Id |
Subject |
Object |
Predicate |
Lexical cue |
T15486 |
0-8 |
NNP |
denotes |
Northern |
T15487 |
9-13 |
NN |
denotes |
blot |
T15488 |
14-22 |
NN |
denotes |
analysis |
T15489 |
22-130 |
sentence |
denotes |
Total RNA was isolated from homogenized embryos using TRIZOL reagent (Invitrogen GmbH, Karlsruhe, Germany). |
T15490 |
23-28 |
JJ |
denotes |
Total |
T15491 |
29-32 |
NN |
denotes |
RNA |
T15493 |
33-36 |
VBD |
denotes |
was |
T15492 |
37-45 |
VBN |
denotes |
isolated |
T15494 |
46-50 |
IN |
denotes |
from |
T15495 |
51-62 |
VBN |
denotes |
homogenized |
T15496 |
63-70 |
NNS |
denotes |
embryos |
T15497 |
71-76 |
VBG |
denotes |
using |
T15498 |
77-83 |
NN |
denotes |
TRIZOL |
T15499 |
84-91 |
NN |
denotes |
reagent |
T15500 |
92-93 |
-LRB- |
denotes |
( |
T15502 |
93-103 |
NNP |
denotes |
Invitrogen |
T15501 |
104-108 |
NNP |
denotes |
GmbH |
T15503 |
108-110 |
, |
denotes |
, |
T15504 |
110-119 |
NNP |
denotes |
Karlsruhe |
T15505 |
119-121 |
, |
denotes |
, |
T15506 |
121-128 |
NNP |
denotes |
Germany |
T15507 |
128-129 |
-RRB- |
denotes |
) |
T15508 |
129-130 |
. |
denotes |
. |
T15509 |
130-526 |
sentence |
denotes |
For northern blots, either total RNA (30 μg) was extracted from embryos, electrophoresed and transferred to a nylon membrane (Hybond N; Amersham) or a polyA+ RNA northern blot (OriGene Technologies Inc., Rockville, USA) was hybridized using as the probe a Ptdsr fragment amplified from wild-type cDNA using forward primer 5'-GTTCCAGCTCGTCAGACTCG-3' and reverse primer 5'-TGCCCCTAAGACATGACCAC-3'. |
T15510 |
131-134 |
IN |
denotes |
For |
T15512 |
135-143 |
NNP |
denotes |
northern |
T15513 |
144-149 |
NNS |
denotes |
blots |
T15514 |
149-151 |
, |
denotes |
, |
T15515 |
151-157 |
CC |
denotes |
either |
T15516 |
158-163 |
JJ |
denotes |
total |
T15517 |
164-167 |
NN |
denotes |
RNA |
T15518 |
168-169 |
-LRB- |
denotes |
( |
T15520 |
169-171 |
CD |
denotes |
30 |
T15519 |
172-174 |
NN |
denotes |
μg |
T15521 |
174-175 |
-RRB- |
denotes |
) |
T15522 |
176-179 |
VBD |
denotes |
was |
T15511 |
180-189 |
VBN |
denotes |
extracted |
T15523 |
190-194 |
IN |
denotes |
from |
T15524 |
195-202 |
NNS |
denotes |
embryos |
T15525 |
202-204 |
, |
denotes |
, |
T15526 |
204-219 |
VBN |
denotes |
electrophoresed |
T15527 |
220-223 |
CC |
denotes |
and |
T15528 |
224-235 |
VBN |
denotes |
transferred |
T15529 |
236-238 |
IN |
denotes |
to |
T15530 |
239-240 |
DT |
denotes |
a |
T15532 |
241-246 |
NN |
denotes |
nylon |
T15531 |
247-255 |
NN |
denotes |
membrane |
T15533 |
256-257 |
-LRB- |
denotes |
( |
T15535 |
257-263 |
NNP |
denotes |
Hybond |
T15534 |
264-265 |
NN |
denotes |
N |
T15536 |
265-266 |
: |
denotes |
; |
T15537 |
267-275 |
NNP |
denotes |
Amersham |
T15538 |
275-276 |
-RRB- |
denotes |
) |
T15539 |
277-279 |
CC |
denotes |
or |
T15540 |
280-281 |
DT |
denotes |
a |
T15542 |
282-288 |
NN |
denotes |
polyA+ |
T15543 |
289-292 |
NN |
denotes |
RNA |
T15544 |
293-301 |
NNP |
denotes |
northern |
T15541 |
302-306 |
NN |
denotes |
blot |
T15546 |
307-308 |
-LRB- |
denotes |
( |
T15548 |
308-315 |
NNP |
denotes |
OriGene |
T15549 |
316-328 |
NNP |
denotes |
Technologies |
T15547 |
329-333 |
NNP |
denotes |
Inc. |
T15550 |
333-335 |
, |
denotes |
, |
T15551 |
335-344 |
NNP |
denotes |
Rockville |
T15552 |
344-346 |
, |
denotes |
, |
T15553 |
346-349 |
NNP |
denotes |
USA |
T15554 |
349-350 |
-RRB- |
denotes |
) |
T15555 |
351-354 |
VBD |
denotes |
was |
T15545 |
355-365 |
VBN |
denotes |
hybridized |
T15556 |
366-371 |
VBG |
denotes |
using |
T15557 |
372-374 |
IN |
denotes |
as |
T15558 |
375-378 |
DT |
denotes |
the |
T15559 |
379-384 |
NN |
denotes |
probe |
T15560 |
385-386 |
DT |
denotes |
a |
T15562 |
387-392 |
NN |
denotes |
Ptdsr |
T15561 |
393-401 |
NN |
denotes |
fragment |
T15563 |
402-411 |
VBN |
denotes |
amplified |
T15564 |
412-416 |
IN |
denotes |
from |
T15565 |
417-421 |
JJ |
denotes |
wild |
T15567 |
421-422 |
HYPH |
denotes |
- |
T15566 |
422-426 |
NN |
denotes |
type |
T15568 |
427-431 |
NN |
denotes |
cDNA |
T15569 |
432-437 |
VBG |
denotes |
using |
T15570 |
438-445 |
JJ |
denotes |
forward |
T15571 |
446-452 |
NN |
denotes |
primer |
T15573 |
453-454 |
CD |
denotes |
5 |
T15574 |
454-455 |
SYM |
denotes |
' |
T15575 |
455-456 |
HYPH |
denotes |
- |
T15572 |
456-476 |
NN |
denotes |
GTTCCAGCTCGTCAGACTCG |
T15576 |
476-477 |
HYPH |
denotes |
- |
T15577 |
477-478 |
CD |
denotes |
3 |
T15578 |
478-479 |
SYM |
denotes |
' |
T15579 |
480-483 |
CC |
denotes |
and |
T15580 |
484-491 |
JJ |
denotes |
reverse |
T15581 |
492-498 |
NN |
denotes |
primer |
T15583 |
499-500 |
CD |
denotes |
5 |
T15584 |
500-501 |
SYM |
denotes |
' |
T15585 |
501-502 |
HYPH |
denotes |
- |
T15582 |
502-522 |
NN |
denotes |
TGCCCCTAAGACATGACCAC |
T15586 |
522-523 |
HYPH |
denotes |
- |
T15587 |
523-524 |
CD |
denotes |
3 |
T15588 |
524-525 |
SYM |
denotes |
' |
T15589 |
525-526 |
. |
denotes |
. |
T15590 |
526-677 |
sentence |
denotes |
In all experiments the same membrane was re-hybridized with a β-actin probe (OriGene) to confirm that equivalent RNA levels were present in each lane. |
T15591 |
527-529 |
IN |
denotes |
In |
T15593 |
530-533 |
DT |
denotes |
all |
T15594 |
534-545 |
NNS |
denotes |
experiments |
T15595 |
546-549 |
DT |
denotes |
the |
T15597 |
550-554 |
JJ |
denotes |
same |
T15596 |
555-563 |
NN |
denotes |
membrane |
T15598 |
564-567 |
VBD |
denotes |
was |
T15592 |
568-581 |
VBN |
denotes |
re-hybridized |
T15599 |
582-586 |
IN |
denotes |
with |
T15600 |
587-588 |
DT |
denotes |
a |
T15602 |
589-590 |
NN |
denotes |
β |
T15604 |
590-591 |
HYPH |
denotes |
- |
T15603 |
591-596 |
NN |
denotes |
actin |
T15601 |
597-602 |
NN |
denotes |
probe |
T15605 |
603-604 |
-LRB- |
denotes |
( |
T15606 |
604-611 |
NNP |
denotes |
OriGene |
T15607 |
611-612 |
-RRB- |
denotes |
) |
T15608 |
613-615 |
TO |
denotes |
to |
T15609 |
616-623 |
VB |
denotes |
confirm |
T15610 |
624-628 |
IN |
denotes |
that |
T15612 |
629-639 |
JJ |
denotes |
equivalent |
T15614 |
640-643 |
NN |
denotes |
RNA |
T15613 |
644-650 |
NNS |
denotes |
levels |
T15611 |
651-655 |
VBD |
denotes |
were |
T15615 |
656-663 |
JJ |
denotes |
present |
T15616 |
664-666 |
IN |
denotes |
in |
T15617 |
667-671 |
DT |
denotes |
each |
T15618 |
672-676 |
NN |
denotes |
lane |
T15619 |
676-677 |
. |
denotes |
. |
T15620 |
677-841 |
sentence |
denotes |
Northern blotting indicated that homozygous mutant embryos did not express Ptdsr mRNA and heterozygous mutant embryos expressed only reduced amounts of Ptdsr mRNA. |
T15621 |
678-686 |
NNP |
denotes |
Northern |
T15622 |
687-695 |
NN |
denotes |
blotting |
T15623 |
696-705 |
VBD |
denotes |
indicated |
T15624 |
706-710 |
IN |
denotes |
that |
T15626 |
711-721 |
JJ |
denotes |
homozygous |
T15628 |
722-728 |
JJ |
denotes |
mutant |
T15627 |
729-736 |
NNS |
denotes |
embryos |
T15629 |
737-740 |
VBD |
denotes |
did |
T15630 |
741-744 |
RB |
denotes |
not |
T15625 |
745-752 |
VB |
denotes |
express |
T15631 |
753-758 |
NN |
denotes |
Ptdsr |
T15632 |
759-763 |
NN |
denotes |
mRNA |
T15633 |
764-767 |
CC |
denotes |
and |
T15634 |
768-780 |
JJ |
denotes |
heterozygous |
T15636 |
781-787 |
NN |
denotes |
mutant |
T15635 |
788-795 |
NNS |
denotes |
embryos |
T15637 |
796-805 |
VBN |
denotes |
expressed |
T15638 |
806-810 |
RB |
denotes |
only |
T15640 |
811-818 |
VBN |
denotes |
reduced |
T15639 |
819-826 |
NNS |
denotes |
amounts |
T15641 |
827-829 |
IN |
denotes |
of |
T15642 |
830-835 |
NN |
denotes |
Ptdsr |
T15643 |
836-840 |
NN |
denotes |
mRNA |
T15644 |
840-841 |
. |
denotes |
. |
R9382 |
T15486 |
T15487 |
compound |
Northern,blot |
R9383 |
T15487 |
T15488 |
compound |
blot,analysis |
R9384 |
T15490 |
T15491 |
amod |
Total,RNA |
R9385 |
T15491 |
T15492 |
nsubjpass |
RNA,isolated |
R9386 |
T15493 |
T15492 |
auxpass |
was,isolated |
R9387 |
T15494 |
T15492 |
prep |
from,isolated |
R9388 |
T15495 |
T15496 |
amod |
homogenized,embryos |
R9389 |
T15496 |
T15494 |
pobj |
embryos,from |
R9390 |
T15497 |
T15492 |
advcl |
using,isolated |
R9391 |
T15498 |
T15499 |
compound |
TRIZOL,reagent |
R9392 |
T15499 |
T15497 |
dobj |
reagent,using |
R9393 |
T15500 |
T15501 |
punct |
(,GmbH |
R9394 |
T15501 |
T15499 |
parataxis |
GmbH,reagent |
R9395 |
T15502 |
T15501 |
compound |
Invitrogen,GmbH |
R9396 |
T15503 |
T15501 |
punct |
", ",GmbH |
R9397 |
T15504 |
T15501 |
npadvmod |
Karlsruhe,GmbH |
R9398 |
T15505 |
T15501 |
punct |
", ",GmbH |
R9399 |
T15506 |
T15501 |
npadvmod |
Germany,GmbH |
R9400 |
T15507 |
T15501 |
punct |
),GmbH |
R9401 |
T15508 |
T15492 |
punct |
.,isolated |
R9402 |
T15510 |
T15511 |
prep |
For,extracted |
R9403 |
T15512 |
T15513 |
compound |
northern,blots |
R9404 |
T15513 |
T15510 |
pobj |
blots,For |
R9405 |
T15514 |
T15511 |
punct |
", ",extracted |
R9406 |
T15515 |
T15511 |
preconj |
either,extracted |
R9407 |
T15516 |
T15517 |
amod |
total,RNA |
R9408 |
T15517 |
T15511 |
nsubjpass |
RNA,extracted |
R9409 |
T15518 |
T15519 |
punct |
(,μg |
R9410 |
T15519 |
T15517 |
parataxis |
μg,RNA |
R9411 |
T15520 |
T15519 |
nummod |
30,μg |
R9412 |
T15521 |
T15519 |
punct |
),μg |
R9413 |
T15522 |
T15511 |
auxpass |
was,extracted |
R9414 |
T15523 |
T15511 |
prep |
from,extracted |
R9415 |
T15524 |
T15523 |
pobj |
embryos,from |
R9416 |
T15525 |
T15511 |
punct |
", ",extracted |
R9417 |
T15526 |
T15511 |
conj |
electrophoresed,extracted |
R9418 |
T15527 |
T15526 |
cc |
and,electrophoresed |
R9419 |
T15528 |
T15526 |
conj |
transferred,electrophoresed |
R9420 |
T15529 |
T15528 |
prep |
to,transferred |
R9421 |
T15530 |
T15531 |
det |
a,membrane |
R9422 |
T15531 |
T15529 |
pobj |
membrane,to |
R9423 |
T15532 |
T15531 |
compound |
nylon,membrane |
R9424 |
T15533 |
T15534 |
punct |
(,N |
R9425 |
T15534 |
T15531 |
parataxis |
N,membrane |
R9426 |
T15535 |
T15534 |
compound |
Hybond,N |
R9427 |
T15536 |
T15534 |
punct |
;,N |
R9428 |
T15537 |
T15534 |
npadvmod |
Amersham,N |
R9429 |
T15538 |
T15534 |
punct |
),N |
R9430 |
T15539 |
T15511 |
cc |
or,extracted |
R9431 |
T15540 |
T15541 |
det |
a,blot |
R9432 |
T15541 |
T15545 |
nsubjpass |
blot,hybridized |
R9433 |
T15542 |
T15541 |
compound |
polyA+,blot |
R9434 |
T15543 |
T15541 |
compound |
RNA,blot |
R9435 |
T15544 |
T15541 |
compound |
northern,blot |
R9436 |
T15545 |
T15511 |
conj |
hybridized,extracted |
R9437 |
T15546 |
T15547 |
punct |
(,Inc. |
R9438 |
T15547 |
T15541 |
parataxis |
Inc.,blot |
R9439 |
T15548 |
T15547 |
compound |
OriGene,Inc. |
R9440 |
T15549 |
T15547 |
compound |
Technologies,Inc. |
R9441 |
T15550 |
T15547 |
punct |
", ",Inc. |
R9442 |
T15551 |
T15547 |
npadvmod |
Rockville,Inc. |
R9443 |
T15552 |
T15547 |
punct |
", ",Inc. |
R9444 |
T15553 |
T15547 |
npadvmod |
USA,Inc. |
R9445 |
T15554 |
T15547 |
punct |
),Inc. |
R9446 |
T15555 |
T15545 |
auxpass |
was,hybridized |
R9447 |
T15556 |
T15545 |
advcl |
using,hybridized |
R9448 |
T15557 |
T15556 |
prep |
as,using |
R9449 |
T15558 |
T15559 |
det |
the,probe |
R9450 |
T15559 |
T15557 |
pobj |
probe,as |
R9451 |
T15560 |
T15561 |
det |
a,fragment |
R9452 |
T15561 |
T15556 |
dobj |
fragment,using |
R9453 |
T15562 |
T15561 |
compound |
Ptdsr,fragment |
R9454 |
T15563 |
T15561 |
acl |
amplified,fragment |
R9455 |
T15564 |
T15563 |
prep |
from,amplified |
R9456 |
T15565 |
T15566 |
amod |
wild,type |
R9457 |
T15566 |
T15568 |
compound |
type,cDNA |
R9458 |
T15567 |
T15566 |
punct |
-,type |
R9459 |
T15568 |
T15564 |
pobj |
cDNA,from |
R9460 |
T15569 |
T15563 |
advcl |
using,amplified |
R9461 |
T15570 |
T15571 |
amod |
forward,primer |
R9462 |
T15571 |
T15572 |
nmod |
primer,GTTCCAGCTCGTCAGACTCG |
R9463 |
T15572 |
T15569 |
dobj |
GTTCCAGCTCGTCAGACTCG,using |
R9464 |
T15573 |
T15572 |
nummod |
5,GTTCCAGCTCGTCAGACTCG |
R9465 |
T15574 |
T15573 |
punct |
',5 |
R9466 |
T15575 |
T15572 |
punct |
-,GTTCCAGCTCGTCAGACTCG |
R9467 |
T15576 |
T15572 |
punct |
-,GTTCCAGCTCGTCAGACTCG |
R9468 |
T15577 |
T15572 |
nummod |
3,GTTCCAGCTCGTCAGACTCG |
R9469 |
T15578 |
T15572 |
punct |
',GTTCCAGCTCGTCAGACTCG |
R9470 |
T15579 |
T15572 |
cc |
and,GTTCCAGCTCGTCAGACTCG |
R9471 |
T15580 |
T15581 |
amod |
reverse,primer |
R9472 |
T15581 |
T15582 |
nmod |
primer,TGCCCCTAAGACATGACCAC |
R9473 |
T15582 |
T15572 |
conj |
TGCCCCTAAGACATGACCAC,GTTCCAGCTCGTCAGACTCG |
R9474 |
T15583 |
T15582 |
nummod |
5,TGCCCCTAAGACATGACCAC |
R9475 |
T15584 |
T15583 |
punct |
',5 |
R9476 |
T15585 |
T15582 |
punct |
-,TGCCCCTAAGACATGACCAC |
R9477 |
T15586 |
T15582 |
punct |
-,TGCCCCTAAGACATGACCAC |
R9478 |
T15587 |
T15582 |
nummod |
3,TGCCCCTAAGACATGACCAC |
R9479 |
T15588 |
T15582 |
punct |
',TGCCCCTAAGACATGACCAC |
R9480 |
T15589 |
T15545 |
punct |
.,hybridized |
R9481 |
T15591 |
T15592 |
prep |
In,re-hybridized |
R9482 |
T15593 |
T15594 |
det |
all,experiments |
R9483 |
T15594 |
T15591 |
pobj |
experiments,In |
R9484 |
T15595 |
T15596 |
det |
the,membrane |
R9485 |
T15596 |
T15592 |
nsubjpass |
membrane,re-hybridized |
R9486 |
T15597 |
T15596 |
amod |
same,membrane |
R9487 |
T15598 |
T15592 |
auxpass |
was,re-hybridized |
R9488 |
T15599 |
T15592 |
prep |
with,re-hybridized |
R9489 |
T15600 |
T15601 |
det |
a,probe |
R9490 |
T15601 |
T15599 |
pobj |
probe,with |
R9491 |
T15602 |
T15603 |
compound |
β,actin |
R9492 |
T15603 |
T15601 |
compound |
actin,probe |
R9493 |
T15604 |
T15603 |
punct |
-,actin |
R9494 |
T15605 |
T15606 |
punct |
(,OriGene |
R9495 |
T15606 |
T15601 |
parataxis |
OriGene,probe |
R9496 |
T15607 |
T15606 |
punct |
),OriGene |
R9497 |
T15608 |
T15609 |
aux |
to,confirm |
R9498 |
T15609 |
T15592 |
advcl |
confirm,re-hybridized |
R9499 |
T15610 |
T15611 |
mark |
that,were |
R9500 |
T15611 |
T15609 |
ccomp |
were,confirm |
R9501 |
T15612 |
T15613 |
amod |
equivalent,levels |
R9502 |
T15613 |
T15611 |
nsubj |
levels,were |
R9503 |
T15614 |
T15613 |
compound |
RNA,levels |
R9504 |
T15615 |
T15611 |
acomp |
present,were |
R9505 |
T15616 |
T15611 |
prep |
in,were |
R9506 |
T15617 |
T15618 |
det |
each,lane |
R9507 |
T15618 |
T15616 |
pobj |
lane,in |
R9508 |
T15619 |
T15592 |
punct |
.,re-hybridized |
R9509 |
T15621 |
T15622 |
compound |
Northern,blotting |
R9510 |
T15622 |
T15623 |
nsubj |
blotting,indicated |
R9511 |
T15624 |
T15625 |
mark |
that,express |
R9512 |
T15625 |
T15623 |
ccomp |
express,indicated |
R9513 |
T15626 |
T15627 |
amod |
homozygous,embryos |
R9514 |
T15627 |
T15625 |
nsubj |
embryos,express |
R9515 |
T15628 |
T15627 |
amod |
mutant,embryos |
R9516 |
T15629 |
T15625 |
aux |
did,express |
R9517 |
T15630 |
T15625 |
neg |
not,express |
R9518 |
T15631 |
T15632 |
compound |
Ptdsr,mRNA |
R9519 |
T15632 |
T15625 |
dobj |
mRNA,express |
R9520 |
T15633 |
T15625 |
cc |
and,express |
R9521 |
T15634 |
T15635 |
amod |
heterozygous,embryos |
R9522 |
T15635 |
T15637 |
nsubj |
embryos,expressed |
R9523 |
T15636 |
T15635 |
compound |
mutant,embryos |
R9524 |
T15637 |
T15625 |
conj |
expressed,express |
R9525 |
T15638 |
T15639 |
advmod |
only,amounts |
R9526 |
T15639 |
T15637 |
dobj |
amounts,expressed |
R9527 |
T15640 |
T15639 |
amod |
reduced,amounts |
R9528 |
T15641 |
T15639 |
prep |
of,amounts |
R9529 |
T15642 |
T15643 |
compound |
Ptdsr,mRNA |
R9530 |
T15643 |
T15641 |
pobj |
mRNA,of |
R9531 |
T15644 |
T15623 |
punct |
.,indicated |