craft-sa-dev Home  

PMC:314463 / 55077-63145 JSONTXT 5 Projects

Annnotations TAB TSV DIC JSON TextAE

Id Subject Object Predicate Lexical cue
T11800 27-637 sentence denotes All mice were obtained originally from The Jackson Laboratory (Bar Harbor, Maine, United States), except the BA strain (Stanford Veterinary Services Center, Stanford, California, United States), Hoxb6-Cre transgenic mice (kindly provided by M. Kuehn of the National Institutes of Health, Bethesda, Maryland, United States), mice carrying the R26R lacZ reporter allele (kindly provided by P. Soriano, Fred Hutchinson Cancer Research Center, Seattle, Washington, United States), and C57BL/6J (B6) ae/ae mice (kindly provided by L. Siracusa, Jefferson Medical College, Philadelphia, Pennsylvania, United States).
T11801 28-31 DT denotes All
T11802 32-36 NNS denotes mice
T11804 37-41 VBD denotes were
T11803 42-50 VBN denotes obtained
T11805 51-61 RB denotes originally
T11806 62-66 IN denotes from
T11807 67-70 DT denotes The
T11809 71-78 NNP denotes Jackson
T11808 79-89 NNP denotes Laboratory
T11810 90-91 -LRB- denotes (
T11812 91-94 NNP denotes Bar
T11811 95-101 NNP denotes Harbor
T11813 101-103 , denotes ,
T11814 103-108 NNP denotes Maine
T11815 108-110 , denotes ,
T11816 110-116 NNP denotes United
T11817 117-123 NNP denotes States
T11818 123-124 -RRB- denotes )
T11819 124-126 , denotes ,
T11820 126-132 IN denotes except
T11821 133-136 DT denotes the
T11823 137-139 NN denotes BA
T11822 140-146 NN denotes strain
T11824 147-148 -LRB- denotes (
T11826 148-156 NNP denotes Stanford
T11827 157-167 NNP denotes Veterinary
T11828 168-176 NNPS denotes Services
T11825 177-183 NNP denotes Center
T11829 183-185 , denotes ,
T11830 185-193 NNP denotes Stanford
T11831 193-195 , denotes ,
T11832 195-205 NNP denotes California
T11833 205-207 , denotes ,
T11834 207-213 NNP denotes United
T11835 214-220 NNP denotes States
T11836 220-221 -RRB- denotes )
T11837 221-223 , denotes ,
T11838 223-228 NN denotes Hoxb6
T11840 228-229 HYPH denotes -
T11839 229-232 NN denotes Cre
T11842 233-243 JJ denotes transgenic
T11841 244-248 NNS denotes mice
T11843 249-250 -LRB- denotes (
T11844 250-256 RB denotes kindly
T11845 257-265 VBN denotes provided
T11846 266-268 IN denotes by
T11847 269-271 NNP denotes M.
T11848 272-277 NNP denotes Kuehn
T11849 278-280 IN denotes of
T11850 281-284 DT denotes the
T11852 285-293 NNP denotes National
T11851 294-304 NNPS denotes Institutes
T11853 305-307 IN denotes of
T11854 308-314 NNP denotes Health
T11855 314-316 , denotes ,
T11856 316-324 NNP denotes Bethesda
T11857 324-326 , denotes ,
T11858 326-334 NNP denotes Maryland
T11859 334-336 , denotes ,
T11860 336-342 NNP denotes United
T11861 343-349 NNP denotes States
T11862 349-350 -RRB- denotes )
T11863 350-352 , denotes ,
T11864 352-356 NNS denotes mice
T11865 357-365 VBG denotes carrying
T11866 366-369 DT denotes the
T11868 370-374 NN denotes R26R
T11870 375-379 NN denotes lacZ
T11869 380-388 NN denotes reporter
T11867 389-395 NN denotes allele
T11871 396-397 -LRB- denotes (
T11872 397-403 RB denotes kindly
T11873 404-412 VBN denotes provided
T11874 413-415 IN denotes by
T11875 416-418 NNP denotes P.
T11876 419-426 NNP denotes Soriano
T11877 426-428 , denotes ,
T11878 428-432 NNP denotes Fred
T11880 433-443 NNP denotes Hutchinson
T11881 444-450 NNP denotes Cancer
T11882 451-459 NNP denotes Research
T11879 460-466 NNP denotes Center
T11883 466-468 , denotes ,
T11884 468-475 NNP denotes Seattle
T11885 475-477 , denotes ,
T11886 477-487 NNP denotes Washington
T11887 487-489 , denotes ,
T11888 489-495 NNP denotes United
T11889 496-502 NNP denotes States
T11890 502-503 -RRB- denotes )
T11891 503-505 , denotes ,
T11892 505-508 CC denotes and
T11893 509-514 NN denotes C57BL
T11895 514-515 HYPH denotes /
T11894 515-517 NN denotes 6J
T11897 518-519 -LRB- denotes (
T11898 519-521 NN denotes B6
T11899 521-522 -RRB- denotes )
T11900 523-525 NN denotes ae
T11902 525-526 HYPH denotes /
T11901 526-528 NN denotes ae
T11896 529-533 NNS denotes mice
T11903 534-535 -LRB- denotes (
T11904 535-541 RB denotes kindly
T11905 542-550 VBN denotes provided
T11906 551-553 IN denotes by
T11907 554-556 NNP denotes L.
T11908 557-565 NNP denotes Siracusa
T11909 565-567 , denotes ,
T11910 567-576 NNP denotes Jefferson
T11912 577-584 NNP denotes Medical
T11911 585-592 NNP denotes College
T11913 592-594 , denotes ,
T11914 594-606 NNP denotes Philadelphia
T11915 606-608 , denotes ,
T11916 608-620 NNP denotes Pennsylvania
T11917 620-622 , denotes ,
T11918 622-628 NNP denotes United
T11919 629-635 NNP denotes States
T11920 635-636 -RRB- denotes )
T11921 636-637 . denotes .
T11922 637-760 sentence denotes The deH mutation arose in the 1960s in Harwell, probably on the BN strain background (C. Beechey, personal communication).
T11923 638-641 DT denotes The
T11925 642-645 NN denotes deH
T11924 646-654 NN denotes mutation
T11926 655-660 VBD denotes arose
T11927 661-663 IN denotes in
T11928 664-667 DT denotes the
T11929 668-673 NNS denotes 1960s
T11930 674-676 IN denotes in
T11931 677-684 NNP denotes Harwell
T11932 684-686 , denotes ,
T11933 686-694 RB denotes probably
T11934 695-697 IN denotes on
T11935 698-701 DT denotes the
T11937 702-704 NN denotes BN
T11938 705-711 NN denotes strain
T11936 712-722 NN denotes background
T11939 723-724 -LRB- denotes (
T11940 724-726 NNP denotes C.
T11941 727-734 NNP denotes Beechey
T11942 734-736 , denotes ,
T11943 736-744 JJ denotes personal
T11944 745-758 NN denotes communication
T11945 758-759 -RRB- denotes )
T11946 759-760 . denotes .
T11947 760-961 sentence denotes We obtained deH on a B6/EiC3H background, introduced the at allele from the BTBR strain, and have maintained the line as a mixed deH/+ × deH/+ intercross stock with periodic outcrossing to BTBR or B6.
T11948 761-763 PRP denotes We
T11949 764-772 VBD denotes obtained
T11950 773-776 NN denotes deH
T11951 777-779 IN denotes on
T11952 780-781 DT denotes a
T11954 782-784 NN denotes B6
T11956 784-785 HYPH denotes /
T11955 785-790 NN denotes EiC3H
T11953 791-801 NN denotes background
T11957 801-803 , denotes ,
T11958 803-813 VBD denotes introduced
T11959 814-817 DT denotes the
T11961 818-820 NN denotes at
T11960 821-827 NN denotes allele
T11962 828-832 IN denotes from
T11963 833-836 DT denotes the
T11965 837-841 NN denotes BTBR
T11964 842-848 NN denotes strain
T11966 848-850 , denotes ,
T11967 850-853 CC denotes and
T11968 854-858 VBP denotes have
T11969 859-869 VBN denotes maintained
T11970 870-873 DT denotes the
T11971 874-878 NN denotes line
T11972 879-881 IN denotes as
T11973 882-883 DT denotes a
T11975 884-889 VBN denotes mixed
T11976 890-893 NN denotes deH
T11977 893-894 HYPH denotes /
T11978 894-895 SYM denotes +
T11979 896-897 SYM denotes ×
T11980 898-901 NN denotes deH
T11981 901-902 HYPH denotes /
T11982 902-903 SYM denotes +
T11983 904-914 JJ denotes intercross
T11974 915-920 NN denotes stock
T11984 921-925 IN denotes with
T11985 926-934 JJ denotes periodic
T11986 935-946 NN denotes outcrossing
T11987 947-949 IN denotes to
T11988 950-954 NN denotes BTBR
T11989 955-957 CC denotes or
T11990 958-960 NN denotes B6
T11991 960-961 . denotes .
T11992 961-1025 sentence denotes For timed matings, the morning of the plug was considered E0.5.
T11993 962-965 IN denotes For
T11995 966-971 VBN denotes timed
T11996 972-979 NNS denotes matings
T11997 979-981 , denotes ,
T11998 981-984 DT denotes the
T11999 985-992 NN denotes morning
T12000 993-995 IN denotes of
T12001 996-999 DT denotes the
T12002 1000-1004 NN denotes plug
T12003 1005-1008 VBD denotes was
T11994 1009-1019 VBN denotes considered
T12004 1020-1024 NN denotes E0.5
T12005 1024-1025 . denotes .
T12006 1025-1082 sentence denotes Postnatally, the day of birth was considered to be P0.5.
T12007 1026-1037 RB denotes Postnatally
T12009 1037-1039 , denotes ,
T12010 1039-1042 DT denotes the
T12011 1043-1046 NN denotes day
T12012 1047-1049 IN denotes of
T12013 1050-1055 NN denotes birth
T12014 1056-1059 VBD denotes was
T12008 1060-1070 VBN denotes considered
T12015 1071-1073 TO denotes to
T12016 1074-1076 VB denotes be
T12017 1077-1081 NN denotes P0.5
T12018 1081-1082 . denotes .
T12097 1084-1094 JJ denotes Phenotypic
T12098 1095-1103 NN denotes analysis
T12099 1103-1295 sentence denotes For measurements of hair length and color, the entire interlimb region of skin was first dissected with a single incision at the dorsal midline and preserved with powdered sodium bicarbonate.
T12100 1104-1107 IN denotes For
T12102 1108-1120 NNS denotes measurements
T12103 1121-1123 IN denotes of
T12104 1124-1128 NN denotes hair
T12105 1129-1135 NN denotes length
T12106 1136-1139 CC denotes and
T12107 1140-1145 NN denotes color
T12108 1145-1147 , denotes ,
T12109 1147-1150 DT denotes the
T12111 1151-1157 JJ denotes entire
T12112 1158-1167 NN denotes interlimb
T12110 1168-1174 NN denotes region
T12113 1175-1177 IN denotes of
T12114 1178-1182 NN denotes skin
T12115 1183-1186 VBD denotes was
T12116 1187-1192 RB denotes first
T12101 1193-1202 VBN denotes dissected
T12117 1203-1207 IN denotes with
T12118 1208-1209 DT denotes a
T12120 1210-1216 JJ denotes single
T12119 1217-1225 NN denotes incision
T12121 1226-1228 IN denotes at
T12122 1229-1232 DT denotes the
T12124 1233-1239 JJ denotes dorsal
T12123 1240-1247 NN denotes midline
T12125 1248-1251 CC denotes and
T12126 1252-1261 VBN denotes preserved
T12127 1262-1266 IN denotes with
T12128 1267-1275 VBN denotes powdered
T12130 1276-1282 NN denotes sodium
T12129 1283-1294 NN denotes bicarbonate
T12131 1294-1295 . denotes .
T12132 1295-1563 sentence denotes Slices 2–2.5 mm in width were then prepared parallel to the dorsoventral axis, hair length boundaries determined from electronic images with Adobe Photoshop (San Jose, California, United States), and measurements obtained using ImageJ (National Institutes of Health).
T12133 1296-1302 NNS denotes Slices
T12135 1303-1304 CD denotes 2
T12137 1304-1305 HYPH denotes –
T12136 1305-1308 CD denotes 2.5
T12138 1309-1311 NN denotes mm
T12139 1312-1314 IN denotes in
T12140 1315-1320 NN denotes width
T12141 1321-1325 VBD denotes were
T12142 1326-1330 RB denotes then
T12134 1331-1339 VBN denotes prepared
T12143 1340-1348 RB denotes parallel
T12144 1349-1351 IN denotes to
T12145 1352-1355 DT denotes the
T12147 1356-1368 JJ denotes dorsoventral
T12146 1369-1373 NN denotes axis
T12148 1373-1375 , denotes ,
T12149 1375-1379 NN denotes hair
T12151 1380-1386 NN denotes length
T12150 1387-1397 NNS denotes boundaries
T12152 1398-1408 VBN denotes determined
T12153 1409-1413 IN denotes from
T12154 1414-1424 JJ denotes electronic
T12155 1425-1431 NNS denotes images
T12156 1432-1436 IN denotes with
T12157 1437-1442 NNP denotes Adobe
T12158 1443-1452 NNP denotes Photoshop
T12159 1453-1454 -LRB- denotes (
T12161 1454-1457 NNP denotes San
T12160 1458-1462 NNP denotes Jose
T12162 1462-1464 , denotes ,
T12163 1464-1474 NNP denotes California
T12164 1474-1476 , denotes ,
T12165 1476-1482 NNP denotes United
T12166 1483-1489 NNP denotes States
T12167 1489-1490 -RRB- denotes )
T12168 1490-1492 , denotes ,
T12169 1492-1495 CC denotes and
T12170 1496-1508 NNS denotes measurements
T12171 1509-1517 VBN denotes obtained
T12172 1518-1523 VBG denotes using
T12173 1524-1530 NNP denotes ImageJ
T12174 1531-1532 -LRB- denotes (
T12176 1532-1540 NNP denotes National
T12175 1541-1551 NNPS denotes Institutes
T12177 1552-1554 IN denotes of
T12178 1555-1561 NNP denotes Health
T12179 1561-1562 -RRB- denotes )
T12180 1562-1563 . denotes .
T12181 1563-1698 sentence denotes This approach samples awls and auchenes, because they are much thicker and therefore visually more predominant than zigzag underhairs.
T12182 1564-1568 DT denotes This
T12183 1569-1577 NN denotes approach
T12184 1578-1585 VBZ denotes samples
T12185 1586-1590 NNS denotes awls
T12186 1591-1594 CC denotes and
T12187 1595-1603 NNS denotes auchenes
T12188 1603-1605 , denotes ,
T12189 1605-1612 IN denotes because
T12191 1613-1617 PRP denotes they
T12190 1618-1621 VBP denotes are
T12192 1622-1626 RB denotes much
T12193 1627-1634 JJR denotes thicker
T12194 1635-1638 CC denotes and
T12195 1639-1648 RB denotes therefore
T12197 1649-1657 RB denotes visually
T12198 1658-1662 RBR denotes more
T12196 1663-1674 JJ denotes predominant
T12199 1675-1679 IN denotes than
T12200 1680-1686 NN denotes zigzag
T12201 1687-1697 NNS denotes underhairs
T12202 1697-1698 . denotes .
T12203 1698-1921 sentence denotes To assess dorsoventral variation in hair-type distribution, several hundred hairs were plucked from the middorsum or midventrum of 8-wk-old male BA strain animals, then sorted and categorized using a dissection microscope.
T12204 1699-1701 TO denotes To
T12205 1702-1708 VB denotes assess
T12207 1709-1721 JJ denotes dorsoventral
T12208 1722-1731 NN denotes variation
T12209 1732-1734 IN denotes in
T12210 1735-1739 NN denotes hair
T12212 1739-1740 HYPH denotes -
T12211 1740-1744 NN denotes type
T12213 1745-1757 NN denotes distribution
T12214 1757-1759 , denotes ,
T12215 1759-1766 JJ denotes several
T12217 1767-1774 CD denotes hundred
T12216 1775-1780 NNS denotes hairs
T12218 1781-1785 VBD denotes were
T12206 1786-1793 VBN denotes plucked
T12219 1794-1798 IN denotes from
T12220 1799-1802 DT denotes the
T12221 1803-1812 NN denotes middorsum
T12222 1813-1815 CC denotes or
T12223 1816-1826 NN denotes midventrum
T12224 1827-1829 IN denotes of
T12225 1830-1831 CD denotes 8
T12227 1831-1832 HYPH denotes -
T12226 1832-1834 NN denotes wk
T12229 1834-1835 HYPH denotes -
T12228 1835-1838 JJ denotes old
T12231 1839-1843 JJ denotes male
T12232 1844-1846 NN denotes BA
T12233 1847-1853 NN denotes strain
T12230 1854-1861 NNS denotes animals
T12234 1861-1863 , denotes ,
T12235 1863-1867 RB denotes then
T12236 1868-1874 VBN denotes sorted
T12237 1875-1878 CC denotes and
T12238 1879-1890 VBN denotes categorized
T12239 1891-1896 VBG denotes using
T12240 1897-1898 DT denotes a
T12242 1899-1909 NN denotes dissection
T12241 1910-1920 NN denotes microscope
T12243 1920-1921 . denotes .
T12244 1921-1983 sentence denotes No attempt was made to distinguish between awls and auchenes.
T12245 1922-1924 DT denotes No
T12246 1925-1932 NN denotes attempt
T12248 1933-1936 VBD denotes was
T12247 1937-1941 VBN denotes made
T12249 1942-1944 TO denotes to
T12250 1945-1956 VB denotes distinguish
T12251 1957-1964 IN denotes between
T12252 1965-1969 NNS denotes awls
T12253 1970-1973 CC denotes and
T12254 1974-1982 NNS denotes auchenes
T12255 1982-1983 . denotes .
T12256 1983-2089 sentence denotes For skin histology, 12 μm sections from paraffin-embedded tissue were stained with hematoxylin and eosin.
T12257 1984-1987 IN denotes For
T12259 1988-1992 NN denotes skin
T12260 1993-2002 NN denotes histology
T12261 2002-2004 , denotes ,
T12262 2004-2006 CD denotes 12
T12263 2007-2009 NN denotes μm
T12264 2010-2018 NNS denotes sections
T12265 2019-2023 IN denotes from
T12266 2024-2032 NN denotes paraffin
T12268 2032-2033 HYPH denotes -
T12267 2033-2041 VBN denotes embedded
T12269 2042-2048 NN denotes tissue
T12270 2049-2053 VBD denotes were
T12258 2054-2061 VBN denotes stained
T12271 2062-2066 IN denotes with
T12272 2067-2078 NN denotes hematoxylin
T12273 2079-2082 CC denotes and
T12274 2083-2088 NN denotes eosin
T12275 2088-2089 . denotes .
T12276 2089-2495 sentence denotes For DOPA staining, the dermis and epidermis were split after 3 h of incubation in 2 M sodium bromide at 37°C (this preparation causes most hair follicles to remain with the dermis), individually fixed for 1 h, then rinsed and stained with 0.1% L-DOPA (Sigma, St. Louis, Missouri, United States), 0.1 M sodium phosphate buffer (pH 6.8) for 5 h at 37°C in the dark, changing the staining solution after 1 h.
T12277 2090-2093 IN denotes For
T12279 2094-2098 NN denotes DOPA
T12280 2099-2107 NN denotes staining
T12281 2107-2109 , denotes ,
T12282 2109-2112 DT denotes the
T12283 2113-2119 NN denotes dermis
T12284 2120-2123 CC denotes and
T12285 2124-2133 NN denotes epidermis
T12286 2134-2138 VBD denotes were
T12278 2139-2144 VBN denotes split
T12287 2145-2150 IN denotes after
T12288 2151-2152 CD denotes 3
T12289 2153-2154 NN denotes h
T12290 2155-2157 IN denotes of
T12291 2158-2168 NN denotes incubation
T12292 2169-2171 IN denotes in
T12293 2172-2173 CD denotes 2
T12294 2174-2175 NN denotes M
T12296 2176-2182 NN denotes sodium
T12295 2183-2190 NN denotes bromide
T12297 2191-2193 IN denotes at
T12298 2194-2196 CD denotes 37
T12299 2196-2198 NN denotes °C
T12300 2199-2200 -LRB- denotes (
T12302 2200-2204 DT denotes this
T12303 2205-2216 NN denotes preparation
T12301 2217-2223 VBZ denotes causes
T12304 2224-2228 JJS denotes most
T12306 2229-2233 NN denotes hair
T12305 2234-2243 NNS denotes follicles
T12308 2244-2246 TO denotes to
T12307 2247-2253 VB denotes remain
T12309 2254-2258 IN denotes with
T12310 2259-2262 DT denotes the
T12311 2263-2269 NN denotes dermis
T12312 2269-2270 -RRB- denotes )
T12313 2270-2272 , denotes ,
T12314 2272-2284 RB denotes individually
T12315 2285-2290 VBN denotes fixed
T12316 2291-2294 IN denotes for
T12317 2295-2296 CD denotes 1
T12318 2297-2298 NN denotes h
T12319 2298-2300 , denotes ,
T12320 2300-2304 RB denotes then
T12321 2305-2311 VBD denotes rinsed
T12322 2312-2315 CC denotes and
T12323 2316-2323 VBD denotes stained
T12324 2324-2328 IN denotes with
T12325 2329-2332 CD denotes 0.1
T12326 2332-2333 NN denotes %
T12328 2334-2335 NN denotes L
T12329 2335-2336 HYPH denotes -
T12327 2336-2340 NN denotes DOPA
T12331 2341-2342 -LRB- denotes (
T12332 2342-2347 NNP denotes Sigma
T12333 2347-2349 , denotes ,
T12334 2349-2352 NNP denotes St.
T12335 2353-2358 NNP denotes Louis
T12336 2358-2360 , denotes ,
T12337 2360-2368 NNP denotes Missouri
T12338 2368-2370 , denotes ,
T12339 2370-2376 NNP denotes United
T12340 2377-2383 NNP denotes States
T12341 2383-2384 -RRB- denotes )
T12342 2384-2386 , denotes ,
T12343 2386-2389 CD denotes 0.1
T12344 2390-2391 NN denotes M
T12346 2392-2398 NN denotes sodium
T12345 2399-2408 NN denotes phosphate
T12330 2409-2415 NN denotes buffer
T12347 2416-2417 -LRB- denotes (
T12348 2417-2419 NN denotes pH
T12349 2420-2423 CD denotes 6.8
T12350 2423-2424 -RRB- denotes )
T12351 2425-2428 IN denotes for
T12352 2429-2430 CD denotes 5
T12353 2431-2432 NN denotes h
T12354 2433-2435 IN denotes at
T12355 2436-2438 CD denotes 37
T12356 2438-2440 NN denotes °C
T12357 2441-2443 IN denotes in
T12358 2444-2447 DT denotes the
T12359 2448-2452 NN denotes dark
T12360 2452-2454 , denotes ,
T12361 2454-2462 VBG denotes changing
T12362 2463-2466 DT denotes the
T12364 2467-2475 NN denotes staining
T12363 2476-2484 NN denotes solution
T12365 2485-2490 IN denotes after
T12366 2491-2492 CD denotes 1
T12367 2493-2494 NN denotes h
T12368 2494-2495 . denotes .
T12369 2495-2559 sentence denotes The samples were then fixed overnight, dehydrated, and mounted.
T12370 2496-2499 DT denotes The
T12371 2500-2507 NNS denotes samples
T12373 2508-2512 VBD denotes were
T12374 2513-2517 RB denotes then
T12372 2518-2523 VBN denotes fixed
T12375 2524-2533 RB denotes overnight
T12376 2533-2535 , denotes ,
T12377 2535-2545 VBN denotes dehydrated
T12378 2545-2547 , denotes ,
T12379 2547-2550 CC denotes and
T12380 2551-2558 VBN denotes mounted
T12381 2558-2559 . denotes .
T12382 2559-2658 sentence denotes This method is sufficient to stain interfollicular melanocytes without creating a high background.
T12383 2560-2564 DT denotes This
T12384 2565-2571 NN denotes method
T12385 2572-2574 VBZ denotes is
T12386 2575-2585 JJ denotes sufficient
T12387 2586-2588 TO denotes to
T12388 2589-2594 VB denotes stain
T12389 2595-2610 JJ denotes interfollicular
T12390 2611-2622 NNS denotes melanocytes
T12391 2623-2630 IN denotes without
T12392 2631-2639 VBG denotes creating
T12393 2640-2641 DT denotes a
T12395 2642-2646 JJ denotes high
T12394 2647-2657 NN denotes background
T12396 2657-2658 . denotes .
T12397 2658-2708 sentence denotes The fixative used was always 4% paraformaldehyde.
T12398 2659-2662 DT denotes The
T12399 2663-2671 JJ denotes fixative
T12401 2672-2676 VBN denotes used
T12400 2677-2680 VBD denotes was
T12402 2681-2687 RB denotes always
T12403 2688-2689 CD denotes 4
T12404 2689-2690 NN denotes %
T12405 2691-2707 NN denotes paraformaldehyde
T12406 2707-2708 . denotes .
T12538 2710-2720 JJ denotes Positional
T12539 2721-2728 NN denotes cloning
T12540 2728-2842 sentence denotes A high-resolution map for deH was generated from an intersubspecific intercross between deH/deH and CAST/Ei mice.
T12541 2729-2730 DT denotes A
T12543 2731-2735 JJ denotes high
T12545 2735-2736 HYPH denotes -
T12544 2736-2746 NN denotes resolution
T12542 2747-2750 NN denotes map
T12547 2751-2754 IN denotes for
T12548 2755-2758 NN denotes deH
T12549 2759-2762 VBD denotes was
T12546 2763-2772 VBN denotes generated
T12550 2773-2777 IN denotes from
T12551 2778-2780 DT denotes an
T12553 2781-2797 JJ denotes intersubspecific
T12552 2798-2808 NN denotes intercross
T12554 2809-2816 IN denotes between
T12555 2817-2820 NN denotes deH
T12557 2820-2821 HYPH denotes /
T12556 2821-2824 NN denotes deH
T12559 2825-2828 CC denotes and
T12560 2829-2833 NN denotes CAST
T12562 2833-2834 HYPH denotes /
T12561 2834-2836 NN denotes Ei
T12558 2837-2841 NNS denotes mice
T12563 2841-2842 . denotes .
T12564 2842-2918 sentence denotes We initially localized deH to a 1 cM interval between D3Mit233 and D3Mit11.
T12565 2843-2845 PRP denotes We
T12567 2846-2855 RB denotes initially
T12566 2856-2865 VBD denotes localized
T12568 2866-2869 NN denotes deH
T12569 2870-2872 IN denotes to
T12570 2873-2874 DT denotes a
T12572 2875-2876 CD denotes 1
T12573 2877-2879 NN denotes cM
T12571 2880-2888 NN denotes interval
T12574 2889-2896 IN denotes between
T12575 2897-2905 NN denotes D3Mit233
T12576 2906-2909 CC denotes and
T12577 2910-2917 NN denotes D3Mit11
T12578 2917-2918 . denotes .
T12579 2918-3090 sentence denotes F2 animals carrying recombinant chromosomes between these markers whose genotype at de was indeterminate (deH/+ or +/+) were progeny-tested by crossing to deH/deH animals.
T12580 2919-2921 NN denotes F2
T12581 2922-2929 NNS denotes animals
T12583 2930-2938 VBG denotes carrying
T12584 2939-2950 JJ denotes recombinant
T12585 2951-2962 NNS denotes chromosomes
T12586 2963-2970 IN denotes between
T12587 2971-2976 DT denotes these
T12588 2977-2984 NNS denotes markers
T12589 2985-2990 WP$ denotes whose
T12590 2991-2999 NN denotes genotype
T12592 3000-3002 IN denotes at
T12593 3003-3005 NN denotes de
T12591 3006-3009 VBD denotes was
T12594 3010-3023 JJ denotes indeterminate
T12595 3024-3025 -LRB- denotes (
T12596 3025-3028 NN denotes deH
T12597 3028-3029 HYPH denotes /
T12598 3029-3030 SYM denotes +
T12599 3031-3033 CC denotes or
T12600 3034-3035 SYM denotes +
T12602 3035-3036 HYPH denotes /
T12601 3036-3037 SYM denotes +
T12603 3037-3038 -RRB- denotes )
T12604 3039-3043 VBD denotes were
T12605 3044-3051 NN denotes progeny
T12606 3051-3052 HYPH denotes -
T12582 3052-3058 VBN denotes tested
T12607 3059-3061 IN denotes by
T12608 3062-3070 VBG denotes crossing
T12609 3071-3073 IN denotes to
T12610 3074-3077 NN denotes deH
T12612 3077-3078 HYPH denotes /
T12611 3078-3081 NN denotes deH
T12613 3082-3089 NNS denotes animals
T12614 3089-3090 . denotes .
T12615 3090-3394 sentence denotes Further genetic mapping established a minimal region of 0.1 cM between D3Mit213 and 16.MMHAP32FLF1; these markers were used to initiate construction of a physical map with BAC genomic clones (Research Genetics, Huntsville, Alabama, United States, and Genome Systems, St. Louis, Missouri, United States).
T12616 3091-3098 JJ denotes Further
T12618 3099-3106 JJ denotes genetic
T12617 3107-3114 NN denotes mapping
T12619 3115-3126 VBD denotes established
T12621 3127-3128 DT denotes a
T12623 3129-3136 JJ denotes minimal
T12622 3137-3143 NN denotes region
T12624 3144-3146 IN denotes of
T12625 3147-3150 CD denotes 0.1
T12626 3151-3153 NN denotes cM
T12627 3154-3161 IN denotes between
T12628 3162-3170 NN denotes D3Mit213
T12629 3171-3174 CC denotes and
T12630 3175-3189 NN denotes 16.MMHAP32FLF1
T12631 3189-3190 : denotes ;
T12632 3191-3196 DT denotes these
T12633 3197-3204 NNS denotes markers
T12634 3205-3209 VBD denotes were
T12620 3210-3214 VBN denotes used
T12635 3215-3217 TO denotes to
T12636 3218-3226 VB denotes initiate
T12637 3227-3239 NN denotes construction
T12638 3240-3242 IN denotes of
T12639 3243-3244 DT denotes a
T12641 3245-3253 JJ denotes physical
T12640 3254-3257 NN denotes map
T12642 3258-3262 IN denotes with
T12643 3263-3266 NN denotes BAC
T12645 3267-3274 JJ denotes genomic
T12644 3275-3281 NNS denotes clones
T12646 3282-3283 -LRB- denotes (
T12648 3283-3291 NNP denotes Research
T12647 3292-3300 NNP denotes Genetics
T12649 3300-3302 , denotes ,
T12650 3302-3312 NNP denotes Huntsville
T12651 3312-3314 , denotes ,
T12652 3314-3321 NNP denotes Alabama
T12653 3321-3323 , denotes ,
T12654 3323-3329 NNP denotes United
T12655 3330-3336 NNP denotes States
T12656 3336-3338 , denotes ,
T12657 3338-3341 CC denotes and
T12658 3342-3348 NNP denotes Genome
T12659 3349-3356 NNP denotes Systems
T12660 3356-3358 , denotes ,
T12661 3358-3361 NNP denotes St.
T12662 3362-3367 NNP denotes Louis
T12663 3367-3369 , denotes ,
T12664 3369-3377 NNP denotes Missouri
T12665 3377-3379 , denotes ,
T12666 3379-3385 NNP denotes United
T12667 3386-3392 NNP denotes States
T12668 3392-3393 -RRB- denotes )
T12669 3393-3394 . denotes .
T12670 3394-3547 sentence denotes End sequence from those BACs was used to develop SSCP markers M1 to M3, as depicted in Figure 3, and to establish a minimal physical interval of 1.4 Mb.
T12671 3395-3398 NN denotes End
T12672 3399-3407 NN denotes sequence
T12674 3408-3412 IN denotes from
T12675 3413-3418 DT denotes those
T12676 3419-3423 NNS denotes BACs
T12677 3424-3427 VBD denotes was
T12673 3428-3432 VBN denotes used
T12678 3433-3435 TO denotes to
T12679 3436-3443 VB denotes develop
T12680 3444-3448 NN denotes SSCP
T12681 3449-3456 NNS denotes markers
T12682 3457-3459 NN denotes M1
T12683 3460-3462 IN denotes to
T12684 3463-3465 NN denotes M3
T12685 3465-3467 , denotes ,
T12686 3467-3469 IN denotes as
T12687 3470-3478 VBN denotes depicted
T12688 3479-3481 IN denotes in
T12689 3482-3488 NN denotes Figure
T12690 3489-3490 CD denotes 3
T12691 3490-3492 , denotes ,
T12692 3492-3495 CC denotes and
T12693 3496-3498 TO denotes to
T12694 3499-3508 VB denotes establish
T12695 3509-3510 DT denotes a
T12697 3511-3518 JJ denotes minimal
T12698 3519-3527 JJ denotes physical
T12696 3528-3536 NN denotes interval
T12699 3537-3539 IN denotes of
T12700 3540-3543 CD denotes 1.4
T12701 3544-3546 NN denotes Mb
T12702 3546-3547 . denotes .
T12703 3547-3876 sentence denotes Primer pairs used were TTCCCTCCAATAAGTTCTGGGTACC and AAGCTTGCTGCTCTGGATTCCATTTGTAG for M1, CCTTCATTTTTTTTTCAAGTAAAA and AAGCTTGGCTTAGTCCCAGTGGC for M2, CCTCCAGGAAGATCTACTAGGCAC and ATGGAAAAAAAAAAGTAAGATTGAAAG for M3, and TGGTTATCGATCTGTGGACCATTC and AAGTGAGAGAGCAGGATGGACCAC for M4 (the M4 marker represents STS 16.MMHAP32FLF1).
T12704 3548-3554 NN denotes Primer
T12705 3555-3560 NNS denotes pairs
T12707 3561-3565 VBN denotes used
T12706 3566-3570 VBD denotes were
T12708 3571-3596 NN denotes TTCCCTCCAATAAGTTCTGGGTACC
T12709 3597-3600 CC denotes and
T12710 3601-3630 NN denotes AAGCTTGCTGCTCTGGATTCCATTTGTAG
T12711 3631-3634 IN denotes for
T12712 3635-3637 NN denotes M1
T12713 3637-3639 , denotes ,
T12714 3639-3663 NN denotes CCTTCATTTTTTTTTCAAGTAAAA
T12715 3664-3667 CC denotes and
T12716 3668-3691 NN denotes AAGCTTGGCTTAGTCCCAGTGGC
T12717 3692-3695 IN denotes for
T12718 3696-3698 NN denotes M2
T12719 3698-3700 , denotes ,
T12720 3700-3724 NN denotes CCTCCAGGAAGATCTACTAGGCAC
T12721 3725-3728 CC denotes and
T12722 3729-3756 NN denotes ATGGAAAAAAAAAAGTAAGATTGAAAG
T12723 3757-3760 IN denotes for
T12724 3761-3763 NN denotes M3
T12725 3763-3765 , denotes ,
T12726 3765-3768 CC denotes and
T12727 3769-3793 NN denotes TGGTTATCGATCTGTGGACCATTC
T12728 3794-3797 CC denotes and
T12729 3798-3822 NN denotes AAGTGAGAGAGCAGGATGGACCAC
T12730 3823-3826 IN denotes for
T12731 3827-3829 NN denotes M4
T12732 3830-3831 -LRB- denotes (
T12734 3831-3834 DT denotes the
T12736 3835-3837 NN denotes M4
T12735 3838-3844 NN denotes marker
T12733 3845-3855 VBZ denotes represents
T12737 3856-3859 NN denotes STS
T12738 3860-3874 NN denotes 16.MMHAP32FLF1
T12739 3874-3875 -RRB- denotes )
T12740 3875-3876 . denotes .
T12741 3876-4276 sentence denotes Genomic sequence and annotations were obtained from the UCSC Genome Browser February 2003 assembly version mm3 (http://genome.ucsc.edu); the 1.4 Mb interval between M1 and M4 contains eight genes: four hydroxysteroid dehydrogenase isomerases, Hsd3b3, Hsd3b2, Hsd3b6, and Hsd3b1; an hydroacid oxidase, Hao3; a tryptophanyl-tRNA synthetase, Wars2; a T-box gene, Tbx15; and a novel gene, 4931427F14Rik.
T12742 3877-3884 JJ denotes Genomic
T12743 3885-3893 NN denotes sequence
T12745 3894-3897 CC denotes and
T12746 3898-3909 NNS denotes annotations
T12747 3910-3914 VBD denotes were
T12744 3915-3923 VBN denotes obtained
T12749 3924-3928 IN denotes from
T12750 3929-3932 DT denotes the
T12752 3933-3937 NN denotes UCSC
T12753 3938-3944 NN denotes Genome
T12751 3945-3952 NN denotes Browser
T12755 3953-3961 NNP denotes February
T12757 3962-3966 CD denotes 2003
T12756 3967-3975 NN denotes assembly
T12758 3976-3983 NN denotes version
T12754 3984-3987 NN denotes mm3
T12759 3988-3989 -LRB- denotes (
T12760 3989-4011 NN denotes http://genome.ucsc.edu
T12761 4011-4012 -RRB- denotes )
T12762 4012-4013 : denotes ;
T12763 4014-4017 DT denotes the
T12765 4018-4021 CD denotes 1.4
T12766 4022-4024 NN denotes Mb
T12764 4025-4033 NN denotes interval
T12767 4034-4041 IN denotes between
T12768 4042-4044 NN denotes M1
T12769 4045-4048 CC denotes and
T12770 4049-4051 NN denotes M4
T12748 4052-4060 VBZ denotes contains
T12771 4061-4066 CD denotes eight
T12772 4067-4072 NNS denotes genes
T12773 4072-4074 : denotes :
T12774 4074-4078 CD denotes four
T12776 4079-4093 NN denotes hydroxysteroid
T12777 4094-4107 NN denotes dehydrogenase
T12775 4108-4118 NNS denotes isomerases
T12778 4118-4120 , denotes ,
T12779 4120-4126 NN denotes Hsd3b3
T12780 4126-4128 , denotes ,
T12781 4128-4134 NN denotes Hsd3b2
T12782 4134-4136 , denotes ,
T12783 4136-4142 NN denotes Hsd3b6
T12784 4142-4144 , denotes ,
T12785 4144-4147 CC denotes and
T12786 4148-4154 NN denotes Hsd3b1
T12787 4154-4155 , denotes ;
T12788 4156-4158 DT denotes an
T12790 4159-4168 NN denotes hydroacid
T12789 4169-4176 NN denotes oxidase
T12791 4176-4178 , denotes ,
T12792 4178-4182 NN denotes Hao3
T12793 4182-4183 , denotes ;
T12794 4184-4185 DT denotes a
T12796 4186-4198 NN denotes tryptophanyl
T12798 4198-4199 HYPH denotes -
T12797 4199-4203 NN denotes tRNA
T12795 4204-4214 NN denotes synthetase
T12799 4214-4216 , denotes ,
T12800 4216-4221 NN denotes Wars2
T12801 4221-4222 , denotes ;
T12802 4223-4224 DT denotes a
T12804 4225-4226 NN denotes T
T12806 4226-4227 HYPH denotes -
T12805 4227-4230 NN denotes box
T12803 4231-4235 NN denotes gene
T12807 4235-4237 , denotes ,
T12808 4237-4242 NN denotes Tbx15
T12809 4242-4243 , denotes ;
T12810 4244-4247 CC denotes and
T12811 4248-4249 DT denotes a
T12813 4250-4255 JJ denotes novel
T12812 4256-4260 NN denotes gene
T12814 4260-4262 , denotes ,
T12815 4262-4275 NN denotes 4931427F14Rik
T12816 4275-4276 . denotes .
T12817 4276-4543 sentence denotes In the genome sequence, M1 primers correspond to AGGCCTCCAATAAGTTCTGGGTACC and AAGCTTGCTCTCTGGATTCCATTTGTAG, the M2 reverse primer corresponds to AAGCTTGGCTTTAGTCCCAGTGGGC, and the M3 primers correspond to CCTCCAGGAAGAATCTACTAGGCAC and AATGAAAAAAAAAAAAGTAAGATTGAAAG.
T12818 4277-4279 IN denotes In
T12820 4280-4283 DT denotes the
T12822 4284-4290 NN denotes genome
T12821 4291-4299 NN denotes sequence
T12823 4299-4301 , denotes ,
T12824 4301-4303 NN denotes M1
T12825 4304-4311 NNS denotes primers
T12819 4312-4322 VBP denotes correspond
T12826 4323-4325 IN denotes to
T12827 4326-4351 NN denotes AGGCCTCCAATAAGTTCTGGGTACC
T12828 4352-4355 CC denotes and
T12829 4356-4384 NN denotes AAGCTTGCTCTCTGGATTCCATTTGTAG
T12830 4384-4386 , denotes ,
T12831 4386-4389 DT denotes the
T12833 4390-4392 NN denotes M2
T12834 4393-4400 JJ denotes reverse
T12832 4401-4407 NN denotes primer
T12835 4408-4419 VBZ denotes corresponds
T12836 4420-4422 IN denotes to
T12837 4423-4448 NN denotes AAGCTTGGCTTTAGTCCCAGTGGGC
T12838 4448-4450 , denotes ,
T12839 4450-4453 CC denotes and
T12840 4454-4457 DT denotes the
T12842 4458-4460 NN denotes M3
T12841 4461-4468 NNS denotes primers
T12843 4469-4479 VBP denotes correspond
T12844 4480-4482 IN denotes to
T12845 4483-4508 NN denotes CCTCCAGGAAGAATCTACTAGGCAC
T12846 4509-4512 CC denotes and
T12847 4513-4542 NN denotes AATGAAAAAAAAAAAAGTAAGATTGAAAG
T12848 4542-4543 . denotes .
T12849 4543-4727 sentence denotes Minor differences among the sequences of the primers we obtained from the BAC ends and the public genome sequence may represent strain differences or sequencing errors on the BAC DNA.
T12850 4544-4549 JJ denotes Minor
T12851 4550-4561 NNS denotes differences
T12853 4562-4567 IN denotes among
T12854 4568-4571 DT denotes the
T12855 4572-4581 NNS denotes sequences
T12856 4582-4584 IN denotes of
T12857 4585-4588 DT denotes the
T12858 4589-4596 NNS denotes primers
T12859 4597-4599 PRP denotes we
T12860 4600-4608 VBD denotes obtained
T12861 4609-4613 IN denotes from
T12862 4614-4617 DT denotes the
T12863 4618-4621 NN denotes BAC
T12864 4622-4626 VBZ denotes ends
T12865 4627-4630 CC denotes and
T12866 4631-4634 DT denotes the
T12868 4635-4641 JJ denotes public
T12869 4642-4648 NN denotes genome
T12867 4649-4657 NN denotes sequence
T12870 4658-4661 MD denotes may
T12852 4662-4671 VB denotes represent
T12871 4672-4678 NN denotes strain
T12872 4679-4690 NNS denotes differences
T12873 4691-4693 CC denotes or
T12874 4694-4704 NN denotes sequencing
T12875 4705-4711 NNS denotes errors
T12876 4712-4714 IN denotes on
T12877 4715-4718 DT denotes the
T12879 4719-4722 NN denotes BAC
T12878 4723-4726 NN denotes DNA
T12880 4726-4727 . denotes .
T12881 4727-4887 sentence denotes A multiplex genotyping assay was developed to genotype for the deH deletion using primers GGAGCAGATCCAATTGCTTT, TCCATAGCCCATCTTCACAA, and CATGTCCACTTCTGCTTCCA.
T12882 4728-4729 DT denotes A
T12884 4730-4739 JJ denotes multiplex
T12885 4740-4750 VBG denotes genotyping
T12883 4751-4756 NN denotes assay
T12887 4757-4760 VBD denotes was
T12886 4761-4770 VBN denotes developed
T12888 4771-4773 TO denotes to
T12889 4774-4782 VB denotes genotype
T12890 4783-4786 IN denotes for
T12891 4787-4790 DT denotes the
T12893 4791-4794 NN denotes deH
T12892 4795-4803 NN denotes deletion
T12894 4804-4809 VBG denotes using
T12895 4810-4817 NNS denotes primers
T12896 4818-4838 NN denotes GGAGCAGATCCAATTGCTTT
T12897 4838-4840 , denotes ,
T12898 4840-4860 NN denotes TCCATAGCCCATCTTCACAA
T12899 4860-4862 , denotes ,
T12900 4862-4865 CC denotes and
T12901 4866-4886 NN denotes CATGTCCACTTCTGCTTCCA
T12902 4886-4887 . denotes .
T12903 4887-5004 sentence denotes This PCR assay produces a 392 bp product from the deH chromosome and a 595 bp product from the nonmutant chromosome.
T12904 4888-4892 DT denotes This
T12906 4893-4896 NN denotes PCR
T12905 4897-4902 NN denotes assay
T12907 4903-4911 VBZ denotes produces
T12908 4912-4913 DT denotes a
T12910 4914-4917 CD denotes 392
T12911 4918-4920 NN denotes bp
T12909 4921-4928 NN denotes product
T12912 4929-4933 IN denotes from
T12913 4934-4937 DT denotes the
T12915 4938-4941 NN denotes deH
T12914 4942-4952 NN denotes chromosome
T12916 4953-4956 CC denotes and
T12917 4957-4958 DT denotes a
T12919 4959-4962 CD denotes 595
T12920 4963-4965 NN denotes bp
T12918 4966-4973 NN denotes product
T12921 4974-4978 IN denotes from
T12922 4979-4982 DT denotes the
T12924 4983-4992 JJ denotes nonmutant
T12923 4993-5003 NN denotes chromosome
T12925 5003-5004 . denotes .
T12974 5006-5010 NN denotes Gene
T12975 5011-5020 NN denotes targeting
T12976 5020-5120 sentence denotes A targeted allele of Tbx15 was constructed using the same approach described in Russ et al. (2000).
T12977 5021-5022 DT denotes A
T12979 5023-5031 VBN denotes targeted
T12978 5032-5038 NN denotes allele
T12981 5039-5041 IN denotes of
T12982 5042-5047 NN denotes Tbx15
T12983 5048-5051 VBD denotes was
T12980 5052-5063 VBN denotes constructed
T12984 5064-5069 VBG denotes using
T12985 5070-5073 DT denotes the
T12987 5074-5078 JJ denotes same
T12986 5079-5087 NN denotes approach
T12988 5088-5097 VBN denotes described
T12989 5098-5100 IN denotes in
T12990 5101-5105 NNP denotes Russ
T12991 5106-5108 FW denotes et
T12992 5109-5112 FW denotes al.
T12993 5113-5114 -LRB- denotes (
T12994 5114-5118 CD denotes 2000
T12995 5118-5119 -RRB- denotes )
T12996 5119-5120 . denotes .
T12997 5120-5363 sentence denotes In brief, an IRES-LacZ-neo cassette with 5′ and 3′ homology arms of 3.5 kb and 1.8 kb was inserted into a unique BamHI site that lies 479 nucleotides downstream of the transcriptional initiation site (relative to the mRNA sequence) in exon 3.
T12998 5121-5123 IN denotes In
T13000 5124-5129 NN denotes brief
T13001 5129-5131 , denotes ,
T13002 5131-5133 DT denotes an
T13004 5134-5138 NN denotes IRES
T13006 5138-5139 HYPH denotes -
T13007 5139-5143 NN denotes LacZ
T13008 5143-5144 HYPH denotes -
T13005 5144-5147 NN denotes neo
T13003 5148-5156 NN denotes cassette
T13009 5157-5161 IN denotes with
T13010 5162-5163 CD denotes 5
T13012 5163-5164 SYM denotes ′
T13013 5165-5168 CC denotes and
T13014 5169-5170 CD denotes 3
T13015 5170-5171 SYM denotes ′
T13016 5172-5180 NN denotes homology
T13011 5181-5185 NNS denotes arms
T13017 5186-5188 IN denotes of
T13018 5189-5192 CD denotes 3.5
T13019 5193-5195 NN denotes kb
T13020 5196-5199 CC denotes and
T13021 5200-5203 CD denotes 1.8
T13022 5204-5206 NN denotes kb
T13023 5207-5210 VBD denotes was
T12999 5211-5219 VBN denotes inserted
T13024 5220-5224 IN denotes into
T13025 5225-5226 DT denotes a
T13027 5227-5233 JJ denotes unique
T13028 5234-5239 NN denotes BamHI
T13026 5240-5244 NN denotes site
T13029 5245-5249 WDT denotes that
T13030 5250-5254 VBZ denotes lies
T13031 5255-5258 CD denotes 479
T13032 5259-5270 NNS denotes nucleotides
T13033 5271-5281 RB denotes downstream
T13034 5282-5284 IN denotes of
T13035 5285-5288 DT denotes the
T13037 5289-5304 JJ denotes transcriptional
T13038 5305-5315 NN denotes initiation
T13036 5316-5320 NN denotes site
T13039 5321-5322 -LRB- denotes (
T13040 5322-5330 JJ denotes relative
T13041 5331-5333 IN denotes to
T13042 5334-5337 DT denotes the
T13044 5338-5342 NN denotes mRNA
T13043 5343-5351 NN denotes sequence
T13045 5351-5352 -RRB- denotes )
T13046 5353-5355 IN denotes in
T13047 5356-5360 NN denotes exon
T13048 5361-5362 CD denotes 3
T13049 5362-5363 . denotes .
T13050 5363-5486 sentence denotes Positive ES clones were injected into B6 blastocysts, and chimeric founders crossed to either B6 mice or to deH/+ animals.
T13051 5364-5372 JJ denotes Positive
T13053 5373-5375 NN denotes ES
T13052 5376-5382 NNS denotes clones
T13055 5383-5387 VBD denotes were
T13054 5388-5396 VBN denotes injected
T13056 5397-5401 IN denotes into
T13057 5402-5404 NN denotes B6
T13058 5405-5416 NNS denotes blastocysts
T13059 5416-5418 , denotes ,
T13060 5418-5421 CC denotes and
T13061 5422-5430 JJ denotes chimeric
T13062 5431-5439 NNS denotes founders
T13063 5440-5447 VBN denotes crossed
T13064 5448-5450 IN denotes to
T13065 5451-5457 CC denotes either
T13067 5458-5460 NN denotes B6
T13066 5461-5465 NNS denotes mice
T13068 5466-5468 CC denotes or
T13069 5469-5471 IN denotes to
T13070 5472-5475 NN denotes deH
T13072 5475-5476 HYPH denotes /
T13073 5476-5477 SYM denotes +
T13071 5478-5485 NNS denotes animals
T13074 5485-5486 . denotes .
T13131 5488-5490 FW denotes In
T13132 5491-5495 FW denotes situ
T13133 5496-5509 NN denotes hybridization
T13134 5509-5729 sentence denotes In situ hybridization was carried out on 12-μm paraffin sections using digoxigenin-labeled RNA probes (Roche Diagnostics, Indianapolis, Indiana, United States) according to standard protocols (Wilkinson and Nieto 1993).
T13135 5510-5512 FW denotes In
T13136 5513-5517 FW denotes situ
T13137 5518-5531 NN denotes hybridization
T13139 5532-5535 VBD denotes was
T13138 5536-5543 VBN denotes carried
T13140 5544-5547 RP denotes out
T13141 5548-5550 IN denotes on
T13142 5551-5553 CD denotes 12
T13144 5553-5554 HYPH denotes -
T13143 5554-5556 NN denotes μm
T13146 5557-5565 NN denotes paraffin
T13145 5566-5574 NNS denotes sections
T13147 5575-5580 VBG denotes using
T13148 5581-5592 NN denotes digoxigenin
T13150 5592-5593 HYPH denotes -
T13149 5593-5600 VBN denotes labeled
T13152 5601-5604 NN denotes RNA
T13151 5605-5611 NNS denotes probes
T13153 5612-5613 -LRB- denotes (
T13155 5613-5618 NNP denotes Roche
T13154 5619-5630 NNP denotes Diagnostics
T13156 5630-5632 , denotes ,
T13157 5632-5644 NNP denotes Indianapolis
T13158 5644-5646 , denotes ,
T13159 5646-5653 NNP denotes Indiana
T13160 5653-5655 , denotes ,
T13161 5655-5661 NNP denotes United
T13162 5662-5668 NNP denotes States
T13163 5668-5669 -RRB- denotes )
T13164 5670-5679 VBG denotes according
T13165 5680-5682 IN denotes to
T13166 5683-5691 JJ denotes standard
T13167 5692-5701 NNS denotes protocols
T13168 5702-5703 -LRB- denotes (
T13169 5703-5712 NNP denotes Wilkinson
T13170 5713-5716 CC denotes and
T13171 5717-5722 NNP denotes Nieto
T13172 5723-5727 CD denotes 1993
T13173 5727-5728 -RRB- denotes )
T13174 5728-5729 . denotes .
T13175 5729-5811 sentence denotes Embryos and postnatal skin samples were obtained from intercrosses of deH/+ mice.
T13176 5730-5737 NNS denotes Embryos
T13178 5738-5741 CC denotes and
T13179 5742-5751 JJ denotes postnatal
T13181 5752-5756 NN denotes skin
T13180 5757-5764 NNS denotes samples
T13182 5765-5769 VBD denotes were
T13177 5770-5778 VBN denotes obtained
T13183 5779-5783 IN denotes from
T13184 5784-5796 NNS denotes intercrosses
T13185 5797-5799 IN denotes of
T13186 5800-5803 NN denotes deH
T13188 5803-5804 HYPH denotes /
T13189 5804-5805 SYM denotes +
T13187 5806-5810 NNS denotes mice
T13190 5810-5811 . denotes .
T13191 5811-5942 sentence denotes Embryos E13.5 or younger were fixed for 24 h; those older than E13.5 and postnatal skin were fixed for 36–48 h prior to embedding.
T13192 5812-5819 NNS denotes Embryos
T13194 5820-5825 NN denotes E13.5
T13195 5826-5828 CC denotes or
T13196 5829-5836 JJR denotes younger
T13197 5837-5841 VBD denotes were
T13193 5842-5847 VBN denotes fixed
T13199 5848-5851 IN denotes for
T13200 5852-5854 CD denotes 24
T13201 5855-5856 NN denotes h
T13202 5856-5857 : denotes ;
T13203 5858-5863 DT denotes those
T13204 5864-5869 JJR denotes older
T13205 5870-5874 IN denotes than
T13206 5875-5880 NN denotes E13.5
T13207 5881-5884 CC denotes and
T13208 5885-5894 JJ denotes postnatal
T13209 5895-5899 NN denotes skin
T13210 5900-5904 VBD denotes were
T13198 5905-5910 VBN denotes fixed
T13211 5911-5914 IN denotes for
T13212 5915-5917 CD denotes 36
T13214 5917-5918 SYM denotes –
T13213 5918-5920 CD denotes 48
T13215 5921-5922 NN denotes h
T13216 5923-5928 RB denotes prior
T13217 5929-5931 IN denotes to
T13218 5932-5941 VBG denotes embedding
T13219 5941-5942 . denotes .
T13220 5942-6217 sentence denotes The Tbx15 probe was generated by RT–PCR using primers GGCGGCTAAAATGAGTGAAC and TGCCTGCTTTGGTGATGAT (corresponds to exons 1 and 2), and the En1 probe was generated by PCR from genomic DNA using primers ACGCACCAGGAAGCTAAAGA and AGCAACGAAAACGAAACTGG (located in the last exon).
T13221 5943-5946 DT denotes The
T13223 5947-5952 NN denotes Tbx15
T13222 5953-5958 NN denotes probe
T13225 5959-5962 VBD denotes was
T13224 5963-5972 VBN denotes generated
T13226 5973-5975 IN denotes by
T13227 5976-5978 NN denotes RT
T13229 5978-5979 HYPH denotes –
T13228 5979-5982 NN denotes PCR
T13230 5983-5988 VBG denotes using
T13231 5989-5996 NNS denotes primers
T13232 5997-6017 NN denotes GGCGGCTAAAATGAGTGAAC
T13233 6018-6021 CC denotes and
T13234 6022-6041 NN denotes TGCCTGCTTTGGTGATGAT
T13235 6042-6043 -LRB- denotes (
T13236 6043-6054 VBZ denotes corresponds
T13237 6055-6057 IN denotes to
T13238 6058-6063 NNS denotes exons
T13239 6064-6065 CD denotes 1
T13240 6066-6069 CC denotes and
T13241 6070-6071 CD denotes 2
T13242 6071-6072 -RRB- denotes )
T13243 6072-6074 , denotes ,
T13244 6074-6077 CC denotes and
T13245 6078-6081 DT denotes the
T13247 6082-6085 NN denotes En1
T13246 6086-6091 NN denotes probe
T13249 6092-6095 VBD denotes was
T13248 6096-6105 VBN denotes generated
T13250 6106-6108 IN denotes by
T13251 6109-6112 NN denotes PCR
T13252 6113-6117 IN denotes from
T13253 6118-6125 JJ denotes genomic
T13254 6126-6129 NN denotes DNA
T13255 6130-6135 VBG denotes using
T13256 6136-6143 NNS denotes primers
T13257 6144-6164 NN denotes ACGCACCAGGAAGCTAAAGA
T13258 6165-6168 CC denotes and
T13259 6169-6189 NN denotes AGCAACGAAAACGAAACTGG
T13260 6190-6191 -LRB- denotes (
T13261 6191-6198 VBN denotes located
T13262 6199-6201 IN denotes in
T13263 6202-6205 DT denotes the
T13265 6206-6210 JJ denotes last
T13264 6211-6215 NN denotes exon
T13266 6215-6216 -RRB- denotes )
T13267 6216-6217 . denotes .
T13268 6217-6278 sentence denotes The Agouti probe corresponds to the protein-coding sequence.
T13269 6218-6221 DT denotes The
T13271 6222-6228 NN denotes Agouti
T13270 6229-6234 NN denotes probe
T13272 6235-6246 VBZ denotes corresponds
T13273 6247-6249 IN denotes to
T13274 6250-6253 DT denotes the
T13276 6254-6261 NN denotes protein
T13278 6261-6262 HYPH denotes -
T13277 6262-6268 VBG denotes coding
T13275 6269-6277 NN denotes sequence
T13279 6277-6278 . denotes .
T13332 6280-6289 JJ denotes Embryonic
T13334 6290-6294 NN denotes skin
T13333 6295-6310 NN denotes transplantation
T13335 6310-6511 sentence denotes (BTBR-at/at × B6-a/a)F1 embryos at E12.5 were dissected in sterile Tyrode's solution, and embryonic skin was divided into dorsal, flank, and ventral pieces, each 1–2 mm2 in size, as shown in Figure 7.
T13336 6311-6312 -LRB- denotes (
T13338 6312-6316 NN denotes BTBR
T13340 6316-6317 HYPH denotes -
T13341 6317-6319 NN denotes at
T13343 6319-6320 HYPH denotes /
T13342 6320-6322 NN denotes at
T13344 6323-6324 SYM denotes ×
T13345 6325-6327 NN denotes B6
T13346 6327-6328 HYPH denotes -
T13347 6328-6329 NN denotes a
T13349 6329-6330 HYPH denotes /
T13348 6330-6331 NN denotes a
T13350 6331-6332 -RRB- denotes )
T13351 6332-6334 NN denotes F1
T13339 6335-6342 NNS denotes embryos
T13352 6343-6345 IN denotes at
T13353 6346-6351 NN denotes E12.5
T13354 6352-6356 VBD denotes were
T13337 6357-6366 VBN denotes dissected
T13355 6367-6369 IN denotes in
T13356 6370-6377 JJ denotes sterile
T13358 6378-6384 NNP denotes Tyrode
T13359 6384-6386 POS denotes 's
T13357 6387-6395 NN denotes solution
T13360 6395-6397 , denotes ,
T13361 6397-6400 CC denotes and
T13362 6401-6410 JJ denotes embryonic
T13363 6411-6415 NN denotes skin
T13365 6416-6419 VBD denotes was
T13364 6420-6427 VBN denotes divided
T13366 6428-6432 IN denotes into
T13367 6433-6439 JJ denotes dorsal
T13369 6439-6441 , denotes ,
T13370 6441-6446 NN denotes flank
T13371 6446-6448 , denotes ,
T13372 6448-6451 CC denotes and
T13373 6452-6459 JJ denotes ventral
T13368 6460-6466 NNS denotes pieces
T13374 6466-6468 , denotes ,
T13375 6468-6472 RB denotes each
T13377 6473-6474 CD denotes 1
T13379 6474-6475 HYPH denotes –
T13378 6475-6476 CD denotes 2
T13376 6477-6480 NN denotes mm2
T13380 6481-6483 IN denotes in
T13381 6484-6488 NN denotes size
T13382 6488-6490 , denotes ,
T13383 6490-6492 IN denotes as
T13384 6493-6498 VBN denotes shown
T13385 6499-6501 IN denotes in
T13386 6502-6508 NN denotes Figure
T13387 6509-6510 CD denotes 7
T13388 6510-6511 . denotes .
T13389 6511-6585 sentence denotes Skin fragments were grafted to the testes of congenic animals as follows.
T13390 6512-6516 NN denotes Skin
T13391 6517-6526 NNS denotes fragments
T13393 6527-6531 VBD denotes were
T13392 6532-6539 VBN denotes grafted
T13394 6540-6542 IN denotes to
T13395 6543-6546 DT denotes the
T13396 6547-6553 NNS denotes testes
T13397 6554-6556 IN denotes of
T13398 6557-6565 JJ denotes congenic
T13399 6566-6573 NNS denotes animals
T13400 6574-6576 IN denotes as
T13401 6577-6584 VBZ denotes follows
T13402 6584-6585 . denotes .
T13403 6585-6723 sentence denotes After anesthetization with 2.5% Avertin, a 1.5-cm incision in the skin and body wall was made at a point level with the top of the limbs.
T13404 6586-6591 IN denotes After
T13406 6592-6607 NN denotes anesthetization
T13407 6608-6612 IN denotes with
T13408 6613-6616 CD denotes 2.5
T13409 6616-6617 NN denotes %
T13410 6618-6625 NN denotes Avertin
T13411 6625-6627 , denotes ,
T13412 6627-6628 DT denotes a
T13414 6629-6632 CD denotes 1.5
T13416 6632-6633 HYPH denotes -
T13415 6633-6635 NN denotes cm
T13413 6636-6644 NN denotes incision
T13417 6645-6647 IN denotes in
T13418 6648-6651 DT denotes the
T13419 6652-6656 NN denotes skin
T13420 6657-6660 CC denotes and
T13421 6661-6665 NN denotes body
T13422 6666-6670 NN denotes wall
T13423 6671-6674 VBD denotes was
T13405 6675-6679 VBN denotes made
T13424 6680-6682 IN denotes at
T13425 6683-6684 DT denotes a
T13426 6685-6690 NN denotes point
T13427 6691-6696 JJ denotes level
T13428 6697-6701 IN denotes with
T13429 6702-6705 DT denotes the
T13430 6706-6709 NN denotes top
T13431 6710-6712 IN denotes of
T13432 6713-6716 DT denotes the
T13433 6717-6722 NNS denotes limbs
T13434 6722-6723 . denotes .
T13435 6723-6810 sentence denotes The fat pads were pulled out and laid on the outside of the body, exposing the testes.
T13436 6724-6727 DT denotes The
T13438 6728-6731 NN denotes fat
T13437 6732-6736 NNS denotes pads
T13440 6737-6741 VBD denotes were
T13439 6742-6748 VBN denotes pulled
T13441 6749-6752 RP denotes out
T13442 6753-6756 CC denotes and
T13443 6757-6761 VBN denotes laid
T13444 6762-6764 IN denotes on
T13445 6765-6768 DT denotes the
T13446 6769-6776 NN denotes outside
T13447 6777-6779 IN denotes of
T13448 6780-6783 DT denotes the
T13449 6784-6788 NN denotes body
T13450 6788-6790 , denotes ,
T13451 6790-6798 VBG denotes exposing
T13452 6799-6802 DT denotes the
T13453 6803-6809 NNS denotes testes
T13454 6809-6810 . denotes .
T13455 6810-7058 sentence denotes Forceps were used to introduce a small hole in the testis capsule through which a piece of dissected embryonic skin was inserted, the testes were then replaced into the abdominal cavity, and the wound was closed in both the body wall and the skin.
T13456 6811-6818 NNS denotes Forceps
T13458 6819-6823 VBD denotes were
T13457 6824-6828 VBN denotes used
T13459 6829-6831 TO denotes to
T13460 6832-6841 VB denotes introduce
T13461 6842-6843 DT denotes a
T13463 6844-6849 JJ denotes small
T13462 6850-6854 NN denotes hole
T13464 6855-6857 IN denotes in
T13465 6858-6861 DT denotes the
T13467 6862-6868 NN denotes testis
T13466 6869-6876 NN denotes capsule
T13468 6877-6884 IN denotes through
T13470 6885-6890 WDT denotes which
T13471 6891-6892 DT denotes a
T13472 6893-6898 NN denotes piece
T13473 6899-6901 IN denotes of
T13474 6902-6911 VBN denotes dissected
T13476 6912-6921 JJ denotes embryonic
T13475 6922-6926 NN denotes skin
T13477 6927-6930 VBD denotes was
T13469 6931-6939 VBN denotes inserted
T13478 6939-6941 , denotes ,
T13479 6941-6944 DT denotes the
T13480 6945-6951 NNS denotes testes
T13482 6952-6956 VBD denotes were
T13483 6957-6961 RB denotes then
T13481 6962-6970 VBN denotes replaced
T13484 6971-6975 IN denotes into
T13485 6976-6979 DT denotes the
T13487 6980-6989 JJ denotes abdominal
T13486 6990-6996 NN denotes cavity
T13488 6996-6998 , denotes ,
T13489 6998-7001 CC denotes and
T13490 7002-7005 DT denotes the
T13491 7006-7011 NN denotes wound
T13493 7012-7015 VBD denotes was
T13492 7016-7022 VBN denotes closed
T13494 7023-7025 IN denotes in
T13495 7026-7030 CC denotes both
T13497 7031-7034 DT denotes the
T13498 7035-7039 NN denotes body
T13496 7040-7044 NN denotes wall
T13499 7045-7048 CC denotes and
T13500 7049-7052 DT denotes the
T13501 7053-7057 NN denotes skin
T13502 7057-7058 . denotes .
T13503 7058-7182 sentence denotes After 21 days, mice that received grafts were sacrificed and the resulting hair was dissected from the testes and examined.
T13504 7059-7064 IN denotes After
T13506 7065-7067 CD denotes 21
T13507 7068-7072 NNS denotes days
T13508 7072-7074 , denotes ,
T13509 7074-7078 NNS denotes mice
T13510 7079-7083 WDT denotes that
T13511 7084-7092 VBD denotes received
T13512 7093-7099 NNS denotes grafts
T13513 7100-7104 VBD denotes were
T13505 7105-7115 VBN denotes sacrificed
T13514 7116-7119 CC denotes and
T13515 7120-7123 DT denotes the
T13517 7124-7133 VBG denotes resulting
T13516 7134-7138 NN denotes hair
T13519 7139-7142 VBD denotes was
T13518 7143-7152 VBN denotes dissected
T13520 7153-7157 IN denotes from
T13521 7158-7161 DT denotes the
T13522 7162-7168 NNS denotes testes
T13523 7169-7172 CC denotes and
T13524 7173-7181 VBN denotes examined
T13525 7181-7182 . denotes .
T13570 7184-7188 NN denotes Fate
T13572 7188-7189 HYPH denotes -
T13571 7189-7196 VBG denotes mapping
T13573 7197-7200 DT denotes the
T13575 7201-7208 JJ denotes lateral
T13576 7209-7216 JJ denotes somitic
T13574 7217-7225 NN denotes frontier
T13577 7225-7398 sentence denotes The Hoxb6-Cre transgene described by Kuehn and colleagues (Lowe et al. 2000) is expressed in the lateral plate but not the somitic mesoderm of the trunk, beginning at E9.5.
T13578 7226-7229 DT denotes The
T13580 7230-7235 NN denotes Hoxb6
T13582 7235-7236 HYPH denotes -
T13581 7236-7239 NN denotes Cre
T13579 7240-7249 NN denotes transgene
T13584 7250-7259 VBN denotes described
T13585 7260-7262 IN denotes by
T13586 7263-7268 NN denotes Kuehn
T13587 7269-7272 CC denotes and
T13588 7273-7283 NNS denotes colleagues
T13589 7284-7285 -LRB- denotes (
T13590 7285-7289 NNP denotes Lowe
T13591 7290-7292 FW denotes et
T13592 7293-7296 FW denotes al.
T13593 7297-7301 CD denotes 2000
T13594 7301-7302 -RRB- denotes )
T13595 7303-7305 VBZ denotes is
T13583 7306-7315 VBN denotes expressed
T13596 7316-7318 IN denotes in
T13597 7319-7322 DT denotes the
T13599 7323-7330 JJ denotes lateral
T13598 7331-7336 NN denotes plate
T13600 7337-7340 CC denotes but
T13601 7341-7344 RB denotes not
T13602 7345-7348 DT denotes the
T13604 7349-7356 JJ denotes somitic
T13603 7357-7365 NN denotes mesoderm
T13605 7366-7368 IN denotes of
T13606 7369-7372 DT denotes the
T13607 7373-7378 NN denotes trunk
T13608 7378-7380 , denotes ,
T13609 7380-7389 VBG denotes beginning
T13610 7390-7392 IN denotes at
T13611 7393-7397 NN denotes E9.5
T13612 7397-7398 . denotes .
T13613 7398-7525 sentence denotes Animals doubly heterozygous for this transgene and the R26R reporter gene were used as a source of whole skin at P1.5 or P4.5.
T13614 7399-7406 NNS denotes Animals
T13616 7407-7413 RB denotes doubly
T13617 7414-7426 JJ denotes heterozygous
T13618 7427-7430 IN denotes for
T13619 7431-7435 DT denotes this
T13620 7436-7445 NN denotes transgene
T13621 7446-7449 CC denotes and
T13622 7450-7453 DT denotes the
T13624 7454-7458 NN denotes R26R
T13625 7459-7467 NN denotes reporter
T13623 7468-7472 NN denotes gene
T13626 7473-7477 VBD denotes were
T13615 7478-7482 VBN denotes used
T13627 7483-7485 IN denotes as
T13628 7486-7487 DT denotes a
T13629 7488-7494 NN denotes source
T13630 7495-7497 IN denotes of
T13631 7498-7503 JJ denotes whole
T13632 7504-7508 NN denotes skin
T13633 7509-7511 IN denotes at
T13634 7512-7516 NN denotes P1.5
T13635 7517-7519 CC denotes or
T13636 7520-7524 NN denotes P4.5
T13637 7524-7525 . denotes .
T13638 7525-7723 sentence denotes Skin sections parallel to the dorsoventral axis were prepared with a single incision along the ventral midline and stained for β-galactosidase activity using standard protocols at room temperature.
T13639 7526-7530 NN denotes Skin
T13640 7531-7539 NNS denotes sections
T13642 7540-7548 JJ denotes parallel
T13643 7549-7551 IN denotes to
T13644 7552-7555 DT denotes the
T13646 7556-7568 JJ denotes dorsoventral
T13645 7569-7573 NN denotes axis
T13647 7574-7578 VBD denotes were
T13641 7579-7587 VBN denotes prepared
T13648 7588-7592 IN denotes with
T13649 7593-7594 DT denotes a
T13651 7595-7601 JJ denotes single
T13650 7602-7610 NN denotes incision
T13652 7611-7616 IN denotes along
T13653 7617-7620 DT denotes the
T13655 7621-7628 JJ denotes ventral
T13654 7629-7636 NN denotes midline
T13656 7637-7640 CC denotes and
T13657 7641-7648 VBN denotes stained
T13658 7649-7652 IN denotes for
T13659 7653-7654 NN denotes β
T13661 7654-7655 HYPH denotes -
T13660 7655-7668 NN denotes galactosidase
T13662 7669-7677 NN denotes activity
T13663 7678-7683 VBG denotes using
T13664 7684-7692 JJ denotes standard
T13665 7693-7702 NNS denotes protocols
T13666 7703-7705 IN denotes at
T13667 7706-7710 NN denotes room
T13668 7711-7722 NN denotes temperature
T13669 7722-7723 . denotes .
T13670 7723-7806 sentence denotes The P1.5 sample was stained overnight and the P4.5 samples were stained for 5.5 h.
T13671 7724-7727 DT denotes The
T13673 7728-7732 NN denotes P1.5
T13672 7733-7739 NN denotes sample
T13675 7740-7743 VBD denotes was
T13674 7744-7751 VBN denotes stained
T13676 7752-7761 RB denotes overnight
T13677 7762-7765 CC denotes and
T13678 7766-7769 DT denotes the
T13680 7770-7774 NN denotes P4.5
T13679 7775-7782 NNS denotes samples
T13682 7783-7787 VBD denotes were
T13681 7788-7795 VBN denotes stained
T13683 7796-7799 IN denotes for
T13684 7800-7803 CD denotes 5.5
T13685 7804-7805 NN denotes h
T13686 7805-7806 . denotes .
T13687 7806-7890 sentence denotes Similar nonstained skin sections were prepared from animals carrying the at allele.
T13688 7807-7814 JJ denotes Similar
T13690 7815-7825 JJ denotes nonstained
T13691 7826-7830 NN denotes skin
T13689 7831-7839 NNS denotes sections
T13693 7840-7844 VBD denotes were
T13692 7845-7853 VBN denotes prepared
T13694 7854-7858 IN denotes from
T13695 7859-7866 NNS denotes animals
T13696 7867-7875 VBG denotes carrying
T13697 7876-7879 DT denotes the
T13699 7880-7882 NN denotes at
T13698 7883-7889 NN denotes allele
T13700 7889-7890 . denotes .
T13701 7890-8068 sentence denotes Images of the different skin fragments were aligned and scaled, and the relative position of the somite–lateral plate and the pigmentation boundaries were measured using ImageJ.
T13702 7891-7897 NNS denotes Images
T13704 7898-7900 IN denotes of
T13705 7901-7904 DT denotes the
T13707 7905-7914 JJ denotes different
T13708 7915-7919 NN denotes skin
T13706 7920-7929 NNS denotes fragments
T13709 7930-7934 VBD denotes were
T13703 7935-7942 VBN denotes aligned
T13710 7943-7946 CC denotes and
T13711 7947-7953 VBN denotes scaled
T13712 7953-7955 , denotes ,
T13713 7955-7958 CC denotes and
T13714 7959-7962 DT denotes the
T13716 7963-7971 JJ denotes relative
T13715 7972-7980 NN denotes position
T13718 7981-7983 IN denotes of
T13719 7984-7987 DT denotes the
T13721 7988-7994 NN denotes somite
T13723 7994-7995 HYPH denotes –
T13722 7995-8002 JJ denotes lateral
T13720 8003-8008 NN denotes plate
T13724 8009-8012 CC denotes and
T13725 8013-8016 DT denotes the
T13727 8017-8029 NN denotes pigmentation
T13726 8030-8040 NNS denotes boundaries
T13728 8041-8045 VBD denotes were
T13717 8046-8054 VBN denotes measured
T13729 8055-8060 VBG denotes using
T13730 8061-8067 NN denotes ImageJ
T13731 8067-8068 . denotes .
R8218 T11801 T11802 det All,mice
R8219 T11802 T11803 nsubjpass mice,obtained
R8220 T11804 T11803 auxpass were,obtained
R8221 T11805 T11803 advmod originally,obtained
R8222 T11806 T11803 prep from,obtained
R8223 T11807 T11808 det The,Laboratory
R8224 T11808 T11806 pobj Laboratory,from
R8225 T11809 T11808 compound Jackson,Laboratory
R8226 T11810 T11811 punct (,Harbor
R8227 T11811 T11808 parataxis Harbor,Laboratory
R8228 T11812 T11811 compound Bar,Harbor
R8229 T11813 T11811 punct ", ",Harbor
R8230 T11814 T11811 npadvmod Maine,Harbor
R8231 T11815 T11811 punct ", ",Harbor
R8232 T11816 T11817 compound United,States
R8233 T11817 T11811 npadvmod States,Harbor
R8234 T11818 T11811 punct ),Harbor
R8235 T11819 T11803 punct ", ",obtained
R8236 T11820 T11803 prep except,obtained
R8237 T11821 T11822 det the,strain
R8238 T11822 T11820 pobj strain,except
R8239 T11823 T11822 compound BA,strain
R8240 T11824 T11825 punct (,Center
R8241 T11825 T11822 parataxis Center,strain
R8242 T11826 T11825 compound Stanford,Center
R8243 T11827 T11828 compound Veterinary,Services
R8244 T11828 T11825 compound Services,Center
R8245 T11829 T11825 punct ", ",Center
R8246 T11830 T11825 npadvmod Stanford,Center
R8247 T11831 T11825 punct ", ",Center
R8248 T11832 T11825 npadvmod California,Center
R8249 T11833 T11825 punct ", ",Center
R8250 T11834 T11835 compound United,States
R8251 T11835 T11825 npadvmod States,Center
R8252 T11836 T11825 punct ),Center
R8253 T11837 T11822 punct ", ",strain
R8254 T11838 T11839 nmod Hoxb6,Cre
R8255 T11839 T11841 nmod Cre,mice
R8256 T11840 T11839 punct -,Cre
R8257 T11841 T11822 conj mice,strain
R8258 T11842 T11841 amod transgenic,mice
R8259 T11843 T11841 punct (,mice
R8260 T11844 T11845 advmod kindly,provided
R8261 T11845 T11841 acl provided,mice
R8262 T11846 T11845 agent by,provided
R8263 T11847 T11848 compound M.,Kuehn
R8264 T11848 T11846 pobj Kuehn,by
R8265 T11849 T11848 prep of,Kuehn
R8266 T11850 T11851 det the,Institutes
R8267 T11851 T11849 pobj Institutes,of
R8268 T11852 T11851 compound National,Institutes
R8269 T11853 T11851 prep of,Institutes
R8270 T11854 T11853 pobj Health,of
R8271 T11855 T11851 punct ", ",Institutes
R8272 T11856 T11851 npadvmod Bethesda,Institutes
R8273 T11857 T11851 punct ", ",Institutes
R8274 T11858 T11851 npadvmod Maryland,Institutes
R8275 T11859 T11851 punct ", ",Institutes
R8276 T11860 T11861 compound United,States
R8277 T11861 T11851 npadvmod States,Institutes
R8278 T11862 T11841 punct ),mice
R8279 T11863 T11841 punct ", ",mice
R8280 T11864 T11841 conj mice,mice
R8281 T11865 T11864 acl carrying,mice
R8282 T11866 T11867 det the,allele
R8283 T11867 T11865 dobj allele,carrying
R8284 T11868 T11869 compound R26R,reporter
R8285 T11869 T11867 compound reporter,allele
R8286 T11870 T11869 compound lacZ,reporter
R8287 T11871 T11864 punct (,mice
R8288 T11872 T11873 advmod kindly,provided
R8289 T11873 T11864 acl provided,mice
R8290 T11874 T11873 agent by,provided
R8291 T11875 T11876 compound P.,Soriano
R8292 T11876 T11874 pobj Soriano,by
R8293 T11877 T11876 punct ", ",Soriano
R8294 T11878 T11879 compound Fred,Center
R8295 T11879 T11876 appos Center,Soriano
R8296 T11880 T11879 compound Hutchinson,Center
R8297 T11881 T11882 compound Cancer,Research
R8298 T11882 T11879 compound Research,Center
R8299 T11883 T11879 punct ", ",Center
R8300 T11884 T11879 npadvmod Seattle,Center
R8301 T11885 T11879 punct ", ",Center
R8302 T11886 T11879 npadvmod Washington,Center
R8303 T11887 T11879 punct ", ",Center
R8304 T11888 T11889 compound United,States
R8305 T11889 T11879 npadvmod States,Center
R8306 T11890 T11864 punct ),mice
R8307 T11891 T11864 punct ", ",mice
R8308 T11892 T11864 cc and,mice
R8309 T11893 T11894 nmod C57BL,6J
R8310 T11894 T11896 nmod 6J,mice
R8311 T11895 T11894 punct /,6J
R8312 T11896 T11864 conj mice,mice
R8313 T11897 T11894 punct (,6J
R8314 T11898 T11894 appos B6,6J
R8315 T11899 T11894 punct ),6J
R8316 T11900 T11901 compound ae,ae
R8317 T11901 T11896 compound ae,mice
R8318 T11902 T11901 punct /,ae
R8319 T11903 T11896 punct (,mice
R8320 T11904 T11905 advmod kindly,provided
R8321 T11905 T11896 acl provided,mice
R8322 T11906 T11905 agent by,provided
R8323 T11907 T11908 compound L.,Siracusa
R8324 T11908 T11906 pobj Siracusa,by
R8325 T11909 T11908 punct ", ",Siracusa
R8326 T11910 T11911 compound Jefferson,College
R8327 T11911 T11908 appos College,Siracusa
R8328 T11912 T11911 compound Medical,College
R8329 T11913 T11911 punct ", ",College
R8330 T11914 T11911 npadvmod Philadelphia,College
R8331 T11915 T11911 punct ", ",College
R8332 T11916 T11911 npadvmod Pennsylvania,College
R8333 T11917 T11911 punct ", ",College
R8334 T11918 T11919 compound United,States
R8335 T11919 T11911 npadvmod States,College
R8336 T11920 T11896 punct ),mice
R8337 T11921 T11803 punct .,obtained
R8338 T11923 T11924 det The,mutation
R8339 T11924 T11926 nsubj mutation,arose
R8340 T11925 T11924 compound deH,mutation
R8341 T11927 T11926 prep in,arose
R8342 T11928 T11929 det the,1960s
R8343 T11929 T11927 pobj 1960s,in
R8344 T11930 T11926 prep in,arose
R8345 T11931 T11930 pobj Harwell,in
R8346 T11932 T11926 punct ", ",arose
R8347 T11933 T11934 advmod probably,on
R8348 T11934 T11926 prep on,arose
R8349 T11935 T11936 det the,background
R8350 T11936 T11934 pobj background,on
R8351 T11937 T11938 compound BN,strain
R8352 T11938 T11936 compound strain,background
R8353 T11939 T11940 punct (,C.
R8354 T11940 T11926 meta C.,arose
R8355 T11941 T11940 nmod Beechey,C.
R8356 T11942 T11940 punct ", ",C.
R8357 T11943 T11940 amod personal,C.
R8358 T11944 T11940 nmod communication,C.
R8359 T11945 T11940 punct ),C.
R8360 T11946 T11926 punct .,arose
R8361 T11948 T11949 nsubj We,obtained
R8362 T11950 T11949 dobj deH,obtained
R8363 T11951 T11950 prep on,deH
R8364 T11952 T11953 det a,background
R8365 T11953 T11951 pobj background,on
R8366 T11954 T11955 compound B6,EiC3H
R8367 T11955 T11953 compound EiC3H,background
R8368 T11956 T11955 punct /,EiC3H
R8369 T11957 T11949 punct ", ",obtained
R8370 T11958 T11949 conj introduced,obtained
R8371 T11959 T11960 det the,allele
R8372 T11960 T11958 dobj allele,introduced
R8373 T11961 T11960 compound at,allele
R8374 T11962 T11960 prep from,allele
R8375 T11963 T11964 det the,strain
R8376 T11964 T11962 pobj strain,from
R8377 T11965 T11964 compound BTBR,strain
R8378 T11966 T11958 punct ", ",introduced
R8379 T11967 T11958 cc and,introduced
R8380 T11968 T11969 aux have,maintained
R8381 T11969 T11958 conj maintained,introduced
R8382 T11970 T11971 det the,line
R8383 T11971 T11969 dobj line,maintained
R8384 T11972 T11969 prep as,maintained
R8385 T11973 T11974 det a,stock
R8386 T11974 T11972 pobj stock,as
R8387 T11975 T11974 amod mixed,stock
R8388 T11976 T11974 nmod deH,stock
R8389 T11977 T11976 punct /,deH
R8390 T11978 T11976 punct +,deH
R8391 T11979 T11976 punct ×,deH
R8392 T11980 T11976 appos deH,deH
R8393 T11981 T11980 punct /,deH
R8394 T11982 T11980 punct +,deH
R8395 T11983 T11976 amod intercross,deH
R8396 T11984 T11969 prep with,maintained
R8397 T11985 T11986 amod periodic,outcrossing
R8398 T11986 T11984 pobj outcrossing,with
R8399 T11987 T11986 prep to,outcrossing
R8400 T11988 T11987 pobj BTBR,to
R8401 T11989 T11988 cc or,BTBR
R8402 T11990 T11988 conj B6,BTBR
R8403 T11991 T11949 punct .,obtained
R8404 T11993 T11994 prep For,considered
R8405 T11995 T11996 amod timed,matings
R8406 T11996 T11993 pobj matings,For
R8407 T11997 T11994 punct ", ",considered
R8408 T11998 T11999 det the,morning
R8409 T11999 T11994 nsubjpass morning,considered
R8410 T12000 T11999 prep of,morning
R8411 T12001 T12002 det the,plug
R8412 T12002 T12000 pobj plug,of
R8413 T12003 T11994 auxpass was,considered
R8414 T12004 T11994 oprd E0.5,considered
R8415 T12005 T11994 punct .,considered
R8416 T12007 T12008 advmod Postnatally,considered
R8417 T12009 T12008 punct ", ",considered
R8418 T12010 T12011 det the,day
R8419 T12011 T12008 nsubjpass day,considered
R8420 T12012 T12011 prep of,day
R8421 T12013 T12012 pobj birth,of
R8422 T12014 T12008 auxpass was,considered
R8423 T12015 T12016 aux to,be
R8424 T12016 T12008 xcomp be,considered
R8425 T12017 T12016 attr P0.5,be
R8426 T12018 T12008 punct .,considered
R8429 T12097 T12098 amod Phenotypic,analysis
R8430 T12100 T12101 prep For,dissected
R8431 T12102 T12100 pobj measurements,For
R8432 T12103 T12102 prep of,measurements
R8433 T12104 T12105 compound hair,length
R8434 T12105 T12103 pobj length,of
R8435 T12106 T12105 cc and,length
R8436 T12107 T12105 conj color,length
R8437 T12108 T12101 punct ", ",dissected
R8438 T12109 T12110 det the,region
R8439 T12110 T12101 nsubjpass region,dissected
R8440 T12111 T12110 amod entire,region
R8441 T12112 T12110 compound interlimb,region
R8442 T12113 T12110 prep of,region
R8443 T12114 T12113 pobj skin,of
R8444 T12115 T12101 auxpass was,dissected
R8445 T12116 T12101 advmod first,dissected
R8446 T12117 T12101 prep with,dissected
R8447 T12118 T12119 det a,incision
R8448 T12119 T12117 pobj incision,with
R8449 T12120 T12119 amod single,incision
R8450 T12121 T12119 prep at,incision
R8451 T12122 T12123 det the,midline
R8452 T12123 T12121 pobj midline,at
R8453 T12124 T12123 amod dorsal,midline
R8454 T12125 T12101 cc and,dissected
R8455 T12126 T12101 conj preserved,dissected
R8456 T12127 T12126 prep with,preserved
R8457 T12128 T12129 amod powdered,bicarbonate
R8458 T12129 T12127 pobj bicarbonate,with
R8459 T12130 T12129 compound sodium,bicarbonate
R8460 T12131 T12101 punct .,dissected
R8461 T12133 T12134 nsubjpass Slices,prepared
R8462 T12135 T12136 compound 2,2.5
R8463 T12136 T12138 nummod 2.5,mm
R8464 T12137 T12136 punct –,2.5
R8465 T12138 T12139 nsubj mm,in
R8466 T12139 T12133 relcl in,Slices
R8467 T12140 T12139 pobj width,in
R8468 T12141 T12134 auxpass were,prepared
R8469 T12142 T12134 advmod then,prepared
R8470 T12143 T12134 advmod parallel,prepared
R8471 T12144 T12143 prep to,parallel
R8472 T12145 T12146 det the,axis
R8473 T12146 T12144 pobj axis,to
R8474 T12147 T12146 amod dorsoventral,axis
R8475 T12148 T12134 punct ", ",prepared
R8476 T12149 T12150 compound hair,boundaries
R8477 T12150 T12152 nsubj boundaries,determined
R8478 T12151 T12150 compound length,boundaries
R8479 T12152 T12134 conj determined,prepared
R8480 T12153 T12152 prep from,determined
R8481 T12154 T12155 amod electronic,images
R8482 T12155 T12153 pobj images,from
R8483 T12156 T12152 prep with,determined
R8484 T12157 T12158 compound Adobe,Photoshop
R8485 T12158 T12156 pobj Photoshop,with
R8486 T12159 T12160 punct (,Jose
R8487 T12160 T12158 parataxis Jose,Photoshop
R8488 T12161 T12160 compound San,Jose
R8489 T12162 T12160 punct ", ",Jose
R8490 T12163 T12160 npadvmod California,Jose
R8491 T12164 T12160 punct ", ",Jose
R8492 T12165 T12166 compound United,States
R8493 T12166 T12160 npadvmod States,Jose
R8494 T12167 T12160 punct ),Jose
R8495 T12168 T12152 punct ", ",determined
R8496 T12169 T12152 cc and,determined
R8497 T12170 T12171 nsubj measurements,obtained
R8498 T12171 T12152 conj obtained,determined
R8499 T12172 T12171 advcl using,obtained
R8500 T12173 T12172 dobj ImageJ,using
R8501 T12174 T12175 punct (,Institutes
R8502 T12175 T12173 parataxis Institutes,ImageJ
R8503 T12176 T12175 compound National,Institutes
R8504 T12177 T12175 prep of,Institutes
R8505 T12178 T12177 pobj Health,of
R8506 T12179 T12175 punct ),Institutes
R8507 T12180 T12171 punct .,obtained
R8508 T12182 T12183 det This,approach
R8509 T12183 T12184 nsubj approach,samples
R8510 T12185 T12184 dobj awls,samples
R8511 T12186 T12185 cc and,awls
R8512 T12187 T12185 conj auchenes,awls
R8513 T12188 T12184 punct ", ",samples
R8514 T12189 T12190 mark because,are
R8515 T12190 T12184 advcl are,samples
R8516 T12191 T12190 nsubj they,are
R8517 T12192 T12193 advmod much,thicker
R8518 T12193 T12190 acomp thicker,are
R8519 T12194 T12193 cc and,thicker
R8520 T12195 T12196 advmod therefore,predominant
R8521 T12196 T12193 conj predominant,thicker
R8522 T12197 T12196 advmod visually,predominant
R8523 T12198 T12196 advmod more,predominant
R8524 T12199 T12193 prep than,thicker
R8525 T12200 T12201 compound zigzag,underhairs
R8526 T12201 T12199 pobj underhairs,than
R8527 T12202 T12184 punct .,samples
R8528 T12204 T12205 aux To,assess
R8529 T12205 T12206 advcl assess,plucked
R8530 T12207 T12208 amod dorsoventral,variation
R8531 T12208 T12205 dobj variation,assess
R8532 T12209 T12208 prep in,variation
R8533 T12210 T12211 compound hair,type
R8534 T12211 T12213 compound type,distribution
R8535 T12212 T12211 punct -,type
R8536 T12213 T12209 pobj distribution,in
R8537 T12214 T12206 punct ", ",plucked
R8538 T12215 T12216 amod several,hairs
R8539 T12216 T12206 nsubjpass hairs,plucked
R8540 T12217 T12216 nummod hundred,hairs
R8541 T12218 T12206 auxpass were,plucked
R8542 T12219 T12206 prep from,plucked
R8543 T12220 T12221 det the,middorsum
R8544 T12221 T12219 pobj middorsum,from
R8545 T12222 T12221 cc or,middorsum
R8546 T12223 T12221 conj midventrum,middorsum
R8547 T12224 T12221 prep of,middorsum
R8548 T12225 T12226 nummod 8,wk
R8549 T12226 T12228 npadvmod wk,old
R8550 T12227 T12226 punct -,wk
R8551 T12228 T12230 amod old,animals
R8552 T12229 T12228 punct -,old
R8553 T12230 T12224 pobj animals,of
R8554 T12231 T12230 amod male,animals
R8555 T12232 T12233 compound BA,strain
R8556 T12233 T12230 compound strain,animals
R8557 T12234 T12206 punct ", ",plucked
R8558 T12235 T12236 advmod then,sorted
R8559 T12236 T12206 dep sorted,plucked
R8560 T12237 T12236 cc and,sorted
R8561 T12238 T12236 conj categorized,sorted
R8562 T12239 T12236 advcl using,sorted
R8563 T12240 T12241 det a,microscope
R8564 T12241 T12239 dobj microscope,using
R8565 T12242 T12241 compound dissection,microscope
R8566 T12243 T12206 punct .,plucked
R8567 T12245 T12246 det No,attempt
R8568 T12246 T12247 nsubjpass attempt,made
R8569 T12248 T12247 auxpass was,made
R8570 T12249 T12250 aux to,distinguish
R8571 T12250 T12247 xcomp distinguish,made
R8572 T12251 T12250 prep between,distinguish
R8573 T12252 T12251 pobj awls,between
R8574 T12253 T12252 cc and,awls
R8575 T12254 T12252 conj auchenes,awls
R8576 T12255 T12247 punct .,made
R8577 T12257 T12258 prep For,stained
R8578 T12259 T12260 compound skin,histology
R8579 T12260 T12257 pobj histology,For
R8580 T12261 T12258 punct ", ",stained
R8581 T12262 T12263 nummod 12,μm
R8582 T12263 T12264 compound μm,sections
R8583 T12264 T12258 nsubjpass sections,stained
R8584 T12265 T12264 prep from,sections
R8585 T12266 T12267 npadvmod paraffin,embedded
R8586 T12267 T12269 amod embedded,tissue
R8587 T12268 T12267 punct -,embedded
R8588 T12269 T12265 pobj tissue,from
R8589 T12270 T12258 auxpass were,stained
R8590 T12271 T12258 prep with,stained
R8591 T12272 T12271 pobj hematoxylin,with
R8592 T12273 T12272 cc and,hematoxylin
R8593 T12274 T12272 conj eosin,hematoxylin
R8594 T12275 T12258 punct .,stained
R8595 T12277 T12278 prep For,split
R8596 T12279 T12280 compound DOPA,staining
R8597 T12280 T12277 pobj staining,For
R8598 T12281 T12278 punct ", ",split
R8599 T12282 T12283 det the,dermis
R8600 T12283 T12278 nsubjpass dermis,split
R8601 T12284 T12283 cc and,dermis
R8602 T12285 T12283 conj epidermis,dermis
R8603 T12286 T12278 auxpass were,split
R8604 T12287 T12278 prep after,split
R8605 T12288 T12289 nummod 3,h
R8606 T12289 T12287 pobj h,after
R8607 T12290 T12289 prep of,h
R8608 T12291 T12290 pobj incubation,of
R8609 T12292 T12291 prep in,incubation
R8610 T12293 T12294 nummod 2,M
R8611 T12294 T12295 compound M,bromide
R8612 T12295 T12292 pobj bromide,in
R8613 T12296 T12295 compound sodium,bromide
R8614 T12297 T12291 prep at,incubation
R8615 T12298 T12299 nummod 37,°C
R8616 T12299 T12297 pobj °C,at
R8617 T12300 T12301 punct (,causes
R8618 T12301 T12291 parataxis causes,incubation
R8619 T12302 T12303 det this,preparation
R8620 T12303 T12301 nsubj preparation,causes
R8621 T12304 T12305 amod most,follicles
R8622 T12305 T12307 nsubj follicles,remain
R8623 T12306 T12305 compound hair,follicles
R8624 T12307 T12301 ccomp remain,causes
R8625 T12308 T12307 aux to,remain
R8626 T12309 T12307 prep with,remain
R8627 T12310 T12311 det the,dermis
R8628 T12311 T12309 pobj dermis,with
R8629 T12312 T12301 punct ),causes
R8630 T12313 T12278 punct ", ",split
R8631 T12314 T12315 advmod individually,fixed
R8632 T12315 T12278 dep fixed,split
R8633 T12316 T12315 prep for,fixed
R8634 T12317 T12318 nummod 1,h
R8635 T12318 T12316 pobj h,for
R8636 T12319 T12278 punct ", ",split
R8637 T12320 T12321 advmod then,rinsed
R8638 T12321 T12278 dep rinsed,split
R8639 T12322 T12321 cc and,rinsed
R8640 T12323 T12321 conj stained,rinsed
R8641 T12324 T12323 prep with,stained
R8642 T12325 T12326 nummod 0.1,%
R8643 T12326 T12327 nmod %,DOPA
R8644 T12327 T12330 nmod DOPA,buffer
R8645 T12328 T12327 nmod L,DOPA
R8646 T12329 T12327 punct -,DOPA
R8647 T12330 T12324 pobj buffer,with
R8648 T12331 T12332 punct (,Sigma
R8649 T12332 T12327 parataxis Sigma,DOPA
R8650 T12333 T12332 punct ", ",Sigma
R8651 T12334 T12335 compound St.,Louis
R8652 T12335 T12332 npadvmod Louis,Sigma
R8653 T12336 T12332 punct ", ",Sigma
R8654 T12337 T12332 npadvmod Missouri,Sigma
R8655 T12338 T12332 punct ", ",Sigma
R8656 T12339 T12340 compound United,States
R8657 T12340 T12332 npadvmod States,Sigma
R8658 T12341 T12332 punct ),Sigma
R8659 T12342 T12327 punct ", ",DOPA
R8660 T12343 T12344 nummod 0.1,M
R8661 T12344 T12345 compound M,phosphate
R8662 T12345 T12327 appos phosphate,DOPA
R8663 T12346 T12345 compound sodium,phosphate
R8664 T12347 T12330 punct (,buffer
R8665 T12348 T12330 npadvmod pH,buffer
R8666 T12349 T12348 nummod 6.8,pH
R8667 T12350 T12330 punct ),buffer
R8668 T12351 T12330 prep for,buffer
R8669 T12352 T12353 nummod 5,h
R8670 T12353 T12351 pobj h,for
R8671 T12354 T12330 prep at,buffer
R8672 T12355 T12356 nummod 37,°C
R8673 T12356 T12354 pobj °C,at
R8674 T12357 T12330 prep in,buffer
R8675 T12358 T12359 det the,dark
R8676 T12359 T12357 pobj dark,in
R8677 T12360 T12323 punct ", ",stained
R8678 T12361 T12323 advcl changing,stained
R8679 T12362 T12363 det the,solution
R8680 T12363 T12361 dobj solution,changing
R8681 T12364 T12363 compound staining,solution
R8682 T12365 T12361 prep after,changing
R8683 T12366 T12367 nummod 1,h
R8684 T12367 T12365 pobj h,after
R8685 T12368 T12278 punct .,split
R8686 T12370 T12371 det The,samples
R8687 T12371 T12372 nsubjpass samples,fixed
R8688 T12373 T12372 auxpass were,fixed
R8689 T12374 T12372 advmod then,fixed
R8690 T12375 T12372 advmod overnight,fixed
R8691 T12376 T12372 punct ", ",fixed
R8692 T12377 T12372 conj dehydrated,fixed
R8693 T12378 T12377 punct ", ",dehydrated
R8694 T12379 T12377 cc and,dehydrated
R8695 T12380 T12377 conj mounted,dehydrated
R8696 T12381 T12372 punct .,fixed
R8697 T12383 T12384 det This,method
R8698 T12384 T12385 nsubj method,is
R8699 T12386 T12385 acomp sufficient,is
R8700 T12387 T12388 aux to,stain
R8701 T12388 T12386 xcomp stain,sufficient
R8702 T12389 T12390 amod interfollicular,melanocytes
R8703 T12390 T12388 dobj melanocytes,stain
R8704 T12391 T12388 prep without,stain
R8705 T12392 T12391 pcomp creating,without
R8706 T12393 T12394 det a,background
R8707 T12394 T12392 dobj background,creating
R8708 T12395 T12394 amod high,background
R8709 T12396 T12385 punct .,is
R8710 T12398 T12399 det The,fixative
R8711 T12399 T12400 nsubj fixative,was
R8712 T12401 T12399 acl used,fixative
R8713 T12402 T12400 advmod always,was
R8714 T12403 T12404 nummod 4,%
R8715 T12404 T12405 compound %,paraformaldehyde
R8716 T12405 T12400 attr paraformaldehyde,was
R8717 T12406 T12400 punct .,was
R8718 T12538 T12539 amod Positional,cloning
R8719 T12541 T12542 det A,map
R8720 T12542 T12546 nsubjpass map,generated
R8721 T12543 T12544 amod high,resolution
R8722 T12544 T12542 compound resolution,map
R8723 T12545 T12544 punct -,resolution
R8724 T12547 T12542 prep for,map
R8725 T12548 T12547 pobj deH,for
R8726 T12549 T12546 auxpass was,generated
R8727 T12550 T12546 prep from,generated
R8728 T12551 T12552 det an,intercross
R8729 T12552 T12550 pobj intercross,from
R8730 T12553 T12552 amod intersubspecific,intercross
R8731 T12554 T12552 prep between,intercross
R8732 T12555 T12556 nmod deH,deH
R8733 T12556 T12558 nmod deH,mice
R8734 T12557 T12556 punct /,deH
R8735 T12558 T12554 pobj mice,between
R8736 T12559 T12556 cc and,deH
R8737 T12560 T12561 compound CAST,Ei
R8738 T12561 T12556 conj Ei,deH
R8739 T12562 T12561 punct /,Ei
R8740 T12563 T12546 punct .,generated
R8741 T12565 T12566 nsubj We,localized
R8742 T12567 T12566 advmod initially,localized
R8743 T12568 T12566 dobj deH,localized
R8744 T12569 T12566 prep to,localized
R8745 T12570 T12571 det a,interval
R8746 T12571 T12569 pobj interval,to
R8747 T12572 T12573 nummod 1,cM
R8748 T12573 T12571 compound cM,interval
R8749 T12574 T12571 prep between,interval
R8750 T12575 T12574 pobj D3Mit233,between
R8751 T12576 T12575 cc and,D3Mit233
R8752 T12577 T12575 conj D3Mit11,D3Mit233
R8753 T12578 T12566 punct .,localized
R8754 T12580 T12581 compound F2,animals
R8755 T12581 T12582 nsubjpass animals,tested
R8756 T12583 T12581 acl carrying,animals
R8757 T12584 T12585 amod recombinant,chromosomes
R8758 T12585 T12583 dobj chromosomes,carrying
R8759 T12586 T12585 prep between,chromosomes
R8760 T12587 T12588 det these,markers
R8761 T12588 T12586 pobj markers,between
R8762 T12589 T12590 poss whose,genotype
R8763 T12590 T12591 dep genotype,was
R8764 T12591 T12581 relcl was,animals
R8765 T12592 T12591 prep at,was
R8766 T12593 T12592 pobj de,at
R8767 T12594 T12591 acomp indeterminate,was
R8768 T12595 T12596 punct (,deH
R8769 T12596 T12591 parataxis deH,was
R8770 T12597 T12596 punct /,deH
R8771 T12598 T12596 punct +,deH
R8772 T12599 T12596 cc or,deH
R8773 T12600 T12601 punct +,+
R8774 T12601 T12596 conj +,deH
R8775 T12602 T12601 punct /,+
R8776 T12603 T12596 punct ),deH
R8777 T12604 T12582 auxpass were,tested
R8778 T12605 T12582 dep progeny,tested
R8779 T12606 T12582 punct -,tested
R8780 T12607 T12582 prep by,tested
R8781 T12608 T12607 pcomp crossing,by
R8782 T12609 T12608 prep to,crossing
R8783 T12610 T12611 compound deH,deH
R8784 T12611 T12613 compound deH,animals
R8785 T12612 T12611 punct /,deH
R8786 T12613 T12609 pobj animals,to
R8787 T12614 T12582 punct .,tested
R8788 T12616 T12617 amod Further,mapping
R8789 T12617 T12619 nsubj mapping,established
R8790 T12618 T12617 amod genetic,mapping
R8791 T12619 T12620 ccomp established,used
R8792 T12621 T12622 det a,region
R8793 T12622 T12619 dobj region,established
R8794 T12623 T12622 amod minimal,region
R8795 T12624 T12622 prep of,region
R8796 T12625 T12626 nummod 0.1,cM
R8797 T12626 T12624 pobj cM,of
R8798 T12627 T12622 prep between,region
R8799 T12628 T12627 pobj D3Mit213,between
R8800 T12629 T12628 cc and,D3Mit213
R8801 T12630 T12628 conj 16.MMHAP32FLF1,D3Mit213
R8802 T12631 T12620 punct ;,used
R8803 T12632 T12633 det these,markers
R8804 T12633 T12620 nsubjpass markers,used
R8805 T12634 T12620 auxpass were,used
R8806 T12635 T12636 aux to,initiate
R8807 T12636 T12620 advcl initiate,used
R8808 T12637 T12636 dobj construction,initiate
R8809 T12638 T12637 prep of,construction
R8810 T12639 T12640 det a,map
R8811 T12640 T12638 pobj map,of
R8812 T12641 T12640 amod physical,map
R8813 T12642 T12637 prep with,construction
R8814 T12643 T12644 nmod BAC,clones
R8815 T12644 T12642 pobj clones,with
R8816 T12645 T12644 amod genomic,clones
R8817 T12646 T12647 punct (,Genetics
R8818 T12647 T12636 parataxis Genetics,initiate
R8819 T12648 T12647 compound Research,Genetics
R8820 T12649 T12647 punct ", ",Genetics
R8821 T12650 T12647 npadvmod Huntsville,Genetics
R8822 T12651 T12647 punct ", ",Genetics
R8823 T12652 T12647 npadvmod Alabama,Genetics
R8824 T12653 T12647 punct ", ",Genetics
R8825 T12654 T12655 compound United,States
R8826 T12655 T12647 npadvmod States,Genetics
R8827 T12656 T12647 punct ", ",Genetics
R8828 T12657 T12647 cc and,Genetics
R8829 T12658 T12659 compound Genome,Systems
R8830 T12659 T12647 conj Systems,Genetics
R8831 T12660 T12659 punct ", ",Systems
R8832 T12661 T12662 compound St.,Louis
R8833 T12662 T12659 npadvmod Louis,Systems
R8834 T12663 T12659 punct ", ",Systems
R8835 T12664 T12659 npadvmod Missouri,Systems
R8836 T12665 T12659 punct ", ",Systems
R8837 T12666 T12667 compound United,States
R8838 T12667 T12659 npadvmod States,Systems
R8839 T12668 T12647 punct ),Genetics
R8840 T12669 T12620 punct .,used
R8841 T12671 T12672 compound End,sequence
R8842 T12672 T12673 nsubjpass sequence,used
R8843 T12674 T12672 prep from,sequence
R8844 T12675 T12676 det those,BACs
R8845 T12676 T12674 pobj BACs,from
R8846 T12677 T12673 auxpass was,used
R8847 T12678 T12679 aux to,develop
R8848 T12679 T12673 advcl develop,used
R8849 T12680 T12681 compound SSCP,markers
R8850 T12681 T12679 dobj markers,develop
R8851 T12682 T12681 appos M1,markers
R8852 T12683 T12682 prep to,M1
R8853 T12684 T12683 pobj M3,to
R8854 T12685 T12679 punct ", ",develop
R8855 T12686 T12687 mark as,depicted
R8856 T12687 T12679 advcl depicted,develop
R8857 T12688 T12687 prep in,depicted
R8858 T12689 T12688 pobj Figure,in
R8859 T12690 T12689 nummod 3,Figure
R8860 T12691 T12679 punct ", ",develop
R8861 T12692 T12679 cc and,develop
R8862 T12693 T12694 aux to,establish
R8863 T12694 T12679 conj establish,develop
R8864 T12695 T12696 det a,interval
R8865 T12696 T12694 dobj interval,establish
R8866 T12697 T12696 amod minimal,interval
R8867 T12698 T12696 amod physical,interval
R8868 T12699 T12696 prep of,interval
R8869 T12700 T12701 nummod 1.4,Mb
R8870 T12701 T12699 pobj Mb,of
R8871 T12702 T12673 punct .,used
R8872 T12704 T12705 compound Primer,pairs
R8873 T12705 T12706 nsubj pairs,were
R8874 T12707 T12705 acl used,pairs
R8875 T12708 T12706 attr TTCCCTCCAATAAGTTCTGGGTACC,were
R8876 T12709 T12708 cc and,TTCCCTCCAATAAGTTCTGGGTACC
R8877 T12710 T12708 conj AAGCTTGCTGCTCTGGATTCCATTTGTAG,TTCCCTCCAATAAGTTCTGGGTACC
R8878 T12711 T12708 prep for,TTCCCTCCAATAAGTTCTGGGTACC
R8879 T12712 T12711 pobj M1,for
R8880 T12713 T12708 punct ", ",TTCCCTCCAATAAGTTCTGGGTACC
R8881 T12714 T12708 conj CCTTCATTTTTTTTTCAAGTAAAA,TTCCCTCCAATAAGTTCTGGGTACC
R8882 T12715 T12714 cc and,CCTTCATTTTTTTTTCAAGTAAAA
R8883 T12716 T12714 conj AAGCTTGGCTTAGTCCCAGTGGC,CCTTCATTTTTTTTTCAAGTAAAA
R8884 T12717 T12714 prep for,CCTTCATTTTTTTTTCAAGTAAAA
R8885 T12718 T12717 pobj M2,for
R8886 T12719 T12714 punct ", ",CCTTCATTTTTTTTTCAAGTAAAA
R8887 T12720 T12714 conj CCTCCAGGAAGATCTACTAGGCAC,CCTTCATTTTTTTTTCAAGTAAAA
R8888 T12721 T12720 cc and,CCTCCAGGAAGATCTACTAGGCAC
R8889 T12722 T12720 conj ATGGAAAAAAAAAAGTAAGATTGAAAG,CCTCCAGGAAGATCTACTAGGCAC
R8890 T12723 T12720 prep for,CCTCCAGGAAGATCTACTAGGCAC
R8891 T12724 T12723 pobj M3,for
R8892 T12725 T12720 punct ", ",CCTCCAGGAAGATCTACTAGGCAC
R8893 T12726 T12720 cc and,CCTCCAGGAAGATCTACTAGGCAC
R8894 T12727 T12720 conj TGGTTATCGATCTGTGGACCATTC,CCTCCAGGAAGATCTACTAGGCAC
R8895 T12728 T12727 cc and,TGGTTATCGATCTGTGGACCATTC
R8896 T12729 T12727 conj AAGTGAGAGAGCAGGATGGACCAC,TGGTTATCGATCTGTGGACCATTC
R8897 T12730 T12727 prep for,TGGTTATCGATCTGTGGACCATTC
R8898 T12731 T12730 pobj M4,for
R8899 T12732 T12733 punct (,represents
R8900 T12733 T12731 parataxis represents,M4
R8901 T12734 T12735 det the,marker
R8902 T12735 T12733 nsubj marker,represents
R8903 T12736 T12735 compound M4,marker
R8904 T12737 T12738 compound STS,16.MMHAP32FLF1
R8905 T12738 T12733 dobj 16.MMHAP32FLF1,represents
R8906 T12739 T12733 punct ),represents
R8907 T12740 T12706 punct .,were
R8908 T12742 T12743 amod Genomic,sequence
R8909 T12743 T12744 nsubjpass sequence,obtained
R8910 T12744 T12748 ccomp obtained,contains
R8911 T12745 T12743 cc and,sequence
R8912 T12746 T12743 conj annotations,sequence
R8913 T12747 T12744 auxpass were,obtained
R8914 T12749 T12744 prep from,obtained
R8915 T12750 T12751 det the,Browser
R8916 T12751 T12754 nmod Browser,mm3
R8917 T12752 T12751 nmod UCSC,Browser
R8918 T12753 T12751 nmod Genome,Browser
R8919 T12754 T12749 pobj mm3,from
R8920 T12755 T12756 nmod February,assembly
R8921 T12756 T12754 compound assembly,mm3
R8922 T12757 T12755 nummod 2003,February
R8923 T12758 T12754 compound version,mm3
R8924 T12759 T12760 punct (,http://genome.ucsc.edu
R8925 T12760 T12754 parataxis http://genome.ucsc.edu,mm3
R8926 T12761 T12760 punct ),http://genome.ucsc.edu
R8927 T12762 T12748 punct ;,contains
R8928 T12763 T12764 det the,interval
R8929 T12764 T12748 nsubj interval,contains
R8930 T12765 T12766 nummod 1.4,Mb
R8931 T12766 T12764 compound Mb,interval
R8932 T12767 T12764 prep between,interval
R8933 T12768 T12767 pobj M1,between
R8934 T12769 T12768 cc and,M1
R8935 T12770 T12768 conj M4,M1
R8936 T12771 T12772 nummod eight,genes
R8937 T12772 T12748 dobj genes,contains
R8938 T12773 T12772 punct : ,genes
R8939 T12774 T12775 nummod four,isomerases
R8940 T12775 T12772 appos isomerases,genes
R8941 T12776 T12775 compound hydroxysteroid,isomerases
R8942 T12777 T12775 compound dehydrogenase,isomerases
R8943 T12778 T12775 punct ", ",isomerases
R8944 T12779 T12775 appos Hsd3b3,isomerases
R8945 T12780 T12779 punct ", ",Hsd3b3
R8946 T12781 T12779 conj Hsd3b2,Hsd3b3
R8947 T12782 T12781 punct ", ",Hsd3b2
R8948 T12783 T12781 conj Hsd3b6,Hsd3b2
R8949 T12784 T12783 punct ", ",Hsd3b6
R8950 T12785 T12783 cc and,Hsd3b6
R8951 T12786 T12783 conj Hsd3b1,Hsd3b6
R8952 T12787 T12775 punct ;,isomerases
R8953 T12788 T12789 det an,oxidase
R8954 T12789 T12775 conj oxidase,isomerases
R8955 T12790 T12789 compound hydroacid,oxidase
R8956 T12791 T12789 punct ", ",oxidase
R8957 T12792 T12789 appos Hao3,oxidase
R8958 T12793 T12789 punct ;,oxidase
R8959 T12794 T12795 det a,synthetase
R8960 T12795 T12789 conj synthetase,oxidase
R8961 T12796 T12797 compound tryptophanyl,tRNA
R8962 T12797 T12795 compound tRNA,synthetase
R8963 T12798 T12797 punct -,tRNA
R8964 T12799 T12795 punct ", ",synthetase
R8965 T12800 T12795 appos Wars2,synthetase
R8966 T12801 T12795 punct ;,synthetase
R8967 T12802 T12803 det a,gene
R8968 T12803 T12795 conj gene,synthetase
R8969 T12804 T12805 compound T,box
R8970 T12805 T12803 compound box,gene
R8971 T12806 T12805 punct -,box
R8972 T12807 T12803 punct ", ",gene
R8973 T12808 T12803 appos Tbx15,gene
R8974 T12809 T12803 punct ;,gene
R8975 T12810 T12803 cc and,gene
R8976 T12811 T12812 det a,gene
R8977 T12812 T12803 conj gene,gene
R8978 T12813 T12812 amod novel,gene
R8979 T12814 T12812 punct ", ",gene
R8980 T12815 T12812 appos 4931427F14Rik,gene
R8981 T12816 T12748 punct .,contains
R8982 T12818 T12819 prep In,correspond
R8983 T12820 T12821 det the,sequence
R8984 T12821 T12818 pobj sequence,In
R8985 T12822 T12821 compound genome,sequence
R8986 T12823 T12819 punct ", ",correspond
R8987 T12824 T12825 compound M1,primers
R8988 T12825 T12819 nsubj primers,correspond
R8989 T12826 T12819 prep to,correspond
R8990 T12827 T12826 pobj AGGCCTCCAATAAGTTCTGGGTACC,to
R8991 T12828 T12827 cc and,AGGCCTCCAATAAGTTCTGGGTACC
R8992 T12829 T12827 conj AAGCTTGCTCTCTGGATTCCATTTGTAG,AGGCCTCCAATAAGTTCTGGGTACC
R8993 T12830 T12819 punct ", ",correspond
R8994 T12831 T12832 det the,primer
R8995 T12832 T12835 nsubj primer,corresponds
R8996 T12833 T12832 nmod M2,primer
R8997 T12834 T12832 amod reverse,primer
R8998 T12835 T12819 conj corresponds,correspond
R8999 T12836 T12835 prep to,corresponds
R9000 T12837 T12836 pobj AAGCTTGGCTTTAGTCCCAGTGGGC,to
R9001 T12838 T12835 punct ", ",corresponds
R9002 T12839 T12835 cc and,corresponds
R9003 T12840 T12841 det the,primers
R9004 T12841 T12843 nsubj primers,correspond
R9005 T12842 T12841 compound M3,primers
R9006 T12843 T12835 conj correspond,corresponds
R9007 T12844 T12843 prep to,correspond
R9008 T12845 T12844 pobj CCTCCAGGAAGAATCTACTAGGCAC,to
R9009 T12846 T12845 cc and,CCTCCAGGAAGAATCTACTAGGCAC
R9010 T12847 T12845 conj AATGAAAAAAAAAAAAGTAAGATTGAAAG,CCTCCAGGAAGAATCTACTAGGCAC
R9011 T12848 T12819 punct .,correspond
R9012 T12850 T12851 amod Minor,differences
R9013 T12851 T12852 nsubj differences,represent
R9014 T12853 T12851 prep among,differences
R9015 T12854 T12855 det the,sequences
R9016 T12855 T12853 pobj sequences,among
R9017 T12856 T12855 prep of,sequences
R9018 T12857 T12858 det the,primers
R9019 T12858 T12856 pobj primers,of
R9020 T12859 T12860 nsubj we,obtained
R9021 T12860 T12858 advcl obtained,primers
R9022 T12861 T12860 prep from,obtained
R9023 T12862 T12863 det the,BAC
R9024 T12863 T12861 pobj BAC,from
R9025 T12864 T12863 nmod ends,BAC
R9026 T12865 T12855 cc and,sequences
R9027 T12866 T12867 det the,sequence
R9028 T12867 T12855 conj sequence,sequences
R9029 T12868 T12867 amod public,sequence
R9030 T12869 T12867 compound genome,sequence
R9031 T12870 T12852 aux may,represent
R9032 T12871 T12872 compound strain,differences
R9033 T12872 T12852 dobj differences,represent
R9034 T12873 T12872 cc or,differences
R9035 T12874 T12875 compound sequencing,errors
R9036 T12875 T12872 conj errors,differences
R9037 T12876 T12875 prep on,errors
R9038 T12877 T12878 det the,DNA
R9039 T12878 T12876 pobj DNA,on
R9040 T12879 T12878 compound BAC,DNA
R9041 T12880 T12852 punct .,represent
R9042 T12882 T12883 det A,assay
R9043 T12883 T12886 nsubjpass assay,developed
R9044 T12884 T12883 amod multiplex,assay
R9045 T12885 T12883 amod genotyping,assay
R9046 T12887 T12886 auxpass was,developed
R9047 T12888 T12889 aux to,genotype
R9048 T12889 T12886 advcl genotype,developed
R9049 T12890 T12889 prep for,genotype
R9050 T12891 T12892 det the,deletion
R9051 T12892 T12890 pobj deletion,for
R9052 T12893 T12892 compound deH,deletion
R9053 T12894 T12889 advcl using,genotype
R9054 T12895 T12896 compound primers,GGAGCAGATCCAATTGCTTT
R9055 T12896 T12894 dobj GGAGCAGATCCAATTGCTTT,using
R9056 T12897 T12896 punct ", ",GGAGCAGATCCAATTGCTTT
R9057 T12898 T12896 conj TCCATAGCCCATCTTCACAA,GGAGCAGATCCAATTGCTTT
R9058 T12899 T12898 punct ", ",TCCATAGCCCATCTTCACAA
R9059 T12900 T12898 cc and,TCCATAGCCCATCTTCACAA
R9060 T12901 T12898 conj CATGTCCACTTCTGCTTCCA,TCCATAGCCCATCTTCACAA
R9061 T12902 T12886 punct .,developed
R9062 T12904 T12905 det This,assay
R9063 T12905 T12907 nsubj assay,produces
R9064 T12906 T12905 compound PCR,assay
R9065 T12908 T12909 det a,product
R9066 T12909 T12907 dobj product,produces
R9067 T12910 T12911 nummod 392,bp
R9068 T12911 T12909 compound bp,product
R9069 T12912 T12907 prep from,produces
R9070 T12913 T12914 det the,chromosome
R9071 T12914 T12912 pobj chromosome,from
R9072 T12915 T12914 compound deH,chromosome
R9073 T12916 T12907 cc and,produces
R9074 T12917 T12918 det a,product
R9075 T12918 T12907 conj product,produces
R9076 T12919 T12920 nummod 595,bp
R9077 T12920 T12918 compound bp,product
R9078 T12921 T12918 prep from,product
R9079 T12922 T12923 det the,chromosome
R9080 T12923 T12921 pobj chromosome,from
R9081 T12924 T12923 amod nonmutant,chromosome
R9082 T12925 T12907 punct .,produces
R9083 T12974 T12975 compound Gene,targeting
R9084 T12977 T12978 det A,allele
R9085 T12978 T12980 nsubjpass allele,constructed
R9086 T12979 T12978 amod targeted,allele
R9087 T12981 T12978 prep of,allele
R9088 T12982 T12981 pobj Tbx15,of
R9089 T12983 T12980 auxpass was,constructed
R9090 T12984 T12980 advcl using,constructed
R9091 T12985 T12986 det the,approach
R9092 T12986 T12984 dobj approach,using
R9093 T12987 T12986 amod same,approach
R9094 T12988 T12986 acl described,approach
R9095 T12989 T12988 prep in,described
R9096 T12990 T12989 pobj Russ,in
R9097 T12991 T12992 advmod et,al.
R9098 T12992 T12990 advmod al.,Russ
R9099 T12993 T12990 punct (,Russ
R9100 T12994 T12990 npadvmod 2000,Russ
R9101 T12995 T12990 punct ),Russ
R9102 T12996 T12980 punct .,constructed
R9103 T12998 T12999 prep In,inserted
R9104 T13000 T12998 pobj brief,In
R9105 T13001 T12999 punct ", ",inserted
R9106 T13002 T13003 det an,cassette
R9107 T13003 T12999 nsubjpass cassette,inserted
R9108 T13004 T13005 compound IRES,neo
R9109 T13005 T13003 compound neo,cassette
R9110 T13006 T13005 punct -,neo
R9111 T13007 T13005 compound LacZ,neo
R9112 T13008 T13005 punct -,neo
R9113 T13009 T13003 prep with,cassette
R9114 T13010 T13011 nummod 5,arms
R9115 T13011 T13009 pobj arms,with
R9116 T13012 T13010 punct ′,5
R9117 T13013 T13010 cc and,5
R9118 T13014 T13010 conj 3,5
R9119 T13015 T13014 punct ′,3
R9120 T13016 T13011 compound homology,arms
R9121 T13017 T13011 prep of,arms
R9122 T13018 T13019 nummod 3.5,kb
R9123 T13019 T13017 pobj kb,of
R9124 T13020 T13019 cc and,kb
R9125 T13021 T13022 nummod 1.8,kb
R9126 T13022 T13019 conj kb,kb
R9127 T13023 T12999 auxpass was,inserted
R9128 T13024 T12999 prep into,inserted
R9129 T13025 T13026 det a,site
R9130 T13026 T13024 pobj site,into
R9131 T13027 T13026 amod unique,site
R9132 T13028 T13026 compound BamHI,site
R9133 T13029 T13030 dep that,lies
R9134 T13030 T13026 relcl lies,site
R9135 T13031 T13032 nummod 479,nucleotides
R9136 T13032 T13033 npadvmod nucleotides,downstream
R9137 T13033 T13030 advmod downstream,lies
R9138 T13034 T13033 prep of,downstream
R9139 T13035 T13036 det the,site
R9140 T13036 T13034 pobj site,of
R9141 T13037 T13036 amod transcriptional,site
R9142 T13038 T13036 compound initiation,site
R9143 T13039 T13030 punct (,lies
R9144 T13040 T13030 advcl relative,lies
R9145 T13041 T13040 prep to,relative
R9146 T13042 T13043 det the,sequence
R9147 T13043 T13041 pobj sequence,to
R9148 T13044 T13043 compound mRNA,sequence
R9149 T13045 T13030 punct ),lies
R9150 T13046 T13030 prep in,lies
R9151 T13047 T13046 pobj exon,in
R9152 T13048 T13047 nummod 3,exon
R9153 T13049 T12999 punct .,inserted
R9154 T13051 T13052 amod Positive,clones
R9155 T13052 T13054 nsubjpass clones,injected
R9156 T13053 T13052 compound ES,clones
R9157 T13055 T13054 auxpass were,injected
R9158 T13056 T13054 prep into,injected
R9159 T13057 T13058 compound B6,blastocysts
R9160 T13058 T13056 pobj blastocysts,into
R9161 T13059 T13054 punct ", ",injected
R9162 T13060 T13054 cc and,injected
R9163 T13061 T13062 amod chimeric,founders
R9164 T13062 T13063 nsubj founders,crossed
R9165 T13063 T13054 conj crossed,injected
R9166 T13064 T13063 prep to,crossed
R9167 T13065 T13066 preconj either,mice
R9168 T13066 T13064 pobj mice,to
R9169 T13067 T13066 compound B6,mice
R9170 T13068 T13064 cc or,to
R9171 T13069 T13064 conj to,to
R9172 T13070 T13071 nmod deH,animals
R9173 T13071 T13069 pobj animals,to
R9174 T13072 T13070 punct /,deH
R9175 T13073 T13070 punct +,deH
R9176 T13074 T13063 punct .,crossed
R9177 T13131 T13132 advmod In,situ
R9178 T13132 T13133 amod situ,hybridization
R9179 T13135 T13136 advmod In,situ
R9180 T13136 T13137 amod situ,hybridization
R9181 T13137 T13138 nsubjpass hybridization,carried
R9182 T13139 T13138 auxpass was,carried
R9183 T13140 T13138 prt out,carried
R9184 T13141 T13138 prep on,carried
R9185 T13142 T13143 nummod 12,μm
R9186 T13143 T13145 compound μm,sections
R9187 T13144 T13143 punct -,μm
R9188 T13145 T13141 pobj sections,on
R9189 T13146 T13145 compound paraffin,sections
R9190 T13147 T13138 advcl using,carried
R9191 T13148 T13149 npadvmod digoxigenin,labeled
R9192 T13149 T13151 amod labeled,probes
R9193 T13150 T13149 punct -,labeled
R9194 T13151 T13147 dobj probes,using
R9195 T13152 T13151 compound RNA,probes
R9196 T13153 T13154 punct (,Diagnostics
R9197 T13154 T13151 parataxis Diagnostics,probes
R9198 T13155 T13154 compound Roche,Diagnostics
R9199 T13156 T13154 punct ", ",Diagnostics
R9200 T13157 T13154 npadvmod Indianapolis,Diagnostics
R9201 T13158 T13154 punct ", ",Diagnostics
R9202 T13159 T13154 npadvmod Indiana,Diagnostics
R9203 T13160 T13154 punct ", ",Diagnostics
R9204 T13161 T13162 compound United,States
R9205 T13162 T13154 npadvmod States,Diagnostics
R9206 T13163 T13154 punct ),Diagnostics
R9207 T13164 T13147 prep according,using
R9208 T13165 T13164 prep to,according
R9209 T13166 T13167 amod standard,protocols
R9210 T13167 T13165 pobj protocols,to
R9211 T13168 T13169 punct (,Wilkinson
R9212 T13169 T13167 meta Wilkinson,protocols
R9213 T13170 T13169 cc and,Wilkinson
R9214 T13171 T13169 conj Nieto,Wilkinson
R9215 T13172 T13171 nummod 1993,Nieto
R9216 T13173 T13171 punct ),Nieto
R9217 T13174 T13138 punct .,carried
R9218 T13176 T13177 nsubjpass Embryos,obtained
R9219 T13178 T13176 cc and,Embryos
R9220 T13179 T13180 amod postnatal,samples
R9221 T13180 T13176 conj samples,Embryos
R9222 T13181 T13180 compound skin,samples
R9223 T13182 T13177 auxpass were,obtained
R9224 T13183 T13177 prep from,obtained
R9225 T13184 T13183 pobj intercrosses,from
R9226 T13185 T13184 prep of,intercrosses
R9227 T13186 T13187 nmod deH,mice
R9228 T13187 T13185 pobj mice,of
R9229 T13188 T13186 punct /,deH
R9230 T13189 T13186 punct +,deH
R9231 T13190 T13177 punct .,obtained
R9232 T13192 T13193 nsubjpass Embryos,fixed
R9233 T13193 T13198 ccomp fixed,fixed
R9234 T13194 T13192 npadvmod E13.5,Embryos
R9235 T13195 T13194 cc or,E13.5
R9236 T13196 T13194 conj younger,E13.5
R9237 T13197 T13193 auxpass were,fixed
R9238 T13199 T13193 prep for,fixed
R9239 T13200 T13201 nummod 24,h
R9240 T13201 T13199 pobj h,for
R9241 T13202 T13198 punct ;,fixed
R9242 T13203 T13198 nsubjpass those,fixed
R9243 T13204 T13203 amod older,those
R9244 T13205 T13204 prep than,older
R9245 T13206 T13205 pobj E13.5,than
R9246 T13207 T13203 cc and,those
R9247 T13208 T13209 amod postnatal,skin
R9248 T13209 T13203 conj skin,those
R9249 T13210 T13198 auxpass were,fixed
R9250 T13211 T13198 prep for,fixed
R9251 T13212 T13213 quantmod 36,48
R9252 T13213 T13215 nummod 48,h
R9253 T13214 T13213 punct –,48
R9254 T13215 T13211 pobj h,for
R9255 T13216 T13198 advmod prior,fixed
R9256 T13217 T13216 prep to,prior
R9257 T13218 T13217 pobj embedding,to
R9258 T13219 T13198 punct .,fixed
R9259 T13221 T13222 det The,probe
R9260 T13222 T13224 nsubjpass probe,generated
R9261 T13223 T13222 compound Tbx15,probe
R9262 T13225 T13224 auxpass was,generated
R9263 T13226 T13224 prep by,generated
R9264 T13227 T13228 compound RT,PCR
R9265 T13228 T13226 pobj PCR,by
R9266 T13229 T13228 punct –,PCR
R9267 T13230 T13224 advcl using,generated
R9268 T13231 T13232 compound primers,GGCGGCTAAAATGAGTGAAC
R9269 T13232 T13230 dobj GGCGGCTAAAATGAGTGAAC,using
R9270 T13233 T13232 cc and,GGCGGCTAAAATGAGTGAAC
R9271 T13234 T13232 conj TGCCTGCTTTGGTGATGAT,GGCGGCTAAAATGAGTGAAC
R9272 T13235 T13236 punct (,corresponds
R9273 T13236 T13230 parataxis corresponds,using
R9274 T13237 T13236 prep to,corresponds
R9275 T13238 T13237 pobj exons,to
R9276 T13239 T13238 nummod 1,exons
R9277 T13240 T13238 cc and,exons
R9278 T13241 T13238 conj 2,exons
R9279 T13242 T13236 punct ),corresponds
R9280 T13243 T13224 punct ", ",generated
R9281 T13244 T13224 cc and,generated
R9282 T13245 T13246 det the,probe
R9283 T13246 T13248 nsubjpass probe,generated
R9284 T13247 T13246 compound En1,probe
R9285 T13248 T13224 conj generated,generated
R9286 T13249 T13248 auxpass was,generated
R9287 T13250 T13248 prep by,generated
R9288 T13251 T13250 pobj PCR,by
R9289 T13252 T13248 prep from,generated
R9290 T13253 T13254 amod genomic,DNA
R9291 T13254 T13252 pobj DNA,from
R9292 T13255 T13248 advcl using,generated
R9293 T13256 T13257 compound primers,ACGCACCAGGAAGCTAAAGA
R9294 T13257 T13255 dobj ACGCACCAGGAAGCTAAAGA,using
R9295 T13258 T13257 cc and,ACGCACCAGGAAGCTAAAGA
R9296 T13259 T13257 conj AGCAACGAAAACGAAACTGG,ACGCACCAGGAAGCTAAAGA
R9297 T13260 T13261 punct (,located
R9298 T13261 T13255 parataxis located,using
R9299 T13262 T13261 prep in,located
R9300 T13263 T13264 det the,exon
R9301 T13264 T13262 pobj exon,in
R9302 T13265 T13264 amod last,exon
R9303 T13266 T13261 punct ),located
R9304 T13267 T13248 punct .,generated
R9305 T13269 T13270 det The,probe
R9306 T13270 T13272 nsubj probe,corresponds
R9307 T13271 T13270 compound Agouti,probe
R9308 T13273 T13272 prep to,corresponds
R9309 T13274 T13275 det the,sequence
R9310 T13275 T13273 pobj sequence,to
R9311 T13276 T13277 npadvmod protein,coding
R9312 T13277 T13275 amod coding,sequence
R9313 T13278 T13277 punct -,coding
R9314 T13279 T13272 punct .,corresponds
R9315 T13332 T13333 amod Embryonic,transplantation
R9316 T13334 T13333 compound skin,transplantation
R9317 T13336 T13337 punct (,dissected
R9318 T13338 T13339 nmod BTBR,embryos
R9319 T13339 T13337 nsubjpass embryos,dissected
R9320 T13340 T13338 punct -,BTBR
R9321 T13341 T13342 compound at,at
R9322 T13342 T13338 appos at,BTBR
R9323 T13343 T13342 punct /,at
R9324 T13344 T13338 punct ×,BTBR
R9325 T13345 T13338 appos B6,BTBR
R9326 T13346 T13345 punct -,B6
R9327 T13347 T13348 compound a,a
R9328 T13348 T13345 appos a,B6
R9329 T13349 T13348 punct /,a
R9330 T13350 T13339 punct ),embryos
R9331 T13351 T13339 compound F1,embryos
R9332 T13352 T13339 prep at,embryos
R9333 T13353 T13352 pobj E12.5,at
R9334 T13354 T13337 auxpass were,dissected
R9335 T13355 T13337 prep in,dissected
R9336 T13356 T13357 amod sterile,solution
R9337 T13357 T13355 pobj solution,in
R9338 T13358 T13357 poss Tyrode,solution
R9339 T13359 T13358 case 's,Tyrode
R9340 T13360 T13337 punct ", ",dissected
R9341 T13361 T13337 cc and,dissected
R9342 T13362 T13363 amod embryonic,skin
R9343 T13363 T13364 nsubjpass skin,divided
R9344 T13364 T13337 conj divided,dissected
R9345 T13365 T13364 auxpass was,divided
R9346 T13366 T13364 prep into,divided
R9347 T13367 T13368 amod dorsal,pieces
R9348 T13368 T13366 pobj pieces,into
R9349 T13369 T13367 punct ", ",dorsal
R9350 T13370 T13367 conj flank,dorsal
R9351 T13371 T13370 punct ", ",flank
R9352 T13372 T13370 cc and,flank
R9353 T13373 T13370 conj ventral,flank
R9354 T13374 T13368 punct ", ",pieces
R9355 T13375 T13376 advmod each,mm2
R9356 T13376 T13368 appos mm2,pieces
R9357 T13377 T13378 compound 1,2
R9358 T13378 T13376 nummod 2,mm2
R9359 T13379 T13378 punct –,2
R9360 T13380 T13376 prep in,mm2
R9361 T13381 T13380 pobj size,in
R9362 T13382 T13364 punct ", ",divided
R9363 T13383 T13384 mark as,shown
R9364 T13384 T13364 advcl shown,divided
R9365 T13385 T13384 prep in,shown
R9366 T13386 T13385 pobj Figure,in
R9367 T13387 T13386 nummod 7,Figure
R9368 T13388 T13364 punct .,divided
R9369 T13390 T13391 compound Skin,fragments
R9370 T13391 T13392 nsubjpass fragments,grafted
R9371 T13393 T13392 auxpass were,grafted
R9372 T13394 T13392 prep to,grafted
R9373 T13395 T13396 det the,testes
R9374 T13396 T13394 pobj testes,to
R9375 T13397 T13396 prep of,testes
R9376 T13398 T13399 amod congenic,animals
R9377 T13399 T13397 pobj animals,of
R9378 T13400 T13401 mark as,follows
R9379 T13401 T13392 advcl follows,grafted
R9380 T13402 T13392 punct .,grafted
R9381 T13404 T13405 prep After,made
R9382 T13406 T13404 pobj anesthetization,After
R9383 T13407 T13406 prep with,anesthetization
R9384 T13408 T13409 nummod 2.5,%
R9385 T13409 T13410 compound %,Avertin
R9386 T13410 T13407 pobj Avertin,with
R9387 T13411 T13405 punct ", ",made
R9388 T13412 T13413 det a,incision
R9389 T13413 T13405 nsubjpass incision,made
R9390 T13414 T13415 nummod 1.5,cm
R9391 T13415 T13413 compound cm,incision
R9392 T13416 T13415 punct -,cm
R9393 T13417 T13413 prep in,incision
R9394 T13418 T13419 det the,skin
R9395 T13419 T13417 pobj skin,in
R9396 T13420 T13419 cc and,skin
R9397 T13421 T13422 compound body,wall
R9398 T13422 T13419 conj wall,skin
R9399 T13423 T13405 auxpass was,made
R9400 T13424 T13405 prep at,made
R9401 T13425 T13426 det a,point
R9402 T13426 T13424 pobj point,at
R9403 T13427 T13426 amod level,point
R9404 T13428 T13427 prep with,level
R9405 T13429 T13430 det the,top
R9406 T13430 T13428 pobj top,with
R9407 T13431 T13430 prep of,top
R9408 T13432 T13433 det the,limbs
R9409 T13433 T13431 pobj limbs,of
R9410 T13434 T13405 punct .,made
R9411 T13436 T13437 det The,pads
R9412 T13437 T13439 nsubjpass pads,pulled
R9413 T13438 T13437 compound fat,pads
R9414 T13440 T13439 auxpass were,pulled
R9415 T13441 T13439 prt out,pulled
R9416 T13442 T13439 cc and,pulled
R9417 T13443 T13439 conj laid,pulled
R9418 T13444 T13443 prep on,laid
R9419 T13445 T13446 det the,outside
R9420 T13446 T13444 pobj outside,on
R9421 T13447 T13446 prep of,outside
R9422 T13448 T13449 det the,body
R9423 T13449 T13447 pobj body,of
R9424 T13450 T13443 punct ", ",laid
R9425 T13451 T13443 advcl exposing,laid
R9426 T13452 T13453 det the,testes
R9427 T13453 T13451 dobj testes,exposing
R9428 T13454 T13439 punct .,pulled
R9429 T13456 T13457 nsubjpass Forceps,used
R9430 T13458 T13457 auxpass were,used
R9431 T13459 T13460 aux to,introduce
R9432 T13460 T13457 advcl introduce,used
R9433 T13461 T13462 det a,hole
R9434 T13462 T13460 dobj hole,introduce
R9435 T13463 T13462 amod small,hole
R9436 T13464 T13462 prep in,hole
R9437 T13465 T13466 det the,capsule
R9438 T13466 T13464 pobj capsule,in
R9439 T13467 T13466 compound testis,capsule
R9440 T13468 T13469 prep through,inserted
R9441 T13469 T13462 relcl inserted,hole
R9442 T13470 T13468 pobj which,through
R9443 T13471 T13472 det a,piece
R9444 T13472 T13469 nsubjpass piece,inserted
R9445 T13473 T13472 prep of,piece
R9446 T13474 T13475 amod dissected,skin
R9447 T13475 T13473 pobj skin,of
R9448 T13476 T13475 amod embryonic,skin
R9449 T13477 T13469 auxpass was,inserted
R9450 T13478 T13457 punct ", ",used
R9451 T13479 T13480 det the,testes
R9452 T13480 T13481 nsubjpass testes,replaced
R9453 T13481 T13457 conj replaced,used
R9454 T13482 T13481 auxpass were,replaced
R9455 T13483 T13481 advmod then,replaced
R9456 T13484 T13481 prep into,replaced
R9457 T13485 T13486 det the,cavity
R9458 T13486 T13484 pobj cavity,into
R9459 T13487 T13486 amod abdominal,cavity
R9460 T13488 T13481 punct ", ",replaced
R9461 T13489 T13481 cc and,replaced
R9462 T13490 T13491 det the,wound
R9463 T13491 T13492 nsubjpass wound,closed
R9464 T13492 T13481 conj closed,replaced
R9465 T13493 T13492 auxpass was,closed
R9466 T13494 T13492 prep in,closed
R9467 T13495 T13496 preconj both,wall
R9468 T13496 T13494 pobj wall,in
R9469 T13497 T13496 det the,wall
R9470 T13498 T13496 compound body,wall
R9471 T13499 T13496 cc and,wall
R9472 T13500 T13501 det the,skin
R9473 T13501 T13496 conj skin,wall
R9474 T13502 T13492 punct .,closed
R9475 T13504 T13505 prep After,sacrificed
R9476 T13506 T13507 nummod 21,days
R9477 T13507 T13504 pobj days,After
R9478 T13508 T13505 punct ", ",sacrificed
R9479 T13509 T13505 nsubjpass mice,sacrificed
R9480 T13510 T13511 dep that,received
R9481 T13511 T13509 relcl received,mice
R9482 T13512 T13511 dobj grafts,received
R9483 T13513 T13505 auxpass were,sacrificed
R9484 T13514 T13505 cc and,sacrificed
R9485 T13515 T13516 det the,hair
R9486 T13516 T13518 nsubjpass hair,dissected
R9487 T13517 T13516 amod resulting,hair
R9488 T13518 T13505 conj dissected,sacrificed
R9489 T13519 T13518 auxpass was,dissected
R9490 T13520 T13518 prep from,dissected
R9491 T13521 T13522 det the,testes
R9492 T13522 T13520 pobj testes,from
R9493 T13523 T13518 cc and,dissected
R9494 T13524 T13518 conj examined,dissected
R9495 T13525 T13505 punct .,sacrificed
R9498 T13570 T13571 dep Fate,mapping
R9499 T13572 T13571 punct -,mapping
R9500 T13573 T13574 det the,frontier
R9501 T13574 T13571 dobj frontier,mapping
R9502 T13575 T13574 amod lateral,frontier
R9503 T13576 T13574 amod somitic,frontier
R9504 T13578 T13579 det The,transgene
R9505 T13579 T13583 nsubjpass transgene,expressed
R9506 T13580 T13581 compound Hoxb6,Cre
R9507 T13581 T13579 compound Cre,transgene
R9508 T13582 T13581 punct -,Cre
R9509 T13584 T13579 acl described,transgene
R9510 T13585 T13584 agent by,described
R9511 T13586 T13585 pobj Kuehn,by
R9512 T13587 T13586 cc and,Kuehn
R9513 T13588 T13586 conj colleagues,Kuehn
R9514 T13589 T13590 punct (,Lowe
R9515 T13590 T13584 meta Lowe,described
R9516 T13591 T13590 nmod et,Lowe
R9517 T13592 T13590 nmod al.,Lowe
R9518 T13593 T13590 nummod 2000,Lowe
R9519 T13594 T13590 punct ),Lowe
R9520 T13595 T13583 auxpass is,expressed
R9521 T13596 T13583 prep in,expressed
R9522 T13597 T13598 det the,plate
R9523 T13598 T13596 pobj plate,in
R9524 T13599 T13598 amod lateral,plate
R9525 T13600 T13598 cc but,plate
R9526 T13601 T13600 neg not,but
R9527 T13602 T13603 det the,mesoderm
R9528 T13603 T13598 conj mesoderm,plate
R9529 T13604 T13603 amod somitic,mesoderm
R9530 T13605 T13598 prep of,plate
R9531 T13606 T13607 det the,trunk
R9532 T13607 T13605 pobj trunk,of
R9533 T13608 T13583 punct ", ",expressed
R9534 T13609 T13583 advcl beginning,expressed
R9535 T13610 T13609 prep at,beginning
R9536 T13611 T13610 pobj E9.5,at
R9537 T13612 T13583 punct .,expressed
R9538 T13614 T13615 nsubjpass Animals,used
R9539 T13616 T13617 advmod doubly,heterozygous
R9540 T13617 T13614 amod heterozygous,Animals
R9541 T13618 T13617 prep for,heterozygous
R9542 T13619 T13620 det this,transgene
R9543 T13620 T13618 pobj transgene,for
R9544 T13621 T13620 cc and,transgene
R9545 T13622 T13623 det the,gene
R9546 T13623 T13620 conj gene,transgene
R9547 T13624 T13623 compound R26R,gene
R9548 T13625 T13623 compound reporter,gene
R9549 T13626 T13615 auxpass were,used
R9550 T13627 T13615 prep as,used
R9551 T13628 T13629 det a,source
R9552 T13629 T13627 pobj source,as
R9553 T13630 T13629 prep of,source
R9554 T13631 T13632 amod whole,skin
R9555 T13632 T13630 pobj skin,of
R9556 T13633 T13615 prep at,used
R9557 T13634 T13633 pobj P1.5,at
R9558 T13635 T13634 cc or,P1.5
R9559 T13636 T13634 conj P4.5,P1.5
R9560 T13637 T13615 punct .,used
R9561 T13639 T13640 compound Skin,sections
R9562 T13640 T13641 nsubjpass sections,prepared
R9563 T13642 T13640 amod parallel,sections
R9564 T13643 T13642 prep to,parallel
R9565 T13644 T13645 det the,axis
R9566 T13645 T13643 pobj axis,to
R9567 T13646 T13645 amod dorsoventral,axis
R9568 T13647 T13641 auxpass were,prepared
R9569 T13648 T13641 prep with,prepared
R9570 T13649 T13650 det a,incision
R9571 T13650 T13648 pobj incision,with
R9572 T13651 T13650 amod single,incision
R9573 T13652 T13650 prep along,incision
R9574 T13653 T13654 det the,midline
R9575 T13654 T13652 pobj midline,along
R9576 T13655 T13654 amod ventral,midline
R9577 T13656 T13641 cc and,prepared
R9578 T13657 T13641 conj stained,prepared
R9579 T13658 T13657 prep for,stained
R9580 T13659 T13660 compound β,galactosidase
R9581 T13660 T13662 compound galactosidase,activity
R9582 T13661 T13660 punct -,galactosidase
R9583 T13662 T13658 pobj activity,for
R9584 T13663 T13657 advcl using,stained
R9585 T13664 T13665 amod standard,protocols
R9586 T13665 T13663 dobj protocols,using
R9587 T13666 T13657 prep at,stained
R9588 T13667 T13668 compound room,temperature
R9589 T13668 T13666 pobj temperature,at
R9590 T13669 T13641 punct .,prepared
R9591 T13671 T13672 det The,sample
R9592 T13672 T13674 nsubjpass sample,stained
R9593 T13673 T13672 compound P1.5,sample
R9594 T13675 T13674 auxpass was,stained
R9595 T13676 T13674 advmod overnight,stained
R9596 T13677 T13674 cc and,stained
R9597 T13678 T13679 det the,samples
R9598 T13679 T13681 nsubjpass samples,stained
R9599 T13680 T13679 compound P4.5,samples
R9600 T13681 T13674 conj stained,stained
R9601 T13682 T13681 auxpass were,stained
R9602 T13683 T13681 prep for,stained
R9603 T13684 T13685 nummod 5.5,h
R9604 T13685 T13683 pobj h,for
R9605 T13686 T13681 punct .,stained
R9606 T13688 T13689 amod Similar,sections
R9607 T13689 T13692 nsubjpass sections,prepared
R9608 T13690 T13689 amod nonstained,sections
R9609 T13691 T13689 compound skin,sections
R9610 T13693 T13692 auxpass were,prepared
R9611 T13694 T13692 prep from,prepared
R9612 T13695 T13694 pobj animals,from
R9613 T13696 T13695 acl carrying,animals
R9614 T13697 T13698 det the,allele
R9615 T13698 T13696 dobj allele,carrying
R9616 T13699 T13698 compound at,allele
R9617 T13700 T13692 punct .,prepared
R9618 T13702 T13703 nsubjpass Images,aligned
R9619 T13704 T13702 prep of,Images
R9620 T13705 T13706 det the,fragments
R9621 T13706 T13704 pobj fragments,of
R9622 T13707 T13706 amod different,fragments
R9623 T13708 T13706 compound skin,fragments
R9624 T13709 T13703 auxpass were,aligned
R9625 T13710 T13703 cc and,aligned
R9626 T13711 T13703 conj scaled,aligned
R9627 T13712 T13703 punct ", ",aligned
R9628 T13713 T13703 cc and,aligned
R9629 T13714 T13715 det the,position
R9630 T13715 T13717 nsubjpass position,measured
R9631 T13716 T13715 amod relative,position
R9632 T13717 T13703 conj measured,aligned
R9633 T13718 T13715 prep of,position
R9634 T13719 T13720 det the,plate
R9635 T13720 T13718 pobj plate,of
R9636 T13721 T13722 npadvmod somite,lateral
R9637 T13722 T13720 amod lateral,plate
R9638 T13723 T13722 punct –,lateral
R9639 T13724 T13720 cc and,plate
R9640 T13725 T13726 det the,boundaries
R9641 T13726 T13720 conj boundaries,plate
R9642 T13727 T13726 compound pigmentation,boundaries
R9643 T13728 T13717 auxpass were,measured
R9644 T13729 T13717 advcl using,measured
R9645 T13730 T13729 dobj ImageJ,using
R9646 T13731 T13717 punct .,measured