Materials and Methods

Mice
All mice were obtained originally from The Jackson Laboratory (Bar Harbor, Maine, United States), except the BA strain (Stanford Veterinary Services Center, Stanford, California, United States), Hoxb6-Cre transgenic mice (kindly provided by M. Kuehn of the National Institutes of Health, Bethesda, Maryland, United States), mice carrying the R26R lacZ reporter allele (kindly provided by P. Soriano, Fred Hutchinson Cancer Research Center, Seattle, Washington, United States), and C57BL/6J (B6) ae/ae mice (kindly provided by L. Siracusa, Jefferson Medical College, Philadelphia, Pennsylvania, United States). The deH mutation arose in the 1960s in Harwell, probably on the BN strain background (C. Beechey, personal communication). We obtained deH on a B6/EiC3H background, introduced the at allele from the BTBR strain, and have maintained the line as a mixed deH/+ × deH/+ intercross stock with periodic outcrossing to BTBR or B6. For timed matings, the morning of the plug was considered E0.5. Postnatally, the day of birth was considered to be P0.5.

Phenotypic analysis
For measurements of hair length and color, the entire interlimb region of skin was first dissected with a single incision at the dorsal midline and preserved with powdered sodium bicarbonate. Slices 2–2.5 mm in width were then prepared parallel to the dorsoventral axis, hair length boundaries determined from electronic images with Adobe Photoshop (San Jose, California, United States), and measurements obtained using ImageJ (National Institutes of Health). This approach samples awls and auchenes, because they are much thicker and therefore visually more predominant than zigzag underhairs. To assess dorsoventral variation in hair-type distribution, several hundred hairs were plucked from the middorsum or midventrum of 8-wk-old male BA strain animals, then sorted and categorized using a dissection microscope. No attempt was made to distinguish between awls and auchenes.
For skin histology, 12 μm sections from paraffin-embedded tissue were stained with hematoxylin and eosin. For DOPA staining, the dermis and epidermis were split after 3 h of incubation in 2 M sodium bromide at 37°C (this preparation causes most hair follicles to remain with the dermis), individually fixed for 1 h, then rinsed and stained with 0.1% L-DOPA (Sigma, St. Louis, Missouri, United States), 0.1 M sodium phosphate buffer (pH 6.8) for 5 h at 37°C in the dark, changing the staining solution after 1 h. The samples were then fixed overnight, dehydrated, and mounted. This method is sufficient to stain interfollicular melanocytes without creating a high background. The fixative used was always 4% paraformaldehyde.

Positional cloning
A high-resolution map for deH was generated from an intersubspecific intercross between deH/deH and CAST/Ei mice. We initially localized deH to a 1 cM interval between D3Mit233 and D3Mit11. F2 animals carrying recombinant chromosomes between these markers whose genotype at de was indeterminate (deH/+ or +/+) were progeny-tested by crossing to deH/deH animals. Further genetic mapping established a minimal region of 0.1 cM between D3Mit213 and 16.MMHAP32FLF1; these markers were used to initiate construction of a physical map with BAC genomic clones (Research Genetics, Huntsville, Alabama, United States, and Genome Systems, St. Louis, Missouri, United States). End sequence from those BACs was used to develop SSCP markers M1 to M3, as depicted in Figure 3, and to establish a minimal physical interval of 1.4 Mb. Primer pairs used were TTCCCTCCAATAAGTTCTGGGTACC and AAGCTTGCTGCTCTGGATTCCATTTGTAG for M1, CCTTCATTTTTTTTTCAAGTAAAA and AAGCTTGGCTTAGTCCCAGTGGC for M2, CCTCCAGGAAGATCTACTAGGCAC and ATGGAAAAAAAAAAGTAAGATTGAAAG for M3, and TGGTTATCGATCTGTGGACCATTC and AAGTGAGAGAGCAGGATGGACCAC for M4 (the M4 marker represents STS 16.MMHAP32FLF1). Genomic sequence and annotations were obtained from the UCSC Genome Browser February 2003 assembly version mm3 (http://genome.ucsc.edu); the 1.4 Mb interval between M1 and M4 contains eight genes: four hydroxysteroid dehydrogenase isomerases, Hsd3b3, Hsd3b2, Hsd3b6, and Hsd3b1; an hydroacid oxidase, Hao3; a tryptophanyl-tRNA synthetase, Wars2; a T-box gene, Tbx15; and a novel gene, 4931427F14Rik. In the genome sequence, M1 primers correspond to AGGCCTCCAATAAGTTCTGGGTACC and AAGCTTGCTCTCTGGATTCCATTTGTAG, the M2 reverse primer corresponds to AAGCTTGGCTTTAGTCCCAGTGGGC, and the M3 primers correspond to CCTCCAGGAAGAATCTACTAGGCAC and AATGAAAAAAAAAAAAGTAAGATTGAAAG. Minor differences among the sequences of the primers we obtained from the BAC ends and the public genome sequence may represent strain differences or sequencing errors on the BAC DNA.
A multiplex genotyping assay was developed to genotype for the deH deletion using primers GGAGCAGATCCAATTGCTTT, TCCATAGCCCATCTTCACAA, and CATGTCCACTTCTGCTTCCA. This PCR assay produces a 392 bp product from the deH chromosome and a 595 bp product from the nonmutant chromosome.

Gene targeting
A targeted allele of Tbx15 was constructed using the same approach described in Russ et al. (2000). In brief, an IRES-LacZ-neo cassette with 5′ and 3′ homology arms of 3.5 kb and 1.8 kb was inserted into a unique BamHI site that lies 479 nucleotides downstream of the transcriptional initiation site (relative to the mRNA sequence) in exon 3. Positive ES clones were injected into B6 blastocysts, and chimeric founders crossed to either B6 mice or to deH/+ animals.

In situ hybridization
In situ hybridization was carried out on 12-μm paraffin sections using digoxigenin-labeled RNA probes (Roche Diagnostics, Indianapolis, Indiana, United States) according to standard protocols (Wilkinson and Nieto 1993). Embryos and postnatal skin samples were obtained from intercrosses of deH/+ mice. Embryos E13.5 or younger were fixed for 24 h; those older than E13.5 and postnatal skin were fixed for 36–48 h prior to embedding. The Tbx15 probe was generated by RT–PCR using primers GGCGGCTAAAATGAGTGAAC and TGCCTGCTTTGGTGATGAT (corresponds to exons 1 and 2), and the En1 probe was generated by PCR from genomic DNA using primers ACGCACCAGGAAGCTAAAGA and AGCAACGAAAACGAAACTGG (located in the last exon). The Agouti probe corresponds to the protein-coding sequence.

Embryonic skin transplantation
(BTBR-at/at × B6-a/a)F1 embryos at E12.5 were dissected in sterile Tyrode's solution, and embryonic skin was divided into dorsal, flank, and ventral pieces, each 1–2 mm2 in size, as shown in Figure 7. Skin fragments were grafted to the testes of congenic animals as follows. After anesthetization with 2.5% Avertin, a 1.5-cm incision in the skin and body wall was made at a point level with the top of the limbs. The fat pads were pulled out and laid on the outside of the body, exposing the testes. Forceps were used to introduce a small hole in the testis capsule through which a piece of dissected embryonic skin was inserted, the testes were then replaced into the abdominal cavity, and the wound was closed in both the body wall and the skin. After 21 days, mice that received grafts were sacrificed and the resulting hair was dissected from the testes and examined.

Fate-mapping the lateral somitic frontier
The Hoxb6-Cre transgene described by Kuehn and colleagues (Lowe et al. 2000) is expressed in the lateral plate but not the somitic mesoderm of the trunk, beginning at E9.5. Animals doubly heterozygous for this transgene and the R26R reporter gene were used as a source of whole skin at P1.5 or P4.5. Skin sections parallel to the dorsoventral axis were prepared with a single incision along the ventral midline and stained for β-galactosidase activity using standard protocols at room temperature. The P1.5 sample was stained overnight and the P4.5 samples were stained for 5.5 h. Similar nonstained skin sections were prepared from animals carrying the at allele. Images of the different skin fragments were aligned and scaled, and the relative position of the somite–lateral plate and the pigmentation boundaries were measured using ImageJ.