| Id |
Subject |
Object |
Predicate |
Lexical cue |
| T8157 |
0-6 |
NN |
denotes |
Trip13 |
| T8159 |
7-10 |
VBD |
denotes |
was |
| T8158 |
11-20 |
VBN |
denotes |
amplified |
| T8160 |
21-25 |
IN |
denotes |
from |
| T8161 |
26-33 |
NNS |
denotes |
samples |
| T8162 |
34-36 |
IN |
denotes |
of |
| T8163 |
37-45 |
NNP |
denotes |
Clontech |
| T8165 |
45-47 |
POS |
denotes |
's |
| T8166 |
48-53 |
NN |
denotes |
Mouse |
| T8167 |
54-62 |
JJ |
denotes |
Multiple |
| T8168 |
63-69 |
NN |
denotes |
Tissue |
| T8169 |
70-74 |
NN |
denotes |
cDNA |
| T8164 |
75-80 |
NN |
denotes |
Panel |
| T8170 |
81-82 |
CD |
denotes |
I |
| T8171 |
83-84 |
-LRB- |
denotes |
( |
| T8172 |
84-107 |
NN |
denotes |
http://www.clontech.com |
| T8173 |
107-108 |
-RRB- |
denotes |
) |
| T8174 |
108-110 |
, |
denotes |
, |
| T8175 |
110-115 |
VBG |
denotes |
using |
| T8176 |
116-119 |
DT |
denotes |
the |
| T8178 |
120-129 |
VBG |
denotes |
following |
| T8177 |
130-137 |
NNS |
denotes |
primers |
| T8179 |
137-139 |
: |
denotes |
: |
| T8180 |
139-140 |
CD |
denotes |
5 |
| T8182 |
140-141 |
SYM |
denotes |
′ |
| T8183 |
141-142 |
HYPH |
denotes |
- |
| T8181 |
142-162 |
NN |
denotes |
GCACCATTGCACTTCACATC |
| T8184 |
162-163 |
HYPH |
denotes |
- |
| T8185 |
163-164 |
CD |
denotes |
3 |
| T8186 |
164-165 |
SYM |
denotes |
′ |
| T8187 |
166-167 |
-LRB- |
denotes |
( |
| T8188 |
167-171 |
NN |
denotes |
TRP3 |
| T8190 |
171-172 |
HYPH |
denotes |
- |
| T8189 |
172-174 |
NN |
denotes |
6F |
| T8191 |
174-175 |
-RRB- |
denotes |
) |
| T8192 |
176-179 |
CC |
denotes |
and |
| T8193 |
180-181 |
CD |
denotes |
5 |
| T8195 |
181-182 |
SYM |
denotes |
′ |
| T8196 |
182-183 |
HYPH |
denotes |
- |
| T8194 |
183-203 |
NN |
denotes |
TGACCATCAGACTGTCGAGC |
| T8197 |
203-204 |
HYPH |
denotes |
- |
| T8198 |
204-205 |
CD |
denotes |
3 |
| T8199 |
205-206 |
SYM |
denotes |
′ |
| T8200 |
207-208 |
-LRB- |
denotes |
( |
| T8201 |
208-212 |
NN |
denotes |
TRP3 |
| T8203 |
212-213 |
HYPH |
denotes |
- |
| T8202 |
213-215 |
NN |
denotes |
6R |
| T8204 |
215-216 |
-RRB- |
denotes |
) |
| T8205 |
216-217 |
. |
denotes |
. |
| T8206 |
217-309 |
sentence |
denotes |
These primers correspond to exons 3 and 6, respectively, and amplify a 330-bp cDNA product. |
| T8207 |
218-223 |
DT |
denotes |
These |
| T8208 |
224-231 |
NNS |
denotes |
primers |
| T8209 |
232-242 |
VBP |
denotes |
correspond |
| T8210 |
243-245 |
IN |
denotes |
to |
| T8211 |
246-251 |
NNS |
denotes |
exons |
| T8212 |
252-253 |
CD |
denotes |
3 |
| T8213 |
254-257 |
CC |
denotes |
and |
| T8214 |
258-259 |
CD |
denotes |
6 |
| T8215 |
259-261 |
, |
denotes |
, |
| T8216 |
261-273 |
RB |
denotes |
respectively |
| T8217 |
273-275 |
, |
denotes |
, |
| T8218 |
275-278 |
CC |
denotes |
and |
| T8219 |
279-286 |
VB |
denotes |
amplify |
| T8220 |
287-288 |
DT |
denotes |
a |
| T8222 |
289-292 |
CD |
denotes |
330 |
| T8224 |
292-293 |
HYPH |
denotes |
- |
| T8223 |
293-295 |
NN |
denotes |
bp |
| T8225 |
296-300 |
NN |
denotes |
cDNA |
| T8221 |
301-308 |
NN |
denotes |
product |
| T8226 |
308-309 |
. |
denotes |
. |
| T8227 |
309-389 |
sentence |
denotes |
The cDNAs in this panel are equalized to allow quantitative analysis by RT-PCR. |
| T8228 |
310-313 |
DT |
denotes |
The |
| T8229 |
314-319 |
NNS |
denotes |
cDNAs |
| T8231 |
320-322 |
IN |
denotes |
in |
| T8232 |
323-327 |
DT |
denotes |
this |
| T8233 |
328-333 |
NN |
denotes |
panel |
| T8234 |
334-337 |
VBP |
denotes |
are |
| T8230 |
338-347 |
VBN |
denotes |
equalized |
| T8235 |
348-350 |
TO |
denotes |
to |
| T8236 |
351-356 |
VB |
denotes |
allow |
| T8237 |
357-369 |
JJ |
denotes |
quantitative |
| T8238 |
370-378 |
NN |
denotes |
analysis |
| T8239 |
379-381 |
IN |
denotes |
by |
| T8240 |
382-384 |
NN |
denotes |
RT |
| T8242 |
384-385 |
HYPH |
denotes |
- |
| T8241 |
385-388 |
NN |
denotes |
PCR |
| T8243 |
388-389 |
. |
denotes |
. |
| R5469 |
T8157 |
T8158 |
nsubjpass |
Trip13,amplified |
| R5470 |
T8159 |
T8158 |
auxpass |
was,amplified |
| R5471 |
T8160 |
T8158 |
prep |
from,amplified |
| R5472 |
T8161 |
T8160 |
pobj |
samples,from |
| R5473 |
T8162 |
T8161 |
prep |
of,samples |
| R5474 |
T8163 |
T8164 |
poss |
Clontech,Panel |
| R5475 |
T8164 |
T8162 |
pobj |
Panel,of |
| R5476 |
T8165 |
T8163 |
case |
's,Clontech |
| R5477 |
T8166 |
T8164 |
nmod |
Mouse,Panel |
| R5478 |
T8167 |
T8168 |
amod |
Multiple,Tissue |
| R5479 |
T8168 |
T8164 |
compound |
Tissue,Panel |
| R5480 |
T8169 |
T8164 |
compound |
cDNA,Panel |
| R5481 |
T8170 |
T8164 |
nummod |
I,Panel |
| R5482 |
T8171 |
T8172 |
punct |
(,http://www.clontech.com |
| R5483 |
T8172 |
T8161 |
parataxis |
http://www.clontech.com,samples |
| R5484 |
T8173 |
T8172 |
punct |
),http://www.clontech.com |
| R5485 |
T8174 |
T8158 |
punct |
", ",amplified |
| R5486 |
T8175 |
T8158 |
advcl |
using,amplified |
| R5487 |
T8176 |
T8177 |
det |
the,primers |
| R5488 |
T8177 |
T8175 |
dobj |
primers,using |
| R5489 |
T8178 |
T8177 |
amod |
following,primers |
| R5490 |
T8179 |
T8177 |
punct |
: ,primers |
| R5491 |
T8180 |
T8181 |
nummod |
5,GCACCATTGCACTTCACATC |
| R5492 |
T8181 |
T8177 |
appos |
GCACCATTGCACTTCACATC,primers |
| R5493 |
T8182 |
T8180 |
punct |
′,5 |
| R5494 |
T8183 |
T8181 |
punct |
-,GCACCATTGCACTTCACATC |
| R5495 |
T8184 |
T8181 |
punct |
-,GCACCATTGCACTTCACATC |
| R5496 |
T8185 |
T8181 |
nummod |
3,GCACCATTGCACTTCACATC |
| R5497 |
T8186 |
T8181 |
punct |
′,GCACCATTGCACTTCACATC |
| R5498 |
T8187 |
T8181 |
punct |
(,GCACCATTGCACTTCACATC |
| R5499 |
T8188 |
T8189 |
compound |
TRP3,6F |
| R5500 |
T8189 |
T8181 |
appos |
6F,GCACCATTGCACTTCACATC |
| R5501 |
T8190 |
T8189 |
punct |
-,6F |
| R5502 |
T8191 |
T8181 |
punct |
),GCACCATTGCACTTCACATC |
| R5503 |
T8192 |
T8181 |
cc |
and,GCACCATTGCACTTCACATC |
| R5504 |
T8193 |
T8194 |
nummod |
5,TGACCATCAGACTGTCGAGC |
| R5505 |
T8194 |
T8181 |
conj |
TGACCATCAGACTGTCGAGC,GCACCATTGCACTTCACATC |
| R5506 |
T8195 |
T8193 |
punct |
′,5 |
| R5507 |
T8196 |
T8194 |
punct |
-,TGACCATCAGACTGTCGAGC |
| R5508 |
T8197 |
T8194 |
punct |
-,TGACCATCAGACTGTCGAGC |
| R5509 |
T8198 |
T8194 |
nummod |
3,TGACCATCAGACTGTCGAGC |
| R5510 |
T8199 |
T8194 |
punct |
′,TGACCATCAGACTGTCGAGC |
| R5511 |
T8200 |
T8194 |
punct |
(,TGACCATCAGACTGTCGAGC |
| R5512 |
T8201 |
T8202 |
compound |
TRP3,6R |
| R5513 |
T8202 |
T8194 |
appos |
6R,TGACCATCAGACTGTCGAGC |
| R5514 |
T8203 |
T8202 |
punct |
-,6R |
| R5515 |
T8204 |
T8158 |
punct |
),amplified |
| R5516 |
T8205 |
T8158 |
punct |
.,amplified |
| R5517 |
T8207 |
T8208 |
det |
These,primers |
| R5518 |
T8208 |
T8209 |
nsubj |
primers,correspond |
| R5519 |
T8210 |
T8209 |
prep |
to,correspond |
| R5520 |
T8211 |
T8212 |
nmod |
exons,3 |
| R5521 |
T8212 |
T8210 |
pobj |
3,to |
| R5522 |
T8213 |
T8212 |
cc |
and,3 |
| R5523 |
T8214 |
T8212 |
conj |
6,3 |
| R5524 |
T8215 |
T8209 |
punct |
", ",correspond |
| R5525 |
T8216 |
T8209 |
advmod |
respectively,correspond |
| R5526 |
T8217 |
T8209 |
punct |
", ",correspond |
| R5527 |
T8218 |
T8209 |
cc |
and,correspond |
| R5528 |
T8219 |
T8209 |
conj |
amplify,correspond |
| R5529 |
T8220 |
T8221 |
det |
a,product |
| R5530 |
T8221 |
T8219 |
dobj |
product,amplify |
| R5531 |
T8222 |
T8223 |
nummod |
330,bp |
| R5532 |
T8223 |
T8221 |
compound |
bp,product |
| R5533 |
T8224 |
T8223 |
punct |
-,bp |
| R5534 |
T8225 |
T8221 |
compound |
cDNA,product |
| R5535 |
T8226 |
T8209 |
punct |
.,correspond |
| R5536 |
T8228 |
T8229 |
det |
The,cDNAs |
| R5537 |
T8229 |
T8230 |
nsubjpass |
cDNAs,equalized |
| R5538 |
T8231 |
T8229 |
prep |
in,cDNAs |
| R5539 |
T8232 |
T8233 |
det |
this,panel |
| R5540 |
T8233 |
T8231 |
pobj |
panel,in |
| R5541 |
T8234 |
T8230 |
auxpass |
are,equalized |
| R5542 |
T8235 |
T8236 |
aux |
to,allow |
| R5543 |
T8236 |
T8230 |
advcl |
allow,equalized |
| R5544 |
T8237 |
T8238 |
amod |
quantitative,analysis |
| R5545 |
T8238 |
T8236 |
dobj |
analysis,allow |
| R5546 |
T8239 |
T8238 |
prep |
by,analysis |
| R5547 |
T8240 |
T8241 |
compound |
RT,PCR |
| R5548 |
T8241 |
T8239 |
pobj |
PCR,by |
| R5549 |
T8242 |
T8241 |
punct |
-,PCR |
| R5550 |
T8243 |
T8230 |
punct |
.,equalized |
