Id |
Subject |
Object |
Predicate |
Lexical cue |
T11076 |
0-5 |
NN |
denotes |
Sam68 |
T11078 |
6-10 |
RB |
denotes |
down |
T11079 |
10-11 |
HYPH |
denotes |
- |
T11077 |
11-21 |
NN |
denotes |
regulation |
T11080 |
22-27 |
VBG |
denotes |
using |
T11081 |
28-35 |
NN |
denotes |
Sam68sh |
T11082 |
35-36 |
. |
denotes |
. |
T11083 |
36-121 |
sentence |
denotes |
To generate an shRNA, 64-base duplex DNA nucleotides were purchased from Invitrogen. |
T11084 |
37-39 |
TO |
denotes |
To |
T11085 |
40-48 |
VB |
denotes |
generate |
T11087 |
49-51 |
DT |
denotes |
an |
T11088 |
52-57 |
NN |
denotes |
shRNA |
T11089 |
57-59 |
, |
denotes |
, |
T11090 |
59-61 |
CD |
denotes |
64 |
T11092 |
61-62 |
HYPH |
denotes |
- |
T11091 |
62-66 |
NN |
denotes |
base |
T11094 |
67-73 |
NN |
denotes |
duplex |
T11095 |
74-77 |
NN |
denotes |
DNA |
T11093 |
78-89 |
NNS |
denotes |
nucleotides |
T11096 |
90-94 |
VBD |
denotes |
were |
T11086 |
95-104 |
VBN |
denotes |
purchased |
T11097 |
105-109 |
IN |
denotes |
from |
T11098 |
110-120 |
NNP |
denotes |
Invitrogen |
T11099 |
120-121 |
. |
denotes |
. |
T11100 |
121-257 |
sentence |
denotes |
This fragment comprised 19 base residues specific to mouse Sam68 (GATCCCC AAGATGACGAGGAGAATTATTCAAGAGA TAATTCTCCTCGTCATCTT TTTTTGGAAA). |
T11101 |
122-126 |
DT |
denotes |
This |
T11102 |
127-135 |
NN |
denotes |
fragment |
T11103 |
136-145 |
VBD |
denotes |
comprised |
T11104 |
146-148 |
CD |
denotes |
19 |
T11106 |
149-153 |
NN |
denotes |
base |
T11105 |
154-162 |
NNS |
denotes |
residues |
T11107 |
163-171 |
JJ |
denotes |
specific |
T11108 |
172-174 |
IN |
denotes |
to |
T11109 |
175-180 |
NN |
denotes |
mouse |
T11110 |
181-186 |
NN |
denotes |
Sam68 |
T11111 |
187-188 |
-LRB- |
denotes |
( |
T11113 |
188-195 |
NN |
denotes |
GATCCCC |
T11114 |
196-224 |
NN |
denotes |
AAGATGACGAGGAGAATTATTCAAGAGA |
T11115 |
225-244 |
NN |
denotes |
TAATTCTCCTCGTCATCTT |
T11112 |
245-255 |
NN |
denotes |
TTTTTGGAAA |
T11116 |
255-256 |
-RRB- |
denotes |
) |
T11117 |
256-257 |
. |
denotes |
. |
T11118 |
257-351 |
sentence |
denotes |
This fragment was cloned into pSUPER retro (OligoEngine, Seattle, Washington, United States). |
T11119 |
258-262 |
DT |
denotes |
This |
T11120 |
263-271 |
NN |
denotes |
fragment |
T11122 |
272-275 |
VBD |
denotes |
was |
T11121 |
276-282 |
VBN |
denotes |
cloned |
T11123 |
283-287 |
IN |
denotes |
into |
T11124 |
288-294 |
NNP |
denotes |
pSUPER |
T11125 |
295-300 |
NNP |
denotes |
retro |
T11126 |
301-302 |
-LRB- |
denotes |
( |
T11127 |
302-313 |
NNP |
denotes |
OligoEngine |
T11128 |
313-315 |
, |
denotes |
, |
T11129 |
315-322 |
NNP |
denotes |
Seattle |
T11130 |
322-324 |
, |
denotes |
, |
T11131 |
324-334 |
NNP |
denotes |
Washington |
T11132 |
334-336 |
, |
denotes |
, |
T11133 |
336-342 |
NNP |
denotes |
United |
T11134 |
343-349 |
NNP |
denotes |
States |
T11135 |
349-350 |
-RRB- |
denotes |
) |
T11136 |
350-351 |
. |
denotes |
. |
T11137 |
351-460 |
sentence |
denotes |
Transfections were performed using LipofectAMINE Plus (Invitrogen) with cloned DNA fragment or empty vector. |
T11138 |
352-365 |
NNS |
denotes |
Transfections |
T11140 |
366-370 |
VBD |
denotes |
were |
T11139 |
371-380 |
VBN |
denotes |
performed |
T11141 |
381-386 |
VBG |
denotes |
using |
T11142 |
387-400 |
NNP |
denotes |
LipofectAMINE |
T11143 |
401-405 |
NNP |
denotes |
Plus |
T11144 |
406-407 |
-LRB- |
denotes |
( |
T11145 |
407-417 |
NNP |
denotes |
Invitrogen |
T11146 |
417-418 |
-RRB- |
denotes |
) |
T11147 |
419-423 |
IN |
denotes |
with |
T11148 |
424-430 |
VBN |
denotes |
cloned |
T11150 |
431-434 |
NN |
denotes |
DNA |
T11149 |
435-443 |
NN |
denotes |
fragment |
T11151 |
444-446 |
CC |
denotes |
or |
T11152 |
447-452 |
JJ |
denotes |
empty |
T11153 |
453-459 |
NN |
denotes |
vector |
T11154 |
459-460 |
. |
denotes |
. |
T11155 |
460-615 |
sentence |
denotes |
At 48 h after transfection, populations were selected for 2.5 μg/ml puromycin and the knockdown observed by immunoblotting with anti-Sam68 (AD1) antibody. |
T11156 |
461-463 |
IN |
denotes |
At |
T11158 |
464-466 |
CD |
denotes |
48 |
T11159 |
467-468 |
NN |
denotes |
h |
T11160 |
469-474 |
IN |
denotes |
after |
T11161 |
475-487 |
NN |
denotes |
transfection |
T11162 |
487-489 |
, |
denotes |
, |
T11163 |
489-500 |
NNS |
denotes |
populations |
T11164 |
501-505 |
VBD |
denotes |
were |
T11157 |
506-514 |
VBN |
denotes |
selected |
T11165 |
515-518 |
IN |
denotes |
for |
T11166 |
519-522 |
CD |
denotes |
2.5 |
T11167 |
523-525 |
NN |
denotes |
μg |
T11169 |
525-526 |
SYM |
denotes |
/ |
T11170 |
526-528 |
NN |
denotes |
ml |
T11168 |
529-538 |
NN |
denotes |
puromycin |
T11171 |
539-542 |
CC |
denotes |
and |
T11172 |
543-546 |
DT |
denotes |
the |
T11173 |
547-556 |
NN |
denotes |
knockdown |
T11174 |
557-565 |
VBN |
denotes |
observed |
T11175 |
566-568 |
IN |
denotes |
by |
T11176 |
569-583 |
VBG |
denotes |
immunoblotting |
T11177 |
584-588 |
IN |
denotes |
with |
T11178 |
589-599 |
JJ |
denotes |
anti-Sam68 |
T11180 |
600-601 |
-LRB- |
denotes |
( |
T11181 |
601-604 |
NN |
denotes |
AD1 |
T11182 |
604-605 |
-RRB- |
denotes |
) |
T11179 |
606-614 |
NN |
denotes |
antibody |
T11183 |
614-615 |
. |
denotes |
. |
R7145 |
T11076 |
T11077 |
nmod |
Sam68,regulation |
R7146 |
T11078 |
T11077 |
advmod |
down,regulation |
R7147 |
T11079 |
T11077 |
punct |
-,regulation |
R7148 |
T11080 |
T11077 |
acl |
using,regulation |
R7149 |
T11081 |
T11080 |
dobj |
Sam68sh,using |
R7150 |
T11082 |
T11077 |
punct |
.,regulation |
R7151 |
T11084 |
T11085 |
aux |
To,generate |
R7152 |
T11085 |
T11086 |
advcl |
generate,purchased |
R7153 |
T11087 |
T11088 |
det |
an,shRNA |
R7154 |
T11088 |
T11085 |
dobj |
shRNA,generate |
R7155 |
T11089 |
T11086 |
punct |
", ",purchased |
R7156 |
T11090 |
T11091 |
nummod |
64,base |
R7157 |
T11091 |
T11093 |
compound |
base,nucleotides |
R7158 |
T11092 |
T11091 |
punct |
-,base |
R7159 |
T11093 |
T11086 |
nsubjpass |
nucleotides,purchased |
R7160 |
T11094 |
T11093 |
compound |
duplex,nucleotides |
R7161 |
T11095 |
T11093 |
compound |
DNA,nucleotides |
R7162 |
T11096 |
T11086 |
auxpass |
were,purchased |
R7163 |
T11097 |
T11086 |
prep |
from,purchased |
R7164 |
T11098 |
T11097 |
pobj |
Invitrogen,from |
R7165 |
T11099 |
T11086 |
punct |
.,purchased |
R7166 |
T11101 |
T11102 |
det |
This,fragment |
R7167 |
T11102 |
T11103 |
nsubj |
fragment,comprised |
R7168 |
T11104 |
T11105 |
nummod |
19,residues |
R7169 |
T11105 |
T11103 |
dobj |
residues,comprised |
R7170 |
T11106 |
T11105 |
compound |
base,residues |
R7171 |
T11107 |
T11105 |
amod |
specific,residues |
R7172 |
T11108 |
T11107 |
prep |
to,specific |
R7173 |
T11109 |
T11110 |
compound |
mouse,Sam68 |
R7174 |
T11110 |
T11108 |
pobj |
Sam68,to |
R7175 |
T11111 |
T11112 |
punct |
(,TTTTTGGAAA |
R7176 |
T11112 |
T11103 |
parataxis |
TTTTTGGAAA,comprised |
R7177 |
T11113 |
T11112 |
compound |
GATCCCC,TTTTTGGAAA |
R7178 |
T11114 |
T11112 |
compound |
AAGATGACGAGGAGAATTATTCAAGAGA,TTTTTGGAAA |
R7179 |
T11115 |
T11112 |
compound |
TAATTCTCCTCGTCATCTT,TTTTTGGAAA |
R7180 |
T11116 |
T11112 |
punct |
),TTTTTGGAAA |
R7181 |
T11117 |
T11103 |
punct |
.,comprised |
R7182 |
T11119 |
T11120 |
det |
This,fragment |
R7183 |
T11120 |
T11121 |
nsubjpass |
fragment,cloned |
R7184 |
T11122 |
T11121 |
auxpass |
was,cloned |
R7185 |
T11123 |
T11121 |
prep |
into,cloned |
R7186 |
T11124 |
T11125 |
compound |
pSUPER,retro |
R7187 |
T11125 |
T11123 |
pobj |
retro,into |
R7188 |
T11126 |
T11127 |
punct |
(,OligoEngine |
R7189 |
T11127 |
T11125 |
parataxis |
OligoEngine,retro |
R7190 |
T11128 |
T11127 |
punct |
", ",OligoEngine |
R7191 |
T11129 |
T11127 |
npadvmod |
Seattle,OligoEngine |
R7192 |
T11130 |
T11127 |
punct |
", ",OligoEngine |
R7193 |
T11131 |
T11127 |
npadvmod |
Washington,OligoEngine |
R7194 |
T11132 |
T11127 |
punct |
", ",OligoEngine |
R7195 |
T11133 |
T11134 |
compound |
United,States |
R7196 |
T11134 |
T11127 |
npadvmod |
States,OligoEngine |
R7197 |
T11135 |
T11127 |
punct |
),OligoEngine |
R7198 |
T11136 |
T11121 |
punct |
.,cloned |
R7199 |
T11138 |
T11139 |
nsubjpass |
Transfections,performed |
R7200 |
T11140 |
T11139 |
auxpass |
were,performed |
R7201 |
T11141 |
T11139 |
advcl |
using,performed |
R7202 |
T11142 |
T11143 |
compound |
LipofectAMINE,Plus |
R7203 |
T11143 |
T11141 |
dobj |
Plus,using |
R7204 |
T11144 |
T11145 |
punct |
(,Invitrogen |
R7205 |
T11145 |
T11143 |
parataxis |
Invitrogen,Plus |
R7206 |
T11146 |
T11145 |
punct |
),Invitrogen |
R7207 |
T11147 |
T11141 |
prep |
with,using |
R7208 |
T11148 |
T11149 |
amod |
cloned,fragment |
R7209 |
T11149 |
T11147 |
pobj |
fragment,with |
R7210 |
T11150 |
T11149 |
compound |
DNA,fragment |
R7211 |
T11151 |
T11149 |
cc |
or,fragment |
R7212 |
T11152 |
T11153 |
amod |
empty,vector |
R7213 |
T11153 |
T11149 |
conj |
vector,fragment |
R7214 |
T11154 |
T11139 |
punct |
.,performed |
R7215 |
T11156 |
T11157 |
prep |
At,selected |
R7216 |
T11158 |
T11159 |
nummod |
48,h |
R7217 |
T11159 |
T11156 |
pobj |
h,At |
R7218 |
T11160 |
T11159 |
prep |
after,h |
R7219 |
T11161 |
T11160 |
pobj |
transfection,after |
R7220 |
T11162 |
T11157 |
punct |
", ",selected |
R7221 |
T11163 |
T11157 |
nsubjpass |
populations,selected |
R7222 |
T11164 |
T11157 |
auxpass |
were,selected |
R7223 |
T11165 |
T11157 |
prep |
for,selected |
R7224 |
T11166 |
T11167 |
nummod |
2.5,μg |
R7225 |
T11167 |
T11168 |
nmod |
μg,puromycin |
R7226 |
T11168 |
T11165 |
pobj |
puromycin,for |
R7227 |
T11169 |
T11170 |
punct |
/,ml |
R7228 |
T11170 |
T11167 |
prep |
ml,μg |
R7229 |
T11171 |
T11157 |
cc |
and,selected |
R7230 |
T11172 |
T11173 |
det |
the,knockdown |
R7231 |
T11173 |
T11174 |
nsubj |
knockdown,observed |
R7232 |
T11174 |
T11157 |
conj |
observed,selected |
R7233 |
T11175 |
T11174 |
prep |
by,observed |
R7234 |
T11176 |
T11175 |
pcomp |
immunoblotting,by |
R7235 |
T11177 |
T11176 |
prep |
with,immunoblotting |
R7236 |
T11178 |
T11179 |
nmod |
anti-Sam68,antibody |
R7237 |
T11179 |
T11177 |
pobj |
antibody,with |
R7238 |
T11180 |
T11181 |
punct |
(,AD1 |
R7239 |
T11181 |
T11178 |
parataxis |
AD1,anti-Sam68 |
R7240 |
T11182 |
T11181 |
punct |
),AD1 |
R7241 |
T11183 |
T11157 |
punct |
.,selected |