Sam68 down-regulation using Sam68sh.
To generate an shRNA, 64-base duplex DNA nucleotides were purchased from Invitrogen. This fragment comprised 19 base residues specific to mouse Sam68 (GATCCCC AAGATGACGAGGAGAATTATTCAAGAGA TAATTCTCCTCGTCATCTT TTTTTGGAAA). This fragment was cloned into pSUPER retro (OligoEngine, Seattle, Washington, United States). Transfections were performed using LipofectAMINE Plus (Invitrogen) with cloned DNA fragment or empty vector. At 48 h after transfection, populations were selected for 2.5 μg/ml puromycin and the knockdown observed by immunoblotting with anti-Sam68 (AD1) antibody.