TEST0

PMC:4829102 / 37083-37954 JSON TXT

EXD2 promotes homologous recombination by facilitating DNA-end resection Abstract Repair of DNA double strand breaks (DSBs) by homologous recombination (HR) is critical for survival and genome stability of individual cells and organisms, but also contributes to the genetic diversity of species. A critical step in HR is MRN/CtIP-dependent end-resection that generates the 3′ single-stranded DNA overhangs required for the subsequent strand exchange reaction. Here, we identify EXD2 (EXDL2) as an exonuclease essential for DSB resection and efficient HR. EXD2 is recruited to chromatin in a damage-dependent manner and confers resistance to DSB-inducing agents. EXD2 functionally interacts with the MRN-complex to accelerate resection via its 3′-5′ exonuclease activity that efficiently processes dsDNA substrates containing nicks. Finally, we establish that EXD2 stimulates both short and long-range DSB resection, and thus together with MRE11 is required for efficient HR. This establishes a key role for EXD2 in controlling the initial steps of chromosomal break repair. DNA double-strand breaks (DSBs) are extremely cytotoxic lesions that can arise during normal cellular processes or are induced by exogenous factors such as ionizing radiation as well as many commonly used anti-cancer drugs. The faithful repair of DSBs is essential for cell survival and organismal development, as defective repair can contribute to a plethora of inherited human syndromes with life-threatening symptoms including cancer, neurodegeneration or premature aging 1, 2. The two major pathways involved in the repair of DSBs in eukaryotic cells are non-homologous end-joining and homologous recombination (HR) 3-5. A key initial step in HR is resection of the DNA ends on either side of the break, which is carried out initially by the MRE11-RAD50-NBS1 complex (MRN) and CtIP to generate short stretches of ssDNA6-8. Subsequently, the EXO1 or DNA2 nucleases, in conjunction with the Bloom’s Syndrome helicase (BLM) extend these to generate longer 3′ ssDNA tails 9-15. These ssDNA strands are then bound by replication protein A (RPA) 10-12, 16-18 which is subsequently replaced by RAD51 in a BRCA2-dependent manner, leading to the formation of ssDNA-RAD51 nucleoprotein filaments essential for the strand exchange process 3, 19. In vitro, MRE11 displays a weak endo- and exonuclease activity, which may be due to the lack of accessory factors 16, 20. Accordingly, work from multiple laboratories has shown that CtIP, or its yeast homologue Sae2, can stimulate MRE11’s endonuclease activity 9, 16-18. Interestingly, MRE11 has been also shown to nick the DNA strand to be resected in multiple positions, as far as 300bp from the break itself, suggesting that resection could proceed from several entry points that are distal to the DSB 21, 22. However, it is unclear whether this would enhance MRE11-dependent nucleolytic processing of DNA ends, thus generating a better substrate for subsequent processing of the break by BLM-DNA2 and/or BLM-EXO1 complexes; or allow access for additional factors accelerating the initial strand processing. Indeed, the inhibition of MRE11’s endonuclease activity confers a stronger resection defect than inhibition of its exonuclease activity, suggesting perhaps that initial break processing might be also carried out by other exonucleases 23. Here we identify EXD2 as a cofactor of the MRN complex required for efficient DNA end-resection, recruitment of RPA, homologous recombination and suppression of genome instability. EXD2 is required for repair of damage to DNA In an effort to identify factors required to promote HR, we carried out an unbiased proteomic approach to define the CtIP interactome. Here, we have identified EXD2, a largely uncharacterized protein with a putative exonuclease domain, as a candidate CtIP binding partner (Fig. 1a). We validated this interaction by co-immunoprecipitations from human cell extracts and found that we could readily detect endogenous EXD2 by western blotting of GFP-CtIP immunoprecipitates (Fig. 1b). Endogenous CtIP, as well as its known interactors MRE11 and BRCA1 were detected in a reciprocal FLAG-EXD2 immunoprecipitates (Fig. 1c; lysates were treated with benzonase to prevent DNA bridging). Therefore, we conclude that the two proteins likely exist in the same complex in cells. EXD2 is highly conserved across vertebrates (Supplementary Fig. 1) and was recently identified in the screen for suppression of sensitivity to mitomycin C 24. However, the biological and biochemical features of this protein are unknown. Since we identified EXD2 as an interactor of DBS-repair factors we tested its requirement in response to a range of DSBs-inducing agents namely, ionizing radiation (IR), campthotecin (CPT) and phleomycin. We found that depletion of EXD2 by two different siRNAs sensitized U2OS cells to these agents (Fig. 1d, e, f and Supplementary Fig. 2a and b). Taken together these results suggest a putative role for this protein in the repair of damaged DNA. EXD2 promotes DNA end resection and the generation of ssDNA CtIP is essential for efficient DNA end processing during DSB repair, with cells depleted for this factor showing a defect in the generation of single stranded DNA (ssDNA) and the subsequent formation of RPA foci 16, 25, 26. Thus we hypothesized that EXD2 may promote DNA end resection. To test this, we analysed RPA focus formation in response to both CPT and IR in WT and EXD2-depleted cells. Strikingly, cells depleted for EXD2 showed severely impaired kinetics of RPA focus formation in response to both treatments (Fig. 2a and b and Supplementary Fig. 2c and d). RPA2 phosphorylation at S4 and S8 has been widely used as a marker for the generation of single-stranded DNA by DNA-end resection 27. Consistent with the data above, EXD2 depleted cells showed impaired RPA S4/S8 phosphorylation in response to DNA damage (Fig. 2c and Supplementary Fig. 2e). Treatment with both agents resulted in a robust phosphorylation of histone H2AX and CHK2 (Fig. 2c and Supplementary Fig. 2e), confirming induction of DNA damage in cells. Moreover, since these responses were intact in EXD2-depleted cells, EXD2 is most likely not required for initial sensing of the DNA damage. Failure to generate RPA foci could be associated with either a defect in exonucleolytic processing of the DSB into ssDNA, or with impaired recruitment of RPA itself to ssDNA. To distinguish between these two possibilities we tested the efficiency of ssDNA generation in EXD2-depleted cells exposed to DNA damage. To this end, we labelled cells with BrdU and then employed immunofluorescence microscopy using an anti-BrdU antibody under non-denaturing conditions to detect stretches of ssDNA. Depletion of EXD2 significantly reduced formation of ssDNA foci (Fig. 2d and e) suggesting impaired resection. This is reminiscent of the phenotype observed in cells depleted for essential components of DNA end resection machinery, such as MRE11 or CtIP 6, 16. Importantly, these phenotypes were not due to changes in the cell cycle, as EXD2-depletion had little effect on the overall cell-cycle distribution profile (Supplementary Fig. 2f). Despite multiple attempts, we were unable to visualise EXD2 recruitment to DNA damage foci. In this regard, we note that certain other proteins involved in DNA repair do not readily form cytologically discernible foci in mammalian cells i.e. Ku70, Ku80 or DNA2. However, EXD2 was recruited to chromatin in HeLa cells upon DNA damage as assayed by subcellular fractionation (Fig. 2f), supporting its putative role in the processing of DSBs. A similar recruitment was also observed for the key resection factor MRE11 (Fig. 2f). Taken together, these results indicate that EXD2 is a putative component of the resection machinery required for the efficient processing of DSBs. EXD2 promotes homologous recombination and suppresses genome instability In vivo, RPA is required for RAD51 focus formation and in vitro it has been shown to promote RAD51-mediated strand exchange 28, 29. Consistent with this, treatment of U2OS cells with IR generated large numbers of RAD51 foci (Fig. 3a and b). In contrast, EXD2 depletion significantly impaired RAD51 focus formation (Fig. 3a and b). RAD51-ssDNA nucleoprotein filament formation is a crucial step in DSB repair by HR 30-32. To examine if EXD2 is also required for efficient HR we used a U2OS cell line carrying an integrated homologous recombination reporter transgene and an I-SceI recognition sequence 33. Transient expression of I-SceI endonuclease generates a DSB that, when repaired by HR, restores the expression of a functional GFP protein. We found that depletion of EXD2 significantly decreased the frequency of homologous recombination (Fig. 3c). Cells defective in HR are intrinsically sensitive to PARP inhibitors 34. Accordingly, EXD2-depletion sensitised cells to the PARP inhibitor olaparib (Fig. 3d). Failure to efficiently repair damaged DNA is associated with chromosomal instability and in line with this, we found a significantly greater number of chromosomal aberrations in EXD2-depleted U2OS cells as compared to the WT control (Fig. 3e). Taken together this data supports a role of EXD2 in promoting homologous recombination and genome stability. EXD2’s exonuclease activity facilitates the generation of ssDNA The MRN complex processes DSBs to generate ssDNA, which requires MRE11’s 3′-5′ exonuclease activity 20, 35. Interestingly, EXD2 has a predicted exonuclease fold, which has sequence homology to the 3′-5′ exonuclease domain of the Werner syndrome protein (WRN). Analysis of the alignment between EXD2 and WRN identified two key amino acids (D108 and E110) within the putative exonuclease domain of EXD2, which are also highly conserved in other DnaQ type exonucleases, including WRN, that coordinate the binding of metal ions within the active site 36 (Supplementary Fig. 3a). Mutation of the equivalent residues in WRN (D82 and E84) renders the protein devoid of nuclease activity 37. Therefore, we hypothesized that the equivalent residues in EXD2 may be also required for its putative nuclease activity. To test this, we expressed the full length GST-tagged EXD2 and the D108A and E110A mutant protein in bacteria, and purified them to apparent homogeneity (Supplementary Fig. 3b). Next, we tested the activity of these purified proteins on single stranded DNA radiolabeled on the 3′ or 5′ end (Fig. 4a and b). We found that purified EXD2, but not the D108A and E110A mutant, exhibited a robust nuclease activity on short 5′ labeled ssDNA (Fig. 4a). Furthermore, a time course of the 3′ labelled substrate digestion indicates that EXD2 degrades the labelled DNA strand from the 3′ end, as evidenced by the release of the single labelled nucleotide (Fig. 4b). This data shows that EXD2 displays a 3′-5′ exonuclease activity in vitro. Moreover, under these conditions the WT protein exhibited only weak activity towards blunt end double stranded DNA (Fig. 4c). To verify this data, we also identified a highly-soluble truncated form of EXD2 (spanning residues lysine 76 through to valine 564, containing the predicted exonuclease domain) that can be produced at very high yields and purity in a three-step procedure (Supplementary Fig. 3c-e). This version of EXD2, and its D108A E110A variant, behaved indistinguishably from full-length EXD2 (Supplementary Fig. 3f). In addition, the protein showed only a weak activity towards dsDNA with resected 3’end (Fig. 4d), and did not display any endonuclease activity on ssDNA or dsDNA with biotin/streptavidin blocked 3′ end (Fig. 4e). Importantly, purified EXD2 displayed a robust exonuclease activity, which co-elutes with the protein (Fig. 4f). Thus our data identify EXD2 as a bone fide exonuclease with a 3′-5′ polarity. To address the potential biological significance of EXD2’s exonuclease activity, we tested whether this activity was required to promote DNA-end resection in vivo. To this end, we examined the phenotypes of two independently derived U2OS clones stably expressing wild-type or the nuclease-dead (D108A and E110A) EXD2 mutant. The endogenous protein was depleted with siRNA targeting the 3′ un-translated region (UTR) of EXD2 (Supplementary Fig. 4a). Notably, cells expressing the nuclease-dead protein did not correct phenotypes associated with EXD2 deficiency as compared to cells expressing wild-type EXD2 (Fig. 5a-d). This result is consistent with our data showing a requirement for EXD2 in the processing of DSBs into ssDNA. Cells overexpressing WT EXD2 displayed elevated resection. In this regard we note that overexpression of WT MRE11 also increases resection efficiency resulting in elevated levels of RPA foci formation and RPA phosphorylation 38. EXD2 cooperates with MRE11 in the repair of DSBs The in vivo resection that initiates DSB repair is catalysed by the MRN complex 6, 7, 14, 39. To test whether or not EXD2 collaborates in this process with MRE11 we analysed the kinetics of RPA foci formation (a marker of resection) in cells depleted for either of these proteins or concomitantly depleted for both EXD2 and MRE11. We found that combined depletion resulted in a comparable inhibition of resection as observed for depletion of MRE11 alone (Fig. 6a). A similar relationship was also observed for RAD51 foci (Supplementary Fig. 4b and c). Interestingly, the defect observed in EXD2-depleted cells was slightly weaker than that observed in MRE11 alone, suggesting that MRE11 functions upstream of EXD2 in DNA resection, perhaps initiating resection through its endonuclease activity. Indeed, it has been suggested recently that MRE11 may create multiple nicks on the strand being resected that could serve as additional exonuclease entry sites to further enhance nucleolytic processing 21, 22. We tested this notion in several ways. First, we analysed if MRN-dependent DNA resection is accelerated in the presence of EXD2. Purified EXD2 and the MRN complex (MRE11, RAD50, NBS1) were incubated together with circular single-stranded PhiX174 DNA. This substrate requires initial endonuclease-dependent nicking by the MRN complex in order to undergo resection. As previously reported, the MRN complex exhibited nuclease activity under these conditions 16 (Fig. 6b). Importantly, combining EXD2 with the MRN complex resulted in increased ssDNA degradation in vitro (Fig. 6b and c). As expected, addition of exonuclease-dead EXD2 protein to the MRN complex resulted in DNA degradation similar to what we observed for MRN alone (Fig. 6b and c). Secondly, we predicted that EXD2 should be able to initiate resection from a nicked and a gapped duplex substrate designed to mimic the substrates generated by MRE11 endonuclease activity during the initial stage of DNA-end resection. Strikingly, EXD2 exhibited robust exonuclease activity on both the nicked and gapped substrates (Fig. 6d, e and f and Supplementary Fig. 4d and e). Taken together, these data show that EXD2 functionally collaborate with the MRN complex in promoting DNA degradation. To gain more functional insight into the role of EXD2’s exonuclease activity in DNA-end resection in vivo, we took advantage of the recently developed small molecule inhibitors targeting the exo- or endonuclease activity of MRE11 23. Inhibition of MRE11 endonuclease activity resulted in almost total inhibition of resection, whereas cells treated with the MRE11 exonuclease inhibitor showed milder resection defect (Fig. 7a) as reported previously 23. Knockdown of EXD2 alone resulted in a resection defect significantly stronger (p<0.0001) than the one observed in cells treated with the MRE11 exonuclease inhibitor alone. Depletion of EXD2 in the presence of the MRE11 exonuclease inhibitor did not decrease efficiency of resection further than what was achieved with EXD2 depletion alone (Fig. 7a). Interestingly, some residual resection was still observed in cells concomitantly depleted for EXD2 and incubated with the MRE11 exonuclease inhibitor, indicating either an involvement of another exonuclease in this step of DNA-end processing 23 or that EXD2 knockdown or MRE11 exonuclease inhibition was not complete. Nevertheless, this data suggests that both the exonuclease activity of EXD2 and that of MRE11 function within the same pathway and are required for efficient DNA end-resection. Knockdown of EXD2 in cells treated with an inhibitor targeting MRE11’s endonuclease activity showed a similar resection defect when compared to the inhibitor alone (Fig. 7a), supporting the notion that EXD2 functions downstream of MRE11’s endonuclease activity. Next, we asked which part of the resection process i.e. short-range vs. long-range resection is affected in cells depleted for EXD2. To test this, we depleted EXD2 in a cell line allowing for the induction of a DSB in a specific genomic locus in vivo 40. Then we analysed the efficiency of DNA resection at this DSB by q-PCR at two positions: one located close to the break (335bp downstream of the break - short range resection) and the other located at 1618bp from the break (long range resection) 40. Interestingly, we found that EXD2-depletion affected both short range as well as long-range resection (Fig. 7b and c and Supplementary Fig. 4f). Knockdown of MRE11 resulted in a similar albeit stronger resection phenotype thus providing further evidence to support its upstream function in this process. Importantly, concomitant depletion of both proteins did not further potentiate the resection defect. Given that both EXD2 and MRE11 regulate DSB resection, we tested the effect of their combined depletion on homologous recombination using the DR-GFP assay. In support of their role in this process, we observed that combined depletion of EXD2 and MRE11 did not decrease homologous recombination efficiency further than what we observed in the single knockdowns (Fig. 6d and Supplementary Fig. 4g). These findings therefore show that EXD2 promotes DNA end resection and homologous recombination by enhancing the generation of ssDNA through a common mechanism with the MRN complex. Furthermore, it seems likely that MRE11 functions upstream of EXD2 in this process, likely initiating resection through its endonuclease activity. To verify and extend the above conclusions, we used CRISPR-Cas9 nickase based gene editing 41 in HeLa cells to generate EXD2−/− clones (Supplementary Fig. 5a). The use of Cas9 nickase has been recently shown to minimize any off-target effects 42. Comparable to siRNA treated U2OS cells, EXD2−/− HeLa cells showed dramatically decreased RPA focus formation in response to CPT (Supplementary Fig. 5b and c), diminished RPA2 phosphorylation on S4/S8 (Supplementary Fig. 5d) and decreased survival in response to CPT (Supplementary Fig. 5e). We also tested if EXD2 depletion affects the MRE11 or CtIP protein stability and/or their recruitment to DSBs. We found this not to be the case, as cells lacking EXD2 had similar level of endogenous MRE11 or CtIP as the WT control (Supplementary Fig. 5f). Likewise, MRE11 or GFP-CtIP localization to DSBs induced by microirradiation 43 was not affected (Supplementary Fig. 6a, b and c). These finding therefore establish EXD2 as an important regulator of DSBs resection. Discussion We have shown that EXD2 facilitates DSB resection thus promoting recruitment of RPA and homologous recombination. Accordingly, cells depleted for EXD2 show spontaneous chromosomal instability and are sensitive to DNA damage induced by agents that generate DSBs. Furthermore, we establish that EXD2 functionally interacts with the MRN complex utilizing its 3′-5′ exonuclease activity to accelerate DSB resection and promote efficient HR. In line with this, complementation experiments showed that exonuclease-dead mutant protein failed to complement these phenotypes. Interestingly, EXD2 seems to be dispensable for the initial sensing of the break as evidenced by efficient γH2AX and CHK2 phosphorylation, and most likely acts downstream of MRE11. Finally we reveal that both, EXD2 and MRE11 function in the same pathway for DSB resection and HR. It is unclear at present why cells would need two exonucleases with the same polarity. However, a paradigm for such a requirement is evident from the fact that cells have two alternate machineries, consisting of BLM-DNA2-RPA-MRN and EXO1-BLM-RPA-MRN that carry out long-range resection9, 10, 13, 44. Thus, by analogy EXD2 may function together with MRE11 to accelerate resection in the 3′-5′ direction in order to efficiently produce short 3′ ssDNA overhangs. This could promote faster generation of longer stretches of ssDNA, which in turn may serve as a better substrate for BLM–DNA2 or BLM-EXO1 to initiate long-range resection. Accordingly, depletion of EXD2 adversely impacts on this process. Ultimately, efficient generation of ssDNA with minimal homology length required for productive HR would supress unscheduled deleterious recombination events. This may be particularly important in vertebrates, as they require significantly longer stretches of ssDNA (200-500 bp) to initiate productive HR 45, which is in contrast to yeast, where as little as 60 bp of 3′ ssDNA is sufficient to support HR 46. Not mutually exclusive is the possibility that EXD2 could also augment resection efficiency under specific circumstances, for instance in the presence of modifications to the damaged DNA and/or polypeptides bound at the 5′ ends. In line with this, we show that in vivo EXD2 depletion impairs short-range resection. Recently, it has been proposed that MRE11 may create multiple incisions on the DNA strand undergoing resection up to 300 bp distal to the break, which could allow for more efficient resection 21, 22. Indeed, inhibition of MRE11’s endonuclease activity seems to be dominant in promoting the generation of ssDNA over its exonuclease activity 23. Thus, we postulate a model whereby EXD2 functionally collaborates with the resection machinery, most likely utilizing DNA nicks generated by MRE11’s endonuclease activity 3′ of the DSB. This would enhance the generation of ssDNA tails required for efficient homologous recombination (model Fig. 6d). In summary, our work identifies EXD2 as a critical factor in the maintenance of genome stability through homologous recombination dependent repair of DSBs, including those induced by commonly used anti-cancer agents, such as IR or CPT. This highlights EXD2 itself and/or its enzymatic activity as a potential candidate for development of anti-cancer drugs. METHODS Cell lines HEK 293FT cells were a kind gift from Dr G. Stewart while HeLa and U2OS cells were a generous gift from Dr F. Esashi. These cell lines were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and standard antibiotics. U2OS cells stably expressing GFP-CtIP and U2OS cells harbouring the HR reporter DR-GFP were a generous gift from Prof. S.P. Jackson and were maintained in media supplemented with 500 μg ml−1 G-418. The ER-AsiSI U2OS cell line 47, a kind gift from Prof. G. Legube, was maintained in DMEM media without phenol red supplemented with 10% dialysed FBS (Life Technologies) and 1 μg ml−1 Puromycin. Cell lines stably expressing FLAG-HA EXD2 WT or D108A/E110A fusion proteins were generated by transfection of U2OS cells with these plasmid constructs followed by clonal selection of cells grown in media containing 500 μg ml−1 G418 (Life Technologies). All cell lines have been verified mycoplasma free by PCR based test (Takara). Plasmids The open reading frame (ORF) of human EXD2 was purchased as a gateway entry clone in the pDONR221 plasmid backbone from DNASU Plasmid Repository (HsCD00295838). Discrepancies in the amino-acid sequence in comparison to the reference sequence for human EXD2 (NM_001193360.1) were corrected by site-directed mutagenesis. Site-directed mutagenesis was then employed to generate EXD2 D108A–E110A in pDONR221. Flag–HA–EXD2 WT and D108A–E110A as well as GST–EXD2 WT and D108A–E110A plasmid constructs were generated by recombination of the WT or D108A–E110A EXD2 ORF in pDONR221 by LR Clonase reaction into either the pHAGE-N-Flag–HA destination vector (a gift from R. Chapman, The Wellcome Trust Centre for Human Genetics, University of Oxford, UK), or the pDEST-pGEX6P-1 destination vector (a gift from C. Green, The Wellcome Trust Centre for Human Genetics, University of Oxford, UK), respectively. LR Clonase reactions were carried out using the Gateway LR Clonase II enzyme mix according to the instructions of the manufacturer (Life Technologies). The pCMV-I-Sce1 plasmid was a gift from V. Macaulay (Department of Oncology, University of Oxford, UK). pmCherry-C1 was obtained from Clontech. pX335-GFP plasmid (pX335 vector48 containing PGK-EGFP-P2A-Neo-pA) was a gift from J. Riepsaame and M. de Bruijn (MRC Molecular Haematology Unit, Weatherall Institute of Molecular Medicine, University of Oxford, UK). His–EXD2 (Lys76–Ser589) construct was generated by cloning of truncated human EXD2 (Lys76–Ser589) in the expression vector pNIC28-Bsa4 (ref. 49), containing an amino-terminal His tag followed by a tobacco etch virus protease cleavage site. The construct was subsequently subjected to site-directed mutagenesis to introduce the D108A–E110A mutations. Plasmids were transfected into human cells using Lipofectamine 2000 (Life Technologies), according to the manufacturer’s instructions. Immunoblotting Cell extracts were prepared by lysing cells in urea buffer (9 M urea, 50 mM Tris HCL, pH 7.3, 150 mM β-mercaptoethanol) followed by sonication using a soniprep 150 (MSE) probe sonicator. Proteins were resolved by SDS-PAGE and transferred to PVDF. Immunoblots were carried out using the indicated antibodies (See Supplementary Table 1) Cell Survival Assay Alamar Blue survival assays were performed in accordance with the manufacturer’s recommendations (Life Technologies). Briefly, 300 cells per well in 96-well plates were untreated or treated with indicated doses of camptothecin, ionising radiation, phleomycin or olaparib and incubated for 7 days. Alamar blue reagent (Life Technologies) was added to each well and fluorometric measurements taken after 2h incubation at 37°C. RNAi treatment siRNAs used in this study are listed in Supplementary Table 2. ON-TARGETplus Non-targeting Pool or siRNA targeting luciferase 50 were used as control siRNAs where appropriate. Immunofluorescence microscopy Antibodies employed for immunofluorescence are listed in Supplementary Table 1. For visualisation of RPA foci, cells were pre-extracted on ice for 2 min (10 mM PIPES, pH 6.8, 300 mM Sucrose, 100 mM NaCl, 1.5 mM MgCl2 and 0.5% TritonX-100) and fixed with 4% paraformaldehyde in PBS for 10 min at room temperature. Coverslips were washed 3 × in PBS and blocked in 10% FBS in PBS for 30 min before incubation with primary antibody in 0.1% FBS in PBS for 1h at room temperature. Unbound primary antibody was removed by washing 4 × 5 min in PBS at room temperature followed by incubation with the indicated secondary antibody for 45 min at room temperature. Slides were then washed 4 × 5 min in PBS before mounting with Vectashield mounting medium (Vector Laboratories) with DAPI. In order to visualise ssDNA foci, the same protocol for RPA focus staining was used, preceded by treatment of cells growing on coverslips with 10 μM BrdU for 24 hours before fixation. In order to visualise RAD51 foci, cells grown on coverslips were fixed with 4% paraformaldehyde in PBS for 10 min at room temperature followed by permeabilisation with 0.5% TritonX-100 in PBS for 10 min at room temperature. Cells were then blocked, incubated with primary and secondary antibodies and mounted for analysis as described above. Confocal microscopy was carried out using a Zeiss LSM 510 laser scanning confocal microscope with Zen 2009 software using a 63x objective. Image analysis was carried out with FIJI (ImageJ) software. Microirradiation experiments Induction of localised DSBs in human cells was carried out as described previously 43. Briefly, cells were grown on coverslips and pre-treated for 24h with 10 μM BrdU before microirradiation. To induce localised DSBs, the media was removed and cells were washed once in PBS, with subsequent removal of excess PBS. Isopore membrane filters (Millipore TMTP02500, 0.5 μM pore size) were placed on top of the coverslips and cells were exposed to 30 J m−2 UVC using a Stratagene UV Stratalinker 2400. Membrane filters were removed and media placed back on the cells which were allowed to recover for the indicated times before fixation. Cells were fixed, permeabilised and blocked as per RAD51 focus staining (described above). Cells expressing GFP-CtIP were stained for GFP (using the GFP-Booster reagent, Chromotek, 1:200,) and γH2AX using the indicated secondary antibody. Images of microirradiated cells were acquired using a DeltaVision DV Elite microscope using either a 40x objective. Image analysis was carried out with FIJI (ImageJ) and Huygens Professional (Scientific Volume Imaging) software. U2OS cells were stained for MRE11 and γH2AX and visualised on a Zeiss LSM 510 confocal microscope using a 40x objective. Image analysis was carried out using FIJI (ImageJ). Immunoprecipitation experiments Lysates for co-immunoprecipitation experiments were prepared as follows; cells were washed twice in PBS and then lysed in IP buffer (100 mM NaCl, 0.2% Igepal CA-630, 1 mM MgCl2, 10% glycerol, 5 mM NaF, 50 mM Tris-HCl, pH 7.5), supplemented with complete EDTA-free protease inhibitor cocktail (Roche) and 25 U ml−1 Benzonase (Novagen). After Benzonase digestion, the NaCl and EDTA concentrations were adjusted to 200 mM and 2 mM, respectively, and lysates cleared by centrifugation (16,000 × g for 25 min). Lysates were then incubated with 20 μl of GFP-Trap agarose beads (ChromoTek) blocked with 5% BSA in IP lysis buffer for 1h at 4 °C in the case of GFP trap IPs or with 20 μl of anti-FLAG M2 affinity gel in the case of FLAG IPs for 2 hours with end-to-end mixing at 4 °C. Complexes were washed extensively in IP buffer (including 200mM NaCl and 2 mM EDTA) before elution. In the case of GFP trap IPs, beads were resuspended in 2X SDS sample buffer and boiled for 3 min before centrifugation at 5000 × g for 5 min. The resultant supernatant fraction was retained as the eluate. In the case of FLAG IPs, beads were incubated for 30 min with gentle agitation at 4 °C in IP buffer supplemented with 400 μM 3x FLAG peptide (Sigma) followed by centrifugation at 5000 × g for 5 min. The resultant supernatant fraction was collected as eluate. For mass spectrometry analyses eluates from immunoprecipitation experiments were analysed by the Mass Spectrometry Laboratory (IBB PAS, Warsaw, Poland) using the Thermo Orbitrap Velos system and protein hits were identified by MASCOT. Chromosomal aberrations Cells were prepared for analyses of chromosomal aberrations as described previously 51. Biriefly, Colcemid (0.1 μg/ml) was added 4 hours prior to cell harvesting. Cells were trypsinized and incubated in 0.075 M KCl for 20 min. After fixing in methanol:acetic acid (3:1) for 30 min, cells were dropped onto slides and stained with Leishman’s solution for 2 min. Slides were then coded and scored blind to the observer. Homologous recombination DR-GFP assay 48 hours after siRNA transfection, U2OS DR-GFP cells 16 were co-transfected using Amaxa nucleofection with an I-SceI expression vector (pCMV-I-SceI) and a vector expressing mCherry fluorescent protein (pmCherry-C1). 24 hours after I-SceI transfection cells were harvested and analysed by flow cytometry (CyAn ADP Analyzer, Beckman Coulter). The percentage of GFP-positive cells among transfected cells (mCherry-positive cells) was determined using Summit 4.3 software. siControl treated sample was set as 100%. Statistical significance was determined with the Student’s t-test. Recombinant protein purification Glutathione S-transferase (GST) tagged proteins were purified as described 51 with some modifications. Briefly, GST protein expression was induced with 0.1 mM IPTG (isopropyl-β-d-thiogalactopyranoside) (Sigma-Aldrich) at 16°C for 18 hours. Bacteria were harvested by centrifugation and resuspended in lysis buffer containing 50 mM Tris-HCl pH 8.0, 150 mM NaCl, 2 mM EDTA, 1 mM DTT, 1% Triton X-100, and protease inhibitors. Lysates were sonicated and cleared by centrifugation. Supernatants were incubated with Glutathione HiCap Matrix (Qiagen) for 2 h with rotation at 4°C. Beads were washed with lysis buffer containing increasing NaCl concentration, elution buffer (50 mM Tris-HCl pH 7.0, 150 mM NaCl, 1 mM EDTA, 1 mM DTT, 0.2% Triton X-100) and resuspended in elution buffer supplemented with PreScission Protease (50 units/ml) (GE Healthcare) and incubated for 18 h with rotation at 4°C. Eluates were dialysed to buffer containing 20 mM Hepes-KOH pH7.2, 100 mM NaCl, 1 mM DTT, 10% glycerol, aliquoted and stored at −80°C. His-EXD2 (K76-S589) protein and corresponding D108A/E110A mutant protein were expressed in E. coli BL21(DE3)-R3-pRARE2cells 49 grown in TB medium and induced with 0.5 mM IPTG at 18°C overnight. Cells were harvested by centrifugation and resuspended in a lysis buffer containing 50mM HEPES, pH 7.5, 500mM NaCl, 10mM imidazole, 5% glycerol, 1 mM TCEP, 0.5% Triton, supplemented with a protease inhibitor mixture (Roche Applied Science). The cells were sonicated, polyethyleneimine was added to 0.15% (w v−1) from a 5% pH7.5 stock solution, and lysates cleared by centrifugation. The supernatant was applied to a Ni-sepharose resin, washed with 50 mM HEPES, pH 7.5, 300 mM NaCl, 45 mM imidazole, 5% glycerol, 1 mM TCEP, 0.5% Triton, 1 mM PMSF and 2 mM benzamidine, and eluted in 50 mM HEPES, pH 7.5, 300 mM NaCl, 300 mM imidazole, 5% glycerol, 1 mM TCEP, 1 mM PMSF and 2 mM benzamidine. The eluate was further purified on two sequential Superdex S200 gel filtration columns in GF buffer (50 mM HEPES, pH 7.5, 500 mM NaCl, 5% glycerol, 1 mM TCEP, 0.1% Triton, 1 mM PMSF and 2 mM benzamidine). At each stage the presence of protein was confirmed on an InstantBlue-stained SDS-PAGE gel, and the identity of the final preparation was confirmed using electrospray ionisation-TOF mass spectrometry. Mass spectrometry indicated that both the WT and D108A, E110A mutant proteins had a shorter mass than predicted. Analysis using PAWS software (Genomic Solutions) suggests the proteins were lacking amino acids 565-589 at the C-terminus, probably due to proteolysis resulting in an EXD2 protein (WT or mutant) that consisted of amino acids K76-V564. In vitro nuclease assay Sequences of DNA oligos used are listed in Supplementary Table 3. In order to generate 3′ end labeled substrates, the indicated ssDNA oligo was labeled using [α-32P] dATP and TdT enzyme (New England Biolabs). To generate 5′ end labeled substrates, the indicated ssDNA oligo was labeled using [γ-32P] dATP and PNK enzyme (New England Biolabs). To obtain dsDNA substrates, complementary ssDNA oligos (as indicated in Supplementary Table 3) were mixed in an equimolar ratio and annealed by heating at 100 °C for 5 min followed by gradual cooling to room temperature. Where indicated DNA substrates with biotin label at 3′ end were used and pre-incubated 5 min at room temperature with 10-fold molar excess of streptavidin (Sigma). Exonuclease assays were performed as described 52 with some modifications. Briefly, reactions were carried out in a buffer containing 20 mM HEPES-KOH, pH 7.5, 50 mM KCl, 0.5 mM DTT, 10 mM MnCl2, 0.05% Triton-X, 0.1 mg ml−1 BSA, 5% glycerol, and 50 ng of EXD2 protein and initiated by adding the indicated amount of substrate and incubated at 37 °C for the indicated amounts of time. Reactions were stopped by addition of EDTA to a final concentration of 20 mM and 1/5 volume of formamide. The samples were resolved on denaturing 20% polyacrylamide TBE-Urea gels. Gels were fixed, dried and visualised using a Typhoon FLA 9500 instrument (GE Healthcare). Thin layer chromatography (TLC) was performed as described 53. Briefly, exonuclease reactions were terminated by addition of stop solution (2% SDS, 120 mM EDTA), 1 μl of reaction mixtures was spotted on PEI cellulose thin layer plates (Merck). Plates were developed in 1.0 M Sodium formate pH 3.4 and subsequently visualised using Typhoon FLA 9500 instrument (GE Healthcare). The PhiX174 circular single-stranded substrate (30 μM nucleotides) from New England Biolabs was incubated with MRN complex (50 nM) in the presence or absence of His-EXD2 (K76-S589) (350 nM) or corresponding mutant protein in buffer containing (20 mM HEPES-KOH, pH 7.5, 50 mM KCl, 0.5 mM DTT, 5 mM MnCl2, 0.05% Triton-X, 0.1 mg ml−1 BSA, 5% glycerol, 1 mM ATP). After 2 hours the reaction was stopped by adding 1/5 volume of Stop solution (2% SDS, 50 mM EDTA). Reactions were resolved on agarose gels, stained with Sybr Gold and visualised using a Typhoon FLA 9500 instrument (GE Healthcare). ER-AsiSI resection assay The level of resection adjacent to specific DSB (Chr 1: 89231183) was measured as described 40 with some modifications. Briefly ER-AsiSI U2OS cells were treated with 300 nM of 4-hydroxytamoxifen (4-OHT, Sigma) for 1 hour to allow the AsiSI enzyme to enter the nucleus and induce DSBs. Cells were then harvested and genomic DNA was extracted as previously described 40. Genomic DNA was then digested with the BsrGI enzyme or mock digested and was used as a template for qPCR performed using iTaq Universal Sybr Green Mix (Bio-Rad) and Rotor-Gene (Corbett Research) qPCR system. Primers used are listed in Supplementary Table 4 40. The percentage of ssDNA was calculated as previously described 40. All data were then related to the siControl treated sample, which was set as 100%. Statistical significance was determined with the Student’s t-test. Generation of EXD2−/− cells by CRISP/Cas9 The following guide RNA (gRNA) sequences targeting first exon of EXD2 were selected using Optimized CRISPR Design tool (http://crispr.mit.edu; 54: gRNA1 AAGGCATCCAGCGCCGCCGA, gRNA2 CCCTACAGCCACACCCAGAA. DNA oligonucleotides were purchased from IDT and cloned into pX335-GFP vector 48 to generate targeting constructs that were subsequently co-transfected in an equimolar ratio into HeLa cells using Lipofectamine. 24 hours after transfection, cells were sorted using a MoFlo cell sorter (Beckman Coulter) for cells expressing Cas9 nickase (GFP-positive cells) and left to recover for 6 days before sorting for single cells and allowing colonies to form. EXD2 expression was analysed by western blotting. Two clones showing loss of all detectable EXD2 were selected for subsequent analysis. Chromatin fractionation HeLa cells were treated with 500 μM phleomycin for 1 hour, washed with ice cold PBS, scraped into PBS and the chromatin fractionation was performed as described 55, 56. Briefly, cells were resuspended in buffer A (10 mM Hepes-KOH pH7.9, 10 mM KCl, 1.5 MgCl2, 340 mM Sucrose, 10% glycerol, 1 mM DTT, protease inhibitors) and Triton X-100 was added to final concentration 0.1 %. After 5 min incubation on ice, nuclei were spun down at 1300 × g for 4 min. Pelleted nuclei were washed with buffer A, resuspended in buffer B (3 mM EDTA, 0.2 mM EGTA, 1 mM DTT, protease inhibitors) and lysed for 20 min on ice before centrifugation at 1700 × g for 5 min. Supernatant (nuclear soluble fraction) was saved, and pellet (chromatin fraction) was washed with buffer B, resuspended in urea buffer (9 M urea, 50 mM Tris-HCl, pH 7.3) and sonicated. Statistics and reproducibility Microsoft Excel or Prism 6 software were used to perform statistical analyses. Detailed information (statistical tests used, number of independent experiments, P values) are listed in individual figure legends. All experiments were repeated at least twice unless stated otherwise. Supplementary Material Supplementary Information Supplementary Table 1 Supplementary Table 2 Supplementary Table 3 Supplementary Table 4 Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3 Supplementary Figure 4 Supplementary Figure 5 Supplementary Figure 6 Supplementary Figure 7

Document structure show

Title	EXD2 promotes homologous recombination by facilitating DNA-end resection
Abstract	Repair of DNA double strand breaks (DSBs) by homologous recombination (HR) is critical for survival and genome stability of individual cells and organisms, but also contributes to the genetic diversity of species. A critical step in HR is MRN/CtIP-dependent end-resection that generates the 3′ single-stranded DNA overhangs required for the subsequent strand exchange reaction. Here, we identify EXD2 (EXDL2) as an exonuclease essential for DSB resection and efficient HR. EXD2 is recruited to chromatin in a damage-dependent manner and confers resistance to DSB-inducing agents. EXD2 functionally interacts with the MRN-complex to accelerate resection via its 3′-5′ exonuclease activity that efficiently processes dsDNA substrates containing nicks. Finally, we establish that EXD2 stimulates both short and long-range DSB resection, and thus together with MRE11 is required for efficient HR. This establishes a key role for EXD2 in controlling the initial steps of chromosomal break repair.
Body	DNA double-strand breaks (DSBs) are extremely cytotoxic lesions that can arise during normal cellular processes or are induced by exogenous factors such as ionizing radiation as well as many commonly used anti-cancer drugs. The faithful repair of DSBs is essential for cell survival and organismal development, as defective repair can contribute to a plethora of inherited human syndromes with life-threatening symptoms including cancer, neurodegeneration or premature aging 1, 2. The two major pathways involved in the repair of DSBs in eukaryotic cells are non-homologous end-joining and homologous recombination (HR) 3-5. A key initial step in HR is resection of the DNA ends on either side of the break, which is carried out initially by the MRE11-RAD50-NBS1 complex (MRN) and CtIP to generate short stretches of ssDNA6-8. Subsequently, the EXO1 or DNA2 nucleases, in conjunction with the Bloom’s Syndrome helicase (BLM) extend these to generate longer 3′ ssDNA tails 9-15. These ssDNA strands are then bound by replication protein A (RPA) 10-12, 16-18 which is subsequently replaced by RAD51 in a BRCA2-dependent manner, leading to the formation of ssDNA-RAD51 nucleoprotein filaments essential for the strand exchange process 3, 19. In vitro, MRE11 displays a weak endo- and exonuclease activity, which may be due to the lack of accessory factors 16, 20. Accordingly, work from multiple laboratories has shown that CtIP, or its yeast homologue Sae2, can stimulate MRE11’s endonuclease activity 9, 16-18. Interestingly, MRE11 has been also shown to nick the DNA strand to be resected in multiple positions, as far as 300bp from the break itself, suggesting that resection could proceed from several entry points that are distal to the DSB 21, 22. However, it is unclear whether this would enhance MRE11-dependent nucleolytic processing of DNA ends, thus generating a better substrate for subsequent processing of the break by BLM-DNA2 and/or BLM-EXO1 complexes; or allow access for additional factors accelerating the initial strand processing. Indeed, the inhibition of MRE11’s endonuclease activity confers a stronger resection defect than inhibition of its exonuclease activity, suggesting perhaps that initial break processing might be also carried out by other exonucleases 23. Here we identify EXD2 as a cofactor of the MRN complex required for efficient DNA end-resection, recruitment of RPA, homologous recombination and suppression of genome instability. EXD2 is required for repair of damage to DNA In an effort to identify factors required to promote HR, we carried out an unbiased proteomic approach to define the CtIP interactome. Here, we have identified EXD2, a largely uncharacterized protein with a putative exonuclease domain, as a candidate CtIP binding partner (Fig. 1a). We validated this interaction by co-immunoprecipitations from human cell extracts and found that we could readily detect endogenous EXD2 by western blotting of GFP-CtIP immunoprecipitates (Fig. 1b). Endogenous CtIP, as well as its known interactors MRE11 and BRCA1 were detected in a reciprocal FLAG-EXD2 immunoprecipitates (Fig. 1c; lysates were treated with benzonase to prevent DNA bridging). Therefore, we conclude that the two proteins likely exist in the same complex in cells. EXD2 is highly conserved across vertebrates (Supplementary Fig. 1) and was recently identified in the screen for suppression of sensitivity to mitomycin C 24. However, the biological and biochemical features of this protein are unknown. Since we identified EXD2 as an interactor of DBS-repair factors we tested its requirement in response to a range of DSBs-inducing agents namely, ionizing radiation (IR), campthotecin (CPT) and phleomycin. We found that depletion of EXD2 by two different siRNAs sensitized U2OS cells to these agents (Fig. 1d, e, f and Supplementary Fig. 2a and b). Taken together these results suggest a putative role for this protein in the repair of damaged DNA. EXD2 promotes DNA end resection and the generation of ssDNA CtIP is essential for efficient DNA end processing during DSB repair, with cells depleted for this factor showing a defect in the generation of single stranded DNA (ssDNA) and the subsequent formation of RPA foci 16, 25, 26. Thus we hypothesized that EXD2 may promote DNA end resection. To test this, we analysed RPA focus formation in response to both CPT and IR in WT and EXD2-depleted cells. Strikingly, cells depleted for EXD2 showed severely impaired kinetics of RPA focus formation in response to both treatments (Fig. 2a and b and Supplementary Fig. 2c and d). RPA2 phosphorylation at S4 and S8 has been widely used as a marker for the generation of single-stranded DNA by DNA-end resection 27. Consistent with the data above, EXD2 depleted cells showed impaired RPA S4/S8 phosphorylation in response to DNA damage (Fig. 2c and Supplementary Fig. 2e). Treatment with both agents resulted in a robust phosphorylation of histone H2AX and CHK2 (Fig. 2c and Supplementary Fig. 2e), confirming induction of DNA damage in cells. Moreover, since these responses were intact in EXD2-depleted cells, EXD2 is most likely not required for initial sensing of the DNA damage. Failure to generate RPA foci could be associated with either a defect in exonucleolytic processing of the DSB into ssDNA, or with impaired recruitment of RPA itself to ssDNA. To distinguish between these two possibilities we tested the efficiency of ssDNA generation in EXD2-depleted cells exposed to DNA damage. To this end, we labelled cells with BrdU and then employed immunofluorescence microscopy using an anti-BrdU antibody under non-denaturing conditions to detect stretches of ssDNA. Depletion of EXD2 significantly reduced formation of ssDNA foci (Fig. 2d and e) suggesting impaired resection. This is reminiscent of the phenotype observed in cells depleted for essential components of DNA end resection machinery, such as MRE11 or CtIP 6, 16. Importantly, these phenotypes were not due to changes in the cell cycle, as EXD2-depletion had little effect on the overall cell-cycle distribution profile (Supplementary Fig. 2f). Despite multiple attempts, we were unable to visualise EXD2 recruitment to DNA damage foci. In this regard, we note that certain other proteins involved in DNA repair do not readily form cytologically discernible foci in mammalian cells i.e. Ku70, Ku80 or DNA2. However, EXD2 was recruited to chromatin in HeLa cells upon DNA damage as assayed by subcellular fractionation (Fig. 2f), supporting its putative role in the processing of DSBs. A similar recruitment was also observed for the key resection factor MRE11 (Fig. 2f). Taken together, these results indicate that EXD2 is a putative component of the resection machinery required for the efficient processing of DSBs. EXD2 promotes homologous recombination and suppresses genome instability In vivo, RPA is required for RAD51 focus formation and in vitro it has been shown to promote RAD51-mediated strand exchange 28, 29. Consistent with this, treatment of U2OS cells with IR generated large numbers of RAD51 foci (Fig. 3a and b). In contrast, EXD2 depletion significantly impaired RAD51 focus formation (Fig. 3a and b). RAD51-ssDNA nucleoprotein filament formation is a crucial step in DSB repair by HR 30-32. To examine if EXD2 is also required for efficient HR we used a U2OS cell line carrying an integrated homologous recombination reporter transgene and an I-SceI recognition sequence 33. Transient expression of I-SceI endonuclease generates a DSB that, when repaired by HR, restores the expression of a functional GFP protein. We found that depletion of EXD2 significantly decreased the frequency of homologous recombination (Fig. 3c). Cells defective in HR are intrinsically sensitive to PARP inhibitors 34. Accordingly, EXD2-depletion sensitised cells to the PARP inhibitor olaparib (Fig. 3d). Failure to efficiently repair damaged DNA is associated with chromosomal instability and in line with this, we found a significantly greater number of chromosomal aberrations in EXD2-depleted U2OS cells as compared to the WT control (Fig. 3e). Taken together this data supports a role of EXD2 in promoting homologous recombination and genome stability. EXD2’s exonuclease activity facilitates the generation of ssDNA The MRN complex processes DSBs to generate ssDNA, which requires MRE11’s 3′-5′ exonuclease activity 20, 35. Interestingly, EXD2 has a predicted exonuclease fold, which has sequence homology to the 3′-5′ exonuclease domain of the Werner syndrome protein (WRN). Analysis of the alignment between EXD2 and WRN identified two key amino acids (D108 and E110) within the putative exonuclease domain of EXD2, which are also highly conserved in other DnaQ type exonucleases, including WRN, that coordinate the binding of metal ions within the active site 36 (Supplementary Fig. 3a). Mutation of the equivalent residues in WRN (D82 and E84) renders the protein devoid of nuclease activity 37. Therefore, we hypothesized that the equivalent residues in EXD2 may be also required for its putative nuclease activity. To test this, we expressed the full length GST-tagged EXD2 and the D108A and E110A mutant protein in bacteria, and purified them to apparent homogeneity (Supplementary Fig. 3b). Next, we tested the activity of these purified proteins on single stranded DNA radiolabeled on the 3′ or 5′ end (Fig. 4a and b). We found that purified EXD2, but not the D108A and E110A mutant, exhibited a robust nuclease activity on short 5′ labeled ssDNA (Fig. 4a). Furthermore, a time course of the 3′ labelled substrate digestion indicates that EXD2 degrades the labelled DNA strand from the 3′ end, as evidenced by the release of the single labelled nucleotide (Fig. 4b). This data shows that EXD2 displays a 3′-5′ exonuclease activity in vitro. Moreover, under these conditions the WT protein exhibited only weak activity towards blunt end double stranded DNA (Fig. 4c). To verify this data, we also identified a highly-soluble truncated form of EXD2 (spanning residues lysine 76 through to valine 564, containing the predicted exonuclease domain) that can be produced at very high yields and purity in a three-step procedure (Supplementary Fig. 3c-e). This version of EXD2, and its D108A E110A variant, behaved indistinguishably from full-length EXD2 (Supplementary Fig. 3f). In addition, the protein showed only a weak activity towards dsDNA with resected 3’end (Fig. 4d), and did not display any endonuclease activity on ssDNA or dsDNA with biotin/streptavidin blocked 3′ end (Fig. 4e). Importantly, purified EXD2 displayed a robust exonuclease activity, which co-elutes with the protein (Fig. 4f). Thus our data identify EXD2 as a bone fide exonuclease with a 3′-5′ polarity. To address the potential biological significance of EXD2’s exonuclease activity, we tested whether this activity was required to promote DNA-end resection in vivo. To this end, we examined the phenotypes of two independently derived U2OS clones stably expressing wild-type or the nuclease-dead (D108A and E110A) EXD2 mutant. The endogenous protein was depleted with siRNA targeting the 3′ un-translated region (UTR) of EXD2 (Supplementary Fig. 4a). Notably, cells expressing the nuclease-dead protein did not correct phenotypes associated with EXD2 deficiency as compared to cells expressing wild-type EXD2 (Fig. 5a-d). This result is consistent with our data showing a requirement for EXD2 in the processing of DSBs into ssDNA. Cells overexpressing WT EXD2 displayed elevated resection. In this regard we note that overexpression of WT MRE11 also increases resection efficiency resulting in elevated levels of RPA foci formation and RPA phosphorylation 38. EXD2 cooperates with MRE11 in the repair of DSBs The in vivo resection that initiates DSB repair is catalysed by the MRN complex 6, 7, 14, 39. To test whether or not EXD2 collaborates in this process with MRE11 we analysed the kinetics of RPA foci formation (a marker of resection) in cells depleted for either of these proteins or concomitantly depleted for both EXD2 and MRE11. We found that combined depletion resulted in a comparable inhibition of resection as observed for depletion of MRE11 alone (Fig. 6a). A similar relationship was also observed for RAD51 foci (Supplementary Fig. 4b and c). Interestingly, the defect observed in EXD2-depleted cells was slightly weaker than that observed in MRE11 alone, suggesting that MRE11 functions upstream of EXD2 in DNA resection, perhaps initiating resection through its endonuclease activity. Indeed, it has been suggested recently that MRE11 may create multiple nicks on the strand being resected that could serve as additional exonuclease entry sites to further enhance nucleolytic processing 21, 22. We tested this notion in several ways. First, we analysed if MRN-dependent DNA resection is accelerated in the presence of EXD2. Purified EXD2 and the MRN complex (MRE11, RAD50, NBS1) were incubated together with circular single-stranded PhiX174 DNA. This substrate requires initial endonuclease-dependent nicking by the MRN complex in order to undergo resection. As previously reported, the MRN complex exhibited nuclease activity under these conditions 16 (Fig. 6b). Importantly, combining EXD2 with the MRN complex resulted in increased ssDNA degradation in vitro (Fig. 6b and c). As expected, addition of exonuclease-dead EXD2 protein to the MRN complex resulted in DNA degradation similar to what we observed for MRN alone (Fig. 6b and c). Secondly, we predicted that EXD2 should be able to initiate resection from a nicked and a gapped duplex substrate designed to mimic the substrates generated by MRE11 endonuclease activity during the initial stage of DNA-end resection. Strikingly, EXD2 exhibited robust exonuclease activity on both the nicked and gapped substrates (Fig. 6d, e and f and Supplementary Fig. 4d and e). Taken together, these data show that EXD2 functionally collaborate with the MRN complex in promoting DNA degradation. To gain more functional insight into the role of EXD2’s exonuclease activity in DNA-end resection in vivo, we took advantage of the recently developed small molecule inhibitors targeting the exo- or endonuclease activity of MRE11 23. Inhibition of MRE11 endonuclease activity resulted in almost total inhibition of resection, whereas cells treated with the MRE11 exonuclease inhibitor showed milder resection defect (Fig. 7a) as reported previously 23. Knockdown of EXD2 alone resulted in a resection defect significantly stronger (p<0.0001) than the one observed in cells treated with the MRE11 exonuclease inhibitor alone. Depletion of EXD2 in the presence of the MRE11 exonuclease inhibitor did not decrease efficiency of resection further than what was achieved with EXD2 depletion alone (Fig. 7a). Interestingly, some residual resection was still observed in cells concomitantly depleted for EXD2 and incubated with the MRE11 exonuclease inhibitor, indicating either an involvement of another exonuclease in this step of DNA-end processing 23 or that EXD2 knockdown or MRE11 exonuclease inhibition was not complete. Nevertheless, this data suggests that both the exonuclease activity of EXD2 and that of MRE11 function within the same pathway and are required for efficient DNA end-resection. Knockdown of EXD2 in cells treated with an inhibitor targeting MRE11’s endonuclease activity showed a similar resection defect when compared to the inhibitor alone (Fig. 7a), supporting the notion that EXD2 functions downstream of MRE11’s endonuclease activity. Next, we asked which part of the resection process i.e. short-range vs. long-range resection is affected in cells depleted for EXD2. To test this, we depleted EXD2 in a cell line allowing for the induction of a DSB in a specific genomic locus in vivo 40. Then we analysed the efficiency of DNA resection at this DSB by q-PCR at two positions: one located close to the break (335bp downstream of the break - short range resection) and the other located at 1618bp from the break (long range resection) 40. Interestingly, we found that EXD2-depletion affected both short range as well as long-range resection (Fig. 7b and c and Supplementary Fig. 4f). Knockdown of MRE11 resulted in a similar albeit stronger resection phenotype thus providing further evidence to support its upstream function in this process. Importantly, concomitant depletion of both proteins did not further potentiate the resection defect. Given that both EXD2 and MRE11 regulate DSB resection, we tested the effect of their combined depletion on homologous recombination using the DR-GFP assay. In support of their role in this process, we observed that combined depletion of EXD2 and MRE11 did not decrease homologous recombination efficiency further than what we observed in the single knockdowns (Fig. 6d and Supplementary Fig. 4g). These findings therefore show that EXD2 promotes DNA end resection and homologous recombination by enhancing the generation of ssDNA through a common mechanism with the MRN complex. Furthermore, it seems likely that MRE11 functions upstream of EXD2 in this process, likely initiating resection through its endonuclease activity. To verify and extend the above conclusions, we used CRISPR-Cas9 nickase based gene editing 41 in HeLa cells to generate EXD2−/− clones (Supplementary Fig. 5a). The use of Cas9 nickase has been recently shown to minimize any off-target effects 42. Comparable to siRNA treated U2OS cells, EXD2−/− HeLa cells showed dramatically decreased RPA focus formation in response to CPT (Supplementary Fig. 5b and c), diminished RPA2 phosphorylation on S4/S8 (Supplementary Fig. 5d) and decreased survival in response to CPT (Supplementary Fig. 5e). We also tested if EXD2 depletion affects the MRE11 or CtIP protein stability and/or their recruitment to DSBs. We found this not to be the case, as cells lacking EXD2 had similar level of endogenous MRE11 or CtIP as the WT control (Supplementary Fig. 5f). Likewise, MRE11 or GFP-CtIP localization to DSBs induced by microirradiation 43 was not affected (Supplementary Fig. 6a, b and c). These finding therefore establish EXD2 as an important regulator of DSBs resection. Discussion We have shown that EXD2 facilitates DSB resection thus promoting recruitment of RPA and homologous recombination. Accordingly, cells depleted for EXD2 show spontaneous chromosomal instability and are sensitive to DNA damage induced by agents that generate DSBs. Furthermore, we establish that EXD2 functionally interacts with the MRN complex utilizing its 3′-5′ exonuclease activity to accelerate DSB resection and promote efficient HR. In line with this, complementation experiments showed that exonuclease-dead mutant protein failed to complement these phenotypes. Interestingly, EXD2 seems to be dispensable for the initial sensing of the break as evidenced by efficient γH2AX and CHK2 phosphorylation, and most likely acts downstream of MRE11. Finally we reveal that both, EXD2 and MRE11 function in the same pathway for DSB resection and HR. It is unclear at present why cells would need two exonucleases with the same polarity. However, a paradigm for such a requirement is evident from the fact that cells have two alternate machineries, consisting of BLM-DNA2-RPA-MRN and EXO1-BLM-RPA-MRN that carry out long-range resection9, 10, 13, 44. Thus, by analogy EXD2 may function together with MRE11 to accelerate resection in the 3′-5′ direction in order to efficiently produce short 3′ ssDNA overhangs. This could promote faster generation of longer stretches of ssDNA, which in turn may serve as a better substrate for BLM–DNA2 or BLM-EXO1 to initiate long-range resection. Accordingly, depletion of EXD2 adversely impacts on this process. Ultimately, efficient generation of ssDNA with minimal homology length required for productive HR would supress unscheduled deleterious recombination events. This may be particularly important in vertebrates, as they require significantly longer stretches of ssDNA (200-500 bp) to initiate productive HR 45, which is in contrast to yeast, where as little as 60 bp of 3′ ssDNA is sufficient to support HR 46. Not mutually exclusive is the possibility that EXD2 could also augment resection efficiency under specific circumstances, for instance in the presence of modifications to the damaged DNA and/or polypeptides bound at the 5′ ends. In line with this, we show that in vivo EXD2 depletion impairs short-range resection. Recently, it has been proposed that MRE11 may create multiple incisions on the DNA strand undergoing resection up to 300 bp distal to the break, which could allow for more efficient resection 21, 22. Indeed, inhibition of MRE11’s endonuclease activity seems to be dominant in promoting the generation of ssDNA over its exonuclease activity 23. Thus, we postulate a model whereby EXD2 functionally collaborates with the resection machinery, most likely utilizing DNA nicks generated by MRE11’s endonuclease activity 3′ of the DSB. This would enhance the generation of ssDNA tails required for efficient homologous recombination (model Fig. 6d). In summary, our work identifies EXD2 as a critical factor in the maintenance of genome stability through homologous recombination dependent repair of DSBs, including those induced by commonly used anti-cancer agents, such as IR or CPT. This highlights EXD2 itself and/or its enzymatic activity as a potential candidate for development of anti-cancer drugs. METHODS Cell lines HEK 293FT cells were a kind gift from Dr G. Stewart while HeLa and U2OS cells were a generous gift from Dr F. Esashi. These cell lines were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and standard antibiotics. U2OS cells stably expressing GFP-CtIP and U2OS cells harbouring the HR reporter DR-GFP were a generous gift from Prof. S.P. Jackson and were maintained in media supplemented with 500 μg ml−1 G-418. The ER-AsiSI U2OS cell line 47, a kind gift from Prof. G. Legube, was maintained in DMEM media without phenol red supplemented with 10% dialysed FBS (Life Technologies) and 1 μg ml−1 Puromycin. Cell lines stably expressing FLAG-HA EXD2 WT or D108A/E110A fusion proteins were generated by transfection of U2OS cells with these plasmid constructs followed by clonal selection of cells grown in media containing 500 μg ml−1 G418 (Life Technologies). All cell lines have been verified mycoplasma free by PCR based test (Takara). Plasmids The open reading frame (ORF) of human EXD2 was purchased as a gateway entry clone in the pDONR221 plasmid backbone from DNASU Plasmid Repository (HsCD00295838). Discrepancies in the amino-acid sequence in comparison to the reference sequence for human EXD2 (NM_001193360.1) were corrected by site-directed mutagenesis. Site-directed mutagenesis was then employed to generate EXD2 D108A–E110A in pDONR221. Flag–HA–EXD2 WT and D108A–E110A as well as GST–EXD2 WT and D108A–E110A plasmid constructs were generated by recombination of the WT or D108A–E110A EXD2 ORF in pDONR221 by LR Clonase reaction into either the pHAGE-N-Flag–HA destination vector (a gift from R. Chapman, The Wellcome Trust Centre for Human Genetics, University of Oxford, UK), or the pDEST-pGEX6P-1 destination vector (a gift from C. Green, The Wellcome Trust Centre for Human Genetics, University of Oxford, UK), respectively. LR Clonase reactions were carried out using the Gateway LR Clonase II enzyme mix according to the instructions of the manufacturer (Life Technologies). The pCMV-I-Sce1 plasmid was a gift from V. Macaulay (Department of Oncology, University of Oxford, UK). pmCherry-C1 was obtained from Clontech. pX335-GFP plasmid (pX335 vector48 containing PGK-EGFP-P2A-Neo-pA) was a gift from J. Riepsaame and M. de Bruijn (MRC Molecular Haematology Unit, Weatherall Institute of Molecular Medicine, University of Oxford, UK). His–EXD2 (Lys76–Ser589) construct was generated by cloning of truncated human EXD2 (Lys76–Ser589) in the expression vector pNIC28-Bsa4 (ref. 49), containing an amino-terminal His tag followed by a tobacco etch virus protease cleavage site. The construct was subsequently subjected to site-directed mutagenesis to introduce the D108A–E110A mutations. Plasmids were transfected into human cells using Lipofectamine 2000 (Life Technologies), according to the manufacturer’s instructions. Immunoblotting Cell extracts were prepared by lysing cells in urea buffer (9 M urea, 50 mM Tris HCL, pH 7.3, 150 mM β-mercaptoethanol) followed by sonication using a soniprep 150 (MSE) probe sonicator. Proteins were resolved by SDS-PAGE and transferred to PVDF. Immunoblots were carried out using the indicated antibodies (See Supplementary Table 1) Cell Survival Assay Alamar Blue survival assays were performed in accordance with the manufacturer’s recommendations (Life Technologies). Briefly, 300 cells per well in 96-well plates were untreated or treated with indicated doses of camptothecin, ionising radiation, phleomycin or olaparib and incubated for 7 days. Alamar blue reagent (Life Technologies) was added to each well and fluorometric measurements taken after 2h incubation at 37°C. RNAi treatment siRNAs used in this study are listed in Supplementary Table 2. ON-TARGETplus Non-targeting Pool or siRNA targeting luciferase 50 were used as control siRNAs where appropriate. Immunofluorescence microscopy Antibodies employed for immunofluorescence are listed in Supplementary Table 1. For visualisation of RPA foci, cells were pre-extracted on ice for 2 min (10 mM PIPES, pH 6.8, 300 mM Sucrose, 100 mM NaCl, 1.5 mM MgCl2 and 0.5% TritonX-100) and fixed with 4% paraformaldehyde in PBS for 10 min at room temperature. Coverslips were washed 3 × in PBS and blocked in 10% FBS in PBS for 30 min before incubation with primary antibody in 0.1% FBS in PBS for 1h at room temperature. Unbound primary antibody was removed by washing 4 × 5 min in PBS at room temperature followed by incubation with the indicated secondary antibody for 45 min at room temperature. Slides were then washed 4 × 5 min in PBS before mounting with Vectashield mounting medium (Vector Laboratories) with DAPI. In order to visualise ssDNA foci, the same protocol for RPA focus staining was used, preceded by treatment of cells growing on coverslips with 10 μM BrdU for 24 hours before fixation. In order to visualise RAD51 foci, cells grown on coverslips were fixed with 4% paraformaldehyde in PBS for 10 min at room temperature followed by permeabilisation with 0.5% TritonX-100 in PBS for 10 min at room temperature. Cells were then blocked, incubated with primary and secondary antibodies and mounted for analysis as described above. Confocal microscopy was carried out using a Zeiss LSM 510 laser scanning confocal microscope with Zen 2009 software using a 63x objective. Image analysis was carried out with FIJI (ImageJ) software. Microirradiation experiments Induction of localised DSBs in human cells was carried out as described previously 43. Briefly, cells were grown on coverslips and pre-treated for 24h with 10 μM BrdU before microirradiation. To induce localised DSBs, the media was removed and cells were washed once in PBS, with subsequent removal of excess PBS. Isopore membrane filters (Millipore TMTP02500, 0.5 μM pore size) were placed on top of the coverslips and cells were exposed to 30 J m−2 UVC using a Stratagene UV Stratalinker 2400. Membrane filters were removed and media placed back on the cells which were allowed to recover for the indicated times before fixation. Cells were fixed, permeabilised and blocked as per RAD51 focus staining (described above). Cells expressing GFP-CtIP were stained for GFP (using the GFP-Booster reagent, Chromotek, 1:200,) and γH2AX using the indicated secondary antibody. Images of microirradiated cells were acquired using a DeltaVision DV Elite microscope using either a 40x objective. Image analysis was carried out with FIJI (ImageJ) and Huygens Professional (Scientific Volume Imaging) software. U2OS cells were stained for MRE11 and γH2AX and visualised on a Zeiss LSM 510 confocal microscope using a 40x objective. Image analysis was carried out using FIJI (ImageJ). Immunoprecipitation experiments Lysates for co-immunoprecipitation experiments were prepared as follows; cells were washed twice in PBS and then lysed in IP buffer (100 mM NaCl, 0.2% Igepal CA-630, 1 mM MgCl2, 10% glycerol, 5 mM NaF, 50 mM Tris-HCl, pH 7.5), supplemented with complete EDTA-free protease inhibitor cocktail (Roche) and 25 U ml−1 Benzonase (Novagen). After Benzonase digestion, the NaCl and EDTA concentrations were adjusted to 200 mM and 2 mM, respectively, and lysates cleared by centrifugation (16,000 × g for 25 min). Lysates were then incubated with 20 μl of GFP-Trap agarose beads (ChromoTek) blocked with 5% BSA in IP lysis buffer for 1h at 4 °C in the case of GFP trap IPs or with 20 μl of anti-FLAG M2 affinity gel in the case of FLAG IPs for 2 hours with end-to-end mixing at 4 °C. Complexes were washed extensively in IP buffer (including 200mM NaCl and 2 mM EDTA) before elution. In the case of GFP trap IPs, beads were resuspended in 2X SDS sample buffer and boiled for 3 min before centrifugation at 5000 × g for 5 min. The resultant supernatant fraction was retained as the eluate. In the case of FLAG IPs, beads were incubated for 30 min with gentle agitation at 4 °C in IP buffer supplemented with 400 μM 3x FLAG peptide (Sigma) followed by centrifugation at 5000 × g for 5 min. The resultant supernatant fraction was collected as eluate. For mass spectrometry analyses eluates from immunoprecipitation experiments were analysed by the Mass Spectrometry Laboratory (IBB PAS, Warsaw, Poland) using the Thermo Orbitrap Velos system and protein hits were identified by MASCOT. Chromosomal aberrations Cells were prepared for analyses of chromosomal aberrations as described previously 51. Biriefly, Colcemid (0.1 μg/ml) was added 4 hours prior to cell harvesting. Cells were trypsinized and incubated in 0.075 M KCl for 20 min. After fixing in methanol:acetic acid (3:1) for 30 min, cells were dropped onto slides and stained with Leishman’s solution for 2 min. Slides were then coded and scored blind to the observer. Homologous recombination DR-GFP assay 48 hours after siRNA transfection, U2OS DR-GFP cells 16 were co-transfected using Amaxa nucleofection with an I-SceI expression vector (pCMV-I-SceI) and a vector expressing mCherry fluorescent protein (pmCherry-C1). 24 hours after I-SceI transfection cells were harvested and analysed by flow cytometry (CyAn ADP Analyzer, Beckman Coulter). The percentage of GFP-positive cells among transfected cells (mCherry-positive cells) was determined using Summit 4.3 software. siControl treated sample was set as 100%. Statistical significance was determined with the Student’s t-test. Recombinant protein purification Glutathione S-transferase (GST) tagged proteins were purified as described 51 with some modifications. Briefly, GST protein expression was induced with 0.1 mM IPTG (isopropyl-β-d-thiogalactopyranoside) (Sigma-Aldrich) at 16°C for 18 hours. Bacteria were harvested by centrifugation and resuspended in lysis buffer containing 50 mM Tris-HCl pH 8.0, 150 mM NaCl, 2 mM EDTA, 1 mM DTT, 1% Triton X-100, and protease inhibitors. Lysates were sonicated and cleared by centrifugation. Supernatants were incubated with Glutathione HiCap Matrix (Qiagen) for 2 h with rotation at 4°C. Beads were washed with lysis buffer containing increasing NaCl concentration, elution buffer (50 mM Tris-HCl pH 7.0, 150 mM NaCl, 1 mM EDTA, 1 mM DTT, 0.2% Triton X-100) and resuspended in elution buffer supplemented with PreScission Protease (50 units/ml) (GE Healthcare) and incubated for 18 h with rotation at 4°C. Eluates were dialysed to buffer containing 20 mM Hepes-KOH pH7.2, 100 mM NaCl, 1 mM DTT, 10% glycerol, aliquoted and stored at −80°C. His-EXD2 (K76-S589) protein and corresponding D108A/E110A mutant protein were expressed in E. coli BL21(DE3)-R3-pRARE2cells 49 grown in TB medium and induced with 0.5 mM IPTG at 18°C overnight. Cells were harvested by centrifugation and resuspended in a lysis buffer containing 50mM HEPES, pH 7.5, 500mM NaCl, 10mM imidazole, 5% glycerol, 1 mM TCEP, 0.5% Triton, supplemented with a protease inhibitor mixture (Roche Applied Science). The cells were sonicated, polyethyleneimine was added to 0.15% (w v−1) from a 5% pH7.5 stock solution, and lysates cleared by centrifugation. The supernatant was applied to a Ni-sepharose resin, washed with 50 mM HEPES, pH 7.5, 300 mM NaCl, 45 mM imidazole, 5% glycerol, 1 mM TCEP, 0.5% Triton, 1 mM PMSF and 2 mM benzamidine, and eluted in 50 mM HEPES, pH 7.5, 300 mM NaCl, 300 mM imidazole, 5% glycerol, 1 mM TCEP, 1 mM PMSF and 2 mM benzamidine. The eluate was further purified on two sequential Superdex S200 gel filtration columns in GF buffer (50 mM HEPES, pH 7.5, 500 mM NaCl, 5% glycerol, 1 mM TCEP, 0.1% Triton, 1 mM PMSF and 2 mM benzamidine). At each stage the presence of protein was confirmed on an InstantBlue-stained SDS-PAGE gel, and the identity of the final preparation was confirmed using electrospray ionisation-TOF mass spectrometry. Mass spectrometry indicated that both the WT and D108A, E110A mutant proteins had a shorter mass than predicted. Analysis using PAWS software (Genomic Solutions) suggests the proteins were lacking amino acids 565-589 at the C-terminus, probably due to proteolysis resulting in an EXD2 protein (WT or mutant) that consisted of amino acids K76-V564. In vitro nuclease assay Sequences of DNA oligos used are listed in Supplementary Table 3. In order to generate 3′ end labeled substrates, the indicated ssDNA oligo was labeled using [α-32P] dATP and TdT enzyme (New England Biolabs). To generate 5′ end labeled substrates, the indicated ssDNA oligo was labeled using [γ-32P] dATP and PNK enzyme (New England Biolabs). To obtain dsDNA substrates, complementary ssDNA oligos (as indicated in Supplementary Table 3) were mixed in an equimolar ratio and annealed by heating at 100 °C for 5 min followed by gradual cooling to room temperature. Where indicated DNA substrates with biotin label at 3′ end were used and pre-incubated 5 min at room temperature with 10-fold molar excess of streptavidin (Sigma). Exonuclease assays were performed as described 52 with some modifications. Briefly, reactions were carried out in a buffer containing 20 mM HEPES-KOH, pH 7.5, 50 mM KCl, 0.5 mM DTT, 10 mM MnCl2, 0.05% Triton-X, 0.1 mg ml−1 BSA, 5% glycerol, and 50 ng of EXD2 protein and initiated by adding the indicated amount of substrate and incubated at 37 °C for the indicated amounts of time. Reactions were stopped by addition of EDTA to a final concentration of 20 mM and 1/5 volume of formamide. The samples were resolved on denaturing 20% polyacrylamide TBE-Urea gels. Gels were fixed, dried and visualised using a Typhoon FLA 9500 instrument (GE Healthcare). Thin layer chromatography (TLC) was performed as described 53. Briefly, exonuclease reactions were terminated by addition of stop solution (2% SDS, 120 mM EDTA), 1 μl of reaction mixtures was spotted on PEI cellulose thin layer plates (Merck). Plates were developed in 1.0 M Sodium formate pH 3.4 and subsequently visualised using Typhoon FLA 9500 instrument (GE Healthcare). The PhiX174 circular single-stranded substrate (30 μM nucleotides) from New England Biolabs was incubated with MRN complex (50 nM) in the presence or absence of His-EXD2 (K76-S589) (350 nM) or corresponding mutant protein in buffer containing (20 mM HEPES-KOH, pH 7.5, 50 mM KCl, 0.5 mM DTT, 5 mM MnCl2, 0.05% Triton-X, 0.1 mg ml−1 BSA, 5% glycerol, 1 mM ATP). After 2 hours the reaction was stopped by adding 1/5 volume of Stop solution (2% SDS, 50 mM EDTA). Reactions were resolved on agarose gels, stained with Sybr Gold and visualised using a Typhoon FLA 9500 instrument (GE Healthcare). ER-AsiSI resection assay The level of resection adjacent to specific DSB (Chr 1: 89231183) was measured as described 40 with some modifications. Briefly ER-AsiSI U2OS cells were treated with 300 nM of 4-hydroxytamoxifen (4-OHT, Sigma) for 1 hour to allow the AsiSI enzyme to enter the nucleus and induce DSBs. Cells were then harvested and genomic DNA was extracted as previously described 40. Genomic DNA was then digested with the BsrGI enzyme or mock digested and was used as a template for qPCR performed using iTaq Universal Sybr Green Mix (Bio-Rad) and Rotor-Gene (Corbett Research) qPCR system. Primers used are listed in Supplementary Table 4 40. The percentage of ssDNA was calculated as previously described 40. All data were then related to the siControl treated sample, which was set as 100%. Statistical significance was determined with the Student’s t-test. Generation of EXD2−/− cells by CRISP/Cas9 The following guide RNA (gRNA) sequences targeting first exon of EXD2 were selected using Optimized CRISPR Design tool (http://crispr.mit.edu; 54: gRNA1 AAGGCATCCAGCGCCGCCGA, gRNA2 CCCTACAGCCACACCCAGAA. DNA oligonucleotides were purchased from IDT and cloned into pX335-GFP vector 48 to generate targeting constructs that were subsequently co-transfected in an equimolar ratio into HeLa cells using Lipofectamine. 24 hours after transfection, cells were sorted using a MoFlo cell sorter (Beckman Coulter) for cells expressing Cas9 nickase (GFP-positive cells) and left to recover for 6 days before sorting for single cells and allowing colonies to form. EXD2 expression was analysed by western blotting. Two clones showing loss of all detectable EXD2 were selected for subsequent analysis. Chromatin fractionation HeLa cells were treated with 500 μM phleomycin for 1 hour, washed with ice cold PBS, scraped into PBS and the chromatin fractionation was performed as described 55, 56. Briefly, cells were resuspended in buffer A (10 mM Hepes-KOH pH7.9, 10 mM KCl, 1.5 MgCl2, 340 mM Sucrose, 10% glycerol, 1 mM DTT, protease inhibitors) and Triton X-100 was added to final concentration 0.1 %. After 5 min incubation on ice, nuclei were spun down at 1300 × g for 4 min. Pelleted nuclei were washed with buffer A, resuspended in buffer B (3 mM EDTA, 0.2 mM EGTA, 1 mM DTT, protease inhibitors) and lysed for 20 min on ice before centrifugation at 1700 × g for 5 min. Supernatant (nuclear soluble fraction) was saved, and pellet (chromatin fraction) was washed with buffer B, resuspended in urea buffer (9 M urea, 50 mM Tris-HCl, pH 7.3) and sonicated. Statistics and reproducibility Microsoft Excel or Prism 6 software were used to perform statistical analyses. Detailed information (statistical tests used, number of independent experiments, P values) are listed in individual figure legends. All experiments were repeated at least twice unless stated otherwise. Supplementary Material Supplementary Information Supplementary Table 1 Supplementary Table 2 Supplementary Table 3 Supplementary Table 4 Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3 Supplementary Figure 4 Supplementary Figure 5 Supplementary Figure 6 Supplementary Figure 7
Section	EXD2 is required for repair of damage to DNA In an effort to identify factors required to promote HR, we carried out an unbiased proteomic approach to define the CtIP interactome. Here, we have identified EXD2, a largely uncharacterized protein with a putative exonuclease domain, as a candidate CtIP binding partner (Fig. 1a). We validated this interaction by co-immunoprecipitations from human cell extracts and found that we could readily detect endogenous EXD2 by western blotting of GFP-CtIP immunoprecipitates (Fig. 1b). Endogenous CtIP, as well as its known interactors MRE11 and BRCA1 were detected in a reciprocal FLAG-EXD2 immunoprecipitates (Fig. 1c; lysates were treated with benzonase to prevent DNA bridging). Therefore, we conclude that the two proteins likely exist in the same complex in cells. EXD2 is highly conserved across vertebrates (Supplementary Fig. 1) and was recently identified in the screen for suppression of sensitivity to mitomycin C 24. However, the biological and biochemical features of this protein are unknown. Since we identified EXD2 as an interactor of DBS-repair factors we tested its requirement in response to a range of DSBs-inducing agents namely, ionizing radiation (IR), campthotecin (CPT) and phleomycin. We found that depletion of EXD2 by two different siRNAs sensitized U2OS cells to these agents (Fig. 1d, e, f and Supplementary Fig. 2a and b). Taken together these results suggest a putative role for this protein in the repair of damaged DNA.
Title	EXD2 is required for repair of damage to DNA
Section	EXD2 promotes DNA end resection and the generation of ssDNA CtIP is essential for efficient DNA end processing during DSB repair, with cells depleted for this factor showing a defect in the generation of single stranded DNA (ssDNA) and the subsequent formation of RPA foci 16, 25, 26. Thus we hypothesized that EXD2 may promote DNA end resection. To test this, we analysed RPA focus formation in response to both CPT and IR in WT and EXD2-depleted cells. Strikingly, cells depleted for EXD2 showed severely impaired kinetics of RPA focus formation in response to both treatments (Fig. 2a and b and Supplementary Fig. 2c and d). RPA2 phosphorylation at S4 and S8 has been widely used as a marker for the generation of single-stranded DNA by DNA-end resection 27. Consistent with the data above, EXD2 depleted cells showed impaired RPA S4/S8 phosphorylation in response to DNA damage (Fig. 2c and Supplementary Fig. 2e). Treatment with both agents resulted in a robust phosphorylation of histone H2AX and CHK2 (Fig. 2c and Supplementary Fig. 2e), confirming induction of DNA damage in cells. Moreover, since these responses were intact in EXD2-depleted cells, EXD2 is most likely not required for initial sensing of the DNA damage. Failure to generate RPA foci could be associated with either a defect in exonucleolytic processing of the DSB into ssDNA, or with impaired recruitment of RPA itself to ssDNA. To distinguish between these two possibilities we tested the efficiency of ssDNA generation in EXD2-depleted cells exposed to DNA damage. To this end, we labelled cells with BrdU and then employed immunofluorescence microscopy using an anti-BrdU antibody under non-denaturing conditions to detect stretches of ssDNA. Depletion of EXD2 significantly reduced formation of ssDNA foci (Fig. 2d and e) suggesting impaired resection. This is reminiscent of the phenotype observed in cells depleted for essential components of DNA end resection machinery, such as MRE11 or CtIP 6, 16. Importantly, these phenotypes were not due to changes in the cell cycle, as EXD2-depletion had little effect on the overall cell-cycle distribution profile (Supplementary Fig. 2f). Despite multiple attempts, we were unable to visualise EXD2 recruitment to DNA damage foci. In this regard, we note that certain other proteins involved in DNA repair do not readily form cytologically discernible foci in mammalian cells i.e. Ku70, Ku80 or DNA2. However, EXD2 was recruited to chromatin in HeLa cells upon DNA damage as assayed by subcellular fractionation (Fig. 2f), supporting its putative role in the processing of DSBs. A similar recruitment was also observed for the key resection factor MRE11 (Fig. 2f). Taken together, these results indicate that EXD2 is a putative component of the resection machinery required for the efficient processing of DSBs.
Title	EXD2 promotes DNA end resection and the generation of ssDNA
Section	EXD2 promotes homologous recombination and suppresses genome instability In vivo, RPA is required for RAD51 focus formation and in vitro it has been shown to promote RAD51-mediated strand exchange 28, 29. Consistent with this, treatment of U2OS cells with IR generated large numbers of RAD51 foci (Fig. 3a and b). In contrast, EXD2 depletion significantly impaired RAD51 focus formation (Fig. 3a and b). RAD51-ssDNA nucleoprotein filament formation is a crucial step in DSB repair by HR 30-32. To examine if EXD2 is also required for efficient HR we used a U2OS cell line carrying an integrated homologous recombination reporter transgene and an I-SceI recognition sequence 33. Transient expression of I-SceI endonuclease generates a DSB that, when repaired by HR, restores the expression of a functional GFP protein. We found that depletion of EXD2 significantly decreased the frequency of homologous recombination (Fig. 3c). Cells defective in HR are intrinsically sensitive to PARP inhibitors 34. Accordingly, EXD2-depletion sensitised cells to the PARP inhibitor olaparib (Fig. 3d). Failure to efficiently repair damaged DNA is associated with chromosomal instability and in line with this, we found a significantly greater number of chromosomal aberrations in EXD2-depleted U2OS cells as compared to the WT control (Fig. 3e). Taken together this data supports a role of EXD2 in promoting homologous recombination and genome stability.
Title	EXD2 promotes homologous recombination and suppresses genome instability
Section	EXD2’s exonuclease activity facilitates the generation of ssDNA The MRN complex processes DSBs to generate ssDNA, which requires MRE11’s 3′-5′ exonuclease activity 20, 35. Interestingly, EXD2 has a predicted exonuclease fold, which has sequence homology to the 3′-5′ exonuclease domain of the Werner syndrome protein (WRN). Analysis of the alignment between EXD2 and WRN identified two key amino acids (D108 and E110) within the putative exonuclease domain of EXD2, which are also highly conserved in other DnaQ type exonucleases, including WRN, that coordinate the binding of metal ions within the active site 36 (Supplementary Fig. 3a). Mutation of the equivalent residues in WRN (D82 and E84) renders the protein devoid of nuclease activity 37. Therefore, we hypothesized that the equivalent residues in EXD2 may be also required for its putative nuclease activity. To test this, we expressed the full length GST-tagged EXD2 and the D108A and E110A mutant protein in bacteria, and purified them to apparent homogeneity (Supplementary Fig. 3b). Next, we tested the activity of these purified proteins on single stranded DNA radiolabeled on the 3′ or 5′ end (Fig. 4a and b). We found that purified EXD2, but not the D108A and E110A mutant, exhibited a robust nuclease activity on short 5′ labeled ssDNA (Fig. 4a). Furthermore, a time course of the 3′ labelled substrate digestion indicates that EXD2 degrades the labelled DNA strand from the 3′ end, as evidenced by the release of the single labelled nucleotide (Fig. 4b). This data shows that EXD2 displays a 3′-5′ exonuclease activity in vitro. Moreover, under these conditions the WT protein exhibited only weak activity towards blunt end double stranded DNA (Fig. 4c). To verify this data, we also identified a highly-soluble truncated form of EXD2 (spanning residues lysine 76 through to valine 564, containing the predicted exonuclease domain) that can be produced at very high yields and purity in a three-step procedure (Supplementary Fig. 3c-e). This version of EXD2, and its D108A E110A variant, behaved indistinguishably from full-length EXD2 (Supplementary Fig. 3f). In addition, the protein showed only a weak activity towards dsDNA with resected 3’end (Fig. 4d), and did not display any endonuclease activity on ssDNA or dsDNA with biotin/streptavidin blocked 3′ end (Fig. 4e). Importantly, purified EXD2 displayed a robust exonuclease activity, which co-elutes with the protein (Fig. 4f). Thus our data identify EXD2 as a bone fide exonuclease with a 3′-5′ polarity. To address the potential biological significance of EXD2’s exonuclease activity, we tested whether this activity was required to promote DNA-end resection in vivo. To this end, we examined the phenotypes of two independently derived U2OS clones stably expressing wild-type or the nuclease-dead (D108A and E110A) EXD2 mutant. The endogenous protein was depleted with siRNA targeting the 3′ un-translated region (UTR) of EXD2 (Supplementary Fig. 4a). Notably, cells expressing the nuclease-dead protein did not correct phenotypes associated with EXD2 deficiency as compared to cells expressing wild-type EXD2 (Fig. 5a-d). This result is consistent with our data showing a requirement for EXD2 in the processing of DSBs into ssDNA. Cells overexpressing WT EXD2 displayed elevated resection. In this regard we note that overexpression of WT MRE11 also increases resection efficiency resulting in elevated levels of RPA foci formation and RPA phosphorylation 38.
Title	EXD2’s exonuclease activity facilitates the generation of ssDNA
Section	EXD2 cooperates with MRE11 in the repair of DSBs The in vivo resection that initiates DSB repair is catalysed by the MRN complex 6, 7, 14, 39. To test whether or not EXD2 collaborates in this process with MRE11 we analysed the kinetics of RPA foci formation (a marker of resection) in cells depleted for either of these proteins or concomitantly depleted for both EXD2 and MRE11. We found that combined depletion resulted in a comparable inhibition of resection as observed for depletion of MRE11 alone (Fig. 6a). A similar relationship was also observed for RAD51 foci (Supplementary Fig. 4b and c). Interestingly, the defect observed in EXD2-depleted cells was slightly weaker than that observed in MRE11 alone, suggesting that MRE11 functions upstream of EXD2 in DNA resection, perhaps initiating resection through its endonuclease activity. Indeed, it has been suggested recently that MRE11 may create multiple nicks on the strand being resected that could serve as additional exonuclease entry sites to further enhance nucleolytic processing 21, 22. We tested this notion in several ways. First, we analysed if MRN-dependent DNA resection is accelerated in the presence of EXD2. Purified EXD2 and the MRN complex (MRE11, RAD50, NBS1) were incubated together with circular single-stranded PhiX174 DNA. This substrate requires initial endonuclease-dependent nicking by the MRN complex in order to undergo resection. As previously reported, the MRN complex exhibited nuclease activity under these conditions 16 (Fig. 6b). Importantly, combining EXD2 with the MRN complex resulted in increased ssDNA degradation in vitro (Fig. 6b and c). As expected, addition of exonuclease-dead EXD2 protein to the MRN complex resulted in DNA degradation similar to what we observed for MRN alone (Fig. 6b and c). Secondly, we predicted that EXD2 should be able to initiate resection from a nicked and a gapped duplex substrate designed to mimic the substrates generated by MRE11 endonuclease activity during the initial stage of DNA-end resection. Strikingly, EXD2 exhibited robust exonuclease activity on both the nicked and gapped substrates (Fig. 6d, e and f and Supplementary Fig. 4d and e). Taken together, these data show that EXD2 functionally collaborate with the MRN complex in promoting DNA degradation. To gain more functional insight into the role of EXD2’s exonuclease activity in DNA-end resection in vivo, we took advantage of the recently developed small molecule inhibitors targeting the exo- or endonuclease activity of MRE11 23. Inhibition of MRE11 endonuclease activity resulted in almost total inhibition of resection, whereas cells treated with the MRE11 exonuclease inhibitor showed milder resection defect (Fig. 7a) as reported previously 23. Knockdown of EXD2 alone resulted in a resection defect significantly stronger (p<0.0001) than the one observed in cells treated with the MRE11 exonuclease inhibitor alone. Depletion of EXD2 in the presence of the MRE11 exonuclease inhibitor did not decrease efficiency of resection further than what was achieved with EXD2 depletion alone (Fig. 7a). Interestingly, some residual resection was still observed in cells concomitantly depleted for EXD2 and incubated with the MRE11 exonuclease inhibitor, indicating either an involvement of another exonuclease in this step of DNA-end processing 23 or that EXD2 knockdown or MRE11 exonuclease inhibition was not complete. Nevertheless, this data suggests that both the exonuclease activity of EXD2 and that of MRE11 function within the same pathway and are required for efficient DNA end-resection. Knockdown of EXD2 in cells treated with an inhibitor targeting MRE11’s endonuclease activity showed a similar resection defect when compared to the inhibitor alone (Fig. 7a), supporting the notion that EXD2 functions downstream of MRE11’s endonuclease activity. Next, we asked which part of the resection process i.e. short-range vs. long-range resection is affected in cells depleted for EXD2. To test this, we depleted EXD2 in a cell line allowing for the induction of a DSB in a specific genomic locus in vivo 40. Then we analysed the efficiency of DNA resection at this DSB by q-PCR at two positions: one located close to the break (335bp downstream of the break - short range resection) and the other located at 1618bp from the break (long range resection) 40. Interestingly, we found that EXD2-depletion affected both short range as well as long-range resection (Fig. 7b and c and Supplementary Fig. 4f). Knockdown of MRE11 resulted in a similar albeit stronger resection phenotype thus providing further evidence to support its upstream function in this process. Importantly, concomitant depletion of both proteins did not further potentiate the resection defect. Given that both EXD2 and MRE11 regulate DSB resection, we tested the effect of their combined depletion on homologous recombination using the DR-GFP assay. In support of their role in this process, we observed that combined depletion of EXD2 and MRE11 did not decrease homologous recombination efficiency further than what we observed in the single knockdowns (Fig. 6d and Supplementary Fig. 4g). These findings therefore show that EXD2 promotes DNA end resection and homologous recombination by enhancing the generation of ssDNA through a common mechanism with the MRN complex. Furthermore, it seems likely that MRE11 functions upstream of EXD2 in this process, likely initiating resection through its endonuclease activity. To verify and extend the above conclusions, we used CRISPR-Cas9 nickase based gene editing 41 in HeLa cells to generate EXD2−/− clones (Supplementary Fig. 5a). The use of Cas9 nickase has been recently shown to minimize any off-target effects 42. Comparable to siRNA treated U2OS cells, EXD2−/− HeLa cells showed dramatically decreased RPA focus formation in response to CPT (Supplementary Fig. 5b and c), diminished RPA2 phosphorylation on S4/S8 (Supplementary Fig. 5d) and decreased survival in response to CPT (Supplementary Fig. 5e). We also tested if EXD2 depletion affects the MRE11 or CtIP protein stability and/or their recruitment to DSBs. We found this not to be the case, as cells lacking EXD2 had similar level of endogenous MRE11 or CtIP as the WT control (Supplementary Fig. 5f). Likewise, MRE11 or GFP-CtIP localization to DSBs induced by microirradiation 43 was not affected (Supplementary Fig. 6a, b and c). These finding therefore establish EXD2 as an important regulator of DSBs resection.
Title	EXD2 cooperates with MRE11 in the repair of DSBs
Section	Discussion We have shown that EXD2 facilitates DSB resection thus promoting recruitment of RPA and homologous recombination. Accordingly, cells depleted for EXD2 show spontaneous chromosomal instability and are sensitive to DNA damage induced by agents that generate DSBs. Furthermore, we establish that EXD2 functionally interacts with the MRN complex utilizing its 3′-5′ exonuclease activity to accelerate DSB resection and promote efficient HR. In line with this, complementation experiments showed that exonuclease-dead mutant protein failed to complement these phenotypes. Interestingly, EXD2 seems to be dispensable for the initial sensing of the break as evidenced by efficient γH2AX and CHK2 phosphorylation, and most likely acts downstream of MRE11. Finally we reveal that both, EXD2 and MRE11 function in the same pathway for DSB resection and HR. It is unclear at present why cells would need two exonucleases with the same polarity. However, a paradigm for such a requirement is evident from the fact that cells have two alternate machineries, consisting of BLM-DNA2-RPA-MRN and EXO1-BLM-RPA-MRN that carry out long-range resection9, 10, 13, 44. Thus, by analogy EXD2 may function together with MRE11 to accelerate resection in the 3′-5′ direction in order to efficiently produce short 3′ ssDNA overhangs. This could promote faster generation of longer stretches of ssDNA, which in turn may serve as a better substrate for BLM–DNA2 or BLM-EXO1 to initiate long-range resection. Accordingly, depletion of EXD2 adversely impacts on this process. Ultimately, efficient generation of ssDNA with minimal homology length required for productive HR would supress unscheduled deleterious recombination events. This may be particularly important in vertebrates, as they require significantly longer stretches of ssDNA (200-500 bp) to initiate productive HR 45, which is in contrast to yeast, where as little as 60 bp of 3′ ssDNA is sufficient to support HR 46. Not mutually exclusive is the possibility that EXD2 could also augment resection efficiency under specific circumstances, for instance in the presence of modifications to the damaged DNA and/or polypeptides bound at the 5′ ends. In line with this, we show that in vivo EXD2 depletion impairs short-range resection. Recently, it has been proposed that MRE11 may create multiple incisions on the DNA strand undergoing resection up to 300 bp distal to the break, which could allow for more efficient resection 21, 22. Indeed, inhibition of MRE11’s endonuclease activity seems to be dominant in promoting the generation of ssDNA over its exonuclease activity 23. Thus, we postulate a model whereby EXD2 functionally collaborates with the resection machinery, most likely utilizing DNA nicks generated by MRE11’s endonuclease activity 3′ of the DSB. This would enhance the generation of ssDNA tails required for efficient homologous recombination (model Fig. 6d). In summary, our work identifies EXD2 as a critical factor in the maintenance of genome stability through homologous recombination dependent repair of DSBs, including those induced by commonly used anti-cancer agents, such as IR or CPT. This highlights EXD2 itself and/or its enzymatic activity as a potential candidate for development of anti-cancer drugs.
Title	Discussion
Section	METHODS Cell lines HEK 293FT cells were a kind gift from Dr G. Stewart while HeLa and U2OS cells were a generous gift from Dr F. Esashi. These cell lines were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and standard antibiotics. U2OS cells stably expressing GFP-CtIP and U2OS cells harbouring the HR reporter DR-GFP were a generous gift from Prof. S.P. Jackson and were maintained in media supplemented with 500 μg ml−1 G-418. The ER-AsiSI U2OS cell line 47, a kind gift from Prof. G. Legube, was maintained in DMEM media without phenol red supplemented with 10% dialysed FBS (Life Technologies) and 1 μg ml−1 Puromycin. Cell lines stably expressing FLAG-HA EXD2 WT or D108A/E110A fusion proteins were generated by transfection of U2OS cells with these plasmid constructs followed by clonal selection of cells grown in media containing 500 μg ml−1 G418 (Life Technologies). All cell lines have been verified mycoplasma free by PCR based test (Takara). Plasmids The open reading frame (ORF) of human EXD2 was purchased as a gateway entry clone in the pDONR221 plasmid backbone from DNASU Plasmid Repository (HsCD00295838). Discrepancies in the amino-acid sequence in comparison to the reference sequence for human EXD2 (NM_001193360.1) were corrected by site-directed mutagenesis. Site-directed mutagenesis was then employed to generate EXD2 D108A–E110A in pDONR221. Flag–HA–EXD2 WT and D108A–E110A as well as GST–EXD2 WT and D108A–E110A plasmid constructs were generated by recombination of the WT or D108A–E110A EXD2 ORF in pDONR221 by LR Clonase reaction into either the pHAGE-N-Flag–HA destination vector (a gift from R. Chapman, The Wellcome Trust Centre for Human Genetics, University of Oxford, UK), or the pDEST-pGEX6P-1 destination vector (a gift from C. Green, The Wellcome Trust Centre for Human Genetics, University of Oxford, UK), respectively. LR Clonase reactions were carried out using the Gateway LR Clonase II enzyme mix according to the instructions of the manufacturer (Life Technologies). The pCMV-I-Sce1 plasmid was a gift from V. Macaulay (Department of Oncology, University of Oxford, UK). pmCherry-C1 was obtained from Clontech. pX335-GFP plasmid (pX335 vector48 containing PGK-EGFP-P2A-Neo-pA) was a gift from J. Riepsaame and M. de Bruijn (MRC Molecular Haematology Unit, Weatherall Institute of Molecular Medicine, University of Oxford, UK). His–EXD2 (Lys76–Ser589) construct was generated by cloning of truncated human EXD2 (Lys76–Ser589) in the expression vector pNIC28-Bsa4 (ref. 49), containing an amino-terminal His tag followed by a tobacco etch virus protease cleavage site. The construct was subsequently subjected to site-directed mutagenesis to introduce the D108A–E110A mutations. Plasmids were transfected into human cells using Lipofectamine 2000 (Life Technologies), according to the manufacturer’s instructions. Immunoblotting Cell extracts were prepared by lysing cells in urea buffer (9 M urea, 50 mM Tris HCL, pH 7.3, 150 mM β-mercaptoethanol) followed by sonication using a soniprep 150 (MSE) probe sonicator. Proteins were resolved by SDS-PAGE and transferred to PVDF. Immunoblots were carried out using the indicated antibodies (See Supplementary Table 1) Cell Survival Assay Alamar Blue survival assays were performed in accordance with the manufacturer’s recommendations (Life Technologies). Briefly, 300 cells per well in 96-well plates were untreated or treated with indicated doses of camptothecin, ionising radiation, phleomycin or olaparib and incubated for 7 days. Alamar blue reagent (Life Technologies) was added to each well and fluorometric measurements taken after 2h incubation at 37°C. RNAi treatment siRNAs used in this study are listed in Supplementary Table 2. ON-TARGETplus Non-targeting Pool or siRNA targeting luciferase 50 were used as control siRNAs where appropriate. Immunofluorescence microscopy Antibodies employed for immunofluorescence are listed in Supplementary Table 1. For visualisation of RPA foci, cells were pre-extracted on ice for 2 min (10 mM PIPES, pH 6.8, 300 mM Sucrose, 100 mM NaCl, 1.5 mM MgCl2 and 0.5% TritonX-100) and fixed with 4% paraformaldehyde in PBS for 10 min at room temperature. Coverslips were washed 3 × in PBS and blocked in 10% FBS in PBS for 30 min before incubation with primary antibody in 0.1% FBS in PBS for 1h at room temperature. Unbound primary antibody was removed by washing 4 × 5 min in PBS at room temperature followed by incubation with the indicated secondary antibody for 45 min at room temperature. Slides were then washed 4 × 5 min in PBS before mounting with Vectashield mounting medium (Vector Laboratories) with DAPI. In order to visualise ssDNA foci, the same protocol for RPA focus staining was used, preceded by treatment of cells growing on coverslips with 10 μM BrdU for 24 hours before fixation. In order to visualise RAD51 foci, cells grown on coverslips were fixed with 4% paraformaldehyde in PBS for 10 min at room temperature followed by permeabilisation with 0.5% TritonX-100 in PBS for 10 min at room temperature. Cells were then blocked, incubated with primary and secondary antibodies and mounted for analysis as described above. Confocal microscopy was carried out using a Zeiss LSM 510 laser scanning confocal microscope with Zen 2009 software using a 63x objective. Image analysis was carried out with FIJI (ImageJ) software. Microirradiation experiments Induction of localised DSBs in human cells was carried out as described previously 43. Briefly, cells were grown on coverslips and pre-treated for 24h with 10 μM BrdU before microirradiation. To induce localised DSBs, the media was removed and cells were washed once in PBS, with subsequent removal of excess PBS. Isopore membrane filters (Millipore TMTP02500, 0.5 μM pore size) were placed on top of the coverslips and cells were exposed to 30 J m−2 UVC using a Stratagene UV Stratalinker 2400. Membrane filters were removed and media placed back on the cells which were allowed to recover for the indicated times before fixation. Cells were fixed, permeabilised and blocked as per RAD51 focus staining (described above). Cells expressing GFP-CtIP were stained for GFP (using the GFP-Booster reagent, Chromotek, 1:200,) and γH2AX using the indicated secondary antibody. Images of microirradiated cells were acquired using a DeltaVision DV Elite microscope using either a 40x objective. Image analysis was carried out with FIJI (ImageJ) and Huygens Professional (Scientific Volume Imaging) software. U2OS cells were stained for MRE11 and γH2AX and visualised on a Zeiss LSM 510 confocal microscope using a 40x objective. Image analysis was carried out using FIJI (ImageJ). Immunoprecipitation experiments Lysates for co-immunoprecipitation experiments were prepared as follows; cells were washed twice in PBS and then lysed in IP buffer (100 mM NaCl, 0.2% Igepal CA-630, 1 mM MgCl2, 10% glycerol, 5 mM NaF, 50 mM Tris-HCl, pH 7.5), supplemented with complete EDTA-free protease inhibitor cocktail (Roche) and 25 U ml−1 Benzonase (Novagen). After Benzonase digestion, the NaCl and EDTA concentrations were adjusted to 200 mM and 2 mM, respectively, and lysates cleared by centrifugation (16,000 × g for 25 min). Lysates were then incubated with 20 μl of GFP-Trap agarose beads (ChromoTek) blocked with 5% BSA in IP lysis buffer for 1h at 4 °C in the case of GFP trap IPs or with 20 μl of anti-FLAG M2 affinity gel in the case of FLAG IPs for 2 hours with end-to-end mixing at 4 °C. Complexes were washed extensively in IP buffer (including 200mM NaCl and 2 mM EDTA) before elution. In the case of GFP trap IPs, beads were resuspended in 2X SDS sample buffer and boiled for 3 min before centrifugation at 5000 × g for 5 min. The resultant supernatant fraction was retained as the eluate. In the case of FLAG IPs, beads were incubated for 30 min with gentle agitation at 4 °C in IP buffer supplemented with 400 μM 3x FLAG peptide (Sigma) followed by centrifugation at 5000 × g for 5 min. The resultant supernatant fraction was collected as eluate. For mass spectrometry analyses eluates from immunoprecipitation experiments were analysed by the Mass Spectrometry Laboratory (IBB PAS, Warsaw, Poland) using the Thermo Orbitrap Velos system and protein hits were identified by MASCOT. Chromosomal aberrations Cells were prepared for analyses of chromosomal aberrations as described previously 51. Biriefly, Colcemid (0.1 μg/ml) was added 4 hours prior to cell harvesting. Cells were trypsinized and incubated in 0.075 M KCl for 20 min. After fixing in methanol:acetic acid (3:1) for 30 min, cells were dropped onto slides and stained with Leishman’s solution for 2 min. Slides were then coded and scored blind to the observer. Homologous recombination DR-GFP assay 48 hours after siRNA transfection, U2OS DR-GFP cells 16 were co-transfected using Amaxa nucleofection with an I-SceI expression vector (pCMV-I-SceI) and a vector expressing mCherry fluorescent protein (pmCherry-C1). 24 hours after I-SceI transfection cells were harvested and analysed by flow cytometry (CyAn ADP Analyzer, Beckman Coulter). The percentage of GFP-positive cells among transfected cells (mCherry-positive cells) was determined using Summit 4.3 software. siControl treated sample was set as 100%. Statistical significance was determined with the Student’s t-test. Recombinant protein purification Glutathione S-transferase (GST) tagged proteins were purified as described 51 with some modifications. Briefly, GST protein expression was induced with 0.1 mM IPTG (isopropyl-β-d-thiogalactopyranoside) (Sigma-Aldrich) at 16°C for 18 hours. Bacteria were harvested by centrifugation and resuspended in lysis buffer containing 50 mM Tris-HCl pH 8.0, 150 mM NaCl, 2 mM EDTA, 1 mM DTT, 1% Triton X-100, and protease inhibitors. Lysates were sonicated and cleared by centrifugation. Supernatants were incubated with Glutathione HiCap Matrix (Qiagen) for 2 h with rotation at 4°C. Beads were washed with lysis buffer containing increasing NaCl concentration, elution buffer (50 mM Tris-HCl pH 7.0, 150 mM NaCl, 1 mM EDTA, 1 mM DTT, 0.2% Triton X-100) and resuspended in elution buffer supplemented with PreScission Protease (50 units/ml) (GE Healthcare) and incubated for 18 h with rotation at 4°C. Eluates were dialysed to buffer containing 20 mM Hepes-KOH pH7.2, 100 mM NaCl, 1 mM DTT, 10% glycerol, aliquoted and stored at −80°C. His-EXD2 (K76-S589) protein and corresponding D108A/E110A mutant protein were expressed in E. coli BL21(DE3)-R3-pRARE2cells 49 grown in TB medium and induced with 0.5 mM IPTG at 18°C overnight. Cells were harvested by centrifugation and resuspended in a lysis buffer containing 50mM HEPES, pH 7.5, 500mM NaCl, 10mM imidazole, 5% glycerol, 1 mM TCEP, 0.5% Triton, supplemented with a protease inhibitor mixture (Roche Applied Science). The cells were sonicated, polyethyleneimine was added to 0.15% (w v−1) from a 5% pH7.5 stock solution, and lysates cleared by centrifugation. The supernatant was applied to a Ni-sepharose resin, washed with 50 mM HEPES, pH 7.5, 300 mM NaCl, 45 mM imidazole, 5% glycerol, 1 mM TCEP, 0.5% Triton, 1 mM PMSF and 2 mM benzamidine, and eluted in 50 mM HEPES, pH 7.5, 300 mM NaCl, 300 mM imidazole, 5% glycerol, 1 mM TCEP, 1 mM PMSF and 2 mM benzamidine. The eluate was further purified on two sequential Superdex S200 gel filtration columns in GF buffer (50 mM HEPES, pH 7.5, 500 mM NaCl, 5% glycerol, 1 mM TCEP, 0.1% Triton, 1 mM PMSF and 2 mM benzamidine). At each stage the presence of protein was confirmed on an InstantBlue-stained SDS-PAGE gel, and the identity of the final preparation was confirmed using electrospray ionisation-TOF mass spectrometry. Mass spectrometry indicated that both the WT and D108A, E110A mutant proteins had a shorter mass than predicted. Analysis using PAWS software (Genomic Solutions) suggests the proteins were lacking amino acids 565-589 at the C-terminus, probably due to proteolysis resulting in an EXD2 protein (WT or mutant) that consisted of amino acids K76-V564. In vitro nuclease assay Sequences of DNA oligos used are listed in Supplementary Table 3. In order to generate 3′ end labeled substrates, the indicated ssDNA oligo was labeled using [α-32P] dATP and TdT enzyme (New England Biolabs). To generate 5′ end labeled substrates, the indicated ssDNA oligo was labeled using [γ-32P] dATP and PNK enzyme (New England Biolabs). To obtain dsDNA substrates, complementary ssDNA oligos (as indicated in Supplementary Table 3) were mixed in an equimolar ratio and annealed by heating at 100 °C for 5 min followed by gradual cooling to room temperature. Where indicated DNA substrates with biotin label at 3′ end were used and pre-incubated 5 min at room temperature with 10-fold molar excess of streptavidin (Sigma). Exonuclease assays were performed as described 52 with some modifications. Briefly, reactions were carried out in a buffer containing 20 mM HEPES-KOH, pH 7.5, 50 mM KCl, 0.5 mM DTT, 10 mM MnCl2, 0.05% Triton-X, 0.1 mg ml−1 BSA, 5% glycerol, and 50 ng of EXD2 protein and initiated by adding the indicated amount of substrate and incubated at 37 °C for the indicated amounts of time. Reactions were stopped by addition of EDTA to a final concentration of 20 mM and 1/5 volume of formamide. The samples were resolved on denaturing 20% polyacrylamide TBE-Urea gels. Gels were fixed, dried and visualised using a Typhoon FLA 9500 instrument (GE Healthcare). Thin layer chromatography (TLC) was performed as described 53. Briefly, exonuclease reactions were terminated by addition of stop solution (2% SDS, 120 mM EDTA), 1 μl of reaction mixtures was spotted on PEI cellulose thin layer plates (Merck). Plates were developed in 1.0 M Sodium formate pH 3.4 and subsequently visualised using Typhoon FLA 9500 instrument (GE Healthcare). The PhiX174 circular single-stranded substrate (30 μM nucleotides) from New England Biolabs was incubated with MRN complex (50 nM) in the presence or absence of His-EXD2 (K76-S589) (350 nM) or corresponding mutant protein in buffer containing (20 mM HEPES-KOH, pH 7.5, 50 mM KCl, 0.5 mM DTT, 5 mM MnCl2, 0.05% Triton-X, 0.1 mg ml−1 BSA, 5% glycerol, 1 mM ATP). After 2 hours the reaction was stopped by adding 1/5 volume of Stop solution (2% SDS, 50 mM EDTA). Reactions were resolved on agarose gels, stained with Sybr Gold and visualised using a Typhoon FLA 9500 instrument (GE Healthcare). ER-AsiSI resection assay The level of resection adjacent to specific DSB (Chr 1: 89231183) was measured as described 40 with some modifications. Briefly ER-AsiSI U2OS cells were treated with 300 nM of 4-hydroxytamoxifen (4-OHT, Sigma) for 1 hour to allow the AsiSI enzyme to enter the nucleus and induce DSBs. Cells were then harvested and genomic DNA was extracted as previously described 40. Genomic DNA was then digested with the BsrGI enzyme or mock digested and was used as a template for qPCR performed using iTaq Universal Sybr Green Mix (Bio-Rad) and Rotor-Gene (Corbett Research) qPCR system. Primers used are listed in Supplementary Table 4 40. The percentage of ssDNA was calculated as previously described 40. All data were then related to the siControl treated sample, which was set as 100%. Statistical significance was determined with the Student’s t-test. Generation of EXD2−/− cells by CRISP/Cas9 The following guide RNA (gRNA) sequences targeting first exon of EXD2 were selected using Optimized CRISPR Design tool (http://crispr.mit.edu; 54: gRNA1 AAGGCATCCAGCGCCGCCGA, gRNA2 CCCTACAGCCACACCCAGAA. DNA oligonucleotides were purchased from IDT and cloned into pX335-GFP vector 48 to generate targeting constructs that were subsequently co-transfected in an equimolar ratio into HeLa cells using Lipofectamine. 24 hours after transfection, cells were sorted using a MoFlo cell sorter (Beckman Coulter) for cells expressing Cas9 nickase (GFP-positive cells) and left to recover for 6 days before sorting for single cells and allowing colonies to form. EXD2 expression was analysed by western blotting. Two clones showing loss of all detectable EXD2 were selected for subsequent analysis. Chromatin fractionation HeLa cells were treated with 500 μM phleomycin for 1 hour, washed with ice cold PBS, scraped into PBS and the chromatin fractionation was performed as described 55, 56. Briefly, cells were resuspended in buffer A (10 mM Hepes-KOH pH7.9, 10 mM KCl, 1.5 MgCl2, 340 mM Sucrose, 10% glycerol, 1 mM DTT, protease inhibitors) and Triton X-100 was added to final concentration 0.1 %. After 5 min incubation on ice, nuclei were spun down at 1300 × g for 4 min. Pelleted nuclei were washed with buffer A, resuspended in buffer B (3 mM EDTA, 0.2 mM EGTA, 1 mM DTT, protease inhibitors) and lysed for 20 min on ice before centrifugation at 1700 × g for 5 min. Supernatant (nuclear soluble fraction) was saved, and pellet (chromatin fraction) was washed with buffer B, resuspended in urea buffer (9 M urea, 50 mM Tris-HCl, pH 7.3) and sonicated. Statistics and reproducibility Microsoft Excel or Prism 6 software were used to perform statistical analyses. Detailed information (statistical tests used, number of independent experiments, P values) are listed in individual figure legends. All experiments were repeated at least twice unless stated otherwise.
Title	METHODS
Section	Cell lines HEK 293FT cells were a kind gift from Dr G. Stewart while HeLa and U2OS cells were a generous gift from Dr F. Esashi. These cell lines were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and standard antibiotics. U2OS cells stably expressing GFP-CtIP and U2OS cells harbouring the HR reporter DR-GFP were a generous gift from Prof. S.P. Jackson and were maintained in media supplemented with 500 μg ml−1 G-418. The ER-AsiSI U2OS cell line 47, a kind gift from Prof. G. Legube, was maintained in DMEM media without phenol red supplemented with 10% dialysed FBS (Life Technologies) and 1 μg ml−1 Puromycin. Cell lines stably expressing FLAG-HA EXD2 WT or D108A/E110A fusion proteins were generated by transfection of U2OS cells with these plasmid constructs followed by clonal selection of cells grown in media containing 500 μg ml−1 G418 (Life Technologies). All cell lines have been verified mycoplasma free by PCR based test (Takara).
Title	Cell lines
Section	Plasmids The open reading frame (ORF) of human EXD2 was purchased as a gateway entry clone in the pDONR221 plasmid backbone from DNASU Plasmid Repository (HsCD00295838). Discrepancies in the amino-acid sequence in comparison to the reference sequence for human EXD2 (NM_001193360.1) were corrected by site-directed mutagenesis. Site-directed mutagenesis was then employed to generate EXD2 D108A–E110A in pDONR221. Flag–HA–EXD2 WT and D108A–E110A as well as GST–EXD2 WT and D108A–E110A plasmid constructs were generated by recombination of the WT or D108A–E110A EXD2 ORF in pDONR221 by LR Clonase reaction into either the pHAGE-N-Flag–HA destination vector (a gift from R. Chapman, The Wellcome Trust Centre for Human Genetics, University of Oxford, UK), or the pDEST-pGEX6P-1 destination vector (a gift from C. Green, The Wellcome Trust Centre for Human Genetics, University of Oxford, UK), respectively. LR Clonase reactions were carried out using the Gateway LR Clonase II enzyme mix according to the instructions of the manufacturer (Life Technologies). The pCMV-I-Sce1 plasmid was a gift from V. Macaulay (Department of Oncology, University of Oxford, UK). pmCherry-C1 was obtained from Clontech. pX335-GFP plasmid (pX335 vector48 containing PGK-EGFP-P2A-Neo-pA) was a gift from J. Riepsaame and M. de Bruijn (MRC Molecular Haematology Unit, Weatherall Institute of Molecular Medicine, University of Oxford, UK). His–EXD2 (Lys76–Ser589) construct was generated by cloning of truncated human EXD2 (Lys76–Ser589) in the expression vector pNIC28-Bsa4 (ref. 49), containing an amino-terminal His tag followed by a tobacco etch virus protease cleavage site. The construct was subsequently subjected to site-directed mutagenesis to introduce the D108A–E110A mutations. Plasmids were transfected into human cells using Lipofectamine 2000 (Life Technologies), according to the manufacturer’s instructions.
Title	Plasmids
Section	Immunoblotting Cell extracts were prepared by lysing cells in urea buffer (9 M urea, 50 mM Tris HCL, pH 7.3, 150 mM β-mercaptoethanol) followed by sonication using a soniprep 150 (MSE) probe sonicator. Proteins were resolved by SDS-PAGE and transferred to PVDF. Immunoblots were carried out using the indicated antibodies (See Supplementary Table 1)
Title	Immunoblotting
Section	Cell Survival Assay Alamar Blue survival assays were performed in accordance with the manufacturer’s recommendations (Life Technologies). Briefly, 300 cells per well in 96-well plates were untreated or treated with indicated doses of camptothecin, ionising radiation, phleomycin or olaparib and incubated for 7 days. Alamar blue reagent (Life Technologies) was added to each well and fluorometric measurements taken after 2h incubation at 37°C.
Title	Cell Survival Assay
Section	RNAi treatment siRNAs used in this study are listed in Supplementary Table 2. ON-TARGETplus Non-targeting Pool or siRNA targeting luciferase 50 were used as control siRNAs where appropriate.
Title	RNAi treatment
Section	Immunofluorescence microscopy Antibodies employed for immunofluorescence are listed in Supplementary Table 1. For visualisation of RPA foci, cells were pre-extracted on ice for 2 min (10 mM PIPES, pH 6.8, 300 mM Sucrose, 100 mM NaCl, 1.5 mM MgCl2 and 0.5% TritonX-100) and fixed with 4% paraformaldehyde in PBS for 10 min at room temperature. Coverslips were washed 3 × in PBS and blocked in 10% FBS in PBS for 30 min before incubation with primary antibody in 0.1% FBS in PBS for 1h at room temperature. Unbound primary antibody was removed by washing 4 × 5 min in PBS at room temperature followed by incubation with the indicated secondary antibody for 45 min at room temperature. Slides were then washed 4 × 5 min in PBS before mounting with Vectashield mounting medium (Vector Laboratories) with DAPI. In order to visualise ssDNA foci, the same protocol for RPA focus staining was used, preceded by treatment of cells growing on coverslips with 10 μM BrdU for 24 hours before fixation. In order to visualise RAD51 foci, cells grown on coverslips were fixed with 4% paraformaldehyde in PBS for 10 min at room temperature followed by permeabilisation with 0.5% TritonX-100 in PBS for 10 min at room temperature. Cells were then blocked, incubated with primary and secondary antibodies and mounted for analysis as described above. Confocal microscopy was carried out using a Zeiss LSM 510 laser scanning confocal microscope with Zen 2009 software using a 63x objective. Image analysis was carried out with FIJI (ImageJ) software.
Title	Immunofluorescence microscopy
Section	Microirradiation experiments Induction of localised DSBs in human cells was carried out as described previously 43. Briefly, cells were grown on coverslips and pre-treated for 24h with 10 μM BrdU before microirradiation. To induce localised DSBs, the media was removed and cells were washed once in PBS, with subsequent removal of excess PBS. Isopore membrane filters (Millipore TMTP02500, 0.5 μM pore size) were placed on top of the coverslips and cells were exposed to 30 J m−2 UVC using a Stratagene UV Stratalinker 2400. Membrane filters were removed and media placed back on the cells which were allowed to recover for the indicated times before fixation. Cells were fixed, permeabilised and blocked as per RAD51 focus staining (described above). Cells expressing GFP-CtIP were stained for GFP (using the GFP-Booster reagent, Chromotek, 1:200,) and γH2AX using the indicated secondary antibody. Images of microirradiated cells were acquired using a DeltaVision DV Elite microscope using either a 40x objective. Image analysis was carried out with FIJI (ImageJ) and Huygens Professional (Scientific Volume Imaging) software. U2OS cells were stained for MRE11 and γH2AX and visualised on a Zeiss LSM 510 confocal microscope using a 40x objective. Image analysis was carried out using FIJI (ImageJ).
Title	Microirradiation experiments
Section	Immunoprecipitation experiments Lysates for co-immunoprecipitation experiments were prepared as follows; cells were washed twice in PBS and then lysed in IP buffer (100 mM NaCl, 0.2% Igepal CA-630, 1 mM MgCl2, 10% glycerol, 5 mM NaF, 50 mM Tris-HCl, pH 7.5), supplemented with complete EDTA-free protease inhibitor cocktail (Roche) and 25 U ml−1 Benzonase (Novagen). After Benzonase digestion, the NaCl and EDTA concentrations were adjusted to 200 mM and 2 mM, respectively, and lysates cleared by centrifugation (16,000 × g for 25 min). Lysates were then incubated with 20 μl of GFP-Trap agarose beads (ChromoTek) blocked with 5% BSA in IP lysis buffer for 1h at 4 °C in the case of GFP trap IPs or with 20 μl of anti-FLAG M2 affinity gel in the case of FLAG IPs for 2 hours with end-to-end mixing at 4 °C. Complexes were washed extensively in IP buffer (including 200mM NaCl and 2 mM EDTA) before elution. In the case of GFP trap IPs, beads were resuspended in 2X SDS sample buffer and boiled for 3 min before centrifugation at 5000 × g for 5 min. The resultant supernatant fraction was retained as the eluate. In the case of FLAG IPs, beads were incubated for 30 min with gentle agitation at 4 °C in IP buffer supplemented with 400 μM 3x FLAG peptide (Sigma) followed by centrifugation at 5000 × g for 5 min. The resultant supernatant fraction was collected as eluate. For mass spectrometry analyses eluates from immunoprecipitation experiments were analysed by the Mass Spectrometry Laboratory (IBB PAS, Warsaw, Poland) using the Thermo Orbitrap Velos system and protein hits were identified by MASCOT.
Title	Immunoprecipitation experiments
Section	Chromosomal aberrations Cells were prepared for analyses of chromosomal aberrations as described previously 51. Biriefly, Colcemid (0.1 μg/ml) was added 4 hours prior to cell harvesting. Cells were trypsinized and incubated in 0.075 M KCl for 20 min. After fixing in methanol:acetic acid (3:1) for 30 min, cells were dropped onto slides and stained with Leishman’s solution for 2 min. Slides were then coded and scored blind to the observer.
Title	Chromosomal aberrations
Section	Homologous recombination DR-GFP assay 48 hours after siRNA transfection, U2OS DR-GFP cells 16 were co-transfected using Amaxa nucleofection with an I-SceI expression vector (pCMV-I-SceI) and a vector expressing mCherry fluorescent protein (pmCherry-C1). 24 hours after I-SceI transfection cells were harvested and analysed by flow cytometry (CyAn ADP Analyzer, Beckman Coulter). The percentage of GFP-positive cells among transfected cells (mCherry-positive cells) was determined using Summit 4.3 software. siControl treated sample was set as 100%. Statistical significance was determined with the Student’s t-test.
Title	Homologous recombination DR-GFP assay
Section	Recombinant protein purification Glutathione S-transferase (GST) tagged proteins were purified as described 51 with some modifications. Briefly, GST protein expression was induced with 0.1 mM IPTG (isopropyl-β-d-thiogalactopyranoside) (Sigma-Aldrich) at 16°C for 18 hours. Bacteria were harvested by centrifugation and resuspended in lysis buffer containing 50 mM Tris-HCl pH 8.0, 150 mM NaCl, 2 mM EDTA, 1 mM DTT, 1% Triton X-100, and protease inhibitors. Lysates were sonicated and cleared by centrifugation. Supernatants were incubated with Glutathione HiCap Matrix (Qiagen) for 2 h with rotation at 4°C. Beads were washed with lysis buffer containing increasing NaCl concentration, elution buffer (50 mM Tris-HCl pH 7.0, 150 mM NaCl, 1 mM EDTA, 1 mM DTT, 0.2% Triton X-100) and resuspended in elution buffer supplemented with PreScission Protease (50 units/ml) (GE Healthcare) and incubated for 18 h with rotation at 4°C. Eluates were dialysed to buffer containing 20 mM Hepes-KOH pH7.2, 100 mM NaCl, 1 mM DTT, 10% glycerol, aliquoted and stored at −80°C. His-EXD2 (K76-S589) protein and corresponding D108A/E110A mutant protein were expressed in E. coli BL21(DE3)-R3-pRARE2cells 49 grown in TB medium and induced with 0.5 mM IPTG at 18°C overnight. Cells were harvested by centrifugation and resuspended in a lysis buffer containing 50mM HEPES, pH 7.5, 500mM NaCl, 10mM imidazole, 5% glycerol, 1 mM TCEP, 0.5% Triton, supplemented with a protease inhibitor mixture (Roche Applied Science). The cells were sonicated, polyethyleneimine was added to 0.15% (w v−1) from a 5% pH7.5 stock solution, and lysates cleared by centrifugation. The supernatant was applied to a Ni-sepharose resin, washed with 50 mM HEPES, pH 7.5, 300 mM NaCl, 45 mM imidazole, 5% glycerol, 1 mM TCEP, 0.5% Triton, 1 mM PMSF and 2 mM benzamidine, and eluted in 50 mM HEPES, pH 7.5, 300 mM NaCl, 300 mM imidazole, 5% glycerol, 1 mM TCEP, 1 mM PMSF and 2 mM benzamidine. The eluate was further purified on two sequential Superdex S200 gel filtration columns in GF buffer (50 mM HEPES, pH 7.5, 500 mM NaCl, 5% glycerol, 1 mM TCEP, 0.1% Triton, 1 mM PMSF and 2 mM benzamidine). At each stage the presence of protein was confirmed on an InstantBlue-stained SDS-PAGE gel, and the identity of the final preparation was confirmed using electrospray ionisation-TOF mass spectrometry. Mass spectrometry indicated that both the WT and D108A, E110A mutant proteins had a shorter mass than predicted. Analysis using PAWS software (Genomic Solutions) suggests the proteins were lacking amino acids 565-589 at the C-terminus, probably due to proteolysis resulting in an EXD2 protein (WT or mutant) that consisted of amino acids K76-V564.
Title	Recombinant protein purification
Section	In vitro nuclease assay Sequences of DNA oligos used are listed in Supplementary Table 3. In order to generate 3′ end labeled substrates, the indicated ssDNA oligo was labeled using [α-32P] dATP and TdT enzyme (New England Biolabs). To generate 5′ end labeled substrates, the indicated ssDNA oligo was labeled using [γ-32P] dATP and PNK enzyme (New England Biolabs). To obtain dsDNA substrates, complementary ssDNA oligos (as indicated in Supplementary Table 3) were mixed in an equimolar ratio and annealed by heating at 100 °C for 5 min followed by gradual cooling to room temperature. Where indicated DNA substrates with biotin label at 3′ end were used and pre-incubated 5 min at room temperature with 10-fold molar excess of streptavidin (Sigma). Exonuclease assays were performed as described 52 with some modifications. Briefly, reactions were carried out in a buffer containing 20 mM HEPES-KOH, pH 7.5, 50 mM KCl, 0.5 mM DTT, 10 mM MnCl2, 0.05% Triton-X, 0.1 mg ml−1 BSA, 5% glycerol, and 50 ng of EXD2 protein and initiated by adding the indicated amount of substrate and incubated at 37 °C for the indicated amounts of time. Reactions were stopped by addition of EDTA to a final concentration of 20 mM and 1/5 volume of formamide. The samples were resolved on denaturing 20% polyacrylamide TBE-Urea gels. Gels were fixed, dried and visualised using a Typhoon FLA 9500 instrument (GE Healthcare). Thin layer chromatography (TLC) was performed as described 53. Briefly, exonuclease reactions were terminated by addition of stop solution (2% SDS, 120 mM EDTA), 1 μl of reaction mixtures was spotted on PEI cellulose thin layer plates (Merck). Plates were developed in 1.0 M Sodium formate pH 3.4 and subsequently visualised using Typhoon FLA 9500 instrument (GE Healthcare). The PhiX174 circular single-stranded substrate (30 μM nucleotides) from New England Biolabs was incubated with MRN complex (50 nM) in the presence or absence of His-EXD2 (K76-S589) (350 nM) or corresponding mutant protein in buffer containing (20 mM HEPES-KOH, pH 7.5, 50 mM KCl, 0.5 mM DTT, 5 mM MnCl2, 0.05% Triton-X, 0.1 mg ml−1 BSA, 5% glycerol, 1 mM ATP). After 2 hours the reaction was stopped by adding 1/5 volume of Stop solution (2% SDS, 50 mM EDTA). Reactions were resolved on agarose gels, stained with Sybr Gold and visualised using a Typhoon FLA 9500 instrument (GE Healthcare).
Title	In vitro nuclease assay
Section	ER-AsiSI resection assay The level of resection adjacent to specific DSB (Chr 1: 89231183) was measured as described 40 with some modifications. Briefly ER-AsiSI U2OS cells were treated with 300 nM of 4-hydroxytamoxifen (4-OHT, Sigma) for 1 hour to allow the AsiSI enzyme to enter the nucleus and induce DSBs. Cells were then harvested and genomic DNA was extracted as previously described 40. Genomic DNA was then digested with the BsrGI enzyme or mock digested and was used as a template for qPCR performed using iTaq Universal Sybr Green Mix (Bio-Rad) and Rotor-Gene (Corbett Research) qPCR system. Primers used are listed in Supplementary Table 4 40. The percentage of ssDNA was calculated as previously described 40. All data were then related to the siControl treated sample, which was set as 100%. Statistical significance was determined with the Student’s t-test.
Title	ER-AsiSI resection assay
Section	Generation of EXD2−/− cells by CRISP/Cas9 The following guide RNA (gRNA) sequences targeting first exon of EXD2 were selected using Optimized CRISPR Design tool (http://crispr.mit.edu; 54: gRNA1 AAGGCATCCAGCGCCGCCGA, gRNA2 CCCTACAGCCACACCCAGAA. DNA oligonucleotides were purchased from IDT and cloned into pX335-GFP vector 48 to generate targeting constructs that were subsequently co-transfected in an equimolar ratio into HeLa cells using Lipofectamine. 24 hours after transfection, cells were sorted using a MoFlo cell sorter (Beckman Coulter) for cells expressing Cas9 nickase (GFP-positive cells) and left to recover for 6 days before sorting for single cells and allowing colonies to form. EXD2 expression was analysed by western blotting. Two clones showing loss of all detectable EXD2 were selected for subsequent analysis.
Title	Generation of EXD2−/− cells by CRISP/Cas9
Section	Chromatin fractionation HeLa cells were treated with 500 μM phleomycin for 1 hour, washed with ice cold PBS, scraped into PBS and the chromatin fractionation was performed as described 55, 56. Briefly, cells were resuspended in buffer A (10 mM Hepes-KOH pH7.9, 10 mM KCl, 1.5 MgCl2, 340 mM Sucrose, 10% glycerol, 1 mM DTT, protease inhibitors) and Triton X-100 was added to final concentration 0.1 %. After 5 min incubation on ice, nuclei were spun down at 1300 × g for 4 min. Pelleted nuclei were washed with buffer A, resuspended in buffer B (3 mM EDTA, 0.2 mM EGTA, 1 mM DTT, protease inhibitors) and lysed for 20 min on ice before centrifugation at 1700 × g for 5 min. Supernatant (nuclear soluble fraction) was saved, and pellet (chromatin fraction) was washed with buffer B, resuspended in urea buffer (9 M urea, 50 mM Tris-HCl, pH 7.3) and sonicated.
Title	Chromatin fractionation
Section	Statistics and reproducibility Microsoft Excel or Prism 6 software were used to perform statistical analyses. Detailed information (statistical tests used, number of independent experiments, P values) are listed in individual figure legends. All experiments were repeated at least twice unless stated otherwise.
Title	Statistics and reproducibility
Section	Supplementary Material Supplementary Information Supplementary Table 1 Supplementary Table 2 Supplementary Table 3 Supplementary Table 4 Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3 Supplementary Figure 4 Supplementary Figure 5 Supplementary Figure 6 Supplementary Figure 7
Title	Supplementary Material

Annnotations TAB TSV DIC JSON TextAE

Denotations: 0
Blocks: 0
Relations: 0

PMC:4829102 / 37083-37954 JSONTXT

Document structure show

Annnotations TAB TSV DIC JSON TextAE

PMC:4829102 / 37083-37954 JSON TXT