LitCovid-sentences  

PMC:7019868 / 9329-12954 JSONTXT 10 Projects

Annnotations TAB TSV DIC JSON TextAE

Id Subject Object Predicate Lexical cue
T65 0-4 Sentence denotes 2.4.
T66 5-112 Sentence denotes In Vitro Characterization of Recombinant iPEDVPT-P5, iPEDVPT-P96, iPEDVPT-P5-96S and iPEDVPT-P96-5S Viruses
T67 114-120 Sentence denotes 2.4.1.
T68 121-167 Sentence denotes Immunofluorescence Assay and Syncytia Analysis
T69 168-285 Sentence denotes Immunofluorescence assay (IFA) was performed to detect PEDV antigens as previously described with modifications [18].
T70 286-438 Sentence denotes Briefly, Vero cells in 96-well plates (1.75 × 104 cells/well) were infected with the designated P1viruses at a multiplicity of infection (MOI) of 0.005.
T71 439-647 Sentence denotes At 18 h post-infection, cells were fixed with 80% ice-cold acetone, air-dried, and then incubated with an in-house anti-PEDV S antibody, P4B [20], at a dilution of 1:1000 at room temperature (RT) for 1 h (h).
T72 648-860 Sentence denotes After being washed three times with phosphate-buffered saline (PBS), the FITC-conjugated monoclonal goat anti-mouse-IG antibody (BD Pharmingen, San Jose, CA, USA) was applied at a dilution of 1:500 at RT for 1 h.
T73 861-1034 Sentence denotes Following the final wash step, the cells were counterstained with mounting medium with 4′,6-diamidino-2-phenylindole (DAPI; Abcam, Cambridge, MA, USA) in the dark for 1 min.
T74 1035-1134 Sentence denotes Images were visualized and captured using ZOE fluorescent cell imager (Bio-Rad, Hercules, CA, USA).
T75 1135-1246 Sentence denotes Syncytia analysis were performed concurrently along with IFA by calculating the number of nuclei per syncytium.
T76 1248-1254 Sentence denotes 2.4.2.
T77 1255-1272 Sentence denotes Sequence Analysis
T78 1273-1918 Sentence denotes Sequence analysis was conducted as described previously [18,19] and two primer pairs (SF-7: ACTCTCGACTGGACATTC and 2R: CAGACTTCGAGACATCTTTG; 5FR-3: ATTAGAGCGATTCTCCATGAC and 5FR-6: TACACACATTGTGGTGCTATTGAG) targeting the C-terminal end of the S gene, which contained both naturally occurred and artificially introduced marker mutations (Figure 1, asterisks and Table 1), as well as the non-structural protein 15 (nsp 15) gene, which contained a naturally occurred mutation (G19470T) were used to verify the identities of the four P1 viral stocks and the recombinant viruses shed in feces per group at the time point of peak fecal viral shedding.
T79 1920-1926 Sentence denotes 2.4.3.
T80 1927-1976 Sentence denotes Growth Kinetics, Viral Titration and Plaque Assay
T81 1977-2151 Sentence denotes Confluent monolayers of Vero cells were seeded onto six-well plates (5 × 105 cells/well) and infected with each virus at a MOI of 1 and 0.001 at 37 °C for 1 h in triplicates.
T82 2152-2262 Sentence denotes The cells were then washed twice with Dulbecco’s phosphate-buffered saline (DPBS) and maintained in PI medium.
T83 2263-2460 Sentence denotes The supernatants at indicated time points were collected and proceeded for viral quantification on Vero cells in 96-well plates using the standard 50% tissue-culture infectious dose (TCID50) assay.
T84 2461-2664 Sentence denotes In brief, Vero cells in 96-well plates were washed twice with DPBS and then incubated with a 10-fold serially diluted culture supernatant acquired from the aforementioned six-well plate at 37 °C for 1 h.
T85 2665-2766 Sentence denotes After absorption, the inoculum was removed and replaced with fresh PI-medium following one wash step.
T86 2767-2851 Sentence denotes The titers were determined at 72 h post-infection using the Reed–Muench method [21].
T87 2852-2946 Sentence denotes Plaque assays were performed as previously described [19] to characterize plaque morphologies.
T88 2947-3164 Sentence denotes Briefly, after absorption of PEDVs at an MOI of 0.0001, confluent monolayers of Vero cells in six-well plates were washed twice with DPBS and then covered with an overlay of pre-warmed PI medium containing 1% agarose.
T89 3165-3275 Sentence denotes After solidification of the overlays, the plates were incubated at 37 °C for 72 h to produce distinct plaques.
T90 3276-3384 Sentence denotes The cells were then fixed in 3.16% neutral-buffered formalin for 1 h before removing the semisolid overlays.
T91 3385-3477 Sentence denotes The plates were stained with 1% crystal violet in 20% ethanol and distilled water for 1 min.
T92 3478-3625 Sentence denotes Viral plaques were inspected after washing off the crystal violet solution, rinsing the plates with water, and air-drying at room temperature (RT).