2.4. In Vitro Characterization of Recombinant iPEDVPT-P5, iPEDVPT-P96, iPEDVPT-P5-96S and iPEDVPT-P96-5S Viruses

2.4.1. Immunofluorescence Assay and Syncytia Analysis
Immunofluorescence assay (IFA) was performed to detect PEDV antigens as previously described with modifications [18]. Briefly, Vero cells in 96-well plates (1.75 × 104 cells/well) were infected with the designated P1viruses at a multiplicity of infection (MOI) of 0.005. At 18 h post-infection, cells were fixed with 80% ice-cold acetone, air-dried, and then incubated with an in-house anti-PEDV S antibody, P4B [20], at a dilution of 1:1000 at room temperature (RT) for 1 h (h). After being washed three times with phosphate-buffered saline (PBS), the FITC-conjugated monoclonal goat anti-mouse-IG antibody (BD Pharmingen, San Jose, CA, USA) was applied at a dilution of 1:500 at RT for 1 h. Following the final wash step, the cells were counterstained with mounting medium with 4′,6-diamidino-2-phenylindole (DAPI; Abcam, Cambridge, MA, USA) in the dark for 1 min. Images were visualized and captured using ZOE fluorescent cell imager (Bio-Rad, Hercules, CA, USA). Syncytia analysis were performed concurrently along with IFA by calculating the number of nuclei per syncytium.

2.4.2. Sequence Analysis
Sequence analysis was conducted as described previously [18,19] and two primer pairs (SF-7: ACTCTCGACTGGACATTC and 2R: CAGACTTCGAGACATCTTTG; 5FR-3: ATTAGAGCGATTCTCCATGAC and 5FR-6: TACACACATTGTGGTGCTATTGAG) targeting the C-terminal end of the S gene, which contained both naturally occurred and artificially introduced marker mutations (Figure 1, asterisks and Table 1), as well as the non-structural protein 15 (nsp 15) gene, which contained a naturally occurred mutation (G19470T) were used to verify the identities of the four P1 viral stocks and the recombinant viruses shed in feces per group at the time point of peak fecal viral shedding.

2.4.3. Growth Kinetics, Viral Titration and Plaque Assay
Confluent monolayers of Vero cells were seeded onto six-well plates (5 × 105 cells/well) and infected with each virus at a MOI of 1 and 0.001 at 37 °C for 1 h in triplicates. The cells were then washed twice with Dulbecco’s phosphate-buffered saline (DPBS) and maintained in PI medium. The supernatants at indicated time points were collected and proceeded for viral quantification on Vero cells in 96-well plates using the standard 50% tissue-culture infectious dose (TCID50) assay. In brief, Vero cells in 96-well plates were washed twice with DPBS and then incubated with a 10-fold serially diluted culture supernatant acquired from the aforementioned six-well plate at 37 °C for 1 h. After absorption, the inoculum was removed and replaced with fresh PI-medium following one wash step. The titers were determined at 72 h post-infection using the Reed–Muench method [21].
Plaque assays were performed as previously described [19] to characterize plaque morphologies. Briefly, after absorption of PEDVs at an MOI of 0.0001, confluent monolayers of Vero cells in six-well plates were washed twice with DPBS and then covered with an overlay of pre-warmed PI medium containing 1% agarose. After solidification of the overlays, the plates were incubated at 37 °C for 72 h to produce distinct plaques. The cells were then fixed in 3.16% neutral-buffered formalin for 1 h before removing the semisolid overlays. The plates were stained with 1% crystal violet in 20% ethanol and distilled water for 1 min. Viral plaques were inspected after washing off the crystal violet solution, rinsing the plates with water, and air-drying at room temperature (RT).