LitCovid-sentences  

PMC:7019868 / 6466-17445 JSONTXT 11 Projects

Annnotations TAB TSV DIC JSON TextAE

Id Subject Object Predicate Lexical cue
T42 0-2 Sentence denotes 2.
T43 3-24 Sentence denotes Materials and Methods
T44 26-30 Sentence denotes 2.1.
T45 31-47 Sentence denotes Ethics Statement
T46 48-307 Sentence denotes All procedures involving animal experiment were reviewed, approved and conducted in strict accordance with the Institutional Animal Care and Use Committee (IACUC) of National Taiwan University (Taiwan, Republic of China) with the approval No.: NTU105EL-00160.
T47 309-313 Sentence denotes 2.2.
T48 314-331 Sentence denotes Cells and Viruses
T49 332-358 Sentence denotes Vero C1008 cells (ATCC No.
T50 359-608 Sentence denotes CRL-1586) were maintained in growth medium containing Dulbecco’s modified Eagle’s medium (DMEM, Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine protein (FBS), 250 ng/mL Amphotericin B, 100 U/mL Penicillin and 100 μg/mL Streptomycin.
T51 609-922 Sentence denotes The recombinant viruses (iPEDVPT-P5 and iPEDVPT-P96), and the chimeric viruses (iPEDVPT-P5-96S and iPEDVPT-P96-5S), were propagated in post-inoculation medium (PI medium) containing DMEM supplemented with 0.3% tryptose phosphate broth (TBP), 0.02% yeast extract, and 10 μg/mL trypsin as described previously [18].
T52 924-928 Sentence denotes 2.3.
T53 929-1034 Sentence denotes Generation and Recovery of Recombinant iPEDVPT-P5, iPEDVPT-P96, iPEDVPT-P5-96S and iPEDVPT-P96-5S Viruses
T54 1035-1111 Sentence denotes The strategy used to recover iPEDVPT-P96 has been described previously [19].
T55 1112-1221 Sentence denotes The approach to constructing a cDNA clone of iPEDVPT-P5 was technically identical to that of the iPEDVPT-P96.
T56 1222-1489 Sentence denotes However, we split the plasmid B into two fragments because the sequence remained toxic to the One Shot™ TOP10 Chemically Competent E. coli cells (Invitrogen, Carlsbad, USA) despite propagation in LB broth supplemented with 10% SOC medium and being incubated at 30 °C.
T57 1490-1688 Sentence denotes To generate chimeric viruses carrying heterologous spike (S) genes, namely the iPEDVPT-P5-96S and iPEDVPT-P96-5S, cDNA clones of iPEDVPT-P5 and iPEDVPT-P96, respectively, were used as the backbones.
T58 1689-1815 Sentence denotes The sequences covering the complete S gene of each virus were exchanged without disruption to the remaining genomic structure.
T59 1816-1916 Sentence denotes Sequence differences in the S genes of iPEDVPT-P5 and iPEDVPT-P96 viruses are summarized in Table 1.
T60 1917-2109 Sentence denotes Each plasmid was digested with corresponding type-IIS restriction enzymes as designated in Figure S1, gel-purified, assembled and phenol-chloroform extracted to generate the full-length cDNAs.
T61 2110-2428 Sentence denotes The cDNAs were then in vitro transcribed to the full-length RNA transcripts using a mMessage mMachine T7 transcription kit (Ambion, Austin, CA, USA) and immediately electroporated into 800 μL of 107 cells/mL Vero cells in RNase-free phosphate buffered saline (PBS) along with 5 μg of PEDV nucleocapsid (N) transcripts.
T62 2429-2621 Sentence denotes After electroporation, the cells were allowed to recover in growth medium for approximately 16 h and then maintained in PI-medium until cytopathic effects involved over 90% of cell monolayers.
T63 2622-2756 Sentence denotes The whole flasks were subjected to one freeze-and-thaw cycle and the rescued viruses were passaged once to generate viral stocks (P1).
T64 2757-2861 Sentence denotes The viral stocks were titrated on Vero cells in 96-well plates to determine the viral titer (see below).
T65 2863-2867 Sentence denotes 2.4.
T66 2868-2975 Sentence denotes In Vitro Characterization of Recombinant iPEDVPT-P5, iPEDVPT-P96, iPEDVPT-P5-96S and iPEDVPT-P96-5S Viruses
T67 2977-2983 Sentence denotes 2.4.1.
T68 2984-3030 Sentence denotes Immunofluorescence Assay and Syncytia Analysis
T69 3031-3148 Sentence denotes Immunofluorescence assay (IFA) was performed to detect PEDV antigens as previously described with modifications [18].
T70 3149-3301 Sentence denotes Briefly, Vero cells in 96-well plates (1.75 × 104 cells/well) were infected with the designated P1viruses at a multiplicity of infection (MOI) of 0.005.
T71 3302-3510 Sentence denotes At 18 h post-infection, cells were fixed with 80% ice-cold acetone, air-dried, and then incubated with an in-house anti-PEDV S antibody, P4B [20], at a dilution of 1:1000 at room temperature (RT) for 1 h (h).
T72 3511-3723 Sentence denotes After being washed three times with phosphate-buffered saline (PBS), the FITC-conjugated monoclonal goat anti-mouse-IG antibody (BD Pharmingen, San Jose, CA, USA) was applied at a dilution of 1:500 at RT for 1 h.
T73 3724-3897 Sentence denotes Following the final wash step, the cells were counterstained with mounting medium with 4′,6-diamidino-2-phenylindole (DAPI; Abcam, Cambridge, MA, USA) in the dark for 1 min.
T74 3898-3997 Sentence denotes Images were visualized and captured using ZOE fluorescent cell imager (Bio-Rad, Hercules, CA, USA).
T75 3998-4109 Sentence denotes Syncytia analysis were performed concurrently along with IFA by calculating the number of nuclei per syncytium.
T76 4111-4117 Sentence denotes 2.4.2.
T77 4118-4135 Sentence denotes Sequence Analysis
T78 4136-4781 Sentence denotes Sequence analysis was conducted as described previously [18,19] and two primer pairs (SF-7: ACTCTCGACTGGACATTC and 2R: CAGACTTCGAGACATCTTTG; 5FR-3: ATTAGAGCGATTCTCCATGAC and 5FR-6: TACACACATTGTGGTGCTATTGAG) targeting the C-terminal end of the S gene, which contained both naturally occurred and artificially introduced marker mutations (Figure 1, asterisks and Table 1), as well as the non-structural protein 15 (nsp 15) gene, which contained a naturally occurred mutation (G19470T) were used to verify the identities of the four P1 viral stocks and the recombinant viruses shed in feces per group at the time point of peak fecal viral shedding.
T79 4783-4789 Sentence denotes 2.4.3.
T80 4790-4839 Sentence denotes Growth Kinetics, Viral Titration and Plaque Assay
T81 4840-5014 Sentence denotes Confluent monolayers of Vero cells were seeded onto six-well plates (5 × 105 cells/well) and infected with each virus at a MOI of 1 and 0.001 at 37 °C for 1 h in triplicates.
T82 5015-5125 Sentence denotes The cells were then washed twice with Dulbecco’s phosphate-buffered saline (DPBS) and maintained in PI medium.
T83 5126-5323 Sentence denotes The supernatants at indicated time points were collected and proceeded for viral quantification on Vero cells in 96-well plates using the standard 50% tissue-culture infectious dose (TCID50) assay.
T84 5324-5527 Sentence denotes In brief, Vero cells in 96-well plates were washed twice with DPBS and then incubated with a 10-fold serially diluted culture supernatant acquired from the aforementioned six-well plate at 37 °C for 1 h.
T85 5528-5629 Sentence denotes After absorption, the inoculum was removed and replaced with fresh PI-medium following one wash step.
T86 5630-5714 Sentence denotes The titers were determined at 72 h post-infection using the Reed–Muench method [21].
T87 5715-5809 Sentence denotes Plaque assays were performed as previously described [19] to characterize plaque morphologies.
T88 5810-6027 Sentence denotes Briefly, after absorption of PEDVs at an MOI of 0.0001, confluent monolayers of Vero cells in six-well plates were washed twice with DPBS and then covered with an overlay of pre-warmed PI medium containing 1% agarose.
T89 6028-6138 Sentence denotes After solidification of the overlays, the plates were incubated at 37 °C for 72 h to produce distinct plaques.
T90 6139-6247 Sentence denotes The cells were then fixed in 3.16% neutral-buffered formalin for 1 h before removing the semisolid overlays.
T91 6248-6340 Sentence denotes The plates were stained with 1% crystal violet in 20% ethanol and distilled water for 1 min.
T92 6341-6488 Sentence denotes Viral plaques were inspected after washing off the crystal violet solution, rinsing the plates with water, and air-drying at room temperature (RT).
T93 6490-6494 Sentence denotes 2.5.
T94 6495-6512 Sentence denotes Animal Experiment
T95 6513-6829 Sentence denotes Thirty-seven, six-day-old, Large White × Duroc, crossbred, fecal PEDV and TGEV shedding-negative suckling piglets were purchased from a conventional pig farm devoid of G2b PEDV infection history based on the negative result of our long-term surveillance of serum antibody and colostrum against PEDV in this pig farm.
T96 6830-7092 Sentence denotes These piglets from different sows were fed with artificial milk and were randomly assigned to five groups, acclimated for one day, and then inoculated orally with indicative recombinant viruses at a dose of 2 mL of 0.5 × 102 TCID50/mL or PI-medium, respectively.
T97 7093-7144 Sentence denotes Clinical signs and weight gain were recorded daily.
T98 7145-7206 Sentence denotes Fecal consistency was monitored daily and scored visually as:
T99 7207-7285 Sentence denotes 0 = normal, 1 = loose, 2 = semi-fluid, and 3 = watery as previously described.
T100 7286-7390 Sentence denotes Calculation of average daily weight gain was only performed on piglets that were not humanly euthanized.
T101 7391-7438 Sentence denotes The formula used for calculation is as follows:
T102 7439-7471 Sentence denotes Weight gained/ surviving period.
T103 7473-7479 Sentence denotes 2.5.1.
T104 7480-7523 Sentence denotes Quantification of PEDV Fecal Viral Shedding
T105 7524-7605 Sentence denotes Methods to quantify fecal PEDV viral shedding has been described previously [19].
T106 7606-7866 Sentence denotes Briefly, fecal samples collected from rectal swabs were resuspended in DPBS and then subjected to automated nucleic acid extraction using Cador Pathogen 96 QIAcube HT Kit with QIAcube (Qiagen Inc., Hilden, Germany) according to the manufacturer’s instructions.
T107 7867-8158 Sentence denotes Complementary DNA was synthesized via reverse transcription using QuantiNova™ Reverse Transcription kit (Qiagen Inc., Hilden, Germany) and proceeded to quantitative real-time PCR analysis using the primer-probe set published previously on a CFX96 Thermal Cycler (Bio-Rad, Hercules, CA, USA).
T108 8159-8296 Sentence denotes The thermal profile comprised an initial denaturation at 95 °C for 2 min and then 45 cycles of 95 °C for 15 s followed by 60 °C for 15 s.
T109 8297-8536 Sentence denotes The detection limit of the assay was determined by generating standard curves from serial 10-fold dilutions of known amounts of in vitro transcribed RNA followed by reverse transcription and real-time PCR quantification as described above.
T110 8537-8603 Sentence denotes The detection limit was calculated as 4.8 log10 RNA copies per mL.
T111 8605-8611 Sentence denotes 2.5.2.
T112 8612-8651 Sentence denotes Histopathology and Immunohistochemistry
T113 8652-8910 Sentence denotes At three days post-inoculation, three pigs from each virus-treated group and one pig from mock group were humanely euthanized by electrocution followed by exsanguination for histopathological and immunohistochemical assessments, as described previously [22].
T114 8911-9228 Sentence denotes Duodenum, jejunum, ileum, cecum, colon, rectum and mesenteric lymph nodes were collected, formalin-fixed, paraffin-embedded, sectioned at 4 μm, and stained routinely with hematoxylin and eosin (H&E) for morphometric analysis by assessing the ratio of villi height to crypt depth blindly by one veterinary pathologist.
T115 9229-9309 Sentence denotes Immunohistochemistry was performed to evaluate the distribution of PEDV antigen.
T116 9310-9557 Sentence denotes Briefly, formalin-fixed paraffin-embedded tissues were sectioned at 4 μm, deparaffined in xylene, rehydrated in serially diluted ethanol, and proceeded to epitope retrieval with the Trilogy antigen retrieval system (Cell Marque, Rocklin, CA, USA).
T117 9558-9866 Sentence denotes After being washed three times with Tris-buffered saline plus 0.1% Tween 20 (TBST), tissue slides were treated with 3% hydrogen peroxidase (KYB, New Taipei City, Taiwan) and 10% normal goat serum (Dako, Carpinteria, CA, USA) to block the endogenous peroxidase activity and non-specific signals, respectively.
T118 9867-10058 Sentence denotes For antigen detection, an in-house anti-PEDV N antibody, DE-1, at a dilution of 1:1000 in 10% normal goat serum was applied to the slides for 1 h at RT followed by three times wash with TBST.
T119 10059-10357 Sentence denotes The first antibodies were then captured using the polyclonal anti-rabbit/mouse immunoglobulin, EnVision-DAB+ system (Agilent Technologies, Santa Clara, CA, USA) at RT for 1 h and color was developed afterward with 3, 3′-diaminobenzidine (DAB) chromogen (Agilent Technologies, Santa Clara, CA, USA).
T120 10358-10494 Sentence denotes The slides were counterstained with hematoxylin (MUTO, Tokyo, Japan), mounted in Entellan (Merck, Darmstadt, Germany) and cover slipped.
T121 10495-10585 Sentence denotes Positive signals were visualized under an inverted light microscope (Nikon, Tokyo, Japan).
T122 10587-10591 Sentence denotes 2.6.
T123 10592-10612 Sentence denotes Statistical Analysis
T124 10613-10677 Sentence denotes All values were expressed as the mean standard ± deviation (SD).
T125 10678-10856 Sentence denotes Comparison of syncytia size and villous height to crypt depth (VH:CD) ratio were analyzed using statistical software GraphPad Prism 6.0 (GraphPad Prism Inc., San Diego, CA, USA).
T126 10857-10979 Sentence denotes Variables were compared using the non-parametrical Kruskal–Wallis test; p < 0.05 was considered statistically significant.