LitCovid-sentences  

PMC:6988269 / 5571-7844 JSONTXT 9 Projects

Annnotations TAB TSV DIC JSON TextAE

Id Subject Object Predicate Lexical cue
T41 0-35 Sentence denotes Real-time reverse-transcription PCR
T42 36-488 Sentence denotes A 25 μL reaction contained 5 μL of RNA, 12.5 μL of 2 × reaction buffer provided with the Superscript III one step RT-PCR system with Platinum Taq Polymerase (Invitrogen, Darmstadt, Germany; containing 0.4 mM of each deoxyribont triphosphates (dNTP) and 3.2 mM magnesium sulphate), 1 μL of reverse transcriptase/Taq mixture from the kit, 0.4 μL of a 50 mM magnesium sulphate solution (Invitrogen), and 1 μg of nonacetylated bovine serum albumin (Roche).
T43 489-574 Sentence denotes Primer and probe sequences, as well as optimised concentrations are shown in Table 1.
T44 575-659 Sentence denotes All oligonucleotides were synthesised and provided by Tib-Molbiol (Berlin, Germany).
T45 660-818 Sentence denotes Thermal cycling was performed at 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and then 45 cycles of 95 °C for 15 s, 58 °C for 30 s.
T46 819-962 Sentence denotes Participating laboratories used either Roche Light Cycler 480II or Applied Biosystems ViiA7 instruments (Applied Biosystems, Hong Kong, China).
T47 963-1035 Sentence denotes Table 1 Primers and probes, real-time RT-PCR for 2019 novel coronavirus
T48 1036-1089 Sentence denotes Assay/use Oligonucleotide Sequencea Concentrationb
T49 1090-1162 Sentence denotes RdRP gene RdRp_SARSr-F GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction
T50 1163-1301 Sentence denotes RdRp_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV, will not detect SARS-CoV.Use 100 nM per reaction and mix with P1
T51 1302-1468 Sentence denotes RdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs.Use 100 nM per reaction and mix with P2
T52 1469-1534 Sentence denotes RdRp_SARSr-R CARATGTTAAASACACTATTAGCATA Use 800 nM per reaction
T53 1535-1607 Sentence denotes E gene E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT Use 400 nm per reaction
T54 1608-1681 Sentence denotes E_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nm per reaction
T55 1682-1742 Sentence denotes E_Sarbeco_R ATATTGCAGCAGTACGCACACA Use 400 nm per reaction
T56 1743-1808 Sentence denotes N gene N_Sarbeco_F CACATTGGCACCCGCAATC Use 600 nm per reaction
T57 1809-1880 Sentence denotes N_Sarbeco_P FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ Use 200 nm per reaction
T58 1881-1939 Sentence denotes N_Sarbeco_R GAGGAACGAGAAGAGGCTTG Use 800 nm per reaction
T59 1940-1981 Sentence denotes a W is A/T; R is G/A; M is A/C; S is G/C.
T60 1982-1986 Sentence denotes FAM:
T61 1987-2034 Sentence denotes 6-carboxyfluorescein; BBQ: blackberry quencher.
T62 2035-2273 Sentence denotes b Optimised concentrations are given in nanomol per litre (nM) based on the final reaction mix, e.g. 1.5 µL of a 10 µM primer stock solution per 25 µL total reaction volume yields a final concentration of 600 nM as indicated in the table.