Real-time reverse-transcription PCR
A 25 μL reaction contained 5 μL of RNA, 12.5 μL of 2 × reaction buffer provided with the Superscript III one step RT-PCR system with Platinum Taq Polymerase (Invitrogen, Darmstadt, Germany; containing 0.4 mM of each deoxyribont triphosphates (dNTP) and 3.2 mM magnesium sulphate), 1 μL of reverse transcriptase/Taq mixture from the kit, 0.4 μL of a 50 mM magnesium sulphate solution (Invitrogen), and 1 μg of nonacetylated bovine serum albumin (Roche). Primer and probe sequences, as well as optimised concentrations are shown in Table 1. All oligonucleotides were synthesised and provided by Tib-Molbiol (Berlin, Germany). Thermal cycling was performed at 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and then 45 cycles of 95 °C for 15 s, 58 °C for 30 s. Participating laboratories used either Roche Light Cycler 480II or Applied Biosystems ViiA7 instruments (Applied Biosystems, Hong Kong, China).
Table 1  Primers and probes, real-time RT-PCR for 2019 novel coronavirus
Assay/use  Oligonucleotide  Sequencea  Concentrationb
RdRP gene  RdRp_SARSr-F  GTGARATGGTCATGTGTGGCGG  Use 600 nM per reaction
RdRp_SARSr-P2  FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ  Specific for 2019-nCoV, will not detect SARS-CoV.Use 100 nM per reaction and mix with P1
RdRP_SARSr-P1  FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ  Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs.Use 100 nM per reaction and mix with P2
RdRp_SARSr-R  CARATGTTAAASACACTATTAGCATA  Use 800 nM per reaction
E gene  E_Sarbeco_F  ACAGGTACGTTAATAGTTAATAGCGT  Use 400 nm per reaction
E_Sarbeco_P1  FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ  Use 200 nm per reaction
E_Sarbeco_R  ATATTGCAGCAGTACGCACACA  Use 400 nm per reaction
N gene  N_Sarbeco_F  CACATTGGCACCCGCAATC  Use 600 nm per reaction
N_Sarbeco_P  FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ  Use 200 nm per reaction
N_Sarbeco_R  GAGGAACGAGAAGAGGCTTG  Use 800 nm per reaction
a W is A/T; R is G/A; M is A/C; S is G/C. FAM: 6-carboxyfluorescein; BBQ: blackberry quencher.
b Optimised concentrations are given in nanomol per litre (nM) based on the final reaction mix, e.g. 1.5 µL of a 10 µM primer stock solution per 25 µL total reaction volume yields a final concentration of 600 nM as indicated in the table.