LitCovid-sentences  

PMC:6988269 / 3935-8891 JSONTXT 12 Projects

Annnotations TAB TSV DIC JSON TextAE

Id Subject Object Predicate Lexical cue
T31 0-7 Sentence denotes Methods
T32 9-96 Sentence denotes Clinical samples and coronavirus cell culture supernatants for initial assay evaluation
T33 97-259 Sentence denotes Cell culture supernatants containing typed coronaviruses and other respiratory viruses were provided by Charité and University of Hong Kong research laboratories.
T34 260-529 Sentence denotes Respiratory samples were obtained during 2019 from patients hospitalised at Charité medical centre and tested by the NxTAG respiratory pathogen panel (Luminex, S´Hertogenbosch, The Netherlands) or in cases of MERS-CoV by the MERS-CoV upE assay as published before [10].
T35 530-773 Sentence denotes Additional samples were selected from biobanks at the Rijksinstituut voor Volksgezondheid en Milieu (RIVM), Bilthoven, at Erasmus University Medical Center, Rotterdam, at Public Health England (PHE), London, and at the University of Hong Kong.
T36 774-892 Sentence denotes Samples from all collections comprised sputum as well as nose and throat swabs with or without viral transport medium.
T37 893-1362 Sentence denotes Faecal samples containing bat-derived SARS-related CoV samples (identified by GenBank accession numbers) were tested: KC633203, Betacoronavirus BtCoV/Rhi_eur/BB98–98/BGR/2008; KC633204, Betacoronavirus BtCoV/Rhi_eur/BB98–92/BGR/2008; KC633201, Betacoronavirus BtCoV/Rhi_bla/BB98–22/BGR/2008; GU190221 Betacoronavirus Bat coronavirus BR98–19/BGR/2008; GU190222 Betacoronavirus Bat coronavirus BM98–01/BGR/2008; GU190223, Betacoronavirus Bat coronavirus BM98–13/BGR/2008.
T38 1363-1431 Sentence denotes All synthetic RNA used in this study was photometrically quantified.
T39 1433-1447 Sentence denotes RNA extraction
T40 1448-1634 Sentence denotes RNA was extracted from clinical samples with the MagNA Pure 96 system (Roche, Penzberg, Germany) and from cell culture supernatants with the viral RNA mini kit (QIAGEN, Hilden, Germany).
T41 1636-1671 Sentence denotes Real-time reverse-transcription PCR
T42 1672-2124 Sentence denotes A 25 μL reaction contained 5 μL of RNA, 12.5 μL of 2 × reaction buffer provided with the Superscript III one step RT-PCR system with Platinum Taq Polymerase (Invitrogen, Darmstadt, Germany; containing 0.4 mM of each deoxyribont triphosphates (dNTP) and 3.2 mM magnesium sulphate), 1 μL of reverse transcriptase/Taq mixture from the kit, 0.4 μL of a 50 mM magnesium sulphate solution (Invitrogen), and 1 μg of nonacetylated bovine serum albumin (Roche).
T43 2125-2210 Sentence denotes Primer and probe sequences, as well as optimised concentrations are shown in Table 1.
T44 2211-2295 Sentence denotes All oligonucleotides were synthesised and provided by Tib-Molbiol (Berlin, Germany).
T45 2296-2454 Sentence denotes Thermal cycling was performed at 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and then 45 cycles of 95 °C for 15 s, 58 °C for 30 s.
T46 2455-2598 Sentence denotes Participating laboratories used either Roche Light Cycler 480II or Applied Biosystems ViiA7 instruments (Applied Biosystems, Hong Kong, China).
T47 2599-2671 Sentence denotes Table 1 Primers and probes, real-time RT-PCR for 2019 novel coronavirus
T48 2672-2725 Sentence denotes Assay/use Oligonucleotide Sequencea Concentrationb
T49 2726-2798 Sentence denotes RdRP gene RdRp_SARSr-F GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction
T50 2799-2937 Sentence denotes RdRp_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV, will not detect SARS-CoV.Use 100 nM per reaction and mix with P1
T51 2938-3104 Sentence denotes RdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs.Use 100 nM per reaction and mix with P2
T52 3105-3170 Sentence denotes RdRp_SARSr-R CARATGTTAAASACACTATTAGCATA Use 800 nM per reaction
T53 3171-3243 Sentence denotes E gene E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT Use 400 nm per reaction
T54 3244-3317 Sentence denotes E_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nm per reaction
T55 3318-3378 Sentence denotes E_Sarbeco_R ATATTGCAGCAGTACGCACACA Use 400 nm per reaction
T56 3379-3444 Sentence denotes N gene N_Sarbeco_F CACATTGGCACCCGCAATC Use 600 nm per reaction
T57 3445-3516 Sentence denotes N_Sarbeco_P FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ Use 200 nm per reaction
T58 3517-3575 Sentence denotes N_Sarbeco_R GAGGAACGAGAAGAGGCTTG Use 800 nm per reaction
T59 3576-3617 Sentence denotes a W is A/T; R is G/A; M is A/C; S is G/C.
T60 3618-3622 Sentence denotes FAM:
T61 3623-3670 Sentence denotes 6-carboxyfluorescein; BBQ: blackberry quencher.
T62 3671-3909 Sentence denotes b Optimised concentrations are given in nanomol per litre (nM) based on the final reaction mix, e.g. 1.5 µL of a 10 µM primer stock solution per 25 µL total reaction volume yields a final concentration of 600 nM as indicated in the table.
T63 3911-3949 Sentence denotes Protocol options and application notes
T64 3950-4124 Sentence denotes Laboratories participating in the evaluation used the TaqMan Fast Virus 1-Step Master Mix (Thermo Fisher) with the same oligonucleotide concentrations and cycling conditions.
T65 4125-4199 Sentence denotes The QIAGEN One-Step RT-PCR Kit was also tested and found to be compatible.
T66 4200-4368 Sentence denotes The intended cross-reactivity of all assays with viral RNA of SARS-CoV allows us to use the assays without having to rely on external sources of specific 2019-nCoV RNA.
T67 4369-4515 Sentence denotes For a routine workflow, we recommend the E gene assay as the first-line screening tool, followed by confirmatory testing with the RdRp gene assay.
T68 4516-4689 Sentence denotes Application of the RdRp gene assay with dual colour technology can discriminate 2019-nCoV (both probes positive) from SARS-CoV RNA if the latter is used as positive control.
T69 4690-4790 Sentence denotes Alternatively, laboratories may choose to run the RdRp assay with only the 2019-nCoV-specific probe.
T70 4792-4809 Sentence denotes Ethical statement
T71 4810-4956 Sentence denotes The internal use of samples for diagnostic workflow optimisation was agreed under the medical ethical rules of each of the participating partners.