CORD-19:de628dce1f0a6c46f7bee9c40f83405b1b3b4ac1 JSONTXT 7 Projects

Supplemental Information Viral Nucleases Induce an mRNA Degradation-Transcription Feedback Loop in Mammalian Cells Gene names, read counts, and log2 expression comparing WT and mock infected (Tab 1) and ∆HS and mock infected (Tab 2). NIH 3T3 cells were plated on coverslips, infected for 24 hours, and then fixed in 4% formaldehyde. Cells were permeabilized with ice-cold methanol at -80 °C for 10 min and incubated with anti-Xrn1 antibody (Sigma) at 1:200 in 5% BSA overnight at 4 °C. AlexaFluor546 secondary antibody was added (1:1000) for 1 hour at 37 °C. Coverslips were mounted in DAPIcontaining Vectashield (VectorLabs). Nuclear and cytoplasmic intensity of Xrn1 staining was quantified using ImageJ software and the ratio calculated by measuring corrected total cell fluorescence (CTCF) of individual cells (Burgess et al., 2010) DsiRNA duplexes targeting Xrn1 (GGAAAUUUCAGUAGACAUAGUGCAC; IDT) were transfected into NIH 3T3 cells using INTERFERin (Polyplus) for 36 h. Cells were fixed and stained as described above.