> top > docs > PMC:6988269 > spans > 5571-7844 > annotations

PMC:6988269 / 5571-7844 JSONTXT

Annnotations TAB JSON ListView MergeView

LitCovid-PD-FMA-UBERON

Id Subject Object Predicate Lexical cue fma_id
T14 71-74 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T15 466-471 Body_part denotes serum http://purl.org/sig/ont/fma/fma63083
T16 1095-1099 Body_part denotes gene http://purl.org/sig/ont/fma/fma74402
T17 1537-1541 Body_part denotes gene http://purl.org/sig/ont/fma/fma74402
T18 1745-1749 Body_part denotes gene http://purl.org/sig/ont/fma/fma74402
T19 1969-1973 Body_part denotes C; S http://purl.org/sig/ont/fma/fma284995

LitCovid-PD-UBERON

Id Subject Object Predicate Lexical cue uberon_id
T4 466-471 Body_part denotes serum http://purl.obolibrary.org/obo/UBERON_0001977

LitCovid-PD-MONDO

Id Subject Object Predicate Lexical cue mondo_id
T14 1253-1257 Disease denotes SARS http://purl.obolibrary.org/obo/MONDO_0005091
T15 1394-1402 Disease denotes SARS-CoV http://purl.obolibrary.org/obo/MONDO_0005091
T16 1394-1398 Disease denotes SARS http://purl.obolibrary.org/obo/MONDO_0005091
T17 1411-1415 Disease denotes SARS http://purl.obolibrary.org/obo/MONDO_0005091

LitCovid-PD-CLO

Id Subject Object Predicate Lexical cue
T49 36-37 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T50 383-384 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T51 642-648 http://purl.obolibrary.org/obo/CLO_0001929 denotes Berlin
T52 774-776 http://purl.obolibrary.org/obo/CLO_0053799 denotes 45
T53 911-922 http://purl.obolibrary.org/obo/OBI_0000968 denotes instruments
T54 1095-1099 http://purl.obolibrary.org/obo/OGG_0000000002 denotes gene
T55 1174-1176 http://purl.obolibrary.org/obo/CLO_0008307 denotes P2
T56 1299-1301 http://purl.obolibrary.org/obo/CLO_0008285 denotes P1
T57 1313-1315 http://purl.obolibrary.org/obo/CLO_0008285 denotes P1
T58 1353-1356 http://purl.obolibrary.org/obo/NCBITaxon_9596 denotes Pan
T59 1407-1410 http://purl.obolibrary.org/obo/NCBITaxon_9397 denotes bat
T60 1466-1468 http://purl.obolibrary.org/obo/CLO_0008307 denotes P2
T61 1537-1541 http://purl.obolibrary.org/obo/OGG_0000000002 denotes gene
T62 1745-1749 http://purl.obolibrary.org/obo/OGG_0000000002 denotes gene
T63 1940-1941 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T64 1947-1948 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T65 1959-1960 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T66 1967-1968 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T67 2035-2036 http://purl.obolibrary.org/obo/CLO_0001021 denotes b
T68 2146-2150 http://purl.obolibrary.org/obo/CLO_0001550 denotes a 10
T69 2215-2216 http://purl.obolibrary.org/obo/CLO_0001020 denotes a

LitCovid-PD-CHEBI

Id Subject Object Predicate Lexical cue chebi_id
T7 100-106 Chemical denotes buffer http://purl.obolibrary.org/obo/CHEBI_35225
T8 296-314 Chemical denotes magnesium sulphate http://purl.obolibrary.org/obo/CHEBI_32599
T9 296-305 Chemical denotes magnesium http://purl.obolibrary.org/obo/CHEBI_25107
T10 306-314 Chemical denotes sulphate http://purl.obolibrary.org/obo/CHEBI_16189
T11 351-358 Chemical denotes mixture http://purl.obolibrary.org/obo/CHEBI_60004
T12 391-409 Chemical denotes magnesium sulphate http://purl.obolibrary.org/obo/CHEBI_32599
T13 391-400 Chemical denotes magnesium http://purl.obolibrary.org/obo/CHEBI_25107
T14 401-409 Chemical denotes sulphate http://purl.obolibrary.org/obo/CHEBI_16189
T15 410-418 Chemical denotes solution http://purl.obolibrary.org/obo/CHEBI_75958
T16 500-505 Chemical denotes probe http://purl.obolibrary.org/obo/CHEBI_50406
T17 579-595 Chemical denotes oligonucleotides http://purl.obolibrary.org/obo/CHEBI_7754
T18 864-869 Chemical denotes Light http://purl.obolibrary.org/obo/CHEBI_30212
T19 1047-1062 Chemical denotes Oligonucleotide http://purl.obolibrary.org/obo/CHEBI_7754
T20 1174-1176 Chemical denotes P2 http://purl.obolibrary.org/obo/CHEBI_33472
T21 1299-1301 Chemical denotes P1 http://purl.obolibrary.org/obo/CHEBI_60949
T22 1313-1315 Chemical denotes P1 http://purl.obolibrary.org/obo/CHEBI_60949
T23 1466-1468 Chemical denotes P2 http://purl.obolibrary.org/obo/CHEBI_33472
T24 1987-2007 Chemical denotes 6-carboxyfluorescein http://purl.obolibrary.org/obo/CHEBI_39073
T25 2167-2175 Chemical denotes solution http://purl.obolibrary.org/obo/CHEBI_75958

LitCovid-PD-GO-BP

Id Subject Object Predicate Lexical cue
T4 10-31 http://purl.obolibrary.org/obo/GO_0001171 denotes reverse-transcription
T5 18-31 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T6 333-346 http://purl.obolibrary.org/obo/GO_0003968 denotes transcriptase
T7 333-346 http://purl.obolibrary.org/obo/GO_0003899 denotes transcriptase
T8 714-735 http://purl.obolibrary.org/obo/GO_0001171 denotes reverse transcription
T9 722-735 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T10 1090-1094 http://purl.obolibrary.org/obo/GO_0003968 denotes RdRP

LitCovid-sentences

Id Subject Object Predicate Lexical cue
T41 0-35 Sentence denotes Real-time reverse-transcription PCR
T42 36-488 Sentence denotes A 25 μL reaction contained 5 μL of RNA, 12.5 μL of 2 × reaction buffer provided with the Superscript III one step RT-PCR system with Platinum Taq Polymerase (Invitrogen, Darmstadt, Germany; containing 0.4 mM of each deoxyribont triphosphates (dNTP) and 3.2 mM magnesium sulphate), 1 μL of reverse transcriptase/Taq mixture from the kit, 0.4 μL of a 50 mM magnesium sulphate solution (Invitrogen), and 1 μg of nonacetylated bovine serum albumin (Roche).
T43 489-574 Sentence denotes Primer and probe sequences, as well as optimised concentrations are shown in Table 1.
T44 575-659 Sentence denotes All oligonucleotides were synthesised and provided by Tib-Molbiol (Berlin, Germany).
T45 660-818 Sentence denotes Thermal cycling was performed at 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and then 45 cycles of 95 °C for 15 s, 58 °C for 30 s.
T46 819-962 Sentence denotes Participating laboratories used either Roche Light Cycler 480II or Applied Biosystems ViiA7 instruments (Applied Biosystems, Hong Kong, China).
T47 963-1035 Sentence denotes Table 1 Primers and probes, real-time RT-PCR for 2019 novel coronavirus
T48 1036-1089 Sentence denotes Assay/use Oligonucleotide Sequencea Concentrationb
T49 1090-1162 Sentence denotes RdRP gene RdRp_SARSr-F GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction
T50 1163-1301 Sentence denotes RdRp_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV, will not detect SARS-CoV.Use 100 nM per reaction and mix with P1
T51 1302-1468 Sentence denotes RdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs.Use 100 nM per reaction and mix with P2
T52 1469-1534 Sentence denotes RdRp_SARSr-R CARATGTTAAASACACTATTAGCATA Use 800 nM per reaction
T53 1535-1607 Sentence denotes E gene E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT Use 400 nm per reaction
T54 1608-1681 Sentence denotes E_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nm per reaction
T55 1682-1742 Sentence denotes E_Sarbeco_R ATATTGCAGCAGTACGCACACA Use 400 nm per reaction
T56 1743-1808 Sentence denotes N gene N_Sarbeco_F CACATTGGCACCCGCAATC Use 600 nm per reaction
T57 1809-1880 Sentence denotes N_Sarbeco_P FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ Use 200 nm per reaction
T58 1881-1939 Sentence denotes N_Sarbeco_R GAGGAACGAGAAGAGGCTTG Use 800 nm per reaction
T59 1940-1981 Sentence denotes a W is A/T; R is G/A; M is A/C; S is G/C.
T60 1982-1986 Sentence denotes FAM:
T61 1987-2034 Sentence denotes 6-carboxyfluorescein; BBQ: blackberry quencher.
T62 2035-2273 Sentence denotes b Optimised concentrations are given in nanomol per litre (nM) based on the final reaction mix, e.g. 1.5 µL of a 10 µM primer stock solution per 25 µL total reaction volume yields a final concentration of 600 nM as indicated in the table.

LitCovid-PubTator

Id Subject Object Predicate Lexical cue tao:has_database_id
115 466-479 Gene denotes serum albumin Gene:213
116 368-371 Gene denotes kit Gene:3815
117 579-595 Chemical denotes oligonucleotides MESH:D009841
125 1457-1460 Gene denotes mix Gene:83881
126 1290-1293 Gene denotes mix Gene:83881
127 1226-1235 Species denotes 2019-nCoV Tax:2697049
128 1253-1261 Species denotes SARS-CoV Tax:694009
129 1383-1392 Species denotes 2019-nCoV Tax:2697049
130 1394-1402 Species denotes SARS-CoV Tax:694009
131 1411-1428 Species denotes SARS-related CoVs Tax:694009
133 1013-1035 Species denotes 2019 novel coronavirus Tax:2697049
135 1987-2007 Chemical denotes 6-carboxyfluorescein MESH:C024098
137 2126-2129 Gene denotes mix Gene:83881