PMC:6988269 / 5571-7844 JSONTXT

{"project":"LitCovid-PD-FMA-UBERON","denotations":[{"id":"T14","span":{"begin":71,"end":74},"obj":"Body_part"},{"id":"T15","span":{"begin":466,"end":471},"obj":"Body_part"},{"id":"T16","span":{"begin":1095,"end":1099},"obj":"Body_part"},{"id":"T17","span":{"begin":1537,"end":1541},"obj":"Body_part"},{"id":"T18","span":{"begin":1745,"end":1749},"obj":"Body_part"},{"id":"T19","span":{"begin":1969,"end":1973},"obj":"Body_part"}],"attributes":[{"id":"A14","pred":"fma_id","subj":"T14","obj":"http://purl.org/sig/ont/fma/fma67095"},{"id":"A15","pred":"fma_id","subj":"T15","obj":"http://purl.org/sig/ont/fma/fma63083"},{"id":"A16","pred":"fma_id","subj":"T16","obj":"http://purl.org/sig/ont/fma/fma74402"},{"id":"A17","pred":"fma_id","subj":"T17","obj":"http://purl.org/sig/ont/fma/fma74402"},{"id":"A18","pred":"fma_id","subj":"T18","obj":"http://purl.org/sig/ont/fma/fma74402"},{"id":"A19","pred":"fma_id","subj":"T19","obj":"http://purl.org/sig/ont/fma/fma284995"}],"text":"Real-time reverse-transcription PCR\nA 25 μL reaction contained 5 μL of RNA, 12.5 μL of 2 × reaction buffer provided with the Superscript III one step RT-PCR system with Platinum Taq Polymerase (Invitrogen, Darmstadt, Germany; containing 0.4 mM of each deoxyribont triphosphates (dNTP) and 3.2 mM magnesium sulphate), 1 μL of reverse transcriptase/Taq mixture from the kit, 0.4 μL of a 50 mM magnesium sulphate solution (Invitrogen), and 1 μg of nonacetylated bovine serum albumin (Roche). Primer and probe sequences, as well as optimised concentrations are shown in Table 1. All oligonucleotides were synthesised and provided by Tib-Molbiol (Berlin, Germany). Thermal cycling was performed at 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and then 45 cycles of 95 °C for 15 s, 58 °C for 30 s. Participating laboratories used either Roche Light Cycler 480II or Applied Biosystems ViiA7 instruments (Applied Biosystems, Hong Kong, China).\nTable 1 Primers and probes, real-time RT-PCR for 2019 novel coronavirus\nAssay/use Oligonucleotide Sequencea Concentrationb\nRdRP gene RdRp_SARSr-F GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction\nRdRp_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV, will not detect SARS-CoV.Use 100 nM per reaction and mix with P1\nRdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs.Use 100 nM per reaction and mix with P2\nRdRp_SARSr-R CARATGTTAAASACACTATTAGCATA Use 800 nM per reaction\nE gene E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT Use 400 nm per reaction\nE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nm per reaction\nE_Sarbeco_R ATATTGCAGCAGTACGCACACA Use 400 nm per reaction\nN gene N_Sarbeco_F CACATTGGCACCCGCAATC Use 600 nm per reaction\nN_Sarbeco_P FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ Use 200 nm per reaction\nN_Sarbeco_R GAGGAACGAGAAGAGGCTTG Use 800 nm per reaction\na W is A/T; R is G/A; M is A/C; S is G/C. FAM: 6-carboxyfluorescein; BBQ: blackberry quencher.\nb Optimised concentrations are given in nanomol per litre (nM) based on the final reaction mix, e.g. 1.5 µL of a 10 µM primer stock solution per 25 µL total reaction volume yields a final concentration of 600 nM as indicated in the table."}

{"project":"LitCovid-PD-UBERON","denotations":[{"id":"T4","span":{"begin":466,"end":471},"obj":"Body_part"}],"attributes":[{"id":"A4","pred":"uberon_id","subj":"T4","obj":"http://purl.obolibrary.org/obo/UBERON_0001977"}],"text":"Real-time reverse-transcription PCR\nA 25 μL reaction contained 5 μL of RNA, 12.5 μL of 2 × reaction buffer provided with the Superscript III one step RT-PCR system with Platinum Taq Polymerase (Invitrogen, Darmstadt, Germany; containing 0.4 mM of each deoxyribont triphosphates (dNTP) and 3.2 mM magnesium sulphate), 1 μL of reverse transcriptase/Taq mixture from the kit, 0.4 μL of a 50 mM magnesium sulphate solution (Invitrogen), and 1 μg of nonacetylated bovine serum albumin (Roche). Primer and probe sequences, as well as optimised concentrations are shown in Table 1. All oligonucleotides were synthesised and provided by Tib-Molbiol (Berlin, Germany). Thermal cycling was performed at 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and then 45 cycles of 95 °C for 15 s, 58 °C for 30 s. Participating laboratories used either Roche Light Cycler 480II or Applied Biosystems ViiA7 instruments (Applied Biosystems, Hong Kong, China).\nTable 1 Primers and probes, real-time RT-PCR for 2019 novel coronavirus\nAssay/use Oligonucleotide Sequencea Concentrationb\nRdRP gene RdRp_SARSr-F GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction\nRdRp_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV, will not detect SARS-CoV.Use 100 nM per reaction and mix with P1\nRdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs.Use 100 nM per reaction and mix with P2\nRdRp_SARSr-R CARATGTTAAASACACTATTAGCATA Use 800 nM per reaction\nE gene E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT Use 400 nm per reaction\nE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nm per reaction\nE_Sarbeco_R ATATTGCAGCAGTACGCACACA Use 400 nm per reaction\nN gene N_Sarbeco_F CACATTGGCACCCGCAATC Use 600 nm per reaction\nN_Sarbeco_P FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ Use 200 nm per reaction\nN_Sarbeco_R GAGGAACGAGAAGAGGCTTG Use 800 nm per reaction\na W is A/T; R is G/A; M is A/C; S is G/C. FAM: 6-carboxyfluorescein; BBQ: blackberry quencher.\nb Optimised concentrations are given in nanomol per litre (nM) based on the final reaction mix, e.g. 1.5 µL of a 10 µM primer stock solution per 25 µL total reaction volume yields a final concentration of 600 nM as indicated in the table."}

{"project":"LitCovid-PD-MONDO","denotations":[{"id":"T14","span":{"begin":1253,"end":1257},"obj":"Disease"},{"id":"T15","span":{"begin":1394,"end":1402},"obj":"Disease"},{"id":"T16","span":{"begin":1394,"end":1398},"obj":"Disease"},{"id":"T17","span":{"begin":1411,"end":1415},"obj":"Disease"}],"attributes":[{"id":"A14","pred":"mondo_id","subj":"T14","obj":"http://purl.obolibrary.org/obo/MONDO_0005091"},{"id":"A15","pred":"mondo_id","subj":"T15","obj":"http://purl.obolibrary.org/obo/MONDO_0005091"},{"id":"A16","pred":"mondo_id","subj":"T16","obj":"http://purl.obolibrary.org/obo/MONDO_0005091"},{"id":"A17","pred":"mondo_id","subj":"T17","obj":"http://purl.obolibrary.org/obo/MONDO_0005091"}],"text":"Real-time reverse-transcription PCR\nA 25 μL reaction contained 5 μL of RNA, 12.5 μL of 2 × reaction buffer provided with the Superscript III one step RT-PCR system with Platinum Taq Polymerase (Invitrogen, Darmstadt, Germany; containing 0.4 mM of each deoxyribont triphosphates (dNTP) and 3.2 mM magnesium sulphate), 1 μL of reverse transcriptase/Taq mixture from the kit, 0.4 μL of a 50 mM magnesium sulphate solution (Invitrogen), and 1 μg of nonacetylated bovine serum albumin (Roche). Primer and probe sequences, as well as optimised concentrations are shown in Table 1. All oligonucleotides were synthesised and provided by Tib-Molbiol (Berlin, Germany). Thermal cycling was performed at 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and then 45 cycles of 95 °C for 15 s, 58 °C for 30 s. Participating laboratories used either Roche Light Cycler 480II or Applied Biosystems ViiA7 instruments (Applied Biosystems, Hong Kong, China).\nTable 1 Primers and probes, real-time RT-PCR for 2019 novel coronavirus\nAssay/use Oligonucleotide Sequencea Concentrationb\nRdRP gene RdRp_SARSr-F GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction\nRdRp_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV, will not detect SARS-CoV.Use 100 nM per reaction and mix with P1\nRdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs.Use 100 nM per reaction and mix with P2\nRdRp_SARSr-R CARATGTTAAASACACTATTAGCATA Use 800 nM per reaction\nE gene E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT Use 400 nm per reaction\nE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nm per reaction\nE_Sarbeco_R ATATTGCAGCAGTACGCACACA Use 400 nm per reaction\nN gene N_Sarbeco_F CACATTGGCACCCGCAATC Use 600 nm per reaction\nN_Sarbeco_P FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ Use 200 nm per reaction\nN_Sarbeco_R GAGGAACGAGAAGAGGCTTG Use 800 nm per reaction\na W is A/T; R is G/A; M is A/C; S is G/C. FAM: 6-carboxyfluorescein; BBQ: blackberry quencher.\nb Optimised concentrations are given in nanomol per litre (nM) based on the final reaction mix, e.g. 1.5 µL of a 10 µM primer stock solution per 25 µL total reaction volume yields a final concentration of 600 nM as indicated in the table."}

{"project":"LitCovid-PD-CLO","denotations":[{"id":"T49","span":{"begin":36,"end":37},"obj":"http://purl.obolibrary.org/obo/CLO_0001020"},{"id":"T50","span":{"begin":383,"end":384},"obj":"http://purl.obolibrary.org/obo/CLO_0001020"},{"id":"T51","span":{"begin":642,"end":648},"obj":"http://purl.obolibrary.org/obo/CLO_0001929"},{"id":"T52","span":{"begin":774,"end":776},"obj":"http://purl.obolibrary.org/obo/CLO_0053799"},{"id":"T53","span":{"begin":911,"end":922},"obj":"http://purl.obolibrary.org/obo/OBI_0000968"},{"id":"T54","span":{"begin":1095,"end":1099},"obj":"http://purl.obolibrary.org/obo/OGG_0000000002"},{"id":"T55","span":{"begin":1174,"end":1176},"obj":"http://purl.obolibrary.org/obo/CLO_0008307"},{"id":"T56","span":{"begin":1299,"end":1301},"obj":"http://purl.obolibrary.org/obo/CLO_0008285"},{"id":"T57","span":{"begin":1313,"end":1315},"obj":"http://purl.obolibrary.org/obo/CLO_0008285"},{"id":"T58","span":{"begin":1353,"end":1356},"obj":"http://purl.obolibrary.org/obo/NCBITaxon_9596"},{"id":"T59","span":{"begin":1407,"end":1410},"obj":"http://purl.obolibrary.org/obo/NCBITaxon_9397"},{"id":"T60","span":{"begin":1466,"end":1468},"obj":"http://purl.obolibrary.org/obo/CLO_0008307"},{"id":"T61","span":{"begin":1537,"end":1541},"obj":"http://purl.obolibrary.org/obo/OGG_0000000002"},{"id":"T62","span":{"begin":1745,"end":1749},"obj":"http://purl.obolibrary.org/obo/OGG_0000000002"},{"id":"T63","span":{"begin":1940,"end":1941},"obj":"http://purl.obolibrary.org/obo/CLO_0001020"},{"id":"T64","span":{"begin":1947,"end":1948},"obj":"http://purl.obolibrary.org/obo/CLO_0001020"},{"id":"T65","span":{"begin":1959,"end":1960},"obj":"http://purl.obolibrary.org/obo/CLO_0001020"},{"id":"T66","span":{"begin":1967,"end":1968},"obj":"http://purl.obolibrary.org/obo/CLO_0001020"},{"id":"T67","span":{"begin":2035,"end":2036},"obj":"http://purl.obolibrary.org/obo/CLO_0001021"},{"id":"T68","span":{"begin":2146,"end":2150},"obj":"http://purl.obolibrary.org/obo/CLO_0001550"},{"id":"T69","span":{"begin":2215,"end":2216},"obj":"http://purl.obolibrary.org/obo/CLO_0001020"}],"text":"Real-time reverse-transcription PCR\nA 25 μL reaction contained 5 μL of RNA, 12.5 μL of 2 × reaction buffer provided with the Superscript III one step RT-PCR system with Platinum Taq Polymerase (Invitrogen, Darmstadt, Germany; containing 0.4 mM of each deoxyribont triphosphates (dNTP) and 3.2 mM magnesium sulphate), 1 μL of reverse transcriptase/Taq mixture from the kit, 0.4 μL of a 50 mM magnesium sulphate solution (Invitrogen), and 1 μg of nonacetylated bovine serum albumin (Roche). Primer and probe sequences, as well as optimised concentrations are shown in Table 1. All oligonucleotides were synthesised and provided by Tib-Molbiol (Berlin, Germany). Thermal cycling was performed at 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and then 45 cycles of 95 °C for 15 s, 58 °C for 30 s. Participating laboratories used either Roche Light Cycler 480II or Applied Biosystems ViiA7 instruments (Applied Biosystems, Hong Kong, China).\nTable 1 Primers and probes, real-time RT-PCR for 2019 novel coronavirus\nAssay/use Oligonucleotide Sequencea Concentrationb\nRdRP gene RdRp_SARSr-F GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction\nRdRp_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV, will not detect SARS-CoV.Use 100 nM per reaction and mix with P1\nRdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs.Use 100 nM per reaction and mix with P2\nRdRp_SARSr-R CARATGTTAAASACACTATTAGCATA Use 800 nM per reaction\nE gene E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT Use 400 nm per reaction\nE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nm per reaction\nE_Sarbeco_R ATATTGCAGCAGTACGCACACA Use 400 nm per reaction\nN gene N_Sarbeco_F CACATTGGCACCCGCAATC Use 600 nm per reaction\nN_Sarbeco_P FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ Use 200 nm per reaction\nN_Sarbeco_R GAGGAACGAGAAGAGGCTTG Use 800 nm per reaction\na W is A/T; R is G/A; M is A/C; S is G/C. FAM: 6-carboxyfluorescein; BBQ: blackberry quencher.\nb Optimised concentrations are given in nanomol per litre (nM) based on the final reaction mix, e.g. 1.5 µL of a 10 µM primer stock solution per 25 µL total reaction volume yields a final concentration of 600 nM as indicated in the table."}

{"project":"LitCovid-PD-CHEBI","denotations":[{"id":"T7","span":{"begin":100,"end":106},"obj":"Chemical"},{"id":"T8","span":{"begin":296,"end":314},"obj":"Chemical"},{"id":"T9","span":{"begin":296,"end":305},"obj":"Chemical"},{"id":"T10","span":{"begin":306,"end":314},"obj":"Chemical"},{"id":"T11","span":{"begin":351,"end":358},"obj":"Chemical"},{"id":"T12","span":{"begin":391,"end":409},"obj":"Chemical"},{"id":"T13","span":{"begin":391,"end":400},"obj":"Chemical"},{"id":"T14","span":{"begin":401,"end":409},"obj":"Chemical"},{"id":"T15","span":{"begin":410,"end":418},"obj":"Chemical"},{"id":"T16","span":{"begin":500,"end":505},"obj":"Chemical"},{"id":"T17","span":{"begin":579,"end":595},"obj":"Chemical"},{"id":"T18","span":{"begin":864,"end":869},"obj":"Chemical"},{"id":"T19","span":{"begin":1047,"end":1062},"obj":"Chemical"},{"id":"T20","span":{"begin":1174,"end":1176},"obj":"Chemical"},{"id":"T21","span":{"begin":1299,"end":1301},"obj":"Chemical"},{"id":"T22","span":{"begin":1313,"end":1315},"obj":"Chemical"},{"id":"T23","span":{"begin":1466,"end":1468},"obj":"Chemical"},{"id":"T24","span":{"begin":1987,"end":2007},"obj":"Chemical"},{"id":"T25","span":{"begin":2167,"end":2175},"obj":"Chemical"}],"attributes":[{"id":"A7","pred":"chebi_id","subj":"T7","obj":"http://purl.obolibrary.org/obo/CHEBI_35225"},{"id":"A8","pred":"chebi_id","subj":"T8","obj":"http://purl.obolibrary.org/obo/CHEBI_32599"},{"id":"A9","pred":"chebi_id","subj":"T9","obj":"http://purl.obolibrary.org/obo/CHEBI_25107"},{"id":"A10","pred":"chebi_id","subj":"T10","obj":"http://purl.obolibrary.org/obo/CHEBI_16189"},{"id":"A11","pred":"chebi_id","subj":"T11","obj":"http://purl.obolibrary.org/obo/CHEBI_60004"},{"id":"A12","pred":"chebi_id","subj":"T12","obj":"http://purl.obolibrary.org/obo/CHEBI_32599"},{"id":"A13","pred":"chebi_id","subj":"T13","obj":"http://purl.obolibrary.org/obo/CHEBI_25107"},{"id":"A14","pred":"chebi_id","subj":"T14","obj":"http://purl.obolibrary.org/obo/CHEBI_16189"},{"id":"A15","pred":"chebi_id","subj":"T15","obj":"http://purl.obolibrary.org/obo/CHEBI_75958"},{"id":"A16","pred":"chebi_id","subj":"T16","obj":"http://purl.obolibrary.org/obo/CHEBI_50406"},{"id":"A17","pred":"chebi_id","subj":"T17","obj":"http://purl.obolibrary.org/obo/CHEBI_7754"},{"id":"A18","pred":"chebi_id","subj":"T18","obj":"http://purl.obolibrary.org/obo/CHEBI_30212"},{"id":"A19","pred":"chebi_id","subj":"T19","obj":"http://purl.obolibrary.org/obo/CHEBI_7754"},{"id":"A20","pred":"chebi_id","subj":"T20","obj":"http://purl.obolibrary.org/obo/CHEBI_33472"},{"id":"A21","pred":"chebi_id","subj":"T21","obj":"http://purl.obolibrary.org/obo/CHEBI_60949"},{"id":"A22","pred":"chebi_id","subj":"T22","obj":"http://purl.obolibrary.org/obo/CHEBI_60949"},{"id":"A23","pred":"chebi_id","subj":"T23","obj":"http://purl.obolibrary.org/obo/CHEBI_33472"},{"id":"A24","pred":"chebi_id","subj":"T24","obj":"http://purl.obolibrary.org/obo/CHEBI_39073"},{"id":"A25","pred":"chebi_id","subj":"T25","obj":"http://purl.obolibrary.org/obo/CHEBI_75958"}],"text":"Real-time reverse-transcription PCR\nA 25 μL reaction contained 5 μL of RNA, 12.5 μL of 2 × reaction buffer provided with the Superscript III one step RT-PCR system with Platinum Taq Polymerase (Invitrogen, Darmstadt, Germany; containing 0.4 mM of each deoxyribont triphosphates (dNTP) and 3.2 mM magnesium sulphate), 1 μL of reverse transcriptase/Taq mixture from the kit, 0.4 μL of a 50 mM magnesium sulphate solution (Invitrogen), and 1 μg of nonacetylated bovine serum albumin (Roche). Primer and probe sequences, as well as optimised concentrations are shown in Table 1. All oligonucleotides were synthesised and provided by Tib-Molbiol (Berlin, Germany). Thermal cycling was performed at 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and then 45 cycles of 95 °C for 15 s, 58 °C for 30 s. Participating laboratories used either Roche Light Cycler 480II or Applied Biosystems ViiA7 instruments (Applied Biosystems, Hong Kong, China).\nTable 1 Primers and probes, real-time RT-PCR for 2019 novel coronavirus\nAssay/use Oligonucleotide Sequencea Concentrationb\nRdRP gene RdRp_SARSr-F GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction\nRdRp_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV, will not detect SARS-CoV.Use 100 nM per reaction and mix with P1\nRdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs.Use 100 nM per reaction and mix with P2\nRdRp_SARSr-R CARATGTTAAASACACTATTAGCATA Use 800 nM per reaction\nE gene E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT Use 400 nm per reaction\nE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nm per reaction\nE_Sarbeco_R ATATTGCAGCAGTACGCACACA Use 400 nm per reaction\nN gene N_Sarbeco_F CACATTGGCACCCGCAATC Use 600 nm per reaction\nN_Sarbeco_P FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ Use 200 nm per reaction\nN_Sarbeco_R GAGGAACGAGAAGAGGCTTG Use 800 nm per reaction\na W is A/T; R is G/A; M is A/C; S is G/C. FAM: 6-carboxyfluorescein; BBQ: blackberry quencher.\nb Optimised concentrations are given in nanomol per litre (nM) based on the final reaction mix, e.g. 1.5 µL of a 10 µM primer stock solution per 25 µL total reaction volume yields a final concentration of 600 nM as indicated in the table."}

{"project":"LitCovid-PD-GO-BP","denotations":[{"id":"T4","span":{"begin":10,"end":31},"obj":"http://purl.obolibrary.org/obo/GO_0001171"},{"id":"T5","span":{"begin":18,"end":31},"obj":"http://purl.obolibrary.org/obo/GO_0006351"},{"id":"T6","span":{"begin":333,"end":346},"obj":"http://purl.obolibrary.org/obo/GO_0003968"},{"id":"T7","span":{"begin":333,"end":346},"obj":"http://purl.obolibrary.org/obo/GO_0003899"},{"id":"T8","span":{"begin":714,"end":735},"obj":"http://purl.obolibrary.org/obo/GO_0001171"},{"id":"T9","span":{"begin":722,"end":735},"obj":"http://purl.obolibrary.org/obo/GO_0006351"},{"id":"T10","span":{"begin":1090,"end":1094},"obj":"http://purl.obolibrary.org/obo/GO_0003968"}],"text":"Real-time reverse-transcription PCR\nA 25 μL reaction contained 5 μL of RNA, 12.5 μL of 2 × reaction buffer provided with the Superscript III one step RT-PCR system with Platinum Taq Polymerase (Invitrogen, Darmstadt, Germany; containing 0.4 mM of each deoxyribont triphosphates (dNTP) and 3.2 mM magnesium sulphate), 1 μL of reverse transcriptase/Taq mixture from the kit, 0.4 μL of a 50 mM magnesium sulphate solution (Invitrogen), and 1 μg of nonacetylated bovine serum albumin (Roche). Primer and probe sequences, as well as optimised concentrations are shown in Table 1. All oligonucleotides were synthesised and provided by Tib-Molbiol (Berlin, Germany). Thermal cycling was performed at 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and then 45 cycles of 95 °C for 15 s, 58 °C for 30 s. Participating laboratories used either Roche Light Cycler 480II or Applied Biosystems ViiA7 instruments (Applied Biosystems, Hong Kong, China).\nTable 1 Primers and probes, real-time RT-PCR for 2019 novel coronavirus\nAssay/use Oligonucleotide Sequencea Concentrationb\nRdRP gene RdRp_SARSr-F GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction\nRdRp_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV, will not detect SARS-CoV.Use 100 nM per reaction and mix with P1\nRdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs.Use 100 nM per reaction and mix with P2\nRdRp_SARSr-R CARATGTTAAASACACTATTAGCATA Use 800 nM per reaction\nE gene E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT Use 400 nm per reaction\nE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nm per reaction\nE_Sarbeco_R ATATTGCAGCAGTACGCACACA Use 400 nm per reaction\nN gene N_Sarbeco_F CACATTGGCACCCGCAATC Use 600 nm per reaction\nN_Sarbeco_P FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ Use 200 nm per reaction\nN_Sarbeco_R GAGGAACGAGAAGAGGCTTG Use 800 nm per reaction\na W is A/T; R is G/A; M is A/C; S is G/C. FAM: 6-carboxyfluorescein; BBQ: blackberry quencher.\nb Optimised concentrations are given in nanomol per litre (nM) based on the final reaction mix, e.g. 1.5 µL of a 10 µM primer stock solution per 25 µL total reaction volume yields a final concentration of 600 nM as indicated in the table."}

{"project":"LitCovid-sentences","denotations":[{"id":"T41","span":{"begin":0,"end":35},"obj":"Sentence"},{"id":"T42","span":{"begin":36,"end":488},"obj":"Sentence"},{"id":"T43","span":{"begin":489,"end":574},"obj":"Sentence"},{"id":"T44","span":{"begin":575,"end":659},"obj":"Sentence"},{"id":"T45","span":{"begin":660,"end":818},"obj":"Sentence"},{"id":"T46","span":{"begin":819,"end":962},"obj":"Sentence"},{"id":"T47","span":{"begin":963,"end":1035},"obj":"Sentence"},{"id":"T48","span":{"begin":1036,"end":1089},"obj":"Sentence"},{"id":"T49","span":{"begin":1090,"end":1162},"obj":"Sentence"},{"id":"T50","span":{"begin":1163,"end":1301},"obj":"Sentence"},{"id":"T51","span":{"begin":1302,"end":1468},"obj":"Sentence"},{"id":"T52","span":{"begin":1469,"end":1534},"obj":"Sentence"},{"id":"T53","span":{"begin":1535,"end":1607},"obj":"Sentence"},{"id":"T54","span":{"begin":1608,"end":1681},"obj":"Sentence"},{"id":"T55","span":{"begin":1682,"end":1742},"obj":"Sentence"},{"id":"T56","span":{"begin":1743,"end":1808},"obj":"Sentence"},{"id":"T57","span":{"begin":1809,"end":1880},"obj":"Sentence"},{"id":"T58","span":{"begin":1881,"end":1939},"obj":"Sentence"},{"id":"T59","span":{"begin":1940,"end":1981},"obj":"Sentence"},{"id":"T60","span":{"begin":1982,"end":1986},"obj":"Sentence"},{"id":"T61","span":{"begin":1987,"end":2034},"obj":"Sentence"},{"id":"T62","span":{"begin":2035,"end":2273},"obj":"Sentence"}],"namespaces":[{"prefix":"_base","uri":"http://pubannotation.org/ontology/tao.owl#"}],"text":"Real-time reverse-transcription PCR\nA 25 μL reaction contained 5 μL of RNA, 12.5 μL of 2 × reaction buffer provided with the Superscript III one step RT-PCR system with Platinum Taq Polymerase (Invitrogen, Darmstadt, Germany; containing 0.4 mM of each deoxyribont triphosphates (dNTP) and 3.2 mM magnesium sulphate), 1 μL of reverse transcriptase/Taq mixture from the kit, 0.4 μL of a 50 mM magnesium sulphate solution (Invitrogen), and 1 μg of nonacetylated bovine serum albumin (Roche). Primer and probe sequences, as well as optimised concentrations are shown in Table 1. All oligonucleotides were synthesised and provided by Tib-Molbiol (Berlin, Germany). Thermal cycling was performed at 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and then 45 cycles of 95 °C for 15 s, 58 °C for 30 s. Participating laboratories used either Roche Light Cycler 480II or Applied Biosystems ViiA7 instruments (Applied Biosystems, Hong Kong, China).\nTable 1 Primers and probes, real-time RT-PCR for 2019 novel coronavirus\nAssay/use Oligonucleotide Sequencea Concentrationb\nRdRP gene RdRp_SARSr-F GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction\nRdRp_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV, will not detect SARS-CoV.Use 100 nM per reaction and mix with P1\nRdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs.Use 100 nM per reaction and mix with P2\nRdRp_SARSr-R CARATGTTAAASACACTATTAGCATA Use 800 nM per reaction\nE gene E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT Use 400 nm per reaction\nE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nm per reaction\nE_Sarbeco_R ATATTGCAGCAGTACGCACACA Use 400 nm per reaction\nN gene N_Sarbeco_F CACATTGGCACCCGCAATC Use 600 nm per reaction\nN_Sarbeco_P FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ Use 200 nm per reaction\nN_Sarbeco_R GAGGAACGAGAAGAGGCTTG Use 800 nm per reaction\na W is A/T; R is G/A; M is A/C; S is G/C. FAM: 6-carboxyfluorescein; BBQ: blackberry quencher.\nb Optimised concentrations are given in nanomol per litre (nM) based on the final reaction mix, e.g. 1.5 µL of a 10 µM primer stock solution per 25 µL total reaction volume yields a final concentration of 600 nM as indicated in the table."}

{"project":"LitCovid-PubTator","denotations":[{"id":"115","span":{"begin":466,"end":479},"obj":"Gene"},{"id":"116","span":{"begin":368,"end":371},"obj":"Gene"},{"id":"117","span":{"begin":579,"end":595},"obj":"Chemical"},{"id":"125","span":{"begin":1457,"end":1460},"obj":"Gene"},{"id":"126","span":{"begin":1290,"end":1293},"obj":"Gene"},{"id":"127","span":{"begin":1226,"end":1235},"obj":"Species"},{"id":"128","span":{"begin":1253,"end":1261},"obj":"Species"},{"id":"129","span":{"begin":1383,"end":1392},"obj":"Species"},{"id":"130","span":{"begin":1394,"end":1402},"obj":"Species"},{"id":"131","span":{"begin":1411,"end":1428},"obj":"Species"},{"id":"133","span":{"begin":1013,"end":1035},"obj":"Species"},{"id":"135","span":{"begin":1987,"end":2007},"obj":"Chemical"},{"id":"137","span":{"begin":2126,"end":2129},"obj":"Gene"}],"attributes":[{"id":"A115","pred":"tao:has_database_id","subj":"115","obj":"Gene:213"},{"id":"A116","pred":"tao:has_database_id","subj":"116","obj":"Gene:3815"},{"id":"A117","pred":"tao:has_database_id","subj":"117","obj":"MESH:D009841"},{"id":"A125","pred":"tao:has_database_id","subj":"125","obj":"Gene:83881"},{"id":"A126","pred":"tao:has_database_id","subj":"126","obj":"Gene:83881"},{"id":"A127","pred":"tao:has_database_id","subj":"127","obj":"Tax:2697049"},{"id":"A128","pred":"tao:has_database_id","subj":"128","obj":"Tax:694009"},{"id":"A129","pred":"tao:has_database_id","subj":"129","obj":"Tax:2697049"},{"id":"A130","pred":"tao:has_database_id","subj":"130","obj":"Tax:694009"},{"id":"A131","pred":"tao:has_database_id","subj":"131","obj":"Tax:694009"},{"id":"A133","pred":"tao:has_database_id","subj":"133","obj":"Tax:2697049"},{"id":"A135","pred":"tao:has_database_id","subj":"135","obj":"MESH:C024098"},{"id":"A137","pred":"tao:has_database_id","subj":"137","obj":"Gene:83881"}],"namespaces":[{"prefix":"Tax","uri":"https://www.ncbi.nlm.nih.gov/taxonomy/"},{"prefix":"MESH","uri":"https://id.nlm.nih.gov/mesh/"},{"prefix":"Gene","uri":"https://www.ncbi.nlm.nih.gov/gene/"},{"prefix":"CVCL","uri":"https://web.expasy.org/cellosaurus/CVCL_"}],"text":"Real-time reverse-transcription PCR\nA 25 μL reaction contained 5 μL of RNA, 12.5 μL of 2 × reaction buffer provided with the Superscript III one step RT-PCR system with Platinum Taq Polymerase (Invitrogen, Darmstadt, Germany; containing 0.4 mM of each deoxyribont triphosphates (dNTP) and 3.2 mM magnesium sulphate), 1 μL of reverse transcriptase/Taq mixture from the kit, 0.4 μL of a 50 mM magnesium sulphate solution (Invitrogen), and 1 μg of nonacetylated bovine serum albumin (Roche). Primer and probe sequences, as well as optimised concentrations are shown in Table 1. All oligonucleotides were synthesised and provided by Tib-Molbiol (Berlin, Germany). Thermal cycling was performed at 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and then 45 cycles of 95 °C for 15 s, 58 °C for 30 s. Participating laboratories used either Roche Light Cycler 480II or Applied Biosystems ViiA7 instruments (Applied Biosystems, Hong Kong, China).\nTable 1 Primers and probes, real-time RT-PCR for 2019 novel coronavirus\nAssay/use Oligonucleotide Sequencea Concentrationb\nRdRP gene RdRp_SARSr-F GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction\nRdRp_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV, will not detect SARS-CoV.Use 100 nM per reaction and mix with P1\nRdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs.Use 100 nM per reaction and mix with P2\nRdRp_SARSr-R CARATGTTAAASACACTATTAGCATA Use 800 nM per reaction\nE gene E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT Use 400 nm per reaction\nE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nm per reaction\nE_Sarbeco_R ATATTGCAGCAGTACGCACACA Use 400 nm per reaction\nN gene N_Sarbeco_F CACATTGGCACCCGCAATC Use 600 nm per reaction\nN_Sarbeco_P FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ Use 200 nm per reaction\nN_Sarbeco_R GAGGAACGAGAAGAGGCTTG Use 800 nm per reaction\na W is A/T; R is G/A; M is A/C; S is G/C. FAM: 6-carboxyfluorescein; BBQ: blackberry quencher.\nb Optimised concentrations are given in nanomol per litre (nM) based on the final reaction mix, e.g. 1.5 µL of a 10 µM primer stock solution per 25 µL total reaction volume yields a final concentration of 600 nM as indicated in the table."}