PMC:6988269 / 3935-8891 JSON TXT

Annnotations TAB JSON ListView MergeView

LitCovid-PD-FMA-UBERON

LitCovid-PD-UBERON

{"project":"LitCovid-PD-UBERON","denotations":[{"id":"T1","span":{"begin":813,"end":819},"obj":"Body_part"},{"id":"T2","span":{"begin":831,"end":835},"obj":"Body_part"},{"id":"T3","span":{"begin":840,"end":846},"obj":"Body_part"},{"id":"T4","span":{"begin":2102,"end":2107},"obj":"Body_part"}],"attributes":[{"id":"A1","pred":"uberon_id","subj":"T1","obj":"http://purl.obolibrary.org/obo/UBERON_0007311"},{"id":"A2","pred":"uberon_id","subj":"T2","obj":"http://purl.obolibrary.org/obo/UBERON_0000004"},{"id":"A3","pred":"uberon_id","subj":"T3","obj":"http://purl.obolibrary.org/obo/UBERON_0000341"},{"id":"A4","pred":"uberon_id","subj":"T4","obj":"http://purl.obolibrary.org/obo/UBERON_0001977"}],"text":"Methods\n\nClinical samples and coronavirus cell culture supernatants for initial assay evaluation\nCell culture supernatants containing typed coronaviruses and other respiratory viruses were provided by Charité and University of Hong Kong research laboratories. Respiratory samples were obtained during 2019 from patients hospitalised at Charité medical centre and tested by the NxTAG respiratory pathogen panel (Luminex, S´Hertogenbosch, The Netherlands) or in cases of MERS-CoV by the MERS-CoV upE assay as published before [10]. Additional samples were selected from biobanks at the Rijksinstituut voor Volksgezondheid en Milieu (RIVM), Bilthoven, at Erasmus University Medical Center, Rotterdam, at Public Health England (PHE), London, and at the University of Hong Kong. Samples from all collections comprised sputum as well as nose and throat swabs with or without viral transport medium.\nFaecal samples containing bat-derived SARS-related CoV samples (identified by GenBank accession numbers) were tested: KC633203, Betacoronavirus BtCoV/Rhi_eur/BB98–98/BGR/2008; KC633204, Betacoronavirus BtCoV/Rhi_eur/BB98–92/BGR/2008; KC633201, Betacoronavirus BtCoV/Rhi_bla/BB98–22/BGR/2008; GU190221 Betacoronavirus Bat coronavirus BR98–19/BGR/2008; GU190222 Betacoronavirus Bat coronavirus BM98–01/BGR/2008; GU190223, Betacoronavirus Bat coronavirus BM98–13/BGR/2008.\nAll synthetic RNA used in this study was photometrically quantified.\n\nRNA extraction\nRNA was extracted from clinical samples with the MagNA Pure 96 system (Roche, Penzberg, Germany) and from cell culture supernatants with the viral RNA mini kit (QIAGEN, Hilden, Germany).\n\nReal-time reverse-transcription PCR\nA 25 μL reaction contained 5 μL of RNA, 12.5 μL of 2 × reaction buffer provided with the Superscript III one step RT-PCR system with Platinum Taq Polymerase (Invitrogen, Darmstadt, Germany; containing 0.4 mM of each deoxyribont triphosphates (dNTP) and 3.2 mM magnesium sulphate), 1 μL of reverse transcriptase/Taq mixture from the kit, 0.4 μL of a 50 mM magnesium sulphate solution (Invitrogen), and 1 μg of nonacetylated bovine serum albumin (Roche). Primer and probe sequences, as well as optimised concentrations are shown in Table 1. All oligonucleotides were synthesised and provided by Tib-Molbiol (Berlin, Germany). Thermal cycling was performed at 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and then 45 cycles of 95 °C for 15 s, 58 °C for 30 s. Participating laboratories used either Roche Light Cycler 480II or Applied Biosystems ViiA7 instruments (Applied Biosystems, Hong Kong, China).\nTable 1 Primers and probes, real-time RT-PCR for 2019 novel coronavirus\nAssay/use Oligonucleotide Sequencea Concentrationb\nRdRP gene RdRp_SARSr-F GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction\nRdRp_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV, will not detect SARS-CoV.Use 100 nM per reaction and mix with P1\nRdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs.Use 100 nM per reaction and mix with P2\nRdRp_SARSr-R CARATGTTAAASACACTATTAGCATA Use 800 nM per reaction\nE gene E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT Use 400 nm per reaction\nE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nm per reaction\nE_Sarbeco_R ATATTGCAGCAGTACGCACACA Use 400 nm per reaction\nN gene N_Sarbeco_F CACATTGGCACCCGCAATC Use 600 nm per reaction\nN_Sarbeco_P FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ Use 200 nm per reaction\nN_Sarbeco_R GAGGAACGAGAAGAGGCTTG Use 800 nm per reaction\na W is A/T; R is G/A; M is A/C; S is G/C. FAM: 6-carboxyfluorescein; BBQ: blackberry quencher.\nb Optimised concentrations are given in nanomol per litre (nM) based on the final reaction mix, e.g. 1.5 µL of a 10 µM primer stock solution per 25 µL total reaction volume yields a final concentration of 600 nM as indicated in the table.\n\nProtocol options and application notes\nLaboratories participating in the evaluation used the TaqMan Fast Virus 1-Step Master Mix (Thermo Fisher) with the same oligonucleotide concentrations and cycling conditions. The QIAGEN One-Step RT-PCR Kit was also tested and found to be compatible.\nThe intended cross-reactivity of all assays with viral RNA of SARS-CoV allows us to use the assays without having to rely on external sources of specific 2019-nCoV RNA.\nFor a routine workflow, we recommend the E gene assay as the first-line screening tool, followed by confirmatory testing with the RdRp gene assay. Application of the RdRp gene assay with dual colour technology can discriminate 2019-nCoV (both probes positive) from SARS-CoV RNA if the latter is used as positive control. Alternatively, laboratories may choose to run the RdRp assay with only the 2019-nCoV-specific probe.\n\nEthical statement\nThe internal use of samples for diagnostic workflow optimisation was agreed under the medical ethical rules of each of the participating partners."}

LitCovid-PD-MONDO

{"project":"LitCovid-PD-MONDO","denotations":[{"id":"T13","span":{"begin":931,"end":935},"obj":"Disease"},{"id":"T14","span":{"begin":2889,"end":2893},"obj":"Disease"},{"id":"T15","span":{"begin":3030,"end":3038},"obj":"Disease"},{"id":"T16","span":{"begin":3030,"end":3034},"obj":"Disease"},{"id":"T17","span":{"begin":3047,"end":3051},"obj":"Disease"},{"id":"T18","span":{"begin":4262,"end":4270},"obj":"Disease"},{"id":"T19","span":{"begin":4262,"end":4266},"obj":"Disease"},{"id":"T20","span":{"begin":4634,"end":4642},"obj":"Disease"},{"id":"T21","span":{"begin":4634,"end":4638},"obj":"Disease"}],"attributes":[{"id":"A13","pred":"mondo_id","subj":"T13","obj":"http://purl.obolibrary.org/obo/MONDO_0005091"},{"id":"A14","pred":"mondo_id","subj":"T14","obj":"http://purl.obolibrary.org/obo/MONDO_0005091"},{"id":"A15","pred":"mondo_id","subj":"T15","obj":"http://purl.obolibrary.org/obo/MONDO_0005091"},{"id":"A16","pred":"mondo_id","subj":"T16","obj":"http://purl.obolibrary.org/obo/MONDO_0005091"},{"id":"A17","pred":"mondo_id","subj":"T17","obj":"http://purl.obolibrary.org/obo/MONDO_0005091"},{"id":"A18","pred":"mondo_id","subj":"T18","obj":"http://purl.obolibrary.org/obo/MONDO_0005091"},{"id":"A19","pred":"mondo_id","subj":"T19","obj":"http://purl.obolibrary.org/obo/MONDO_0005091"},{"id":"A20","pred":"mondo_id","subj":"T20","obj":"http://purl.obolibrary.org/obo/MONDO_0005091"},{"id":"A21","pred":"mondo_id","subj":"T21","obj":"http://purl.obolibrary.org/obo/MONDO_0005091"}],"text":"Methods\n\nClinical samples and coronavirus cell culture supernatants for initial assay evaluation\nCell culture supernatants containing typed coronaviruses and other respiratory viruses were provided by Charité and University of Hong Kong research laboratories. Respiratory samples were obtained during 2019 from patients hospitalised at Charité medical centre and tested by the NxTAG respiratory pathogen panel (Luminex, S´Hertogenbosch, The Netherlands) or in cases of MERS-CoV by the MERS-CoV upE assay as published before [10]. Additional samples were selected from biobanks at the Rijksinstituut voor Volksgezondheid en Milieu (RIVM), Bilthoven, at Erasmus University Medical Center, Rotterdam, at Public Health England (PHE), London, and at the University of Hong Kong. Samples from all collections comprised sputum as well as nose and throat swabs with or without viral transport medium.\nFaecal samples containing bat-derived SARS-related CoV samples (identified by GenBank accession numbers) were tested: KC633203, Betacoronavirus BtCoV/Rhi_eur/BB98–98/BGR/2008; KC633204, Betacoronavirus BtCoV/Rhi_eur/BB98–92/BGR/2008; KC633201, Betacoronavirus BtCoV/Rhi_bla/BB98–22/BGR/2008; GU190221 Betacoronavirus Bat coronavirus BR98–19/BGR/2008; GU190222 Betacoronavirus Bat coronavirus BM98–01/BGR/2008; GU190223, Betacoronavirus Bat coronavirus BM98–13/BGR/2008.\nAll synthetic RNA used in this study was photometrically quantified.\n\nRNA extraction\nRNA was extracted from clinical samples with the MagNA Pure 96 system (Roche, Penzberg, Germany) and from cell culture supernatants with the viral RNA mini kit (QIAGEN, Hilden, Germany).\n\nReal-time reverse-transcription PCR\nA 25 μL reaction contained 5 μL of RNA, 12.5 μL of 2 × reaction buffer provided with the Superscript III one step RT-PCR system with Platinum Taq Polymerase (Invitrogen, Darmstadt, Germany; containing 0.4 mM of each deoxyribont triphosphates (dNTP) and 3.2 mM magnesium sulphate), 1 μL of reverse transcriptase/Taq mixture from the kit, 0.4 μL of a 50 mM magnesium sulphate solution (Invitrogen), and 1 μg of nonacetylated bovine serum albumin (Roche). Primer and probe sequences, as well as optimised concentrations are shown in Table 1. All oligonucleotides were synthesised and provided by Tib-Molbiol (Berlin, Germany). Thermal cycling was performed at 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and then 45 cycles of 95 °C for 15 s, 58 °C for 30 s. Participating laboratories used either Roche Light Cycler 480II or Applied Biosystems ViiA7 instruments (Applied Biosystems, Hong Kong, China).\nTable 1 Primers and probes, real-time RT-PCR for 2019 novel coronavirus\nAssay/use Oligonucleotide Sequencea Concentrationb\nRdRP gene RdRp_SARSr-F GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction\nRdRp_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV, will not detect SARS-CoV.Use 100 nM per reaction and mix with P1\nRdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs.Use 100 nM per reaction and mix with P2\nRdRp_SARSr-R CARATGTTAAASACACTATTAGCATA Use 800 nM per reaction\nE gene E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT Use 400 nm per reaction\nE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nm per reaction\nE_Sarbeco_R ATATTGCAGCAGTACGCACACA Use 400 nm per reaction\nN gene N_Sarbeco_F CACATTGGCACCCGCAATC Use 600 nm per reaction\nN_Sarbeco_P FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ Use 200 nm per reaction\nN_Sarbeco_R GAGGAACGAGAAGAGGCTTG Use 800 nm per reaction\na W is A/T; R is G/A; M is A/C; S is G/C. FAM: 6-carboxyfluorescein; BBQ: blackberry quencher.\nb Optimised concentrations are given in nanomol per litre (nM) based on the final reaction mix, e.g. 1.5 µL of a 10 µM primer stock solution per 25 µL total reaction volume yields a final concentration of 600 nM as indicated in the table.\n\nProtocol options and application notes\nLaboratories participating in the evaluation used the TaqMan Fast Virus 1-Step Master Mix (Thermo Fisher) with the same oligonucleotide concentrations and cycling conditions. The QIAGEN One-Step RT-PCR Kit was also tested and found to be compatible.\nThe intended cross-reactivity of all assays with viral RNA of SARS-CoV allows us to use the assays without having to rely on external sources of specific 2019-nCoV RNA.\nFor a routine workflow, we recommend the E gene assay as the first-line screening tool, followed by confirmatory testing with the RdRp gene assay. Application of the RdRp gene assay with dual colour technology can discriminate 2019-nCoV (both probes positive) from SARS-CoV RNA if the latter is used as positive control. Alternatively, laboratories may choose to run the RdRp assay with only the 2019-nCoV-specific probe.\n\nEthical statement\nThe internal use of samples for diagnostic workflow optimisation was agreed under the medical ethical rules of each of the participating partners."}

LitCovid-PD-CLO

LitCovid-PD-CHEBI

LitCovid-PD-GO-BP

{"project":"LitCovid-PD-GO-BP","denotations":[{"id":"T2","span":{"begin":869,"end":884},"obj":"http://purl.obolibrary.org/obo/GO_0046794"},{"id":"T3","span":{"begin":875,"end":884},"obj":"http://purl.obolibrary.org/obo/GO_0006810"},{"id":"T4","span":{"begin":1646,"end":1667},"obj":"http://purl.obolibrary.org/obo/GO_0001171"},{"id":"T5","span":{"begin":1654,"end":1667},"obj":"http://purl.obolibrary.org/obo/GO_0006351"},{"id":"T6","span":{"begin":1969,"end":1982},"obj":"http://purl.obolibrary.org/obo/GO_0003968"},{"id":"T7","span":{"begin":1969,"end":1982},"obj":"http://purl.obolibrary.org/obo/GO_0003899"},{"id":"T8","span":{"begin":2350,"end":2371},"obj":"http://purl.obolibrary.org/obo/GO_0001171"},{"id":"T9","span":{"begin":2358,"end":2371},"obj":"http://purl.obolibrary.org/obo/GO_0006351"},{"id":"T10","span":{"begin":2726,"end":2730},"obj":"http://purl.obolibrary.org/obo/GO_0003968"}],"text":"Methods\n\nClinical samples and coronavirus cell culture supernatants for initial assay evaluation\nCell culture supernatants containing typed coronaviruses and other respiratory viruses were provided by Charité and University of Hong Kong research laboratories. Respiratory samples were obtained during 2019 from patients hospitalised at Charité medical centre and tested by the NxTAG respiratory pathogen panel (Luminex, S´Hertogenbosch, The Netherlands) or in cases of MERS-CoV by the MERS-CoV upE assay as published before [10]. Additional samples were selected from biobanks at the Rijksinstituut voor Volksgezondheid en Milieu (RIVM), Bilthoven, at Erasmus University Medical Center, Rotterdam, at Public Health England (PHE), London, and at the University of Hong Kong. Samples from all collections comprised sputum as well as nose and throat swabs with or without viral transport medium.\nFaecal samples containing bat-derived SARS-related CoV samples (identified by GenBank accession numbers) were tested: KC633203, Betacoronavirus BtCoV/Rhi_eur/BB98–98/BGR/2008; KC633204, Betacoronavirus BtCoV/Rhi_eur/BB98–92/BGR/2008; KC633201, Betacoronavirus BtCoV/Rhi_bla/BB98–22/BGR/2008; GU190221 Betacoronavirus Bat coronavirus BR98–19/BGR/2008; GU190222 Betacoronavirus Bat coronavirus BM98–01/BGR/2008; GU190223, Betacoronavirus Bat coronavirus BM98–13/BGR/2008.\nAll synthetic RNA used in this study was photometrically quantified.\n\nRNA extraction\nRNA was extracted from clinical samples with the MagNA Pure 96 system (Roche, Penzberg, Germany) and from cell culture supernatants with the viral RNA mini kit (QIAGEN, Hilden, Germany).\n\nReal-time reverse-transcription PCR\nA 25 μL reaction contained 5 μL of RNA, 12.5 μL of 2 × reaction buffer provided with the Superscript III one step RT-PCR system with Platinum Taq Polymerase (Invitrogen, Darmstadt, Germany; containing 0.4 mM of each deoxyribont triphosphates (dNTP) and 3.2 mM magnesium sulphate), 1 μL of reverse transcriptase/Taq mixture from the kit, 0.4 μL of a 50 mM magnesium sulphate solution (Invitrogen), and 1 μg of nonacetylated bovine serum albumin (Roche). Primer and probe sequences, as well as optimised concentrations are shown in Table 1. All oligonucleotides were synthesised and provided by Tib-Molbiol (Berlin, Germany). Thermal cycling was performed at 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and then 45 cycles of 95 °C for 15 s, 58 °C for 30 s. Participating laboratories used either Roche Light Cycler 480II or Applied Biosystems ViiA7 instruments (Applied Biosystems, Hong Kong, China).\nTable 1 Primers and probes, real-time RT-PCR for 2019 novel coronavirus\nAssay/use Oligonucleotide Sequencea Concentrationb\nRdRP gene RdRp_SARSr-F GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction\nRdRp_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV, will not detect SARS-CoV.Use 100 nM per reaction and mix with P1\nRdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs.Use 100 nM per reaction and mix with P2\nRdRp_SARSr-R CARATGTTAAASACACTATTAGCATA Use 800 nM per reaction\nE gene E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT Use 400 nm per reaction\nE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nm per reaction\nE_Sarbeco_R ATATTGCAGCAGTACGCACACA Use 400 nm per reaction\nN gene N_Sarbeco_F CACATTGGCACCCGCAATC Use 600 nm per reaction\nN_Sarbeco_P FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ Use 200 nm per reaction\nN_Sarbeco_R GAGGAACGAGAAGAGGCTTG Use 800 nm per reaction\na W is A/T; R is G/A; M is A/C; S is G/C. FAM: 6-carboxyfluorescein; BBQ: blackberry quencher.\nb Optimised concentrations are given in nanomol per litre (nM) based on the final reaction mix, e.g. 1.5 µL of a 10 µM primer stock solution per 25 µL total reaction volume yields a final concentration of 600 nM as indicated in the table.\n\nProtocol options and application notes\nLaboratories participating in the evaluation used the TaqMan Fast Virus 1-Step Master Mix (Thermo Fisher) with the same oligonucleotide concentrations and cycling conditions. The QIAGEN One-Step RT-PCR Kit was also tested and found to be compatible.\nThe intended cross-reactivity of all assays with viral RNA of SARS-CoV allows us to use the assays without having to rely on external sources of specific 2019-nCoV RNA.\nFor a routine workflow, we recommend the E gene assay as the first-line screening tool, followed by confirmatory testing with the RdRp gene assay. Application of the RdRp gene assay with dual colour technology can discriminate 2019-nCoV (both probes positive) from SARS-CoV RNA if the latter is used as positive control. Alternatively, laboratories may choose to run the RdRp assay with only the 2019-nCoV-specific probe.\n\nEthical statement\nThe internal use of samples for diagnostic workflow optimisation was agreed under the medical ethical rules of each of the participating partners."}

LitCovid-sentences

2_test

{"project":"2_test","denotations":[{"id":"31992387-23041020-29325739","span":{"begin":525,"end":527},"obj":"23041020"}],"text":"Methods\n\nClinical samples and coronavirus cell culture supernatants for initial assay evaluation\nCell culture supernatants containing typed coronaviruses and other respiratory viruses were provided by Charité and University of Hong Kong research laboratories. Respiratory samples were obtained during 2019 from patients hospitalised at Charité medical centre and tested by the NxTAG respiratory pathogen panel (Luminex, S´Hertogenbosch, The Netherlands) or in cases of MERS-CoV by the MERS-CoV upE assay as published before [10]. Additional samples were selected from biobanks at the Rijksinstituut voor Volksgezondheid en Milieu (RIVM), Bilthoven, at Erasmus University Medical Center, Rotterdam, at Public Health England (PHE), London, and at the University of Hong Kong. Samples from all collections comprised sputum as well as nose and throat swabs with or without viral transport medium.\nFaecal samples containing bat-derived SARS-related CoV samples (identified by GenBank accession numbers) were tested: KC633203, Betacoronavirus BtCoV/Rhi_eur/BB98–98/BGR/2008; KC633204, Betacoronavirus BtCoV/Rhi_eur/BB98–92/BGR/2008; KC633201, Betacoronavirus BtCoV/Rhi_bla/BB98–22/BGR/2008; GU190221 Betacoronavirus Bat coronavirus BR98–19/BGR/2008; GU190222 Betacoronavirus Bat coronavirus BM98–01/BGR/2008; GU190223, Betacoronavirus Bat coronavirus BM98–13/BGR/2008.\nAll synthetic RNA used in this study was photometrically quantified.\n\nRNA extraction\nRNA was extracted from clinical samples with the MagNA Pure 96 system (Roche, Penzberg, Germany) and from cell culture supernatants with the viral RNA mini kit (QIAGEN, Hilden, Germany).\n\nReal-time reverse-transcription PCR\nA 25 μL reaction contained 5 μL of RNA, 12.5 μL of 2 × reaction buffer provided with the Superscript III one step RT-PCR system with Platinum Taq Polymerase (Invitrogen, Darmstadt, Germany; containing 0.4 mM of each deoxyribont triphosphates (dNTP) and 3.2 mM magnesium sulphate), 1 μL of reverse transcriptase/Taq mixture from the kit, 0.4 μL of a 50 mM magnesium sulphate solution (Invitrogen), and 1 μg of nonacetylated bovine serum albumin (Roche). Primer and probe sequences, as well as optimised concentrations are shown in Table 1. All oligonucleotides were synthesised and provided by Tib-Molbiol (Berlin, Germany). Thermal cycling was performed at 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and then 45 cycles of 95 °C for 15 s, 58 °C for 30 s. Participating laboratories used either Roche Light Cycler 480II or Applied Biosystems ViiA7 instruments (Applied Biosystems, Hong Kong, China).\nTable 1 Primers and probes, real-time RT-PCR for 2019 novel coronavirus\nAssay/use Oligonucleotide Sequencea Concentrationb\nRdRP gene RdRp_SARSr-F GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction\nRdRp_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV, will not detect SARS-CoV.Use 100 nM per reaction and mix with P1\nRdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs.Use 100 nM per reaction and mix with P2\nRdRp_SARSr-R CARATGTTAAASACACTATTAGCATA Use 800 nM per reaction\nE gene E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT Use 400 nm per reaction\nE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nm per reaction\nE_Sarbeco_R ATATTGCAGCAGTACGCACACA Use 400 nm per reaction\nN gene N_Sarbeco_F CACATTGGCACCCGCAATC Use 600 nm per reaction\nN_Sarbeco_P FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ Use 200 nm per reaction\nN_Sarbeco_R GAGGAACGAGAAGAGGCTTG Use 800 nm per reaction\na W is A/T; R is G/A; M is A/C; S is G/C. FAM: 6-carboxyfluorescein; BBQ: blackberry quencher.\nb Optimised concentrations are given in nanomol per litre (nM) based on the final reaction mix, e.g. 1.5 µL of a 10 µM primer stock solution per 25 µL total reaction volume yields a final concentration of 600 nM as indicated in the table.\n\nProtocol options and application notes\nLaboratories participating in the evaluation used the TaqMan Fast Virus 1-Step Master Mix (Thermo Fisher) with the same oligonucleotide concentrations and cycling conditions. The QIAGEN One-Step RT-PCR Kit was also tested and found to be compatible.\nThe intended cross-reactivity of all assays with viral RNA of SARS-CoV allows us to use the assays without having to rely on external sources of specific 2019-nCoV RNA.\nFor a routine workflow, we recommend the E gene assay as the first-line screening tool, followed by confirmatory testing with the RdRp gene assay. Application of the RdRp gene assay with dual colour technology can discriminate 2019-nCoV (both probes positive) from SARS-CoV RNA if the latter is used as positive control. Alternatively, laboratories may choose to run the RdRp assay with only the 2019-nCoV-specific probe.\n\nEthical statement\nThe internal use of samples for diagnostic workflow optimisation was agreed under the medical ethical rules of each of the participating partners."}

LitCovid-PubTator

MyTest

{"project":"MyTest","denotations":[{"id":"31992387-23041020-29325739","span":{"begin":525,"end":527},"obj":"23041020"}],"namespaces":[{"prefix":"_base","uri":"https://www.uniprot.org/uniprot/testbase"},{"prefix":"UniProtKB","uri":"https://www.uniprot.org/uniprot/"},{"prefix":"uniprot","uri":"https://www.uniprot.org/uniprotkb/"}],"text":"Methods\n\nClinical samples and coronavirus cell culture supernatants for initial assay evaluation\nCell culture supernatants containing typed coronaviruses and other respiratory viruses were provided by Charité and University of Hong Kong research laboratories. Respiratory samples were obtained during 2019 from patients hospitalised at Charité medical centre and tested by the NxTAG respiratory pathogen panel (Luminex, S´Hertogenbosch, The Netherlands) or in cases of MERS-CoV by the MERS-CoV upE assay as published before [10]. Additional samples were selected from biobanks at the Rijksinstituut voor Volksgezondheid en Milieu (RIVM), Bilthoven, at Erasmus University Medical Center, Rotterdam, at Public Health England (PHE), London, and at the University of Hong Kong. Samples from all collections comprised sputum as well as nose and throat swabs with or without viral transport medium.\nFaecal samples containing bat-derived SARS-related CoV samples (identified by GenBank accession numbers) were tested: KC633203, Betacoronavirus BtCoV/Rhi_eur/BB98–98/BGR/2008; KC633204, Betacoronavirus BtCoV/Rhi_eur/BB98–92/BGR/2008; KC633201, Betacoronavirus BtCoV/Rhi_bla/BB98–22/BGR/2008; GU190221 Betacoronavirus Bat coronavirus BR98–19/BGR/2008; GU190222 Betacoronavirus Bat coronavirus BM98–01/BGR/2008; GU190223, Betacoronavirus Bat coronavirus BM98–13/BGR/2008.\nAll synthetic RNA used in this study was photometrically quantified.\n\nRNA extraction\nRNA was extracted from clinical samples with the MagNA Pure 96 system (Roche, Penzberg, Germany) and from cell culture supernatants with the viral RNA mini kit (QIAGEN, Hilden, Germany).\n\nReal-time reverse-transcription PCR\nA 25 μL reaction contained 5 μL of RNA, 12.5 μL of 2 × reaction buffer provided with the Superscript III one step RT-PCR system with Platinum Taq Polymerase (Invitrogen, Darmstadt, Germany; containing 0.4 mM of each deoxyribont triphosphates (dNTP) and 3.2 mM magnesium sulphate), 1 μL of reverse transcriptase/Taq mixture from the kit, 0.4 μL of a 50 mM magnesium sulphate solution (Invitrogen), and 1 μg of nonacetylated bovine serum albumin (Roche). Primer and probe sequences, as well as optimised concentrations are shown in Table 1. All oligonucleotides were synthesised and provided by Tib-Molbiol (Berlin, Germany). Thermal cycling was performed at 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and then 45 cycles of 95 °C for 15 s, 58 °C for 30 s. Participating laboratories used either Roche Light Cycler 480II or Applied Biosystems ViiA7 instruments (Applied Biosystems, Hong Kong, China).\nTable 1 Primers and probes, real-time RT-PCR for 2019 novel coronavirus\nAssay/use Oligonucleotide Sequencea Concentrationb\nRdRP gene RdRp_SARSr-F GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction\nRdRp_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV, will not detect SARS-CoV.Use 100 nM per reaction and mix with P1\nRdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs.Use 100 nM per reaction and mix with P2\nRdRp_SARSr-R CARATGTTAAASACACTATTAGCATA Use 800 nM per reaction\nE gene E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT Use 400 nm per reaction\nE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nm per reaction\nE_Sarbeco_R ATATTGCAGCAGTACGCACACA Use 400 nm per reaction\nN gene N_Sarbeco_F CACATTGGCACCCGCAATC Use 600 nm per reaction\nN_Sarbeco_P FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ Use 200 nm per reaction\nN_Sarbeco_R GAGGAACGAGAAGAGGCTTG Use 800 nm per reaction\na W is A/T; R is G/A; M is A/C; S is G/C. FAM: 6-carboxyfluorescein; BBQ: blackberry quencher.\nb Optimised concentrations are given in nanomol per litre (nM) based on the final reaction mix, e.g. 1.5 µL of a 10 µM primer stock solution per 25 µL total reaction volume yields a final concentration of 600 nM as indicated in the table.\n\nProtocol options and application notes\nLaboratories participating in the evaluation used the TaqMan Fast Virus 1-Step Master Mix (Thermo Fisher) with the same oligonucleotide concentrations and cycling conditions. The QIAGEN One-Step RT-PCR Kit was also tested and found to be compatible.\nThe intended cross-reactivity of all assays with viral RNA of SARS-CoV allows us to use the assays without having to rely on external sources of specific 2019-nCoV RNA.\nFor a routine workflow, we recommend the E gene assay as the first-line screening tool, followed by confirmatory testing with the RdRp gene assay. Application of the RdRp gene assay with dual colour technology can discriminate 2019-nCoV (both probes positive) from SARS-CoV RNA if the latter is used as positive control. Alternatively, laboratories may choose to run the RdRp assay with only the 2019-nCoV-specific probe.\n\nEthical statement\nThe internal use of samples for diagnostic workflow optimisation was agreed under the medical ethical rules of each of the participating partners."}

PMC:6988269 / 3935-8891 JSONTXT

Annnotations TAB JSON ListView MergeView

PMC:6988269 / 3935-8891 JSON TXT