> top > docs > PMC:6988269 > spans > 3935-8891 > annotations

PMC:6988269 / 3935-8891 JSONTXT

Annnotations TAB JSON ListView MergeView

LitCovid-PD-FMA-UBERON

Id Subject Object Predicate Lexical cue fma_id
T4 42-46 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T5 97-101 Body_part denotes Cell http://purl.org/sig/ont/fma/fma68646
T6 813-819 Body_part denotes sputum http://purl.org/sig/ont/fma/fma312401
T7 831-835 Body_part denotes nose http://purl.org/sig/ont/fma/fma46472
T8 840-846 Body_part denotes throat http://purl.org/sig/ont/fma/fma228738
T9 1377-1380 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T10 1433-1436 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T11 1448-1451 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T12 1554-1558 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T13 1595-1598 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T14 1707-1710 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T15 2102-2107 Body_part denotes serum http://purl.org/sig/ont/fma/fma63083
T16 2731-2735 Body_part denotes gene http://purl.org/sig/ont/fma/fma74402
T17 3173-3177 Body_part denotes gene http://purl.org/sig/ont/fma/fma74402
T18 3381-3385 Body_part denotes gene http://purl.org/sig/ont/fma/fma74402
T19 3605-3609 Body_part denotes C; S http://purl.org/sig/ont/fma/fma284995
T20 4255-4258 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T21 4364-4367 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T22 4412-4416 Body_part denotes gene http://purl.org/sig/ont/fma/fma74402
T23 4504-4508 Body_part denotes gene http://purl.org/sig/ont/fma/fma74402
T24 4540-4544 Body_part denotes gene http://purl.org/sig/ont/fma/fma74402
T25 4643-4646 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095

LitCovid-PD-UBERON

Id Subject Object Predicate Lexical cue uberon_id
T1 813-819 Body_part denotes sputum http://purl.obolibrary.org/obo/UBERON_0007311
T2 831-835 Body_part denotes nose http://purl.obolibrary.org/obo/UBERON_0000004
T3 840-846 Body_part denotes throat http://purl.obolibrary.org/obo/UBERON_0000341
T4 2102-2107 Body_part denotes serum http://purl.obolibrary.org/obo/UBERON_0001977

LitCovid-PD-MONDO

Id Subject Object Predicate Lexical cue mondo_id
T13 931-935 Disease denotes SARS http://purl.obolibrary.org/obo/MONDO_0005091
T14 2889-2893 Disease denotes SARS http://purl.obolibrary.org/obo/MONDO_0005091
T15 3030-3038 Disease denotes SARS-CoV http://purl.obolibrary.org/obo/MONDO_0005091
T16 3030-3034 Disease denotes SARS http://purl.obolibrary.org/obo/MONDO_0005091
T17 3047-3051 Disease denotes SARS http://purl.obolibrary.org/obo/MONDO_0005091
T18 4262-4270 Disease denotes SARS-CoV http://purl.obolibrary.org/obo/MONDO_0005091
T19 4262-4266 Disease denotes SARS http://purl.obolibrary.org/obo/MONDO_0005091
T20 4634-4642 Disease denotes SARS-CoV http://purl.obolibrary.org/obo/MONDO_0005091
T21 4634-4638 Disease denotes SARS http://purl.obolibrary.org/obo/MONDO_0005091

LitCovid-PD-CLO

Id Subject Object Predicate Lexical cue
T33 42-46 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T34 97-101 http://purl.obolibrary.org/obo/GO_0005623 denotes Cell
T35 176-183 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes viruses
T36 363-369 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tested
T37 620-622 http://purl.obolibrary.org/obo/CLO_0037161 denotes en
T38 831-835 http://www.ebi.ac.uk/efo/EFO_0000828 denotes nose
T39 919-922 http://purl.obolibrary.org/obo/NCBITaxon_9397 denotes bat
T40 1003-1009 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tested
T41 1059-1062 http://purl.obolibrary.org/obo/PR_000001807 denotes BGR
T42 1117-1120 http://purl.obolibrary.org/obo/PR_000001807 denotes BGR
T43 1172-1174 http://purl.obolibrary.org/obo/CLO_0050507 denotes 22
T44 1175-1178 http://purl.obolibrary.org/obo/PR_000001807 denotes BGR
T45 1234-1237 http://purl.obolibrary.org/obo/PR_000001807 denotes BGR
T46 1293-1296 http://purl.obolibrary.org/obo/PR_000001807 denotes BGR
T47 1353-1356 http://purl.obolibrary.org/obo/PR_000001807 denotes BGR
T48 1554-1558 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T49 1672-1673 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T50 2019-2020 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T51 2278-2284 http://purl.obolibrary.org/obo/CLO_0001929 denotes Berlin
T52 2410-2412 http://purl.obolibrary.org/obo/CLO_0053799 denotes 45
T53 2547-2558 http://purl.obolibrary.org/obo/OBI_0000968 denotes instruments
T54 2731-2735 http://purl.obolibrary.org/obo/OGG_0000000002 denotes gene
T55 2810-2812 http://purl.obolibrary.org/obo/CLO_0008307 denotes P2
T56 2935-2937 http://purl.obolibrary.org/obo/CLO_0008285 denotes P1
T57 2949-2951 http://purl.obolibrary.org/obo/CLO_0008285 denotes P1
T58 2989-2992 http://purl.obolibrary.org/obo/NCBITaxon_9596 denotes Pan
T59 3043-3046 http://purl.obolibrary.org/obo/NCBITaxon_9397 denotes bat
T60 3102-3104 http://purl.obolibrary.org/obo/CLO_0008307 denotes P2
T61 3173-3177 http://purl.obolibrary.org/obo/OGG_0000000002 denotes gene
T62 3381-3385 http://purl.obolibrary.org/obo/OGG_0000000002 denotes gene
T63 3576-3577 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T64 3583-3584 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T65 3595-3596 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T66 3603-3604 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T67 3671-3672 http://purl.obolibrary.org/obo/CLO_0001021 denotes b
T68 3782-3786 http://purl.obolibrary.org/obo/CLO_0001550 denotes a 10
T69 3851-3852 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T70 4016-4021 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes Virus
T71 4165-4171 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tested
T72 4373-4374 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T73 4412-4416 http://purl.obolibrary.org/obo/OGG_0000000002 denotes gene
T74 4482-4489 http://purl.obolibrary.org/obo/UBERON_0000473 denotes testing
T75 4504-4508 http://purl.obolibrary.org/obo/OGG_0000000002 denotes gene
T76 4540-4544 http://purl.obolibrary.org/obo/OGG_0000000002 denotes gene

LitCovid-PD-CHEBI

Id Subject Object Predicate Lexical cue chebi_id
T5 620-622 Chemical denotes en http://purl.obolibrary.org/obo/CHEBI_30347
T6 724-727 Chemical denotes PHE http://purl.obolibrary.org/obo/CHEBI_28044
T7 1736-1742 Chemical denotes buffer http://purl.obolibrary.org/obo/CHEBI_35225
T8 1932-1950 Chemical denotes magnesium sulphate http://purl.obolibrary.org/obo/CHEBI_32599
T9 1932-1941 Chemical denotes magnesium http://purl.obolibrary.org/obo/CHEBI_25107
T10 1942-1950 Chemical denotes sulphate http://purl.obolibrary.org/obo/CHEBI_16189
T11 1987-1994 Chemical denotes mixture http://purl.obolibrary.org/obo/CHEBI_60004
T12 2027-2045 Chemical denotes magnesium sulphate http://purl.obolibrary.org/obo/CHEBI_32599
T13 2027-2036 Chemical denotes magnesium http://purl.obolibrary.org/obo/CHEBI_25107
T14 2037-2045 Chemical denotes sulphate http://purl.obolibrary.org/obo/CHEBI_16189
T15 2046-2054 Chemical denotes solution http://purl.obolibrary.org/obo/CHEBI_75958
T16 2136-2141 Chemical denotes probe http://purl.obolibrary.org/obo/CHEBI_50406
T17 2215-2231 Chemical denotes oligonucleotides http://purl.obolibrary.org/obo/CHEBI_7754
T18 2500-2505 Chemical denotes Light http://purl.obolibrary.org/obo/CHEBI_30212
T19 2683-2698 Chemical denotes Oligonucleotide http://purl.obolibrary.org/obo/CHEBI_7754
T20 2810-2812 Chemical denotes P2 http://purl.obolibrary.org/obo/CHEBI_33472
T21 2935-2937 Chemical denotes P1 http://purl.obolibrary.org/obo/CHEBI_60949
T22 2949-2951 Chemical denotes P1 http://purl.obolibrary.org/obo/CHEBI_60949
T23 3102-3104 Chemical denotes P2 http://purl.obolibrary.org/obo/CHEBI_33472
T24 3623-3643 Chemical denotes 6-carboxyfluorescein http://purl.obolibrary.org/obo/CHEBI_39073
T25 3803-3811 Chemical denotes solution http://purl.obolibrary.org/obo/CHEBI_75958
T26 3932-3943 Chemical denotes application http://purl.obolibrary.org/obo/CHEBI_33232
T27 4070-4085 Chemical denotes oligonucleotide http://purl.obolibrary.org/obo/CHEBI_7754
T28 4784-4789 Chemical denotes probe http://purl.obolibrary.org/obo/CHEBI_50406

LitCovid-PD-GO-BP

Id Subject Object Predicate Lexical cue
T2 869-884 http://purl.obolibrary.org/obo/GO_0046794 denotes viral transport
T3 875-884 http://purl.obolibrary.org/obo/GO_0006810 denotes transport
T4 1646-1667 http://purl.obolibrary.org/obo/GO_0001171 denotes reverse-transcription
T5 1654-1667 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T6 1969-1982 http://purl.obolibrary.org/obo/GO_0003968 denotes transcriptase
T7 1969-1982 http://purl.obolibrary.org/obo/GO_0003899 denotes transcriptase
T8 2350-2371 http://purl.obolibrary.org/obo/GO_0001171 denotes reverse transcription
T9 2358-2371 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T10 2726-2730 http://purl.obolibrary.org/obo/GO_0003968 denotes RdRP

LitCovid-sentences

Id Subject Object Predicate Lexical cue
T31 0-7 Sentence denotes Methods
T32 9-96 Sentence denotes Clinical samples and coronavirus cell culture supernatants for initial assay evaluation
T33 97-259 Sentence denotes Cell culture supernatants containing typed coronaviruses and other respiratory viruses were provided by Charité and University of Hong Kong research laboratories.
T34 260-529 Sentence denotes Respiratory samples were obtained during 2019 from patients hospitalised at Charité medical centre and tested by the NxTAG respiratory pathogen panel (Luminex, S´Hertogenbosch, The Netherlands) or in cases of MERS-CoV by the MERS-CoV upE assay as published before [10].
T35 530-773 Sentence denotes Additional samples were selected from biobanks at the Rijksinstituut voor Volksgezondheid en Milieu (RIVM), Bilthoven, at Erasmus University Medical Center, Rotterdam, at Public Health England (PHE), London, and at the University of Hong Kong.
T36 774-892 Sentence denotes Samples from all collections comprised sputum as well as nose and throat swabs with or without viral transport medium.
T37 893-1362 Sentence denotes Faecal samples containing bat-derived SARS-related CoV samples (identified by GenBank accession numbers) were tested: KC633203, Betacoronavirus BtCoV/Rhi_eur/BB98–98/BGR/2008; KC633204, Betacoronavirus BtCoV/Rhi_eur/BB98–92/BGR/2008; KC633201, Betacoronavirus BtCoV/Rhi_bla/BB98–22/BGR/2008; GU190221 Betacoronavirus Bat coronavirus BR98–19/BGR/2008; GU190222 Betacoronavirus Bat coronavirus BM98–01/BGR/2008; GU190223, Betacoronavirus Bat coronavirus BM98–13/BGR/2008.
T38 1363-1431 Sentence denotes All synthetic RNA used in this study was photometrically quantified.
T39 1433-1447 Sentence denotes RNA extraction
T40 1448-1634 Sentence denotes RNA was extracted from clinical samples with the MagNA Pure 96 system (Roche, Penzberg, Germany) and from cell culture supernatants with the viral RNA mini kit (QIAGEN, Hilden, Germany).
T41 1636-1671 Sentence denotes Real-time reverse-transcription PCR
T42 1672-2124 Sentence denotes A 25 μL reaction contained 5 μL of RNA, 12.5 μL of 2 × reaction buffer provided with the Superscript III one step RT-PCR system with Platinum Taq Polymerase (Invitrogen, Darmstadt, Germany; containing 0.4 mM of each deoxyribont triphosphates (dNTP) and 3.2 mM magnesium sulphate), 1 μL of reverse transcriptase/Taq mixture from the kit, 0.4 μL of a 50 mM magnesium sulphate solution (Invitrogen), and 1 μg of nonacetylated bovine serum albumin (Roche).
T43 2125-2210 Sentence denotes Primer and probe sequences, as well as optimised concentrations are shown in Table 1.
T44 2211-2295 Sentence denotes All oligonucleotides were synthesised and provided by Tib-Molbiol (Berlin, Germany).
T45 2296-2454 Sentence denotes Thermal cycling was performed at 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and then 45 cycles of 95 °C for 15 s, 58 °C for 30 s.
T46 2455-2598 Sentence denotes Participating laboratories used either Roche Light Cycler 480II or Applied Biosystems ViiA7 instruments (Applied Biosystems, Hong Kong, China).
T47 2599-2671 Sentence denotes Table 1 Primers and probes, real-time RT-PCR for 2019 novel coronavirus
T48 2672-2725 Sentence denotes Assay/use Oligonucleotide Sequencea Concentrationb
T49 2726-2798 Sentence denotes RdRP gene RdRp_SARSr-F GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction
T50 2799-2937 Sentence denotes RdRp_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV, will not detect SARS-CoV.Use 100 nM per reaction and mix with P1
T51 2938-3104 Sentence denotes RdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs.Use 100 nM per reaction and mix with P2
T52 3105-3170 Sentence denotes RdRp_SARSr-R CARATGTTAAASACACTATTAGCATA Use 800 nM per reaction
T53 3171-3243 Sentence denotes E gene E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT Use 400 nm per reaction
T54 3244-3317 Sentence denotes E_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nm per reaction
T55 3318-3378 Sentence denotes E_Sarbeco_R ATATTGCAGCAGTACGCACACA Use 400 nm per reaction
T56 3379-3444 Sentence denotes N gene N_Sarbeco_F CACATTGGCACCCGCAATC Use 600 nm per reaction
T57 3445-3516 Sentence denotes N_Sarbeco_P FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ Use 200 nm per reaction
T58 3517-3575 Sentence denotes N_Sarbeco_R GAGGAACGAGAAGAGGCTTG Use 800 nm per reaction
T59 3576-3617 Sentence denotes a W is A/T; R is G/A; M is A/C; S is G/C.
T60 3618-3622 Sentence denotes FAM:
T61 3623-3670 Sentence denotes 6-carboxyfluorescein; BBQ: blackberry quencher.
T62 3671-3909 Sentence denotes b Optimised concentrations are given in nanomol per litre (nM) based on the final reaction mix, e.g. 1.5 µL of a 10 µM primer stock solution per 25 µL total reaction volume yields a final concentration of 600 nM as indicated in the table.
T63 3911-3949 Sentence denotes Protocol options and application notes
T64 3950-4124 Sentence denotes Laboratories participating in the evaluation used the TaqMan Fast Virus 1-Step Master Mix (Thermo Fisher) with the same oligonucleotide concentrations and cycling conditions.
T65 4125-4199 Sentence denotes The QIAGEN One-Step RT-PCR Kit was also tested and found to be compatible.
T66 4200-4368 Sentence denotes The intended cross-reactivity of all assays with viral RNA of SARS-CoV allows us to use the assays without having to rely on external sources of specific 2019-nCoV RNA.
T67 4369-4515 Sentence denotes For a routine workflow, we recommend the E gene assay as the first-line screening tool, followed by confirmatory testing with the RdRp gene assay.
T68 4516-4689 Sentence denotes Application of the RdRp gene assay with dual colour technology can discriminate 2019-nCoV (both probes positive) from SARS-CoV RNA if the latter is used as positive control.
T69 4690-4790 Sentence denotes Alternatively, laboratories may choose to run the RdRp assay with only the 2019-nCoV-specific probe.
T70 4792-4809 Sentence denotes Ethical statement
T71 4810-4956 Sentence denotes The internal use of samples for diagnostic workflow optimisation was agreed under the medical ethical rules of each of the participating partners.

2_test

Id Subject Object Predicate Lexical cue
31992387-23041020-29325739 525-527 23041020 denotes 10

LitCovid-PubTator

Id Subject Object Predicate Lexical cue tao:has_database_id
71 30-41 Species denotes coronavirus Tax:11118
80 140-153 Species denotes coronaviruses Tax:11118
81 311-319 Species denotes patients Tax:9606
82 469-477 Species denotes MERS-CoV Tax:1335626
83 485-493 Species denotes MERS-CoV Tax:1335626
84 164-175 Species denotes respiratory Tax:1439707
85 260-271 Species denotes Respiratory Tax:1439707
86 383-394 Species denotes respiratory Tax:1439707
87 584-619 Disease denotes Rijksinstituut voor Volksgezondheid
98 931-947 Species denotes SARS-related CoV Tax:694009
99 1021-1036 Species denotes Betacoronavirus Tax:694002
100 1079-1094 Species denotes Betacoronavirus Tax:694002
101 1137-1152 Species denotes Betacoronavirus Tax:694002
102 1194-1209 Species denotes Betacoronavirus Tax:694002
103 1210-1225 Species denotes Bat coronavirus Tax:1508220
104 1253-1268 Species denotes Betacoronavirus Tax:694002
105 1269-1301 Species denotes Bat coronavirus BM98–01/BGR/2008 Tax:864602
106 1313-1328 Species denotes Betacoronavirus Tax:694002
107 1329-1361 Species denotes Bat coronavirus BM98–13/BGR/2008 Tax:864605
109 1367-1380 Species denotes synthetic RNA Tax:2086595
111 1604-1607 Gene denotes kit Gene:3815
115 2102-2115 Gene denotes serum albumin Gene:213
116 2004-2007 Gene denotes kit Gene:3815
117 2215-2231 Chemical denotes oligonucleotides MESH:D009841
125 3093-3096 Gene denotes mix Gene:83881
126 2926-2929 Gene denotes mix Gene:83881
127 2862-2871 Species denotes 2019-nCoV Tax:2697049
128 2889-2897 Species denotes SARS-CoV Tax:694009
129 3019-3028 Species denotes 2019-nCoV Tax:2697049
130 3030-3038 Species denotes SARS-CoV Tax:694009
131 3047-3064 Species denotes SARS-related CoVs Tax:694009
133 2649-2671 Species denotes 2019 novel coronavirus Tax:2697049
135 3623-3643 Chemical denotes 6-carboxyfluorescein MESH:C024098
137 3762-3765 Gene denotes mix Gene:83881
141 4036-4039 Gene denotes Mix Gene:83881
142 4152-4155 Gene denotes Kit Gene:3815
143 4070-4085 Chemical denotes oligonucleotide MESH:D009841
146 4262-4270 Species denotes SARS-CoV Tax:694009
147 4354-4363 Species denotes 2019-nCoV Tax:2697049
154 4499-4503 Gene denotes RdRp Gene:43740578
155 4535-4539 Gene denotes RdRp Gene:43740578
156 4740-4744 Gene denotes RdRp Gene:43740578
157 4596-4605 Species denotes 2019-nCoV Tax:2697049
158 4634-4642 Species denotes SARS-CoV Tax:694009
159 4765-4774 Species denotes 2019-nCoV Tax:2697049

MyTest

Id Subject Object Predicate Lexical cue
31992387-23041020-29325739 525-527 23041020 denotes 10