Id |
Subject |
Object |
Predicate |
Lexical cue |
T5764 |
0-2 |
TO |
denotes |
To |
T5765 |
3-7 |
VB |
denotes |
make |
T5766 |
43-52 |
VBD |
denotes |
subcloned |
T5767 |
8-9 |
DT |
denotes |
a |
T5768 |
25-32 |
NN |
denotes |
protein |
T5769 |
10-13 |
NN |
denotes |
p53 |
T5770 |
14-17 |
NN |
denotes |
GFP |
T5771 |
13-14 |
HYPH |
denotes |
- |
T5772 |
18-24 |
NN |
denotes |
fusion |
T5773 |
32-34 |
, |
denotes |
, |
T5774 |
34-36 |
PRP |
denotes |
we |
T5775 |
37-42 |
RB |
denotes |
first |
T5776 |
53-54 |
DT |
denotes |
a |
T5777 |
69-77 |
NN |
denotes |
fragment |
T5778 |
55-60 |
NN |
denotes |
SacII |
T5779 |
61-68 |
NN |
denotes |
HindIII |
T5780 |
60-61 |
HYPH |
denotes |
- |
T5781 |
78-80 |
IN |
denotes |
of |
T5782 |
81-84 |
DT |
denotes |
the |
T5783 |
89-94 |
NN |
denotes |
locus |
T5784 |
85-88 |
NN |
denotes |
p53 |
T5785 |
95-96 |
-LRB- |
denotes |
( |
T5786 |
96-109 |
VBG |
denotes |
corresponding |
T5787 |
110-112 |
IN |
denotes |
to |
T5788 |
113-117 |
NN |
denotes |
part |
T5789 |
118-120 |
IN |
denotes |
of |
T5790 |
121-125 |
NN |
denotes |
exon |
T5791 |
126-128 |
CD |
denotes |
10 |
T5792 |
129-131 |
IN |
denotes |
to |
T5793 |
132-141 |
NNS |
denotes |
sequences |
T5794 |
142-152 |
RB |
denotes |
downstream |
T5795 |
153-155 |
IN |
denotes |
of |
T5796 |
156-159 |
DT |
denotes |
the |
T5797 |
160-164 |
NN |
denotes |
gene |
T5798 |
164-165 |
-RRB- |
denotes |
) |
T5799 |
166-170 |
IN |
denotes |
into |
T5800 |
171-174 |
NN |
denotes |
pBS |
T5801 |
174-176 |
, |
denotes |
, |
T5802 |
176-180 |
RB |
denotes |
then |
T5803 |
181-188 |
VBD |
denotes |
mutated |
T5804 |
189-192 |
DT |
denotes |
the |
T5805 |
201-205 |
NN |
denotes |
site |
T5806 |
193-200 |
NN |
denotes |
HindIII |
T5807 |
206-210 |
IN |
denotes |
into |
T5808 |
211-212 |
DT |
denotes |
a |
T5809 |
218-222 |
NN |
denotes |
site |
T5810 |
213-217 |
NN |
denotes |
FseI |
T5811 |
222-223 |
. |
denotes |
. |
T5812 |
223-614 |
sentence |
denotes |
We next mutated the C-terminal part of the p53 gene in two rounds of PCR mutagenesis, first with primers 5′-GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC-3′ and 5′-GACGGGATGCAGAGGGGATCCGTCTGAGTCAGGCCC-3′, which removed the stop codon and introduced a BamHI site, then with primers 5′-GACGGATCCCCTCTGAATTCCGTCCCCATCACCA-3′ and 5′-TGGTGATGGGGACGGAATACAGAGGGGATCCGTC-3′, which introduced an EcoRI site. |
T5813 |
224-226 |
PRP |
denotes |
We |
T5814 |
232-239 |
VBD |
denotes |
mutated |
T5815 |
227-231 |
RB |
denotes |
next |
T5816 |
240-243 |
DT |
denotes |
the |
T5817 |
255-259 |
NN |
denotes |
part |
T5818 |
244-245 |
NN |
denotes |
C |
T5819 |
246-254 |
JJ |
denotes |
terminal |
T5820 |
245-246 |
HYPH |
denotes |
- |
T5821 |
260-262 |
IN |
denotes |
of |
T5822 |
263-266 |
DT |
denotes |
the |
T5823 |
271-275 |
NN |
denotes |
gene |
T5824 |
267-270 |
NN |
denotes |
p53 |
T5825 |
276-278 |
IN |
denotes |
in |
T5826 |
279-282 |
CD |
denotes |
two |
T5827 |
283-289 |
NNS |
denotes |
rounds |
T5828 |
290-292 |
IN |
denotes |
of |
T5829 |
293-296 |
NN |
denotes |
PCR |
T5830 |
297-308 |
NN |
denotes |
mutagenesis |
T5831 |
308-310 |
, |
denotes |
, |
T5832 |
310-315 |
RB |
denotes |
first |
T5833 |
316-320 |
IN |
denotes |
with |
T5834 |
321-328 |
NNS |
denotes |
primers |
T5835 |
332-368 |
NN |
denotes |
GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
T5836 |
329-330 |
CD |
denotes |
5 |
T5837 |
330-331 |
SYM |
denotes |
′ |
T5838 |
331-332 |
HYPH |
denotes |
- |
T5839 |
368-369 |
HYPH |
denotes |
- |
T5840 |
369-370 |
CD |
denotes |
3 |
T5841 |
370-371 |
SYM |
denotes |
′ |
T5842 |
372-375 |
CC |
denotes |
and |
T5843 |
376-377 |
CD |
denotes |
5 |
T5844 |
379-415 |
NN |
denotes |
GACGGGATGCAGAGGGGATCCGTCTGAGTCAGGCCC |
T5845 |
377-378 |
SYM |
denotes |
′ |
T5846 |
378-379 |
HYPH |
denotes |
- |
T5847 |
415-416 |
HYPH |
denotes |
- |
T5848 |
416-417 |
CD |
denotes |
3 |
T5849 |
417-418 |
SYM |
denotes |
′ |
T5850 |
418-420 |
, |
denotes |
, |
T5851 |
420-425 |
WDT |
denotes |
which |
T5852 |
426-433 |
VBD |
denotes |
removed |
T5853 |
434-437 |
DT |
denotes |
the |
T5854 |
443-448 |
NN |
denotes |
codon |
T5855 |
438-442 |
NN |
denotes |
stop |
T5856 |
449-452 |
CC |
denotes |
and |
T5857 |
453-463 |
VBD |
denotes |
introduced |
T5858 |
464-465 |
DT |
denotes |
a |
T5859 |
472-476 |
NN |
denotes |
site |
T5860 |
466-471 |
NN |
denotes |
BamHI |
T5861 |
476-478 |
, |
denotes |
, |
T5862 |
478-482 |
RB |
denotes |
then |
T5863 |
483-487 |
IN |
denotes |
with |
T5864 |
488-495 |
NNS |
denotes |
primers |
T5865 |
499-533 |
NN |
denotes |
GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
T5866 |
496-497 |
CD |
denotes |
5 |
T5867 |
497-498 |
SYM |
denotes |
′ |
T5868 |
498-499 |
HYPH |
denotes |
- |
T5869 |
533-534 |
HYPH |
denotes |
- |
T5870 |
534-535 |
CD |
denotes |
3 |
T5871 |
535-536 |
SYM |
denotes |
′ |
T5872 |
537-540 |
CC |
denotes |
and |
T5873 |
541-542 |
CD |
denotes |
5 |
T5874 |
544-578 |
NN |
denotes |
TGGTGATGGGGACGGAATACAGAGGGGATCCGTC |
T5875 |
542-543 |
SYM |
denotes |
′ |
T5876 |
543-544 |
HYPH |
denotes |
- |
T5877 |
578-579 |
HYPH |
denotes |
- |
T5878 |
579-580 |
CD |
denotes |
3 |
T5879 |
580-581 |
SYM |
denotes |
′ |
T5880 |
581-583 |
, |
denotes |
, |
T5881 |
583-588 |
WDT |
denotes |
which |
T5882 |
589-599 |
VBD |
denotes |
introduced |
T5883 |
600-602 |
DT |
denotes |
an |
T5884 |
609-613 |
NN |
denotes |
site |
T5885 |
603-608 |
NN |
denotes |
EcoRI |
T5886 |
613-614 |
. |
denotes |
. |
T5887 |
614-801 |
sentence |
denotes |
We verified the sequence from the mutated plasmid, then digested it with BamHI and EcoRI, to insert in frame GFP sequences from a Bam HI-EcoRI fragment of plasmid phr-GFP-1 (Stratagene). |
T5888 |
615-617 |
PRP |
denotes |
We |
T5889 |
618-626 |
VBD |
denotes |
verified |
T5890 |
627-630 |
DT |
denotes |
the |
T5891 |
631-639 |
NN |
denotes |
sequence |
T5892 |
640-644 |
IN |
denotes |
from |
T5893 |
645-648 |
DT |
denotes |
the |
T5894 |
657-664 |
NN |
denotes |
plasmid |
T5895 |
649-656 |
VBN |
denotes |
mutated |
T5896 |
664-666 |
, |
denotes |
, |
T5897 |
666-670 |
RB |
denotes |
then |
T5898 |
671-679 |
VBD |
denotes |
digested |
T5899 |
680-682 |
PRP |
denotes |
it |
T5900 |
683-687 |
IN |
denotes |
with |
T5901 |
688-693 |
NN |
denotes |
BamHI |
T5902 |
694-697 |
CC |
denotes |
and |
T5903 |
698-703 |
NN |
denotes |
EcoRI |
T5904 |
703-705 |
, |
denotes |
, |
T5905 |
705-707 |
TO |
denotes |
to |
T5906 |
708-714 |
VB |
denotes |
insert |
T5907 |
715-717 |
IN |
denotes |
in |
T5908 |
718-723 |
NN |
denotes |
frame |
T5909 |
724-727 |
NN |
denotes |
GFP |
T5910 |
728-737 |
NNS |
denotes |
sequences |
T5911 |
738-742 |
IN |
denotes |
from |
T5912 |
743-744 |
DT |
denotes |
a |
T5913 |
758-766 |
NN |
denotes |
fragment |
T5914 |
745-748 |
NN |
denotes |
Bam |
T5915 |
752-757 |
NN |
denotes |
EcoRI |
T5916 |
749-751 |
NN |
denotes |
HI |
T5917 |
751-752 |
HYPH |
denotes |
- |
T5918 |
767-769 |
IN |
denotes |
of |
T5919 |
770-777 |
NN |
denotes |
plasmid |
T5920 |
782-785 |
NN |
denotes |
GFP |
T5921 |
778-781 |
NN |
denotes |
phr |
T5922 |
781-782 |
HYPH |
denotes |
- |
T5923 |
785-786 |
HYPH |
denotes |
- |
T5924 |
786-787 |
CD |
denotes |
1 |
T5925 |
788-789 |
-LRB- |
denotes |
( |
T5926 |
789-799 |
NNP |
denotes |
Stratagene |
T5927 |
799-800 |
-RRB- |
denotes |
) |
T5928 |
800-801 |
. |
denotes |
. |
T5929 |
801-1044 |
sentence |
denotes |
We verified the sequence of this p53-GFP fusion fragment, then swapped it in the L3-p53PmlEagPuroΔTK-1L plasmid (see above) by HindIII and FseI digestion, resulting in the p53GFP exchange construct, the sequence which was verified before use. |
T5930 |
802-804 |
PRP |
denotes |
We |
T5931 |
805-813 |
VBD |
denotes |
verified |
T5932 |
814-817 |
DT |
denotes |
the |
T5933 |
818-826 |
NN |
denotes |
sequence |
T5934 |
827-829 |
IN |
denotes |
of |
T5935 |
830-834 |
DT |
denotes |
this |
T5936 |
850-858 |
NN |
denotes |
fragment |
T5937 |
835-838 |
NN |
denotes |
p53 |
T5938 |
839-842 |
NN |
denotes |
GFP |
T5939 |
838-839 |
HYPH |
denotes |
- |
T5940 |
843-849 |
NN |
denotes |
fusion |
T5941 |
858-860 |
, |
denotes |
, |
T5942 |
860-864 |
RB |
denotes |
then |
T5943 |
865-872 |
VBD |
denotes |
swapped |
T5944 |
873-875 |
PRP |
denotes |
it |
T5945 |
876-878 |
IN |
denotes |
in |
T5946 |
879-882 |
DT |
denotes |
the |
T5947 |
906-913 |
NN |
denotes |
plasmid |
T5948 |
883-885 |
NN |
denotes |
L3 |
T5949 |
903-905 |
NN |
denotes |
1L |
T5950 |
885-886 |
HYPH |
denotes |
- |
T5951 |
886-902 |
NN |
denotes |
p53PmlEagPuroΔTK |
T5952 |
902-903 |
HYPH |
denotes |
- |
T5953 |
914-915 |
-LRB- |
denotes |
( |
T5954 |
915-918 |
VB |
denotes |
see |
T5955 |
919-924 |
RB |
denotes |
above |
T5956 |
924-925 |
-RRB- |
denotes |
) |
T5957 |
926-928 |
IN |
denotes |
by |
T5958 |
929-936 |
NN |
denotes |
HindIII |
T5959 |
946-955 |
NN |
denotes |
digestion |
T5960 |
937-940 |
CC |
denotes |
and |
T5961 |
941-945 |
NN |
denotes |
FseI |
T5962 |
955-957 |
, |
denotes |
, |
T5963 |
957-966 |
VBG |
denotes |
resulting |
T5964 |
967-969 |
IN |
denotes |
in |
T5965 |
970-973 |
DT |
denotes |
the |
T5966 |
990-999 |
NN |
denotes |
construct |
T5967 |
974-980 |
NN |
denotes |
p53GFP |
T5968 |
981-989 |
NN |
denotes |
exchange |
T5969 |
999-1001 |
, |
denotes |
, |
T5970 |
1001-1004 |
DT |
denotes |
the |
T5971 |
1005-1013 |
NN |
denotes |
sequence |
T5972 |
1014-1019 |
WDT |
denotes |
which |
T5973 |
1024-1032 |
VBN |
denotes |
verified |
T5974 |
1020-1023 |
VBD |
denotes |
was |
T5975 |
1033-1039 |
IN |
denotes |
before |
T5976 |
1040-1043 |
NN |
denotes |
use |
T5977 |
1043-1044 |
. |
denotes |
. |
T5978 |
1044-1220 |
sentence |
denotes |
The p53ΔPGFP exchange construct was engineered by combining sequences from the p53GFP exchange plasmid and sequences from the p53ΔP targeting construct described recently (5). |
T5979 |
1045-1048 |
DT |
denotes |
The |
T5980 |
1067-1076 |
NN |
denotes |
construct |
T5981 |
1049-1057 |
NN |
denotes |
p53ΔPGFP |
T5982 |
1058-1066 |
NN |
denotes |
exchange |
T5983 |
1081-1091 |
VBN |
denotes |
engineered |
T5984 |
1077-1080 |
VBD |
denotes |
was |
T5985 |
1092-1094 |
IN |
denotes |
by |
T5986 |
1095-1104 |
VBG |
denotes |
combining |
T5987 |
1105-1114 |
NNS |
denotes |
sequences |
T5988 |
1115-1119 |
IN |
denotes |
from |
T5989 |
1120-1123 |
DT |
denotes |
the |
T5990 |
1140-1147 |
NN |
denotes |
plasmid |
T5991 |
1124-1130 |
NN |
denotes |
p53GFP |
T5992 |
1131-1139 |
NN |
denotes |
exchange |
T5993 |
1148-1151 |
CC |
denotes |
and |
T5994 |
1152-1161 |
NNS |
denotes |
sequences |
T5995 |
1162-1166 |
IN |
denotes |
from |
T5996 |
1167-1170 |
DT |
denotes |
the |
T5997 |
1187-1196 |
NN |
denotes |
construct |
T5998 |
1171-1176 |
NN |
denotes |
p53ΔP |
T5999 |
1177-1186 |
NN |
denotes |
targeting |
T6000 |
1197-1206 |
VBN |
denotes |
described |
T6001 |
1207-1215 |
RB |
denotes |
recently |
T6002 |
1216-1217 |
-LRB- |
denotes |
( |
T6003 |
1217-1218 |
CD |
denotes |
5 |
T6004 |
1218-1219 |
-RRB- |
denotes |
) |
T6005 |
1219-1220 |
. |
denotes |
. |
T6006 |
1220-1263 |
sentence |
denotes |
Its sequence was also verified before use. |
T6007 |
1221-1224 |
PRP$ |
denotes |
Its |
T6008 |
1225-1233 |
NN |
denotes |
sequence |
T6009 |
1243-1251 |
VBN |
denotes |
verified |
T6010 |
1234-1237 |
VBD |
denotes |
was |
T6011 |
1238-1242 |
RB |
denotes |
also |
T6012 |
1252-1258 |
IN |
denotes |
before |
T6013 |
1259-1262 |
NN |
denotes |
use |
T6014 |
1262-1263 |
. |
denotes |
. |
R1628 |
T5764 |
T5765 |
aux |
To,make |
R1629 |
T5765 |
T5766 |
advcl |
make,subcloned |
R1630 |
T5767 |
T5768 |
det |
a,protein |
R1631 |
T5768 |
T5765 |
dobj |
protein,make |
R1632 |
T5769 |
T5770 |
compound |
p53,GFP |
R1633 |
T5770 |
T5768 |
compound |
GFP,protein |
R1634 |
T5771 |
T5770 |
punct |
-,GFP |
R1635 |
T5772 |
T5768 |
compound |
fusion,protein |
R1636 |
T5773 |
T5766 |
punct |
", ",subcloned |
R1637 |
T5774 |
T5766 |
nsubj |
we,subcloned |
R1638 |
T5775 |
T5766 |
advmod |
first,subcloned |
R1639 |
T5776 |
T5777 |
det |
a,fragment |
R1640 |
T5777 |
T5766 |
dobj |
fragment,subcloned |
R1641 |
T5778 |
T5779 |
compound |
SacII,HindIII |
R1642 |
T5779 |
T5777 |
compound |
HindIII,fragment |
R1643 |
T5780 |
T5779 |
punct |
-,HindIII |
R1644 |
T5781 |
T5777 |
prep |
of,fragment |
R1645 |
T5782 |
T5783 |
det |
the,locus |
R1646 |
T5783 |
T5781 |
pobj |
locus,of |
R1647 |
T5784 |
T5783 |
compound |
p53,locus |
R1648 |
T5785 |
T5777 |
punct |
(,fragment |
R1649 |
T5786 |
T5777 |
acl |
corresponding,fragment |
R1650 |
T5787 |
T5786 |
prep |
to,corresponding |
R1651 |
T5788 |
T5787 |
pobj |
part,to |
R1652 |
T5789 |
T5788 |
prep |
of,part |
R1653 |
T5790 |
T5789 |
pobj |
exon,of |
R1654 |
T5791 |
T5790 |
nummod |
10,exon |
R1655 |
T5792 |
T5786 |
prep |
to,corresponding |
R1656 |
T5793 |
T5792 |
pobj |
sequences,to |
R1657 |
T5794 |
T5793 |
advmod |
downstream,sequences |
R1658 |
T5795 |
T5794 |
prep |
of,downstream |
R1659 |
T5796 |
T5797 |
det |
the,gene |
R1660 |
T5797 |
T5795 |
pobj |
gene,of |
R1661 |
T5798 |
T5766 |
punct |
),subcloned |
R1662 |
T5799 |
T5766 |
prep |
into,subcloned |
R1663 |
T5800 |
T5799 |
pobj |
pBS,into |
R1664 |
T5801 |
T5766 |
punct |
", ",subcloned |
R1665 |
T5802 |
T5803 |
advmod |
then,mutated |
R1666 |
T5803 |
T5766 |
dep |
mutated,subcloned |
R1667 |
T5804 |
T5805 |
det |
the,site |
R1668 |
T5805 |
T5803 |
dobj |
site,mutated |
R1669 |
T5806 |
T5805 |
compound |
HindIII,site |
R1670 |
T5807 |
T5803 |
prep |
into,mutated |
R1671 |
T5808 |
T5809 |
det |
a,site |
R1672 |
T5809 |
T5807 |
pobj |
site,into |
R1673 |
T5810 |
T5809 |
compound |
FseI,site |
R1674 |
T5811 |
T5766 |
punct |
.,subcloned |
R1675 |
T5813 |
T5814 |
nsubj |
We,mutated |
R1676 |
T5815 |
T5814 |
advmod |
next,mutated |
R1677 |
T5816 |
T5817 |
det |
the,part |
R1678 |
T5817 |
T5814 |
dobj |
part,mutated |
R1679 |
T5818 |
T5819 |
npadvmod |
C,terminal |
R1680 |
T5819 |
T5817 |
amod |
terminal,part |
R1681 |
T5820 |
T5819 |
punct |
-,terminal |
R1682 |
T5821 |
T5817 |
prep |
of,part |
R1683 |
T5822 |
T5823 |
det |
the,gene |
R1684 |
T5823 |
T5821 |
pobj |
gene,of |
R1685 |
T5824 |
T5823 |
compound |
p53,gene |
R1686 |
T5825 |
T5814 |
prep |
in,mutated |
R1687 |
T5826 |
T5827 |
nummod |
two,rounds |
R1688 |
T5827 |
T5825 |
pobj |
rounds,in |
R1689 |
T5828 |
T5827 |
prep |
of,rounds |
R1690 |
T5829 |
T5830 |
compound |
PCR,mutagenesis |
R1691 |
T5830 |
T5828 |
pobj |
mutagenesis,of |
R1692 |
T5831 |
T5814 |
punct |
", ",mutated |
R1693 |
T5832 |
T5833 |
advmod |
first,with |
R1694 |
T5833 |
T5814 |
prep |
with,mutated |
R1695 |
T5834 |
T5835 |
nmod |
primers,GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1696 |
T5835 |
T5833 |
pobj |
GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC,with |
R1697 |
T5836 |
T5835 |
nummod |
5,GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1698 |
T5837 |
T5836 |
punct |
′,5 |
R1699 |
T5838 |
T5835 |
punct |
-,GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1700 |
T5839 |
T5835 |
punct |
-,GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1701 |
T5840 |
T5835 |
nummod |
3,GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1702 |
T5841 |
T5835 |
punct |
′,GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1703 |
T5842 |
T5835 |
cc |
and,GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1704 |
T5843 |
T5844 |
nummod |
5,GACGGGATGCAGAGGGGATCCGTCTGAGTCAGGCCC |
R1705 |
T5844 |
T5835 |
conj |
GACGGGATGCAGAGGGGATCCGTCTGAGTCAGGCCC,GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1706 |
T5845 |
T5843 |
punct |
′,5 |
R1707 |
T5846 |
T5844 |
punct |
-,GACGGGATGCAGAGGGGATCCGTCTGAGTCAGGCCC |
R1708 |
T5847 |
T5844 |
punct |
-,GACGGGATGCAGAGGGGATCCGTCTGAGTCAGGCCC |
R1709 |
T5848 |
T5844 |
nummod |
3,GACGGGATGCAGAGGGGATCCGTCTGAGTCAGGCCC |
R1710 |
T5849 |
T5844 |
punct |
′,GACGGGATGCAGAGGGGATCCGTCTGAGTCAGGCCC |
R1711 |
T5850 |
T5835 |
punct |
", ",GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1712 |
T5851 |
T5852 |
dep |
which,removed |
R1713 |
T5852 |
T5835 |
relcl |
removed,GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1714 |
T5853 |
T5854 |
det |
the,codon |
R1715 |
T5854 |
T5852 |
dobj |
codon,removed |
R1716 |
T5855 |
T5854 |
compound |
stop,codon |
R1717 |
T5856 |
T5852 |
cc |
and,removed |
R1718 |
T5857 |
T5852 |
conj |
introduced,removed |
R1719 |
T5858 |
T5859 |
det |
a,site |
R1720 |
T5859 |
T5857 |
dobj |
site,introduced |
R1721 |
T5860 |
T5859 |
compound |
BamHI,site |
R1722 |
T5861 |
T5833 |
punct |
", ",with |
R1723 |
T5862 |
T5863 |
advmod |
then,with |
R1724 |
T5863 |
T5833 |
prep |
with,with |
R1725 |
T5864 |
T5865 |
nmod |
primers,GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1726 |
T5865 |
T5863 |
pobj |
GACGGATCCCCTCTGAATTCCGTCCCCATCACCA,with |
R1727 |
T5866 |
T5865 |
nummod |
5,GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1728 |
T5867 |
T5866 |
punct |
′,5 |
R1729 |
T5868 |
T5865 |
punct |
-,GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1730 |
T5869 |
T5865 |
punct |
-,GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1731 |
T5870 |
T5865 |
nummod |
3,GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1732 |
T5871 |
T5865 |
punct |
′,GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1733 |
T5872 |
T5865 |
cc |
and,GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1734 |
T5873 |
T5874 |
nummod |
5,TGGTGATGGGGACGGAATACAGAGGGGATCCGTC |
R1735 |
T5874 |
T5865 |
conj |
TGGTGATGGGGACGGAATACAGAGGGGATCCGTC,GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1736 |
T5875 |
T5873 |
punct |
′,5 |
R1737 |
T5876 |
T5874 |
punct |
-,TGGTGATGGGGACGGAATACAGAGGGGATCCGTC |
R1738 |
T5877 |
T5874 |
punct |
-,TGGTGATGGGGACGGAATACAGAGGGGATCCGTC |
R1739 |
T5878 |
T5874 |
nummod |
3,TGGTGATGGGGACGGAATACAGAGGGGATCCGTC |
R1740 |
T5879 |
T5874 |
punct |
′,TGGTGATGGGGACGGAATACAGAGGGGATCCGTC |
R1741 |
T5880 |
T5865 |
punct |
", ",GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1742 |
T5881 |
T5882 |
dep |
which,introduced |
R1743 |
T5882 |
T5865 |
relcl |
introduced,GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1744 |
T5883 |
T5884 |
det |
an,site |
R1745 |
T5884 |
T5882 |
dobj |
site,introduced |
R1746 |
T5885 |
T5884 |
compound |
EcoRI,site |
R1747 |
T5886 |
T5814 |
punct |
.,mutated |
R1748 |
T5888 |
T5889 |
nsubj |
We,verified |
R1749 |
T5890 |
T5891 |
det |
the,sequence |
R1750 |
T5891 |
T5889 |
dobj |
sequence,verified |
R1751 |
T5892 |
T5891 |
prep |
from,sequence |
R1752 |
T5893 |
T5894 |
det |
the,plasmid |
R1753 |
T5894 |
T5892 |
pobj |
plasmid,from |
R1754 |
T5895 |
T5894 |
amod |
mutated,plasmid |
R1755 |
T5896 |
T5889 |
punct |
", ",verified |
R1756 |
T5897 |
T5898 |
advmod |
then,digested |
R1757 |
T5898 |
T5889 |
dep |
digested,verified |
R1758 |
T5899 |
T5898 |
dobj |
it,digested |
R1759 |
T5900 |
T5898 |
prep |
with,digested |
R1760 |
T5901 |
T5900 |
pobj |
BamHI,with |
R1761 |
T5902 |
T5901 |
cc |
and,BamHI |
R1762 |
T5903 |
T5901 |
conj |
EcoRI,BamHI |
R1763 |
T5904 |
T5889 |
punct |
", ",verified |
R1764 |
T5905 |
T5906 |
aux |
to,insert |
R1765 |
T5906 |
T5889 |
advcl |
insert,verified |
R1766 |
T5907 |
T5906 |
prep |
in,insert |
R1767 |
T5908 |
T5909 |
compound |
frame,GFP |
R1768 |
T5909 |
T5910 |
compound |
GFP,sequences |
R1769 |
T5910 |
T5907 |
pobj |
sequences,in |
R1770 |
T5911 |
T5910 |
prep |
from,sequences |
R1771 |
T5912 |
T5913 |
det |
a,fragment |
R1772 |
T5913 |
T5911 |
pobj |
fragment,from |
R1773 |
T5914 |
T5915 |
compound |
Bam,EcoRI |
R1774 |
T5915 |
T5913 |
compound |
EcoRI,fragment |
R1775 |
T5916 |
T5915 |
compound |
HI,EcoRI |
R1776 |
T5917 |
T5915 |
punct |
-,EcoRI |
R1777 |
T5918 |
T5913 |
prep |
of,fragment |
R1778 |
T5919 |
T5920 |
compound |
plasmid,GFP |
R1779 |
T5920 |
T5918 |
pobj |
GFP,of |
R1780 |
T5921 |
T5920 |
compound |
phr,GFP |
R1781 |
T5922 |
T5920 |
punct |
-,GFP |
R1782 |
T5923 |
T5920 |
punct |
-,GFP |
R1783 |
T5924 |
T5920 |
nummod |
1,GFP |
R1784 |
T5925 |
T5926 |
punct |
(,Stratagene |
R1785 |
T5926 |
T5913 |
parataxis |
Stratagene,fragment |
R1786 |
T5927 |
T5926 |
punct |
),Stratagene |
R1787 |
T5928 |
T5889 |
punct |
.,verified |
R1788 |
T5930 |
T5931 |
nsubj |
We,verified |
R1789 |
T5932 |
T5933 |
det |
the,sequence |
R1790 |
T5933 |
T5931 |
dobj |
sequence,verified |
R1791 |
T5934 |
T5933 |
prep |
of,sequence |
R1792 |
T5935 |
T5936 |
det |
this,fragment |
R1793 |
T5936 |
T5934 |
pobj |
fragment,of |
R1794 |
T5937 |
T5938 |
compound |
p53,GFP |
R1795 |
T5938 |
T5940 |
compound |
GFP,fusion |
R1796 |
T5939 |
T5938 |
punct |
-,GFP |
R1797 |
T5940 |
T5936 |
compound |
fusion,fragment |
R1798 |
T5941 |
T5931 |
punct |
", ",verified |
R1799 |
T5942 |
T5943 |
advmod |
then,swapped |
R1800 |
T5943 |
T5931 |
dep |
swapped,verified |
R1801 |
T5944 |
T5943 |
dobj |
it,swapped |
R1802 |
T5945 |
T5943 |
prep |
in,swapped |
R1803 |
T5946 |
T5947 |
det |
the,plasmid |
R1804 |
T5947 |
T5945 |
pobj |
plasmid,in |
R1805 |
T5948 |
T5949 |
compound |
L3,1L |
R1806 |
T5949 |
T5947 |
compound |
1L,plasmid |
R1807 |
T5950 |
T5949 |
punct |
-,1L |
R1808 |
T5951 |
T5949 |
compound |
p53PmlEagPuroΔTK,1L |
R1809 |
T5952 |
T5949 |
punct |
-,1L |
R1810 |
T5953 |
T5954 |
punct |
(,see |
R1811 |
T5954 |
T5943 |
parataxis |
see,swapped |
R1812 |
T5955 |
T5954 |
advmod |
above,see |
R1813 |
T5956 |
T5954 |
punct |
),see |
R1814 |
T5957 |
T5943 |
prep |
by,swapped |
R1815 |
T5958 |
T5959 |
nmod |
HindIII,digestion |
R1816 |
T5959 |
T5957 |
pobj |
digestion,by |
R1817 |
T5960 |
T5958 |
cc |
and,HindIII |
R1818 |
T5961 |
T5958 |
conj |
FseI,HindIII |
R1819 |
T5962 |
T5943 |
punct |
", ",swapped |
R1820 |
T5963 |
T5943 |
advcl |
resulting,swapped |
R1821 |
T5964 |
T5963 |
prep |
in,resulting |
R1822 |
T5965 |
T5966 |
det |
the,construct |
R1823 |
T5966 |
T5964 |
pobj |
construct,in |
R1824 |
T5967 |
T5968 |
compound |
p53GFP,exchange |
R1825 |
T5968 |
T5966 |
compound |
exchange,construct |
R1826 |
T5969 |
T5966 |
punct |
", ",construct |
R1827 |
T5970 |
T5971 |
det |
the,sequence |
R1828 |
T5971 |
T5966 |
appos |
sequence,construct |
R1829 |
T5972 |
T5973 |
dep |
which,verified |
R1830 |
T5973 |
T5971 |
relcl |
verified,sequence |
R1831 |
T5974 |
T5973 |
auxpass |
was,verified |
R1832 |
T5975 |
T5973 |
prep |
before,verified |
R1833 |
T5976 |
T5975 |
pobj |
use,before |
R1834 |
T5977 |
T5931 |
punct |
.,verified |
R1835 |
T5979 |
T5980 |
det |
The,construct |
R1836 |
T5980 |
T5983 |
nsubjpass |
construct,engineered |
R1837 |
T5981 |
T5982 |
compound |
p53ΔPGFP,exchange |
R1838 |
T5982 |
T5980 |
compound |
exchange,construct |
R1839 |
T5984 |
T5983 |
auxpass |
was,engineered |
R1840 |
T5985 |
T5983 |
prep |
by,engineered |
R1841 |
T5986 |
T5985 |
pcomp |
combining,by |
R1842 |
T5987 |
T5986 |
dobj |
sequences,combining |
R1843 |
T5988 |
T5987 |
prep |
from,sequences |
R1844 |
T5989 |
T5990 |
det |
the,plasmid |
R1845 |
T5990 |
T5988 |
pobj |
plasmid,from |
R1846 |
T5991 |
T5990 |
compound |
p53GFP,plasmid |
R1847 |
T5992 |
T5990 |
compound |
exchange,plasmid |
R1848 |
T5993 |
T5987 |
cc |
and,sequences |
R1849 |
T5994 |
T5987 |
conj |
sequences,sequences |
R1850 |
T5995 |
T5994 |
prep |
from,sequences |
R1851 |
T5996 |
T5997 |
det |
the,construct |
R1852 |
T5997 |
T5995 |
pobj |
construct,from |
R1853 |
T5998 |
T5997 |
compound |
p53ΔP,construct |
R1854 |
T5999 |
T5997 |
compound |
targeting,construct |
R1855 |
T6000 |
T5987 |
acl |
described,sequences |
R1856 |
T6001 |
T6000 |
advmod |
recently,described |
R1857 |
T6002 |
T6003 |
punct |
(,5 |
R1858 |
T6003 |
T5986 |
parataxis |
5,combining |
R1859 |
T6004 |
T6003 |
punct |
),5 |
R1860 |
T6005 |
T5983 |
punct |
.,engineered |
R1861 |
T6007 |
T6008 |
poss |
Its,sequence |
R1862 |
T6008 |
T6009 |
nsubjpass |
sequence,verified |
R1863 |
T6010 |
T6009 |
auxpass |
was,verified |
R1864 |
T6011 |
T6009 |
advmod |
also,verified |
R1865 |
T6012 |
T6009 |
prep |
before,verified |
R1866 |
T6013 |
T6012 |
pobj |
use,before |
R1867 |
T6014 |
T6009 |
punct |
.,verified |