> top > docs > PMC:1420271 > spans > 17460-18413 > annotations

PMC:1420271 / 17460-18413 JSONTXT

Annnotations TAB JSON ListView MergeView

craft-ca-core-dev

Below, discontinuous spans are shown in the chain model. You can change it to the bag model.

Id Subject Object Predicate Lexical cue
T9778 53-61 CL:0002322 denotes ES cells
T9779 62-69 SO:0001026 denotes genomic
T9780 103-113 GO:0019835 denotes Cell Lysis
T9781 114-122 CHEBI:75958 denotes Solution
T9782 172-179 SO:0001026 denotes genomic
T9783 240-247 CHEBI:2511 denotes agarose
T9784 273-278 CHEBI:25614 denotes nylon
T9785 313-315 SO:0000028 denotes bp
T9786 435-442 SO:0000112 denotes primers
T9787 482-484 SO:0000028 denotes bp
T9788 522-524 SO:0000028 denotes bp
T9789 562-564 SO:0000028 denotes bp
T9790 591-598 SO:0001026 denotes Genomic
T9791 670-672 SO:0000028 denotes bp
T9792 800-807 SO:0000112 denotes primers
T9793 819-829 GO:0097617 denotes hybridized
T9794 842-844 SO:0000028 denotes bp
T9795 884-886 SO:0000028 denotes bp
T9796 925-927 SO:0000028 denotes bp

craft-ca-core-ex-dev

Below, discontinuous spans are shown in the chain model. You can change it to the bag model.

Id Subject Object Predicate Lexical cue
T9797 39-52 GO_SO_EXT:sequence_rearrangement_process denotes recombination
T9798 53-61 CL:0002322 denotes ES cells
T9799 56-61 CL_GO_EXT:cell denotes cells
T9800 62-73 SO_EXT:genomic_DNA denotes genomic DNA
T9801 70-73 CHEBI_SO_EXT:DNA denotes DNA
T9802 103-107 CL_GO_EXT:cell denotes Cell
T9803 103-113 GO:0019835 denotes Cell Lysis
T9804 114-122 CHEBI:75958 denotes Solution
T9805 172-183 SO_EXT:genomic_DNA denotes genomic DNA
T9806 180-183 CHEBI_SO_EXT:DNA denotes DNA
T9807 240-247 CHEBI:2511 denotes agarose
T9808 256-267 GO_EXT:biological_movement_or_translocation_process denotes transferred
T9809 273-278 CHEBI:25614 denotes nylon
T9810 313-315 SO_EXT:0000028 denotes bp
T9811 319-324 CHEBI_SO_EXT:molecular_probe denotes probe
T9812 435-442 SO_EXT:0000112 denotes primers
T9813 448-453 CHEBI_SO_EXT:molecular_probe denotes probe
T9814 467-474 CHEBI_SO_EXT:molecular_label_or_mark_or_tag_process denotes labeled
T9815 482-484 SO_EXT:0000028 denotes bp
T9816 499-508 SO_EXT:wild_type_entity_or_quality denotes wild-type
T9817 522-524 SO_EXT:0000028 denotes bp
T9818 539-544 GO_EXT:beta_geo denotes β-geo
T9819 562-564 SO_EXT:0000028 denotes bp
T9820 591-602 SO_EXT:genomic_DNA denotes Genomic DNA
T9821 599-602 CHEBI_SO_EXT:DNA denotes DNA
T9822 670-672 SO_EXT:0000028 denotes bp
T9823 676-681 CHEBI_SO_EXT:molecular_probe denotes probe
T9824 800-807 SO_EXT:0000112 denotes primers
T9825 813-818 CHEBI_SO_EXT:molecular_probe denotes probe
T9826 819-829 GO:0097617 denotes hybridized
T9827 842-844 SO_EXT:0000028 denotes bp
T9828 859-868 SO_EXT:wild_type_entity_or_quality denotes wild-type
T9829 884-886 SO_EXT:0000028 denotes bp
T9830 901-906 GO_EXT:beta_geo denotes β-geo
T9831 925-927 SO_EXT:0000028 denotes bp

craft-sa-dev

Id Subject Object Predicate Lexical cue
T9832 0-8 NNP denotes Southern
T9833 9-13 NN denotes blot
T9834 14-23 NN denotes screening
T9835 24-27 IN denotes for
T9836 28-38 JJ denotes homologous
T9837 39-52 NN denotes recombination
T9838 52-140 sentence denotes ES cells genomic DNA was extracted with PUREGENE™ Cell Lysis Solution (Gentra systems).
T9839 53-55 NN denotes ES
T9840 56-61 NNS denotes cells
T9841 70-73 NN denotes DNA
T9842 62-69 JJ denotes genomic
T9843 78-87 VBN denotes extracted
T9844 74-77 VBD denotes was
T9845 88-92 IN denotes with
T9846 93-101 NNP denotes PUREGENE
T9847 114-122 NN denotes Solution
T9848 101-102 SYM denotes ™
T9849 103-107 NN denotes Cell
T9850 108-113 NN denotes Lysis
T9851 123-124 -LRB- denotes (
T9852 131-138 NNPS denotes systems
T9853 124-130 NNP denotes Gentra
T9854 138-139 -RRB- denotes )
T9855 139-140 . denotes .
T9856 140-306 sentence denotes For 5' Southern blot analysis, genomic DNA was first digested with PstI, then separated on an 0.8% agarose gel and transferred to a nylon membrane as described [20].
T9857 141-144 IN denotes For
T9858 194-202 VBN denotes digested
T9859 145-146 CD denotes 5
T9860 162-170 NN denotes analysis
T9861 146-147 SYM denotes '
T9862 148-156 NNP denotes Southern
T9863 157-161 NN denotes blot
T9864 170-172 , denotes ,
T9865 172-179 JJ denotes genomic
T9866 180-183 NN denotes DNA
T9867 184-187 VBD denotes was
T9868 188-193 RB denotes first
T9869 203-207 IN denotes with
T9870 208-212 NN denotes PstI
T9871 212-214 , denotes ,
T9872 214-218 RB denotes then
T9873 219-228 VBN denotes separated
T9874 229-231 IN denotes on
T9875 232-234 DT denotes an
T9876 248-251 NN denotes gel
T9877 235-238 CD denotes 0.8
T9878 238-239 NN denotes %
T9879 240-247 NN denotes agarose
T9880 252-255 CC denotes and
T9881 256-267 VBN denotes transferred
T9882 268-270 IN denotes to
T9883 271-272 DT denotes a
T9884 279-287 NN denotes membrane
T9885 273-278 NN denotes nylon
T9886 288-290 IN denotes as
T9887 291-300 VBN denotes described
T9888 301-302 -LRB- denotes [
T9889 302-304 CD denotes 20
T9890 304-305 -RRB- denotes ]
T9891 305-306 . denotes .
T9892 306-443 sentence denotes A 560 bp 5' probe was amplified using the ESG1S5 (5'- GATGGTGGTGGTGACTCAGAG -3') and ESG1AS5 as (5'- CCTCCATTGCCTCTATATCAG -3') primers.
T9893 307-308 DT denotes A
T9894 319-324 NN denotes probe
T9895 309-312 CD denotes 560
T9896 313-315 NN denotes bp
T9897 316-317 CD denotes 5
T9898 317-318 SYM denotes '
T9899 329-338 VBN denotes amplified
T9900 325-328 VBD denotes was
T9901 339-344 VBG denotes using
T9902 345-348 DT denotes the
T9903 349-355 NN denotes ESG1S5
T9904 356-357 -LRB- denotes (
T9905 361-382 NN denotes GATGGTGGTGGTGACTCAGAG
T9906 357-358 CD denotes 5
T9907 358-359 SYM denotes '
T9908 359-360 HYPH denotes -
T9909 383-384 HYPH denotes -
T9910 384-385 CD denotes 3
T9911 385-386 SYM denotes '
T9912 386-387 -RRB- denotes )
T9913 388-391 CC denotes and
T9914 392-399 NN denotes ESG1AS5
T9915 400-402 IN denotes as
T9916 403-404 -LRB- denotes (
T9917 435-442 NNS denotes primers
T9918 404-405 CD denotes 5
T9919 408-429 NN denotes CCTCCATTGCCTCTATATCAG
T9920 405-406 SYM denotes '
T9921 406-407 HYPH denotes -
T9922 430-431 HYPH denotes -
T9923 431-432 CD denotes 3
T9924 432-433 SYM denotes '
T9925 433-434 -RRB- denotes )
T9926 442-443 . denotes .
T9927 443-590 sentence denotes The probe specifically labeled an 18 kbp band from the wild-type locus, a 15 kbp band from the β-geo locus, and a 12 kbp band from the HygR locus.
T9928 444-447 DT denotes The
T9929 448-453 NN denotes probe
T9930 467-474 VBD denotes labeled
T9931 454-466 RB denotes specifically
T9932 475-477 DT denotes an
T9933 485-489 NN denotes band
T9934 478-480 CD denotes 18
T9935 481-484 NN denotes kbp
T9936 490-494 IN denotes from
T9937 495-498 DT denotes the
T9938 509-514 NN denotes locus
T9939 499-503 JJ denotes wild
T9940 503-504 HYPH denotes -
T9941 504-508 NN denotes type
T9942 514-516 , denotes ,
T9943 516-517 DT denotes a
T9944 525-529 NN denotes band
T9945 518-520 CD denotes 15
T9946 521-524 NN denotes kbp
T9947 530-534 IN denotes from
T9948 535-538 DT denotes the
T9949 545-550 NN denotes locus
T9950 539-540 NN denotes β
T9951 541-544 NN denotes geo
T9952 540-541 HYPH denotes -
T9953 550-552 , denotes ,
T9954 552-555 CC denotes and
T9955 556-557 DT denotes a
T9956 565-569 NN denotes band
T9957 558-560 CD denotes 12
T9958 561-564 NN denotes kbp
T9959 570-574 IN denotes from
T9960 575-578 DT denotes the
T9961 584-589 NN denotes locus
T9962 579-583 NN denotes HygR
T9963 589-590 . denotes .
T9964 590-661 sentence denotes Genomic DNA was also digested with SpeI for 3' Southern blot analysis.
T9965 591-598 JJ denotes Genomic
T9966 599-602 NN denotes DNA
T9967 612-620 VBN denotes digested
T9968 603-606 VBD denotes was
T9969 607-611 RB denotes also
T9970 621-625 IN denotes with
T9971 626-630 NN denotes SpeI
T9972 631-634 IN denotes for
T9973 635-636 CD denotes 3
T9974 652-660 NN denotes analysis
T9975 636-637 SYM denotes '
T9976 638-646 NNP denotes Southern
T9977 647-651 NN denotes blot
T9978 660-661 . denotes .
T9979 661-808 sentence denotes A 1,010 bp 3' probe was amplified with the pH34U-8000 (5'- CCAACCAGCCAGAGTTTCAGTTAT -3') and pH34L-9000 (5'-GATAAGCTGCTGCCAAAAGACAAG -3') primers.
T9980 662-663 DT denotes A
T9981 676-681 NN denotes probe
T9982 664-669 CD denotes 1,010
T9983 670-672 NN denotes bp
T9984 673-674 CD denotes 3
T9985 674-675 SYM denotes '
T9986 686-695 VBN denotes amplified
T9987 682-685 VBD denotes was
T9988 696-700 IN denotes with
T9989 701-704 DT denotes the
T9990 800-807 NNS denotes primers
T9991 705-710 NN denotes pH34U
T9992 710-711 HYPH denotes -
T9993 711-715 CD denotes 8000
T9994 716-717 -LRB- denotes (
T9995 721-745 NN denotes CCAACCAGCCAGAGTTTCAGTTAT
T9996 717-718 CD denotes 5
T9997 718-719 SYM denotes '
T9998 719-720 HYPH denotes -
T9999 746-747 HYPH denotes -
T10000 747-748 CD denotes 3
T10001 748-749 SYM denotes '
T10002 749-750 -RRB- denotes )
T10003 751-754 CC denotes and
T10004 755-760 NN denotes pH34L
T10005 760-761 HYPH denotes -
T10006 761-765 CD denotes 9000
T10007 766-767 -LRB- denotes (
T10008 770-794 NN denotes GATAAGCTGCTGCCAAAAGACAAG
T10009 767-768 CD denotes 5
T10010 768-769 SYM denotes '
T10011 769-770 HYPH denotes -
T10012 795-796 HYPH denotes -
T10013 796-797 CD denotes 3
T10014 797-798 SYM denotes '
T10015 798-799 -RRB- denotes )
T10016 807-808 . denotes .
T10017 808-953 sentence denotes The probe hybridized to an 11.5 kbp band from the wild-type locus, a 12.5 kbp band from the β-geo locus, and a 9.5 kbp band from the HygR locus.
T10018 809-812 DT denotes The
T10019 813-818 NN denotes probe
T10020 819-829 VBD denotes hybridized
T10021 830-832 IN denotes to
T10022 833-835 DT denotes an
T10023 845-849 NN denotes band
T10024 836-840 CD denotes 11.5
T10025 841-844 NN denotes kbp
T10026 850-854 IN denotes from
T10027 855-858 DT denotes the
T10028 869-874 NN denotes locus
T10029 859-863 JJ denotes wild
T10030 864-868 NN denotes type
T10031 863-864 HYPH denotes -
T10032 874-876 , denotes ,
T10033 876-877 DT denotes a
T10034 887-891 NN denotes band
T10035 878-882 CD denotes 12.5
T10036 883-886 NN denotes kbp
T10037 892-896 IN denotes from
T10038 897-900 DT denotes the
T10039 907-912 NN denotes locus
T10040 901-902 NN denotes β
T10041 903-906 NN denotes geo
T10042 902-903 HYPH denotes -
T10043 912-914 , denotes ,
T10044 914-917 CC denotes and
T10045 918-919 DT denotes a
T10046 928-932 NN denotes band
T10047 920-923 CD denotes 9.5
T10048 924-927 NN denotes kbp
T10049 933-937 IN denotes from
T10050 938-941 DT denotes the
T10051 947-952 NN denotes locus
T10052 942-946 NN denotes HygR
T10053 952-953 . denotes .
R2683 T9832 T9833 compound Southern,blot
R2684 T9833 T9834 compound blot,screening
R2685 T9835 T9834 prep for,screening
R2686 T9836 T9837 amod homologous,recombination
R2687 T9837 T9835 pobj recombination,for
R2688 T9839 T9840 nmod ES,cells
R2689 T9840 T9841 nmod cells,DNA
R2690 T9841 T9843 nsubjpass DNA,extracted
R2691 T9842 T9841 amod genomic,DNA
R2692 T9844 T9843 auxpass was,extracted
R2693 T9845 T9843 prep with,extracted
R2694 T9846 T9847 nmod PUREGENE,Solution
R2695 T9847 T9845 pobj Solution,with
R2696 T9848 T9846 punct ™,PUREGENE
R2697 T9849 T9850 compound Cell,Lysis
R2698 T9850 T9847 compound Lysis,Solution
R2699 T9851 T9852 punct (,systems
R2700 T9852 T9847 parataxis systems,Solution
R2701 T9853 T9852 compound Gentra,systems
R2702 T9854 T9852 punct ),systems
R2703 T9855 T9843 punct .,extracted
R2704 T9857 T9858 prep For,digested
R2705 T9859 T9860 nummod 5,analysis
R2706 T9860 T9857 pobj analysis,For
R2707 T9861 T9859 punct ',5
R2708 T9862 T9863 compound Southern,blot
R2709 T9863 T9860 compound blot,analysis
R2710 T9864 T9858 punct ", ",digested
R2711 T9865 T9866 amod genomic,DNA
R2712 T9866 T9858 nsubjpass DNA,digested
R2713 T9867 T9858 auxpass was,digested
R2714 T9868 T9858 advmod first,digested
R2715 T9869 T9858 prep with,digested
R2716 T9870 T9869 pobj PstI,with
R2717 T9871 T9858 punct ", ",digested
R2718 T9872 T9873 advmod then,separated
R2719 T9873 T9858 conj separated,digested
R2720 T9874 T9873 prep on,separated
R2721 T9875 T9876 det an,gel
R2722 T9876 T9874 pobj gel,on
R2723 T9877 T9878 nummod 0.8,%
R2724 T9878 T9876 compound %,gel
R2725 T9879 T9876 compound agarose,gel
R2726 T9880 T9873 cc and,separated
R2727 T9881 T9873 conj transferred,separated
R2728 T9882 T9881 prep to,transferred
R2729 T9883 T9884 det a,membrane
R2730 T9884 T9882 pobj membrane,to
R2731 T9885 T9884 compound nylon,membrane
R2732 T9886 T9887 mark as,described
R2733 T9887 T9881 advcl described,transferred
R2734 T9888 T9889 punct [,20
R2735 T9889 T9887 parataxis 20,described
R2736 T9890 T9889 punct ],20
R2737 T9891 T9858 punct .,digested
R2738 T9893 T9894 det A,probe
R2739 T9894 T9899 nsubjpass probe,amplified
R2740 T9895 T9896 nummod 560,bp
R2741 T9896 T9894 nmod bp,probe
R2742 T9897 T9894 nummod 5,probe
R2743 T9898 T9897 punct ',5
R2744 T9900 T9899 auxpass was,amplified
R2745 T9901 T9899 advcl using,amplified
R2746 T9902 T9903 det the,ESG1S5
R2747 T9903 T9901 dobj ESG1S5,using
R2748 T9904 T9905 punct (,GATGGTGGTGGTGACTCAGAG
R2749 T9905 T9903 parataxis GATGGTGGTGGTGACTCAGAG,ESG1S5
R2750 T9906 T9905 nummod 5,GATGGTGGTGGTGACTCAGAG
R2751 T9907 T9906 punct ',5
R2752 T9908 T9905 punct -,GATGGTGGTGGTGACTCAGAG
R2753 T9909 T9905 punct -,GATGGTGGTGGTGACTCAGAG
R2754 T9910 T9905 nummod 3,GATGGTGGTGGTGACTCAGAG
R2755 T9911 T9905 punct ',GATGGTGGTGGTGACTCAGAG
R2756 T9912 T9905 punct ),GATGGTGGTGGTGACTCAGAG
R2757 T9913 T9903 cc and,ESG1S5
R2758 T9914 T9903 conj ESG1AS5,ESG1S5
R2759 T9915 T9901 prep as,using
R2760 T9916 T9917 punct (,primers
R2761 T9917 T9915 pobj primers,as
R2762 T9918 T9919 nummod 5,CCTCCATTGCCTCTATATCAG
R2763 T9919 T9917 nmod CCTCCATTGCCTCTATATCAG,primers
R2764 T9920 T9918 punct ',5
R2765 T9921 T9919 punct -,CCTCCATTGCCTCTATATCAG
R2766 T9922 T9919 punct -,CCTCCATTGCCTCTATATCAG
R2767 T9923 T9919 nummod 3,CCTCCATTGCCTCTATATCAG
R2768 T9924 T9919 punct ',CCTCCATTGCCTCTATATCAG
R2769 T9925 T9919 punct ),CCTCCATTGCCTCTATATCAG
R2770 T9926 T9899 punct .,amplified
R2771 T9928 T9929 det The,probe
R2772 T9929 T9930 nsubj probe,labeled
R2773 T9931 T9930 advmod specifically,labeled
R2774 T9932 T9933 det an,band
R2775 T9933 T9930 dobj band,labeled
R2776 T9934 T9935 nummod 18,kbp
R2777 T9935 T9933 compound kbp,band
R2778 T9936 T9933 prep from,band
R2779 T9937 T9938 det the,locus
R2780 T9938 T9936 pobj locus,from
R2781 T9939 T9938 nmod wild,locus
R2782 T9940 T9939 punct -,wild
R2783 T9941 T9938 compound type,locus
R2784 T9942 T9933 punct ", ",band
R2785 T9943 T9944 det a,band
R2786 T9944 T9933 conj band,band
R2787 T9945 T9946 nummod 15,kbp
R2788 T9946 T9944 compound kbp,band
R2789 T9947 T9944 prep from,band
R2790 T9948 T9949 det the,locus
R2791 T9949 T9947 pobj locus,from
R2792 T9950 T9951 compound β,geo
R2793 T9951 T9949 compound geo,locus
R2794 T9952 T9951 punct -,geo
R2795 T9953 T9944 punct ", ",band
R2796 T9954 T9944 cc and,band
R2797 T9955 T9956 det a,band
R2798 T9956 T9944 conj band,band
R2799 T9957 T9958 nummod 12,kbp
R2800 T9958 T9956 compound kbp,band
R2801 T9959 T9956 prep from,band
R2802 T9960 T9961 det the,locus
R2803 T9961 T9959 pobj locus,from
R2804 T9962 T9961 compound HygR,locus
R2805 T9963 T9930 punct .,labeled
R2806 T9965 T9966 amod Genomic,DNA
R2807 T9966 T9967 nsubjpass DNA,digested
R2808 T9968 T9967 auxpass was,digested
R2809 T9969 T9967 advmod also,digested
R2810 T9970 T9967 prep with,digested
R2811 T9971 T9970 pobj SpeI,with
R2812 T9972 T9967 prep for,digested
R2813 T9973 T9974 nummod 3,analysis
R2814 T9974 T9972 pobj analysis,for
R2815 T9975 T9973 punct ',3
R2816 T9976 T9977 compound Southern,blot
R2817 T9977 T9974 compound blot,analysis
R2818 T9978 T9967 punct .,digested
R2819 T9980 T9981 det A,probe
R2820 T9981 T9986 nsubjpass probe,amplified
R2821 T9982 T9983 nummod "1,010",bp
R2822 T9983 T9981 nmod bp,probe
R2823 T9984 T9981 nummod 3,probe
R2824 T9985 T9984 punct ',3
R2825 T9987 T9986 auxpass was,amplified
R2826 T9988 T9986 prep with,amplified
R2827 T9989 T9990 det the,primers
R2828 T9990 T9988 pobj primers,with
R2829 T9991 T9990 nmod pH34U,primers
R2830 T9992 T9991 punct -,pH34U
R2831 T9993 T9991 nummod 8000,pH34U
R2832 T9994 T9995 punct (,CCAACCAGCCAGAGTTTCAGTTAT
R2833 T9995 T9991 parataxis CCAACCAGCCAGAGTTTCAGTTAT,pH34U
R2834 T9996 T9995 nummod 5,CCAACCAGCCAGAGTTTCAGTTAT
R2835 T9997 T9996 punct ',5
R2836 T9998 T9995 punct -,CCAACCAGCCAGAGTTTCAGTTAT
R2837 T9999 T9995 punct -,CCAACCAGCCAGAGTTTCAGTTAT
R2838 T10000 T9995 nummod 3,CCAACCAGCCAGAGTTTCAGTTAT
R2839 T10001 T9995 punct ',CCAACCAGCCAGAGTTTCAGTTAT
R2840 T10002 T9995 punct ),CCAACCAGCCAGAGTTTCAGTTAT
R2841 T10003 T9991 cc and,pH34U
R2842 T10004 T9991 conj pH34L,pH34U
R2843 T10005 T10004 punct -,pH34L
R2844 T10006 T10004 nummod 9000,pH34L
R2845 T10007 T10008 punct (,GATAAGCTGCTGCCAAAAGACAAG
R2846 T10008 T10004 parataxis GATAAGCTGCTGCCAAAAGACAAG,pH34L
R2847 T10009 T10008 nummod 5,GATAAGCTGCTGCCAAAAGACAAG
R2848 T10010 T10009 punct ',5
R2849 T10011 T10008 punct -,GATAAGCTGCTGCCAAAAGACAAG
R2850 T10012 T10008 punct -,GATAAGCTGCTGCCAAAAGACAAG
R2851 T10013 T10008 nummod 3,GATAAGCTGCTGCCAAAAGACAAG
R2852 T10014 T10008 punct ',GATAAGCTGCTGCCAAAAGACAAG
R2853 T10015 T10008 punct ),GATAAGCTGCTGCCAAAAGACAAG
R2854 T10016 T9986 punct .,amplified
R2855 T10018 T10019 det The,probe
R2856 T10019 T10020 nsubj probe,hybridized
R2857 T10021 T10020 prep to,hybridized
R2858 T10022 T10023 det an,band
R2859 T10023 T10021 pobj band,to
R2860 T10024 T10025 nummod 11.5,kbp
R2861 T10025 T10023 compound kbp,band
R2862 T10026 T10023 prep from,band
R2863 T10027 T10028 det the,locus
R2864 T10028 T10026 pobj locus,from
R2865 T10029 T10030 amod wild,type
R2866 T10030 T10028 compound type,locus
R2867 T10031 T10030 punct -,type
R2868 T10032 T10023 punct ", ",band
R2869 T10033 T10034 det a,band
R2870 T10034 T10023 conj band,band
R2871 T10035 T10036 nummod 12.5,kbp
R2872 T10036 T10034 compound kbp,band
R2873 T10037 T10034 prep from,band
R2874 T10038 T10039 det the,locus
R2875 T10039 T10037 pobj locus,from
R2876 T10040 T10041 compound β,geo
R2877 T10041 T10039 compound geo,locus
R2878 T10042 T10041 punct -,geo
R2879 T10043 T10034 punct ", ",band
R2880 T10044 T10034 cc and,band
R2881 T10045 T10046 det a,band
R2882 T10046 T10034 conj band,band
R2883 T10047 T10048 nummod 9.5,kbp
R2884 T10048 T10046 compound kbp,band
R2885 T10049 T10046 prep from,band
R2886 T10050 T10051 det the,locus
R2887 T10051 T10049 pobj locus,from
R2888 T10052 T10051 compound HygR,locus
R2889 T10053 T10020 punct .,hybridized