Southern blot screening for homologous recombination
ES cells genomic DNA was extracted with PUREGENE™ Cell Lysis Solution (Gentra systems). For 5' Southern blot analysis, genomic DNA was first digested with PstI, then separated on an 0.8% agarose gel and transferred to a nylon membrane as described [20]. A 560 bp 5' probe was amplified using the ESG1S5 (5'- GATGGTGGTGGTGACTCAGAG -3') and ESG1AS5 as (5'- CCTCCATTGCCTCTATATCAG -3') primers. The probe specifically labeled an 18 kbp band from the wild-type locus, a 15 kbp band from the β-geo locus, and a 12 kbp band from the HygR locus. Genomic DNA was also digested with SpeI for 3' Southern blot analysis. A 1,010 bp 3' probe was amplified with the pH34U-8000 (5'- CCAACCAGCCAGAGTTTCAGTTAT -3') and pH34L-9000 (5'-GATAAGCTGCTGCCAAAAGACAAG -3') primers. The probe hybridized to an 11.5 kbp band from the wild-type locus, a 12.5 kbp band from the β-geo locus, and a 9.5 kbp band from the HygR locus.