> top > projects > sentences > docs > PMC:3589482 > annotations
sentences Home  

PMC:3589482 JSONTXT 31 Projects

Annnotations TAB TSV DIC JSON TextAE

Id Subject Object Predicate Lexical cue
T99 0-105 Sentence denotes The Transcription Factor C/EBP-β Mediates Constitutive and LPS-Inducible Transcription of Murine SerpinB2
T1 0-105 Sentence denotes The Transcription Factor C/EBP-β Mediates Constitutive and LPS-Inducible Transcription of Murine SerpinB2
T2 106-145 Sentence denotes C/EBP-β Mediates SerpinB2 Transcription
T3 147-155 Sentence denotes Abstract
T100 156-398 Sentence denotes SerpinB2 or plasminogen activator inhibitor type 2 (PAI-2) is highly induced in macrophages in response to inflammatory stimuli and is linked to the modulation of innate immunity, macrophage survival, and inhibition of plasminogen activators.
T4 156-398 Sentence denotes SerpinB2 or plasminogen activator inhibitor type 2 (PAI-2) is highly induced in macrophages in response to inflammatory stimuli and is linked to the modulation of innate immunity, macrophage survival, and inhibition of plasminogen activators.
T101 399-582 Sentence denotes Lipopolysaccharide (LPS), a potent bacterial endotoxin, can induce SerpinB2 expression via the toll-like receptor 4 (TLR4) by ∼1000-fold over a period of 24 hrs in murine macrophages.
T5 399-582 Sentence denotes Lipopolysaccharide (LPS), a potent bacterial endotoxin, can induce SerpinB2 expression via the toll-like receptor 4 (TLR4) by ∼1000-fold over a period of 24 hrs in murine macrophages.
T102 583-790 Sentence denotes To map the LPS-regulated SerpinB2 promoter regions, we transfected reporter constructs driven by the ∼5 kb 5'-flanking region of the murine SerpinB2 gene and several deletion mutants into murine macrophages.
T6 583-790 Sentence denotes To map the LPS-regulated SerpinB2 promoter regions, we transfected reporter constructs driven by the ∼5 kb 5'-flanking region of the murine SerpinB2 gene and several deletion mutants into murine macrophages.
T103 791-1058 Sentence denotes In addition, we compared the DNA sequence of the murine 5′ flanking sequence with the sequence of the human gene for homologous functional regulatory elements and identified several regulatory cis-acting elements in the human SERPINB2 promoter conserved in the mouse.
T7 791-1058 Sentence denotes In addition, we compared the DNA sequence of the murine 5′ flanking sequence with the sequence of the human gene for homologous functional regulatory elements and identified several regulatory cis-acting elements in the human SERPINB2 promoter conserved in the mouse.
T104 1059-1306 Sentence denotes Mutation analyses revealed that a CCAAT enhancer binding (C/EBP) element, a cyclic AMP response element (CRE) and two activator protein 1 (AP-1) response elements in the murine SerpinB2 proximal promoter are essential for optimal LPS-inducibility.
T8 1059-1306 Sentence denotes Mutation analyses revealed that a CCAAT enhancer binding (C/EBP) element, a cyclic AMP response element (CRE) and two activator protein 1 (AP-1) response elements in the murine SerpinB2 proximal promoter are essential for optimal LPS-inducibility.
T105 1307-1496 Sentence denotes Electrophoretic mobility shift (EMSA) and chromatin immunoprecipitation (ChIP) assays demonstrated that LPS induces the formation of C/EBP-β containing complexes with the SerpinB2 promoter.
T9 1307-1496 Sentence denotes Electrophoretic mobility shift (EMSA) and chromatin immunoprecipitation (ChIP) assays demonstrated that LPS induces the formation of C/EBP-β containing complexes with the SerpinB2 promoter.
T106 1497-1691 Sentence denotes Importantly, both constitutive and LPS-induced SerpinB2 expression was severely abrogated in C/EBP-β-null mouse embryonic fibroblasts (MEFs) and primary C/EBP-β-deficient peritoneal macrophages.
T10 1497-1691 Sentence denotes Importantly, both constitutive and LPS-induced SerpinB2 expression was severely abrogated in C/EBP-β-null mouse embryonic fibroblasts (MEFs) and primary C/EBP-β-deficient peritoneal macrophages.
T107 1692-1814 Sentence denotes Together, these data provide new insight into C/EBP-β-dependent regulation of inflammation-associated SerpinB2 expression.
T11 1692-1814 Sentence denotes Together, these data provide new insight into C/EBP-β-dependent regulation of inflammation-associated SerpinB2 expression.
T12 1816-1828 Sentence denotes Introduction
T1203 1829-1879 Sentence denotes The inflammatory response is a double-edged sword.
T13 1829-1879 Sentence denotes The inflammatory response is a double-edged sword.
T1204 1880-1988 Sentence denotes Properly orchestrated, it results in the clearing of foreign molecules and invading pathogens from the body.
T14 1880-1988 Sentence denotes Properly orchestrated, it results in the clearing of foreign molecules and invading pathogens from the body.
T1205 1989-2064 Sentence denotes Uncontrolled, it may lead to organ damage, sepsis, and even cancer [1]–[3].
T15 1989-2064 Sentence denotes Uncontrolled, it may lead to organ damage, sepsis, and even cancer [1]–[3].
T1206 2065-2288 Sentence denotes Many of the pathological manifestations of the inflammatory response are mediated by cytokines and other inducible gene products expressed by macrophages upon exposure to the gram-negative bacterial cell wall component LPS.
T16 2065-2288 Sentence denotes Many of the pathological manifestations of the inflammatory response are mediated by cytokines and other inducible gene products expressed by macrophages upon exposure to the gram-negative bacterial cell wall component LPS.
T1207 2289-2486 Sentence denotes As macrophages are key effectors of pathogen-induced innate immune responses, their survival is critical for initial pathogen neutralization and subsequent development of adaptive immune responses.
T17 2289-2486 Sentence denotes As macrophages are key effectors of pathogen-induced innate immune responses, their survival is critical for initial pathogen neutralization and subsequent development of adaptive immune responses.
T1208 2487-2674 Sentence denotes One of the most LPS-inducible macrophage gene products known is the ovalbumin-like serine protease inhibitor (ov-serpin) SerpinB2, a widely recognized macrophage survival factor [4]; [5].
T18 2487-2674 Sentence denotes One of the most LPS-inducible macrophage gene products known is the ovalbumin-like serine protease inhibitor (ov-serpin) SerpinB2, a widely recognized macrophage survival factor [4]; [5].
T1209 2675-2909 Sentence denotes SerpinB2 was first identified as an inhibitor of urokinase-type plasminogen activator (uPA)[6]–[8], a serine protease involved in the degradation and turnover of the extracellular matrix through the activation of plasminogen [7]; [9].
T19 2675-2909 Sentence denotes SerpinB2 was first identified as an inhibitor of urokinase-type plasminogen activator (uPA)[6]–[8], a serine protease involved in the degradation and turnover of the extracellular matrix through the activation of plasminogen [7]; [9].
T1210 2910-3049 Sentence denotes Such function requires SerpinB2 to be secreted from the cell yet SerpinB2 exists primarily as a nonglycosylated intracellular protein [10].
T20 2910-3049 Sentence denotes Such function requires SerpinB2 to be secreted from the cell yet SerpinB2 exists primarily as a nonglycosylated intracellular protein [10].
T1211 3050-3266 Sentence denotes Over the past decade, intracellular roles for SerpinB2 in cell survival [11]–[17], proliferation and differentiation [18]–[21], signal transduction [15]; [22]; [23] and innate immunity [24]–[28], have been described.
T21 3050-3266 Sentence denotes Over the past decade, intracellular roles for SerpinB2 in cell survival [11]–[17], proliferation and differentiation [18]–[21], signal transduction [15]; [22]; [23] and innate immunity [24]–[28], have been described.
T1212 3267-3392 Sentence denotes The SerpinB2 gene is highly regulated in a cell type specific manner analogous to that of cytokines and oncogenes [29]; [30].
T22 3267-3392 Sentence denotes The SerpinB2 gene is highly regulated in a cell type specific manner analogous to that of cytokines and oncogenes [29]; [30].
T1213 3393-3557 Sentence denotes It is one of the most responsive genes known [31], and can be induced over 1000-fold by LPS [31]–[32], and is up-regulated by a range of inflammatory mediators [9].
T23 3393-3557 Sentence denotes It is one of the most responsive genes known [31], and can be induced over 1000-fold by LPS [31]–[32], and is up-regulated by a range of inflammatory mediators [9].
T1214 3558-3626 Sentence denotes LPS activates immune responses through multiple signalling pathways.
T24 3558-3626 Sentence denotes LPS activates immune responses through multiple signalling pathways.
T1215 3627-3828 Sentence denotes The toll-like receptor 4 (TLR4) is responsible for the recognition of LPS and other microbial products and plays a central role in the initiation of innate immune responses, including cytokine release.
T25 3627-3828 Sentence denotes The toll-like receptor 4 (TLR4) is responsible for the recognition of LPS and other microbial products and plays a central role in the initiation of innate immune responses, including cytokine release.
T1216 3829-4116 Sentence denotes The binding of LPS to TLR4 on the surface of macrophages leads to the recruitment of adaptor molecules and the activation of protein kinases, generating signals to the nuclear factor-κB (NF-κB), mitogen-activated protein kinase (MAPK) and/or phosphoinositide 3(PI3)-kinase pathways [33].
T26 3829-4116 Sentence denotes The binding of LPS to TLR4 on the surface of macrophages leads to the recruitment of adaptor molecules and the activation of protein kinases, generating signals to the nuclear factor-κB (NF-κB), mitogen-activated protein kinase (MAPK) and/or phosphoinositide 3(PI3)-kinase pathways [33].
T1217 4117-4342 Sentence denotes In studies aimed at identifying LPS-inducible pro-survival factors downstream of p38 MAPK, SerpinB2 was identified as a factor whose expression was upregulated by cooperation of the IKKβ/NF-κB and p38 MAPK/CREB pathways [16].
T27 4117-4342 Sentence denotes In studies aimed at identifying LPS-inducible pro-survival factors downstream of p38 MAPK, SerpinB2 was identified as a factor whose expression was upregulated by cooperation of the IKKβ/NF-κB and p38 MAPK/CREB pathways [16].
T1218 4343-4757 Sentence denotes Our previously published data indicated that SerpinB2 is distinctly regulated from other LPS-inducible genes in terms of kinetics, LPS dose response and sensitivity to IFN-γ co-stimulation [4]; however, the cis-acting elements in the SerpinB2 promoter responsible for LPS-dependent transcription in macrophages and the specific LPS-responsive transcription factors that bind the SerpinB2 promoter were not defined.
T28 4343-4757 Sentence denotes Our previously published data indicated that SerpinB2 is distinctly regulated from other LPS-inducible genes in terms of kinetics, LPS dose response and sensitivity to IFN-γ co-stimulation [4]; however, the cis-acting elements in the SerpinB2 promoter responsible for LPS-dependent transcription in macrophages and the specific LPS-responsive transcription factors that bind the SerpinB2 promoter were not defined.
T1219 4758-5000 Sentence denotes Here we show that LPS induction of SerpinB2 is dependent upon cis-acting regulatory sequences in the region between nucleotides −189 and −539 of the murine SerpinB2 promoter, and is critically dependent upon a C/EBP binding site at −203/−195.
T29 4758-5000 Sentence denotes Here we show that LPS induction of SerpinB2 is dependent upon cis-acting regulatory sequences in the region between nucleotides −189 and −539 of the murine SerpinB2 promoter, and is critically dependent upon a C/EBP binding site at −203/−195.
T1220 5001-5137 Sentence denotes C/EBP-β directly bound to this site in vivo and its deficiency abrogated constitutive SerpinB2 expression and SerpinB2 induction by LPS.
T30 5001-5137 Sentence denotes C/EBP-β directly bound to this site in vivo and its deficiency abrogated constitutive SerpinB2 expression and SerpinB2 induction by LPS.
T1221 5138-5255 Sentence denotes Importantly, a C/EBP-β phospho-acceptor site was found to negatively regulate LPS-induced SerpinB2 promoter activity.
T31 5138-5255 Sentence denotes Importantly, a C/EBP-β phospho-acceptor site was found to negatively regulate LPS-induced SerpinB2 promoter activity.
T1222 5256-5358 Sentence denotes Together, these findings provide new insight into the transcriptional regulation of the SerpinB2 gene.
T32 5256-5358 Sentence denotes Together, these findings provide new insight into the transcriptional regulation of the SerpinB2 gene.
T33 5360-5383 Sentence denotes Experimental Procedures
T3159 5385-5397 Sentence denotes Cell Culture
T34 5385-5397 Sentence denotes Cell Culture
T35 5398-5771 Sentence denotes Murine macrophage RAW 264.7 cells (ATCC TIB-71) were maintained in RPMI 1640 media (Gibco BRL), supplemented with 2 mM L-glutamine (Gibco BRL), 10% serum supreme (BioWhittaker), 200 µg/ml penicillin, 100 µg/ml streptomycin, 25 mM N-2-hydroxyethylpiperazine-N-2-ethane sulphonic acid (HEPES) and 25 mM sodium bicarbonate, in 5% CO2 and 95% humidified air atmosphere at 37°C.
T3160 5398-6020 Sentence denotes Murine macrophage RAW 264.7 cells (ATCC TIB-71) were maintained in RPMI 1640 media (Gibco BRL), supplemented with 2 mM L-glutamine (Gibco BRL), 10% serum supreme (BioWhittaker), 200 µg/ml penicillin, 100 µg/ml streptomycin, 25 mM N-2-hydroxyethylpiperazine-N-2-ethane sulphonic acid (HEPES) and 25 mM sodium bicarbonate, in 5% CO2 and 95% humidified air atmosphere at 37°C. Wild-type (Cebpb+/+) and knockout (Cebpb−/−) mouse embryonic fibroblasts (MEFs) [34] were grown in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin/glutamate solution (Cellgro).
T36 5772-6020 Sentence denotes Wild-type (Cebpb+/+) and knockout (Cebpb−/−) mouse embryonic fibroblasts (MEFs) [34] were grown in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin/glutamate solution (Cellgro).
T3161 6021-6216 Sentence denotes Primary peritoneal macrophages were obtained by injecting C57BL/6 mice with 3% thioglycollate broth followed by peritoneal lavage 3–5 days later, and maintained in 50% DMEM/F12 media (Gibco BRL).
T37 6021-6216 Sentence denotes Primary peritoneal macrophages were obtained by injecting C57BL/6 mice with 3% thioglycollate broth followed by peritoneal lavage 3–5 days later, and maintained in 50% DMEM/F12 media (Gibco BRL).
T3162 6217-6361 Sentence denotes Precautions were taken to exclude bacterial lipopolysaccharide contamination from all cell cultures through the use of certified LPS-free serum.
T38 6217-6361 Sentence denotes Precautions were taken to exclude bacterial lipopolysaccharide contamination from all cell cultures through the use of certified LPS-free serum.
T3163 6362-6443 Sentence denotes Cell viability was determined using the trypan blue (Sigma) dye exclusion method.
T39 6362-6443 Sentence denotes Cell viability was determined using the trypan blue (Sigma) dye exclusion method.
T3164 6444-6606 Sentence denotes All cultures were routinely checked to exclude Mycoplasma infection by nuclear staining using Hoechst stain 33258 (Sigma) and the MycoAlert Detection Kit (Lonza).
T40 6444-6606 Sentence denotes All cultures were routinely checked to exclude Mycoplasma infection by nuclear staining using Hoechst stain 33258 (Sigma) and the MycoAlert Detection Kit (Lonza).
T3165 6607-6702 Sentence denotes Bacterial lipopolysaccharide (LPS) (Salmonella minnesota Strain Re595) was obtained from Sigma.
T41 6607-6702 Sentence denotes Bacterial lipopolysaccharide (LPS) (Salmonella minnesota Strain Re595) was obtained from Sigma.
T3580 6704-6737 Sentence denotes Real-time Quantitative PCR (qPCR)
T42 6704-6737 Sentence denotes Real-time Quantitative PCR (qPCR)
T3581 6738-6808 Sentence denotes The RNeasy Mini Kit (Qiagen) was used to isolate total RNA from cells.
T43 6738-6808 Sentence denotes The RNeasy Mini Kit (Qiagen) was used to isolate total RNA from cells.
T3582 6809-7109 Sentence denotes For cDNA synthesis, 1 µg of total RNA was reverse transcribed using TaqMan® Reverse Transcription Reagents (Applied Biosystems). qPCR was performed using TaqMan® Gene Expression 20X primers for Serpinb2/SerpinB2 (Mm00440905_m1), Cebpb (Mm00843434_s1) and β-actin (Mm00607939_s1) (Applied Biosystems).
T44 6809-7109 Sentence denotes For cDNA synthesis, 1 µg of total RNA was reverse transcribed using TaqMan® Reverse Transcription Reagents (Applied Biosystems). qPCR was performed using TaqMan® Gene Expression 20X primers for Serpinb2/SerpinB2 (Mm00440905_m1), Cebpb (Mm00843434_s1) and β-actin (Mm00607939_s1) (Applied Biosystems).
T3811 7111-7132 Sentence denotes DNA Sequence Analysis
T45 7111-7132 Sentence denotes DNA Sequence Analysis
T3812 7133-7395 Sentence denotes The DNA sequence of the murine SerpinB2 promoter was determined by sequencing the pUC-based plasmids pDB9406, pDB9402-41 and pDB9402-42, in addition to plasmids prepared from pDB9402-41 and pDB9402-42 containing deletions introduced by exonuclease III digestion.
T46 7133-7395 Sentence denotes The DNA sequence of the murine SerpinB2 promoter was determined by sequencing the pUC-based plasmids pDB9406, pDB9402-41 and pDB9402-42, in addition to plasmids prepared from pDB9402-41 and pDB9402-42 containing deletions introduced by exonuclease III digestion.
T3813 7396-7873 Sentence denotes Plasmids pDB9406, pDB9402-41 and pDB9402-42 containing genomic DNA isolated from a λFIXII (Stratagene) genomic library prepared from a 129 mouse strain, were kindly provided by Dr. Dominique Belin, University of Geneva. pDB9406 contains a 4.4 kb EcoRI/SpeI genomic fragment spanning the transcription initiation site; pDB9402-41 and pDB9402-42 contain a 1.2 kb EcoRI genomic fragment, located immediately upstream of the pDB9406 EcoRI fragment, cloned in opposite orientations.
T47 7396-7873 Sentence denotes Plasmids pDB9406, pDB9402-41 and pDB9402-42 containing genomic DNA isolated from a λFIXII (Stratagene) genomic library prepared from a 129 mouse strain, were kindly provided by Dr. Dominique Belin, University of Geneva. pDB9406 contains a 4.4 kb EcoRI/SpeI genomic fragment spanning the transcription initiation site; pDB9402-41 and pDB9402-42 contain a 1.2 kb EcoRI genomic fragment, located immediately upstream of the pDB9406 EcoRI fragment, cloned in opposite orientations.
T3814 7874-7957 Sentence denotes Subcloned inserts were verified by restriction enzyme digestion and DNA sequencing.
T48 7874-7957 Sentence denotes Subcloned inserts were verified by restriction enzyme digestion and DNA sequencing.
T3815 7958-8177 Sentence denotes The nucleotide sequence of the 4480 bp murine SerpinB2 gene 5′ flanking region was determined using the ABI PRISM dye terminator cycle sequencing ready reaction kit (Perkin-Elmer) and a PE 373A sequencer (Perkin-Elmer).
T49 7958-8177 Sentence denotes The nucleotide sequence of the 4480 bp murine SerpinB2 gene 5′ flanking region was determined using the ABI PRISM dye terminator cycle sequencing ready reaction kit (Perkin-Elmer) and a PE 373A sequencer (Perkin-Elmer).
T50 8178-8255 Sentence denotes This sequence was deposited in GenBank/EMBL/DDBJ Data Bank with Accession No.
T3816 8178-8265 Sentence denotes This sequence was deposited in GenBank/EMBL/DDBJ Data Bank with Accession No. AF339731.
T51 8256-8265 Sentence denotes AF339731.
T4260 8267-8286 Sentence denotes Western Blot Assays
T52 8267-8286 Sentence denotes Western Blot Assays
T4261 8287-8521 Sentence denotes Whole cell lysates were prepared in RIPA buffer (10 mM Tris, 150 mM NaCl, 1%Triton X-100, 0.5% NP-40, 0.5% deoxycholate, 0.1% SDS), proteins were separated on 4–12% Bis-Tris NuPAGE gels (Invitrogen), and transferred to PVDF membranes.
T53 8287-8521 Sentence denotes Whole cell lysates were prepared in RIPA buffer (10 mM Tris, 150 mM NaCl, 1%Triton X-100, 0.5% NP-40, 0.5% deoxycholate, 0.1% SDS), proteins were separated on 4–12% Bis-Tris NuPAGE gels (Invitrogen), and transferred to PVDF membranes.
T4262 8522-8653 Sentence denotes Membranes were subsequently blocked with 5% milk in PBS-T (1X PBS, 0.1% Tween-20), and incubated with primary antibodies overnight.
T54 8522-8653 Sentence denotes Membranes were subsequently blocked with 5% milk in PBS-T (1X PBS, 0.1% Tween-20), and incubated with primary antibodies overnight.
T4263 8654-8837 Sentence denotes Affinity purified rabbit anti-mouse SerpinB2 antibodies were prepared after immunization with a purified recombinant GST-murine SerpinB2 fusion protein produced in E. coli as in [35].
T55 8654-8837 Sentence denotes Affinity purified rabbit anti-mouse SerpinB2 antibodies were prepared after immunization with a purified recombinant GST-murine SerpinB2 fusion protein produced in E. coli as in [35].
T4264 8838-9039 Sentence denotes Other antibodies used for western blot assays include: C/EBP-β (sc-150) (Santa Cruz Biotechnologies), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and α/β tubulin (Cell Signaling Technology, Inc.).
T56 8838-9039 Sentence denotes Other antibodies used for western blot assays include: C/EBP-β (sc-150) (Santa Cruz Biotechnologies), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and α/β tubulin (Cell Signaling Technology, Inc.).
T4741 9041-9088 Sentence denotes Construction of SerpinB2 Reporter Gene Plasmids
T57 9041-9088 Sentence denotes Construction of SerpinB2 Reporter Gene Plasmids
T4742 9089-9383 Sentence denotes The PCR primers DW5’LUC, containing a Kpn I restriction site, and DW3’LUC, containing an Xho I restriction site, were used to PCR amplify and clone the SerpinB2 promoter (−3261 to +92) from pDB9406 into the Kpn I/Xho I polylinker restriction sites of pGL3 Basic (Promega) to produce pGLmP-3261.
T58 9089-9383 Sentence denotes The PCR primers DW5’LUC, containing a Kpn I restriction site, and DW3’LUC, containing an Xho I restriction site, were used to PCR amplify and clone the SerpinB2 promoter (−3261 to +92) from pDB9406 into the Kpn I/Xho I polylinker restriction sites of pGL3 Basic (Promega) to produce pGLmP-3261.
T4743 9384-9533 Sentence denotes The EcoR I insert of pDB9402-42 was sub-cloned immediately upstream of the SerpinB2 promoter EcoR I site (−3261) of pGLmP-3261 to produce pGLmP-4480.
T59 9384-9533 Sentence denotes The EcoR I insert of pDB9402-42 was sub-cloned immediately upstream of the SerpinB2 promoter EcoR I site (−3261) of pGLmP-3261 to produce pGLmP-4480.
T4744 9534-9958 Sentence denotes Additional murine SerpinB2 luciferase reporter constructs (pGLmP-2751, pGLmP-2614, pGLmP-1686, pGLmP-1341, pGLmP-694, pGLmP-539 and pGLmP-189) were generated by digesting pGLmP-3261 with EcoR I and a second restriction enzyme (Sfi I, Apa I, BstX I, Bsu36 I, Pac I, Hae III and Apo I respectively), blunt ending the resultant 5′ or 3′ overhangs with T4 DNA polymerase (NEB) and re-ligating the vector ends with T4 DNA ligase.
T60 9534-9958 Sentence denotes Additional murine SerpinB2 luciferase reporter constructs (pGLmP-2751, pGLmP-2614, pGLmP-1686, pGLmP-1341, pGLmP-694, pGLmP-539 and pGLmP-189) were generated by digesting pGLmP-3261 with EcoR I and a second restriction enzyme (Sfi I, Apa I, BstX I, Bsu36 I, Pac I, Hae III and Apo I respectively), blunt ending the resultant 5′ or 3′ overhangs with T4 DNA polymerase (NEB) and re-ligating the vector ends with T4 DNA ligase.
T4745 9959-10148 Sentence denotes The PCR primers BSPCR2 and DW3’LUC were used to subclone the murine SerpinB2 promoter regions −87 to +92 into the Kpn I/Xho I polylinker restriction sites of pGL3 Basic to produce pGLmP-87.
T61 9959-10148 Sentence denotes The PCR primers BSPCR2 and DW3’LUC were used to subclone the murine SerpinB2 promoter regions −87 to +92 into the Kpn I/Xho I polylinker restriction sites of pGL3 Basic to produce pGLmP-87.
T4746 10149-10199 Sentence denotes The control empty vector was pGL3 Basic (Promega).
T62 10149-10199 Sentence denotes The control empty vector was pGL3 Basic (Promega).
T4747 10200-10443 Sentence denotes Luciferase reporter constructs containing mutations in the SerpinB2 promoter LPS-responsive regions E box, PU.1, Oct-1 and C/EBP (pGLmP-539mEbox, pGLmP-539mPU.1, pGLmP-539mOct and pGLmP-539mC/EBP respectively) were generated as described [36].
T63 10200-10443 Sentence denotes Luciferase reporter constructs containing mutations in the SerpinB2 promoter LPS-responsive regions E box, PU.1, Oct-1 and C/EBP (pGLmP-539mEbox, pGLmP-539mPU.1, pGLmP-539mOct and pGLmP-539mC/EBP respectively) were generated as described [36].
T4748 10444-10724 Sentence denotes The mutant oligonucleotide PCR primer sequences are provided in Fig. S1, and were used as follows: pGLmP-539mEbox: mPAI2mEboxa and mPAI2mEboxb; pGLmP-539mPU.1: mPAI2mPU.1a and mPAI2mPU.1b; pGLmP-539mOct: mPAI2mOct-2a and mPAI2mOct-2b; pGLmP-539mC/EBP: mPAI2mCEBPa and mPAI2mCEBPb.
T64 10444-10724 Sentence denotes The mutant oligonucleotide PCR primer sequences are provided in Fig. S1, and were used as follows: pGLmP-539mEbox: mPAI2mEboxa and mPAI2mEboxb; pGLmP-539mPU.1: mPAI2mPU.1a and mPAI2mPU.1b; pGLmP-539mOct: mPAI2mOct-2a and mPAI2mOct-2b; pGLmP-539mC/EBP: mPAI2mCEBPa and mPAI2mCEBPb.
T4749 10725-10865 Sentence denotes The oligonucleotide PCR primers used to generate mutants, pGLmP-539mCRE, pGLmP-539mAP-1a, and pGLmP-539mAP-1b were reported previously [37].
T65 10725-10865 Sentence denotes The oligonucleotide PCR primers used to generate mutants, pGLmP-539mCRE, pGLmP-539mAP-1a, and pGLmP-539mAP-1b were reported previously [37].
T4750 10866-11005 Sentence denotes The flanking oligonucleotide PCR primers were RVprimer3 (Promega) and GLprimer2 (Promega). pGLmP-539 was used as the template in each case.
T66 10866-11005 Sentence denotes The flanking oligonucleotide PCR primers were RVprimer3 (Promega) and GLprimer2 (Promega). pGLmP-539 was used as the template in each case.
T4751 11006-11212 Sentence denotes Recombinant PCR products were digested with EcoR I and Xho I and cloned between the EcoR I and Xho I restriction sites of pGLmP-539 in place of the −539/+92 region of the wild-type murine SerpinB2 promoter.
T67 11006-11212 Sentence denotes Recombinant PCR products were digested with EcoR I and Xho I and cloned between the EcoR I and Xho I restriction sites of pGLmP-539 in place of the −539/+92 region of the wild-type murine SerpinB2 promoter.
T4752 11213-11271 Sentence denotes Sequence verified constructs were used in the experiments.
T68 11213-11271 Sentence denotes Sequence verified constructs were used in the experiments.
T5965 11273-11340 Sentence denotes Transient Transfection and Luciferase Assays (RAW264.7 Macrophages)
T69 11273-11340 Sentence denotes Transient Transfection and Luciferase Assays (RAW264.7 Macrophages)
T7210 11273-13848 Sentence denotes Transient Transfection and Luciferase Assays (RAW264.7 Macrophages) RAW 264.7 cells (2×107) growing in log phase were transfected with the indicated luciferase reporter plasmid (20 µg) along with the pRL-thymidine kinase (TK) (Promega) internal control reporter plasmid (2 µg) by electroporation using a Bio-Rad Gene Pulser with a Capacitance Extender (0.25 kV, 960 µFd). pGL3 control plasmid which encodes the SV40 promoter and enhancer was included as a positive control for transfection efficiency, and as an internal standard for promoter and enhancer activities. Transfected cells were transferred to 10 ml of pre-warmed media in 6-well tissue culture plates, divided into two identical cell pools and incubated 16 hrs in a 5% CO2 and 95% humidified air atmosphere at 37°C either in the presence or absence of 100 ng/ml LPS. Luciferase activity was measured using a Dual-Luciferase Reporter Assay System kit (Promega). Measurements represent the results of at least three independent experiments. Promoter activity is expressed as the number of firefly luciferase light units normalized either to pRL-TK renilla luciferase light units or to cellular protein concentration (where co-transfected C/EBP-β or LPS affected pRL-TK activity). Protein concentration was determined using the Bio-Rad protein microassay reagent. Lentiviral shRNAs, Packaging and Transduction pLKO.1-puro lentiviral vectors carrying short hairpin RNAs (shRNA) specific for human and mouse cebpb were used in these studies. Because the human and mouse cebpb 3′ untranslated regions are not identical, these species-specific shRNAs cannot knockdown expression of endogenous C/EBP-β when used on cells of the other species; therefore we used the human CEBPB shRNA as a control in these experiments as in [38]. To produce lentiviral particles, HEK-293T cells were transfected with a mixture of plasmids: each shRNA expression plasmid (1 µg), pCMV-ΔR8.2dvpr packaging plasmid (0.75 µg), and pCMV-VSV-G envelope plasmid (0.25 µg) using Lipofectamine 2000 reagent (Invitrogen). The lentiviral supernatant was collected 48 hrs after transfection, cleared by centrifugation at 2,000 g for 10 mins and passed through a 0.45 µm filter. The target cells were treated with the lentiviral supernatant and 8 µg/ml Polybrene (American Bioanalytical) for 24 hrs. The lentiviral supernatant was replaced with fresh growth media and incubated further for 72 hrs to allow for effective gene knockdown. C/EBP-β knockdown was confirmed by western blot analysis. Transient Transfection and Luciferase Assays (MEF Cells)
T5966 11341-11840 Sentence denotes RAW 264.7 cells (2×107) growing in log phase were transfected with the indicated luciferase reporter plasmid (20 µg) along with the pRL-thymidine kinase (TK) (Promega) internal control reporter plasmid (2 µg) by electroporation using a Bio-Rad Gene Pulser with a Capacitance Extender (0.25 kV, 960 µFd). pGL3 control plasmid which encodes the SV40 promoter and enhancer was included as a positive control for transfection efficiency, and as an internal standard for promoter and enhancer activities.
T70 11341-11840 Sentence denotes RAW 264.7 cells (2×107) growing in log phase were transfected with the indicated luciferase reporter plasmid (20 µg) along with the pRL-thymidine kinase (TK) (Promega) internal control reporter plasmid (2 µg) by electroporation using a Bio-Rad Gene Pulser with a Capacitance Extender (0.25 kV, 960 µFd). pGL3 control plasmid which encodes the SV40 promoter and enhancer was included as a positive control for transfection efficiency, and as an internal standard for promoter and enhancer activities.
T5967 11841-12102 Sentence denotes Transfected cells were transferred to 10 ml of pre-warmed media in 6-well tissue culture plates, divided into two identical cell pools and incubated 16 hrs in a 5% CO2 and 95% humidified air atmosphere at 37°C either in the presence or absence of 100 ng/ml LPS.
T71 11841-12102 Sentence denotes Transfected cells were transferred to 10 ml of pre-warmed media in 6-well tissue culture plates, divided into two identical cell pools and incubated 16 hrs in a 5% CO2 and 95% humidified air atmosphere at 37°C either in the presence or absence of 100 ng/ml LPS.
T5968 12103-12196 Sentence denotes Luciferase activity was measured using a Dual-Luciferase Reporter Assay System kit (Promega).
T72 12103-12196 Sentence denotes Luciferase activity was measured using a Dual-Luciferase Reporter Assay System kit (Promega).
T5969 12197-12274 Sentence denotes Measurements represent the results of at least three independent experiments.
T73 12197-12274 Sentence denotes Measurements represent the results of at least three independent experiments.
T5970 12275-12513 Sentence denotes Promoter activity is expressed as the number of firefly luciferase light units normalized either to pRL-TK renilla luciferase light units or to cellular protein concentration (where co-transfected C/EBP-β or LPS affected pRL-TK activity).
T74 12275-12513 Sentence denotes Promoter activity is expressed as the number of firefly luciferase light units normalized either to pRL-TK renilla luciferase light units or to cellular protein concentration (where co-transfected C/EBP-β or LPS affected pRL-TK activity).
T5971 12514-12596 Sentence denotes Protein concentration was determined using the Bio-Rad protein microassay reagent.
T75 12514-12596 Sentence denotes Protein concentration was determined using the Bio-Rad protein microassay reagent.
T6632 12598-12643 Sentence denotes Lentiviral shRNAs, Packaging and Transduction
T76 12598-12643 Sentence denotes Lentiviral shRNAs, Packaging and Transduction
T6633 12644-12773 Sentence denotes pLKO.1-puro lentiviral vectors carrying short hairpin RNAs (shRNA) specific for human and mouse cebpb were used in these studies.
T77 12644-12773 Sentence denotes pLKO.1-puro lentiviral vectors carrying short hairpin RNAs (shRNA) specific for human and mouse cebpb were used in these studies.
T6634 12774-13057 Sentence denotes Because the human and mouse cebpb 3′ untranslated regions are not identical, these species-specific shRNAs cannot knockdown expression of endogenous C/EBP-β when used on cells of the other species; therefore we used the human CEBPB shRNA as a control in these experiments as in [38].
T78 12774-13057 Sentence denotes Because the human and mouse cebpb 3′ untranslated regions are not identical, these species-specific shRNAs cannot knockdown expression of endogenous C/EBP-β when used on cells of the other species; therefore we used the human CEBPB shRNA as a control in these experiments as in [38].
T6635 13058-13321 Sentence denotes To produce lentiviral particles, HEK-293T cells were transfected with a mixture of plasmids: each shRNA expression plasmid (1 µg), pCMV-ΔR8.2dvpr packaging plasmid (0.75 µg), and pCMV-VSV-G envelope plasmid (0.25 µg) using Lipofectamine 2000 reagent (Invitrogen).
T79 13058-13321 Sentence denotes To produce lentiviral particles, HEK-293T cells were transfected with a mixture of plasmids: each shRNA expression plasmid (1 µg), pCMV-ΔR8.2dvpr packaging plasmid (0.75 µg), and pCMV-VSV-G envelope plasmid (0.25 µg) using Lipofectamine 2000 reagent (Invitrogen).
T6636 13322-13475 Sentence denotes The lentiviral supernatant was collected 48 hrs after transfection, cleared by centrifugation at 2,000 g for 10 mins and passed through a 0.45 µm filter.
T80 13322-13475 Sentence denotes The lentiviral supernatant was collected 48 hrs after transfection, cleared by centrifugation at 2,000 g for 10 mins and passed through a 0.45 µm filter.
T6637 13476-13596 Sentence denotes The target cells were treated with the lentiviral supernatant and 8 µg/ml Polybrene (American Bioanalytical) for 24 hrs.
T81 13476-13596 Sentence denotes The target cells were treated with the lentiviral supernatant and 8 µg/ml Polybrene (American Bioanalytical) for 24 hrs.
T6638 13597-13732 Sentence denotes The lentiviral supernatant was replaced with fresh growth media and incubated further for 72 hrs to allow for effective gene knockdown.
T82 13597-13732 Sentence denotes The lentiviral supernatant was replaced with fresh growth media and incubated further for 72 hrs to allow for effective gene knockdown.
T6639 13733-13790 Sentence denotes C/EBP-β knockdown was confirmed by western blot analysis.
T83 13733-13790 Sentence denotes C/EBP-β knockdown was confirmed by western blot analysis.
T84 13792-13848 Sentence denotes Transient Transfection and Luciferase Assays (MEF Cells)
T7211 13849-14093 Sentence denotes Cebpb −/− MEFs (1×105) [34] were transfected with the indicated luciferase reporter plasmid (400 ng) along with a β-actin-β-galactosidase reporter plasmid (200 ng) by electroporation using the Invitrogen Neon™ system (1 pulse, 1350 V, 30 msec).
T85 13849-14093 Sentence denotes Cebpb −/− MEFs (1×105) [34] were transfected with the indicated luciferase reporter plasmid (400 ng) along with a β-actin-β-galactosidase reporter plasmid (200 ng) by electroporation using the Invitrogen Neon™ system (1 pulse, 1350 V, 30 msec).
T7212 14094-14259 Sentence denotes Transfected cells were transferred to pre-warmed media in 24 well plates and incubated for 48 hrs prior to incubation with LPS (100 ng/ml) for 4 hrs where indicated.
T86 14094-14259 Sentence denotes Transfected cells were transferred to pre-warmed media in 24 well plates and incubated for 48 hrs prior to incubation with LPS (100 ng/ml) for 4 hrs where indicated.
T7213 14260-14435 Sentence denotes In some experiments, plasmids encoding C/EBP-β or C/EBP-β phospho-acceptor mutants (T188A, T217A, S64A) [38]–[40] or control vector were co-transfected (0.6–1.0 µg total DNA).
T87 14260-14435 Sentence denotes In some experiments, plasmids encoding C/EBP-β or C/EBP-β phospho-acceptor mutants (T188A, T217A, S64A) [38]–[40] or control vector were co-transfected (0.6–1.0 µg total DNA).
T7214 14436-14621 Sentence denotes Luciferase activity was determined and normalized to that of β-galactosidase [38] using the Luciferase Assay System and β-Galactosidase Enzyme Assay System Kits, respectively (Promega).
T88 14436-14621 Sentence denotes Luciferase activity was determined and normalized to that of β-galactosidase [38] using the Luciferase Assay System and β-Galactosidase Enzyme Assay System Kits, respectively (Promega).
T7215 14622-14726 Sentence denotes Each experiment was repeated at least three times, and triplicate samples were employed for each sample.
T89 14622-14726 Sentence denotes Each experiment was repeated at least three times, and triplicate samples were employed for each sample.
T7216 14727-14835 Sentence denotes Expression of the C/EBP-β phospho-acceptor mutant proteins was checked for equal expression by western blot.
T90 14727-14835 Sentence denotes Expression of the C/EBP-β phospho-acceptor mutant proteins was checked for equal expression by western blot.
T7817 14837-14874 Sentence denotes Electrophoretic Mobility Shift Assays
T91 14837-14874 Sentence denotes Electrophoretic Mobility Shift Assays
T7818 14875-15011 Sentence denotes Radiolabelled, double-stranded oligonucleotide probes for gel shift assays were prepared using T4 polynucleotide kinase and [γ-32P]-ATP.
T92 14875-15011 Sentence denotes Radiolabelled, double-stranded oligonucleotide probes for gel shift assays were prepared using T4 polynucleotide kinase and [γ-32P]-ATP.
T7819 15012-15088 Sentence denotes RAW 264.7 nuclear extracts were prepared by the detergent lysis method [41].
T93 15012-15088 Sentence denotes RAW 264.7 nuclear extracts were prepared by the detergent lysis method [41].
T7820 15089-15363 Sentence denotes DNA binding reactions (25 µl) containing 10 mM HEPES pH 7.9, 10 µg/ml BSA, 2 mM DTT, 30% glycerol, 20% Ficoll-400, 1 µg poly (dI-dC), 6 µg of nuclear extracts and 10,000 to 20,000 cpm (0.05 to 0.2 ng) of radiolabelled probe were performed for 20 minutes at room temperature.
T94 15089-15363 Sentence denotes DNA binding reactions (25 µl) containing 10 mM HEPES pH 7.9, 10 µg/ml BSA, 2 mM DTT, 30% glycerol, 20% Ficoll-400, 1 µg poly (dI-dC), 6 µg of nuclear extracts and 10,000 to 20,000 cpm (0.05 to 0.2 ng) of radiolabelled probe were performed for 20 minutes at room temperature.
T7821 15364-15532 Sentence denotes Binding reaction products were resolved by electrophoresis at room temperature on 5% polyacrylamide gels (29∶1 acrylamide:bis-acrylamide (Bio-Rad)) in 1x TBE at 10V/cm.
T95 15364-15532 Sentence denotes Binding reaction products were resolved by electrophoresis at room temperature on 5% polyacrylamide gels (29∶1 acrylamide:bis-acrylamide (Bio-Rad)) in 1x TBE at 10V/cm.
T7822 15533-15642 Sentence denotes For supershift assays, nuclear extracts were pre-incubated 2 hrs on ice with 4 µg of specific C/EBP antibody.
T96 15533-15642 Sentence denotes For supershift assays, nuclear extracts were pre-incubated 2 hrs on ice with 4 µg of specific C/EBP antibody.
T7823 15643-15779 Sentence denotes Antibodies were purchased from Santa Cruz: anti-C/EBP-α (sc-61), anti-C/EBP-β (sc-150), anti-C/EBP-δ (sc-151) and anti-C/EBP-ε (sc-158).
T97 15643-15779 Sentence denotes Antibodies were purchased from Santa Cruz: anti-C/EBP-α (sc-61), anti-C/EBP-β (sc-150), anti-C/EBP-δ (sc-151) and anti-C/EBP-ε (sc-158).
T8267 15781-15823 Sentence denotes Chromatin Immunoprecipitation (ChIP) Assay
T98 15781-15823 Sentence denotes Chromatin Immunoprecipitation (ChIP) Assay
T8268 15824-15972 Sentence denotes ChIP assays were performed using a commercially available Magna-ChIP™ kit (Millipore), as recommended by the manufacturer, with minor modifications.
T99 15824-15972 Sentence denotes ChIP assays were performed using a commercially available Magna-ChIP™ kit (Millipore), as recommended by the manufacturer, with minor modifications.
T8269 15973-16190 Sentence denotes Briefly, after crosslinking the chromatin with 1% formaldehyde at room temperature for 10 min and neutralizing with glycine for 5 min at room temperature, cells were washed with cold PBS, scraped and collected on ice.
T100 15973-16190 Sentence denotes Briefly, after crosslinking the chromatin with 1% formaldehyde at room temperature for 10 min and neutralizing with glycine for 5 min at room temperature, cells were washed with cold PBS, scraped and collected on ice.
T8270 16191-16267 Sentence denotes Cells extracts were prepared using a commercially available kit (Millipore).
T101 16191-16267 Sentence denotes Cells extracts were prepared using a commercially available kit (Millipore).
T8271 16268-16382 Sentence denotes Nuclear lysates were sonicated 5 times for 15 sec with 1 min intervals on ice using a Sonic Dismembrator (Fisher).
T102 16268-16382 Sentence denotes Nuclear lysates were sonicated 5 times for 15 sec with 1 min intervals on ice using a Sonic Dismembrator (Fisher).
T8272 16383-16653 Sentence denotes An equal amount of chromatin was immunoprecipitated at 4°C overnight with at least 1 µg of the following antibodies: C/EBP-β (sc-150X), p-C/EBP-β (T217) (sc-16993X), normal rabbit IgG (sc-2027)(Santa Cruz Biotechnologies) and RNA polymerase II (Clone CTD4H8)(Millipore).
T103 16383-16653 Sentence denotes An equal amount of chromatin was immunoprecipitated at 4°C overnight with at least 1 µg of the following antibodies: C/EBP-β (sc-150X), p-C/EBP-β (T217) (sc-16993X), normal rabbit IgG (sc-2027)(Santa Cruz Biotechnologies) and RNA polymerase II (Clone CTD4H8)(Millipore).
T8273 16654-16763 Sentence denotes Immunoprecipitated products were collected after incubation with Protein G coated magnetic beads (Millipore).
T104 16654-16763 Sentence denotes Immunoprecipitated products were collected after incubation with Protein G coated magnetic beads (Millipore).
T105 16764-16920 Sentence denotes The beads were washed, the bound chromatin was eluted in ChIP Elution Buffer (Millipore) and the proteins were digested with Proteinase K for 2 hrs at 62°C.
T8274 16764-16996 Sentence denotes The beads were washed, the bound chromatin was eluted in ChIP Elution Buffer (Millipore) and the proteins were digested with Proteinase K for 2 hrs at 62°C. The DNA was then purified using the QIAquick PCR Purification Kit (Qiagen).
T106 16921-16996 Sentence denotes The DNA was then purified using the QIAquick PCR Purification Kit (Qiagen).
T8275 16997-17232 Sentence denotes DNA was amplified by semi-quantitative PCR or by qPCR using the SYBR green method and primers specific for the SerpinB2 proximal promoter: forward (−338/−315) 5′AAGACTCCCACAGATGGTGGCTGT3’; reverse (−5/+19) 5′TTCTTGGAAAGCTGGCACTGTGTG3’.
T107 16997-17232 Sentence denotes DNA was amplified by semi-quantitative PCR or by qPCR using the SYBR green method and primers specific for the SerpinB2 proximal promoter: forward (−338/−315) 5′AAGACTCCCACAGATGGTGGCTGT3’; reverse (−5/+19) 5′TTCTTGGAAAGCTGGCACTGTGTG3’.
T8901 17234-17254 Sentence denotes Statistical Analysis
T108 17234-17254 Sentence denotes Statistical Analysis
T8902 17255-17298 Sentence denotes Data are presented as mean ± SEM per group.
T109 17255-17298 Sentence denotes Data are presented as mean ± SEM per group.
T8903 17299-17395 Sentence denotes Results were analyzed using the analysis of variance (ANOVA) or Student’s t test where relevant.
T110 17299-17395 Sentence denotes Results were analyzed using the analysis of variance (ANOVA) or Student’s t test where relevant.
T8904 17396-17439 Sentence denotes P-values <0.05 were considered significant.
T111 17396-17439 Sentence denotes P-values <0.05 were considered significant.
T112 17441-17448 Sentence denotes Results
T9013 17450-17495 Sentence denotes The SerpinB2 Gene is Highly Responsive to LPS
T113 17450-17495 Sentence denotes The SerpinB2 Gene is Highly Responsive to LPS
T9014 17496-17660 Sentence denotes When RAW264.7 macrophages were exposed to LPS, SerpinB2 mRNA was detectable as early as 30 min following LPS challenge, reaching maximal levels at 24 hrs (Fig. 1A).
T114 17496-17660 Sentence denotes When RAW264.7 macrophages were exposed to LPS, SerpinB2 mRNA was detectable as early as 30 min following LPS challenge, reaching maximal levels at 24 hrs (Fig. 1A).
T9015 17661-17847 Sentence denotes A similar strong induction of LPS-inducible SerpinB2 mRNA expression has been reported previously in murine peritoneal macrophages and human peripheral blood mononuclear cells [4]; [32].
T115 17661-17847 Sentence denotes A similar strong induction of LPS-inducible SerpinB2 mRNA expression has been reported previously in murine peritoneal macrophages and human peripheral blood mononuclear cells [4]; [32].
T9016 17848-17979 Sentence denotes LPS-induced SerpinB2 expression involves both an increase in gene transcription and stabilization of the mRNA [5]; [29]; [42]–[44].
T116 17848-17979 Sentence denotes LPS-induced SerpinB2 expression involves both an increase in gene transcription and stabilization of the mRNA [5]; [29]; [42]–[44].
T9017 17980-18125 Sentence denotes SerpinB2 protein expression was also induced as has been reported in other cell types [31], and detectable after 8 hrs of LPS treatment (Fig. 1).
T117 17980-18125 Sentence denotes SerpinB2 protein expression was also induced as has been reported in other cell types [31], and detectable after 8 hrs of LPS treatment (Fig. 1).
T118 18126-18251 Sentence denotes 10.1371/journal.pone.0057855.g001 Figure 1 LPS induction of SerpinB2 mRNA and protein expression in murine macrophage cells.
T22396 18170-18251 Sentence denotes LPS induction of SerpinB2 mRNA and protein expression in murine macrophage cells.
T22397 18252-18400 Sentence denotes RAW264.7 macrophages were treated for the indicated times with 100 ng/ml LPS. (A) qPCR analysis of murine SerpinB2 mRNA levels, relative to β-actin.
T119 18252-18400 Sentence denotes RAW264.7 macrophages were treated for the indicated times with 100 ng/ml LPS. (A) qPCR analysis of murine SerpinB2 mRNA levels, relative to β-actin.
T22398 18401-18570 Sentence denotes The plot is representative of at least two independent experiments performed in triplicate. (B) Immunoblot analysis of SerpinB2 protein expression in whole cell lysates.
T120 18401-18570 Sentence denotes The plot is representative of at least two independent experiments performed in triplicate. (B) Immunoblot analysis of SerpinB2 protein expression in whole cell lysates.
T22399 18571-18620 Sentence denotes Blot was reprobed for GAPDH as a loading control.
T121 18571-18620 Sentence denotes Blot was reprobed for GAPDH as a loading control.
T9469 18622-18679 Sentence denotes The SerpinB2 Proximal Promoter Confers LPS Responsiveness
T122 18622-18679 Sentence denotes The SerpinB2 Proximal Promoter Confers LPS Responsiveness
T9470 18680-18989 Sentence denotes To investigate cis-acting regulatory elements responsive to LPS in the 5′ flanking region of the murine SerpinB2 gene, nucleotides −4480 to +92 and a series of generated deletion mutants of the 5′ flanking region were cloned upstream of a promoter-less firefly luciferase reporter gene (pGL3 Basic) (Fig. 2A).
T123 18680-18989 Sentence denotes To investigate cis-acting regulatory elements responsive to LPS in the 5′ flanking region of the murine SerpinB2 gene, nucleotides −4480 to +92 and a series of generated deletion mutants of the 5′ flanking region were cloned upstream of a promoter-less firefly luciferase reporter gene (pGL3 Basic) (Fig. 2A).
T9471 18990-19182 Sentence denotes The reporter constructs were then transiently transfected into sub-confluent RAW264.7 macrophages and assayed for luciferase activity in the presence and absence of LPS or PMA, for comparison.
T124 18990-19182 Sentence denotes The reporter constructs were then transiently transfected into sub-confluent RAW264.7 macrophages and assayed for luciferase activity in the presence and absence of LPS or PMA, for comparison.
T9472 19183-19402 Sentence denotes PMA-induced SerpinB2 gene regulation has been extensively studied in human macrophage cell lines [45]–[47], and has been shown to occur through several proximal and distal AP-1 responsive elements [30]; [37]; [47]–[51].
T125 19183-19402 Sentence denotes PMA-induced SerpinB2 gene regulation has been extensively studied in human macrophage cell lines [45]–[47], and has been shown to occur through several proximal and distal AP-1 responsive elements [30]; [37]; [47]–[51].
T9473 19403-19571 Sentence denotes As shown in Fig. 2B, the SerpinB2 5′ flanking region from −4480 to +92 directs both PMA- and LPS-inducible transcription, approximately 2-fold and 7-fold, respectively.
T126 19403-19571 Sentence denotes As shown in Fig. 2B, the SerpinB2 5′ flanking region from −4480 to +92 directs both PMA- and LPS-inducible transcription, approximately 2-fold and 7-fold, respectively.
T9474 19572-19747 Sentence denotes Deletion of the murine SerpinB2 promoter from −1686 to −1341 increased LPS-inducibility to approximately 16-fold, indicating the presence of a silencer element in this region.
T127 19572-19747 Sentence denotes Deletion of the murine SerpinB2 promoter from −1686 to −1341 increased LPS-inducibility to approximately 16-fold, indicating the presence of a silencer element in this region.
T9475 19748-20014 Sentence denotes Further deletion beyond −539 abolished the LPS-response of the promoter, indicating the presence of an essential LPS response element in the region between −539 and −189; however, the response of the murine SerpinB2 promoter to PMA is less affected by this deletion.
T128 19748-20014 Sentence denotes Further deletion beyond −539 abolished the LPS-response of the promoter, indicating the presence of an essential LPS response element in the region between −539 and −189; however, the response of the murine SerpinB2 promoter to PMA is less affected by this deletion.
T9476 20015-20359 Sentence denotes While deletion of the SerpinB2 promoter from −189 to −87 eliminated the LPS response and marginally reduced the PMA response, the −87 murine SerpinB2 promoter construct was still partially responsive to PMA, indicating that cis-acting elements mediating the response of the murine SerpinB2 promoter to PMA also lie downstream of nucleotide −87.
T129 20015-20359 Sentence denotes While deletion of the SerpinB2 promoter from −189 to −87 eliminated the LPS response and marginally reduced the PMA response, the −87 murine SerpinB2 promoter construct was still partially responsive to PMA, indicating that cis-acting elements mediating the response of the murine SerpinB2 promoter to PMA also lie downstream of nucleotide −87.
T130 20360-20502 Sentence denotes 10.1371/journal.pone.0057855.g002 Figure 2 Deletion reporter gene analysis of LPS and PMA-responsive regions in the murine SerpinB2 promoter.
T22690 20404-20502 Sentence denotes Deletion reporter gene analysis of LPS and PMA-responsive regions in the murine SerpinB2 promoter.
T22691 20503-20611 Sentence denotes (A) Schematic representation of the murine SerpinB2 promoter and 5′ deletion luciferase reporter constructs.
T131 20503-20611 Sentence denotes (A) Schematic representation of the murine SerpinB2 promoter and 5′ deletion luciferase reporter constructs.
T22692 20612-20822 Sentence denotes The murine 5′ flanking region from −4480 to +92 was inserted upstream of the luciferase reporter gene and 5′ deletions were generated using restriction enzyme sites or with specific oligonucleotide PCR primers.
T132 20612-20822 Sentence denotes The murine 5′ flanking region from −4480 to +92 was inserted upstream of the luciferase reporter gene and 5′ deletions were generated using restriction enzyme sites or with specific oligonucleotide PCR primers.
T22693 20823-21063 Sentence denotes Construct names indicate the most 5′ nucleotide of murine SerpinB2 5′ flanking sequence. (B) RAW 264.7 macrophages were transiently transfected with the indicated murine SerpinB2 promoter-luciferase reporter constructs and control plasmids.
T133 20823-21063 Sentence denotes Construct names indicate the most 5′ nucleotide of murine SerpinB2 5′ flanking sequence. (B) RAW 264.7 macrophages were transiently transfected with the indicated murine SerpinB2 promoter-luciferase reporter constructs and control plasmids.
T22694 21064-21154 Sentence denotes Cells were either left untreated or treated with 100 ng/ml LPS or 40 ng/ml PMA for 16 hrs.
T134 21064-21154 Sentence denotes Cells were either left untreated or treated with 100 ng/ml LPS or 40 ng/ml PMA for 16 hrs.
T22695 21155-21231 Sentence denotes Shown is the relative luciferase reporter gene activity following treatment.
T135 21155-21231 Sentence denotes Shown is the relative luciferase reporter gene activity following treatment.
T22696 21232-21392 Sentence denotes The results represent the mean and SEM of four independent experiments. (C) DNA sequence conservation between the human and murine SerpinB2 5′ flanking regions.
T136 21232-21392 Sentence denotes The results represent the mean and SEM of four independent experiments. (C) DNA sequence conservation between the human and murine SerpinB2 5′ flanking regions.
T22697 21393-21552 Sentence denotes Schematic representation of the human and murine SerpinB2 5′ flanking regions with regions of nucleotide sequence identity indicated by the same colored boxes.
T137 21393-21552 Sentence denotes Schematic representation of the human and murine SerpinB2 5′ flanking regions with regions of nucleotide sequence identity indicated by the same colored boxes.
T22698 21553-21648 Sentence denotes Homologous regions are interrupted by repetitive sequence elements in both 5′ flanking regions.
T138 21553-21648 Sentence denotes Homologous regions are interrupted by repetitive sequence elements in both 5′ flanking regions.
T22699 21649-21919 Sentence denotes Alu = Alu repeat, ID4 =  ID4 short interspersed nuclear repeat (SINE), L1 =  L1 long interspersed nuclear element (LINE), L2 =  L2 LINE, MIR = MIR SINE, MLT1L = MLT1L long terminal repeat (LTR), (TATG)n = TATG tetranucleotide repeat, tis = transcription initiation site.
T139 21649-21919 Sentence denotes Alu = Alu repeat, ID4 =  ID4 short interspersed nuclear repeat (SINE), L1 =  L1 long interspersed nuclear element (LINE), L2 =  L2 LINE, MIR = MIR SINE, MLT1L = MLT1L long terminal repeat (LTR), (TATG)n = TATG tetranucleotide repeat, tis = transcription initiation site.
T10389 21921-21998 Sentence denotes Sequence Conservation within the Human and Murine SerpinB2 Proximal Promoters
T140 21921-21998 Sentence denotes Sequence Conservation within the Human and Murine SerpinB2 Proximal Promoters
T10390 21999-22188 Sentence denotes To look for potential cis-acting elements that might mediate transcription of the murine SerpinB2 gene and the response to LPS, we aligned the murine and human SerpinB2 5′ flanking regions.
T141 21999-22188 Sentence denotes To look for potential cis-acting elements that might mediate transcription of the murine SerpinB2 gene and the response to LPS, we aligned the murine and human SerpinB2 5′ flanking regions.
T10391 22189-22377 Sentence denotes We reasoned that the presence of evolutionarily conserved, potential transcription factor binding sites in this region might play a role in the regulation of SerpinB2 gene expression [52].
T142 22189-22377 Sentence denotes We reasoned that the presence of evolutionarily conserved, potential transcription factor binding sites in this region might play a role in the regulation of SerpinB2 gene expression [52].
T10392 22378-22529 Sentence denotes The presence of several repetitive sequence elements delineated five broadly homologous regions (A-E) between the human and murine promoters (Fig. 2C).
T143 22378-22529 Sentence denotes The presence of several repetitive sequence elements delineated five broadly homologous regions (A-E) between the human and murine promoters (Fig. 2C).
T10393 22530-22647 Sentence denotes The proximal promoter (Region E), which contains the essential LPS response element, exhibited the greatest homology.
T144 22530-22647 Sentence denotes The proximal promoter (Region E), which contains the essential LPS response element, exhibited the greatest homology.
T10394 22648-22840 Sentence denotes Further analysis of Region E revealed that several of the cis-acting regulatory elements defined in the human SerpinB2 proximal promoter are conserved in the murine SerpinB2 promoter (Fig. 3).
T145 22648-22840 Sentence denotes Further analysis of Region E revealed that several of the cis-acting regulatory elements defined in the human SerpinB2 proximal promoter are conserved in the murine SerpinB2 promoter (Fig. 3).
T10395 22841-23030 Sentence denotes Specifically, a TATA consensus sequence is located 23 to 29bp upstream from the transcription initiation site, similar to the position of the TATA box of the human SERPINB2 gene [53]; [54].
T146 22841-23030 Sentence denotes Specifically, a TATA consensus sequence is located 23 to 29bp upstream from the transcription initiation site, similar to the position of the TATA box of the human SERPINB2 gene [53]; [54].
T10396 23031-23287 Sentence denotes A putative CCAAT enhancer binding protein (C/EBP) site is present at −192/−203, two potential activator protein 1 (AP-1) binding sites are found at nucleotides −88/−94 and −100/−106, and a putative cyclic AMP response element (CRE) is present at −172/−177.
T147 23031-23287 Sentence denotes A putative CCAAT enhancer binding protein (C/EBP) site is present at −192/−203, two potential activator protein 1 (AP-1) binding sites are found at nucleotides −88/−94 and −100/−106, and a putative cyclic AMP response element (CRE) is present at −172/−177.
T10397 23288-23467 Sentence denotes Both of the AP-1 sites are identical in sequence to those identified in the human SERPINB2 promoter, and the CRE differs in the identity of a single central nucleotide [37]; [55].
T148 23288-23467 Sentence denotes Both of the AP-1 sites are identical in sequence to those identified in the human SERPINB2 promoter, and the CRE differs in the identity of a single central nucleotide [37]; [55].
T10398 23468-23644 Sentence denotes A consensus E box (−538/−533), as well as potential binding sites for PU.1 (−412/−407) and Oct-1 (−296/−288) were also identified within the proximal promoter region (Fig. S2).
T149 23468-23644 Sentence denotes A consensus E box (−538/−533), as well as potential binding sites for PU.1 (−412/−407) and Oct-1 (−296/−288) were also identified within the proximal promoter region (Fig. S2).
T10399 23645-23849 Sentence denotes Further upstream, a retinoic acid response element at −1349/−1340, a PAUSE-1 silencer element at −1540/−1528 and a NF-κB p65 binding site at −1342/−1351 (Fig. S2) are also well conserved [16]; [30]; [56].
T150 23645-23849 Sentence denotes Further upstream, a retinoic acid response element at −1349/−1340, a PAUSE-1 silencer element at −1540/−1528 and a NF-κB p65 binding site at −1342/−1351 (Fig. S2) are also well conserved [16]; [30]; [56].
T151 23850-23995 Sentence denotes 10.1371/journal.pone.0057855.g003 Figure 3 Potential cis-acting regulatory elements in the LPS responsive region of the murine SerpinB2 promoter
T23398 23894-23995 Sentence denotes Potential cis-acting regulatory elements in the LPS responsive region of the murine SerpinB2 promoter
T23399 23996-24004 Sentence denotes −563/−1.
T152 23996-24004 Sentence denotes −563/−1.
T23400 24005-24080 Sentence denotes Mouse and human nucleotide sequences were aligned using Clustal W software.
T153 24005-24080 Sentence denotes Mouse and human nucleotide sequences were aligned using Clustal W software.
T23401 24081-24181 Sentence denotes Cis-acting elements conserved between the human and murine SerpinB2 promoters are boxed and labeled.
T154 24081-24181 Sentence denotes Cis-acting elements conserved between the human and murine SerpinB2 promoters are boxed and labeled.
T23402 24182-24365 Sentence denotes AP-1 =  activator protein 1; C/EBP =  CCAAT enhancer binding protein; CRE = cAMP response element; Oct1 =  octamer transcription factor 1/POU2F1; PU.1 =  purine box binding protein 1.
T155 24182-24365 Sentence denotes AP-1 =  activator protein 1; C/EBP =  CCAAT enhancer binding protein; CRE = cAMP response element; Oct1 =  octamer transcription factor 1/POU2F1; PU.1 =  purine box binding protein 1.
T23403 24366-24465 Sentence denotes The putative transcription initiation site (tis) is indicated and exon 1 is presented in uppercase.
T156 24366-24465 Sentence denotes The putative transcription initiation site (tis) is indicated and exon 1 is presented in uppercase.
T23404 24466-24555 Sentence denotes The location of the 5' ends of the −539, −189 and −87 reporter constructs are also shown.
T157 24466-24555 Sentence denotes The location of the 5' ends of the −539, −189 and −87 reporter constructs are also shown.
T11443 24557-24688 Sentence denotes A C/EBP, CRE and Two AP-1 Sites in the Murine SerpinB2 Gene Proximal Promoter are Essential for Optimal LPS-inducible Transcription
T158 24557-24688 Sentence denotes A C/EBP, CRE and Two AP-1 Sites in the Murine SerpinB2 Gene Proximal Promoter are Essential for Optimal LPS-inducible Transcription
T11444 24689-25103 Sentence denotes To investigate regulatory elements between −539 and −189 essential for LPS-inducible transcription, several candidate binding sites for transcription factors previously reported to mediate LPS-inducible transcription in other genes [57] were targeted by nucleotide substitution designed to disrupt transcription factor binding to the pGLmP-539 murine SerpinB2 promoter-luciferase reporter gene construct (Fig. 4A).
T159 24689-25103 Sentence denotes To investigate regulatory elements between −539 and −189 essential for LPS-inducible transcription, several candidate binding sites for transcription factors previously reported to mediate LPS-inducible transcription in other genes [57] were targeted by nucleotide substitution designed to disrupt transcription factor binding to the pGLmP-539 murine SerpinB2 promoter-luciferase reporter gene construct (Fig. 4A).
T11445 25104-25273 Sentence denotes As shown in Fig. 4B, mutation of the consensus E box (−538/−533), PU.1 (−412/−407), or the variant Oct-1 (−296/−288) site did not decrease LPS-induced promoter activity.
T160 25104-25273 Sentence denotes As shown in Fig. 4B, mutation of the consensus E box (−538/−533), PU.1 (−412/−407), or the variant Oct-1 (−296/−288) site did not decrease LPS-induced promoter activity.
T11446 25274-25448 Sentence denotes In contrast, mutation of the C/EBP site (−203/−192) completely eliminated promoter activity, similar to the levels observed for the −189 SerpinB2 promoter deletion construct.
T161 25274-25448 Sentence denotes In contrast, mutation of the C/EBP site (−203/−192) completely eliminated promoter activity, similar to the levels observed for the −189 SerpinB2 promoter deletion construct.
T11447 25449-25554 Sentence denotes Others have also recently implicated this C/EBP site in LPS-induced activation of the SerpinB2 gene [58].
T162 25449-25554 Sentence denotes Others have also recently implicated this C/EBP site in LPS-induced activation of the SerpinB2 gene [58].
T163 25555-25705 Sentence denotes 10.1371/journal.pone.0057855.g004 Figure 4 Identification of cis-acting elements required for the LPS-responsiveness of the murine SerpinB2 promoter.
T23781 25599-25705 Sentence denotes Identification of cis-acting elements required for the LPS-responsiveness of the murine SerpinB2 promoter.
T23782 25706-25873 Sentence denotes (A) Schematic representation of the −539/+92 region of the murine SerpinB2 promoter with the location of candidate cis-acting regulatory elements indicated with boxes.
T164 25706-25873 Sentence denotes (A) Schematic representation of the −539/+92 region of the murine SerpinB2 promoter with the location of candidate cis-acting regulatory elements indicated with boxes.
T23783 25874-25962 Sentence denotes The location of the 5′ ends of the −539, −189 and −87 reporter constructs is also shown.
T165 25874-25962 Sentence denotes The location of the 5′ ends of the −539, −189 and −87 reporter constructs is also shown.
T23784 25963-26280 Sentence denotes Positions of murine SerpinB2 proximal promoter-specific primers, 338/−315 and −5/+19 used in ChIP assays are indicated. (B) RAW 264.7 macrophages were transiently transfected with the indicated murine SerpinB2 promoter-luciferase reporter constructs and either left untreated or treated with 100 ng/ml LPS for 16 hrs.
T166 25963-26280 Sentence denotes Positions of murine SerpinB2 proximal promoter-specific primers, 338/−315 and −5/+19 used in ChIP assays are indicated. (B) RAW 264.7 macrophages were transiently transfected with the indicated murine SerpinB2 promoter-luciferase reporter constructs and either left untreated or treated with 100 ng/ml LPS for 16 hrs.
T23785 26281-26413 Sentence denotes The results show relative luciferase activity following LPS treatment and represent the mean and SEM of 4–7 independent experiments.
T167 26281-26413 Sentence denotes The results show relative luciferase activity following LPS treatment and represent the mean and SEM of 4–7 independent experiments.
T11448 26414-26773 Sentence denotes Considering the conserved sequence and position of the CRE and two AP-1 sites in the murine SerpinB2 promoter and their demonstrated involvement in the PMA-responsiveness of the human SERPINB2 promoter [37], these sites were also mutated by nucleotide substitution to investigate whether they played a role in the LPS response of the murine SerpinB2 promoter.
T168 26414-26773 Sentence denotes Considering the conserved sequence and position of the CRE and two AP-1 sites in the murine SerpinB2 promoter and their demonstrated involvement in the PMA-responsiveness of the human SERPINB2 promoter [37], these sites were also mutated by nucleotide substitution to investigate whether they played a role in the LPS response of the murine SerpinB2 promoter.
T11449 26774-26990 Sentence denotes As shown in Fig. 4B, mutation of the CRE at −177/−172 or either of the two AP-1 sites at −106/−100 and −94/−88, completely or significantly reduced LPS-inducible luciferase activity from the murine SerpinB2 promoter.
T169 26774-26990 Sentence denotes As shown in Fig. 4B, mutation of the CRE at −177/−172 or either of the two AP-1 sites at −106/−100 and −94/−88, completely or significantly reduced LPS-inducible luciferase activity from the murine SerpinB2 promoter.
T11450 26991-27165 Sentence denotes These data show that the C/EBP element, as well as the CRE and both AP-1 cis-acting elements are critical for LPS-inducible transcription from the SerpinB2 proximal promoter.
T170 26991-27165 Sentence denotes These data show that the C/EBP element, as well as the CRE and both AP-1 cis-acting elements are critical for LPS-inducible transcription from the SerpinB2 proximal promoter.
T12399 27167-27253 Sentence denotes The C/EBP Element is Bound by an LPS-induced Nuclear Factor from RAW 264.7 Macrophages
T171 27167-27253 Sentence denotes The C/EBP Element is Bound by an LPS-induced Nuclear Factor from RAW 264.7 Macrophages
T12400 27254-27459 Sentence denotes Nuclear factor binding to the putative C/EBP element (−203/−192) was investigated by electrophoretic mobility shift assay (EMSA) using nuclear extracts from untreated and LPS-treated RAW 264.7 macrophages.
T172 27254-27459 Sentence denotes Nuclear factor binding to the putative C/EBP element (−203/−192) was investigated by electrophoretic mobility shift assay (EMSA) using nuclear extracts from untreated and LPS-treated RAW 264.7 macrophages.
T12401 27460-27791 Sentence denotes Three different double stranded oligonucleotide probes were used for EMSA, representing (1) the putative SerpinB2 C/EBP element (−203/−192), (2) a mutant SerpinB2 element containing the same mutation as in pGLmP-539mC/EBP and (3) the rat albumin promoter distal element 1 (DEI) region containing a high affinity C/EBP binding site.
T173 27460-27791 Sentence denotes Three different double stranded oligonucleotide probes were used for EMSA, representing (1) the putative SerpinB2 C/EBP element (−203/−192), (2) a mutant SerpinB2 element containing the same mutation as in pGLmP-539mC/EBP and (3) the rat albumin promoter distal element 1 (DEI) region containing a high affinity C/EBP binding site.
T12402 27792-27895 Sentence denotes Four bands of different mobilities, representing DNA-nuclear protein complexes were detected (Fig. 5A).
T174 27792-27895 Sentence denotes Four bands of different mobilities, representing DNA-nuclear protein complexes were detected (Fig. 5A).
T12403 27896-28052 Sentence denotes Three of these bands (I, II, III) represent complexes with single stranded DNA (Fig. 5A) while the uppermost (slowest migrating) complex was induced by LPS.
T175 27896-28052 Sentence denotes Three of these bands (I, II, III) represent complexes with single stranded DNA (Fig. 5A) while the uppermost (slowest migrating) complex was induced by LPS.
T12404 28053-28448 Sentence denotes The LPS-inducible complex was not detected using the mutant C/EBP oligonucleotide probe and could be abolished by an excess of unlabeled double-stranded oligonucleotide, carrying either the same sequence (Fig. 5B, lanes 4 and 5) or the sequence of a known C/EBP binding site from the rat albumin promoter (Fig. 5B, lanes 8 and 9), but not by the mutated oligonucleotide (Fig. 5B, lanes 6 and 7).
T176 28053-28448 Sentence denotes The LPS-inducible complex was not detected using the mutant C/EBP oligonucleotide probe and could be abolished by an excess of unlabeled double-stranded oligonucleotide, carrying either the same sequence (Fig. 5B, lanes 4 and 5) or the sequence of a known C/EBP binding site from the rat albumin promoter (Fig. 5B, lanes 8 and 9), but not by the mutated oligonucleotide (Fig. 5B, lanes 6 and 7).
T12405 28449-28639 Sentence denotes Together these data indicate that the putative SerpinB2 C/EBP site at −203/−192 binds a LPS-inducible complex that is likely to contain a member of the C/EBP family of transcription factors.
T177 28449-28639 Sentence denotes Together these data indicate that the putative SerpinB2 C/EBP site at −203/−192 binds a LPS-inducible complex that is likely to contain a member of the C/EBP family of transcription factors.
T178 28640-28791 Sentence denotes 10.1371/journal.pone.0057855.g005 Figure 5 The LPS-inducible nuclear factor binding the murine SerpinB2 proximal promoter C/EBP site contains C/EBP-β.
T24176 28684-28791 Sentence denotes The LPS-inducible nuclear factor binding the murine SerpinB2 proximal promoter C/EBP site contains C/EBP-β.
T24177 28792-29486 Sentence denotes (A) EMSA with nuclear extracts from untreated (UN) and 10 hr LPS treated (LPS) RAW 264.7 cells incubated with either the murine SerpinB2 promoter −212/−185 probe containing an intact (SerpinB2 C/EBP) or mutated (mutant C/EBP) C/EBP site or with the rat albumin promoter DEI region C/EBP (rat albumin C/EBP) probe. (B) Cold competition EMSAs performed with the radiolabelled murine SerpinB2 promoter −212/−185 probe and a 100-fold molar excess of each of the double stranded oligonucleotides described in (A) demonstrate the specificity of the DNA-protein complexes. (C) Supershift assays were performed with the −212/−185 probe by after preincubation with the indicated specific C/EBP antibody.
T179 28792-29486 Sentence denotes (A) EMSA with nuclear extracts from untreated (UN) and 10 hr LPS treated (LPS) RAW 264.7 cells incubated with either the murine SerpinB2 promoter −212/−185 probe containing an intact (SerpinB2 C/EBP) or mutated (mutant C/EBP) C/EBP site or with the rat albumin promoter DEI region C/EBP (rat albumin C/EBP) probe. (B) Cold competition EMSAs performed with the radiolabelled murine SerpinB2 promoter −212/−185 probe and a 100-fold molar excess of each of the double stranded oligonucleotides described in (A) demonstrate the specificity of the DNA-protein complexes. (C) Supershift assays were performed with the −212/−185 probe by after preincubation with the indicated specific C/EBP antibody.
T24178 29487-29544 Sentence denotes The LPS-inducible complex is indicated with an arrowhead.
T180 29487-29544 Sentence denotes The LPS-inducible complex is indicated with an arrowhead.
T13141 29546-29651 Sentence denotes C/EBP-β is a LPS-induced Nuclear Factor that Binds to the C/EBP Element of the SerpinB2 Proximal Promoter
T181 29546-29651 Sentence denotes C/EBP-β is a LPS-induced Nuclear Factor that Binds to the C/EBP Element of the SerpinB2 Proximal Promoter
T13142 29652-29791 Sentence denotes The C/EBP family of basic leucine zipper transcription factors are known for their roles in cellular differentiation and inflammation [59].
T182 29652-29791 Sentence denotes The C/EBP family of basic leucine zipper transcription factors are known for their roles in cellular differentiation and inflammation [59].
T13143 29792-29927 Sentence denotes Consisting of six members, the C/EBP transcription factors can homo−/heterodimerize and display similar DNA binding specificities [60].
T183 29792-29927 Sentence denotes Consisting of six members, the C/EBP transcription factors can homo−/heterodimerize and display similar DNA binding specificities [60].
T13144 29928-30123 Sentence denotes Four family members, C/EBP-α, C/EBP-β, C/EBP-δ and C/EBP-ε, are present in myeloid cells and play different roles in differentiating myeloid cells depending on the extracellular environment [61].
T184 29928-30123 Sentence denotes Four family members, C/EBP-α, C/EBP-β, C/EBP-δ and C/EBP-ε, are present in myeloid cells and play different roles in differentiating myeloid cells depending on the extracellular environment [61].
T13145 30124-30411 Sentence denotes To determine which C/EBP proteins were involved in the formation of the different nucleo-protein complexes, and particularly of the LPS-inducible complex, EMSA was performed after incubating the nucleo-protein complexes with antibodies specific for C/EBP-α, C/EBP-β, C/EBP-δ and C/EBP-ε.
T185 30124-30411 Sentence denotes To determine which C/EBP proteins were involved in the formation of the different nucleo-protein complexes, and particularly of the LPS-inducible complex, EMSA was performed after incubating the nucleo-protein complexes with antibodies specific for C/EBP-α, C/EBP-β, C/EBP-δ and C/EBP-ε.
T13146 30412-30605 Sentence denotes Each antibody detects the carboxy-terminal DNA-binding region of the respective protein, so that pre-incubation of antibody with nuclear extract is expected to abolish DNA binding by EMSA [62].
T186 30412-30605 Sentence denotes Each antibody detects the carboxy-terminal DNA-binding region of the respective protein, so that pre-incubation of antibody with nuclear extract is expected to abolish DNA binding by EMSA [62].
T13147 30606-30701 Sentence denotes Only antibodies against C/EBP-β abolished the formation of the LPS-inducible complex (Fig. 5C).
T187 30606-30701 Sentence denotes Only antibodies against C/EBP-β abolished the formation of the LPS-inducible complex (Fig. 5C).
T13148 30702-30814 Sentence denotes Taken together these data show that the LPS-induced complex with the C/EBP element (−203/−192) contains C/EBP-β.
T188 30702-30814 Sentence denotes Taken together these data show that the LPS-induced complex with the C/EBP element (−203/−192) contains C/EBP-β.
T13960 30816-30936 Sentence denotes C/EBP-β Mediates both Constitutive and LPS-induced SerpinB2 mRNA Expression in MEFs and Inflammatory Primary Macrophages
T189 30816-30936 Sentence denotes C/EBP-β Mediates both Constitutive and LPS-induced SerpinB2 mRNA Expression in MEFs and Inflammatory Primary Macrophages
T13961 30937-31168 Sentence denotes To investigate the importance of C/EBP-β to endogenous SerpinB2 mRNA expression in response to LPS, we utilized C/EBP-β-null (Cebpb −/−) and wild-type MEFs (Cebpb+/+), since RAW264.7 cells constitutively express endogenous C/EBP-β.
T190 30937-31168 Sentence denotes To investigate the importance of C/EBP-β to endogenous SerpinB2 mRNA expression in response to LPS, we utilized C/EBP-β-null (Cebpb −/−) and wild-type MEFs (Cebpb+/+), since RAW264.7 cells constitutively express endogenous C/EBP-β.
T13962 31169-31300 Sentence denotes Wild-type MEFs express low levels of endogenous SerpinB2 and the absence of C/EBP-β attenuated endogenous SerpinB2 mRNA expression.
T191 31169-31300 Sentence denotes Wild-type MEFs express low levels of endogenous SerpinB2 and the absence of C/EBP-β attenuated endogenous SerpinB2 mRNA expression.
T13963 31301-31502 Sentence denotes LPS stimulated an increase in SerpinB2 mRNA expression in wild-type MEFs (Fig. 6A), whereas LPS-stimulated SerpinB2 mRNA expression was significantly dampened in Cebpb−/− MEFs as compared to wild-type.
T192 31301-31502 Sentence denotes LPS stimulated an increase in SerpinB2 mRNA expression in wild-type MEFs (Fig. 6A), whereas LPS-stimulated SerpinB2 mRNA expression was significantly dampened in Cebpb−/− MEFs as compared to wild-type.
T13964 31503-31705 Sentence denotes We next tested if similar effects could be seen in thioglycollate-elicited inflammatory macrophages in which C/EBP-β expression was knocked down using species-specific lentiviral shRNAs (Fig. 6B, left).
T193 31503-31705 Sentence denotes We next tested if similar effects could be seen in thioglycollate-elicited inflammatory macrophages in which C/EBP-β expression was knocked down using species-specific lentiviral shRNAs (Fig. 6B, left).
T13965 31706-31881 Sentence denotes As was observed in MEFs, both constitutive and LPS-induced SerpinB2 mRNA expression was significantly decreased in C/EBP-β-deficient inflammatory macrophages (Fig. 6B, right).
T194 31706-31881 Sentence denotes As was observed in MEFs, both constitutive and LPS-induced SerpinB2 mRNA expression was significantly decreased in C/EBP-β-deficient inflammatory macrophages (Fig. 6B, right).
T13966 31882-32010 Sentence denotes These data show that C/EBP-β is critical for mediating constitutive and LPS-inducible transcription of endogenous SerpinB2 mRNA.
T195 31882-32010 Sentence denotes These data show that C/EBP-β is critical for mediating constitutive and LPS-inducible transcription of endogenous SerpinB2 mRNA.
T196 32011-32134 Sentence denotes 10.1371/journal.pone.0057855.g006 Figure 6 C/EBP-β is essential for constitutive and LPS-induced SerpinB2 mRNA expression.
T24569 32055-32134 Sentence denotes C/EBP-β is essential for constitutive and LPS-induced SerpinB2 mRNA expression.
T24570 32135-32518 Sentence denotes (A) Endogenous SerpinB2 mRNA expression is abrogated in Cebpb−/− MEFs compared to Cebpb+/+ MEFs in the absence and presence of LPS. qPCR analysis of murine SerpinB2 mRNA expression in untreated Cebpb+/+ and Cebpb−/− MEFs, and after simulation with LPS (100 ng/ml) for the indicated times. (B) Endogenous SerpinB2 expression is abrogated in C/EBP-β-deficient inflammatory macrophages.
T197 32135-32518 Sentence denotes (A) Endogenous SerpinB2 mRNA expression is abrogated in Cebpb−/− MEFs compared to Cebpb+/+ MEFs in the absence and presence of LPS. qPCR analysis of murine SerpinB2 mRNA expression in untreated Cebpb+/+ and Cebpb−/− MEFs, and after simulation with LPS (100 ng/ml) for the indicated times. (B) Endogenous SerpinB2 expression is abrogated in C/EBP-β-deficient inflammatory macrophages.
T24571 32519-32639 Sentence denotes Thioglycollate-elicited peritoneal macrophages (TG macs) were infected with human and murine specific lentiviral shRNAs.
T198 32519-32639 Sentence denotes Thioglycollate-elicited peritoneal macrophages (TG macs) were infected with human and murine specific lentiviral shRNAs.
T24572 32640-32750 Sentence denotes Human CEBPB shRNA serves as the non-silencing control since it does not target the murine Cebpb sequence [38].
T199 32640-32750 Sentence denotes Human CEBPB shRNA serves as the non-silencing control since it does not target the murine Cebpb sequence [38].
T24573 32751-32832 Sentence denotes Lentiviral transduced macrophages were stimulated with LPS (100 ng/ml) for 4 hrs.
T200 32751-32832 Sentence denotes Lentiviral transduced macrophages were stimulated with LPS (100 ng/ml) for 4 hrs.
T24574 32833-32838 Sentence denotes Left:
T201 32833-32838 Sentence denotes Left:
T24575 32839-32979 Sentence denotes Western blot analysis shows effective knockdown of endogenous C/EBP-β following infection with murine Cebpb shRNA and not human CEBPB shRNA.
T202 32839-32979 Sentence denotes Western blot analysis shows effective knockdown of endogenous C/EBP-β following infection with murine Cebpb shRNA and not human CEBPB shRNA.
T24576 32980-33088 Sentence denotes Right: qPCR analysis of murine SerpinB2 mRNA expression in the lentiviral transduced peritoneal macrophages.
T203 32980-33088 Sentence denotes Right: qPCR analysis of murine SerpinB2 mRNA expression in the lentiviral transduced peritoneal macrophages.
T24577 33089-33224 Sentence denotes The results represent the mean and SEM of two independent experiments performed in duplicate or triplicate. (*, p<0.05, two-way ANOVA).
T204 33089-33224 Sentence denotes The results represent the mean and SEM of two independent experiments performed in duplicate or triplicate. (*, p<0.05, two-way ANOVA).
T14839 33226-33312 Sentence denotes C/EBP-β Binds the Murine SerpinB2 Proximal Promoter in vivo in an LPS-inducible Manner
T205 33226-33312 Sentence denotes C/EBP-β Binds the Murine SerpinB2 Proximal Promoter in vivo in an LPS-inducible Manner
T14840 33313-33473 Sentence denotes We investigated the temporal dynamics of C/EBP-β recruitment to the murine SerpinB2 promoter in response to LPS in vivo by chromatin immunoprecipitation (ChIP).
T206 33313-33473 Sentence denotes We investigated the temporal dynamics of C/EBP-β recruitment to the murine SerpinB2 promoter in response to LPS in vivo by chromatin immunoprecipitation (ChIP).
T14841 33474-33755 Sentence denotes RAW 264.7 cells were stimulated with LPS for up to 8 hrs, soluble chromatin was immunoprecipitated with antibodies against DNA binding proteins, and the enriched DNA amplified by both semi-quantitative and qPCR using SerpinB2 proximal promoter specific primers (illustrated in fig.
T207 33474-33760 Sentence denotes RAW 264.7 cells were stimulated with LPS for up to 8 hrs, soluble chromatin was immunoprecipitated with antibodies against DNA binding proteins, and the enriched DNA amplified by both semi-quantitative and qPCR using SerpinB2 proximal promoter specific primers (illustrated in fig. 4A).
T14842 33756-33760 Sentence denotes 4A).
T14843 33761-34042 Sentence denotes The results showed that C/EBP-β is constitutively present at the SerpinB2 promoter as demonstrated by its association with the promoter in unstimulated macrophages and increased temporally in response to LPS reaching as much as 10-fold over unstimulated cells after 8 hrs (Fig. 7).
T208 33761-34042 Sentence denotes The results showed that C/EBP-β is constitutively present at the SerpinB2 promoter as demonstrated by its association with the promoter in unstimulated macrophages and increased temporally in response to LPS reaching as much as 10-fold over unstimulated cells after 8 hrs (Fig. 7).
T14844 34043-34470 Sentence denotes Since changes in C/EBP-β phosphorylation states can affect C/EBP-β’s ability to transactivate target genes [38]; [63]; [64], we investigated recruitment to the SerpinB2 proximal promoter of the T217 phosphorylated C/EBP-β isoform (p-C/EBP-βT217), which has been associated with cell survival [65]. p-C/EBP-βT217 was constitutively bound to the SerpinB2 proximal promoter and also present after 1 hr of LPS stimulation (Fig. 7).
T209 34043-34470 Sentence denotes Since changes in C/EBP-β phosphorylation states can affect C/EBP-β’s ability to transactivate target genes [38]; [63]; [64], we investigated recruitment to the SerpinB2 proximal promoter of the T217 phosphorylated C/EBP-β isoform (p-C/EBP-βT217), which has been associated with cell survival [65]. p-C/EBP-βT217 was constitutively bound to the SerpinB2 proximal promoter and also present after 1 hr of LPS stimulation (Fig. 7).
T14845 34471-34648 Sentence denotes In contrast to total C/EBP-β, the binding affinity of p-C/EBP-βT217 for the SerpinB2 proximal promoter diminished with LPS stimulation at later timepoints (4 and 8 hrs)(Fig. 7).
T210 34471-34648 Sentence denotes In contrast to total C/EBP-β, the binding affinity of p-C/EBP-βT217 for the SerpinB2 proximal promoter diminished with LPS stimulation at later timepoints (4 and 8 hrs)(Fig. 7).
T14846 34649-34879 Sentence denotes These data show an inverse relationship between C/EBP-β and p-C/EBP-βT217 recruitment, and indicate that T217-phosphorylated C/EBP-β may not be responsible for increased transcription from the SerpinB2 promoter in response to LPS.
T211 34649-34879 Sentence denotes These data show an inverse relationship between C/EBP-β and p-C/EBP-βT217 recruitment, and indicate that T217-phosphorylated C/EBP-β may not be responsible for increased transcription from the SerpinB2 promoter in response to LPS.
T212 34880-35016 Sentence denotes 10.1371/journal.pone.0057855.g007 Figure 7 Differential recruitment of C/EBP-β and C/EBP-βT217 to the murine SerpinB2 promoter in vivo.
T25322 34924-35016 Sentence denotes Differential recruitment of C/EBP-β and C/EBP-βT217 to the murine SerpinB2 promoter in vivo.
T25323 35017-35151 Sentence denotes Transcription factor occupancy on the SerpinB2 proximal promoter in vivo was determined by chromatin immunoprecipitation (ChIP) assay.
T213 35017-35151 Sentence denotes Transcription factor occupancy on the SerpinB2 proximal promoter in vivo was determined by chromatin immunoprecipitation (ChIP) assay.
T25324 35152-35341 Sentence denotes RAW264.7 macrophages were treated in the presence or absence of LPS for the indicated times and chromatin immunoprecipitation performed using antibodies against C/EBP-β or p-C/EBP-β (T217).
T214 35152-35341 Sentence denotes RAW264.7 macrophages were treated in the presence or absence of LPS for the indicated times and chromatin immunoprecipitation performed using antibodies against C/EBP-β or p-C/EBP-β (T217).
T25325 35342-35655 Sentence denotes Soluble chromatin (600–700 ng) was immunoprecipitated with antibodies against C/EBP-β, p-C/EBP-β (T217), RNA Polymerase II (RNAPII), or a rabbit IgG (rIgG) control. (A) Typical PCR pattern obtained in ChIP assays using murine SerpinB2 proximal promoter-specific primers, 338/−315 and −5/+19, as diagrammed in top.
T215 35342-35655 Sentence denotes Soluble chromatin (600–700 ng) was immunoprecipitated with antibodies against C/EBP-β, p-C/EBP-β (T217), RNA Polymerase II (RNAPII), or a rabbit IgG (rIgG) control. (A) Typical PCR pattern obtained in ChIP assays using murine SerpinB2 proximal promoter-specific primers, 338/−315 and −5/+19, as diagrammed in top.
T25326 35656-35759 Sentence denotes Recruitment of RNAPII to the SerpinB2 promoter suggests active transcription following LPS stimulation.
T216 35656-35759 Sentence denotes Recruitment of RNAPII to the SerpinB2 promoter suggests active transcription following LPS stimulation.
T25327 35760-35996 Sentence denotes Minimal background was detected using the rabbit IgG control, indicative of the specificity of the ChIP reaction. (B) qPCR analysis of chromatin immunoprecipitated with antibodies against C/EBP-β, p-C/EBP-β (T217), and the rIgG control.
T217 35760-35996 Sentence denotes Minimal background was detected using the rabbit IgG control, indicative of the specificity of the ChIP reaction. (B) qPCR analysis of chromatin immunoprecipitated with antibodies against C/EBP-β, p-C/EBP-β (T217), and the rIgG control.
T25328 35997-36070 Sentence denotes The data are represented relative to rIgG signal using the 2-ΔΔCt method.
T218 35997-36070 Sentence denotes The data are represented relative to rIgG signal using the 2-ΔΔCt method.
T15710 36072-36145 Sentence denotes C/EBP-β Promotes LPS-inducible Murine SerpinB2 Proximal Promoter Activity
T219 36072-36145 Sentence denotes C/EBP-β Promotes LPS-inducible Murine SerpinB2 Proximal Promoter Activity
T15711 36146-36412 Sentence denotes Since C/EBP-β binds to the SerpinB2 proximal promoter in an LPS-inducible manner both in vitro and in vivo, we wanted to address the question of whether C/EBP-β was an essential factor for driving transcription from the SerpinB2 promoter in cells in response to LPS.
T220 36146-36412 Sentence denotes Since C/EBP-β binds to the SerpinB2 proximal promoter in an LPS-inducible manner both in vitro and in vivo, we wanted to address the question of whether C/EBP-β was an essential factor for driving transcription from the SerpinB2 promoter in cells in response to LPS.
T15712 36413-36631 Sentence denotes The ability of endogenous C/EBP-β to direct transcription from the SerpinB2 proximal promoter was examined by transfection of the pGLmP-539 murine SerpinB2 luciferase reporter construct into Cebpb+/+ and Cebpb−/− MEFs.
T221 36413-36631 Sentence denotes The ability of endogenous C/EBP-β to direct transcription from the SerpinB2 proximal promoter was examined by transfection of the pGLmP-539 murine SerpinB2 luciferase reporter construct into Cebpb+/+ and Cebpb−/− MEFs.
T15713 36632-36874 Sentence denotes We found that LPS-stimulated SerpinB2 promoter activity was significantly increased in Cebpb+/+ MEFs and abrogated in Cebpb−/− MEFs (Fig. 8A), indicating that endogenous C/EBP-β is required for LPS-induced SerpinB2 proximal promoter activity.
T222 36632-36874 Sentence denotes We found that LPS-stimulated SerpinB2 promoter activity was significantly increased in Cebpb+/+ MEFs and abrogated in Cebpb−/− MEFs (Fig. 8A), indicating that endogenous C/EBP-β is required for LPS-induced SerpinB2 proximal promoter activity.
T223 36875-36980 Sentence denotes 10.1371/journal.pone.0057855.g008 Figure 8 C/EBP-β is necessary for SerpinB2 proximal promoter activity.
T26086 36919-36980 Sentence denotes C/EBP-β is necessary for SerpinB2 proximal promoter activity.
T26087 36981-37100 Sentence denotes (A) The SerpinB2 proximal promoter is significantly activated in LPS-stimulated Cebpb+/+ MEFs and not in Cebpb−/− MEFs.
T224 36981-37100 Sentence denotes (A) The SerpinB2 proximal promoter is significantly activated in LPS-stimulated Cebpb+/+ MEFs and not in Cebpb−/− MEFs.
T26088 37101-37288 Sentence denotes Murine SerpinB2 gene promoter activity measured in Cebpb+/+ and Cebpb−/− MEFs expressing the pGLmP-539 SerpinB2 promoter-luciferase reporter in the presence or absence of LPS (100 ng/mL).
T225 37101-37288 Sentence denotes Murine SerpinB2 gene promoter activity measured in Cebpb+/+ and Cebpb−/− MEFs expressing the pGLmP-539 SerpinB2 promoter-luciferase reporter in the presence or absence of LPS (100 ng/mL).
T26089 37289-37659 Sentence denotes Cells were co-transfected with the pGLmP-539 SerpinB2 promoter-luciferase reporter and β-galactosidase reporter plasmids, and luciferase units normalized to β-galactosidase activity. (B) C/EBP-β gene schematic depicting gene structure and phospho-acceptor sites. (C) Phosphorylation of C/EBP-β at Serine 64 negatively regulates LPS-stimulated SerpinB2 promoter activity.
T226 37289-37659 Sentence denotes Cells were co-transfected with the pGLmP-539 SerpinB2 promoter-luciferase reporter and β-galactosidase reporter plasmids, and luciferase units normalized to β-galactosidase activity. (B) C/EBP-β gene schematic depicting gene structure and phospho-acceptor sites. (C) Phosphorylation of C/EBP-β at Serine 64 negatively regulates LPS-stimulated SerpinB2 promoter activity.
T26090 37660-37933 Sentence denotes Cebpb−/− MEFs were co-transfected with expression plasmids encoding wild-type C/EBP-β or the indicated C/EBP-β phospho-acceptor mutants, along with the pGLmP-539 SerpinB2 promoter-luciferase reporter and β-galactosidase reporter plasmids, and stimulated with LPS for 4 hrs.
T227 37660-37933 Sentence denotes Cebpb−/− MEFs were co-transfected with expression plasmids encoding wild-type C/EBP-β or the indicated C/EBP-β phospho-acceptor mutants, along with the pGLmP-539 SerpinB2 promoter-luciferase reporter and β-galactosidase reporter plasmids, and stimulated with LPS for 4 hrs.
T26091 37934-38012 Sentence denotes Luciferase activity was quantified and normalized to β-galactosidase activity.
T228 37934-38012 Sentence denotes Luciferase activity was quantified and normalized to β-galactosidase activity.
T26092 38013-38124 Sentence denotes The western blot (below the graphs) confirms the expression of the respective C/EBP-β phospho-acceptor mutants.
T229 38013-38124 Sentence denotes The western blot (below the graphs) confirms the expression of the respective C/EBP-β phospho-acceptor mutants.
T26093 38125-38215 Sentence denotes The C/EBP-βT217A -transfected MEFs express both the 38 kDa and 35 kDa isoforms of C/EBP-β.
T230 38125-38215 Sentence denotes The C/EBP-βT217A -transfected MEFs express both the 38 kDa and 35 kDa isoforms of C/EBP-β.
T26094 38216-38349 Sentence denotes The results represent the mean and SEM of at least three independent experiments performed in triplicate. (*, p<0.05, one-way ANOVA).
T231 38216-38349 Sentence denotes The results represent the mean and SEM of at least three independent experiments performed in triplicate. (*, p<0.05, one-way ANOVA).
T16492 38351-38453 Sentence denotes Phosphorylation of C/EBP-β at Serine 64 negatively Regulates LPS-stimulated SerpinB2 Promoter Activity
T232 38351-38453 Sentence denotes Phosphorylation of C/EBP-β at Serine 64 negatively Regulates LPS-stimulated SerpinB2 Promoter Activity
T16493 38454-38547 Sentence denotes Phosphorylation of C/EBP-β is well recognized to modulate its transactivation potential [63].
T233 38454-38547 Sentence denotes Phosphorylation of C/EBP-β is well recognized to modulate its transactivation potential [63].
T16494 38548-38893 Sentence denotes To investigate C/EBP-β phosphorylation sites that may be important for LPS-stimulated SerpinB2 proximal promoter activity (Fig. 8B), we co-expressed several C/EBP-β phospho-acceptor mutants in which the critical threonine or serine residue was mutated to an alanine, along with the pGLmP-539 murine SerpinB2 luciferase reporter in Cebpb−/− MEFs.
T234 38548-38893 Sentence denotes To investigate C/EBP-β phosphorylation sites that may be important for LPS-stimulated SerpinB2 proximal promoter activity (Fig. 8B), we co-expressed several C/EBP-β phospho-acceptor mutants in which the critical threonine or serine residue was mutated to an alanine, along with the pGLmP-539 murine SerpinB2 luciferase reporter in Cebpb−/− MEFs.
T16495 38894-39147 Sentence denotes Re-expression of wild-type C/EBP-β in Cebpb−/− MEFs significantly stimulated SerpinB2 luciferase reporter gene expression in the presence of LPS by ∼3 fold (Fig. 8C, left), confirming the importance of C/EBP-β to LPS-induced SerpinB2 gene transcription.
T235 38894-39147 Sentence denotes Re-expression of wild-type C/EBP-β in Cebpb−/− MEFs significantly stimulated SerpinB2 luciferase reporter gene expression in the presence of LPS by ∼3 fold (Fig. 8C, left), confirming the importance of C/EBP-β to LPS-induced SerpinB2 gene transcription.
T16496 39148-39477 Sentence denotes Expression of the C/EBP-β phospho-acceptor mutant, C/EBPβT217A, in Cebpb−/− MEFs did not significantly increase SerpinB2 promoter activity above that of wild-type C/EBP-β (Fig. 8C, right); confirming that phosphorylation of C/EBP-β at T217 is not a major factor in the regulation of SerpinB2 promoter activity in response to LPS.
T236 39148-39477 Sentence denotes Expression of the C/EBP-β phospho-acceptor mutant, C/EBPβT217A, in Cebpb−/− MEFs did not significantly increase SerpinB2 promoter activity above that of wild-type C/EBP-β (Fig. 8C, right); confirming that phosphorylation of C/EBP-β at T217 is not a major factor in the regulation of SerpinB2 promoter activity in response to LPS.
T16497 39478-39649 Sentence denotes C/EBP-β contains additional phosphorylation sites, C/EBP-βT188 and C/EBP-βS64 (Fig. 8B), which may be involved in modulating C/EBP-β-dependent SerpinB2 gene transcription.
T237 39478-39649 Sentence denotes C/EBP-β contains additional phosphorylation sites, C/EBP-βT188 and C/EBP-βS64 (Fig. 8B), which may be involved in modulating C/EBP-β-dependent SerpinB2 gene transcription.
T16498 39650-39841 Sentence denotes C/EBP-βT188 is implicated in regulating DAPK1, an IFNγ-inducible gene involved in the regulation of cell cycle and apoptosis [38], processes with which SerpinB2 has also been associated [17].
T238 39650-39841 Sentence denotes C/EBP-βT188 is implicated in regulating DAPK1, an IFNγ-inducible gene involved in the regulation of cell cycle and apoptosis [38], processes with which SerpinB2 has also been associated [17].
T16499 39842-39933 Sentence denotes C/EBP-βS64 is important for LPS-induced transcription of the cytokines IL-6 and MCP-1 [64].
T239 39842-39933 Sentence denotes C/EBP-βS64 is important for LPS-induced transcription of the cytokines IL-6 and MCP-1 [64].
T16500 39934-40024 Sentence denotes Similarly, SerpinB2 is induced by LPS and regulated in a manner similar to cytokines [29].
T240 39934-40024 Sentence denotes Similarly, SerpinB2 is induced by LPS and regulated in a manner similar to cytokines [29].
T16501 40025-40236 Sentence denotes Given the similarities in the functional significance of these phospho-specific isoforms of C/EBP-β and SerpinB2, we investigated whether these phospho-acceptor sites may play a role in SerpinB2 gene expression.
T241 40025-40236 Sentence denotes Given the similarities in the functional significance of these phospho-specific isoforms of C/EBP-β and SerpinB2, we investigated whether these phospho-acceptor sites may play a role in SerpinB2 gene expression.
T16502 40237-40472 Sentence denotes C/EBP-βT188A-transfected MEFs exhibited SerpinB2 promoter activity similar to that of wild-type C/EBP-β-transfected MEFs, whereas the expression of C/EBP-βS64A potentiated SerpinB2 promoter activity in response to LPS (Fig. 8C, right).
T242 40237-40472 Sentence denotes C/EBP-βT188A-transfected MEFs exhibited SerpinB2 promoter activity similar to that of wild-type C/EBP-β-transfected MEFs, whereas the expression of C/EBP-βS64A potentiated SerpinB2 promoter activity in response to LPS (Fig. 8C, right).
T16503 40473-40595 Sentence denotes These data suggest that phosphorylation of C/EBP-β at S64 acts to negatively regulate SerpinB2 proximal promoter activity.
T243 40473-40595 Sentence denotes These data suggest that phosphorylation of C/EBP-β at S64 acts to negatively regulate SerpinB2 proximal promoter activity.
T244 40597-40607 Sentence denotes Discussion
T18480 40608-40738 Sentence denotes Macrophages are key mediators of the innate immune response, and consequently provide the first line of defense against pathogens.
T245 40608-40738 Sentence denotes Macrophages are key mediators of the innate immune response, and consequently provide the first line of defense against pathogens.
T18481 40739-40930 Sentence denotes Pro-inflammatory stimuli, such as the bacterial endotoxin LPS, stimulate macrophages to mount an anti-pathogenic response which involves massive induction of the pro-survival factor SerpinB2.
T246 40739-40930 Sentence denotes Pro-inflammatory stimuli, such as the bacterial endotoxin LPS, stimulate macrophages to mount an anti-pathogenic response which involves massive induction of the pro-survival factor SerpinB2.
T18482 40931-41060 Sentence denotes SerpinB2 is transcriptionally induced by cross talk between the IKKβ/NF-κB and p38MAPK signaling modules in response to LPS [16].
T247 40931-41060 Sentence denotes SerpinB2 is transcriptionally induced by cross talk between the IKKβ/NF-κB and p38MAPK signaling modules in response to LPS [16].
T18483 41061-41213 Sentence denotes Here we report that SerpinB2 gene transcription in response to LPS is conferred by the SerpinB2 proximal promoter and is greatly dependent upon C/EBP-β.
T248 41061-41213 Sentence denotes Here we report that SerpinB2 gene transcription in response to LPS is conferred by the SerpinB2 proximal promoter and is greatly dependent upon C/EBP-β.
T18484 41214-41443 Sentence denotes LPS-induced C/EBP-β was shown to specifically bind the C/EBP response element in the SerpinB2 proximal promoter in vitro and in vivo, and loss of C/EBP-β abrogates constitutive SerpinB2 gene transcription and the response to LPS.
T249 41214-41443 Sentence denotes LPS-induced C/EBP-β was shown to specifically bind the C/EBP response element in the SerpinB2 proximal promoter in vitro and in vivo, and loss of C/EBP-β abrogates constitutive SerpinB2 gene transcription and the response to LPS.
T18485 41444-41656 Sentence denotes The murine SerpinB2 proximal promoter region between nucleotides -539 and +92 mediated both PMA- and LPS-inducible gene transcription, with induction by PMA being less intense and more transient than that by LPS.
T250 41444-41656 Sentence denotes The murine SerpinB2 proximal promoter region between nucleotides -539 and +92 mediated both PMA- and LPS-inducible gene transcription, with induction by PMA being less intense and more transient than that by LPS.
T18486 41657-41940 Sentence denotes Inspection of the murine SerpinB2 proximal promoter sequence shows that a CRE and two AP-1-like elements, demonstrated to mediate PMA-stimulated transcription of the human SERPINB2 gene [37], also are present in the murine SerpinB2 proximal promoter between nucleotides −189 and −87.
T251 41657-41940 Sentence denotes Inspection of the murine SerpinB2 proximal promoter sequence shows that a CRE and two AP-1-like elements, demonstrated to mediate PMA-stimulated transcription of the human SERPINB2 gene [37], also are present in the murine SerpinB2 proximal promoter between nucleotides −189 and −87.
T18487 41941-42053 Sentence denotes These sites may therefore also play a role in mediating PMA-inducible transcription of the murine SerpinB2 gene.
T252 41941-42053 Sentence denotes These sites may therefore also play a role in mediating PMA-inducible transcription of the murine SerpinB2 gene.
T18488 42054-42356 Sentence denotes In contrast to the pattern of incremental increases in PMA-induced transcriptional activity conferred by regions of the murine SerpinB2 promoter containing these sites, most of the LPS-inducible response is dependent upon cis-acting regulatory sequences in the region between nucleotides −189 and −539.
T253 42054-42356 Sentence denotes In contrast to the pattern of incremental increases in PMA-induced transcriptional activity conferred by regions of the murine SerpinB2 promoter containing these sites, most of the LPS-inducible response is dependent upon cis-acting regulatory sequences in the region between nucleotides −189 and −539.
T18489 42357-42543 Sentence denotes LPS responsiveness absolutely required the C/EBP binding site located in the region between nucleotides −189 and −539, with the downstream CRE and AP-1-like elements also being critical.
T254 42357-42543 Sentence denotes LPS responsiveness absolutely required the C/EBP binding site located in the region between nucleotides −189 and −539, with the downstream CRE and AP-1-like elements also being critical.
T18490 42544-42811 Sentence denotes Of note, there are previous reports of combinatorial interactions between C/EBP-β and CRE binding proteins (CREB) and AP-1 [63], and C/EBP-β has been reported to physically interact with AP-1, and NF-κB to promote gene expression of inflammatory mediators [63]; [66].
T255 42544-42811 Sentence denotes Of note, there are previous reports of combinatorial interactions between C/EBP-β and CRE binding proteins (CREB) and AP-1 [63], and C/EBP-β has been reported to physically interact with AP-1, and NF-κB to promote gene expression of inflammatory mediators [63]; [66].
T18491 42812-42896 Sentence denotes Additionally, CREB has been shown to control transcription of the C/EBP-β gene [67].
T256 42812-42896 Sentence denotes Additionally, CREB has been shown to control transcription of the C/EBP-β gene [67].
T18492 42897-43022 Sentence denotes In this study, C/EBP-β was found to be a major requirement for both constitutive and LPS-induced SerpinB2 gene transcription.
T257 42897-43022 Sentence denotes In this study, C/EBP-β was found to be a major requirement for both constitutive and LPS-induced SerpinB2 gene transcription.
T18493 43023-43245 Sentence denotes In a previous microarray expression profiling study, SerpinB2 was identified as gene whose induction in C/EBP-β-deficient peritoneal macrophages by LPS and IFNγ was severely impaired compared to wild-type macrophages [68].
T258 43023-43245 Sentence denotes In a previous microarray expression profiling study, SerpinB2 was identified as gene whose induction in C/EBP-β-deficient peritoneal macrophages by LPS and IFNγ was severely impaired compared to wild-type macrophages [68].
T18494 43246-43512 Sentence denotes Our qPCR results validate this finding, as we found that both constitutive and LPS-inducible SerpinB2 mRNA expression is significantly abrogated in C/EBP-β-shRNA transduced peritoneal macrophages, emphasizing the link between C/EBP-β and SerpinB2 gene transcription.
T259 43246-43512 Sentence denotes Our qPCR results validate this finding, as we found that both constitutive and LPS-inducible SerpinB2 mRNA expression is significantly abrogated in C/EBP-β-shRNA transduced peritoneal macrophages, emphasizing the link between C/EBP-β and SerpinB2 gene transcription.
T18495 43513-43774 Sentence denotes While C/EBP proteins can act as either homodimers or heterodimers [63], we identified C/EBP-β as the only LPS-inducible C/EBP isoform to bind the SerpinB2 C/EBP response element, suggesting a predominant role for C/EBP-β in LPS-induced SerpinB2 gene expression.
T260 43513-43774 Sentence denotes While C/EBP proteins can act as either homodimers or heterodimers [63], we identified C/EBP-β as the only LPS-inducible C/EBP isoform to bind the SerpinB2 C/EBP response element, suggesting a predominant role for C/EBP-β in LPS-induced SerpinB2 gene expression.
T18496 43775-43922 Sentence denotes C/EBP-β, like SerpinB2, plays an important role in inflammation, as it is upregulated by LPS and a host of other inflammatory cytokines [59]; [62].
T261 43775-43922 Sentence denotes C/EBP-β, like SerpinB2, plays an important role in inflammation, as it is upregulated by LPS and a host of other inflammatory cytokines [59]; [62].
T18497 43923-44110 Sentence denotes Furthermore, C/EBP-β-null mice are susceptible to bacterial infection [69]; [70] and SerpinB2 has been demonstrated to protect from bacterial and viral-induced cell death [14]–[16]; [25].
T262 43923-44110 Sentence denotes Furthermore, C/EBP-β-null mice are susceptible to bacterial infection [69]; [70] and SerpinB2 has been demonstrated to protect from bacterial and viral-induced cell death [14]–[16]; [25].
T18498 44111-44225 Sentence denotes Thus the regulation of SerpinB2 gene expression by C/EBP-β is consistent with its functional role in inflammation.
T263 44111-44225 Sentence denotes Thus the regulation of SerpinB2 gene expression by C/EBP-β is consistent with its functional role in inflammation.
T18499 44226-44364 Sentence denotes Phosphorylation of C/EBP-β at several different amino acid residues has been shown to modulate transactivation of its target genes [63]; .
T264 44226-44364 Sentence denotes Phosphorylation of C/EBP-β at several different amino acid residues has been shown to modulate transactivation of its target genes [63]; .
T18500 44365-44564 Sentence denotes C/EBP-β phosphorylated on T217 has been reported to rescue macrophages from apoptosis induced by Bacillus anthracis lethal toxin (LT) [65], an activity that has also been attributed to SerpinB2 [16].
T265 44365-44564 Sentence denotes C/EBP-β phosphorylated on T217 has been reported to rescue macrophages from apoptosis induced by Bacillus anthracis lethal toxin (LT) [65], an activity that has also been attributed to SerpinB2 [16].
T18501 44565-44876 Sentence denotes However, expression of a C/EBP-β phospho-acceptor site mutant, C/EBPβT217A, in Cebpb−/− MEFs did not increase SerpinB2 proximal promoter activity over that of wild-type C/EBP-β, even though recruitment of C/EBP-βT217 to the SerpinB2 promoter was observed to decrease following LPS stimulation of RAW264.7 cells.
T266 44565-44876 Sentence denotes However, expression of a C/EBP-β phospho-acceptor site mutant, C/EBPβT217A, in Cebpb−/− MEFs did not increase SerpinB2 proximal promoter activity over that of wild-type C/EBP-β, even though recruitment of C/EBP-βT217 to the SerpinB2 promoter was observed to decrease following LPS stimulation of RAW264.7 cells.
T18502 44877-44997 Sentence denotes These data indicate that the T217 phospho-acceptor site is not important for the regulation of SerpinB2 gene expression.
T267 44877-44997 Sentence denotes These data indicate that the T217 phospho-acceptor site is not important for the regulation of SerpinB2 gene expression.
T18503 44998-45156 Sentence denotes Similarly, expression of the C/EBP-β phospho-acceptor site mutant, C/EBP-βT188A, did not affect SerpinB2 promoter activity differently from that of wild-type.
T268 44998-45156 Sentence denotes Similarly, expression of the C/EBP-β phospho-acceptor site mutant, C/EBP-βT188A, did not affect SerpinB2 promoter activity differently from that of wild-type.
T18504 45157-45369 Sentence denotes In contrast, expression of C/EBP-βS64A significantly enhanced LPS-induced SerpinB2 promoter activity, indicating that phosphorylation of C/EBP-β at S64 negatively regulates LPS-induced SerpinB2 promoter activity.
T269 45157-45369 Sentence denotes In contrast, expression of C/EBP-βS64A significantly enhanced LPS-induced SerpinB2 promoter activity, indicating that phosphorylation of C/EBP-β at S64 negatively regulates LPS-induced SerpinB2 promoter activity.
T18505 45370-45611 Sentence denotes Since C/EBP-β S64 is constitutively phosphorylated in both RAW264.7 cells and MEFs [73], it is likely that dephosphorylation at this site may be a critical event during LPS-induced transcription of SerpinB2 to increase its promoter activity.
T270 45370-45611 Sentence denotes Since C/EBP-β S64 is constitutively phosphorylated in both RAW264.7 cells and MEFs [73], it is likely that dephosphorylation at this site may be a critical event during LPS-induced transcription of SerpinB2 to increase its promoter activity.
T18506 45612-45776 Sentence denotes Roy and colleagues demonstrated that Mixed lineage kinase-3 (MLK3)-driven dephosphorylation of C/EBP-β S64 was important for IFNγ-regulated signaling pathways [73].
T271 45612-45776 Sentence denotes Roy and colleagues demonstrated that Mixed lineage kinase-3 (MLK3)-driven dephosphorylation of C/EBP-β S64 was important for IFNγ-regulated signaling pathways [73].
T18507 45777-45883 Sentence denotes Our data suggest that MLK3-driven dephosphorylation of S64 may also be involved in LPS-signaling pathways.
T272 45777-45883 Sentence denotes Our data suggest that MLK3-driven dephosphorylation of S64 may also be involved in LPS-signaling pathways.
T18508 45884-46109 Sentence denotes In recent years it has become apparent that persistent infection is integrally linked to chronic inflammation and cancer, and immune cells such as macrophages can either promote or attenuate cancer progression [2]; [74]–[76].
T273 45884-46109 Sentence denotes In recent years it has become apparent that persistent infection is integrally linked to chronic inflammation and cancer, and immune cells such as macrophages can either promote or attenuate cancer progression [2]; [74]–[76].
T18509 46110-46270 Sentence denotes SerpinB2 expression has been associated with both inflammation and cancer, and is a favorable or unfavorable prognostic indicator depending on cancer type [77].
T274 46110-46270 Sentence denotes SerpinB2 expression has been associated with both inflammation and cancer, and is a favorable or unfavorable prognostic indicator depending on cancer type [77].
T18510 46271-46406 Sentence denotes The presence of SerpinB2 has been shown to modulate cytokine profiles which can affect immune cell polarization [27]; [28]; [77]; [78].
T275 46271-46406 Sentence denotes The presence of SerpinB2 has been shown to modulate cytokine profiles which can affect immune cell polarization [27]; [28]; [77]; [78].
T18511 46407-46549 Sentence denotes Interestingly C/EBP-β has also been shown to modulate cytokine secretion from immune cells, thereby modifying their phenotype [27]; [79]–[81].
T276 46407-46549 Sentence denotes Interestingly C/EBP-β has also been shown to modulate cytokine secretion from immune cells, thereby modifying their phenotype [27]; [79]–[81].
T18512 46550-46815 Sentence denotes Our study has demonstrated that C/EBP-β plays an important role in mediating both constitutive and LPS-induced transcription of the SerpinB2 gene, which may have implications for the inflammatory phenotype of infiltrating immune cells in the tumor microenvironment.
T277 46550-46815 Sentence denotes Our study has demonstrated that C/EBP-β plays an important role in mediating both constitutive and LPS-induced transcription of the SerpinB2 gene, which may have implications for the inflammatory phenotype of infiltrating immune cells in the tumor microenvironment.
T18513 46816-47001 Sentence denotes In summary, our studies show that the C/EBP site (−203/−195) in the murine SerpinB2 proximal promoter is necessary to support both constitutive and LPS-induced SerpinB2 gene expression.
T278 46816-47001 Sentence denotes In summary, our studies show that the C/EBP site (−203/−195) in the murine SerpinB2 proximal promoter is necessary to support both constitutive and LPS-induced SerpinB2 gene expression.
T18514 47002-47132 Sentence denotes Importantly, we were able to uncover a previously unknown role for C/EBP-βS64 in negatively regulating SerpinB2 promoter activity.
T279 47002-47132 Sentence denotes Importantly, we were able to uncover a previously unknown role for C/EBP-βS64 in negatively regulating SerpinB2 promoter activity.
T18515 47133-47251 Sentence denotes Taken together these data provide new insight into the regulation of inflammation-associated SerpinB2 gene expression.
T280 47133-47251 Sentence denotes Taken together these data provide new insight into the regulation of inflammation-associated SerpinB2 gene expression.
T281 47253-47275 Sentence denotes Supporting Information
T282 47276-47551 Sentence denotes Figure S1 PCR primer sequences used to generate murine SerpinB2 reporter constructs. (top) PCR primer sequences used to subclone SerpinB2 promoter sequences into pGL3 Basic luciferase reporter plasmid and generate deletion constructs as indicated in Experimental Procedures.
T283 47552-47734 Sentence denotes KpnI (GGTACC) and XhoI (CTCGAG) restriction sites are underlined. (bottom) mutant oligonucleotide PCR primers used to mutate LPS-responsive regions in the SerpinB2 proximal promoter.
T284 47735-47773 Sentence denotes Mutated nucleotides are shown in bold.
T285 47774-47779 Sentence denotes (TIF)
T286 47780-47816 Sentence denotes Click here for additional data file.
T287 47817-47900 Sentence denotes Figure S2 Conserved response elements in the murine and human SerpinB2 promoter.
T288 47901-48044 Sentence denotes Location and nucleotide sequences of the cis-acting elements conserved between the human and murine SerpinB2 promoters are listed as indicated.
T289 48045-48050 Sentence denotes (TIF)
T290 48051-48087 Sentence denotes Click here for additional data file.