> top > projects > sentences > docs > PMC:3585731 > annotations
sentences Home  

PMC:3585731 JSONTXT 30 Projects

Annnotations TAB TSV DIC JSON TextAE

Id Subject Object Predicate Lexical cue
T60 0-84 Sentence denotes Akt Regulates TNFα Synthesis Downstream of RIP1 Kinase Activation during Necroptosis
T1 0-84 Sentence denotes Akt Regulates TNFα Synthesis Downstream of RIP1 Kinase Activation during Necroptosis
T2 85-132 Sentence denotes Interplay of Akt and JNK in Necroptosis Control
T3 134-142 Sentence denotes Abstract
T61 143-348 Sentence denotes Necroptosis is a regulated form of necrotic cell death that has been implicated in the pathogenesis of various diseases including intestinal inflammation and systemic inflammatory response syndrome (SIRS).
T4 143-348 Sentence denotes Necroptosis is a regulated form of necrotic cell death that has been implicated in the pathogenesis of various diseases including intestinal inflammation and systemic inflammatory response syndrome (SIRS).
T62 349-488 Sentence denotes In this work, we investigated the signaling mechanisms controlled by the necroptosis mediator receptor interacting protein-1 (RIP1) kinase.
T5 349-488 Sentence denotes In this work, we investigated the signaling mechanisms controlled by the necroptosis mediator receptor interacting protein-1 (RIP1) kinase.
T63 489-604 Sentence denotes We show that Akt kinase activity is critical for necroptosis in L929 cells and plays a key role in TNFα production.
T6 489-604 Sentence denotes We show that Akt kinase activity is critical for necroptosis in L929 cells and plays a key role in TNFα production.
T64 605-708 Sentence denotes During necroptosis, Akt is activated in a RIP1 dependent fashion through its phosphorylation on Thr308.
T7 605-708 Sentence denotes During necroptosis, Akt is activated in a RIP1 dependent fashion through its phosphorylation on Thr308.
T65 709-812 Sentence denotes In L929 cells, this activation requires independent signaling inputs from both growth factors and RIP1.
T8 709-812 Sentence denotes In L929 cells, this activation requires independent signaling inputs from both growth factors and RIP1.
T66 813-919 Sentence denotes Akt controls necroptosis through downstream targeting of mammalian Target of Rapamycin complex 1 (mTORC1).
T9 813-919 Sentence denotes Akt controls necroptosis through downstream targeting of mammalian Target of Rapamycin complex 1 (mTORC1).
T67 920-1029 Sentence denotes Akt activity, mediated in part through mTORC1, links RIP1 to JNK activation and autocrine production of TNFα.
T10 920-1029 Sentence denotes Akt activity, mediated in part through mTORC1, links RIP1 to JNK activation and autocrine production of TNFα.
T68 1030-1200 Sentence denotes In other cell types, such as mouse lung fibroblasts and macrophages, Akt exhibited control over necroptosis-associated TNFα production without contributing to cell death.
T11 1030-1200 Sentence denotes In other cell types, such as mouse lung fibroblasts and macrophages, Akt exhibited control over necroptosis-associated TNFα production without contributing to cell death.
T69 1201-1351 Sentence denotes Overall, our results provide new insights into the mechanism of necroptosis and the role of Akt kinase in both cell death and inflammatory regulation.
T12 1201-1351 Sentence denotes Overall, our results provide new insights into the mechanism of necroptosis and the role of Akt kinase in both cell death and inflammatory regulation.
T13 1353-1365 Sentence denotes Introduction
T880 1366-1466 Sentence denotes Necroptosis is a form of regulated cell death that displays all the major hallmarks of necrosis [1].
T14 1366-1466 Sentence denotes Necroptosis is a form of regulated cell death that displays all the major hallmarks of necrosis [1].
T881 1467-1726 Sentence denotes A growing number of studies have implicated necroptosis in a wide range of animal models of human disease, including brain, heart and retinal ischemia-reperfusion injury, acute pancreatitis, brain trauma, retinal detachment, and Huntington’s disease [2], [3].
T15 1467-1726 Sentence denotes A growing number of studies have implicated necroptosis in a wide range of animal models of human disease, including brain, heart and retinal ischemia-reperfusion injury, acute pancreatitis, brain trauma, retinal detachment, and Huntington’s disease [2], [3].
T882 1727-1912 Sentence denotes Importantly, several recent studies have linked necroptosis to models of inflammation including intestinal inflammation and systemic inflammatory response syndrome (SIRS) [4], [5], [6].
T16 1727-1912 Sentence denotes Importantly, several recent studies have linked necroptosis to models of inflammation including intestinal inflammation and systemic inflammatory response syndrome (SIRS) [4], [5], [6].
T883 1913-2078 Sentence denotes The discovery of a regulated form of necrotic death could uncover molecular targets amenable to pharmacological intervention for the treatment of various conditions.
T17 1913-2078 Sentence denotes The discovery of a regulated form of necrotic death could uncover molecular targets amenable to pharmacological intervention for the treatment of various conditions.
T884 2079-2236 Sentence denotes A complex consisting of two related Ser/Thr kinases, RIP1 and RIP3, plays a critical role in the initiation of necroptosis in multiple systems [7], [8], [9].
T18 2079-2236 Sentence denotes A complex consisting of two related Ser/Thr kinases, RIP1 and RIP3, plays a critical role in the initiation of necroptosis in multiple systems [7], [8], [9].
T885 2237-2475 Sentence denotes A recent genome wide siRNA screen for mediators of necroptosis induced by the pan-caspase inhibitor zVAD.fmk in mouse fibrosarcoma L929 cells, revealed a broad and diverse cellular network of 432 genes that may regulate this process [10].
T19 2237-2475 Sentence denotes A recent genome wide siRNA screen for mediators of necroptosis induced by the pan-caspase inhibitor zVAD.fmk in mouse fibrosarcoma L929 cells, revealed a broad and diverse cellular network of 432 genes that may regulate this process [10].
T886 2476-2661 Sentence denotes These data provided important confirmation of the highly regulated nature of necroptosis and revealed the first insight into the full repertoire of mediators of this form of cell death.
T20 2476-2661 Sentence denotes These data provided important confirmation of the highly regulated nature of necroptosis and revealed the first insight into the full repertoire of mediators of this form of cell death.
T887 2662-2796 Sentence denotes However, the specific signaling pathways activated during necroptosis and their connections to RIP1 and RIP3 remain poorly understood.
T21 2662-2796 Sentence denotes However, the specific signaling pathways activated during necroptosis and their connections to RIP1 and RIP3 remain poorly understood.
T888 2797-2976 Sentence denotes Several recent studies [10], [11], [12], [13], [14] have suggested that JNK kinase activation plays an important role during necroptosis in L929 cells downstream from RIP1 kinase.
T22 2797-2976 Sentence denotes Several recent studies [10], [11], [12], [13], [14] have suggested that JNK kinase activation plays an important role during necroptosis in L929 cells downstream from RIP1 kinase.
T889 2977-3118 Sentence denotes For example, the transcription factor c-Jun, a key cellular target of JNK activity, was one of the hits in the genome wide siRNA screen [10].
T23 2977-3118 Sentence denotes For example, the transcription factor c-Jun, a key cellular target of JNK activity, was one of the hits in the genome wide siRNA screen [10].
T890 3119-3294 Sentence denotes Activation of JNK in L929 cells has been linked to autocrine TNFα synthesis, activation of oxidative stress and induction of autophagy, all of which contribute to necroptosis.
T24 3119-3294 Sentence denotes Activation of JNK in L929 cells has been linked to autocrine TNFα synthesis, activation of oxidative stress and induction of autophagy, all of which contribute to necroptosis.
T891 3295-3446 Sentence denotes Importantly, RIP1 kinase dependent activation of JNK and TNFα production has recently been described to be independent of its role in necroptosis [15].
T25 3295-3446 Sentence denotes Importantly, RIP1 kinase dependent activation of JNK and TNFα production has recently been described to be independent of its role in necroptosis [15].
T5280 3308-10171 Sentence denotes RIP1 kinase dependent activation of JNK and TNFα production has recently been described to be independent of its role in necroptosis [15]. Curiously, Akt kinase, a key pro-survival molecule and a well-established inhibitor of apoptotic cell death, has also recently been linked to necroptosis in L929 cells [16], where insulin-dependent activation of Akt was suggested to promote necroptosis by suppressing autophagy. This conclusion was unexpected, since several reports from different groups, including ours, have established that autophagy promotes, rather than suppresses, zVAD.fmk-induced necroptosis in L929 cells [11], [14], [17]. This raised the possibility that Akt controls more general mechanisms that contribute to the execution of necroptosis. Furthermore, the key question of whether insulin-dependent Akt activity solely provides an environment conducive for necroptosis or if Akt activation is an intrinsic component of necroptosis signaling that is linked to RIP1 kinase has not been explored. In this study, we expanded these observations to delineate the specific contributions and molecular ordering of the Akt and JNK pathways downstream from RIP1 kinase during necroptosis. Our data reveal that Akt is activated through RIP1 kinase-dependent Thr308 phosphorylation during necroptosis in multiple cell types. Furthermore, we found that downstream Akt signaling through mTORC1 and S6 contributes to the activation of necroptosis and TNFα production. We found that the Akt pathway serves as a critical link between RIP1 kinase and JNK activation in L929 cells. Further data suggested that in multiple other cell types including FADD deficient Jurkat cells, RAW and J774.1 macrophage cell lines, and mouse lung fibroblasts Akt provides a key link to TNFα production, but is dispensible for cell death per se. Overall, our results reveal a specific and novel role for the Akt pathway in regulated necrosis and necrosis-associated inflammatory signaling. Results Basic Fibroblast Growth Factor Promotes Necroptosis in L929 Cells It has been established that mouse fibrosarcoma L929 cells undergo necroptotic cell death following stimulation with TNFα [10], [17]. In addition, inhibition of caspase-8 activity alone, either through siRNA knockdown or by using the pan-caspase inhibitor, zVAD.fmk, is sufficient to trigger necroptosis in these cells [10], [14]. Interestingly, while necroptosis was initially identified as a back-up form of cell death triggered by pro-apoptotic stimuli in the presence of apoptosis inhibitors [17], recent analysis of physiological cell death during mouse development has suggested that the loss of apoptotic regulators, such as caspase-8 and FADD [18], [19], [20], leads to robust induction of necroptosis and death of E10.5 embryos even though apoptosis is not normally induced in wild type embryos. These data are reminiscent of the observations in L929 cells where the loss of caspase activity in healthy cells is sufficient to trigger necroptosis and prompted us to explore the extrinsic or intrinsic cellular factors that promote necroptosis once caspase-8 activity, which cleaves and inactivates RIP1 kinase and the RIP1 deubiquitinase CYLD [21], [22], is removed in L929 cells. Consistent with a previous report [16], we found that serum starvation of L929 cells prevented necroptosis in response to zVAD.fmk (Fig. 1A). The addition of growth factors, such as bFGF, restored zVAD.fmk induced death under serum free conditions (Fig. 1B). Interestingly, this does not reflect a generic requirement for growth factor signaling, as only some growth factors (bFGF and IGF-1, but not EGF and PDGF) promoted death (Fig. 1B). Furthermore, growth factor-dependent necroptosis required the inhibition of caspase activity, as bFGF alone did not induce cell death (Fig. 1C). In contrast, TNFα triggered necroptosis equally efficiently in the absence of serum (Fig. 1A), suggesting that either growth factors and zVAD.fmk or TNFα are required for necroptotic death in L929 cells. 10.1371/journal.pone.0056576.g001 Figure 1 bFGF and IGF-1 promote necroptosis in concert with zVAD.fmk. (A) L929 cells were treated with TNFα or zVAD.fmk under normal serum (10% FBS) or serum free conditions. Cell viability was determined after 24 hr using the CellTiter-Glo Viability assay. The concentrations of all necroptosis-inducing agents are listed in the Materials and Methods section or indicated in the figures. (B) Cells were treated with zVAD.fmk, the indicated growth factors, and Nec-1 under serum free conditions for 24 hrs followed by measurement of cell viability. (C) Cells under serum free conditions were treated with FGF, zVAD.fmk, or both for 24 hrs followed by viability assay. (D) Cell death was induced by zVAD.fmk or TNFα under full serum condition in the presence of 2 µM PD173074 and 20 µM PD166866. In all graphs, average±SD was plotted. Previously we described the development of 7-Cl-O-Nec-1 (Nec-1) as a potent and selective inhibitor of RIP1 kinase and necroptosis (Fig. S1A) [23], [24]. Recently, its selectivity has been further validated against a panel of more than 400 human kinases [15]. This inhibitor efficiently blocked growth factor/zVAD.fmk-induced necroptosis under serum free conditions in L929 cells and both zVAD.fmk and TNFα-induced necroptosis under full serum conditions (Fig. 1B, S1B). To further validate the role of RIP1, we used an inactive analog, 7-Cl-O-Nec-1i (Nec-1i) (Fig. S1A), which contains an extra N-methyl group that leads to almost complete loss of RIP1 kinase inhibitory activity in vitro [23]. Nec-1i was unable to protect L929 cell death under serum condtions treated with zVAD.fmk or TNFα (Fig. S1B) or serum free conditions treated with bFGF/zVAD.fmk (Fig. S1C). This confirms that RIP1 kinase is responsible for necroptosis in L929 cells under both serum and serum free conditions. We next examined whether bFGF contributes to zVAD.fmk-induced necroptosis under normal serum conditions (10% FBS). We used two bFGF receptor tyrosine kinase inhibitors (PD173074 and PD166866), and determined that inhibition of bFGF signaling strongly inhibited zVAD.fmk-induced necroptosis under normal serum conditions (Fig. 1D). In contrast, neither bFGF receptor inhibitor was able to attenuate TNFα-induced necroptosis (Fig. 1D), consistent with growth factors being dispensable for this pathway (Fig. 1A). Overall, these data suggest that the induction of necroptosis by zVAD.fmk is promoted by bFGF under both serum and serum free conditions. The induction of necroptosis, however, is not a simple consequence of growth factor signaling since not all growth factors allowed death to occur. Instead, specific signaling events mediated by particular growth factors appear to contribute to necroptotic death. RIP1 Kinase-dependent Activation of Akt Contributes to Necroptosis
T892 3447-3725 Sentence denotes Curiously, Akt kinase, a key pro-survival molecule and a well-established inhibitor of apoptotic cell death, has also recently been linked to necroptosis in L929 cells [16], where insulin-dependent activation of Akt was suggested to promote necroptosis by suppressing autophagy.
T26 3447-3725 Sentence denotes Curiously, Akt kinase, a key pro-survival molecule and a well-established inhibitor of apoptotic cell death, has also recently been linked to necroptosis in L929 cells [16], where insulin-dependent activation of Akt was suggested to promote necroptosis by suppressing autophagy.
T893 3726-3945 Sentence denotes This conclusion was unexpected, since several reports from different groups, including ours, have established that autophagy promotes, rather than suppresses, zVAD.fmk-induced necroptosis in L929 cells [11], [14], [17].
T27 3726-3945 Sentence denotes This conclusion was unexpected, since several reports from different groups, including ours, have established that autophagy promotes, rather than suppresses, zVAD.fmk-induced necroptosis in L929 cells [11], [14], [17].
T894 3946-4064 Sentence denotes This raised the possibility that Akt controls more general mechanisms that contribute to the execution of necroptosis.
T28 3946-4064 Sentence denotes This raised the possibility that Akt controls more general mechanisms that contribute to the execution of necroptosis.
T895 4065-4318 Sentence denotes Furthermore, the key question of whether insulin-dependent Akt activity solely provides an environment conducive for necroptosis or if Akt activation is an intrinsic component of necroptosis signaling that is linked to RIP1 kinase has not been explored.
T29 4065-4318 Sentence denotes Furthermore, the key question of whether insulin-dependent Akt activity solely provides an environment conducive for necroptosis or if Akt activation is an intrinsic component of necroptosis signaling that is linked to RIP1 kinase has not been explored.
T896 4319-4503 Sentence denotes In this study, we expanded these observations to delineate the specific contributions and molecular ordering of the Akt and JNK pathways downstream from RIP1 kinase during necroptosis.
T30 4319-4503 Sentence denotes In this study, we expanded these observations to delineate the specific contributions and molecular ordering of the Akt and JNK pathways downstream from RIP1 kinase during necroptosis.
T897 4504-4637 Sentence denotes Our data reveal that Akt is activated through RIP1 kinase-dependent Thr308 phosphorylation during necroptosis in multiple cell types.
T31 4504-4637 Sentence denotes Our data reveal that Akt is activated through RIP1 kinase-dependent Thr308 phosphorylation during necroptosis in multiple cell types.
T13706 4550-30921 Sentence denotes RIP1 kinase-dependent Thr308 phosphorylation during necroptosis in multiple cell types. Furthermore, we found that downstream Akt signaling through mTORC1 and S6 contributes to the activation of necroptosis and TNFα production. We found that the Akt pathway serves as a critical link between RIP1 kinase and JNK activation in L929 cells. Further data suggested that in multiple other cell types including FADD deficient Jurkat cells, RAW and J774.1 macrophage cell lines, and mouse lung fibroblasts Akt provides a key link to TNFα production, but is dispensible for cell death per se. Overall, our results reveal a specific and novel role for the Akt pathway in regulated necrosis and necrosis-associated inflammatory signaling. Results Basic Fibroblast Growth Factor Promotes Necroptosis in L929 Cells It has been established that mouse fibrosarcoma L929 cells undergo necroptotic cell death following stimulation with TNFα [10], [17]. In addition, inhibition of caspase-8 activity alone, either through siRNA knockdown or by using the pan-caspase inhibitor, zVAD.fmk, is sufficient to trigger necroptosis in these cells [10], [14]. Interestingly, while necroptosis was initially identified as a back-up form of cell death triggered by pro-apoptotic stimuli in the presence of apoptosis inhibitors [17], recent analysis of physiological cell death during mouse development has suggested that the loss of apoptotic regulators, such as caspase-8 and FADD [18], [19], [20], leads to robust induction of necroptosis and death of E10.5 embryos even though apoptosis is not normally induced in wild type embryos. These data are reminiscent of the observations in L929 cells where the loss of caspase activity in healthy cells is sufficient to trigger necroptosis and prompted us to explore the extrinsic or intrinsic cellular factors that promote necroptosis once caspase-8 activity, which cleaves and inactivates RIP1 kinase and the RIP1 deubiquitinase CYLD [21], [22], is removed in L929 cells. Consistent with a previous report [16], we found that serum starvation of L929 cells prevented necroptosis in response to zVAD.fmk (Fig. 1A). The addition of growth factors, such as bFGF, restored zVAD.fmk induced death under serum free conditions (Fig. 1B). Interestingly, this does not reflect a generic requirement for growth factor signaling, as only some growth factors (bFGF and IGF-1, but not EGF and PDGF) promoted death (Fig. 1B). Furthermore, growth factor-dependent necroptosis required the inhibition of caspase activity, as bFGF alone did not induce cell death (Fig. 1C). In contrast, TNFα triggered necroptosis equally efficiently in the absence of serum (Fig. 1A), suggesting that either growth factors and zVAD.fmk or TNFα are required for necroptotic death in L929 cells. 10.1371/journal.pone.0056576.g001 Figure 1 bFGF and IGF-1 promote necroptosis in concert with zVAD.fmk. (A) L929 cells were treated with TNFα or zVAD.fmk under normal serum (10% FBS) or serum free conditions. Cell viability was determined after 24 hr using the CellTiter-Glo Viability assay. The concentrations of all necroptosis-inducing agents are listed in the Materials and Methods section or indicated in the figures. (B) Cells were treated with zVAD.fmk, the indicated growth factors, and Nec-1 under serum free conditions for 24 hrs followed by measurement of cell viability. (C) Cells under serum free conditions were treated with FGF, zVAD.fmk, or both for 24 hrs followed by viability assay. (D) Cell death was induced by zVAD.fmk or TNFα under full serum condition in the presence of 2 µM PD173074 and 20 µM PD166866. In all graphs, average±SD was plotted. Previously we described the development of 7-Cl-O-Nec-1 (Nec-1) as a potent and selective inhibitor of RIP1 kinase and necroptosis (Fig. S1A) [23], [24]. Recently, its selectivity has been further validated against a panel of more than 400 human kinases [15]. This inhibitor efficiently blocked growth factor/zVAD.fmk-induced necroptosis under serum free conditions in L929 cells and both zVAD.fmk and TNFα-induced necroptosis under full serum conditions (Fig. 1B, S1B). To further validate the role of RIP1, we used an inactive analog, 7-Cl-O-Nec-1i (Nec-1i) (Fig. S1A), which contains an extra N-methyl group that leads to almost complete loss of RIP1 kinase inhibitory activity in vitro [23]. Nec-1i was unable to protect L929 cell death under serum condtions treated with zVAD.fmk or TNFα (Fig. S1B) or serum free conditions treated with bFGF/zVAD.fmk (Fig. S1C). This confirms that RIP1 kinase is responsible for necroptosis in L929 cells under both serum and serum free conditions. We next examined whether bFGF contributes to zVAD.fmk-induced necroptosis under normal serum conditions (10% FBS). We used two bFGF receptor tyrosine kinase inhibitors (PD173074 and PD166866), and determined that inhibition of bFGF signaling strongly inhibited zVAD.fmk-induced necroptosis under normal serum conditions (Fig. 1D). In contrast, neither bFGF receptor inhibitor was able to attenuate TNFα-induced necroptosis (Fig. 1D), consistent with growth factors being dispensable for this pathway (Fig. 1A). Overall, these data suggest that the induction of necroptosis by zVAD.fmk is promoted by bFGF under both serum and serum free conditions. The induction of necroptosis, however, is not a simple consequence of growth factor signaling since not all growth factors allowed death to occur. Instead, specific signaling events mediated by particular growth factors appear to contribute to necroptotic death. RIP1 Kinase-dependent Activation of Akt Contributes to Necroptosis Given our observation that growth factors are important for zVAD.fmk induced death, we examined the contribution of several pathways, including MAPK pathways and Akt, which are known to be activated following growth factor receptor activation (Fig. 2A). Inhibition of Akt (Akt inhibitor VIII) strongly protected the cells from growth factor-sensitive necroptosis induced by zVAD.fmk [16] as well as cell death triggered by bFGF or IGF-1/zVAD.fmk under serum free conditions (Fig. 2B). Inhibition of Akt also protected the cells from growth-factor insensitive death by caused by TNFα (Fig. 2A). Consistent with previous reports, the JNK inhibitor SP600125 protected the cells from both zVAD.fmk and TNFα induced death (Fig. 2A,B and Fig. S2A) [12], [14]. In contrast, inhibition of two other MAPKs, p38 and ERK, previously reported not to be activated during necroptosis [14], did not protect from either zVAD.fmk or TNFα induced death (Fig. 2A). 10.1371/journal.pone.0056576.g002 Figure 2 Akt contributes to necroptosis induced by zVAD.fmk and TNFα. (A,B) Necroptosis was induced by zVAD.fmk or TNFα (full serum, A) or growth factors/zVAD.fmk (serum free, B) in the presence of inhibitors of Akt (Akt inhibitor VIII), JNK (SP600125), p38 (PD169316), and Erk (UO126). Cell viability was determined after 24 hrs. (C) L929 cells transfected with Akt1, Akt2, and Akt3 siRNAs for 72 hrs were treated with zVAD.fmk or TNFα for 9 hrs. Cell viability and Akt expression levels were determined after 24 hrs. In all graphs, average±SD was plotted. Next, we used two approaches to further validate the role of Akt in necroptotic cell death. First, two additional Akt inhibitors, a highly specific, allosteric kinase inhibitor MK-2206 [25] and triciribine (TCN) [26], which blocks membrane translocation of Akt, both attenuated cell death (Fig. S2B). Secondly, simultaneous knockdown of Akt isoforms Akt1 and Akt2 using siRNAs protected cells from necroptosis induced by both zVAD.fmk and TNFα (Fig. 2C). No expression of Akt3 was seen in L929 cells (Fig. S2C) and, consistently, Akt3 siRNA had no additional effect on necroptosis. Our results confirmed that Akt plays a key role in necroptosis induced by multiple stimuli in L929 cells. To understand the activation of Akt and JNK under necroptotic conditions, we examined the changes in Akt and JNK phosphorylation at 9 hrs post zVAD.fmk and TNFα stimulation. This time point was chosen because it reflects the early stage of cell death in our system (Fig. S3A, B). Following stimulation with either zVAD.fmk or TNFα we observed a robust increase in Akt phosphorylation at a known major activation site, Thr308 (Fig. 3A). Interestingly, we did not observe concomitant phosphorylation changes in the second major activation site of Akt, Ser473. We also observed an increase in the phosphorylation of both the p46 and p54 isoforms of JNK and its major substrate c-Jun (Fig. 3A). These data indicate that both Akt and JNK are activated under necroptotic conditions. 10.1371/journal.pone.0056576.g003 Figure 3 RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis. (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr, followed by western blotting with indicated antibodies. (B,C) L929 cells were treated with zVAD.fmk (B) or bFGF/zVAD.fmk (serum free conditions, C) and samples were collected at the indicated time points for western blot. (D) Nec-1 was added to the cells stimulated with bFGF or bFGF/zVAD (serum free conditions) for 15 min or 9 hr followed by western blot with the indicated antibodies. The RIP1 kinase inhibitor, Nec-1, completely prevented the increase in Thr308 Akt phosphorylation, while Nec-1i did not (Fig. 3A, Fig. S1D). Similarly, Nec-1 prevented the induction of JNK phosphorylation in response to zVAD.fmk and substantially reduced this change after TNFα addition. We observed some changes in total protein levels of JNK and c-Jun following necroptotic stimulation. Some of these changes, e.g. zVAD.fmk-induced increase in c-Jun, were also attenuated by Nec-1. Importantly, Nec-1 did not alter the basal phosphorylation levels of either Akt or JNK (Fig. 3A). This established that Akt Thr308 and JNK phosphorylation during necroptosis is RIP1 dependent. Interestingly, we discovered that the phosphorylation of Akt Thr308, JNK and Jun are late events following zVAD.fmk stimulation (Fig. 3B) that coincide with the onset of necroptosis at 6 hr post-stimulation (Fig. S3A). To better understand the contributions of growth factors and RIP1 kinase to necroptotic regulation of Akt, we next analyzed the time course of these phosphorylation changes under serum free conditions. We found that the addition of bFGF alone or in combination with zVAD.fmk led to a substantial rapid and transient increase in both Thr308 and Ser473 phosphorylation of Akt as well as JNK and c-Jun at 15 minutes, reflecting the expected response to growth factor stimulation (Fig. 3C). Significantly, the combination of bFGF/zVAD.fmk, but not bFGF alone, also caused a robust, second, delayed increase in the phosphorylation of Thr308, but not Ser473, of Akt as well as a delayed increase in the phosphorylation of JNK and Jun. Furthermore, Nec-1 had no significant effect on the early increase in both Akt and JNK/c-Jun phosphorylation triggered by both bFGF and bFGF/zVAD, while Nec-1, but not its inactive analog Nec-1i (Fig. S1E), efficiently blocked the bFGF/zVAD increase at 6–9 hr (Fig. 3D), suggesting that only the delayed activation of Akt and JNK is specific for necroptosis and dependent on RIP1 kinase activity. Similarly, IGF/zVAD, which also promoted cell death under serum free conditions, produced a delayed increase in Thr308 phosphorylation on Akt, while IGF alone caused solely an early, transient increase in phosphorylation (Fig. S3C). We confirmed the kinetics of the Akt Thr308 and Ser473 phosphorylation changes using a quantitative ELISA assay, which also showed a robust delayed necroptosis-specific RIP1-dependent increase in Akt Thr308 phosphorylation (Fig. S3D, E). Taken together, these results indicate that the observed delayed increases in Akt and JNK phosphorylation, preceding the onset of cell death, represent specific consequences of necroptotic signaling downstream from RIP1 kinase. TNFα Induces Delayed Akt Thr308 Phosphorylation and Necroptosis Independent of Growth Factor Stimulation Consistent with TNFα inducing necroptosis independently of growth factors (Fig. 1A), FGFR inhibitors did not attenuate TNFα-induced changes in Akt or JNK phosphorylation, while efficiently preventing these changes in response to zVAD.fmk (Fig. S4A). Furthermore, addition of TNFα led to comparable late activation of Akt p308 signal under both normal and serum free conditions (Fig. S4B, C), indicating that TNFα signaling to Akt Thr308 is growth factor-independent. In contrast, activation of JNK by TNFα followed different kinetics from zVAD.fmk-induced changes. TNFα treatment caused an early and robust increase in the phosphorylation of JNK and c-Jun. Nec-1 did not affect this early increase, however, it reduced levels of pJNK/Jun at the late, 9 hr time point (Fig. S4B, C). This again separated early RIP1-independent changes, which likely reflect the ability of additional upstream kinases, such as Ask1 to activate JNK [27], from the late RIP1 kinase-dependent necroptotic signaling. Late Increase in Akt Thr308 Phosphorylation Contributes to the Induction of Necroptotic Cell Death We next investigated if the delayed RIP1 kinase-dependent increase in Akt Thr308 phosphorylation functionally contributes to the execution of necroptotic cell death. Firstly, PDGF/zVAD.fmk, which cannot induce necroptosis (Fig. 2A), triggered only the initial, rapid Akt and JNK phosphorylation changes and not the delayed activation (Fig. 4A), indicating that late, rather than early Akt phosphorylation correlates with necroptosis. Secondly, we saw that the ability of the Akt inhibitor to protect cells from necroptosis rapidly declined after 6 hrs of stimulation with zVAD.fmk, TNFα or bFGF/zVAD.fmk and no protection was observed when the inhibitor was added at 9 hrs (Fig. 4B,C). This time frame coincides with the timing of the secondary Akt Thr308 phosphorylation. Finally, we terminated the bFGF signal one hour after addition of bFGF by the addition of PD173074. This allowed us to retain early Akt activation, but to suppress the secondary increase (Fig. 4D). Both pre-addition and delayed addition of PD173074 fully prevented necroptosis (Fig. 4E). Overall, these data, while correlative, indicate that early Akt activation is insufficient to promote necroptosis and are strongly supportive of an important role for the delayed activation of Akt in the induction of necroptotic cell death. 10.1371/journal.pone.0056576.g004 Figure 4 Late Thr308 phosphorylation of Akt contributes to necroptosis. (A) L929 cells were treated with zVAD.fmk and bFGF or PDGF, with or without Nec-1, for the indicated periods of time. (B,C) L929 cells were stimulated by zVAD.fmk or TNFα (B) or bFGF/zVAD.fmk under serum free conditions (C). Akt inh. VIII was added 15 min before necroptotic stimulation (Pre) or at indicated times after stimulation. Viability was measured 24 hr after activation of necroptosis. (D) L929 cells were stimulated with bFGF/zVAD under serum free conditions. PD173074 was added 15 min before or 1 hr after FGF/zVAD. Samples for western blot were collected at 15 min and 9 hr time points. (E) Cells were pretreated with PD173074 or it was added 1 hr after bFGF/zVAD.fmk, followed by viability assessment at 24 hr. In all graphs, average±SD was plotted. The Akt Signaling Pathway Contributes to the Regulation of Necroptosis We next determined whether the necroptosis-associated increase in Thr308 phosphorylation results in an increase in Akt kinase activity. Under necroptotic conditions, we observed an increase in the phosphorylation of multiple known Akt substrates (Forkhead box class O (FoxO) proteins, GSK-3 kinases and mouse double minute 2 (MDM2)) as well as downstream molecules (p70 ribosomal protein S6 Kinase (p70S6K), S6) (Fig. 5A). In some cases (FoxO1, FoxO4, MDM2), a robust increase was observed. In other cases (FoxO3a, GSK-3α/β, p70S6K and its substrate S6), the changes were less pronounced (Fig. 5A). The timing of the phosphorylation changes paralleled the increase in Akt phosphorylation (Fig. 5B, S5A, B). In the case of pFoxO1 we occasionally observed a shift in migration rather than an increase in band intensity (e.g. comparing Fig. 5A and B), suggesting that phosphorylation events in addition to Thr24 take place during necroptosis. Notably, in all cases the necroptosis-associated increases in Akt substrates were abrogated by Nec-1 (Fig. 5A, Fig. S5A, B). Overall, these data suggested that a significant part of the “canonical” Akt signaling network is activated at the onset of necroptotic cell death in a RIP1 dependent fashion. 10.1371/journal.pone.0056576.g005 Figure 5 mTORC1 contributes to the regulation of necroptosis. (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr and harvested for western blot. (B) Cell under serum free condition were treated with bFGF or bFGF/zVAD.fmk for the indicated amounts of time, followed by western blotting using the indicated antibodies. (C) Necroptosis was induced by zVAD.fmk or TNFα in L929 cell in the presence of inhibitors of Akt(Akt inh. VIII) and mTOR (rapamycin, Torin-1 and PI-103). (D) L929 cells with mTOR siRNA knockdown were harvested for western blot or treated with zVAD.fmk or TNFα for 24 hrs. Cell viability was determined 24 hr after activation of necroptosis. In all graphs, average±SD was plotted. Akt kinase is considered to be a pro-survival protein that inhibits apoptosis through the control of multiple effectors including mTORC1, GSK-3 and others [28]. An important question is whether these same molecules reverse their pro-survival roles during necroptosis. We found that inhibition of mTORC1 by rapamycin, an inhibitor of the mTOR co-factor Raptor [29], protected cells from necroptosis (Fig. 5C). Similarly, the direct mTOR kinase inhibitor Torin1 [30] and the dual PI3K/mTOR inhibitor PI-103 [31] also efficiently inhibited necroptosis (Fig. 5C). Knockdown of mTOR using siRNA further validated the small-molecule inhibitor data indicating a role for mTOR in necroptosis by protecting cells from both zVAD.fmk and TNFα induced death (Fig. 5D). mTORC1 regulates translation through activation of p70S6 kinase and, subsequently, ribosomal protein S6 [32]. Notably, a genome-wide siRNA screen [10] suggested an important role for protein translation in necroptosis. Consistently, we found that the small molecule inhibitor of p70S6K PF-4708671 [33] attenuated necroptosis at the concentrations required to block S6 phosphorylation (Fig. S5C, D). Partial siRNA knockdown of S6 protein attenuated necroptosis as well (Fig. S5E), suggesting that translational control by p70S6K/S6 may play a role in necroptosis. Overall, while the full repertoire of Akt targets during necroptosis remains to be fully explored, our data provide evidence that the activity of an anti-apoptotic branch of Akt signaling can promote necroptosis. RIP1 kinase, Akt, mTORC1 and JNK control the upregulation of TNFα accompanying necroptosis. Hitomi et al. [10] have recently reported that the induction of necroptosis by zVAD.fmk in L929 cells is associated with increased synthesis of TNFα, which potentiates cell death. Therefore, we examined whether Akt and its effectors contribute to TNFα synthesis. Consistent with a RIP1-dependent increase in TNFα protein (Fig. S6A, B), we found that TNFα mRNA levels increased during necroptosis in L929 cells in a RIP1 (Fig. S6C. Under serum free conditions, bFGF alone triggered some induction of TNFα mRNA, while its combination with zVAD.fmk (but not zVAD.fmk alone) caused a pronounced further increase (Fig. 6A). Conversely, PDGF caused a modest upregulation of TNFα mRNA, which was not further increased in the presence of zVAD.fmk (Fig. 6A), demonstrating that activation of necroptosis is specifically accompanied by a marked increase in autocrine TNFα synthesis. 10.1371/journal.pone.0056576.g006 Figure 6 Akt and mTORC1 control autocrine TNFα synthesis and JNK activation during necroptosis. (A) Cells were treated under serum free conditions with bFGF or PDGF with or without zVAD.fmk for 9 hr, followed by qRT-PCR analysis of mTNFα. Data was normalized to mouse 18S RNA. (B) Necroptosis was induced by zVAD.fmk or TNFα in cells treated with Nec-1, rapamycin (rapa), or Akt inh. VIII inh. followed by qRT-PCR analysis of TNFα mRNA levels. (C-F) L929 cells with siRNA knockdown of Akt isoforms (C,E) or mTOR (D,F) were stimulated with zVAD.fmk or TNFα for 9 hr, followed by qRT-PCR analysis of mTNFα (C,D) or western blot (E,F). In all graphs, average±SD was plotted. Further analysis suggested that both Akt and mTORC1 contribute to the upregulation of TNFα mRNA during necroptosis as both small-molecule inhibition and siRNA knockdown of Akt and mTOR reduced TNFα mRNA levels in necroptotic cells (Fig. 6B,C,D). Notably, RIP1 and Akt inhibitors had no effect on the levels of TNFα mRNA in control cells or in the cells stimulated with bFGF alone (Fig. 6A,B, Fig. S6C), suggesting that these kinases specifically mediate necroptosis-dependent increase in TNFα synthesis. Akt and mTORC1 Control the Activation of JNK during Necroptosis JNK is a well-established regulator of TNFα synthesis in a variety of systems [13], [14], [15], [34]. Therefore, the ability of Akt and mTORC1 inhibitors to block the increase in TNFα mRNA lead us to examine their role in the activation of JNK during necroptosis. Knockdown of Akt isoforms Akt1 and Akt2 or inhibition of Akt prominently suppressed the necroptosis dependent increase in JNK and c-Jun phosphorylation (Fig. 6E, S6D,E) suggesting that Akt may provide a link between RIP1 and JNK activation. Importantly, inhibition of Akt only inhibited the delayed, but not the early, increase in bFGF/zVAD.fmk induced JNK and c-Jun phosphorylation (Fig. S6F). Knockdown of mTOR, rapamycin and the p70S6K inhibitor PF-4708671 also attenuated the necroptosis-associated increase in JNK and c-Jun phosphorylation (Fig. 6F, S6E,G, Fig. S5D). Overall, these data suggested that the Akt-mTORC1-S6K axis, acting downstream from RIP1 kinase, is required for the increase in JNK activity during necroptosis in L929 cells. PI3-kinase and PDK1 Mediate the Increase in Akt Thr308 Phosphorylation Under Necroptotic Conditions Typical regulation of Akt by growth factors involves its recruitment to the plasma membrane, which is mediated by the binding of the pleckstrin homology (PH) domain of Akt to the product of PI3K, phosphatidylinositol-3,4,5-triphosphate (PIP3). In the membrane, Akt is phosphorylated on Thr308 and Ser473 by 3-phosphoinositide dependent protein kinase-1 (PDK1) and mTORC2 (or DNA-PK), respectively [35]. Since our results showed that only Thr308 Akt phosphorylation is increased during necroptosis, we next examined whether it is still dependent on PI3K and PDK1. Inhibition of PI3K and PDK1 using the specific inhibitors LY249002 and BX912 [36] resulted in the efficient inhibition of cell death and Akt Thr308 phosphorylation (Fig. S7A–D). Likewise, siRNA knockdown of PDK1 protected cells from death and inhibited Akt Thr308 phosphorylation (Fig. S7E,F) Therefore, PI3K and PDK1 activity is still required for non-canonical Akt activation during necroptosis. Expression of Constitutively Active Akt, Rescues Necroptosis Under Serum Free Conditions We used L929 cells stably expressing constitutively active wild type Akt1 (Myr-Akt) or the catalytically inactive mutant K179M in order to further understand the contribution of growth factors and RIP1 kinase to Akt activation during necroptosis. Constitutively active Akt1 (Myr-Akt) was generated as previously described [37] by the addition of a myristoylation signal which provides constitutive localization to the plasma membrane and by the deletion of the auto-inhibitory PH domain (Fig. 7A) resulting in an Akt that is active under serum free. It is important to note that the cells expressing Myr-Akt were viable, grew in a manner indistinguishable from the empty vector control cells, and were not triggered to induce necroptosis by serum starvation (Fig. 7B). This indicates that active Akt alone is not sufficient to induce necroptotic cell death. Under serum free conditions Myr-Akt, but not the K179M mutant, fully restored zVAD.fmk-induced necroptosis (Fig. 7A,B). Nec-1 prevented both Myr-Akt dependent cell death and the necroptosis-specific delayed increase in Akt Thr308 phosphorylation (Fig. 7B,C). Myr-Akt also allowed other zVAD.fmk-dependent events, including activation of JNK and c-Jun phosphorylation (Fig. 7C) and upregulation of TNFα mRNA (Fig. 7D) to occur under serum free conditions, confirming an important role for Akt at the apex of necroptotic signaling. These data demonstrated that the presence of active and membrane localized Akt is sufficient to uncouple Akt activation during necroptosis from growth factor signaling. RIP1 kinase was still able to regulate Akt activation during necroptosis, suggesting that growth factors and RIP1 kinase provide two independent inputs required for Akt changes during necroptosis. 10.1371/journal.pone.0056576.g007 Figure 7 Over expression of constitutively active Akt restores necroptosis under serum free conditions. (A,B) L929 cells were stably infected with empty MSCV retrovirus or viruses encoding Myr-Akt or the catalytically inactive Myr-Akt K179M. Necroptosis was induced by the addition of zVAD.fmk under serum free conditions (A) or serum or serum free conditions with Nec-1 (B). Viability assays were performed after 24 hr. (C) Myr-Akt and Myr-Akt K179M cells were treated with zVAD.fmk and/or Nec-1 under serum free conditions for 9 hr, followed by western blot using the indicated antibodies. Endogenous Akt (∼) and Myr-Akt (*) bands are indicated. (D) L929 cells, stably infected with Myr-Akt and Myr-Akt K179KM, were stimulated with zVAD.fmk for 9 hr under serum free conditions. TNFα mRNA levels were determined by qRT-PCR and normalized using mouse 18S RNA. (E-G) L929 cells expressing Myr-Akt and Ala and Asp mutants of Thr308 and Ser473 were treated with zVAD.fmk under serum free conditions, followed by viability assay at 24 hr (E), western blot at 9 hr (F), or evaluation of TNFα mRNA levels by qRT-PCR at 9 hrs (G). In all graphs, average±SD was plotted. RIP1 kinase-dependent Thr308 phosphorylation of Myr-Akt during necroptosis increased Myr-Akt activity as it did with endogenous Akt (Fig. 5).
T898 4638-4777 Sentence denotes Furthermore, we found that downstream Akt signaling through mTORC1 and S6 contributes to the activation of necroptosis and TNFα production.
T32 4638-4777 Sentence denotes Furthermore, we found that downstream Akt signaling through mTORC1 and S6 contributes to the activation of necroptosis and TNFα production.
T899 4778-4887 Sentence denotes We found that the Akt pathway serves as a critical link between RIP1 kinase and JNK activation in L929 cells.
T33 4778-4887 Sentence denotes We found that the Akt pathway serves as a critical link between RIP1 kinase and JNK activation in L929 cells.
T900 4888-5134 Sentence denotes Further data suggested that in multiple other cell types including FADD deficient Jurkat cells, RAW and J774.1 macrophage cell lines, and mouse lung fibroblasts Akt provides a key link to TNFα production, but is dispensible for cell death per se.
T34 4888-5134 Sentence denotes Further data suggested that in multiple other cell types including FADD deficient Jurkat cells, RAW and J774.1 macrophage cell lines, and mouse lung fibroblasts Akt provides a key link to TNFα production, but is dispensible for cell death per se.
T901 5135-5278 Sentence denotes Overall, our results reveal a specific and novel role for the Akt pathway in regulated necrosis and necrosis-associated inflammatory signaling.
T35 5135-5278 Sentence denotes Overall, our results reveal a specific and novel role for the Akt pathway in regulated necrosis and necrosis-associated inflammatory signaling.
T36 5280-5287 Sentence denotes Results
T2972 5289-5354 Sentence denotes Basic Fibroblast Growth Factor Promotes Necroptosis in L929 Cells
T37 5289-5354 Sentence denotes Basic Fibroblast Growth Factor Promotes Necroptosis in L929 Cells
T2973 5355-5488 Sentence denotes It has been established that mouse fibrosarcoma L929 cells undergo necroptotic cell death following stimulation with TNFα [10], [17].
T38 5355-5488 Sentence denotes It has been established that mouse fibrosarcoma L929 cells undergo necroptotic cell death following stimulation with TNFα [10], [17].
T2974 5489-5685 Sentence denotes In addition, inhibition of caspase-8 activity alone, either through siRNA knockdown or by using the pan-caspase inhibitor, zVAD.fmk, is sufficient to trigger necroptosis in these cells [10], [14].
T39 5489-5685 Sentence denotes In addition, inhibition of caspase-8 activity alone, either through siRNA knockdown or by using the pan-caspase inhibitor, zVAD.fmk, is sufficient to trigger necroptosis in these cells [10], [14].
T2975 5686-6159 Sentence denotes Interestingly, while necroptosis was initially identified as a back-up form of cell death triggered by pro-apoptotic stimuli in the presence of apoptosis inhibitors [17], recent analysis of physiological cell death during mouse development has suggested that the loss of apoptotic regulators, such as caspase-8 and FADD [18], [19], [20], leads to robust induction of necroptosis and death of E10.5 embryos even though apoptosis is not normally induced in wild type embryos.
T40 5686-6159 Sentence denotes Interestingly, while necroptosis was initially identified as a back-up form of cell death triggered by pro-apoptotic stimuli in the presence of apoptosis inhibitors [17], recent analysis of physiological cell death during mouse development has suggested that the loss of apoptotic regulators, such as caspase-8 and FADD [18], [19], [20], leads to robust induction of necroptosis and death of E10.5 embryos even though apoptosis is not normally induced in wild type embryos.
T2976 6160-6543 Sentence denotes These data are reminiscent of the observations in L929 cells where the loss of caspase activity in healthy cells is sufficient to trigger necroptosis and prompted us to explore the extrinsic or intrinsic cellular factors that promote necroptosis once caspase-8 activity, which cleaves and inactivates RIP1 kinase and the RIP1 deubiquitinase CYLD [21], [22], is removed in L929 cells.
T41 6160-6543 Sentence denotes These data are reminiscent of the observations in L929 cells where the loss of caspase activity in healthy cells is sufficient to trigger necroptosis and prompted us to explore the extrinsic or intrinsic cellular factors that promote necroptosis once caspase-8 activity, which cleaves and inactivates RIP1 kinase and the RIP1 deubiquitinase CYLD [21], [22], is removed in L929 cells.
T2977 6544-6685 Sentence denotes Consistent with a previous report [16], we found that serum starvation of L929 cells prevented necroptosis in response to zVAD.fmk (Fig. 1A).
T42 6544-6685 Sentence denotes Consistent with a previous report [16], we found that serum starvation of L929 cells prevented necroptosis in response to zVAD.fmk (Fig. 1A).
T2978 6686-6802 Sentence denotes The addition of growth factors, such as bFGF, restored zVAD.fmk induced death under serum free conditions (Fig. 1B).
T43 6686-6802 Sentence denotes The addition of growth factors, such as bFGF, restored zVAD.fmk induced death under serum free conditions (Fig. 1B).
T2979 6803-6983 Sentence denotes Interestingly, this does not reflect a generic requirement for growth factor signaling, as only some growth factors (bFGF and IGF-1, but not EGF and PDGF) promoted death (Fig. 1B).
T44 6803-6983 Sentence denotes Interestingly, this does not reflect a generic requirement for growth factor signaling, as only some growth factors (bFGF and IGF-1, but not EGF and PDGF) promoted death (Fig. 1B).
T2980 6984-7128 Sentence denotes Furthermore, growth factor-dependent necroptosis required the inhibition of caspase activity, as bFGF alone did not induce cell death (Fig. 1C).
T45 6984-7128 Sentence denotes Furthermore, growth factor-dependent necroptosis required the inhibition of caspase activity, as bFGF alone did not induce cell death (Fig. 1C).
T2981 7129-7332 Sentence denotes In contrast, TNFα triggered necroptosis equally efficiently in the absence of serum (Fig. 1A), suggesting that either growth factors and zVAD.fmk or TNFα are required for necroptotic death in L929 cells.
T46 7129-7332 Sentence denotes In contrast, TNFα triggered necroptosis equally efficiently in the absence of serum (Fig. 1A), suggesting that either growth factors and zVAD.fmk or TNFα are required for necroptotic death in L929 cells.
T47 7333-7437 Sentence denotes 10.1371/journal.pone.0056576.g001 Figure 1 bFGF and IGF-1 promote necroptosis in concert with zVAD.fmk.
T28504 7377-7437 Sentence denotes bFGF and IGF-1 promote necroptosis in concert with zVAD.fmk.
T28505 7438-7542 Sentence denotes (A) L929 cells were treated with TNFα or zVAD.fmk under normal serum (10% FBS) or serum free conditions.
T48 7438-7542 Sentence denotes (A) L929 cells were treated with TNFα or zVAD.fmk under normal serum (10% FBS) or serum free conditions.
T28506 7543-7625 Sentence denotes Cell viability was determined after 24 hr using the CellTiter-Glo Viability assay.
T49 7543-7625 Sentence denotes Cell viability was determined after 24 hr using the CellTiter-Glo Viability assay.
T28507 7626-8164 Sentence denotes The concentrations of all necroptosis-inducing agents are listed in the Materials and Methods section or indicated in the figures. (B) Cells were treated with zVAD.fmk, the indicated growth factors, and Nec-1 under serum free conditions for 24 hrs followed by measurement of cell viability. (C) Cells under serum free conditions were treated with FGF, zVAD.fmk, or both for 24 hrs followed by viability assay. (D) Cell death was induced by zVAD.fmk or TNFα under full serum condition in the presence of 2 µM PD173074 and 20 µM PD166866.
T50 7626-8164 Sentence denotes The concentrations of all necroptosis-inducing agents are listed in the Materials and Methods section or indicated in the figures. (B) Cells were treated with zVAD.fmk, the indicated growth factors, and Nec-1 under serum free conditions for 24 hrs followed by measurement of cell viability. (C) Cells under serum free conditions were treated with FGF, zVAD.fmk, or both for 24 hrs followed by viability assay. (D) Cell death was induced by zVAD.fmk or TNFα under full serum condition in the presence of 2 µM PD173074 and 20 µM PD166866.
T28508 8165-8203 Sentence denotes In all graphs, average±SD was plotted.
T51 8165-8203 Sentence denotes In all graphs, average±SD was plotted.
T2982 8204-8357 Sentence denotes Previously we described the development of 7-Cl-O-Nec-1 (Nec-1) as a potent and selective inhibitor of RIP1 kinase and necroptosis (Fig. S1A) [23], [24].
T52 8204-8357 Sentence denotes Previously we described the development of 7-Cl-O-Nec-1 (Nec-1) as a potent and selective inhibitor of RIP1 kinase and necroptosis (Fig. S1A) [23], [24].
T2983 8358-8463 Sentence denotes Recently, its selectivity has been further validated against a panel of more than 400 human kinases [15].
T53 8358-8463 Sentence denotes Recently, its selectivity has been further validated against a panel of more than 400 human kinases [15].
T2984 8464-8674 Sentence denotes This inhibitor efficiently blocked growth factor/zVAD.fmk-induced necroptosis under serum free conditions in L929 cells and both zVAD.fmk and TNFα-induced necroptosis under full serum conditions (Fig. 1B, S1B).
T54 8464-8674 Sentence denotes This inhibitor efficiently blocked growth factor/zVAD.fmk-induced necroptosis under serum free conditions in L929 cells and both zVAD.fmk and TNFα-induced necroptosis under full serum conditions (Fig. 1B, S1B).
T2985 8675-8899 Sentence denotes To further validate the role of RIP1, we used an inactive analog, 7-Cl-O-Nec-1i (Nec-1i) (Fig. S1A), which contains an extra N-methyl group that leads to almost complete loss of RIP1 kinase inhibitory activity in vitro [23].
T55 8675-8899 Sentence denotes To further validate the role of RIP1, we used an inactive analog, 7-Cl-O-Nec-1i (Nec-1i) (Fig. S1A), which contains an extra N-methyl group that leads to almost complete loss of RIP1 kinase inhibitory activity in vitro [23].
T2986 8900-9071 Sentence denotes Nec-1i was unable to protect L929 cell death under serum condtions treated with zVAD.fmk or TNFα (Fig. S1B) or serum free conditions treated with bFGF/zVAD.fmk (Fig. S1C).
T56 8900-9071 Sentence denotes Nec-1i was unable to protect L929 cell death under serum condtions treated with zVAD.fmk or TNFα (Fig. S1B) or serum free conditions treated with bFGF/zVAD.fmk (Fig. S1C).
T2987 9072-9191 Sentence denotes This confirms that RIP1 kinase is responsible for necroptosis in L929 cells under both serum and serum free conditions.
T57 9072-9191 Sentence denotes This confirms that RIP1 kinase is responsible for necroptosis in L929 cells under both serum and serum free conditions.
T2988 9192-9306 Sentence denotes We next examined whether bFGF contributes to zVAD.fmk-induced necroptosis under normal serum conditions (10% FBS).
T58 9192-9306 Sentence denotes We next examined whether bFGF contributes to zVAD.fmk-induced necroptosis under normal serum conditions (10% FBS).
T2989 9307-9522 Sentence denotes We used two bFGF receptor tyrosine kinase inhibitors (PD173074 and PD166866), and determined that inhibition of bFGF signaling strongly inhibited zVAD.fmk-induced necroptosis under normal serum conditions (Fig. 1D).
T59 9307-9522 Sentence denotes We used two bFGF receptor tyrosine kinase inhibitors (PD173074 and PD166866), and determined that inhibition of bFGF signaling strongly inhibited zVAD.fmk-induced necroptosis under normal serum conditions (Fig. 1D).
T2990 9523-9702 Sentence denotes In contrast, neither bFGF receptor inhibitor was able to attenuate TNFα-induced necroptosis (Fig. 1D), consistent with growth factors being dispensable for this pathway (Fig. 1A).
T60 9523-9702 Sentence denotes In contrast, neither bFGF receptor inhibitor was able to attenuate TNFα-induced necroptosis (Fig. 1D), consistent with growth factors being dispensable for this pathway (Fig. 1A).
T2991 9703-9840 Sentence denotes Overall, these data suggest that the induction of necroptosis by zVAD.fmk is promoted by bFGF under both serum and serum free conditions.
T61 9703-9840 Sentence denotes Overall, these data suggest that the induction of necroptosis by zVAD.fmk is promoted by bFGF under both serum and serum free conditions.
T2992 9841-9987 Sentence denotes The induction of necroptosis, however, is not a simple consequence of growth factor signaling since not all growth factors allowed death to occur.
T62 9841-9987 Sentence denotes The induction of necroptosis, however, is not a simple consequence of growth factor signaling since not all growth factors allowed death to occur.
T2993 9988-10103 Sentence denotes Instead, specific signaling events mediated by particular growth factors appear to contribute to necroptotic death.
T63 9988-10103 Sentence denotes Instead, specific signaling events mediated by particular growth factors appear to contribute to necroptotic death.
T64 10105-10171 Sentence denotes RIP1 Kinase-dependent Activation of Akt Contributes to Necroptosis
T5281 10172-10425 Sentence denotes Given our observation that growth factors are important for zVAD.fmk induced death, we examined the contribution of several pathways, including MAPK pathways and Akt, which are known to be activated following growth factor receptor activation (Fig. 2A).
T65 10172-10425 Sentence denotes Given our observation that growth factors are important for zVAD.fmk induced death, we examined the contribution of several pathways, including MAPK pathways and Akt, which are known to be activated following growth factor receptor activation (Fig. 2A).
T5282 10426-10656 Sentence denotes Inhibition of Akt (Akt inhibitor VIII) strongly protected the cells from growth factor-sensitive necroptosis induced by zVAD.fmk [16] as well as cell death triggered by bFGF or IGF-1/zVAD.fmk under serum free conditions (Fig. 2B).
T66 10426-10656 Sentence denotes Inhibition of Akt (Akt inhibitor VIII) strongly protected the cells from growth factor-sensitive necroptosis induced by zVAD.fmk [16] as well as cell death triggered by bFGF or IGF-1/zVAD.fmk under serum free conditions (Fig. 2B).
T5283 10657-10765 Sentence denotes Inhibition of Akt also protected the cells from growth-factor insensitive death by caused by TNFα (Fig. 2A).
T67 10657-10765 Sentence denotes Inhibition of Akt also protected the cells from growth-factor insensitive death by caused by TNFα (Fig. 2A).
T5284 10766-10925 Sentence denotes Consistent with previous reports, the JNK inhibitor SP600125 protected the cells from both zVAD.fmk and TNFα induced death (Fig. 2A,B and Fig. S2A) [12], [14].
T68 10766-10925 Sentence denotes Consistent with previous reports, the JNK inhibitor SP600125 protected the cells from both zVAD.fmk and TNFα induced death (Fig. 2A,B and Fig. S2A) [12], [14].
T5285 10926-11117 Sentence denotes In contrast, inhibition of two other MAPKs, p38 and ERK, previously reported not to be activated during necroptosis [14], did not protect from either zVAD.fmk or TNFα induced death (Fig. 2A).
T69 10926-11117 Sentence denotes In contrast, inhibition of two other MAPKs, p38 and ERK, previously reported not to be activated during necroptosis [14], did not protect from either zVAD.fmk or TNFα induced death (Fig. 2A).
T70 11118-11222 Sentence denotes 10.1371/journal.pone.0056576.g002 Figure 2 Akt contributes to necroptosis induced by zVAD.fmk and TNFα.
T28945 11162-11222 Sentence denotes Akt contributes to necroptosis induced by zVAD.fmk and TNFα.
T28946 11223-11439 Sentence denotes (A,B) Necroptosis was induced by zVAD.fmk or TNFα (full serum, A) or growth factors/zVAD.fmk (serum free, B) in the presence of inhibitors of Akt (Akt inhibitor VIII), JNK (SP600125), p38 (PD169316), and Erk (UO126).
T71 11223-11439 Sentence denotes (A,B) Necroptosis was induced by zVAD.fmk or TNFα (full serum, A) or growth factors/zVAD.fmk (serum free, B) in the presence of inhibitors of Akt (Akt inhibitor VIII), JNK (SP600125), p38 (PD169316), and Erk (UO126).
T28947 11440-11600 Sentence denotes Cell viability was determined after 24 hrs. (C) L929 cells transfected with Akt1, Akt2, and Akt3 siRNAs for 72 hrs were treated with zVAD.fmk or TNFα for 9 hrs.
T72 11440-11600 Sentence denotes Cell viability was determined after 24 hrs. (C) L929 cells transfected with Akt1, Akt2, and Akt3 siRNAs for 72 hrs were treated with zVAD.fmk or TNFα for 9 hrs.
T28948 11601-11671 Sentence denotes Cell viability and Akt expression levels were determined after 24 hrs.
T73 11601-11671 Sentence denotes Cell viability and Akt expression levels were determined after 24 hrs.
T28949 11672-11710 Sentence denotes In all graphs, average±SD was plotted.
T74 11672-11710 Sentence denotes In all graphs, average±SD was plotted.
T5286 11711-11802 Sentence denotes Next, we used two approaches to further validate the role of Akt in necroptotic cell death.
T75 11711-11802 Sentence denotes Next, we used two approaches to further validate the role of Akt in necroptotic cell death.
T5287 11803-12011 Sentence denotes First, two additional Akt inhibitors, a highly specific, allosteric kinase inhibitor MK-2206 [25] and triciribine (TCN) [26], which blocks membrane translocation of Akt, both attenuated cell death (Fig. S2B).
T76 11803-12011 Sentence denotes First, two additional Akt inhibitors, a highly specific, allosteric kinase inhibitor MK-2206 [25] and triciribine (TCN) [26], which blocks membrane translocation of Akt, both attenuated cell death (Fig. S2B).
T5288 12012-12165 Sentence denotes Secondly, simultaneous knockdown of Akt isoforms Akt1 and Akt2 using siRNAs protected cells from necroptosis induced by both zVAD.fmk and TNFα (Fig. 2C).
T77 12012-12165 Sentence denotes Secondly, simultaneous knockdown of Akt isoforms Akt1 and Akt2 using siRNAs protected cells from necroptosis induced by both zVAD.fmk and TNFα (Fig. 2C).
T5289 12166-12292 Sentence denotes No expression of Akt3 was seen in L929 cells (Fig. S2C) and, consistently, Akt3 siRNA had no additional effect on necroptosis.
T78 12166-12292 Sentence denotes No expression of Akt3 was seen in L929 cells (Fig. S2C) and, consistently, Akt3 siRNA had no additional effect on necroptosis.
T5290 12293-12398 Sentence denotes Our results confirmed that Akt plays a key role in necroptosis induced by multiple stimuli in L929 cells.
T79 12293-12398 Sentence denotes Our results confirmed that Akt plays a key role in necroptosis induced by multiple stimuli in L929 cells.
T5291 12399-12572 Sentence denotes To understand the activation of Akt and JNK under necroptotic conditions, we examined the changes in Akt and JNK phosphorylation at 9 hrs post zVAD.fmk and TNFα stimulation.
T80 12399-12572 Sentence denotes To understand the activation of Akt and JNK under necroptotic conditions, we examined the changes in Akt and JNK phosphorylation at 9 hrs post zVAD.fmk and TNFα stimulation.
T5292 12573-12678 Sentence denotes This time point was chosen because it reflects the early stage of cell death in our system (Fig. S3A, B).
T81 12573-12678 Sentence denotes This time point was chosen because it reflects the early stage of cell death in our system (Fig. S3A, B).
T5293 12679-12834 Sentence denotes Following stimulation with either zVAD.fmk or TNFα we observed a robust increase in Akt phosphorylation at a known major activation site, Thr308 (Fig. 3A).
T82 12679-12834 Sentence denotes Following stimulation with either zVAD.fmk or TNFα we observed a robust increase in Akt phosphorylation at a known major activation site, Thr308 (Fig. 3A).
T5294 12835-12956 Sentence denotes Interestingly, we did not observe concomitant phosphorylation changes in the second major activation site of Akt, Ser473.
T83 12835-12956 Sentence denotes Interestingly, we did not observe concomitant phosphorylation changes in the second major activation site of Akt, Ser473.
T5295 12957-13089 Sentence denotes We also observed an increase in the phosphorylation of both the p46 and p54 isoforms of JNK and its major substrate c-Jun (Fig. 3A).
T84 12957-13089 Sentence denotes We also observed an increase in the phosphorylation of both the p46 and p54 isoforms of JNK and its major substrate c-Jun (Fig. 3A).
T5296 13090-13175 Sentence denotes These data indicate that both Akt and JNK are activated under necroptotic conditions.
T85 13090-13175 Sentence denotes These data indicate that both Akt and JNK are activated under necroptotic conditions.
T86 13176-13292 Sentence denotes 10.1371/journal.pone.0056576.g003 Figure 3 RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis.
T29402 13220-13292 Sentence denotes RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis.
T29403 13293-13740 Sentence denotes (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr, followed by western blotting with indicated antibodies. (B,C) L929 cells were treated with zVAD.fmk (B) or bFGF/zVAD.fmk (serum free conditions, C) and samples were collected at the indicated time points for western blot. (D) Nec-1 was added to the cells stimulated with bFGF or bFGF/zVAD (serum free conditions) for 15 min or 9 hr followed by western blot with the indicated antibodies.
T87 13293-13740 Sentence denotes (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr, followed by western blotting with indicated antibodies. (B,C) L929 cells were treated with zVAD.fmk (B) or bFGF/zVAD.fmk (serum free conditions, C) and samples were collected at the indicated time points for western blot. (D) Nec-1 was added to the cells stimulated with bFGF or bFGF/zVAD (serum free conditions) for 15 min or 9 hr followed by western blot with the indicated antibodies.
T5297 13741-13881 Sentence denotes The RIP1 kinase inhibitor, Nec-1, completely prevented the increase in Thr308 Akt phosphorylation, while Nec-1i did not (Fig. 3A, Fig. S1D).
T88 13741-13881 Sentence denotes The RIP1 kinase inhibitor, Nec-1, completely prevented the increase in Thr308 Akt phosphorylation, while Nec-1i did not (Fig. 3A, Fig. S1D).
T5298 13882-14028 Sentence denotes Similarly, Nec-1 prevented the induction of JNK phosphorylation in response to zVAD.fmk and substantially reduced this change after TNFα addition.
T89 13882-14028 Sentence denotes Similarly, Nec-1 prevented the induction of JNK phosphorylation in response to zVAD.fmk and substantially reduced this change after TNFα addition.
T5299 14029-14129 Sentence denotes We observed some changes in total protein levels of JNK and c-Jun following necroptotic stimulation.
T90 14029-14129 Sentence denotes We observed some changes in total protein levels of JNK and c-Jun following necroptotic stimulation.
T5300 14130-14224 Sentence denotes Some of these changes, e.g. zVAD.fmk-induced increase in c-Jun, were also attenuated by Nec-1.
T91 14130-14224 Sentence denotes Some of these changes, e.g. zVAD.fmk-induced increase in c-Jun, were also attenuated by Nec-1.
T5301 14225-14322 Sentence denotes Importantly, Nec-1 did not alter the basal phosphorylation levels of either Akt or JNK (Fig. 3A).
T92 14225-14322 Sentence denotes Importantly, Nec-1 did not alter the basal phosphorylation levels of either Akt or JNK (Fig. 3A).
T5302 14323-14417 Sentence denotes This established that Akt Thr308 and JNK phosphorylation during necroptosis is RIP1 dependent.
T93 14323-14417 Sentence denotes This established that Akt Thr308 and JNK phosphorylation during necroptosis is RIP1 dependent.
T5303 14418-14636 Sentence denotes Interestingly, we discovered that the phosphorylation of Akt Thr308, JNK and Jun are late events following zVAD.fmk stimulation (Fig. 3B) that coincide with the onset of necroptosis at 6 hr post-stimulation (Fig. S3A).
T94 14418-14636 Sentence denotes Interestingly, we discovered that the phosphorylation of Akt Thr308, JNK and Jun are late events following zVAD.fmk stimulation (Fig. 3B) that coincide with the onset of necroptosis at 6 hr post-stimulation (Fig. S3A).
T5304 14637-14838 Sentence denotes To better understand the contributions of growth factors and RIP1 kinase to necroptotic regulation of Akt, we next analyzed the time course of these phosphorylation changes under serum free conditions.
T95 14637-14838 Sentence denotes To better understand the contributions of growth factors and RIP1 kinase to necroptotic regulation of Akt, we next analyzed the time course of these phosphorylation changes under serum free conditions.
T5305 14839-15123 Sentence denotes We found that the addition of bFGF alone or in combination with zVAD.fmk led to a substantial rapid and transient increase in both Thr308 and Ser473 phosphorylation of Akt as well as JNK and c-Jun at 15 minutes, reflecting the expected response to growth factor stimulation (Fig. 3C).
T96 14839-15123 Sentence denotes We found that the addition of bFGF alone or in combination with zVAD.fmk led to a substantial rapid and transient increase in both Thr308 and Ser473 phosphorylation of Akt as well as JNK and c-Jun at 15 minutes, reflecting the expected response to growth factor stimulation (Fig. 3C).
T97 15124-15365 Sentence denotes Significantly, the combination of bFGF/zVAD.fmk, but not bFGF alone, also caused a robust, second, delayed increase in the phosphorylation of Thr308, but not Ser473, of Akt as well as a delayed increase in the phosphorylation of JNK and Jun.
T5306 15124-15762 Sentence denotes Significantly, the combination of bFGF/zVAD.fmk, but not bFGF alone, also caused a robust, second, delayed increase in the phosphorylation of Thr308, but not Ser473, of Akt as well as a delayed increase in the phosphorylation of JNK and Jun. Furthermore, Nec-1 had no significant effect on the early increase in both Akt and JNK/c-Jun phosphorylation triggered by both bFGF and bFGF/zVAD, while Nec-1, but not its inactive analog Nec-1i (Fig. S1E), efficiently blocked the bFGF/zVAD increase at 6–9 hr (Fig. 3D), suggesting that only the delayed activation of Akt and JNK is specific for necroptosis and dependent on RIP1 kinase activity.
T98 15366-15762 Sentence denotes Furthermore, Nec-1 had no significant effect on the early increase in both Akt and JNK/c-Jun phosphorylation triggered by both bFGF and bFGF/zVAD, while Nec-1, but not its inactive analog Nec-1i (Fig. S1E), efficiently blocked the bFGF/zVAD increase at 6–9 hr (Fig. 3D), suggesting that only the delayed activation of Akt and JNK is specific for necroptosis and dependent on RIP1 kinase activity.
T5307 15763-15995 Sentence denotes Similarly, IGF/zVAD, which also promoted cell death under serum free conditions, produced a delayed increase in Thr308 phosphorylation on Akt, while IGF alone caused solely an early, transient increase in phosphorylation (Fig. S3C).
T99 15763-15995 Sentence denotes Similarly, IGF/zVAD, which also promoted cell death under serum free conditions, produced a delayed increase in Thr308 phosphorylation on Akt, while IGF alone caused solely an early, transient increase in phosphorylation (Fig. S3C).
T5308 15996-16233 Sentence denotes We confirmed the kinetics of the Akt Thr308 and Ser473 phosphorylation changes using a quantitative ELISA assay, which also showed a robust delayed necroptosis-specific RIP1-dependent increase in Akt Thr308 phosphorylation (Fig. S3D, E).
T100 15996-16233 Sentence denotes We confirmed the kinetics of the Akt Thr308 and Ser473 phosphorylation changes using a quantitative ELISA assay, which also showed a robust delayed necroptosis-specific RIP1-dependent increase in Akt Thr308 phosphorylation (Fig. S3D, E).
T5309 16234-16461 Sentence denotes Taken together, these results indicate that the observed delayed increases in Akt and JNK phosphorylation, preceding the onset of cell death, represent specific consequences of necroptotic signaling downstream from RIP1 kinase.
T101 16234-16461 Sentence denotes Taken together, these results indicate that the observed delayed increases in Akt and JNK phosphorylation, preceding the onset of cell death, represent specific consequences of necroptotic signaling downstream from RIP1 kinase.
T7409 16463-16567 Sentence denotes TNFα Induces Delayed Akt Thr308 Phosphorylation and Necroptosis Independent of Growth Factor Stimulation
T102 16463-16567 Sentence denotes TNFα Induces Delayed Akt Thr308 Phosphorylation and Necroptosis Independent of Growth Factor Stimulation
T7410 16568-16817 Sentence denotes Consistent with TNFα inducing necroptosis independently of growth factors (Fig. 1A), FGFR inhibitors did not attenuate TNFα-induced changes in Akt or JNK phosphorylation, while efficiently preventing these changes in response to zVAD.fmk (Fig. S4A).
T103 16568-16817 Sentence denotes Consistent with TNFα inducing necroptosis independently of growth factors (Fig. 1A), FGFR inhibitors did not attenuate TNFα-induced changes in Akt or JNK phosphorylation, while efficiently preventing these changes in response to zVAD.fmk (Fig. S4A).
T7411 16818-17034 Sentence denotes Furthermore, addition of TNFα led to comparable late activation of Akt p308 signal under both normal and serum free conditions (Fig. S4B, C), indicating that TNFα signaling to Akt Thr308 is growth factor-independent.
T104 16818-17034 Sentence denotes Furthermore, addition of TNFα led to comparable late activation of Akt p308 signal under both normal and serum free conditions (Fig. S4B, C), indicating that TNFα signaling to Akt Thr308 is growth factor-independent.
T7412 17035-17132 Sentence denotes In contrast, activation of JNK by TNFα followed different kinetics from zVAD.fmk-induced changes.
T105 17035-17132 Sentence denotes In contrast, activation of JNK by TNFα followed different kinetics from zVAD.fmk-induced changes.
T106 17133-17224 Sentence denotes TNFα treatment caused an early and robust increase in the phosphorylation of JNK and c-Jun.
T7413 17133-17349 Sentence denotes TNFα treatment caused an early and robust increase in the phosphorylation of JNK and c-Jun. Nec-1 did not affect this early increase, however, it reduced levels of pJNK/Jun at the late, 9 hr time point (Fig. S4B, C).
T107 17225-17349 Sentence denotes Nec-1 did not affect this early increase, however, it reduced levels of pJNK/Jun at the late, 9 hr time point (Fig. S4B, C).
T7414 17350-17561 Sentence denotes This again separated early RIP1-independent changes, which likely reflect the ability of additional upstream kinases, such as Ask1 to activate JNK [27], from the late RIP1 kinase-dependent necroptotic signaling.
T108 17350-17561 Sentence denotes This again separated early RIP1-independent changes, which likely reflect the ability of additional upstream kinases, such as Ask1 to activate JNK [27], from the late RIP1 kinase-dependent necroptotic signaling.
T8134 17563-17661 Sentence denotes Late Increase in Akt Thr308 Phosphorylation Contributes to the Induction of Necroptotic Cell Death
T109 17563-17661 Sentence denotes Late Increase in Akt Thr308 Phosphorylation Contributes to the Induction of Necroptotic Cell Death
T8135 17662-17827 Sentence denotes We next investigated if the delayed RIP1 kinase-dependent increase in Akt Thr308 phosphorylation functionally contributes to the execution of necroptotic cell death.
T110 17662-17827 Sentence denotes We next investigated if the delayed RIP1 kinase-dependent increase in Akt Thr308 phosphorylation functionally contributes to the execution of necroptotic cell death.
T8136 17828-18095 Sentence denotes Firstly, PDGF/zVAD.fmk, which cannot induce necroptosis (Fig. 2A), triggered only the initial, rapid Akt and JNK phosphorylation changes and not the delayed activation (Fig. 4A), indicating that late, rather than early Akt phosphorylation correlates with necroptosis.
T111 17828-18095 Sentence denotes Firstly, PDGF/zVAD.fmk, which cannot induce necroptosis (Fig. 2A), triggered only the initial, rapid Akt and JNK phosphorylation changes and not the delayed activation (Fig. 4A), indicating that late, rather than early Akt phosphorylation correlates with necroptosis.
T8137 18096-18347 Sentence denotes Secondly, we saw that the ability of the Akt inhibitor to protect cells from necroptosis rapidly declined after 6 hrs of stimulation with zVAD.fmk, TNFα or bFGF/zVAD.fmk and no protection was observed when the inhibitor was added at 9 hrs (Fig. 4B,C).
T112 18096-18347 Sentence denotes Secondly, we saw that the ability of the Akt inhibitor to protect cells from necroptosis rapidly declined after 6 hrs of stimulation with zVAD.fmk, TNFα or bFGF/zVAD.fmk and no protection was observed when the inhibitor was added at 9 hrs (Fig. 4B,C).
T8138 18348-18434 Sentence denotes This time frame coincides with the timing of the secondary Akt Thr308 phosphorylation.
T113 18348-18434 Sentence denotes This time frame coincides with the timing of the secondary Akt Thr308 phosphorylation.
T8139 18435-18534 Sentence denotes Finally, we terminated the bFGF signal one hour after addition of bFGF by the addition of PD173074.
T114 18435-18534 Sentence denotes Finally, we terminated the bFGF signal one hour after addition of bFGF by the addition of PD173074.
T8140 18535-18632 Sentence denotes This allowed us to retain early Akt activation, but to suppress the secondary increase (Fig. 4D).
T115 18535-18632 Sentence denotes This allowed us to retain early Akt activation, but to suppress the secondary increase (Fig. 4D).
T8141 18633-18722 Sentence denotes Both pre-addition and delayed addition of PD173074 fully prevented necroptosis (Fig. 4E).
T116 18633-18722 Sentence denotes Both pre-addition and delayed addition of PD173074 fully prevented necroptosis (Fig. 4E).
T8142 18723-18963 Sentence denotes Overall, these data, while correlative, indicate that early Akt activation is insufficient to promote necroptosis and are strongly supportive of an important role for the delayed activation of Akt in the induction of necroptotic cell death.
T117 18723-18963 Sentence denotes Overall, these data, while correlative, indicate that early Akt activation is insufficient to promote necroptosis and are strongly supportive of an important role for the delayed activation of Akt in the induction of necroptotic cell death.
T118 18964-19070 Sentence denotes 10.1371/journal.pone.0056576.g004 Figure 4 Late Thr308 phosphorylation of Akt contributes to necroptosis.
T29750 19008-19070 Sentence denotes Late Thr308 phosphorylation of Akt contributes to necroptosis.
T29751 19071-19295 Sentence denotes (A) L929 cells were treated with zVAD.fmk and bFGF or PDGF, with or without Nec-1, for the indicated periods of time. (B,C) L929 cells were stimulated by zVAD.fmk or TNFα (B) or bFGF/zVAD.fmk under serum free conditions (C).
T119 19071-19295 Sentence denotes (A) L929 cells were treated with zVAD.fmk and bFGF or PDGF, with or without Nec-1, for the indicated periods of time. (B,C) L929 cells were stimulated by zVAD.fmk or TNFα (B) or bFGF/zVAD.fmk under serum free conditions (C).
T29752 19296-19304 Sentence denotes Akt inh.
T120 19296-19304 Sentence denotes Akt inh.
T29753 19305-19404 Sentence denotes VIII was added 15 min before necroptotic stimulation (Pre) or at indicated times after stimulation.
T121 19305-19404 Sentence denotes VIII was added 15 min before necroptotic stimulation (Pre) or at indicated times after stimulation.
T29754 19405-19541 Sentence denotes Viability was measured 24 hr after activation of necroptosis. (D) L929 cells were stimulated with bFGF/zVAD under serum free conditions.
T122 19405-19541 Sentence denotes Viability was measured 24 hr after activation of necroptosis. (D) L929 cells were stimulated with bFGF/zVAD under serum free conditions.
T29755 19542-19598 Sentence denotes PD173074 was added 15 min before or 1 hr after FGF/zVAD.
T123 19542-19598 Sentence denotes PD173074 was added 15 min before or 1 hr after FGF/zVAD.
T29756 19599-19795 Sentence denotes Samples for western blot were collected at 15 min and 9 hr time points. (E) Cells were pretreated with PD173074 or it was added 1 hr after bFGF/zVAD.fmk, followed by viability assessment at 24 hr.
T124 19599-19795 Sentence denotes Samples for western blot were collected at 15 min and 9 hr time points. (E) Cells were pretreated with PD173074 or it was added 1 hr after bFGF/zVAD.fmk, followed by viability assessment at 24 hr.
T29757 19796-19834 Sentence denotes In all graphs, average±SD was plotted.
T125 19796-19834 Sentence denotes In all graphs, average±SD was plotted.
T9085 19836-19906 Sentence denotes The Akt Signaling Pathway Contributes to the Regulation of Necroptosis
T126 19836-19906 Sentence denotes The Akt Signaling Pathway Contributes to the Regulation of Necroptosis
T9086 19907-20042 Sentence denotes We next determined whether the necroptosis-associated increase in Thr308 phosphorylation results in an increase in Akt kinase activity.
T127 19907-20042 Sentence denotes We next determined whether the necroptosis-associated increase in Thr308 phosphorylation results in an increase in Akt kinase activity.
T9087 20043-20329 Sentence denotes Under necroptotic conditions, we observed an increase in the phosphorylation of multiple known Akt substrates (Forkhead box class O (FoxO) proteins, GSK-3 kinases and mouse double minute 2 (MDM2)) as well as downstream molecules (p70 ribosomal protein S6 Kinase (p70S6K), S6) (Fig. 5A).
T128 20043-20329 Sentence denotes Under necroptotic conditions, we observed an increase in the phosphorylation of multiple known Akt substrates (Forkhead box class O (FoxO) proteins, GSK-3 kinases and mouse double minute 2 (MDM2)) as well as downstream molecules (p70 ribosomal protein S6 Kinase (p70S6K), S6) (Fig. 5A).
T9088 20330-20397 Sentence denotes In some cases (FoxO1, FoxO4, MDM2), a robust increase was observed.
T129 20330-20397 Sentence denotes In some cases (FoxO1, FoxO4, MDM2), a robust increase was observed.
T9089 20398-20505 Sentence denotes In other cases (FoxO3a, GSK-3α/β, p70S6K and its substrate S6), the changes were less pronounced (Fig. 5A).
T130 20398-20505 Sentence denotes In other cases (FoxO3a, GSK-3α/β, p70S6K and its substrate S6), the changes were less pronounced (Fig. 5A).
T9090 20506-20613 Sentence denotes The timing of the phosphorylation changes paralleled the increase in Akt phosphorylation (Fig. 5B, S5A, B).
T131 20506-20613 Sentence denotes The timing of the phosphorylation changes paralleled the increase in Akt phosphorylation (Fig. 5B, S5A, B).
T9091 20614-20846 Sentence denotes In the case of pFoxO1 we occasionally observed a shift in migration rather than an increase in band intensity (e.g. comparing Fig. 5A and B), suggesting that phosphorylation events in addition to Thr24 take place during necroptosis.
T132 20614-20846 Sentence denotes In the case of pFoxO1 we occasionally observed a shift in migration rather than an increase in band intensity (e.g. comparing Fig. 5A and B), suggesting that phosphorylation events in addition to Thr24 take place during necroptosis.
T9092 20847-20971 Sentence denotes Notably, in all cases the necroptosis-associated increases in Akt substrates were abrogated by Nec-1 (Fig. 5A, Fig. S5A, B).
T133 20847-20971 Sentence denotes Notably, in all cases the necroptosis-associated increases in Akt substrates were abrogated by Nec-1 (Fig. 5A, Fig. S5A, B).
T9093 20972-21147 Sentence denotes Overall, these data suggested that a significant part of the “canonical” Akt signaling network is activated at the onset of necroptotic cell death in a RIP1 dependent fashion.
T134 20972-21147 Sentence denotes Overall, these data suggested that a significant part of the “canonical” Akt signaling network is activated at the onset of necroptotic cell death in a RIP1 dependent fashion.
T135 21148-21244 Sentence denotes 10.1371/journal.pone.0056576.g005 Figure 5 mTORC1 contributes to the regulation of necroptosis.
T30234 21192-21244 Sentence denotes mTORC1 contributes to the regulation of necroptosis.
T30235 21245-21614 Sentence denotes (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr and harvested for western blot. (B) Cell under serum free condition were treated with bFGF or bFGF/zVAD.fmk for the indicated amounts of time, followed by western blotting using the indicated antibodies. (C) Necroptosis was induced by zVAD.fmk or TNFα in L929 cell in the presence of inhibitors of Akt(Akt inh.
T136 21245-21614 Sentence denotes (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr and harvested for western blot. (B) Cell under serum free condition were treated with bFGF or bFGF/zVAD.fmk for the indicated amounts of time, followed by western blotting using the indicated antibodies. (C) Necroptosis was induced by zVAD.fmk or TNFα in L929 cell in the presence of inhibitors of Akt(Akt inh.
T30236 21615-21780 Sentence denotes VIII) and mTOR (rapamycin, Torin-1 and PI-103). (D) L929 cells with mTOR siRNA knockdown were harvested for western blot or treated with zVAD.fmk or TNFα for 24 hrs.
T137 21615-21780 Sentence denotes VIII) and mTOR (rapamycin, Torin-1 and PI-103). (D) L929 cells with mTOR siRNA knockdown were harvested for western blot or treated with zVAD.fmk or TNFα for 24 hrs.
T30237 21781-21849 Sentence denotes Cell viability was determined 24 hr after activation of necroptosis.
T138 21781-21849 Sentence denotes Cell viability was determined 24 hr after activation of necroptosis.
T30238 21850-21888 Sentence denotes In all graphs, average±SD was plotted.
T139 21850-21888 Sentence denotes In all graphs, average±SD was plotted.
T9094 21889-22049 Sentence denotes Akt kinase is considered to be a pro-survival protein that inhibits apoptosis through the control of multiple effectors including mTORC1, GSK-3 and others [28].
T140 21889-22049 Sentence denotes Akt kinase is considered to be a pro-survival protein that inhibits apoptosis through the control of multiple effectors including mTORC1, GSK-3 and others [28].
T9095 22050-22156 Sentence denotes An important question is whether these same molecules reverse their pro-survival roles during necroptosis.
T141 22050-22156 Sentence denotes An important question is whether these same molecules reverse their pro-survival roles during necroptosis.
T9096 22157-22297 Sentence denotes We found that inhibition of mTORC1 by rapamycin, an inhibitor of the mTOR co-factor Raptor [29], protected cells from necroptosis (Fig. 5C).
T142 22157-22297 Sentence denotes We found that inhibition of mTORC1 by rapamycin, an inhibitor of the mTOR co-factor Raptor [29], protected cells from necroptosis (Fig. 5C).
T9097 22298-22448 Sentence denotes Similarly, the direct mTOR kinase inhibitor Torin1 [30] and the dual PI3K/mTOR inhibitor PI-103 [31] also efficiently inhibited necroptosis (Fig. 5C).
T143 22298-22448 Sentence denotes Similarly, the direct mTOR kinase inhibitor Torin1 [30] and the dual PI3K/mTOR inhibitor PI-103 [31] also efficiently inhibited necroptosis (Fig. 5C).
T9098 22449-22645 Sentence denotes Knockdown of mTOR using siRNA further validated the small-molecule inhibitor data indicating a role for mTOR in necroptosis by protecting cells from both zVAD.fmk and TNFα induced death (Fig. 5D).
T144 22449-22645 Sentence denotes Knockdown of mTOR using siRNA further validated the small-molecule inhibitor data indicating a role for mTOR in necroptosis by protecting cells from both zVAD.fmk and TNFα induced death (Fig. 5D).
T9099 22646-22755 Sentence denotes mTORC1 regulates translation through activation of p70S6 kinase and, subsequently, ribosomal protein S6 [32].
T145 22646-22755 Sentence denotes mTORC1 regulates translation through activation of p70S6 kinase and, subsequently, ribosomal protein S6 [32].
T9100 22756-22864 Sentence denotes Notably, a genome-wide siRNA screen [10] suggested an important role for protein translation in necroptosis.
T146 22756-22864 Sentence denotes Notably, a genome-wide siRNA screen [10] suggested an important role for protein translation in necroptosis.
T9101 22865-23044 Sentence denotes Consistently, we found that the small molecule inhibitor of p70S6K PF-4708671 [33] attenuated necroptosis at the concentrations required to block S6 phosphorylation (Fig. S5C, D).
T147 22865-23044 Sentence denotes Consistently, we found that the small molecule inhibitor of p70S6K PF-4708671 [33] attenuated necroptosis at the concentrations required to block S6 phosphorylation (Fig. S5C, D).
T9102 23045-23208 Sentence denotes Partial siRNA knockdown of S6 protein attenuated necroptosis as well (Fig. S5E), suggesting that translational control by p70S6K/S6 may play a role in necroptosis.
T148 23045-23208 Sentence denotes Partial siRNA knockdown of S6 protein attenuated necroptosis as well (Fig. S5E), suggesting that translational control by p70S6K/S6 may play a role in necroptosis.
T9103 23209-23421 Sentence denotes Overall, while the full repertoire of Akt targets during necroptosis remains to be fully explored, our data provide evidence that the activity of an anti-apoptotic branch of Akt signaling can promote necroptosis.
T149 23209-23421 Sentence denotes Overall, while the full repertoire of Akt targets during necroptosis remains to be fully explored, our data provide evidence that the activity of an anti-apoptotic branch of Akt signaling can promote necroptosis.
T9104 23422-23513 Sentence denotes RIP1 kinase, Akt, mTORC1 and JNK control the upregulation of TNFα accompanying necroptosis.
T150 23422-23513 Sentence denotes RIP1 kinase, Akt, mTORC1 and JNK control the upregulation of TNFα accompanying necroptosis.
T9105 23514-23693 Sentence denotes Hitomi et al. [10] have recently reported that the induction of necroptosis by zVAD.fmk in L929 cells is associated with increased synthesis of TNFα, which potentiates cell death.
T151 23514-23693 Sentence denotes Hitomi et al. [10] have recently reported that the induction of necroptosis by zVAD.fmk in L929 cells is associated with increased synthesis of TNFα, which potentiates cell death.
T9106 23694-23776 Sentence denotes Therefore, we examined whether Akt and its effectors contribute to TNFα synthesis.
T152 23694-23776 Sentence denotes Therefore, we examined whether Akt and its effectors contribute to TNFα synthesis.
T9107 23777-23944 Sentence denotes Consistent with a RIP1-dependent increase in TNFα protein (Fig. S6A, B), we found that TNFα mRNA levels increased during necroptosis in L929 cells in a RIP1 (Fig. S6C.
T153 23777-23944 Sentence denotes Consistent with a RIP1-dependent increase in TNFα protein (Fig. S6A, B), we found that TNFα mRNA levels increased during necroptosis in L929 cells in a RIP1 (Fig. S6C.
T9108 23945-24132 Sentence denotes Under serum free conditions, bFGF alone triggered some induction of TNFα mRNA, while its combination with zVAD.fmk (but not zVAD.fmk alone) caused a pronounced further increase (Fig. 6A).
T154 23945-24132 Sentence denotes Under serum free conditions, bFGF alone triggered some induction of TNFα mRNA, while its combination with zVAD.fmk (but not zVAD.fmk alone) caused a pronounced further increase (Fig. 6A).
T9109 24133-24386 Sentence denotes Conversely, PDGF caused a modest upregulation of TNFα mRNA, which was not further increased in the presence of zVAD.fmk (Fig. 6A), demonstrating that activation of necroptosis is specifically accompanied by a marked increase in autocrine TNFα synthesis.
T155 24133-24386 Sentence denotes Conversely, PDGF caused a modest upregulation of TNFα mRNA, which was not further increased in the presence of zVAD.fmk (Fig. 6A), demonstrating that activation of necroptosis is specifically accompanied by a marked increase in autocrine TNFα synthesis.
T156 24387-24517 Sentence denotes 10.1371/journal.pone.0056576.g006 Figure 6 Akt and mTORC1 control autocrine TNFα synthesis and JNK activation during necroptosis.
T30670 24431-24517 Sentence denotes Akt and mTORC1 control autocrine TNFα synthesis and JNK activation during necroptosis.
T30671 24518-24660 Sentence denotes (A) Cells were treated under serum free conditions with bFGF or PDGF with or without zVAD.fmk for 9 hr, followed by qRT-PCR analysis of mTNFα.
T157 24518-24660 Sentence denotes (A) Cells were treated under serum free conditions with bFGF or PDGF with or without zVAD.fmk for 9 hr, followed by qRT-PCR analysis of mTNFα.
T30672 24661-24805 Sentence denotes Data was normalized to mouse 18S RNA. (B) Necroptosis was induced by zVAD.fmk or TNFα in cells treated with Nec-1, rapamycin (rapa), or Akt inh.
T158 24661-24805 Sentence denotes Data was normalized to mouse 18S RNA. (B) Necroptosis was induced by zVAD.fmk or TNFα in cells treated with Nec-1, rapamycin (rapa), or Akt inh.
T30673 24806-25054 Sentence denotes VIII inh. followed by qRT-PCR analysis of TNFα mRNA levels. (C-F) L929 cells with siRNA knockdown of Akt isoforms (C,E) or mTOR (D,F) were stimulated with zVAD.fmk or TNFα for 9 hr, followed by qRT-PCR analysis of mTNFα (C,D) or western blot (E,F).
T159 24806-25054 Sentence denotes VIII inh. followed by qRT-PCR analysis of TNFα mRNA levels. (C-F) L929 cells with siRNA knockdown of Akt isoforms (C,E) or mTOR (D,F) were stimulated with zVAD.fmk or TNFα for 9 hr, followed by qRT-PCR analysis of mTNFα (C,D) or western blot (E,F).
T30674 25055-25093 Sentence denotes In all graphs, average±SD was plotted.
T160 25055-25093 Sentence denotes In all graphs, average±SD was plotted.
T9110 25094-25339 Sentence denotes Further analysis suggested that both Akt and mTORC1 contribute to the upregulation of TNFα mRNA during necroptosis as both small-molecule inhibition and siRNA knockdown of Akt and mTOR reduced TNFα mRNA levels in necroptotic cells (Fig. 6B,C,D).
T161 25094-25339 Sentence denotes Further analysis suggested that both Akt and mTORC1 contribute to the upregulation of TNFα mRNA during necroptosis as both small-molecule inhibition and siRNA knockdown of Akt and mTOR reduced TNFα mRNA levels in necroptotic cells (Fig. 6B,C,D).
T9111 25340-25597 Sentence denotes Notably, RIP1 and Akt inhibitors had no effect on the levels of TNFα mRNA in control cells or in the cells stimulated with bFGF alone (Fig. 6A,B, Fig. S6C), suggesting that these kinases specifically mediate necroptosis-dependent increase in TNFα synthesis.
T162 25340-25597 Sentence denotes Notably, RIP1 and Akt inhibitors had no effect on the levels of TNFα mRNA in control cells or in the cells stimulated with bFGF alone (Fig. 6A,B, Fig. S6C), suggesting that these kinases specifically mediate necroptosis-dependent increase in TNFα synthesis.
T11852 25599-25662 Sentence denotes Akt and mTORC1 Control the Activation of JNK during Necroptosis
T163 25599-25662 Sentence denotes Akt and mTORC1 Control the Activation of JNK during Necroptosis
T11853 25663-25764 Sentence denotes JNK is a well-established regulator of TNFα synthesis in a variety of systems [13], [14], [15], [34].
T164 25663-25764 Sentence denotes JNK is a well-established regulator of TNFα synthesis in a variety of systems [13], [14], [15], [34].
T11854 25765-25926 Sentence denotes Therefore, the ability of Akt and mTORC1 inhibitors to block the increase in TNFα mRNA lead us to examine their role in the activation of JNK during necroptosis.
T165 25765-25926 Sentence denotes Therefore, the ability of Akt and mTORC1 inhibitors to block the increase in TNFα mRNA lead us to examine their role in the activation of JNK during necroptosis.
T11855 25927-26167 Sentence denotes Knockdown of Akt isoforms Akt1 and Akt2 or inhibition of Akt prominently suppressed the necroptosis dependent increase in JNK and c-Jun phosphorylation (Fig. 6E, S6D,E) suggesting that Akt may provide a link between RIP1 and JNK activation.
T166 25927-26167 Sentence denotes Knockdown of Akt isoforms Akt1 and Akt2 or inhibition of Akt prominently suppressed the necroptosis dependent increase in JNK and c-Jun phosphorylation (Fig. 6E, S6D,E) suggesting that Akt may provide a link between RIP1 and JNK activation.
T11856 26168-26321 Sentence denotes Importantly, inhibition of Akt only inhibited the delayed, but not the early, increase in bFGF/zVAD.fmk induced JNK and c-Jun phosphorylation (Fig. S6F).
T167 26168-26321 Sentence denotes Importantly, inhibition of Akt only inhibited the delayed, but not the early, increase in bFGF/zVAD.fmk induced JNK and c-Jun phosphorylation (Fig. S6F).
T11857 26322-26499 Sentence denotes Knockdown of mTOR, rapamycin and the p70S6K inhibitor PF-4708671 also attenuated the necroptosis-associated increase in JNK and c-Jun phosphorylation (Fig. 6F, S6E,G, Fig. S5D).
T168 26322-26499 Sentence denotes Knockdown of mTOR, rapamycin and the p70S6K inhibitor PF-4708671 also attenuated the necroptosis-associated increase in JNK and c-Jun phosphorylation (Fig. 6F, S6E,G, Fig. S5D).
T11858 26500-26674 Sentence denotes Overall, these data suggested that the Akt-mTORC1-S6K axis, acting downstream from RIP1 kinase, is required for the increase in JNK activity during necroptosis in L929 cells.
T169 26500-26674 Sentence denotes Overall, these data suggested that the Akt-mTORC1-S6K axis, acting downstream from RIP1 kinase, is required for the increase in JNK activity during necroptosis in L929 cells.
T12747 26676-26775 Sentence denotes PI3-kinase and PDK1 Mediate the Increase in Akt Thr308 Phosphorylation Under Necroptotic Conditions
T170 26676-26775 Sentence denotes PI3-kinase and PDK1 Mediate the Increase in Akt Thr308 Phosphorylation Under Necroptotic Conditions
T12748 26776-27019 Sentence denotes Typical regulation of Akt by growth factors involves its recruitment to the plasma membrane, which is mediated by the binding of the pleckstrin homology (PH) domain of Akt to the product of PI3K, phosphatidylinositol-3,4,5-triphosphate (PIP3).
T171 26776-27019 Sentence denotes Typical regulation of Akt by growth factors involves its recruitment to the plasma membrane, which is mediated by the binding of the pleckstrin homology (PH) domain of Akt to the product of PI3K, phosphatidylinositol-3,4,5-triphosphate (PIP3).
T12749 27020-27178 Sentence denotes In the membrane, Akt is phosphorylated on Thr308 and Ser473 by 3-phosphoinositide dependent protein kinase-1 (PDK1) and mTORC2 (or DNA-PK), respectively [35].
T172 27020-27178 Sentence denotes In the membrane, Akt is phosphorylated on Thr308 and Ser473 by 3-phosphoinositide dependent protein kinase-1 (PDK1) and mTORC2 (or DNA-PK), respectively [35].
T12750 27179-27338 Sentence denotes Since our results showed that only Thr308 Akt phosphorylation is increased during necroptosis, we next examined whether it is still dependent on PI3K and PDK1.
T173 27179-27338 Sentence denotes Since our results showed that only Thr308 Akt phosphorylation is increased during necroptosis, we next examined whether it is still dependent on PI3K and PDK1.
T12751 27339-27516 Sentence denotes Inhibition of PI3K and PDK1 using the specific inhibitors LY249002 and BX912 [36] resulted in the efficient inhibition of cell death and Akt Thr308 phosphorylation (Fig. S7A–D).
T174 27339-27516 Sentence denotes Inhibition of PI3K and PDK1 using the specific inhibitors LY249002 and BX912 [36] resulted in the efficient inhibition of cell death and Akt Thr308 phosphorylation (Fig. S7A–D).
T12752 27517-27736 Sentence denotes Likewise, siRNA knockdown of PDK1 protected cells from death and inhibited Akt Thr308 phosphorylation (Fig. S7E,F) Therefore, PI3K and PDK1 activity is still required for non-canonical Akt activation during necroptosis.
T175 27517-27736 Sentence denotes Likewise, siRNA knockdown of PDK1 protected cells from death and inhibited Akt Thr308 phosphorylation (Fig. S7E,F) Therefore, PI3K and PDK1 activity is still required for non-canonical Akt activation during necroptosis.
T13696 27738-27826 Sentence denotes Expression of Constitutively Active Akt, Rescues Necroptosis Under Serum Free Conditions
T176 27738-27826 Sentence denotes Expression of Constitutively Active Akt, Rescues Necroptosis Under Serum Free Conditions
T13697 27827-28073 Sentence denotes We used L929 cells stably expressing constitutively active wild type Akt1 (Myr-Akt) or the catalytically inactive mutant K179M in order to further understand the contribution of growth factors and RIP1 kinase to Akt activation during necroptosis.
T177 27827-28073 Sentence denotes We used L929 cells stably expressing constitutively active wild type Akt1 (Myr-Akt) or the catalytically inactive mutant K179M in order to further understand the contribution of growth factors and RIP1 kinase to Akt activation during necroptosis.
T13698 28074-28376 Sentence denotes Constitutively active Akt1 (Myr-Akt) was generated as previously described [37] by the addition of a myristoylation signal which provides constitutive localization to the plasma membrane and by the deletion of the auto-inhibitory PH domain (Fig. 7A) resulting in an Akt that is active under serum free.
T178 28074-28376 Sentence denotes Constitutively active Akt1 (Myr-Akt) was generated as previously described [37] by the addition of a myristoylation signal which provides constitutive localization to the plasma membrane and by the deletion of the auto-inhibitory PH domain (Fig. 7A) resulting in an Akt that is active under serum free.
T13699 28377-28595 Sentence denotes It is important to note that the cells expressing Myr-Akt were viable, grew in a manner indistinguishable from the empty vector control cells, and were not triggered to induce necroptosis by serum starvation (Fig. 7B).
T179 28377-28595 Sentence denotes It is important to note that the cells expressing Myr-Akt were viable, grew in a manner indistinguishable from the empty vector control cells, and were not triggered to induce necroptosis by serum starvation (Fig. 7B).
T13700 28596-28684 Sentence denotes This indicates that active Akt alone is not sufficient to induce necroptotic cell death.
T180 28596-28684 Sentence denotes This indicates that active Akt alone is not sufficient to induce necroptotic cell death.
T13701 28685-28804 Sentence denotes Under serum free conditions Myr-Akt, but not the K179M mutant, fully restored zVAD.fmk-induced necroptosis (Fig. 7A,B).
T181 28685-28804 Sentence denotes Under serum free conditions Myr-Akt, but not the K179M mutant, fully restored zVAD.fmk-induced necroptosis (Fig. 7A,B).
T13702 28805-28943 Sentence denotes Nec-1 prevented both Myr-Akt dependent cell death and the necroptosis-specific delayed increase in Akt Thr308 phosphorylation (Fig. 7B,C).
T182 28805-28943 Sentence denotes Nec-1 prevented both Myr-Akt dependent cell death and the necroptosis-specific delayed increase in Akt Thr308 phosphorylation (Fig. 7B,C).
T13703 28944-29214 Sentence denotes Myr-Akt also allowed other zVAD.fmk-dependent events, including activation of JNK and c-Jun phosphorylation (Fig. 7C) and upregulation of TNFα mRNA (Fig. 7D) to occur under serum free conditions, confirming an important role for Akt at the apex of necroptotic signaling.
T183 28944-29214 Sentence denotes Myr-Akt also allowed other zVAD.fmk-dependent events, including activation of JNK and c-Jun phosphorylation (Fig. 7C) and upregulation of TNFα mRNA (Fig. 7D) to occur under serum free conditions, confirming an important role for Akt at the apex of necroptotic signaling.
T13704 29215-29383 Sentence denotes These data demonstrated that the presence of active and membrane localized Akt is sufficient to uncouple Akt activation during necroptosis from growth factor signaling.
T184 29215-29383 Sentence denotes These data demonstrated that the presence of active and membrane localized Akt is sufficient to uncouple Akt activation during necroptosis from growth factor signaling.
T13705 29384-29580 Sentence denotes RIP1 kinase was still able to regulate Akt activation during necroptosis, suggesting that growth factors and RIP1 kinase provide two independent inputs required for Akt changes during necroptosis.
T185 29384-29580 Sentence denotes RIP1 kinase was still able to regulate Akt activation during necroptosis, suggesting that growth factors and RIP1 kinase provide two independent inputs required for Akt changes during necroptosis.
T186 29581-29719 Sentence denotes 10.1371/journal.pone.0056576.g007 Figure 7 Over expression of constitutively active Akt restores necroptosis under serum free conditions.
T31184 29625-29719 Sentence denotes Over expression of constitutively active Akt restores necroptosis under serum free conditions.
T31185 29720-29857 Sentence denotes (A,B) L929 cells were stably infected with empty MSCV retrovirus or viruses encoding Myr-Akt or the catalytically inactive Myr-Akt K179M.
T187 29720-29857 Sentence denotes (A,B) L929 cells were stably infected with empty MSCV retrovirus or viruses encoding Myr-Akt or the catalytically inactive Myr-Akt K179M.
T31186 29858-29991 Sentence denotes Necroptosis was induced by the addition of zVAD.fmk under serum free conditions (A) or serum or serum free conditions with Nec-1 (B).
T188 29858-29991 Sentence denotes Necroptosis was induced by the addition of zVAD.fmk under serum free conditions (A) or serum or serum free conditions with Nec-1 (B).
T31187 29992-30207 Sentence denotes Viability assays were performed after 24 hr. (C) Myr-Akt and Myr-Akt K179M cells were treated with zVAD.fmk and/or Nec-1 under serum free conditions for 9 hr, followed by western blot using the indicated antibodies.
T189 29992-30207 Sentence denotes Viability assays were performed after 24 hr. (C) Myr-Akt and Myr-Akt K179M cells were treated with zVAD.fmk and/or Nec-1 under serum free conditions for 9 hr, followed by western blot using the indicated antibodies.
T31188 30208-30396 Sentence denotes Endogenous Akt (∼) and Myr-Akt (*) bands are indicated. (D) L929 cells, stably infected with Myr-Akt and Myr-Akt K179KM, were stimulated with zVAD.fmk for 9 hr under serum free conditions.
T190 30208-30396 Sentence denotes Endogenous Akt (∼) and Myr-Akt (*) bands are indicated. (D) L929 cells, stably infected with Myr-Akt and Myr-Akt K179KM, were stimulated with zVAD.fmk for 9 hr under serum free conditions.
T31189 30397-30740 Sentence denotes TNFα mRNA levels were determined by qRT-PCR and normalized using mouse 18S RNA. (E-G) L929 cells expressing Myr-Akt and Ala and Asp mutants of Thr308 and Ser473 were treated with zVAD.fmk under serum free conditions, followed by viability assay at 24 hr (E), western blot at 9 hr (F), or evaluation of TNFα mRNA levels by qRT-PCR at 9 hrs (G).
T191 30397-30740 Sentence denotes TNFα mRNA levels were determined by qRT-PCR and normalized using mouse 18S RNA. (E-G) L929 cells expressing Myr-Akt and Ala and Asp mutants of Thr308 and Ser473 were treated with zVAD.fmk under serum free conditions, followed by viability assay at 24 hr (E), western blot at 9 hr (F), or evaluation of TNFα mRNA levels by qRT-PCR at 9 hrs (G).
T31190 30741-30779 Sentence denotes In all graphs, average±SD was plotted.
T192 30741-30779 Sentence denotes In all graphs, average±SD was plotted.
T193 30780-30921 Sentence denotes RIP1 kinase-dependent Thr308 phosphorylation of Myr-Akt during necroptosis increased Myr-Akt activity as it did with endogenous Akt (Fig. 5).
T13707 30922-31129 Sentence denotes Phosphorylation of many previously described Akt substrates was increased upon the expression of Myr-Akt, but not the K179M mutant, confirming that these molecules are Akt substrates in L929 cells (Fig. 7C).
T194 30922-31129 Sentence denotes Phosphorylation of many previously described Akt substrates was increased upon the expression of Myr-Akt, but not the K179M mutant, confirming that these molecules are Akt substrates in L929 cells (Fig. 7C).
T195 31130-31240 Sentence denotes The effect of zVAD.fmk on their phosphorylation varied, likely due to the increased basal activity of Myr-Akt.
T13708 31130-31355 Sentence denotes The effect of zVAD.fmk on their phosphorylation varied, likely due to the increased basal activity of Myr-Akt. Some substrates, including p70S6K, S6, GSK-3 and FoxO4, were fully phosphorylated even in the absence of zVAD.fmk.
T196 31241-31355 Sentence denotes Some substrates, including p70S6K, S6, GSK-3 and FoxO4, were fully phosphorylated even in the absence of zVAD.fmk.
T13709 31356-31556 Sentence denotes On the other hand, phosphorylation of FoxO1 and MDM2 was significantly increased in the presence of zVAD.fmk, indicating that necroptotic Thr308 phosphorylation of Myr-Akt still promoted its activity.
T197 31356-31556 Sentence denotes On the other hand, phosphorylation of FoxO1 and MDM2 was significantly increased in the presence of zVAD.fmk, indicating that necroptotic Thr308 phosphorylation of Myr-Akt still promoted its activity.
T198 31557-31715 Sentence denotes Under serum free conditions all zVAD.fmk-induced downstream events (cell death, JNK activation, TNFα production) were dependent on the over expressed Myr-Akt.
T13710 31557-31793 Sentence denotes Under serum free conditions all zVAD.fmk-induced downstream events (cell death, JNK activation, TNFα production) were dependent on the over expressed Myr-Akt. This allowed us to examine the effects of other Akt mutations on necroptosis.
T199 31716-31793 Sentence denotes This allowed us to examine the effects of other Akt mutations on necroptosis.
T13711 31794-31856 Sentence denotes First, we found that membrane localization of Akt is required.
T200 31794-31856 Sentence denotes First, we found that membrane localization of Akt is required.
T13712 31857-32078 Sentence denotes Full length Akt or a mutant lacking both the PH domain and the Myr tag did not support the activation of cell death or increased Thr308 phosphorylation following zVAD.fmk addition under serum free conditions (Fig. S8A,B).
T201 31857-32078 Sentence denotes Full length Akt or a mutant lacking both the PH domain and the Myr tag did not support the activation of cell death or increased Thr308 phosphorylation following zVAD.fmk addition under serum free conditions (Fig. S8A,B).
T202 32079-32206 Sentence denotes Second, we found a specific and critical role for Thr308 phosphorylation in the regulation of the necroptotic functions of Akt.
T13713 32079-32361 Sentence denotes Second, we found a specific and critical role for Thr308 phosphorylation in the regulation of the necroptotic functions of Akt. It has been reported that Ala mutations at Thr308 and Ser473 cause a reduction in the catalytic activity of Akt, while Asp mutants increase activity [38].
T203 32207-32361 Sentence denotes It has been reported that Ala mutations at Thr308 and Ser473 cause a reduction in the catalytic activity of Akt, while Asp mutants increase activity [38].
T13714 32362-32441 Sentence denotes We examined the effect of Ala and Asp mutants at both sites during necroptosis.
T204 32362-32441 Sentence denotes We examined the effect of Ala and Asp mutants at both sites during necroptosis.
T13715 32442-32598 Sentence denotes In our hands, both Asp mutants displayed activity comparable to wild type Akt, while both Ala mutants displayed comparable decreases in activity (Fig. S8C).
T205 32442-32598 Sentence denotes In our hands, both Asp mutants displayed activity comparable to wild type Akt, while both Ala mutants displayed comparable decreases in activity (Fig. S8C).
T13716 32599-32753 Sentence denotes Despite similar catalytic activities, Thr308 and Ser473 mutants displayed major differences in their ability to promote necroptotic changes (Fig. 7E,F,G).
T206 32599-32753 Sentence denotes Despite similar catalytic activities, Thr308 and Ser473 mutants displayed major differences in their ability to promote necroptotic changes (Fig. 7E,F,G).
T13717 32754-32962 Sentence denotes As expected, the S473D mutant, which was phosphorylated on Thr308 after the addition of zVAD, displayed only slightly reduced activity, while S473A was significantly less active in all aspects of necroptosis.
T207 32754-32962 Sentence denotes As expected, the S473D mutant, which was phosphorylated on Thr308 after the addition of zVAD, displayed only slightly reduced activity, while S473A was significantly less active in all aspects of necroptosis.
T13718 32963-33167 Sentence denotes S473A was unable to be efficiently phosphorylated on Thr308 possibly due to the inability of the Ala mutated 473 site to be phosphorylated and provide a docking site for PDK1 to phosphorylate Thr308 [39].
T208 32963-33167 Sentence denotes S473A was unable to be efficiently phosphorylated on Thr308 possibly due to the inability of the Ala mutated 473 site to be phosphorylated and provide a docking site for PDK1 to phosphorylate Thr308 [39].
T13719 33168-33319 Sentence denotes Strikingly, both Ala and Asp mutants of Thr308 were significantly less active in promoting cell death, phosphorylation of JNK and c-Jun, and TNFα mRNA.
T209 33168-33319 Sentence denotes Strikingly, both Ala and Asp mutants of Thr308 were significantly less active in promoting cell death, phosphorylation of JNK and c-Jun, and TNFα mRNA.
T13720 33320-33569 Sentence denotes This suggests that T308D, in spite of being an active Akt construct, may not be a perfect mimic of phosphorylation and this mutant form of the kinase may not have sufficient activity to phosphorylate the entire repertoire of substrates in the cells.
T210 33320-33569 Sentence denotes This suggests that T308D, in spite of being an active Akt construct, may not be a perfect mimic of phosphorylation and this mutant form of the kinase may not have sufficient activity to phosphorylate the entire repertoire of substrates in the cells.
T13721 33570-33784 Sentence denotes When tested, T308D did not support the downstream phosphorylation of several substrates that were phosphorylated by the Myr-Akt construct in the presence of zVAD including FoxO1, Foxo4, MDM2, and p70S6K (Fig. S8D).
T211 33570-33784 Sentence denotes When tested, T308D did not support the downstream phosphorylation of several substrates that were phosphorylated by the Myr-Akt construct in the presence of zVAD including FoxO1, Foxo4, MDM2, and p70S6K (Fig. S8D).
T13722 33785-34067 Sentence denotes Our model, based on these results, is that necroptosis-specific Thr308 phosphorylation provides a critical link between necroptotic machinery and Akt kinase, allowing Akt to phosphorylate substrates during necroptosis, promote TNFα synthesis, JNK activation and eventual cell death.
T212 33785-34067 Sentence denotes Our model, based on these results, is that necroptosis-specific Thr308 phosphorylation provides a critical link between necroptotic machinery and Akt kinase, allowing Akt to phosphorylate substrates during necroptosis, promote TNFα synthesis, JNK activation and eventual cell death.
T16826 34069-34117 Sentence denotes Akt Controls TNFα Production in Other Cell Types
T213 34069-34117 Sentence denotes Akt Controls TNFα Production in Other Cell Types
T16827 34118-34302 Sentence denotes After establishing the role of RIP1 kinase-dependent signaling to Akt in L929 cells, we sought to expand our study to other cell types that are known to undergo necroptotic cell death.
T214 34118-34302 Sentence denotes After establishing the role of RIP1 kinase-dependent signaling to Akt in L929 cells, we sought to expand our study to other cell types that are known to undergo necroptotic cell death.
T16828 34303-34545 Sentence denotes Fas-associated protein with death domain (FADD)-deficient Jurkat T lymphocytes and the macrophage cell lines (J774A.1 and RAW264.7) are other models of necroptosis, which can be induced by stimulation with TNFα or zVAD.fmk, respectively [17].
T215 34303-34545 Sentence denotes Fas-associated protein with death domain (FADD)-deficient Jurkat T lymphocytes and the macrophage cell lines (J774A.1 and RAW264.7) are other models of necroptosis, which can be induced by stimulation with TNFα or zVAD.fmk, respectively [17].
T16829 34546-34704 Sentence denotes Similar to L929 cells, a RIP1 kinase dependent increase in the phosphorylation of Thr308 on Akt occurred during necroptosis (Fig. 8B,D,F) in these cell types.
T216 34546-34704 Sentence denotes Similar to L929 cells, a RIP1 kinase dependent increase in the phosphorylation of Thr308 on Akt occurred during necroptosis (Fig. 8B,D,F) in these cell types.
T16830 34705-34869 Sentence denotes Furthermore, TNFα mRNA levels were increased in each of these cell types during necroptosis and efficiently inhibited by both RIP1 and Akt inhibitors (Fig. 8A,C,E).
T217 34705-34869 Sentence denotes Furthermore, TNFα mRNA levels were increased in each of these cell types during necroptosis and efficiently inhibited by both RIP1 and Akt inhibitors (Fig. 8A,C,E).
T16831 34870-34951 Sentence denotes However, inhibition of Akt did not protect these cells from death (Fig. S9A,B,C).
T218 34870-34951 Sentence denotes However, inhibition of Akt did not protect these cells from death (Fig. S9A,B,C).
T16832 34952-35209 Sentence denotes These results indicate that regulation of autocrine TNFα synthesis and necroptosis-associated inflammatory signaling may be a more important function of Akt pathway activation by RIP1 kinase in multiple cell types compared to its contribution to cell death.
T219 34952-35209 Sentence denotes These results indicate that regulation of autocrine TNFα synthesis and necroptosis-associated inflammatory signaling may be a more important function of Akt pathway activation by RIP1 kinase in multiple cell types compared to its contribution to cell death.
T220 35210-35332 Sentence denotes 10.1371/journal.pone.0056576.g008 Figure 8 Akt signaling contributes to autocrine TNFα production in multiple cell types.
T31846 35254-35332 Sentence denotes Akt signaling contributes to autocrine TNFα production in multiple cell types.
T31847 35333-35512 Sentence denotes FADD deficient Jurkat cells were treated with TNFα followed by measurement of (A) human TNFα mRNA levels by qRT-PCR and normalized using human 18S RNA or (B) western blot at 9 hr.
T221 35333-35512 Sentence denotes FADD deficient Jurkat cells were treated with TNFα followed by measurement of (A) human TNFα mRNA levels by qRT-PCR and normalized using human 18S RNA or (B) western blot at 9 hr.
T31848 35513-36020 Sentence denotes RAW 264.7 or J774A.1 cells were treated with zVAD.fmk (100 uM or 50 uM respectively) followed by (C,E) measurement of TNFα mRNA levels by qRT-PCR or (D,F) western blot at 9 hr. (G) Akt null mouse lung fibroblasts expressing Myr-Akt or K179M were treated with zVAD.fmk and TNFα followed by measurement of TNFα mRNA levels by qRT-PCR at 9 hr. (H) Mouse lung fibroblasts expressing only endogenous Akt1 or Akt2 were treated with zVAD.fmk and TNFα followed by measurement of TNFα mRNA levels by qRT-PCR at 9 hr.
T222 35513-36020 Sentence denotes RAW 264.7 or J774A.1 cells were treated with zVAD.fmk (100 uM or 50 uM respectively) followed by (C,E) measurement of TNFα mRNA levels by qRT-PCR or (D,F) western blot at 9 hr. (G) Akt null mouse lung fibroblasts expressing Myr-Akt or K179M were treated with zVAD.fmk and TNFα followed by measurement of TNFα mRNA levels by qRT-PCR at 9 hr. (H) Mouse lung fibroblasts expressing only endogenous Akt1 or Akt2 were treated with zVAD.fmk and TNFα followed by measurement of TNFα mRNA levels by qRT-PCR at 9 hr.
T16833 36021-36103 Sentence denotes We next chose to look at the role of Akt in necroptosis in mouse lung fibroblasts.
T223 36021-36103 Sentence denotes We next chose to look at the role of Akt in necroptosis in mouse lung fibroblasts.
T16834 36104-36261 Sentence denotes Lung fibroblasts selected to survive after deletion of all three Akt isoforms [40] were resistant to cell death induced by the addition of TNFα and zVAD.fmk.
T224 36104-36261 Sentence denotes Lung fibroblasts selected to survive after deletion of all three Akt isoforms [40] were resistant to cell death induced by the addition of TNFα and zVAD.fmk.
T16835 36262-36445 Sentence denotes Expression of catalytically active Akt (Myr-Akt) in these cells restored TNFα mRNA production in response to TNFα and zVAD.fmk (Fig. 8G) without re-establishing cell death (Fig. S9D).
T225 36262-36445 Sentence denotes Expression of catalytically active Akt (Myr-Akt) in these cells restored TNFα mRNA production in response to TNFα and zVAD.fmk (Fig. 8G) without re-establishing cell death (Fig. S9D).
T16836 36446-36731 Sentence denotes Consistent with our earlier Akt knockdown data, lung fibroblasts expressing endogenous Akt1 or Akt2 were phosphorylated on Thr308 in response to TNFα and zVAD.fmk (Fig. S9E) and in both cases robust RIP1-dependent TNFα mRNA upregulation occurred under necroptotic conditions (Fig. 8H).
T226 36446-36731 Sentence denotes Consistent with our earlier Akt knockdown data, lung fibroblasts expressing endogenous Akt1 or Akt2 were phosphorylated on Thr308 in response to TNFα and zVAD.fmk (Fig. S9E) and in both cases robust RIP1-dependent TNFα mRNA upregulation occurred under necroptotic conditions (Fig. 8H).
T16837 36732-37013 Sentence denotes These data further support the notion that Akt activity is critical for autocrine TNFα synthesis, even in the absence of necroptotic cell death, indicating an unexpected differentiation between Akt-mediated inflammatory signaling under necroptotic conditions and cell death per se.
T227 36732-37013 Sentence denotes These data further support the notion that Akt activity is critical for autocrine TNFα synthesis, even in the absence of necroptotic cell death, indicating an unexpected differentiation between Akt-mediated inflammatory signaling under necroptotic conditions and cell death per se.
T18312 37015-37087 Sentence denotes Model of RIP1, Akt and JNK Dependent Signaling in Necroptotic L929 Cells
T228 37015-37087 Sentence denotes Model of RIP1, Akt and JNK Dependent Signaling in Necroptotic L929 Cells
T18313 37088-37272 Sentence denotes In this study we investigated RIP1 kinase-dependent signaling pathways using mouse fibrosarcoma L929 cells that die by necroptosis when treated with the pan-caspase inhibitor zVAD.fmk.
T229 37088-37272 Sentence denotes In this study we investigated RIP1 kinase-dependent signaling pathways using mouse fibrosarcoma L929 cells that die by necroptosis when treated with the pan-caspase inhibitor zVAD.fmk.
T18314 37273-37472 Sentence denotes Altogether, our results suggest that Akt kinase is specifically engaged in signaling downstream from RIP1 kinase, which leads to a selective increase in its phosphorylation on Thr308, but not Ser473.
T230 37273-37472 Sentence denotes Altogether, our results suggest that Akt kinase is specifically engaged in signaling downstream from RIP1 kinase, which leads to a selective increase in its phosphorylation on Thr308, but not Ser473.
T18315 37473-37582 Sentence denotes According to our model (Fig. 9), necroptosis-associated phosphorylation of Akt requires two distinct signals.
T231 37473-37582 Sentence denotes According to our model (Fig. 9), necroptosis-associated phosphorylation of Akt requires two distinct signals.
T232 37583-37685 Sentence denotes The first input, which is induced by growth factors, leads to the plasma membrane localization of Akt.
T18316 37583-37804 Sentence denotes The first input, which is induced by growth factors, leads to the plasma membrane localization of Akt. Expression of a constitutively membrane-targeted Akt construct, Myr-Akt, overcomes the requirement for growth factors.
T233 37686-37804 Sentence denotes Expression of a constitutively membrane-targeted Akt construct, Myr-Akt, overcomes the requirement for growth factors.
T18317 37805-37902 Sentence denotes At the same time, expression of Myr-Akt alone is not sufficient for the induction of necroptosis.
T234 37805-37902 Sentence denotes At the same time, expression of Myr-Akt alone is not sufficient for the induction of necroptosis.
T18318 37903-38084 Sentence denotes A second, RIP1 kinase-dependent input is required for Thr308 phosphorylation of Akt in response to caspase inhibition and is essential for the propagation of the necroptotic signal.
T235 37903-38084 Sentence denotes A second, RIP1 kinase-dependent input is required for Thr308 phosphorylation of Akt in response to caspase inhibition and is essential for the propagation of the necroptotic signal.
T236 38085-38202 Sentence denotes 10.1371/journal.pone.0056576.g009 Figure 9 Model of RIP1, Akt and JNK dependent signaling in necroptotic L929 cells.
T32301 38129-38202 Sentence denotes Model of RIP1, Akt and JNK dependent signaling in necroptotic L929 cells.
T32302 38203-38309 Sentence denotes Akt phosphorylation at Thr308 during necroptosis requires inputs from both growth factors and RIP1 kinase.
T237 38203-38309 Sentence denotes Akt phosphorylation at Thr308 during necroptosis requires inputs from both growth factors and RIP1 kinase.
T32303 38310-38370 Sentence denotes Downstream from Akt, JNK activation leads to TNFα synthesis.
T238 38310-38370 Sentence denotes Downstream from Akt, JNK activation leads to TNFα synthesis.
T32304 38371-38555 Sentence denotes Activation of Akt during necroptosis also leads the phosphorylation of several known Akt substrates, such as mTOR, which contribute to the execution of necroptotic death in L929 cells.
T239 38371-38555 Sentence denotes Activation of Akt during necroptosis also leads the phosphorylation of several known Akt substrates, such as mTOR, which contribute to the execution of necroptotic death in L929 cells.
T18319 38556-38744 Sentence denotes Using Akt inhibitors, knockdown of Akt isoforms, and the expression of Akt mutants, we showed that necroptotic activation of Akt is indispensable for this form of cell death in L929 cells.
T240 38556-38744 Sentence denotes Using Akt inhibitors, knockdown of Akt isoforms, and the expression of Akt mutants, we showed that necroptotic activation of Akt is indispensable for this form of cell death in L929 cells.
T18320 38745-38831 Sentence denotes We also investigated downstream Akt-dependent pathways that contribute to necroptosis.
T241 38745-38831 Sentence denotes We also investigated downstream Akt-dependent pathways that contribute to necroptosis.
T18321 38832-39087 Sentence denotes First, we demonstrated that selective necroptotic phosphorylation of Thr308 of Akt is sufficient to increase its activity towards a number of known substrates and Akt effector pathways such as the mTORC1 pathway, which, in turn, contributes to cell death.
T242 38832-39087 Sentence denotes First, we demonstrated that selective necroptotic phosphorylation of Thr308 of Akt is sufficient to increase its activity towards a number of known substrates and Akt effector pathways such as the mTORC1 pathway, which, in turn, contributes to cell death.
T18322 39088-39364 Sentence denotes Second, our data suggested that Akt activation provides a pivotal link connecting RIP1 kinase to known downstream signaling and execution events in necroptotic L929 cells, namely, JNK activation and autocrine TNFα synthesis, a critical event in necroptosis in L929 cells [15].
T243 39088-39364 Sentence denotes Second, our data suggested that Akt activation provides a pivotal link connecting RIP1 kinase to known downstream signaling and execution events in necroptotic L929 cells, namely, JNK activation and autocrine TNFα synthesis, a critical event in necroptosis in L929 cells [15].
T18323 39365-39493 Sentence denotes In order to further test our model, we examined Akt phosphorylation after inhibition of a downstream kinase in the pathway, JNK.
T244 39365-39493 Sentence denotes In order to further test our model, we examined Akt phosphorylation after inhibition of a downstream kinase in the pathway, JNK.
T18324 39494-39725 Sentence denotes However, we found that SP600125, which protected L929 cells from death and inhibited TNFα production (Fig. 2A,B S2A S10A), inhibited both basal and post-treatment phosphorylation levels of Akt at both Ser473 and Thr308 (Fig. S10B).
T245 39494-39725 Sentence denotes However, we found that SP600125, which protected L929 cells from death and inhibited TNFα production (Fig. 2A,B S2A S10A), inhibited both basal and post-treatment phosphorylation levels of Akt at both Ser473 and Thr308 (Fig. S10B).
T18325 39726-39861 Sentence denotes It has been published that SP600125 is a somewhat non-specific inhibitor that may inhibit the p110δ subunit of PI3K [41] and PDK1 [42].
T246 39726-39861 Sentence denotes It has been published that SP600125 is a somewhat non-specific inhibitor that may inhibit the p110δ subunit of PI3K [41] and PDK1 [42].
T18326 39862-39989 Sentence denotes Both of these off-target effects could inhibit basal Akt phosphorylation levels, precluding the use of SP600125 in this system.
T247 39862-39989 Sentence denotes Both of these off-target effects could inhibit basal Akt phosphorylation levels, precluding the use of SP600125 in this system.
T18327 39990-40147 Sentence denotes Therefore, to examine the role of JNK, we switched to a more specific JNK inhibitor, JNK inhibitor VIII [43], and siRNAs against JNK1 and JNK2 (Fig. S10B–G).
T248 39990-40147 Sentence denotes Therefore, to examine the role of JNK, we switched to a more specific JNK inhibitor, JNK inhibitor VIII [43], and siRNAs against JNK1 and JNK2 (Fig. S10B–G).
T18328 40148-40339 Sentence denotes As expected, specific inhibition or knockdown of JNK1/2 allowed phosphorylation of Akt on Thr308 while inhibiting the phosphorylation of c-Jun at Ser63 (Fig. S10B,E), agreeing with our model.
T249 40148-40339 Sentence denotes As expected, specific inhibition or knockdown of JNK1/2 allowed phosphorylation of Akt on Thr308 while inhibiting the phosphorylation of c-Jun at Ser63 (Fig. S10B,E), agreeing with our model.
T18329 40340-40574 Sentence denotes It did not, however, lead to a reduction in TNFα production or cell death (Fig. S10C,D,F,G), suggesting that earlier data with SP600125 protection (Fig. 2) could reflect off-target effects of this molecule, rather than JNK inhibition.
T250 40340-40574 Sentence denotes It did not, however, lead to a reduction in TNFα production or cell death (Fig. S10C,D,F,G), suggesting that earlier data with SP600125 protection (Fig. 2) could reflect off-target effects of this molecule, rather than JNK inhibition.
T18330 40575-40771 Sentence denotes Previous reports also suggested a critical role for c-Jun in necroptosis and autocrine TNFα synthesis [13], [14], [15] and we confirmed these conclusions using c-Jun siRNA knockdown (Fig. S10H–J).
T251 40575-40771 Sentence denotes Previous reports also suggested a critical role for c-Jun in necroptosis and autocrine TNFα synthesis [13], [14], [15] and we confirmed these conclusions using c-Jun siRNA knockdown (Fig. S10H–J).
T18331 40772-40865 Sentence denotes Notably, in this case, Thr308 phosphorylation was reduced after the induction of necroptosis.
T252 40772-40865 Sentence denotes Notably, in this case, Thr308 phosphorylation was reduced after the induction of necroptosis.
T253 40866-40996 Sentence denotes Thus, autocrine TNFα production, dependent on c-Jun, may create a feedback loop that contributes to the delayed activation of Akt.
T18332 40866-41196 Sentence denotes Thus, autocrine TNFα production, dependent on c-Jun, may create a feedback loop that contributes to the delayed activation of Akt. It is also important to note that we observed an overall increase in the protein level of c-Jun after treatment of L929 cells with zVAD.fmk or TNFα, which was both Akt and mTOR-dependent (Fig. 6E,F).
T254 40997-41196 Sentence denotes It is also important to note that we observed an overall increase in the protein level of c-Jun after treatment of L929 cells with zVAD.fmk or TNFα, which was both Akt and mTOR-dependent (Fig. 6E,F).
T18333 41197-41503 Sentence denotes These new data led us to an unexpected, but important conclusion that c-Jun is critical for necroptosis, while JNK activity may serve as a useful marker of pathway activation, but may be either redundant (e.g. phosphorylation of c-Jun on a site other than Ser63 may occur [44]) or dispensable functionally.
T255 41197-41503 Sentence denotes These new data led us to an unexpected, but important conclusion that c-Jun is critical for necroptosis, while JNK activity may serve as a useful marker of pathway activation, but may be either redundant (e.g. phosphorylation of c-Jun on a site other than Ser63 may occur [44]) or dispensable functionally.
T18334 41504-41605 Sentence denotes In addition, researchers need to use caution when using SP600125 due to potantial off-target effects.
T256 41504-41605 Sentence denotes In addition, researchers need to use caution when using SP600125 due to potantial off-target effects.
T257 41607-41617 Sentence denotes Discussion
T20934 41618-41834 Sentence denotes Altogether, our results suggest that Akt kinase is specifically engaged in the signaling downstream from RIP1 kinase, which exerts its activity through promoting a selective increase in Akt phosphorylation on Thr308.
T258 41618-41834 Sentence denotes Altogether, our results suggest that Akt kinase is specifically engaged in the signaling downstream from RIP1 kinase, which exerts its activity through promoting a selective increase in Akt phosphorylation on Thr308.
T20935 41835-42033 Sentence denotes This provides a link connecting RIP1 kinase to downstream signaling and execution events during necroptosis in L929 cells, including JNK activation, autocrine TNFα synthesis and eventual cell death.
T259 41835-42033 Sentence denotes This provides a link connecting RIP1 kinase to downstream signaling and execution events during necroptosis in L929 cells, including JNK activation, autocrine TNFα synthesis and eventual cell death.
T20936 42034-42111 Sentence denotes According to our model, phosphorylation of Akt requires two distinct signals.
T260 42034-42111 Sentence denotes According to our model, phosphorylation of Akt requires two distinct signals.
T261 42112-42214 Sentence denotes The first input, which is induced by growth factors, leads to the plasma membrane localization of Akt.
T20937 42112-42304 Sentence denotes The first input, which is induced by growth factors, leads to the plasma membrane localization of Akt. Expression of constitutively active membrane-targeted Myr-Akt overcomes this requirement.
T262 42215-42304 Sentence denotes Expression of constitutively active membrane-targeted Myr-Akt overcomes this requirement.
T20938 42305-42446 Sentence denotes At the same time, expression of Myr-Akt is not sufficient for the induction of necroptosis or efficient activation of JNK and TNFα synthesis.
T263 42305-42446 Sentence denotes At the same time, expression of Myr-Akt is not sufficient for the induction of necroptosis or efficient activation of JNK and TNFα synthesis.
T20939 42447-42584 Sentence denotes A second, RIP1 kinase-dependent input is required for Thr308 phosphorylation of Akt, which in turn is required for necroptotic signaling.
T264 42447-42584 Sentence denotes A second, RIP1 kinase-dependent input is required for Thr308 phosphorylation of Akt, which in turn is required for necroptotic signaling.
T20940 42585-42881 Sentence denotes Necroptotic phosphorylation of Thr308 of Akt is sufficient to increase its activity towards a number of known substrates in L929 cells and our data reveal that the Akt effector pathway downstream of mTORC1 contributes to necroptosis, thereby identifying a new mediator of this form of cell death.
T265 42585-42881 Sentence denotes Necroptotic phosphorylation of Thr308 of Akt is sufficient to increase its activity towards a number of known substrates in L929 cells and our data reveal that the Akt effector pathway downstream of mTORC1 contributes to necroptosis, thereby identifying a new mediator of this form of cell death.
T20941 42882-42999 Sentence denotes Our results raise some important mechanistic questions relevant to the specific regulation of Akt during necroptosis.
T266 42882-42999 Sentence denotes Our results raise some important mechanistic questions relevant to the specific regulation of Akt during necroptosis.
T20942 43000-43090 Sentence denotes First, what is the mechanism of the RIP1-dependent increase in Akt Thr308 phosphorylation?
T267 43000-43090 Sentence denotes First, what is the mechanism of the RIP1-dependent increase in Akt Thr308 phosphorylation?
T20943 43091-43170 Sentence denotes One possibility is that RIP1 kinase inhibits a phosphatase that targets Thr308.
T268 43091-43170 Sentence denotes One possibility is that RIP1 kinase inhibits a phosphatase that targets Thr308.
T20944 43171-43275 Sentence denotes To our knowledge, PP2A is the only enzyme established to specifically dephosphorylate this residue [45].
T269 43171-43275 Sentence denotes To our knowledge, PP2A is the only enzyme established to specifically dephosphorylate this residue [45].
T20945 43276-43421 Sentence denotes However, we did not observe any effect of the PP2A inhibitor, okadaic acid, on Thr308 phosphorylation or activation of necroptosis in L929 cells.
T270 43276-43421 Sentence denotes However, we did not observe any effect of the PP2A inhibitor, okadaic acid, on Thr308 phosphorylation or activation of necroptosis in L929 cells.
T20946 43422-43579 Sentence denotes Another possibility is that the increase in Thr308 results from RIP1 kinase targeting PDK1, Akt or scaffolding factors that bring these two kinases together.
T271 43422-43579 Sentence denotes Another possibility is that the increase in Thr308 results from RIP1 kinase targeting PDK1, Akt or scaffolding factors that bring these two kinases together.
T20947 43580-43714 Sentence denotes Interestingly, we observed phosphorylation of Akt by recombinant RIP1 kinase in vitro on Thr146, 195/197, and 435 and Ser381 residues.
T272 43580-43714 Sentence denotes Interestingly, we observed phosphorylation of Akt by recombinant RIP1 kinase in vitro on Thr146, 195/197, and 435 and Ser381 residues.
T20948 43715-43826 Sentence denotes Furthermore, mutating these residues to Ala in Myr-Akt leads to the loss of its ability to promote necroptosis.
T273 43715-43826 Sentence denotes Furthermore, mutating these residues to Ala in Myr-Akt leads to the loss of its ability to promote necroptosis.
T20949 43827-44181 Sentence denotes However, we were not able to confirm phosphorylation of these residues on endogenous Akt in L929 cells using either mass spectrometry or western blotting with a phospho-specific antibody raised against Thr435 peptide, suggesting that direct phosphorylation of Akt by RIP1 likely represents an in vitro artifact and does not reflect endogenous regulation.
T274 43827-44181 Sentence denotes However, we were not able to confirm phosphorylation of these residues on endogenous Akt in L929 cells using either mass spectrometry or western blotting with a phospho-specific antibody raised against Thr435 peptide, suggesting that direct phosphorylation of Akt by RIP1 likely represents an in vitro artifact and does not reflect endogenous regulation.
T20950 44182-44272 Sentence denotes Second, what are the key substrates of Akt that promote necrotic death and TNFα synthesis?
T275 44182-44272 Sentence denotes Second, what are the key substrates of Akt that promote necrotic death and TNFα synthesis?
T20951 44273-44385 Sentence denotes On the one hand, our data suggest new roles for Akt effector pathways mediated by mTORC1 in necroptotic control.
T276 44273-44385 Sentence denotes On the one hand, our data suggest new roles for Akt effector pathways mediated by mTORC1 in necroptotic control.
T20952 44386-44559 Sentence denotes On the other hand, we have observed only modest changes in mTORC1 activity under necroptotic conditions, suggesting that additional Akt substrates are likely to be involved.
T277 44386-44559 Sentence denotes On the other hand, we have observed only modest changes in mTORC1 activity under necroptotic conditions, suggesting that additional Akt substrates are likely to be involved.
T20953 44560-44702 Sentence denotes This warrants a re-evaluation of the roles of additional Akt substrates in necroptotic death, since no such connections have been established.
T278 44560-44702 Sentence denotes This warrants a re-evaluation of the roles of additional Akt substrates in necroptotic death, since no such connections have been established.
T20954 44703-44778 Sentence denotes Similarly, the mechanisms connecting mTORC1 to JNK remain to be elucidated.
T279 44703-44778 Sentence denotes Similarly, the mechanisms connecting mTORC1 to JNK remain to be elucidated.
T20955 44779-44951 Sentence denotes While there are some recent examples of mTORC1-dependent regulation of JNK, e.g. following ER stress [46], the exact mechanisms during necroptosis remain to be established.
T280 44779-44951 Sentence denotes While there are some recent examples of mTORC1-dependent regulation of JNK, e.g. following ER stress [46], the exact mechanisms during necroptosis remain to be established.
T20956 44952-45183 Sentence denotes Given the activation of JNK by TNFα and the importance of mTORC1-dependent translational control in necroptosis, one possibility is that mTORC1 contributes to the translation of TNFα and forms a positive feed forward loop with JNK.
T281 44952-45183 Sentence denotes Given the activation of JNK by TNFα and the importance of mTORC1-dependent translational control in necroptosis, one possibility is that mTORC1 contributes to the translation of TNFα and forms a positive feed forward loop with JNK.
T20957 45184-45380 Sentence denotes Akt’s role as a key inhibitor of apoptosis is well documented, however, evidence of its contribution as a mediator of cell death under various circumstances has begun to emerge as well [45], [47].
T282 45184-45380 Sentence denotes Akt’s role as a key inhibitor of apoptosis is well documented, however, evidence of its contribution as a mediator of cell death under various circumstances has begun to emerge as well [45], [47].
T20958 45381-45468 Sentence denotes Our data demonstrates a new mode of necrosis-specific regulation of Akt by RIP1 kinase.
T283 45381-45468 Sentence denotes Our data demonstrates a new mode of necrosis-specific regulation of Akt by RIP1 kinase.
T20959 45469-45685 Sentence denotes Importantly, while it is possible that necroptosis-specific targets of Akt exist, this regulation clearly involves a number of well established Akt targets including mTORC1, and potentially, GSK-3, FoxO1/4, and MDM2.
T284 45469-45685 Sentence denotes Importantly, while it is possible that necroptosis-specific targets of Akt exist, this regulation clearly involves a number of well established Akt targets including mTORC1, and potentially, GSK-3, FoxO1/4, and MDM2.
T20960 45686-45852 Sentence denotes Therefore, it may no longer be safe to assume that activation of Akt universally reflects pro-survival signaling nor that its inhibition will lead to more cell death.
T285 45686-45852 Sentence denotes Therefore, it may no longer be safe to assume that activation of Akt universally reflects pro-survival signaling nor that its inhibition will lead to more cell death.
T20961 45853-46066 Sentence denotes It is tempting to speculate that rather than serving a universally pro-survival role, the Akt pathway may function to promote cell fates alternative to apoptosis, ranging from survival to non-apoptotic cell death.
T286 45853-46066 Sentence denotes It is tempting to speculate that rather than serving a universally pro-survival role, the Akt pathway may function to promote cell fates alternative to apoptosis, ranging from survival to non-apoptotic cell death.
T20962 46067-46281 Sentence denotes The final decision between survival and death may depend on additional, Akt-independent inputs, such as the status of RIP1 kinase, expression of particular oncogenic factors [45] or excessive metabolic stress [47].
T287 46067-46281 Sentence denotes The final decision between survival and death may depend on additional, Akt-independent inputs, such as the status of RIP1 kinase, expression of particular oncogenic factors [45] or excessive metabolic stress [47].
T20963 46282-46395 Sentence denotes Another mechanism that should be considered in conjunction with the regulation of cell death by Akt is autophagy.
T288 46282-46395 Sentence denotes Another mechanism that should be considered in conjunction with the regulation of cell death by Akt is autophagy.
T20964 46396-46480 Sentence denotes Akt activation leads to the inhibition of autophagy through activation of mTOR [48].
T289 46396-46480 Sentence denotes Akt activation leads to the inhibition of autophagy through activation of mTOR [48].
T20965 46481-46614 Sentence denotes The role of autophagy in cell death in general is very complex and it can both promote and inhibit necroptosis in various situations.
T290 46481-46614 Sentence denotes The role of autophagy in cell death in general is very complex and it can both promote and inhibit necroptosis in various situations.
T20966 46615-46736 Sentence denotes Several studies suggested that activation of autophagy promotes necroptosis induced by zVAD.fmk in L929 cells [11], [14].
T291 46615-46736 Sentence denotes Several studies suggested that activation of autophagy promotes necroptosis induced by zVAD.fmk in L929 cells [11], [14].
T20967 46737-46861 Sentence denotes Others, including ourselves in unpublished data, have found that inihibition of autophagy promotes necroptosis by TNFα [49].
T292 46737-46861 Sentence denotes Others, including ourselves in unpublished data, have found that inihibition of autophagy promotes necroptosis by TNFα [49].
T20968 46862-47091 Sentence denotes This suggests that the inhibition of autophagy by Akt or mTOR in our system may contribute to necroptosis induced by TNFα, however, it is more difficult to reconcile with the positive role of these proteins in zVAD-induced death.
T293 46862-47091 Sentence denotes This suggests that the inhibition of autophagy by Akt or mTOR in our system may contribute to necroptosis induced by TNFα, however, it is more difficult to reconcile with the positive role of these proteins in zVAD-induced death.
T20969 47092-47306 Sentence denotes Clearly, further identification of the factors differentiating between pro-death and pro-survival autophagy in mammalian cells is required to better understand its role in the regulation necroptosis by Akt pathway.
T294 47092-47306 Sentence denotes Clearly, further identification of the factors differentiating between pro-death and pro-survival autophagy in mammalian cells is required to better understand its role in the regulation necroptosis by Akt pathway.
T20970 47307-47458 Sentence denotes Importantly, our data revealed that RIP1 kinase signaling to Akt is a general feature of necroptotic signaling that is observed in multiple cell types.
T295 47307-47458 Sentence denotes Importantly, our data revealed that RIP1 kinase signaling to Akt is a general feature of necroptotic signaling that is observed in multiple cell types.
T20971 47459-47552 Sentence denotes At the same time, the significance of this connection varies in a cell type specific fashion.
T296 47459-47552 Sentence denotes At the same time, the significance of this connection varies in a cell type specific fashion.
T20972 47553-47777 Sentence denotes Importantly, in mouse lung fibroblasts, FADD-deficient Jurkat cells, and macrophages, Akt signaling contributed more prominently to an increase in TNFα synthesis, rather than cell death per se, unlike its role in L929 cells.
T297 47553-47777 Sentence denotes Importantly, in mouse lung fibroblasts, FADD-deficient Jurkat cells, and macrophages, Akt signaling contributed more prominently to an increase in TNFα synthesis, rather than cell death per se, unlike its role in L929 cells.
T20973 47778-47926 Sentence denotes A recent study [15] has demonstrated that, in addition to its role in necroptosis, RIP1 plays an important role in mediating the production of TNFα.
T298 47778-47926 Sentence denotes A recent study [15] has demonstrated that, in addition to its role in necroptosis, RIP1 plays an important role in mediating the production of TNFα.
T20974 47927-48162 Sentence denotes These data emphasize the emerging complexity of necroptotic signaling mechanisms and highlight the major contribution of Akt to increased inflammatory signaling, specifically accompanying this form of regulated necrosis [5], [6], [10].
T299 47927-48162 Sentence denotes These data emphasize the emerging complexity of necroptotic signaling mechanisms and highlight the major contribution of Akt to increased inflammatory signaling, specifically accompanying this form of regulated necrosis [5], [6], [10].
T20975 48163-48347 Sentence denotes Robust inflammation is one of the most important consequences of necrotic cell death as well as its regulated subtype, necroptosis, both in vitro and in vivo [1], [5], [6], [50], [51].
T300 48163-48347 Sentence denotes Robust inflammation is one of the most important consequences of necrotic cell death as well as its regulated subtype, necroptosis, both in vitro and in vivo [1], [5], [6], [50], [51].
T20976 48348-48722 Sentence denotes Our results highlight an important notion that inflammation not only passively accompanies necroptosis in a variety of cellular systems by the virtue of rapid loss of plasma membrane integrity characteristic for necrotic cell death, but also that it is an intrinsic and regulated component of necroptosis due to the specific activation of TNFα synthesis by RIP1/Akt kinases.
T301 48348-48722 Sentence denotes Our results highlight an important notion that inflammation not only passively accompanies necroptosis in a variety of cellular systems by the virtue of rapid loss of plasma membrane integrity characteristic for necrotic cell death, but also that it is an intrinsic and regulated component of necroptosis due to the specific activation of TNFα synthesis by RIP1/Akt kinases.
T20977 48723-48840 Sentence denotes Therefore, this pathway may represent a new molecular target for the inhibition of pathologic inflammatory signaling.
T302 48723-48840 Sentence denotes Therefore, this pathway may represent a new molecular target for the inhibition of pathologic inflammatory signaling.
T20978 48841-48893 Sentence denotes Initial in vivo data appears to support this notion.
T303 48841-48893 Sentence denotes Initial in vivo data appears to support this notion.
T20979 48894-49207 Sentence denotes Two recent papers showed that the loss of control over RIP1/RIP3 kinase activities by FADD and caspase-8 in epithelial cells unleashes a feed forward cycle of necroptosis and TNFα production, resulting in the development of intestinal inflammation in mice and, possibly, in patients with Crohn’s disease [4], [5].
T304 48894-49207 Sentence denotes Two recent papers showed that the loss of control over RIP1/RIP3 kinase activities by FADD and caspase-8 in epithelial cells unleashes a feed forward cycle of necroptosis and TNFα production, resulting in the development of intestinal inflammation in mice and, possibly, in patients with Crohn’s disease [4], [5].
T20980 49208-49509 Sentence denotes This increased production of TNFα during necroptosis may also be important for acute necrotizing diseases, such as necrotizing pancreatitis and acute bacterial infections, where hyper-acute inflammation accompanying necrotic cell death is the primary cause of multiple organ failure and patient death.
T305 49208-49509 Sentence denotes This increased production of TNFα during necroptosis may also be important for acute necrotizing diseases, such as necrotizing pancreatitis and acute bacterial infections, where hyper-acute inflammation accompanying necrotic cell death is the primary cause of multiple organ failure and patient death.
T20981 49510-49659 Sentence denotes Along these lines, another recent paper by Duprez et al. has shown that RIP1 and RIP3 mediate the cellular damage introduced by TNF-induced SIRS [6].
T306 49510-49659 Sentence denotes Along these lines, another recent paper by Duprez et al. has shown that RIP1 and RIP3 mediate the cellular damage introduced by TNF-induced SIRS [6].
T20982 49660-49868 Sentence denotes The role of RIP1 kinase in acute and chronic inflammatory diseases warrants further investigation, as efficient and specific RIP1 kinase inhibitors may offer therapeutic benefit for treating these conditions.
T307 49660-49868 Sentence denotes The role of RIP1 kinase in acute and chronic inflammatory diseases warrants further investigation, as efficient and specific RIP1 kinase inhibitors may offer therapeutic benefit for treating these conditions.
T308 49870-49891 Sentence denotes Materials and Methods
T25129 49893-49915 Sentence denotes Reagents and Chemicals
T309 49893-49915 Sentence denotes Reagents and Chemicals
T25130 49916-49988 Sentence denotes Necrostatin analogs were synthesized as previously described [23], [24].
T310 49916-49988 Sentence denotes Necrostatin analogs were synthesized as previously described [23], [24].
T25131 49989-50115 Sentence denotes The following reagents and final concentrations (unless otherwise specified in the text/figures) were used in the experiments:
T311 49989-50115 Sentence denotes The following reagents and final concentrations (unless otherwise specified in the text/figures) were used in the experiments:
T25132 50116-50716 Sentence denotes Akt inhibitor VIII (10 µM, Calbiochem), MK-2206 (10 µM, Selleck Chem), Triciribine (100 µM, National Cancer Institute), SP600125 (10 µM, Calbiochem), JNK inhibitor VIII (10 µM, Calbiochem), UO126 (10 mM, Cayman Chem), PD169316 (10 µM, Calbiochem), LiCl (10 mM, Sigma), SB216763 (10 µM, Calbiochem), BX912 (10 µM, Axon Med Chem), PF-4706871 (Sigma), rapamycin (100 nM, Santa Cruz), PI-103 (10 µM, Calbiochem), Torin-1 (500 nM, gift of Dr. Nathanael Grey (Harvard Medical School), LY249002 (10 µM, Cell Signaling), PD173074 (2 µM, Cayman Chem), PD166866 (20 µM, Calbiochem), 4EGI-1 (50 µM, Calbiochem).
T312 50116-50716 Sentence denotes Akt inhibitor VIII (10 µM, Calbiochem), MK-2206 (10 µM, Selleck Chem), Triciribine (100 µM, National Cancer Institute), SP600125 (10 µM, Calbiochem), JNK inhibitor VIII (10 µM, Calbiochem), UO126 (10 mM, Cayman Chem), PD169316 (10 µM, Calbiochem), LiCl (10 mM, Sigma), SB216763 (10 µM, Calbiochem), BX912 (10 µM, Axon Med Chem), PF-4706871 (Sigma), rapamycin (100 nM, Santa Cruz), PI-103 (10 µM, Calbiochem), Torin-1 (500 nM, gift of Dr. Nathanael Grey (Harvard Medical School), LY249002 (10 µM, Cell Signaling), PD173074 (2 µM, Cayman Chem), PD166866 (20 µM, Calbiochem), 4EGI-1 (50 µM, Calbiochem).
T313 50717-50785 Sentence denotes Pan-caspase inhibitor zVAD.fmk (20–30 µM) was purchased from Bachem.
T25133 50717-50972 Sentence denotes Pan-caspase inhibitor zVAD.fmk (20–30 µM) was purchased from Bachem. Human and mouse TNFα (10 ng/ml), human bFGF (25 ng/ml), EGF (50 ng/ml), PDGF-BB (20 ng/ml), and IGF-1 (50 ng/ml) were from Cell Sciences or Peprotech. All other reagents were from Sigma.
T314 50786-50936 Sentence denotes Human and mouse TNFα (10 ng/ml), human bFGF (25 ng/ml), EGF (50 ng/ml), PDGF-BB (20 ng/ml), and IGF-1 (50 ng/ml) were from Cell Sciences or Peprotech.
T315 50937-50972 Sentence denotes All other reagents were from Sigma.
T25586 50974-50977 Sentence denotes DNA
T316 50974-50977 Sentence denotes DNA
T25587 50978-51055 Sentence denotes Cloning of Myr-Akt1, containing c-terminal FLAG tag, has been described [52].
T317 50978-51055 Sentence denotes Cloning of Myr-Akt1, containing c-terminal FLAG tag, has been described [52].
T25588 51056-51181 Sentence denotes Myr-Akt1-FLAG was amplified by PCR and subcloned into the BglII and EcoRI sites of pMSCV-puro retroviral vector (Invitrogen).
T318 51056-51181 Sentence denotes Myr-Akt1-FLAG was amplified by PCR and subcloned into the BglII and EcoRI sites of pMSCV-puro retroviral vector (Invitrogen).
T25589 51182-51249 Sentence denotes Mutant versions of Myr-Akt1 were generated using the same strategy.
T319 51182-51249 Sentence denotes Mutant versions of Myr-Akt1 were generated using the same strategy.
T25723 51251-51261 Sentence denotes Antibodies
T320 51251-51261 Sentence denotes Antibodies
T25724 51262-52196 Sentence denotes The following antibodies were used: phospho-Akt (Thr308) (clone C31E5E) rabbit mAb, phospho-Akt (Ser473) (clone D9E) XP rabbit mAb, Akt (pan) (clone C67E7) rabbit mAb, Akt1 (clone C73H10) rabbit mAb, Akt2 (clone D6G4) rabbit mAb, Akt3 (clone 62A8) rabbit mAb, phospho-JNK (Thr183/Tyr185) (81E11) rabbit mAb, SAPK/JNK rabbit pAb, phospho-c-Jun (Ser63) II rabbit pAb, c-Jun (60A8) rabbit mAb, α-tubulin (clone DM1A) mouse mAb, phospho-FoxO1 (Thr24)/FoxO3a (Thr32) rabbit pAb, FoxO1 (L27) rabbit pAb, phospho-FoxO4 (Ser193) rabbit pAb, FoxO4 rabbit pAb, phospho-MDM2 (Ser166) rabbit pAb, phospho-GSK-3α/β (Ser21/9) rabbit pAb, phospho-p70 S6 Kinase (Thr389) (clone 108D2) rabbit mAb, phospho-S6 Ribosomal Protein (Ser235/236) (clone D57.2.2E) XP rabbit mAb, S6 Ribosomal Protein (clone 54D2) mouse mAb, phospho-4E-BP1 (Thr37/46) rabbit pAb, mTOR (clone 7C10) rabbit mAb, PDK1 rabbit pAb (all Cell Signaling), MDM2 rabbit pAb (Bioworlde).
T321 51262-52196 Sentence denotes The following antibodies were used: phospho-Akt (Thr308) (clone C31E5E) rabbit mAb, phospho-Akt (Ser473) (clone D9E) XP rabbit mAb, Akt (pan) (clone C67E7) rabbit mAb, Akt1 (clone C73H10) rabbit mAb, Akt2 (clone D6G4) rabbit mAb, Akt3 (clone 62A8) rabbit mAb, phospho-JNK (Thr183/Tyr185) (81E11) rabbit mAb, SAPK/JNK rabbit pAb, phospho-c-Jun (Ser63) II rabbit pAb, c-Jun (60A8) rabbit mAb, α-tubulin (clone DM1A) mouse mAb, phospho-FoxO1 (Thr24)/FoxO3a (Thr32) rabbit pAb, FoxO1 (L27) rabbit pAb, phospho-FoxO4 (Ser193) rabbit pAb, FoxO4 rabbit pAb, phospho-MDM2 (Ser166) rabbit pAb, phospho-GSK-3α/β (Ser21/9) rabbit pAb, phospho-p70 S6 Kinase (Thr389) (clone 108D2) rabbit mAb, phospho-S6 Ribosomal Protein (Ser235/236) (clone D57.2.2E) XP rabbit mAb, S6 Ribosomal Protein (clone 54D2) mouse mAb, phospho-4E-BP1 (Thr37/46) rabbit pAb, mTOR (clone 7C10) rabbit mAb, PDK1 rabbit pAb (all Cell Signaling), MDM2 rabbit pAb (Bioworlde).
T25989 52198-52210 Sentence denotes QPCR Primers
T322 52198-52210 Sentence denotes QPCR Primers
T25990 52211-52581 Sentence denotes Mouse TNFα: forward 5′-CCCTCACACTCAGATCATCTTCT-3′, reverse 5′-GCTACGACGTGGGCTACAG-3′;mouse 18S: forward 5-′ ATAACAGGTCTGTGATGCCCTTAG-3, reverse 5′-CTAAACCATCCAATCGGTAGTAGC-3′;human TNFα: forward 5′- ATGAGCACTGAAAGCATGATCC-3′, human TNFα: reverse 5′-GAGGGCTGATTAGAGAGAGGTC-3′; human 18S: forward 5′- CAGCCACCCGAGATTGAGCA -3, human 18S: reverse 5′-TAGTAGCGACGGGCGGTGTG-3′.
T323 52211-52581 Sentence denotes Mouse TNFα: forward 5′-CCCTCACACTCAGATCATCTTCT-3′, reverse 5′-GCTACGACGTGGGCTACAG-3′;mouse 18S: forward 5-′ ATAACAGGTCTGTGATGCCCTTAG-3, reverse 5′-CTAAACCATCCAATCGGTAGTAGC-3′;human TNFα: forward 5′- ATGAGCACTGAAAGCATGATCC-3′, human TNFα: reverse 5′-GAGGGCTGATTAGAGAGAGGTC-3′; human 18S: forward 5′- CAGCCACCCGAGATTGAGCA -3, human 18S: reverse 5′-TAGTAGCGACGGGCGGTGTG-3′.
T26191 52583-52593 Sentence denotes Cell Lines
T324 52583-52593 Sentence denotes Cell Lines
T26192 52594-52655 Sentence denotes L929 and FADD-deficient Jurkat cells were obtained from ATCC.
T325 52594-52655 Sentence denotes L929 and FADD-deficient Jurkat cells were obtained from ATCC.
T26193 52656-52741 Sentence denotes Lung fibroblasts were a generous gift of Dr. Philip Tsichlis (Tufts University) [53].
T326 52656-52741 Sentence denotes Lung fibroblasts were a generous gift of Dr. Philip Tsichlis (Tufts University) [53].
T26194 52742-52902 Sentence denotes J774A.1 (ATCC) cells and RAW264.7 (ATCC) cells were generous gifts of Junying Yuan (Harvard University) and Alexander Poltorak (Tufts University), respectively.
T327 52742-52902 Sentence denotes J774A.1 (ATCC) cells and RAW264.7 (ATCC) cells were generous gifts of Junying Yuan (Harvard University) and Alexander Poltorak (Tufts University), respectively.
T26195 52903-53031 Sentence denotes Cells were maintained in DMEM supplemented with 10% fetal bovine serum (FBS) and 1% antibiotic-antimycotic mixture (Invitrogen).
T328 52903-53031 Sentence denotes Cells were maintained in DMEM supplemented with 10% fetal bovine serum (FBS) and 1% antibiotic-antimycotic mixture (Invitrogen).
T26196 53032-53159 Sentence denotes The mouse lung fibroblast media was additionally supplemented with L-glutamine, non-essential amino acids, and sodium pyruvate.
T329 53032-53159 Sentence denotes The mouse lung fibroblast media was additionally supplemented with L-glutamine, non-essential amino acids, and sodium pyruvate.
T26197 53160-53273 Sentence denotes Jurkat cells were maintained in RPMI1640, supplemented with 10% FetalPlex (Gemini) and 1% antibiotic-antimycotic.
T330 53160-53273 Sentence denotes Jurkat cells were maintained in RPMI1640, supplemented with 10% FetalPlex (Gemini) and 1% antibiotic-antimycotic.
T26475 53275-53301 Sentence denotes Cell Viability Experiments
T331 53275-53301 Sentence denotes Cell Viability Experiments
T26476 53302-53448 Sentence denotes Cells were seeded into white clear bottom 96 well plates at the density of 1×104 cells/well and treated as described for western blot experiments.
T332 53302-53448 Sentence denotes Cells were seeded into white clear bottom 96 well plates at the density of 1×104 cells/well and treated as described for western blot experiments.
T26477 53449-53530 Sentence denotes Cell viability was determined using CellTiter-Glo Cell Viability Assay (Promega).
T333 53449-53530 Sentence denotes Cell viability was determined using CellTiter-Glo Cell Viability Assay (Promega).
T26478 53531-53585 Sentence denotes Experiments were performed in duplicate or triplicate.
T334 53531-53585 Sentence denotes Experiments were performed in duplicate or triplicate.
T26479 53586-53643 Sentence denotes Viability of the control untreated cells was set as 100%.
T335 53586-53643 Sentence denotes Viability of the control untreated cells was set as 100%.
T26480 53644-53889 Sentence denotes Relative viability of cells, induced to undergo necroptosis and treated with the compound relative to the control compound-treated cells, was determined and plotted to exclude the possible effects of non-specific toxicity of the small molecules.
T336 53644-53889 Sentence denotes Relative viability of cells, induced to undergo necroptosis and treated with the compound relative to the control compound-treated cells, was determined and plotted to exclude the possible effects of non-specific toxicity of the small molecules.
T26720 53891-53906 Sentence denotes siRNA Knockdown
T337 53891-53906 Sentence denotes siRNA Knockdown
T338 53907-53944 Sentence denotes siRNAs were purchased from Dharmacon.
T26721 53907-54352 Sentence denotes siRNAs were purchased from Dharmacon. Mouse ribosomal S6 protein (L-040893-00 and L-045791-00), mouse Akt1 (L-040709-00), mouse Akt2 (L-040782-00), mouse Akt3 (L-040891-00), mouse mTOR (L-065427-00), mouse PDK1 (L-040658-00), non-coding control (D-001810-10-05), mouse Mapk8 (J-040128-05), mouse Mapk9 (J-040134-05), mouse Jun (L-043776-00). siRNA were transfected using RNAiMAX reagent (Invitrogen), according to manufacturer’s recommendations.
T339 53945-54352 Sentence denotes Mouse ribosomal S6 protein (L-040893-00 and L-045791-00), mouse Akt1 (L-040709-00), mouse Akt2 (L-040782-00), mouse Akt3 (L-040891-00), mouse mTOR (L-065427-00), mouse PDK1 (L-040658-00), non-coding control (D-001810-10-05), mouse Mapk8 (J-040128-05), mouse Mapk9 (J-040134-05), mouse Jun (L-043776-00). siRNA were transfected using RNAiMAX reagent (Invitrogen), according to manufacturer’s recommendations.
T26722 54353-54464 Sentence denotes After 72 hr, cells were treated with zVAD.fmk or TNFα for 9 hr (RNA or Western blot) or 24 hr (cell viability).
T340 54353-54464 Sentence denotes After 72 hr, cells were treated with zVAD.fmk or TNFα for 9 hr (RNA or Western blot) or 24 hr (cell viability).
T27063 54466-54478 Sentence denotes Western Blot
T341 54466-54478 Sentence denotes Western Blot
T27064 54479-54570 Sentence denotes For Western blot, 4×105 adherent cells (1×106 Jurkat cells) were seeded into 35 mm2 dishes.
T342 54479-54570 Sentence denotes For Western blot, 4×105 adherent cells (1×106 Jurkat cells) were seeded into 35 mm2 dishes.
T27065 54571-54652 Sentence denotes After 24–48 hr, cells were stimulated with 30 µM zVAD.fmk or 10 ng/ml mouse TNFα.
T343 54571-54652 Sentence denotes After 24–48 hr, cells were stimulated with 30 µM zVAD.fmk or 10 ng/ml mouse TNFα.
T27066 54653-54811 Sentence denotes For treatments under serum free conditions, cells were serum starved for 24 hr prior to the addition of growth factors, 20 µM zVAD.fmk or 10 ng/ml mouse TNFα.
T344 54653-54811 Sentence denotes For treatments under serum free conditions, cells were serum starved for 24 hr prior to the addition of growth factors, 20 µM zVAD.fmk or 10 ng/ml mouse TNFα.
T27067 54812-54924 Sentence denotes Cells were harvested in 1×RIPA buffer (Cell Signaling) supplemented with 50 µg/ml phenylmethanesulfonylfluoride.
T345 54812-54924 Sentence denotes Cells were harvested in 1×RIPA buffer (Cell Signaling) supplemented with 50 µg/ml phenylmethanesulfonylfluoride.
T27068 54925-55002 Sentence denotes After brief sonication, cell lysates were spun down for 15 min at 14,000×rpm.
T346 54925-55002 Sentence denotes After brief sonication, cell lysates were spun down for 15 min at 14,000×rpm.
T27069 55003-55087 Sentence denotes Protein concentrations were measured using the Pierce 660 nm Assay Reagent (Pierce).
T347 55003-55087 Sentence denotes Protein concentrations were measured using the Pierce 660 nm Assay Reagent (Pierce).
T348 55088-55144 Sentence denotes Equal amounts of proteins were boiled for 5 min at 95°C.
T27070 55088-55208 Sentence denotes Equal amounts of proteins were boiled for 5 min at 95°C. Western blotting was performed according to standard protocols.
T349 55145-55208 Sentence denotes Western blotting was performed according to standard protocols.
T27071 55209-55365 Sentence denotes Briefly, SDS-PAGE gels were transferred to PVDF membrane, blocked in 3% milk or 5% bovine serum albumin (BSA) in TBST buffer for 30 min at room temperature.
T350 55209-55365 Sentence denotes Briefly, SDS-PAGE gels were transferred to PVDF membrane, blocked in 3% milk or 5% bovine serum albumin (BSA) in TBST buffer for 30 min at room temperature.
T351 55366-55431 Sentence denotes Primary antibodies were incubated in 5%BSA/TBST overnight at 4°C.
T27072 55366-55507 Sentence denotes Primary antibodies were incubated in 5%BSA/TBST overnight at 4°C. Secondary antibodies were incubated in TBST for 30 min at room temperature.
T352 55432-55507 Sentence denotes Secondary antibodies were incubated in TBST for 30 min at room temperature.
T27073 55508-55575 Sentence denotes Luminata (Millipore) ECL reagents were used to develop the signals.
T353 55508-55575 Sentence denotes Luminata (Millipore) ECL reagents were used to develop the signals.
T27074 55576-55698 Sentence denotes In some cases, membranes were stripped using OneMinute stripping buffer (GM Biosciences) and reprobed with new antibodies.
T354 55576-55698 Sentence denotes In some cases, membranes were stripped using OneMinute stripping buffer (GM Biosciences) and reprobed with new antibodies.
T27611 55700-55707 Sentence denotes qRT-PCR
T355 55700-55707 Sentence denotes qRT-PCR
T27612 55708-55758 Sentence denotes Cells were treated as described for Western blots.
T356 55708-55758 Sentence denotes Cells were treated as described for Western blots.
T27613 55759-55820 Sentence denotes Total RNA was isolated using ZR Miniprep kit (Zymo Research).
T357 55759-55820 Sentence denotes Total RNA was isolated using ZR Miniprep kit (Zymo Research).
T27614 55821-55915 Sentence denotes 1 µg of RNA was converted to cDNA using random primers (M-MuLV cDNA kit, New England Biolabs).
T358 55821-55915 Sentence denotes 1 µg of RNA was converted to cDNA using random primers (M-MuLV cDNA kit, New England Biolabs).
T27615 55916-55976 Sentence denotes 1 µL of cDNA was used with 500 pM primers in qPCR reactions.
T359 55916-55976 Sentence denotes 1 µL of cDNA was used with 500 pM primers in qPCR reactions.
T27616 55977-56074 Sentence denotes Reactions were performs using SYBRGreen 2×Master mix (SABiosciences) in a LightCycler480 (Roche).
T360 55977-56074 Sentence denotes Reactions were performs using SYBRGreen 2×Master mix (SABiosciences) in a LightCycler480 (Roche).
T27774 56076-56104 Sentence denotes Stable Infection of Myr-Akt1
T361 56076-56104 Sentence denotes Stable Infection of Myr-Akt1
T27775 56105-56320 Sentence denotes To generate MSCV retroviruses, HEK293FT cells (Invitrogen) were transfected with 2 µg of viral DNA and 1 µg of gal/pol and VSV-G accessory plasmids in 6 well plates using GenJet transfection reagent (Signagen Labs).
T362 56105-56320 Sentence denotes To generate MSCV retroviruses, HEK293FT cells (Invitrogen) were transfected with 2 µg of viral DNA and 1 µg of gal/pol and VSV-G accessory plasmids in 6 well plates using GenJet transfection reagent (Signagen Labs).
T27776 56321-56452 Sentence denotes Virus-containing media was collected 72 hr later, filtered through 0.45 µm filter and applied to L929 cells with 8 µg/ml polybrene.
T363 56321-56452 Sentence denotes Virus-containing media was collected 72 hr later, filtered through 0.45 µm filter and applied to L929 cells with 8 µg/ml polybrene.
T27777 56453-56510 Sentence denotes Cells were selected and maintained in 10 µg/ml puromycin.
T364 56453-56510 Sentence denotes Cells were selected and maintained in 10 µg/ml puromycin.
T27960 56512-56526 Sentence denotes ELISAOne Assay
T365 56512-56526 Sentence denotes ELISAOne Assay
T27961 56527-56659 Sentence denotes ELISAOne assays (TGRBio, Hindmarsh, Australia) were performed according to manufacturer’s protocol with the following modifications.
T366 56527-56659 Sentence denotes ELISAOne assays (TGRBio, Hindmarsh, Australia) were performed according to manufacturer’s protocol with the following modifications.
T27962 56660-56733 Sentence denotes Cell lysates were prepared in RIPA buffer as described for Western blots.
T367 56660-56733 Sentence denotes Cell lysates were prepared in RIPA buffer as described for Western blots.
T27963 56734-56827 Sentence denotes Five microliters of samples were diluted in 45 µL of ELISAOne lysis buffer prior to analysis.
T368 56734-56827 Sentence denotes Five microliters of samples were diluted in 45 µL of ELISAOne lysis buffer prior to analysis.
T27964 56828-56945 Sentence denotes Primary antibodies to phopsho-Thr308 and phopsho-Ser473 were incubated with the samples for 2 hr at room temperature.
T369 56828-56945 Sentence denotes Primary antibodies to phopsho-Thr308 and phopsho-Ser473 were incubated with the samples for 2 hr at room temperature.
T370 56946-57005 Sentence denotes Primary antibody to pan-Akt was incubated overnight at 4°C.
T27965 56946-57077 Sentence denotes Primary antibody to pan-Akt was incubated overnight at 4°C. Signals for phospho-antibodies were normalized based on pan-Akt values.
T371 57006-57077 Sentence denotes Signals for phospho-antibodies were normalized based on pan-Akt values.
T28169 57079-57089 Sentence denotes TNFα ELISA
T372 57079-57089 Sentence denotes TNFα ELISA
T28170 57090-57195 Sentence denotes Mouse TNFα Quantikine ELISA assays (R&D Systems) were performed according to manufacturer’s descriptions.
T373 57090-57195 Sentence denotes Mouse TNFα Quantikine ELISA assays (R&D Systems) were performed according to manufacturer’s descriptions.
T28171 57196-57276 Sentence denotes Cell lysates were prepared from 3×106 cells plated and treated in a 10 cm2 dish.
T374 57196-57276 Sentence denotes Cell lysates were prepared from 3×106 cells plated and treated in a 10 cm2 dish.
T28279 57278-57303 Sentence denotes In vitro Akt Kinase Assay
T375 57278-57303 Sentence denotes In vitro Akt Kinase Assay
T376 57304-57416 Sentence denotes Akt kinase activity was measured using the Akt kinase assay kit (nonradioactive) from Cell Signaling Technology.
T28280 57304-57516 Sentence denotes Akt kinase activity was measured using the Akt kinase assay kit (nonradioactive) from Cell Signaling Technology. In brief, Myr-Akt was immunoprecipitated from L929 cells using anti-FLAG M2 magnetic beads (Sigma).
T377 57417-57516 Sentence denotes In brief, Myr-Akt was immunoprecipitated from L929 cells using anti-FLAG M2 magnetic beads (Sigma).
T28281 57517-57600 Sentence denotes The in vitro assay was performed in the presence of a GSK fusion protein substrate.
T378 57517-57600 Sentence denotes The in vitro assay was performed in the presence of a GSK fusion protein substrate.
T28282 57601-57674 Sentence denotes Phosphorylation of the GSK fusion protein was visualized by western blot.
T379 57601-57674 Sentence denotes Phosphorylation of the GSK fusion protein was visualized by western blot.
T380 57676-57698 Sentence denotes Supporting Information
T381 57699-58214 Sentence denotes Figure S1 Necroptosis, induced by zVAD.fmk or TNFα, was inhibited by Nec-1 but not Nec-1i. (A) Structures of 7-Cl-O-Nec-1 (Nec-1) and the inactive analog, 7-Cl-O-Nec-1i (Nec-1i). (B, D) L929 cells were treated with zVAD.fmk or TNFα in the presence of Nec-1 or Nec-1i. (C, E) L929 cells were serum starved followed by treatment with bFGF/zVAD.fmk in the prescence of either Nec-1 or Nec-1i. (B, C) Cell viability was measured 24 hrs post-treatment. (D, E) Cells were harvested for western blot 9 hrs post-treatment.
T382 58215-58253 Sentence denotes In all graphs, average±SD was plotted.
T383 58254-58259 Sentence denotes (TIF)
T384 58260-58296 Sentence denotes Click here for additional data file.
T385 58297-58441 Sentence denotes Figure S2 Akt contributes to death by necroptosis. (A) L929 cells treated with zVAD.fmk or TNFα in the presence of the JNK inhibitor, SP600125.
T386 58442-58905 Sentence denotes Cells were analyzed for cell viability 24 hrs post-treatment. (B) L929 cells were treated with zVAD.fmk or TNFα or bFGF/zVAD.fmk (serum free conditions) in the presence of the Akt inhibitors (Akt inhibitor VIII 10 µM, MK2206 10 µM or Triceribine (TCN) 100 µM) and cell viability was measured 24 hrs post-treatment. (C) Mouse lung fibroblasts expressing either Akt1, Akt2, or Akt3 and L929 lysates were harvested and western blotted using the indicated antibodies.
T387 58906-58944 Sentence denotes In all graphs, average±SD was plotted.
T388 58945-58950 Sentence denotes (TIF)
T389 58951-58987 Sentence denotes Click here for additional data file.
T390 58988-59475 Sentence denotes Figure S3 RIP1 kinase-dependent increase in Akt Thr308 phosphorylation during necroptosis. (A, B) L929 cells treated with zVAD.fmk (A) or TNFα (B) for the indicated period of time followed by assessment of cell viability. (C) Cells were serum starved followed by treatment with IGF alone or IGF/zVAD.fmk and samples were collected at the indicated time points for western blot. (D,E) L929 cells were stimulated with bFGF and/or zVAD.fmk and Nec-1 (N1) for the indicated periods of time.
T391 59476-59563 Sentence denotes Samples were analyzed using phospho-Thr308, phospho-Ser473 and pan-Akt ELISAOne assays.
T392 59564-59607 Sentence denotes Phospho-signals were normalized to pan-Akt.
T393 59608-59653 Sentence denotes Fold induction over control cells is plotted.
T394 59654-59692 Sentence denotes In all graphs, average±SD was plotted.
T395 59693-59698 Sentence denotes (TIF)
T396 59699-59735 Sentence denotes Click here for additional data file.
T397 59736-60107 Sentence denotes Figure S4 Growth factor independent activation of Akt Thr308 phosphorylation by TNFα. (A) Necroptosis was induced by zVAD.fmk or TNFα in the presence of 2 µM PD173074 or 20 µM PD166866 for 9 hrs followed by western blot. (B,C) Cells were stimulated with TNFα under normal serum (B) or serum free (C) conditions for the indicated periods of time followed by western blot.
T398 60108-60113 Sentence denotes (TIF)
T399 60114-60150 Sentence denotes Click here for additional data file.
T400 60151-60483 Sentence denotes Figure S5 Downstream Akt signaling contributes to the control of necroptosis. (A,B) L929 were stimulated with zVAD.fmk (A) TNFα (B) for the indicated periods of time, followed by western blot using indicated antibodies. (C,D) L929 were stimulated with TNFα or zVAD.fmk in the presence of the indicated concentrations of PF-4706871.
T401 60484-60525 Sentence denotes Viability was determined after 24 hr (C).
T402 60526-60625 Sentence denotes Western blot samples were collected after 9 hr (D). (E) L929 cells were transfected with S6 siRNAs.
T403 60626-60694 Sentence denotes After 48 hr, necroptosis was induced by TNFα and zVAD.fmk for 24 hr.
T404 60695-60756 Sentence denotes Inset, levels of S6 were determined 48 hr after transfection.
T405 60757-60795 Sentence denotes In all graphs, average±SD was plotted.
T406 60796-60801 Sentence denotes (TIF)
T407 60802-60838 Sentence denotes Click here for additional data file.
T408 60839-61020 Sentence denotes Figure S6 Akt and mTORC1 contribute to autocrine TNFα synthesis and JNK activation during necroptosis. (A,B) L929 cells were stimulated by zVAD.fmk (A) and human TNFα (B) for 9 hr.
T409 61021-61486 Sentence denotes Cell lysates were subjected to mouse TNFα ELISA. (C) L929 cells were stimulated by zVAD.fmk and TNFα in the presence of either Nec-1 followed by measurement of TNFα mRNA levels by qRT-PCR at 9 hr. (D) L929 cells were stimulated by zVAD.fmk and TNFα in the presence of Akt inh VIII (10 µM), MK2206 (10 µM) and TCN (100 µM) followed by western blot at 9 hrs. (E) Cells were stimulated with TNFα for 15 min or 9 hr in the presence of Nec-1, Akt inh VIII and rapamycin.
T410 61487-61660 Sentence denotes Western blot samples were collected after 9 hr. (F) L929 cells were stimulated with bFGF and zVAD.fmk (serum free conditions) for 15 min and 9 hr in the presence of Akt inh.
T411 61661-61825 Sentence denotes VIII and analyzed by western blot. (G) L929 cells were stimulated by zVAD.fmk in the presence of Nec1, Akt inh VIII, or rapamycin followed by western blot at 9 hrs.
T412 61826-61864 Sentence denotes In all graphs, average±SD was plotted.
T413 61865-61870 Sentence denotes (TIF)
T414 61871-61907 Sentence denotes Click here for additional data file.
T415 61908-62123 Sentence denotes Figure S7 PI3-Kinase and PDK1 mediate the increase in Akt Thr308 phosphorylation under necroptotic conditions. (A-D) L929 cells were stimulated by zVAD.fmk and TNFα in the presence of LY249002 (A,B) or BX912 (C,D).
T416 62124-62174 Sentence denotes Viability assays were performed after 24 hr (A,C).
T417 62175-62281 Sentence denotes Western blot samples were collected after 9 hr. (B,D). (E,F) L929 cells were transfected with PDK1 siRNAs.
T418 62282-62339 Sentence denotes After 72 hr, necroptosis was induced by TNFα or zVAD.fmk.
T419 62340-62388 Sentence denotes Viability assays were performed after 24 hr (E).
T420 62389-62440 Sentence denotes Western blot samples were collected after 9 hr (F).
T421 62441-62479 Sentence denotes In all graphs, average±SD was plotted.
T422 62480-62485 Sentence denotes (TIF)
T423 62486-62522 Sentence denotes Click here for additional data file.
T424 62523-63295 Sentence denotes Figure S8 Constitutively active Myr-Akt promotes necroptosis under serum free conditions. (A,B) L929 cells expressing Myr-Akt, full length Akt and a mutant lacking the PH domain were treated with zVAD.fmk under serum free conditions, followed by viability measurement at 24 hr (A) or western blot at 9 hr (B). * - non-specific band, coinciding with the migration of Myr-Akt was detected by some lots of the p308 antibody. (C) L929 cells expressing Myr-Akt and Ala and Asp mutants of Thr308 and Ser473 were immunoprecipitated from L929 cells and their in vitro catalytic activity towards GSK-3β peptide was determined. (D) L929 cells expressing Myr-Akt or the T308D mutant were treated with zVAD.fmk for 9 hrs under serum free conditions followed by western blot analysis.
T425 63296-63334 Sentence denotes In all graphs, average±SD was plotted.
T426 63335-63340 Sentence denotes (TIF)
T427 63341-63377 Sentence denotes Click here for additional data file.
T428 63378-63564 Sentence denotes Figure S9 Akt signaling contributes to autocrine TNFα production in multiple cell types. (A) FADD-deficient Jurkat cells were treated with TNFα in the presence of Nec-1 or Akt inh VIII.
T429 63565-63699 Sentence denotes Cell viability was assayed after 24 hrs. (B,C) RAW 264.7 (B) or J774A.1 (C) were treated with zVAD.fmk (100 uM or 50 uM respectively).
T430 63700-64121 Sentence denotes Cell viability was assayed after 24 hrs. (D,E) Akt deficient mouse lung fibroblasts stably expressing Myr-Akt or Myr-Akt K179M mutant, were stimulated with TNFα and zVAD.fmk under serum free conditions for 24 hr, followed by cell viability assay or (D) western blot analysis (E). (F) Mouse lung fibroblasts expressing one isoform of Akt (Akt1 or Akt2) were treated with zVAD.fmk and TNFα followed by cell viability assay.
T431 64122-64160 Sentence denotes In all graphs, average±SD was plotted.
T432 64161-64166 Sentence denotes (TIF)
T433 64167-64203 Sentence denotes Click here for additional data file.
T434 64204-64557 Sentence denotes Figure S10 JNK and c-Jun differentially contribute to autocrine TNFα production and cell death. (A) Cells were treated with TNFα or zVAD.fmk with or without SP600125 (SP6) followed by evaluation of TNFα mRNA levels by qRT-PCR at 9 hrs. (B) L929 cells were treated with TNFα for 9 hrs in the presence of the JNK inhibitor SP600125 (SP6), Nec-1, JNK inh.
T435 64558-64575 Sentence denotes VIII, or Akt inh.
T436 64576-65349 Sentence denotes VIII and analysed by western blot. (C) Cells were treated with TNFα with or without JNK inhibitor VIII followed by evaluation of TNFα mRNA levels by qRT-PCR at 9 hrs. (D) Cells were treated with zVAD.fmk or TNFα with either SP600125 or JNK inh VIII followed by viability assay at 24 hr. (E-G) L929 cells transfected with JNK1 and JNK2 siRNAs for 72 hrs were treated with zVAD.fmk or TNFα followed by western blot at 9 hr (E), evaluation of TNFα mRNA levels by qRT-PCR at 9 hrs (F), or viability assay at 24 hr (G), (H-J) L929 cells transfected with c-jun siRNAs for 72 hrs were treated with zVAD.fmk or TNFα followed by western blot at 9 hr (H), evaluation of TNFα mRNA levels by qRT-PCR at 9 hrs (I), or viability assay at 24 hr (J), In all graphs, average±SD was plotted.
T437 65350-65355 Sentence denotes (TIF)
T438 65356-65392 Sentence denotes Click here for additional data file.