> top > projects > sentences > docs > PMC:3333881 > annotations

PMC:3333881 JSONTXT 24 Projects

Annnotations TAB TSV DIC JSON TextAE Lectin_function IAV-Glycan

Id Subject Object Predicate Lexical cue
T89 0-94 Sentence denotes Human immunodeficiency virus-1 Tat activates NF-κB via physical interaction with IκB-α and p65
T1 0-94 Sentence denotes Human immunodeficiency virus-1 Tat activates NF-κB via physical interaction with IκB-α and p65
T2 97-105 Sentence denotes Abstract
T90 106-248 Sentence denotes Nuclear factor (NF)-κB is a master regulator of pro-inflammatory genes and is upregulated in human immunodeficiency virus 1 (HIV-1) infection.
T3 106-248 Sentence denotes Nuclear factor (NF)-κB is a master regulator of pro-inflammatory genes and is upregulated in human immunodeficiency virus 1 (HIV-1) infection.
T91 249-347 Sentence denotes Mechanisms underlying the NF-κB deregulation by HIV-1 are relevant for immune dysfunction in AIDS.
T4 249-347 Sentence denotes Mechanisms underlying the NF-κB deregulation by HIV-1 are relevant for immune dysfunction in AIDS.
T92 348-568 Sentence denotes We report that in single round HIV-1 infection, or single-pulse PMA stimulation, the HIV-1 Tat transactivator activated NF-κB by hijacking the inhibitor IκB-α and by preventing the repressor binding to the NF-κB complex.
T5 348-568 Sentence denotes We report that in single round HIV-1 infection, or single-pulse PMA stimulation, the HIV-1 Tat transactivator activated NF-κB by hijacking the inhibitor IκB-α and by preventing the repressor binding to the NF-κB complex.
T93 569-696 Sentence denotes Moreover, Tat associated with the p65 subunit of NF-κB and increased the p65 DNA-binding affinity and transcriptional activity.
T6 569-696 Sentence denotes Moreover, Tat associated with the p65 subunit of NF-κB and increased the p65 DNA-binding affinity and transcriptional activity.
T94 697-841 Sentence denotes The arginine- and cysteine-rich domains of Tat were required for IκB-α and p65 association, respectively, and for sustaining the NF-κB activity.
T7 697-841 Sentence denotes The arginine- and cysteine-rich domains of Tat were required for IκB-α and p65 association, respectively, and for sustaining the NF-κB activity.
T95 842-1148 Sentence denotes Among an array of NF-κB-responsive genes, Tat mostly activated the MIP-1α expression in a p65-dependent manner, and bound to the MIP-1α NF-κB enhancer thus promoting the recruitment of p65 with displacement of IκB-α; similar findings were obtained for the NF-κB-responsive genes CSF3, LTA, NFKBIA and TLR2.
T8 842-1148 Sentence denotes Among an array of NF-κB-responsive genes, Tat mostly activated the MIP-1α expression in a p65-dependent manner, and bound to the MIP-1α NF-κB enhancer thus promoting the recruitment of p65 with displacement of IκB-α; similar findings were obtained for the NF-κB-responsive genes CSF3, LTA, NFKBIA and TLR2.
T96 1149-1358 Sentence denotes Our results support a novel mechanism of NF-κB activation via physical interaction of Tat with IκB-α and p65, and may contribute to further insights into the deregulation of the inflammatory response by HIV-1.
T9 1149-1358 Sentence denotes Our results support a novel mechanism of NF-κB activation via physical interaction of Tat with IκB-α and p65, and may contribute to further insights into the deregulation of the inflammatory response by HIV-1.
T10 1360-1372 Sentence denotes INTRODUCTION
T1429 1373-1516 Sentence denotes Nuclear factor (NF)-κB transcription factors regulate the transcription of genes that are involved in the immune and inflammatory response (1).
T11 1373-1516 Sentence denotes Nuclear factor (NF)-κB transcription factors regulate the transcription of genes that are involved in the immune and inflammatory response (1).
T1430 1517-1698 Sentence denotes The NF-κB family includes RelA/p65, c-Rel, RelB, p50 and p52 that share a highly conserved 300-amino acid Rel homology domain (RHD) for homo- or hetero-dimerization and DNA-binding.
T12 1517-1698 Sentence denotes The NF-κB family includes RelA/p65, c-Rel, RelB, p50 and p52 that share a highly conserved 300-amino acid Rel homology domain (RHD) for homo- or hetero-dimerization and DNA-binding.
T1431 1699-1891 Sentence denotes The transcriptional activity of the NF-κB complex depends on dimer composition since C-terminal unrelated transcriptional activation domains are present exclusively in p65, RelB and c-Rel (2).
T13 1699-1891 Sentence denotes The transcriptional activity of the NF-κB complex depends on dimer composition since C-terminal unrelated transcriptional activation domains are present exclusively in p65, RelB and c-Rel (2).
T1432 1892-1993 Sentence denotes Inhibitors of NF-κB (IκB) associate with the NF-κB complex and interfere with its binding to DNA (3).
T14 1892-1993 Sentence denotes Inhibitors of NF-κB (IκB) associate with the NF-κB complex and interfere with its binding to DNA (3).
T1433 1994-2248 Sentence denotes In the canonical pathway of NF-κB activation, the activated IκB kinase (IKK) phosphorylates IκB at specific serine residues that target the protein to ubiquitination and proteasomal degradation, which releases the functional NF-κB complex in the nucleus.
T15 1994-2248 Sentence denotes In the canonical pathway of NF-κB activation, the activated IκB kinase (IKK) phosphorylates IκB at specific serine residues that target the protein to ubiquitination and proteasomal degradation, which releases the functional NF-κB complex in the nucleus.
T1434 2249-2438 Sentence denotes IκB-α, the most abundant inhibitor of NF-κB (4), is phosphorylated by IKK at Ser32 and Ser36 (5), and subsequently ubiquitylated at Lys21 and Lys22 to be degraded by the 26S proteasome (6).
T16 2249-2438 Sentence denotes IκB-α, the most abundant inhibitor of NF-κB (4), is phosphorylated by IKK at Ser32 and Ser36 (5), and subsequently ubiquitylated at Lys21 and Lys22 to be degraded by the 26S proteasome (6).
T1435 2439-2575 Sentence denotes The NF-κB activity is enhanced by phosphorylation of p65 at Ser276 by PKA and MSK1 (7,8), Ser311 by PKCζ (9) and Ser536 by IKKα (10,11).
T17 2439-2575 Sentence denotes The NF-κB activity is enhanced by phosphorylation of p65 at Ser276 by PKA and MSK1 (7,8), Ser311 by PKCζ (9) and Ser536 by IKKα (10,11).
T1436 2576-2758 Sentence denotes Acetylation of p65 at Lys218 and Lys221 increases the DNA binding and impairs the association with IκB-α, and acetylation at Lys310 enhances the p65 transcriptional activity (12,13).
T18 2576-2758 Sentence denotes Acetylation of p65 at Lys218 and Lys221 increases the DNA binding and impairs the association with IκB-α, and acetylation at Lys310 enhances the p65 transcriptional activity (12,13).
T1437 2759-2951 Sentence denotes Post-activation turn off of NF-κB is regulated by negative feedback loop through inhibitors under the transcriptional control of NF-κB, such as IκB-α and ubiquitin-editing protein A20 (14–20).
T19 2759-2951 Sentence denotes Post-activation turn off of NF-κB is regulated by negative feedback loop through inhibitors under the transcriptional control of NF-κB, such as IκB-α and ubiquitin-editing protein A20 (14–20).
T1438 2952-3095 Sentence denotes Deacetylation of p65 by histone deacetylase-3 or SIRT1, or acetylation of p65 at Lys122 and Lys123 down-regulate the NF-κB activity (12,21,22).
T20 2952-3095 Sentence denotes Deacetylation of p65 by histone deacetylase-3 or SIRT1, or acetylation of p65 at Lys122 and Lys123 down-regulate the NF-κB activity (12,21,22).
T1439 3096-3363 Sentence denotes Persistent activation of NF-κB occurs in human immunodeficiency virus-1 (HIV-1)-infected monocytes, macrophages and microglia, and enhances the expression of NF-κB-responsive genes, including pro-inflammatory cytokines, cell adhesion molecules and chemokines (23–25).
T21 3096-3363 Sentence denotes Persistent activation of NF-κB occurs in human immunodeficiency virus-1 (HIV-1)-infected monocytes, macrophages and microglia, and enhances the expression of NF-κB-responsive genes, including pro-inflammatory cytokines, cell adhesion molecules and chemokines (23–25).
T1440 3364-3451 Sentence denotes Chronic inflammation is a major cause of immune and neuron dysfunction in AIDS (26,27).
T22 3364-3451 Sentence denotes Chronic inflammation is a major cause of immune and neuron dysfunction in AIDS (26,27).
T1441 3452-3670 Sentence denotes Consistently, non-human primate hosts for simian immunodeficiency virus, such as African green monkeys and sooty mangabey, lack aberrant immune activation and do not develop AIDS despite high virus replication (28,29).
T23 3452-3670 Sentence denotes Consistently, non-human primate hosts for simian immunodeficiency virus, such as African green monkeys and sooty mangabey, lack aberrant immune activation and do not develop AIDS despite high virus replication (28,29).
T1442 3671-3789 Sentence denotes Thus, understanding the mechanisms of NF-κB deregulation by HIV-1 may provide further insights into AIDS pathogenesis.
T24 3671-3789 Sentence denotes Thus, understanding the mechanisms of NF-κB deregulation by HIV-1 may provide further insights into AIDS pathogenesis.
T1443 3790-3928 Sentence denotes In HIV-1 entry, the binding of the gp120 viral envelope to CD4 induces the NF-κB activity by activation of IKK (30) and procaspase 8 (31).
T25 3790-3928 Sentence denotes In HIV-1 entry, the binding of the gp120 viral envelope to CD4 induces the NF-κB activity by activation of IKK (30) and procaspase 8 (31).
T1444 3929-4078 Sentence denotes Following viral integration, the early encoded HIV-1 Tat protein interacts with the HIV-1 RNA and host cell factors to sustain the viral replication.
T26 3929-4078 Sentence denotes Following viral integration, the early encoded HIV-1 Tat protein interacts with the HIV-1 RNA and host cell factors to sustain the viral replication.
T1445 4079-4328 Sentence denotes Tat binds to RNA stem-loop structures generated by the 5′ end of target transcripts, including the HIV-1 transactivation-responsive element (TAR) (32), tumor necrosis factor β (TNFβ) (33) and interleukin-6 (IL-6) (34) to activate gene transcription.
T27 4079-4328 Sentence denotes Tat binds to RNA stem-loop structures generated by the 5′ end of target transcripts, including the HIV-1 transactivation-responsive element (TAR) (32), tumor necrosis factor β (TNFβ) (33) and interleukin-6 (IL-6) (34) to activate gene transcription.
T1446 4329-4591 Sentence denotes Indeed, Tat promotes the transcriptional initiation and elongation by interacting with transacting factors and cofactors, such as Sp1 (35), TFIID (36), E2F-4 (37), C/EBPβ (38), cyclin T1/CDK9 (39,40) and the histone acetyltransferases p300/CBP and P/CAF (41–43).
T28 4329-4591 Sentence denotes Indeed, Tat promotes the transcriptional initiation and elongation by interacting with transacting factors and cofactors, such as Sp1 (35), TFIID (36), E2F-4 (37), C/EBPβ (38), cyclin T1/CDK9 (39,40) and the histone acetyltransferases p300/CBP and P/CAF (41–43).
T1447 4592-4774 Sentence denotes When released from HIV-1-infected cells, Tat deregulates the cell signaling by binding to cell receptors, such as integrins (44), Flk1/KDR receptor (45) and chemokine receptors (46).
T29 4592-4774 Sentence denotes When released from HIV-1-infected cells, Tat deregulates the cell signaling by binding to cell receptors, such as integrins (44), Flk1/KDR receptor (45) and chemokine receptors (46).
T1448 4775-4886 Sentence denotes We first reported that NF-κB was constitutively active in Jurkat cells that stably expressed the Tat gene (47).
T30 4775-4886 Sentence denotes We first reported that NF-κB was constitutively active in Jurkat cells that stably expressed the Tat gene (47).
T1449 4887-5126 Sentence denotes Following gene transfection or protein transduction, Tat induced the IKK activity and proteasomal degradation of IκB-α (48), and increased the p65 transcriptional activity by inhibiting the SIRT-1-mediated deacetylation of p65 Lys310 (49).
T31 4887-5126 Sentence denotes Following gene transfection or protein transduction, Tat induced the IKK activity and proteasomal degradation of IκB-α (48), and increased the p65 transcriptional activity by inhibiting the SIRT-1-mediated deacetylation of p65 Lys310 (49).
T1450 5127-5358 Sentence denotes These findings suggested that Tat modulates crucial enzymes involved in NF-κB signaling; however, it was unclear how Tat could subvert the negative feedback of NF-κB, which is mainly dependent on de novo synthesis of IκB-α (15,17).
T32 5127-5358 Sentence denotes These findings suggested that Tat modulates crucial enzymes involved in NF-κB signaling; however, it was unclear how Tat could subvert the negative feedback of NF-κB, which is mainly dependent on de novo synthesis of IκB-α (15,17).
T1451 5359-5471 Sentence denotes We previously found that IκB-α binds to Tat and promotes the nuclear export of the viral transactivator (50,51).
T33 5359-5471 Sentence denotes We previously found that IκB-α binds to Tat and promotes the nuclear export of the viral transactivator (50,51).
T1452 5472-5684 Sentence denotes In this study, we report that Tat counteracts the post-activation turn off of NF-κB through direct interaction with IκB-α and p65, which enhances the DNA binding and transcriptional activity of the NF-κB complex.
T34 5472-5684 Sentence denotes In this study, we report that Tat counteracts the post-activation turn off of NF-κB through direct interaction with IκB-α and p65, which enhances the DNA binding and transcriptional activity of the NF-κB complex.
T1453 5685-5823 Sentence denotes The new mechanism of NF-κB deregulation here described may provide further insights into the chronic immune activation of HIV-1 infection.
T35 5685-5823 Sentence denotes The new mechanism of NF-κB deregulation here described may provide further insights into the chronic immune activation of HIV-1 infection.
T36 5825-5846 Sentence denotes MATERIALS AND METHODS
T4409 5848-5856 Sentence denotes Plasmids
T37 5848-5856 Sentence denotes Plasmids
T4410 5857-6081 Sentence denotes The plasmids pcDNA-3xHA-IκB-α, p3xFLAG-CMV-Tat, p3xFLAG-CMV-Tat C(22,25,27)A, p3xFLAG-CMV-Tat R(49,52,53,55,56,57)A, pGEX-2T-Tat, pGEX-2T-Tat C(22,25,27)A and pGEX-2T-Tat R(49,52,53,55,56,57)A were previously described (50).
T38 5857-6081 Sentence denotes The plasmids pcDNA-3xHA-IκB-α, p3xFLAG-CMV-Tat, p3xFLAG-CMV-Tat C(22,25,27)A, p3xFLAG-CMV-Tat R(49,52,53,55,56,57)A, pGEX-2T-Tat, pGEX-2T-Tat C(22,25,27)A and pGEX-2T-Tat R(49,52,53,55,56,57)A were previously described (50).
T4411 6082-6294 Sentence denotes The plasmids pNL4-3.Luc.R-E- and pHXB2-env were obtained from the AIDS Research & Reference Reagent Program, Division of AIDS, NIAID, NIH, USA; pκBluc and pSV-β-Gal were purchased from Promega (Madison, WI, USA).
T39 6082-6294 Sentence denotes The plasmids pNL4-3.Luc.R-E- and pHXB2-env were obtained from the AIDS Research & Reference Reagent Program, Division of AIDS, NIAID, NIH, USA; pκBluc and pSV-β-Gal were purchased from Promega (Madison, WI, USA).
T4412 6295-6560 Sentence denotes The plasmids pRc/CMV-3xHA-p65, pRc/CMV-3xHA-p65ΔC(1–318), pRc/CMV-3xHA-p65ΔN(122–551), p3xFLAG-CMV-Tat T,N(23,24)A, p3xFLAG-CMV-Tat K(50,51)A, pGEX-2T-Tat T,N(23,24)A, pGEX-2T-Tat K(50,51)A and pNL4-3.FLAG-Tat.R-E- were generated as described in Supplementary Data.
T40 6295-6560 Sentence denotes The plasmids pRc/CMV-3xHA-p65, pRc/CMV-3xHA-p65ΔC(1–318), pRc/CMV-3xHA-p65ΔN(122–551), p3xFLAG-CMV-Tat T,N(23,24)A, p3xFLAG-CMV-Tat K(50,51)A, pGEX-2T-Tat T,N(23,24)A, pGEX-2T-Tat K(50,51)A and pNL4-3.FLAG-Tat.R-E- were generated as described in Supplementary Data.
T4906 6562-6614 Sentence denotes Cells, transfection, treatments and luciferase assay
T41 6562-6614 Sentence denotes Cells, transfection, treatments and luciferase assay
T4907 6615-6841 Sentence denotes HeLa, p50−/−p65−/− mouse embryonic fibroblasts (MEFs) (52) and 293T cells were cultured in Dulbecco's modified Eagle's medium; Jurkat, U937 cells and human peripheral blood mononuclear cells (PBMCs) were cultured in RPMI 1640.
T42 6615-6841 Sentence denotes HeLa, p50−/−p65−/− mouse embryonic fibroblasts (MEFs) (52) and 293T cells were cultured in Dulbecco's modified Eagle's medium; Jurkat, U937 cells and human peripheral blood mononuclear cells (PBMCs) were cultured in RPMI 1640.
T4908 6842-6891 Sentence denotes PBMCs were isolated as previously described (53).
T43 6842-6891 Sentence denotes PBMCs were isolated as previously described (53).
T4909 6892-7008 Sentence denotes Media were supplemented with 10% heat-inactivated fetal calf serum and 2 mM l-glutamine (Lonza Cologne AG, Germany).
T44 6892-7008 Sentence denotes Media were supplemented with 10% heat-inactivated fetal calf serum and 2 mM l-glutamine (Lonza Cologne AG, Germany).
T4910 7009-7278 Sentence denotes HeLa, p50−/−p65−/− MEFs and 293T were transfected with DNA by using FuGENE HD (Roche Diagnostic GmbH, Mannheim, Germany), according to the manufacturer's protocol; total DNA amounts were equalized by transfection of pRc/CMV empty vector (Invitrogen, Carlsbad, CA, USA).
T45 7009-7278 Sentence denotes HeLa, p50−/−p65−/− MEFs and 293T were transfected with DNA by using FuGENE HD (Roche Diagnostic GmbH, Mannheim, Germany), according to the manufacturer's protocol; total DNA amounts were equalized by transfection of pRc/CMV empty vector (Invitrogen, Carlsbad, CA, USA).
T4911 7279-7567 Sentence denotes For pulse-stimulation, HeLa cells were treated with phorbol 12-myristate 13-acetate (PMA; Sigma-Aldrich, St Louis, MO, USA) (20 ng/ml) for 5 min, or tumor necrosis factor-α (TNF-α; Sigma-Aldrich) (20 ng/ml) for 30 min, washed twice in complete culture medium and then returned to culture.
T46 7279-7567 Sentence denotes For pulse-stimulation, HeLa cells were treated with phorbol 12-myristate 13-acetate (PMA; Sigma-Aldrich, St Louis, MO, USA) (20 ng/ml) for 5 min, or tumor necrosis factor-α (TNF-α; Sigma-Aldrich) (20 ng/ml) for 30 min, washed twice in complete culture medium and then returned to culture.
T4912 7568-7671 Sentence denotes For luciferase assays, pSV-β-Gal was co-transfected with pκBluc to monitor the transfection efficiency.
T47 7568-7671 Sentence denotes For luciferase assays, pSV-β-Gal was co-transfected with pκBluc to monitor the transfection efficiency.
T4913 7672-7971 Sentence denotes Forty-eight-hour post-transfection, cells were lysed in lysis buffer of Dual Light Luciferase System (Tropix, Bedford, MA, USA) and the luciferase and β-galactosidase activities were evaluated by using Dual Light Luciferase System (Tropix) in a bioluminometer (Turner Biosystem, Sunnyvale, CA, USA).
T48 7672-7971 Sentence denotes Forty-eight-hour post-transfection, cells were lysed in lysis buffer of Dual Light Luciferase System (Tropix, Bedford, MA, USA) and the luciferase and β-galactosidase activities were evaluated by using Dual Light Luciferase System (Tropix) in a bioluminometer (Turner Biosystem, Sunnyvale, CA, USA).
T4914 7972-8079 Sentence denotes The ratio of firefly luciferase activity to β-galactosidase activity was expressed as relative light units.
T49 7972-8079 Sentence denotes The ratio of firefly luciferase activity to β-galactosidase activity was expressed as relative light units.
T5677 8081-8097 Sentence denotes RNA interference
T50 8081-8097 Sentence denotes RNA interference
T5678 8098-8223 Sentence denotes Jurkat or U937 cells were transfected by electroporation using a Bio-Rad apparatus (Bio-Rad Laboratories, Hercules, CA, USA).
T51 8098-8223 Sentence denotes Jurkat or U937 cells were transfected by electroporation using a Bio-Rad apparatus (Bio-Rad Laboratories, Hercules, CA, USA).
T5679 8224-8506 Sentence denotes Briefly, aliquots (5 × 106 cells) were suspended in 0.3 ml of RPMI 1640 supplemented with 20% fetal calf serum and subjected to a double electrical pulse (0.22 V, 960 µF) in the presence of annealed siRNA (200 pmol); electroporated cells were washed and cultured in complete medium.
T52 8224-8506 Sentence denotes Briefly, aliquots (5 × 106 cells) were suspended in 0.3 ml of RPMI 1640 supplemented with 20% fetal calf serum and subjected to a double electrical pulse (0.22 V, 960 µF) in the presence of annealed siRNA (200 pmol); electroporated cells were washed and cultured in complete medium.
T5680 8507-8726 Sentence denotes RNA interference was performed with: siRNA Tat sense, CUGCUUGUACCAAUUGCUAUU and siRNA Tat antisense, UAGCAAUUGGUACAAGCAGUU; siRNA control sense, CUGCUUGUCACA AUUGCUAUU and siRNA control antisense, UAGCAAUUGUGACAAGCAGUU.
T53 8507-8726 Sentence denotes RNA interference was performed with: siRNA Tat sense, CUGCUUGUACCAAUUGCUAUU and siRNA Tat antisense, UAGCAAUUGGUACAAGCAGUU; siRNA control sense, CUGCUUGUCACA AUUGCUAUU and siRNA control antisense, UAGCAAUUGUGACAAGCAGUU.
T5681 8727-8841 Sentence denotes RNA interference of p65 and IκB-α was performed with SMART pool siRNA p65 and IκB-α (Dharmacon, Chicago, IL, USA).
T54 8727-8841 Sentence denotes RNA interference of p65 and IκB-α was performed with SMART pool siRNA p65 and IκB-α (Dharmacon, Chicago, IL, USA).
T6045 8843-8889 Sentence denotes Pseudotyped virions and single round infection
T55 8843-8889 Sentence denotes Pseudotyped virions and single round infection
T6046 8890-9072 Sentence denotes 293T cells (1 × 107) were transfected with pNL4-3.Luc.R-E- or pNL4-3.FLAG-Tat.R-E- (10 µg) together with pHXB2 Env (10 µg), and 48-h post-transfection cell supernatant was collected.
T56 8890-9072 Sentence denotes 293T cells (1 × 107) were transfected with pNL4-3.Luc.R-E- or pNL4-3.FLAG-Tat.R-E- (10 µg) together with pHXB2 Env (10 µg), and 48-h post-transfection cell supernatant was collected.
T6047 9073-9169 Sentence denotes Enzyme-linked immunosorbent assay (ELISA) using anti-p24 antibody measured virion concentration.
T57 9073-9169 Sentence denotes Enzyme-linked immunosorbent assay (ELISA) using anti-p24 antibody measured virion concentration.
T6048 9170-9319 Sentence denotes PBMCs, Jurkat or U937 cells (5 × 107) were infected with HXB2 Env-pseudotyped virions (500 ng of p24) by spinoculation, as previously described (50).
T58 9170-9319 Sentence denotes PBMCs, Jurkat or U937 cells (5 × 107) were infected with HXB2 Env-pseudotyped virions (500 ng of p24) by spinoculation, as previously described (50).
T6288 9321-9388 Sentence denotes Cell extracts, western blotting, IKK activity and NF-κB DNA binding
T59 9321-9388 Sentence denotes Cell extracts, western blotting, IKK activity and NF-κB DNA binding
T60 9389-9515 Sentence denotes Total, nuclear and cytosolic extracts were performed as previously described (54); details are reported in Supplementary Data.
T6289 9389-10064 Sentence denotes Total, nuclear and cytosolic extracts were performed as previously described (54); details are reported in Supplementary Data. Western blotting analysis was performed by resuspending protein aliquots in loading buffer (125 mM Tris–HCl, pH 6.8, 5% SDS, 1% bromophenol blue, 10% β-mercaptoethanol, 25% glycerol), resolved on 12% SDS–PAGE, transferred to polyvinylidene difluoride membrane (Millipore, Bedford, MA, USA) and incubated with primary antibodies (1:1000) followed by incubation with horseradish-peroxidase-linked mouse or rabbit IgG (1:2000) (GE Healthcare Amersham, Little Chalfont, Buckinghamshire, UK) in PBS containing 5% non-fat dry milk (Bio-Rad Laboratories).
T61 9516-10064 Sentence denotes Western blotting analysis was performed by resuspending protein aliquots in loading buffer (125 mM Tris–HCl, pH 6.8, 5% SDS, 1% bromophenol blue, 10% β-mercaptoethanol, 25% glycerol), resolved on 12% SDS–PAGE, transferred to polyvinylidene difluoride membrane (Millipore, Bedford, MA, USA) and incubated with primary antibodies (1:1000) followed by incubation with horseradish-peroxidase-linked mouse or rabbit IgG (1:2000) (GE Healthcare Amersham, Little Chalfont, Buckinghamshire, UK) in PBS containing 5% non-fat dry milk (Bio-Rad Laboratories).
T6290 10065-10155 Sentence denotes Proteins were detected by chemiluminescence using the ECL System (GE Healthcare Amersham).
T62 10065-10155 Sentence denotes Proteins were detected by chemiluminescence using the ECL System (GE Healthcare Amersham).
T6291 10156-10195 Sentence denotes Primary antibodies were purchased from:
T63 10156-10195 Sentence denotes Primary antibodies were purchased from:
T6292 10196-10396 Sentence denotes Santa Cruz Biotechnology, Santa Cruz, CA, USA (anti-HA F7, anti-IκB-α C15, anti-Histone H1, anti-Hexokinase-II); Sigma-Aldrich (anti-FLAG M2, anti-γ-Tubulin); Upstate, Lake Placid, NY, USA (anti-p65).
T64 10196-10396 Sentence denotes Santa Cruz Biotechnology, Santa Cruz, CA, USA (anti-HA F7, anti-IκB-α C15, anti-Histone H1, anti-Hexokinase-II); Sigma-Aldrich (anti-FLAG M2, anti-γ-Tubulin); Upstate, Lake Placid, NY, USA (anti-p65).
T6293 10397-10477 Sentence denotes Densitometry of single bands was analysed by ImageJ software package (NIH, USA).
T65 10397-10477 Sentence denotes Densitometry of single bands was analysed by ImageJ software package (NIH, USA).
T6294 10478-10611 Sentence denotes IKK activity was evaluated in cytosolic extracts using the HTScan IKK kinase assay kit (Cell Signaling Technology, Danvers, MA, USA).
T66 10478-10611 Sentence denotes IKK activity was evaluated in cytosolic extracts using the HTScan IKK kinase assay kit (Cell Signaling Technology, Danvers, MA, USA).
T6295 10612-10798 Sentence denotes Binding of p65, p50 and FLAG-Tat to the double-stranded NF-κB oligonucleotide was measured using NF-κB Combo Transcription Factor Assay kit (Cayman Chemical Company, Ann Arbor, MI, USA).
T67 10612-10798 Sentence denotes Binding of p65, p50 and FLAG-Tat to the double-stranded NF-κB oligonucleotide was measured using NF-κB Combo Transcription Factor Assay kit (Cayman Chemical Company, Ann Arbor, MI, USA).
T6296 10799-10931 Sentence denotes Electrophoretic Mobility Shift Assay (EMSA) was performed as previously described (55); details are described in Supplementary Data.
T68 10799-10931 Sentence denotes Electrophoretic Mobility Shift Assay (EMSA) was performed as previously described (55); details are described in Supplementary Data.
T6715 10933-10953 Sentence denotes In vitro translation
T69 10933-10953 Sentence denotes In vitro translation
T6716 10954-11137 Sentence denotes HA-IκB-α, p65 and Tat were expressed under the T7 promoter and in vitro translated using the TnT quick coupled transcription/translation system (Promega), as previously reported (50).
T70 10954-11137 Sentence denotes HA-IκB-α, p65 and Tat were expressed under the T7 promoter and in vitro translated using the TnT quick coupled transcription/translation system (Promega), as previously reported (50).
T6717 11138-11182 Sentence denotes Details are described in Supplementary Data.
T71 11138-11182 Sentence denotes Details are described in Supplementary Data.
T6879 11184-11227 Sentence denotes Immunoprecipitation assay and GST-pull down
T72 11184-11227 Sentence denotes Immunoprecipitation assay and GST-pull down
T6880 11228-11370 Sentence denotes Immunoprecipitation, GST-pull down, and production of GST proteins in Escherichia coli strain BL21 were performed as previously reported (50).
T73 11228-11370 Sentence denotes Immunoprecipitation, GST-pull down, and production of GST proteins in Escherichia coli strain BL21 were performed as previously reported (50).
T6881 11371-11415 Sentence denotes Details are described in Supplementary Data.
T74 11371-11415 Sentence denotes Details are described in Supplementary Data.
T7009 11417-11430 Sentence denotes Real-time PCR
T75 11417-11430 Sentence denotes Real-time PCR
T7010 11431-11681 Sentence denotes Total RNA was extracted from cells by using the TRIzol reagent (Invitrogen); RNA aliquots (200 ng) were reverse transcribed using Random Examers (Roche) and Superscript III Reverse Transcriptase (Invitrogen), according to the manufacturer's protocol.
T76 11431-11681 Sentence denotes Total RNA was extracted from cells by using the TRIzol reagent (Invitrogen); RNA aliquots (200 ng) were reverse transcribed using Random Examers (Roche) and Superscript III Reverse Transcriptase (Invitrogen), according to the manufacturer's protocol.
T7011 11682-11878 Sentence denotes Real-time PCR was performed with the iQ Green Super mix (Bio-Rad Laboratories) and carried out with the iCycler iQ Real-Time detection system (Bio-Rad Laboratories) under the following conditions:
T77 11682-11878 Sentence denotes Real-time PCR was performed with the iQ Green Super mix (Bio-Rad Laboratories) and carried out with the iCycler iQ Real-Time detection system (Bio-Rad Laboratories) under the following conditions:
T7012 11879-11921 Sentence denotes 95°C, 1 min; (94°C, 10 s; 60°C, 30 s) ×40.
T78 11879-11921 Sentence denotes 95°C, 1 min; (94°C, 10 s; 60°C, 30 s) ×40.
T79 11922-11982 Sentence denotes Primers for Tat and MIP-1α are listed in Supplementary Data.
T7013 11922-12144 Sentence denotes Primers for Tat and MIP-1α are listed in Supplementary Data. Real-time PCR of CSF3, LTA, NFKBIA, TLR2, GAPDH and ACTB was performed using the RT2 profiler PCR Array-Human NF-κB signaling pathway (QIAGEN Sciences, MD, USA).
T80 11983-12144 Sentence denotes Real-time PCR of CSF3, LTA, NFKBIA, TLR2, GAPDH and ACTB was performed using the RT2 profiler PCR Array-Human NF-κB signaling pathway (QIAGEN Sciences, MD, USA).
T7014 12145-12282 Sentence denotes Reactions were carried out in triplicate, and gene expression levels were calculated relative to GAPDH mRNA levels as endogenous control.
T81 12145-12282 Sentence denotes Reactions were carried out in triplicate, and gene expression levels were calculated relative to GAPDH mRNA levels as endogenous control.
T7015 12283-12363 Sentence denotes Relative expression was calculated as 2(Ct gene under investigation − Ct GAPDH).
T82 12283-12363 Sentence denotes Relative expression was calculated as 2(Ct gene under investigation − Ct GAPDH).
T7515 12365-12400 Sentence denotes Chromatin immunoprecipitation assay
T83 12365-12400 Sentence denotes Chromatin immunoprecipitation assay
T7516 12401-12490 Sentence denotes Cells were fixed by adding formaldehyde (Sigma-Aldrich) at the final concentration of 1%.
T84 12401-12490 Sentence denotes Cells were fixed by adding formaldehyde (Sigma-Aldrich) at the final concentration of 1%.
T7517 12491-12627 Sentence denotes After 10 min, ice-cold PBS plus 0.125 M glycine was added, and plates were transferred on ice, washed extensively with PBS, and scraped.
T85 12491-12627 Sentence denotes After 10 min, ice-cold PBS plus 0.125 M glycine was added, and plates were transferred on ice, washed extensively with PBS, and scraped.
T7518 12628-12806 Sentence denotes After centrifugation, cells were 10 min lysed in lysis buffer (5 mM PIPES pH 8.0, 85 mM KCl, 0.5% NP-40) supplemented with 1× Complete Protease Inhibitor (Roche Diagnostic GmbH).
T86 12628-12806 Sentence denotes After centrifugation, cells were 10 min lysed in lysis buffer (5 mM PIPES pH 8.0, 85 mM KCl, 0.5% NP-40) supplemented with 1× Complete Protease Inhibitor (Roche Diagnostic GmbH).
T7519 12807-12929 Sentence denotes Nuclei were pelletted (1000 × g, 5 min), and resuspended in sonication buffer (50 mM Tris–HCl pH 8.0, 1% SDS, 10 mM EDTA).
T87 12807-12929 Sentence denotes Nuclei were pelletted (1000 × g, 5 min), and resuspended in sonication buffer (50 mM Tris–HCl pH 8.0, 1% SDS, 10 mM EDTA).
T7520 12930-13194 Sentence denotes Chromatin was sonicated using Bandelin Sonoplus GM70 (Bandelin Electronic, Berlin, Germany), centrifuged (14 000 × g, 15 min), and supernatant was 10-fold diluted in dilution buffer (0.01% SDS, 16.7 mM Tris–HCl pH 8.0, 1.1% Triton X-100, 167 mM NaCl, 1.2 mM EDTA).
T88 12930-13194 Sentence denotes Chromatin was sonicated using Bandelin Sonoplus GM70 (Bandelin Electronic, Berlin, Germany), centrifuged (14 000 × g, 15 min), and supernatant was 10-fold diluted in dilution buffer (0.01% SDS, 16.7 mM Tris–HCl pH 8.0, 1.1% Triton X-100, 167 mM NaCl, 1.2 mM EDTA).
T7521 13195-13345 Sentence denotes Samples were pre-cleared by 3-h incubation with 20 µl of protein G agarose beads followed by incubation with antibodies against the analysed proteins.
T89 13195-13345 Sentence denotes Samples were pre-cleared by 3-h incubation with 20 µl of protein G agarose beads followed by incubation with antibodies against the analysed proteins.
T90 13346-13497 Sentence denotes Primary antibodies were: anti-p65 (sc-372), anti-IκBα (sc-203) and rabbit IgG (sc-2027) from Santa Cruz Biotechnology; anti-FLAG M2 from Sigma–Aldrich.
T7522 13346-13944 Sentence denotes Primary antibodies were: anti-p65 (sc-372), anti-IκBα (sc-203) and rabbit IgG (sc-2027) from Santa Cruz Biotechnology; anti-FLAG M2 from Sigma–Aldrich. Immunoprecipitations were carried out at 4°C overnight and immune complexes were collected with protein G agarose beads, washed five times with low salt buffer (20 mM Tris–HCl pH 8.0, 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 150 mM NaCl), four times with high salt buffer (20 mM Tris–HCl pH 8.0, 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 500 mM NaCl), once with TE buffer (10 mM Tris–HCl pH 8.0, 1 mM EDTA), and extracted in TE buffer containing 2% SDS.
T91 13498-13944 Sentence denotes Immunoprecipitations were carried out at 4°C overnight and immune complexes were collected with protein G agarose beads, washed five times with low salt buffer (20 mM Tris–HCl pH 8.0, 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 150 mM NaCl), four times with high salt buffer (20 mM Tris–HCl pH 8.0, 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 500 mM NaCl), once with TE buffer (10 mM Tris–HCl pH 8.0, 1 mM EDTA), and extracted in TE buffer containing 2% SDS.
T7523 13945-14012 Sentence denotes Protein–DNA cross-links were reverted by heating at 65°C overnight.
T92 13945-14012 Sentence denotes Protein–DNA cross-links were reverted by heating at 65°C overnight.
T7524 14013-14124 Sentence denotes DNA was further purified by QIAquick PCR purification kit (QIAGEN) and eluted in 50 µl sterile distilled water.
T93 14013-14124 Sentence denotes DNA was further purified by QIAquick PCR purification kit (QIAGEN) and eluted in 50 µl sterile distilled water.
T7525 14125-14294 Sentence denotes Specific enrichment in NF-κB enhancer sequences was measured by real-time PCR of chromatin immunoprecipitation (ChIP) eluates using SYBR GreenER Master Mix (Invitrogen).
T94 14125-14294 Sentence denotes Specific enrichment in NF-κB enhancer sequences was measured by real-time PCR of chromatin immunoprecipitation (ChIP) eluates using SYBR GreenER Master Mix (Invitrogen).
T7526 14295-14423 Sentence denotes Reactions were carried out with the iCycler iQ Real-Time detection system (Bio-Rad Laboratories) using the following conditions:
T95 14295-14423 Sentence denotes Reactions were carried out with the iCycler iQ Real-Time detection system (Bio-Rad Laboratories) using the following conditions:
T7527 14424-14466 Sentence denotes 95°C, 1 min; (94°C, 10 s; 60°C, 30 s) ×40.
T96 14424-14466 Sentence denotes 95°C, 1 min; (94°C, 10 s; 60°C, 30 s) ×40.
T97 14467-14540 Sentence denotes Primers used for MIP-1α, GAPDH and ACTB are listed in Supplementary Data.
T7528 14467-14637 Sentence denotes Primers used for MIP-1α, GAPDH and ACTB are listed in Supplementary Data. Real-time PCR of CSF3, LTA, NFKBIA and TLR2 were performed using the Custom ChIP array (QIAGEN).
T98 14541-14637 Sentence denotes Real-time PCR of CSF3, LTA, NFKBIA and TLR2 were performed using the Custom ChIP array (QIAGEN).
T7529 14638-14746 Sentence denotes For each sample, values were normalized to input DNA and reported as % of input over the rabbit IgG control.
T99 14638-14746 Sentence denotes For each sample, values were normalized to input DNA and reported as % of input over the rabbit IgG control.
T8155 14748-14768 Sentence denotes Statistical analysis
T100 14748-14768 Sentence denotes Statistical analysis
T8156 14769-14842 Sentence denotes Statistical analysis was performed by two-tail unpaired Student's t-test.
T101 14769-14842 Sentence denotes Statistical analysis was performed by two-tail unpaired Student's t-test.
T8157 14843-14876 Sentence denotes Data were reported as means ± SE.
T102 14843-14876 Sentence denotes Data were reported as means ± SE.
T8158 14877-14980 Sentence denotes Differences between the means were considered as statistically significant at the 95% level (P < 0.05).
T103 14877-14980 Sentence denotes Differences between the means were considered as statistically significant at the 95% level (P < 0.05).
T104 14982-14989 Sentence denotes RESULTS
T8532 14991-15094 Sentence denotes Tat enhances the NF-κB activity by hijacking IκB-α and inhibiting the post-activation turn off of NF-κB
T105 14991-15094 Sentence denotes Tat enhances the NF-κB activity by hijacking IκB-α and inhibiting the post-activation turn off of NF-κB
T8533 15095-15229 Sentence denotes We analysed the kinetic of NF-κB activation in single round HIV-1 infection by modulating the expression of Tat with RNA interference.
T106 15095-15229 Sentence denotes We analysed the kinetic of NF-κB activation in single round HIV-1 infection by modulating the expression of Tat with RNA interference.
T8534 15230-15398 Sentence denotes Jurkat cells were transfected with siRNA Tat, siRNA control, or left untransfected, and 24 h later cells were infected with HXB2 Env-pseudotyped NL4-3.Luc.R−E− virions.
T107 15230-15398 Sentence denotes Jurkat cells were transfected with siRNA Tat, siRNA control, or left untransfected, and 24 h later cells were infected with HXB2 Env-pseudotyped NL4-3.Luc.R−E− virions.
T8535 15399-15533 Sentence denotes By cytofluorimetric analysis, ∼40% of cells was siRNA-transfected and HIV-1-infected at 12-h post-infection (Supplementary Figure S1).
T108 15399-15533 Sentence denotes By cytofluorimetric analysis, ∼40% of cells was siRNA-transfected and HIV-1-infected at 12-h post-infection (Supplementary Figure S1).
T8536 15534-15756 Sentence denotes The expression of Tat was detected at 1-h post-infection and progressively increased up to 12 h in untransfected and siRNA control-transfected cells, while it was barely detected in siRNA Tat-transfected cells (Figure 1A).
T109 15534-15756 Sentence denotes The expression of Tat was detected at 1-h post-infection and progressively increased up to 12 h in untransfected and siRNA control-transfected cells, while it was barely detected in siRNA Tat-transfected cells (Figure 1A).
T8537 15757-16051 Sentence denotes The LTR-dependent luciferase expression was also progressively induced at 1- to 12-h post-infection in untransfected and siRNA control-transfected cells, while it was barely observed in siRNA Tat-transfected cells, as expected for the Tat-dependent transactivation of the HIV-1 LTR (Figure 1A).
T110 15757-16051 Sentence denotes The LTR-dependent luciferase expression was also progressively induced at 1- to 12-h post-infection in untransfected and siRNA control-transfected cells, while it was barely observed in siRNA Tat-transfected cells, as expected for the Tat-dependent transactivation of the HIV-1 LTR (Figure 1A).
T111 16052-16061 Sentence denotes Figure 1.
T23911 16062-16148 Sentence denotes Tat counteracts the post-activation turn off of NF-κB in single round HIV-1-infection.
T112 16062-16148 Sentence denotes Tat counteracts the post-activation turn off of NF-κB in single round HIV-1-infection.
T23912 16149-16861 Sentence denotes Jurkat cells (5 × 107) were transfected with siRNA Tat or siRNA control (2 nmol), or left untransfected; 24 h later, cells were infected with HXB2-pseudotyped NL4-3.Luc.R−E− virions (500 ng of p24) and harvested at the indicated time. (A) Tat expression was measured in total RNA by real-time PCR, while the luciferase activity was measured in whole cell extracts. (B) Nuclear extracts (10 µg) were analysed for the p65 and p50 binding to the NF-κB double-stranded oligonucleotide using the NF-κB Transcription Factor ELISA Assay kit (Cayman). (C) The expression of p65 and IκB-α was analysed by 12% SDS–PAGE and western blotting of nuclear or cytosolic extracts (20 µg) using anti-p65 and anti-IκB-α antibodies.
T113 16149-16861 Sentence denotes Jurkat cells (5 × 107) were transfected with siRNA Tat or siRNA control (2 nmol), or left untransfected; 24 h later, cells were infected with HXB2-pseudotyped NL4-3.Luc.R−E− virions (500 ng of p24) and harvested at the indicated time. (A) Tat expression was measured in total RNA by real-time PCR, while the luciferase activity was measured in whole cell extracts. (B) Nuclear extracts (10 µg) were analysed for the p65 and p50 binding to the NF-κB double-stranded oligonucleotide using the NF-κB Transcription Factor ELISA Assay kit (Cayman). (C) The expression of p65 and IκB-α was analysed by 12% SDS–PAGE and western blotting of nuclear or cytosolic extracts (20 µg) using anti-p65 and anti-IκB-α antibodies.
T23913 16862-16989 Sentence denotes Histone H1 and Hexokinase II were detected with specific antibodies as markers of nuclear and cytosolic extracts, respectively.
T114 16862-16989 Sentence denotes Histone H1 and Hexokinase II were detected with specific antibodies as markers of nuclear and cytosolic extracts, respectively.
T23914 16990-17207 Sentence denotes Densitometry values (D) of the bands were expressed as fold increase above the control (mock). (D) IKK activity was measured in cytosolic extracts (100 µg) by using HTScan IKK Kinase Assay (Cell Signaling Technology).
T115 16990-17207 Sentence denotes Densitometry values (D) of the bands were expressed as fold increase above the control (mock). (D) IKK activity was measured in cytosolic extracts (100 µg) by using HTScan IKK Kinase Assay (Cell Signaling Technology).
T23915 17208-17244 Sentence denotes Values (mean ± SE, n = 3) are shown.
T116 17208-17244 Sentence denotes Values (mean ± SE, n = 3) are shown.
T8538 17245-17738 Sentence denotes The progressive increase in NF-κB activity, as measured by p65–p50 binding to an NF-κB consensus oligonucleotide (Figure 1B) and nuclear p65 (Figure 1C, nucleus), was observed at 1- to 3-h post-infection in both Tat-positive (no siRNA or siRNA control) and Tat-negative (siRNA Tat) cells; however, at 12-h post-infection, the p65 DNA binding and nuclear p65 persisted elevated in presence of Tat (no siRNA and siRNA control), while they dropped in absence of Tat (siRNA Tat) (Figure 1B and C).
T117 17245-17738 Sentence denotes The progressive increase in NF-κB activity, as measured by p65–p50 binding to an NF-κB consensus oligonucleotide (Figure 1B) and nuclear p65 (Figure 1C, nucleus), was observed at 1- to 3-h post-infection in both Tat-positive (no siRNA or siRNA control) and Tat-negative (siRNA Tat) cells; however, at 12-h post-infection, the p65 DNA binding and nuclear p65 persisted elevated in presence of Tat (no siRNA and siRNA control), while they dropped in absence of Tat (siRNA Tat) (Figure 1B and C).
T8539 17739-17942 Sentence denotes IκB-α was degraded in the cytosol within 3-h post-infection and de novo synthesized at 6 h with full replenishment at 12-h post-infection in both Tat-positive and Tat-negative cells (Figure 1C, cytosol).
T118 17739-17942 Sentence denotes IκB-α was degraded in the cytosol within 3-h post-infection and de novo synthesized at 6 h with full replenishment at 12-h post-infection in both Tat-positive and Tat-negative cells (Figure 1C, cytosol).
T8540 17943-18094 Sentence denotes Consistently, the IKK activity was induced at 1-h post-infection, and decreased at 3-h post-infection independently of the presence of Tat (Figure 1D).
T119 17943-18094 Sentence denotes Consistently, the IKK activity was induced at 1-h post-infection, and decreased at 3-h post-infection independently of the presence of Tat (Figure 1D).
T8541 18095-18360 Sentence denotes Similar kinetics of NF-κB activity, IKK activation and IκB-α degradation/re-synthesis were observed in single-round HIV-1 infection of PBMCs using a cocktail of Azidothymidine (AZT) and Lamivudine (3TC) as reverse transcriptase inhibitors (Supplementary Figure S2).
T120 18095-18360 Sentence denotes Similar kinetics of NF-κB activity, IKK activation and IκB-α degradation/re-synthesis were observed in single-round HIV-1 infection of PBMCs using a cocktail of Azidothymidine (AZT) and Lamivudine (3TC) as reverse transcriptase inhibitors (Supplementary Figure S2).
T8542 18361-18659 Sentence denotes These results indicated that in single-round HIV-1 infection the NF-κB activation initially correlated with the IKK activation and IκB-α degradation independently of the presence of Tat, and it was kept elevated in presence of Tat following the decay of the IKK activity and new synthesis of IκB-α.
T121 18361-18659 Sentence denotes These results indicated that in single-round HIV-1 infection the NF-κB activation initially correlated with the IKK activation and IκB-α degradation independently of the presence of Tat, and it was kept elevated in presence of Tat following the decay of the IKK activity and new synthesis of IκB-α.
T8543 18660-18749 Sentence denotes Next, we tested the single action of Tat on the kinetic of NF-κB activity induced by PMA.
T122 18660-18749 Sentence denotes Next, we tested the single action of Tat on the kinetic of NF-κB activity induced by PMA.
T8544 18750-18942 Sentence denotes To this end, HeLa cells were transfected with p3x-FLAG-Tat, or empty vector, stimulated with PMA for 5 min, and extensively washed to avoid the oscillatory kinetic of NF-κB activation (17,18).
T123 18750-18942 Sentence denotes To this end, HeLa cells were transfected with p3x-FLAG-Tat, or empty vector, stimulated with PMA for 5 min, and extensively washed to avoid the oscillatory kinetic of NF-κB activation (17,18).
T8545 18943-19143 Sentence denotes In un-stimulated cells, the p65 DNA binding (Figure 2A) and nuclear p65 (Figure 2B, nucleus) were slightly enhanced by Tat, while the IκB-α content was not significantly affected (Figure 2B, cytosol).
T124 18943-19143 Sentence denotes In un-stimulated cells, the p65 DNA binding (Figure 2A) and nuclear p65 (Figure 2B, nucleus) were slightly enhanced by Tat, while the IκB-α content was not significantly affected (Figure 2B, cytosol).
T8546 19144-19491 Sentence denotes Transient stimulation with PMA increased the NF-κB DNA binding activity and nuclear p65 at 5 min peaking at 60–120 min independently of the presence of Tat (Figure 2A and B); however, while the p65 DNA binding and nuclear p65 persisted elevated at 240-min post-treatment in Tat-positive cells, they dropped in Tat-negative cells (Figure 2A and B).
T125 19144-19491 Sentence denotes Transient stimulation with PMA increased the NF-κB DNA binding activity and nuclear p65 at 5 min peaking at 60–120 min independently of the presence of Tat (Figure 2A and B); however, while the p65 DNA binding and nuclear p65 persisted elevated at 240-min post-treatment in Tat-positive cells, they dropped in Tat-negative cells (Figure 2A and B).
T8547 19492-19716 Sentence denotes In addition, Tat bound to the NF-κB oligonucleotide in un-stimulated cells and its binding increased following PMA stimulation (Figure 2A), suggesting that the viral protein was a component of the NF-κB complex bound to DNA.
T126 19492-19716 Sentence denotes In addition, Tat bound to the NF-κB oligonucleotide in un-stimulated cells and its binding increased following PMA stimulation (Figure 2A), suggesting that the viral protein was a component of the NF-κB complex bound to DNA.
T8548 19717-19913 Sentence denotes Degradation of IκB-α was progressively induced at 5–30 min, followed by de novo synthesis at 60 min with full replenishment at 240 min in both Tat-positive and negative cells (Figure 2B, cytosol).
T127 19717-19913 Sentence denotes Degradation of IκB-α was progressively induced at 5–30 min, followed by de novo synthesis at 60 min with full replenishment at 240 min in both Tat-positive and negative cells (Figure 2B, cytosol).
T8549 19914-20039 Sentence denotes Consistently, the IKK activation started at 5 min, and turned off at 30 min independently of the presence of Tat (Figure 2C).
T128 19914-20039 Sentence denotes Consistently, the IKK activation started at 5 min, and turned off at 30 min independently of the presence of Tat (Figure 2C).
T8550 20040-20196 Sentence denotes These results indicated that Tat enhanced the NF-κB activity in un-stimulated and PMA-stimulated cells without affecting the IKK activity and IκB-α content.
T129 20040-20196 Sentence denotes These results indicated that Tat enhanced the NF-κB activity in un-stimulated and PMA-stimulated cells without affecting the IKK activity and IκB-α content.
T130 20197-20206 Sentence denotes Figure 2.
T24351 20207-20330 Sentence denotes Tat enhances the NF-κB activity following PMA stimulation by associating with IκB-α and counteracting the NF-κB repression.
T131 20207-20330 Sentence denotes Tat enhances the NF-κB activity following PMA stimulation by associating with IκB-α and counteracting the NF-κB repression.
T24352 20331-20558 Sentence denotes HeLa cells (5 × 106) were transfected with p3xFLAG-Tat or p3xFLAG empty vector (5 µg), and 48 h later were stimulated with PMA (5 min, 20 ng/ml) or left unstimulated, washed twice with DMEM and harvested at the indicated times.
T132 20331-20558 Sentence denotes HeLa cells (5 × 106) were transfected with p3xFLAG-Tat or p3xFLAG empty vector (5 µg), and 48 h later were stimulated with PMA (5 min, 20 ng/ml) or left unstimulated, washed twice with DMEM and harvested at the indicated times.
T24353 20559-21007 Sentence denotes Nuclear and cytosolic extracts were prepared for further analysis. (A) Nuclear extracts were analysed for the p65, p50 and FLAG-Tat binding to the NF-κB double-stranded oligonucleotide using the NF-κB Transcription Factor ELISA assay kit (Cayman). (B) Nuclear and cytosolic extracts (20 µg) were separated by 12% SDS–PAGE and analysed by western blotting using the anti-p65, anti-FLAG, anti-Histone H1, anti-IκB-α and anti-Hexokinase-II antibodies.
T133 20559-21007 Sentence denotes Nuclear and cytosolic extracts were prepared for further analysis. (A) Nuclear extracts were analysed for the p65, p50 and FLAG-Tat binding to the NF-κB double-stranded oligonucleotide using the NF-κB Transcription Factor ELISA assay kit (Cayman). (B) Nuclear and cytosolic extracts (20 µg) were separated by 12% SDS–PAGE and analysed by western blotting using the anti-p65, anti-FLAG, anti-Histone H1, anti-IκB-α and anti-Hexokinase-II antibodies.
T24354 21008-21441 Sentence denotes Densitometry values (D) of the bands were expressed as fold increase above the control (lane 1). (C) IKK activity was measured in cytosolic extracts (100 µg) by using HTScan IKK kinase assay (Cell Signaling Technology). (D) HeLa cells (5 × 106) were transfected with or without p3xFLAG-Tat (5 µg); 48 h later, cells were stimulated with PMA (5 min, 20 ng/ml) or left unstimulated, washed twice with DMEM, and harvested after 240 min.
T134 21008-21441 Sentence denotes Densitometry values (D) of the bands were expressed as fold increase above the control (lane 1). (C) IKK activity was measured in cytosolic extracts (100 µg) by using HTScan IKK kinase assay (Cell Signaling Technology). (D) HeLa cells (5 × 106) were transfected with or without p3xFLAG-Tat (5 µg); 48 h later, cells were stimulated with PMA (5 min, 20 ng/ml) or left unstimulated, washed twice with DMEM, and harvested after 240 min.
T24355 21442-21546 Sentence denotes Whole cell extracts (1 mg) were immunoprecipitated with protein G-Sepharose-coupled anti-IκB-α antibody.
T135 21442-21546 Sentence denotes Whole cell extracts (1 mg) were immunoprecipitated with protein G-Sepharose-coupled anti-IκB-α antibody.
T24356 21547-21678 Sentence denotes Immunocomplexes were separated by 12% SDS–PAGE and analysed by western blotting with anti-p65, anti-FLAG and anti-IκB-α antibodies.
T136 21547-21678 Sentence denotes Immunocomplexes were separated by 12% SDS–PAGE and analysed by western blotting with anti-p65, anti-FLAG and anti-IκB-α antibodies.
T24357 21679-21775 Sentence denotes Densitometry values (D) of the bands were expressed as fold increase above the control (lane 1).
T137 21679-21775 Sentence denotes Densitometry values (D) of the bands were expressed as fold increase above the control (lane 1).
T24358 21776-21812 Sentence denotes Values (mean ± SE, n = 3) are shown.
T138 21776-21812 Sentence denotes Values (mean ± SE, n = 3) are shown.
T8551 21813-21967 Sentence denotes As we previously found that Tat binds to the sixth ankyrin of IκB-α (50,51), we tested whether Tat counteracted the generation of the IκB-α/NF-κB complex.
T139 21813-21967 Sentence denotes As we previously found that Tat binds to the sixth ankyrin of IκB-α (50,51), we tested whether Tat counteracted the generation of the IκB-α/NF-κB complex.
T8552 21968-22195 Sentence denotes To this end, the association of IκB-α with p65 was analysed in vivo at 0 and 240 min after short-pulse PMA, which corresponded to the time of un-stimulated condition and post-activation de novo synthesis of IκB-α, respectively.
T140 21968-22195 Sentence denotes To this end, the association of IκB-α with p65 was analysed in vivo at 0 and 240 min after short-pulse PMA, which corresponded to the time of un-stimulated condition and post-activation de novo synthesis of IκB-α, respectively.
T8553 22196-22494 Sentence denotes Coimmunoprecipitation of IκB-α with p65 was detected at 0- and 240-min post-treatment in Tat-negative cells (Figure 2D, lanes 1 and 3), and was halved in Tat-positive cells, where Tat coimmunoprecipitated with IκB-α (Figure 2D, lanes 2 and 4), indicating that Tat competed the IκB-α binding to p65.
T141 22196-22494 Sentence denotes Coimmunoprecipitation of IκB-α with p65 was detected at 0- and 240-min post-treatment in Tat-negative cells (Figure 2D, lanes 1 and 3), and was halved in Tat-positive cells, where Tat coimmunoprecipitated with IκB-α (Figure 2D, lanes 2 and 4), indicating that Tat competed the IκB-α binding to p65.
T11602 22496-22574 Sentence denotes Tat counteracts the IκB-α inhibition of p65 by competing the repressor binding
T142 22496-22574 Sentence denotes Tat counteracts the IκB-α inhibition of p65 by competing the repressor binding
T11603 22575-22709 Sentence denotes We further investigated the physical interaction of Tat with IκB-α using in vitro translated proteins in coimmunoprecipitation assays.
T143 22575-22709 Sentence denotes We further investigated the physical interaction of Tat with IκB-α using in vitro translated proteins in coimmunoprecipitation assays.
T11604 22710-22781 Sentence denotes For mapping the interaction domains, we used the following Tat mutants:
T144 22710-22781 Sentence denotes For mapping the interaction domains, we used the following Tat mutants:
T11605 22782-22861 Sentence denotes Tat T,N(23,24)A, Tat C(22,25,27)A, Tat K(50,51)A and Tat R(49–57)A (Figure 3A).
T145 22782-22861 Sentence denotes Tat T,N(23,24)A, Tat C(22,25,27)A, Tat K(50,51)A and Tat R(49–57)A (Figure 3A).
T11606 22862-22945 Sentence denotes IκB-α coimmunoprecipitated with all Tat proteins, except Tat R(49–57)A (Figure 3B).
T146 22862-22945 Sentence denotes IκB-α coimmunoprecipitated with all Tat proteins, except Tat R(49–57)A (Figure 3B).
T11607 22946-23101 Sentence denotes These results indicated that the arginine-rich domain of Tat was involved in the binding to IκB-α, which was consistent with previous observations (50,51).
T147 22946-23101 Sentence denotes These results indicated that the arginine-rich domain of Tat was involved in the binding to IκB-α, which was consistent with previous observations (50,51).
T11608 23102-23389 Sentence denotes Moreover, Tat associating with IκB-α competed the binding of IκB-α to p65 in a dose-dependent manner (Figure 3C, lanes 3–5), while Tat R(49–57)A, which lacked the binding site for IκB-α, did not associate with IκB-α and did not compete the binding of IκB-α to p65 (Figure 3C, lanes 6–8).
T148 23102-23389 Sentence denotes Moreover, Tat associating with IκB-α competed the binding of IκB-α to p65 in a dose-dependent manner (Figure 3C, lanes 3–5), while Tat R(49–57)A, which lacked the binding site for IκB-α, did not associate with IκB-α and did not compete the binding of IκB-α to p65 (Figure 3C, lanes 6–8).
T149 23390-23399 Sentence denotes Figure 3.
T25204 23400-23710 Sentence denotes Tat relieves p65 from the IκB-α inhibition. (A) Schematic representation of wild-type and mutant Tat proteins. (B) HA-IκB-α (5 µl) was incubated in presence or absence of FLAG-Tat, FLAG-Tat T,N(23,24)A, FLAG-Tat K(50,51)A, FLAG-Tat R(49–57)A or FLAG-Tat C(22,25,27)A (10 µl) using in vitro translated proteins.
T150 23400-23710 Sentence denotes Tat relieves p65 from the IκB-α inhibition. (A) Schematic representation of wild-type and mutant Tat proteins. (B) HA-IκB-α (5 µl) was incubated in presence or absence of FLAG-Tat, FLAG-Tat T,N(23,24)A, FLAG-Tat K(50,51)A, FLAG-Tat R(49–57)A or FLAG-Tat C(22,25,27)A (10 µl) using in vitro translated proteins.
T25205 23711-24080 Sentence denotes Wild-type and mutant Tat proteins were immunoprecipitated with anti-FLAG antibody; immunocomplexes were separated by 12% SDS–PAGE and analysed by western blotting with anti-HA and anti-FLAG antibodies. (C) 35S-methionine-labeled p65 (5 µl) was incubated with in vitro translated HA-IκB-α (5 µl) in presence or absence of FLAG-Tat or FLAG-Tat R(49–57)A (5, 10 or 20 µl).
T151 23711-24080 Sentence denotes Wild-type and mutant Tat proteins were immunoprecipitated with anti-FLAG antibody; immunocomplexes were separated by 12% SDS–PAGE and analysed by western blotting with anti-HA and anti-FLAG antibodies. (C) 35S-methionine-labeled p65 (5 µl) was incubated with in vitro translated HA-IκB-α (5 µl) in presence or absence of FLAG-Tat or FLAG-Tat R(49–57)A (5, 10 or 20 µl).
T25206 24081-24288 Sentence denotes HA-IκB-α was immunoprecipitated with anti-HA antibody; immunocomplexes were separated by 12% SDS–PAGE and analysed by western blotting with anti-HA and anti-FLAG antibodies, or autoradiography (35S-Met-p65).
T152 24081-24288 Sentence denotes HA-IκB-α was immunoprecipitated with anti-HA antibody; immunocomplexes were separated by 12% SDS–PAGE and analysed by western blotting with anti-HA and anti-FLAG antibodies, or autoradiography (35S-Met-p65).
T25207 24289-24475 Sentence denotes Densitometry values (D) of the bands were expressed as fold increase above the control (lane 1). (D) The p65 DNA binding activity was analysed by EMSA using in vitro translated proteins.
T153 24289-24475 Sentence denotes Densitometry values (D) of the bands were expressed as fold increase above the control (lane 1). (D) The p65 DNA binding activity was analysed by EMSA using in vitro translated proteins.
T25208 24476-24777 Sentence denotes 32P-labeled-NF-κB double-stranded oligonucleotide was incubated with p65 (0.5 µl) in presence or absence of HA-IκB-α (1 µl), FLAG-Tat or FLAG-Tat R(49–57)A (5 and 10 µl); competition of DNA binding was performed with 10 - up to 100-fold molar excess of unlabeled NF-κB double-stranded oligonucleotide.
T154 24476-24777 Sentence denotes 32P-labeled-NF-κB double-stranded oligonucleotide was incubated with p65 (0.5 µl) in presence or absence of HA-IκB-α (1 µl), FLAG-Tat or FLAG-Tat R(49–57)A (5 and 10 µl); competition of DNA binding was performed with 10 - up to 100-fold molar excess of unlabeled NF-κB double-stranded oligonucleotide.
T25209 24778-25073 Sentence denotes DNA/protein complexes were run on 6% PAGE–TBE and analysed by autoradiography. (E) p50−/−p65−/−MEFs (3 × 105 cells) were transfected with pκBLuc (0.5 µg) and pSV-β-Gal (0.1 µg) with or without pRc/CMV-p65 (0.5 µg), pCMV4-HA-IκB-α (0.5 µg), p3xFLAG-Tat or p3xFLAG-Tat R(49–57)A (0.5, 1 and 2 µg).
T155 24778-25073 Sentence denotes DNA/protein complexes were run on 6% PAGE–TBE and analysed by autoradiography. (E) p50−/−p65−/−MEFs (3 × 105 cells) were transfected with pκBLuc (0.5 µg) and pSV-β-Gal (0.1 µg) with or without pRc/CMV-p65 (0.5 µg), pCMV4-HA-IκB-α (0.5 µg), p3xFLAG-Tat or p3xFLAG-Tat R(49–57)A (0.5, 1 and 2 µg).
T25210 25074-25194 Sentence denotes The luciferase activity was measured in cell extracts 48-h post-transfection and normalized to β-galactosidase activity.
T156 25074-25194 Sentence denotes The luciferase activity was measured in cell extracts 48-h post-transfection and normalized to β-galactosidase activity.
T25211 25195-25279 Sentence denotes Fold activation was calculated relative to transfection of the pκBLuc plasmid alone.
T157 25195-25279 Sentence denotes Fold activation was calculated relative to transfection of the pκBLuc plasmid alone.
T25212 25280-25316 Sentence denotes Values (mean ± SE, n = 3) are shown.
T158 25280-25316 Sentence denotes Values (mean ± SE, n = 3) are shown.
T25213 25317-25483 Sentence denotes As control of protein expression, aliquots of cell extracts (20 µg) were analysed by western blotting with anti-p65, anti-HA, anti-FLAG and anti-γ-tubulin antibodies.
T159 25317-25483 Sentence denotes As control of protein expression, aliquots of cell extracts (20 µg) were analysed by western blotting with anti-p65, anti-HA, anti-FLAG and anti-γ-tubulin antibodies.
T11609 25484-25705 Sentence denotes Next, we evaluated whether Tat counteracted the IκB-α-mediated inhibition of p65 binding to DNA by incubating in vitro translated p65 and IκB-α proteins with the NF-κB probe in presence or absence of Tat followed by EMSA.
T160 25484-25705 Sentence denotes Next, we evaluated whether Tat counteracted the IκB-α-mediated inhibition of p65 binding to DNA by incubating in vitro translated p65 and IκB-α proteins with the NF-κB probe in presence or absence of Tat followed by EMSA.
T11610 25706-25852 Sentence denotes The p65 DNA binding activity was inhibited by IκB-α and restored in a dose-dependent manner by wild-type Tat, and not by Tat R(49–57) (Figure 3D).
T161 25706-25852 Sentence denotes The p65 DNA binding activity was inhibited by IκB-α and restored in a dose-dependent manner by wild-type Tat, and not by Tat R(49–57) (Figure 3D).
T162 25853-26087 Sentence denotes Further, we analysed the Tat effect on the IκB-α repression of p65 transcriptional activity by transfecting p50−/−p65−/−MEFs with the NF-κB-Luc reporter together with expression vectors of p65 and IκB-α, in presence or absence of Tat.
T11611 25853-26258 Sentence denotes Further, we analysed the Tat effect on the IκB-α repression of p65 transcriptional activity by transfecting p50−/−p65−/−MEFs with the NF-κB-Luc reporter together with expression vectors of p65 and IκB-α, in presence or absence of Tat. IκB-α inhibited the p65-dependent expression of the luciferase gene, which was restored in a dose-dependent manner by wild-type Tat, and not by Tat R(49–57)A (Figure 3E).
T163 26088-26258 Sentence denotes IκB-α inhibited the p65-dependent expression of the luciferase gene, which was restored in a dose-dependent manner by wild-type Tat, and not by Tat R(49–57)A (Figure 3E).
T11612 26259-26457 Sentence denotes Altogether these results indicated that Tat counteracts the IκB-α repression of the p65 DNA-binding and transcriptional activity by associating with IκB-α and competing the repressor binding to p65.
T164 26259-26457 Sentence denotes Altogether these results indicated that Tat counteracts the IκB-α repression of the p65 DNA-binding and transcriptional activity by associating with IκB-α and competing the repressor binding to p65.
T13324 26459-26533 Sentence denotes Tat increases the p65 affinity binding to DNA through association with p65
T165 26459-26533 Sentence denotes Tat increases the p65 affinity binding to DNA through association with p65
T13325 26534-26587 Sentence denotes We tested whether Tat physically interacted with p65.
T166 26534-26587 Sentence denotes We tested whether Tat physically interacted with p65.
T13326 26588-26729 Sentence denotes HeLa cells were transfected with the expression vectors of HA-p65 and FLAG-Tat, and 24 h later Tat was immunoprecipitated from cell extracts.
T167 26588-26729 Sentence denotes HeLa cells were transfected with the expression vectors of HA-p65 and FLAG-Tat, and 24 h later Tat was immunoprecipitated from cell extracts.
T13327 26730-26973 Sentence denotes The p65 protein was coimmunoprecipitated with wild-type Tat or the mutants Tat T,N(23,24)A, Tat K(50,51)A and Tat R(49–57)A at similar levels, while a significant decrease in coimmunoprecipitation was observed for Tat C(22,25,27)A (Figure 4A).
T168 26730-26973 Sentence denotes The p65 protein was coimmunoprecipitated with wild-type Tat or the mutants Tat T,N(23,24)A, Tat K(50,51)A and Tat R(49–57)A at similar levels, while a significant decrease in coimmunoprecipitation was observed for Tat C(22,25,27)A (Figure 4A).
T13328 26974-27202 Sentence denotes Consistently, GST-pull down of in vitro translated proteins showed the direct binding of p65 to wild-type Tat, or the mutants Tat T,N(23,24)A, Tat K(50,51)A and Tat R(49–57)A, and lack of binding to Tat C(22,25,27)A (Figure 4B).
T169 26974-27202 Sentence denotes Consistently, GST-pull down of in vitro translated proteins showed the direct binding of p65 to wild-type Tat, or the mutants Tat T,N(23,24)A, Tat K(50,51)A and Tat R(49–57)A, and lack of binding to Tat C(22,25,27)A (Figure 4B).
T13329 27203-27368 Sentence denotes These results indicated that Tat associated with p65 through the cysteine-rich domain and ruled-out the requirement of bridging proteins to mediate such interaction.
T170 27203-27368 Sentence denotes These results indicated that Tat associated with p65 through the cysteine-rich domain and ruled-out the requirement of bridging proteins to mediate such interaction.
T171 27369-27378 Sentence denotes Figure 4.
T26499 27379-27646 Sentence denotes Tat associates with p65 increasing its DNA-affinity binding. (A) HeLa cells were transfected with pRc/CMV-3xHA-p65 (5 µg) in presence or absence of p3xFLAG-Tat, p3xFLAG-Tat T,N(23,24)A, p3xFLAG-Tat K(50,51)A, p3xFLAG-Tat R(49–57)A, or p3xFLAG-Tat C(22,25,27)A (5 µg).
T172 27379-27646 Sentence denotes Tat associates with p65 increasing its DNA-affinity binding. (A) HeLa cells were transfected with pRc/CMV-3xHA-p65 (5 µg) in presence or absence of p3xFLAG-Tat, p3xFLAG-Tat T,N(23,24)A, p3xFLAG-Tat K(50,51)A, p3xFLAG-Tat R(49–57)A, or p3xFLAG-Tat C(22,25,27)A (5 µg).
T173 27647-28028 Sentence denotes FLAG-Tat proteins were immunoprecipitated with anti-FLAG antibody; immunocomplexes were separated by 12% SDS–PAGE and analysed by western blotting with anti-FLAG or anti-HA antibodies. (B) In vitro translated p65 (5 µl) was incubated with GST-Tat, GST-Tat T,N(23,24)A, GST-Tat K(50,51)A, GST-Tat R(49–57)A, GST-Tat C(22,25,27)A, or GST (5 µg) conjugated with Glutathione-Sepharose.
T26500 27647-28416 Sentence denotes FLAG-Tat proteins were immunoprecipitated with anti-FLAG antibody; immunocomplexes were separated by 12% SDS–PAGE and analysed by western blotting with anti-FLAG or anti-HA antibodies. (B) In vitro translated p65 (5 µl) was incubated with GST-Tat, GST-Tat T,N(23,24)A, GST-Tat K(50,51)A, GST-Tat R(49–57)A, GST-Tat C(22,25,27)A, or GST (5 µg) conjugated with Glutathione-Sepharose. Protein complexes were recovered by GST-pull down, separated by 12% SDS–PAGE, and analysed by western blotting with anti-p65 or anti-GST antibodies. (C) Schematic representation of wild-type and mutant p65 proteins. (D) HeLa cells were transfected with p3xFLAG-Tat (5 µg) in the presence or absence of pRc/CMV-3xHA-p65, pRc/CMV-3xHA-p65ΔC (1–318), or pRc/CMV-3xHA-p65ΔN (122–551) (5 µg).
T174 28029-28416 Sentence denotes Protein complexes were recovered by GST-pull down, separated by 12% SDS–PAGE, and analysed by western blotting with anti-p65 or anti-GST antibodies. (C) Schematic representation of wild-type and mutant p65 proteins. (D) HeLa cells were transfected with p3xFLAG-Tat (5 µg) in the presence or absence of pRc/CMV-3xHA-p65, pRc/CMV-3xHA-p65ΔC (1–318), or pRc/CMV-3xHA-p65ΔN (122–551) (5 µg).
T26501 28417-28947 Sentence denotes Wild-type and mutant HA-p65 proteins were immunoprecipitated with anti-HA antibody; immunocomplexes were separated by 12% SDS–PAGE and analysed by western blotting with anti-FLAG or anti-HA antibodies. (E) Recombinant p65 protein (100 ng; Active Motif Carlsbad, CA, USA) was 20 min incubated with 32P-labeled NF-κB double-stranded oligonucleotide in presence or absence of in vitro translated FLAG-Tat or FLAG-Tat C(22,25,27)A (5 µl); competitions were performed with 1.25- up to 40-fold molar excess of unlabeled oligonucleotide.
T175 28417-28947 Sentence denotes Wild-type and mutant HA-p65 proteins were immunoprecipitated with anti-HA antibody; immunocomplexes were separated by 12% SDS–PAGE and analysed by western blotting with anti-FLAG or anti-HA antibodies. (E) Recombinant p65 protein (100 ng; Active Motif Carlsbad, CA, USA) was 20 min incubated with 32P-labeled NF-κB double-stranded oligonucleotide in presence or absence of in vitro translated FLAG-Tat or FLAG-Tat C(22,25,27)A (5 µl); competitions were performed with 1.25- up to 40-fold molar excess of unlabeled oligonucleotide.
T26502 28948-29092 Sentence denotes DNA/protein complexes were separated by 6% PAGE in 0.5 × TBE buffer and analysed by autoradiography. (F) Densitometry of band-shifts shown in E.
T176 28948-29092 Sentence denotes DNA/protein complexes were separated by 6% PAGE in 0.5 × TBE buffer and analysed by autoradiography. (F) Densitometry of band-shifts shown in E.
T13330 29093-29328 Sentence denotes To identify the p65 domain required for binding to Tat, HeLa cells were transfected with FLAG-Tat together with HA-p65 mutants, which were deleted of the transactivation domain [p65ΔC (1–318)], or the RHD [p65ΔN (122–551)] (Figure 4C).
T177 29093-29328 Sentence denotes To identify the p65 domain required for binding to Tat, HeLa cells were transfected with FLAG-Tat together with HA-p65 mutants, which were deleted of the transactivation domain [p65ΔC (1–318)], or the RHD [p65ΔN (122–551)] (Figure 4C).
T13331 29329-29497 Sentence denotes Tat coimmunoprecipitated with p65ΔC (1–318), and not with p65ΔN (122–551) (Figure 4D), indicating that the RHD of p65 was involved in the physical interaction with Tat.
T178 29329-29497 Sentence denotes Tat coimmunoprecipitated with p65ΔC (1–318), and not with p65ΔN (122–551) (Figure 4D), indicating that the RHD of p65 was involved in the physical interaction with Tat.
T13332 29498-29764 Sentence denotes To address the effect of Tat on the p65 DNA-binding affinity, purified recombinant p65 protein was incubated with 32P-labeled-NF-κB double-stranded oligonucleotide in presence or absence of wild-type Tat or Tat C(22,25,27)A, and p65 DNA-binding was analysed by EMSA.
T179 29498-29764 Sentence denotes To address the effect of Tat on the p65 DNA-binding affinity, purified recombinant p65 protein was incubated with 32P-labeled-NF-κB double-stranded oligonucleotide in presence or absence of wild-type Tat or Tat C(22,25,27)A, and p65 DNA-binding was analysed by EMSA.
T13333 29765-29929 Sentence denotes Whereas wild-type Tat significantly increased the binding of p65 to DNA, the mutant Tat C(22,25,27)A, lacking the binding site for p65, was ineffective (Figure 4E).
T180 29765-29929 Sentence denotes Whereas wild-type Tat significantly increased the binding of p65 to DNA, the mutant Tat C(22,25,27)A, lacking the binding site for p65, was ineffective (Figure 4E).
T13334 29930-30143 Sentence denotes The p65 binding to DNA was evaluated by competition with increasing amounts of cold competitor NF-κB oligonucleotide, which showed that Tat significantly enhanced the p65 affinity binding to DNA (Figure 4E and F).
T181 29930-30143 Sentence denotes The p65 binding to DNA was evaluated by competition with increasing amounts of cold competitor NF-κB oligonucleotide, which showed that Tat significantly enhanced the p65 affinity binding to DNA (Figure 4E and F).
T15219 30145-30300 Sentence denotes Tat activates the p65-dependent expression of NF-κB-responsive genes, occupies the NF-κB enhancers and promotes the p65 recruitment with IκB-α displacement
T182 30145-30300 Sentence denotes Tat activates the p65-dependent expression of NF-κB-responsive genes, occupies the NF-κB enhancers and promotes the p65 recruitment with IκB-α displacement
T15220 30301-30383 Sentence denotes We analysed the action of Tat on the expression of NF-κB-responsive genes in vivo.
T183 30301-30383 Sentence denotes We analysed the action of Tat on the expression of NF-κB-responsive genes in vivo.
T15221 30384-30582 Sentence denotes To this end, HeLa cells were transfected with FLAG-Tat, FLAG-Tat C(22,25,27)A or FLAG-Tat R(49–57)A, and 48 h later the expression of a number of NF-κB-dependent genes was analysed by real-time PCR.
T184 30384-30582 Sentence denotes To this end, HeLa cells were transfected with FLAG-Tat, FLAG-Tat C(22,25,27)A or FLAG-Tat R(49–57)A, and 48 h later the expression of a number of NF-κB-dependent genes was analysed by real-time PCR.
T15222 30583-30749 Sentence denotes Tat significantly increased the expression of MIP-1α, CSF3, LTA, NFKBIA and TLR2, while the mutants Tat C(22,25,27)A and Tat R(49–57)A were ineffective (Figure 5A–E).
T185 30583-30749 Sentence denotes Tat significantly increased the expression of MIP-1α, CSF3, LTA, NFKBIA and TLR2, while the mutants Tat C(22,25,27)A and Tat R(49–57)A were ineffective (Figure 5A–E).
T15223 30750-30956 Sentence denotes The Tat-dependent transactivation of the NF-κB-dependent genes was abolished when cells were transfected with siRNA p65, indicating that the Tat transcriptional activation was mediated by p65 (Figure 5A–E).
T186 30750-30956 Sentence denotes The Tat-dependent transactivation of the NF-κB-dependent genes was abolished when cells were transfected with siRNA p65, indicating that the Tat transcriptional activation was mediated by p65 (Figure 5A–E).
T15224 30957-31093 Sentence denotes Differently, the expression of the NF-κB-independent genes GAPDH and ACTB was unaffected by wild-type and Tat mutants (Figure 5F and G).
T187 30957-31093 Sentence denotes Differently, the expression of the NF-κB-independent genes GAPDH and ACTB was unaffected by wild-type and Tat mutants (Figure 5F and G).
T15225 31094-31383 Sentence denotes These results were consistent with the requirement of both the cysteine-rich and arginine-rich domains of Tat to enhance the NF-κB activity, suggesting that the up-regulation of NF-κB-responsive genes by Tat might occur through physical interaction of the viral protein with p65 and IκB-α.
T188 31094-31383 Sentence denotes These results were consistent with the requirement of both the cysteine-rich and arginine-rich domains of Tat to enhance the NF-κB activity, suggesting that the up-regulation of NF-κB-responsive genes by Tat might occur through physical interaction of the viral protein with p65 and IκB-α.
T189 31384-31393 Sentence denotes Figure 5.
T27258 31394-31554 Sentence denotes Tat activates the p65-dependent expression of NF-κB-responsive genes by occupying the NF-κB enhancers and promoting the p65 recruitment with IκB-α displacement.
T190 31394-31554 Sentence denotes Tat activates the p65-dependent expression of NF-κB-responsive genes by occupying the NF-κB enhancers and promoting the p65 recruitment with IκB-α displacement.
T27259 31555-31808 Sentence denotes HeLa cells (5 × 106) were transfected with p3xFLAG-Tat, p3xFLAG-Tat C(22,25,27), p3xFLAG-Tat R(49–57) or empty vector (10 µg); for p65 RNA interference, cells (5 × 106) were transfected with p3xFLAG-Tat (10 µg) and siRNA p65 or siRNA control (200 pmol).
T191 31555-31808 Sentence denotes HeLa cells (5 × 106) were transfected with p3xFLAG-Tat, p3xFLAG-Tat C(22,25,27), p3xFLAG-Tat R(49–57) or empty vector (10 µg); for p65 RNA interference, cells (5 × 106) were transfected with p3xFLAG-Tat (10 µg) and siRNA p65 or siRNA control (200 pmol).
T27260 31809-32150 Sentence denotes Twenty-four-hour post-transfection, total RNA was extracted and analysed by real-time PCR to evaluate the expression of MIP-1α (A), CSF3 (B), LTA (C), NFKBIA (D), TLR2 (E), GAPDH (F), ACTB (G) genes. (H) HeLa cells (5 × 106) were transfected with p3xFLAG-Tat, or empty vector (10 µg) and 48 h later ChIP was performed with anti-p65 antibody.
T192 31809-32150 Sentence denotes Twenty-four-hour post-transfection, total RNA was extracted and analysed by real-time PCR to evaluate the expression of MIP-1α (A), CSF3 (B), LTA (C), NFKBIA (D), TLR2 (E), GAPDH (F), ACTB (G) genes. (H) HeLa cells (5 × 106) were transfected with p3xFLAG-Tat, or empty vector (10 µg) and 48 h later ChIP was performed with anti-p65 antibody.
T27261 32151-32435 Sentence denotes Real-time PCR was performed with primers specific for the indicated promoters. (I) HeLa cells (5 × 106) were transfected with empty vector, or p3xFLAG-Tat (10 µg) in presence or absence of siRNA p65, or siRNA control (200 pmol); 48 h later, ChIP was performed with anti-FLAG antibody.
T193 32151-32435 Sentence denotes Real-time PCR was performed with primers specific for the indicated promoters. (I) HeLa cells (5 × 106) were transfected with empty vector, or p3xFLAG-Tat (10 µg) in presence or absence of siRNA p65, or siRNA control (200 pmol); 48 h later, ChIP was performed with anti-FLAG antibody.
T27262 32436-32715 Sentence denotes Real-time PCR was performed with primers specific for the indicated promoters. (J) HeLa cells (5 × 106) were transfected with empty vector, p3xFLAG-Tat (10 µg), or empty vector plus siRNA IκB-α or siRNA control (200 pmol); 48 h later, ChIP was performed with anti-IκB-α antibody.
T194 32436-32715 Sentence denotes Real-time PCR was performed with primers specific for the indicated promoters. (J) HeLa cells (5 × 106) were transfected with empty vector, p3xFLAG-Tat (10 µg), or empty vector plus siRNA IκB-α or siRNA control (200 pmol); 48 h later, ChIP was performed with anti-IκB-α antibody.
T27263 32716-32794 Sentence denotes Real-time PCR was performed with primers specific for the indicated promoters.
T195 32716-32794 Sentence denotes Real-time PCR was performed with primers specific for the indicated promoters.
T27264 32795-32831 Sentence denotes Values (mean ± SE, n = 3) are shown.
T196 32795-32831 Sentence denotes Values (mean ± SE, n = 3) are shown.
T27265 32832-32977 Sentence denotes The asterisks indicate statistically significant differences compared to the control (empty vector) according to the Student's t-test (P < 0.05).
T197 32832-32977 Sentence denotes The asterisks indicate statistically significant differences compared to the control (empty vector) according to the Student's t-test (P < 0.05).
T15226 32978-33115 Sentence denotes MIP-1α, which was the mostly activated gene by Tat, encodes for a chemokine that promotes the recruitment of pro-inflammatory cells (56).
T198 32978-33115 Sentence denotes MIP-1α, which was the mostly activated gene by Tat, encodes for a chemokine that promotes the recruitment of pro-inflammatory cells (56).
T15227 33116-33331 Sentence denotes Consistently with our findings, MIP-1α expression was increased in glial cells and lymph nodes of AIDS patients (57,58); moreover, MIP-1α production was induced by HIV-1 infection (59,60) and Tat protein (57,61,62).
T199 33116-33331 Sentence denotes Consistently with our findings, MIP-1α expression was increased in glial cells and lymph nodes of AIDS patients (57,58); moreover, MIP-1α production was induced by HIV-1 infection (59,60) and Tat protein (57,61,62).
T15228 33332-33403 Sentence denotes The transcriptional regulation of MIP-1α has been poorly characterized.
T200 33332-33403 Sentence denotes The transcriptional regulation of MIP-1α has been poorly characterized.
T15229 33404-33669 Sentence denotes Jaspar-based analysis (http://jaspar.genereg.net/) predicted three putative NF-κB enhancers in the proximal promoter region of the MIP-1α gene: NF-κB1, −1023/−1014 nucleotides; NF-κB2, −661/−652 nucleotides; NF-κB3, +370/+379 nucleotides (Supplementary Figure S3A).
T201 33404-33669 Sentence denotes Jaspar-based analysis (http://jaspar.genereg.net/) predicted three putative NF-κB enhancers in the proximal promoter region of the MIP-1α gene: NF-κB1, −1023/−1014 nucleotides; NF-κB2, −661/−652 nucleotides; NF-κB3, +370/+379 nucleotides (Supplementary Figure S3A).
T15230 33670-33917 Sentence denotes To validate the predicted NF-κB binding sites of the MIP-1α promoter, we stimulated HeLa cells with TNF-α, a well-known NF-κB inducer, and measured the expression levels of MIP-1α by real-time PCR, and the p65 occupancy of the NF-κB sites by ChIP.
T202 33670-33917 Sentence denotes To validate the predicted NF-κB binding sites of the MIP-1α promoter, we stimulated HeLa cells with TNF-α, a well-known NF-κB inducer, and measured the expression levels of MIP-1α by real-time PCR, and the p65 occupancy of the NF-κB sites by ChIP.
T15231 33918-34127 Sentence denotes TNF-α activated the expression of MIP-1α and induced the p65 recruitment to the NF-κB1 site of MIP-1α without affecting the occupancy of the putative NF-κB2 and NF-κB3 sites (Supplementary Figure S3B and S3C).
T203 33918-34127 Sentence denotes TNF-α activated the expression of MIP-1α and induced the p65 recruitment to the NF-κB1 site of MIP-1α without affecting the occupancy of the putative NF-κB2 and NF-κB3 sites (Supplementary Figure S3B and S3C).
T15232 34128-34287 Sentence denotes Tat also promoted the recruitment of p65 to the NF-κB1 site of MIP-1α, while it did not affect the putative NF-κB2 and NF-κB3 sites (Supplementary Figure S3D).
T204 34128-34287 Sentence denotes Tat also promoted the recruitment of p65 to the NF-κB1 site of MIP-1α, while it did not affect the putative NF-κB2 and NF-κB3 sites (Supplementary Figure S3D).
T15233 34288-34434 Sentence denotes Altogether these results indicated that the NF-κB1 site was the only effective NF-κB enhancer of the MIP-1α promoter in response to TNF-α and Tat.
T205 34288-34434 Sentence denotes Altogether these results indicated that the NF-κB1 site was the only effective NF-κB enhancer of the MIP-1α promoter in response to TNF-α and Tat.
T15234 34435-34619 Sentence denotes Similarly to MIP-1α, Tat increased the recruitment of p65 to the NF-κB enhancers of CSF3, LTA, NFKBIA and TLR2, while it was ineffective at the promoters of GAPDH and ACTB (Figure 5H).
T206 34435-34619 Sentence denotes Similarly to MIP-1α, Tat increased the recruitment of p65 to the NF-κB enhancers of CSF3, LTA, NFKBIA and TLR2, while it was ineffective at the promoters of GAPDH and ACTB (Figure 5H).
T15235 34620-34839 Sentence denotes By ChIP, Tat bound to the NF-κB-responsive promoters, and not to the GAPDH and ACTB promoters, with loss of binding following p65 RNA interference (Figure 5I), suggesting that Tat occupancy occurred via p65 interaction.
T207 34620-34839 Sentence denotes By ChIP, Tat bound to the NF-κB-responsive promoters, and not to the GAPDH and ACTB promoters, with loss of binding following p65 RNA interference (Figure 5I), suggesting that Tat occupancy occurred via p65 interaction.
T15236 34840-35098 Sentence denotes As additional findings, IκB-α was chromatin-immunoprecipitated at the NF-κB enhancers in absence of Tat, and it was significantly removed in presence of Tat, or following IκB-α RNA interference (Figure 5J), indicating that Tat displaced IκB-α from promoters.
T208 34840-35098 Sentence denotes As additional findings, IκB-α was chromatin-immunoprecipitated at the NF-κB enhancers in absence of Tat, and it was significantly removed in presence of Tat, or following IκB-α RNA interference (Figure 5J), indicating that Tat displaced IκB-α from promoters.
T17783 35100-35247 Sentence denotes In HIV-1-infected monocytes Tat sustains the NF-κB activity and promotes the transcriptional activation of MIP-1α by interacting with IκB-α and p65
T209 35100-35247 Sentence denotes In HIV-1-infected monocytes Tat sustains the NF-κB activity and promotes the transcriptional activation of MIP-1α by interacting with IκB-α and p65
T17784 35248-35367 Sentence denotes We next analysed whether Tat affected the NF-κB activity and the expression of MIP-1α in the course of HIV-1 infection.
T210 35248-35367 Sentence denotes We next analysed whether Tat affected the NF-κB activity and the expression of MIP-1α in the course of HIV-1 infection.
T17785 35368-35536 Sentence denotes To detect the Tat protein, we produced HXB2 Env-pseudotyped NL4-3.FLAG-Tat.R−E− virions, which were used in single-round infection of U937, a human monocytic cell line.
T211 35368-35536 Sentence denotes To detect the Tat protein, we produced HXB2 Env-pseudotyped NL4-3.FLAG-Tat.R−E− virions, which were used in single-round infection of U937, a human monocytic cell line.
T17786 35537-35724 Sentence denotes Cells were transfected with siRNA Tat, siRNA control or left untransfected to modulate the Tat expression, and then analysed for the kinetic of NF-κB activation following viral infection.
T212 35537-35724 Sentence denotes Cells were transfected with siRNA Tat, siRNA control or left untransfected to modulate the Tat expression, and then analysed for the kinetic of NF-κB activation following viral infection.
T17787 35725-35870 Sentence denotes The expression of Tat and p24 was detected at 3- to 12-h post-infection, while it was barely detected in siRNA Tat-transfected cells (Figure 6A).
T213 35725-35870 Sentence denotes The expression of Tat and p24 was detected at 3- to 12-h post-infection, while it was barely detected in siRNA Tat-transfected cells (Figure 6A).
T214 35871-35880 Sentence denotes Figure 6.
T28289 35881-36002 Sentence denotes In HIV-1 infection Tat sustains the NF-κB activity and enhances the MIP-1α expression via interaction with IκB-α and p65.
T215 35881-36002 Sentence denotes In HIV-1 infection Tat sustains the NF-κB activity and enhances the MIP-1α expression via interaction with IκB-α and p65.
T28290 36003-36655 Sentence denotes U937 cells (5 × 107) were transfected with siRNA Tat, siRNA control (2 nmol), or left untransfected; 24 h later cells were infected with HXB2-pseudotyped NL4-3.FLAG-Tat.R−E− virions (500 ng of p24) and harvested at the indicated time. (A) Real-time PCR of total RNA measured the Tat expression; ELISA measured the amount of p24 in whole cell extracts. (B) The binding of p65 to the NF-κB double-stranded oligonucleotide was measured in nuclear extracts (10 µg) using the NF-κB Transcription Factor ELISA assay kit (Cayman). (C) The IκB-α content was analysed by 12% SDS–PAGE and western blotting of cytosolic extracts (20 µg) using anti-IκB-α antibody.
T216 36003-36655 Sentence denotes U937 cells (5 × 107) were transfected with siRNA Tat, siRNA control (2 nmol), or left untransfected; 24 h later cells were infected with HXB2-pseudotyped NL4-3.FLAG-Tat.R−E− virions (500 ng of p24) and harvested at the indicated time. (A) Real-time PCR of total RNA measured the Tat expression; ELISA measured the amount of p24 in whole cell extracts. (B) The binding of p65 to the NF-κB double-stranded oligonucleotide was measured in nuclear extracts (10 µg) using the NF-κB Transcription Factor ELISA assay kit (Cayman). (C) The IκB-α content was analysed by 12% SDS–PAGE and western blotting of cytosolic extracts (20 µg) using anti-IκB-α antibody.
T28291 36656-36985 Sentence denotes Densitometry values (D) of the bands were expressed as fold increase above the control (mock). (D) IKK activity was measured in cytosolic cell extracts (100 µg) using HTScan IKK Kinase Assay (Cell Signaling Technology). (E) U937 cells (5 × 107) were infected with HXB2-pseudotyped NL4-3.FLAG-Tat.R−E− virions, or left uninfected.
T217 36656-36985 Sentence denotes Densitometry values (D) of the bands were expressed as fold increase above the control (mock). (D) IKK activity was measured in cytosolic cell extracts (100 µg) using HTScan IKK Kinase Assay (Cell Signaling Technology). (E) U937 cells (5 × 107) were infected with HXB2-pseudotyped NL4-3.FLAG-Tat.R−E− virions, or left uninfected.
T28292 36986-37116 Sentence denotes Twenty-four-hour post-infection, cell extracts (1 mg) were immunoprecipitated with protein G-Sepharose-coupled anti-FLAG antibody.
T218 36986-37116 Sentence denotes Twenty-four-hour post-infection, cell extracts (1 mg) were immunoprecipitated with protein G-Sepharose-coupled anti-FLAG antibody.
T28293 37117-37467 Sentence denotes Immunocomplexes were separated by 12% SDS–PAGE and analysed by western blotting with anti-p65, anti-FLAG and anti-IκB-α antibodies. (F) U937 cells (5 × 107) were transfected with siRNA Tat, siRNA p65, siRNA control (2 nmol), or left untransfected; 24 h later, cells were infected with HXB2-pseudotyped NL4-3.FLAG-Tat.R−E− virions, or left uninfected.
T219 37117-37467 Sentence denotes Immunocomplexes were separated by 12% SDS–PAGE and analysed by western blotting with anti-p65, anti-FLAG and anti-IκB-α antibodies. (F) U937 cells (5 × 107) were transfected with siRNA Tat, siRNA p65, siRNA control (2 nmol), or left untransfected; 24 h later, cells were infected with HXB2-pseudotyped NL4-3.FLAG-Tat.R−E− virions, or left uninfected.
T28294 37468-37779 Sentence denotes Twenty-four-hour post-infection, total RNA was analysed for MIP-1α expression by real-time PCR. (G and H) U937 cells (5 × 107) were transfected with siRNA Tat or siRNA control (2 nmol), or left untransfected; 24 h later, cells were infected with HXB2-pseudotyped NL4-3.FLAG-Tat.R−E− virions, or left uninfected.
T220 37468-37779 Sentence denotes Twenty-four-hour post-infection, total RNA was analysed for MIP-1α expression by real-time PCR. (G and H) U937 cells (5 × 107) were transfected with siRNA Tat or siRNA control (2 nmol), or left untransfected; 24 h later, cells were infected with HXB2-pseudotyped NL4-3.FLAG-Tat.R−E− virions, or left uninfected.
T28295 37780-37867 Sentence denotes Twenty-four-hour post-infection, ChIP was performed with anti-p65 (G) or anti-FLAG (H).
T221 37780-37867 Sentence denotes Twenty-four-hour post-infection, ChIP was performed with anti-p65 (G) or anti-FLAG (H).
T28296 37868-37949 Sentence denotes Real-time PCR was performed with primers specific for MIP-1α and GAPDH promoters.
T222 37868-37949 Sentence denotes Real-time PCR was performed with primers specific for MIP-1α and GAPDH promoters.
T28297 37950-37986 Sentence denotes Values (mean ± SE, n = 3) are shown.
T223 37950-37986 Sentence denotes Values (mean ± SE, n = 3) are shown.
T28298 37987-38125 Sentence denotes The asterisks indicate statistically significant differences compared to the control (mock), according to the Student's t-test (P < 0.05).
T224 37987-38125 Sentence denotes The asterisks indicate statistically significant differences compared to the control (mock), according to the Student's t-test (P < 0.05).
T17788 38126-38359 Sentence denotes The NF-κB activity, as measured by p65 DNA binding, was induced at 3-h post-infection in both Tat-positive (no siRNA and siRNA control) and Tat-negative cells (siRNA Tat), and increased at 12 h only in Tat-positive cells (Figure 6B).
T225 38126-38359 Sentence denotes The NF-κB activity, as measured by p65 DNA binding, was induced at 3-h post-infection in both Tat-positive (no siRNA and siRNA control) and Tat-negative cells (siRNA Tat), and increased at 12 h only in Tat-positive cells (Figure 6B).
T17789 38360-38518 Sentence denotes Degradation of IκB-α was observed at 3-h post-infection, and was followed by de novo synthesis of IκB-α at 12 h independently of the Tat presence (Figure 6C).
T226 38360-38518 Sentence denotes Degradation of IκB-α was observed at 3-h post-infection, and was followed by de novo synthesis of IκB-α at 12 h independently of the Tat presence (Figure 6C).
T17790 38519-38653 Sentence denotes Consistently, the IKK activity was induced at 3-h post-infection and turned off at 12 h independently of the Tat presence (Figure 6D).
T227 38519-38653 Sentence denotes Consistently, the IKK activity was induced at 3-h post-infection and turned off at 12 h independently of the Tat presence (Figure 6D).
T17791 38654-38882 Sentence denotes These results agreed with the kinetic of NF-κB activation in single-round HIV-1 infection of Jurkat cells (Figure 1), and further supported the requirement of viral expression to counteract the post-activation turn off of NF-κB.
T228 38654-38882 Sentence denotes These results agreed with the kinetic of NF-κB activation in single-round HIV-1 infection of Jurkat cells (Figure 1), and further supported the requirement of viral expression to counteract the post-activation turn off of NF-κB.
T17792 38883-39136 Sentence denotes In HIV-1-infected U937 cells, the endogenous Tat was coimmunoprecipitated with IκB-α and p65 (Figure 6E), and activated the MIP-1α expression in a p65-dependent manner, as shown by the lack of effect following RNA interference of Tat or p65 (Figure 6F).
T229 38883-39136 Sentence denotes In HIV-1-infected U937 cells, the endogenous Tat was coimmunoprecipitated with IκB-α and p65 (Figure 6E), and activated the MIP-1α expression in a p65-dependent manner, as shown by the lack of effect following RNA interference of Tat or p65 (Figure 6F).
T17793 39137-39281 Sentence denotes Moreover, Tat and p65 were both recruited to the NF-κB enhancer of MIP-1α, while the p65 occupancy was abolished by siRNA Tat (Figure 6G and H).
T230 39137-39281 Sentence denotes Moreover, Tat and p65 were both recruited to the NF-κB enhancer of MIP-1α, while the p65 occupancy was abolished by siRNA Tat (Figure 6G and H).
T17794 39282-39525 Sentence denotes Altogether these results indicated that in single round HIV-1 infection Tat associated with IκB-α and p65, and induced the p65-dependent activation of MIP-1α expression through occupancy of the MIP-1α promoter and increased recruitment of p65.
T231 39282-39525 Sentence denotes Altogether these results indicated that in single round HIV-1 infection Tat associated with IκB-α and p65, and induced the p65-dependent activation of MIP-1α expression through occupancy of the MIP-1α promoter and increased recruitment of p65.
T232 39527-39537 Sentence denotes DISCUSSION
T19880 39538-39627 Sentence denotes This study reports a novel mechanism of NF-κB activation by the HIV-1 Tat transactivator.
T233 39538-39627 Sentence denotes This study reports a novel mechanism of NF-κB activation by the HIV-1 Tat transactivator.
T19881 39628-39901 Sentence denotes Based on the evidence that Tat enhanced the transcriptional activity of the p65 subunit of NF-κB (49,63,64), and physically interacted with the IκB-α repressor (50,51), we investigated the possibility that Tat could activate NF-κB via direct interaction with IκB-α and p65.
T234 39628-39901 Sentence denotes Based on the evidence that Tat enhanced the transcriptional activity of the p65 subunit of NF-κB (49,63,64), and physically interacted with the IκB-α repressor (50,51), we investigated the possibility that Tat could activate NF-κB via direct interaction with IκB-α and p65.
T19882 39902-40033 Sentence denotes To this end, the NF-κB activity was monitored in single round HIV-1 infection using RNA interference to silence the Tat expression.
T235 39902-40033 Sentence denotes To this end, the NF-κB activity was monitored in single round HIV-1 infection using RNA interference to silence the Tat expression.
T19883 40034-40186 Sentence denotes By this approach, we avoided the perpetuation of NF-κB activation signaling due to subsequent rounds of viral entry in cell culture propagation (30,31).
T236 40034-40186 Sentence denotes By this approach, we avoided the perpetuation of NF-κB activation signaling due to subsequent rounds of viral entry in cell culture propagation (30,31).
T237 40187-40323 Sentence denotes Upon HIV-1 infection, the early NF-κB activation occurred concomitantly with IKK activation and IκB-α degradation in the absence of Tat.
T19884 40187-40512 Sentence denotes Upon HIV-1 infection, the early NF-κB activation occurred concomitantly with IKK activation and IκB-α degradation in the absence of Tat. Soon after the shut off of IKK activity and new synthesis of IκB-α, the NF-κB activity was kept elevated in the presence of Tat, while it was down regulated upon silencing of the Tat gene.
T238 40324-40512 Sentence denotes Soon after the shut off of IKK activity and new synthesis of IκB-α, the NF-κB activity was kept elevated in the presence of Tat, while it was down regulated upon silencing of the Tat gene.
T19885 40513-40669 Sentence denotes These findings indicate that in single round HIV-1 infection, Tat enhanced the NF-κB activity without affecting the IKK activity and the half-life of IκB-α.
T239 40513-40669 Sentence denotes These findings indicate that in single round HIV-1 infection, Tat enhanced the NF-κB activity without affecting the IKK activity and the half-life of IκB-α.
T19886 40670-40867 Sentence denotes Similar kinetic of NF-κB activation occurred upon short-pulse of PMA in Tat-transfected HeLa cells, where Tat inhibited the post-activation turn off of NF-κB in presence of newly synthesized IκB-α.
T240 40670-40867 Sentence denotes Similar kinetic of NF-κB activation occurred upon short-pulse of PMA in Tat-transfected HeLa cells, where Tat inhibited the post-activation turn off of NF-κB in presence of newly synthesized IκB-α.
T19887 40868-41033 Sentence denotes The Tat-dependent activation of NF-κB correlated with the association of the viral protein with IκB-α, which interfered with the generation of the IκB-α/p65 complex.
T241 40868-41033 Sentence denotes The Tat-dependent activation of NF-κB correlated with the association of the viral protein with IκB-α, which interfered with the generation of the IκB-α/p65 complex.
T19888 41034-41153 Sentence denotes This evidence demonstrated that Tat competed for the binding of IκB-α to p65 and prevented the IκB-α repression of p65.
T242 41034-41153 Sentence denotes This evidence demonstrated that Tat competed for the binding of IκB-α to p65 and prevented the IκB-α repression of p65.
T19889 41154-41490 Sentence denotes As additional mechanism of NF-κB activation, Tat associated with p65 and increased the p65 binding affinity to the NF-κB enhancer; this evidence was obtained with recombinant proteins indicating that the stronger binding of p65 to DNA was a consequence of direct association with Tat, which likely caused a conformational change of p65.
T243 41154-41490 Sentence denotes As additional mechanism of NF-κB activation, Tat associated with p65 and increased the p65 binding affinity to the NF-κB enhancer; this evidence was obtained with recombinant proteins indicating that the stronger binding of p65 to DNA was a consequence of direct association with Tat, which likely caused a conformational change of p65.
T19890 41491-41627 Sentence denotes We also demonstrated that the Tat cysteine-rich sequence (C22,25,27) was involved in the binding to the RHD of p65 and NF-κB activation.
T244 41491-41627 Sentence denotes We also demonstrated that the Tat cysteine-rich sequence (C22,25,27) was involved in the binding to the RHD of p65 and NF-κB activation.
T19891 41628-41809 Sentence denotes Differently, the Tat arginine-rich sequence (R49,52,53,55,56,57) was required for the binding to the sixth ankyrin of IκB-α (50,51), and for releasing p65 from the IκB-α inhibition.
T245 41628-41809 Sentence denotes Differently, the Tat arginine-rich sequence (R49,52,53,55,56,57) was required for the binding to the sixth ankyrin of IκB-α (50,51), and for releasing p65 from the IκB-α inhibition.
T19892 41810-42018 Sentence denotes Altogether these results demonstrated that Tat abolished the negative feedback regulation of NF-κB by hijacking the IκB-α repressor, shielding p65 from the IκB-α embrace, and enforcing the p65 binding to DNA.
T246 41810-42018 Sentence denotes Altogether these results demonstrated that Tat abolished the negative feedback regulation of NF-κB by hijacking the IκB-α repressor, shielding p65 from the IκB-α embrace, and enforcing the p65 binding to DNA.
T19893 42019-42282 Sentence denotes Further evidence of Tat activation of NF-κB showed that wild-type Tat, and not the Tat mutants lacking the arginine- or cysteine-rich domains, up-regulated in vivo the expression of a number of NF-κB-responsive genes, including MIP-1α, CSF3, LTA, NFKBIA and TLR2.
T247 42019-42282 Sentence denotes Further evidence of Tat activation of NF-κB showed that wild-type Tat, and not the Tat mutants lacking the arginine- or cysteine-rich domains, up-regulated in vivo the expression of a number of NF-κB-responsive genes, including MIP-1α, CSF3, LTA, NFKBIA and TLR2.
T19894 42283-42438 Sentence denotes By ChIP analysis, we observed that Tat increased the recruitment of p65 to the NF-κB enhancers of the activated genes, and was recovered at the same sites.
T248 42283-42438 Sentence denotes By ChIP analysis, we observed that Tat increased the recruitment of p65 to the NF-κB enhancers of the activated genes, and was recovered at the same sites.
T19895 42439-42585 Sentence denotes RNA interference of p65 abolished the Tat occupancy of the NF-κB enhancers indicating that the Tat binding to the NF-κB sites was mediated by p65.
T249 42439-42585 Sentence denotes RNA interference of p65 abolished the Tat occupancy of the NF-κB enhancers indicating that the Tat binding to the NF-κB sites was mediated by p65.
T19896 42586-42785 Sentence denotes These results were consistent with the evidence that Tat displaced p65 from the binding to IκB-α (Figures 2D and 3C), and increased the p65 DNA binding affinity through association (Figure 4E and F).
T250 42586-42785 Sentence denotes These results were consistent with the evidence that Tat displaced p65 from the binding to IκB-α (Figures 2D and 3C), and increased the p65 DNA binding affinity through association (Figure 4E and F).
T19897 42786-42962 Sentence denotes Thus, Tat likely increased the recruitment of p65 to the NF-κB-dependent promoters by associating with p65 and by interfering with the assembly of p65 with the repressor IκB-α.
T251 42786-42962 Sentence denotes Thus, Tat likely increased the recruitment of p65 to the NF-κB-dependent promoters by associating with p65 and by interfering with the assembly of p65 with the repressor IκB-α.
T252 42963-43087 Sentence denotes Of interest, IκB-α was found associated to the NF-κB enhancers in absence of Tat, where it was displaced in presence of Tat.
T19898 42963-43205 Sentence denotes Of interest, IκB-α was found associated to the NF-κB enhancers in absence of Tat, where it was displaced in presence of Tat. These results suggest a negative regulatory role of IκB-α in gene regulation through occupancy of specific promoters.
T253 43088-43205 Sentence denotes These results suggest a negative regulatory role of IκB-α in gene regulation through occupancy of specific promoters.
T19899 43206-43412 Sentence denotes Indeed, IκB-α was found associated with hystone deacetylases at the hes1 promoter, from where it was removed following TNF-α stimulation causing histone acetylation and hes1 transcriptional activation (65).
T254 43206-43412 Sentence denotes Indeed, IκB-α was found associated with hystone deacetylases at the hes1 promoter, from where it was removed following TNF-α stimulation causing histone acetylation and hes1 transcriptional activation (65).
T19900 43413-43621 Sentence denotes A similar mechanism of gene regulation could apply to the NF-κB-dependent genes analysed in this study, where Tat could activate the gene expression by removing IκB-α and promoting the p65 loading (Figure 7).
T255 43413-43621 Sentence denotes A similar mechanism of gene regulation could apply to the NF-κB-dependent genes analysed in this study, where Tat could activate the gene expression by removing IκB-α and promoting the p65 loading (Figure 7).
T256 43622-43631 Sentence denotes Figure 7.
T29103 43632-44044 Sentence denotes Model of MIP-1α transcriptional activation by HIV-1 Tat. (A) In absence of Tat, IκB-α occupies the NF-κB enhancer of the MIP-1α promoter and likely interacts with transcriptional repressors, such as HDACs (65), to inhibit gene transcription. (B) Tat activates the MIP-1α expression by removing the IκB-α repressor from the NF-κB enhancer, and by increasing the binding of p65 NF-κB complex to the NF-κB enhancer.
T257 43632-44044 Sentence denotes Model of MIP-1α transcriptional activation by HIV-1 Tat. (A) In absence of Tat, IκB-α occupies the NF-κB enhancer of the MIP-1α promoter and likely interacts with transcriptional repressors, such as HDACs (65), to inhibit gene transcription. (B) Tat activates the MIP-1α expression by removing the IκB-α repressor from the NF-κB enhancer, and by increasing the binding of p65 NF-κB complex to the NF-κB enhancer.
T19901 44045-44541 Sentence denotes The physiological relevance of Tat cross talk with NF-κB was demonstrated in the HIV-1 infection of human monocytes, where HIV-1-encoded Tat protein counteracted post-activation turn off of NF-κB, as shown by: (i) sustained NF-κB activity by Tat in presence of newly synthesized IκB-α; (ii) coimmunoprecipitation of Tat with IκB-α and p65; (iii) induction of MIP-1α expression dependent on Tat and p65; (iv) Tat occupancy of the MIP-1α NF-κB enhancer associated with increased recruitment of p65.
T258 44045-44541 Sentence denotes The physiological relevance of Tat cross talk with NF-κB was demonstrated in the HIV-1 infection of human monocytes, where HIV-1-encoded Tat protein counteracted post-activation turn off of NF-κB, as shown by: (i) sustained NF-κB activity by Tat in presence of newly synthesized IκB-α; (ii) coimmunoprecipitation of Tat with IκB-α and p65; (iii) induction of MIP-1α expression dependent on Tat and p65; (iv) Tat occupancy of the MIP-1α NF-κB enhancer associated with increased recruitment of p65.
T19902 44542-44645 Sentence denotes This study supports the pro-inflammatory action of Tat through physical interaction with p65 and IκB-α.
T259 44542-44645 Sentence denotes This study supports the pro-inflammatory action of Tat through physical interaction with p65 and IκB-α.
T19903 44646-44832 Sentence denotes Several inflammatory cytokines under the transcriptional control of NF-κB are hyper-expressed in HIV-1 infected individuals, including IL-6 (66,67), TNF-α (68), and MIP-1α (57–62,69–71).
T260 44646-44832 Sentence denotes Several inflammatory cytokines under the transcriptional control of NF-κB are hyper-expressed in HIV-1 infected individuals, including IL-6 (66,67), TNF-α (68), and MIP-1α (57–62,69–71).
T19904 44833-45025 Sentence denotes In the case of TNF-α and IL-6, Tat activated the cytokine expression by binding to the TAR-like stem loop of the 5′ transcript, thus likely promoting the transcriptional elongation (33,37,47).
T261 44833-45025 Sentence denotes In the case of TNF-α and IL-6, Tat activated the cytokine expression by binding to the TAR-like stem loop of the 5′ transcript, thus likely promoting the transcriptional elongation (33,37,47).
T19905 45026-45245 Sentence denotes Here, we have shown that the Tat-dependent transcriptional activation of a number of pro-inflammatory genes required the assembly of Tat with p65 at the NF-κB enhancer together with the displacement of IκB-α (Figure 5).
T262 45026-45245 Sentence denotes Here, we have shown that the Tat-dependent transcriptional activation of a number of pro-inflammatory genes required the assembly of Tat with p65 at the NF-κB enhancer together with the displacement of IκB-α (Figure 5).
T19906 45246-45467 Sentence denotes Thus, in the set of distinct NF-κB-responsive genes, Tat acted as a component of the transcriptional initiation complex, which is consistent with previous reports on Tat promoting the transcription via DNA motifs (72,73).
T263 45246-45467 Sentence denotes Thus, in the set of distinct NF-κB-responsive genes, Tat acted as a component of the transcriptional initiation complex, which is consistent with previous reports on Tat promoting the transcription via DNA motifs (72,73).
T19907 45468-45612 Sentence denotes Overproduction of pro-inflammatory cytokines is considered a major mechanism of immune deregulation (26) and neuron dysfunction in AIDS (74,75).
T264 45468-45612 Sentence denotes Overproduction of pro-inflammatory cytokines is considered a major mechanism of immune deregulation (26) and neuron dysfunction in AIDS (74,75).
T19908 45613-45803 Sentence denotes In this scenario, inhibition of NF-κB activity could lead to a therapeutic strategy for counteracting the abnormal production of pro-inflammatory cytokines and chemokines in HIV-1 infection.
T265 45613-45803 Sentence denotes In this scenario, inhibition of NF-κB activity could lead to a therapeutic strategy for counteracting the abnormal production of pro-inflammatory cytokines and chemokines in HIV-1 infection.
T19909 45804-46069 Sentence denotes NF-κB inhibitors, such as anti-oxidants, proteasome and IKK inhibitors, significantly reduced the HIV-1 replication and the associated inflammatory response (76,77); however, these NF-κB inhibitors acted indiscriminately in both HIV-1-infected and uninfected cells.
T266 45804-46069 Sentence denotes NF-κB inhibitors, such as anti-oxidants, proteasome and IKK inhibitors, significantly reduced the HIV-1 replication and the associated inflammatory response (76,77); however, these NF-κB inhibitors acted indiscriminately in both HIV-1-infected and uninfected cells.
T19910 46070-46232 Sentence denotes The evidence that Tat activates NF-κB through direct interaction with IκB-α and p65 may lead to specific inhibitors to counteract the Tat pro-inflammatory action.
T267 46070-46232 Sentence denotes The evidence that Tat activates NF-κB through direct interaction with IκB-α and p65 may lead to specific inhibitors to counteract the Tat pro-inflammatory action.
T268 46234-46252 Sentence denotes SUPPLEMENTARY DATA
T269 46253-46300 Sentence denotes Supplementary Data are available at NAR Online:
T270 46301-46367 Sentence denotes Supplementary Figures 1–3 and Supplementary Materials and Methods.
T271 46369-46376 Sentence denotes FUNDING
T272 46377-46654 Sentence denotes Istituto Superiore di Sanità-National Research Program on AIDS (Grant number 40C.77 to I.Q.); Ministero dell'Istruzione, dell'Università e della Ricerca (Grant number FIRB RBLA033WJX_006 to I.Q.); EUROPRISE (Grant number LSHP-CT-2006-037611 to G.S.); FIRC fellowship (to A.R.).
T273 46655-46732 Sentence denotes Funding for open access charge: EUROPRISE (grant number LSHP-CT-2006-037611).
T274 46733-46764 Sentence denotes Conflict of interest statement.
T275 46765-46779 Sentence denotes None declared.
T276 46781-46803 Sentence denotes Supplementary Material
T277 46804-46822 Sentence denotes Supplementary Data