sentences Home  

PMC:2889865 / 26063-32795 JSONTXT 18 Projects

Annnotations TAB TSV DIC JSON TextAE

Id Subject Object Predicate Lexical cue
T190 0-21 Sentence denotes Materials and methods
T11971 23-32 Sentence denotes Chemicals
T191 23-32 Sentence denotes Chemicals
T11972 33-493 Sentence denotes The following chemicals were used in the present study: PMA (Phorbol 12-myristate 13-acetate, (Sigma #P1585, USA)); NF-κB activation inhibitor (NAI), (InSolution™ NF-κB Activation Inhibitor, Calbiochem #481407, USA); JNK inhibitor, (InSolution™ JNK Inhibitor II, Calbiochem #420128, USA); PKC Inhibitor, (InSolution™ Bisindolylmaleimide I, Calbiochem #203293, USA); Calcium Ionophore, (Calcium Ionophore A23187 mixed calcium magnesium salt, Sigma #C5149, USA).
T192 33-493 Sentence denotes The following chemicals were used in the present study: PMA (Phorbol 12-myristate 13-acetate, (Sigma #P1585, USA)); NF-κB activation inhibitor (NAI), (InSolution™ NF-κB Activation Inhibitor, Calbiochem #481407, USA); JNK inhibitor, (InSolution™ JNK Inhibitor II, Calbiochem #420128, USA); PKC Inhibitor, (InSolution™ Bisindolylmaleimide I, Calbiochem #203293, USA); Calcium Ionophore, (Calcium Ionophore A23187 mixed calcium magnesium salt, Sigma #C5149, USA).
T12189 495-528 Sentence denotes Heat killed (HK) Escherichia coli
T193 495-528 Sentence denotes Heat killed (HK) Escherichia coli
T12190 529-614 Sentence denotes E. coli MG1655 were grown on Luria-Bertani (LB) agar and incubated at 37°C overnight.
T194 529-614 Sentence denotes E. coli MG1655 were grown on Luria-Bertani (LB) agar and incubated at 37°C overnight.
T12191 615-715 Sentence denotes One colony was inoculated into 10 ml LB broth and incubated on a shaker (200 rpm) at 37°C overnight.
T195 615-715 Sentence denotes One colony was inoculated into 10 ml LB broth and incubated on a shaker (200 rpm) at 37°C overnight.
T12192 716-904 Sentence denotes The bacteria were centrifuged for 10 min at 3000 × g, washed with 3 ml phosphate buffered saline (PBS; 8 g NaCl, 1.16 g Na2HPO4, 0.2 g KH2PO4, 0.2 g KCl, pH7) and resuspended in 50 μl PBS.
T196 716-904 Sentence denotes The bacteria were centrifuged for 10 min at 3000 × g, washed with 3 ml phosphate buffered saline (PBS; 8 g NaCl, 1.16 g Na2HPO4, 0.2 g KH2PO4, 0.2 g KCl, pH7) and resuspended in 50 μl PBS.
T12193 905-957 Sentence denotes The bacteria were killed by heating to 70°C for 1 h.
T197 905-957 Sentence denotes The bacteria were killed by heating to 70°C for 1 h.
T12194 958-1092 Sentence denotes To ensure that the bacteria were killed; 10 μl of the heat-killed suspension was spread on a LB plate and incubated overnight at 37°C.
T198 958-1092 Sentence denotes To ensure that the bacteria were killed; 10 μl of the heat-killed suspension was spread on a LB plate and incubated overnight at 37°C.
T12470 1094-1138 Sentence denotes Cell culturing, transfection and stimulation
T199 1094-1138 Sentence denotes Cell culturing, transfection and stimulation
T12471 1139-1449 Sentence denotes Jurkat T-cells (wild type and TCR deficient- TCR-/-) were maintained in 90% RPMI 1640 medium (PAA laboratories, Austria) with 1.5 mM L-glutamine (Invitrogen, USA), 10% foetal bovine serum (Invitrogen, USA) and 1% antibiotic-antimycotic (Invitrogen, USA) and incubated in a stable environment of 5% CO2 at 37°C.
T200 1139-1449 Sentence denotes Jurkat T-cells (wild type and TCR deficient- TCR-/-) were maintained in 90% RPMI 1640 medium (PAA laboratories, Austria) with 1.5 mM L-glutamine (Invitrogen, USA), 10% foetal bovine serum (Invitrogen, USA) and 1% antibiotic-antimycotic (Invitrogen, USA) and incubated in a stable environment of 5% CO2 at 37°C.
T12472 1450-1595 Sentence denotes The cells were centrifuged at 1000 × g for 8 min and resuspended in fresh media to a final cell density of 1.6 × 107 cells/ml in a 24-well plate.
T201 1450-1595 Sentence denotes The cells were centrifuged at 1000 × g for 8 min and resuspended in fresh media to a final cell density of 1.6 × 107 cells/ml in a 24-well plate.
T12473 1596-1828 Sentence denotes Reporter plasmid (pNFκB-Luc, pAP1 (PMA)-TA-Luc, pNFκB-SEAP), internal control plasmid (pRL) (Promega, USA) and lipofectamine 2000 (Invitrogen, USA) were added to each well at 0.54 μg/well, 0.06 μg/well and 1.5 μl/well, respectively.
T202 1596-1828 Sentence denotes Reporter plasmid (pNFκB-Luc, pAP1 (PMA)-TA-Luc, pNFκB-SEAP), internal control plasmid (pRL) (Promega, USA) and lipofectamine 2000 (Invitrogen, USA) were added to each well at 0.54 μg/well, 0.06 μg/well and 1.5 μl/well, respectively.
T12474 1829-1917 Sentence denotes Initially, the reporter plasmid and pRL were mixed separately with OptiMEM (Gibco, USA).
T203 1829-1917 Sentence denotes Initially, the reporter plasmid and pRL were mixed separately with OptiMEM (Gibco, USA).
T12475 1918-2063 Sentence denotes After 5 min of incubation at room temperature, lipofectamine 2000 was added and the mixture was incubated further for 20 min at room temperature.
T204 1918-2063 Sentence denotes After 5 min of incubation at room temperature, lipofectamine 2000 was added and the mixture was incubated further for 20 min at room temperature.
T12476 2064-2215 Sentence denotes The transfection was allowed to proceed overnight at 37°C, after which, the cells were centrifuged, the media removed and fresh pre-warmed media added.
T205 2064-2215 Sentence denotes The transfection was allowed to proceed overnight at 37°C, after which, the cells were centrifuged, the media removed and fresh pre-warmed media added.
T12477 2216-2398 Sentence denotes The cells were pre-incubated with NF-κB, JNK and PKC inhibitors and stimulated in 24-well plates with different concentrations of PMA, HK E. coli MG1655 and Calcium Ionophore A23187.
T206 2216-2398 Sentence denotes The cells were pre-incubated with NF-κB, JNK and PKC inhibitors and stimulated in 24-well plates with different concentrations of PMA, HK E. coli MG1655 and Calcium Ionophore A23187.
T12478 2399-2641 Sentence denotes The cells were lysed and luciferase activity (NF-κB and AP-1) was measured using the Dual-Luciferase® reporter assay system (Promega, USA) according to the manufacturer's instructions on a TD 20/20 luminometer (Turner Designs, Sunnyvale, CA).
T207 2399-2641 Sentence denotes The cells were lysed and luciferase activity (NF-κB and AP-1) was measured using the Dual-Luciferase® reporter assay system (Promega, USA) according to the manufacturer's instructions on a TD 20/20 luminometer (Turner Designs, Sunnyvale, CA).
T12479 2642-2774 Sentence denotes Secreted alkaline phosphatase (NFκB-SEAP, figure 4a, b) levels were measured using Great EscAPe™ SEAP Detection Kit (Clontech, USA).
T208 2642-2774 Sentence denotes Secreted alkaline phosphatase (NFκB-SEAP, figure 4a, b) levels were measured using Great EscAPe™ SEAP Detection Kit (Clontech, USA).
T13208 2776-2800 Sentence denotes Multiplex cytokine assay
T209 2776-2800 Sentence denotes Multiplex cytokine assay
T13209 2801-3054 Sentence denotes Quantification of the levels of cytokines IL-2, IL-6, IL-10 and TNF and the chemokine CXCL8 was performed on culture supernatants using multiplexed biomarker immunoassay kits according to manufacturer's instructions (Bio-Rad Laboratories, Hercules, CA).
T210 2801-3054 Sentence denotes Quantification of the levels of cytokines IL-2, IL-6, IL-10 and TNF and the chemokine CXCL8 was performed on culture supernatants using multiplexed biomarker immunoassay kits according to manufacturer's instructions (Bio-Rad Laboratories, Hercules, CA).
T13210 3055-3194 Sentence denotes A Bio-Plex™ 200 readout System was used (Bio-Rad), which utilizes Luminex® xMAP™ fluorescent bead-based technology (Luminex Corp., Austin).
T211 3055-3194 Sentence denotes A Bio-Plex™ 200 readout System was used (Bio-Rad), which utilizes Luminex® xMAP™ fluorescent bead-based technology (Luminex Corp., Austin).
T13211 3195-3304 Sentence denotes Levels were automatically calculated from standard curves using Bio-Plex Manager software (v.4.1.1, Bio-Rad).
T212 3195-3304 Sentence denotes Levels were automatically calculated from standard curves using Bio-Plex Manager software (v.4.1.1, Bio-Rad).
T13450 3306-3347 Sentence denotes Enzyme-linked immunosorbent assay (ELISA)
T213 3306-3347 Sentence denotes Enzyme-linked immunosorbent assay (ELISA)
T13451 3348-3610 Sentence denotes ELISA was performed on supernatants from challenged Jurkat T-cells to quantify IL-6, CXCL8 and TNF (BD OptEIA Human IL-6 Elisa Set, BD OptEIA Human CXCL8 Elisa Set and BD OptEIA Human TNF Elisa Set, Biosciences, USA) according to the manufacturer's instructions.
T214 3348-3610 Sentence denotes ELISA was performed on supernatants from challenged Jurkat T-cells to quantify IL-6, CXCL8 and TNF (BD OptEIA Human IL-6 Elisa Set, BD OptEIA Human CXCL8 Elisa Set and BD OptEIA Human TNF Elisa Set, Biosciences, USA) according to the manufacturer's instructions.
T13452 3611-3774 Sentence denotes Briefly, Jurkat T-cells were stimulated with PMA (162 nM) for 1 h, centrifuged (1000 × g, 8 min) and the supernatants were collected and stored at -80°C until use.
T215 3611-3774 Sentence denotes Briefly, Jurkat T-cells were stimulated with PMA (162 nM) for 1 h, centrifuged (1000 × g, 8 min) and the supernatants were collected and stored at -80°C until use.
T13453 3775-3894 Sentence denotes Following centrifugation, the cells were resuspended in 1 h aged media, where cells have been grown in, containing PMA.
T216 3775-3894 Sentence denotes Following centrifugation, the cells were resuspended in 1 h aged media, where cells have been grown in, containing PMA.
T13454 3895-3963 Sentence denotes The same procedure was performed to collect media after 2 h and 6 h.
T217 3895-3963 Sentence denotes The same procedure was performed to collect media after 2 h and 6 h.
T13455 3964-4019 Sentence denotes The final collection of media was performed after 24 h.
T218 3964-4019 Sentence denotes The final collection of media was performed after 24 h.
T13793 4021-4042 Sentence denotes Western blot analysis
T219 4021-4042 Sentence denotes Western blot analysis
T13794 4043-4237 Sentence denotes Following stimulation, Jurkat T-cells were centrifuged at 1000 × g for 8 min and lysed on ice for 2 h using sodium hydroxide with the addition of a protease inhibitor cocktail (Roche, Mannheim).
T220 4043-4237 Sentence denotes Following stimulation, Jurkat T-cells were centrifuged at 1000 × g for 8 min and lysed on ice for 2 h using sodium hydroxide with the addition of a protease inhibitor cocktail (Roche, Mannheim).
T13795 4238-4352 Sentence denotes The cells were further centrifuged at 8000 × g, 4°C for 10 min and the supernatants were transferred to new tubes.
T221 4238-4352 Sentence denotes The cells were further centrifuged at 8000 × g, 4°C for 10 min and the supernatants were transferred to new tubes.
T13796 4353-4580 Sentence denotes Cytoplasmic proteins (~8 μg) were separated by SDS-PAGE (10%) followed by western blotting using anti-IκBβ, phospho-PKC (pan)(ζ Thr410)(190D10), anti-Bcl10 (Cell Signalling Technology, Boston) and beta-actin (Abcam, Cambridge).
T222 4353-4580 Sentence denotes Cytoplasmic proteins (~8 μg) were separated by SDS-PAGE (10%) followed by western blotting using anti-IκBβ, phospho-PKC (pan)(ζ Thr410)(190D10), anti-Bcl10 (Cell Signalling Technology, Boston) and beta-actin (Abcam, Cambridge).
T13797 4581-4821 Sentence denotes Detection was performed following incubation with ECL™ Anti-rabbit IgG, horseradish peroxidase linked whole antibodies (Amersham Biosciences, Buckinghamshire) and developed using ECL™ Western Blotting Detection Reagents (GE Healthcare, UK).
T223 4581-4821 Sentence denotes Detection was performed following incubation with ECL™ Anti-rabbit IgG, horseradish peroxidase linked whole antibodies (Amersham Biosciences, Buckinghamshire) and developed using ECL™ Western Blotting Detection Reagents (GE Healthcare, UK).
T14125 4823-4837 Sentence denotes RNA extraction
T224 4823-4837 Sentence denotes RNA extraction
T14126 4838-4975 Sentence denotes Jurkat T-cells were treated with NF-κB, JNK and PKC inhibitors for 2 h in 6-well plates followed by stimulation with 162 nM PMA for 24 h.
T225 4838-4975 Sentence denotes Jurkat T-cells were treated with NF-κB, JNK and PKC inhibitors for 2 h in 6-well plates followed by stimulation with 162 nM PMA for 24 h.
T14127 4976-5077 Sentence denotes At sampling the cells were pelleted followed by RNA extraction using 100 μl TRI-reagent (Sigma, USA).
T226 4976-5077 Sentence denotes At sampling the cells were pelleted followed by RNA extraction using 100 μl TRI-reagent (Sigma, USA).
T14128 5078-5151 Sentence denotes This was followed by addition of 100 μl chloroform/isoamylalcohol (24/1).
T227 5078-5151 Sentence denotes This was followed by addition of 100 μl chloroform/isoamylalcohol (24/1).
T228 5152-5249 Sentence denotes The solutions were mixed by vortexing followed by centrifugation at 12,000 rpm for 15 min at 4°C.
T14129 5152-5385 Sentence denotes The solutions were mixed by vortexing followed by centrifugation at 12,000 rpm for 15 min at 4°C. The upper phase was transferred to a new tube followed by addition of 100 μl iso-propanol and incubated at room temperature for 10 min.
T229 5250-5385 Sentence denotes The upper phase was transferred to a new tube followed by addition of 100 μl iso-propanol and incubated at room temperature for 10 min.
T14130 5386-5486 Sentence denotes RNA was then pelleted by centrifugation at 12,000 rpm for 15 min at 4°C and washed with 70% ethanol.
T230 5386-5486 Sentence denotes RNA was then pelleted by centrifugation at 12,000 rpm for 15 min at 4°C and washed with 70% ethanol.
T14131 5487-5627 Sentence denotes The RNA pellet was dissolved in 25 μl RNase free water and the yield and ratio (A260/A280) was determined using NanoVue (GE Healthcare, UK).
T231 5487-5627 Sentence denotes The RNA pellet was dissolved in 25 μl RNase free water and the yield and ratio (A260/A280) was determined using NanoVue (GE Healthcare, UK).
T14132 5628-5679 Sentence denotes The samples were stored at -80°C until further use.
T232 5628-5679 Sentence denotes The samples were stored at -80°C until further use.
T14524 5681-5729 Sentence denotes Reverse transcription quantitative PCR (RT-qPCR)
T233 5681-5729 Sentence denotes Reverse transcription quantitative PCR (RT-qPCR)
T14525 5730-5863 Sentence denotes RT-qPCR was used to determine gene expression levels of il-6 and cxcl8 in response to PMA following inhibition of NF-κB, JNK and PKC.
T234 5730-5863 Sentence denotes RT-qPCR was used to determine gene expression levels of il-6 and cxcl8 in response to PMA following inhibition of NF-κB, JNK and PKC.
T14526 5864-6058 Sentence denotes The following primer sequences were used, il-6: forward- TGTGAAAGCAGCAAAGAGGCACTG, reverse- ACAGCTCTGGCTTGTTCCTCACTA; cxcl8: forward- ACCACACTGCGCCAACACAGAAAT, reverse- AAACTTCTCCACAACCCTCTGCAC.
T235 5864-6058 Sentence denotes The following primer sequences were used, il-6: forward- TGTGAAAGCAGCAAAGAGGCACTG, reverse- ACAGCTCTGGCTTGTTCCTCACTA; cxcl8: forward- ACCACACTGCGCCAACACAGAAAT, reverse- AAACTTCTCCACAACCCTCTGCAC.
T14527 6059-6220 Sentence denotes Thermocycling conditions for CYBR Green (Quanta, USA) consisted of a denaturation step for 10 min at 95 °C followed by 60 cycles of 95°C for 1s and 60°C for 30s.
T236 6059-6220 Sentence denotes Thermocycling conditions for CYBR Green (Quanta, USA) consisted of a denaturation step for 10 min at 95 °C followed by 60 cycles of 95°C for 1s and 60°C for 30s.
T14528 6221-6295 Sentence denotes Gene expression was analysed using Stratagene (Mx3000p™) (AH diagnostics).
T237 6221-6295 Sentence denotes Gene expression was analysed using Stratagene (Mx3000p™) (AH diagnostics).
T14529 6296-6347 Sentence denotes The obtained Ct values were normalized against 18S.
T238 6296-6347 Sentence denotes The obtained Ct values were normalized against 18S.
T14530 6348-6483 Sentence denotes Initially, all measured 18S Ct values were used to calculate a mean Ct value that was used to determine the ΔCt values for each sample.
T239 6348-6483 Sentence denotes Initially, all measured 18S Ct values were used to calculate a mean Ct value that was used to determine the ΔCt values for each sample.
T14531 6484-6584 Sentence denotes Gene expression patterns for il-6 and cxcl8 were then normalized with regard to the samples 18S ΔCt.
T240 6484-6584 Sentence denotes Gene expression patterns for il-6 and cxcl8 were then normalized with regard to the samples 18S ΔCt.
T14962 6586-6606 Sentence denotes Statistical analysis
T241 6586-6606 Sentence denotes Statistical analysis
T14963 6607-6731 Sentence denotes Statistical significant differences were determined using two-tailed Student's t-test (*p < 0.05; **p < 0.01; ***p < 0.001).
T242 6607-6731 Sentence denotes Statistical significant differences were determined using two-tailed Student's t-test (*p < 0.05; **p < 0.01; ***p < 0.001).