> top > projects > sentences > docs > PMC:1359074 > annotations
sentences Home  

PMC:1359074 JSONTXT 30 Projects

Annnotations TAB TSV DIC JSON TextAE

Id Subject Object Predicate Lexical cue
T92 0-77 Sentence denotes Sox6 Directly Silences Epsilon Globin Expression in Definitive Erythropoiesis
T1 0-77 Sentence denotes Sox6 Directly Silences Epsilon Globin Expression in Definitive Erythropoiesis
T2 78-116 Sentence denotes Sox6 Silence Epsilon Globin Expression
T3 118-126 Sentence denotes Abstract
T4 127-314 Sentence denotes Sox6 is a member of the Sox transcription factor family that is defined by the conserved high mobility group (HMG) DNA binding domain, first described in the testis determining gene, Sry.
T93 127-442 Sentence denotes Sox6 is a member of the Sox transcription factor family that is defined by the conserved high mobility group (HMG) DNA binding domain, first described in the testis determining gene, Sry. Previous studies have suggested that Sox6 plays a role in the development of the central nervous system, cartilage, and muscle.
T5 315-442 Sentence denotes Previous studies have suggested that Sox6 plays a role in the development of the central nervous system, cartilage, and muscle.
T94 443-598 Sentence denotes In the Sox6-deficient mouse, p100H, ɛy globin is persistently expressed, and increased numbers of nucleated red cells are present in the fetal circulation.
T6 443-598 Sentence denotes In the Sox6-deficient mouse, p100H, ɛy globin is persistently expressed, and increased numbers of nucleated red cells are present in the fetal circulation.
T95 599-755 Sentence denotes Transfection assays in GM979 (erythroleukemic) cells define a 36–base pair region of the ɛy proximal promoter that is critical for Sox6 mediated repression.
T7 599-755 Sentence denotes Transfection assays in GM979 (erythroleukemic) cells define a 36–base pair region of the ɛy proximal promoter that is critical for Sox6 mediated repression.
T96 756-929 Sentence denotes Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) assays demonstrate that Sox6 acts as a repressor by directly binding to the ɛy promoter.
T8 756-929 Sentence denotes Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) assays demonstrate that Sox6 acts as a repressor by directly binding to the ɛy promoter.
T97 930-1111 Sentence denotes The normal expression of Sox6 in wild-type fetal liver and the ectopic expression of ɛy in p100H homozygous fetal liver demonstrate that Sox6 functions in definitive erythropoiesis.
T9 930-1111 Sentence denotes The normal expression of Sox6 in wild-type fetal liver and the ectopic expression of ɛy in p100H homozygous fetal liver demonstrate that Sox6 functions in definitive erythropoiesis.
T98 1112-1272 Sentence denotes The present study shows that Sox6 is required for silencing of ɛy globin in definitive erythropoiesis and suggests a role for Sox6 in erythroid cell maturation.
T10 1112-1272 Sentence denotes The present study shows that Sox6 is required for silencing of ɛy globin in definitive erythropoiesis and suggests a role for Sox6 in erythroid cell maturation.
T99 1273-1433 Sentence denotes Thus, Sox6 regulation of ɛy globin might provide a novel therapeutical target in the treatment of hemoglobinopathies such as sickle cell anemia and thalassemia.
T11 1273-1433 Sentence denotes Thus, Sox6 regulation of ɛy globin might provide a novel therapeutical target in the treatment of hemoglobinopathies such as sickle cell anemia and thalassemia.
T12 1435-1443 Sentence denotes Synopsis
T13 1444-1613 Sentence denotes Beta-globin gene switching—the transition from embryonic to fetal to adult synthesis of specific globin chains—results in hemoglobins with different affinity for oxygen.
T14 1614-1918 Sentence denotes This system is a longstanding paradigm for developmental biology and is directly relevant to human disease, since small amounts of normal embryonic or fetal beta-globins can “balance” the detrimental effect of abnormal or missing adult globins in diseases such as sickle cell anemia and beta-thalassemia.
T15 1919-2097 Sentence denotes In the current study, the transcription factor Sox6 was identified as a novel and crucial silencing factor of epsilon (embryonic) globin through a somewhat serendipitous pathway.
T16 2098-2285 Sentence denotes The authors had previously identified a chromosomal inversion, p100H, by virtue of its effect on the pink-eyed dilution gene and found that the same inversion also disrupts the Sox6 gene.
T17 2286-2619 Sentence denotes Using p100H mutant mice as a tool for identifying downstream targets of Sox6, the authors discovered that epsilon-globin levels were dramatically elevated, paving the way for a series of molecular genetic experiments demonstrating that Sox6 directly binds to and normally inhibits transcription from the epsilon-globin gene promoter.
T18 2620-2840 Sentence denotes This work provides fundamental new insights into regulation of globin gene transcription during development, and provides new clues for manipulating globin gene transcription as an approach to treat human blood diseases.
T19 2842-2854 Sentence denotes Introduction
T1200 2855-3068 Sentence denotes Sry type HMG box (Sox6) is a member of the Sox transcription factor family characterized by the conserved high mobility group (HMG) domain, consisting of 79 amino acids involved in DNA recognition and binding [1].
T20 2855-3068 Sentence denotes Sry type HMG box (Sox6) is a member of the Sox transcription factor family characterized by the conserved high mobility group (HMG) domain, consisting of 79 amino acids involved in DNA recognition and binding [1].
T1201 3069-3287 Sentence denotes Sox transcription factors bind to the minor groove of DNA and cause a 70°–85° bend of the DNA that leads to local conformational changes [2,3], while most other transcription factors target the major groove of DNA [4].
T21 3069-3287 Sentence denotes Sox transcription factors bind to the minor groove of DNA and cause a 70°–85° bend of the DNA that leads to local conformational changes [2,3], while most other transcription factors target the major groove of DNA [4].
T1202 3288-3534 Sentence denotes Therefore, Sox proteins may perform part of their function as architectural proteins by organizing local chromatin structure and assembling other DNA-bound transcription factors into biologically active, sterically defined multiprotein complexes.
T22 3288-3534 Sentence denotes Therefore, Sox proteins may perform part of their function as architectural proteins by organizing local chromatin structure and assembling other DNA-bound transcription factors into biologically active, sterically defined multiprotein complexes.
T1203 3535-3682 Sentence denotes Sox6 has been reported to be able to act as either an activator or a repressor, depending on its interactors and its target promoter context [5,6].
T23 3535-3682 Sentence denotes Sox6 has been reported to be able to act as either an activator or a repressor, depending on its interactors and its target promoter context [5,6].
T1204 3683-3801 Sentence denotes Intriguingly, Sox6 has also been shown to act as a general splicing factor that participates in pre-mRNA splicing [7].
T24 3683-3801 Sentence denotes Intriguingly, Sox6 has also been shown to act as a general splicing factor that participates in pre-mRNA splicing [7].
T1205 3802-4032 Sentence denotes Depletion of Sox6 in HeLa cell extracts blocked splicing of multiple substrates, and expression of the HMG domain of either Sox6, Sox9, or Sry in the extracts restored splicing, indicating functional overlap of these proteins [7].
T25 3802-4032 Sentence denotes Depletion of Sox6 in HeLa cell extracts blocked splicing of multiple substrates, and expression of the HMG domain of either Sox6, Sox9, or Sry in the extracts restored splicing, indicating functional overlap of these proteins [7].
T1206 4033-4293 Sentence denotes Regardless of how Sox6 functions in regulating gene expression, previous studies have demonstrated that Sox6 is an important regulatory molecule that plays a role in the development of the central nervous system [8–11], cartilage [6,12,13], and muscle [14,15].
T26 4033-4293 Sentence denotes Regardless of how Sox6 functions in regulating gene expression, previous studies have demonstrated that Sox6 is an important regulatory molecule that plays a role in the development of the central nervous system [8–11], cartilage [6,12,13], and muscle [14,15].
T1207 4294-4381 Sentence denotes A Sox6-null mutant mouse (p100H) has previously been identified in our laboratory [14].
T27 4294-4381 Sentence denotes A Sox6-null mutant mouse (p100H) has previously been identified in our laboratory [14].
T1208 4382-4519 Sentence denotes Mice homozygous for p100H show delayed growth, develop myopathy and arterioventricular heart block, and die within 2 wk after birth [14].
T28 4382-4519 Sentence denotes Mice homozygous for p100H show delayed growth, develop myopathy and arterioventricular heart block, and die within 2 wk after birth [14].
T1209 4520-4718 Sentence denotes The p100H mutant allele is associated with a Chromosome 7 inversion that disrupts both the p gene and the Sox6 gene (and no other gene within 50,000 nucleotides of the chromosomal breakpoints) [14].
T29 4520-4718 Sentence denotes The p100H mutant allele is associated with a Chromosome 7 inversion that disrupts both the p gene and the Sox6 gene (and no other gene within 50,000 nucleotides of the chromosomal breakpoints) [14].
T1210 4719-4845 Sentence denotes Because the p gene functions solely in pigmentation [16], the Sox6 transcription factor is implicated in all other phenotypes.
T30 4719-4845 Sentence denotes Because the p gene functions solely in pigmentation [16], the Sox6 transcription factor is implicated in all other phenotypes.
T1211 4846-5114 Sentence denotes Among the HMG box proteins distantly related to Sry (the first member identified of the Sox transcription factor family) that similarly bind to the minor groove and bend DNA, but without sequence specificity, are the ubiquitously expressed HMG1 and HMG2 proteins [17].
T31 4846-5114 Sentence denotes Among the HMG box proteins distantly related to Sry (the first member identified of the Sox transcription factor family) that similarly bind to the minor groove and bend DNA, but without sequence specificity, are the ubiquitously expressed HMG1 and HMG2 proteins [17].
T1212 5115-5325 Sentence denotes Modulation of DNA structure by these and other HMG proteins can mediate long-range enhancer function on both DNA and chromatin-assembled genes by bringing together distant regions of DNA and associated factors.
T32 5115-5325 Sentence denotes Modulation of DNA structure by these and other HMG proteins can mediate long-range enhancer function on both DNA and chromatin-assembled genes by bringing together distant regions of DNA and associated factors.
T1213 5326-5404 Sentence denotes Specifically, HMG proteins have been shown to modulate β-globin genes [18–21].
T33 5326-5404 Sentence denotes Specifically, HMG proteins have been shown to modulate β-globin genes [18–21].
T1214 5405-5597 Sentence denotes The mouse β-globin genes {ɛy, βh1, β-major, and β-minor} are clustered on Chromosome 7 and they are highly homologous to their human counterparts in organizational structure and function [22].
T34 5405-5597 Sentence denotes The mouse β-globin genes {ɛy, βh1, β-major, and β-minor} are clustered on Chromosome 7 and they are highly homologous to their human counterparts in organizational structure and function [22].
T1215 5598-5804 Sentence denotes High-level expression of these genes requires a regulatory element, the locus control region that is characterized by a set of nuclease hypersensitive sites spread over 25 kb located 5′ of the ɛy gene [23].
T35 5598-5804 Sentence denotes High-level expression of these genes requires a regulatory element, the locus control region that is characterized by a set of nuclease hypersensitive sites spread over 25 kb located 5′ of the ɛy gene [23].
T1216 5805-5884 Sentence denotes The β-globin genes are expressed in a tissue- and development-specific fashion.
T36 5805-5884 Sentence denotes The β-globin genes are expressed in a tissue- and development-specific fashion.
T1217 5885-6011 Sentence denotes In mice, erythropoiesis originates in the embryonic yolk sac where primitive erythroid cells express ɛy and βh-1 globins [22].
T37 5885-6011 Sentence denotes In mice, erythropoiesis originates in the embryonic yolk sac where primitive erythroid cells express ɛy and βh-1 globins [22].
T1218 6012-6164 Sentence denotes At 11.5 d post coitus (dpc), erythropoiesis shifts to the fetal liver where definitive erythroid cells express adult β globins (β major and minor) [22].
T38 6012-6164 Sentence denotes At 11.5 d post coitus (dpc), erythropoiesis shifts to the fetal liver where definitive erythroid cells express adult β globins (β major and minor) [22].
T1219 6165-6219 Sentence denotes The ɛy gene is silenced in definitive erythroid cells.
T39 6165-6219 Sentence denotes The ɛy gene is silenced in definitive erythroid cells.
T1220 6220-6312 Sentence denotes The mechanism of silencing of its human counterpart, ɛ globin, has been studied extensively.
T40 6220-6312 Sentence denotes The mechanism of silencing of its human counterpart, ɛ globin, has been studied extensively.
T1221 6313-6480 Sentence denotes In definitive erythropoiesis, ɛ is activated and silenced autonomously [24,25], although in primitive erythropoiesis ɛ also appears to be regulated competitively [26].
T41 6313-6480 Sentence denotes In definitive erythropoiesis, ɛ is activated and silenced autonomously [24,25], although in primitive erythropoiesis ɛ also appears to be regulated competitively [26].
T1222 6481-6577 Sentence denotes The γ-globin to adult β-globin switch is controlled by promoter competition for the LCR [24,25].
T42 6481-6577 Sentence denotes The γ-globin to adult β-globin switch is controlled by promoter competition for the LCR [24,25].
T1223 6578-6747 Sentence denotes All the elements responsible for silencing the ɛ globin gene are within the ɛ gene or in adjacent sequences [27], suggesting that silencing is primarily gene autonomous.
T43 6578-6747 Sentence denotes All the elements responsible for silencing the ɛ globin gene are within the ɛ gene or in adjacent sequences [27], suggesting that silencing is primarily gene autonomous.
T1224 6748-6984 Sentence denotes Using promoter deletion analyses in transgenic mouse models and cell transfection assays, multiple DNA elements important to the silencing process have been previously identified in both the proximal and the distal ɛ gene promoter [27].
T44 6748-6984 Sentence denotes Using promoter deletion analyses in transgenic mouse models and cell transfection assays, multiple DNA elements important to the silencing process have been previously identified in both the proximal and the distal ɛ gene promoter [27].
T1225 6985-7198 Sentence denotes Their corresponding transcription factors, such as GATA-1, YY-1, COUP-TF, and DRED have been identified and shown to directly bind to these DNA elements (as part of protein complexes) to regulate ɛ silencing [27].
T45 6985-7198 Sentence denotes Their corresponding transcription factors, such as GATA-1, YY-1, COUP-TF, and DRED have been identified and shown to directly bind to these DNA elements (as part of protein complexes) to regulate ɛ silencing [27].
T1226 7199-7330 Sentence denotes Thus, it appears that the silencing of the ɛ gene involves a complicated network of multiple cis elements and transacting proteins.
T46 7199-7330 Sentence denotes Thus, it appears that the silencing of the ɛ gene involves a complicated network of multiple cis elements and transacting proteins.
T1227 7331-7633 Sentence denotes In addition to playing an important role in the development of the central nervous system [8–11], cartilage [6,12,13], and muscle [14,15], it was shown that Sox6 is upregulated in long-term hematopoiesis stem cells (LT-HSC) compared with multipotent progenitors of adult mouse bone marrow lineage [28].
T47 7331-7633 Sentence denotes In addition to playing an important role in the development of the central nervous system [8–11], cartilage [6,12,13], and muscle [14,15], it was shown that Sox6 is upregulated in long-term hematopoiesis stem cells (LT-HSC) compared with multipotent progenitors of adult mouse bone marrow lineage [28].
T1228 7634-7721 Sentence denotes In this study, we describe that Sox6 also exerts pleiotropic effects on erythropoiesis.
T48 7634-7721 Sentence denotes In this study, we describe that Sox6 also exerts pleiotropic effects on erythropoiesis.
T1229 7722-7892 Sentence denotes These effects include delayed maturation of erythrocytes (that normally enucleate prior to entering the bloodstream [27]) and higher expression of embryonic globin genes.
T49 7722-7892 Sentence denotes These effects include delayed maturation of erythrocytes (that normally enucleate prior to entering the bloodstream [27]) and higher expression of embryonic globin genes.
T1230 7893-7987 Sentence denotes The most extreme effect is the persistence of high expression of the embryonic ɛy globin gene.
T50 7893-7987 Sentence denotes The most extreme effect is the persistence of high expression of the embryonic ɛy globin gene.
T1231 7988-8064 Sentence denotes Here we describe and characterize the effects of Sox6 on the ɛy globin gene.
T51 7988-8064 Sentence denotes Here we describe and characterize the effects of Sox6 on the ɛy globin gene.
T1232 8065-8159 Sentence denotes We show that Sox6 binds to the proximal promoter of ɛy globin and represses its transcription.
T52 8065-8159 Sentence denotes We show that Sox6 binds to the proximal promoter of ɛy globin and represses its transcription.
T1233 8160-8311 Sentence denotes In wild-type (WT) mice, Sox6 is not expressed in yolk sac blood islands, but is expressed in fetal liver, the opposite expression pattern of ɛy globin.
T53 8160-8311 Sentence denotes In wild-type (WT) mice, Sox6 is not expressed in yolk sac blood islands, but is expressed in fetal liver, the opposite expression pattern of ɛy globin.
T1234 8312-8454 Sentence denotes In the absence of Sox6, ɛy globin is ectopically expressed in the fetal liver, demonstrating that Sox6 functions in definitive erythropoiesis.
T54 8312-8454 Sentence denotes In the absence of Sox6, ɛy globin is ectopically expressed in the fetal liver, demonstrating that Sox6 functions in definitive erythropoiesis.
T55 8456-8463 Sentence denotes Results
T4427 8465-8538 Sentence denotes Persistent Expression of the Embryonic Globin, ɛy, in Sox6-Deficient Mice
T56 8465-8538 Sentence denotes Persistent Expression of the Embryonic Globin, ɛy, in Sox6-Deficient Mice
T4428 8539-8700 Sentence denotes The ɛy globin gene was initially identified as an upregulated transcript in the p 100H mouse using subtractive hybridization to identify Sox6 downstream targets.
T57 8539-8700 Sentence denotes The ɛy globin gene was initially identified as an upregulated transcript in the p 100H mouse using subtractive hybridization to identify Sox6 downstream targets.
T4429 8701-8855 Sentence denotes This initial observation was confirmed in an independent knock-out allele of Sox6 [13] using real-time polymerase chain reaction (PCR) (unpublished data).
T58 8701-8855 Sentence denotes This initial observation was confirmed in an independent knock-out allele of Sox6 [13] using real-time polymerase chain reaction (PCR) (unpublished data).
T4430 8856-9024 Sentence denotes Real-time PCR was used to quantitate the expression levels of other globin genes in p100H mutant and WT mouse livers at two developmental stages, 15.5 dpc and 18.5 dpc.
T59 8856-9024 Sentence denotes Real-time PCR was used to quantitate the expression levels of other globin genes in p100H mutant and WT mouse livers at two developmental stages, 15.5 dpc and 18.5 dpc.
T4431 9025-9184 Sentence denotes As shown in Figure 1, the ɛy gene is expressed at high levels at both time points in mutant mice, in contrast to the decline in expression observed in WT mice.
T60 9025-9184 Sentence denotes As shown in Figure 1, the ɛy gene is expressed at high levels at both time points in mutant mice, in contrast to the decline in expression observed in WT mice.
T4432 9185-9260 Sentence denotes No difference was seen between WT and heterozygous mice (unpublished data).
T61 9185-9260 Sentence denotes No difference was seen between WT and heterozygous mice (unpublished data).
T4433 9261-9490 Sentence denotes Interestingly, the expression levels of the other two embryonic globin genes (ζ and βh1) are also higher in p100H homozygous mice, compared with WT mice, but to a much lesser extent than seen for ɛy globin at 18.5 dpc (Figure 1).
T62 9261-9490 Sentence denotes Interestingly, the expression levels of the other two embryonic globin genes (ζ and βh1) are also higher in p100H homozygous mice, compared with WT mice, but to a much lesser extent than seen for ɛy globin at 18.5 dpc (Figure 1).
T4434 9491-9628 Sentence denotes Moreover, the expression level of adult β globin is also somewhat higher in p100H homozygous mice than in WT mice at 18.5 dpc (Figure 1).
T63 9491-9628 Sentence denotes Moreover, the expression level of adult β globin is also somewhat higher in p100H homozygous mice than in WT mice at 18.5 dpc (Figure 1).
T4435 9629-9761 Sentence denotes Perinatal lethality of mutant mice (presumably from the heart defect [14]) precludes us from evaluating postnatal globin expression.
T64 9629-9761 Sentence denotes Perinatal lethality of mutant mice (presumably from the heart defect [14]) precludes us from evaluating postnatal globin expression.
T4436 9762-9908 Sentence denotes The graphs in Figure 1 illustrate real time PCR results that were performed in triplicate (standard deviation of the data is shown by error bars).
T65 9762-9908 Sentence denotes The graphs in Figure 1 illustrate real time PCR results that were performed in triplicate (standard deviation of the data is shown by error bars).
T4437 9909-10157 Sentence denotes Because all of the assays were performed at the same time with the same internal control, the levels shown are relative levels and are thus comparable across all samples and are in agreement with previously published results for WT fetal mice [29].
T66 9909-10157 Sentence denotes Because all of the assays were performed at the same time with the same internal control, the levels shown are relative levels and are thus comparable across all samples and are in agreement with previously published results for WT fetal mice [29].
T4438 10158-10382 Sentence denotes We note that the level of ɛy expression in the livers of 15.5 dpc and 18.5 dpc homozygous mutant mice is statistically equivalent to the level of βmaj/min expression in the livers of 15.5 dpc and 18.5 dpc homozygous WT mice.
T67 10158-10382 Sentence denotes We note that the level of ɛy expression in the livers of 15.5 dpc and 18.5 dpc homozygous mutant mice is statistically equivalent to the level of βmaj/min expression in the livers of 15.5 dpc and 18.5 dpc homozygous WT mice.
T68 10383-10422 Sentence denotes Figure 1 Real-Time PCR of Globin Genes
T69 10423-10609 Sentence denotes The levels of expression of ɛy, βh1, zeta, and βmaj/min were measured at 15.5 dpc and 18.5 dpc in homozygous WT and p100H mutant littermates by real-time PCR (see Materials and Methods).
T70 10610-10753 Sentence denotes Relative expression levels in the livers of each genotype are graphed for each globin gene (performed in triplicate and normalized with GAPDH).
T71 10754-10794 Sentence denotes Standard deviation is indicated by bars.
T5592 10796-10922 Sentence denotes Transfection Studies Using GM979 Cells Indicate That Sox6 Directly Represses the ɛy Gene Promoter at the Transcriptional Level
T72 10796-10922 Sentence denotes Transfection Studies Using GM979 Cells Indicate That Sox6 Directly Represses the ɛy Gene Promoter at the Transcriptional Level
T5593 10923-11043 Sentence denotes Real-time PCR assays (Figure 1) measure steady-state levels of ɛy mRNA, not transcriptional activity of the ɛy promoter.
T73 10923-11043 Sentence denotes Real-time PCR assays (Figure 1) measure steady-state levels of ɛy mRNA, not transcriptional activity of the ɛy promoter.
T5594 11044-11292 Sentence denotes To investigate whether Sox6 directly acts on the ɛy gene promoter at the transcriptional level, we used an in vitro transient transfection assay and GM979 cells, a murine erythroleukemic cell line that expresses both ɛy and adult beta globins [30].
T74 11044-11292 Sentence denotes To investigate whether Sox6 directly acts on the ɛy gene promoter at the transcriptional level, we used an in vitro transient transfection assay and GM979 cells, a murine erythroleukemic cell line that expresses both ɛy and adult beta globins [30].
T5595 11293-11537 Sentence denotes We generated an ɛy promoter reporter construct (E-Luc) by fusing a micro-LCR (μLCR) element (2.5 kb) [31] to the ɛy proximal promoter (2.2 kb), followed by the luciferase reporter gene, as shown in Figure 2A (detailed in Materials and Methods).
T75 11293-11537 Sentence denotes We generated an ɛy promoter reporter construct (E-Luc) by fusing a micro-LCR (μLCR) element (2.5 kb) [31] to the ɛy proximal promoter (2.2 kb), followed by the luciferase reporter gene, as shown in Figure 2A (detailed in Materials and Methods).
T5596 11538-11680 Sentence denotes Overexpression of Sox6 in GM979 cells by transient transfection leads to a dosage-dependent repression of E-Luc reporter activity (Figure 2B).
T76 11538-11680 Sentence denotes Overexpression of Sox6 in GM979 cells by transient transfection leads to a dosage-dependent repression of E-Luc reporter activity (Figure 2B).
T5597 11681-11849 Sentence denotes In contrast, overexpression of a truncated Sox6 protein that lacks its HMG domain [32] (similar to the p 100H mouse allele) fails to repress E-Luc activity (Figure 2B).
T77 11681-11849 Sentence denotes In contrast, overexpression of a truncated Sox6 protein that lacks its HMG domain [32] (similar to the p 100H mouse allele) fails to repress E-Luc activity (Figure 2B).
T5598 11850-11941 Sentence denotes These data indicate that Sox6 acts to repress the ɛy promoter at the transcriptional level.
T78 11850-11941 Sentence denotes These data indicate that Sox6 acts to repress the ɛy promoter at the transcriptional level.
T79 11942-11989 Sentence denotes Figure 2 The Effect of Sox6 on the ɛy Promoter
T80 11990-12072 Sentence denotes (A) Constructs of the ɛy promoter reporter (E-luc) and Sox6 overexpression vector.
T81 12073-12251 Sentence denotes The E-luc reporter construct consists of a 2.5-kb μLCR element, a 2.2-kb ɛy proximal promoter, and the luciferase reporter in the pGL-3 basic plasmid (see Materials and Methods).
T82 12252-12298 Sentence denotes Sox6 expression is driven by the CMV promoter.
T83 12299-12368 Sentence denotes (B) Sox6 represses ɛy promoter activity in a dosage-dependent manner.
T84 12369-12795 Sentence denotes In GM979 cells, the E-Luc ɛy promoter reporter construct was co-transfected (1) without overexpression of Sox6; (2–4) with increasing amounts of CMV-Sox6 overexpression vector; (5) with a truncated version of Sox6 that lacks its HMG domain; (6) with a mutant version of Sox6 (L386H) that has previously been shown to abolish interaction with CtBP2; or (7) with an empty reporter plasmid (without ɛy promoter and μLCR element).
T85 12796-12860 Sentence denotes (C) Promoter deletion analyses to delimit the critical sequence.
T86 12861-13186 Sentence denotes The 2.2-kb proximal promoter or deletions of it, as indicated on the left (numbering relative to +1 = the transcription start site of ɛy globin, see Materials and Methods), were engineered in reporter constructs as in (A) and were transfected along with CMV driven Sox6 to GM979 cells (see Materials and Methods for details).
T87 13187-13281 Sentence denotes The relative repression by Sox6 on the activity of the different reporter constructs is shown.
T88 13282-13322 Sentence denotes All experiments were done in triplicate.
T5599 13323-13452 Sentence denotes Sox6 has been shown to act as a repressor and to interact with a widely expressed co-repressor, CtBP2, on the fgf-3 promoter [5].
T89 13323-13452 Sentence denotes Sox6 has been shown to act as a repressor and to interact with a widely expressed co-repressor, CtBP2, on the fgf-3 promoter [5].
T5600 13453-13506 Sentence denotes CtBP2 is expressed in GM979 cells (unpublished data).
T90 13453-13506 Sentence denotes CtBP2 is expressed in GM979 cells (unpublished data).
T5601 13507-13757 Sentence denotes To investigate whether the interaction with CtBP2 is required for Sox6 repression of the ɛy promoter, we introduced a point mutation (L386H) in the Sox6 protein that has been previously reported to be sufficient to abolish Sox6-CtBP2 interaction [5].
T91 13507-13757 Sentence denotes To investigate whether the interaction with CtBP2 is required for Sox6 repression of the ɛy promoter, we introduced a point mutation (L386H) in the Sox6 protein that has been previously reported to be sufficient to abolish Sox6-CtBP2 interaction [5].
T5602 13758-13818 Sentence denotes This amino acid change is not in the HMG DNA binding domain.
T92 13758-13818 Sentence denotes This amino acid change is not in the HMG DNA binding domain.
T5603 13819-14019 Sentence denotes However, this mutant version of Sox6 retains the ability to repress the ɛy promoter in the transfection assay (Figure 2B), indicating that Sox6 represses the ɛy promoter in a CtBP2-independent manner.
T93 13819-14019 Sentence denotes However, this mutant version of Sox6 retains the ability to repress the ɛy promoter in the transfection assay (Figure 2B), indicating that Sox6 represses the ɛy promoter in a CtBP2-independent manner.
T5604 14020-14180 Sentence denotes Deletion analysis of the ɛy promoter, as shown in Figure 2C, defined a region (−63 to −37) within the ɛy proximal promoter that is critical for Sox6 repression.
T94 14020-14180 Sentence denotes Deletion analysis of the ɛy promoter, as shown in Figure 2C, defined a region (−63 to −37) within the ɛy proximal promoter that is critical for Sox6 repression.
T5605 14181-14272 Sentence denotes Analysis of this short region reveals two Sox/Sox6 consensus binding sites [5] (Figure 3A).
T95 14181-14272 Sentence denotes Analysis of this short region reveals two Sox/Sox6 consensus binding sites [5] (Figure 3A).
T96 14273-14368 Sentence denotes Figure 3 Analysis of the Minimal Region (36 bp) of the Proximal ɛy Promoter Responsive to Sox6
T97 14369-14445 Sentence denotes (A) The sequence of the 36-bp fragment and its mutant versions used in EMSA.
T98 14446-14591 Sentence denotes The WT 36-bp DNA sequence (−63 to −28) of the ɛy globin proximal promoter contains two Sox/Sox6 consensus binding sites, shown in bold underline.
T99 14592-14720 Sentence denotes Versions with truncation of this sequence (M1) or mutation of one of the two consensus binding sites (M2 and M3) are also shown.
T100 14721-14753 Sentence denotes (B) EMSA with c-Myc-tagged Sox6.
T101 14754-14926 Sentence denotes EMSA was performed using the 36-bp radio-labeled WT probe (as shown in (A)) and c-Myc tagged Sox6 translated in vitro using reticulocyte lysate (see Materials and Methods).
T102 14927-15312 Sentence denotes Lane 1: radio-labeled free probe (run out of the gel); Lane 2: no competition, no antibody; Lane 3: competition with 200-fold excess cold probe, no antibody; Lane 4: no competition, c-Myc antibody (producing a supershift); Lane 5: no competition, Sox6 antibody (producing a supershift); Lane 6: no competion, no antibody using in vitro translated vector containing c-Myc, but not Sox6.
T103 15313-15342 Sentence denotes (C) EMSA with HA-tagged Sox6.
T104 15343-15423 Sentence denotes EMSA was performed similarly as in (B) using HA-tagged Sox6 translated in vitro.
T105 15424-15643 Sentence denotes Lane 1: radio-labeled free probe (run out of the gel); Lane 2: no competition, no antibody; Lane 3: competition with 200-fold excess cold probe, no antibody; Lane 4: no competition, HA antibody (producing a supershift).
T106 15644-15708 Sentence denotes (D) EMSA using MEL cell nuclear extracts and the 36-bp WT probe.
T107 15709-15930 Sentence denotes Lane 1: radio-labeled free probe (run out of the gel); Lane 2: no competition, no antibody; Lane 3: competition with 200-fold excess cold probe, no antibody; Lane 4: no competition, Sox6 antibody (producing a supershift).
T108 15931-16024 Sentence denotes (E) EMSA with c-Myc-tagged Sox6, WT and mutant versions of the 36-bp fragment in competition.
T109 16025-16129 Sentence denotes EMSA was performed using the radio-labeled 36-bp WT probe and the c-Myc tagged Sox6 translated in vitro.
T110 16130-16200 Sentence denotes Lane 1: radio-labeled free probe; Lane 2: no competition, no antibody.
T111 16201-16333 Sentence denotes Competition was performed using 200-fold excess cold probes corresponding to WT (Lane 3), M1 (Lane 4), M2 (Lane 5), and M3 (Lane 6).
T112 16334-16413 Sentence denotes (F) Both consensus Sox/Sox6 binding sites are required for Sox6 responsiveness.
T113 16414-16580 Sentence denotes GM979 cells were transfected with a reporter construct (Figure 2A) containing −63 to +45 of the ɛy proximal promoter together with the CMV-Sox6 overexpression vector.
T114 16581-16669 Sentence denotes Mutations of the consensus binding sites were also tested (M3, M2, M2 plus M3, see (A)).
T115 16670-16740 Sentence denotes The fold repression of Sox6 with the WT or mutant constructs is shown.
T116 16741-16839 Sentence denotes The baseline activities of the mutagenized reporter constructs are comparable to the WT construct.
T7141 16841-16910 Sentence denotes EMSA and ChIP Assays Show that Sox6 Directly Binds to the ɛy Promoter
T117 16841-16910 Sentence denotes EMSA and ChIP Assays Show that Sox6 Directly Binds to the ɛy Promoter
T7142 16911-17061 Sentence denotes Sox6 might repress the ɛy promoter, either through direct physical contact with the promoter or by regulating intermediates affecting the ɛy promoter.
T118 16911-17061 Sentence denotes Sox6 might repress the ɛy promoter, either through direct physical contact with the promoter or by regulating intermediates affecting the ɛy promoter.
T7143 17062-17298 Sentence denotes To investigate whether Sox6 is directly associated with the ɛy promoter, we first performed electrophoretic mobility shift assays (EMSA) using a c-Myc-tagged Sox6 in a reticulocyte lysate-based transcription/translation in vitro system.
T119 17062-17298 Sentence denotes To investigate whether Sox6 is directly associated with the ɛy promoter, we first performed electrophoretic mobility shift assays (EMSA) using a c-Myc-tagged Sox6 in a reticulocyte lysate-based transcription/translation in vitro system.
T7144 17299-17339 Sentence denotes The probes used are listed in Figure 3A.
T120 17299-17339 Sentence denotes The probes used are listed in Figure 3A.
T7145 17340-17467 Sentence denotes The 36–base pair (bp) WT probe corresponds to the critical region of the ɛy promoter defined in our promoter deletion analyses.
T121 17340-17467 Sentence denotes The 36–base pair (bp) WT probe corresponds to the critical region of the ɛy promoter defined in our promoter deletion analyses.
T7146 17468-17525 Sentence denotes This probe contains two consensus Sox/Sox6 binding sites.
T122 17468-17525 Sentence denotes This probe contains two consensus Sox/Sox6 binding sites.
T7147 17526-17671 Sentence denotes Also included in our EMSA are three mutated probes that are, either truncated (M1), or mutated (M2 and M3) in Sox/Sox6 binding sites (Figure 3A).
T123 17526-17671 Sentence denotes Also included in our EMSA are three mutated probes that are, either truncated (M1), or mutated (M2 and M3) in Sox/Sox6 binding sites (Figure 3A).
T7148 17672-17823 Sentence denotes Sox6 is able to physically associate with the 36-bp region (Figure 3B) within the ɛy promoter defined by the deletion analysis experiments (Figure 2C).
T124 17672-17823 Sentence denotes Sox6 is able to physically associate with the 36-bp region (Figure 3B) within the ɛy promoter defined by the deletion analysis experiments (Figure 2C).
T7149 17824-17879 Sentence denotes The 36-bp probe was shifted by the tagged Sox6 protein.
T125 17824-17879 Sentence denotes The 36-bp probe was shifted by the tagged Sox6 protein.
T7150 17880-17987 Sentence denotes Moreover, both c-Myc and Sox6 antibodies supershift the band, indicating that the binding is Sox6-specific.
T126 17880-17987 Sentence denotes Moreover, both c-Myc and Sox6 antibodies supershift the band, indicating that the binding is Sox6-specific.
T7151 17988-18146 Sentence denotes To rule out the possibility that the c-Myc tag itself binds to the probe, an HA-tagged Sox6 was used in another EMSA that confirmed these results (Figure 3C).
T127 17988-18146 Sentence denotes To rule out the possibility that the c-Myc tag itself binds to the probe, an HA-tagged Sox6 was used in another EMSA that confirmed these results (Figure 3C).
T7152 18147-18234 Sentence denotes Next, nuclear extracts from MEL cells were used in EMSA employing the same 36-bp probe.
T128 18147-18234 Sentence denotes Next, nuclear extracts from MEL cells were used in EMSA employing the same 36-bp probe.
T7153 18235-18323 Sentence denotes MEL cells, a murine erythroleukemic cell line, express adult β globins, but not ɛy [33].
T129 18235-18323 Sentence denotes MEL cells, a murine erythroleukemic cell line, express adult β globins, but not ɛy [33].
T7154 18324-18390 Sentence denotes Sox6 directly binds to this DNA sequence in MEL cells (Figure 3D).
T130 18324-18390 Sentence denotes Sox6 directly binds to this DNA sequence in MEL cells (Figure 3D).
T7155 18391-18528 Sentence denotes The intact consensus Sox/Sox6 binding sites of the DNA probe are required for the binding, as shown in the competition assay (Figure 3E).
T131 18391-18528 Sentence denotes The intact consensus Sox/Sox6 binding sites of the DNA probe are required for the binding, as shown in the competition assay (Figure 3E).
T7156 18529-18638 Sentence denotes Ablation of putative Sox/Sox6 binding sites (M1 and M3) abolish their ability to compete in EMSA (Figure 3E).
T132 18529-18638 Sentence denotes Ablation of putative Sox/Sox6 binding sites (M1 and M3) abolish their ability to compete in EMSA (Figure 3E).
T7157 18639-18697 Sentence denotes The M2 mutant probe may compete partially with WT binding.
T133 18639-18697 Sentence denotes The M2 mutant probe may compete partially with WT binding.
T7158 18698-18928 Sentence denotes To investigate the functional significance of the intact Sox/Sox6 binding sites, the ɛy promoter reporter constructs with mutagenized Sox/Sox6 binding sites were co-transfected with the Sox6 overexpression vector into GM979 cells.
T134 18698-18928 Sentence denotes To investigate the functional significance of the intact Sox/Sox6 binding sites, the ɛy promoter reporter constructs with mutagenized Sox/Sox6 binding sites were co-transfected with the Sox6 overexpression vector into GM979 cells.
T7159 18929-19152 Sentence denotes Consistent with the EMSA results, the mutant ɛy promoter reporter constructs (with either one or both Sox/Sox6 binding sites mutagenized) do not result in significant promoter repression in transfection studies (Figure 3F).
T135 18929-19152 Sentence denotes Consistent with the EMSA results, the mutant ɛy promoter reporter constructs (with either one or both Sox/Sox6 binding sites mutagenized) do not result in significant promoter repression in transfection studies (Figure 3F).
T7160 19153-19248 Sentence denotes Thus, both sites are required for maximal repression of ɛy by Sox6, but not to the same degree.
T136 19153-19248 Sentence denotes Thus, both sites are required for maximal repression of ɛy by Sox6, but not to the same degree.
T7161 19249-19364 Sentence denotes We also tested whether Sox6 binds to the ɛy promoter in vivo using chromatin immunoprecipitation (ChIP) (Figure 4).
T137 19249-19364 Sentence denotes We also tested whether Sox6 binds to the ɛy promoter in vivo using chromatin immunoprecipitation (ChIP) (Figure 4).
T7162 19365-19491 Sentence denotes The Sox6-containing complex was immunoprecipitated from MEL cells or from liver cells of 15.5 dpc WT mice using Sox6 antibody.
T138 19365-19491 Sentence denotes The Sox6-containing complex was immunoprecipitated from MEL cells or from liver cells of 15.5 dpc WT mice using Sox6 antibody.
T7163 19492-19620 Sentence denotes Figure 4 shows that the ɛy proximal promoter is readily immunoprecipitated with Sox6 antibody in both MEL cells and liver cells.
T139 19492-19620 Sentence denotes Figure 4 shows that the ɛy proximal promoter is readily immunoprecipitated with Sox6 antibody in both MEL cells and liver cells.
T7164 19621-19675 Sentence denotes Normal IgG was used as a negative control (Figure 4A).
T140 19621-19675 Sentence denotes Normal IgG was used as a negative control (Figure 4A).
T7165 19676-19831 Sentence denotes The above data (Figures 3 and 4) clearly indicate that Sox6 acts as a repressor of the ɛy gene by directly binding to the ɛy promoter, probably as a dimer.
T141 19676-19831 Sentence denotes The above data (Figures 3 and 4) clearly indicate that Sox6 acts as a repressor of the ɛy gene by directly binding to the ɛy promoter, probably as a dimer.
T142 19832-19852 Sentence denotes Figure 4 ChIP Assay
T143 19853-19952 Sentence denotes MEL cells (A) and 15.5-dpc fetal liver cells (B) were treated as detailed in Materials and Methods.
T144 19953-20174 Sentence denotes 10% of the sample was saved as total input (Inp); remaining samples were divided: plus Sox6 antibody (Ab+), minus Sox6 antibody (Ab−), as well as no DNA (DNA−) and normal rabbit IgG (IgG) that served as negative controls.
T145 20175-20294 Sentence denotes Other controls for these experiments included PCR within the promoter of the α-globin gene and intron 24 of the p gene.
T146 20295-20333 Sentence denotes Both were negative (unpublished data).
T147 20334-20464 Sentence denotes PCR was carried out using primer pairs flanking the Sox/Sox6 binding sites (see Material and Methods) of the ɛy proximal promoter.
T148 20465-20554 Sentence denotes For all reactions, we used 2 μl of immuno-precipitated DNA and 2 μl of 1/100 total input.
T149 20555-20614 Sentence denotes Semiquantitative PCR was done within the exponential range.
T150 20615-20658 Sentence denotes Multiple independent experiments were done.
T9024 20660-20805 Sentence denotes The Persistent Expression of ɛy Globin in Sox6-Deficient Mice Is Due to a Defect in the ɛy-Gene–Silencing Mechanism in Definitive Erythroid Cells
T151 20660-20805 Sentence denotes The Persistent Expression of ɛy Globin in Sox6-Deficient Mice Is Due to a Defect in the ɛy-Gene–Silencing Mechanism in Definitive Erythroid Cells
T9025 20806-20926 Sentence denotes Normally, the ɛy globin gene is exclusively expressed in primitive erythrocytes and silenced in definitive erythrocytes.
T152 20806-20926 Sentence denotes Normally, the ɛy globin gene is exclusively expressed in primitive erythrocytes and silenced in definitive erythrocytes.
T9026 20927-21212 Sentence denotes To determine whether the persistent expression of ɛy globin is due to residual primitive erythrocytes or is due to ectopic expression of ɛy globin in definitive erythrocytes, we examined the spatial pattern of ɛy globin transcripts in mouse embryos by in situ hybridization (Figure 5).
T153 20927-21212 Sentence denotes To determine whether the persistent expression of ɛy globin is due to residual primitive erythrocytes or is due to ectopic expression of ɛy globin in definitive erythrocytes, we examined the spatial pattern of ɛy globin transcripts in mouse embryos by in situ hybridization (Figure 5).
T9027 21213-21330 Sentence denotes As expected, ɛy globin is not expressed in the WT 14.5-dpc liver, the site of definitive erythropoiesis in the fetus.
T154 21213-21330 Sentence denotes As expected, ɛy globin is not expressed in the WT 14.5-dpc liver, the site of definitive erythropoiesis in the fetus.
T9028 21331-21436 Sentence denotes In contrast, abundant ectopic ɛy mRNA expression is seen in the liver of 14.5-dpc mutants (Figure 5 A–D).
T155 21331-21436 Sentence denotes In contrast, abundant ectopic ɛy mRNA expression is seen in the liver of 14.5-dpc mutants (Figure 5 A–D).
T9029 21437-21552 Sentence denotes However, the expression of βmaj/min globin is equally abundant in both WT and p100H mutant mice (Figure 5 E and F).
T156 21437-21552 Sentence denotes However, the expression of βmaj/min globin is equally abundant in both WT and p100H mutant mice (Figure 5 E and F).
T9030 21553-21803 Sentence denotes These data demonstrate that the persistent high levels of ɛy are due to ectopic expression in the definitive erythroid cells that mature in the fetal liver, suggesting that there is an intrinsic defect of the ɛy silencing mechanism in Sox6-null mice.
T157 21553-21803 Sentence denotes These data demonstrate that the persistent high levels of ɛy are due to ectopic expression in the definitive erythroid cells that mature in the fetal liver, suggesting that there is an intrinsic defect of the ɛy silencing mechanism in Sox6-null mice.
T158 21804-21906 Sentence denotes Figure 5 In Situ Hybridization of ɛy and βmaj/min transcripts in WT and p100H Mutant Mice at 14.5 dpc
T159 21907-22031 Sentence denotes Expression of ɛy globin (A–D) and β globin (E and F) in sagittal sections of 14.5-dpc fetuses is shown in pseudocolor (red).
T160 22032-22045 Sentence denotes (A) WT fetus.
T161 22046-22080 Sentence denotes (B) p100H Homozygous mutant fetus.
T162 22081-22113 Sentence denotes (C and D) Inset boxes are shown.
T163 22114-22193 Sentence denotes Prominent expression of ɛy globin is only detected in the liver of mutant mice.
T164 22194-22286 Sentence denotes (E and F) In contrast, both WT and mutant mouse livers express adult βmaj/min, respectively.
T165 22287-22367 Sentence denotes No signals were detected above background using sense probes (unpublished data).
T166 22368-22431 Sentence denotes The size bars represent 1 mm for (A) and (B); 100 μm for (C–F).
T9782 22433-22508 Sentence denotes The Expression Pattern of Sox6 Suggests a Role in Definitive Erythropoiesis
T167 22433-22508 Sentence denotes The Expression Pattern of Sox6 Suggests a Role in Definitive Erythropoiesis
T9783 22509-22705 Sentence denotes The observation that Sox6-deficient mice ectopically express ɛy globin in liver, where definitive erythroid cells mature, suggests that Sox6 is an important regulator in definitive erythropoiesis.
T168 22509-22705 Sentence denotes The observation that Sox6-deficient mice ectopically express ɛy globin in liver, where definitive erythroid cells mature, suggests that Sox6 is an important regulator in definitive erythropoiesis.
T9784 22706-22833 Sentence denotes To determine the temporal and spatial expression pattern of Sox6, Northern blot and in situ hybridization assays were employed.
T169 22706-22833 Sentence denotes To determine the temporal and spatial expression pattern of Sox6, Northern blot and in situ hybridization assays were employed.
T9785 22834-22993 Sentence denotes As shown in Figure 6A, Sox6 is detectable by Northern blot beginning at 10.5 dpc, coincident with the temporal onset of definitive erythropoiesis in the liver.
T170 22834-22993 Sentence denotes As shown in Figure 6A, Sox6 is detectable by Northern blot beginning at 10.5 dpc, coincident with the temporal onset of definitive erythropoiesis in the liver.
T9786 22994-23143 Sentence denotes Furthermore, in situ hybridization shows that Sox6 is highly transcribed in 12.5-dpc liver, but not in yolk sac blood islands at 7.5 dpc (Figure 6B).
T171 22994-23143 Sentence denotes Furthermore, in situ hybridization shows that Sox6 is highly transcribed in 12.5-dpc liver, but not in yolk sac blood islands at 7.5 dpc (Figure 6B).
T9787 23144-23261 Sentence denotes Therefore, Sox6 expression is temporally and spatially coincident with definitive, but not primitive, erythropoiesis.
T172 23144-23261 Sentence denotes Therefore, Sox6 expression is temporally and spatially coincident with definitive, but not primitive, erythropoiesis.
T9788 23262-23467 Sentence denotes These data, taken together with the observation that ɛy globin is highly expressed in the liver cells of 14.5-dpc p100H mutant mice (Figure 5), demonstrate that Sox6 functions in definitive erythropoiesis.
T173 23262-23467 Sentence denotes These data, taken together with the observation that ɛy globin is highly expressed in the liver cells of 14.5-dpc p100H mutant mice (Figure 5), demonstrate that Sox6 functions in definitive erythropoiesis.
T174 23468-23540 Sentence denotes Figure 6 Expression Pattern of Sox6 by Northern Blot and In Situ Assays
T175 23541-23613 Sentence denotes (A) Sox6 expression during embryonic development shown by Northern blot.
T176 23614-23710 Sentence denotes Each lane contains 20 μg of total RNA from embryos whose ages are listed above each lane as dpc.
T177 23711-23812 Sentence denotes The filter was hybridized with a 32P-labeled 575-bp mouse Sox6 cDNA fragment (nucleotides 1353–1927).
T178 23813-23878 Sentence denotes Numbers on the left are sizes of standard marker fragments in kb.
T179 23879-23930 Sentence denotes (B) Sox6 expression shown by in situ hybridization.
T180 23931-23939 Sentence denotes Panel i:
T181 23940-24114 Sentence denotes Sagittal section through an E12.5 mouse embryo using antisense Sox6. mRNA distribution is represented by pseudocolored red signal superimposed on the counterstained specimen.
T182 24115-24237 Sentence denotes Sox6 transcripts are detected primarily in the fetal liver, developing nervous system, chondrocytes and craniofacial area.
T183 24238-24247 Sentence denotes Panel ii:
T184 24248-24305 Sentence denotes The sense control probe shows no signal above background.
T185 24306-24368 Sentence denotes Panel iii: E7.5 embryo hybridized to antisense probe for Sox6.
T186 24369-24482 Sentence denotes No signal is detected above background specifically in blood islands (or with the sense probe, unpublished data).
T187 24483-24514 Sentence denotes The size bars represent 100 μm.
T10347 24516-24576 Sentence denotes Mutant p100H Mice Have Higher Numbers of Nucleated Red Cells
T188 24516-24576 Sentence denotes Mutant p100H Mice Have Higher Numbers of Nucleated Red Cells
T10348 24577-24773 Sentence denotes Among the other Sox6 effects in erythropoiesis, we have noticed that there are more nucleated red blood cells circulating in p100H mutant mice than in WT mice at 14.5 dpc and 18.5 dpc (Figure 7A).
T189 24577-24773 Sentence denotes Among the other Sox6 effects in erythropoiesis, we have noticed that there are more nucleated red blood cells circulating in p100H mutant mice than in WT mice at 14.5 dpc and 18.5 dpc (Figure 7A).
T10349 24774-24928 Sentence denotes However, at postnatal day 10.5, we do not see circulating nucleated red cells in either WT or mutant mice, suggesting that this may be a transient effect.
T190 24774-24928 Sentence denotes However, at postnatal day 10.5, we do not see circulating nucleated red cells in either WT or mutant mice, suggesting that this may be a transient effect.
T10350 24929-25078 Sentence denotes In addition, the mutant liver shows a significant increase in hematopoietic precursor cells including nucleated erythrocytes at 18.5 dpc (Figure 7B).
T191 24929-25078 Sentence denotes In addition, the mutant liver shows a significant increase in hematopoietic precursor cells including nucleated erythrocytes at 18.5 dpc (Figure 7B).
T10351 25079-25125 Sentence denotes This alteration is noted as early as 14.5 dpc.
T192 25079-25125 Sentence denotes This alteration is noted as early as 14.5 dpc.
T10352 25126-25232 Sentence denotes These observations suggest that besides silencing the ɛy globin gene, Sox6 may affect red cell maturation.
T193 25126-25232 Sentence denotes These observations suggest that besides silencing the ɛy globin gene, Sox6 may affect red cell maturation.
T194 25233-25304 Sentence denotes Figure 7 The Blood and Liver Phenotype of WT and p100H Homozygous Mice
T195 25305-25423 Sentence denotes (A) Red blood cells of WT mice (left panels) and p100H homozygous mice (right panels) are shown at the indicated ages.
T196 25424-25538 Sentence denotes (B) Liver cells of WT mice (left panels) and p100H homozygous mice (right panels) are shown at the indicated ages.
T197 25540-25550 Sentence denotes Discussion
T11149 25551-25659 Sentence denotes In this report, we show that Sox6 is a novel factor in the complicated regulation mechanism of globin genes.
T198 25551-25659 Sentence denotes In this report, we show that Sox6 is a novel factor in the complicated regulation mechanism of globin genes.
T11150 25660-25806 Sentence denotes In the Sox6 null mouse, there is a transient effect on the embryonic globin genes, ζ and βH1, and a persistent upregulation of the ɛy globin gene.
T199 25660-25806 Sentence denotes In the Sox6 null mouse, there is a transient effect on the embryonic globin genes, ζ and βH1, and a persistent upregulation of the ɛy globin gene.
T11151 25807-25939 Sentence denotes Sox6 directly regulates and binds to the proximal promoter of ɛy gene and represses the ɛy-globin gene in definitive erythropoiesis.
T200 25807-25939 Sentence denotes Sox6 directly regulates and binds to the proximal promoter of ɛy gene and represses the ɛy-globin gene in definitive erythropoiesis.
T11152 25940-26034 Sentence denotes Sox6 belongs to group D of the Sox family of proteins that includes Sox5, 12, 13, and 23 [34].
T201 25940-26034 Sentence denotes Sox6 belongs to group D of the Sox family of proteins that includes Sox5, 12, 13, and 23 [34].
T11153 26035-26137 Sentence denotes Group D Sox proteins contain a coiled–coiled domain that mediates homo- and heterodimerization [6,35].
T202 26035-26137 Sentence denotes Group D Sox proteins contain a coiled–coiled domain that mediates homo- and heterodimerization [6,35].
T11154 26138-26308 Sentence denotes Functionally, dimerization of Sox5 and Sox6 has been shown to greatly increase the binding efficiency of the two Sox proteins to DNA that contains adjacent Sox sites [6].
T203 26138-26308 Sentence denotes Functionally, dimerization of Sox5 and Sox6 has been shown to greatly increase the binding efficiency of the two Sox proteins to DNA that contains adjacent Sox sites [6].
T11155 26309-26408 Sentence denotes In addition, Sox6 binds more strongly to an HMG-box dimer motif than to a single HMG-box motif [5].
T204 26309-26408 Sentence denotes In addition, Sox6 binds more strongly to an HMG-box dimer motif than to a single HMG-box motif [5].
T11156 26409-26601 Sentence denotes Therefore, it appears that target genes for group D Sox proteins, such as Sox6, probably harbor pairs of HMG binding sites with a configuration compatible with binding of D-Sox protein dimers.
T205 26409-26601 Sentence denotes Therefore, it appears that target genes for group D Sox proteins, such as Sox6, probably harbor pairs of HMG binding sites with a configuration compatible with binding of D-Sox protein dimers.
T11157 26602-26734 Sentence denotes Indeed, in the present study, the defined Sox6 target sequence of the ɛy promoter contains two Sox/Sox6 consensus sites (Figure 3A).
T206 26602-26734 Sentence denotes Indeed, in the present study, the defined Sox6 target sequence of the ɛy promoter contains two Sox/Sox6 consensus sites (Figure 3A).
T11158 26735-26860 Sentence denotes Functionally, both sites are essential for Sox6 binding to the ɛy promoter and repression of its activity (Figure 3E and 3F).
T207 26735-26860 Sentence denotes Functionally, both sites are essential for Sox6 binding to the ɛy promoter and repression of its activity (Figure 3E and 3F).
T11159 26861-27006 Sentence denotes These observations suggest that Sox6 binds to this sequence of the ɛy promoter either as a homodimer or as a heterodimer with other Sox proteins.
T208 26861-27006 Sentence denotes These observations suggest that Sox6 binds to this sequence of the ɛy promoter either as a homodimer or as a heterodimer with other Sox proteins.
T11160 27007-27222 Sentence denotes Because Sox proteins recognize a short 6-bp core-binding sequence that allows for considerable degeneracy, the specificity of their actions is thought to rely upon interactions with other transcription factors [36].
T209 27007-27222 Sentence denotes Because Sox proteins recognize a short 6-bp core-binding sequence that allows for considerable degeneracy, the specificity of their actions is thought to rely upon interactions with other transcription factors [36].
T11161 27223-27405 Sentence denotes In our EMSAs, we had to run the electrophoresis on a 4%–6% gel for at least 4–8 h to detect the Sox6-associated band, suggesting that Sox6 is part of a high molecular weight complex.
T210 27223-27405 Sentence denotes In our EMSAs, we had to run the electrophoresis on a 4%–6% gel for at least 4–8 h to detect the Sox6-associated band, suggesting that Sox6 is part of a high molecular weight complex.
T11162 27406-27567 Sentence denotes A few other ɛy globin repressors have been reported to bind to DNA sequences near the Sox/Sox6 consensus sites, including the DRED complex [37] and COUP-TF [38].
T211 27406-27567 Sentence denotes A few other ɛy globin repressors have been reported to bind to DNA sequences near the Sox/Sox6 consensus sites, including the DRED complex [37] and COUP-TF [38].
T11163 27568-27643 Sentence denotes Sox6 might interact with these factors and form a large repression complex.
T212 27568-27643 Sentence denotes Sox6 might interact with these factors and form a large repression complex.
T11164 27644-27789 Sentence denotes Identification of other components of the Sox6-containing complex associated with the ɛy promoter will shed light on its mechanism of repression.
T213 27644-27789 Sentence denotes Identification of other components of the Sox6-containing complex associated with the ɛy promoter will shed light on its mechanism of repression.
T11165 27790-27920 Sentence denotes Sox proteins bind and bend linear DNA by partial intercalation in the minor groove, and can also bind to four-way junctions [2–4].
T214 27790-27920 Sentence denotes Sox proteins bind and bend linear DNA by partial intercalation in the minor groove, and can also bind to four-way junctions [2–4].
T11166 27921-28177 Sentence denotes Therefore, one attractive model to explain how Sox6 proteins control gene expression is that they function as architectural factors bound to DNA, influencing local chromatin structure by bending DNA and by assembling multiprotein transcriptional complexes.
T215 27921-28177 Sentence denotes Therefore, one attractive model to explain how Sox6 proteins control gene expression is that they function as architectural factors bound to DNA, influencing local chromatin structure by bending DNA and by assembling multiprotein transcriptional complexes.
T11167 28178-28340 Sentence denotes By changing the local chromatin structure, Sox6 could either interfere with binding of other activators to the promoter or facilitate binding of other repressors.
T216 28178-28340 Sentence denotes By changing the local chromatin structure, Sox6 could either interfere with binding of other activators to the promoter or facilitate binding of other repressors.
T11168 28341-28433 Sentence denotes Another example of a repressor that interferes with an activator on the ɛy promoter is DRED.
T217 28341-28433 Sentence denotes Another example of a repressor that interferes with an activator on the ɛy promoter is DRED.
T11169 28434-28510 Sentence denotes DRED interferes with EKLF, an activator, in binding to the ɛy promoter [39].
T218 28434-28510 Sentence denotes DRED interferes with EKLF, an activator, in binding to the ɛy promoter [39].
T11170 28511-28788 Sentence denotes Two HMG architectural proteins (distantly related to the Sox family of transcription factors), HMG-I and HMG-Y, were demonstrated to bind to the human adult β globin silencers (silencers I and II) and cause bending of the DNA, facilitating the binding of other repressors [40].
T219 28511-28788 Sentence denotes Two HMG architectural proteins (distantly related to the Sox family of transcription factors), HMG-I and HMG-Y, were demonstrated to bind to the human adult β globin silencers (silencers I and II) and cause bending of the DNA, facilitating the binding of other repressors [40].
T11171 28789-28995 Sentence denotes Sox6 expression is temporally and spatially coincident with definitive (but not primitive) erythropoiesis (Figure 6), and Sox6 represses ɛy globin expression both in vivo (Figure 1) and in vitro (Figure 2).
T220 28789-28995 Sentence denotes Sox6 expression is temporally and spatially coincident with definitive (but not primitive) erythropoiesis (Figure 6), and Sox6 represses ɛy globin expression both in vivo (Figure 1) and in vitro (Figure 2).
T11172 28996-29222 Sentence denotes Moreover, in situ hybridization clearly shows that the persistent expression of ɛy globin in p100H mutant mice is due to defects in the silencing mechanism of definitive erythropoiesis that takes place in the liver (Figure 5).
T221 28996-29222 Sentence denotes Moreover, in situ hybridization clearly shows that the persistent expression of ɛy globin in p100H mutant mice is due to defects in the silencing mechanism of definitive erythropoiesis that takes place in the liver (Figure 5).
T11173 29223-29343 Sentence denotes Taken together, these data demonstrate that Sox6 functions in definitive erythropoiesis to silence ɛy globin expression.
T222 29223-29343 Sentence denotes Taken together, these data demonstrate that Sox6 functions in definitive erythropoiesis to silence ɛy globin expression.
T11174 29344-29565 Sentence denotes The expression level of ɛy globin in homozygous Sox6 null mice at 15.5 dpc and 18.5 dpc is statistically equivalent to the level of βmaj/min expression in the livers of 15.5-dpc and 18.5-dpc homozygous WT mice (Figure 1).
T223 29344-29565 Sentence denotes The expression level of ɛy globin in homozygous Sox6 null mice at 15.5 dpc and 18.5 dpc is statistically equivalent to the level of βmaj/min expression in the livers of 15.5-dpc and 18.5-dpc homozygous WT mice (Figure 1).
T11175 29566-29672 Sentence denotes This demonstrates that ectopic expression of the ɛy globin gene is quite robust in homozygous mutant mice.
T224 29566-29672 Sentence denotes This demonstrates that ectopic expression of the ɛy globin gene is quite robust in homozygous mutant mice.
T11176 29673-29798 Sentence denotes The expression levels of two other embryonic globin genes (ζ and βh1) are also higher in p100H homozygotes, compared with WT.
T225 29673-29798 Sentence denotes The expression levels of two other embryonic globin genes (ζ and βh1) are also higher in p100H homozygotes, compared with WT.
T11177 29799-29879 Sentence denotes Like ɛy, levels of ζ and βh1 are dramatically higher in mutant mice at 15.5 dpc.
T226 29799-29879 Sentence denotes Like ɛy, levels of ζ and βh1 are dramatically higher in mutant mice at 15.5 dpc.
T11178 29880-30026 Sentence denotes However, unlike ɛy globin, ζ and βh1 decline in expression by day 18.5 dpc (Figure 1), suggesting that ɛy is regulated differently than ζ and βh1.
T227 29880-30026 Sentence denotes However, unlike ɛy globin, ζ and βh1 decline in expression by day 18.5 dpc (Figure 1), suggesting that ɛy is regulated differently than ζ and βh1.
T11179 30027-30175 Sentence denotes It is possible that Sox6 has a general effect on embryonic globin genes (and erythrocyte maturation) in addition to a specific role in silencing ɛy.
T228 30027-30175 Sentence denotes It is possible that Sox6 has a general effect on embryonic globin genes (and erythrocyte maturation) in addition to a specific role in silencing ɛy.
T11180 30176-30261 Sentence denotes Although most p100H mutant mice die just after being born, a rare few survive longer.
T229 30176-30261 Sentence denotes Although most p100H mutant mice die just after being born, a rare few survive longer.
T11181 30262-30328 Sentence denotes None have been observed to live longer than 2 wk after birth [14].
T230 30262-30328 Sentence denotes None have been observed to live longer than 2 wk after birth [14].
T11182 30329-30559 Sentence denotes We examined a single archived sample of liver RNA from a mutant mouse on postnatal day 13.5 for globin gene expression and detected high levels of ɛy globin in this RNA sample, compared with undetectable ɛy RNA in WT control mice.
T231 30329-30559 Sentence denotes We examined a single archived sample of liver RNA from a mutant mouse on postnatal day 13.5 for globin gene expression and detected high levels of ɛy globin in this RNA sample, compared with undetectable ɛy RNA in WT control mice.
T11183 30560-30829 Sentence denotes At this point in development, the levels of ζ and βh1 RNA were undetectable both in mutant and WT; however, adult β-like globin RNA levels were moderately elevated in the mutant RNA compared with WT (unpublished data), similar to what we observe at 18.5 dpc (Figure 1).
T232 30560-30829 Sentence denotes At this point in development, the levels of ζ and βh1 RNA were undetectable both in mutant and WT; however, adult β-like globin RNA levels were moderately elevated in the mutant RNA compared with WT (unpublished data), similar to what we observe at 18.5 dpc (Figure 1).
T11184 30830-30986 Sentence denotes These findings suggest that Sox6 continues to function postnatally to silence ɛy globin expression and has a unique function in the regulation of ɛy-globin.
T233 30830-30986 Sentence denotes These findings suggest that Sox6 continues to function postnatally to silence ɛy globin expression and has a unique function in the regulation of ɛy-globin.
T11185 30987-31083 Sentence denotes The mechanism by which Sox6 regulates the other embryonic globin genes remains to be elucidated.
T234 30987-31083 Sentence denotes The mechanism by which Sox6 regulates the other embryonic globin genes remains to be elucidated.
T11186 31084-31191 Sentence denotes Sox6 has other effects in erythropoiesis, including a delay in enucleation/maturation in p100H mutant mice.
T235 31084-31191 Sentence denotes Sox6 has other effects in erythropoiesis, including a delay in enucleation/maturation in p100H mutant mice.
T11187 31192-31320 Sentence denotes This may be the result of indirect effects, such as stress-induced proliferation (resulting from cardiac defects) and/or anemia.
T236 31192-31320 Sentence denotes This may be the result of indirect effects, such as stress-induced proliferation (resulting from cardiac defects) and/or anemia.
T11188 31321-31420 Sentence denotes Severe anemia can lead to rapid premature release of red cells, prior to their complete maturation.
T237 31321-31420 Sentence denotes Severe anemia can lead to rapid premature release of red cells, prior to their complete maturation.
T11189 31421-31616 Sentence denotes However, the hematocrit of 18.5-dpc mutant mice is only 20% lower than that of WT (unpublished data), and this mild anemia is probably not sufficient to explain the extent of nucleated red cells.
T238 31421-31616 Sentence denotes However, the hematocrit of 18.5-dpc mutant mice is only 20% lower than that of WT (unpublished data), and this mild anemia is probably not sufficient to explain the extent of nucleated red cells.
T11190 31617-31844 Sentence denotes Alternatively, Sox6 itself may play a role in red cell terminal differentiation, as it has been shown to be an important factor in cardiac [15], neuronal [10], astrocytic [11], and cartilage differentiation programs [32,41–44].
T239 31617-31844 Sentence denotes Alternatively, Sox6 itself may play a role in red cell terminal differentiation, as it has been shown to be an important factor in cardiac [15], neuronal [10], astrocytic [11], and cartilage differentiation programs [32,41–44].
T11191 31845-32125 Sentence denotes The restoration of normal enucleation of red cells in Sox6-deficient mouse by postnatal day 10.5 may result from functional compensation of other Sox proteins (expressed at later developmental stages), since functional redundancy is a recurring theme with Sox proteins [13,45,46].
T240 31845-32125 Sentence denotes The restoration of normal enucleation of red cells in Sox6-deficient mouse by postnatal day 10.5 may result from functional compensation of other Sox proteins (expressed at later developmental stages), since functional redundancy is a recurring theme with Sox proteins [13,45,46].
T11192 32126-32225 Sentence denotes Moreover, erythropoiesis has already shifted from fetal liver to bone marrow by postnatal day 10.5.
T241 32126-32225 Sentence denotes Moreover, erythropoiesis has already shifted from fetal liver to bone marrow by postnatal day 10.5.
T11193 32226-32327 Sentence denotes The accompanying change in the microenvironment of red cell production may permit normal enucleation.
T242 32226-32327 Sentence denotes The accompanying change in the microenvironment of red cell production may permit normal enucleation.
T11194 32328-32505 Sentence denotes Identification of Sox6 downstream target genes and its interacting proteins will shed light on the role of Sox6 in red cell terminal differentiation and the enucleation process.
T243 32328-32505 Sentence denotes Identification of Sox6 downstream target genes and its interacting proteins will shed light on the role of Sox6 in red cell terminal differentiation and the enucleation process.
T11195 32506-32769 Sentence denotes Recently, in vivo and in vitro analyses suggest that reactivation of human ɛ-globin would be therapeutically beneficial to adults with sickle cell disease [47], providing a rationale for detailed investigations into the molecular basis of ɛ-globin gene silencing.
T244 32506-32769 Sentence denotes Recently, in vivo and in vitro analyses suggest that reactivation of human ɛ-globin would be therapeutically beneficial to adults with sickle cell disease [47], providing a rationale for detailed investigations into the molecular basis of ɛ-globin gene silencing.
T11196 32770-32916 Sentence denotes The present study identifies a novel repressor, Sox6, which binds to the ɛy proximal promoter, potentially as part of a larger repression complex.
T245 32770-32916 Sentence denotes The present study identifies a novel repressor, Sox6, which binds to the ɛy proximal promoter, potentially as part of a larger repression complex.
T11197 32917-33092 Sentence denotes Because murine Sox6 and its human counterpart are 94% identical at the amino acid level [48], it is possible that human Sox6 may also be important in human ɛ globin silencing.
T246 32917-33092 Sentence denotes Because murine Sox6 and its human counterpart are 94% identical at the amino acid level [48], it is possible that human Sox6 may also be important in human ɛ globin silencing.
T11198 33093-33254 Sentence denotes There is significant sequence homology between the human and mouse ɛ promoter regions, and the human promoter contains at least two potential Sox6 binding sites.
T247 33093-33254 Sentence denotes There is significant sequence homology between the human and mouse ɛ promoter regions, and the human promoter contains at least two potential Sox6 binding sites.
T11199 33255-33344 Sentence denotes Indeed, the existence of a silencer of the human ɛ globin gene has been proposed [49,50].
T248 33255-33344 Sentence denotes Indeed, the existence of a silencer of the human ɛ globin gene has been proposed [49,50].
T11200 33345-33630 Sentence denotes Thus, elucidation of the Sox6 repression mechanism and identification of other components of the Sox6-containing complex may further our understanding of ɛ globin regulation and potentially reveal additional molecular targets for the treatment of sickle cell anemia and β thalassemias.
T249 33345-33630 Sentence denotes Thus, elucidation of the Sox6 repression mechanism and identification of other components of the Sox6-containing complex may further our understanding of ɛ globin regulation and potentially reveal additional molecular targets for the treatment of sickle cell anemia and β thalassemias.
T250 33632-33653 Sentence denotes Materials and Methods
T15995 33655-33676 Sentence denotes Plasmid construction.
T251 33655-33676 Sentence denotes Plasmid construction.
T15996 33677-33790 Sentence denotes The ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter.
T252 33677-33790 Sentence denotes The ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter.
T15997 33791-34064 Sentence denotes A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50].
T253 33791-34064 Sentence denotes A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50].
T15998 34065-34130 Sentence denotes Nucleotide numbering is relative to the transcription start site.
T254 34065-34130 Sentence denotes Nucleotide numbering is relative to the transcription start site.
T15999 34131-34247 Sentence denotes The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database.
T255 34131-34247 Sentence denotes The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database.
T16000 34248-34445 Sentence denotes The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States).
T256 34248-34445 Sentence denotes The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States).
T16001 34446-34678 Sentence denotes A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter.
T257 34446-34678 Sentence denotes A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter.
T16002 34679-34755 Sentence denotes A series of deletion constructs of the ɛy promoter were generated similarly.
T258 34679-34755 Sentence denotes A series of deletion constructs of the ɛy promoter were generated similarly.
T16003 34756-35149 Sentence denotes Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9).
T259 34756-35149 Sentence denotes Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9).
T16004 35150-35285 Sentence denotes All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20).
T260 35150-35285 Sentence denotes All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20).
T16005 35286-35334 Sentence denotes Sox6-pcDNA3.1 [15] was used to overexpress Sox6.
T261 35286-35334 Sentence denotes Sox6-pcDNA3.1 [15] was used to overexpress Sox6.
T16006 35335-35482 Sentence denotes A truncated version of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1) that lacks the HMG domain was generated, as described by others [32].
T262 35335-35482 Sentence denotes A truncated version of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1) that lacks the HMG domain was generated, as described by others [32].
T16007 35483-35567 Sentence denotes Mutagenesis of Sox/Sox6 consensus binding sites of the ɛy promoter were done by PCR.
T263 35483-35567 Sentence denotes Mutagenesis of Sox/Sox6 consensus binding sites of the ɛy promoter were done by PCR.
T16008 35568-35886 Sentence denotes Forward primers used to generate these mutagenized ɛy promoter reporter constructs include: MHB1661, 5′CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3′ (−63 to −19); MHB1662, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3′ (−63 to −16); and MHB1663, 5′CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA 3′ (−63 to −18).
T264 35568-35886 Sentence denotes Forward primers used to generate these mutagenized ɛy promoter reporter constructs include: MHB1661, 5′CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3′ (−63 to −19); MHB1662, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3′ (−63 to −16); and MHB1663, 5′CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA 3′ (−63 to −18).
T17142 35888-35916 Sentence denotes Quantitation of globin mRNA.
T265 35888-35916 Sentence denotes Quantitation of globin mRNA.
T17143 35917-35959 Sentence denotes RNA was first reverse transcribed to cDNA.
T266 35917-35959 Sentence denotes RNA was first reverse transcribed to cDNA.
T17144 35960-36046 Sentence denotes Primers for cDNA PCR amplification of globin genes were obtained from Primerbank [51].
T267 35960-36046 Sentence denotes Primers for cDNA PCR amplification of globin genes were obtained from Primerbank [51].
T17145 36047-36122 Sentence denotes All primers were searched against the NCBI database to confirm specificity.
T268 36047-36122 Sentence denotes All primers were searched against the NCBI database to confirm specificity.
T17146 36123-36213 Sentence denotes For ɛy globin: MHB1666, 5′TGGCCTGTGGAGTAAGGTCAA3′; and MHB1667, 5′GAAGCAGAGGACAAGTTCCCA3′.
T269 36123-36213 Sentence denotes For ɛy globin: MHB1666, 5′TGGCCTGTGGAGTAAGGTCAA3′; and MHB1667, 5′GAAGCAGAGGACAAGTTCCCA3′.
T17147 36214-36302 Sentence denotes For ζ globin: MHB1668, 5′CTACCCCCAGACGAAGACCTA3′; and MHB1669, 5′CTTAACCGCATCCCCTACGG3′.
T270 36214-36302 Sentence denotes For ζ globin: MHB1668, 5′CTACCCCCAGACGAAGACCTA3′; and MHB1669, 5′CTTAACCGCATCCCCTACGG3′.
T17148 36303-36392 Sentence denotes For βH1 globin: MHB1672, 5′TGGACAACCTCAAGGAGACC3′; and MHB1673, 5′ACCTCTGGGGTGAATTCCTT3′.
T271 36303-36392 Sentence denotes For βH1 globin: MHB1672, 5′TGGACAACCTCAAGGAGACC3′; and MHB1673, 5′ACCTCTGGGGTGAATTCCTT3′.
T17149 36393-36422 Sentence denotes For βmaj/min globin: MHB1674:
T272 36393-36422 Sentence denotes For βmaj/min globin: MHB1674:
T17150 36423-36487 Sentence denotes 5′ATGGCCTGAATCACTTGGAC3′; and MHB1675, 5′ACGATCATATTGCCCAGGAG3′.
T273 36423-36487 Sentence denotes 5′ATGGCCTGAATCACTTGGAC3′; and MHB1675, 5′ACGATCATATTGCCCAGGAG3′.
T17151 36488-36723 Sentence denotes Using the SYBR green supermix kit with ROX (Bio-Rad, Hercules, California, United States), PCR amplification was run on an ABI7000 (Applied Biosystems, Foster City, California, United States) at the University of Arizona core facility.
T274 36488-36723 Sentence denotes Using the SYBR green supermix kit with ROX (Bio-Rad, Hercules, California, United States), PCR amplification was run on an ABI7000 (Applied Biosystems, Foster City, California, United States) at the University of Arizona core facility.
T17152 36724-36799 Sentence denotes All PCR was performed in a 25-μl reaction with 12.5 μl SYBR green supermix.
T275 36724-36799 Sentence denotes All PCR was performed in a 25-μl reaction with 12.5 μl SYBR green supermix.
T17153 36800-36853 Sentence denotes GAPDH mRNA levels were used as control for input RNA.
T276 36800-36853 Sentence denotes GAPDH mRNA levels were used as control for input RNA.
T17154 36854-36938 Sentence denotes Standard curve analyses were performed to test the efficiency of the amplifications.
T277 36854-36938 Sentence denotes Standard curve analyses were performed to test the efficiency of the amplifications.
T17155 36939-36983 Sentence denotes Triplicates were done for each PCR reaction.
T278 36939-36983 Sentence denotes Triplicates were done for each PCR reaction.
T17156 36984-37165 Sentence denotes Relative quantitative values were calculated in the ABI Prism 7000 SDS Software (Applied Biosystems) and normalized to GAPDH in Microsoft Excel (Redmond, Washington, United States).
T279 36984-37165 Sentence denotes Relative quantitative values were calculated in the ABI Prism 7000 SDS Software (Applied Biosystems) and normalized to GAPDH in Microsoft Excel (Redmond, Washington, United States).
T17743 37167-37189 Sentence denotes In situ hybridization.
T280 37167-37189 Sentence denotes In situ hybridization.
T17744 37190-37332 Sentence denotes Antisense probes were designed to murine ɛy globin nucleotides 509–584; βmaj globin nucleotides 458–549; and mouse Sox6 nucleotides 1353–1927.
T281 37190-37332 Sentence denotes Antisense probes were designed to murine ɛy globin nucleotides 509–584; βmaj globin nucleotides 458–549; and mouse Sox6 nucleotides 1353–1927.
T17745 37333-37527 Sentence denotes Embryos were fixed overnight by immersion in 4% paraformaldehyde, embedded in paraffin, sectioned at 5 μm, and adhered to charge modified slides (VWR, West Chester, Pennsylvania, United States).
T282 37333-37527 Sentence denotes Embryos were fixed overnight by immersion in 4% paraformaldehyde, embedded in paraffin, sectioned at 5 μm, and adhered to charge modified slides (VWR, West Chester, Pennsylvania, United States).
T17746 37528-37649 Sentence denotes Slides were processed for in situ hybridization as described [52] using in vitro transcribed RNA probes labeled with 33P.
T283 37528-37649 Sentence denotes Slides were processed for in situ hybridization as described [52] using in vitro transcribed RNA probes labeled with 33P.
T17747 37650-37875 Sentence denotes Darkfield and brightfield images were obtained with a Nikon Optiphot microscope (Nikon, Melville, New York, United States) and SPOT RT-Slider digital camera (Diagnostic Instruments, Sterling Heights, Michigan, United States).
T284 37650-37875 Sentence denotes Darkfield and brightfield images were obtained with a Nikon Optiphot microscope (Nikon, Melville, New York, United States) and SPOT RT-Slider digital camera (Diagnostic Instruments, Sterling Heights, Michigan, United States).
T17748 37876-37931 Sentence denotes Objectives used were 1× (NA = 0.04) and 10× (NA = 0.5).
T285 37876-37931 Sentence denotes Objectives used were 1× (NA = 0.04) and 10× (NA = 0.5).
T17749 37932-38138 Sentence denotes Images were processed, pseudocolored, and combined using Photoshop (Adobe, San Jose, California, United States) software with Fovea Pro (Reindeer Graphics, Asheville, North Carolina, United States) plugins.
T286 37932-38138 Sentence denotes Images were processed, pseudocolored, and combined using Photoshop (Adobe, San Jose, California, United States) software with Fovea Pro (Reindeer Graphics, Asheville, North Carolina, United States) plugins.
T17750 38139-38169 Sentence denotes Original images are available.
T287 38139-38169 Sentence denotes Original images are available.
T18176 38171-38181 Sentence denotes Histology.
T288 38171-38181 Sentence denotes Histology.
T18177 38182-38289 Sentence denotes 18.5-dpc embryos were exsanguinated and peripheral blood smears were prepared from both mutant and WT mice.
T289 38182-38289 Sentence denotes 18.5-dpc embryos were exsanguinated and peripheral blood smears were prepared from both mutant and WT mice.
T18178 38290-38337 Sentence denotes The slides were Wright-stained and read by DAF.
T290 38290-38337 Sentence denotes The slides were Wright-stained and read by DAF.
T18179 38338-38529 Sentence denotes For whole mount analysis, 14.5-dpc WT and mutant embryos, and postnatal day–10.5 mice were fixed in 10% formalin, paraffin-embedded, sectioned at 5 μm, and stained with hematoxylin and eosin.
T291 38338-38529 Sentence denotes For whole mount analysis, 14.5-dpc WT and mutant embryos, and postnatal day–10.5 mice were fixed in 10% formalin, paraffin-embedded, sectioned at 5 μm, and stained with hematoxylin and eosin.
T18180 38530-38605 Sentence denotes Liver samples (at 14.5 dpc and 18.5 dpc) were prepared in a similar manner.
T292 38530-38605 Sentence denotes Liver samples (at 14.5 dpc and 18.5 dpc) were prepared in a similar manner.
T18181 38606-38660 Sentence denotes Images were obtained with Nikon Labophot-2 microscope.
T293 38606-38660 Sentence denotes Images were obtained with Nikon Labophot-2 microscope.
T18182 38661-38781 Sentence denotes Objectives used were E Plan 40/0.65 160/0.17 Nikon (40× objective), E Plan 100/1.25 oil 160/0.17 Nikon (100× objective).
T294 38661-38781 Sentence denotes Objectives used were E Plan 40/0.65 160/0.17 Nikon (40× objective), E Plan 100/1.25 oil 160/0.17 Nikon (100× objective).
T18183 38782-38818 Sentence denotes The camera was a Nikon Coolpix 4300.
T295 38782-38818 Sentence denotes The camera was a Nikon Coolpix 4300.
T18184 38819-38849 Sentence denotes Original images are available.
T296 38819-38849 Sentence denotes Original images are available.
T18452 38851-38865 Sentence denotes Northern blot.
T297 38851-38865 Sentence denotes Northern blot.
T18453 38866-39169 Sentence denotes A mouse embryonic tissue Northern blot filter (Seegene, Rockville, Maryland, United States) was hybridized with a Sox6 probe generated by RT-PCR (nucleotides 1353–1927) and labeled with [α-32P]dCTP, by random primer labeling (RediprimeII; Amersham Biosciences, Buckinghamshire, England, United Kingdom).
T298 38866-39169 Sentence denotes A mouse embryonic tissue Northern blot filter (Seegene, Rockville, Maryland, United States) was hybridized with a Sox6 probe generated by RT-PCR (nucleotides 1353–1927) and labeled with [α-32P]dCTP, by random primer labeling (RediprimeII; Amersham Biosciences, Buckinghamshire, England, United Kingdom).
T18454 39170-39254 Sentence denotes The hybridization was performed in phosphate buffered 7% SDS hybridization solution.
T299 39170-39254 Sentence denotes The hybridization was performed in phosphate buffered 7% SDS hybridization solution.
T18455 39255-39398 Sentence denotes Blots were washed with 0.2× SSC, 1% SDS at 60 °C prior to exposure to X-ray film (Kodak, Rochester, New York, United States) at −80 °C for 6 d.
T300 39255-39398 Sentence denotes Blots were washed with 0.2× SSC, 1% SDS at 60 °C prior to exposure to X-ray film (Kodak, Rochester, New York, United States) at −80 °C for 6 d.
T18704 39400-39430 Sentence denotes Cell culture and transfection.
T301 39400-39430 Sentence denotes Cell culture and transfection.
T18705 39431-39736 Sentence denotes GM979 cells (Coriell Cell Repositories, Camden, New Jersey, United States) were cultured in Ham's F12 with 2 mM L-glutamine supplemented with heat-inactivated 10% fetal calf serum (Ivitrogen, Carlsbad, California, United States), penicillin (100 units/ml), streptomycin 100 μg/ml), and L-glutamine (2 mM).
T302 39431-39736 Sentence denotes GM979 cells (Coriell Cell Repositories, Camden, New Jersey, United States) were cultured in Ham's F12 with 2 mM L-glutamine supplemented with heat-inactivated 10% fetal calf serum (Ivitrogen, Carlsbad, California, United States), penicillin (100 units/ml), streptomycin 100 μg/ml), and L-glutamine (2 mM).
T18706 39737-39829 Sentence denotes MEL cells were cultured in DMEM supplemented as above (without heat inactivating the serum).
T303 39737-39829 Sentence denotes MEL cells were cultured in DMEM supplemented as above (without heat inactivating the serum).
T18707 39830-39963 Sentence denotes GM979 cells (4 × 105) in log phase of growth were transfected with plasmids by FuGENE6 (Roche, Indianapolis, Indiana, United States).
T304 39830-39963 Sentence denotes GM979 cells (4 × 105) in log phase of growth were transfected with plasmids by FuGENE6 (Roche, Indianapolis, Indiana, United States).
T18708 39964-40104 Sentence denotes Cells were transfected with ɛy promoter reporter constructs (500 ng) along with either empty vector or Sox6 overexpression vector (1000 ng).
T305 39964-40104 Sentence denotes Cells were transfected with ɛy promoter reporter constructs (500 ng) along with either empty vector or Sox6 overexpression vector (1000 ng).
T18709 40105-40244 Sentence denotes In assays of dosage effect, we used 200 ng, 500 ng, and 1000 ng). pRL-CMV 15ng (Promega) was used as a control for transfection efficiency.
T306 40105-40244 Sentence denotes In assays of dosage effect, we used 200 ng, 500 ng, and 1000 ng). pRL-CMV 15ng (Promega) was used as a control for transfection efficiency.
T19119 40246-40303 Sentence denotes Nuclear protein extract and in vitro translation of Sox6.
T307 40246-40303 Sentence denotes Nuclear protein extract and in vitro translation of Sox6.
T19120 40304-40424 Sentence denotes Nuclear extracts were prepared from MEL cells (2 × 107) using a kit (Active Motif, Carlsbad, California, United States).
T308 40304-40424 Sentence denotes Nuclear extracts were prepared from MEL cells (2 × 107) using a kit (Active Motif, Carlsbad, California, United States).
T19121 40425-40526 Sentence denotes The Sox6 in vitro translation expression vector, tagged with c-Myc and HA, was described before [15].
T309 40425-40526 Sentence denotes The Sox6 in vitro translation expression vector, tagged with c-Myc and HA, was described before [15].
T19122 40527-40682 Sentence denotes The translation was performed in a reticulocyte lysate based in vitro translational system (TNT® Quick Coupled Transcription/Translation Systems, Promega).
T310 40527-40682 Sentence denotes The translation was performed in a reticulocyte lysate based in vitro translational system (TNT® Quick Coupled Transcription/Translation Systems, Promega).
T19123 40683-40767 Sentence denotes A vector without the Sox6 coding sequence was also translated as a negative control.
T311 40683-40767 Sentence denotes A vector without the Sox6 coding sequence was also translated as a negative control.
T19402 40769-40780 Sentence denotes Antibodies.
T312 40769-40780 Sentence denotes Antibodies.
T19403 40781-41016 Sentence denotes Sox6 antibodies used in this study were either kindly provided by Dr. Enzo Lalli (Université Louis Pasteur, France [7]) or commercially obtained (Catalog No. sc-17332 X, Santa Cruz Biotechnology, Santa Cruz, California, United States).
T313 40781-41016 Sentence denotes Sox6 antibodies used in this study were either kindly provided by Dr. Enzo Lalli (Université Louis Pasteur, France [7]) or commercially obtained (Catalog No. sc-17332 X, Santa Cruz Biotechnology, Santa Cruz, California, United States).
T314 41017-41109 Sentence denotes All Sox6 antibodies generated similar results. c-Myc antibody was purchased from Invitrogen.
T19404 41017-41216 Sentence denotes All Sox6 antibodies generated similar results. c-Myc antibody was purchased from Invitrogen. Normal rabbit IgG antibody was obtained from Upstate Biotechnology (Lake Placid, New York, United States).
T315 41110-41216 Sentence denotes Normal rabbit IgG antibody was obtained from Upstate Biotechnology (Lake Placid, New York, United States).
T19648 41218-41223 Sentence denotes EMSA.
T316 41218-41223 Sentence denotes EMSA.
T19649 41224-41348 Sentence denotes Single-stranded complementary oligonucleotides were annealed and end-labeled with [γ-32P] ATP with T4 polynucleotide kinase.
T317 41224-41348 Sentence denotes Single-stranded complementary oligonucleotides were annealed and end-labeled with [γ-32P] ATP with T4 polynucleotide kinase.
T19650 41349-41502 Sentence denotes EMSA was performed with 5 μg of nuclear proteins from MEL cells or 3 μl of in vitro-translated Sox6 along with the reticulocyte lysate in binding buffer:
T318 41349-41502 Sentence denotes EMSA was performed with 5 μg of nuclear proteins from MEL cells or 3 μl of in vitro-translated Sox6 along with the reticulocyte lysate in binding buffer:
T19651 41503-41643 Sentence denotes 100 mM NaCl, 10% glycerol, 200 ng/μl BSA, 50 ng/μl poly (dI-dC) or poly (dG-dC), 10 mM HEPES (pH 7), 0.1 mM EDTA, 0.25 mM DTT, 0.6 mM MgCl2.
T319 41503-41643 Sentence denotes 100 mM NaCl, 10% glycerol, 200 ng/μl BSA, 50 ng/μl poly (dI-dC) or poly (dG-dC), 10 mM HEPES (pH 7), 0.1 mM EDTA, 0.25 mM DTT, 0.6 mM MgCl2.
T19652 41644-41844 Sentence denotes For competition or supershift assays, the indicated unlabelled oligonucleotide competitor (200-fold molar excess) or antibody (3 μl) was added 30 min to 60 min prior to addition of radiolabeled probe.
T320 41644-41844 Sentence denotes For competition or supershift assays, the indicated unlabelled oligonucleotide competitor (200-fold molar excess) or antibody (3 μl) was added 30 min to 60 min prior to addition of radiolabeled probe.
T19653 41845-42009 Sentence denotes Following addition of the radiolabeled probe, the samples were incubated for 30 min or 60 min at room temperature and loaded on a 4% or 6% (w/v) polyacrylamide gel.
T321 41845-42009 Sentence denotes Following addition of the radiolabeled probe, the samples were incubated for 30 min or 60 min at room temperature and loaded on a 4% or 6% (w/v) polyacrylamide gel.
T19654 42010-42142 Sentence denotes Electrophoresis was performed at a constant 19 mAmp for 4–8 h at room temperature, and the gels were dried prior to autoradiography.
T322 42010-42142 Sentence denotes Electrophoresis was performed at a constant 19 mAmp for 4–8 h at room temperature, and the gels were dried prior to autoradiography.
T19655 42143-42244 Sentence denotes Antibodies used for supershift analyses included c-Myc, HA, and Sox6 antibodies (described as above).
T323 42143-42244 Sentence denotes Antibodies used for supershift analyses included c-Myc, HA, and Sox6 antibodies (described as above).
T19656 42245-42335 Sentence denotes The DNA sequences of the oligonucleotides are as follows (only forward oligos are listed):
T324 42245-42335 Sentence denotes The DNA sequences of the oligonucleotides are as follows (only forward oligos are listed):
T19657 42336-42359 Sentence denotes For the 36-bp WT probe:
T325 42336-42359 Sentence denotes For the 36-bp WT probe:
T19658 42360-42436 Sentence denotes 5′AATGCAGAACAAAGGGTCAGAACATTGTCTGCGAAG3′ (MHB1556); for mutant probe 1 (M1):
T326 42360-42436 Sentence denotes 5′AATGCAGAACAAAGGGTCAGAACATTGTCTGCGAAG3′ (MHB1556); for mutant probe 1 (M1):
T19659 42437-42506 Sentence denotes 5′AACAAAGGGTCAGAACATTGTCTGCGAAG3′ (MHB1644); for mutant probe 2 (M2):
T327 42437-42506 Sentence denotes 5′AACAAAGGGTCAGAACATTGTCTGCGAAG3′ (MHB1644); for mutant probe 2 (M2):
T19660 42507-42583 Sentence denotes 5′AATGCAGAACAAAGGGTCAGAtgagTGTCTGCGAAG3′ (MHB1648); for mutant probe 3 (M3):
T328 42507-42583 Sentence denotes 5′AATGCAGAACAAAGGGTCAGAtgagTGTCTGCGAAG3′ (MHB1648); for mutant probe 3 (M3):
T19661 42584-42635 Sentence denotes 5′AATGCAGtgccAAGGGTCAGAACATTGTCTGCGAAG3′ (MHB1650).
T329 42584-42635 Sentence denotes 5′AATGCAGtgccAAGGGTCAGAACATTGTCTGCGAAG3′ (MHB1650).
T20341 42637-42648 Sentence denotes ChIP assay.
T330 42637-42648 Sentence denotes ChIP assay.
T20342 42649-42688 Sentence denotes As described by Nouzova [53], in brief:
T331 42649-42688 Sentence denotes As described by Nouzova [53], in brief:
T20343 42689-43058 Sentence denotes Cells from MEL cells (4 × 107) or fetal liver cells from three 15.5-dpc WT mice were treated with 1% formaldehyde for 10 min at 37 °C, rinsed in ice-cold 1× Hanks' balanced salt solution with 0.1% EDTA containing protease inhibitors, collected by centrifugation at 4 °C, resuspended in a SDS lysis buffer containing protease inhibitors, and incubated on ice for 10 min.
T332 42689-43058 Sentence denotes Cells from MEL cells (4 × 107) or fetal liver cells from three 15.5-dpc WT mice were treated with 1% formaldehyde for 10 min at 37 °C, rinsed in ice-cold 1× Hanks' balanced salt solution with 0.1% EDTA containing protease inhibitors, collected by centrifugation at 4 °C, resuspended in a SDS lysis buffer containing protease inhibitors, and incubated on ice for 10 min.
T20344 43059-43114 Sentence denotes DNA-protein complexes were sonicated to 200 and 600 bp.
T333 43059-43114 Sentence denotes DNA-protein complexes were sonicated to 200 and 600 bp.
T20345 43115-43299 Sentence denotes One-tenth of the sample was set aside for input control, and the remaining sample was precleared with protein A-Sepharose (Amersham Biosciences, Piscataway, New Jersey, United States).
T334 43115-43299 Sentence denotes One-tenth of the sample was set aside for input control, and the remaining sample was precleared with protein A-Sepharose (Amersham Biosciences, Piscataway, New Jersey, United States).
T335 43300-43467 Sentence denotes Following preclearing, the samples were split into thirds: one sample treated with anti-Sox6, a second treated with normal rabbit IgG, and the third sample without Ab.
T20346 43300-43512 Sentence denotes Following preclearing, the samples were split into thirds: one sample treated with anti-Sox6, a second treated with normal rabbit IgG, and the third sample without Ab. The last two were used as negative controls.
T336 43468-43512 Sentence denotes The last two were used as negative controls.
T20347 43513-43636 Sentence denotes The chromatin-antibody complexes were eluted, and the DNA protein cross-links were reversed with 5 M NaCl at 65 °C for 4 h.
T337 43513-43636 Sentence denotes The chromatin-antibody complexes were eluted, and the DNA protein cross-links were reversed with 5 M NaCl at 65 °C for 4 h.
T20348 43637-43716 Sentence denotes Input DNA or immunoprecipitated DNA was used as a template in the PCR reaction.
T338 43637-43716 Sentence denotes Input DNA or immunoprecipitated DNA was used as a template in the PCR reaction.
T20349 43717-43942 Sentence denotes PCR amplification of the ɛy promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides −31 to +140 of the ɛy promoter (primers MHB1688, 5′CGAAGAATAAAAGGCCACCA3′; and MHB1689, 5′GCTTCACCACCAACCTCTTC3′).
T339 43717-43942 Sentence denotes PCR amplification of the ɛy promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides −31 to +140 of the ɛy promoter (primers MHB1688, 5′CGAAGAATAAAAGGCCACCA3′; and MHB1689, 5′GCTTCACCACCAACCTCTTC3′).
T20350 43943-43992 Sentence denotes PCR was performed under the following conditions:
T340 43943-43992 Sentence denotes PCR was performed under the following conditions:
T20351 43993-44136 Sentence denotes 95 °C for 15 min followed by 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 45 s, ending with a final extension at 72 °C for 5 min.
T341 43993-44136 Sentence denotes 95 °C for 15 min followed by 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 45 s, ending with a final extension at 72 °C for 5 min.
T342 44138-44160 Sentence denotes Supporting Information
T343 44162-44179 Sentence denotes Accession Numbers
T344 44180-44537 Sentence denotes Accession numbers for the genes and gene products discussed in this paper are βH1 globin (GenBank NM_008219), βmaj globin (J00413) (in situ), βmaj/min globin (NM_008220) (real time PCR), ɛy globin cDNA (NM_008221) from the Fantom (Functional Annotation of Mouse) database (http://fantom2.gsc.riken.jp), ζ globin (GenBank NM_010405), and mouse Sox6 (U32614).