craft-sa-dev Home  

PMC:88885 / 15550-16260 JSONTXT 4 Projects

Annnotations TAB TSV DIC JSON TextAE

Id Subject Object Predicate Lexical cue
T4011 0-8 NNP denotes Northern
T4012 9-13 NN denotes Blot
T4013 14-22 NN denotes Analysis
T4014 22-178 sentence denotes Mouse embryo multiple-tissue northern blot and mouse adult multiple-tissue northern blot filters were purchased from Clontech Laboratories (Palo Alto, CA).
T4015 23-28 NN denotes Mouse
T4017 29-35 NN denotes embryo
T4018 36-44 JJ denotes multiple
T4019 44-45 HYPH denotes -
T4016 45-51 NN denotes tissue
T4021 52-60 JJ denotes northern
T4020 61-65 NN denotes blot
T4023 66-69 CC denotes and
T4024 70-75 NN denotes mouse
T4026 76-81 JJ denotes adult
T4027 82-90 JJ denotes multiple
T4028 90-91 HYPH denotes -
T4025 91-97 NN denotes tissue
T4030 98-106 JJ denotes northern
T4029 107-111 NN denotes blot
T4022 112-119 NNS denotes filters
T4032 120-124 VBD denotes were
T4031 125-134 VBN denotes purchased
T4033 135-139 IN denotes from
T4034 140-148 NNP denotes Clontech
T4035 149-161 NNP denotes Laboratories
T4036 162-163 -LRB- denotes (
T4038 163-167 NNP denotes Palo
T4037 168-172 NNP denotes Alto
T4039 172-174 , denotes ,
T4040 174-176 NNP denotes CA
T4041 176-177 -RRB- denotes )
T4042 177-178 . denotes .
T4043 178-306 sentence denotes The filters were hybridized with the 32P-dATP labeled DNA fragment of Mcoln1 coding region corresponding to exon 2 (see above).
T4044 179-182 DT denotes The
T4045 183-190 NNS denotes filters
T4047 191-195 VBD denotes were
T4046 196-206 VBN denotes hybridized
T4048 207-211 IN denotes with
T4049 212-215 DT denotes the
T4051 216-219 NN denotes 32P
T4053 219-220 HYPH denotes -
T4052 220-224 NN denotes dATP
T4054 225-232 JJ denotes labeled
T4055 233-236 NN denotes DNA
T4050 237-245 NN denotes fragment
T4056 246-248 IN denotes of
T4057 249-255 NN denotes Mcoln1
T4059 256-262 NN denotes coding
T4058 263-269 NN denotes region
T4060 270-283 VBG denotes corresponding
T4061 284-286 IN denotes to
T4062 287-291 NN denotes exon
T4063 292-293 CD denotes 2
T4064 294-295 -LRB- denotes (
T4065 295-298 VB denotes see
T4066 299-304 RB denotes above
T4067 304-305 -RRB- denotes )
T4068 305-306 . denotes .
T4069 306-526 sentence denotes For the alternative transcript, a probe was generated in the region between exons 12 and 13 with primers 5'-GTGTCCACCACCTGAGAG-3' (forward) and 5'-GAAGTAGCATTCCTGCAGGC-3' (reverse) with an annealing temperature of 62°C.
T4070 307-310 IN denotes For
T4072 311-314 DT denotes the
T4074 315-326 JJ denotes alternative
T4073 327-337 NN denotes transcript
T4075 337-339 , denotes ,
T4076 339-340 DT denotes a
T4077 341-346 NN denotes probe
T4078 347-350 VBD denotes was
T4071 351-360 VBN denotes generated
T4079 361-363 IN denotes in
T4080 364-367 DT denotes the
T4081 368-374 NN denotes region
T4082 375-382 IN denotes between
T4083 383-388 NNS denotes exons
T4084 389-391 CD denotes 12
T4085 392-395 CC denotes and
T4086 396-398 CD denotes 13
T4087 399-403 IN denotes with
T4088 404-411 NNS denotes primers
T4090 412-413 NN denotes 5
T4091 413-414 SYM denotes '
T4092 414-415 HYPH denotes -
T4093 415-433 NN denotes GTGTCCACCACCTGAGAG
T4094 433-434 HYPH denotes -
T4089 434-435 NN denotes 3
T4095 435-436 SYM denotes '
T4096 437-438 -LRB- denotes (
T4097 438-445 RB denotes forward
T4098 445-446 -RRB- denotes )
T4099 447-450 CC denotes and
T4100 451-452 NN denotes 5
T4102 452-453 SYM denotes '
T4103 453-454 HYPH denotes -
T4104 454-474 NN denotes GAAGTAGCATTCCTGCAGGC
T4105 474-475 HYPH denotes -
T4101 475-476 NN denotes 3
T4106 476-477 SYM denotes '
T4107 478-479 -LRB- denotes (
T4108 479-486 RB denotes reverse
T4109 486-487 -RRB- denotes )
T4110 488-492 IN denotes with
T4111 493-495 DT denotes an
T4113 496-505 JJ denotes annealing
T4112 506-517 NN denotes temperature
T4114 518-520 IN denotes of
T4115 521-523 CD denotes 62
T4116 523-525 NNS denotes °C
T4117 525-526 . denotes .
T4118 526-580 sentence denotes The filters were then hybridized with β-actin probes.
T4119 527-530 DT denotes The
T4120 531-538 NNS denotes filters
T4122 539-543 VBD denotes were
T4123 544-548 RB denotes then
T4121 549-559 VBN denotes hybridized
T4124 560-564 IN denotes with
T4125 565-566 NN denotes β
T4127 566-567 HYPH denotes -
T4126 567-572 NN denotes actin
T4128 573-579 NNS denotes probes
T4129 579-580 . denotes .
T4130 580-710 sentence denotes Hybridizations and washes were carried out in standard conditions, with the stripping of previously bound probes in between [16].
T4131 581-595 NNS denotes Hybridizations
T4133 596-599 CC denotes and
T4134 600-606 NNS denotes washes
T4135 607-611 VBD denotes were
T4132 612-619 VBN denotes carried
T4136 620-623 RP denotes out
T4137 624-626 IN denotes in
T4138 627-635 JJ denotes standard
T4139 636-646 NNS denotes conditions
T4140 646-648 , denotes ,
T4141 648-652 IN denotes with
T4142 653-656 DT denotes the
T4143 657-666 NN denotes stripping
T4144 667-669 IN denotes of
T4145 670-680 RB denotes previously
T4146 681-686 VBN denotes bound
T4147 687-693 NNS denotes probes
T4148 694-696 RB denotes in
T4149 697-704 RB denotes between
T4150 705-706 -LRB- denotes [
T4151 706-708 CD denotes 16
T4152 708-709 -RRB- denotes ]
T4153 709-710 . denotes .
R2479 T4011 T4012 compound Northern,Blot
R2480 T4012 T4013 compound Blot,Analysis
R2481 T4015 T4016 nmod Mouse,tissue
R2482 T4016 T4020 nmod tissue,blot
R2483 T4017 T4016 nmod embryo,tissue
R2484 T4018 T4016 amod multiple,tissue
R2485 T4019 T4016 punct -,tissue
R2486 T4020 T4022 nmod blot,filters
R2487 T4021 T4020 amod northern,blot
R2488 T4022 T4031 nsubjpass filters,purchased
R2489 T4023 T4020 cc and,blot
R2490 T4024 T4025 nmod mouse,tissue
R2491 T4025 T4029 nmod tissue,blot
R2492 T4026 T4025 amod adult,tissue
R2493 T4027 T4025 amod multiple,tissue
R2494 T4028 T4025 punct -,tissue
R2495 T4029 T4020 conj blot,blot
R2496 T4030 T4029 amod northern,blot
R2497 T4032 T4031 auxpass were,purchased
R2498 T4033 T4031 prep from,purchased
R2499 T4034 T4035 compound Clontech,Laboratories
R2500 T4035 T4033 pobj Laboratories,from
R2501 T4036 T4037 punct (,Alto
R2502 T4037 T4035 parataxis Alto,Laboratories
R2503 T4038 T4037 compound Palo,Alto
R2504 T4039 T4037 punct ", ",Alto
R2505 T4040 T4037 npadvmod CA,Alto
R2506 T4041 T4037 punct ),Alto
R2507 T4042 T4031 punct .,purchased
R2508 T4044 T4045 det The,filters
R2509 T4045 T4046 nsubjpass filters,hybridized
R2510 T4047 T4046 auxpass were,hybridized
R2511 T4048 T4046 prep with,hybridized
R2512 T4049 T4050 det the,fragment
R2513 T4050 T4048 pobj fragment,with
R2514 T4051 T4052 compound 32P,dATP
R2515 T4052 T4054 npadvmod dATP,labeled
R2516 T4053 T4052 punct -,dATP
R2517 T4054 T4050 amod labeled,fragment
R2518 T4055 T4050 compound DNA,fragment
R2519 T4056 T4050 prep of,fragment
R2520 T4057 T4058 compound Mcoln1,region
R2521 T4058 T4056 pobj region,of
R2522 T4059 T4058 compound coding,region
R2523 T4060 T4058 acl corresponding,region
R2524 T4061 T4060 prep to,corresponding
R2525 T4062 T4061 pobj exon,to
R2526 T4063 T4062 nummod 2,exon
R2527 T4064 T4065 punct (,see
R2528 T4065 T4046 parataxis see,hybridized
R2529 T4066 T4065 advmod above,see
R2530 T4067 T4065 punct ),see
R2531 T4068 T4046 punct .,hybridized
R2532 T4070 T4071 prep For,generated
R2533 T4072 T4073 det the,transcript
R2534 T4073 T4070 pobj transcript,For
R2535 T4074 T4073 amod alternative,transcript
R2536 T4075 T4071 punct ", ",generated
R2537 T4076 T4077 det a,probe
R2538 T4077 T4071 nsubjpass probe,generated
R2539 T4078 T4071 auxpass was,generated
R2540 T4079 T4071 prep in,generated
R2541 T4080 T4081 det the,region
R2542 T4081 T4079 pobj region,in
R2543 T4082 T4081 prep between,region
R2544 T4083 T4084 nmod exons,12
R2545 T4084 T4082 pobj 12,between
R2546 T4085 T4084 cc and,12
R2547 T4086 T4084 conj 13,12
R2548 T4087 T4071 prep with,generated
R2549 T4088 T4089 nmod primers,3
R2550 T4089 T4087 pobj 3,with
R2551 T4090 T4089 nmod 5,3
R2552 T4091 T4090 punct ',5
R2553 T4092 T4089 punct -,3
R2554 T4093 T4089 compound GTGTCCACCACCTGAGAG,3
R2555 T4094 T4089 punct -,3
R2556 T4095 T4089 punct ',3
R2557 T4096 T4097 punct (,forward
R2558 T4097 T4089 parataxis forward,3
R2559 T4098 T4097 punct ),forward
R2560 T4099 T4089 cc and,3
R2561 T4100 T4101 nmod 5,3
R2562 T4101 T4089 conj 3,3
R2563 T4102 T4100 punct ',5
R2564 T4103 T4101 punct -,3
R2565 T4104 T4101 compound GAAGTAGCATTCCTGCAGGC,3
R2566 T4105 T4101 punct -,3
R2567 T4106 T4101 punct ',3
R2568 T4107 T4108 punct (,reverse
R2569 T4108 T4101 parataxis reverse,3
R2570 T4109 T4108 punct ),reverse
R2571 T4110 T4071 prep with,generated
R2572 T4111 T4112 det an,temperature
R2573 T4112 T4110 pobj temperature,with
R2574 T4113 T4112 amod annealing,temperature
R2575 T4114 T4112 prep of,temperature
R2576 T4115 T4116 nummod 62,°C
R2577 T4116 T4114 pobj °C,of
R2578 T4117 T4071 punct .,generated
R2579 T4119 T4120 det The,filters
R2580 T4120 T4121 nsubjpass filters,hybridized
R2581 T4122 T4121 auxpass were,hybridized
R2582 T4123 T4121 advmod then,hybridized
R2583 T4124 T4121 prep with,hybridized
R2584 T4125 T4126 compound β,actin
R2585 T4126 T4128 compound actin,probes
R2586 T4127 T4126 punct -,actin
R2587 T4128 T4124 pobj probes,with
R2588 T4129 T4121 punct .,hybridized
R2589 T4131 T4132 nsubjpass Hybridizations,carried
R2590 T4133 T4131 cc and,Hybridizations
R2591 T4134 T4131 conj washes,Hybridizations
R2592 T4135 T4132 auxpass were,carried
R2593 T4136 T4132 prt out,carried
R2594 T4137 T4132 prep in,carried
R2595 T4138 T4139 amod standard,conditions
R2596 T4139 T4137 pobj conditions,in
R2597 T4140 T4132 punct ", ",carried
R2598 T4141 T4132 prep with,carried
R2599 T4142 T4143 det the,stripping
R2600 T4143 T4141 pobj stripping,with
R2601 T4144 T4143 prep of,stripping
R2602 T4145 T4146 advmod previously,bound
R2603 T4146 T4147 amod bound,probes
R2604 T4147 T4144 pobj probes,of
R2605 T4148 T4149 advmod in,between
R2606 T4149 T4143 advmod between,stripping
R2607 T4150 T4151 punct [,16
R2608 T4151 T4132 parataxis 16,carried
R2609 T4152 T4151 punct ],16
R2610 T4153 T4132 punct .,carried