| Id |
Subject |
Object |
Predicate |
Lexical cue |
| T12021 |
23-31 |
NNS |
denotes |
Reagents |
| T12022 |
31-1122 |
sentence |
denotes |
Primary antibodies used were against: E-cadherin (M. Takeichi, Kyoto University, Japan); α-catenin, β-catenin, pMAPK, tubulin (Sigma, St. Louis, Missouri, United States), Ajuba (G. Longmore, Washington University, St. Louis, Missouri, United States); β4 integrin/CD104 (BD Pharmingen, San Diego, California, United States), laminin 5 (R. Burgeson, Harvard University, Cambridge, Massachusetts, United States), K5, K1, loricrin (Fuchs Lab), involucrin, fillagrin (Covance, Berkeley, California, United States), MAPK, pSMAD2 (Cell Signaling, Beverly, Massachusetts, United States); Grb-2 (Santa Cruz Biotech, Santa Cruz, California, United States); P-cadherin (Zymed Laboratories, South San Francisco, California, United States); HA (Roche Biochemicals), vimentin (Chemicon, Temecula, California, United States), Ki67 (Novo Castra, Newcastle Upon Tyne, United Kingdom), keratin 6 (P. Coulombe, John Hopkins University, Baltimore, Maryland, United States), cyclin D (Oncogene, San Diego, California, United States), and TGF-β2 (L. Gold, New York University, New York, New York, United States). |
| T12023 |
32-39 |
JJ |
denotes |
Primary |
| T12024 |
40-50 |
NNS |
denotes |
antibodies |
| T12026 |
51-55 |
VBN |
denotes |
used |
| T12025 |
56-60 |
VBD |
denotes |
were |
| T12027 |
61-68 |
IN |
denotes |
against |
| T12028 |
68-70 |
: |
denotes |
: |
| T12029 |
70-71 |
NN |
denotes |
E |
| T12031 |
71-72 |
HYPH |
denotes |
- |
| T12030 |
72-80 |
NN |
denotes |
cadherin |
| T12032 |
81-82 |
-LRB- |
denotes |
( |
| T12034 |
82-84 |
NNP |
denotes |
M. |
| T12033 |
85-93 |
NNP |
denotes |
Takeichi |
| T12035 |
93-95 |
, |
denotes |
, |
| T12036 |
95-100 |
NNP |
denotes |
Kyoto |
| T12037 |
101-111 |
NNP |
denotes |
University |
| T12038 |
111-113 |
, |
denotes |
, |
| T12039 |
113-118 |
NNP |
denotes |
Japan |
| T12040 |
118-119 |
-RRB- |
denotes |
) |
| T12041 |
119-120 |
: |
denotes |
; |
| T12042 |
121-122 |
NN |
denotes |
α |
| T12044 |
122-123 |
HYPH |
denotes |
- |
| T12043 |
123-130 |
NN |
denotes |
catenin |
| T12045 |
130-132 |
, |
denotes |
, |
| T12046 |
132-133 |
NN |
denotes |
β |
| T12048 |
133-134 |
HYPH |
denotes |
- |
| T12047 |
134-141 |
NN |
denotes |
catenin |
| T12049 |
141-143 |
, |
denotes |
, |
| T12050 |
143-148 |
NN |
denotes |
pMAPK |
| T12051 |
148-150 |
, |
denotes |
, |
| T12052 |
150-157 |
NN |
denotes |
tubulin |
| T12053 |
158-159 |
-LRB- |
denotes |
( |
| T12054 |
159-164 |
NNP |
denotes |
Sigma |
| T12055 |
164-166 |
, |
denotes |
, |
| T12056 |
166-169 |
NNP |
denotes |
St. |
| T12057 |
170-175 |
NNP |
denotes |
Louis |
| T12058 |
175-177 |
, |
denotes |
, |
| T12059 |
177-185 |
NNP |
denotes |
Missouri |
| T12060 |
185-187 |
, |
denotes |
, |
| T12061 |
187-193 |
NNP |
denotes |
United |
| T12062 |
194-200 |
NNP |
denotes |
States |
| T12063 |
200-201 |
-RRB- |
denotes |
) |
| T12064 |
201-203 |
, |
denotes |
, |
| T12065 |
203-208 |
NN |
denotes |
Ajuba |
| T12066 |
209-210 |
-LRB- |
denotes |
( |
| T12068 |
210-212 |
NNP |
denotes |
G. |
| T12067 |
213-221 |
NNP |
denotes |
Longmore |
| T12069 |
221-223 |
, |
denotes |
, |
| T12070 |
223-233 |
NNP |
denotes |
Washington |
| T12071 |
234-244 |
NNP |
denotes |
University |
| T12072 |
244-246 |
, |
denotes |
, |
| T12073 |
246-249 |
NNP |
denotes |
St. |
| T12074 |
250-255 |
NNP |
denotes |
Louis |
| T12075 |
255-257 |
, |
denotes |
, |
| T12076 |
257-265 |
NNP |
denotes |
Missouri |
| T12077 |
265-267 |
, |
denotes |
, |
| T12078 |
267-273 |
NNP |
denotes |
United |
| T12079 |
274-280 |
NNP |
denotes |
States |
| T12080 |
280-281 |
-RRB- |
denotes |
) |
| T12081 |
281-282 |
: |
denotes |
; |
| T12082 |
283-285 |
NN |
denotes |
β4 |
| T12083 |
286-294 |
NN |
denotes |
integrin |
| T12084 |
294-295 |
HYPH |
denotes |
/ |
| T12085 |
295-300 |
NN |
denotes |
CD104 |
| T12086 |
301-302 |
-LRB- |
denotes |
( |
| T12088 |
302-304 |
NNP |
denotes |
BD |
| T12087 |
305-315 |
NNP |
denotes |
Pharmingen |
| T12089 |
315-317 |
, |
denotes |
, |
| T12090 |
317-320 |
NNP |
denotes |
San |
| T12091 |
321-326 |
NNP |
denotes |
Diego |
| T12092 |
326-328 |
, |
denotes |
, |
| T12093 |
328-338 |
NNP |
denotes |
California |
| T12094 |
338-340 |
, |
denotes |
, |
| T12095 |
340-346 |
NNP |
denotes |
United |
| T12096 |
347-353 |
NNP |
denotes |
States |
| T12097 |
353-354 |
-RRB- |
denotes |
) |
| T12098 |
354-356 |
, |
denotes |
, |
| T12099 |
356-363 |
NN |
denotes |
laminin |
| T12100 |
364-365 |
CD |
denotes |
5 |
| T12101 |
366-367 |
-LRB- |
denotes |
( |
| T12103 |
367-369 |
NNP |
denotes |
R. |
| T12102 |
370-378 |
NNP |
denotes |
Burgeson |
| T12104 |
378-380 |
, |
denotes |
, |
| T12105 |
380-387 |
NNP |
denotes |
Harvard |
| T12106 |
388-398 |
NNP |
denotes |
University |
| T12107 |
398-400 |
, |
denotes |
, |
| T12108 |
400-409 |
NNP |
denotes |
Cambridge |
| T12109 |
409-411 |
, |
denotes |
, |
| T12110 |
411-424 |
NNP |
denotes |
Massachusetts |
| T12111 |
424-426 |
, |
denotes |
, |
| T12112 |
426-432 |
NNP |
denotes |
United |
| T12113 |
433-439 |
NNP |
denotes |
States |
| T12114 |
439-440 |
-RRB- |
denotes |
) |
| T12115 |
440-442 |
, |
denotes |
, |
| T12116 |
442-444 |
NN |
denotes |
K5 |
| T12117 |
444-446 |
, |
denotes |
, |
| T12118 |
446-448 |
NN |
denotes |
K1 |
| T12119 |
448-450 |
, |
denotes |
, |
| T12120 |
450-458 |
NN |
denotes |
loricrin |
| T12121 |
459-460 |
-LRB- |
denotes |
( |
| T12123 |
460-465 |
NNP |
denotes |
Fuchs |
| T12122 |
466-469 |
NNP |
denotes |
Lab |
| T12124 |
469-470 |
-RRB- |
denotes |
) |
| T12125 |
470-472 |
, |
denotes |
, |
| T12126 |
472-482 |
NN |
denotes |
involucrin |
| T12127 |
482-484 |
, |
denotes |
, |
| T12128 |
484-493 |
NN |
denotes |
fillagrin |
| T12129 |
494-495 |
-LRB- |
denotes |
( |
| T12130 |
495-502 |
NNP |
denotes |
Covance |
| T12131 |
502-504 |
, |
denotes |
, |
| T12132 |
504-512 |
NNP |
denotes |
Berkeley |
| T12133 |
512-514 |
, |
denotes |
, |
| T12134 |
514-524 |
NNP |
denotes |
California |
| T12135 |
524-526 |
, |
denotes |
, |
| T12136 |
526-532 |
NNP |
denotes |
United |
| T12137 |
533-539 |
NNP |
denotes |
States |
| T12138 |
539-540 |
-RRB- |
denotes |
) |
| T12139 |
540-542 |
, |
denotes |
, |
| T12140 |
542-546 |
NN |
denotes |
MAPK |
| T12141 |
546-548 |
, |
denotes |
, |
| T12142 |
548-554 |
NN |
denotes |
pSMAD2 |
| T12143 |
555-556 |
-LRB- |
denotes |
( |
| T12145 |
556-560 |
NNP |
denotes |
Cell |
| T12144 |
561-570 |
NNP |
denotes |
Signaling |
| T12146 |
570-572 |
, |
denotes |
, |
| T12147 |
572-579 |
NNP |
denotes |
Beverly |
| T12148 |
579-581 |
, |
denotes |
, |
| T12149 |
581-594 |
NNP |
denotes |
Massachusetts |
| T12150 |
594-596 |
, |
denotes |
, |
| T12151 |
596-602 |
NNP |
denotes |
United |
| T12152 |
603-609 |
NNP |
denotes |
States |
| T12153 |
609-610 |
-RRB- |
denotes |
) |
| T12154 |
610-611 |
: |
denotes |
; |
| T12155 |
612-615 |
NN |
denotes |
Grb |
| T12156 |
615-616 |
HYPH |
denotes |
- |
| T12157 |
616-617 |
CD |
denotes |
2 |
| T12158 |
618-619 |
-LRB- |
denotes |
( |
| T12160 |
619-624 |
NNP |
denotes |
Santa |
| T12161 |
625-629 |
NNP |
denotes |
Cruz |
| T12159 |
630-637 |
NNP |
denotes |
Biotech |
| T12162 |
637-639 |
, |
denotes |
, |
| T12163 |
639-644 |
NNP |
denotes |
Santa |
| T12164 |
645-649 |
NNP |
denotes |
Cruz |
| T12165 |
649-651 |
, |
denotes |
, |
| T12166 |
651-661 |
NNP |
denotes |
California |
| T12167 |
661-663 |
, |
denotes |
, |
| T12168 |
663-669 |
NNP |
denotes |
United |
| T12169 |
670-676 |
NNP |
denotes |
States |
| T12170 |
676-677 |
-RRB- |
denotes |
) |
| T12171 |
677-678 |
: |
denotes |
; |
| T12172 |
679-680 |
NN |
denotes |
P |
| T12174 |
680-681 |
HYPH |
denotes |
- |
| T12173 |
681-689 |
NN |
denotes |
cadherin |
| T12175 |
690-691 |
-LRB- |
denotes |
( |
| T12177 |
691-696 |
NNP |
denotes |
Zymed |
| T12176 |
697-709 |
NNP |
denotes |
Laboratories |
| T12178 |
709-711 |
, |
denotes |
, |
| T12179 |
711-716 |
JJ |
denotes |
South |
| T12181 |
717-720 |
NNP |
denotes |
San |
| T12180 |
721-730 |
NNP |
denotes |
Francisco |
| T12182 |
730-732 |
, |
denotes |
, |
| T12183 |
732-742 |
NNP |
denotes |
California |
| T12184 |
742-744 |
, |
denotes |
, |
| T12185 |
744-750 |
NNP |
denotes |
United |
| T12186 |
751-757 |
NNP |
denotes |
States |
| T12187 |
757-758 |
-RRB- |
denotes |
) |
| T12188 |
758-759 |
: |
denotes |
; |
| T12189 |
760-762 |
NN |
denotes |
HA |
| T12190 |
763-764 |
-LRB- |
denotes |
( |
| T12192 |
764-769 |
NNP |
denotes |
Roche |
| T12191 |
770-782 |
NNP |
denotes |
Biochemicals |
| T12193 |
782-783 |
-RRB- |
denotes |
) |
| T12194 |
783-785 |
, |
denotes |
, |
| T12195 |
785-793 |
NN |
denotes |
vimentin |
| T12196 |
794-795 |
-LRB- |
denotes |
( |
| T12197 |
795-803 |
NNP |
denotes |
Chemicon |
| T12198 |
803-805 |
, |
denotes |
, |
| T12199 |
805-813 |
NNP |
denotes |
Temecula |
| T12200 |
813-815 |
, |
denotes |
, |
| T12201 |
815-825 |
NNP |
denotes |
California |
| T12202 |
825-827 |
, |
denotes |
, |
| T12203 |
827-833 |
NNP |
denotes |
United |
| T12204 |
834-840 |
NNP |
denotes |
States |
| T12205 |
840-841 |
-RRB- |
denotes |
) |
| T12206 |
841-843 |
, |
denotes |
, |
| T12207 |
843-847 |
NN |
denotes |
Ki67 |
| T12208 |
848-849 |
-LRB- |
denotes |
( |
| T12210 |
849-853 |
NNP |
denotes |
Novo |
| T12209 |
854-860 |
NNP |
denotes |
Castra |
| T12211 |
860-862 |
, |
denotes |
, |
| T12212 |
862-871 |
NNP |
denotes |
Newcastle |
| T12213 |
872-876 |
IN |
denotes |
Upon |
| T12214 |
877-881 |
NNP |
denotes |
Tyne |
| T12215 |
881-883 |
, |
denotes |
, |
| T12216 |
883-889 |
NNP |
denotes |
United |
| T12217 |
890-897 |
NNP |
denotes |
Kingdom |
| T12218 |
897-898 |
-RRB- |
denotes |
) |
| T12219 |
898-900 |
, |
denotes |
, |
| T12220 |
900-907 |
NN |
denotes |
keratin |
| T12221 |
908-909 |
CD |
denotes |
6 |
| T12222 |
910-911 |
-LRB- |
denotes |
( |
| T12224 |
911-913 |
NNP |
denotes |
P. |
| T12223 |
914-922 |
NNP |
denotes |
Coulombe |
| T12225 |
922-924 |
, |
denotes |
, |
| T12226 |
924-928 |
NNP |
denotes |
John |
| T12227 |
929-936 |
NNP |
denotes |
Hopkins |
| T12228 |
937-947 |
NNP |
denotes |
University |
| T12229 |
947-949 |
, |
denotes |
, |
| T12230 |
949-958 |
NNP |
denotes |
Baltimore |
| T12231 |
958-960 |
, |
denotes |
, |
| T12232 |
960-968 |
NNP |
denotes |
Maryland |
| T12233 |
968-970 |
, |
denotes |
, |
| T12234 |
970-976 |
NNP |
denotes |
United |
| T12235 |
977-983 |
NNP |
denotes |
States |
| T12236 |
983-984 |
-RRB- |
denotes |
) |
| T12237 |
984-986 |
, |
denotes |
, |
| T12238 |
986-992 |
NN |
denotes |
cyclin |
| T12239 |
993-994 |
NN |
denotes |
D |
| T12240 |
995-996 |
-LRB- |
denotes |
( |
| T12241 |
996-1004 |
NNP |
denotes |
Oncogene |
| T12242 |
1004-1006 |
, |
denotes |
, |
| T12243 |
1006-1009 |
NNP |
denotes |
San |
| T12244 |
1010-1015 |
NNP |
denotes |
Diego |
| T12245 |
1015-1017 |
, |
denotes |
, |
| T12246 |
1017-1027 |
NNP |
denotes |
California |
| T12247 |
1027-1029 |
, |
denotes |
, |
| T12248 |
1029-1035 |
NNP |
denotes |
United |
| T12249 |
1036-1042 |
NNP |
denotes |
States |
| T12250 |
1042-1043 |
-RRB- |
denotes |
) |
| T12251 |
1043-1045 |
, |
denotes |
, |
| T12252 |
1045-1048 |
CC |
denotes |
and |
| T12253 |
1049-1052 |
NN |
denotes |
TGF |
| T12255 |
1052-1053 |
HYPH |
denotes |
- |
| T12254 |
1053-1055 |
NN |
denotes |
β2 |
| T12256 |
1056-1057 |
-LRB- |
denotes |
( |
| T12258 |
1057-1059 |
NNP |
denotes |
L. |
| T12257 |
1060-1064 |
NNP |
denotes |
Gold |
| T12259 |
1064-1066 |
, |
denotes |
, |
| T12260 |
1066-1069 |
NNP |
denotes |
New |
| T12261 |
1070-1074 |
NNP |
denotes |
York |
| T12262 |
1075-1085 |
NNP |
denotes |
University |
| T12263 |
1085-1087 |
, |
denotes |
, |
| T12264 |
1087-1090 |
NNP |
denotes |
New |
| T12265 |
1091-1095 |
NNP |
denotes |
York |
| T12266 |
1095-1097 |
, |
denotes |
, |
| T12267 |
1097-1100 |
NNP |
denotes |
New |
| T12268 |
1101-1105 |
NNP |
denotes |
York |
| T12269 |
1105-1107 |
, |
denotes |
, |
| T12270 |
1107-1113 |
NNP |
denotes |
United |
| T12271 |
1114-1120 |
NNP |
denotes |
States |
| T12272 |
1120-1121 |
-RRB- |
denotes |
) |
| T12273 |
1121-1122 |
. |
denotes |
. |
| T12274 |
1122-1256 |
sentence |
denotes |
FITC-, Texas Red-, or HRP-conjugated secondary antibodies were from Jackson ImmunoResearch (West Grove, Pennsylvania, United States). |
| T12275 |
1123-1127 |
NN |
denotes |
FITC |
| T12277 |
1127-1128 |
HYPH |
denotes |
- |
| T12278 |
1128-1130 |
, |
denotes |
, |
| T12279 |
1130-1135 |
NNP |
denotes |
Texas |
| T12280 |
1136-1139 |
NNP |
denotes |
Red |
| T12281 |
1139-1140 |
HYPH |
denotes |
- |
| T12282 |
1140-1142 |
, |
denotes |
, |
| T12283 |
1142-1144 |
CC |
denotes |
or |
| T12284 |
1145-1148 |
NN |
denotes |
HRP |
| T12285 |
1148-1149 |
HYPH |
denotes |
- |
| T12276 |
1149-1159 |
VBN |
denotes |
conjugated |
| T12287 |
1160-1169 |
JJ |
denotes |
secondary |
| T12286 |
1170-1180 |
NNS |
denotes |
antibodies |
| T12288 |
1181-1185 |
VBD |
denotes |
were |
| T12289 |
1186-1190 |
IN |
denotes |
from |
| T12290 |
1191-1198 |
NNP |
denotes |
Jackson |
| T12291 |
1199-1213 |
NNP |
denotes |
ImmunoResearch |
| T12292 |
1214-1215 |
-LRB- |
denotes |
( |
| T12294 |
1215-1219 |
NNP |
denotes |
West |
| T12293 |
1220-1225 |
NNP |
denotes |
Grove |
| T12295 |
1225-1227 |
, |
denotes |
, |
| T12296 |
1227-1239 |
NNP |
denotes |
Pennsylvania |
| T12297 |
1239-1241 |
, |
denotes |
, |
| T12298 |
1241-1247 |
NNP |
denotes |
United |
| T12299 |
1248-1254 |
NNP |
denotes |
States |
| T12300 |
1254-1255 |
-RRB- |
denotes |
) |
| T12301 |
1255-1256 |
. |
denotes |
. |
| T12302 |
1256-1353 |
sentence |
denotes |
Biotinylated secondary antibodies were from Vector Labs (Burlingame, California, United States). |
| T12303 |
1257-1269 |
VBN |
denotes |
Biotinylated |
| T12305 |
1270-1279 |
JJ |
denotes |
secondary |
| T12304 |
1280-1290 |
NNS |
denotes |
antibodies |
| T12306 |
1291-1295 |
VBD |
denotes |
were |
| T12307 |
1296-1300 |
IN |
denotes |
from |
| T12308 |
1301-1307 |
NNP |
denotes |
Vector |
| T12309 |
1308-1312 |
NNP |
denotes |
Labs |
| T12310 |
1313-1314 |
-LRB- |
denotes |
( |
| T12311 |
1314-1324 |
NNP |
denotes |
Burlingame |
| T12312 |
1324-1326 |
, |
denotes |
, |
| T12313 |
1326-1336 |
NNP |
denotes |
California |
| T12314 |
1336-1338 |
, |
denotes |
, |
| T12315 |
1338-1344 |
NNP |
denotes |
United |
| T12316 |
1345-1351 |
NNP |
denotes |
States |
| T12317 |
1351-1352 |
-RRB- |
denotes |
) |
| T12318 |
1352-1353 |
. |
denotes |
. |
| T12319 |
1353-1416 |
sentence |
denotes |
Dilutions were according to the manufacturer's recommendation. |
| T12320 |
1354-1363 |
NNS |
denotes |
Dilutions |
| T12321 |
1364-1368 |
VBD |
denotes |
were |
| T12322 |
1369-1378 |
VBG |
denotes |
according |
| T12323 |
1379-1381 |
IN |
denotes |
to |
| T12324 |
1382-1385 |
DT |
denotes |
the |
| T12325 |
1386-1398 |
NN |
denotes |
manufacturer |
| T12327 |
1398-1400 |
POS |
denotes |
's |
| T12326 |
1401-1415 |
NN |
denotes |
recommendation |
| T12328 |
1415-1416 |
. |
denotes |
. |
| T12329 |
1416-1591 |
sentence |
denotes |
The Snail antibody was generated in Guinea pigs by inoculating them with the N-terminal sequence of murine Snail fused to GST (Covance, Princeton, New Jersey, United States). |
| T12330 |
1417-1420 |
DT |
denotes |
The |
| T12332 |
1421-1426 |
NN |
denotes |
Snail |
| T12331 |
1427-1435 |
NN |
denotes |
antibody |
| T12334 |
1436-1439 |
VBD |
denotes |
was |
| T12333 |
1440-1449 |
VBN |
denotes |
generated |
| T12335 |
1450-1452 |
IN |
denotes |
in |
| T12336 |
1453-1459 |
NN |
denotes |
Guinea |
| T12337 |
1460-1464 |
NNS |
denotes |
pigs |
| T12338 |
1465-1467 |
IN |
denotes |
by |
| T12339 |
1468-1479 |
VBG |
denotes |
inoculating |
| T12340 |
1480-1484 |
PRP |
denotes |
them |
| T12341 |
1485-1489 |
IN |
denotes |
with |
| T12342 |
1490-1493 |
DT |
denotes |
the |
| T12344 |
1494-1495 |
NN |
denotes |
N |
| T12346 |
1495-1496 |
HYPH |
denotes |
- |
| T12345 |
1496-1504 |
JJ |
denotes |
terminal |
| T12343 |
1505-1513 |
NN |
denotes |
sequence |
| T12347 |
1514-1516 |
IN |
denotes |
of |
| T12348 |
1517-1523 |
JJ |
denotes |
murine |
| T12349 |
1524-1529 |
NN |
denotes |
Snail |
| T12350 |
1530-1535 |
VBN |
denotes |
fused |
| T12351 |
1536-1538 |
IN |
denotes |
to |
| T12352 |
1539-1542 |
NN |
denotes |
GST |
| T12353 |
1543-1544 |
-LRB- |
denotes |
( |
| T12354 |
1544-1551 |
NNP |
denotes |
Covance |
| T12355 |
1551-1553 |
, |
denotes |
, |
| T12356 |
1553-1562 |
NNP |
denotes |
Princeton |
| T12357 |
1562-1564 |
, |
denotes |
, |
| T12358 |
1564-1567 |
NNP |
denotes |
New |
| T12359 |
1568-1574 |
NNP |
denotes |
Jersey |
| T12360 |
1574-1576 |
, |
denotes |
, |
| T12361 |
1576-1582 |
NNP |
denotes |
United |
| T12362 |
1583-1589 |
NNP |
denotes |
States |
| T12363 |
1589-1590 |
-RRB- |
denotes |
) |
| T12364 |
1590-1591 |
. |
denotes |
. |
| T12365 |
1591-1680 |
sentence |
denotes |
Recombinant human TGF-β2 was purchased from R&D (Minneapolis, Minnesota, United States). |
| T12366 |
1592-1603 |
JJ |
denotes |
Recombinant |
| T12368 |
1604-1609 |
JJ |
denotes |
human |
| T12369 |
1610-1613 |
NN |
denotes |
TGF |
| T12370 |
1613-1614 |
HYPH |
denotes |
- |
| T12367 |
1614-1616 |
NN |
denotes |
β2 |
| T12372 |
1617-1620 |
VBD |
denotes |
was |
| T12371 |
1621-1630 |
VBN |
denotes |
purchased |
| T12373 |
1631-1635 |
IN |
denotes |
from |
| T12374 |
1636-1637 |
NNP |
denotes |
R |
| T12375 |
1637-1638 |
CC |
denotes |
& |
| T12376 |
1638-1639 |
NNP |
denotes |
D |
| T12377 |
1640-1641 |
-LRB- |
denotes |
( |
| T12378 |
1641-1652 |
NNP |
denotes |
Minneapolis |
| T12379 |
1652-1654 |
, |
denotes |
, |
| T12380 |
1654-1663 |
NNP |
denotes |
Minnesota |
| T12381 |
1663-1665 |
, |
denotes |
, |
| T12382 |
1665-1671 |
NNP |
denotes |
United |
| T12383 |
1672-1678 |
NNP |
denotes |
States |
| T12384 |
1678-1679 |
-RRB- |
denotes |
) |
| T12385 |
1679-1680 |
. |
denotes |
. |
| T12386 |
1680-1775 |
sentence |
denotes |
Heat inactivated TGF-β2 was generated by heating the recombinant protein at 100 °C for 10 min. |
| T12387 |
1681-1685 |
NN |
denotes |
Heat |
| T12388 |
1686-1697 |
VBN |
denotes |
inactivated |
| T12390 |
1698-1701 |
NN |
denotes |
TGF |
| T12391 |
1701-1702 |
HYPH |
denotes |
- |
| T12389 |
1702-1704 |
NN |
denotes |
β2 |
| T12393 |
1705-1708 |
VBD |
denotes |
was |
| T12392 |
1709-1718 |
VBN |
denotes |
generated |
| T12394 |
1719-1721 |
IN |
denotes |
by |
| T12395 |
1722-1729 |
VBG |
denotes |
heating |
| T12396 |
1730-1733 |
DT |
denotes |
the |
| T12398 |
1734-1745 |
JJ |
denotes |
recombinant |
| T12397 |
1746-1753 |
NN |
denotes |
protein |
| T12399 |
1754-1756 |
IN |
denotes |
at |
| T12400 |
1757-1760 |
CD |
denotes |
100 |
| T12401 |
1761-1763 |
NN |
denotes |
°C |
| T12402 |
1764-1767 |
IN |
denotes |
for |
| T12403 |
1768-1770 |
CD |
denotes |
10 |
| T12404 |
1771-1774 |
NN |
denotes |
min |
| T12405 |
1774-1775 |
. |
denotes |
. |
| T12464 |
1777-1781 |
NNS |
denotes |
Mice |
| T12465 |
1781-1984 |
sentence |
denotes |
The K14-Snail Tg mouse was generated by digesting the pcDNA3-mm Snail-HA plasmid (G. de Herreros, Universitat Pompeu, Fabra, Barcelona, Spain) with BamHI and NotI and subcloned into the K14 vector [49]. |
| T12466 |
1782-1785 |
DT |
denotes |
The |
| T12468 |
1786-1789 |
NN |
denotes |
K14 |
| T12470 |
1789-1790 |
HYPH |
denotes |
- |
| T12469 |
1790-1795 |
NN |
denotes |
Snail |
| T12471 |
1796-1798 |
NN |
denotes |
Tg |
| T12467 |
1799-1804 |
NN |
denotes |
mouse |
| T12473 |
1805-1808 |
VBD |
denotes |
was |
| T12472 |
1809-1818 |
VBN |
denotes |
generated |
| T12474 |
1819-1821 |
IN |
denotes |
by |
| T12475 |
1822-1831 |
VBG |
denotes |
digesting |
| T12476 |
1832-1835 |
DT |
denotes |
the |
| T12478 |
1836-1842 |
NN |
denotes |
pcDNA3 |
| T12480 |
1842-1843 |
HYPH |
denotes |
- |
| T12479 |
1843-1845 |
NN |
denotes |
mm |
| T12481 |
1846-1851 |
NN |
denotes |
Snail |
| T12483 |
1851-1852 |
HYPH |
denotes |
- |
| T12482 |
1852-1854 |
NN |
denotes |
HA |
| T12477 |
1855-1862 |
NN |
denotes |
plasmid |
| T12484 |
1863-1864 |
-LRB- |
denotes |
( |
| T12486 |
1864-1866 |
NNP |
denotes |
G. |
| T12487 |
1867-1869 |
NNP |
denotes |
de |
| T12485 |
1870-1878 |
NNP |
denotes |
Herreros |
| T12488 |
1878-1880 |
, |
denotes |
, |
| T12489 |
1880-1891 |
NNP |
denotes |
Universitat |
| T12490 |
1892-1898 |
NNP |
denotes |
Pompeu |
| T12491 |
1898-1900 |
, |
denotes |
, |
| T12492 |
1900-1905 |
NNP |
denotes |
Fabra |
| T12493 |
1905-1907 |
, |
denotes |
, |
| T12494 |
1907-1916 |
NNP |
denotes |
Barcelona |
| T12495 |
1916-1918 |
, |
denotes |
, |
| T12496 |
1918-1923 |
NNP |
denotes |
Spain |
| T12497 |
1923-1924 |
-RRB- |
denotes |
) |
| T12498 |
1925-1929 |
IN |
denotes |
with |
| T12499 |
1930-1935 |
NN |
denotes |
BamHI |
| T12500 |
1936-1939 |
CC |
denotes |
and |
| T12501 |
1940-1944 |
NN |
denotes |
NotI |
| T12502 |
1945-1948 |
CC |
denotes |
and |
| T12503 |
1949-1958 |
VBN |
denotes |
subcloned |
| T12504 |
1959-1963 |
IN |
denotes |
into |
| T12505 |
1964-1967 |
DT |
denotes |
the |
| T12507 |
1968-1971 |
NN |
denotes |
K14 |
| T12506 |
1972-1978 |
NN |
denotes |
vector |
| T12508 |
1979-1980 |
-LRB- |
denotes |
[ |
| T12509 |
1980-1982 |
CD |
denotes |
49 |
| T12510 |
1982-1983 |
-RRB- |
denotes |
] |
| T12511 |
1983-1984 |
. |
denotes |
. |
| T12512 |
1984-2065 |
sentence |
denotes |
The linearized construct was injected into the nucleus of embryos from CD1 mice. |
| T12513 |
1985-1988 |
DT |
denotes |
The |
| T12515 |
1989-1999 |
VBN |
denotes |
linearized |
| T12514 |
2000-2009 |
NN |
denotes |
construct |
| T12517 |
2010-2013 |
VBD |
denotes |
was |
| T12516 |
2014-2022 |
VBN |
denotes |
injected |
| T12518 |
2023-2027 |
IN |
denotes |
into |
| T12519 |
2028-2031 |
DT |
denotes |
the |
| T12520 |
2032-2039 |
NN |
denotes |
nucleus |
| T12521 |
2040-2042 |
IN |
denotes |
of |
| T12522 |
2043-2050 |
NNS |
denotes |
embryos |
| T12523 |
2051-2055 |
IN |
denotes |
from |
| T12524 |
2056-2059 |
NN |
denotes |
CD1 |
| T12525 |
2060-2064 |
NNS |
denotes |
mice |
| T12526 |
2064-2065 |
. |
denotes |
. |
| T12527 |
2065-2123 |
sentence |
denotes |
The K14-Smad 2 Tg mouse was reported in Ito et al., 2001. |
| T12528 |
2066-2069 |
DT |
denotes |
The |
| T12530 |
2070-2073 |
NN |
denotes |
K14 |
| T12532 |
2073-2074 |
HYPH |
denotes |
- |
| T12531 |
2074-2078 |
NN |
denotes |
Smad |
| T12533 |
2079-2080 |
CD |
denotes |
2 |
| T12534 |
2081-2083 |
NN |
denotes |
Tg |
| T12529 |
2084-2089 |
NN |
denotes |
mouse |
| T12536 |
2090-2093 |
VBD |
denotes |
was |
| T12535 |
2094-2102 |
VBN |
denotes |
reported |
| T12537 |
2103-2105 |
IN |
denotes |
in |
| T12538 |
2106-2109 |
NNP |
denotes |
Ito |
| T12539 |
2110-2112 |
FW |
denotes |
et |
| T12540 |
2113-2116 |
FW |
denotes |
al. |
| T12541 |
2116-2118 |
, |
denotes |
, |
| T12542 |
2118-2122 |
CD |
denotes |
2001 |
| T12543 |
2122-2123 |
. |
denotes |
. |
| T12544 |
2123-2177 |
sentence |
denotes |
The TGF-β2 knockout (KO) mouse was described in [34]. |
| T12545 |
2124-2127 |
DT |
denotes |
The |
| T12547 |
2128-2131 |
NN |
denotes |
TGF |
| T12549 |
2131-2132 |
HYPH |
denotes |
- |
| T12548 |
2132-2134 |
NN |
denotes |
β2 |
| T12550 |
2135-2143 |
NN |
denotes |
knockout |
| T12551 |
2144-2145 |
-LRB- |
denotes |
( |
| T12552 |
2145-2147 |
NN |
denotes |
KO |
| T12553 |
2147-2148 |
-RRB- |
denotes |
) |
| T12546 |
2149-2154 |
NN |
denotes |
mouse |
| T12555 |
2155-2158 |
VBD |
denotes |
was |
| T12554 |
2159-2168 |
VBN |
denotes |
described |
| T12556 |
2169-2171 |
IN |
denotes |
in |
| T12557 |
2172-2173 |
-LRB- |
denotes |
[ |
| T12558 |
2173-2175 |
NN |
denotes |
34 |
| T12559 |
2175-2176 |
-RRB- |
denotes |
] |
| T12560 |
2176-2177 |
. |
denotes |
. |
| T12561 |
2177-2252 |
sentence |
denotes |
The shh KO mouse [38] and TOPGal mouse [20] have previously been reported. |
| T12562 |
2178-2181 |
DT |
denotes |
The |
| T12564 |
2182-2185 |
NN |
denotes |
shh |
| T12565 |
2186-2188 |
NN |
denotes |
KO |
| T12563 |
2189-2194 |
NN |
denotes |
mouse |
| T12567 |
2195-2196 |
-LRB- |
denotes |
[ |
| T12568 |
2196-2198 |
CD |
denotes |
38 |
| T12569 |
2198-2199 |
-RRB- |
denotes |
] |
| T12570 |
2200-2203 |
CC |
denotes |
and |
| T12571 |
2204-2210 |
NN |
denotes |
TOPGal |
| T12572 |
2211-2216 |
NN |
denotes |
mouse |
| T12573 |
2217-2218 |
-LRB- |
denotes |
[ |
| T12574 |
2218-2220 |
CD |
denotes |
20 |
| T12575 |
2220-2221 |
-RRB- |
denotes |
] |
| T12576 |
2222-2226 |
VBP |
denotes |
have |
| T12577 |
2227-2237 |
RB |
denotes |
previously |
| T12578 |
2238-2242 |
VBN |
denotes |
been |
| T12566 |
2243-2251 |
VBN |
denotes |
reported |
| T12579 |
2251-2252 |
. |
denotes |
. |
| T12687 |
2254-2261 |
NNP |
denotes |
Western |
| T12688 |
2262-2266 |
NN |
denotes |
blot |
| T12689 |
2267-2270 |
CC |
denotes |
and |
| T12690 |
2271-2290 |
NN |
denotes |
immunoprecipitation |
| T12691 |
2290-2596 |
sentence |
denotes |
Protein extracts from primary keratinocytes were generated either by lysing cells in lysis buffer (1% NP-40, 1% sodium deoxycholate, 20 mM Tris-Cl [pH 7.4], 140 mM NaCl containing 1 mM sodium vanadate, 2 mM phenylmethylsulfonyl fluoride, and protease inhibitors) or directly in Laemmli bβuffer and boiled. |
| T12692 |
2291-2298 |
NN |
denotes |
Protein |
| T12693 |
2299-2307 |
NNS |
denotes |
extracts |
| T12695 |
2308-2312 |
IN |
denotes |
from |
| T12696 |
2313-2320 |
JJ |
denotes |
primary |
| T12697 |
2321-2334 |
NNS |
denotes |
keratinocytes |
| T12698 |
2335-2339 |
VBD |
denotes |
were |
| T12694 |
2340-2349 |
VBN |
denotes |
generated |
| T12699 |
2350-2356 |
CC |
denotes |
either |
| T12700 |
2357-2359 |
IN |
denotes |
by |
| T12701 |
2360-2366 |
VBG |
denotes |
lysing |
| T12702 |
2367-2372 |
NNS |
denotes |
cells |
| T12703 |
2373-2375 |
IN |
denotes |
in |
| T12704 |
2376-2381 |
NN |
denotes |
lysis |
| T12705 |
2382-2388 |
NN |
denotes |
buffer |
| T12706 |
2389-2390 |
-LRB- |
denotes |
( |
| T12708 |
2390-2391 |
CD |
denotes |
1 |
| T12709 |
2391-2392 |
NN |
denotes |
% |
| T12707 |
2393-2395 |
NN |
denotes |
NP |
| T12710 |
2395-2396 |
HYPH |
denotes |
- |
| T12711 |
2396-2398 |
CD |
denotes |
40 |
| T12712 |
2398-2400 |
, |
denotes |
, |
| T12713 |
2400-2401 |
CD |
denotes |
1 |
| T12714 |
2401-2402 |
NN |
denotes |
% |
| T12716 |
2403-2409 |
NN |
denotes |
sodium |
| T12715 |
2410-2422 |
NN |
denotes |
deoxycholate |
| T12717 |
2422-2424 |
, |
denotes |
, |
| T12718 |
2424-2426 |
CD |
denotes |
20 |
| T12719 |
2427-2429 |
NN |
denotes |
mM |
| T12721 |
2430-2434 |
NN |
denotes |
Tris |
| T12722 |
2434-2435 |
HYPH |
denotes |
- |
| T12720 |
2435-2437 |
NN |
denotes |
Cl |
| T12723 |
2438-2439 |
-LRB- |
denotes |
[ |
| T12724 |
2439-2441 |
NN |
denotes |
pH |
| T12725 |
2442-2445 |
CD |
denotes |
7.4 |
| T12726 |
2445-2446 |
-RRB- |
denotes |
] |
| T12727 |
2446-2448 |
, |
denotes |
, |
| T12728 |
2448-2451 |
CD |
denotes |
140 |
| T12729 |
2452-2454 |
NN |
denotes |
mM |
| T12730 |
2455-2459 |
NN |
denotes |
NaCl |
| T12731 |
2460-2470 |
VBG |
denotes |
containing |
| T12732 |
2471-2472 |
CD |
denotes |
1 |
| T12733 |
2473-2475 |
NN |
denotes |
mM |
| T12735 |
2476-2482 |
NN |
denotes |
sodium |
| T12734 |
2483-2491 |
NN |
denotes |
vanadate |
| T12736 |
2491-2493 |
, |
denotes |
, |
| T12737 |
2493-2494 |
CD |
denotes |
2 |
| T12738 |
2495-2497 |
NN |
denotes |
mM |
| T12740 |
2498-2518 |
NN |
denotes |
phenylmethylsulfonyl |
| T12739 |
2519-2527 |
NN |
denotes |
fluoride |
| T12741 |
2527-2529 |
, |
denotes |
, |
| T12742 |
2529-2532 |
CC |
denotes |
and |
| T12743 |
2533-2541 |
NN |
denotes |
protease |
| T12744 |
2542-2552 |
NNS |
denotes |
inhibitors |
| T12745 |
2552-2553 |
-RRB- |
denotes |
) |
| T12746 |
2554-2556 |
CC |
denotes |
or |
| T12747 |
2557-2565 |
RB |
denotes |
directly |
| T12748 |
2566-2568 |
IN |
denotes |
in |
| T12749 |
2569-2576 |
NNP |
denotes |
Laemmli |
| T12750 |
2577-2584 |
NN |
denotes |
bβuffer |
| T12751 |
2585-2588 |
CC |
denotes |
and |
| T12752 |
2589-2595 |
VBN |
denotes |
boiled |
| T12753 |
2595-2596 |
. |
denotes |
. |
| T12754 |
2596-2745 |
sentence |
denotes |
For skin tissue: Frozen tissue was pulverized in a liquid nitrogen-cooled Gevebesmascher and the powder scraped into a chilled microcentrifuge tube. |
| T12755 |
2597-2600 |
IN |
denotes |
For |
| T12757 |
2601-2605 |
NN |
denotes |
skin |
| T12758 |
2606-2612 |
NN |
denotes |
tissue |
| T12759 |
2612-2614 |
: |
denotes |
: |
| T12760 |
2614-2620 |
JJ |
denotes |
Frozen |
| T12761 |
2621-2627 |
NN |
denotes |
tissue |
| T12762 |
2628-2631 |
VBD |
denotes |
was |
| T12756 |
2632-2642 |
VBN |
denotes |
pulverized |
| T12763 |
2643-2645 |
IN |
denotes |
in |
| T12764 |
2646-2647 |
DT |
denotes |
a |
| T12766 |
2648-2654 |
JJ |
denotes |
liquid |
| T12767 |
2655-2663 |
NN |
denotes |
nitrogen |
| T12769 |
2663-2664 |
HYPH |
denotes |
- |
| T12768 |
2664-2670 |
VBN |
denotes |
cooled |
| T12765 |
2671-2685 |
NN |
denotes |
Gevebesmascher |
| T12770 |
2686-2689 |
CC |
denotes |
and |
| T12771 |
2690-2693 |
DT |
denotes |
the |
| T12772 |
2694-2700 |
NN |
denotes |
powder |
| T12773 |
2701-2708 |
VBN |
denotes |
scraped |
| T12774 |
2709-2713 |
IN |
denotes |
into |
| T12775 |
2714-2715 |
DT |
denotes |
a |
| T12777 |
2716-2723 |
JJ |
denotes |
chilled |
| T12778 |
2724-2739 |
NN |
denotes |
microcentrifuge |
| T12776 |
2740-2744 |
NN |
denotes |
tube |
| T12779 |
2744-2745 |
. |
denotes |
. |
| T12780 |
2745-2902 |
sentence |
denotes |
RIPA buffer (1% Triton X-100 in PBS with 10 mM EDTA, 150 mN NaCl, 1% sodium deoxycholate, and 0.1% SDS) and protease inhibitors or Laemmli buffer was added. |
| T12781 |
2746-2750 |
NN |
denotes |
RIPA |
| T12782 |
2751-2757 |
NN |
denotes |
buffer |
| T12784 |
2758-2759 |
-LRB- |
denotes |
( |
| T12786 |
2759-2760 |
CD |
denotes |
1 |
| T12787 |
2760-2761 |
NN |
denotes |
% |
| T12788 |
2762-2768 |
NN |
denotes |
Triton |
| T12785 |
2769-2770 |
NN |
denotes |
X |
| T12789 |
2770-2771 |
HYPH |
denotes |
- |
| T12790 |
2771-2774 |
CD |
denotes |
100 |
| T12791 |
2775-2777 |
IN |
denotes |
in |
| T12792 |
2778-2781 |
NN |
denotes |
PBS |
| T12793 |
2782-2786 |
IN |
denotes |
with |
| T12794 |
2787-2789 |
CD |
denotes |
10 |
| T12795 |
2790-2792 |
NN |
denotes |
mM |
| T12796 |
2793-2797 |
NN |
denotes |
EDTA |
| T12797 |
2797-2799 |
, |
denotes |
, |
| T12798 |
2799-2802 |
CD |
denotes |
150 |
| T12799 |
2803-2805 |
NN |
denotes |
mN |
| T12800 |
2806-2810 |
NN |
denotes |
NaCl |
| T12801 |
2810-2812 |
, |
denotes |
, |
| T12802 |
2812-2813 |
CD |
denotes |
1 |
| T12803 |
2813-2814 |
NN |
denotes |
% |
| T12805 |
2815-2821 |
NN |
denotes |
sodium |
| T12804 |
2822-2834 |
NN |
denotes |
deoxycholate |
| T12806 |
2834-2836 |
, |
denotes |
, |
| T12807 |
2836-2839 |
CC |
denotes |
and |
| T12808 |
2840-2843 |
CD |
denotes |
0.1 |
| T12809 |
2843-2844 |
NN |
denotes |
% |
| T12810 |
2845-2848 |
NN |
denotes |
SDS |
| T12811 |
2848-2849 |
-RRB- |
denotes |
) |
| T12812 |
2850-2853 |
CC |
denotes |
and |
| T12813 |
2854-2862 |
NN |
denotes |
protease |
| T12814 |
2863-2873 |
NNS |
denotes |
inhibitors |
| T12815 |
2874-2876 |
CC |
denotes |
or |
| T12816 |
2877-2884 |
NNP |
denotes |
Laemmli |
| T12817 |
2885-2891 |
NN |
denotes |
buffer |
| T12818 |
2892-2895 |
VBD |
denotes |
was |
| T12783 |
2896-2901 |
VBN |
denotes |
added |
| T12819 |
2901-2902 |
. |
denotes |
. |
| T12820 |
2902-2996 |
sentence |
denotes |
The cell suspension was sonicated three times for 15 s and centrifuged at 14,000 rpm at 4 °C. |
| T12821 |
2903-2906 |
DT |
denotes |
The |
| T12823 |
2907-2911 |
NN |
denotes |
cell |
| T12822 |
2912-2922 |
NN |
denotes |
suspension |
| T12825 |
2923-2926 |
VBD |
denotes |
was |
| T12824 |
2927-2936 |
VBN |
denotes |
sonicated |
| T12826 |
2937-2942 |
CD |
denotes |
three |
| T12827 |
2943-2948 |
NNS |
denotes |
times |
| T12828 |
2949-2952 |
IN |
denotes |
for |
| T12829 |
2953-2955 |
CD |
denotes |
15 |
| T12830 |
2956-2957 |
NN |
denotes |
s |
| T12831 |
2958-2961 |
CC |
denotes |
and |
| T12832 |
2962-2973 |
VBN |
denotes |
centrifuged |
| T12833 |
2974-2976 |
IN |
denotes |
at |
| T12834 |
2977-2983 |
CD |
denotes |
14,000 |
| T12835 |
2984-2987 |
NN |
denotes |
rpm |
| T12836 |
2988-2990 |
IN |
denotes |
at |
| T12837 |
2991-2992 |
CD |
denotes |
4 |
| T12838 |
2993-2995 |
NN |
denotes |
°C |
| T12839 |
2995-2996 |
. |
denotes |
. |
| T12840 |
2996-3071 |
sentence |
denotes |
The supernatant was separated from the pellet and used in the experiments. |
| T12841 |
2997-3000 |
DT |
denotes |
The |
| T12842 |
3001-3012 |
NN |
denotes |
supernatant |
| T12844 |
3013-3016 |
VBD |
denotes |
was |
| T12843 |
3017-3026 |
VBN |
denotes |
separated |
| T12845 |
3027-3031 |
IN |
denotes |
from |
| T12846 |
3032-3035 |
DT |
denotes |
the |
| T12847 |
3036-3042 |
NN |
denotes |
pellet |
| T12848 |
3043-3046 |
CC |
denotes |
and |
| T12849 |
3047-3051 |
VBN |
denotes |
used |
| T12850 |
3052-3054 |
IN |
denotes |
in |
| T12851 |
3055-3058 |
DT |
denotes |
the |
| T12852 |
3059-3070 |
NNS |
denotes |
experiments |
| T12853 |
3070-3071 |
. |
denotes |
. |
| T12854 |
3071-3262 |
sentence |
denotes |
Extracts subjected to immunoprecipitation were precleared with Protein G Sepharose (Amersham, Piscataway, New York, United States) and incubated with antibody with rocking overnight at 4 °C. |
| T12855 |
3072-3080 |
NNS |
denotes |
Extracts |
| T12857 |
3081-3090 |
VBN |
denotes |
subjected |
| T12858 |
3091-3093 |
IN |
denotes |
to |
| T12859 |
3094-3113 |
NN |
denotes |
immunoprecipitation |
| T12860 |
3114-3118 |
VBD |
denotes |
were |
| T12856 |
3119-3129 |
VBN |
denotes |
precleared |
| T12861 |
3130-3134 |
IN |
denotes |
with |
| T12862 |
3135-3142 |
NN |
denotes |
Protein |
| T12863 |
3143-3144 |
NN |
denotes |
G |
| T12864 |
3145-3154 |
NN |
denotes |
Sepharose |
| T12865 |
3155-3156 |
-LRB- |
denotes |
( |
| T12866 |
3156-3164 |
NNP |
denotes |
Amersham |
| T12867 |
3164-3166 |
, |
denotes |
, |
| T12868 |
3166-3176 |
NNP |
denotes |
Piscataway |
| T12869 |
3176-3178 |
, |
denotes |
, |
| T12870 |
3178-3181 |
NNP |
denotes |
New |
| T12871 |
3182-3186 |
NNP |
denotes |
York |
| T12872 |
3186-3188 |
, |
denotes |
, |
| T12873 |
3188-3194 |
NNP |
denotes |
United |
| T12874 |
3195-3201 |
NNP |
denotes |
States |
| T12875 |
3201-3202 |
-RRB- |
denotes |
) |
| T12876 |
3203-3206 |
CC |
denotes |
and |
| T12877 |
3207-3216 |
VBN |
denotes |
incubated |
| T12878 |
3217-3221 |
IN |
denotes |
with |
| T12879 |
3222-3230 |
NN |
denotes |
antibody |
| T12880 |
3231-3235 |
IN |
denotes |
with |
| T12881 |
3236-3243 |
NN |
denotes |
rocking |
| T12882 |
3244-3253 |
RB |
denotes |
overnight |
| T12883 |
3254-3256 |
IN |
denotes |
at |
| T12884 |
3257-3258 |
CD |
denotes |
4 |
| T12885 |
3259-3261 |
NN |
denotes |
°C |
| T12886 |
3261-3262 |
. |
denotes |
. |
| T12887 |
3262-3349 |
sentence |
denotes |
Protein G Sepharose was added and samples were incubated for 1 h at 4 °C with rocking. |
| T12888 |
3263-3270 |
NN |
denotes |
Protein |
| T12889 |
3271-3272 |
NN |
denotes |
G |
| T12890 |
3273-3282 |
NN |
denotes |
Sepharose |
| T12892 |
3283-3286 |
VBD |
denotes |
was |
| T12891 |
3287-3292 |
VBN |
denotes |
added |
| T12893 |
3293-3296 |
CC |
denotes |
and |
| T12894 |
3297-3304 |
NNS |
denotes |
samples |
| T12896 |
3305-3309 |
VBD |
denotes |
were |
| T12895 |
3310-3319 |
VBN |
denotes |
incubated |
| T12897 |
3320-3323 |
IN |
denotes |
for |
| T12898 |
3324-3325 |
CD |
denotes |
1 |
| T12899 |
3326-3327 |
NN |
denotes |
h |
| T12900 |
3328-3330 |
IN |
denotes |
at |
| T12901 |
3331-3332 |
CD |
denotes |
4 |
| T12902 |
3333-3335 |
NN |
denotes |
°C |
| T12903 |
3336-3340 |
IN |
denotes |
with |
| T12904 |
3341-3348 |
NN |
denotes |
rocking |
| T12905 |
3348-3349 |
. |
denotes |
. |
| T12906 |
3349-3522 |
sentence |
denotes |
Samples were washed three times for 5 min each in lysis buffer, and the Protein G Sepharose-antibody-antigen pellet was resuspended in Laemmli buffer and boiled for 10 min. |
| T12907 |
3350-3357 |
NNS |
denotes |
Samples |
| T12909 |
3358-3362 |
VBD |
denotes |
were |
| T12908 |
3363-3369 |
VBN |
denotes |
washed |
| T12910 |
3370-3375 |
CD |
denotes |
three |
| T12911 |
3376-3381 |
NNS |
denotes |
times |
| T12912 |
3382-3385 |
IN |
denotes |
for |
| T12913 |
3386-3387 |
CD |
denotes |
5 |
| T12914 |
3388-3391 |
NN |
denotes |
min |
| T12915 |
3392-3396 |
RB |
denotes |
each |
| T12916 |
3397-3399 |
IN |
denotes |
in |
| T12917 |
3400-3405 |
NN |
denotes |
lysis |
| T12918 |
3406-3412 |
NN |
denotes |
buffer |
| T12919 |
3412-3414 |
, |
denotes |
, |
| T12920 |
3414-3417 |
CC |
denotes |
and |
| T12921 |
3418-3421 |
DT |
denotes |
the |
| T12923 |
3422-3429 |
NN |
denotes |
Protein |
| T12924 |
3430-3431 |
NN |
denotes |
G |
| T12926 |
3432-3441 |
NN |
denotes |
Sepharose |
| T12927 |
3441-3442 |
HYPH |
denotes |
- |
| T12928 |
3442-3450 |
NN |
denotes |
antibody |
| T12929 |
3450-3451 |
HYPH |
denotes |
- |
| T12925 |
3451-3458 |
NN |
denotes |
antigen |
| T12922 |
3459-3465 |
NN |
denotes |
pellet |
| T12931 |
3466-3469 |
VBD |
denotes |
was |
| T12930 |
3470-3481 |
VBN |
denotes |
resuspended |
| T12932 |
3482-3484 |
IN |
denotes |
in |
| T12933 |
3485-3492 |
NNP |
denotes |
Laemmli |
| T12934 |
3493-3499 |
NN |
denotes |
buffer |
| T12935 |
3500-3503 |
CC |
denotes |
and |
| T12936 |
3504-3510 |
VBN |
denotes |
boiled |
| T12937 |
3511-3514 |
IN |
denotes |
for |
| T12938 |
3515-3517 |
CD |
denotes |
10 |
| T12939 |
3518-3521 |
NN |
denotes |
min |
| T12940 |
3521-3522 |
. |
denotes |
. |
| T12941 |
3522-3668 |
sentence |
denotes |
Samples were run on SDS-PAGE and transferred to nitrocellulose membrane (Schleicher and Schuell Bioscience, Keene, New Hampshire, United States). |
| T12942 |
3523-3530 |
NNS |
denotes |
Samples |
| T12944 |
3531-3535 |
VBD |
denotes |
were |
| T12943 |
3536-3539 |
VBN |
denotes |
run |
| T12945 |
3540-3542 |
IN |
denotes |
on |
| T12946 |
3543-3546 |
NN |
denotes |
SDS |
| T12948 |
3546-3547 |
HYPH |
denotes |
- |
| T12947 |
3547-3551 |
NN |
denotes |
PAGE |
| T12949 |
3552-3555 |
CC |
denotes |
and |
| T12950 |
3556-3567 |
VBN |
denotes |
transferred |
| T12951 |
3568-3570 |
IN |
denotes |
to |
| T12952 |
3571-3585 |
NN |
denotes |
nitrocellulose |
| T12953 |
3586-3594 |
NN |
denotes |
membrane |
| T12954 |
3595-3596 |
-LRB- |
denotes |
( |
| T12956 |
3596-3606 |
NNP |
denotes |
Schleicher |
| T12957 |
3607-3610 |
CC |
denotes |
and |
| T12958 |
3611-3618 |
NNP |
denotes |
Schuell |
| T12955 |
3619-3629 |
NNP |
denotes |
Bioscience |
| T12959 |
3629-3631 |
, |
denotes |
, |
| T12960 |
3631-3636 |
NNP |
denotes |
Keene |
| T12961 |
3636-3638 |
, |
denotes |
, |
| T12962 |
3638-3641 |
NNP |
denotes |
New |
| T12963 |
3642-3651 |
NNP |
denotes |
Hampshire |
| T12964 |
3651-3653 |
, |
denotes |
, |
| T12965 |
3653-3659 |
NNP |
denotes |
United |
| T12966 |
3660-3666 |
NNP |
denotes |
States |
| T12967 |
3666-3667 |
-RRB- |
denotes |
) |
| T12968 |
3667-3668 |
. |
denotes |
. |
| T12969 |
3668-3759 |
sentence |
denotes |
Western blot signals were developed using the enhanced chemiluminescence kit from Amersham |
| T12970 |
3669-3676 |
NNP |
denotes |
Western |
| T12971 |
3677-3681 |
NN |
denotes |
blot |
| T12972 |
3682-3689 |
NNS |
denotes |
signals |
| T12974 |
3690-3694 |
VBD |
denotes |
were |
| T12973 |
3695-3704 |
VBN |
denotes |
developed |
| T12975 |
3705-3710 |
VBG |
denotes |
using |
| T12976 |
3711-3714 |
DT |
denotes |
the |
| T12978 |
3715-3723 |
VBN |
denotes |
enhanced |
| T12979 |
3724-3741 |
NN |
denotes |
chemiluminescence |
| T12977 |
3742-3745 |
NN |
denotes |
kit |
| T12980 |
3746-3750 |
IN |
denotes |
from |
| T12981 |
3751-3759 |
NNP |
denotes |
Amersham |
| T13041 |
3761-3765 |
NN |
denotes |
Cell |
| T13042 |
3766-3773 |
NN |
denotes |
culture |
| T13043 |
3773-3859 |
sentence |
denotes |
Primary keratinocytes were culture in low-calcium medium as previously described [4]. |
| T13044 |
3774-3781 |
JJ |
denotes |
Primary |
| T13045 |
3782-3795 |
NNS |
denotes |
keratinocytes |
| T13047 |
3796-3800 |
VBD |
denotes |
were |
| T13046 |
3801-3808 |
VBN |
denotes |
culture |
| T13048 |
3809-3811 |
IN |
denotes |
in |
| T13049 |
3812-3815 |
JJ |
denotes |
low |
| T13051 |
3815-3816 |
HYPH |
denotes |
- |
| T13050 |
3816-3823 |
NN |
denotes |
calcium |
| T13052 |
3824-3830 |
NN |
denotes |
medium |
| T13053 |
3831-3833 |
IN |
denotes |
as |
| T13055 |
3834-3844 |
RB |
denotes |
previously |
| T13054 |
3845-3854 |
VBN |
denotes |
described |
| T13056 |
3855-3856 |
-LRB- |
denotes |
[ |
| T13057 |
3856-3857 |
CD |
denotes |
4 |
| T13058 |
3857-3858 |
-RRB- |
denotes |
] |
| T13059 |
3858-3859 |
. |
denotes |
. |
| T13060 |
3859-4009 |
sentence |
denotes |
Transient transfections were carried out with FuGENE6 reagent (Roche, Indianapolis, Indiana, United States) according to the manufacturer's protocol. |
| T13061 |
3860-3869 |
JJ |
denotes |
Transient |
| T13062 |
3870-3883 |
NNS |
denotes |
transfections |
| T13064 |
3884-3888 |
VBD |
denotes |
were |
| T13063 |
3889-3896 |
VBN |
denotes |
carried |
| T13065 |
3897-3900 |
RP |
denotes |
out |
| T13066 |
3901-3905 |
IN |
denotes |
with |
| T13067 |
3906-3913 |
NN |
denotes |
FuGENE6 |
| T13068 |
3914-3921 |
NN |
denotes |
reagent |
| T13069 |
3922-3923 |
-LRB- |
denotes |
( |
| T13070 |
3923-3928 |
NNP |
denotes |
Roche |
| T13071 |
3928-3930 |
, |
denotes |
, |
| T13072 |
3930-3942 |
NNP |
denotes |
Indianapolis |
| T13073 |
3942-3944 |
, |
denotes |
, |
| T13074 |
3944-3951 |
NNP |
denotes |
Indiana |
| T13075 |
3951-3953 |
, |
denotes |
, |
| T13076 |
3953-3959 |
NNP |
denotes |
United |
| T13077 |
3960-3966 |
NNP |
denotes |
States |
| T13078 |
3966-3967 |
-RRB- |
denotes |
) |
| T13079 |
3968-3977 |
VBG |
denotes |
according |
| T13080 |
3978-3980 |
IN |
denotes |
to |
| T13081 |
3981-3984 |
DT |
denotes |
the |
| T13082 |
3985-3997 |
NN |
denotes |
manufacturer |
| T13084 |
3997-3999 |
POS |
denotes |
's |
| T13083 |
4000-4008 |
NN |
denotes |
protocol |
| T13085 |
4008-4009 |
. |
denotes |
. |
| T13086 |
4009-4271 |
sentence |
denotes |
Measurement of β-galactosidase or luciferase levels in promoter activity studies were carried out with the Galacto-Lite assay kit (TROPIX, Bedford, Massachusetts, United States) and the Dual luciferase (Promega, Madison, Wisconsin, United States), respectively. |
| T13087 |
4010-4021 |
NN |
denotes |
Measurement |
| T13089 |
4022-4024 |
IN |
denotes |
of |
| T13090 |
4025-4026 |
NN |
denotes |
β |
| T13092 |
4026-4027 |
HYPH |
denotes |
- |
| T13091 |
4027-4040 |
NN |
denotes |
galactosidase |
| T13094 |
4041-4043 |
CC |
denotes |
or |
| T13095 |
4044-4054 |
NN |
denotes |
luciferase |
| T13093 |
4055-4061 |
NNS |
denotes |
levels |
| T13096 |
4062-4064 |
IN |
denotes |
in |
| T13097 |
4065-4073 |
NN |
denotes |
promoter |
| T13098 |
4074-4082 |
NN |
denotes |
activity |
| T13099 |
4083-4090 |
NNS |
denotes |
studies |
| T13100 |
4091-4095 |
VBD |
denotes |
were |
| T13088 |
4096-4103 |
VBN |
denotes |
carried |
| T13101 |
4104-4107 |
RP |
denotes |
out |
| T13102 |
4108-4112 |
IN |
denotes |
with |
| T13103 |
4113-4116 |
DT |
denotes |
the |
| T13105 |
4117-4124 |
NNP |
denotes |
Galacto |
| T13107 |
4124-4125 |
HYPH |
denotes |
- |
| T13106 |
4125-4129 |
NNP |
denotes |
Lite |
| T13108 |
4130-4135 |
NN |
denotes |
assay |
| T13104 |
4136-4139 |
NN |
denotes |
kit |
| T13109 |
4140-4141 |
-LRB- |
denotes |
( |
| T13110 |
4141-4147 |
NNP |
denotes |
TROPIX |
| T13111 |
4147-4149 |
, |
denotes |
, |
| T13112 |
4149-4156 |
NNP |
denotes |
Bedford |
| T13113 |
4156-4158 |
, |
denotes |
, |
| T13114 |
4158-4171 |
NNP |
denotes |
Massachusetts |
| T13115 |
4171-4173 |
, |
denotes |
, |
| T13116 |
4173-4179 |
NNP |
denotes |
United |
| T13117 |
4180-4186 |
NNP |
denotes |
States |
| T13118 |
4186-4187 |
-RRB- |
denotes |
) |
| T13119 |
4188-4191 |
CC |
denotes |
and |
| T13120 |
4192-4195 |
DT |
denotes |
the |
| T13122 |
4196-4200 |
JJ |
denotes |
Dual |
| T13121 |
4201-4211 |
NN |
denotes |
luciferase |
| T13123 |
4212-4213 |
-LRB- |
denotes |
( |
| T13124 |
4213-4220 |
NNP |
denotes |
Promega |
| T13125 |
4220-4222 |
, |
denotes |
, |
| T13126 |
4222-4229 |
NNP |
denotes |
Madison |
| T13127 |
4229-4231 |
, |
denotes |
, |
| T13128 |
4231-4240 |
NNP |
denotes |
Wisconsin |
| T13129 |
4240-4242 |
, |
denotes |
, |
| T13130 |
4242-4248 |
NNP |
denotes |
United |
| T13131 |
4249-4255 |
NNP |
denotes |
States |
| T13132 |
4255-4256 |
-RRB- |
denotes |
) |
| T13133 |
4256-4258 |
, |
denotes |
, |
| T13134 |
4258-4270 |
RB |
denotes |
respectively |
| T13135 |
4270-4271 |
. |
denotes |
. |
| T13136 |
4271-4359 |
sentence |
denotes |
Runella luciferase was cotransfected into cells to correct for transfection efficiency. |
| T13137 |
4272-4279 |
NN |
denotes |
Runella |
| T13138 |
4280-4290 |
NN |
denotes |
luciferase |
| T13140 |
4291-4294 |
VBD |
denotes |
was |
| T13139 |
4295-4308 |
VBN |
denotes |
cotransfected |
| T13141 |
4309-4313 |
IN |
denotes |
into |
| T13142 |
4314-4319 |
NNS |
denotes |
cells |
| T13143 |
4320-4322 |
TO |
denotes |
to |
| T13144 |
4323-4330 |
VB |
denotes |
correct |
| T13145 |
4331-4334 |
IN |
denotes |
for |
| T13146 |
4335-4347 |
NN |
denotes |
transfection |
| T13147 |
4348-4358 |
NN |
denotes |
efficiency |
| T13148 |
4358-4359 |
. |
denotes |
. |
| T13149 |
4359-4430 |
sentence |
denotes |
Experiments were done in triplicate and repeated at least three times. |
| T13150 |
4360-4371 |
NNS |
denotes |
Experiments |
| T13152 |
4372-4376 |
VBD |
denotes |
were |
| T13151 |
4377-4381 |
VBN |
denotes |
done |
| T13153 |
4382-4384 |
IN |
denotes |
in |
| T13154 |
4385-4395 |
NN |
denotes |
triplicate |
| T13155 |
4396-4399 |
CC |
denotes |
and |
| T13156 |
4400-4408 |
VBN |
denotes |
repeated |
| T13157 |
4409-4411 |
RB |
denotes |
at |
| T13159 |
4412-4417 |
RBS |
denotes |
least |
| T13158 |
4418-4423 |
CD |
denotes |
three |
| T13160 |
4424-4429 |
NNS |
denotes |
times |
| T13161 |
4429-4430 |
. |
denotes |
. |
| T13162 |
4430-4525 |
sentence |
denotes |
Measurements were done on a luminometer (MGM Instruments, Hamden, Connecticut, United States). |
| T13163 |
4431-4443 |
NNS |
denotes |
Measurements |
| T13165 |
4444-4448 |
VBD |
denotes |
were |
| T13164 |
4449-4453 |
VBN |
denotes |
done |
| T13166 |
4454-4456 |
IN |
denotes |
on |
| T13167 |
4457-4458 |
DT |
denotes |
a |
| T13168 |
4459-4470 |
NN |
denotes |
luminometer |
| T13169 |
4471-4472 |
-LRB- |
denotes |
( |
| T13171 |
4472-4475 |
NNP |
denotes |
MGM |
| T13170 |
4476-4487 |
NNP |
denotes |
Instruments |
| T13172 |
4487-4489 |
, |
denotes |
, |
| T13173 |
4489-4495 |
NNP |
denotes |
Hamden |
| T13174 |
4495-4497 |
, |
denotes |
, |
| T13175 |
4497-4508 |
NNP |
denotes |
Connecticut |
| T13176 |
4508-4510 |
, |
denotes |
, |
| T13177 |
4510-4516 |
NNP |
denotes |
United |
| T13178 |
4517-4523 |
NNP |
denotes |
States |
| T13179 |
4523-4524 |
-RRB- |
denotes |
) |
| T13180 |
4524-4525 |
. |
denotes |
. |
| T13181 |
4525-4685 |
sentence |
denotes |
For experiments measuring phosphorylation of MAPK, keratinocytes were serum starved for 3 h prior to harvesting of cells by incubation in medium lacking serum. |
| T13182 |
4526-4529 |
IN |
denotes |
For |
| T13184 |
4530-4541 |
NNS |
denotes |
experiments |
| T13185 |
4542-4551 |
VBG |
denotes |
measuring |
| T13186 |
4552-4567 |
NN |
denotes |
phosphorylation |
| T13187 |
4568-4570 |
IN |
denotes |
of |
| T13188 |
4571-4575 |
NN |
denotes |
MAPK |
| T13189 |
4575-4577 |
, |
denotes |
, |
| T13190 |
4577-4590 |
NNS |
denotes |
keratinocytes |
| T13191 |
4591-4595 |
VBD |
denotes |
were |
| T13192 |
4596-4601 |
NN |
denotes |
serum |
| T13183 |
4602-4609 |
VBN |
denotes |
starved |
| T13193 |
4610-4613 |
IN |
denotes |
for |
| T13194 |
4614-4615 |
CD |
denotes |
3 |
| T13195 |
4616-4617 |
NN |
denotes |
h |
| T13196 |
4618-4623 |
JJ |
denotes |
prior |
| T13197 |
4624-4626 |
IN |
denotes |
to |
| T13198 |
4627-4637 |
NN |
denotes |
harvesting |
| T13199 |
4638-4640 |
IN |
denotes |
of |
| T13200 |
4641-4646 |
NNS |
denotes |
cells |
| T13201 |
4647-4649 |
IN |
denotes |
by |
| T13202 |
4650-4660 |
NN |
denotes |
incubation |
| T13203 |
4661-4663 |
IN |
denotes |
in |
| T13204 |
4664-4670 |
NN |
denotes |
medium |
| T13205 |
4671-4678 |
VBG |
denotes |
lacking |
| T13206 |
4679-4684 |
NN |
denotes |
serum |
| T13207 |
4684-4685 |
. |
denotes |
. |
| T13208 |
4685-4774 |
sentence |
denotes |
Treatment of cells with Wnt- and noggin-conditioned medium was previously described [4]. |
| T13209 |
4686-4695 |
NN |
denotes |
Treatment |
| T13211 |
4696-4698 |
IN |
denotes |
of |
| T13212 |
4699-4704 |
NNS |
denotes |
cells |
| T13213 |
4705-4709 |
IN |
denotes |
with |
| T13214 |
4710-4713 |
NN |
denotes |
Wnt |
| T13216 |
4713-4714 |
HYPH |
denotes |
- |
| T13217 |
4715-4718 |
CC |
denotes |
and |
| T13218 |
4719-4725 |
NN |
denotes |
noggin |
| T13219 |
4725-4726 |
HYPH |
denotes |
- |
| T13215 |
4726-4737 |
VBN |
denotes |
conditioned |
| T13220 |
4738-4744 |
NN |
denotes |
medium |
| T13221 |
4745-4748 |
VBD |
denotes |
was |
| T13222 |
4749-4759 |
RB |
denotes |
previously |
| T13210 |
4760-4769 |
VBN |
denotes |
described |
| T13223 |
4770-4771 |
-LRB- |
denotes |
[ |
| T13224 |
4771-4772 |
CD |
denotes |
4 |
| T13225 |
4772-4773 |
-RRB- |
denotes |
] |
| T13226 |
4773-4774 |
. |
denotes |
. |
| T13308 |
4776-4786 |
NNS |
denotes |
Constructs |
| T13309 |
4786-5067 |
sentence |
denotes |
The 2.2-kb murine Snail promoter was generated by PCR using a forward primer with an XbaI linker sequence, 5′- TCTAGAATTGTTTGCTGCTGTATGGTCTTC-3′, along with a reverse primer with a BglII linker sequence, 5′- AGATCTGTTGGCCAGAGCGACCTAG- GTAG-3′, and mouse genomic DNA as a template. |
| T13310 |
4787-4790 |
DT |
denotes |
The |
| T13312 |
4791-4794 |
CD |
denotes |
2.2 |
| T13314 |
4794-4795 |
HYPH |
denotes |
- |
| T13313 |
4795-4797 |
NN |
denotes |
kb |
| T13315 |
4798-4804 |
JJ |
denotes |
murine |
| T13316 |
4805-4810 |
NN |
denotes |
Snail |
| T13311 |
4811-4819 |
NN |
denotes |
promoter |
| T13318 |
4820-4823 |
VBD |
denotes |
was |
| T13317 |
4824-4833 |
VBN |
denotes |
generated |
| T13319 |
4834-4836 |
IN |
denotes |
by |
| T13320 |
4837-4840 |
NN |
denotes |
PCR |
| T13321 |
4841-4846 |
VBG |
denotes |
using |
| T13322 |
4847-4848 |
DT |
denotes |
a |
| T13324 |
4849-4856 |
JJ |
denotes |
forward |
| T13323 |
4857-4863 |
NN |
denotes |
primer |
| T13325 |
4864-4868 |
IN |
denotes |
with |
| T13326 |
4869-4871 |
DT |
denotes |
an |
| T13328 |
4872-4876 |
NN |
denotes |
XbaI |
| T13329 |
4877-4883 |
NN |
denotes |
linker |
| T13327 |
4884-4892 |
NN |
denotes |
sequence |
| T13330 |
4892-4894 |
, |
denotes |
, |
| T13331 |
4894-4895 |
CD |
denotes |
5 |
| T13333 |
4895-4896 |
SYM |
denotes |
′ |
| T13334 |
4896-4897 |
HYPH |
denotes |
- |
| T13332 |
4898-4928 |
NN |
denotes |
TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
| T13335 |
4928-4929 |
HYPH |
denotes |
- |
| T13336 |
4929-4930 |
CD |
denotes |
3 |
| T13337 |
4930-4931 |
SYM |
denotes |
′ |
| T13338 |
4931-4933 |
, |
denotes |
, |
| T13339 |
4933-4938 |
IN |
denotes |
along |
| T13340 |
4939-4943 |
IN |
denotes |
with |
| T13341 |
4944-4945 |
DT |
denotes |
a |
| T13343 |
4946-4953 |
JJ |
denotes |
reverse |
| T13342 |
4954-4960 |
NN |
denotes |
primer |
| T13344 |
4961-4965 |
IN |
denotes |
with |
| T13345 |
4966-4967 |
DT |
denotes |
a |
| T13347 |
4968-4973 |
NN |
denotes |
BglII |
| T13348 |
4974-4980 |
NN |
denotes |
linker |
| T13346 |
4981-4989 |
NN |
denotes |
sequence |
| T13349 |
4989-4991 |
, |
denotes |
, |
| T13350 |
4991-4992 |
CD |
denotes |
5 |
| T13352 |
4992-4993 |
SYM |
denotes |
′ |
| T13353 |
4993-4994 |
HYPH |
denotes |
- |
| T13354 |
4995-5020 |
NN |
denotes |
AGATCTGTTGGCCAGAGCGACCTAG |
| T13355 |
5020-5021 |
HYPH |
denotes |
- |
| T13351 |
5022-5026 |
NN |
denotes |
GTAG |
| T13356 |
5026-5027 |
HYPH |
denotes |
- |
| T13357 |
5027-5028 |
CD |
denotes |
3 |
| T13358 |
5028-5029 |
SYM |
denotes |
′ |
| T13359 |
5029-5031 |
, |
denotes |
, |
| T13360 |
5031-5034 |
CC |
denotes |
and |
| T13361 |
5035-5040 |
NN |
denotes |
mouse |
| T13363 |
5041-5048 |
JJ |
denotes |
genomic |
| T13362 |
5049-5052 |
NN |
denotes |
DNA |
| T13364 |
5053-5055 |
IN |
denotes |
as |
| T13365 |
5056-5057 |
DT |
denotes |
a |
| T13366 |
5058-5066 |
NN |
denotes |
template |
| T13367 |
5066-5067 |
. |
denotes |
. |
| T13368 |
5067-5259 |
sentence |
denotes |
The PCR product was purified with the Gel Extraction Kit (Qiagen, Valencia, California, United States) and ligated into pCRII-TOPO TA vector (Invitrogen, Carlsbad, California, United States). |
| T13369 |
5068-5071 |
DT |
denotes |
The |
| T13371 |
5072-5075 |
NN |
denotes |
PCR |
| T13370 |
5076-5083 |
NN |
denotes |
product |
| T13373 |
5084-5087 |
VBD |
denotes |
was |
| T13372 |
5088-5096 |
VBN |
denotes |
purified |
| T13374 |
5097-5101 |
IN |
denotes |
with |
| T13375 |
5102-5105 |
DT |
denotes |
the |
| T13377 |
5106-5109 |
NN |
denotes |
Gel |
| T13378 |
5110-5120 |
NN |
denotes |
Extraction |
| T13376 |
5121-5124 |
NN |
denotes |
Kit |
| T13379 |
5125-5126 |
-LRB- |
denotes |
( |
| T13380 |
5126-5132 |
NNP |
denotes |
Qiagen |
| T13381 |
5132-5134 |
, |
denotes |
, |
| T13382 |
5134-5142 |
NNP |
denotes |
Valencia |
| T13383 |
5142-5144 |
, |
denotes |
, |
| T13384 |
5144-5154 |
NNP |
denotes |
California |
| T13385 |
5154-5156 |
, |
denotes |
, |
| T13386 |
5156-5162 |
NNP |
denotes |
United |
| T13387 |
5163-5169 |
NNP |
denotes |
States |
| T13388 |
5169-5170 |
-RRB- |
denotes |
) |
| T13389 |
5171-5174 |
CC |
denotes |
and |
| T13390 |
5175-5182 |
VBN |
denotes |
ligated |
| T13391 |
5183-5187 |
IN |
denotes |
into |
| T13392 |
5188-5193 |
NN |
denotes |
pCRII |
| T13394 |
5193-5194 |
HYPH |
denotes |
- |
| T13393 |
5194-5198 |
NN |
denotes |
TOPO |
| T13396 |
5199-5201 |
NN |
denotes |
TA |
| T13395 |
5202-5208 |
NN |
denotes |
vector |
| T13397 |
5209-5210 |
-LRB- |
denotes |
( |
| T13398 |
5210-5220 |
NNP |
denotes |
Invitrogen |
| T13399 |
5220-5222 |
, |
denotes |
, |
| T13400 |
5222-5230 |
NNP |
denotes |
Carlsbad |
| T13401 |
5230-5232 |
, |
denotes |
, |
| T13402 |
5232-5242 |
NNP |
denotes |
California |
| T13403 |
5242-5244 |
, |
denotes |
, |
| T13404 |
5244-5250 |
NNP |
denotes |
United |
| T13405 |
5251-5257 |
NNP |
denotes |
States |
| T13406 |
5257-5258 |
-RRB- |
denotes |
) |
| T13407 |
5258-5259 |
. |
denotes |
. |
| T13408 |
5259-5440 |
sentence |
denotes |
The promoter was verified by sequencing and digested with XbaI and BglII and subcloned into the pβ-gal BASIC vector (BD Biosciences Clontech, Palo Alto, California, United States). |
| T13409 |
5260-5263 |
DT |
denotes |
The |
| T13410 |
5264-5272 |
NN |
denotes |
promoter |
| T13412 |
5273-5276 |
VBD |
denotes |
was |
| T13411 |
5277-5285 |
VBN |
denotes |
verified |
| T13413 |
5286-5288 |
IN |
denotes |
by |
| T13414 |
5289-5299 |
NN |
denotes |
sequencing |
| T13415 |
5300-5303 |
CC |
denotes |
and |
| T13416 |
5304-5312 |
VBN |
denotes |
digested |
| T13417 |
5313-5317 |
IN |
denotes |
with |
| T13418 |
5318-5322 |
NN |
denotes |
XbaI |
| T13419 |
5323-5326 |
CC |
denotes |
and |
| T13420 |
5327-5332 |
NN |
denotes |
BglII |
| T13421 |
5333-5336 |
CC |
denotes |
and |
| T13422 |
5337-5346 |
VBN |
denotes |
subcloned |
| T13423 |
5347-5351 |
IN |
denotes |
into |
| T13424 |
5352-5355 |
DT |
denotes |
the |
| T13426 |
5356-5358 |
NN |
denotes |
pβ |
| T13428 |
5358-5359 |
HYPH |
denotes |
- |
| T13427 |
5359-5362 |
NN |
denotes |
gal |
| T13429 |
5363-5368 |
NN |
denotes |
BASIC |
| T13425 |
5369-5375 |
NN |
denotes |
vector |
| T13430 |
5376-5377 |
-LRB- |
denotes |
( |
| T13432 |
5377-5379 |
NNP |
denotes |
BD |
| T13433 |
5380-5391 |
NNP |
denotes |
Biosciences |
| T13431 |
5392-5400 |
NNP |
denotes |
Clontech |
| T13434 |
5400-5402 |
, |
denotes |
, |
| T13435 |
5402-5406 |
NNP |
denotes |
Palo |
| T13436 |
5407-5411 |
NNP |
denotes |
Alto |
| T13437 |
5411-5413 |
, |
denotes |
, |
| T13438 |
5413-5423 |
NNP |
denotes |
California |
| T13439 |
5423-5425 |
, |
denotes |
, |
| T13440 |
5425-5431 |
NNP |
denotes |
United |
| T13441 |
5432-5438 |
NNP |
denotes |
States |
| T13442 |
5438-5439 |
-RRB- |
denotes |
) |
| T13443 |
5439-5440 |
. |
denotes |
. |
| T13444 |
5440-5734 |
sentence |
denotes |
The point mutations in the SMAD binding element was generated with the Quik-Change Kit (Stratagene, La Jolla, California, United States) using the forward primer 5′- GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC-3′ and the reverse primer 5′- GCTTTT- CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC-3′. |
| T13445 |
5441-5444 |
DT |
denotes |
The |
| T13447 |
5445-5450 |
NN |
denotes |
point |
| T13446 |
5451-5460 |
NNS |
denotes |
mutations |
| T13449 |
5461-5463 |
IN |
denotes |
in |
| T13450 |
5464-5467 |
DT |
denotes |
the |
| T13452 |
5468-5472 |
NN |
denotes |
SMAD |
| T13453 |
5473-5480 |
NN |
denotes |
binding |
| T13451 |
5481-5488 |
NN |
denotes |
element |
| T13454 |
5489-5492 |
VBD |
denotes |
was |
| T13448 |
5493-5502 |
VBN |
denotes |
generated |
| T13455 |
5503-5507 |
IN |
denotes |
with |
| T13456 |
5508-5511 |
DT |
denotes |
the |
| T13458 |
5512-5516 |
NNP |
denotes |
Quik |
| T13460 |
5516-5517 |
HYPH |
denotes |
- |
| T13459 |
5517-5523 |
NNP |
denotes |
Change |
| T13457 |
5524-5527 |
NNP |
denotes |
Kit |
| T13461 |
5528-5529 |
-LRB- |
denotes |
( |
| T13462 |
5529-5539 |
NNP |
denotes |
Stratagene |
| T13463 |
5539-5541 |
, |
denotes |
, |
| T13464 |
5541-5543 |
NNP |
denotes |
La |
| T13465 |
5544-5549 |
NNP |
denotes |
Jolla |
| T13466 |
5549-5551 |
, |
denotes |
, |
| T13467 |
5551-5561 |
NNP |
denotes |
California |
| T13468 |
5561-5563 |
, |
denotes |
, |
| T13469 |
5563-5569 |
NNP |
denotes |
United |
| T13470 |
5570-5576 |
NNP |
denotes |
States |
| T13471 |
5576-5577 |
-RRB- |
denotes |
) |
| T13472 |
5578-5583 |
VBG |
denotes |
using |
| T13473 |
5584-5587 |
DT |
denotes |
the |
| T13475 |
5588-5595 |
JJ |
denotes |
forward |
| T13474 |
5596-5602 |
NN |
denotes |
primer |
| T13476 |
5603-5604 |
CD |
denotes |
5 |
| T13478 |
5604-5605 |
SYM |
denotes |
′ |
| T13479 |
5605-5606 |
HYPH |
denotes |
- |
| T13477 |
5607-5652 |
NN |
denotes |
GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
| T13480 |
5652-5653 |
HYPH |
denotes |
- |
| T13481 |
5653-5654 |
CD |
denotes |
3 |
| T13482 |
5654-5655 |
SYM |
denotes |
′ |
| T13483 |
5656-5659 |
CC |
denotes |
and |
| T13484 |
5660-5663 |
DT |
denotes |
the |
| T13486 |
5664-5671 |
JJ |
denotes |
reverse |
| T13485 |
5672-5678 |
NN |
denotes |
primer |
| T13487 |
5679-5680 |
CD |
denotes |
5 |
| T13489 |
5680-5681 |
SYM |
denotes |
′ |
| T13490 |
5681-5682 |
HYPH |
denotes |
- |
| T13491 |
5683-5689 |
NN |
denotes |
GCTTTT |
| T13492 |
5689-5690 |
HYPH |
denotes |
- |
| T13488 |
5691-5730 |
NN |
denotes |
CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
| T13493 |
5730-5731 |
HYPH |
denotes |
- |
| T13494 |
5731-5732 |
CD |
denotes |
3 |
| T13495 |
5732-5733 |
SYM |
denotes |
′ |
| T13496 |
5733-5734 |
. |
denotes |
. |
| T13497 |
5734-5967 |
sentence |
denotes |
The probes for the Snail in situ hybridization were generated against the 3′ UTR by PCR using the forward primer 5′- ACCTTCTCCCGCATGTCCTTGCTCC-3′ and the reverse primer 5′- CTGCTGAGGCATGGTTACAGCTGG-3′, and genomic DNA as a template. |
| T13498 |
5735-5738 |
DT |
denotes |
The |
| T13499 |
5739-5745 |
NNS |
denotes |
probes |
| T13501 |
5746-5749 |
IN |
denotes |
for |
| T13502 |
5750-5753 |
DT |
denotes |
the |
| T13504 |
5754-5759 |
NN |
denotes |
Snail |
| T13505 |
5760-5762 |
FW |
denotes |
in |
| T13506 |
5763-5767 |
FW |
denotes |
situ |
| T13503 |
5768-5781 |
NN |
denotes |
hybridization |
| T13507 |
5782-5786 |
VBD |
denotes |
were |
| T13500 |
5787-5796 |
VBN |
denotes |
generated |
| T13508 |
5797-5804 |
IN |
denotes |
against |
| T13509 |
5805-5808 |
DT |
denotes |
the |
| T13511 |
5809-5810 |
CD |
denotes |
3 |
| T13512 |
5810-5811 |
SYM |
denotes |
′ |
| T13510 |
5812-5815 |
NN |
denotes |
UTR |
| T13513 |
5816-5818 |
IN |
denotes |
by |
| T13514 |
5819-5822 |
NN |
denotes |
PCR |
| T13515 |
5823-5828 |
VBG |
denotes |
using |
| T13516 |
5829-5832 |
DT |
denotes |
the |
| T13518 |
5833-5840 |
JJ |
denotes |
forward |
| T13517 |
5841-5847 |
NN |
denotes |
primer |
| T13519 |
5848-5849 |
CD |
denotes |
5 |
| T13521 |
5849-5850 |
SYM |
denotes |
′ |
| T13522 |
5850-5851 |
HYPH |
denotes |
- |
| T13520 |
5852-5877 |
NN |
denotes |
ACCTTCTCCCGCATGTCCTTGCTCC |
| T13523 |
5877-5878 |
HYPH |
denotes |
- |
| T13524 |
5878-5879 |
CD |
denotes |
3 |
| T13525 |
5879-5880 |
SYM |
denotes |
′ |
| T13526 |
5881-5884 |
CC |
denotes |
and |
| T13527 |
5885-5888 |
DT |
denotes |
the |
| T13529 |
5889-5896 |
JJ |
denotes |
reverse |
| T13528 |
5897-5903 |
NN |
denotes |
primer |
| T13530 |
5904-5905 |
CD |
denotes |
5 |
| T13532 |
5905-5906 |
SYM |
denotes |
′ |
| T13533 |
5906-5907 |
HYPH |
denotes |
- |
| T13531 |
5908-5932 |
NN |
denotes |
CTGCTGAGGCATGGTTACAGCTGG |
| T13534 |
5932-5933 |
HYPH |
denotes |
- |
| T13535 |
5933-5934 |
CD |
denotes |
3 |
| T13536 |
5934-5935 |
SYM |
denotes |
′ |
| T13537 |
5935-5937 |
, |
denotes |
, |
| T13538 |
5937-5940 |
CC |
denotes |
and |
| T13539 |
5941-5948 |
JJ |
denotes |
genomic |
| T13540 |
5949-5952 |
NN |
denotes |
DNA |
| T13541 |
5953-5955 |
IN |
denotes |
as |
| T13542 |
5956-5957 |
DT |
denotes |
a |
| T13543 |
5958-5966 |
NN |
denotes |
template |
| T13544 |
5966-5967 |
. |
denotes |
. |
| T13545 |
5967-6039 |
sentence |
denotes |
The PCR product was gel purified and ligated into pCRII-TOPO TA vector. |
| T13546 |
5968-5971 |
DT |
denotes |
The |
| T13548 |
5972-5975 |
NN |
denotes |
PCR |
| T13547 |
5976-5983 |
NN |
denotes |
product |
| T13550 |
5984-5987 |
VBD |
denotes |
was |
| T13551 |
5988-5991 |
NN |
denotes |
gel |
| T13549 |
5992-6000 |
VBN |
denotes |
purified |
| T13552 |
6001-6004 |
CC |
denotes |
and |
| T13553 |
6005-6012 |
VBN |
denotes |
ligated |
| T13554 |
6013-6017 |
IN |
denotes |
into |
| T13555 |
6018-6023 |
NN |
denotes |
pCRII |
| T13557 |
6023-6024 |
HYPH |
denotes |
- |
| T13556 |
6024-6028 |
NN |
denotes |
TOPO |
| T13559 |
6029-6031 |
NN |
denotes |
TA |
| T13558 |
6032-6038 |
NN |
denotes |
vector |
| T13560 |
6038-6039 |
. |
denotes |
. |
| T13561 |
6039-6200 |
sentence |
denotes |
The pre-LIM domain of Ajuba was generated essentially as described [9], but was fused to GFP by subcloning from the pEGFP-N1 20 vector (BD Biosciences Clontech) |
| T13562 |
6040-6043 |
DT |
denotes |
The |
| T13564 |
6044-6051 |
JJ |
denotes |
pre-LIM |
| T13563 |
6052-6058 |
NN |
denotes |
domain |
| T13566 |
6059-6061 |
IN |
denotes |
of |
| T13567 |
6062-6067 |
NN |
denotes |
Ajuba |
| T13568 |
6068-6071 |
VBD |
denotes |
was |
| T13565 |
6072-6081 |
VBN |
denotes |
generated |
| T13569 |
6082-6093 |
RB |
denotes |
essentially |
| T13570 |
6094-6096 |
IN |
denotes |
as |
| T13571 |
6097-6106 |
VBN |
denotes |
described |
| T13572 |
6107-6108 |
-LRB- |
denotes |
[ |
| T13573 |
6108-6109 |
CD |
denotes |
9 |
| T13574 |
6109-6110 |
-RRB- |
denotes |
] |
| T13575 |
6110-6112 |
, |
denotes |
, |
| T13576 |
6112-6115 |
CC |
denotes |
but |
| T13577 |
6116-6119 |
VBD |
denotes |
was |
| T13578 |
6120-6125 |
VBN |
denotes |
fused |
| T13579 |
6126-6128 |
IN |
denotes |
to |
| T13580 |
6129-6132 |
NN |
denotes |
GFP |
| T13581 |
6133-6135 |
IN |
denotes |
by |
| T13582 |
6136-6146 |
VBG |
denotes |
subcloning |
| T13583 |
6147-6151 |
IN |
denotes |
from |
| T13584 |
6152-6155 |
DT |
denotes |
the |
| T13586 |
6156-6161 |
NN |
denotes |
pEGFP |
| T13588 |
6161-6162 |
HYPH |
denotes |
- |
| T13587 |
6162-6164 |
NN |
denotes |
N1 |
| T13589 |
6165-6167 |
CD |
denotes |
20 |
| T13585 |
6168-6174 |
NN |
denotes |
vector |
| T13590 |
6175-6176 |
-LRB- |
denotes |
( |
| T13592 |
6176-6178 |
NNP |
denotes |
BD |
| T13593 |
6179-6190 |
NNP |
denotes |
Biosciences |
| T13591 |
6191-6199 |
NNP |
denotes |
Clontech |
| T13594 |
6199-6200 |
-RRB- |
denotes |
) |
| T13649 |
6202-6204 |
FW |
denotes |
In |
| T13650 |
6205-6209 |
FW |
denotes |
situ |
| T13651 |
6210-6223 |
NN |
denotes |
hybridization |
| T13652 |
6223-6386 |
sentence |
denotes |
The pCRII-TOPO TA vector containing a region of the 3′ UTR of Snail was used as a template to generate digoxigenin-labeled sense and antisense riboprobes (Roche). |
| T13653 |
6224-6227 |
DT |
denotes |
The |
| T13655 |
6228-6233 |
NN |
denotes |
pCRII |
| T13657 |
6233-6234 |
HYPH |
denotes |
- |
| T13656 |
6234-6238 |
NN |
denotes |
TOPO |
| T13658 |
6239-6241 |
NN |
denotes |
TA |
| T13654 |
6242-6248 |
NN |
denotes |
vector |
| T13660 |
6249-6259 |
VBG |
denotes |
containing |
| T13661 |
6260-6261 |
DT |
denotes |
a |
| T13662 |
6262-6268 |
NN |
denotes |
region |
| T13663 |
6269-6271 |
IN |
denotes |
of |
| T13664 |
6272-6275 |
DT |
denotes |
the |
| T13666 |
6276-6277 |
CD |
denotes |
3 |
| T13667 |
6277-6278 |
SYM |
denotes |
′ |
| T13665 |
6279-6282 |
NN |
denotes |
UTR |
| T13668 |
6283-6285 |
IN |
denotes |
of |
| T13669 |
6286-6291 |
NN |
denotes |
Snail |
| T13670 |
6292-6295 |
VBD |
denotes |
was |
| T13659 |
6296-6300 |
VBN |
denotes |
used |
| T13671 |
6301-6303 |
IN |
denotes |
as |
| T13672 |
6304-6305 |
DT |
denotes |
a |
| T13673 |
6306-6314 |
NN |
denotes |
template |
| T13674 |
6315-6317 |
TO |
denotes |
to |
| T13675 |
6318-6326 |
VB |
denotes |
generate |
| T13676 |
6327-6338 |
NN |
denotes |
digoxigenin |
| T13678 |
6338-6339 |
HYPH |
denotes |
- |
| T13677 |
6339-6346 |
VBN |
denotes |
labeled |
| T13680 |
6347-6352 |
NN |
denotes |
sense |
| T13681 |
6353-6356 |
CC |
denotes |
and |
| T13682 |
6357-6366 |
NN |
denotes |
antisense |
| T13679 |
6367-6377 |
NNS |
denotes |
riboprobes |
| T13683 |
6378-6379 |
-LRB- |
denotes |
( |
| T13684 |
6379-6384 |
NNP |
denotes |
Roche |
| T13685 |
6384-6385 |
-RRB- |
denotes |
) |
| T13686 |
6385-6386 |
. |
denotes |
. |
| T13687 |
6386-6452 |
sentence |
denotes |
The respective probes were obtained by XhoI and BamH1 digestions. |
| T13688 |
6387-6390 |
DT |
denotes |
The |
| T13690 |
6391-6401 |
JJ |
denotes |
respective |
| T13689 |
6402-6408 |
NNS |
denotes |
probes |
| T13692 |
6409-6413 |
VBD |
denotes |
were |
| T13691 |
6414-6422 |
VBN |
denotes |
obtained |
| T13693 |
6423-6425 |
IN |
denotes |
by |
| T13694 |
6426-6430 |
NN |
denotes |
XhoI |
| T13696 |
6431-6434 |
CC |
denotes |
and |
| T13697 |
6435-6440 |
NN |
denotes |
BamH1 |
| T13695 |
6441-6451 |
NNS |
denotes |
digestions |
| T13698 |
6451-6452 |
. |
denotes |
. |
| T13699 |
6452-6538 |
sentence |
denotes |
In situ hybridizations were performed on 10-μm thick sections of E17.5 mouse embryos. |
| T13700 |
6453-6455 |
FW |
denotes |
In |
| T13701 |
6456-6460 |
FW |
denotes |
situ |
| T13702 |
6461-6475 |
NNS |
denotes |
hybridizations |
| T13704 |
6476-6480 |
VBD |
denotes |
were |
| T13703 |
6481-6490 |
VBN |
denotes |
performed |
| T13705 |
6491-6493 |
IN |
denotes |
on |
| T13706 |
6494-6496 |
CD |
denotes |
10 |
| T13708 |
6496-6497 |
HYPH |
denotes |
- |
| T13707 |
6497-6499 |
NN |
denotes |
μm |
| T13709 |
6500-6505 |
JJ |
denotes |
thick |
| T13710 |
6506-6514 |
NNS |
denotes |
sections |
| T13711 |
6515-6517 |
IN |
denotes |
of |
| T13712 |
6518-6523 |
NN |
denotes |
E17.5 |
| T13714 |
6524-6529 |
NN |
denotes |
mouse |
| T13713 |
6530-6537 |
NNS |
denotes |
embryos |
| T13715 |
6537-6538 |
. |
denotes |
. |
| T13716 |
6538-6821 |
sentence |
denotes |
The sections were fixed with 4% PFA for 10 min at room temperature, prehybridized at room temperature for 4.5 h, hybridized with the probe (2 μg/ml) at 55 °C for 12–14 h, blocked with 10% NGS, and treated with anti-dig Fab-AP antibody (Roche #1093274) at a 1:2,500 dilution for 3 h. |
| T13717 |
6539-6542 |
DT |
denotes |
The |
| T13718 |
6543-6551 |
NNS |
denotes |
sections |
| T13720 |
6552-6556 |
VBD |
denotes |
were |
| T13719 |
6557-6562 |
VBN |
denotes |
fixed |
| T13721 |
6563-6567 |
IN |
denotes |
with |
| T13722 |
6568-6569 |
CD |
denotes |
4 |
| T13723 |
6569-6570 |
NN |
denotes |
% |
| T13724 |
6571-6574 |
NN |
denotes |
PFA |
| T13725 |
6575-6578 |
IN |
denotes |
for |
| T13726 |
6579-6581 |
CD |
denotes |
10 |
| T13727 |
6582-6585 |
NN |
denotes |
min |
| T13728 |
6586-6588 |
IN |
denotes |
at |
| T13729 |
6589-6593 |
NN |
denotes |
room |
| T13730 |
6594-6605 |
NN |
denotes |
temperature |
| T13731 |
6605-6607 |
, |
denotes |
, |
| T13732 |
6607-6620 |
VBN |
denotes |
prehybridized |
| T13733 |
6621-6623 |
IN |
denotes |
at |
| T13734 |
6624-6628 |
NN |
denotes |
room |
| T13735 |
6629-6640 |
NN |
denotes |
temperature |
| T13736 |
6641-6644 |
IN |
denotes |
for |
| T13737 |
6645-6648 |
CD |
denotes |
4.5 |
| T13738 |
6649-6650 |
NN |
denotes |
h |
| T13739 |
6650-6652 |
, |
denotes |
, |
| T13740 |
6652-6662 |
VBN |
denotes |
hybridized |
| T13741 |
6663-6667 |
IN |
denotes |
with |
| T13742 |
6668-6671 |
DT |
denotes |
the |
| T13743 |
6672-6677 |
NN |
denotes |
probe |
| T13744 |
6678-6679 |
-LRB- |
denotes |
( |
| T13746 |
6679-6680 |
CD |
denotes |
2 |
| T13745 |
6681-6683 |
NN |
denotes |
μg |
| T13747 |
6683-6684 |
SYM |
denotes |
/ |
| T13748 |
6684-6686 |
NN |
denotes |
ml |
| T13749 |
6686-6687 |
-RRB- |
denotes |
) |
| T13750 |
6688-6690 |
IN |
denotes |
at |
| T13751 |
6691-6693 |
CD |
denotes |
55 |
| T13752 |
6694-6696 |
NN |
denotes |
°C |
| T13753 |
6697-6700 |
IN |
denotes |
for |
| T13754 |
6701-6703 |
CD |
denotes |
12 |
| T13756 |
6703-6704 |
SYM |
denotes |
– |
| T13755 |
6704-6706 |
CD |
denotes |
14 |
| T13757 |
6707-6708 |
NN |
denotes |
h |
| T13758 |
6708-6710 |
, |
denotes |
, |
| T13759 |
6710-6717 |
VBN |
denotes |
blocked |
| T13760 |
6718-6722 |
IN |
denotes |
with |
| T13761 |
6723-6725 |
CD |
denotes |
10 |
| T13762 |
6725-6726 |
NN |
denotes |
% |
| T13763 |
6727-6730 |
NN |
denotes |
NGS |
| T13764 |
6730-6732 |
, |
denotes |
, |
| T13765 |
6732-6735 |
CC |
denotes |
and |
| T13766 |
6736-6743 |
VBN |
denotes |
treated |
| T13767 |
6744-6748 |
IN |
denotes |
with |
| T13768 |
6749-6757 |
JJ |
denotes |
anti-dig |
| T13770 |
6758-6761 |
NN |
denotes |
Fab |
| T13772 |
6761-6762 |
HYPH |
denotes |
- |
| T13771 |
6762-6764 |
NN |
denotes |
AP |
| T13769 |
6765-6773 |
NN |
denotes |
antibody |
| T13773 |
6774-6775 |
-LRB- |
denotes |
( |
| T13774 |
6775-6780 |
NNP |
denotes |
Roche |
| T13775 |
6781-6782 |
SYM |
denotes |
# |
| T13776 |
6782-6789 |
CD |
denotes |
1093274 |
| T13777 |
6789-6790 |
-RRB- |
denotes |
) |
| T13778 |
6791-6793 |
IN |
denotes |
at |
| T13779 |
6794-6795 |
DT |
denotes |
a |
| T13781 |
6796-6797 |
CD |
denotes |
1 |
| T13783 |
6797-6798 |
SYM |
denotes |
: |
| T13782 |
6798-6803 |
CD |
denotes |
2,500 |
| T13780 |
6804-6812 |
NN |
denotes |
dilution |
| T13784 |
6813-6816 |
IN |
denotes |
for |
| T13785 |
6817-6818 |
CD |
denotes |
3 |
| T13786 |
6819-6820 |
NN |
denotes |
h |
| T13787 |
6820-6821 |
. |
denotes |
. |
| T13788 |
6821-6903 |
sentence |
denotes |
The sections were incubated with NBT and BCIP until adequate signal was detected. |
| T13789 |
6822-6825 |
DT |
denotes |
The |
| T13790 |
6826-6834 |
NNS |
denotes |
sections |
| T13792 |
6835-6839 |
VBD |
denotes |
were |
| T13791 |
6840-6849 |
VBN |
denotes |
incubated |
| T13793 |
6850-6854 |
IN |
denotes |
with |
| T13794 |
6855-6858 |
NN |
denotes |
NBT |
| T13795 |
6859-6862 |
CC |
denotes |
and |
| T13796 |
6863-6867 |
NN |
denotes |
BCIP |
| T13797 |
6868-6873 |
IN |
denotes |
until |
| T13799 |
6874-6882 |
JJ |
denotes |
adequate |
| T13800 |
6883-6889 |
NN |
denotes |
signal |
| T13801 |
6890-6893 |
VBD |
denotes |
was |
| T13798 |
6894-6902 |
VBN |
denotes |
detected |
| T13802 |
6902-6903 |
. |
denotes |
. |
| T13828 |
6905-6923 |
NN |
denotes |
Immunofluorescence |
| T13829 |
6924-6927 |
CC |
denotes |
and |
| T13830 |
6928-6948 |
NN |
denotes |
immunohistochemistry |
| T13831 |
6948-7046 |
sentence |
denotes |
Tissue samples for immunofluorescence were frozen in OCT and sectioned 10 μm thick on a cryostat. |
| T13832 |
6949-6955 |
NN |
denotes |
Tissue |
| T13833 |
6956-6963 |
NNS |
denotes |
samples |
| T13835 |
6964-6967 |
IN |
denotes |
for |
| T13836 |
6968-6986 |
NN |
denotes |
immunofluorescence |
| T13837 |
6987-6991 |
VBD |
denotes |
were |
| T13834 |
6992-6998 |
VBN |
denotes |
frozen |
| T13838 |
6999-7001 |
IN |
denotes |
in |
| T13839 |
7002-7005 |
NN |
denotes |
OCT |
| T13840 |
7006-7009 |
CC |
denotes |
and |
| T13841 |
7010-7019 |
VBN |
denotes |
sectioned |
| T13842 |
7020-7022 |
CD |
denotes |
10 |
| T13843 |
7023-7025 |
NN |
denotes |
μm |
| T13844 |
7026-7031 |
JJ |
denotes |
thick |
| T13845 |
7032-7034 |
IN |
denotes |
on |
| T13846 |
7035-7036 |
DT |
denotes |
a |
| T13847 |
7037-7045 |
NN |
denotes |
cryostat |
| T13848 |
7045-7046 |
. |
denotes |
. |
| T13849 |
7046-7159 |
sentence |
denotes |
Sections were fixed in 4% paraformaldehyde for 10 min at room temperature, blocked, and stained with antibodies. |
| T13850 |
7047-7055 |
NNS |
denotes |
Sections |
| T13852 |
7056-7060 |
VBD |
denotes |
were |
| T13851 |
7061-7066 |
VBN |
denotes |
fixed |
| T13853 |
7067-7069 |
IN |
denotes |
in |
| T13854 |
7070-7071 |
CD |
denotes |
4 |
| T13855 |
7071-7072 |
NN |
denotes |
% |
| T13856 |
7073-7089 |
NN |
denotes |
paraformaldehyde |
| T13857 |
7090-7093 |
IN |
denotes |
for |
| T13858 |
7094-7096 |
CD |
denotes |
10 |
| T13859 |
7097-7100 |
NN |
denotes |
min |
| T13860 |
7101-7103 |
IN |
denotes |
at |
| T13861 |
7104-7108 |
NN |
denotes |
room |
| T13862 |
7109-7120 |
NN |
denotes |
temperature |
| T13863 |
7120-7122 |
, |
denotes |
, |
| T13864 |
7122-7129 |
VBN |
denotes |
blocked |
| T13865 |
7129-7131 |
, |
denotes |
, |
| T13866 |
7131-7134 |
CC |
denotes |
and |
| T13867 |
7135-7142 |
VBN |
denotes |
stained |
| T13868 |
7143-7147 |
IN |
denotes |
with |
| T13869 |
7148-7158 |
NNS |
denotes |
antibodies |
| T13870 |
7158-7159 |
. |
denotes |
. |
| T13871 |
7159-7272 |
sentence |
denotes |
Tissue samples for immunohistochemistry were fixed in 4% paraformaldehyde, dehydrated, and embedded in paraffin. |
| T13872 |
7160-7166 |
NN |
denotes |
Tissue |
| T13873 |
7167-7174 |
NNS |
denotes |
samples |
| T13875 |
7175-7178 |
IN |
denotes |
for |
| T13876 |
7179-7199 |
NN |
denotes |
immunohistochemistry |
| T13877 |
7200-7204 |
VBD |
denotes |
were |
| T13874 |
7205-7210 |
VBN |
denotes |
fixed |
| T13878 |
7211-7213 |
IN |
denotes |
in |
| T13879 |
7214-7215 |
CD |
denotes |
4 |
| T13880 |
7215-7216 |
NN |
denotes |
% |
| T13881 |
7217-7233 |
NN |
denotes |
paraformaldehyde |
| T13882 |
7233-7235 |
, |
denotes |
, |
| T13883 |
7235-7245 |
VBN |
denotes |
dehydrated |
| T13884 |
7245-7247 |
, |
denotes |
, |
| T13885 |
7247-7250 |
CC |
denotes |
and |
| T13886 |
7251-7259 |
VBN |
denotes |
embedded |
| T13887 |
7260-7262 |
IN |
denotes |
in |
| T13888 |
7263-7271 |
NN |
denotes |
paraffin |
| T13889 |
7271-7272 |
. |
denotes |
. |
| T13890 |
7272-7372 |
sentence |
denotes |
Samples were sectioned on a microtome (10 μm thick) and rehydrated prior to staining with antibody. |
| T13891 |
7273-7280 |
NNS |
denotes |
Samples |
| T13893 |
7281-7285 |
VBD |
denotes |
were |
| T13892 |
7286-7295 |
VBN |
denotes |
sectioned |
| T13894 |
7296-7298 |
IN |
denotes |
on |
| T13895 |
7299-7300 |
DT |
denotes |
a |
| T13896 |
7301-7310 |
NN |
denotes |
microtome |
| T13897 |
7311-7312 |
-LRB- |
denotes |
( |
| T13899 |
7312-7314 |
CD |
denotes |
10 |
| T13900 |
7315-7317 |
NN |
denotes |
μm |
| T13898 |
7318-7323 |
JJ |
denotes |
thick |
| T13901 |
7323-7324 |
-RRB- |
denotes |
) |
| T13902 |
7325-7328 |
CC |
denotes |
and |
| T13903 |
7329-7339 |
VBD |
denotes |
rehydrated |
| T13904 |
7340-7345 |
IN |
denotes |
prior |
| T13905 |
7346-7348 |
IN |
denotes |
to |
| T13906 |
7349-7357 |
VBG |
denotes |
staining |
| T13907 |
7358-7362 |
IN |
denotes |
with |
| T13908 |
7363-7371 |
NN |
denotes |
antibody |
| T13909 |
7371-7372 |
. |
denotes |
. |
| T13910 |
7372-7558 |
sentence |
denotes |
Samples stained with Snail, pMAPK, pSmad2, and cyclin D were antigen unmasked with 10 mM sodium citrate (pH 6) in an Antigen Retriever 2100 (Pickcell Laboratories, Leiden, Netherlands). |
| T13911 |
7373-7380 |
NNS |
denotes |
Samples |
| T13913 |
7381-7388 |
VBN |
denotes |
stained |
| T13914 |
7389-7393 |
IN |
denotes |
with |
| T13915 |
7394-7399 |
NN |
denotes |
Snail |
| T13916 |
7399-7401 |
, |
denotes |
, |
| T13917 |
7401-7406 |
NN |
denotes |
pMAPK |
| T13918 |
7406-7408 |
, |
denotes |
, |
| T13919 |
7408-7414 |
NN |
denotes |
pSmad2 |
| T13920 |
7414-7416 |
, |
denotes |
, |
| T13921 |
7416-7419 |
CC |
denotes |
and |
| T13922 |
7420-7426 |
NN |
denotes |
cyclin |
| T13923 |
7427-7428 |
NN |
denotes |
D |
| T13924 |
7429-7433 |
VBD |
denotes |
were |
| T13925 |
7434-7441 |
NN |
denotes |
antigen |
| T13912 |
7442-7450 |
VBN |
denotes |
unmasked |
| T13926 |
7451-7455 |
IN |
denotes |
with |
| T13927 |
7456-7458 |
CD |
denotes |
10 |
| T13928 |
7459-7461 |
NN |
denotes |
mM |
| T13930 |
7462-7468 |
NN |
denotes |
sodium |
| T13929 |
7469-7476 |
NN |
denotes |
citrate |
| T13931 |
7477-7478 |
-LRB- |
denotes |
( |
| T13932 |
7478-7480 |
NN |
denotes |
pH |
| T13933 |
7481-7482 |
CD |
denotes |
6 |
| T13934 |
7482-7483 |
-RRB- |
denotes |
) |
| T13935 |
7484-7486 |
IN |
denotes |
in |
| T13936 |
7487-7489 |
DT |
denotes |
an |
| T13938 |
7490-7497 |
NNP |
denotes |
Antigen |
| T13937 |
7498-7507 |
NNP |
denotes |
Retriever |
| T13939 |
7508-7512 |
CD |
denotes |
2100 |
| T13940 |
7513-7514 |
-LRB- |
denotes |
( |
| T13942 |
7514-7522 |
NNP |
denotes |
Pickcell |
| T13941 |
7523-7535 |
NNP |
denotes |
Laboratories |
| T13943 |
7535-7537 |
, |
denotes |
, |
| T13944 |
7537-7543 |
NNP |
denotes |
Leiden |
| T13945 |
7543-7545 |
, |
denotes |
, |
| T13946 |
7545-7556 |
NNP |
denotes |
Netherlands |
| T13947 |
7556-7557 |
-RRB- |
denotes |
) |
| T13948 |
7557-7558 |
. |
denotes |
. |
| T13949 |
7558-7667 |
sentence |
denotes |
The DAB substrate kit (Vector Labs) was used according to manufacturer's instructions to develop the signal. |
| T13950 |
7559-7562 |
DT |
denotes |
The |
| T13952 |
7563-7566 |
NN |
denotes |
DAB |
| T13953 |
7567-7576 |
NN |
denotes |
substrate |
| T13951 |
7577-7580 |
NN |
denotes |
kit |
| T13955 |
7581-7582 |
-LRB- |
denotes |
( |
| T13957 |
7582-7588 |
NNP |
denotes |
Vector |
| T13956 |
7589-7593 |
NNPS |
denotes |
Labs |
| T13958 |
7593-7594 |
-RRB- |
denotes |
) |
| T13959 |
7595-7598 |
VBD |
denotes |
was |
| T13954 |
7599-7603 |
VBN |
denotes |
used |
| T13960 |
7604-7613 |
VBG |
denotes |
according |
| T13961 |
7614-7616 |
IN |
denotes |
to |
| T13962 |
7617-7629 |
NN |
denotes |
manufacturer |
| T13964 |
7629-7631 |
POS |
denotes |
's |
| T13963 |
7632-7644 |
NNS |
denotes |
instructions |
| T13965 |
7645-7647 |
TO |
denotes |
to |
| T13966 |
7648-7655 |
VB |
denotes |
develop |
| T13967 |
7656-7659 |
DT |
denotes |
the |
| T13968 |
7660-7666 |
NN |
denotes |
signal |
| T13969 |
7666-7667 |
. |
denotes |
. |
| T14008 |
7669-7671 |
NN |
denotes |
RT |
| T14010 |
7671-7672 |
HYPH |
denotes |
- |
| T14009 |
7672-7675 |
NN |
denotes |
PCR |
| T14011 |
7675-7794 |
sentence |
denotes |
RNA was extracted from keratinocytes or skin tissue with Trizol (Invitrogen) according to the manufacturer's protocol. |
| T14012 |
7676-7679 |
NN |
denotes |
RNA |
| T14014 |
7680-7683 |
VBD |
denotes |
was |
| T14013 |
7684-7693 |
VBN |
denotes |
extracted |
| T14015 |
7694-7698 |
IN |
denotes |
from |
| T14016 |
7699-7712 |
NNS |
denotes |
keratinocytes |
| T14017 |
7713-7715 |
CC |
denotes |
or |
| T14018 |
7716-7720 |
NN |
denotes |
skin |
| T14019 |
7721-7727 |
NN |
denotes |
tissue |
| T14020 |
7728-7732 |
IN |
denotes |
with |
| T14021 |
7733-7739 |
NN |
denotes |
Trizol |
| T14022 |
7740-7741 |
-LRB- |
denotes |
( |
| T14023 |
7741-7751 |
NNP |
denotes |
Invitrogen |
| T14024 |
7751-7752 |
-RRB- |
denotes |
) |
| T14025 |
7753-7762 |
VBG |
denotes |
according |
| T14026 |
7763-7765 |
IN |
denotes |
to |
| T14027 |
7766-7769 |
DT |
denotes |
the |
| T14028 |
7770-7782 |
NN |
denotes |
manufacturer |
| T14030 |
7782-7784 |
POS |
denotes |
's |
| T14029 |
7785-7793 |
NN |
denotes |
protocol |
| T14031 |
7793-7794 |
. |
denotes |
. |
| T14032 |
7794-7877 |
sentence |
denotes |
cDNA was generated using oligo-dT primers and the Superscript II kit (Invitrogen). |
| T14033 |
7795-7799 |
NN |
denotes |
cDNA |
| T14035 |
7800-7803 |
VBD |
denotes |
was |
| T14034 |
7804-7813 |
VBN |
denotes |
generated |
| T14036 |
7814-7819 |
VBG |
denotes |
using |
| T14037 |
7820-7825 |
NN |
denotes |
oligo |
| T14039 |
7825-7826 |
HYPH |
denotes |
- |
| T14038 |
7826-7828 |
NN |
denotes |
dT |
| T14040 |
7829-7836 |
NNS |
denotes |
primers |
| T14041 |
7837-7840 |
CC |
denotes |
and |
| T14042 |
7841-7844 |
DT |
denotes |
the |
| T14044 |
7845-7856 |
NNP |
denotes |
Superscript |
| T14045 |
7857-7859 |
CD |
denotes |
II |
| T14043 |
7860-7863 |
NN |
denotes |
kit |
| T14046 |
7864-7865 |
-LRB- |
denotes |
( |
| T14047 |
7865-7875 |
NNP |
denotes |
Invitrogen |
| T14048 |
7875-7876 |
-RRB- |
denotes |
) |
| T14049 |
7876-7877 |
. |
denotes |
. |
| T14050 |
7877-8090 |
sentence |
denotes |
The primers used for PCR were Snail forward: 5′- CAGCTGGCCAGGCTCTCGGT-3′; Snail reverse: 5′- GCGAGGGCCTCCGGAGCA-3′; GAPDH forward 5′- CGTAGACAAAATGGTGAAGGTCGG-3′; and GAPDH reverse: 5′- AAGCAGTTGGTGGTGCAGGATG-3′. |
| T14051 |
7878-7881 |
DT |
denotes |
The |
| T14052 |
7882-7889 |
NNS |
denotes |
primers |
| T14054 |
7890-7894 |
VBN |
denotes |
used |
| T14055 |
7895-7898 |
IN |
denotes |
for |
| T14056 |
7899-7902 |
NN |
denotes |
PCR |
| T14053 |
7903-7907 |
VBD |
denotes |
were |
| T14057 |
7908-7913 |
NN |
denotes |
Snail |
| T14058 |
7914-7921 |
NN |
denotes |
forward |
| T14059 |
7921-7923 |
: |
denotes |
: |
| T14060 |
7923-7924 |
CD |
denotes |
5 |
| T14062 |
7924-7925 |
SYM |
denotes |
′ |
| T14063 |
7925-7926 |
HYPH |
denotes |
- |
| T14061 |
7927-7947 |
NN |
denotes |
CAGCTGGCCAGGCTCTCGGT |
| T14064 |
7947-7948 |
HYPH |
denotes |
- |
| T14065 |
7948-7949 |
CD |
denotes |
3 |
| T14066 |
7949-7950 |
SYM |
denotes |
′ |
| T14067 |
7950-7951 |
: |
denotes |
; |
| T14068 |
7952-7957 |
NN |
denotes |
Snail |
| T14069 |
7958-7965 |
NN |
denotes |
reverse |
| T14070 |
7965-7967 |
: |
denotes |
: |
| T14071 |
7967-7968 |
CD |
denotes |
5 |
| T14073 |
7968-7969 |
SYM |
denotes |
′ |
| T14074 |
7969-7970 |
HYPH |
denotes |
- |
| T14072 |
7971-7989 |
NN |
denotes |
GCGAGGGCCTCCGGAGCA |
| T14075 |
7989-7990 |
HYPH |
denotes |
- |
| T14076 |
7990-7991 |
CD |
denotes |
3 |
| T14077 |
7991-7992 |
SYM |
denotes |
′ |
| T14078 |
7992-7993 |
: |
denotes |
; |
| T14079 |
7994-7999 |
NN |
denotes |
GAPDH |
| T14080 |
8000-8007 |
NN |
denotes |
forward |
| T14081 |
8008-8009 |
CD |
denotes |
5 |
| T14083 |
8009-8010 |
SYM |
denotes |
′ |
| T14084 |
8010-8011 |
HYPH |
denotes |
- |
| T14082 |
8012-8036 |
NN |
denotes |
CGTAGACAAAATGGTGAAGGTCGG |
| T14085 |
8036-8037 |
HYPH |
denotes |
- |
| T14086 |
8037-8038 |
CD |
denotes |
3 |
| T14087 |
8038-8039 |
SYM |
denotes |
′ |
| T14088 |
8039-8040 |
: |
denotes |
; |
| T14089 |
8041-8044 |
CC |
denotes |
and |
| T14090 |
8045-8050 |
NN |
denotes |
GAPDH |
| T14091 |
8051-8058 |
NN |
denotes |
reverse |
| T14092 |
8058-8060 |
: |
denotes |
: |
| T14093 |
8060-8061 |
CD |
denotes |
5 |
| T14095 |
8061-8062 |
SYM |
denotes |
′ |
| T14096 |
8062-8063 |
HYPH |
denotes |
- |
| T14094 |
8064-8086 |
NN |
denotes |
AAGCAGTTGGTGGTGCAGGATG |
| T14097 |
8086-8087 |
HYPH |
denotes |
- |
| T14098 |
8087-8088 |
CD |
denotes |
3 |
| T14099 |
8088-8089 |
SYM |
denotes |
′ |
| T14100 |
8089-8090 |
. |
denotes |
. |
| R7682 |
T12023 |
T12024 |
amod |
Primary,antibodies |
| R7683 |
T12024 |
T12025 |
nsubj |
antibodies,were |
| R7684 |
T12026 |
T12024 |
acl |
used,antibodies |
| R7685 |
T12027 |
T12025 |
prep |
against,were |
| R7686 |
T12028 |
T12027 |
punct |
: ,against |
| R7687 |
T12029 |
T12030 |
compound |
E,cadherin |
| R7688 |
T12030 |
T12027 |
pobj |
cadherin,against |
| R7689 |
T12031 |
T12030 |
punct |
-,cadherin |
| R7690 |
T12032 |
T12033 |
punct |
(,Takeichi |
| R7691 |
T12033 |
T12030 |
parataxis |
Takeichi,cadherin |
| R7692 |
T12034 |
T12033 |
compound |
M.,Takeichi |
| R7693 |
T12035 |
T12033 |
punct |
", ",Takeichi |
| R7694 |
T12036 |
T12037 |
compound |
Kyoto,University |
| R7695 |
T12037 |
T12033 |
npadvmod |
University,Takeichi |
| R7696 |
T12038 |
T12033 |
punct |
", ",Takeichi |
| R7697 |
T12039 |
T12033 |
npadvmod |
Japan,Takeichi |
| R7698 |
T12040 |
T12033 |
punct |
),Takeichi |
| R7699 |
T12041 |
T12030 |
punct |
;,cadherin |
| R7700 |
T12042 |
T12043 |
compound |
α,catenin |
| R7701 |
T12043 |
T12030 |
conj |
catenin,cadherin |
| R7702 |
T12044 |
T12043 |
punct |
-,catenin |
| R7703 |
T12045 |
T12043 |
punct |
", ",catenin |
| R7704 |
T12046 |
T12047 |
compound |
β,catenin |
| R7705 |
T12047 |
T12043 |
appos |
catenin,catenin |
| R7706 |
T12048 |
T12047 |
punct |
-,catenin |
| R7707 |
T12049 |
T12043 |
punct |
", ",catenin |
| R7708 |
T12050 |
T12043 |
appos |
pMAPK,catenin |
| R7709 |
T12051 |
T12043 |
punct |
", ",catenin |
| R7710 |
T12052 |
T12043 |
appos |
tubulin,catenin |
| R7711 |
T12053 |
T12054 |
punct |
(,Sigma |
| R7712 |
T12054 |
T12043 |
parataxis |
Sigma,catenin |
| R7713 |
T12055 |
T12054 |
punct |
", ",Sigma |
| R7714 |
T12056 |
T12057 |
compound |
St.,Louis |
| R7715 |
T12057 |
T12054 |
npadvmod |
Louis,Sigma |
| R7716 |
T12058 |
T12054 |
punct |
", ",Sigma |
| R7717 |
T12059 |
T12054 |
npadvmod |
Missouri,Sigma |
| R7718 |
T12060 |
T12054 |
punct |
", ",Sigma |
| R7719 |
T12061 |
T12062 |
compound |
United,States |
| R7720 |
T12062 |
T12054 |
npadvmod |
States,Sigma |
| R7721 |
T12063 |
T12054 |
punct |
),Sigma |
| R7722 |
T12064 |
T12043 |
punct |
", ",catenin |
| R7723 |
T12065 |
T12043 |
conj |
Ajuba,catenin |
| R7724 |
T12066 |
T12067 |
punct |
(,Longmore |
| R7725 |
T12067 |
T12065 |
parataxis |
Longmore,Ajuba |
| R7726 |
T12068 |
T12067 |
compound |
G.,Longmore |
| R7727 |
T12069 |
T12067 |
punct |
", ",Longmore |
| R7728 |
T12070 |
T12071 |
compound |
Washington,University |
| R7729 |
T12071 |
T12067 |
npadvmod |
University,Longmore |
| R7730 |
T12072 |
T12067 |
punct |
", ",Longmore |
| R7731 |
T12073 |
T12074 |
compound |
St.,Louis |
| R7732 |
T12074 |
T12067 |
npadvmod |
Louis,Longmore |
| R7733 |
T12075 |
T12067 |
punct |
", ",Longmore |
| R7734 |
T12076 |
T12067 |
npadvmod |
Missouri,Longmore |
| R7735 |
T12077 |
T12067 |
punct |
", ",Longmore |
| R7736 |
T12078 |
T12079 |
compound |
United,States |
| R7737 |
T12079 |
T12067 |
npadvmod |
States,Longmore |
| R7738 |
T12080 |
T12067 |
punct |
),Longmore |
| R7739 |
T12081 |
T12065 |
punct |
;,Ajuba |
| R7740 |
T12082 |
T12083 |
compound |
β4,integrin |
| R7741 |
T12083 |
T12065 |
conj |
integrin,Ajuba |
| R7742 |
T12084 |
T12083 |
punct |
/,integrin |
| R7743 |
T12085 |
T12083 |
appos |
CD104,integrin |
| R7744 |
T12086 |
T12087 |
punct |
(,Pharmingen |
| R7745 |
T12087 |
T12083 |
parataxis |
Pharmingen,integrin |
| R7746 |
T12088 |
T12087 |
compound |
BD,Pharmingen |
| R7747 |
T12089 |
T12087 |
punct |
", ",Pharmingen |
| R7748 |
T12090 |
T12091 |
compound |
San,Diego |
| R7749 |
T12091 |
T12087 |
npadvmod |
Diego,Pharmingen |
| R7750 |
T12092 |
T12087 |
punct |
", ",Pharmingen |
| R7751 |
T12093 |
T12087 |
npadvmod |
California,Pharmingen |
| R7752 |
T12094 |
T12087 |
punct |
", ",Pharmingen |
| R7753 |
T12095 |
T12096 |
compound |
United,States |
| R7754 |
T12096 |
T12087 |
npadvmod |
States,Pharmingen |
| R7755 |
T12097 |
T12087 |
punct |
),Pharmingen |
| R7756 |
T12098 |
T12083 |
punct |
", ",integrin |
| R7757 |
T12099 |
T12083 |
conj |
laminin,integrin |
| R7758 |
T12100 |
T12099 |
nummod |
5,laminin |
| R7759 |
T12101 |
T12102 |
punct |
(,Burgeson |
| R7760 |
T12102 |
T12099 |
parataxis |
Burgeson,laminin |
| R7761 |
T12103 |
T12102 |
compound |
R.,Burgeson |
| R7762 |
T12104 |
T12102 |
punct |
", ",Burgeson |
| R7763 |
T12105 |
T12106 |
compound |
Harvard,University |
| R7764 |
T12106 |
T12102 |
npadvmod |
University,Burgeson |
| R7765 |
T12107 |
T12102 |
punct |
", ",Burgeson |
| R7766 |
T12108 |
T12102 |
npadvmod |
Cambridge,Burgeson |
| R7767 |
T12109 |
T12102 |
punct |
", ",Burgeson |
| R7768 |
T12110 |
T12102 |
npadvmod |
Massachusetts,Burgeson |
| R7769 |
T12111 |
T12102 |
punct |
", ",Burgeson |
| R7770 |
T12112 |
T12113 |
compound |
United,States |
| R7771 |
T12113 |
T12102 |
npadvmod |
States,Burgeson |
| R7772 |
T12114 |
T12102 |
punct |
),Burgeson |
| R7773 |
T12115 |
T12099 |
punct |
", ",laminin |
| R7774 |
T12116 |
T12099 |
conj |
K5,laminin |
| R7775 |
T12117 |
T12116 |
punct |
", ",K5 |
| R7776 |
T12118 |
T12116 |
conj |
K1,K5 |
| R7777 |
T12119 |
T12118 |
punct |
", ",K1 |
| R7778 |
T12120 |
T12118 |
conj |
loricrin,K1 |
| R7779 |
T12121 |
T12122 |
punct |
(,Lab |
| R7780 |
T12122 |
T12120 |
parataxis |
Lab,loricrin |
| R7781 |
T12123 |
T12122 |
compound |
Fuchs,Lab |
| R7782 |
T12124 |
T12122 |
punct |
),Lab |
| R7783 |
T12125 |
T12120 |
punct |
", ",loricrin |
| R7784 |
T12126 |
T12120 |
conj |
involucrin,loricrin |
| R7785 |
T12127 |
T12126 |
punct |
", ",involucrin |
| R7786 |
T12128 |
T12126 |
conj |
fillagrin,involucrin |
| R7787 |
T12129 |
T12130 |
punct |
(,Covance |
| R7788 |
T12130 |
T12128 |
parataxis |
Covance,fillagrin |
| R7789 |
T12131 |
T12130 |
punct |
", ",Covance |
| R7790 |
T12132 |
T12130 |
npadvmod |
Berkeley,Covance |
| R7791 |
T12133 |
T12130 |
punct |
", ",Covance |
| R7792 |
T12134 |
T12130 |
npadvmod |
California,Covance |
| R7793 |
T12135 |
T12130 |
punct |
", ",Covance |
| R7794 |
T12136 |
T12137 |
compound |
United,States |
| R7795 |
T12137 |
T12130 |
npadvmod |
States,Covance |
| R7796 |
T12138 |
T12130 |
punct |
),Covance |
| R7797 |
T12139 |
T12128 |
punct |
", ",fillagrin |
| R7798 |
T12140 |
T12128 |
conj |
MAPK,fillagrin |
| R7799 |
T12141 |
T12140 |
punct |
", ",MAPK |
| R7800 |
T12142 |
T12140 |
conj |
pSMAD2,MAPK |
| R7801 |
T12143 |
T12144 |
punct |
(,Signaling |
| R7802 |
T12144 |
T12142 |
parataxis |
Signaling,pSMAD2 |
| R7803 |
T12145 |
T12144 |
compound |
Cell,Signaling |
| R7804 |
T12146 |
T12144 |
punct |
", ",Signaling |
| R7805 |
T12147 |
T12144 |
npadvmod |
Beverly,Signaling |
| R7806 |
T12148 |
T12144 |
punct |
", ",Signaling |
| R7807 |
T12149 |
T12144 |
npadvmod |
Massachusetts,Signaling |
| R7808 |
T12150 |
T12144 |
punct |
", ",Signaling |
| R7809 |
T12151 |
T12152 |
compound |
United,States |
| R7810 |
T12152 |
T12144 |
npadvmod |
States,Signaling |
| R7811 |
T12153 |
T12144 |
punct |
),Signaling |
| R7812 |
T12154 |
T12142 |
punct |
;,pSMAD2 |
| R7813 |
T12155 |
T12142 |
conj |
Grb,pSMAD2 |
| R7814 |
T12156 |
T12155 |
punct |
-,Grb |
| R7815 |
T12157 |
T12155 |
nummod |
2,Grb |
| R7816 |
T12158 |
T12159 |
punct |
(,Biotech |
| R7817 |
T12159 |
T12155 |
parataxis |
Biotech,Grb |
| R7818 |
T12160 |
T12161 |
compound |
Santa,Cruz |
| R7819 |
T12161 |
T12159 |
compound |
Cruz,Biotech |
| R7820 |
T12162 |
T12159 |
punct |
", ",Biotech |
| R7821 |
T12163 |
T12164 |
compound |
Santa,Cruz |
| R7822 |
T12164 |
T12159 |
npadvmod |
Cruz,Biotech |
| R7823 |
T12165 |
T12159 |
punct |
", ",Biotech |
| R7824 |
T12166 |
T12159 |
npadvmod |
California,Biotech |
| R7825 |
T12167 |
T12159 |
punct |
", ",Biotech |
| R7826 |
T12168 |
T12169 |
compound |
United,States |
| R7827 |
T12169 |
T12159 |
npadvmod |
States,Biotech |
| R7828 |
T12170 |
T12159 |
punct |
),Biotech |
| R7829 |
T12171 |
T12155 |
punct |
;,Grb |
| R7830 |
T12172 |
T12173 |
compound |
P,cadherin |
| R7831 |
T12173 |
T12155 |
conj |
cadherin,Grb |
| R7832 |
T12174 |
T12173 |
punct |
-,cadherin |
| R7833 |
T12175 |
T12176 |
punct |
(,Laboratories |
| R7834 |
T12176 |
T12173 |
parataxis |
Laboratories,cadherin |
| R7835 |
T12177 |
T12176 |
compound |
Zymed,Laboratories |
| R7836 |
T12178 |
T12176 |
punct |
", ",Laboratories |
| R7837 |
T12179 |
T12180 |
amod |
South,Francisco |
| R7838 |
T12180 |
T12176 |
npadvmod |
Francisco,Laboratories |
| R7839 |
T12181 |
T12180 |
compound |
San,Francisco |
| R7840 |
T12182 |
T12176 |
punct |
", ",Laboratories |
| R7841 |
T12183 |
T12176 |
npadvmod |
California,Laboratories |
| R7842 |
T12184 |
T12176 |
punct |
", ",Laboratories |
| R7843 |
T12185 |
T12186 |
compound |
United,States |
| R7844 |
T12186 |
T12176 |
npadvmod |
States,Laboratories |
| R7845 |
T12187 |
T12176 |
punct |
),Laboratories |
| R7846 |
T12188 |
T12173 |
punct |
;,cadherin |
| R7847 |
T12189 |
T12173 |
conj |
HA,cadherin |
| R7848 |
T12190 |
T12191 |
punct |
(,Biochemicals |
| R7849 |
T12191 |
T12189 |
parataxis |
Biochemicals,HA |
| R7850 |
T12192 |
T12191 |
compound |
Roche,Biochemicals |
| R7851 |
T12193 |
T12191 |
punct |
),Biochemicals |
| R7852 |
T12194 |
T12189 |
punct |
", ",HA |
| R7853 |
T12195 |
T12189 |
conj |
vimentin,HA |
| R7854 |
T12196 |
T12197 |
punct |
(,Chemicon |
| R7855 |
T12197 |
T12195 |
parataxis |
Chemicon,vimentin |
| R7856 |
T12198 |
T12197 |
punct |
", ",Chemicon |
| R7857 |
T12199 |
T12197 |
npadvmod |
Temecula,Chemicon |
| R7858 |
T12200 |
T12197 |
punct |
", ",Chemicon |
| R7859 |
T12201 |
T12197 |
npadvmod |
California,Chemicon |
| R7860 |
T12202 |
T12197 |
punct |
", ",Chemicon |
| R7861 |
T12203 |
T12204 |
compound |
United,States |
| R7862 |
T12204 |
T12197 |
npadvmod |
States,Chemicon |
| R7863 |
T12205 |
T12197 |
punct |
),Chemicon |
| R7864 |
T12206 |
T12195 |
punct |
", ",vimentin |
| R7865 |
T12207 |
T12195 |
conj |
Ki67,vimentin |
| R7866 |
T12208 |
T12209 |
punct |
(,Castra |
| R7867 |
T12209 |
T12207 |
parataxis |
Castra,Ki67 |
| R7868 |
T12210 |
T12209 |
compound |
Novo,Castra |
| R7869 |
T12211 |
T12209 |
punct |
", ",Castra |
| R7870 |
T12212 |
T12209 |
npadvmod |
Newcastle,Castra |
| R7871 |
T12213 |
T12212 |
prep |
Upon,Newcastle |
| R7872 |
T12214 |
T12213 |
pobj |
Tyne,Upon |
| R7873 |
T12215 |
T12209 |
punct |
", ",Castra |
| R7874 |
T12216 |
T12217 |
compound |
United,Kingdom |
| R7875 |
T12217 |
T12209 |
npadvmod |
Kingdom,Castra |
| R7876 |
T12218 |
T12209 |
punct |
),Castra |
| R7877 |
T12219 |
T12207 |
punct |
", ",Ki67 |
| R7878 |
T12220 |
T12207 |
conj |
keratin,Ki67 |
| R7879 |
T12221 |
T12220 |
nummod |
6,keratin |
| R7880 |
T12222 |
T12223 |
punct |
(,Coulombe |
| R7881 |
T12223 |
T12220 |
parataxis |
Coulombe,keratin |
| R7882 |
T12224 |
T12223 |
compound |
P.,Coulombe |
| R7883 |
T12225 |
T12223 |
punct |
", ",Coulombe |
| R7884 |
T12226 |
T12227 |
compound |
John,Hopkins |
| R7885 |
T12227 |
T12228 |
compound |
Hopkins,University |
| R7886 |
T12228 |
T12223 |
npadvmod |
University,Coulombe |
| R7887 |
T12229 |
T12223 |
punct |
", ",Coulombe |
| R7888 |
T12230 |
T12223 |
npadvmod |
Baltimore,Coulombe |
| R7889 |
T12231 |
T12223 |
punct |
", ",Coulombe |
| R7890 |
T12232 |
T12223 |
npadvmod |
Maryland,Coulombe |
| R7891 |
T12233 |
T12223 |
punct |
", ",Coulombe |
| R7892 |
T12234 |
T12235 |
compound |
United,States |
| R7893 |
T12235 |
T12223 |
npadvmod |
States,Coulombe |
| R7894 |
T12236 |
T12223 |
punct |
),Coulombe |
| R7895 |
T12237 |
T12220 |
punct |
", ",keratin |
| R7896 |
T12238 |
T12239 |
compound |
cyclin,D |
| R7897 |
T12239 |
T12220 |
conj |
D,keratin |
| R7898 |
T12240 |
T12241 |
punct |
(,Oncogene |
| R7899 |
T12241 |
T12239 |
parataxis |
Oncogene,D |
| R7900 |
T12242 |
T12241 |
punct |
", ",Oncogene |
| R7901 |
T12243 |
T12244 |
compound |
San,Diego |
| R7902 |
T12244 |
T12241 |
npadvmod |
Diego,Oncogene |
| R7903 |
T12245 |
T12241 |
punct |
", ",Oncogene |
| R7904 |
T12246 |
T12241 |
npadvmod |
California,Oncogene |
| R7905 |
T12247 |
T12241 |
punct |
", ",Oncogene |
| R7906 |
T12248 |
T12249 |
compound |
United,States |
| R7907 |
T12249 |
T12241 |
npadvmod |
States,Oncogene |
| R7908 |
T12250 |
T12241 |
punct |
),Oncogene |
| R7909 |
T12251 |
T12239 |
punct |
", ",D |
| R7910 |
T12252 |
T12239 |
cc |
and,D |
| R7911 |
T12253 |
T12254 |
compound |
TGF,β2 |
| R7912 |
T12254 |
T12239 |
conj |
β2,D |
| R7913 |
T12255 |
T12254 |
punct |
-,β2 |
| R7914 |
T12256 |
T12257 |
punct |
(,Gold |
| R7915 |
T12257 |
T12254 |
parataxis |
Gold,β2 |
| R7916 |
T12258 |
T12257 |
compound |
L.,Gold |
| R7917 |
T12259 |
T12257 |
punct |
", ",Gold |
| R7918 |
T12260 |
T12261 |
compound |
New,York |
| R7919 |
T12261 |
T12262 |
compound |
York,University |
| R7920 |
T12262 |
T12257 |
npadvmod |
University,Gold |
| R7921 |
T12263 |
T12257 |
punct |
", ",Gold |
| R7922 |
T12264 |
T12265 |
compound |
New,York |
| R7923 |
T12265 |
T12257 |
npadvmod |
York,Gold |
| R7924 |
T12266 |
T12257 |
punct |
", ",Gold |
| R7925 |
T12267 |
T12268 |
compound |
New,York |
| R7926 |
T12268 |
T12257 |
npadvmod |
York,Gold |
| R7927 |
T12269 |
T12257 |
punct |
", ",Gold |
| R7928 |
T12270 |
T12271 |
compound |
United,States |
| R7929 |
T12271 |
T12257 |
npadvmod |
States,Gold |
| R7930 |
T12272 |
T12257 |
punct |
),Gold |
| R7931 |
T12273 |
T12025 |
punct |
.,were |
| R7932 |
T12275 |
T12276 |
npadvmod |
FITC,conjugated |
| R7933 |
T12276 |
T12286 |
amod |
conjugated,antibodies |
| R7934 |
T12277 |
T12275 |
punct |
-,FITC |
| R7935 |
T12278 |
T12275 |
punct |
", ",FITC |
| R7936 |
T12279 |
T12280 |
compound |
Texas,Red |
| R7937 |
T12280 |
T12275 |
conj |
Red,FITC |
| R7938 |
T12281 |
T12280 |
punct |
-,Red |
| R7939 |
T12282 |
T12280 |
punct |
", ",Red |
| R7940 |
T12283 |
T12280 |
cc |
or,Red |
| R7941 |
T12284 |
T12280 |
conj |
HRP,Red |
| R7942 |
T12285 |
T12276 |
punct |
-,conjugated |
| R7943 |
T12286 |
T12288 |
nsubj |
antibodies,were |
| R7944 |
T12287 |
T12286 |
amod |
secondary,antibodies |
| R7945 |
T12289 |
T12288 |
prep |
from,were |
| R7946 |
T12290 |
T12291 |
compound |
Jackson,ImmunoResearch |
| R7947 |
T12291 |
T12289 |
pobj |
ImmunoResearch,from |
| R7948 |
T12292 |
T12293 |
punct |
(,Grove |
| R7949 |
T12293 |
T12291 |
parataxis |
Grove,ImmunoResearch |
| R7950 |
T12294 |
T12293 |
compound |
West,Grove |
| R7951 |
T12295 |
T12293 |
punct |
", ",Grove |
| R7952 |
T12296 |
T12293 |
npadvmod |
Pennsylvania,Grove |
| R7953 |
T12297 |
T12293 |
punct |
", ",Grove |
| R7954 |
T12298 |
T12299 |
compound |
United,States |
| R7955 |
T12299 |
T12293 |
npadvmod |
States,Grove |
| R7956 |
T12300 |
T12293 |
punct |
),Grove |
| R7957 |
T12301 |
T12288 |
punct |
.,were |
| R7958 |
T12303 |
T12304 |
amod |
Biotinylated,antibodies |
| R7959 |
T12304 |
T12306 |
nsubj |
antibodies,were |
| R7960 |
T12305 |
T12304 |
amod |
secondary,antibodies |
| R7961 |
T12307 |
T12306 |
prep |
from,were |
| R7962 |
T12308 |
T12309 |
compound |
Vector,Labs |
| R7963 |
T12309 |
T12307 |
pobj |
Labs,from |
| R7964 |
T12310 |
T12311 |
punct |
(,Burlingame |
| R7965 |
T12311 |
T12309 |
parataxis |
Burlingame,Labs |
| R7966 |
T12312 |
T12311 |
punct |
", ",Burlingame |
| R7967 |
T12313 |
T12311 |
npadvmod |
California,Burlingame |
| R7968 |
T12314 |
T12311 |
punct |
", ",Burlingame |
| R7969 |
T12315 |
T12316 |
compound |
United,States |
| R7970 |
T12316 |
T12311 |
npadvmod |
States,Burlingame |
| R7971 |
T12317 |
T12311 |
punct |
),Burlingame |
| R7972 |
T12318 |
T12306 |
punct |
.,were |
| R7973 |
T12320 |
T12321 |
nsubj |
Dilutions,were |
| R7974 |
T12322 |
T12321 |
prep |
according,were |
| R7975 |
T12323 |
T12322 |
prep |
to,according |
| R7976 |
T12324 |
T12325 |
det |
the,manufacturer |
| R7977 |
T12325 |
T12326 |
poss |
manufacturer,recommendation |
| R7978 |
T12326 |
T12323 |
pobj |
recommendation,to |
| R7979 |
T12327 |
T12325 |
case |
's,manufacturer |
| R7980 |
T12328 |
T12321 |
punct |
.,were |
| R7981 |
T12330 |
T12331 |
det |
The,antibody |
| R7982 |
T12331 |
T12333 |
nsubjpass |
antibody,generated |
| R7983 |
T12332 |
T12331 |
compound |
Snail,antibody |
| R7984 |
T12334 |
T12333 |
auxpass |
was,generated |
| R7985 |
T12335 |
T12333 |
prep |
in,generated |
| R7986 |
T12336 |
T12337 |
compound |
Guinea,pigs |
| R7987 |
T12337 |
T12335 |
pobj |
pigs,in |
| R7988 |
T12338 |
T12333 |
prep |
by,generated |
| R7989 |
T12339 |
T12338 |
pcomp |
inoculating,by |
| R7990 |
T12340 |
T12339 |
dobj |
them,inoculating |
| R7991 |
T12341 |
T12339 |
prep |
with,inoculating |
| R7992 |
T12342 |
T12343 |
det |
the,sequence |
| R7993 |
T12343 |
T12341 |
pobj |
sequence,with |
| R7994 |
T12344 |
T12345 |
npadvmod |
N,terminal |
| R7995 |
T12345 |
T12343 |
amod |
terminal,sequence |
| R7996 |
T12346 |
T12345 |
punct |
-,terminal |
| R7997 |
T12347 |
T12343 |
prep |
of,sequence |
| R7998 |
T12348 |
T12349 |
amod |
murine,Snail |
| R7999 |
T12349 |
T12347 |
pobj |
Snail,of |
| R8000 |
T12350 |
T12343 |
acl |
fused,sequence |
| R8001 |
T12351 |
T12350 |
prep |
to,fused |
| R8002 |
T12352 |
T12351 |
pobj |
GST,to |
| R8003 |
T12353 |
T12354 |
punct |
(,Covance |
| R8004 |
T12354 |
T12352 |
parataxis |
Covance,GST |
| R8005 |
T12355 |
T12354 |
punct |
", ",Covance |
| R8006 |
T12356 |
T12354 |
npadvmod |
Princeton,Covance |
| R8007 |
T12357 |
T12354 |
punct |
", ",Covance |
| R8008 |
T12358 |
T12359 |
compound |
New,Jersey |
| R8009 |
T12359 |
T12354 |
npadvmod |
Jersey,Covance |
| R8010 |
T12360 |
T12354 |
punct |
", ",Covance |
| R8011 |
T12361 |
T12362 |
compound |
United,States |
| R8012 |
T12362 |
T12354 |
npadvmod |
States,Covance |
| R8013 |
T12363 |
T12354 |
punct |
),Covance |
| R8014 |
T12364 |
T12333 |
punct |
.,generated |
| R8015 |
T12366 |
T12367 |
amod |
Recombinant,β2 |
| R8016 |
T12367 |
T12371 |
nsubjpass |
β2,purchased |
| R8017 |
T12368 |
T12367 |
amod |
human,β2 |
| R8018 |
T12369 |
T12367 |
compound |
TGF,β2 |
| R8019 |
T12370 |
T12367 |
punct |
-,β2 |
| R8020 |
T12372 |
T12371 |
auxpass |
was,purchased |
| R8021 |
T12373 |
T12371 |
prep |
from,purchased |
| R8022 |
T12374 |
T12373 |
pobj |
R,from |
| R8023 |
T12375 |
T12374 |
cc |
&,R |
| R8024 |
T12376 |
T12374 |
conj |
D,R |
| R8025 |
T12377 |
T12378 |
punct |
(,Minneapolis |
| R8026 |
T12378 |
T12376 |
parataxis |
Minneapolis,D |
| R8027 |
T12379 |
T12378 |
punct |
", ",Minneapolis |
| R8028 |
T12380 |
T12378 |
npadvmod |
Minnesota,Minneapolis |
| R8029 |
T12381 |
T12378 |
punct |
", ",Minneapolis |
| R8030 |
T12382 |
T12383 |
compound |
United,States |
| R8031 |
T12383 |
T12378 |
npadvmod |
States,Minneapolis |
| R8032 |
T12384 |
T12378 |
punct |
),Minneapolis |
| R8033 |
T12385 |
T12371 |
punct |
.,purchased |
| R8034 |
T12387 |
T12388 |
npadvmod |
Heat,inactivated |
| R8035 |
T12388 |
T12389 |
amod |
inactivated,β2 |
| R8036 |
T12389 |
T12392 |
nsubjpass |
β2,generated |
| R8037 |
T12390 |
T12389 |
compound |
TGF,β2 |
| R8038 |
T12391 |
T12389 |
punct |
-,β2 |
| R8039 |
T12393 |
T12392 |
auxpass |
was,generated |
| R8040 |
T12394 |
T12392 |
prep |
by,generated |
| R8041 |
T12395 |
T12394 |
pcomp |
heating,by |
| R8042 |
T12396 |
T12397 |
det |
the,protein |
| R8043 |
T12397 |
T12395 |
dobj |
protein,heating |
| R8044 |
T12398 |
T12397 |
amod |
recombinant,protein |
| R8045 |
T12399 |
T12395 |
prep |
at,heating |
| R8046 |
T12400 |
T12401 |
nummod |
100,°C |
| R8047 |
T12401 |
T12399 |
pobj |
°C,at |
| R8048 |
T12402 |
T12395 |
prep |
for,heating |
| R8049 |
T12403 |
T12404 |
nummod |
10,min |
| R8050 |
T12404 |
T12402 |
pobj |
min,for |
| R8051 |
T12405 |
T12392 |
punct |
.,generated |
| R8052 |
T12466 |
T12467 |
det |
The,mouse |
| R8053 |
T12467 |
T12472 |
nsubjpass |
mouse,generated |
| R8054 |
T12468 |
T12469 |
compound |
K14,Snail |
| R8055 |
T12469 |
T12467 |
compound |
Snail,mouse |
| R8056 |
T12470 |
T12469 |
punct |
-,Snail |
| R8057 |
T12471 |
T12467 |
compound |
Tg,mouse |
| R8058 |
T12473 |
T12472 |
auxpass |
was,generated |
| R8059 |
T12474 |
T12472 |
prep |
by,generated |
| R8060 |
T12475 |
T12474 |
pcomp |
digesting,by |
| R8061 |
T12476 |
T12477 |
det |
the,plasmid |
| R8062 |
T12477 |
T12475 |
dobj |
plasmid,digesting |
| R8063 |
T12478 |
T12479 |
compound |
pcDNA3,mm |
| R8064 |
T12479 |
T12477 |
compound |
mm,plasmid |
| R8065 |
T12480 |
T12479 |
punct |
-,mm |
| R8066 |
T12481 |
T12482 |
compound |
Snail,HA |
| R8067 |
T12482 |
T12477 |
compound |
HA,plasmid |
| R8068 |
T12483 |
T12482 |
punct |
-,HA |
| R8069 |
T12484 |
T12485 |
punct |
(,Herreros |
| R8070 |
T12485 |
T12477 |
parataxis |
Herreros,plasmid |
| R8071 |
T12486 |
T12485 |
compound |
G.,Herreros |
| R8072 |
T12487 |
T12485 |
compound |
de,Herreros |
| R8073 |
T12488 |
T12485 |
punct |
", ",Herreros |
| R8074 |
T12489 |
T12490 |
compound |
Universitat,Pompeu |
| R8075 |
T12490 |
T12485 |
npadvmod |
Pompeu,Herreros |
| R8076 |
T12491 |
T12485 |
punct |
", ",Herreros |
| R8077 |
T12492 |
T12485 |
npadvmod |
Fabra,Herreros |
| R8078 |
T12493 |
T12485 |
punct |
", ",Herreros |
| R8079 |
T12494 |
T12485 |
npadvmod |
Barcelona,Herreros |
| R8080 |
T12495 |
T12485 |
punct |
", ",Herreros |
| R8081 |
T12496 |
T12485 |
npadvmod |
Spain,Herreros |
| R8082 |
T12497 |
T12485 |
punct |
),Herreros |
| R8083 |
T12498 |
T12475 |
prep |
with,digesting |
| R8084 |
T12499 |
T12498 |
pobj |
BamHI,with |
| R8085 |
T12500 |
T12499 |
cc |
and,BamHI |
| R8086 |
T12501 |
T12499 |
conj |
NotI,BamHI |
| R8087 |
T12502 |
T12472 |
cc |
and,generated |
| R8088 |
T12503 |
T12472 |
conj |
subcloned,generated |
| R8089 |
T12504 |
T12503 |
prep |
into,subcloned |
| R8090 |
T12505 |
T12506 |
det |
the,vector |
| R8091 |
T12506 |
T12504 |
pobj |
vector,into |
| R8092 |
T12507 |
T12506 |
compound |
K14,vector |
| R8093 |
T12508 |
T12509 |
punct |
[,49 |
| R8094 |
T12509 |
T12503 |
parataxis |
49,subcloned |
| R8095 |
T12510 |
T12509 |
punct |
],49 |
| R8096 |
T12511 |
T12472 |
punct |
.,generated |
| R8097 |
T12513 |
T12514 |
det |
The,construct |
| R8098 |
T12514 |
T12516 |
nsubjpass |
construct,injected |
| R8099 |
T12515 |
T12514 |
amod |
linearized,construct |
| R8100 |
T12517 |
T12516 |
auxpass |
was,injected |
| R8101 |
T12518 |
T12516 |
prep |
into,injected |
| R8102 |
T12519 |
T12520 |
det |
the,nucleus |
| R8103 |
T12520 |
T12518 |
pobj |
nucleus,into |
| R8104 |
T12521 |
T12520 |
prep |
of,nucleus |
| R8105 |
T12522 |
T12521 |
pobj |
embryos,of |
| R8106 |
T12523 |
T12522 |
prep |
from,embryos |
| R8107 |
T12524 |
T12525 |
compound |
CD1,mice |
| R8108 |
T12525 |
T12523 |
pobj |
mice,from |
| R8109 |
T12526 |
T12516 |
punct |
.,injected |
| R8110 |
T12528 |
T12529 |
det |
The,mouse |
| R8111 |
T12529 |
T12535 |
nsubjpass |
mouse,reported |
| R8112 |
T12530 |
T12531 |
nmod |
K14,Smad |
| R8113 |
T12531 |
T12529 |
nmod |
Smad,mouse |
| R8114 |
T12532 |
T12531 |
punct |
-,Smad |
| R8115 |
T12533 |
T12534 |
nummod |
2,Tg |
| R8116 |
T12534 |
T12529 |
compound |
Tg,mouse |
| R8117 |
T12536 |
T12535 |
auxpass |
was,reported |
| R8118 |
T12537 |
T12535 |
prep |
in,reported |
| R8119 |
T12538 |
T12537 |
pobj |
Ito,in |
| R8120 |
T12539 |
T12540 |
advmod |
et,al. |
| R8121 |
T12540 |
T12538 |
advmod |
al.,Ito |
| R8122 |
T12541 |
T12538 |
punct |
", ",Ito |
| R8123 |
T12542 |
T12538 |
npadvmod |
2001,Ito |
| R8124 |
T12543 |
T12535 |
punct |
.,reported |
| R8125 |
T12545 |
T12546 |
det |
The,mouse |
| R8126 |
T12546 |
T12554 |
nsubjpass |
mouse,described |
| R8127 |
T12547 |
T12548 |
nmod |
TGF,β2 |
| R8128 |
T12548 |
T12546 |
nmod |
β2,mouse |
| R8129 |
T12549 |
T12548 |
punct |
-,β2 |
| R8130 |
T12550 |
T12548 |
appos |
knockout,β2 |
| R8131 |
T12551 |
T12550 |
punct |
(,knockout |
| R8132 |
T12552 |
T12550 |
appos |
KO,knockout |
| R8133 |
T12553 |
T12546 |
punct |
),mouse |
| R8134 |
T12555 |
T12554 |
auxpass |
was,described |
| R8135 |
T12556 |
T12554 |
prep |
in,described |
| R8136 |
T12557 |
T12558 |
punct |
[,34 |
| R8137 |
T12558 |
T12556 |
pobj |
34,in |
| R8138 |
T12559 |
T12554 |
punct |
],described |
| R8139 |
T12560 |
T12554 |
punct |
.,described |
| R8140 |
T12562 |
T12563 |
det |
The,mouse |
| R8141 |
T12563 |
T12566 |
nsubjpass |
mouse,reported |
| R8142 |
T12564 |
T12565 |
compound |
shh,KO |
| R8143 |
T12565 |
T12563 |
compound |
KO,mouse |
| R8144 |
T12567 |
T12568 |
punct |
[,38 |
| R8145 |
T12568 |
T12563 |
parataxis |
38,mouse |
| R8146 |
T12569 |
T12568 |
punct |
],38 |
| R8147 |
T12570 |
T12563 |
cc |
and,mouse |
| R8148 |
T12571 |
T12572 |
compound |
TOPGal,mouse |
| R8149 |
T12572 |
T12563 |
conj |
mouse,mouse |
| R8150 |
T12573 |
T12574 |
punct |
[,20 |
| R8151 |
T12574 |
T12572 |
parataxis |
20,mouse |
| R8152 |
T12575 |
T12574 |
punct |
],20 |
| R8153 |
T12576 |
T12566 |
aux |
have,reported |
| R8154 |
T12577 |
T12566 |
advmod |
previously,reported |
| R8155 |
T12578 |
T12566 |
auxpass |
been,reported |
| R8156 |
T12579 |
T12566 |
punct |
.,reported |
| R8157 |
T12687 |
T12688 |
compound |
Western,blot |
| R8158 |
T12689 |
T12688 |
cc |
and,blot |
| R8159 |
T12690 |
T12688 |
conj |
immunoprecipitation,blot |
| R8160 |
T12692 |
T12693 |
compound |
Protein,extracts |
| R8161 |
T12693 |
T12694 |
nsubjpass |
extracts,generated |
| R8162 |
T12695 |
T12693 |
prep |
from,extracts |
| R8163 |
T12696 |
T12697 |
amod |
primary,keratinocytes |
| R8164 |
T12697 |
T12695 |
pobj |
keratinocytes,from |
| R8165 |
T12698 |
T12694 |
auxpass |
were,generated |
| R8166 |
T12699 |
T12700 |
preconj |
either,by |
| R8167 |
T12700 |
T12694 |
prep |
by,generated |
| R8168 |
T12701 |
T12700 |
pcomp |
lysing,by |
| R8169 |
T12702 |
T12701 |
dobj |
cells,lysing |
| R8170 |
T12703 |
T12701 |
prep |
in,lysing |
| R8171 |
T12704 |
T12705 |
compound |
lysis,buffer |
| R8172 |
T12705 |
T12703 |
pobj |
buffer,in |
| R8173 |
T12706 |
T12707 |
punct |
(,NP |
| R8174 |
T12707 |
T12705 |
parataxis |
NP,buffer |
| R8175 |
T12708 |
T12709 |
nummod |
1,% |
| R8176 |
T12709 |
T12707 |
compound |
%,NP |
| R8177 |
T12710 |
T12707 |
punct |
-,NP |
| R8178 |
T12711 |
T12707 |
nummod |
40,NP |
| R8179 |
T12712 |
T12707 |
punct |
", ",NP |
| R8180 |
T12713 |
T12714 |
nummod |
1,% |
| R8181 |
T12714 |
T12715 |
compound |
%,deoxycholate |
| R8182 |
T12715 |
T12707 |
conj |
deoxycholate,NP |
| R8183 |
T12716 |
T12715 |
compound |
sodium,deoxycholate |
| R8184 |
T12717 |
T12715 |
punct |
", ",deoxycholate |
| R8185 |
T12718 |
T12719 |
nummod |
20,mM |
| R8186 |
T12719 |
T12720 |
compound |
mM,Cl |
| R8187 |
T12720 |
T12715 |
conj |
Cl,deoxycholate |
| R8188 |
T12721 |
T12720 |
compound |
Tris,Cl |
| R8189 |
T12722 |
T12720 |
punct |
-,Cl |
| R8190 |
T12723 |
T12720 |
punct |
[,Cl |
| R8191 |
T12724 |
T12720 |
npadvmod |
pH,Cl |
| R8192 |
T12725 |
T12724 |
nummod |
7.4,pH |
| R8193 |
T12726 |
T12720 |
punct |
],Cl |
| R8194 |
T12727 |
T12720 |
punct |
", ",Cl |
| R8195 |
T12728 |
T12729 |
nummod |
140,mM |
| R8196 |
T12729 |
T12730 |
compound |
mM,NaCl |
| R8197 |
T12730 |
T12720 |
conj |
NaCl,Cl |
| R8198 |
T12731 |
T12730 |
acl |
containing,NaCl |
| R8199 |
T12732 |
T12733 |
nummod |
1,mM |
| R8200 |
T12733 |
T12734 |
compound |
mM,vanadate |
| R8201 |
T12734 |
T12731 |
dobj |
vanadate,containing |
| R8202 |
T12735 |
T12734 |
compound |
sodium,vanadate |
| R8203 |
T12736 |
T12730 |
punct |
", ",NaCl |
| R8204 |
T12737 |
T12738 |
nummod |
2,mM |
| R8205 |
T12738 |
T12739 |
compound |
mM,fluoride |
| R8206 |
T12739 |
T12730 |
conj |
fluoride,NaCl |
| R8207 |
T12740 |
T12739 |
compound |
phenylmethylsulfonyl,fluoride |
| R8208 |
T12741 |
T12739 |
punct |
", ",fluoride |
| R8209 |
T12742 |
T12739 |
cc |
and,fluoride |
| R8210 |
T12743 |
T12744 |
compound |
protease,inhibitors |
| R8211 |
T12744 |
T12739 |
conj |
inhibitors,fluoride |
| R8212 |
T12745 |
T12707 |
punct |
),NP |
| R8213 |
T12746 |
T12703 |
cc |
or,in |
| R8214 |
T12747 |
T12748 |
advmod |
directly,in |
| R8215 |
T12748 |
T12703 |
conj |
in,in |
| R8216 |
T12749 |
T12750 |
compound |
Laemmli,bβuffer |
| R8217 |
T12750 |
T12748 |
pobj |
bβuffer,in |
| R8218 |
T12751 |
T12694 |
cc |
and,generated |
| R8219 |
T12752 |
T12694 |
conj |
boiled,generated |
| R8220 |
T12753 |
T12694 |
punct |
.,generated |
| R8221 |
T12755 |
T12756 |
prep |
For,pulverized |
| R8222 |
T12757 |
T12758 |
compound |
skin,tissue |
| R8223 |
T12758 |
T12755 |
pobj |
tissue,For |
| R8224 |
T12759 |
T12756 |
punct |
: ,pulverized |
| R8225 |
T12760 |
T12761 |
amod |
Frozen,tissue |
| R8226 |
T12761 |
T12756 |
nsubjpass |
tissue,pulverized |
| R8227 |
T12762 |
T12756 |
auxpass |
was,pulverized |
| R8228 |
T12763 |
T12756 |
prep |
in,pulverized |
| R8229 |
T12764 |
T12765 |
det |
a,Gevebesmascher |
| R8230 |
T12765 |
T12763 |
pobj |
Gevebesmascher,in |
| R8231 |
T12766 |
T12767 |
amod |
liquid,nitrogen |
| R8232 |
T12767 |
T12768 |
npadvmod |
nitrogen,cooled |
| R8233 |
T12768 |
T12765 |
amod |
cooled,Gevebesmascher |
| R8234 |
T12769 |
T12768 |
punct |
-,cooled |
| R8235 |
T12770 |
T12756 |
cc |
and,pulverized |
| R8236 |
T12771 |
T12772 |
det |
the,powder |
| R8237 |
T12772 |
T12773 |
nsubj |
powder,scraped |
| R8238 |
T12773 |
T12756 |
conj |
scraped,pulverized |
| R8239 |
T12774 |
T12773 |
prep |
into,scraped |
| R8240 |
T12775 |
T12776 |
det |
a,tube |
| R8241 |
T12776 |
T12774 |
pobj |
tube,into |
| R8242 |
T12777 |
T12776 |
amod |
chilled,tube |
| R8243 |
T12778 |
T12776 |
compound |
microcentrifuge,tube |
| R8244 |
T12779 |
T12756 |
punct |
.,pulverized |
| R8245 |
T12781 |
T12782 |
compound |
RIPA,buffer |
| R8246 |
T12782 |
T12783 |
nsubjpass |
buffer,added |
| R8247 |
T12784 |
T12785 |
punct |
(,X |
| R8248 |
T12785 |
T12782 |
parataxis |
X,buffer |
| R8249 |
T12786 |
T12787 |
nummod |
1,% |
| R8250 |
T12787 |
T12785 |
compound |
%,X |
| R8251 |
T12788 |
T12785 |
compound |
Triton,X |
| R8252 |
T12789 |
T12785 |
punct |
-,X |
| R8253 |
T12790 |
T12785 |
nummod |
100,X |
| R8254 |
T12791 |
T12785 |
prep |
in,X |
| R8255 |
T12792 |
T12791 |
pobj |
PBS,in |
| R8256 |
T12793 |
T12785 |
prep |
with,X |
| R8257 |
T12794 |
T12795 |
nummod |
10,mM |
| R8258 |
T12795 |
T12796 |
compound |
mM,EDTA |
| R8259 |
T12796 |
T12793 |
pobj |
EDTA,with |
| R8260 |
T12797 |
T12796 |
punct |
", ",EDTA |
| R8261 |
T12798 |
T12799 |
nummod |
150,mN |
| R8262 |
T12799 |
T12800 |
compound |
mN,NaCl |
| R8263 |
T12800 |
T12796 |
conj |
NaCl,EDTA |
| R8264 |
T12801 |
T12800 |
punct |
", ",NaCl |
| R8265 |
T12802 |
T12803 |
nummod |
1,% |
| R8266 |
T12803 |
T12804 |
compound |
%,deoxycholate |
| R8267 |
T12804 |
T12800 |
conj |
deoxycholate,NaCl |
| R8268 |
T12805 |
T12804 |
compound |
sodium,deoxycholate |
| R8269 |
T12806 |
T12804 |
punct |
", ",deoxycholate |
| R8270 |
T12807 |
T12804 |
cc |
and,deoxycholate |
| R8271 |
T12808 |
T12809 |
nummod |
0.1,% |
| R8272 |
T12809 |
T12810 |
compound |
%,SDS |
| R8273 |
T12810 |
T12804 |
conj |
SDS,deoxycholate |
| R8274 |
T12811 |
T12785 |
punct |
),X |
| R8275 |
T12812 |
T12782 |
cc |
and,buffer |
| R8276 |
T12813 |
T12814 |
compound |
protease,inhibitors |
| R8277 |
T12814 |
T12782 |
conj |
inhibitors,buffer |
| R8278 |
T12815 |
T12814 |
cc |
or,inhibitors |
| R8279 |
T12816 |
T12817 |
compound |
Laemmli,buffer |
| R8280 |
T12817 |
T12814 |
conj |
buffer,inhibitors |
| R8281 |
T12818 |
T12783 |
auxpass |
was,added |
| R8282 |
T12819 |
T12783 |
punct |
.,added |
| R8283 |
T12821 |
T12822 |
det |
The,suspension |
| R8284 |
T12822 |
T12824 |
nsubjpass |
suspension,sonicated |
| R8285 |
T12823 |
T12822 |
compound |
cell,suspension |
| R8286 |
T12825 |
T12824 |
auxpass |
was,sonicated |
| R8287 |
T12826 |
T12827 |
nummod |
three,times |
| R8288 |
T12827 |
T12824 |
npadvmod |
times,sonicated |
| R8289 |
T12828 |
T12824 |
prep |
for,sonicated |
| R8290 |
T12829 |
T12830 |
nummod |
15,s |
| R8291 |
T12830 |
T12828 |
pobj |
s,for |
| R8292 |
T12831 |
T12824 |
cc |
and,sonicated |
| R8293 |
T12832 |
T12824 |
conj |
centrifuged,sonicated |
| R8294 |
T12833 |
T12832 |
prep |
at,centrifuged |
| R8295 |
T12834 |
T12835 |
nummod |
"14,000",rpm |
| R8296 |
T12835 |
T12833 |
pobj |
rpm,at |
| R8297 |
T12836 |
T12832 |
prep |
at,centrifuged |
| R8298 |
T12837 |
T12838 |
nummod |
4,°C |
| R8299 |
T12838 |
T12836 |
pobj |
°C,at |
| R8300 |
T12839 |
T12824 |
punct |
.,sonicated |
| R8301 |
T12841 |
T12842 |
det |
The,supernatant |
| R8302 |
T12842 |
T12843 |
nsubjpass |
supernatant,separated |
| R8303 |
T12844 |
T12843 |
auxpass |
was,separated |
| R8304 |
T12845 |
T12843 |
prep |
from,separated |
| R8305 |
T12846 |
T12847 |
det |
the,pellet |
| R8306 |
T12847 |
T12845 |
pobj |
pellet,from |
| R8307 |
T12848 |
T12843 |
cc |
and,separated |
| R8308 |
T12849 |
T12843 |
conj |
used,separated |
| R8309 |
T12850 |
T12849 |
prep |
in,used |
| R8310 |
T12851 |
T12852 |
det |
the,experiments |
| R8311 |
T12852 |
T12850 |
pobj |
experiments,in |
| R8312 |
T12853 |
T12843 |
punct |
.,separated |
| R8313 |
T12855 |
T12856 |
nsubjpass |
Extracts,precleared |
| R8314 |
T12857 |
T12855 |
acl |
subjected,Extracts |
| R8315 |
T12858 |
T12857 |
prep |
to,subjected |
| R8316 |
T12859 |
T12858 |
pobj |
immunoprecipitation,to |
| R8317 |
T12860 |
T12856 |
auxpass |
were,precleared |
| R8318 |
T12861 |
T12856 |
prep |
with,precleared |
| R8319 |
T12862 |
T12863 |
compound |
Protein,G |
| R8320 |
T12863 |
T12864 |
compound |
G,Sepharose |
| R8321 |
T12864 |
T12861 |
pobj |
Sepharose,with |
| R8322 |
T12865 |
T12866 |
punct |
(,Amersham |
| R8323 |
T12866 |
T12864 |
parataxis |
Amersham,Sepharose |
| R8324 |
T12867 |
T12866 |
punct |
", ",Amersham |
| R8325 |
T12868 |
T12866 |
npadvmod |
Piscataway,Amersham |
| R8326 |
T12869 |
T12866 |
punct |
", ",Amersham |
| R8327 |
T12870 |
T12871 |
compound |
New,York |
| R8328 |
T12871 |
T12866 |
npadvmod |
York,Amersham |
| R8329 |
T12872 |
T12866 |
punct |
", ",Amersham |
| R8330 |
T12873 |
T12874 |
compound |
United,States |
| R8331 |
T12874 |
T12866 |
npadvmod |
States,Amersham |
| R8332 |
T12875 |
T12866 |
punct |
),Amersham |
| R8333 |
T12876 |
T12856 |
cc |
and,precleared |
| R8334 |
T12877 |
T12856 |
conj |
incubated,precleared |
| R8335 |
T12878 |
T12877 |
prep |
with,incubated |
| R8336 |
T12879 |
T12878 |
pobj |
antibody,with |
| R8337 |
T12880 |
T12877 |
prep |
with,incubated |
| R8338 |
T12881 |
T12880 |
pobj |
rocking,with |
| R8339 |
T12882 |
T12877 |
advmod |
overnight,incubated |
| R8340 |
T12883 |
T12877 |
prep |
at,incubated |
| R8341 |
T12884 |
T12885 |
nummod |
4,°C |
| R8342 |
T12885 |
T12883 |
pobj |
°C,at |
| R8343 |
T12886 |
T12856 |
punct |
.,precleared |
| R8344 |
T12888 |
T12889 |
compound |
Protein,G |
| R8345 |
T12889 |
T12890 |
compound |
G,Sepharose |
| R8346 |
T12890 |
T12891 |
nsubjpass |
Sepharose,added |
| R8347 |
T12892 |
T12891 |
auxpass |
was,added |
| R8348 |
T12893 |
T12891 |
cc |
and,added |
| R8349 |
T12894 |
T12895 |
nsubjpass |
samples,incubated |
| R8350 |
T12895 |
T12891 |
conj |
incubated,added |
| R8351 |
T12896 |
T12895 |
auxpass |
were,incubated |
| R8352 |
T12897 |
T12895 |
prep |
for,incubated |
| R8353 |
T12898 |
T12899 |
nummod |
1,h |
| R8354 |
T12899 |
T12897 |
pobj |
h,for |
| R8355 |
T12900 |
T12895 |
prep |
at,incubated |
| R8356 |
T12901 |
T12902 |
nummod |
4,°C |
| R8357 |
T12902 |
T12900 |
pobj |
°C,at |
| R8358 |
T12903 |
T12895 |
prep |
with,incubated |
| R8359 |
T12904 |
T12903 |
pobj |
rocking,with |
| R8360 |
T12905 |
T12895 |
punct |
.,incubated |
| R8361 |
T12907 |
T12908 |
nsubjpass |
Samples,washed |
| R8362 |
T12909 |
T12908 |
auxpass |
were,washed |
| R8363 |
T12910 |
T12911 |
nummod |
three,times |
| R8364 |
T12911 |
T12908 |
npadvmod |
times,washed |
| R8365 |
T12912 |
T12908 |
prep |
for,washed |
| R8366 |
T12913 |
T12914 |
nummod |
5,min |
| R8367 |
T12914 |
T12912 |
pobj |
min,for |
| R8368 |
T12915 |
T12914 |
advmod |
each,min |
| R8369 |
T12916 |
T12908 |
prep |
in,washed |
| R8370 |
T12917 |
T12918 |
compound |
lysis,buffer |
| R8371 |
T12918 |
T12916 |
pobj |
buffer,in |
| R8372 |
T12919 |
T12908 |
punct |
", ",washed |
| R8373 |
T12920 |
T12908 |
cc |
and,washed |
| R8374 |
T12921 |
T12922 |
det |
the,pellet |
| R8375 |
T12922 |
T12930 |
nsubjpass |
pellet,resuspended |
| R8376 |
T12923 |
T12924 |
compound |
Protein,G |
| R8377 |
T12924 |
T12925 |
compound |
G,antigen |
| R8378 |
T12925 |
T12922 |
compound |
antigen,pellet |
| R8379 |
T12926 |
T12925 |
compound |
Sepharose,antigen |
| R8380 |
T12927 |
T12925 |
punct |
-,antigen |
| R8381 |
T12928 |
T12925 |
compound |
antibody,antigen |
| R8382 |
T12929 |
T12925 |
punct |
-,antigen |
| R8383 |
T12930 |
T12908 |
conj |
resuspended,washed |
| R8384 |
T12931 |
T12930 |
auxpass |
was,resuspended |
| R8385 |
T12932 |
T12930 |
prep |
in,resuspended |
| R8386 |
T12933 |
T12934 |
compound |
Laemmli,buffer |
| R8387 |
T12934 |
T12932 |
pobj |
buffer,in |
| R8388 |
T12935 |
T12930 |
cc |
and,resuspended |
| R8389 |
T12936 |
T12930 |
conj |
boiled,resuspended |
| R8390 |
T12937 |
T12936 |
prep |
for,boiled |
| R8391 |
T12938 |
T12939 |
nummod |
10,min |
| R8392 |
T12939 |
T12937 |
pobj |
min,for |
| R8393 |
T12940 |
T12930 |
punct |
.,resuspended |
| R8394 |
T12942 |
T12943 |
nsubjpass |
Samples,run |
| R8395 |
T12944 |
T12943 |
auxpass |
were,run |
| R8396 |
T12945 |
T12943 |
prep |
on,run |
| R8397 |
T12946 |
T12947 |
compound |
SDS,PAGE |
| R8398 |
T12947 |
T12945 |
pobj |
PAGE,on |
| R8399 |
T12948 |
T12947 |
punct |
-,PAGE |
| R8400 |
T12949 |
T12943 |
cc |
and,run |
| R8401 |
T12950 |
T12943 |
conj |
transferred,run |
| R8402 |
T12951 |
T12950 |
prep |
to,transferred |
| R8403 |
T12952 |
T12953 |
compound |
nitrocellulose,membrane |
| R8404 |
T12953 |
T12951 |
pobj |
membrane,to |
| R8405 |
T12954 |
T12955 |
punct |
(,Bioscience |
| R8406 |
T12955 |
T12953 |
parataxis |
Bioscience,membrane |
| R8407 |
T12956 |
T12955 |
nmod |
Schleicher,Bioscience |
| R8408 |
T12957 |
T12956 |
cc |
and,Schleicher |
| R8409 |
T12958 |
T12956 |
conj |
Schuell,Schleicher |
| R8410 |
T12959 |
T12955 |
punct |
", ",Bioscience |
| R8411 |
T12960 |
T12955 |
npadvmod |
Keene,Bioscience |
| R8412 |
T12961 |
T12955 |
punct |
", ",Bioscience |
| R8413 |
T12962 |
T12963 |
compound |
New,Hampshire |
| R8414 |
T12963 |
T12955 |
npadvmod |
Hampshire,Bioscience |
| R8415 |
T12964 |
T12955 |
punct |
", ",Bioscience |
| R8416 |
T12965 |
T12966 |
compound |
United,States |
| R8417 |
T12966 |
T12955 |
npadvmod |
States,Bioscience |
| R8418 |
T12967 |
T12955 |
punct |
),Bioscience |
| R8419 |
T12968 |
T12943 |
punct |
.,run |
| R8420 |
T12970 |
T12971 |
compound |
Western,blot |
| R8421 |
T12971 |
T12972 |
compound |
blot,signals |
| R8422 |
T12972 |
T12973 |
nsubjpass |
signals,developed |
| R8423 |
T12974 |
T12973 |
auxpass |
were,developed |
| R8424 |
T12975 |
T12973 |
advcl |
using,developed |
| R8425 |
T12976 |
T12977 |
det |
the,kit |
| R8426 |
T12977 |
T12975 |
dobj |
kit,using |
| R8427 |
T12978 |
T12977 |
amod |
enhanced,kit |
| R8428 |
T12979 |
T12977 |
compound |
chemiluminescence,kit |
| R8429 |
T12980 |
T12977 |
prep |
from,kit |
| R8430 |
T12981 |
T12980 |
pobj |
Amersham,from |
| R8431 |
T13041 |
T13042 |
compound |
Cell,culture |
| R8432 |
T13044 |
T13045 |
amod |
Primary,keratinocytes |
| R8433 |
T13045 |
T13046 |
nsubjpass |
keratinocytes,culture |
| R8434 |
T13047 |
T13046 |
auxpass |
were,culture |
| R8435 |
T13048 |
T13046 |
prep |
in,culture |
| R8436 |
T13049 |
T13050 |
amod |
low,calcium |
| R8437 |
T13050 |
T13052 |
compound |
calcium,medium |
| R8438 |
T13051 |
T13050 |
punct |
-,calcium |
| R8439 |
T13052 |
T13048 |
pobj |
medium,in |
| R8440 |
T13053 |
T13054 |
mark |
as,described |
| R8441 |
T13054 |
T13046 |
advcl |
described,culture |
| R8442 |
T13055 |
T13054 |
advmod |
previously,described |
| R8443 |
T13056 |
T13057 |
punct |
[,4 |
| R8444 |
T13057 |
T13046 |
parataxis |
4,culture |
| R8445 |
T13058 |
T13057 |
punct |
],4 |
| R8446 |
T13059 |
T13046 |
punct |
.,culture |
| R8447 |
T13061 |
T13062 |
amod |
Transient,transfections |
| R8448 |
T13062 |
T13063 |
nsubjpass |
transfections,carried |
| R8449 |
T13064 |
T13063 |
auxpass |
were,carried |
| R8450 |
T13065 |
T13063 |
prt |
out,carried |
| R8451 |
T13066 |
T13063 |
prep |
with,carried |
| R8452 |
T13067 |
T13068 |
compound |
FuGENE6,reagent |
| R8453 |
T13068 |
T13066 |
pobj |
reagent,with |
| R8454 |
T13069 |
T13070 |
punct |
(,Roche |
| R8455 |
T13070 |
T13068 |
parataxis |
Roche,reagent |
| R8456 |
T13071 |
T13070 |
punct |
", ",Roche |
| R8457 |
T13072 |
T13070 |
npadvmod |
Indianapolis,Roche |
| R8458 |
T13073 |
T13070 |
punct |
", ",Roche |
| R8459 |
T13074 |
T13070 |
npadvmod |
Indiana,Roche |
| R8460 |
T13075 |
T13070 |
punct |
", ",Roche |
| R8461 |
T13076 |
T13077 |
compound |
United,States |
| R8462 |
T13077 |
T13070 |
npadvmod |
States,Roche |
| R8463 |
T13078 |
T13070 |
punct |
),Roche |
| R8464 |
T13079 |
T13063 |
prep |
according,carried |
| R8465 |
T13080 |
T13079 |
prep |
to,according |
| R8466 |
T13081 |
T13082 |
det |
the,manufacturer |
| R8467 |
T13082 |
T13083 |
poss |
manufacturer,protocol |
| R8468 |
T13083 |
T13080 |
pobj |
protocol,to |
| R8469 |
T13084 |
T13082 |
case |
's,manufacturer |
| R8470 |
T13085 |
T13063 |
punct |
.,carried |
| R8471 |
T13087 |
T13088 |
nsubjpass |
Measurement,carried |
| R8472 |
T13089 |
T13087 |
prep |
of,Measurement |
| R8473 |
T13090 |
T13091 |
nmod |
β,galactosidase |
| R8474 |
T13091 |
T13093 |
nmod |
galactosidase,levels |
| R8475 |
T13092 |
T13091 |
punct |
-,galactosidase |
| R8476 |
T13093 |
T13089 |
pobj |
levels,of |
| R8477 |
T13094 |
T13091 |
cc |
or,galactosidase |
| R8478 |
T13095 |
T13091 |
conj |
luciferase,galactosidase |
| R8479 |
T13096 |
T13088 |
prep |
in,carried |
| R8480 |
T13097 |
T13098 |
compound |
promoter,activity |
| R8481 |
T13098 |
T13099 |
compound |
activity,studies |
| R8482 |
T13099 |
T13096 |
pobj |
studies,in |
| R8483 |
T13100 |
T13088 |
auxpass |
were,carried |
| R8484 |
T13101 |
T13088 |
prt |
out,carried |
| R8485 |
T13102 |
T13088 |
prep |
with,carried |
| R8486 |
T13103 |
T13104 |
det |
the,kit |
| R8487 |
T13104 |
T13102 |
pobj |
kit,with |
| R8488 |
T13105 |
T13106 |
compound |
Galacto,Lite |
| R8489 |
T13106 |
T13104 |
compound |
Lite,kit |
| R8490 |
T13107 |
T13106 |
punct |
-,Lite |
| R8491 |
T13108 |
T13104 |
compound |
assay,kit |
| R8492 |
T13109 |
T13110 |
punct |
(,TROPIX |
| R8493 |
T13110 |
T13104 |
parataxis |
TROPIX,kit |
| R8494 |
T13111 |
T13110 |
punct |
", ",TROPIX |
| R8495 |
T13112 |
T13110 |
npadvmod |
Bedford,TROPIX |
| R8496 |
T13113 |
T13110 |
punct |
", ",TROPIX |
| R8497 |
T13114 |
T13110 |
npadvmod |
Massachusetts,TROPIX |
| R8498 |
T13115 |
T13110 |
punct |
", ",TROPIX |
| R8499 |
T13116 |
T13117 |
compound |
United,States |
| R8500 |
T13117 |
T13110 |
npadvmod |
States,TROPIX |
| R8501 |
T13118 |
T13110 |
punct |
),TROPIX |
| R8502 |
T13119 |
T13104 |
cc |
and,kit |
| R8503 |
T13120 |
T13121 |
det |
the,luciferase |
| R8504 |
T13121 |
T13104 |
conj |
luciferase,kit |
| R8505 |
T13122 |
T13121 |
amod |
Dual,luciferase |
| R8506 |
T13123 |
T13124 |
punct |
(,Promega |
| R8507 |
T13124 |
T13121 |
parataxis |
Promega,luciferase |
| R8508 |
T13125 |
T13124 |
punct |
", ",Promega |
| R8509 |
T13126 |
T13124 |
npadvmod |
Madison,Promega |
| R8510 |
T13127 |
T13124 |
punct |
", ",Promega |
| R8511 |
T13128 |
T13124 |
npadvmod |
Wisconsin,Promega |
| R8512 |
T13129 |
T13124 |
punct |
", ",Promega |
| R8513 |
T13130 |
T13131 |
compound |
United,States |
| R8514 |
T13131 |
T13124 |
npadvmod |
States,Promega |
| R8515 |
T13132 |
T13124 |
punct |
),Promega |
| R8516 |
T13133 |
T13121 |
punct |
", ",luciferase |
| R8517 |
T13134 |
T13088 |
advmod |
respectively,carried |
| R8518 |
T13135 |
T13088 |
punct |
.,carried |
| R8519 |
T13137 |
T13138 |
compound |
Runella,luciferase |
| R8520 |
T13138 |
T13139 |
nsubjpass |
luciferase,cotransfected |
| R8521 |
T13140 |
T13139 |
auxpass |
was,cotransfected |
| R8522 |
T13141 |
T13139 |
prep |
into,cotransfected |
| R8523 |
T13142 |
T13141 |
pobj |
cells,into |
| R8524 |
T13143 |
T13144 |
aux |
to,correct |
| R8525 |
T13144 |
T13139 |
advcl |
correct,cotransfected |
| R8526 |
T13145 |
T13144 |
prep |
for,correct |
| R8527 |
T13146 |
T13147 |
compound |
transfection,efficiency |
| R8528 |
T13147 |
T13145 |
pobj |
efficiency,for |
| R8529 |
T13148 |
T13139 |
punct |
.,cotransfected |
| R8530 |
T13150 |
T13151 |
nsubjpass |
Experiments,done |
| R8531 |
T13152 |
T13151 |
auxpass |
were,done |
| R8532 |
T13153 |
T13151 |
prep |
in,done |
| R8533 |
T13154 |
T13153 |
pobj |
triplicate,in |
| R8534 |
T13155 |
T13151 |
cc |
and,done |
| R8535 |
T13156 |
T13151 |
conj |
repeated,done |
| R8536 |
T13157 |
T13158 |
advmod |
at,three |
| R8537 |
T13158 |
T13160 |
nummod |
three,times |
| R8538 |
T13159 |
T13158 |
advmod |
least,three |
| R8539 |
T13160 |
T13156 |
npadvmod |
times,repeated |
| R8540 |
T13161 |
T13151 |
punct |
.,done |
| R8541 |
T13163 |
T13164 |
nsubjpass |
Measurements,done |
| R8542 |
T13165 |
T13164 |
auxpass |
were,done |
| R8543 |
T13166 |
T13164 |
prep |
on,done |
| R8544 |
T13167 |
T13168 |
det |
a,luminometer |
| R8545 |
T13168 |
T13166 |
pobj |
luminometer,on |
| R8546 |
T13169 |
T13170 |
punct |
(,Instruments |
| R8547 |
T13170 |
T13168 |
parataxis |
Instruments,luminometer |
| R8548 |
T13171 |
T13170 |
compound |
MGM,Instruments |
| R8549 |
T13172 |
T13170 |
punct |
", ",Instruments |
| R8550 |
T13173 |
T13170 |
npadvmod |
Hamden,Instruments |
| R8551 |
T13174 |
T13170 |
punct |
", ",Instruments |
| R8552 |
T13175 |
T13170 |
npadvmod |
Connecticut,Instruments |
| R8553 |
T13176 |
T13170 |
punct |
", ",Instruments |
| R8554 |
T13177 |
T13178 |
compound |
United,States |
| R8555 |
T13178 |
T13170 |
npadvmod |
States,Instruments |
| R8556 |
T13179 |
T13170 |
punct |
),Instruments |
| R8557 |
T13180 |
T13164 |
punct |
.,done |
| R8558 |
T13182 |
T13183 |
prep |
For,starved |
| R8559 |
T13184 |
T13182 |
pobj |
experiments,For |
| R8560 |
T13185 |
T13184 |
acl |
measuring,experiments |
| R8561 |
T13186 |
T13185 |
dobj |
phosphorylation,measuring |
| R8562 |
T13187 |
T13186 |
prep |
of,phosphorylation |
| R8563 |
T13188 |
T13187 |
pobj |
MAPK,of |
| R8564 |
T13189 |
T13183 |
punct |
", ",starved |
| R8565 |
T13190 |
T13183 |
nsubjpass |
keratinocytes,starved |
| R8566 |
T13191 |
T13183 |
auxpass |
were,starved |
| R8567 |
T13192 |
T13183 |
dep |
serum,starved |
| R8568 |
T13193 |
T13183 |
prep |
for,starved |
| R8569 |
T13194 |
T13195 |
nummod |
3,h |
| R8570 |
T13195 |
T13193 |
pobj |
h,for |
| R8571 |
T13196 |
T13197 |
amod |
prior,to |
| R8572 |
T13197 |
T13183 |
prep |
to,starved |
| R8573 |
T13198 |
T13197 |
pobj |
harvesting,to |
| R8574 |
T13199 |
T13198 |
prep |
of,harvesting |
| R8575 |
T13200 |
T13199 |
pobj |
cells,of |
| R8576 |
T13201 |
T13198 |
prep |
by,harvesting |
| R8577 |
T13202 |
T13201 |
pobj |
incubation,by |
| R8578 |
T13203 |
T13202 |
prep |
in,incubation |
| R8579 |
T13204 |
T13203 |
pobj |
medium,in |
| R8580 |
T13205 |
T13204 |
acl |
lacking,medium |
| R8581 |
T13206 |
T13205 |
dobj |
serum,lacking |
| R8582 |
T13207 |
T13183 |
punct |
.,starved |
| R8583 |
T13209 |
T13210 |
nsubjpass |
Treatment,described |
| R8584 |
T13211 |
T13209 |
prep |
of,Treatment |
| R8585 |
T13212 |
T13211 |
pobj |
cells,of |
| R8586 |
T13213 |
T13209 |
prep |
with,Treatment |
| R8587 |
T13214 |
T13215 |
npadvmod |
Wnt,conditioned |
| R8588 |
T13215 |
T13220 |
amod |
conditioned,medium |
| R8589 |
T13216 |
T13214 |
punct |
-,Wnt |
| R8590 |
T13217 |
T13214 |
cc |
and,Wnt |
| R8591 |
T13218 |
T13214 |
conj |
noggin,Wnt |
| R8592 |
T13219 |
T13215 |
punct |
-,conditioned |
| R8593 |
T13220 |
T13213 |
pobj |
medium,with |
| R8594 |
T13221 |
T13210 |
auxpass |
was,described |
| R8595 |
T13222 |
T13210 |
advmod |
previously,described |
| R8596 |
T13223 |
T13224 |
punct |
[,4 |
| R8597 |
T13224 |
T13210 |
parataxis |
4,described |
| R8598 |
T13225 |
T13224 |
punct |
],4 |
| R8599 |
T13226 |
T13210 |
punct |
.,described |
| R8600 |
T13310 |
T13311 |
det |
The,promoter |
| R8601 |
T13311 |
T13317 |
nsubjpass |
promoter,generated |
| R8602 |
T13312 |
T13313 |
nummod |
2.2,kb |
| R8603 |
T13313 |
T13311 |
nmod |
kb,promoter |
| R8604 |
T13314 |
T13313 |
punct |
-,kb |
| R8605 |
T13315 |
T13311 |
amod |
murine,promoter |
| R8606 |
T13316 |
T13311 |
compound |
Snail,promoter |
| R8607 |
T13318 |
T13317 |
auxpass |
was,generated |
| R8608 |
T13319 |
T13317 |
prep |
by,generated |
| R8609 |
T13320 |
T13319 |
pobj |
PCR,by |
| R8610 |
T13321 |
T13317 |
advcl |
using,generated |
| R8611 |
T13322 |
T13323 |
det |
a,primer |
| R8612 |
T13323 |
T13321 |
dobj |
primer,using |
| R8613 |
T13324 |
T13323 |
amod |
forward,primer |
| R8614 |
T13325 |
T13321 |
prep |
with,using |
| R8615 |
T13326 |
T13327 |
det |
an,sequence |
| R8616 |
T13327 |
T13325 |
pobj |
sequence,with |
| R8617 |
T13328 |
T13327 |
compound |
XbaI,sequence |
| R8618 |
T13329 |
T13327 |
compound |
linker,sequence |
| R8619 |
T13330 |
T13327 |
punct |
", ",sequence |
| R8620 |
T13331 |
T13332 |
nummod |
5,TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
| R8621 |
T13332 |
T13327 |
appos |
TCTAGAATTGTTTGCTGCTGTATGGTCTTC,sequence |
| R8622 |
T13333 |
T13331 |
punct |
′,5 |
| R8623 |
T13334 |
T13332 |
punct |
-,TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
| R8624 |
T13335 |
T13332 |
punct |
-,TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
| R8625 |
T13336 |
T13332 |
nummod |
3,TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
| R8626 |
T13337 |
T13332 |
punct |
′,TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
| R8627 |
T13338 |
T13327 |
punct |
", ",sequence |
| R8628 |
T13339 |
T13327 |
cc |
along,sequence |
| R8629 |
T13340 |
T13339 |
dep |
with,along |
| R8630 |
T13341 |
T13342 |
det |
a,primer |
| R8631 |
T13342 |
T13327 |
conj |
primer,sequence |
| R8632 |
T13343 |
T13342 |
amod |
reverse,primer |
| R8633 |
T13344 |
T13342 |
prep |
with,primer |
| R8634 |
T13345 |
T13346 |
det |
a,sequence |
| R8635 |
T13346 |
T13344 |
pobj |
sequence,with |
| R8636 |
T13347 |
T13346 |
compound |
BglII,sequence |
| R8637 |
T13348 |
T13346 |
compound |
linker,sequence |
| R8638 |
T13349 |
T13346 |
punct |
", ",sequence |
| R8639 |
T13350 |
T13351 |
nummod |
5,GTAG |
| R8640 |
T13351 |
T13346 |
appos |
GTAG,sequence |
| R8641 |
T13352 |
T13350 |
punct |
′,5 |
| R8642 |
T13353 |
T13351 |
punct |
-,GTAG |
| R8643 |
T13354 |
T13351 |
compound |
AGATCTGTTGGCCAGAGCGACCTAG,GTAG |
| R8644 |
T13355 |
T13351 |
punct |
-,GTAG |
| R8645 |
T13356 |
T13351 |
punct |
-,GTAG |
| R8646 |
T13357 |
T13351 |
nummod |
3,GTAG |
| R8647 |
T13358 |
T13351 |
punct |
′,GTAG |
| R8648 |
T13359 |
T13342 |
punct |
", ",primer |
| R8649 |
T13360 |
T13342 |
cc |
and,primer |
| R8650 |
T13361 |
T13362 |
nmod |
mouse,DNA |
| R8651 |
T13362 |
T13342 |
conj |
DNA,primer |
| R8652 |
T13363 |
T13362 |
amod |
genomic,DNA |
| R8653 |
T13364 |
T13362 |
prep |
as,DNA |
| R8654 |
T13365 |
T13366 |
det |
a,template |
| R8655 |
T13366 |
T13364 |
pobj |
template,as |
| R8656 |
T13367 |
T13317 |
punct |
.,generated |
| R8657 |
T13369 |
T13370 |
det |
The,product |
| R8658 |
T13370 |
T13372 |
nsubjpass |
product,purified |
| R8659 |
T13371 |
T13370 |
compound |
PCR,product |
| R8660 |
T13373 |
T13372 |
auxpass |
was,purified |
| R8661 |
T13374 |
T13372 |
prep |
with,purified |
| R8662 |
T13375 |
T13376 |
det |
the,Kit |
| R8663 |
T13376 |
T13374 |
pobj |
Kit,with |
| R8664 |
T13377 |
T13378 |
compound |
Gel,Extraction |
| R8665 |
T13378 |
T13376 |
compound |
Extraction,Kit |
| R8666 |
T13379 |
T13380 |
punct |
(,Qiagen |
| R8667 |
T13380 |
T13376 |
parataxis |
Qiagen,Kit |
| R8668 |
T13381 |
T13380 |
punct |
", ",Qiagen |
| R8669 |
T13382 |
T13380 |
npadvmod |
Valencia,Qiagen |
| R8670 |
T13383 |
T13380 |
punct |
", ",Qiagen |
| R8671 |
T13384 |
T13380 |
npadvmod |
California,Qiagen |
| R8672 |
T13385 |
T13380 |
punct |
", ",Qiagen |
| R8673 |
T13386 |
T13387 |
compound |
United,States |
| R8674 |
T13387 |
T13380 |
npadvmod |
States,Qiagen |
| R8675 |
T13388 |
T13380 |
punct |
),Qiagen |
| R8676 |
T13389 |
T13372 |
cc |
and,purified |
| R8677 |
T13390 |
T13372 |
conj |
ligated,purified |
| R8678 |
T13391 |
T13390 |
prep |
into,ligated |
| R8679 |
T13392 |
T13393 |
compound |
pCRII,TOPO |
| R8680 |
T13393 |
T13395 |
compound |
TOPO,vector |
| R8681 |
T13394 |
T13393 |
punct |
-,TOPO |
| R8682 |
T13395 |
T13391 |
pobj |
vector,into |
| R8683 |
T13396 |
T13395 |
compound |
TA,vector |
| R8684 |
T13397 |
T13398 |
punct |
(,Invitrogen |
| R8685 |
T13398 |
T13395 |
parataxis |
Invitrogen,vector |
| R8686 |
T13399 |
T13398 |
punct |
", ",Invitrogen |
| R8687 |
T13400 |
T13398 |
npadvmod |
Carlsbad,Invitrogen |
| R8688 |
T13401 |
T13398 |
punct |
", ",Invitrogen |
| R8689 |
T13402 |
T13398 |
npadvmod |
California,Invitrogen |
| R8690 |
T13403 |
T13398 |
punct |
", ",Invitrogen |
| R8691 |
T13404 |
T13405 |
compound |
United,States |
| R8692 |
T13405 |
T13398 |
npadvmod |
States,Invitrogen |
| R8693 |
T13406 |
T13398 |
punct |
),Invitrogen |
| R8694 |
T13407 |
T13372 |
punct |
.,purified |
| R8695 |
T13409 |
T13410 |
det |
The,promoter |
| R8696 |
T13410 |
T13411 |
nsubjpass |
promoter,verified |
| R8697 |
T13412 |
T13411 |
auxpass |
was,verified |
| R8698 |
T13413 |
T13411 |
prep |
by,verified |
| R8699 |
T13414 |
T13413 |
pobj |
sequencing,by |
| R8700 |
T13415 |
T13411 |
cc |
and,verified |
| R8701 |
T13416 |
T13411 |
conj |
digested,verified |
| R8702 |
T13417 |
T13416 |
prep |
with,digested |
| R8703 |
T13418 |
T13417 |
pobj |
XbaI,with |
| R8704 |
T13419 |
T13418 |
cc |
and,XbaI |
| R8705 |
T13420 |
T13418 |
conj |
BglII,XbaI |
| R8706 |
T13421 |
T13416 |
cc |
and,digested |
| R8707 |
T13422 |
T13416 |
conj |
subcloned,digested |
| R8708 |
T13423 |
T13422 |
prep |
into,subcloned |
| R8709 |
T13424 |
T13425 |
det |
the,vector |
| R8710 |
T13425 |
T13423 |
pobj |
vector,into |
| R8711 |
T13426 |
T13427 |
compound |
pβ,gal |
| R8712 |
T13427 |
T13425 |
compound |
gal,vector |
| R8713 |
T13428 |
T13427 |
punct |
-,gal |
| R8714 |
T13429 |
T13425 |
compound |
BASIC,vector |
| R8715 |
T13430 |
T13431 |
punct |
(,Clontech |
| R8716 |
T13431 |
T13425 |
parataxis |
Clontech,vector |
| R8717 |
T13432 |
T13431 |
compound |
BD,Clontech |
| R8718 |
T13433 |
T13431 |
compound |
Biosciences,Clontech |
| R8719 |
T13434 |
T13431 |
punct |
", ",Clontech |
| R8720 |
T13435 |
T13436 |
compound |
Palo,Alto |
| R8721 |
T13436 |
T13431 |
npadvmod |
Alto,Clontech |
| R8722 |
T13437 |
T13431 |
punct |
", ",Clontech |
| R8723 |
T13438 |
T13431 |
npadvmod |
California,Clontech |
| R8724 |
T13439 |
T13431 |
punct |
", ",Clontech |
| R8725 |
T13440 |
T13441 |
compound |
United,States |
| R8726 |
T13441 |
T13431 |
npadvmod |
States,Clontech |
| R8727 |
T13442 |
T13431 |
punct |
),Clontech |
| R8728 |
T13443 |
T13411 |
punct |
.,verified |
| R8729 |
T13445 |
T13446 |
det |
The,mutations |
| R8730 |
T13446 |
T13448 |
nsubjpass |
mutations,generated |
| R8731 |
T13447 |
T13446 |
compound |
point,mutations |
| R8732 |
T13449 |
T13446 |
prep |
in,mutations |
| R8733 |
T13450 |
T13451 |
det |
the,element |
| R8734 |
T13451 |
T13449 |
pobj |
element,in |
| R8735 |
T13452 |
T13451 |
compound |
SMAD,element |
| R8736 |
T13453 |
T13451 |
compound |
binding,element |
| R8737 |
T13454 |
T13448 |
auxpass |
was,generated |
| R8738 |
T13455 |
T13448 |
prep |
with,generated |
| R8739 |
T13456 |
T13457 |
det |
the,Kit |
| R8740 |
T13457 |
T13455 |
pobj |
Kit,with |
| R8741 |
T13458 |
T13459 |
compound |
Quik,Change |
| R8742 |
T13459 |
T13457 |
compound |
Change,Kit |
| R8743 |
T13460 |
T13459 |
punct |
-,Change |
| R8744 |
T13461 |
T13462 |
punct |
(,Stratagene |
| R8745 |
T13462 |
T13457 |
parataxis |
Stratagene,Kit |
| R8746 |
T13463 |
T13462 |
punct |
", ",Stratagene |
| R8747 |
T13464 |
T13465 |
compound |
La,Jolla |
| R8748 |
T13465 |
T13462 |
npadvmod |
Jolla,Stratagene |
| R8749 |
T13466 |
T13462 |
punct |
", ",Stratagene |
| R8750 |
T13467 |
T13462 |
npadvmod |
California,Stratagene |
| R8751 |
T13468 |
T13462 |
punct |
", ",Stratagene |
| R8752 |
T13469 |
T13470 |
compound |
United,States |
| R8753 |
T13470 |
T13462 |
npadvmod |
States,Stratagene |
| R8754 |
T13471 |
T13462 |
punct |
),Stratagene |
| R8755 |
T13472 |
T13448 |
advcl |
using,generated |
| R8756 |
T13473 |
T13474 |
det |
the,primer |
| R8757 |
T13474 |
T13472 |
dobj |
primer,using |
| R8758 |
T13475 |
T13474 |
amod |
forward,primer |
| R8759 |
T13476 |
T13477 |
nummod |
5,GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
| R8760 |
T13477 |
T13474 |
appos |
GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC,primer |
| R8761 |
T13478 |
T13476 |
punct |
′,5 |
| R8762 |
T13479 |
T13477 |
punct |
-,GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
| R8763 |
T13480 |
T13477 |
punct |
-,GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
| R8764 |
T13481 |
T13477 |
nummod |
3,GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
| R8765 |
T13482 |
T13477 |
punct |
′,GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
| R8766 |
T13483 |
T13474 |
cc |
and,primer |
| R8767 |
T13484 |
T13485 |
det |
the,primer |
| R8768 |
T13485 |
T13474 |
conj |
primer,primer |
| R8769 |
T13486 |
T13485 |
amod |
reverse,primer |
| R8770 |
T13487 |
T13488 |
nummod |
5,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
| R8771 |
T13488 |
T13485 |
appos |
CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC,primer |
| R8772 |
T13489 |
T13487 |
punct |
′,5 |
| R8773 |
T13490 |
T13488 |
punct |
-,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
| R8774 |
T13491 |
T13488 |
compound |
GCTTTT,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
| R8775 |
T13492 |
T13488 |
punct |
-,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
| R8776 |
T13493 |
T13488 |
punct |
-,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
| R8777 |
T13494 |
T13488 |
nummod |
3,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
| R8778 |
T13495 |
T13488 |
punct |
′,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
| R8779 |
T13496 |
T13448 |
punct |
.,generated |
| R8780 |
T13498 |
T13499 |
det |
The,probes |
| R8781 |
T13499 |
T13500 |
nsubjpass |
probes,generated |
| R8782 |
T13501 |
T13499 |
prep |
for,probes |
| R8783 |
T13502 |
T13503 |
det |
the,hybridization |
| R8784 |
T13503 |
T13501 |
pobj |
hybridization,for |
| R8785 |
T13504 |
T13503 |
nmod |
Snail,hybridization |
| R8786 |
T13505 |
T13506 |
advmod |
in,situ |
| R8787 |
T13506 |
T13503 |
amod |
situ,hybridization |
| R8788 |
T13507 |
T13500 |
auxpass |
were,generated |
| R8789 |
T13508 |
T13500 |
prep |
against,generated |
| R8790 |
T13509 |
T13510 |
det |
the,UTR |
| R8791 |
T13510 |
T13508 |
pobj |
UTR,against |
| R8792 |
T13511 |
T13510 |
nummod |
3,UTR |
| R8793 |
T13512 |
T13511 |
punct |
′,3 |
| R8794 |
T13513 |
T13500 |
prep |
by,generated |
| R8795 |
T13514 |
T13513 |
pobj |
PCR,by |
| R8796 |
T13515 |
T13500 |
advcl |
using,generated |
| R8797 |
T13516 |
T13517 |
det |
the,primer |
| R8798 |
T13517 |
T13515 |
dobj |
primer,using |
| R8799 |
T13518 |
T13517 |
amod |
forward,primer |
| R8800 |
T13519 |
T13520 |
nummod |
5,ACCTTCTCCCGCATGTCCTTGCTCC |
| R8801 |
T13520 |
T13517 |
appos |
ACCTTCTCCCGCATGTCCTTGCTCC,primer |
| R8802 |
T13521 |
T13519 |
punct |
′,5 |
| R8803 |
T13522 |
T13520 |
punct |
-,ACCTTCTCCCGCATGTCCTTGCTCC |
| R8804 |
T13523 |
T13520 |
punct |
-,ACCTTCTCCCGCATGTCCTTGCTCC |
| R8805 |
T13524 |
T13520 |
nummod |
3,ACCTTCTCCCGCATGTCCTTGCTCC |
| R8806 |
T13525 |
T13520 |
punct |
′,ACCTTCTCCCGCATGTCCTTGCTCC |
| R8807 |
T13526 |
T13517 |
cc |
and,primer |
| R8808 |
T13527 |
T13528 |
det |
the,primer |
| R8809 |
T13528 |
T13517 |
conj |
primer,primer |
| R8810 |
T13529 |
T13528 |
amod |
reverse,primer |
| R8811 |
T13530 |
T13531 |
nummod |
5,CTGCTGAGGCATGGTTACAGCTGG |
| R8812 |
T13531 |
T13528 |
appos |
CTGCTGAGGCATGGTTACAGCTGG,primer |
| R8813 |
T13532 |
T13530 |
punct |
′,5 |
| R8814 |
T13533 |
T13531 |
punct |
-,CTGCTGAGGCATGGTTACAGCTGG |
| R8815 |
T13534 |
T13531 |
punct |
-,CTGCTGAGGCATGGTTACAGCTGG |
| R8816 |
T13535 |
T13531 |
nummod |
3,CTGCTGAGGCATGGTTACAGCTGG |
| R8817 |
T13536 |
T13531 |
punct |
′,CTGCTGAGGCATGGTTACAGCTGG |
| R8818 |
T13537 |
T13528 |
punct |
", ",primer |
| R8819 |
T13538 |
T13528 |
cc |
and,primer |
| R8820 |
T13539 |
T13540 |
amod |
genomic,DNA |
| R8821 |
T13540 |
T13528 |
conj |
DNA,primer |
| R8822 |
T13541 |
T13540 |
prep |
as,DNA |
| R8823 |
T13542 |
T13543 |
det |
a,template |
| R8824 |
T13543 |
T13541 |
pobj |
template,as |
| R8825 |
T13544 |
T13500 |
punct |
.,generated |
| R8826 |
T13546 |
T13547 |
det |
The,product |
| R8827 |
T13547 |
T13549 |
nsubjpass |
product,purified |
| R8828 |
T13548 |
T13547 |
compound |
PCR,product |
| R8829 |
T13550 |
T13549 |
auxpass |
was,purified |
| R8830 |
T13551 |
T13549 |
dep |
gel,purified |
| R8831 |
T13552 |
T13549 |
cc |
and,purified |
| R8832 |
T13553 |
T13549 |
conj |
ligated,purified |
| R8833 |
T13554 |
T13553 |
prep |
into,ligated |
| R8834 |
T13555 |
T13556 |
compound |
pCRII,TOPO |
| R8835 |
T13556 |
T13558 |
compound |
TOPO,vector |
| R8836 |
T13557 |
T13556 |
punct |
-,TOPO |
| R8837 |
T13558 |
T13554 |
pobj |
vector,into |
| R8838 |
T13559 |
T13558 |
compound |
TA,vector |
| R8839 |
T13560 |
T13549 |
punct |
.,purified |
| R8840 |
T13562 |
T13563 |
det |
The,domain |
| R8841 |
T13563 |
T13565 |
nsubjpass |
domain,generated |
| R8842 |
T13564 |
T13563 |
amod |
pre-LIM,domain |
| R8843 |
T13566 |
T13563 |
prep |
of,domain |
| R8844 |
T13567 |
T13566 |
pobj |
Ajuba,of |
| R8845 |
T13568 |
T13565 |
auxpass |
was,generated |
| R8846 |
T13569 |
T13565 |
advmod |
essentially,generated |
| R8847 |
T13570 |
T13571 |
mark |
as,described |
| R8848 |
T13571 |
T13565 |
advcl |
described,generated |
| R8849 |
T13572 |
T13573 |
punct |
[,9 |
| R8850 |
T13573 |
T13571 |
parataxis |
9,described |
| R8851 |
T13574 |
T13573 |
punct |
],9 |
| R8852 |
T13575 |
T13565 |
punct |
", ",generated |
| R8853 |
T13576 |
T13565 |
cc |
but,generated |
| R8854 |
T13577 |
T13578 |
auxpass |
was,fused |
| R8855 |
T13578 |
T13565 |
conj |
fused,generated |
| R8856 |
T13579 |
T13578 |
prep |
to,fused |
| R8857 |
T13580 |
T13579 |
pobj |
GFP,to |
| R8858 |
T13581 |
T13578 |
prep |
by,fused |
| R8859 |
T13582 |
T13581 |
pcomp |
subcloning,by |
| R8860 |
T13583 |
T13582 |
prep |
from,subcloning |
| R8861 |
T13584 |
T13585 |
det |
the,vector |
| R8862 |
T13585 |
T13583 |
pobj |
vector,from |
| R8863 |
T13586 |
T13587 |
nmod |
pEGFP,N1 |
| R8864 |
T13587 |
T13585 |
nmod |
N1,vector |
| R8865 |
T13588 |
T13587 |
punct |
-,N1 |
| R8866 |
T13589 |
T13585 |
nummod |
20,vector |
| R8867 |
T13590 |
T13591 |
punct |
(,Clontech |
| R8868 |
T13591 |
T13585 |
parataxis |
Clontech,vector |
| R8869 |
T13592 |
T13591 |
compound |
BD,Clontech |
| R8870 |
T13593 |
T13591 |
compound |
Biosciences,Clontech |
| R8871 |
T13594 |
T13591 |
punct |
),Clontech |
| R8874 |
T13649 |
T13650 |
advmod |
In,situ |
| R8875 |
T13650 |
T13651 |
amod |
situ,hybridization |
| R8876 |
T13653 |
T13654 |
det |
The,vector |
| R8877 |
T13654 |
T13659 |
nsubjpass |
vector,used |
| R8878 |
T13655 |
T13656 |
compound |
pCRII,TOPO |
| R8879 |
T13656 |
T13654 |
compound |
TOPO,vector |
| R8880 |
T13657 |
T13656 |
punct |
-,TOPO |
| R8881 |
T13658 |
T13654 |
compound |
TA,vector |
| R8882 |
T13660 |
T13654 |
acl |
containing,vector |
| R8883 |
T13661 |
T13662 |
det |
a,region |
| R8884 |
T13662 |
T13660 |
dobj |
region,containing |
| R8885 |
T13663 |
T13662 |
prep |
of,region |
| R8886 |
T13664 |
T13665 |
det |
the,UTR |
| R8887 |
T13665 |
T13663 |
pobj |
UTR,of |
| R8888 |
T13666 |
T13665 |
nummod |
3,UTR |
| R8889 |
T13667 |
T13666 |
punct |
′,3 |
| R8890 |
T13668 |
T13665 |
prep |
of,UTR |
| R8891 |
T13669 |
T13668 |
pobj |
Snail,of |
| R8892 |
T13670 |
T13659 |
auxpass |
was,used |
| R8893 |
T13671 |
T13659 |
prep |
as,used |
| R8894 |
T13672 |
T13673 |
det |
a,template |
| R8895 |
T13673 |
T13671 |
pobj |
template,as |
| R8896 |
T13674 |
T13675 |
aux |
to,generate |
| R8897 |
T13675 |
T13659 |
advcl |
generate,used |
| R8898 |
T13676 |
T13677 |
npadvmod |
digoxigenin,labeled |
| R8899 |
T13677 |
T13679 |
amod |
labeled,riboprobes |
| R8900 |
T13678 |
T13677 |
punct |
-,labeled |
| R8901 |
T13679 |
T13675 |
dobj |
riboprobes,generate |
| R8902 |
T13680 |
T13679 |
nmod |
sense,riboprobes |
| R8903 |
T13681 |
T13680 |
cc |
and,sense |
| R8904 |
T13682 |
T13680 |
conj |
antisense,sense |
| R8905 |
T13683 |
T13684 |
punct |
(,Roche |
| R8906 |
T13684 |
T13679 |
parataxis |
Roche,riboprobes |
| R8907 |
T13685 |
T13684 |
punct |
),Roche |
| R8908 |
T13686 |
T13659 |
punct |
.,used |
| R8909 |
T13688 |
T13689 |
det |
The,probes |
| R8910 |
T13689 |
T13691 |
nsubjpass |
probes,obtained |
| R8911 |
T13690 |
T13689 |
amod |
respective,probes |
| R8912 |
T13692 |
T13691 |
auxpass |
were,obtained |
| R8913 |
T13693 |
T13691 |
prep |
by,obtained |
| R8914 |
T13694 |
T13695 |
nmod |
XhoI,digestions |
| R8915 |
T13695 |
T13693 |
pobj |
digestions,by |
| R8916 |
T13696 |
T13694 |
cc |
and,XhoI |
| R8917 |
T13697 |
T13694 |
conj |
BamH1,XhoI |
| R8918 |
T13698 |
T13691 |
punct |
.,obtained |
| R8919 |
T13700 |
T13701 |
advmod |
In,situ |
| R8920 |
T13701 |
T13702 |
amod |
situ,hybridizations |
| R8921 |
T13702 |
T13703 |
nsubjpass |
hybridizations,performed |
| R8922 |
T13704 |
T13703 |
auxpass |
were,performed |
| R8923 |
T13705 |
T13703 |
prep |
on,performed |
| R8924 |
T13706 |
T13707 |
nummod |
10,μm |
| R8925 |
T13707 |
T13709 |
npadvmod |
μm,thick |
| R8926 |
T13708 |
T13707 |
punct |
-,μm |
| R8927 |
T13709 |
T13710 |
amod |
thick,sections |
| R8928 |
T13710 |
T13705 |
pobj |
sections,on |
| R8929 |
T13711 |
T13710 |
prep |
of,sections |
| R8930 |
T13712 |
T13713 |
compound |
E17.5,embryos |
| R8931 |
T13713 |
T13711 |
pobj |
embryos,of |
| R8932 |
T13714 |
T13713 |
compound |
mouse,embryos |
| R8933 |
T13715 |
T13703 |
punct |
.,performed |
| R8934 |
T13717 |
T13718 |
det |
The,sections |
| R8935 |
T13718 |
T13719 |
nsubjpass |
sections,fixed |
| R8936 |
T13720 |
T13719 |
auxpass |
were,fixed |
| R8937 |
T13721 |
T13719 |
prep |
with,fixed |
| R8938 |
T13722 |
T13723 |
nummod |
4,% |
| R8939 |
T13723 |
T13724 |
compound |
%,PFA |
| R8940 |
T13724 |
T13721 |
pobj |
PFA,with |
| R8941 |
T13725 |
T13719 |
prep |
for,fixed |
| R8942 |
T13726 |
T13727 |
nummod |
10,min |
| R8943 |
T13727 |
T13725 |
pobj |
min,for |
| R8944 |
T13728 |
T13719 |
prep |
at,fixed |
| R8945 |
T13729 |
T13730 |
compound |
room,temperature |
| R8946 |
T13730 |
T13728 |
pobj |
temperature,at |
| R8947 |
T13731 |
T13719 |
punct |
", ",fixed |
| R8948 |
T13732 |
T13719 |
conj |
prehybridized,fixed |
| R8949 |
T13733 |
T13732 |
prep |
at,prehybridized |
| R8950 |
T13734 |
T13735 |
compound |
room,temperature |
| R8951 |
T13735 |
T13733 |
pobj |
temperature,at |
| R8952 |
T13736 |
T13732 |
prep |
for,prehybridized |
| R8953 |
T13737 |
T13738 |
nummod |
4.5,h |
| R8954 |
T13738 |
T13736 |
pobj |
h,for |
| R8955 |
T13739 |
T13732 |
punct |
", ",prehybridized |
| R8956 |
T13740 |
T13732 |
conj |
hybridized,prehybridized |
| R8957 |
T13741 |
T13740 |
prep |
with,hybridized |
| R8958 |
T13742 |
T13743 |
det |
the,probe |
| R8959 |
T13743 |
T13741 |
pobj |
probe,with |
| R8960 |
T13744 |
T13745 |
punct |
(,μg |
| R8961 |
T13745 |
T13743 |
parataxis |
μg,probe |
| R8962 |
T13746 |
T13745 |
nummod |
2,μg |
| R8963 |
T13747 |
T13748 |
punct |
/,ml |
| R8964 |
T13748 |
T13745 |
prep |
ml,μg |
| R8965 |
T13749 |
T13745 |
punct |
),μg |
| R8966 |
T13750 |
T13740 |
prep |
at,hybridized |
| R8967 |
T13751 |
T13752 |
nummod |
55,°C |
| R8968 |
T13752 |
T13750 |
pobj |
°C,at |
| R8969 |
T13753 |
T13740 |
prep |
for,hybridized |
| R8970 |
T13754 |
T13755 |
quantmod |
12,14 |
| R8971 |
T13755 |
T13757 |
nummod |
14,h |
| R8972 |
T13756 |
T13755 |
punct |
–,14 |
| R8973 |
T13757 |
T13753 |
pobj |
h,for |
| R8974 |
T13758 |
T13740 |
punct |
", ",hybridized |
| R8975 |
T13759 |
T13740 |
conj |
blocked,hybridized |
| R8976 |
T13760 |
T13759 |
prep |
with,blocked |
| R8977 |
T13761 |
T13762 |
nummod |
10,% |
| R8978 |
T13762 |
T13763 |
compound |
%,NGS |
| R8979 |
T13763 |
T13760 |
pobj |
NGS,with |
| R8980 |
T13764 |
T13759 |
punct |
", ",blocked |
| R8981 |
T13765 |
T13759 |
cc |
and,blocked |
| R8982 |
T13766 |
T13759 |
conj |
treated,blocked |
| R8983 |
T13767 |
T13766 |
prep |
with,treated |
| R8984 |
T13768 |
T13769 |
amod |
anti-dig,antibody |
| R8985 |
T13769 |
T13767 |
pobj |
antibody,with |
| R8986 |
T13770 |
T13771 |
compound |
Fab,AP |
| R8987 |
T13771 |
T13769 |
compound |
AP,antibody |
| R8988 |
T13772 |
T13771 |
punct |
-,AP |
| R8989 |
T13773 |
T13774 |
punct |
(,Roche |
| R8990 |
T13774 |
T13769 |
parataxis |
Roche,antibody |
| R8991 |
T13775 |
T13774 |
punct |
#,Roche |
| R8992 |
T13776 |
T13774 |
nummod |
1093274,Roche |
| R8993 |
T13777 |
T13774 |
punct |
),Roche |
| R8994 |
T13778 |
T13766 |
prep |
at,treated |
| R8995 |
T13779 |
T13780 |
det |
a,dilution |
| R8996 |
T13780 |
T13778 |
pobj |
dilution,at |
| R8997 |
T13781 |
T13782 |
quantmod |
1,"2,500" |
| R8998 |
T13782 |
T13780 |
nummod |
"2,500",dilution |
| R8999 |
T13783 |
T13782 |
punct |
:,"2,500" |
| R9000 |
T13784 |
T13766 |
prep |
for,treated |
| R9001 |
T13785 |
T13786 |
nummod |
3,h |
| R9002 |
T13786 |
T13784 |
pobj |
h,for |
| R9003 |
T13787 |
T13719 |
punct |
.,fixed |
| R9004 |
T13789 |
T13790 |
det |
The,sections |
| R9005 |
T13790 |
T13791 |
nsubjpass |
sections,incubated |
| R9006 |
T13792 |
T13791 |
auxpass |
were,incubated |
| R9007 |
T13793 |
T13791 |
prep |
with,incubated |
| R9008 |
T13794 |
T13793 |
pobj |
NBT,with |
| R9009 |
T13795 |
T13794 |
cc |
and,NBT |
| R9010 |
T13796 |
T13794 |
conj |
BCIP,NBT |
| R9011 |
T13797 |
T13798 |
mark |
until,detected |
| R9012 |
T13798 |
T13791 |
advcl |
detected,incubated |
| R9013 |
T13799 |
T13800 |
amod |
adequate,signal |
| R9014 |
T13800 |
T13798 |
nsubjpass |
signal,detected |
| R9015 |
T13801 |
T13798 |
auxpass |
was,detected |
| R9016 |
T13802 |
T13791 |
punct |
.,incubated |
| R9017 |
T13829 |
T13828 |
cc |
and,Immunofluorescence |
| R9018 |
T13830 |
T13828 |
conj |
immunohistochemistry,Immunofluorescence |
| R9019 |
T13832 |
T13833 |
compound |
Tissue,samples |
| R9020 |
T13833 |
T13834 |
nsubjpass |
samples,frozen |
| R9021 |
T13835 |
T13833 |
prep |
for,samples |
| R9022 |
T13836 |
T13835 |
pobj |
immunofluorescence,for |
| R9023 |
T13837 |
T13834 |
auxpass |
were,frozen |
| R9024 |
T13838 |
T13834 |
prep |
in,frozen |
| R9025 |
T13839 |
T13838 |
pobj |
OCT,in |
| R9026 |
T13840 |
T13834 |
cc |
and,frozen |
| R9027 |
T13841 |
T13834 |
conj |
sectioned,frozen |
| R9028 |
T13842 |
T13843 |
nummod |
10,μm |
| R9029 |
T13843 |
T13844 |
npadvmod |
μm,thick |
| R9030 |
T13844 |
T13841 |
advcl |
thick,sectioned |
| R9031 |
T13845 |
T13841 |
prep |
on,sectioned |
| R9032 |
T13846 |
T13847 |
det |
a,cryostat |
| R9033 |
T13847 |
T13845 |
pobj |
cryostat,on |
| R9034 |
T13848 |
T13834 |
punct |
.,frozen |
| R9035 |
T13850 |
T13851 |
nsubjpass |
Sections,fixed |
| R9036 |
T13852 |
T13851 |
auxpass |
were,fixed |
| R9037 |
T13853 |
T13851 |
prep |
in,fixed |
| R9038 |
T13854 |
T13855 |
nummod |
4,% |
| R9039 |
T13855 |
T13856 |
compound |
%,paraformaldehyde |
| R9040 |
T13856 |
T13853 |
pobj |
paraformaldehyde,in |
| R9041 |
T13857 |
T13851 |
prep |
for,fixed |
| R9042 |
T13858 |
T13859 |
nummod |
10,min |
| R9043 |
T13859 |
T13857 |
pobj |
min,for |
| R9044 |
T13860 |
T13851 |
prep |
at,fixed |
| R9045 |
T13861 |
T13862 |
compound |
room,temperature |
| R9046 |
T13862 |
T13860 |
pobj |
temperature,at |
| R9047 |
T13863 |
T13851 |
punct |
", ",fixed |
| R9048 |
T13864 |
T13851 |
conj |
blocked,fixed |
| R9049 |
T13865 |
T13864 |
punct |
", ",blocked |
| R9050 |
T13866 |
T13864 |
cc |
and,blocked |
| R9051 |
T13867 |
T13864 |
conj |
stained,blocked |
| R9052 |
T13868 |
T13867 |
prep |
with,stained |
| R9053 |
T13869 |
T13868 |
pobj |
antibodies,with |
| R9054 |
T13870 |
T13851 |
punct |
.,fixed |
| R9055 |
T13872 |
T13873 |
compound |
Tissue,samples |
| R9056 |
T13873 |
T13874 |
nsubjpass |
samples,fixed |
| R9057 |
T13875 |
T13873 |
prep |
for,samples |
| R9058 |
T13876 |
T13875 |
pobj |
immunohistochemistry,for |
| R9059 |
T13877 |
T13874 |
auxpass |
were,fixed |
| R9060 |
T13878 |
T13874 |
prep |
in,fixed |
| R9061 |
T13879 |
T13880 |
nummod |
4,% |
| R9062 |
T13880 |
T13881 |
compound |
%,paraformaldehyde |
| R9063 |
T13881 |
T13878 |
pobj |
paraformaldehyde,in |
| R9064 |
T13882 |
T13874 |
punct |
", ",fixed |
| R9065 |
T13883 |
T13874 |
conj |
dehydrated,fixed |
| R9066 |
T13884 |
T13883 |
punct |
", ",dehydrated |
| R9067 |
T13885 |
T13883 |
cc |
and,dehydrated |
| R9068 |
T13886 |
T13883 |
conj |
embedded,dehydrated |
| R9069 |
T13887 |
T13886 |
prep |
in,embedded |
| R9070 |
T13888 |
T13887 |
pobj |
paraffin,in |
| R9071 |
T13889 |
T13874 |
punct |
.,fixed |
| R9072 |
T13891 |
T13892 |
nsubjpass |
Samples,sectioned |
| R9073 |
T13893 |
T13892 |
auxpass |
were,sectioned |
| R9074 |
T13894 |
T13892 |
prep |
on,sectioned |
| R9075 |
T13895 |
T13896 |
det |
a,microtome |
| R9076 |
T13896 |
T13894 |
pobj |
microtome,on |
| R9077 |
T13897 |
T13898 |
punct |
(,thick |
| R9078 |
T13898 |
T13892 |
parataxis |
thick,sectioned |
| R9079 |
T13899 |
T13900 |
nummod |
10,μm |
| R9080 |
T13900 |
T13898 |
npadvmod |
μm,thick |
| R9081 |
T13901 |
T13898 |
punct |
),thick |
| R9082 |
T13902 |
T13892 |
cc |
and,sectioned |
| R9083 |
T13903 |
T13892 |
conj |
rehydrated,sectioned |
| R9084 |
T13904 |
T13903 |
prep |
prior,rehydrated |
| R9085 |
T13905 |
T13904 |
pcomp |
to,prior |
| R9086 |
T13906 |
T13904 |
pcomp |
staining,prior |
| R9087 |
T13907 |
T13906 |
prep |
with,staining |
| R9088 |
T13908 |
T13907 |
pobj |
antibody,with |
| R9089 |
T13909 |
T13892 |
punct |
.,sectioned |
| R9090 |
T13911 |
T13912 |
nsubjpass |
Samples,unmasked |
| R9091 |
T13913 |
T13911 |
acl |
stained,Samples |
| R9092 |
T13914 |
T13913 |
prep |
with,stained |
| R9093 |
T13915 |
T13914 |
pobj |
Snail,with |
| R9094 |
T13916 |
T13915 |
punct |
", ",Snail |
| R9095 |
T13917 |
T13915 |
conj |
pMAPK,Snail |
| R9096 |
T13918 |
T13917 |
punct |
", ",pMAPK |
| R9097 |
T13919 |
T13917 |
conj |
pSmad2,pMAPK |
| R9098 |
T13920 |
T13919 |
punct |
", ",pSmad2 |
| R9099 |
T13921 |
T13919 |
cc |
and,pSmad2 |
| R9100 |
T13922 |
T13923 |
compound |
cyclin,D |
| R9101 |
T13923 |
T13919 |
conj |
D,pSmad2 |
| R9102 |
T13924 |
T13912 |
auxpass |
were,unmasked |
| R9103 |
T13925 |
T13912 |
dep |
antigen,unmasked |
| R9104 |
T13926 |
T13912 |
prep |
with,unmasked |
| R9105 |
T13927 |
T13928 |
nummod |
10,mM |
| R9106 |
T13928 |
T13929 |
compound |
mM,citrate |
| R9107 |
T13929 |
T13926 |
pobj |
citrate,with |
| R9108 |
T13930 |
T13929 |
compound |
sodium,citrate |
| R9109 |
T13931 |
T13929 |
punct |
(,citrate |
| R9110 |
T13932 |
T13929 |
npadvmod |
pH,citrate |
| R9111 |
T13933 |
T13932 |
nummod |
6,pH |
| R9112 |
T13934 |
T13929 |
punct |
),citrate |
| R9113 |
T13935 |
T13912 |
prep |
in,unmasked |
| R9114 |
T13936 |
T13937 |
det |
an,Retriever |
| R9115 |
T13937 |
T13935 |
pobj |
Retriever,in |
| R9116 |
T13938 |
T13937 |
compound |
Antigen,Retriever |
| R9117 |
T13939 |
T13937 |
nummod |
2100,Retriever |
| R9118 |
T13940 |
T13941 |
punct |
(,Laboratories |
| R9119 |
T13941 |
T13937 |
parataxis |
Laboratories,Retriever |
| R9120 |
T13942 |
T13941 |
compound |
Pickcell,Laboratories |
| R9121 |
T13943 |
T13941 |
punct |
", ",Laboratories |
| R9122 |
T13944 |
T13941 |
npadvmod |
Leiden,Laboratories |
| R9123 |
T13945 |
T13941 |
punct |
", ",Laboratories |
| R9124 |
T13946 |
T13941 |
npadvmod |
Netherlands,Laboratories |
| R9125 |
T13947 |
T13941 |
punct |
),Laboratories |
| R9126 |
T13948 |
T13912 |
punct |
.,unmasked |
| R9127 |
T13950 |
T13951 |
det |
The,kit |
| R9128 |
T13951 |
T13954 |
nsubjpass |
kit,used |
| R9129 |
T13952 |
T13953 |
compound |
DAB,substrate |
| R9130 |
T13953 |
T13951 |
compound |
substrate,kit |
| R9131 |
T13955 |
T13956 |
punct |
(,Labs |
| R9132 |
T13956 |
T13951 |
parataxis |
Labs,kit |
| R9133 |
T13957 |
T13956 |
compound |
Vector,Labs |
| R9134 |
T13958 |
T13956 |
punct |
),Labs |
| R9135 |
T13959 |
T13954 |
auxpass |
was,used |
| R9136 |
T13960 |
T13954 |
prep |
according,used |
| R9137 |
T13961 |
T13960 |
prep |
to,according |
| R9138 |
T13962 |
T13963 |
poss |
manufacturer,instructions |
| R9139 |
T13963 |
T13961 |
pobj |
instructions,to |
| R9140 |
T13964 |
T13962 |
case |
's,manufacturer |
| R9141 |
T13965 |
T13966 |
aux |
to,develop |
| R9142 |
T13966 |
T13954 |
advcl |
develop,used |
| R9143 |
T13967 |
T13968 |
det |
the,signal |
| R9144 |
T13968 |
T13966 |
dobj |
signal,develop |
| R9145 |
T13969 |
T13954 |
punct |
.,used |
| R9146 |
T14008 |
T14009 |
compound |
RT,PCR |
| R9147 |
T14010 |
T14009 |
punct |
-,PCR |
| R9148 |
T14012 |
T14013 |
nsubjpass |
RNA,extracted |
| R9149 |
T14014 |
T14013 |
auxpass |
was,extracted |
| R9150 |
T14015 |
T14013 |
prep |
from,extracted |
| R9151 |
T14016 |
T14015 |
pobj |
keratinocytes,from |
| R9152 |
T14017 |
T14016 |
cc |
or,keratinocytes |
| R9153 |
T14018 |
T14019 |
compound |
skin,tissue |
| R9154 |
T14019 |
T14016 |
conj |
tissue,keratinocytes |
| R9155 |
T14020 |
T14013 |
prep |
with,extracted |
| R9156 |
T14021 |
T14020 |
pobj |
Trizol,with |
| R9157 |
T14022 |
T14023 |
punct |
(,Invitrogen |
| R9158 |
T14023 |
T14021 |
parataxis |
Invitrogen,Trizol |
| R9159 |
T14024 |
T14023 |
punct |
),Invitrogen |
| R9160 |
T14025 |
T14013 |
prep |
according,extracted |
| R9161 |
T14026 |
T14025 |
prep |
to,according |
| R9162 |
T14027 |
T14028 |
det |
the,manufacturer |
| R9163 |
T14028 |
T14029 |
poss |
manufacturer,protocol |
| R9164 |
T14029 |
T14026 |
pobj |
protocol,to |
| R9165 |
T14030 |
T14028 |
case |
's,manufacturer |
| R9166 |
T14031 |
T14013 |
punct |
.,extracted |
| R9167 |
T14033 |
T14034 |
nsubjpass |
cDNA,generated |
| R9168 |
T14035 |
T14034 |
auxpass |
was,generated |
| R9169 |
T14036 |
T14034 |
advcl |
using,generated |
| R9170 |
T14037 |
T14038 |
compound |
oligo,dT |
| R9171 |
T14038 |
T14040 |
compound |
dT,primers |
| R9172 |
T14039 |
T14038 |
punct |
-,dT |
| R9173 |
T14040 |
T14036 |
dobj |
primers,using |
| R9174 |
T14041 |
T14040 |
cc |
and,primers |
| R9175 |
T14042 |
T14043 |
det |
the,kit |
| R9176 |
T14043 |
T14040 |
conj |
kit,primers |
| R9177 |
T14044 |
T14043 |
nmod |
Superscript,kit |
| R9178 |
T14045 |
T14044 |
nummod |
II,Superscript |
| R9179 |
T14046 |
T14047 |
punct |
(,Invitrogen |
| R9180 |
T14047 |
T14043 |
parataxis |
Invitrogen,kit |
| R9181 |
T14048 |
T14047 |
punct |
),Invitrogen |
| R9182 |
T14049 |
T14034 |
punct |
.,generated |
| R9183 |
T14051 |
T14052 |
det |
The,primers |
| R9184 |
T14052 |
T14053 |
nsubj |
primers,were |
| R9185 |
T14054 |
T14052 |
acl |
used,primers |
| R9186 |
T14055 |
T14054 |
prep |
for,used |
| R9187 |
T14056 |
T14055 |
pobj |
PCR,for |
| R9188 |
T14057 |
T14058 |
compound |
Snail,forward |
| R9189 |
T14058 |
T14053 |
attr |
forward,were |
| R9190 |
T14059 |
T14058 |
punct |
: ,forward |
| R9191 |
T14060 |
T14061 |
nummod |
5,CAGCTGGCCAGGCTCTCGGT |
| R9192 |
T14061 |
T14058 |
appos |
CAGCTGGCCAGGCTCTCGGT,forward |
| R9193 |
T14062 |
T14060 |
punct |
′,5 |
| R9194 |
T14063 |
T14061 |
punct |
-,CAGCTGGCCAGGCTCTCGGT |
| R9195 |
T14064 |
T14061 |
punct |
-,CAGCTGGCCAGGCTCTCGGT |
| R9196 |
T14065 |
T14061 |
nummod |
3,CAGCTGGCCAGGCTCTCGGT |
| R9197 |
T14066 |
T14061 |
punct |
′,CAGCTGGCCAGGCTCTCGGT |
| R9198 |
T14067 |
T14058 |
punct |
;,forward |
| R9199 |
T14068 |
T14069 |
compound |
Snail,reverse |
| R9200 |
T14069 |
T14058 |
conj |
reverse,forward |
| R9201 |
T14070 |
T14069 |
punct |
: ,reverse |
| R9202 |
T14071 |
T14072 |
nummod |
5,GCGAGGGCCTCCGGAGCA |
| R9203 |
T14072 |
T14069 |
appos |
GCGAGGGCCTCCGGAGCA,reverse |
| R9204 |
T14073 |
T14071 |
punct |
′,5 |
| R9205 |
T14074 |
T14072 |
punct |
-,GCGAGGGCCTCCGGAGCA |
| R9206 |
T14075 |
T14072 |
punct |
-,GCGAGGGCCTCCGGAGCA |
| R9207 |
T14076 |
T14072 |
nummod |
3,GCGAGGGCCTCCGGAGCA |
| R9208 |
T14077 |
T14072 |
punct |
′,GCGAGGGCCTCCGGAGCA |
| R9209 |
T14078 |
T14069 |
punct |
;,reverse |
| R9210 |
T14079 |
T14080 |
compound |
GAPDH,forward |
| R9211 |
T14080 |
T14069 |
conj |
forward,reverse |
| R9212 |
T14081 |
T14082 |
nummod |
5,CGTAGACAAAATGGTGAAGGTCGG |
| R9213 |
T14082 |
T14080 |
appos |
CGTAGACAAAATGGTGAAGGTCGG,forward |
| R9214 |
T14083 |
T14081 |
punct |
′,5 |
| R9215 |
T14084 |
T14082 |
punct |
-,CGTAGACAAAATGGTGAAGGTCGG |
| R9216 |
T14085 |
T14082 |
punct |
-,CGTAGACAAAATGGTGAAGGTCGG |
| R9217 |
T14086 |
T14082 |
nummod |
3,CGTAGACAAAATGGTGAAGGTCGG |
| R9218 |
T14087 |
T14082 |
punct |
′,CGTAGACAAAATGGTGAAGGTCGG |
| R9219 |
T14088 |
T14080 |
punct |
;,forward |
| R9220 |
T14089 |
T14080 |
cc |
and,forward |
| R9221 |
T14090 |
T14091 |
compound |
GAPDH,reverse |
| R9222 |
T14091 |
T14080 |
conj |
reverse,forward |
| R9223 |
T14092 |
T14091 |
punct |
: ,reverse |
| R9224 |
T14093 |
T14094 |
nummod |
5,AAGCAGTTGGTGGTGCAGGATG |
| R9225 |
T14094 |
T14091 |
appos |
AAGCAGTTGGTGGTGCAGGATG,reverse |
| R9226 |
T14095 |
T14093 |
punct |
′,5 |
| R9227 |
T14096 |
T14094 |
punct |
-,AAGCAGTTGGTGGTGCAGGATG |
| R9228 |
T14097 |
T14094 |
punct |
-,AAGCAGTTGGTGGTGCAGGATG |
| R9229 |
T14098 |
T14094 |
nummod |
3,AAGCAGTTGGTGGTGCAGGATG |
| R9230 |
T14099 |
T14094 |
punct |
′,AAGCAGTTGGTGGTGCAGGATG |
| R9231 |
T14100 |
T14053 |
punct |
.,were |
