| Id |
Subject |
Object |
Predicate |
Lexical cue |
| T1019 |
13-22 |
JJ |
denotes |
Mammalian |
| T1020 |
23-34 |
NN |
denotes |
development |
| T1021 |
35-43 |
VBZ |
denotes |
involves |
| T1022 |
44-47 |
DT |
denotes |
the |
| T1023 |
48-61 |
NN |
denotes |
morphogenesis |
| T1024 |
62-64 |
IN |
denotes |
of |
| T1025 |
65-72 |
JJ |
denotes |
complex |
| T1027 |
73-78 |
CD |
denotes |
three |
| T1029 |
78-79 |
HYPH |
denotes |
- |
| T1028 |
79-90 |
JJ |
denotes |
dimensional |
| T1026 |
91-101 |
NNS |
denotes |
structures |
| T1030 |
102-106 |
IN |
denotes |
from |
| T1031 |
107-116 |
RB |
denotes |
seemingly |
| T1032 |
117-124 |
JJ |
denotes |
uniform |
| T1033 |
125-131 |
NNS |
denotes |
sheets |
| T1034 |
132-134 |
CC |
denotes |
or |
| T1035 |
135-141 |
NNS |
denotes |
masses |
| T1036 |
142-144 |
IN |
denotes |
of |
| T1037 |
145-150 |
NNS |
denotes |
cells |
| T1038 |
150-151 |
. |
denotes |
. |
| T1039 |
151-289 |
sentence |
denotes |
A simple bud-like structure initiates the formation of many organs, including lungs, spinal cord, mammary glands, and hair follicles [1]. |
| T1040 |
152-153 |
DT |
denotes |
A |
| T1042 |
154-160 |
JJ |
denotes |
simple |
| T1043 |
161-164 |
NN |
denotes |
bud |
| T1045 |
164-165 |
HYPH |
denotes |
- |
| T1044 |
165-169 |
JJ |
denotes |
like |
| T1041 |
170-179 |
NN |
denotes |
structure |
| T1046 |
180-189 |
VBZ |
denotes |
initiates |
| T1047 |
190-193 |
DT |
denotes |
the |
| T1048 |
194-203 |
NN |
denotes |
formation |
| T1049 |
204-206 |
IN |
denotes |
of |
| T1050 |
207-211 |
JJ |
denotes |
many |
| T1051 |
212-218 |
NNS |
denotes |
organs |
| T1052 |
218-220 |
, |
denotes |
, |
| T1053 |
220-229 |
VBG |
denotes |
including |
| T1054 |
230-235 |
NNS |
denotes |
lungs |
| T1055 |
235-237 |
, |
denotes |
, |
| T1056 |
237-243 |
JJ |
denotes |
spinal |
| T1057 |
244-248 |
NN |
denotes |
cord |
| T1058 |
248-250 |
, |
denotes |
, |
| T1059 |
250-257 |
JJ |
denotes |
mammary |
| T1060 |
258-264 |
NNS |
denotes |
glands |
| T1061 |
264-266 |
, |
denotes |
, |
| T1062 |
266-269 |
CC |
denotes |
and |
| T1063 |
270-274 |
NN |
denotes |
hair |
| T1064 |
275-284 |
NNS |
denotes |
follicles |
| T1065 |
285-286 |
-LRB- |
denotes |
[ |
| T1066 |
286-287 |
CD |
denotes |
1 |
| T1067 |
287-288 |
-RRB- |
denotes |
] |
| T1068 |
288-289 |
. |
denotes |
. |
| T1069 |
289-467 |
sentence |
denotes |
The multipotent, adhering epithelial cells are typically attached to an underlying basal lamina that polarizes the epithelial sheet and separates it from surrounding mesenchyme. |
| T1070 |
290-293 |
DT |
denotes |
The |
| T1072 |
294-305 |
JJ |
denotes |
multipotent |
| T1073 |
305-307 |
, |
denotes |
, |
| T1074 |
307-315 |
VBG |
denotes |
adhering |
| T1075 |
316-326 |
JJ |
denotes |
epithelial |
| T1071 |
327-332 |
NNS |
denotes |
cells |
| T1077 |
333-336 |
VBP |
denotes |
are |
| T1078 |
337-346 |
RB |
denotes |
typically |
| T1076 |
347-355 |
VBN |
denotes |
attached |
| T1079 |
356-358 |
IN |
denotes |
to |
| T1080 |
359-361 |
DT |
denotes |
an |
| T1082 |
362-372 |
VBG |
denotes |
underlying |
| T1083 |
373-378 |
JJ |
denotes |
basal |
| T1081 |
379-385 |
NN |
denotes |
lamina |
| T1084 |
386-390 |
WDT |
denotes |
that |
| T1085 |
391-400 |
VBZ |
denotes |
polarizes |
| T1086 |
401-404 |
DT |
denotes |
the |
| T1088 |
405-415 |
JJ |
denotes |
epithelial |
| T1087 |
416-421 |
NN |
denotes |
sheet |
| T1089 |
422-425 |
CC |
denotes |
and |
| T1090 |
426-435 |
VBZ |
denotes |
separates |
| T1091 |
436-438 |
PRP |
denotes |
it |
| T1092 |
439-443 |
IN |
denotes |
from |
| T1093 |
444-455 |
VBG |
denotes |
surrounding |
| T1094 |
456-466 |
NN |
denotes |
mesenchyme |
| T1095 |
466-467 |
. |
denotes |
. |
| T1096 |
467-647 |
sentence |
denotes |
Budding morphogenesis is guided by a reciprocal exchange of signals between epithelium and mesenchyme to specify the identity of the organ that will form and to govern its growth. |
| T1097 |
468-475 |
VBG |
denotes |
Budding |
| T1098 |
476-489 |
NN |
denotes |
morphogenesis |
| T1100 |
490-492 |
VBZ |
denotes |
is |
| T1099 |
493-499 |
VBN |
denotes |
guided |
| T1101 |
500-502 |
IN |
denotes |
by |
| T1102 |
503-504 |
DT |
denotes |
a |
| T1104 |
505-515 |
JJ |
denotes |
reciprocal |
| T1103 |
516-524 |
NN |
denotes |
exchange |
| T1105 |
525-527 |
IN |
denotes |
of |
| T1106 |
528-535 |
NNS |
denotes |
signals |
| T1107 |
536-543 |
IN |
denotes |
between |
| T1108 |
544-554 |
NN |
denotes |
epithelium |
| T1109 |
555-558 |
CC |
denotes |
and |
| T1110 |
559-569 |
NN |
denotes |
mesenchyme |
| T1111 |
570-572 |
TO |
denotes |
to |
| T1112 |
573-580 |
VB |
denotes |
specify |
| T1113 |
581-584 |
DT |
denotes |
the |
| T1114 |
585-593 |
NN |
denotes |
identity |
| T1115 |
594-596 |
IN |
denotes |
of |
| T1116 |
597-600 |
DT |
denotes |
the |
| T1117 |
601-606 |
NN |
denotes |
organ |
| T1118 |
607-611 |
WDT |
denotes |
that |
| T1120 |
612-616 |
MD |
denotes |
will |
| T1119 |
617-621 |
VB |
denotes |
form |
| T1121 |
622-625 |
CC |
denotes |
and |
| T1122 |
626-628 |
TO |
denotes |
to |
| T1123 |
629-635 |
VB |
denotes |
govern |
| T1124 |
636-639 |
PRP$ |
denotes |
its |
| T1125 |
640-646 |
NN |
denotes |
growth |
| T1126 |
646-647 |
. |
denotes |
. |
| T1127 |
647-823 |
sentence |
denotes |
At the helm of these molecular communication pathways are Wnts, bone morphogenic proteins (BMPs), transforming growth factor βs (TGF-βs), and fibroblast growth factors (FGFs). |
| T1128 |
648-650 |
IN |
denotes |
At |
| T1130 |
651-654 |
DT |
denotes |
the |
| T1131 |
655-659 |
NN |
denotes |
helm |
| T1132 |
660-662 |
IN |
denotes |
of |
| T1133 |
663-668 |
DT |
denotes |
these |
| T1135 |
669-678 |
JJ |
denotes |
molecular |
| T1136 |
679-692 |
NN |
denotes |
communication |
| T1134 |
693-701 |
NNS |
denotes |
pathways |
| T1129 |
702-705 |
VBP |
denotes |
are |
| T1137 |
706-710 |
NNS |
denotes |
Wnts |
| T1138 |
710-712 |
, |
denotes |
, |
| T1139 |
712-716 |
NN |
denotes |
bone |
| T1141 |
717-728 |
JJ |
denotes |
morphogenic |
| T1140 |
729-737 |
NN |
denotes |
proteins |
| T1142 |
738-739 |
-LRB- |
denotes |
( |
| T1143 |
739-743 |
NNS |
denotes |
BMPs |
| T1144 |
743-744 |
-RRB- |
denotes |
) |
| T1145 |
744-746 |
, |
denotes |
, |
| T1146 |
746-758 |
VBG |
denotes |
transforming |
| T1148 |
759-765 |
NN |
denotes |
growth |
| T1149 |
766-772 |
NN |
denotes |
factor |
| T1147 |
773-775 |
NNS |
denotes |
βs |
| T1150 |
776-777 |
-LRB- |
denotes |
( |
| T1151 |
777-780 |
NN |
denotes |
TGF |
| T1153 |
780-781 |
HYPH |
denotes |
- |
| T1152 |
781-783 |
NNS |
denotes |
βs |
| T1154 |
783-784 |
-RRB- |
denotes |
) |
| T1155 |
784-786 |
, |
denotes |
, |
| T1156 |
786-789 |
CC |
denotes |
and |
| T1157 |
790-800 |
NN |
denotes |
fibroblast |
| T1159 |
801-807 |
NN |
denotes |
growth |
| T1158 |
808-815 |
NNS |
denotes |
factors |
| T1160 |
816-817 |
-LRB- |
denotes |
( |
| T1161 |
817-821 |
NNS |
denotes |
FGFs |
| T1162 |
821-822 |
-RRB- |
denotes |
) |
| T1163 |
822-823 |
. |
denotes |
. |
| T1164 |
823-1047 |
sentence |
denotes |
Through activation of cell surface transmembrane receptors, these external signaling molecules trigger distinct cascades of intracellular events that culminate in changes in gene expression, growth, and differentiation [2]. |
| T1165 |
824-831 |
IN |
denotes |
Through |
| T1167 |
832-842 |
NN |
denotes |
activation |
| T1168 |
843-845 |
IN |
denotes |
of |
| T1169 |
846-850 |
NN |
denotes |
cell |
| T1170 |
851-858 |
NN |
denotes |
surface |
| T1172 |
859-872 |
NN |
denotes |
transmembrane |
| T1171 |
873-882 |
NNS |
denotes |
receptors |
| T1173 |
882-884 |
, |
denotes |
, |
| T1174 |
884-889 |
DT |
denotes |
these |
| T1176 |
890-898 |
JJ |
denotes |
external |
| T1177 |
899-908 |
NN |
denotes |
signaling |
| T1175 |
909-918 |
NNS |
denotes |
molecules |
| T1166 |
919-926 |
VBP |
denotes |
trigger |
| T1178 |
927-935 |
JJ |
denotes |
distinct |
| T1179 |
936-944 |
NNS |
denotes |
cascades |
| T1180 |
945-947 |
IN |
denotes |
of |
| T1181 |
948-961 |
JJ |
denotes |
intracellular |
| T1182 |
962-968 |
NNS |
denotes |
events |
| T1183 |
969-973 |
WDT |
denotes |
that |
| T1184 |
974-983 |
VBP |
denotes |
culminate |
| T1185 |
984-986 |
IN |
denotes |
in |
| T1186 |
987-994 |
NNS |
denotes |
changes |
| T1187 |
995-997 |
IN |
denotes |
in |
| T1188 |
998-1002 |
NN |
denotes |
gene |
| T1189 |
1003-1013 |
NN |
denotes |
expression |
| T1190 |
1013-1015 |
, |
denotes |
, |
| T1191 |
1015-1021 |
NN |
denotes |
growth |
| T1192 |
1021-1023 |
, |
denotes |
, |
| T1193 |
1023-1026 |
CC |
denotes |
and |
| T1194 |
1027-1042 |
NN |
denotes |
differentiation |
| T1195 |
1043-1044 |
-LRB- |
denotes |
[ |
| T1196 |
1044-1045 |
CD |
denotes |
2 |
| T1197 |
1045-1046 |
-RRB- |
denotes |
] |
| T1198 |
1046-1047 |
. |
denotes |
. |
| T1199 |
1047-1220 |
sentence |
denotes |
How this constellation of signals collaborates in tailoring each budding process so that it executes a distinct morphogenetic program has yet to be comprehensively defined. |
| T1200 |
1048-1051 |
WRB |
denotes |
How |
| T1202 |
1052-1056 |
DT |
denotes |
this |
| T1203 |
1057-1070 |
NN |
denotes |
constellation |
| T1204 |
1071-1073 |
IN |
denotes |
of |
| T1205 |
1074-1081 |
NNS |
denotes |
signals |
| T1201 |
1082-1094 |
VBZ |
denotes |
collaborates |
| T1207 |
1095-1097 |
IN |
denotes |
in |
| T1208 |
1098-1107 |
VBG |
denotes |
tailoring |
| T1209 |
1108-1112 |
DT |
denotes |
each |
| T1211 |
1113-1120 |
NN |
denotes |
budding |
| T1210 |
1121-1128 |
NN |
denotes |
process |
| T1212 |
1129-1131 |
IN |
denotes |
so |
| T1214 |
1132-1136 |
IN |
denotes |
that |
| T1215 |
1137-1139 |
PRP |
denotes |
it |
| T1213 |
1140-1148 |
VBZ |
denotes |
executes |
| T1216 |
1149-1150 |
DT |
denotes |
a |
| T1218 |
1151-1159 |
JJ |
denotes |
distinct |
| T1219 |
1160-1173 |
JJ |
denotes |
morphogenetic |
| T1217 |
1174-1181 |
NN |
denotes |
program |
| T1206 |
1182-1185 |
VBZ |
denotes |
has |
| T1220 |
1186-1189 |
RB |
denotes |
yet |
| T1222 |
1190-1192 |
TO |
denotes |
to |
| T1223 |
1193-1195 |
VB |
denotes |
be |
| T1224 |
1196-1211 |
RB |
denotes |
comprehensively |
| T1221 |
1212-1219 |
VBN |
denotes |
defined |
| T1225 |
1219-1220 |
. |
denotes |
. |
| T1226 |
1220-1446 |
sentence |
denotes |
However, the process appears to be patterned at the initial stages of bud formation, since the relative importance of these pathways and their downstream effectors differ as buds begin to develop and cell fates are specified. |
| T1227 |
1221-1228 |
RB |
denotes |
However |
| T1229 |
1228-1230 |
, |
denotes |
, |
| T1230 |
1230-1233 |
DT |
denotes |
the |
| T1231 |
1234-1241 |
NN |
denotes |
process |
| T1228 |
1242-1249 |
VBZ |
denotes |
appears |
| T1232 |
1250-1252 |
TO |
denotes |
to |
| T1234 |
1253-1255 |
VB |
denotes |
be |
| T1233 |
1256-1265 |
VBN |
denotes |
patterned |
| T1235 |
1266-1268 |
IN |
denotes |
at |
| T1236 |
1269-1272 |
DT |
denotes |
the |
| T1238 |
1273-1280 |
JJ |
denotes |
initial |
| T1237 |
1281-1287 |
NNS |
denotes |
stages |
| T1239 |
1288-1290 |
IN |
denotes |
of |
| T1240 |
1291-1294 |
NN |
denotes |
bud |
| T1241 |
1295-1304 |
NN |
denotes |
formation |
| T1242 |
1304-1306 |
, |
denotes |
, |
| T1243 |
1306-1311 |
IN |
denotes |
since |
| T1245 |
1312-1315 |
DT |
denotes |
the |
| T1247 |
1316-1324 |
JJ |
denotes |
relative |
| T1246 |
1325-1335 |
NN |
denotes |
importance |
| T1248 |
1336-1338 |
IN |
denotes |
of |
| T1249 |
1339-1344 |
DT |
denotes |
these |
| T1250 |
1345-1353 |
NNS |
denotes |
pathways |
| T1251 |
1354-1357 |
CC |
denotes |
and |
| T1252 |
1358-1363 |
PRP$ |
denotes |
their |
| T1254 |
1364-1374 |
JJ |
denotes |
downstream |
| T1253 |
1375-1384 |
NNS |
denotes |
effectors |
| T1244 |
1385-1391 |
VBP |
denotes |
differ |
| T1255 |
1392-1394 |
IN |
denotes |
as |
| T1257 |
1395-1399 |
NNS |
denotes |
buds |
| T1256 |
1400-1405 |
VBP |
denotes |
begin |
| T1258 |
1406-1408 |
TO |
denotes |
to |
| T1259 |
1409-1416 |
VB |
denotes |
develop |
| T1260 |
1417-1420 |
CC |
denotes |
and |
| T1261 |
1421-1425 |
NN |
denotes |
cell |
| T1262 |
1426-1431 |
NNS |
denotes |
fates |
| T1264 |
1432-1435 |
VBP |
denotes |
are |
| T1263 |
1436-1445 |
VBN |
denotes |
specified |
| T1265 |
1445-1446 |
. |
denotes |
. |
| T1266 |
1446-1578 |
sentence |
denotes |
The development of a bud requires a number of coordinated changes in the behavior of the targeted cells within an epithelial sheet. |
| T1267 |
1447-1450 |
DT |
denotes |
The |
| T1268 |
1451-1462 |
NN |
denotes |
development |
| T1270 |
1463-1465 |
IN |
denotes |
of |
| T1271 |
1466-1467 |
DT |
denotes |
a |
| T1272 |
1468-1471 |
NN |
denotes |
bud |
| T1269 |
1472-1480 |
VBZ |
denotes |
requires |
| T1273 |
1481-1482 |
DT |
denotes |
a |
| T1274 |
1483-1489 |
NN |
denotes |
number |
| T1275 |
1490-1492 |
IN |
denotes |
of |
| T1276 |
1493-1504 |
VBN |
denotes |
coordinated |
| T1277 |
1505-1512 |
NNS |
denotes |
changes |
| T1278 |
1513-1515 |
IN |
denotes |
in |
| T1279 |
1516-1519 |
DT |
denotes |
the |
| T1280 |
1520-1528 |
NN |
denotes |
behavior |
| T1281 |
1529-1531 |
IN |
denotes |
of |
| T1282 |
1532-1535 |
DT |
denotes |
the |
| T1284 |
1536-1544 |
VBN |
denotes |
targeted |
| T1283 |
1545-1550 |
NNS |
denotes |
cells |
| T1285 |
1551-1557 |
IN |
denotes |
within |
| T1286 |
1558-1560 |
DT |
denotes |
an |
| T1288 |
1561-1571 |
JJ |
denotes |
epithelial |
| T1287 |
1572-1577 |
NN |
denotes |
sheet |
| T1289 |
1577-1578 |
. |
denotes |
. |
| T1290 |
1578-1762 |
sentence |
denotes |
The process must be accompanied by alterations in the proliferation, polarity, shape, and adhesiveness of selected cells, as well as by modifications in their underlying basal lamina. |
| T1291 |
1579-1582 |
DT |
denotes |
The |
| T1292 |
1583-1590 |
NN |
denotes |
process |
| T1294 |
1591-1595 |
MD |
denotes |
must |
| T1295 |
1596-1598 |
VB |
denotes |
be |
| T1293 |
1599-1610 |
VBN |
denotes |
accompanied |
| T1296 |
1611-1613 |
IN |
denotes |
by |
| T1297 |
1614-1625 |
NNS |
denotes |
alterations |
| T1298 |
1626-1628 |
IN |
denotes |
in |
| T1299 |
1629-1632 |
DT |
denotes |
the |
| T1300 |
1633-1646 |
NN |
denotes |
proliferation |
| T1301 |
1646-1648 |
, |
denotes |
, |
| T1302 |
1648-1656 |
NN |
denotes |
polarity |
| T1303 |
1656-1658 |
, |
denotes |
, |
| T1304 |
1658-1663 |
NN |
denotes |
shape |
| T1305 |
1663-1665 |
, |
denotes |
, |
| T1306 |
1665-1668 |
CC |
denotes |
and |
| T1307 |
1669-1681 |
NN |
denotes |
adhesiveness |
| T1308 |
1682-1684 |
IN |
denotes |
of |
| T1309 |
1685-1693 |
VBN |
denotes |
selected |
| T1310 |
1694-1699 |
NNS |
denotes |
cells |
| T1311 |
1699-1701 |
, |
denotes |
, |
| T1312 |
1701-1703 |
RB |
denotes |
as |
| T1314 |
1704-1708 |
RB |
denotes |
well |
| T1313 |
1709-1711 |
IN |
denotes |
as |
| T1315 |
1712-1714 |
IN |
denotes |
by |
| T1316 |
1715-1728 |
NNS |
denotes |
modifications |
| T1317 |
1729-1731 |
IN |
denotes |
in |
| T1318 |
1732-1737 |
PRP$ |
denotes |
their |
| T1320 |
1738-1748 |
VBG |
denotes |
underlying |
| T1321 |
1749-1754 |
JJ |
denotes |
basal |
| T1319 |
1755-1761 |
NN |
denotes |
lamina |
| T1322 |
1761-1762 |
. |
denotes |
. |
| T1323 |
1762-1990 |
sentence |
denotes |
Thus, extracellular epithelial-mesenchymal crosstalk must be intricately orchestrated to couple the determination of distinct cell fates with the contemporaneous remodeling of the physical and structural properties of the cell. |
| T1324 |
1763-1767 |
RB |
denotes |
Thus |
| T1326 |
1767-1769 |
, |
denotes |
, |
| T1327 |
1769-1782 |
JJ |
denotes |
extracellular |
| T1329 |
1783-1793 |
JJ |
denotes |
epithelial |
| T1331 |
1793-1794 |
HYPH |
denotes |
- |
| T1330 |
1794-1805 |
JJ |
denotes |
mesenchymal |
| T1328 |
1806-1815 |
NN |
denotes |
crosstalk |
| T1332 |
1816-1820 |
MD |
denotes |
must |
| T1333 |
1821-1823 |
VB |
denotes |
be |
| T1334 |
1824-1835 |
RB |
denotes |
intricately |
| T1325 |
1836-1848 |
VBN |
denotes |
orchestrated |
| T1335 |
1849-1851 |
TO |
denotes |
to |
| T1336 |
1852-1858 |
VB |
denotes |
couple |
| T1337 |
1859-1862 |
DT |
denotes |
the |
| T1338 |
1863-1876 |
NN |
denotes |
determination |
| T1339 |
1877-1879 |
IN |
denotes |
of |
| T1340 |
1880-1888 |
JJ |
denotes |
distinct |
| T1342 |
1889-1893 |
NN |
denotes |
cell |
| T1341 |
1894-1899 |
NNS |
denotes |
fates |
| T1343 |
1900-1904 |
IN |
denotes |
with |
| T1344 |
1905-1908 |
DT |
denotes |
the |
| T1346 |
1909-1924 |
JJ |
denotes |
contemporaneous |
| T1345 |
1925-1935 |
NN |
denotes |
remodeling |
| T1347 |
1936-1938 |
IN |
denotes |
of |
| T1348 |
1939-1942 |
DT |
denotes |
the |
| T1350 |
1943-1951 |
JJ |
denotes |
physical |
| T1351 |
1952-1955 |
CC |
denotes |
and |
| T1352 |
1956-1966 |
JJ |
denotes |
structural |
| T1349 |
1967-1977 |
NNS |
denotes |
properties |
| T1353 |
1978-1980 |
IN |
denotes |
of |
| T1354 |
1981-1984 |
DT |
denotes |
the |
| T1355 |
1985-1989 |
NN |
denotes |
cell |
| T1356 |
1989-1990 |
. |
denotes |
. |
| T1357 |
1990-2106 |
sentence |
denotes |
Among the few dispensable organs, hair follicles offer an excellent model system to study epithelial bud formation. |
| T1358 |
1991-1996 |
IN |
denotes |
Among |
| T1360 |
1997-2000 |
DT |
denotes |
the |
| T1362 |
2001-2004 |
JJ |
denotes |
few |
| T1363 |
2005-2016 |
JJ |
denotes |
dispensable |
| T1361 |
2017-2023 |
NNS |
denotes |
organs |
| T1364 |
2023-2025 |
, |
denotes |
, |
| T1365 |
2025-2029 |
NN |
denotes |
hair |
| T1366 |
2030-2039 |
NNS |
denotes |
follicles |
| T1359 |
2040-2045 |
VBP |
denotes |
offer |
| T1367 |
2046-2048 |
DT |
denotes |
an |
| T1369 |
2049-2058 |
JJ |
denotes |
excellent |
| T1370 |
2059-2064 |
NN |
denotes |
model |
| T1368 |
2065-2071 |
NN |
denotes |
system |
| T1371 |
2072-2074 |
TO |
denotes |
to |
| T1372 |
2075-2080 |
VB |
denotes |
study |
| T1373 |
2081-2091 |
JJ |
denotes |
epithelial |
| T1374 |
2092-2095 |
NN |
denotes |
bud |
| T1375 |
2096-2105 |
NN |
denotes |
formation |
| T1376 |
2105-2106 |
. |
denotes |
. |
| T1377 |
2106-2190 |
sentence |
denotes |
Mammalian skin epithelium begins as a single sheet of multipotent ectodermal cells. |
| T1378 |
2107-2116 |
JJ |
denotes |
Mammalian |
| T1380 |
2117-2121 |
NN |
denotes |
skin |
| T1379 |
2122-2132 |
NN |
denotes |
epithelium |
| T1381 |
2133-2139 |
VBZ |
denotes |
begins |
| T1382 |
2140-2142 |
IN |
denotes |
as |
| T1383 |
2143-2144 |
DT |
denotes |
a |
| T1385 |
2145-2151 |
JJ |
denotes |
single |
| T1384 |
2152-2157 |
NN |
denotes |
sheet |
| T1386 |
2158-2160 |
IN |
denotes |
of |
| T1387 |
2161-2172 |
JJ |
denotes |
multipotent |
| T1389 |
2173-2183 |
JJ |
denotes |
ectodermal |
| T1388 |
2184-2189 |
NNS |
denotes |
cells |
| T1390 |
2189-2190 |
. |
denotes |
. |
| T1391 |
2190-2377 |
sentence |
denotes |
During development, specialized mesenchymal cells populate the skin in a spatially defined pattern to initiate the complex epithelial-mesenchymal crosstalk that will specify the bud [3]. |
| T1392 |
2191-2197 |
IN |
denotes |
During |
| T1394 |
2198-2209 |
NN |
denotes |
development |
| T1395 |
2209-2211 |
, |
denotes |
, |
| T1396 |
2211-2222 |
JJ |
denotes |
specialized |
| T1398 |
2223-2234 |
JJ |
denotes |
mesenchymal |
| T1397 |
2235-2240 |
NNS |
denotes |
cells |
| T1393 |
2241-2249 |
VBP |
denotes |
populate |
| T1399 |
2250-2253 |
DT |
denotes |
the |
| T1400 |
2254-2258 |
NN |
denotes |
skin |
| T1401 |
2259-2261 |
IN |
denotes |
in |
| T1402 |
2262-2263 |
DT |
denotes |
a |
| T1404 |
2264-2273 |
RB |
denotes |
spatially |
| T1405 |
2274-2281 |
VBN |
denotes |
defined |
| T1403 |
2282-2289 |
NN |
denotes |
pattern |
| T1406 |
2290-2292 |
TO |
denotes |
to |
| T1407 |
2293-2301 |
VB |
denotes |
initiate |
| T1408 |
2302-2305 |
DT |
denotes |
the |
| T1410 |
2306-2313 |
JJ |
denotes |
complex |
| T1411 |
2314-2324 |
JJ |
denotes |
epithelial |
| T1413 |
2324-2325 |
HYPH |
denotes |
- |
| T1412 |
2325-2336 |
JJ |
denotes |
mesenchymal |
| T1409 |
2337-2346 |
NN |
denotes |
crosstalk |
| T1414 |
2347-2351 |
WDT |
denotes |
that |
| T1416 |
2352-2356 |
MD |
denotes |
will |
| T1415 |
2357-2364 |
VB |
denotes |
specify |
| T1417 |
2365-2368 |
DT |
denotes |
the |
| T1418 |
2369-2372 |
NN |
denotes |
bud |
| T1419 |
2373-2374 |
-LRB- |
denotes |
[ |
| T1420 |
2374-2375 |
CD |
denotes |
3 |
| T1421 |
2375-2376 |
-RRB- |
denotes |
] |
| T1422 |
2376-2377 |
. |
denotes |
. |
| T1423 |
2377-2598 |
sentence |
denotes |
Once committed, a small cluster of epithelial cells, the placode, instructs a group of underlying mesenchymal cells to condense and form the nascent dermal papilla, which will be a permanent fixture of the hair follicle. |
| T1424 |
2378-2382 |
IN |
denotes |
Once |
| T1425 |
2383-2392 |
VBN |
denotes |
committed |
| T1427 |
2392-2394 |
, |
denotes |
, |
| T1428 |
2394-2395 |
DT |
denotes |
a |
| T1430 |
2396-2401 |
JJ |
denotes |
small |
| T1429 |
2402-2409 |
NN |
denotes |
cluster |
| T1431 |
2410-2412 |
IN |
denotes |
of |
| T1432 |
2413-2423 |
JJ |
denotes |
epithelial |
| T1433 |
2424-2429 |
NNS |
denotes |
cells |
| T1434 |
2429-2431 |
, |
denotes |
, |
| T1435 |
2431-2434 |
DT |
denotes |
the |
| T1436 |
2435-2442 |
NN |
denotes |
placode |
| T1437 |
2442-2444 |
, |
denotes |
, |
| T1426 |
2444-2453 |
VBZ |
denotes |
instructs |
| T1438 |
2454-2455 |
DT |
denotes |
a |
| T1439 |
2456-2461 |
NN |
denotes |
group |
| T1441 |
2462-2464 |
IN |
denotes |
of |
| T1442 |
2465-2475 |
VBG |
denotes |
underlying |
| T1444 |
2476-2487 |
JJ |
denotes |
mesenchymal |
| T1443 |
2488-2493 |
NNS |
denotes |
cells |
| T1445 |
2494-2496 |
TO |
denotes |
to |
| T1440 |
2497-2505 |
VB |
denotes |
condense |
| T1446 |
2506-2509 |
CC |
denotes |
and |
| T1447 |
2510-2514 |
VB |
denotes |
form |
| T1448 |
2515-2518 |
DT |
denotes |
the |
| T1450 |
2519-2526 |
JJ |
denotes |
nascent |
| T1451 |
2527-2533 |
JJ |
denotes |
dermal |
| T1449 |
2534-2541 |
NN |
denotes |
papilla |
| T1452 |
2541-2543 |
, |
denotes |
, |
| T1453 |
2543-2548 |
WDT |
denotes |
which |
| T1455 |
2549-2553 |
MD |
denotes |
will |
| T1454 |
2554-2556 |
VB |
denotes |
be |
| T1456 |
2557-2558 |
DT |
denotes |
a |
| T1458 |
2559-2568 |
JJ |
denotes |
permanent |
| T1457 |
2569-2576 |
NN |
denotes |
fixture |
| T1459 |
2577-2579 |
IN |
denotes |
of |
| T1460 |
2580-2583 |
DT |
denotes |
the |
| T1462 |
2584-2588 |
NN |
denotes |
hair |
| T1461 |
2589-2597 |
NN |
denotes |
follicle |
| T1463 |
2597-2598 |
. |
denotes |
. |
| T1464 |
2598-2835 |
sentence |
denotes |
Subsequent exchanges between the placode and nascent dermal papilla result in further growth of the follicle into the underlying dermis, or down-growth, and eventual differentiation into the six concentric layers of the mature follicle. |
| T1465 |
2599-2609 |
JJ |
denotes |
Subsequent |
| T1466 |
2610-2619 |
NNS |
denotes |
exchanges |
| T1468 |
2620-2627 |
IN |
denotes |
between |
| T1469 |
2628-2631 |
DT |
denotes |
the |
| T1470 |
2632-2639 |
NN |
denotes |
placode |
| T1471 |
2640-2643 |
CC |
denotes |
and |
| T1472 |
2644-2651 |
JJ |
denotes |
nascent |
| T1474 |
2652-2658 |
JJ |
denotes |
dermal |
| T1473 |
2659-2666 |
NN |
denotes |
papilla |
| T1467 |
2667-2673 |
VBP |
denotes |
result |
| T1475 |
2674-2676 |
IN |
denotes |
in |
| T1476 |
2677-2684 |
JJ |
denotes |
further |
| T1477 |
2685-2691 |
NN |
denotes |
growth |
| T1478 |
2692-2694 |
IN |
denotes |
of |
| T1479 |
2695-2698 |
DT |
denotes |
the |
| T1480 |
2699-2707 |
NN |
denotes |
follicle |
| T1481 |
2708-2712 |
IN |
denotes |
into |
| T1482 |
2713-2716 |
DT |
denotes |
the |
| T1484 |
2717-2727 |
JJ |
denotes |
underlying |
| T1483 |
2728-2734 |
NN |
denotes |
dermis |
| T1485 |
2734-2736 |
, |
denotes |
, |
| T1486 |
2736-2738 |
CC |
denotes |
or |
| T1487 |
2739-2743 |
JJ |
denotes |
down |
| T1489 |
2743-2744 |
HYPH |
denotes |
- |
| T1488 |
2744-2750 |
NN |
denotes |
growth |
| T1490 |
2750-2752 |
, |
denotes |
, |
| T1491 |
2752-2755 |
CC |
denotes |
and |
| T1492 |
2756-2764 |
JJ |
denotes |
eventual |
| T1493 |
2765-2780 |
NN |
denotes |
differentiation |
| T1494 |
2781-2785 |
IN |
denotes |
into |
| T1495 |
2786-2789 |
DT |
denotes |
the |
| T1497 |
2790-2793 |
CD |
denotes |
six |
| T1498 |
2794-2804 |
JJ |
denotes |
concentric |
| T1496 |
2805-2811 |
NNS |
denotes |
layers |
| T1499 |
2812-2814 |
IN |
denotes |
of |
| T1500 |
2815-2818 |
DT |
denotes |
the |
| T1502 |
2819-2825 |
JJ |
denotes |
mature |
| T1501 |
2826-2834 |
NN |
denotes |
follicle |
| T1503 |
2834-2835 |
. |
denotes |
. |
| T1504 |
2835-3105 |
sentence |
denotes |
Previously, we delineated how two respective epithelial and mesenchymal signals, Wnts and the BMP-inhibitory factor noggin, function in concert to induce lymphoid enhancer factor-1/β-catenin (LEF-1/β-catenin)-mediated gene transcription within the follicle placode [4]. |
| T1505 |
2836-2846 |
RB |
denotes |
Previously |
| T1507 |
2846-2848 |
, |
denotes |
, |
| T1508 |
2848-2850 |
PRP |
denotes |
we |
| T1506 |
2851-2861 |
VBD |
denotes |
delineated |
| T1509 |
2862-2865 |
WRB |
denotes |
how |
| T1511 |
2866-2869 |
CD |
denotes |
two |
| T1513 |
2870-2880 |
JJ |
denotes |
respective |
| T1514 |
2881-2891 |
JJ |
denotes |
epithelial |
| T1515 |
2892-2895 |
CC |
denotes |
and |
| T1516 |
2896-2907 |
JJ |
denotes |
mesenchymal |
| T1512 |
2908-2915 |
NNS |
denotes |
signals |
| T1517 |
2915-2917 |
, |
denotes |
, |
| T1518 |
2917-2921 |
NNS |
denotes |
Wnts |
| T1519 |
2922-2925 |
CC |
denotes |
and |
| T1520 |
2926-2929 |
DT |
denotes |
the |
| T1522 |
2930-2933 |
NN |
denotes |
BMP |
| T1524 |
2933-2934 |
HYPH |
denotes |
- |
| T1523 |
2934-2944 |
JJ |
denotes |
inhibitory |
| T1521 |
2945-2951 |
NN |
denotes |
factor |
| T1525 |
2952-2958 |
NN |
denotes |
noggin |
| T1526 |
2958-2960 |
, |
denotes |
, |
| T1510 |
2960-2968 |
VBP |
denotes |
function |
| T1527 |
2969-2971 |
IN |
denotes |
in |
| T1528 |
2972-2979 |
NN |
denotes |
concert |
| T1529 |
2980-2982 |
TO |
denotes |
to |
| T1530 |
2983-2989 |
VB |
denotes |
induce |
| T1531 |
2990-2998 |
JJ |
denotes |
lymphoid |
| T1533 |
2999-3007 |
NN |
denotes |
enhancer |
| T1532 |
3008-3014 |
NN |
denotes |
factor |
| T1535 |
3014-3015 |
HYPH |
denotes |
- |
| T1536 |
3015-3016 |
CD |
denotes |
1 |
| T1537 |
3016-3017 |
HYPH |
denotes |
/ |
| T1538 |
3017-3018 |
NN |
denotes |
β |
| T1540 |
3018-3019 |
HYPH |
denotes |
- |
| T1539 |
3019-3026 |
NN |
denotes |
catenin |
| T1541 |
3027-3028 |
-LRB- |
denotes |
( |
| T1542 |
3028-3031 |
NN |
denotes |
LEF |
| T1543 |
3031-3032 |
HYPH |
denotes |
- |
| T1544 |
3032-3033 |
CD |
denotes |
1 |
| T1545 |
3033-3034 |
HYPH |
denotes |
/ |
| T1546 |
3034-3035 |
NN |
denotes |
β |
| T1548 |
3035-3036 |
HYPH |
denotes |
- |
| T1547 |
3036-3043 |
NN |
denotes |
catenin |
| T1549 |
3043-3044 |
-RRB- |
denotes |
) |
| T1550 |
3044-3045 |
HYPH |
denotes |
- |
| T1534 |
3045-3053 |
VBN |
denotes |
mediated |
| T1552 |
3054-3058 |
NN |
denotes |
gene |
| T1551 |
3059-3072 |
NN |
denotes |
transcription |
| T1553 |
3073-3079 |
IN |
denotes |
within |
| T1554 |
3080-3083 |
DT |
denotes |
the |
| T1556 |
3084-3092 |
NN |
denotes |
follicle |
| T1555 |
3093-3100 |
NN |
denotes |
placode |
| T1557 |
3101-3102 |
-LRB- |
denotes |
[ |
| T1558 |
3102-3103 |
CD |
denotes |
4 |
| T1559 |
3103-3104 |
-RRB- |
denotes |
] |
| T1560 |
3104-3105 |
. |
denotes |
. |
| T1561 |
3105-3370 |
sentence |
denotes |
The downstream changes elicited through convergence of these two early signaling pathways include down-regulation of the gene encoding E-cadherin, the prototypical epithelial cadherin that forms the transmembrane core of intercellular adherens junctions (AJs) [5]. |
| T1562 |
3106-3109 |
DT |
denotes |
The |
| T1564 |
3110-3120 |
JJ |
denotes |
downstream |
| T1563 |
3121-3128 |
NNS |
denotes |
changes |
| T1566 |
3129-3137 |
VBN |
denotes |
elicited |
| T1567 |
3138-3145 |
IN |
denotes |
through |
| T1568 |
3146-3157 |
NN |
denotes |
convergence |
| T1569 |
3158-3160 |
IN |
denotes |
of |
| T1570 |
3161-3166 |
DT |
denotes |
these |
| T1572 |
3167-3170 |
CD |
denotes |
two |
| T1573 |
3171-3176 |
JJ |
denotes |
early |
| T1574 |
3177-3186 |
NN |
denotes |
signaling |
| T1571 |
3187-3195 |
NNS |
denotes |
pathways |
| T1565 |
3196-3203 |
VBP |
denotes |
include |
| T1575 |
3204-3208 |
JJ |
denotes |
down |
| T1577 |
3208-3209 |
HYPH |
denotes |
- |
| T1576 |
3209-3219 |
NN |
denotes |
regulation |
| T1578 |
3220-3222 |
IN |
denotes |
of |
| T1579 |
3223-3226 |
DT |
denotes |
the |
| T1580 |
3227-3231 |
NN |
denotes |
gene |
| T1581 |
3232-3240 |
VBG |
denotes |
encoding |
| T1582 |
3241-3242 |
NN |
denotes |
E |
| T1584 |
3242-3243 |
HYPH |
denotes |
- |
| T1583 |
3243-3251 |
NN |
denotes |
cadherin |
| T1585 |
3251-3253 |
, |
denotes |
, |
| T1586 |
3253-3256 |
DT |
denotes |
the |
| T1588 |
3257-3269 |
JJ |
denotes |
prototypical |
| T1589 |
3270-3280 |
JJ |
denotes |
epithelial |
| T1587 |
3281-3289 |
NN |
denotes |
cadherin |
| T1590 |
3290-3294 |
WDT |
denotes |
that |
| T1591 |
3295-3300 |
VBZ |
denotes |
forms |
| T1592 |
3301-3304 |
DT |
denotes |
the |
| T1594 |
3305-3318 |
JJ |
denotes |
transmembrane |
| T1593 |
3319-3323 |
NN |
denotes |
core |
| T1595 |
3324-3326 |
IN |
denotes |
of |
| T1596 |
3327-3340 |
JJ |
denotes |
intercellular |
| T1598 |
3341-3349 |
NN |
denotes |
adherens |
| T1597 |
3350-3359 |
NNS |
denotes |
junctions |
| T1599 |
3360-3361 |
-LRB- |
denotes |
( |
| T1600 |
3361-3364 |
NNS |
denotes |
AJs |
| T1601 |
3364-3365 |
-RRB- |
denotes |
) |
| T1602 |
3366-3367 |
-LRB- |
denotes |
[ |
| T1603 |
3367-3368 |
CD |
denotes |
5 |
| T1604 |
3368-3369 |
-RRB- |
denotes |
] |
| T1605 |
3369-3370 |
. |
denotes |
. |
| T1606 |
3370-3635 |
sentence |
denotes |
We subsequently showed that when E-cadherin is transgenically elevated in mouse skin, hair follicle morphogenesis is blocked, suggesting that E-cadherin down-regulation is a critical event in governing the adhesion dynamics necessary for budding morphogenesis [4]. |
| T1607 |
3371-3373 |
PRP |
denotes |
We |
| T1609 |
3374-3386 |
RB |
denotes |
subsequently |
| T1608 |
3387-3393 |
VBD |
denotes |
showed |
| T1610 |
3394-3398 |
IN |
denotes |
that |
| T1612 |
3399-3403 |
WRB |
denotes |
when |
| T1614 |
3404-3405 |
NN |
denotes |
E |
| T1616 |
3405-3406 |
HYPH |
denotes |
- |
| T1615 |
3406-3414 |
NN |
denotes |
cadherin |
| T1617 |
3415-3417 |
VBZ |
denotes |
is |
| T1618 |
3418-3432 |
RB |
denotes |
transgenically |
| T1613 |
3433-3441 |
VBN |
denotes |
elevated |
| T1619 |
3442-3444 |
IN |
denotes |
in |
| T1620 |
3445-3450 |
NN |
denotes |
mouse |
| T1621 |
3451-3455 |
NN |
denotes |
skin |
| T1622 |
3455-3457 |
, |
denotes |
, |
| T1623 |
3457-3461 |
NN |
denotes |
hair |
| T1624 |
3462-3470 |
NN |
denotes |
follicle |
| T1625 |
3471-3484 |
NN |
denotes |
morphogenesis |
| T1626 |
3485-3487 |
VBZ |
denotes |
is |
| T1611 |
3488-3495 |
VBN |
denotes |
blocked |
| T1627 |
3495-3497 |
, |
denotes |
, |
| T1628 |
3497-3507 |
VBG |
denotes |
suggesting |
| T1629 |
3508-3512 |
IN |
denotes |
that |
| T1631 |
3513-3514 |
NN |
denotes |
E |
| T1633 |
3514-3515 |
HYPH |
denotes |
- |
| T1632 |
3515-3523 |
NN |
denotes |
cadherin |
| T1635 |
3524-3528 |
JJ |
denotes |
down |
| T1636 |
3528-3529 |
HYPH |
denotes |
- |
| T1634 |
3529-3539 |
NN |
denotes |
regulation |
| T1630 |
3540-3542 |
VBZ |
denotes |
is |
| T1637 |
3543-3544 |
DT |
denotes |
a |
| T1639 |
3545-3553 |
JJ |
denotes |
critical |
| T1638 |
3554-3559 |
NN |
denotes |
event |
| T1640 |
3560-3562 |
IN |
denotes |
in |
| T1641 |
3563-3572 |
VBG |
denotes |
governing |
| T1642 |
3573-3576 |
DT |
denotes |
the |
| T1644 |
3577-3585 |
NN |
denotes |
adhesion |
| T1643 |
3586-3594 |
NNS |
denotes |
dynamics |
| T1645 |
3595-3604 |
JJ |
denotes |
necessary |
| T1646 |
3605-3608 |
IN |
denotes |
for |
| T1647 |
3609-3616 |
NN |
denotes |
budding |
| T1648 |
3617-3630 |
NN |
denotes |
morphogenesis |
| T1649 |
3631-3632 |
-LRB- |
denotes |
[ |
| T1650 |
3632-3633 |
CD |
denotes |
4 |
| T1651 |
3633-3634 |
-RRB- |
denotes |
] |
| T1652 |
3634-3635 |
. |
denotes |
. |
| T1653 |
3635-3683 |
sentence |
denotes |
Like LEF-1, E-cadherin also binds to β-catenin. |
| T1654 |
3636-3640 |
IN |
denotes |
Like |
| T1656 |
3641-3644 |
NN |
denotes |
LEF |
| T1657 |
3644-3645 |
HYPH |
denotes |
- |
| T1658 |
3645-3646 |
CD |
denotes |
1 |
| T1659 |
3646-3648 |
, |
denotes |
, |
| T1660 |
3648-3649 |
NN |
denotes |
E |
| T1662 |
3649-3650 |
HYPH |
denotes |
- |
| T1661 |
3650-3658 |
NN |
denotes |
cadherin |
| T1663 |
3659-3663 |
RB |
denotes |
also |
| T1655 |
3664-3669 |
VBZ |
denotes |
binds |
| T1664 |
3670-3672 |
IN |
denotes |
to |
| T1665 |
3673-3674 |
NN |
denotes |
β |
| T1667 |
3674-3675 |
HYPH |
denotes |
- |
| T1666 |
3675-3682 |
NN |
denotes |
catenin |
| T1668 |
3682-3683 |
. |
denotes |
. |
| T1669 |
3683-3946 |
sentence |
denotes |
At sites of cell-cell contact, however, E-cadherin-β-catenin complexes recruit α-catenin, which in turn coordinates the associated actin polymerization dynamics necessary to stabilize nascent AJs and integrate the cytoskeleton across an epithelial sheet [6,7,8]. |
| T1670 |
3684-3686 |
IN |
denotes |
At |
| T1672 |
3687-3692 |
NNS |
denotes |
sites |
| T1673 |
3693-3695 |
IN |
denotes |
of |
| T1674 |
3696-3700 |
NN |
denotes |
cell |
| T1676 |
3700-3701 |
HYPH |
denotes |
- |
| T1675 |
3701-3705 |
NN |
denotes |
cell |
| T1677 |
3706-3713 |
NN |
denotes |
contact |
| T1678 |
3713-3715 |
, |
denotes |
, |
| T1679 |
3715-3722 |
RB |
denotes |
however |
| T1680 |
3722-3724 |
, |
denotes |
, |
| T1681 |
3724-3725 |
NN |
denotes |
E |
| T1683 |
3725-3726 |
HYPH |
denotes |
- |
| T1682 |
3726-3734 |
NN |
denotes |
cadherin |
| T1685 |
3734-3735 |
HYPH |
denotes |
- |
| T1686 |
3735-3736 |
NN |
denotes |
β |
| T1688 |
3736-3737 |
HYPH |
denotes |
- |
| T1687 |
3737-3744 |
NN |
denotes |
catenin |
| T1684 |
3745-3754 |
NNS |
denotes |
complexes |
| T1671 |
3755-3762 |
VBP |
denotes |
recruit |
| T1689 |
3763-3764 |
NN |
denotes |
α |
| T1691 |
3764-3765 |
HYPH |
denotes |
- |
| T1690 |
3765-3772 |
NN |
denotes |
catenin |
| T1692 |
3772-3774 |
, |
denotes |
, |
| T1693 |
3774-3779 |
WDT |
denotes |
which |
| T1695 |
3780-3782 |
IN |
denotes |
in |
| T1696 |
3783-3787 |
NN |
denotes |
turn |
| T1694 |
3788-3799 |
VBZ |
denotes |
coordinates |
| T1697 |
3800-3803 |
DT |
denotes |
the |
| T1699 |
3804-3814 |
VBN |
denotes |
associated |
| T1700 |
3815-3820 |
NN |
denotes |
actin |
| T1701 |
3821-3835 |
NN |
denotes |
polymerization |
| T1698 |
3836-3844 |
NNS |
denotes |
dynamics |
| T1702 |
3845-3854 |
JJ |
denotes |
necessary |
| T1703 |
3855-3857 |
TO |
denotes |
to |
| T1704 |
3858-3867 |
VB |
denotes |
stabilize |
| T1705 |
3868-3875 |
JJ |
denotes |
nascent |
| T1706 |
3876-3879 |
NNS |
denotes |
AJs |
| T1707 |
3880-3883 |
CC |
denotes |
and |
| T1708 |
3884-3893 |
VB |
denotes |
integrate |
| T1709 |
3894-3897 |
DT |
denotes |
the |
| T1710 |
3898-3910 |
NN |
denotes |
cytoskeleton |
| T1711 |
3911-3917 |
IN |
denotes |
across |
| T1712 |
3918-3920 |
DT |
denotes |
an |
| T1714 |
3921-3931 |
JJ |
denotes |
epithelial |
| T1713 |
3932-3937 |
NN |
denotes |
sheet |
| T1715 |
3938-3939 |
-LRB- |
denotes |
[ |
| T1717 |
3939-3940 |
CD |
denotes |
6 |
| T1718 |
3940-3941 |
, |
denotes |
, |
| T1719 |
3941-3942 |
CD |
denotes |
7 |
| T1720 |
3942-3943 |
, |
denotes |
, |
| T1716 |
3943-3944 |
CD |
denotes |
8 |
| T1721 |
3944-3945 |
-RRB- |
denotes |
] |
| T1722 |
3945-3946 |
. |
denotes |
. |
| T1723 |
3946-4203 |
sentence |
denotes |
α-Catenin also binds to the class III Lin-1, Isl-1, Mec-3 (LIM) protein Ajuba (a member of the zyxin family of proteins), which appears to function dually in both adhesion and in activation of the Ras-mitogen-activated protein kinase (MAPK) pathway [9,10]. |
| T1724 |
3947-3948 |
NN |
denotes |
α |
| T1726 |
3948-3949 |
HYPH |
denotes |
- |
| T1725 |
3949-3956 |
NN |
denotes |
Catenin |
| T1728 |
3957-3961 |
RB |
denotes |
also |
| T1727 |
3962-3967 |
VBZ |
denotes |
binds |
| T1729 |
3968-3970 |
IN |
denotes |
to |
| T1730 |
3971-3974 |
DT |
denotes |
the |
| T1732 |
3975-3980 |
NN |
denotes |
class |
| T1733 |
3981-3984 |
CD |
denotes |
III |
| T1734 |
3985-3988 |
NN |
denotes |
Lin |
| T1735 |
3988-3989 |
HYPH |
denotes |
- |
| T1736 |
3989-3990 |
CD |
denotes |
1 |
| T1737 |
3990-3992 |
, |
denotes |
, |
| T1738 |
3992-3995 |
NN |
denotes |
Isl |
| T1739 |
3995-3996 |
HYPH |
denotes |
- |
| T1740 |
3996-3997 |
CD |
denotes |
1 |
| T1741 |
3997-3999 |
, |
denotes |
, |
| T1742 |
3999-4002 |
NN |
denotes |
Mec |
| T1743 |
4002-4003 |
HYPH |
denotes |
- |
| T1744 |
4003-4004 |
CD |
denotes |
3 |
| T1745 |
4005-4006 |
-LRB- |
denotes |
( |
| T1746 |
4006-4009 |
NN |
denotes |
LIM |
| T1747 |
4009-4010 |
-RRB- |
denotes |
) |
| T1731 |
4011-4018 |
NN |
denotes |
protein |
| T1748 |
4019-4024 |
NN |
denotes |
Ajuba |
| T1749 |
4025-4026 |
-LRB- |
denotes |
( |
| T1750 |
4026-4027 |
DT |
denotes |
a |
| T1751 |
4028-4034 |
NN |
denotes |
member |
| T1752 |
4035-4037 |
IN |
denotes |
of |
| T1753 |
4038-4041 |
DT |
denotes |
the |
| T1755 |
4042-4047 |
NN |
denotes |
zyxin |
| T1754 |
4048-4054 |
NN |
denotes |
family |
| T1756 |
4055-4057 |
IN |
denotes |
of |
| T1757 |
4058-4066 |
NN |
denotes |
proteins |
| T1758 |
4066-4067 |
-RRB- |
denotes |
) |
| T1759 |
4067-4069 |
, |
denotes |
, |
| T1760 |
4069-4074 |
WDT |
denotes |
which |
| T1761 |
4075-4082 |
VBZ |
denotes |
appears |
| T1762 |
4083-4085 |
TO |
denotes |
to |
| T1763 |
4086-4094 |
VB |
denotes |
function |
| T1764 |
4095-4101 |
RB |
denotes |
dually |
| T1765 |
4102-4104 |
IN |
denotes |
in |
| T1766 |
4105-4109 |
CC |
denotes |
both |
| T1767 |
4110-4118 |
NN |
denotes |
adhesion |
| T1768 |
4119-4122 |
CC |
denotes |
and |
| T1769 |
4123-4125 |
IN |
denotes |
in |
| T1770 |
4126-4136 |
NN |
denotes |
activation |
| T1771 |
4137-4139 |
IN |
denotes |
of |
| T1772 |
4140-4143 |
DT |
denotes |
the |
| T1774 |
4144-4147 |
NN |
denotes |
Ras |
| T1775 |
4147-4148 |
HYPH |
denotes |
- |
| T1776 |
4148-4155 |
NN |
denotes |
mitogen |
| T1778 |
4155-4156 |
HYPH |
denotes |
- |
| T1777 |
4156-4165 |
VBN |
denotes |
activated |
| T1780 |
4166-4173 |
NN |
denotes |
protein |
| T1779 |
4174-4180 |
NN |
denotes |
kinase |
| T1781 |
4181-4182 |
-LRB- |
denotes |
( |
| T1782 |
4182-4186 |
NN |
denotes |
MAPK |
| T1783 |
4186-4187 |
-RRB- |
denotes |
) |
| T1773 |
4188-4195 |
NN |
denotes |
pathway |
| T1784 |
4196-4197 |
-LRB- |
denotes |
[ |
| T1786 |
4197-4198 |
CD |
denotes |
9 |
| T1787 |
4198-4199 |
, |
denotes |
, |
| T1785 |
4199-4201 |
CD |
denotes |
10 |
| T1788 |
4201-4202 |
-RRB- |
denotes |
] |
| T1789 |
4202-4203 |
. |
denotes |
. |
| T1790 |
4203-4337 |
sentence |
denotes |
Through these links, AJs appear able to couple adhesion with cytoskeletal dynamics as well as with nuclear and cytoplasmic signaling. |
| T1791 |
4204-4211 |
IN |
denotes |
Through |
| T1793 |
4212-4217 |
DT |
denotes |
these |
| T1794 |
4218-4223 |
NNS |
denotes |
links |
| T1795 |
4223-4225 |
, |
denotes |
, |
| T1796 |
4225-4228 |
NNS |
denotes |
AJs |
| T1792 |
4229-4235 |
VBP |
denotes |
appear |
| T1797 |
4236-4240 |
JJ |
denotes |
able |
| T1798 |
4241-4243 |
TO |
denotes |
to |
| T1799 |
4244-4250 |
VB |
denotes |
couple |
| T1800 |
4251-4259 |
NN |
denotes |
adhesion |
| T1801 |
4260-4264 |
IN |
denotes |
with |
| T1802 |
4265-4277 |
JJ |
denotes |
cytoskeletal |
| T1803 |
4278-4286 |
NNS |
denotes |
dynamics |
| T1804 |
4287-4289 |
RB |
denotes |
as |
| T1806 |
4290-4294 |
RB |
denotes |
well |
| T1805 |
4295-4297 |
IN |
denotes |
as |
| T1807 |
4298-4302 |
IN |
denotes |
with |
| T1808 |
4303-4310 |
JJ |
denotes |
nuclear |
| T1810 |
4311-4314 |
CC |
denotes |
and |
| T1811 |
4315-4326 |
JJ |
denotes |
cytoplasmic |
| T1809 |
4327-4336 |
NN |
denotes |
signaling |
| T1812 |
4336-4337 |
. |
denotes |
. |
| T1813 |
4337-4485 |
sentence |
denotes |
This provides a framework for conceptualizing why E-cadherin levels appear to impact upon a plethora of developmental processes (reviewed in [11]). |
| T1814 |
4338-4342 |
DT |
denotes |
This |
| T1815 |
4343-4351 |
VBZ |
denotes |
provides |
| T1816 |
4352-4353 |
DT |
denotes |
a |
| T1817 |
4354-4363 |
NN |
denotes |
framework |
| T1818 |
4364-4367 |
IN |
denotes |
for |
| T1819 |
4368-4383 |
VBG |
denotes |
conceptualizing |
| T1820 |
4384-4387 |
WRB |
denotes |
why |
| T1822 |
4388-4389 |
NN |
denotes |
E |
| T1824 |
4389-4390 |
HYPH |
denotes |
- |
| T1823 |
4390-4398 |
NN |
denotes |
cadherin |
| T1825 |
4399-4405 |
NNS |
denotes |
levels |
| T1821 |
4406-4412 |
VBP |
denotes |
appear |
| T1826 |
4413-4415 |
TO |
denotes |
to |
| T1827 |
4416-4422 |
VB |
denotes |
impact |
| T1828 |
4423-4427 |
IN |
denotes |
upon |
| T1829 |
4428-4429 |
DT |
denotes |
a |
| T1830 |
4430-4438 |
NN |
denotes |
plethora |
| T1831 |
4439-4441 |
IN |
denotes |
of |
| T1832 |
4442-4455 |
JJ |
denotes |
developmental |
| T1833 |
4456-4465 |
NNS |
denotes |
processes |
| T1834 |
4466-4467 |
-LRB- |
denotes |
( |
| T1835 |
4467-4475 |
VBN |
denotes |
reviewed |
| T1836 |
4476-4478 |
IN |
denotes |
in |
| T1837 |
4479-4480 |
-LRB- |
denotes |
[ |
| T1838 |
4480-4482 |
CD |
denotes |
11 |
| T1839 |
4482-4483 |
-RRB- |
denotes |
] |
| T1840 |
4483-4484 |
-RRB- |
denotes |
) |
| T1841 |
4484-4485 |
. |
denotes |
. |
| T1842 |
4485-4769 |
sentence |
denotes |
As we probed more deeply into the underlying mechanisms governing E-cadherin promoter activity, we were intrigued by the close proximity of the LEF-1/β-catenin binding site to a site known to bind the Snail/Slug family of zinc finger transcriptional repressor proteins [12,13,14,15]. |
| T1843 |
4486-4488 |
IN |
denotes |
As |
| T1845 |
4489-4491 |
PRP |
denotes |
we |
| T1844 |
4492-4498 |
VBD |
denotes |
probed |
| T1847 |
4499-4503 |
RBR |
denotes |
more |
| T1848 |
4504-4510 |
RB |
denotes |
deeply |
| T1849 |
4511-4515 |
IN |
denotes |
into |
| T1850 |
4516-4519 |
DT |
denotes |
the |
| T1852 |
4520-4530 |
JJ |
denotes |
underlying |
| T1851 |
4531-4541 |
NNS |
denotes |
mechanisms |
| T1853 |
4542-4551 |
VBG |
denotes |
governing |
| T1854 |
4552-4553 |
NN |
denotes |
E |
| T1856 |
4553-4554 |
HYPH |
denotes |
- |
| T1855 |
4554-4562 |
NN |
denotes |
cadherin |
| T1857 |
4563-4571 |
NN |
denotes |
promoter |
| T1858 |
4572-4580 |
NN |
denotes |
activity |
| T1859 |
4580-4582 |
, |
denotes |
, |
| T1860 |
4582-4584 |
PRP |
denotes |
we |
| T1861 |
4585-4589 |
VBD |
denotes |
were |
| T1846 |
4590-4599 |
VBN |
denotes |
intrigued |
| T1862 |
4600-4602 |
IN |
denotes |
by |
| T1863 |
4603-4606 |
DT |
denotes |
the |
| T1865 |
4607-4612 |
JJ |
denotes |
close |
| T1864 |
4613-4622 |
NN |
denotes |
proximity |
| T1866 |
4623-4625 |
IN |
denotes |
of |
| T1867 |
4626-4629 |
DT |
denotes |
the |
| T1869 |
4630-4633 |
NN |
denotes |
LEF |
| T1870 |
4633-4634 |
HYPH |
denotes |
- |
| T1871 |
4634-4635 |
CD |
denotes |
1 |
| T1872 |
4635-4636 |
HYPH |
denotes |
/ |
| T1873 |
4636-4637 |
NN |
denotes |
β |
| T1875 |
4637-4638 |
HYPH |
denotes |
- |
| T1874 |
4638-4645 |
NN |
denotes |
catenin |
| T1876 |
4646-4653 |
NN |
denotes |
binding |
| T1868 |
4654-4658 |
NN |
denotes |
site |
| T1877 |
4659-4661 |
IN |
denotes |
to |
| T1878 |
4662-4663 |
DT |
denotes |
a |
| T1879 |
4664-4668 |
NN |
denotes |
site |
| T1880 |
4669-4674 |
VBN |
denotes |
known |
| T1881 |
4675-4677 |
TO |
denotes |
to |
| T1882 |
4678-4682 |
VB |
denotes |
bind |
| T1883 |
4683-4686 |
DT |
denotes |
the |
| T1885 |
4687-4692 |
NN |
denotes |
Snail |
| T1887 |
4692-4693 |
HYPH |
denotes |
/ |
| T1886 |
4693-4697 |
NN |
denotes |
Slug |
| T1884 |
4698-4704 |
NN |
denotes |
family |
| T1888 |
4705-4707 |
IN |
denotes |
of |
| T1889 |
4708-4712 |
NN |
denotes |
zinc |
| T1890 |
4713-4719 |
NN |
denotes |
finger |
| T1892 |
4720-4735 |
JJ |
denotes |
transcriptional |
| T1893 |
4736-4745 |
NN |
denotes |
repressor |
| T1891 |
4746-4754 |
NN |
denotes |
proteins |
| T1894 |
4755-4756 |
-LRB- |
denotes |
[ |
| T1896 |
4756-4758 |
CD |
denotes |
12 |
| T1897 |
4758-4759 |
, |
denotes |
, |
| T1898 |
4759-4761 |
CD |
denotes |
13 |
| T1899 |
4761-4762 |
, |
denotes |
, |
| T1900 |
4762-4764 |
CD |
denotes |
14 |
| T1901 |
4764-4765 |
, |
denotes |
, |
| T1895 |
4765-4767 |
CD |
denotes |
15 |
| T1902 |
4767-4768 |
-RRB- |
denotes |
] |
| T1903 |
4768-4769 |
. |
denotes |
. |
| T1904 |
4769-5004 |
sentence |
denotes |
Both activity of Snail and down-regulation of E-cadherin play pivotal roles in epithelial to mesenchymal transitions (EMTs), typified by the transformation of polarized, adhering epithelial cells into motile mesenchymal cells [16,17]. |
| T1905 |
4770-4774 |
CC |
denotes |
Both |
| T1906 |
4775-4783 |
NN |
denotes |
activity |
| T1908 |
4784-4786 |
IN |
denotes |
of |
| T1909 |
4787-4792 |
NN |
denotes |
Snail |
| T1910 |
4793-4796 |
CC |
denotes |
and |
| T1911 |
4797-4801 |
NN |
denotes |
down |
| T1913 |
4801-4802 |
HYPH |
denotes |
- |
| T1912 |
4802-4812 |
NN |
denotes |
regulation |
| T1914 |
4813-4815 |
IN |
denotes |
of |
| T1915 |
4816-4817 |
NN |
denotes |
E |
| T1917 |
4817-4818 |
HYPH |
denotes |
- |
| T1916 |
4818-4826 |
NN |
denotes |
cadherin |
| T1907 |
4827-4831 |
VBP |
denotes |
play |
| T1918 |
4832-4839 |
JJ |
denotes |
pivotal |
| T1919 |
4840-4845 |
NNS |
denotes |
roles |
| T1920 |
4846-4848 |
IN |
denotes |
in |
| T1921 |
4849-4859 |
JJ |
denotes |
epithelial |
| T1923 |
4860-4862 |
IN |
denotes |
to |
| T1924 |
4863-4874 |
JJ |
denotes |
mesenchymal |
| T1922 |
4875-4886 |
NNS |
denotes |
transitions |
| T1925 |
4887-4888 |
-LRB- |
denotes |
( |
| T1926 |
4888-4892 |
NNS |
denotes |
EMTs |
| T1927 |
4892-4893 |
-RRB- |
denotes |
) |
| T1928 |
4893-4895 |
, |
denotes |
, |
| T1929 |
4895-4903 |
VBN |
denotes |
typified |
| T1930 |
4904-4906 |
IN |
denotes |
by |
| T1931 |
4907-4910 |
DT |
denotes |
the |
| T1932 |
4911-4925 |
NN |
denotes |
transformation |
| T1933 |
4926-4928 |
IN |
denotes |
of |
| T1934 |
4929-4938 |
VBN |
denotes |
polarized |
| T1936 |
4938-4940 |
, |
denotes |
, |
| T1937 |
4940-4948 |
VBG |
denotes |
adhering |
| T1938 |
4949-4959 |
JJ |
denotes |
epithelial |
| T1935 |
4960-4965 |
NNS |
denotes |
cells |
| T1939 |
4966-4970 |
IN |
denotes |
into |
| T1940 |
4971-4977 |
JJ |
denotes |
motile |
| T1942 |
4978-4989 |
JJ |
denotes |
mesenchymal |
| T1941 |
4990-4995 |
NNS |
denotes |
cells |
| T1943 |
4996-4997 |
-LRB- |
denotes |
[ |
| T1945 |
4997-4999 |
CD |
denotes |
16 |
| T1946 |
4999-5000 |
, |
denotes |
, |
| T1944 |
5000-5002 |
CD |
denotes |
17 |
| T1947 |
5002-5003 |
-RRB- |
denotes |
] |
| T1948 |
5003-5004 |
. |
denotes |
. |
| T1949 |
5004-5190 |
sentence |
denotes |
Bud formation differs from an EMT in that E-cadherin activity needs to be down-regulated but not prevented, so that adhesive junctions are remodeled rather than quantitatively impaired. |
| T1950 |
5005-5008 |
NN |
denotes |
Bud |
| T1951 |
5009-5018 |
NN |
denotes |
formation |
| T1952 |
5019-5026 |
VBZ |
denotes |
differs |
| T1953 |
5027-5031 |
IN |
denotes |
from |
| T1954 |
5032-5034 |
DT |
denotes |
an |
| T1955 |
5035-5038 |
NN |
denotes |
EMT |
| T1956 |
5039-5041 |
IN |
denotes |
in |
| T1958 |
5042-5046 |
DT |
denotes |
that |
| T1959 |
5047-5048 |
NN |
denotes |
E |
| T1961 |
5048-5049 |
HYPH |
denotes |
- |
| T1960 |
5049-5057 |
NN |
denotes |
cadherin |
| T1962 |
5058-5066 |
NN |
denotes |
activity |
| T1957 |
5067-5072 |
VBZ |
denotes |
needs |
| T1963 |
5073-5075 |
TO |
denotes |
to |
| T1965 |
5076-5078 |
VB |
denotes |
be |
| T1966 |
5079-5083 |
RB |
denotes |
down |
| T1967 |
5083-5084 |
HYPH |
denotes |
- |
| T1964 |
5084-5093 |
VBN |
denotes |
regulated |
| T1968 |
5094-5097 |
CC |
denotes |
but |
| T1969 |
5098-5101 |
RB |
denotes |
not |
| T1970 |
5102-5111 |
VBN |
denotes |
prevented |
| T1971 |
5111-5113 |
, |
denotes |
, |
| T1972 |
5113-5115 |
IN |
denotes |
so |
| T1974 |
5116-5120 |
IN |
denotes |
that |
| T1975 |
5121-5129 |
JJ |
denotes |
adhesive |
| T1976 |
5130-5139 |
NNS |
denotes |
junctions |
| T1977 |
5140-5143 |
VBP |
denotes |
are |
| T1973 |
5144-5153 |
VBN |
denotes |
remodeled |
| T1978 |
5154-5160 |
RB |
denotes |
rather |
| T1979 |
5161-5165 |
IN |
denotes |
than |
| T1980 |
5166-5180 |
RB |
denotes |
quantitatively |
| T1981 |
5181-5189 |
VBN |
denotes |
impaired |
| T1982 |
5189-5190 |
. |
denotes |
. |
| T1983 |
5190-5408 |
sentence |
denotes |
Supportive of an underlying ability to fine-tune cadherin expression at the transcriptional level, Snail seems to have an additive effect with LEF-1/β-catenin in negatively modulating E-cadherin promoter activity [4]. |
| T1984 |
5191-5201 |
JJ |
denotes |
Supportive |
| T1986 |
5202-5204 |
IN |
denotes |
of |
| T1987 |
5205-5207 |
DT |
denotes |
an |
| T1989 |
5208-5218 |
JJ |
denotes |
underlying |
| T1988 |
5219-5226 |
NN |
denotes |
ability |
| T1990 |
5227-5229 |
TO |
denotes |
to |
| T1992 |
5230-5234 |
RB |
denotes |
fine |
| T1993 |
5234-5235 |
HYPH |
denotes |
- |
| T1991 |
5235-5239 |
VB |
denotes |
tune |
| T1994 |
5240-5248 |
NN |
denotes |
cadherin |
| T1995 |
5249-5259 |
NN |
denotes |
expression |
| T1996 |
5260-5262 |
IN |
denotes |
at |
| T1997 |
5263-5266 |
DT |
denotes |
the |
| T1999 |
5267-5282 |
JJ |
denotes |
transcriptional |
| T1998 |
5283-5288 |
NN |
denotes |
level |
| T2000 |
5288-5290 |
, |
denotes |
, |
| T2001 |
5290-5295 |
NN |
denotes |
Snail |
| T1985 |
5296-5301 |
VBZ |
denotes |
seems |
| T2002 |
5302-5304 |
TO |
denotes |
to |
| T2003 |
5305-5309 |
VB |
denotes |
have |
| T2004 |
5310-5312 |
DT |
denotes |
an |
| T2006 |
5313-5321 |
JJ |
denotes |
additive |
| T2005 |
5322-5328 |
NN |
denotes |
effect |
| T2007 |
5329-5333 |
IN |
denotes |
with |
| T2008 |
5334-5337 |
NN |
denotes |
LEF |
| T2009 |
5337-5338 |
HYPH |
denotes |
- |
| T2010 |
5338-5339 |
CD |
denotes |
1 |
| T2011 |
5339-5340 |
HYPH |
denotes |
/ |
| T2012 |
5340-5341 |
NN |
denotes |
β |
| T2014 |
5341-5342 |
HYPH |
denotes |
- |
| T2013 |
5342-5349 |
NN |
denotes |
catenin |
| T2015 |
5350-5352 |
IN |
denotes |
in |
| T2016 |
5353-5363 |
RB |
denotes |
negatively |
| T2017 |
5364-5374 |
VBG |
denotes |
modulating |
| T2018 |
5375-5376 |
NN |
denotes |
E |
| T2020 |
5376-5377 |
HYPH |
denotes |
- |
| T2019 |
5377-5385 |
NN |
denotes |
cadherin |
| T2021 |
5386-5394 |
NN |
denotes |
promoter |
| T2022 |
5395-5403 |
NN |
denotes |
activity |
| T2023 |
5404-5405 |
-LRB- |
denotes |
[ |
| T2024 |
5405-5406 |
CD |
denotes |
4 |
| T2025 |
5406-5407 |
-RRB- |
denotes |
] |
| T2026 |
5407-5408 |
. |
denotes |
. |
| T2027 |
5408-5593 |
sentence |
denotes |
In the present study, we discovered that Snail is expressed briefly at an early stage of hair bud formation, when E-cadherin down-regulation and activation of proliferation take place. |
| T2028 |
5409-5411 |
IN |
denotes |
In |
| T2030 |
5412-5415 |
DT |
denotes |
the |
| T2032 |
5416-5423 |
JJ |
denotes |
present |
| T2031 |
5424-5429 |
NN |
denotes |
study |
| T2033 |
5429-5431 |
, |
denotes |
, |
| T2034 |
5431-5433 |
PRP |
denotes |
we |
| T2029 |
5434-5444 |
VBD |
denotes |
discovered |
| T2035 |
5445-5449 |
IN |
denotes |
that |
| T2037 |
5450-5455 |
NN |
denotes |
Snail |
| T2038 |
5456-5458 |
VBZ |
denotes |
is |
| T2036 |
5459-5468 |
VBN |
denotes |
expressed |
| T2039 |
5469-5476 |
RB |
denotes |
briefly |
| T2040 |
5477-5479 |
IN |
denotes |
at |
| T2041 |
5480-5482 |
DT |
denotes |
an |
| T2043 |
5483-5488 |
JJ |
denotes |
early |
| T2042 |
5489-5494 |
NN |
denotes |
stage |
| T2044 |
5495-5497 |
IN |
denotes |
of |
| T2045 |
5498-5502 |
NN |
denotes |
hair |
| T2046 |
5503-5506 |
NN |
denotes |
bud |
| T2047 |
5507-5516 |
NN |
denotes |
formation |
| T2048 |
5516-5518 |
, |
denotes |
, |
| T2049 |
5518-5522 |
WRB |
denotes |
when |
| T2051 |
5523-5524 |
NN |
denotes |
E |
| T2053 |
5524-5525 |
HYPH |
denotes |
- |
| T2052 |
5525-5533 |
NN |
denotes |
cadherin |
| T2054 |
5534-5538 |
JJ |
denotes |
down |
| T2056 |
5538-5539 |
HYPH |
denotes |
- |
| T2055 |
5539-5549 |
NN |
denotes |
regulation |
| T2057 |
5550-5553 |
CC |
denotes |
and |
| T2058 |
5554-5564 |
NN |
denotes |
activation |
| T2059 |
5565-5567 |
IN |
denotes |
of |
| T2060 |
5568-5581 |
NN |
denotes |
proliferation |
| T2050 |
5582-5586 |
VBP |
denotes |
take |
| T2061 |
5587-5592 |
NN |
denotes |
place |
| T2062 |
5592-5593 |
. |
denotes |
. |
| T2063 |
5593-5696 |
sentence |
denotes |
Thereafter, Snail disappears and remains absent during subsequent follicle down-growth and maturation. |
| T2064 |
5594-5604 |
RB |
denotes |
Thereafter |
| T2066 |
5604-5606 |
, |
denotes |
, |
| T2067 |
5606-5611 |
NN |
denotes |
Snail |
| T2065 |
5612-5622 |
VBZ |
denotes |
disappears |
| T2068 |
5623-5626 |
CC |
denotes |
and |
| T2069 |
5627-5634 |
VBZ |
denotes |
remains |
| T2070 |
5635-5641 |
JJ |
denotes |
absent |
| T2071 |
5642-5648 |
IN |
denotes |
during |
| T2072 |
5649-5659 |
JJ |
denotes |
subsequent |
| T2074 |
5660-5668 |
NN |
denotes |
follicle |
| T2075 |
5669-5673 |
JJ |
denotes |
down |
| T2076 |
5673-5674 |
HYPH |
denotes |
- |
| T2073 |
5674-5680 |
NN |
denotes |
growth |
| T2077 |
5681-5684 |
CC |
denotes |
and |
| T2078 |
5685-5695 |
NN |
denotes |
maturation |
| T2079 |
5695-5696 |
. |
denotes |
. |
| T2080 |
5696-5956 |
sentence |
denotes |
This exquisite pattern appears to be functionally relevant since altering it in vivo correspondingly affects features associated with hair bud formation, including down-regulation of E-cadherin, increased proliferation, and repressed terminal differentiation. |
| T2081 |
5697-5701 |
DT |
denotes |
This |
| T2083 |
5702-5711 |
JJ |
denotes |
exquisite |
| T2082 |
5712-5719 |
NN |
denotes |
pattern |
| T2084 |
5720-5727 |
VBZ |
denotes |
appears |
| T2085 |
5728-5730 |
TO |
denotes |
to |
| T2086 |
5731-5733 |
VB |
denotes |
be |
| T2087 |
5734-5746 |
RB |
denotes |
functionally |
| T2088 |
5747-5755 |
JJ |
denotes |
relevant |
| T2089 |
5756-5761 |
IN |
denotes |
since |
| T2091 |
5762-5770 |
VBG |
denotes |
altering |
| T2092 |
5771-5773 |
PRP |
denotes |
it |
| T2093 |
5774-5776 |
FW |
denotes |
in |
| T2094 |
5777-5781 |
FW |
denotes |
vivo |
| T2095 |
5782-5797 |
RB |
denotes |
correspondingly |
| T2090 |
5798-5805 |
VBZ |
denotes |
affects |
| T2096 |
5806-5814 |
NNS |
denotes |
features |
| T2097 |
5815-5825 |
VBN |
denotes |
associated |
| T2098 |
5826-5830 |
IN |
denotes |
with |
| T2099 |
5831-5835 |
NN |
denotes |
hair |
| T2100 |
5836-5839 |
NN |
denotes |
bud |
| T2101 |
5840-5849 |
NN |
denotes |
formation |
| T2102 |
5849-5851 |
, |
denotes |
, |
| T2103 |
5851-5860 |
VBG |
denotes |
including |
| T2104 |
5861-5865 |
NN |
denotes |
down |
| T2106 |
5865-5866 |
HYPH |
denotes |
- |
| T2105 |
5866-5876 |
NN |
denotes |
regulation |
| T2107 |
5877-5879 |
IN |
denotes |
of |
| T2108 |
5880-5881 |
NN |
denotes |
E |
| T2110 |
5881-5882 |
HYPH |
denotes |
- |
| T2109 |
5882-5890 |
NN |
denotes |
cadherin |
| T2111 |
5890-5892 |
, |
denotes |
, |
| T2112 |
5892-5901 |
VBN |
denotes |
increased |
| T2113 |
5902-5915 |
NN |
denotes |
proliferation |
| T2114 |
5915-5917 |
, |
denotes |
, |
| T2115 |
5917-5920 |
CC |
denotes |
and |
| T2116 |
5921-5930 |
VBN |
denotes |
repressed |
| T2118 |
5931-5939 |
JJ |
denotes |
terminal |
| T2117 |
5940-5955 |
NN |
denotes |
differentiation |
| T2119 |
5955-5956 |
. |
denotes |
. |
| T2120 |
5956-6202 |
sentence |
denotes |
Although the temporal spike of Snail in the hair bud is reflected at the mRNA level and seems to follow Wnt signaling and BMP inhibition, LEF-1/β-catenin activation does not appear to induce Snail gene expression in embryonic skin keratinocytes. |
| T2121 |
5957-5965 |
IN |
denotes |
Although |
| T2123 |
5966-5969 |
DT |
denotes |
the |
| T2125 |
5970-5978 |
JJ |
denotes |
temporal |
| T2124 |
5979-5984 |
NN |
denotes |
spike |
| T2126 |
5985-5987 |
IN |
denotes |
of |
| T2127 |
5988-5993 |
NN |
denotes |
Snail |
| T2128 |
5994-5996 |
IN |
denotes |
in |
| T2129 |
5997-6000 |
DT |
denotes |
the |
| T2131 |
6001-6005 |
NN |
denotes |
hair |
| T2130 |
6006-6009 |
NN |
denotes |
bud |
| T2132 |
6010-6012 |
VBZ |
denotes |
is |
| T2122 |
6013-6022 |
VBN |
denotes |
reflected |
| T2134 |
6023-6025 |
IN |
denotes |
at |
| T2135 |
6026-6029 |
DT |
denotes |
the |
| T2137 |
6030-6034 |
NN |
denotes |
mRNA |
| T2136 |
6035-6040 |
NN |
denotes |
level |
| T2138 |
6041-6044 |
CC |
denotes |
and |
| T2139 |
6045-6050 |
VBZ |
denotes |
seems |
| T2140 |
6051-6053 |
TO |
denotes |
to |
| T2141 |
6054-6060 |
VB |
denotes |
follow |
| T2142 |
6061-6064 |
NN |
denotes |
Wnt |
| T2143 |
6065-6074 |
NN |
denotes |
signaling |
| T2144 |
6075-6078 |
CC |
denotes |
and |
| T2145 |
6079-6082 |
NN |
denotes |
BMP |
| T2146 |
6083-6093 |
NN |
denotes |
inhibition |
| T2147 |
6093-6095 |
, |
denotes |
, |
| T2148 |
6095-6098 |
NN |
denotes |
LEF |
| T2150 |
6098-6099 |
HYPH |
denotes |
- |
| T2151 |
6099-6100 |
CD |
denotes |
1 |
| T2152 |
6100-6101 |
HYPH |
denotes |
/ |
| T2153 |
6101-6102 |
NN |
denotes |
β |
| T2155 |
6102-6103 |
HYPH |
denotes |
- |
| T2154 |
6103-6110 |
NN |
denotes |
catenin |
| T2149 |
6111-6121 |
NN |
denotes |
activation |
| T2156 |
6122-6126 |
VBZ |
denotes |
does |
| T2157 |
6127-6130 |
RB |
denotes |
not |
| T2133 |
6131-6137 |
VB |
denotes |
appear |
| T2158 |
6138-6140 |
TO |
denotes |
to |
| T2159 |
6141-6147 |
VB |
denotes |
induce |
| T2160 |
6148-6153 |
NN |
denotes |
Snail |
| T2162 |
6154-6158 |
NN |
denotes |
gene |
| T2161 |
6159-6169 |
NN |
denotes |
expression |
| T2163 |
6170-6172 |
IN |
denotes |
in |
| T2164 |
6173-6182 |
JJ |
denotes |
embryonic |
| T2166 |
6183-6187 |
NN |
denotes |
skin |
| T2165 |
6188-6201 |
NNS |
denotes |
keratinocytes |
| T2167 |
6201-6202 |
. |
denotes |
. |
| T2168 |
6202-6461 |
sentence |
denotes |
In contrast, we provide in vitro, transgenic (Tg), and gene targeting evidence to show that TGF-β2 and small phenotype– and mothers against decapentaplegic–related protein 2 (SMAD2) signaling are upstream inducers of Snail gene expression in skin epithelium. |
| T2169 |
6203-6205 |
IN |
denotes |
In |
| T2171 |
6206-6214 |
NN |
denotes |
contrast |
| T2172 |
6214-6216 |
, |
denotes |
, |
| T2173 |
6216-6218 |
PRP |
denotes |
we |
| T2170 |
6219-6226 |
VBP |
denotes |
provide |
| T2174 |
6227-6229 |
FW |
denotes |
in |
| T2175 |
6230-6235 |
FW |
denotes |
vitro |
| T2177 |
6235-6237 |
, |
denotes |
, |
| T2178 |
6237-6247 |
JJ |
denotes |
transgenic |
| T2179 |
6248-6249 |
-LRB- |
denotes |
( |
| T2180 |
6249-6251 |
JJ |
denotes |
Tg |
| T2181 |
6251-6252 |
-RRB- |
denotes |
) |
| T2182 |
6252-6254 |
, |
denotes |
, |
| T2183 |
6254-6257 |
CC |
denotes |
and |
| T2184 |
6258-6262 |
NN |
denotes |
gene |
| T2185 |
6263-6272 |
VBG |
denotes |
targeting |
| T2176 |
6273-6281 |
NN |
denotes |
evidence |
| T2186 |
6282-6284 |
TO |
denotes |
to |
| T2187 |
6285-6289 |
VB |
denotes |
show |
| T2188 |
6290-6294 |
IN |
denotes |
that |
| T2190 |
6295-6298 |
NN |
denotes |
TGF |
| T2192 |
6298-6299 |
HYPH |
denotes |
- |
| T2191 |
6299-6301 |
NN |
denotes |
β2 |
| T2194 |
6302-6305 |
CC |
denotes |
and |
| T2195 |
6306-6311 |
JJ |
denotes |
small |
| T2196 |
6312-6321 |
NN |
denotes |
phenotype |
| T2198 |
6321-6322 |
-LRB- |
denotes |
– |
| T2199 |
6323-6326 |
CC |
denotes |
and |
| T2200 |
6327-6334 |
NNS |
denotes |
mothers |
| T2201 |
6335-6342 |
IN |
denotes |
against |
| T2202 |
6343-6358 |
NN |
denotes |
decapentaplegic |
| T2203 |
6358-6359 |
-RRB- |
denotes |
– |
| T2197 |
6359-6366 |
VBN |
denotes |
related |
| T2204 |
6367-6374 |
NN |
denotes |
protein |
| T2205 |
6375-6376 |
CD |
denotes |
2 |
| T2206 |
6377-6378 |
-LRB- |
denotes |
( |
| T2207 |
6378-6383 |
NN |
denotes |
SMAD2 |
| T2208 |
6383-6384 |
-RRB- |
denotes |
) |
| T2193 |
6385-6394 |
NN |
denotes |
signaling |
| T2189 |
6395-6398 |
VBP |
denotes |
are |
| T2209 |
6399-6407 |
JJ |
denotes |
upstream |
| T2210 |
6408-6416 |
NNS |
denotes |
inducers |
| T2211 |
6417-6419 |
IN |
denotes |
of |
| T2212 |
6420-6425 |
NN |
denotes |
Snail |
| T2214 |
6426-6430 |
NN |
denotes |
gene |
| T2213 |
6431-6441 |
NN |
denotes |
expression |
| T2215 |
6442-6444 |
IN |
denotes |
in |
| T2216 |
6445-6449 |
NN |
denotes |
skin |
| T2217 |
6450-6460 |
NN |
denotes |
epithelium |
| T2218 |
6460-6461 |
. |
denotes |
. |
| T2219 |
6461-6592 |
sentence |
denotes |
In the absence of TGF-β2 signaling and Snail gene expression, hair placodes can form, but further follicle down-growth is blocked. |
| T2220 |
6462-6464 |
IN |
denotes |
In |
| T2222 |
6465-6468 |
DT |
denotes |
the |
| T2223 |
6469-6476 |
NN |
denotes |
absence |
| T2224 |
6477-6479 |
IN |
denotes |
of |
| T2225 |
6480-6483 |
NN |
denotes |
TGF |
| T2227 |
6483-6484 |
HYPH |
denotes |
- |
| T2226 |
6484-6486 |
NN |
denotes |
β2 |
| T2228 |
6487-6496 |
NN |
denotes |
signaling |
| T2229 |
6497-6500 |
CC |
denotes |
and |
| T2230 |
6501-6506 |
NN |
denotes |
Snail |
| T2232 |
6507-6511 |
NN |
denotes |
gene |
| T2231 |
6512-6522 |
NN |
denotes |
expression |
| T2233 |
6522-6524 |
, |
denotes |
, |
| T2234 |
6524-6528 |
NN |
denotes |
hair |
| T2235 |
6529-6537 |
NNS |
denotes |
placodes |
| T2236 |
6538-6541 |
MD |
denotes |
can |
| T2221 |
6542-6546 |
VB |
denotes |
form |
| T2237 |
6546-6548 |
, |
denotes |
, |
| T2238 |
6548-6551 |
CC |
denotes |
but |
| T2239 |
6552-6559 |
JJ |
denotes |
further |
| T2241 |
6560-6568 |
NN |
denotes |
follicle |
| T2242 |
6569-6573 |
JJ |
denotes |
down |
| T2243 |
6573-6574 |
HYPH |
denotes |
- |
| T2240 |
6574-6580 |
NN |
denotes |
growth |
| T2245 |
6581-6583 |
VBZ |
denotes |
is |
| T2244 |
6584-6591 |
VBN |
denotes |
blocked |
| T2246 |
6591-6592 |
. |
denotes |
. |
| T2247 |
6592-6770 |
sentence |
denotes |
Our studies point to the view that Snail likely functions downstream of cell fate specification, at a stage where the bud begins to exhibit enhanced proliferation and migration. |
| T2248 |
6593-6596 |
PRP$ |
denotes |
Our |
| T2249 |
6597-6604 |
NNS |
denotes |
studies |
| T2250 |
6605-6610 |
VBP |
denotes |
point |
| T2251 |
6611-6613 |
IN |
denotes |
to |
| T2252 |
6614-6617 |
DT |
denotes |
the |
| T2253 |
6618-6622 |
NN |
denotes |
view |
| T2254 |
6623-6627 |
IN |
denotes |
that |
| T2256 |
6628-6633 |
NN |
denotes |
Snail |
| T2257 |
6634-6640 |
RB |
denotes |
likely |
| T2255 |
6641-6650 |
VBZ |
denotes |
functions |
| T2258 |
6651-6661 |
RB |
denotes |
downstream |
| T2259 |
6662-6664 |
IN |
denotes |
of |
| T2260 |
6665-6669 |
NN |
denotes |
cell |
| T2261 |
6670-6674 |
NN |
denotes |
fate |
| T2262 |
6675-6688 |
NN |
denotes |
specification |
| T2263 |
6688-6690 |
, |
denotes |
, |
| T2264 |
6690-6692 |
IN |
denotes |
at |
| T2265 |
6693-6694 |
DT |
denotes |
a |
| T2266 |
6695-6700 |
NN |
denotes |
stage |
| T2267 |
6701-6706 |
WRB |
denotes |
where |
| T2269 |
6707-6710 |
DT |
denotes |
the |
| T2270 |
6711-6714 |
NN |
denotes |
bud |
| T2268 |
6715-6721 |
VBZ |
denotes |
begins |
| T2271 |
6722-6724 |
TO |
denotes |
to |
| T2272 |
6725-6732 |
VB |
denotes |
exhibit |
| T2273 |
6733-6741 |
VBN |
denotes |
enhanced |
| T2274 |
6742-6755 |
NN |
denotes |
proliferation |
| T2275 |
6756-6759 |
CC |
denotes |
and |
| T2276 |
6760-6769 |
NN |
denotes |
migration |
| T2277 |
6769-6770 |
. |
denotes |
. |
| T2702 |
6781-6786 |
NN |
denotes |
Snail |
| T2703 |
6787-6791 |
NN |
denotes |
mRNA |
| T2705 |
6792-6795 |
CC |
denotes |
and |
| T2706 |
6796-6803 |
NN |
denotes |
Protein |
| T2707 |
6804-6807 |
VBP |
denotes |
Are |
| T2704 |
6808-6817 |
VBN |
denotes |
Expressed |
| T2708 |
6818-6829 |
RB |
denotes |
Transiently |
| T2709 |
6830-6832 |
IN |
denotes |
at |
| T2710 |
6833-6836 |
DT |
denotes |
the |
| T2712 |
6837-6841 |
NN |
denotes |
Hair |
| T2713 |
6842-6845 |
NN |
denotes |
Bud |
| T2711 |
6846-6851 |
NN |
denotes |
Stage |
| T2714 |
6852-6854 |
IN |
denotes |
of |
| T2715 |
6855-6863 |
NN |
denotes |
Follicle |
| T2716 |
6864-6877 |
NN |
denotes |
Morphogenesis |
| T2717 |
6877-7094 |
sentence |
denotes |
Although Snail family members are most frequently associated with EMTs, they also participate in many malignant processes involving a down-regulation but not a quantitative abrogation of intercellular junctions [18]. |
| T2718 |
6878-6886 |
IN |
denotes |
Although |
| T2720 |
6887-6892 |
NN |
denotes |
Snail |
| T2722 |
6893-6899 |
NN |
denotes |
family |
| T2721 |
6900-6907 |
NNS |
denotes |
members |
| T2723 |
6908-6911 |
VBP |
denotes |
are |
| T2724 |
6912-6916 |
RBS |
denotes |
most |
| T2725 |
6917-6927 |
RB |
denotes |
frequently |
| T2719 |
6928-6938 |
VBN |
denotes |
associated |
| T2727 |
6939-6943 |
IN |
denotes |
with |
| T2728 |
6944-6948 |
NNS |
denotes |
EMTs |
| T2729 |
6948-6950 |
, |
denotes |
, |
| T2730 |
6950-6954 |
PRP |
denotes |
they |
| T2731 |
6955-6959 |
RB |
denotes |
also |
| T2726 |
6960-6971 |
VBP |
denotes |
participate |
| T2732 |
6972-6974 |
IN |
denotes |
in |
| T2733 |
6975-6979 |
JJ |
denotes |
many |
| T2735 |
6980-6989 |
JJ |
denotes |
malignant |
| T2734 |
6990-6999 |
NNS |
denotes |
processes |
| T2736 |
7000-7009 |
VBG |
denotes |
involving |
| T2737 |
7010-7011 |
DT |
denotes |
a |
| T2739 |
7012-7016 |
JJ |
denotes |
down |
| T2740 |
7016-7017 |
HYPH |
denotes |
- |
| T2738 |
7017-7027 |
NN |
denotes |
regulation |
| T2741 |
7028-7031 |
CC |
denotes |
but |
| T2742 |
7032-7035 |
RB |
denotes |
not |
| T2743 |
7036-7037 |
DT |
denotes |
a |
| T2745 |
7038-7050 |
JJ |
denotes |
quantitative |
| T2744 |
7051-7061 |
NN |
denotes |
abrogation |
| T2746 |
7062-7064 |
IN |
denotes |
of |
| T2747 |
7065-7078 |
JJ |
denotes |
intercellular |
| T2748 |
7079-7088 |
NNS |
denotes |
junctions |
| T2749 |
7089-7090 |
-LRB- |
denotes |
[ |
| T2750 |
7090-7092 |
CD |
denotes |
18 |
| T2751 |
7092-7093 |
-RRB- |
denotes |
] |
| T2752 |
7093-7094 |
. |
denotes |
. |
| T2753 |
7094-7279 |
sentence |
denotes |
The range of developmental processes in which Snail family members have been implicated thus includes the type of epithelial remodeling that is observed in hair follicle bud formation. |
| T2754 |
7095-7098 |
DT |
denotes |
The |
| T2755 |
7099-7104 |
NN |
denotes |
range |
| T2757 |
7105-7107 |
IN |
denotes |
of |
| T2758 |
7108-7121 |
JJ |
denotes |
developmental |
| T2759 |
7122-7131 |
NNS |
denotes |
processes |
| T2760 |
7132-7134 |
IN |
denotes |
in |
| T2762 |
7135-7140 |
WDT |
denotes |
which |
| T2763 |
7141-7146 |
NN |
denotes |
Snail |
| T2765 |
7147-7153 |
NN |
denotes |
family |
| T2764 |
7154-7161 |
NNS |
denotes |
members |
| T2766 |
7162-7166 |
VBP |
denotes |
have |
| T2767 |
7167-7171 |
VBN |
denotes |
been |
| T2761 |
7172-7182 |
VBN |
denotes |
implicated |
| T2768 |
7183-7187 |
RB |
denotes |
thus |
| T2756 |
7188-7196 |
VBZ |
denotes |
includes |
| T2769 |
7197-7200 |
DT |
denotes |
the |
| T2770 |
7201-7205 |
NN |
denotes |
type |
| T2771 |
7206-7208 |
IN |
denotes |
of |
| T2772 |
7209-7219 |
JJ |
denotes |
epithelial |
| T2773 |
7220-7230 |
NN |
denotes |
remodeling |
| T2774 |
7231-7235 |
WDT |
denotes |
that |
| T2776 |
7236-7238 |
VBZ |
denotes |
is |
| T2775 |
7239-7247 |
VBN |
denotes |
observed |
| T2777 |
7248-7250 |
IN |
denotes |
in |
| T2778 |
7251-7255 |
NN |
denotes |
hair |
| T2779 |
7256-7264 |
NN |
denotes |
follicle |
| T2780 |
7265-7268 |
NN |
denotes |
bud |
| T2781 |
7269-7278 |
NN |
denotes |
formation |
| T2782 |
7278-7279 |
. |
denotes |
. |
| T2783 |
7279-7633 |
sentence |
denotes |
Given our prior observation that exogenously added Snail can participate with LEF-1/β-catenin in down-regulating E-cadherin expression in keratinocytes [4], coupled with the established requirement for LEF-1/β-catenin in hair follicle morphogenesis [4,19], we turned to addressing whether Snail/Slug family members might also participate in the process. |
| T2784 |
7280-7285 |
VBN |
denotes |
Given |
| T2786 |
7286-7289 |
PRP$ |
denotes |
our |
| T2788 |
7290-7295 |
JJ |
denotes |
prior |
| T2787 |
7296-7307 |
NN |
denotes |
observation |
| T2789 |
7308-7312 |
IN |
denotes |
that |
| T2791 |
7313-7324 |
RB |
denotes |
exogenously |
| T2792 |
7325-7330 |
VBN |
denotes |
added |
| T2793 |
7331-7336 |
NN |
denotes |
Snail |
| T2794 |
7337-7340 |
MD |
denotes |
can |
| T2790 |
7341-7352 |
VB |
denotes |
participate |
| T2795 |
7353-7357 |
IN |
denotes |
with |
| T2796 |
7358-7361 |
NN |
denotes |
LEF |
| T2797 |
7361-7362 |
HYPH |
denotes |
- |
| T2798 |
7362-7363 |
CD |
denotes |
1 |
| T2799 |
7363-7364 |
HYPH |
denotes |
/ |
| T2800 |
7364-7365 |
NN |
denotes |
β |
| T2802 |
7365-7366 |
HYPH |
denotes |
- |
| T2801 |
7366-7373 |
NN |
denotes |
catenin |
| T2803 |
7374-7376 |
IN |
denotes |
in |
| T2804 |
7377-7381 |
RB |
denotes |
down |
| T2806 |
7381-7382 |
HYPH |
denotes |
- |
| T2805 |
7382-7392 |
VBG |
denotes |
regulating |
| T2807 |
7393-7394 |
NN |
denotes |
E |
| T2809 |
7394-7395 |
HYPH |
denotes |
- |
| T2808 |
7395-7403 |
NN |
denotes |
cadherin |
| T2810 |
7404-7414 |
NN |
denotes |
expression |
| T2811 |
7415-7417 |
IN |
denotes |
in |
| T2812 |
7418-7431 |
NNS |
denotes |
keratinocytes |
| T2813 |
7432-7433 |
-LRB- |
denotes |
[ |
| T2814 |
7433-7434 |
CD |
denotes |
4 |
| T2815 |
7434-7435 |
-RRB- |
denotes |
] |
| T2816 |
7435-7437 |
, |
denotes |
, |
| T2817 |
7437-7444 |
VBN |
denotes |
coupled |
| T2818 |
7445-7449 |
IN |
denotes |
with |
| T2819 |
7450-7453 |
DT |
denotes |
the |
| T2821 |
7454-7465 |
JJ |
denotes |
established |
| T2820 |
7466-7477 |
NN |
denotes |
requirement |
| T2822 |
7478-7481 |
IN |
denotes |
for |
| T2823 |
7482-7485 |
NN |
denotes |
LEF |
| T2824 |
7485-7486 |
HYPH |
denotes |
- |
| T2825 |
7486-7487 |
CD |
denotes |
1 |
| T2826 |
7487-7488 |
HYPH |
denotes |
/ |
| T2827 |
7488-7489 |
NN |
denotes |
β |
| T2829 |
7489-7490 |
HYPH |
denotes |
- |
| T2828 |
7490-7497 |
NN |
denotes |
catenin |
| T2830 |
7498-7500 |
IN |
denotes |
in |
| T2831 |
7501-7505 |
NN |
denotes |
hair |
| T2832 |
7506-7514 |
NN |
denotes |
follicle |
| T2833 |
7515-7528 |
NN |
denotes |
morphogenesis |
| T2834 |
7529-7530 |
-LRB- |
denotes |
[ |
| T2836 |
7530-7531 |
CD |
denotes |
4 |
| T2837 |
7531-7532 |
, |
denotes |
, |
| T2835 |
7532-7534 |
CD |
denotes |
19 |
| T2838 |
7534-7535 |
-RRB- |
denotes |
] |
| T2839 |
7535-7537 |
, |
denotes |
, |
| T2840 |
7537-7539 |
PRP |
denotes |
we |
| T2785 |
7540-7546 |
VBD |
denotes |
turned |
| T2841 |
7547-7549 |
IN |
denotes |
to |
| T2842 |
7550-7560 |
VBG |
denotes |
addressing |
| T2843 |
7561-7568 |
IN |
denotes |
whether |
| T2845 |
7569-7574 |
NN |
denotes |
Snail |
| T2847 |
7574-7575 |
HYPH |
denotes |
/ |
| T2846 |
7575-7579 |
NN |
denotes |
Slug |
| T2849 |
7580-7586 |
NN |
denotes |
family |
| T2848 |
7587-7594 |
NNS |
denotes |
members |
| T2850 |
7595-7600 |
MD |
denotes |
might |
| T2851 |
7601-7605 |
RB |
denotes |
also |
| T2844 |
7606-7617 |
VB |
denotes |
participate |
| T2852 |
7618-7620 |
IN |
denotes |
in |
| T2853 |
7621-7624 |
DT |
denotes |
the |
| T2854 |
7625-7632 |
NN |
denotes |
process |
| T2855 |
7632-7633 |
. |
denotes |
. |
| T2856 |
7633-7788 |
sentence |
denotes |
PCR analyses identified transient Snail mRNA expression during a period of skin embryogenesis when waves of hair follicles are forming (unpublished data). |
| T2857 |
7634-7637 |
NN |
denotes |
PCR |
| T2858 |
7638-7646 |
NNS |
denotes |
analyses |
| T2859 |
7647-7657 |
VBD |
denotes |
identified |
| T2860 |
7658-7667 |
JJ |
denotes |
transient |
| T2862 |
7668-7673 |
NN |
denotes |
Snail |
| T2863 |
7674-7678 |
NN |
denotes |
mRNA |
| T2861 |
7679-7689 |
NN |
denotes |
expression |
| T2864 |
7690-7696 |
IN |
denotes |
during |
| T2865 |
7697-7698 |
DT |
denotes |
a |
| T2866 |
7699-7705 |
NN |
denotes |
period |
| T2867 |
7706-7708 |
IN |
denotes |
of |
| T2868 |
7709-7713 |
NN |
denotes |
skin |
| T2869 |
7714-7727 |
NN |
denotes |
embryogenesis |
| T2870 |
7728-7732 |
WRB |
denotes |
when |
| T2872 |
7733-7738 |
NNS |
denotes |
waves |
| T2873 |
7739-7741 |
IN |
denotes |
of |
| T2874 |
7742-7746 |
NN |
denotes |
hair |
| T2875 |
7747-7756 |
NNS |
denotes |
follicles |
| T2876 |
7757-7760 |
VBP |
denotes |
are |
| T2871 |
7761-7768 |
VBG |
denotes |
forming |
| T2877 |
7769-7770 |
-LRB- |
denotes |
( |
| T2879 |
7770-7781 |
JJ |
denotes |
unpublished |
| T2878 |
7782-7786 |
NNS |
denotes |
data |
| T2880 |
7786-7787 |
-RRB- |
denotes |
) |
| T2881 |
7787-7788 |
. |
denotes |
. |
| T2882 |
7788-7790 |
TO |
denotes |
To |
| T2884 |
7788-7970 |
sentence |
denotes |
To pinpoint specifically where Snail mRNA is expressed in the developing skin, we conducted in situ hybridization using a cRNA probe unique to the Snail 3′ untranslated region (UTR). |
| T2883 |
7791-7799 |
VB |
denotes |
pinpoint |
| T2886 |
7800-7812 |
RB |
denotes |
specifically |
| T2887 |
7813-7818 |
WRB |
denotes |
where |
| T2889 |
7819-7824 |
NN |
denotes |
Snail |
| T2890 |
7825-7829 |
NN |
denotes |
mRNA |
| T2891 |
7830-7832 |
VBZ |
denotes |
is |
| T2888 |
7833-7842 |
VBN |
denotes |
expressed |
| T2892 |
7843-7845 |
IN |
denotes |
in |
| T2893 |
7846-7849 |
DT |
denotes |
the |
| T2895 |
7850-7860 |
VBG |
denotes |
developing |
| T2894 |
7861-7865 |
NN |
denotes |
skin |
| T2896 |
7865-7867 |
, |
denotes |
, |
| T2897 |
7867-7869 |
PRP |
denotes |
we |
| T2885 |
7870-7879 |
VBD |
denotes |
conducted |
| T2898 |
7880-7882 |
FW |
denotes |
in |
| T2899 |
7883-7887 |
FW |
denotes |
situ |
| T2900 |
7888-7901 |
NN |
denotes |
hybridization |
| T2901 |
7902-7907 |
VBG |
denotes |
using |
| T2902 |
7908-7909 |
DT |
denotes |
a |
| T2904 |
7910-7914 |
NN |
denotes |
cRNA |
| T2903 |
7915-7920 |
NN |
denotes |
probe |
| T2905 |
7921-7927 |
JJ |
denotes |
unique |
| T2906 |
7928-7930 |
IN |
denotes |
to |
| T2907 |
7931-7934 |
DT |
denotes |
the |
| T2909 |
7935-7940 |
NNP |
denotes |
Snail |
| T2910 |
7941-7942 |
CD |
denotes |
3 |
| T2911 |
7942-7943 |
SYM |
denotes |
′ |
| T2912 |
7944-7956 |
JJ |
denotes |
untranslated |
| T2908 |
7957-7963 |
NN |
denotes |
region |
| T2913 |
7964-7965 |
-LRB- |
denotes |
( |
| T2914 |
7965-7968 |
NN |
denotes |
UTR |
| T2915 |
7968-7969 |
-RRB- |
denotes |
) |
| T2916 |
7969-7970 |
. |
denotes |
. |
| T2917 |
7970-8159 |
sentence |
denotes |
Embryonic day 17.5 (E17.5) was chosen, since the multiple waves of follicle morphogenesis occurring at this time enabled us to evaluate Snail expression at different stages of the process. |
| T2918 |
7971-7980 |
JJ |
denotes |
Embryonic |
| T2919 |
7981-7984 |
NN |
denotes |
day |
| T2921 |
7985-7989 |
CD |
denotes |
17.5 |
| T2922 |
7990-7991 |
-LRB- |
denotes |
( |
| T2923 |
7991-7996 |
NN |
denotes |
E17.5 |
| T2924 |
7996-7997 |
-RRB- |
denotes |
) |
| T2925 |
7998-8001 |
VBD |
denotes |
was |
| T2920 |
8002-8008 |
VBN |
denotes |
chosen |
| T2926 |
8008-8010 |
, |
denotes |
, |
| T2927 |
8010-8015 |
IN |
denotes |
since |
| T2929 |
8016-8019 |
DT |
denotes |
the |
| T2931 |
8020-8028 |
JJ |
denotes |
multiple |
| T2930 |
8029-8034 |
NNS |
denotes |
waves |
| T2932 |
8035-8037 |
IN |
denotes |
of |
| T2933 |
8038-8046 |
NN |
denotes |
follicle |
| T2934 |
8047-8060 |
NN |
denotes |
morphogenesis |
| T2935 |
8061-8070 |
VBG |
denotes |
occurring |
| T2936 |
8071-8073 |
IN |
denotes |
at |
| T2937 |
8074-8078 |
DT |
denotes |
this |
| T2938 |
8079-8083 |
NN |
denotes |
time |
| T2928 |
8084-8091 |
VBD |
denotes |
enabled |
| T2939 |
8092-8094 |
PRP |
denotes |
us |
| T2940 |
8095-8097 |
TO |
denotes |
to |
| T2941 |
8098-8106 |
VB |
denotes |
evaluate |
| T2942 |
8107-8112 |
NN |
denotes |
Snail |
| T2943 |
8113-8123 |
NN |
denotes |
expression |
| T2944 |
8124-8126 |
IN |
denotes |
at |
| T2945 |
8127-8136 |
JJ |
denotes |
different |
| T2946 |
8137-8143 |
NNS |
denotes |
stages |
| T2947 |
8144-8146 |
IN |
denotes |
of |
| T2948 |
8147-8150 |
DT |
denotes |
the |
| T2949 |
8151-8158 |
NN |
denotes |
process |
| T2950 |
8158-8159 |
. |
denotes |
. |
| T2951 |
8159-8262 |
sentence |
denotes |
As shown in Figure 1A, specific hybridization was detected within the epithelium of nascent hair buds. |
| T2952 |
8160-8162 |
IN |
denotes |
As |
| T2953 |
8163-8168 |
VBN |
denotes |
shown |
| T2955 |
8169-8171 |
IN |
denotes |
in |
| T2956 |
8172-8178 |
NN |
denotes |
Figure |
| T2957 |
8179-8181 |
NN |
denotes |
1A |
| T2958 |
8181-8183 |
, |
denotes |
, |
| T2959 |
8183-8191 |
JJ |
denotes |
specific |
| T2960 |
8192-8205 |
NN |
denotes |
hybridization |
| T2961 |
8206-8209 |
VBD |
denotes |
was |
| T2954 |
8210-8218 |
VBN |
denotes |
detected |
| T2962 |
8219-8225 |
IN |
denotes |
within |
| T2963 |
8226-8229 |
DT |
denotes |
the |
| T2964 |
8230-8240 |
NN |
denotes |
epithelium |
| T2965 |
8241-8243 |
IN |
denotes |
of |
| T2966 |
8244-8251 |
JJ |
denotes |
nascent |
| T2968 |
8252-8256 |
NN |
denotes |
hair |
| T2967 |
8257-8261 |
NNS |
denotes |
buds |
| T2969 |
8261-8262 |
. |
denotes |
. |
| T2970 |
8262-8416 |
sentence |
denotes |
By contrast, as follicles progressed further through their development (e.g., germ and peg stages), they exhibited no signs of hybridization (Figure 1A). |
| T2971 |
8263-8265 |
IN |
denotes |
By |
| T2973 |
8266-8274 |
NN |
denotes |
contrast |
| T2974 |
8274-8276 |
, |
denotes |
, |
| T2975 |
8276-8278 |
IN |
denotes |
as |
| T2977 |
8279-8288 |
NNS |
denotes |
follicles |
| T2976 |
8289-8299 |
VBD |
denotes |
progressed |
| T2978 |
8300-8307 |
RBR |
denotes |
further |
| T2979 |
8308-8315 |
IN |
denotes |
through |
| T2980 |
8316-8321 |
PRP$ |
denotes |
their |
| T2981 |
8322-8333 |
NN |
denotes |
development |
| T2982 |
8334-8335 |
-LRB- |
denotes |
( |
| T2984 |
8335-8339 |
FW |
denotes |
e.g. |
| T2985 |
8339-8341 |
, |
denotes |
, |
| T2986 |
8341-8345 |
NN |
denotes |
germ |
| T2987 |
8346-8349 |
CC |
denotes |
and |
| T2988 |
8350-8353 |
NN |
denotes |
peg |
| T2983 |
8354-8360 |
NNS |
denotes |
stages |
| T2989 |
8360-8361 |
-RRB- |
denotes |
) |
| T2990 |
8361-8363 |
, |
denotes |
, |
| T2991 |
8363-8367 |
PRP |
denotes |
they |
| T2972 |
8368-8377 |
VBD |
denotes |
exhibited |
| T2992 |
8378-8380 |
DT |
denotes |
no |
| T2993 |
8381-8386 |
NNS |
denotes |
signs |
| T2994 |
8387-8389 |
IN |
denotes |
of |
| T2995 |
8390-8403 |
NN |
denotes |
hybridization |
| T2996 |
8404-8405 |
-LRB- |
denotes |
( |
| T2998 |
8405-8411 |
NN |
denotes |
Figure |
| T2997 |
8412-8414 |
NN |
denotes |
1A |
| T2999 |
8414-8415 |
-RRB- |
denotes |
) |
| T3000 |
8415-8416 |
. |
denotes |
. |
| T3001 |
8416-8623 |
sentence |
denotes |
The transient nature of Snail mRNA expression during follicle development was most apparent in hybridized skin sections containing follicles from two different waves of morphogenesis (as shown in Figure 1). |
| T3002 |
8417-8420 |
DT |
denotes |
The |
| T3004 |
8421-8430 |
JJ |
denotes |
transient |
| T3003 |
8431-8437 |
NN |
denotes |
nature |
| T3006 |
8438-8440 |
IN |
denotes |
of |
| T3007 |
8441-8446 |
NN |
denotes |
Snail |
| T3009 |
8447-8451 |
NN |
denotes |
mRNA |
| T3008 |
8452-8462 |
NN |
denotes |
expression |
| T3010 |
8463-8469 |
IN |
denotes |
during |
| T3011 |
8470-8478 |
NN |
denotes |
follicle |
| T3012 |
8479-8490 |
NN |
denotes |
development |
| T3005 |
8491-8494 |
VBD |
denotes |
was |
| T3013 |
8495-8499 |
RBS |
denotes |
most |
| T3014 |
8500-8508 |
JJ |
denotes |
apparent |
| T3015 |
8509-8511 |
IN |
denotes |
in |
| T3016 |
8512-8522 |
VBN |
denotes |
hybridized |
| T3018 |
8523-8527 |
NN |
denotes |
skin |
| T3017 |
8528-8536 |
NNS |
denotes |
sections |
| T3019 |
8537-8547 |
VBG |
denotes |
containing |
| T3020 |
8548-8557 |
NNS |
denotes |
follicles |
| T3021 |
8558-8562 |
IN |
denotes |
from |
| T3022 |
8563-8566 |
CD |
denotes |
two |
| T3024 |
8567-8576 |
JJ |
denotes |
different |
| T3023 |
8577-8582 |
NNS |
denotes |
waves |
| T3025 |
8583-8585 |
IN |
denotes |
of |
| T3026 |
8586-8599 |
NN |
denotes |
morphogenesis |
| T3027 |
8600-8601 |
-LRB- |
denotes |
( |
| T3029 |
8601-8603 |
IN |
denotes |
as |
| T3028 |
8604-8609 |
VBN |
denotes |
shown |
| T3030 |
8610-8612 |
IN |
denotes |
in |
| T3031 |
8613-8619 |
NN |
denotes |
Figure |
| T3032 |
8620-8621 |
CD |
denotes |
1 |
| T3033 |
8621-8622 |
-RRB- |
denotes |
) |
| T3034 |
8622-8623 |
. |
denotes |
. |
| T3035 |
8623-8735 |
sentence |
denotes |
Hybridizing hair buds from a later wave appeared juxtaposed with nonhybridizing follicles from an earlier wave. |
| T3036 |
8624-8635 |
VBG |
denotes |
Hybridizing |
| T3038 |
8636-8640 |
NN |
denotes |
hair |
| T3037 |
8641-8645 |
NNS |
denotes |
buds |
| T3040 |
8646-8650 |
IN |
denotes |
from |
| T3041 |
8651-8652 |
DT |
denotes |
a |
| T3043 |
8653-8658 |
JJ |
denotes |
later |
| T3042 |
8659-8663 |
NN |
denotes |
wave |
| T3039 |
8664-8672 |
VBD |
denotes |
appeared |
| T3044 |
8673-8683 |
JJ |
denotes |
juxtaposed |
| T3045 |
8684-8688 |
IN |
denotes |
with |
| T3046 |
8689-8703 |
JJ |
denotes |
nonhybridizing |
| T3047 |
8704-8713 |
NNS |
denotes |
follicles |
| T3048 |
8714-8718 |
IN |
denotes |
from |
| T3049 |
8719-8721 |
DT |
denotes |
an |
| T3051 |
8722-8729 |
JJR |
denotes |
earlier |
| T3050 |
8730-8734 |
NN |
denotes |
wave |
| T3052 |
8734-8735 |
. |
denotes |
. |
| T3053 |
8735-11356 |
sentence |
denotes |
Figure 1 Snail Is Expressed Exclusively in the Hair Bud during Morphogenesis
Embryos were either frozen in OCT embedding compound (A, F, and H) or embedded in paraffin (C, D, E, and G), and then sectioned (8 μm).
(A) In situ hybridizations with Snail sense or antisense cRNA probes. Black dotted lines demarcate the basement membrane that separates the epidermis (epi) from dermis (der). Arrows point to Snail RNA expression, restricted to the hair bud stage of follicle morphogenesis. It was not seen in later hair germ or peg stages.
(B) Expression of Snail protein coincides with hair development. Protein extracts were prepared from keratinocytes transfected with empty expression vector (K14), containing the K14 promoter or with the vector driving HA-tagged Snail (K14-Snail); or from whole skin from E13.5 to P5 animals, including newborn (nb). Equal amounts of proteins were then resolved by SDS-PAGE through 12% gels and subjected to Western blotting using either an affinity-purified Snail polyclonal antiserum, which we generated, or anti-tubulin (loading control).
(C–E) Immunohistochemistry shows expression of Snail protein in the nuclei of cells within the hair and skin. (C) E13.5 skin with a single layered epidermis (epi) shows no Snail expression. (D) The first morphological sign that cells have adopted a hair follicle fate is a cluster of cells called a placode in E16.5 skin. Snail is not expressed at this stage of development. (E) Snail is expressed in the hair bud of E17.5 skin but not in later stages of development such as the germ or peg.
(F) Immunofluorescence with anti-Ki67 (green) identifies the proliferating cells of the skin, restricted to the basal layer of the epidermis and developing hair follicles. Anti-β4 int labeling reveals the presence of the hemidesmosomal integrin β4, restricted to the base of cells adhering to the underlying basement membrane. The white dotted line marks the outermost surface of the skin.
(G) Immunohistochemistry with pMAPK marks a subset of proliferating cells within the epidermis and hair bud. Anti-pMAPK labeling was consistently robust within the hair bud.
(H) Immunofluorescence with anti-laminin 5 (lam5), which demarcates the basement membrane, and anti-E-cadherin (E-cad), a component of AJs. At the leading edge of the growing bud, cell-cell borders show markedly diminished anti-E-cadherin labeling (arrowheads). To determine whether this transient nature of Snail mRNA expression is reflected at the protein level, we generated an antibody against the N-terminal sequence that resides upstream of the more conserved zinc finger domains. |
| T3054 |
11132-11134 |
TO |
denotes |
To |
| T3055 |
11135-11144 |
VB |
denotes |
determine |
| T3057 |
11145-11152 |
IN |
denotes |
whether |
| T3059 |
11153-11157 |
DT |
denotes |
this |
| T3061 |
11158-11167 |
JJ |
denotes |
transient |
| T3060 |
11168-11174 |
NN |
denotes |
nature |
| T3062 |
11175-11177 |
IN |
denotes |
of |
| T3063 |
11178-11183 |
NN |
denotes |
Snail |
| T3065 |
11184-11188 |
NN |
denotes |
mRNA |
| T3064 |
11189-11199 |
NN |
denotes |
expression |
| T3066 |
11200-11202 |
VBZ |
denotes |
is |
| T3058 |
11203-11212 |
VBN |
denotes |
reflected |
| T3067 |
11213-11215 |
IN |
denotes |
at |
| T3068 |
11216-11219 |
DT |
denotes |
the |
| T3070 |
11220-11227 |
NN |
denotes |
protein |
| T3069 |
11228-11233 |
NN |
denotes |
level |
| T3071 |
11233-11235 |
, |
denotes |
, |
| T3072 |
11235-11237 |
PRP |
denotes |
we |
| T3056 |
11238-11247 |
VBD |
denotes |
generated |
| T3073 |
11248-11250 |
DT |
denotes |
an |
| T3074 |
11251-11259 |
NN |
denotes |
antibody |
| T3075 |
11260-11267 |
IN |
denotes |
against |
| T3076 |
11268-11271 |
DT |
denotes |
the |
| T3078 |
11272-11273 |
NN |
denotes |
N |
| T3080 |
11273-11274 |
HYPH |
denotes |
- |
| T3079 |
11274-11282 |
JJ |
denotes |
terminal |
| T3077 |
11283-11291 |
NN |
denotes |
sequence |
| T3081 |
11292-11296 |
WDT |
denotes |
that |
| T3082 |
11297-11304 |
VBZ |
denotes |
resides |
| T3083 |
11305-11313 |
RB |
denotes |
upstream |
| T3084 |
11314-11316 |
IN |
denotes |
of |
| T3085 |
11317-11320 |
DT |
denotes |
the |
| T3087 |
11321-11325 |
RBR |
denotes |
more |
| T3088 |
11326-11335 |
VBN |
denotes |
conserved |
| T3089 |
11336-11340 |
NN |
denotes |
zinc |
| T3090 |
11341-11347 |
NN |
denotes |
finger |
| T3086 |
11348-11355 |
NNS |
denotes |
domains |
| T3091 |
11355-11356 |
. |
denotes |
. |
| T3092 |
11356-11611 |
sentence |
denotes |
As judged by Western blot analysis, the antibody did not detect endogenous proteins from cultured keratinocytes, but it did yield a band of the expected size from keratinocytes transiently expressing a hemagglutinin (HA)-tagged Snail protein (Figure 1B). |
| T3093 |
11357-11359 |
IN |
denotes |
As |
| T3094 |
11360-11366 |
VBN |
denotes |
judged |
| T3096 |
11367-11369 |
IN |
denotes |
by |
| T3097 |
11370-11377 |
NNP |
denotes |
Western |
| T3098 |
11378-11382 |
NN |
denotes |
blot |
| T3099 |
11383-11391 |
NN |
denotes |
analysis |
| T3100 |
11391-11393 |
, |
denotes |
, |
| T3101 |
11393-11396 |
DT |
denotes |
the |
| T3102 |
11397-11405 |
NN |
denotes |
antibody |
| T3103 |
11406-11409 |
VBD |
denotes |
did |
| T3104 |
11410-11413 |
RB |
denotes |
not |
| T3095 |
11414-11420 |
VB |
denotes |
detect |
| T3105 |
11421-11431 |
JJ |
denotes |
endogenous |
| T3106 |
11432-11440 |
NN |
denotes |
proteins |
| T3107 |
11441-11445 |
IN |
denotes |
from |
| T3108 |
11446-11454 |
VBN |
denotes |
cultured |
| T3109 |
11455-11468 |
NNS |
denotes |
keratinocytes |
| T3110 |
11468-11470 |
, |
denotes |
, |
| T3111 |
11470-11473 |
CC |
denotes |
but |
| T3112 |
11474-11476 |
PRP |
denotes |
it |
| T3114 |
11477-11480 |
VBD |
denotes |
did |
| T3113 |
11481-11486 |
VB |
denotes |
yield |
| T3115 |
11487-11488 |
DT |
denotes |
a |
| T3116 |
11489-11493 |
NN |
denotes |
band |
| T3117 |
11494-11496 |
IN |
denotes |
of |
| T3118 |
11497-11500 |
DT |
denotes |
the |
| T3120 |
11501-11509 |
VBN |
denotes |
expected |
| T3119 |
11510-11514 |
NN |
denotes |
size |
| T3121 |
11515-11519 |
IN |
denotes |
from |
| T3122 |
11520-11533 |
NNS |
denotes |
keratinocytes |
| T3123 |
11534-11545 |
RB |
denotes |
transiently |
| T3124 |
11546-11556 |
VBG |
denotes |
expressing |
| T3125 |
11557-11558 |
DT |
denotes |
a |
| T3127 |
11559-11572 |
NN |
denotes |
hemagglutinin |
| T3129 |
11573-11574 |
-LRB- |
denotes |
( |
| T3130 |
11574-11576 |
NN |
denotes |
HA |
| T3131 |
11576-11577 |
-RRB- |
denotes |
) |
| T3132 |
11577-11578 |
HYPH |
denotes |
- |
| T3128 |
11578-11584 |
VBN |
denotes |
tagged |
| T3133 |
11585-11590 |
NN |
denotes |
Snail |
| T3126 |
11591-11598 |
NN |
denotes |
protein |
| T3134 |
11599-11600 |
-LRB- |
denotes |
( |
| T3136 |
11600-11606 |
NN |
denotes |
Figure |
| T3135 |
11607-11609 |
NN |
denotes |
1B |
| T3137 |
11609-11610 |
-RRB- |
denotes |
) |
| T3138 |
11610-11611 |
. |
denotes |
. |
| T3139 |
11611-11928 |
sentence |
denotes |
The antibody also recognized a band corresponding to the size of endogenous Snail (approximately 28 kDa) in lysates from embryonic mouse skin, the temporal appearance of which corresponded to the waves of hair follicle morphogenesis from E15.5 to newborn when over 90% of the hair on the mouse is formed (Figure 1B). |
| T3140 |
11612-11615 |
DT |
denotes |
The |
| T3141 |
11616-11624 |
NN |
denotes |
antibody |
| T3143 |
11625-11629 |
RB |
denotes |
also |
| T3142 |
11630-11640 |
VBD |
denotes |
recognized |
| T3144 |
11641-11642 |
DT |
denotes |
a |
| T3145 |
11643-11647 |
NN |
denotes |
band |
| T3146 |
11648-11661 |
VBG |
denotes |
corresponding |
| T3147 |
11662-11664 |
IN |
denotes |
to |
| T3148 |
11665-11668 |
DT |
denotes |
the |
| T3149 |
11669-11673 |
NN |
denotes |
size |
| T3150 |
11674-11676 |
IN |
denotes |
of |
| T3151 |
11677-11687 |
JJ |
denotes |
endogenous |
| T3152 |
11688-11693 |
NN |
denotes |
Snail |
| T3153 |
11694-11695 |
-LRB- |
denotes |
( |
| T3154 |
11695-11708 |
RB |
denotes |
approximately |
| T3155 |
11709-11711 |
CD |
denotes |
28 |
| T3156 |
11712-11715 |
NN |
denotes |
kDa |
| T3157 |
11715-11716 |
-RRB- |
denotes |
) |
| T3158 |
11717-11719 |
IN |
denotes |
in |
| T3159 |
11720-11727 |
NNS |
denotes |
lysates |
| T3160 |
11728-11732 |
IN |
denotes |
from |
| T3161 |
11733-11742 |
JJ |
denotes |
embryonic |
| T3163 |
11743-11748 |
NN |
denotes |
mouse |
| T3162 |
11749-11753 |
NN |
denotes |
skin |
| T3164 |
11753-11755 |
, |
denotes |
, |
| T3165 |
11755-11758 |
DT |
denotes |
the |
| T3167 |
11759-11767 |
JJ |
denotes |
temporal |
| T3166 |
11768-11778 |
NN |
denotes |
appearance |
| T3169 |
11779-11781 |
IN |
denotes |
of |
| T3170 |
11782-11787 |
WDT |
denotes |
which |
| T3168 |
11788-11800 |
VBD |
denotes |
corresponded |
| T3171 |
11801-11803 |
IN |
denotes |
to |
| T3172 |
11804-11807 |
DT |
denotes |
the |
| T3173 |
11808-11813 |
NNS |
denotes |
waves |
| T3174 |
11814-11816 |
IN |
denotes |
of |
| T3175 |
11817-11821 |
NN |
denotes |
hair |
| T3176 |
11822-11830 |
NN |
denotes |
follicle |
| T3177 |
11831-11844 |
NN |
denotes |
morphogenesis |
| T3178 |
11845-11849 |
IN |
denotes |
from |
| T3179 |
11850-11855 |
NN |
denotes |
E15.5 |
| T3180 |
11856-11858 |
IN |
denotes |
to |
| T3181 |
11859-11866 |
JJ |
denotes |
newborn |
| T3182 |
11867-11871 |
WRB |
denotes |
when |
| T3184 |
11872-11876 |
IN |
denotes |
over |
| T3185 |
11877-11879 |
CD |
denotes |
90 |
| T3186 |
11879-11880 |
NN |
denotes |
% |
| T3187 |
11881-11883 |
IN |
denotes |
of |
| T3188 |
11884-11887 |
DT |
denotes |
the |
| T3189 |
11888-11892 |
NN |
denotes |
hair |
| T3190 |
11893-11895 |
IN |
denotes |
on |
| T3191 |
11896-11899 |
DT |
denotes |
the |
| T3192 |
11900-11905 |
NN |
denotes |
mouse |
| T3193 |
11906-11908 |
VBZ |
denotes |
is |
| T3183 |
11909-11915 |
VBN |
denotes |
formed |
| T3194 |
11916-11917 |
-LRB- |
denotes |
( |
| T3196 |
11917-11923 |
NN |
denotes |
Figure |
| T3195 |
11924-11926 |
NN |
denotes |
1B |
| T3197 |
11926-11927 |
-RRB- |
denotes |
) |
| T3198 |
11927-11928 |
. |
denotes |
. |
| T3199 |
11928-12222 |
sentence |
denotes |
Consistent with the Western blot data, immunohistochemical analysis did not detect Snail in single-layered E13.5 epidermis (Figure 1C) nor in the placode, which is the earliest morphological sign of the commitment of multipotent cells of the embryonic ectoderm to a hair cell fate (Figure 1D). |
| T3200 |
11929-11939 |
JJ |
denotes |
Consistent |
| T3202 |
11940-11944 |
IN |
denotes |
with |
| T3203 |
11945-11948 |
DT |
denotes |
the |
| T3205 |
11949-11956 |
NNP |
denotes |
Western |
| T3206 |
11957-11961 |
NN |
denotes |
blot |
| T3204 |
11962-11966 |
NNS |
denotes |
data |
| T3207 |
11966-11968 |
, |
denotes |
, |
| T3208 |
11968-11987 |
JJ |
denotes |
immunohistochemical |
| T3209 |
11988-11996 |
NN |
denotes |
analysis |
| T3210 |
11997-12000 |
VBD |
denotes |
did |
| T3211 |
12001-12004 |
RB |
denotes |
not |
| T3201 |
12005-12011 |
VB |
denotes |
detect |
| T3212 |
12012-12017 |
NN |
denotes |
Snail |
| T3213 |
12018-12020 |
IN |
denotes |
in |
| T3214 |
12021-12027 |
JJ |
denotes |
single |
| T3216 |
12027-12028 |
HYPH |
denotes |
- |
| T3215 |
12028-12035 |
JJ |
denotes |
layered |
| T3218 |
12036-12041 |
NN |
denotes |
E13.5 |
| T3217 |
12042-12051 |
NN |
denotes |
epidermis |
| T3219 |
12052-12053 |
-LRB- |
denotes |
( |
| T3221 |
12053-12059 |
NN |
denotes |
Figure |
| T3220 |
12060-12062 |
NN |
denotes |
1C |
| T3222 |
12062-12063 |
-RRB- |
denotes |
) |
| T3223 |
12064-12067 |
CC |
denotes |
nor |
| T3224 |
12068-12070 |
IN |
denotes |
in |
| T3225 |
12071-12074 |
DT |
denotes |
the |
| T3226 |
12075-12082 |
NN |
denotes |
placode |
| T3227 |
12082-12084 |
, |
denotes |
, |
| T3228 |
12084-12089 |
WDT |
denotes |
which |
| T3229 |
12090-12092 |
VBZ |
denotes |
is |
| T3230 |
12093-12096 |
DT |
denotes |
the |
| T3232 |
12097-12105 |
JJS |
denotes |
earliest |
| T3233 |
12106-12119 |
JJ |
denotes |
morphological |
| T3231 |
12120-12124 |
NN |
denotes |
sign |
| T3234 |
12125-12127 |
IN |
denotes |
of |
| T3235 |
12128-12131 |
DT |
denotes |
the |
| T3236 |
12132-12142 |
NN |
denotes |
commitment |
| T3237 |
12143-12145 |
IN |
denotes |
of |
| T3238 |
12146-12157 |
JJ |
denotes |
multipotent |
| T3239 |
12158-12163 |
NNS |
denotes |
cells |
| T3240 |
12164-12166 |
IN |
denotes |
of |
| T3241 |
12167-12170 |
DT |
denotes |
the |
| T3243 |
12171-12180 |
JJ |
denotes |
embryonic |
| T3242 |
12181-12189 |
NN |
denotes |
ectoderm |
| T3244 |
12190-12192 |
IN |
denotes |
to |
| T3245 |
12193-12194 |
DT |
denotes |
a |
| T3247 |
12195-12199 |
NN |
denotes |
hair |
| T3248 |
12200-12204 |
NN |
denotes |
cell |
| T3246 |
12205-12209 |
NN |
denotes |
fate |
| T3249 |
12210-12211 |
-LRB- |
denotes |
( |
| T3251 |
12211-12217 |
NN |
denotes |
Figure |
| T3250 |
12218-12220 |
NN |
denotes |
1D |
| T3252 |
12220-12221 |
-RRB- |
denotes |
) |
| T3253 |
12221-12222 |
. |
denotes |
. |
| T3254 |
12222-12384 |
sentence |
denotes |
Consistent with the in situ hybridization results, anti-Snail antibody labeled only hair buds and not follicles at more mature stages of development (Figure 1E). |
| T3255 |
12223-12233 |
JJ |
denotes |
Consistent |
| T3257 |
12234-12238 |
IN |
denotes |
with |
| T3258 |
12239-12242 |
DT |
denotes |
the |
| T3260 |
12243-12245 |
FW |
denotes |
in |
| T3261 |
12246-12250 |
FW |
denotes |
situ |
| T3262 |
12251-12264 |
NN |
denotes |
hybridization |
| T3259 |
12265-12272 |
NNS |
denotes |
results |
| T3263 |
12272-12274 |
, |
denotes |
, |
| T3264 |
12274-12284 |
JJ |
denotes |
anti-Snail |
| T3265 |
12285-12293 |
NN |
denotes |
antibody |
| T3256 |
12294-12301 |
VBD |
denotes |
labeled |
| T3266 |
12302-12306 |
RB |
denotes |
only |
| T3268 |
12307-12311 |
NN |
denotes |
hair |
| T3267 |
12312-12316 |
NNS |
denotes |
buds |
| T3269 |
12317-12320 |
CC |
denotes |
and |
| T3270 |
12321-12324 |
RB |
denotes |
not |
| T3271 |
12325-12334 |
NNS |
denotes |
follicles |
| T3272 |
12335-12337 |
IN |
denotes |
at |
| T3273 |
12338-12342 |
RBR |
denotes |
more |
| T3275 |
12343-12349 |
JJ |
denotes |
mature |
| T3274 |
12350-12356 |
NNS |
denotes |
stages |
| T3276 |
12357-12359 |
IN |
denotes |
of |
| T3277 |
12360-12371 |
NN |
denotes |
development |
| T3278 |
12372-12373 |
-LRB- |
denotes |
( |
| T3280 |
12373-12379 |
NN |
denotes |
Figure |
| T3279 |
12380-12382 |
NN |
denotes |
1E |
| T3281 |
12382-12383 |
-RRB- |
denotes |
) |
| T3282 |
12383-12384 |
. |
denotes |
. |
| T3283 |
12384-12472 |
sentence |
denotes |
Taken together, the anti-Snail antibody appeared to be specific for its target protein. |
| T3284 |
12385-12390 |
VBN |
denotes |
Taken |
| T3286 |
12391-12399 |
RB |
denotes |
together |
| T3287 |
12399-12401 |
, |
denotes |
, |
| T3288 |
12401-12404 |
DT |
denotes |
the |
| T3290 |
12405-12415 |
JJ |
denotes |
anti-Snail |
| T3289 |
12416-12424 |
NN |
denotes |
antibody |
| T3285 |
12425-12433 |
VBD |
denotes |
appeared |
| T3291 |
12434-12436 |
TO |
denotes |
to |
| T3292 |
12437-12439 |
VB |
denotes |
be |
| T3293 |
12440-12448 |
JJ |
denotes |
specific |
| T3294 |
12449-12452 |
IN |
denotes |
for |
| T3295 |
12453-12456 |
PRP$ |
denotes |
its |
| T3297 |
12457-12463 |
NN |
denotes |
target |
| T3296 |
12464-12471 |
NN |
denotes |
protein |
| T3298 |
12471-12472 |
. |
denotes |
. |
| T3299 |
12472-12588 |
sentence |
denotes |
It did not detect other Snail family members known to be expressed in keratinocytes and/or skin (unpublished data). |
| T3300 |
12473-12475 |
PRP |
denotes |
It |
| T3302 |
12476-12479 |
VBD |
denotes |
did |
| T3303 |
12480-12483 |
RB |
denotes |
not |
| T3301 |
12484-12490 |
VB |
denotes |
detect |
| T3304 |
12491-12496 |
JJ |
denotes |
other |
| T3306 |
12497-12502 |
NN |
denotes |
Snail |
| T3307 |
12503-12509 |
NN |
denotes |
family |
| T3305 |
12510-12517 |
NNS |
denotes |
members |
| T3308 |
12518-12523 |
VBN |
denotes |
known |
| T3309 |
12524-12526 |
TO |
denotes |
to |
| T3311 |
12527-12529 |
VB |
denotes |
be |
| T3310 |
12530-12539 |
VBN |
denotes |
expressed |
| T3312 |
12540-12542 |
IN |
denotes |
in |
| T3313 |
12543-12556 |
NNS |
denotes |
keratinocytes |
| T3314 |
12557-12560 |
CC |
denotes |
and |
| T3315 |
12560-12561 |
HYPH |
denotes |
/ |
| T3316 |
12561-12563 |
CC |
denotes |
or |
| T3317 |
12564-12568 |
NN |
denotes |
skin |
| T3318 |
12569-12570 |
-LRB- |
denotes |
( |
| T3320 |
12570-12581 |
JJ |
denotes |
unpublished |
| T3319 |
12582-12586 |
NNS |
denotes |
data |
| T3321 |
12586-12587 |
-RRB- |
denotes |
) |
| T3322 |
12587-12588 |
. |
denotes |
. |
| T3323 |
12588-12750 |
sentence |
denotes |
Furthermore, the immunohistochemical data paralleled our Snail in situ hybridization data revealing transient Snail expression at the hair bud stage (Figure 1A). |
| T3324 |
12589-12600 |
RB |
denotes |
Furthermore |
| T3326 |
12600-12602 |
, |
denotes |
, |
| T3327 |
12602-12605 |
DT |
denotes |
the |
| T3329 |
12606-12625 |
JJ |
denotes |
immunohistochemical |
| T3328 |
12626-12630 |
NNS |
denotes |
data |
| T3325 |
12631-12641 |
VBD |
denotes |
paralleled |
| T3330 |
12642-12645 |
PRP$ |
denotes |
our |
| T3332 |
12646-12651 |
NN |
denotes |
Snail |
| T3334 |
12652-12654 |
FW |
denotes |
in |
| T3335 |
12655-12659 |
FW |
denotes |
situ |
| T3333 |
12660-12673 |
NN |
denotes |
hybridization |
| T3331 |
12674-12678 |
NNS |
denotes |
data |
| T3336 |
12679-12688 |
VBG |
denotes |
revealing |
| T3337 |
12689-12698 |
JJ |
denotes |
transient |
| T3339 |
12699-12704 |
NN |
denotes |
Snail |
| T3338 |
12705-12715 |
NN |
denotes |
expression |
| T3340 |
12716-12718 |
IN |
denotes |
at |
| T3341 |
12719-12722 |
DT |
denotes |
the |
| T3343 |
12723-12727 |
NN |
denotes |
hair |
| T3344 |
12728-12731 |
NN |
denotes |
bud |
| T3342 |
12732-12737 |
NN |
denotes |
stage |
| T3345 |
12738-12739 |
-LRB- |
denotes |
( |
| T3347 |
12739-12745 |
NN |
denotes |
Figure |
| T3346 |
12746-12748 |
NN |
denotes |
1A |
| T3348 |
12748-12749 |
-RRB- |
denotes |
) |
| T3349 |
12749-12750 |
. |
denotes |
. |
| T3350 |
12750-12862 |
sentence |
denotes |
As judged by immunohistochemistry, Snail protein was localized to the nuclei of the hair bud cells (Figure 1E). |
| T3351 |
12751-12753 |
IN |
denotes |
As |
| T3352 |
12754-12760 |
VBN |
denotes |
judged |
| T3354 |
12761-12763 |
IN |
denotes |
by |
| T3355 |
12764-12784 |
NN |
denotes |
immunohistochemistry |
| T3356 |
12784-12786 |
, |
denotes |
, |
| T3357 |
12786-12791 |
NN |
denotes |
Snail |
| T3358 |
12792-12799 |
NN |
denotes |
protein |
| T3359 |
12800-12803 |
VBD |
denotes |
was |
| T3353 |
12804-12813 |
VBN |
denotes |
localized |
| T3360 |
12814-12816 |
IN |
denotes |
to |
| T3361 |
12817-12820 |
DT |
denotes |
the |
| T3362 |
12821-12827 |
NNS |
denotes |
nuclei |
| T3363 |
12828-12830 |
IN |
denotes |
of |
| T3364 |
12831-12834 |
DT |
denotes |
the |
| T3366 |
12835-12839 |
NN |
denotes |
hair |
| T3367 |
12840-12843 |
NN |
denotes |
bud |
| T3365 |
12844-12849 |
NNS |
denotes |
cells |
| T3368 |
12850-12851 |
-LRB- |
denotes |
( |
| T3370 |
12851-12857 |
NN |
denotes |
Figure |
| T3369 |
12858-12860 |
NN |
denotes |
1E |
| T3371 |
12860-12861 |
-RRB- |
denotes |
) |
| T3372 |
12861-12862 |
. |
denotes |
. |
| T3373 |
12862-12958 |
sentence |
denotes |
This feature was consistent with Snail's known function as a transcriptional repressor [12,13]. |
| T3374 |
12863-12867 |
DT |
denotes |
This |
| T3375 |
12868-12875 |
NN |
denotes |
feature |
| T3376 |
12876-12879 |
VBD |
denotes |
was |
| T3377 |
12880-12890 |
JJ |
denotes |
consistent |
| T3378 |
12891-12895 |
IN |
denotes |
with |
| T3379 |
12896-12901 |
NN |
denotes |
Snail |
| T3381 |
12901-12903 |
POS |
denotes |
's |
| T3382 |
12904-12909 |
VBN |
denotes |
known |
| T3380 |
12910-12918 |
NN |
denotes |
function |
| T3383 |
12919-12921 |
IN |
denotes |
as |
| T3384 |
12922-12923 |
DT |
denotes |
a |
| T3386 |
12924-12939 |
JJ |
denotes |
transcriptional |
| T3385 |
12940-12949 |
NN |
denotes |
repressor |
| T3387 |
12950-12951 |
-LRB- |
denotes |
[ |
| T3389 |
12951-12953 |
CD |
denotes |
12 |
| T3390 |
12953-12954 |
, |
denotes |
, |
| T3388 |
12954-12956 |
CD |
denotes |
13 |
| T3391 |
12956-12957 |
-RRB- |
denotes |
] |
| T3392 |
12957-12958 |
. |
denotes |
. |
| T3393 |
12958-13070 |
sentence |
denotes |
Additionally, anti-Snail labeling was detected in only three of the four major waves of follicle morphogenesis. |
| T3394 |
12959-12971 |
RB |
denotes |
Additionally |
| T3396 |
12971-12973 |
, |
denotes |
, |
| T3397 |
12973-12983 |
JJ |
denotes |
anti-Snail |
| T3398 |
12984-12992 |
NN |
denotes |
labeling |
| T3399 |
12993-12996 |
VBD |
denotes |
was |
| T3395 |
12997-13005 |
VBN |
denotes |
detected |
| T3400 |
13006-13008 |
IN |
denotes |
in |
| T3401 |
13009-13013 |
RB |
denotes |
only |
| T3403 |
13014-13019 |
CD |
denotes |
three |
| T3404 |
13020-13022 |
IN |
denotes |
of |
| T3405 |
13023-13026 |
DT |
denotes |
the |
| T3402 |
13027-13031 |
CD |
denotes |
four |
| T3407 |
13032-13037 |
JJ |
denotes |
major |
| T3406 |
13038-13043 |
NNS |
denotes |
waves |
| T3408 |
13044-13046 |
IN |
denotes |
of |
| T3409 |
13047-13055 |
NN |
denotes |
follicle |
| T3410 |
13056-13069 |
NN |
denotes |
morphogenesis |
| T3411 |
13069-13070 |
. |
denotes |
. |
| T3412 |
13070-13244 |
sentence |
denotes |
Snail was not found in the buds of guard hairs that are the earliest of all hairs to form (at E13.5), and which constitute less than 5% of the mouse coat (unpublished data). |
| T3413 |
13071-13076 |
NN |
denotes |
Snail |
| T3415 |
13077-13080 |
VBD |
denotes |
was |
| T3416 |
13081-13084 |
RB |
denotes |
not |
| T3414 |
13085-13090 |
VBN |
denotes |
found |
| T3417 |
13091-13093 |
IN |
denotes |
in |
| T3418 |
13094-13097 |
DT |
denotes |
the |
| T3419 |
13098-13102 |
NNS |
denotes |
buds |
| T3420 |
13103-13105 |
IN |
denotes |
of |
| T3421 |
13106-13111 |
NN |
denotes |
guard |
| T3422 |
13112-13117 |
NNS |
denotes |
hairs |
| T3423 |
13118-13122 |
WDT |
denotes |
that |
| T3424 |
13123-13126 |
VBP |
denotes |
are |
| T3425 |
13127-13130 |
DT |
denotes |
the |
| T3426 |
13131-13139 |
JJS |
denotes |
earliest |
| T3427 |
13140-13142 |
IN |
denotes |
of |
| T3428 |
13143-13146 |
DT |
denotes |
all |
| T3429 |
13147-13152 |
NNS |
denotes |
hairs |
| T3430 |
13153-13155 |
TO |
denotes |
to |
| T3431 |
13156-13160 |
VB |
denotes |
form |
| T3432 |
13161-13162 |
-LRB- |
denotes |
( |
| T3433 |
13162-13164 |
IN |
denotes |
at |
| T3434 |
13165-13170 |
NN |
denotes |
E13.5 |
| T3435 |
13170-13171 |
-RRB- |
denotes |
) |
| T3436 |
13171-13173 |
, |
denotes |
, |
| T3437 |
13173-13176 |
CC |
denotes |
and |
| T3438 |
13177-13182 |
WDT |
denotes |
which |
| T3439 |
13183-13193 |
VBP |
denotes |
constitute |
| T3440 |
13194-13198 |
JJR |
denotes |
less |
| T3442 |
13199-13203 |
IN |
denotes |
than |
| T3441 |
13204-13205 |
CD |
denotes |
5 |
| T3443 |
13205-13206 |
NN |
denotes |
% |
| T3444 |
13207-13209 |
IN |
denotes |
of |
| T3445 |
13210-13213 |
DT |
denotes |
the |
| T3447 |
13214-13219 |
NN |
denotes |
mouse |
| T3446 |
13220-13224 |
NN |
denotes |
coat |
| T3448 |
13225-13226 |
-LRB- |
denotes |
( |
| T3450 |
13226-13237 |
JJ |
denotes |
unpublished |
| T3449 |
13238-13242 |
NNS |
denotes |
data |
| T3451 |
13242-13243 |
-RRB- |
denotes |
) |
| T3452 |
13243-13244 |
. |
denotes |
. |
| T3453 |
13244-13485 |
sentence |
denotes |
As judged by immunofluorescence with antibodies against the proliferating nuclear antigen Ki67, the timing of Snail expression coincided with the stage at which the developing follicle enhanced its proliferation and down-growth (Figure 1F). |
| T3454 |
13245-13247 |
IN |
denotes |
As |
| T3455 |
13248-13254 |
VBN |
denotes |
judged |
| T3457 |
13255-13257 |
IN |
denotes |
by |
| T3458 |
13258-13276 |
NN |
denotes |
immunofluorescence |
| T3459 |
13277-13281 |
IN |
denotes |
with |
| T3460 |
13282-13292 |
NNS |
denotes |
antibodies |
| T3461 |
13293-13300 |
IN |
denotes |
against |
| T3462 |
13301-13304 |
DT |
denotes |
the |
| T3464 |
13305-13318 |
VBG |
denotes |
proliferating |
| T3465 |
13319-13326 |
JJ |
denotes |
nuclear |
| T3463 |
13327-13334 |
NN |
denotes |
antigen |
| T3466 |
13335-13339 |
NN |
denotes |
Ki67 |
| T3467 |
13339-13341 |
, |
denotes |
, |
| T3468 |
13341-13344 |
DT |
denotes |
the |
| T3469 |
13345-13351 |
NN |
denotes |
timing |
| T3470 |
13352-13354 |
IN |
denotes |
of |
| T3471 |
13355-13360 |
NN |
denotes |
Snail |
| T3472 |
13361-13371 |
NN |
denotes |
expression |
| T3456 |
13372-13381 |
VBD |
denotes |
coincided |
| T3473 |
13382-13386 |
IN |
denotes |
with |
| T3474 |
13387-13390 |
DT |
denotes |
the |
| T3475 |
13391-13396 |
NN |
denotes |
stage |
| T3476 |
13397-13399 |
IN |
denotes |
at |
| T3478 |
13400-13405 |
WDT |
denotes |
which |
| T3479 |
13406-13409 |
DT |
denotes |
the |
| T3481 |
13410-13420 |
VBG |
denotes |
developing |
| T3480 |
13421-13429 |
NN |
denotes |
follicle |
| T3477 |
13430-13438 |
VBD |
denotes |
enhanced |
| T3482 |
13439-13442 |
PRP$ |
denotes |
its |
| T3483 |
13443-13456 |
NN |
denotes |
proliferation |
| T3484 |
13457-13460 |
CC |
denotes |
and |
| T3485 |
13461-13465 |
JJ |
denotes |
down |
| T3487 |
13465-13466 |
HYPH |
denotes |
- |
| T3486 |
13466-13472 |
NN |
denotes |
growth |
| T3488 |
13473-13474 |
-LRB- |
denotes |
( |
| T3490 |
13474-13480 |
NN |
denotes |
Figure |
| T3489 |
13481-13483 |
NN |
denotes |
1F |
| T3491 |
13483-13484 |
-RRB- |
denotes |
) |
| T3492 |
13484-13485 |
. |
denotes |
. |
| T3493 |
13485-13707 |
sentence |
denotes |
Immunohistochemistry with antibodies against the active (phosphorylated) form of MAPK (pMAPK) marked a subset of the proliferating (Ki67-positive) cells, and pMAPK-positive cells were enriched in the hair bud (Figure 1G). |
| T3494 |
13486-13506 |
NN |
denotes |
Immunohistochemistry |
| T3496 |
13507-13511 |
IN |
denotes |
with |
| T3497 |
13512-13522 |
NNS |
denotes |
antibodies |
| T3498 |
13523-13530 |
IN |
denotes |
against |
| T3499 |
13531-13534 |
DT |
denotes |
the |
| T3501 |
13535-13541 |
JJ |
denotes |
active |
| T3502 |
13542-13543 |
-LRB- |
denotes |
( |
| T3503 |
13543-13557 |
VBN |
denotes |
phosphorylated |
| T3504 |
13557-13558 |
-RRB- |
denotes |
) |
| T3500 |
13559-13563 |
NN |
denotes |
form |
| T3505 |
13564-13566 |
IN |
denotes |
of |
| T3506 |
13567-13571 |
NN |
denotes |
MAPK |
| T3507 |
13572-13573 |
-LRB- |
denotes |
( |
| T3508 |
13573-13578 |
NN |
denotes |
pMAPK |
| T3509 |
13578-13579 |
-RRB- |
denotes |
) |
| T3495 |
13580-13586 |
VBD |
denotes |
marked |
| T3510 |
13587-13588 |
DT |
denotes |
a |
| T3511 |
13589-13595 |
NN |
denotes |
subset |
| T3512 |
13596-13598 |
IN |
denotes |
of |
| T3513 |
13599-13602 |
DT |
denotes |
the |
| T3515 |
13603-13616 |
VBG |
denotes |
proliferating |
| T3516 |
13617-13618 |
-LRB- |
denotes |
( |
| T3517 |
13618-13622 |
NN |
denotes |
Ki67 |
| T3519 |
13622-13623 |
HYPH |
denotes |
- |
| T3518 |
13623-13631 |
JJ |
denotes |
positive |
| T3520 |
13631-13632 |
-RRB- |
denotes |
) |
| T3514 |
13633-13638 |
NNS |
denotes |
cells |
| T3521 |
13638-13640 |
, |
denotes |
, |
| T3522 |
13640-13643 |
CC |
denotes |
and |
| T3523 |
13644-13649 |
NN |
denotes |
pMAPK |
| T3525 |
13649-13650 |
HYPH |
denotes |
- |
| T3524 |
13650-13658 |
JJ |
denotes |
positive |
| T3526 |
13659-13664 |
NNS |
denotes |
cells |
| T3528 |
13665-13669 |
VBD |
denotes |
were |
| T3527 |
13670-13678 |
VBN |
denotes |
enriched |
| T3529 |
13679-13681 |
IN |
denotes |
in |
| T3530 |
13682-13685 |
DT |
denotes |
the |
| T3532 |
13686-13690 |
NN |
denotes |
hair |
| T3531 |
13691-13694 |
NN |
denotes |
bud |
| T3533 |
13695-13696 |
-LRB- |
denotes |
( |
| T3535 |
13696-13702 |
NN |
denotes |
Figure |
| T3534 |
13703-13705 |
NN |
denotes |
1G |
| T3536 |
13705-13706 |
-RRB- |
denotes |
) |
| T3537 |
13706-13707 |
. |
denotes |
. |
| T3538 |
13707-13903 |
sentence |
denotes |
The timing of Snail induction and Ki67 and pMAPK enrichment in the hair bud appeared to follow closely the induction of LEF-1/β-catenin activity, known to initiate in the hair placode stage [20]. |
| T3539 |
13708-13711 |
DT |
denotes |
The |
| T3540 |
13712-13718 |
NN |
denotes |
timing |
| T3542 |
13719-13721 |
IN |
denotes |
of |
| T3543 |
13722-13727 |
NN |
denotes |
Snail |
| T3544 |
13728-13737 |
NN |
denotes |
induction |
| T3545 |
13738-13741 |
CC |
denotes |
and |
| T3546 |
13742-13746 |
NN |
denotes |
Ki67 |
| T3548 |
13747-13750 |
CC |
denotes |
and |
| T3549 |
13751-13756 |
NN |
denotes |
pMAPK |
| T3547 |
13757-13767 |
NN |
denotes |
enrichment |
| T3550 |
13768-13770 |
IN |
denotes |
in |
| T3551 |
13771-13774 |
DT |
denotes |
the |
| T3553 |
13775-13779 |
NN |
denotes |
hair |
| T3552 |
13780-13783 |
NN |
denotes |
bud |
| T3541 |
13784-13792 |
VBD |
denotes |
appeared |
| T3554 |
13793-13795 |
TO |
denotes |
to |
| T3555 |
13796-13802 |
VB |
denotes |
follow |
| T3556 |
13803-13810 |
RB |
denotes |
closely |
| T3557 |
13811-13814 |
DT |
denotes |
the |
| T3558 |
13815-13824 |
NN |
denotes |
induction |
| T3559 |
13825-13827 |
IN |
denotes |
of |
| T3560 |
13828-13831 |
NN |
denotes |
LEF |
| T3562 |
13831-13832 |
HYPH |
denotes |
- |
| T3563 |
13832-13833 |
CD |
denotes |
1 |
| T3564 |
13833-13834 |
HYPH |
denotes |
/ |
| T3565 |
13834-13835 |
NN |
denotes |
β |
| T3567 |
13835-13836 |
HYPH |
denotes |
- |
| T3566 |
13836-13843 |
NN |
denotes |
catenin |
| T3561 |
13844-13852 |
NN |
denotes |
activity |
| T3568 |
13852-13854 |
, |
denotes |
, |
| T3569 |
13854-13859 |
VBN |
denotes |
known |
| T3570 |
13860-13862 |
TO |
denotes |
to |
| T3571 |
13863-13871 |
VB |
denotes |
initiate |
| T3572 |
13872-13874 |
IN |
denotes |
in |
| T3573 |
13875-13878 |
DT |
denotes |
the |
| T3575 |
13879-13883 |
NN |
denotes |
hair |
| T3576 |
13884-13891 |
NN |
denotes |
placode |
| T3574 |
13892-13897 |
NN |
denotes |
stage |
| T3577 |
13898-13899 |
-LRB- |
denotes |
[ |
| T3578 |
13899-13901 |
CD |
denotes |
20 |
| T3579 |
13901-13902 |
-RRB- |
denotes |
] |
| T3580 |
13902-13903 |
. |
denotes |
. |
| T3581 |
13903-14015 |
sentence |
denotes |
However, like placodes, hair buds exhibited down-regulation in E-cadherin expression (Figure 1H; see also [4]). |
| T3582 |
13904-13911 |
RB |
denotes |
However |
| T3584 |
13911-13913 |
, |
denotes |
, |
| T3585 |
13913-13917 |
IN |
denotes |
like |
| T3586 |
13918-13926 |
NNS |
denotes |
placodes |
| T3587 |
13926-13928 |
, |
denotes |
, |
| T3588 |
13928-13932 |
NN |
denotes |
hair |
| T3589 |
13933-13937 |
NNS |
denotes |
buds |
| T3583 |
13938-13947 |
VBD |
denotes |
exhibited |
| T3590 |
13948-13952 |
JJ |
denotes |
down |
| T3592 |
13952-13953 |
HYPH |
denotes |
- |
| T3591 |
13953-13963 |
NN |
denotes |
regulation |
| T3593 |
13964-13966 |
IN |
denotes |
in |
| T3594 |
13967-13968 |
NN |
denotes |
E |
| T3596 |
13968-13969 |
HYPH |
denotes |
- |
| T3595 |
13969-13977 |
NN |
denotes |
cadherin |
| T3597 |
13978-13988 |
NN |
denotes |
expression |
| T3598 |
13989-13990 |
-LRB- |
denotes |
( |
| T3600 |
13990-13996 |
NN |
denotes |
Figure |
| T3599 |
13997-13999 |
NN |
denotes |
1H |
| T3601 |
13999-14000 |
: |
denotes |
; |
| T3602 |
14001-14004 |
VB |
denotes |
see |
| T3603 |
14005-14009 |
RB |
denotes |
also |
| T3604 |
14010-14011 |
-LRB- |
denotes |
[ |
| T3605 |
14011-14012 |
CD |
denotes |
4 |
| T3606 |
14012-14013 |
-RRB- |
denotes |
] |
| T3607 |
14013-14014 |
-RRB- |
denotes |
) |
| T3608 |
14014-14015 |
. |
denotes |
. |
| T3910 |
14017-14026 |
JJ |
denotes |
Sustained |
| T3911 |
14027-14037 |
NN |
denotes |
Expression |
| T3913 |
14038-14040 |
IN |
denotes |
of |
| T3914 |
14041-14046 |
NN |
denotes |
Snail |
| T3912 |
14047-14054 |
VBZ |
denotes |
Results |
| T3915 |
14055-14057 |
IN |
denotes |
in |
| T3916 |
14058-14067 |
JJ |
denotes |
Epidermal |
| T3917 |
14068-14086 |
NN |
denotes |
Hyperproliferation |
| T3918 |
14087-14090 |
CC |
denotes |
and |
| T3919 |
14091-14106 |
NN |
denotes |
Differentiation |
| T3920 |
14107-14114 |
NNS |
denotes |
Defects |
| T3921 |
14115-14117 |
IN |
denotes |
in |
| T3922 |
14118-14120 |
NN |
denotes |
Tg |
| T3924 |
14121-14126 |
NN |
denotes |
Mouse |
| T3923 |
14127-14131 |
NN |
denotes |
Skin |
| T3925 |
14131-14339 |
sentence |
denotes |
The striking spike of Snail expression coincident with hair bud formation and enhanced proliferation prompted us to examine the consequences of ectopically expressing Snail elsewhere in mouse skin epidermis. |
| T3926 |
14132-14135 |
DT |
denotes |
The |
| T3928 |
14136-14144 |
JJ |
denotes |
striking |
| T3927 |
14145-14150 |
NN |
denotes |
spike |
| T3930 |
14151-14153 |
IN |
denotes |
of |
| T3931 |
14154-14159 |
NN |
denotes |
Snail |
| T3932 |
14160-14170 |
NN |
denotes |
expression |
| T3933 |
14171-14181 |
JJ |
denotes |
coincident |
| T3934 |
14182-14186 |
IN |
denotes |
with |
| T3935 |
14187-14191 |
NN |
denotes |
hair |
| T3936 |
14192-14195 |
NN |
denotes |
bud |
| T3937 |
14196-14205 |
NN |
denotes |
formation |
| T3938 |
14206-14209 |
CC |
denotes |
and |
| T3939 |
14210-14218 |
VBN |
denotes |
enhanced |
| T3940 |
14219-14232 |
NN |
denotes |
proliferation |
| T3929 |
14233-14241 |
VBD |
denotes |
prompted |
| T3941 |
14242-14244 |
PRP |
denotes |
us |
| T3942 |
14245-14247 |
TO |
denotes |
to |
| T3943 |
14248-14255 |
VB |
denotes |
examine |
| T3944 |
14256-14259 |
DT |
denotes |
the |
| T3945 |
14260-14272 |
NNS |
denotes |
consequences |
| T3946 |
14273-14275 |
IN |
denotes |
of |
| T3947 |
14276-14287 |
RB |
denotes |
ectopically |
| T3948 |
14288-14298 |
VBG |
denotes |
expressing |
| T3949 |
14299-14304 |
NN |
denotes |
Snail |
| T3950 |
14305-14314 |
RB |
denotes |
elsewhere |
| T3951 |
14315-14317 |
IN |
denotes |
in |
| T3952 |
14318-14323 |
NN |
denotes |
mouse |
| T3954 |
14324-14328 |
NN |
denotes |
skin |
| T3953 |
14329-14338 |
NN |
denotes |
epidermis |
| T3955 |
14338-14339 |
. |
denotes |
. |
| T3956 |
14339-14473 |
sentence |
denotes |
To distinguish Tg from endogenous Snail, we used the HA-epitope, shown previously not to alter Snail's transcriptional activity [12]. |
| T3957 |
14340-14342 |
TO |
denotes |
To |
| T3958 |
14343-14354 |
VB |
denotes |
distinguish |
| T3960 |
14355-14357 |
NN |
denotes |
Tg |
| T3961 |
14358-14362 |
IN |
denotes |
from |
| T3962 |
14363-14373 |
JJ |
denotes |
endogenous |
| T3963 |
14374-14379 |
NN |
denotes |
Snail |
| T3964 |
14379-14381 |
, |
denotes |
, |
| T3965 |
14381-14383 |
PRP |
denotes |
we |
| T3959 |
14384-14388 |
VBD |
denotes |
used |
| T3966 |
14389-14392 |
DT |
denotes |
the |
| T3968 |
14393-14395 |
NN |
denotes |
HA |
| T3969 |
14395-14396 |
HYPH |
denotes |
- |
| T3967 |
14396-14403 |
NN |
denotes |
epitope |
| T3970 |
14403-14405 |
, |
denotes |
, |
| T3971 |
14405-14410 |
VBN |
denotes |
shown |
| T3972 |
14411-14421 |
RB |
denotes |
previously |
| T3973 |
14422-14425 |
RB |
denotes |
not |
| T3975 |
14426-14428 |
TO |
denotes |
to |
| T3974 |
14429-14434 |
VB |
denotes |
alter |
| T3976 |
14435-14440 |
NNP |
denotes |
Snail |
| T3978 |
14440-14442 |
POS |
denotes |
's |
| T3979 |
14443-14458 |
JJ |
denotes |
transcriptional |
| T3977 |
14459-14467 |
NN |
denotes |
activity |
| T3980 |
14468-14469 |
-LRB- |
denotes |
[ |
| T3981 |
14469-14471 |
CD |
denotes |
12 |
| T3982 |
14471-14472 |
-RRB- |
denotes |
] |
| T3983 |
14472-14473 |
. |
denotes |
. |
| T3984 |
14473-14585 |
sentence |
denotes |
Of 20 K14-Snail[HA] Tg animals generated, three expressed the transgene and all exhibited analogous phenotypes. |
| T3985 |
14474-14476 |
IN |
denotes |
Of |
| T3987 |
14477-14479 |
CD |
denotes |
20 |
| T3989 |
14480-14483 |
NN |
denotes |
K14 |
| T3991 |
14483-14484 |
HYPH |
denotes |
- |
| T3990 |
14484-14489 |
NN |
denotes |
Snail |
| T3992 |
14489-14490 |
-LRB- |
denotes |
[ |
| T3993 |
14490-14492 |
NN |
denotes |
HA |
| T3994 |
14492-14493 |
-RRB- |
denotes |
] |
| T3995 |
14494-14496 |
NN |
denotes |
Tg |
| T3988 |
14497-14504 |
NNS |
denotes |
animals |
| T3996 |
14505-14514 |
VBN |
denotes |
generated |
| T3997 |
14514-14516 |
, |
denotes |
, |
| T3998 |
14516-14521 |
CD |
denotes |
three |
| T3986 |
14522-14531 |
VBD |
denotes |
expressed |
| T3999 |
14532-14535 |
DT |
denotes |
the |
| T4000 |
14536-14545 |
NN |
denotes |
transgene |
| T4001 |
14546-14549 |
CC |
denotes |
and |
| T4002 |
14550-14553 |
DT |
denotes |
all |
| T4003 |
14554-14563 |
VBD |
denotes |
exhibited |
| T4004 |
14564-14573 |
JJ |
denotes |
analogous |
| T4005 |
14574-14584 |
NNS |
denotes |
phenotypes |
| T4006 |
14584-14585 |
. |
denotes |
. |
| T4007 |
14585-14677 |
sentence |
denotes |
Mice that integrated the transgene at the single-cell stage died at or shortly after birth. |
| T4008 |
14586-14590 |
NNS |
denotes |
Mice |
| T4010 |
14591-14595 |
WDT |
denotes |
that |
| T4011 |
14596-14606 |
VBD |
denotes |
integrated |
| T4012 |
14607-14610 |
DT |
denotes |
the |
| T4013 |
14611-14620 |
NN |
denotes |
transgene |
| T4014 |
14621-14623 |
IN |
denotes |
at |
| T4015 |
14624-14627 |
DT |
denotes |
the |
| T4017 |
14628-14634 |
JJ |
denotes |
single |
| T4019 |
14634-14635 |
HYPH |
denotes |
- |
| T4018 |
14635-14639 |
NN |
denotes |
cell |
| T4016 |
14640-14645 |
NN |
denotes |
stage |
| T4009 |
14646-14650 |
VBD |
denotes |
died |
| T4020 |
14651-14653 |
IN |
denotes |
at |
| T4021 |
14654-14656 |
CC |
denotes |
or |
| T4022 |
14657-14664 |
RB |
denotes |
shortly |
| T4023 |
14665-14670 |
IN |
denotes |
after |
| T4024 |
14671-14676 |
NN |
denotes |
birth |
| T4025 |
14676-14677 |
. |
denotes |
. |
| T4026 |
14677-14834 |
sentence |
denotes |
The three surviving full-Tg founder mice harbored transgene integrations that gave stable transmission of mosaic Snail gene expression through the germline. |
| T4027 |
14678-14681 |
DT |
denotes |
The |
| T4029 |
14682-14687 |
CD |
denotes |
three |
| T4030 |
14688-14697 |
VBG |
denotes |
surviving |
| T4031 |
14698-14702 |
JJ |
denotes |
full |
| T4033 |
14702-14703 |
HYPH |
denotes |
- |
| T4032 |
14703-14705 |
NN |
denotes |
Tg |
| T4034 |
14706-14713 |
NN |
denotes |
founder |
| T4028 |
14714-14718 |
NNS |
denotes |
mice |
| T4035 |
14719-14727 |
VBD |
denotes |
harbored |
| T4036 |
14728-14737 |
NN |
denotes |
transgene |
| T4037 |
14738-14750 |
NNS |
denotes |
integrations |
| T4038 |
14751-14755 |
WDT |
denotes |
that |
| T4039 |
14756-14760 |
VBD |
denotes |
gave |
| T4040 |
14761-14767 |
JJ |
denotes |
stable |
| T4041 |
14768-14780 |
NN |
denotes |
transmission |
| T4042 |
14781-14783 |
IN |
denotes |
of |
| T4043 |
14784-14790 |
JJ |
denotes |
mosaic |
| T4045 |
14791-14796 |
NN |
denotes |
Snail |
| T4044 |
14797-14801 |
NN |
denotes |
gene |
| T4046 |
14802-14812 |
NN |
denotes |
expression |
| T4047 |
14813-14820 |
IN |
denotes |
through |
| T4048 |
14821-14824 |
DT |
denotes |
the |
| T4049 |
14825-14833 |
NN |
denotes |
germline |
| T4050 |
14833-14834 |
. |
denotes |
. |
| T4051 |
14834-14945 |
sentence |
denotes |
Progressively poor health necessitated our sacrificing most offspring from these lines within a year of birth. |
| T4052 |
14835-14848 |
RB |
denotes |
Progressively |
| T4053 |
14849-14853 |
JJ |
denotes |
poor |
| T4054 |
14854-14860 |
NN |
denotes |
health |
| T4055 |
14861-14873 |
VBD |
denotes |
necessitated |
| T4056 |
14874-14877 |
PRP$ |
denotes |
our |
| T4057 |
14878-14889 |
VBG |
denotes |
sacrificing |
| T4058 |
14890-14894 |
JJS |
denotes |
most |
| T4059 |
14895-14904 |
NN |
denotes |
offspring |
| T4060 |
14905-14909 |
IN |
denotes |
from |
| T4061 |
14910-14915 |
DT |
denotes |
these |
| T4062 |
14916-14921 |
NNS |
denotes |
lines |
| T4063 |
14922-14928 |
IN |
denotes |
within |
| T4064 |
14929-14930 |
DT |
denotes |
a |
| T4065 |
14931-14935 |
NN |
denotes |
year |
| T4066 |
14936-14938 |
IN |
denotes |
of |
| T4067 |
14939-14944 |
NN |
denotes |
birth |
| T4068 |
14944-14945 |
. |
denotes |
. |
| T4069 |
14945-15059 |
sentence |
denotes |
As Snail Tg animals grew, they became distinguished by their small size, short tails, and flaky skin (Figure 2A). |
| T4070 |
14946-14948 |
IN |
denotes |
As |
| T4072 |
14949-14954 |
NN |
denotes |
Snail |
| T4074 |
14955-14957 |
NN |
denotes |
Tg |
| T4073 |
14958-14965 |
NNS |
denotes |
animals |
| T4071 |
14966-14970 |
VBD |
denotes |
grew |
| T4076 |
14970-14972 |
, |
denotes |
, |
| T4077 |
14972-14976 |
PRP |
denotes |
they |
| T4075 |
14977-14983 |
VBD |
denotes |
became |
| T4078 |
14984-14997 |
JJ |
denotes |
distinguished |
| T4079 |
14998-15000 |
IN |
denotes |
by |
| T4080 |
15001-15006 |
PRP$ |
denotes |
their |
| T4082 |
15007-15012 |
JJ |
denotes |
small |
| T4081 |
15013-15017 |
NN |
denotes |
size |
| T4083 |
15017-15019 |
, |
denotes |
, |
| T4084 |
15019-15024 |
JJ |
denotes |
short |
| T4085 |
15025-15030 |
NNS |
denotes |
tails |
| T4086 |
15030-15032 |
, |
denotes |
, |
| T4087 |
15032-15035 |
CC |
denotes |
and |
| T4088 |
15036-15041 |
JJ |
denotes |
flaky |
| T4089 |
15042-15046 |
NN |
denotes |
skin |
| T4090 |
15047-15048 |
-LRB- |
denotes |
( |
| T4092 |
15048-15054 |
NN |
denotes |
Figure |
| T4091 |
15055-15057 |
NN |
denotes |
2A |
| T4093 |
15057-15058 |
-RRB- |
denotes |
) |
| T4094 |
15058-15059 |
. |
denotes |
. |
| T4095 |
15059-15170 |
sentence |
denotes |
Histological analyses of 3-d old (P3) mice revealed mosaic patches marked by epidermal thickening (Figure 2B). |
| T4096 |
15060-15072 |
JJ |
denotes |
Histological |
| T4097 |
15073-15081 |
NNS |
denotes |
analyses |
| T4099 |
15082-15084 |
IN |
denotes |
of |
| T4100 |
15085-15086 |
CD |
denotes |
3 |
| T4102 |
15086-15087 |
HYPH |
denotes |
- |
| T4101 |
15087-15088 |
NN |
denotes |
d |
| T4103 |
15089-15092 |
JJ |
denotes |
old |
| T4105 |
15093-15094 |
-LRB- |
denotes |
( |
| T4106 |
15094-15096 |
JJ |
denotes |
P3 |
| T4107 |
15096-15097 |
-RRB- |
denotes |
) |
| T4104 |
15098-15102 |
NNS |
denotes |
mice |
| T4098 |
15103-15111 |
VBD |
denotes |
revealed |
| T4108 |
15112-15118 |
NN |
denotes |
mosaic |
| T4109 |
15119-15126 |
NNS |
denotes |
patches |
| T4110 |
15127-15133 |
VBN |
denotes |
marked |
| T4111 |
15134-15136 |
IN |
denotes |
by |
| T4112 |
15137-15146 |
JJ |
denotes |
epidermal |
| T4113 |
15147-15157 |
NN |
denotes |
thickening |
| T4114 |
15158-15159 |
-LRB- |
denotes |
( |
| T4116 |
15159-15165 |
NN |
denotes |
Figure |
| T4115 |
15166-15168 |
NN |
denotes |
2B |
| T4117 |
15168-15169 |
-RRB- |
denotes |
) |
| T4118 |
15169-15170 |
. |
denotes |
. |
| T4119 |
15170-15325 |
sentence |
denotes |
The mosaic morphology was reflected at the level of Tg Snail protein, with only the hyperthickened regions expressing nuclear HA-tagged Snail (Figure 2C). |
| T4120 |
15171-15174 |
DT |
denotes |
The |
| T4122 |
15175-15181 |
NN |
denotes |
mosaic |
| T4121 |
15182-15192 |
NN |
denotes |
morphology |
| T4124 |
15193-15196 |
VBD |
denotes |
was |
| T4123 |
15197-15206 |
VBN |
denotes |
reflected |
| T4125 |
15207-15209 |
IN |
denotes |
at |
| T4126 |
15210-15213 |
DT |
denotes |
the |
| T4127 |
15214-15219 |
NN |
denotes |
level |
| T4128 |
15220-15222 |
IN |
denotes |
of |
| T4129 |
15223-15225 |
NN |
denotes |
Tg |
| T4131 |
15226-15231 |
NN |
denotes |
Snail |
| T4130 |
15232-15239 |
NN |
denotes |
protein |
| T4132 |
15239-15241 |
, |
denotes |
, |
| T4133 |
15241-15245 |
IN |
denotes |
with |
| T4135 |
15246-15250 |
RB |
denotes |
only |
| T4137 |
15251-15254 |
DT |
denotes |
the |
| T4138 |
15255-15269 |
VBN |
denotes |
hyperthickened |
| T4136 |
15270-15277 |
NNS |
denotes |
regions |
| T4134 |
15278-15288 |
VBG |
denotes |
expressing |
| T4139 |
15289-15296 |
JJ |
denotes |
nuclear |
| T4141 |
15297-15299 |
NN |
denotes |
HA |
| T4143 |
15299-15300 |
HYPH |
denotes |
- |
| T4142 |
15300-15306 |
VBN |
denotes |
tagged |
| T4140 |
15307-15312 |
NN |
denotes |
Snail |
| T4144 |
15313-15314 |
-LRB- |
denotes |
( |
| T4146 |
15314-15320 |
NN |
denotes |
Figure |
| T4145 |
15321-15323 |
NN |
denotes |
2C |
| T4147 |
15323-15324 |
-RRB- |
denotes |
) |
| T4148 |
15324-15325 |
. |
denotes |
. |
| T4149 |
15325-15485 |
sentence |
denotes |
These hyperthickened areas were marked by excessive proliferation, as revealed by antibodies against the proliferating nuclear antigen Ki67 (Figure 2D and 2E). |
| T4150 |
15326-15331 |
DT |
denotes |
These |
| T4152 |
15332-15346 |
VBN |
denotes |
hyperthickened |
| T4151 |
15347-15352 |
NNS |
denotes |
areas |
| T4154 |
15353-15357 |
VBD |
denotes |
were |
| T4153 |
15358-15364 |
VBN |
denotes |
marked |
| T4155 |
15365-15367 |
IN |
denotes |
by |
| T4156 |
15368-15377 |
JJ |
denotes |
excessive |
| T4157 |
15378-15391 |
NN |
denotes |
proliferation |
| T4158 |
15391-15393 |
, |
denotes |
, |
| T4159 |
15393-15395 |
IN |
denotes |
as |
| T4160 |
15396-15404 |
VBN |
denotes |
revealed |
| T4161 |
15405-15407 |
IN |
denotes |
by |
| T4162 |
15408-15418 |
NNS |
denotes |
antibodies |
| T4163 |
15419-15426 |
IN |
denotes |
against |
| T4164 |
15427-15430 |
DT |
denotes |
the |
| T4166 |
15431-15444 |
VBG |
denotes |
proliferating |
| T4167 |
15445-15452 |
JJ |
denotes |
nuclear |
| T4165 |
15453-15460 |
NN |
denotes |
antigen |
| T4168 |
15461-15465 |
NN |
denotes |
Ki67 |
| T4169 |
15466-15467 |
-LRB- |
denotes |
( |
| T4171 |
15467-15473 |
NN |
denotes |
Figure |
| T4170 |
15474-15476 |
NN |
denotes |
2D |
| T4172 |
15477-15480 |
CC |
denotes |
and |
| T4173 |
15481-15483 |
NN |
denotes |
2E |
| T4174 |
15483-15484 |
-RRB- |
denotes |
) |
| T4175 |
15484-15485 |
. |
denotes |
. |
| T4176 |
15485-15698 |
sentence |
denotes |
Activated, pMAPK-positive cells were also prevalent in these areas (Figure 2F and 2G), as were cells expressing keratin 6, a keratin induced in the suprabasal layers of hyperproliferative skin (Figure 2H and 2I). |
| T4177 |
15486-15495 |
VBN |
denotes |
Activated |
| T4179 |
15495-15497 |
, |
denotes |
, |
| T4180 |
15497-15502 |
NN |
denotes |
pMAPK |
| T4182 |
15502-15503 |
HYPH |
denotes |
- |
| T4181 |
15503-15511 |
JJ |
denotes |
positive |
| T4178 |
15512-15517 |
NNS |
denotes |
cells |
| T4183 |
15518-15522 |
VBD |
denotes |
were |
| T4184 |
15523-15527 |
RB |
denotes |
also |
| T4185 |
15528-15537 |
JJ |
denotes |
prevalent |
| T4186 |
15538-15540 |
IN |
denotes |
in |
| T4187 |
15541-15546 |
DT |
denotes |
these |
| T4188 |
15547-15552 |
NNS |
denotes |
areas |
| T4189 |
15553-15554 |
-LRB- |
denotes |
( |
| T4191 |
15554-15560 |
NN |
denotes |
Figure |
| T4190 |
15561-15563 |
NN |
denotes |
2F |
| T4192 |
15564-15567 |
CC |
denotes |
and |
| T4193 |
15568-15570 |
NN |
denotes |
2G |
| T4194 |
15570-15571 |
-RRB- |
denotes |
) |
| T4195 |
15571-15573 |
, |
denotes |
, |
| T4196 |
15573-15575 |
IN |
denotes |
as |
| T4197 |
15576-15580 |
VBD |
denotes |
were |
| T4198 |
15581-15586 |
NNS |
denotes |
cells |
| T4199 |
15587-15597 |
VBG |
denotes |
expressing |
| T4200 |
15598-15605 |
NN |
denotes |
keratin |
| T4201 |
15606-15607 |
CD |
denotes |
6 |
| T4202 |
15607-15609 |
, |
denotes |
, |
| T4203 |
15609-15610 |
DT |
denotes |
a |
| T4204 |
15611-15618 |
NN |
denotes |
keratin |
| T4205 |
15619-15626 |
VBN |
denotes |
induced |
| T4206 |
15627-15629 |
IN |
denotes |
in |
| T4207 |
15630-15633 |
DT |
denotes |
the |
| T4209 |
15634-15644 |
JJ |
denotes |
suprabasal |
| T4208 |
15645-15651 |
NNS |
denotes |
layers |
| T4210 |
15652-15654 |
IN |
denotes |
of |
| T4211 |
15655-15673 |
JJ |
denotes |
hyperproliferative |
| T4212 |
15674-15678 |
NN |
denotes |
skin |
| T4213 |
15679-15680 |
-LRB- |
denotes |
( |
| T4215 |
15680-15686 |
NN |
denotes |
Figure |
| T4214 |
15687-15689 |
NN |
denotes |
2H |
| T4216 |
15690-15693 |
CC |
denotes |
and |
| T4217 |
15694-15696 |
NN |
denotes |
2I |
| T4218 |
15696-15697 |
-RRB- |
denotes |
) |
| T4219 |
15697-15698 |
. |
denotes |
. |
| T4220 |
15698-17837 |
sentence |
denotes |
Figure 2 Misexpression of Snail in Mouse Skin Epidermis Results in Hyperproliferation
Three different surviving Tg founder mice harbored a K14-Snail transgene that was integrated into a locus that resulted in inheritable, mosaic expression of the transgene in skin epidermis. All displayed similar abnormalities, as did their offspring.
(A) P16 WT and K14-Snail Tg mice. Insets denote magnified tail segments, which displayed a mosaic, flaky appearance in Tg mice. Size differences appeared with age, and are likely due to K14-promoter activity in the tongue and oral epithelium, resulting in progressive defects and reduced food intake. Hence, skin sections from young (P3) mice were analyzed (B–I).
(B) Hematoxylin- and eosin-stained Tg skin section. Double arrows demarcate the border of mosaic histology, with seemingly normal epidermis (epi) and a mature hair follicle (hf) at left and hyperthickened epidermis at right.
(C) Immunofluorescence of Tg skin section labeled with antibodies as color-coded on frame. Double arrows demarcate the border of mosaic anti-Snail (green), revealing Snail expression coincident with regions of hyperthickened epidermis (at left) and absent in regions of normal epidermis (at right).
(D–I) Sections of P3 WT or Tg skin (affected region) subjected to either immunofluorescence (D, E, H, and I) or immunohistochemistry (F and G) with antibodies as indicated on the panel. Anti-keratin 5 indicates K5, normally restricted to the basal layer of the epidermis; anti-keratin 6 detects keratin 6, expressed in postnatal epidermis under conditions such as wounding, in which hyperproliferation occurs. All other antibodies are as in the legend to Figure 2. Comparison of D and E provide representative examples that illustrate that pMAPK is found in only a subset of all proliferating (Ki67-positive) cells. Note also the presence of Ki67- (E) and pMAPK-positive (G) cells in some suprabasal areas; Ki67-positive cells colabeled with anti-Snail (E). Expression of the Snail transgene did not block terminal differentiation in the hyperproliferative epidermis, but it distorted it markedly (Figure 3A–3H). |
| T4221 |
17683-17693 |
NN |
denotes |
Expression |
| T4223 |
17694-17696 |
IN |
denotes |
of |
| T4224 |
17697-17700 |
DT |
denotes |
the |
| T4226 |
17701-17706 |
NN |
denotes |
Snail |
| T4225 |
17707-17716 |
NN |
denotes |
transgene |
| T4227 |
17717-17720 |
VBD |
denotes |
did |
| T4228 |
17721-17724 |
RB |
denotes |
not |
| T4222 |
17725-17730 |
VB |
denotes |
block |
| T4229 |
17731-17739 |
JJ |
denotes |
terminal |
| T4230 |
17740-17755 |
NN |
denotes |
differentiation |
| T4231 |
17756-17758 |
IN |
denotes |
in |
| T4232 |
17759-17762 |
DT |
denotes |
the |
| T4234 |
17763-17781 |
JJ |
denotes |
hyperproliferative |
| T4233 |
17782-17791 |
NN |
denotes |
epidermis |
| T4235 |
17791-17793 |
, |
denotes |
, |
| T4236 |
17793-17796 |
CC |
denotes |
but |
| T4237 |
17797-17799 |
PRP |
denotes |
it |
| T4238 |
17800-17809 |
VBD |
denotes |
distorted |
| T4239 |
17810-17812 |
PRP |
denotes |
it |
| T4240 |
17813-17821 |
RB |
denotes |
markedly |
| T4241 |
17822-17823 |
-LRB- |
denotes |
( |
| T4243 |
17823-17829 |
NN |
denotes |
Figure |
| T4242 |
17830-17832 |
NN |
denotes |
3A |
| T4244 |
17832-17833 |
SYM |
denotes |
– |
| T4245 |
17833-17835 |
NN |
denotes |
3H |
| T4246 |
17835-17836 |
-RRB- |
denotes |
) |
| T4247 |
17836-17837 |
. |
denotes |
. |
| T4248 |
17837-17974 |
sentence |
denotes |
Typical of most hyperproliferating conditions, Snail expression led to a large expansion in layers with spinous and granular morphology. |
| T4249 |
17838-17845 |
JJ |
denotes |
Typical |
| T4251 |
17846-17848 |
IN |
denotes |
of |
| T4252 |
17849-17853 |
JJS |
denotes |
most |
| T4254 |
17854-17872 |
NN |
denotes |
hyperproliferating |
| T4253 |
17873-17883 |
NNS |
denotes |
conditions |
| T4255 |
17883-17885 |
, |
denotes |
, |
| T4256 |
17885-17890 |
NN |
denotes |
Snail |
| T4257 |
17891-17901 |
NN |
denotes |
expression |
| T4250 |
17902-17905 |
VBD |
denotes |
led |
| T4258 |
17906-17908 |
IN |
denotes |
to |
| T4259 |
17909-17910 |
DT |
denotes |
a |
| T4261 |
17911-17916 |
JJ |
denotes |
large |
| T4260 |
17917-17926 |
NN |
denotes |
expansion |
| T4262 |
17927-17929 |
IN |
denotes |
in |
| T4263 |
17930-17936 |
NNS |
denotes |
layers |
| T4264 |
17937-17941 |
IN |
denotes |
with |
| T4265 |
17942-17949 |
JJ |
denotes |
spinous |
| T4267 |
17950-17953 |
CC |
denotes |
and |
| T4268 |
17954-17962 |
JJ |
denotes |
granular |
| T4266 |
17963-17973 |
NN |
denotes |
morphology |
| T4269 |
17973-17974 |
. |
denotes |
. |
| T4270 |
17974-18117 |
sentence |
denotes |
Additionally, however, was a marked and variable expansion of keratin 5 (K5), normally restricted to the innermost basal layer (see Figure 3). |
| T4271 |
17975-17987 |
RB |
denotes |
Additionally |
| T4273 |
17987-17989 |
, |
denotes |
, |
| T4274 |
17989-17996 |
RB |
denotes |
however |
| T4275 |
17996-17998 |
, |
denotes |
, |
| T4272 |
17998-18001 |
VBD |
denotes |
was |
| T4276 |
18002-18003 |
DT |
denotes |
a |
| T4278 |
18004-18010 |
JJ |
denotes |
marked |
| T4279 |
18011-18014 |
CC |
denotes |
and |
| T4280 |
18015-18023 |
JJ |
denotes |
variable |
| T4277 |
18024-18033 |
NN |
denotes |
expansion |
| T4281 |
18034-18036 |
IN |
denotes |
of |
| T4282 |
18037-18044 |
NN |
denotes |
keratin |
| T4283 |
18045-18046 |
CD |
denotes |
5 |
| T4284 |
18047-18048 |
-LRB- |
denotes |
( |
| T4285 |
18048-18050 |
NN |
denotes |
K5 |
| T4286 |
18050-18051 |
-RRB- |
denotes |
) |
| T4287 |
18051-18053 |
, |
denotes |
, |
| T4288 |
18053-18061 |
RB |
denotes |
normally |
| T4289 |
18062-18072 |
VBN |
denotes |
restricted |
| T4290 |
18073-18075 |
IN |
denotes |
to |
| T4291 |
18076-18079 |
DT |
denotes |
the |
| T4293 |
18080-18089 |
JJS |
denotes |
innermost |
| T4294 |
18090-18095 |
JJ |
denotes |
basal |
| T4292 |
18096-18101 |
NN |
denotes |
layer |
| T4295 |
18102-18103 |
-LRB- |
denotes |
( |
| T4296 |
18103-18106 |
VB |
denotes |
see |
| T4297 |
18107-18113 |
NN |
denotes |
Figure |
| T4298 |
18114-18115 |
CD |
denotes |
3 |
| T4299 |
18115-18116 |
-RRB- |
denotes |
) |
| T4300 |
18116-18117 |
. |
denotes |
. |
| T4301 |
18117-18426 |
sentence |
denotes |
Although the failure of Snail-null mice to develop past gastrulation [21] precluded our ability to study the loss of Snail function in skin development, a good correlation emerged between the expression of Snail protein and the extension of K5, Ki67, and pMAPK suprabasally (compare data in Figures 2 and 3). |
| T4302 |
18118-18126 |
IN |
denotes |
Although |
| T4304 |
18127-18130 |
DT |
denotes |
the |
| T4305 |
18131-18138 |
NN |
denotes |
failure |
| T4306 |
18139-18141 |
IN |
denotes |
of |
| T4307 |
18142-18147 |
NN |
denotes |
Snail |
| T4309 |
18147-18148 |
HYPH |
denotes |
- |
| T4310 |
18148-18152 |
JJ |
denotes |
null |
| T4308 |
18153-18157 |
NNS |
denotes |
mice |
| T4311 |
18158-18160 |
TO |
denotes |
to |
| T4312 |
18161-18168 |
VB |
denotes |
develop |
| T4313 |
18169-18173 |
JJ |
denotes |
past |
| T4314 |
18174-18186 |
NN |
denotes |
gastrulation |
| T4315 |
18187-18188 |
-LRB- |
denotes |
[ |
| T4316 |
18188-18190 |
CD |
denotes |
21 |
| T4317 |
18190-18191 |
-RRB- |
denotes |
] |
| T4303 |
18192-18201 |
VBD |
denotes |
precluded |
| T4319 |
18202-18205 |
PRP$ |
denotes |
our |
| T4320 |
18206-18213 |
NN |
denotes |
ability |
| T4321 |
18214-18216 |
TO |
denotes |
to |
| T4322 |
18217-18222 |
VB |
denotes |
study |
| T4323 |
18223-18226 |
DT |
denotes |
the |
| T4324 |
18227-18231 |
NN |
denotes |
loss |
| T4325 |
18232-18234 |
IN |
denotes |
of |
| T4326 |
18235-18240 |
NN |
denotes |
Snail |
| T4327 |
18241-18249 |
NN |
denotes |
function |
| T4328 |
18250-18252 |
IN |
denotes |
in |
| T4329 |
18253-18257 |
NN |
denotes |
skin |
| T4330 |
18258-18269 |
NN |
denotes |
development |
| T4331 |
18269-18271 |
, |
denotes |
, |
| T4332 |
18271-18272 |
DT |
denotes |
a |
| T4334 |
18273-18277 |
JJ |
denotes |
good |
| T4333 |
18278-18289 |
NN |
denotes |
correlation |
| T4318 |
18290-18297 |
VBD |
denotes |
emerged |
| T4335 |
18298-18305 |
IN |
denotes |
between |
| T4336 |
18306-18309 |
DT |
denotes |
the |
| T4337 |
18310-18320 |
NN |
denotes |
expression |
| T4338 |
18321-18323 |
IN |
denotes |
of |
| T4339 |
18324-18329 |
NN |
denotes |
Snail |
| T4340 |
18330-18337 |
NN |
denotes |
protein |
| T4341 |
18338-18341 |
CC |
denotes |
and |
| T4342 |
18342-18345 |
DT |
denotes |
the |
| T4343 |
18346-18355 |
NN |
denotes |
extension |
| T4344 |
18356-18358 |
IN |
denotes |
of |
| T4345 |
18359-18361 |
NN |
denotes |
K5 |
| T4346 |
18361-18363 |
, |
denotes |
, |
| T4347 |
18363-18367 |
NN |
denotes |
Ki67 |
| T4348 |
18367-18369 |
, |
denotes |
, |
| T4349 |
18369-18372 |
CC |
denotes |
and |
| T4350 |
18373-18378 |
NN |
denotes |
pMAPK |
| T4351 |
18379-18391 |
RB |
denotes |
suprabasally |
| T4352 |
18392-18393 |
-LRB- |
denotes |
( |
| T4353 |
18393-18400 |
VB |
denotes |
compare |
| T4354 |
18401-18405 |
NNS |
denotes |
data |
| T4355 |
18406-18408 |
IN |
denotes |
in |
| T4356 |
18409-18416 |
NNS |
denotes |
Figures |
| T4357 |
18417-18418 |
CD |
denotes |
2 |
| T4358 |
18419-18422 |
CC |
denotes |
and |
| T4359 |
18423-18424 |
CD |
denotes |
3 |
| T4360 |
18424-18425 |
-RRB- |
denotes |
) |
| T4361 |
18425-18426 |
. |
denotes |
. |
| T4362 |
18426-20408 |
sentence |
denotes |
Figure 3 Alterations in the Differentiation Program and Basement Membrane Organization in Snail-Expressing Tg Epidermis
(A–H) Immunofluorescence of skin sections from P3 WT and Tg mice. Shown are affected areas of Tg skin; in areas where Snail protein was not expressed, stainings were normal. Sections were labeled with antibodies as indicated and color-coded on each frame. Antibodies are against markers of normal epidermal differentiation, and include K5 (a basally expressed keratin), K1 (a suprabasal keratin, expressed in spinous layer cells), involucrin (Inv; a suprabasally expressed cornified envelope protein found in upper spinous and granular layer cells), loricrin (Lor; a cornified envelope protein expressed in the granular layer), and filaggrin (Fil; a protein that bundles keratin filaments in the granular layer and stratum corneum). Note abnormal extension of anti-K5 suprabasally, often present in anti-K1 positive suprabasal Tg cells.
(I–N) Immunohistochemistry (I and J) or immunofluorescence (K–N) of sections of P30 Wt (I, K, and M) and Tg (J, L, and N) (affected areas) skins using the antibodies indicated. Note that with age, affected areas of the Tg epidermis became increasingly undulating, often exhibiting papilloma-like invaginations (J). Insets in I and J are magnified views of the boxed areas, illustrating the absence (Wt) or presence (Tg) of nuclear anti-cyclin D staining. With age, affected areas of the Tg epidermis also displayed perturbations within the basement membrane, as judged by antibody labeling against either basement membrane (K and L) or hemidesmosomal (M and N) components. Double arrows in L demarcate mosaic zones, revealing that perturbations were restricted to hyperthickened, i.e., Snail-positive zones (to left of double arrows). Other abbreviations are as noted in the legend to Figure 2. The changes in hyperproliferation and differentiation were not initially accompanied by gross signs of epithelial invaginations. |
| T4363 |
20280-20283 |
DT |
denotes |
The |
| T4364 |
20284-20291 |
NNS |
denotes |
changes |
| T4366 |
20292-20294 |
IN |
denotes |
in |
| T4367 |
20295-20313 |
NN |
denotes |
hyperproliferation |
| T4368 |
20314-20317 |
CC |
denotes |
and |
| T4369 |
20318-20333 |
NN |
denotes |
differentiation |
| T4370 |
20334-20338 |
VBD |
denotes |
were |
| T4371 |
20339-20342 |
RB |
denotes |
not |
| T4372 |
20343-20352 |
RB |
denotes |
initially |
| T4365 |
20353-20364 |
VBN |
denotes |
accompanied |
| T4373 |
20365-20367 |
IN |
denotes |
by |
| T4374 |
20368-20373 |
JJ |
denotes |
gross |
| T4375 |
20374-20379 |
NNS |
denotes |
signs |
| T4376 |
20380-20382 |
IN |
denotes |
of |
| T4377 |
20383-20393 |
JJ |
denotes |
epithelial |
| T4378 |
20394-20407 |
NNS |
denotes |
invaginations |
| T4379 |
20407-20408 |
. |
denotes |
. |
| T4380 |
20408-20602 |
sentence |
denotes |
With age, however, epidermal folds and undulations developed in areas where Snail was expressed, and proliferative markers persisted in these regions (Figure 3I and 3J; anti-cyclin D staining). |
| T4381 |
20409-20413 |
IN |
denotes |
With |
| T4383 |
20414-20417 |
NN |
denotes |
age |
| T4384 |
20417-20419 |
, |
denotes |
, |
| T4385 |
20419-20426 |
RB |
denotes |
however |
| T4386 |
20426-20428 |
, |
denotes |
, |
| T4387 |
20428-20437 |
JJ |
denotes |
epidermal |
| T4388 |
20438-20443 |
NNS |
denotes |
folds |
| T4389 |
20444-20447 |
CC |
denotes |
and |
| T4390 |
20448-20459 |
NNS |
denotes |
undulations |
| T4382 |
20460-20469 |
VBN |
denotes |
developed |
| T4391 |
20470-20472 |
IN |
denotes |
in |
| T4392 |
20473-20478 |
NNS |
denotes |
areas |
| T4393 |
20479-20484 |
WRB |
denotes |
where |
| T4395 |
20485-20490 |
NN |
denotes |
Snail |
| T4396 |
20491-20494 |
VBD |
denotes |
was |
| T4394 |
20495-20504 |
VBN |
denotes |
expressed |
| T4397 |
20504-20506 |
, |
denotes |
, |
| T4398 |
20506-20509 |
CC |
denotes |
and |
| T4399 |
20510-20523 |
JJ |
denotes |
proliferative |
| T4400 |
20524-20531 |
NNS |
denotes |
markers |
| T4401 |
20532-20541 |
VBD |
denotes |
persisted |
| T4402 |
20542-20544 |
IN |
denotes |
in |
| T4403 |
20545-20550 |
DT |
denotes |
these |
| T4404 |
20551-20558 |
NNS |
denotes |
regions |
| T4405 |
20559-20560 |
-LRB- |
denotes |
( |
| T4407 |
20560-20566 |
NN |
denotes |
Figure |
| T4408 |
20567-20569 |
NN |
denotes |
3I |
| T4409 |
20570-20573 |
CC |
denotes |
and |
| T4410 |
20574-20576 |
NN |
denotes |
3J |
| T4411 |
20576-20577 |
: |
denotes |
; |
| T4412 |
20578-20589 |
JJ |
denotes |
anti-cyclin |
| T4413 |
20590-20591 |
NN |
denotes |
D |
| T4406 |
20592-20600 |
NN |
denotes |
staining |
| T4414 |
20600-20601 |
-RRB- |
denotes |
) |
| T4415 |
20601-20602 |
. |
denotes |
. |
| T4416 |
20602-20714 |
sentence |
denotes |
The undulations were accompanied by partial dissolution of the underlying basement membrane (Figure 3K and 3L). |
| T4417 |
20603-20606 |
DT |
denotes |
The |
| T4418 |
20607-20618 |
NNS |
denotes |
undulations |
| T4420 |
20619-20623 |
VBD |
denotes |
were |
| T4419 |
20624-20635 |
VBN |
denotes |
accompanied |
| T4421 |
20636-20638 |
IN |
denotes |
by |
| T4422 |
20639-20646 |
JJ |
denotes |
partial |
| T4423 |
20647-20658 |
NN |
denotes |
dissolution |
| T4424 |
20659-20661 |
IN |
denotes |
of |
| T4425 |
20662-20665 |
DT |
denotes |
the |
| T4427 |
20666-20676 |
JJ |
denotes |
underlying |
| T4428 |
20677-20685 |
NN |
denotes |
basement |
| T4426 |
20686-20694 |
NN |
denotes |
membrane |
| T4429 |
20695-20696 |
-LRB- |
denotes |
( |
| T4431 |
20696-20702 |
NN |
denotes |
Figure |
| T4430 |
20703-20705 |
NN |
denotes |
3K |
| T4432 |
20706-20709 |
CC |
denotes |
and |
| T4433 |
20710-20712 |
NN |
denotes |
3L |
| T4434 |
20712-20713 |
-RRB- |
denotes |
) |
| T4435 |
20713-20714 |
. |
denotes |
. |
| T4436 |
20714-20914 |
sentence |
denotes |
Aberrant staining was also observed with antibodies against components of the hemidesmosomes, which provide strong adhesion of basal epidermal cells to the underlying basal lamina (Figure 3M and 3N). |
| T4437 |
20715-20723 |
JJ |
denotes |
Aberrant |
| T4438 |
20724-20732 |
NN |
denotes |
staining |
| T4440 |
20733-20736 |
VBD |
denotes |
was |
| T4441 |
20737-20741 |
RB |
denotes |
also |
| T4439 |
20742-20750 |
VBN |
denotes |
observed |
| T4442 |
20751-20755 |
IN |
denotes |
with |
| T4443 |
20756-20766 |
NNS |
denotes |
antibodies |
| T4444 |
20767-20774 |
IN |
denotes |
against |
| T4445 |
20775-20785 |
NNS |
denotes |
components |
| T4446 |
20786-20788 |
IN |
denotes |
of |
| T4447 |
20789-20792 |
DT |
denotes |
the |
| T4448 |
20793-20807 |
NNS |
denotes |
hemidesmosomes |
| T4449 |
20807-20809 |
, |
denotes |
, |
| T4450 |
20809-20814 |
WDT |
denotes |
which |
| T4451 |
20815-20822 |
VBP |
denotes |
provide |
| T4452 |
20823-20829 |
JJ |
denotes |
strong |
| T4453 |
20830-20838 |
NN |
denotes |
adhesion |
| T4454 |
20839-20841 |
IN |
denotes |
of |
| T4455 |
20842-20847 |
JJ |
denotes |
basal |
| T4457 |
20848-20857 |
JJ |
denotes |
epidermal |
| T4456 |
20858-20863 |
NNS |
denotes |
cells |
| T4458 |
20864-20866 |
IN |
denotes |
to |
| T4459 |
20867-20870 |
DT |
denotes |
the |
| T4461 |
20871-20881 |
JJ |
denotes |
underlying |
| T4462 |
20882-20887 |
JJ |
denotes |
basal |
| T4460 |
20888-20894 |
NN |
denotes |
lamina |
| T4463 |
20895-20896 |
-LRB- |
denotes |
( |
| T4465 |
20896-20902 |
NN |
denotes |
Figure |
| T4464 |
20903-20905 |
NN |
denotes |
3M |
| T4466 |
20906-20909 |
CC |
denotes |
and |
| T4467 |
20910-20912 |
NN |
denotes |
3N |
| T4468 |
20912-20913 |
-RRB- |
denotes |
) |
| T4469 |
20913-20914 |
. |
denotes |
. |
| T4470 |
20914-21069 |
sentence |
denotes |
Interestingly, similar types of alterations occur in the basement membrane in the hair bud of embryonic and newborn mice when Snail is normally expressed. |
| T4471 |
20915-20928 |
RB |
denotes |
Interestingly |
| T4473 |
20928-20930 |
, |
denotes |
, |
| T4474 |
20930-20937 |
JJ |
denotes |
similar |
| T4475 |
20938-20943 |
NNS |
denotes |
types |
| T4476 |
20944-20946 |
IN |
denotes |
of |
| T4477 |
20947-20958 |
NNS |
denotes |
alterations |
| T4472 |
20959-20964 |
VBP |
denotes |
occur |
| T4478 |
20965-20967 |
IN |
denotes |
in |
| T4479 |
20968-20971 |
DT |
denotes |
the |
| T4481 |
20972-20980 |
NN |
denotes |
basement |
| T4480 |
20981-20989 |
NN |
denotes |
membrane |
| T4482 |
20990-20992 |
IN |
denotes |
in |
| T4483 |
20993-20996 |
DT |
denotes |
the |
| T4485 |
20997-21001 |
NN |
denotes |
hair |
| T4484 |
21002-21005 |
NN |
denotes |
bud |
| T4486 |
21006-21008 |
IN |
denotes |
of |
| T4487 |
21009-21018 |
JJ |
denotes |
embryonic |
| T4489 |
21019-21022 |
CC |
denotes |
and |
| T4490 |
21023-21030 |
JJ |
denotes |
newborn |
| T4488 |
21031-21035 |
NNS |
denotes |
mice |
| T4491 |
21036-21040 |
WRB |
denotes |
when |
| T4493 |
21041-21046 |
NN |
denotes |
Snail |
| T4494 |
21047-21049 |
VBZ |
denotes |
is |
| T4495 |
21050-21058 |
RB |
denotes |
normally |
| T4492 |
21059-21068 |
VBN |
denotes |
expressed |
| T4496 |
21068-21069 |
. |
denotes |
. |
| T4497 |
21069-21306 |
sentence |
denotes |
The fact that the basement membrane separating the epidermis from the dermis is altered only in the adult Tg animals suggests the involvement of intermediary factors not as readily available in the epidermis as they are in the follicle. |
| T4498 |
21070-21073 |
DT |
denotes |
The |
| T4499 |
21074-21078 |
NN |
denotes |
fact |
| T4501 |
21079-21083 |
IN |
denotes |
that |
| T4503 |
21084-21087 |
DT |
denotes |
the |
| T4505 |
21088-21096 |
NN |
denotes |
basement |
| T4504 |
21097-21105 |
NN |
denotes |
membrane |
| T4506 |
21106-21116 |
VBG |
denotes |
separating |
| T4507 |
21117-21120 |
DT |
denotes |
the |
| T4508 |
21121-21130 |
NN |
denotes |
epidermis |
| T4509 |
21131-21135 |
IN |
denotes |
from |
| T4510 |
21136-21139 |
DT |
denotes |
the |
| T4511 |
21140-21146 |
NN |
denotes |
dermis |
| T4512 |
21147-21149 |
VBZ |
denotes |
is |
| T4502 |
21150-21157 |
VBN |
denotes |
altered |
| T4513 |
21158-21162 |
RB |
denotes |
only |
| T4514 |
21163-21165 |
IN |
denotes |
in |
| T4515 |
21166-21169 |
DT |
denotes |
the |
| T4517 |
21170-21175 |
JJ |
denotes |
adult |
| T4518 |
21176-21178 |
NN |
denotes |
Tg |
| T4516 |
21179-21186 |
NNS |
denotes |
animals |
| T4500 |
21187-21195 |
VBZ |
denotes |
suggests |
| T4519 |
21196-21199 |
DT |
denotes |
the |
| T4520 |
21200-21211 |
NN |
denotes |
involvement |
| T4521 |
21212-21214 |
IN |
denotes |
of |
| T4522 |
21215-21227 |
JJ |
denotes |
intermediary |
| T4523 |
21228-21235 |
NNS |
denotes |
factors |
| T4524 |
21236-21239 |
RB |
denotes |
not |
| T4526 |
21240-21242 |
RB |
denotes |
as |
| T4527 |
21243-21250 |
RB |
denotes |
readily |
| T4525 |
21251-21260 |
JJ |
denotes |
available |
| T4528 |
21261-21263 |
IN |
denotes |
in |
| T4529 |
21264-21267 |
DT |
denotes |
the |
| T4530 |
21268-21277 |
NN |
denotes |
epidermis |
| T4531 |
21278-21280 |
IN |
denotes |
as |
| T4533 |
21281-21285 |
PRP |
denotes |
they |
| T4532 |
21286-21289 |
VBP |
denotes |
are |
| T4534 |
21290-21292 |
IN |
denotes |
in |
| T4535 |
21293-21296 |
DT |
denotes |
the |
| T4536 |
21297-21305 |
NN |
denotes |
follicle |
| T4537 |
21305-21306 |
. |
denotes |
. |
| T5218 |
21308-21316 |
JJ |
denotes |
Possible |
| T5219 |
21317-21322 |
NNS |
denotes |
Links |
| T5220 |
21323-21330 |
IN |
denotes |
between |
| T5221 |
21331-21340 |
JJ |
denotes |
Epidermal |
| T5222 |
21341-21359 |
NN |
denotes |
Hyperproliferation |
| T5223 |
21360-21363 |
CC |
denotes |
and |
| T5224 |
21364-21368 |
JJ |
denotes |
Down |
| T5226 |
21368-21369 |
HYPH |
denotes |
- |
| T5225 |
21369-21379 |
NN |
denotes |
regulation |
| T5227 |
21380-21382 |
IN |
denotes |
of |
| T5228 |
21383-21385 |
NN |
denotes |
AJ |
| T5229 |
21386-21394 |
NNS |
denotes |
Proteins |
| T5230 |
21395-21397 |
IN |
denotes |
in |
| T5231 |
21398-21403 |
NN |
denotes |
Snail |
| T5233 |
21404-21406 |
NN |
denotes |
Tg |
| T5232 |
21407-21411 |
NNS |
denotes |
Mice |
| T5234 |
21411-21731 |
sentence |
denotes |
Given that the E-cadherin promoter is a direct target for Snail-mediated repression in vitro [4,12,13], and that E-cadherin was down-regulated in Snail-expressing hair buds, we examined the status of E-cadherin and other AJ proteins within regions of hyperproliferative epidermis where Tg Snail was present (Figure 4A). |
| T5235 |
21412-21417 |
VBN |
denotes |
Given |
| T5237 |
21418-21422 |
IN |
denotes |
that |
| T5239 |
21423-21426 |
DT |
denotes |
the |
| T5241 |
21427-21428 |
NN |
denotes |
E |
| T5243 |
21428-21429 |
HYPH |
denotes |
- |
| T5242 |
21429-21437 |
NN |
denotes |
cadherin |
| T5240 |
21438-21446 |
NN |
denotes |
promoter |
| T5238 |
21447-21449 |
VBZ |
denotes |
is |
| T5244 |
21450-21451 |
DT |
denotes |
a |
| T5246 |
21452-21458 |
JJ |
denotes |
direct |
| T5245 |
21459-21465 |
NN |
denotes |
target |
| T5247 |
21466-21469 |
IN |
denotes |
for |
| T5248 |
21470-21475 |
NN |
denotes |
Snail |
| T5250 |
21475-21476 |
HYPH |
denotes |
- |
| T5249 |
21476-21484 |
VBN |
denotes |
mediated |
| T5251 |
21485-21495 |
NN |
denotes |
repression |
| T5252 |
21496-21498 |
FW |
denotes |
in |
| T5253 |
21499-21504 |
FW |
denotes |
vitro |
| T5254 |
21505-21506 |
-LRB- |
denotes |
[ |
| T5256 |
21506-21507 |
CD |
denotes |
4 |
| T5257 |
21507-21508 |
, |
denotes |
, |
| T5258 |
21508-21510 |
CD |
denotes |
12 |
| T5259 |
21510-21511 |
, |
denotes |
, |
| T5255 |
21511-21513 |
CD |
denotes |
13 |
| T5260 |
21513-21514 |
-RRB- |
denotes |
] |
| T5261 |
21514-21516 |
, |
denotes |
, |
| T5262 |
21516-21519 |
CC |
denotes |
and |
| T5263 |
21520-21524 |
IN |
denotes |
that |
| T5265 |
21525-21526 |
NN |
denotes |
E |
| T5267 |
21526-21527 |
HYPH |
denotes |
- |
| T5266 |
21527-21535 |
NN |
denotes |
cadherin |
| T5268 |
21536-21539 |
VBD |
denotes |
was |
| T5269 |
21540-21544 |
RB |
denotes |
down |
| T5270 |
21544-21545 |
HYPH |
denotes |
- |
| T5264 |
21545-21554 |
VBN |
denotes |
regulated |
| T5271 |
21555-21557 |
IN |
denotes |
in |
| T5272 |
21558-21563 |
NN |
denotes |
Snail |
| T5274 |
21563-21564 |
HYPH |
denotes |
- |
| T5273 |
21564-21574 |
VBG |
denotes |
expressing |
| T5276 |
21575-21579 |
NN |
denotes |
hair |
| T5275 |
21580-21584 |
NNS |
denotes |
buds |
| T5277 |
21584-21586 |
, |
denotes |
, |
| T5278 |
21586-21588 |
PRP |
denotes |
we |
| T5236 |
21589-21597 |
VBD |
denotes |
examined |
| T5279 |
21598-21601 |
DT |
denotes |
the |
| T5280 |
21602-21608 |
NN |
denotes |
status |
| T5281 |
21609-21611 |
IN |
denotes |
of |
| T5282 |
21612-21613 |
NN |
denotes |
E |
| T5284 |
21613-21614 |
HYPH |
denotes |
- |
| T5283 |
21614-21622 |
NN |
denotes |
cadherin |
| T5285 |
21623-21626 |
CC |
denotes |
and |
| T5286 |
21627-21632 |
JJ |
denotes |
other |
| T5288 |
21633-21635 |
NN |
denotes |
AJ |
| T5287 |
21636-21644 |
NN |
denotes |
proteins |
| T5289 |
21645-21651 |
IN |
denotes |
within |
| T5290 |
21652-21659 |
NNS |
denotes |
regions |
| T5291 |
21660-21662 |
IN |
denotes |
of |
| T5292 |
21663-21681 |
JJ |
denotes |
hyperproliferative |
| T5293 |
21682-21691 |
NN |
denotes |
epidermis |
| T5294 |
21692-21697 |
WRB |
denotes |
where |
| T5296 |
21698-21700 |
NN |
denotes |
Tg |
| T5297 |
21701-21706 |
NN |
denotes |
Snail |
| T5295 |
21707-21710 |
VBD |
denotes |
was |
| T5298 |
21711-21718 |
JJ |
denotes |
present |
| T5299 |
21719-21720 |
-LRB- |
denotes |
( |
| T5301 |
21720-21726 |
NN |
denotes |
Figure |
| T5300 |
21727-21729 |
NN |
denotes |
4A |
| T5302 |
21729-21730 |
-RRB- |
denotes |
) |
| T5303 |
21730-21731 |
. |
denotes |
. |
| T5304 |
21731-21831 |
sentence |
denotes |
In these regions, immunofluorescence staining of E-cadherin and α-catenin were markedly diminished. |
| T5305 |
21732-21734 |
IN |
denotes |
In |
| T5307 |
21735-21740 |
DT |
denotes |
these |
| T5308 |
21741-21748 |
NNS |
denotes |
regions |
| T5309 |
21748-21750 |
, |
denotes |
, |
| T5310 |
21750-21768 |
NN |
denotes |
immunofluorescence |
| T5311 |
21769-21777 |
NN |
denotes |
staining |
| T5312 |
21778-21780 |
IN |
denotes |
of |
| T5313 |
21781-21782 |
NN |
denotes |
E |
| T5315 |
21782-21783 |
HYPH |
denotes |
- |
| T5314 |
21783-21791 |
NN |
denotes |
cadherin |
| T5316 |
21792-21795 |
CC |
denotes |
and |
| T5317 |
21796-21797 |
NN |
denotes |
α |
| T5319 |
21797-21798 |
HYPH |
denotes |
- |
| T5318 |
21798-21805 |
NN |
denotes |
catenin |
| T5320 |
21806-21810 |
VBD |
denotes |
were |
| T5321 |
21811-21819 |
RB |
denotes |
markedly |
| T5306 |
21820-21830 |
VBN |
denotes |
diminished |
| T5322 |
21830-21831 |
. |
denotes |
. |
| T5323 |
21831-21945 |
sentence |
denotes |
In contrast, the intensity of antibody staining for two other AJ proteins, β-catenin and Ajuba, was still strong. |
| T5324 |
21832-21834 |
IN |
denotes |
In |
| T5326 |
21835-21843 |
NN |
denotes |
contrast |
| T5327 |
21843-21845 |
, |
denotes |
, |
| T5328 |
21845-21848 |
DT |
denotes |
the |
| T5329 |
21849-21858 |
NN |
denotes |
intensity |
| T5330 |
21859-21861 |
IN |
denotes |
of |
| T5331 |
21862-21870 |
NN |
denotes |
antibody |
| T5332 |
21871-21879 |
NN |
denotes |
staining |
| T5333 |
21880-21883 |
IN |
denotes |
for |
| T5334 |
21884-21887 |
CD |
denotes |
two |
| T5336 |
21888-21893 |
JJ |
denotes |
other |
| T5337 |
21894-21896 |
NN |
denotes |
AJ |
| T5335 |
21897-21905 |
NN |
denotes |
proteins |
| T5338 |
21905-21907 |
, |
denotes |
, |
| T5339 |
21907-21908 |
NN |
denotes |
β |
| T5341 |
21908-21909 |
HYPH |
denotes |
- |
| T5340 |
21909-21916 |
NN |
denotes |
catenin |
| T5342 |
21917-21920 |
CC |
denotes |
and |
| T5343 |
21921-21926 |
NN |
denotes |
Ajuba |
| T5344 |
21926-21928 |
, |
denotes |
, |
| T5325 |
21928-21931 |
VBD |
denotes |
was |
| T5345 |
21932-21937 |
RB |
denotes |
still |
| T5346 |
21938-21944 |
JJ |
denotes |
strong |
| T5347 |
21944-21945 |
. |
denotes |
. |
| T5348 |
21945-22133 |
sentence |
denotes |
Interestingly, however, despite appreciable immunofluorescence, localization of β-catenin and Ajuba appeared to be largely cytoplasmic rather than at cell-cell borders (Figure 4A insets). |
| T5349 |
21946-21959 |
RB |
denotes |
Interestingly |
| T5351 |
21959-21961 |
, |
denotes |
, |
| T5352 |
21961-21968 |
RB |
denotes |
however |
| T5353 |
21968-21970 |
, |
denotes |
, |
| T5354 |
21970-21977 |
IN |
denotes |
despite |
| T5355 |
21978-21989 |
JJ |
denotes |
appreciable |
| T5356 |
21990-22008 |
NN |
denotes |
immunofluorescence |
| T5357 |
22008-22010 |
, |
denotes |
, |
| T5358 |
22010-22022 |
NN |
denotes |
localization |
| T5359 |
22023-22025 |
IN |
denotes |
of |
| T5360 |
22026-22027 |
NN |
denotes |
β |
| T5362 |
22027-22028 |
HYPH |
denotes |
- |
| T5361 |
22028-22035 |
NN |
denotes |
catenin |
| T5363 |
22036-22039 |
CC |
denotes |
and |
| T5364 |
22040-22045 |
NN |
denotes |
Ajuba |
| T5350 |
22046-22054 |
VBD |
denotes |
appeared |
| T5365 |
22055-22057 |
TO |
denotes |
to |
| T5366 |
22058-22060 |
VB |
denotes |
be |
| T5367 |
22061-22068 |
RB |
denotes |
largely |
| T5368 |
22069-22080 |
JJ |
denotes |
cytoplasmic |
| T5369 |
22081-22087 |
RB |
denotes |
rather |
| T5370 |
22088-22092 |
IN |
denotes |
than |
| T5371 |
22093-22095 |
IN |
denotes |
at |
| T5372 |
22096-22100 |
NN |
denotes |
cell |
| T5374 |
22100-22101 |
HYPH |
denotes |
- |
| T5373 |
22101-22105 |
NN |
denotes |
cell |
| T5375 |
22106-22113 |
NNS |
denotes |
borders |
| T5376 |
22114-22115 |
-LRB- |
denotes |
( |
| T5378 |
22115-22121 |
NN |
denotes |
Figure |
| T5379 |
22122-22124 |
NN |
denotes |
4A |
| T5377 |
22125-22131 |
NNS |
denotes |
insets |
| T5380 |
22131-22132 |
-RRB- |
denotes |
) |
| T5381 |
22132-22133 |
. |
denotes |
. |
| T5382 |
22133-26210 |
sentence |
denotes |
Figure 4 Snail-Mediated Remodeling of AJs Contributes to Hyperproliferation
(A) Immunofluorescence of skin sections from P30 Wt and Tg mice. Shown are affected areas of Tg skin; in areas where Snail protein was not expressed, stainings were normal. Antibodies used are against AJ proteins and include E-cadherin (E-cad), the transmembrane core protein; β-catenin (β-cat), which binds E-cadherin at AJs and which can also participate as a transcription cofactor when associated with LEF-1/TCF proteins in the nucleus; α-catenin (α-cat) which binds to both β-catenin and Ajuba, a close relative of zyxin; and Ajuba, which can associate with proteins that bind to the actin cytoskeleton, as well as with Grb-2, a mediator of the GTP nucleotide-exchange protein Sos, involved in activation of the Ras-MAPK signaling cascade. In Snail-expressing Tg regions, there was a reduced staining with anti-E-cad and anti-α-cat and a more diffuse staining with anti-Ajuba. Insets in the panels for β-catenin and Ajuba staining are magnified views of the boxed areas. Arrows mark membrane localization of the protein and asterisks mark cells with elevated levels of cytoplasmic β-catenin or Ajuba.
(B) Western blot analyses of protein extracts from P30 Wt and Tg back and ear skins. Antibodies are as in (A) except anti-P-cad, which detects P-cadherin, whose expression in the hair follicle was not affected, and anti-tubulin, which detects tubulin, a control for equal protein loadings. Note that the reductions seen in E-cadherin and α-catenin are likely to be underestimates of the actual differences in affected regions, since the Tg skin expressed Snail mosaically.
(C) In the presence of elevated Snail, α-catenin levels can be restored by overexpression of E-cadherin. Keratinocytes were transfected with either HA-tagged Snail (Snail[HA]; images on the left) or Snail(HA) and Ecad(HA) (images on the right). 2 d after transfection, cells were switched from low-calcium growth medium to high-calcium medium for 6 h to induce AJ formation. Cells were stained with antibodies as indicated on the panels. Arrowheads point to sites of intercellular contact between a Snail-transfected keratinocyte and its neighboring untransfected cell.
(D) Reintroduction of E-cadherin in keratinocytes expressing Snail returns pMAPK to basal levels. Keratinocytes were transfected with control vector (K14), or Snail(HA), or Snail(HA) + E-cad(HA). After 2 d, cells were serum starved for 4 h and whole cell lysates were made and Western blotted with antibodies to pMAPK, HA to recognize the HA-tagged Snail and E-cadherin protein, 20or tubulin as a loading control.
(E) Ajuba interacts with Grb-2 under conditions where α-catenin levels are reduced. Protein extracts were made from skins of P30 Wt and K14-Snail Tg P30 mice (blots on the left) and of newborn Wt and K14-Cre/α-catenin (fl/fl) conditionally null animals (blots on the right) [7]. Equal amounts of protein extracts were treated with anti-Grb-2 antibody (+) or control isotype antibody (–), and following centrifugation, immunoprecipitates were subjected to SDS-PAGE and Western blot analysis with anti-Ajuba and anti-Grb-2 antibodies. Note the presence of Ajuba only under conditions where levels of α-catenin and other AJ proteins were aberrantly low or absent.
(F) Transgene expression of excess Ajuba or the Grb-2-interacting domain (pre-LIM) of Ajuba in keratinocytes results in the activation of the Ras-MAPK pathway. Primary newborn mouse keratinocytes were transfected with either the empty K14 expression vector (K14), or the expression vector driving Snail, full length Ajuba, or the pre-LIM domain of Ajuba in the absence or presence of a peptide inhibitor (inh) that disrupts the interaction between Grb-2 and Sos. 48 h posttransfection, protein extracts were prepared and subjected to SDS-PAGE and Western blot analyses with antibodies against pMAPK, total MAPK, Ajuba (also recognizing the smaller, pre-LIM domain), and Snail. Architectural differences in the epidermis made Western blot analyses somewhat difficult to gauge. |
| T5383 |
26112-26125 |
JJ |
denotes |
Architectural |
| T5384 |
26126-26137 |
NNS |
denotes |
differences |
| T5386 |
26138-26140 |
IN |
denotes |
in |
| T5387 |
26141-26144 |
DT |
denotes |
the |
| T5388 |
26145-26154 |
NN |
denotes |
epidermis |
| T5385 |
26155-26159 |
VBD |
denotes |
made |
| T5389 |
26160-26167 |
NNP |
denotes |
Western |
| T5390 |
26168-26172 |
NN |
denotes |
blot |
| T5391 |
26173-26181 |
NNS |
denotes |
analyses |
| T5393 |
26182-26190 |
RB |
denotes |
somewhat |
| T5392 |
26191-26200 |
JJ |
denotes |
difficult |
| T5394 |
26201-26203 |
TO |
denotes |
to |
| T5395 |
26204-26209 |
VB |
denotes |
gauge |
| T5396 |
26209-26210 |
. |
denotes |
. |
| T5397 |
26210-26336 |
sentence |
denotes |
However, in regions such as ear skin, where the highest levels of Snail protein were expressed, the effects were accentuated. |
| T5398 |
26211-26218 |
RB |
denotes |
However |
| T5400 |
26218-26220 |
, |
denotes |
, |
| T5401 |
26220-26222 |
IN |
denotes |
in |
| T5402 |
26223-26230 |
NNS |
denotes |
regions |
| T5403 |
26231-26235 |
JJ |
denotes |
such |
| T5404 |
26236-26238 |
IN |
denotes |
as |
| T5405 |
26239-26242 |
NN |
denotes |
ear |
| T5406 |
26243-26247 |
NN |
denotes |
skin |
| T5407 |
26247-26249 |
, |
denotes |
, |
| T5408 |
26249-26254 |
WRB |
denotes |
where |
| T5410 |
26255-26258 |
DT |
denotes |
the |
| T5412 |
26259-26266 |
JJS |
denotes |
highest |
| T5411 |
26267-26273 |
NNS |
denotes |
levels |
| T5413 |
26274-26276 |
IN |
denotes |
of |
| T5414 |
26277-26282 |
NN |
denotes |
Snail |
| T5415 |
26283-26290 |
NN |
denotes |
protein |
| T5416 |
26291-26295 |
VBD |
denotes |
were |
| T5409 |
26296-26305 |
VBN |
denotes |
expressed |
| T5417 |
26305-26307 |
, |
denotes |
, |
| T5418 |
26307-26310 |
DT |
denotes |
the |
| T5419 |
26311-26318 |
NNS |
denotes |
effects |
| T5420 |
26319-26323 |
VBD |
denotes |
were |
| T5399 |
26324-26335 |
VBN |
denotes |
accentuated |
| T5421 |
26335-26336 |
. |
denotes |
. |
| T5422 |
26336-26528 |
sentence |
denotes |
In both back skin and ear skin, overall levels of E-cadherin and α-catenin were reduced, under conditions where β-catenin and Ajuba levels remained unchanged relative to controls (Figure 4B). |
| T5423 |
26337-26339 |
IN |
denotes |
In |
| T5425 |
26340-26344 |
CC |
denotes |
both |
| T5427 |
26345-26349 |
NN |
denotes |
back |
| T5426 |
26350-26354 |
NN |
denotes |
skin |
| T5428 |
26355-26358 |
CC |
denotes |
and |
| T5429 |
26359-26362 |
NN |
denotes |
ear |
| T5430 |
26363-26367 |
NN |
denotes |
skin |
| T5431 |
26367-26369 |
, |
denotes |
, |
| T5432 |
26369-26376 |
JJ |
denotes |
overall |
| T5433 |
26377-26383 |
NNS |
denotes |
levels |
| T5434 |
26384-26386 |
IN |
denotes |
of |
| T5435 |
26387-26388 |
NN |
denotes |
E |
| T5437 |
26388-26389 |
HYPH |
denotes |
- |
| T5436 |
26389-26397 |
NN |
denotes |
cadherin |
| T5438 |
26398-26401 |
CC |
denotes |
and |
| T5439 |
26402-26403 |
NN |
denotes |
α |
| T5441 |
26403-26404 |
HYPH |
denotes |
- |
| T5440 |
26404-26411 |
NN |
denotes |
catenin |
| T5442 |
26412-26416 |
VBD |
denotes |
were |
| T5424 |
26417-26424 |
VBN |
denotes |
reduced |
| T5443 |
26424-26426 |
, |
denotes |
, |
| T5444 |
26426-26431 |
IN |
denotes |
under |
| T5445 |
26432-26442 |
NNS |
denotes |
conditions |
| T5446 |
26443-26448 |
WRB |
denotes |
where |
| T5448 |
26449-26450 |
NN |
denotes |
β |
| T5450 |
26450-26451 |
HYPH |
denotes |
- |
| T5449 |
26451-26458 |
NN |
denotes |
catenin |
| T5452 |
26459-26462 |
CC |
denotes |
and |
| T5453 |
26463-26468 |
NN |
denotes |
Ajuba |
| T5451 |
26469-26475 |
NNS |
denotes |
levels |
| T5447 |
26476-26484 |
VBD |
denotes |
remained |
| T5454 |
26485-26494 |
JJ |
denotes |
unchanged |
| T5455 |
26495-26503 |
JJ |
denotes |
relative |
| T5456 |
26504-26506 |
IN |
denotes |
to |
| T5457 |
26507-26515 |
NNS |
denotes |
controls |
| T5458 |
26516-26517 |
-LRB- |
denotes |
( |
| T5460 |
26517-26523 |
NN |
denotes |
Figure |
| T5459 |
26524-26526 |
NN |
denotes |
4B |
| T5461 |
26526-26527 |
-RRB- |
denotes |
) |
| T5462 |
26527-26528 |
. |
denotes |
. |
| T5463 |
26528-26633 |
sentence |
denotes |
Taken together, these data were consistent with our results obtained from immunofluorescence microscopy. |
| T5464 |
26529-26534 |
VBN |
denotes |
Taken |
| T5466 |
26535-26543 |
RB |
denotes |
together |
| T5467 |
26543-26545 |
, |
denotes |
, |
| T5468 |
26545-26550 |
DT |
denotes |
these |
| T5469 |
26551-26555 |
NNS |
denotes |
data |
| T5465 |
26556-26560 |
VBD |
denotes |
were |
| T5470 |
26561-26571 |
JJ |
denotes |
consistent |
| T5471 |
26572-26576 |
IN |
denotes |
with |
| T5472 |
26577-26580 |
PRP$ |
denotes |
our |
| T5473 |
26581-26588 |
NNS |
denotes |
results |
| T5474 |
26589-26597 |
VBN |
denotes |
obtained |
| T5475 |
26598-26602 |
IN |
denotes |
from |
| T5476 |
26603-26621 |
NN |
denotes |
immunofluorescence |
| T5477 |
26622-26632 |
NN |
denotes |
microscopy |
| T5478 |
26632-26633 |
. |
denotes |
. |
| T5479 |
26633-26829 |
sentence |
denotes |
A priori, the decrease in α-catenin levels could be due to either direct transcriptional repression by Snail or perturbations in AJ formation caused by the decrease in E-cadherin gene expression. |
| T5480 |
26634-26635 |
FW |
denotes |
A |
| T5481 |
26636-26642 |
FW |
denotes |
priori |
| T5483 |
26642-26644 |
, |
denotes |
, |
| T5484 |
26644-26647 |
DT |
denotes |
the |
| T5485 |
26648-26656 |
NN |
denotes |
decrease |
| T5486 |
26657-26659 |
IN |
denotes |
in |
| T5487 |
26660-26661 |
NN |
denotes |
α |
| T5489 |
26661-26662 |
HYPH |
denotes |
- |
| T5488 |
26662-26669 |
NN |
denotes |
catenin |
| T5490 |
26670-26676 |
NNS |
denotes |
levels |
| T5491 |
26677-26682 |
MD |
denotes |
could |
| T5482 |
26683-26685 |
VB |
denotes |
be |
| T5492 |
26686-26689 |
IN |
denotes |
due |
| T5493 |
26690-26692 |
IN |
denotes |
to |
| T5494 |
26693-26699 |
CC |
denotes |
either |
| T5496 |
26700-26706 |
JJ |
denotes |
direct |
| T5497 |
26707-26722 |
JJ |
denotes |
transcriptional |
| T5495 |
26723-26733 |
NN |
denotes |
repression |
| T5498 |
26734-26736 |
IN |
denotes |
by |
| T5499 |
26737-26742 |
NN |
denotes |
Snail |
| T5500 |
26743-26745 |
CC |
denotes |
or |
| T5501 |
26746-26759 |
NNS |
denotes |
perturbations |
| T5502 |
26760-26762 |
IN |
denotes |
in |
| T5503 |
26763-26765 |
NN |
denotes |
AJ |
| T5504 |
26766-26775 |
NN |
denotes |
formation |
| T5505 |
26776-26782 |
VBN |
denotes |
caused |
| T5506 |
26783-26785 |
IN |
denotes |
by |
| T5507 |
26786-26789 |
DT |
denotes |
the |
| T5508 |
26790-26798 |
NN |
denotes |
decrease |
| T5509 |
26799-26801 |
IN |
denotes |
in |
| T5510 |
26802-26803 |
NN |
denotes |
E |
| T5512 |
26803-26804 |
HYPH |
denotes |
- |
| T5511 |
26804-26812 |
NN |
denotes |
cadherin |
| T5514 |
26813-26817 |
NN |
denotes |
gene |
| T5513 |
26818-26828 |
NN |
denotes |
expression |
| T5515 |
26828-26829 |
. |
denotes |
. |
| T5516 |
26829-26999 |
sentence |
denotes |
To distinguish between these possibilities, we tested whether α-catenin levels could be restored by exogenous expression of E-cadherin in Snail-expressing keratinocytes. |
| T5517 |
26830-26832 |
TO |
denotes |
To |
| T5518 |
26833-26844 |
VB |
denotes |
distinguish |
| T5520 |
26845-26852 |
IN |
denotes |
between |
| T5521 |
26853-26858 |
DT |
denotes |
these |
| T5522 |
26859-26872 |
NNS |
denotes |
possibilities |
| T5523 |
26872-26874 |
, |
denotes |
, |
| T5524 |
26874-26876 |
PRP |
denotes |
we |
| T5519 |
26877-26883 |
VBD |
denotes |
tested |
| T5525 |
26884-26891 |
IN |
denotes |
whether |
| T5527 |
26892-26893 |
NN |
denotes |
α |
| T5529 |
26893-26894 |
HYPH |
denotes |
- |
| T5528 |
26894-26901 |
NN |
denotes |
catenin |
| T5530 |
26902-26908 |
NNS |
denotes |
levels |
| T5531 |
26909-26914 |
MD |
denotes |
could |
| T5532 |
26915-26917 |
VB |
denotes |
be |
| T5526 |
26918-26926 |
VBN |
denotes |
restored |
| T5533 |
26927-26929 |
IN |
denotes |
by |
| T5534 |
26930-26939 |
JJ |
denotes |
exogenous |
| T5535 |
26940-26950 |
NN |
denotes |
expression |
| T5536 |
26951-26953 |
IN |
denotes |
of |
| T5537 |
26954-26955 |
NN |
denotes |
E |
| T5539 |
26955-26956 |
HYPH |
denotes |
- |
| T5538 |
26956-26964 |
NN |
denotes |
cadherin |
| T5540 |
26965-26967 |
IN |
denotes |
in |
| T5541 |
26968-26973 |
NN |
denotes |
Snail |
| T5543 |
26973-26974 |
HYPH |
denotes |
- |
| T5542 |
26974-26984 |
VBG |
denotes |
expressing |
| T5544 |
26985-26998 |
NNS |
denotes |
keratinocytes |
| T5545 |
26998-26999 |
. |
denotes |
. |
| T5546 |
26999-27154 |
sentence |
denotes |
As shown in Figure 4C, transiently transfected keratinocytes expressing HA-tagged Snail displayed a loss of E-cadherin and α-catenin at cell-cell borders. |
| T5547 |
27000-27002 |
IN |
denotes |
As |
| T5548 |
27003-27008 |
VBN |
denotes |
shown |
| T5550 |
27009-27011 |
IN |
denotes |
in |
| T5551 |
27012-27018 |
NN |
denotes |
Figure |
| T5552 |
27019-27021 |
NN |
denotes |
4C |
| T5553 |
27021-27023 |
, |
denotes |
, |
| T5554 |
27023-27034 |
RB |
denotes |
transiently |
| T5555 |
27035-27046 |
VBN |
denotes |
transfected |
| T5556 |
27047-27060 |
NNS |
denotes |
keratinocytes |
| T5557 |
27061-27071 |
VBG |
denotes |
expressing |
| T5558 |
27072-27074 |
NN |
denotes |
HA |
| T5560 |
27074-27075 |
HYPH |
denotes |
- |
| T5559 |
27075-27081 |
VBN |
denotes |
tagged |
| T5561 |
27082-27087 |
NN |
denotes |
Snail |
| T5549 |
27088-27097 |
VBD |
denotes |
displayed |
| T5562 |
27098-27099 |
DT |
denotes |
a |
| T5563 |
27100-27104 |
NN |
denotes |
loss |
| T5564 |
27105-27107 |
IN |
denotes |
of |
| T5565 |
27108-27109 |
NN |
denotes |
E |
| T5567 |
27109-27110 |
HYPH |
denotes |
- |
| T5566 |
27110-27118 |
NN |
denotes |
cadherin |
| T5568 |
27119-27122 |
CC |
denotes |
and |
| T5569 |
27123-27124 |
NN |
denotes |
α |
| T5571 |
27124-27125 |
HYPH |
denotes |
- |
| T5570 |
27125-27132 |
NN |
denotes |
catenin |
| T5572 |
27133-27135 |
IN |
denotes |
at |
| T5573 |
27136-27140 |
NN |
denotes |
cell |
| T5575 |
27140-27141 |
HYPH |
denotes |
- |
| T5574 |
27141-27145 |
NN |
denotes |
cell |
| T5576 |
27146-27153 |
NNS |
denotes |
borders |
| T5577 |
27153-27154 |
. |
denotes |
. |
| T5578 |
27154-27344 |
sentence |
denotes |
Coexpression of exogenous HA-tagged E-cadherin not only enabled cell-cell border localization of E-cadherin protein, but also rescued the cell-cell border staining of α-catenin (Figure 4C). |
| T5579 |
27155-27167 |
NN |
denotes |
Coexpression |
| T5581 |
27168-27170 |
IN |
denotes |
of |
| T5582 |
27171-27180 |
JJ |
denotes |
exogenous |
| T5584 |
27181-27183 |
NN |
denotes |
HA |
| T5586 |
27183-27184 |
HYPH |
denotes |
- |
| T5585 |
27184-27190 |
VBN |
denotes |
tagged |
| T5587 |
27191-27192 |
NN |
denotes |
E |
| T5588 |
27192-27193 |
HYPH |
denotes |
- |
| T5583 |
27193-27201 |
NN |
denotes |
cadherin |
| T5589 |
27202-27205 |
RB |
denotes |
not |
| T5590 |
27206-27210 |
RB |
denotes |
only |
| T5580 |
27211-27218 |
VBD |
denotes |
enabled |
| T5591 |
27219-27223 |
NN |
denotes |
cell |
| T5593 |
27223-27224 |
HYPH |
denotes |
- |
| T5592 |
27224-27228 |
NN |
denotes |
cell |
| T5595 |
27229-27235 |
NN |
denotes |
border |
| T5594 |
27236-27248 |
NN |
denotes |
localization |
| T5596 |
27249-27251 |
IN |
denotes |
of |
| T5597 |
27252-27253 |
NN |
denotes |
E |
| T5599 |
27253-27254 |
HYPH |
denotes |
- |
| T5598 |
27254-27262 |
NN |
denotes |
cadherin |
| T5600 |
27263-27270 |
NN |
denotes |
protein |
| T5601 |
27270-27272 |
, |
denotes |
, |
| T5602 |
27272-27275 |
CC |
denotes |
but |
| T5603 |
27276-27280 |
RB |
denotes |
also |
| T5604 |
27281-27288 |
VBD |
denotes |
rescued |
| T5605 |
27289-27292 |
DT |
denotes |
the |
| T5607 |
27293-27297 |
NN |
denotes |
cell |
| T5609 |
27297-27298 |
HYPH |
denotes |
- |
| T5608 |
27298-27302 |
NN |
denotes |
cell |
| T5610 |
27303-27309 |
NN |
denotes |
border |
| T5606 |
27310-27318 |
NN |
denotes |
staining |
| T5611 |
27319-27321 |
IN |
denotes |
of |
| T5612 |
27322-27323 |
NN |
denotes |
α |
| T5614 |
27323-27324 |
HYPH |
denotes |
- |
| T5613 |
27324-27331 |
NN |
denotes |
catenin |
| T5615 |
27332-27333 |
-LRB- |
denotes |
( |
| T5617 |
27333-27339 |
NN |
denotes |
Figure |
| T5616 |
27340-27342 |
NN |
denotes |
4C |
| T5618 |
27342-27343 |
-RRB- |
denotes |
) |
| T5619 |
27343-27344 |
. |
denotes |
. |
| T5620 |
27344-27504 |
sentence |
denotes |
The ability to restore α-catenin expression and localization under these conditions argues against the notion that Snail transcriptionally represses α-catenin. |
| T5621 |
27345-27348 |
DT |
denotes |
The |
| T5622 |
27349-27356 |
NN |
denotes |
ability |
| T5624 |
27357-27359 |
TO |
denotes |
to |
| T5625 |
27360-27367 |
VB |
denotes |
restore |
| T5626 |
27368-27369 |
NN |
denotes |
α |
| T5628 |
27369-27370 |
HYPH |
denotes |
- |
| T5627 |
27370-27377 |
NN |
denotes |
catenin |
| T5629 |
27378-27388 |
NN |
denotes |
expression |
| T5630 |
27389-27392 |
CC |
denotes |
and |
| T5631 |
27393-27405 |
NN |
denotes |
localization |
| T5632 |
27406-27411 |
IN |
denotes |
under |
| T5633 |
27412-27417 |
DT |
denotes |
these |
| T5634 |
27418-27428 |
NNS |
denotes |
conditions |
| T5623 |
27429-27435 |
VBZ |
denotes |
argues |
| T5635 |
27436-27443 |
IN |
denotes |
against |
| T5636 |
27444-27447 |
DT |
denotes |
the |
| T5637 |
27448-27454 |
NN |
denotes |
notion |
| T5638 |
27455-27459 |
IN |
denotes |
that |
| T5640 |
27460-27465 |
NN |
denotes |
Snail |
| T5641 |
27466-27483 |
RB |
denotes |
transcriptionally |
| T5639 |
27484-27493 |
VBZ |
denotes |
represses |
| T5642 |
27494-27495 |
NN |
denotes |
α |
| T5644 |
27495-27496 |
HYPH |
denotes |
- |
| T5643 |
27496-27503 |
NN |
denotes |
catenin |
| T5645 |
27503-27504 |
. |
denotes |
. |
| T5646 |
27504-27635 |
sentence |
denotes |
Rather, the findings are consistent with a previous report that E-cadherin is required for the translation of α-catenin mRNA [22]. |
| T5647 |
27505-27511 |
RB |
denotes |
Rather |
| T5649 |
27511-27513 |
, |
denotes |
, |
| T5650 |
27513-27516 |
DT |
denotes |
the |
| T5651 |
27517-27525 |
NNS |
denotes |
findings |
| T5648 |
27526-27529 |
VBP |
denotes |
are |
| T5652 |
27530-27540 |
JJ |
denotes |
consistent |
| T5653 |
27541-27545 |
IN |
denotes |
with |
| T5654 |
27546-27547 |
DT |
denotes |
a |
| T5656 |
27548-27556 |
JJ |
denotes |
previous |
| T5655 |
27557-27563 |
NN |
denotes |
report |
| T5657 |
27564-27568 |
IN |
denotes |
that |
| T5659 |
27569-27570 |
NN |
denotes |
E |
| T5661 |
27570-27571 |
HYPH |
denotes |
- |
| T5660 |
27571-27579 |
NN |
denotes |
cadherin |
| T5662 |
27580-27582 |
VBZ |
denotes |
is |
| T5658 |
27583-27591 |
VBN |
denotes |
required |
| T5663 |
27592-27595 |
IN |
denotes |
for |
| T5664 |
27596-27599 |
DT |
denotes |
the |
| T5665 |
27600-27611 |
NN |
denotes |
translation |
| T5666 |
27612-27614 |
IN |
denotes |
of |
| T5667 |
27615-27616 |
NN |
denotes |
α |
| T5669 |
27616-27617 |
HYPH |
denotes |
- |
| T5668 |
27617-27624 |
NN |
denotes |
catenin |
| T5670 |
27625-27629 |
NN |
denotes |
mRNA |
| T5671 |
27630-27631 |
-LRB- |
denotes |
[ |
| T5672 |
27631-27633 |
CD |
denotes |
22 |
| T5673 |
27633-27634 |
-RRB- |
denotes |
] |
| T5674 |
27634-27635 |
. |
denotes |
. |
| T5675 |
27635-27826 |
sentence |
denotes |
Despite the reductions in AJ markers, Tg skin still displayed sealed membranes and intercellular junctions that were largely intact, as judged by ultrastructural analyses (unpublished data). |
| T5676 |
27636-27643 |
IN |
denotes |
Despite |
| T5678 |
27644-27647 |
DT |
denotes |
the |
| T5679 |
27648-27658 |
NNS |
denotes |
reductions |
| T5680 |
27659-27661 |
IN |
denotes |
in |
| T5681 |
27662-27664 |
NN |
denotes |
AJ |
| T5682 |
27665-27672 |
NNS |
denotes |
markers |
| T5683 |
27672-27674 |
, |
denotes |
, |
| T5684 |
27674-27676 |
NN |
denotes |
Tg |
| T5685 |
27677-27681 |
NN |
denotes |
skin |
| T5686 |
27682-27687 |
RB |
denotes |
still |
| T5677 |
27688-27697 |
VBD |
denotes |
displayed |
| T5687 |
27698-27704 |
JJ |
denotes |
sealed |
| T5688 |
27705-27714 |
NNS |
denotes |
membranes |
| T5689 |
27715-27718 |
CC |
denotes |
and |
| T5690 |
27719-27732 |
JJ |
denotes |
intercellular |
| T5691 |
27733-27742 |
NNS |
denotes |
junctions |
| T5692 |
27743-27747 |
WDT |
denotes |
that |
| T5693 |
27748-27752 |
VBD |
denotes |
were |
| T5694 |
27753-27760 |
RB |
denotes |
largely |
| T5695 |
27761-27767 |
JJ |
denotes |
intact |
| T5696 |
27767-27769 |
, |
denotes |
, |
| T5697 |
27769-27771 |
IN |
denotes |
as |
| T5698 |
27772-27778 |
VBN |
denotes |
judged |
| T5699 |
27779-27781 |
IN |
denotes |
by |
| T5700 |
27782-27797 |
JJ |
denotes |
ultrastructural |
| T5701 |
27798-27806 |
NNS |
denotes |
analyses |
| T5702 |
27807-27808 |
-LRB- |
denotes |
( |
| T5704 |
27808-27819 |
JJ |
denotes |
unpublished |
| T5703 |
27820-27824 |
NNS |
denotes |
data |
| T5705 |
27824-27825 |
-RRB- |
denotes |
) |
| T5706 |
27825-27826 |
. |
denotes |
. |
| T5707 |
27826-28024 |
sentence |
denotes |
In this respect, the skin epithelium resembled that of the hair bud, where the down-regulation in junction proteins is permissive for cell-cell remodeling without abrogating intercellular adhesion. |
| T5708 |
27827-27829 |
IN |
denotes |
In |
| T5710 |
27830-27834 |
DT |
denotes |
this |
| T5711 |
27835-27842 |
NN |
denotes |
respect |
| T5712 |
27842-27844 |
, |
denotes |
, |
| T5713 |
27844-27847 |
DT |
denotes |
the |
| T5715 |
27848-27852 |
NN |
denotes |
skin |
| T5714 |
27853-27863 |
NN |
denotes |
epithelium |
| T5709 |
27864-27873 |
VBD |
denotes |
resembled |
| T5716 |
27874-27878 |
DT |
denotes |
that |
| T5717 |
27879-27881 |
IN |
denotes |
of |
| T5718 |
27882-27885 |
DT |
denotes |
the |
| T5720 |
27886-27890 |
NN |
denotes |
hair |
| T5719 |
27891-27894 |
NN |
denotes |
bud |
| T5721 |
27894-27896 |
, |
denotes |
, |
| T5722 |
27896-27901 |
WRB |
denotes |
where |
| T5724 |
27902-27905 |
DT |
denotes |
the |
| T5726 |
27906-27910 |
JJ |
denotes |
down |
| T5727 |
27910-27911 |
HYPH |
denotes |
- |
| T5725 |
27911-27921 |
NN |
denotes |
regulation |
| T5728 |
27922-27924 |
IN |
denotes |
in |
| T5729 |
27925-27933 |
NN |
denotes |
junction |
| T5730 |
27934-27942 |
NN |
denotes |
proteins |
| T5723 |
27943-27945 |
VBZ |
denotes |
is |
| T5731 |
27946-27956 |
JJ |
denotes |
permissive |
| T5732 |
27957-27960 |
IN |
denotes |
for |
| T5733 |
27961-27965 |
NN |
denotes |
cell |
| T5735 |
27965-27966 |
HYPH |
denotes |
- |
| T5734 |
27966-27970 |
NN |
denotes |
cell |
| T5736 |
27971-27981 |
NN |
denotes |
remodeling |
| T5737 |
27982-27989 |
IN |
denotes |
without |
| T5738 |
27990-28000 |
VBG |
denotes |
abrogating |
| T5739 |
28001-28014 |
JJ |
denotes |
intercellular |
| T5740 |
28015-28023 |
NN |
denotes |
adhesion |
| T5741 |
28023-28024 |
. |
denotes |
. |
| T5742 |
28024-28224 |
sentence |
denotes |
The similarities between Snail Tg epidermis and hair buds extended to the hyperproliferative state, leading us to wonder whether the down-regulation of AJ proteins might contribute to this condition. |
| T5743 |
28025-28028 |
DT |
denotes |
The |
| T5744 |
28029-28041 |
NNS |
denotes |
similarities |
| T5746 |
28042-28049 |
IN |
denotes |
between |
| T5747 |
28050-28055 |
NN |
denotes |
Snail |
| T5749 |
28056-28058 |
NN |
denotes |
Tg |
| T5748 |
28059-28068 |
NN |
denotes |
epidermis |
| T5750 |
28069-28072 |
CC |
denotes |
and |
| T5751 |
28073-28077 |
NN |
denotes |
hair |
| T5752 |
28078-28082 |
NNS |
denotes |
buds |
| T5745 |
28083-28091 |
VBD |
denotes |
extended |
| T5753 |
28092-28094 |
IN |
denotes |
to |
| T5754 |
28095-28098 |
DT |
denotes |
the |
| T5756 |
28099-28117 |
JJ |
denotes |
hyperproliferative |
| T5755 |
28118-28123 |
NN |
denotes |
state |
| T5757 |
28123-28125 |
, |
denotes |
, |
| T5758 |
28125-28132 |
VBG |
denotes |
leading |
| T5759 |
28133-28135 |
PRP |
denotes |
us |
| T5760 |
28136-28138 |
TO |
denotes |
to |
| T5761 |
28139-28145 |
VB |
denotes |
wonder |
| T5762 |
28146-28153 |
IN |
denotes |
whether |
| T5764 |
28154-28157 |
DT |
denotes |
the |
| T5766 |
28158-28162 |
JJ |
denotes |
down |
| T5767 |
28162-28163 |
HYPH |
denotes |
- |
| T5765 |
28163-28173 |
NN |
denotes |
regulation |
| T5768 |
28174-28176 |
IN |
denotes |
of |
| T5769 |
28177-28179 |
NN |
denotes |
AJ |
| T5770 |
28180-28188 |
NN |
denotes |
proteins |
| T5771 |
28189-28194 |
MD |
denotes |
might |
| T5763 |
28195-28205 |
VB |
denotes |
contribute |
| T5772 |
28206-28208 |
IN |
denotes |
to |
| T5773 |
28209-28213 |
DT |
denotes |
this |
| T5774 |
28214-28223 |
NN |
denotes |
condition |
| T5775 |
28223-28224 |
. |
denotes |
. |
| T5776 |
28224-28434 |
sentence |
denotes |
Given the increase in pMAPK staining in Snail Tg epidermis (see Figure 2G), we used pMAPK levels as our assay to test whether the loss of E-cadherin contributed to the Snail-mediated increase in proliferation. |
| T5777 |
28225-28230 |
VBN |
denotes |
Given |
| T5779 |
28231-28234 |
DT |
denotes |
the |
| T5780 |
28235-28243 |
NN |
denotes |
increase |
| T5781 |
28244-28246 |
IN |
denotes |
in |
| T5782 |
28247-28252 |
NN |
denotes |
pMAPK |
| T5783 |
28253-28261 |
NN |
denotes |
staining |
| T5784 |
28262-28264 |
IN |
denotes |
in |
| T5785 |
28265-28270 |
NN |
denotes |
Snail |
| T5787 |
28271-28273 |
NN |
denotes |
Tg |
| T5786 |
28274-28283 |
NN |
denotes |
epidermis |
| T5788 |
28284-28285 |
-LRB- |
denotes |
( |
| T5789 |
28285-28288 |
VB |
denotes |
see |
| T5790 |
28289-28295 |
NN |
denotes |
Figure |
| T5791 |
28296-28298 |
NN |
denotes |
2G |
| T5792 |
28298-28299 |
-RRB- |
denotes |
) |
| T5793 |
28299-28301 |
, |
denotes |
, |
| T5794 |
28301-28303 |
PRP |
denotes |
we |
| T5778 |
28304-28308 |
VBD |
denotes |
used |
| T5795 |
28309-28314 |
NN |
denotes |
pMAPK |
| T5796 |
28315-28321 |
NNS |
denotes |
levels |
| T5797 |
28322-28324 |
IN |
denotes |
as |
| T5798 |
28325-28328 |
PRP$ |
denotes |
our |
| T5799 |
28329-28334 |
NN |
denotes |
assay |
| T5800 |
28335-28337 |
TO |
denotes |
to |
| T5801 |
28338-28342 |
VB |
denotes |
test |
| T5802 |
28343-28350 |
IN |
denotes |
whether |
| T5804 |
28351-28354 |
DT |
denotes |
the |
| T5805 |
28355-28359 |
NN |
denotes |
loss |
| T5806 |
28360-28362 |
IN |
denotes |
of |
| T5807 |
28363-28364 |
NN |
denotes |
E |
| T5809 |
28364-28365 |
HYPH |
denotes |
- |
| T5808 |
28365-28373 |
NN |
denotes |
cadherin |
| T5803 |
28374-28385 |
VBD |
denotes |
contributed |
| T5810 |
28386-28388 |
IN |
denotes |
to |
| T5811 |
28389-28392 |
DT |
denotes |
the |
| T5813 |
28393-28398 |
NN |
denotes |
Snail |
| T5815 |
28398-28399 |
HYPH |
denotes |
- |
| T5814 |
28399-28407 |
VBN |
denotes |
mediated |
| T5812 |
28408-28416 |
NN |
denotes |
increase |
| T5816 |
28417-28419 |
IN |
denotes |
in |
| T5817 |
28420-28433 |
NN |
denotes |
proliferation |
| T5818 |
28433-28434 |
. |
denotes |
. |
| T5819 |
28434-28607 |
sentence |
denotes |
Consistent with our in vivo observations, transfected keratinocytes expressing Snail exhibited a substantial increase in pMAPK levels relative to control cells (Figure 4D). |
| T5820 |
28435-28445 |
JJ |
denotes |
Consistent |
| T5822 |
28446-28450 |
IN |
denotes |
with |
| T5823 |
28451-28454 |
PRP$ |
denotes |
our |
| T5825 |
28455-28457 |
FW |
denotes |
in |
| T5826 |
28458-28462 |
FW |
denotes |
vivo |
| T5824 |
28463-28475 |
NNS |
denotes |
observations |
| T5827 |
28475-28477 |
, |
denotes |
, |
| T5828 |
28477-28488 |
VBN |
denotes |
transfected |
| T5829 |
28489-28502 |
NNS |
denotes |
keratinocytes |
| T5830 |
28503-28513 |
VBG |
denotes |
expressing |
| T5831 |
28514-28519 |
NN |
denotes |
Snail |
| T5821 |
28520-28529 |
VBD |
denotes |
exhibited |
| T5832 |
28530-28531 |
DT |
denotes |
a |
| T5834 |
28532-28543 |
JJ |
denotes |
substantial |
| T5833 |
28544-28552 |
NN |
denotes |
increase |
| T5835 |
28553-28555 |
IN |
denotes |
in |
| T5836 |
28556-28561 |
NN |
denotes |
pMAPK |
| T5837 |
28562-28568 |
NNS |
denotes |
levels |
| T5838 |
28569-28577 |
JJ |
denotes |
relative |
| T5839 |
28578-28580 |
IN |
denotes |
to |
| T5840 |
28581-28588 |
NN |
denotes |
control |
| T5841 |
28589-28594 |
NNS |
denotes |
cells |
| T5842 |
28595-28596 |
-LRB- |
denotes |
( |
| T5844 |
28596-28602 |
NN |
denotes |
Figure |
| T5843 |
28603-28605 |
NN |
denotes |
4D |
| T5845 |
28605-28606 |
-RRB- |
denotes |
) |
| T5846 |
28606-28607 |
. |
denotes |
. |
| T5847 |
28607-28679 |
sentence |
denotes |
Coexpression of E-cadherin with Snail appeared to abrogate this effect. |
| T5848 |
28608-28620 |
NN |
denotes |
Coexpression |
| T5850 |
28621-28623 |
IN |
denotes |
of |
| T5851 |
28624-28625 |
NN |
denotes |
E |
| T5853 |
28625-28626 |
HYPH |
denotes |
- |
| T5852 |
28626-28634 |
NN |
denotes |
cadherin |
| T5854 |
28635-28639 |
IN |
denotes |
with |
| T5855 |
28640-28645 |
NN |
denotes |
Snail |
| T5849 |
28646-28654 |
VBD |
denotes |
appeared |
| T5856 |
28655-28657 |
TO |
denotes |
to |
| T5857 |
28658-28666 |
VB |
denotes |
abrogate |
| T5858 |
28667-28671 |
DT |
denotes |
this |
| T5859 |
28672-28678 |
NN |
denotes |
effect |
| T5860 |
28678-28679 |
. |
denotes |
. |
| T5861 |
28679-28890 |
sentence |
denotes |
Together, these findings raised the possibility that an AJ-associated protein that is normally sequestered at the plasma membrane may participate in a proliferation signaling pathway when AJs are deconstructed. |
| T5862 |
28680-28688 |
RB |
denotes |
Together |
| T5864 |
28688-28690 |
, |
denotes |
, |
| T5865 |
28690-28695 |
DT |
denotes |
these |
| T5866 |
28696-28704 |
NNS |
denotes |
findings |
| T5863 |
28705-28711 |
VBD |
denotes |
raised |
| T5867 |
28712-28715 |
DT |
denotes |
the |
| T5868 |
28716-28727 |
NN |
denotes |
possibility |
| T5869 |
28728-28732 |
IN |
denotes |
that |
| T5871 |
28733-28735 |
DT |
denotes |
an |
| T5873 |
28736-28738 |
NN |
denotes |
AJ |
| T5875 |
28738-28739 |
HYPH |
denotes |
- |
| T5874 |
28739-28749 |
VBN |
denotes |
associated |
| T5872 |
28750-28757 |
NN |
denotes |
protein |
| T5876 |
28758-28762 |
WDT |
denotes |
that |
| T5878 |
28763-28765 |
VBZ |
denotes |
is |
| T5879 |
28766-28774 |
RB |
denotes |
normally |
| T5877 |
28775-28786 |
VBN |
denotes |
sequestered |
| T5880 |
28787-28789 |
IN |
denotes |
at |
| T5881 |
28790-28793 |
DT |
denotes |
the |
| T5883 |
28794-28800 |
NN |
denotes |
plasma |
| T5882 |
28801-28809 |
NN |
denotes |
membrane |
| T5884 |
28810-28813 |
MD |
denotes |
may |
| T5870 |
28814-28825 |
VB |
denotes |
participate |
| T5885 |
28826-28828 |
IN |
denotes |
in |
| T5886 |
28829-28830 |
DT |
denotes |
a |
| T5888 |
28831-28844 |
NN |
denotes |
proliferation |
| T5889 |
28845-28854 |
NN |
denotes |
signaling |
| T5887 |
28855-28862 |
NN |
denotes |
pathway |
| T5890 |
28863-28867 |
WRB |
denotes |
when |
| T5892 |
28868-28871 |
NNS |
denotes |
AJs |
| T5893 |
28872-28875 |
VBP |
denotes |
are |
| T5891 |
28876-28889 |
VBN |
denotes |
deconstructed |
| T5894 |
28889-28890 |
. |
denotes |
. |
| T5895 |
28890-29130 |
sentence |
denotes |
Numerous studies have correlated a down-regulation of E-cadherin with a translocation of β-catenin to the nucleus and a transactivation of genes that are regulated by the LEF-1/T cell factor (TCF) family of DNA binding proteins [23,24,25]. |
| T5896 |
28891-28899 |
JJ |
denotes |
Numerous |
| T5897 |
28900-28907 |
NNS |
denotes |
studies |
| T5899 |
28908-28912 |
VBP |
denotes |
have |
| T5898 |
28913-28923 |
VBN |
denotes |
correlated |
| T5900 |
28924-28925 |
DT |
denotes |
a |
| T5902 |
28926-28930 |
JJ |
denotes |
down |
| T5903 |
28930-28931 |
HYPH |
denotes |
- |
| T5901 |
28931-28941 |
NN |
denotes |
regulation |
| T5904 |
28942-28944 |
IN |
denotes |
of |
| T5905 |
28945-28946 |
NN |
denotes |
E |
| T5907 |
28946-28947 |
HYPH |
denotes |
- |
| T5906 |
28947-28955 |
NN |
denotes |
cadherin |
| T5908 |
28956-28960 |
IN |
denotes |
with |
| T5909 |
28961-28962 |
DT |
denotes |
a |
| T5910 |
28963-28976 |
NN |
denotes |
translocation |
| T5911 |
28977-28979 |
IN |
denotes |
of |
| T5912 |
28980-28981 |
NN |
denotes |
β |
| T5914 |
28981-28982 |
HYPH |
denotes |
- |
| T5913 |
28982-28989 |
NN |
denotes |
catenin |
| T5915 |
28990-28992 |
IN |
denotes |
to |
| T5916 |
28993-28996 |
DT |
denotes |
the |
| T5917 |
28997-29004 |
NN |
denotes |
nucleus |
| T5918 |
29005-29008 |
CC |
denotes |
and |
| T5919 |
29009-29010 |
DT |
denotes |
a |
| T5920 |
29011-29026 |
NN |
denotes |
transactivation |
| T5921 |
29027-29029 |
IN |
denotes |
of |
| T5922 |
29030-29035 |
NNS |
denotes |
genes |
| T5923 |
29036-29040 |
WDT |
denotes |
that |
| T5925 |
29041-29044 |
VBP |
denotes |
are |
| T5924 |
29045-29054 |
VBN |
denotes |
regulated |
| T5926 |
29055-29057 |
IN |
denotes |
by |
| T5927 |
29058-29061 |
DT |
denotes |
the |
| T5929 |
29062-29065 |
NN |
denotes |
LEF |
| T5930 |
29065-29066 |
HYPH |
denotes |
- |
| T5931 |
29066-29067 |
CD |
denotes |
1 |
| T5932 |
29067-29068 |
HYPH |
denotes |
/ |
| T5933 |
29068-29069 |
NN |
denotes |
T |
| T5934 |
29070-29074 |
NN |
denotes |
cell |
| T5935 |
29075-29081 |
NN |
denotes |
factor |
| T5936 |
29082-29083 |
-LRB- |
denotes |
( |
| T5937 |
29083-29086 |
NN |
denotes |
TCF |
| T5938 |
29086-29087 |
-RRB- |
denotes |
) |
| T5928 |
29088-29094 |
NN |
denotes |
family |
| T5939 |
29095-29097 |
IN |
denotes |
of |
| T5940 |
29098-29101 |
NN |
denotes |
DNA |
| T5941 |
29102-29109 |
VBG |
denotes |
binding |
| T5942 |
29110-29118 |
NN |
denotes |
proteins |
| T5943 |
29119-29120 |
-LRB- |
denotes |
[ |
| T5945 |
29120-29122 |
CD |
denotes |
23 |
| T5946 |
29122-29123 |
, |
denotes |
, |
| T5947 |
29123-29125 |
CD |
denotes |
24 |
| T5948 |
29125-29126 |
, |
denotes |
, |
| T5944 |
29126-29128 |
CD |
denotes |
25 |
| T5949 |
29128-29129 |
-RRB- |
denotes |
] |
| T5950 |
29129-29130 |
. |
denotes |
. |
| T5951 |
29130-29336 |
sentence |
denotes |
The presence of nuclear cyclin D in hyperproliferative Snail Tg epidermis was particularly intriguing since prior studies have reported cyclin D gene as a direct target of TCF/β-catenin transcription [26]. |
| T5952 |
29131-29134 |
DT |
denotes |
The |
| T5953 |
29135-29143 |
NN |
denotes |
presence |
| T5955 |
29144-29146 |
IN |
denotes |
of |
| T5956 |
29147-29154 |
JJ |
denotes |
nuclear |
| T5958 |
29155-29161 |
NN |
denotes |
cyclin |
| T5957 |
29162-29163 |
NN |
denotes |
D |
| T5959 |
29164-29166 |
IN |
denotes |
in |
| T5960 |
29167-29185 |
JJ |
denotes |
hyperproliferative |
| T5962 |
29186-29191 |
NN |
denotes |
Snail |
| T5963 |
29192-29194 |
NN |
denotes |
Tg |
| T5961 |
29195-29204 |
NN |
denotes |
epidermis |
| T5954 |
29205-29208 |
VBD |
denotes |
was |
| T5964 |
29209-29221 |
RB |
denotes |
particularly |
| T5965 |
29222-29232 |
JJ |
denotes |
intriguing |
| T5966 |
29233-29238 |
IN |
denotes |
since |
| T5968 |
29239-29244 |
JJ |
denotes |
prior |
| T5969 |
29245-29252 |
NNS |
denotes |
studies |
| T5970 |
29253-29257 |
VBP |
denotes |
have |
| T5967 |
29258-29266 |
VBN |
denotes |
reported |
| T5971 |
29267-29273 |
NN |
denotes |
cyclin |
| T5972 |
29274-29275 |
NN |
denotes |
D |
| T5973 |
29276-29280 |
NN |
denotes |
gene |
| T5974 |
29281-29283 |
IN |
denotes |
as |
| T5975 |
29284-29285 |
DT |
denotes |
a |
| T5977 |
29286-29292 |
JJ |
denotes |
direct |
| T5976 |
29293-29299 |
NN |
denotes |
target |
| T5978 |
29300-29302 |
IN |
denotes |
of |
| T5979 |
29303-29306 |
NN |
denotes |
TCF |
| T5981 |
29306-29307 |
HYPH |
denotes |
/ |
| T5980 |
29307-29308 |
NN |
denotes |
β |
| T5983 |
29308-29309 |
HYPH |
denotes |
- |
| T5984 |
29309-29316 |
NN |
denotes |
catenin |
| T5982 |
29317-29330 |
NN |
denotes |
transcription |
| T5985 |
29331-29332 |
-LRB- |
denotes |
[ |
| T5986 |
29332-29334 |
CD |
denotes |
26 |
| T5987 |
29334-29335 |
-RRB- |
denotes |
] |
| T5988 |
29335-29336 |
. |
denotes |
. |
| T5989 |
29336-29546 |
sentence |
denotes |
This said, we did not detect nuclear β-catenin in our Tg epidermis, and mating the Snail Tg mice against the TOPGal reporter mouse [20] gave no signs of ectopic LEF-1/Tcf/β-catenin activity (unpublished data). |
| T5990 |
29337-29341 |
DT |
denotes |
This |
| T5991 |
29342-29346 |
VBN |
denotes |
said |
| T5993 |
29346-29348 |
, |
denotes |
, |
| T5994 |
29348-29350 |
PRP |
denotes |
we |
| T5995 |
29351-29354 |
VBD |
denotes |
did |
| T5996 |
29355-29358 |
RB |
denotes |
not |
| T5992 |
29359-29365 |
VB |
denotes |
detect |
| T5997 |
29366-29373 |
JJ |
denotes |
nuclear |
| T5999 |
29374-29375 |
NN |
denotes |
β |
| T6000 |
29375-29376 |
HYPH |
denotes |
- |
| T5998 |
29376-29383 |
NN |
denotes |
catenin |
| T6001 |
29384-29386 |
IN |
denotes |
in |
| T6002 |
29387-29390 |
PRP$ |
denotes |
our |
| T6004 |
29391-29393 |
NN |
denotes |
Tg |
| T6003 |
29394-29403 |
NN |
denotes |
epidermis |
| T6005 |
29403-29405 |
, |
denotes |
, |
| T6006 |
29405-29408 |
CC |
denotes |
and |
| T6007 |
29409-29415 |
VBG |
denotes |
mating |
| T6009 |
29416-29419 |
DT |
denotes |
the |
| T6011 |
29420-29425 |
NN |
denotes |
Snail |
| T6012 |
29426-29428 |
NN |
denotes |
Tg |
| T6010 |
29429-29433 |
NNS |
denotes |
mice |
| T6013 |
29434-29441 |
IN |
denotes |
against |
| T6014 |
29442-29445 |
DT |
denotes |
the |
| T6016 |
29446-29452 |
NN |
denotes |
TOPGal |
| T6017 |
29453-29461 |
NN |
denotes |
reporter |
| T6015 |
29462-29467 |
NN |
denotes |
mouse |
| T6018 |
29468-29469 |
-LRB- |
denotes |
[ |
| T6019 |
29469-29471 |
CD |
denotes |
20 |
| T6020 |
29471-29472 |
-RRB- |
denotes |
] |
| T6008 |
29473-29477 |
VBD |
denotes |
gave |
| T6021 |
29478-29480 |
DT |
denotes |
no |
| T6022 |
29481-29486 |
NNS |
denotes |
signs |
| T6023 |
29487-29489 |
IN |
denotes |
of |
| T6024 |
29490-29497 |
JJ |
denotes |
ectopic |
| T6026 |
29498-29501 |
NN |
denotes |
LEF |
| T6027 |
29501-29502 |
HYPH |
denotes |
- |
| T6028 |
29502-29503 |
CD |
denotes |
1 |
| T6029 |
29503-29504 |
HYPH |
denotes |
/ |
| T6030 |
29504-29507 |
NN |
denotes |
Tcf |
| T6031 |
29507-29508 |
HYPH |
denotes |
/ |
| T6032 |
29508-29509 |
NN |
denotes |
β |
| T6034 |
29509-29510 |
HYPH |
denotes |
- |
| T6033 |
29510-29517 |
NN |
denotes |
catenin |
| T6025 |
29518-29526 |
NN |
denotes |
activity |
| T6035 |
29527-29528 |
-LRB- |
denotes |
( |
| T6037 |
29528-29539 |
JJ |
denotes |
unpublished |
| T6036 |
29540-29544 |
NNS |
denotes |
data |
| T6038 |
29544-29545 |
-RRB- |
denotes |
) |
| T6039 |
29545-29546 |
. |
denotes |
. |
| T6040 |
29546-29687 |
sentence |
denotes |
We next turned to the presence of cytoplasmic Ajuba for a possible mechanistic link to the proliferative increase in our Snail Tg epidermis. |
| T6041 |
29547-29549 |
PRP |
denotes |
We |
| T6043 |
29550-29554 |
RB |
denotes |
next |
| T6042 |
29555-29561 |
VBD |
denotes |
turned |
| T6044 |
29562-29564 |
IN |
denotes |
to |
| T6045 |
29565-29568 |
DT |
denotes |
the |
| T6046 |
29569-29577 |
NN |
denotes |
presence |
| T6047 |
29578-29580 |
IN |
denotes |
of |
| T6048 |
29581-29592 |
JJ |
denotes |
cytoplasmic |
| T6049 |
29593-29598 |
NN |
denotes |
Ajuba |
| T6050 |
29599-29602 |
IN |
denotes |
for |
| T6051 |
29603-29604 |
DT |
denotes |
a |
| T6053 |
29605-29613 |
JJ |
denotes |
possible |
| T6054 |
29614-29625 |
JJ |
denotes |
mechanistic |
| T6052 |
29626-29630 |
NN |
denotes |
link |
| T6055 |
29631-29633 |
IN |
denotes |
to |
| T6056 |
29634-29637 |
DT |
denotes |
the |
| T6058 |
29638-29651 |
JJ |
denotes |
proliferative |
| T6057 |
29652-29660 |
NN |
denotes |
increase |
| T6059 |
29661-29663 |
IN |
denotes |
in |
| T6060 |
29664-29667 |
PRP$ |
denotes |
our |
| T6062 |
29668-29673 |
NN |
denotes |
Snail |
| T6063 |
29674-29676 |
NN |
denotes |
Tg |
| T6061 |
29677-29686 |
NN |
denotes |
epidermis |
| T6064 |
29686-29687 |
. |
denotes |
. |
| T6065 |
29687-29937 |
sentence |
denotes |
In addition to its documented ability to bind α-catenin [10], Ajuba can also associate with growth factor receptor-bound protein-2 (Grb-2)/son of sevenless (Sos), the nucleotide exchange factor for Ras, which is upstream from activation of MAPK [9]. |
| T6066 |
29688-29690 |
IN |
denotes |
In |
| T6068 |
29691-29699 |
NN |
denotes |
addition |
| T6069 |
29700-29702 |
IN |
denotes |
to |
| T6070 |
29703-29706 |
PRP$ |
denotes |
its |
| T6072 |
29707-29717 |
VBN |
denotes |
documented |
| T6071 |
29718-29725 |
NN |
denotes |
ability |
| T6073 |
29726-29728 |
TO |
denotes |
to |
| T6074 |
29729-29733 |
VB |
denotes |
bind |
| T6075 |
29734-29735 |
NN |
denotes |
α |
| T6077 |
29735-29736 |
HYPH |
denotes |
- |
| T6076 |
29736-29743 |
NN |
denotes |
catenin |
| T6078 |
29744-29745 |
-LRB- |
denotes |
[ |
| T6079 |
29745-29747 |
CD |
denotes |
10 |
| T6080 |
29747-29748 |
-RRB- |
denotes |
] |
| T6081 |
29748-29750 |
, |
denotes |
, |
| T6082 |
29750-29755 |
NN |
denotes |
Ajuba |
| T6083 |
29756-29759 |
MD |
denotes |
can |
| T6084 |
29760-29764 |
RB |
denotes |
also |
| T6067 |
29765-29774 |
VB |
denotes |
associate |
| T6085 |
29775-29779 |
IN |
denotes |
with |
| T6086 |
29780-29786 |
NN |
denotes |
growth |
| T6087 |
29787-29793 |
NN |
denotes |
factor |
| T6088 |
29794-29802 |
NN |
denotes |
receptor |
| T6090 |
29802-29803 |
HYPH |
denotes |
- |
| T6089 |
29803-29808 |
JJ |
denotes |
bound |
| T6091 |
29809-29816 |
NN |
denotes |
protein |
| T6092 |
29816-29817 |
HYPH |
denotes |
- |
| T6093 |
29817-29818 |
CD |
denotes |
2 |
| T6094 |
29819-29820 |
-LRB- |
denotes |
( |
| T6095 |
29820-29823 |
NN |
denotes |
Grb |
| T6096 |
29823-29824 |
HYPH |
denotes |
- |
| T6097 |
29824-29825 |
CD |
denotes |
2 |
| T6098 |
29825-29826 |
-RRB- |
denotes |
) |
| T6099 |
29826-29827 |
HYPH |
denotes |
/ |
| T6100 |
29827-29830 |
NN |
denotes |
son |
| T6101 |
29831-29833 |
IN |
denotes |
of |
| T6102 |
29834-29843 |
NN |
denotes |
sevenless |
| T6103 |
29844-29845 |
-LRB- |
denotes |
( |
| T6104 |
29845-29848 |
NN |
denotes |
Sos |
| T6105 |
29848-29849 |
-RRB- |
denotes |
) |
| T6106 |
29849-29851 |
, |
denotes |
, |
| T6107 |
29851-29854 |
DT |
denotes |
the |
| T6109 |
29855-29865 |
NN |
denotes |
nucleotide |
| T6110 |
29866-29874 |
NN |
denotes |
exchange |
| T6108 |
29875-29881 |
NN |
denotes |
factor |
| T6111 |
29882-29885 |
IN |
denotes |
for |
| T6112 |
29886-29889 |
NN |
denotes |
Ras |
| T6113 |
29889-29891 |
, |
denotes |
, |
| T6114 |
29891-29896 |
WDT |
denotes |
which |
| T6115 |
29897-29899 |
VBZ |
denotes |
is |
| T6116 |
29900-29908 |
RB |
denotes |
upstream |
| T6117 |
29909-29913 |
IN |
denotes |
from |
| T6118 |
29914-29924 |
NN |
denotes |
activation |
| T6119 |
29925-29927 |
IN |
denotes |
of |
| T6120 |
29928-29932 |
NN |
denotes |
MAPK |
| T6121 |
29933-29934 |
-LRB- |
denotes |
[ |
| T6122 |
29934-29935 |
CD |
denotes |
9 |
| T6123 |
29935-29936 |
-RRB- |
denotes |
] |
| T6124 |
29936-29937 |
. |
denotes |
. |
| T6125 |
29937-30095 |
sentence |
denotes |
Given the increase in pMAPK staining in Tg skin, we examined the possibility that Ajuba might have changed its binding partner in Snail-expressing epidermis. |
| T6126 |
29938-29943 |
VBN |
denotes |
Given |
| T6128 |
29944-29947 |
DT |
denotes |
the |
| T6129 |
29948-29956 |
NN |
denotes |
increase |
| T6130 |
29957-29959 |
IN |
denotes |
in |
| T6131 |
29960-29965 |
NN |
denotes |
pMAPK |
| T6132 |
29966-29974 |
NN |
denotes |
staining |
| T6133 |
29975-29977 |
IN |
denotes |
in |
| T6134 |
29978-29980 |
NN |
denotes |
Tg |
| T6135 |
29981-29985 |
NN |
denotes |
skin |
| T6136 |
29985-29987 |
, |
denotes |
, |
| T6137 |
29987-29989 |
PRP |
denotes |
we |
| T6127 |
29990-29998 |
VBD |
denotes |
examined |
| T6138 |
29999-30002 |
DT |
denotes |
the |
| T6139 |
30003-30014 |
NN |
denotes |
possibility |
| T6140 |
30015-30019 |
IN |
denotes |
that |
| T6142 |
30020-30025 |
NN |
denotes |
Ajuba |
| T6143 |
30026-30031 |
MD |
denotes |
might |
| T6144 |
30032-30036 |
VB |
denotes |
have |
| T6141 |
30037-30044 |
VBN |
denotes |
changed |
| T6145 |
30045-30048 |
PRP$ |
denotes |
its |
| T6147 |
30049-30056 |
NN |
denotes |
binding |
| T6146 |
30057-30064 |
NN |
denotes |
partner |
| T6148 |
30065-30067 |
IN |
denotes |
in |
| T6149 |
30068-30073 |
NN |
denotes |
Snail |
| T6151 |
30073-30074 |
HYPH |
denotes |
- |
| T6150 |
30074-30084 |
VBG |
denotes |
expressing |
| T6152 |
30085-30094 |
NN |
denotes |
epidermis |
| T6153 |
30094-30095 |
. |
denotes |
. |
| T6154 |
30095-30284 |
sentence |
denotes |
Interestingly, Ajuba was readily detected in anti-Grb-2 immunoprecipitates of protein lysates from skins of Snail Tg mice but not from the corresponding wild-type (WT) animals (Figure 4E). |
| T6155 |
30096-30109 |
RB |
denotes |
Interestingly |
| T6157 |
30109-30111 |
, |
denotes |
, |
| T6158 |
30111-30116 |
NN |
denotes |
Ajuba |
| T6159 |
30117-30120 |
VBD |
denotes |
was |
| T6160 |
30121-30128 |
RB |
denotes |
readily |
| T6156 |
30129-30137 |
VBN |
denotes |
detected |
| T6161 |
30138-30140 |
IN |
denotes |
in |
| T6162 |
30141-30149 |
JJ |
denotes |
anti-Grb |
| T6164 |
30149-30150 |
HYPH |
denotes |
- |
| T6165 |
30150-30151 |
CD |
denotes |
2 |
| T6163 |
30152-30170 |
NNS |
denotes |
immunoprecipitates |
| T6166 |
30171-30173 |
IN |
denotes |
of |
| T6167 |
30174-30181 |
NN |
denotes |
protein |
| T6168 |
30182-30189 |
NNS |
denotes |
lysates |
| T6169 |
30190-30194 |
IN |
denotes |
from |
| T6170 |
30195-30200 |
NNS |
denotes |
skins |
| T6171 |
30201-30203 |
IN |
denotes |
of |
| T6172 |
30204-30209 |
NN |
denotes |
Snail |
| T6174 |
30210-30212 |
NN |
denotes |
Tg |
| T6173 |
30213-30217 |
NNS |
denotes |
mice |
| T6175 |
30218-30221 |
CC |
denotes |
but |
| T6176 |
30222-30225 |
RB |
denotes |
not |
| T6177 |
30226-30230 |
IN |
denotes |
from |
| T6178 |
30231-30234 |
DT |
denotes |
the |
| T6180 |
30235-30248 |
JJ |
denotes |
corresponding |
| T6181 |
30249-30253 |
JJ |
denotes |
wild |
| T6183 |
30253-30254 |
HYPH |
denotes |
- |
| T6182 |
30254-30258 |
NN |
denotes |
type |
| T6184 |
30259-30260 |
-LRB- |
denotes |
( |
| T6185 |
30260-30262 |
NN |
denotes |
WT |
| T6186 |
30262-30263 |
-RRB- |
denotes |
) |
| T6179 |
30264-30271 |
NNS |
denotes |
animals |
| T6187 |
30272-30273 |
-LRB- |
denotes |
( |
| T6189 |
30273-30279 |
NN |
denotes |
Figure |
| T6188 |
30280-30282 |
NN |
denotes |
4E |
| T6190 |
30282-30283 |
-RRB- |
denotes |
) |
| T6191 |
30283-30284 |
. |
denotes |
. |
| T6192 |
30284-30511 |
sentence |
denotes |
When these experiments were repeated with α-catenin-null epidermis, a similar Grb-2-Ajuba association was detected, and again, this interaction was not detected in the protein extracts from control littermate skin (Figure 4E). |
| T6193 |
30285-30289 |
WRB |
denotes |
When |
| T6195 |
30290-30295 |
DT |
denotes |
these |
| T6196 |
30296-30307 |
NNS |
denotes |
experiments |
| T6197 |
30308-30312 |
VBD |
denotes |
were |
| T6194 |
30313-30321 |
VBN |
denotes |
repeated |
| T6199 |
30322-30326 |
IN |
denotes |
with |
| T6200 |
30327-30328 |
NN |
denotes |
α |
| T6202 |
30328-30329 |
HYPH |
denotes |
- |
| T6201 |
30329-30336 |
NN |
denotes |
catenin |
| T6204 |
30336-30337 |
HYPH |
denotes |
- |
| T6203 |
30337-30341 |
JJ |
denotes |
null |
| T6205 |
30342-30351 |
NN |
denotes |
epidermis |
| T6206 |
30351-30353 |
, |
denotes |
, |
| T6207 |
30353-30354 |
DT |
denotes |
a |
| T6209 |
30355-30362 |
JJ |
denotes |
similar |
| T6210 |
30363-30366 |
NN |
denotes |
Grb |
| T6212 |
30366-30367 |
HYPH |
denotes |
- |
| T6213 |
30367-30368 |
CD |
denotes |
2 |
| T6214 |
30368-30369 |
HYPH |
denotes |
- |
| T6211 |
30369-30374 |
NN |
denotes |
Ajuba |
| T6208 |
30375-30386 |
NN |
denotes |
association |
| T6215 |
30387-30390 |
VBD |
denotes |
was |
| T6198 |
30391-30399 |
VBN |
denotes |
detected |
| T6216 |
30399-30401 |
, |
denotes |
, |
| T6217 |
30401-30404 |
CC |
denotes |
and |
| T6218 |
30405-30410 |
RB |
denotes |
again |
| T6220 |
30410-30412 |
, |
denotes |
, |
| T6221 |
30412-30416 |
DT |
denotes |
this |
| T6222 |
30417-30428 |
NN |
denotes |
interaction |
| T6223 |
30429-30432 |
VBD |
denotes |
was |
| T6224 |
30433-30436 |
RB |
denotes |
not |
| T6219 |
30437-30445 |
VBN |
denotes |
detected |
| T6225 |
30446-30448 |
IN |
denotes |
in |
| T6226 |
30449-30452 |
DT |
denotes |
the |
| T6228 |
30453-30460 |
NN |
denotes |
protein |
| T6227 |
30461-30469 |
NNS |
denotes |
extracts |
| T6229 |
30470-30474 |
IN |
denotes |
from |
| T6230 |
30475-30482 |
NN |
denotes |
control |
| T6232 |
30483-30493 |
NN |
denotes |
littermate |
| T6231 |
30494-30498 |
NN |
denotes |
skin |
| T6233 |
30499-30500 |
-LRB- |
denotes |
( |
| T6235 |
30500-30506 |
NN |
denotes |
Figure |
| T6234 |
30507-30509 |
NN |
denotes |
4E |
| T6236 |
30509-30510 |
-RRB- |
denotes |
) |
| T6237 |
30510-30511 |
. |
denotes |
. |
| T6238 |
30511-30719 |
sentence |
denotes |
Together, these data demonstrate that the reduction in α-catenin levels, either by Snail-mediated down-regulation of E-cadherin or by α-catenin conditional targeting, allows Ajuba to interact with Grb-2/Sos. |
| T6239 |
30512-30520 |
RB |
denotes |
Together |
| T6241 |
30520-30522 |
, |
denotes |
, |
| T6242 |
30522-30527 |
DT |
denotes |
these |
| T6243 |
30528-30532 |
NNS |
denotes |
data |
| T6240 |
30533-30544 |
VBP |
denotes |
demonstrate |
| T6244 |
30545-30549 |
IN |
denotes |
that |
| T6246 |
30550-30553 |
DT |
denotes |
the |
| T6247 |
30554-30563 |
NN |
denotes |
reduction |
| T6248 |
30564-30566 |
IN |
denotes |
in |
| T6249 |
30567-30568 |
NN |
denotes |
α |
| T6251 |
30568-30569 |
HYPH |
denotes |
- |
| T6250 |
30569-30576 |
NN |
denotes |
catenin |
| T6252 |
30577-30583 |
NNS |
denotes |
levels |
| T6253 |
30583-30585 |
, |
denotes |
, |
| T6254 |
30585-30591 |
CC |
denotes |
either |
| T6255 |
30592-30594 |
IN |
denotes |
by |
| T6256 |
30595-30600 |
NN |
denotes |
Snail |
| T6258 |
30600-30601 |
HYPH |
denotes |
- |
| T6257 |
30601-30609 |
VBN |
denotes |
mediated |
| T6260 |
30610-30614 |
JJ |
denotes |
down |
| T6261 |
30614-30615 |
HYPH |
denotes |
- |
| T6259 |
30615-30625 |
NN |
denotes |
regulation |
| T6262 |
30626-30628 |
IN |
denotes |
of |
| T6263 |
30629-30630 |
NN |
denotes |
E |
| T6265 |
30630-30631 |
HYPH |
denotes |
- |
| T6264 |
30631-30639 |
NN |
denotes |
cadherin |
| T6266 |
30640-30642 |
CC |
denotes |
or |
| T6267 |
30643-30645 |
IN |
denotes |
by |
| T6268 |
30646-30647 |
NN |
denotes |
α |
| T6270 |
30647-30648 |
HYPH |
denotes |
- |
| T6269 |
30648-30655 |
NN |
denotes |
catenin |
| T6271 |
30656-30667 |
JJ |
denotes |
conditional |
| T6272 |
30668-30677 |
NN |
denotes |
targeting |
| T6273 |
30677-30679 |
, |
denotes |
, |
| T6245 |
30679-30685 |
VBZ |
denotes |
allows |
| T6274 |
30686-30691 |
NN |
denotes |
Ajuba |
| T6276 |
30692-30694 |
TO |
denotes |
to |
| T6275 |
30695-30703 |
VB |
denotes |
interact |
| T6277 |
30704-30708 |
IN |
denotes |
with |
| T6278 |
30709-30712 |
NN |
denotes |
Grb |
| T6279 |
30712-30713 |
HYPH |
denotes |
- |
| T6280 |
30713-30714 |
CD |
denotes |
2 |
| T6281 |
30714-30715 |
HYPH |
denotes |
/ |
| T6282 |
30715-30718 |
NN |
denotes |
Sos |
| T6283 |
30718-30719 |
. |
denotes |
. |
| T6284 |
30719-30997 |
sentence |
denotes |
If the competition between Grb-2/Sos and α-catenin for Ajuba is functionally relevant to the hyperproliferative state of a keratinocyte, then overexpression of Ajuba would be expected to bypass the competition and promote activation of the Ras-MAPK pathway in WT keratinocytes. |
| T6285 |
30720-30722 |
IN |
denotes |
If |
| T6287 |
30723-30726 |
DT |
denotes |
the |
| T6288 |
30727-30738 |
NN |
denotes |
competition |
| T6289 |
30739-30746 |
IN |
denotes |
between |
| T6290 |
30747-30750 |
NN |
denotes |
Grb |
| T6291 |
30750-30751 |
HYPH |
denotes |
- |
| T6292 |
30751-30752 |
CD |
denotes |
2 |
| T6293 |
30752-30753 |
HYPH |
denotes |
/ |
| T6294 |
30753-30756 |
NN |
denotes |
Sos |
| T6295 |
30757-30760 |
CC |
denotes |
and |
| T6296 |
30761-30762 |
NN |
denotes |
α |
| T6298 |
30762-30763 |
HYPH |
denotes |
- |
| T6297 |
30763-30770 |
NN |
denotes |
catenin |
| T6299 |
30771-30774 |
IN |
denotes |
for |
| T6300 |
30775-30780 |
NN |
denotes |
Ajuba |
| T6286 |
30781-30783 |
VBZ |
denotes |
is |
| T6302 |
30784-30796 |
RB |
denotes |
functionally |
| T6303 |
30797-30805 |
JJ |
denotes |
relevant |
| T6304 |
30806-30808 |
IN |
denotes |
to |
| T6305 |
30809-30812 |
DT |
denotes |
the |
| T6307 |
30813-30831 |
JJ |
denotes |
hyperproliferative |
| T6306 |
30832-30837 |
NN |
denotes |
state |
| T6308 |
30838-30840 |
IN |
denotes |
of |
| T6309 |
30841-30842 |
DT |
denotes |
a |
| T6310 |
30843-30855 |
NN |
denotes |
keratinocyte |
| T6311 |
30855-30857 |
, |
denotes |
, |
| T6312 |
30857-30861 |
RB |
denotes |
then |
| T6313 |
30862-30876 |
NN |
denotes |
overexpression |
| T6314 |
30877-30879 |
IN |
denotes |
of |
| T6315 |
30880-30885 |
NN |
denotes |
Ajuba |
| T6316 |
30886-30891 |
MD |
denotes |
would |
| T6317 |
30892-30894 |
VB |
denotes |
be |
| T6301 |
30895-30903 |
VBN |
denotes |
expected |
| T6318 |
30904-30906 |
TO |
denotes |
to |
| T6319 |
30907-30913 |
VB |
denotes |
bypass |
| T6320 |
30914-30917 |
DT |
denotes |
the |
| T6321 |
30918-30929 |
NN |
denotes |
competition |
| T6322 |
30930-30933 |
CC |
denotes |
and |
| T6323 |
30934-30941 |
VB |
denotes |
promote |
| T6324 |
30942-30952 |
NN |
denotes |
activation |
| T6325 |
30953-30955 |
IN |
denotes |
of |
| T6326 |
30956-30959 |
DT |
denotes |
the |
| T6328 |
30960-30963 |
NN |
denotes |
Ras |
| T6330 |
30963-30964 |
HYPH |
denotes |
- |
| T6329 |
30964-30968 |
NN |
denotes |
MAPK |
| T6327 |
30969-30976 |
NN |
denotes |
pathway |
| T6331 |
30977-30979 |
IN |
denotes |
in |
| T6332 |
30980-30982 |
NN |
denotes |
WT |
| T6333 |
30983-30996 |
NNS |
denotes |
keratinocytes |
| T6334 |
30996-30997 |
. |
denotes |
. |
| T6335 |
30997-31228 |
sentence |
denotes |
Indeed, when serum-starved keratinocytes were transiently transfected with an Ajuba expression vector, the levels of pMAPK were not only elevated but also comparable to those transfected with the K14-HASnail transgene (Figure 4F). |
| T6336 |
30998-31004 |
RB |
denotes |
Indeed |
| T6338 |
31004-31006 |
, |
denotes |
, |
| T6339 |
31006-31010 |
WRB |
denotes |
when |
| T6341 |
31011-31016 |
NN |
denotes |
serum |
| T6343 |
31016-31017 |
HYPH |
denotes |
- |
| T6342 |
31017-31024 |
VBN |
denotes |
starved |
| T6344 |
31025-31038 |
NNS |
denotes |
keratinocytes |
| T6345 |
31039-31043 |
VBD |
denotes |
were |
| T6346 |
31044-31055 |
RB |
denotes |
transiently |
| T6340 |
31056-31067 |
VBN |
denotes |
transfected |
| T6347 |
31068-31072 |
IN |
denotes |
with |
| T6348 |
31073-31075 |
DT |
denotes |
an |
| T6350 |
31076-31081 |
NN |
denotes |
Ajuba |
| T6351 |
31082-31092 |
NN |
denotes |
expression |
| T6349 |
31093-31099 |
NN |
denotes |
vector |
| T6352 |
31099-31101 |
, |
denotes |
, |
| T6353 |
31101-31104 |
DT |
denotes |
the |
| T6354 |
31105-31111 |
NNS |
denotes |
levels |
| T6355 |
31112-31114 |
IN |
denotes |
of |
| T6356 |
31115-31120 |
NN |
denotes |
pMAPK |
| T6337 |
31121-31125 |
VBD |
denotes |
were |
| T6357 |
31126-31129 |
RB |
denotes |
not |
| T6359 |
31130-31134 |
RB |
denotes |
only |
| T6358 |
31135-31143 |
JJ |
denotes |
elevated |
| T6360 |
31144-31147 |
CC |
denotes |
but |
| T6361 |
31148-31152 |
RB |
denotes |
also |
| T6362 |
31153-31163 |
JJ |
denotes |
comparable |
| T6363 |
31164-31166 |
IN |
denotes |
to |
| T6364 |
31167-31172 |
DT |
denotes |
those |
| T6365 |
31173-31184 |
VBN |
denotes |
transfected |
| T6366 |
31185-31189 |
IN |
denotes |
with |
| T6367 |
31190-31193 |
DT |
denotes |
the |
| T6369 |
31194-31197 |
NN |
denotes |
K14 |
| T6371 |
31197-31198 |
HYPH |
denotes |
- |
| T6370 |
31198-31205 |
NN |
denotes |
HASnail |
| T6368 |
31206-31215 |
NN |
denotes |
transgene |
| T6372 |
31216-31217 |
-LRB- |
denotes |
( |
| T6374 |
31217-31223 |
NN |
denotes |
Figure |
| T6373 |
31224-31226 |
NN |
denotes |
4F |
| T6375 |
31226-31227 |
-RRB- |
denotes |
) |
| T6376 |
31227-31228 |
. |
denotes |
. |
| T6377 |
31228-31410 |
sentence |
denotes |
This activation was abolished when cells were treated with a small peptide inhibitor that specifically interrupts the Grb-2/Sos interaction (Figure 4F; see lanes marked “inh”) [27]. |
| T6378 |
31229-31233 |
DT |
denotes |
This |
| T6379 |
31234-31244 |
NN |
denotes |
activation |
| T6381 |
31245-31248 |
VBD |
denotes |
was |
| T6380 |
31249-31258 |
VBN |
denotes |
abolished |
| T6382 |
31259-31263 |
WRB |
denotes |
when |
| T6384 |
31264-31269 |
NNS |
denotes |
cells |
| T6385 |
31270-31274 |
VBD |
denotes |
were |
| T6383 |
31275-31282 |
VBN |
denotes |
treated |
| T6386 |
31283-31287 |
IN |
denotes |
with |
| T6387 |
31288-31289 |
DT |
denotes |
a |
| T6389 |
31290-31295 |
JJ |
denotes |
small |
| T6390 |
31296-31303 |
NN |
denotes |
peptide |
| T6388 |
31304-31313 |
NN |
denotes |
inhibitor |
| T6391 |
31314-31318 |
WDT |
denotes |
that |
| T6393 |
31319-31331 |
RB |
denotes |
specifically |
| T6392 |
31332-31342 |
VBZ |
denotes |
interrupts |
| T6394 |
31343-31346 |
DT |
denotes |
the |
| T6396 |
31347-31350 |
NN |
denotes |
Grb |
| T6397 |
31350-31351 |
HYPH |
denotes |
- |
| T6398 |
31351-31352 |
CD |
denotes |
2 |
| T6399 |
31352-31353 |
HYPH |
denotes |
/ |
| T6400 |
31353-31356 |
NN |
denotes |
Sos |
| T6395 |
31357-31368 |
NN |
denotes |
interaction |
| T6401 |
31369-31370 |
-LRB- |
denotes |
( |
| T6403 |
31370-31376 |
NN |
denotes |
Figure |
| T6402 |
31377-31379 |
NN |
denotes |
4F |
| T6404 |
31379-31380 |
: |
denotes |
; |
| T6405 |
31381-31384 |
VB |
denotes |
see |
| T6406 |
31385-31390 |
NNS |
denotes |
lanes |
| T6407 |
31391-31397 |
VBN |
denotes |
marked |
| T6408 |
31398-31399 |
`` |
denotes |
“ |
| T6409 |
31399-31402 |
NN |
denotes |
inh |
| T6410 |
31402-31403 |
'' |
denotes |
” |
| T6411 |
31403-31404 |
-RRB- |
denotes |
) |
| T6412 |
31405-31406 |
-LRB- |
denotes |
[ |
| T6413 |
31406-31408 |
CD |
denotes |
27 |
| T6414 |
31408-31409 |
-RRB- |
denotes |
] |
| T6415 |
31409-31410 |
. |
denotes |
. |
| T6416 |
31410-31504 |
sentence |
denotes |
Ajuba's pre-LIM domain is the segment that associates with Grb-2's Src-homology 3 domain [9]. |
| T6417 |
31411-31416 |
NN |
denotes |
Ajuba |
| T6419 |
31416-31418 |
POS |
denotes |
's |
| T6420 |
31419-31426 |
JJ |
denotes |
pre-LIM |
| T6418 |
31427-31433 |
NN |
denotes |
domain |
| T6421 |
31434-31436 |
VBZ |
denotes |
is |
| T6422 |
31437-31440 |
DT |
denotes |
the |
| T6423 |
31441-31448 |
NN |
denotes |
segment |
| T6424 |
31449-31453 |
WDT |
denotes |
that |
| T6425 |
31454-31464 |
VBZ |
denotes |
associates |
| T6426 |
31465-31469 |
IN |
denotes |
with |
| T6427 |
31470-31473 |
NN |
denotes |
Grb |
| T6429 |
31473-31474 |
HYPH |
denotes |
- |
| T6430 |
31474-31475 |
CD |
denotes |
2 |
| T6431 |
31475-31477 |
POS |
denotes |
's |
| T6432 |
31478-31481 |
NN |
denotes |
Src |
| T6434 |
31481-31482 |
HYPH |
denotes |
- |
| T6433 |
31482-31490 |
NN |
denotes |
homology |
| T6435 |
31491-31492 |
CD |
denotes |
3 |
| T6428 |
31493-31499 |
NN |
denotes |
domain |
| T6436 |
31500-31501 |
-LRB- |
denotes |
[ |
| T6437 |
31501-31502 |
CD |
denotes |
9 |
| T6438 |
31502-31503 |
-RRB- |
denotes |
] |
| T6439 |
31503-31504 |
. |
denotes |
. |
| T6440 |
31504-31629 |
sentence |
denotes |
When this domain was overexpressed in serum-starved keratinocytes, a comparable elevation in pMAPK was observed (Figure 4F). |
| T6441 |
31505-31509 |
WRB |
denotes |
When |
| T6443 |
31510-31514 |
DT |
denotes |
this |
| T6444 |
31515-31521 |
NN |
denotes |
domain |
| T6445 |
31522-31525 |
VBD |
denotes |
was |
| T6442 |
31526-31539 |
VBN |
denotes |
overexpressed |
| T6447 |
31540-31542 |
IN |
denotes |
in |
| T6448 |
31543-31548 |
NN |
denotes |
serum |
| T6450 |
31548-31549 |
HYPH |
denotes |
- |
| T6449 |
31549-31556 |
VBN |
denotes |
starved |
| T6451 |
31557-31570 |
NNS |
denotes |
keratinocytes |
| T6452 |
31570-31572 |
, |
denotes |
, |
| T6453 |
31572-31573 |
DT |
denotes |
a |
| T6455 |
31574-31584 |
JJ |
denotes |
comparable |
| T6454 |
31585-31594 |
NN |
denotes |
elevation |
| T6456 |
31595-31597 |
IN |
denotes |
in |
| T6457 |
31598-31603 |
NN |
denotes |
pMAPK |
| T6458 |
31604-31607 |
VBD |
denotes |
was |
| T6446 |
31608-31616 |
VBN |
denotes |
observed |
| T6459 |
31617-31618 |
-LRB- |
denotes |
( |
| T6461 |
31618-31624 |
NN |
denotes |
Figure |
| T6460 |
31625-31627 |
NN |
denotes |
4F |
| T6462 |
31627-31628 |
-RRB- |
denotes |
) |
| T6463 |
31628-31629 |
. |
denotes |
. |
| T6464 |
31629-31733 |
sentence |
denotes |
As expected, the small peptide inhibitor that interrupts the Grb-2/Sos association blocked the effects. |
| T6465 |
31630-31632 |
IN |
denotes |
As |
| T6466 |
31633-31641 |
VBN |
denotes |
expected |
| T6468 |
31641-31643 |
, |
denotes |
, |
| T6469 |
31643-31646 |
DT |
denotes |
the |
| T6471 |
31647-31652 |
JJ |
denotes |
small |
| T6472 |
31653-31660 |
NN |
denotes |
peptide |
| T6470 |
31661-31670 |
NN |
denotes |
inhibitor |
| T6473 |
31671-31675 |
WDT |
denotes |
that |
| T6474 |
31676-31686 |
VBZ |
denotes |
interrupts |
| T6475 |
31687-31690 |
DT |
denotes |
the |
| T6477 |
31691-31694 |
NN |
denotes |
Grb |
| T6478 |
31694-31695 |
HYPH |
denotes |
- |
| T6479 |
31695-31696 |
CD |
denotes |
2 |
| T6480 |
31696-31697 |
HYPH |
denotes |
/ |
| T6481 |
31697-31700 |
NN |
denotes |
Sos |
| T6476 |
31701-31712 |
NN |
denotes |
association |
| T6467 |
31713-31720 |
VBD |
denotes |
blocked |
| T6482 |
31721-31724 |
DT |
denotes |
the |
| T6483 |
31725-31732 |
NNS |
denotes |
effects |
| T6484 |
31732-31733 |
. |
denotes |
. |
| T6485 |
31733-31958 |
sentence |
denotes |
These data suggested that by elevating cytosolic Ajuba levels, Ajuba's pre-LIM domain may associate with Grb-2/Sos in a manner that stimulates its nucleotide exchange activity and leads to activation of the Ras-MAPK pathway. |
| T6486 |
31734-31739 |
DT |
denotes |
These |
| T6487 |
31740-31744 |
NNS |
denotes |
data |
| T6488 |
31745-31754 |
VBD |
denotes |
suggested |
| T6489 |
31755-31759 |
IN |
denotes |
that |
| T6491 |
31760-31762 |
IN |
denotes |
by |
| T6492 |
31763-31772 |
VBG |
denotes |
elevating |
| T6493 |
31773-31782 |
JJ |
denotes |
cytosolic |
| T6495 |
31783-31788 |
NN |
denotes |
Ajuba |
| T6494 |
31789-31795 |
NNS |
denotes |
levels |
| T6496 |
31795-31797 |
, |
denotes |
, |
| T6497 |
31797-31802 |
NN |
denotes |
Ajuba |
| T6499 |
31802-31804 |
POS |
denotes |
's |
| T6500 |
31805-31812 |
JJ |
denotes |
pre-LIM |
| T6498 |
31813-31819 |
NN |
denotes |
domain |
| T6501 |
31820-31823 |
MD |
denotes |
may |
| T6490 |
31824-31833 |
VB |
denotes |
associate |
| T6502 |
31834-31838 |
IN |
denotes |
with |
| T6503 |
31839-31842 |
NN |
denotes |
Grb |
| T6504 |
31842-31843 |
HYPH |
denotes |
- |
| T6505 |
31843-31844 |
CD |
denotes |
2 |
| T6506 |
31844-31845 |
HYPH |
denotes |
/ |
| T6507 |
31845-31848 |
NN |
denotes |
Sos |
| T6508 |
31849-31851 |
IN |
denotes |
in |
| T6509 |
31852-31853 |
DT |
denotes |
a |
| T6510 |
31854-31860 |
NN |
denotes |
manner |
| T6511 |
31861-31865 |
WDT |
denotes |
that |
| T6512 |
31866-31876 |
VBZ |
denotes |
stimulates |
| T6513 |
31877-31880 |
PRP$ |
denotes |
its |
| T6515 |
31881-31891 |
NN |
denotes |
nucleotide |
| T6516 |
31892-31900 |
NN |
denotes |
exchange |
| T6514 |
31901-31909 |
NN |
denotes |
activity |
| T6517 |
31910-31913 |
CC |
denotes |
and |
| T6518 |
31914-31919 |
VBZ |
denotes |
leads |
| T6519 |
31920-31922 |
IN |
denotes |
to |
| T6520 |
31923-31933 |
NN |
denotes |
activation |
| T6521 |
31934-31936 |
IN |
denotes |
of |
| T6522 |
31937-31940 |
DT |
denotes |
the |
| T6524 |
31941-31944 |
NN |
denotes |
Ras |
| T6526 |
31944-31945 |
HYPH |
denotes |
- |
| T6525 |
31945-31949 |
NN |
denotes |
MAPK |
| T6523 |
31950-31957 |
NN |
denotes |
pathway |
| T6527 |
31957-31958 |
. |
denotes |
. |
| T6528 |
31958-32168 |
sentence |
denotes |
Although this pathway provides one mechanism by which Snail expression and proliferation may be coupled in skin epithelium, proliferative circuitries involving AJs are known to be complex and often interwoven. |
| T6529 |
31959-31967 |
IN |
denotes |
Although |
| T6531 |
31968-31972 |
DT |
denotes |
this |
| T6532 |
31973-31980 |
NN |
denotes |
pathway |
| T6530 |
31981-31989 |
VBZ |
denotes |
provides |
| T6534 |
31990-31993 |
CD |
denotes |
one |
| T6535 |
31994-32003 |
NN |
denotes |
mechanism |
| T6536 |
32004-32006 |
IN |
denotes |
by |
| T6538 |
32007-32012 |
WDT |
denotes |
which |
| T6539 |
32013-32018 |
NN |
denotes |
Snail |
| T6540 |
32019-32029 |
NN |
denotes |
expression |
| T6541 |
32030-32033 |
CC |
denotes |
and |
| T6542 |
32034-32047 |
NN |
denotes |
proliferation |
| T6543 |
32048-32051 |
MD |
denotes |
may |
| T6544 |
32052-32054 |
VB |
denotes |
be |
| T6537 |
32055-32062 |
VBN |
denotes |
coupled |
| T6545 |
32063-32065 |
IN |
denotes |
in |
| T6546 |
32066-32070 |
NN |
denotes |
skin |
| T6547 |
32071-32081 |
NN |
denotes |
epithelium |
| T6548 |
32081-32083 |
, |
denotes |
, |
| T6549 |
32083-32096 |
JJ |
denotes |
proliferative |
| T6550 |
32097-32108 |
NNS |
denotes |
circuitries |
| T6551 |
32109-32118 |
VBG |
denotes |
involving |
| T6552 |
32119-32122 |
NNS |
denotes |
AJs |
| T6553 |
32123-32126 |
VBP |
denotes |
are |
| T6533 |
32127-32132 |
VBN |
denotes |
known |
| T6554 |
32133-32135 |
TO |
denotes |
to |
| T6555 |
32136-32138 |
VB |
denotes |
be |
| T6556 |
32139-32146 |
JJ |
denotes |
complex |
| T6557 |
32147-32150 |
CC |
denotes |
and |
| T6558 |
32151-32156 |
RB |
denotes |
often |
| T6559 |
32157-32167 |
VBN |
denotes |
interwoven |
| T6560 |
32167-32168 |
. |
denotes |
. |
| T6561 |
32168-32273 |
sentence |
denotes |
Future studies will be needed to systematically dissect these putative intricacies at a molecular level. |
| T6562 |
32169-32175 |
JJ |
denotes |
Future |
| T6563 |
32176-32183 |
NNS |
denotes |
studies |
| T6565 |
32184-32188 |
MD |
denotes |
will |
| T6566 |
32189-32191 |
VB |
denotes |
be |
| T6564 |
32192-32198 |
VBN |
denotes |
needed |
| T6567 |
32199-32201 |
TO |
denotes |
to |
| T6569 |
32202-32216 |
RB |
denotes |
systematically |
| T6568 |
32217-32224 |
VB |
denotes |
dissect |
| T6570 |
32225-32230 |
DT |
denotes |
these |
| T6572 |
32231-32239 |
JJ |
denotes |
putative |
| T6571 |
32240-32251 |
NNS |
denotes |
intricacies |
| T6573 |
32252-32254 |
IN |
denotes |
at |
| T6574 |
32255-32256 |
DT |
denotes |
a |
| T6576 |
32257-32266 |
JJ |
denotes |
molecular |
| T6575 |
32267-32272 |
NN |
denotes |
level |
| T6577 |
32272-32273 |
. |
denotes |
. |
| T7354 |
32275-32282 |
VBG |
denotes |
Probing |
| T7356 |
32283-32286 |
DT |
denotes |
the |
| T7357 |
32287-32297 |
NN |
denotes |
Regulation |
| T7358 |
32298-32300 |
IN |
denotes |
of |
| T7359 |
32301-32306 |
NN |
denotes |
Snail |
| T7360 |
32307-32311 |
NN |
denotes |
Gene |
| T7361 |
32312-32322 |
NN |
denotes |
Expression |
| T7355 |
32323-32330 |
VBZ |
denotes |
Reveals |
| T7362 |
32331-32333 |
DT |
denotes |
an |
| T7364 |
32334-32343 |
JJ |
denotes |
Essential |
| T7363 |
32344-32348 |
NN |
denotes |
Link |
| T7365 |
32349-32351 |
IN |
denotes |
to |
| T7366 |
32352-32355 |
NN |
denotes |
TGF |
| T7368 |
32355-32356 |
HYPH |
denotes |
- |
| T7367 |
32356-32358 |
NN |
denotes |
β2 |
| T7369 |
32359-32368 |
NN |
denotes |
Signaling |
| T7370 |
32369-32371 |
IN |
denotes |
in |
| T7371 |
32372-32375 |
DT |
denotes |
the |
| T7373 |
32376-32386 |
VBG |
denotes |
Developing |
| T7374 |
32387-32391 |
NN |
denotes |
Hair |
| T7372 |
32392-32395 |
NN |
denotes |
Bud |
| T7375 |
32395-32528 |
sentence |
denotes |
The temporal spike of Snail mRNA expression in the hair bud prompted us to consider what factor(s) may be regulating the Snail gene. |
| T7376 |
32396-32399 |
DT |
denotes |
The |
| T7378 |
32400-32408 |
JJ |
denotes |
temporal |
| T7377 |
32409-32414 |
NN |
denotes |
spike |
| T7380 |
32415-32417 |
IN |
denotes |
of |
| T7381 |
32418-32423 |
NN |
denotes |
Snail |
| T7383 |
32424-32428 |
NN |
denotes |
mRNA |
| T7382 |
32429-32439 |
NN |
denotes |
expression |
| T7384 |
32440-32442 |
IN |
denotes |
in |
| T7385 |
32443-32446 |
DT |
denotes |
the |
| T7387 |
32447-32451 |
NN |
denotes |
hair |
| T7386 |
32452-32455 |
NN |
denotes |
bud |
| T7379 |
32456-32464 |
VBD |
denotes |
prompted |
| T7388 |
32465-32467 |
PRP |
denotes |
us |
| T7389 |
32468-32470 |
TO |
denotes |
to |
| T7390 |
32471-32479 |
VB |
denotes |
consider |
| T7391 |
32480-32484 |
WDT |
denotes |
what |
| T7392 |
32485-32491 |
NN |
denotes |
factor |
| T7394 |
32491-32492 |
-LRB- |
denotes |
( |
| T7395 |
32492-32493 |
AFX |
denotes |
s |
| T7396 |
32493-32494 |
-RRB- |
denotes |
) |
| T7397 |
32495-32498 |
MD |
denotes |
may |
| T7398 |
32499-32501 |
VB |
denotes |
be |
| T7393 |
32502-32512 |
VBG |
denotes |
regulating |
| T7399 |
32513-32516 |
DT |
denotes |
the |
| T7401 |
32517-32522 |
NN |
denotes |
Snail |
| T7400 |
32523-32527 |
NN |
denotes |
gene |
| T7402 |
32527-32528 |
. |
denotes |
. |
| T7403 |
32528-32752 |
sentence |
denotes |
A variety of extracellular signals have an impact on the cell type-specific expression of different Snail family members, and many of them, including Wnts, BMPs, FGFs, and TGF-βs, also affect hair bud development [2,16,28]. |
| T7404 |
32529-32530 |
DT |
denotes |
A |
| T7405 |
32531-32538 |
NN |
denotes |
variety |
| T7407 |
32539-32541 |
IN |
denotes |
of |
| T7408 |
32542-32555 |
JJ |
denotes |
extracellular |
| T7409 |
32556-32563 |
NNS |
denotes |
signals |
| T7406 |
32564-32568 |
VBP |
denotes |
have |
| T7410 |
32569-32571 |
DT |
denotes |
an |
| T7411 |
32572-32578 |
NN |
denotes |
impact |
| T7412 |
32579-32581 |
IN |
denotes |
on |
| T7413 |
32582-32585 |
DT |
denotes |
the |
| T7415 |
32586-32590 |
NN |
denotes |
cell |
| T7416 |
32591-32595 |
NN |
denotes |
type |
| T7418 |
32595-32596 |
HYPH |
denotes |
- |
| T7417 |
32596-32604 |
JJ |
denotes |
specific |
| T7414 |
32605-32615 |
NN |
denotes |
expression |
| T7419 |
32616-32618 |
IN |
denotes |
of |
| T7420 |
32619-32628 |
JJ |
denotes |
different |
| T7422 |
32629-32634 |
NN |
denotes |
Snail |
| T7423 |
32635-32641 |
NN |
denotes |
family |
| T7421 |
32642-32649 |
NNS |
denotes |
members |
| T7424 |
32649-32651 |
, |
denotes |
, |
| T7425 |
32651-32654 |
CC |
denotes |
and |
| T7426 |
32655-32659 |
JJ |
denotes |
many |
| T7428 |
32660-32662 |
IN |
denotes |
of |
| T7429 |
32663-32667 |
PRP |
denotes |
them |
| T7430 |
32667-32669 |
, |
denotes |
, |
| T7431 |
32669-32678 |
VBG |
denotes |
including |
| T7432 |
32679-32683 |
NNS |
denotes |
Wnts |
| T7433 |
32683-32685 |
, |
denotes |
, |
| T7434 |
32685-32689 |
NNS |
denotes |
BMPs |
| T7435 |
32689-32691 |
, |
denotes |
, |
| T7436 |
32691-32695 |
NNS |
denotes |
FGFs |
| T7437 |
32695-32697 |
, |
denotes |
, |
| T7438 |
32697-32700 |
CC |
denotes |
and |
| T7439 |
32701-32704 |
NN |
denotes |
TGF |
| T7441 |
32704-32705 |
HYPH |
denotes |
- |
| T7440 |
32705-32707 |
NNS |
denotes |
βs |
| T7442 |
32707-32709 |
, |
denotes |
, |
| T7443 |
32709-32713 |
RB |
denotes |
also |
| T7427 |
32714-32720 |
VBP |
denotes |
affect |
| T7444 |
32721-32725 |
NN |
denotes |
hair |
| T7445 |
32726-32729 |
NN |
denotes |
bud |
| T7446 |
32730-32741 |
NN |
denotes |
development |
| T7447 |
32742-32743 |
-LRB- |
denotes |
[ |
| T7449 |
32743-32744 |
CD |
denotes |
2 |
| T7450 |
32744-32745 |
, |
denotes |
, |
| T7451 |
32745-32747 |
CD |
denotes |
16 |
| T7452 |
32747-32748 |
, |
denotes |
, |
| T7448 |
32748-32750 |
CD |
denotes |
28 |
| T7453 |
32750-32751 |
-RRB- |
denotes |
] |
| T7454 |
32751-32752 |
. |
denotes |
. |
| T7455 |
32752-32980 |
sentence |
denotes |
Since Snail is not expressed in cultured skin keratinocytes that secrete active BMPs and FGFs (see Figure 1B), we focused our attention on Wnt and TGF-β signaling as more likely candidates for Snail induction in this cell type. |
| T7456 |
32753-32758 |
IN |
denotes |
Since |
| T7458 |
32759-32764 |
NN |
denotes |
Snail |
| T7459 |
32765-32767 |
VBZ |
denotes |
is |
| T7460 |
32768-32771 |
RB |
denotes |
not |
| T7457 |
32772-32781 |
VBN |
denotes |
expressed |
| T7462 |
32782-32784 |
IN |
denotes |
in |
| T7463 |
32785-32793 |
VBN |
denotes |
cultured |
| T7465 |
32794-32798 |
NN |
denotes |
skin |
| T7464 |
32799-32812 |
NNS |
denotes |
keratinocytes |
| T7466 |
32813-32817 |
WDT |
denotes |
that |
| T7467 |
32818-32825 |
VBP |
denotes |
secrete |
| T7468 |
32826-32832 |
JJ |
denotes |
active |
| T7469 |
32833-32837 |
NNS |
denotes |
BMPs |
| T7470 |
32838-32841 |
CC |
denotes |
and |
| T7471 |
32842-32846 |
NNS |
denotes |
FGFs |
| T7472 |
32847-32848 |
-LRB- |
denotes |
( |
| T7473 |
32848-32851 |
VB |
denotes |
see |
| T7474 |
32852-32858 |
NN |
denotes |
Figure |
| T7475 |
32859-32861 |
NN |
denotes |
1B |
| T7476 |
32861-32862 |
-RRB- |
denotes |
) |
| T7477 |
32862-32864 |
, |
denotes |
, |
| T7478 |
32864-32866 |
PRP |
denotes |
we |
| T7461 |
32867-32874 |
VBD |
denotes |
focused |
| T7479 |
32875-32878 |
PRP$ |
denotes |
our |
| T7480 |
32879-32888 |
NN |
denotes |
attention |
| T7481 |
32889-32891 |
IN |
denotes |
on |
| T7482 |
32892-32895 |
NN |
denotes |
Wnt |
| T7484 |
32896-32899 |
CC |
denotes |
and |
| T7485 |
32900-32903 |
NN |
denotes |
TGF |
| T7487 |
32903-32904 |
HYPH |
denotes |
- |
| T7486 |
32904-32905 |
NN |
denotes |
β |
| T7483 |
32906-32915 |
NN |
denotes |
signaling |
| T7488 |
32916-32918 |
IN |
denotes |
as |
| T7489 |
32919-32923 |
RBR |
denotes |
more |
| T7490 |
32924-32930 |
JJ |
denotes |
likely |
| T7491 |
32931-32941 |
NNS |
denotes |
candidates |
| T7492 |
32942-32945 |
IN |
denotes |
for |
| T7493 |
32946-32951 |
NN |
denotes |
Snail |
| T7494 |
32952-32961 |
NN |
denotes |
induction |
| T7495 |
32962-32964 |
IN |
denotes |
in |
| T7496 |
32965-32969 |
DT |
denotes |
this |
| T7498 |
32970-32974 |
NN |
denotes |
cell |
| T7497 |
32975-32979 |
NN |
denotes |
type |
| T7499 |
32979-32980 |
. |
denotes |
. |
| T7500 |
32980-33179 |
sentence |
denotes |
Previously, we showed that effective transmission of a Wnt-3a signal in cultured keratinocytes can be achieved through their exposure to the BMP inhibitor noggin, which induces LEF-1 expression [4]. |
| T7501 |
32981-32991 |
RB |
denotes |
Previously |
| T7503 |
32991-32993 |
, |
denotes |
, |
| T7504 |
32993-32995 |
PRP |
denotes |
we |
| T7502 |
32996-33002 |
VBD |
denotes |
showed |
| T7505 |
33003-33007 |
IN |
denotes |
that |
| T7507 |
33008-33017 |
JJ |
denotes |
effective |
| T7508 |
33018-33030 |
NN |
denotes |
transmission |
| T7509 |
33031-33033 |
IN |
denotes |
of |
| T7510 |
33034-33035 |
DT |
denotes |
a |
| T7512 |
33036-33039 |
NN |
denotes |
Wnt |
| T7513 |
33039-33040 |
HYPH |
denotes |
- |
| T7514 |
33040-33042 |
CD |
denotes |
3a |
| T7511 |
33043-33049 |
NN |
denotes |
signal |
| T7515 |
33050-33052 |
IN |
denotes |
in |
| T7516 |
33053-33061 |
VBN |
denotes |
cultured |
| T7517 |
33062-33075 |
NNS |
denotes |
keratinocytes |
| T7518 |
33076-33079 |
MD |
denotes |
can |
| T7519 |
33080-33082 |
VB |
denotes |
be |
| T7506 |
33083-33091 |
VBN |
denotes |
achieved |
| T7520 |
33092-33099 |
IN |
denotes |
through |
| T7521 |
33100-33105 |
PRP$ |
denotes |
their |
| T7522 |
33106-33114 |
NN |
denotes |
exposure |
| T7523 |
33115-33117 |
IN |
denotes |
to |
| T7524 |
33118-33121 |
DT |
denotes |
the |
| T7526 |
33122-33125 |
NN |
denotes |
BMP |
| T7525 |
33126-33135 |
NN |
denotes |
inhibitor |
| T7527 |
33136-33142 |
NN |
denotes |
noggin |
| T7528 |
33142-33144 |
, |
denotes |
, |
| T7529 |
33144-33149 |
WDT |
denotes |
which |
| T7530 |
33150-33157 |
VBZ |
denotes |
induces |
| T7531 |
33158-33161 |
NN |
denotes |
LEF |
| T7533 |
33161-33162 |
HYPH |
denotes |
- |
| T7534 |
33162-33163 |
CD |
denotes |
1 |
| T7532 |
33164-33174 |
NN |
denotes |
expression |
| T7535 |
33175-33176 |
-LRB- |
denotes |
[ |
| T7536 |
33176-33177 |
CD |
denotes |
4 |
| T7537 |
33177-33178 |
-RRB- |
denotes |
] |
| T7538 |
33178-33179 |
. |
denotes |
. |
| T7539 |
33179-33314 |
sentence |
denotes |
In vitro, these conditions down-regulated the E-cadherin promoter and induced a LEF-1/β-catenin-sensitive reporter gene, TOPFLASH [4]. |
| T7540 |
33180-33182 |
FW |
denotes |
In |
| T7541 |
33183-33188 |
FW |
denotes |
vitro |
| T7543 |
33188-33190 |
, |
denotes |
, |
| T7544 |
33190-33195 |
DT |
denotes |
these |
| T7545 |
33196-33206 |
NNS |
denotes |
conditions |
| T7546 |
33207-33211 |
RB |
denotes |
down |
| T7547 |
33211-33212 |
HYPH |
denotes |
- |
| T7542 |
33212-33221 |
VBD |
denotes |
regulated |
| T7548 |
33222-33225 |
DT |
denotes |
the |
| T7550 |
33226-33227 |
NN |
denotes |
E |
| T7552 |
33227-33228 |
HYPH |
denotes |
- |
| T7551 |
33228-33236 |
NN |
denotes |
cadherin |
| T7549 |
33237-33245 |
NN |
denotes |
promoter |
| T7553 |
33246-33249 |
CC |
denotes |
and |
| T7554 |
33250-33257 |
VBD |
denotes |
induced |
| T7555 |
33258-33259 |
DT |
denotes |
a |
| T7557 |
33260-33263 |
NN |
denotes |
LEF |
| T7559 |
33263-33264 |
HYPH |
denotes |
- |
| T7560 |
33264-33265 |
CD |
denotes |
1 |
| T7561 |
33265-33266 |
HYPH |
denotes |
/ |
| T7562 |
33266-33267 |
NN |
denotes |
β |
| T7564 |
33267-33268 |
HYPH |
denotes |
- |
| T7563 |
33268-33275 |
NN |
denotes |
catenin |
| T7565 |
33275-33276 |
HYPH |
denotes |
- |
| T7558 |
33276-33285 |
JJ |
denotes |
sensitive |
| T7566 |
33286-33294 |
NN |
denotes |
reporter |
| T7556 |
33295-33299 |
NN |
denotes |
gene |
| T7567 |
33299-33301 |
, |
denotes |
, |
| T7568 |
33301-33309 |
NN |
denotes |
TOPFLASH |
| T7569 |
33310-33311 |
-LRB- |
denotes |
[ |
| T7570 |
33311-33312 |
CD |
denotes |
4 |
| T7571 |
33312-33313 |
-RRB- |
denotes |
] |
| T7572 |
33313-33314 |
. |
denotes |
. |
| T7573 |
33314-33393 |
sentence |
denotes |
In contrast, Snail expression was not induced by these conditions (Figure 5A). |
| T7574 |
33315-33317 |
IN |
denotes |
In |
| T7576 |
33318-33326 |
NN |
denotes |
contrast |
| T7577 |
33326-33328 |
, |
denotes |
, |
| T7578 |
33328-33333 |
NN |
denotes |
Snail |
| T7579 |
33334-33344 |
NN |
denotes |
expression |
| T7580 |
33345-33348 |
VBD |
denotes |
was |
| T7581 |
33349-33352 |
RB |
denotes |
not |
| T7575 |
33353-33360 |
VBN |
denotes |
induced |
| T7582 |
33361-33363 |
IN |
denotes |
by |
| T7583 |
33364-33369 |
DT |
denotes |
these |
| T7584 |
33370-33380 |
NNS |
denotes |
conditions |
| T7585 |
33381-33382 |
-LRB- |
denotes |
( |
| T7587 |
33382-33388 |
NN |
denotes |
Figure |
| T7586 |
33389-33391 |
NN |
denotes |
5A |
| T7588 |
33391-33392 |
-RRB- |
denotes |
) |
| T7589 |
33392-33393 |
. |
denotes |
. |
| T7590 |
33393-33597 |
sentence |
denotes |
Thus, despite essential roles for Wnts and noggin in hair follicle specification [4,29,30], our studies did not support an essential role for these signals in governing Snail expression in keratinocytes. |
| T7591 |
33394-33398 |
RB |
denotes |
Thus |
| T7593 |
33398-33400 |
, |
denotes |
, |
| T7594 |
33400-33407 |
IN |
denotes |
despite |
| T7595 |
33408-33417 |
JJ |
denotes |
essential |
| T7596 |
33418-33423 |
NNS |
denotes |
roles |
| T7597 |
33424-33427 |
IN |
denotes |
for |
| T7598 |
33428-33432 |
NNS |
denotes |
Wnts |
| T7599 |
33433-33436 |
CC |
denotes |
and |
| T7600 |
33437-33443 |
NN |
denotes |
noggin |
| T7601 |
33444-33446 |
IN |
denotes |
in |
| T7602 |
33447-33451 |
NN |
denotes |
hair |
| T7603 |
33452-33460 |
NN |
denotes |
follicle |
| T7604 |
33461-33474 |
NN |
denotes |
specification |
| T7605 |
33475-33476 |
-LRB- |
denotes |
[ |
| T7607 |
33476-33477 |
CD |
denotes |
4 |
| T7608 |
33477-33478 |
, |
denotes |
, |
| T7609 |
33478-33480 |
CD |
denotes |
29 |
| T7610 |
33480-33481 |
, |
denotes |
, |
| T7606 |
33481-33483 |
CD |
denotes |
30 |
| T7611 |
33483-33484 |
-RRB- |
denotes |
] |
| T7612 |
33484-33486 |
, |
denotes |
, |
| T7613 |
33486-33489 |
PRP$ |
denotes |
our |
| T7614 |
33490-33497 |
NNS |
denotes |
studies |
| T7615 |
33498-33501 |
VBD |
denotes |
did |
| T7616 |
33502-33505 |
RB |
denotes |
not |
| T7592 |
33506-33513 |
VB |
denotes |
support |
| T7617 |
33514-33516 |
DT |
denotes |
an |
| T7619 |
33517-33526 |
JJ |
denotes |
essential |
| T7618 |
33527-33531 |
NN |
denotes |
role |
| T7620 |
33532-33535 |
IN |
denotes |
for |
| T7621 |
33536-33541 |
DT |
denotes |
these |
| T7622 |
33542-33549 |
NNS |
denotes |
signals |
| T7623 |
33550-33552 |
IN |
denotes |
in |
| T7624 |
33553-33562 |
VBG |
denotes |
governing |
| T7625 |
33563-33568 |
NN |
denotes |
Snail |
| T7626 |
33569-33579 |
NN |
denotes |
expression |
| T7627 |
33580-33582 |
IN |
denotes |
in |
| T7628 |
33583-33596 |
NNS |
denotes |
keratinocytes |
| T7629 |
33596-33597 |
. |
denotes |
. |
| T7630 |
33597-35796 |
sentence |
denotes |
Figure 5 TGF-β2, but Not Wnt/noggin, Transiently Induces Snail Expression In Vitro
(A) Failure of Wnt and noggin signaling to induce Snail in cultured keratinocytes. Primary mouse keratinocytes were treated with Wnt- and/or noggin-conditioned medium (+) or the corresponding control medium (–). These conditions are known to activate the LEF-1/β-catenin reporter TOPGal and down-regulate the E-cadherin promoter (see [4] for details). Using Western blot analyses, cellular proteins were then analyzed for Snail, LEF-1, β-catenin, and tubulin. Proteins from keratinocytes transfected with K14-Snail were used as a positive control for Snail expression.
(B) TGF-β2 can induce Snail protein. Primary keratinocytes were treated for the indicated times with recombinant TGF-β2 (+) or heat inactivated TGF-β2 (–).Total cellular proteins were then isolated and analyzed by Western blot for Snail, pSMAD2 (reflective of activated TGF- signaling), and tubulin. Note the activation of Snail expression, peaking at 2 h post-TGF-β2 treatment and then disappearing thereafter.
(C) Snail mRNA expression is transiently induced by TGF-β2. The experiment in (B) was repeated, and this time, total RNAs were isolated from keratinocytes treated with TGF-β2 for the indicated times. RT-PCR was then used with (+) or without (–) reverse transcriptase (RT) and with primer sets specific for Snail and GAPDH mRNAs. Note that Snail mRNA expression also peaked at 2 h, paralleling Snail protein.
(D) TGF-β2 treatment results in enhanced activity of a Snail promoter-β-galactosidase reporter. Keratinocytes were transfected with a β-galactosidase reporter driven by a Snail promoter that is either WT (wt prom) or harbors a mutation in a putative pSMAD2/pSMAD4 binding site (mt prom). At 2 d posttransfection, cells were treated with either TGF-β or heat-inactivated TGF-β2 (inact) for the times indicated. β-galactosidase assays were then conducted, and results are reported as fold increase over a basal level of activity of 1. The experiment was repeated three times in triplicate, and error bars reflect variations in the results. TGF-β1 has been shown to induce Snail family members in hepatocytes and heart [15, 31]. |
| T7631 |
35709-35712 |
NN |
denotes |
TGF |
| T7633 |
35712-35713 |
HYPH |
denotes |
- |
| T7632 |
35713-35715 |
NN |
denotes |
β1 |
| T7635 |
35716-35719 |
VBZ |
denotes |
has |
| T7636 |
35720-35724 |
VBN |
denotes |
been |
| T7634 |
35725-35730 |
VBN |
denotes |
shown |
| T7637 |
35731-35733 |
TO |
denotes |
to |
| T7638 |
35734-35740 |
VB |
denotes |
induce |
| T7639 |
35741-35746 |
NN |
denotes |
Snail |
| T7641 |
35747-35753 |
NN |
denotes |
family |
| T7640 |
35754-35761 |
NNS |
denotes |
members |
| T7642 |
35762-35764 |
IN |
denotes |
in |
| T7643 |
35765-35776 |
NNS |
denotes |
hepatocytes |
| T7644 |
35777-35780 |
CC |
denotes |
and |
| T7645 |
35781-35786 |
NN |
denotes |
heart |
| T7646 |
35787-35788 |
-LRB- |
denotes |
[ |
| T7648 |
35788-35790 |
CD |
denotes |
15 |
| T7649 |
35790-35792 |
, |
denotes |
, |
| T7647 |
35792-35794 |
CD |
denotes |
31 |
| T7650 |
35794-35795 |
-RRB- |
denotes |
] |
| T7651 |
35795-35796 |
. |
denotes |
. |
| T7652 |
35796-35955 |
sentence |
denotes |
In keratinocytes, however, TGF-β1 inhibits keratinocyte growth and seems to be involved in triggering the destructive phase of the cycling hair follicle [32]. |
| T7653 |
35797-35799 |
IN |
denotes |
In |
| T7655 |
35800-35813 |
NNS |
denotes |
keratinocytes |
| T7656 |
35813-35815 |
, |
denotes |
, |
| T7657 |
35815-35822 |
RB |
denotes |
however |
| T7658 |
35822-35824 |
, |
denotes |
, |
| T7659 |
35824-35827 |
NN |
denotes |
TGF |
| T7661 |
35827-35828 |
HYPH |
denotes |
- |
| T7660 |
35828-35830 |
NN |
denotes |
β1 |
| T7654 |
35831-35839 |
VBZ |
denotes |
inhibits |
| T7662 |
35840-35852 |
NN |
denotes |
keratinocyte |
| T7663 |
35853-35859 |
NN |
denotes |
growth |
| T7664 |
35860-35863 |
CC |
denotes |
and |
| T7665 |
35864-35869 |
VBZ |
denotes |
seems |
| T7666 |
35870-35872 |
TO |
denotes |
to |
| T7668 |
35873-35875 |
VB |
denotes |
be |
| T7667 |
35876-35884 |
VBN |
denotes |
involved |
| T7669 |
35885-35887 |
IN |
denotes |
in |
| T7670 |
35888-35898 |
VBG |
denotes |
triggering |
| T7671 |
35899-35902 |
DT |
denotes |
the |
| T7673 |
35903-35914 |
JJ |
denotes |
destructive |
| T7672 |
35915-35920 |
NN |
denotes |
phase |
| T7674 |
35921-35923 |
IN |
denotes |
of |
| T7675 |
35924-35927 |
DT |
denotes |
the |
| T7677 |
35928-35935 |
VBG |
denotes |
cycling |
| T7678 |
35936-35940 |
NN |
denotes |
hair |
| T7676 |
35941-35949 |
NN |
denotes |
follicle |
| T7679 |
35950-35951 |
-LRB- |
denotes |
[ |
| T7680 |
35951-35953 |
CD |
denotes |
32 |
| T7681 |
35953-35954 |
-RRB- |
denotes |
] |
| T7682 |
35954-35955 |
. |
denotes |
. |
| T7683 |
35955-36111 |
sentence |
denotes |
Of the loss-of-function mutations generated in each of the TGF-β genes, only the TGF-β2 null state blocked follicle development at the hair bud stage [32]. |
| T7684 |
35956-35958 |
IN |
denotes |
Of |
| T7686 |
35959-35962 |
DT |
denotes |
the |
| T7688 |
35963-35967 |
NN |
denotes |
loss |
| T7689 |
35967-35968 |
HYPH |
denotes |
- |
| T7690 |
35968-35970 |
IN |
denotes |
of |
| T7691 |
35970-35971 |
HYPH |
denotes |
- |
| T7692 |
35971-35979 |
NN |
denotes |
function |
| T7687 |
35980-35989 |
NNS |
denotes |
mutations |
| T7693 |
35990-35999 |
VBN |
denotes |
generated |
| T7694 |
36000-36002 |
IN |
denotes |
in |
| T7695 |
36003-36007 |
DT |
denotes |
each |
| T7696 |
36008-36010 |
IN |
denotes |
of |
| T7697 |
36011-36014 |
DT |
denotes |
the |
| T7699 |
36015-36018 |
NN |
denotes |
TGF |
| T7701 |
36018-36019 |
HYPH |
denotes |
- |
| T7700 |
36019-36020 |
NN |
denotes |
β |
| T7698 |
36021-36026 |
NNS |
denotes |
genes |
| T7702 |
36026-36028 |
, |
denotes |
, |
| T7703 |
36028-36032 |
RB |
denotes |
only |
| T7705 |
36033-36036 |
DT |
denotes |
the |
| T7706 |
36037-36040 |
NN |
denotes |
TGF |
| T7708 |
36040-36041 |
HYPH |
denotes |
- |
| T7707 |
36041-36043 |
NN |
denotes |
β2 |
| T7709 |
36044-36048 |
JJ |
denotes |
null |
| T7704 |
36049-36054 |
NN |
denotes |
state |
| T7685 |
36055-36062 |
VBD |
denotes |
blocked |
| T7710 |
36063-36071 |
NN |
denotes |
follicle |
| T7711 |
36072-36083 |
NN |
denotes |
development |
| T7712 |
36084-36086 |
IN |
denotes |
at |
| T7713 |
36087-36090 |
DT |
denotes |
the |
| T7715 |
36091-36095 |
NN |
denotes |
hair |
| T7716 |
36096-36099 |
NN |
denotes |
bud |
| T7714 |
36100-36105 |
NN |
denotes |
stage |
| T7717 |
36106-36107 |
-LRB- |
denotes |
[ |
| T7718 |
36107-36109 |
CD |
denotes |
32 |
| T7719 |
36109-36110 |
-RRB- |
denotes |
] |
| T7720 |
36110-36111 |
. |
denotes |
. |
| T7721 |
36111-36275 |
sentence |
denotes |
Thus, we turned towards addressing whether TGF-β2 might be involved in regulating Snail expression in keratinocytes isolated from the basal layer of the epidermis. |
| T7722 |
36112-36116 |
RB |
denotes |
Thus |
| T7724 |
36116-36118 |
, |
denotes |
, |
| T7725 |
36118-36120 |
PRP |
denotes |
we |
| T7723 |
36121-36127 |
VBD |
denotes |
turned |
| T7726 |
36128-36135 |
IN |
denotes |
towards |
| T7727 |
36136-36146 |
VBG |
denotes |
addressing |
| T7728 |
36147-36154 |
IN |
denotes |
whether |
| T7730 |
36155-36158 |
NN |
denotes |
TGF |
| T7732 |
36158-36159 |
HYPH |
denotes |
- |
| T7731 |
36159-36161 |
NN |
denotes |
β2 |
| T7733 |
36162-36167 |
MD |
denotes |
might |
| T7734 |
36168-36170 |
VB |
denotes |
be |
| T7729 |
36171-36179 |
VBN |
denotes |
involved |
| T7735 |
36180-36182 |
IN |
denotes |
in |
| T7736 |
36183-36193 |
VBG |
denotes |
regulating |
| T7737 |
36194-36199 |
NN |
denotes |
Snail |
| T7738 |
36200-36210 |
NN |
denotes |
expression |
| T7739 |
36211-36213 |
IN |
denotes |
in |
| T7740 |
36214-36227 |
NNS |
denotes |
keratinocytes |
| T7741 |
36228-36236 |
VBN |
denotes |
isolated |
| T7742 |
36237-36241 |
IN |
denotes |
from |
| T7743 |
36242-36245 |
DT |
denotes |
the |
| T7745 |
36246-36251 |
JJ |
denotes |
basal |
| T7744 |
36252-36257 |
NN |
denotes |
layer |
| T7746 |
36258-36260 |
IN |
denotes |
of |
| T7747 |
36261-36264 |
DT |
denotes |
the |
| T7748 |
36265-36274 |
NN |
denotes |
epidermis |
| T7749 |
36274-36275 |
. |
denotes |
. |
| T7750 |
36275-36506 |
sentence |
denotes |
Though there is no cell culture system available to specifically study placodal cells, these keratinocytes are their progenitors and are the closest approximation available to study the behavior of epithelial cells of the placode. |
| T7751 |
36276-36282 |
IN |
denotes |
Though |
| T7753 |
36283-36288 |
EX |
denotes |
there |
| T7752 |
36289-36291 |
VBZ |
denotes |
is |
| T7755 |
36292-36294 |
DT |
denotes |
no |
| T7757 |
36295-36299 |
NN |
denotes |
cell |
| T7758 |
36300-36307 |
NN |
denotes |
culture |
| T7756 |
36308-36314 |
NN |
denotes |
system |
| T7759 |
36315-36324 |
JJ |
denotes |
available |
| T7760 |
36325-36327 |
TO |
denotes |
to |
| T7762 |
36328-36340 |
RB |
denotes |
specifically |
| T7761 |
36341-36346 |
VB |
denotes |
study |
| T7763 |
36347-36355 |
JJ |
denotes |
placodal |
| T7764 |
36356-36361 |
NNS |
denotes |
cells |
| T7765 |
36361-36363 |
, |
denotes |
, |
| T7766 |
36363-36368 |
DT |
denotes |
these |
| T7767 |
36369-36382 |
NNS |
denotes |
keratinocytes |
| T7754 |
36383-36386 |
VBP |
denotes |
are |
| T7768 |
36387-36392 |
PRP$ |
denotes |
their |
| T7769 |
36393-36404 |
NNS |
denotes |
progenitors |
| T7770 |
36405-36408 |
CC |
denotes |
and |
| T7771 |
36409-36412 |
VBP |
denotes |
are |
| T7772 |
36413-36416 |
DT |
denotes |
the |
| T7774 |
36417-36424 |
JJS |
denotes |
closest |
| T7773 |
36425-36438 |
NN |
denotes |
approximation |
| T7775 |
36439-36448 |
JJ |
denotes |
available |
| T7776 |
36449-36451 |
TO |
denotes |
to |
| T7777 |
36452-36457 |
VB |
denotes |
study |
| T7778 |
36458-36461 |
DT |
denotes |
the |
| T7779 |
36462-36470 |
NN |
denotes |
behavior |
| T7780 |
36471-36473 |
IN |
denotes |
of |
| T7781 |
36474-36484 |
JJ |
denotes |
epithelial |
| T7782 |
36485-36490 |
NNS |
denotes |
cells |
| T7783 |
36491-36493 |
IN |
denotes |
of |
| T7784 |
36494-36497 |
DT |
denotes |
the |
| T7785 |
36498-36505 |
NN |
denotes |
placode |
| T7786 |
36505-36506 |
. |
denotes |
. |
| T7787 |
36506-36654 |
sentence |
denotes |
Interestingly, treatment of cultured keratinocytes with as little as 5 ng/ml of TGF-β2 caused a rapid and transient induction of Snail (Figure 5B). |
| T7788 |
36507-36520 |
RB |
denotes |
Interestingly |
| T7790 |
36520-36522 |
, |
denotes |
, |
| T7791 |
36522-36531 |
NN |
denotes |
treatment |
| T7792 |
36532-36534 |
IN |
denotes |
of |
| T7793 |
36535-36543 |
VBN |
denotes |
cultured |
| T7794 |
36544-36557 |
NNS |
denotes |
keratinocytes |
| T7795 |
36558-36562 |
IN |
denotes |
with |
| T7796 |
36563-36565 |
RB |
denotes |
as |
| T7798 |
36566-36572 |
JJ |
denotes |
little |
| T7799 |
36573-36575 |
IN |
denotes |
as |
| T7797 |
36576-36577 |
CD |
denotes |
5 |
| T7800 |
36578-36580 |
NN |
denotes |
ng |
| T7801 |
36580-36581 |
SYM |
denotes |
/ |
| T7802 |
36581-36583 |
NN |
denotes |
ml |
| T7803 |
36584-36586 |
IN |
denotes |
of |
| T7804 |
36587-36590 |
NN |
denotes |
TGF |
| T7806 |
36590-36591 |
HYPH |
denotes |
- |
| T7805 |
36591-36593 |
NN |
denotes |
β2 |
| T7789 |
36594-36600 |
VBD |
denotes |
caused |
| T7807 |
36601-36602 |
DT |
denotes |
a |
| T7809 |
36603-36608 |
JJ |
denotes |
rapid |
| T7810 |
36609-36612 |
CC |
denotes |
and |
| T7811 |
36613-36622 |
JJ |
denotes |
transient |
| T7808 |
36623-36632 |
NN |
denotes |
induction |
| T7812 |
36633-36635 |
IN |
denotes |
of |
| T7813 |
36636-36641 |
NN |
denotes |
Snail |
| T7814 |
36642-36643 |
-LRB- |
denotes |
( |
| T7816 |
36643-36649 |
NN |
denotes |
Figure |
| T7815 |
36650-36652 |
NN |
denotes |
5B |
| T7817 |
36652-36653 |
-RRB- |
denotes |
) |
| T7818 |
36653-36654 |
. |
denotes |
. |
| T7819 |
36654-36767 |
sentence |
denotes |
Following this treatment, Snail protein was detected within 30 min, peaked at 2 h, and then declined thereafter. |
| T7820 |
36655-36664 |
VBG |
denotes |
Following |
| T7822 |
36665-36669 |
DT |
denotes |
this |
| T7823 |
36670-36679 |
NN |
denotes |
treatment |
| T7824 |
36679-36681 |
, |
denotes |
, |
| T7825 |
36681-36686 |
NN |
denotes |
Snail |
| T7826 |
36687-36694 |
NN |
denotes |
protein |
| T7827 |
36695-36698 |
VBD |
denotes |
was |
| T7821 |
36699-36707 |
VBN |
denotes |
detected |
| T7828 |
36708-36714 |
IN |
denotes |
within |
| T7829 |
36715-36717 |
CD |
denotes |
30 |
| T7830 |
36718-36721 |
NN |
denotes |
min |
| T7831 |
36721-36723 |
, |
denotes |
, |
| T7832 |
36723-36729 |
VBD |
denotes |
peaked |
| T7833 |
36730-36732 |
IN |
denotes |
at |
| T7834 |
36733-36734 |
CD |
denotes |
2 |
| T7835 |
36735-36736 |
NN |
denotes |
h |
| T7836 |
36736-36738 |
, |
denotes |
, |
| T7837 |
36738-36741 |
CC |
denotes |
and |
| T7838 |
36742-36746 |
RB |
denotes |
then |
| T7839 |
36747-36755 |
VBD |
denotes |
declined |
| T7840 |
36756-36766 |
RB |
denotes |
thereafter |
| T7841 |
36766-36767 |
. |
denotes |
. |
| T7842 |
36767-36959 |
sentence |
denotes |
The induction of Snail appeared to be specific for the active form of the growth factor, as pretreatment of TGF-β2 for 10 min at 100 °C obliterated the response [Figure 5B, lanes marked (–)]. |
| T7843 |
36768-36771 |
DT |
denotes |
The |
| T7844 |
36772-36781 |
NN |
denotes |
induction |
| T7846 |
36782-36784 |
IN |
denotes |
of |
| T7847 |
36785-36790 |
NN |
denotes |
Snail |
| T7845 |
36791-36799 |
VBD |
denotes |
appeared |
| T7848 |
36800-36802 |
TO |
denotes |
to |
| T7849 |
36803-36805 |
VB |
denotes |
be |
| T7850 |
36806-36814 |
JJ |
denotes |
specific |
| T7851 |
36815-36818 |
IN |
denotes |
for |
| T7852 |
36819-36822 |
DT |
denotes |
the |
| T7854 |
36823-36829 |
JJ |
denotes |
active |
| T7853 |
36830-36834 |
NN |
denotes |
form |
| T7855 |
36835-36837 |
IN |
denotes |
of |
| T7856 |
36838-36841 |
DT |
denotes |
the |
| T7858 |
36842-36848 |
NN |
denotes |
growth |
| T7857 |
36849-36855 |
NN |
denotes |
factor |
| T7859 |
36855-36857 |
, |
denotes |
, |
| T7860 |
36857-36859 |
IN |
denotes |
as |
| T7862 |
36860-36872 |
NN |
denotes |
pretreatment |
| T7863 |
36873-36875 |
IN |
denotes |
of |
| T7864 |
36876-36879 |
NN |
denotes |
TGF |
| T7866 |
36879-36880 |
HYPH |
denotes |
- |
| T7865 |
36880-36882 |
NN |
denotes |
β2 |
| T7867 |
36883-36886 |
IN |
denotes |
for |
| T7868 |
36887-36889 |
CD |
denotes |
10 |
| T7869 |
36890-36893 |
NN |
denotes |
min |
| T7870 |
36894-36896 |
IN |
denotes |
at |
| T7871 |
36897-36900 |
CD |
denotes |
100 |
| T7872 |
36901-36903 |
NN |
denotes |
°C |
| T7861 |
36904-36915 |
VBD |
denotes |
obliterated |
| T7873 |
36916-36919 |
DT |
denotes |
the |
| T7874 |
36920-36928 |
NN |
denotes |
response |
| T7875 |
36929-36930 |
-LRB- |
denotes |
[ |
| T7877 |
36930-36936 |
NN |
denotes |
Figure |
| T7878 |
36937-36939 |
NN |
denotes |
5B |
| T7879 |
36939-36941 |
, |
denotes |
, |
| T7876 |
36941-36946 |
NNS |
denotes |
lanes |
| T7880 |
36947-36953 |
VBN |
denotes |
marked |
| T7881 |
36954-36955 |
-LRB- |
denotes |
( |
| T7882 |
36955-36956 |
SYM |
denotes |
– |
| T7883 |
36956-36957 |
-RRB- |
denotes |
) |
| T7884 |
36957-36958 |
-RRB- |
denotes |
] |
| T7885 |
36958-36959 |
. |
denotes |
. |
| T7886 |
36959-37197 |
sentence |
denotes |
By contrast, although TGF-β receptor activation remained elevated during the duration of the experiment (as measured by the sustained phosphorylation of the downstream effector SMAD2) Snail expression could not be maintained (Figure 5B). |
| T7887 |
36960-36962 |
IN |
denotes |
By |
| T7889 |
36963-36971 |
NN |
denotes |
contrast |
| T7890 |
36971-36973 |
, |
denotes |
, |
| T7891 |
36973-36981 |
IN |
denotes |
although |
| T7893 |
36982-36985 |
NN |
denotes |
TGF |
| T7895 |
36985-36986 |
HYPH |
denotes |
- |
| T7894 |
36986-36987 |
NN |
denotes |
β |
| T7896 |
36988-36996 |
NN |
denotes |
receptor |
| T7897 |
36997-37007 |
NN |
denotes |
activation |
| T7892 |
37008-37016 |
VBD |
denotes |
remained |
| T7898 |
37017-37025 |
JJ |
denotes |
elevated |
| T7899 |
37026-37032 |
IN |
denotes |
during |
| T7900 |
37033-37036 |
DT |
denotes |
the |
| T7901 |
37037-37045 |
NN |
denotes |
duration |
| T7902 |
37046-37048 |
IN |
denotes |
of |
| T7903 |
37049-37052 |
DT |
denotes |
the |
| T7904 |
37053-37063 |
NN |
denotes |
experiment |
| T7905 |
37064-37065 |
-LRB- |
denotes |
( |
| T7906 |
37065-37067 |
IN |
denotes |
as |
| T7907 |
37068-37076 |
VBN |
denotes |
measured |
| T7908 |
37077-37079 |
IN |
denotes |
by |
| T7909 |
37080-37083 |
DT |
denotes |
the |
| T7911 |
37084-37093 |
JJ |
denotes |
sustained |
| T7910 |
37094-37109 |
NN |
denotes |
phosphorylation |
| T7912 |
37110-37112 |
IN |
denotes |
of |
| T7913 |
37113-37116 |
DT |
denotes |
the |
| T7915 |
37117-37127 |
JJ |
denotes |
downstream |
| T7914 |
37128-37136 |
NN |
denotes |
effector |
| T7916 |
37137-37142 |
NN |
denotes |
SMAD2 |
| T7917 |
37142-37143 |
-RRB- |
denotes |
) |
| T7918 |
37144-37149 |
NN |
denotes |
Snail |
| T7919 |
37150-37160 |
NN |
denotes |
expression |
| T7920 |
37161-37166 |
MD |
denotes |
could |
| T7921 |
37167-37170 |
RB |
denotes |
not |
| T7922 |
37171-37173 |
VB |
denotes |
be |
| T7888 |
37174-37184 |
VBN |
denotes |
maintained |
| T7923 |
37185-37186 |
-LRB- |
denotes |
( |
| T7925 |
37186-37192 |
NN |
denotes |
Figure |
| T7924 |
37193-37195 |
NN |
denotes |
5B |
| T7926 |
37195-37196 |
-RRB- |
denotes |
) |
| T7927 |
37196-37197 |
. |
denotes |
. |
| T7928 |
37197-37345 |
sentence |
denotes |
Thus, although Snail expression correlated with phosphorylated SMAD2 (pSMAD2) induction, its decline seemed to rely on secondary downstream events. |
| T7929 |
37198-37202 |
RB |
denotes |
Thus |
| T7931 |
37202-37204 |
, |
denotes |
, |
| T7932 |
37204-37212 |
IN |
denotes |
although |
| T7934 |
37213-37218 |
NN |
denotes |
Snail |
| T7935 |
37219-37229 |
NN |
denotes |
expression |
| T7933 |
37230-37240 |
VBD |
denotes |
correlated |
| T7936 |
37241-37245 |
IN |
denotes |
with |
| T7937 |
37246-37260 |
VBN |
denotes |
phosphorylated |
| T7938 |
37261-37266 |
NN |
denotes |
SMAD2 |
| T7940 |
37267-37268 |
-LRB- |
denotes |
( |
| T7941 |
37268-37274 |
NN |
denotes |
pSMAD2 |
| T7942 |
37274-37275 |
-RRB- |
denotes |
) |
| T7939 |
37276-37285 |
NN |
denotes |
induction |
| T7943 |
37285-37287 |
, |
denotes |
, |
| T7944 |
37287-37290 |
PRP$ |
denotes |
its |
| T7945 |
37291-37298 |
NN |
denotes |
decline |
| T7930 |
37299-37305 |
VBD |
denotes |
seemed |
| T7946 |
37306-37308 |
TO |
denotes |
to |
| T7947 |
37309-37313 |
VB |
denotes |
rely |
| T7948 |
37314-37316 |
IN |
denotes |
on |
| T7949 |
37317-37326 |
JJ |
denotes |
secondary |
| T7951 |
37327-37337 |
JJ |
denotes |
downstream |
| T7950 |
37338-37344 |
NNS |
denotes |
events |
| T7952 |
37344-37345 |
. |
denotes |
. |
| T7953 |
37345-37527 |
sentence |
denotes |
The rapid kinetics of Snail expression were reflected at the mRNA level, suggesting that Snail promoter activity in keratinocytes might be sensitive to TGF-β2 signaling (Figure 5C). |
| T7954 |
37346-37349 |
DT |
denotes |
The |
| T7956 |
37350-37355 |
JJ |
denotes |
rapid |
| T7955 |
37356-37364 |
NNS |
denotes |
kinetics |
| T7958 |
37365-37367 |
IN |
denotes |
of |
| T7959 |
37368-37373 |
NN |
denotes |
Snail |
| T7960 |
37374-37384 |
NN |
denotes |
expression |
| T7961 |
37385-37389 |
VBD |
denotes |
were |
| T7957 |
37390-37399 |
VBN |
denotes |
reflected |
| T7962 |
37400-37402 |
IN |
denotes |
at |
| T7963 |
37403-37406 |
DT |
denotes |
the |
| T7965 |
37407-37411 |
NN |
denotes |
mRNA |
| T7964 |
37412-37417 |
NN |
denotes |
level |
| T7966 |
37417-37419 |
, |
denotes |
, |
| T7967 |
37419-37429 |
VBG |
denotes |
suggesting |
| T7968 |
37430-37434 |
IN |
denotes |
that |
| T7970 |
37435-37440 |
NN |
denotes |
Snail |
| T7971 |
37441-37449 |
NN |
denotes |
promoter |
| T7972 |
37450-37458 |
NN |
denotes |
activity |
| T7973 |
37459-37461 |
IN |
denotes |
in |
| T7974 |
37462-37475 |
NNS |
denotes |
keratinocytes |
| T7975 |
37476-37481 |
MD |
denotes |
might |
| T7969 |
37482-37484 |
VB |
denotes |
be |
| T7976 |
37485-37494 |
JJ |
denotes |
sensitive |
| T7977 |
37495-37497 |
IN |
denotes |
to |
| T7978 |
37498-37501 |
NN |
denotes |
TGF |
| T7980 |
37501-37502 |
HYPH |
denotes |
- |
| T7979 |
37502-37504 |
NN |
denotes |
β2 |
| T7981 |
37505-37514 |
NN |
denotes |
signaling |
| T7982 |
37515-37516 |
-LRB- |
denotes |
( |
| T7984 |
37516-37522 |
NN |
denotes |
Figure |
| T7983 |
37523-37525 |
NN |
denotes |
5C |
| T7985 |
37525-37526 |
-RRB- |
denotes |
) |
| T7986 |
37526-37527 |
. |
denotes |
. |
| T7987 |
37527-37754 |
sentence |
denotes |
To test this possibility, we engineered a transgene driving the β-galactosidase reporter under the control of approximately 2.2 kb of promoter sequence located 5′ from the transcription initiation site of the mouse Snail gene. |
| T7988 |
37528-37530 |
TO |
denotes |
To |
| T7989 |
37531-37535 |
VB |
denotes |
test |
| T7991 |
37536-37540 |
DT |
denotes |
this |
| T7992 |
37541-37552 |
NN |
denotes |
possibility |
| T7993 |
37552-37554 |
, |
denotes |
, |
| T7994 |
37554-37556 |
PRP |
denotes |
we |
| T7990 |
37557-37567 |
VBD |
denotes |
engineered |
| T7995 |
37568-37569 |
DT |
denotes |
a |
| T7996 |
37570-37579 |
NN |
denotes |
transgene |
| T7997 |
37580-37587 |
VBG |
denotes |
driving |
| T7998 |
37588-37591 |
DT |
denotes |
the |
| T8000 |
37592-37593 |
NN |
denotes |
β |
| T8002 |
37593-37594 |
HYPH |
denotes |
- |
| T8001 |
37594-37607 |
NN |
denotes |
galactosidase |
| T7999 |
37608-37616 |
NN |
denotes |
reporter |
| T8003 |
37617-37622 |
IN |
denotes |
under |
| T8004 |
37623-37626 |
DT |
denotes |
the |
| T8005 |
37627-37634 |
NN |
denotes |
control |
| T8006 |
37635-37637 |
IN |
denotes |
of |
| T8007 |
37638-37651 |
RB |
denotes |
approximately |
| T8008 |
37652-37655 |
CD |
denotes |
2.2 |
| T8009 |
37656-37658 |
NN |
denotes |
kb |
| T8010 |
37659-37661 |
IN |
denotes |
of |
| T8011 |
37662-37670 |
NN |
denotes |
promoter |
| T8012 |
37671-37679 |
NN |
denotes |
sequence |
| T8013 |
37680-37687 |
VBN |
denotes |
located |
| T8014 |
37688-37689 |
CD |
denotes |
5 |
| T8015 |
37689-37690 |
SYM |
denotes |
′ |
| T8016 |
37691-37695 |
IN |
denotes |
from |
| T8017 |
37696-37699 |
DT |
denotes |
the |
| T8019 |
37700-37713 |
NN |
denotes |
transcription |
| T8020 |
37714-37724 |
NN |
denotes |
initiation |
| T8018 |
37725-37729 |
NN |
denotes |
site |
| T8021 |
37730-37732 |
IN |
denotes |
of |
| T8022 |
37733-37736 |
DT |
denotes |
the |
| T8024 |
37737-37742 |
NN |
denotes |
mouse |
| T8025 |
37743-37748 |
NN |
denotes |
Snail |
| T8023 |
37749-37753 |
NN |
denotes |
gene |
| T8026 |
37753-37754 |
. |
denotes |
. |
| T8027 |
37754-37954 |
sentence |
denotes |
At 2 d after transient transfection, keratinocytes were treated with TGF-β2 (t = 0) and then assayed for transgene activity over the same time course in which we had observed Snail protein induction. |
| T8028 |
37755-37757 |
IN |
denotes |
At |
| T8030 |
37758-37759 |
CD |
denotes |
2 |
| T8031 |
37760-37761 |
NN |
denotes |
d |
| T8032 |
37762-37767 |
IN |
denotes |
after |
| T8033 |
37768-37777 |
JJ |
denotes |
transient |
| T8034 |
37778-37790 |
NN |
denotes |
transfection |
| T8035 |
37790-37792 |
, |
denotes |
, |
| T8036 |
37792-37805 |
NNS |
denotes |
keratinocytes |
| T8037 |
37806-37810 |
VBD |
denotes |
were |
| T8029 |
37811-37818 |
VBN |
denotes |
treated |
| T8038 |
37819-37823 |
IN |
denotes |
with |
| T8039 |
37824-37827 |
NN |
denotes |
TGF |
| T8041 |
37827-37828 |
HYPH |
denotes |
- |
| T8040 |
37828-37830 |
NN |
denotes |
β2 |
| T8042 |
37831-37832 |
-LRB- |
denotes |
( |
| T8044 |
37832-37833 |
NN |
denotes |
t |
| T8045 |
37834-37835 |
SYM |
denotes |
= |
| T8043 |
37836-37837 |
CD |
denotes |
0 |
| T8046 |
37837-37838 |
-RRB- |
denotes |
) |
| T8047 |
37839-37842 |
CC |
denotes |
and |
| T8048 |
37843-37847 |
RB |
denotes |
then |
| T8049 |
37848-37855 |
VBN |
denotes |
assayed |
| T8050 |
37856-37859 |
IN |
denotes |
for |
| T8051 |
37860-37869 |
NN |
denotes |
transgene |
| T8052 |
37870-37878 |
NN |
denotes |
activity |
| T8053 |
37879-37883 |
IN |
denotes |
over |
| T8054 |
37884-37887 |
DT |
denotes |
the |
| T8056 |
37888-37892 |
JJ |
denotes |
same |
| T8057 |
37893-37897 |
NN |
denotes |
time |
| T8055 |
37898-37904 |
NN |
denotes |
course |
| T8058 |
37905-37907 |
IN |
denotes |
in |
| T8060 |
37908-37913 |
WDT |
denotes |
which |
| T8061 |
37914-37916 |
PRP |
denotes |
we |
| T8062 |
37917-37920 |
VBD |
denotes |
had |
| T8059 |
37921-37929 |
VBN |
denotes |
observed |
| T8063 |
37930-37935 |
NN |
denotes |
Snail |
| T8064 |
37936-37943 |
NN |
denotes |
protein |
| T8065 |
37944-37953 |
NN |
denotes |
induction |
| T8066 |
37953-37954 |
. |
denotes |
. |
| T8067 |
37954-38013 |
sentence |
denotes |
The results of this experiment are presented in Figure 5D. |
| T8068 |
37955-37958 |
DT |
denotes |
The |
| T8069 |
37959-37966 |
NNS |
denotes |
results |
| T8071 |
37967-37969 |
IN |
denotes |
of |
| T8072 |
37970-37974 |
DT |
denotes |
this |
| T8073 |
37975-37985 |
NN |
denotes |
experiment |
| T8074 |
37986-37989 |
VBP |
denotes |
are |
| T8070 |
37990-37999 |
VBN |
denotes |
presented |
| T8075 |
38000-38002 |
IN |
denotes |
in |
| T8076 |
38003-38009 |
NN |
denotes |
Figure |
| T8077 |
38010-38012 |
NN |
denotes |
5D |
| T8078 |
38012-38013 |
. |
denotes |
. |
| T8079 |
38013-38173 |
sentence |
denotes |
Within 0.5 h of TGF-β2 treatment, Snail promoter activity had increased 3-fold, and by 2 h, it peaked to approximately 10-fold over control levels (Figure 5D). |
| T8080 |
38014-38020 |
IN |
denotes |
Within |
| T8082 |
38021-38024 |
CD |
denotes |
0.5 |
| T8083 |
38025-38026 |
NN |
denotes |
h |
| T8084 |
38027-38029 |
IN |
denotes |
of |
| T8085 |
38030-38033 |
NN |
denotes |
TGF |
| T8087 |
38033-38034 |
HYPH |
denotes |
- |
| T8086 |
38034-38036 |
NN |
denotes |
β2 |
| T8088 |
38037-38046 |
NN |
denotes |
treatment |
| T8089 |
38046-38048 |
, |
denotes |
, |
| T8090 |
38048-38053 |
NN |
denotes |
Snail |
| T8091 |
38054-38062 |
NN |
denotes |
promoter |
| T8092 |
38063-38071 |
NN |
denotes |
activity |
| T8093 |
38072-38075 |
VBD |
denotes |
had |
| T8081 |
38076-38085 |
VBN |
denotes |
increased |
| T8094 |
38086-38092 |
RB |
denotes |
3-fold |
| T8095 |
38092-38094 |
, |
denotes |
, |
| T8096 |
38094-38097 |
CC |
denotes |
and |
| T8097 |
38098-38100 |
IN |
denotes |
by |
| T8099 |
38101-38102 |
CD |
denotes |
2 |
| T8100 |
38103-38104 |
NN |
denotes |
h |
| T8101 |
38104-38106 |
, |
denotes |
, |
| T8102 |
38106-38108 |
PRP |
denotes |
it |
| T8098 |
38109-38115 |
VBD |
denotes |
peaked |
| T8103 |
38116-38118 |
IN |
denotes |
to |
| T8104 |
38119-38132 |
RB |
denotes |
approximately |
| T8105 |
38133-38140 |
RB |
denotes |
10-fold |
| T8106 |
38141-38145 |
IN |
denotes |
over |
| T8107 |
38146-38153 |
NN |
denotes |
control |
| T8108 |
38154-38160 |
NNS |
denotes |
levels |
| T8109 |
38161-38162 |
-LRB- |
denotes |
( |
| T8111 |
38162-38168 |
NN |
denotes |
Figure |
| T8110 |
38169-38171 |
NN |
denotes |
5D |
| T8112 |
38171-38172 |
-RRB- |
denotes |
) |
| T8113 |
38172-38173 |
. |
denotes |
. |
| T8114 |
38173-38282 |
sentence |
denotes |
Thereafter, Snail promoter activity rapidly returned to the basal levels seen in unstimulated keratinocytes. |
| T8115 |
38174-38184 |
RB |
denotes |
Thereafter |
| T8117 |
38184-38186 |
, |
denotes |
, |
| T8118 |
38186-38191 |
NN |
denotes |
Snail |
| T8119 |
38192-38200 |
NN |
denotes |
promoter |
| T8120 |
38201-38209 |
NN |
denotes |
activity |
| T8121 |
38210-38217 |
RB |
denotes |
rapidly |
| T8116 |
38218-38226 |
VBD |
denotes |
returned |
| T8122 |
38227-38229 |
IN |
denotes |
to |
| T8123 |
38230-38233 |
DT |
denotes |
the |
| T8125 |
38234-38239 |
JJ |
denotes |
basal |
| T8124 |
38240-38246 |
NNS |
denotes |
levels |
| T8126 |
38247-38251 |
VBN |
denotes |
seen |
| T8127 |
38252-38254 |
IN |
denotes |
in |
| T8128 |
38255-38267 |
JJ |
denotes |
unstimulated |
| T8129 |
38268-38281 |
NNS |
denotes |
keratinocytes |
| T8130 |
38281-38282 |
. |
denotes |
. |
| T8131 |
38282-38385 |
sentence |
denotes |
The kinetics of Snail promoter activity closely paralleled those observed for Snail protein induction. |
| T8132 |
38283-38286 |
DT |
denotes |
The |
| T8133 |
38287-38295 |
NNS |
denotes |
kinetics |
| T8135 |
38296-38298 |
IN |
denotes |
of |
| T8136 |
38299-38304 |
NN |
denotes |
Snail |
| T8137 |
38305-38313 |
NN |
denotes |
promoter |
| T8138 |
38314-38322 |
NN |
denotes |
activity |
| T8139 |
38323-38330 |
RB |
denotes |
closely |
| T8134 |
38331-38341 |
VBD |
denotes |
paralleled |
| T8140 |
38342-38347 |
DT |
denotes |
those |
| T8141 |
38348-38356 |
VBN |
denotes |
observed |
| T8142 |
38357-38360 |
IN |
denotes |
for |
| T8143 |
38361-38366 |
NN |
denotes |
Snail |
| T8144 |
38367-38374 |
NN |
denotes |
protein |
| T8145 |
38375-38384 |
NN |
denotes |
induction |
| T8146 |
38384-38385 |
. |
denotes |
. |
| T8147 |
38385-38657 |
sentence |
denotes |
Moreover, the stimulatory effects appeared to be specific to TGF-β2, since they were abrogated either by heat inactivation of the TGF-β2 protein or by mutation of a putative SMAD binding element located about 1.8 kb 5′ from the Snail transcription start site (Figure 5D). |
| T8148 |
38386-38394 |
RB |
denotes |
Moreover |
| T8150 |
38394-38396 |
, |
denotes |
, |
| T8151 |
38396-38399 |
DT |
denotes |
the |
| T8153 |
38400-38411 |
JJ |
denotes |
stimulatory |
| T8152 |
38412-38419 |
NNS |
denotes |
effects |
| T8149 |
38420-38428 |
VBD |
denotes |
appeared |
| T8154 |
38429-38431 |
TO |
denotes |
to |
| T8155 |
38432-38434 |
VB |
denotes |
be |
| T8156 |
38435-38443 |
JJ |
denotes |
specific |
| T8157 |
38444-38446 |
IN |
denotes |
to |
| T8158 |
38447-38450 |
NN |
denotes |
TGF |
| T8160 |
38450-38451 |
HYPH |
denotes |
- |
| T8159 |
38451-38453 |
NN |
denotes |
β2 |
| T8161 |
38453-38455 |
, |
denotes |
, |
| T8162 |
38455-38460 |
IN |
denotes |
since |
| T8164 |
38461-38465 |
PRP |
denotes |
they |
| T8165 |
38466-38470 |
VBD |
denotes |
were |
| T8163 |
38471-38480 |
VBN |
denotes |
abrogated |
| T8166 |
38481-38487 |
CC |
denotes |
either |
| T8167 |
38488-38490 |
IN |
denotes |
by |
| T8168 |
38491-38495 |
NN |
denotes |
heat |
| T8169 |
38496-38508 |
NN |
denotes |
inactivation |
| T8170 |
38509-38511 |
IN |
denotes |
of |
| T8171 |
38512-38515 |
DT |
denotes |
the |
| T8173 |
38516-38519 |
NN |
denotes |
TGF |
| T8175 |
38519-38520 |
HYPH |
denotes |
- |
| T8174 |
38520-38522 |
NN |
denotes |
β2 |
| T8172 |
38523-38530 |
NN |
denotes |
protein |
| T8176 |
38531-38533 |
CC |
denotes |
or |
| T8177 |
38534-38536 |
IN |
denotes |
by |
| T8178 |
38537-38545 |
NN |
denotes |
mutation |
| T8179 |
38546-38548 |
IN |
denotes |
of |
| T8180 |
38549-38550 |
DT |
denotes |
a |
| T8182 |
38551-38559 |
JJ |
denotes |
putative |
| T8183 |
38560-38564 |
NN |
denotes |
SMAD |
| T8184 |
38565-38572 |
NN |
denotes |
binding |
| T8181 |
38573-38580 |
NN |
denotes |
element |
| T8185 |
38581-38588 |
VBN |
denotes |
located |
| T8186 |
38589-38594 |
IN |
denotes |
about |
| T8187 |
38595-38598 |
CD |
denotes |
1.8 |
| T8188 |
38599-38601 |
NN |
denotes |
kb |
| T8189 |
38602-38603 |
CD |
denotes |
5 |
| T8190 |
38603-38604 |
SYM |
denotes |
′ |
| T8191 |
38605-38609 |
IN |
denotes |
from |
| T8192 |
38610-38613 |
DT |
denotes |
the |
| T8194 |
38614-38619 |
NN |
denotes |
Snail |
| T8195 |
38620-38633 |
NN |
denotes |
transcription |
| T8196 |
38634-38639 |
NN |
denotes |
start |
| T8193 |
38640-38644 |
NN |
denotes |
site |
| T8197 |
38645-38646 |
-LRB- |
denotes |
( |
| T8199 |
38646-38652 |
NN |
denotes |
Figure |
| T8198 |
38653-38655 |
NN |
denotes |
5D |
| T8200 |
38655-38656 |
-RRB- |
denotes |
) |
| T8201 |
38656-38657 |
. |
denotes |
. |
| T8202 |
38657-38896 |
sentence |
denotes |
Taken together, these results suggested that in keratinocytes, TGF-β2 signaling results in a pSMAD2-dependent transient activation of the Snail gene, and that maintenance of Snail protein relies, in part, upon sustained promoter activity. |
| T8203 |
38658-38663 |
VBN |
denotes |
Taken |
| T8205 |
38664-38672 |
RB |
denotes |
together |
| T8206 |
38672-38674 |
, |
denotes |
, |
| T8207 |
38674-38679 |
DT |
denotes |
these |
| T8208 |
38680-38687 |
NNS |
denotes |
results |
| T8204 |
38688-38697 |
VBD |
denotes |
suggested |
| T8209 |
38698-38702 |
IN |
denotes |
that |
| T8211 |
38703-38705 |
IN |
denotes |
in |
| T8212 |
38706-38719 |
NNS |
denotes |
keratinocytes |
| T8213 |
38719-38721 |
, |
denotes |
, |
| T8214 |
38721-38724 |
NN |
denotes |
TGF |
| T8216 |
38724-38725 |
HYPH |
denotes |
- |
| T8215 |
38725-38727 |
NN |
denotes |
β2 |
| T8217 |
38728-38737 |
NN |
denotes |
signaling |
| T8210 |
38738-38745 |
VBZ |
denotes |
results |
| T8218 |
38746-38748 |
IN |
denotes |
in |
| T8219 |
38749-38750 |
DT |
denotes |
a |
| T8221 |
38751-38757 |
NN |
denotes |
pSMAD2 |
| T8223 |
38757-38758 |
HYPH |
denotes |
- |
| T8222 |
38758-38767 |
JJ |
denotes |
dependent |
| T8224 |
38768-38777 |
JJ |
denotes |
transient |
| T8220 |
38778-38788 |
NN |
denotes |
activation |
| T8225 |
38789-38791 |
IN |
denotes |
of |
| T8226 |
38792-38795 |
DT |
denotes |
the |
| T8228 |
38796-38801 |
NN |
denotes |
Snail |
| T8227 |
38802-38806 |
NN |
denotes |
gene |
| T8229 |
38806-38808 |
, |
denotes |
, |
| T8230 |
38808-38811 |
CC |
denotes |
and |
| T8231 |
38812-38816 |
IN |
denotes |
that |
| T8233 |
38817-38828 |
NN |
denotes |
maintenance |
| T8234 |
38829-38831 |
IN |
denotes |
of |
| T8235 |
38832-38837 |
NN |
denotes |
Snail |
| T8236 |
38838-38845 |
NN |
denotes |
protein |
| T8232 |
38846-38852 |
VBZ |
denotes |
relies |
| T8237 |
38852-38854 |
, |
denotes |
, |
| T8238 |
38854-38856 |
IN |
denotes |
in |
| T8239 |
38857-38861 |
NN |
denotes |
part |
| T8240 |
38861-38863 |
, |
denotes |
, |
| T8241 |
38863-38867 |
IN |
denotes |
upon |
| T8242 |
38868-38877 |
JJ |
denotes |
sustained |
| T8244 |
38878-38886 |
NN |
denotes |
promoter |
| T8243 |
38887-38895 |
NN |
denotes |
activity |
| T8245 |
38895-38896 |
. |
denotes |
. |
| T8246 |
38896-39119 |
sentence |
denotes |
The brevity of Snail gene and protein induction in TGF-β2 treated cultured keratinocytes resembled the temporal appearance of Snail mRNA and protein at the initiation of hair follicle morphogenesis in embryonic mouse skin. |
| T8247 |
38897-38900 |
DT |
denotes |
The |
| T8248 |
38901-38908 |
NN |
denotes |
brevity |
| T8250 |
38909-38911 |
IN |
denotes |
of |
| T8251 |
38912-38917 |
NN |
denotes |
Snail |
| T8252 |
38918-38922 |
NN |
denotes |
gene |
| T8254 |
38923-38926 |
CC |
denotes |
and |
| T8255 |
38927-38934 |
NN |
denotes |
protein |
| T8253 |
38935-38944 |
NN |
denotes |
induction |
| T8256 |
38945-38947 |
IN |
denotes |
in |
| T8257 |
38948-38951 |
NN |
denotes |
TGF |
| T8259 |
38951-38952 |
HYPH |
denotes |
- |
| T8258 |
38952-38954 |
NN |
denotes |
β2 |
| T8260 |
38955-38962 |
VBN |
denotes |
treated |
| T8262 |
38963-38971 |
VBN |
denotes |
cultured |
| T8261 |
38972-38985 |
NNS |
denotes |
keratinocytes |
| T8249 |
38986-38995 |
VBD |
denotes |
resembled |
| T8263 |
38996-38999 |
DT |
denotes |
the |
| T8265 |
39000-39008 |
JJ |
denotes |
temporal |
| T8264 |
39009-39019 |
NN |
denotes |
appearance |
| T8266 |
39020-39022 |
IN |
denotes |
of |
| T8267 |
39023-39028 |
NN |
denotes |
Snail |
| T8268 |
39029-39033 |
NN |
denotes |
mRNA |
| T8269 |
39034-39037 |
CC |
denotes |
and |
| T8270 |
39038-39045 |
NN |
denotes |
protein |
| T8271 |
39046-39048 |
IN |
denotes |
at |
| T8272 |
39049-39052 |
DT |
denotes |
the |
| T8273 |
39053-39063 |
NN |
denotes |
initiation |
| T8274 |
39064-39066 |
IN |
denotes |
of |
| T8275 |
39067-39071 |
NN |
denotes |
hair |
| T8276 |
39072-39080 |
NN |
denotes |
follicle |
| T8277 |
39081-39094 |
NN |
denotes |
morphogenesis |
| T8278 |
39095-39097 |
IN |
denotes |
in |
| T8279 |
39098-39107 |
JJ |
denotes |
embryonic |
| T8281 |
39108-39113 |
NN |
denotes |
mouse |
| T8280 |
39114-39118 |
NN |
denotes |
skin |
| T8282 |
39118-39119 |
. |
denotes |
. |
| T8283 |
39119-39285 |
sentence |
denotes |
To test whether TGF-β2 might be required for Snail induction in hair bud formation in vivo, we first analyzed whether TGF-β2 was expressed in or around the hair bud. |
| T8284 |
39120-39122 |
TO |
denotes |
To |
| T8285 |
39123-39127 |
VB |
denotes |
test |
| T8287 |
39128-39135 |
IN |
denotes |
whether |
| T8289 |
39136-39139 |
NN |
denotes |
TGF |
| T8291 |
39139-39140 |
HYPH |
denotes |
- |
| T8290 |
39140-39142 |
NN |
denotes |
β2 |
| T8292 |
39143-39148 |
MD |
denotes |
might |
| T8293 |
39149-39151 |
VB |
denotes |
be |
| T8288 |
39152-39160 |
VBN |
denotes |
required |
| T8294 |
39161-39164 |
IN |
denotes |
for |
| T8295 |
39165-39170 |
NN |
denotes |
Snail |
| T8296 |
39171-39180 |
NN |
denotes |
induction |
| T8297 |
39181-39183 |
IN |
denotes |
in |
| T8298 |
39184-39188 |
NN |
denotes |
hair |
| T8299 |
39189-39192 |
NN |
denotes |
bud |
| T8300 |
39193-39202 |
NN |
denotes |
formation |
| T8301 |
39203-39205 |
FW |
denotes |
in |
| T8302 |
39206-39210 |
FW |
denotes |
vivo |
| T8303 |
39210-39212 |
, |
denotes |
, |
| T8304 |
39212-39214 |
PRP |
denotes |
we |
| T8305 |
39215-39220 |
RB |
denotes |
first |
| T8286 |
39221-39229 |
VBD |
denotes |
analyzed |
| T8306 |
39230-39237 |
IN |
denotes |
whether |
| T8308 |
39238-39241 |
NN |
denotes |
TGF |
| T8310 |
39241-39242 |
HYPH |
denotes |
- |
| T8309 |
39242-39244 |
NN |
denotes |
β2 |
| T8311 |
39245-39248 |
VBD |
denotes |
was |
| T8307 |
39249-39258 |
VBN |
denotes |
expressed |
| T8312 |
39259-39261 |
IN |
denotes |
in |
| T8313 |
39262-39264 |
CC |
denotes |
or |
| T8314 |
39265-39271 |
IN |
denotes |
around |
| T8315 |
39272-39275 |
DT |
denotes |
the |
| T8317 |
39276-39280 |
NN |
denotes |
hair |
| T8316 |
39281-39284 |
NN |
denotes |
bud |
| T8318 |
39284-39285 |
. |
denotes |
. |
| T8319 |
39285-39395 |
sentence |
denotes |
Consistent with previous observations [33], an anti-TGF-β2 antibody labeled developing hair buds (Figure 6A). |
| T8320 |
39286-39296 |
JJ |
denotes |
Consistent |
| T8322 |
39297-39301 |
IN |
denotes |
with |
| T8323 |
39302-39310 |
JJ |
denotes |
previous |
| T8324 |
39311-39323 |
NNS |
denotes |
observations |
| T8325 |
39324-39325 |
-LRB- |
denotes |
[ |
| T8326 |
39325-39327 |
CD |
denotes |
33 |
| T8327 |
39327-39328 |
-RRB- |
denotes |
] |
| T8328 |
39328-39330 |
, |
denotes |
, |
| T8329 |
39330-39332 |
DT |
denotes |
an |
| T8331 |
39333-39341 |
JJ |
denotes |
anti-TGF |
| T8333 |
39341-39342 |
HYPH |
denotes |
- |
| T8332 |
39342-39344 |
NN |
denotes |
β2 |
| T8330 |
39345-39353 |
NN |
denotes |
antibody |
| T8321 |
39354-39361 |
VBD |
denotes |
labeled |
| T8334 |
39362-39372 |
VBG |
denotes |
developing |
| T8336 |
39373-39377 |
NN |
denotes |
hair |
| T8335 |
39378-39382 |
NNS |
denotes |
buds |
| T8337 |
39383-39384 |
-LRB- |
denotes |
( |
| T8339 |
39384-39390 |
NN |
denotes |
Figure |
| T8338 |
39391-39393 |
NN |
denotes |
6A |
| T8340 |
39393-39394 |
-RRB- |
denotes |
) |
| T8341 |
39394-39395 |
. |
denotes |
. |
| T8342 |
39395-39551 |
sentence |
denotes |
This labeling appeared to be specific as judged by the lack of staining in follicle buds from mice homozygous for a TGF-β2 null mutation (Figure 6A; [34]). |
| T8343 |
39396-39400 |
DT |
denotes |
This |
| T8344 |
39401-39409 |
NN |
denotes |
labeling |
| T8345 |
39410-39418 |
VBD |
denotes |
appeared |
| T8346 |
39419-39421 |
TO |
denotes |
to |
| T8347 |
39422-39424 |
VB |
denotes |
be |
| T8348 |
39425-39433 |
JJ |
denotes |
specific |
| T8349 |
39434-39436 |
IN |
denotes |
as |
| T8350 |
39437-39443 |
VBN |
denotes |
judged |
| T8351 |
39444-39446 |
IN |
denotes |
by |
| T8352 |
39447-39450 |
DT |
denotes |
the |
| T8353 |
39451-39455 |
NN |
denotes |
lack |
| T8354 |
39456-39458 |
IN |
denotes |
of |
| T8355 |
39459-39467 |
NN |
denotes |
staining |
| T8356 |
39468-39470 |
IN |
denotes |
in |
| T8357 |
39471-39479 |
NN |
denotes |
follicle |
| T8358 |
39480-39484 |
NNS |
denotes |
buds |
| T8359 |
39485-39489 |
IN |
denotes |
from |
| T8360 |
39490-39494 |
NNS |
denotes |
mice |
| T8361 |
39495-39505 |
JJ |
denotes |
homozygous |
| T8362 |
39506-39509 |
IN |
denotes |
for |
| T8363 |
39510-39511 |
DT |
denotes |
a |
| T8365 |
39512-39515 |
NN |
denotes |
TGF |
| T8367 |
39515-39516 |
HYPH |
denotes |
- |
| T8366 |
39516-39518 |
NN |
denotes |
β2 |
| T8368 |
39519-39523 |
JJ |
denotes |
null |
| T8364 |
39524-39532 |
NN |
denotes |
mutation |
| T8369 |
39533-39534 |
-LRB- |
denotes |
( |
| T8371 |
39534-39540 |
NN |
denotes |
Figure |
| T8372 |
39541-39543 |
NN |
denotes |
6A |
| T8373 |
39543-39544 |
: |
denotes |
; |
| T8374 |
39545-39546 |
-LRB- |
denotes |
[ |
| T8370 |
39546-39548 |
CD |
denotes |
34 |
| T8375 |
39548-39549 |
-RRB- |
denotes |
] |
| T8376 |
39549-39550 |
-RRB- |
denotes |
) |
| T8377 |
39550-39551 |
. |
denotes |
. |
| T8378 |
39551-39684 |
sentence |
denotes |
Moreover, the downstream effector of TGF-β2 signaling, pSMAD2, was also expressed in WT, but not TGF-β2-null, hair buds (Figure 6B). |
| T8379 |
39552-39560 |
RB |
denotes |
Moreover |
| T8381 |
39560-39562 |
, |
denotes |
, |
| T8382 |
39562-39565 |
DT |
denotes |
the |
| T8384 |
39566-39576 |
JJ |
denotes |
downstream |
| T8383 |
39577-39585 |
NN |
denotes |
effector |
| T8385 |
39586-39588 |
IN |
denotes |
of |
| T8386 |
39589-39592 |
NN |
denotes |
TGF |
| T8388 |
39592-39593 |
HYPH |
denotes |
- |
| T8387 |
39593-39595 |
NN |
denotes |
β2 |
| T8389 |
39596-39605 |
NN |
denotes |
signaling |
| T8390 |
39605-39607 |
, |
denotes |
, |
| T8391 |
39607-39613 |
NN |
denotes |
pSMAD2 |
| T8392 |
39613-39615 |
, |
denotes |
, |
| T8393 |
39615-39618 |
VBD |
denotes |
was |
| T8394 |
39619-39623 |
RB |
denotes |
also |
| T8380 |
39624-39633 |
VBN |
denotes |
expressed |
| T8395 |
39634-39636 |
IN |
denotes |
in |
| T8396 |
39637-39639 |
NN |
denotes |
WT |
| T8398 |
39639-39641 |
, |
denotes |
, |
| T8399 |
39641-39644 |
CC |
denotes |
but |
| T8400 |
39645-39648 |
RB |
denotes |
not |
| T8401 |
39649-39652 |
NN |
denotes |
TGF |
| T8403 |
39652-39653 |
HYPH |
denotes |
- |
| T8402 |
39653-39655 |
NN |
denotes |
β2 |
| T8405 |
39655-39656 |
HYPH |
denotes |
- |
| T8404 |
39656-39660 |
JJ |
denotes |
null |
| T8406 |
39660-39662 |
, |
denotes |
, |
| T8407 |
39662-39666 |
NN |
denotes |
hair |
| T8397 |
39667-39671 |
NNS |
denotes |
buds |
| T8408 |
39672-39673 |
-LRB- |
denotes |
( |
| T8410 |
39673-39679 |
NN |
denotes |
Figure |
| T8409 |
39680-39682 |
NN |
denotes |
6B |
| T8411 |
39682-39683 |
-RRB- |
denotes |
) |
| T8412 |
39683-39684 |
. |
denotes |
. |
| T8413 |
39684-39837 |
sentence |
denotes |
Together, these data underscore the importance of the TGF-β2 isoform despite expression of both TGF-β1 and TGF-β2 in developing hair buds at this stage. |
| T8414 |
39685-39693 |
RB |
denotes |
Together |
| T8416 |
39693-39695 |
, |
denotes |
, |
| T8417 |
39695-39700 |
DT |
denotes |
these |
| T8418 |
39701-39705 |
NNS |
denotes |
data |
| T8415 |
39706-39716 |
VBP |
denotes |
underscore |
| T8419 |
39717-39720 |
DT |
denotes |
the |
| T8420 |
39721-39731 |
NN |
denotes |
importance |
| T8421 |
39732-39734 |
IN |
denotes |
of |
| T8422 |
39735-39738 |
DT |
denotes |
the |
| T8424 |
39739-39742 |
NN |
denotes |
TGF |
| T8426 |
39742-39743 |
HYPH |
denotes |
- |
| T8425 |
39743-39745 |
NN |
denotes |
β2 |
| T8423 |
39746-39753 |
NN |
denotes |
isoform |
| T8427 |
39754-39761 |
IN |
denotes |
despite |
| T8428 |
39762-39772 |
NN |
denotes |
expression |
| T8429 |
39773-39775 |
IN |
denotes |
of |
| T8430 |
39776-39780 |
CC |
denotes |
both |
| T8432 |
39781-39784 |
NN |
denotes |
TGF |
| T8433 |
39784-39785 |
HYPH |
denotes |
- |
| T8431 |
39785-39787 |
NN |
denotes |
β1 |
| T8434 |
39788-39791 |
CC |
denotes |
and |
| T8435 |
39792-39795 |
NN |
denotes |
TGF |
| T8437 |
39795-39796 |
HYPH |
denotes |
- |
| T8436 |
39796-39798 |
NN |
denotes |
β2 |
| T8438 |
39799-39801 |
IN |
denotes |
in |
| T8439 |
39802-39812 |
VBG |
denotes |
developing |
| T8441 |
39813-39817 |
NN |
denotes |
hair |
| T8440 |
39818-39822 |
NNS |
denotes |
buds |
| T8442 |
39823-39825 |
IN |
denotes |
at |
| T8443 |
39826-39830 |
DT |
denotes |
this |
| T8444 |
39831-39836 |
NN |
denotes |
stage |
| T8445 |
39836-39837 |
. |
denotes |
. |
| T8446 |
39837-40968 |
sentence |
denotes |
Figure 6 TGF-β2 Is Necessary to Induce Snail Expression and Regulate Proliferation and E-Cadherin in the Hair Bud
(A–D) Skins from TGF-β2 WT or KO E17.5 embryos were analyzed for expression of TGF-β2 protein (A), which is present in the epidermis and dermis as previously described [33] and in the hair bud, pSMAD2 (B), Snail (C), and Snail mRNA (D). Arrows point to the hair buds.
(E) Western blot analyses of Snail expression in the skins of 2-wk-old K14-Smad2 transgenic (SMAD2 TG) and WT littermate (WT) mice. Antibody to tubulin was used as a control for equal protein loadings. The K14-Smad2 Tg mouse was previously shown to possess activated TGF-β signaling [35].
(F–G) Proliferation markers Ki67 (F) and pMAPK (G) are diminished in TGF-β2-null hair relative to its WT counterpart.
(H–J) TGF-β2-null hair fails to down-regulate E-cadherin (H). Wnt and noggin signaling pathways are still intact in the TGF-β2 null hair as nuclear LEF-1 (I) and nuclear β-catenin (J) are still expressed. To further explore the possible relation between Snail and TGF-β2, we examined the status of Snail expression in TGF-β2-null hair buds. |
| T8447 |
40833-40835 |
TO |
denotes |
To |
| T8449 |
40836-40843 |
RB |
denotes |
further |
| T8448 |
40844-40851 |
VB |
denotes |
explore |
| T8451 |
40852-40855 |
DT |
denotes |
the |
| T8453 |
40856-40864 |
JJ |
denotes |
possible |
| T8452 |
40865-40873 |
NN |
denotes |
relation |
| T8454 |
40874-40881 |
IN |
denotes |
between |
| T8455 |
40882-40887 |
NN |
denotes |
Snail |
| T8456 |
40888-40891 |
CC |
denotes |
and |
| T8457 |
40892-40895 |
NN |
denotes |
TGF |
| T8459 |
40895-40896 |
HYPH |
denotes |
- |
| T8458 |
40896-40898 |
NN |
denotes |
β2 |
| T8460 |
40898-40900 |
, |
denotes |
, |
| T8461 |
40900-40902 |
PRP |
denotes |
we |
| T8450 |
40903-40911 |
VBD |
denotes |
examined |
| T8462 |
40912-40915 |
DT |
denotes |
the |
| T8463 |
40916-40922 |
NN |
denotes |
status |
| T8464 |
40923-40925 |
IN |
denotes |
of |
| T8465 |
40926-40931 |
NN |
denotes |
Snail |
| T8466 |
40932-40942 |
NN |
denotes |
expression |
| T8467 |
40943-40945 |
IN |
denotes |
in |
| T8468 |
40946-40949 |
NN |
denotes |
TGF |
| T8470 |
40949-40950 |
HYPH |
denotes |
- |
| T8469 |
40950-40952 |
NN |
denotes |
β2 |
| T8472 |
40952-40953 |
HYPH |
denotes |
- |
| T8471 |
40953-40957 |
JJ |
denotes |
null |
| T8474 |
40958-40962 |
NN |
denotes |
hair |
| T8473 |
40963-40967 |
NNS |
denotes |
buds |
| T8475 |
40967-40968 |
. |
denotes |
. |
| T8476 |
40968-41121 |
sentence |
denotes |
As judged by immunohistochemistry, Snail protein was absent from E17.5 skin of TGF-β2-null embryos but not from that of control littermates (Figure 6C). |
| T8477 |
40969-40971 |
IN |
denotes |
As |
| T8478 |
40972-40978 |
VBN |
denotes |
judged |
| T8480 |
40979-40981 |
IN |
denotes |
by |
| T8481 |
40982-41002 |
NN |
denotes |
immunohistochemistry |
| T8482 |
41002-41004 |
, |
denotes |
, |
| T8483 |
41004-41009 |
NN |
denotes |
Snail |
| T8484 |
41010-41017 |
NN |
denotes |
protein |
| T8479 |
41018-41021 |
VBD |
denotes |
was |
| T8485 |
41022-41028 |
JJ |
denotes |
absent |
| T8486 |
41029-41033 |
IN |
denotes |
from |
| T8487 |
41034-41039 |
NN |
denotes |
E17.5 |
| T8488 |
41040-41044 |
NN |
denotes |
skin |
| T8489 |
41045-41047 |
IN |
denotes |
of |
| T8490 |
41048-41051 |
NN |
denotes |
TGF |
| T8492 |
41051-41052 |
HYPH |
denotes |
- |
| T8491 |
41052-41054 |
NN |
denotes |
β2 |
| T8494 |
41054-41055 |
HYPH |
denotes |
- |
| T8493 |
41055-41059 |
JJ |
denotes |
null |
| T8495 |
41060-41067 |
NNS |
denotes |
embryos |
| T8496 |
41068-41071 |
CC |
denotes |
but |
| T8497 |
41072-41075 |
RB |
denotes |
not |
| T8498 |
41076-41080 |
IN |
denotes |
from |
| T8499 |
41081-41085 |
DT |
denotes |
that |
| T8500 |
41086-41088 |
IN |
denotes |
of |
| T8501 |
41089-41096 |
NN |
denotes |
control |
| T8502 |
41097-41108 |
NNS |
denotes |
littermates |
| T8503 |
41109-41110 |
-LRB- |
denotes |
( |
| T8505 |
41110-41116 |
NN |
denotes |
Figure |
| T8504 |
41117-41119 |
NN |
denotes |
6C |
| T8506 |
41119-41120 |
-RRB- |
denotes |
) |
| T8507 |
41120-41121 |
. |
denotes |
. |
| T8508 |
41121-41356 |
sentence |
denotes |
This effect appeared to be exerted at the transcriptional level, since Snail mRNAs were also not found in TGF-β2 null hair buds under conditions in which the signal was readily detected in the hair buds of littermate skin (Figure 6D). |
| T8509 |
41122-41126 |
DT |
denotes |
This |
| T8510 |
41127-41133 |
NN |
denotes |
effect |
| T8511 |
41134-41142 |
VBD |
denotes |
appeared |
| T8512 |
41143-41145 |
TO |
denotes |
to |
| T8514 |
41146-41148 |
VB |
denotes |
be |
| T8513 |
41149-41156 |
VBN |
denotes |
exerted |
| T8515 |
41157-41159 |
IN |
denotes |
at |
| T8516 |
41160-41163 |
DT |
denotes |
the |
| T8518 |
41164-41179 |
JJ |
denotes |
transcriptional |
| T8517 |
41180-41185 |
NN |
denotes |
level |
| T8519 |
41185-41187 |
, |
denotes |
, |
| T8520 |
41187-41192 |
IN |
denotes |
since |
| T8522 |
41193-41198 |
NN |
denotes |
Snail |
| T8523 |
41199-41204 |
NNS |
denotes |
mRNAs |
| T8524 |
41205-41209 |
VBD |
denotes |
were |
| T8525 |
41210-41214 |
RB |
denotes |
also |
| T8526 |
41215-41218 |
RB |
denotes |
not |
| T8521 |
41219-41224 |
VBN |
denotes |
found |
| T8527 |
41225-41227 |
IN |
denotes |
in |
| T8528 |
41228-41231 |
NN |
denotes |
TGF |
| T8530 |
41231-41232 |
HYPH |
denotes |
- |
| T8529 |
41232-41234 |
NN |
denotes |
β2 |
| T8531 |
41235-41239 |
JJ |
denotes |
null |
| T8533 |
41240-41244 |
NN |
denotes |
hair |
| T8532 |
41245-41249 |
NNS |
denotes |
buds |
| T8534 |
41250-41255 |
IN |
denotes |
under |
| T8535 |
41256-41266 |
NNS |
denotes |
conditions |
| T8536 |
41267-41269 |
IN |
denotes |
in |
| T8538 |
41270-41275 |
WDT |
denotes |
which |
| T8539 |
41276-41279 |
DT |
denotes |
the |
| T8540 |
41280-41286 |
NN |
denotes |
signal |
| T8541 |
41287-41290 |
VBD |
denotes |
was |
| T8542 |
41291-41298 |
RB |
denotes |
readily |
| T8537 |
41299-41307 |
VBN |
denotes |
detected |
| T8543 |
41308-41310 |
IN |
denotes |
in |
| T8544 |
41311-41314 |
DT |
denotes |
the |
| T8546 |
41315-41319 |
NN |
denotes |
hair |
| T8545 |
41320-41324 |
NNS |
denotes |
buds |
| T8547 |
41325-41327 |
IN |
denotes |
of |
| T8548 |
41328-41338 |
NN |
denotes |
littermate |
| T8549 |
41339-41343 |
NN |
denotes |
skin |
| T8550 |
41344-41345 |
-LRB- |
denotes |
( |
| T8552 |
41345-41351 |
NN |
denotes |
Figure |
| T8551 |
41352-41354 |
NN |
denotes |
6D |
| T8553 |
41354-41355 |
-RRB- |
denotes |
) |
| T8554 |
41355-41356 |
. |
denotes |
. |
| T8555 |
41356-41567 |
sentence |
denotes |
Conversely, in 2-wk-old K14-Smad2 Tg mice, which display elevated TGF-β signaling in skin [35], Snail protein was readily detected by Western blot analyses, where it was not found in postnatal skin (Figure 6E). |
| T8556 |
41357-41367 |
RB |
denotes |
Conversely |
| T8558 |
41367-41369 |
, |
denotes |
, |
| T8559 |
41369-41371 |
IN |
denotes |
in |
| T8560 |
41372-41373 |
CD |
denotes |
2 |
| T8562 |
41373-41374 |
HYPH |
denotes |
- |
| T8561 |
41374-41376 |
NN |
denotes |
wk |
| T8564 |
41376-41377 |
HYPH |
denotes |
- |
| T8563 |
41377-41380 |
JJ |
denotes |
old |
| T8566 |
41381-41384 |
NN |
denotes |
K14 |
| T8568 |
41384-41385 |
HYPH |
denotes |
- |
| T8567 |
41385-41390 |
NN |
denotes |
Smad2 |
| T8569 |
41391-41393 |
NN |
denotes |
Tg |
| T8565 |
41394-41398 |
NNS |
denotes |
mice |
| T8570 |
41398-41400 |
, |
denotes |
, |
| T8571 |
41400-41405 |
WDT |
denotes |
which |
| T8572 |
41406-41413 |
VBP |
denotes |
display |
| T8573 |
41414-41422 |
VBN |
denotes |
elevated |
| T8575 |
41423-41426 |
NN |
denotes |
TGF |
| T8577 |
41426-41427 |
HYPH |
denotes |
- |
| T8576 |
41427-41428 |
NN |
denotes |
β |
| T8574 |
41429-41438 |
NN |
denotes |
signaling |
| T8578 |
41439-41441 |
IN |
denotes |
in |
| T8579 |
41442-41446 |
NN |
denotes |
skin |
| T8580 |
41447-41448 |
-LRB- |
denotes |
[ |
| T8581 |
41448-41450 |
CD |
denotes |
35 |
| T8582 |
41450-41451 |
-RRB- |
denotes |
] |
| T8583 |
41451-41453 |
, |
denotes |
, |
| T8584 |
41453-41458 |
NN |
denotes |
Snail |
| T8585 |
41459-41466 |
NN |
denotes |
protein |
| T8586 |
41467-41470 |
VBD |
denotes |
was |
| T8587 |
41471-41478 |
RB |
denotes |
readily |
| T8557 |
41479-41487 |
VBN |
denotes |
detected |
| T8588 |
41488-41490 |
IN |
denotes |
by |
| T8589 |
41491-41498 |
NNP |
denotes |
Western |
| T8590 |
41499-41503 |
NN |
denotes |
blot |
| T8591 |
41504-41512 |
NNS |
denotes |
analyses |
| T8592 |
41512-41514 |
, |
denotes |
, |
| T8593 |
41514-41519 |
WRB |
denotes |
where |
| T8595 |
41520-41522 |
PRP |
denotes |
it |
| T8596 |
41523-41526 |
VBD |
denotes |
was |
| T8597 |
41527-41530 |
RB |
denotes |
not |
| T8594 |
41531-41536 |
VBN |
denotes |
found |
| T8598 |
41537-41539 |
IN |
denotes |
in |
| T8599 |
41540-41549 |
JJ |
denotes |
postnatal |
| T8600 |
41550-41554 |
NN |
denotes |
skin |
| T8601 |
41555-41556 |
-LRB- |
denotes |
( |
| T8603 |
41556-41562 |
NN |
denotes |
Figure |
| T8602 |
41563-41565 |
NN |
denotes |
6E |
| T8604 |
41565-41566 |
-RRB- |
denotes |
) |
| T8605 |
41566-41567 |
. |
denotes |
. |
| T8606 |
41567-41751 |
sentence |
denotes |
Taken together, these results provide compelling evidence that TGF-β2 is functionally important for inducing Snail gene expression in a pSMAD-dependent manner in developing hair buds. |
| T8607 |
41568-41573 |
VBN |
denotes |
Taken |
| T8609 |
41574-41582 |
RB |
denotes |
together |
| T8610 |
41582-41584 |
, |
denotes |
, |
| T8611 |
41584-41589 |
DT |
denotes |
these |
| T8612 |
41590-41597 |
NNS |
denotes |
results |
| T8608 |
41598-41605 |
VBP |
denotes |
provide |
| T8613 |
41606-41616 |
JJ |
denotes |
compelling |
| T8614 |
41617-41625 |
NN |
denotes |
evidence |
| T8615 |
41626-41630 |
IN |
denotes |
that |
| T8617 |
41631-41634 |
NN |
denotes |
TGF |
| T8619 |
41634-41635 |
HYPH |
denotes |
- |
| T8618 |
41635-41637 |
NN |
denotes |
β2 |
| T8616 |
41638-41640 |
VBZ |
denotes |
is |
| T8620 |
41641-41653 |
RB |
denotes |
functionally |
| T8621 |
41654-41663 |
JJ |
denotes |
important |
| T8622 |
41664-41667 |
IN |
denotes |
for |
| T8623 |
41668-41676 |
VBG |
denotes |
inducing |
| T8624 |
41677-41682 |
NN |
denotes |
Snail |
| T8626 |
41683-41687 |
NN |
denotes |
gene |
| T8625 |
41688-41698 |
NN |
denotes |
expression |
| T8627 |
41699-41701 |
IN |
denotes |
in |
| T8628 |
41702-41703 |
DT |
denotes |
a |
| T8630 |
41704-41709 |
NN |
denotes |
pSMAD |
| T8632 |
41709-41710 |
HYPH |
denotes |
- |
| T8631 |
41710-41719 |
JJ |
denotes |
dependent |
| T8629 |
41720-41726 |
NN |
denotes |
manner |
| T8633 |
41727-41729 |
IN |
denotes |
in |
| T8634 |
41730-41740 |
VBG |
denotes |
developing |
| T8636 |
41741-41745 |
NN |
denotes |
hair |
| T8635 |
41746-41750 |
NNS |
denotes |
buds |
| T8637 |
41750-41751 |
. |
denotes |
. |
| T8638 |
41751-41855 |
sentence |
denotes |
Whether pMARK activity also contributes to Snail induction was not addressed in the present study [15]. |
| T8639 |
41752-41759 |
IN |
denotes |
Whether |
| T8641 |
41760-41765 |
NN |
denotes |
pMARK |
| T8642 |
41766-41774 |
NN |
denotes |
activity |
| T8643 |
41775-41779 |
RB |
denotes |
also |
| T8640 |
41780-41791 |
VBZ |
denotes |
contributes |
| T8645 |
41792-41794 |
IN |
denotes |
to |
| T8646 |
41795-41800 |
NN |
denotes |
Snail |
| T8647 |
41801-41810 |
NN |
denotes |
induction |
| T8648 |
41811-41814 |
VBD |
denotes |
was |
| T8649 |
41815-41818 |
RB |
denotes |
not |
| T8644 |
41819-41828 |
VBN |
denotes |
addressed |
| T8650 |
41829-41831 |
IN |
denotes |
in |
| T8651 |
41832-41835 |
DT |
denotes |
the |
| T8653 |
41836-41843 |
JJ |
denotes |
present |
| T8652 |
41844-41849 |
NN |
denotes |
study |
| T8654 |
41850-41851 |
-LRB- |
denotes |
[ |
| T8655 |
41851-41853 |
CD |
denotes |
15 |
| T8656 |
41853-41854 |
-RRB- |
denotes |
] |
| T8657 |
41854-41855 |
. |
denotes |
. |
| T8658 |
41855-41965 |
sentence |
denotes |
Although some hair buds still formed in TGF-β2 null skin, their number was reduced by approximately 50% [32]. |
| T8659 |
41856-41864 |
IN |
denotes |
Although |
| T8661 |
41865-41869 |
DT |
denotes |
some |
| T8663 |
41870-41874 |
NN |
denotes |
hair |
| T8662 |
41875-41879 |
NNS |
denotes |
buds |
| T8664 |
41880-41885 |
RB |
denotes |
still |
| T8660 |
41886-41892 |
VBD |
denotes |
formed |
| T8666 |
41893-41895 |
IN |
denotes |
in |
| T8667 |
41896-41899 |
NN |
denotes |
TGF |
| T8669 |
41899-41900 |
HYPH |
denotes |
- |
| T8668 |
41900-41902 |
NN |
denotes |
β2 |
| T8670 |
41903-41907 |
JJ |
denotes |
null |
| T8671 |
41908-41912 |
NN |
denotes |
skin |
| T8672 |
41912-41914 |
, |
denotes |
, |
| T8673 |
41914-41919 |
PRP$ |
denotes |
their |
| T8674 |
41920-41926 |
NN |
denotes |
number |
| T8675 |
41927-41930 |
VBD |
denotes |
was |
| T8665 |
41931-41938 |
VBN |
denotes |
reduced |
| T8676 |
41939-41941 |
IN |
denotes |
by |
| T8677 |
41942-41955 |
RB |
denotes |
approximately |
| T8678 |
41956-41958 |
CD |
denotes |
50 |
| T8679 |
41958-41959 |
NN |
denotes |
% |
| T8680 |
41960-41961 |
-LRB- |
denotes |
[ |
| T8681 |
41961-41963 |
CD |
denotes |
32 |
| T8682 |
41963-41964 |
-RRB- |
denotes |
] |
| T8683 |
41964-41965 |
. |
denotes |
. |
| T8684 |
41965-42133 |
sentence |
denotes |
Thus, although the pathway mediated by TGF-β2 signaling impacts the earliest step of epithelial invagination, it does not appear to be essential for bud morphogenesis. |
| T8685 |
41966-41970 |
RB |
denotes |
Thus |
| T8687 |
41970-41972 |
, |
denotes |
, |
| T8688 |
41972-41980 |
IN |
denotes |
although |
| T8690 |
41981-41984 |
DT |
denotes |
the |
| T8691 |
41985-41992 |
NN |
denotes |
pathway |
| T8692 |
41993-42001 |
VBN |
denotes |
mediated |
| T8693 |
42002-42004 |
IN |
denotes |
by |
| T8694 |
42005-42008 |
NN |
denotes |
TGF |
| T8696 |
42008-42009 |
HYPH |
denotes |
- |
| T8695 |
42009-42011 |
NN |
denotes |
β2 |
| T8697 |
42012-42021 |
NN |
denotes |
signaling |
| T8689 |
42022-42029 |
VBZ |
denotes |
impacts |
| T8698 |
42030-42033 |
DT |
denotes |
the |
| T8700 |
42034-42042 |
JJS |
denotes |
earliest |
| T8699 |
42043-42047 |
NN |
denotes |
step |
| T8701 |
42048-42050 |
IN |
denotes |
of |
| T8702 |
42051-42061 |
JJ |
denotes |
epithelial |
| T8703 |
42062-42074 |
NN |
denotes |
invagination |
| T8704 |
42074-42076 |
, |
denotes |
, |
| T8705 |
42076-42078 |
PRP |
denotes |
it |
| T8706 |
42079-42083 |
VBZ |
denotes |
does |
| T8707 |
42084-42087 |
RB |
denotes |
not |
| T8686 |
42088-42094 |
VB |
denotes |
appear |
| T8708 |
42095-42097 |
TO |
denotes |
to |
| T8709 |
42098-42100 |
VB |
denotes |
be |
| T8710 |
42101-42110 |
JJ |
denotes |
essential |
| T8711 |
42111-42114 |
IN |
denotes |
for |
| T8712 |
42115-42118 |
NN |
denotes |
bud |
| T8713 |
42119-42132 |
NN |
denotes |
morphogenesis |
| T8714 |
42132-42133 |
. |
denotes |
. |
| T8715 |
42133-42407 |
sentence |
denotes |
Consistent with this notion, basement membrane remodeling still took place in the TGF-β2-null buds, as judged by immunofluorescence with antibodies against β4 integrin, an integral component of keratinocyte-mediated adhesion to its underlying basement membrane (Figure 6F). |
| T8716 |
42134-42144 |
JJ |
denotes |
Consistent |
| T8718 |
42145-42149 |
IN |
denotes |
with |
| T8719 |
42150-42154 |
DT |
denotes |
this |
| T8720 |
42155-42161 |
NN |
denotes |
notion |
| T8721 |
42161-42163 |
, |
denotes |
, |
| T8722 |
42163-42171 |
NN |
denotes |
basement |
| T8723 |
42172-42180 |
NN |
denotes |
membrane |
| T8724 |
42181-42191 |
NN |
denotes |
remodeling |
| T8725 |
42192-42197 |
RB |
denotes |
still |
| T8717 |
42198-42202 |
VBD |
denotes |
took |
| T8726 |
42203-42208 |
RP |
denotes |
place |
| T8727 |
42209-42211 |
IN |
denotes |
in |
| T8728 |
42212-42215 |
DT |
denotes |
the |
| T8730 |
42216-42219 |
NN |
denotes |
TGF |
| T8732 |
42219-42220 |
HYPH |
denotes |
- |
| T8731 |
42220-42222 |
NN |
denotes |
β2 |
| T8734 |
42222-42223 |
HYPH |
denotes |
- |
| T8733 |
42223-42227 |
JJ |
denotes |
null |
| T8729 |
42228-42232 |
NNS |
denotes |
buds |
| T8735 |
42232-42234 |
, |
denotes |
, |
| T8736 |
42234-42236 |
IN |
denotes |
as |
| T8737 |
42237-42243 |
VBN |
denotes |
judged |
| T8738 |
42244-42246 |
IN |
denotes |
by |
| T8739 |
42247-42265 |
NN |
denotes |
immunofluorescence |
| T8740 |
42266-42270 |
IN |
denotes |
with |
| T8741 |
42271-42281 |
NNS |
denotes |
antibodies |
| T8742 |
42282-42289 |
IN |
denotes |
against |
| T8743 |
42290-42292 |
NN |
denotes |
β4 |
| T8744 |
42293-42301 |
NN |
denotes |
integrin |
| T8745 |
42301-42303 |
, |
denotes |
, |
| T8746 |
42303-42305 |
DT |
denotes |
an |
| T8748 |
42306-42314 |
JJ |
denotes |
integral |
| T8747 |
42315-42324 |
NN |
denotes |
component |
| T8749 |
42325-42327 |
IN |
denotes |
of |
| T8750 |
42328-42340 |
NN |
denotes |
keratinocyte |
| T8752 |
42340-42341 |
HYPH |
denotes |
- |
| T8751 |
42341-42349 |
VBN |
denotes |
mediated |
| T8753 |
42350-42358 |
NN |
denotes |
adhesion |
| T8754 |
42359-42361 |
IN |
denotes |
to |
| T8755 |
42362-42365 |
PRP$ |
denotes |
its |
| T8757 |
42366-42376 |
JJ |
denotes |
underlying |
| T8758 |
42377-42385 |
NN |
denotes |
basement |
| T8756 |
42386-42394 |
NN |
denotes |
membrane |
| T8759 |
42395-42396 |
-LRB- |
denotes |
( |
| T8761 |
42396-42402 |
NN |
denotes |
Figure |
| T8760 |
42403-42405 |
NN |
denotes |
6F |
| T8762 |
42405-42406 |
-RRB- |
denotes |
) |
| T8763 |
42406-42407 |
. |
denotes |
. |
| T8764 |
42407-42618 |
sentence |
denotes |
In contrast, TGF-β2 signaling appeared to be an important factor for the early proliferation that occurs in the developing hair buds, as judged by anti-Ki67 and anti-pMAPK immunofluorescence (Figure 6F and 6G). |
| T8765 |
42408-42410 |
IN |
denotes |
In |
| T8767 |
42411-42419 |
NN |
denotes |
contrast |
| T8768 |
42419-42421 |
, |
denotes |
, |
| T8769 |
42421-42424 |
NN |
denotes |
TGF |
| T8771 |
42424-42425 |
HYPH |
denotes |
- |
| T8770 |
42425-42427 |
NN |
denotes |
β2 |
| T8772 |
42428-42437 |
NN |
denotes |
signaling |
| T8766 |
42438-42446 |
VBD |
denotes |
appeared |
| T8773 |
42447-42449 |
TO |
denotes |
to |
| T8774 |
42450-42452 |
VB |
denotes |
be |
| T8775 |
42453-42455 |
DT |
denotes |
an |
| T8777 |
42456-42465 |
JJ |
denotes |
important |
| T8776 |
42466-42472 |
NN |
denotes |
factor |
| T8778 |
42473-42476 |
IN |
denotes |
for |
| T8779 |
42477-42480 |
DT |
denotes |
the |
| T8781 |
42481-42486 |
JJ |
denotes |
early |
| T8780 |
42487-42500 |
NN |
denotes |
proliferation |
| T8782 |
42501-42505 |
WDT |
denotes |
that |
| T8783 |
42506-42512 |
VBZ |
denotes |
occurs |
| T8784 |
42513-42515 |
IN |
denotes |
in |
| T8785 |
42516-42519 |
DT |
denotes |
the |
| T8787 |
42520-42530 |
VBG |
denotes |
developing |
| T8788 |
42531-42535 |
NN |
denotes |
hair |
| T8786 |
42536-42540 |
NNS |
denotes |
buds |
| T8789 |
42540-42542 |
, |
denotes |
, |
| T8790 |
42542-42544 |
IN |
denotes |
as |
| T8791 |
42545-42551 |
VBN |
denotes |
judged |
| T8792 |
42552-42554 |
IN |
denotes |
by |
| T8793 |
42555-42564 |
JJ |
denotes |
anti-Ki67 |
| T8795 |
42565-42568 |
CC |
denotes |
and |
| T8796 |
42569-42579 |
JJ |
denotes |
anti-pMAPK |
| T8794 |
42580-42598 |
NN |
denotes |
immunofluorescence |
| T8797 |
42599-42600 |
-LRB- |
denotes |
( |
| T8799 |
42600-42606 |
NN |
denotes |
Figure |
| T8798 |
42607-42609 |
NN |
denotes |
6F |
| T8800 |
42610-42613 |
CC |
denotes |
and |
| T8801 |
42614-42616 |
NN |
denotes |
6G |
| T8802 |
42616-42617 |
-RRB- |
denotes |
) |
| T8803 |
42617-42618 |
. |
denotes |
. |
| T8804 |
42618-42790 |
sentence |
denotes |
If TGF-β2 stimulates Snail expression in developing buds, loss of this morphogen would be expected to affect the expression of genes that are typically repressed by Snail. |
| T8805 |
42619-42621 |
IN |
denotes |
If |
| T8807 |
42622-42625 |
NN |
denotes |
TGF |
| T8809 |
42625-42626 |
HYPH |
denotes |
- |
| T8808 |
42626-42628 |
NN |
denotes |
β2 |
| T8806 |
42629-42639 |
VBZ |
denotes |
stimulates |
| T8811 |
42640-42645 |
NN |
denotes |
Snail |
| T8812 |
42646-42656 |
NN |
denotes |
expression |
| T8813 |
42657-42659 |
IN |
denotes |
in |
| T8814 |
42660-42670 |
VBG |
denotes |
developing |
| T8815 |
42671-42675 |
NNS |
denotes |
buds |
| T8816 |
42675-42677 |
, |
denotes |
, |
| T8817 |
42677-42681 |
NN |
denotes |
loss |
| T8818 |
42682-42684 |
IN |
denotes |
of |
| T8819 |
42685-42689 |
DT |
denotes |
this |
| T8820 |
42690-42699 |
NN |
denotes |
morphogen |
| T8821 |
42700-42705 |
MD |
denotes |
would |
| T8822 |
42706-42708 |
VB |
denotes |
be |
| T8810 |
42709-42717 |
VBN |
denotes |
expected |
| T8823 |
42718-42720 |
TO |
denotes |
to |
| T8824 |
42721-42727 |
VB |
denotes |
affect |
| T8825 |
42728-42731 |
DT |
denotes |
the |
| T8826 |
42732-42742 |
NN |
denotes |
expression |
| T8827 |
42743-42745 |
IN |
denotes |
of |
| T8828 |
42746-42751 |
NNS |
denotes |
genes |
| T8829 |
42752-42756 |
WDT |
denotes |
that |
| T8831 |
42757-42760 |
VBP |
denotes |
are |
| T8832 |
42761-42770 |
RB |
denotes |
typically |
| T8830 |
42771-42780 |
VBN |
denotes |
repressed |
| T8833 |
42781-42783 |
IN |
denotes |
by |
| T8834 |
42784-42789 |
NN |
denotes |
Snail |
| T8835 |
42789-42790 |
. |
denotes |
. |
| T8836 |
42790-42935 |
sentence |
denotes |
Since a major target for Snail-mediated repression is the E-cadherin gene [12,13], we investigated the status of E-cadherin in TGF-β2-null buds. |
| T8837 |
42791-42796 |
IN |
denotes |
Since |
| T8839 |
42797-42798 |
DT |
denotes |
a |
| T8841 |
42799-42804 |
JJ |
denotes |
major |
| T8840 |
42805-42811 |
NN |
denotes |
target |
| T8842 |
42812-42815 |
IN |
denotes |
for |
| T8843 |
42816-42821 |
NN |
denotes |
Snail |
| T8845 |
42821-42822 |
HYPH |
denotes |
- |
| T8844 |
42822-42830 |
VBN |
denotes |
mediated |
| T8846 |
42831-42841 |
NN |
denotes |
repression |
| T8838 |
42842-42844 |
VBZ |
denotes |
is |
| T8848 |
42845-42848 |
DT |
denotes |
the |
| T8850 |
42849-42850 |
NN |
denotes |
E |
| T8852 |
42850-42851 |
HYPH |
denotes |
- |
| T8851 |
42851-42859 |
NN |
denotes |
cadherin |
| T8849 |
42860-42864 |
NN |
denotes |
gene |
| T8853 |
42865-42866 |
-LRB- |
denotes |
[ |
| T8855 |
42866-42868 |
CD |
denotes |
12 |
| T8856 |
42868-42869 |
, |
denotes |
, |
| T8854 |
42869-42871 |
CD |
denotes |
13 |
| T8857 |
42871-42872 |
-RRB- |
denotes |
] |
| T8858 |
42872-42874 |
, |
denotes |
, |
| T8859 |
42874-42876 |
PRP |
denotes |
we |
| T8847 |
42877-42889 |
VBD |
denotes |
investigated |
| T8860 |
42890-42893 |
DT |
denotes |
the |
| T8861 |
42894-42900 |
NN |
denotes |
status |
| T8862 |
42901-42903 |
IN |
denotes |
of |
| T8863 |
42904-42905 |
NN |
denotes |
E |
| T8865 |
42905-42906 |
HYPH |
denotes |
- |
| T8864 |
42906-42914 |
NN |
denotes |
cadherin |
| T8866 |
42915-42917 |
IN |
denotes |
in |
| T8867 |
42918-42921 |
NN |
denotes |
TGF |
| T8869 |
42921-42922 |
HYPH |
denotes |
- |
| T8868 |
42922-42924 |
NN |
denotes |
β2 |
| T8871 |
42924-42925 |
HYPH |
denotes |
- |
| T8870 |
42925-42929 |
JJ |
denotes |
null |
| T8872 |
42930-42934 |
NNS |
denotes |
buds |
| T8873 |
42934-42935 |
. |
denotes |
. |
| T8874 |
42935-43070 |
sentence |
denotes |
As shown in Figure 6H, hair buds in TGF-β2 null skin displayed elevated immunofluorescence staining relative to their WT counterparts. |
| T8875 |
42936-42938 |
IN |
denotes |
As |
| T8876 |
42939-42944 |
VBN |
denotes |
shown |
| T8878 |
42945-42947 |
IN |
denotes |
in |
| T8879 |
42948-42954 |
NN |
denotes |
Figure |
| T8880 |
42955-42957 |
NN |
denotes |
6H |
| T8881 |
42957-42959 |
, |
denotes |
, |
| T8882 |
42959-42963 |
NN |
denotes |
hair |
| T8883 |
42964-42968 |
NNS |
denotes |
buds |
| T8884 |
42969-42971 |
IN |
denotes |
in |
| T8885 |
42972-42975 |
NN |
denotes |
TGF |
| T8887 |
42975-42976 |
HYPH |
denotes |
- |
| T8886 |
42976-42978 |
NN |
denotes |
β2 |
| T8888 |
42979-42983 |
JJ |
denotes |
null |
| T8889 |
42984-42988 |
NN |
denotes |
skin |
| T8877 |
42989-42998 |
VBD |
denotes |
displayed |
| T8890 |
42999-43007 |
JJ |
denotes |
elevated |
| T8892 |
43008-43026 |
NN |
denotes |
immunofluorescence |
| T8891 |
43027-43035 |
NN |
denotes |
staining |
| T8893 |
43036-43044 |
JJ |
denotes |
relative |
| T8894 |
43045-43047 |
IN |
denotes |
to |
| T8895 |
43048-43053 |
PRP$ |
denotes |
their |
| T8897 |
43054-43056 |
NN |
denotes |
WT |
| T8896 |
43057-43069 |
NNS |
denotes |
counterparts |
| T8898 |
43069-43070 |
. |
denotes |
. |
| T8899 |
43070-43319 |
sentence |
denotes |
Previously we demonstrated that the concerted action of the extracellular signals Wnt and noggin are required for the generation of a LEF-1/β-catenin transcription complex to repress E-cadherin transcription at the onset of hair fate specification. |
| T8900 |
43071-43081 |
RB |
denotes |
Previously |
| T8902 |
43082-43084 |
PRP |
denotes |
we |
| T8901 |
43085-43097 |
VBD |
denotes |
demonstrated |
| T8903 |
43098-43102 |
IN |
denotes |
that |
| T8905 |
43103-43106 |
DT |
denotes |
the |
| T8907 |
43107-43116 |
JJ |
denotes |
concerted |
| T8906 |
43117-43123 |
NN |
denotes |
action |
| T8908 |
43124-43126 |
IN |
denotes |
of |
| T8909 |
43127-43130 |
DT |
denotes |
the |
| T8911 |
43131-43144 |
JJ |
denotes |
extracellular |
| T8910 |
43145-43152 |
NNS |
denotes |
signals |
| T8912 |
43153-43156 |
NN |
denotes |
Wnt |
| T8913 |
43157-43160 |
CC |
denotes |
and |
| T8914 |
43161-43167 |
NN |
denotes |
noggin |
| T8915 |
43168-43171 |
VBP |
denotes |
are |
| T8904 |
43172-43180 |
VBN |
denotes |
required |
| T8916 |
43181-43184 |
IN |
denotes |
for |
| T8918 |
43185-43188 |
DT |
denotes |
the |
| T8919 |
43189-43199 |
NN |
denotes |
generation |
| T8920 |
43200-43202 |
IN |
denotes |
of |
| T8921 |
43203-43204 |
DT |
denotes |
a |
| T8923 |
43205-43208 |
NN |
denotes |
LEF |
| T8924 |
43208-43209 |
HYPH |
denotes |
- |
| T8925 |
43209-43210 |
CD |
denotes |
1 |
| T8926 |
43210-43211 |
HYPH |
denotes |
/ |
| T8927 |
43211-43212 |
NN |
denotes |
β |
| T8929 |
43212-43213 |
HYPH |
denotes |
- |
| T8928 |
43213-43220 |
NN |
denotes |
catenin |
| T8930 |
43221-43234 |
NN |
denotes |
transcription |
| T8922 |
43235-43242 |
NN |
denotes |
complex |
| T8931 |
43243-43245 |
TO |
denotes |
to |
| T8917 |
43246-43253 |
VB |
denotes |
repress |
| T8932 |
43254-43255 |
NN |
denotes |
E |
| T8934 |
43255-43256 |
HYPH |
denotes |
- |
| T8933 |
43256-43264 |
NN |
denotes |
cadherin |
| T8935 |
43265-43278 |
NN |
denotes |
transcription |
| T8936 |
43279-43281 |
IN |
denotes |
at |
| T8937 |
43282-43285 |
DT |
denotes |
the |
| T8938 |
43286-43291 |
NN |
denotes |
onset |
| T8939 |
43292-43294 |
IN |
denotes |
of |
| T8940 |
43295-43299 |
NN |
denotes |
hair |
| T8941 |
43300-43304 |
NN |
denotes |
fate |
| T8942 |
43305-43318 |
NN |
denotes |
specification |
| T8943 |
43318-43319 |
. |
denotes |
. |
| T8944 |
43319-43486 |
sentence |
denotes |
As shown in Figure 6I and 6J, both WT and TGF-β2 null buds exhibited nuclear LEF-1 and β-catenin localization, signs that the Wnt-noggin signaling pathway was intact. |
| T8945 |
43320-43322 |
IN |
denotes |
As |
| T8946 |
43323-43328 |
VBN |
denotes |
shown |
| T8948 |
43329-43331 |
IN |
denotes |
in |
| T8949 |
43332-43338 |
NN |
denotes |
Figure |
| T8950 |
43339-43341 |
NN |
denotes |
6I |
| T8951 |
43342-43345 |
CC |
denotes |
and |
| T8952 |
43346-43348 |
NN |
denotes |
6J |
| T8953 |
43348-43350 |
, |
denotes |
, |
| T8954 |
43350-43354 |
CC |
denotes |
both |
| T8955 |
43355-43357 |
NN |
denotes |
WT |
| T8957 |
43358-43361 |
CC |
denotes |
and |
| T8958 |
43362-43365 |
NN |
denotes |
TGF |
| T8960 |
43365-43366 |
HYPH |
denotes |
- |
| T8959 |
43366-43368 |
NN |
denotes |
β2 |
| T8956 |
43369-43373 |
JJ |
denotes |
null |
| T8961 |
43374-43378 |
NNS |
denotes |
buds |
| T8947 |
43379-43388 |
VBD |
denotes |
exhibited |
| T8962 |
43389-43396 |
JJ |
denotes |
nuclear |
| T8964 |
43397-43400 |
NN |
denotes |
LEF |
| T8965 |
43400-43401 |
HYPH |
denotes |
- |
| T8966 |
43401-43402 |
CD |
denotes |
1 |
| T8967 |
43403-43406 |
CC |
denotes |
and |
| T8968 |
43407-43408 |
NN |
denotes |
β |
| T8970 |
43408-43409 |
HYPH |
denotes |
- |
| T8969 |
43409-43416 |
NN |
denotes |
catenin |
| T8963 |
43417-43429 |
NN |
denotes |
localization |
| T8971 |
43429-43431 |
, |
denotes |
, |
| T8972 |
43431-43436 |
NNS |
denotes |
signs |
| T8973 |
43437-43441 |
IN |
denotes |
that |
| T8975 |
43442-43445 |
DT |
denotes |
the |
| T8977 |
43446-43449 |
NN |
denotes |
Wnt |
| T8979 |
43449-43450 |
HYPH |
denotes |
- |
| T8978 |
43450-43456 |
NN |
denotes |
noggin |
| T8980 |
43457-43466 |
NN |
denotes |
signaling |
| T8976 |
43467-43474 |
NN |
denotes |
pathway |
| T8974 |
43475-43478 |
VBD |
denotes |
was |
| T8981 |
43479-43485 |
JJ |
denotes |
intact |
| T8982 |
43485-43486 |
. |
denotes |
. |
| T8983 |
43486-43627 |
sentence |
denotes |
These data suggest that during hair follicle morphogenesis, TGF-β2 functions subsequently to Wnt/noggin-mediated determination of hair fate. |
| T8984 |
43487-43492 |
DT |
denotes |
These |
| T8985 |
43493-43497 |
NNS |
denotes |
data |
| T8986 |
43498-43505 |
VBP |
denotes |
suggest |
| T8987 |
43506-43510 |
IN |
denotes |
that |
| T8989 |
43511-43517 |
IN |
denotes |
during |
| T8990 |
43518-43522 |
NN |
denotes |
hair |
| T8991 |
43523-43531 |
NN |
denotes |
follicle |
| T8992 |
43532-43545 |
NN |
denotes |
morphogenesis |
| T8993 |
43545-43547 |
, |
denotes |
, |
| T8994 |
43547-43550 |
NN |
denotes |
TGF |
| T8996 |
43550-43551 |
HYPH |
denotes |
- |
| T8995 |
43551-43553 |
NN |
denotes |
β2 |
| T8988 |
43554-43563 |
VBZ |
denotes |
functions |
| T8997 |
43564-43576 |
RB |
denotes |
subsequently |
| T8998 |
43577-43579 |
IN |
denotes |
to |
| T8999 |
43580-43583 |
NN |
denotes |
Wnt |
| T9001 |
43583-43584 |
HYPH |
denotes |
/ |
| T9000 |
43584-43590 |
NN |
denotes |
noggin |
| T9003 |
43590-43591 |
HYPH |
denotes |
- |
| T9002 |
43591-43599 |
VBN |
denotes |
mediated |
| T9004 |
43600-43613 |
NN |
denotes |
determination |
| T9005 |
43614-43616 |
IN |
denotes |
of |
| T9006 |
43617-43621 |
NN |
denotes |
hair |
| T9007 |
43622-43626 |
NN |
denotes |
fate |
| T9008 |
43626-43627 |
. |
denotes |
. |
| T9009 |
43627-43845 |
sentence |
denotes |
Moreover, through activation of Snail gene expression, TGF-β2 appears to work in tandem with these other morphogens to down-regulate E-cadherin levels, which contributes to the activation of proliferative circuitries. |
| T9010 |
43628-43636 |
RB |
denotes |
Moreover |
| T9012 |
43636-43638 |
, |
denotes |
, |
| T9013 |
43638-43645 |
IN |
denotes |
through |
| T9014 |
43646-43656 |
NN |
denotes |
activation |
| T9015 |
43657-43659 |
IN |
denotes |
of |
| T9016 |
43660-43665 |
NN |
denotes |
Snail |
| T9018 |
43666-43670 |
NN |
denotes |
gene |
| T9017 |
43671-43681 |
NN |
denotes |
expression |
| T9019 |
43681-43683 |
, |
denotes |
, |
| T9020 |
43683-43686 |
NN |
denotes |
TGF |
| T9022 |
43686-43687 |
HYPH |
denotes |
- |
| T9021 |
43687-43689 |
NN |
denotes |
β2 |
| T9011 |
43690-43697 |
VBZ |
denotes |
appears |
| T9023 |
43698-43700 |
TO |
denotes |
to |
| T9024 |
43701-43705 |
VB |
denotes |
work |
| T9025 |
43706-43708 |
IN |
denotes |
in |
| T9026 |
43709-43715 |
NN |
denotes |
tandem |
| T9027 |
43716-43720 |
IN |
denotes |
with |
| T9028 |
43721-43726 |
DT |
denotes |
these |
| T9030 |
43727-43732 |
JJ |
denotes |
other |
| T9029 |
43733-43743 |
NNS |
denotes |
morphogens |
| T9031 |
43744-43746 |
TO |
denotes |
to |
| T9033 |
43747-43751 |
RB |
denotes |
down |
| T9034 |
43751-43752 |
HYPH |
denotes |
- |
| T9032 |
43752-43760 |
VB |
denotes |
regulate |
| T9035 |
43761-43762 |
NN |
denotes |
E |
| T9037 |
43762-43763 |
HYPH |
denotes |
- |
| T9036 |
43763-43771 |
NN |
denotes |
cadherin |
| T9038 |
43772-43778 |
NNS |
denotes |
levels |
| T9039 |
43778-43780 |
, |
denotes |
, |
| T9040 |
43780-43785 |
WDT |
denotes |
which |
| T9041 |
43786-43797 |
VBZ |
denotes |
contributes |
| T9042 |
43798-43800 |
IN |
denotes |
to |
| T9043 |
43801-43804 |
DT |
denotes |
the |
| T9044 |
43805-43815 |
NN |
denotes |
activation |
| T9045 |
43816-43818 |
IN |
denotes |
of |
| T9046 |
43819-43832 |
JJ |
denotes |
proliferative |
| T9047 |
43833-43844 |
NNS |
denotes |
circuitries |
| T9048 |
43844-43845 |
. |
denotes |
. |
| T9102 |
43858-43864 |
IN |
denotes |
During |
| T9104 |
43865-43872 |
NN |
denotes |
budding |
| T9105 |
43873-43886 |
NN |
denotes |
morphogenesis |
| T9106 |
43886-43888 |
, |
denotes |
, |
| T9107 |
43888-43900 |
VBG |
denotes |
intersecting |
| T9109 |
43901-43910 |
NN |
denotes |
signaling |
| T9108 |
43911-43919 |
NNS |
denotes |
networks |
| T9110 |
43920-43924 |
IN |
denotes |
from |
| T9111 |
43925-43928 |
DT |
denotes |
the |
| T9112 |
43929-43939 |
NN |
denotes |
epithelium |
| T9113 |
43940-43943 |
CC |
denotes |
and |
| T9114 |
43944-43954 |
NN |
denotes |
mesenchyme |
| T9103 |
43955-43961 |
VBP |
denotes |
govern |
| T9115 |
43962-43977 |
JJ |
denotes |
transcriptional |
| T9117 |
43977-43979 |
, |
denotes |
, |
| T9118 |
43979-43987 |
JJ |
denotes |
adhesive |
| T9119 |
43987-43989 |
, |
denotes |
, |
| T9120 |
43989-43997 |
NN |
denotes |
polarity |
| T9121 |
43997-43999 |
, |
denotes |
, |
| T9122 |
43999-44002 |
CC |
denotes |
and |
| T9123 |
44003-44011 |
NN |
denotes |
motility |
| T9116 |
44012-44020 |
NNS |
denotes |
programs |
| T9124 |
44021-44023 |
IN |
denotes |
in |
| T9125 |
44024-44029 |
DT |
denotes |
these |
| T9127 |
44030-44036 |
JJ |
denotes |
select |
| T9126 |
44037-44043 |
NNS |
denotes |
groups |
| T9128 |
44044-44046 |
IN |
denotes |
of |
| T9129 |
44047-44052 |
NNS |
denotes |
cells |
| T9130 |
44052-44053 |
. |
denotes |
. |
| T9131 |
44053-44174 |
sentence |
denotes |
The dynamic nuclear and cytosolic changes that take place during this time form the cornerstone for organ morphogenesis. |
| T9132 |
44054-44057 |
DT |
denotes |
The |
| T9134 |
44058-44065 |
JJ |
denotes |
dynamic |
| T9135 |
44066-44073 |
JJ |
denotes |
nuclear |
| T9136 |
44074-44077 |
CC |
denotes |
and |
| T9137 |
44078-44087 |
JJ |
denotes |
cytosolic |
| T9133 |
44088-44095 |
NNS |
denotes |
changes |
| T9139 |
44096-44100 |
WDT |
denotes |
that |
| T9140 |
44101-44105 |
VBP |
denotes |
take |
| T9141 |
44106-44111 |
NN |
denotes |
place |
| T9142 |
44112-44118 |
IN |
denotes |
during |
| T9143 |
44119-44123 |
DT |
denotes |
this |
| T9144 |
44124-44128 |
NN |
denotes |
time |
| T9138 |
44129-44133 |
VBP |
denotes |
form |
| T9145 |
44134-44137 |
DT |
denotes |
the |
| T9146 |
44138-44149 |
NN |
denotes |
cornerstone |
| T9147 |
44150-44153 |
IN |
denotes |
for |
| T9148 |
44154-44159 |
NN |
denotes |
organ |
| T9149 |
44160-44173 |
NN |
denotes |
morphogenesis |
| T9150 |
44173-44174 |
. |
denotes |
. |
| T9151 |
44174-44495 |
sentence |
denotes |
Two major challenges in understanding the mechanisms underlying a particular budding process are to order the temporal sequence of external cues involved and then to dissect how the cells of the developing bud translate these signals into the downstream events of cellular remodeling, proliferation, and differentiation. |
| T9152 |
44175-44178 |
CD |
denotes |
Two |
| T9154 |
44179-44184 |
JJ |
denotes |
major |
| T9153 |
44185-44195 |
NNS |
denotes |
challenges |
| T9156 |
44196-44198 |
IN |
denotes |
in |
| T9157 |
44199-44212 |
VBG |
denotes |
understanding |
| T9158 |
44213-44216 |
DT |
denotes |
the |
| T9159 |
44217-44227 |
NNS |
denotes |
mechanisms |
| T9160 |
44228-44238 |
VBG |
denotes |
underlying |
| T9161 |
44239-44240 |
DT |
denotes |
a |
| T9163 |
44241-44251 |
JJ |
denotes |
particular |
| T9164 |
44252-44259 |
NN |
denotes |
budding |
| T9162 |
44260-44267 |
NN |
denotes |
process |
| T9155 |
44268-44271 |
VBP |
denotes |
are |
| T9165 |
44272-44274 |
TO |
denotes |
to |
| T9166 |
44275-44280 |
VB |
denotes |
order |
| T9167 |
44281-44284 |
DT |
denotes |
the |
| T9169 |
44285-44293 |
JJ |
denotes |
temporal |
| T9168 |
44294-44302 |
NN |
denotes |
sequence |
| T9170 |
44303-44305 |
IN |
denotes |
of |
| T9171 |
44306-44314 |
JJ |
denotes |
external |
| T9172 |
44315-44319 |
NNS |
denotes |
cues |
| T9173 |
44320-44328 |
VBN |
denotes |
involved |
| T9174 |
44329-44332 |
CC |
denotes |
and |
| T9175 |
44333-44337 |
RB |
denotes |
then |
| T9177 |
44338-44340 |
TO |
denotes |
to |
| T9176 |
44341-44348 |
VB |
denotes |
dissect |
| T9178 |
44349-44352 |
WRB |
denotes |
how |
| T9180 |
44353-44356 |
DT |
denotes |
the |
| T9181 |
44357-44362 |
NNS |
denotes |
cells |
| T9182 |
44363-44365 |
IN |
denotes |
of |
| T9183 |
44366-44369 |
DT |
denotes |
the |
| T9185 |
44370-44380 |
VBG |
denotes |
developing |
| T9184 |
44381-44384 |
NN |
denotes |
bud |
| T9179 |
44385-44394 |
VB |
denotes |
translate |
| T9186 |
44395-44400 |
DT |
denotes |
these |
| T9187 |
44401-44408 |
NNS |
denotes |
signals |
| T9188 |
44409-44413 |
IN |
denotes |
into |
| T9189 |
44414-44417 |
DT |
denotes |
the |
| T9191 |
44418-44428 |
JJ |
denotes |
downstream |
| T9190 |
44429-44435 |
NNS |
denotes |
events |
| T9192 |
44436-44438 |
IN |
denotes |
of |
| T9193 |
44439-44447 |
JJ |
denotes |
cellular |
| T9194 |
44448-44458 |
NN |
denotes |
remodeling |
| T9195 |
44458-44460 |
, |
denotes |
, |
| T9196 |
44460-44473 |
NN |
denotes |
proliferation |
| T9197 |
44473-44475 |
, |
denotes |
, |
| T9198 |
44475-44478 |
CC |
denotes |
and |
| T9199 |
44479-44494 |
NN |
denotes |
differentiation |
| T9200 |
44494-44495 |
. |
denotes |
. |
| T9201 |
44495-44619 |
sentence |
denotes |
Our studies here provide some insights into how these events are orchestrated during hair bud formation in developing skin. |
| T9202 |
44496-44499 |
PRP$ |
denotes |
Our |
| T9203 |
44500-44507 |
NNS |
denotes |
studies |
| T9205 |
44508-44512 |
RB |
denotes |
here |
| T9204 |
44513-44520 |
VBP |
denotes |
provide |
| T9206 |
44521-44525 |
DT |
denotes |
some |
| T9207 |
44526-44534 |
NNS |
denotes |
insights |
| T9208 |
44535-44539 |
IN |
denotes |
into |
| T9209 |
44540-44543 |
WRB |
denotes |
how |
| T9211 |
44544-44549 |
DT |
denotes |
these |
| T9212 |
44550-44556 |
NNS |
denotes |
events |
| T9213 |
44557-44560 |
VBP |
denotes |
are |
| T9210 |
44561-44573 |
VBN |
denotes |
orchestrated |
| T9214 |
44574-44580 |
IN |
denotes |
during |
| T9215 |
44581-44585 |
NN |
denotes |
hair |
| T9216 |
44586-44589 |
NN |
denotes |
bud |
| T9217 |
44590-44599 |
NN |
denotes |
formation |
| T9218 |
44600-44602 |
IN |
denotes |
in |
| T9219 |
44603-44613 |
VBG |
denotes |
developing |
| T9220 |
44614-44618 |
NN |
denotes |
skin |
| T9221 |
44618-44619 |
. |
denotes |
. |
| T9653 |
44621-44630 |
NN |
denotes |
Signaling |
| T9654 |
44631-44637 |
IN |
denotes |
during |
| T9655 |
44638-44643 |
JJ |
denotes |
Early |
| T9657 |
44644-44648 |
NN |
denotes |
Hair |
| T9658 |
44649-44657 |
NN |
denotes |
Follicle |
| T9656 |
44658-44671 |
NN |
denotes |
Morphogenesis |
| T9659 |
44671-44997 |
sentence |
denotes |
Recent studies on hair bud morphogenesis suggest that Wnt signals likely from the epithelium and BMP inhibitory signals from the underlying mesenchyme converge to produce an active transcription factor complex involving β-catenin and LEF-1, which in turn plays a key role in specifying the hair follicle fate [4,29,30,36,37]. |
| T9660 |
44672-44678 |
JJ |
denotes |
Recent |
| T9661 |
44679-44686 |
NNS |
denotes |
studies |
| T9663 |
44687-44689 |
IN |
denotes |
on |
| T9664 |
44690-44694 |
NN |
denotes |
hair |
| T9665 |
44695-44698 |
NN |
denotes |
bud |
| T9666 |
44699-44712 |
NN |
denotes |
morphogenesis |
| T9662 |
44713-44720 |
VBP |
denotes |
suggest |
| T9667 |
44721-44725 |
IN |
denotes |
that |
| T9669 |
44726-44729 |
NN |
denotes |
Wnt |
| T9670 |
44730-44737 |
NNS |
denotes |
signals |
| T9671 |
44738-44744 |
RB |
denotes |
likely |
| T9672 |
44745-44749 |
IN |
denotes |
from |
| T9673 |
44750-44753 |
DT |
denotes |
the |
| T9674 |
44754-44764 |
NN |
denotes |
epithelium |
| T9675 |
44765-44768 |
CC |
denotes |
and |
| T9676 |
44769-44772 |
NN |
denotes |
BMP |
| T9678 |
44773-44783 |
JJ |
denotes |
inhibitory |
| T9677 |
44784-44791 |
NNS |
denotes |
signals |
| T9679 |
44792-44796 |
IN |
denotes |
from |
| T9680 |
44797-44800 |
DT |
denotes |
the |
| T9682 |
44801-44811 |
VBG |
denotes |
underlying |
| T9681 |
44812-44822 |
NN |
denotes |
mesenchyme |
| T9668 |
44823-44831 |
VBP |
denotes |
converge |
| T9683 |
44832-44834 |
TO |
denotes |
to |
| T9684 |
44835-44842 |
VB |
denotes |
produce |
| T9685 |
44843-44845 |
DT |
denotes |
an |
| T9687 |
44846-44852 |
JJ |
denotes |
active |
| T9688 |
44853-44866 |
NN |
denotes |
transcription |
| T9689 |
44867-44873 |
NN |
denotes |
factor |
| T9686 |
44874-44881 |
NN |
denotes |
complex |
| T9690 |
44882-44891 |
VBG |
denotes |
involving |
| T9691 |
44892-44893 |
NN |
denotes |
β |
| T9693 |
44893-44894 |
HYPH |
denotes |
- |
| T9692 |
44894-44901 |
NN |
denotes |
catenin |
| T9694 |
44902-44905 |
CC |
denotes |
and |
| T9695 |
44906-44909 |
NN |
denotes |
LEF |
| T9696 |
44909-44910 |
HYPH |
denotes |
- |
| T9697 |
44910-44911 |
CD |
denotes |
1 |
| T9698 |
44911-44913 |
, |
denotes |
, |
| T9699 |
44913-44918 |
WDT |
denotes |
which |
| T9701 |
44919-44921 |
IN |
denotes |
in |
| T9702 |
44922-44926 |
NN |
denotes |
turn |
| T9700 |
44927-44932 |
VBZ |
denotes |
plays |
| T9703 |
44933-44934 |
DT |
denotes |
a |
| T9705 |
44935-44938 |
JJ |
denotes |
key |
| T9704 |
44939-44943 |
NN |
denotes |
role |
| T9706 |
44944-44946 |
IN |
denotes |
in |
| T9707 |
44947-44957 |
VBG |
denotes |
specifying |
| T9708 |
44958-44961 |
DT |
denotes |
the |
| T9710 |
44962-44966 |
NN |
denotes |
hair |
| T9711 |
44967-44975 |
NN |
denotes |
follicle |
| T9709 |
44976-44980 |
NN |
denotes |
fate |
| T9712 |
44981-44982 |
-LRB- |
denotes |
[ |
| T9714 |
44982-44983 |
CD |
denotes |
4 |
| T9715 |
44983-44984 |
, |
denotes |
, |
| T9716 |
44984-44986 |
CD |
denotes |
29 |
| T9717 |
44986-44987 |
, |
denotes |
, |
| T9718 |
44987-44989 |
CD |
denotes |
30 |
| T9719 |
44989-44990 |
, |
denotes |
, |
| T9720 |
44990-44992 |
CD |
denotes |
36 |
| T9721 |
44992-44993 |
, |
denotes |
, |
| T9713 |
44993-44995 |
CD |
denotes |
37 |
| T9722 |
44995-44996 |
-RRB- |
denotes |
] |
| T9723 |
44996-44997 |
. |
denotes |
. |
| T9724 |
44997-45256 |
sentence |
denotes |
Sonic hedgehog (Shh) and TGF-β2 signaling also play essential roles in follicle morphogenesis, but in contrast to β-catenin null skin, in which follicle invaginations are absent [30], some hair buds still form in the absence of LEF-1, Shh, or TGF-β2 [32,38]. |
| T9725 |
44998-45003 |
JJ |
denotes |
Sonic |
| T9726 |
45004-45012 |
NN |
denotes |
hedgehog |
| T9728 |
45013-45014 |
-LRB- |
denotes |
( |
| T9729 |
45014-45017 |
NN |
denotes |
Shh |
| T9730 |
45017-45018 |
-RRB- |
denotes |
) |
| T9731 |
45019-45022 |
CC |
denotes |
and |
| T9732 |
45023-45026 |
NN |
denotes |
TGF |
| T9734 |
45026-45027 |
HYPH |
denotes |
- |
| T9733 |
45027-45029 |
NN |
denotes |
β2 |
| T9735 |
45030-45039 |
NN |
denotes |
signaling |
| T9736 |
45040-45044 |
RB |
denotes |
also |
| T9727 |
45045-45049 |
VBP |
denotes |
play |
| T9737 |
45050-45059 |
JJ |
denotes |
essential |
| T9738 |
45060-45065 |
NNS |
denotes |
roles |
| T9739 |
45066-45068 |
IN |
denotes |
in |
| T9740 |
45069-45077 |
NN |
denotes |
follicle |
| T9741 |
45078-45091 |
NN |
denotes |
morphogenesis |
| T9742 |
45091-45093 |
, |
denotes |
, |
| T9743 |
45093-45096 |
CC |
denotes |
but |
| T9744 |
45097-45099 |
IN |
denotes |
in |
| T9746 |
45100-45108 |
NN |
denotes |
contrast |
| T9747 |
45109-45111 |
IN |
denotes |
to |
| T9748 |
45112-45113 |
NN |
denotes |
β |
| T9750 |
45113-45114 |
HYPH |
denotes |
- |
| T9749 |
45114-45121 |
NN |
denotes |
catenin |
| T9751 |
45122-45126 |
JJ |
denotes |
null |
| T9752 |
45127-45131 |
NN |
denotes |
skin |
| T9753 |
45131-45133 |
, |
denotes |
, |
| T9754 |
45133-45135 |
IN |
denotes |
in |
| T9756 |
45136-45141 |
WDT |
denotes |
which |
| T9757 |
45142-45150 |
NN |
denotes |
follicle |
| T9758 |
45151-45164 |
NNS |
denotes |
invaginations |
| T9755 |
45165-45168 |
VBP |
denotes |
are |
| T9759 |
45169-45175 |
JJ |
denotes |
absent |
| T9760 |
45176-45177 |
-LRB- |
denotes |
[ |
| T9761 |
45177-45179 |
CD |
denotes |
30 |
| T9762 |
45179-45180 |
-RRB- |
denotes |
] |
| T9763 |
45180-45182 |
, |
denotes |
, |
| T9764 |
45182-45186 |
DT |
denotes |
some |
| T9766 |
45187-45191 |
NN |
denotes |
hair |
| T9765 |
45192-45196 |
NNS |
denotes |
buds |
| T9767 |
45197-45202 |
RB |
denotes |
still |
| T9745 |
45203-45207 |
VBP |
denotes |
form |
| T9768 |
45208-45210 |
IN |
denotes |
in |
| T9769 |
45211-45214 |
DT |
denotes |
the |
| T9770 |
45215-45222 |
NN |
denotes |
absence |
| T9771 |
45223-45225 |
IN |
denotes |
of |
| T9772 |
45226-45229 |
NN |
denotes |
LEF |
| T9773 |
45229-45230 |
HYPH |
denotes |
- |
| T9774 |
45230-45231 |
CD |
denotes |
1 |
| T9775 |
45231-45233 |
, |
denotes |
, |
| T9776 |
45233-45236 |
NN |
denotes |
Shh |
| T9777 |
45236-45238 |
, |
denotes |
, |
| T9778 |
45238-45240 |
CC |
denotes |
or |
| T9779 |
45241-45244 |
NN |
denotes |
TGF |
| T9781 |
45244-45245 |
HYPH |
denotes |
- |
| T9780 |
45245-45247 |
NN |
denotes |
β2 |
| T9782 |
45248-45249 |
-LRB- |
denotes |
[ |
| T9784 |
45249-45251 |
CD |
denotes |
32 |
| T9785 |
45251-45252 |
, |
denotes |
, |
| T9783 |
45252-45254 |
CD |
denotes |
38 |
| T9786 |
45254-45255 |
-RRB- |
denotes |
] |
| T9787 |
45255-45256 |
. |
denotes |
. |
| T9788 |
45256-45439 |
sentence |
denotes |
These likely reflect the first wave of follicle (i.e., guard hair) morphogenesis, which accounts for a small number (fewer than 5%) of hairs and is under distinct regulatory control. |
| T9789 |
45257-45262 |
DT |
denotes |
These |
| T9791 |
45263-45269 |
RB |
denotes |
likely |
| T9790 |
45270-45277 |
VBP |
denotes |
reflect |
| T9792 |
45278-45281 |
DT |
denotes |
the |
| T9794 |
45282-45287 |
JJ |
denotes |
first |
| T9793 |
45288-45292 |
NN |
denotes |
wave |
| T9795 |
45293-45295 |
IN |
denotes |
of |
| T9796 |
45296-45304 |
NN |
denotes |
follicle |
| T9798 |
45305-45306 |
-LRB- |
denotes |
( |
| T9800 |
45306-45310 |
FW |
denotes |
i.e. |
| T9801 |
45310-45312 |
, |
denotes |
, |
| T9802 |
45312-45317 |
NN |
denotes |
guard |
| T9799 |
45318-45322 |
NN |
denotes |
hair |
| T9803 |
45322-45323 |
-RRB- |
denotes |
) |
| T9797 |
45324-45337 |
NN |
denotes |
morphogenesis |
| T9804 |
45337-45339 |
, |
denotes |
, |
| T9805 |
45339-45344 |
WDT |
denotes |
which |
| T9806 |
45345-45353 |
VBZ |
denotes |
accounts |
| T9807 |
45354-45357 |
IN |
denotes |
for |
| T9808 |
45358-45359 |
DT |
denotes |
a |
| T9810 |
45360-45365 |
JJ |
denotes |
small |
| T9809 |
45366-45372 |
NN |
denotes |
number |
| T9811 |
45373-45374 |
-LRB- |
denotes |
( |
| T9812 |
45374-45379 |
JJR |
denotes |
fewer |
| T9814 |
45380-45384 |
IN |
denotes |
than |
| T9813 |
45385-45386 |
CD |
denotes |
5 |
| T9815 |
45386-45387 |
NN |
denotes |
% |
| T9816 |
45387-45388 |
-RRB- |
denotes |
) |
| T9817 |
45389-45391 |
IN |
denotes |
of |
| T9818 |
45392-45397 |
NNS |
denotes |
hairs |
| T9819 |
45398-45401 |
CC |
denotes |
and |
| T9820 |
45402-45404 |
VBZ |
denotes |
is |
| T9821 |
45405-45410 |
IN |
denotes |
under |
| T9822 |
45411-45419 |
JJ |
denotes |
distinct |
| T9824 |
45420-45430 |
JJ |
denotes |
regulatory |
| T9823 |
45431-45438 |
NN |
denotes |
control |
| T9825 |
45438-45439 |
. |
denotes |
. |
| T9826 |
45439-45603 |
sentence |
denotes |
Guard hairs form in the absence of LEF-1 and TGF-β2, and we have found that they also fail to express Snail at the budding stage of development (unpublished data). |
| T9827 |
45440-45445 |
NN |
denotes |
Guard |
| T9828 |
45446-45451 |
NNS |
denotes |
hairs |
| T9829 |
45452-45456 |
VBP |
denotes |
form |
| T9830 |
45457-45459 |
IN |
denotes |
in |
| T9831 |
45460-45463 |
DT |
denotes |
the |
| T9832 |
45464-45471 |
NN |
denotes |
absence |
| T9833 |
45472-45474 |
IN |
denotes |
of |
| T9834 |
45475-45478 |
NN |
denotes |
LEF |
| T9835 |
45478-45479 |
HYPH |
denotes |
- |
| T9836 |
45479-45480 |
CD |
denotes |
1 |
| T9837 |
45481-45484 |
CC |
denotes |
and |
| T9838 |
45485-45488 |
NN |
denotes |
TGF |
| T9840 |
45488-45489 |
HYPH |
denotes |
- |
| T9839 |
45489-45491 |
NN |
denotes |
β2 |
| T9841 |
45491-45493 |
, |
denotes |
, |
| T9842 |
45493-45496 |
CC |
denotes |
and |
| T9843 |
45497-45499 |
PRP |
denotes |
we |
| T9845 |
45500-45504 |
VBP |
denotes |
have |
| T9844 |
45505-45510 |
VBN |
denotes |
found |
| T9846 |
45511-45515 |
IN |
denotes |
that |
| T9848 |
45516-45520 |
PRP |
denotes |
they |
| T9849 |
45521-45525 |
RB |
denotes |
also |
| T9847 |
45526-45530 |
VBP |
denotes |
fail |
| T9850 |
45531-45533 |
TO |
denotes |
to |
| T9851 |
45534-45541 |
VB |
denotes |
express |
| T9852 |
45542-45547 |
NN |
denotes |
Snail |
| T9853 |
45548-45550 |
IN |
denotes |
at |
| T9854 |
45551-45554 |
DT |
denotes |
the |
| T9856 |
45555-45562 |
NN |
denotes |
budding |
| T9855 |
45563-45568 |
NN |
denotes |
stage |
| T9857 |
45569-45571 |
IN |
denotes |
of |
| T9858 |
45572-45583 |
NN |
denotes |
development |
| T9859 |
45584-45585 |
-LRB- |
denotes |
( |
| T9861 |
45585-45596 |
JJ |
denotes |
unpublished |
| T9860 |
45597-45601 |
NNS |
denotes |
data |
| T9862 |
45601-45602 |
-RRB- |
denotes |
) |
| T9863 |
45602-45603 |
. |
denotes |
. |
| T9864 |
45603-45672 |
sentence |
denotes |
How E-cadherin is regulated in guard hairs remains to be determined. |
| T9865 |
45604-45607 |
WRB |
denotes |
How |
| T9867 |
45608-45609 |
NN |
denotes |
E |
| T9869 |
45609-45610 |
HYPH |
denotes |
- |
| T9868 |
45610-45618 |
NN |
denotes |
cadherin |
| T9870 |
45619-45621 |
VBZ |
denotes |
is |
| T9866 |
45622-45631 |
VBN |
denotes |
regulated |
| T9872 |
45632-45634 |
IN |
denotes |
in |
| T9873 |
45635-45640 |
NN |
denotes |
guard |
| T9874 |
45641-45646 |
NNS |
denotes |
hairs |
| T9871 |
45647-45654 |
VBZ |
denotes |
remains |
| T9875 |
45655-45657 |
TO |
denotes |
to |
| T9877 |
45658-45660 |
VB |
denotes |
be |
| T9876 |
45661-45671 |
VBN |
denotes |
determined |
| T9878 |
45671-45672 |
. |
denotes |
. |
| T9879 |
45672-45906 |
sentence |
denotes |
Several candidates include other Snail family members such as Slug or twist, or alternatively, transcription factors involving β-catenin and a different member of the LEF-1/TCF/Sry-type HMG box (commonly known as SOX) family [39,40]. |
| T9880 |
45673-45680 |
JJ |
denotes |
Several |
| T9881 |
45681-45691 |
NNS |
denotes |
candidates |
| T9882 |
45692-45699 |
VBP |
denotes |
include |
| T9883 |
45700-45705 |
JJ |
denotes |
other |
| T9885 |
45706-45711 |
NN |
denotes |
Snail |
| T9886 |
45712-45718 |
NN |
denotes |
family |
| T9884 |
45719-45726 |
NNS |
denotes |
members |
| T9887 |
45727-45731 |
JJ |
denotes |
such |
| T9888 |
45732-45734 |
IN |
denotes |
as |
| T9889 |
45735-45739 |
NN |
denotes |
Slug |
| T9890 |
45740-45742 |
CC |
denotes |
or |
| T9891 |
45743-45748 |
NN |
denotes |
twist |
| T9892 |
45748-45750 |
, |
denotes |
, |
| T9893 |
45750-45752 |
CC |
denotes |
or |
| T9894 |
45753-45766 |
RB |
denotes |
alternatively |
| T9896 |
45766-45768 |
, |
denotes |
, |
| T9897 |
45768-45781 |
NN |
denotes |
transcription |
| T9895 |
45782-45789 |
NNS |
denotes |
factors |
| T9898 |
45790-45799 |
VBG |
denotes |
involving |
| T9899 |
45800-45801 |
NN |
denotes |
β |
| T9901 |
45801-45802 |
HYPH |
denotes |
- |
| T9900 |
45802-45809 |
NN |
denotes |
catenin |
| T9902 |
45810-45813 |
CC |
denotes |
and |
| T9903 |
45814-45815 |
DT |
denotes |
a |
| T9905 |
45816-45825 |
JJ |
denotes |
different |
| T9904 |
45826-45832 |
NN |
denotes |
member |
| T9906 |
45833-45835 |
IN |
denotes |
of |
| T9907 |
45836-45839 |
DT |
denotes |
the |
| T9909 |
45840-45843 |
NN |
denotes |
LEF |
| T9911 |
45843-45844 |
HYPH |
denotes |
- |
| T9912 |
45844-45845 |
CD |
denotes |
1 |
| T9913 |
45845-45846 |
HYPH |
denotes |
/ |
| T9914 |
45846-45849 |
NN |
denotes |
TCF |
| T9915 |
45849-45850 |
HYPH |
denotes |
/ |
| T9916 |
45850-45853 |
NN |
denotes |
Sry |
| T9918 |
45853-45854 |
HYPH |
denotes |
- |
| T9917 |
45854-45858 |
NN |
denotes |
type |
| T9919 |
45859-45862 |
NN |
denotes |
HMG |
| T9910 |
45863-45866 |
NN |
denotes |
box |
| T9920 |
45867-45868 |
-LRB- |
denotes |
( |
| T9922 |
45868-45876 |
RB |
denotes |
commonly |
| T9921 |
45877-45882 |
VBN |
denotes |
known |
| T9923 |
45883-45885 |
IN |
denotes |
as |
| T9924 |
45886-45889 |
NN |
denotes |
SOX |
| T9925 |
45889-45890 |
-RRB- |
denotes |
) |
| T9908 |
45891-45897 |
NN |
denotes |
family |
| T9926 |
45898-45899 |
-LRB- |
denotes |
[ |
| T9928 |
45899-45901 |
CD |
denotes |
39 |
| T9929 |
45901-45902 |
, |
denotes |
, |
| T9927 |
45902-45904 |
CD |
denotes |
40 |
| T9930 |
45904-45905 |
-RRB- |
denotes |
] |
| T9931 |
45905-45906 |
. |
denotes |
. |
| T9932 |
45906-46049 |
sentence |
denotes |
Further investigation will be required to determine whether the signaling pathway we have elucidated here is a theme with multiple variations. |
| T9933 |
45907-45914 |
JJ |
denotes |
Further |
| T9934 |
45915-45928 |
NN |
denotes |
investigation |
| T9936 |
45929-45933 |
MD |
denotes |
will |
| T9937 |
45934-45936 |
VB |
denotes |
be |
| T9935 |
45937-45945 |
VBN |
denotes |
required |
| T9938 |
45946-45948 |
TO |
denotes |
to |
| T9939 |
45949-45958 |
VB |
denotes |
determine |
| T9940 |
45959-45966 |
IN |
denotes |
whether |
| T9942 |
45967-45970 |
DT |
denotes |
the |
| T9944 |
45971-45980 |
NN |
denotes |
signaling |
| T9943 |
45981-45988 |
NN |
denotes |
pathway |
| T9945 |
45989-45991 |
PRP |
denotes |
we |
| T9947 |
45992-45996 |
VBP |
denotes |
have |
| T9946 |
45997-46007 |
VBN |
denotes |
elucidated |
| T9948 |
46008-46012 |
RB |
denotes |
here |
| T9941 |
46013-46015 |
VBZ |
denotes |
is |
| T9949 |
46016-46017 |
DT |
denotes |
a |
| T9950 |
46018-46023 |
NN |
denotes |
theme |
| T9951 |
46024-46028 |
IN |
denotes |
with |
| T9952 |
46029-46037 |
JJ |
denotes |
multiple |
| T9953 |
46038-46048 |
NNS |
denotes |
variations |
| T9954 |
46048-46049 |
. |
denotes |
. |
| T9955 |
46049-46131 |
sentence |
denotes |
TGF-βs are known to promote withdrawal of keratinocytes from the cell cycle [41]. |
| T9956 |
46050-46053 |
NN |
denotes |
TGF |
| T9958 |
46053-46054 |
HYPH |
denotes |
- |
| T9957 |
46054-46056 |
NNS |
denotes |
βs |
| T9960 |
46057-46060 |
VBP |
denotes |
are |
| T9959 |
46061-46066 |
VBN |
denotes |
known |
| T9961 |
46067-46069 |
TO |
denotes |
to |
| T9962 |
46070-46077 |
VB |
denotes |
promote |
| T9963 |
46078-46088 |
NN |
denotes |
withdrawal |
| T9964 |
46089-46091 |
IN |
denotes |
of |
| T9965 |
46092-46105 |
NNS |
denotes |
keratinocytes |
| T9966 |
46106-46110 |
IN |
denotes |
from |
| T9967 |
46111-46114 |
DT |
denotes |
the |
| T9969 |
46115-46119 |
NN |
denotes |
cell |
| T9968 |
46120-46125 |
NN |
denotes |
cycle |
| T9970 |
46126-46127 |
-LRB- |
denotes |
[ |
| T9971 |
46127-46129 |
CD |
denotes |
41 |
| T9972 |
46129-46130 |
-RRB- |
denotes |
] |
| T9973 |
46130-46131 |
. |
denotes |
. |
| T9974 |
46131-46413 |
sentence |
denotes |
Hence, when TGF-β2 protein was detected at the transition between the growing and destructive phases of the adult hair cycle, research initially and naturally focused on a role for this family member in cessation of growth and/or triggering apoptosis ([42] and references therein). |
| T9975 |
46132-46137 |
RB |
denotes |
Hence |
| T9977 |
46137-46139 |
, |
denotes |
, |
| T9978 |
46139-46143 |
WRB |
denotes |
when |
| T9980 |
46144-46147 |
NN |
denotes |
TGF |
| T9982 |
46147-46148 |
HYPH |
denotes |
- |
| T9981 |
46148-46150 |
NN |
denotes |
β2 |
| T9983 |
46151-46158 |
NN |
denotes |
protein |
| T9984 |
46159-46162 |
VBD |
denotes |
was |
| T9979 |
46163-46171 |
VBN |
denotes |
detected |
| T9985 |
46172-46174 |
IN |
denotes |
at |
| T9986 |
46175-46178 |
DT |
denotes |
the |
| T9987 |
46179-46189 |
NN |
denotes |
transition |
| T9988 |
46190-46197 |
IN |
denotes |
between |
| T9989 |
46198-46201 |
DT |
denotes |
the |
| T9991 |
46202-46209 |
NN |
denotes |
growing |
| T9993 |
46210-46213 |
CC |
denotes |
and |
| T9992 |
46214-46225 |
JJ |
denotes |
destructive |
| T9990 |
46226-46232 |
NNS |
denotes |
phases |
| T9994 |
46233-46235 |
IN |
denotes |
of |
| T9995 |
46236-46239 |
DT |
denotes |
the |
| T9997 |
46240-46245 |
JJ |
denotes |
adult |
| T9998 |
46246-46250 |
NN |
denotes |
hair |
| T9996 |
46251-46256 |
NN |
denotes |
cycle |
| T9999 |
46256-46258 |
, |
denotes |
, |
| T10000 |
46258-46266 |
NN |
denotes |
research |
| T10001 |
46267-46276 |
RB |
denotes |
initially |
| T10002 |
46277-46280 |
CC |
denotes |
and |
| T10003 |
46281-46290 |
RB |
denotes |
naturally |
| T9976 |
46291-46298 |
VBD |
denotes |
focused |
| T10004 |
46299-46301 |
IN |
denotes |
on |
| T10005 |
46302-46303 |
DT |
denotes |
a |
| T10006 |
46304-46308 |
NN |
denotes |
role |
| T10007 |
46309-46312 |
IN |
denotes |
for |
| T10008 |
46313-46317 |
DT |
denotes |
this |
| T10010 |
46318-46324 |
NN |
denotes |
family |
| T10009 |
46325-46331 |
NN |
denotes |
member |
| T10011 |
46332-46334 |
IN |
denotes |
in |
| T10012 |
46335-46344 |
NN |
denotes |
cessation |
| T10013 |
46345-46347 |
IN |
denotes |
of |
| T10014 |
46348-46354 |
NN |
denotes |
growth |
| T10015 |
46355-46358 |
CC |
denotes |
and |
| T10016 |
46358-46359 |
HYPH |
denotes |
/ |
| T10017 |
46359-46361 |
CC |
denotes |
or |
| T10018 |
46362-46372 |
VBG |
denotes |
triggering |
| T10019 |
46373-46382 |
NN |
denotes |
apoptosis |
| T10020 |
46383-46384 |
-LRB- |
denotes |
( |
| T10022 |
46384-46385 |
-LRB- |
denotes |
[ |
| T10021 |
46385-46387 |
CD |
denotes |
42 |
| T10023 |
46387-46388 |
-RRB- |
denotes |
] |
| T10024 |
46389-46392 |
CC |
denotes |
and |
| T10025 |
46393-46403 |
NNS |
denotes |
references |
| T10026 |
46404-46411 |
RB |
denotes |
therein |
| T10027 |
46411-46412 |
-RRB- |
denotes |
) |
| T10028 |
46412-46413 |
. |
denotes |
. |
| T10029 |
46413-46604 |
sentence |
denotes |
However, in contrast to TGF-β1-null skin, which exhibits an extended growing phase of postnatal hair follicles, TGF-β2-null skin displays an embryonic block in follicle bud progression [32]. |
| T10030 |
46414-46421 |
RB |
denotes |
However |
| T10032 |
46421-46423 |
, |
denotes |
, |
| T10033 |
46423-46425 |
IN |
denotes |
in |
| T10034 |
46426-46434 |
NN |
denotes |
contrast |
| T10035 |
46435-46437 |
IN |
denotes |
to |
| T10036 |
46438-46441 |
NN |
denotes |
TGF |
| T10038 |
46441-46442 |
HYPH |
denotes |
- |
| T10037 |
46442-46444 |
NN |
denotes |
β1 |
| T10040 |
46444-46445 |
HYPH |
denotes |
- |
| T10039 |
46445-46449 |
JJ |
denotes |
null |
| T10041 |
46450-46454 |
NN |
denotes |
skin |
| T10042 |
46454-46456 |
, |
denotes |
, |
| T10043 |
46456-46461 |
WDT |
denotes |
which |
| T10044 |
46462-46470 |
VBZ |
denotes |
exhibits |
| T10045 |
46471-46473 |
DT |
denotes |
an |
| T10047 |
46474-46482 |
JJ |
denotes |
extended |
| T10048 |
46483-46490 |
NN |
denotes |
growing |
| T10046 |
46491-46496 |
NN |
denotes |
phase |
| T10049 |
46497-46499 |
IN |
denotes |
of |
| T10050 |
46500-46509 |
JJ |
denotes |
postnatal |
| T10052 |
46510-46514 |
NN |
denotes |
hair |
| T10051 |
46515-46524 |
NNS |
denotes |
follicles |
| T10053 |
46524-46526 |
, |
denotes |
, |
| T10054 |
46526-46529 |
NN |
denotes |
TGF |
| T10056 |
46529-46530 |
HYPH |
denotes |
- |
| T10055 |
46530-46532 |
NN |
denotes |
β2 |
| T10058 |
46532-46533 |
HYPH |
denotes |
- |
| T10057 |
46533-46537 |
JJ |
denotes |
null |
| T10059 |
46538-46542 |
NN |
denotes |
skin |
| T10031 |
46543-46551 |
VBZ |
denotes |
displays |
| T10060 |
46552-46554 |
DT |
denotes |
an |
| T10062 |
46555-46564 |
JJ |
denotes |
embryonic |
| T10061 |
46565-46570 |
NN |
denotes |
block |
| T10063 |
46571-46573 |
IN |
denotes |
in |
| T10064 |
46574-46582 |
NN |
denotes |
follicle |
| T10065 |
46583-46586 |
NN |
denotes |
bud |
| T10066 |
46587-46598 |
NN |
denotes |
progression |
| T10067 |
46599-46600 |
-LRB- |
denotes |
[ |
| T10068 |
46600-46602 |
CD |
denotes |
32 |
| T10069 |
46602-46603 |
-RRB- |
denotes |
] |
| T10070 |
46603-46604 |
. |
denotes |
. |
| T10071 |
46604-46875 |
sentence |
denotes |
Although this phenotype is consistent with TGF-β2's embryonic expression patterns [33], about 50% of TGF-β2 null buds appear unable to progress to the down-growth phase, a feature that cannot be explained readily on the basis of previously established effects of TGF-βs. |
| T10072 |
46605-46613 |
IN |
denotes |
Although |
| T10074 |
46614-46618 |
DT |
denotes |
this |
| T10075 |
46619-46628 |
NN |
denotes |
phenotype |
| T10073 |
46629-46631 |
VBZ |
denotes |
is |
| T10077 |
46632-46642 |
JJ |
denotes |
consistent |
| T10078 |
46643-46647 |
IN |
denotes |
with |
| T10079 |
46648-46651 |
NN |
denotes |
TGF |
| T10081 |
46651-46652 |
HYPH |
denotes |
- |
| T10080 |
46652-46654 |
NN |
denotes |
β2 |
| T10083 |
46654-46656 |
POS |
denotes |
's |
| T10084 |
46657-46666 |
JJ |
denotes |
embryonic |
| T10085 |
46667-46677 |
NN |
denotes |
expression |
| T10082 |
46678-46686 |
NNS |
denotes |
patterns |
| T10086 |
46687-46688 |
-LRB- |
denotes |
[ |
| T10087 |
46688-46690 |
CD |
denotes |
33 |
| T10088 |
46690-46691 |
-RRB- |
denotes |
] |
| T10089 |
46691-46693 |
, |
denotes |
, |
| T10090 |
46693-46698 |
IN |
denotes |
about |
| T10091 |
46699-46701 |
CD |
denotes |
50 |
| T10092 |
46701-46702 |
NN |
denotes |
% |
| T10093 |
46703-46705 |
IN |
denotes |
of |
| T10094 |
46706-46709 |
NN |
denotes |
TGF |
| T10096 |
46709-46710 |
HYPH |
denotes |
- |
| T10095 |
46710-46712 |
NN |
denotes |
β2 |
| T10097 |
46713-46717 |
JJ |
denotes |
null |
| T10098 |
46718-46722 |
NNS |
denotes |
buds |
| T10076 |
46723-46729 |
VBP |
denotes |
appear |
| T10099 |
46730-46736 |
JJ |
denotes |
unable |
| T10100 |
46737-46739 |
TO |
denotes |
to |
| T10101 |
46740-46748 |
VB |
denotes |
progress |
| T10102 |
46749-46751 |
IN |
denotes |
to |
| T10103 |
46752-46755 |
DT |
denotes |
the |
| T10105 |
46756-46760 |
JJ |
denotes |
down |
| T10107 |
46760-46761 |
HYPH |
denotes |
- |
| T10106 |
46761-46767 |
NN |
denotes |
growth |
| T10104 |
46768-46773 |
NN |
denotes |
phase |
| T10108 |
46773-46775 |
, |
denotes |
, |
| T10109 |
46775-46776 |
DT |
denotes |
a |
| T10110 |
46777-46784 |
NN |
denotes |
feature |
| T10111 |
46785-46789 |
WDT |
denotes |
that |
| T10113 |
46790-46793 |
MD |
denotes |
can |
| T10114 |
46793-46796 |
RB |
denotes |
not |
| T10115 |
46797-46799 |
VB |
denotes |
be |
| T10112 |
46800-46809 |
VBN |
denotes |
explained |
| T10116 |
46810-46817 |
RB |
denotes |
readily |
| T10117 |
46818-46820 |
IN |
denotes |
on |
| T10118 |
46821-46824 |
DT |
denotes |
the |
| T10119 |
46825-46830 |
NN |
denotes |
basis |
| T10120 |
46831-46833 |
IN |
denotes |
of |
| T10121 |
46834-46844 |
RB |
denotes |
previously |
| T10122 |
46845-46856 |
VBN |
denotes |
established |
| T10123 |
46857-46864 |
NNS |
denotes |
effects |
| T10124 |
46865-46867 |
IN |
denotes |
of |
| T10125 |
46868-46871 |
NN |
denotes |
TGF |
| T10127 |
46871-46872 |
HYPH |
denotes |
- |
| T10126 |
46872-46874 |
NNS |
denotes |
βs |
| T10128 |
46874-46875 |
. |
denotes |
. |
| T10129 |
46875-47150 |
sentence |
denotes |
Our finding that TGF-β2 is upstream from Ki67 expression and MAPK activation lends further support to the notion that hair follicle keratinocytes at this early stage of development react to TGF-β2 signaling in a fashion opposite to that typically expected for TGF-β factors. |
| T10130 |
46876-46879 |
PRP$ |
denotes |
Our |
| T10131 |
46880-46887 |
NN |
denotes |
finding |
| T10133 |
46888-46892 |
IN |
denotes |
that |
| T10135 |
46893-46896 |
NN |
denotes |
TGF |
| T10137 |
46896-46897 |
HYPH |
denotes |
- |
| T10136 |
46897-46899 |
NN |
denotes |
β2 |
| T10134 |
46900-46902 |
VBZ |
denotes |
is |
| T10138 |
46903-46911 |
RB |
denotes |
upstream |
| T10139 |
46912-46916 |
IN |
denotes |
from |
| T10140 |
46917-46921 |
NN |
denotes |
Ki67 |
| T10141 |
46922-46932 |
NN |
denotes |
expression |
| T10142 |
46933-46936 |
CC |
denotes |
and |
| T10143 |
46937-46941 |
NN |
denotes |
MAPK |
| T10144 |
46942-46952 |
NN |
denotes |
activation |
| T10132 |
46953-46958 |
VBZ |
denotes |
lends |
| T10145 |
46959-46966 |
JJ |
denotes |
further |
| T10146 |
46967-46974 |
NN |
denotes |
support |
| T10147 |
46975-46977 |
IN |
denotes |
to |
| T10148 |
46978-46981 |
DT |
denotes |
the |
| T10149 |
46982-46988 |
NN |
denotes |
notion |
| T10150 |
46989-46993 |
IN |
denotes |
that |
| T10152 |
46994-46998 |
NN |
denotes |
hair |
| T10153 |
46999-47007 |
NN |
denotes |
follicle |
| T10154 |
47008-47021 |
NNS |
denotes |
keratinocytes |
| T10155 |
47022-47024 |
IN |
denotes |
at |
| T10156 |
47025-47029 |
DT |
denotes |
this |
| T10158 |
47030-47035 |
JJ |
denotes |
early |
| T10157 |
47036-47041 |
NN |
denotes |
stage |
| T10159 |
47042-47044 |
IN |
denotes |
of |
| T10160 |
47045-47056 |
NN |
denotes |
development |
| T10151 |
47057-47062 |
VBP |
denotes |
react |
| T10161 |
47063-47065 |
IN |
denotes |
to |
| T10162 |
47066-47069 |
NN |
denotes |
TGF |
| T10164 |
47069-47070 |
HYPH |
denotes |
- |
| T10163 |
47070-47072 |
NN |
denotes |
β2 |
| T10165 |
47073-47082 |
NN |
denotes |
signaling |
| T10166 |
47083-47085 |
IN |
denotes |
in |
| T10167 |
47086-47087 |
DT |
denotes |
a |
| T10168 |
47088-47095 |
NN |
denotes |
fashion |
| T10169 |
47096-47104 |
JJ |
denotes |
opposite |
| T10170 |
47105-47107 |
IN |
denotes |
to |
| T10171 |
47108-47112 |
DT |
denotes |
that |
| T10172 |
47113-47122 |
RB |
denotes |
typically |
| T10173 |
47123-47131 |
VBN |
denotes |
expected |
| T10174 |
47132-47135 |
IN |
denotes |
for |
| T10175 |
47136-47139 |
NN |
denotes |
TGF |
| T10177 |
47139-47140 |
HYPH |
denotes |
- |
| T10176 |
47140-47141 |
NN |
denotes |
β |
| T10178 |
47142-47149 |
NNS |
denotes |
factors |
| T10179 |
47149-47150 |
. |
denotes |
. |
| T10180 |
47150-47268 |
sentence |
denotes |
This said, based upon pSMAD2 immunohistochemistry, the immediate steps of downstream signaling appeared to be intact. |
| T10181 |
47151-47155 |
DT |
denotes |
This |
| T10182 |
47156-47160 |
VBN |
denotes |
said |
| T10184 |
47160-47162 |
, |
denotes |
, |
| T10185 |
47162-47167 |
VBN |
denotes |
based |
| T10186 |
47168-47172 |
IN |
denotes |
upon |
| T10187 |
47173-47179 |
NN |
denotes |
pSMAD2 |
| T10188 |
47180-47200 |
NN |
denotes |
immunohistochemistry |
| T10189 |
47200-47202 |
, |
denotes |
, |
| T10190 |
47202-47205 |
DT |
denotes |
the |
| T10192 |
47206-47215 |
JJ |
denotes |
immediate |
| T10191 |
47216-47221 |
NNS |
denotes |
steps |
| T10193 |
47222-47224 |
IN |
denotes |
of |
| T10194 |
47225-47235 |
JJ |
denotes |
downstream |
| T10195 |
47236-47245 |
NN |
denotes |
signaling |
| T10183 |
47246-47254 |
VBD |
denotes |
appeared |
| T10196 |
47255-47257 |
TO |
denotes |
to |
| T10197 |
47258-47260 |
VB |
denotes |
be |
| T10198 |
47261-47267 |
JJ |
denotes |
intact |
| T10199 |
47267-47268 |
. |
denotes |
. |
| T10200 |
47268-47404 |
sentence |
denotes |
Thus, we surmise that the proliferative outcome is likely to be rooted in differences in the repertoire of activated SMAD target genes. |
| T10201 |
47269-47273 |
RB |
denotes |
Thus |
| T10203 |
47273-47275 |
, |
denotes |
, |
| T10204 |
47275-47277 |
PRP |
denotes |
we |
| T10202 |
47278-47285 |
VBP |
denotes |
surmise |
| T10205 |
47286-47290 |
IN |
denotes |
that |
| T10207 |
47291-47294 |
DT |
denotes |
the |
| T10209 |
47295-47308 |
JJ |
denotes |
proliferative |
| T10208 |
47309-47316 |
NN |
denotes |
outcome |
| T10206 |
47317-47319 |
VBZ |
denotes |
is |
| T10210 |
47320-47326 |
JJ |
denotes |
likely |
| T10211 |
47327-47329 |
TO |
denotes |
to |
| T10213 |
47330-47332 |
VB |
denotes |
be |
| T10212 |
47333-47339 |
VBN |
denotes |
rooted |
| T10214 |
47340-47342 |
IN |
denotes |
in |
| T10215 |
47343-47354 |
NNS |
denotes |
differences |
| T10216 |
47355-47357 |
IN |
denotes |
in |
| T10217 |
47358-47361 |
DT |
denotes |
the |
| T10218 |
47362-47372 |
NN |
denotes |
repertoire |
| T10219 |
47373-47375 |
IN |
denotes |
of |
| T10220 |
47376-47385 |
VBN |
denotes |
activated |
| T10222 |
47386-47390 |
NN |
denotes |
SMAD |
| T10223 |
47391-47397 |
NN |
denotes |
target |
| T10221 |
47398-47403 |
NNS |
denotes |
genes |
| T10224 |
47403-47404 |
. |
denotes |
. |
| T10225 |
47404-47669 |
sentence |
denotes |
In this regard, the positive effects of TGF-β2 on proliferation within the hair bud may be more analogous to what has been seen in progression of squamous cell carcinoma to metastatic carcinoma [43] rather than that typically observed for keratinocytes [44,45,46]. |
| T10226 |
47405-47407 |
IN |
denotes |
In |
| T10228 |
47408-47412 |
DT |
denotes |
this |
| T10229 |
47413-47419 |
NN |
denotes |
regard |
| T10230 |
47419-47421 |
, |
denotes |
, |
| T10231 |
47421-47424 |
DT |
denotes |
the |
| T10233 |
47425-47433 |
JJ |
denotes |
positive |
| T10232 |
47434-47441 |
NNS |
denotes |
effects |
| T10234 |
47442-47444 |
IN |
denotes |
of |
| T10235 |
47445-47448 |
NN |
denotes |
TGF |
| T10237 |
47448-47449 |
HYPH |
denotes |
- |
| T10236 |
47449-47451 |
NN |
denotes |
β2 |
| T10238 |
47452-47454 |
IN |
denotes |
on |
| T10239 |
47455-47468 |
NN |
denotes |
proliferation |
| T10240 |
47469-47475 |
IN |
denotes |
within |
| T10241 |
47476-47479 |
DT |
denotes |
the |
| T10243 |
47480-47484 |
NN |
denotes |
hair |
| T10242 |
47485-47488 |
NN |
denotes |
bud |
| T10244 |
47489-47492 |
MD |
denotes |
may |
| T10227 |
47493-47495 |
VB |
denotes |
be |
| T10245 |
47496-47500 |
RBR |
denotes |
more |
| T10246 |
47501-47510 |
JJ |
denotes |
analogous |
| T10247 |
47511-47513 |
IN |
denotes |
to |
| T10248 |
47514-47518 |
WP |
denotes |
what |
| T10250 |
47519-47522 |
VBZ |
denotes |
has |
| T10251 |
47523-47527 |
VBN |
denotes |
been |
| T10249 |
47528-47532 |
VBN |
denotes |
seen |
| T10252 |
47533-47535 |
IN |
denotes |
in |
| T10253 |
47536-47547 |
NN |
denotes |
progression |
| T10254 |
47548-47550 |
IN |
denotes |
of |
| T10255 |
47551-47559 |
JJ |
denotes |
squamous |
| T10256 |
47560-47564 |
NN |
denotes |
cell |
| T10257 |
47565-47574 |
NN |
denotes |
carcinoma |
| T10258 |
47575-47577 |
IN |
denotes |
to |
| T10259 |
47578-47588 |
JJ |
denotes |
metastatic |
| T10260 |
47589-47598 |
NN |
denotes |
carcinoma |
| T10261 |
47599-47600 |
-LRB- |
denotes |
[ |
| T10262 |
47600-47602 |
CD |
denotes |
43 |
| T10263 |
47602-47603 |
-RRB- |
denotes |
] |
| T10264 |
47604-47610 |
RB |
denotes |
rather |
| T10265 |
47611-47615 |
IN |
denotes |
than |
| T10266 |
47616-47620 |
DT |
denotes |
that |
| T10267 |
47621-47630 |
RB |
denotes |
typically |
| T10268 |
47631-47639 |
VBN |
denotes |
observed |
| T10269 |
47640-47643 |
IN |
denotes |
for |
| T10270 |
47644-47657 |
NNS |
denotes |
keratinocytes |
| T10271 |
47658-47659 |
-LRB- |
denotes |
[ |
| T10273 |
47659-47661 |
CD |
denotes |
44 |
| T10274 |
47661-47662 |
, |
denotes |
, |
| T10275 |
47662-47664 |
CD |
denotes |
45 |
| T10276 |
47664-47665 |
, |
denotes |
, |
| T10272 |
47665-47667 |
CD |
denotes |
46 |
| T10277 |
47667-47668 |
-RRB- |
denotes |
] |
| T10278 |
47668-47669 |
. |
denotes |
. |
| T10279 |
47669-47863 |
sentence |
denotes |
The prior identification of the Snail gene as a potential target of TGF-β signaling [15] was intriguing, given the temporal wave of Snail gene expression that occurs in the developing hair bud. |
| T10280 |
47670-47673 |
DT |
denotes |
The |
| T10282 |
47674-47679 |
JJ |
denotes |
prior |
| T10281 |
47680-47694 |
NN |
denotes |
identification |
| T10284 |
47695-47697 |
IN |
denotes |
of |
| T10285 |
47698-47701 |
DT |
denotes |
the |
| T10287 |
47702-47707 |
NN |
denotes |
Snail |
| T10286 |
47708-47712 |
NN |
denotes |
gene |
| T10288 |
47713-47715 |
IN |
denotes |
as |
| T10289 |
47716-47717 |
DT |
denotes |
a |
| T10291 |
47718-47727 |
JJ |
denotes |
potential |
| T10290 |
47728-47734 |
NN |
denotes |
target |
| T10292 |
47735-47737 |
IN |
denotes |
of |
| T10293 |
47738-47741 |
NN |
denotes |
TGF |
| T10295 |
47741-47742 |
HYPH |
denotes |
- |
| T10294 |
47742-47743 |
NN |
denotes |
β |
| T10296 |
47744-47753 |
NN |
denotes |
signaling |
| T10297 |
47754-47755 |
-LRB- |
denotes |
[ |
| T10298 |
47755-47757 |
CD |
denotes |
15 |
| T10299 |
47757-47758 |
-RRB- |
denotes |
] |
| T10283 |
47759-47762 |
VBD |
denotes |
was |
| T10300 |
47763-47773 |
JJ |
denotes |
intriguing |
| T10301 |
47773-47775 |
, |
denotes |
, |
| T10302 |
47775-47780 |
VBN |
denotes |
given |
| T10303 |
47781-47784 |
DT |
denotes |
the |
| T10305 |
47785-47793 |
JJ |
denotes |
temporal |
| T10304 |
47794-47798 |
NN |
denotes |
wave |
| T10306 |
47799-47801 |
IN |
denotes |
of |
| T10307 |
47802-47807 |
NN |
denotes |
Snail |
| T10309 |
47808-47812 |
NN |
denotes |
gene |
| T10308 |
47813-47823 |
NN |
denotes |
expression |
| T10310 |
47824-47828 |
WDT |
denotes |
that |
| T10311 |
47829-47835 |
VBZ |
denotes |
occurs |
| T10312 |
47836-47838 |
IN |
denotes |
in |
| T10313 |
47839-47842 |
DT |
denotes |
the |
| T10315 |
47843-47853 |
VBG |
denotes |
developing |
| T10316 |
47854-47858 |
NN |
denotes |
hair |
| T10314 |
47859-47862 |
NN |
denotes |
bud |
| T10317 |
47862-47863 |
. |
denotes |
. |
| T10318 |
47863-48034 |
sentence |
denotes |
The additional correlation between epithelial hyperproliferation and Snail transgene expression further fostered our interest in a possible link between TGF-β2 and Snail. |
| T10319 |
47864-47867 |
DT |
denotes |
The |
| T10321 |
47868-47878 |
JJ |
denotes |
additional |
| T10320 |
47879-47890 |
NN |
denotes |
correlation |
| T10323 |
47891-47898 |
IN |
denotes |
between |
| T10324 |
47899-47909 |
JJ |
denotes |
epithelial |
| T10325 |
47910-47928 |
NN |
denotes |
hyperproliferation |
| T10326 |
47929-47932 |
CC |
denotes |
and |
| T10327 |
47933-47938 |
NN |
denotes |
Snail |
| T10329 |
47939-47948 |
NN |
denotes |
transgene |
| T10328 |
47949-47959 |
NN |
denotes |
expression |
| T10330 |
47960-47967 |
RB |
denotes |
further |
| T10322 |
47968-47976 |
VBD |
denotes |
fostered |
| T10331 |
47977-47980 |
PRP$ |
denotes |
our |
| T10332 |
47981-47989 |
NN |
denotes |
interest |
| T10333 |
47990-47992 |
IN |
denotes |
in |
| T10334 |
47993-47994 |
DT |
denotes |
a |
| T10336 |
47995-48003 |
JJ |
denotes |
possible |
| T10335 |
48004-48008 |
NN |
denotes |
link |
| T10337 |
48009-48016 |
IN |
denotes |
between |
| T10338 |
48017-48020 |
NN |
denotes |
TGF |
| T10340 |
48020-48021 |
HYPH |
denotes |
- |
| T10339 |
48021-48023 |
NN |
denotes |
β2 |
| T10341 |
48024-48027 |
CC |
denotes |
and |
| T10342 |
48028-48033 |
NN |
denotes |
Snail |
| T10343 |
48033-48034 |
. |
denotes |
. |
| T10344 |
48034-48212 |
sentence |
denotes |
Our functional studies demonstrate that without TGF-β2, Snail expression is abolished in the mutant hair buds, and conversely, in K14-Smad2 skin, Snail is ectopically activated. |
| T10345 |
48035-48038 |
PRP$ |
denotes |
Our |
| T10347 |
48039-48049 |
JJ |
denotes |
functional |
| T10346 |
48050-48057 |
NNS |
denotes |
studies |
| T10348 |
48058-48069 |
VBP |
denotes |
demonstrate |
| T10349 |
48070-48074 |
IN |
denotes |
that |
| T10351 |
48075-48082 |
IN |
denotes |
without |
| T10352 |
48083-48086 |
NN |
denotes |
TGF |
| T10354 |
48086-48087 |
HYPH |
denotes |
- |
| T10353 |
48087-48089 |
NN |
denotes |
β2 |
| T10355 |
48089-48091 |
, |
denotes |
, |
| T10356 |
48091-48096 |
NN |
denotes |
Snail |
| T10357 |
48097-48107 |
NN |
denotes |
expression |
| T10358 |
48108-48110 |
VBZ |
denotes |
is |
| T10350 |
48111-48120 |
VBN |
denotes |
abolished |
| T10359 |
48121-48123 |
IN |
denotes |
in |
| T10360 |
48124-48127 |
DT |
denotes |
the |
| T10362 |
48128-48134 |
NN |
denotes |
mutant |
| T10363 |
48135-48139 |
NN |
denotes |
hair |
| T10361 |
48140-48144 |
NNS |
denotes |
buds |
| T10364 |
48144-48146 |
, |
denotes |
, |
| T10365 |
48146-48149 |
CC |
denotes |
and |
| T10366 |
48150-48160 |
RB |
denotes |
conversely |
| T10368 |
48160-48162 |
, |
denotes |
, |
| T10369 |
48162-48164 |
IN |
denotes |
in |
| T10370 |
48165-48168 |
NN |
denotes |
K14 |
| T10372 |
48168-48169 |
HYPH |
denotes |
- |
| T10371 |
48169-48174 |
NN |
denotes |
Smad2 |
| T10373 |
48175-48179 |
NN |
denotes |
skin |
| T10374 |
48179-48181 |
, |
denotes |
, |
| T10375 |
48181-48186 |
NN |
denotes |
Snail |
| T10376 |
48187-48189 |
VBZ |
denotes |
is |
| T10377 |
48190-48201 |
RB |
denotes |
ectopically |
| T10367 |
48202-48211 |
VBN |
denotes |
activated |
| T10378 |
48211-48212 |
. |
denotes |
. |
| T10379 |
48212-48443 |
sentence |
denotes |
Moreover, our in vitro studies indicate that even sustained TGF-β2 exposure may cause only a transient induction of Snail, offering a possible explanation as to why Snail is so briefly expressed during hair follicle morphogenesis. |
| T10380 |
48213-48221 |
RB |
denotes |
Moreover |
| T10382 |
48221-48223 |
, |
denotes |
, |
| T10383 |
48223-48226 |
PRP$ |
denotes |
our |
| T10385 |
48227-48229 |
FW |
denotes |
in |
| T10386 |
48230-48235 |
FW |
denotes |
vitro |
| T10384 |
48236-48243 |
NNS |
denotes |
studies |
| T10381 |
48244-48252 |
VBP |
denotes |
indicate |
| T10387 |
48253-48257 |
IN |
denotes |
that |
| T10389 |
48258-48262 |
RB |
denotes |
even |
| T10391 |
48263-48272 |
JJ |
denotes |
sustained |
| T10392 |
48273-48276 |
NN |
denotes |
TGF |
| T10394 |
48276-48277 |
HYPH |
denotes |
- |
| T10393 |
48277-48279 |
NN |
denotes |
β2 |
| T10390 |
48280-48288 |
NN |
denotes |
exposure |
| T10395 |
48289-48292 |
MD |
denotes |
may |
| T10388 |
48293-48298 |
VB |
denotes |
cause |
| T10396 |
48299-48303 |
RB |
denotes |
only |
| T10398 |
48304-48305 |
DT |
denotes |
a |
| T10399 |
48306-48315 |
JJ |
denotes |
transient |
| T10397 |
48316-48325 |
NN |
denotes |
induction |
| T10400 |
48326-48328 |
IN |
denotes |
of |
| T10401 |
48329-48334 |
NN |
denotes |
Snail |
| T10402 |
48334-48336 |
, |
denotes |
, |
| T10403 |
48336-48344 |
VBG |
denotes |
offering |
| T10404 |
48345-48346 |
DT |
denotes |
a |
| T10406 |
48347-48355 |
JJ |
denotes |
possible |
| T10405 |
48356-48367 |
NN |
denotes |
explanation |
| T10407 |
48368-48370 |
IN |
denotes |
as |
| T10408 |
48371-48373 |
IN |
denotes |
to |
| T10409 |
48374-48377 |
WRB |
denotes |
why |
| T10411 |
48378-48383 |
NN |
denotes |
Snail |
| T10412 |
48384-48386 |
VBZ |
denotes |
is |
| T10413 |
48387-48389 |
RB |
denotes |
so |
| T10414 |
48390-48397 |
RB |
denotes |
briefly |
| T10410 |
48398-48407 |
VBN |
denotes |
expressed |
| T10415 |
48408-48414 |
IN |
denotes |
during |
| T10416 |
48415-48419 |
NN |
denotes |
hair |
| T10417 |
48420-48428 |
NN |
denotes |
follicle |
| T10418 |
48429-48442 |
NN |
denotes |
morphogenesis |
| T10419 |
48442-48443 |
. |
denotes |
. |
| T10420 |
48443-48760 |
sentence |
denotes |
An additional point worth mentioning is that prolonged expression of Tg Snail in postnatal skin resulted in morphological and biochemical signs of epithelial to mesenchymal transitions (unpublished data), underscoring why transient Snail expression may be so important during normal hair follicle morphogenesis [18]. |
| T10421 |
48444-48446 |
DT |
denotes |
An |
| T10423 |
48447-48457 |
JJ |
denotes |
additional |
| T10422 |
48458-48463 |
NN |
denotes |
point |
| T10425 |
48464-48469 |
JJ |
denotes |
worth |
| T10426 |
48470-48480 |
VBG |
denotes |
mentioning |
| T10424 |
48481-48483 |
VBZ |
denotes |
is |
| T10427 |
48484-48488 |
IN |
denotes |
that |
| T10429 |
48489-48498 |
VBN |
denotes |
prolonged |
| T10430 |
48499-48509 |
NN |
denotes |
expression |
| T10431 |
48510-48512 |
IN |
denotes |
of |
| T10432 |
48513-48515 |
NN |
denotes |
Tg |
| T10433 |
48516-48521 |
NN |
denotes |
Snail |
| T10434 |
48522-48524 |
IN |
denotes |
in |
| T10435 |
48525-48534 |
JJ |
denotes |
postnatal |
| T10436 |
48535-48539 |
NN |
denotes |
skin |
| T10428 |
48540-48548 |
VBD |
denotes |
resulted |
| T10437 |
48549-48551 |
IN |
denotes |
in |
| T10438 |
48552-48565 |
JJ |
denotes |
morphological |
| T10440 |
48566-48569 |
CC |
denotes |
and |
| T10441 |
48570-48581 |
JJ |
denotes |
biochemical |
| T10439 |
48582-48587 |
NNS |
denotes |
signs |
| T10442 |
48588-48590 |
IN |
denotes |
of |
| T10443 |
48591-48601 |
JJ |
denotes |
epithelial |
| T10445 |
48602-48604 |
IN |
denotes |
to |
| T10446 |
48605-48616 |
JJ |
denotes |
mesenchymal |
| T10444 |
48617-48628 |
NNS |
denotes |
transitions |
| T10447 |
48629-48630 |
-LRB- |
denotes |
( |
| T10449 |
48630-48641 |
JJ |
denotes |
unpublished |
| T10448 |
48642-48646 |
NNS |
denotes |
data |
| T10450 |
48646-48647 |
-RRB- |
denotes |
) |
| T10451 |
48647-48649 |
, |
denotes |
, |
| T10452 |
48649-48661 |
VBG |
denotes |
underscoring |
| T10453 |
48662-48665 |
WRB |
denotes |
why |
| T10455 |
48666-48675 |
JJ |
denotes |
transient |
| T10457 |
48676-48681 |
NN |
denotes |
Snail |
| T10456 |
48682-48692 |
NN |
denotes |
expression |
| T10458 |
48693-48696 |
MD |
denotes |
may |
| T10454 |
48697-48699 |
VB |
denotes |
be |
| T10459 |
48700-48702 |
RB |
denotes |
so |
| T10460 |
48703-48712 |
JJ |
denotes |
important |
| T10461 |
48713-48719 |
IN |
denotes |
during |
| T10462 |
48720-48726 |
JJ |
denotes |
normal |
| T10464 |
48727-48731 |
NN |
denotes |
hair |
| T10465 |
48732-48740 |
NN |
denotes |
follicle |
| T10463 |
48741-48754 |
NN |
denotes |
morphogenesis |
| T10466 |
48755-48756 |
-LRB- |
denotes |
[ |
| T10467 |
48756-48758 |
CD |
denotes |
18 |
| T10468 |
48758-48759 |
-RRB- |
denotes |
] |
| T10469 |
48759-48760 |
. |
denotes |
. |
| T10470 |
48760-48893 |
sentence |
denotes |
At first glance, the sparsity in hair coat of K14-Snail Tg mice seemed indicative of a defect in follicle formation (see Figure 2A). |
| T10471 |
48761-48763 |
IN |
denotes |
At |
| T10473 |
48764-48769 |
JJ |
denotes |
first |
| T10474 |
48770-48776 |
NN |
denotes |
glance |
| T10475 |
48776-48778 |
, |
denotes |
, |
| T10476 |
48778-48781 |
DT |
denotes |
the |
| T10477 |
48782-48790 |
NN |
denotes |
sparsity |
| T10478 |
48791-48793 |
IN |
denotes |
in |
| T10479 |
48794-48798 |
NN |
denotes |
hair |
| T10480 |
48799-48803 |
NN |
denotes |
coat |
| T10481 |
48804-48806 |
IN |
denotes |
of |
| T10482 |
48807-48810 |
NN |
denotes |
K14 |
| T10484 |
48810-48811 |
HYPH |
denotes |
- |
| T10483 |
48811-48816 |
NN |
denotes |
Snail |
| T10486 |
48817-48819 |
NN |
denotes |
Tg |
| T10485 |
48820-48824 |
NNS |
denotes |
mice |
| T10472 |
48825-48831 |
VBD |
denotes |
seemed |
| T10487 |
48832-48842 |
JJ |
denotes |
indicative |
| T10488 |
48843-48845 |
IN |
denotes |
of |
| T10489 |
48846-48847 |
DT |
denotes |
a |
| T10490 |
48848-48854 |
NN |
denotes |
defect |
| T10491 |
48855-48857 |
IN |
denotes |
in |
| T10492 |
48858-48866 |
NN |
denotes |
follicle |
| T10493 |
48867-48876 |
NN |
denotes |
formation |
| T10494 |
48877-48878 |
-LRB- |
denotes |
( |
| T10495 |
48878-48881 |
VB |
denotes |
see |
| T10496 |
48882-48888 |
NN |
denotes |
Figure |
| T10497 |
48889-48891 |
NN |
denotes |
2A |
| T10498 |
48891-48892 |
-RRB- |
denotes |
) |
| T10499 |
48892-48893 |
. |
denotes |
. |
| T10500 |
48893-48993 |
sentence |
denotes |
Closer inspection, however, revealed that not all hairs penetrated the hyperthickened Tg epidermis. |
| T10501 |
48894-48900 |
JJR |
denotes |
Closer |
| T10502 |
48901-48911 |
NN |
denotes |
inspection |
| T10504 |
48911-48913 |
, |
denotes |
, |
| T10505 |
48913-48920 |
RB |
denotes |
however |
| T10506 |
48920-48922 |
, |
denotes |
, |
| T10503 |
48922-48930 |
VBD |
denotes |
revealed |
| T10507 |
48931-48935 |
IN |
denotes |
that |
| T10509 |
48936-48939 |
RB |
denotes |
not |
| T10511 |
48940-48943 |
DT |
denotes |
all |
| T10510 |
48944-48949 |
NNS |
denotes |
hairs |
| T10508 |
48950-48960 |
VBD |
denotes |
penetrated |
| T10512 |
48961-48964 |
DT |
denotes |
the |
| T10514 |
48965-48979 |
VBN |
denotes |
hyperthickened |
| T10515 |
48980-48982 |
NN |
denotes |
Tg |
| T10513 |
48983-48992 |
NN |
denotes |
epidermis |
| T10516 |
48992-48993 |
. |
denotes |
. |
| T10517 |
48993-49084 |
sentence |
denotes |
Several factors may contribute to the seemingly normal follicle development in these mice. |
| T10518 |
48994-49001 |
JJ |
denotes |
Several |
| T10519 |
49002-49009 |
NNS |
denotes |
factors |
| T10521 |
49010-49013 |
MD |
denotes |
may |
| T10520 |
49014-49024 |
VB |
denotes |
contribute |
| T10522 |
49025-49027 |
IN |
denotes |
to |
| T10523 |
49028-49031 |
DT |
denotes |
the |
| T10525 |
49032-49041 |
RB |
denotes |
seemingly |
| T10526 |
49042-49048 |
JJ |
denotes |
normal |
| T10527 |
49049-49057 |
NN |
denotes |
follicle |
| T10524 |
49058-49069 |
NN |
denotes |
development |
| T10528 |
49070-49072 |
IN |
denotes |
in |
| T10529 |
49073-49078 |
DT |
denotes |
these |
| T10530 |
49079-49083 |
NNS |
denotes |
mice |
| T10531 |
49083-49084 |
. |
denotes |
. |
| T10532 |
49084-49348 |
sentence |
denotes |
One obvious factor is the K14 promoter, which is elevated in the basal layer of the epidermis and the outer root sheath (ORS) of the hair follicle, but is markedly down-regulated in developing embryonic hair buds as well as in the postnatal hair progenitor cells. |
| T10533 |
49085-49088 |
CD |
denotes |
One |
| T10535 |
49089-49096 |
JJ |
denotes |
obvious |
| T10534 |
49097-49103 |
NN |
denotes |
factor |
| T10536 |
49104-49106 |
VBZ |
denotes |
is |
| T10537 |
49107-49110 |
DT |
denotes |
the |
| T10539 |
49111-49114 |
NN |
denotes |
K14 |
| T10538 |
49115-49123 |
NN |
denotes |
promoter |
| T10540 |
49123-49125 |
, |
denotes |
, |
| T10541 |
49125-49130 |
WDT |
denotes |
which |
| T10542 |
49131-49133 |
VBZ |
denotes |
is |
| T10543 |
49134-49142 |
JJ |
denotes |
elevated |
| T10544 |
49143-49145 |
IN |
denotes |
in |
| T10545 |
49146-49149 |
DT |
denotes |
the |
| T10547 |
49150-49155 |
JJ |
denotes |
basal |
| T10546 |
49156-49161 |
NN |
denotes |
layer |
| T10548 |
49162-49164 |
IN |
denotes |
of |
| T10549 |
49165-49168 |
DT |
denotes |
the |
| T10550 |
49169-49178 |
NN |
denotes |
epidermis |
| T10551 |
49179-49182 |
CC |
denotes |
and |
| T10552 |
49183-49186 |
DT |
denotes |
the |
| T10554 |
49187-49192 |
JJ |
denotes |
outer |
| T10555 |
49193-49197 |
NN |
denotes |
root |
| T10553 |
49198-49204 |
NN |
denotes |
sheath |
| T10556 |
49205-49206 |
-LRB- |
denotes |
( |
| T10557 |
49206-49209 |
NN |
denotes |
ORS |
| T10558 |
49209-49210 |
-RRB- |
denotes |
) |
| T10559 |
49211-49213 |
IN |
denotes |
of |
| T10560 |
49214-49217 |
DT |
denotes |
the |
| T10562 |
49218-49222 |
NN |
denotes |
hair |
| T10561 |
49223-49231 |
NN |
denotes |
follicle |
| T10563 |
49231-49233 |
, |
denotes |
, |
| T10564 |
49233-49236 |
CC |
denotes |
but |
| T10565 |
49237-49239 |
VBZ |
denotes |
is |
| T10567 |
49240-49248 |
RB |
denotes |
markedly |
| T10568 |
49249-49253 |
RB |
denotes |
down |
| T10569 |
49253-49254 |
HYPH |
denotes |
- |
| T10566 |
49254-49263 |
VBN |
denotes |
regulated |
| T10570 |
49264-49266 |
IN |
denotes |
in |
| T10571 |
49267-49277 |
JJ |
denotes |
developing |
| T10573 |
49278-49287 |
JJ |
denotes |
embryonic |
| T10574 |
49288-49292 |
NN |
denotes |
hair |
| T10572 |
49293-49297 |
NNS |
denotes |
buds |
| T10575 |
49298-49300 |
RB |
denotes |
as |
| T10577 |
49301-49305 |
RB |
denotes |
well |
| T10576 |
49306-49308 |
IN |
denotes |
as |
| T10578 |
49309-49311 |
IN |
denotes |
in |
| T10579 |
49312-49315 |
DT |
denotes |
the |
| T10581 |
49316-49325 |
JJ |
denotes |
postnatal |
| T10582 |
49326-49330 |
NN |
denotes |
hair |
| T10583 |
49331-49341 |
NN |
denotes |
progenitor |
| T10580 |
49342-49347 |
NNS |
denotes |
cells |
| T10584 |
49347-49348 |
. |
denotes |
. |
| T10585 |
49348-49508 |
sentence |
denotes |
The K14 promoter is also less active in the ORS than epidermis and hence this might also account for the lack of apparent response of the ORS to ectopic Snail. |
| T10586 |
49349-49352 |
DT |
denotes |
The |
| T10588 |
49353-49356 |
NN |
denotes |
K14 |
| T10587 |
49357-49365 |
NN |
denotes |
promoter |
| T10589 |
49366-49368 |
VBZ |
denotes |
is |
| T10590 |
49369-49373 |
RB |
denotes |
also |
| T10591 |
49374-49378 |
RBR |
denotes |
less |
| T10592 |
49379-49385 |
JJ |
denotes |
active |
| T10593 |
49386-49388 |
IN |
denotes |
in |
| T10594 |
49389-49392 |
DT |
denotes |
the |
| T10595 |
49393-49396 |
NN |
denotes |
ORS |
| T10596 |
49397-49401 |
IN |
denotes |
than |
| T10597 |
49402-49411 |
NN |
denotes |
epidermis |
| T10598 |
49412-49415 |
CC |
denotes |
and |
| T10599 |
49416-49421 |
RB |
denotes |
hence |
| T10601 |
49422-49426 |
DT |
denotes |
this |
| T10602 |
49427-49432 |
MD |
denotes |
might |
| T10603 |
49433-49437 |
RB |
denotes |
also |
| T10600 |
49438-49445 |
VB |
denotes |
account |
| T10604 |
49446-49449 |
IN |
denotes |
for |
| T10605 |
49450-49453 |
DT |
denotes |
the |
| T10606 |
49454-49458 |
NN |
denotes |
lack |
| T10607 |
49459-49461 |
IN |
denotes |
of |
| T10608 |
49462-49470 |
JJ |
denotes |
apparent |
| T10609 |
49471-49479 |
NN |
denotes |
response |
| T10610 |
49480-49482 |
IN |
denotes |
of |
| T10611 |
49483-49486 |
DT |
denotes |
the |
| T10612 |
49487-49490 |
NN |
denotes |
ORS |
| T10613 |
49491-49493 |
IN |
denotes |
to |
| T10614 |
49494-49501 |
JJ |
denotes |
ectopic |
| T10615 |
49502-49507 |
NN |
denotes |
Snail |
| T10616 |
49507-49508 |
. |
denotes |
. |
| T10617 |
49508-49759 |
sentence |
denotes |
Additional contributing factors could be the multiplicity of Snail family members and their differential expression, the saturation, and/or diversity of regulatory mechanisms that govern AJ formation, migration, and proliferation in the follicle ORS. |
| T10618 |
49509-49519 |
JJ |
denotes |
Additional |
| T10620 |
49520-49532 |
VBG |
denotes |
contributing |
| T10619 |
49533-49540 |
NNS |
denotes |
factors |
| T10622 |
49541-49546 |
MD |
denotes |
could |
| T10621 |
49547-49549 |
VB |
denotes |
be |
| T10623 |
49550-49553 |
DT |
denotes |
the |
| T10624 |
49554-49566 |
NN |
denotes |
multiplicity |
| T10625 |
49567-49569 |
IN |
denotes |
of |
| T10626 |
49570-49575 |
NN |
denotes |
Snail |
| T10628 |
49576-49582 |
NN |
denotes |
family |
| T10627 |
49583-49590 |
NNS |
denotes |
members |
| T10629 |
49591-49594 |
CC |
denotes |
and |
| T10630 |
49595-49600 |
PRP$ |
denotes |
their |
| T10632 |
49601-49613 |
JJ |
denotes |
differential |
| T10631 |
49614-49624 |
NN |
denotes |
expression |
| T10633 |
49624-49626 |
, |
denotes |
, |
| T10634 |
49626-49629 |
DT |
denotes |
the |
| T10635 |
49630-49640 |
NN |
denotes |
saturation |
| T10636 |
49640-49642 |
, |
denotes |
, |
| T10637 |
49642-49645 |
CC |
denotes |
and |
| T10638 |
49645-49646 |
HYPH |
denotes |
/ |
| T10639 |
49646-49648 |
CC |
denotes |
or |
| T10640 |
49649-49658 |
NN |
denotes |
diversity |
| T10641 |
49659-49661 |
IN |
denotes |
of |
| T10642 |
49662-49672 |
JJ |
denotes |
regulatory |
| T10643 |
49673-49683 |
NNS |
denotes |
mechanisms |
| T10644 |
49684-49688 |
WDT |
denotes |
that |
| T10645 |
49689-49695 |
VBP |
denotes |
govern |
| T10646 |
49696-49698 |
NN |
denotes |
AJ |
| T10647 |
49699-49708 |
NN |
denotes |
formation |
| T10648 |
49708-49710 |
, |
denotes |
, |
| T10649 |
49710-49719 |
NN |
denotes |
migration |
| T10650 |
49719-49721 |
, |
denotes |
, |
| T10651 |
49721-49724 |
CC |
denotes |
and |
| T10652 |
49725-49738 |
NN |
denotes |
proliferation |
| T10653 |
49739-49741 |
IN |
denotes |
in |
| T10654 |
49742-49745 |
DT |
denotes |
the |
| T10656 |
49746-49754 |
NN |
denotes |
follicle |
| T10655 |
49755-49758 |
NN |
denotes |
ORS |
| T10657 |
49758-49759 |
. |
denotes |
. |
| T10658 |
49759-49894 |
sentence |
denotes |
Distinguishing between these possibilities must await the generation of mice harboring skin-specific loss-of-function Snail mutations. |
| T10659 |
49760-49774 |
VBG |
denotes |
Distinguishing |
| T10661 |
49775-49782 |
IN |
denotes |
between |
| T10662 |
49783-49788 |
DT |
denotes |
these |
| T10663 |
49789-49802 |
NNS |
denotes |
possibilities |
| T10664 |
49803-49807 |
MD |
denotes |
must |
| T10660 |
49808-49813 |
VB |
denotes |
await |
| T10665 |
49814-49817 |
DT |
denotes |
the |
| T10666 |
49818-49828 |
NN |
denotes |
generation |
| T10667 |
49829-49831 |
IN |
denotes |
of |
| T10668 |
49832-49836 |
NNS |
denotes |
mice |
| T10669 |
49837-49846 |
VBG |
denotes |
harboring |
| T10670 |
49847-49851 |
NN |
denotes |
skin |
| T10672 |
49851-49852 |
HYPH |
denotes |
- |
| T10671 |
49852-49860 |
JJ |
denotes |
specific |
| T10674 |
49861-49865 |
NN |
denotes |
loss |
| T10675 |
49865-49866 |
HYPH |
denotes |
- |
| T10676 |
49866-49868 |
IN |
denotes |
of |
| T10677 |
49868-49869 |
HYPH |
denotes |
- |
| T10678 |
49869-49877 |
NN |
denotes |
function |
| T10679 |
49878-49883 |
NN |
denotes |
Snail |
| T10673 |
49884-49893 |
NNS |
denotes |
mutations |
| T10680 |
49893-49894 |
. |
denotes |
. |
| T11057 |
49896-49901 |
NNS |
denotes |
Links |
| T11058 |
49902-49909 |
IN |
denotes |
between |
| T11059 |
49910-49919 |
NN |
denotes |
Signaling |
| T11060 |
49919-49921 |
, |
denotes |
, |
| T11061 |
49921-49936 |
JJ |
denotes |
Transcriptional |
| T11062 |
49937-49945 |
NNS |
denotes |
Cascades |
| T11063 |
49945-49947 |
, |
denotes |
, |
| T11064 |
49947-49957 |
JJ |
denotes |
Epithelial |
| T11065 |
49958-49968 |
NN |
denotes |
Remodeling |
| T11066 |
49968-49970 |
, |
denotes |
, |
| T11067 |
49970-49973 |
CC |
denotes |
and |
| T11068 |
49974-49987 |
NN |
denotes |
Proliferation |
| T11069 |
49988-49990 |
IN |
denotes |
in |
| T11070 |
49991-49994 |
DT |
denotes |
the |
| T11072 |
49995-49999 |
NN |
denotes |
Hair |
| T11071 |
50000-50003 |
NN |
denotes |
Bud |
| T11073 |
50003-50200 |
sentence |
denotes |
Previously, we discovered that early during hair follicle morphogenesis, E-cadherin gene expression is down-regulated concomitantly with the invagination of developing bud cells into the skin [4]. |
| T11074 |
50004-50014 |
RB |
denotes |
Previously |
| T11076 |
50014-50016 |
, |
denotes |
, |
| T11077 |
50016-50018 |
PRP |
denotes |
we |
| T11075 |
50019-50029 |
VBD |
denotes |
discovered |
| T11078 |
50030-50034 |
IN |
denotes |
that |
| T11080 |
50035-50040 |
RB |
denotes |
early |
| T11081 |
50041-50047 |
IN |
denotes |
during |
| T11082 |
50048-50052 |
NN |
denotes |
hair |
| T11083 |
50053-50061 |
NN |
denotes |
follicle |
| T11084 |
50062-50075 |
NN |
denotes |
morphogenesis |
| T11085 |
50075-50077 |
, |
denotes |
, |
| T11086 |
50077-50078 |
NN |
denotes |
E |
| T11088 |
50078-50079 |
HYPH |
denotes |
- |
| T11087 |
50079-50087 |
NN |
denotes |
cadherin |
| T11090 |
50088-50092 |
NN |
denotes |
gene |
| T11089 |
50093-50103 |
NN |
denotes |
expression |
| T11091 |
50104-50106 |
VBZ |
denotes |
is |
| T11092 |
50107-50111 |
RB |
denotes |
down |
| T11093 |
50111-50112 |
HYPH |
denotes |
- |
| T11079 |
50112-50121 |
VBN |
denotes |
regulated |
| T11094 |
50122-50135 |
RB |
denotes |
concomitantly |
| T11095 |
50136-50140 |
IN |
denotes |
with |
| T11096 |
50141-50144 |
DT |
denotes |
the |
| T11097 |
50145-50157 |
NN |
denotes |
invagination |
| T11098 |
50158-50160 |
IN |
denotes |
of |
| T11099 |
50161-50171 |
JJ |
denotes |
developing |
| T11101 |
50172-50175 |
NN |
denotes |
bud |
| T11100 |
50176-50181 |
NNS |
denotes |
cells |
| T11102 |
50182-50186 |
IN |
denotes |
into |
| T11103 |
50187-50190 |
DT |
denotes |
the |
| T11104 |
50191-50195 |
NN |
denotes |
skin |
| T11105 |
50196-50197 |
-LRB- |
denotes |
[ |
| T11106 |
50197-50198 |
CD |
denotes |
4 |
| T11107 |
50198-50199 |
-RRB- |
denotes |
] |
| T11108 |
50199-50200 |
. |
denotes |
. |
| T11109 |
50200-50419 |
sentence |
denotes |
Because the timing of this event correlated with the activation of a LEF-1/β-catenin transcription factor complex [20], we were intrigued by the presence of a putative LEF-1/TCF binding site in the E-cadherin promoter. |
| T11110 |
50201-50208 |
IN |
denotes |
Because |
| T11112 |
50209-50212 |
DT |
denotes |
the |
| T11113 |
50213-50219 |
NN |
denotes |
timing |
| T11114 |
50220-50222 |
IN |
denotes |
of |
| T11115 |
50223-50227 |
DT |
denotes |
this |
| T11116 |
50228-50233 |
NN |
denotes |
event |
| T11111 |
50234-50244 |
VBD |
denotes |
correlated |
| T11118 |
50245-50249 |
IN |
denotes |
with |
| T11119 |
50250-50253 |
DT |
denotes |
the |
| T11120 |
50254-50264 |
NN |
denotes |
activation |
| T11121 |
50265-50267 |
IN |
denotes |
of |
| T11122 |
50268-50269 |
DT |
denotes |
a |
| T11124 |
50270-50273 |
NN |
denotes |
LEF |
| T11126 |
50273-50274 |
HYPH |
denotes |
- |
| T11127 |
50274-50275 |
CD |
denotes |
1 |
| T11128 |
50275-50276 |
HYPH |
denotes |
/ |
| T11129 |
50276-50277 |
NN |
denotes |
β |
| T11131 |
50277-50278 |
HYPH |
denotes |
- |
| T11130 |
50278-50285 |
NN |
denotes |
catenin |
| T11132 |
50286-50299 |
NN |
denotes |
transcription |
| T11125 |
50300-50306 |
NN |
denotes |
factor |
| T11123 |
50307-50314 |
NN |
denotes |
complex |
| T11133 |
50315-50316 |
-LRB- |
denotes |
[ |
| T11134 |
50316-50318 |
CD |
denotes |
20 |
| T11135 |
50318-50319 |
-RRB- |
denotes |
] |
| T11136 |
50319-50321 |
, |
denotes |
, |
| T11137 |
50321-50323 |
PRP |
denotes |
we |
| T11138 |
50324-50328 |
VBD |
denotes |
were |
| T11117 |
50329-50338 |
VBN |
denotes |
intrigued |
| T11139 |
50339-50341 |
IN |
denotes |
by |
| T11140 |
50342-50345 |
DT |
denotes |
the |
| T11141 |
50346-50354 |
NN |
denotes |
presence |
| T11142 |
50355-50357 |
IN |
denotes |
of |
| T11143 |
50358-50359 |
DT |
denotes |
a |
| T11145 |
50360-50368 |
JJ |
denotes |
putative |
| T11146 |
50369-50372 |
NN |
denotes |
LEF |
| T11147 |
50372-50373 |
HYPH |
denotes |
- |
| T11148 |
50373-50374 |
CD |
denotes |
1 |
| T11149 |
50374-50375 |
HYPH |
denotes |
/ |
| T11150 |
50375-50378 |
NN |
denotes |
TCF |
| T11151 |
50379-50386 |
NN |
denotes |
binding |
| T11144 |
50387-50391 |
NN |
denotes |
site |
| T11152 |
50392-50394 |
IN |
denotes |
in |
| T11153 |
50395-50398 |
DT |
denotes |
the |
| T11155 |
50399-50400 |
NN |
denotes |
E |
| T11157 |
50400-50401 |
HYPH |
denotes |
- |
| T11156 |
50401-50409 |
NN |
denotes |
cadherin |
| T11154 |
50410-50418 |
NN |
denotes |
promoter |
| T11158 |
50418-50419 |
. |
denotes |
. |
| T11159 |
50419-50596 |
sentence |
denotes |
This prompted an investigation that subsequently led to our discovery that LEF-1/β-catenin can contribute to repression of E-cadherin gene expression in skin keratinocytes [4]. |
| T11160 |
50420-50424 |
DT |
denotes |
This |
| T11161 |
50425-50433 |
VBD |
denotes |
prompted |
| T11162 |
50434-50436 |
DT |
denotes |
an |
| T11163 |
50437-50450 |
NN |
denotes |
investigation |
| T11164 |
50451-50455 |
WDT |
denotes |
that |
| T11166 |
50456-50468 |
RB |
denotes |
subsequently |
| T11165 |
50469-50472 |
VBD |
denotes |
led |
| T11167 |
50473-50475 |
IN |
denotes |
to |
| T11168 |
50476-50479 |
PRP$ |
denotes |
our |
| T11169 |
50480-50489 |
NN |
denotes |
discovery |
| T11170 |
50490-50494 |
IN |
denotes |
that |
| T11172 |
50495-50498 |
NN |
denotes |
LEF |
| T11173 |
50498-50499 |
HYPH |
denotes |
- |
| T11174 |
50499-50500 |
CD |
denotes |
1 |
| T11175 |
50500-50501 |
HYPH |
denotes |
/ |
| T11176 |
50501-50502 |
NN |
denotes |
β |
| T11178 |
50502-50503 |
HYPH |
denotes |
- |
| T11177 |
50503-50510 |
NN |
denotes |
catenin |
| T11179 |
50511-50514 |
MD |
denotes |
can |
| T11171 |
50515-50525 |
VB |
denotes |
contribute |
| T11180 |
50526-50528 |
IN |
denotes |
to |
| T11181 |
50529-50539 |
NN |
denotes |
repression |
| T11182 |
50540-50542 |
IN |
denotes |
of |
| T11183 |
50543-50544 |
NN |
denotes |
E |
| T11185 |
50544-50545 |
HYPH |
denotes |
- |
| T11184 |
50545-50553 |
NN |
denotes |
cadherin |
| T11187 |
50554-50558 |
NN |
denotes |
gene |
| T11186 |
50559-50569 |
NN |
denotes |
expression |
| T11188 |
50570-50572 |
IN |
denotes |
in |
| T11189 |
50573-50577 |
NN |
denotes |
skin |
| T11190 |
50578-50591 |
NNS |
denotes |
keratinocytes |
| T11191 |
50592-50593 |
-LRB- |
denotes |
[ |
| T11192 |
50593-50594 |
CD |
denotes |
4 |
| T11193 |
50594-50595 |
-RRB- |
denotes |
] |
| T11194 |
50595-50596 |
. |
denotes |
. |
| T11195 |
50596-50848 |
sentence |
denotes |
In the course of these studies, we also noted that Snail can also contribute to this process in keratinocytes in vitro, and our present studies revealed that Snail is expressed at the right place and time to be physiologically relevant in the process. |
| T11196 |
50597-50599 |
IN |
denotes |
In |
| T11198 |
50600-50603 |
DT |
denotes |
the |
| T11199 |
50604-50610 |
NN |
denotes |
course |
| T11200 |
50611-50613 |
IN |
denotes |
of |
| T11201 |
50614-50619 |
DT |
denotes |
these |
| T11202 |
50620-50627 |
NNS |
denotes |
studies |
| T11203 |
50627-50629 |
, |
denotes |
, |
| T11204 |
50629-50631 |
PRP |
denotes |
we |
| T11205 |
50632-50636 |
RB |
denotes |
also |
| T11197 |
50637-50642 |
VBD |
denotes |
noted |
| T11206 |
50643-50647 |
IN |
denotes |
that |
| T11208 |
50648-50653 |
NN |
denotes |
Snail |
| T11209 |
50654-50657 |
MD |
denotes |
can |
| T11210 |
50658-50662 |
RB |
denotes |
also |
| T11207 |
50663-50673 |
VB |
denotes |
contribute |
| T11211 |
50674-50676 |
IN |
denotes |
to |
| T11212 |
50677-50681 |
DT |
denotes |
this |
| T11213 |
50682-50689 |
NN |
denotes |
process |
| T11214 |
50690-50692 |
IN |
denotes |
in |
| T11215 |
50693-50706 |
NNS |
denotes |
keratinocytes |
| T11216 |
50707-50709 |
FW |
denotes |
in |
| T11217 |
50710-50715 |
FW |
denotes |
vitro |
| T11218 |
50715-50717 |
, |
denotes |
, |
| T11219 |
50717-50720 |
CC |
denotes |
and |
| T11220 |
50721-50724 |
PRP$ |
denotes |
our |
| T11222 |
50725-50732 |
JJ |
denotes |
present |
| T11221 |
50733-50740 |
NNS |
denotes |
studies |
| T11223 |
50741-50749 |
VBD |
denotes |
revealed |
| T11224 |
50750-50754 |
IN |
denotes |
that |
| T11226 |
50755-50760 |
NN |
denotes |
Snail |
| T11227 |
50761-50763 |
VBZ |
denotes |
is |
| T11225 |
50764-50773 |
VBN |
denotes |
expressed |
| T11228 |
50774-50776 |
IN |
denotes |
at |
| T11229 |
50777-50780 |
DT |
denotes |
the |
| T11231 |
50781-50786 |
JJ |
denotes |
right |
| T11230 |
50787-50792 |
NN |
denotes |
place |
| T11232 |
50793-50796 |
CC |
denotes |
and |
| T11233 |
50797-50801 |
NN |
denotes |
time |
| T11234 |
50802-50804 |
TO |
denotes |
to |
| T11235 |
50805-50807 |
VB |
denotes |
be |
| T11236 |
50808-50823 |
RB |
denotes |
physiologically |
| T11237 |
50824-50832 |
JJ |
denotes |
relevant |
| T11238 |
50833-50835 |
IN |
denotes |
in |
| T11239 |
50836-50839 |
DT |
denotes |
the |
| T11240 |
50840-50847 |
NN |
denotes |
process |
| T11241 |
50847-50848 |
. |
denotes |
. |
| T11242 |
50848-51000 |
sentence |
denotes |
In noggin-null embryonic skin, LEF-1 expression and subsequent activation of the LEF-1/β-catenin reporter gene is abrogated in the developing placodes. |
| T11243 |
50849-50851 |
IN |
denotes |
In |
| T11245 |
50852-50858 |
NN |
denotes |
noggin |
| T11247 |
50858-50859 |
HYPH |
denotes |
- |
| T11246 |
50859-50863 |
JJ |
denotes |
null |
| T11249 |
50864-50873 |
JJ |
denotes |
embryonic |
| T11248 |
50874-50878 |
NN |
denotes |
skin |
| T11250 |
50878-50880 |
, |
denotes |
, |
| T11251 |
50880-50883 |
NN |
denotes |
LEF |
| T11253 |
50883-50884 |
HYPH |
denotes |
- |
| T11254 |
50884-50885 |
CD |
denotes |
1 |
| T11252 |
50886-50896 |
NN |
denotes |
expression |
| T11255 |
50897-50900 |
CC |
denotes |
and |
| T11256 |
50901-50911 |
JJ |
denotes |
subsequent |
| T11257 |
50912-50922 |
NN |
denotes |
activation |
| T11258 |
50923-50925 |
IN |
denotes |
of |
| T11259 |
50926-50929 |
DT |
denotes |
the |
| T11261 |
50930-50933 |
NN |
denotes |
LEF |
| T11262 |
50933-50934 |
HYPH |
denotes |
- |
| T11263 |
50934-50935 |
CD |
denotes |
1 |
| T11264 |
50935-50936 |
HYPH |
denotes |
/ |
| T11265 |
50936-50937 |
NN |
denotes |
β |
| T11267 |
50937-50938 |
HYPH |
denotes |
- |
| T11266 |
50938-50945 |
NN |
denotes |
catenin |
| T11268 |
50946-50954 |
NN |
denotes |
reporter |
| T11260 |
50955-50959 |
NN |
denotes |
gene |
| T11269 |
50960-50962 |
VBZ |
denotes |
is |
| T11244 |
50963-50972 |
VBN |
denotes |
abrogated |
| T11270 |
50973-50975 |
IN |
denotes |
in |
| T11271 |
50976-50979 |
DT |
denotes |
the |
| T11273 |
50980-50990 |
VBG |
denotes |
developing |
| T11272 |
50991-50999 |
NNS |
denotes |
placodes |
| T11274 |
50999-51000 |
. |
denotes |
. |
| T11275 |
51000-51163 |
sentence |
denotes |
The corresponding failure of E-cadherin down-regulation underscores the importance of Wnt/noggin signaling in regulating this event in follicle morphogenesis [4]. |
| T11276 |
51001-51004 |
DT |
denotes |
The |
| T11278 |
51005-51018 |
VBG |
denotes |
corresponding |
| T11277 |
51019-51026 |
NN |
denotes |
failure |
| T11280 |
51027-51029 |
IN |
denotes |
of |
| T11281 |
51030-51031 |
NN |
denotes |
E |
| T11283 |
51031-51032 |
HYPH |
denotes |
- |
| T11282 |
51032-51040 |
NN |
denotes |
cadherin |
| T11285 |
51041-51045 |
JJ |
denotes |
down |
| T11286 |
51045-51046 |
HYPH |
denotes |
- |
| T11284 |
51046-51056 |
NN |
denotes |
regulation |
| T11279 |
51057-51068 |
VBZ |
denotes |
underscores |
| T11287 |
51069-51072 |
DT |
denotes |
the |
| T11288 |
51073-51083 |
NN |
denotes |
importance |
| T11289 |
51084-51086 |
IN |
denotes |
of |
| T11290 |
51087-51090 |
NN |
denotes |
Wnt |
| T11292 |
51090-51091 |
HYPH |
denotes |
/ |
| T11291 |
51091-51097 |
NN |
denotes |
noggin |
| T11293 |
51098-51107 |
NN |
denotes |
signaling |
| T11294 |
51108-51110 |
IN |
denotes |
in |
| T11295 |
51111-51121 |
VBG |
denotes |
regulating |
| T11296 |
51122-51126 |
DT |
denotes |
this |
| T11297 |
51127-51132 |
NN |
denotes |
event |
| T11298 |
51133-51135 |
IN |
denotes |
in |
| T11299 |
51136-51144 |
NN |
denotes |
follicle |
| T11300 |
51145-51158 |
NN |
denotes |
morphogenesis |
| T11301 |
51159-51160 |
-LRB- |
denotes |
[ |
| T11302 |
51160-51161 |
CD |
denotes |
4 |
| T11303 |
51161-51162 |
-RRB- |
denotes |
] |
| T11304 |
51162-51163 |
. |
denotes |
. |
| T11305 |
51163-51366 |
sentence |
denotes |
Conditional gene targeting studies will be necessary to establish whether Snail family members also contribute to the down-regulation in E-cadherin gene expression that occurs during follicle formation. |
| T11306 |
51164-51175 |
JJ |
denotes |
Conditional |
| T11308 |
51176-51180 |
NN |
denotes |
gene |
| T11309 |
51181-51190 |
NN |
denotes |
targeting |
| T11307 |
51191-51198 |
NNS |
denotes |
studies |
| T11311 |
51199-51203 |
MD |
denotes |
will |
| T11310 |
51204-51206 |
VB |
denotes |
be |
| T11312 |
51207-51216 |
JJ |
denotes |
necessary |
| T11313 |
51217-51219 |
TO |
denotes |
to |
| T11314 |
51220-51229 |
VB |
denotes |
establish |
| T11315 |
51230-51237 |
IN |
denotes |
whether |
| T11317 |
51238-51243 |
NN |
denotes |
Snail |
| T11319 |
51244-51250 |
NN |
denotes |
family |
| T11318 |
51251-51258 |
NNS |
denotes |
members |
| T11320 |
51259-51263 |
RB |
denotes |
also |
| T11316 |
51264-51274 |
VBP |
denotes |
contribute |
| T11321 |
51275-51277 |
IN |
denotes |
to |
| T11322 |
51278-51281 |
DT |
denotes |
the |
| T11324 |
51282-51286 |
JJ |
denotes |
down |
| T11325 |
51286-51287 |
HYPH |
denotes |
- |
| T11323 |
51287-51297 |
NN |
denotes |
regulation |
| T11326 |
51298-51300 |
IN |
denotes |
in |
| T11327 |
51301-51302 |
NN |
denotes |
E |
| T11329 |
51302-51303 |
HYPH |
denotes |
- |
| T11328 |
51303-51311 |
NN |
denotes |
cadherin |
| T11331 |
51312-51316 |
NN |
denotes |
gene |
| T11330 |
51317-51327 |
NN |
denotes |
expression |
| T11332 |
51328-51332 |
WDT |
denotes |
that |
| T11333 |
51333-51339 |
VBZ |
denotes |
occurs |
| T11334 |
51340-51346 |
IN |
denotes |
during |
| T11335 |
51347-51355 |
NN |
denotes |
follicle |
| T11336 |
51356-51365 |
NN |
denotes |
formation |
| T11337 |
51365-51366 |
. |
denotes |
. |
| T11338 |
51366-51535 |
sentence |
denotes |
However, it is intriguing that K14-Snail Tg epidermis displayed a marked down-regulation in E-cadherin expression, thereby demonstrating its potential to do so in skin. |
| T11339 |
51367-51374 |
RB |
denotes |
However |
| T11341 |
51374-51376 |
, |
denotes |
, |
| T11342 |
51376-51378 |
PRP |
denotes |
it |
| T11340 |
51379-51381 |
VBZ |
denotes |
is |
| T11343 |
51382-51392 |
VBG |
denotes |
intriguing |
| T11344 |
51393-51397 |
IN |
denotes |
that |
| T11346 |
51398-51401 |
NN |
denotes |
K14 |
| T11348 |
51401-51402 |
HYPH |
denotes |
- |
| T11347 |
51402-51407 |
NN |
denotes |
Snail |
| T11350 |
51408-51410 |
NN |
denotes |
Tg |
| T11349 |
51411-51420 |
NN |
denotes |
epidermis |
| T11345 |
51421-51430 |
VBD |
denotes |
displayed |
| T11351 |
51431-51432 |
DT |
denotes |
a |
| T11353 |
51433-51439 |
JJ |
denotes |
marked |
| T11354 |
51440-51444 |
JJ |
denotes |
down |
| T11355 |
51444-51445 |
HYPH |
denotes |
- |
| T11352 |
51445-51455 |
NN |
denotes |
regulation |
| T11356 |
51456-51458 |
IN |
denotes |
in |
| T11357 |
51459-51460 |
NN |
denotes |
E |
| T11359 |
51460-51461 |
HYPH |
denotes |
- |
| T11358 |
51461-51469 |
NN |
denotes |
cadherin |
| T11360 |
51470-51480 |
NN |
denotes |
expression |
| T11361 |
51480-51482 |
, |
denotes |
, |
| T11362 |
51482-51489 |
RB |
denotes |
thereby |
| T11363 |
51490-51503 |
VBG |
denotes |
demonstrating |
| T11364 |
51504-51507 |
PRP$ |
denotes |
its |
| T11365 |
51508-51517 |
NN |
denotes |
potential |
| T11366 |
51518-51520 |
TO |
denotes |
to |
| T11367 |
51521-51523 |
VB |
denotes |
do |
| T11368 |
51524-51526 |
RB |
denotes |
so |
| T11369 |
51527-51529 |
IN |
denotes |
in |
| T11370 |
51530-51534 |
NN |
denotes |
skin |
| T11371 |
51534-51535 |
. |
denotes |
. |
| T11372 |
51535-51688 |
sentence |
denotes |
Our prior findings showed that by elevating E-cadherin levels or by conditionally ablating α-catenin, hair follicle morphogenesis can be impaired [4,7]. |
| T11373 |
51536-51539 |
PRP$ |
denotes |
Our |
| T11375 |
51540-51545 |
JJ |
denotes |
prior |
| T11374 |
51546-51554 |
NNS |
denotes |
findings |
| T11376 |
51555-51561 |
VBD |
denotes |
showed |
| T11377 |
51562-51566 |
IN |
denotes |
that |
| T11379 |
51567-51569 |
IN |
denotes |
by |
| T11380 |
51570-51579 |
VBG |
denotes |
elevating |
| T11381 |
51580-51581 |
NN |
denotes |
E |
| T11383 |
51581-51582 |
HYPH |
denotes |
- |
| T11382 |
51582-51590 |
NN |
denotes |
cadherin |
| T11384 |
51591-51597 |
NNS |
denotes |
levels |
| T11385 |
51598-51600 |
CC |
denotes |
or |
| T11386 |
51601-51603 |
IN |
denotes |
by |
| T11387 |
51604-51617 |
RB |
denotes |
conditionally |
| T11388 |
51618-51626 |
VBG |
denotes |
ablating |
| T11389 |
51627-51628 |
NN |
denotes |
α |
| T11391 |
51628-51629 |
HYPH |
denotes |
- |
| T11390 |
51629-51636 |
NN |
denotes |
catenin |
| T11392 |
51636-51638 |
, |
denotes |
, |
| T11393 |
51638-51642 |
NN |
denotes |
hair |
| T11394 |
51643-51651 |
NN |
denotes |
follicle |
| T11395 |
51652-51665 |
NN |
denotes |
morphogenesis |
| T11396 |
51666-51669 |
MD |
denotes |
can |
| T11397 |
51670-51672 |
VB |
denotes |
be |
| T11378 |
51673-51681 |
VBN |
denotes |
impaired |
| T11398 |
51682-51683 |
-LRB- |
denotes |
[ |
| T11400 |
51683-51684 |
CD |
denotes |
4 |
| T11401 |
51684-51685 |
, |
denotes |
, |
| T11399 |
51685-51686 |
CD |
denotes |
7 |
| T11402 |
51686-51687 |
-RRB- |
denotes |
] |
| T11403 |
51687-51688 |
. |
denotes |
. |
| T11404 |
51688-52018 |
sentence |
denotes |
The marked epidermal hyperproliferation seen in the K14-Snail Tg skin, coupled with the converse suppression of proliferation and Snail in TGF-β2-null hair buds led us to wonder whether the down-regulation of E-cadherin during follicle morphogenesis might have a direct impact on elevating the proliferative state of these cells. |
| T11405 |
51689-51692 |
DT |
denotes |
The |
| T11407 |
51693-51699 |
JJ |
denotes |
marked |
| T11408 |
51700-51709 |
JJ |
denotes |
epidermal |
| T11406 |
51710-51728 |
NN |
denotes |
hyperproliferation |
| T11410 |
51729-51733 |
VBN |
denotes |
seen |
| T11411 |
51734-51736 |
IN |
denotes |
in |
| T11412 |
51737-51740 |
DT |
denotes |
the |
| T11414 |
51741-51744 |
NN |
denotes |
K14 |
| T11416 |
51744-51745 |
HYPH |
denotes |
- |
| T11415 |
51745-51750 |
NN |
denotes |
Snail |
| T11417 |
51751-51753 |
NN |
denotes |
Tg |
| T11413 |
51754-51758 |
NN |
denotes |
skin |
| T11418 |
51758-51760 |
, |
denotes |
, |
| T11419 |
51760-51767 |
VBN |
denotes |
coupled |
| T11420 |
51768-51772 |
IN |
denotes |
with |
| T11421 |
51773-51776 |
DT |
denotes |
the |
| T11423 |
51777-51785 |
JJ |
denotes |
converse |
| T11422 |
51786-51797 |
NN |
denotes |
suppression |
| T11424 |
51798-51800 |
IN |
denotes |
of |
| T11425 |
51801-51814 |
NN |
denotes |
proliferation |
| T11426 |
51815-51818 |
CC |
denotes |
and |
| T11427 |
51819-51824 |
NN |
denotes |
Snail |
| T11428 |
51825-51827 |
IN |
denotes |
in |
| T11429 |
51828-51831 |
NN |
denotes |
TGF |
| T11431 |
51831-51832 |
HYPH |
denotes |
- |
| T11430 |
51832-51834 |
NN |
denotes |
β2 |
| T11433 |
51834-51835 |
HYPH |
denotes |
- |
| T11432 |
51835-51839 |
JJ |
denotes |
null |
| T11435 |
51840-51844 |
NN |
denotes |
hair |
| T11434 |
51845-51849 |
NNS |
denotes |
buds |
| T11409 |
51850-51853 |
VBD |
denotes |
led |
| T11436 |
51854-51856 |
PRP |
denotes |
us |
| T11437 |
51857-51859 |
TO |
denotes |
to |
| T11438 |
51860-51866 |
VB |
denotes |
wonder |
| T11439 |
51867-51874 |
IN |
denotes |
whether |
| T11441 |
51875-51878 |
DT |
denotes |
the |
| T11443 |
51879-51883 |
JJ |
denotes |
down |
| T11444 |
51883-51884 |
HYPH |
denotes |
- |
| T11442 |
51884-51894 |
NN |
denotes |
regulation |
| T11445 |
51895-51897 |
IN |
denotes |
of |
| T11446 |
51898-51899 |
NN |
denotes |
E |
| T11448 |
51899-51900 |
HYPH |
denotes |
- |
| T11447 |
51900-51908 |
NN |
denotes |
cadherin |
| T11449 |
51909-51915 |
IN |
denotes |
during |
| T11450 |
51916-51924 |
NN |
denotes |
follicle |
| T11451 |
51925-51938 |
NN |
denotes |
morphogenesis |
| T11452 |
51939-51944 |
MD |
denotes |
might |
| T11440 |
51945-51949 |
VB |
denotes |
have |
| T11453 |
51950-51951 |
DT |
denotes |
a |
| T11455 |
51952-51958 |
JJ |
denotes |
direct |
| T11454 |
51959-51965 |
NN |
denotes |
impact |
| T11456 |
51966-51968 |
IN |
denotes |
on |
| T11457 |
51969-51978 |
VBG |
denotes |
elevating |
| T11458 |
51979-51982 |
DT |
denotes |
the |
| T11460 |
51983-51996 |
JJ |
denotes |
proliferative |
| T11459 |
51997-52002 |
NN |
denotes |
state |
| T11461 |
52003-52005 |
IN |
denotes |
of |
| T11462 |
52006-52011 |
DT |
denotes |
these |
| T11463 |
52012-52017 |
NNS |
denotes |
cells |
| T11464 |
52017-52018 |
. |
denotes |
. |
| T11465 |
52018-52200 |
sentence |
denotes |
Our Tg studies suggested that, at least in part through its regulation of E-cadherin, Snail is able to influence the subcellular localization of a variety of AJ-associated proteins. |
| T11466 |
52019-52022 |
PRP$ |
denotes |
Our |
| T11468 |
52023-52025 |
NN |
denotes |
Tg |
| T11467 |
52026-52033 |
NNS |
denotes |
studies |
| T11469 |
52034-52043 |
VBD |
denotes |
suggested |
| T11470 |
52044-52048 |
IN |
denotes |
that |
| T11472 |
52048-52050 |
, |
denotes |
, |
| T11473 |
52050-52052 |
RB |
denotes |
at |
| T11474 |
52053-52058 |
RBS |
denotes |
least |
| T11475 |
52059-52061 |
IN |
denotes |
in |
| T11477 |
52062-52066 |
NN |
denotes |
part |
| T11476 |
52067-52074 |
IN |
denotes |
through |
| T11478 |
52075-52078 |
PRP$ |
denotes |
its |
| T11479 |
52079-52089 |
NN |
denotes |
regulation |
| T11480 |
52090-52092 |
IN |
denotes |
of |
| T11481 |
52093-52094 |
NN |
denotes |
E |
| T11483 |
52094-52095 |
HYPH |
denotes |
- |
| T11482 |
52095-52103 |
NN |
denotes |
cadherin |
| T11484 |
52103-52105 |
, |
denotes |
, |
| T11485 |
52105-52110 |
NN |
denotes |
Snail |
| T11471 |
52111-52113 |
VBZ |
denotes |
is |
| T11486 |
52114-52118 |
JJ |
denotes |
able |
| T11487 |
52119-52121 |
TO |
denotes |
to |
| T11488 |
52122-52131 |
VB |
denotes |
influence |
| T11489 |
52132-52135 |
DT |
denotes |
the |
| T11491 |
52136-52147 |
JJ |
denotes |
subcellular |
| T11490 |
52148-52160 |
NN |
denotes |
localization |
| T11492 |
52161-52163 |
IN |
denotes |
of |
| T11493 |
52164-52165 |
DT |
denotes |
a |
| T11494 |
52166-52173 |
NN |
denotes |
variety |
| T11495 |
52174-52176 |
IN |
denotes |
of |
| T11496 |
52177-52179 |
NN |
denotes |
AJ |
| T11498 |
52179-52180 |
HYPH |
denotes |
- |
| T11497 |
52180-52190 |
VBN |
denotes |
associated |
| T11499 |
52191-52199 |
NN |
denotes |
proteins |
| T11500 |
52199-52200 |
. |
denotes |
. |
| T11501 |
52200-52330 |
sentence |
denotes |
One of these appears to be Ajuba, which was previously shown to have the dual capacity to bind Grb-2 as well as α-catenin [9,10]. |
| T11502 |
52201-52204 |
CD |
denotes |
One |
| T11504 |
52205-52207 |
IN |
denotes |
of |
| T11505 |
52208-52213 |
DT |
denotes |
these |
| T11503 |
52214-52221 |
VBZ |
denotes |
appears |
| T11506 |
52222-52224 |
TO |
denotes |
to |
| T11507 |
52225-52227 |
VB |
denotes |
be |
| T11508 |
52228-52233 |
NN |
denotes |
Ajuba |
| T11509 |
52233-52235 |
, |
denotes |
, |
| T11510 |
52235-52240 |
WDT |
denotes |
which |
| T11512 |
52241-52244 |
VBD |
denotes |
was |
| T11513 |
52245-52255 |
RB |
denotes |
previously |
| T11511 |
52256-52261 |
VBN |
denotes |
shown |
| T11514 |
52262-52264 |
TO |
denotes |
to |
| T11515 |
52265-52269 |
VB |
denotes |
have |
| T11516 |
52270-52273 |
DT |
denotes |
the |
| T11518 |
52274-52278 |
JJ |
denotes |
dual |
| T11517 |
52279-52287 |
NN |
denotes |
capacity |
| T11519 |
52288-52290 |
TO |
denotes |
to |
| T11520 |
52291-52295 |
VB |
denotes |
bind |
| T11521 |
52296-52299 |
NN |
denotes |
Grb |
| T11522 |
52299-52300 |
HYPH |
denotes |
- |
| T11523 |
52300-52301 |
CD |
denotes |
2 |
| T11524 |
52302-52304 |
RB |
denotes |
as |
| T11526 |
52305-52309 |
RB |
denotes |
well |
| T11525 |
52310-52312 |
IN |
denotes |
as |
| T11527 |
52313-52314 |
NN |
denotes |
α |
| T11529 |
52314-52315 |
HYPH |
denotes |
- |
| T11528 |
52315-52322 |
NN |
denotes |
catenin |
| T11530 |
52323-52324 |
-LRB- |
denotes |
[ |
| T11532 |
52324-52325 |
CD |
denotes |
9 |
| T11533 |
52325-52326 |
, |
denotes |
, |
| T11531 |
52326-52328 |
CD |
denotes |
10 |
| T11534 |
52328-52329 |
-RRB- |
denotes |
] |
| T11535 |
52329-52330 |
. |
denotes |
. |
| T11536 |
52330-52558 |
sentence |
denotes |
Our studies revealed that in skin keratinocytes that either harbor a conditional null mutation in α-catenin or that overexpress Snail, Ajuba develops an interaction with Grb-2 that is otherwise not observed in WT keratinocytes. |
| T11537 |
52331-52334 |
PRP$ |
denotes |
Our |
| T11538 |
52335-52342 |
NNS |
denotes |
studies |
| T11539 |
52343-52351 |
VBD |
denotes |
revealed |
| T11540 |
52352-52356 |
IN |
denotes |
that |
| T11542 |
52357-52359 |
IN |
denotes |
in |
| T11543 |
52360-52364 |
NN |
denotes |
skin |
| T11544 |
52365-52378 |
NNS |
denotes |
keratinocytes |
| T11545 |
52379-52383 |
WDT |
denotes |
that |
| T11547 |
52384-52390 |
CC |
denotes |
either |
| T11546 |
52391-52397 |
VBP |
denotes |
harbor |
| T11548 |
52398-52399 |
DT |
denotes |
a |
| T11550 |
52400-52411 |
JJ |
denotes |
conditional |
| T11551 |
52412-52416 |
JJ |
denotes |
null |
| T11549 |
52417-52425 |
NN |
denotes |
mutation |
| T11552 |
52426-52428 |
IN |
denotes |
in |
| T11553 |
52429-52430 |
NN |
denotes |
α |
| T11555 |
52430-52431 |
HYPH |
denotes |
- |
| T11554 |
52431-52438 |
NN |
denotes |
catenin |
| T11556 |
52439-52441 |
CC |
denotes |
or |
| T11557 |
52442-52446 |
WDT |
denotes |
that |
| T11558 |
52447-52458 |
VBP |
denotes |
overexpress |
| T11559 |
52459-52464 |
NN |
denotes |
Snail |
| T11560 |
52464-52466 |
, |
denotes |
, |
| T11561 |
52466-52471 |
NN |
denotes |
Ajuba |
| T11541 |
52472-52480 |
VBZ |
denotes |
develops |
| T11562 |
52481-52483 |
DT |
denotes |
an |
| T11563 |
52484-52495 |
NN |
denotes |
interaction |
| T11564 |
52496-52500 |
IN |
denotes |
with |
| T11565 |
52501-52504 |
NN |
denotes |
Grb |
| T11566 |
52504-52505 |
HYPH |
denotes |
- |
| T11567 |
52505-52506 |
CD |
denotes |
2 |
| T11568 |
52507-52511 |
WDT |
denotes |
that |
| T11570 |
52512-52514 |
VBZ |
denotes |
is |
| T11571 |
52515-52524 |
RB |
denotes |
otherwise |
| T11572 |
52525-52528 |
RB |
denotes |
not |
| T11569 |
52529-52537 |
VBN |
denotes |
observed |
| T11573 |
52538-52540 |
IN |
denotes |
in |
| T11574 |
52541-52543 |
NN |
denotes |
WT |
| T11575 |
52544-52557 |
NNS |
denotes |
keratinocytes |
| T11576 |
52557-52558 |
. |
denotes |
. |
| T11577 |
52558-52862 |
sentence |
denotes |
The corresponding abilities of either Snail-transfected or Ajuba-transfected keratinocytes to exhibit elevated activation of the Ras-MAPK pathway suggest that the Grb-2 association of Ajuba under conditions of reduced levels of AJ proteins may be directly relevant to the parallel in hyperproliferation. |
| T11578 |
52559-52562 |
DT |
denotes |
The |
| T11580 |
52563-52576 |
VBG |
denotes |
corresponding |
| T11579 |
52577-52586 |
NNS |
denotes |
abilities |
| T11582 |
52587-52589 |
IN |
denotes |
of |
| T11583 |
52590-52596 |
CC |
denotes |
either |
| T11585 |
52597-52602 |
NN |
denotes |
Snail |
| T11587 |
52602-52603 |
HYPH |
denotes |
- |
| T11586 |
52603-52614 |
VBN |
denotes |
transfected |
| T11588 |
52615-52617 |
CC |
denotes |
or |
| T11589 |
52618-52623 |
NN |
denotes |
Ajuba |
| T11591 |
52623-52624 |
HYPH |
denotes |
- |
| T11590 |
52624-52635 |
VBN |
denotes |
transfected |
| T11584 |
52636-52649 |
NNS |
denotes |
keratinocytes |
| T11592 |
52650-52652 |
TO |
denotes |
to |
| T11593 |
52653-52660 |
VB |
denotes |
exhibit |
| T11594 |
52661-52669 |
JJ |
denotes |
elevated |
| T11595 |
52670-52680 |
NN |
denotes |
activation |
| T11596 |
52681-52683 |
IN |
denotes |
of |
| T11597 |
52684-52687 |
DT |
denotes |
the |
| T11599 |
52688-52691 |
NN |
denotes |
Ras |
| T11601 |
52691-52692 |
HYPH |
denotes |
- |
| T11600 |
52692-52696 |
NN |
denotes |
MAPK |
| T11598 |
52697-52704 |
NN |
denotes |
pathway |
| T11581 |
52705-52712 |
VBP |
denotes |
suggest |
| T11602 |
52713-52717 |
IN |
denotes |
that |
| T11604 |
52718-52721 |
DT |
denotes |
the |
| T11606 |
52722-52725 |
NN |
denotes |
Grb |
| T11607 |
52725-52726 |
HYPH |
denotes |
- |
| T11608 |
52726-52727 |
CD |
denotes |
2 |
| T11605 |
52728-52739 |
NN |
denotes |
association |
| T11609 |
52740-52742 |
IN |
denotes |
of |
| T11610 |
52743-52748 |
NN |
denotes |
Ajuba |
| T11611 |
52749-52754 |
IN |
denotes |
under |
| T11612 |
52755-52765 |
NNS |
denotes |
conditions |
| T11613 |
52766-52768 |
IN |
denotes |
of |
| T11614 |
52769-52776 |
JJ |
denotes |
reduced |
| T11615 |
52777-52783 |
NNS |
denotes |
levels |
| T11616 |
52784-52786 |
IN |
denotes |
of |
| T11617 |
52787-52789 |
NN |
denotes |
AJ |
| T11618 |
52790-52798 |
NN |
denotes |
proteins |
| T11619 |
52799-52802 |
MD |
denotes |
may |
| T11603 |
52803-52805 |
VB |
denotes |
be |
| T11620 |
52806-52814 |
RB |
denotes |
directly |
| T11621 |
52815-52823 |
JJ |
denotes |
relevant |
| T11622 |
52824-52826 |
IN |
denotes |
to |
| T11623 |
52827-52830 |
DT |
denotes |
the |
| T11624 |
52831-52839 |
NN |
denotes |
parallel |
| T11625 |
52840-52842 |
IN |
denotes |
in |
| T11626 |
52843-52861 |
NN |
denotes |
hyperproliferation |
| T11627 |
52861-52862 |
. |
denotes |
. |
| T11628 |
52862-53049 |
sentence |
denotes |
In stable epithelial (i.e., Madin-Darby canine kidney, or MDCK) cell lines, Snail has been shown to block cell cycle progression and promote motility and shape changes for invasion [47]. |
| T11629 |
52863-52865 |
IN |
denotes |
In |
| T11631 |
52866-52872 |
JJ |
denotes |
stable |
| T11633 |
52873-52883 |
JJ |
denotes |
epithelial |
| T11634 |
52884-52885 |
-LRB- |
denotes |
( |
| T11636 |
52885-52889 |
FW |
denotes |
i.e. |
| T11637 |
52889-52891 |
, |
denotes |
, |
| T11638 |
52891-52896 |
NNP |
denotes |
Madin |
| T11640 |
52896-52897 |
HYPH |
denotes |
- |
| T11639 |
52897-52902 |
NNP |
denotes |
Darby |
| T11641 |
52903-52909 |
JJ |
denotes |
canine |
| T11635 |
52910-52916 |
NN |
denotes |
kidney |
| T11642 |
52916-52918 |
, |
denotes |
, |
| T11643 |
52918-52920 |
CC |
denotes |
or |
| T11644 |
52921-52925 |
NN |
denotes |
MDCK |
| T11645 |
52925-52926 |
-RRB- |
denotes |
) |
| T11646 |
52927-52931 |
NN |
denotes |
cell |
| T11632 |
52932-52937 |
NNS |
denotes |
lines |
| T11647 |
52937-52939 |
, |
denotes |
, |
| T11648 |
52939-52944 |
NN |
denotes |
Snail |
| T11649 |
52945-52948 |
VBZ |
denotes |
has |
| T11650 |
52949-52953 |
VBN |
denotes |
been |
| T11630 |
52954-52959 |
VBN |
denotes |
shown |
| T11651 |
52960-52962 |
TO |
denotes |
to |
| T11652 |
52963-52968 |
VB |
denotes |
block |
| T11653 |
52969-52973 |
NN |
denotes |
cell |
| T11654 |
52974-52979 |
NN |
denotes |
cycle |
| T11655 |
52980-52991 |
NN |
denotes |
progression |
| T11656 |
52992-52995 |
CC |
denotes |
and |
| T11657 |
52996-53003 |
VB |
denotes |
promote |
| T11658 |
53004-53012 |
NN |
denotes |
motility |
| T11660 |
53013-53016 |
CC |
denotes |
and |
| T11661 |
53017-53022 |
NN |
denotes |
shape |
| T11659 |
53023-53030 |
NNS |
denotes |
changes |
| T11662 |
53031-53034 |
IN |
denotes |
for |
| T11663 |
53035-53043 |
NN |
denotes |
invasion |
| T11664 |
53044-53045 |
-LRB- |
denotes |
[ |
| T11665 |
53045-53047 |
CD |
denotes |
47 |
| T11666 |
53047-53048 |
-RRB- |
denotes |
] |
| T11667 |
53048-53049 |
. |
denotes |
. |
| T11668 |
53049-53219 |
sentence |
denotes |
While our in vivo studies are consistent with a role for Snail in motility and epithelial remodeling, they differ with respect to Snail's apparent proliferative effects. |
| T11669 |
53050-53055 |
IN |
denotes |
While |
| T11671 |
53056-53059 |
PRP$ |
denotes |
our |
| T11673 |
53060-53062 |
FW |
denotes |
in |
| T11674 |
53063-53067 |
FW |
denotes |
vivo |
| T11672 |
53068-53075 |
NNS |
denotes |
studies |
| T11670 |
53076-53079 |
VBP |
denotes |
are |
| T11676 |
53080-53090 |
JJ |
denotes |
consistent |
| T11677 |
53091-53095 |
IN |
denotes |
with |
| T11678 |
53096-53097 |
DT |
denotes |
a |
| T11679 |
53098-53102 |
NN |
denotes |
role |
| T11680 |
53103-53106 |
IN |
denotes |
for |
| T11681 |
53107-53112 |
NN |
denotes |
Snail |
| T11682 |
53113-53115 |
IN |
denotes |
in |
| T11683 |
53116-53124 |
NN |
denotes |
motility |
| T11685 |
53125-53128 |
CC |
denotes |
and |
| T11686 |
53129-53139 |
JJ |
denotes |
epithelial |
| T11684 |
53140-53150 |
NN |
denotes |
remodeling |
| T11687 |
53150-53152 |
, |
denotes |
, |
| T11688 |
53152-53156 |
PRP |
denotes |
they |
| T11675 |
53157-53163 |
VBP |
denotes |
differ |
| T11689 |
53164-53168 |
IN |
denotes |
with |
| T11690 |
53169-53176 |
NN |
denotes |
respect |
| T11691 |
53177-53179 |
IN |
denotes |
to |
| T11692 |
53180-53185 |
NN |
denotes |
Snail |
| T11694 |
53185-53187 |
POS |
denotes |
's |
| T11695 |
53188-53196 |
JJ |
denotes |
apparent |
| T11696 |
53197-53210 |
JJ |
denotes |
proliferative |
| T11693 |
53211-53218 |
NNS |
denotes |
effects |
| T11697 |
53218-53219 |
. |
denotes |
. |
| T11698 |
53219-53329 |
sentence |
denotes |
A priori, this could be simply due to variations in the response of different cell types to Snail expression. |
| T11699 |
53220-53221 |
FW |
denotes |
A |
| T11700 |
53222-53228 |
FW |
denotes |
priori |
| T11702 |
53228-53230 |
, |
denotes |
, |
| T11703 |
53230-53234 |
DT |
denotes |
this |
| T11704 |
53235-53240 |
MD |
denotes |
could |
| T11701 |
53241-53243 |
VB |
denotes |
be |
| T11705 |
53244-53250 |
RB |
denotes |
simply |
| T11706 |
53251-53254 |
IN |
denotes |
due |
| T11707 |
53255-53257 |
IN |
denotes |
to |
| T11708 |
53258-53268 |
NNS |
denotes |
variations |
| T11709 |
53269-53271 |
IN |
denotes |
in |
| T11710 |
53272-53275 |
DT |
denotes |
the |
| T11711 |
53276-53284 |
NN |
denotes |
response |
| T11712 |
53285-53287 |
IN |
denotes |
of |
| T11713 |
53288-53297 |
JJ |
denotes |
different |
| T11715 |
53298-53302 |
NN |
denotes |
cell |
| T11714 |
53303-53308 |
NNS |
denotes |
types |
| T11716 |
53309-53311 |
IN |
denotes |
to |
| T11717 |
53312-53317 |
NN |
denotes |
Snail |
| T11718 |
53318-53328 |
NN |
denotes |
expression |
| T11719 |
53328-53329 |
. |
denotes |
. |
| T11720 |
53329-53488 |
sentence |
denotes |
Alternatively, these differences may be relevant to the benefit of using mouse models to reveal functions not always recapitulated in stable cell line models. |
| T11721 |
53330-53343 |
RB |
denotes |
Alternatively |
| T11723 |
53343-53345 |
, |
denotes |
, |
| T11724 |
53345-53350 |
DT |
denotes |
these |
| T11725 |
53351-53362 |
NNS |
denotes |
differences |
| T11726 |
53363-53366 |
MD |
denotes |
may |
| T11722 |
53367-53369 |
VB |
denotes |
be |
| T11727 |
53370-53378 |
JJ |
denotes |
relevant |
| T11728 |
53379-53381 |
IN |
denotes |
to |
| T11729 |
53382-53385 |
DT |
denotes |
the |
| T11730 |
53386-53393 |
NN |
denotes |
benefit |
| T11731 |
53394-53396 |
IN |
denotes |
of |
| T11732 |
53397-53402 |
VBG |
denotes |
using |
| T11733 |
53403-53408 |
NN |
denotes |
mouse |
| T11734 |
53409-53415 |
NNS |
denotes |
models |
| T11735 |
53416-53418 |
TO |
denotes |
to |
| T11736 |
53419-53425 |
VB |
denotes |
reveal |
| T11737 |
53426-53435 |
NNS |
denotes |
functions |
| T11738 |
53436-53439 |
RB |
denotes |
not |
| T11740 |
53440-53446 |
RB |
denotes |
always |
| T11739 |
53447-53460 |
VBN |
denotes |
recapitulated |
| T11741 |
53461-53463 |
IN |
denotes |
in |
| T11742 |
53464-53470 |
JJ |
denotes |
stable |
| T11744 |
53471-53475 |
NN |
denotes |
cell |
| T11745 |
53476-53480 |
NN |
denotes |
line |
| T11743 |
53481-53487 |
NNS |
denotes |
models |
| T11746 |
53487-53488 |
. |
denotes |
. |
| T11747 |
53488-53571 |
sentence |
denotes |
Future studies should highlight the underlying reasons for these opposing results. |
| T11748 |
53489-53495 |
JJ |
denotes |
Future |
| T11749 |
53496-53503 |
NNS |
denotes |
studies |
| T11751 |
53504-53510 |
MD |
denotes |
should |
| T11750 |
53511-53520 |
VB |
denotes |
highlight |
| T11752 |
53521-53524 |
DT |
denotes |
the |
| T11754 |
53525-53535 |
JJ |
denotes |
underlying |
| T11753 |
53536-53543 |
NNS |
denotes |
reasons |
| T11755 |
53544-53547 |
IN |
denotes |
for |
| T11756 |
53548-53553 |
DT |
denotes |
these |
| T11758 |
53554-53562 |
VBG |
denotes |
opposing |
| T11757 |
53563-53570 |
NNS |
denotes |
results |
| T11759 |
53570-53571 |
. |
denotes |
. |
| T11760 |
53571-53756 |
sentence |
denotes |
Irrespective of these differences, our in vivo studies do not stand alone, as there are many situations in which a down-regulation in AJ proteins correlate with enhanced proliferation. |
| T11761 |
53572-53584 |
JJ |
denotes |
Irrespective |
| T11763 |
53585-53587 |
IN |
denotes |
of |
| T11764 |
53588-53593 |
DT |
denotes |
these |
| T11765 |
53594-53605 |
NNS |
denotes |
differences |
| T11766 |
53605-53607 |
, |
denotes |
, |
| T11767 |
53607-53610 |
PRP$ |
denotes |
our |
| T11769 |
53611-53613 |
FW |
denotes |
in |
| T11770 |
53614-53618 |
FW |
denotes |
vivo |
| T11768 |
53619-53626 |
NNS |
denotes |
studies |
| T11771 |
53627-53629 |
VBP |
denotes |
do |
| T11772 |
53630-53633 |
RB |
denotes |
not |
| T11762 |
53634-53639 |
VB |
denotes |
stand |
| T11773 |
53640-53645 |
RB |
denotes |
alone |
| T11774 |
53645-53647 |
, |
denotes |
, |
| T11775 |
53647-53649 |
IN |
denotes |
as |
| T11777 |
53650-53655 |
EX |
denotes |
there |
| T11776 |
53656-53659 |
VBP |
denotes |
are |
| T11778 |
53660-53664 |
JJ |
denotes |
many |
| T11779 |
53665-53675 |
NNS |
denotes |
situations |
| T11780 |
53676-53678 |
IN |
denotes |
in |
| T11782 |
53679-53684 |
WDT |
denotes |
which |
| T11783 |
53685-53686 |
DT |
denotes |
a |
| T11785 |
53687-53691 |
JJ |
denotes |
down |
| T11786 |
53691-53692 |
HYPH |
denotes |
- |
| T11784 |
53692-53702 |
NN |
denotes |
regulation |
| T11787 |
53703-53705 |
IN |
denotes |
in |
| T11788 |
53706-53708 |
NN |
denotes |
AJ |
| T11789 |
53709-53717 |
NN |
denotes |
proteins |
| T11781 |
53718-53727 |
VBP |
denotes |
correlate |
| T11790 |
53728-53732 |
IN |
denotes |
with |
| T11791 |
53733-53741 |
VBN |
denotes |
enhanced |
| T11792 |
53742-53755 |
NN |
denotes |
proliferation |
| T11793 |
53755-53756 |
. |
denotes |
. |
| T11794 |
53756-53906 |
sentence |
denotes |
In fact, a myriad of diverse mechanisms have been implicated in activating epithelial proliferation upon down-regulation of AJ proteins [7,23,24,48]. |
| T11795 |
53757-53759 |
IN |
denotes |
In |
| T11797 |
53760-53764 |
NN |
denotes |
fact |
| T11798 |
53764-53766 |
, |
denotes |
, |
| T11799 |
53766-53767 |
DT |
denotes |
a |
| T11800 |
53768-53774 |
NN |
denotes |
myriad |
| T11801 |
53775-53777 |
IN |
denotes |
of |
| T11802 |
53778-53785 |
JJ |
denotes |
diverse |
| T11803 |
53786-53796 |
NNS |
denotes |
mechanisms |
| T11804 |
53797-53801 |
VBP |
denotes |
have |
| T11805 |
53802-53806 |
VBN |
denotes |
been |
| T11796 |
53807-53817 |
VBN |
denotes |
implicated |
| T11806 |
53818-53820 |
IN |
denotes |
in |
| T11807 |
53821-53831 |
VBG |
denotes |
activating |
| T11808 |
53832-53842 |
JJ |
denotes |
epithelial |
| T11809 |
53843-53856 |
NN |
denotes |
proliferation |
| T11810 |
53857-53861 |
IN |
denotes |
upon |
| T11811 |
53862-53866 |
JJ |
denotes |
down |
| T11813 |
53866-53867 |
HYPH |
denotes |
- |
| T11812 |
53867-53877 |
NN |
denotes |
regulation |
| T11814 |
53878-53880 |
IN |
denotes |
of |
| T11815 |
53881-53883 |
NN |
denotes |
AJ |
| T11816 |
53884-53892 |
NN |
denotes |
proteins |
| T11817 |
53893-53894 |
-LRB- |
denotes |
[ |
| T11819 |
53894-53895 |
CD |
denotes |
7 |
| T11820 |
53895-53896 |
, |
denotes |
, |
| T11821 |
53896-53898 |
CD |
denotes |
23 |
| T11822 |
53898-53899 |
, |
denotes |
, |
| T11823 |
53899-53901 |
CD |
denotes |
24 |
| T11824 |
53901-53902 |
, |
denotes |
, |
| T11818 |
53902-53904 |
CD |
denotes |
48 |
| T11825 |
53904-53905 |
-RRB- |
denotes |
] |
| T11826 |
53905-53906 |
. |
denotes |
. |
| T11827 |
53906-54001 |
sentence |
denotes |
Sifting through these converging pathways is likely to be a difficult and painstaking process. |
| T11828 |
53907-53914 |
VBG |
denotes |
Sifting |
| T11830 |
53915-53922 |
IN |
denotes |
through |
| T11831 |
53923-53928 |
DT |
denotes |
these |
| T11833 |
53929-53939 |
VBG |
denotes |
converging |
| T11832 |
53940-53948 |
NNS |
denotes |
pathways |
| T11829 |
53949-53951 |
VBZ |
denotes |
is |
| T11834 |
53952-53958 |
JJ |
denotes |
likely |
| T11835 |
53959-53961 |
TO |
denotes |
to |
| T11836 |
53962-53964 |
VB |
denotes |
be |
| T11837 |
53965-53966 |
DT |
denotes |
a |
| T11839 |
53967-53976 |
JJ |
denotes |
difficult |
| T11840 |
53977-53980 |
CC |
denotes |
and |
| T11841 |
53981-53992 |
JJ |
denotes |
painstaking |
| T11838 |
53993-54000 |
NN |
denotes |
process |
| T11842 |
54000-54001 |
. |
denotes |
. |
| T11843 |
54001-54286 |
sentence |
denotes |
This said, by identifying the status of different players involved in specific cell types and at specific stages in development, our mechanistic understanding of how intercellular remodeling is linked to proliferation in epithelial morphogenesis should begin to surface in the future. |
| T11844 |
54002-54006 |
DT |
denotes |
This |
| T11845 |
54007-54011 |
VBD |
denotes |
said |
| T11847 |
54011-54013 |
, |
denotes |
, |
| T11848 |
54013-54015 |
IN |
denotes |
by |
| T11849 |
54016-54027 |
VBG |
denotes |
identifying |
| T11850 |
54028-54031 |
DT |
denotes |
the |
| T11851 |
54032-54038 |
NN |
denotes |
status |
| T11852 |
54039-54041 |
IN |
denotes |
of |
| T11853 |
54042-54051 |
JJ |
denotes |
different |
| T11854 |
54052-54059 |
NNS |
denotes |
players |
| T11855 |
54060-54068 |
VBN |
denotes |
involved |
| T11856 |
54069-54071 |
IN |
denotes |
in |
| T11857 |
54072-54080 |
JJ |
denotes |
specific |
| T11859 |
54081-54085 |
NN |
denotes |
cell |
| T11858 |
54086-54091 |
NNS |
denotes |
types |
| T11860 |
54092-54095 |
CC |
denotes |
and |
| T11861 |
54096-54098 |
IN |
denotes |
at |
| T11862 |
54099-54107 |
JJ |
denotes |
specific |
| T11863 |
54108-54114 |
NNS |
denotes |
stages |
| T11864 |
54115-54117 |
IN |
denotes |
in |
| T11865 |
54118-54129 |
NN |
denotes |
development |
| T11866 |
54129-54131 |
, |
denotes |
, |
| T11867 |
54131-54134 |
PRP$ |
denotes |
our |
| T11869 |
54135-54146 |
JJ |
denotes |
mechanistic |
| T11868 |
54147-54160 |
NN |
denotes |
understanding |
| T11870 |
54161-54163 |
IN |
denotes |
of |
| T11871 |
54164-54167 |
WRB |
denotes |
how |
| T11873 |
54168-54181 |
JJ |
denotes |
intercellular |
| T11874 |
54182-54192 |
NN |
denotes |
remodeling |
| T11875 |
54193-54195 |
VBZ |
denotes |
is |
| T11872 |
54196-54202 |
VBN |
denotes |
linked |
| T11876 |
54203-54205 |
IN |
denotes |
to |
| T11877 |
54206-54219 |
NN |
denotes |
proliferation |
| T11878 |
54220-54222 |
IN |
denotes |
in |
| T11879 |
54223-54233 |
JJ |
denotes |
epithelial |
| T11880 |
54234-54247 |
NN |
denotes |
morphogenesis |
| T11881 |
54248-54254 |
MD |
denotes |
should |
| T11846 |
54255-54260 |
VB |
denotes |
begin |
| T11882 |
54261-54263 |
TO |
denotes |
to |
| T11883 |
54264-54271 |
VB |
denotes |
surface |
| T11884 |
54272-54274 |
IN |
denotes |
in |
| T11885 |
54275-54278 |
DT |
denotes |
the |
| T11886 |
54279-54285 |
NN |
denotes |
future |
| T11887 |
54285-54286 |
. |
denotes |
. |
| T11888 |
54286-54452 |
sentence |
denotes |
Elucidating the molecular mechanisms through which these networks converge is also a prerequisite for understanding how these processes go awry during tumorigenesis. |
| T11889 |
54287-54298 |
VBG |
denotes |
Elucidating |
| T11891 |
54299-54302 |
DT |
denotes |
the |
| T11893 |
54303-54312 |
JJ |
denotes |
molecular |
| T11892 |
54313-54323 |
NNS |
denotes |
mechanisms |
| T11894 |
54324-54331 |
IN |
denotes |
through |
| T11896 |
54332-54337 |
WDT |
denotes |
which |
| T11897 |
54338-54343 |
DT |
denotes |
these |
| T11898 |
54344-54352 |
NNS |
denotes |
networks |
| T11895 |
54353-54361 |
VBP |
denotes |
converge |
| T11890 |
54362-54364 |
VBZ |
denotes |
is |
| T11899 |
54365-54369 |
RB |
denotes |
also |
| T11900 |
54370-54371 |
DT |
denotes |
a |
| T11901 |
54372-54384 |
NN |
denotes |
prerequisite |
| T11902 |
54385-54388 |
IN |
denotes |
for |
| T11903 |
54389-54402 |
VBG |
denotes |
understanding |
| T11904 |
54403-54406 |
WRB |
denotes |
how |
| T11906 |
54407-54412 |
DT |
denotes |
these |
| T11907 |
54413-54422 |
NNS |
denotes |
processes |
| T11905 |
54423-54425 |
VBP |
denotes |
go |
| T11908 |
54426-54430 |
RB |
denotes |
awry |
| T11909 |
54431-54437 |
IN |
denotes |
during |
| T11910 |
54438-54451 |
NN |
denotes |
tumorigenesis |
| T11911 |
54451-54452 |
. |
denotes |
. |
| T12021 |
54477-54485 |
NNS |
denotes |
Reagents |
| T12022 |
54485-55576 |
sentence |
denotes |
Primary antibodies used were against: E-cadherin (M. Takeichi, Kyoto University, Japan); α-catenin, β-catenin, pMAPK, tubulin (Sigma, St. Louis, Missouri, United States), Ajuba (G. Longmore, Washington University, St. Louis, Missouri, United States); β4 integrin/CD104 (BD Pharmingen, San Diego, California, United States), laminin 5 (R. Burgeson, Harvard University, Cambridge, Massachusetts, United States), K5, K1, loricrin (Fuchs Lab), involucrin, fillagrin (Covance, Berkeley, California, United States), MAPK, pSMAD2 (Cell Signaling, Beverly, Massachusetts, United States); Grb-2 (Santa Cruz Biotech, Santa Cruz, California, United States); P-cadherin (Zymed Laboratories, South San Francisco, California, United States); HA (Roche Biochemicals), vimentin (Chemicon, Temecula, California, United States), Ki67 (Novo Castra, Newcastle Upon Tyne, United Kingdom), keratin 6 (P. Coulombe, John Hopkins University, Baltimore, Maryland, United States), cyclin D (Oncogene, San Diego, California, United States), and TGF-β2 (L. Gold, New York University, New York, New York, United States). |
| T12023 |
54486-54493 |
JJ |
denotes |
Primary |
| T12024 |
54494-54504 |
NNS |
denotes |
antibodies |
| T12026 |
54505-54509 |
VBN |
denotes |
used |
| T12025 |
54510-54514 |
VBD |
denotes |
were |
| T12027 |
54515-54522 |
IN |
denotes |
against |
| T12028 |
54522-54524 |
: |
denotes |
: |
| T12029 |
54524-54525 |
NN |
denotes |
E |
| T12031 |
54525-54526 |
HYPH |
denotes |
- |
| T12030 |
54526-54534 |
NN |
denotes |
cadherin |
| T12032 |
54535-54536 |
-LRB- |
denotes |
( |
| T12034 |
54536-54538 |
NNP |
denotes |
M. |
| T12033 |
54539-54547 |
NNP |
denotes |
Takeichi |
| T12035 |
54547-54549 |
, |
denotes |
, |
| T12036 |
54549-54554 |
NNP |
denotes |
Kyoto |
| T12037 |
54555-54565 |
NNP |
denotes |
University |
| T12038 |
54565-54567 |
, |
denotes |
, |
| T12039 |
54567-54572 |
NNP |
denotes |
Japan |
| T12040 |
54572-54573 |
-RRB- |
denotes |
) |
| T12041 |
54573-54574 |
: |
denotes |
; |
| T12042 |
54575-54576 |
NN |
denotes |
α |
| T12044 |
54576-54577 |
HYPH |
denotes |
- |
| T12043 |
54577-54584 |
NN |
denotes |
catenin |
| T12045 |
54584-54586 |
, |
denotes |
, |
| T12046 |
54586-54587 |
NN |
denotes |
β |
| T12048 |
54587-54588 |
HYPH |
denotes |
- |
| T12047 |
54588-54595 |
NN |
denotes |
catenin |
| T12049 |
54595-54597 |
, |
denotes |
, |
| T12050 |
54597-54602 |
NN |
denotes |
pMAPK |
| T12051 |
54602-54604 |
, |
denotes |
, |
| T12052 |
54604-54611 |
NN |
denotes |
tubulin |
| T12053 |
54612-54613 |
-LRB- |
denotes |
( |
| T12054 |
54613-54618 |
NNP |
denotes |
Sigma |
| T12055 |
54618-54620 |
, |
denotes |
, |
| T12056 |
54620-54623 |
NNP |
denotes |
St. |
| T12057 |
54624-54629 |
NNP |
denotes |
Louis |
| T12058 |
54629-54631 |
, |
denotes |
, |
| T12059 |
54631-54639 |
NNP |
denotes |
Missouri |
| T12060 |
54639-54641 |
, |
denotes |
, |
| T12061 |
54641-54647 |
NNP |
denotes |
United |
| T12062 |
54648-54654 |
NNP |
denotes |
States |
| T12063 |
54654-54655 |
-RRB- |
denotes |
) |
| T12064 |
54655-54657 |
, |
denotes |
, |
| T12065 |
54657-54662 |
NN |
denotes |
Ajuba |
| T12066 |
54663-54664 |
-LRB- |
denotes |
( |
| T12068 |
54664-54666 |
NNP |
denotes |
G. |
| T12067 |
54667-54675 |
NNP |
denotes |
Longmore |
| T12069 |
54675-54677 |
, |
denotes |
, |
| T12070 |
54677-54687 |
NNP |
denotes |
Washington |
| T12071 |
54688-54698 |
NNP |
denotes |
University |
| T12072 |
54698-54700 |
, |
denotes |
, |
| T12073 |
54700-54703 |
NNP |
denotes |
St. |
| T12074 |
54704-54709 |
NNP |
denotes |
Louis |
| T12075 |
54709-54711 |
, |
denotes |
, |
| T12076 |
54711-54719 |
NNP |
denotes |
Missouri |
| T12077 |
54719-54721 |
, |
denotes |
, |
| T12078 |
54721-54727 |
NNP |
denotes |
United |
| T12079 |
54728-54734 |
NNP |
denotes |
States |
| T12080 |
54734-54735 |
-RRB- |
denotes |
) |
| T12081 |
54735-54736 |
: |
denotes |
; |
| T12082 |
54737-54739 |
NN |
denotes |
β4 |
| T12083 |
54740-54748 |
NN |
denotes |
integrin |
| T12084 |
54748-54749 |
HYPH |
denotes |
/ |
| T12085 |
54749-54754 |
NN |
denotes |
CD104 |
| T12086 |
54755-54756 |
-LRB- |
denotes |
( |
| T12088 |
54756-54758 |
NNP |
denotes |
BD |
| T12087 |
54759-54769 |
NNP |
denotes |
Pharmingen |
| T12089 |
54769-54771 |
, |
denotes |
, |
| T12090 |
54771-54774 |
NNP |
denotes |
San |
| T12091 |
54775-54780 |
NNP |
denotes |
Diego |
| T12092 |
54780-54782 |
, |
denotes |
, |
| T12093 |
54782-54792 |
NNP |
denotes |
California |
| T12094 |
54792-54794 |
, |
denotes |
, |
| T12095 |
54794-54800 |
NNP |
denotes |
United |
| T12096 |
54801-54807 |
NNP |
denotes |
States |
| T12097 |
54807-54808 |
-RRB- |
denotes |
) |
| T12098 |
54808-54810 |
, |
denotes |
, |
| T12099 |
54810-54817 |
NN |
denotes |
laminin |
| T12100 |
54818-54819 |
CD |
denotes |
5 |
| T12101 |
54820-54821 |
-LRB- |
denotes |
( |
| T12103 |
54821-54823 |
NNP |
denotes |
R. |
| T12102 |
54824-54832 |
NNP |
denotes |
Burgeson |
| T12104 |
54832-54834 |
, |
denotes |
, |
| T12105 |
54834-54841 |
NNP |
denotes |
Harvard |
| T12106 |
54842-54852 |
NNP |
denotes |
University |
| T12107 |
54852-54854 |
, |
denotes |
, |
| T12108 |
54854-54863 |
NNP |
denotes |
Cambridge |
| T12109 |
54863-54865 |
, |
denotes |
, |
| T12110 |
54865-54878 |
NNP |
denotes |
Massachusetts |
| T12111 |
54878-54880 |
, |
denotes |
, |
| T12112 |
54880-54886 |
NNP |
denotes |
United |
| T12113 |
54887-54893 |
NNP |
denotes |
States |
| T12114 |
54893-54894 |
-RRB- |
denotes |
) |
| T12115 |
54894-54896 |
, |
denotes |
, |
| T12116 |
54896-54898 |
NN |
denotes |
K5 |
| T12117 |
54898-54900 |
, |
denotes |
, |
| T12118 |
54900-54902 |
NN |
denotes |
K1 |
| T12119 |
54902-54904 |
, |
denotes |
, |
| T12120 |
54904-54912 |
NN |
denotes |
loricrin |
| T12121 |
54913-54914 |
-LRB- |
denotes |
( |
| T12123 |
54914-54919 |
NNP |
denotes |
Fuchs |
| T12122 |
54920-54923 |
NNP |
denotes |
Lab |
| T12124 |
54923-54924 |
-RRB- |
denotes |
) |
| T12125 |
54924-54926 |
, |
denotes |
, |
| T12126 |
54926-54936 |
NN |
denotes |
involucrin |
| T12127 |
54936-54938 |
, |
denotes |
, |
| T12128 |
54938-54947 |
NN |
denotes |
fillagrin |
| T12129 |
54948-54949 |
-LRB- |
denotes |
( |
| T12130 |
54949-54956 |
NNP |
denotes |
Covance |
| T12131 |
54956-54958 |
, |
denotes |
, |
| T12132 |
54958-54966 |
NNP |
denotes |
Berkeley |
| T12133 |
54966-54968 |
, |
denotes |
, |
| T12134 |
54968-54978 |
NNP |
denotes |
California |
| T12135 |
54978-54980 |
, |
denotes |
, |
| T12136 |
54980-54986 |
NNP |
denotes |
United |
| T12137 |
54987-54993 |
NNP |
denotes |
States |
| T12138 |
54993-54994 |
-RRB- |
denotes |
) |
| T12139 |
54994-54996 |
, |
denotes |
, |
| T12140 |
54996-55000 |
NN |
denotes |
MAPK |
| T12141 |
55000-55002 |
, |
denotes |
, |
| T12142 |
55002-55008 |
NN |
denotes |
pSMAD2 |
| T12143 |
55009-55010 |
-LRB- |
denotes |
( |
| T12145 |
55010-55014 |
NNP |
denotes |
Cell |
| T12144 |
55015-55024 |
NNP |
denotes |
Signaling |
| T12146 |
55024-55026 |
, |
denotes |
, |
| T12147 |
55026-55033 |
NNP |
denotes |
Beverly |
| T12148 |
55033-55035 |
, |
denotes |
, |
| T12149 |
55035-55048 |
NNP |
denotes |
Massachusetts |
| T12150 |
55048-55050 |
, |
denotes |
, |
| T12151 |
55050-55056 |
NNP |
denotes |
United |
| T12152 |
55057-55063 |
NNP |
denotes |
States |
| T12153 |
55063-55064 |
-RRB- |
denotes |
) |
| T12154 |
55064-55065 |
: |
denotes |
; |
| T12155 |
55066-55069 |
NN |
denotes |
Grb |
| T12156 |
55069-55070 |
HYPH |
denotes |
- |
| T12157 |
55070-55071 |
CD |
denotes |
2 |
| T12158 |
55072-55073 |
-LRB- |
denotes |
( |
| T12160 |
55073-55078 |
NNP |
denotes |
Santa |
| T12161 |
55079-55083 |
NNP |
denotes |
Cruz |
| T12159 |
55084-55091 |
NNP |
denotes |
Biotech |
| T12162 |
55091-55093 |
, |
denotes |
, |
| T12163 |
55093-55098 |
NNP |
denotes |
Santa |
| T12164 |
55099-55103 |
NNP |
denotes |
Cruz |
| T12165 |
55103-55105 |
, |
denotes |
, |
| T12166 |
55105-55115 |
NNP |
denotes |
California |
| T12167 |
55115-55117 |
, |
denotes |
, |
| T12168 |
55117-55123 |
NNP |
denotes |
United |
| T12169 |
55124-55130 |
NNP |
denotes |
States |
| T12170 |
55130-55131 |
-RRB- |
denotes |
) |
| T12171 |
55131-55132 |
: |
denotes |
; |
| T12172 |
55133-55134 |
NN |
denotes |
P |
| T12174 |
55134-55135 |
HYPH |
denotes |
- |
| T12173 |
55135-55143 |
NN |
denotes |
cadherin |
| T12175 |
55144-55145 |
-LRB- |
denotes |
( |
| T12177 |
55145-55150 |
NNP |
denotes |
Zymed |
| T12176 |
55151-55163 |
NNP |
denotes |
Laboratories |
| T12178 |
55163-55165 |
, |
denotes |
, |
| T12179 |
55165-55170 |
JJ |
denotes |
South |
| T12181 |
55171-55174 |
NNP |
denotes |
San |
| T12180 |
55175-55184 |
NNP |
denotes |
Francisco |
| T12182 |
55184-55186 |
, |
denotes |
, |
| T12183 |
55186-55196 |
NNP |
denotes |
California |
| T12184 |
55196-55198 |
, |
denotes |
, |
| T12185 |
55198-55204 |
NNP |
denotes |
United |
| T12186 |
55205-55211 |
NNP |
denotes |
States |
| T12187 |
55211-55212 |
-RRB- |
denotes |
) |
| T12188 |
55212-55213 |
: |
denotes |
; |
| T12189 |
55214-55216 |
NN |
denotes |
HA |
| T12190 |
55217-55218 |
-LRB- |
denotes |
( |
| T12192 |
55218-55223 |
NNP |
denotes |
Roche |
| T12191 |
55224-55236 |
NNP |
denotes |
Biochemicals |
| T12193 |
55236-55237 |
-RRB- |
denotes |
) |
| T12194 |
55237-55239 |
, |
denotes |
, |
| T12195 |
55239-55247 |
NN |
denotes |
vimentin |
| T12196 |
55248-55249 |
-LRB- |
denotes |
( |
| T12197 |
55249-55257 |
NNP |
denotes |
Chemicon |
| T12198 |
55257-55259 |
, |
denotes |
, |
| T12199 |
55259-55267 |
NNP |
denotes |
Temecula |
| T12200 |
55267-55269 |
, |
denotes |
, |
| T12201 |
55269-55279 |
NNP |
denotes |
California |
| T12202 |
55279-55281 |
, |
denotes |
, |
| T12203 |
55281-55287 |
NNP |
denotes |
United |
| T12204 |
55288-55294 |
NNP |
denotes |
States |
| T12205 |
55294-55295 |
-RRB- |
denotes |
) |
| T12206 |
55295-55297 |
, |
denotes |
, |
| T12207 |
55297-55301 |
NN |
denotes |
Ki67 |
| T12208 |
55302-55303 |
-LRB- |
denotes |
( |
| T12210 |
55303-55307 |
NNP |
denotes |
Novo |
| T12209 |
55308-55314 |
NNP |
denotes |
Castra |
| T12211 |
55314-55316 |
, |
denotes |
, |
| T12212 |
55316-55325 |
NNP |
denotes |
Newcastle |
| T12213 |
55326-55330 |
IN |
denotes |
Upon |
| T12214 |
55331-55335 |
NNP |
denotes |
Tyne |
| T12215 |
55335-55337 |
, |
denotes |
, |
| T12216 |
55337-55343 |
NNP |
denotes |
United |
| T12217 |
55344-55351 |
NNP |
denotes |
Kingdom |
| T12218 |
55351-55352 |
-RRB- |
denotes |
) |
| T12219 |
55352-55354 |
, |
denotes |
, |
| T12220 |
55354-55361 |
NN |
denotes |
keratin |
| T12221 |
55362-55363 |
CD |
denotes |
6 |
| T12222 |
55364-55365 |
-LRB- |
denotes |
( |
| T12224 |
55365-55367 |
NNP |
denotes |
P. |
| T12223 |
55368-55376 |
NNP |
denotes |
Coulombe |
| T12225 |
55376-55378 |
, |
denotes |
, |
| T12226 |
55378-55382 |
NNP |
denotes |
John |
| T12227 |
55383-55390 |
NNP |
denotes |
Hopkins |
| T12228 |
55391-55401 |
NNP |
denotes |
University |
| T12229 |
55401-55403 |
, |
denotes |
, |
| T12230 |
55403-55412 |
NNP |
denotes |
Baltimore |
| T12231 |
55412-55414 |
, |
denotes |
, |
| T12232 |
55414-55422 |
NNP |
denotes |
Maryland |
| T12233 |
55422-55424 |
, |
denotes |
, |
| T12234 |
55424-55430 |
NNP |
denotes |
United |
| T12235 |
55431-55437 |
NNP |
denotes |
States |
| T12236 |
55437-55438 |
-RRB- |
denotes |
) |
| T12237 |
55438-55440 |
, |
denotes |
, |
| T12238 |
55440-55446 |
NN |
denotes |
cyclin |
| T12239 |
55447-55448 |
NN |
denotes |
D |
| T12240 |
55449-55450 |
-LRB- |
denotes |
( |
| T12241 |
55450-55458 |
NNP |
denotes |
Oncogene |
| T12242 |
55458-55460 |
, |
denotes |
, |
| T12243 |
55460-55463 |
NNP |
denotes |
San |
| T12244 |
55464-55469 |
NNP |
denotes |
Diego |
| T12245 |
55469-55471 |
, |
denotes |
, |
| T12246 |
55471-55481 |
NNP |
denotes |
California |
| T12247 |
55481-55483 |
, |
denotes |
, |
| T12248 |
55483-55489 |
NNP |
denotes |
United |
| T12249 |
55490-55496 |
NNP |
denotes |
States |
| T12250 |
55496-55497 |
-RRB- |
denotes |
) |
| T12251 |
55497-55499 |
, |
denotes |
, |
| T12252 |
55499-55502 |
CC |
denotes |
and |
| T12253 |
55503-55506 |
NN |
denotes |
TGF |
| T12255 |
55506-55507 |
HYPH |
denotes |
- |
| T12254 |
55507-55509 |
NN |
denotes |
β2 |
| T12256 |
55510-55511 |
-LRB- |
denotes |
( |
| T12258 |
55511-55513 |
NNP |
denotes |
L. |
| T12257 |
55514-55518 |
NNP |
denotes |
Gold |
| T12259 |
55518-55520 |
, |
denotes |
, |
| T12260 |
55520-55523 |
NNP |
denotes |
New |
| T12261 |
55524-55528 |
NNP |
denotes |
York |
| T12262 |
55529-55539 |
NNP |
denotes |
University |
| T12263 |
55539-55541 |
, |
denotes |
, |
| T12264 |
55541-55544 |
NNP |
denotes |
New |
| T12265 |
55545-55549 |
NNP |
denotes |
York |
| T12266 |
55549-55551 |
, |
denotes |
, |
| T12267 |
55551-55554 |
NNP |
denotes |
New |
| T12268 |
55555-55559 |
NNP |
denotes |
York |
| T12269 |
55559-55561 |
, |
denotes |
, |
| T12270 |
55561-55567 |
NNP |
denotes |
United |
| T12271 |
55568-55574 |
NNP |
denotes |
States |
| T12272 |
55574-55575 |
-RRB- |
denotes |
) |
| T12273 |
55575-55576 |
. |
denotes |
. |
| T12274 |
55576-55710 |
sentence |
denotes |
FITC-, Texas Red-, or HRP-conjugated secondary antibodies were from Jackson ImmunoResearch (West Grove, Pennsylvania, United States). |
| T12275 |
55577-55581 |
NN |
denotes |
FITC |
| T12277 |
55581-55582 |
HYPH |
denotes |
- |
| T12278 |
55582-55584 |
, |
denotes |
, |
| T12279 |
55584-55589 |
NNP |
denotes |
Texas |
| T12280 |
55590-55593 |
NNP |
denotes |
Red |
| T12281 |
55593-55594 |
HYPH |
denotes |
- |
| T12282 |
55594-55596 |
, |
denotes |
, |
| T12283 |
55596-55598 |
CC |
denotes |
or |
| T12284 |
55599-55602 |
NN |
denotes |
HRP |
| T12285 |
55602-55603 |
HYPH |
denotes |
- |
| T12276 |
55603-55613 |
VBN |
denotes |
conjugated |
| T12287 |
55614-55623 |
JJ |
denotes |
secondary |
| T12286 |
55624-55634 |
NNS |
denotes |
antibodies |
| T12288 |
55635-55639 |
VBD |
denotes |
were |
| T12289 |
55640-55644 |
IN |
denotes |
from |
| T12290 |
55645-55652 |
NNP |
denotes |
Jackson |
| T12291 |
55653-55667 |
NNP |
denotes |
ImmunoResearch |
| T12292 |
55668-55669 |
-LRB- |
denotes |
( |
| T12294 |
55669-55673 |
NNP |
denotes |
West |
| T12293 |
55674-55679 |
NNP |
denotes |
Grove |
| T12295 |
55679-55681 |
, |
denotes |
, |
| T12296 |
55681-55693 |
NNP |
denotes |
Pennsylvania |
| T12297 |
55693-55695 |
, |
denotes |
, |
| T12298 |
55695-55701 |
NNP |
denotes |
United |
| T12299 |
55702-55708 |
NNP |
denotes |
States |
| T12300 |
55708-55709 |
-RRB- |
denotes |
) |
| T12301 |
55709-55710 |
. |
denotes |
. |
| T12302 |
55710-55807 |
sentence |
denotes |
Biotinylated secondary antibodies were from Vector Labs (Burlingame, California, United States). |
| T12303 |
55711-55723 |
VBN |
denotes |
Biotinylated |
| T12305 |
55724-55733 |
JJ |
denotes |
secondary |
| T12304 |
55734-55744 |
NNS |
denotes |
antibodies |
| T12306 |
55745-55749 |
VBD |
denotes |
were |
| T12307 |
55750-55754 |
IN |
denotes |
from |
| T12308 |
55755-55761 |
NNP |
denotes |
Vector |
| T12309 |
55762-55766 |
NNP |
denotes |
Labs |
| T12310 |
55767-55768 |
-LRB- |
denotes |
( |
| T12311 |
55768-55778 |
NNP |
denotes |
Burlingame |
| T12312 |
55778-55780 |
, |
denotes |
, |
| T12313 |
55780-55790 |
NNP |
denotes |
California |
| T12314 |
55790-55792 |
, |
denotes |
, |
| T12315 |
55792-55798 |
NNP |
denotes |
United |
| T12316 |
55799-55805 |
NNP |
denotes |
States |
| T12317 |
55805-55806 |
-RRB- |
denotes |
) |
| T12318 |
55806-55807 |
. |
denotes |
. |
| T12319 |
55807-55870 |
sentence |
denotes |
Dilutions were according to the manufacturer's recommendation. |
| T12320 |
55808-55817 |
NNS |
denotes |
Dilutions |
| T12321 |
55818-55822 |
VBD |
denotes |
were |
| T12322 |
55823-55832 |
VBG |
denotes |
according |
| T12323 |
55833-55835 |
IN |
denotes |
to |
| T12324 |
55836-55839 |
DT |
denotes |
the |
| T12325 |
55840-55852 |
NN |
denotes |
manufacturer |
| T12327 |
55852-55854 |
POS |
denotes |
's |
| T12326 |
55855-55869 |
NN |
denotes |
recommendation |
| T12328 |
55869-55870 |
. |
denotes |
. |
| T12329 |
55870-56045 |
sentence |
denotes |
The Snail antibody was generated in Guinea pigs by inoculating them with the N-terminal sequence of murine Snail fused to GST (Covance, Princeton, New Jersey, United States). |
| T12330 |
55871-55874 |
DT |
denotes |
The |
| T12332 |
55875-55880 |
NN |
denotes |
Snail |
| T12331 |
55881-55889 |
NN |
denotes |
antibody |
| T12334 |
55890-55893 |
VBD |
denotes |
was |
| T12333 |
55894-55903 |
VBN |
denotes |
generated |
| T12335 |
55904-55906 |
IN |
denotes |
in |
| T12336 |
55907-55913 |
NN |
denotes |
Guinea |
| T12337 |
55914-55918 |
NNS |
denotes |
pigs |
| T12338 |
55919-55921 |
IN |
denotes |
by |
| T12339 |
55922-55933 |
VBG |
denotes |
inoculating |
| T12340 |
55934-55938 |
PRP |
denotes |
them |
| T12341 |
55939-55943 |
IN |
denotes |
with |
| T12342 |
55944-55947 |
DT |
denotes |
the |
| T12344 |
55948-55949 |
NN |
denotes |
N |
| T12346 |
55949-55950 |
HYPH |
denotes |
- |
| T12345 |
55950-55958 |
JJ |
denotes |
terminal |
| T12343 |
55959-55967 |
NN |
denotes |
sequence |
| T12347 |
55968-55970 |
IN |
denotes |
of |
| T12348 |
55971-55977 |
JJ |
denotes |
murine |
| T12349 |
55978-55983 |
NN |
denotes |
Snail |
| T12350 |
55984-55989 |
VBN |
denotes |
fused |
| T12351 |
55990-55992 |
IN |
denotes |
to |
| T12352 |
55993-55996 |
NN |
denotes |
GST |
| T12353 |
55997-55998 |
-LRB- |
denotes |
( |
| T12354 |
55998-56005 |
NNP |
denotes |
Covance |
| T12355 |
56005-56007 |
, |
denotes |
, |
| T12356 |
56007-56016 |
NNP |
denotes |
Princeton |
| T12357 |
56016-56018 |
, |
denotes |
, |
| T12358 |
56018-56021 |
NNP |
denotes |
New |
| T12359 |
56022-56028 |
NNP |
denotes |
Jersey |
| T12360 |
56028-56030 |
, |
denotes |
, |
| T12361 |
56030-56036 |
NNP |
denotes |
United |
| T12362 |
56037-56043 |
NNP |
denotes |
States |
| T12363 |
56043-56044 |
-RRB- |
denotes |
) |
| T12364 |
56044-56045 |
. |
denotes |
. |
| T12365 |
56045-56134 |
sentence |
denotes |
Recombinant human TGF-β2 was purchased from R&D (Minneapolis, Minnesota, United States). |
| T12366 |
56046-56057 |
JJ |
denotes |
Recombinant |
| T12368 |
56058-56063 |
JJ |
denotes |
human |
| T12369 |
56064-56067 |
NN |
denotes |
TGF |
| T12370 |
56067-56068 |
HYPH |
denotes |
- |
| T12367 |
56068-56070 |
NN |
denotes |
β2 |
| T12372 |
56071-56074 |
VBD |
denotes |
was |
| T12371 |
56075-56084 |
VBN |
denotes |
purchased |
| T12373 |
56085-56089 |
IN |
denotes |
from |
| T12374 |
56090-56091 |
NNP |
denotes |
R |
| T12375 |
56091-56092 |
CC |
denotes |
& |
| T12376 |
56092-56093 |
NNP |
denotes |
D |
| T12377 |
56094-56095 |
-LRB- |
denotes |
( |
| T12378 |
56095-56106 |
NNP |
denotes |
Minneapolis |
| T12379 |
56106-56108 |
, |
denotes |
, |
| T12380 |
56108-56117 |
NNP |
denotes |
Minnesota |
| T12381 |
56117-56119 |
, |
denotes |
, |
| T12382 |
56119-56125 |
NNP |
denotes |
United |
| T12383 |
56126-56132 |
NNP |
denotes |
States |
| T12384 |
56132-56133 |
-RRB- |
denotes |
) |
| T12385 |
56133-56134 |
. |
denotes |
. |
| T12386 |
56134-56229 |
sentence |
denotes |
Heat inactivated TGF-β2 was generated by heating the recombinant protein at 100 °C for 10 min. |
| T12387 |
56135-56139 |
NN |
denotes |
Heat |
| T12388 |
56140-56151 |
VBN |
denotes |
inactivated |
| T12390 |
56152-56155 |
NN |
denotes |
TGF |
| T12391 |
56155-56156 |
HYPH |
denotes |
- |
| T12389 |
56156-56158 |
NN |
denotes |
β2 |
| T12393 |
56159-56162 |
VBD |
denotes |
was |
| T12392 |
56163-56172 |
VBN |
denotes |
generated |
| T12394 |
56173-56175 |
IN |
denotes |
by |
| T12395 |
56176-56183 |
VBG |
denotes |
heating |
| T12396 |
56184-56187 |
DT |
denotes |
the |
| T12398 |
56188-56199 |
JJ |
denotes |
recombinant |
| T12397 |
56200-56207 |
NN |
denotes |
protein |
| T12399 |
56208-56210 |
IN |
denotes |
at |
| T12400 |
56211-56214 |
CD |
denotes |
100 |
| T12401 |
56215-56217 |
NN |
denotes |
°C |
| T12402 |
56218-56221 |
IN |
denotes |
for |
| T12403 |
56222-56224 |
CD |
denotes |
10 |
| T12404 |
56225-56228 |
NN |
denotes |
min |
| T12405 |
56228-56229 |
. |
denotes |
. |
| T12464 |
56231-56235 |
NNS |
denotes |
Mice |
| T12465 |
56235-56438 |
sentence |
denotes |
The K14-Snail Tg mouse was generated by digesting the pcDNA3-mm Snail-HA plasmid (G. de Herreros, Universitat Pompeu, Fabra, Barcelona, Spain) with BamHI and NotI and subcloned into the K14 vector [49]. |
| T12466 |
56236-56239 |
DT |
denotes |
The |
| T12468 |
56240-56243 |
NN |
denotes |
K14 |
| T12470 |
56243-56244 |
HYPH |
denotes |
- |
| T12469 |
56244-56249 |
NN |
denotes |
Snail |
| T12471 |
56250-56252 |
NN |
denotes |
Tg |
| T12467 |
56253-56258 |
NN |
denotes |
mouse |
| T12473 |
56259-56262 |
VBD |
denotes |
was |
| T12472 |
56263-56272 |
VBN |
denotes |
generated |
| T12474 |
56273-56275 |
IN |
denotes |
by |
| T12475 |
56276-56285 |
VBG |
denotes |
digesting |
| T12476 |
56286-56289 |
DT |
denotes |
the |
| T12478 |
56290-56296 |
NN |
denotes |
pcDNA3 |
| T12480 |
56296-56297 |
HYPH |
denotes |
- |
| T12479 |
56297-56299 |
NN |
denotes |
mm |
| T12481 |
56300-56305 |
NN |
denotes |
Snail |
| T12483 |
56305-56306 |
HYPH |
denotes |
- |
| T12482 |
56306-56308 |
NN |
denotes |
HA |
| T12477 |
56309-56316 |
NN |
denotes |
plasmid |
| T12484 |
56317-56318 |
-LRB- |
denotes |
( |
| T12486 |
56318-56320 |
NNP |
denotes |
G. |
| T12487 |
56321-56323 |
NNP |
denotes |
de |
| T12485 |
56324-56332 |
NNP |
denotes |
Herreros |
| T12488 |
56332-56334 |
, |
denotes |
, |
| T12489 |
56334-56345 |
NNP |
denotes |
Universitat |
| T12490 |
56346-56352 |
NNP |
denotes |
Pompeu |
| T12491 |
56352-56354 |
, |
denotes |
, |
| T12492 |
56354-56359 |
NNP |
denotes |
Fabra |
| T12493 |
56359-56361 |
, |
denotes |
, |
| T12494 |
56361-56370 |
NNP |
denotes |
Barcelona |
| T12495 |
56370-56372 |
, |
denotes |
, |
| T12496 |
56372-56377 |
NNP |
denotes |
Spain |
| T12497 |
56377-56378 |
-RRB- |
denotes |
) |
| T12498 |
56379-56383 |
IN |
denotes |
with |
| T12499 |
56384-56389 |
NN |
denotes |
BamHI |
| T12500 |
56390-56393 |
CC |
denotes |
and |
| T12501 |
56394-56398 |
NN |
denotes |
NotI |
| T12502 |
56399-56402 |
CC |
denotes |
and |
| T12503 |
56403-56412 |
VBN |
denotes |
subcloned |
| T12504 |
56413-56417 |
IN |
denotes |
into |
| T12505 |
56418-56421 |
DT |
denotes |
the |
| T12507 |
56422-56425 |
NN |
denotes |
K14 |
| T12506 |
56426-56432 |
NN |
denotes |
vector |
| T12508 |
56433-56434 |
-LRB- |
denotes |
[ |
| T12509 |
56434-56436 |
CD |
denotes |
49 |
| T12510 |
56436-56437 |
-RRB- |
denotes |
] |
| T12511 |
56437-56438 |
. |
denotes |
. |
| T12512 |
56438-56519 |
sentence |
denotes |
The linearized construct was injected into the nucleus of embryos from CD1 mice. |
| T12513 |
56439-56442 |
DT |
denotes |
The |
| T12515 |
56443-56453 |
VBN |
denotes |
linearized |
| T12514 |
56454-56463 |
NN |
denotes |
construct |
| T12517 |
56464-56467 |
VBD |
denotes |
was |
| T12516 |
56468-56476 |
VBN |
denotes |
injected |
| T12518 |
56477-56481 |
IN |
denotes |
into |
| T12519 |
56482-56485 |
DT |
denotes |
the |
| T12520 |
56486-56493 |
NN |
denotes |
nucleus |
| T12521 |
56494-56496 |
IN |
denotes |
of |
| T12522 |
56497-56504 |
NNS |
denotes |
embryos |
| T12523 |
56505-56509 |
IN |
denotes |
from |
| T12524 |
56510-56513 |
NN |
denotes |
CD1 |
| T12525 |
56514-56518 |
NNS |
denotes |
mice |
| T12526 |
56518-56519 |
. |
denotes |
. |
| T12527 |
56519-56577 |
sentence |
denotes |
The K14-Smad 2 Tg mouse was reported in Ito et al., 2001. |
| T12528 |
56520-56523 |
DT |
denotes |
The |
| T12530 |
56524-56527 |
NN |
denotes |
K14 |
| T12532 |
56527-56528 |
HYPH |
denotes |
- |
| T12531 |
56528-56532 |
NN |
denotes |
Smad |
| T12533 |
56533-56534 |
CD |
denotes |
2 |
| T12534 |
56535-56537 |
NN |
denotes |
Tg |
| T12529 |
56538-56543 |
NN |
denotes |
mouse |
| T12536 |
56544-56547 |
VBD |
denotes |
was |
| T12535 |
56548-56556 |
VBN |
denotes |
reported |
| T12537 |
56557-56559 |
IN |
denotes |
in |
| T12538 |
56560-56563 |
NNP |
denotes |
Ito |
| T12539 |
56564-56566 |
FW |
denotes |
et |
| T12540 |
56567-56570 |
FW |
denotes |
al. |
| T12541 |
56570-56572 |
, |
denotes |
, |
| T12542 |
56572-56576 |
CD |
denotes |
2001 |
| T12543 |
56576-56577 |
. |
denotes |
. |
| T12544 |
56577-56631 |
sentence |
denotes |
The TGF-β2 knockout (KO) mouse was described in [34]. |
| T12545 |
56578-56581 |
DT |
denotes |
The |
| T12547 |
56582-56585 |
NN |
denotes |
TGF |
| T12549 |
56585-56586 |
HYPH |
denotes |
- |
| T12548 |
56586-56588 |
NN |
denotes |
β2 |
| T12550 |
56589-56597 |
NN |
denotes |
knockout |
| T12551 |
56598-56599 |
-LRB- |
denotes |
( |
| T12552 |
56599-56601 |
NN |
denotes |
KO |
| T12553 |
56601-56602 |
-RRB- |
denotes |
) |
| T12546 |
56603-56608 |
NN |
denotes |
mouse |
| T12555 |
56609-56612 |
VBD |
denotes |
was |
| T12554 |
56613-56622 |
VBN |
denotes |
described |
| T12556 |
56623-56625 |
IN |
denotes |
in |
| T12557 |
56626-56627 |
-LRB- |
denotes |
[ |
| T12558 |
56627-56629 |
NN |
denotes |
34 |
| T12559 |
56629-56630 |
-RRB- |
denotes |
] |
| T12560 |
56630-56631 |
. |
denotes |
. |
| T12561 |
56631-56706 |
sentence |
denotes |
The shh KO mouse [38] and TOPGal mouse [20] have previously been reported. |
| T12562 |
56632-56635 |
DT |
denotes |
The |
| T12564 |
56636-56639 |
NN |
denotes |
shh |
| T12565 |
56640-56642 |
NN |
denotes |
KO |
| T12563 |
56643-56648 |
NN |
denotes |
mouse |
| T12567 |
56649-56650 |
-LRB- |
denotes |
[ |
| T12568 |
56650-56652 |
CD |
denotes |
38 |
| T12569 |
56652-56653 |
-RRB- |
denotes |
] |
| T12570 |
56654-56657 |
CC |
denotes |
and |
| T12571 |
56658-56664 |
NN |
denotes |
TOPGal |
| T12572 |
56665-56670 |
NN |
denotes |
mouse |
| T12573 |
56671-56672 |
-LRB- |
denotes |
[ |
| T12574 |
56672-56674 |
CD |
denotes |
20 |
| T12575 |
56674-56675 |
-RRB- |
denotes |
] |
| T12576 |
56676-56680 |
VBP |
denotes |
have |
| T12577 |
56681-56691 |
RB |
denotes |
previously |
| T12578 |
56692-56696 |
VBN |
denotes |
been |
| T12566 |
56697-56705 |
VBN |
denotes |
reported |
| T12579 |
56705-56706 |
. |
denotes |
. |
| T12687 |
56708-56715 |
NNP |
denotes |
Western |
| T12688 |
56716-56720 |
NN |
denotes |
blot |
| T12689 |
56721-56724 |
CC |
denotes |
and |
| T12690 |
56725-56744 |
NN |
denotes |
immunoprecipitation |
| T12691 |
56744-57050 |
sentence |
denotes |
Protein extracts from primary keratinocytes were generated either by lysing cells in lysis buffer (1% NP-40, 1% sodium deoxycholate, 20 mM Tris-Cl [pH 7.4], 140 mM NaCl containing 1 mM sodium vanadate, 2 mM phenylmethylsulfonyl fluoride, and protease inhibitors) or directly in Laemmli bβuffer and boiled. |
| T12692 |
56745-56752 |
NN |
denotes |
Protein |
| T12693 |
56753-56761 |
NNS |
denotes |
extracts |
| T12695 |
56762-56766 |
IN |
denotes |
from |
| T12696 |
56767-56774 |
JJ |
denotes |
primary |
| T12697 |
56775-56788 |
NNS |
denotes |
keratinocytes |
| T12698 |
56789-56793 |
VBD |
denotes |
were |
| T12694 |
56794-56803 |
VBN |
denotes |
generated |
| T12699 |
56804-56810 |
CC |
denotes |
either |
| T12700 |
56811-56813 |
IN |
denotes |
by |
| T12701 |
56814-56820 |
VBG |
denotes |
lysing |
| T12702 |
56821-56826 |
NNS |
denotes |
cells |
| T12703 |
56827-56829 |
IN |
denotes |
in |
| T12704 |
56830-56835 |
NN |
denotes |
lysis |
| T12705 |
56836-56842 |
NN |
denotes |
buffer |
| T12706 |
56843-56844 |
-LRB- |
denotes |
( |
| T12708 |
56844-56845 |
CD |
denotes |
1 |
| T12709 |
56845-56846 |
NN |
denotes |
% |
| T12707 |
56847-56849 |
NN |
denotes |
NP |
| T12710 |
56849-56850 |
HYPH |
denotes |
- |
| T12711 |
56850-56852 |
CD |
denotes |
40 |
| T12712 |
56852-56854 |
, |
denotes |
, |
| T12713 |
56854-56855 |
CD |
denotes |
1 |
| T12714 |
56855-56856 |
NN |
denotes |
% |
| T12716 |
56857-56863 |
NN |
denotes |
sodium |
| T12715 |
56864-56876 |
NN |
denotes |
deoxycholate |
| T12717 |
56876-56878 |
, |
denotes |
, |
| T12718 |
56878-56880 |
CD |
denotes |
20 |
| T12719 |
56881-56883 |
NN |
denotes |
mM |
| T12721 |
56884-56888 |
NN |
denotes |
Tris |
| T12722 |
56888-56889 |
HYPH |
denotes |
- |
| T12720 |
56889-56891 |
NN |
denotes |
Cl |
| T12723 |
56892-56893 |
-LRB- |
denotes |
[ |
| T12724 |
56893-56895 |
NN |
denotes |
pH |
| T12725 |
56896-56899 |
CD |
denotes |
7.4 |
| T12726 |
56899-56900 |
-RRB- |
denotes |
] |
| T12727 |
56900-56902 |
, |
denotes |
, |
| T12728 |
56902-56905 |
CD |
denotes |
140 |
| T12729 |
56906-56908 |
NN |
denotes |
mM |
| T12730 |
56909-56913 |
NN |
denotes |
NaCl |
| T12731 |
56914-56924 |
VBG |
denotes |
containing |
| T12732 |
56925-56926 |
CD |
denotes |
1 |
| T12733 |
56927-56929 |
NN |
denotes |
mM |
| T12735 |
56930-56936 |
NN |
denotes |
sodium |
| T12734 |
56937-56945 |
NN |
denotes |
vanadate |
| T12736 |
56945-56947 |
, |
denotes |
, |
| T12737 |
56947-56948 |
CD |
denotes |
2 |
| T12738 |
56949-56951 |
NN |
denotes |
mM |
| T12740 |
56952-56972 |
NN |
denotes |
phenylmethylsulfonyl |
| T12739 |
56973-56981 |
NN |
denotes |
fluoride |
| T12741 |
56981-56983 |
, |
denotes |
, |
| T12742 |
56983-56986 |
CC |
denotes |
and |
| T12743 |
56987-56995 |
NN |
denotes |
protease |
| T12744 |
56996-57006 |
NNS |
denotes |
inhibitors |
| T12745 |
57006-57007 |
-RRB- |
denotes |
) |
| T12746 |
57008-57010 |
CC |
denotes |
or |
| T12747 |
57011-57019 |
RB |
denotes |
directly |
| T12748 |
57020-57022 |
IN |
denotes |
in |
| T12749 |
57023-57030 |
NNP |
denotes |
Laemmli |
| T12750 |
57031-57038 |
NN |
denotes |
bβuffer |
| T12751 |
57039-57042 |
CC |
denotes |
and |
| T12752 |
57043-57049 |
VBN |
denotes |
boiled |
| T12753 |
57049-57050 |
. |
denotes |
. |
| T12754 |
57050-57199 |
sentence |
denotes |
For skin tissue: Frozen tissue was pulverized in a liquid nitrogen-cooled Gevebesmascher and the powder scraped into a chilled microcentrifuge tube. |
| T12755 |
57051-57054 |
IN |
denotes |
For |
| T12757 |
57055-57059 |
NN |
denotes |
skin |
| T12758 |
57060-57066 |
NN |
denotes |
tissue |
| T12759 |
57066-57068 |
: |
denotes |
: |
| T12760 |
57068-57074 |
JJ |
denotes |
Frozen |
| T12761 |
57075-57081 |
NN |
denotes |
tissue |
| T12762 |
57082-57085 |
VBD |
denotes |
was |
| T12756 |
57086-57096 |
VBN |
denotes |
pulverized |
| T12763 |
57097-57099 |
IN |
denotes |
in |
| T12764 |
57100-57101 |
DT |
denotes |
a |
| T12766 |
57102-57108 |
JJ |
denotes |
liquid |
| T12767 |
57109-57117 |
NN |
denotes |
nitrogen |
| T12769 |
57117-57118 |
HYPH |
denotes |
- |
| T12768 |
57118-57124 |
VBN |
denotes |
cooled |
| T12765 |
57125-57139 |
NN |
denotes |
Gevebesmascher |
| T12770 |
57140-57143 |
CC |
denotes |
and |
| T12771 |
57144-57147 |
DT |
denotes |
the |
| T12772 |
57148-57154 |
NN |
denotes |
powder |
| T12773 |
57155-57162 |
VBN |
denotes |
scraped |
| T12774 |
57163-57167 |
IN |
denotes |
into |
| T12775 |
57168-57169 |
DT |
denotes |
a |
| T12777 |
57170-57177 |
JJ |
denotes |
chilled |
| T12778 |
57178-57193 |
NN |
denotes |
microcentrifuge |
| T12776 |
57194-57198 |
NN |
denotes |
tube |
| T12779 |
57198-57199 |
. |
denotes |
. |
| T12780 |
57199-57356 |
sentence |
denotes |
RIPA buffer (1% Triton X-100 in PBS with 10 mM EDTA, 150 mN NaCl, 1% sodium deoxycholate, and 0.1% SDS) and protease inhibitors or Laemmli buffer was added. |
| T12781 |
57200-57204 |
NN |
denotes |
RIPA |
| T12782 |
57205-57211 |
NN |
denotes |
buffer |
| T12784 |
57212-57213 |
-LRB- |
denotes |
( |
| T12786 |
57213-57214 |
CD |
denotes |
1 |
| T12787 |
57214-57215 |
NN |
denotes |
% |
| T12788 |
57216-57222 |
NN |
denotes |
Triton |
| T12785 |
57223-57224 |
NN |
denotes |
X |
| T12789 |
57224-57225 |
HYPH |
denotes |
- |
| T12790 |
57225-57228 |
CD |
denotes |
100 |
| T12791 |
57229-57231 |
IN |
denotes |
in |
| T12792 |
57232-57235 |
NN |
denotes |
PBS |
| T12793 |
57236-57240 |
IN |
denotes |
with |
| T12794 |
57241-57243 |
CD |
denotes |
10 |
| T12795 |
57244-57246 |
NN |
denotes |
mM |
| T12796 |
57247-57251 |
NN |
denotes |
EDTA |
| T12797 |
57251-57253 |
, |
denotes |
, |
| T12798 |
57253-57256 |
CD |
denotes |
150 |
| T12799 |
57257-57259 |
NN |
denotes |
mN |
| T12800 |
57260-57264 |
NN |
denotes |
NaCl |
| T12801 |
57264-57266 |
, |
denotes |
, |
| T12802 |
57266-57267 |
CD |
denotes |
1 |
| T12803 |
57267-57268 |
NN |
denotes |
% |
| T12805 |
57269-57275 |
NN |
denotes |
sodium |
| T12804 |
57276-57288 |
NN |
denotes |
deoxycholate |
| T12806 |
57288-57290 |
, |
denotes |
, |
| T12807 |
57290-57293 |
CC |
denotes |
and |
| T12808 |
57294-57297 |
CD |
denotes |
0.1 |
| T12809 |
57297-57298 |
NN |
denotes |
% |
| T12810 |
57299-57302 |
NN |
denotes |
SDS |
| T12811 |
57302-57303 |
-RRB- |
denotes |
) |
| T12812 |
57304-57307 |
CC |
denotes |
and |
| T12813 |
57308-57316 |
NN |
denotes |
protease |
| T12814 |
57317-57327 |
NNS |
denotes |
inhibitors |
| T12815 |
57328-57330 |
CC |
denotes |
or |
| T12816 |
57331-57338 |
NNP |
denotes |
Laemmli |
| T12817 |
57339-57345 |
NN |
denotes |
buffer |
| T12818 |
57346-57349 |
VBD |
denotes |
was |
| T12783 |
57350-57355 |
VBN |
denotes |
added |
| T12819 |
57355-57356 |
. |
denotes |
. |
| T12820 |
57356-57450 |
sentence |
denotes |
The cell suspension was sonicated three times for 15 s and centrifuged at 14,000 rpm at 4 °C. |
| T12821 |
57357-57360 |
DT |
denotes |
The |
| T12823 |
57361-57365 |
NN |
denotes |
cell |
| T12822 |
57366-57376 |
NN |
denotes |
suspension |
| T12825 |
57377-57380 |
VBD |
denotes |
was |
| T12824 |
57381-57390 |
VBN |
denotes |
sonicated |
| T12826 |
57391-57396 |
CD |
denotes |
three |
| T12827 |
57397-57402 |
NNS |
denotes |
times |
| T12828 |
57403-57406 |
IN |
denotes |
for |
| T12829 |
57407-57409 |
CD |
denotes |
15 |
| T12830 |
57410-57411 |
NN |
denotes |
s |
| T12831 |
57412-57415 |
CC |
denotes |
and |
| T12832 |
57416-57427 |
VBN |
denotes |
centrifuged |
| T12833 |
57428-57430 |
IN |
denotes |
at |
| T12834 |
57431-57437 |
CD |
denotes |
14,000 |
| T12835 |
57438-57441 |
NN |
denotes |
rpm |
| T12836 |
57442-57444 |
IN |
denotes |
at |
| T12837 |
57445-57446 |
CD |
denotes |
4 |
| T12838 |
57447-57449 |
NN |
denotes |
°C |
| T12839 |
57449-57450 |
. |
denotes |
. |
| T12840 |
57450-57525 |
sentence |
denotes |
The supernatant was separated from the pellet and used in the experiments. |
| T12841 |
57451-57454 |
DT |
denotes |
The |
| T12842 |
57455-57466 |
NN |
denotes |
supernatant |
| T12844 |
57467-57470 |
VBD |
denotes |
was |
| T12843 |
57471-57480 |
VBN |
denotes |
separated |
| T12845 |
57481-57485 |
IN |
denotes |
from |
| T12846 |
57486-57489 |
DT |
denotes |
the |
| T12847 |
57490-57496 |
NN |
denotes |
pellet |
| T12848 |
57497-57500 |
CC |
denotes |
and |
| T12849 |
57501-57505 |
VBN |
denotes |
used |
| T12850 |
57506-57508 |
IN |
denotes |
in |
| T12851 |
57509-57512 |
DT |
denotes |
the |
| T12852 |
57513-57524 |
NNS |
denotes |
experiments |
| T12853 |
57524-57525 |
. |
denotes |
. |
| T12854 |
57525-57716 |
sentence |
denotes |
Extracts subjected to immunoprecipitation were precleared with Protein G Sepharose (Amersham, Piscataway, New York, United States) and incubated with antibody with rocking overnight at 4 °C. |
| T12855 |
57526-57534 |
NNS |
denotes |
Extracts |
| T12857 |
57535-57544 |
VBN |
denotes |
subjected |
| T12858 |
57545-57547 |
IN |
denotes |
to |
| T12859 |
57548-57567 |
NN |
denotes |
immunoprecipitation |
| T12860 |
57568-57572 |
VBD |
denotes |
were |
| T12856 |
57573-57583 |
VBN |
denotes |
precleared |
| T12861 |
57584-57588 |
IN |
denotes |
with |
| T12862 |
57589-57596 |
NN |
denotes |
Protein |
| T12863 |
57597-57598 |
NN |
denotes |
G |
| T12864 |
57599-57608 |
NN |
denotes |
Sepharose |
| T12865 |
57609-57610 |
-LRB- |
denotes |
( |
| T12866 |
57610-57618 |
NNP |
denotes |
Amersham |
| T12867 |
57618-57620 |
, |
denotes |
, |
| T12868 |
57620-57630 |
NNP |
denotes |
Piscataway |
| T12869 |
57630-57632 |
, |
denotes |
, |
| T12870 |
57632-57635 |
NNP |
denotes |
New |
| T12871 |
57636-57640 |
NNP |
denotes |
York |
| T12872 |
57640-57642 |
, |
denotes |
, |
| T12873 |
57642-57648 |
NNP |
denotes |
United |
| T12874 |
57649-57655 |
NNP |
denotes |
States |
| T12875 |
57655-57656 |
-RRB- |
denotes |
) |
| T12876 |
57657-57660 |
CC |
denotes |
and |
| T12877 |
57661-57670 |
VBN |
denotes |
incubated |
| T12878 |
57671-57675 |
IN |
denotes |
with |
| T12879 |
57676-57684 |
NN |
denotes |
antibody |
| T12880 |
57685-57689 |
IN |
denotes |
with |
| T12881 |
57690-57697 |
NN |
denotes |
rocking |
| T12882 |
57698-57707 |
RB |
denotes |
overnight |
| T12883 |
57708-57710 |
IN |
denotes |
at |
| T12884 |
57711-57712 |
CD |
denotes |
4 |
| T12885 |
57713-57715 |
NN |
denotes |
°C |
| T12886 |
57715-57716 |
. |
denotes |
. |
| T12887 |
57716-57803 |
sentence |
denotes |
Protein G Sepharose was added and samples were incubated for 1 h at 4 °C with rocking. |
| T12888 |
57717-57724 |
NN |
denotes |
Protein |
| T12889 |
57725-57726 |
NN |
denotes |
G |
| T12890 |
57727-57736 |
NN |
denotes |
Sepharose |
| T12892 |
57737-57740 |
VBD |
denotes |
was |
| T12891 |
57741-57746 |
VBN |
denotes |
added |
| T12893 |
57747-57750 |
CC |
denotes |
and |
| T12894 |
57751-57758 |
NNS |
denotes |
samples |
| T12896 |
57759-57763 |
VBD |
denotes |
were |
| T12895 |
57764-57773 |
VBN |
denotes |
incubated |
| T12897 |
57774-57777 |
IN |
denotes |
for |
| T12898 |
57778-57779 |
CD |
denotes |
1 |
| T12899 |
57780-57781 |
NN |
denotes |
h |
| T12900 |
57782-57784 |
IN |
denotes |
at |
| T12901 |
57785-57786 |
CD |
denotes |
4 |
| T12902 |
57787-57789 |
NN |
denotes |
°C |
| T12903 |
57790-57794 |
IN |
denotes |
with |
| T12904 |
57795-57802 |
NN |
denotes |
rocking |
| T12905 |
57802-57803 |
. |
denotes |
. |
| T12906 |
57803-57976 |
sentence |
denotes |
Samples were washed three times for 5 min each in lysis buffer, and the Protein G Sepharose-antibody-antigen pellet was resuspended in Laemmli buffer and boiled for 10 min. |
| T12907 |
57804-57811 |
NNS |
denotes |
Samples |
| T12909 |
57812-57816 |
VBD |
denotes |
were |
| T12908 |
57817-57823 |
VBN |
denotes |
washed |
| T12910 |
57824-57829 |
CD |
denotes |
three |
| T12911 |
57830-57835 |
NNS |
denotes |
times |
| T12912 |
57836-57839 |
IN |
denotes |
for |
| T12913 |
57840-57841 |
CD |
denotes |
5 |
| T12914 |
57842-57845 |
NN |
denotes |
min |
| T12915 |
57846-57850 |
RB |
denotes |
each |
| T12916 |
57851-57853 |
IN |
denotes |
in |
| T12917 |
57854-57859 |
NN |
denotes |
lysis |
| T12918 |
57860-57866 |
NN |
denotes |
buffer |
| T12919 |
57866-57868 |
, |
denotes |
, |
| T12920 |
57868-57871 |
CC |
denotes |
and |
| T12921 |
57872-57875 |
DT |
denotes |
the |
| T12923 |
57876-57883 |
NN |
denotes |
Protein |
| T12924 |
57884-57885 |
NN |
denotes |
G |
| T12926 |
57886-57895 |
NN |
denotes |
Sepharose |
| T12927 |
57895-57896 |
HYPH |
denotes |
- |
| T12928 |
57896-57904 |
NN |
denotes |
antibody |
| T12929 |
57904-57905 |
HYPH |
denotes |
- |
| T12925 |
57905-57912 |
NN |
denotes |
antigen |
| T12922 |
57913-57919 |
NN |
denotes |
pellet |
| T12931 |
57920-57923 |
VBD |
denotes |
was |
| T12930 |
57924-57935 |
VBN |
denotes |
resuspended |
| T12932 |
57936-57938 |
IN |
denotes |
in |
| T12933 |
57939-57946 |
NNP |
denotes |
Laemmli |
| T12934 |
57947-57953 |
NN |
denotes |
buffer |
| T12935 |
57954-57957 |
CC |
denotes |
and |
| T12936 |
57958-57964 |
VBN |
denotes |
boiled |
| T12937 |
57965-57968 |
IN |
denotes |
for |
| T12938 |
57969-57971 |
CD |
denotes |
10 |
| T12939 |
57972-57975 |
NN |
denotes |
min |
| T12940 |
57975-57976 |
. |
denotes |
. |
| T12941 |
57976-58122 |
sentence |
denotes |
Samples were run on SDS-PAGE and transferred to nitrocellulose membrane (Schleicher and Schuell Bioscience, Keene, New Hampshire, United States). |
| T12942 |
57977-57984 |
NNS |
denotes |
Samples |
| T12944 |
57985-57989 |
VBD |
denotes |
were |
| T12943 |
57990-57993 |
VBN |
denotes |
run |
| T12945 |
57994-57996 |
IN |
denotes |
on |
| T12946 |
57997-58000 |
NN |
denotes |
SDS |
| T12948 |
58000-58001 |
HYPH |
denotes |
- |
| T12947 |
58001-58005 |
NN |
denotes |
PAGE |
| T12949 |
58006-58009 |
CC |
denotes |
and |
| T12950 |
58010-58021 |
VBN |
denotes |
transferred |
| T12951 |
58022-58024 |
IN |
denotes |
to |
| T12952 |
58025-58039 |
NN |
denotes |
nitrocellulose |
| T12953 |
58040-58048 |
NN |
denotes |
membrane |
| T12954 |
58049-58050 |
-LRB- |
denotes |
( |
| T12956 |
58050-58060 |
NNP |
denotes |
Schleicher |
| T12957 |
58061-58064 |
CC |
denotes |
and |
| T12958 |
58065-58072 |
NNP |
denotes |
Schuell |
| T12955 |
58073-58083 |
NNP |
denotes |
Bioscience |
| T12959 |
58083-58085 |
, |
denotes |
, |
| T12960 |
58085-58090 |
NNP |
denotes |
Keene |
| T12961 |
58090-58092 |
, |
denotes |
, |
| T12962 |
58092-58095 |
NNP |
denotes |
New |
| T12963 |
58096-58105 |
NNP |
denotes |
Hampshire |
| T12964 |
58105-58107 |
, |
denotes |
, |
| T12965 |
58107-58113 |
NNP |
denotes |
United |
| T12966 |
58114-58120 |
NNP |
denotes |
States |
| T12967 |
58120-58121 |
-RRB- |
denotes |
) |
| T12968 |
58121-58122 |
. |
denotes |
. |
| T12969 |
58122-58213 |
sentence |
denotes |
Western blot signals were developed using the enhanced chemiluminescence kit from Amersham |
| T12970 |
58123-58130 |
NNP |
denotes |
Western |
| T12971 |
58131-58135 |
NN |
denotes |
blot |
| T12972 |
58136-58143 |
NNS |
denotes |
signals |
| T12974 |
58144-58148 |
VBD |
denotes |
were |
| T12973 |
58149-58158 |
VBN |
denotes |
developed |
| T12975 |
58159-58164 |
VBG |
denotes |
using |
| T12976 |
58165-58168 |
DT |
denotes |
the |
| T12978 |
58169-58177 |
VBN |
denotes |
enhanced |
| T12979 |
58178-58195 |
NN |
denotes |
chemiluminescence |
| T12977 |
58196-58199 |
NN |
denotes |
kit |
| T12980 |
58200-58204 |
IN |
denotes |
from |
| T12981 |
58205-58213 |
NNP |
denotes |
Amersham |
| T13041 |
58215-58219 |
NN |
denotes |
Cell |
| T13042 |
58220-58227 |
NN |
denotes |
culture |
| T13043 |
58227-58313 |
sentence |
denotes |
Primary keratinocytes were culture in low-calcium medium as previously described [4]. |
| T13044 |
58228-58235 |
JJ |
denotes |
Primary |
| T13045 |
58236-58249 |
NNS |
denotes |
keratinocytes |
| T13047 |
58250-58254 |
VBD |
denotes |
were |
| T13046 |
58255-58262 |
VBN |
denotes |
culture |
| T13048 |
58263-58265 |
IN |
denotes |
in |
| T13049 |
58266-58269 |
JJ |
denotes |
low |
| T13051 |
58269-58270 |
HYPH |
denotes |
- |
| T13050 |
58270-58277 |
NN |
denotes |
calcium |
| T13052 |
58278-58284 |
NN |
denotes |
medium |
| T13053 |
58285-58287 |
IN |
denotes |
as |
| T13055 |
58288-58298 |
RB |
denotes |
previously |
| T13054 |
58299-58308 |
VBN |
denotes |
described |
| T13056 |
58309-58310 |
-LRB- |
denotes |
[ |
| T13057 |
58310-58311 |
CD |
denotes |
4 |
| T13058 |
58311-58312 |
-RRB- |
denotes |
] |
| T13059 |
58312-58313 |
. |
denotes |
. |
| T13060 |
58313-58463 |
sentence |
denotes |
Transient transfections were carried out with FuGENE6 reagent (Roche, Indianapolis, Indiana, United States) according to the manufacturer's protocol. |
| T13061 |
58314-58323 |
JJ |
denotes |
Transient |
| T13062 |
58324-58337 |
NNS |
denotes |
transfections |
| T13064 |
58338-58342 |
VBD |
denotes |
were |
| T13063 |
58343-58350 |
VBN |
denotes |
carried |
| T13065 |
58351-58354 |
RP |
denotes |
out |
| T13066 |
58355-58359 |
IN |
denotes |
with |
| T13067 |
58360-58367 |
NN |
denotes |
FuGENE6 |
| T13068 |
58368-58375 |
NN |
denotes |
reagent |
| T13069 |
58376-58377 |
-LRB- |
denotes |
( |
| T13070 |
58377-58382 |
NNP |
denotes |
Roche |
| T13071 |
58382-58384 |
, |
denotes |
, |
| T13072 |
58384-58396 |
NNP |
denotes |
Indianapolis |
| T13073 |
58396-58398 |
, |
denotes |
, |
| T13074 |
58398-58405 |
NNP |
denotes |
Indiana |
| T13075 |
58405-58407 |
, |
denotes |
, |
| T13076 |
58407-58413 |
NNP |
denotes |
United |
| T13077 |
58414-58420 |
NNP |
denotes |
States |
| T13078 |
58420-58421 |
-RRB- |
denotes |
) |
| T13079 |
58422-58431 |
VBG |
denotes |
according |
| T13080 |
58432-58434 |
IN |
denotes |
to |
| T13081 |
58435-58438 |
DT |
denotes |
the |
| T13082 |
58439-58451 |
NN |
denotes |
manufacturer |
| T13084 |
58451-58453 |
POS |
denotes |
's |
| T13083 |
58454-58462 |
NN |
denotes |
protocol |
| T13085 |
58462-58463 |
. |
denotes |
. |
| T13086 |
58463-58725 |
sentence |
denotes |
Measurement of β-galactosidase or luciferase levels in promoter activity studies were carried out with the Galacto-Lite assay kit (TROPIX, Bedford, Massachusetts, United States) and the Dual luciferase (Promega, Madison, Wisconsin, United States), respectively. |
| T13087 |
58464-58475 |
NN |
denotes |
Measurement |
| T13089 |
58476-58478 |
IN |
denotes |
of |
| T13090 |
58479-58480 |
NN |
denotes |
β |
| T13092 |
58480-58481 |
HYPH |
denotes |
- |
| T13091 |
58481-58494 |
NN |
denotes |
galactosidase |
| T13094 |
58495-58497 |
CC |
denotes |
or |
| T13095 |
58498-58508 |
NN |
denotes |
luciferase |
| T13093 |
58509-58515 |
NNS |
denotes |
levels |
| T13096 |
58516-58518 |
IN |
denotes |
in |
| T13097 |
58519-58527 |
NN |
denotes |
promoter |
| T13098 |
58528-58536 |
NN |
denotes |
activity |
| T13099 |
58537-58544 |
NNS |
denotes |
studies |
| T13100 |
58545-58549 |
VBD |
denotes |
were |
| T13088 |
58550-58557 |
VBN |
denotes |
carried |
| T13101 |
58558-58561 |
RP |
denotes |
out |
| T13102 |
58562-58566 |
IN |
denotes |
with |
| T13103 |
58567-58570 |
DT |
denotes |
the |
| T13105 |
58571-58578 |
NNP |
denotes |
Galacto |
| T13107 |
58578-58579 |
HYPH |
denotes |
- |
| T13106 |
58579-58583 |
NNP |
denotes |
Lite |
| T13108 |
58584-58589 |
NN |
denotes |
assay |
| T13104 |
58590-58593 |
NN |
denotes |
kit |
| T13109 |
58594-58595 |
-LRB- |
denotes |
( |
| T13110 |
58595-58601 |
NNP |
denotes |
TROPIX |
| T13111 |
58601-58603 |
, |
denotes |
, |
| T13112 |
58603-58610 |
NNP |
denotes |
Bedford |
| T13113 |
58610-58612 |
, |
denotes |
, |
| T13114 |
58612-58625 |
NNP |
denotes |
Massachusetts |
| T13115 |
58625-58627 |
, |
denotes |
, |
| T13116 |
58627-58633 |
NNP |
denotes |
United |
| T13117 |
58634-58640 |
NNP |
denotes |
States |
| T13118 |
58640-58641 |
-RRB- |
denotes |
) |
| T13119 |
58642-58645 |
CC |
denotes |
and |
| T13120 |
58646-58649 |
DT |
denotes |
the |
| T13122 |
58650-58654 |
JJ |
denotes |
Dual |
| T13121 |
58655-58665 |
NN |
denotes |
luciferase |
| T13123 |
58666-58667 |
-LRB- |
denotes |
( |
| T13124 |
58667-58674 |
NNP |
denotes |
Promega |
| T13125 |
58674-58676 |
, |
denotes |
, |
| T13126 |
58676-58683 |
NNP |
denotes |
Madison |
| T13127 |
58683-58685 |
, |
denotes |
, |
| T13128 |
58685-58694 |
NNP |
denotes |
Wisconsin |
| T13129 |
58694-58696 |
, |
denotes |
, |
| T13130 |
58696-58702 |
NNP |
denotes |
United |
| T13131 |
58703-58709 |
NNP |
denotes |
States |
| T13132 |
58709-58710 |
-RRB- |
denotes |
) |
| T13133 |
58710-58712 |
, |
denotes |
, |
| T13134 |
58712-58724 |
RB |
denotes |
respectively |
| T13135 |
58724-58725 |
. |
denotes |
. |
| T13136 |
58725-58813 |
sentence |
denotes |
Runella luciferase was cotransfected into cells to correct for transfection efficiency. |
| T13137 |
58726-58733 |
NN |
denotes |
Runella |
| T13138 |
58734-58744 |
NN |
denotes |
luciferase |
| T13140 |
58745-58748 |
VBD |
denotes |
was |
| T13139 |
58749-58762 |
VBN |
denotes |
cotransfected |
| T13141 |
58763-58767 |
IN |
denotes |
into |
| T13142 |
58768-58773 |
NNS |
denotes |
cells |
| T13143 |
58774-58776 |
TO |
denotes |
to |
| T13144 |
58777-58784 |
VB |
denotes |
correct |
| T13145 |
58785-58788 |
IN |
denotes |
for |
| T13146 |
58789-58801 |
NN |
denotes |
transfection |
| T13147 |
58802-58812 |
NN |
denotes |
efficiency |
| T13148 |
58812-58813 |
. |
denotes |
. |
| T13149 |
58813-58884 |
sentence |
denotes |
Experiments were done in triplicate and repeated at least three times. |
| T13150 |
58814-58825 |
NNS |
denotes |
Experiments |
| T13152 |
58826-58830 |
VBD |
denotes |
were |
| T13151 |
58831-58835 |
VBN |
denotes |
done |
| T13153 |
58836-58838 |
IN |
denotes |
in |
| T13154 |
58839-58849 |
NN |
denotes |
triplicate |
| T13155 |
58850-58853 |
CC |
denotes |
and |
| T13156 |
58854-58862 |
VBN |
denotes |
repeated |
| T13157 |
58863-58865 |
RB |
denotes |
at |
| T13159 |
58866-58871 |
RBS |
denotes |
least |
| T13158 |
58872-58877 |
CD |
denotes |
three |
| T13160 |
58878-58883 |
NNS |
denotes |
times |
| T13161 |
58883-58884 |
. |
denotes |
. |
| T13162 |
58884-58979 |
sentence |
denotes |
Measurements were done on a luminometer (MGM Instruments, Hamden, Connecticut, United States). |
| T13163 |
58885-58897 |
NNS |
denotes |
Measurements |
| T13165 |
58898-58902 |
VBD |
denotes |
were |
| T13164 |
58903-58907 |
VBN |
denotes |
done |
| T13166 |
58908-58910 |
IN |
denotes |
on |
| T13167 |
58911-58912 |
DT |
denotes |
a |
| T13168 |
58913-58924 |
NN |
denotes |
luminometer |
| T13169 |
58925-58926 |
-LRB- |
denotes |
( |
| T13171 |
58926-58929 |
NNP |
denotes |
MGM |
| T13170 |
58930-58941 |
NNP |
denotes |
Instruments |
| T13172 |
58941-58943 |
, |
denotes |
, |
| T13173 |
58943-58949 |
NNP |
denotes |
Hamden |
| T13174 |
58949-58951 |
, |
denotes |
, |
| T13175 |
58951-58962 |
NNP |
denotes |
Connecticut |
| T13176 |
58962-58964 |
, |
denotes |
, |
| T13177 |
58964-58970 |
NNP |
denotes |
United |
| T13178 |
58971-58977 |
NNP |
denotes |
States |
| T13179 |
58977-58978 |
-RRB- |
denotes |
) |
| T13180 |
58978-58979 |
. |
denotes |
. |
| T13181 |
58979-59139 |
sentence |
denotes |
For experiments measuring phosphorylation of MAPK, keratinocytes were serum starved for 3 h prior to harvesting of cells by incubation in medium lacking serum. |
| T13182 |
58980-58983 |
IN |
denotes |
For |
| T13184 |
58984-58995 |
NNS |
denotes |
experiments |
| T13185 |
58996-59005 |
VBG |
denotes |
measuring |
| T13186 |
59006-59021 |
NN |
denotes |
phosphorylation |
| T13187 |
59022-59024 |
IN |
denotes |
of |
| T13188 |
59025-59029 |
NN |
denotes |
MAPK |
| T13189 |
59029-59031 |
, |
denotes |
, |
| T13190 |
59031-59044 |
NNS |
denotes |
keratinocytes |
| T13191 |
59045-59049 |
VBD |
denotes |
were |
| T13192 |
59050-59055 |
NN |
denotes |
serum |
| T13183 |
59056-59063 |
VBN |
denotes |
starved |
| T13193 |
59064-59067 |
IN |
denotes |
for |
| T13194 |
59068-59069 |
CD |
denotes |
3 |
| T13195 |
59070-59071 |
NN |
denotes |
h |
| T13196 |
59072-59077 |
JJ |
denotes |
prior |
| T13197 |
59078-59080 |
IN |
denotes |
to |
| T13198 |
59081-59091 |
NN |
denotes |
harvesting |
| T13199 |
59092-59094 |
IN |
denotes |
of |
| T13200 |
59095-59100 |
NNS |
denotes |
cells |
| T13201 |
59101-59103 |
IN |
denotes |
by |
| T13202 |
59104-59114 |
NN |
denotes |
incubation |
| T13203 |
59115-59117 |
IN |
denotes |
in |
| T13204 |
59118-59124 |
NN |
denotes |
medium |
| T13205 |
59125-59132 |
VBG |
denotes |
lacking |
| T13206 |
59133-59138 |
NN |
denotes |
serum |
| T13207 |
59138-59139 |
. |
denotes |
. |
| T13208 |
59139-59228 |
sentence |
denotes |
Treatment of cells with Wnt- and noggin-conditioned medium was previously described [4]. |
| T13209 |
59140-59149 |
NN |
denotes |
Treatment |
| T13211 |
59150-59152 |
IN |
denotes |
of |
| T13212 |
59153-59158 |
NNS |
denotes |
cells |
| T13213 |
59159-59163 |
IN |
denotes |
with |
| T13214 |
59164-59167 |
NN |
denotes |
Wnt |
| T13216 |
59167-59168 |
HYPH |
denotes |
- |
| T13217 |
59169-59172 |
CC |
denotes |
and |
| T13218 |
59173-59179 |
NN |
denotes |
noggin |
| T13219 |
59179-59180 |
HYPH |
denotes |
- |
| T13215 |
59180-59191 |
VBN |
denotes |
conditioned |
| T13220 |
59192-59198 |
NN |
denotes |
medium |
| T13221 |
59199-59202 |
VBD |
denotes |
was |
| T13222 |
59203-59213 |
RB |
denotes |
previously |
| T13210 |
59214-59223 |
VBN |
denotes |
described |
| T13223 |
59224-59225 |
-LRB- |
denotes |
[ |
| T13224 |
59225-59226 |
CD |
denotes |
4 |
| T13225 |
59226-59227 |
-RRB- |
denotes |
] |
| T13226 |
59227-59228 |
. |
denotes |
. |
| T13308 |
59230-59240 |
NNS |
denotes |
Constructs |
| T13309 |
59240-59521 |
sentence |
denotes |
The 2.2-kb murine Snail promoter was generated by PCR using a forward primer with an XbaI linker sequence, 5′- TCTAGAATTGTTTGCTGCTGTATGGTCTTC-3′, along with a reverse primer with a BglII linker sequence, 5′- AGATCTGTTGGCCAGAGCGACCTAG- GTAG-3′, and mouse genomic DNA as a template. |
| T13310 |
59241-59244 |
DT |
denotes |
The |
| T13312 |
59245-59248 |
CD |
denotes |
2.2 |
| T13314 |
59248-59249 |
HYPH |
denotes |
- |
| T13313 |
59249-59251 |
NN |
denotes |
kb |
| T13315 |
59252-59258 |
JJ |
denotes |
murine |
| T13316 |
59259-59264 |
NN |
denotes |
Snail |
| T13311 |
59265-59273 |
NN |
denotes |
promoter |
| T13318 |
59274-59277 |
VBD |
denotes |
was |
| T13317 |
59278-59287 |
VBN |
denotes |
generated |
| T13319 |
59288-59290 |
IN |
denotes |
by |
| T13320 |
59291-59294 |
NN |
denotes |
PCR |
| T13321 |
59295-59300 |
VBG |
denotes |
using |
| T13322 |
59301-59302 |
DT |
denotes |
a |
| T13324 |
59303-59310 |
JJ |
denotes |
forward |
| T13323 |
59311-59317 |
NN |
denotes |
primer |
| T13325 |
59318-59322 |
IN |
denotes |
with |
| T13326 |
59323-59325 |
DT |
denotes |
an |
| T13328 |
59326-59330 |
NN |
denotes |
XbaI |
| T13329 |
59331-59337 |
NN |
denotes |
linker |
| T13327 |
59338-59346 |
NN |
denotes |
sequence |
| T13330 |
59346-59348 |
, |
denotes |
, |
| T13331 |
59348-59349 |
CD |
denotes |
5 |
| T13333 |
59349-59350 |
SYM |
denotes |
′ |
| T13334 |
59350-59351 |
HYPH |
denotes |
- |
| T13332 |
59352-59382 |
NN |
denotes |
TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
| T13335 |
59382-59383 |
HYPH |
denotes |
- |
| T13336 |
59383-59384 |
CD |
denotes |
3 |
| T13337 |
59384-59385 |
SYM |
denotes |
′ |
| T13338 |
59385-59387 |
, |
denotes |
, |
| T13339 |
59387-59392 |
IN |
denotes |
along |
| T13340 |
59393-59397 |
IN |
denotes |
with |
| T13341 |
59398-59399 |
DT |
denotes |
a |
| T13343 |
59400-59407 |
JJ |
denotes |
reverse |
| T13342 |
59408-59414 |
NN |
denotes |
primer |
| T13344 |
59415-59419 |
IN |
denotes |
with |
| T13345 |
59420-59421 |
DT |
denotes |
a |
| T13347 |
59422-59427 |
NN |
denotes |
BglII |
| T13348 |
59428-59434 |
NN |
denotes |
linker |
| T13346 |
59435-59443 |
NN |
denotes |
sequence |
| T13349 |
59443-59445 |
, |
denotes |
, |
| T13350 |
59445-59446 |
CD |
denotes |
5 |
| T13352 |
59446-59447 |
SYM |
denotes |
′ |
| T13353 |
59447-59448 |
HYPH |
denotes |
- |
| T13354 |
59449-59474 |
NN |
denotes |
AGATCTGTTGGCCAGAGCGACCTAG |
| T13355 |
59474-59475 |
HYPH |
denotes |
- |
| T13351 |
59476-59480 |
NN |
denotes |
GTAG |
| T13356 |
59480-59481 |
HYPH |
denotes |
- |
| T13357 |
59481-59482 |
CD |
denotes |
3 |
| T13358 |
59482-59483 |
SYM |
denotes |
′ |
| T13359 |
59483-59485 |
, |
denotes |
, |
| T13360 |
59485-59488 |
CC |
denotes |
and |
| T13361 |
59489-59494 |
NN |
denotes |
mouse |
| T13363 |
59495-59502 |
JJ |
denotes |
genomic |
| T13362 |
59503-59506 |
NN |
denotes |
DNA |
| T13364 |
59507-59509 |
IN |
denotes |
as |
| T13365 |
59510-59511 |
DT |
denotes |
a |
| T13366 |
59512-59520 |
NN |
denotes |
template |
| T13367 |
59520-59521 |
. |
denotes |
. |
| T13368 |
59521-59713 |
sentence |
denotes |
The PCR product was purified with the Gel Extraction Kit (Qiagen, Valencia, California, United States) and ligated into pCRII-TOPO TA vector (Invitrogen, Carlsbad, California, United States). |
| T13369 |
59522-59525 |
DT |
denotes |
The |
| T13371 |
59526-59529 |
NN |
denotes |
PCR |
| T13370 |
59530-59537 |
NN |
denotes |
product |
| T13373 |
59538-59541 |
VBD |
denotes |
was |
| T13372 |
59542-59550 |
VBN |
denotes |
purified |
| T13374 |
59551-59555 |
IN |
denotes |
with |
| T13375 |
59556-59559 |
DT |
denotes |
the |
| T13377 |
59560-59563 |
NN |
denotes |
Gel |
| T13378 |
59564-59574 |
NN |
denotes |
Extraction |
| T13376 |
59575-59578 |
NN |
denotes |
Kit |
| T13379 |
59579-59580 |
-LRB- |
denotes |
( |
| T13380 |
59580-59586 |
NNP |
denotes |
Qiagen |
| T13381 |
59586-59588 |
, |
denotes |
, |
| T13382 |
59588-59596 |
NNP |
denotes |
Valencia |
| T13383 |
59596-59598 |
, |
denotes |
, |
| T13384 |
59598-59608 |
NNP |
denotes |
California |
| T13385 |
59608-59610 |
, |
denotes |
, |
| T13386 |
59610-59616 |
NNP |
denotes |
United |
| T13387 |
59617-59623 |
NNP |
denotes |
States |
| T13388 |
59623-59624 |
-RRB- |
denotes |
) |
| T13389 |
59625-59628 |
CC |
denotes |
and |
| T13390 |
59629-59636 |
VBN |
denotes |
ligated |
| T13391 |
59637-59641 |
IN |
denotes |
into |
| T13392 |
59642-59647 |
NN |
denotes |
pCRII |
| T13394 |
59647-59648 |
HYPH |
denotes |
- |
| T13393 |
59648-59652 |
NN |
denotes |
TOPO |
| T13396 |
59653-59655 |
NN |
denotes |
TA |
| T13395 |
59656-59662 |
NN |
denotes |
vector |
| T13397 |
59663-59664 |
-LRB- |
denotes |
( |
| T13398 |
59664-59674 |
NNP |
denotes |
Invitrogen |
| T13399 |
59674-59676 |
, |
denotes |
, |
| T13400 |
59676-59684 |
NNP |
denotes |
Carlsbad |
| T13401 |
59684-59686 |
, |
denotes |
, |
| T13402 |
59686-59696 |
NNP |
denotes |
California |
| T13403 |
59696-59698 |
, |
denotes |
, |
| T13404 |
59698-59704 |
NNP |
denotes |
United |
| T13405 |
59705-59711 |
NNP |
denotes |
States |
| T13406 |
59711-59712 |
-RRB- |
denotes |
) |
| T13407 |
59712-59713 |
. |
denotes |
. |
| T13408 |
59713-59894 |
sentence |
denotes |
The promoter was verified by sequencing and digested with XbaI and BglII and subcloned into the pβ-gal BASIC vector (BD Biosciences Clontech, Palo Alto, California, United States). |
| T13409 |
59714-59717 |
DT |
denotes |
The |
| T13410 |
59718-59726 |
NN |
denotes |
promoter |
| T13412 |
59727-59730 |
VBD |
denotes |
was |
| T13411 |
59731-59739 |
VBN |
denotes |
verified |
| T13413 |
59740-59742 |
IN |
denotes |
by |
| T13414 |
59743-59753 |
NN |
denotes |
sequencing |
| T13415 |
59754-59757 |
CC |
denotes |
and |
| T13416 |
59758-59766 |
VBN |
denotes |
digested |
| T13417 |
59767-59771 |
IN |
denotes |
with |
| T13418 |
59772-59776 |
NN |
denotes |
XbaI |
| T13419 |
59777-59780 |
CC |
denotes |
and |
| T13420 |
59781-59786 |
NN |
denotes |
BglII |
| T13421 |
59787-59790 |
CC |
denotes |
and |
| T13422 |
59791-59800 |
VBN |
denotes |
subcloned |
| T13423 |
59801-59805 |
IN |
denotes |
into |
| T13424 |
59806-59809 |
DT |
denotes |
the |
| T13426 |
59810-59812 |
NN |
denotes |
pβ |
| T13428 |
59812-59813 |
HYPH |
denotes |
- |
| T13427 |
59813-59816 |
NN |
denotes |
gal |
| T13429 |
59817-59822 |
NN |
denotes |
BASIC |
| T13425 |
59823-59829 |
NN |
denotes |
vector |
| T13430 |
59830-59831 |
-LRB- |
denotes |
( |
| T13432 |
59831-59833 |
NNP |
denotes |
BD |
| T13433 |
59834-59845 |
NNP |
denotes |
Biosciences |
| T13431 |
59846-59854 |
NNP |
denotes |
Clontech |
| T13434 |
59854-59856 |
, |
denotes |
, |
| T13435 |
59856-59860 |
NNP |
denotes |
Palo |
| T13436 |
59861-59865 |
NNP |
denotes |
Alto |
| T13437 |
59865-59867 |
, |
denotes |
, |
| T13438 |
59867-59877 |
NNP |
denotes |
California |
| T13439 |
59877-59879 |
, |
denotes |
, |
| T13440 |
59879-59885 |
NNP |
denotes |
United |
| T13441 |
59886-59892 |
NNP |
denotes |
States |
| T13442 |
59892-59893 |
-RRB- |
denotes |
) |
| T13443 |
59893-59894 |
. |
denotes |
. |
| T13444 |
59894-60188 |
sentence |
denotes |
The point mutations in the SMAD binding element was generated with the Quik-Change Kit (Stratagene, La Jolla, California, United States) using the forward primer 5′- GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC-3′ and the reverse primer 5′- GCTTTT- CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC-3′. |
| T13445 |
59895-59898 |
DT |
denotes |
The |
| T13447 |
59899-59904 |
NN |
denotes |
point |
| T13446 |
59905-59914 |
NNS |
denotes |
mutations |
| T13449 |
59915-59917 |
IN |
denotes |
in |
| T13450 |
59918-59921 |
DT |
denotes |
the |
| T13452 |
59922-59926 |
NN |
denotes |
SMAD |
| T13453 |
59927-59934 |
NN |
denotes |
binding |
| T13451 |
59935-59942 |
NN |
denotes |
element |
| T13454 |
59943-59946 |
VBD |
denotes |
was |
| T13448 |
59947-59956 |
VBN |
denotes |
generated |
| T13455 |
59957-59961 |
IN |
denotes |
with |
| T13456 |
59962-59965 |
DT |
denotes |
the |
| T13458 |
59966-59970 |
NNP |
denotes |
Quik |
| T13460 |
59970-59971 |
HYPH |
denotes |
- |
| T13459 |
59971-59977 |
NNP |
denotes |
Change |
| T13457 |
59978-59981 |
NNP |
denotes |
Kit |
| T13461 |
59982-59983 |
-LRB- |
denotes |
( |
| T13462 |
59983-59993 |
NNP |
denotes |
Stratagene |
| T13463 |
59993-59995 |
, |
denotes |
, |
| T13464 |
59995-59997 |
NNP |
denotes |
La |
| T13465 |
59998-60003 |
NNP |
denotes |
Jolla |
| T13466 |
60003-60005 |
, |
denotes |
, |
| T13467 |
60005-60015 |
NNP |
denotes |
California |
| T13468 |
60015-60017 |
, |
denotes |
, |
| T13469 |
60017-60023 |
NNP |
denotes |
United |
| T13470 |
60024-60030 |
NNP |
denotes |
States |
| T13471 |
60030-60031 |
-RRB- |
denotes |
) |
| T13472 |
60032-60037 |
VBG |
denotes |
using |
| T13473 |
60038-60041 |
DT |
denotes |
the |
| T13475 |
60042-60049 |
JJ |
denotes |
forward |
| T13474 |
60050-60056 |
NN |
denotes |
primer |
| T13476 |
60057-60058 |
CD |
denotes |
5 |
| T13478 |
60058-60059 |
SYM |
denotes |
′ |
| T13479 |
60059-60060 |
HYPH |
denotes |
- |
| T13477 |
60061-60106 |
NN |
denotes |
GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
| T13480 |
60106-60107 |
HYPH |
denotes |
- |
| T13481 |
60107-60108 |
CD |
denotes |
3 |
| T13482 |
60108-60109 |
SYM |
denotes |
′ |
| T13483 |
60110-60113 |
CC |
denotes |
and |
| T13484 |
60114-60117 |
DT |
denotes |
the |
| T13486 |
60118-60125 |
JJ |
denotes |
reverse |
| T13485 |
60126-60132 |
NN |
denotes |
primer |
| T13487 |
60133-60134 |
CD |
denotes |
5 |
| T13489 |
60134-60135 |
SYM |
denotes |
′ |
| T13490 |
60135-60136 |
HYPH |
denotes |
- |
| T13491 |
60137-60143 |
NN |
denotes |
GCTTTT |
| T13492 |
60143-60144 |
HYPH |
denotes |
- |
| T13488 |
60145-60184 |
NN |
denotes |
CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
| T13493 |
60184-60185 |
HYPH |
denotes |
- |
| T13494 |
60185-60186 |
CD |
denotes |
3 |
| T13495 |
60186-60187 |
SYM |
denotes |
′ |
| T13496 |
60187-60188 |
. |
denotes |
. |
| T13497 |
60188-60421 |
sentence |
denotes |
The probes for the Snail in situ hybridization were generated against the 3′ UTR by PCR using the forward primer 5′- ACCTTCTCCCGCATGTCCTTGCTCC-3′ and the reverse primer 5′- CTGCTGAGGCATGGTTACAGCTGG-3′, and genomic DNA as a template. |
| T13498 |
60189-60192 |
DT |
denotes |
The |
| T13499 |
60193-60199 |
NNS |
denotes |
probes |
| T13501 |
60200-60203 |
IN |
denotes |
for |
| T13502 |
60204-60207 |
DT |
denotes |
the |
| T13504 |
60208-60213 |
NN |
denotes |
Snail |
| T13505 |
60214-60216 |
FW |
denotes |
in |
| T13506 |
60217-60221 |
FW |
denotes |
situ |
| T13503 |
60222-60235 |
NN |
denotes |
hybridization |
| T13507 |
60236-60240 |
VBD |
denotes |
were |
| T13500 |
60241-60250 |
VBN |
denotes |
generated |
| T13508 |
60251-60258 |
IN |
denotes |
against |
| T13509 |
60259-60262 |
DT |
denotes |
the |
| T13511 |
60263-60264 |
CD |
denotes |
3 |
| T13512 |
60264-60265 |
SYM |
denotes |
′ |
| T13510 |
60266-60269 |
NN |
denotes |
UTR |
| T13513 |
60270-60272 |
IN |
denotes |
by |
| T13514 |
60273-60276 |
NN |
denotes |
PCR |
| T13515 |
60277-60282 |
VBG |
denotes |
using |
| T13516 |
60283-60286 |
DT |
denotes |
the |
| T13518 |
60287-60294 |
JJ |
denotes |
forward |
| T13517 |
60295-60301 |
NN |
denotes |
primer |
| T13519 |
60302-60303 |
CD |
denotes |
5 |
| T13521 |
60303-60304 |
SYM |
denotes |
′ |
| T13522 |
60304-60305 |
HYPH |
denotes |
- |
| T13520 |
60306-60331 |
NN |
denotes |
ACCTTCTCCCGCATGTCCTTGCTCC |
| T13523 |
60331-60332 |
HYPH |
denotes |
- |
| T13524 |
60332-60333 |
CD |
denotes |
3 |
| T13525 |
60333-60334 |
SYM |
denotes |
′ |
| T13526 |
60335-60338 |
CC |
denotes |
and |
| T13527 |
60339-60342 |
DT |
denotes |
the |
| T13529 |
60343-60350 |
JJ |
denotes |
reverse |
| T13528 |
60351-60357 |
NN |
denotes |
primer |
| T13530 |
60358-60359 |
CD |
denotes |
5 |
| T13532 |
60359-60360 |
SYM |
denotes |
′ |
| T13533 |
60360-60361 |
HYPH |
denotes |
- |
| T13531 |
60362-60386 |
NN |
denotes |
CTGCTGAGGCATGGTTACAGCTGG |
| T13534 |
60386-60387 |
HYPH |
denotes |
- |
| T13535 |
60387-60388 |
CD |
denotes |
3 |
| T13536 |
60388-60389 |
SYM |
denotes |
′ |
| T13537 |
60389-60391 |
, |
denotes |
, |
| T13538 |
60391-60394 |
CC |
denotes |
and |
| T13539 |
60395-60402 |
JJ |
denotes |
genomic |
| T13540 |
60403-60406 |
NN |
denotes |
DNA |
| T13541 |
60407-60409 |
IN |
denotes |
as |
| T13542 |
60410-60411 |
DT |
denotes |
a |
| T13543 |
60412-60420 |
NN |
denotes |
template |
| T13544 |
60420-60421 |
. |
denotes |
. |
| T13545 |
60421-60493 |
sentence |
denotes |
The PCR product was gel purified and ligated into pCRII-TOPO TA vector. |
| T13546 |
60422-60425 |
DT |
denotes |
The |
| T13548 |
60426-60429 |
NN |
denotes |
PCR |
| T13547 |
60430-60437 |
NN |
denotes |
product |
| T13550 |
60438-60441 |
VBD |
denotes |
was |
| T13551 |
60442-60445 |
NN |
denotes |
gel |
| T13549 |
60446-60454 |
VBN |
denotes |
purified |
| T13552 |
60455-60458 |
CC |
denotes |
and |
| T13553 |
60459-60466 |
VBN |
denotes |
ligated |
| T13554 |
60467-60471 |
IN |
denotes |
into |
| T13555 |
60472-60477 |
NN |
denotes |
pCRII |
| T13557 |
60477-60478 |
HYPH |
denotes |
- |
| T13556 |
60478-60482 |
NN |
denotes |
TOPO |
| T13559 |
60483-60485 |
NN |
denotes |
TA |
| T13558 |
60486-60492 |
NN |
denotes |
vector |
| T13560 |
60492-60493 |
. |
denotes |
. |
| T13561 |
60493-60654 |
sentence |
denotes |
The pre-LIM domain of Ajuba was generated essentially as described [9], but was fused to GFP by subcloning from the pEGFP-N1 20 vector (BD Biosciences Clontech) |
| T13562 |
60494-60497 |
DT |
denotes |
The |
| T13564 |
60498-60505 |
JJ |
denotes |
pre-LIM |
| T13563 |
60506-60512 |
NN |
denotes |
domain |
| T13566 |
60513-60515 |
IN |
denotes |
of |
| T13567 |
60516-60521 |
NN |
denotes |
Ajuba |
| T13568 |
60522-60525 |
VBD |
denotes |
was |
| T13565 |
60526-60535 |
VBN |
denotes |
generated |
| T13569 |
60536-60547 |
RB |
denotes |
essentially |
| T13570 |
60548-60550 |
IN |
denotes |
as |
| T13571 |
60551-60560 |
VBN |
denotes |
described |
| T13572 |
60561-60562 |
-LRB- |
denotes |
[ |
| T13573 |
60562-60563 |
CD |
denotes |
9 |
| T13574 |
60563-60564 |
-RRB- |
denotes |
] |
| T13575 |
60564-60566 |
, |
denotes |
, |
| T13576 |
60566-60569 |
CC |
denotes |
but |
| T13577 |
60570-60573 |
VBD |
denotes |
was |
| T13578 |
60574-60579 |
VBN |
denotes |
fused |
| T13579 |
60580-60582 |
IN |
denotes |
to |
| T13580 |
60583-60586 |
NN |
denotes |
GFP |
| T13581 |
60587-60589 |
IN |
denotes |
by |
| T13582 |
60590-60600 |
VBG |
denotes |
subcloning |
| T13583 |
60601-60605 |
IN |
denotes |
from |
| T13584 |
60606-60609 |
DT |
denotes |
the |
| T13586 |
60610-60615 |
NN |
denotes |
pEGFP |
| T13588 |
60615-60616 |
HYPH |
denotes |
- |
| T13587 |
60616-60618 |
NN |
denotes |
N1 |
| T13589 |
60619-60621 |
CD |
denotes |
20 |
| T13585 |
60622-60628 |
NN |
denotes |
vector |
| T13590 |
60629-60630 |
-LRB- |
denotes |
( |
| T13592 |
60630-60632 |
NNP |
denotes |
BD |
| T13593 |
60633-60644 |
NNP |
denotes |
Biosciences |
| T13591 |
60645-60653 |
NNP |
denotes |
Clontech |
| T13594 |
60653-60654 |
-RRB- |
denotes |
) |
| T13649 |
60656-60658 |
FW |
denotes |
In |
| T13650 |
60659-60663 |
FW |
denotes |
situ |
| T13651 |
60664-60677 |
NN |
denotes |
hybridization |
| T13652 |
60677-60840 |
sentence |
denotes |
The pCRII-TOPO TA vector containing a region of the 3′ UTR of Snail was used as a template to generate digoxigenin-labeled sense and antisense riboprobes (Roche). |
| T13653 |
60678-60681 |
DT |
denotes |
The |
| T13655 |
60682-60687 |
NN |
denotes |
pCRII |
| T13657 |
60687-60688 |
HYPH |
denotes |
- |
| T13656 |
60688-60692 |
NN |
denotes |
TOPO |
| T13658 |
60693-60695 |
NN |
denotes |
TA |
| T13654 |
60696-60702 |
NN |
denotes |
vector |
| T13660 |
60703-60713 |
VBG |
denotes |
containing |
| T13661 |
60714-60715 |
DT |
denotes |
a |
| T13662 |
60716-60722 |
NN |
denotes |
region |
| T13663 |
60723-60725 |
IN |
denotes |
of |
| T13664 |
60726-60729 |
DT |
denotes |
the |
| T13666 |
60730-60731 |
CD |
denotes |
3 |
| T13667 |
60731-60732 |
SYM |
denotes |
′ |
| T13665 |
60733-60736 |
NN |
denotes |
UTR |
| T13668 |
60737-60739 |
IN |
denotes |
of |
| T13669 |
60740-60745 |
NN |
denotes |
Snail |
| T13670 |
60746-60749 |
VBD |
denotes |
was |
| T13659 |
60750-60754 |
VBN |
denotes |
used |
| T13671 |
60755-60757 |
IN |
denotes |
as |
| T13672 |
60758-60759 |
DT |
denotes |
a |
| T13673 |
60760-60768 |
NN |
denotes |
template |
| T13674 |
60769-60771 |
TO |
denotes |
to |
| T13675 |
60772-60780 |
VB |
denotes |
generate |
| T13676 |
60781-60792 |
NN |
denotes |
digoxigenin |
| T13678 |
60792-60793 |
HYPH |
denotes |
- |
| T13677 |
60793-60800 |
VBN |
denotes |
labeled |
| T13680 |
60801-60806 |
NN |
denotes |
sense |
| T13681 |
60807-60810 |
CC |
denotes |
and |
| T13682 |
60811-60820 |
NN |
denotes |
antisense |
| T13679 |
60821-60831 |
NNS |
denotes |
riboprobes |
| T13683 |
60832-60833 |
-LRB- |
denotes |
( |
| T13684 |
60833-60838 |
NNP |
denotes |
Roche |
| T13685 |
60838-60839 |
-RRB- |
denotes |
) |
| T13686 |
60839-60840 |
. |
denotes |
. |
| T13687 |
60840-60906 |
sentence |
denotes |
The respective probes were obtained by XhoI and BamH1 digestions. |
| T13688 |
60841-60844 |
DT |
denotes |
The |
| T13690 |
60845-60855 |
JJ |
denotes |
respective |
| T13689 |
60856-60862 |
NNS |
denotes |
probes |
| T13692 |
60863-60867 |
VBD |
denotes |
were |
| T13691 |
60868-60876 |
VBN |
denotes |
obtained |
| T13693 |
60877-60879 |
IN |
denotes |
by |
| T13694 |
60880-60884 |
NN |
denotes |
XhoI |
| T13696 |
60885-60888 |
CC |
denotes |
and |
| T13697 |
60889-60894 |
NN |
denotes |
BamH1 |
| T13695 |
60895-60905 |
NNS |
denotes |
digestions |
| T13698 |
60905-60906 |
. |
denotes |
. |
| T13699 |
60906-60992 |
sentence |
denotes |
In situ hybridizations were performed on 10-μm thick sections of E17.5 mouse embryos. |
| T13700 |
60907-60909 |
FW |
denotes |
In |
| T13701 |
60910-60914 |
FW |
denotes |
situ |
| T13702 |
60915-60929 |
NNS |
denotes |
hybridizations |
| T13704 |
60930-60934 |
VBD |
denotes |
were |
| T13703 |
60935-60944 |
VBN |
denotes |
performed |
| T13705 |
60945-60947 |
IN |
denotes |
on |
| T13706 |
60948-60950 |
CD |
denotes |
10 |
| T13708 |
60950-60951 |
HYPH |
denotes |
- |
| T13707 |
60951-60953 |
NN |
denotes |
μm |
| T13709 |
60954-60959 |
JJ |
denotes |
thick |
| T13710 |
60960-60968 |
NNS |
denotes |
sections |
| T13711 |
60969-60971 |
IN |
denotes |
of |
| T13712 |
60972-60977 |
NN |
denotes |
E17.5 |
| T13714 |
60978-60983 |
NN |
denotes |
mouse |
| T13713 |
60984-60991 |
NNS |
denotes |
embryos |
| T13715 |
60991-60992 |
. |
denotes |
. |
| T13716 |
60992-61275 |
sentence |
denotes |
The sections were fixed with 4% PFA for 10 min at room temperature, prehybridized at room temperature for 4.5 h, hybridized with the probe (2 μg/ml) at 55 °C for 12–14 h, blocked with 10% NGS, and treated with anti-dig Fab-AP antibody (Roche #1093274) at a 1:2,500 dilution for 3 h. |
| T13717 |
60993-60996 |
DT |
denotes |
The |
| T13718 |
60997-61005 |
NNS |
denotes |
sections |
| T13720 |
61006-61010 |
VBD |
denotes |
were |
| T13719 |
61011-61016 |
VBN |
denotes |
fixed |
| T13721 |
61017-61021 |
IN |
denotes |
with |
| T13722 |
61022-61023 |
CD |
denotes |
4 |
| T13723 |
61023-61024 |
NN |
denotes |
% |
| T13724 |
61025-61028 |
NN |
denotes |
PFA |
| T13725 |
61029-61032 |
IN |
denotes |
for |
| T13726 |
61033-61035 |
CD |
denotes |
10 |
| T13727 |
61036-61039 |
NN |
denotes |
min |
| T13728 |
61040-61042 |
IN |
denotes |
at |
| T13729 |
61043-61047 |
NN |
denotes |
room |
| T13730 |
61048-61059 |
NN |
denotes |
temperature |
| T13731 |
61059-61061 |
, |
denotes |
, |
| T13732 |
61061-61074 |
VBN |
denotes |
prehybridized |
| T13733 |
61075-61077 |
IN |
denotes |
at |
| T13734 |
61078-61082 |
NN |
denotes |
room |
| T13735 |
61083-61094 |
NN |
denotes |
temperature |
| T13736 |
61095-61098 |
IN |
denotes |
for |
| T13737 |
61099-61102 |
CD |
denotes |
4.5 |
| T13738 |
61103-61104 |
NN |
denotes |
h |
| T13739 |
61104-61106 |
, |
denotes |
, |
| T13740 |
61106-61116 |
VBN |
denotes |
hybridized |
| T13741 |
61117-61121 |
IN |
denotes |
with |
| T13742 |
61122-61125 |
DT |
denotes |
the |
| T13743 |
61126-61131 |
NN |
denotes |
probe |
| T13744 |
61132-61133 |
-LRB- |
denotes |
( |
| T13746 |
61133-61134 |
CD |
denotes |
2 |
| T13745 |
61135-61137 |
NN |
denotes |
μg |
| T13747 |
61137-61138 |
SYM |
denotes |
/ |
| T13748 |
61138-61140 |
NN |
denotes |
ml |
| T13749 |
61140-61141 |
-RRB- |
denotes |
) |
| T13750 |
61142-61144 |
IN |
denotes |
at |
| T13751 |
61145-61147 |
CD |
denotes |
55 |
| T13752 |
61148-61150 |
NN |
denotes |
°C |
| T13753 |
61151-61154 |
IN |
denotes |
for |
| T13754 |
61155-61157 |
CD |
denotes |
12 |
| T13756 |
61157-61158 |
SYM |
denotes |
– |
| T13755 |
61158-61160 |
CD |
denotes |
14 |
| T13757 |
61161-61162 |
NN |
denotes |
h |
| T13758 |
61162-61164 |
, |
denotes |
, |
| T13759 |
61164-61171 |
VBN |
denotes |
blocked |
| T13760 |
61172-61176 |
IN |
denotes |
with |
| T13761 |
61177-61179 |
CD |
denotes |
10 |
| T13762 |
61179-61180 |
NN |
denotes |
% |
| T13763 |
61181-61184 |
NN |
denotes |
NGS |
| T13764 |
61184-61186 |
, |
denotes |
, |
| T13765 |
61186-61189 |
CC |
denotes |
and |
| T13766 |
61190-61197 |
VBN |
denotes |
treated |
| T13767 |
61198-61202 |
IN |
denotes |
with |
| T13768 |
61203-61211 |
JJ |
denotes |
anti-dig |
| T13770 |
61212-61215 |
NN |
denotes |
Fab |
| T13772 |
61215-61216 |
HYPH |
denotes |
- |
| T13771 |
61216-61218 |
NN |
denotes |
AP |
| T13769 |
61219-61227 |
NN |
denotes |
antibody |
| T13773 |
61228-61229 |
-LRB- |
denotes |
( |
| T13774 |
61229-61234 |
NNP |
denotes |
Roche |
| T13775 |
61235-61236 |
SYM |
denotes |
# |
| T13776 |
61236-61243 |
CD |
denotes |
1093274 |
| T13777 |
61243-61244 |
-RRB- |
denotes |
) |
| T13778 |
61245-61247 |
IN |
denotes |
at |
| T13779 |
61248-61249 |
DT |
denotes |
a |
| T13781 |
61250-61251 |
CD |
denotes |
1 |
| T13783 |
61251-61252 |
SYM |
denotes |
: |
| T13782 |
61252-61257 |
CD |
denotes |
2,500 |
| T13780 |
61258-61266 |
NN |
denotes |
dilution |
| T13784 |
61267-61270 |
IN |
denotes |
for |
| T13785 |
61271-61272 |
CD |
denotes |
3 |
| T13786 |
61273-61274 |
NN |
denotes |
h |
| T13787 |
61274-61275 |
. |
denotes |
. |
| T13788 |
61275-61357 |
sentence |
denotes |
The sections were incubated with NBT and BCIP until adequate signal was detected. |
| T13789 |
61276-61279 |
DT |
denotes |
The |
| T13790 |
61280-61288 |
NNS |
denotes |
sections |
| T13792 |
61289-61293 |
VBD |
denotes |
were |
| T13791 |
61294-61303 |
VBN |
denotes |
incubated |
| T13793 |
61304-61308 |
IN |
denotes |
with |
| T13794 |
61309-61312 |
NN |
denotes |
NBT |
| T13795 |
61313-61316 |
CC |
denotes |
and |
| T13796 |
61317-61321 |
NN |
denotes |
BCIP |
| T13797 |
61322-61327 |
IN |
denotes |
until |
| T13799 |
61328-61336 |
JJ |
denotes |
adequate |
| T13800 |
61337-61343 |
NN |
denotes |
signal |
| T13801 |
61344-61347 |
VBD |
denotes |
was |
| T13798 |
61348-61356 |
VBN |
denotes |
detected |
| T13802 |
61356-61357 |
. |
denotes |
. |
| T13828 |
61359-61377 |
NN |
denotes |
Immunofluorescence |
| T13829 |
61378-61381 |
CC |
denotes |
and |
| T13830 |
61382-61402 |
NN |
denotes |
immunohistochemistry |
| T13831 |
61402-61500 |
sentence |
denotes |
Tissue samples for immunofluorescence were frozen in OCT and sectioned 10 μm thick on a cryostat. |
| T13832 |
61403-61409 |
NN |
denotes |
Tissue |
| T13833 |
61410-61417 |
NNS |
denotes |
samples |
| T13835 |
61418-61421 |
IN |
denotes |
for |
| T13836 |
61422-61440 |
NN |
denotes |
immunofluorescence |
| T13837 |
61441-61445 |
VBD |
denotes |
were |
| T13834 |
61446-61452 |
VBN |
denotes |
frozen |
| T13838 |
61453-61455 |
IN |
denotes |
in |
| T13839 |
61456-61459 |
NN |
denotes |
OCT |
| T13840 |
61460-61463 |
CC |
denotes |
and |
| T13841 |
61464-61473 |
VBN |
denotes |
sectioned |
| T13842 |
61474-61476 |
CD |
denotes |
10 |
| T13843 |
61477-61479 |
NN |
denotes |
μm |
| T13844 |
61480-61485 |
JJ |
denotes |
thick |
| T13845 |
61486-61488 |
IN |
denotes |
on |
| T13846 |
61489-61490 |
DT |
denotes |
a |
| T13847 |
61491-61499 |
NN |
denotes |
cryostat |
| T13848 |
61499-61500 |
. |
denotes |
. |
| T13849 |
61500-61613 |
sentence |
denotes |
Sections were fixed in 4% paraformaldehyde for 10 min at room temperature, blocked, and stained with antibodies. |
| T13850 |
61501-61509 |
NNS |
denotes |
Sections |
| T13852 |
61510-61514 |
VBD |
denotes |
were |
| T13851 |
61515-61520 |
VBN |
denotes |
fixed |
| T13853 |
61521-61523 |
IN |
denotes |
in |
| T13854 |
61524-61525 |
CD |
denotes |
4 |
| T13855 |
61525-61526 |
NN |
denotes |
% |
| T13856 |
61527-61543 |
NN |
denotes |
paraformaldehyde |
| T13857 |
61544-61547 |
IN |
denotes |
for |
| T13858 |
61548-61550 |
CD |
denotes |
10 |
| T13859 |
61551-61554 |
NN |
denotes |
min |
| T13860 |
61555-61557 |
IN |
denotes |
at |
| T13861 |
61558-61562 |
NN |
denotes |
room |
| T13862 |
61563-61574 |
NN |
denotes |
temperature |
| T13863 |
61574-61576 |
, |
denotes |
, |
| T13864 |
61576-61583 |
VBN |
denotes |
blocked |
| T13865 |
61583-61585 |
, |
denotes |
, |
| T13866 |
61585-61588 |
CC |
denotes |
and |
| T13867 |
61589-61596 |
VBN |
denotes |
stained |
| T13868 |
61597-61601 |
IN |
denotes |
with |
| T13869 |
61602-61612 |
NNS |
denotes |
antibodies |
| T13870 |
61612-61613 |
. |
denotes |
. |
| T13871 |
61613-61726 |
sentence |
denotes |
Tissue samples for immunohistochemistry were fixed in 4% paraformaldehyde, dehydrated, and embedded in paraffin. |
| T13872 |
61614-61620 |
NN |
denotes |
Tissue |
| T13873 |
61621-61628 |
NNS |
denotes |
samples |
| T13875 |
61629-61632 |
IN |
denotes |
for |
| T13876 |
61633-61653 |
NN |
denotes |
immunohistochemistry |
| T13877 |
61654-61658 |
VBD |
denotes |
were |
| T13874 |
61659-61664 |
VBN |
denotes |
fixed |
| T13878 |
61665-61667 |
IN |
denotes |
in |
| T13879 |
61668-61669 |
CD |
denotes |
4 |
| T13880 |
61669-61670 |
NN |
denotes |
% |
| T13881 |
61671-61687 |
NN |
denotes |
paraformaldehyde |
| T13882 |
61687-61689 |
, |
denotes |
, |
| T13883 |
61689-61699 |
VBN |
denotes |
dehydrated |
| T13884 |
61699-61701 |
, |
denotes |
, |
| T13885 |
61701-61704 |
CC |
denotes |
and |
| T13886 |
61705-61713 |
VBN |
denotes |
embedded |
| T13887 |
61714-61716 |
IN |
denotes |
in |
| T13888 |
61717-61725 |
NN |
denotes |
paraffin |
| T13889 |
61725-61726 |
. |
denotes |
. |
| T13890 |
61726-61826 |
sentence |
denotes |
Samples were sectioned on a microtome (10 μm thick) and rehydrated prior to staining with antibody. |
| T13891 |
61727-61734 |
NNS |
denotes |
Samples |
| T13893 |
61735-61739 |
VBD |
denotes |
were |
| T13892 |
61740-61749 |
VBN |
denotes |
sectioned |
| T13894 |
61750-61752 |
IN |
denotes |
on |
| T13895 |
61753-61754 |
DT |
denotes |
a |
| T13896 |
61755-61764 |
NN |
denotes |
microtome |
| T13897 |
61765-61766 |
-LRB- |
denotes |
( |
| T13899 |
61766-61768 |
CD |
denotes |
10 |
| T13900 |
61769-61771 |
NN |
denotes |
μm |
| T13898 |
61772-61777 |
JJ |
denotes |
thick |
| T13901 |
61777-61778 |
-RRB- |
denotes |
) |
| T13902 |
61779-61782 |
CC |
denotes |
and |
| T13903 |
61783-61793 |
VBD |
denotes |
rehydrated |
| T13904 |
61794-61799 |
IN |
denotes |
prior |
| T13905 |
61800-61802 |
IN |
denotes |
to |
| T13906 |
61803-61811 |
VBG |
denotes |
staining |
| T13907 |
61812-61816 |
IN |
denotes |
with |
| T13908 |
61817-61825 |
NN |
denotes |
antibody |
| T13909 |
61825-61826 |
. |
denotes |
. |
| T13910 |
61826-62012 |
sentence |
denotes |
Samples stained with Snail, pMAPK, pSmad2, and cyclin D were antigen unmasked with 10 mM sodium citrate (pH 6) in an Antigen Retriever 2100 (Pickcell Laboratories, Leiden, Netherlands). |
| T13911 |
61827-61834 |
NNS |
denotes |
Samples |
| T13913 |
61835-61842 |
VBN |
denotes |
stained |
| T13914 |
61843-61847 |
IN |
denotes |
with |
| T13915 |
61848-61853 |
NN |
denotes |
Snail |
| T13916 |
61853-61855 |
, |
denotes |
, |
| T13917 |
61855-61860 |
NN |
denotes |
pMAPK |
| T13918 |
61860-61862 |
, |
denotes |
, |
| T13919 |
61862-61868 |
NN |
denotes |
pSmad2 |
| T13920 |
61868-61870 |
, |
denotes |
, |
| T13921 |
61870-61873 |
CC |
denotes |
and |
| T13922 |
61874-61880 |
NN |
denotes |
cyclin |
| T13923 |
61881-61882 |
NN |
denotes |
D |
| T13924 |
61883-61887 |
VBD |
denotes |
were |
| T13925 |
61888-61895 |
NN |
denotes |
antigen |
| T13912 |
61896-61904 |
VBN |
denotes |
unmasked |
| T13926 |
61905-61909 |
IN |
denotes |
with |
| T13927 |
61910-61912 |
CD |
denotes |
10 |
| T13928 |
61913-61915 |
NN |
denotes |
mM |
| T13930 |
61916-61922 |
NN |
denotes |
sodium |
| T13929 |
61923-61930 |
NN |
denotes |
citrate |
| T13931 |
61931-61932 |
-LRB- |
denotes |
( |
| T13932 |
61932-61934 |
NN |
denotes |
pH |
| T13933 |
61935-61936 |
CD |
denotes |
6 |
| T13934 |
61936-61937 |
-RRB- |
denotes |
) |
| T13935 |
61938-61940 |
IN |
denotes |
in |
| T13936 |
61941-61943 |
DT |
denotes |
an |
| T13938 |
61944-61951 |
NNP |
denotes |
Antigen |
| T13937 |
61952-61961 |
NNP |
denotes |
Retriever |
| T13939 |
61962-61966 |
CD |
denotes |
2100 |
| T13940 |
61967-61968 |
-LRB- |
denotes |
( |
| T13942 |
61968-61976 |
NNP |
denotes |
Pickcell |
| T13941 |
61977-61989 |
NNP |
denotes |
Laboratories |
| T13943 |
61989-61991 |
, |
denotes |
, |
| T13944 |
61991-61997 |
NNP |
denotes |
Leiden |
| T13945 |
61997-61999 |
, |
denotes |
, |
| T13946 |
61999-62010 |
NNP |
denotes |
Netherlands |
| T13947 |
62010-62011 |
-RRB- |
denotes |
) |
| T13948 |
62011-62012 |
. |
denotes |
. |
| T13949 |
62012-62121 |
sentence |
denotes |
The DAB substrate kit (Vector Labs) was used according to manufacturer's instructions to develop the signal. |
| T13950 |
62013-62016 |
DT |
denotes |
The |
| T13952 |
62017-62020 |
NN |
denotes |
DAB |
| T13953 |
62021-62030 |
NN |
denotes |
substrate |
| T13951 |
62031-62034 |
NN |
denotes |
kit |
| T13955 |
62035-62036 |
-LRB- |
denotes |
( |
| T13957 |
62036-62042 |
NNP |
denotes |
Vector |
| T13956 |
62043-62047 |
NNPS |
denotes |
Labs |
| T13958 |
62047-62048 |
-RRB- |
denotes |
) |
| T13959 |
62049-62052 |
VBD |
denotes |
was |
| T13954 |
62053-62057 |
VBN |
denotes |
used |
| T13960 |
62058-62067 |
VBG |
denotes |
according |
| T13961 |
62068-62070 |
IN |
denotes |
to |
| T13962 |
62071-62083 |
NN |
denotes |
manufacturer |
| T13964 |
62083-62085 |
POS |
denotes |
's |
| T13963 |
62086-62098 |
NNS |
denotes |
instructions |
| T13965 |
62099-62101 |
TO |
denotes |
to |
| T13966 |
62102-62109 |
VB |
denotes |
develop |
| T13967 |
62110-62113 |
DT |
denotes |
the |
| T13968 |
62114-62120 |
NN |
denotes |
signal |
| T13969 |
62120-62121 |
. |
denotes |
. |
| T14008 |
62123-62125 |
NN |
denotes |
RT |
| T14010 |
62125-62126 |
HYPH |
denotes |
- |
| T14009 |
62126-62129 |
NN |
denotes |
PCR |
| T14011 |
62129-62248 |
sentence |
denotes |
RNA was extracted from keratinocytes or skin tissue with Trizol (Invitrogen) according to the manufacturer's protocol. |
| T14012 |
62130-62133 |
NN |
denotes |
RNA |
| T14014 |
62134-62137 |
VBD |
denotes |
was |
| T14013 |
62138-62147 |
VBN |
denotes |
extracted |
| T14015 |
62148-62152 |
IN |
denotes |
from |
| T14016 |
62153-62166 |
NNS |
denotes |
keratinocytes |
| T14017 |
62167-62169 |
CC |
denotes |
or |
| T14018 |
62170-62174 |
NN |
denotes |
skin |
| T14019 |
62175-62181 |
NN |
denotes |
tissue |
| T14020 |
62182-62186 |
IN |
denotes |
with |
| T14021 |
62187-62193 |
NN |
denotes |
Trizol |
| T14022 |
62194-62195 |
-LRB- |
denotes |
( |
| T14023 |
62195-62205 |
NNP |
denotes |
Invitrogen |
| T14024 |
62205-62206 |
-RRB- |
denotes |
) |
| T14025 |
62207-62216 |
VBG |
denotes |
according |
| T14026 |
62217-62219 |
IN |
denotes |
to |
| T14027 |
62220-62223 |
DT |
denotes |
the |
| T14028 |
62224-62236 |
NN |
denotes |
manufacturer |
| T14030 |
62236-62238 |
POS |
denotes |
's |
| T14029 |
62239-62247 |
NN |
denotes |
protocol |
| T14031 |
62247-62248 |
. |
denotes |
. |
| T14032 |
62248-62331 |
sentence |
denotes |
cDNA was generated using oligo-dT primers and the Superscript II kit (Invitrogen). |
| T14033 |
62249-62253 |
NN |
denotes |
cDNA |
| T14035 |
62254-62257 |
VBD |
denotes |
was |
| T14034 |
62258-62267 |
VBN |
denotes |
generated |
| T14036 |
62268-62273 |
VBG |
denotes |
using |
| T14037 |
62274-62279 |
NN |
denotes |
oligo |
| T14039 |
62279-62280 |
HYPH |
denotes |
- |
| T14038 |
62280-62282 |
NN |
denotes |
dT |
| T14040 |
62283-62290 |
NNS |
denotes |
primers |
| T14041 |
62291-62294 |
CC |
denotes |
and |
| T14042 |
62295-62298 |
DT |
denotes |
the |
| T14044 |
62299-62310 |
NNP |
denotes |
Superscript |
| T14045 |
62311-62313 |
CD |
denotes |
II |
| T14043 |
62314-62317 |
NN |
denotes |
kit |
| T14046 |
62318-62319 |
-LRB- |
denotes |
( |
| T14047 |
62319-62329 |
NNP |
denotes |
Invitrogen |
| T14048 |
62329-62330 |
-RRB- |
denotes |
) |
| T14049 |
62330-62331 |
. |
denotes |
. |
| T14050 |
62331-62544 |
sentence |
denotes |
The primers used for PCR were Snail forward: 5′- CAGCTGGCCAGGCTCTCGGT-3′; Snail reverse: 5′- GCGAGGGCCTCCGGAGCA-3′; GAPDH forward 5′- CGTAGACAAAATGGTGAAGGTCGG-3′; and GAPDH reverse: 5′- AAGCAGTTGGTGGTGCAGGATG-3′. |
| T14051 |
62332-62335 |
DT |
denotes |
The |
| T14052 |
62336-62343 |
NNS |
denotes |
primers |
| T14054 |
62344-62348 |
VBN |
denotes |
used |
| T14055 |
62349-62352 |
IN |
denotes |
for |
| T14056 |
62353-62356 |
NN |
denotes |
PCR |
| T14053 |
62357-62361 |
VBD |
denotes |
were |
| T14057 |
62362-62367 |
NN |
denotes |
Snail |
| T14058 |
62368-62375 |
NN |
denotes |
forward |
| T14059 |
62375-62377 |
: |
denotes |
: |
| T14060 |
62377-62378 |
CD |
denotes |
5 |
| T14062 |
62378-62379 |
SYM |
denotes |
′ |
| T14063 |
62379-62380 |
HYPH |
denotes |
- |
| T14061 |
62381-62401 |
NN |
denotes |
CAGCTGGCCAGGCTCTCGGT |
| T14064 |
62401-62402 |
HYPH |
denotes |
- |
| T14065 |
62402-62403 |
CD |
denotes |
3 |
| T14066 |
62403-62404 |
SYM |
denotes |
′ |
| T14067 |
62404-62405 |
: |
denotes |
; |
| T14068 |
62406-62411 |
NN |
denotes |
Snail |
| T14069 |
62412-62419 |
NN |
denotes |
reverse |
| T14070 |
62419-62421 |
: |
denotes |
: |
| T14071 |
62421-62422 |
CD |
denotes |
5 |
| T14073 |
62422-62423 |
SYM |
denotes |
′ |
| T14074 |
62423-62424 |
HYPH |
denotes |
- |
| T14072 |
62425-62443 |
NN |
denotes |
GCGAGGGCCTCCGGAGCA |
| T14075 |
62443-62444 |
HYPH |
denotes |
- |
| T14076 |
62444-62445 |
CD |
denotes |
3 |
| T14077 |
62445-62446 |
SYM |
denotes |
′ |
| T14078 |
62446-62447 |
: |
denotes |
; |
| T14079 |
62448-62453 |
NN |
denotes |
GAPDH |
| T14080 |
62454-62461 |
NN |
denotes |
forward |
| T14081 |
62462-62463 |
CD |
denotes |
5 |
| T14083 |
62463-62464 |
SYM |
denotes |
′ |
| T14084 |
62464-62465 |
HYPH |
denotes |
- |
| T14082 |
62466-62490 |
NN |
denotes |
CGTAGACAAAATGGTGAAGGTCGG |
| T14085 |
62490-62491 |
HYPH |
denotes |
- |
| T14086 |
62491-62492 |
CD |
denotes |
3 |
| T14087 |
62492-62493 |
SYM |
denotes |
′ |
| T14088 |
62493-62494 |
: |
denotes |
; |
| T14089 |
62495-62498 |
CC |
denotes |
and |
| T14090 |
62499-62504 |
NN |
denotes |
GAPDH |
| T14091 |
62505-62512 |
NN |
denotes |
reverse |
| T14092 |
62512-62514 |
: |
denotes |
: |
| T14093 |
62514-62515 |
CD |
denotes |
5 |
| T14095 |
62515-62516 |
SYM |
denotes |
′ |
| T14096 |
62516-62517 |
HYPH |
denotes |
- |
| T14094 |
62518-62540 |
NN |
denotes |
AAGCAGTTGGTGGTGCAGGATG |
| T14097 |
62540-62541 |
HYPH |
denotes |
- |
| T14098 |
62541-62542 |
CD |
denotes |
3 |
| T14099 |
62542-62543 |
SYM |
denotes |
′ |
| T14100 |
62543-62544 |
. |
denotes |
. |
| R1000 |
T1864 |
T1862 |
pobj |
proximity,by |
| R1001 |
T1865 |
T1864 |
amod |
close,proximity |
| R1002 |
T1757 |
T1756 |
pobj |
proteins,of |
| R1003 |
T1866 |
T1864 |
prep |
of,proximity |
| R1004 |
T1867 |
T1868 |
det |
the,site |
| R1005 |
T1758 |
T1731 |
punct |
),protein |
| R1006 |
T1759 |
T1731 |
punct |
", ",protein |
| R1007 |
T1868 |
T1866 |
pobj |
site,of |
| R1008 |
T1869 |
T1868 |
nmod |
LEF,site |
| R1009 |
T1870 |
T1869 |
punct |
-,LEF |
| R1010 |
T1760 |
T1761 |
dep |
which,appears |
| R1011 |
T1871 |
T1869 |
nummod |
1,LEF |
| R1012 |
T1872 |
T1869 |
punct |
/,LEF |
| R1013 |
T1761 |
T1731 |
relcl |
appears,protein |
| R1014 |
T1873 |
T1874 |
compound |
β,catenin |
| R1015 |
T1762 |
T1763 |
aux |
to,function |
| R1016 |
T1874 |
T1869 |
appos |
catenin,LEF |
| R1017 |
T1875 |
T1874 |
punct |
-,catenin |
| R1018 |
T1876 |
T1868 |
compound |
binding,site |
| R1019 |
T1763 |
T1761 |
xcomp |
function,appears |
| R1020 |
T1877 |
T1864 |
prep |
to,proximity |
| R1021 |
T1878 |
T1879 |
det |
a,site |
| R1022 |
T1879 |
T1877 |
pobj |
site,to |
| R1023 |
T1764 |
T1763 |
advmod |
dually,function |
| R1024 |
T1880 |
T1879 |
acl |
known,site |
| R1025 |
T1881 |
T1882 |
aux |
to,bind |
| R1026 |
T1765 |
T1763 |
prep |
in,function |
| R1027 |
T1882 |
T1880 |
xcomp |
bind,known |
| R1028 |
T1883 |
T1884 |
det |
the,family |
| R1029 |
T1884 |
T1882 |
dobj |
family,bind |
| R1030 |
T1766 |
T1765 |
preconj |
both,in |
| R1031 |
T1767 |
T1765 |
conj |
adhesion,in |
| R1032 |
T1768 |
T1765 |
cc |
and,in |
| R1033 |
T1769 |
T1765 |
conj |
in,in |
| R1034 |
T1885 |
T1886 |
compound |
Snail,Slug |
| R1035 |
T1886 |
T1884 |
compound |
Slug,family |
| R1036 |
T1770 |
T1769 |
pobj |
activation,in |
| R1037 |
T1887 |
T1886 |
punct |
/,Slug |
| R1038 |
T1888 |
T1884 |
prep |
of,family |
| R1039 |
T1889 |
T1890 |
nmod |
zinc,finger |
| R1040 |
T1771 |
T1770 |
prep |
of,activation |
| R1041 |
T1890 |
T1891 |
nmod |
finger,proteins |
| R1042 |
T1891 |
T1888 |
pobj |
proteins,of |
| R1043 |
T1772 |
T1773 |
det |
the,pathway |
| R1044 |
T1892 |
T1893 |
amod |
transcriptional,repressor |
| R1045 |
T1893 |
T1891 |
compound |
repressor,proteins |
| R1046 |
T1894 |
T1895 |
punct |
[,15 |
| R1047 |
T1773 |
T1771 |
pobj |
pathway,of |
| R1048 |
T1895 |
T1846 |
parataxis |
15,intrigued |
| R1049 |
T1896 |
T1895 |
nummod |
12,15 |
| R1050 |
T1897 |
T1895 |
punct |
",",15 |
| R1051 |
T1898 |
T1895 |
nummod |
13,15 |
| R1052 |
T1899 |
T1895 |
punct |
",",15 |
| R1053 |
T1900 |
T1895 |
nummod |
14,15 |
| R1054 |
T1774 |
T1773 |
nmod |
Ras,pathway |
| R1055 |
T1901 |
T1895 |
punct |
",",15 |
| R1056 |
T1902 |
T1895 |
punct |
],15 |
| R1057 |
T1903 |
T1846 |
punct |
.,intrigued |
| R1058 |
T1775 |
T1774 |
punct |
-,Ras |
| R1059 |
T1905 |
T1906 |
preconj |
Both,activity |
| R1060 |
T1776 |
T1777 |
npadvmod |
mitogen,activated |
| R1061 |
T1906 |
T1907 |
nsubj |
activity,play |
| R1062 |
T1908 |
T1906 |
prep |
of,activity |
| R1063 |
T1777 |
T1779 |
amod |
activated,kinase |
| R1064 |
T1909 |
T1908 |
pobj |
Snail,of |
| R1065 |
T1910 |
T1906 |
cc |
and,activity |
| R1066 |
T1911 |
T1912 |
compound |
down,regulation |
| R1067 |
T1778 |
T1777 |
punct |
-,activated |
| R1068 |
T1912 |
T1906 |
conj |
regulation,activity |
| R1069 |
T1913 |
T1912 |
punct |
-,regulation |
| R1070 |
T1914 |
T1912 |
prep |
of,regulation |
| R1071 |
T1779 |
T1774 |
appos |
kinase,Ras |
| R1072 |
T1915 |
T1916 |
compound |
E,cadherin |
| R1073 |
T1916 |
T1914 |
pobj |
cadherin,of |
| R1074 |
T1991 |
T1988 |
acl |
tune,ability |
| R1075 |
T1917 |
T1916 |
punct |
-,cadherin |
| R1076 |
T1918 |
T1919 |
amod |
pivotal,roles |
| R1077 |
T1919 |
T1907 |
dobj |
roles,play |
| R1078 |
T1920 |
T1907 |
prep |
in,play |
| R1079 |
T1992 |
T1991 |
advmod |
fine,tune |
| R1080 |
T1921 |
T1922 |
amod |
epithelial,transitions |
| R1081 |
T1922 |
T1920 |
pobj |
transitions,in |
| R1082 |
T1923 |
T1921 |
prep |
to,epithelial |
| R1083 |
T1993 |
T1991 |
punct |
-,tune |
| R1084 |
T1924 |
T1923 |
amod |
mesenchymal,to |
| R1085 |
T1925 |
T1922 |
punct |
(,transitions |
| R1086 |
T1994 |
T1995 |
compound |
cadherin,expression |
| R1087 |
T1926 |
T1922 |
appos |
EMTs,transitions |
| R1088 |
T1927 |
T1922 |
punct |
),transitions |
| R1089 |
T1928 |
T1922 |
punct |
", ",transitions |
| R1090 |
T1995 |
T1991 |
dobj |
expression,tune |
| R1091 |
T1929 |
T1922 |
acl |
typified,transitions |
| R1092 |
T1930 |
T1929 |
agent |
by,typified |
| R1093 |
T1931 |
T1932 |
det |
the,transformation |
| R1094 |
T1996 |
T1991 |
prep |
at,tune |
| R1095 |
T1932 |
T1930 |
pobj |
transformation,by |
| R1096 |
T1933 |
T1932 |
prep |
of,transformation |
| R1097 |
T1934 |
T1935 |
amod |
polarized,cells |
| R1098 |
T1997 |
T1998 |
det |
the,level |
| R1099 |
T1935 |
T1933 |
pobj |
cells,of |
| R1100 |
T1936 |
T1935 |
punct |
", ",cells |
| R1101 |
T1937 |
T1935 |
amod |
adhering,cells |
| R1102 |
T1938 |
T1935 |
amod |
epithelial,cells |
| R1103 |
T1939 |
T1932 |
prep |
into,transformation |
| R1104 |
T1998 |
T1996 |
pobj |
level,at |
| R1105 |
T1940 |
T1941 |
amod |
motile,cells |
| R1106 |
T1941 |
T1939 |
pobj |
cells,into |
| R1107 |
T1999 |
T1998 |
amod |
transcriptional,level |
| R1108 |
T1942 |
T1941 |
amod |
mesenchymal,cells |
| R1109 |
T1943 |
T1944 |
punct |
[,17 |
| R1110 |
T1944 |
T1907 |
parataxis |
17,play |
| R1111 |
T2000 |
T1985 |
punct |
", ",seems |
| R1112 |
T1945 |
T1944 |
nummod |
16,17 |
| R1113 |
T1946 |
T1944 |
punct |
",",17 |
| R1114 |
T1947 |
T1944 |
punct |
],17 |
| R1115 |
T2001 |
T1985 |
nsubj |
Snail,seems |
| R1116 |
T1948 |
T1907 |
punct |
.,play |
| R1117 |
T1950 |
T1951 |
compound |
Bud,formation |
| R1118 |
T2002 |
T2003 |
aux |
to,have |
| R1119 |
T1951 |
T1952 |
nsubj |
formation,differs |
| R1120 |
T2003 |
T1985 |
xcomp |
have,seems |
| R1121 |
T1953 |
T1952 |
prep |
from,differs |
| R1122 |
T1954 |
T1955 |
det |
an,EMT |
| R1123 |
T2004 |
T2005 |
det |
an,effect |
| R1124 |
T1955 |
T1953 |
pobj |
EMT,from |
| R1125 |
T1956 |
T1957 |
mark |
in,needs |
| R1126 |
T2005 |
T2003 |
dobj |
effect,have |
| R1127 |
T2006 |
T2005 |
amod |
additive,effect |
| R1128 |
T1957 |
T1952 |
advcl |
needs,differs |
| R1129 |
T1958 |
T1957 |
mark |
that,needs |
| R1130 |
T1959 |
T1960 |
compound |
E,cadherin |
| R1131 |
T2007 |
T2003 |
prep |
with,have |
| R1132 |
T1960 |
T1962 |
compound |
cadherin,activity |
| R1133 |
T1961 |
T1960 |
punct |
-,cadherin |
| R1134 |
T1962 |
T1957 |
nsubj |
activity,needs |
| R1135 |
T2008 |
T2007 |
pobj |
LEF,with |
| R1136 |
T1963 |
T1964 |
aux |
to,regulated |
| R1137 |
T1964 |
T1957 |
xcomp |
regulated,needs |
| R1138 |
T1965 |
T1964 |
aux |
be,regulated |
| R1139 |
T2009 |
T2008 |
punct |
-,LEF |
| R1140 |
T1966 |
T1964 |
advmod |
down,regulated |
| R1141 |
T1967 |
T1964 |
punct |
-,regulated |
| R1142 |
T2010 |
T2008 |
nummod |
1,LEF |
| R1143 |
T1968 |
T1964 |
cc |
but,regulated |
| R1144 |
T1969 |
T1968 |
neg |
not,but |
| R1145 |
T2011 |
T2008 |
punct |
/,LEF |
| R1146 |
T1970 |
T1964 |
conj |
prevented,regulated |
| R1147 |
T1971 |
T1964 |
punct |
", ",regulated |
| R1148 |
T1972 |
T1973 |
mark |
so,remodeled |
| R1149 |
T2012 |
T2013 |
compound |
β,catenin |
| R1150 |
T1973 |
T1964 |
advcl |
remodeled,regulated |
| R1151 |
T1974 |
T1973 |
mark |
that,remodeled |
| R1152 |
T2013 |
T2008 |
appos |
catenin,LEF |
| R1153 |
T1975 |
T1976 |
amod |
adhesive,junctions |
| R1154 |
T1976 |
T1973 |
nsubjpass |
junctions,remodeled |
| R1155 |
T1977 |
T1973 |
auxpass |
are,remodeled |
| R1156 |
T1978 |
T1979 |
advmod |
rather,than |
| R1157 |
T1979 |
T1973 |
cc |
than,remodeled |
| R1158 |
T1980 |
T1981 |
advmod |
quantitatively,impaired |
| R1159 |
T1981 |
T1973 |
conj |
impaired,remodeled |
| R1160 |
T2014 |
T2013 |
punct |
-,catenin |
| R1161 |
T1982 |
T1952 |
punct |
.,differs |
| R1162 |
T2015 |
T2003 |
prep |
in,have |
| R1163 |
T1984 |
T1985 |
advcl |
Supportive,seems |
| R1164 |
T1986 |
T1984 |
prep |
of,Supportive |
| R1165 |
T2016 |
T2017 |
advmod |
negatively,modulating |
| R1166 |
T1987 |
T1988 |
det |
an,ability |
| R1167 |
T1988 |
T1986 |
pobj |
ability,of |
| R1168 |
T1989 |
T1988 |
amod |
underlying,ability |
| R1169 |
T2017 |
T2015 |
pcomp |
modulating,in |
| R1170 |
T1990 |
T1991 |
aux |
to,tune |
| R1171 |
T2018 |
T2019 |
compound |
E,cadherin |
| R1172 |
T2019 |
T2021 |
compound |
cadherin,promoter |
| R1173 |
T2020 |
T2019 |
punct |
-,cadherin |
| R1174 |
T2021 |
T2022 |
compound |
promoter,activity |
| R1175 |
T2022 |
T2017 |
dobj |
activity,modulating |
| R1176 |
T2023 |
T2024 |
punct |
[,4 |
| R1177 |
T2097 |
T2096 |
acl |
associated,features |
| R1178 |
T2098 |
T2097 |
prep |
with,associated |
| R1179 |
T2024 |
T1985 |
parataxis |
4,seems |
| R1180 |
T2099 |
T2100 |
compound |
hair,bud |
| R1181 |
T2100 |
T2101 |
compound |
bud,formation |
| R1182 |
T2025 |
T2024 |
punct |
],4 |
| R1183 |
T2101 |
T2098 |
pobj |
formation,with |
| R1184 |
T2102 |
T2096 |
punct |
", ",features |
| R1185 |
T2103 |
T2096 |
prep |
including,features |
| R1186 |
T2026 |
T1985 |
punct |
.,seems |
| R1187 |
T2104 |
T2105 |
compound |
down,regulation |
| R1188 |
T2105 |
T2103 |
pobj |
regulation,including |
| R1189 |
T2028 |
T2029 |
prep |
In,discovered |
| R1190 |
T2106 |
T2105 |
punct |
-,regulation |
| R1191 |
T2107 |
T2105 |
prep |
of,regulation |
| R1192 |
T2108 |
T2109 |
compound |
E,cadherin |
| R1193 |
T2109 |
T2107 |
pobj |
cadherin,of |
| R1194 |
T2030 |
T2031 |
det |
the,study |
| R1195 |
T2110 |
T2109 |
punct |
-,cadherin |
| R1196 |
T2111 |
T2105 |
punct |
", ",regulation |
| R1197 |
T2112 |
T2113 |
amod |
increased,proliferation |
| R1198 |
T2113 |
T2105 |
conj |
proliferation,regulation |
| R1199 |
T2031 |
T2028 |
pobj |
study,In |
| R1200 |
T2114 |
T2113 |
punct |
", ",proliferation |
| R1201 |
T2115 |
T2113 |
cc |
and,proliferation |
| R1202 |
T2032 |
T2031 |
amod |
present,study |
| R1203 |
T2116 |
T2117 |
amod |
repressed,differentiation |
| R1204 |
T2117 |
T2113 |
conj |
differentiation,proliferation |
| R1205 |
T2118 |
T2117 |
amod |
terminal,differentiation |
| R1206 |
T2119 |
T2084 |
punct |
.,appears |
| R1207 |
T2033 |
T2029 |
punct |
", ",discovered |
| R1208 |
T2121 |
T2122 |
mark |
Although,reflected |
| R1209 |
T2034 |
T2029 |
nsubj |
we,discovered |
| R1210 |
T2122 |
T2133 |
advcl |
reflected,appear |
| R1211 |
T2123 |
T2124 |
det |
the,spike |
| R1212 |
T2035 |
T2036 |
mark |
that,expressed |
| R1213 |
T2124 |
T2122 |
nsubjpass |
spike,reflected |
| R1214 |
T2125 |
T2124 |
amod |
temporal,spike |
| R1215 |
T2036 |
T2029 |
ccomp |
expressed,discovered |
| R1216 |
T2126 |
T2124 |
prep |
of,spike |
| R1217 |
T2127 |
T2126 |
pobj |
Snail,of |
| R1218 |
T2037 |
T2036 |
nsubjpass |
Snail,expressed |
| R1219 |
T2128 |
T2124 |
prep |
in,spike |
| R1220 |
T2129 |
T2130 |
det |
the,bud |
| R1221 |
T2130 |
T2128 |
pobj |
bud,in |
| R1222 |
T2038 |
T2036 |
auxpass |
is,expressed |
| R1223 |
T2131 |
T2130 |
compound |
hair,bud |
| R1224 |
T2132 |
T2122 |
auxpass |
is,reflected |
| R1225 |
T2039 |
T2036 |
advmod |
briefly,expressed |
| R1226 |
T2134 |
T2122 |
prep |
at,reflected |
| R1227 |
T2135 |
T2136 |
det |
the,level |
| R1228 |
T2136 |
T2134 |
pobj |
level,at |
| R1229 |
T2040 |
T2036 |
prep |
at,expressed |
| R1230 |
T2137 |
T2136 |
compound |
mRNA,level |
| R1231 |
T2138 |
T2122 |
cc |
and,reflected |
| R1232 |
T2139 |
T2122 |
conj |
seems,reflected |
| R1233 |
T2041 |
T2042 |
det |
an,stage |
| R1234 |
T2140 |
T2141 |
aux |
to,follow |
| R1235 |
T2141 |
T2139 |
xcomp |
follow,seems |
| R1236 |
T2142 |
T2143 |
compound |
Wnt,signaling |
| R1237 |
T2042 |
T2040 |
pobj |
stage,at |
| R1238 |
T2143 |
T2141 |
dobj |
signaling,follow |
| R1239 |
T2144 |
T2143 |
cc |
and,signaling |
| R1240 |
T2043 |
T2042 |
amod |
early,stage |
| R1241 |
T2145 |
T2146 |
compound |
BMP,inhibition |
| R1242 |
T2146 |
T2143 |
conj |
inhibition,signaling |
| R1243 |
T2147 |
T2133 |
punct |
", ",appear |
| R1244 |
T2044 |
T2042 |
prep |
of,stage |
| R1245 |
T2148 |
T2149 |
nmod |
LEF,activation |
| R1246 |
T2149 |
T2133 |
nsubj |
activation,appear |
| R1247 |
T2045 |
T2046 |
compound |
hair,bud |
| R1248 |
T2150 |
T2148 |
punct |
-,LEF |
| R1249 |
T2151 |
T2148 |
nummod |
1,LEF |
| R1250 |
T2152 |
T2148 |
punct |
/,LEF |
| R1251 |
T2046 |
T2047 |
compound |
bud,formation |
| R1252 |
T2153 |
T2154 |
compound |
β,catenin |
| R1253 |
T2154 |
T2148 |
appos |
catenin,LEF |
| R1254 |
T2155 |
T2154 |
punct |
-,catenin |
| R1255 |
T2047 |
T2044 |
pobj |
formation,of |
| R1256 |
T2156 |
T2133 |
aux |
does,appear |
| R1257 |
T2157 |
T2133 |
neg |
not,appear |
| R1258 |
T2158 |
T2159 |
aux |
to,induce |
| R1259 |
T2159 |
T2133 |
xcomp |
induce,appear |
| R1260 |
T2160 |
T2161 |
compound |
Snail,expression |
| R1261 |
T2161 |
T2159 |
dobj |
expression,induce |
| R1262 |
T2162 |
T2161 |
compound |
gene,expression |
| R1263 |
T2048 |
T2042 |
punct |
", ",stage |
| R1264 |
T2163 |
T2159 |
prep |
in,induce |
| R1265 |
T2164 |
T2165 |
amod |
embryonic,keratinocytes |
| R1266 |
T2165 |
T2163 |
pobj |
keratinocytes,in |
| R1267 |
T2166 |
T2165 |
compound |
skin,keratinocytes |
| R1268 |
T2049 |
T2050 |
advmod |
when,take |
| R1269 |
T2167 |
T2133 |
punct |
.,appear |
| R1270 |
T2050 |
T2042 |
relcl |
take,stage |
| R1271 |
T2169 |
T2170 |
prep |
In,provide |
| R1272 |
T2171 |
T2169 |
pobj |
contrast,In |
| R1273 |
T2051 |
T2052 |
compound |
E,cadherin |
| R1274 |
T2172 |
T2170 |
punct |
", ",provide |
| R1275 |
T2173 |
T2170 |
nsubj |
we,provide |
| R1276 |
T2174 |
T2175 |
advmod |
in,vitro |
| R1277 |
T2052 |
T2050 |
nsubj |
cadherin,take |
| R1278 |
T2175 |
T2176 |
amod |
vitro,evidence |
| R1279 |
T2176 |
T2170 |
dobj |
evidence,provide |
| R1280 |
T2053 |
T2052 |
punct |
-,cadherin |
| R1281 |
T2177 |
T2175 |
punct |
", ",vitro |
| R1282 |
T2178 |
T2175 |
conj |
transgenic,vitro |
| R1283 |
T2179 |
T2180 |
punct |
(,Tg |
| R1284 |
T2054 |
T2055 |
amod |
down,regulation |
| R1285 |
T2180 |
T2178 |
parataxis |
Tg,transgenic |
| R1286 |
T2181 |
T2180 |
punct |
),Tg |
| R1287 |
T2182 |
T2178 |
punct |
", ",transgenic |
| R1288 |
T2055 |
T2052 |
appos |
regulation,cadherin |
| R1289 |
T2183 |
T2178 |
cc |
and,transgenic |
| R1290 |
T2184 |
T2185 |
npadvmod |
gene,targeting |
| R1291 |
T2056 |
T2055 |
punct |
-,regulation |
| R1292 |
T2185 |
T2178 |
conj |
targeting,transgenic |
| R1293 |
T2186 |
T2187 |
aux |
to,show |
| R1294 |
T2057 |
T2055 |
cc |
and,regulation |
| R1295 |
T2187 |
T2170 |
advcl |
show,provide |
| R1296 |
T2188 |
T2189 |
mark |
that,are |
| R1297 |
T2058 |
T2055 |
conj |
activation,regulation |
| R1298 |
T2059 |
T2058 |
prep |
of,activation |
| R1299 |
T2189 |
T2187 |
ccomp |
are,show |
| R1300 |
T2190 |
T2191 |
nmod |
TGF,β2 |
| R1301 |
T2060 |
T2059 |
pobj |
proliferation,of |
| R1302 |
T2191 |
T2193 |
nmod |
β2,signaling |
| R1303 |
T2192 |
T2191 |
punct |
-,β2 |
| R1304 |
T2193 |
T2189 |
nsubj |
signaling,are |
| R1305 |
T2061 |
T2050 |
dobj |
place,take |
| R1306 |
T2194 |
T2191 |
cc |
and,β2 |
| R1307 |
T2195 |
T2196 |
amod |
small,phenotype |
| R1308 |
T2196 |
T2197 |
npadvmod |
phenotype,related |
| R1309 |
T2197 |
T2204 |
amod |
related,protein |
| R1310 |
T2198 |
T2196 |
punct |
–,phenotype |
| R1311 |
T2199 |
T2196 |
cc |
and,phenotype |
| R1312 |
T2062 |
T2029 |
punct |
.,discovered |
| R1313 |
T2200 |
T2196 |
conj |
mothers,phenotype |
| R1314 |
T2201 |
T2200 |
prep |
against,mothers |
| R1315 |
T2202 |
T2201 |
pobj |
decapentaplegic,against |
| R1316 |
T2064 |
T2065 |
advmod |
Thereafter,disappears |
| R1317 |
T2066 |
T2065 |
punct |
", ",disappears |
| R1318 |
T2203 |
T2197 |
punct |
–,related |
| R1319 |
T2204 |
T2191 |
conj |
protein,β2 |
| R1320 |
T2067 |
T2065 |
nsubj |
Snail,disappears |
| R1321 |
T2205 |
T2204 |
nummod |
2,protein |
| R1322 |
T2206 |
T2204 |
punct |
(,protein |
| R1323 |
T2207 |
T2204 |
appos |
SMAD2,protein |
| R1324 |
T2068 |
T2065 |
cc |
and,disappears |
| R1325 |
T2208 |
T2193 |
punct |
),signaling |
| R1326 |
T2209 |
T2210 |
amod |
upstream,inducers |
| R1327 |
T2069 |
T2065 |
conj |
remains,disappears |
| R1328 |
T2210 |
T2189 |
attr |
inducers,are |
| R1329 |
T2211 |
T2210 |
prep |
of,inducers |
| R1330 |
T2212 |
T2213 |
compound |
Snail,expression |
| R1331 |
T2070 |
T2069 |
acomp |
absent,remains |
| R1332 |
T2213 |
T2211 |
pobj |
expression,of |
| R1333 |
T2214 |
T2213 |
compound |
gene,expression |
| R1334 |
T2071 |
T2069 |
prep |
during,remains |
| R1335 |
T2215 |
T2189 |
prep |
in,are |
| R1336 |
T2216 |
T2217 |
compound |
skin,epithelium |
| R1337 |
T2072 |
T2073 |
amod |
subsequent,growth |
| R1338 |
T2217 |
T2215 |
pobj |
epithelium,in |
| R1339 |
T2218 |
T2170 |
punct |
.,provide |
| R1340 |
T2073 |
T2071 |
pobj |
growth,during |
| R1341 |
T2220 |
T2221 |
prep |
In,form |
| R1342 |
T2074 |
T2073 |
nmod |
follicle,growth |
| R1343 |
T2222 |
T2223 |
det |
the,absence |
| R1344 |
T2223 |
T2220 |
pobj |
absence,In |
| R1345 |
T2075 |
T2073 |
amod |
down,growth |
| R1346 |
T2224 |
T2223 |
prep |
of,absence |
| R1347 |
T2225 |
T2226 |
compound |
TGF,β2 |
| R1348 |
T2226 |
T2228 |
compound |
β2,signaling |
| R1349 |
T2076 |
T2073 |
punct |
-,growth |
| R1350 |
T2227 |
T2226 |
punct |
-,β2 |
| R1351 |
T2077 |
T2073 |
cc |
and,growth |
| R1352 |
T2228 |
T2224 |
pobj |
signaling,of |
| R1353 |
T2229 |
T2228 |
cc |
and,signaling |
| R1354 |
T2230 |
T2231 |
compound |
Snail,expression |
| R1355 |
T2078 |
T2073 |
conj |
maturation,growth |
| R1356 |
T2231 |
T2228 |
conj |
expression,signaling |
| R1357 |
T2232 |
T2231 |
compound |
gene,expression |
| R1358 |
T2079 |
T2065 |
punct |
.,disappears |
| R1359 |
T2233 |
T2221 |
punct |
", ",form |
| R1360 |
T2234 |
T2235 |
compound |
hair,placodes |
| R1361 |
T2235 |
T2221 |
nsubj |
placodes,form |
| R1362 |
T2236 |
T2221 |
aux |
can,form |
| R1363 |
T2237 |
T2221 |
punct |
", ",form |
| R1364 |
T2238 |
T2221 |
cc |
but,form |
| R1365 |
T2081 |
T2082 |
det |
This,pattern |
| R1366 |
T2239 |
T2240 |
amod |
further,growth |
| R1367 |
T2240 |
T2244 |
nsubjpass |
growth,blocked |
| R1368 |
T2241 |
T2240 |
nmod |
follicle,growth |
| R1369 |
T2242 |
T2240 |
amod |
down,growth |
| R1370 |
T2082 |
T2084 |
nsubj |
pattern,appears |
| R1371 |
T2243 |
T2240 |
punct |
-,growth |
| R1372 |
T2244 |
T2221 |
conj |
blocked,form |
| R1373 |
T2245 |
T2244 |
auxpass |
is,blocked |
| R1374 |
T2083 |
T2082 |
amod |
exquisite,pattern |
| R1375 |
T2246 |
T2221 |
punct |
.,form |
| R1376 |
T2085 |
T2086 |
aux |
to,be |
| R1377 |
T2248 |
T2249 |
poss |
Our,studies |
| R1378 |
T2249 |
T2250 |
nsubj |
studies,point |
| R1379 |
T2251 |
T2250 |
prep |
to,point |
| R1380 |
T2086 |
T2084 |
xcomp |
be,appears |
| R1381 |
T2252 |
T2253 |
det |
the,view |
| R1382 |
T2253 |
T2251 |
pobj |
view,to |
| R1383 |
T2087 |
T2088 |
advmod |
functionally,relevant |
| R1384 |
T2254 |
T2255 |
mark |
that,functions |
| R1385 |
T2255 |
T2253 |
acl |
functions,view |
| R1386 |
T2256 |
T2255 |
nsubj |
Snail,functions |
| R1387 |
T2088 |
T2086 |
acomp |
relevant,be |
| R1388 |
T2257 |
T2255 |
advmod |
likely,functions |
| R1389 |
T2258 |
T2255 |
advmod |
downstream,functions |
| R1390 |
T2259 |
T2258 |
prep |
of,downstream |
| R1391 |
T2089 |
T2090 |
mark |
since,affects |
| R1392 |
T2260 |
T2261 |
compound |
cell,fate |
| R1393 |
T2261 |
T2262 |
compound |
fate,specification |
| R1394 |
T2090 |
T2086 |
advcl |
affects,be |
| R1395 |
T2262 |
T2259 |
pobj |
specification,of |
| R1396 |
T2263 |
T2250 |
punct |
", ",point |
| R1397 |
T2264 |
T2250 |
prep |
at,point |
| R1398 |
T2091 |
T2090 |
csubj |
altering,affects |
| R1399 |
T2265 |
T2266 |
det |
a,stage |
| R1400 |
T2266 |
T2264 |
pobj |
stage,at |
| R1401 |
T2092 |
T2091 |
dobj |
it,altering |
| R1402 |
T2267 |
T2268 |
advmod |
where,begins |
| R1403 |
T2268 |
T2266 |
relcl |
begins,stage |
| R1404 |
T2093 |
T2094 |
advmod |
in,vivo |
| R1405 |
T2269 |
T2270 |
det |
the,bud |
| R1406 |
T2270 |
T2268 |
nsubj |
bud,begins |
| R1407 |
T2094 |
T2091 |
advmod |
vivo,altering |
| R1408 |
T2271 |
T2272 |
aux |
to,exhibit |
| R1409 |
T2272 |
T2268 |
xcomp |
exhibit,begins |
| R1410 |
T2273 |
T2274 |
amod |
enhanced,proliferation |
| R1411 |
T2095 |
T2090 |
advmod |
correspondingly,affects |
| R1412 |
T2274 |
T2272 |
dobj |
proliferation,exhibit |
| R1413 |
T2275 |
T2274 |
cc |
and,proliferation |
| R1414 |
T2276 |
T2274 |
conj |
migration,proliferation |
| R1415 |
T2277 |
T2250 |
punct |
.,point |
| R1416 |
T2096 |
T2090 |
dobj |
features,affects |
| R1433 |
T2702 |
T2703 |
compound |
Snail,mRNA |
| R1434 |
T2703 |
T2704 |
nsubjpass |
mRNA,Expressed |
| R1435 |
T2705 |
T2703 |
cc |
and,mRNA |
| R1436 |
T2706 |
T2703 |
conj |
Protein,mRNA |
| R1437 |
T2707 |
T2704 |
auxpass |
Are,Expressed |
| R1438 |
T2708 |
T2704 |
advmod |
Transiently,Expressed |
| R1439 |
T2709 |
T2704 |
prep |
at,Expressed |
| R1440 |
T2710 |
T2711 |
det |
the,Stage |
| R1441 |
T2711 |
T2709 |
pobj |
Stage,at |
| R1442 |
T2712 |
T2713 |
compound |
Hair,Bud |
| R1443 |
T2713 |
T2711 |
compound |
Bud,Stage |
| R1444 |
T2714 |
T2711 |
prep |
of,Stage |
| R1445 |
T2715 |
T2716 |
compound |
Follicle,Morphogenesis |
| R1446 |
T2716 |
T2714 |
pobj |
Morphogenesis,of |
| R1447 |
T2718 |
T2719 |
mark |
Although,associated |
| R1448 |
T2719 |
T2726 |
advcl |
associated,participate |
| R1449 |
T2720 |
T2721 |
compound |
Snail,members |
| R1450 |
T2721 |
T2719 |
nsubjpass |
members,associated |
| R1451 |
T2722 |
T2721 |
compound |
family,members |
| R1452 |
T2723 |
T2719 |
auxpass |
are,associated |
| R1453 |
T2724 |
T2725 |
advmod |
most,frequently |
| R1454 |
T2725 |
T2719 |
advmod |
frequently,associated |
| R1455 |
T2727 |
T2719 |
prep |
with,associated |
| R1456 |
T2728 |
T2727 |
pobj |
EMTs,with |
| R1457 |
T2729 |
T2726 |
punct |
", ",participate |
| R1458 |
T2730 |
T2726 |
nsubj |
they,participate |
| R1459 |
T2731 |
T2726 |
advmod |
also,participate |
| R1460 |
T2732 |
T2726 |
prep |
in,participate |
| R1461 |
T2733 |
T2734 |
amod |
many,processes |
| R1462 |
T2734 |
T2732 |
pobj |
processes,in |
| R1463 |
T2735 |
T2734 |
amod |
malignant,processes |
| R1464 |
T2736 |
T2734 |
acl |
involving,processes |
| R1465 |
T2737 |
T2738 |
det |
a,regulation |
| R1466 |
T2738 |
T2736 |
dobj |
regulation,involving |
| R1467 |
T2739 |
T2738 |
amod |
down,regulation |
| R1468 |
T2740 |
T2738 |
punct |
-,regulation |
| R1469 |
T2741 |
T2738 |
cc |
but,regulation |
| R1470 |
T2742 |
T2741 |
neg |
not,but |
| R1471 |
T2743 |
T2744 |
det |
a,abrogation |
| R1472 |
T2744 |
T2738 |
conj |
abrogation,regulation |
| R1473 |
T2745 |
T2744 |
amod |
quantitative,abrogation |
| R1474 |
T2746 |
T2738 |
prep |
of,regulation |
| R1475 |
T2747 |
T2748 |
amod |
intercellular,junctions |
| R1476 |
T2748 |
T2746 |
pobj |
junctions,of |
| R1477 |
T2749 |
T2750 |
punct |
[,18 |
| R1478 |
T2750 |
T2726 |
parataxis |
18,participate |
| R1479 |
T2751 |
T2750 |
punct |
],18 |
| R1480 |
T2752 |
T2726 |
punct |
.,participate |
| R1481 |
T2754 |
T2755 |
det |
The,range |
| R1482 |
T2755 |
T2756 |
nsubj |
range,includes |
| R1483 |
T2757 |
T2755 |
prep |
of,range |
| R1484 |
T2758 |
T2759 |
amod |
developmental,processes |
| R1485 |
T2759 |
T2757 |
pobj |
processes,of |
| R1486 |
T2760 |
T2761 |
prep |
in,implicated |
| R1487 |
T2761 |
T2759 |
relcl |
implicated,processes |
| R1488 |
T2762 |
T2760 |
pobj |
which,in |
| R1489 |
T2763 |
T2764 |
compound |
Snail,members |
| R1490 |
T2764 |
T2761 |
nsubjpass |
members,implicated |
| R1491 |
T2765 |
T2764 |
compound |
family,members |
| R1492 |
T2766 |
T2761 |
aux |
have,implicated |
| R1493 |
T2767 |
T2761 |
auxpass |
been,implicated |
| R1494 |
T2768 |
T2756 |
advmod |
thus,includes |
| R1495 |
T2769 |
T2770 |
det |
the,type |
| R1496 |
T2770 |
T2756 |
dobj |
type,includes |
| R1497 |
T2771 |
T2770 |
prep |
of,type |
| R1498 |
T2772 |
T2773 |
amod |
epithelial,remodeling |
| R1499 |
T2773 |
T2771 |
pobj |
remodeling,of |
| R1500 |
T2774 |
T2775 |
dep |
that,observed |
| R1501 |
T2775 |
T2770 |
relcl |
observed,type |
| R1502 |
T2776 |
T2775 |
auxpass |
is,observed |
| R1503 |
T2777 |
T2775 |
prep |
in,observed |
| R1504 |
T2778 |
T2779 |
compound |
hair,follicle |
| R1505 |
T2779 |
T2780 |
compound |
follicle,bud |
| R1506 |
T2780 |
T2781 |
compound |
bud,formation |
| R1507 |
T2781 |
T2777 |
pobj |
formation,in |
| R1508 |
T2782 |
T2756 |
punct |
.,includes |
| R1509 |
T2784 |
T2785 |
prep |
Given,turned |
| R1510 |
T2786 |
T2787 |
poss |
our,observation |
| R1511 |
T2787 |
T2784 |
pobj |
observation,Given |
| R1512 |
T2788 |
T2787 |
amod |
prior,observation |
| R1513 |
T2789 |
T2790 |
mark |
that,participate |
| R1514 |
T2790 |
T2787 |
acl |
participate,observation |
| R1515 |
T2791 |
T2792 |
advmod |
exogenously,added |
| R1516 |
T2792 |
T2793 |
amod |
added,Snail |
| R1517 |
T2793 |
T2790 |
nsubj |
Snail,participate |
| R1518 |
T2794 |
T2790 |
aux |
can,participate |
| R1519 |
T2795 |
T2790 |
prep |
with,participate |
| R1520 |
T2796 |
T2795 |
pobj |
LEF,with |
| R1521 |
T2797 |
T2796 |
punct |
-,LEF |
| R1522 |
T2798 |
T2796 |
nummod |
1,LEF |
| R1523 |
T2799 |
T2796 |
punct |
/,LEF |
| R1524 |
T2800 |
T2801 |
compound |
β,catenin |
| R1525 |
T2801 |
T2796 |
appos |
catenin,LEF |
| R1526 |
T2802 |
T2801 |
punct |
-,catenin |
| R1527 |
T2803 |
T2790 |
prep |
in,participate |
| R1528 |
T2804 |
T2805 |
advmod |
down,regulating |
| R1529 |
T2805 |
T2803 |
pcomp |
regulating,in |
| R1530 |
T2806 |
T2805 |
punct |
-,regulating |
| R1531 |
T2807 |
T2808 |
compound |
E,cadherin |
| R1532 |
T2808 |
T2810 |
compound |
cadherin,expression |
| R1533 |
T2809 |
T2808 |
punct |
-,cadherin |
| R1534 |
T2810 |
T2805 |
dobj |
expression,regulating |
| R1535 |
T2811 |
T2790 |
prep |
in,participate |
| R1536 |
T2812 |
T2811 |
pobj |
keratinocytes,in |
| R1537 |
T2813 |
T2814 |
punct |
[,4 |
| R1538 |
T2814 |
T2790 |
parataxis |
4,participate |
| R1539 |
T2815 |
T2814 |
punct |
],4 |
| R1540 |
T2816 |
T2787 |
punct |
", ",observation |
| R1541 |
T2817 |
T2787 |
acl |
coupled,observation |
| R1542 |
T2818 |
T2817 |
prep |
with,coupled |
| R1543 |
T2819 |
T2820 |
det |
the,requirement |
| R1544 |
T2820 |
T2818 |
pobj |
requirement,with |
| R1545 |
T2821 |
T2820 |
amod |
established,requirement |
| R1546 |
T2822 |
T2820 |
prep |
for,requirement |
| R1547 |
T2823 |
T2822 |
pobj |
LEF,for |
| R1548 |
T2824 |
T2823 |
punct |
-,LEF |
| R1549 |
T2825 |
T2823 |
nummod |
1,LEF |
| R1550 |
T2826 |
T2823 |
punct |
/,LEF |
| R1551 |
T2827 |
T2828 |
compound |
β,catenin |
| R1552 |
T2828 |
T2823 |
appos |
catenin,LEF |
| R1553 |
T2829 |
T2828 |
punct |
-,catenin |
| R1554 |
T2830 |
T2820 |
prep |
in,requirement |
| R1555 |
T2831 |
T2832 |
compound |
hair,follicle |
| R1556 |
T2832 |
T2833 |
compound |
follicle,morphogenesis |
| R1557 |
T2833 |
T2830 |
pobj |
morphogenesis,in |
| R1558 |
T2834 |
T2835 |
punct |
[,19 |
| R1559 |
T2835 |
T2817 |
parataxis |
19,coupled |
| R1560 |
T2836 |
T2835 |
nummod |
4,19 |
| R1561 |
T2837 |
T2835 |
punct |
",",19 |
| R1562 |
T2838 |
T2835 |
punct |
],19 |
| R1563 |
T2839 |
T2785 |
punct |
", ",turned |
| R1564 |
T2840 |
T2785 |
nsubj |
we,turned |
| R1565 |
T2841 |
T2785 |
prep |
to,turned |
| R1566 |
T2842 |
T2841 |
pcomp |
addressing,to |
| R1567 |
T2843 |
T2844 |
mark |
whether,participate |
| R1568 |
T2844 |
T2842 |
ccomp |
participate,addressing |
| R1569 |
T2845 |
T2846 |
compound |
Snail,Slug |
| R1570 |
T2846 |
T2848 |
compound |
Slug,members |
| R1571 |
T2847 |
T2846 |
punct |
/,Slug |
| R1572 |
T2848 |
T2844 |
nsubj |
members,participate |
| R1573 |
T2849 |
T2848 |
compound |
family,members |
| R1574 |
T2850 |
T2844 |
aux |
might,participate |
| R1575 |
T2851 |
T2844 |
advmod |
also,participate |
| R1576 |
T2852 |
T2844 |
prep |
in,participate |
| R1577 |
T2853 |
T2854 |
det |
the,process |
| R1578 |
T2854 |
T2852 |
pobj |
process,in |
| R1579 |
T2855 |
T2785 |
punct |
.,turned |
| R1580 |
T2857 |
T2858 |
compound |
PCR,analyses |
| R1581 |
T2858 |
T2859 |
nsubj |
analyses,identified |
| R1582 |
T2860 |
T2861 |
amod |
transient,expression |
| R1583 |
T2861 |
T2859 |
dobj |
expression,identified |
| R1584 |
T2862 |
T2861 |
compound |
Snail,expression |
| R1585 |
T2863 |
T2861 |
compound |
mRNA,expression |
| R1586 |
T2864 |
T2859 |
prep |
during,identified |
| R1587 |
T2865 |
T2866 |
det |
a,period |
| R1588 |
T2866 |
T2864 |
pobj |
period,during |
| R1589 |
T2867 |
T2866 |
prep |
of,period |
| R1590 |
T2868 |
T2869 |
compound |
skin,embryogenesis |
| R1591 |
T2869 |
T2867 |
pobj |
embryogenesis,of |
| R1592 |
T2870 |
T2871 |
advmod |
when,forming |
| R1593 |
T2871 |
T2866 |
advcl |
forming,period |
| R1594 |
T2872 |
T2871 |
nsubj |
waves,forming |
| R1595 |
T2873 |
T2872 |
prep |
of,waves |
| R1596 |
T2874 |
T2875 |
compound |
hair,follicles |
| R1597 |
T2875 |
T2873 |
pobj |
follicles,of |
| R1598 |
T2876 |
T2871 |
aux |
are,forming |
| R1599 |
T2877 |
T2878 |
punct |
(,data |
| R1600 |
T2878 |
T2859 |
meta |
data,identified |
| R1601 |
T2879 |
T2878 |
amod |
unpublished,data |
| R1602 |
T2880 |
T2878 |
punct |
),data |
| R1603 |
T2881 |
T2859 |
punct |
.,identified |
| R1604 |
T2882 |
T2883 |
aux |
To,pinpoint |
| R1605 |
T2883 |
T2885 |
advcl |
pinpoint,conducted |
| R1606 |
T2886 |
T2883 |
advmod |
specifically,pinpoint |
| R1607 |
T2887 |
T2888 |
advmod |
where,expressed |
| R1608 |
T2888 |
T2883 |
advcl |
expressed,pinpoint |
| R1609 |
T2889 |
T2890 |
compound |
Snail,mRNA |
| R1610 |
T2890 |
T2888 |
nsubjpass |
mRNA,expressed |
| R1611 |
T2891 |
T2888 |
auxpass |
is,expressed |
| R1612 |
T2892 |
T2888 |
prep |
in,expressed |
| R1613 |
T2893 |
T2894 |
det |
the,skin |
| R1614 |
T2894 |
T2892 |
pobj |
skin,in |
| R1615 |
T2895 |
T2894 |
amod |
developing,skin |
| R1616 |
T2896 |
T2885 |
punct |
", ",conducted |
| R1617 |
T2897 |
T2885 |
nsubj |
we,conducted |
| R1618 |
T2898 |
T2899 |
advmod |
in,situ |
| R1619 |
T2899 |
T2900 |
amod |
situ,hybridization |
| R1620 |
T2900 |
T2885 |
dobj |
hybridization,conducted |
| R1621 |
T2901 |
T2885 |
advcl |
using,conducted |
| R1622 |
T2902 |
T2903 |
det |
a,probe |
| R1623 |
T2903 |
T2901 |
dobj |
probe,using |
| R1624 |
T2904 |
T2903 |
compound |
cRNA,probe |
| R1625 |
T2905 |
T2903 |
amod |
unique,probe |
| R1626 |
T2906 |
T2905 |
prep |
to,unique |
| R1627 |
T2907 |
T2908 |
det |
the,region |
| R1628 |
T2908 |
T2906 |
pobj |
region,to |
| R1629 |
T2909 |
T2908 |
nmod |
Snail,region |
| R1630 |
T2910 |
T2908 |
nummod |
3,region |
| R1631 |
T2911 |
T2910 |
punct |
′,3 |
| R1632 |
T2912 |
T2908 |
amod |
untranslated,region |
| R1633 |
T2913 |
T2908 |
punct |
(,region |
| R1634 |
T2914 |
T2908 |
appos |
UTR,region |
| R1635 |
T2915 |
T2908 |
punct |
),region |
| R1636 |
T2916 |
T2885 |
punct |
.,conducted |
| R1637 |
T2918 |
T2919 |
amod |
Embryonic,day |
| R1638 |
T2919 |
T2920 |
nsubjpass |
day,chosen |
| R1639 |
T2921 |
T2919 |
nummod |
17.5,day |
| R1640 |
T2922 |
T2919 |
punct |
(,day |
| R1641 |
T2923 |
T2919 |
appos |
E17.5,day |
| R1642 |
T2924 |
T2920 |
punct |
),chosen |
| R1643 |
T2925 |
T2920 |
auxpass |
was,chosen |
| R1644 |
T2926 |
T2920 |
punct |
", ",chosen |
| R1645 |
T2927 |
T2928 |
mark |
since,enabled |
| R1646 |
T2928 |
T2920 |
advcl |
enabled,chosen |
| R1647 |
T2929 |
T2930 |
det |
the,waves |
| R1648 |
T2930 |
T2928 |
nsubj |
waves,enabled |
| R1649 |
T2931 |
T2930 |
amod |
multiple,waves |
| R1650 |
T2932 |
T2930 |
prep |
of,waves |
| R1651 |
T2933 |
T2934 |
compound |
follicle,morphogenesis |
| R1652 |
T2934 |
T2932 |
pobj |
morphogenesis,of |
| R1653 |
T2935 |
T2930 |
acl |
occurring,waves |
| R1654 |
T2936 |
T2935 |
prep |
at,occurring |
| R1655 |
T2937 |
T2938 |
det |
this,time |
| R1656 |
T2938 |
T2936 |
pobj |
time,at |
| R1657 |
T2939 |
T2928 |
dobj |
us,enabled |
| R1658 |
T2940 |
T2941 |
aux |
to,evaluate |
| R1659 |
T2941 |
T2928 |
xcomp |
evaluate,enabled |
| R1660 |
T2942 |
T2943 |
compound |
Snail,expression |
| R1661 |
T2943 |
T2941 |
dobj |
expression,evaluate |
| R1662 |
T2944 |
T2941 |
prep |
at,evaluate |
| R1663 |
T2945 |
T2946 |
amod |
different,stages |
| R1664 |
T2946 |
T2944 |
pobj |
stages,at |
| R1665 |
T2947 |
T2946 |
prep |
of,stages |
| R1666 |
T2948 |
T2949 |
det |
the,process |
| R1667 |
T2949 |
T2947 |
pobj |
process,of |
| R1668 |
T2950 |
T2920 |
punct |
.,chosen |
| R1669 |
T2952 |
T2953 |
mark |
As,shown |
| R1670 |
T2953 |
T2954 |
advcl |
shown,detected |
| R1671 |
T2955 |
T2953 |
prep |
in,shown |
| R1672 |
T2956 |
T2957 |
compound |
Figure,1A |
| R1673 |
T2957 |
T2955 |
pobj |
1A,in |
| R1674 |
T2958 |
T2954 |
punct |
", ",detected |
| R1675 |
T2959 |
T2960 |
amod |
specific,hybridization |
| R1676 |
T2960 |
T2954 |
nsubjpass |
hybridization,detected |
| R1677 |
T2961 |
T2954 |
auxpass |
was,detected |
| R1678 |
T2962 |
T2954 |
prep |
within,detected |
| R1679 |
T2963 |
T2964 |
det |
the,epithelium |
| R1680 |
T2964 |
T2962 |
pobj |
epithelium,within |
| R1681 |
T2965 |
T2964 |
prep |
of,epithelium |
| R1682 |
T2966 |
T2967 |
amod |
nascent,buds |
| R1683 |
T2967 |
T2965 |
pobj |
buds,of |
| R1684 |
T2968 |
T2967 |
compound |
hair,buds |
| R1685 |
T2969 |
T2954 |
punct |
.,detected |
| R1686 |
T2971 |
T2972 |
prep |
By,exhibited |
| R1687 |
T2973 |
T2971 |
pobj |
contrast,By |
| R1688 |
T2974 |
T2972 |
punct |
", ",exhibited |
| R1689 |
T2975 |
T2976 |
mark |
as,progressed |
| R1690 |
T2976 |
T2972 |
advcl |
progressed,exhibited |
| R1691 |
T2977 |
T2976 |
nsubj |
follicles,progressed |
| R1692 |
T2978 |
T2976 |
advmod |
further,progressed |
| R1693 |
T2979 |
T2976 |
prep |
through,progressed |
| R1694 |
T2980 |
T2981 |
poss |
their,development |
| R1695 |
T2981 |
T2979 |
pobj |
development,through |
| R1696 |
T2982 |
T2983 |
punct |
(,stages |
| R1697 |
T2983 |
T2976 |
parataxis |
stages,progressed |
| R1698 |
T2984 |
T2983 |
advmod |
e.g.,stages |
| R1699 |
T2985 |
T2983 |
punct |
", ",stages |
| R1700 |
T2986 |
T2983 |
nmod |
germ,stages |
| R1701 |
T2987 |
T2986 |
cc |
and,germ |
| R1702 |
T2988 |
T2986 |
conj |
peg,germ |
| R1703 |
T2989 |
T2983 |
punct |
),stages |
| R1704 |
T2990 |
T2972 |
punct |
", ",exhibited |
| R1705 |
T2991 |
T2972 |
nsubj |
they,exhibited |
| R1706 |
T2992 |
T2993 |
det |
no,signs |
| R1707 |
T2993 |
T2972 |
dobj |
signs,exhibited |
| R1708 |
T2994 |
T2993 |
prep |
of,signs |
| R1709 |
T2995 |
T2994 |
pobj |
hybridization,of |
| R1710 |
T2996 |
T2997 |
punct |
(,1A |
| R1711 |
T2997 |
T2972 |
parataxis |
1A,exhibited |
| R1712 |
T2998 |
T2997 |
compound |
Figure,1A |
| R1713 |
T2999 |
T2997 |
punct |
),1A |
| R1714 |
T3000 |
T2972 |
punct |
.,exhibited |
| R1715 |
T3002 |
T3003 |
det |
The,nature |
| R1716 |
T3003 |
T3005 |
nsubj |
nature,was |
| R1717 |
T3004 |
T3003 |
amod |
transient,nature |
| R1718 |
T3006 |
T3003 |
prep |
of,nature |
| R1719 |
T3007 |
T3008 |
compound |
Snail,expression |
| R1720 |
T3008 |
T3006 |
pobj |
expression,of |
| R1721 |
T3009 |
T3008 |
compound |
mRNA,expression |
| R1722 |
T3010 |
T3008 |
prep |
during,expression |
| R1723 |
T3011 |
T3012 |
compound |
follicle,development |
| R1724 |
T3012 |
T3010 |
pobj |
development,during |
| R1725 |
T3013 |
T3014 |
advmod |
most,apparent |
| R1726 |
T3014 |
T3005 |
acomp |
apparent,was |
| R1727 |
T3015 |
T3005 |
prep |
in,was |
| R1728 |
T3016 |
T3017 |
amod |
hybridized,sections |
| R1729 |
T3017 |
T3015 |
pobj |
sections,in |
| R1730 |
T3018 |
T3017 |
compound |
skin,sections |
| R1731 |
T3019 |
T3017 |
acl |
containing,sections |
| R1732 |
T3020 |
T3019 |
dobj |
follicles,containing |
| R1733 |
T3021 |
T3020 |
prep |
from,follicles |
| R1734 |
T3022 |
T3023 |
nummod |
two,waves |
| R1735 |
T3023 |
T3021 |
pobj |
waves,from |
| R1736 |
T3024 |
T3023 |
amod |
different,waves |
| R1737 |
T3025 |
T3023 |
prep |
of,waves |
| R1738 |
T3026 |
T3025 |
pobj |
morphogenesis,of |
| R1739 |
T3027 |
T3028 |
punct |
(,shown |
| R1740 |
T3028 |
T3005 |
parataxis |
shown,was |
| R1741 |
T3029 |
T3028 |
mark |
as,shown |
| R1742 |
T3030 |
T3028 |
prep |
in,shown |
| R1743 |
T3031 |
T3030 |
pobj |
Figure,in |
| R1744 |
T3032 |
T3031 |
nummod |
1,Figure |
| R1745 |
T3033 |
T3028 |
punct |
),shown |
| R1746 |
T3034 |
T3005 |
punct |
.,was |
| R1747 |
T3036 |
T3037 |
amod |
Hybridizing,buds |
| R1748 |
T3037 |
T3039 |
nsubj |
buds,appeared |
| R1749 |
T3038 |
T3037 |
compound |
hair,buds |
| R1750 |
T3040 |
T3037 |
prep |
from,buds |
| R1751 |
T3041 |
T3042 |
det |
a,wave |
| R1752 |
T3042 |
T3040 |
pobj |
wave,from |
| R1753 |
T3043 |
T3042 |
amod |
later,wave |
| R1754 |
T3044 |
T3039 |
oprd |
juxtaposed,appeared |
| R1755 |
T3045 |
T3044 |
prep |
with,juxtaposed |
| R1756 |
T3046 |
T3047 |
amod |
nonhybridizing,follicles |
| R1757 |
T3047 |
T3045 |
pobj |
follicles,with |
| R1758 |
T3048 |
T3047 |
prep |
from,follicles |
| R1759 |
T3049 |
T3050 |
det |
an,wave |
| R1760 |
T3050 |
T3048 |
pobj |
wave,from |
| R1761 |
T3051 |
T3050 |
amod |
earlier,wave |
| R1762 |
T3052 |
T3039 |
punct |
.,appeared |
| R1763 |
T3054 |
T3055 |
aux |
To,determine |
| R1764 |
T3055 |
T3056 |
advcl |
determine,generated |
| R1765 |
T3057 |
T3058 |
mark |
whether,reflected |
| R1766 |
T3058 |
T3055 |
ccomp |
reflected,determine |
| R1767 |
T3059 |
T3060 |
det |
this,nature |
| R1768 |
T3060 |
T3058 |
nsubjpass |
nature,reflected |
| R1769 |
T3061 |
T3060 |
amod |
transient,nature |
| R1770 |
T3062 |
T3060 |
prep |
of,nature |
| R1771 |
T3063 |
T3064 |
compound |
Snail,expression |
| R1772 |
T3064 |
T3062 |
pobj |
expression,of |
| R1773 |
T3065 |
T3064 |
compound |
mRNA,expression |
| R1774 |
T3066 |
T3058 |
auxpass |
is,reflected |
| R1775 |
T3067 |
T3058 |
prep |
at,reflected |
| R1776 |
T3068 |
T3069 |
det |
the,level |
| R1777 |
T3069 |
T3067 |
pobj |
level,at |
| R1778 |
T3070 |
T3069 |
compound |
protein,level |
| R1779 |
T3071 |
T3056 |
punct |
", ",generated |
| R1780 |
T3072 |
T3056 |
nsubj |
we,generated |
| R1781 |
T3073 |
T3074 |
det |
an,antibody |
| R1782 |
T3074 |
T3056 |
dobj |
antibody,generated |
| R1783 |
T3075 |
T3074 |
prep |
against,antibody |
| R1784 |
T3076 |
T3077 |
det |
the,sequence |
| R1785 |
T3077 |
T3075 |
pobj |
sequence,against |
| R1786 |
T3078 |
T3079 |
npadvmod |
N,terminal |
| R1787 |
T3079 |
T3077 |
amod |
terminal,sequence |
| R1788 |
T3080 |
T3079 |
punct |
-,terminal |
| R1789 |
T3081 |
T3082 |
dep |
that,resides |
| R1790 |
T3082 |
T3077 |
relcl |
resides,sequence |
| R1791 |
T3083 |
T3082 |
advmod |
upstream,resides |
| R1792 |
T3084 |
T3083 |
prep |
of,upstream |
| R1793 |
T3085 |
T3086 |
det |
the,domains |
| R1794 |
T3086 |
T3084 |
pobj |
domains,of |
| R1795 |
T3087 |
T3088 |
advmod |
more,conserved |
| R1796 |
T3088 |
T3086 |
amod |
conserved,domains |
| R1797 |
T3089 |
T3090 |
compound |
zinc,finger |
| R1798 |
T3090 |
T3086 |
compound |
finger,domains |
| R1799 |
T3091 |
T3056 |
punct |
.,generated |
| R1800 |
T3093 |
T3094 |
mark |
As,judged |
| R1801 |
T3094 |
T3095 |
advcl |
judged,detect |
| R1802 |
T3096 |
T3094 |
prep |
by,judged |
| R1803 |
T3097 |
T3098 |
compound |
Western,blot |
| R1804 |
T3098 |
T3099 |
compound |
blot,analysis |
| R1805 |
T3099 |
T3096 |
pobj |
analysis,by |
| R1806 |
T3100 |
T3095 |
punct |
", ",detect |
| R1807 |
T3101 |
T3102 |
det |
the,antibody |
| R1808 |
T3102 |
T3095 |
nsubj |
antibody,detect |
| R1809 |
T3103 |
T3095 |
aux |
did,detect |
| R1810 |
T3104 |
T3095 |
neg |
not,detect |
| R1811 |
T3105 |
T3106 |
amod |
endogenous,proteins |
| R1812 |
T3106 |
T3095 |
dobj |
proteins,detect |
| R1813 |
T3107 |
T3106 |
prep |
from,proteins |
| R1814 |
T3108 |
T3109 |
amod |
cultured,keratinocytes |
| R1815 |
T3109 |
T3107 |
pobj |
keratinocytes,from |
| R1816 |
T3110 |
T3095 |
punct |
", ",detect |
| R1817 |
T3111 |
T3095 |
cc |
but,detect |
| R1818 |
T3112 |
T3113 |
nsubj |
it,yield |
| R1819 |
T3113 |
T3095 |
conj |
yield,detect |
| R1820 |
T3114 |
T3113 |
aux |
did,yield |
| R1821 |
T3115 |
T3116 |
det |
a,band |
| R1822 |
T3116 |
T3113 |
dobj |
band,yield |
| R1823 |
T3117 |
T3116 |
prep |
of,band |
| R1824 |
T3118 |
T3119 |
det |
the,size |
| R1825 |
T3119 |
T3117 |
pobj |
size,of |
| R1826 |
T3120 |
T3119 |
amod |
expected,size |
| R1827 |
T3121 |
T3113 |
prep |
from,yield |
| R1828 |
T3122 |
T3121 |
pobj |
keratinocytes,from |
| R1829 |
T3123 |
T3124 |
advmod |
transiently,expressing |
| R1830 |
T3124 |
T3122 |
acl |
expressing,keratinocytes |
| R1831 |
T3125 |
T3126 |
det |
a,protein |
| R1832 |
T3126 |
T3124 |
dobj |
protein,expressing |
| R1833 |
T3127 |
T3128 |
npadvmod |
hemagglutinin,tagged |
| R1834 |
T3128 |
T3126 |
amod |
tagged,protein |
| R1835 |
T3129 |
T3127 |
punct |
(,hemagglutinin |
| R1836 |
T3130 |
T3127 |
appos |
HA,hemagglutinin |
| R1837 |
T3131 |
T3128 |
punct |
),tagged |
| R1838 |
T3132 |
T3128 |
punct |
-,tagged |
| R1839 |
T3133 |
T3126 |
compound |
Snail,protein |
| R1840 |
T3134 |
T3135 |
punct |
(,1B |
| R1841 |
T3135 |
T3113 |
parataxis |
1B,yield |
| R1842 |
T3136 |
T3135 |
compound |
Figure,1B |
| R1843 |
T3137 |
T3135 |
punct |
),1B |
| R1844 |
T3138 |
T3095 |
punct |
.,detect |
| R1845 |
T3140 |
T3141 |
det |
The,antibody |
| R1846 |
T3141 |
T3142 |
nsubj |
antibody,recognized |
| R1847 |
T3143 |
T3142 |
advmod |
also,recognized |
| R1848 |
T3144 |
T3145 |
det |
a,band |
| R1849 |
T3145 |
T3142 |
dobj |
band,recognized |
| R1850 |
T3146 |
T3145 |
acl |
corresponding,band |
| R1851 |
T3147 |
T3146 |
prep |
to,corresponding |
| R1852 |
T3148 |
T3149 |
det |
the,size |
| R1853 |
T3149 |
T3147 |
pobj |
size,to |
| R1854 |
T3150 |
T3149 |
prep |
of,size |
| R1855 |
T3151 |
T3152 |
amod |
endogenous,Snail |
| R1856 |
T3152 |
T3150 |
pobj |
Snail,of |
| R1857 |
T3153 |
T3149 |
punct |
(,size |
| R1858 |
T3154 |
T3155 |
advmod |
approximately,28 |
| R1859 |
T3155 |
T3156 |
nummod |
28,kDa |
| R1860 |
T3156 |
T3149 |
appos |
kDa,size |
| R1861 |
T3157 |
T3149 |
punct |
),size |
| R1862 |
T3158 |
T3149 |
prep |
in,size |
| R1863 |
T3159 |
T3158 |
pobj |
lysates,in |
| R1864 |
T3160 |
T3159 |
prep |
from,lysates |
| R1865 |
T3161 |
T3162 |
amod |
embryonic,skin |
| R1866 |
T3162 |
T3160 |
pobj |
skin,from |
| R1867 |
T3163 |
T3162 |
compound |
mouse,skin |
| R1868 |
T3164 |
T3145 |
punct |
", ",band |
| R1869 |
T3165 |
T3166 |
det |
the,appearance |
| R1870 |
T3166 |
T3168 |
dep |
appearance,corresponded |
| R1871 |
T3167 |
T3166 |
amod |
temporal,appearance |
| R1872 |
T3168 |
T3145 |
relcl |
corresponded,band |
| R1873 |
T3169 |
T3166 |
prep |
of,appearance |
| R1874 |
T3170 |
T3169 |
pobj |
which,of |
| R1875 |
T3171 |
T3168 |
prep |
to,corresponded |
| R1876 |
T3172 |
T3173 |
det |
the,waves |
| R1877 |
T3173 |
T3171 |
pobj |
waves,to |
| R1878 |
T3174 |
T3173 |
prep |
of,waves |
| R1879 |
T3175 |
T3176 |
compound |
hair,follicle |
| R1880 |
T3176 |
T3177 |
compound |
follicle,morphogenesis |
| R1881 |
T3177 |
T3174 |
pobj |
morphogenesis,of |
| R1882 |
T3178 |
T3173 |
prep |
from,waves |
| R1883 |
T3179 |
T3178 |
pobj |
E15.5,from |
| R1884 |
T3180 |
T3178 |
prep |
to,from |
| R1885 |
T3181 |
T3180 |
amod |
newborn,to |
| R1886 |
T3182 |
T3183 |
advmod |
when,formed |
| R1887 |
T3183 |
T3173 |
relcl |
formed,waves |
| R1888 |
T3184 |
T3185 |
quantmod |
over,90 |
| R1889 |
T3185 |
T3186 |
nummod |
90,% |
| R1890 |
T3186 |
T3183 |
nsubjpass |
%,formed |
| R1891 |
T3187 |
T3186 |
prep |
of,% |
| R1892 |
T3188 |
T3189 |
det |
the,hair |
| R1893 |
T3189 |
T3187 |
pobj |
hair,of |
| R1894 |
T3190 |
T3189 |
prep |
on,hair |
| R1895 |
T3191 |
T3192 |
det |
the,mouse |
| R1896 |
T3192 |
T3190 |
pobj |
mouse,on |
| R1897 |
T3193 |
T3183 |
auxpass |
is,formed |
| R1898 |
T3194 |
T3195 |
punct |
(,1B |
| R1899 |
T3195 |
T3142 |
parataxis |
1B,recognized |
| R1900 |
T3196 |
T3195 |
compound |
Figure,1B |
| R1901 |
T3197 |
T3195 |
punct |
),1B |
| R1902 |
T3198 |
T3142 |
punct |
.,recognized |
| R1903 |
T3200 |
T3201 |
advcl |
Consistent,detect |
| R1904 |
T3202 |
T3200 |
prep |
with,Consistent |
| R1905 |
T3203 |
T3204 |
det |
the,data |
| R1906 |
T3204 |
T3202 |
pobj |
data,with |
| R1907 |
T3205 |
T3206 |
compound |
Western,blot |
| R1908 |
T3206 |
T3204 |
compound |
blot,data |
| R1909 |
T3207 |
T3201 |
punct |
", ",detect |
| R1910 |
T3208 |
T3209 |
amod |
immunohistochemical,analysis |
| R1911 |
T3209 |
T3201 |
nsubj |
analysis,detect |
| R1912 |
T3210 |
T3201 |
aux |
did,detect |
| R1913 |
T3211 |
T3201 |
neg |
not,detect |
| R1914 |
T3212 |
T3201 |
dobj |
Snail,detect |
| R1915 |
T3213 |
T3201 |
prep |
in,detect |
| R1916 |
T3214 |
T3215 |
amod |
single,layered |
| R1917 |
T3215 |
T3217 |
amod |
layered,epidermis |
| R1918 |
T3216 |
T3215 |
punct |
-,layered |
| R1919 |
T3217 |
T3213 |
pobj |
epidermis,in |
| R1920 |
T3218 |
T3217 |
compound |
E13.5,epidermis |
| R1921 |
T3219 |
T3220 |
punct |
(,1C |
| R1922 |
T3220 |
T3217 |
parataxis |
1C,epidermis |
| R1923 |
T3221 |
T3220 |
compound |
Figure,1C |
| R1924 |
T3222 |
T3220 |
punct |
),1C |
| R1925 |
T3223 |
T3213 |
cc |
nor,in |
| R1926 |
T3224 |
T3213 |
conj |
in,in |
| R1927 |
T3225 |
T3226 |
det |
the,placode |
| R1928 |
T3226 |
T3224 |
pobj |
placode,in |
| R1929 |
T3227 |
T3201 |
punct |
", ",detect |
| R1930 |
T3228 |
T3229 |
dep |
which,is |
| R1931 |
T3229 |
T3201 |
advcl |
is,detect |
| R1932 |
T3230 |
T3231 |
det |
the,sign |
| R1933 |
T3231 |
T3229 |
attr |
sign,is |
| R1934 |
T3232 |
T3231 |
amod |
earliest,sign |
| R1935 |
T3233 |
T3231 |
amod |
morphological,sign |
| R1936 |
T3234 |
T3231 |
prep |
of,sign |
| R1937 |
T3235 |
T3236 |
det |
the,commitment |
| R1938 |
T3236 |
T3234 |
pobj |
commitment,of |
| R1939 |
T3237 |
T3236 |
prep |
of,commitment |
| R1940 |
T3238 |
T3239 |
amod |
multipotent,cells |
| R1941 |
T3239 |
T3237 |
pobj |
cells,of |
| R1942 |
T3240 |
T3239 |
prep |
of,cells |
| R1943 |
T3241 |
T3242 |
det |
the,ectoderm |
| R1944 |
T3242 |
T3240 |
pobj |
ectoderm,of |
| R1945 |
T3243 |
T3242 |
amod |
embryonic,ectoderm |
| R1946 |
T3244 |
T3236 |
prep |
to,commitment |
| R1947 |
T3245 |
T3246 |
det |
a,fate |
| R1948 |
T3246 |
T3244 |
pobj |
fate,to |
| R1949 |
T3247 |
T3248 |
compound |
hair,cell |
| R1950 |
T3248 |
T3246 |
compound |
cell,fate |
| R1951 |
T3249 |
T3250 |
punct |
(,1D |
| R1952 |
T3250 |
T3201 |
parataxis |
1D,detect |
| R1953 |
T3251 |
T3250 |
compound |
Figure,1D |
| R1954 |
T3252 |
T3250 |
punct |
),1D |
| R1955 |
T3253 |
T3201 |
punct |
.,detect |
| R1956 |
T3255 |
T3256 |
advcl |
Consistent,labeled |
| R1957 |
T3257 |
T3255 |
prep |
with,Consistent |
| R1958 |
T3258 |
T3259 |
det |
the,results |
| R1959 |
T3259 |
T3257 |
pobj |
results,with |
| R1960 |
T3260 |
T3261 |
advmod |
in,situ |
| R1961 |
T3261 |
T3259 |
amod |
situ,results |
| R1962 |
T3262 |
T3259 |
compound |
hybridization,results |
| R1963 |
T3263 |
T3256 |
punct |
", ",labeled |
| R1964 |
T3264 |
T3265 |
amod |
anti-Snail,antibody |
| R1965 |
T3265 |
T3256 |
nsubj |
antibody,labeled |
| R1966 |
T3266 |
T3267 |
advmod |
only,buds |
| R1967 |
T3267 |
T3256 |
dobj |
buds,labeled |
| R1968 |
T3268 |
T3267 |
compound |
hair,buds |
| R1969 |
T3269 |
T3267 |
cc |
and,buds |
| R1970 |
T3270 |
T3269 |
neg |
not,and |
| R1971 |
T3271 |
T3267 |
conj |
follicles,buds |
| R1972 |
T3272 |
T3256 |
prep |
at,labeled |
| R1973 |
T3273 |
T3274 |
advmod |
more,stages |
| R1974 |
T3274 |
T3272 |
pobj |
stages,at |
| R1975 |
T3275 |
T3274 |
amod |
mature,stages |
| R1976 |
T3276 |
T3274 |
prep |
of,stages |
| R1977 |
T3277 |
T3276 |
pobj |
development,of |
| R1978 |
T3278 |
T3279 |
punct |
(,1E |
| R1979 |
T3279 |
T3256 |
parataxis |
1E,labeled |
| R1980 |
T3280 |
T3279 |
compound |
Figure,1E |
| R1981 |
T3281 |
T3279 |
punct |
),1E |
| R1982 |
T3282 |
T3256 |
punct |
.,labeled |
| R1983 |
T3284 |
T3285 |
advcl |
Taken,appeared |
| R1984 |
T3286 |
T3284 |
advmod |
together,Taken |
| R1985 |
T3287 |
T3285 |
punct |
", ",appeared |
| R1986 |
T3288 |
T3289 |
det |
the,antibody |
| R1987 |
T3289 |
T3285 |
nsubj |
antibody,appeared |
| R1988 |
T3290 |
T3289 |
amod |
anti-Snail,antibody |
| R1989 |
T3291 |
T3292 |
aux |
to,be |
| R1990 |
T3292 |
T3285 |
xcomp |
be,appeared |
| R1991 |
T3293 |
T3292 |
acomp |
specific,be |
| R1992 |
T3294 |
T3293 |
prep |
for,specific |
| R1993 |
T3295 |
T3296 |
poss |
its,protein |
| R1994 |
T3296 |
T3294 |
pobj |
protein,for |
| R1995 |
T3297 |
T3296 |
compound |
target,protein |
| R1996 |
T3298 |
T3285 |
punct |
.,appeared |
| R1997 |
T3300 |
T3301 |
nsubj |
It,detect |
| R1998 |
T3302 |
T3301 |
aux |
did,detect |
| R1999 |
T3303 |
T3301 |
neg |
not,detect |
| R2000 |
T3304 |
T3305 |
amod |
other,members |
| R2001 |
T3305 |
T3301 |
dobj |
members,detect |
| R2002 |
T3306 |
T3305 |
compound |
Snail,members |
| R2003 |
T3307 |
T3305 |
compound |
family,members |
| R2004 |
T3308 |
T3305 |
acl |
known,members |
| R2005 |
T3309 |
T3310 |
aux |
to,expressed |
| R2006 |
T3310 |
T3308 |
xcomp |
expressed,known |
| R2007 |
T3311 |
T3310 |
auxpass |
be,expressed |
| R2008 |
T3312 |
T3310 |
prep |
in,expressed |
| R2009 |
T3313 |
T3312 |
pobj |
keratinocytes,in |
| R2010 |
T3314 |
T3313 |
cc |
and,keratinocytes |
| R2011 |
T3315 |
T3314 |
punct |
/,and |
| R2012 |
T3316 |
T3314 |
cc |
or,and |
| R2013 |
T3317 |
T3313 |
conj |
skin,keratinocytes |
| R2014 |
T3318 |
T3319 |
punct |
(,data |
| R2015 |
T3319 |
T3308 |
meta |
data,known |
| R2016 |
T3320 |
T3319 |
amod |
unpublished,data |
| R2017 |
T3321 |
T3319 |
punct |
),data |
| R2018 |
T3322 |
T3301 |
punct |
.,detect |
| R2019 |
T3324 |
T3325 |
advmod |
Furthermore,paralleled |
| R2020 |
T3326 |
T3325 |
punct |
", ",paralleled |
| R2021 |
T3327 |
T3328 |
det |
the,data |
| R2022 |
T3328 |
T3325 |
nsubj |
data,paralleled |
| R2023 |
T3329 |
T3328 |
amod |
immunohistochemical,data |
| R2024 |
T3330 |
T3331 |
poss |
our,data |
| R2025 |
T3331 |
T3325 |
dobj |
data,paralleled |
| R2026 |
T3332 |
T3333 |
nmod |
Snail,hybridization |
| R2027 |
T3333 |
T3331 |
compound |
hybridization,data |
| R2028 |
T3334 |
T3335 |
advmod |
in,situ |
| R2029 |
T3335 |
T3333 |
amod |
situ,hybridization |
| R2030 |
T3336 |
T3325 |
advcl |
revealing,paralleled |
| R2031 |
T3337 |
T3338 |
amod |
transient,expression |
| R2032 |
T3338 |
T3336 |
dobj |
expression,revealing |
| R2033 |
T3339 |
T3338 |
compound |
Snail,expression |
| R2034 |
T3340 |
T3336 |
prep |
at,revealing |
| R2035 |
T3341 |
T3342 |
det |
the,stage |
| R2036 |
T3342 |
T3340 |
pobj |
stage,at |
| R2037 |
T3343 |
T3344 |
compound |
hair,bud |
| R2038 |
T3344 |
T3342 |
compound |
bud,stage |
| R2039 |
T3345 |
T3346 |
punct |
(,1A |
| R2040 |
T3346 |
T3325 |
parataxis |
1A,paralleled |
| R2041 |
T3347 |
T3346 |
compound |
Figure,1A |
| R2042 |
T3348 |
T3346 |
punct |
),1A |
| R2043 |
T3349 |
T3325 |
punct |
.,paralleled |
| R2044 |
T3351 |
T3352 |
mark |
As,judged |
| R2045 |
T3352 |
T3353 |
advcl |
judged,localized |
| R2046 |
T3354 |
T3352 |
prep |
by,judged |
| R2047 |
T3355 |
T3354 |
pobj |
immunohistochemistry,by |
| R2048 |
T3356 |
T3353 |
punct |
", ",localized |
| R2049 |
T3357 |
T3358 |
compound |
Snail,protein |
| R2050 |
T3358 |
T3353 |
nsubjpass |
protein,localized |
| R2051 |
T3359 |
T3353 |
auxpass |
was,localized |
| R2052 |
T3360 |
T3353 |
prep |
to,localized |
| R2053 |
T3361 |
T3362 |
det |
the,nuclei |
| R2054 |
T3362 |
T3360 |
pobj |
nuclei,to |
| R2055 |
T3363 |
T3362 |
prep |
of,nuclei |
| R2056 |
T3364 |
T3365 |
det |
the,cells |
| R2057 |
T3365 |
T3363 |
pobj |
cells,of |
| R2058 |
T3366 |
T3367 |
compound |
hair,bud |
| R2059 |
T3367 |
T3365 |
compound |
bud,cells |
| R2060 |
T3368 |
T3369 |
punct |
(,1E |
| R2061 |
T3369 |
T3353 |
parataxis |
1E,localized |
| R2062 |
T3370 |
T3369 |
compound |
Figure,1E |
| R2063 |
T3371 |
T3369 |
punct |
),1E |
| R2064 |
T3372 |
T3353 |
punct |
.,localized |
| R2065 |
T3374 |
T3375 |
det |
This,feature |
| R2066 |
T3375 |
T3376 |
nsubj |
feature,was |
| R2067 |
T3377 |
T3376 |
acomp |
consistent,was |
| R2068 |
T3378 |
T3377 |
prep |
with,consistent |
| R2069 |
T3379 |
T3380 |
poss |
Snail,function |
| R2070 |
T3380 |
T3378 |
pobj |
function,with |
| R2071 |
T3381 |
T3379 |
case |
's,Snail |
| R2072 |
T3382 |
T3380 |
amod |
known,function |
| R2073 |
T3383 |
T3380 |
prep |
as,function |
| R2074 |
T3384 |
T3385 |
det |
a,repressor |
| R2075 |
T3385 |
T3383 |
pobj |
repressor,as |
| R2076 |
T3386 |
T3385 |
amod |
transcriptional,repressor |
| R2077 |
T3387 |
T3388 |
punct |
[,13 |
| R2078 |
T3388 |
T3376 |
parataxis |
13,was |
| R2079 |
T3389 |
T3388 |
nummod |
12,13 |
| R2080 |
T3390 |
T3388 |
punct |
",",13 |
| R2081 |
T3391 |
T3388 |
punct |
],13 |
| R2082 |
T3392 |
T3376 |
punct |
.,was |
| R2083 |
T3394 |
T3395 |
advmod |
Additionally,detected |
| R2084 |
T3396 |
T3395 |
punct |
", ",detected |
| R2085 |
T3397 |
T3398 |
amod |
anti-Snail,labeling |
| R2086 |
T3398 |
T3395 |
nsubjpass |
labeling,detected |
| R2087 |
T3399 |
T3395 |
auxpass |
was,detected |
| R2088 |
T3400 |
T3395 |
prep |
in,detected |
| R2089 |
T3401 |
T3402 |
advmod |
only,four |
| R2090 |
T3402 |
T3406 |
nummod |
four,waves |
| R2091 |
T3403 |
T3402 |
quantmod |
three,four |
| R2092 |
T3404 |
T3402 |
quantmod |
of,four |
| R2093 |
T3405 |
T3402 |
quantmod |
the,four |
| R2094 |
T3406 |
T3400 |
pobj |
waves,in |
| R2095 |
T3407 |
T3406 |
amod |
major,waves |
| R2096 |
T3408 |
T3406 |
prep |
of,waves |
| R2097 |
T3409 |
T3410 |
compound |
follicle,morphogenesis |
| R2098 |
T3410 |
T3408 |
pobj |
morphogenesis,of |
| R2099 |
T3411 |
T3395 |
punct |
.,detected |
| R2100 |
T3413 |
T3414 |
nsubjpass |
Snail,found |
| R2101 |
T3415 |
T3414 |
auxpass |
was,found |
| R2102 |
T3416 |
T3414 |
neg |
not,found |
| R2103 |
T3417 |
T3414 |
prep |
in,found |
| R2104 |
T3418 |
T3419 |
det |
the,buds |
| R2105 |
T3419 |
T3417 |
pobj |
buds,in |
| R2106 |
T3420 |
T3419 |
prep |
of,buds |
| R2107 |
T3421 |
T3422 |
compound |
guard,hairs |
| R2108 |
T3422 |
T3420 |
pobj |
hairs,of |
| R2109 |
T3423 |
T3424 |
dep |
that,are |
| R2110 |
T3424 |
T3422 |
advcl |
are,hairs |
| R2111 |
T3425 |
T3426 |
det |
the,earliest |
| R2112 |
T3426 |
T3424 |
attr |
earliest,are |
| R2113 |
T3427 |
T3426 |
prep |
of,earliest |
| R2114 |
T3428 |
T3429 |
det |
all,hairs |
| R2115 |
T3429 |
T3427 |
pobj |
hairs,of |
| R2116 |
T3430 |
T3431 |
aux |
to,form |
| R2117 |
T3431 |
T3429 |
advcl |
form,hairs |
| R2118 |
T3432 |
T3433 |
punct |
(,at |
| R2119 |
T3433 |
T3426 |
parataxis |
at,earliest |
| R2120 |
T3434 |
T3433 |
pobj |
E13.5,at |
| R2121 |
T3435 |
T3433 |
punct |
),at |
| R2122 |
T3436 |
T3424 |
punct |
", ",are |
| R2123 |
T3437 |
T3424 |
cc |
and,are |
| R2124 |
T3438 |
T3439 |
dep |
which,constitute |
| R2125 |
T3439 |
T3424 |
conj |
constitute,are |
| R2126 |
T3440 |
T3441 |
amod |
less,5 |
| R2127 |
T3441 |
T3443 |
nummod |
5,% |
| R2128 |
T3442 |
T3441 |
quantmod |
than,5 |
| R2129 |
T3443 |
T3439 |
dobj |
%,constitute |
| R2130 |
T3444 |
T3443 |
prep |
of,% |
| R2131 |
T3445 |
T3446 |
det |
the,coat |
| R2132 |
T3446 |
T3444 |
pobj |
coat,of |
| R2133 |
T3447 |
T3446 |
compound |
mouse,coat |
| R2134 |
T3448 |
T3449 |
punct |
(,data |
| R2135 |
T3449 |
T3414 |
meta |
data,found |
| R2136 |
T3450 |
T3449 |
amod |
unpublished,data |
| R2137 |
T3451 |
T3449 |
punct |
),data |
| R2138 |
T3452 |
T3414 |
punct |
.,found |
| R2139 |
T3454 |
T3455 |
mark |
As,judged |
| R2140 |
T3455 |
T3456 |
advcl |
judged,coincided |
| R2141 |
T3457 |
T3455 |
prep |
by,judged |
| R2142 |
T3458 |
T3457 |
pobj |
immunofluorescence,by |
| R2143 |
T3459 |
T3458 |
prep |
with,immunofluorescence |
| R2144 |
T3460 |
T3459 |
pobj |
antibodies,with |
| R2145 |
T3461 |
T3460 |
prep |
against,antibodies |
| R2146 |
T3462 |
T3463 |
det |
the,antigen |
| R2147 |
T3463 |
T3461 |
pobj |
antigen,against |
| R2148 |
T3464 |
T3463 |
amod |
proliferating,antigen |
| R2149 |
T3465 |
T3463 |
amod |
nuclear,antigen |
| R2150 |
T3466 |
T3463 |
appos |
Ki67,antigen |
| R2151 |
T3467 |
T3456 |
punct |
", ",coincided |
| R2152 |
T3468 |
T3469 |
det |
the,timing |
| R2153 |
T3469 |
T3456 |
nsubj |
timing,coincided |
| R2154 |
T3470 |
T3469 |
prep |
of,timing |
| R2155 |
T3471 |
T3472 |
compound |
Snail,expression |
| R2156 |
T3472 |
T3470 |
pobj |
expression,of |
| R2157 |
T3473 |
T3456 |
prep |
with,coincided |
| R2158 |
T3474 |
T3475 |
det |
the,stage |
| R2159 |
T3475 |
T3473 |
pobj |
stage,with |
| R2160 |
T3476 |
T3477 |
prep |
at,enhanced |
| R2161 |
T3477 |
T3475 |
relcl |
enhanced,stage |
| R2162 |
T3478 |
T3476 |
pobj |
which,at |
| R2163 |
T3479 |
T3480 |
det |
the,follicle |
| R2164 |
T3480 |
T3477 |
nsubj |
follicle,enhanced |
| R2165 |
T3481 |
T3480 |
amod |
developing,follicle |
| R2166 |
T3482 |
T3483 |
poss |
its,proliferation |
| R2167 |
T3483 |
T3477 |
dobj |
proliferation,enhanced |
| R2168 |
T3484 |
T3483 |
cc |
and,proliferation |
| R2169 |
T3485 |
T3486 |
amod |
down,growth |
| R2170 |
T3486 |
T3483 |
conj |
growth,proliferation |
| R2171 |
T3487 |
T3486 |
punct |
-,growth |
| R2172 |
T3488 |
T3489 |
punct |
(,1F |
| R2173 |
T3489 |
T3456 |
parataxis |
1F,coincided |
| R2174 |
T3490 |
T3489 |
compound |
Figure,1F |
| R2175 |
T3491 |
T3489 |
punct |
),1F |
| R2176 |
T3492 |
T3456 |
punct |
.,coincided |
| R2177 |
T3494 |
T3495 |
nsubj |
Immunohistochemistry,marked |
| R2178 |
T3496 |
T3494 |
prep |
with,Immunohistochemistry |
| R2179 |
T3497 |
T3496 |
pobj |
antibodies,with |
| R2180 |
T3498 |
T3497 |
prep |
against,antibodies |
| R2181 |
T3499 |
T3500 |
det |
the,form |
| R2182 |
T3500 |
T3498 |
pobj |
form,against |
| R2183 |
T3501 |
T3500 |
amod |
active,form |
| R2184 |
T3502 |
T3500 |
punct |
(,form |
| R2185 |
T3503 |
T3500 |
amod |
phosphorylated,form |
| R2186 |
T3504 |
T3500 |
punct |
),form |
| R2187 |
T3505 |
T3500 |
prep |
of,form |
| R2188 |
T3506 |
T3505 |
pobj |
MAPK,of |
| R2189 |
T3507 |
T3500 |
punct |
(,form |
| R2190 |
T3508 |
T3500 |
appos |
pMAPK,form |
| R2191 |
T3509 |
T3495 |
punct |
),marked |
| R2192 |
T3510 |
T3511 |
det |
a,subset |
| R2193 |
T3511 |
T3495 |
dobj |
subset,marked |
| R2194 |
T3512 |
T3511 |
prep |
of,subset |
| R2195 |
T3513 |
T3514 |
det |
the,cells |
| R2196 |
T3514 |
T3512 |
pobj |
cells,of |
| R2197 |
T3601 |
T3599 |
punct |
;,1H |
| R2198 |
T3515 |
T3514 |
amod |
proliferating,cells |
| R2199 |
T3602 |
T3599 |
advcl |
see,1H |
| R2200 |
T3516 |
T3514 |
punct |
(,cells |
| R2201 |
T3603 |
T3602 |
advmod |
also,see |
| R2202 |
T3604 |
T3602 |
punct |
[,see |
| R2203 |
T3517 |
T3518 |
npadvmod |
Ki67,positive |
| R2204 |
T3605 |
T3602 |
dobj |
4,see |
| R2205 |
T3606 |
T3599 |
punct |
],1H |
| R2206 |
T3607 |
T3599 |
punct |
),1H |
| R2207 |
T3518 |
T3514 |
amod |
positive,cells |
| R2208 |
T3608 |
T3583 |
punct |
.,exhibited |
| R2209 |
T3519 |
T3518 |
punct |
-,positive |
| R2210 |
T3520 |
T3514 |
punct |
),cells |
| R2211 |
T3521 |
T3495 |
punct |
", ",marked |
| R2212 |
T3522 |
T3495 |
cc |
and,marked |
| R2213 |
T3523 |
T3524 |
npadvmod |
pMAPK,positive |
| R2214 |
T3524 |
T3526 |
amod |
positive,cells |
| R2215 |
T3525 |
T3524 |
punct |
-,positive |
| R2216 |
T3526 |
T3527 |
nsubjpass |
cells,enriched |
| R2217 |
T3527 |
T3495 |
conj |
enriched,marked |
| R2218 |
T3528 |
T3527 |
auxpass |
were,enriched |
| R2219 |
T3529 |
T3527 |
prep |
in,enriched |
| R2220 |
T3530 |
T3531 |
det |
the,bud |
| R2221 |
T3531 |
T3529 |
pobj |
bud,in |
| R2222 |
T3532 |
T3531 |
compound |
hair,bud |
| R2223 |
T3533 |
T3534 |
punct |
(,1G |
| R2224 |
T3534 |
T3527 |
parataxis |
1G,enriched |
| R2225 |
T3535 |
T3534 |
compound |
Figure,1G |
| R2226 |
T3536 |
T3534 |
punct |
),1G |
| R2227 |
T3537 |
T3527 |
punct |
.,enriched |
| R2228 |
T3539 |
T3540 |
det |
The,timing |
| R2229 |
T3540 |
T3541 |
nsubj |
timing,appeared |
| R2230 |
T3542 |
T3540 |
prep |
of,timing |
| R2231 |
T3543 |
T3544 |
compound |
Snail,induction |
| R2232 |
T3544 |
T3542 |
pobj |
induction,of |
| R2233 |
T3545 |
T3544 |
cc |
and,induction |
| R2234 |
T3546 |
T3547 |
nmod |
Ki67,enrichment |
| R2235 |
T3547 |
T3544 |
conj |
enrichment,induction |
| R2236 |
T3548 |
T3546 |
cc |
and,Ki67 |
| R2237 |
T3549 |
T3546 |
conj |
pMAPK,Ki67 |
| R2238 |
T3550 |
T3540 |
prep |
in,timing |
| R2239 |
T3551 |
T3552 |
det |
the,bud |
| R2240 |
T3552 |
T3550 |
pobj |
bud,in |
| R2241 |
T3553 |
T3552 |
compound |
hair,bud |
| R2242 |
T3554 |
T3555 |
aux |
to,follow |
| R2243 |
T3555 |
T3541 |
xcomp |
follow,appeared |
| R2244 |
T3556 |
T3555 |
advmod |
closely,follow |
| R2245 |
T3557 |
T3558 |
det |
the,induction |
| R2246 |
T3558 |
T3555 |
dobj |
induction,follow |
| R2247 |
T3559 |
T3558 |
prep |
of,induction |
| R2248 |
T3560 |
T3561 |
nmod |
LEF,activity |
| R2249 |
T3561 |
T3559 |
pobj |
activity,of |
| R2250 |
T3562 |
T3560 |
punct |
-,LEF |
| R2251 |
T3563 |
T3560 |
nummod |
1,LEF |
| R2252 |
T3564 |
T3560 |
punct |
/,LEF |
| R2253 |
T3565 |
T3566 |
compound |
β,catenin |
| R2254 |
T3566 |
T3560 |
appos |
catenin,LEF |
| R2255 |
T3567 |
T3566 |
punct |
-,catenin |
| R2256 |
T3568 |
T3561 |
punct |
", ",activity |
| R2257 |
T3569 |
T3561 |
acl |
known,activity |
| R2258 |
T3570 |
T3571 |
aux |
to,initiate |
| R2259 |
T3571 |
T3569 |
xcomp |
initiate,known |
| R2260 |
T3572 |
T3571 |
prep |
in,initiate |
| R2261 |
T3573 |
T3574 |
det |
the,stage |
| R2262 |
T3574 |
T3572 |
pobj |
stage,in |
| R2263 |
T3575 |
T3576 |
compound |
hair,placode |
| R2264 |
T3576 |
T3574 |
compound |
placode,stage |
| R2265 |
T3577 |
T3578 |
punct |
[,20 |
| R2266 |
T3578 |
T3555 |
parataxis |
20,follow |
| R2267 |
T3579 |
T3578 |
punct |
],20 |
| R2268 |
T3580 |
T3541 |
punct |
.,appeared |
| R2269 |
T3582 |
T3583 |
advmod |
However,exhibited |
| R227 |
T1019 |
T1020 |
amod |
Mammalian,development |
| R2270 |
T3584 |
T3583 |
punct |
", ",exhibited |
| R2271 |
T3585 |
T3583 |
prep |
like,exhibited |
| R2272 |
T3586 |
T3585 |
pobj |
placodes,like |
| R2273 |
T3587 |
T3583 |
punct |
", ",exhibited |
| R2274 |
T3588 |
T3589 |
compound |
hair,buds |
| R2275 |
T3589 |
T3583 |
nsubj |
buds,exhibited |
| R2276 |
T3590 |
T3591 |
amod |
down,regulation |
| R2277 |
T3591 |
T3583 |
dobj |
regulation,exhibited |
| R2278 |
T3592 |
T3591 |
punct |
-,regulation |
| R2279 |
T3593 |
T3591 |
prep |
in,regulation |
| R228 |
T1020 |
T1021 |
nsubj |
development,involves |
| R2280 |
T3594 |
T3595 |
compound |
E,cadherin |
| R2281 |
T3595 |
T3597 |
compound |
cadherin,expression |
| R2282 |
T3596 |
T3595 |
punct |
-,cadherin |
| R2283 |
T3597 |
T3593 |
pobj |
expression,in |
| R2284 |
T3598 |
T3599 |
punct |
(,1H |
| R2285 |
T3599 |
T3583 |
parataxis |
1H,exhibited |
| R2286 |
T3600 |
T3599 |
compound |
Figure,1H |
| R2289 |
T3910 |
T3911 |
amod |
Sustained,Expression |
| R229 |
T1022 |
T1023 |
det |
the,morphogenesis |
| R2290 |
T3911 |
T3912 |
nsubj |
Expression,Results |
| R2291 |
T3913 |
T3911 |
prep |
of,Expression |
| R2292 |
T3914 |
T3913 |
pobj |
Snail,of |
| R2293 |
T3915 |
T3912 |
prep |
in,Results |
| R2294 |
T3916 |
T3917 |
amod |
Epidermal,Hyperproliferation |
| R2295 |
T3917 |
T3915 |
pobj |
Hyperproliferation,in |
| R2296 |
T3918 |
T3917 |
cc |
and,Hyperproliferation |
| R2297 |
T3919 |
T3920 |
compound |
Differentiation,Defects |
| R2298 |
T3920 |
T3917 |
conj |
Defects,Hyperproliferation |
| R2299 |
T3921 |
T3912 |
prep |
in,Results |
| R230 |
T1023 |
T1021 |
dobj |
morphogenesis,involves |
| R2300 |
T3922 |
T3923 |
compound |
Tg,Skin |
| R2301 |
T3923 |
T3921 |
pobj |
Skin,in |
| R2302 |
T3924 |
T3923 |
compound |
Mouse,Skin |
| R2303 |
T3926 |
T3927 |
det |
The,spike |
| R2304 |
T3927 |
T3929 |
nsubj |
spike,prompted |
| R2305 |
T3928 |
T3927 |
amod |
striking,spike |
| R2306 |
T3930 |
T3927 |
prep |
of,spike |
| R2307 |
T3931 |
T3932 |
compound |
Snail,expression |
| R2308 |
T3932 |
T3930 |
pobj |
expression,of |
| R2309 |
T3933 |
T3927 |
amod |
coincident,spike |
| R231 |
T1024 |
T1023 |
prep |
of,morphogenesis |
| R2310 |
T3934 |
T3933 |
prep |
with,coincident |
| R2311 |
T3935 |
T3936 |
compound |
hair,bud |
| R2312 |
T3936 |
T3937 |
compound |
bud,formation |
| R2313 |
T3937 |
T3934 |
pobj |
formation,with |
| R2314 |
T3938 |
T3937 |
cc |
and,formation |
| R2315 |
T3939 |
T3940 |
amod |
enhanced,proliferation |
| R2316 |
T3940 |
T3937 |
conj |
proliferation,formation |
| R2317 |
T3941 |
T3929 |
dobj |
us,prompted |
| R2318 |
T3942 |
T3943 |
aux |
to,examine |
| R2319 |
T3943 |
T3929 |
xcomp |
examine,prompted |
| R232 |
T1025 |
T1026 |
amod |
complex,structures |
| R2320 |
T3944 |
T3945 |
det |
the,consequences |
| R2321 |
T3945 |
T3943 |
dobj |
consequences,examine |
| R2322 |
T3946 |
T3945 |
prep |
of,consequences |
| R2323 |
T3947 |
T3948 |
advmod |
ectopically,expressing |
| R2324 |
T3948 |
T3946 |
pcomp |
expressing,of |
| R2325 |
T3949 |
T3948 |
dobj |
Snail,expressing |
| R2326 |
T3950 |
T3948 |
advmod |
elsewhere,expressing |
| R2327 |
T3951 |
T3950 |
prep |
in,elsewhere |
| R2328 |
T3952 |
T3953 |
compound |
mouse,epidermis |
| R2329 |
T3953 |
T3951 |
pobj |
epidermis,in |
| R233 |
T1026 |
T1024 |
pobj |
structures,of |
| R2330 |
T3954 |
T3953 |
compound |
skin,epidermis |
| R2331 |
T3955 |
T3929 |
punct |
.,prompted |
| R2332 |
T3957 |
T3958 |
aux |
To,distinguish |
| R2333 |
T3958 |
T3959 |
advcl |
distinguish,used |
| R2334 |
T3960 |
T3958 |
dobj |
Tg,distinguish |
| R2335 |
T3961 |
T3958 |
prep |
from,distinguish |
| R2336 |
T3962 |
T3963 |
amod |
endogenous,Snail |
| R2337 |
T3963 |
T3961 |
pobj |
Snail,from |
| R2338 |
T3964 |
T3959 |
punct |
", ",used |
| R2339 |
T3965 |
T3959 |
nsubj |
we,used |
| R234 |
T1027 |
T1028 |
advmod |
three,dimensional |
| R2340 |
T3966 |
T3967 |
det |
the,epitope |
| R2341 |
T3967 |
T3959 |
dobj |
epitope,used |
| R2342 |
T3968 |
T3967 |
compound |
HA,epitope |
| R2343 |
T3969 |
T3967 |
punct |
-,epitope |
| R2344 |
T3970 |
T3967 |
punct |
", ",epitope |
| R2345 |
T3971 |
T3967 |
acl |
shown,epitope |
| R2346 |
T3972 |
T3971 |
advmod |
previously,shown |
| R2347 |
T3973 |
T3974 |
neg |
not,alter |
| R2348 |
T3974 |
T3971 |
xcomp |
alter,shown |
| R2349 |
T3975 |
T3974 |
aux |
to,alter |
| R235 |
T1028 |
T1026 |
amod |
dimensional,structures |
| R2350 |
T3976 |
T3977 |
poss |
Snail,activity |
| R2351 |
T3977 |
T3974 |
dobj |
activity,alter |
| R2352 |
T3978 |
T3976 |
case |
's,Snail |
| R2353 |
T3979 |
T3977 |
amod |
transcriptional,activity |
| R2354 |
T3980 |
T3981 |
punct |
[,12 |
| R2355 |
T3981 |
T3959 |
parataxis |
12,used |
| R2356 |
T3982 |
T3981 |
punct |
],12 |
| R2357 |
T3983 |
T3959 |
punct |
.,used |
| R2358 |
T3985 |
T3986 |
prep |
Of,expressed |
| R2359 |
T3987 |
T3988 |
nummod |
20,animals |
| R236 |
T1029 |
T1028 |
punct |
-,dimensional |
| R2360 |
T3988 |
T3985 |
pobj |
animals,Of |
| R2361 |
T3989 |
T3990 |
nmod |
K14,Snail |
| R2362 |
T3990 |
T3988 |
nmod |
Snail,animals |
| R2363 |
T3991 |
T3990 |
punct |
-,Snail |
| R2364 |
T3992 |
T3988 |
punct |
[,animals |
| R2365 |
T3993 |
T3988 |
nmod |
HA,animals |
| R2366 |
T3994 |
T3988 |
punct |
],animals |
| R2367 |
T3995 |
T3988 |
compound |
Tg,animals |
| R2368 |
T3996 |
T3988 |
acl |
generated,animals |
| R2369 |
T3997 |
T3986 |
punct |
", ",expressed |
| R237 |
T1030 |
T1023 |
prep |
from,morphogenesis |
| R2370 |
T3998 |
T3986 |
nsubj |
three,expressed |
| R2371 |
T3999 |
T4000 |
det |
the,transgene |
| R2372 |
T4000 |
T3986 |
dobj |
transgene,expressed |
| R2373 |
T4001 |
T3986 |
cc |
and,expressed |
| R2374 |
T4002 |
T4003 |
nsubj |
all,exhibited |
| R2375 |
T4003 |
T3986 |
conj |
exhibited,expressed |
| R2376 |
T4004 |
T4005 |
amod |
analogous,phenotypes |
| R2377 |
T4005 |
T4003 |
dobj |
phenotypes,exhibited |
| R2378 |
T4006 |
T3986 |
punct |
.,expressed |
| R2379 |
T4008 |
T4009 |
nsubj |
Mice,died |
| R238 |
T1031 |
T1032 |
advmod |
seemingly,uniform |
| R2380 |
T4010 |
T4011 |
dep |
that,integrated |
| R2381 |
T4011 |
T4008 |
relcl |
integrated,Mice |
| R2382 |
T4012 |
T4013 |
det |
the,transgene |
| R2383 |
T4013 |
T4011 |
dobj |
transgene,integrated |
| R2384 |
T4014 |
T4011 |
prep |
at,integrated |
| R2385 |
T4015 |
T4016 |
det |
the,stage |
| R2386 |
T4016 |
T4014 |
pobj |
stage,at |
| R2387 |
T4017 |
T4018 |
amod |
single,cell |
| R2388 |
T4018 |
T4016 |
compound |
cell,stage |
| R2389 |
T4019 |
T4018 |
punct |
-,cell |
| R239 |
T1032 |
T1033 |
amod |
uniform,sheets |
| R2390 |
T4020 |
T4009 |
prep |
at,died |
| R2391 |
T4021 |
T4020 |
cc |
or,at |
| R2392 |
T4022 |
T4023 |
advmod |
shortly,after |
| R2393 |
T4023 |
T4020 |
conj |
after,at |
| R2394 |
T4024 |
T4023 |
pobj |
birth,after |
| R2395 |
T4025 |
T4009 |
punct |
.,died |
| R2396 |
T4027 |
T4028 |
det |
The,mice |
| R2397 |
T4028 |
T4035 |
nsubj |
mice,harbored |
| R2398 |
T4029 |
T4028 |
nummod |
three,mice |
| R2399 |
T4030 |
T4028 |
amod |
surviving,mice |
| R240 |
T1033 |
T1030 |
pobj |
sheets,from |
| R2400 |
T4031 |
T4032 |
amod |
full,Tg |
| R2401 |
T4032 |
T4028 |
compound |
Tg,mice |
| R2402 |
T4033 |
T4032 |
punct |
-,Tg |
| R2403 |
T4034 |
T4028 |
compound |
founder,mice |
| R2404 |
T4036 |
T4037 |
compound |
transgene,integrations |
| R2405 |
T4037 |
T4035 |
dobj |
integrations,harbored |
| R2406 |
T4038 |
T4039 |
dep |
that,gave |
| R2407 |
T4039 |
T4037 |
relcl |
gave,integrations |
| R2408 |
T4040 |
T4041 |
amod |
stable,transmission |
| R2409 |
T4041 |
T4039 |
dobj |
transmission,gave |
| R241 |
T1034 |
T1033 |
cc |
or,sheets |
| R2410 |
T4042 |
T4041 |
prep |
of,transmission |
| R2411 |
T4043 |
T4044 |
amod |
mosaic,gene |
| R2412 |
T4044 |
T4046 |
compound |
gene,expression |
| R2413 |
T4045 |
T4044 |
compound |
Snail,gene |
| R2414 |
T4046 |
T4042 |
pobj |
expression,of |
| R2415 |
T4047 |
T4039 |
prep |
through,gave |
| R2416 |
T4048 |
T4049 |
det |
the,germline |
| R2417 |
T4049 |
T4047 |
pobj |
germline,through |
| R2418 |
T4050 |
T4035 |
punct |
.,harbored |
| R2419 |
T4052 |
T4053 |
advmod |
Progressively,poor |
| R242 |
T1035 |
T1033 |
conj |
masses,sheets |
| R2420 |
T4053 |
T4054 |
amod |
poor,health |
| R2421 |
T4054 |
T4055 |
nsubj |
health,necessitated |
| R2422 |
T4056 |
T4057 |
nsubj |
our,sacrificing |
| R2423 |
T4057 |
T4055 |
ccomp |
sacrificing,necessitated |
| R2424 |
T4058 |
T4059 |
amod |
most,offspring |
| R2425 |
T4059 |
T4057 |
dobj |
offspring,sacrificing |
| R2426 |
T4060 |
T4059 |
prep |
from,offspring |
| R2427 |
T4061 |
T4062 |
det |
these,lines |
| R2428 |
T4062 |
T4060 |
pobj |
lines,from |
| R2429 |
T4063 |
T4057 |
prep |
within,sacrificing |
| R243 |
T1036 |
T1033 |
prep |
of,sheets |
| R2430 |
T4064 |
T4065 |
det |
a,year |
| R2431 |
T4065 |
T4063 |
pobj |
year,within |
| R2432 |
T4066 |
T4065 |
prep |
of,year |
| R2433 |
T4067 |
T4066 |
pobj |
birth,of |
| R2434 |
T4068 |
T4055 |
punct |
.,necessitated |
| R2435 |
T4070 |
T4071 |
mark |
As,grew |
| R2436 |
T4071 |
T4075 |
advcl |
grew,became |
| R2437 |
T4072 |
T4073 |
compound |
Snail,animals |
| R2438 |
T4073 |
T4071 |
nsubj |
animals,grew |
| R2439 |
T4074 |
T4073 |
compound |
Tg,animals |
| R244 |
T1037 |
T1036 |
pobj |
cells,of |
| R2440 |
T4076 |
T4075 |
punct |
", ",became |
| R2441 |
T4077 |
T4075 |
nsubj |
they,became |
| R2442 |
T4078 |
T4075 |
acomp |
distinguished,became |
| R2443 |
T4079 |
T4078 |
prep |
by,distinguished |
| R2444 |
T4080 |
T4081 |
poss |
their,size |
| R2445 |
T4081 |
T4079 |
pobj |
size,by |
| R2446 |
T4082 |
T4081 |
amod |
small,size |
| R2447 |
T4083 |
T4081 |
punct |
", ",size |
| R2448 |
T4084 |
T4085 |
amod |
short,tails |
| R2449 |
T4085 |
T4081 |
conj |
tails,size |
| R245 |
T1038 |
T1021 |
punct |
.,involves |
| R2450 |
T4086 |
T4085 |
punct |
", ",tails |
| R2451 |
T4087 |
T4085 |
cc |
and,tails |
| R2452 |
T4088 |
T4089 |
amod |
flaky,skin |
| R2453 |
T4089 |
T4085 |
conj |
skin,tails |
| R2454 |
T4090 |
T4091 |
punct |
(,2A |
| R2455 |
T4091 |
T4075 |
parataxis |
2A,became |
| R2456 |
T4092 |
T4091 |
compound |
Figure,2A |
| R2457 |
T4093 |
T4091 |
punct |
),2A |
| R2458 |
T4094 |
T4075 |
punct |
.,became |
| R2459 |
T4096 |
T4097 |
amod |
Histological,analyses |
| R246 |
T1040 |
T1041 |
det |
A,structure |
| R2460 |
T4097 |
T4098 |
nsubj |
analyses,revealed |
| R2461 |
T4099 |
T4097 |
prep |
of,analyses |
| R2462 |
T4100 |
T4101 |
nummod |
3,d |
| R2463 |
T4101 |
T4103 |
npadvmod |
d,old |
| R2464 |
T4102 |
T4101 |
punct |
-,d |
| R2465 |
T4103 |
T4104 |
amod |
old,mice |
| R2466 |
T4104 |
T4099 |
pobj |
mice,of |
| R2467 |
T4105 |
T4106 |
punct |
(,P3 |
| R2468 |
T4106 |
T4103 |
parataxis |
P3,old |
| R2469 |
T4107 |
T4106 |
punct |
),P3 |
| R247 |
T1041 |
T1046 |
nsubj |
structure,initiates |
| R2470 |
T4108 |
T4109 |
compound |
mosaic,patches |
| R2471 |
T4109 |
T4098 |
dobj |
patches,revealed |
| R2472 |
T4110 |
T4109 |
acl |
marked,patches |
| R2473 |
T4111 |
T4110 |
agent |
by,marked |
| R2474 |
T4112 |
T4113 |
amod |
epidermal,thickening |
| R2475 |
T4113 |
T4111 |
pobj |
thickening,by |
| R2476 |
T4114 |
T4115 |
punct |
(,2B |
| R2477 |
T4115 |
T4098 |
parataxis |
2B,revealed |
| R2478 |
T4116 |
T4115 |
compound |
Figure,2B |
| R2479 |
T4117 |
T4115 |
punct |
),2B |
| R248 |
T1042 |
T1041 |
amod |
simple,structure |
| R2480 |
T4118 |
T4098 |
punct |
.,revealed |
| R2481 |
T4120 |
T4121 |
det |
The,morphology |
| R2482 |
T4121 |
T4123 |
nsubjpass |
morphology,reflected |
| R2483 |
T4122 |
T4121 |
compound |
mosaic,morphology |
| R2484 |
T4124 |
T4123 |
auxpass |
was,reflected |
| R2485 |
T4125 |
T4123 |
prep |
at,reflected |
| R2486 |
T4126 |
T4127 |
det |
the,level |
| R2487 |
T4127 |
T4125 |
pobj |
level,at |
| R2488 |
T4128 |
T4127 |
prep |
of,level |
| R2489 |
T4129 |
T4130 |
compound |
Tg,protein |
| R249 |
T1043 |
T1044 |
npadvmod |
bud,like |
| R2490 |
T4130 |
T4128 |
pobj |
protein,of |
| R2491 |
T4131 |
T4130 |
compound |
Snail,protein |
| R2492 |
T4132 |
T4123 |
punct |
", ",reflected |
| R2493 |
T4133 |
T4134 |
mark |
with,expressing |
| R2494 |
T4134 |
T4123 |
advcl |
expressing,reflected |
| R2495 |
T4135 |
T4136 |
advmod |
only,regions |
| R2496 |
T4136 |
T4134 |
nsubj |
regions,expressing |
| R2497 |
T4137 |
T4136 |
det |
the,regions |
| R2498 |
T4138 |
T4136 |
amod |
hyperthickened,regions |
| R2499 |
T4139 |
T4140 |
amod |
nuclear,Snail |
| R250 |
T1044 |
T1041 |
amod |
like,structure |
| R2500 |
T4140 |
T4134 |
dobj |
Snail,expressing |
| R2501 |
T4141 |
T4142 |
npadvmod |
HA,tagged |
| R2502 |
T4142 |
T4140 |
amod |
tagged,Snail |
| R2503 |
T4143 |
T4142 |
punct |
-,tagged |
| R2504 |
T4144 |
T4145 |
punct |
(,2C |
| R2505 |
T4145 |
T4123 |
parataxis |
2C,reflected |
| R2506 |
T4146 |
T4145 |
compound |
Figure,2C |
| R2507 |
T4147 |
T4145 |
punct |
),2C |
| R2508 |
T4148 |
T4123 |
punct |
.,reflected |
| R2509 |
T4150 |
T4151 |
det |
These,areas |
| R251 |
T1045 |
T1044 |
punct |
-,like |
| R2510 |
T4151 |
T4153 |
nsubjpass |
areas,marked |
| R2511 |
T4152 |
T4151 |
amod |
hyperthickened,areas |
| R2512 |
T4154 |
T4153 |
auxpass |
were,marked |
| R2513 |
T4155 |
T4153 |
agent |
by,marked |
| R2514 |
T4156 |
T4157 |
amod |
excessive,proliferation |
| R2515 |
T4157 |
T4155 |
pobj |
proliferation,by |
| R2516 |
T4158 |
T4153 |
punct |
", ",marked |
| R2517 |
T4159 |
T4160 |
mark |
as,revealed |
| R2518 |
T4160 |
T4153 |
advcl |
revealed,marked |
| R2519 |
T4161 |
T4160 |
agent |
by,revealed |
| R252 |
T1047 |
T1048 |
det |
the,formation |
| R2520 |
T4162 |
T4161 |
pobj |
antibodies,by |
| R2521 |
T4163 |
T4162 |
prep |
against,antibodies |
| R2522 |
T4164 |
T4165 |
det |
the,antigen |
| R2523 |
T4165 |
T4163 |
pobj |
antigen,against |
| R2524 |
T4166 |
T4165 |
amod |
proliferating,antigen |
| R2525 |
T4167 |
T4165 |
amod |
nuclear,antigen |
| R2526 |
T4168 |
T4165 |
appos |
Ki67,antigen |
| R2527 |
T4169 |
T4170 |
punct |
(,2D |
| R2528 |
T4170 |
T4153 |
parataxis |
2D,marked |
| R2529 |
T4171 |
T4170 |
compound |
Figure,2D |
| R253 |
T1048 |
T1046 |
dobj |
formation,initiates |
| R2530 |
T4172 |
T4170 |
cc |
and,2D |
| R2531 |
T4173 |
T4170 |
conj |
2E,2D |
| R2532 |
T4174 |
T4170 |
punct |
),2D |
| R2533 |
T4175 |
T4153 |
punct |
.,marked |
| R2534 |
T4177 |
T4178 |
amod |
Activated,cells |
| R2535 |
T4178 |
T4183 |
nsubj |
cells,were |
| R2536 |
T4179 |
T4178 |
punct |
", ",cells |
| R2537 |
T4180 |
T4181 |
npadvmod |
pMAPK,positive |
| R2538 |
T4181 |
T4178 |
amod |
positive,cells |
| R2539 |
T4182 |
T4181 |
punct |
-,positive |
| R254 |
T1049 |
T1048 |
prep |
of,formation |
| R2540 |
T4184 |
T4183 |
advmod |
also,were |
| R2541 |
T4185 |
T4183 |
acomp |
prevalent,were |
| R2542 |
T4186 |
T4183 |
prep |
in,were |
| R2543 |
T4187 |
T4188 |
det |
these,areas |
| R2544 |
T4188 |
T4186 |
pobj |
areas,in |
| R2545 |
T4189 |
T4190 |
punct |
(,2F |
| R2546 |
T4190 |
T4183 |
parataxis |
2F,were |
| R2547 |
T4191 |
T4190 |
compound |
Figure,2F |
| R2548 |
T4192 |
T4190 |
cc |
and,2F |
| R2549 |
T4193 |
T4190 |
conj |
2G,2F |
| R255 |
T1050 |
T1051 |
amod |
many,organs |
| R2550 |
T4194 |
T4190 |
punct |
),2F |
| R2551 |
T4195 |
T4183 |
punct |
", ",were |
| R2552 |
T4196 |
T4197 |
mark |
as,were |
| R2553 |
T4197 |
T4183 |
advcl |
were,were |
| R2554 |
T4198 |
T4197 |
nsubj |
cells,were |
| R2555 |
T4199 |
T4198 |
acl |
expressing,cells |
| R2556 |
T4200 |
T4199 |
dobj |
keratin,expressing |
| R2557 |
T4201 |
T4200 |
nummod |
6,keratin |
| R2558 |
T4202 |
T4200 |
punct |
", ",keratin |
| R2559 |
T4203 |
T4204 |
det |
a,keratin |
| R256 |
T1051 |
T1049 |
pobj |
organs,of |
| R2560 |
T4204 |
T4200 |
appos |
keratin,keratin |
| R2561 |
T4205 |
T4204 |
acl |
induced,keratin |
| R2562 |
T4206 |
T4205 |
prep |
in,induced |
| R2563 |
T4207 |
T4208 |
det |
the,layers |
| R2564 |
T4208 |
T4206 |
pobj |
layers,in |
| R2565 |
T4209 |
T4208 |
amod |
suprabasal,layers |
| R2566 |
T4210 |
T4208 |
prep |
of,layers |
| R2567 |
T4211 |
T4212 |
amod |
hyperproliferative,skin |
| R2568 |
T4212 |
T4210 |
pobj |
skin,of |
| R2569 |
T4213 |
T4214 |
punct |
(,2H |
| R257 |
T1052 |
T1051 |
punct |
", ",organs |
| R2570 |
T4214 |
T4183 |
parataxis |
2H,were |
| R2571 |
T4215 |
T4214 |
compound |
Figure,2H |
| R2572 |
T4216 |
T4214 |
cc |
and,2H |
| R2573 |
T4217 |
T4214 |
conj |
2I,2H |
| R2574 |
T4218 |
T4214 |
punct |
),2H |
| R2575 |
T4219 |
T4183 |
punct |
.,were |
| R2576 |
T4221 |
T4222 |
nsubj |
Expression,block |
| R2577 |
T4223 |
T4221 |
prep |
of,Expression |
| R2578 |
T4224 |
T4225 |
det |
the,transgene |
| R2579 |
T4225 |
T4223 |
pobj |
transgene,of |
| R258 |
T1053 |
T1051 |
prep |
including,organs |
| R2580 |
T4226 |
T4225 |
compound |
Snail,transgene |
| R2581 |
T4227 |
T4222 |
aux |
did,block |
| R2582 |
T4228 |
T4222 |
neg |
not,block |
| R2583 |
T4229 |
T4230 |
amod |
terminal,differentiation |
| R2584 |
T4230 |
T4222 |
dobj |
differentiation,block |
| R2585 |
T4231 |
T4222 |
prep |
in,block |
| R2586 |
T4232 |
T4233 |
det |
the,epidermis |
| R2587 |
T4233 |
T4231 |
pobj |
epidermis,in |
| R2588 |
T4234 |
T4233 |
amod |
hyperproliferative,epidermis |
| R2589 |
T4235 |
T4222 |
punct |
", ",block |
| R259 |
T1054 |
T1053 |
pobj |
lungs,including |
| R2590 |
T4236 |
T4222 |
cc |
but,block |
| R2591 |
T4237 |
T4238 |
nsubj |
it,distorted |
| R2592 |
T4238 |
T4222 |
conj |
distorted,block |
| R2593 |
T4239 |
T4238 |
dobj |
it,distorted |
| R2594 |
T4240 |
T4238 |
advmod |
markedly,distorted |
| R2595 |
T4241 |
T4242 |
punct |
(,3A |
| R2596 |
T4242 |
T4238 |
parataxis |
3A,distorted |
| R2597 |
T4243 |
T4242 |
compound |
Figure,3A |
| R2598 |
T4244 |
T4245 |
punct |
–,3H |
| R2599 |
T4245 |
T4242 |
prep |
3H,3A |
| R260 |
T1055 |
T1054 |
punct |
", ",lungs |
| R2600 |
T4246 |
T4242 |
punct |
),3A |
| R2601 |
T4247 |
T4238 |
punct |
.,distorted |
| R2602 |
T4249 |
T4250 |
advcl |
Typical,led |
| R2603 |
T4251 |
T4249 |
prep |
of,Typical |
| R2604 |
T4252 |
T4253 |
amod |
most,conditions |
| R2605 |
T4253 |
T4251 |
pobj |
conditions,of |
| R2606 |
T4254 |
T4253 |
compound |
hyperproliferating,conditions |
| R2607 |
T4255 |
T4250 |
punct |
", ",led |
| R2608 |
T4256 |
T4257 |
compound |
Snail,expression |
| R2609 |
T4257 |
T4250 |
nsubj |
expression,led |
| R261 |
T1056 |
T1057 |
amod |
spinal,cord |
| R2610 |
T4258 |
T4250 |
prep |
to,led |
| R2611 |
T4259 |
T4260 |
det |
a,expansion |
| R2612 |
T4260 |
T4258 |
pobj |
expansion,to |
| R2613 |
T4261 |
T4260 |
amod |
large,expansion |
| R2614 |
T4262 |
T4250 |
prep |
in,led |
| R2615 |
T4263 |
T4262 |
pobj |
layers,in |
| R2616 |
T4264 |
T4263 |
prep |
with,layers |
| R2617 |
T4265 |
T4266 |
amod |
spinous,morphology |
| R2618 |
T4266 |
T4264 |
pobj |
morphology,with |
| R2619 |
T4267 |
T4265 |
cc |
and,spinous |
| R262 |
T1057 |
T1054 |
conj |
cord,lungs |
| R2620 |
T4268 |
T4265 |
conj |
granular,spinous |
| R2621 |
T4269 |
T4250 |
punct |
.,led |
| R2622 |
T4271 |
T4272 |
advmod |
Additionally,was |
| R2623 |
T4273 |
T4272 |
punct |
", ",was |
| R2624 |
T4274 |
T4272 |
advmod |
however,was |
| R2625 |
T4275 |
T4272 |
punct |
", ",was |
| R2626 |
T4276 |
T4277 |
det |
a,expansion |
| R2627 |
T4277 |
T4272 |
attr |
expansion,was |
| R2628 |
T4278 |
T4277 |
amod |
marked,expansion |
| R2629 |
T4279 |
T4278 |
cc |
and,marked |
| R263 |
T1058 |
T1057 |
punct |
", ",cord |
| R2630 |
T4280 |
T4278 |
conj |
variable,marked |
| R2631 |
T4281 |
T4277 |
prep |
of,expansion |
| R2632 |
T4282 |
T4281 |
pobj |
keratin,of |
| R2633 |
T4283 |
T4282 |
nummod |
5,keratin |
| R2634 |
T4284 |
T4282 |
punct |
(,keratin |
| R2635 |
T4285 |
T4282 |
appos |
K5,keratin |
| R2636 |
T4286 |
T4282 |
punct |
),keratin |
| R2637 |
T4287 |
T4282 |
punct |
", ",keratin |
| R2638 |
T4288 |
T4289 |
advmod |
normally,restricted |
| R2639 |
T4289 |
T4282 |
acl |
restricted,keratin |
| R264 |
T1059 |
T1060 |
amod |
mammary,glands |
| R2640 |
T4290 |
T4289 |
prep |
to,restricted |
| R2641 |
T4291 |
T4292 |
det |
the,layer |
| R2642 |
T4292 |
T4290 |
pobj |
layer,to |
| R2643 |
T4293 |
T4292 |
amod |
innermost,layer |
| R2644 |
T4294 |
T4292 |
amod |
basal,layer |
| R2645 |
T4295 |
T4296 |
punct |
(,see |
| R2646 |
T4296 |
T4272 |
parataxis |
see,was |
| R2647 |
T4297 |
T4296 |
dobj |
Figure,see |
| R2648 |
T4298 |
T4297 |
nummod |
3,Figure |
| R2649 |
T4299 |
T4296 |
punct |
),see |
| R265 |
T1060 |
T1057 |
conj |
glands,cord |
| R2650 |
T4300 |
T4272 |
punct |
.,was |
| R2651 |
T4302 |
T4303 |
mark |
Although,precluded |
| R2652 |
T4303 |
T4318 |
advcl |
precluded,emerged |
| R2653 |
T4304 |
T4305 |
det |
the,failure |
| R2654 |
T4305 |
T4303 |
nsubj |
failure,precluded |
| R2655 |
T4306 |
T4305 |
prep |
of,failure |
| R2656 |
T4307 |
T4308 |
nmod |
Snail,mice |
| R2657 |
T4308 |
T4306 |
pobj |
mice,of |
| R2658 |
T4309 |
T4307 |
punct |
-,Snail |
| R2659 |
T4310 |
T4307 |
amod |
null,Snail |
| R266 |
T1061 |
T1060 |
punct |
", ",glands |
| R2660 |
T4311 |
T4312 |
aux |
to,develop |
| R2661 |
T4312 |
T4305 |
acl |
develop,failure |
| R2662 |
T4313 |
T4314 |
amod |
past,gastrulation |
| R2663 |
T4314 |
T4312 |
dobj |
gastrulation,develop |
| R2664 |
T4315 |
T4316 |
punct |
[,21 |
| R2665 |
T4316 |
T4305 |
parataxis |
21,failure |
| R2666 |
T4317 |
T4316 |
punct |
],21 |
| R2667 |
T4319 |
T4320 |
poss |
our,ability |
| R2668 |
T4320 |
T4303 |
dobj |
ability,precluded |
| R2669 |
T4321 |
T4322 |
aux |
to,study |
| R267 |
T1062 |
T1060 |
cc |
and,glands |
| R2670 |
T4322 |
T4320 |
acl |
study,ability |
| R2671 |
T4323 |
T4324 |
det |
the,loss |
| R2672 |
T4324 |
T4322 |
dobj |
loss,study |
| R2673 |
T4325 |
T4324 |
prep |
of,loss |
| R2674 |
T4326 |
T4327 |
compound |
Snail,function |
| R2675 |
T4327 |
T4325 |
pobj |
function,of |
| R2676 |
T4328 |
T4324 |
prep |
in,loss |
| R2677 |
T4329 |
T4330 |
compound |
skin,development |
| R2678 |
T4330 |
T4328 |
pobj |
development,in |
| R2679 |
T4331 |
T4318 |
punct |
", ",emerged |
| R268 |
T1063 |
T1064 |
compound |
hair,follicles |
| R2680 |
T4332 |
T4333 |
det |
a,correlation |
| R2681 |
T4333 |
T4318 |
nsubj |
correlation,emerged |
| R2682 |
T4334 |
T4333 |
amod |
good,correlation |
| R2683 |
T4335 |
T4318 |
prep |
between,emerged |
| R2684 |
T4336 |
T4337 |
det |
the,expression |
| R2685 |
T4337 |
T4335 |
pobj |
expression,between |
| R2686 |
T4338 |
T4337 |
prep |
of,expression |
| R2687 |
T4339 |
T4340 |
compound |
Snail,protein |
| R2688 |
T4340 |
T4338 |
pobj |
protein,of |
| R2689 |
T4341 |
T4337 |
cc |
and,expression |
| R269 |
T1064 |
T1060 |
conj |
follicles,glands |
| R2690 |
T4342 |
T4343 |
det |
the,extension |
| R2691 |
T4343 |
T4337 |
conj |
extension,expression |
| R2692 |
T4344 |
T4343 |
prep |
of,extension |
| R2693 |
T4345 |
T4344 |
pobj |
K5,of |
| R2694 |
T4346 |
T4345 |
punct |
", ",K5 |
| R2695 |
T4347 |
T4345 |
conj |
Ki67,K5 |
| R2696 |
T4348 |
T4347 |
punct |
", ",Ki67 |
| R2697 |
T4349 |
T4347 |
cc |
and,Ki67 |
| R2698 |
T4350 |
T4347 |
conj |
pMAPK,Ki67 |
| R2699 |
T4351 |
T4343 |
advmod |
suprabasally,extension |
| R270 |
T1065 |
T1066 |
punct |
[,1 |
| R2700 |
T4352 |
T4353 |
punct |
(,compare |
| R2701 |
T4353 |
T4318 |
parataxis |
compare,emerged |
| R2702 |
T4354 |
T4353 |
dobj |
data,compare |
| R2703 |
T4355 |
T4353 |
prep |
in,compare |
| R2704 |
T4356 |
T4357 |
nmod |
Figures,2 |
| R2705 |
T4357 |
T4355 |
pobj |
2,in |
| R2706 |
T4358 |
T4357 |
cc |
and,2 |
| R2707 |
T4359 |
T4357 |
conj |
3,2 |
| R2708 |
T4360 |
T4353 |
punct |
),compare |
| R2709 |
T4361 |
T4318 |
punct |
.,emerged |
| R271 |
T1066 |
T1046 |
parataxis |
1,initiates |
| R2710 |
T4363 |
T4364 |
det |
The,changes |
| R2711 |
T4364 |
T4365 |
nsubjpass |
changes,accompanied |
| R2712 |
T4366 |
T4364 |
prep |
in,changes |
| R2713 |
T4367 |
T4366 |
pobj |
hyperproliferation,in |
| R2714 |
T4368 |
T4367 |
cc |
and,hyperproliferation |
| R2715 |
T4369 |
T4367 |
conj |
differentiation,hyperproliferation |
| R2716 |
T4370 |
T4365 |
auxpass |
were,accompanied |
| R2717 |
T4371 |
T4365 |
neg |
not,accompanied |
| R2718 |
T4372 |
T4365 |
advmod |
initially,accompanied |
| R2719 |
T4373 |
T4365 |
agent |
by,accompanied |
| R272 |
T1067 |
T1066 |
punct |
],1 |
| R2720 |
T4374 |
T4375 |
amod |
gross,signs |
| R2721 |
T4375 |
T4373 |
pobj |
signs,by |
| R2722 |
T4376 |
T4375 |
prep |
of,signs |
| R2723 |
T4377 |
T4378 |
amod |
epithelial,invaginations |
| R2724 |
T4378 |
T4376 |
pobj |
invaginations,of |
| R2725 |
T4379 |
T4365 |
punct |
.,accompanied |
| R2726 |
T4381 |
T4382 |
prep |
With,developed |
| R2727 |
T4383 |
T4381 |
pobj |
age,With |
| R2728 |
T4384 |
T4382 |
punct |
", ",developed |
| R2729 |
T4385 |
T4382 |
advmod |
however,developed |
| R273 |
T1068 |
T1046 |
punct |
.,initiates |
| R2730 |
T4386 |
T4382 |
punct |
", ",developed |
| R2731 |
T4387 |
T4388 |
amod |
epidermal,folds |
| R2732 |
T4388 |
T4382 |
nsubj |
folds,developed |
| R2733 |
T4389 |
T4388 |
cc |
and,folds |
| R2734 |
T4390 |
T4388 |
conj |
undulations,folds |
| R2735 |
T4391 |
T4382 |
prep |
in,developed |
| R2736 |
T4392 |
T4391 |
pobj |
areas,in |
| R2737 |
T4393 |
T4394 |
advmod |
where,expressed |
| R2738 |
T4394 |
T4392 |
relcl |
expressed,areas |
| R2739 |
T4395 |
T4394 |
nsubjpass |
Snail,expressed |
| R274 |
T1070 |
T1071 |
det |
The,cells |
| R2740 |
T4396 |
T4394 |
auxpass |
was,expressed |
| R2741 |
T4397 |
T4382 |
punct |
", ",developed |
| R2742 |
T4398 |
T4382 |
cc |
and,developed |
| R2743 |
T4399 |
T4400 |
amod |
proliferative,markers |
| R2744 |
T4400 |
T4401 |
nsubj |
markers,persisted |
| R2745 |
T4401 |
T4382 |
conj |
persisted,developed |
| R2746 |
T4402 |
T4401 |
prep |
in,persisted |
| R2747 |
T4403 |
T4404 |
det |
these,regions |
| R2748 |
T4404 |
T4402 |
pobj |
regions,in |
| R2749 |
T4405 |
T4406 |
punct |
(,staining |
| R275 |
T1071 |
T1076 |
nsubjpass |
cells,attached |
| R2750 |
T4406 |
T4401 |
parataxis |
staining,persisted |
| R2751 |
T4407 |
T4408 |
compound |
Figure,3I |
| R2752 |
T4408 |
T4406 |
dep |
3I,staining |
| R2753 |
T4409 |
T4408 |
cc |
and,3I |
| R2754 |
T4410 |
T4408 |
conj |
3J,3I |
| R2755 |
T4411 |
T4406 |
punct |
;,staining |
| R2756 |
T4412 |
T4413 |
amod |
anti-cyclin,D |
| R2757 |
T4413 |
T4406 |
compound |
D,staining |
| R2758 |
T4414 |
T4406 |
punct |
),staining |
| R2759 |
T4415 |
T4382 |
punct |
.,developed |
| R276 |
T1072 |
T1071 |
amod |
multipotent,cells |
| R2760 |
T4417 |
T4418 |
det |
The,undulations |
| R2761 |
T4418 |
T4419 |
nsubjpass |
undulations,accompanied |
| R2762 |
T4420 |
T4419 |
auxpass |
were,accompanied |
| R2763 |
T4421 |
T4419 |
agent |
by,accompanied |
| R2764 |
T4422 |
T4423 |
amod |
partial,dissolution |
| R2765 |
T4423 |
T4421 |
pobj |
dissolution,by |
| R2766 |
T4424 |
T4423 |
prep |
of,dissolution |
| R2767 |
T4425 |
T4426 |
det |
the,membrane |
| R2768 |
T4426 |
T4424 |
pobj |
membrane,of |
| R2769 |
T4427 |
T4426 |
amod |
underlying,membrane |
| R277 |
T1073 |
T1071 |
punct |
", ",cells |
| R2770 |
T4428 |
T4426 |
compound |
basement,membrane |
| R2771 |
T4429 |
T4430 |
punct |
(,3K |
| R2772 |
T4430 |
T4419 |
parataxis |
3K,accompanied |
| R2773 |
T4431 |
T4430 |
compound |
Figure,3K |
| R2774 |
T4432 |
T4430 |
cc |
and,3K |
| R2775 |
T4433 |
T4430 |
conj |
3L,3K |
| R2776 |
T4434 |
T4430 |
punct |
),3K |
| R2777 |
T4435 |
T4419 |
punct |
.,accompanied |
| R2778 |
T4437 |
T4438 |
amod |
Aberrant,staining |
| R2779 |
T4438 |
T4439 |
nsubjpass |
staining,observed |
| R278 |
T1074 |
T1071 |
amod |
adhering,cells |
| R2780 |
T4440 |
T4439 |
auxpass |
was,observed |
| R2781 |
T4441 |
T4439 |
advmod |
also,observed |
| R2782 |
T4442 |
T4439 |
prep |
with,observed |
| R2783 |
T4443 |
T4442 |
pobj |
antibodies,with |
| R2784 |
T4444 |
T4443 |
prep |
against,antibodies |
| R2785 |
T4445 |
T4444 |
pobj |
components,against |
| R2786 |
T4446 |
T4445 |
prep |
of,components |
| R2787 |
T4447 |
T4448 |
det |
the,hemidesmosomes |
| R2788 |
T4448 |
T4446 |
pobj |
hemidesmosomes,of |
| R2789 |
T4449 |
T4445 |
punct |
", ",components |
| R279 |
T1075 |
T1071 |
amod |
epithelial,cells |
| R2790 |
T4450 |
T4451 |
dep |
which,provide |
| R2791 |
T4451 |
T4445 |
relcl |
provide,components |
| R2792 |
T4452 |
T4453 |
amod |
strong,adhesion |
| R2793 |
T4453 |
T4451 |
dobj |
adhesion,provide |
| R2794 |
T4454 |
T4453 |
prep |
of,adhesion |
| R2795 |
T4455 |
T4456 |
amod |
basal,cells |
| R2796 |
T4456 |
T4454 |
pobj |
cells,of |
| R2797 |
T4457 |
T4456 |
amod |
epidermal,cells |
| R2798 |
T4458 |
T4451 |
prep |
to,provide |
| R2799 |
T4459 |
T4460 |
det |
the,lamina |
| R280 |
T1077 |
T1076 |
auxpass |
are,attached |
| R2800 |
T4460 |
T4458 |
pobj |
lamina,to |
| R2801 |
T4461 |
T4460 |
amod |
underlying,lamina |
| R2802 |
T4462 |
T4460 |
amod |
basal,lamina |
| R2803 |
T4463 |
T4464 |
punct |
(,3M |
| R2804 |
T4464 |
T4439 |
parataxis |
3M,observed |
| R2805 |
T4465 |
T4464 |
compound |
Figure,3M |
| R2806 |
T4466 |
T4464 |
cc |
and,3M |
| R2807 |
T4467 |
T4464 |
conj |
3N,3M |
| R2808 |
T4468 |
T4464 |
punct |
),3M |
| R2809 |
T4469 |
T4439 |
punct |
.,observed |
| R281 |
T1078 |
T1076 |
advmod |
typically,attached |
| R2810 |
T4471 |
T4472 |
advmod |
Interestingly,occur |
| R2811 |
T4473 |
T4472 |
punct |
", ",occur |
| R2812 |
T4474 |
T4475 |
amod |
similar,types |
| R2813 |
T4475 |
T4472 |
nsubj |
types,occur |
| R2814 |
T4476 |
T4475 |
prep |
of,types |
| R2815 |
T4477 |
T4476 |
pobj |
alterations,of |
| R2816 |
T4478 |
T4472 |
prep |
in,occur |
| R2817 |
T4479 |
T4480 |
det |
the,membrane |
| R2818 |
T4480 |
T4478 |
pobj |
membrane,in |
| R2819 |
T4481 |
T4480 |
compound |
basement,membrane |
| R282 |
T1079 |
T1076 |
prep |
to,attached |
| R2820 |
T4482 |
T4472 |
prep |
in,occur |
| R2821 |
T4483 |
T4484 |
det |
the,bud |
| R2822 |
T4484 |
T4482 |
pobj |
bud,in |
| R2823 |
T4485 |
T4484 |
compound |
hair,bud |
| R2824 |
T4486 |
T4484 |
prep |
of,bud |
| R2825 |
T4487 |
T4488 |
amod |
embryonic,mice |
| R2826 |
T4488 |
T4486 |
pobj |
mice,of |
| R2827 |
T4489 |
T4487 |
cc |
and,embryonic |
| R2828 |
T4490 |
T4487 |
conj |
newborn,embryonic |
| R2829 |
T4491 |
T4492 |
advmod |
when,expressed |
| R283 |
T1080 |
T1081 |
det |
an,lamina |
| R2830 |
T4492 |
T4472 |
advcl |
expressed,occur |
| R2831 |
T4493 |
T4492 |
nsubjpass |
Snail,expressed |
| R2832 |
T4494 |
T4492 |
auxpass |
is,expressed |
| R2833 |
T4495 |
T4492 |
advmod |
normally,expressed |
| R2834 |
T4496 |
T4472 |
punct |
.,occur |
| R2835 |
T4498 |
T4499 |
det |
The,fact |
| R2836 |
T4499 |
T4500 |
nsubj |
fact,suggests |
| R2837 |
T4501 |
T4502 |
mark |
that,altered |
| R2838 |
T4502 |
T4499 |
acl |
altered,fact |
| R2839 |
T4503 |
T4504 |
det |
the,membrane |
| R284 |
T1081 |
T1079 |
pobj |
lamina,to |
| R2840 |
T4504 |
T4502 |
nsubjpass |
membrane,altered |
| R2841 |
T4505 |
T4504 |
compound |
basement,membrane |
| R2842 |
T4506 |
T4504 |
acl |
separating,membrane |
| R2843 |
T4507 |
T4508 |
det |
the,epidermis |
| R2844 |
T4508 |
T4506 |
dobj |
epidermis,separating |
| R2845 |
T4509 |
T4506 |
prep |
from,separating |
| R2846 |
T4510 |
T4511 |
det |
the,dermis |
| R2847 |
T4511 |
T4509 |
pobj |
dermis,from |
| R2848 |
T4512 |
T4502 |
auxpass |
is,altered |
| R2849 |
T4513 |
T4514 |
advmod |
only,in |
| R285 |
T1082 |
T1081 |
amod |
underlying,lamina |
| R2850 |
T4514 |
T4502 |
prep |
in,altered |
| R2851 |
T4515 |
T4516 |
det |
the,animals |
| R2852 |
T4516 |
T4514 |
pobj |
animals,in |
| R2853 |
T4517 |
T4516 |
amod |
adult,animals |
| R2854 |
T4518 |
T4516 |
compound |
Tg,animals |
| R2855 |
T4519 |
T4520 |
det |
the,involvement |
| R2856 |
T4520 |
T4500 |
dobj |
involvement,suggests |
| R2857 |
T4521 |
T4520 |
prep |
of,involvement |
| R2858 |
T4522 |
T4523 |
amod |
intermediary,factors |
| R2859 |
T4523 |
T4521 |
pobj |
factors,of |
| R286 |
T1083 |
T1081 |
amod |
basal,lamina |
| R2860 |
T4524 |
T4525 |
neg |
not,available |
| R2861 |
T4525 |
T4523 |
relcl |
available,factors |
| R2862 |
T4526 |
T4527 |
advmod |
as,readily |
| R2863 |
T4527 |
T4525 |
advmod |
readily,available |
| R2864 |
T4528 |
T4525 |
prep |
in,available |
| R2865 |
T4529 |
T4530 |
det |
the,epidermis |
| R2866 |
T4530 |
T4528 |
pobj |
epidermis,in |
| R2867 |
T4531 |
T4532 |
mark |
as,are |
| R2868 |
T4532 |
T4525 |
advcl |
are,available |
| R2869 |
T4533 |
T4532 |
nsubj |
they,are |
| R287 |
T1084 |
T1085 |
dep |
that,polarizes |
| R2870 |
T4534 |
T4532 |
prep |
in,are |
| R2871 |
T4535 |
T4536 |
det |
the,follicle |
| R2872 |
T4536 |
T4534 |
pobj |
follicle,in |
| R2873 |
T4537 |
T4500 |
punct |
.,suggests |
| R2878 |
T5218 |
T5219 |
amod |
Possible,Links |
| R2879 |
T5220 |
T5219 |
prep |
between,Links |
| R288 |
T1085 |
T1081 |
relcl |
polarizes,lamina |
| R2880 |
T5221 |
T5222 |
amod |
Epidermal,Hyperproliferation |
| R2881 |
T5222 |
T5220 |
pobj |
Hyperproliferation,between |
| R2882 |
T5223 |
T5222 |
cc |
and,Hyperproliferation |
| R2883 |
T5224 |
T5225 |
amod |
Down,regulation |
| R2884 |
T5225 |
T5222 |
conj |
regulation,Hyperproliferation |
| R2885 |
T5226 |
T5225 |
punct |
-,regulation |
| R2886 |
T5227 |
T5225 |
prep |
of,regulation |
| R2887 |
T5228 |
T5229 |
compound |
AJ,Proteins |
| R2888 |
T5229 |
T5227 |
pobj |
Proteins,of |
| R2889 |
T5230 |
T5219 |
prep |
in,Links |
| R289 |
T1086 |
T1087 |
det |
the,sheet |
| R2890 |
T5231 |
T5232 |
compound |
Snail,Mice |
| R2891 |
T5232 |
T5230 |
pobj |
Mice,in |
| R2892 |
T5233 |
T5232 |
compound |
Tg,Mice |
| R2893 |
T5235 |
T5236 |
prep |
Given,examined |
| R2894 |
T5237 |
T5238 |
mark |
that,is |
| R2895 |
T5238 |
T5235 |
pcomp |
is,Given |
| R2896 |
T5239 |
T5240 |
det |
the,promoter |
| R2897 |
T5240 |
T5238 |
nsubj |
promoter,is |
| R2898 |
T5241 |
T5242 |
compound |
E,cadherin |
| R2899 |
T5242 |
T5240 |
compound |
cadherin,promoter |
| R290 |
T1087 |
T1085 |
dobj |
sheet,polarizes |
| R2900 |
T5243 |
T5242 |
punct |
-,cadherin |
| R2901 |
T5244 |
T5245 |
det |
a,target |
| R2902 |
T5245 |
T5238 |
attr |
target,is |
| R2903 |
T5246 |
T5245 |
amod |
direct,target |
| R2904 |
T5247 |
T5245 |
prep |
for,target |
| R2905 |
T5248 |
T5249 |
npadvmod |
Snail,mediated |
| R2906 |
T5249 |
T5251 |
amod |
mediated,repression |
| R2907 |
T5250 |
T5249 |
punct |
-,mediated |
| R2908 |
T5251 |
T5247 |
pobj |
repression,for |
| R2909 |
T5252 |
T5253 |
advmod |
in,vitro |
| R291 |
T1088 |
T1087 |
amod |
epithelial,sheet |
| R2910 |
T5253 |
T5238 |
advmod |
vitro,is |
| R2911 |
T5254 |
T5255 |
punct |
[,13 |
| R2912 |
T5255 |
T5238 |
parataxis |
13,is |
| R2913 |
T5256 |
T5255 |
nummod |
4,13 |
| R2914 |
T5257 |
T5255 |
punct |
",",13 |
| R2915 |
T5258 |
T5255 |
nummod |
12,13 |
| R2916 |
T5259 |
T5255 |
punct |
",",13 |
| R2917 |
T5260 |
T5255 |
punct |
],13 |
| R2918 |
T5261 |
T5238 |
punct |
", ",is |
| R2919 |
T5262 |
T5238 |
cc |
and,is |
| R292 |
T1089 |
T1085 |
cc |
and,polarizes |
| R2920 |
T5263 |
T5264 |
mark |
that,regulated |
| R2921 |
T5264 |
T5238 |
conj |
regulated,is |
| R2922 |
T5265 |
T5266 |
compound |
E,cadherin |
| R2923 |
T5266 |
T5264 |
nsubjpass |
cadherin,regulated |
| R2924 |
T5267 |
T5266 |
punct |
-,cadherin |
| R2925 |
T5268 |
T5264 |
auxpass |
was,regulated |
| R2926 |
T5269 |
T5264 |
advmod |
down,regulated |
| R2927 |
T5270 |
T5264 |
punct |
-,regulated |
| R2928 |
T5271 |
T5264 |
prep |
in,regulated |
| R2929 |
T5272 |
T5273 |
npadvmod |
Snail,expressing |
| R293 |
T1090 |
T1085 |
conj |
separates,polarizes |
| R2930 |
T5273 |
T5275 |
amod |
expressing,buds |
| R2931 |
T5274 |
T5273 |
punct |
-,expressing |
| R2932 |
T5275 |
T5271 |
pobj |
buds,in |
| R2933 |
T5276 |
T5275 |
compound |
hair,buds |
| R2934 |
T5277 |
T5236 |
punct |
", ",examined |
| R2935 |
T5278 |
T5236 |
nsubj |
we,examined |
| R2936 |
T5279 |
T5280 |
det |
the,status |
| R2937 |
T5280 |
T5236 |
dobj |
status,examined |
| R2938 |
T5281 |
T5280 |
prep |
of,status |
| R2939 |
T5282 |
T5283 |
compound |
E,cadherin |
| R294 |
T1091 |
T1090 |
dobj |
it,separates |
| R2940 |
T5283 |
T5281 |
pobj |
cadherin,of |
| R2941 |
T5284 |
T5283 |
punct |
-,cadherin |
| R2942 |
T5285 |
T5283 |
cc |
and,cadherin |
| R2943 |
T5286 |
T5287 |
amod |
other,proteins |
| R2944 |
T5287 |
T5283 |
conj |
proteins,cadherin |
| R2945 |
T5288 |
T5287 |
compound |
AJ,proteins |
| R2946 |
T5289 |
T5236 |
prep |
within,examined |
| R2947 |
T5290 |
T5289 |
pobj |
regions,within |
| R2948 |
T5291 |
T5290 |
prep |
of,regions |
| R2949 |
T5292 |
T5293 |
amod |
hyperproliferative,epidermis |
| R295 |
T1092 |
T1090 |
prep |
from,separates |
| R2950 |
T5293 |
T5291 |
pobj |
epidermis,of |
| R2951 |
T5294 |
T5295 |
advmod |
where,was |
| R2952 |
T5295 |
T5290 |
relcl |
was,regions |
| R2953 |
T5296 |
T5297 |
compound |
Tg,Snail |
| R2954 |
T5297 |
T5295 |
nsubj |
Snail,was |
| R2955 |
T5298 |
T5295 |
acomp |
present,was |
| R2956 |
T5299 |
T5300 |
punct |
(,4A |
| R2957 |
T5300 |
T5236 |
parataxis |
4A,examined |
| R2958 |
T5301 |
T5300 |
compound |
Figure,4A |
| R2959 |
T5302 |
T5300 |
punct |
),4A |
| R296 |
T1093 |
T1094 |
amod |
surrounding,mesenchyme |
| R2960 |
T5303 |
T5236 |
punct |
.,examined |
| R2961 |
T5305 |
T5306 |
prep |
In,diminished |
| R2962 |
T5307 |
T5308 |
det |
these,regions |
| R2963 |
T5308 |
T5305 |
pobj |
regions,In |
| R2964 |
T5309 |
T5306 |
punct |
", ",diminished |
| R2965 |
T5310 |
T5311 |
compound |
immunofluorescence,staining |
| R2966 |
T5311 |
T5306 |
nsubjpass |
staining,diminished |
| R2967 |
T5312 |
T5311 |
prep |
of,staining |
| R2968 |
T5313 |
T5314 |
compound |
E,cadherin |
| R2969 |
T5314 |
T5312 |
pobj |
cadherin,of |
| R297 |
T1094 |
T1092 |
pobj |
mesenchyme,from |
| R2970 |
T5315 |
T5314 |
punct |
-,cadherin |
| R2971 |
T5316 |
T5314 |
cc |
and,cadherin |
| R2972 |
T5317 |
T5318 |
compound |
α,catenin |
| R2973 |
T5318 |
T5314 |
conj |
catenin,cadherin |
| R2974 |
T5319 |
T5318 |
punct |
-,catenin |
| R2975 |
T5320 |
T5306 |
auxpass |
were,diminished |
| R2976 |
T5321 |
T5306 |
advmod |
markedly,diminished |
| R2977 |
T5322 |
T5306 |
punct |
.,diminished |
| R2978 |
T5324 |
T5325 |
prep |
In,was |
| R2979 |
T5326 |
T5324 |
pobj |
contrast,In |
| R298 |
T1095 |
T1076 |
punct |
.,attached |
| R2980 |
T5327 |
T5325 |
punct |
", ",was |
| R2981 |
T5328 |
T5329 |
det |
the,intensity |
| R2982 |
T5329 |
T5325 |
nsubj |
intensity,was |
| R2983 |
T5330 |
T5329 |
prep |
of,intensity |
| R2984 |
T5331 |
T5332 |
compound |
antibody,staining |
| R2985 |
T5332 |
T5330 |
pobj |
staining,of |
| R2986 |
T5333 |
T5329 |
prep |
for,intensity |
| R2987 |
T5334 |
T5335 |
nummod |
two,proteins |
| R2988 |
T5335 |
T5333 |
pobj |
proteins,for |
| R2989 |
T5336 |
T5335 |
amod |
other,proteins |
| R299 |
T1097 |
T1098 |
amod |
Budding,morphogenesis |
| R2990 |
T5337 |
T5335 |
compound |
AJ,proteins |
| R2991 |
T5338 |
T5335 |
punct |
", ",proteins |
| R2992 |
T5339 |
T5340 |
compound |
β,catenin |
| R2993 |
T5340 |
T5335 |
appos |
catenin,proteins |
| R2994 |
T5341 |
T5340 |
punct |
-,catenin |
| R2995 |
T5342 |
T5340 |
cc |
and,catenin |
| R2996 |
T5343 |
T5340 |
conj |
Ajuba,catenin |
| R2997 |
T5344 |
T5325 |
punct |
", ",was |
| R2998 |
T5345 |
T5325 |
advmod |
still,was |
| R2999 |
T5346 |
T5325 |
acomp |
strong,was |
| R300 |
T1098 |
T1099 |
nsubjpass |
morphogenesis,guided |
| R3000 |
T5347 |
T5325 |
punct |
.,was |
| R3001 |
T5349 |
T5350 |
advmod |
Interestingly,appeared |
| R3002 |
T5351 |
T5350 |
punct |
", ",appeared |
| R3003 |
T5352 |
T5350 |
advmod |
however,appeared |
| R3004 |
T5353 |
T5350 |
punct |
", ",appeared |
| R3005 |
T5354 |
T5350 |
prep |
despite,appeared |
| R3006 |
T5355 |
T5356 |
amod |
appreciable,immunofluorescence |
| R3007 |
T5356 |
T5354 |
pobj |
immunofluorescence,despite |
| R3008 |
T5357 |
T5350 |
punct |
", ",appeared |
| R3009 |
T5358 |
T5350 |
nsubj |
localization,appeared |
| R301 |
T1100 |
T1099 |
auxpass |
is,guided |
| R3010 |
T5359 |
T5358 |
prep |
of,localization |
| R3011 |
T5360 |
T5361 |
compound |
β,catenin |
| R3012 |
T5361 |
T5359 |
pobj |
catenin,of |
| R3013 |
T5362 |
T5361 |
punct |
-,catenin |
| R3014 |
T5363 |
T5361 |
cc |
and,catenin |
| R3015 |
T5364 |
T5361 |
conj |
Ajuba,catenin |
| R3016 |
T5365 |
T5366 |
aux |
to,be |
| R3017 |
T5366 |
T5350 |
xcomp |
be,appeared |
| R3018 |
T5367 |
T5368 |
advmod |
largely,cytoplasmic |
| R3019 |
T5368 |
T5366 |
acomp |
cytoplasmic,be |
| R302 |
T1101 |
T1099 |
agent |
by,guided |
| R3020 |
T5369 |
T5370 |
advmod |
rather,than |
| R3021 |
T5370 |
T5368 |
cc |
than,cytoplasmic |
| R3022 |
T5371 |
T5368 |
conj |
at,cytoplasmic |
| R3023 |
T5372 |
T5373 |
compound |
cell,cell |
| R3024 |
T5373 |
T5375 |
compound |
cell,borders |
| R3025 |
T5374 |
T5373 |
punct |
-,cell |
| R3026 |
T5375 |
T5371 |
pobj |
borders,at |
| R3027 |
T5376 |
T5377 |
punct |
(,insets |
| R3028 |
T5377 |
T5350 |
parataxis |
insets,appeared |
| R3029 |
T5378 |
T5379 |
compound |
Figure,4A |
| R303 |
T1102 |
T1103 |
det |
a,exchange |
| R3030 |
T5379 |
T5377 |
compound |
4A,insets |
| R3031 |
T5380 |
T5377 |
punct |
),insets |
| R3032 |
T5381 |
T5350 |
punct |
.,appeared |
| R3033 |
T5383 |
T5384 |
amod |
Architectural,differences |
| R3034 |
T5384 |
T5385 |
nsubj |
differences,made |
| R3035 |
T5386 |
T5384 |
prep |
in,differences |
| R3036 |
T5387 |
T5388 |
det |
the,epidermis |
| R3037 |
T5388 |
T5386 |
pobj |
epidermis,in |
| R3038 |
T5389 |
T5390 |
compound |
Western,blot |
| R3039 |
T5390 |
T5391 |
compound |
blot,analyses |
| R304 |
T1103 |
T1101 |
pobj |
exchange,by |
| R3040 |
T5391 |
T5392 |
nsubj |
analyses,difficult |
| R3041 |
T5392 |
T5385 |
ccomp |
difficult,made |
| R3042 |
T5393 |
T5392 |
advmod |
somewhat,difficult |
| R3043 |
T5394 |
T5395 |
aux |
to,gauge |
| R3044 |
T5395 |
T5392 |
advcl |
gauge,difficult |
| R3045 |
T5396 |
T5385 |
punct |
.,made |
| R3046 |
T5398 |
T5399 |
advmod |
However,accentuated |
| R3047 |
T5400 |
T5399 |
punct |
", ",accentuated |
| R3048 |
T5401 |
T5399 |
prep |
in,accentuated |
| R3049 |
T5402 |
T5401 |
pobj |
regions,in |
| R305 |
T1104 |
T1103 |
amod |
reciprocal,exchange |
| R3050 |
T5403 |
T5404 |
amod |
such,as |
| R3051 |
T5404 |
T5402 |
prep |
as,regions |
| R3052 |
T5405 |
T5406 |
compound |
ear,skin |
| R3053 |
T5406 |
T5404 |
pobj |
skin,as |
| R3054 |
T5407 |
T5402 |
punct |
", ",regions |
| R3055 |
T5408 |
T5409 |
advmod |
where,expressed |
| R3056 |
T5409 |
T5402 |
relcl |
expressed,regions |
| R3057 |
T5410 |
T5411 |
det |
the,levels |
| R3058 |
T5411 |
T5409 |
nsubjpass |
levels,expressed |
| R3059 |
T5412 |
T5411 |
amod |
highest,levels |
| R306 |
T1105 |
T1103 |
prep |
of,exchange |
| R3060 |
T5413 |
T5411 |
prep |
of,levels |
| R3061 |
T5414 |
T5415 |
compound |
Snail,protein |
| R3062 |
T5415 |
T5413 |
pobj |
protein,of |
| R3063 |
T5416 |
T5409 |
auxpass |
were,expressed |
| R3064 |
T5417 |
T5399 |
punct |
", ",accentuated |
| R3065 |
T5418 |
T5419 |
det |
the,effects |
| R3066 |
T5419 |
T5399 |
nsubjpass |
effects,accentuated |
| R3067 |
T5420 |
T5399 |
auxpass |
were,accentuated |
| R3068 |
T5421 |
T5399 |
punct |
.,accentuated |
| R3069 |
T5423 |
T5424 |
prep |
In,reduced |
| R307 |
T1106 |
T1105 |
pobj |
signals,of |
| R3070 |
T5425 |
T5426 |
preconj |
both,skin |
| R3071 |
T5426 |
T5423 |
pobj |
skin,In |
| R3072 |
T5427 |
T5426 |
compound |
back,skin |
| R3073 |
T5428 |
T5426 |
cc |
and,skin |
| R3074 |
T5429 |
T5430 |
compound |
ear,skin |
| R3075 |
T5430 |
T5426 |
conj |
skin,skin |
| R3076 |
T5431 |
T5424 |
punct |
", ",reduced |
| R3077 |
T5432 |
T5433 |
amod |
overall,levels |
| R3078 |
T5433 |
T5424 |
nsubjpass |
levels,reduced |
| R3079 |
T5434 |
T5433 |
prep |
of,levels |
| R308 |
T1107 |
T1103 |
prep |
between,exchange |
| R3080 |
T5435 |
T5436 |
compound |
E,cadherin |
| R3081 |
T5436 |
T5434 |
pobj |
cadherin,of |
| R3082 |
T5437 |
T5436 |
punct |
-,cadherin |
| R3083 |
T5438 |
T5436 |
cc |
and,cadherin |
| R3084 |
T5439 |
T5440 |
compound |
α,catenin |
| R3085 |
T5440 |
T5436 |
conj |
catenin,cadherin |
| R3086 |
T5441 |
T5440 |
punct |
-,catenin |
| R3087 |
T5442 |
T5424 |
auxpass |
were,reduced |
| R3088 |
T5443 |
T5424 |
punct |
", ",reduced |
| R3089 |
T5444 |
T5424 |
prep |
under,reduced |
| R309 |
T1108 |
T1107 |
pobj |
epithelium,between |
| R3090 |
T5445 |
T5444 |
pobj |
conditions,under |
| R3091 |
T5446 |
T5447 |
advmod |
where,remained |
| R3092 |
T5447 |
T5445 |
relcl |
remained,conditions |
| R3093 |
T5448 |
T5449 |
nmod |
β,catenin |
| R3094 |
T5449 |
T5451 |
nmod |
catenin,levels |
| R3095 |
T5450 |
T5449 |
punct |
-,catenin |
| R3096 |
T5451 |
T5447 |
nsubj |
levels,remained |
| R3097 |
T5452 |
T5449 |
cc |
and,catenin |
| R3098 |
T5453 |
T5449 |
conj |
Ajuba,catenin |
| R3099 |
T5454 |
T5447 |
acomp |
unchanged,remained |
| R310 |
T1109 |
T1108 |
cc |
and,epithelium |
| R3100 |
T5455 |
T5447 |
advcl |
relative,remained |
| R3101 |
T5456 |
T5455 |
prep |
to,relative |
| R3102 |
T5457 |
T5456 |
pobj |
controls,to |
| R3103 |
T5458 |
T5459 |
punct |
(,4B |
| R3104 |
T5459 |
T5424 |
parataxis |
4B,reduced |
| R3105 |
T5460 |
T5459 |
compound |
Figure,4B |
| R3106 |
T5461 |
T5459 |
punct |
),4B |
| R3107 |
T5462 |
T5424 |
punct |
.,reduced |
| R3108 |
T5464 |
T5465 |
advcl |
Taken,were |
| R3109 |
T5466 |
T5464 |
advmod |
together,Taken |
| R311 |
T1110 |
T1108 |
conj |
mesenchyme,epithelium |
| R3110 |
T5467 |
T5465 |
punct |
", ",were |
| R3111 |
T5468 |
T5469 |
det |
these,data |
| R3112 |
T5469 |
T5465 |
nsubj |
data,were |
| R3113 |
T5470 |
T5465 |
acomp |
consistent,were |
| R3114 |
T5471 |
T5470 |
prep |
with,consistent |
| R3115 |
T5472 |
T5473 |
poss |
our,results |
| R3116 |
T5473 |
T5471 |
pobj |
results,with |
| R3117 |
T5474 |
T5473 |
acl |
obtained,results |
| R3118 |
T5475 |
T5474 |
prep |
from,obtained |
| R3119 |
T5476 |
T5477 |
compound |
immunofluorescence,microscopy |
| R312 |
T1111 |
T1112 |
aux |
to,specify |
| R3120 |
T5477 |
T5475 |
pobj |
microscopy,from |
| R3121 |
T5478 |
T5465 |
punct |
.,were |
| R3122 |
T5480 |
T5481 |
advmod |
A,priori |
| R3123 |
T5481 |
T5482 |
advmod |
priori,be |
| R3124 |
T5483 |
T5482 |
punct |
", ",be |
| R3125 |
T5484 |
T5485 |
det |
the,decrease |
| R3126 |
T5485 |
T5482 |
nsubj |
decrease,be |
| R3127 |
T5486 |
T5485 |
prep |
in,decrease |
| R3128 |
T5487 |
T5488 |
compound |
α,catenin |
| R3129 |
T5488 |
T5490 |
compound |
catenin,levels |
| R313 |
T1112 |
T1103 |
advcl |
specify,exchange |
| R3130 |
T5489 |
T5488 |
punct |
-,catenin |
| R3131 |
T5490 |
T5486 |
pobj |
levels,in |
| R3132 |
T5491 |
T5482 |
aux |
could,be |
| R3133 |
T5492 |
T5482 |
prep |
due,be |
| R3134 |
T5493 |
T5492 |
pcomp |
to,due |
| R3135 |
T5494 |
T5495 |
preconj |
either,repression |
| R3136 |
T5495 |
T5492 |
pobj |
repression,due |
| R3137 |
T5496 |
T5495 |
amod |
direct,repression |
| R3138 |
T5497 |
T5495 |
amod |
transcriptional,repression |
| R3139 |
T5498 |
T5495 |
prep |
by,repression |
| R314 |
T1113 |
T1114 |
det |
the,identity |
| R3140 |
T5499 |
T5498 |
pobj |
Snail,by |
| R3141 |
T5500 |
T5495 |
cc |
or,repression |
| R3142 |
T5501 |
T5495 |
conj |
perturbations,repression |
| R3143 |
T5502 |
T5501 |
prep |
in,perturbations |
| R3144 |
T5503 |
T5504 |
compound |
AJ,formation |
| R3145 |
T5504 |
T5502 |
pobj |
formation,in |
| R3146 |
T5505 |
T5501 |
acl |
caused,perturbations |
| R3147 |
T5506 |
T5505 |
agent |
by,caused |
| R3148 |
T5507 |
T5508 |
det |
the,decrease |
| R3149 |
T5508 |
T5506 |
pobj |
decrease,by |
| R315 |
T1114 |
T1112 |
dobj |
identity,specify |
| R3150 |
T5509 |
T5508 |
prep |
in,decrease |
| R3151 |
T5510 |
T5511 |
compound |
E,cadherin |
| R3152 |
T5511 |
T5513 |
compound |
cadherin,expression |
| R3153 |
T5512 |
T5511 |
punct |
-,cadherin |
| R3154 |
T5513 |
T5509 |
pobj |
expression,in |
| R3155 |
T5514 |
T5513 |
compound |
gene,expression |
| R3156 |
T5515 |
T5482 |
punct |
.,be |
| R3157 |
T5517 |
T5518 |
aux |
To,distinguish |
| R3158 |
T5518 |
T5519 |
advcl |
distinguish,tested |
| R3159 |
T5520 |
T5518 |
prep |
between,distinguish |
| R316 |
T1115 |
T1114 |
prep |
of,identity |
| R3160 |
T5521 |
T5522 |
det |
these,possibilities |
| R3161 |
T5522 |
T5520 |
pobj |
possibilities,between |
| R3162 |
T5523 |
T5519 |
punct |
", ",tested |
| R3163 |
T5524 |
T5519 |
nsubj |
we,tested |
| R3164 |
T5525 |
T5526 |
mark |
whether,restored |
| R3165 |
T5526 |
T5519 |
ccomp |
restored,tested |
| R3166 |
T5527 |
T5528 |
compound |
α,catenin |
| R3167 |
T5528 |
T5530 |
compound |
catenin,levels |
| R3168 |
T5529 |
T5528 |
punct |
-,catenin |
| R3169 |
T5530 |
T5526 |
nsubjpass |
levels,restored |
| R317 |
T1116 |
T1117 |
det |
the,organ |
| R3170 |
T5531 |
T5526 |
aux |
could,restored |
| R3171 |
T5532 |
T5526 |
auxpass |
be,restored |
| R3172 |
T5533 |
T5526 |
agent |
by,restored |
| R3173 |
T5534 |
T5535 |
amod |
exogenous,expression |
| R3174 |
T5535 |
T5533 |
pobj |
expression,by |
| R3175 |
T5536 |
T5535 |
prep |
of,expression |
| R3176 |
T5537 |
T5538 |
compound |
E,cadherin |
| R3177 |
T5538 |
T5536 |
pobj |
cadherin,of |
| R3178 |
T5539 |
T5538 |
punct |
-,cadherin |
| R3179 |
T5540 |
T5526 |
prep |
in,restored |
| R318 |
T1117 |
T1115 |
pobj |
organ,of |
| R3180 |
T5541 |
T5542 |
npadvmod |
Snail,expressing |
| R3181 |
T5542 |
T5544 |
amod |
expressing,keratinocytes |
| R3182 |
T5543 |
T5542 |
punct |
-,expressing |
| R3183 |
T5544 |
T5540 |
pobj |
keratinocytes,in |
| R3184 |
T5545 |
T5519 |
punct |
.,tested |
| R3185 |
T5547 |
T5548 |
mark |
As,shown |
| R3186 |
T5548 |
T5549 |
advcl |
shown,displayed |
| R3187 |
T5550 |
T5548 |
prep |
in,shown |
| R3188 |
T5551 |
T5552 |
compound |
Figure,4C |
| R3189 |
T5552 |
T5550 |
pobj |
4C,in |
| R319 |
T1118 |
T1119 |
dep |
that,form |
| R3190 |
T5553 |
T5549 |
punct |
", ",displayed |
| R3191 |
T5554 |
T5555 |
advmod |
transiently,transfected |
| R3192 |
T5555 |
T5556 |
amod |
transfected,keratinocytes |
| R3193 |
T5556 |
T5549 |
nsubj |
keratinocytes,displayed |
| R3194 |
T5557 |
T5556 |
acl |
expressing,keratinocytes |
| R3195 |
T5558 |
T5559 |
npadvmod |
HA,tagged |
| R3196 |
T5559 |
T5561 |
amod |
tagged,Snail |
| R3197 |
T5560 |
T5559 |
punct |
-,tagged |
| R3198 |
T5561 |
T5557 |
dobj |
Snail,expressing |
| R3199 |
T5562 |
T5563 |
det |
a,loss |
| R320 |
T1119 |
T1117 |
relcl |
form,organ |
| R3200 |
T5563 |
T5549 |
dobj |
loss,displayed |
| R3201 |
T5564 |
T5563 |
prep |
of,loss |
| R3202 |
T5565 |
T5566 |
compound |
E,cadherin |
| R3203 |
T5566 |
T5564 |
pobj |
cadherin,of |
| R3204 |
T5567 |
T5566 |
punct |
-,cadherin |
| R3205 |
T5568 |
T5566 |
cc |
and,cadherin |
| R3206 |
T5569 |
T5570 |
compound |
α,catenin |
| R3207 |
T5570 |
T5566 |
conj |
catenin,cadherin |
| R3208 |
T5571 |
T5570 |
punct |
-,catenin |
| R3209 |
T5572 |
T5549 |
prep |
at,displayed |
| R321 |
T1120 |
T1119 |
aux |
will,form |
| R3210 |
T5573 |
T5574 |
compound |
cell,cell |
| R3211 |
T5574 |
T5576 |
compound |
cell,borders |
| R3212 |
T5575 |
T5574 |
punct |
-,cell |
| R3213 |
T5576 |
T5572 |
pobj |
borders,at |
| R3214 |
T5577 |
T5549 |
punct |
.,displayed |
| R3215 |
T5579 |
T5580 |
nsubj |
Coexpression,enabled |
| R3216 |
T5581 |
T5579 |
prep |
of,Coexpression |
| R3217 |
T5582 |
T5583 |
amod |
exogenous,cadherin |
| R3218 |
T5583 |
T5581 |
pobj |
cadherin,of |
| R3219 |
T5584 |
T5585 |
npadvmod |
HA,tagged |
| R322 |
T1121 |
T1112 |
cc |
and,specify |
| R3220 |
T5585 |
T5583 |
amod |
tagged,cadherin |
| R3221 |
T5586 |
T5585 |
punct |
-,tagged |
| R3222 |
T5587 |
T5583 |
compound |
E,cadherin |
| R3223 |
T5588 |
T5583 |
punct |
-,cadherin |
| R3224 |
T5589 |
T5580 |
preconj |
not,enabled |
| R3225 |
T5590 |
T5589 |
advmod |
only,not |
| R3226 |
T5591 |
T5592 |
compound |
cell,cell |
| R3227 |
T5592 |
T5594 |
compound |
cell,localization |
| R3228 |
T5593 |
T5592 |
punct |
-,cell |
| R3229 |
T5594 |
T5580 |
dobj |
localization,enabled |
| R323 |
T1122 |
T1123 |
aux |
to,govern |
| R3230 |
T5595 |
T5594 |
compound |
border,localization |
| R3231 |
T5596 |
T5594 |
prep |
of,localization |
| R3232 |
T5597 |
T5598 |
compound |
E,cadherin |
| R3233 |
T5598 |
T5600 |
compound |
cadherin,protein |
| R3234 |
T5599 |
T5598 |
punct |
-,cadherin |
| R3235 |
T5600 |
T5596 |
pobj |
protein,of |
| R3236 |
T5601 |
T5580 |
punct |
", ",enabled |
| R3237 |
T5602 |
T5580 |
cc |
but,enabled |
| R3238 |
T5603 |
T5602 |
advmod |
also,but |
| R3239 |
T5604 |
T5580 |
conj |
rescued,enabled |
| R324 |
T1123 |
T1112 |
conj |
govern,specify |
| R3240 |
T5605 |
T5606 |
det |
the,staining |
| R3241 |
T5606 |
T5604 |
dobj |
staining,rescued |
| R3242 |
T5607 |
T5608 |
compound |
cell,cell |
| R3243 |
T5608 |
T5606 |
compound |
cell,staining |
| R3244 |
T5609 |
T5608 |
punct |
-,cell |
| R3245 |
T5610 |
T5606 |
compound |
border,staining |
| R3246 |
T5611 |
T5606 |
prep |
of,staining |
| R3247 |
T5612 |
T5613 |
compound |
α,catenin |
| R3248 |
T5613 |
T5611 |
pobj |
catenin,of |
| R3249 |
T5614 |
T5613 |
punct |
-,catenin |
| R325 |
T1124 |
T1125 |
poss |
its,growth |
| R3250 |
T5615 |
T5616 |
punct |
(,4C |
| R3251 |
T5616 |
T5604 |
parataxis |
4C,rescued |
| R3252 |
T5617 |
T5616 |
compound |
Figure,4C |
| R3253 |
T5618 |
T5616 |
punct |
),4C |
| R3254 |
T5619 |
T5580 |
punct |
.,enabled |
| R3255 |
T5621 |
T5622 |
det |
The,ability |
| R3256 |
T5622 |
T5623 |
nsubj |
ability,argues |
| R3257 |
T5624 |
T5625 |
aux |
to,restore |
| R3258 |
T5625 |
T5622 |
acl |
restore,ability |
| R3259 |
T5626 |
T5627 |
compound |
α,catenin |
| R326 |
T1125 |
T1123 |
dobj |
growth,govern |
| R3260 |
T5627 |
T5625 |
dobj |
catenin,restore |
| R3261 |
T5628 |
T5627 |
punct |
-,catenin |
| R3262 |
T5629 |
T5627 |
appos |
expression,catenin |
| R3263 |
T5630 |
T5629 |
cc |
and,expression |
| R3264 |
T5631 |
T5629 |
conj |
localization,expression |
| R3265 |
T5632 |
T5625 |
prep |
under,restore |
| R3266 |
T5633 |
T5634 |
det |
these,conditions |
| R3267 |
T5634 |
T5632 |
pobj |
conditions,under |
| R3268 |
T5635 |
T5623 |
prep |
against,argues |
| R3269 |
T5636 |
T5637 |
det |
the,notion |
| R327 |
T1126 |
T1099 |
punct |
.,guided |
| R3270 |
T5637 |
T5635 |
pobj |
notion,against |
| R3271 |
T5638 |
T5639 |
mark |
that,represses |
| R3272 |
T5639 |
T5637 |
acl |
represses,notion |
| R3273 |
T5640 |
T5639 |
nsubj |
Snail,represses |
| R3274 |
T5641 |
T5639 |
advmod |
transcriptionally,represses |
| R3275 |
T5642 |
T5643 |
compound |
α,catenin |
| R3276 |
T5643 |
T5639 |
dobj |
catenin,represses |
| R3277 |
T5644 |
T5643 |
punct |
-,catenin |
| R3278 |
T5645 |
T5623 |
punct |
.,argues |
| R3279 |
T5647 |
T5648 |
advmod |
Rather,are |
| R328 |
T1128 |
T1129 |
prep |
At,are |
| R3280 |
T5649 |
T5648 |
punct |
", ",are |
| R3281 |
T5650 |
T5651 |
det |
the,findings |
| R3282 |
T5651 |
T5648 |
nsubj |
findings,are |
| R3283 |
T5652 |
T5648 |
acomp |
consistent,are |
| R3284 |
T5653 |
T5652 |
prep |
with,consistent |
| R3285 |
T5654 |
T5655 |
det |
a,report |
| R3286 |
T5655 |
T5653 |
pobj |
report,with |
| R3287 |
T5656 |
T5655 |
amod |
previous,report |
| R3288 |
T5657 |
T5658 |
mark |
that,required |
| R3289 |
T5658 |
T5655 |
acl |
required,report |
| R329 |
T1130 |
T1131 |
det |
the,helm |
| R3290 |
T5659 |
T5660 |
compound |
E,cadherin |
| R3291 |
T5660 |
T5658 |
nsubjpass |
cadherin,required |
| R3292 |
T5661 |
T5660 |
punct |
-,cadherin |
| R3293 |
T5662 |
T5658 |
auxpass |
is,required |
| R3294 |
T5663 |
T5658 |
prep |
for,required |
| R3295 |
T5664 |
T5665 |
det |
the,translation |
| R3296 |
T5665 |
T5663 |
pobj |
translation,for |
| R3297 |
T5666 |
T5665 |
prep |
of,translation |
| R3298 |
T5667 |
T5668 |
compound |
α,catenin |
| R3299 |
T5668 |
T5670 |
compound |
catenin,mRNA |
| R330 |
T1131 |
T1128 |
pobj |
helm,At |
| R3300 |
T5669 |
T5668 |
punct |
-,catenin |
| R3301 |
T5670 |
T5666 |
pobj |
mRNA,of |
| R3302 |
T5671 |
T5672 |
punct |
[,22 |
| R3303 |
T5672 |
T5648 |
parataxis |
22,are |
| R3304 |
T5673 |
T5672 |
punct |
],22 |
| R3305 |
T5674 |
T5648 |
punct |
.,are |
| R3306 |
T5676 |
T5677 |
prep |
Despite,displayed |
| R3307 |
T5678 |
T5679 |
det |
the,reductions |
| R3308 |
T5679 |
T5676 |
pobj |
reductions,Despite |
| R3309 |
T5680 |
T5679 |
prep |
in,reductions |
| R331 |
T1132 |
T1131 |
prep |
of,helm |
| R3310 |
T5681 |
T5682 |
compound |
AJ,markers |
| R3311 |
T5682 |
T5680 |
pobj |
markers,in |
| R3312 |
T5683 |
T5677 |
punct |
", ",displayed |
| R3313 |
T5684 |
T5685 |
compound |
Tg,skin |
| R3314 |
T5685 |
T5677 |
nsubj |
skin,displayed |
| R3315 |
T5686 |
T5677 |
advmod |
still,displayed |
| R3316 |
T5687 |
T5688 |
amod |
sealed,membranes |
| R3317 |
T5688 |
T5677 |
dobj |
membranes,displayed |
| R3318 |
T5689 |
T5688 |
cc |
and,membranes |
| R3319 |
T5690 |
T5691 |
amod |
intercellular,junctions |
| R332 |
T1133 |
T1134 |
det |
these,pathways |
| R3320 |
T5691 |
T5688 |
conj |
junctions,membranes |
| R3321 |
T5692 |
T5693 |
dep |
that,were |
| R3322 |
T5693 |
T5691 |
relcl |
were,junctions |
| R3323 |
T5694 |
T5693 |
advmod |
largely,were |
| R3324 |
T5695 |
T5693 |
acomp |
intact,were |
| R3325 |
T5696 |
T5693 |
punct |
", ",were |
| R3326 |
T5697 |
T5698 |
mark |
as,judged |
| R3327 |
T5698 |
T5693 |
advcl |
judged,were |
| R3328 |
T5699 |
T5698 |
prep |
by,judged |
| R3329 |
T5700 |
T5701 |
amod |
ultrastructural,analyses |
| R333 |
T1134 |
T1132 |
pobj |
pathways,of |
| R3330 |
T5701 |
T5699 |
pobj |
analyses,by |
| R3331 |
T5702 |
T5703 |
punct |
(,data |
| R3332 |
T5703 |
T5677 |
meta |
data,displayed |
| R3333 |
T5704 |
T5703 |
amod |
unpublished,data |
| R3334 |
T5705 |
T5703 |
punct |
),data |
| R3335 |
T5706 |
T5677 |
punct |
.,displayed |
| R3336 |
T5708 |
T5709 |
prep |
In,resembled |
| R3337 |
T5710 |
T5711 |
det |
this,respect |
| R3338 |
T5711 |
T5708 |
pobj |
respect,In |
| R3339 |
T5712 |
T5709 |
punct |
", ",resembled |
| R334 |
T1135 |
T1136 |
amod |
molecular,communication |
| R3340 |
T5713 |
T5714 |
det |
the,epithelium |
| R3341 |
T5714 |
T5709 |
nsubj |
epithelium,resembled |
| R3342 |
T5715 |
T5714 |
compound |
skin,epithelium |
| R3343 |
T5716 |
T5709 |
dobj |
that,resembled |
| R3344 |
T5717 |
T5716 |
prep |
of,that |
| R3345 |
T5718 |
T5719 |
det |
the,bud |
| R3346 |
T5719 |
T5717 |
pobj |
bud,of |
| R3347 |
T5720 |
T5719 |
compound |
hair,bud |
| R3348 |
T5721 |
T5719 |
punct |
", ",bud |
| R3349 |
T5722 |
T5723 |
advmod |
where,is |
| R335 |
T1136 |
T1134 |
compound |
communication,pathways |
| R3350 |
T5723 |
T5719 |
relcl |
is,bud |
| R3351 |
T5724 |
T5725 |
det |
the,regulation |
| R3352 |
T5725 |
T5723 |
nsubj |
regulation,is |
| R3353 |
T5726 |
T5725 |
amod |
down,regulation |
| R3354 |
T5727 |
T5725 |
punct |
-,regulation |
| R3355 |
T5728 |
T5725 |
prep |
in,regulation |
| R3356 |
T5729 |
T5730 |
compound |
junction,proteins |
| R3357 |
T5730 |
T5728 |
pobj |
proteins,in |
| R3358 |
T5731 |
T5723 |
acomp |
permissive,is |
| R3359 |
T5732 |
T5723 |
prep |
for,is |
| R336 |
T1137 |
T1129 |
nsubj |
Wnts,are |
| R3360 |
T5733 |
T5734 |
compound |
cell,cell |
| R3361 |
T5734 |
T5736 |
compound |
cell,remodeling |
| R3362 |
T5735 |
T5734 |
punct |
-,cell |
| R3363 |
T5736 |
T5732 |
pobj |
remodeling,for |
| R3364 |
T5737 |
T5723 |
prep |
without,is |
| R3365 |
T5738 |
T5737 |
pcomp |
abrogating,without |
| R3366 |
T5739 |
T5740 |
amod |
intercellular,adhesion |
| R3367 |
T5740 |
T5738 |
dobj |
adhesion,abrogating |
| R3368 |
T5741 |
T5709 |
punct |
.,resembled |
| R3369 |
T5743 |
T5744 |
det |
The,similarities |
| R337 |
T1138 |
T1137 |
punct |
", ",Wnts |
| R3370 |
T5744 |
T5745 |
nsubj |
similarities,extended |
| R3371 |
T5746 |
T5744 |
prep |
between,similarities |
| R3372 |
T5747 |
T5748 |
compound |
Snail,epidermis |
| R3373 |
T5748 |
T5746 |
pobj |
epidermis,between |
| R3374 |
T5749 |
T5748 |
compound |
Tg,epidermis |
| R3375 |
T5750 |
T5748 |
cc |
and,epidermis |
| R3376 |
T5751 |
T5752 |
compound |
hair,buds |
| R3377 |
T5752 |
T5748 |
conj |
buds,epidermis |
| R3378 |
T5753 |
T5745 |
prep |
to,extended |
| R3379 |
T5754 |
T5755 |
det |
the,state |
| R338 |
T1139 |
T1140 |
nmod |
bone,proteins |
| R3380 |
T5755 |
T5753 |
pobj |
state,to |
| R3381 |
T5756 |
T5755 |
amod |
hyperproliferative,state |
| R3382 |
T5757 |
T5745 |
punct |
", ",extended |
| R3383 |
T5758 |
T5745 |
advcl |
leading,extended |
| R3384 |
T5759 |
T5758 |
dobj |
us,leading |
| R3385 |
T5760 |
T5761 |
aux |
to,wonder |
| R3386 |
T5761 |
T5758 |
xcomp |
wonder,leading |
| R3387 |
T5762 |
T5763 |
mark |
whether,contribute |
| R3388 |
T5763 |
T5761 |
ccomp |
contribute,wonder |
| R3389 |
T5764 |
T5765 |
det |
the,regulation |
| R339 |
T1140 |
T1137 |
appos |
proteins,Wnts |
| R3390 |
T5765 |
T5763 |
nsubj |
regulation,contribute |
| R3391 |
T5766 |
T5765 |
amod |
down,regulation |
| R3392 |
T5767 |
T5765 |
punct |
-,regulation |
| R3393 |
T5768 |
T5765 |
prep |
of,regulation |
| R3394 |
T5769 |
T5770 |
compound |
AJ,proteins |
| R3395 |
T5770 |
T5768 |
pobj |
proteins,of |
| R3396 |
T5771 |
T5763 |
aux |
might,contribute |
| R3397 |
T5772 |
T5763 |
prep |
to,contribute |
| R3398 |
T5773 |
T5774 |
det |
this,condition |
| R3399 |
T5774 |
T5772 |
pobj |
condition,to |
| R340 |
T1141 |
T1140 |
amod |
morphogenic,proteins |
| R3400 |
T5775 |
T5745 |
punct |
.,extended |
| R3401 |
T5777 |
T5778 |
prep |
Given,used |
| R3402 |
T5779 |
T5780 |
det |
the,increase |
| R3403 |
T5780 |
T5777 |
pobj |
increase,Given |
| R3404 |
T5781 |
T5780 |
prep |
in,increase |
| R3405 |
T5782 |
T5783 |
compound |
pMAPK,staining |
| R3406 |
T5783 |
T5781 |
pobj |
staining,in |
| R3407 |
T5784 |
T5780 |
prep |
in,increase |
| R3408 |
T5785 |
T5786 |
compound |
Snail,epidermis |
| R3409 |
T5786 |
T5784 |
pobj |
epidermis,in |
| R341 |
T1142 |
T1140 |
punct |
(,proteins |
| R3410 |
T5787 |
T5786 |
compound |
Tg,epidermis |
| R3411 |
T5788 |
T5789 |
punct |
(,see |
| R3412 |
T5789 |
T5780 |
parataxis |
see,increase |
| R3413 |
T5790 |
T5791 |
compound |
Figure,2G |
| R3414 |
T5791 |
T5789 |
dobj |
2G,see |
| R3415 |
T5792 |
T5789 |
punct |
),see |
| R3416 |
T5793 |
T5778 |
punct |
", ",used |
| R3417 |
T5794 |
T5778 |
nsubj |
we,used |
| R3418 |
T5795 |
T5796 |
compound |
pMAPK,levels |
| R3419 |
T5796 |
T5778 |
dobj |
levels,used |
| R342 |
T1143 |
T1140 |
appos |
BMPs,proteins |
| R3420 |
T5797 |
T5778 |
prep |
as,used |
| R3421 |
T5798 |
T5799 |
poss |
our,assay |
| R3422 |
T5799 |
T5797 |
pobj |
assay,as |
| R3423 |
T5800 |
T5801 |
aux |
to,test |
| R3424 |
T5801 |
T5778 |
advcl |
test,used |
| R3425 |
T5802 |
T5803 |
mark |
whether,contributed |
| R3426 |
T5803 |
T5801 |
ccomp |
contributed,test |
| R3427 |
T5804 |
T5805 |
det |
the,loss |
| R3428 |
T5805 |
T5803 |
nsubj |
loss,contributed |
| R3429 |
T5806 |
T5805 |
prep |
of,loss |
| R343 |
T1144 |
T1137 |
punct |
),Wnts |
| R3430 |
T5807 |
T5808 |
compound |
E,cadherin |
| R3431 |
T5808 |
T5806 |
pobj |
cadherin,of |
| R3432 |
T5809 |
T5808 |
punct |
-,cadherin |
| R3433 |
T5810 |
T5803 |
prep |
to,contributed |
| R3434 |
T5811 |
T5812 |
det |
the,increase |
| R3435 |
T5812 |
T5810 |
pobj |
increase,to |
| R3436 |
T5813 |
T5814 |
npadvmod |
Snail,mediated |
| R3437 |
T5814 |
T5812 |
amod |
mediated,increase |
| R3438 |
T5815 |
T5814 |
punct |
-,mediated |
| R3439 |
T5816 |
T5812 |
prep |
in,increase |
| R344 |
T1145 |
T1137 |
punct |
", ",Wnts |
| R3440 |
T5817 |
T5816 |
pobj |
proliferation,in |
| R3441 |
T5818 |
T5778 |
punct |
.,used |
| R3442 |
T5820 |
T5821 |
advcl |
Consistent,exhibited |
| R3443 |
T5822 |
T5820 |
prep |
with,Consistent |
| R3444 |
T5823 |
T5824 |
poss |
our,observations |
| R3445 |
T5824 |
T5822 |
pobj |
observations,with |
| R3446 |
T5825 |
T5826 |
advmod |
in,vivo |
| R3447 |
T5826 |
T5824 |
amod |
vivo,observations |
| R3448 |
T5827 |
T5821 |
punct |
", ",exhibited |
| R3449 |
T5828 |
T5829 |
amod |
transfected,keratinocytes |
| R345 |
T1146 |
T1147 |
amod |
transforming,βs |
| R3450 |
T5829 |
T5821 |
nsubj |
keratinocytes,exhibited |
| R3451 |
T5830 |
T5829 |
acl |
expressing,keratinocytes |
| R3452 |
T5831 |
T5830 |
dobj |
Snail,expressing |
| R3453 |
T5832 |
T5833 |
det |
a,increase |
| R3454 |
T5833 |
T5821 |
dobj |
increase,exhibited |
| R3455 |
T5834 |
T5833 |
amod |
substantial,increase |
| R3456 |
T5835 |
T5833 |
prep |
in,increase |
| R3457 |
T5836 |
T5837 |
compound |
pMAPK,levels |
| R3458 |
T5837 |
T5835 |
pobj |
levels,in |
| R3459 |
T5838 |
T5833 |
amod |
relative,increase |
| R346 |
T1147 |
T1137 |
appos |
βs,Wnts |
| R3460 |
T5839 |
T5838 |
prep |
to,relative |
| R3461 |
T5840 |
T5841 |
compound |
control,cells |
| R3462 |
T5841 |
T5839 |
pobj |
cells,to |
| R3463 |
T5842 |
T5843 |
punct |
(,4D |
| R3464 |
T5843 |
T5821 |
parataxis |
4D,exhibited |
| R3465 |
T5844 |
T5843 |
compound |
Figure,4D |
| R3466 |
T5845 |
T5843 |
punct |
),4D |
| R3467 |
T5846 |
T5821 |
punct |
.,exhibited |
| R3468 |
T5848 |
T5849 |
nsubj |
Coexpression,appeared |
| R3469 |
T5850 |
T5848 |
prep |
of,Coexpression |
| R347 |
T1148 |
T1147 |
compound |
growth,βs |
| R3470 |
T5851 |
T5852 |
compound |
E,cadherin |
| R3471 |
T5852 |
T5850 |
pobj |
cadherin,of |
| R3472 |
T5853 |
T5852 |
punct |
-,cadherin |
| R3473 |
T5854 |
T5848 |
prep |
with,Coexpression |
| R3474 |
T5855 |
T5854 |
pobj |
Snail,with |
| R3475 |
T5856 |
T5857 |
aux |
to,abrogate |
| R3476 |
T5857 |
T5849 |
xcomp |
abrogate,appeared |
| R3477 |
T5858 |
T5859 |
det |
this,effect |
| R3478 |
T5859 |
T5857 |
dobj |
effect,abrogate |
| R3479 |
T5860 |
T5849 |
punct |
.,appeared |
| R348 |
T1149 |
T1147 |
compound |
factor,βs |
| R3480 |
T5862 |
T5863 |
advmod |
Together,raised |
| R3481 |
T5864 |
T5863 |
punct |
", ",raised |
| R3482 |
T5865 |
T5866 |
det |
these,findings |
| R3483 |
T5866 |
T5863 |
nsubj |
findings,raised |
| R3484 |
T5867 |
T5868 |
det |
the,possibility |
| R3485 |
T5868 |
T5863 |
dobj |
possibility,raised |
| R3486 |
T5869 |
T5870 |
mark |
that,participate |
| R3487 |
T5870 |
T5868 |
acl |
participate,possibility |
| R3488 |
T5871 |
T5872 |
det |
an,protein |
| R3489 |
T5872 |
T5870 |
nsubj |
protein,participate |
| R349 |
T1150 |
T1147 |
punct |
(,βs |
| R3490 |
T5873 |
T5874 |
npadvmod |
AJ,associated |
| R3491 |
T5874 |
T5872 |
amod |
associated,protein |
| R3492 |
T5875 |
T5874 |
punct |
-,associated |
| R3493 |
T5876 |
T5877 |
dep |
that,sequestered |
| R3494 |
T5877 |
T5872 |
relcl |
sequestered,protein |
| R3495 |
T5878 |
T5877 |
auxpass |
is,sequestered |
| R3496 |
T5879 |
T5877 |
advmod |
normally,sequestered |
| R3497 |
T5880 |
T5877 |
prep |
at,sequestered |
| R3498 |
T5881 |
T5882 |
det |
the,membrane |
| R3499 |
T5882 |
T5880 |
pobj |
membrane,at |
| R350 |
T1151 |
T1152 |
compound |
TGF,βs |
| R3500 |
T5883 |
T5882 |
compound |
plasma,membrane |
| R3501 |
T5884 |
T5870 |
aux |
may,participate |
| R3502 |
T5885 |
T5870 |
prep |
in,participate |
| R3503 |
T5886 |
T5887 |
det |
a,pathway |
| R3504 |
T5887 |
T5885 |
pobj |
pathway,in |
| R3505 |
T5888 |
T5887 |
compound |
proliferation,pathway |
| R3506 |
T5889 |
T5887 |
compound |
signaling,pathway |
| R3507 |
T5890 |
T5891 |
advmod |
when,deconstructed |
| R3508 |
T5891 |
T5870 |
advcl |
deconstructed,participate |
| R3509 |
T5892 |
T5891 |
nsubjpass |
AJs,deconstructed |
| R351 |
T1152 |
T1147 |
appos |
βs,βs |
| R3510 |
T5893 |
T5891 |
auxpass |
are,deconstructed |
| R3511 |
T5894 |
T5863 |
punct |
.,raised |
| R3512 |
T5896 |
T5897 |
amod |
Numerous,studies |
| R3513 |
T5897 |
T5898 |
nsubj |
studies,correlated |
| R3514 |
T5899 |
T5898 |
aux |
have,correlated |
| R3515 |
T5900 |
T5901 |
det |
a,regulation |
| R3516 |
T5901 |
T5898 |
dobj |
regulation,correlated |
| R3517 |
T5902 |
T5901 |
amod |
down,regulation |
| R3518 |
T5903 |
T5901 |
punct |
-,regulation |
| R3519 |
T5904 |
T5901 |
prep |
of,regulation |
| R352 |
T1153 |
T1152 |
punct |
-,βs |
| R3520 |
T5905 |
T5906 |
compound |
E,cadherin |
| R3521 |
T5906 |
T5904 |
pobj |
cadherin,of |
| R3522 |
T5907 |
T5906 |
punct |
-,cadherin |
| R3523 |
T5908 |
T5898 |
prep |
with,correlated |
| R3524 |
T5909 |
T5910 |
det |
a,translocation |
| R3525 |
T5910 |
T5908 |
pobj |
translocation,with |
| R3526 |
T5911 |
T5910 |
prep |
of,translocation |
| R3527 |
T5912 |
T5913 |
compound |
β,catenin |
| R3528 |
T5913 |
T5911 |
pobj |
catenin,of |
| R3529 |
T5914 |
T5913 |
punct |
-,catenin |
| R353 |
T1154 |
T1137 |
punct |
),Wnts |
| R3530 |
T5915 |
T5910 |
prep |
to,translocation |
| R3531 |
T5916 |
T5917 |
det |
the,nucleus |
| R3532 |
T5917 |
T5915 |
pobj |
nucleus,to |
| R3533 |
T5918 |
T5910 |
cc |
and,translocation |
| R3534 |
T5919 |
T5920 |
det |
a,transactivation |
| R3535 |
T5920 |
T5910 |
conj |
transactivation,translocation |
| R3536 |
T5921 |
T5920 |
prep |
of,transactivation |
| R3537 |
T5922 |
T5921 |
pobj |
genes,of |
| R3538 |
T5923 |
T5924 |
dep |
that,regulated |
| R3539 |
T5924 |
T5922 |
relcl |
regulated,genes |
| R354 |
T1155 |
T1137 |
punct |
", ",Wnts |
| R3540 |
T5925 |
T5924 |
auxpass |
are,regulated |
| R3541 |
T5926 |
T5924 |
agent |
by,regulated |
| R3542 |
T5927 |
T5928 |
det |
the,family |
| R3543 |
T5928 |
T5926 |
pobj |
family,by |
| R3544 |
T5929 |
T5928 |
nmod |
LEF,family |
| R3545 |
T5930 |
T5929 |
punct |
-,LEF |
| R3546 |
T5931 |
T5929 |
nummod |
1,LEF |
| R3547 |
T5932 |
T5929 |
punct |
/,LEF |
| R3548 |
T5933 |
T5934 |
compound |
T,cell |
| R3549 |
T5934 |
T5935 |
compound |
cell,factor |
| R355 |
T1156 |
T1137 |
cc |
and,Wnts |
| R3550 |
T5935 |
T5929 |
appos |
factor,LEF |
| R3551 |
T5936 |
T5935 |
punct |
(,factor |
| R3552 |
T5937 |
T5935 |
appos |
TCF,factor |
| R3553 |
T5938 |
T5928 |
punct |
),family |
| R3554 |
T5939 |
T5928 |
prep |
of,family |
| R3555 |
T5940 |
T5941 |
npadvmod |
DNA,binding |
| R3556 |
T5941 |
T5942 |
amod |
binding,proteins |
| R3557 |
T5942 |
T5939 |
pobj |
proteins,of |
| R3558 |
T5943 |
T5944 |
punct |
[,25 |
| R3559 |
T5944 |
T5898 |
parataxis |
25,correlated |
| R356 |
T1157 |
T1158 |
compound |
fibroblast,factors |
| R3560 |
T5945 |
T5944 |
nummod |
23,25 |
| R3561 |
T5946 |
T5944 |
punct |
",",25 |
| R3562 |
T5947 |
T5944 |
nummod |
24,25 |
| R3563 |
T5948 |
T5944 |
punct |
",",25 |
| R3564 |
T5949 |
T5944 |
punct |
],25 |
| R3565 |
T5950 |
T5898 |
punct |
.,correlated |
| R3566 |
T5952 |
T5953 |
det |
The,presence |
| R3567 |
T5953 |
T5954 |
nsubj |
presence,was |
| R3568 |
T5955 |
T5953 |
prep |
of,presence |
| R3569 |
T5956 |
T5957 |
amod |
nuclear,D |
| R357 |
T1158 |
T1137 |
conj |
factors,Wnts |
| R3570 |
T5957 |
T5955 |
pobj |
D,of |
| R3571 |
T5958 |
T5957 |
compound |
cyclin,D |
| R3572 |
T5959 |
T5953 |
prep |
in,presence |
| R3573 |
T5960 |
T5961 |
amod |
hyperproliferative,epidermis |
| R3574 |
T5961 |
T5959 |
pobj |
epidermis,in |
| R3575 |
T5962 |
T5961 |
compound |
Snail,epidermis |
| R3576 |
T5963 |
T5961 |
compound |
Tg,epidermis |
| R3577 |
T5964 |
T5965 |
advmod |
particularly,intriguing |
| R3578 |
T5965 |
T5954 |
acomp |
intriguing,was |
| R3579 |
T5966 |
T5967 |
mark |
since,reported |
| R358 |
T1159 |
T1158 |
compound |
growth,factors |
| R3580 |
T5967 |
T5954 |
advcl |
reported,was |
| R3581 |
T5968 |
T5969 |
amod |
prior,studies |
| R3582 |
T5969 |
T5967 |
nsubj |
studies,reported |
| R3583 |
T5970 |
T5967 |
aux |
have,reported |
| R3584 |
T5971 |
T5972 |
compound |
cyclin,D |
| R3585 |
T5972 |
T5973 |
compound |
D,gene |
| R3586 |
T5973 |
T5967 |
dobj |
gene,reported |
| R3587 |
T5974 |
T5967 |
prep |
as,reported |
| R3588 |
T5975 |
T5976 |
det |
a,target |
| R3589 |
T5976 |
T5974 |
pobj |
target,as |
| R359 |
T1160 |
T1158 |
punct |
(,factors |
| R3590 |
T5977 |
T5976 |
amod |
direct,target |
| R3591 |
T5978 |
T5976 |
prep |
of,target |
| R3592 |
T5979 |
T5980 |
nmod |
TCF,β |
| R3593 |
T5980 |
T5982 |
nmod |
β,transcription |
| R3594 |
T5981 |
T5980 |
punct |
/,β |
| R3595 |
T5982 |
T5978 |
pobj |
transcription,of |
| R3596 |
T5983 |
T5980 |
punct |
-,β |
| R3597 |
T5984 |
T5980 |
appos |
catenin,β |
| R3598 |
T5985 |
T5986 |
punct |
[,26 |
| R3599 |
T5986 |
T5954 |
parataxis |
26,was |
| R360 |
T1161 |
T1158 |
appos |
FGFs,factors |
| R3600 |
T5987 |
T5986 |
punct |
],26 |
| R3601 |
T5988 |
T5954 |
punct |
.,was |
| R3602 |
T5990 |
T5991 |
nsubj |
This,said |
| R3603 |
T5991 |
T5992 |
advcl |
said,detect |
| R3604 |
T5993 |
T5992 |
punct |
", ",detect |
| R3605 |
T5994 |
T5992 |
nsubj |
we,detect |
| R3606 |
T5995 |
T5992 |
aux |
did,detect |
| R3607 |
T5996 |
T5992 |
neg |
not,detect |
| R3608 |
T5997 |
T5998 |
amod |
nuclear,catenin |
| R3609 |
T5998 |
T5992 |
dobj |
catenin,detect |
| R361 |
T1162 |
T1129 |
punct |
),are |
| R3610 |
T5999 |
T5998 |
compound |
β,catenin |
| R3611 |
T6000 |
T5998 |
punct |
-,catenin |
| R3612 |
T6001 |
T5992 |
prep |
in,detect |
| R3613 |
T6002 |
T6003 |
poss |
our,epidermis |
| R3614 |
T6003 |
T6001 |
pobj |
epidermis,in |
| R3615 |
T6004 |
T6003 |
compound |
Tg,epidermis |
| R3616 |
T6005 |
T5992 |
punct |
", ",detect |
| R3617 |
T6006 |
T5992 |
cc |
and,detect |
| R3618 |
T6007 |
T6008 |
csubj |
mating,gave |
| R3619 |
T6008 |
T5992 |
conj |
gave,detect |
| R362 |
T1163 |
T1129 |
punct |
.,are |
| R3620 |
T6009 |
T6010 |
det |
the,mice |
| R3621 |
T6010 |
T6007 |
dobj |
mice,mating |
| R3622 |
T6011 |
T6010 |
compound |
Snail,mice |
| R3623 |
T6012 |
T6010 |
compound |
Tg,mice |
| R3624 |
T6013 |
T6007 |
prep |
against,mating |
| R3625 |
T6014 |
T6015 |
det |
the,mouse |
| R3626 |
T6015 |
T6013 |
pobj |
mouse,against |
| R3627 |
T6016 |
T6015 |
compound |
TOPGal,mouse |
| R3628 |
T6017 |
T6015 |
compound |
reporter,mouse |
| R3629 |
T6018 |
T6019 |
punct |
[,20 |
| R363 |
T1165 |
T1166 |
prep |
Through,trigger |
| R3630 |
T6019 |
T6007 |
parataxis |
20,mating |
| R3631 |
T6020 |
T6019 |
punct |
],20 |
| R3632 |
T6021 |
T6022 |
det |
no,signs |
| R3633 |
T6022 |
T6008 |
dobj |
signs,gave |
| R3634 |
T6023 |
T6022 |
prep |
of,signs |
| R3635 |
T6024 |
T6025 |
amod |
ectopic,activity |
| R3636 |
T6025 |
T6023 |
pobj |
activity,of |
| R3637 |
T6026 |
T6025 |
nmod |
LEF,activity |
| R3638 |
T6027 |
T6026 |
punct |
-,LEF |
| R3639 |
T6028 |
T6026 |
nummod |
1,LEF |
| R364 |
T1167 |
T1165 |
pobj |
activation,Through |
| R3640 |
T6029 |
T6026 |
punct |
/,LEF |
| R3641 |
T6030 |
T6026 |
appos |
Tcf,LEF |
| R3642 |
T6031 |
T6026 |
punct |
/,LEF |
| R3643 |
T6032 |
T6033 |
compound |
β,catenin |
| R3644 |
T6033 |
T6026 |
appos |
catenin,LEF |
| R3645 |
T6034 |
T6033 |
punct |
-,catenin |
| R3646 |
T6035 |
T6036 |
punct |
(,data |
| R3647 |
T6036 |
T6008 |
meta |
data,gave |
| R3648 |
T6037 |
T6036 |
amod |
unpublished,data |
| R3649 |
T6038 |
T6036 |
punct |
),data |
| R365 |
T1168 |
T1167 |
prep |
of,activation |
| R3650 |
T6039 |
T5992 |
punct |
.,detect |
| R3651 |
T6041 |
T6042 |
nsubj |
We,turned |
| R3652 |
T6043 |
T6042 |
advmod |
next,turned |
| R3653 |
T6044 |
T6042 |
prep |
to,turned |
| R3654 |
T6045 |
T6046 |
det |
the,presence |
| R3655 |
T6093 |
T6091 |
nummod |
2,protein |
| R3656 |
T6046 |
T6044 |
pobj |
presence,to |
| R3657 |
T6094 |
T6091 |
punct |
(,protein |
| R3658 |
T6095 |
T6091 |
appos |
Grb,protein |
| R3659 |
T6047 |
T6046 |
prep |
of,presence |
| R366 |
T1169 |
T1170 |
compound |
cell,surface |
| R3660 |
T6096 |
T6095 |
punct |
-,Grb |
| R3661 |
T6097 |
T6095 |
nummod |
2,Grb |
| R3662 |
T6048 |
T6049 |
amod |
cytoplasmic,Ajuba |
| R3663 |
T6098 |
T6091 |
punct |
),protein |
| R3664 |
T6099 |
T6091 |
punct |
/,protein |
| R3665 |
T6100 |
T6091 |
appos |
son,protein |
| R3666 |
T6049 |
T6047 |
pobj |
Ajuba,of |
| R3667 |
T6101 |
T6100 |
prep |
of,son |
| R3668 |
T6102 |
T6101 |
pobj |
sevenless,of |
| R3669 |
T6103 |
T6100 |
punct |
(,son |
| R367 |
T1170 |
T1171 |
compound |
surface,receptors |
| R3670 |
T6050 |
T6042 |
prep |
for,turned |
| R3671 |
T6104 |
T6100 |
appos |
Sos,son |
| R3672 |
T6105 |
T6091 |
punct |
),protein |
| R3673 |
T6106 |
T6091 |
punct |
", ",protein |
| R3674 |
T6051 |
T6052 |
det |
a,link |
| R3675 |
T6107 |
T6108 |
det |
the,factor |
| R3676 |
T6108 |
T6091 |
appos |
factor,protein |
| R3677 |
T6109 |
T6108 |
compound |
nucleotide,factor |
| R3678 |
T6052 |
T6050 |
pobj |
link,for |
| R3679 |
T6110 |
T6108 |
compound |
exchange,factor |
| R368 |
T1171 |
T1168 |
pobj |
receptors,of |
| R3680 |
T6111 |
T6108 |
prep |
for,factor |
| R3681 |
T6112 |
T6111 |
pobj |
Ras,for |
| R3682 |
T6053 |
T6052 |
amod |
possible,link |
| R3683 |
T6113 |
T6112 |
punct |
", ",Ras |
| R3684 |
T6114 |
T6115 |
dep |
which,is |
| R3685 |
T6115 |
T6112 |
relcl |
is,Ras |
| R3686 |
T6054 |
T6052 |
amod |
mechanistic,link |
| R3687 |
T6116 |
T6115 |
advmod |
upstream,is |
| R3688 |
T6117 |
T6116 |
prep |
from,upstream |
| R3689 |
T6118 |
T6117 |
pobj |
activation,from |
| R369 |
T1172 |
T1171 |
compound |
transmembrane,receptors |
| R3690 |
T6119 |
T6118 |
prep |
of,activation |
| R3691 |
T6055 |
T6052 |
prep |
to,link |
| R3692 |
T6120 |
T6119 |
pobj |
MAPK,of |
| R3693 |
T6121 |
T6122 |
punct |
[,9 |
| R3694 |
T6056 |
T6057 |
det |
the,increase |
| R3695 |
T6122 |
T6067 |
parataxis |
9,associate |
| R3696 |
T6123 |
T6122 |
punct |
],9 |
| R3697 |
T6124 |
T6067 |
punct |
.,associate |
| R3698 |
T6057 |
T6055 |
pobj |
increase,to |
| R3699 |
T6126 |
T6127 |
prep |
Given,examined |
| R370 |
T1173 |
T1166 |
punct |
", ",trigger |
| R3700 |
T6058 |
T6057 |
amod |
proliferative,increase |
| R3701 |
T6128 |
T6129 |
det |
the,increase |
| R3702 |
T6129 |
T6126 |
pobj |
increase,Given |
| R3703 |
T6130 |
T6129 |
prep |
in,increase |
| R3704 |
T6131 |
T6132 |
compound |
pMAPK,staining |
| R3705 |
T6059 |
T6057 |
prep |
in,increase |
| R3706 |
T6132 |
T6130 |
pobj |
staining,in |
| R3707 |
T6060 |
T6061 |
poss |
our,epidermis |
| R3708 |
T6133 |
T6129 |
prep |
in,increase |
| R3709 |
T6134 |
T6135 |
compound |
Tg,skin |
| R371 |
T1174 |
T1175 |
det |
these,molecules |
| R3710 |
T6061 |
T6059 |
pobj |
epidermis,in |
| R3711 |
T6135 |
T6133 |
pobj |
skin,in |
| R3712 |
T6136 |
T6127 |
punct |
", ",examined |
| R3713 |
T6137 |
T6127 |
nsubj |
we,examined |
| R3714 |
T6062 |
T6061 |
compound |
Snail,epidermis |
| R3715 |
T6138 |
T6139 |
det |
the,possibility |
| R3716 |
T6139 |
T6127 |
dobj |
possibility,examined |
| R3717 |
T6140 |
T6141 |
mark |
that,changed |
| R3718 |
T6063 |
T6061 |
compound |
Tg,epidermis |
| R3719 |
T6141 |
T6139 |
acl |
changed,possibility |
| R372 |
T1175 |
T1166 |
nsubj |
molecules,trigger |
| R3720 |
T6142 |
T6141 |
nsubj |
Ajuba,changed |
| R3721 |
T6143 |
T6141 |
aux |
might,changed |
| R3722 |
T6064 |
T6042 |
punct |
.,turned |
| R3723 |
T6144 |
T6141 |
aux |
have,changed |
| R3724 |
T6145 |
T6146 |
poss |
its,partner |
| R3725 |
T6146 |
T6141 |
dobj |
partner,changed |
| R3726 |
T6066 |
T6067 |
prep |
In,associate |
| R3727 |
T6147 |
T6146 |
compound |
binding,partner |
| R3728 |
T6148 |
T6141 |
prep |
in,changed |
| R3729 |
T6149 |
T6150 |
npadvmod |
Snail,expressing |
| R373 |
T1176 |
T1175 |
amod |
external,molecules |
| R3730 |
T6150 |
T6152 |
amod |
expressing,epidermis |
| R3731 |
T6151 |
T6150 |
punct |
-,expressing |
| R3732 |
T6068 |
T6066 |
pobj |
addition,In |
| R3733 |
T6152 |
T6148 |
pobj |
epidermis,in |
| R3734 |
T6153 |
T6127 |
punct |
.,examined |
| R3735 |
T6155 |
T6156 |
advmod |
Interestingly,detected |
| R3736 |
T6069 |
T6068 |
prep |
to,addition |
| R3737 |
T6157 |
T6156 |
punct |
", ",detected |
| R3738 |
T6070 |
T6071 |
poss |
its,ability |
| R3739 |
T6158 |
T6156 |
nsubjpass |
Ajuba,detected |
| R374 |
T1177 |
T1175 |
compound |
signaling,molecules |
| R3740 |
T6159 |
T6156 |
auxpass |
was,detected |
| R3741 |
T6160 |
T6156 |
advmod |
readily,detected |
| R3742 |
T6071 |
T6069 |
pobj |
ability,to |
| R3743 |
T6161 |
T6156 |
prep |
in,detected |
| R3744 |
T6162 |
T6163 |
amod |
anti-Grb,immunoprecipitates |
| R3745 |
T6163 |
T6161 |
pobj |
immunoprecipitates,in |
| R3746 |
T6072 |
T6071 |
amod |
documented,ability |
| R3747 |
T6164 |
T6162 |
punct |
-,anti-Grb |
| R3748 |
T6165 |
T6162 |
advmod |
2,anti-Grb |
| R3749 |
T6073 |
T6074 |
aux |
to,bind |
| R375 |
T1178 |
T1179 |
amod |
distinct,cascades |
| R3750 |
T6166 |
T6163 |
prep |
of,immunoprecipitates |
| R3751 |
T6167 |
T6168 |
compound |
protein,lysates |
| R3752 |
T6168 |
T6166 |
pobj |
lysates,of |
| R3753 |
T6074 |
T6071 |
acl |
bind,ability |
| R3754 |
T6169 |
T6168 |
prep |
from,lysates |
| R3755 |
T6170 |
T6169 |
pobj |
skins,from |
| R3756 |
T6171 |
T6170 |
prep |
of,skins |
| R3757 |
T6075 |
T6076 |
compound |
α,catenin |
| R3758 |
T6172 |
T6173 |
compound |
Snail,mice |
| R3759 |
T6173 |
T6171 |
pobj |
mice,of |
| R376 |
T1179 |
T1166 |
dobj |
cascades,trigger |
| R3760 |
T6076 |
T6074 |
dobj |
catenin,bind |
| R3761 |
T6174 |
T6173 |
compound |
Tg,mice |
| R3762 |
T6175 |
T6169 |
cc |
but,from |
| R3763 |
T6176 |
T6175 |
neg |
not,but |
| R3764 |
T6077 |
T6076 |
punct |
-,catenin |
| R3765 |
T6177 |
T6169 |
conj |
from,from |
| R3766 |
T6178 |
T6179 |
det |
the,animals |
| R3767 |
T6078 |
T6079 |
punct |
[,10 |
| R3768 |
T6179 |
T6177 |
pobj |
animals,from |
| R3769 |
T6180 |
T6179 |
amod |
corresponding,animals |
| R377 |
T1180 |
T1179 |
prep |
of,cascades |
| R3770 |
T6181 |
T6182 |
amod |
wild,type |
| R3771 |
T6079 |
T6068 |
parataxis |
10,addition |
| R3772 |
T6182 |
T6179 |
nmod |
type,animals |
| R3773 |
T6183 |
T6182 |
punct |
-,type |
| R3774 |
T6184 |
T6182 |
punct |
(,type |
| R3775 |
T6080 |
T6079 |
punct |
],10 |
| R3776 |
T6185 |
T6182 |
appos |
WT,type |
| R3777 |
T6186 |
T6179 |
punct |
),animals |
| R3778 |
T6081 |
T6067 |
punct |
", ",associate |
| R3779 |
T6187 |
T6188 |
punct |
(,4E |
| R378 |
T1181 |
T1182 |
amod |
intracellular,events |
| R3780 |
T6188 |
T6156 |
parataxis |
4E,detected |
| R3781 |
T6189 |
T6188 |
compound |
Figure,4E |
| R3782 |
T6082 |
T6067 |
nsubj |
Ajuba,associate |
| R3783 |
T6190 |
T6188 |
punct |
),4E |
| R3784 |
T6191 |
T6156 |
punct |
.,detected |
| R3785 |
T6083 |
T6067 |
aux |
can,associate |
| R3786 |
T6193 |
T6194 |
advmod |
When,repeated |
| R3787 |
T6194 |
T6198 |
advcl |
repeated,detected |
| R3788 |
T6195 |
T6196 |
det |
these,experiments |
| R3789 |
T6084 |
T6067 |
advmod |
also,associate |
| R379 |
T1182 |
T1180 |
pobj |
events,of |
| R3790 |
T6196 |
T6194 |
nsubjpass |
experiments,repeated |
| R3791 |
T6197 |
T6194 |
auxpass |
were,repeated |
| R3792 |
T6085 |
T6067 |
prep |
with,associate |
| R3793 |
T6086 |
T6087 |
compound |
growth,factor |
| R3794 |
T6087 |
T6088 |
compound |
factor,receptor |
| R3795 |
T6199 |
T6194 |
prep |
with,repeated |
| R3796 |
T6088 |
T6089 |
npadvmod |
receptor,bound |
| R3797 |
T6200 |
T6201 |
compound |
α,catenin |
| R3798 |
T6201 |
T6203 |
npadvmod |
catenin,null |
| R3799 |
T6202 |
T6201 |
punct |
-,catenin |
| R380 |
T1183 |
T1184 |
dep |
that,culminate |
| R3800 |
T6089 |
T6091 |
amod |
bound,protein |
| R3801 |
T6203 |
T6205 |
amod |
null,epidermis |
| R3802 |
T6204 |
T6203 |
punct |
-,null |
| R3803 |
T6205 |
T6199 |
pobj |
epidermis,with |
| R3804 |
T6090 |
T6089 |
punct |
-,bound |
| R3805 |
T6206 |
T6198 |
punct |
", ",detected |
| R3806 |
T6207 |
T6208 |
det |
a,association |
| R3807 |
T6208 |
T6198 |
nsubjpass |
association,detected |
| R3808 |
T6209 |
T6208 |
amod |
similar,association |
| R3809 |
T6210 |
T6211 |
nmod |
Grb,Ajuba |
| R381 |
T1184 |
T1179 |
relcl |
culminate,cascades |
| R3810 |
T6211 |
T6208 |
compound |
Ajuba,association |
| R3811 |
T6091 |
T6085 |
pobj |
protein,with |
| R3812 |
T6212 |
T6211 |
punct |
-,Ajuba |
| R3813 |
T6213 |
T6211 |
nummod |
2,Ajuba |
| R3814 |
T6214 |
T6211 |
punct |
-,Ajuba |
| R3815 |
T6215 |
T6198 |
auxpass |
was,detected |
| R3816 |
T6092 |
T6091 |
punct |
-,protein |
| R3817 |
T6216 |
T6198 |
punct |
", ",detected |
| R3818 |
T6217 |
T6198 |
cc |
and,detected |
| R3819 |
T6218 |
T6219 |
advmod |
again,detected |
| R382 |
T1185 |
T1184 |
prep |
in,culminate |
| R3820 |
T6303 |
T6286 |
acomp |
relevant,is |
| R3821 |
T6219 |
T6198 |
conj |
detected,detected |
| R3822 |
T6220 |
T6219 |
punct |
", ",detected |
| R3823 |
T6221 |
T6222 |
det |
this,interaction |
| R3824 |
T6222 |
T6219 |
nsubjpass |
interaction,detected |
| R3825 |
T6223 |
T6219 |
auxpass |
was,detected |
| R3826 |
T6304 |
T6303 |
prep |
to,relevant |
| R3827 |
T6224 |
T6219 |
neg |
not,detected |
| R3828 |
T6225 |
T6219 |
prep |
in,detected |
| R3829 |
T6226 |
T6227 |
det |
the,extracts |
| R383 |
T1186 |
T1185 |
pobj |
changes,in |
| R3830 |
T6227 |
T6225 |
pobj |
extracts,in |
| R3831 |
T6305 |
T6306 |
det |
the,state |
| R3832 |
T6228 |
T6227 |
compound |
protein,extracts |
| R3833 |
T6229 |
T6227 |
prep |
from,extracts |
| R3834 |
T6230 |
T6231 |
compound |
control,skin |
| R3835 |
T6306 |
T6304 |
pobj |
state,to |
| R3836 |
T6231 |
T6229 |
pobj |
skin,from |
| R3837 |
T6232 |
T6231 |
compound |
littermate,skin |
| R3838 |
T6233 |
T6234 |
punct |
(,4E |
| R3839 |
T6307 |
T6306 |
amod |
hyperproliferative,state |
| R384 |
T1187 |
T1186 |
prep |
in,changes |
| R3840 |
T6234 |
T6219 |
parataxis |
4E,detected |
| R3841 |
T6235 |
T6234 |
compound |
Figure,4E |
| R3842 |
T6236 |
T6234 |
punct |
),4E |
| R3843 |
T6308 |
T6306 |
prep |
of,state |
| R3844 |
T6237 |
T6198 |
punct |
.,detected |
| R3845 |
T6239 |
T6240 |
advmod |
Together,demonstrate |
| R3846 |
T6309 |
T6310 |
det |
a,keratinocyte |
| R3847 |
T6241 |
T6240 |
punct |
", ",demonstrate |
| R3848 |
T6242 |
T6243 |
det |
these,data |
| R3849 |
T6243 |
T6240 |
nsubj |
data,demonstrate |
| R385 |
T1188 |
T1189 |
compound |
gene,expression |
| R3850 |
T6310 |
T6308 |
pobj |
keratinocyte,of |
| R3851 |
T6244 |
T6245 |
mark |
that,allows |
| R3852 |
T6311 |
T6301 |
punct |
", ",expected |
| R3853 |
T6245 |
T6240 |
ccomp |
allows,demonstrate |
| R3854 |
T6246 |
T6247 |
det |
the,reduction |
| R3855 |
T6312 |
T6301 |
advmod |
then,expected |
| R3856 |
T6247 |
T6245 |
nsubj |
reduction,allows |
| R3857 |
T6248 |
T6247 |
prep |
in,reduction |
| R3858 |
T6249 |
T6250 |
compound |
α,catenin |
| R3859 |
T6250 |
T6252 |
compound |
catenin,levels |
| R386 |
T1189 |
T1187 |
pobj |
expression,in |
| R3860 |
T6251 |
T6250 |
punct |
-,catenin |
| R3861 |
T6252 |
T6248 |
pobj |
levels,in |
| R3862 |
T6253 |
T6247 |
punct |
", ",reduction |
| R3863 |
T6313 |
T6301 |
nsubjpass |
overexpression,expected |
| R3864 |
T6254 |
T6255 |
preconj |
either,by |
| R3865 |
T6255 |
T6247 |
prep |
by,reduction |
| R3866 |
T6256 |
T6257 |
npadvmod |
Snail,mediated |
| R3867 |
T6314 |
T6313 |
prep |
of,overexpression |
| R3868 |
T6257 |
T6259 |
amod |
mediated,regulation |
| R3869 |
T6258 |
T6257 |
punct |
-,mediated |
| R387 |
T1190 |
T1189 |
punct |
", ",expression |
| R3870 |
T6259 |
T6255 |
pobj |
regulation,by |
| R3871 |
T6315 |
T6314 |
pobj |
Ajuba,of |
| R3872 |
T6260 |
T6259 |
amod |
down,regulation |
| R3873 |
T6261 |
T6259 |
punct |
-,regulation |
| R3874 |
T6262 |
T6259 |
prep |
of,regulation |
| R3875 |
T6316 |
T6301 |
aux |
would,expected |
| R3876 |
T6263 |
T6264 |
compound |
E,cadherin |
| R3877 |
T6264 |
T6262 |
pobj |
cadherin,of |
| R3878 |
T6265 |
T6264 |
punct |
-,cadherin |
| R3879 |
T6317 |
T6301 |
auxpass |
be,expected |
| R388 |
T1191 |
T1189 |
conj |
growth,expression |
| R3880 |
T6266 |
T6255 |
cc |
or,by |
| R3881 |
T6267 |
T6255 |
conj |
by,by |
| R3882 |
T6268 |
T6269 |
compound |
α,catenin |
| R3883 |
T6318 |
T6319 |
aux |
to,bypass |
| R3884 |
T6269 |
T6271 |
npadvmod |
catenin,conditional |
| R3885 |
T6270 |
T6269 |
punct |
-,catenin |
| R3886 |
T6271 |
T6272 |
amod |
conditional,targeting |
| R3887 |
T6319 |
T6301 |
xcomp |
bypass,expected |
| R3888 |
T6272 |
T6267 |
pobj |
targeting,by |
| R3889 |
T6273 |
T6245 |
punct |
", ",allows |
| R389 |
T1192 |
T1191 |
punct |
", ",growth |
| R3890 |
T6274 |
T6275 |
nsubj |
Ajuba,interact |
| R3891 |
T6320 |
T6321 |
det |
the,competition |
| R3892 |
T6275 |
T6245 |
ccomp |
interact,allows |
| R3893 |
T6276 |
T6275 |
aux |
to,interact |
| R3894 |
T6277 |
T6275 |
prep |
with,interact |
| R3895 |
T6321 |
T6319 |
dobj |
competition,bypass |
| R3896 |
T6278 |
T6277 |
pobj |
Grb,with |
| R3897 |
T6279 |
T6278 |
punct |
-,Grb |
| R3898 |
T6280 |
T6278 |
nummod |
2,Grb |
| R3899 |
T6281 |
T6278 |
punct |
/,Grb |
| R390 |
T1193 |
T1191 |
cc |
and,growth |
| R3900 |
T6322 |
T6319 |
cc |
and,bypass |
| R3901 |
T6282 |
T6278 |
appos |
Sos,Grb |
| R3902 |
T6283 |
T6240 |
punct |
.,demonstrate |
| R3903 |
T6323 |
T6319 |
conj |
promote,bypass |
| R3904 |
T6285 |
T6286 |
mark |
If,is |
| R3905 |
T6286 |
T6301 |
advcl |
is,expected |
| R3906 |
T6287 |
T6288 |
det |
the,competition |
| R3907 |
T6324 |
T6323 |
dobj |
activation,promote |
| R3908 |
T6288 |
T6286 |
nsubj |
competition,is |
| R3909 |
T6289 |
T6288 |
prep |
between,competition |
| R391 |
T1194 |
T1191 |
conj |
differentiation,growth |
| R3910 |
T6290 |
T6289 |
pobj |
Grb,between |
| R3911 |
T6291 |
T6290 |
punct |
-,Grb |
| R3912 |
T6292 |
T6290 |
nummod |
2,Grb |
| R3913 |
T6293 |
T6290 |
punct |
/,Grb |
| R3914 |
T6294 |
T6290 |
appos |
Sos,Grb |
| R3915 |
T6325 |
T6324 |
prep |
of,activation |
| R3916 |
T6295 |
T6290 |
cc |
and,Grb |
| R3917 |
T6296 |
T6297 |
compound |
α,catenin |
| R3918 |
T6297 |
T6290 |
conj |
catenin,Grb |
| R3919 |
T6326 |
T6327 |
det |
the,pathway |
| R392 |
T1195 |
T1196 |
punct |
[,2 |
| R3920 |
T6298 |
T6297 |
punct |
-,catenin |
| R3921 |
T6299 |
T6288 |
prep |
for,competition |
| R3922 |
T6300 |
T6299 |
pobj |
Ajuba,for |
| R3923 |
T6327 |
T6325 |
pobj |
pathway,of |
| R3924 |
T6302 |
T6303 |
advmod |
functionally,relevant |
| R3925 |
T6328 |
T6329 |
compound |
Ras,MAPK |
| R3926 |
T6329 |
T6327 |
compound |
MAPK,pathway |
| R3927 |
T6330 |
T6329 |
punct |
-,MAPK |
| R3928 |
T6331 |
T6324 |
prep |
in,activation |
| R3929 |
T6409 |
T6407 |
oprd |
inh,marked |
| R393 |
T1196 |
T1166 |
parataxis |
2,trigger |
| R3930 |
T6410 |
T6405 |
punct |
”,see |
| R3931 |
T6332 |
T6333 |
compound |
WT,keratinocytes |
| R3932 |
T6411 |
T6402 |
punct |
),4F |
| R3933 |
T6412 |
T6413 |
punct |
[,27 |
| R3934 |
T6413 |
T6380 |
parataxis |
27,abolished |
| R3935 |
T6333 |
T6331 |
pobj |
keratinocytes,in |
| R3936 |
T6414 |
T6413 |
punct |
],27 |
| R3937 |
T6415 |
T6380 |
punct |
.,abolished |
| R3938 |
T6334 |
T6301 |
punct |
.,expected |
| R3939 |
T6417 |
T6418 |
poss |
Ajuba,domain |
| R394 |
T1197 |
T1196 |
punct |
],2 |
| R3940 |
T6418 |
T6421 |
nsubj |
domain,is |
| R3941 |
T6419 |
T6417 |
case |
's,Ajuba |
| R3942 |
T6336 |
T6337 |
advmod |
Indeed,were |
| R3943 |
T6420 |
T6418 |
amod |
pre-LIM,domain |
| R3944 |
T6422 |
T6423 |
det |
the,segment |
| R3945 |
T6423 |
T6421 |
attr |
segment,is |
| R3946 |
T6338 |
T6337 |
punct |
", ",were |
| R3947 |
T6424 |
T6425 |
dep |
that,associates |
| R3948 |
T6339 |
T6340 |
advmod |
when,transfected |
| R3949 |
T6425 |
T6423 |
relcl |
associates,segment |
| R395 |
T1198 |
T1166 |
punct |
.,trigger |
| R3950 |
T6426 |
T6425 |
prep |
with,associates |
| R3951 |
T6340 |
T6337 |
advcl |
transfected,were |
| R3952 |
T6427 |
T6428 |
poss |
Grb,domain |
| R3953 |
T6428 |
T6426 |
pobj |
domain,with |
| R3954 |
T6429 |
T6427 |
punct |
-,Grb |
| R3955 |
T6341 |
T6342 |
npadvmod |
serum,starved |
| R3956 |
T6430 |
T6427 |
nummod |
2,Grb |
| R3957 |
T6431 |
T6427 |
case |
's,Grb |
| R3958 |
T6432 |
T6433 |
nmod |
Src,homology |
| R3959 |
T6433 |
T6428 |
nmod |
homology,domain |
| R396 |
T1200 |
T1201 |
advmod |
How,collaborates |
| R3960 |
T6342 |
T6344 |
amod |
starved,keratinocytes |
| R3961 |
T6434 |
T6433 |
punct |
-,homology |
| R3962 |
T6435 |
T6433 |
nummod |
3,homology |
| R3963 |
T6436 |
T6437 |
punct |
[,9 |
| R3964 |
T6437 |
T6421 |
parataxis |
9,is |
| R3965 |
T6438 |
T6437 |
punct |
],9 |
| R3966 |
T6439 |
T6421 |
punct |
.,is |
| R3967 |
T6343 |
T6342 |
punct |
-,starved |
| R3968 |
T6441 |
T6442 |
advmod |
When,overexpressed |
| R3969 |
T6442 |
T6446 |
advcl |
overexpressed,observed |
| R397 |
T1201 |
T1206 |
csubj |
collaborates,has |
| R3970 |
T6344 |
T6340 |
nsubjpass |
keratinocytes,transfected |
| R3971 |
T6443 |
T6444 |
det |
this,domain |
| R3972 |
T6444 |
T6442 |
nsubjpass |
domain,overexpressed |
| R3973 |
T6445 |
T6442 |
auxpass |
was,overexpressed |
| R3974 |
T6345 |
T6340 |
auxpass |
were,transfected |
| R3975 |
T6447 |
T6442 |
prep |
in,overexpressed |
| R3976 |
T6448 |
T6449 |
npadvmod |
serum,starved |
| R3977 |
T6346 |
T6340 |
advmod |
transiently,transfected |
| R3978 |
T6449 |
T6451 |
amod |
starved,keratinocytes |
| R3979 |
T6450 |
T6449 |
punct |
-,starved |
| R398 |
T1202 |
T1203 |
det |
this,constellation |
| R3980 |
T6451 |
T6447 |
pobj |
keratinocytes,in |
| R3981 |
T6347 |
T6340 |
prep |
with,transfected |
| R3982 |
T6452 |
T6446 |
punct |
", ",observed |
| R3983 |
T6453 |
T6454 |
det |
a,elevation |
| R3984 |
T6454 |
T6446 |
nsubjpass |
elevation,observed |
| R3985 |
T6348 |
T6349 |
det |
an,vector |
| R3986 |
T6455 |
T6454 |
amod |
comparable,elevation |
| R3987 |
T6456 |
T6454 |
prep |
in,elevation |
| R3988 |
T6457 |
T6456 |
pobj |
pMAPK,in |
| R3989 |
T6458 |
T6446 |
auxpass |
was,observed |
| R399 |
T1203 |
T1201 |
nsubj |
constellation,collaborates |
| R3990 |
T6349 |
T6347 |
pobj |
vector,with |
| R3991 |
T6459 |
T6460 |
punct |
(,4F |
| R3992 |
T6460 |
T6446 |
parataxis |
4F,observed |
| R3993 |
T6461 |
T6460 |
compound |
Figure,4F |
| R3994 |
T6350 |
T6351 |
compound |
Ajuba,expression |
| R3995 |
T6462 |
T6460 |
punct |
),4F |
| R3996 |
T6463 |
T6446 |
punct |
.,observed |
| R3997 |
T6351 |
T6349 |
compound |
expression,vector |
| R3998 |
T6465 |
T6466 |
mark |
As,expected |
| R3999 |
T6466 |
T6467 |
advcl |
expected,blocked |
| R400 |
T1204 |
T1203 |
prep |
of,constellation |
| R4000 |
T6352 |
T6337 |
punct |
", ",were |
| R4001 |
T6468 |
T6467 |
punct |
", ",blocked |
| R4002 |
T6469 |
T6470 |
det |
the,inhibitor |
| R4003 |
T6470 |
T6467 |
nsubj |
inhibitor,blocked |
| R4004 |
T6471 |
T6470 |
amod |
small,inhibitor |
| R4005 |
T6353 |
T6354 |
det |
the,levels |
| R4006 |
T6472 |
T6470 |
compound |
peptide,inhibitor |
| R4007 |
T6473 |
T6474 |
dep |
that,interrupts |
| R4008 |
T6474 |
T6470 |
relcl |
interrupts,inhibitor |
| R4009 |
T6354 |
T6337 |
nsubj |
levels,were |
| R401 |
T1205 |
T1204 |
pobj |
signals,of |
| R4010 |
T6475 |
T6476 |
det |
the,association |
| R4011 |
T6476 |
T6474 |
dobj |
association,interrupts |
| R4012 |
T6477 |
T6476 |
nmod |
Grb,association |
| R4013 |
T6478 |
T6477 |
punct |
-,Grb |
| R4014 |
T6479 |
T6477 |
nummod |
2,Grb |
| R4015 |
T6355 |
T6354 |
prep |
of,levels |
| R4016 |
T6480 |
T6477 |
punct |
/,Grb |
| R4017 |
T6481 |
T6477 |
appos |
Sos,Grb |
| R4018 |
T6482 |
T6483 |
det |
the,effects |
| R4019 |
T6483 |
T6467 |
dobj |
effects,blocked |
| R402 |
T1207 |
T1201 |
prep |
in,collaborates |
| R4020 |
T6356 |
T6355 |
pobj |
pMAPK,of |
| R4021 |
T6484 |
T6467 |
punct |
.,blocked |
| R4022 |
T6486 |
T6487 |
det |
These,data |
| R4023 |
T6357 |
T6358 |
preconj |
not,elevated |
| R4024 |
T6487 |
T6488 |
nsubj |
data,suggested |
| R4025 |
T6489 |
T6490 |
mark |
that,associate |
| R4026 |
T6358 |
T6337 |
acomp |
elevated,were |
| R4027 |
T6490 |
T6488 |
ccomp |
associate,suggested |
| R4028 |
T6491 |
T6490 |
prep |
by,associate |
| R4029 |
T6492 |
T6491 |
pcomp |
elevating,by |
| R403 |
T1208 |
T1207 |
pcomp |
tailoring,in |
| R4030 |
T6493 |
T6494 |
amod |
cytosolic,levels |
| R4031 |
T6359 |
T6357 |
advmod |
only,not |
| R4032 |
T6494 |
T6492 |
dobj |
levels,elevating |
| R4033 |
T6495 |
T6494 |
compound |
Ajuba,levels |
| R4034 |
T6496 |
T6490 |
punct |
", ",associate |
| R4035 |
T6360 |
T6358 |
cc |
but,elevated |
| R4036 |
T6497 |
T6498 |
poss |
Ajuba,domain |
| R4037 |
T6498 |
T6490 |
nsubj |
domain,associate |
| R4038 |
T6499 |
T6497 |
case |
's,Ajuba |
| R4039 |
T6500 |
T6498 |
amod |
pre-LIM,domain |
| R404 |
T1209 |
T1210 |
det |
each,process |
| R4040 |
T6361 |
T6360 |
advmod |
also,but |
| R4041 |
T6501 |
T6490 |
aux |
may,associate |
| R4042 |
T6502 |
T6490 |
prep |
with,associate |
| R4043 |
T6503 |
T6502 |
pobj |
Grb,with |
| R4044 |
T6362 |
T6358 |
conj |
comparable,elevated |
| R4045 |
T6504 |
T6503 |
punct |
-,Grb |
| R4046 |
T6505 |
T6503 |
nummod |
2,Grb |
| R4047 |
T6506 |
T6503 |
punct |
/,Grb |
| R4048 |
T6363 |
T6362 |
prep |
to,comparable |
| R4049 |
T6507 |
T6503 |
appos |
Sos,Grb |
| R405 |
T1210 |
T1208 |
dobj |
process,tailoring |
| R4050 |
T6508 |
T6490 |
prep |
in,associate |
| R4051 |
T6509 |
T6510 |
det |
a,manner |
| R4052 |
T6364 |
T6363 |
pobj |
those,to |
| R4053 |
T6510 |
T6508 |
pobj |
manner,in |
| R4054 |
T6511 |
T6512 |
dep |
that,stimulates |
| R4055 |
T6365 |
T6364 |
acl |
transfected,those |
| R4056 |
T6512 |
T6510 |
relcl |
stimulates,manner |
| R4057 |
T6513 |
T6514 |
poss |
its,activity |
| R4058 |
T6366 |
T6365 |
prep |
with,transfected |
| R4059 |
T6367 |
T6368 |
det |
the,transgene |
| R406 |
T1211 |
T1210 |
compound |
budding,process |
| R4060 |
T6368 |
T6366 |
pobj |
transgene,with |
| R4061 |
T6514 |
T6512 |
dobj |
activity,stimulates |
| R4062 |
T6515 |
T6514 |
compound |
nucleotide,activity |
| R4063 |
T6516 |
T6514 |
compound |
exchange,activity |
| R4064 |
T6369 |
T6370 |
compound |
K14,HASnail |
| R4065 |
T6517 |
T6512 |
cc |
and,stimulates |
| R4066 |
T6518 |
T6512 |
conj |
leads,stimulates |
| R4067 |
T6370 |
T6368 |
compound |
HASnail,transgene |
| R4068 |
T6519 |
T6518 |
prep |
to,leads |
| R4069 |
T6520 |
T6519 |
pobj |
activation,to |
| R407 |
T1212 |
T1213 |
mark |
so,executes |
| R4070 |
T6521 |
T6520 |
prep |
of,activation |
| R4071 |
T6371 |
T6370 |
punct |
-,HASnail |
| R4072 |
T6522 |
T6523 |
det |
the,pathway |
| R4073 |
T6523 |
T6521 |
pobj |
pathway,of |
| R4074 |
T6524 |
T6525 |
compound |
Ras,MAPK |
| R4075 |
T6372 |
T6373 |
punct |
(,4F |
| R4076 |
T6525 |
T6523 |
compound |
MAPK,pathway |
| R4077 |
T6526 |
T6525 |
punct |
-,MAPK |
| R4078 |
T6527 |
T6488 |
punct |
.,suggested |
| R4079 |
T6373 |
T6337 |
parataxis |
4F,were |
| R408 |
T1213 |
T1208 |
advcl |
executes,tailoring |
| R4080 |
T6529 |
T6530 |
mark |
Although,provides |
| R4081 |
T6530 |
T6533 |
advcl |
provides,known |
| R4082 |
T6374 |
T6373 |
compound |
Figure,4F |
| R4083 |
T6531 |
T6532 |
det |
this,pathway |
| R4084 |
T6532 |
T6530 |
nsubj |
pathway,provides |
| R4085 |
T6375 |
T6373 |
punct |
),4F |
| R4086 |
T6534 |
T6535 |
nummod |
one,mechanism |
| R4087 |
T6535 |
T6530 |
dobj |
mechanism,provides |
| R4088 |
T6536 |
T6537 |
prep |
by,coupled |
| R4089 |
T6537 |
T6535 |
relcl |
coupled,mechanism |
| R409 |
T1214 |
T1213 |
mark |
that,executes |
| R4090 |
T6376 |
T6337 |
punct |
.,were |
| R4091 |
T6538 |
T6536 |
pobj |
which,by |
| R4092 |
T6539 |
T6540 |
compound |
Snail,expression |
| R4093 |
T6540 |
T6537 |
nsubjpass |
expression,coupled |
| R4094 |
T6378 |
T6379 |
det |
This,activation |
| R4095 |
T6541 |
T6540 |
cc |
and,expression |
| R4096 |
T6542 |
T6540 |
conj |
proliferation,expression |
| R4097 |
T6543 |
T6537 |
aux |
may,coupled |
| R4098 |
T6544 |
T6537 |
auxpass |
be,coupled |
| R4099 |
T6379 |
T6380 |
nsubjpass |
activation,abolished |
| R410 |
T1215 |
T1213 |
nsubj |
it,executes |
| R4100 |
T6545 |
T6537 |
prep |
in,coupled |
| R4101 |
T6546 |
T6547 |
compound |
skin,epithelium |
| R4102 |
T6547 |
T6545 |
pobj |
epithelium,in |
| R4103 |
T6381 |
T6380 |
auxpass |
was,abolished |
| R4104 |
T6548 |
T6533 |
punct |
", ",known |
| R4105 |
T6549 |
T6550 |
amod |
proliferative,circuitries |
| R4106 |
T6550 |
T6533 |
nsubjpass |
circuitries,known |
| R4107 |
T6551 |
T6550 |
acl |
involving,circuitries |
| R4108 |
T6382 |
T6383 |
advmod |
when,treated |
| R4109 |
T6552 |
T6551 |
dobj |
AJs,involving |
| R411 |
T1216 |
T1217 |
det |
a,program |
| R4110 |
T6553 |
T6533 |
auxpass |
are,known |
| R4111 |
T6554 |
T6555 |
aux |
to,be |
| R4112 |
T6555 |
T6533 |
xcomp |
be,known |
| R4113 |
T6383 |
T6380 |
advcl |
treated,abolished |
| R4114 |
T6556 |
T6555 |
acomp |
complex,be |
| R4115 |
T6557 |
T6556 |
cc |
and,complex |
| R4116 |
T6558 |
T6559 |
advmod |
often,interwoven |
| R4117 |
T6559 |
T6556 |
conj |
interwoven,complex |
| R4118 |
T6560 |
T6533 |
punct |
.,known |
| R4119 |
T6384 |
T6383 |
nsubjpass |
cells,treated |
| R412 |
T1217 |
T1213 |
dobj |
program,executes |
| R4120 |
T6562 |
T6563 |
amod |
Future,studies |
| R4121 |
T6563 |
T6564 |
nsubjpass |
studies,needed |
| R4122 |
T6385 |
T6383 |
auxpass |
were,treated |
| R4123 |
T6565 |
T6564 |
aux |
will,needed |
| R4124 |
T6566 |
T6564 |
auxpass |
be,needed |
| R4125 |
T6567 |
T6568 |
aux |
to,dissect |
| R4126 |
T6386 |
T6383 |
prep |
with,treated |
| R4127 |
T6568 |
T6564 |
advcl |
dissect,needed |
| R4128 |
T6569 |
T6568 |
advmod |
systematically,dissect |
| R4129 |
T6570 |
T6571 |
det |
these,intricacies |
| R413 |
T1218 |
T1217 |
amod |
distinct,program |
| R4130 |
T6387 |
T6388 |
det |
a,inhibitor |
| R4131 |
T6571 |
T6568 |
dobj |
intricacies,dissect |
| R4132 |
T6572 |
T6571 |
amod |
putative,intricacies |
| R4133 |
T6573 |
T6568 |
prep |
at,dissect |
| R4134 |
T6388 |
T6386 |
pobj |
inhibitor,with |
| R4135 |
T6574 |
T6575 |
det |
a,level |
| R4136 |
T6575 |
T6573 |
pobj |
level,at |
| R4137 |
T6576 |
T6575 |
amod |
molecular,level |
| R4138 |
T6389 |
T6388 |
amod |
small,inhibitor |
| R4139 |
T6577 |
T6564 |
punct |
.,needed |
| R414 |
T1219 |
T1217 |
amod |
morphogenetic,program |
| R4140 |
T6390 |
T6388 |
compound |
peptide,inhibitor |
| R4141 |
T6391 |
T6392 |
dep |
that,interrupts |
| R4142 |
T6392 |
T6388 |
relcl |
interrupts,inhibitor |
| R4143 |
T6393 |
T6392 |
advmod |
specifically,interrupts |
| R4144 |
T6394 |
T6395 |
det |
the,interaction |
| R4145 |
T6395 |
T6392 |
dobj |
interaction,interrupts |
| R4146 |
T6396 |
T6395 |
nmod |
Grb,interaction |
| R4147 |
T6397 |
T6396 |
punct |
-,Grb |
| R4148 |
T6398 |
T6396 |
nummod |
2,Grb |
| R4149 |
T6399 |
T6396 |
punct |
/,Grb |
| R415 |
T1220 |
T1221 |
advmod |
yet,defined |
| R4150 |
T6400 |
T6396 |
appos |
Sos,Grb |
| R4151 |
T6401 |
T6402 |
punct |
(,4F |
| R4152 |
T6402 |
T6380 |
parataxis |
4F,abolished |
| R4153 |
T6403 |
T6402 |
compound |
Figure,4F |
| R4154 |
T6404 |
T6402 |
punct |
;,4F |
| R4155 |
T6405 |
T6402 |
advcl |
see,4F |
| R4156 |
T6406 |
T6405 |
dobj |
lanes,see |
| R4157 |
T6407 |
T6406 |
acl |
marked,lanes |
| R4158 |
T6408 |
T6409 |
punct |
“,inh |
| R416 |
T1221 |
T1206 |
xcomp |
defined,has |
| R417 |
T1222 |
T1221 |
aux |
to,defined |
| R4172 |
T7354 |
T7355 |
csubj |
Probing,Reveals |
| R4173 |
T7356 |
T7357 |
det |
the,Regulation |
| R4174 |
T7357 |
T7354 |
dobj |
Regulation,Probing |
| R4175 |
T7358 |
T7357 |
prep |
of,Regulation |
| R4176 |
T7359 |
T7360 |
compound |
Snail,Gene |
| R4177 |
T7360 |
T7361 |
compound |
Gene,Expression |
| R4178 |
T7361 |
T7358 |
pobj |
Expression,of |
| R4179 |
T7362 |
T7363 |
det |
an,Link |
| R418 |
T1223 |
T1221 |
auxpass |
be,defined |
| R4180 |
T7363 |
T7355 |
dobj |
Link,Reveals |
| R4181 |
T7364 |
T7363 |
amod |
Essential,Link |
| R4182 |
T7365 |
T7363 |
prep |
to,Link |
| R4183 |
T7366 |
T7367 |
compound |
TGF,β2 |
| R4184 |
T7367 |
T7369 |
compound |
β2,Signaling |
| R4185 |
T7368 |
T7367 |
punct |
-,β2 |
| R4186 |
T7369 |
T7365 |
pobj |
Signaling,to |
| R4187 |
T7370 |
T7355 |
prep |
in,Reveals |
| R4188 |
T7371 |
T7372 |
det |
the,Bud |
| R4189 |
T7372 |
T7370 |
pobj |
Bud,in |
| R419 |
T1224 |
T1221 |
advmod |
comprehensively,defined |
| R4190 |
T7373 |
T7372 |
amod |
Developing,Bud |
| R4191 |
T7374 |
T7372 |
compound |
Hair,Bud |
| R4192 |
T7376 |
T7377 |
det |
The,spike |
| R4193 |
T7377 |
T7379 |
nsubj |
spike,prompted |
| R4194 |
T7378 |
T7377 |
amod |
temporal,spike |
| R4195 |
T7380 |
T7377 |
prep |
of,spike |
| R4196 |
T7381 |
T7382 |
compound |
Snail,expression |
| R4197 |
T7382 |
T7380 |
pobj |
expression,of |
| R4198 |
T7383 |
T7382 |
compound |
mRNA,expression |
| R4199 |
T7384 |
T7377 |
prep |
in,spike |
| R420 |
T1225 |
T1206 |
punct |
.,has |
| R4200 |
T7385 |
T7386 |
det |
the,bud |
| R4201 |
T7386 |
T7384 |
pobj |
bud,in |
| R4202 |
T7387 |
T7386 |
compound |
hair,bud |
| R4203 |
T7388 |
T7379 |
dobj |
us,prompted |
| R4204 |
T7389 |
T7390 |
aux |
to,consider |
| R4205 |
T7390 |
T7379 |
xcomp |
consider,prompted |
| R4206 |
T7391 |
T7392 |
det |
what,factor |
| R4207 |
T7392 |
T7393 |
dep |
factor,regulating |
| R4208 |
T7393 |
T7390 |
ccomp |
regulating,consider |
| R4209 |
T7394 |
T7392 |
punct |
(,factor |
| R421 |
T1227 |
T1228 |
advmod |
However,appears |
| R4210 |
T7395 |
T7392 |
nmod |
s,factor |
| R4211 |
T7396 |
T7392 |
punct |
),factor |
| R4212 |
T7397 |
T7393 |
aux |
may,regulating |
| R4213 |
T7398 |
T7393 |
aux |
be,regulating |
| R4214 |
T7399 |
T7400 |
det |
the,gene |
| R4215 |
T7400 |
T7393 |
dobj |
gene,regulating |
| R4216 |
T7401 |
T7400 |
compound |
Snail,gene |
| R4217 |
T7402 |
T7379 |
punct |
.,prompted |
| R4218 |
T7404 |
T7405 |
det |
A,variety |
| R4219 |
T7405 |
T7406 |
nsubj |
variety,have |
| R422 |
T1229 |
T1228 |
punct |
", ",appears |
| R4220 |
T7407 |
T7405 |
prep |
of,variety |
| R4221 |
T7408 |
T7409 |
amod |
extracellular,signals |
| R4222 |
T7409 |
T7407 |
pobj |
signals,of |
| R4223 |
T7410 |
T7411 |
det |
an,impact |
| R4224 |
T7411 |
T7406 |
dobj |
impact,have |
| R4225 |
T7412 |
T7411 |
prep |
on,impact |
| R4226 |
T7413 |
T7414 |
det |
the,expression |
| R4227 |
T7414 |
T7412 |
pobj |
expression,on |
| R4228 |
T7415 |
T7416 |
compound |
cell,type |
| R4229 |
T7416 |
T7417 |
npadvmod |
type,specific |
| R423 |
T1230 |
T1231 |
det |
the,process |
| R4230 |
T7417 |
T7414 |
amod |
specific,expression |
| R4231 |
T7418 |
T7417 |
punct |
-,specific |
| R4232 |
T7419 |
T7414 |
prep |
of,expression |
| R4233 |
T7420 |
T7421 |
amod |
different,members |
| R4234 |
T7421 |
T7419 |
pobj |
members,of |
| R4235 |
T7422 |
T7423 |
compound |
Snail,family |
| R4236 |
T7423 |
T7421 |
compound |
family,members |
| R4237 |
T7424 |
T7406 |
punct |
", ",have |
| R4238 |
T7425 |
T7406 |
cc |
and,have |
| R4239 |
T7426 |
T7427 |
nsubj |
many,affect |
| R424 |
T1231 |
T1228 |
nsubj |
process,appears |
| R4240 |
T7427 |
T7406 |
conj |
affect,have |
| R4241 |
T7428 |
T7426 |
prep |
of,many |
| R4242 |
T7429 |
T7428 |
pobj |
them,of |
| R4243 |
T7430 |
T7426 |
punct |
", ",many |
| R4244 |
T7431 |
T7426 |
prep |
including,many |
| R4245 |
T7432 |
T7431 |
pobj |
Wnts,including |
| R4246 |
T7433 |
T7432 |
punct |
", ",Wnts |
| R4247 |
T7434 |
T7432 |
conj |
BMPs,Wnts |
| R4248 |
T7435 |
T7434 |
punct |
", ",BMPs |
| R4249 |
T7436 |
T7434 |
conj |
FGFs,BMPs |
| R425 |
T1232 |
T1233 |
aux |
to,patterned |
| R4250 |
T7437 |
T7436 |
punct |
", ",FGFs |
| R4251 |
T7438 |
T7436 |
cc |
and,FGFs |
| R4252 |
T7439 |
T7440 |
compound |
TGF,βs |
| R4253 |
T7440 |
T7436 |
conj |
βs,FGFs |
| R4254 |
T7441 |
T7440 |
punct |
-,βs |
| R4255 |
T7442 |
T7427 |
punct |
", ",affect |
| R4256 |
T7443 |
T7427 |
advmod |
also,affect |
| R4257 |
T7444 |
T7445 |
compound |
hair,bud |
| R4258 |
T7445 |
T7446 |
compound |
bud,development |
| R4259 |
T7446 |
T7427 |
dobj |
development,affect |
| R426 |
T1233 |
T1228 |
xcomp |
patterned,appears |
| R4260 |
T7447 |
T7448 |
punct |
[,28 |
| R4261 |
T7448 |
T7427 |
parataxis |
28,affect |
| R4262 |
T7449 |
T7448 |
nummod |
2,28 |
| R4263 |
T7450 |
T7448 |
punct |
",",28 |
| R4264 |
T7451 |
T7448 |
nummod |
16,28 |
| R4265 |
T7452 |
T7448 |
punct |
",",28 |
| R4266 |
T7453 |
T7448 |
punct |
],28 |
| R4267 |
T7454 |
T7427 |
punct |
.,affect |
| R4268 |
T7456 |
T7457 |
mark |
Since,expressed |
| R4269 |
T7457 |
T7461 |
advcl |
expressed,focused |
| R427 |
T1234 |
T1233 |
auxpass |
be,patterned |
| R4270 |
T7458 |
T7457 |
nsubjpass |
Snail,expressed |
| R4271 |
T7459 |
T7457 |
auxpass |
is,expressed |
| R4272 |
T7460 |
T7457 |
neg |
not,expressed |
| R4273 |
T7462 |
T7457 |
prep |
in,expressed |
| R4274 |
T7463 |
T7464 |
amod |
cultured,keratinocytes |
| R4275 |
T7464 |
T7462 |
pobj |
keratinocytes,in |
| R4276 |
T7465 |
T7464 |
compound |
skin,keratinocytes |
| R4277 |
T7466 |
T7467 |
dep |
that,secrete |
| R4278 |
T7467 |
T7464 |
relcl |
secrete,keratinocytes |
| R4279 |
T7468 |
T7469 |
amod |
active,BMPs |
| R428 |
T1235 |
T1233 |
prep |
at,patterned |
| R4280 |
T7469 |
T7467 |
dobj |
BMPs,secrete |
| R4281 |
T7470 |
T7469 |
cc |
and,BMPs |
| R4282 |
T7471 |
T7469 |
conj |
FGFs,BMPs |
| R4283 |
T7472 |
T7473 |
punct |
(,see |
| R4284 |
T7473 |
T7457 |
parataxis |
see,expressed |
| R4285 |
T7474 |
T7475 |
compound |
Figure,1B |
| R4286 |
T7475 |
T7473 |
dobj |
1B,see |
| R4287 |
T7476 |
T7473 |
punct |
),see |
| R4288 |
T7477 |
T7461 |
punct |
", ",focused |
| R4289 |
T7478 |
T7461 |
nsubj |
we,focused |
| R429 |
T1236 |
T1237 |
det |
the,stages |
| R4290 |
T7479 |
T7480 |
poss |
our,attention |
| R4291 |
T7480 |
T7461 |
dobj |
attention,focused |
| R4292 |
T7481 |
T7461 |
prep |
on,focused |
| R4293 |
T7482 |
T7483 |
nmod |
Wnt,signaling |
| R4294 |
T7483 |
T7481 |
pobj |
signaling,on |
| R4295 |
T7484 |
T7482 |
cc |
and,Wnt |
| R4296 |
T7485 |
T7486 |
compound |
TGF,β |
| R4297 |
T7486 |
T7482 |
conj |
β,Wnt |
| R4298 |
T7487 |
T7486 |
punct |
-,β |
| R4299 |
T7488 |
T7483 |
prep |
as,signaling |
| R430 |
T1237 |
T1235 |
pobj |
stages,at |
| R4300 |
T7489 |
T7490 |
advmod |
more,likely |
| R4301 |
T7490 |
T7491 |
amod |
likely,candidates |
| R4302 |
T7491 |
T7488 |
pobj |
candidates,as |
| R4303 |
T7492 |
T7491 |
prep |
for,candidates |
| R4304 |
T7493 |
T7494 |
compound |
Snail,induction |
| R4305 |
T7494 |
T7492 |
pobj |
induction,for |
| R4306 |
T7495 |
T7491 |
prep |
in,candidates |
| R4307 |
T7496 |
T7497 |
det |
this,type |
| R4308 |
T7497 |
T7495 |
pobj |
type,in |
| R4309 |
T7498 |
T7497 |
compound |
cell,type |
| R431 |
T1238 |
T1237 |
amod |
initial,stages |
| R4310 |
T7499 |
T7461 |
punct |
.,focused |
| R4311 |
T7501 |
T7502 |
advmod |
Previously,showed |
| R4312 |
T7503 |
T7502 |
punct |
", ",showed |
| R4313 |
T7504 |
T7502 |
nsubj |
we,showed |
| R4314 |
T7505 |
T7506 |
mark |
that,achieved |
| R4315 |
T7506 |
T7502 |
ccomp |
achieved,showed |
| R4316 |
T7507 |
T7508 |
amod |
effective,transmission |
| R4317 |
T7508 |
T7506 |
nsubjpass |
transmission,achieved |
| R4318 |
T7509 |
T7508 |
prep |
of,transmission |
| R4319 |
T7510 |
T7511 |
det |
a,signal |
| R432 |
T1239 |
T1237 |
prep |
of,stages |
| R4320 |
T7511 |
T7509 |
pobj |
signal,of |
| R4321 |
T7512 |
T7511 |
nmod |
Wnt,signal |
| R4322 |
T7513 |
T7512 |
punct |
-,Wnt |
| R4323 |
T7514 |
T7512 |
nummod |
3a,Wnt |
| R4324 |
T7515 |
T7508 |
prep |
in,transmission |
| R4325 |
T7516 |
T7517 |
amod |
cultured,keratinocytes |
| R4326 |
T7517 |
T7515 |
pobj |
keratinocytes,in |
| R4327 |
T7518 |
T7506 |
aux |
can,achieved |
| R4328 |
T7519 |
T7506 |
auxpass |
be,achieved |
| R4329 |
T7520 |
T7506 |
prep |
through,achieved |
| R433 |
T1240 |
T1241 |
compound |
bud,formation |
| R4330 |
T7521 |
T7522 |
poss |
their,exposure |
| R4331 |
T7522 |
T7520 |
pobj |
exposure,through |
| R4332 |
T7523 |
T7522 |
prep |
to,exposure |
| R4333 |
T7524 |
T7525 |
det |
the,inhibitor |
| R4334 |
T7525 |
T7523 |
pobj |
inhibitor,to |
| R4335 |
T7526 |
T7525 |
compound |
BMP,inhibitor |
| R4336 |
T7527 |
T7525 |
appos |
noggin,inhibitor |
| R4337 |
T7528 |
T7525 |
punct |
", ",inhibitor |
| R4338 |
T7529 |
T7530 |
dep |
which,induces |
| R4339 |
T7530 |
T7525 |
relcl |
induces,inhibitor |
| R434 |
T1241 |
T1239 |
pobj |
formation,of |
| R4340 |
T7531 |
T7532 |
nmod |
LEF,expression |
| R4341 |
T7532 |
T7530 |
dobj |
expression,induces |
| R4342 |
T7533 |
T7531 |
punct |
-,LEF |
| R4343 |
T7534 |
T7531 |
nummod |
1,LEF |
| R4344 |
T7535 |
T7536 |
punct |
[,4 |
| R4345 |
T7536 |
T7502 |
parataxis |
4,showed |
| R4346 |
T7537 |
T7536 |
punct |
],4 |
| R4347 |
T7538 |
T7502 |
punct |
.,showed |
| R4348 |
T7540 |
T7541 |
advmod |
In,vitro |
| R4349 |
T7541 |
T7542 |
advmod |
vitro,regulated |
| R435 |
T1242 |
T1228 |
punct |
", ",appears |
| R4350 |
T7543 |
T7542 |
punct |
", ",regulated |
| R4351 |
T7544 |
T7545 |
det |
these,conditions |
| R4352 |
T7545 |
T7542 |
nsubj |
conditions,regulated |
| R4353 |
T7546 |
T7542 |
advmod |
down,regulated |
| R4354 |
T7547 |
T7542 |
punct |
-,regulated |
| R4355 |
T7548 |
T7549 |
det |
the,promoter |
| R4356 |
T7549 |
T7542 |
dobj |
promoter,regulated |
| R4357 |
T7550 |
T7551 |
compound |
E,cadherin |
| R4358 |
T7551 |
T7549 |
compound |
cadherin,promoter |
| R4359 |
T7552 |
T7551 |
punct |
-,cadherin |
| R436 |
T1243 |
T1244 |
mark |
since,differ |
| R4360 |
T7553 |
T7542 |
cc |
and,regulated |
| R4361 |
T7554 |
T7542 |
conj |
induced,regulated |
| R4362 |
T7555 |
T7556 |
det |
a,gene |
| R4363 |
T7556 |
T7554 |
dobj |
gene,induced |
| R4364 |
T7557 |
T7558 |
npadvmod |
LEF,sensitive |
| R4365 |
T7558 |
T7556 |
amod |
sensitive,gene |
| R4366 |
T7559 |
T7557 |
punct |
-,LEF |
| R4367 |
T7560 |
T7557 |
nummod |
1,LEF |
| R4368 |
T7561 |
T7557 |
punct |
/,LEF |
| R4369 |
T7562 |
T7563 |
compound |
β,catenin |
| R437 |
T1244 |
T1228 |
advcl |
differ,appears |
| R4370 |
T7563 |
T7557 |
appos |
catenin,LEF |
| R4371 |
T7564 |
T7563 |
punct |
-,catenin |
| R4372 |
T7565 |
T7558 |
punct |
-,sensitive |
| R4373 |
T7566 |
T7556 |
compound |
reporter,gene |
| R4374 |
T7567 |
T7556 |
punct |
", ",gene |
| R4375 |
T7568 |
T7556 |
appos |
TOPFLASH,gene |
| R4376 |
T7569 |
T7570 |
punct |
[,4 |
| R4377 |
T7570 |
T7554 |
parataxis |
4,induced |
| R4378 |
T7571 |
T7570 |
punct |
],4 |
| R4379 |
T7572 |
T7542 |
punct |
.,regulated |
| R438 |
T1245 |
T1246 |
det |
the,importance |
| R4380 |
T7574 |
T7575 |
prep |
In,induced |
| R4381 |
T7576 |
T7574 |
pobj |
contrast,In |
| R4382 |
T7577 |
T7575 |
punct |
", ",induced |
| R4383 |
T7578 |
T7579 |
compound |
Snail,expression |
| R4384 |
T7579 |
T7575 |
nsubjpass |
expression,induced |
| R4385 |
T7580 |
T7575 |
auxpass |
was,induced |
| R4386 |
T7581 |
T7575 |
neg |
not,induced |
| R4387 |
T7582 |
T7575 |
agent |
by,induced |
| R4388 |
T7583 |
T7584 |
det |
these,conditions |
| R4389 |
T7584 |
T7582 |
pobj |
conditions,by |
| R439 |
T1246 |
T1244 |
nsubj |
importance,differ |
| R4390 |
T7585 |
T7586 |
punct |
(,5A |
| R4391 |
T7586 |
T7575 |
parataxis |
5A,induced |
| R4392 |
T7587 |
T7586 |
compound |
Figure,5A |
| R4393 |
T7588 |
T7586 |
punct |
),5A |
| R4394 |
T7589 |
T7575 |
punct |
.,induced |
| R4395 |
T7591 |
T7592 |
advmod |
Thus,support |
| R4396 |
T7593 |
T7592 |
punct |
", ",support |
| R4397 |
T7594 |
T7592 |
prep |
despite,support |
| R4398 |
T7595 |
T7596 |
amod |
essential,roles |
| R4399 |
T7596 |
T7594 |
pobj |
roles,despite |
| R440 |
T1247 |
T1246 |
amod |
relative,importance |
| R4400 |
T7597 |
T7596 |
prep |
for,roles |
| R4401 |
T7598 |
T7597 |
pobj |
Wnts,for |
| R4402 |
T7599 |
T7598 |
cc |
and,Wnts |
| R4403 |
T7600 |
T7598 |
conj |
noggin,Wnts |
| R4404 |
T7601 |
T7596 |
prep |
in,roles |
| R4405 |
T7602 |
T7603 |
compound |
hair,follicle |
| R4406 |
T7603 |
T7604 |
compound |
follicle,specification |
| R4407 |
T7604 |
T7601 |
pobj |
specification,in |
| R4408 |
T7605 |
T7606 |
punct |
[,30 |
| R4409 |
T7606 |
T7596 |
parataxis |
30,roles |
| R441 |
T1248 |
T1246 |
prep |
of,importance |
| R4410 |
T7607 |
T7606 |
nummod |
4,30 |
| R4411 |
T7608 |
T7606 |
punct |
",",30 |
| R4412 |
T7609 |
T7606 |
nummod |
29,30 |
| R4413 |
T7610 |
T7606 |
punct |
",",30 |
| R4414 |
T7611 |
T7606 |
punct |
],30 |
| R4415 |
T7612 |
T7592 |
punct |
", ",support |
| R4416 |
T7613 |
T7614 |
poss |
our,studies |
| R4417 |
T7614 |
T7592 |
nsubj |
studies,support |
| R4418 |
T7615 |
T7592 |
aux |
did,support |
| R4419 |
T7616 |
T7592 |
neg |
not,support |
| R442 |
T1249 |
T1250 |
det |
these,pathways |
| R4420 |
T7617 |
T7618 |
det |
an,role |
| R4421 |
T7618 |
T7592 |
dobj |
role,support |
| R4422 |
T7619 |
T7618 |
amod |
essential,role |
| R4423 |
T7620 |
T7618 |
prep |
for,role |
| R4424 |
T7621 |
T7622 |
det |
these,signals |
| R4425 |
T7622 |
T7620 |
pobj |
signals,for |
| R4426 |
T7623 |
T7618 |
prep |
in,role |
| R4427 |
T7624 |
T7623 |
pcomp |
governing,in |
| R4428 |
T7625 |
T7626 |
compound |
Snail,expression |
| R4429 |
T7626 |
T7624 |
dobj |
expression,governing |
| R443 |
T1250 |
T1248 |
pobj |
pathways,of |
| R4430 |
T7627 |
T7624 |
prep |
in,governing |
| R4431 |
T7628 |
T7627 |
pobj |
keratinocytes,in |
| R4432 |
T7629 |
T7592 |
punct |
.,support |
| R4433 |
T7631 |
T7632 |
compound |
TGF,β1 |
| R4434 |
T7632 |
T7634 |
nsubjpass |
β1,shown |
| R4435 |
T7633 |
T7632 |
punct |
-,β1 |
| R4436 |
T7635 |
T7634 |
aux |
has,shown |
| R4437 |
T7636 |
T7634 |
auxpass |
been,shown |
| R4438 |
T7637 |
T7638 |
aux |
to,induce |
| R4439 |
T7638 |
T7634 |
xcomp |
induce,shown |
| R444 |
T1251 |
T1250 |
cc |
and,pathways |
| R4440 |
T7639 |
T7640 |
compound |
Snail,members |
| R4441 |
T7640 |
T7638 |
dobj |
members,induce |
| R4442 |
T7641 |
T7640 |
compound |
family,members |
| R4443 |
T7642 |
T7638 |
prep |
in,induce |
| R4444 |
T7643 |
T7642 |
pobj |
hepatocytes,in |
| R4445 |
T7644 |
T7643 |
cc |
and,hepatocytes |
| R4446 |
T7645 |
T7643 |
conj |
heart,hepatocytes |
| R4447 |
T7646 |
T7647 |
punct |
[,31 |
| R4448 |
T7647 |
T7634 |
parataxis |
31,shown |
| R4449 |
T7648 |
T7647 |
nummod |
15,31 |
| R445 |
T1252 |
T1253 |
poss |
their,effectors |
| R4450 |
T7649 |
T7647 |
punct |
", ",31 |
| R4451 |
T7650 |
T7647 |
punct |
],31 |
| R4452 |
T7651 |
T7634 |
punct |
.,shown |
| R4453 |
T7653 |
T7654 |
prep |
In,inhibits |
| R4454 |
T7655 |
T7653 |
pobj |
keratinocytes,In |
| R4455 |
T7656 |
T7654 |
punct |
", ",inhibits |
| R4456 |
T7657 |
T7654 |
advmod |
however,inhibits |
| R4457 |
T7658 |
T7654 |
punct |
", ",inhibits |
| R4458 |
T7659 |
T7660 |
compound |
TGF,β1 |
| R4459 |
T7660 |
T7654 |
nsubj |
β1,inhibits |
| R446 |
T1253 |
T1250 |
conj |
effectors,pathways |
| R4460 |
T7661 |
T7660 |
punct |
-,β1 |
| R4461 |
T7662 |
T7663 |
compound |
keratinocyte,growth |
| R4462 |
T7663 |
T7654 |
dobj |
growth,inhibits |
| R4463 |
T7664 |
T7654 |
cc |
and,inhibits |
| R4464 |
T7665 |
T7654 |
conj |
seems,inhibits |
| R4465 |
T7666 |
T7667 |
aux |
to,involved |
| R4466 |
T7667 |
T7665 |
xcomp |
involved,seems |
| R4467 |
T7668 |
T7667 |
auxpass |
be,involved |
| R4468 |
T7669 |
T7667 |
prep |
in,involved |
| R4469 |
T7670 |
T7669 |
pcomp |
triggering,in |
| R447 |
T1254 |
T1253 |
amod |
downstream,effectors |
| R4470 |
T7671 |
T7672 |
det |
the,phase |
| R4471 |
T7672 |
T7670 |
dobj |
phase,triggering |
| R4472 |
T7673 |
T7672 |
amod |
destructive,phase |
| R4473 |
T7674 |
T7672 |
prep |
of,phase |
| R4474 |
T7675 |
T7676 |
det |
the,follicle |
| R4475 |
T7676 |
T7674 |
pobj |
follicle,of |
| R4476 |
T7677 |
T7676 |
amod |
cycling,follicle |
| R4477 |
T7678 |
T7676 |
compound |
hair,follicle |
| R4478 |
T7679 |
T7680 |
punct |
[,32 |
| R4479 |
T7680 |
T7665 |
parataxis |
32,seems |
| R448 |
T1255 |
T1256 |
mark |
as,begin |
| R4480 |
T7681 |
T7680 |
punct |
],32 |
| R4481 |
T7682 |
T7654 |
punct |
.,inhibits |
| R4482 |
T7684 |
T7685 |
prep |
Of,blocked |
| R4483 |
T7686 |
T7687 |
det |
the,mutations |
| R4484 |
T7687 |
T7684 |
pobj |
mutations,Of |
| R4485 |
T7688 |
T7687 |
nmod |
loss,mutations |
| R4486 |
T7689 |
T7688 |
punct |
-,loss |
| R4487 |
T7690 |
T7688 |
prep |
of,loss |
| R4488 |
T7691 |
T7690 |
punct |
-,of |
| R4489 |
T7692 |
T7690 |
pobj |
function,of |
| R449 |
T1256 |
T1244 |
advcl |
begin,differ |
| R4490 |
T7693 |
T7687 |
acl |
generated,mutations |
| R4491 |
T7694 |
T7693 |
prep |
in,generated |
| R4492 |
T7695 |
T7694 |
pobj |
each,in |
| R4493 |
T7696 |
T7695 |
prep |
of,each |
| R4494 |
T7697 |
T7698 |
det |
the,genes |
| R4495 |
T7698 |
T7696 |
pobj |
genes,of |
| R4496 |
T7699 |
T7700 |
compound |
TGF,β |
| R4497 |
T7700 |
T7698 |
compound |
β,genes |
| R4498 |
T7701 |
T7700 |
punct |
-,β |
| R4499 |
T7702 |
T7685 |
punct |
", ",blocked |
| R450 |
T1257 |
T1256 |
nsubj |
buds,begin |
| R4500 |
T7703 |
T7704 |
advmod |
only,state |
| R4501 |
T7704 |
T7685 |
nsubj |
state,blocked |
| R4502 |
T7705 |
T7704 |
det |
the,state |
| R4503 |
T7706 |
T7707 |
nmod |
TGF,β2 |
| R4504 |
T7707 |
T7704 |
nmod |
β2,state |
| R4505 |
T7708 |
T7707 |
punct |
-,β2 |
| R4506 |
T7709 |
T7704 |
amod |
null,state |
| R4507 |
T7710 |
T7711 |
compound |
follicle,development |
| R4508 |
T7711 |
T7685 |
dobj |
development,blocked |
| R4509 |
T7712 |
T7685 |
prep |
at,blocked |
| R451 |
T1258 |
T1259 |
aux |
to,develop |
| R4510 |
T7713 |
T7714 |
det |
the,stage |
| R4511 |
T7714 |
T7712 |
pobj |
stage,at |
| R4512 |
T7715 |
T7716 |
compound |
hair,bud |
| R4513 |
T7716 |
T7714 |
compound |
bud,stage |
| R4514 |
T7717 |
T7718 |
punct |
[,32 |
| R4515 |
T7718 |
T7685 |
parataxis |
32,blocked |
| R4516 |
T7719 |
T7718 |
punct |
],32 |
| R4517 |
T7720 |
T7685 |
punct |
.,blocked |
| R4518 |
T7722 |
T7723 |
advmod |
Thus,turned |
| R4519 |
T7724 |
T7723 |
punct |
", ",turned |
| R452 |
T1259 |
T1256 |
xcomp |
develop,begin |
| R4520 |
T7725 |
T7723 |
nsubj |
we,turned |
| R4521 |
T7726 |
T7723 |
prep |
towards,turned |
| R4522 |
T7727 |
T7726 |
pcomp |
addressing,towards |
| R4523 |
T7728 |
T7729 |
mark |
whether,involved |
| R4524 |
T7729 |
T7727 |
ccomp |
involved,addressing |
| R4525 |
T7730 |
T7731 |
compound |
TGF,β2 |
| R4526 |
T7731 |
T7729 |
nsubjpass |
β2,involved |
| R4527 |
T7732 |
T7731 |
punct |
-,β2 |
| R4528 |
T7733 |
T7729 |
aux |
might,involved |
| R4529 |
T7734 |
T7729 |
auxpass |
be,involved |
| R453 |
T1260 |
T1256 |
cc |
and,begin |
| R4530 |
T7735 |
T7729 |
prep |
in,involved |
| R4531 |
T7736 |
T7735 |
pcomp |
regulating,in |
| R4532 |
T7737 |
T7738 |
compound |
Snail,expression |
| R4533 |
T7738 |
T7736 |
dobj |
expression,regulating |
| R4534 |
T7739 |
T7736 |
prep |
in,regulating |
| R4535 |
T7740 |
T7739 |
pobj |
keratinocytes,in |
| R4536 |
T7741 |
T7740 |
acl |
isolated,keratinocytes |
| R4537 |
T7742 |
T7741 |
prep |
from,isolated |
| R4538 |
T7743 |
T7744 |
det |
the,layer |
| R4539 |
T7744 |
T7742 |
pobj |
layer,from |
| R454 |
T1261 |
T1262 |
compound |
cell,fates |
| R4540 |
T7745 |
T7744 |
amod |
basal,layer |
| R4541 |
T7746 |
T7744 |
prep |
of,layer |
| R4542 |
T7747 |
T7748 |
det |
the,epidermis |
| R4543 |
T7748 |
T7746 |
pobj |
epidermis,of |
| R4544 |
T7749 |
T7723 |
punct |
.,turned |
| R4545 |
T7751 |
T7752 |
mark |
Though,is |
| R4546 |
T7752 |
T7754 |
advcl |
is,are |
| R4547 |
T7753 |
T7752 |
expl |
there,is |
| R4548 |
T7755 |
T7756 |
det |
no,system |
| R4549 |
T7756 |
T7752 |
attr |
system,is |
| R455 |
T1262 |
T1263 |
nsubjpass |
fates,specified |
| R4550 |
T7757 |
T7758 |
compound |
cell,culture |
| R4551 |
T7758 |
T7756 |
compound |
culture,system |
| R4552 |
T7759 |
T7756 |
amod |
available,system |
| R4553 |
T7760 |
T7761 |
aux |
to,study |
| R4554 |
T7761 |
T7759 |
xcomp |
study,available |
| R4555 |
T7762 |
T7761 |
advmod |
specifically,study |
| R4556 |
T7763 |
T7764 |
amod |
placodal,cells |
| R4557 |
T7764 |
T7761 |
dobj |
cells,study |
| R4558 |
T7765 |
T7754 |
punct |
", ",are |
| R4559 |
T7766 |
T7767 |
det |
these,keratinocytes |
| R456 |
T1263 |
T1256 |
conj |
specified,begin |
| R4560 |
T7767 |
T7754 |
nsubj |
keratinocytes,are |
| R4561 |
T7768 |
T7769 |
poss |
their,progenitors |
| R4562 |
T7769 |
T7754 |
attr |
progenitors,are |
| R4563 |
T7770 |
T7754 |
cc |
and,are |
| R4564 |
T7771 |
T7754 |
conj |
are,are |
| R4565 |
T7772 |
T7773 |
det |
the,approximation |
| R4566 |
T7773 |
T7771 |
attr |
approximation,are |
| R4567 |
T7774 |
T7773 |
amod |
closest,approximation |
| R4568 |
T7775 |
T7773 |
amod |
available,approximation |
| R4569 |
T7776 |
T7777 |
aux |
to,study |
| R457 |
T1264 |
T1263 |
auxpass |
are,specified |
| R4570 |
T7777 |
T7775 |
xcomp |
study,available |
| R4571 |
T7778 |
T7779 |
det |
the,behavior |
| R4572 |
T7779 |
T7777 |
dobj |
behavior,study |
| R4573 |
T7780 |
T7779 |
prep |
of,behavior |
| R4574 |
T7781 |
T7782 |
amod |
epithelial,cells |
| R4575 |
T7782 |
T7780 |
pobj |
cells,of |
| R4576 |
T7783 |
T7782 |
prep |
of,cells |
| R4577 |
T7784 |
T7785 |
det |
the,placode |
| R4578 |
T7785 |
T7783 |
pobj |
placode,of |
| R4579 |
T7786 |
T7754 |
punct |
.,are |
| R458 |
T1265 |
T1228 |
punct |
.,appears |
| R4580 |
T7788 |
T7789 |
advmod |
Interestingly,caused |
| R4581 |
T7790 |
T7789 |
punct |
", ",caused |
| R4582 |
T7791 |
T7789 |
nsubj |
treatment,caused |
| R4583 |
T7792 |
T7791 |
prep |
of,treatment |
| R4584 |
T7793 |
T7794 |
amod |
cultured,keratinocytes |
| R4585 |
T7794 |
T7792 |
pobj |
keratinocytes,of |
| R4586 |
T7795 |
T7791 |
prep |
with,treatment |
| R4587 |
T7796 |
T7797 |
advmod |
as,5 |
| R4588 |
T7797 |
T7800 |
nummod |
5,ng |
| R4589 |
T7798 |
T7797 |
amod |
little,5 |
| R459 |
T1267 |
T1268 |
det |
The,development |
| R4590 |
T7799 |
T7797 |
quantmod |
as,5 |
| R4591 |
T7800 |
T7795 |
pobj |
ng,with |
| R4592 |
T7801 |
T7802 |
punct |
/,ml |
| R4593 |
T7802 |
T7800 |
prep |
ml,ng |
| R4594 |
T7803 |
T7800 |
prep |
of,ng |
| R4595 |
T7804 |
T7805 |
compound |
TGF,β2 |
| R4596 |
T7805 |
T7803 |
pobj |
β2,of |
| R4597 |
T7806 |
T7805 |
punct |
-,β2 |
| R4598 |
T7807 |
T7808 |
det |
a,induction |
| R4599 |
T7808 |
T7789 |
dobj |
induction,caused |
| R460 |
T1268 |
T1269 |
nsubj |
development,requires |
| R4600 |
T7809 |
T7808 |
amod |
rapid,induction |
| R4601 |
T7810 |
T7809 |
cc |
and,rapid |
| R4602 |
T7811 |
T7809 |
conj |
transient,rapid |
| R4603 |
T7812 |
T7808 |
prep |
of,induction |
| R4604 |
T7813 |
T7812 |
pobj |
Snail,of |
| R4605 |
T7814 |
T7815 |
punct |
(,5B |
| R4606 |
T7815 |
T7789 |
parataxis |
5B,caused |
| R4607 |
T7816 |
T7815 |
compound |
Figure,5B |
| R4608 |
T7817 |
T7815 |
punct |
),5B |
| R4609 |
T7818 |
T7789 |
punct |
.,caused |
| R461 |
T1270 |
T1268 |
prep |
of,development |
| R4610 |
T7820 |
T7821 |
prep |
Following,detected |
| R4611 |
T7822 |
T7823 |
det |
this,treatment |
| R4612 |
T7823 |
T7820 |
pobj |
treatment,Following |
| R4613 |
T7824 |
T7821 |
punct |
", ",detected |
| R4614 |
T7825 |
T7826 |
compound |
Snail,protein |
| R4615 |
T7826 |
T7821 |
nsubjpass |
protein,detected |
| R4616 |
T7827 |
T7821 |
auxpass |
was,detected |
| R4617 |
T7828 |
T7821 |
prep |
within,detected |
| R4618 |
T7829 |
T7830 |
nummod |
30,min |
| R4619 |
T7830 |
T7828 |
pobj |
min,within |
| R462 |
T1271 |
T1272 |
det |
a,bud |
| R4620 |
T7831 |
T7821 |
punct |
", ",detected |
| R4621 |
T7832 |
T7821 |
conj |
peaked,detected |
| R4622 |
T7833 |
T7832 |
prep |
at,peaked |
| R4623 |
T7834 |
T7835 |
nummod |
2,h |
| R4624 |
T7835 |
T7833 |
pobj |
h,at |
| R4625 |
T7836 |
T7832 |
punct |
", ",peaked |
| R4626 |
T7837 |
T7832 |
cc |
and,peaked |
| R4627 |
T7838 |
T7839 |
advmod |
then,declined |
| R4628 |
T7839 |
T7832 |
conj |
declined,peaked |
| R4629 |
T7840 |
T7839 |
advmod |
thereafter,declined |
| R463 |
T1272 |
T1270 |
pobj |
bud,of |
| R4630 |
T7841 |
T7821 |
punct |
.,detected |
| R4631 |
T7843 |
T7844 |
det |
The,induction |
| R4632 |
T7844 |
T7845 |
nsubj |
induction,appeared |
| R4633 |
T7846 |
T7844 |
prep |
of,induction |
| R4634 |
T7847 |
T7846 |
pobj |
Snail,of |
| R4635 |
T7848 |
T7849 |
aux |
to,be |
| R4636 |
T7849 |
T7845 |
xcomp |
be,appeared |
| R4637 |
T7850 |
T7849 |
acomp |
specific,be |
| R4638 |
T7851 |
T7850 |
prep |
for,specific |
| R4639 |
T7852 |
T7853 |
det |
the,form |
| R464 |
T1273 |
T1274 |
det |
a,number |
| R4640 |
T7853 |
T7851 |
pobj |
form,for |
| R4641 |
T7854 |
T7853 |
amod |
active,form |
| R4642 |
T7855 |
T7853 |
prep |
of,form |
| R4643 |
T7856 |
T7857 |
det |
the,factor |
| R4644 |
T7857 |
T7855 |
pobj |
factor,of |
| R4645 |
T7858 |
T7857 |
compound |
growth,factor |
| R4646 |
T7859 |
T7849 |
punct |
", ",be |
| R4647 |
T7860 |
T7861 |
mark |
as,obliterated |
| R4648 |
T7861 |
T7849 |
advcl |
obliterated,be |
| R4649 |
T7862 |
T7861 |
nsubj |
pretreatment,obliterated |
| R465 |
T1274 |
T1269 |
dobj |
number,requires |
| R4650 |
T7863 |
T7862 |
prep |
of,pretreatment |
| R4651 |
T7864 |
T7865 |
compound |
TGF,β2 |
| R4652 |
T7865 |
T7863 |
pobj |
β2,of |
| R4653 |
T7866 |
T7865 |
punct |
-,β2 |
| R4654 |
T7867 |
T7862 |
prep |
for,pretreatment |
| R4655 |
T7868 |
T7869 |
nummod |
10,min |
| R4656 |
T7869 |
T7867 |
pobj |
min,for |
| R4657 |
T7870 |
T7862 |
prep |
at,pretreatment |
| R4658 |
T7871 |
T7872 |
nummod |
100,°C |
| R4659 |
T7872 |
T7870 |
pobj |
°C,at |
| R466 |
T1275 |
T1274 |
prep |
of,number |
| R4660 |
T7873 |
T7874 |
det |
the,response |
| R4661 |
T7874 |
T7861 |
dobj |
response,obliterated |
| R4662 |
T7875 |
T7876 |
punct |
[,lanes |
| R4663 |
T7876 |
T7849 |
parataxis |
lanes,be |
| R4664 |
T7877 |
T7878 |
compound |
Figure,5B |
| R4665 |
T7878 |
T7876 |
dep |
5B,lanes |
| R4666 |
T7879 |
T7876 |
punct |
", ",lanes |
| R4667 |
T7880 |
T7876 |
acl |
marked,lanes |
| R4668 |
T7881 |
T7880 |
punct |
(,marked |
| R4669 |
T7882 |
T7880 |
oprd |
–,marked |
| R467 |
T1276 |
T1277 |
amod |
coordinated,changes |
| R4670 |
T7883 |
T7876 |
punct |
),lanes |
| R4671 |
T7884 |
T7876 |
punct |
],lanes |
| R4672 |
T7885 |
T7845 |
punct |
.,appeared |
| R4673 |
T7887 |
T7888 |
prep |
By,maintained |
| R4674 |
T7889 |
T7887 |
pobj |
contrast,By |
| R4675 |
T7890 |
T7888 |
punct |
", ",maintained |
| R4676 |
T7891 |
T7892 |
mark |
although,remained |
| R4677 |
T7892 |
T7888 |
advcl |
remained,maintained |
| R4678 |
T7893 |
T7894 |
compound |
TGF,β |
| R4679 |
T7894 |
T7896 |
compound |
β,receptor |
| R468 |
T1277 |
T1275 |
pobj |
changes,of |
| R4680 |
T7895 |
T7894 |
punct |
-,β |
| R4681 |
T7896 |
T7897 |
compound |
receptor,activation |
| R4682 |
T7897 |
T7892 |
nsubj |
activation,remained |
| R4683 |
T7898 |
T7892 |
acomp |
elevated,remained |
| R4684 |
T7899 |
T7892 |
prep |
during,remained |
| R4685 |
T7900 |
T7901 |
det |
the,duration |
| R4686 |
T7901 |
T7899 |
pobj |
duration,during |
| R4687 |
T7902 |
T7901 |
prep |
of,duration |
| R4688 |
T7903 |
T7904 |
det |
the,experiment |
| R4689 |
T7904 |
T7902 |
pobj |
experiment,of |
| R469 |
T1278 |
T1277 |
prep |
in,changes |
| R4690 |
T7905 |
T7892 |
punct |
(,remained |
| R4691 |
T7906 |
T7907 |
mark |
as,measured |
| R4692 |
T7907 |
T7892 |
advcl |
measured,remained |
| R4693 |
T7908 |
T7907 |
prep |
by,measured |
| R4694 |
T7909 |
T7910 |
det |
the,phosphorylation |
| R4695 |
T7910 |
T7908 |
pobj |
phosphorylation,by |
| R4696 |
T7911 |
T7910 |
amod |
sustained,phosphorylation |
| R4697 |
T7912 |
T7910 |
prep |
of,phosphorylation |
| R4698 |
T7913 |
T7914 |
det |
the,effector |
| R4699 |
T7914 |
T7912 |
pobj |
effector,of |
| R470 |
T1279 |
T1280 |
det |
the,behavior |
| R4700 |
T7915 |
T7914 |
amod |
downstream,effector |
| R4701 |
T7916 |
T7914 |
appos |
SMAD2,effector |
| R4702 |
T7917 |
T7888 |
punct |
),maintained |
| R4703 |
T7918 |
T7919 |
compound |
Snail,expression |
| R4704 |
T7919 |
T7888 |
nsubjpass |
expression,maintained |
| R4705 |
T7920 |
T7888 |
aux |
could,maintained |
| R4706 |
T7921 |
T7888 |
neg |
not,maintained |
| R4707 |
T7922 |
T7888 |
auxpass |
be,maintained |
| R4708 |
T7923 |
T7924 |
punct |
(,5B |
| R4709 |
T7924 |
T7888 |
parataxis |
5B,maintained |
| R471 |
T1280 |
T1278 |
pobj |
behavior,in |
| R4710 |
T7925 |
T7924 |
compound |
Figure,5B |
| R4711 |
T7926 |
T7924 |
punct |
),5B |
| R4712 |
T7927 |
T7888 |
punct |
.,maintained |
| R4713 |
T7929 |
T7930 |
advmod |
Thus,seemed |
| R4714 |
T7931 |
T7930 |
punct |
", ",seemed |
| R4715 |
T7932 |
T7933 |
mark |
although,correlated |
| R4716 |
T7933 |
T7930 |
advcl |
correlated,seemed |
| R4717 |
T7934 |
T7935 |
compound |
Snail,expression |
| R4718 |
T7935 |
T7933 |
nsubj |
expression,correlated |
| R4719 |
T7936 |
T7933 |
prep |
with,correlated |
| R472 |
T1281 |
T1280 |
prep |
of,behavior |
| R4720 |
T7937 |
T7938 |
amod |
phosphorylated,SMAD2 |
| R4721 |
T7938 |
T7939 |
nmod |
SMAD2,induction |
| R4722 |
T7939 |
T7936 |
pobj |
induction,with |
| R4723 |
T7940 |
T7938 |
punct |
(,SMAD2 |
| R4724 |
T7941 |
T7938 |
appos |
pSMAD2,SMAD2 |
| R4725 |
T7942 |
T7939 |
punct |
),induction |
| R4726 |
T7943 |
T7930 |
punct |
", ",seemed |
| R4727 |
T7944 |
T7945 |
poss |
its,decline |
| R4728 |
T7945 |
T7930 |
nsubj |
decline,seemed |
| R4729 |
T7946 |
T7947 |
aux |
to,rely |
| R473 |
T1282 |
T1283 |
det |
the,cells |
| R4730 |
T7947 |
T7930 |
xcomp |
rely,seemed |
| R4731 |
T7948 |
T7947 |
prep |
on,rely |
| R4732 |
T7949 |
T7950 |
amod |
secondary,events |
| R4733 |
T7950 |
T7948 |
pobj |
events,on |
| R4734 |
T7951 |
T7950 |
amod |
downstream,events |
| R4735 |
T7952 |
T7930 |
punct |
.,seemed |
| R4736 |
T7954 |
T7955 |
det |
The,kinetics |
| R4737 |
T7955 |
T7957 |
nsubjpass |
kinetics,reflected |
| R4738 |
T7956 |
T7955 |
amod |
rapid,kinetics |
| R4739 |
T7958 |
T7955 |
prep |
of,kinetics |
| R474 |
T1283 |
T1281 |
pobj |
cells,of |
| R4740 |
T7959 |
T7960 |
compound |
Snail,expression |
| R4741 |
T7960 |
T7958 |
pobj |
expression,of |
| R4742 |
T7961 |
T7957 |
auxpass |
were,reflected |
| R4743 |
T7962 |
T7957 |
prep |
at,reflected |
| R4744 |
T7963 |
T7964 |
det |
the,level |
| R4745 |
T7964 |
T7962 |
pobj |
level,at |
| R4746 |
T7965 |
T7964 |
compound |
mRNA,level |
| R4747 |
T7966 |
T7957 |
punct |
", ",reflected |
| R4748 |
T7967 |
T7957 |
advcl |
suggesting,reflected |
| R4749 |
T7968 |
T7969 |
mark |
that,be |
| R475 |
T1284 |
T1283 |
amod |
targeted,cells |
| R4750 |
T7969 |
T7967 |
ccomp |
be,suggesting |
| R4751 |
T7970 |
T7971 |
compound |
Snail,promoter |
| R4752 |
T7971 |
T7972 |
compound |
promoter,activity |
| R4753 |
T7972 |
T7969 |
nsubj |
activity,be |
| R4754 |
T7973 |
T7972 |
prep |
in,activity |
| R4755 |
T7974 |
T7973 |
pobj |
keratinocytes,in |
| R4756 |
T7975 |
T7969 |
aux |
might,be |
| R4757 |
T7976 |
T7969 |
acomp |
sensitive,be |
| R4758 |
T7977 |
T7976 |
prep |
to,sensitive |
| R4759 |
T7978 |
T7979 |
compound |
TGF,β2 |
| R476 |
T1285 |
T1280 |
prep |
within,behavior |
| R4760 |
T7979 |
T7981 |
compound |
β2,signaling |
| R4761 |
T7980 |
T7979 |
punct |
-,β2 |
| R4762 |
T7981 |
T7977 |
pobj |
signaling,to |
| R4763 |
T7982 |
T7983 |
punct |
(,5C |
| R4764 |
T7983 |
T7957 |
parataxis |
5C,reflected |
| R4765 |
T7984 |
T7983 |
compound |
Figure,5C |
| R4766 |
T7985 |
T7983 |
punct |
),5C |
| R4767 |
T7986 |
T7957 |
punct |
.,reflected |
| R4768 |
T7988 |
T7989 |
aux |
To,test |
| R4769 |
T7989 |
T7990 |
advcl |
test,engineered |
| R477 |
T1286 |
T1287 |
det |
an,sheet |
| R4770 |
T7991 |
T7992 |
det |
this,possibility |
| R4771 |
T7992 |
T7989 |
dobj |
possibility,test |
| R4772 |
T7993 |
T7990 |
punct |
", ",engineered |
| R4773 |
T7994 |
T7990 |
nsubj |
we,engineered |
| R4774 |
T7995 |
T7996 |
det |
a,transgene |
| R4775 |
T7996 |
T7990 |
dobj |
transgene,engineered |
| R4776 |
T7997 |
T7996 |
acl |
driving,transgene |
| R4777 |
T7998 |
T7999 |
det |
the,reporter |
| R4778 |
T7999 |
T7997 |
dobj |
reporter,driving |
| R4779 |
T8000 |
T8001 |
compound |
β,galactosidase |
| R478 |
T1287 |
T1285 |
pobj |
sheet,within |
| R4780 |
T8001 |
T7999 |
compound |
galactosidase,reporter |
| R4781 |
T8002 |
T8001 |
punct |
-,galactosidase |
| R4782 |
T8003 |
T7997 |
prep |
under,driving |
| R4783 |
T8004 |
T8005 |
det |
the,control |
| R4784 |
T8005 |
T8003 |
pobj |
control,under |
| R4785 |
T8006 |
T8005 |
prep |
of,control |
| R4786 |
T8007 |
T8008 |
advmod |
approximately,2.2 |
| R4787 |
T8008 |
T8009 |
nummod |
2.2,kb |
| R4788 |
T8009 |
T8006 |
pobj |
kb,of |
| R4789 |
T8010 |
T8009 |
prep |
of,kb |
| R479 |
T1288 |
T1287 |
amod |
epithelial,sheet |
| R4790 |
T8011 |
T8012 |
compound |
promoter,sequence |
| R4791 |
T8012 |
T8010 |
pobj |
sequence,of |
| R4792 |
T8013 |
T8012 |
acl |
located,sequence |
| R4793 |
T8014 |
T8013 |
npadvmod |
5,located |
| R4794 |
T8015 |
T8014 |
punct |
′,5 |
| R4795 |
T8016 |
T8014 |
prep |
from,5 |
| R4796 |
T8017 |
T8018 |
det |
the,site |
| R4797 |
T8018 |
T8016 |
pobj |
site,from |
| R4798 |
T8019 |
T8018 |
compound |
transcription,site |
| R4799 |
T8020 |
T8018 |
compound |
initiation,site |
| R480 |
T1289 |
T1269 |
punct |
.,requires |
| R4800 |
T8021 |
T8018 |
prep |
of,site |
| R4801 |
T8022 |
T8023 |
det |
the,gene |
| R4802 |
T8023 |
T8021 |
pobj |
gene,of |
| R4803 |
T8024 |
T8023 |
compound |
mouse,gene |
| R4804 |
T8025 |
T8023 |
compound |
Snail,gene |
| R4805 |
T8026 |
T7990 |
punct |
.,engineered |
| R4806 |
T8028 |
T8029 |
prep |
At,treated |
| R4807 |
T8030 |
T8031 |
nummod |
2,d |
| R4808 |
T8031 |
T8028 |
pobj |
d,At |
| R4809 |
T8032 |
T8031 |
prep |
after,d |
| R481 |
T1291 |
T1292 |
det |
The,process |
| R4810 |
T8033 |
T8034 |
amod |
transient,transfection |
| R4811 |
T8034 |
T8032 |
pobj |
transfection,after |
| R4812 |
T8035 |
T8029 |
punct |
", ",treated |
| R4813 |
T8036 |
T8029 |
nsubjpass |
keratinocytes,treated |
| R4814 |
T8037 |
T8029 |
auxpass |
were,treated |
| R4815 |
T8038 |
T8029 |
prep |
with,treated |
| R4816 |
T8039 |
T8040 |
compound |
TGF,β2 |
| R4817 |
T8040 |
T8038 |
pobj |
β2,with |
| R4818 |
T8041 |
T8040 |
punct |
-,β2 |
| R4819 |
T8042 |
T8043 |
punct |
(,0 |
| R482 |
T1292 |
T1293 |
nsubjpass |
process,accompanied |
| R4820 |
T8043 |
T8029 |
parataxis |
0,treated |
| R4821 |
T8044 |
T8043 |
nsubj |
t,0 |
| R4822 |
T8045 |
T8043 |
punct |
=,0 |
| R4823 |
T8046 |
T8043 |
punct |
),0 |
| R4824 |
T8047 |
T8029 |
cc |
and,treated |
| R4825 |
T8048 |
T8049 |
advmod |
then,assayed |
| R4826 |
T8049 |
T8029 |
conj |
assayed,treated |
| R4827 |
T8050 |
T8049 |
prep |
for,assayed |
| R4828 |
T8051 |
T8052 |
compound |
transgene,activity |
| R4829 |
T8052 |
T8050 |
pobj |
activity,for |
| R483 |
T1294 |
T1293 |
aux |
must,accompanied |
| R4830 |
T8053 |
T8049 |
prep |
over,assayed |
| R4831 |
T8054 |
T8055 |
det |
the,course |
| R4832 |
T8055 |
T8053 |
pobj |
course,over |
| R4833 |
T8056 |
T8055 |
amod |
same,course |
| R4834 |
T8057 |
T8055 |
compound |
time,course |
| R4835 |
T8058 |
T8059 |
prep |
in,observed |
| R4836 |
T8059 |
T8055 |
relcl |
observed,course |
| R4837 |
T8060 |
T8058 |
pobj |
which,in |
| R4838 |
T8061 |
T8059 |
nsubj |
we,observed |
| R4839 |
T8062 |
T8059 |
aux |
had,observed |
| R484 |
T1295 |
T1293 |
auxpass |
be,accompanied |
| R4840 |
T8063 |
T8064 |
compound |
Snail,protein |
| R4841 |
T8064 |
T8065 |
compound |
protein,induction |
| R4842 |
T8065 |
T8059 |
dobj |
induction,observed |
| R4843 |
T8066 |
T8029 |
punct |
.,treated |
| R4844 |
T8068 |
T8069 |
det |
The,results |
| R4845 |
T8069 |
T8070 |
nsubjpass |
results,presented |
| R4846 |
T8071 |
T8069 |
prep |
of,results |
| R4847 |
T8072 |
T8073 |
det |
this,experiment |
| R4848 |
T8073 |
T8071 |
pobj |
experiment,of |
| R4849 |
T8074 |
T8070 |
auxpass |
are,presented |
| R485 |
T1296 |
T1293 |
prep |
by,accompanied |
| R4850 |
T8075 |
T8070 |
prep |
in,presented |
| R4851 |
T8076 |
T8077 |
compound |
Figure,5D |
| R4852 |
T8077 |
T8075 |
pobj |
5D,in |
| R4853 |
T8078 |
T8070 |
punct |
.,presented |
| R4854 |
T8080 |
T8081 |
prep |
Within,increased |
| R4855 |
T8082 |
T8083 |
nummod |
0.5,h |
| R4856 |
T8083 |
T8080 |
pobj |
h,Within |
| R4857 |
T8084 |
T8083 |
prep |
of,h |
| R4858 |
T8085 |
T8086 |
compound |
TGF,β2 |
| R4859 |
T8086 |
T8088 |
compound |
β2,treatment |
| R486 |
T1297 |
T1296 |
pobj |
alterations,by |
| R4860 |
T8087 |
T8086 |
punct |
-,β2 |
| R4861 |
T8088 |
T8084 |
pobj |
treatment,of |
| R4862 |
T8089 |
T8081 |
punct |
", ",increased |
| R4863 |
T8090 |
T8091 |
compound |
Snail,promoter |
| R4864 |
T8091 |
T8092 |
compound |
promoter,activity |
| R4865 |
T8092 |
T8081 |
nsubj |
activity,increased |
| R4866 |
T8093 |
T8081 |
aux |
had,increased |
| R4867 |
T8094 |
T8081 |
advmod |
3-fold,increased |
| R4868 |
T8095 |
T8081 |
punct |
", ",increased |
| R4869 |
T8096 |
T8081 |
cc |
and,increased |
| R487 |
T1298 |
T1297 |
prep |
in,alterations |
| R4870 |
T8097 |
T8098 |
prep |
by,peaked |
| R4871 |
T8098 |
T8081 |
conj |
peaked,increased |
| R4872 |
T8099 |
T8100 |
nummod |
2,h |
| R4873 |
T8100 |
T8097 |
pobj |
h,by |
| R4874 |
T8101 |
T8098 |
punct |
", ",peaked |
| R4875 |
T8102 |
T8098 |
nsubj |
it,peaked |
| R4876 |
T8103 |
T8098 |
prep |
to,peaked |
| R4877 |
T8104 |
T8105 |
advmod |
approximately,10-fold |
| R4878 |
T8105 |
T8103 |
pcomp |
10-fold,to |
| R4879 |
T8106 |
T8105 |
prep |
over,10-fold |
| R488 |
T1299 |
T1300 |
det |
the,proliferation |
| R4880 |
T8107 |
T8108 |
compound |
control,levels |
| R4881 |
T8108 |
T8106 |
pobj |
levels,over |
| R4882 |
T8109 |
T8110 |
punct |
(,5D |
| R4883 |
T8110 |
T8098 |
parataxis |
5D,peaked |
| R4884 |
T8111 |
T8110 |
compound |
Figure,5D |
| R4885 |
T8112 |
T8110 |
punct |
),5D |
| R4886 |
T8113 |
T8098 |
punct |
.,peaked |
| R4887 |
T8115 |
T8116 |
advmod |
Thereafter,returned |
| R4888 |
T8117 |
T8116 |
punct |
", ",returned |
| R4889 |
T8118 |
T8119 |
compound |
Snail,promoter |
| R489 |
T1300 |
T1298 |
pobj |
proliferation,in |
| R4890 |
T8119 |
T8120 |
compound |
promoter,activity |
| R4891 |
T8120 |
T8116 |
nsubj |
activity,returned |
| R4892 |
T8121 |
T8116 |
advmod |
rapidly,returned |
| R4893 |
T8122 |
T8116 |
prep |
to,returned |
| R4894 |
T8123 |
T8124 |
det |
the,levels |
| R4895 |
T8124 |
T8122 |
pobj |
levels,to |
| R4896 |
T8125 |
T8124 |
amod |
basal,levels |
| R4897 |
T8126 |
T8124 |
acl |
seen,levels |
| R4898 |
T8127 |
T8126 |
prep |
in,seen |
| R4899 |
T8128 |
T8129 |
amod |
unstimulated,keratinocytes |
| R490 |
T1301 |
T1300 |
punct |
", ",proliferation |
| R4900 |
T8129 |
T8127 |
pobj |
keratinocytes,in |
| R4901 |
T8130 |
T8116 |
punct |
.,returned |
| R4902 |
T8132 |
T8133 |
det |
The,kinetics |
| R4903 |
T8133 |
T8134 |
nsubj |
kinetics,paralleled |
| R4904 |
T8135 |
T8133 |
prep |
of,kinetics |
| R4905 |
T8136 |
T8137 |
compound |
Snail,promoter |
| R4906 |
T8137 |
T8138 |
compound |
promoter,activity |
| R4907 |
T8138 |
T8135 |
pobj |
activity,of |
| R4908 |
T8139 |
T8134 |
advmod |
closely,paralleled |
| R4909 |
T8140 |
T8134 |
dobj |
those,paralleled |
| R491 |
T1302 |
T1300 |
conj |
polarity,proliferation |
| R4910 |
T8141 |
T8140 |
acl |
observed,those |
| R4911 |
T8142 |
T8141 |
prep |
for,observed |
| R4912 |
T8143 |
T8144 |
compound |
Snail,protein |
| R4913 |
T8144 |
T8145 |
compound |
protein,induction |
| R4914 |
T8145 |
T8142 |
pobj |
induction,for |
| R4915 |
T8146 |
T8134 |
punct |
.,paralleled |
| R4916 |
T8148 |
T8149 |
advmod |
Moreover,appeared |
| R4917 |
T8150 |
T8149 |
punct |
", ",appeared |
| R4918 |
T8151 |
T8152 |
det |
the,effects |
| R4919 |
T8152 |
T8149 |
nsubj |
effects,appeared |
| R492 |
T1303 |
T1302 |
punct |
", ",polarity |
| R4920 |
T8153 |
T8152 |
amod |
stimulatory,effects |
| R4921 |
T8154 |
T8155 |
aux |
to,be |
| R4922 |
T8155 |
T8149 |
xcomp |
be,appeared |
| R4923 |
T8156 |
T8155 |
acomp |
specific,be |
| R4924 |
T8157 |
T8156 |
prep |
to,specific |
| R4925 |
T8158 |
T8159 |
compound |
TGF,β2 |
| R4926 |
T8159 |
T8157 |
pobj |
β2,to |
| R4927 |
T8160 |
T8159 |
punct |
-,β2 |
| R4928 |
T8161 |
T8155 |
punct |
", ",be |
| R4929 |
T8162 |
T8163 |
mark |
since,abrogated |
| R493 |
T1304 |
T1302 |
conj |
shape,polarity |
| R4930 |
T8163 |
T8155 |
advcl |
abrogated,be |
| R4931 |
T8164 |
T8163 |
nsubjpass |
they,abrogated |
| R4932 |
T8165 |
T8163 |
auxpass |
were,abrogated |
| R4933 |
T8166 |
T8167 |
preconj |
either,by |
| R4934 |
T8167 |
T8163 |
prep |
by,abrogated |
| R4935 |
T8168 |
T8169 |
compound |
heat,inactivation |
| R4936 |
T8169 |
T8167 |
pobj |
inactivation,by |
| R4937 |
T8170 |
T8169 |
prep |
of,inactivation |
| R4938 |
T8171 |
T8172 |
det |
the,protein |
| R4939 |
T8172 |
T8170 |
pobj |
protein,of |
| R494 |
T1305 |
T1304 |
punct |
", ",shape |
| R4940 |
T8173 |
T8174 |
compound |
TGF,β2 |
| R4941 |
T8174 |
T8172 |
compound |
β2,protein |
| R4942 |
T8175 |
T8174 |
punct |
-,β2 |
| R4943 |
T8176 |
T8167 |
cc |
or,by |
| R4944 |
T8177 |
T8167 |
conj |
by,by |
| R4945 |
T8178 |
T8177 |
pobj |
mutation,by |
| R4946 |
T8179 |
T8178 |
prep |
of,mutation |
| R4947 |
T8180 |
T8181 |
det |
a,element |
| R4948 |
T8181 |
T8179 |
pobj |
element,of |
| R4949 |
T8182 |
T8181 |
amod |
putative,element |
| R495 |
T1306 |
T1304 |
cc |
and,shape |
| R4950 |
T8183 |
T8184 |
compound |
SMAD,binding |
| R4951 |
T8184 |
T8181 |
compound |
binding,element |
| R4952 |
T8185 |
T8181 |
acl |
located,element |
| R4953 |
T8186 |
T8187 |
quantmod |
about,1.8 |
| R4954 |
T8187 |
T8188 |
nummod |
1.8,kb |
| R4955 |
T8188 |
T8185 |
npadvmod |
kb,located |
| R4956 |
T8189 |
T8188 |
nummod |
5,kb |
| R4957 |
T8190 |
T8188 |
punct |
′,kb |
| R4958 |
T8191 |
T8188 |
prep |
from,kb |
| R4959 |
T8192 |
T8193 |
det |
the,site |
| R496 |
T1307 |
T1304 |
conj |
adhesiveness,shape |
| R4960 |
T8193 |
T8191 |
pobj |
site,from |
| R4961 |
T8194 |
T8193 |
compound |
Snail,site |
| R4962 |
T8195 |
T8193 |
compound |
transcription,site |
| R4963 |
T8196 |
T8193 |
compound |
start,site |
| R4964 |
T8197 |
T8198 |
punct |
(,5D |
| R4965 |
T8198 |
T8163 |
parataxis |
5D,abrogated |
| R4966 |
T8199 |
T8198 |
compound |
Figure,5D |
| R4967 |
T8200 |
T8198 |
punct |
),5D |
| R4968 |
T8201 |
T8149 |
punct |
.,appeared |
| R4969 |
T8203 |
T8204 |
advcl |
Taken,suggested |
| R497 |
T1308 |
T1300 |
prep |
of,proliferation |
| R4970 |
T8205 |
T8203 |
advmod |
together,Taken |
| R4971 |
T8206 |
T8204 |
punct |
", ",suggested |
| R4972 |
T8207 |
T8208 |
det |
these,results |
| R4973 |
T8208 |
T8204 |
nsubj |
results,suggested |
| R4974 |
T8209 |
T8210 |
mark |
that,results |
| R4975 |
T8210 |
T8204 |
advcl |
results,suggested |
| R4976 |
T8211 |
T8210 |
prep |
in,results |
| R4977 |
T8212 |
T8211 |
pobj |
keratinocytes,in |
| R4978 |
T8213 |
T8210 |
punct |
", ",results |
| R4979 |
T8214 |
T8215 |
compound |
TGF,β2 |
| R498 |
T1309 |
T1310 |
amod |
selected,cells |
| R4980 |
T8215 |
T8217 |
compound |
β2,signaling |
| R4981 |
T8216 |
T8215 |
punct |
-,β2 |
| R4982 |
T8217 |
T8210 |
nsubj |
signaling,results |
| R4983 |
T8218 |
T8210 |
prep |
in,results |
| R4984 |
T8219 |
T8220 |
det |
a,activation |
| R4985 |
T8220 |
T8218 |
pobj |
activation,in |
| R4986 |
T8221 |
T8222 |
npadvmod |
pSMAD2,dependent |
| R4987 |
T8222 |
T8220 |
amod |
dependent,activation |
| R4988 |
T8223 |
T8222 |
punct |
-,dependent |
| R4989 |
T8224 |
T8220 |
amod |
transient,activation |
| R499 |
T1310 |
T1308 |
pobj |
cells,of |
| R4990 |
T8225 |
T8220 |
prep |
of,activation |
| R4991 |
T8226 |
T8227 |
det |
the,gene |
| R4992 |
T8227 |
T8225 |
pobj |
gene,of |
| R4993 |
T8228 |
T8227 |
compound |
Snail,gene |
| R4994 |
T8229 |
T8210 |
punct |
", ",results |
| R4995 |
T8230 |
T8210 |
cc |
and,results |
| R4996 |
T8231 |
T8232 |
mark |
that,relies |
| R4997 |
T8232 |
T8210 |
conj |
relies,results |
| R4998 |
T8233 |
T8232 |
nsubj |
maintenance,relies |
| R4999 |
T8234 |
T8233 |
prep |
of,maintenance |
| R500 |
T1311 |
T1296 |
punct |
", ",by |
| R5000 |
T8235 |
T8236 |
compound |
Snail,protein |
| R5001 |
T8236 |
T8234 |
pobj |
protein,of |
| R5002 |
T8237 |
T8232 |
punct |
", ",relies |
| R5003 |
T8238 |
T8232 |
prep |
in,relies |
| R5004 |
T8239 |
T8238 |
pobj |
part,in |
| R5005 |
T8240 |
T8232 |
punct |
", ",relies |
| R5006 |
T8241 |
T8232 |
prep |
upon,relies |
| R5007 |
T8242 |
T8243 |
amod |
sustained,activity |
| R5008 |
T8243 |
T8241 |
pobj |
activity,upon |
| R5009 |
T8244 |
T8243 |
compound |
promoter,activity |
| R501 |
T1312 |
T1313 |
advmod |
as,as |
| R5010 |
T8245 |
T8204 |
punct |
.,suggested |
| R5011 |
T8247 |
T8248 |
det |
The,brevity |
| R5012 |
T8248 |
T8249 |
nsubj |
brevity,resembled |
| R5013 |
T8250 |
T8248 |
prep |
of,brevity |
| R5014 |
T8251 |
T8252 |
nmod |
Snail,gene |
| R5015 |
T8252 |
T8253 |
nmod |
gene,induction |
| R5016 |
T8253 |
T8250 |
pobj |
induction,of |
| R5017 |
T8254 |
T8252 |
cc |
and,gene |
| R5018 |
T8255 |
T8252 |
conj |
protein,gene |
| R5019 |
T8256 |
T8253 |
prep |
in,induction |
| R502 |
T1313 |
T1296 |
cc |
as,by |
| R5020 |
T8257 |
T8258 |
compound |
TGF,β2 |
| R5021 |
T8258 |
T8260 |
npadvmod |
β2,treated |
| R5022 |
T8259 |
T8258 |
punct |
-,β2 |
| R5023 |
T8260 |
T8261 |
amod |
treated,keratinocytes |
| R5024 |
T8261 |
T8256 |
pobj |
keratinocytes,in |
| R5025 |
T8262 |
T8261 |
amod |
cultured,keratinocytes |
| R5026 |
T8263 |
T8264 |
det |
the,appearance |
| R5027 |
T8264 |
T8249 |
dobj |
appearance,resembled |
| R5028 |
T8265 |
T8264 |
amod |
temporal,appearance |
| R5029 |
T8266 |
T8264 |
prep |
of,appearance |
| R503 |
T1314 |
T1313 |
advmod |
well,as |
| R5030 |
T8267 |
T8268 |
compound |
Snail,mRNA |
| R5031 |
T8268 |
T8266 |
pobj |
mRNA,of |
| R5032 |
T8269 |
T8268 |
cc |
and,mRNA |
| R5033 |
T8270 |
T8268 |
conj |
protein,mRNA |
| R5034 |
T8271 |
T8264 |
prep |
at,appearance |
| R5035 |
T8272 |
T8273 |
det |
the,initiation |
| R5036 |
T8273 |
T8271 |
pobj |
initiation,at |
| R5037 |
T8274 |
T8273 |
prep |
of,initiation |
| R5038 |
T8275 |
T8276 |
compound |
hair,follicle |
| R5039 |
T8276 |
T8277 |
compound |
follicle,morphogenesis |
| R504 |
T1315 |
T1296 |
conj |
by,by |
| R5040 |
T8277 |
T8274 |
pobj |
morphogenesis,of |
| R5041 |
T8278 |
T8249 |
prep |
in,resembled |
| R5042 |
T8279 |
T8280 |
amod |
embryonic,skin |
| R5043 |
T8280 |
T8278 |
pobj |
skin,in |
| R5044 |
T8281 |
T8280 |
compound |
mouse,skin |
| R5045 |
T8282 |
T8249 |
punct |
.,resembled |
| R5046 |
T8284 |
T8285 |
aux |
To,test |
| R5047 |
T8285 |
T8286 |
advcl |
test,analyzed |
| R5048 |
T8287 |
T8288 |
mark |
whether,required |
| R5049 |
T8288 |
T8285 |
ccomp |
required,test |
| R505 |
T1316 |
T1315 |
pobj |
modifications,by |
| R5050 |
T8289 |
T8290 |
compound |
TGF,β2 |
| R5051 |
T8290 |
T8288 |
nsubjpass |
β2,required |
| R5052 |
T8291 |
T8290 |
punct |
-,β2 |
| R5053 |
T8292 |
T8288 |
aux |
might,required |
| R5054 |
T8293 |
T8288 |
auxpass |
be,required |
| R5055 |
T8294 |
T8288 |
prep |
for,required |
| R5056 |
T8295 |
T8296 |
compound |
Snail,induction |
| R5057 |
T8296 |
T8294 |
pobj |
induction,for |
| R5058 |
T8297 |
T8296 |
prep |
in,induction |
| R5059 |
T8298 |
T8299 |
compound |
hair,bud |
| R506 |
T1317 |
T1316 |
prep |
in,modifications |
| R5060 |
T8299 |
T8300 |
compound |
bud,formation |
| R5061 |
T8300 |
T8297 |
pobj |
formation,in |
| R5062 |
T8301 |
T8302 |
advmod |
in,vivo |
| R5063 |
T8302 |
T8288 |
advmod |
vivo,required |
| R5064 |
T8303 |
T8286 |
punct |
", ",analyzed |
| R5065 |
T8304 |
T8286 |
nsubj |
we,analyzed |
| R5066 |
T8305 |
T8286 |
advmod |
first,analyzed |
| R5067 |
T8306 |
T8307 |
mark |
whether,expressed |
| R5068 |
T8307 |
T8286 |
ccomp |
expressed,analyzed |
| R5069 |
T8308 |
T8309 |
compound |
TGF,β2 |
| R507 |
T1318 |
T1319 |
poss |
their,lamina |
| R5070 |
T8309 |
T8307 |
nsubjpass |
β2,expressed |
| R5071 |
T8310 |
T8309 |
punct |
-,β2 |
| R5072 |
T8311 |
T8307 |
auxpass |
was,expressed |
| R5073 |
T8312 |
T8307 |
prep |
in,expressed |
| R5074 |
T8313 |
T8312 |
cc |
or,in |
| R5075 |
T8314 |
T8312 |
conj |
around,in |
| R5076 |
T8315 |
T8316 |
det |
the,bud |
| R5077 |
T8316 |
T8314 |
pobj |
bud,around |
| R5078 |
T8317 |
T8316 |
compound |
hair,bud |
| R5079 |
T8318 |
T8286 |
punct |
.,analyzed |
| R508 |
T1319 |
T1317 |
pobj |
lamina,in |
| R5080 |
T8320 |
T8321 |
advcl |
Consistent,labeled |
| R5081 |
T8322 |
T8320 |
prep |
with,Consistent |
| R5082 |
T8323 |
T8324 |
amod |
previous,observations |
| R5083 |
T8324 |
T8322 |
pobj |
observations,with |
| R5084 |
T8325 |
T8326 |
punct |
[,33 |
| R5085 |
T8326 |
T8320 |
parataxis |
33,Consistent |
| R5086 |
T8327 |
T8326 |
punct |
],33 |
| R5087 |
T8328 |
T8321 |
punct |
", ",labeled |
| R5088 |
T8329 |
T8330 |
det |
an,antibody |
| R5089 |
T8330 |
T8321 |
nsubj |
antibody,labeled |
| R509 |
T1320 |
T1319 |
amod |
underlying,lamina |
| R5090 |
T8331 |
T8332 |
amod |
anti-TGF,β2 |
| R5091 |
T8332 |
T8330 |
compound |
β2,antibody |
| R5092 |
T8333 |
T8332 |
punct |
-,β2 |
| R5093 |
T8334 |
T8335 |
amod |
developing,buds |
| R5094 |
T8335 |
T8321 |
dobj |
buds,labeled |
| R5095 |
T8336 |
T8335 |
compound |
hair,buds |
| R5096 |
T8337 |
T8338 |
punct |
(,6A |
| R5097 |
T8338 |
T8321 |
parataxis |
6A,labeled |
| R5098 |
T8339 |
T8338 |
compound |
Figure,6A |
| R5099 |
T8340 |
T8338 |
punct |
),6A |
| R510 |
T1321 |
T1319 |
amod |
basal,lamina |
| R5100 |
T8341 |
T8321 |
punct |
.,labeled |
| R5101 |
T8343 |
T8344 |
det |
This,labeling |
| R5102 |
T8344 |
T8345 |
nsubj |
labeling,appeared |
| R5103 |
T8346 |
T8347 |
aux |
to,be |
| R5104 |
T8347 |
T8345 |
xcomp |
be,appeared |
| R5105 |
T8348 |
T8347 |
acomp |
specific,be |
| R5106 |
T8349 |
T8350 |
mark |
as,judged |
| R5107 |
T8350 |
T8347 |
advcl |
judged,be |
| R5108 |
T8351 |
T8350 |
prep |
by,judged |
| R5109 |
T8352 |
T8353 |
det |
the,lack |
| R511 |
T1322 |
T1293 |
punct |
.,accompanied |
| R5110 |
T8353 |
T8351 |
pobj |
lack,by |
| R5111 |
T8354 |
T8353 |
prep |
of,lack |
| R5112 |
T8355 |
T8354 |
pobj |
staining,of |
| R5113 |
T8356 |
T8353 |
prep |
in,lack |
| R5114 |
T8357 |
T8358 |
compound |
follicle,buds |
| R5115 |
T8358 |
T8356 |
pobj |
buds,in |
| R5116 |
T8359 |
T8358 |
prep |
from,buds |
| R5117 |
T8360 |
T8359 |
pobj |
mice,from |
| R5118 |
T8361 |
T8360 |
amod |
homozygous,mice |
| R5119 |
T8362 |
T8361 |
prep |
for,homozygous |
| R512 |
T1324 |
T1325 |
advmod |
Thus,orchestrated |
| R5120 |
T8363 |
T8364 |
det |
a,mutation |
| R5121 |
T8364 |
T8362 |
pobj |
mutation,for |
| R5122 |
T8365 |
T8366 |
nmod |
TGF,β2 |
| R5123 |
T8366 |
T8364 |
nmod |
β2,mutation |
| R5124 |
T8367 |
T8366 |
punct |
-,β2 |
| R5125 |
T8368 |
T8364 |
amod |
null,mutation |
| R5126 |
T8369 |
T8370 |
punct |
(,34 |
| R5127 |
T8370 |
T8345 |
parataxis |
34,appeared |
| R5128 |
T8371 |
T8372 |
compound |
Figure,6A |
| R5129 |
T8372 |
T8370 |
dep |
6A,34 |
| R513 |
T1326 |
T1325 |
punct |
", ",orchestrated |
| R5130 |
T8373 |
T8370 |
punct |
;,34 |
| R5131 |
T8374 |
T8370 |
punct |
[,34 |
| R5132 |
T8375 |
T8370 |
punct |
],34 |
| R5133 |
T8376 |
T8370 |
punct |
),34 |
| R5134 |
T8377 |
T8345 |
punct |
.,appeared |
| R5135 |
T8379 |
T8380 |
advmod |
Moreover,expressed |
| R5136 |
T8381 |
T8380 |
punct |
", ",expressed |
| R5137 |
T8382 |
T8383 |
det |
the,effector |
| R5138 |
T8383 |
T8380 |
nsubjpass |
effector,expressed |
| R5139 |
T8384 |
T8383 |
amod |
downstream,effector |
| R514 |
T1327 |
T1328 |
amod |
extracellular,crosstalk |
| R5140 |
T8385 |
T8383 |
prep |
of,effector |
| R5141 |
T8386 |
T8387 |
compound |
TGF,β2 |
| R5142 |
T8387 |
T8389 |
compound |
β2,signaling |
| R5143 |
T8388 |
T8387 |
punct |
-,β2 |
| R5144 |
T8389 |
T8385 |
pobj |
signaling,of |
| R5145 |
T8390 |
T8383 |
punct |
", ",effector |
| R5146 |
T8391 |
T8383 |
appos |
pSMAD2,effector |
| R5147 |
T8392 |
T8380 |
punct |
", ",expressed |
| R5148 |
T8393 |
T8380 |
auxpass |
was,expressed |
| R5149 |
T8394 |
T8380 |
advmod |
also,expressed |
| R515 |
T1328 |
T1325 |
nsubjpass |
crosstalk,orchestrated |
| R5150 |
T8395 |
T8380 |
prep |
in,expressed |
| R5151 |
T8396 |
T8397 |
nmod |
WT,buds |
| R5152 |
T8397 |
T8395 |
pobj |
buds,in |
| R5153 |
T8398 |
T8396 |
punct |
", ",WT |
| R5154 |
T8399 |
T8396 |
cc |
but,WT |
| R5155 |
T8400 |
T8399 |
neg |
not,but |
| R5156 |
T8401 |
T8402 |
compound |
TGF,β2 |
| R5157 |
T8402 |
T8404 |
npadvmod |
β2,null |
| R5158 |
T8403 |
T8402 |
punct |
-,β2 |
| R5159 |
T8404 |
T8396 |
conj |
null,WT |
| R516 |
T1329 |
T1330 |
amod |
epithelial,mesenchymal |
| R5160 |
T8405 |
T8404 |
punct |
-,null |
| R5161 |
T8406 |
T8397 |
punct |
", ",buds |
| R5162 |
T8407 |
T8397 |
compound |
hair,buds |
| R5163 |
T8408 |
T8409 |
punct |
(,6B |
| R5164 |
T8409 |
T8380 |
parataxis |
6B,expressed |
| R5165 |
T8410 |
T8409 |
compound |
Figure,6B |
| R5166 |
T8411 |
T8409 |
punct |
),6B |
| R5167 |
T8412 |
T8380 |
punct |
.,expressed |
| R5168 |
T8414 |
T8415 |
advmod |
Together,underscore |
| R5169 |
T8416 |
T8415 |
punct |
", ",underscore |
| R517 |
T1330 |
T1328 |
amod |
mesenchymal,crosstalk |
| R5170 |
T8417 |
T8418 |
det |
these,data |
| R5171 |
T8418 |
T8415 |
nsubj |
data,underscore |
| R5172 |
T8419 |
T8420 |
det |
the,importance |
| R5173 |
T8420 |
T8415 |
dobj |
importance,underscore |
| R5174 |
T8421 |
T8420 |
prep |
of,importance |
| R5175 |
T8422 |
T8423 |
det |
the,isoform |
| R5176 |
T8423 |
T8421 |
pobj |
isoform,of |
| R5177 |
T8424 |
T8425 |
compound |
TGF,β2 |
| R5178 |
T8425 |
T8423 |
compound |
β2,isoform |
| R5179 |
T8426 |
T8425 |
punct |
-,β2 |
| R518 |
T1331 |
T1330 |
punct |
-,mesenchymal |
| R5180 |
T8427 |
T8415 |
prep |
despite,underscore |
| R5181 |
T8428 |
T8427 |
pobj |
expression,despite |
| R5182 |
T8429 |
T8428 |
prep |
of,expression |
| R5183 |
T8430 |
T8431 |
preconj |
both,β1 |
| R5184 |
T8431 |
T8429 |
pobj |
β1,of |
| R5185 |
T8432 |
T8431 |
compound |
TGF,β1 |
| R5186 |
T8433 |
T8431 |
punct |
-,β1 |
| R5187 |
T8434 |
T8431 |
cc |
and,β1 |
| R5188 |
T8435 |
T8436 |
compound |
TGF,β2 |
| R5189 |
T8436 |
T8431 |
conj |
β2,β1 |
| R519 |
T1332 |
T1325 |
aux |
must,orchestrated |
| R5190 |
T8437 |
T8436 |
punct |
-,β2 |
| R5191 |
T8438 |
T8428 |
prep |
in,expression |
| R5192 |
T8439 |
T8440 |
amod |
developing,buds |
| R5193 |
T8440 |
T8438 |
pobj |
buds,in |
| R5194 |
T8441 |
T8440 |
compound |
hair,buds |
| R5195 |
T8442 |
T8428 |
prep |
at,expression |
| R5196 |
T8443 |
T8444 |
det |
this,stage |
| R5197 |
T8444 |
T8442 |
pobj |
stage,at |
| R5198 |
T8445 |
T8415 |
punct |
.,underscore |
| R5199 |
T8447 |
T8448 |
aux |
To,explore |
| R520 |
T1333 |
T1325 |
auxpass |
be,orchestrated |
| R5200 |
T8448 |
T8450 |
advcl |
explore,examined |
| R5201 |
T8449 |
T8448 |
advmod |
further,explore |
| R5202 |
T8451 |
T8452 |
det |
the,relation |
| R5203 |
T8452 |
T8448 |
dobj |
relation,explore |
| R5204 |
T8453 |
T8452 |
amod |
possible,relation |
| R5205 |
T8454 |
T8452 |
prep |
between,relation |
| R5206 |
T8455 |
T8454 |
pobj |
Snail,between |
| R5207 |
T8456 |
T8455 |
cc |
and,Snail |
| R5208 |
T8457 |
T8458 |
compound |
TGF,β2 |
| R5209 |
T8458 |
T8455 |
conj |
β2,Snail |
| R521 |
T1334 |
T1325 |
advmod |
intricately,orchestrated |
| R5210 |
T8459 |
T8458 |
punct |
-,β2 |
| R5211 |
T8460 |
T8450 |
punct |
", ",examined |
| R5212 |
T8461 |
T8450 |
nsubj |
we,examined |
| R5213 |
T8462 |
T8463 |
det |
the,status |
| R5214 |
T8463 |
T8450 |
dobj |
status,examined |
| R5215 |
T8464 |
T8463 |
prep |
of,status |
| R5216 |
T8465 |
T8466 |
compound |
Snail,expression |
| R5217 |
T8466 |
T8464 |
pobj |
expression,of |
| R5218 |
T8467 |
T8463 |
prep |
in,status |
| R5219 |
T8468 |
T8469 |
compound |
TGF,β2 |
| R522 |
T1335 |
T1336 |
aux |
to,couple |
| R5220 |
T8469 |
T8471 |
npadvmod |
β2,null |
| R5221 |
T8470 |
T8469 |
punct |
-,β2 |
| R5222 |
T8471 |
T8473 |
amod |
null,buds |
| R5223 |
T8472 |
T8471 |
punct |
-,null |
| R5224 |
T8473 |
T8467 |
pobj |
buds,in |
| R5225 |
T8474 |
T8473 |
compound |
hair,buds |
| R5226 |
T8475 |
T8450 |
punct |
.,examined |
| R5227 |
T8477 |
T8478 |
mark |
As,judged |
| R5228 |
T8478 |
T8479 |
advcl |
judged,was |
| R5229 |
T8480 |
T8478 |
prep |
by,judged |
| R523 |
T1336 |
T1325 |
advcl |
couple,orchestrated |
| R5230 |
T8481 |
T8480 |
pobj |
immunohistochemistry,by |
| R5231 |
T8482 |
T8479 |
punct |
", ",was |
| R5232 |
T8483 |
T8484 |
compound |
Snail,protein |
| R5233 |
T8484 |
T8479 |
nsubj |
protein,was |
| R5234 |
T8485 |
T8479 |
acomp |
absent,was |
| R5235 |
T8486 |
T8485 |
prep |
from,absent |
| R5236 |
T8487 |
T8488 |
compound |
E17.5,skin |
| R5237 |
T8488 |
T8486 |
pobj |
skin,from |
| R5238 |
T8489 |
T8488 |
prep |
of,skin |
| R5239 |
T8490 |
T8491 |
compound |
TGF,β2 |
| R524 |
T1337 |
T1338 |
det |
the,determination |
| R5240 |
T8491 |
T8493 |
npadvmod |
β2,null |
| R5241 |
T8492 |
T8491 |
punct |
-,β2 |
| R5242 |
T8493 |
T8495 |
amod |
null,embryos |
| R5243 |
T8494 |
T8493 |
punct |
-,null |
| R5244 |
T8495 |
T8489 |
pobj |
embryos,of |
| R5245 |
T8496 |
T8486 |
cc |
but,from |
| R5246 |
T8497 |
T8496 |
neg |
not,but |
| R5247 |
T8498 |
T8486 |
conj |
from,from |
| R5248 |
T8499 |
T8498 |
pobj |
that,from |
| R5249 |
T8500 |
T8499 |
prep |
of,that |
| R525 |
T1338 |
T1336 |
dobj |
determination,couple |
| R5250 |
T8501 |
T8502 |
compound |
control,littermates |
| R5251 |
T8502 |
T8500 |
pobj |
littermates,of |
| R5252 |
T8503 |
T8504 |
punct |
(,6C |
| R5253 |
T8504 |
T8479 |
parataxis |
6C,was |
| R5254 |
T8505 |
T8504 |
compound |
Figure,6C |
| R5255 |
T8506 |
T8504 |
punct |
),6C |
| R5256 |
T8507 |
T8479 |
punct |
.,was |
| R5257 |
T8509 |
T8510 |
det |
This,effect |
| R5258 |
T8510 |
T8511 |
nsubj |
effect,appeared |
| R5259 |
T8512 |
T8513 |
aux |
to,exerted |
| R526 |
T1339 |
T1338 |
prep |
of,determination |
| R5260 |
T8513 |
T8511 |
xcomp |
exerted,appeared |
| R5261 |
T8514 |
T8513 |
auxpass |
be,exerted |
| R5262 |
T8515 |
T8513 |
prep |
at,exerted |
| R5263 |
T8516 |
T8517 |
det |
the,level |
| R5264 |
T8517 |
T8515 |
pobj |
level,at |
| R5265 |
T8518 |
T8517 |
amod |
transcriptional,level |
| R5266 |
T8519 |
T8511 |
punct |
", ",appeared |
| R5267 |
T8520 |
T8521 |
mark |
since,found |
| R5268 |
T8521 |
T8511 |
advcl |
found,appeared |
| R5269 |
T8522 |
T8523 |
compound |
Snail,mRNAs |
| R527 |
T1340 |
T1341 |
amod |
distinct,fates |
| R5270 |
T8523 |
T8521 |
nsubjpass |
mRNAs,found |
| R5271 |
T8524 |
T8521 |
auxpass |
were,found |
| R5272 |
T8525 |
T8521 |
advmod |
also,found |
| R5273 |
T8526 |
T8521 |
neg |
not,found |
| R5274 |
T8527 |
T8521 |
prep |
in,found |
| R5275 |
T8528 |
T8529 |
compound |
TGF,β2 |
| R5276 |
T8529 |
T8531 |
npadvmod |
β2,null |
| R5277 |
T8530 |
T8529 |
punct |
-,β2 |
| R5278 |
T8531 |
T8532 |
amod |
null,buds |
| R5279 |
T8532 |
T8527 |
pobj |
buds,in |
| R528 |
T1341 |
T1339 |
pobj |
fates,of |
| R5280 |
T8533 |
T8532 |
compound |
hair,buds |
| R5281 |
T8534 |
T8521 |
prep |
under,found |
| R5282 |
T8535 |
T8534 |
pobj |
conditions,under |
| R5283 |
T8536 |
T8537 |
prep |
in,detected |
| R5284 |
T8537 |
T8535 |
relcl |
detected,conditions |
| R5285 |
T8538 |
T8536 |
pobj |
which,in |
| R5286 |
T8539 |
T8540 |
det |
the,signal |
| R5287 |
T8559 |
T8557 |
prep |
in,detected |
| R5288 |
T8540 |
T8537 |
nsubjpass |
signal,detected |
| R5289 |
T8541 |
T8537 |
auxpass |
was,detected |
| R529 |
T1342 |
T1341 |
compound |
cell,fates |
| R5290 |
T8560 |
T8561 |
nummod |
2,wk |
| R5291 |
T8561 |
T8563 |
npadvmod |
wk,old |
| R5292 |
T8542 |
T8537 |
advmod |
readily,detected |
| R5293 |
T8562 |
T8561 |
punct |
-,wk |
| R5294 |
T8563 |
T8565 |
amod |
old,mice |
| R5295 |
T8564 |
T8563 |
punct |
-,old |
| R5296 |
T8543 |
T8537 |
prep |
in,detected |
| R5297 |
T8565 |
T8559 |
pobj |
mice,in |
| R5298 |
T8566 |
T8567 |
compound |
K14,Smad2 |
| R5299 |
T8567 |
T8565 |
compound |
Smad2,mice |
| R530 |
T1343 |
T1336 |
prep |
with,couple |
| R5300 |
T8568 |
T8567 |
punct |
-,Smad2 |
| R5301 |
T8569 |
T8565 |
compound |
Tg,mice |
| R5302 |
T8544 |
T8545 |
det |
the,buds |
| R5303 |
T8570 |
T8565 |
punct |
", ",mice |
| R5304 |
T8571 |
T8572 |
dep |
which,display |
| R5305 |
T8572 |
T8565 |
relcl |
display,mice |
| R5306 |
T8545 |
T8543 |
pobj |
buds,in |
| R5307 |
T8573 |
T8574 |
amod |
elevated,signaling |
| R5308 |
T8546 |
T8545 |
compound |
hair,buds |
| R5309 |
T8574 |
T8572 |
dobj |
signaling,display |
| R531 |
T1344 |
T1345 |
det |
the,remodeling |
| R5310 |
T8575 |
T8576 |
compound |
TGF,β |
| R5311 |
T8547 |
T8545 |
prep |
of,buds |
| R5312 |
T8576 |
T8574 |
compound |
β,signaling |
| R5313 |
T8577 |
T8576 |
punct |
-,β |
| R5314 |
T8578 |
T8572 |
prep |
in,display |
| R5315 |
T8548 |
T8549 |
compound |
littermate,skin |
| R5316 |
T8549 |
T8547 |
pobj |
skin,of |
| R5317 |
T8579 |
T8578 |
pobj |
skin,in |
| R5318 |
T8580 |
T8581 |
punct |
[,35 |
| R5319 |
T8550 |
T8551 |
punct |
(,6D |
| R532 |
T1345 |
T1343 |
pobj |
remodeling,with |
| R5320 |
T8581 |
T8559 |
parataxis |
35,in |
| R5321 |
T8582 |
T8581 |
punct |
],35 |
| R5322 |
T8583 |
T8557 |
punct |
", ",detected |
| R5323 |
T8551 |
T8521 |
parataxis |
6D,found |
| R5324 |
T8584 |
T8585 |
compound |
Snail,protein |
| R5325 |
T8585 |
T8557 |
nsubjpass |
protein,detected |
| R5326 |
T8552 |
T8551 |
compound |
Figure,6D |
| R5327 |
T8586 |
T8557 |
auxpass |
was,detected |
| R5328 |
T8587 |
T8557 |
advmod |
readily,detected |
| R5329 |
T8553 |
T8551 |
punct |
),6D |
| R533 |
T1346 |
T1345 |
amod |
contemporaneous,remodeling |
| R5330 |
T8588 |
T8557 |
prep |
by,detected |
| R5331 |
T8554 |
T8511 |
punct |
.,appeared |
| R5332 |
T8589 |
T8590 |
compound |
Western,blot |
| R5333 |
T8590 |
T8591 |
compound |
blot,analyses |
| R5334 |
T8591 |
T8588 |
pobj |
analyses,by |
| R5335 |
T8592 |
T8557 |
punct |
", ",detected |
| R5336 |
T8593 |
T8594 |
advmod |
where,found |
| R5337 |
T8556 |
T8557 |
advmod |
Conversely,detected |
| R5338 |
T8594 |
T8557 |
advcl |
found,detected |
| R5339 |
T8595 |
T8594 |
nsubjpass |
it,found |
| R534 |
T1347 |
T1345 |
prep |
of,remodeling |
| R5340 |
T8596 |
T8594 |
auxpass |
was,found |
| R5341 |
T8597 |
T8594 |
neg |
not,found |
| R5342 |
T8558 |
T8557 |
punct |
", ",detected |
| R5343 |
T8598 |
T8594 |
prep |
in,found |
| R5344 |
T8599 |
T8600 |
amod |
postnatal,skin |
| R5345 |
T8600 |
T8598 |
pobj |
skin,in |
| R5346 |
T8601 |
T8602 |
punct |
(,6E |
| R5347 |
T8664 |
T8660 |
advmod |
still,formed |
| R5348 |
T8602 |
T8557 |
parataxis |
6E,detected |
| R5349 |
T8603 |
T8602 |
compound |
Figure,6E |
| R535 |
T1348 |
T1349 |
det |
the,properties |
| R5350 |
T8604 |
T8602 |
punct |
),6E |
| R5351 |
T8605 |
T8557 |
punct |
.,detected |
| R5352 |
T8607 |
T8608 |
advcl |
Taken,provide |
| R5353 |
T8609 |
T8607 |
advmod |
together,Taken |
| R5354 |
T8610 |
T8608 |
punct |
", ",provide |
| R5355 |
T8611 |
T8612 |
det |
these,results |
| R5356 |
T8666 |
T8660 |
prep |
in,formed |
| R5357 |
T8612 |
T8608 |
nsubj |
results,provide |
| R5358 |
T8613 |
T8614 |
amod |
compelling,evidence |
| R5359 |
T8614 |
T8608 |
dobj |
evidence,provide |
| R536 |
T1349 |
T1347 |
pobj |
properties,of |
| R5360 |
T8615 |
T8616 |
mark |
that,is |
| R5361 |
T8616 |
T8614 |
acl |
is,evidence |
| R5362 |
T8667 |
T8668 |
compound |
TGF,β2 |
| R5363 |
T8617 |
T8618 |
compound |
TGF,β2 |
| R5364 |
T8618 |
T8616 |
nsubj |
β2,is |
| R5365 |
T8619 |
T8618 |
punct |
-,β2 |
| R5366 |
T8668 |
T8670 |
npadvmod |
β2,null |
| R5367 |
T8620 |
T8621 |
advmod |
functionally,important |
| R5368 |
T8621 |
T8616 |
acomp |
important,is |
| R5369 |
T8669 |
T8668 |
punct |
-,β2 |
| R537 |
T1350 |
T1349 |
amod |
physical,properties |
| R5370 |
T8622 |
T8621 |
prep |
for,important |
| R5371 |
T8623 |
T8622 |
pcomp |
inducing,for |
| R5372 |
T8624 |
T8625 |
compound |
Snail,expression |
| R5373 |
T8670 |
T8671 |
amod |
null,skin |
| R5374 |
T8625 |
T8623 |
dobj |
expression,inducing |
| R5375 |
T8626 |
T8625 |
compound |
gene,expression |
| R5376 |
T8627 |
T8623 |
prep |
in,inducing |
| R5377 |
T8671 |
T8666 |
pobj |
skin,in |
| R5378 |
T8628 |
T8629 |
det |
a,manner |
| R5379 |
T8629 |
T8627 |
pobj |
manner,in |
| R538 |
T1351 |
T1350 |
cc |
and,physical |
| R5380 |
T8672 |
T8665 |
punct |
", ",reduced |
| R5381 |
T8630 |
T8631 |
npadvmod |
pSMAD,dependent |
| R5382 |
T8631 |
T8629 |
amod |
dependent,manner |
| R5383 |
T8632 |
T8631 |
punct |
-,dependent |
| R5384 |
T8673 |
T8674 |
poss |
their,number |
| R5385 |
T8633 |
T8623 |
prep |
in,inducing |
| R5386 |
T8634 |
T8635 |
amod |
developing,buds |
| R5387 |
T8635 |
T8633 |
pobj |
buds,in |
| R5388 |
T8674 |
T8665 |
nsubjpass |
number,reduced |
| R5389 |
T8636 |
T8635 |
compound |
hair,buds |
| R539 |
T1352 |
T1350 |
conj |
structural,physical |
| R5390 |
T8637 |
T8608 |
punct |
.,provide |
| R5391 |
T8675 |
T8665 |
auxpass |
was,reduced |
| R5392 |
T8639 |
T8640 |
mark |
Whether,contributes |
| R5393 |
T8640 |
T8644 |
csubjpass |
contributes,addressed |
| R5394 |
T8676 |
T8665 |
prep |
by,reduced |
| R5395 |
T8641 |
T8642 |
compound |
pMARK,activity |
| R5396 |
T8642 |
T8640 |
nsubj |
activity,contributes |
| R5397 |
T8643 |
T8640 |
advmod |
also,contributes |
| R5398 |
T8677 |
T8678 |
advmod |
approximately,50 |
| R5399 |
T8645 |
T8640 |
prep |
to,contributes |
| R540 |
T1353 |
T1349 |
prep |
of,properties |
| R5400 |
T8646 |
T8647 |
compound |
Snail,induction |
| R5401 |
T8647 |
T8645 |
pobj |
induction,to |
| R5402 |
T8648 |
T8644 |
auxpass |
was,addressed |
| R5403 |
T8649 |
T8644 |
neg |
not,addressed |
| R5404 |
T8678 |
T8679 |
nummod |
50,% |
| R5405 |
T8650 |
T8644 |
prep |
in,addressed |
| R5406 |
T8651 |
T8652 |
det |
the,study |
| R5407 |
T8652 |
T8650 |
pobj |
study,in |
| R5408 |
T8679 |
T8676 |
pobj |
%,by |
| R5409 |
T8653 |
T8652 |
amod |
present,study |
| R541 |
T1354 |
T1355 |
det |
the,cell |
| R5410 |
T8654 |
T8655 |
punct |
[,15 |
| R5411 |
T8655 |
T8644 |
parataxis |
15,addressed |
| R5412 |
T8680 |
T8681 |
punct |
[,32 |
| R5413 |
T8656 |
T8655 |
punct |
],15 |
| R5414 |
T8657 |
T8644 |
punct |
.,addressed |
| R5415 |
T8681 |
T8665 |
parataxis |
32,reduced |
| R5416 |
T8659 |
T8660 |
mark |
Although,formed |
| R5417 |
T8660 |
T8665 |
advcl |
formed,reduced |
| R5418 |
T8661 |
T8662 |
det |
some,buds |
| R5419 |
T8682 |
T8681 |
punct |
],32 |
| R542 |
T1355 |
T1353 |
pobj |
cell,of |
| R5420 |
T8662 |
T8660 |
nsubj |
buds,formed |
| R5421 |
T8663 |
T8662 |
compound |
hair,buds |
| R5422 |
T8683 |
T8665 |
punct |
.,reduced |
| R5423 |
T8685 |
T8686 |
advmod |
Thus,appear |
| R5424 |
T8687 |
T8686 |
punct |
", ",appear |
| R5425 |
T8770 |
T8772 |
compound |
β2,signaling |
| R5426 |
T8688 |
T8689 |
mark |
although,impacts |
| R5427 |
T8689 |
T8686 |
advcl |
impacts,appear |
| R5428 |
T8771 |
T8770 |
punct |
-,β2 |
| R5429 |
T8772 |
T8766 |
nsubj |
signaling,appeared |
| R543 |
T1356 |
T1325 |
punct |
.,orchestrated |
| R5430 |
T8690 |
T8691 |
det |
the,pathway |
| R5431 |
T8773 |
T8774 |
aux |
to,be |
| R5432 |
T8774 |
T8766 |
xcomp |
be,appeared |
| R5433 |
T8775 |
T8776 |
det |
an,factor |
| R5434 |
T8691 |
T8689 |
nsubj |
pathway,impacts |
| R5435 |
T8776 |
T8774 |
attr |
factor,be |
| R5436 |
T8777 |
T8776 |
amod |
important,factor |
| R5437 |
T8692 |
T8691 |
acl |
mediated,pathway |
| R5438 |
T8778 |
T8776 |
prep |
for,factor |
| R5439 |
T8779 |
T8780 |
det |
the,proliferation |
| R544 |
T1358 |
T1359 |
prep |
Among,offer |
| R5440 |
T8693 |
T8692 |
prep |
by,mediated |
| R5441 |
T8780 |
T8778 |
pobj |
proliferation,for |
| R5442 |
T8781 |
T8780 |
amod |
early,proliferation |
| R5443 |
T8782 |
T8783 |
dep |
that,occurs |
| R5444 |
T8694 |
T8695 |
compound |
TGF,β2 |
| R5445 |
T8783 |
T8780 |
relcl |
occurs,proliferation |
| R5446 |
T8784 |
T8783 |
prep |
in,occurs |
| R5447 |
T8695 |
T8697 |
compound |
β2,signaling |
| R5448 |
T8785 |
T8786 |
det |
the,buds |
| R5449 |
T8786 |
T8784 |
pobj |
buds,in |
| R545 |
T1360 |
T1361 |
det |
the,organs |
| R5450 |
T8787 |
T8786 |
amod |
developing,buds |
| R5451 |
T8696 |
T8695 |
punct |
-,β2 |
| R5452 |
T8788 |
T8786 |
compound |
hair,buds |
| R5453 |
T8789 |
T8774 |
punct |
", ",be |
| R5454 |
T8790 |
T8791 |
mark |
as,judged |
| R5455 |
T8791 |
T8774 |
advcl |
judged,be |
| R5456 |
T8792 |
T8791 |
prep |
by,judged |
| R5457 |
T8793 |
T8794 |
amod |
anti-Ki67,immunofluorescence |
| R5458 |
T8697 |
T8693 |
pobj |
signaling,by |
| R5459 |
T8794 |
T8792 |
pobj |
immunofluorescence,by |
| R546 |
T1361 |
T1358 |
pobj |
organs,Among |
| R5460 |
T8795 |
T8793 |
cc |
and,anti-Ki67 |
| R5461 |
T8698 |
T8699 |
det |
the,step |
| R5462 |
T8796 |
T8793 |
conj |
anti-pMAPK,anti-Ki67 |
| R5463 |
T8797 |
T8798 |
punct |
(,6F |
| R5464 |
T8798 |
T8774 |
parataxis |
6F,be |
| R5465 |
T8699 |
T8689 |
dobj |
step,impacts |
| R5466 |
T8799 |
T8798 |
compound |
Figure,6F |
| R5467 |
T8800 |
T8798 |
cc |
and,6F |
| R5468 |
T8801 |
T8798 |
conj |
6G,6F |
| R5469 |
T8700 |
T8699 |
amod |
earliest,step |
| R547 |
T1362 |
T1361 |
amod |
few,organs |
| R5470 |
T8802 |
T8798 |
punct |
),6F |
| R5471 |
T8803 |
T8766 |
punct |
.,appeared |
| R5472 |
T8701 |
T8699 |
prep |
of,step |
| R5473 |
T8805 |
T8806 |
mark |
If,stimulates |
| R5474 |
T8806 |
T8810 |
advcl |
stimulates,expected |
| R5475 |
T8702 |
T8703 |
amod |
epithelial,invagination |
| R5476 |
T8807 |
T8808 |
compound |
TGF,β2 |
| R5477 |
T8808 |
T8806 |
nsubj |
β2,stimulates |
| R5478 |
T8809 |
T8808 |
punct |
-,β2 |
| R5479 |
T8703 |
T8701 |
pobj |
invagination,of |
| R548 |
T1363 |
T1361 |
amod |
dispensable,organs |
| R5480 |
T8811 |
T8812 |
compound |
Snail,expression |
| R5481 |
T8812 |
T8806 |
dobj |
expression,stimulates |
| R5482 |
T8704 |
T8686 |
punct |
", ",appear |
| R5483 |
T8813 |
T8806 |
prep |
in,stimulates |
| R5484 |
T8814 |
T8815 |
amod |
developing,buds |
| R5485 |
T8815 |
T8813 |
pobj |
buds,in |
| R5486 |
T8705 |
T8686 |
nsubj |
it,appear |
| R5487 |
T8816 |
T8810 |
punct |
", ",expected |
| R5488 |
T8817 |
T8810 |
nsubjpass |
loss,expected |
| R5489 |
T8818 |
T8817 |
prep |
of,loss |
| R549 |
T1364 |
T1359 |
punct |
", ",offer |
| R5490 |
T8706 |
T8686 |
aux |
does,appear |
| R5491 |
T8819 |
T8820 |
det |
this,morphogen |
| R5492 |
T8820 |
T8818 |
pobj |
morphogen,of |
| R5493 |
T8707 |
T8686 |
neg |
not,appear |
| R5494 |
T8821 |
T8810 |
aux |
would,expected |
| R5495 |
T8822 |
T8810 |
auxpass |
be,expected |
| R5496 |
T8823 |
T8824 |
aux |
to,affect |
| R5497 |
T8708 |
T8709 |
aux |
to,be |
| R5498 |
T8824 |
T8810 |
xcomp |
affect,expected |
| R5499 |
T8825 |
T8826 |
det |
the,expression |
| R550 |
T1365 |
T1366 |
compound |
hair,follicles |
| R5500 |
T8826 |
T8824 |
dobj |
expression,affect |
| R5501 |
T8709 |
T8686 |
xcomp |
be,appear |
| R5502 |
T8827 |
T8826 |
prep |
of,expression |
| R5503 |
T8828 |
T8827 |
pobj |
genes,of |
| R5504 |
T8829 |
T8830 |
dep |
that,repressed |
| R5505 |
T8830 |
T8828 |
relcl |
repressed,genes |
| R5506 |
T8831 |
T8830 |
auxpass |
are,repressed |
| R5507 |
T8832 |
T8830 |
advmod |
typically,repressed |
| R5508 |
T8710 |
T8709 |
acomp |
essential,be |
| R5509 |
T8833 |
T8830 |
agent |
by,repressed |
| R551 |
T1366 |
T1359 |
nsubj |
follicles,offer |
| R5510 |
T8834 |
T8833 |
pobj |
Snail,by |
| R5511 |
T8835 |
T8810 |
punct |
.,expected |
| R5512 |
T8711 |
T8710 |
prep |
for,essential |
| R5513 |
T8712 |
T8713 |
compound |
bud,morphogenesis |
| R5514 |
T8837 |
T8838 |
mark |
Since,is |
| R5515 |
T8713 |
T8711 |
pobj |
morphogenesis,for |
| R5516 |
T8838 |
T8847 |
advcl |
is,investigated |
| R5517 |
T8839 |
T8840 |
det |
a,target |
| R5518 |
T8714 |
T8686 |
punct |
.,appear |
| R5519 |
T8840 |
T8838 |
nsubj |
target,is |
| R552 |
T1367 |
T1368 |
det |
an,system |
| R5520 |
T8841 |
T8840 |
amod |
major,target |
| R5521 |
T8842 |
T8840 |
prep |
for,target |
| R5522 |
T8843 |
T8844 |
npadvmod |
Snail,mediated |
| R5523 |
T8716 |
T8717 |
advcl |
Consistent,took |
| R5524 |
T8844 |
T8846 |
amod |
mediated,repression |
| R5525 |
T8845 |
T8844 |
punct |
-,mediated |
| R5526 |
T8846 |
T8842 |
pobj |
repression,for |
| R5527 |
T8718 |
T8716 |
prep |
with,Consistent |
| R5528 |
T8848 |
T8849 |
det |
the,gene |
| R5529 |
T8849 |
T8838 |
attr |
gene,is |
| R553 |
T1368 |
T1359 |
dobj |
system,offer |
| R5530 |
T8850 |
T8851 |
compound |
E,cadherin |
| R5531 |
T8719 |
T8720 |
det |
this,notion |
| R5532 |
T8720 |
T8718 |
pobj |
notion,with |
| R5533 |
T8721 |
T8717 |
punct |
", ",took |
| R5534 |
T8851 |
T8849 |
compound |
cadherin,gene |
| R5535 |
T8722 |
T8723 |
compound |
basement,membrane |
| R5536 |
T8723 |
T8724 |
compound |
membrane,remodeling |
| R5537 |
T8852 |
T8851 |
punct |
-,cadherin |
| R5538 |
T8853 |
T8854 |
punct |
[,13 |
| R5539 |
T8854 |
T8838 |
parataxis |
13,is |
| R554 |
T1369 |
T1368 |
amod |
excellent,system |
| R5540 |
T8724 |
T8717 |
nsubj |
remodeling,took |
| R5541 |
T8855 |
T8854 |
nummod |
12,13 |
| R5542 |
T8856 |
T8854 |
punct |
",",13 |
| R5543 |
T8725 |
T8717 |
advmod |
still,took |
| R5544 |
T8857 |
T8854 |
punct |
],13 |
| R5545 |
T8858 |
T8847 |
punct |
", ",investigated |
| R5546 |
T8859 |
T8847 |
nsubj |
we,investigated |
| R5547 |
T8726 |
T8717 |
dobj |
place,took |
| R5548 |
T8860 |
T8861 |
det |
the,status |
| R5549 |
T8861 |
T8847 |
dobj |
status,investigated |
| R555 |
T1370 |
T1368 |
compound |
model,system |
| R5550 |
T8727 |
T8717 |
prep |
in,took |
| R5551 |
T8862 |
T8861 |
prep |
of,status |
| R5552 |
T8863 |
T8864 |
compound |
E,cadherin |
| R5553 |
T8864 |
T8862 |
pobj |
cadherin,of |
| R5554 |
T8728 |
T8729 |
det |
the,buds |
| R5555 |
T8865 |
T8864 |
punct |
-,cadherin |
| R5556 |
T8866 |
T8847 |
prep |
in,investigated |
| R5557 |
T8867 |
T8868 |
compound |
TGF,β2 |
| R5558 |
T8868 |
T8870 |
npadvmod |
β2,null |
| R5559 |
T8869 |
T8868 |
punct |
-,β2 |
| R556 |
T1371 |
T1372 |
aux |
to,study |
| R5560 |
T8870 |
T8872 |
amod |
null,buds |
| R5561 |
T8729 |
T8727 |
pobj |
buds,in |
| R5562 |
T8871 |
T8870 |
punct |
-,null |
| R5563 |
T8872 |
T8866 |
pobj |
buds,in |
| R5564 |
T8873 |
T8847 |
punct |
.,investigated |
| R5565 |
T8730 |
T8731 |
compound |
TGF,β2 |
| R5566 |
T8875 |
T8876 |
mark |
As,shown |
| R5567 |
T8731 |
T8733 |
npadvmod |
β2,null |
| R5568 |
T8732 |
T8731 |
punct |
-,β2 |
| R5569 |
T8733 |
T8729 |
amod |
null,buds |
| R557 |
T1372 |
T1368 |
advcl |
study,system |
| R5570 |
T8734 |
T8733 |
punct |
-,null |
| R5571 |
T8876 |
T8877 |
advcl |
shown,displayed |
| R5572 |
T8735 |
T8717 |
punct |
", ",took |
| R5573 |
T8878 |
T8876 |
prep |
in,shown |
| R5574 |
T8736 |
T8737 |
mark |
as,judged |
| R5575 |
T8879 |
T8880 |
compound |
Figure,6H |
| R5576 |
T8880 |
T8878 |
pobj |
6H,in |
| R5577 |
T8881 |
T8877 |
punct |
", ",displayed |
| R5578 |
T8737 |
T8717 |
advcl |
judged,took |
| R5579 |
T8882 |
T8883 |
compound |
hair,buds |
| R558 |
T1373 |
T1374 |
amod |
epithelial,bud |
| R5580 |
T8883 |
T8877 |
nsubj |
buds,displayed |
| R5581 |
T8884 |
T8883 |
prep |
in,buds |
| R5582 |
T8738 |
T8737 |
prep |
by,judged |
| R5583 |
T8885 |
T8886 |
compound |
TGF,β2 |
| R5584 |
T8886 |
T8888 |
npadvmod |
β2,null |
| R5585 |
T8887 |
T8886 |
punct |
-,β2 |
| R5586 |
T8739 |
T8738 |
pobj |
immunofluorescence,by |
| R5587 |
T8888 |
T8889 |
amod |
null,skin |
| R5588 |
T8889 |
T8884 |
pobj |
skin,in |
| R5589 |
T8740 |
T8739 |
prep |
with,immunofluorescence |
| R559 |
T1374 |
T1375 |
compound |
bud,formation |
| R5590 |
T8890 |
T8891 |
amod |
elevated,staining |
| R5591 |
T8891 |
T8877 |
dobj |
staining,displayed |
| R5592 |
T8892 |
T8891 |
compound |
immunofluorescence,staining |
| R5593 |
T8741 |
T8740 |
pobj |
antibodies,with |
| R5594 |
T8893 |
T8877 |
advcl |
relative,displayed |
| R5595 |
T8894 |
T8893 |
prep |
to,relative |
| R5596 |
T8895 |
T8896 |
poss |
their,counterparts |
| R5597 |
T8742 |
T8741 |
prep |
against,antibodies |
| R5598 |
T8896 |
T8894 |
pobj |
counterparts,to |
| R5599 |
T8897 |
T8896 |
compound |
WT,counterparts |
| R560 |
T1375 |
T1372 |
dobj |
formation,study |
| R5600 |
T8898 |
T8877 |
punct |
.,displayed |
| R5601 |
T8743 |
T8744 |
compound |
β4,integrin |
| R5602 |
T8900 |
T8901 |
advmod |
Previously,demonstrated |
| R5603 |
T8744 |
T8742 |
pobj |
integrin,against |
| R5604 |
T8902 |
T8901 |
nsubj |
we,demonstrated |
| R5605 |
T8903 |
T8904 |
mark |
that,required |
| R5606 |
T8745 |
T8744 |
punct |
", ",integrin |
| R5607 |
T8904 |
T8901 |
ccomp |
required,demonstrated |
| R5608 |
T8905 |
T8906 |
det |
the,action |
| R5609 |
T8906 |
T8904 |
nsubjpass |
action,required |
| R561 |
T1376 |
T1359 |
punct |
.,offer |
| R5610 |
T8907 |
T8906 |
amod |
concerted,action |
| R5611 |
T8908 |
T8906 |
prep |
of,action |
| R5612 |
T8746 |
T8747 |
det |
an,component |
| R5613 |
T8909 |
T8910 |
det |
the,signals |
| R5614 |
T8910 |
T8908 |
pobj |
signals,of |
| R5615 |
T8911 |
T8910 |
amod |
extracellular,signals |
| R5616 |
T8747 |
T8744 |
appos |
component,integrin |
| R5617 |
T8912 |
T8910 |
appos |
Wnt,signals |
| R5618 |
T8913 |
T8912 |
cc |
and,Wnt |
| R5619 |
T8914 |
T8912 |
conj |
noggin,Wnt |
| R562 |
T1378 |
T1379 |
amod |
Mammalian,epithelium |
| R5620 |
T8748 |
T8747 |
amod |
integral,component |
| R5621 |
T8915 |
T8904 |
auxpass |
are,required |
| R5622 |
T8916 |
T8917 |
mark |
for,repress |
| R5623 |
T8749 |
T8747 |
prep |
of,component |
| R5624 |
T8750 |
T8751 |
npadvmod |
keratinocyte,mediated |
| R5625 |
T8917 |
T8904 |
advcl |
repress,required |
| R5626 |
T8918 |
T8919 |
det |
the,generation |
| R5627 |
T8751 |
T8753 |
amod |
mediated,adhesion |
| R5628 |
T8919 |
T8917 |
nsubj |
generation,repress |
| R5629 |
T8920 |
T8919 |
prep |
of,generation |
| R563 |
T1379 |
T1381 |
nsubj |
epithelium,begins |
| R5630 |
T8921 |
T8922 |
det |
a,complex |
| R5631 |
T8752 |
T8751 |
punct |
-,mediated |
| R5632 |
T8922 |
T8920 |
pobj |
complex,of |
| R5633 |
T8923 |
T8922 |
nmod |
LEF,complex |
| R5634 |
T8924 |
T8923 |
punct |
-,LEF |
| R5635 |
T8753 |
T8749 |
pobj |
adhesion,of |
| R5636 |
T8925 |
T8923 |
nummod |
1,LEF |
| R5637 |
T8926 |
T8923 |
punct |
/,LEF |
| R5638 |
T8927 |
T8928 |
compound |
β,catenin |
| R5639 |
T8754 |
T8753 |
prep |
to,adhesion |
| R564 |
T1380 |
T1379 |
compound |
skin,epithelium |
| R5640 |
T8928 |
T8923 |
appos |
catenin,LEF |
| R5641 |
T8929 |
T8928 |
punct |
-,catenin |
| R5642 |
T8755 |
T8756 |
poss |
its,membrane |
| R5643 |
T8930 |
T8922 |
compound |
transcription,complex |
| R5644 |
T8931 |
T8917 |
aux |
to,repress |
| R5645 |
T8932 |
T8933 |
compound |
E,cadherin |
| R5646 |
T8756 |
T8754 |
pobj |
membrane,to |
| R5647 |
T8933 |
T8935 |
compound |
cadherin,transcription |
| R5648 |
T8934 |
T8933 |
punct |
-,cadherin |
| R5649 |
T8757 |
T8756 |
amod |
underlying,membrane |
| R565 |
T1382 |
T1381 |
prep |
as,begins |
| R5650 |
T8935 |
T8917 |
dobj |
transcription,repress |
| R5651 |
T8936 |
T8917 |
prep |
at,repress |
| R5652 |
T8937 |
T8938 |
det |
the,onset |
| R5653 |
T8758 |
T8756 |
compound |
basement,membrane |
| R5654 |
T8938 |
T8936 |
pobj |
onset,at |
| R5655 |
T8939 |
T8938 |
prep |
of,onset |
| R5656 |
T8759 |
T8760 |
punct |
(,6F |
| R5657 |
T8940 |
T8941 |
compound |
hair,fate |
| R5658 |
T8941 |
T8942 |
compound |
fate,specification |
| R5659 |
T8942 |
T8939 |
pobj |
specification,of |
| R566 |
T1383 |
T1384 |
det |
a,sheet |
| R5660 |
T8943 |
T8901 |
punct |
.,demonstrated |
| R5661 |
T8760 |
T8717 |
parataxis |
6F,took |
| R5662 |
T8945 |
T8946 |
mark |
As,shown |
| R5663 |
T8946 |
T8947 |
advcl |
shown,exhibited |
| R5664 |
T8948 |
T8946 |
prep |
in,shown |
| R5665 |
T8761 |
T8760 |
compound |
Figure,6F |
| R5666 |
T8949 |
T8950 |
compound |
Figure,6I |
| R5667 |
T8950 |
T8948 |
pobj |
6I,in |
| R5668 |
T8762 |
T8760 |
punct |
),6F |
| R5669 |
T8951 |
T8950 |
cc |
and,6I |
| R567 |
T1384 |
T1382 |
pobj |
sheet,as |
| R5670 |
T8952 |
T8950 |
conj |
6J,6I |
| R5671 |
T8953 |
T8947 |
punct |
", ",exhibited |
| R5672 |
T8763 |
T8717 |
punct |
.,took |
| R5673 |
T8954 |
T8955 |
preconj |
both,WT |
| R5674 |
T8955 |
T8956 |
npadvmod |
WT,null |
| R5675 |
T8765 |
T8766 |
prep |
In,appeared |
| R5676 |
T8956 |
T8961 |
amod |
null,buds |
| R5677 |
T8957 |
T8955 |
cc |
and,WT |
| R5678 |
T8958 |
T8959 |
compound |
TGF,β2 |
| R5679 |
T8959 |
T8955 |
conj |
β2,WT |
| R568 |
T1385 |
T1384 |
amod |
single,sheet |
| R5680 |
T8960 |
T8959 |
punct |
-,β2 |
| R5681 |
T8767 |
T8765 |
pobj |
contrast,In |
| R5682 |
T8961 |
T8947 |
nsubj |
buds,exhibited |
| R5683 |
T8962 |
T8963 |
amod |
nuclear,localization |
| R5684 |
T8963 |
T8947 |
dobj |
localization,exhibited |
| R5685 |
T8964 |
T8963 |
nmod |
LEF,localization |
| R5686 |
T8768 |
T8766 |
punct |
", ",appeared |
| R5687 |
T8965 |
T8964 |
punct |
-,LEF |
| R5688 |
T8966 |
T8964 |
nummod |
1,LEF |
| R5689 |
T8967 |
T8964 |
cc |
and,LEF |
| R569 |
T1386 |
T1384 |
prep |
of,sheet |
| R5690 |
T8769 |
T8770 |
compound |
TGF,β2 |
| R5691 |
T8968 |
T8969 |
compound |
β,catenin |
| R5692 |
T8969 |
T8964 |
conj |
catenin,LEF |
| R5693 |
T8970 |
T8969 |
punct |
-,catenin |
| R5694 |
T8982 |
T8947 |
punct |
.,exhibited |
| R5695 |
T8971 |
T8947 |
punct |
", ",exhibited |
| R5696 |
T8972 |
T8947 |
npadvmod |
signs,exhibited |
| R5697 |
T8973 |
T8974 |
mark |
that,was |
| R5698 |
T8974 |
T8972 |
acl |
was,signs |
| R5699 |
T8975 |
T8976 |
det |
the,pathway |
| R570 |
T1387 |
T1388 |
amod |
multipotent,cells |
| R5700 |
T8976 |
T8974 |
nsubj |
pathway,was |
| R5701 |
T8977 |
T8978 |
compound |
Wnt,noggin |
| R5702 |
T8984 |
T8985 |
det |
These,data |
| R5703 |
T8978 |
T8976 |
compound |
noggin,pathway |
| R5704 |
T8979 |
T8978 |
punct |
-,noggin |
| R5705 |
T8980 |
T8976 |
compound |
signaling,pathway |
| R5706 |
T8981 |
T8974 |
acomp |
intact,was |
| R5707 |
T8985 |
T8986 |
nsubj |
data,suggest |
| R5708 |
T8987 |
T8988 |
mark |
that,functions |
| R5709 |
T8988 |
T8986 |
ccomp |
functions,suggest |
| R571 |
T1388 |
T1386 |
pobj |
cells,of |
| R5710 |
T8989 |
T8988 |
prep |
during,functions |
| R5711 |
T8990 |
T8991 |
compound |
hair,follicle |
| R5712 |
T8991 |
T8992 |
compound |
follicle,morphogenesis |
| R5713 |
T8992 |
T8989 |
pobj |
morphogenesis,during |
| R5714 |
T8993 |
T8988 |
punct |
", ",functions |
| R5715 |
T8994 |
T8995 |
compound |
TGF,β2 |
| R5716 |
T8995 |
T8988 |
nsubj |
β2,functions |
| R5717 |
T8996 |
T8995 |
punct |
-,β2 |
| R5718 |
T8997 |
T8988 |
advmod |
subsequently,functions |
| R5719 |
T8998 |
T8997 |
prep |
to,subsequently |
| R572 |
T1389 |
T1388 |
amod |
ectodermal,cells |
| R5720 |
T8999 |
T9000 |
compound |
Wnt,noggin |
| R5721 |
T9000 |
T9002 |
npadvmod |
noggin,mediated |
| R5722 |
T9001 |
T9000 |
punct |
/,noggin |
| R5723 |
T9002 |
T9004 |
amod |
mediated,determination |
| R5724 |
T9003 |
T9002 |
punct |
-,mediated |
| R5725 |
T9004 |
T8998 |
pobj |
determination,to |
| R5726 |
T9005 |
T9004 |
prep |
of,determination |
| R5727 |
T9006 |
T9007 |
compound |
hair,fate |
| R5728 |
T9007 |
T9005 |
pobj |
fate,of |
| R5729 |
T9008 |
T8986 |
punct |
.,suggest |
| R573 |
T1390 |
T1381 |
punct |
.,begins |
| R5730 |
T9010 |
T9011 |
advmod |
Moreover,appears |
| R5731 |
T9012 |
T9011 |
punct |
", ",appears |
| R5732 |
T9013 |
T9011 |
prep |
through,appears |
| R5733 |
T9014 |
T9013 |
pobj |
activation,through |
| R5734 |
T9015 |
T9014 |
prep |
of,activation |
| R5735 |
T9016 |
T9017 |
compound |
Snail,expression |
| R5736 |
T9017 |
T9015 |
pobj |
expression,of |
| R5737 |
T9018 |
T9017 |
compound |
gene,expression |
| R5738 |
T9019 |
T9011 |
punct |
", ",appears |
| R5739 |
T9020 |
T9021 |
compound |
TGF,β2 |
| R574 |
T1392 |
T1393 |
prep |
During,populate |
| R5740 |
T9021 |
T9011 |
nsubj |
β2,appears |
| R5741 |
T9022 |
T9021 |
punct |
-,β2 |
| R5742 |
T9023 |
T9024 |
aux |
to,work |
| R5743 |
T9024 |
T9011 |
xcomp |
work,appears |
| R5744 |
T9025 |
T9024 |
prep |
in,work |
| R5745 |
T9026 |
T9025 |
pobj |
tandem,in |
| R5746 |
T9027 |
T9026 |
prep |
with,tandem |
| R5747 |
T9028 |
T9029 |
det |
these,morphogens |
| R5748 |
T9029 |
T9027 |
pobj |
morphogens,with |
| R5749 |
T9030 |
T9029 |
amod |
other,morphogens |
| R575 |
T1394 |
T1392 |
pobj |
development,During |
| R5750 |
T9031 |
T9032 |
aux |
to,regulate |
| R5751 |
T9032 |
T9024 |
advcl |
regulate,work |
| R5752 |
T9033 |
T9032 |
advmod |
down,regulate |
| R5753 |
T9034 |
T9032 |
punct |
-,regulate |
| R5754 |
T9035 |
T9036 |
compound |
E,cadherin |
| R5755 |
T9036 |
T9038 |
compound |
cadherin,levels |
| R5756 |
T9037 |
T9036 |
punct |
-,cadherin |
| R5757 |
T9038 |
T9032 |
dobj |
levels,regulate |
| R5758 |
T9039 |
T9024 |
punct |
", ",work |
| R5759 |
T9040 |
T9041 |
dep |
which,contributes |
| R576 |
T1395 |
T1393 |
punct |
", ",populate |
| R5760 |
T9041 |
T9024 |
advcl |
contributes,work |
| R5761 |
T9042 |
T9041 |
prep |
to,contributes |
| R5762 |
T9043 |
T9044 |
det |
the,activation |
| R5763 |
T9044 |
T9042 |
pobj |
activation,to |
| R5764 |
T9045 |
T9044 |
prep |
of,activation |
| R5765 |
T9046 |
T9047 |
amod |
proliferative,circuitries |
| R5766 |
T9047 |
T9045 |
pobj |
circuitries,of |
| R5767 |
T9048 |
T9011 |
punct |
.,appears |
| R577 |
T1396 |
T1397 |
amod |
specialized,cells |
| R5772 |
T9102 |
T9103 |
prep |
During,govern |
| R5773 |
T9104 |
T9105 |
compound |
budding,morphogenesis |
| R5774 |
T9105 |
T9102 |
pobj |
morphogenesis,During |
| R5775 |
T9106 |
T9103 |
punct |
", ",govern |
| R5776 |
T9107 |
T9108 |
amod |
intersecting,networks |
| R5777 |
T9108 |
T9103 |
nsubj |
networks,govern |
| R5778 |
T9109 |
T9108 |
compound |
signaling,networks |
| R5779 |
T9110 |
T9108 |
prep |
from,networks |
| R578 |
T1397 |
T1393 |
nsubj |
cells,populate |
| R5780 |
T9111 |
T9112 |
det |
the,epithelium |
| R5781 |
T9112 |
T9110 |
pobj |
epithelium,from |
| R5782 |
T9113 |
T9112 |
cc |
and,epithelium |
| R5783 |
T9114 |
T9112 |
conj |
mesenchyme,epithelium |
| R5784 |
T9115 |
T9116 |
amod |
transcriptional,programs |
| R5785 |
T9116 |
T9103 |
dobj |
programs,govern |
| R5786 |
T9117 |
T9115 |
punct |
", ",transcriptional |
| R5787 |
T9118 |
T9115 |
conj |
adhesive,transcriptional |
| R5788 |
T9119 |
T9118 |
punct |
", ",adhesive |
| R5789 |
T9120 |
T9118 |
conj |
polarity,adhesive |
| R579 |
T1398 |
T1397 |
amod |
mesenchymal,cells |
| R5790 |
T9121 |
T9120 |
punct |
", ",polarity |
| R5791 |
T9122 |
T9120 |
cc |
and,polarity |
| R5792 |
T9123 |
T9120 |
conj |
motility,polarity |
| R5793 |
T9124 |
T9103 |
prep |
in,govern |
| R5794 |
T9125 |
T9126 |
det |
these,groups |
| R5795 |
T9126 |
T9124 |
pobj |
groups,in |
| R5796 |
T9127 |
T9126 |
amod |
select,groups |
| R5797 |
T9128 |
T9126 |
prep |
of,groups |
| R5798 |
T9129 |
T9128 |
pobj |
cells,of |
| R5799 |
T9130 |
T9103 |
punct |
.,govern |
| R580 |
T1399 |
T1400 |
det |
the,skin |
| R5800 |
T9132 |
T9133 |
det |
The,changes |
| R5801 |
T9133 |
T9138 |
nsubj |
changes,form |
| R5802 |
T9134 |
T9133 |
amod |
dynamic,changes |
| R5803 |
T9135 |
T9133 |
amod |
nuclear,changes |
| R5804 |
T9136 |
T9135 |
cc |
and,nuclear |
| R5805 |
T9137 |
T9135 |
conj |
cytosolic,nuclear |
| R5806 |
T9139 |
T9140 |
dep |
that,take |
| R5807 |
T9140 |
T9133 |
relcl |
take,changes |
| R5808 |
T9141 |
T9140 |
dobj |
place,take |
| R5809 |
T9142 |
T9140 |
prep |
during,take |
| R581 |
T1400 |
T1393 |
dobj |
skin,populate |
| R5810 |
T9143 |
T9144 |
det |
this,time |
| R5811 |
T9144 |
T9142 |
pobj |
time,during |
| R5812 |
T9145 |
T9146 |
det |
the,cornerstone |
| R5813 |
T9146 |
T9138 |
dobj |
cornerstone,form |
| R5814 |
T9147 |
T9146 |
prep |
for,cornerstone |
| R5815 |
T9148 |
T9149 |
compound |
organ,morphogenesis |
| R5816 |
T9149 |
T9147 |
pobj |
morphogenesis,for |
| R5817 |
T9150 |
T9138 |
punct |
.,form |
| R5818 |
T9152 |
T9153 |
nummod |
Two,challenges |
| R5819 |
T9153 |
T9155 |
nsubj |
challenges,are |
| R582 |
T1401 |
T1393 |
prep |
in,populate |
| R5820 |
T9154 |
T9153 |
amod |
major,challenges |
| R5821 |
T9156 |
T9153 |
prep |
in,challenges |
| R5822 |
T9157 |
T9156 |
pcomp |
understanding,in |
| R5823 |
T9158 |
T9159 |
det |
the,mechanisms |
| R5824 |
T9159 |
T9157 |
dobj |
mechanisms,understanding |
| R5825 |
T9160 |
T9159 |
acl |
underlying,mechanisms |
| R5826 |
T9161 |
T9162 |
det |
a,process |
| R5827 |
T9162 |
T9160 |
dobj |
process,underlying |
| R5828 |
T9163 |
T9162 |
amod |
particular,process |
| R5829 |
T9164 |
T9162 |
compound |
budding,process |
| R583 |
T1402 |
T1403 |
det |
a,pattern |
| R5830 |
T9165 |
T9166 |
aux |
to,order |
| R5831 |
T9166 |
T9155 |
xcomp |
order,are |
| R5832 |
T9167 |
T9168 |
det |
the,sequence |
| R5833 |
T9168 |
T9166 |
dobj |
sequence,order |
| R5834 |
T9169 |
T9168 |
amod |
temporal,sequence |
| R5835 |
T9170 |
T9168 |
prep |
of,sequence |
| R5836 |
T9171 |
T9172 |
amod |
external,cues |
| R5837 |
T9172 |
T9170 |
pobj |
cues,of |
| R5838 |
T9173 |
T9172 |
acl |
involved,cues |
| R5839 |
T9174 |
T9166 |
cc |
and,order |
| R584 |
T1403 |
T1401 |
pobj |
pattern,in |
| R5840 |
T9175 |
T9176 |
advmod |
then,dissect |
| R5841 |
T9176 |
T9166 |
conj |
dissect,order |
| R5842 |
T9177 |
T9176 |
aux |
to,dissect |
| R5843 |
T9178 |
T9179 |
advmod |
how,translate |
| R5844 |
T9179 |
T9176 |
ccomp |
translate,dissect |
| R5845 |
T9180 |
T9181 |
det |
the,cells |
| R5846 |
T9181 |
T9179 |
nsubj |
cells,translate |
| R5847 |
T9182 |
T9181 |
prep |
of,cells |
| R5848 |
T9183 |
T9184 |
det |
the,bud |
| R5849 |
T9184 |
T9182 |
pobj |
bud,of |
| R585 |
T1404 |
T1405 |
advmod |
spatially,defined |
| R5850 |
T9185 |
T9184 |
amod |
developing,bud |
| R5851 |
T9186 |
T9187 |
det |
these,signals |
| R5852 |
T9187 |
T9179 |
dobj |
signals,translate |
| R5853 |
T9188 |
T9179 |
prep |
into,translate |
| R5854 |
T9189 |
T9190 |
det |
the,events |
| R5855 |
T9190 |
T9188 |
pobj |
events,into |
| R5856 |
T9191 |
T9190 |
amod |
downstream,events |
| R5857 |
T9192 |
T9190 |
prep |
of,events |
| R5858 |
T9193 |
T9194 |
amod |
cellular,remodeling |
| R5859 |
T9194 |
T9192 |
pobj |
remodeling,of |
| R586 |
T1405 |
T1403 |
amod |
defined,pattern |
| R5860 |
T9195 |
T9194 |
punct |
", ",remodeling |
| R5861 |
T9196 |
T9194 |
conj |
proliferation,remodeling |
| R5862 |
T9197 |
T9196 |
punct |
", ",proliferation |
| R5863 |
T9198 |
T9196 |
cc |
and,proliferation |
| R5864 |
T9199 |
T9196 |
conj |
differentiation,proliferation |
| R5865 |
T9200 |
T9155 |
punct |
.,are |
| R5866 |
T9202 |
T9203 |
poss |
Our,studies |
| R5867 |
T9203 |
T9204 |
nsubj |
studies,provide |
| R5868 |
T9205 |
T9203 |
advmod |
here,studies |
| R5869 |
T9206 |
T9207 |
det |
some,insights |
| R587 |
T1406 |
T1407 |
aux |
to,initiate |
| R5870 |
T9207 |
T9204 |
dobj |
insights,provide |
| R5871 |
T9208 |
T9207 |
prep |
into,insights |
| R5872 |
T9209 |
T9210 |
advmod |
how,orchestrated |
| R5873 |
T9210 |
T9208 |
pcomp |
orchestrated,into |
| R5874 |
T9211 |
T9212 |
det |
these,events |
| R5875 |
T9212 |
T9210 |
nsubjpass |
events,orchestrated |
| R5876 |
T9213 |
T9210 |
auxpass |
are,orchestrated |
| R5877 |
T9214 |
T9210 |
prep |
during,orchestrated |
| R5878 |
T9215 |
T9216 |
compound |
hair,bud |
| R5879 |
T9216 |
T9217 |
compound |
bud,formation |
| R588 |
T1407 |
T1393 |
advcl |
initiate,populate |
| R5880 |
T9217 |
T9214 |
pobj |
formation,during |
| R5881 |
T9218 |
T9210 |
prep |
in,orchestrated |
| R5882 |
T9219 |
T9220 |
amod |
developing,skin |
| R5883 |
T9220 |
T9218 |
pobj |
skin,in |
| R5884 |
T9221 |
T9204 |
punct |
.,provide |
| R589 |
T1408 |
T1409 |
det |
the,crosstalk |
| R5895 |
T9654 |
T9653 |
prep |
during,Signaling |
| R5896 |
T9655 |
T9656 |
amod |
Early,Morphogenesis |
| R5897 |
T9656 |
T9654 |
pobj |
Morphogenesis,during |
| R5898 |
T9657 |
T9658 |
compound |
Hair,Follicle |
| R5899 |
T9658 |
T9656 |
compound |
Follicle,Morphogenesis |
| R590 |
T1409 |
T1407 |
dobj |
crosstalk,initiate |
| R5900 |
T9660 |
T9661 |
amod |
Recent,studies |
| R5901 |
T9661 |
T9662 |
nsubj |
studies,suggest |
| R5902 |
T9663 |
T9661 |
prep |
on,studies |
| R5903 |
T9664 |
T9665 |
compound |
hair,bud |
| R5904 |
T9665 |
T9666 |
compound |
bud,morphogenesis |
| R5905 |
T9666 |
T9663 |
pobj |
morphogenesis,on |
| R5906 |
T9667 |
T9668 |
mark |
that,converge |
| R5907 |
T9668 |
T9662 |
ccomp |
converge,suggest |
| R5908 |
T9669 |
T9670 |
compound |
Wnt,signals |
| R5909 |
T9670 |
T9668 |
nsubj |
signals,converge |
| R591 |
T1410 |
T1409 |
amod |
complex,crosstalk |
| R5910 |
T9671 |
T9672 |
advmod |
likely,from |
| R5911 |
T9672 |
T9670 |
prep |
from,signals |
| R5912 |
T9673 |
T9674 |
det |
the,epithelium |
| R5913 |
T9674 |
T9672 |
pobj |
epithelium,from |
| R5914 |
T9675 |
T9670 |
cc |
and,signals |
| R5915 |
T9676 |
T9677 |
nmod |
BMP,signals |
| R5916 |
T9677 |
T9670 |
conj |
signals,signals |
| R5917 |
T9678 |
T9677 |
amod |
inhibitory,signals |
| R5918 |
T9679 |
T9677 |
prep |
from,signals |
| R5919 |
T9680 |
T9681 |
det |
the,mesenchyme |
| R592 |
T1411 |
T1412 |
amod |
epithelial,mesenchymal |
| R5920 |
T9681 |
T9679 |
pobj |
mesenchyme,from |
| R5921 |
T9682 |
T9681 |
amod |
underlying,mesenchyme |
| R5922 |
T9683 |
T9684 |
aux |
to,produce |
| R5923 |
T9684 |
T9668 |
advcl |
produce,converge |
| R5924 |
T9685 |
T9686 |
det |
an,complex |
| R5925 |
T9686 |
T9684 |
dobj |
complex,produce |
| R5926 |
T9687 |
T9686 |
amod |
active,complex |
| R5927 |
T9688 |
T9689 |
compound |
transcription,factor |
| R5928 |
T9689 |
T9686 |
compound |
factor,complex |
| R5929 |
T9690 |
T9686 |
acl |
involving,complex |
| R593 |
T1412 |
T1409 |
amod |
mesenchymal,crosstalk |
| R5930 |
T9691 |
T9692 |
compound |
β,catenin |
| R5931 |
T9692 |
T9690 |
dobj |
catenin,involving |
| R5932 |
T9693 |
T9692 |
punct |
-,catenin |
| R5933 |
T9694 |
T9692 |
cc |
and,catenin |
| R5934 |
T9695 |
T9692 |
conj |
LEF,catenin |
| R5935 |
T9696 |
T9695 |
punct |
-,LEF |
| R5936 |
T9697 |
T9695 |
nummod |
1,LEF |
| R5937 |
T9698 |
T9686 |
punct |
", ",complex |
| R5938 |
T9699 |
T9700 |
dep |
which,plays |
| R5939 |
T9700 |
T9686 |
relcl |
plays,complex |
| R594 |
T1413 |
T1412 |
punct |
-,mesenchymal |
| R5940 |
T9701 |
T9700 |
prep |
in,plays |
| R5941 |
T9702 |
T9701 |
pobj |
turn,in |
| R5942 |
T9703 |
T9704 |
det |
a,role |
| R5943 |
T9704 |
T9700 |
dobj |
role,plays |
| R5944 |
T9705 |
T9704 |
amod |
key,role |
| R5945 |
T9706 |
T9700 |
prep |
in,plays |
| R5946 |
T9707 |
T9706 |
pcomp |
specifying,in |
| R5947 |
T9708 |
T9709 |
det |
the,fate |
| R5948 |
T9709 |
T9707 |
dobj |
fate,specifying |
| R5949 |
T9710 |
T9711 |
compound |
hair,follicle |
| R595 |
T1414 |
T1415 |
dep |
that,specify |
| R5950 |
T9711 |
T9709 |
compound |
follicle,fate |
| R5951 |
T9712 |
T9713 |
punct |
[,37 |
| R5952 |
T9713 |
T9684 |
parataxis |
37,produce |
| R5953 |
T9714 |
T9713 |
nummod |
4,37 |
| R5954 |
T9715 |
T9713 |
punct |
",",37 |
| R5955 |
T9716 |
T9713 |
nummod |
29,37 |
| R5956 |
T9717 |
T9713 |
punct |
",",37 |
| R5957 |
T9718 |
T9713 |
nummod |
30,37 |
| R5958 |
T9719 |
T9713 |
punct |
",",37 |
| R5959 |
T9720 |
T9713 |
nummod |
36,37 |
| R596 |
T1415 |
T1409 |
relcl |
specify,crosstalk |
| R5960 |
T9721 |
T9713 |
punct |
",",37 |
| R5961 |
T9722 |
T9713 |
punct |
],37 |
| R5962 |
T9723 |
T9662 |
punct |
.,suggest |
| R5963 |
T9725 |
T9726 |
amod |
Sonic,hedgehog |
| R5964 |
T9726 |
T9727 |
nsubj |
hedgehog,play |
| R5965 |
T9728 |
T9726 |
punct |
(,hedgehog |
| R5966 |
T9729 |
T9726 |
appos |
Shh,hedgehog |
| R5967 |
T9730 |
T9726 |
punct |
),hedgehog |
| R5968 |
T9731 |
T9726 |
cc |
and,hedgehog |
| R5969 |
T9732 |
T9733 |
compound |
TGF,β2 |
| R597 |
T1416 |
T1415 |
aux |
will,specify |
| R5970 |
T9733 |
T9735 |
compound |
β2,signaling |
| R5971 |
T9734 |
T9733 |
punct |
-,β2 |
| R5972 |
T9735 |
T9726 |
conj |
signaling,hedgehog |
| R5973 |
T9736 |
T9727 |
advmod |
also,play |
| R5974 |
T9737 |
T9738 |
amod |
essential,roles |
| R5975 |
T9738 |
T9727 |
dobj |
roles,play |
| R5976 |
T9739 |
T9727 |
prep |
in,play |
| R5977 |
T9740 |
T9741 |
compound |
follicle,morphogenesis |
| R5978 |
T9741 |
T9739 |
pobj |
morphogenesis,in |
| R5979 |
T9742 |
T9727 |
punct |
", ",play |
| R598 |
T1417 |
T1418 |
det |
the,bud |
| R5980 |
T9743 |
T9727 |
cc |
but,play |
| R5981 |
T9744 |
T9745 |
prep |
in,form |
| R5982 |
T9745 |
T9727 |
conj |
form,play |
| R5983 |
T9746 |
T9744 |
pobj |
contrast,in |
| R5984 |
T9747 |
T9746 |
prep |
to,contrast |
| R5985 |
T9748 |
T9749 |
compound |
β,catenin |
| R5986 |
T9749 |
T9751 |
npadvmod |
catenin,null |
| R5987 |
T9750 |
T9749 |
punct |
-,catenin |
| R5988 |
T9751 |
T9752 |
amod |
null,skin |
| R5989 |
T9752 |
T9747 |
pobj |
skin,to |
| R599 |
T1418 |
T1415 |
dobj |
bud,specify |
| R5990 |
T9753 |
T9752 |
punct |
", ",skin |
| R5991 |
T9754 |
T9755 |
prep |
in,are |
| R5992 |
T9755 |
T9752 |
relcl |
are,skin |
| R5993 |
T9756 |
T9754 |
pobj |
which,in |
| R5994 |
T9757 |
T9758 |
compound |
follicle,invaginations |
| R5995 |
T9758 |
T9755 |
nsubj |
invaginations,are |
| R5996 |
T9759 |
T9755 |
acomp |
absent,are |
| R5997 |
T9760 |
T9761 |
punct |
[,30 |
| R5998 |
T9761 |
T9747 |
parataxis |
30,to |
| R5999 |
T9762 |
T9761 |
punct |
],30 |
| R600 |
T1419 |
T1420 |
punct |
[,3 |
| R6000 |
T9763 |
T9745 |
punct |
", ",form |
| R6001 |
T9764 |
T9765 |
det |
some,buds |
| R6002 |
T9765 |
T9745 |
nsubj |
buds,form |
| R6003 |
T9766 |
T9765 |
compound |
hair,buds |
| R6004 |
T9767 |
T9745 |
advmod |
still,form |
| R6005 |
T9768 |
T9745 |
prep |
in,form |
| R6006 |
T9769 |
T9770 |
det |
the,absence |
| R6007 |
T9770 |
T9768 |
pobj |
absence,in |
| R6008 |
T9771 |
T9770 |
prep |
of,absence |
| R6009 |
T9772 |
T9771 |
pobj |
LEF,of |
| R601 |
T1420 |
T1393 |
parataxis |
3,populate |
| R6010 |
T9773 |
T9772 |
punct |
-,LEF |
| R6011 |
T9774 |
T9772 |
nummod |
1,LEF |
| R6012 |
T9775 |
T9772 |
punct |
", ",LEF |
| R6013 |
T9776 |
T9772 |
conj |
Shh,LEF |
| R6014 |
T9777 |
T9776 |
punct |
", ",Shh |
| R6015 |
T9778 |
T9776 |
cc |
or,Shh |
| R6016 |
T9779 |
T9780 |
compound |
TGF,β2 |
| R6017 |
T9780 |
T9776 |
conj |
β2,Shh |
| R6018 |
T9781 |
T9780 |
punct |
-,β2 |
| R6019 |
T9782 |
T9783 |
punct |
[,38 |
| R602 |
T1421 |
T1420 |
punct |
],3 |
| R6020 |
T9783 |
T9745 |
parataxis |
38,form |
| R6021 |
T9784 |
T9783 |
nummod |
32,38 |
| R6022 |
T9785 |
T9783 |
punct |
",",38 |
| R6023 |
T9786 |
T9783 |
punct |
],38 |
| R6024 |
T9787 |
T9745 |
punct |
.,form |
| R6025 |
T9789 |
T9790 |
nsubj |
These,reflect |
| R6026 |
T9791 |
T9790 |
advmod |
likely,reflect |
| R6027 |
T9792 |
T9793 |
det |
the,wave |
| R6028 |
T9793 |
T9790 |
dobj |
wave,reflect |
| R6029 |
T9794 |
T9793 |
amod |
first,wave |
| R603 |
T1422 |
T1393 |
punct |
.,populate |
| R6030 |
T9795 |
T9793 |
prep |
of,wave |
| R6031 |
T9796 |
T9797 |
nmod |
follicle,morphogenesis |
| R6032 |
T9797 |
T9795 |
pobj |
morphogenesis,of |
| R6033 |
T9798 |
T9799 |
punct |
(,hair |
| R6034 |
T9799 |
T9797 |
parataxis |
hair,morphogenesis |
| R6035 |
T9800 |
T9799 |
advmod |
i.e.,hair |
| R6036 |
T9801 |
T9799 |
punct |
", ",hair |
| R6037 |
T9802 |
T9799 |
compound |
guard,hair |
| R6038 |
T9803 |
T9799 |
punct |
),hair |
| R6039 |
T9804 |
T9793 |
punct |
", ",wave |
| R604 |
T1424 |
T1425 |
mark |
Once,committed |
| R6040 |
T9805 |
T9806 |
dep |
which,accounts |
| R6041 |
T9806 |
T9793 |
relcl |
accounts,wave |
| R6042 |
T9807 |
T9806 |
prep |
for,accounts |
| R6043 |
T9808 |
T9809 |
det |
a,number |
| R6044 |
T9809 |
T9807 |
pobj |
number,for |
| R6045 |
T9810 |
T9809 |
amod |
small,number |
| R6046 |
T9811 |
T9809 |
punct |
(,number |
| R6047 |
T9812 |
T9813 |
amod |
fewer,5 |
| R6048 |
T9813 |
T9815 |
nummod |
5,% |
| R6049 |
T9814 |
T9813 |
quantmod |
than,5 |
| R605 |
T1425 |
T1426 |
advcl |
committed,instructs |
| R6050 |
T9815 |
T9809 |
appos |
%,number |
| R6051 |
T9816 |
T9809 |
punct |
),number |
| R6052 |
T9817 |
T9809 |
prep |
of,number |
| R6053 |
T9818 |
T9817 |
pobj |
hairs,of |
| R6054 |
T9819 |
T9806 |
cc |
and,accounts |
| R6055 |
T9820 |
T9806 |
conj |
is,accounts |
| R6056 |
T9821 |
T9820 |
prep |
under,is |
| R6057 |
T9822 |
T9823 |
amod |
distinct,control |
| R6058 |
T9823 |
T9821 |
pobj |
control,under |
| R6059 |
T9824 |
T9823 |
amod |
regulatory,control |
| R606 |
T1427 |
T1426 |
punct |
", ",instructs |
| R6060 |
T9825 |
T9790 |
punct |
.,reflect |
| R6061 |
T9827 |
T9828 |
compound |
Guard,hairs |
| R6062 |
T9828 |
T9829 |
nsubj |
hairs,form |
| R6063 |
T9830 |
T9829 |
prep |
in,form |
| R6064 |
T9831 |
T9832 |
det |
the,absence |
| R6065 |
T9832 |
T9830 |
pobj |
absence,in |
| R6066 |
T9833 |
T9832 |
prep |
of,absence |
| R6067 |
T9834 |
T9833 |
pobj |
LEF,of |
| R6068 |
T9835 |
T9834 |
punct |
-,LEF |
| R6069 |
T9836 |
T9834 |
nummod |
1,LEF |
| R607 |
T1428 |
T1429 |
det |
a,cluster |
| R6070 |
T9837 |
T9834 |
cc |
and,LEF |
| R6071 |
T9838 |
T9839 |
compound |
TGF,β2 |
| R6072 |
T9839 |
T9834 |
conj |
β2,LEF |
| R6073 |
T9840 |
T9839 |
punct |
-,β2 |
| R6074 |
T9841 |
T9829 |
punct |
", ",form |
| R6075 |
T9842 |
T9829 |
cc |
and,form |
| R6076 |
T9843 |
T9844 |
nsubj |
we,found |
| R6077 |
T9844 |
T9829 |
conj |
found,form |
| R6078 |
T9845 |
T9844 |
aux |
have,found |
| R6079 |
T9846 |
T9847 |
mark |
that,fail |
| R608 |
T1429 |
T1426 |
nsubj |
cluster,instructs |
| R6080 |
T9847 |
T9844 |
ccomp |
fail,found |
| R6081 |
T9848 |
T9847 |
nsubj |
they,fail |
| R6082 |
T9849 |
T9847 |
advmod |
also,fail |
| R6083 |
T9850 |
T9851 |
aux |
to,express |
| R6084 |
T9851 |
T9847 |
xcomp |
express,fail |
| R6085 |
T9852 |
T9851 |
dobj |
Snail,express |
| R6086 |
T9853 |
T9847 |
prep |
at,fail |
| R6087 |
T9854 |
T9855 |
det |
the,stage |
| R6088 |
T9855 |
T9853 |
pobj |
stage,at |
| R6089 |
T9856 |
T9855 |
compound |
budding,stage |
| R609 |
T1430 |
T1429 |
amod |
small,cluster |
| R6090 |
T9857 |
T9855 |
prep |
of,stage |
| R6091 |
T9858 |
T9857 |
pobj |
development,of |
| R6092 |
T9859 |
T9860 |
punct |
(,data |
| R6093 |
T9860 |
T9844 |
meta |
data,found |
| R6094 |
T9861 |
T9860 |
amod |
unpublished,data |
| R6095 |
T9862 |
T9860 |
punct |
),data |
| R6096 |
T9863 |
T9844 |
punct |
.,found |
| R6097 |
T9865 |
T9866 |
advmod |
How,regulated |
| R6098 |
T9866 |
T9871 |
csubj |
regulated,remains |
| R6099 |
T9867 |
T9868 |
compound |
E,cadherin |
| R610 |
T1431 |
T1429 |
prep |
of,cluster |
| R6100 |
T9868 |
T9866 |
nsubjpass |
cadherin,regulated |
| R6101 |
T9869 |
T9868 |
punct |
-,cadherin |
| R6102 |
T9870 |
T9866 |
auxpass |
is,regulated |
| R6103 |
T9872 |
T9866 |
prep |
in,regulated |
| R6104 |
T9873 |
T9874 |
compound |
guard,hairs |
| R6105 |
T9874 |
T9872 |
pobj |
hairs,in |
| R6106 |
T9875 |
T9876 |
aux |
to,determined |
| R6107 |
T9876 |
T9871 |
xcomp |
determined,remains |
| R6108 |
T9877 |
T9876 |
auxpass |
be,determined |
| R6109 |
T9878 |
T9871 |
punct |
.,remains |
| R611 |
T1432 |
T1433 |
amod |
epithelial,cells |
| R6110 |
T9880 |
T9881 |
amod |
Several,candidates |
| R6111 |
T9881 |
T9882 |
nsubj |
candidates,include |
| R6112 |
T9883 |
T9884 |
amod |
other,members |
| R6113 |
T9884 |
T9882 |
dobj |
members,include |
| R6114 |
T9885 |
T9884 |
compound |
Snail,members |
| R6115 |
T9886 |
T9884 |
compound |
family,members |
| R6116 |
T9887 |
T9888 |
amod |
such,as |
| R6117 |
T9888 |
T9884 |
prep |
as,members |
| R6118 |
T9889 |
T9888 |
pobj |
Slug,as |
| R6119 |
T9890 |
T9889 |
cc |
or,Slug |
| R612 |
T1433 |
T1431 |
pobj |
cells,of |
| R6120 |
T9891 |
T9889 |
conj |
twist,Slug |
| R6121 |
T9892 |
T9884 |
punct |
", ",members |
| R6122 |
T9893 |
T9884 |
cc |
or,members |
| R6123 |
T9894 |
T9895 |
advmod |
alternatively,factors |
| R6124 |
T9895 |
T9884 |
conj |
factors,members |
| R6125 |
T9896 |
T9895 |
punct |
", ",factors |
| R6126 |
T9897 |
T9895 |
compound |
transcription,factors |
| R6127 |
T9898 |
T9895 |
acl |
involving,factors |
| R6128 |
T9899 |
T9900 |
compound |
β,catenin |
| R6129 |
T9900 |
T9898 |
dobj |
catenin,involving |
| R613 |
T1434 |
T1429 |
punct |
", ",cluster |
| R6130 |
T9901 |
T9900 |
punct |
-,catenin |
| R6131 |
T9902 |
T9900 |
cc |
and,catenin |
| R6132 |
T9903 |
T9904 |
det |
a,member |
| R6133 |
T9904 |
T9900 |
conj |
member,catenin |
| R6134 |
T9905 |
T9904 |
amod |
different,member |
| R6135 |
T9906 |
T9904 |
prep |
of,member |
| R6136 |
T9907 |
T9908 |
det |
the,family |
| R6137 |
T9908 |
T9906 |
pobj |
family,of |
| R6138 |
T9909 |
T9910 |
nmod |
LEF,box |
| R6139 |
T9910 |
T9908 |
nmod |
box,family |
| R614 |
T1435 |
T1436 |
det |
the,placode |
| R6140 |
T9911 |
T9909 |
punct |
-,LEF |
| R6141 |
T9912 |
T9909 |
nummod |
1,LEF |
| R6142 |
T9913 |
T9909 |
punct |
/,LEF |
| R6143 |
T9914 |
T9909 |
appos |
TCF,LEF |
| R6144 |
T9915 |
T9909 |
punct |
/,LEF |
| R6145 |
T9916 |
T9917 |
compound |
Sry,type |
| R6146 |
T9917 |
T9909 |
appos |
type,LEF |
| R6147 |
T9918 |
T9917 |
punct |
-,type |
| R6148 |
T9919 |
T9910 |
nmod |
HMG,box |
| R6149 |
T9920 |
T9921 |
punct |
(,known |
| R615 |
T1436 |
T1429 |
appos |
placode,cluster |
| R6150 |
T9921 |
T9910 |
parataxis |
known,box |
| R6151 |
T9922 |
T9921 |
advmod |
commonly,known |
| R6152 |
T9923 |
T9921 |
prep |
as,known |
| R6153 |
T9924 |
T9923 |
pobj |
SOX,as |
| R6154 |
T9925 |
T9921 |
punct |
),known |
| R6155 |
T9926 |
T9927 |
punct |
[,40 |
| R6156 |
T9927 |
T9882 |
parataxis |
40,include |
| R6157 |
T9928 |
T9927 |
nummod |
39,40 |
| R6158 |
T9929 |
T9927 |
punct |
",",40 |
| R6159 |
T9930 |
T9927 |
punct |
],40 |
| R616 |
T1437 |
T1426 |
punct |
", ",instructs |
| R6160 |
T9931 |
T9882 |
punct |
.,include |
| R6161 |
T9933 |
T9934 |
amod |
Further,investigation |
| R6162 |
T9934 |
T9935 |
nsubjpass |
investigation,required |
| R6163 |
T9936 |
T9935 |
aux |
will,required |
| R6164 |
T9937 |
T9935 |
auxpass |
be,required |
| R6165 |
T9938 |
T9939 |
aux |
to,determine |
| R6166 |
T9939 |
T9935 |
advcl |
determine,required |
| R6167 |
T9940 |
T9941 |
mark |
whether,is |
| R6168 |
T9941 |
T9939 |
ccomp |
is,determine |
| R6169 |
T9942 |
T9943 |
det |
the,pathway |
| R617 |
T1438 |
T1439 |
det |
a,group |
| R6170 |
T9943 |
T9941 |
nsubj |
pathway,is |
| R6171 |
T9944 |
T9943 |
compound |
signaling,pathway |
| R6172 |
T9945 |
T9946 |
nsubj |
we,elucidated |
| R6173 |
T9946 |
T9943 |
advcl |
elucidated,pathway |
| R6174 |
T9947 |
T9946 |
aux |
have,elucidated |
| R6175 |
T9948 |
T9946 |
advmod |
here,elucidated |
| R6176 |
T9949 |
T9950 |
det |
a,theme |
| R6177 |
T9950 |
T9941 |
attr |
theme,is |
| R6178 |
T9951 |
T9950 |
prep |
with,theme |
| R6179 |
T9952 |
T9953 |
amod |
multiple,variations |
| R618 |
T1439 |
T1440 |
nsubj |
group,condense |
| R6180 |
T9953 |
T9951 |
pobj |
variations,with |
| R6181 |
T9954 |
T9935 |
punct |
.,required |
| R6182 |
T9956 |
T9957 |
compound |
TGF,βs |
| R6183 |
T9957 |
T9959 |
nsubjpass |
βs,known |
| R6184 |
T9958 |
T9957 |
punct |
-,βs |
| R6185 |
T9960 |
T9959 |
auxpass |
are,known |
| R6186 |
T9961 |
T9962 |
aux |
to,promote |
| R6187 |
T9962 |
T9959 |
xcomp |
promote,known |
| R6188 |
T9963 |
T9962 |
dobj |
withdrawal,promote |
| R6189 |
T9964 |
T9963 |
prep |
of,withdrawal |
| R619 |
T1440 |
T1426 |
ccomp |
condense,instructs |
| R6190 |
T9965 |
T9964 |
pobj |
keratinocytes,of |
| R6191 |
T9966 |
T9963 |
prep |
from,withdrawal |
| R6192 |
T9967 |
T9968 |
det |
the,cycle |
| R6193 |
T9968 |
T9966 |
pobj |
cycle,from |
| R6194 |
T9969 |
T9968 |
compound |
cell,cycle |
| R6195 |
T9970 |
T9971 |
punct |
[,41 |
| R6196 |
T9971 |
T9959 |
parataxis |
41,known |
| R6197 |
T9972 |
T9971 |
punct |
],41 |
| R6198 |
T9973 |
T9959 |
punct |
.,known |
| R6199 |
T9975 |
T9976 |
advmod |
Hence,focused |
| R620 |
T1441 |
T1439 |
prep |
of,group |
| R6200 |
T9977 |
T9976 |
punct |
", ",focused |
| R6201 |
T9978 |
T9979 |
advmod |
when,detected |
| R6202 |
T9979 |
T9976 |
advcl |
detected,focused |
| R6203 |
T9980 |
T9981 |
compound |
TGF,β2 |
| R6204 |
T9981 |
T9983 |
compound |
β2,protein |
| R6205 |
T9982 |
T9981 |
punct |
-,β2 |
| R6206 |
T9983 |
T9979 |
nsubjpass |
protein,detected |
| R6207 |
T9984 |
T9979 |
auxpass |
was,detected |
| R6208 |
T9985 |
T9979 |
prep |
at,detected |
| R6209 |
T9986 |
T9987 |
det |
the,transition |
| R621 |
T1442 |
T1443 |
amod |
underlying,cells |
| R6210 |
T9987 |
T9985 |
pobj |
transition,at |
| R6211 |
T9988 |
T9987 |
prep |
between,transition |
| R6212 |
T9989 |
T9990 |
det |
the,phases |
| R6213 |
T9990 |
T9988 |
pobj |
phases,between |
| R6214 |
T9991 |
T9992 |
npadvmod |
growing,destructive |
| R6215 |
T9992 |
T9990 |
amod |
destructive,phases |
| R6216 |
T9993 |
T9992 |
cc |
and,destructive |
| R6217 |
T9994 |
T9990 |
prep |
of,phases |
| R6218 |
T9995 |
T9996 |
det |
the,cycle |
| R6219 |
T9996 |
T9994 |
pobj |
cycle,of |
| R622 |
T1443 |
T1441 |
pobj |
cells,of |
| R6220 |
T9997 |
T9996 |
amod |
adult,cycle |
| R6221 |
T9998 |
T9996 |
compound |
hair,cycle |
| R6222 |
T9999 |
T9976 |
punct |
", ",focused |
| R6223 |
T10000 |
T9976 |
nsubj |
research,focused |
| R6224 |
T10001 |
T9976 |
advmod |
initially,focused |
| R6225 |
T10002 |
T10001 |
cc |
and,initially |
| R6226 |
T10003 |
T10001 |
conj |
naturally,initially |
| R6227 |
T10004 |
T9976 |
prep |
on,focused |
| R6228 |
T10005 |
T10006 |
det |
a,role |
| R6229 |
T10006 |
T10004 |
pobj |
role,on |
| R623 |
T1444 |
T1443 |
amod |
mesenchymal,cells |
| R6230 |
T10007 |
T10006 |
prep |
for,role |
| R6231 |
T10008 |
T10009 |
det |
this,member |
| R6232 |
T10009 |
T10007 |
pobj |
member,for |
| R6233 |
T10010 |
T10009 |
compound |
family,member |
| R6234 |
T10011 |
T10006 |
prep |
in,role |
| R6235 |
T10012 |
T10011 |
pobj |
cessation,in |
| R6236 |
T10013 |
T10012 |
prep |
of,cessation |
| R6237 |
T10014 |
T10013 |
pobj |
growth,of |
| R6238 |
T10015 |
T10012 |
cc |
and,cessation |
| R6239 |
T10016 |
T10015 |
punct |
/,and |
| R624 |
T1445 |
T1440 |
aux |
to,condense |
| R6240 |
T10017 |
T10015 |
cc |
or,and |
| R6241 |
T10018 |
T10012 |
conj |
triggering,cessation |
| R6242 |
T10019 |
T10018 |
dobj |
apoptosis,triggering |
| R6243 |
T10020 |
T10021 |
punct |
(,42 |
| R6244 |
T10021 |
T9976 |
parataxis |
42,focused |
| R6245 |
T10022 |
T10021 |
punct |
[,42 |
| R6246 |
T10023 |
T10021 |
punct |
],42 |
| R6247 |
T10024 |
T10021 |
cc |
and,42 |
| R6248 |
T10025 |
T10021 |
conj |
references,42 |
| R6249 |
T10026 |
T10025 |
advmod |
therein,references |
| R625 |
T1446 |
T1440 |
cc |
and,condense |
| R6250 |
T10027 |
T10021 |
punct |
),42 |
| R6251 |
T10028 |
T9976 |
punct |
.,focused |
| R6252 |
T10030 |
T10031 |
advmod |
However,displays |
| R6253 |
T10032 |
T10031 |
punct |
", ",displays |
| R6254 |
T10033 |
T10031 |
prep |
in,displays |
| R6255 |
T10034 |
T10033 |
pobj |
contrast,in |
| R6256 |
T10035 |
T10034 |
prep |
to,contrast |
| R6257 |
T10036 |
T10037 |
compound |
TGF,β1 |
| R6258 |
T10037 |
T10039 |
npadvmod |
β1,null |
| R6259 |
T10038 |
T10037 |
punct |
-,β1 |
| R626 |
T1447 |
T1440 |
conj |
form,condense |
| R6260 |
T10039 |
T10041 |
amod |
null,skin |
| R6261 |
T10040 |
T10039 |
punct |
-,null |
| R6262 |
T10041 |
T10035 |
pobj |
skin,to |
| R6263 |
T10042 |
T10041 |
punct |
", ",skin |
| R6264 |
T10043 |
T10044 |
dep |
which,exhibits |
| R6265 |
T10044 |
T10041 |
relcl |
exhibits,skin |
| R6266 |
T10045 |
T10046 |
det |
an,phase |
| R6267 |
T10046 |
T10044 |
dobj |
phase,exhibits |
| R6268 |
T10047 |
T10046 |
amod |
extended,phase |
| R6269 |
T10048 |
T10046 |
compound |
growing,phase |
| R627 |
T1448 |
T1449 |
det |
the,papilla |
| R6270 |
T10049 |
T10046 |
prep |
of,phase |
| R6271 |
T10050 |
T10051 |
amod |
postnatal,follicles |
| R6272 |
T10051 |
T10049 |
pobj |
follicles,of |
| R6273 |
T10052 |
T10051 |
compound |
hair,follicles |
| R6274 |
T10053 |
T10031 |
punct |
", ",displays |
| R6275 |
T10054 |
T10055 |
compound |
TGF,β2 |
| R6276 |
T10055 |
T10057 |
npadvmod |
β2,null |
| R6277 |
T10056 |
T10055 |
punct |
-,β2 |
| R6278 |
T10057 |
T10059 |
amod |
null,skin |
| R6279 |
T10058 |
T10057 |
punct |
-,null |
| R628 |
T1449 |
T1447 |
dobj |
papilla,form |
| R6280 |
T10059 |
T10031 |
nsubj |
skin,displays |
| R6281 |
T10060 |
T10061 |
det |
an,block |
| R6282 |
T10061 |
T10031 |
dobj |
block,displays |
| R6283 |
T10062 |
T10061 |
amod |
embryonic,block |
| R6284 |
T10063 |
T10061 |
prep |
in,block |
| R6285 |
T10064 |
T10065 |
compound |
follicle,bud |
| R6286 |
T10065 |
T10066 |
compound |
bud,progression |
| R6287 |
T10066 |
T10063 |
pobj |
progression,in |
| R6288 |
T10067 |
T10068 |
punct |
[,32 |
| R6289 |
T10068 |
T10031 |
parataxis |
32,displays |
| R629 |
T1450 |
T1449 |
amod |
nascent,papilla |
| R6290 |
T10069 |
T10068 |
punct |
],32 |
| R6291 |
T10070 |
T10031 |
punct |
.,displays |
| R6292 |
T10072 |
T10073 |
mark |
Although,is |
| R6293 |
T10073 |
T10076 |
advcl |
is,appear |
| R6294 |
T10074 |
T10075 |
det |
this,phenotype |
| R6295 |
T10075 |
T10073 |
nsubj |
phenotype,is |
| R6296 |
T10077 |
T10073 |
acomp |
consistent,is |
| R6297 |
T10078 |
T10077 |
prep |
with,consistent |
| R6298 |
T10079 |
T10080 |
compound |
TGF,β2 |
| R6299 |
T10080 |
T10082 |
poss |
β2,patterns |
| R630 |
T1451 |
T1449 |
amod |
dermal,papilla |
| R6300 |
T10081 |
T10080 |
punct |
-,β2 |
| R6301 |
T10082 |
T10078 |
pobj |
patterns,with |
| R6302 |
T10083 |
T10080 |
case |
's,β2 |
| R6303 |
T10084 |
T10082 |
amod |
embryonic,patterns |
| R6304 |
T10085 |
T10082 |
compound |
expression,patterns |
| R6305 |
T10086 |
T10087 |
punct |
[,33 |
| R6306 |
T10087 |
T10073 |
parataxis |
33,is |
| R6307 |
T10088 |
T10087 |
punct |
],33 |
| R6308 |
T10089 |
T10076 |
punct |
", ",appear |
| R6309 |
T10090 |
T10091 |
quantmod |
about,50 |
| R631 |
T1452 |
T1449 |
punct |
", ",papilla |
| R6310 |
T10091 |
T10092 |
nummod |
50,% |
| R6311 |
T10092 |
T10076 |
nsubj |
%,appear |
| R6312 |
T10093 |
T10092 |
prep |
of,% |
| R6313 |
T10094 |
T10095 |
compound |
TGF,β2 |
| R6314 |
T10095 |
T10097 |
npadvmod |
β2,null |
| R6315 |
T10096 |
T10095 |
punct |
-,β2 |
| R6316 |
T10097 |
T10098 |
amod |
null,buds |
| R6317 |
T10098 |
T10093 |
pobj |
buds,of |
| R6318 |
T10099 |
T10076 |
oprd |
unable,appear |
| R6319 |
T10100 |
T10101 |
aux |
to,progress |
| R632 |
T1453 |
T1454 |
dep |
which,be |
| R6320 |
T10101 |
T10099 |
xcomp |
progress,unable |
| R6321 |
T10102 |
T10101 |
prep |
to,progress |
| R6322 |
T10103 |
T10104 |
det |
the,phase |
| R6323 |
T10104 |
T10102 |
pobj |
phase,to |
| R6324 |
T10105 |
T10106 |
amod |
down,growth |
| R6325 |
T10106 |
T10104 |
compound |
growth,phase |
| R6326 |
T10107 |
T10106 |
punct |
-,growth |
| R6327 |
T10108 |
T10099 |
punct |
", ",unable |
| R6328 |
T10109 |
T10110 |
det |
a,feature |
| R6329 |
T10110 |
T10099 |
npadvmod |
feature,unable |
| R633 |
T1454 |
T1449 |
relcl |
be,papilla |
| R6330 |
T10111 |
T10112 |
dep |
that,explained |
| R6331 |
T10112 |
T10110 |
relcl |
explained,feature |
| R6332 |
T10113 |
T10112 |
aux |
can,explained |
| R6333 |
T10114 |
T10112 |
neg |
not,explained |
| R6334 |
T10115 |
T10112 |
auxpass |
be,explained |
| R6335 |
T10116 |
T10112 |
advmod |
readily,explained |
| R6336 |
T10117 |
T10112 |
prep |
on,explained |
| R6337 |
T10118 |
T10119 |
det |
the,basis |
| R6338 |
T10119 |
T10117 |
pobj |
basis,on |
| R6339 |
T10120 |
T10119 |
prep |
of,basis |
| R634 |
T1455 |
T1454 |
aux |
will,be |
| R6340 |
T10121 |
T10122 |
advmod |
previously,established |
| R6341 |
T10122 |
T10123 |
amod |
established,effects |
| R6342 |
T10123 |
T10120 |
pobj |
effects,of |
| R6343 |
T10124 |
T10123 |
prep |
of,effects |
| R6344 |
T10125 |
T10126 |
compound |
TGF,βs |
| R6345 |
T10126 |
T10124 |
pobj |
βs,of |
| R6346 |
T10127 |
T10126 |
punct |
-,βs |
| R6347 |
T10128 |
T10076 |
punct |
.,appear |
| R6348 |
T10130 |
T10131 |
poss |
Our,finding |
| R6349 |
T10131 |
T10132 |
nsubj |
finding,lends |
| R635 |
T1456 |
T1457 |
det |
a,fixture |
| R6350 |
T10133 |
T10134 |
mark |
that,is |
| R6351 |
T10134 |
T10131 |
acl |
is,finding |
| R6352 |
T10135 |
T10136 |
compound |
TGF,β2 |
| R6353 |
T10136 |
T10134 |
nsubj |
β2,is |
| R6354 |
T10137 |
T10136 |
punct |
-,β2 |
| R6355 |
T10138 |
T10134 |
advmod |
upstream,is |
| R6356 |
T10139 |
T10138 |
prep |
from,upstream |
| R6357 |
T10140 |
T10141 |
compound |
Ki67,expression |
| R6358 |
T10141 |
T10139 |
pobj |
expression,from |
| R6359 |
T10142 |
T10141 |
cc |
and,expression |
| R636 |
T1457 |
T1454 |
attr |
fixture,be |
| R6360 |
T10143 |
T10144 |
compound |
MAPK,activation |
| R6361 |
T10144 |
T10141 |
conj |
activation,expression |
| R6362 |
T10145 |
T10146 |
amod |
further,support |
| R6363 |
T10146 |
T10132 |
dobj |
support,lends |
| R6364 |
T10147 |
T10132 |
dative |
to,lends |
| R6365 |
T10148 |
T10149 |
det |
the,notion |
| R6366 |
T10149 |
T10147 |
pobj |
notion,to |
| R6367 |
T10150 |
T10151 |
mark |
that,react |
| R6368 |
T10151 |
T10149 |
acl |
react,notion |
| R6369 |
T10152 |
T10153 |
compound |
hair,follicle |
| R637 |
T1458 |
T1457 |
amod |
permanent,fixture |
| R6370 |
T10153 |
T10154 |
compound |
follicle,keratinocytes |
| R6371 |
T10154 |
T10151 |
nsubj |
keratinocytes,react |
| R6372 |
T10155 |
T10154 |
prep |
at,keratinocytes |
| R6373 |
T10156 |
T10157 |
det |
this,stage |
| R6374 |
T10157 |
T10155 |
pobj |
stage,at |
| R6375 |
T10158 |
T10157 |
amod |
early,stage |
| R6376 |
T10159 |
T10157 |
prep |
of,stage |
| R6377 |
T10160 |
T10159 |
pobj |
development,of |
| R6378 |
T10161 |
T10151 |
prep |
to,react |
| R6379 |
T10162 |
T10163 |
compound |
TGF,β2 |
| R638 |
T1459 |
T1457 |
prep |
of,fixture |
| R6380 |
T10163 |
T10165 |
compound |
β2,signaling |
| R6381 |
T10164 |
T10163 |
punct |
-,β2 |
| R6382 |
T10165 |
T10161 |
pobj |
signaling,to |
| R6383 |
T10166 |
T10151 |
prep |
in,react |
| R6384 |
T10167 |
T10168 |
det |
a,fashion |
| R6385 |
T10168 |
T10166 |
pobj |
fashion,in |
| R6386 |
T10169 |
T10168 |
amod |
opposite,fashion |
| R6387 |
T10170 |
T10169 |
prep |
to,opposite |
| R6388 |
T10171 |
T10170 |
pobj |
that,to |
| R6389 |
T10172 |
T10173 |
advmod |
typically,expected |
| R639 |
T1460 |
T1461 |
det |
the,follicle |
| R6390 |
T10173 |
T10171 |
acl |
expected,that |
| R6391 |
T10174 |
T10173 |
prep |
for,expected |
| R6392 |
T10175 |
T10176 |
compound |
TGF,β |
| R6393 |
T10176 |
T10178 |
compound |
β,factors |
| R6394 |
T10177 |
T10176 |
punct |
-,β |
| R6395 |
T10178 |
T10174 |
pobj |
factors,for |
| R6396 |
T10179 |
T10132 |
punct |
.,lends |
| R6397 |
T10181 |
T10182 |
nsubj |
This,said |
| R6398 |
T10182 |
T10183 |
advcl |
said,appeared |
| R6399 |
T10184 |
T10183 |
punct |
", ",appeared |
| R640 |
T1461 |
T1459 |
pobj |
follicle,of |
| R6400 |
T10185 |
T10183 |
prep |
based,appeared |
| R6401 |
T10186 |
T10185 |
prep |
upon,based |
| R6402 |
T10187 |
T10188 |
compound |
pSMAD2,immunohistochemistry |
| R6403 |
T10188 |
T10186 |
pobj |
immunohistochemistry,upon |
| R6404 |
T10189 |
T10183 |
punct |
", ",appeared |
| R6405 |
T10190 |
T10191 |
det |
the,steps |
| R6406 |
T10191 |
T10183 |
nsubj |
steps,appeared |
| R6407 |
T10192 |
T10191 |
amod |
immediate,steps |
| R6408 |
T10193 |
T10191 |
prep |
of,steps |
| R6409 |
T10194 |
T10195 |
amod |
downstream,signaling |
| R641 |
T1462 |
T1461 |
compound |
hair,follicle |
| R6410 |
T10195 |
T10193 |
pobj |
signaling,of |
| R6411 |
T10196 |
T10197 |
aux |
to,be |
| R6412 |
T10197 |
T10183 |
xcomp |
be,appeared |
| R6413 |
T10198 |
T10197 |
acomp |
intact,be |
| R6414 |
T10199 |
T10183 |
punct |
.,appeared |
| R6415 |
T10201 |
T10202 |
advmod |
Thus,surmise |
| R6416 |
T10203 |
T10202 |
punct |
", ",surmise |
| R6417 |
T10204 |
T10202 |
nsubj |
we,surmise |
| R6418 |
T10205 |
T10206 |
mark |
that,is |
| R6419 |
T10206 |
T10202 |
ccomp |
is,surmise |
| R642 |
T1463 |
T1426 |
punct |
.,instructs |
| R6420 |
T10207 |
T10208 |
det |
the,outcome |
| R6421 |
T10208 |
T10206 |
nsubj |
outcome,is |
| R6422 |
T10209 |
T10208 |
amod |
proliferative,outcome |
| R6423 |
T10210 |
T10206 |
acomp |
likely,is |
| R6424 |
T10211 |
T10212 |
aux |
to,rooted |
| R6425 |
T10212 |
T10210 |
xcomp |
rooted,likely |
| R6426 |
T10213 |
T10212 |
auxpass |
be,rooted |
| R6427 |
T10214 |
T10212 |
prep |
in,rooted |
| R6428 |
T10215 |
T10214 |
pobj |
differences,in |
| R6429 |
T10216 |
T10215 |
prep |
in,differences |
| R643 |
T1465 |
T1466 |
amod |
Subsequent,exchanges |
| R6430 |
T10217 |
T10218 |
det |
the,repertoire |
| R6431 |
T10218 |
T10216 |
pobj |
repertoire,in |
| R6432 |
T10219 |
T10218 |
prep |
of,repertoire |
| R6433 |
T10220 |
T10221 |
amod |
activated,genes |
| R6434 |
T10221 |
T10219 |
pobj |
genes,of |
| R6435 |
T10222 |
T10221 |
compound |
SMAD,genes |
| R6436 |
T10223 |
T10221 |
compound |
target,genes |
| R6437 |
T10224 |
T10202 |
punct |
.,surmise |
| R6438 |
T10226 |
T10227 |
prep |
In,be |
| R6439 |
T10228 |
T10229 |
det |
this,regard |
| R644 |
T1466 |
T1467 |
nsubj |
exchanges,result |
| R6440 |
T10229 |
T10226 |
pobj |
regard,In |
| R6441 |
T10230 |
T10227 |
punct |
", ",be |
| R6442 |
T10231 |
T10232 |
det |
the,effects |
| R6443 |
T10232 |
T10227 |
nsubj |
effects,be |
| R6444 |
T10233 |
T10232 |
amod |
positive,effects |
| R6445 |
T10234 |
T10232 |
prep |
of,effects |
| R6446 |
T10235 |
T10236 |
compound |
TGF,β2 |
| R6447 |
T10236 |
T10234 |
pobj |
β2,of |
| R6448 |
T10237 |
T10236 |
punct |
-,β2 |
| R6449 |
T10238 |
T10232 |
prep |
on,effects |
| R645 |
T1468 |
T1466 |
prep |
between,exchanges |
| R6450 |
T10239 |
T10238 |
pobj |
proliferation,on |
| R6451 |
T10240 |
T10232 |
prep |
within,effects |
| R6452 |
T10241 |
T10242 |
det |
the,bud |
| R6453 |
T10242 |
T10240 |
pobj |
bud,within |
| R6454 |
T10243 |
T10242 |
compound |
hair,bud |
| R6455 |
T10244 |
T10227 |
aux |
may,be |
| R6456 |
T10245 |
T10246 |
advmod |
more,analogous |
| R6457 |
T10246 |
T10227 |
acomp |
analogous,be |
| R6458 |
T10247 |
T10246 |
prep |
to,analogous |
| R6459 |
T10248 |
T10249 |
dep |
what,seen |
| R646 |
T1469 |
T1470 |
det |
the,placode |
| R6460 |
T10249 |
T10247 |
pobj |
seen,to |
| R6461 |
T10250 |
T10249 |
aux |
has,seen |
| R6462 |
T10251 |
T10249 |
auxpass |
been,seen |
| R6463 |
T10252 |
T10249 |
prep |
in,seen |
| R6464 |
T10253 |
T10252 |
pobj |
progression,in |
| R6465 |
T10254 |
T10253 |
prep |
of,progression |
| R6466 |
T10255 |
T10256 |
amod |
squamous,cell |
| R6467 |
T10256 |
T10257 |
compound |
cell,carcinoma |
| R6468 |
T10257 |
T10254 |
pobj |
carcinoma,of |
| R6469 |
T10258 |
T10253 |
prep |
to,progression |
| R647 |
T1470 |
T1468 |
pobj |
placode,between |
| R6470 |
T10259 |
T10260 |
amod |
metastatic,carcinoma |
| R6471 |
T10260 |
T10258 |
pobj |
carcinoma,to |
| R6472 |
T10261 |
T10262 |
punct |
[,43 |
| R6473 |
T10262 |
T10249 |
parataxis |
43,seen |
| R6474 |
T10263 |
T10262 |
punct |
],43 |
| R6475 |
T10264 |
T10265 |
advmod |
rather,than |
| R6476 |
T10265 |
T10249 |
cc |
than,seen |
| R6477 |
T10266 |
T10249 |
conj |
that,seen |
| R6478 |
T10267 |
T10268 |
advmod |
typically,observed |
| R6479 |
T10268 |
T10266 |
acl |
observed,that |
| R648 |
T1471 |
T1470 |
cc |
and,placode |
| R6480 |
T10269 |
T10268 |
prep |
for,observed |
| R6481 |
T10270 |
T10269 |
pobj |
keratinocytes,for |
| R6482 |
T10271 |
T10272 |
punct |
[,46 |
| R6483 |
T10272 |
T10227 |
parataxis |
46,be |
| R6484 |
T10273 |
T10272 |
nummod |
44,46 |
| R6485 |
T10274 |
T10272 |
punct |
",",46 |
| R6486 |
T10275 |
T10272 |
nummod |
45,46 |
| R6487 |
T10276 |
T10272 |
punct |
",",46 |
| R6488 |
T10277 |
T10272 |
punct |
],46 |
| R6489 |
T10278 |
T10227 |
punct |
.,be |
| R649 |
T1472 |
T1473 |
amod |
nascent,papilla |
| R6490 |
T10280 |
T10281 |
det |
The,identification |
| R6491 |
T10281 |
T10283 |
nsubj |
identification,was |
| R6492 |
T10282 |
T10281 |
amod |
prior,identification |
| R6493 |
T10284 |
T10281 |
prep |
of,identification |
| R6494 |
T10285 |
T10286 |
det |
the,gene |
| R6495 |
T10286 |
T10284 |
pobj |
gene,of |
| R6496 |
T10287 |
T10286 |
compound |
Snail,gene |
| R6497 |
T10288 |
T10281 |
prep |
as,identification |
| R6498 |
T10289 |
T10290 |
det |
a,target |
| R6499 |
T10290 |
T10288 |
pobj |
target,as |
| R650 |
T1473 |
T1470 |
conj |
papilla,placode |
| R6500 |
T10291 |
T10290 |
amod |
potential,target |
| R6501 |
T10292 |
T10290 |
prep |
of,target |
| R6502 |
T10293 |
T10294 |
compound |
TGF,β |
| R6503 |
T10294 |
T10296 |
compound |
β,signaling |
| R6504 |
T10295 |
T10294 |
punct |
-,β |
| R6505 |
T10296 |
T10292 |
pobj |
signaling,of |
| R6506 |
T10297 |
T10298 |
punct |
[,15 |
| R6507 |
T10298 |
T10281 |
parataxis |
15,identification |
| R6508 |
T10299 |
T10298 |
punct |
],15 |
| R6509 |
T10300 |
T10283 |
acomp |
intriguing,was |
| R651 |
T1474 |
T1473 |
amod |
dermal,papilla |
| R6510 |
T10301 |
T10283 |
punct |
", ",was |
| R6511 |
T10302 |
T10283 |
prep |
given,was |
| R6512 |
T10303 |
T10304 |
det |
the,wave |
| R6513 |
T10304 |
T10302 |
pobj |
wave,given |
| R6514 |
T10305 |
T10304 |
amod |
temporal,wave |
| R6515 |
T10306 |
T10304 |
prep |
of,wave |
| R6516 |
T10307 |
T10308 |
compound |
Snail,expression |
| R6517 |
T10308 |
T10306 |
pobj |
expression,of |
| R6518 |
T10309 |
T10308 |
compound |
gene,expression |
| R6519 |
T10310 |
T10311 |
dep |
that,occurs |
| R652 |
T1475 |
T1467 |
prep |
in,result |
| R6520 |
T10311 |
T10304 |
relcl |
occurs,wave |
| R6521 |
T10312 |
T10311 |
prep |
in,occurs |
| R6522 |
T10313 |
T10314 |
det |
the,bud |
| R6523 |
T10314 |
T10312 |
pobj |
bud,in |
| R6524 |
T10315 |
T10314 |
amod |
developing,bud |
| R6525 |
T10316 |
T10314 |
compound |
hair,bud |
| R6526 |
T10317 |
T10283 |
punct |
.,was |
| R6527 |
T10319 |
T10320 |
det |
The,correlation |
| R6528 |
T10320 |
T10322 |
nsubj |
correlation,fostered |
| R6529 |
T10321 |
T10320 |
amod |
additional,correlation |
| R653 |
T1476 |
T1477 |
amod |
further,growth |
| R6530 |
T10323 |
T10320 |
prep |
between,correlation |
| R6531 |
T10324 |
T10325 |
amod |
epithelial,hyperproliferation |
| R6532 |
T10325 |
T10323 |
pobj |
hyperproliferation,between |
| R6533 |
T10326 |
T10325 |
cc |
and,hyperproliferation |
| R6534 |
T10327 |
T10328 |
compound |
Snail,expression |
| R6535 |
T10328 |
T10325 |
conj |
expression,hyperproliferation |
| R6536 |
T10329 |
T10328 |
compound |
transgene,expression |
| R6537 |
T10330 |
T10322 |
advmod |
further,fostered |
| R6538 |
T10331 |
T10332 |
poss |
our,interest |
| R6539 |
T10332 |
T10322 |
dobj |
interest,fostered |
| R654 |
T1477 |
T1475 |
pobj |
growth,in |
| R6540 |
T10333 |
T10332 |
prep |
in,interest |
| R6541 |
T10334 |
T10335 |
det |
a,link |
| R6542 |
T10335 |
T10333 |
pobj |
link,in |
| R6543 |
T10336 |
T10335 |
amod |
possible,link |
| R6544 |
T10337 |
T10335 |
prep |
between,link |
| R6545 |
T10338 |
T10339 |
compound |
TGF,β2 |
| R6546 |
T10339 |
T10337 |
pobj |
β2,between |
| R6547 |
T10340 |
T10339 |
punct |
-,β2 |
| R6548 |
T10341 |
T10339 |
cc |
and,β2 |
| R6549 |
T10342 |
T10339 |
conj |
Snail,β2 |
| R655 |
T1478 |
T1477 |
prep |
of,growth |
| R6550 |
T10343 |
T10322 |
punct |
.,fostered |
| R6551 |
T10345 |
T10346 |
poss |
Our,studies |
| R6552 |
T10346 |
T10348 |
nsubj |
studies,demonstrate |
| R6553 |
T10347 |
T10346 |
amod |
functional,studies |
| R6554 |
T10349 |
T10350 |
mark |
that,abolished |
| R6555 |
T10350 |
T10348 |
ccomp |
abolished,demonstrate |
| R6556 |
T10351 |
T10350 |
prep |
without,abolished |
| R6557 |
T10352 |
T10353 |
compound |
TGF,β2 |
| R6558 |
T10353 |
T10351 |
pobj |
β2,without |
| R6559 |
T10354 |
T10353 |
punct |
-,β2 |
| R656 |
T1479 |
T1480 |
det |
the,follicle |
| R6560 |
T10355 |
T10350 |
punct |
", ",abolished |
| R6561 |
T10356 |
T10357 |
compound |
Snail,expression |
| R6562 |
T10357 |
T10350 |
nsubjpass |
expression,abolished |
| R6563 |
T10358 |
T10350 |
auxpass |
is,abolished |
| R6564 |
T10359 |
T10350 |
prep |
in,abolished |
| R6565 |
T10360 |
T10361 |
det |
the,buds |
| R6566 |
T10361 |
T10359 |
pobj |
buds,in |
| R6567 |
T10362 |
T10361 |
compound |
mutant,buds |
| R6568 |
T10363 |
T10361 |
compound |
hair,buds |
| R6569 |
T10364 |
T10350 |
punct |
", ",abolished |
| R657 |
T1480 |
T1478 |
pobj |
follicle,of |
| R6570 |
T10365 |
T10350 |
cc |
and,abolished |
| R6571 |
T10366 |
T10367 |
advmod |
conversely,activated |
| R6572 |
T10367 |
T10350 |
conj |
activated,abolished |
| R6573 |
T10368 |
T10367 |
punct |
", ",activated |
| R6574 |
T10369 |
T10367 |
prep |
in,activated |
| R6575 |
T10370 |
T10371 |
compound |
K14,Smad2 |
| R6576 |
T10371 |
T10373 |
compound |
Smad2,skin |
| R6577 |
T10372 |
T10371 |
punct |
-,Smad2 |
| R6578 |
T10373 |
T10369 |
pobj |
skin,in |
| R6579 |
T10374 |
T10367 |
punct |
", ",activated |
| R658 |
T1481 |
T1477 |
prep |
into,growth |
| R6580 |
T10375 |
T10367 |
nsubjpass |
Snail,activated |
| R6581 |
T10376 |
T10367 |
auxpass |
is,activated |
| R6582 |
T10377 |
T10367 |
advmod |
ectopically,activated |
| R6583 |
T10378 |
T10348 |
punct |
.,demonstrate |
| R6584 |
T10380 |
T10381 |
advmod |
Moreover,indicate |
| R6585 |
T10382 |
T10381 |
punct |
", ",indicate |
| R6586 |
T10383 |
T10384 |
poss |
our,studies |
| R6587 |
T10384 |
T10381 |
nsubj |
studies,indicate |
| R6588 |
T10385 |
T10386 |
advmod |
in,vitro |
| R6589 |
T10386 |
T10384 |
amod |
vitro,studies |
| R659 |
T1482 |
T1483 |
det |
the,dermis |
| R6590 |
T10387 |
T10388 |
mark |
that,cause |
| R6591 |
T10388 |
T10381 |
ccomp |
cause,indicate |
| R6592 |
T10389 |
T10390 |
advmod |
even,exposure |
| R6593 |
T10390 |
T10388 |
nsubj |
exposure,cause |
| R6594 |
T10391 |
T10390 |
amod |
sustained,exposure |
| R6595 |
T10392 |
T10393 |
compound |
TGF,β2 |
| R6596 |
T10393 |
T10390 |
compound |
β2,exposure |
| R6597 |
T10394 |
T10393 |
punct |
-,β2 |
| R6598 |
T10395 |
T10388 |
aux |
may,cause |
| R6599 |
T10396 |
T10397 |
advmod |
only,induction |
| R660 |
T1483 |
T1481 |
pobj |
dermis,into |
| R6600 |
T10397 |
T10388 |
dobj |
induction,cause |
| R6601 |
T10398 |
T10397 |
det |
a,induction |
| R6602 |
T10399 |
T10397 |
amod |
transient,induction |
| R6603 |
T10400 |
T10397 |
prep |
of,induction |
| R6604 |
T10401 |
T10400 |
pobj |
Snail,of |
| R6605 |
T10402 |
T10381 |
punct |
", ",indicate |
| R6606 |
T10403 |
T10381 |
advcl |
offering,indicate |
| R6607 |
T10404 |
T10405 |
det |
a,explanation |
| R6608 |
T10405 |
T10403 |
dobj |
explanation,offering |
| R6609 |
T10406 |
T10405 |
amod |
possible,explanation |
| R661 |
T1484 |
T1483 |
amod |
underlying,dermis |
| R6610 |
T10407 |
T10405 |
prep |
as,explanation |
| R6611 |
T10408 |
T10407 |
prep |
to,as |
| R6612 |
T10409 |
T10410 |
advmod |
why,expressed |
| R6613 |
T10410 |
T10408 |
pcomp |
expressed,to |
| R6614 |
T10411 |
T10410 |
nsubjpass |
Snail,expressed |
| R6615 |
T10412 |
T10410 |
auxpass |
is,expressed |
| R6616 |
T10413 |
T10414 |
advmod |
so,briefly |
| R6617 |
T10414 |
T10410 |
advmod |
briefly,expressed |
| R6618 |
T10415 |
T10410 |
prep |
during,expressed |
| R6619 |
T10416 |
T10417 |
compound |
hair,follicle |
| R662 |
T1485 |
T1477 |
punct |
", ",growth |
| R6620 |
T10417 |
T10418 |
compound |
follicle,morphogenesis |
| R6621 |
T10418 |
T10415 |
pobj |
morphogenesis,during |
| R6622 |
T10419 |
T10381 |
punct |
.,indicate |
| R6623 |
T10421 |
T10422 |
det |
An,point |
| R6624 |
T10422 |
T10424 |
nsubj |
point,is |
| R6625 |
T10423 |
T10422 |
amod |
additional,point |
| R6626 |
T10425 |
T10422 |
amod |
worth,point |
| R6627 |
T10426 |
T10425 |
advcl |
mentioning,worth |
| R6628 |
T10427 |
T10428 |
mark |
that,resulted |
| R6629 |
T10428 |
T10424 |
ccomp |
resulted,is |
| R663 |
T1486 |
T1477 |
cc |
or,growth |
| R6630 |
T10429 |
T10430 |
amod |
prolonged,expression |
| R6631 |
T10430 |
T10428 |
nsubj |
expression,resulted |
| R6632 |
T10431 |
T10430 |
prep |
of,expression |
| R6633 |
T10432 |
T10433 |
compound |
Tg,Snail |
| R6634 |
T10433 |
T10431 |
pobj |
Snail,of |
| R6635 |
T10434 |
T10430 |
prep |
in,expression |
| R6636 |
T10435 |
T10436 |
amod |
postnatal,skin |
| R6637 |
T10436 |
T10434 |
pobj |
skin,in |
| R6638 |
T10437 |
T10428 |
prep |
in,resulted |
| R6639 |
T10438 |
T10439 |
amod |
morphological,signs |
| R664 |
T1487 |
T1488 |
amod |
down,growth |
| R6640 |
T10439 |
T10437 |
pobj |
signs,in |
| R6641 |
T10440 |
T10438 |
cc |
and,morphological |
| R6642 |
T10441 |
T10438 |
conj |
biochemical,morphological |
| R6643 |
T10442 |
T10439 |
prep |
of,signs |
| R6644 |
T10443 |
T10444 |
amod |
epithelial,transitions |
| R6645 |
T10444 |
T10442 |
pobj |
transitions,of |
| R6646 |
T10445 |
T10443 |
prep |
to,epithelial |
| R6647 |
T10446 |
T10445 |
amod |
mesenchymal,to |
| R6648 |
T10447 |
T10448 |
punct |
(,data |
| R6649 |
T10448 |
T10428 |
meta |
data,resulted |
| R665 |
T1488 |
T1477 |
conj |
growth,growth |
| R6650 |
T10449 |
T10448 |
amod |
unpublished,data |
| R6651 |
T10450 |
T10448 |
punct |
),data |
| R6652 |
T10451 |
T10428 |
punct |
", ",resulted |
| R6653 |
T10452 |
T10428 |
advcl |
underscoring,resulted |
| R6654 |
T10453 |
T10454 |
advmod |
why,be |
| R6655 |
T10454 |
T10452 |
ccomp |
be,underscoring |
| R6656 |
T10455 |
T10456 |
amod |
transient,expression |
| R6657 |
T10456 |
T10454 |
nsubj |
expression,be |
| R6658 |
T10457 |
T10456 |
compound |
Snail,expression |
| R6659 |
T10458 |
T10454 |
aux |
may,be |
| R666 |
T1489 |
T1488 |
punct |
-,growth |
| R6660 |
T10459 |
T10460 |
advmod |
so,important |
| R6661 |
T10460 |
T10454 |
acomp |
important,be |
| R6662 |
T10461 |
T10454 |
prep |
during,be |
| R6663 |
T10462 |
T10463 |
amod |
normal,morphogenesis |
| R6664 |
T10463 |
T10461 |
pobj |
morphogenesis,during |
| R6665 |
T10464 |
T10465 |
compound |
hair,follicle |
| R6666 |
T10465 |
T10463 |
compound |
follicle,morphogenesis |
| R6667 |
T10466 |
T10467 |
punct |
[,18 |
| R6668 |
T10467 |
T10424 |
parataxis |
18,is |
| R6669 |
T10468 |
T10467 |
punct |
],18 |
| R667 |
T1490 |
T1488 |
punct |
", ",growth |
| R6670 |
T10469 |
T10424 |
punct |
.,is |
| R6671 |
T10471 |
T10472 |
prep |
At,seemed |
| R6672 |
T10473 |
T10474 |
amod |
first,glance |
| R6673 |
T10474 |
T10471 |
pobj |
glance,At |
| R6674 |
T10475 |
T10472 |
punct |
", ",seemed |
| R6675 |
T10476 |
T10477 |
det |
the,sparsity |
| R6676 |
T10477 |
T10472 |
nsubj |
sparsity,seemed |
| R6677 |
T10478 |
T10477 |
prep |
in,sparsity |
| R6678 |
T10479 |
T10480 |
compound |
hair,coat |
| R6679 |
T10480 |
T10478 |
pobj |
coat,in |
| R668 |
T1491 |
T1488 |
cc |
and,growth |
| R6680 |
T10481 |
T10480 |
prep |
of,coat |
| R6681 |
T10482 |
T10483 |
compound |
K14,Snail |
| R6682 |
T10483 |
T10485 |
compound |
Snail,mice |
| R6683 |
T10484 |
T10483 |
punct |
-,Snail |
| R6684 |
T10485 |
T10481 |
pobj |
mice,of |
| R6685 |
T10486 |
T10485 |
compound |
Tg,mice |
| R6686 |
T10487 |
T10472 |
oprd |
indicative,seemed |
| R6687 |
T10488 |
T10487 |
prep |
of,indicative |
| R6688 |
T10489 |
T10490 |
det |
a,defect |
| R6689 |
T10490 |
T10488 |
pobj |
defect,of |
| R669 |
T1492 |
T1493 |
amod |
eventual,differentiation |
| R6690 |
T10491 |
T10490 |
prep |
in,defect |
| R6691 |
T10492 |
T10493 |
compound |
follicle,formation |
| R6692 |
T10493 |
T10491 |
pobj |
formation,in |
| R6693 |
T10494 |
T10495 |
punct |
(,see |
| R6694 |
T10495 |
T10472 |
parataxis |
see,seemed |
| R6695 |
T10496 |
T10497 |
compound |
Figure,2A |
| R6696 |
T10497 |
T10495 |
dobj |
2A,see |
| R6697 |
T10498 |
T10495 |
punct |
),see |
| R6698 |
T10499 |
T10472 |
punct |
.,seemed |
| R6699 |
T10501 |
T10502 |
amod |
Closer,inspection |
| R670 |
T1493 |
T1488 |
conj |
differentiation,growth |
| R6700 |
T10502 |
T10503 |
nsubj |
inspection,revealed |
| R6701 |
T10504 |
T10503 |
punct |
", ",revealed |
| R6702 |
T10505 |
T10503 |
advmod |
however,revealed |
| R6703 |
T10506 |
T10503 |
punct |
", ",revealed |
| R6704 |
T10507 |
T10508 |
mark |
that,penetrated |
| R6705 |
T10508 |
T10503 |
ccomp |
penetrated,revealed |
| R6706 |
T10509 |
T10510 |
neg |
not,hairs |
| R6707 |
T10510 |
T10508 |
nsubj |
hairs,penetrated |
| R6708 |
T10511 |
T10510 |
det |
all,hairs |
| R6709 |
T10512 |
T10513 |
det |
the,epidermis |
| R671 |
T1494 |
T1493 |
prep |
into,differentiation |
| R6710 |
T10513 |
T10508 |
dobj |
epidermis,penetrated |
| R6711 |
T10514 |
T10513 |
amod |
hyperthickened,epidermis |
| R6712 |
T10515 |
T10513 |
compound |
Tg,epidermis |
| R6713 |
T10516 |
T10503 |
punct |
.,revealed |
| R6714 |
T10518 |
T10519 |
amod |
Several,factors |
| R6715 |
T10519 |
T10520 |
nsubj |
factors,contribute |
| R6716 |
T10521 |
T10520 |
aux |
may,contribute |
| R6717 |
T10522 |
T10520 |
prep |
to,contribute |
| R6718 |
T10523 |
T10524 |
det |
the,development |
| R6719 |
T10524 |
T10522 |
pobj |
development,to |
| R672 |
T1495 |
T1496 |
det |
the,layers |
| R6720 |
T10525 |
T10526 |
advmod |
seemingly,normal |
| R6721 |
T10526 |
T10524 |
amod |
normal,development |
| R6722 |
T10527 |
T10524 |
compound |
follicle,development |
| R6723 |
T10528 |
T10524 |
prep |
in,development |
| R6724 |
T10529 |
T10530 |
det |
these,mice |
| R6725 |
T10530 |
T10528 |
pobj |
mice,in |
| R6726 |
T10531 |
T10520 |
punct |
.,contribute |
| R6727 |
T10533 |
T10534 |
nummod |
One,factor |
| R6728 |
T10534 |
T10536 |
nsubj |
factor,is |
| R6729 |
T10535 |
T10534 |
amod |
obvious,factor |
| R673 |
T1496 |
T1494 |
pobj |
layers,into |
| R6730 |
T10537 |
T10538 |
det |
the,promoter |
| R6731 |
T10538 |
T10536 |
attr |
promoter,is |
| R6732 |
T10539 |
T10538 |
compound |
K14,promoter |
| R6733 |
T10540 |
T10538 |
punct |
", ",promoter |
| R6734 |
T10541 |
T10542 |
dep |
which,is |
| R6735 |
T10542 |
T10538 |
relcl |
is,promoter |
| R6736 |
T10543 |
T10542 |
acomp |
elevated,is |
| R6737 |
T10544 |
T10542 |
prep |
in,is |
| R6738 |
T10545 |
T10546 |
det |
the,layer |
| R6739 |
T10546 |
T10544 |
pobj |
layer,in |
| R674 |
T1497 |
T1496 |
nummod |
six,layers |
| R6740 |
T10547 |
T10546 |
amod |
basal,layer |
| R6741 |
T10548 |
T10546 |
prep |
of,layer |
| R6742 |
T10549 |
T10550 |
det |
the,epidermis |
| R6743 |
T10550 |
T10548 |
pobj |
epidermis,of |
| R6744 |
T10551 |
T10546 |
cc |
and,layer |
| R6745 |
T10552 |
T10553 |
det |
the,sheath |
| R6746 |
T10553 |
T10546 |
conj |
sheath,layer |
| R6747 |
T10554 |
T10553 |
amod |
outer,sheath |
| R6748 |
T10555 |
T10553 |
compound |
root,sheath |
| R6749 |
T10556 |
T10553 |
punct |
(,sheath |
| R675 |
T1498 |
T1496 |
amod |
concentric,layers |
| R6750 |
T10557 |
T10553 |
appos |
ORS,sheath |
| R6751 |
T10558 |
T10553 |
punct |
),sheath |
| R6752 |
T10559 |
T10553 |
prep |
of,sheath |
| R6753 |
T10560 |
T10561 |
det |
the,follicle |
| R6754 |
T10561 |
T10559 |
pobj |
follicle,of |
| R6755 |
T10562 |
T10561 |
compound |
hair,follicle |
| R6756 |
T10563 |
T10536 |
punct |
", ",is |
| R6757 |
T10564 |
T10536 |
cc |
but,is |
| R6758 |
T10565 |
T10566 |
auxpass |
is,regulated |
| R6759 |
T10566 |
T10536 |
conj |
regulated,is |
| R676 |
T1499 |
T1496 |
prep |
of,layers |
| R6760 |
T10567 |
T10566 |
advmod |
markedly,regulated |
| R6761 |
T10568 |
T10566 |
advmod |
down,regulated |
| R6762 |
T10569 |
T10566 |
punct |
-,regulated |
| R6763 |
T10570 |
T10566 |
prep |
in,regulated |
| R6764 |
T10571 |
T10572 |
amod |
developing,buds |
| R6765 |
T10572 |
T10570 |
pobj |
buds,in |
| R6766 |
T10573 |
T10572 |
amod |
embryonic,buds |
| R6767 |
T10574 |
T10572 |
compound |
hair,buds |
| R6768 |
T10575 |
T10576 |
advmod |
as,as |
| R6769 |
T10576 |
T10570 |
cc |
as,in |
| R677 |
T1500 |
T1501 |
det |
the,follicle |
| R6770 |
T10577 |
T10576 |
advmod |
well,as |
| R6771 |
T10578 |
T10570 |
conj |
in,in |
| R6772 |
T10579 |
T10580 |
det |
the,cells |
| R6773 |
T10580 |
T10578 |
pobj |
cells,in |
| R6774 |
T10581 |
T10580 |
amod |
postnatal,cells |
| R6775 |
T10582 |
T10580 |
compound |
hair,cells |
| R6776 |
T10583 |
T10580 |
compound |
progenitor,cells |
| R6777 |
T10584 |
T10536 |
punct |
.,is |
| R6778 |
T10586 |
T10587 |
det |
The,promoter |
| R6779 |
T10587 |
T10589 |
nsubj |
promoter,is |
| R678 |
T1501 |
T1499 |
pobj |
follicle,of |
| R6780 |
T10588 |
T10587 |
compound |
K14,promoter |
| R6781 |
T10590 |
T10589 |
advmod |
also,is |
| R6782 |
T10591 |
T10592 |
advmod |
less,active |
| R6783 |
T10592 |
T10589 |
acomp |
active,is |
| R6784 |
T10593 |
T10592 |
prep |
in,active |
| R6785 |
T10594 |
T10595 |
det |
the,ORS |
| R6786 |
T10595 |
T10593 |
pobj |
ORS,in |
| R6787 |
T10596 |
T10592 |
prep |
than,active |
| R6788 |
T10597 |
T10596 |
pcomp |
epidermis,than |
| R6789 |
T10598 |
T10589 |
cc |
and,is |
| R679 |
T1502 |
T1501 |
amod |
mature,follicle |
| R6790 |
T10599 |
T10600 |
advmod |
hence,account |
| R6791 |
T10600 |
T10589 |
conj |
account,is |
| R6792 |
T10601 |
T10600 |
nsubj |
this,account |
| R6793 |
T10602 |
T10600 |
aux |
might,account |
| R6794 |
T10603 |
T10600 |
advmod |
also,account |
| R6795 |
T10604 |
T10600 |
prep |
for,account |
| R6796 |
T10605 |
T10606 |
det |
the,lack |
| R6797 |
T10606 |
T10604 |
pobj |
lack,for |
| R6798 |
T10607 |
T10606 |
prep |
of,lack |
| R6799 |
T10608 |
T10609 |
amod |
apparent,response |
| R680 |
T1503 |
T1467 |
punct |
.,result |
| R6800 |
T10609 |
T10607 |
pobj |
response,of |
| R6801 |
T10610 |
T10609 |
prep |
of,response |
| R6802 |
T10611 |
T10612 |
det |
the,ORS |
| R6803 |
T10612 |
T10610 |
pobj |
ORS,of |
| R6804 |
T10613 |
T10609 |
prep |
to,response |
| R6805 |
T10614 |
T10615 |
amod |
ectopic,Snail |
| R6806 |
T10615 |
T10613 |
pobj |
Snail,to |
| R6807 |
T10616 |
T10600 |
punct |
.,account |
| R6808 |
T10618 |
T10619 |
amod |
Additional,factors |
| R6809 |
T10619 |
T10621 |
nsubj |
factors,be |
| R681 |
T1505 |
T1506 |
advmod |
Previously,delineated |
| R6810 |
T10620 |
T10619 |
amod |
contributing,factors |
| R6811 |
T10622 |
T10621 |
aux |
could,be |
| R6812 |
T10623 |
T10624 |
det |
the,multiplicity |
| R6813 |
T10624 |
T10621 |
attr |
multiplicity,be |
| R6814 |
T10625 |
T10624 |
prep |
of,multiplicity |
| R6815 |
T10626 |
T10627 |
compound |
Snail,members |
| R6816 |
T10627 |
T10625 |
pobj |
members,of |
| R6817 |
T10628 |
T10627 |
compound |
family,members |
| R6818 |
T10629 |
T10627 |
cc |
and,members |
| R6819 |
T10630 |
T10631 |
poss |
their,expression |
| R682 |
T1507 |
T1506 |
punct |
", ",delineated |
| R6820 |
T10631 |
T10627 |
conj |
expression,members |
| R6821 |
T10632 |
T10631 |
amod |
differential,expression |
| R6822 |
T10633 |
T10627 |
punct |
", ",members |
| R6823 |
T10634 |
T10635 |
det |
the,saturation |
| R6824 |
T10635 |
T10627 |
appos |
saturation,members |
| R6825 |
T10636 |
T10635 |
punct |
", ",saturation |
| R6826 |
T10637 |
T10635 |
cc |
and,saturation |
| R6827 |
T10638 |
T10637 |
punct |
/,and |
| R6828 |
T10639 |
T10637 |
cc |
or,and |
| R6829 |
T10640 |
T10635 |
conj |
diversity,saturation |
| R683 |
T1508 |
T1506 |
nsubj |
we,delineated |
| R6830 |
T10641 |
T10635 |
prep |
of,saturation |
| R6831 |
T10642 |
T10643 |
amod |
regulatory,mechanisms |
| R6832 |
T10643 |
T10641 |
pobj |
mechanisms,of |
| R6833 |
T10644 |
T10645 |
dep |
that,govern |
| R6834 |
T10645 |
T10643 |
relcl |
govern,mechanisms |
| R6835 |
T10646 |
T10647 |
compound |
AJ,formation |
| R6836 |
T10647 |
T10645 |
dobj |
formation,govern |
| R6837 |
T10648 |
T10647 |
punct |
", ",formation |
| R6838 |
T10649 |
T10647 |
conj |
migration,formation |
| R6839 |
T10650 |
T10649 |
punct |
", ",migration |
| R684 |
T1509 |
T1510 |
advmod |
how,function |
| R6840 |
T10651 |
T10649 |
cc |
and,migration |
| R6841 |
T10652 |
T10649 |
conj |
proliferation,migration |
| R6842 |
T10653 |
T10645 |
prep |
in,govern |
| R6843 |
T10654 |
T10655 |
det |
the,ORS |
| R6844 |
T10655 |
T10653 |
pobj |
ORS,in |
| R6845 |
T10656 |
T10655 |
compound |
follicle,ORS |
| R6846 |
T10657 |
T10621 |
punct |
.,be |
| R6847 |
T10659 |
T10660 |
csubj |
Distinguishing,await |
| R6848 |
T10661 |
T10659 |
prep |
between,Distinguishing |
| R6849 |
T10662 |
T10663 |
det |
these,possibilities |
| R685 |
T1510 |
T1506 |
ccomp |
function,delineated |
| R6850 |
T10663 |
T10661 |
pobj |
possibilities,between |
| R6851 |
T10664 |
T10660 |
aux |
must,await |
| R6852 |
T10665 |
T10666 |
det |
the,generation |
| R6853 |
T10666 |
T10660 |
dobj |
generation,await |
| R6854 |
T10667 |
T10666 |
prep |
of,generation |
| R6855 |
T10668 |
T10667 |
pobj |
mice,of |
| R6856 |
T10669 |
T10668 |
acl |
harboring,mice |
| R6857 |
T10670 |
T10671 |
npadvmod |
skin,specific |
| R6858 |
T10671 |
T10673 |
amod |
specific,mutations |
| R6859 |
T10672 |
T10671 |
punct |
-,specific |
| R686 |
T1511 |
T1512 |
nummod |
two,signals |
| R6860 |
T10673 |
T10669 |
dobj |
mutations,harboring |
| R6861 |
T10674 |
T10673 |
nmod |
loss,mutations |
| R6862 |
T10675 |
T10674 |
punct |
-,loss |
| R6863 |
T10676 |
T10674 |
prep |
of,loss |
| R6864 |
T10677 |
T10676 |
punct |
-,of |
| R6865 |
T10678 |
T10676 |
pobj |
function,of |
| R6866 |
T10679 |
T10673 |
compound |
Snail,mutations |
| R6867 |
T10680 |
T10660 |
punct |
.,await |
| R687 |
T1512 |
T1510 |
nsubj |
signals,function |
| R6876 |
T11058 |
T11057 |
prep |
between,Links |
| R6877 |
T11059 |
T11058 |
pobj |
Signaling,between |
| R6878 |
T11060 |
T11059 |
punct |
", ",Signaling |
| R6879 |
T11061 |
T11062 |
amod |
Transcriptional,Cascades |
| R688 |
T1513 |
T1512 |
amod |
respective,signals |
| R6880 |
T11062 |
T11059 |
conj |
Cascades,Signaling |
| R6881 |
T11063 |
T11062 |
punct |
", ",Cascades |
| R6882 |
T11064 |
T11065 |
amod |
Epithelial,Remodeling |
| R6883 |
T11065 |
T11062 |
conj |
Remodeling,Cascades |
| R6884 |
T11066 |
T11065 |
punct |
", ",Remodeling |
| R6885 |
T11067 |
T11065 |
cc |
and,Remodeling |
| R6886 |
T11068 |
T11065 |
conj |
Proliferation,Remodeling |
| R6887 |
T11069 |
T11057 |
prep |
in,Links |
| R6888 |
T11070 |
T11071 |
det |
the,Bud |
| R6889 |
T11071 |
T11069 |
pobj |
Bud,in |
| R689 |
T1514 |
T1512 |
amod |
epithelial,signals |
| R6890 |
T11072 |
T11071 |
compound |
Hair,Bud |
| R6891 |
T11074 |
T11075 |
advmod |
Previously,discovered |
| R6892 |
T11076 |
T11075 |
punct |
", ",discovered |
| R6893 |
T11077 |
T11075 |
nsubj |
we,discovered |
| R6894 |
T11078 |
T11079 |
mark |
that,regulated |
| R6895 |
T11079 |
T11075 |
ccomp |
regulated,discovered |
| R6896 |
T11080 |
T11079 |
advmod |
early,regulated |
| R6897 |
T11081 |
T11080 |
prep |
during,early |
| R6898 |
T11082 |
T11083 |
compound |
hair,follicle |
| R6899 |
T11083 |
T11084 |
compound |
follicle,morphogenesis |
| R690 |
T1515 |
T1514 |
cc |
and,epithelial |
| R6900 |
T11084 |
T11081 |
pobj |
morphogenesis,during |
| R6901 |
T11085 |
T11079 |
punct |
", ",regulated |
| R6902 |
T11086 |
T11087 |
compound |
E,cadherin |
| R6903 |
T11087 |
T11089 |
compound |
cadherin,expression |
| R6904 |
T11088 |
T11087 |
punct |
-,cadherin |
| R6905 |
T11089 |
T11079 |
nsubjpass |
expression,regulated |
| R6906 |
T11090 |
T11089 |
compound |
gene,expression |
| R6907 |
T11091 |
T11079 |
auxpass |
is,regulated |
| R6908 |
T11092 |
T11079 |
advmod |
down,regulated |
| R6909 |
T11093 |
T11079 |
punct |
-,regulated |
| R691 |
T1516 |
T1514 |
conj |
mesenchymal,epithelial |
| R6910 |
T11094 |
T11079 |
advmod |
concomitantly,regulated |
| R6911 |
T11095 |
T11079 |
prep |
with,regulated |
| R6912 |
T11096 |
T11097 |
det |
the,invagination |
| R6913 |
T11097 |
T11095 |
pobj |
invagination,with |
| R6914 |
T11098 |
T11097 |
prep |
of,invagination |
| R6915 |
T11099 |
T11100 |
amod |
developing,cells |
| R6916 |
T11100 |
T11098 |
pobj |
cells,of |
| R6917 |
T11101 |
T11100 |
compound |
bud,cells |
| R6918 |
T11102 |
T11097 |
prep |
into,invagination |
| R6919 |
T11103 |
T11104 |
det |
the,skin |
| R692 |
T1517 |
T1512 |
punct |
", ",signals |
| R6920 |
T11104 |
T11102 |
pobj |
skin,into |
| R6921 |
T11105 |
T11106 |
punct |
[,4 |
| R6922 |
T11106 |
T11075 |
parataxis |
4,discovered |
| R6923 |
T11107 |
T11106 |
punct |
],4 |
| R6924 |
T11108 |
T11075 |
punct |
.,discovered |
| R6925 |
T11110 |
T11111 |
mark |
Because,correlated |
| R6926 |
T11111 |
T11117 |
advcl |
correlated,intrigued |
| R6927 |
T11112 |
T11113 |
det |
the,timing |
| R6928 |
T11113 |
T11111 |
nsubj |
timing,correlated |
| R6929 |
T11114 |
T11113 |
prep |
of,timing |
| R693 |
T1518 |
T1512 |
appos |
Wnts,signals |
| R6930 |
T11115 |
T11116 |
det |
this,event |
| R6931 |
T11116 |
T11114 |
pobj |
event,of |
| R6932 |
T11118 |
T11111 |
prep |
with,correlated |
| R6933 |
T11119 |
T11120 |
det |
the,activation |
| R6934 |
T11120 |
T11118 |
pobj |
activation,with |
| R6935 |
T11121 |
T11120 |
prep |
of,activation |
| R6936 |
T11122 |
T11123 |
det |
a,complex |
| R6937 |
T11123 |
T11121 |
pobj |
complex,of |
| R6938 |
T11124 |
T11125 |
nmod |
LEF,factor |
| R6939 |
T11125 |
T11123 |
compound |
factor,complex |
| R694 |
T1519 |
T1518 |
cc |
and,Wnts |
| R6940 |
T11126 |
T11124 |
punct |
-,LEF |
| R6941 |
T11127 |
T11124 |
nummod |
1,LEF |
| R6942 |
T11128 |
T11124 |
punct |
/,LEF |
| R6943 |
T11129 |
T11130 |
compound |
β,catenin |
| R6944 |
T11130 |
T11124 |
appos |
catenin,LEF |
| R6945 |
T11131 |
T11130 |
punct |
-,catenin |
| R6946 |
T11132 |
T11125 |
compound |
transcription,factor |
| R6947 |
T11133 |
T11134 |
punct |
[,20 |
| R6948 |
T11134 |
T11111 |
parataxis |
20,correlated |
| R6949 |
T11135 |
T11134 |
punct |
],20 |
| R695 |
T1520 |
T1521 |
det |
the,factor |
| R6950 |
T11136 |
T11117 |
punct |
", ",intrigued |
| R6951 |
T11137 |
T11117 |
nsubjpass |
we,intrigued |
| R6952 |
T11138 |
T11117 |
auxpass |
were,intrigued |
| R6953 |
T11139 |
T11117 |
agent |
by,intrigued |
| R6954 |
T11140 |
T11141 |
det |
the,presence |
| R6955 |
T11141 |
T11139 |
pobj |
presence,by |
| R6956 |
T11142 |
T11141 |
prep |
of,presence |
| R6957 |
T11143 |
T11144 |
det |
a,site |
| R6958 |
T11144 |
T11142 |
pobj |
site,of |
| R6959 |
T11145 |
T11144 |
amod |
putative,site |
| R696 |
T1521 |
T1518 |
conj |
factor,Wnts |
| R6960 |
T11146 |
T11144 |
nmod |
LEF,site |
| R6961 |
T11147 |
T11146 |
punct |
-,LEF |
| R6962 |
T11148 |
T11146 |
nummod |
1,LEF |
| R6963 |
T11149 |
T11146 |
punct |
/,LEF |
| R6964 |
T11150 |
T11146 |
appos |
TCF,LEF |
| R6965 |
T11151 |
T11144 |
compound |
binding,site |
| R6966 |
T11152 |
T11141 |
prep |
in,presence |
| R6967 |
T11153 |
T11154 |
det |
the,promoter |
| R6968 |
T11154 |
T11152 |
pobj |
promoter,in |
| R6969 |
T11155 |
T11156 |
compound |
E,cadherin |
| R697 |
T1522 |
T1523 |
npadvmod |
BMP,inhibitory |
| R6970 |
T11156 |
T11154 |
compound |
cadherin,promoter |
| R6971 |
T11157 |
T11156 |
punct |
-,cadherin |
| R6972 |
T11158 |
T11117 |
punct |
.,intrigued |
| R6973 |
T11160 |
T11161 |
nsubj |
This,prompted |
| R6974 |
T11162 |
T11163 |
det |
an,investigation |
| R6975 |
T11163 |
T11161 |
dobj |
investigation,prompted |
| R6976 |
T11164 |
T11165 |
dep |
that,led |
| R6977 |
T11165 |
T11163 |
relcl |
led,investigation |
| R6978 |
T11166 |
T11165 |
advmod |
subsequently,led |
| R6979 |
T11167 |
T11165 |
prep |
to,led |
| R698 |
T1523 |
T1521 |
amod |
inhibitory,factor |
| R6980 |
T11168 |
T11169 |
poss |
our,discovery |
| R6981 |
T11169 |
T11167 |
pobj |
discovery,to |
| R6982 |
T11170 |
T11171 |
mark |
that,contribute |
| R6983 |
T11171 |
T11169 |
acl |
contribute,discovery |
| R6984 |
T11172 |
T11171 |
nsubj |
LEF,contribute |
| R6985 |
T11173 |
T11172 |
punct |
-,LEF |
| R6986 |
T11174 |
T11172 |
nummod |
1,LEF |
| R6987 |
T11175 |
T11172 |
punct |
/,LEF |
| R6988 |
T11176 |
T11177 |
compound |
β,catenin |
| R6989 |
T11177 |
T11172 |
appos |
catenin,LEF |
| R699 |
T1524 |
T1523 |
punct |
-,inhibitory |
| R6990 |
T11178 |
T11177 |
punct |
-,catenin |
| R6991 |
T11179 |
T11171 |
aux |
can,contribute |
| R6992 |
T11180 |
T11171 |
prep |
to,contribute |
| R6993 |
T11181 |
T11180 |
pobj |
repression,to |
| R6994 |
T11182 |
T11181 |
prep |
of,repression |
| R6995 |
T11183 |
T11184 |
compound |
E,cadherin |
| R6996 |
T11184 |
T11186 |
compound |
cadherin,expression |
| R6997 |
T11185 |
T11184 |
punct |
-,cadherin |
| R6998 |
T11186 |
T11182 |
pobj |
expression,of |
| R6999 |
T11187 |
T11186 |
compound |
gene,expression |
| R700 |
T1525 |
T1521 |
appos |
noggin,factor |
| R7000 |
T11188 |
T11171 |
prep |
in,contribute |
| R7001 |
T11189 |
T11190 |
compound |
skin,keratinocytes |
| R7002 |
T11190 |
T11188 |
pobj |
keratinocytes,in |
| R7003 |
T11191 |
T11192 |
punct |
[,4 |
| R7004 |
T11192 |
T11161 |
parataxis |
4,prompted |
| R7005 |
T11193 |
T11192 |
punct |
],4 |
| R7006 |
T11194 |
T11161 |
punct |
.,prompted |
| R7007 |
T11196 |
T11197 |
prep |
In,noted |
| R7008 |
T11198 |
T11199 |
det |
the,course |
| R7009 |
T11199 |
T11196 |
pobj |
course,In |
| R701 |
T1526 |
T1510 |
punct |
", ",function |
| R7010 |
T11200 |
T11199 |
prep |
of,course |
| R7011 |
T11201 |
T11202 |
det |
these,studies |
| R7012 |
T11202 |
T11200 |
pobj |
studies,of |
| R7013 |
T11203 |
T11197 |
punct |
", ",noted |
| R7014 |
T11204 |
T11197 |
nsubj |
we,noted |
| R7015 |
T11205 |
T11197 |
advmod |
also,noted |
| R7016 |
T11206 |
T11207 |
mark |
that,contribute |
| R7017 |
T11207 |
T11197 |
ccomp |
contribute,noted |
| R7018 |
T11208 |
T11207 |
nsubj |
Snail,contribute |
| R7019 |
T11209 |
T11207 |
aux |
can,contribute |
| R702 |
T1527 |
T1510 |
prep |
in,function |
| R7020 |
T11210 |
T11207 |
advmod |
also,contribute |
| R7021 |
T11211 |
T11207 |
prep |
to,contribute |
| R7022 |
T11212 |
T11213 |
det |
this,process |
| R7023 |
T11213 |
T11211 |
pobj |
process,to |
| R7024 |
T11214 |
T11207 |
prep |
in,contribute |
| R7025 |
T11215 |
T11214 |
pobj |
keratinocytes,in |
| R7026 |
T11216 |
T11217 |
advmod |
in,vitro |
| R7027 |
T11217 |
T11207 |
advmod |
vitro,contribute |
| R7028 |
T11218 |
T11197 |
punct |
", ",noted |
| R7029 |
T11219 |
T11197 |
cc |
and,noted |
| R703 |
T1528 |
T1527 |
pobj |
concert,in |
| R7030 |
T11220 |
T11221 |
poss |
our,studies |
| R7031 |
T11221 |
T11223 |
nsubj |
studies,revealed |
| R7032 |
T11222 |
T11221 |
amod |
present,studies |
| R7033 |
T11223 |
T11197 |
conj |
revealed,noted |
| R7034 |
T11224 |
T11225 |
mark |
that,expressed |
| R7035 |
T11225 |
T11223 |
ccomp |
expressed,revealed |
| R7036 |
T11226 |
T11225 |
nsubjpass |
Snail,expressed |
| R7037 |
T11227 |
T11225 |
auxpass |
is,expressed |
| R7038 |
T11228 |
T11225 |
prep |
at,expressed |
| R7039 |
T11229 |
T11230 |
det |
the,place |
| R704 |
T1529 |
T1530 |
aux |
to,induce |
| R7040 |
T11230 |
T11228 |
pobj |
place,at |
| R7041 |
T11231 |
T11230 |
amod |
right,place |
| R7042 |
T11232 |
T11230 |
cc |
and,place |
| R7043 |
T11233 |
T11230 |
conj |
time,place |
| R7044 |
T11234 |
T11235 |
aux |
to,be |
| R7045 |
T11235 |
T11230 |
advcl |
be,place |
| R7046 |
T11236 |
T11237 |
advmod |
physiologically,relevant |
| R7047 |
T11237 |
T11235 |
acomp |
relevant,be |
| R7048 |
T11238 |
T11235 |
prep |
in,be |
| R7049 |
T11239 |
T11240 |
det |
the,process |
| R705 |
T1530 |
T1510 |
advcl |
induce,function |
| R7050 |
T11240 |
T11238 |
pobj |
process,in |
| R7051 |
T11241 |
T11223 |
punct |
.,revealed |
| R7052 |
T11243 |
T11244 |
prep |
In,abrogated |
| R7053 |
T11245 |
T11246 |
npadvmod |
noggin,null |
| R7054 |
T11246 |
T11248 |
amod |
null,skin |
| R7055 |
T11247 |
T11246 |
punct |
-,null |
| R7056 |
T11248 |
T11243 |
pobj |
skin,In |
| R7057 |
T11249 |
T11248 |
amod |
embryonic,skin |
| R7058 |
T11250 |
T11244 |
punct |
", ",abrogated |
| R7059 |
T11251 |
T11252 |
nmod |
LEF,expression |
| R706 |
T1531 |
T1532 |
amod |
lymphoid,factor |
| R7060 |
T11252 |
T11244 |
nsubjpass |
expression,abrogated |
| R7061 |
T11253 |
T11251 |
punct |
-,LEF |
| R7062 |
T11254 |
T11251 |
nummod |
1,LEF |
| R7063 |
T11255 |
T11252 |
cc |
and,expression |
| R7064 |
T11256 |
T11257 |
amod |
subsequent,activation |
| R7065 |
T11257 |
T11252 |
conj |
activation,expression |
| R7066 |
T11258 |
T11257 |
prep |
of,activation |
| R7067 |
T11259 |
T11260 |
det |
the,gene |
| R7068 |
T11260 |
T11258 |
pobj |
gene,of |
| R7069 |
T11261 |
T11260 |
nmod |
LEF,gene |
| R707 |
T1532 |
T1534 |
npadvmod |
factor,mediated |
| R7070 |
T11262 |
T11261 |
punct |
-,LEF |
| R7071 |
T11263 |
T11261 |
nummod |
1,LEF |
| R7072 |
T11264 |
T11261 |
punct |
/,LEF |
| R7073 |
T11265 |
T11266 |
compound |
β,catenin |
| R7074 |
T11266 |
T11261 |
appos |
catenin,LEF |
| R7075 |
T11267 |
T11266 |
punct |
-,catenin |
| R7076 |
T11268 |
T11260 |
compound |
reporter,gene |
| R7077 |
T11269 |
T11244 |
auxpass |
is,abrogated |
| R7078 |
T11270 |
T11244 |
prep |
in,abrogated |
| R7079 |
T11271 |
T11272 |
det |
the,placodes |
| R708 |
T1533 |
T1532 |
compound |
enhancer,factor |
| R7080 |
T11272 |
T11270 |
pobj |
placodes,in |
| R7081 |
T11273 |
T11272 |
amod |
developing,placodes |
| R7082 |
T11274 |
T11244 |
punct |
.,abrogated |
| R7083 |
T11276 |
T11277 |
det |
The,failure |
| R7084 |
T11277 |
T11279 |
nsubj |
failure,underscores |
| R7085 |
T11278 |
T11277 |
amod |
corresponding,failure |
| R7086 |
T11280 |
T11277 |
prep |
of,failure |
| R7087 |
T11281 |
T11282 |
nmod |
E,cadherin |
| R7088 |
T11282 |
T11284 |
nmod |
cadherin,regulation |
| R7089 |
T11283 |
T11282 |
punct |
-,cadherin |
| R709 |
T1534 |
T1551 |
amod |
mediated,transcription |
| R7090 |
T11284 |
T11280 |
pobj |
regulation,of |
| R7091 |
T11285 |
T11284 |
amod |
down,regulation |
| R7092 |
T11286 |
T11284 |
punct |
-,regulation |
| R7093 |
T11287 |
T11288 |
det |
the,importance |
| R7094 |
T11288 |
T11279 |
dobj |
importance,underscores |
| R7095 |
T11289 |
T11288 |
prep |
of,importance |
| R7096 |
T11290 |
T11291 |
compound |
Wnt,noggin |
| R7097 |
T11291 |
T11293 |
compound |
noggin,signaling |
| R7098 |
T11292 |
T11291 |
punct |
/,noggin |
| R7099 |
T11293 |
T11289 |
pobj |
signaling,of |
| R710 |
T1535 |
T1532 |
punct |
-,factor |
| R7100 |
T11294 |
T11288 |
prep |
in,importance |
| R7101 |
T11295 |
T11294 |
pcomp |
regulating,in |
| R7102 |
T11296 |
T11297 |
det |
this,event |
| R7103 |
T11297 |
T11295 |
dobj |
event,regulating |
| R7104 |
T11298 |
T11295 |
prep |
in,regulating |
| R7105 |
T11299 |
T11300 |
compound |
follicle,morphogenesis |
| R7106 |
T11300 |
T11298 |
pobj |
morphogenesis,in |
| R7107 |
T11301 |
T11302 |
punct |
[,4 |
| R7108 |
T11302 |
T11279 |
parataxis |
4,underscores |
| R7109 |
T11303 |
T11302 |
punct |
],4 |
| R711 |
T1536 |
T1532 |
nummod |
1,factor |
| R7110 |
T11304 |
T11279 |
punct |
.,underscores |
| R7111 |
T11306 |
T11307 |
amod |
Conditional,studies |
| R7112 |
T11307 |
T11310 |
nsubj |
studies,be |
| R7113 |
T11308 |
T11309 |
compound |
gene,targeting |
| R7114 |
T11309 |
T11307 |
compound |
targeting,studies |
| R7115 |
T11311 |
T11310 |
aux |
will,be |
| R7116 |
T11312 |
T11310 |
acomp |
necessary,be |
| R7117 |
T11313 |
T11314 |
aux |
to,establish |
| R7118 |
T11314 |
T11310 |
advcl |
establish,be |
| R7119 |
T11315 |
T11316 |
mark |
whether,contribute |
| R712 |
T1537 |
T1532 |
punct |
/,factor |
| R7120 |
T11316 |
T11314 |
ccomp |
contribute,establish |
| R7121 |
T11317 |
T11318 |
compound |
Snail,members |
| R7122 |
T11318 |
T11316 |
nsubj |
members,contribute |
| R7123 |
T11319 |
T11318 |
compound |
family,members |
| R7124 |
T11320 |
T11316 |
advmod |
also,contribute |
| R7125 |
T11321 |
T11316 |
prep |
to,contribute |
| R7126 |
T11322 |
T11323 |
det |
the,regulation |
| R7127 |
T11323 |
T11321 |
pobj |
regulation,to |
| R7128 |
T11324 |
T11323 |
amod |
down,regulation |
| R7129 |
T11325 |
T11323 |
punct |
-,regulation |
| R713 |
T1538 |
T1539 |
compound |
β,catenin |
| R7130 |
T11326 |
T11323 |
prep |
in,regulation |
| R7131 |
T11327 |
T11328 |
compound |
E,cadherin |
| R7132 |
T11328 |
T11330 |
compound |
cadherin,expression |
| R7133 |
T11329 |
T11328 |
punct |
-,cadherin |
| R7134 |
T11330 |
T11326 |
pobj |
expression,in |
| R7135 |
T11331 |
T11330 |
compound |
gene,expression |
| R7136 |
T11332 |
T11333 |
dep |
that,occurs |
| R7137 |
T11333 |
T11323 |
relcl |
occurs,regulation |
| R7138 |
T11334 |
T11333 |
prep |
during,occurs |
| R7139 |
T11335 |
T11336 |
compound |
follicle,formation |
| R714 |
T1539 |
T1532 |
appos |
catenin,factor |
| R7140 |
T11336 |
T11334 |
pobj |
formation,during |
| R7141 |
T11337 |
T11310 |
punct |
.,be |
| R7142 |
T11339 |
T11340 |
advmod |
However,is |
| R7143 |
T11341 |
T11340 |
punct |
", ",is |
| R7144 |
T11342 |
T11340 |
nsubj |
it,is |
| R7145 |
T11343 |
T11340 |
acomp |
intriguing,is |
| R7146 |
T11344 |
T11345 |
mark |
that,displayed |
| R7147 |
T11345 |
T11340 |
ccomp |
displayed,is |
| R7148 |
T11346 |
T11347 |
compound |
K14,Snail |
| R7149 |
T11347 |
T11349 |
compound |
Snail,epidermis |
| R715 |
T1540 |
T1539 |
punct |
-,catenin |
| R7150 |
T11348 |
T11347 |
punct |
-,Snail |
| R7151 |
T11349 |
T11345 |
nsubj |
epidermis,displayed |
| R7152 |
T11350 |
T11349 |
compound |
Tg,epidermis |
| R7153 |
T11351 |
T11352 |
det |
a,regulation |
| R7154 |
T11352 |
T11345 |
dobj |
regulation,displayed |
| R7155 |
T11353 |
T11352 |
amod |
marked,regulation |
| R7156 |
T11354 |
T11352 |
amod |
down,regulation |
| R7157 |
T11355 |
T11352 |
punct |
-,regulation |
| R7158 |
T11356 |
T11352 |
prep |
in,regulation |
| R7159 |
T11357 |
T11358 |
compound |
E,cadherin |
| R716 |
T1541 |
T1532 |
punct |
(,factor |
| R7160 |
T11358 |
T11360 |
compound |
cadherin,expression |
| R7161 |
T11359 |
T11358 |
punct |
-,cadherin |
| R7162 |
T11360 |
T11356 |
pobj |
expression,in |
| R7163 |
T11361 |
T11345 |
punct |
", ",displayed |
| R7164 |
T11362 |
T11363 |
advmod |
thereby,demonstrating |
| R7165 |
T11363 |
T11345 |
advcl |
demonstrating,displayed |
| R7166 |
T11364 |
T11365 |
poss |
its,potential |
| R7167 |
T11365 |
T11363 |
dobj |
potential,demonstrating |
| R7168 |
T11366 |
T11367 |
aux |
to,do |
| R7169 |
T11367 |
T11365 |
acl |
do,potential |
| R717 |
T1542 |
T1532 |
appos |
LEF,factor |
| R7170 |
T11368 |
T11367 |
advmod |
so,do |
| R7171 |
T11369 |
T11367 |
prep |
in,do |
| R7172 |
T11370 |
T11369 |
pobj |
skin,in |
| R7173 |
T11371 |
T11340 |
punct |
.,is |
| R7174 |
T11373 |
T11374 |
poss |
Our,findings |
| R7175 |
T11374 |
T11376 |
nsubj |
findings,showed |
| R7176 |
T11375 |
T11374 |
amod |
prior,findings |
| R7177 |
T11377 |
T11378 |
mark |
that,impaired |
| R7178 |
T11378 |
T11376 |
ccomp |
impaired,showed |
| R7179 |
T11379 |
T11378 |
prep |
by,impaired |
| R718 |
T1543 |
T1542 |
punct |
-,LEF |
| R7180 |
T11380 |
T11379 |
pcomp |
elevating,by |
| R7181 |
T11381 |
T11382 |
compound |
E,cadherin |
| R7182 |
T11382 |
T11384 |
compound |
cadherin,levels |
| R7183 |
T11383 |
T11382 |
punct |
-,cadherin |
| R7184 |
T11384 |
T11380 |
dobj |
levels,elevating |
| R7185 |
T11385 |
T11379 |
cc |
or,by |
| R7186 |
T11386 |
T11379 |
conj |
by,by |
| R7187 |
T11387 |
T11388 |
advmod |
conditionally,ablating |
| R7188 |
T11388 |
T11386 |
pcomp |
ablating,by |
| R7189 |
T11389 |
T11390 |
compound |
α,catenin |
| R719 |
T1544 |
T1542 |
nummod |
1,LEF |
| R7190 |
T11390 |
T11388 |
dobj |
catenin,ablating |
| R7191 |
T11391 |
T11390 |
punct |
-,catenin |
| R7192 |
T11392 |
T11378 |
punct |
", ",impaired |
| R7193 |
T11393 |
T11394 |
compound |
hair,follicle |
| R7194 |
T11394 |
T11395 |
compound |
follicle,morphogenesis |
| R7195 |
T11395 |
T11378 |
nsubjpass |
morphogenesis,impaired |
| R7196 |
T11396 |
T11378 |
aux |
can,impaired |
| R7197 |
T11397 |
T11378 |
auxpass |
be,impaired |
| R7198 |
T11398 |
T11399 |
punct |
[,7 |
| R7199 |
T11399 |
T11376 |
parataxis |
7,showed |
| R720 |
T1545 |
T1542 |
punct |
/,LEF |
| R7200 |
T11400 |
T11399 |
nummod |
4,7 |
| R7201 |
T11401 |
T11399 |
punct |
",",7 |
| R7202 |
T11402 |
T11399 |
punct |
],7 |
| R7203 |
T11403 |
T11376 |
punct |
.,showed |
| R7204 |
T11405 |
T11406 |
det |
The,hyperproliferation |
| R7205 |
T11406 |
T11409 |
nsubj |
hyperproliferation,led |
| R7206 |
T11407 |
T11406 |
amod |
marked,hyperproliferation |
| R7207 |
T11408 |
T11406 |
amod |
epidermal,hyperproliferation |
| R7208 |
T11410 |
T11406 |
acl |
seen,hyperproliferation |
| R7209 |
T11411 |
T11410 |
prep |
in,seen |
| R721 |
T1546 |
T1547 |
compound |
β,catenin |
| R7210 |
T11412 |
T11413 |
det |
the,skin |
| R7211 |
T11413 |
T11411 |
pobj |
skin,in |
| R7212 |
T11414 |
T11415 |
compound |
K14,Snail |
| R7213 |
T11415 |
T11413 |
compound |
Snail,skin |
| R7214 |
T11416 |
T11415 |
punct |
-,Snail |
| R7215 |
T11417 |
T11413 |
compound |
Tg,skin |
| R7216 |
T11418 |
T11406 |
punct |
", ",hyperproliferation |
| R7217 |
T11419 |
T11406 |
acl |
coupled,hyperproliferation |
| R7218 |
T11420 |
T11419 |
prep |
with,coupled |
| R7219 |
T11421 |
T11422 |
det |
the,suppression |
| R722 |
T1547 |
T1542 |
appos |
catenin,LEF |
| R7220 |
T11422 |
T11420 |
pobj |
suppression,with |
| R7221 |
T11423 |
T11422 |
amod |
converse,suppression |
| R7222 |
T11424 |
T11422 |
prep |
of,suppression |
| R7223 |
T11425 |
T11424 |
pobj |
proliferation,of |
| R7224 |
T11426 |
T11425 |
cc |
and,proliferation |
| R7225 |
T11427 |
T11425 |
conj |
Snail,proliferation |
| R7226 |
T11428 |
T11422 |
prep |
in,suppression |
| R7227 |
T11429 |
T11430 |
compound |
TGF,β2 |
| R7228 |
T11430 |
T11432 |
npadvmod |
β2,null |
| R7229 |
T11431 |
T11430 |
punct |
-,β2 |
| R723 |
T1548 |
T1547 |
punct |
-,catenin |
| R7230 |
T11432 |
T11434 |
amod |
null,buds |
| R7231 |
T11433 |
T11432 |
punct |
-,null |
| R7232 |
T11434 |
T11428 |
pobj |
buds,in |
| R7233 |
T11435 |
T11434 |
compound |
hair,buds |
| R7234 |
T11436 |
T11409 |
dobj |
us,led |
| R7235 |
T11437 |
T11438 |
aux |
to,wonder |
| R7236 |
T11438 |
T11409 |
xcomp |
wonder,led |
| R7237 |
T11439 |
T11440 |
mark |
whether,have |
| R7238 |
T11440 |
T11438 |
ccomp |
have,wonder |
| R7239 |
T11441 |
T11442 |
det |
the,regulation |
| R724 |
T1549 |
T1534 |
punct |
),mediated |
| R7240 |
T11442 |
T11440 |
nsubj |
regulation,have |
| R7241 |
T11443 |
T11442 |
amod |
down,regulation |
| R7242 |
T11444 |
T11442 |
punct |
-,regulation |
| R7243 |
T11445 |
T11442 |
prep |
of,regulation |
| R7244 |
T11446 |
T11447 |
compound |
E,cadherin |
| R7245 |
T11447 |
T11445 |
pobj |
cadherin,of |
| R7246 |
T11448 |
T11447 |
punct |
-,cadherin |
| R7247 |
T11449 |
T11442 |
prep |
during,regulation |
| R7248 |
T11450 |
T11451 |
compound |
follicle,morphogenesis |
| R7249 |
T11451 |
T11449 |
pobj |
morphogenesis,during |
| R725 |
T1550 |
T1534 |
punct |
-,mediated |
| R7250 |
T11452 |
T11440 |
aux |
might,have |
| R7251 |
T11453 |
T11454 |
det |
a,impact |
| R7252 |
T11454 |
T11440 |
dobj |
impact,have |
| R7253 |
T11455 |
T11454 |
amod |
direct,impact |
| R7254 |
T11456 |
T11454 |
prep |
on,impact |
| R7255 |
T11457 |
T11456 |
pcomp |
elevating,on |
| R7256 |
T11458 |
T11459 |
det |
the,state |
| R7257 |
T11459 |
T11457 |
dobj |
state,elevating |
| R7258 |
T11460 |
T11459 |
amod |
proliferative,state |
| R7259 |
T11461 |
T11459 |
prep |
of,state |
| R726 |
T1551 |
T1530 |
dobj |
transcription,induce |
| R7260 |
T11462 |
T11463 |
det |
these,cells |
| R7261 |
T11463 |
T11461 |
pobj |
cells,of |
| R7262 |
T11464 |
T11409 |
punct |
.,led |
| R7263 |
T11466 |
T11467 |
poss |
Our,studies |
| R7264 |
T11467 |
T11469 |
nsubj |
studies,suggested |
| R7265 |
T11468 |
T11467 |
compound |
Tg,studies |
| R7266 |
T11470 |
T11471 |
mark |
that,is |
| R7267 |
T11471 |
T11469 |
ccomp |
is,suggested |
| R7268 |
T11472 |
T11471 |
punct |
", ",is |
| R7269 |
T11473 |
T11474 |
advmod |
at,least |
| R727 |
T1552 |
T1551 |
compound |
gene,transcription |
| R7270 |
T11474 |
T11475 |
advmod |
least,in |
| R7271 |
T11475 |
T11476 |
prep |
in,through |
| R7272 |
T11476 |
T11471 |
prep |
through,is |
| R7273 |
T11477 |
T11475 |
pobj |
part,in |
| R7274 |
T11478 |
T11479 |
poss |
its,regulation |
| R7275 |
T11479 |
T11476 |
pobj |
regulation,through |
| R7276 |
T11480 |
T11479 |
prep |
of,regulation |
| R7277 |
T11481 |
T11482 |
compound |
E,cadherin |
| R7278 |
T11482 |
T11480 |
pobj |
cadherin,of |
| R7279 |
T11483 |
T11482 |
punct |
-,cadherin |
| R728 |
T1553 |
T1530 |
prep |
within,induce |
| R7280 |
T11484 |
T11471 |
punct |
", ",is |
| R7281 |
T11485 |
T11471 |
nsubj |
Snail,is |
| R7282 |
T11486 |
T11471 |
acomp |
able,is |
| R7283 |
T11487 |
T11488 |
aux |
to,influence |
| R7284 |
T11488 |
T11486 |
xcomp |
influence,able |
| R7285 |
T11489 |
T11490 |
det |
the,localization |
| R7286 |
T11490 |
T11488 |
dobj |
localization,influence |
| R7287 |
T11491 |
T11490 |
amod |
subcellular,localization |
| R7288 |
T11492 |
T11490 |
prep |
of,localization |
| R7289 |
T11493 |
T11494 |
det |
a,variety |
| R729 |
T1554 |
T1555 |
det |
the,placode |
| R7290 |
T11494 |
T11492 |
pobj |
variety,of |
| R7291 |
T11495 |
T11494 |
prep |
of,variety |
| R7292 |
T11496 |
T11497 |
npadvmod |
AJ,associated |
| R7293 |
T11497 |
T11499 |
amod |
associated,proteins |
| R7294 |
T11498 |
T11497 |
punct |
-,associated |
| R7295 |
T11499 |
T11495 |
pobj |
proteins,of |
| R7296 |
T11500 |
T11469 |
punct |
.,suggested |
| R7297 |
T11502 |
T11503 |
nsubj |
One,appears |
| R7298 |
T11504 |
T11502 |
prep |
of,One |
| R7299 |
T11505 |
T11504 |
pobj |
these,of |
| R730 |
T1555 |
T1553 |
pobj |
placode,within |
| R7300 |
T11506 |
T11507 |
aux |
to,be |
| R7301 |
T11507 |
T11503 |
xcomp |
be,appears |
| R7302 |
T11508 |
T11507 |
attr |
Ajuba,be |
| R7303 |
T11509 |
T11508 |
punct |
", ",Ajuba |
| R7304 |
T11510 |
T11511 |
dep |
which,shown |
| R7305 |
T11511 |
T11508 |
relcl |
shown,Ajuba |
| R7306 |
T11512 |
T11511 |
auxpass |
was,shown |
| R7307 |
T11513 |
T11511 |
advmod |
previously,shown |
| R7308 |
T11514 |
T11515 |
aux |
to,have |
| R7309 |
T11515 |
T11511 |
xcomp |
have,shown |
| R731 |
T1556 |
T1555 |
compound |
follicle,placode |
| R7310 |
T11516 |
T11517 |
det |
the,capacity |
| R7311 |
T11517 |
T11515 |
dobj |
capacity,have |
| R7312 |
T11518 |
T11517 |
amod |
dual,capacity |
| R7313 |
T11519 |
T11520 |
aux |
to,bind |
| R7314 |
T11520 |
T11517 |
acl |
bind,capacity |
| R7315 |
T11521 |
T11520 |
dobj |
Grb,bind |
| R7316 |
T11522 |
T11521 |
punct |
-,Grb |
| R7317 |
T11523 |
T11521 |
nummod |
2,Grb |
| R7318 |
T11524 |
T11525 |
advmod |
as,as |
| R7319 |
T11525 |
T11521 |
cc |
as,Grb |
| R732 |
T1557 |
T1558 |
punct |
[,4 |
| R7320 |
T11526 |
T11525 |
advmod |
well,as |
| R7321 |
T11527 |
T11528 |
compound |
α,catenin |
| R7322 |
T11528 |
T11521 |
conj |
catenin,Grb |
| R7323 |
T11529 |
T11528 |
punct |
-,catenin |
| R7324 |
T11530 |
T11531 |
punct |
[,10 |
| R7325 |
T11531 |
T11503 |
parataxis |
10,appears |
| R7326 |
T11532 |
T11531 |
nummod |
9,10 |
| R7327 |
T11533 |
T11531 |
punct |
",",10 |
| R7328 |
T11534 |
T11531 |
punct |
],10 |
| R7329 |
T11535 |
T11503 |
punct |
.,appears |
| R733 |
T1558 |
T1506 |
parataxis |
4,delineated |
| R7330 |
T11537 |
T11538 |
poss |
Our,studies |
| R7331 |
T11538 |
T11539 |
nsubj |
studies,revealed |
| R7332 |
T11540 |
T11541 |
mark |
that,develops |
| R7333 |
T11541 |
T11539 |
ccomp |
develops,revealed |
| R7334 |
T11542 |
T11541 |
prep |
in,develops |
| R7335 |
T11543 |
T11544 |
compound |
skin,keratinocytes |
| R7336 |
T11544 |
T11542 |
pobj |
keratinocytes,in |
| R7337 |
T11545 |
T11546 |
dep |
that,harbor |
| R7338 |
T11546 |
T11544 |
advcl |
harbor,keratinocytes |
| R7339 |
T11547 |
T11546 |
preconj |
either,harbor |
| R734 |
T1559 |
T1558 |
punct |
],4 |
| R7340 |
T11548 |
T11549 |
det |
a,mutation |
| R7341 |
T11549 |
T11546 |
dobj |
mutation,harbor |
| R7342 |
T11550 |
T11549 |
amod |
conditional,mutation |
| R7343 |
T11551 |
T11549 |
amod |
null,mutation |
| R7344 |
T11552 |
T11546 |
prep |
in,harbor |
| R7345 |
T11553 |
T11554 |
compound |
α,catenin |
| R7346 |
T11554 |
T11552 |
pobj |
catenin,in |
| R7347 |
T11555 |
T11554 |
punct |
-,catenin |
| R7348 |
T11556 |
T11546 |
cc |
or,harbor |
| R7349 |
T11557 |
T11558 |
dep |
that,overexpress |
| R735 |
T1560 |
T1506 |
punct |
.,delineated |
| R7350 |
T11558 |
T11546 |
conj |
overexpress,harbor |
| R7351 |
T11559 |
T11558 |
dobj |
Snail,overexpress |
| R7352 |
T11560 |
T11541 |
punct |
", ",develops |
| R7353 |
T11561 |
T11541 |
nsubj |
Ajuba,develops |
| R7354 |
T11562 |
T11563 |
det |
an,interaction |
| R7355 |
T11563 |
T11541 |
dobj |
interaction,develops |
| R7356 |
T11564 |
T11563 |
prep |
with,interaction |
| R7357 |
T11565 |
T11564 |
pobj |
Grb,with |
| R7358 |
T11566 |
T11565 |
punct |
-,Grb |
| R7359 |
T11567 |
T11565 |
nummod |
2,Grb |
| R736 |
T1562 |
T1563 |
det |
The,changes |
| R7360 |
T11568 |
T11569 |
dep |
that,observed |
| R7361 |
T11569 |
T11563 |
relcl |
observed,interaction |
| R7362 |
T11570 |
T11569 |
auxpass |
is,observed |
| R7363 |
T11571 |
T11569 |
advmod |
otherwise,observed |
| R7364 |
T11572 |
T11569 |
neg |
not,observed |
| R7365 |
T11573 |
T11569 |
prep |
in,observed |
| R7366 |
T11574 |
T11575 |
compound |
WT,keratinocytes |
| R7367 |
T11575 |
T11573 |
pobj |
keratinocytes,in |
| R7368 |
T11576 |
T11539 |
punct |
.,revealed |
| R7369 |
T11578 |
T11579 |
det |
The,abilities |
| R737 |
T1563 |
T1565 |
nsubj |
changes,include |
| R7370 |
T11579 |
T11581 |
nsubj |
abilities,suggest |
| R7371 |
T11580 |
T11579 |
amod |
corresponding,abilities |
| R7372 |
T11582 |
T11579 |
prep |
of,abilities |
| R7373 |
T11583 |
T11584 |
preconj |
either,keratinocytes |
| R7374 |
T11584 |
T11582 |
pobj |
keratinocytes,of |
| R7375 |
T11585 |
T11586 |
npadvmod |
Snail,transfected |
| R7376 |
T11586 |
T11584 |
amod |
transfected,keratinocytes |
| R7377 |
T11587 |
T11586 |
punct |
-,transfected |
| R7378 |
T11588 |
T11586 |
cc |
or,transfected |
| R7379 |
T11589 |
T11590 |
npadvmod |
Ajuba,transfected |
| R738 |
T1564 |
T1563 |
amod |
downstream,changes |
| R7380 |
T11590 |
T11586 |
conj |
transfected,transfected |
| R7381 |
T11591 |
T11590 |
punct |
-,transfected |
| R7382 |
T11592 |
T11593 |
aux |
to,exhibit |
| R7383 |
T11593 |
T11579 |
acl |
exhibit,abilities |
| R7384 |
T11594 |
T11595 |
amod |
elevated,activation |
| R7385 |
T11595 |
T11593 |
dobj |
activation,exhibit |
| R7386 |
T11596 |
T11595 |
prep |
of,activation |
| R7387 |
T11597 |
T11598 |
det |
the,pathway |
| R7388 |
T11598 |
T11596 |
pobj |
pathway,of |
| R7389 |
T11599 |
T11600 |
compound |
Ras,MAPK |
| R739 |
T1566 |
T1563 |
acl |
elicited,changes |
| R7390 |
T11600 |
T11598 |
compound |
MAPK,pathway |
| R7391 |
T11601 |
T11600 |
punct |
-,MAPK |
| R7392 |
T11602 |
T11603 |
mark |
that,be |
| R7393 |
T11603 |
T11581 |
ccomp |
be,suggest |
| R7394 |
T11604 |
T11605 |
det |
the,association |
| R7395 |
T11605 |
T11603 |
nsubj |
association,be |
| R7396 |
T11606 |
T11605 |
nmod |
Grb,association |
| R7397 |
T11607 |
T11606 |
punct |
-,Grb |
| R7398 |
T11608 |
T11606 |
nummod |
2,Grb |
| R7399 |
T11609 |
T11605 |
prep |
of,association |
| R740 |
T1567 |
T1566 |
prep |
through,elicited |
| R7400 |
T11610 |
T11609 |
pobj |
Ajuba,of |
| R7401 |
T11611 |
T11603 |
prep |
under,be |
| R7402 |
T11612 |
T11611 |
pobj |
conditions,under |
| R7403 |
T11613 |
T11612 |
prep |
of,conditions |
| R7404 |
T11614 |
T11615 |
amod |
reduced,levels |
| R7405 |
T11615 |
T11613 |
pobj |
levels,of |
| R7406 |
T11616 |
T11615 |
prep |
of,levels |
| R7407 |
T11617 |
T11618 |
compound |
AJ,proteins |
| R7408 |
T11618 |
T11616 |
pobj |
proteins,of |
| R7409 |
T11619 |
T11603 |
aux |
may,be |
| R741 |
T1568 |
T1567 |
pobj |
convergence,through |
| R7410 |
T11620 |
T11621 |
advmod |
directly,relevant |
| R7411 |
T11621 |
T11603 |
acomp |
relevant,be |
| R7412 |
T11622 |
T11621 |
prep |
to,relevant |
| R7413 |
T11623 |
T11624 |
det |
the,parallel |
| R7414 |
T11624 |
T11622 |
pobj |
parallel,to |
| R7415 |
T11625 |
T11624 |
prep |
in,parallel |
| R7416 |
T11626 |
T11625 |
pobj |
hyperproliferation,in |
| R7417 |
T11627 |
T11581 |
punct |
.,suggest |
| R7418 |
T11629 |
T11630 |
prep |
In,shown |
| R7419 |
T11631 |
T11632 |
amod |
stable,lines |
| R742 |
T1569 |
T1568 |
prep |
of,convergence |
| R7420 |
T11632 |
T11629 |
pobj |
lines,In |
| R7421 |
T11633 |
T11632 |
amod |
epithelial,lines |
| R7422 |
T11634 |
T11635 |
punct |
(,kidney |
| R7423 |
T11635 |
T11632 |
parataxis |
kidney,lines |
| R7424 |
T11636 |
T11635 |
advmod |
i.e.,kidney |
| R7425 |
T11637 |
T11635 |
punct |
", ",kidney |
| R7426 |
T11638 |
T11639 |
nmod |
Madin,Darby |
| R7427 |
T11639 |
T11635 |
nmod |
Darby,kidney |
| R7428 |
T11640 |
T11639 |
punct |
-,Darby |
| R7429 |
T11641 |
T11635 |
amod |
canine,kidney |
| R743 |
T1675 |
T1677 |
compound |
cell,contact |
| R7430 |
T11642 |
T11635 |
punct |
", ",kidney |
| R7431 |
T11643 |
T11635 |
cc |
or,kidney |
| R7432 |
T11644 |
T11635 |
conj |
MDCK,kidney |
| R7433 |
T11645 |
T11635 |
punct |
),kidney |
| R7434 |
T11646 |
T11632 |
compound |
cell,lines |
| R7435 |
T11647 |
T11630 |
punct |
", ",shown |
| R7436 |
T11648 |
T11630 |
nsubjpass |
Snail,shown |
| R7437 |
T11649 |
T11630 |
aux |
has,shown |
| R7438 |
T11650 |
T11630 |
auxpass |
been,shown |
| R7439 |
T11651 |
T11652 |
aux |
to,block |
| R744 |
T1676 |
T1675 |
punct |
-,cell |
| R7440 |
T11652 |
T11630 |
xcomp |
block,shown |
| R7441 |
T11653 |
T11654 |
compound |
cell,cycle |
| R7442 |
T11654 |
T11655 |
compound |
cycle,progression |
| R7443 |
T11655 |
T11652 |
dobj |
progression,block |
| R7444 |
T11656 |
T11652 |
cc |
and,block |
| R7445 |
T11657 |
T11652 |
conj |
promote,block |
| R7446 |
T11658 |
T11659 |
nmod |
motility,changes |
| R7447 |
T11659 |
T11657 |
dobj |
changes,promote |
| R7448 |
T11660 |
T11658 |
cc |
and,motility |
| R7449 |
T11661 |
T11658 |
conj |
shape,motility |
| R745 |
T1677 |
T1673 |
pobj |
contact,of |
| R7450 |
T11662 |
T11657 |
prep |
for,promote |
| R7451 |
T11663 |
T11662 |
pobj |
invasion,for |
| R7452 |
T11664 |
T11665 |
punct |
[,47 |
| R7453 |
T11665 |
T11630 |
parataxis |
47,shown |
| R7454 |
T11666 |
T11665 |
punct |
],47 |
| R7455 |
T11667 |
T11630 |
punct |
.,shown |
| R7456 |
T11669 |
T11670 |
mark |
While,are |
| R7457 |
T11670 |
T11675 |
advcl |
are,differ |
| R7458 |
T11671 |
T11672 |
poss |
our,studies |
| R7459 |
T11672 |
T11670 |
nsubj |
studies,are |
| R746 |
T1678 |
T1671 |
punct |
", ",recruit |
| R7460 |
T11673 |
T11674 |
advmod |
in,vivo |
| R7461 |
T11674 |
T11672 |
amod |
vivo,studies |
| R7462 |
T11676 |
T11670 |
acomp |
consistent,are |
| R7463 |
T11677 |
T11676 |
prep |
with,consistent |
| R7464 |
T11678 |
T11679 |
det |
a,role |
| R7465 |
T11679 |
T11677 |
pobj |
role,with |
| R7466 |
T11680 |
T11679 |
prep |
for,role |
| R7467 |
T11681 |
T11680 |
pobj |
Snail,for |
| R7468 |
T11682 |
T11679 |
prep |
in,role |
| R7469 |
T11683 |
T11684 |
nmod |
motility,remodeling |
| R747 |
T1679 |
T1671 |
advmod |
however,recruit |
| R7470 |
T11684 |
T11682 |
pobj |
remodeling,in |
| R7471 |
T11685 |
T11683 |
cc |
and,motility |
| R7472 |
T11686 |
T11683 |
conj |
epithelial,motility |
| R7473 |
T11687 |
T11675 |
punct |
", ",differ |
| R7474 |
T11688 |
T11675 |
nsubj |
they,differ |
| R7475 |
T11689 |
T11675 |
prep |
with,differ |
| R7476 |
T11690 |
T11689 |
pobj |
respect,with |
| R7477 |
T11691 |
T11690 |
prep |
to,respect |
| R7478 |
T11692 |
T11693 |
poss |
Snail,effects |
| R7479 |
T11693 |
T11691 |
pobj |
effects,to |
| R748 |
T1570 |
T1571 |
det |
these,pathways |
| R7480 |
T11694 |
T11692 |
case |
's,Snail |
| R7481 |
T11695 |
T11693 |
amod |
apparent,effects |
| R7482 |
T11696 |
T11693 |
amod |
proliferative,effects |
| R7483 |
T11697 |
T11675 |
punct |
.,differ |
| R7484 |
T11699 |
T11700 |
advmod |
A,priori |
| R7485 |
T11700 |
T11701 |
advmod |
priori,be |
| R7486 |
T11702 |
T11701 |
punct |
", ",be |
| R7487 |
T11703 |
T11701 |
nsubj |
this,be |
| R7488 |
T11704 |
T11701 |
aux |
could,be |
| R7489 |
T11705 |
T11701 |
advmod |
simply,be |
| R749 |
T1680 |
T1671 |
punct |
", ",recruit |
| R7490 |
T11706 |
T11701 |
prep |
due,be |
| R7491 |
T11707 |
T11706 |
pcomp |
to,due |
| R7492 |
T11708 |
T11706 |
pobj |
variations,due |
| R7493 |
T11709 |
T11708 |
prep |
in,variations |
| R7494 |
T11710 |
T11711 |
det |
the,response |
| R7495 |
T11711 |
T11709 |
pobj |
response,in |
| R7496 |
T11712 |
T11711 |
prep |
of,response |
| R7497 |
T11713 |
T11714 |
amod |
different,types |
| R7498 |
T11714 |
T11712 |
pobj |
types,of |
| R7499 |
T11715 |
T11714 |
compound |
cell,types |
| R750 |
T1571 |
T1569 |
pobj |
pathways,of |
| R7500 |
T11716 |
T11711 |
prep |
to,response |
| R7501 |
T11717 |
T11718 |
compound |
Snail,expression |
| R7502 |
T11718 |
T11716 |
pobj |
expression,to |
| R7503 |
T11719 |
T11701 |
punct |
.,be |
| R7504 |
T11721 |
T11722 |
advmod |
Alternatively,be |
| R7505 |
T11723 |
T11722 |
punct |
", ",be |
| R7506 |
T11724 |
T11725 |
det |
these,differences |
| R7507 |
T11725 |
T11722 |
nsubj |
differences,be |
| R7508 |
T11726 |
T11722 |
aux |
may,be |
| R7509 |
T11727 |
T11722 |
acomp |
relevant,be |
| R751 |
T1681 |
T1682 |
nmod |
E,cadherin |
| R7510 |
T11728 |
T11727 |
prep |
to,relevant |
| R7511 |
T11729 |
T11730 |
det |
the,benefit |
| R7512 |
T11730 |
T11728 |
pobj |
benefit,to |
| R7513 |
T11731 |
T11730 |
prep |
of,benefit |
| R7514 |
T11732 |
T11731 |
pcomp |
using,of |
| R7515 |
T11733 |
T11734 |
compound |
mouse,models |
| R7516 |
T11734 |
T11732 |
dobj |
models,using |
| R7517 |
T11735 |
T11736 |
aux |
to,reveal |
| R7518 |
T11736 |
T11732 |
advcl |
reveal,using |
| R7519 |
T11737 |
T11736 |
dobj |
functions,reveal |
| R752 |
T1572 |
T1571 |
nummod |
two,pathways |
| R7520 |
T11738 |
T11739 |
neg |
not,recapitulated |
| R7521 |
T11739 |
T11737 |
acl |
recapitulated,functions |
| R7522 |
T11740 |
T11739 |
advmod |
always,recapitulated |
| R7523 |
T11741 |
T11739 |
prep |
in,recapitulated |
| R7524 |
T11742 |
T11743 |
amod |
stable,models |
| R7525 |
T11743 |
T11741 |
pobj |
models,in |
| R7526 |
T11744 |
T11745 |
compound |
cell,line |
| R7527 |
T11745 |
T11743 |
compound |
line,models |
| R7528 |
T11746 |
T11722 |
punct |
.,be |
| R7529 |
T11748 |
T11749 |
amod |
Future,studies |
| R753 |
T1573 |
T1571 |
amod |
early,pathways |
| R7530 |
T11749 |
T11750 |
nsubj |
studies,highlight |
| R7531 |
T11751 |
T11750 |
aux |
should,highlight |
| R7532 |
T11752 |
T11753 |
det |
the,reasons |
| R7533 |
T11753 |
T11750 |
dobj |
reasons,highlight |
| R7534 |
T11754 |
T11753 |
amod |
underlying,reasons |
| R7535 |
T11755 |
T11753 |
prep |
for,reasons |
| R7536 |
T11756 |
T11757 |
det |
these,results |
| R7537 |
T11757 |
T11755 |
pobj |
results,for |
| R7538 |
T11758 |
T11757 |
amod |
opposing,results |
| R7539 |
T11759 |
T11750 |
punct |
.,highlight |
| R754 |
T1682 |
T1684 |
nmod |
cadherin,complexes |
| R7540 |
T11761 |
T11762 |
advcl |
Irrespective,stand |
| R7541 |
T11763 |
T11761 |
prep |
of,Irrespective |
| R7542 |
T11764 |
T11765 |
det |
these,differences |
| R7543 |
T11765 |
T11763 |
pobj |
differences,of |
| R7544 |
T11766 |
T11762 |
punct |
", ",stand |
| R7545 |
T11767 |
T11768 |
poss |
our,studies |
| R7546 |
T11768 |
T11762 |
nsubj |
studies,stand |
| R7547 |
T11769 |
T11770 |
advmod |
in,vivo |
| R7548 |
T11770 |
T11768 |
amod |
vivo,studies |
| R7549 |
T11771 |
T11762 |
aux |
do,stand |
| R755 |
T1574 |
T1571 |
compound |
signaling,pathways |
| R7550 |
T11772 |
T11762 |
neg |
not,stand |
| R7551 |
T11773 |
T11762 |
advmod |
alone,stand |
| R7552 |
T11774 |
T11762 |
punct |
", ",stand |
| R7553 |
T11775 |
T11776 |
mark |
as,are |
| R7554 |
T11776 |
T11762 |
advcl |
are,stand |
| R7555 |
T11777 |
T11776 |
expl |
there,are |
| R7556 |
T11778 |
T11779 |
amod |
many,situations |
| R7557 |
T11779 |
T11776 |
attr |
situations,are |
| R7558 |
T11780 |
T11781 |
prep |
in,correlate |
| R7559 |
T11781 |
T11779 |
relcl |
correlate,situations |
| R756 |
T1575 |
T1576 |
amod |
down,regulation |
| R7560 |
T11782 |
T11780 |
pobj |
which,in |
| R7561 |
T11783 |
T11784 |
det |
a,regulation |
| R7562 |
T11784 |
T11781 |
nsubj |
regulation,correlate |
| R7563 |
T11785 |
T11784 |
amod |
down,regulation |
| R7564 |
T11786 |
T11784 |
punct |
-,regulation |
| R7565 |
T11787 |
T11784 |
prep |
in,regulation |
| R7566 |
T11788 |
T11789 |
compound |
AJ,proteins |
| R7567 |
T11789 |
T11787 |
pobj |
proteins,in |
| R7568 |
T11790 |
T11781 |
prep |
with,correlate |
| R7569 |
T11791 |
T11792 |
amod |
enhanced,proliferation |
| R757 |
T1683 |
T1682 |
punct |
-,cadherin |
| R7570 |
T11792 |
T11790 |
pobj |
proliferation,with |
| R7571 |
T11793 |
T11762 |
punct |
.,stand |
| R7572 |
T11795 |
T11796 |
prep |
In,implicated |
| R7573 |
T11797 |
T11795 |
pobj |
fact,In |
| R7574 |
T11798 |
T11796 |
punct |
", ",implicated |
| R7575 |
T11799 |
T11800 |
det |
a,myriad |
| R7576 |
T11800 |
T11796 |
nsubjpass |
myriad,implicated |
| R7577 |
T11801 |
T11800 |
prep |
of,myriad |
| R7578 |
T11802 |
T11803 |
amod |
diverse,mechanisms |
| R7579 |
T11803 |
T11801 |
pobj |
mechanisms,of |
| R758 |
T1576 |
T1565 |
dobj |
regulation,include |
| R7580 |
T11804 |
T11796 |
aux |
have,implicated |
| R7581 |
T11805 |
T11796 |
auxpass |
been,implicated |
| R7582 |
T11806 |
T11796 |
prep |
in,implicated |
| R7583 |
T11807 |
T11806 |
pcomp |
activating,in |
| R7584 |
T11808 |
T11809 |
amod |
epithelial,proliferation |
| R7585 |
T11809 |
T11807 |
dobj |
proliferation,activating |
| R7586 |
T11810 |
T11807 |
prep |
upon,activating |
| R7587 |
T11811 |
T11812 |
amod |
down,regulation |
| R7588 |
T11812 |
T11810 |
pobj |
regulation,upon |
| R7589 |
T11813 |
T11812 |
punct |
-,regulation |
| R759 |
T1577 |
T1576 |
punct |
-,regulation |
| R7590 |
T11814 |
T11812 |
prep |
of,regulation |
| R7591 |
T11815 |
T11816 |
compound |
AJ,proteins |
| R7592 |
T11816 |
T11814 |
pobj |
proteins,of |
| R7593 |
T11817 |
T11818 |
punct |
[,48 |
| R7594 |
T11818 |
T11796 |
parataxis |
48,implicated |
| R7595 |
T11819 |
T11818 |
nummod |
7,48 |
| R7596 |
T11820 |
T11818 |
punct |
",",48 |
| R7597 |
T11821 |
T11818 |
nummod |
23,48 |
| R7598 |
T11822 |
T11818 |
punct |
",",48 |
| R7599 |
T11823 |
T11818 |
nummod |
24,48 |
| R760 |
T1578 |
T1576 |
prep |
of,regulation |
| R7600 |
T11824 |
T11818 |
punct |
",",48 |
| R7601 |
T11825 |
T11818 |
punct |
],48 |
| R7602 |
T11826 |
T11796 |
punct |
.,implicated |
| R7603 |
T11828 |
T11829 |
csubj |
Sifting,is |
| R7604 |
T11830 |
T11828 |
prep |
through,Sifting |
| R7605 |
T11831 |
T11832 |
det |
these,pathways |
| R7606 |
T11832 |
T11830 |
pobj |
pathways,through |
| R7607 |
T11833 |
T11832 |
amod |
converging,pathways |
| R7608 |
T11834 |
T11829 |
acomp |
likely,is |
| R7609 |
T11835 |
T11836 |
aux |
to,be |
| R761 |
T1684 |
T1671 |
nsubj |
complexes,recruit |
| R7610 |
T11836 |
T11834 |
xcomp |
be,likely |
| R7611 |
T11837 |
T11838 |
det |
a,process |
| R7612 |
T11838 |
T11836 |
attr |
process,be |
| R7613 |
T11839 |
T11838 |
amod |
difficult,process |
| R7614 |
T11840 |
T11839 |
cc |
and,difficult |
| R7615 |
T11841 |
T11839 |
conj |
painstaking,difficult |
| R7616 |
T11842 |
T11829 |
punct |
.,is |
| R7617 |
T11844 |
T11845 |
nsubj |
This,said |
| R7618 |
T11845 |
T11846 |
advcl |
said,begin |
| R7619 |
T11847 |
T11846 |
punct |
", ",begin |
| R762 |
T1579 |
T1580 |
det |
the,gene |
| R7620 |
T11848 |
T11846 |
prep |
by,begin |
| R7621 |
T11849 |
T11848 |
pcomp |
identifying,by |
| R7622 |
T11850 |
T11851 |
det |
the,status |
| R7623 |
T11851 |
T11849 |
dobj |
status,identifying |
| R7624 |
T11852 |
T11851 |
prep |
of,status |
| R7625 |
T11853 |
T11854 |
amod |
different,players |
| R7626 |
T11854 |
T11852 |
pobj |
players,of |
| R7627 |
T11855 |
T11854 |
acl |
involved,players |
| R7628 |
T11856 |
T11849 |
prep |
in,identifying |
| R7629 |
T11857 |
T11858 |
amod |
specific,types |
| R763 |
T1580 |
T1578 |
pobj |
gene,of |
| R7630 |
T11858 |
T11856 |
pobj |
types,in |
| R7631 |
T11859 |
T11858 |
compound |
cell,types |
| R7632 |
T11860 |
T11856 |
cc |
and,in |
| R7633 |
T11861 |
T11856 |
conj |
at,in |
| R7634 |
T11862 |
T11863 |
amod |
specific,stages |
| R7635 |
T11863 |
T11861 |
pobj |
stages,at |
| R7636 |
T11864 |
T11863 |
prep |
in,stages |
| R7637 |
T11865 |
T11864 |
pobj |
development,in |
| R7638 |
T11866 |
T11846 |
punct |
", ",begin |
| R7639 |
T11867 |
T11868 |
poss |
our,understanding |
| R764 |
T1685 |
T1682 |
punct |
-,cadherin |
| R7640 |
T11868 |
T11846 |
nsubj |
understanding,begin |
| R7641 |
T11869 |
T11868 |
amod |
mechanistic,understanding |
| R7642 |
T11870 |
T11868 |
prep |
of,understanding |
| R7643 |
T11871 |
T11872 |
advmod |
how,linked |
| R7644 |
T11872 |
T11870 |
pcomp |
linked,of |
| R7645 |
T11873 |
T11874 |
amod |
intercellular,remodeling |
| R7646 |
T11874 |
T11872 |
nsubjpass |
remodeling,linked |
| R7647 |
T11875 |
T11872 |
auxpass |
is,linked |
| R7648 |
T11876 |
T11872 |
prep |
to,linked |
| R7649 |
T11877 |
T11876 |
pobj |
proliferation,to |
| R765 |
T1581 |
T1580 |
acl |
encoding,gene |
| R7650 |
T11878 |
T11872 |
prep |
in,linked |
| R7651 |
T11879 |
T11880 |
amod |
epithelial,morphogenesis |
| R7652 |
T11880 |
T11878 |
pobj |
morphogenesis,in |
| R7653 |
T11881 |
T11846 |
aux |
should,begin |
| R7654 |
T11882 |
T11883 |
aux |
to,surface |
| R7655 |
T11883 |
T11846 |
xcomp |
surface,begin |
| R7656 |
T11884 |
T11883 |
prep |
in,surface |
| R7657 |
T11885 |
T11886 |
det |
the,future |
| R7658 |
T11886 |
T11884 |
pobj |
future,in |
| R7659 |
T11887 |
T11846 |
punct |
.,begin |
| R766 |
T1582 |
T1583 |
compound |
E,cadherin |
| R7660 |
T11889 |
T11890 |
csubj |
Elucidating,is |
| R7661 |
T11891 |
T11892 |
det |
the,mechanisms |
| R7662 |
T11892 |
T11889 |
dobj |
mechanisms,Elucidating |
| R7663 |
T11893 |
T11892 |
amod |
molecular,mechanisms |
| R7664 |
T11894 |
T11895 |
prep |
through,converge |
| R7665 |
T11895 |
T11892 |
relcl |
converge,mechanisms |
| R7666 |
T11896 |
T11894 |
pobj |
which,through |
| R7667 |
T11897 |
T11898 |
det |
these,networks |
| R7668 |
T11898 |
T11895 |
nsubj |
networks,converge |
| R7669 |
T11899 |
T11890 |
advmod |
also,is |
| R767 |
T1583 |
T1581 |
dobj |
cadherin,encoding |
| R7670 |
T11900 |
T11901 |
det |
a,prerequisite |
| R7671 |
T11901 |
T11890 |
attr |
prerequisite,is |
| R7672 |
T11902 |
T11901 |
prep |
for,prerequisite |
| R7673 |
T11903 |
T11902 |
pcomp |
understanding,for |
| R7674 |
T11904 |
T11905 |
advmod |
how,go |
| R7675 |
T11905 |
T11903 |
ccomp |
go,understanding |
| R7676 |
T11906 |
T11907 |
det |
these,processes |
| R7677 |
T11907 |
T11905 |
nsubj |
processes,go |
| R7678 |
T11908 |
T11905 |
advmod |
awry,go |
| R7679 |
T11909 |
T11905 |
prep |
during,go |
| R768 |
T1686 |
T1687 |
compound |
β,catenin |
| R7680 |
T11910 |
T11909 |
pobj |
tumorigenesis,during |
| R7681 |
T11911 |
T11890 |
punct |
.,is |
| R7682 |
T12023 |
T12024 |
amod |
Primary,antibodies |
| R7683 |
T12024 |
T12025 |
nsubj |
antibodies,were |
| R7684 |
T12026 |
T12024 |
acl |
used,antibodies |
| R7685 |
T12027 |
T12025 |
prep |
against,were |
| R7686 |
T12028 |
T12027 |
punct |
: ,against |
| R7687 |
T12029 |
T12030 |
compound |
E,cadherin |
| R7688 |
T12030 |
T12027 |
pobj |
cadherin,against |
| R7689 |
T12031 |
T12030 |
punct |
-,cadherin |
| R769 |
T1584 |
T1583 |
punct |
-,cadherin |
| R7690 |
T12032 |
T12033 |
punct |
(,Takeichi |
| R7691 |
T12033 |
T12030 |
parataxis |
Takeichi,cadherin |
| R7692 |
T12034 |
T12033 |
compound |
M.,Takeichi |
| R7693 |
T12035 |
T12033 |
punct |
", ",Takeichi |
| R7694 |
T12036 |
T12037 |
compound |
Kyoto,University |
| R7695 |
T12037 |
T12033 |
npadvmod |
University,Takeichi |
| R7696 |
T12038 |
T12033 |
punct |
", ",Takeichi |
| R7697 |
T12039 |
T12033 |
npadvmod |
Japan,Takeichi |
| R7698 |
T12040 |
T12033 |
punct |
),Takeichi |
| R7699 |
T12041 |
T12030 |
punct |
;,cadherin |
| R770 |
T1585 |
T1583 |
punct |
", ",cadherin |
| R7700 |
T12042 |
T12043 |
compound |
α,catenin |
| R7701 |
T12043 |
T12030 |
conj |
catenin,cadherin |
| R7702 |
T12044 |
T12043 |
punct |
-,catenin |
| R7703 |
T12045 |
T12043 |
punct |
", ",catenin |
| R7704 |
T12046 |
T12047 |
compound |
β,catenin |
| R7705 |
T12047 |
T12043 |
appos |
catenin,catenin |
| R7706 |
T12048 |
T12047 |
punct |
-,catenin |
| R7707 |
T12049 |
T12043 |
punct |
", ",catenin |
| R7708 |
T12050 |
T12043 |
appos |
pMAPK,catenin |
| R7709 |
T12051 |
T12043 |
punct |
", ",catenin |
| R771 |
T1586 |
T1587 |
det |
the,cadherin |
| R7710 |
T12052 |
T12043 |
appos |
tubulin,catenin |
| R7711 |
T12053 |
T12054 |
punct |
(,Sigma |
| R7712 |
T12054 |
T12043 |
parataxis |
Sigma,catenin |
| R7713 |
T12055 |
T12054 |
punct |
", ",Sigma |
| R7714 |
T12056 |
T12057 |
compound |
St.,Louis |
| R7715 |
T12057 |
T12054 |
npadvmod |
Louis,Sigma |
| R7716 |
T12058 |
T12054 |
punct |
", ",Sigma |
| R7717 |
T12059 |
T12054 |
npadvmod |
Missouri,Sigma |
| R7718 |
T12060 |
T12054 |
punct |
", ",Sigma |
| R7719 |
T12061 |
T12062 |
compound |
United,States |
| R772 |
T1687 |
T1682 |
appos |
catenin,cadherin |
| R7720 |
T12062 |
T12054 |
npadvmod |
States,Sigma |
| R7721 |
T12063 |
T12054 |
punct |
),Sigma |
| R7722 |
T12064 |
T12043 |
punct |
", ",catenin |
| R7723 |
T12065 |
T12043 |
conj |
Ajuba,catenin |
| R7724 |
T12066 |
T12067 |
punct |
(,Longmore |
| R7725 |
T12067 |
T12065 |
parataxis |
Longmore,Ajuba |
| R7726 |
T12068 |
T12067 |
compound |
G.,Longmore |
| R7727 |
T12069 |
T12067 |
punct |
", ",Longmore |
| R7728 |
T12070 |
T12071 |
compound |
Washington,University |
| R7729 |
T12071 |
T12067 |
npadvmod |
University,Longmore |
| R773 |
T1587 |
T1583 |
appos |
cadherin,cadherin |
| R7730 |
T12072 |
T12067 |
punct |
", ",Longmore |
| R7731 |
T12073 |
T12074 |
compound |
St.,Louis |
| R7732 |
T12074 |
T12067 |
npadvmod |
Louis,Longmore |
| R7733 |
T12075 |
T12067 |
punct |
", ",Longmore |
| R7734 |
T12076 |
T12067 |
npadvmod |
Missouri,Longmore |
| R7735 |
T12077 |
T12067 |
punct |
", ",Longmore |
| R7736 |
T12078 |
T12079 |
compound |
United,States |
| R7737 |
T12079 |
T12067 |
npadvmod |
States,Longmore |
| R7738 |
T12080 |
T12067 |
punct |
),Longmore |
| R7739 |
T12081 |
T12065 |
punct |
;,Ajuba |
| R774 |
T1588 |
T1587 |
amod |
prototypical,cadherin |
| R7740 |
T12082 |
T12083 |
compound |
β4,integrin |
| R7741 |
T12083 |
T12065 |
conj |
integrin,Ajuba |
| R7742 |
T12084 |
T12083 |
punct |
/,integrin |
| R7743 |
T12085 |
T12083 |
appos |
CD104,integrin |
| R7744 |
T12086 |
T12087 |
punct |
(,Pharmingen |
| R7745 |
T12087 |
T12083 |
parataxis |
Pharmingen,integrin |
| R7746 |
T12088 |
T12087 |
compound |
BD,Pharmingen |
| R7747 |
T12089 |
T12087 |
punct |
", ",Pharmingen |
| R7748 |
T12090 |
T12091 |
compound |
San,Diego |
| R7749 |
T12091 |
T12087 |
npadvmod |
Diego,Pharmingen |
| R775 |
T1688 |
T1687 |
punct |
-,catenin |
| R7750 |
T12092 |
T12087 |
punct |
", ",Pharmingen |
| R7751 |
T12093 |
T12087 |
npadvmod |
California,Pharmingen |
| R7752 |
T12094 |
T12087 |
punct |
", ",Pharmingen |
| R7753 |
T12095 |
T12096 |
compound |
United,States |
| R7754 |
T12096 |
T12087 |
npadvmod |
States,Pharmingen |
| R7755 |
T12097 |
T12087 |
punct |
),Pharmingen |
| R7756 |
T12098 |
T12083 |
punct |
", ",integrin |
| R7757 |
T12099 |
T12083 |
conj |
laminin,integrin |
| R7758 |
T12100 |
T12099 |
nummod |
5,laminin |
| R7759 |
T12101 |
T12102 |
punct |
(,Burgeson |
| R776 |
T1589 |
T1587 |
amod |
epithelial,cadherin |
| R7760 |
T12102 |
T12099 |
parataxis |
Burgeson,laminin |
| R7761 |
T12103 |
T12102 |
compound |
R.,Burgeson |
| R7762 |
T12104 |
T12102 |
punct |
", ",Burgeson |
| R7763 |
T12105 |
T12106 |
compound |
Harvard,University |
| R7764 |
T12106 |
T12102 |
npadvmod |
University,Burgeson |
| R7765 |
T12107 |
T12102 |
punct |
", ",Burgeson |
| R7766 |
T12108 |
T12102 |
npadvmod |
Cambridge,Burgeson |
| R7767 |
T12109 |
T12102 |
punct |
", ",Burgeson |
| R7768 |
T12110 |
T12102 |
npadvmod |
Massachusetts,Burgeson |
| R7769 |
T12111 |
T12102 |
punct |
", ",Burgeson |
| R777 |
T1590 |
T1591 |
dep |
that,forms |
| R7770 |
T12112 |
T12113 |
compound |
United,States |
| R7771 |
T12113 |
T12102 |
npadvmod |
States,Burgeson |
| R7772 |
T12114 |
T12102 |
punct |
),Burgeson |
| R7773 |
T12115 |
T12099 |
punct |
", ",laminin |
| R7774 |
T12116 |
T12099 |
conj |
K5,laminin |
| R7775 |
T12117 |
T12116 |
punct |
", ",K5 |
| R7776 |
T12118 |
T12116 |
conj |
K1,K5 |
| R7777 |
T12119 |
T12118 |
punct |
", ",K1 |
| R7778 |
T12120 |
T12118 |
conj |
loricrin,K1 |
| R7779 |
T12121 |
T12122 |
punct |
(,Lab |
| R778 |
T1591 |
T1587 |
relcl |
forms,cadherin |
| R7780 |
T12122 |
T12120 |
parataxis |
Lab,loricrin |
| R7781 |
T12123 |
T12122 |
compound |
Fuchs,Lab |
| R7782 |
T12124 |
T12122 |
punct |
),Lab |
| R7783 |
T12125 |
T12120 |
punct |
", ",loricrin |
| R7784 |
T12126 |
T12120 |
conj |
involucrin,loricrin |
| R7785 |
T12127 |
T12126 |
punct |
", ",involucrin |
| R7786 |
T12128 |
T12126 |
conj |
fillagrin,involucrin |
| R7787 |
T12129 |
T12130 |
punct |
(,Covance |
| R7788 |
T12130 |
T12128 |
parataxis |
Covance,fillagrin |
| R7789 |
T12131 |
T12130 |
punct |
", ",Covance |
| R779 |
T1689 |
T1690 |
compound |
α,catenin |
| R7790 |
T12132 |
T12130 |
npadvmod |
Berkeley,Covance |
| R7791 |
T12133 |
T12130 |
punct |
", ",Covance |
| R7792 |
T12134 |
T12130 |
npadvmod |
California,Covance |
| R7793 |
T12135 |
T12130 |
punct |
", ",Covance |
| R7794 |
T12136 |
T12137 |
compound |
United,States |
| R7795 |
T12137 |
T12130 |
npadvmod |
States,Covance |
| R7796 |
T12138 |
T12130 |
punct |
),Covance |
| R7797 |
T12139 |
T12128 |
punct |
", ",fillagrin |
| R7798 |
T12140 |
T12128 |
conj |
MAPK,fillagrin |
| R7799 |
T12141 |
T12140 |
punct |
", ",MAPK |
| R780 |
T1592 |
T1593 |
det |
the,core |
| R7800 |
T12142 |
T12140 |
conj |
pSMAD2,MAPK |
| R7801 |
T12143 |
T12144 |
punct |
(,Signaling |
| R7802 |
T12144 |
T12142 |
parataxis |
Signaling,pSMAD2 |
| R7803 |
T12145 |
T12144 |
compound |
Cell,Signaling |
| R7804 |
T12146 |
T12144 |
punct |
", ",Signaling |
| R7805 |
T12147 |
T12144 |
npadvmod |
Beverly,Signaling |
| R7806 |
T12148 |
T12144 |
punct |
", ",Signaling |
| R7807 |
T12149 |
T12144 |
npadvmod |
Massachusetts,Signaling |
| R7808 |
T12150 |
T12144 |
punct |
", ",Signaling |
| R7809 |
T12151 |
T12152 |
compound |
United,States |
| R781 |
T1593 |
T1591 |
dobj |
core,forms |
| R7810 |
T12152 |
T12144 |
npadvmod |
States,Signaling |
| R7811 |
T12153 |
T12144 |
punct |
),Signaling |
| R7812 |
T12154 |
T12142 |
punct |
;,pSMAD2 |
| R7813 |
T12155 |
T12142 |
conj |
Grb,pSMAD2 |
| R7814 |
T12156 |
T12155 |
punct |
-,Grb |
| R7815 |
T12157 |
T12155 |
nummod |
2,Grb |
| R7816 |
T12158 |
T12159 |
punct |
(,Biotech |
| R7817 |
T12159 |
T12155 |
parataxis |
Biotech,Grb |
| R7818 |
T12160 |
T12161 |
compound |
Santa,Cruz |
| R7819 |
T12161 |
T12159 |
compound |
Cruz,Biotech |
| R782 |
T1690 |
T1671 |
dobj |
catenin,recruit |
| R7820 |
T12162 |
T12159 |
punct |
", ",Biotech |
| R7821 |
T12163 |
T12164 |
compound |
Santa,Cruz |
| R7822 |
T12164 |
T12159 |
npadvmod |
Cruz,Biotech |
| R7823 |
T12165 |
T12159 |
punct |
", ",Biotech |
| R7824 |
T12166 |
T12159 |
npadvmod |
California,Biotech |
| R7825 |
T12167 |
T12159 |
punct |
", ",Biotech |
| R7826 |
T12168 |
T12169 |
compound |
United,States |
| R7827 |
T12169 |
T12159 |
npadvmod |
States,Biotech |
| R7828 |
T12170 |
T12159 |
punct |
),Biotech |
| R7829 |
T12171 |
T12155 |
punct |
;,Grb |
| R783 |
T1594 |
T1593 |
amod |
transmembrane,core |
| R7830 |
T12172 |
T12173 |
compound |
P,cadherin |
| R7831 |
T12173 |
T12155 |
conj |
cadherin,Grb |
| R7832 |
T12174 |
T12173 |
punct |
-,cadherin |
| R7833 |
T12175 |
T12176 |
punct |
(,Laboratories |
| R7834 |
T12176 |
T12173 |
parataxis |
Laboratories,cadherin |
| R7835 |
T12177 |
T12176 |
compound |
Zymed,Laboratories |
| R7836 |
T12178 |
T12176 |
punct |
", ",Laboratories |
| R7837 |
T12179 |
T12180 |
amod |
South,Francisco |
| R7838 |
T12180 |
T12176 |
npadvmod |
Francisco,Laboratories |
| R7839 |
T12181 |
T12180 |
compound |
San,Francisco |
| R784 |
T1595 |
T1593 |
prep |
of,core |
| R7840 |
T12182 |
T12176 |
punct |
", ",Laboratories |
| R7841 |
T12183 |
T12176 |
npadvmod |
California,Laboratories |
| R7842 |
T12184 |
T12176 |
punct |
", ",Laboratories |
| R7843 |
T12185 |
T12186 |
compound |
United,States |
| R7844 |
T12186 |
T12176 |
npadvmod |
States,Laboratories |
| R7845 |
T12187 |
T12176 |
punct |
),Laboratories |
| R7846 |
T12188 |
T12173 |
punct |
;,cadherin |
| R7847 |
T12189 |
T12173 |
conj |
HA,cadherin |
| R7848 |
T12190 |
T12191 |
punct |
(,Biochemicals |
| R7849 |
T12191 |
T12189 |
parataxis |
Biochemicals,HA |
| R785 |
T1596 |
T1597 |
amod |
intercellular,junctions |
| R7850 |
T12192 |
T12191 |
compound |
Roche,Biochemicals |
| R7851 |
T12193 |
T12191 |
punct |
),Biochemicals |
| R7852 |
T12194 |
T12189 |
punct |
", ",HA |
| R7853 |
T12195 |
T12189 |
conj |
vimentin,HA |
| R7854 |
T12196 |
T12197 |
punct |
(,Chemicon |
| R7855 |
T12197 |
T12195 |
parataxis |
Chemicon,vimentin |
| R7856 |
T12198 |
T12197 |
punct |
", ",Chemicon |
| R7857 |
T12199 |
T12197 |
npadvmod |
Temecula,Chemicon |
| R7858 |
T12200 |
T12197 |
punct |
", ",Chemicon |
| R7859 |
T12201 |
T12197 |
npadvmod |
California,Chemicon |
| R786 |
T1691 |
T1690 |
punct |
-,catenin |
| R7860 |
T12202 |
T12197 |
punct |
", ",Chemicon |
| R7861 |
T12203 |
T12204 |
compound |
United,States |
| R7862 |
T12204 |
T12197 |
npadvmod |
States,Chemicon |
| R7863 |
T12205 |
T12197 |
punct |
),Chemicon |
| R7864 |
T12206 |
T12195 |
punct |
", ",vimentin |
| R7865 |
T12207 |
T12195 |
conj |
Ki67,vimentin |
| R7866 |
T12208 |
T12209 |
punct |
(,Castra |
| R7867 |
T12209 |
T12207 |
parataxis |
Castra,Ki67 |
| R7868 |
T12210 |
T12209 |
compound |
Novo,Castra |
| R7869 |
T12211 |
T12209 |
punct |
", ",Castra |
| R787 |
T1597 |
T1595 |
pobj |
junctions,of |
| R7870 |
T12212 |
T12209 |
npadvmod |
Newcastle,Castra |
| R7871 |
T12213 |
T12212 |
prep |
Upon,Newcastle |
| R7872 |
T12214 |
T12213 |
pobj |
Tyne,Upon |
| R7873 |
T12215 |
T12209 |
punct |
", ",Castra |
| R7874 |
T12216 |
T12217 |
compound |
United,Kingdom |
| R7875 |
T12217 |
T12209 |
npadvmod |
Kingdom,Castra |
| R7876 |
T12218 |
T12209 |
punct |
),Castra |
| R7877 |
T12219 |
T12207 |
punct |
", ",Ki67 |
| R7878 |
T12220 |
T12207 |
conj |
keratin,Ki67 |
| R7879 |
T12221 |
T12220 |
nummod |
6,keratin |
| R788 |
T1598 |
T1597 |
compound |
adherens,junctions |
| R7880 |
T12222 |
T12223 |
punct |
(,Coulombe |
| R7881 |
T12223 |
T12220 |
parataxis |
Coulombe,keratin |
| R7882 |
T12224 |
T12223 |
compound |
P.,Coulombe |
| R7883 |
T12225 |
T12223 |
punct |
", ",Coulombe |
| R7884 |
T12226 |
T12227 |
compound |
John,Hopkins |
| R7885 |
T12227 |
T12228 |
compound |
Hopkins,University |
| R7886 |
T12228 |
T12223 |
npadvmod |
University,Coulombe |
| R7887 |
T12229 |
T12223 |
punct |
", ",Coulombe |
| R7888 |
T12230 |
T12223 |
npadvmod |
Baltimore,Coulombe |
| R7889 |
T12231 |
T12223 |
punct |
", ",Coulombe |
| R789 |
T1599 |
T1597 |
punct |
(,junctions |
| R7890 |
T12232 |
T12223 |
npadvmod |
Maryland,Coulombe |
| R7891 |
T12233 |
T12223 |
punct |
", ",Coulombe |
| R7892 |
T12234 |
T12235 |
compound |
United,States |
| R7893 |
T12235 |
T12223 |
npadvmod |
States,Coulombe |
| R7894 |
T12236 |
T12223 |
punct |
),Coulombe |
| R7895 |
T12237 |
T12220 |
punct |
", ",keratin |
| R7896 |
T12238 |
T12239 |
compound |
cyclin,D |
| R7897 |
T12239 |
T12220 |
conj |
D,keratin |
| R7898 |
T12240 |
T12241 |
punct |
(,Oncogene |
| R7899 |
T12241 |
T12239 |
parataxis |
Oncogene,D |
| R790 |
T1692 |
T1690 |
punct |
", ",catenin |
| R7900 |
T12242 |
T12241 |
punct |
", ",Oncogene |
| R7901 |
T12243 |
T12244 |
compound |
San,Diego |
| R7902 |
T12244 |
T12241 |
npadvmod |
Diego,Oncogene |
| R7903 |
T12245 |
T12241 |
punct |
", ",Oncogene |
| R7904 |
T12246 |
T12241 |
npadvmod |
California,Oncogene |
| R7905 |
T12247 |
T12241 |
punct |
", ",Oncogene |
| R7906 |
T12248 |
T12249 |
compound |
United,States |
| R7907 |
T12249 |
T12241 |
npadvmod |
States,Oncogene |
| R7908 |
T12250 |
T12241 |
punct |
),Oncogene |
| R7909 |
T12251 |
T12239 |
punct |
", ",D |
| R791 |
T1600 |
T1597 |
appos |
AJs,junctions |
| R7910 |
T12252 |
T12239 |
cc |
and,D |
| R7911 |
T12253 |
T12254 |
compound |
TGF,β2 |
| R7912 |
T12254 |
T12239 |
conj |
β2,D |
| R7913 |
T12255 |
T12254 |
punct |
-,β2 |
| R7914 |
T12256 |
T12257 |
punct |
(,Gold |
| R7915 |
T12257 |
T12254 |
parataxis |
Gold,β2 |
| R7916 |
T12258 |
T12257 |
compound |
L.,Gold |
| R7917 |
T12259 |
T12257 |
punct |
", ",Gold |
| R7918 |
T12260 |
T12261 |
compound |
New,York |
| R7919 |
T12261 |
T12262 |
compound |
York,University |
| R792 |
T1601 |
T1565 |
punct |
),include |
| R7920 |
T12262 |
T12257 |
npadvmod |
University,Gold |
| R7921 |
T12263 |
T12257 |
punct |
", ",Gold |
| R7922 |
T12264 |
T12265 |
compound |
New,York |
| R7923 |
T12265 |
T12257 |
npadvmod |
York,Gold |
| R7924 |
T12266 |
T12257 |
punct |
", ",Gold |
| R7925 |
T12267 |
T12268 |
compound |
New,York |
| R7926 |
T12268 |
T12257 |
npadvmod |
York,Gold |
| R7927 |
T12269 |
T12257 |
punct |
", ",Gold |
| R7928 |
T12270 |
T12271 |
compound |
United,States |
| R7929 |
T12271 |
T12257 |
npadvmod |
States,Gold |
| R793 |
T1602 |
T1603 |
punct |
[,5 |
| R7930 |
T12272 |
T12257 |
punct |
),Gold |
| R7931 |
T12273 |
T12025 |
punct |
.,were |
| R7932 |
T12275 |
T12276 |
npadvmod |
FITC,conjugated |
| R7933 |
T12276 |
T12286 |
amod |
conjugated,antibodies |
| R7934 |
T12277 |
T12275 |
punct |
-,FITC |
| R7935 |
T12278 |
T12275 |
punct |
", ",FITC |
| R7936 |
T12279 |
T12280 |
compound |
Texas,Red |
| R7937 |
T12280 |
T12275 |
conj |
Red,FITC |
| R7938 |
T12281 |
T12280 |
punct |
-,Red |
| R7939 |
T12282 |
T12280 |
punct |
", ",Red |
| R794 |
T1603 |
T1565 |
parataxis |
5,include |
| R7940 |
T12283 |
T12280 |
cc |
or,Red |
| R7941 |
T12284 |
T12280 |
conj |
HRP,Red |
| R7942 |
T12285 |
T12276 |
punct |
-,conjugated |
| R7943 |
T12286 |
T12288 |
nsubj |
antibodies,were |
| R7944 |
T12287 |
T12286 |
amod |
secondary,antibodies |
| R7945 |
T12289 |
T12288 |
prep |
from,were |
| R7946 |
T12290 |
T12291 |
compound |
Jackson,ImmunoResearch |
| R7947 |
T12291 |
T12289 |
pobj |
ImmunoResearch,from |
| R7948 |
T12292 |
T12293 |
punct |
(,Grove |
| R7949 |
T12293 |
T12291 |
parataxis |
Grove,ImmunoResearch |
| R795 |
T1604 |
T1603 |
punct |
],5 |
| R7950 |
T12294 |
T12293 |
compound |
West,Grove |
| R7951 |
T12295 |
T12293 |
punct |
", ",Grove |
| R7952 |
T12296 |
T12293 |
npadvmod |
Pennsylvania,Grove |
| R7953 |
T12297 |
T12293 |
punct |
", ",Grove |
| R7954 |
T12298 |
T12299 |
compound |
United,States |
| R7955 |
T12299 |
T12293 |
npadvmod |
States,Grove |
| R7956 |
T12300 |
T12293 |
punct |
),Grove |
| R7957 |
T12301 |
T12288 |
punct |
.,were |
| R7958 |
T12303 |
T12304 |
amod |
Biotinylated,antibodies |
| R7959 |
T12304 |
T12306 |
nsubj |
antibodies,were |
| R796 |
T1693 |
T1694 |
dep |
which,coordinates |
| R7960 |
T12305 |
T12304 |
amod |
secondary,antibodies |
| R7961 |
T12307 |
T12306 |
prep |
from,were |
| R7962 |
T12308 |
T12309 |
compound |
Vector,Labs |
| R7963 |
T12309 |
T12307 |
pobj |
Labs,from |
| R7964 |
T12310 |
T12311 |
punct |
(,Burlingame |
| R7965 |
T12311 |
T12309 |
parataxis |
Burlingame,Labs |
| R7966 |
T12312 |
T12311 |
punct |
", ",Burlingame |
| R7967 |
T12313 |
T12311 |
npadvmod |
California,Burlingame |
| R7968 |
T12314 |
T12311 |
punct |
", ",Burlingame |
| R7969 |
T12315 |
T12316 |
compound |
United,States |
| R797 |
T1605 |
T1565 |
punct |
.,include |
| R7970 |
T12316 |
T12311 |
npadvmod |
States,Burlingame |
| R7971 |
T12317 |
T12311 |
punct |
),Burlingame |
| R7972 |
T12318 |
T12306 |
punct |
.,were |
| R7973 |
T12320 |
T12321 |
nsubj |
Dilutions,were |
| R7974 |
T12322 |
T12321 |
prep |
according,were |
| R7975 |
T12323 |
T12322 |
prep |
to,according |
| R7976 |
T12324 |
T12325 |
det |
the,manufacturer |
| R7977 |
T12325 |
T12326 |
poss |
manufacturer,recommendation |
| R7978 |
T12326 |
T12323 |
pobj |
recommendation,to |
| R7979 |
T12327 |
T12325 |
case |
's,manufacturer |
| R798 |
T1607 |
T1608 |
nsubj |
We,showed |
| R7980 |
T12328 |
T12321 |
punct |
.,were |
| R7981 |
T12330 |
T12331 |
det |
The,antibody |
| R7982 |
T12331 |
T12333 |
nsubjpass |
antibody,generated |
| R7983 |
T12332 |
T12331 |
compound |
Snail,antibody |
| R7984 |
T12334 |
T12333 |
auxpass |
was,generated |
| R7985 |
T12335 |
T12333 |
prep |
in,generated |
| R7986 |
T12336 |
T12337 |
compound |
Guinea,pigs |
| R7987 |
T12337 |
T12335 |
pobj |
pigs,in |
| R7988 |
T12338 |
T12333 |
prep |
by,generated |
| R7989 |
T12339 |
T12338 |
pcomp |
inoculating,by |
| R799 |
T1694 |
T1690 |
relcl |
coordinates,catenin |
| R7990 |
T12340 |
T12339 |
dobj |
them,inoculating |
| R7991 |
T12341 |
T12339 |
prep |
with,inoculating |
| R7992 |
T12342 |
T12343 |
det |
the,sequence |
| R7993 |
T12343 |
T12341 |
pobj |
sequence,with |
| R7994 |
T12344 |
T12345 |
npadvmod |
N,terminal |
| R7995 |
T12345 |
T12343 |
amod |
terminal,sequence |
| R7996 |
T12346 |
T12345 |
punct |
-,terminal |
| R7997 |
T12347 |
T12343 |
prep |
of,sequence |
| R7998 |
T12348 |
T12349 |
amod |
murine,Snail |
| R7999 |
T12349 |
T12347 |
pobj |
Snail,of |
| R800 |
T1609 |
T1608 |
advmod |
subsequently,showed |
| R8000 |
T12350 |
T12343 |
acl |
fused,sequence |
| R8001 |
T12351 |
T12350 |
prep |
to,fused |
| R8002 |
T12352 |
T12351 |
pobj |
GST,to |
| R8003 |
T12353 |
T12354 |
punct |
(,Covance |
| R8004 |
T12354 |
T12352 |
parataxis |
Covance,GST |
| R8005 |
T12355 |
T12354 |
punct |
", ",Covance |
| R8006 |
T12356 |
T12354 |
npadvmod |
Princeton,Covance |
| R8007 |
T12357 |
T12354 |
punct |
", ",Covance |
| R8008 |
T12358 |
T12359 |
compound |
New,Jersey |
| R8009 |
T12359 |
T12354 |
npadvmod |
Jersey,Covance |
| R801 |
T1695 |
T1694 |
prep |
in,coordinates |
| R8010 |
T12360 |
T12354 |
punct |
", ",Covance |
| R8011 |
T12361 |
T12362 |
compound |
United,States |
| R8012 |
T12362 |
T12354 |
npadvmod |
States,Covance |
| R8013 |
T12363 |
T12354 |
punct |
),Covance |
| R8014 |
T12364 |
T12333 |
punct |
.,generated |
| R8015 |
T12366 |
T12367 |
amod |
Recombinant,β2 |
| R8016 |
T12367 |
T12371 |
nsubjpass |
β2,purchased |
| R8017 |
T12368 |
T12367 |
amod |
human,β2 |
| R8018 |
T12369 |
T12367 |
compound |
TGF,β2 |
| R8019 |
T12370 |
T12367 |
punct |
-,β2 |
| R802 |
T1610 |
T1611 |
mark |
that,blocked |
| R8020 |
T12372 |
T12371 |
auxpass |
was,purchased |
| R8021 |
T12373 |
T12371 |
prep |
from,purchased |
| R8022 |
T12374 |
T12373 |
pobj |
R,from |
| R8023 |
T12375 |
T12374 |
cc |
&,R |
| R8024 |
T12376 |
T12374 |
conj |
D,R |
| R8025 |
T12377 |
T12378 |
punct |
(,Minneapolis |
| R8026 |
T12378 |
T12376 |
parataxis |
Minneapolis,D |
| R8027 |
T12379 |
T12378 |
punct |
", ",Minneapolis |
| R8028 |
T12380 |
T12378 |
npadvmod |
Minnesota,Minneapolis |
| R8029 |
T12381 |
T12378 |
punct |
", ",Minneapolis |
| R803 |
T1696 |
T1695 |
pobj |
turn,in |
| R8030 |
T12382 |
T12383 |
compound |
United,States |
| R8031 |
T12383 |
T12378 |
npadvmod |
States,Minneapolis |
| R8032 |
T12384 |
T12378 |
punct |
),Minneapolis |
| R8033 |
T12385 |
T12371 |
punct |
.,purchased |
| R8034 |
T12387 |
T12388 |
npadvmod |
Heat,inactivated |
| R8035 |
T12388 |
T12389 |
amod |
inactivated,β2 |
| R8036 |
T12389 |
T12392 |
nsubjpass |
β2,generated |
| R8037 |
T12390 |
T12389 |
compound |
TGF,β2 |
| R8038 |
T12391 |
T12389 |
punct |
-,β2 |
| R8039 |
T12393 |
T12392 |
auxpass |
was,generated |
| R804 |
T1611 |
T1608 |
ccomp |
blocked,showed |
| R8040 |
T12394 |
T12392 |
prep |
by,generated |
| R8041 |
T12395 |
T12394 |
pcomp |
heating,by |
| R8042 |
T12396 |
T12397 |
det |
the,protein |
| R8043 |
T12397 |
T12395 |
dobj |
protein,heating |
| R8044 |
T12398 |
T12397 |
amod |
recombinant,protein |
| R8045 |
T12399 |
T12395 |
prep |
at,heating |
| R8046 |
T12400 |
T12401 |
nummod |
100,°C |
| R8047 |
T12401 |
T12399 |
pobj |
°C,at |
| R8048 |
T12402 |
T12395 |
prep |
for,heating |
| R8049 |
T12403 |
T12404 |
nummod |
10,min |
| R805 |
T1697 |
T1698 |
det |
the,dynamics |
| R8050 |
T12404 |
T12402 |
pobj |
min,for |
| R8051 |
T12405 |
T12392 |
punct |
.,generated |
| R8052 |
T12466 |
T12467 |
det |
The,mouse |
| R8053 |
T12467 |
T12472 |
nsubjpass |
mouse,generated |
| R8054 |
T12468 |
T12469 |
compound |
K14,Snail |
| R8055 |
T12469 |
T12467 |
compound |
Snail,mouse |
| R8056 |
T12470 |
T12469 |
punct |
-,Snail |
| R8057 |
T12471 |
T12467 |
compound |
Tg,mouse |
| R8058 |
T12473 |
T12472 |
auxpass |
was,generated |
| R8059 |
T12474 |
T12472 |
prep |
by,generated |
| R806 |
T1612 |
T1613 |
advmod |
when,elevated |
| R8060 |
T12475 |
T12474 |
pcomp |
digesting,by |
| R8061 |
T12476 |
T12477 |
det |
the,plasmid |
| R8062 |
T12477 |
T12475 |
dobj |
plasmid,digesting |
| R8063 |
T12478 |
T12479 |
compound |
pcDNA3,mm |
| R8064 |
T12479 |
T12477 |
compound |
mm,plasmid |
| R8065 |
T12480 |
T12479 |
punct |
-,mm |
| R8066 |
T12481 |
T12482 |
compound |
Snail,HA |
| R8067 |
T12482 |
T12477 |
compound |
HA,plasmid |
| R8068 |
T12483 |
T12482 |
punct |
-,HA |
| R8069 |
T12484 |
T12485 |
punct |
(,Herreros |
| R807 |
T1613 |
T1611 |
advcl |
elevated,blocked |
| R8070 |
T12485 |
T12477 |
parataxis |
Herreros,plasmid |
| R8071 |
T12486 |
T12485 |
compound |
G.,Herreros |
| R8072 |
T12487 |
T12485 |
compound |
de,Herreros |
| R8073 |
T12488 |
T12485 |
punct |
", ",Herreros |
| R8074 |
T12489 |
T12490 |
compound |
Universitat,Pompeu |
| R8075 |
T12490 |
T12485 |
npadvmod |
Pompeu,Herreros |
| R8076 |
T12491 |
T12485 |
punct |
", ",Herreros |
| R8077 |
T12492 |
T12485 |
npadvmod |
Fabra,Herreros |
| R8078 |
T12493 |
T12485 |
punct |
", ",Herreros |
| R8079 |
T12494 |
T12485 |
npadvmod |
Barcelona,Herreros |
| R808 |
T1698 |
T1694 |
dobj |
dynamics,coordinates |
| R8080 |
T12495 |
T12485 |
punct |
", ",Herreros |
| R8081 |
T12496 |
T12485 |
npadvmod |
Spain,Herreros |
| R8082 |
T12497 |
T12485 |
punct |
),Herreros |
| R8083 |
T12498 |
T12475 |
prep |
with,digesting |
| R8084 |
T12499 |
T12498 |
pobj |
BamHI,with |
| R8085 |
T12500 |
T12499 |
cc |
and,BamHI |
| R8086 |
T12501 |
T12499 |
conj |
NotI,BamHI |
| R8087 |
T12502 |
T12472 |
cc |
and,generated |
| R8088 |
T12503 |
T12472 |
conj |
subcloned,generated |
| R8089 |
T12504 |
T12503 |
prep |
into,subcloned |
| R809 |
T1614 |
T1615 |
compound |
E,cadherin |
| R8090 |
T12505 |
T12506 |
det |
the,vector |
| R8091 |
T12506 |
T12504 |
pobj |
vector,into |
| R8092 |
T12507 |
T12506 |
compound |
K14,vector |
| R8093 |
T12508 |
T12509 |
punct |
[,49 |
| R8094 |
T12509 |
T12503 |
parataxis |
49,subcloned |
| R8095 |
T12510 |
T12509 |
punct |
],49 |
| R8096 |
T12511 |
T12472 |
punct |
.,generated |
| R8097 |
T12513 |
T12514 |
det |
The,construct |
| R8098 |
T12514 |
T12516 |
nsubjpass |
construct,injected |
| R8099 |
T12515 |
T12514 |
amod |
linearized,construct |
| R810 |
T1615 |
T1613 |
nsubjpass |
cadherin,elevated |
| R8100 |
T12517 |
T12516 |
auxpass |
was,injected |
| R8101 |
T12518 |
T12516 |
prep |
into,injected |
| R8102 |
T12519 |
T12520 |
det |
the,nucleus |
| R8103 |
T12520 |
T12518 |
pobj |
nucleus,into |
| R8104 |
T12521 |
T12520 |
prep |
of,nucleus |
| R8105 |
T12522 |
T12521 |
pobj |
embryos,of |
| R8106 |
T12523 |
T12522 |
prep |
from,embryos |
| R8107 |
T12524 |
T12525 |
compound |
CD1,mice |
| R8108 |
T12525 |
T12523 |
pobj |
mice,from |
| R8109 |
T12526 |
T12516 |
punct |
.,injected |
| R811 |
T1616 |
T1615 |
punct |
-,cadherin |
| R8110 |
T12528 |
T12529 |
det |
The,mouse |
| R8111 |
T12529 |
T12535 |
nsubjpass |
mouse,reported |
| R8112 |
T12530 |
T12531 |
nmod |
K14,Smad |
| R8113 |
T12531 |
T12529 |
nmod |
Smad,mouse |
| R8114 |
T12532 |
T12531 |
punct |
-,Smad |
| R8115 |
T12533 |
T12534 |
nummod |
2,Tg |
| R8116 |
T12534 |
T12529 |
compound |
Tg,mouse |
| R8117 |
T12536 |
T12535 |
auxpass |
was,reported |
| R8118 |
T12537 |
T12535 |
prep |
in,reported |
| R8119 |
T12538 |
T12537 |
pobj |
Ito,in |
| R812 |
T1699 |
T1698 |
amod |
associated,dynamics |
| R8120 |
T12539 |
T12540 |
advmod |
et,al. |
| R8121 |
T12540 |
T12538 |
advmod |
al.,Ito |
| R8122 |
T12541 |
T12538 |
punct |
", ",Ito |
| R8123 |
T12542 |
T12538 |
npadvmod |
2001,Ito |
| R8124 |
T12543 |
T12535 |
punct |
.,reported |
| R8125 |
T12545 |
T12546 |
det |
The,mouse |
| R8126 |
T12546 |
T12554 |
nsubjpass |
mouse,described |
| R8127 |
T12547 |
T12548 |
nmod |
TGF,β2 |
| R8128 |
T12548 |
T12546 |
nmod |
β2,mouse |
| R8129 |
T12549 |
T12548 |
punct |
-,β2 |
| R813 |
T1617 |
T1613 |
auxpass |
is,elevated |
| R8130 |
T12550 |
T12548 |
appos |
knockout,β2 |
| R8131 |
T12551 |
T12550 |
punct |
(,knockout |
| R8132 |
T12552 |
T12550 |
appos |
KO,knockout |
| R8133 |
T12553 |
T12546 |
punct |
),mouse |
| R8134 |
T12555 |
T12554 |
auxpass |
was,described |
| R8135 |
T12556 |
T12554 |
prep |
in,described |
| R8136 |
T12557 |
T12558 |
punct |
[,34 |
| R8137 |
T12558 |
T12556 |
pobj |
34,in |
| R8138 |
T12559 |
T12554 |
punct |
],described |
| R8139 |
T12560 |
T12554 |
punct |
.,described |
| R814 |
T1618 |
T1613 |
advmod |
transgenically,elevated |
| R8140 |
T12562 |
T12563 |
det |
The,mouse |
| R8141 |
T12563 |
T12566 |
nsubjpass |
mouse,reported |
| R8142 |
T12564 |
T12565 |
compound |
shh,KO |
| R8143 |
T12565 |
T12563 |
compound |
KO,mouse |
| R8144 |
T12567 |
T12568 |
punct |
[,38 |
| R8145 |
T12568 |
T12563 |
parataxis |
38,mouse |
| R8146 |
T12569 |
T12568 |
punct |
],38 |
| R8147 |
T12570 |
T12563 |
cc |
and,mouse |
| R8148 |
T12571 |
T12572 |
compound |
TOPGal,mouse |
| R8149 |
T12572 |
T12563 |
conj |
mouse,mouse |
| R815 |
T1700 |
T1698 |
compound |
actin,dynamics |
| R8150 |
T12573 |
T12574 |
punct |
[,20 |
| R8151 |
T12574 |
T12572 |
parataxis |
20,mouse |
| R8152 |
T12575 |
T12574 |
punct |
],20 |
| R8153 |
T12576 |
T12566 |
aux |
have,reported |
| R8154 |
T12577 |
T12566 |
advmod |
previously,reported |
| R8155 |
T12578 |
T12566 |
auxpass |
been,reported |
| R8156 |
T12579 |
T12566 |
punct |
.,reported |
| R8157 |
T12687 |
T12688 |
compound |
Western,blot |
| R8158 |
T12689 |
T12688 |
cc |
and,blot |
| R8159 |
T12690 |
T12688 |
conj |
immunoprecipitation,blot |
| R816 |
T1619 |
T1613 |
prep |
in,elevated |
| R8160 |
T12692 |
T12693 |
compound |
Protein,extracts |
| R8161 |
T12693 |
T12694 |
nsubjpass |
extracts,generated |
| R8162 |
T12695 |
T12693 |
prep |
from,extracts |
| R8163 |
T12696 |
T12697 |
amod |
primary,keratinocytes |
| R8164 |
T12697 |
T12695 |
pobj |
keratinocytes,from |
| R8165 |
T12698 |
T12694 |
auxpass |
were,generated |
| R8166 |
T12699 |
T12700 |
preconj |
either,by |
| R8167 |
T12700 |
T12694 |
prep |
by,generated |
| R8168 |
T12701 |
T12700 |
pcomp |
lysing,by |
| R8169 |
T12702 |
T12701 |
dobj |
cells,lysing |
| R817 |
T1620 |
T1621 |
compound |
mouse,skin |
| R8170 |
T12703 |
T12701 |
prep |
in,lysing |
| R8171 |
T12704 |
T12705 |
compound |
lysis,buffer |
| R8172 |
T12705 |
T12703 |
pobj |
buffer,in |
| R8173 |
T12706 |
T12707 |
punct |
(,NP |
| R8174 |
T12707 |
T12705 |
parataxis |
NP,buffer |
| R8175 |
T12708 |
T12709 |
nummod |
1,% |
| R8176 |
T12709 |
T12707 |
compound |
%,NP |
| R8177 |
T12710 |
T12707 |
punct |
-,NP |
| R8178 |
T12711 |
T12707 |
nummod |
40,NP |
| R8179 |
T12712 |
T12707 |
punct |
", ",NP |
| R818 |
T1621 |
T1619 |
pobj |
skin,in |
| R8180 |
T12713 |
T12714 |
nummod |
1,% |
| R8181 |
T12714 |
T12715 |
compound |
%,deoxycholate |
| R8182 |
T12715 |
T12707 |
conj |
deoxycholate,NP |
| R8183 |
T12716 |
T12715 |
compound |
sodium,deoxycholate |
| R8184 |
T12717 |
T12715 |
punct |
", ",deoxycholate |
| R8185 |
T12718 |
T12719 |
nummod |
20,mM |
| R8186 |
T12719 |
T12720 |
compound |
mM,Cl |
| R8187 |
T12720 |
T12715 |
conj |
Cl,deoxycholate |
| R8188 |
T12721 |
T12720 |
compound |
Tris,Cl |
| R8189 |
T12722 |
T12720 |
punct |
-,Cl |
| R819 |
T1701 |
T1698 |
compound |
polymerization,dynamics |
| R8190 |
T12723 |
T12720 |
punct |
[,Cl |
| R8191 |
T12724 |
T12720 |
npadvmod |
pH,Cl |
| R8192 |
T12725 |
T12724 |
nummod |
7.4,pH |
| R8193 |
T12726 |
T12720 |
punct |
],Cl |
| R8194 |
T12727 |
T12720 |
punct |
", ",Cl |
| R8195 |
T12728 |
T12729 |
nummod |
140,mM |
| R8196 |
T12729 |
T12730 |
compound |
mM,NaCl |
| R8197 |
T12730 |
T12720 |
conj |
NaCl,Cl |
| R8198 |
T12731 |
T12730 |
acl |
containing,NaCl |
| R8199 |
T12732 |
T12733 |
nummod |
1,mM |
| R820 |
T1622 |
T1611 |
punct |
", ",blocked |
| R8200 |
T12733 |
T12734 |
compound |
mM,vanadate |
| R8201 |
T12734 |
T12731 |
dobj |
vanadate,containing |
| R8202 |
T12735 |
T12734 |
compound |
sodium,vanadate |
| R8203 |
T12736 |
T12730 |
punct |
", ",NaCl |
| R8204 |
T12737 |
T12738 |
nummod |
2,mM |
| R8205 |
T12738 |
T12739 |
compound |
mM,fluoride |
| R8206 |
T12739 |
T12730 |
conj |
fluoride,NaCl |
| R8207 |
T12740 |
T12739 |
compound |
phenylmethylsulfonyl,fluoride |
| R8208 |
T12741 |
T12739 |
punct |
", ",fluoride |
| R8209 |
T12742 |
T12739 |
cc |
and,fluoride |
| R821 |
T1623 |
T1624 |
compound |
hair,follicle |
| R8210 |
T12743 |
T12744 |
compound |
protease,inhibitors |
| R8211 |
T12744 |
T12739 |
conj |
inhibitors,fluoride |
| R8212 |
T12745 |
T12707 |
punct |
),NP |
| R8213 |
T12746 |
T12703 |
cc |
or,in |
| R8214 |
T12747 |
T12748 |
advmod |
directly,in |
| R8215 |
T12748 |
T12703 |
conj |
in,in |
| R8216 |
T12749 |
T12750 |
compound |
Laemmli,bβuffer |
| R8217 |
T12750 |
T12748 |
pobj |
bβuffer,in |
| R8218 |
T12751 |
T12694 |
cc |
and,generated |
| R8219 |
T12752 |
T12694 |
conj |
boiled,generated |
| R822 |
T1624 |
T1625 |
compound |
follicle,morphogenesis |
| R8220 |
T12753 |
T12694 |
punct |
.,generated |
| R8221 |
T12755 |
T12756 |
prep |
For,pulverized |
| R8222 |
T12757 |
T12758 |
compound |
skin,tissue |
| R8223 |
T12758 |
T12755 |
pobj |
tissue,For |
| R8224 |
T12759 |
T12756 |
punct |
: ,pulverized |
| R8225 |
T12760 |
T12761 |
amod |
Frozen,tissue |
| R8226 |
T12761 |
T12756 |
nsubjpass |
tissue,pulverized |
| R8227 |
T12762 |
T12756 |
auxpass |
was,pulverized |
| R8228 |
T12763 |
T12756 |
prep |
in,pulverized |
| R8229 |
T12764 |
T12765 |
det |
a,Gevebesmascher |
| R823 |
T1702 |
T1698 |
amod |
necessary,dynamics |
| R8230 |
T12765 |
T12763 |
pobj |
Gevebesmascher,in |
| R8231 |
T12766 |
T12767 |
amod |
liquid,nitrogen |
| R8232 |
T12767 |
T12768 |
npadvmod |
nitrogen,cooled |
| R8233 |
T12768 |
T12765 |
amod |
cooled,Gevebesmascher |
| R8234 |
T12769 |
T12768 |
punct |
-,cooled |
| R8235 |
T12770 |
T12756 |
cc |
and,pulverized |
| R8236 |
T12771 |
T12772 |
det |
the,powder |
| R8237 |
T12772 |
T12773 |
nsubj |
powder,scraped |
| R8238 |
T12773 |
T12756 |
conj |
scraped,pulverized |
| R8239 |
T12774 |
T12773 |
prep |
into,scraped |
| R824 |
T1625 |
T1611 |
nsubjpass |
morphogenesis,blocked |
| R8240 |
T12775 |
T12776 |
det |
a,tube |
| R8241 |
T12776 |
T12774 |
pobj |
tube,into |
| R8242 |
T12777 |
T12776 |
amod |
chilled,tube |
| R8243 |
T12778 |
T12776 |
compound |
microcentrifuge,tube |
| R8244 |
T12779 |
T12756 |
punct |
.,pulverized |
| R8245 |
T12781 |
T12782 |
compound |
RIPA,buffer |
| R8246 |
T12782 |
T12783 |
nsubjpass |
buffer,added |
| R8247 |
T12784 |
T12785 |
punct |
(,X |
| R8248 |
T12785 |
T12782 |
parataxis |
X,buffer |
| R8249 |
T12786 |
T12787 |
nummod |
1,% |
| R825 |
T1626 |
T1611 |
auxpass |
is,blocked |
| R8250 |
T12787 |
T12785 |
compound |
%,X |
| R8251 |
T12788 |
T12785 |
compound |
Triton,X |
| R8252 |
T12789 |
T12785 |
punct |
-,X |
| R8253 |
T12790 |
T12785 |
nummod |
100,X |
| R8254 |
T12791 |
T12785 |
prep |
in,X |
| R8255 |
T12792 |
T12791 |
pobj |
PBS,in |
| R8256 |
T12793 |
T12785 |
prep |
with,X |
| R8257 |
T12794 |
T12795 |
nummod |
10,mM |
| R8258 |
T12795 |
T12796 |
compound |
mM,EDTA |
| R8259 |
T12796 |
T12793 |
pobj |
EDTA,with |
| R826 |
T1627 |
T1611 |
punct |
", ",blocked |
| R8260 |
T12797 |
T12796 |
punct |
", ",EDTA |
| R8261 |
T12798 |
T12799 |
nummod |
150,mN |
| R8262 |
T12799 |
T12800 |
compound |
mN,NaCl |
| R8263 |
T12800 |
T12796 |
conj |
NaCl,EDTA |
| R8264 |
T12801 |
T12800 |
punct |
", ",NaCl |
| R8265 |
T12802 |
T12803 |
nummod |
1,% |
| R8266 |
T12803 |
T12804 |
compound |
%,deoxycholate |
| R8267 |
T12804 |
T12800 |
conj |
deoxycholate,NaCl |
| R8268 |
T12805 |
T12804 |
compound |
sodium,deoxycholate |
| R8269 |
T12806 |
T12804 |
punct |
", ",deoxycholate |
| R827 |
T1703 |
T1704 |
aux |
to,stabilize |
| R8270 |
T12807 |
T12804 |
cc |
and,deoxycholate |
| R8271 |
T12808 |
T12809 |
nummod |
0.1,% |
| R8272 |
T12809 |
T12810 |
compound |
%,SDS |
| R8273 |
T12810 |
T12804 |
conj |
SDS,deoxycholate |
| R8274 |
T12811 |
T12785 |
punct |
),X |
| R8275 |
T12812 |
T12782 |
cc |
and,buffer |
| R8276 |
T12813 |
T12814 |
compound |
protease,inhibitors |
| R8277 |
T12814 |
T12782 |
conj |
inhibitors,buffer |
| R8278 |
T12815 |
T12814 |
cc |
or,inhibitors |
| R8279 |
T12816 |
T12817 |
compound |
Laemmli,buffer |
| R828 |
T1628 |
T1611 |
advcl |
suggesting,blocked |
| R8280 |
T12817 |
T12814 |
conj |
buffer,inhibitors |
| R8281 |
T12818 |
T12783 |
auxpass |
was,added |
| R8282 |
T12819 |
T12783 |
punct |
.,added |
| R8283 |
T12821 |
T12822 |
det |
The,suspension |
| R8284 |
T12822 |
T12824 |
nsubjpass |
suspension,sonicated |
| R8285 |
T12823 |
T12822 |
compound |
cell,suspension |
| R8286 |
T12825 |
T12824 |
auxpass |
was,sonicated |
| R8287 |
T12826 |
T12827 |
nummod |
three,times |
| R8288 |
T12827 |
T12824 |
npadvmod |
times,sonicated |
| R8289 |
T12828 |
T12824 |
prep |
for,sonicated |
| R829 |
T1629 |
T1630 |
mark |
that,is |
| R8290 |
T12829 |
T12830 |
nummod |
15,s |
| R8291 |
T12830 |
T12828 |
pobj |
s,for |
| R8292 |
T12831 |
T12824 |
cc |
and,sonicated |
| R8293 |
T12832 |
T12824 |
conj |
centrifuged,sonicated |
| R8294 |
T12833 |
T12832 |
prep |
at,centrifuged |
| R8295 |
T12834 |
T12835 |
nummod |
"14,000",rpm |
| R8296 |
T12835 |
T12833 |
pobj |
rpm,at |
| R8297 |
T12836 |
T12832 |
prep |
at,centrifuged |
| R8298 |
T12837 |
T12838 |
nummod |
4,°C |
| R8299 |
T12838 |
T12836 |
pobj |
°C,at |
| R830 |
T1630 |
T1628 |
ccomp |
is,suggesting |
| R8300 |
T12839 |
T12824 |
punct |
.,sonicated |
| R8301 |
T12841 |
T12842 |
det |
The,supernatant |
| R8302 |
T12842 |
T12843 |
nsubjpass |
supernatant,separated |
| R8303 |
T12844 |
T12843 |
auxpass |
was,separated |
| R8304 |
T12845 |
T12843 |
prep |
from,separated |
| R8305 |
T12846 |
T12847 |
det |
the,pellet |
| R8306 |
T12847 |
T12845 |
pobj |
pellet,from |
| R8307 |
T12848 |
T12843 |
cc |
and,separated |
| R8308 |
T12849 |
T12843 |
conj |
used,separated |
| R8309 |
T12850 |
T12849 |
prep |
in,used |
| R831 |
T1704 |
T1702 |
xcomp |
stabilize,necessary |
| R8310 |
T12851 |
T12852 |
det |
the,experiments |
| R8311 |
T12852 |
T12850 |
pobj |
experiments,in |
| R8312 |
T12853 |
T12843 |
punct |
.,separated |
| R8313 |
T12855 |
T12856 |
nsubjpass |
Extracts,precleared |
| R8314 |
T12857 |
T12855 |
acl |
subjected,Extracts |
| R8315 |
T12858 |
T12857 |
prep |
to,subjected |
| R8316 |
T12859 |
T12858 |
pobj |
immunoprecipitation,to |
| R8317 |
T12860 |
T12856 |
auxpass |
were,precleared |
| R8318 |
T12861 |
T12856 |
prep |
with,precleared |
| R8319 |
T12862 |
T12863 |
compound |
Protein,G |
| R832 |
T1631 |
T1632 |
nmod |
E,cadherin |
| R8320 |
T12863 |
T12864 |
compound |
G,Sepharose |
| R8321 |
T12864 |
T12861 |
pobj |
Sepharose,with |
| R8322 |
T12865 |
T12866 |
punct |
(,Amersham |
| R8323 |
T12866 |
T12864 |
parataxis |
Amersham,Sepharose |
| R8324 |
T12867 |
T12866 |
punct |
", ",Amersham |
| R8325 |
T12868 |
T12866 |
npadvmod |
Piscataway,Amersham |
| R8326 |
T12869 |
T12866 |
punct |
", ",Amersham |
| R8327 |
T12870 |
T12871 |
compound |
New,York |
| R8328 |
T12871 |
T12866 |
npadvmod |
York,Amersham |
| R8329 |
T12872 |
T12866 |
punct |
", ",Amersham |
| R833 |
T1632 |
T1634 |
nmod |
cadherin,regulation |
| R8330 |
T12873 |
T12874 |
compound |
United,States |
| R8331 |
T12874 |
T12866 |
npadvmod |
States,Amersham |
| R8332 |
T12875 |
T12866 |
punct |
),Amersham |
| R8333 |
T12876 |
T12856 |
cc |
and,precleared |
| R8334 |
T12877 |
T12856 |
conj |
incubated,precleared |
| R8335 |
T12878 |
T12877 |
prep |
with,incubated |
| R8336 |
T12879 |
T12878 |
pobj |
antibody,with |
| R8337 |
T12880 |
T12877 |
prep |
with,incubated |
| R8338 |
T12881 |
T12880 |
pobj |
rocking,with |
| R8339 |
T12882 |
T12877 |
advmod |
overnight,incubated |
| R834 |
T1705 |
T1706 |
amod |
nascent,AJs |
| R8340 |
T12883 |
T12877 |
prep |
at,incubated |
| R8341 |
T12884 |
T12885 |
nummod |
4,°C |
| R8342 |
T12885 |
T12883 |
pobj |
°C,at |
| R8343 |
T12886 |
T12856 |
punct |
.,precleared |
| R8344 |
T12888 |
T12889 |
compound |
Protein,G |
| R8345 |
T12889 |
T12890 |
compound |
G,Sepharose |
| R8346 |
T12890 |
T12891 |
nsubjpass |
Sepharose,added |
| R8347 |
T12892 |
T12891 |
auxpass |
was,added |
| R8348 |
T12893 |
T12891 |
cc |
and,added |
| R8349 |
T12894 |
T12895 |
nsubjpass |
samples,incubated |
| R835 |
T1633 |
T1632 |
punct |
-,cadherin |
| R8350 |
T12895 |
T12891 |
conj |
incubated,added |
| R8351 |
T12896 |
T12895 |
auxpass |
were,incubated |
| R8352 |
T12897 |
T12895 |
prep |
for,incubated |
| R8353 |
T12898 |
T12899 |
nummod |
1,h |
| R8354 |
T12899 |
T12897 |
pobj |
h,for |
| R8355 |
T12900 |
T12895 |
prep |
at,incubated |
| R8356 |
T12901 |
T12902 |
nummod |
4,°C |
| R8357 |
T12902 |
T12900 |
pobj |
°C,at |
| R8358 |
T12903 |
T12895 |
prep |
with,incubated |
| R8359 |
T12904 |
T12903 |
pobj |
rocking,with |
| R836 |
T1634 |
T1630 |
nsubj |
regulation,is |
| R8360 |
T12905 |
T12895 |
punct |
.,incubated |
| R8361 |
T12907 |
T12908 |
nsubjpass |
Samples,washed |
| R8362 |
T12909 |
T12908 |
auxpass |
were,washed |
| R8363 |
T12910 |
T12911 |
nummod |
three,times |
| R8364 |
T12911 |
T12908 |
npadvmod |
times,washed |
| R8365 |
T12912 |
T12908 |
prep |
for,washed |
| R8366 |
T12913 |
T12914 |
nummod |
5,min |
| R8367 |
T12914 |
T12912 |
pobj |
min,for |
| R8368 |
T12915 |
T12914 |
advmod |
each,min |
| R8369 |
T12916 |
T12908 |
prep |
in,washed |
| R837 |
T1635 |
T1634 |
amod |
down,regulation |
| R8370 |
T12917 |
T12918 |
compound |
lysis,buffer |
| R8371 |
T12918 |
T12916 |
pobj |
buffer,in |
| R8372 |
T12919 |
T12908 |
punct |
", ",washed |
| R8373 |
T12920 |
T12908 |
cc |
and,washed |
| R8374 |
T12921 |
T12922 |
det |
the,pellet |
| R8375 |
T12922 |
T12930 |
nsubjpass |
pellet,resuspended |
| R8376 |
T12923 |
T12924 |
compound |
Protein,G |
| R8377 |
T12924 |
T12925 |
compound |
G,antigen |
| R8378 |
T12925 |
T12922 |
compound |
antigen,pellet |
| R8379 |
T12926 |
T12925 |
compound |
Sepharose,antigen |
| R838 |
T1706 |
T1704 |
dobj |
AJs,stabilize |
| R8380 |
T12927 |
T12925 |
punct |
-,antigen |
| R8381 |
T12928 |
T12925 |
compound |
antibody,antigen |
| R8382 |
T12929 |
T12925 |
punct |
-,antigen |
| R8383 |
T12930 |
T12908 |
conj |
resuspended,washed |
| R8384 |
T12931 |
T12930 |
auxpass |
was,resuspended |
| R8385 |
T12932 |
T12930 |
prep |
in,resuspended |
| R8386 |
T12933 |
T12934 |
compound |
Laemmli,buffer |
| R8387 |
T12934 |
T12932 |
pobj |
buffer,in |
| R8388 |
T12935 |
T12930 |
cc |
and,resuspended |
| R8389 |
T12936 |
T12930 |
conj |
boiled,resuspended |
| R839 |
T1636 |
T1634 |
punct |
-,regulation |
| R8390 |
T12937 |
T12936 |
prep |
for,boiled |
| R8391 |
T12938 |
T12939 |
nummod |
10,min |
| R8392 |
T12939 |
T12937 |
pobj |
min,for |
| R8393 |
T12940 |
T12930 |
punct |
.,resuspended |
| R8394 |
T12942 |
T12943 |
nsubjpass |
Samples,run |
| R8395 |
T12944 |
T12943 |
auxpass |
were,run |
| R8396 |
T12945 |
T12943 |
prep |
on,run |
| R8397 |
T12946 |
T12947 |
compound |
SDS,PAGE |
| R8398 |
T12947 |
T12945 |
pobj |
PAGE,on |
| R8399 |
T12948 |
T12947 |
punct |
-,PAGE |
| R840 |
T1637 |
T1638 |
det |
a,event |
| R8400 |
T12949 |
T12943 |
cc |
and,run |
| R8401 |
T12950 |
T12943 |
conj |
transferred,run |
| R8402 |
T12951 |
T12950 |
prep |
to,transferred |
| R8403 |
T12952 |
T12953 |
compound |
nitrocellulose,membrane |
| R8404 |
T12953 |
T12951 |
pobj |
membrane,to |
| R8405 |
T12954 |
T12955 |
punct |
(,Bioscience |
| R8406 |
T12955 |
T12953 |
parataxis |
Bioscience,membrane |
| R8407 |
T12956 |
T12955 |
nmod |
Schleicher,Bioscience |
| R8408 |
T12957 |
T12956 |
cc |
and,Schleicher |
| R8409 |
T12958 |
T12956 |
conj |
Schuell,Schleicher |
| R841 |
T1638 |
T1630 |
attr |
event,is |
| R8410 |
T12959 |
T12955 |
punct |
", ",Bioscience |
| R8411 |
T12960 |
T12955 |
npadvmod |
Keene,Bioscience |
| R8412 |
T12961 |
T12955 |
punct |
", ",Bioscience |
| R8413 |
T12962 |
T12963 |
compound |
New,Hampshire |
| R8414 |
T12963 |
T12955 |
npadvmod |
Hampshire,Bioscience |
| R8415 |
T12964 |
T12955 |
punct |
", ",Bioscience |
| R8416 |
T12965 |
T12966 |
compound |
United,States |
| R8417 |
T12966 |
T12955 |
npadvmod |
States,Bioscience |
| R8418 |
T12967 |
T12955 |
punct |
),Bioscience |
| R8419 |
T12968 |
T12943 |
punct |
.,run |
| R842 |
T1639 |
T1638 |
amod |
critical,event |
| R8420 |
T12970 |
T12971 |
compound |
Western,blot |
| R8421 |
T12971 |
T12972 |
compound |
blot,signals |
| R8422 |
T12972 |
T12973 |
nsubjpass |
signals,developed |
| R8423 |
T12974 |
T12973 |
auxpass |
were,developed |
| R8424 |
T12975 |
T12973 |
advcl |
using,developed |
| R8425 |
T12976 |
T12977 |
det |
the,kit |
| R8426 |
T12977 |
T12975 |
dobj |
kit,using |
| R8427 |
T12978 |
T12977 |
amod |
enhanced,kit |
| R8428 |
T12979 |
T12977 |
compound |
chemiluminescence,kit |
| R8429 |
T12980 |
T12977 |
prep |
from,kit |
| R843 |
T1640 |
T1638 |
prep |
in,event |
| R8430 |
T12981 |
T12980 |
pobj |
Amersham,from |
| R8431 |
T13041 |
T13042 |
compound |
Cell,culture |
| R8432 |
T13044 |
T13045 |
amod |
Primary,keratinocytes |
| R8433 |
T13045 |
T13046 |
nsubjpass |
keratinocytes,culture |
| R8434 |
T13047 |
T13046 |
auxpass |
were,culture |
| R8435 |
T13048 |
T13046 |
prep |
in,culture |
| R8436 |
T13049 |
T13050 |
amod |
low,calcium |
| R8437 |
T13050 |
T13052 |
compound |
calcium,medium |
| R8438 |
T13051 |
T13050 |
punct |
-,calcium |
| R8439 |
T13052 |
T13048 |
pobj |
medium,in |
| R844 |
T1707 |
T1704 |
cc |
and,stabilize |
| R8440 |
T13053 |
T13054 |
mark |
as,described |
| R8441 |
T13054 |
T13046 |
advcl |
described,culture |
| R8442 |
T13055 |
T13054 |
advmod |
previously,described |
| R8443 |
T13056 |
T13057 |
punct |
[,4 |
| R8444 |
T13057 |
T13046 |
parataxis |
4,culture |
| R8445 |
T13058 |
T13057 |
punct |
],4 |
| R8446 |
T13059 |
T13046 |
punct |
.,culture |
| R8447 |
T13061 |
T13062 |
amod |
Transient,transfections |
| R8448 |
T13062 |
T13063 |
nsubjpass |
transfections,carried |
| R8449 |
T13064 |
T13063 |
auxpass |
were,carried |
| R845 |
T1708 |
T1704 |
conj |
integrate,stabilize |
| R8450 |
T13065 |
T13063 |
prt |
out,carried |
| R8451 |
T13066 |
T13063 |
prep |
with,carried |
| R8452 |
T13067 |
T13068 |
compound |
FuGENE6,reagent |
| R8453 |
T13068 |
T13066 |
pobj |
reagent,with |
| R8454 |
T13069 |
T13070 |
punct |
(,Roche |
| R8455 |
T13070 |
T13068 |
parataxis |
Roche,reagent |
| R8456 |
T13071 |
T13070 |
punct |
", ",Roche |
| R8457 |
T13072 |
T13070 |
npadvmod |
Indianapolis,Roche |
| R8458 |
T13073 |
T13070 |
punct |
", ",Roche |
| R8459 |
T13074 |
T13070 |
npadvmod |
Indiana,Roche |
| R846 |
T1641 |
T1640 |
pcomp |
governing,in |
| R8460 |
T13075 |
T13070 |
punct |
", ",Roche |
| R8461 |
T13076 |
T13077 |
compound |
United,States |
| R8462 |
T13077 |
T13070 |
npadvmod |
States,Roche |
| R8463 |
T13078 |
T13070 |
punct |
),Roche |
| R8464 |
T13079 |
T13063 |
prep |
according,carried |
| R8465 |
T13080 |
T13079 |
prep |
to,according |
| R8466 |
T13081 |
T13082 |
det |
the,manufacturer |
| R8467 |
T13082 |
T13083 |
poss |
manufacturer,protocol |
| R8468 |
T13083 |
T13080 |
pobj |
protocol,to |
| R8469 |
T13084 |
T13082 |
case |
's,manufacturer |
| R847 |
T1709 |
T1710 |
det |
the,cytoskeleton |
| R8470 |
T13085 |
T13063 |
punct |
.,carried |
| R8471 |
T13087 |
T13088 |
nsubjpass |
Measurement,carried |
| R8472 |
T13089 |
T13087 |
prep |
of,Measurement |
| R8473 |
T13090 |
T13091 |
nmod |
β,galactosidase |
| R8474 |
T13091 |
T13093 |
nmod |
galactosidase,levels |
| R8475 |
T13092 |
T13091 |
punct |
-,galactosidase |
| R8476 |
T13093 |
T13089 |
pobj |
levels,of |
| R8477 |
T13094 |
T13091 |
cc |
or,galactosidase |
| R8478 |
T13095 |
T13091 |
conj |
luciferase,galactosidase |
| R8479 |
T13096 |
T13088 |
prep |
in,carried |
| R848 |
T1642 |
T1643 |
det |
the,dynamics |
| R8480 |
T13097 |
T13098 |
compound |
promoter,activity |
| R8481 |
T13098 |
T13099 |
compound |
activity,studies |
| R8482 |
T13099 |
T13096 |
pobj |
studies,in |
| R8483 |
T13100 |
T13088 |
auxpass |
were,carried |
| R8484 |
T13101 |
T13088 |
prt |
out,carried |
| R8485 |
T13102 |
T13088 |
prep |
with,carried |
| R8486 |
T13103 |
T13104 |
det |
the,kit |
| R8487 |
T13104 |
T13102 |
pobj |
kit,with |
| R8488 |
T13105 |
T13106 |
compound |
Galacto,Lite |
| R8489 |
T13106 |
T13104 |
compound |
Lite,kit |
| R849 |
T1643 |
T1641 |
dobj |
dynamics,governing |
| R8490 |
T13107 |
T13106 |
punct |
-,Lite |
| R8491 |
T13108 |
T13104 |
compound |
assay,kit |
| R8492 |
T13109 |
T13110 |
punct |
(,TROPIX |
| R8493 |
T13110 |
T13104 |
parataxis |
TROPIX,kit |
| R8494 |
T13111 |
T13110 |
punct |
", ",TROPIX |
| R8495 |
T13112 |
T13110 |
npadvmod |
Bedford,TROPIX |
| R8496 |
T13113 |
T13110 |
punct |
", ",TROPIX |
| R8497 |
T13114 |
T13110 |
npadvmod |
Massachusetts,TROPIX |
| R8498 |
T13115 |
T13110 |
punct |
", ",TROPIX |
| R8499 |
T13116 |
T13117 |
compound |
United,States |
| R850 |
T1644 |
T1643 |
compound |
adhesion,dynamics |
| R8500 |
T13117 |
T13110 |
npadvmod |
States,TROPIX |
| R8501 |
T13118 |
T13110 |
punct |
),TROPIX |
| R8502 |
T13119 |
T13104 |
cc |
and,kit |
| R8503 |
T13120 |
T13121 |
det |
the,luciferase |
| R8504 |
T13121 |
T13104 |
conj |
luciferase,kit |
| R8505 |
T13122 |
T13121 |
amod |
Dual,luciferase |
| R8506 |
T13123 |
T13124 |
punct |
(,Promega |
| R8507 |
T13124 |
T13121 |
parataxis |
Promega,luciferase |
| R8508 |
T13125 |
T13124 |
punct |
", ",Promega |
| R8509 |
T13126 |
T13124 |
npadvmod |
Madison,Promega |
| R851 |
T1710 |
T1708 |
dobj |
cytoskeleton,integrate |
| R8510 |
T13127 |
T13124 |
punct |
", ",Promega |
| R8511 |
T13128 |
T13124 |
npadvmod |
Wisconsin,Promega |
| R8512 |
T13129 |
T13124 |
punct |
", ",Promega |
| R8513 |
T13130 |
T13131 |
compound |
United,States |
| R8514 |
T13131 |
T13124 |
npadvmod |
States,Promega |
| R8515 |
T13132 |
T13124 |
punct |
),Promega |
| R8516 |
T13133 |
T13121 |
punct |
", ",luciferase |
| R8517 |
T13134 |
T13088 |
advmod |
respectively,carried |
| R8518 |
T13135 |
T13088 |
punct |
.,carried |
| R8519 |
T13137 |
T13138 |
compound |
Runella,luciferase |
| R852 |
T1645 |
T1643 |
amod |
necessary,dynamics |
| R8520 |
T13138 |
T13139 |
nsubjpass |
luciferase,cotransfected |
| R8521 |
T13140 |
T13139 |
auxpass |
was,cotransfected |
| R8522 |
T13141 |
T13139 |
prep |
into,cotransfected |
| R8523 |
T13142 |
T13141 |
pobj |
cells,into |
| R8524 |
T13143 |
T13144 |
aux |
to,correct |
| R8525 |
T13144 |
T13139 |
advcl |
correct,cotransfected |
| R8526 |
T13145 |
T13144 |
prep |
for,correct |
| R8527 |
T13146 |
T13147 |
compound |
transfection,efficiency |
| R8528 |
T13147 |
T13145 |
pobj |
efficiency,for |
| R8529 |
T13148 |
T13139 |
punct |
.,cotransfected |
| R853 |
T1646 |
T1645 |
prep |
for,necessary |
| R8530 |
T13150 |
T13151 |
nsubjpass |
Experiments,done |
| R8531 |
T13152 |
T13151 |
auxpass |
were,done |
| R8532 |
T13153 |
T13151 |
prep |
in,done |
| R8533 |
T13154 |
T13153 |
pobj |
triplicate,in |
| R8534 |
T13155 |
T13151 |
cc |
and,done |
| R8535 |
T13156 |
T13151 |
conj |
repeated,done |
| R8536 |
T13157 |
T13158 |
advmod |
at,three |
| R8537 |
T13158 |
T13160 |
nummod |
three,times |
| R8538 |
T13159 |
T13158 |
advmod |
least,three |
| R8539 |
T13160 |
T13156 |
npadvmod |
times,repeated |
| R854 |
T1647 |
T1648 |
compound |
budding,morphogenesis |
| R8540 |
T13161 |
T13151 |
punct |
.,done |
| R8541 |
T13163 |
T13164 |
nsubjpass |
Measurements,done |
| R8542 |
T13165 |
T13164 |
auxpass |
were,done |
| R8543 |
T13166 |
T13164 |
prep |
on,done |
| R8544 |
T13167 |
T13168 |
det |
a,luminometer |
| R8545 |
T13168 |
T13166 |
pobj |
luminometer,on |
| R8546 |
T13169 |
T13170 |
punct |
(,Instruments |
| R8547 |
T13170 |
T13168 |
parataxis |
Instruments,luminometer |
| R8548 |
T13171 |
T13170 |
compound |
MGM,Instruments |
| R8549 |
T13172 |
T13170 |
punct |
", ",Instruments |
| R855 |
T1711 |
T1708 |
prep |
across,integrate |
| R8550 |
T13173 |
T13170 |
npadvmod |
Hamden,Instruments |
| R8551 |
T13174 |
T13170 |
punct |
", ",Instruments |
| R8552 |
T13175 |
T13170 |
npadvmod |
Connecticut,Instruments |
| R8553 |
T13176 |
T13170 |
punct |
", ",Instruments |
| R8554 |
T13177 |
T13178 |
compound |
United,States |
| R8555 |
T13178 |
T13170 |
npadvmod |
States,Instruments |
| R8556 |
T13179 |
T13170 |
punct |
),Instruments |
| R8557 |
T13180 |
T13164 |
punct |
.,done |
| R8558 |
T13182 |
T13183 |
prep |
For,starved |
| R8559 |
T13184 |
T13182 |
pobj |
experiments,For |
| R856 |
T1648 |
T1646 |
pobj |
morphogenesis,for |
| R8560 |
T13185 |
T13184 |
acl |
measuring,experiments |
| R8561 |
T13186 |
T13185 |
dobj |
phosphorylation,measuring |
| R8562 |
T13187 |
T13186 |
prep |
of,phosphorylation |
| R8563 |
T13188 |
T13187 |
pobj |
MAPK,of |
| R8564 |
T13189 |
T13183 |
punct |
", ",starved |
| R8565 |
T13190 |
T13183 |
nsubjpass |
keratinocytes,starved |
| R8566 |
T13191 |
T13183 |
auxpass |
were,starved |
| R8567 |
T13192 |
T13183 |
dep |
serum,starved |
| R8568 |
T13193 |
T13183 |
prep |
for,starved |
| R8569 |
T13194 |
T13195 |
nummod |
3,h |
| R857 |
T1649 |
T1650 |
punct |
[,4 |
| R8570 |
T13195 |
T13193 |
pobj |
h,for |
| R8571 |
T13196 |
T13197 |
amod |
prior,to |
| R8572 |
T13197 |
T13183 |
prep |
to,starved |
| R8573 |
T13198 |
T13197 |
pobj |
harvesting,to |
| R8574 |
T13199 |
T13198 |
prep |
of,harvesting |
| R8575 |
T13200 |
T13199 |
pobj |
cells,of |
| R8576 |
T13201 |
T13198 |
prep |
by,harvesting |
| R8577 |
T13202 |
T13201 |
pobj |
incubation,by |
| R8578 |
T13203 |
T13202 |
prep |
in,incubation |
| R8579 |
T13204 |
T13203 |
pobj |
medium,in |
| R858 |
T1712 |
T1713 |
det |
an,sheet |
| R8580 |
T13205 |
T13204 |
acl |
lacking,medium |
| R8581 |
T13206 |
T13205 |
dobj |
serum,lacking |
| R8582 |
T13207 |
T13183 |
punct |
.,starved |
| R8583 |
T13209 |
T13210 |
nsubjpass |
Treatment,described |
| R8584 |
T13211 |
T13209 |
prep |
of,Treatment |
| R8585 |
T13212 |
T13211 |
pobj |
cells,of |
| R8586 |
T13213 |
T13209 |
prep |
with,Treatment |
| R8587 |
T13214 |
T13215 |
npadvmod |
Wnt,conditioned |
| R8588 |
T13215 |
T13220 |
amod |
conditioned,medium |
| R8589 |
T13216 |
T13214 |
punct |
-,Wnt |
| R859 |
T1650 |
T1608 |
parataxis |
4,showed |
| R8590 |
T13217 |
T13214 |
cc |
and,Wnt |
| R8591 |
T13218 |
T13214 |
conj |
noggin,Wnt |
| R8592 |
T13219 |
T13215 |
punct |
-,conditioned |
| R8593 |
T13220 |
T13213 |
pobj |
medium,with |
| R8594 |
T13221 |
T13210 |
auxpass |
was,described |
| R8595 |
T13222 |
T13210 |
advmod |
previously,described |
| R8596 |
T13223 |
T13224 |
punct |
[,4 |
| R8597 |
T13224 |
T13210 |
parataxis |
4,described |
| R8598 |
T13225 |
T13224 |
punct |
],4 |
| R8599 |
T13226 |
T13210 |
punct |
.,described |
| R860 |
T1651 |
T1650 |
punct |
],4 |
| R8600 |
T13310 |
T13311 |
det |
The,promoter |
| R8601 |
T13311 |
T13317 |
nsubjpass |
promoter,generated |
| R8602 |
T13312 |
T13313 |
nummod |
2.2,kb |
| R8603 |
T13313 |
T13311 |
nmod |
kb,promoter |
| R8604 |
T13314 |
T13313 |
punct |
-,kb |
| R8605 |
T13315 |
T13311 |
amod |
murine,promoter |
| R8606 |
T13316 |
T13311 |
compound |
Snail,promoter |
| R8607 |
T13318 |
T13317 |
auxpass |
was,generated |
| R8608 |
T13319 |
T13317 |
prep |
by,generated |
| R8609 |
T13320 |
T13319 |
pobj |
PCR,by |
| R861 |
T1652 |
T1608 |
punct |
.,showed |
| R8610 |
T13321 |
T13317 |
advcl |
using,generated |
| R8611 |
T13322 |
T13323 |
det |
a,primer |
| R8612 |
T13323 |
T13321 |
dobj |
primer,using |
| R8613 |
T13324 |
T13323 |
amod |
forward,primer |
| R8614 |
T13325 |
T13321 |
prep |
with,using |
| R8615 |
T13326 |
T13327 |
det |
an,sequence |
| R8616 |
T13327 |
T13325 |
pobj |
sequence,with |
| R8617 |
T13328 |
T13327 |
compound |
XbaI,sequence |
| R8618 |
T13329 |
T13327 |
compound |
linker,sequence |
| R8619 |
T13330 |
T13327 |
punct |
", ",sequence |
| R862 |
T1713 |
T1711 |
pobj |
sheet,across |
| R8620 |
T13331 |
T13332 |
nummod |
5,TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
| R8621 |
T13332 |
T13327 |
appos |
TCTAGAATTGTTTGCTGCTGTATGGTCTTC,sequence |
| R8622 |
T13333 |
T13331 |
punct |
′,5 |
| R8623 |
T13334 |
T13332 |
punct |
-,TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
| R8624 |
T13335 |
T13332 |
punct |
-,TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
| R8625 |
T13336 |
T13332 |
nummod |
3,TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
| R8626 |
T13337 |
T13332 |
punct |
′,TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
| R8627 |
T13338 |
T13327 |
punct |
", ",sequence |
| R8628 |
T13339 |
T13327 |
cc |
along,sequence |
| R8629 |
T13340 |
T13339 |
dep |
with,along |
| R863 |
T1654 |
T1655 |
prep |
Like,binds |
| R8630 |
T13341 |
T13342 |
det |
a,primer |
| R8631 |
T13342 |
T13327 |
conj |
primer,sequence |
| R8632 |
T13343 |
T13342 |
amod |
reverse,primer |
| R8633 |
T13344 |
T13342 |
prep |
with,primer |
| R8634 |
T13345 |
T13346 |
det |
a,sequence |
| R8635 |
T13346 |
T13344 |
pobj |
sequence,with |
| R8636 |
T13347 |
T13346 |
compound |
BglII,sequence |
| R8637 |
T13348 |
T13346 |
compound |
linker,sequence |
| R8638 |
T13349 |
T13346 |
punct |
", ",sequence |
| R8639 |
T13350 |
T13351 |
nummod |
5,GTAG |
| R864 |
T1714 |
T1713 |
amod |
epithelial,sheet |
| R8640 |
T13351 |
T13346 |
appos |
GTAG,sequence |
| R8641 |
T13352 |
T13350 |
punct |
′,5 |
| R8642 |
T13353 |
T13351 |
punct |
-,GTAG |
| R8643 |
T13354 |
T13351 |
compound |
AGATCTGTTGGCCAGAGCGACCTAG,GTAG |
| R8644 |
T13355 |
T13351 |
punct |
-,GTAG |
| R8645 |
T13356 |
T13351 |
punct |
-,GTAG |
| R8646 |
T13357 |
T13351 |
nummod |
3,GTAG |
| R8647 |
T13358 |
T13351 |
punct |
′,GTAG |
| R8648 |
T13359 |
T13342 |
punct |
", ",primer |
| R8649 |
T13360 |
T13342 |
cc |
and,primer |
| R865 |
T1656 |
T1654 |
pobj |
LEF,Like |
| R8650 |
T13361 |
T13362 |
nmod |
mouse,DNA |
| R8651 |
T13362 |
T13342 |
conj |
DNA,primer |
| R8652 |
T13363 |
T13362 |
amod |
genomic,DNA |
| R8653 |
T13364 |
T13362 |
prep |
as,DNA |
| R8654 |
T13365 |
T13366 |
det |
a,template |
| R8655 |
T13366 |
T13364 |
pobj |
template,as |
| R8656 |
T13367 |
T13317 |
punct |
.,generated |
| R8657 |
T13369 |
T13370 |
det |
The,product |
| R8658 |
T13370 |
T13372 |
nsubjpass |
product,purified |
| R8659 |
T13371 |
T13370 |
compound |
PCR,product |
| R866 |
T1657 |
T1656 |
punct |
-,LEF |
| R8660 |
T13373 |
T13372 |
auxpass |
was,purified |
| R8661 |
T13374 |
T13372 |
prep |
with,purified |
| R8662 |
T13375 |
T13376 |
det |
the,Kit |
| R8663 |
T13376 |
T13374 |
pobj |
Kit,with |
| R8664 |
T13377 |
T13378 |
compound |
Gel,Extraction |
| R8665 |
T13378 |
T13376 |
compound |
Extraction,Kit |
| R8666 |
T13379 |
T13380 |
punct |
(,Qiagen |
| R8667 |
T13380 |
T13376 |
parataxis |
Qiagen,Kit |
| R8668 |
T13381 |
T13380 |
punct |
", ",Qiagen |
| R8669 |
T13382 |
T13380 |
npadvmod |
Valencia,Qiagen |
| R867 |
T1715 |
T1716 |
punct |
[,8 |
| R8670 |
T13383 |
T13380 |
punct |
", ",Qiagen |
| R8671 |
T13384 |
T13380 |
npadvmod |
California,Qiagen |
| R8672 |
T13385 |
T13380 |
punct |
", ",Qiagen |
| R8673 |
T13386 |
T13387 |
compound |
United,States |
| R8674 |
T13387 |
T13380 |
npadvmod |
States,Qiagen |
| R8675 |
T13388 |
T13380 |
punct |
),Qiagen |
| R8676 |
T13389 |
T13372 |
cc |
and,purified |
| R8677 |
T13390 |
T13372 |
conj |
ligated,purified |
| R8678 |
T13391 |
T13390 |
prep |
into,ligated |
| R8679 |
T13392 |
T13393 |
compound |
pCRII,TOPO |
| R868 |
T1658 |
T1656 |
nummod |
1,LEF |
| R8680 |
T13393 |
T13395 |
compound |
TOPO,vector |
| R8681 |
T13394 |
T13393 |
punct |
-,TOPO |
| R8682 |
T13395 |
T13391 |
pobj |
vector,into |
| R8683 |
T13396 |
T13395 |
compound |
TA,vector |
| R8684 |
T13397 |
T13398 |
punct |
(,Invitrogen |
| R8685 |
T13398 |
T13395 |
parataxis |
Invitrogen,vector |
| R8686 |
T13399 |
T13398 |
punct |
", ",Invitrogen |
| R8687 |
T13400 |
T13398 |
npadvmod |
Carlsbad,Invitrogen |
| R8688 |
T13401 |
T13398 |
punct |
", ",Invitrogen |
| R8689 |
T13402 |
T13398 |
npadvmod |
California,Invitrogen |
| R869 |
T1659 |
T1655 |
punct |
", ",binds |
| R8690 |
T13403 |
T13398 |
punct |
", ",Invitrogen |
| R8691 |
T13404 |
T13405 |
compound |
United,States |
| R8692 |
T13405 |
T13398 |
npadvmod |
States,Invitrogen |
| R8693 |
T13406 |
T13398 |
punct |
),Invitrogen |
| R8694 |
T13407 |
T13372 |
punct |
.,purified |
| R8695 |
T13409 |
T13410 |
det |
The,promoter |
| R8696 |
T13410 |
T13411 |
nsubjpass |
promoter,verified |
| R8697 |
T13412 |
T13411 |
auxpass |
was,verified |
| R8698 |
T13413 |
T13411 |
prep |
by,verified |
| R8699 |
T13414 |
T13413 |
pobj |
sequencing,by |
| R870 |
T1660 |
T1661 |
compound |
E,cadherin |
| R8700 |
T13415 |
T13411 |
cc |
and,verified |
| R8701 |
T13416 |
T13411 |
conj |
digested,verified |
| R8702 |
T13417 |
T13416 |
prep |
with,digested |
| R8703 |
T13418 |
T13417 |
pobj |
XbaI,with |
| R8704 |
T13419 |
T13418 |
cc |
and,XbaI |
| R8705 |
T13420 |
T13418 |
conj |
BglII,XbaI |
| R8706 |
T13421 |
T13416 |
cc |
and,digested |
| R8707 |
T13422 |
T13416 |
conj |
subcloned,digested |
| R8708 |
T13423 |
T13422 |
prep |
into,subcloned |
| R8709 |
T13424 |
T13425 |
det |
the,vector |
| R871 |
T1661 |
T1655 |
nsubj |
cadherin,binds |
| R8710 |
T13425 |
T13423 |
pobj |
vector,into |
| R8711 |
T13426 |
T13427 |
compound |
pβ,gal |
| R8712 |
T13427 |
T13425 |
compound |
gal,vector |
| R8713 |
T13428 |
T13427 |
punct |
-,gal |
| R8714 |
T13429 |
T13425 |
compound |
BASIC,vector |
| R8715 |
T13430 |
T13431 |
punct |
(,Clontech |
| R8716 |
T13431 |
T13425 |
parataxis |
Clontech,vector |
| R8717 |
T13432 |
T13431 |
compound |
BD,Clontech |
| R8718 |
T13433 |
T13431 |
compound |
Biosciences,Clontech |
| R8719 |
T13434 |
T13431 |
punct |
", ",Clontech |
| R872 |
T1716 |
T1694 |
parataxis |
8,coordinates |
| R8720 |
T13435 |
T13436 |
compound |
Palo,Alto |
| R8721 |
T13436 |
T13431 |
npadvmod |
Alto,Clontech |
| R8722 |
T13437 |
T13431 |
punct |
", ",Clontech |
| R8723 |
T13438 |
T13431 |
npadvmod |
California,Clontech |
| R8724 |
T13439 |
T13431 |
punct |
", ",Clontech |
| R8725 |
T13440 |
T13441 |
compound |
United,States |
| R8726 |
T13441 |
T13431 |
npadvmod |
States,Clontech |
| R8727 |
T13442 |
T13431 |
punct |
),Clontech |
| R8728 |
T13443 |
T13411 |
punct |
.,verified |
| R8729 |
T13445 |
T13446 |
det |
The,mutations |
| R873 |
T1662 |
T1661 |
punct |
-,cadherin |
| R8730 |
T13446 |
T13448 |
nsubjpass |
mutations,generated |
| R8731 |
T13447 |
T13446 |
compound |
point,mutations |
| R8732 |
T13449 |
T13446 |
prep |
in,mutations |
| R8733 |
T13450 |
T13451 |
det |
the,element |
| R8734 |
T13451 |
T13449 |
pobj |
element,in |
| R8735 |
T13452 |
T13451 |
compound |
SMAD,element |
| R8736 |
T13453 |
T13451 |
compound |
binding,element |
| R8737 |
T13454 |
T13448 |
auxpass |
was,generated |
| R8738 |
T13455 |
T13448 |
prep |
with,generated |
| R8739 |
T13456 |
T13457 |
det |
the,Kit |
| R874 |
T1663 |
T1655 |
advmod |
also,binds |
| R8740 |
T13457 |
T13455 |
pobj |
Kit,with |
| R8741 |
T13458 |
T13459 |
compound |
Quik,Change |
| R8742 |
T13459 |
T13457 |
compound |
Change,Kit |
| R8743 |
T13460 |
T13459 |
punct |
-,Change |
| R8744 |
T13461 |
T13462 |
punct |
(,Stratagene |
| R8745 |
T13462 |
T13457 |
parataxis |
Stratagene,Kit |
| R8746 |
T13463 |
T13462 |
punct |
", ",Stratagene |
| R8747 |
T13464 |
T13465 |
compound |
La,Jolla |
| R8748 |
T13465 |
T13462 |
npadvmod |
Jolla,Stratagene |
| R8749 |
T13466 |
T13462 |
punct |
", ",Stratagene |
| R875 |
T1717 |
T1716 |
nummod |
6,8 |
| R8750 |
T13467 |
T13462 |
npadvmod |
California,Stratagene |
| R8751 |
T13468 |
T13462 |
punct |
", ",Stratagene |
| R8752 |
T13469 |
T13470 |
compound |
United,States |
| R8753 |
T13470 |
T13462 |
npadvmod |
States,Stratagene |
| R8754 |
T13471 |
T13462 |
punct |
),Stratagene |
| R8755 |
T13472 |
T13448 |
advcl |
using,generated |
| R8756 |
T13473 |
T13474 |
det |
the,primer |
| R8757 |
T13474 |
T13472 |
dobj |
primer,using |
| R8758 |
T13475 |
T13474 |
amod |
forward,primer |
| R8759 |
T13476 |
T13477 |
nummod |
5,GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
| R876 |
T1664 |
T1655 |
prep |
to,binds |
| R8760 |
T13477 |
T13474 |
appos |
GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC,primer |
| R8761 |
T13478 |
T13476 |
punct |
′,5 |
| R8762 |
T13479 |
T13477 |
punct |
-,GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
| R8763 |
T13480 |
T13477 |
punct |
-,GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
| R8764 |
T13481 |
T13477 |
nummod |
3,GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
| R8765 |
T13482 |
T13477 |
punct |
′,GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
| R8766 |
T13483 |
T13474 |
cc |
and,primer |
| R8767 |
T13484 |
T13485 |
det |
the,primer |
| R8768 |
T13485 |
T13474 |
conj |
primer,primer |
| R8769 |
T13486 |
T13485 |
amod |
reverse,primer |
| R877 |
T1665 |
T1666 |
compound |
β,catenin |
| R8770 |
T13487 |
T13488 |
nummod |
5,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
| R8771 |
T13488 |
T13485 |
appos |
CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC,primer |
| R8772 |
T13489 |
T13487 |
punct |
′,5 |
| R8773 |
T13490 |
T13488 |
punct |
-,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
| R8774 |
T13491 |
T13488 |
compound |
GCTTTT,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
| R8775 |
T13492 |
T13488 |
punct |
-,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
| R8776 |
T13493 |
T13488 |
punct |
-,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
| R8777 |
T13494 |
T13488 |
nummod |
3,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
| R8778 |
T13495 |
T13488 |
punct |
′,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
| R8779 |
T13496 |
T13448 |
punct |
.,generated |
| R878 |
T1666 |
T1664 |
pobj |
catenin,to |
| R8780 |
T13498 |
T13499 |
det |
The,probes |
| R8781 |
T13499 |
T13500 |
nsubjpass |
probes,generated |
| R8782 |
T13501 |
T13499 |
prep |
for,probes |
| R8783 |
T13502 |
T13503 |
det |
the,hybridization |
| R8784 |
T13503 |
T13501 |
pobj |
hybridization,for |
| R8785 |
T13504 |
T13503 |
nmod |
Snail,hybridization |
| R8786 |
T13505 |
T13506 |
advmod |
in,situ |
| R8787 |
T13506 |
T13503 |
amod |
situ,hybridization |
| R8788 |
T13507 |
T13500 |
auxpass |
were,generated |
| R8789 |
T13508 |
T13500 |
prep |
against,generated |
| R879 |
T1718 |
T1716 |
punct |
",",8 |
| R8790 |
T13509 |
T13510 |
det |
the,UTR |
| R8791 |
T13510 |
T13508 |
pobj |
UTR,against |
| R8792 |
T13511 |
T13510 |
nummod |
3,UTR |
| R8793 |
T13512 |
T13511 |
punct |
′,3 |
| R8794 |
T13513 |
T13500 |
prep |
by,generated |
| R8795 |
T13514 |
T13513 |
pobj |
PCR,by |
| R8796 |
T13515 |
T13500 |
advcl |
using,generated |
| R8797 |
T13516 |
T13517 |
det |
the,primer |
| R8798 |
T13517 |
T13515 |
dobj |
primer,using |
| R8799 |
T13518 |
T13517 |
amod |
forward,primer |
| R880 |
T1667 |
T1666 |
punct |
-,catenin |
| R8800 |
T13519 |
T13520 |
nummod |
5,ACCTTCTCCCGCATGTCCTTGCTCC |
| R8801 |
T13520 |
T13517 |
appos |
ACCTTCTCCCGCATGTCCTTGCTCC,primer |
| R8802 |
T13521 |
T13519 |
punct |
′,5 |
| R8803 |
T13522 |
T13520 |
punct |
-,ACCTTCTCCCGCATGTCCTTGCTCC |
| R8804 |
T13523 |
T13520 |
punct |
-,ACCTTCTCCCGCATGTCCTTGCTCC |
| R8805 |
T13524 |
T13520 |
nummod |
3,ACCTTCTCCCGCATGTCCTTGCTCC |
| R8806 |
T13525 |
T13520 |
punct |
′,ACCTTCTCCCGCATGTCCTTGCTCC |
| R8807 |
T13526 |
T13517 |
cc |
and,primer |
| R8808 |
T13527 |
T13528 |
det |
the,primer |
| R8809 |
T13528 |
T13517 |
conj |
primer,primer |
| R881 |
T1668 |
T1655 |
punct |
.,binds |
| R8810 |
T13529 |
T13528 |
amod |
reverse,primer |
| R8811 |
T13530 |
T13531 |
nummod |
5,CTGCTGAGGCATGGTTACAGCTGG |
| R8812 |
T13531 |
T13528 |
appos |
CTGCTGAGGCATGGTTACAGCTGG,primer |
| R8813 |
T13532 |
T13530 |
punct |
′,5 |
| R8814 |
T13533 |
T13531 |
punct |
-,CTGCTGAGGCATGGTTACAGCTGG |
| R8815 |
T13534 |
T13531 |
punct |
-,CTGCTGAGGCATGGTTACAGCTGG |
| R8816 |
T13535 |
T13531 |
nummod |
3,CTGCTGAGGCATGGTTACAGCTGG |
| R8817 |
T13536 |
T13531 |
punct |
′,CTGCTGAGGCATGGTTACAGCTGG |
| R8818 |
T13537 |
T13528 |
punct |
", ",primer |
| R8819 |
T13538 |
T13528 |
cc |
and,primer |
| R882 |
T1719 |
T1716 |
nummod |
7,8 |
| R8820 |
T13539 |
T13540 |
amod |
genomic,DNA |
| R8821 |
T13540 |
T13528 |
conj |
DNA,primer |
| R8822 |
T13541 |
T13540 |
prep |
as,DNA |
| R8823 |
T13542 |
T13543 |
det |
a,template |
| R8824 |
T13543 |
T13541 |
pobj |
template,as |
| R8825 |
T13544 |
T13500 |
punct |
.,generated |
| R8826 |
T13546 |
T13547 |
det |
The,product |
| R8827 |
T13547 |
T13549 |
nsubjpass |
product,purified |
| R8828 |
T13548 |
T13547 |
compound |
PCR,product |
| R8829 |
T13550 |
T13549 |
auxpass |
was,purified |
| R883 |
T1670 |
T1671 |
prep |
At,recruit |
| R8830 |
T13551 |
T13549 |
dep |
gel,purified |
| R8831 |
T13552 |
T13549 |
cc |
and,purified |
| R8832 |
T13553 |
T13549 |
conj |
ligated,purified |
| R8833 |
T13554 |
T13553 |
prep |
into,ligated |
| R8834 |
T13555 |
T13556 |
compound |
pCRII,TOPO |
| R8835 |
T13556 |
T13558 |
compound |
TOPO,vector |
| R8836 |
T13557 |
T13556 |
punct |
-,TOPO |
| R8837 |
T13558 |
T13554 |
pobj |
vector,into |
| R8838 |
T13559 |
T13558 |
compound |
TA,vector |
| R8839 |
T13560 |
T13549 |
punct |
.,purified |
| R884 |
T1720 |
T1716 |
punct |
",",8 |
| R8840 |
T13562 |
T13563 |
det |
The,domain |
| R8841 |
T13563 |
T13565 |
nsubjpass |
domain,generated |
| R8842 |
T13564 |
T13563 |
amod |
pre-LIM,domain |
| R8843 |
T13566 |
T13563 |
prep |
of,domain |
| R8844 |
T13567 |
T13566 |
pobj |
Ajuba,of |
| R8845 |
T13568 |
T13565 |
auxpass |
was,generated |
| R8846 |
T13569 |
T13565 |
advmod |
essentially,generated |
| R8847 |
T13570 |
T13571 |
mark |
as,described |
| R8848 |
T13571 |
T13565 |
advcl |
described,generated |
| R8849 |
T13572 |
T13573 |
punct |
[,9 |
| R885 |
T1672 |
T1670 |
pobj |
sites,At |
| R8850 |
T13573 |
T13571 |
parataxis |
9,described |
| R8851 |
T13574 |
T13573 |
punct |
],9 |
| R8852 |
T13575 |
T13565 |
punct |
", ",generated |
| R8853 |
T13576 |
T13565 |
cc |
but,generated |
| R8854 |
T13577 |
T13578 |
auxpass |
was,fused |
| R8855 |
T13578 |
T13565 |
conj |
fused,generated |
| R8856 |
T13579 |
T13578 |
prep |
to,fused |
| R8857 |
T13580 |
T13579 |
pobj |
GFP,to |
| R8858 |
T13581 |
T13578 |
prep |
by,fused |
| R8859 |
T13582 |
T13581 |
pcomp |
subcloning,by |
| R886 |
T1673 |
T1672 |
prep |
of,sites |
| R8860 |
T13583 |
T13582 |
prep |
from,subcloning |
| R8861 |
T13584 |
T13585 |
det |
the,vector |
| R8862 |
T13585 |
T13583 |
pobj |
vector,from |
| R8863 |
T13586 |
T13587 |
nmod |
pEGFP,N1 |
| R8864 |
T13587 |
T13585 |
nmod |
N1,vector |
| R8865 |
T13588 |
T13587 |
punct |
-,N1 |
| R8866 |
T13589 |
T13585 |
nummod |
20,vector |
| R8867 |
T13590 |
T13591 |
punct |
(,Clontech |
| R8868 |
T13591 |
T13585 |
parataxis |
Clontech,vector |
| R8869 |
T13592 |
T13591 |
compound |
BD,Clontech |
| R887 |
T1674 |
T1675 |
compound |
cell,cell |
| R8870 |
T13593 |
T13591 |
compound |
Biosciences,Clontech |
| R8871 |
T13594 |
T13591 |
punct |
),Clontech |
| R8874 |
T13649 |
T13650 |
advmod |
In,situ |
| R8875 |
T13650 |
T13651 |
amod |
situ,hybridization |
| R8876 |
T13653 |
T13654 |
det |
The,vector |
| R8877 |
T13654 |
T13659 |
nsubjpass |
vector,used |
| R8878 |
T13655 |
T13656 |
compound |
pCRII,TOPO |
| R8879 |
T13656 |
T13654 |
compound |
TOPO,vector |
| R888 |
T1721 |
T1716 |
punct |
],8 |
| R8880 |
T13657 |
T13656 |
punct |
-,TOPO |
| R8881 |
T13658 |
T13654 |
compound |
TA,vector |
| R8882 |
T13660 |
T13654 |
acl |
containing,vector |
| R8883 |
T13661 |
T13662 |
det |
a,region |
| R8884 |
T13662 |
T13660 |
dobj |
region,containing |
| R8885 |
T13663 |
T13662 |
prep |
of,region |
| R8886 |
T13664 |
T13665 |
det |
the,UTR |
| R8887 |
T13665 |
T13663 |
pobj |
UTR,of |
| R8888 |
T13666 |
T13665 |
nummod |
3,UTR |
| R8889 |
T13667 |
T13666 |
punct |
′,3 |
| R889 |
T1722 |
T1671 |
punct |
.,recruit |
| R8890 |
T13668 |
T13665 |
prep |
of,UTR |
| R8891 |
T13669 |
T13668 |
pobj |
Snail,of |
| R8892 |
T13670 |
T13659 |
auxpass |
was,used |
| R8893 |
T13671 |
T13659 |
prep |
as,used |
| R8894 |
T13672 |
T13673 |
det |
a,template |
| R8895 |
T13673 |
T13671 |
pobj |
template,as |
| R8896 |
T13674 |
T13675 |
aux |
to,generate |
| R8897 |
T13675 |
T13659 |
advcl |
generate,used |
| R8898 |
T13676 |
T13677 |
npadvmod |
digoxigenin,labeled |
| R8899 |
T13677 |
T13679 |
amod |
labeled,riboprobes |
| R890 |
T1724 |
T1725 |
compound |
α,Catenin |
| R8900 |
T13678 |
T13677 |
punct |
-,labeled |
| R8901 |
T13679 |
T13675 |
dobj |
riboprobes,generate |
| R8902 |
T13680 |
T13679 |
nmod |
sense,riboprobes |
| R8903 |
T13681 |
T13680 |
cc |
and,sense |
| R8904 |
T13682 |
T13680 |
conj |
antisense,sense |
| R8905 |
T13683 |
T13684 |
punct |
(,Roche |
| R8906 |
T13684 |
T13679 |
parataxis |
Roche,riboprobes |
| R8907 |
T13685 |
T13684 |
punct |
),Roche |
| R8908 |
T13686 |
T13659 |
punct |
.,used |
| R8909 |
T13688 |
T13689 |
det |
The,probes |
| R891 |
T1725 |
T1727 |
nsubj |
Catenin,binds |
| R8910 |
T13689 |
T13691 |
nsubjpass |
probes,obtained |
| R8911 |
T13690 |
T13689 |
amod |
respective,probes |
| R8912 |
T13692 |
T13691 |
auxpass |
were,obtained |
| R8913 |
T13693 |
T13691 |
prep |
by,obtained |
| R8914 |
T13694 |
T13695 |
nmod |
XhoI,digestions |
| R8915 |
T13695 |
T13693 |
pobj |
digestions,by |
| R8916 |
T13696 |
T13694 |
cc |
and,XhoI |
| R8917 |
T13697 |
T13694 |
conj |
BamH1,XhoI |
| R8918 |
T13698 |
T13691 |
punct |
.,obtained |
| R8919 |
T13700 |
T13701 |
advmod |
In,situ |
| R892 |
T1726 |
T1725 |
punct |
-,Catenin |
| R8920 |
T13701 |
T13702 |
amod |
situ,hybridizations |
| R8921 |
T13702 |
T13703 |
nsubjpass |
hybridizations,performed |
| R8922 |
T13704 |
T13703 |
auxpass |
were,performed |
| R8923 |
T13705 |
T13703 |
prep |
on,performed |
| R8924 |
T13706 |
T13707 |
nummod |
10,μm |
| R8925 |
T13707 |
T13709 |
npadvmod |
μm,thick |
| R8926 |
T13708 |
T13707 |
punct |
-,μm |
| R8927 |
T13709 |
T13710 |
amod |
thick,sections |
| R8928 |
T13710 |
T13705 |
pobj |
sections,on |
| R8929 |
T13711 |
T13710 |
prep |
of,sections |
| R893 |
T1780 |
T1779 |
compound |
protein,kinase |
| R8930 |
T13712 |
T13713 |
compound |
E17.5,embryos |
| R8931 |
T13713 |
T13711 |
pobj |
embryos,of |
| R8932 |
T13714 |
T13713 |
compound |
mouse,embryos |
| R8933 |
T13715 |
T13703 |
punct |
.,performed |
| R8934 |
T13717 |
T13718 |
det |
The,sections |
| R8935 |
T13718 |
T13719 |
nsubjpass |
sections,fixed |
| R8936 |
T13720 |
T13719 |
auxpass |
were,fixed |
| R8937 |
T13721 |
T13719 |
prep |
with,fixed |
| R8938 |
T13722 |
T13723 |
nummod |
4,% |
| R8939 |
T13723 |
T13724 |
compound |
%,PFA |
| R894 |
T1781 |
T1779 |
punct |
(,kinase |
| R8940 |
T13724 |
T13721 |
pobj |
PFA,with |
| R8941 |
T13725 |
T13719 |
prep |
for,fixed |
| R8942 |
T13726 |
T13727 |
nummod |
10,min |
| R8943 |
T13727 |
T13725 |
pobj |
min,for |
| R8944 |
T13728 |
T13719 |
prep |
at,fixed |
| R8945 |
T13729 |
T13730 |
compound |
room,temperature |
| R8946 |
T13730 |
T13728 |
pobj |
temperature,at |
| R8947 |
T13731 |
T13719 |
punct |
", ",fixed |
| R8948 |
T13732 |
T13719 |
conj |
prehybridized,fixed |
| R8949 |
T13733 |
T13732 |
prep |
at,prehybridized |
| R895 |
T1782 |
T1779 |
appos |
MAPK,kinase |
| R8950 |
T13734 |
T13735 |
compound |
room,temperature |
| R8951 |
T13735 |
T13733 |
pobj |
temperature,at |
| R8952 |
T13736 |
T13732 |
prep |
for,prehybridized |
| R8953 |
T13737 |
T13738 |
nummod |
4.5,h |
| R8954 |
T13738 |
T13736 |
pobj |
h,for |
| R8955 |
T13739 |
T13732 |
punct |
", ",prehybridized |
| R8956 |
T13740 |
T13732 |
conj |
hybridized,prehybridized |
| R8957 |
T13741 |
T13740 |
prep |
with,hybridized |
| R8958 |
T13742 |
T13743 |
det |
the,probe |
| R8959 |
T13743 |
T13741 |
pobj |
probe,with |
| R896 |
T1728 |
T1727 |
advmod |
also,binds |
| R8960 |
T13744 |
T13745 |
punct |
(,μg |
| R8961 |
T13745 |
T13743 |
parataxis |
μg,probe |
| R8962 |
T13746 |
T13745 |
nummod |
2,μg |
| R8963 |
T13747 |
T13748 |
punct |
/,ml |
| R8964 |
T13748 |
T13745 |
prep |
ml,μg |
| R8965 |
T13749 |
T13745 |
punct |
),μg |
| R8966 |
T13750 |
T13740 |
prep |
at,hybridized |
| R8967 |
T13751 |
T13752 |
nummod |
55,°C |
| R8968 |
T13752 |
T13750 |
pobj |
°C,at |
| R8969 |
T13753 |
T13740 |
prep |
for,hybridized |
| R897 |
T1783 |
T1773 |
punct |
),pathway |
| R8970 |
T13754 |
T13755 |
quantmod |
12,14 |
| R8971 |
T13755 |
T13757 |
nummod |
14,h |
| R8972 |
T13756 |
T13755 |
punct |
–,14 |
| R8973 |
T13757 |
T13753 |
pobj |
h,for |
| R8974 |
T13758 |
T13740 |
punct |
", ",hybridized |
| R8975 |
T13759 |
T13740 |
conj |
blocked,hybridized |
| R8976 |
T13760 |
T13759 |
prep |
with,blocked |
| R8977 |
T13761 |
T13762 |
nummod |
10,% |
| R8978 |
T13762 |
T13763 |
compound |
%,NGS |
| R8979 |
T13763 |
T13760 |
pobj |
NGS,with |
| R898 |
T1784 |
T1785 |
punct |
[,10 |
| R8980 |
T13764 |
T13759 |
punct |
", ",blocked |
| R8981 |
T13765 |
T13759 |
cc |
and,blocked |
| R8982 |
T13766 |
T13759 |
conj |
treated,blocked |
| R8983 |
T13767 |
T13766 |
prep |
with,treated |
| R8984 |
T13768 |
T13769 |
amod |
anti-dig,antibody |
| R8985 |
T13769 |
T13767 |
pobj |
antibody,with |
| R8986 |
T13770 |
T13771 |
compound |
Fab,AP |
| R8987 |
T13771 |
T13769 |
compound |
AP,antibody |
| R8988 |
T13772 |
T13771 |
punct |
-,AP |
| R8989 |
T13773 |
T13774 |
punct |
(,Roche |
| R899 |
T1729 |
T1727 |
prep |
to,binds |
| R8990 |
T13774 |
T13769 |
parataxis |
Roche,antibody |
| R8991 |
T13775 |
T13774 |
punct |
#,Roche |
| R8992 |
T13776 |
T13774 |
nummod |
1093274,Roche |
| R8993 |
T13777 |
T13774 |
punct |
),Roche |
| R8994 |
T13778 |
T13766 |
prep |
at,treated |
| R8995 |
T13779 |
T13780 |
det |
a,dilution |
| R8996 |
T13780 |
T13778 |
pobj |
dilution,at |
| R8997 |
T13781 |
T13782 |
quantmod |
1,"2,500" |
| R8998 |
T13782 |
T13780 |
nummod |
"2,500",dilution |
| R8999 |
T13783 |
T13782 |
punct |
:,"2,500" |
| R900 |
T1785 |
T1727 |
parataxis |
10,binds |
| R9000 |
T13784 |
T13766 |
prep |
for,treated |
| R9001 |
T13785 |
T13786 |
nummod |
3,h |
| R9002 |
T13786 |
T13784 |
pobj |
h,for |
| R9003 |
T13787 |
T13719 |
punct |
.,fixed |
| R9004 |
T13789 |
T13790 |
det |
The,sections |
| R9005 |
T13790 |
T13791 |
nsubjpass |
sections,incubated |
| R9006 |
T13792 |
T13791 |
auxpass |
were,incubated |
| R9007 |
T13793 |
T13791 |
prep |
with,incubated |
| R9008 |
T13794 |
T13793 |
pobj |
NBT,with |
| R9009 |
T13795 |
T13794 |
cc |
and,NBT |
| R901 |
T1786 |
T1785 |
nummod |
9,10 |
| R9010 |
T13796 |
T13794 |
conj |
BCIP,NBT |
| R9011 |
T13797 |
T13798 |
mark |
until,detected |
| R9012 |
T13798 |
T13791 |
advcl |
detected,incubated |
| R9013 |
T13799 |
T13800 |
amod |
adequate,signal |
| R9014 |
T13800 |
T13798 |
nsubjpass |
signal,detected |
| R9015 |
T13801 |
T13798 |
auxpass |
was,detected |
| R9016 |
T13802 |
T13791 |
punct |
.,incubated |
| R9017 |
T13829 |
T13828 |
cc |
and,Immunofluorescence |
| R9018 |
T13830 |
T13828 |
conj |
immunohistochemistry,Immunofluorescence |
| R9019 |
T13832 |
T13833 |
compound |
Tissue,samples |
| R902 |
T1730 |
T1731 |
det |
the,protein |
| R9020 |
T13833 |
T13834 |
nsubjpass |
samples,frozen |
| R9021 |
T13835 |
T13833 |
prep |
for,samples |
| R9022 |
T13836 |
T13835 |
pobj |
immunofluorescence,for |
| R9023 |
T13837 |
T13834 |
auxpass |
were,frozen |
| R9024 |
T13838 |
T13834 |
prep |
in,frozen |
| R9025 |
T13839 |
T13838 |
pobj |
OCT,in |
| R9026 |
T13840 |
T13834 |
cc |
and,frozen |
| R9027 |
T13841 |
T13834 |
conj |
sectioned,frozen |
| R9028 |
T13842 |
T13843 |
nummod |
10,μm |
| R9029 |
T13843 |
T13844 |
npadvmod |
μm,thick |
| R903 |
T1787 |
T1785 |
punct |
",",10 |
| R9030 |
T13844 |
T13841 |
advcl |
thick,sectioned |
| R9031 |
T13845 |
T13841 |
prep |
on,sectioned |
| R9032 |
T13846 |
T13847 |
det |
a,cryostat |
| R9033 |
T13847 |
T13845 |
pobj |
cryostat,on |
| R9034 |
T13848 |
T13834 |
punct |
.,frozen |
| R9035 |
T13850 |
T13851 |
nsubjpass |
Sections,fixed |
| R9036 |
T13852 |
T13851 |
auxpass |
were,fixed |
| R9037 |
T13853 |
T13851 |
prep |
in,fixed |
| R9038 |
T13854 |
T13855 |
nummod |
4,% |
| R9039 |
T13855 |
T13856 |
compound |
%,paraformaldehyde |
| R904 |
T1788 |
T1785 |
punct |
],10 |
| R9040 |
T13856 |
T13853 |
pobj |
paraformaldehyde,in |
| R9041 |
T13857 |
T13851 |
prep |
for,fixed |
| R9042 |
T13858 |
T13859 |
nummod |
10,min |
| R9043 |
T13859 |
T13857 |
pobj |
min,for |
| R9044 |
T13860 |
T13851 |
prep |
at,fixed |
| R9045 |
T13861 |
T13862 |
compound |
room,temperature |
| R9046 |
T13862 |
T13860 |
pobj |
temperature,at |
| R9047 |
T13863 |
T13851 |
punct |
", ",fixed |
| R9048 |
T13864 |
T13851 |
conj |
blocked,fixed |
| R9049 |
T13865 |
T13864 |
punct |
", ",blocked |
| R905 |
T1731 |
T1729 |
pobj |
protein,to |
| R9050 |
T13866 |
T13864 |
cc |
and,blocked |
| R9051 |
T13867 |
T13864 |
conj |
stained,blocked |
| R9052 |
T13868 |
T13867 |
prep |
with,stained |
| R9053 |
T13869 |
T13868 |
pobj |
antibodies,with |
| R9054 |
T13870 |
T13851 |
punct |
.,fixed |
| R9055 |
T13872 |
T13873 |
compound |
Tissue,samples |
| R9056 |
T13873 |
T13874 |
nsubjpass |
samples,fixed |
| R9057 |
T13875 |
T13873 |
prep |
for,samples |
| R9058 |
T13876 |
T13875 |
pobj |
immunohistochemistry,for |
| R9059 |
T13877 |
T13874 |
auxpass |
were,fixed |
| R906 |
T1789 |
T1727 |
punct |
.,binds |
| R9060 |
T13878 |
T13874 |
prep |
in,fixed |
| R9061 |
T13879 |
T13880 |
nummod |
4,% |
| R9062 |
T13880 |
T13881 |
compound |
%,paraformaldehyde |
| R9063 |
T13881 |
T13878 |
pobj |
paraformaldehyde,in |
| R9064 |
T13882 |
T13874 |
punct |
", ",fixed |
| R9065 |
T13883 |
T13874 |
conj |
dehydrated,fixed |
| R9066 |
T13884 |
T13883 |
punct |
", ",dehydrated |
| R9067 |
T13885 |
T13883 |
cc |
and,dehydrated |
| R9068 |
T13886 |
T13883 |
conj |
embedded,dehydrated |
| R9069 |
T13887 |
T13886 |
prep |
in,embedded |
| R907 |
T1732 |
T1731 |
nmod |
class,protein |
| R9070 |
T13888 |
T13887 |
pobj |
paraffin,in |
| R9071 |
T13889 |
T13874 |
punct |
.,fixed |
| R9072 |
T13891 |
T13892 |
nsubjpass |
Samples,sectioned |
| R9073 |
T13893 |
T13892 |
auxpass |
were,sectioned |
| R9074 |
T13894 |
T13892 |
prep |
on,sectioned |
| R9075 |
T13895 |
T13896 |
det |
a,microtome |
| R9076 |
T13896 |
T13894 |
pobj |
microtome,on |
| R9077 |
T13897 |
T13898 |
punct |
(,thick |
| R9078 |
T13898 |
T13892 |
parataxis |
thick,sectioned |
| R9079 |
T13899 |
T13900 |
nummod |
10,μm |
| R908 |
T1791 |
T1792 |
prep |
Through,appear |
| R9080 |
T13900 |
T13898 |
npadvmod |
μm,thick |
| R9081 |
T13901 |
T13898 |
punct |
),thick |
| R9082 |
T13902 |
T13892 |
cc |
and,sectioned |
| R9083 |
T13903 |
T13892 |
conj |
rehydrated,sectioned |
| R9084 |
T13904 |
T13903 |
prep |
prior,rehydrated |
| R9085 |
T13905 |
T13904 |
pcomp |
to,prior |
| R9086 |
T13906 |
T13904 |
pcomp |
staining,prior |
| R9087 |
T13907 |
T13906 |
prep |
with,staining |
| R9088 |
T13908 |
T13907 |
pobj |
antibody,with |
| R9089 |
T13909 |
T13892 |
punct |
.,sectioned |
| R909 |
T1793 |
T1794 |
det |
these,links |
| R9090 |
T13911 |
T13912 |
nsubjpass |
Samples,unmasked |
| R9091 |
T13913 |
T13911 |
acl |
stained,Samples |
| R9092 |
T13914 |
T13913 |
prep |
with,stained |
| R9093 |
T13915 |
T13914 |
pobj |
Snail,with |
| R9094 |
T13916 |
T13915 |
punct |
", ",Snail |
| R9095 |
T13917 |
T13915 |
conj |
pMAPK,Snail |
| R9096 |
T13918 |
T13917 |
punct |
", ",pMAPK |
| R9097 |
T13919 |
T13917 |
conj |
pSmad2,pMAPK |
| R9098 |
T13920 |
T13919 |
punct |
", ",pSmad2 |
| R9099 |
T13921 |
T13919 |
cc |
and,pSmad2 |
| R910 |
T1733 |
T1732 |
nummod |
III,class |
| R9100 |
T13922 |
T13923 |
compound |
cyclin,D |
| R9101 |
T13923 |
T13919 |
conj |
D,pSmad2 |
| R9102 |
T13924 |
T13912 |
auxpass |
were,unmasked |
| R9103 |
T13925 |
T13912 |
dep |
antigen,unmasked |
| R9104 |
T13926 |
T13912 |
prep |
with,unmasked |
| R9105 |
T13927 |
T13928 |
nummod |
10,mM |
| R9106 |
T13928 |
T13929 |
compound |
mM,citrate |
| R9107 |
T13929 |
T13926 |
pobj |
citrate,with |
| R9108 |
T13930 |
T13929 |
compound |
sodium,citrate |
| R9109 |
T13931 |
T13929 |
punct |
(,citrate |
| R911 |
T1794 |
T1791 |
pobj |
links,Through |
| R9110 |
T13932 |
T13929 |
npadvmod |
pH,citrate |
| R9111 |
T13933 |
T13932 |
nummod |
6,pH |
| R9112 |
T13934 |
T13929 |
punct |
),citrate |
| R9113 |
T13935 |
T13912 |
prep |
in,unmasked |
| R9114 |
T13936 |
T13937 |
det |
an,Retriever |
| R9115 |
T13937 |
T13935 |
pobj |
Retriever,in |
| R9116 |
T13938 |
T13937 |
compound |
Antigen,Retriever |
| R9117 |
T13939 |
T13937 |
nummod |
2100,Retriever |
| R9118 |
T13940 |
T13941 |
punct |
(,Laboratories |
| R9119 |
T13941 |
T13937 |
parataxis |
Laboratories,Retriever |
| R912 |
T1795 |
T1792 |
punct |
", ",appear |
| R9120 |
T13942 |
T13941 |
compound |
Pickcell,Laboratories |
| R9121 |
T13943 |
T13941 |
punct |
", ",Laboratories |
| R9122 |
T13944 |
T13941 |
npadvmod |
Leiden,Laboratories |
| R9123 |
T13945 |
T13941 |
punct |
", ",Laboratories |
| R9124 |
T13946 |
T13941 |
npadvmod |
Netherlands,Laboratories |
| R9125 |
T13947 |
T13941 |
punct |
),Laboratories |
| R9126 |
T13948 |
T13912 |
punct |
.,unmasked |
| R9127 |
T13950 |
T13951 |
det |
The,kit |
| R9128 |
T13951 |
T13954 |
nsubjpass |
kit,used |
| R9129 |
T13952 |
T13953 |
compound |
DAB,substrate |
| R913 |
T1734 |
T1731 |
nmod |
Lin,protein |
| R9130 |
T13953 |
T13951 |
compound |
substrate,kit |
| R9131 |
T13955 |
T13956 |
punct |
(,Labs |
| R9132 |
T13956 |
T13951 |
parataxis |
Labs,kit |
| R9133 |
T13957 |
T13956 |
compound |
Vector,Labs |
| R9134 |
T13958 |
T13956 |
punct |
),Labs |
| R9135 |
T13959 |
T13954 |
auxpass |
was,used |
| R9136 |
T13960 |
T13954 |
prep |
according,used |
| R9137 |
T13961 |
T13960 |
prep |
to,according |
| R9138 |
T13962 |
T13963 |
poss |
manufacturer,instructions |
| R9139 |
T13963 |
T13961 |
pobj |
instructions,to |
| R914 |
T1796 |
T1792 |
nsubj |
AJs,appear |
| R9140 |
T13964 |
T13962 |
case |
's,manufacturer |
| R9141 |
T13965 |
T13966 |
aux |
to,develop |
| R9142 |
T13966 |
T13954 |
advcl |
develop,used |
| R9143 |
T13967 |
T13968 |
det |
the,signal |
| R9144 |
T13968 |
T13966 |
dobj |
signal,develop |
| R9145 |
T13969 |
T13954 |
punct |
.,used |
| R9146 |
T14008 |
T14009 |
compound |
RT,PCR |
| R9147 |
T14010 |
T14009 |
punct |
-,PCR |
| R9148 |
T14012 |
T14013 |
nsubjpass |
RNA,extracted |
| R9149 |
T14014 |
T14013 |
auxpass |
was,extracted |
| R915 |
T1797 |
T1792 |
oprd |
able,appear |
| R9150 |
T14015 |
T14013 |
prep |
from,extracted |
| R9151 |
T14016 |
T14015 |
pobj |
keratinocytes,from |
| R9152 |
T14017 |
T14016 |
cc |
or,keratinocytes |
| R9153 |
T14018 |
T14019 |
compound |
skin,tissue |
| R9154 |
T14019 |
T14016 |
conj |
tissue,keratinocytes |
| R9155 |
T14020 |
T14013 |
prep |
with,extracted |
| R9156 |
T14021 |
T14020 |
pobj |
Trizol,with |
| R9157 |
T14022 |
T14023 |
punct |
(,Invitrogen |
| R9158 |
T14023 |
T14021 |
parataxis |
Invitrogen,Trizol |
| R9159 |
T14024 |
T14023 |
punct |
),Invitrogen |
| R916 |
T1798 |
T1799 |
aux |
to,couple |
| R9160 |
T14025 |
T14013 |
prep |
according,extracted |
| R9161 |
T14026 |
T14025 |
prep |
to,according |
| R9162 |
T14027 |
T14028 |
det |
the,manufacturer |
| R9163 |
T14028 |
T14029 |
poss |
manufacturer,protocol |
| R9164 |
T14029 |
T14026 |
pobj |
protocol,to |
| R9165 |
T14030 |
T14028 |
case |
's,manufacturer |
| R9166 |
T14031 |
T14013 |
punct |
.,extracted |
| R9167 |
T14033 |
T14034 |
nsubjpass |
cDNA,generated |
| R9168 |
T14035 |
T14034 |
auxpass |
was,generated |
| R9169 |
T14036 |
T14034 |
advcl |
using,generated |
| R917 |
T1735 |
T1734 |
punct |
-,Lin |
| R9170 |
T14037 |
T14038 |
compound |
oligo,dT |
| R9171 |
T14038 |
T14040 |
compound |
dT,primers |
| R9172 |
T14039 |
T14038 |
punct |
-,dT |
| R9173 |
T14040 |
T14036 |
dobj |
primers,using |
| R9174 |
T14041 |
T14040 |
cc |
and,primers |
| R9175 |
T14042 |
T14043 |
det |
the,kit |
| R9176 |
T14043 |
T14040 |
conj |
kit,primers |
| R9177 |
T14044 |
T14043 |
nmod |
Superscript,kit |
| R9178 |
T14045 |
T14044 |
nummod |
II,Superscript |
| R9179 |
T14046 |
T14047 |
punct |
(,Invitrogen |
| R918 |
T1799 |
T1797 |
xcomp |
couple,able |
| R9180 |
T14047 |
T14043 |
parataxis |
Invitrogen,kit |
| R9181 |
T14048 |
T14047 |
punct |
),Invitrogen |
| R9182 |
T14049 |
T14034 |
punct |
.,generated |
| R9183 |
T14051 |
T14052 |
det |
The,primers |
| R9184 |
T14052 |
T14053 |
nsubj |
primers,were |
| R9185 |
T14054 |
T14052 |
acl |
used,primers |
| R9186 |
T14055 |
T14054 |
prep |
for,used |
| R9187 |
T14056 |
T14055 |
pobj |
PCR,for |
| R9188 |
T14057 |
T14058 |
compound |
Snail,forward |
| R9189 |
T14058 |
T14053 |
attr |
forward,were |
| R919 |
T1800 |
T1799 |
dobj |
adhesion,couple |
| R9190 |
T14059 |
T14058 |
punct |
: ,forward |
| R9191 |
T14060 |
T14061 |
nummod |
5,CAGCTGGCCAGGCTCTCGGT |
| R9192 |
T14061 |
T14058 |
appos |
CAGCTGGCCAGGCTCTCGGT,forward |
| R9193 |
T14062 |
T14060 |
punct |
′,5 |
| R9194 |
T14063 |
T14061 |
punct |
-,CAGCTGGCCAGGCTCTCGGT |
| R9195 |
T14064 |
T14061 |
punct |
-,CAGCTGGCCAGGCTCTCGGT |
| R9196 |
T14065 |
T14061 |
nummod |
3,CAGCTGGCCAGGCTCTCGGT |
| R9197 |
T14066 |
T14061 |
punct |
′,CAGCTGGCCAGGCTCTCGGT |
| R9198 |
T14067 |
T14058 |
punct |
;,forward |
| R9199 |
T14068 |
T14069 |
compound |
Snail,reverse |
| R920 |
T1736 |
T1734 |
nummod |
1,Lin |
| R9200 |
T14069 |
T14058 |
conj |
reverse,forward |
| R9201 |
T14070 |
T14069 |
punct |
: ,reverse |
| R9202 |
T14071 |
T14072 |
nummod |
5,GCGAGGGCCTCCGGAGCA |
| R9203 |
T14072 |
T14069 |
appos |
GCGAGGGCCTCCGGAGCA,reverse |
| R9204 |
T14073 |
T14071 |
punct |
′,5 |
| R9205 |
T14074 |
T14072 |
punct |
-,GCGAGGGCCTCCGGAGCA |
| R9206 |
T14075 |
T14072 |
punct |
-,GCGAGGGCCTCCGGAGCA |
| R9207 |
T14076 |
T14072 |
nummod |
3,GCGAGGGCCTCCGGAGCA |
| R9208 |
T14077 |
T14072 |
punct |
′,GCGAGGGCCTCCGGAGCA |
| R9209 |
T14078 |
T14069 |
punct |
;,reverse |
| R921 |
T1801 |
T1799 |
prep |
with,couple |
| R9210 |
T14079 |
T14080 |
compound |
GAPDH,forward |
| R9211 |
T14080 |
T14069 |
conj |
forward,reverse |
| R9212 |
T14081 |
T14082 |
nummod |
5,CGTAGACAAAATGGTGAAGGTCGG |
| R9213 |
T14082 |
T14080 |
appos |
CGTAGACAAAATGGTGAAGGTCGG,forward |
| R9214 |
T14083 |
T14081 |
punct |
′,5 |
| R9215 |
T14084 |
T14082 |
punct |
-,CGTAGACAAAATGGTGAAGGTCGG |
| R9216 |
T14085 |
T14082 |
punct |
-,CGTAGACAAAATGGTGAAGGTCGG |
| R9217 |
T14086 |
T14082 |
nummod |
3,CGTAGACAAAATGGTGAAGGTCGG |
| R9218 |
T14087 |
T14082 |
punct |
′,CGTAGACAAAATGGTGAAGGTCGG |
| R9219 |
T14088 |
T14080 |
punct |
;,forward |
| R922 |
T1802 |
T1803 |
amod |
cytoskeletal,dynamics |
| R9220 |
T14089 |
T14080 |
cc |
and,forward |
| R9221 |
T14090 |
T14091 |
compound |
GAPDH,reverse |
| R9222 |
T14091 |
T14080 |
conj |
reverse,forward |
| R9223 |
T14092 |
T14091 |
punct |
: ,reverse |
| R9224 |
T14093 |
T14094 |
nummod |
5,AAGCAGTTGGTGGTGCAGGATG |
| R9225 |
T14094 |
T14091 |
appos |
AAGCAGTTGGTGGTGCAGGATG,reverse |
| R9226 |
T14095 |
T14093 |
punct |
′,5 |
| R9227 |
T14096 |
T14094 |
punct |
-,AAGCAGTTGGTGGTGCAGGATG |
| R9228 |
T14097 |
T14094 |
punct |
-,AAGCAGTTGGTGGTGCAGGATG |
| R9229 |
T14098 |
T14094 |
nummod |
3,AAGCAGTTGGTGGTGCAGGATG |
| R923 |
T1803 |
T1801 |
pobj |
dynamics,with |
| R9230 |
T14099 |
T14094 |
punct |
′,AAGCAGTTGGTGGTGCAGGATG |
| R9231 |
T14100 |
T14053 |
punct |
.,were |
| R924 |
T1737 |
T1734 |
punct |
", ",Lin |
| R925 |
T1804 |
T1805 |
advmod |
as,as |
| R926 |
T1805 |
T1801 |
cc |
as,with |
| R927 |
T1806 |
T1805 |
advmod |
well,as |
| R928 |
T1738 |
T1734 |
appos |
Isl,Lin |
| R929 |
T1807 |
T1801 |
conj |
with,with |
| R930 |
T1808 |
T1809 |
amod |
nuclear,signaling |
| R931 |
T1739 |
T1738 |
punct |
-,Isl |
| R932 |
T1809 |
T1807 |
pobj |
signaling,with |
| R933 |
T1810 |
T1808 |
cc |
and,nuclear |
| R934 |
T1811 |
T1808 |
conj |
cytoplasmic,nuclear |
| R935 |
T1740 |
T1738 |
nummod |
1,Isl |
| R936 |
T1812 |
T1792 |
punct |
.,appear |
| R937 |
T1814 |
T1815 |
nsubj |
This,provides |
| R938 |
T1741 |
T1734 |
punct |
", ",Lin |
| R939 |
T1816 |
T1817 |
det |
a,framework |
| R940 |
T1742 |
T1734 |
appos |
Mec,Lin |
| R941 |
T1817 |
T1815 |
dobj |
framework,provides |
| R942 |
T1818 |
T1817 |
prep |
for,framework |
| R943 |
T1819 |
T1818 |
pcomp |
conceptualizing,for |
| R944 |
T1820 |
T1821 |
advmod |
why,appear |
| R945 |
T1821 |
T1819 |
ccomp |
appear,conceptualizing |
| R946 |
T1822 |
T1823 |
compound |
E,cadherin |
| R947 |
T1743 |
T1742 |
punct |
-,Mec |
| R948 |
T1823 |
T1825 |
compound |
cadherin,levels |
| R949 |
T1824 |
T1823 |
punct |
-,cadherin |
| R950 |
T1825 |
T1821 |
nsubj |
levels,appear |
| R951 |
T1826 |
T1827 |
aux |
to,impact |
| R952 |
T1744 |
T1742 |
nummod |
3,Mec |
| R953 |
T1827 |
T1821 |
xcomp |
impact,appear |
| R954 |
T1828 |
T1827 |
prep |
upon,impact |
| R955 |
T1745 |
T1734 |
punct |
(,Lin |
| R956 |
T1829 |
T1830 |
det |
a,plethora |
| R957 |
T1830 |
T1828 |
pobj |
plethora,upon |
| R958 |
T1831 |
T1830 |
prep |
of,plethora |
| R959 |
T1746 |
T1734 |
appos |
LIM,Lin |
| R960 |
T1832 |
T1833 |
amod |
developmental,processes |
| R961 |
T1833 |
T1831 |
pobj |
processes,of |
| R962 |
T1834 |
T1835 |
punct |
(,reviewed |
| R963 |
T1747 |
T1731 |
punct |
),protein |
| R964 |
T1835 |
T1815 |
parataxis |
reviewed,provides |
| R965 |
T1836 |
T1835 |
prep |
in,reviewed |
| R966 |
T1837 |
T1836 |
punct |
[,in |
| R967 |
T1748 |
T1731 |
appos |
Ajuba,protein |
| R968 |
T1838 |
T1836 |
pobj |
11,in |
| R969 |
T1839 |
T1835 |
punct |
],reviewed |
| R970 |
T1840 |
T1835 |
punct |
),reviewed |
| R971 |
T1749 |
T1731 |
punct |
(,protein |
| R972 |
T1841 |
T1815 |
punct |
.,provides |
| R973 |
T1750 |
T1751 |
det |
a,member |
| R974 |
T1843 |
T1844 |
mark |
As,probed |
| R975 |
T1844 |
T1846 |
advcl |
probed,intrigued |
| R976 |
T1845 |
T1844 |
nsubj |
we,probed |
| R977 |
T1751 |
T1731 |
appos |
member,protein |
| R978 |
T1847 |
T1848 |
advmod |
more,deeply |
| R979 |
T1848 |
T1844 |
advmod |
deeply,probed |
| R980 |
T1752 |
T1751 |
prep |
of,member |
| R981 |
T1849 |
T1844 |
prep |
into,probed |
| R982 |
T1850 |
T1851 |
det |
the,mechanisms |
| R983 |
T1851 |
T1849 |
pobj |
mechanisms,into |
| R984 |
T1753 |
T1754 |
det |
the,family |
| R985 |
T1852 |
T1851 |
amod |
underlying,mechanisms |
| R986 |
T1853 |
T1851 |
acl |
governing,mechanisms |
| R987 |
T1854 |
T1855 |
compound |
E,cadherin |
| R988 |
T1754 |
T1752 |
pobj |
family,of |
| R989 |
T1855 |
T1857 |
compound |
cadherin,promoter |
| R990 |
T1856 |
T1855 |
punct |
-,cadherin |
| R991 |
T1857 |
T1858 |
compound |
promoter,activity |
| R992 |
T1755 |
T1754 |
compound |
zyxin,family |
| R993 |
T1858 |
T1853 |
dobj |
activity,governing |
| R994 |
T1859 |
T1846 |
punct |
", ",intrigued |
| R995 |
T1756 |
T1754 |
prep |
of,family |
| R996 |
T1860 |
T1846 |
nsubjpass |
we,intrigued |
| R997 |
T1861 |
T1846 |
auxpass |
were,intrigued |
| R998 |
T1862 |
T1846 |
agent |
by,intrigued |
| R999 |
T1863 |
T1864 |
det |
the,proximity |