| Id |
Subject |
Object |
Predicate |
Lexical cue |
| T146 |
0-1 |
DT |
denotes |
A |
| T148 |
0-77 |
sentence |
denotes |
A Signaling Pathway Involving TGF-β2 and Snail in Hair Follicle Morphogenesis |
| T149 |
2-11 |
NN |
denotes |
Signaling |
| T147 |
12-19 |
NN |
denotes |
Pathway |
| T150 |
20-29 |
VBG |
denotes |
Involving |
| T151 |
30-33 |
NN |
denotes |
TGF |
| T153 |
33-34 |
HYPH |
denotes |
- |
| T152 |
34-36 |
NN |
denotes |
β2 |
| T154 |
37-40 |
CC |
denotes |
and |
| T155 |
41-46 |
NN |
denotes |
Snail |
| T156 |
47-49 |
IN |
denotes |
in |
| T157 |
50-54 |
NN |
denotes |
Hair |
| T158 |
55-63 |
NN |
denotes |
Follicle |
| T159 |
64-77 |
NN |
denotes |
Morphogenesis |
| T160 |
77-78 |
sentence |
denotes |
|
| T162 |
129-131 |
IN |
denotes |
In |
| T161 |
129-288 |
sentence |
denotes |
In a common theme of organogenesis, certain cells within a multipotent epithelial sheet exchange signals with their neighbors and develop into a bud structure. |
| T164 |
132-133 |
DT |
denotes |
a |
| T166 |
134-140 |
JJ |
denotes |
common |
| T165 |
141-146 |
NN |
denotes |
theme |
| T167 |
147-149 |
IN |
denotes |
of |
| T168 |
150-163 |
NN |
denotes |
organogenesis |
| T169 |
163-165 |
, |
denotes |
, |
| T170 |
165-172 |
JJ |
denotes |
certain |
| T171 |
173-178 |
NNS |
denotes |
cells |
| T172 |
179-185 |
IN |
denotes |
within |
| T173 |
186-187 |
DT |
denotes |
a |
| T175 |
188-199 |
JJ |
denotes |
multipotent |
| T176 |
200-210 |
JJ |
denotes |
epithelial |
| T174 |
211-216 |
NN |
denotes |
sheet |
| T163 |
217-225 |
VB |
denotes |
exchange |
| T177 |
226-233 |
NNS |
denotes |
signals |
| T178 |
234-238 |
IN |
denotes |
with |
| T179 |
239-244 |
PRP$ |
denotes |
their |
| T180 |
245-254 |
NNS |
denotes |
neighbors |
| T181 |
255-258 |
CC |
denotes |
and |
| T182 |
259-266 |
VBP |
denotes |
develop |
| T183 |
267-271 |
IN |
denotes |
into |
| T184 |
272-273 |
DT |
denotes |
a |
| T186 |
274-277 |
NN |
denotes |
bud |
| T185 |
278-287 |
NN |
denotes |
structure |
| T187 |
287-288 |
. |
denotes |
. |
| T188 |
288-544 |
sentence |
denotes |
Using hair bud morphogenesis as a paradigm, we employed mutant mouse models and cultured keratinocytes to dissect the contributions of multiple extracellular cues in orchestrating adhesion dynamics and proliferation to shape the cluster of cells involved. |
| T189 |
289-294 |
VBG |
denotes |
Using |
| T191 |
295-299 |
NN |
denotes |
hair |
| T192 |
300-303 |
NN |
denotes |
bud |
| T193 |
304-317 |
NN |
denotes |
morphogenesis |
| T194 |
318-320 |
IN |
denotes |
as |
| T195 |
321-322 |
DT |
denotes |
a |
| T196 |
323-331 |
NN |
denotes |
paradigm |
| T197 |
331-333 |
, |
denotes |
, |
| T198 |
333-335 |
PRP |
denotes |
we |
| T190 |
336-344 |
VBD |
denotes |
employed |
| T199 |
345-351 |
NN |
denotes |
mutant |
| T200 |
352-357 |
NN |
denotes |
mouse |
| T201 |
358-364 |
NNS |
denotes |
models |
| T202 |
365-368 |
CC |
denotes |
and |
| T203 |
369-377 |
VBN |
denotes |
cultured |
| T204 |
378-391 |
NNS |
denotes |
keratinocytes |
| T205 |
392-394 |
TO |
denotes |
to |
| T206 |
395-402 |
VB |
denotes |
dissect |
| T207 |
403-406 |
DT |
denotes |
the |
| T208 |
407-420 |
NNS |
denotes |
contributions |
| T209 |
421-423 |
IN |
denotes |
of |
| T210 |
424-432 |
JJ |
denotes |
multiple |
| T212 |
433-446 |
JJ |
denotes |
extracellular |
| T211 |
447-451 |
NNS |
denotes |
cues |
| T213 |
452-454 |
IN |
denotes |
in |
| T214 |
455-468 |
VBG |
denotes |
orchestrating |
| T215 |
469-477 |
NN |
denotes |
adhesion |
| T216 |
478-486 |
NNS |
denotes |
dynamics |
| T217 |
487-490 |
CC |
denotes |
and |
| T218 |
491-504 |
NN |
denotes |
proliferation |
| T219 |
505-507 |
TO |
denotes |
to |
| T220 |
508-513 |
VB |
denotes |
shape |
| T221 |
514-517 |
DT |
denotes |
the |
| T222 |
518-525 |
NN |
denotes |
cluster |
| T223 |
526-528 |
IN |
denotes |
of |
| T224 |
529-534 |
NNS |
denotes |
cells |
| T225 |
535-543 |
VBN |
denotes |
involved |
| T226 |
543-544 |
. |
denotes |
. |
| T227 |
544-745 |
sentence |
denotes |
We found that transforming growth factor β2 signaling is necessary to transiently induce the transcription factor Snail and activate the Ras-mitogen-activated protein kinase (MAPK) pathway in the bud. |
| T228 |
545-547 |
PRP |
denotes |
We |
| T229 |
548-553 |
VBD |
denotes |
found |
| T230 |
554-558 |
IN |
denotes |
that |
| T232 |
559-571 |
VBG |
denotes |
transforming |
| T233 |
572-578 |
NN |
denotes |
growth |
| T235 |
579-585 |
NN |
denotes |
factor |
| T234 |
586-588 |
NN |
denotes |
β2 |
| T236 |
589-598 |
NN |
denotes |
signaling |
| T231 |
599-601 |
VBZ |
denotes |
is |
| T237 |
602-611 |
JJ |
denotes |
necessary |
| T238 |
612-614 |
TO |
denotes |
to |
| T240 |
615-626 |
RB |
denotes |
transiently |
| T239 |
627-633 |
VB |
denotes |
induce |
| T241 |
634-637 |
DT |
denotes |
the |
| T243 |
638-651 |
NN |
denotes |
transcription |
| T244 |
652-658 |
NN |
denotes |
factor |
| T242 |
659-664 |
NN |
denotes |
Snail |
| T245 |
665-668 |
CC |
denotes |
and |
| T246 |
669-677 |
VB |
denotes |
activate |
| T247 |
678-681 |
DT |
denotes |
the |
| T249 |
682-685 |
NN |
denotes |
Ras |
| T251 |
685-686 |
HYPH |
denotes |
- |
| T252 |
686-693 |
NN |
denotes |
mitogen |
| T254 |
693-694 |
HYPH |
denotes |
- |
| T253 |
694-703 |
VBN |
denotes |
activated |
| T255 |
704-711 |
NN |
denotes |
protein |
| T250 |
712-718 |
NN |
denotes |
kinase |
| T256 |
719-720 |
-LRB- |
denotes |
( |
| T257 |
720-724 |
NN |
denotes |
MAPK |
| T258 |
724-725 |
-RRB- |
denotes |
) |
| T248 |
726-733 |
NN |
denotes |
pathway |
| T259 |
734-736 |
IN |
denotes |
in |
| T260 |
737-740 |
DT |
denotes |
the |
| T261 |
741-744 |
NN |
denotes |
bud |
| T262 |
744-745 |
. |
denotes |
. |
| T263 |
745-854 |
sentence |
denotes |
In the epidermis, Snail misexpression leads to hyperproliferation and a reduction in intercellular adhesion. |
| T264 |
746-748 |
IN |
denotes |
In |
| T266 |
749-752 |
DT |
denotes |
the |
| T267 |
753-762 |
NN |
denotes |
epidermis |
| T268 |
762-764 |
, |
denotes |
, |
| T269 |
764-769 |
NN |
denotes |
Snail |
| T270 |
770-783 |
NN |
denotes |
misexpression |
| T265 |
784-789 |
VBZ |
denotes |
leads |
| T271 |
790-792 |
IN |
denotes |
to |
| T272 |
793-811 |
NN |
denotes |
hyperproliferation |
| T273 |
812-815 |
CC |
denotes |
and |
| T274 |
816-817 |
DT |
denotes |
a |
| T275 |
818-827 |
NN |
denotes |
reduction |
| T276 |
828-830 |
IN |
denotes |
in |
| T277 |
831-844 |
JJ |
denotes |
intercellular |
| T278 |
845-853 |
NN |
denotes |
adhesion |
| T279 |
853-854 |
. |
denotes |
. |
| T280 |
854-1068 |
sentence |
denotes |
When E-cadherin is transcriptionally down-regulated, associated adhesion proteins with dual functions in signaling are released from cell-cell contacts, a process which we demonstrate leads to Ras-MAPK activation. |
| T281 |
855-859 |
WRB |
denotes |
When |
| T283 |
860-861 |
NN |
denotes |
E |
| T285 |
861-862 |
HYPH |
denotes |
- |
| T284 |
862-870 |
NN |
denotes |
cadherin |
| T286 |
871-873 |
VBZ |
denotes |
is |
| T287 |
874-891 |
RB |
denotes |
transcriptionally |
| T288 |
892-896 |
RB |
denotes |
down |
| T289 |
896-897 |
HYPH |
denotes |
- |
| T282 |
897-906 |
VBN |
denotes |
regulated |
| T291 |
906-908 |
, |
denotes |
, |
| T292 |
908-918 |
VBN |
denotes |
associated |
| T294 |
919-927 |
NN |
denotes |
adhesion |
| T293 |
928-936 |
NN |
denotes |
proteins |
| T295 |
937-941 |
IN |
denotes |
with |
| T296 |
942-946 |
JJ |
denotes |
dual |
| T297 |
947-956 |
NNS |
denotes |
functions |
| T298 |
957-959 |
IN |
denotes |
in |
| T299 |
960-969 |
NN |
denotes |
signaling |
| T300 |
970-973 |
VBP |
denotes |
are |
| T290 |
974-982 |
VBN |
denotes |
released |
| T301 |
983-987 |
IN |
denotes |
from |
| T302 |
988-992 |
NN |
denotes |
cell |
| T304 |
992-993 |
HYPH |
denotes |
- |
| T303 |
993-997 |
NN |
denotes |
cell |
| T305 |
998-1006 |
NNS |
denotes |
contacts |
| T306 |
1006-1008 |
, |
denotes |
, |
| T307 |
1008-1009 |
DT |
denotes |
a |
| T308 |
1010-1017 |
NN |
denotes |
process |
| T309 |
1018-1023 |
WDT |
denotes |
which |
| T311 |
1024-1026 |
PRP |
denotes |
we |
| T310 |
1027-1038 |
VBP |
denotes |
demonstrate |
| T312 |
1039-1044 |
VBZ |
denotes |
leads |
| T313 |
1045-1047 |
IN |
denotes |
to |
| T314 |
1048-1051 |
NN |
denotes |
Ras |
| T316 |
1051-1052 |
HYPH |
denotes |
- |
| T315 |
1052-1056 |
NN |
denotes |
MAPK |
| T317 |
1057-1067 |
NN |
denotes |
activation |
| T318 |
1067-1068 |
. |
denotes |
. |
| T319 |
1068-1263 |
sentence |
denotes |
These studies provide insights into how multipotent cells within a sheet are stimulated to undergo transcriptional changes that result in proliferation, junctional remodeling, and bud formation. |
| T320 |
1069-1074 |
DT |
denotes |
These |
| T321 |
1075-1082 |
NNS |
denotes |
studies |
| T322 |
1083-1090 |
VBP |
denotes |
provide |
| T323 |
1091-1099 |
NNS |
denotes |
insights |
| T324 |
1100-1104 |
IN |
denotes |
into |
| T325 |
1105-1108 |
WRB |
denotes |
how |
| T327 |
1109-1120 |
JJ |
denotes |
multipotent |
| T328 |
1121-1126 |
NNS |
denotes |
cells |
| T329 |
1127-1133 |
IN |
denotes |
within |
| T330 |
1134-1135 |
DT |
denotes |
a |
| T331 |
1136-1141 |
NN |
denotes |
sheet |
| T332 |
1142-1145 |
VBP |
denotes |
are |
| T326 |
1146-1156 |
VBN |
denotes |
stimulated |
| T333 |
1157-1159 |
TO |
denotes |
to |
| T334 |
1160-1167 |
VB |
denotes |
undergo |
| T335 |
1168-1183 |
JJ |
denotes |
transcriptional |
| T336 |
1184-1191 |
NNS |
denotes |
changes |
| T337 |
1192-1196 |
WDT |
denotes |
that |
| T338 |
1197-1203 |
VBP |
denotes |
result |
| T339 |
1204-1206 |
IN |
denotes |
in |
| T340 |
1207-1220 |
NN |
denotes |
proliferation |
| T341 |
1220-1222 |
, |
denotes |
, |
| T342 |
1222-1232 |
JJ |
denotes |
junctional |
| T343 |
1233-1243 |
NN |
denotes |
remodeling |
| T344 |
1243-1245 |
, |
denotes |
, |
| T345 |
1245-1248 |
CC |
denotes |
and |
| T346 |
1249-1252 |
NN |
denotes |
bud |
| T347 |
1253-1262 |
NN |
denotes |
formation |
| T348 |
1262-1263 |
. |
denotes |
. |
| T349 |
1263-1444 |
sentence |
denotes |
This novel signaling pathway further weaves together the web of different morphogens and downstream transcriptional events that guide hair bud formation within the developing skin. |
| T350 |
1264-1268 |
DT |
denotes |
This |
| T352 |
1269-1274 |
JJ |
denotes |
novel |
| T353 |
1275-1284 |
NN |
denotes |
signaling |
| T351 |
1285-1292 |
NN |
denotes |
pathway |
| T355 |
1293-1300 |
RB |
denotes |
further |
| T354 |
1301-1307 |
VBZ |
denotes |
weaves |
| T356 |
1308-1316 |
RP |
denotes |
together |
| T357 |
1317-1320 |
DT |
denotes |
the |
| T358 |
1321-1324 |
NN |
denotes |
web |
| T359 |
1325-1327 |
IN |
denotes |
of |
| T360 |
1328-1337 |
JJ |
denotes |
different |
| T361 |
1338-1348 |
NNS |
denotes |
morphogens |
| T362 |
1349-1352 |
CC |
denotes |
and |
| T363 |
1353-1363 |
JJ |
denotes |
downstream |
| T365 |
1364-1379 |
JJ |
denotes |
transcriptional |
| T364 |
1380-1386 |
NNS |
denotes |
events |
| T366 |
1387-1391 |
WDT |
denotes |
that |
| T367 |
1392-1397 |
VBP |
denotes |
guide |
| T368 |
1398-1402 |
NN |
denotes |
hair |
| T369 |
1403-1406 |
NN |
denotes |
bud |
| T370 |
1407-1416 |
NN |
denotes |
formation |
| T371 |
1417-1423 |
IN |
denotes |
within |
| T372 |
1424-1427 |
DT |
denotes |
the |
| T374 |
1428-1438 |
VBG |
denotes |
developing |
| T373 |
1439-1443 |
NN |
denotes |
skin |
| T375 |
1443-1444 |
. |
denotes |
. |
| T1019 |
1640-1649 |
JJ |
denotes |
Mammalian |
| T1020 |
1650-1661 |
NN |
denotes |
development |
| T1021 |
1662-1670 |
VBZ |
denotes |
involves |
| T1022 |
1671-1674 |
DT |
denotes |
the |
| T1023 |
1675-1688 |
NN |
denotes |
morphogenesis |
| T1024 |
1689-1691 |
IN |
denotes |
of |
| T1025 |
1692-1699 |
JJ |
denotes |
complex |
| T1027 |
1700-1705 |
CD |
denotes |
three |
| T1029 |
1705-1706 |
HYPH |
denotes |
- |
| T1028 |
1706-1717 |
JJ |
denotes |
dimensional |
| T1026 |
1718-1728 |
NNS |
denotes |
structures |
| T1030 |
1729-1733 |
IN |
denotes |
from |
| T1031 |
1734-1743 |
RB |
denotes |
seemingly |
| T1032 |
1744-1751 |
JJ |
denotes |
uniform |
| T1033 |
1752-1758 |
NNS |
denotes |
sheets |
| T1034 |
1759-1761 |
CC |
denotes |
or |
| T1035 |
1762-1768 |
NNS |
denotes |
masses |
| T1036 |
1769-1771 |
IN |
denotes |
of |
| T1037 |
1772-1777 |
NNS |
denotes |
cells |
| T1038 |
1777-1778 |
. |
denotes |
. |
| T1039 |
1778-1916 |
sentence |
denotes |
A simple bud-like structure initiates the formation of many organs, including lungs, spinal cord, mammary glands, and hair follicles [1]. |
| T1040 |
1779-1780 |
DT |
denotes |
A |
| T1042 |
1781-1787 |
JJ |
denotes |
simple |
| T1043 |
1788-1791 |
NN |
denotes |
bud |
| T1045 |
1791-1792 |
HYPH |
denotes |
- |
| T1044 |
1792-1796 |
JJ |
denotes |
like |
| T1041 |
1797-1806 |
NN |
denotes |
structure |
| T1046 |
1807-1816 |
VBZ |
denotes |
initiates |
| T1047 |
1817-1820 |
DT |
denotes |
the |
| T1048 |
1821-1830 |
NN |
denotes |
formation |
| T1049 |
1831-1833 |
IN |
denotes |
of |
| T1050 |
1834-1838 |
JJ |
denotes |
many |
| T1051 |
1839-1845 |
NNS |
denotes |
organs |
| T1052 |
1845-1847 |
, |
denotes |
, |
| T1053 |
1847-1856 |
VBG |
denotes |
including |
| T1054 |
1857-1862 |
NNS |
denotes |
lungs |
| T1055 |
1862-1864 |
, |
denotes |
, |
| T1056 |
1864-1870 |
JJ |
denotes |
spinal |
| T1057 |
1871-1875 |
NN |
denotes |
cord |
| T1058 |
1875-1877 |
, |
denotes |
, |
| T1059 |
1877-1884 |
JJ |
denotes |
mammary |
| T1060 |
1885-1891 |
NNS |
denotes |
glands |
| T1061 |
1891-1893 |
, |
denotes |
, |
| T1062 |
1893-1896 |
CC |
denotes |
and |
| T1063 |
1897-1901 |
NN |
denotes |
hair |
| T1064 |
1902-1911 |
NNS |
denotes |
follicles |
| T1065 |
1912-1913 |
-LRB- |
denotes |
[ |
| T1066 |
1913-1914 |
CD |
denotes |
1 |
| T1067 |
1914-1915 |
-RRB- |
denotes |
] |
| T1068 |
1915-1916 |
. |
denotes |
. |
| T1069 |
1916-2094 |
sentence |
denotes |
The multipotent, adhering epithelial cells are typically attached to an underlying basal lamina that polarizes the epithelial sheet and separates it from surrounding mesenchyme. |
| T1070 |
1917-1920 |
DT |
denotes |
The |
| T1072 |
1921-1932 |
JJ |
denotes |
multipotent |
| T1073 |
1932-1934 |
, |
denotes |
, |
| T1074 |
1934-1942 |
VBG |
denotes |
adhering |
| T1075 |
1943-1953 |
JJ |
denotes |
epithelial |
| T1071 |
1954-1959 |
NNS |
denotes |
cells |
| T1077 |
1960-1963 |
VBP |
denotes |
are |
| T1078 |
1964-1973 |
RB |
denotes |
typically |
| T1076 |
1974-1982 |
VBN |
denotes |
attached |
| T1079 |
1983-1985 |
IN |
denotes |
to |
| T1080 |
1986-1988 |
DT |
denotes |
an |
| T1082 |
1989-1999 |
VBG |
denotes |
underlying |
| T1083 |
2000-2005 |
JJ |
denotes |
basal |
| T1081 |
2006-2012 |
NN |
denotes |
lamina |
| T1084 |
2013-2017 |
WDT |
denotes |
that |
| T1085 |
2018-2027 |
VBZ |
denotes |
polarizes |
| T1086 |
2028-2031 |
DT |
denotes |
the |
| T1088 |
2032-2042 |
JJ |
denotes |
epithelial |
| T1087 |
2043-2048 |
NN |
denotes |
sheet |
| T1089 |
2049-2052 |
CC |
denotes |
and |
| T1090 |
2053-2062 |
VBZ |
denotes |
separates |
| T1091 |
2063-2065 |
PRP |
denotes |
it |
| T1092 |
2066-2070 |
IN |
denotes |
from |
| T1093 |
2071-2082 |
VBG |
denotes |
surrounding |
| T1094 |
2083-2093 |
NN |
denotes |
mesenchyme |
| T1095 |
2093-2094 |
. |
denotes |
. |
| T1096 |
2094-2274 |
sentence |
denotes |
Budding morphogenesis is guided by a reciprocal exchange of signals between epithelium and mesenchyme to specify the identity of the organ that will form and to govern its growth. |
| T1097 |
2095-2102 |
VBG |
denotes |
Budding |
| T1098 |
2103-2116 |
NN |
denotes |
morphogenesis |
| T1100 |
2117-2119 |
VBZ |
denotes |
is |
| T1099 |
2120-2126 |
VBN |
denotes |
guided |
| T1101 |
2127-2129 |
IN |
denotes |
by |
| T1102 |
2130-2131 |
DT |
denotes |
a |
| T1104 |
2132-2142 |
JJ |
denotes |
reciprocal |
| T1103 |
2143-2151 |
NN |
denotes |
exchange |
| T1105 |
2152-2154 |
IN |
denotes |
of |
| T1106 |
2155-2162 |
NNS |
denotes |
signals |
| T1107 |
2163-2170 |
IN |
denotes |
between |
| T1108 |
2171-2181 |
NN |
denotes |
epithelium |
| T1109 |
2182-2185 |
CC |
denotes |
and |
| T1110 |
2186-2196 |
NN |
denotes |
mesenchyme |
| T1111 |
2197-2199 |
TO |
denotes |
to |
| T1112 |
2200-2207 |
VB |
denotes |
specify |
| T1113 |
2208-2211 |
DT |
denotes |
the |
| T1114 |
2212-2220 |
NN |
denotes |
identity |
| T1115 |
2221-2223 |
IN |
denotes |
of |
| T1116 |
2224-2227 |
DT |
denotes |
the |
| T1117 |
2228-2233 |
NN |
denotes |
organ |
| T1118 |
2234-2238 |
WDT |
denotes |
that |
| T1120 |
2239-2243 |
MD |
denotes |
will |
| T1119 |
2244-2248 |
VB |
denotes |
form |
| T1121 |
2249-2252 |
CC |
denotes |
and |
| T1122 |
2253-2255 |
TO |
denotes |
to |
| T1123 |
2256-2262 |
VB |
denotes |
govern |
| T1124 |
2263-2266 |
PRP$ |
denotes |
its |
| T1125 |
2267-2273 |
NN |
denotes |
growth |
| T1126 |
2273-2274 |
. |
denotes |
. |
| T1127 |
2274-2450 |
sentence |
denotes |
At the helm of these molecular communication pathways are Wnts, bone morphogenic proteins (BMPs), transforming growth factor βs (TGF-βs), and fibroblast growth factors (FGFs). |
| T1128 |
2275-2277 |
IN |
denotes |
At |
| T1130 |
2278-2281 |
DT |
denotes |
the |
| T1131 |
2282-2286 |
NN |
denotes |
helm |
| T1132 |
2287-2289 |
IN |
denotes |
of |
| T1133 |
2290-2295 |
DT |
denotes |
these |
| T1135 |
2296-2305 |
JJ |
denotes |
molecular |
| T1136 |
2306-2319 |
NN |
denotes |
communication |
| T1134 |
2320-2328 |
NNS |
denotes |
pathways |
| T1129 |
2329-2332 |
VBP |
denotes |
are |
| T1137 |
2333-2337 |
NNS |
denotes |
Wnts |
| T1138 |
2337-2339 |
, |
denotes |
, |
| T1139 |
2339-2343 |
NN |
denotes |
bone |
| T1141 |
2344-2355 |
JJ |
denotes |
morphogenic |
| T1140 |
2356-2364 |
NN |
denotes |
proteins |
| T1142 |
2365-2366 |
-LRB- |
denotes |
( |
| T1143 |
2366-2370 |
NNS |
denotes |
BMPs |
| T1144 |
2370-2371 |
-RRB- |
denotes |
) |
| T1145 |
2371-2373 |
, |
denotes |
, |
| T1146 |
2373-2385 |
VBG |
denotes |
transforming |
| T1148 |
2386-2392 |
NN |
denotes |
growth |
| T1149 |
2393-2399 |
NN |
denotes |
factor |
| T1147 |
2400-2402 |
NNS |
denotes |
βs |
| T1150 |
2403-2404 |
-LRB- |
denotes |
( |
| T1151 |
2404-2407 |
NN |
denotes |
TGF |
| T1153 |
2407-2408 |
HYPH |
denotes |
- |
| T1152 |
2408-2410 |
NNS |
denotes |
βs |
| T1154 |
2410-2411 |
-RRB- |
denotes |
) |
| T1155 |
2411-2413 |
, |
denotes |
, |
| T1156 |
2413-2416 |
CC |
denotes |
and |
| T1157 |
2417-2427 |
NN |
denotes |
fibroblast |
| T1159 |
2428-2434 |
NN |
denotes |
growth |
| T1158 |
2435-2442 |
NNS |
denotes |
factors |
| T1160 |
2443-2444 |
-LRB- |
denotes |
( |
| T1161 |
2444-2448 |
NNS |
denotes |
FGFs |
| T1162 |
2448-2449 |
-RRB- |
denotes |
) |
| T1163 |
2449-2450 |
. |
denotes |
. |
| T1164 |
2450-2674 |
sentence |
denotes |
Through activation of cell surface transmembrane receptors, these external signaling molecules trigger distinct cascades of intracellular events that culminate in changes in gene expression, growth, and differentiation [2]. |
| T1165 |
2451-2458 |
IN |
denotes |
Through |
| T1167 |
2459-2469 |
NN |
denotes |
activation |
| T1168 |
2470-2472 |
IN |
denotes |
of |
| T1169 |
2473-2477 |
NN |
denotes |
cell |
| T1170 |
2478-2485 |
NN |
denotes |
surface |
| T1172 |
2486-2499 |
NN |
denotes |
transmembrane |
| T1171 |
2500-2509 |
NNS |
denotes |
receptors |
| T1173 |
2509-2511 |
, |
denotes |
, |
| T1174 |
2511-2516 |
DT |
denotes |
these |
| T1176 |
2517-2525 |
JJ |
denotes |
external |
| T1177 |
2526-2535 |
NN |
denotes |
signaling |
| T1175 |
2536-2545 |
NNS |
denotes |
molecules |
| T1166 |
2546-2553 |
VBP |
denotes |
trigger |
| T1178 |
2554-2562 |
JJ |
denotes |
distinct |
| T1179 |
2563-2571 |
NNS |
denotes |
cascades |
| T1180 |
2572-2574 |
IN |
denotes |
of |
| T1181 |
2575-2588 |
JJ |
denotes |
intracellular |
| T1182 |
2589-2595 |
NNS |
denotes |
events |
| T1183 |
2596-2600 |
WDT |
denotes |
that |
| T1184 |
2601-2610 |
VBP |
denotes |
culminate |
| T1185 |
2611-2613 |
IN |
denotes |
in |
| T1186 |
2614-2621 |
NNS |
denotes |
changes |
| T1187 |
2622-2624 |
IN |
denotes |
in |
| T1188 |
2625-2629 |
NN |
denotes |
gene |
| T1189 |
2630-2640 |
NN |
denotes |
expression |
| T1190 |
2640-2642 |
, |
denotes |
, |
| T1191 |
2642-2648 |
NN |
denotes |
growth |
| T1192 |
2648-2650 |
, |
denotes |
, |
| T1193 |
2650-2653 |
CC |
denotes |
and |
| T1194 |
2654-2669 |
NN |
denotes |
differentiation |
| T1195 |
2670-2671 |
-LRB- |
denotes |
[ |
| T1196 |
2671-2672 |
CD |
denotes |
2 |
| T1197 |
2672-2673 |
-RRB- |
denotes |
] |
| T1198 |
2673-2674 |
. |
denotes |
. |
| T1199 |
2674-2847 |
sentence |
denotes |
How this constellation of signals collaborates in tailoring each budding process so that it executes a distinct morphogenetic program has yet to be comprehensively defined. |
| T1200 |
2675-2678 |
WRB |
denotes |
How |
| T1202 |
2679-2683 |
DT |
denotes |
this |
| T1203 |
2684-2697 |
NN |
denotes |
constellation |
| T1204 |
2698-2700 |
IN |
denotes |
of |
| T1205 |
2701-2708 |
NNS |
denotes |
signals |
| T1201 |
2709-2721 |
VBZ |
denotes |
collaborates |
| T1207 |
2722-2724 |
IN |
denotes |
in |
| T1208 |
2725-2734 |
VBG |
denotes |
tailoring |
| T1209 |
2735-2739 |
DT |
denotes |
each |
| T1211 |
2740-2747 |
NN |
denotes |
budding |
| T1210 |
2748-2755 |
NN |
denotes |
process |
| T1212 |
2756-2758 |
IN |
denotes |
so |
| T1214 |
2759-2763 |
IN |
denotes |
that |
| T1215 |
2764-2766 |
PRP |
denotes |
it |
| T1213 |
2767-2775 |
VBZ |
denotes |
executes |
| T1216 |
2776-2777 |
DT |
denotes |
a |
| T1218 |
2778-2786 |
JJ |
denotes |
distinct |
| T1219 |
2787-2800 |
JJ |
denotes |
morphogenetic |
| T1217 |
2801-2808 |
NN |
denotes |
program |
| T1206 |
2809-2812 |
VBZ |
denotes |
has |
| T1220 |
2813-2816 |
RB |
denotes |
yet |
| T1222 |
2817-2819 |
TO |
denotes |
to |
| T1223 |
2820-2822 |
VB |
denotes |
be |
| T1224 |
2823-2838 |
RB |
denotes |
comprehensively |
| T1221 |
2839-2846 |
VBN |
denotes |
defined |
| T1225 |
2846-2847 |
. |
denotes |
. |
| T1226 |
2847-3073 |
sentence |
denotes |
However, the process appears to be patterned at the initial stages of bud formation, since the relative importance of these pathways and their downstream effectors differ as buds begin to develop and cell fates are specified. |
| T1227 |
2848-2855 |
RB |
denotes |
However |
| T1229 |
2855-2857 |
, |
denotes |
, |
| T1230 |
2857-2860 |
DT |
denotes |
the |
| T1231 |
2861-2868 |
NN |
denotes |
process |
| T1228 |
2869-2876 |
VBZ |
denotes |
appears |
| T1232 |
2877-2879 |
TO |
denotes |
to |
| T1234 |
2880-2882 |
VB |
denotes |
be |
| T1233 |
2883-2892 |
VBN |
denotes |
patterned |
| T1235 |
2893-2895 |
IN |
denotes |
at |
| T1236 |
2896-2899 |
DT |
denotes |
the |
| T1238 |
2900-2907 |
JJ |
denotes |
initial |
| T1237 |
2908-2914 |
NNS |
denotes |
stages |
| T1239 |
2915-2917 |
IN |
denotes |
of |
| T1240 |
2918-2921 |
NN |
denotes |
bud |
| T1241 |
2922-2931 |
NN |
denotes |
formation |
| T1242 |
2931-2933 |
, |
denotes |
, |
| T1243 |
2933-2938 |
IN |
denotes |
since |
| T1245 |
2939-2942 |
DT |
denotes |
the |
| T1247 |
2943-2951 |
JJ |
denotes |
relative |
| T1246 |
2952-2962 |
NN |
denotes |
importance |
| T1248 |
2963-2965 |
IN |
denotes |
of |
| T1249 |
2966-2971 |
DT |
denotes |
these |
| T1250 |
2972-2980 |
NNS |
denotes |
pathways |
| T1251 |
2981-2984 |
CC |
denotes |
and |
| T1252 |
2985-2990 |
PRP$ |
denotes |
their |
| T1254 |
2991-3001 |
JJ |
denotes |
downstream |
| T1253 |
3002-3011 |
NNS |
denotes |
effectors |
| T1244 |
3012-3018 |
VBP |
denotes |
differ |
| T1255 |
3019-3021 |
IN |
denotes |
as |
| T1257 |
3022-3026 |
NNS |
denotes |
buds |
| T1256 |
3027-3032 |
VBP |
denotes |
begin |
| T1258 |
3033-3035 |
TO |
denotes |
to |
| T1259 |
3036-3043 |
VB |
denotes |
develop |
| T1260 |
3044-3047 |
CC |
denotes |
and |
| T1261 |
3048-3052 |
NN |
denotes |
cell |
| T1262 |
3053-3058 |
NNS |
denotes |
fates |
| T1264 |
3059-3062 |
VBP |
denotes |
are |
| T1263 |
3063-3072 |
VBN |
denotes |
specified |
| T1265 |
3072-3073 |
. |
denotes |
. |
| T1266 |
3073-3205 |
sentence |
denotes |
The development of a bud requires a number of coordinated changes in the behavior of the targeted cells within an epithelial sheet. |
| T1267 |
3074-3077 |
DT |
denotes |
The |
| T1268 |
3078-3089 |
NN |
denotes |
development |
| T1270 |
3090-3092 |
IN |
denotes |
of |
| T1271 |
3093-3094 |
DT |
denotes |
a |
| T1272 |
3095-3098 |
NN |
denotes |
bud |
| T1269 |
3099-3107 |
VBZ |
denotes |
requires |
| T1273 |
3108-3109 |
DT |
denotes |
a |
| T1274 |
3110-3116 |
NN |
denotes |
number |
| T1275 |
3117-3119 |
IN |
denotes |
of |
| T1276 |
3120-3131 |
VBN |
denotes |
coordinated |
| T1277 |
3132-3139 |
NNS |
denotes |
changes |
| T1278 |
3140-3142 |
IN |
denotes |
in |
| T1279 |
3143-3146 |
DT |
denotes |
the |
| T1280 |
3147-3155 |
NN |
denotes |
behavior |
| T1281 |
3156-3158 |
IN |
denotes |
of |
| T1282 |
3159-3162 |
DT |
denotes |
the |
| T1284 |
3163-3171 |
VBN |
denotes |
targeted |
| T1283 |
3172-3177 |
NNS |
denotes |
cells |
| T1285 |
3178-3184 |
IN |
denotes |
within |
| T1286 |
3185-3187 |
DT |
denotes |
an |
| T1288 |
3188-3198 |
JJ |
denotes |
epithelial |
| T1287 |
3199-3204 |
NN |
denotes |
sheet |
| T1289 |
3204-3205 |
. |
denotes |
. |
| T1290 |
3205-3389 |
sentence |
denotes |
The process must be accompanied by alterations in the proliferation, polarity, shape, and adhesiveness of selected cells, as well as by modifications in their underlying basal lamina. |
| T1291 |
3206-3209 |
DT |
denotes |
The |
| T1292 |
3210-3217 |
NN |
denotes |
process |
| T1294 |
3218-3222 |
MD |
denotes |
must |
| T1295 |
3223-3225 |
VB |
denotes |
be |
| T1293 |
3226-3237 |
VBN |
denotes |
accompanied |
| T1296 |
3238-3240 |
IN |
denotes |
by |
| T1297 |
3241-3252 |
NNS |
denotes |
alterations |
| T1298 |
3253-3255 |
IN |
denotes |
in |
| T1299 |
3256-3259 |
DT |
denotes |
the |
| T1300 |
3260-3273 |
NN |
denotes |
proliferation |
| T1301 |
3273-3275 |
, |
denotes |
, |
| T1302 |
3275-3283 |
NN |
denotes |
polarity |
| T1303 |
3283-3285 |
, |
denotes |
, |
| T1304 |
3285-3290 |
NN |
denotes |
shape |
| T1305 |
3290-3292 |
, |
denotes |
, |
| T1306 |
3292-3295 |
CC |
denotes |
and |
| T1307 |
3296-3308 |
NN |
denotes |
adhesiveness |
| T1308 |
3309-3311 |
IN |
denotes |
of |
| T1309 |
3312-3320 |
VBN |
denotes |
selected |
| T1310 |
3321-3326 |
NNS |
denotes |
cells |
| T1311 |
3326-3328 |
, |
denotes |
, |
| T1312 |
3328-3330 |
RB |
denotes |
as |
| T1314 |
3331-3335 |
RB |
denotes |
well |
| T1313 |
3336-3338 |
IN |
denotes |
as |
| T1315 |
3339-3341 |
IN |
denotes |
by |
| T1316 |
3342-3355 |
NNS |
denotes |
modifications |
| T1317 |
3356-3358 |
IN |
denotes |
in |
| T1318 |
3359-3364 |
PRP$ |
denotes |
their |
| T1320 |
3365-3375 |
VBG |
denotes |
underlying |
| T1321 |
3376-3381 |
JJ |
denotes |
basal |
| T1319 |
3382-3388 |
NN |
denotes |
lamina |
| T1322 |
3388-3389 |
. |
denotes |
. |
| T1323 |
3389-3617 |
sentence |
denotes |
Thus, extracellular epithelial-mesenchymal crosstalk must be intricately orchestrated to couple the determination of distinct cell fates with the contemporaneous remodeling of the physical and structural properties of the cell. |
| T1324 |
3390-3394 |
RB |
denotes |
Thus |
| T1326 |
3394-3396 |
, |
denotes |
, |
| T1327 |
3396-3409 |
JJ |
denotes |
extracellular |
| T1329 |
3410-3420 |
JJ |
denotes |
epithelial |
| T1331 |
3420-3421 |
HYPH |
denotes |
- |
| T1330 |
3421-3432 |
JJ |
denotes |
mesenchymal |
| T1328 |
3433-3442 |
NN |
denotes |
crosstalk |
| T1332 |
3443-3447 |
MD |
denotes |
must |
| T1333 |
3448-3450 |
VB |
denotes |
be |
| T1334 |
3451-3462 |
RB |
denotes |
intricately |
| T1325 |
3463-3475 |
VBN |
denotes |
orchestrated |
| T1335 |
3476-3478 |
TO |
denotes |
to |
| T1336 |
3479-3485 |
VB |
denotes |
couple |
| T1337 |
3486-3489 |
DT |
denotes |
the |
| T1338 |
3490-3503 |
NN |
denotes |
determination |
| T1339 |
3504-3506 |
IN |
denotes |
of |
| T1340 |
3507-3515 |
JJ |
denotes |
distinct |
| T1342 |
3516-3520 |
NN |
denotes |
cell |
| T1341 |
3521-3526 |
NNS |
denotes |
fates |
| T1343 |
3527-3531 |
IN |
denotes |
with |
| T1344 |
3532-3535 |
DT |
denotes |
the |
| T1346 |
3536-3551 |
JJ |
denotes |
contemporaneous |
| T1345 |
3552-3562 |
NN |
denotes |
remodeling |
| T1347 |
3563-3565 |
IN |
denotes |
of |
| T1348 |
3566-3569 |
DT |
denotes |
the |
| T1350 |
3570-3578 |
JJ |
denotes |
physical |
| T1351 |
3579-3582 |
CC |
denotes |
and |
| T1352 |
3583-3593 |
JJ |
denotes |
structural |
| T1349 |
3594-3604 |
NNS |
denotes |
properties |
| T1353 |
3605-3607 |
IN |
denotes |
of |
| T1354 |
3608-3611 |
DT |
denotes |
the |
| T1355 |
3612-3616 |
NN |
denotes |
cell |
| T1356 |
3616-3617 |
. |
denotes |
. |
| T1357 |
3617-3733 |
sentence |
denotes |
Among the few dispensable organs, hair follicles offer an excellent model system to study epithelial bud formation. |
| T1358 |
3618-3623 |
IN |
denotes |
Among |
| T1360 |
3624-3627 |
DT |
denotes |
the |
| T1362 |
3628-3631 |
JJ |
denotes |
few |
| T1363 |
3632-3643 |
JJ |
denotes |
dispensable |
| T1361 |
3644-3650 |
NNS |
denotes |
organs |
| T1364 |
3650-3652 |
, |
denotes |
, |
| T1365 |
3652-3656 |
NN |
denotes |
hair |
| T1366 |
3657-3666 |
NNS |
denotes |
follicles |
| T1359 |
3667-3672 |
VBP |
denotes |
offer |
| T1367 |
3673-3675 |
DT |
denotes |
an |
| T1369 |
3676-3685 |
JJ |
denotes |
excellent |
| T1370 |
3686-3691 |
NN |
denotes |
model |
| T1368 |
3692-3698 |
NN |
denotes |
system |
| T1371 |
3699-3701 |
TO |
denotes |
to |
| T1372 |
3702-3707 |
VB |
denotes |
study |
| T1373 |
3708-3718 |
JJ |
denotes |
epithelial |
| T1374 |
3719-3722 |
NN |
denotes |
bud |
| T1375 |
3723-3732 |
NN |
denotes |
formation |
| T1376 |
3732-3733 |
. |
denotes |
. |
| T1377 |
3733-3817 |
sentence |
denotes |
Mammalian skin epithelium begins as a single sheet of multipotent ectodermal cells. |
| T1378 |
3734-3743 |
JJ |
denotes |
Mammalian |
| T1380 |
3744-3748 |
NN |
denotes |
skin |
| T1379 |
3749-3759 |
NN |
denotes |
epithelium |
| T1381 |
3760-3766 |
VBZ |
denotes |
begins |
| T1382 |
3767-3769 |
IN |
denotes |
as |
| T1383 |
3770-3771 |
DT |
denotes |
a |
| T1385 |
3772-3778 |
JJ |
denotes |
single |
| T1384 |
3779-3784 |
NN |
denotes |
sheet |
| T1386 |
3785-3787 |
IN |
denotes |
of |
| T1387 |
3788-3799 |
JJ |
denotes |
multipotent |
| T1389 |
3800-3810 |
JJ |
denotes |
ectodermal |
| T1388 |
3811-3816 |
NNS |
denotes |
cells |
| T1390 |
3816-3817 |
. |
denotes |
. |
| T1391 |
3817-4004 |
sentence |
denotes |
During development, specialized mesenchymal cells populate the skin in a spatially defined pattern to initiate the complex epithelial-mesenchymal crosstalk that will specify the bud [3]. |
| T1392 |
3818-3824 |
IN |
denotes |
During |
| T1394 |
3825-3836 |
NN |
denotes |
development |
| T1395 |
3836-3838 |
, |
denotes |
, |
| T1396 |
3838-3849 |
JJ |
denotes |
specialized |
| T1398 |
3850-3861 |
JJ |
denotes |
mesenchymal |
| T1397 |
3862-3867 |
NNS |
denotes |
cells |
| T1393 |
3868-3876 |
VBP |
denotes |
populate |
| T1399 |
3877-3880 |
DT |
denotes |
the |
| T1400 |
3881-3885 |
NN |
denotes |
skin |
| T1401 |
3886-3888 |
IN |
denotes |
in |
| T1402 |
3889-3890 |
DT |
denotes |
a |
| T1404 |
3891-3900 |
RB |
denotes |
spatially |
| T1405 |
3901-3908 |
VBN |
denotes |
defined |
| T1403 |
3909-3916 |
NN |
denotes |
pattern |
| T1406 |
3917-3919 |
TO |
denotes |
to |
| T1407 |
3920-3928 |
VB |
denotes |
initiate |
| T1408 |
3929-3932 |
DT |
denotes |
the |
| T1410 |
3933-3940 |
JJ |
denotes |
complex |
| T1411 |
3941-3951 |
JJ |
denotes |
epithelial |
| T1413 |
3951-3952 |
HYPH |
denotes |
- |
| T1412 |
3952-3963 |
JJ |
denotes |
mesenchymal |
| T1409 |
3964-3973 |
NN |
denotes |
crosstalk |
| T1414 |
3974-3978 |
WDT |
denotes |
that |
| T1416 |
3979-3983 |
MD |
denotes |
will |
| T1415 |
3984-3991 |
VB |
denotes |
specify |
| T1417 |
3992-3995 |
DT |
denotes |
the |
| T1418 |
3996-3999 |
NN |
denotes |
bud |
| T1419 |
4000-4001 |
-LRB- |
denotes |
[ |
| T1420 |
4001-4002 |
CD |
denotes |
3 |
| T1421 |
4002-4003 |
-RRB- |
denotes |
] |
| T1422 |
4003-4004 |
. |
denotes |
. |
| T1423 |
4004-4225 |
sentence |
denotes |
Once committed, a small cluster of epithelial cells, the placode, instructs a group of underlying mesenchymal cells to condense and form the nascent dermal papilla, which will be a permanent fixture of the hair follicle. |
| T1424 |
4005-4009 |
IN |
denotes |
Once |
| T1425 |
4010-4019 |
VBN |
denotes |
committed |
| T1427 |
4019-4021 |
, |
denotes |
, |
| T1428 |
4021-4022 |
DT |
denotes |
a |
| T1430 |
4023-4028 |
JJ |
denotes |
small |
| T1429 |
4029-4036 |
NN |
denotes |
cluster |
| T1431 |
4037-4039 |
IN |
denotes |
of |
| T1432 |
4040-4050 |
JJ |
denotes |
epithelial |
| T1433 |
4051-4056 |
NNS |
denotes |
cells |
| T1434 |
4056-4058 |
, |
denotes |
, |
| T1435 |
4058-4061 |
DT |
denotes |
the |
| T1436 |
4062-4069 |
NN |
denotes |
placode |
| T1437 |
4069-4071 |
, |
denotes |
, |
| T1426 |
4071-4080 |
VBZ |
denotes |
instructs |
| T1438 |
4081-4082 |
DT |
denotes |
a |
| T1439 |
4083-4088 |
NN |
denotes |
group |
| T1441 |
4089-4091 |
IN |
denotes |
of |
| T1442 |
4092-4102 |
VBG |
denotes |
underlying |
| T1444 |
4103-4114 |
JJ |
denotes |
mesenchymal |
| T1443 |
4115-4120 |
NNS |
denotes |
cells |
| T1445 |
4121-4123 |
TO |
denotes |
to |
| T1440 |
4124-4132 |
VB |
denotes |
condense |
| T1446 |
4133-4136 |
CC |
denotes |
and |
| T1447 |
4137-4141 |
VB |
denotes |
form |
| T1448 |
4142-4145 |
DT |
denotes |
the |
| T1450 |
4146-4153 |
JJ |
denotes |
nascent |
| T1451 |
4154-4160 |
JJ |
denotes |
dermal |
| T1449 |
4161-4168 |
NN |
denotes |
papilla |
| T1452 |
4168-4170 |
, |
denotes |
, |
| T1453 |
4170-4175 |
WDT |
denotes |
which |
| T1455 |
4176-4180 |
MD |
denotes |
will |
| T1454 |
4181-4183 |
VB |
denotes |
be |
| T1456 |
4184-4185 |
DT |
denotes |
a |
| T1458 |
4186-4195 |
JJ |
denotes |
permanent |
| T1457 |
4196-4203 |
NN |
denotes |
fixture |
| T1459 |
4204-4206 |
IN |
denotes |
of |
| T1460 |
4207-4210 |
DT |
denotes |
the |
| T1462 |
4211-4215 |
NN |
denotes |
hair |
| T1461 |
4216-4224 |
NN |
denotes |
follicle |
| T1463 |
4224-4225 |
. |
denotes |
. |
| T1464 |
4225-4462 |
sentence |
denotes |
Subsequent exchanges between the placode and nascent dermal papilla result in further growth of the follicle into the underlying dermis, or down-growth, and eventual differentiation into the six concentric layers of the mature follicle. |
| T1465 |
4226-4236 |
JJ |
denotes |
Subsequent |
| T1466 |
4237-4246 |
NNS |
denotes |
exchanges |
| T1468 |
4247-4254 |
IN |
denotes |
between |
| T1469 |
4255-4258 |
DT |
denotes |
the |
| T1470 |
4259-4266 |
NN |
denotes |
placode |
| T1471 |
4267-4270 |
CC |
denotes |
and |
| T1472 |
4271-4278 |
JJ |
denotes |
nascent |
| T1474 |
4279-4285 |
JJ |
denotes |
dermal |
| T1473 |
4286-4293 |
NN |
denotes |
papilla |
| T1467 |
4294-4300 |
VBP |
denotes |
result |
| T1475 |
4301-4303 |
IN |
denotes |
in |
| T1476 |
4304-4311 |
JJ |
denotes |
further |
| T1477 |
4312-4318 |
NN |
denotes |
growth |
| T1478 |
4319-4321 |
IN |
denotes |
of |
| T1479 |
4322-4325 |
DT |
denotes |
the |
| T1480 |
4326-4334 |
NN |
denotes |
follicle |
| T1481 |
4335-4339 |
IN |
denotes |
into |
| T1482 |
4340-4343 |
DT |
denotes |
the |
| T1484 |
4344-4354 |
JJ |
denotes |
underlying |
| T1483 |
4355-4361 |
NN |
denotes |
dermis |
| T1485 |
4361-4363 |
, |
denotes |
, |
| T1486 |
4363-4365 |
CC |
denotes |
or |
| T1487 |
4366-4370 |
JJ |
denotes |
down |
| T1489 |
4370-4371 |
HYPH |
denotes |
- |
| T1488 |
4371-4377 |
NN |
denotes |
growth |
| T1490 |
4377-4379 |
, |
denotes |
, |
| T1491 |
4379-4382 |
CC |
denotes |
and |
| T1492 |
4383-4391 |
JJ |
denotes |
eventual |
| T1493 |
4392-4407 |
NN |
denotes |
differentiation |
| T1494 |
4408-4412 |
IN |
denotes |
into |
| T1495 |
4413-4416 |
DT |
denotes |
the |
| T1497 |
4417-4420 |
CD |
denotes |
six |
| T1498 |
4421-4431 |
JJ |
denotes |
concentric |
| T1496 |
4432-4438 |
NNS |
denotes |
layers |
| T1499 |
4439-4441 |
IN |
denotes |
of |
| T1500 |
4442-4445 |
DT |
denotes |
the |
| T1502 |
4446-4452 |
JJ |
denotes |
mature |
| T1501 |
4453-4461 |
NN |
denotes |
follicle |
| T1503 |
4461-4462 |
. |
denotes |
. |
| T1504 |
4462-4732 |
sentence |
denotes |
Previously, we delineated how two respective epithelial and mesenchymal signals, Wnts and the BMP-inhibitory factor noggin, function in concert to induce lymphoid enhancer factor-1/β-catenin (LEF-1/β-catenin)-mediated gene transcription within the follicle placode [4]. |
| T1505 |
4463-4473 |
RB |
denotes |
Previously |
| T1507 |
4473-4475 |
, |
denotes |
, |
| T1508 |
4475-4477 |
PRP |
denotes |
we |
| T1506 |
4478-4488 |
VBD |
denotes |
delineated |
| T1509 |
4489-4492 |
WRB |
denotes |
how |
| T1511 |
4493-4496 |
CD |
denotes |
two |
| T1513 |
4497-4507 |
JJ |
denotes |
respective |
| T1514 |
4508-4518 |
JJ |
denotes |
epithelial |
| T1515 |
4519-4522 |
CC |
denotes |
and |
| T1516 |
4523-4534 |
JJ |
denotes |
mesenchymal |
| T1512 |
4535-4542 |
NNS |
denotes |
signals |
| T1517 |
4542-4544 |
, |
denotes |
, |
| T1518 |
4544-4548 |
NNS |
denotes |
Wnts |
| T1519 |
4549-4552 |
CC |
denotes |
and |
| T1520 |
4553-4556 |
DT |
denotes |
the |
| T1522 |
4557-4560 |
NN |
denotes |
BMP |
| T1524 |
4560-4561 |
HYPH |
denotes |
- |
| T1523 |
4561-4571 |
JJ |
denotes |
inhibitory |
| T1521 |
4572-4578 |
NN |
denotes |
factor |
| T1525 |
4579-4585 |
NN |
denotes |
noggin |
| T1526 |
4585-4587 |
, |
denotes |
, |
| T1510 |
4587-4595 |
VBP |
denotes |
function |
| T1527 |
4596-4598 |
IN |
denotes |
in |
| T1528 |
4599-4606 |
NN |
denotes |
concert |
| T1529 |
4607-4609 |
TO |
denotes |
to |
| T1530 |
4610-4616 |
VB |
denotes |
induce |
| T1531 |
4617-4625 |
JJ |
denotes |
lymphoid |
| T1533 |
4626-4634 |
NN |
denotes |
enhancer |
| T1532 |
4635-4641 |
NN |
denotes |
factor |
| T1535 |
4641-4642 |
HYPH |
denotes |
- |
| T1536 |
4642-4643 |
CD |
denotes |
1 |
| T1537 |
4643-4644 |
HYPH |
denotes |
/ |
| T1538 |
4644-4645 |
NN |
denotes |
β |
| T1540 |
4645-4646 |
HYPH |
denotes |
- |
| T1539 |
4646-4653 |
NN |
denotes |
catenin |
| T1541 |
4654-4655 |
-LRB- |
denotes |
( |
| T1542 |
4655-4658 |
NN |
denotes |
LEF |
| T1543 |
4658-4659 |
HYPH |
denotes |
- |
| T1544 |
4659-4660 |
CD |
denotes |
1 |
| T1545 |
4660-4661 |
HYPH |
denotes |
/ |
| T1546 |
4661-4662 |
NN |
denotes |
β |
| T1548 |
4662-4663 |
HYPH |
denotes |
- |
| T1547 |
4663-4670 |
NN |
denotes |
catenin |
| T1549 |
4670-4671 |
-RRB- |
denotes |
) |
| T1550 |
4671-4672 |
HYPH |
denotes |
- |
| T1534 |
4672-4680 |
VBN |
denotes |
mediated |
| T1552 |
4681-4685 |
NN |
denotes |
gene |
| T1551 |
4686-4699 |
NN |
denotes |
transcription |
| T1553 |
4700-4706 |
IN |
denotes |
within |
| T1554 |
4707-4710 |
DT |
denotes |
the |
| T1556 |
4711-4719 |
NN |
denotes |
follicle |
| T1555 |
4720-4727 |
NN |
denotes |
placode |
| T1557 |
4728-4729 |
-LRB- |
denotes |
[ |
| T1558 |
4729-4730 |
CD |
denotes |
4 |
| T1559 |
4730-4731 |
-RRB- |
denotes |
] |
| T1560 |
4731-4732 |
. |
denotes |
. |
| T1561 |
4732-4997 |
sentence |
denotes |
The downstream changes elicited through convergence of these two early signaling pathways include down-regulation of the gene encoding E-cadherin, the prototypical epithelial cadherin that forms the transmembrane core of intercellular adherens junctions (AJs) [5]. |
| T1562 |
4733-4736 |
DT |
denotes |
The |
| T1564 |
4737-4747 |
JJ |
denotes |
downstream |
| T1563 |
4748-4755 |
NNS |
denotes |
changes |
| T1566 |
4756-4764 |
VBN |
denotes |
elicited |
| T1567 |
4765-4772 |
IN |
denotes |
through |
| T1568 |
4773-4784 |
NN |
denotes |
convergence |
| T1569 |
4785-4787 |
IN |
denotes |
of |
| T1570 |
4788-4793 |
DT |
denotes |
these |
| T1572 |
4794-4797 |
CD |
denotes |
two |
| T1573 |
4798-4803 |
JJ |
denotes |
early |
| T1574 |
4804-4813 |
NN |
denotes |
signaling |
| T1571 |
4814-4822 |
NNS |
denotes |
pathways |
| T1565 |
4823-4830 |
VBP |
denotes |
include |
| T1575 |
4831-4835 |
JJ |
denotes |
down |
| T1577 |
4835-4836 |
HYPH |
denotes |
- |
| T1576 |
4836-4846 |
NN |
denotes |
regulation |
| T1578 |
4847-4849 |
IN |
denotes |
of |
| T1579 |
4850-4853 |
DT |
denotes |
the |
| T1580 |
4854-4858 |
NN |
denotes |
gene |
| T1581 |
4859-4867 |
VBG |
denotes |
encoding |
| T1582 |
4868-4869 |
NN |
denotes |
E |
| T1584 |
4869-4870 |
HYPH |
denotes |
- |
| T1583 |
4870-4878 |
NN |
denotes |
cadherin |
| T1585 |
4878-4880 |
, |
denotes |
, |
| T1586 |
4880-4883 |
DT |
denotes |
the |
| T1588 |
4884-4896 |
JJ |
denotes |
prototypical |
| T1589 |
4897-4907 |
JJ |
denotes |
epithelial |
| T1587 |
4908-4916 |
NN |
denotes |
cadherin |
| T1590 |
4917-4921 |
WDT |
denotes |
that |
| T1591 |
4922-4927 |
VBZ |
denotes |
forms |
| T1592 |
4928-4931 |
DT |
denotes |
the |
| T1594 |
4932-4945 |
JJ |
denotes |
transmembrane |
| T1593 |
4946-4950 |
NN |
denotes |
core |
| T1595 |
4951-4953 |
IN |
denotes |
of |
| T1596 |
4954-4967 |
JJ |
denotes |
intercellular |
| T1598 |
4968-4976 |
NN |
denotes |
adherens |
| T1597 |
4977-4986 |
NNS |
denotes |
junctions |
| T1599 |
4987-4988 |
-LRB- |
denotes |
( |
| T1600 |
4988-4991 |
NNS |
denotes |
AJs |
| T1601 |
4991-4992 |
-RRB- |
denotes |
) |
| T1602 |
4993-4994 |
-LRB- |
denotes |
[ |
| T1603 |
4994-4995 |
CD |
denotes |
5 |
| T1604 |
4995-4996 |
-RRB- |
denotes |
] |
| T1605 |
4996-4997 |
. |
denotes |
. |
| T1606 |
4997-5262 |
sentence |
denotes |
We subsequently showed that when E-cadherin is transgenically elevated in mouse skin, hair follicle morphogenesis is blocked, suggesting that E-cadherin down-regulation is a critical event in governing the adhesion dynamics necessary for budding morphogenesis [4]. |
| T1607 |
4998-5000 |
PRP |
denotes |
We |
| T1609 |
5001-5013 |
RB |
denotes |
subsequently |
| T1608 |
5014-5020 |
VBD |
denotes |
showed |
| T1610 |
5021-5025 |
IN |
denotes |
that |
| T1612 |
5026-5030 |
WRB |
denotes |
when |
| T1614 |
5031-5032 |
NN |
denotes |
E |
| T1616 |
5032-5033 |
HYPH |
denotes |
- |
| T1615 |
5033-5041 |
NN |
denotes |
cadherin |
| T1617 |
5042-5044 |
VBZ |
denotes |
is |
| T1618 |
5045-5059 |
RB |
denotes |
transgenically |
| T1613 |
5060-5068 |
VBN |
denotes |
elevated |
| T1619 |
5069-5071 |
IN |
denotes |
in |
| T1620 |
5072-5077 |
NN |
denotes |
mouse |
| T1621 |
5078-5082 |
NN |
denotes |
skin |
| T1622 |
5082-5084 |
, |
denotes |
, |
| T1623 |
5084-5088 |
NN |
denotes |
hair |
| T1624 |
5089-5097 |
NN |
denotes |
follicle |
| T1625 |
5098-5111 |
NN |
denotes |
morphogenesis |
| T1626 |
5112-5114 |
VBZ |
denotes |
is |
| T1611 |
5115-5122 |
VBN |
denotes |
blocked |
| T1627 |
5122-5124 |
, |
denotes |
, |
| T1628 |
5124-5134 |
VBG |
denotes |
suggesting |
| T1629 |
5135-5139 |
IN |
denotes |
that |
| T1631 |
5140-5141 |
NN |
denotes |
E |
| T1633 |
5141-5142 |
HYPH |
denotes |
- |
| T1632 |
5142-5150 |
NN |
denotes |
cadherin |
| T1635 |
5151-5155 |
JJ |
denotes |
down |
| T1636 |
5155-5156 |
HYPH |
denotes |
- |
| T1634 |
5156-5166 |
NN |
denotes |
regulation |
| T1630 |
5167-5169 |
VBZ |
denotes |
is |
| T1637 |
5170-5171 |
DT |
denotes |
a |
| T1639 |
5172-5180 |
JJ |
denotes |
critical |
| T1638 |
5181-5186 |
NN |
denotes |
event |
| T1640 |
5187-5189 |
IN |
denotes |
in |
| T1641 |
5190-5199 |
VBG |
denotes |
governing |
| T1642 |
5200-5203 |
DT |
denotes |
the |
| T1644 |
5204-5212 |
NN |
denotes |
adhesion |
| T1643 |
5213-5221 |
NNS |
denotes |
dynamics |
| T1645 |
5222-5231 |
JJ |
denotes |
necessary |
| T1646 |
5232-5235 |
IN |
denotes |
for |
| T1647 |
5236-5243 |
NN |
denotes |
budding |
| T1648 |
5244-5257 |
NN |
denotes |
morphogenesis |
| T1649 |
5258-5259 |
-LRB- |
denotes |
[ |
| T1650 |
5259-5260 |
CD |
denotes |
4 |
| T1651 |
5260-5261 |
-RRB- |
denotes |
] |
| T1652 |
5261-5262 |
. |
denotes |
. |
| T1653 |
5262-5310 |
sentence |
denotes |
Like LEF-1, E-cadherin also binds to β-catenin. |
| T1654 |
5263-5267 |
IN |
denotes |
Like |
| T1656 |
5268-5271 |
NN |
denotes |
LEF |
| T1657 |
5271-5272 |
HYPH |
denotes |
- |
| T1658 |
5272-5273 |
CD |
denotes |
1 |
| T1659 |
5273-5275 |
, |
denotes |
, |
| T1660 |
5275-5276 |
NN |
denotes |
E |
| T1662 |
5276-5277 |
HYPH |
denotes |
- |
| T1661 |
5277-5285 |
NN |
denotes |
cadherin |
| T1663 |
5286-5290 |
RB |
denotes |
also |
| T1655 |
5291-5296 |
VBZ |
denotes |
binds |
| T1664 |
5297-5299 |
IN |
denotes |
to |
| T1665 |
5300-5301 |
NN |
denotes |
β |
| T1667 |
5301-5302 |
HYPH |
denotes |
- |
| T1666 |
5302-5309 |
NN |
denotes |
catenin |
| T1668 |
5309-5310 |
. |
denotes |
. |
| T1669 |
5310-5573 |
sentence |
denotes |
At sites of cell-cell contact, however, E-cadherin-β-catenin complexes recruit α-catenin, which in turn coordinates the associated actin polymerization dynamics necessary to stabilize nascent AJs and integrate the cytoskeleton across an epithelial sheet [6,7,8]. |
| T1670 |
5311-5313 |
IN |
denotes |
At |
| T1672 |
5314-5319 |
NNS |
denotes |
sites |
| T1673 |
5320-5322 |
IN |
denotes |
of |
| T1674 |
5323-5327 |
NN |
denotes |
cell |
| T1676 |
5327-5328 |
HYPH |
denotes |
- |
| T1675 |
5328-5332 |
NN |
denotes |
cell |
| T1677 |
5333-5340 |
NN |
denotes |
contact |
| T1678 |
5340-5342 |
, |
denotes |
, |
| T1679 |
5342-5349 |
RB |
denotes |
however |
| T1680 |
5349-5351 |
, |
denotes |
, |
| T1681 |
5351-5352 |
NN |
denotes |
E |
| T1683 |
5352-5353 |
HYPH |
denotes |
- |
| T1682 |
5353-5361 |
NN |
denotes |
cadherin |
| T1685 |
5361-5362 |
HYPH |
denotes |
- |
| T1686 |
5362-5363 |
NN |
denotes |
β |
| T1688 |
5363-5364 |
HYPH |
denotes |
- |
| T1687 |
5364-5371 |
NN |
denotes |
catenin |
| T1684 |
5372-5381 |
NNS |
denotes |
complexes |
| T1671 |
5382-5389 |
VBP |
denotes |
recruit |
| T1689 |
5390-5391 |
NN |
denotes |
α |
| T1691 |
5391-5392 |
HYPH |
denotes |
- |
| T1690 |
5392-5399 |
NN |
denotes |
catenin |
| T1692 |
5399-5401 |
, |
denotes |
, |
| T1693 |
5401-5406 |
WDT |
denotes |
which |
| T1695 |
5407-5409 |
IN |
denotes |
in |
| T1696 |
5410-5414 |
NN |
denotes |
turn |
| T1694 |
5415-5426 |
VBZ |
denotes |
coordinates |
| T1697 |
5427-5430 |
DT |
denotes |
the |
| T1699 |
5431-5441 |
VBN |
denotes |
associated |
| T1700 |
5442-5447 |
NN |
denotes |
actin |
| T1701 |
5448-5462 |
NN |
denotes |
polymerization |
| T1698 |
5463-5471 |
NNS |
denotes |
dynamics |
| T1702 |
5472-5481 |
JJ |
denotes |
necessary |
| T1703 |
5482-5484 |
TO |
denotes |
to |
| T1704 |
5485-5494 |
VB |
denotes |
stabilize |
| T1705 |
5495-5502 |
JJ |
denotes |
nascent |
| T1706 |
5503-5506 |
NNS |
denotes |
AJs |
| T1707 |
5507-5510 |
CC |
denotes |
and |
| T1708 |
5511-5520 |
VB |
denotes |
integrate |
| T1709 |
5521-5524 |
DT |
denotes |
the |
| T1710 |
5525-5537 |
NN |
denotes |
cytoskeleton |
| T1711 |
5538-5544 |
IN |
denotes |
across |
| T1712 |
5545-5547 |
DT |
denotes |
an |
| T1714 |
5548-5558 |
JJ |
denotes |
epithelial |
| T1713 |
5559-5564 |
NN |
denotes |
sheet |
| T1715 |
5565-5566 |
-LRB- |
denotes |
[ |
| T1717 |
5566-5567 |
CD |
denotes |
6 |
| T1718 |
5567-5568 |
, |
denotes |
, |
| T1719 |
5568-5569 |
CD |
denotes |
7 |
| T1720 |
5569-5570 |
, |
denotes |
, |
| T1716 |
5570-5571 |
CD |
denotes |
8 |
| T1721 |
5571-5572 |
-RRB- |
denotes |
] |
| T1722 |
5572-5573 |
. |
denotes |
. |
| T1723 |
5573-5830 |
sentence |
denotes |
α-Catenin also binds to the class III Lin-1, Isl-1, Mec-3 (LIM) protein Ajuba (a member of the zyxin family of proteins), which appears to function dually in both adhesion and in activation of the Ras-mitogen-activated protein kinase (MAPK) pathway [9,10]. |
| T1724 |
5574-5575 |
NN |
denotes |
α |
| T1726 |
5575-5576 |
HYPH |
denotes |
- |
| T1725 |
5576-5583 |
NN |
denotes |
Catenin |
| T1728 |
5584-5588 |
RB |
denotes |
also |
| T1727 |
5589-5594 |
VBZ |
denotes |
binds |
| T1729 |
5595-5597 |
IN |
denotes |
to |
| T1730 |
5598-5601 |
DT |
denotes |
the |
| T1732 |
5602-5607 |
NN |
denotes |
class |
| T1733 |
5608-5611 |
CD |
denotes |
III |
| T1734 |
5612-5615 |
NN |
denotes |
Lin |
| T1735 |
5615-5616 |
HYPH |
denotes |
- |
| T1736 |
5616-5617 |
CD |
denotes |
1 |
| T1737 |
5617-5619 |
, |
denotes |
, |
| T1738 |
5619-5622 |
NN |
denotes |
Isl |
| T1739 |
5622-5623 |
HYPH |
denotes |
- |
| T1740 |
5623-5624 |
CD |
denotes |
1 |
| T1741 |
5624-5626 |
, |
denotes |
, |
| T1742 |
5626-5629 |
NN |
denotes |
Mec |
| T1743 |
5629-5630 |
HYPH |
denotes |
- |
| T1744 |
5630-5631 |
CD |
denotes |
3 |
| T1745 |
5632-5633 |
-LRB- |
denotes |
( |
| T1746 |
5633-5636 |
NN |
denotes |
LIM |
| T1747 |
5636-5637 |
-RRB- |
denotes |
) |
| T1731 |
5638-5645 |
NN |
denotes |
protein |
| T1748 |
5646-5651 |
NN |
denotes |
Ajuba |
| T1749 |
5652-5653 |
-LRB- |
denotes |
( |
| T1750 |
5653-5654 |
DT |
denotes |
a |
| T1751 |
5655-5661 |
NN |
denotes |
member |
| T1752 |
5662-5664 |
IN |
denotes |
of |
| T1753 |
5665-5668 |
DT |
denotes |
the |
| T1755 |
5669-5674 |
NN |
denotes |
zyxin |
| T1754 |
5675-5681 |
NN |
denotes |
family |
| T1756 |
5682-5684 |
IN |
denotes |
of |
| T1757 |
5685-5693 |
NN |
denotes |
proteins |
| T1758 |
5693-5694 |
-RRB- |
denotes |
) |
| T1759 |
5694-5696 |
, |
denotes |
, |
| T1760 |
5696-5701 |
WDT |
denotes |
which |
| T1761 |
5702-5709 |
VBZ |
denotes |
appears |
| T1762 |
5710-5712 |
TO |
denotes |
to |
| T1763 |
5713-5721 |
VB |
denotes |
function |
| T1764 |
5722-5728 |
RB |
denotes |
dually |
| T1765 |
5729-5731 |
IN |
denotes |
in |
| T1766 |
5732-5736 |
CC |
denotes |
both |
| T1767 |
5737-5745 |
NN |
denotes |
adhesion |
| T1768 |
5746-5749 |
CC |
denotes |
and |
| T1769 |
5750-5752 |
IN |
denotes |
in |
| T1770 |
5753-5763 |
NN |
denotes |
activation |
| T1771 |
5764-5766 |
IN |
denotes |
of |
| T1772 |
5767-5770 |
DT |
denotes |
the |
| T1774 |
5771-5774 |
NN |
denotes |
Ras |
| T1775 |
5774-5775 |
HYPH |
denotes |
- |
| T1776 |
5775-5782 |
NN |
denotes |
mitogen |
| T1778 |
5782-5783 |
HYPH |
denotes |
- |
| T1777 |
5783-5792 |
VBN |
denotes |
activated |
| T1780 |
5793-5800 |
NN |
denotes |
protein |
| T1779 |
5801-5807 |
NN |
denotes |
kinase |
| T1781 |
5808-5809 |
-LRB- |
denotes |
( |
| T1782 |
5809-5813 |
NN |
denotes |
MAPK |
| T1783 |
5813-5814 |
-RRB- |
denotes |
) |
| T1773 |
5815-5822 |
NN |
denotes |
pathway |
| T1784 |
5823-5824 |
-LRB- |
denotes |
[ |
| T1786 |
5824-5825 |
CD |
denotes |
9 |
| T1787 |
5825-5826 |
, |
denotes |
, |
| T1785 |
5826-5828 |
CD |
denotes |
10 |
| T1788 |
5828-5829 |
-RRB- |
denotes |
] |
| T1789 |
5829-5830 |
. |
denotes |
. |
| T1790 |
5830-5964 |
sentence |
denotes |
Through these links, AJs appear able to couple adhesion with cytoskeletal dynamics as well as with nuclear and cytoplasmic signaling. |
| T1791 |
5831-5838 |
IN |
denotes |
Through |
| T1793 |
5839-5844 |
DT |
denotes |
these |
| T1794 |
5845-5850 |
NNS |
denotes |
links |
| T1795 |
5850-5852 |
, |
denotes |
, |
| T1796 |
5852-5855 |
NNS |
denotes |
AJs |
| T1792 |
5856-5862 |
VBP |
denotes |
appear |
| T1797 |
5863-5867 |
JJ |
denotes |
able |
| T1798 |
5868-5870 |
TO |
denotes |
to |
| T1799 |
5871-5877 |
VB |
denotes |
couple |
| T1800 |
5878-5886 |
NN |
denotes |
adhesion |
| T1801 |
5887-5891 |
IN |
denotes |
with |
| T1802 |
5892-5904 |
JJ |
denotes |
cytoskeletal |
| T1803 |
5905-5913 |
NNS |
denotes |
dynamics |
| T1804 |
5914-5916 |
RB |
denotes |
as |
| T1806 |
5917-5921 |
RB |
denotes |
well |
| T1805 |
5922-5924 |
IN |
denotes |
as |
| T1807 |
5925-5929 |
IN |
denotes |
with |
| T1808 |
5930-5937 |
JJ |
denotes |
nuclear |
| T1810 |
5938-5941 |
CC |
denotes |
and |
| T1811 |
5942-5953 |
JJ |
denotes |
cytoplasmic |
| T1809 |
5954-5963 |
NN |
denotes |
signaling |
| T1812 |
5963-5964 |
. |
denotes |
. |
| T1813 |
5964-6112 |
sentence |
denotes |
This provides a framework for conceptualizing why E-cadherin levels appear to impact upon a plethora of developmental processes (reviewed in [11]). |
| T1814 |
5965-5969 |
DT |
denotes |
This |
| T1815 |
5970-5978 |
VBZ |
denotes |
provides |
| T1816 |
5979-5980 |
DT |
denotes |
a |
| T1817 |
5981-5990 |
NN |
denotes |
framework |
| T1818 |
5991-5994 |
IN |
denotes |
for |
| T1819 |
5995-6010 |
VBG |
denotes |
conceptualizing |
| T1820 |
6011-6014 |
WRB |
denotes |
why |
| T1822 |
6015-6016 |
NN |
denotes |
E |
| T1824 |
6016-6017 |
HYPH |
denotes |
- |
| T1823 |
6017-6025 |
NN |
denotes |
cadherin |
| T1825 |
6026-6032 |
NNS |
denotes |
levels |
| T1821 |
6033-6039 |
VBP |
denotes |
appear |
| T1826 |
6040-6042 |
TO |
denotes |
to |
| T1827 |
6043-6049 |
VB |
denotes |
impact |
| T1828 |
6050-6054 |
IN |
denotes |
upon |
| T1829 |
6055-6056 |
DT |
denotes |
a |
| T1830 |
6057-6065 |
NN |
denotes |
plethora |
| T1831 |
6066-6068 |
IN |
denotes |
of |
| T1832 |
6069-6082 |
JJ |
denotes |
developmental |
| T1833 |
6083-6092 |
NNS |
denotes |
processes |
| T1834 |
6093-6094 |
-LRB- |
denotes |
( |
| T1835 |
6094-6102 |
VBN |
denotes |
reviewed |
| T1836 |
6103-6105 |
IN |
denotes |
in |
| T1837 |
6106-6107 |
-LRB- |
denotes |
[ |
| T1838 |
6107-6109 |
CD |
denotes |
11 |
| T1839 |
6109-6110 |
-RRB- |
denotes |
] |
| T1840 |
6110-6111 |
-RRB- |
denotes |
) |
| T1841 |
6111-6112 |
. |
denotes |
. |
| T1842 |
6112-6396 |
sentence |
denotes |
As we probed more deeply into the underlying mechanisms governing E-cadherin promoter activity, we were intrigued by the close proximity of the LEF-1/β-catenin binding site to a site known to bind the Snail/Slug family of zinc finger transcriptional repressor proteins [12,13,14,15]. |
| T1843 |
6113-6115 |
IN |
denotes |
As |
| T1845 |
6116-6118 |
PRP |
denotes |
we |
| T1844 |
6119-6125 |
VBD |
denotes |
probed |
| T1847 |
6126-6130 |
RBR |
denotes |
more |
| T1848 |
6131-6137 |
RB |
denotes |
deeply |
| T1849 |
6138-6142 |
IN |
denotes |
into |
| T1850 |
6143-6146 |
DT |
denotes |
the |
| T1852 |
6147-6157 |
JJ |
denotes |
underlying |
| T1851 |
6158-6168 |
NNS |
denotes |
mechanisms |
| T1853 |
6169-6178 |
VBG |
denotes |
governing |
| T1854 |
6179-6180 |
NN |
denotes |
E |
| T1856 |
6180-6181 |
HYPH |
denotes |
- |
| T1855 |
6181-6189 |
NN |
denotes |
cadherin |
| T1857 |
6190-6198 |
NN |
denotes |
promoter |
| T1858 |
6199-6207 |
NN |
denotes |
activity |
| T1859 |
6207-6209 |
, |
denotes |
, |
| T1860 |
6209-6211 |
PRP |
denotes |
we |
| T1861 |
6212-6216 |
VBD |
denotes |
were |
| T1846 |
6217-6226 |
VBN |
denotes |
intrigued |
| T1862 |
6227-6229 |
IN |
denotes |
by |
| T1863 |
6230-6233 |
DT |
denotes |
the |
| T1865 |
6234-6239 |
JJ |
denotes |
close |
| T1864 |
6240-6249 |
NN |
denotes |
proximity |
| T1866 |
6250-6252 |
IN |
denotes |
of |
| T1867 |
6253-6256 |
DT |
denotes |
the |
| T1869 |
6257-6260 |
NN |
denotes |
LEF |
| T1870 |
6260-6261 |
HYPH |
denotes |
- |
| T1871 |
6261-6262 |
CD |
denotes |
1 |
| T1872 |
6262-6263 |
HYPH |
denotes |
/ |
| T1873 |
6263-6264 |
NN |
denotes |
β |
| T1875 |
6264-6265 |
HYPH |
denotes |
- |
| T1874 |
6265-6272 |
NN |
denotes |
catenin |
| T1876 |
6273-6280 |
NN |
denotes |
binding |
| T1868 |
6281-6285 |
NN |
denotes |
site |
| T1877 |
6286-6288 |
IN |
denotes |
to |
| T1878 |
6289-6290 |
DT |
denotes |
a |
| T1879 |
6291-6295 |
NN |
denotes |
site |
| T1880 |
6296-6301 |
VBN |
denotes |
known |
| T1881 |
6302-6304 |
TO |
denotes |
to |
| T1882 |
6305-6309 |
VB |
denotes |
bind |
| T1883 |
6310-6313 |
DT |
denotes |
the |
| T1885 |
6314-6319 |
NN |
denotes |
Snail |
| T1887 |
6319-6320 |
HYPH |
denotes |
/ |
| T1886 |
6320-6324 |
NN |
denotes |
Slug |
| T1884 |
6325-6331 |
NN |
denotes |
family |
| T1888 |
6332-6334 |
IN |
denotes |
of |
| T1889 |
6335-6339 |
NN |
denotes |
zinc |
| T1890 |
6340-6346 |
NN |
denotes |
finger |
| T1892 |
6347-6362 |
JJ |
denotes |
transcriptional |
| T1893 |
6363-6372 |
NN |
denotes |
repressor |
| T1891 |
6373-6381 |
NN |
denotes |
proteins |
| T1894 |
6382-6383 |
-LRB- |
denotes |
[ |
| T1896 |
6383-6385 |
CD |
denotes |
12 |
| T1897 |
6385-6386 |
, |
denotes |
, |
| T1898 |
6386-6388 |
CD |
denotes |
13 |
| T1899 |
6388-6389 |
, |
denotes |
, |
| T1900 |
6389-6391 |
CD |
denotes |
14 |
| T1901 |
6391-6392 |
, |
denotes |
, |
| T1895 |
6392-6394 |
CD |
denotes |
15 |
| T1902 |
6394-6395 |
-RRB- |
denotes |
] |
| T1903 |
6395-6396 |
. |
denotes |
. |
| T1904 |
6396-6631 |
sentence |
denotes |
Both activity of Snail and down-regulation of E-cadherin play pivotal roles in epithelial to mesenchymal transitions (EMTs), typified by the transformation of polarized, adhering epithelial cells into motile mesenchymal cells [16,17]. |
| T1905 |
6397-6401 |
CC |
denotes |
Both |
| T1906 |
6402-6410 |
NN |
denotes |
activity |
| T1908 |
6411-6413 |
IN |
denotes |
of |
| T1909 |
6414-6419 |
NN |
denotes |
Snail |
| T1910 |
6420-6423 |
CC |
denotes |
and |
| T1911 |
6424-6428 |
NN |
denotes |
down |
| T1913 |
6428-6429 |
HYPH |
denotes |
- |
| T1912 |
6429-6439 |
NN |
denotes |
regulation |
| T1914 |
6440-6442 |
IN |
denotes |
of |
| T1915 |
6443-6444 |
NN |
denotes |
E |
| T1917 |
6444-6445 |
HYPH |
denotes |
- |
| T1916 |
6445-6453 |
NN |
denotes |
cadherin |
| T1907 |
6454-6458 |
VBP |
denotes |
play |
| T1918 |
6459-6466 |
JJ |
denotes |
pivotal |
| T1919 |
6467-6472 |
NNS |
denotes |
roles |
| T1920 |
6473-6475 |
IN |
denotes |
in |
| T1921 |
6476-6486 |
JJ |
denotes |
epithelial |
| T1923 |
6487-6489 |
IN |
denotes |
to |
| T1924 |
6490-6501 |
JJ |
denotes |
mesenchymal |
| T1922 |
6502-6513 |
NNS |
denotes |
transitions |
| T1925 |
6514-6515 |
-LRB- |
denotes |
( |
| T1926 |
6515-6519 |
NNS |
denotes |
EMTs |
| T1927 |
6519-6520 |
-RRB- |
denotes |
) |
| T1928 |
6520-6522 |
, |
denotes |
, |
| T1929 |
6522-6530 |
VBN |
denotes |
typified |
| T1930 |
6531-6533 |
IN |
denotes |
by |
| T1931 |
6534-6537 |
DT |
denotes |
the |
| T1932 |
6538-6552 |
NN |
denotes |
transformation |
| T1933 |
6553-6555 |
IN |
denotes |
of |
| T1934 |
6556-6565 |
VBN |
denotes |
polarized |
| T1936 |
6565-6567 |
, |
denotes |
, |
| T1937 |
6567-6575 |
VBG |
denotes |
adhering |
| T1938 |
6576-6586 |
JJ |
denotes |
epithelial |
| T1935 |
6587-6592 |
NNS |
denotes |
cells |
| T1939 |
6593-6597 |
IN |
denotes |
into |
| T1940 |
6598-6604 |
JJ |
denotes |
motile |
| T1942 |
6605-6616 |
JJ |
denotes |
mesenchymal |
| T1941 |
6617-6622 |
NNS |
denotes |
cells |
| T1943 |
6623-6624 |
-LRB- |
denotes |
[ |
| T1945 |
6624-6626 |
CD |
denotes |
16 |
| T1946 |
6626-6627 |
, |
denotes |
, |
| T1944 |
6627-6629 |
CD |
denotes |
17 |
| T1947 |
6629-6630 |
-RRB- |
denotes |
] |
| T1948 |
6630-6631 |
. |
denotes |
. |
| T1949 |
6631-6817 |
sentence |
denotes |
Bud formation differs from an EMT in that E-cadherin activity needs to be down-regulated but not prevented, so that adhesive junctions are remodeled rather than quantitatively impaired. |
| T1950 |
6632-6635 |
NN |
denotes |
Bud |
| T1951 |
6636-6645 |
NN |
denotes |
formation |
| T1952 |
6646-6653 |
VBZ |
denotes |
differs |
| T1953 |
6654-6658 |
IN |
denotes |
from |
| T1954 |
6659-6661 |
DT |
denotes |
an |
| T1955 |
6662-6665 |
NN |
denotes |
EMT |
| T1956 |
6666-6668 |
IN |
denotes |
in |
| T1958 |
6669-6673 |
DT |
denotes |
that |
| T1959 |
6674-6675 |
NN |
denotes |
E |
| T1961 |
6675-6676 |
HYPH |
denotes |
- |
| T1960 |
6676-6684 |
NN |
denotes |
cadherin |
| T1962 |
6685-6693 |
NN |
denotes |
activity |
| T1957 |
6694-6699 |
VBZ |
denotes |
needs |
| T1963 |
6700-6702 |
TO |
denotes |
to |
| T1965 |
6703-6705 |
VB |
denotes |
be |
| T1966 |
6706-6710 |
RB |
denotes |
down |
| T1967 |
6710-6711 |
HYPH |
denotes |
- |
| T1964 |
6711-6720 |
VBN |
denotes |
regulated |
| T1968 |
6721-6724 |
CC |
denotes |
but |
| T1969 |
6725-6728 |
RB |
denotes |
not |
| T1970 |
6729-6738 |
VBN |
denotes |
prevented |
| T1971 |
6738-6740 |
, |
denotes |
, |
| T1972 |
6740-6742 |
IN |
denotes |
so |
| T1974 |
6743-6747 |
IN |
denotes |
that |
| T1975 |
6748-6756 |
JJ |
denotes |
adhesive |
| T1976 |
6757-6766 |
NNS |
denotes |
junctions |
| T1977 |
6767-6770 |
VBP |
denotes |
are |
| T1973 |
6771-6780 |
VBN |
denotes |
remodeled |
| T1978 |
6781-6787 |
RB |
denotes |
rather |
| T1979 |
6788-6792 |
IN |
denotes |
than |
| T1980 |
6793-6807 |
RB |
denotes |
quantitatively |
| T1981 |
6808-6816 |
VBN |
denotes |
impaired |
| T1982 |
6816-6817 |
. |
denotes |
. |
| T1983 |
6817-7035 |
sentence |
denotes |
Supportive of an underlying ability to fine-tune cadherin expression at the transcriptional level, Snail seems to have an additive effect with LEF-1/β-catenin in negatively modulating E-cadherin promoter activity [4]. |
| T1984 |
6818-6828 |
JJ |
denotes |
Supportive |
| T1986 |
6829-6831 |
IN |
denotes |
of |
| T1987 |
6832-6834 |
DT |
denotes |
an |
| T1989 |
6835-6845 |
JJ |
denotes |
underlying |
| T1988 |
6846-6853 |
NN |
denotes |
ability |
| T1990 |
6854-6856 |
TO |
denotes |
to |
| T1992 |
6857-6861 |
RB |
denotes |
fine |
| T1993 |
6861-6862 |
HYPH |
denotes |
- |
| T1991 |
6862-6866 |
VB |
denotes |
tune |
| T1994 |
6867-6875 |
NN |
denotes |
cadherin |
| T1995 |
6876-6886 |
NN |
denotes |
expression |
| T1996 |
6887-6889 |
IN |
denotes |
at |
| T1997 |
6890-6893 |
DT |
denotes |
the |
| T1999 |
6894-6909 |
JJ |
denotes |
transcriptional |
| T1998 |
6910-6915 |
NN |
denotes |
level |
| T2000 |
6915-6917 |
, |
denotes |
, |
| T2001 |
6917-6922 |
NN |
denotes |
Snail |
| T1985 |
6923-6928 |
VBZ |
denotes |
seems |
| T2002 |
6929-6931 |
TO |
denotes |
to |
| T2003 |
6932-6936 |
VB |
denotes |
have |
| T2004 |
6937-6939 |
DT |
denotes |
an |
| T2006 |
6940-6948 |
JJ |
denotes |
additive |
| T2005 |
6949-6955 |
NN |
denotes |
effect |
| T2007 |
6956-6960 |
IN |
denotes |
with |
| T2008 |
6961-6964 |
NN |
denotes |
LEF |
| T2009 |
6964-6965 |
HYPH |
denotes |
- |
| T2010 |
6965-6966 |
CD |
denotes |
1 |
| T2011 |
6966-6967 |
HYPH |
denotes |
/ |
| T2012 |
6967-6968 |
NN |
denotes |
β |
| T2014 |
6968-6969 |
HYPH |
denotes |
- |
| T2013 |
6969-6976 |
NN |
denotes |
catenin |
| T2015 |
6977-6979 |
IN |
denotes |
in |
| T2016 |
6980-6990 |
RB |
denotes |
negatively |
| T2017 |
6991-7001 |
VBG |
denotes |
modulating |
| T2018 |
7002-7003 |
NN |
denotes |
E |
| T2020 |
7003-7004 |
HYPH |
denotes |
- |
| T2019 |
7004-7012 |
NN |
denotes |
cadherin |
| T2021 |
7013-7021 |
NN |
denotes |
promoter |
| T2022 |
7022-7030 |
NN |
denotes |
activity |
| T2023 |
7031-7032 |
-LRB- |
denotes |
[ |
| T2024 |
7032-7033 |
CD |
denotes |
4 |
| T2025 |
7033-7034 |
-RRB- |
denotes |
] |
| T2026 |
7034-7035 |
. |
denotes |
. |
| T2027 |
7035-7220 |
sentence |
denotes |
In the present study, we discovered that Snail is expressed briefly at an early stage of hair bud formation, when E-cadherin down-regulation and activation of proliferation take place. |
| T2028 |
7036-7038 |
IN |
denotes |
In |
| T2030 |
7039-7042 |
DT |
denotes |
the |
| T2032 |
7043-7050 |
JJ |
denotes |
present |
| T2031 |
7051-7056 |
NN |
denotes |
study |
| T2033 |
7056-7058 |
, |
denotes |
, |
| T2034 |
7058-7060 |
PRP |
denotes |
we |
| T2029 |
7061-7071 |
VBD |
denotes |
discovered |
| T2035 |
7072-7076 |
IN |
denotes |
that |
| T2037 |
7077-7082 |
NN |
denotes |
Snail |
| T2038 |
7083-7085 |
VBZ |
denotes |
is |
| T2036 |
7086-7095 |
VBN |
denotes |
expressed |
| T2039 |
7096-7103 |
RB |
denotes |
briefly |
| T2040 |
7104-7106 |
IN |
denotes |
at |
| T2041 |
7107-7109 |
DT |
denotes |
an |
| T2043 |
7110-7115 |
JJ |
denotes |
early |
| T2042 |
7116-7121 |
NN |
denotes |
stage |
| T2044 |
7122-7124 |
IN |
denotes |
of |
| T2045 |
7125-7129 |
NN |
denotes |
hair |
| T2046 |
7130-7133 |
NN |
denotes |
bud |
| T2047 |
7134-7143 |
NN |
denotes |
formation |
| T2048 |
7143-7145 |
, |
denotes |
, |
| T2049 |
7145-7149 |
WRB |
denotes |
when |
| T2051 |
7150-7151 |
NN |
denotes |
E |
| T2053 |
7151-7152 |
HYPH |
denotes |
- |
| T2052 |
7152-7160 |
NN |
denotes |
cadherin |
| T2054 |
7161-7165 |
JJ |
denotes |
down |
| T2056 |
7165-7166 |
HYPH |
denotes |
- |
| T2055 |
7166-7176 |
NN |
denotes |
regulation |
| T2057 |
7177-7180 |
CC |
denotes |
and |
| T2058 |
7181-7191 |
NN |
denotes |
activation |
| T2059 |
7192-7194 |
IN |
denotes |
of |
| T2060 |
7195-7208 |
NN |
denotes |
proliferation |
| T2050 |
7209-7213 |
VBP |
denotes |
take |
| T2061 |
7214-7219 |
NN |
denotes |
place |
| T2062 |
7219-7220 |
. |
denotes |
. |
| T2063 |
7220-7323 |
sentence |
denotes |
Thereafter, Snail disappears and remains absent during subsequent follicle down-growth and maturation. |
| T2064 |
7221-7231 |
RB |
denotes |
Thereafter |
| T2066 |
7231-7233 |
, |
denotes |
, |
| T2067 |
7233-7238 |
NN |
denotes |
Snail |
| T2065 |
7239-7249 |
VBZ |
denotes |
disappears |
| T2068 |
7250-7253 |
CC |
denotes |
and |
| T2069 |
7254-7261 |
VBZ |
denotes |
remains |
| T2070 |
7262-7268 |
JJ |
denotes |
absent |
| T2071 |
7269-7275 |
IN |
denotes |
during |
| T2072 |
7276-7286 |
JJ |
denotes |
subsequent |
| T2074 |
7287-7295 |
NN |
denotes |
follicle |
| T2075 |
7296-7300 |
JJ |
denotes |
down |
| T2076 |
7300-7301 |
HYPH |
denotes |
- |
| T2073 |
7301-7307 |
NN |
denotes |
growth |
| T2077 |
7308-7311 |
CC |
denotes |
and |
| T2078 |
7312-7322 |
NN |
denotes |
maturation |
| T2079 |
7322-7323 |
. |
denotes |
. |
| T2080 |
7323-7583 |
sentence |
denotes |
This exquisite pattern appears to be functionally relevant since altering it in vivo correspondingly affects features associated with hair bud formation, including down-regulation of E-cadherin, increased proliferation, and repressed terminal differentiation. |
| T2081 |
7324-7328 |
DT |
denotes |
This |
| T2083 |
7329-7338 |
JJ |
denotes |
exquisite |
| T2082 |
7339-7346 |
NN |
denotes |
pattern |
| T2084 |
7347-7354 |
VBZ |
denotes |
appears |
| T2085 |
7355-7357 |
TO |
denotes |
to |
| T2086 |
7358-7360 |
VB |
denotes |
be |
| T2087 |
7361-7373 |
RB |
denotes |
functionally |
| T2088 |
7374-7382 |
JJ |
denotes |
relevant |
| T2089 |
7383-7388 |
IN |
denotes |
since |
| T2091 |
7389-7397 |
VBG |
denotes |
altering |
| T2092 |
7398-7400 |
PRP |
denotes |
it |
| T2093 |
7401-7403 |
FW |
denotes |
in |
| T2094 |
7404-7408 |
FW |
denotes |
vivo |
| T2095 |
7409-7424 |
RB |
denotes |
correspondingly |
| T2090 |
7425-7432 |
VBZ |
denotes |
affects |
| T2096 |
7433-7441 |
NNS |
denotes |
features |
| T2097 |
7442-7452 |
VBN |
denotes |
associated |
| T2098 |
7453-7457 |
IN |
denotes |
with |
| T2099 |
7458-7462 |
NN |
denotes |
hair |
| T2100 |
7463-7466 |
NN |
denotes |
bud |
| T2101 |
7467-7476 |
NN |
denotes |
formation |
| T2102 |
7476-7478 |
, |
denotes |
, |
| T2103 |
7478-7487 |
VBG |
denotes |
including |
| T2104 |
7488-7492 |
NN |
denotes |
down |
| T2106 |
7492-7493 |
HYPH |
denotes |
- |
| T2105 |
7493-7503 |
NN |
denotes |
regulation |
| T2107 |
7504-7506 |
IN |
denotes |
of |
| T2108 |
7507-7508 |
NN |
denotes |
E |
| T2110 |
7508-7509 |
HYPH |
denotes |
- |
| T2109 |
7509-7517 |
NN |
denotes |
cadherin |
| T2111 |
7517-7519 |
, |
denotes |
, |
| T2112 |
7519-7528 |
VBN |
denotes |
increased |
| T2113 |
7529-7542 |
NN |
denotes |
proliferation |
| T2114 |
7542-7544 |
, |
denotes |
, |
| T2115 |
7544-7547 |
CC |
denotes |
and |
| T2116 |
7548-7557 |
VBN |
denotes |
repressed |
| T2118 |
7558-7566 |
JJ |
denotes |
terminal |
| T2117 |
7567-7582 |
NN |
denotes |
differentiation |
| T2119 |
7582-7583 |
. |
denotes |
. |
| T2120 |
7583-7829 |
sentence |
denotes |
Although the temporal spike of Snail in the hair bud is reflected at the mRNA level and seems to follow Wnt signaling and BMP inhibition, LEF-1/β-catenin activation does not appear to induce Snail gene expression in embryonic skin keratinocytes. |
| T2121 |
7584-7592 |
IN |
denotes |
Although |
| T2123 |
7593-7596 |
DT |
denotes |
the |
| T2125 |
7597-7605 |
JJ |
denotes |
temporal |
| T2124 |
7606-7611 |
NN |
denotes |
spike |
| T2126 |
7612-7614 |
IN |
denotes |
of |
| T2127 |
7615-7620 |
NN |
denotes |
Snail |
| T2128 |
7621-7623 |
IN |
denotes |
in |
| T2129 |
7624-7627 |
DT |
denotes |
the |
| T2131 |
7628-7632 |
NN |
denotes |
hair |
| T2130 |
7633-7636 |
NN |
denotes |
bud |
| T2132 |
7637-7639 |
VBZ |
denotes |
is |
| T2122 |
7640-7649 |
VBN |
denotes |
reflected |
| T2134 |
7650-7652 |
IN |
denotes |
at |
| T2135 |
7653-7656 |
DT |
denotes |
the |
| T2137 |
7657-7661 |
NN |
denotes |
mRNA |
| T2136 |
7662-7667 |
NN |
denotes |
level |
| T2138 |
7668-7671 |
CC |
denotes |
and |
| T2139 |
7672-7677 |
VBZ |
denotes |
seems |
| T2140 |
7678-7680 |
TO |
denotes |
to |
| T2141 |
7681-7687 |
VB |
denotes |
follow |
| T2142 |
7688-7691 |
NN |
denotes |
Wnt |
| T2143 |
7692-7701 |
NN |
denotes |
signaling |
| T2144 |
7702-7705 |
CC |
denotes |
and |
| T2145 |
7706-7709 |
NN |
denotes |
BMP |
| T2146 |
7710-7720 |
NN |
denotes |
inhibition |
| T2147 |
7720-7722 |
, |
denotes |
, |
| T2148 |
7722-7725 |
NN |
denotes |
LEF |
| T2150 |
7725-7726 |
HYPH |
denotes |
- |
| T2151 |
7726-7727 |
CD |
denotes |
1 |
| T2152 |
7727-7728 |
HYPH |
denotes |
/ |
| T2153 |
7728-7729 |
NN |
denotes |
β |
| T2155 |
7729-7730 |
HYPH |
denotes |
- |
| T2154 |
7730-7737 |
NN |
denotes |
catenin |
| T2149 |
7738-7748 |
NN |
denotes |
activation |
| T2156 |
7749-7753 |
VBZ |
denotes |
does |
| T2157 |
7754-7757 |
RB |
denotes |
not |
| T2133 |
7758-7764 |
VB |
denotes |
appear |
| T2158 |
7765-7767 |
TO |
denotes |
to |
| T2159 |
7768-7774 |
VB |
denotes |
induce |
| T2160 |
7775-7780 |
NN |
denotes |
Snail |
| T2162 |
7781-7785 |
NN |
denotes |
gene |
| T2161 |
7786-7796 |
NN |
denotes |
expression |
| T2163 |
7797-7799 |
IN |
denotes |
in |
| T2164 |
7800-7809 |
JJ |
denotes |
embryonic |
| T2166 |
7810-7814 |
NN |
denotes |
skin |
| T2165 |
7815-7828 |
NNS |
denotes |
keratinocytes |
| T2167 |
7828-7829 |
. |
denotes |
. |
| T2168 |
7829-8088 |
sentence |
denotes |
In contrast, we provide in vitro, transgenic (Tg), and gene targeting evidence to show that TGF-β2 and small phenotype– and mothers against decapentaplegic–related protein 2 (SMAD2) signaling are upstream inducers of Snail gene expression in skin epithelium. |
| T2169 |
7830-7832 |
IN |
denotes |
In |
| T2171 |
7833-7841 |
NN |
denotes |
contrast |
| T2172 |
7841-7843 |
, |
denotes |
, |
| T2173 |
7843-7845 |
PRP |
denotes |
we |
| T2170 |
7846-7853 |
VBP |
denotes |
provide |
| T2174 |
7854-7856 |
FW |
denotes |
in |
| T2175 |
7857-7862 |
FW |
denotes |
vitro |
| T2177 |
7862-7864 |
, |
denotes |
, |
| T2178 |
7864-7874 |
JJ |
denotes |
transgenic |
| T2179 |
7875-7876 |
-LRB- |
denotes |
( |
| T2180 |
7876-7878 |
JJ |
denotes |
Tg |
| T2181 |
7878-7879 |
-RRB- |
denotes |
) |
| T2182 |
7879-7881 |
, |
denotes |
, |
| T2183 |
7881-7884 |
CC |
denotes |
and |
| T2184 |
7885-7889 |
NN |
denotes |
gene |
| T2185 |
7890-7899 |
VBG |
denotes |
targeting |
| T2176 |
7900-7908 |
NN |
denotes |
evidence |
| T2186 |
7909-7911 |
TO |
denotes |
to |
| T2187 |
7912-7916 |
VB |
denotes |
show |
| T2188 |
7917-7921 |
IN |
denotes |
that |
| T2190 |
7922-7925 |
NN |
denotes |
TGF |
| T2192 |
7925-7926 |
HYPH |
denotes |
- |
| T2191 |
7926-7928 |
NN |
denotes |
β2 |
| T2194 |
7929-7932 |
CC |
denotes |
and |
| T2195 |
7933-7938 |
JJ |
denotes |
small |
| T2196 |
7939-7948 |
NN |
denotes |
phenotype |
| T2198 |
7948-7949 |
-LRB- |
denotes |
– |
| T2199 |
7950-7953 |
CC |
denotes |
and |
| T2200 |
7954-7961 |
NNS |
denotes |
mothers |
| T2201 |
7962-7969 |
IN |
denotes |
against |
| T2202 |
7970-7985 |
NN |
denotes |
decapentaplegic |
| T2203 |
7985-7986 |
-RRB- |
denotes |
– |
| T2197 |
7986-7993 |
VBN |
denotes |
related |
| T2204 |
7994-8001 |
NN |
denotes |
protein |
| T2205 |
8002-8003 |
CD |
denotes |
2 |
| T2206 |
8004-8005 |
-LRB- |
denotes |
( |
| T2207 |
8005-8010 |
NN |
denotes |
SMAD2 |
| T2208 |
8010-8011 |
-RRB- |
denotes |
) |
| T2193 |
8012-8021 |
NN |
denotes |
signaling |
| T2189 |
8022-8025 |
VBP |
denotes |
are |
| T2209 |
8026-8034 |
JJ |
denotes |
upstream |
| T2210 |
8035-8043 |
NNS |
denotes |
inducers |
| T2211 |
8044-8046 |
IN |
denotes |
of |
| T2212 |
8047-8052 |
NN |
denotes |
Snail |
| T2214 |
8053-8057 |
NN |
denotes |
gene |
| T2213 |
8058-8068 |
NN |
denotes |
expression |
| T2215 |
8069-8071 |
IN |
denotes |
in |
| T2216 |
8072-8076 |
NN |
denotes |
skin |
| T2217 |
8077-8087 |
NN |
denotes |
epithelium |
| T2218 |
8087-8088 |
. |
denotes |
. |
| T2219 |
8088-8219 |
sentence |
denotes |
In the absence of TGF-β2 signaling and Snail gene expression, hair placodes can form, but further follicle down-growth is blocked. |
| T2220 |
8089-8091 |
IN |
denotes |
In |
| T2222 |
8092-8095 |
DT |
denotes |
the |
| T2223 |
8096-8103 |
NN |
denotes |
absence |
| T2224 |
8104-8106 |
IN |
denotes |
of |
| T2225 |
8107-8110 |
NN |
denotes |
TGF |
| T2227 |
8110-8111 |
HYPH |
denotes |
- |
| T2226 |
8111-8113 |
NN |
denotes |
β2 |
| T2228 |
8114-8123 |
NN |
denotes |
signaling |
| T2229 |
8124-8127 |
CC |
denotes |
and |
| T2230 |
8128-8133 |
NN |
denotes |
Snail |
| T2232 |
8134-8138 |
NN |
denotes |
gene |
| T2231 |
8139-8149 |
NN |
denotes |
expression |
| T2233 |
8149-8151 |
, |
denotes |
, |
| T2234 |
8151-8155 |
NN |
denotes |
hair |
| T2235 |
8156-8164 |
NNS |
denotes |
placodes |
| T2236 |
8165-8168 |
MD |
denotes |
can |
| T2221 |
8169-8173 |
VB |
denotes |
form |
| T2237 |
8173-8175 |
, |
denotes |
, |
| T2238 |
8175-8178 |
CC |
denotes |
but |
| T2239 |
8179-8186 |
JJ |
denotes |
further |
| T2241 |
8187-8195 |
NN |
denotes |
follicle |
| T2242 |
8196-8200 |
JJ |
denotes |
down |
| T2243 |
8200-8201 |
HYPH |
denotes |
- |
| T2240 |
8201-8207 |
NN |
denotes |
growth |
| T2245 |
8208-8210 |
VBZ |
denotes |
is |
| T2244 |
8211-8218 |
VBN |
denotes |
blocked |
| T2246 |
8218-8219 |
. |
denotes |
. |
| T2247 |
8219-8397 |
sentence |
denotes |
Our studies point to the view that Snail likely functions downstream of cell fate specification, at a stage where the bud begins to exhibit enhanced proliferation and migration. |
| T2248 |
8220-8223 |
PRP$ |
denotes |
Our |
| T2249 |
8224-8231 |
NNS |
denotes |
studies |
| T2250 |
8232-8237 |
VBP |
denotes |
point |
| T2251 |
8238-8240 |
IN |
denotes |
to |
| T2252 |
8241-8244 |
DT |
denotes |
the |
| T2253 |
8245-8249 |
NN |
denotes |
view |
| T2254 |
8250-8254 |
IN |
denotes |
that |
| T2256 |
8255-8260 |
NN |
denotes |
Snail |
| T2257 |
8261-8267 |
RB |
denotes |
likely |
| T2255 |
8268-8277 |
VBZ |
denotes |
functions |
| T2258 |
8278-8288 |
RB |
denotes |
downstream |
| T2259 |
8289-8291 |
IN |
denotes |
of |
| T2260 |
8292-8296 |
NN |
denotes |
cell |
| T2261 |
8297-8301 |
NN |
denotes |
fate |
| T2262 |
8302-8315 |
NN |
denotes |
specification |
| T2263 |
8315-8317 |
, |
denotes |
, |
| T2264 |
8317-8319 |
IN |
denotes |
at |
| T2265 |
8320-8321 |
DT |
denotes |
a |
| T2266 |
8322-8327 |
NN |
denotes |
stage |
| T2267 |
8328-8333 |
WRB |
denotes |
where |
| T2269 |
8334-8337 |
DT |
denotes |
the |
| T2270 |
8338-8341 |
NN |
denotes |
bud |
| T2268 |
8342-8348 |
VBZ |
denotes |
begins |
| T2271 |
8349-8351 |
TO |
denotes |
to |
| T2272 |
8352-8359 |
VB |
denotes |
exhibit |
| T2273 |
8360-8368 |
VBN |
denotes |
enhanced |
| T2274 |
8369-8382 |
NN |
denotes |
proliferation |
| T2275 |
8383-8386 |
CC |
denotes |
and |
| T2276 |
8387-8396 |
NN |
denotes |
migration |
| T2277 |
8396-8397 |
. |
denotes |
. |
| T2702 |
8408-8413 |
NN |
denotes |
Snail |
| T2703 |
8414-8418 |
NN |
denotes |
mRNA |
| T2705 |
8419-8422 |
CC |
denotes |
and |
| T2706 |
8423-8430 |
NN |
denotes |
Protein |
| T2707 |
8431-8434 |
VBP |
denotes |
Are |
| T2704 |
8435-8444 |
VBN |
denotes |
Expressed |
| T2708 |
8445-8456 |
RB |
denotes |
Transiently |
| T2709 |
8457-8459 |
IN |
denotes |
at |
| T2710 |
8460-8463 |
DT |
denotes |
the |
| T2712 |
8464-8468 |
NN |
denotes |
Hair |
| T2713 |
8469-8472 |
NN |
denotes |
Bud |
| T2711 |
8473-8478 |
NN |
denotes |
Stage |
| T2714 |
8479-8481 |
IN |
denotes |
of |
| T2715 |
8482-8490 |
NN |
denotes |
Follicle |
| T2716 |
8491-8504 |
NN |
denotes |
Morphogenesis |
| T2717 |
8504-8721 |
sentence |
denotes |
Although Snail family members are most frequently associated with EMTs, they also participate in many malignant processes involving a down-regulation but not a quantitative abrogation of intercellular junctions [18]. |
| T2718 |
8505-8513 |
IN |
denotes |
Although |
| T2720 |
8514-8519 |
NN |
denotes |
Snail |
| T2722 |
8520-8526 |
NN |
denotes |
family |
| T2721 |
8527-8534 |
NNS |
denotes |
members |
| T2723 |
8535-8538 |
VBP |
denotes |
are |
| T2724 |
8539-8543 |
RBS |
denotes |
most |
| T2725 |
8544-8554 |
RB |
denotes |
frequently |
| T2719 |
8555-8565 |
VBN |
denotes |
associated |
| T2727 |
8566-8570 |
IN |
denotes |
with |
| T2728 |
8571-8575 |
NNS |
denotes |
EMTs |
| T2729 |
8575-8577 |
, |
denotes |
, |
| T2730 |
8577-8581 |
PRP |
denotes |
they |
| T2731 |
8582-8586 |
RB |
denotes |
also |
| T2726 |
8587-8598 |
VBP |
denotes |
participate |
| T2732 |
8599-8601 |
IN |
denotes |
in |
| T2733 |
8602-8606 |
JJ |
denotes |
many |
| T2735 |
8607-8616 |
JJ |
denotes |
malignant |
| T2734 |
8617-8626 |
NNS |
denotes |
processes |
| T2736 |
8627-8636 |
VBG |
denotes |
involving |
| T2737 |
8637-8638 |
DT |
denotes |
a |
| T2739 |
8639-8643 |
JJ |
denotes |
down |
| T2740 |
8643-8644 |
HYPH |
denotes |
- |
| T2738 |
8644-8654 |
NN |
denotes |
regulation |
| T2741 |
8655-8658 |
CC |
denotes |
but |
| T2742 |
8659-8662 |
RB |
denotes |
not |
| T2743 |
8663-8664 |
DT |
denotes |
a |
| T2745 |
8665-8677 |
JJ |
denotes |
quantitative |
| T2744 |
8678-8688 |
NN |
denotes |
abrogation |
| T2746 |
8689-8691 |
IN |
denotes |
of |
| T2747 |
8692-8705 |
JJ |
denotes |
intercellular |
| T2748 |
8706-8715 |
NNS |
denotes |
junctions |
| T2749 |
8716-8717 |
-LRB- |
denotes |
[ |
| T2750 |
8717-8719 |
CD |
denotes |
18 |
| T2751 |
8719-8720 |
-RRB- |
denotes |
] |
| T2752 |
8720-8721 |
. |
denotes |
. |
| T2753 |
8721-8906 |
sentence |
denotes |
The range of developmental processes in which Snail family members have been implicated thus includes the type of epithelial remodeling that is observed in hair follicle bud formation. |
| T2754 |
8722-8725 |
DT |
denotes |
The |
| T2755 |
8726-8731 |
NN |
denotes |
range |
| T2757 |
8732-8734 |
IN |
denotes |
of |
| T2758 |
8735-8748 |
JJ |
denotes |
developmental |
| T2759 |
8749-8758 |
NNS |
denotes |
processes |
| T2760 |
8759-8761 |
IN |
denotes |
in |
| T2762 |
8762-8767 |
WDT |
denotes |
which |
| T2763 |
8768-8773 |
NN |
denotes |
Snail |
| T2765 |
8774-8780 |
NN |
denotes |
family |
| T2764 |
8781-8788 |
NNS |
denotes |
members |
| T2766 |
8789-8793 |
VBP |
denotes |
have |
| T2767 |
8794-8798 |
VBN |
denotes |
been |
| T2761 |
8799-8809 |
VBN |
denotes |
implicated |
| T2768 |
8810-8814 |
RB |
denotes |
thus |
| T2756 |
8815-8823 |
VBZ |
denotes |
includes |
| T2769 |
8824-8827 |
DT |
denotes |
the |
| T2770 |
8828-8832 |
NN |
denotes |
type |
| T2771 |
8833-8835 |
IN |
denotes |
of |
| T2772 |
8836-8846 |
JJ |
denotes |
epithelial |
| T2773 |
8847-8857 |
NN |
denotes |
remodeling |
| T2774 |
8858-8862 |
WDT |
denotes |
that |
| T2776 |
8863-8865 |
VBZ |
denotes |
is |
| T2775 |
8866-8874 |
VBN |
denotes |
observed |
| T2777 |
8875-8877 |
IN |
denotes |
in |
| T2778 |
8878-8882 |
NN |
denotes |
hair |
| T2779 |
8883-8891 |
NN |
denotes |
follicle |
| T2780 |
8892-8895 |
NN |
denotes |
bud |
| T2781 |
8896-8905 |
NN |
denotes |
formation |
| T2782 |
8905-8906 |
. |
denotes |
. |
| T2783 |
8906-9260 |
sentence |
denotes |
Given our prior observation that exogenously added Snail can participate with LEF-1/β-catenin in down-regulating E-cadherin expression in keratinocytes [4], coupled with the established requirement for LEF-1/β-catenin in hair follicle morphogenesis [4,19], we turned to addressing whether Snail/Slug family members might also participate in the process. |
| T2784 |
8907-8912 |
VBN |
denotes |
Given |
| T2786 |
8913-8916 |
PRP$ |
denotes |
our |
| T2788 |
8917-8922 |
JJ |
denotes |
prior |
| T2787 |
8923-8934 |
NN |
denotes |
observation |
| T2789 |
8935-8939 |
IN |
denotes |
that |
| T2791 |
8940-8951 |
RB |
denotes |
exogenously |
| T2792 |
8952-8957 |
VBN |
denotes |
added |
| T2793 |
8958-8963 |
NN |
denotes |
Snail |
| T2794 |
8964-8967 |
MD |
denotes |
can |
| T2790 |
8968-8979 |
VB |
denotes |
participate |
| T2795 |
8980-8984 |
IN |
denotes |
with |
| T2796 |
8985-8988 |
NN |
denotes |
LEF |
| T2797 |
8988-8989 |
HYPH |
denotes |
- |
| T2798 |
8989-8990 |
CD |
denotes |
1 |
| T2799 |
8990-8991 |
HYPH |
denotes |
/ |
| T2800 |
8991-8992 |
NN |
denotes |
β |
| T2802 |
8992-8993 |
HYPH |
denotes |
- |
| T2801 |
8993-9000 |
NN |
denotes |
catenin |
| T2803 |
9001-9003 |
IN |
denotes |
in |
| T2804 |
9004-9008 |
RB |
denotes |
down |
| T2806 |
9008-9009 |
HYPH |
denotes |
- |
| T2805 |
9009-9019 |
VBG |
denotes |
regulating |
| T2807 |
9020-9021 |
NN |
denotes |
E |
| T2809 |
9021-9022 |
HYPH |
denotes |
- |
| T2808 |
9022-9030 |
NN |
denotes |
cadherin |
| T2810 |
9031-9041 |
NN |
denotes |
expression |
| T2811 |
9042-9044 |
IN |
denotes |
in |
| T2812 |
9045-9058 |
NNS |
denotes |
keratinocytes |
| T2813 |
9059-9060 |
-LRB- |
denotes |
[ |
| T2814 |
9060-9061 |
CD |
denotes |
4 |
| T2815 |
9061-9062 |
-RRB- |
denotes |
] |
| T2816 |
9062-9064 |
, |
denotes |
, |
| T2817 |
9064-9071 |
VBN |
denotes |
coupled |
| T2818 |
9072-9076 |
IN |
denotes |
with |
| T2819 |
9077-9080 |
DT |
denotes |
the |
| T2821 |
9081-9092 |
JJ |
denotes |
established |
| T2820 |
9093-9104 |
NN |
denotes |
requirement |
| T2822 |
9105-9108 |
IN |
denotes |
for |
| T2823 |
9109-9112 |
NN |
denotes |
LEF |
| T2824 |
9112-9113 |
HYPH |
denotes |
- |
| T2825 |
9113-9114 |
CD |
denotes |
1 |
| T2826 |
9114-9115 |
HYPH |
denotes |
/ |
| T2827 |
9115-9116 |
NN |
denotes |
β |
| T2829 |
9116-9117 |
HYPH |
denotes |
- |
| T2828 |
9117-9124 |
NN |
denotes |
catenin |
| T2830 |
9125-9127 |
IN |
denotes |
in |
| T2831 |
9128-9132 |
NN |
denotes |
hair |
| T2832 |
9133-9141 |
NN |
denotes |
follicle |
| T2833 |
9142-9155 |
NN |
denotes |
morphogenesis |
| T2834 |
9156-9157 |
-LRB- |
denotes |
[ |
| T2836 |
9157-9158 |
CD |
denotes |
4 |
| T2837 |
9158-9159 |
, |
denotes |
, |
| T2835 |
9159-9161 |
CD |
denotes |
19 |
| T2838 |
9161-9162 |
-RRB- |
denotes |
] |
| T2839 |
9162-9164 |
, |
denotes |
, |
| T2840 |
9164-9166 |
PRP |
denotes |
we |
| T2785 |
9167-9173 |
VBD |
denotes |
turned |
| T2841 |
9174-9176 |
IN |
denotes |
to |
| T2842 |
9177-9187 |
VBG |
denotes |
addressing |
| T2843 |
9188-9195 |
IN |
denotes |
whether |
| T2845 |
9196-9201 |
NN |
denotes |
Snail |
| T2847 |
9201-9202 |
HYPH |
denotes |
/ |
| T2846 |
9202-9206 |
NN |
denotes |
Slug |
| T2849 |
9207-9213 |
NN |
denotes |
family |
| T2848 |
9214-9221 |
NNS |
denotes |
members |
| T2850 |
9222-9227 |
MD |
denotes |
might |
| T2851 |
9228-9232 |
RB |
denotes |
also |
| T2844 |
9233-9244 |
VB |
denotes |
participate |
| T2852 |
9245-9247 |
IN |
denotes |
in |
| T2853 |
9248-9251 |
DT |
denotes |
the |
| T2854 |
9252-9259 |
NN |
denotes |
process |
| T2855 |
9259-9260 |
. |
denotes |
. |
| T2856 |
9260-9415 |
sentence |
denotes |
PCR analyses identified transient Snail mRNA expression during a period of skin embryogenesis when waves of hair follicles are forming (unpublished data). |
| T2857 |
9261-9264 |
NN |
denotes |
PCR |
| T2858 |
9265-9273 |
NNS |
denotes |
analyses |
| T2859 |
9274-9284 |
VBD |
denotes |
identified |
| T2860 |
9285-9294 |
JJ |
denotes |
transient |
| T2862 |
9295-9300 |
NN |
denotes |
Snail |
| T2863 |
9301-9305 |
NN |
denotes |
mRNA |
| T2861 |
9306-9316 |
NN |
denotes |
expression |
| T2864 |
9317-9323 |
IN |
denotes |
during |
| T2865 |
9324-9325 |
DT |
denotes |
a |
| T2866 |
9326-9332 |
NN |
denotes |
period |
| T2867 |
9333-9335 |
IN |
denotes |
of |
| T2868 |
9336-9340 |
NN |
denotes |
skin |
| T2869 |
9341-9354 |
NN |
denotes |
embryogenesis |
| T2870 |
9355-9359 |
WRB |
denotes |
when |
| T2872 |
9360-9365 |
NNS |
denotes |
waves |
| T2873 |
9366-9368 |
IN |
denotes |
of |
| T2874 |
9369-9373 |
NN |
denotes |
hair |
| T2875 |
9374-9383 |
NNS |
denotes |
follicles |
| T2876 |
9384-9387 |
VBP |
denotes |
are |
| T2871 |
9388-9395 |
VBG |
denotes |
forming |
| T2877 |
9396-9397 |
-LRB- |
denotes |
( |
| T2879 |
9397-9408 |
JJ |
denotes |
unpublished |
| T2878 |
9409-9413 |
NNS |
denotes |
data |
| T2880 |
9413-9414 |
-RRB- |
denotes |
) |
| T2881 |
9414-9415 |
. |
denotes |
. |
| T2882 |
9415-9417 |
TO |
denotes |
To |
| T2884 |
9415-9597 |
sentence |
denotes |
To pinpoint specifically where Snail mRNA is expressed in the developing skin, we conducted in situ hybridization using a cRNA probe unique to the Snail 3′ untranslated region (UTR). |
| T2883 |
9418-9426 |
VB |
denotes |
pinpoint |
| T2886 |
9427-9439 |
RB |
denotes |
specifically |
| T2887 |
9440-9445 |
WRB |
denotes |
where |
| T2889 |
9446-9451 |
NN |
denotes |
Snail |
| T2890 |
9452-9456 |
NN |
denotes |
mRNA |
| T2891 |
9457-9459 |
VBZ |
denotes |
is |
| T2888 |
9460-9469 |
VBN |
denotes |
expressed |
| T2892 |
9470-9472 |
IN |
denotes |
in |
| T2893 |
9473-9476 |
DT |
denotes |
the |
| T2895 |
9477-9487 |
VBG |
denotes |
developing |
| T2894 |
9488-9492 |
NN |
denotes |
skin |
| T2896 |
9492-9494 |
, |
denotes |
, |
| T2897 |
9494-9496 |
PRP |
denotes |
we |
| T2885 |
9497-9506 |
VBD |
denotes |
conducted |
| T2898 |
9507-9509 |
FW |
denotes |
in |
| T2899 |
9510-9514 |
FW |
denotes |
situ |
| T2900 |
9515-9528 |
NN |
denotes |
hybridization |
| T2901 |
9529-9534 |
VBG |
denotes |
using |
| T2902 |
9535-9536 |
DT |
denotes |
a |
| T2904 |
9537-9541 |
NN |
denotes |
cRNA |
| T2903 |
9542-9547 |
NN |
denotes |
probe |
| T2905 |
9548-9554 |
JJ |
denotes |
unique |
| T2906 |
9555-9557 |
IN |
denotes |
to |
| T2907 |
9558-9561 |
DT |
denotes |
the |
| T2909 |
9562-9567 |
NNP |
denotes |
Snail |
| T2910 |
9568-9569 |
CD |
denotes |
3 |
| T2911 |
9569-9570 |
SYM |
denotes |
′ |
| T2912 |
9571-9583 |
JJ |
denotes |
untranslated |
| T2908 |
9584-9590 |
NN |
denotes |
region |
| T2913 |
9591-9592 |
-LRB- |
denotes |
( |
| T2914 |
9592-9595 |
NN |
denotes |
UTR |
| T2915 |
9595-9596 |
-RRB- |
denotes |
) |
| T2916 |
9596-9597 |
. |
denotes |
. |
| T2917 |
9597-9786 |
sentence |
denotes |
Embryonic day 17.5 (E17.5) was chosen, since the multiple waves of follicle morphogenesis occurring at this time enabled us to evaluate Snail expression at different stages of the process. |
| T2918 |
9598-9607 |
JJ |
denotes |
Embryonic |
| T2919 |
9608-9611 |
NN |
denotes |
day |
| T2921 |
9612-9616 |
CD |
denotes |
17.5 |
| T2922 |
9617-9618 |
-LRB- |
denotes |
( |
| T2923 |
9618-9623 |
NN |
denotes |
E17.5 |
| T2924 |
9623-9624 |
-RRB- |
denotes |
) |
| T2925 |
9625-9628 |
VBD |
denotes |
was |
| T2920 |
9629-9635 |
VBN |
denotes |
chosen |
| T2926 |
9635-9637 |
, |
denotes |
, |
| T2927 |
9637-9642 |
IN |
denotes |
since |
| T2929 |
9643-9646 |
DT |
denotes |
the |
| T2931 |
9647-9655 |
JJ |
denotes |
multiple |
| T2930 |
9656-9661 |
NNS |
denotes |
waves |
| T2932 |
9662-9664 |
IN |
denotes |
of |
| T2933 |
9665-9673 |
NN |
denotes |
follicle |
| T2934 |
9674-9687 |
NN |
denotes |
morphogenesis |
| T2935 |
9688-9697 |
VBG |
denotes |
occurring |
| T2936 |
9698-9700 |
IN |
denotes |
at |
| T2937 |
9701-9705 |
DT |
denotes |
this |
| T2938 |
9706-9710 |
NN |
denotes |
time |
| T2928 |
9711-9718 |
VBD |
denotes |
enabled |
| T2939 |
9719-9721 |
PRP |
denotes |
us |
| T2940 |
9722-9724 |
TO |
denotes |
to |
| T2941 |
9725-9733 |
VB |
denotes |
evaluate |
| T2942 |
9734-9739 |
NN |
denotes |
Snail |
| T2943 |
9740-9750 |
NN |
denotes |
expression |
| T2944 |
9751-9753 |
IN |
denotes |
at |
| T2945 |
9754-9763 |
JJ |
denotes |
different |
| T2946 |
9764-9770 |
NNS |
denotes |
stages |
| T2947 |
9771-9773 |
IN |
denotes |
of |
| T2948 |
9774-9777 |
DT |
denotes |
the |
| T2949 |
9778-9785 |
NN |
denotes |
process |
| T2950 |
9785-9786 |
. |
denotes |
. |
| T2951 |
9786-9889 |
sentence |
denotes |
As shown in Figure 1A, specific hybridization was detected within the epithelium of nascent hair buds. |
| T2952 |
9787-9789 |
IN |
denotes |
As |
| T2953 |
9790-9795 |
VBN |
denotes |
shown |
| T2955 |
9796-9798 |
IN |
denotes |
in |
| T2956 |
9799-9805 |
NN |
denotes |
Figure |
| T2957 |
9806-9808 |
NN |
denotes |
1A |
| T2958 |
9808-9810 |
, |
denotes |
, |
| T2959 |
9810-9818 |
JJ |
denotes |
specific |
| T2960 |
9819-9832 |
NN |
denotes |
hybridization |
| T2961 |
9833-9836 |
VBD |
denotes |
was |
| T2954 |
9837-9845 |
VBN |
denotes |
detected |
| T2962 |
9846-9852 |
IN |
denotes |
within |
| T2963 |
9853-9856 |
DT |
denotes |
the |
| T2964 |
9857-9867 |
NN |
denotes |
epithelium |
| T2965 |
9868-9870 |
IN |
denotes |
of |
| T2966 |
9871-9878 |
JJ |
denotes |
nascent |
| T2968 |
9879-9883 |
NN |
denotes |
hair |
| T2967 |
9884-9888 |
NNS |
denotes |
buds |
| T2969 |
9888-9889 |
. |
denotes |
. |
| T2970 |
9889-10043 |
sentence |
denotes |
By contrast, as follicles progressed further through their development (e.g., germ and peg stages), they exhibited no signs of hybridization (Figure 1A). |
| T2971 |
9890-9892 |
IN |
denotes |
By |
| T2973 |
9893-9901 |
NN |
denotes |
contrast |
| T2974 |
9901-9903 |
, |
denotes |
, |
| T2975 |
9903-9905 |
IN |
denotes |
as |
| T2977 |
9906-9915 |
NNS |
denotes |
follicles |
| T2976 |
9916-9926 |
VBD |
denotes |
progressed |
| T2978 |
9927-9934 |
RBR |
denotes |
further |
| T2979 |
9935-9942 |
IN |
denotes |
through |
| T2980 |
9943-9948 |
PRP$ |
denotes |
their |
| T2981 |
9949-9960 |
NN |
denotes |
development |
| T2982 |
9961-9962 |
-LRB- |
denotes |
( |
| T2984 |
9962-9966 |
FW |
denotes |
e.g. |
| T2985 |
9966-9968 |
, |
denotes |
, |
| T2986 |
9968-9972 |
NN |
denotes |
germ |
| T2987 |
9973-9976 |
CC |
denotes |
and |
| T2988 |
9977-9980 |
NN |
denotes |
peg |
| T2983 |
9981-9987 |
NNS |
denotes |
stages |
| T2989 |
9987-9988 |
-RRB- |
denotes |
) |
| T2990 |
9988-9990 |
, |
denotes |
, |
| T2991 |
9990-9994 |
PRP |
denotes |
they |
| T2972 |
9995-10004 |
VBD |
denotes |
exhibited |
| T2992 |
10005-10007 |
DT |
denotes |
no |
| T2993 |
10008-10013 |
NNS |
denotes |
signs |
| T2994 |
10014-10016 |
IN |
denotes |
of |
| T2995 |
10017-10030 |
NN |
denotes |
hybridization |
| T2996 |
10031-10032 |
-LRB- |
denotes |
( |
| T2998 |
10032-10038 |
NN |
denotes |
Figure |
| T2997 |
10039-10041 |
NN |
denotes |
1A |
| T2999 |
10041-10042 |
-RRB- |
denotes |
) |
| T3000 |
10042-10043 |
. |
denotes |
. |
| T3001 |
10043-10250 |
sentence |
denotes |
The transient nature of Snail mRNA expression during follicle development was most apparent in hybridized skin sections containing follicles from two different waves of morphogenesis (as shown in Figure 1). |
| T3002 |
10044-10047 |
DT |
denotes |
The |
| T3004 |
10048-10057 |
JJ |
denotes |
transient |
| T3003 |
10058-10064 |
NN |
denotes |
nature |
| T3006 |
10065-10067 |
IN |
denotes |
of |
| T3007 |
10068-10073 |
NN |
denotes |
Snail |
| T3009 |
10074-10078 |
NN |
denotes |
mRNA |
| T3008 |
10079-10089 |
NN |
denotes |
expression |
| T3010 |
10090-10096 |
IN |
denotes |
during |
| T3011 |
10097-10105 |
NN |
denotes |
follicle |
| T3012 |
10106-10117 |
NN |
denotes |
development |
| T3005 |
10118-10121 |
VBD |
denotes |
was |
| T3013 |
10122-10126 |
RBS |
denotes |
most |
| T3014 |
10127-10135 |
JJ |
denotes |
apparent |
| T3015 |
10136-10138 |
IN |
denotes |
in |
| T3016 |
10139-10149 |
VBN |
denotes |
hybridized |
| T3018 |
10150-10154 |
NN |
denotes |
skin |
| T3017 |
10155-10163 |
NNS |
denotes |
sections |
| T3019 |
10164-10174 |
VBG |
denotes |
containing |
| T3020 |
10175-10184 |
NNS |
denotes |
follicles |
| T3021 |
10185-10189 |
IN |
denotes |
from |
| T3022 |
10190-10193 |
CD |
denotes |
two |
| T3024 |
10194-10203 |
JJ |
denotes |
different |
| T3023 |
10204-10209 |
NNS |
denotes |
waves |
| T3025 |
10210-10212 |
IN |
denotes |
of |
| T3026 |
10213-10226 |
NN |
denotes |
morphogenesis |
| T3027 |
10227-10228 |
-LRB- |
denotes |
( |
| T3029 |
10228-10230 |
IN |
denotes |
as |
| T3028 |
10231-10236 |
VBN |
denotes |
shown |
| T3030 |
10237-10239 |
IN |
denotes |
in |
| T3031 |
10240-10246 |
NN |
denotes |
Figure |
| T3032 |
10247-10248 |
CD |
denotes |
1 |
| T3033 |
10248-10249 |
-RRB- |
denotes |
) |
| T3034 |
10249-10250 |
. |
denotes |
. |
| T3035 |
10250-10362 |
sentence |
denotes |
Hybridizing hair buds from a later wave appeared juxtaposed with nonhybridizing follicles from an earlier wave. |
| T3036 |
10251-10262 |
VBG |
denotes |
Hybridizing |
| T3038 |
10263-10267 |
NN |
denotes |
hair |
| T3037 |
10268-10272 |
NNS |
denotes |
buds |
| T3040 |
10273-10277 |
IN |
denotes |
from |
| T3041 |
10278-10279 |
DT |
denotes |
a |
| T3043 |
10280-10285 |
JJ |
denotes |
later |
| T3042 |
10286-10290 |
NN |
denotes |
wave |
| T3039 |
10291-10299 |
VBD |
denotes |
appeared |
| T3044 |
10300-10310 |
JJ |
denotes |
juxtaposed |
| T3045 |
10311-10315 |
IN |
denotes |
with |
| T3046 |
10316-10330 |
JJ |
denotes |
nonhybridizing |
| T3047 |
10331-10340 |
NNS |
denotes |
follicles |
| T3048 |
10341-10345 |
IN |
denotes |
from |
| T3049 |
10346-10348 |
DT |
denotes |
an |
| T3051 |
10349-10356 |
JJR |
denotes |
earlier |
| T3050 |
10357-10361 |
NN |
denotes |
wave |
| T3052 |
10361-10362 |
. |
denotes |
. |
| T3053 |
10362-12983 |
sentence |
denotes |
Figure 1 Snail Is Expressed Exclusively in the Hair Bud during Morphogenesis
Embryos were either frozen in OCT embedding compound (A, F, and H) or embedded in paraffin (C, D, E, and G), and then sectioned (8 μm).
(A) In situ hybridizations with Snail sense or antisense cRNA probes. Black dotted lines demarcate the basement membrane that separates the epidermis (epi) from dermis (der). Arrows point to Snail RNA expression, restricted to the hair bud stage of follicle morphogenesis. It was not seen in later hair germ or peg stages.
(B) Expression of Snail protein coincides with hair development. Protein extracts were prepared from keratinocytes transfected with empty expression vector (K14), containing the K14 promoter or with the vector driving HA-tagged Snail (K14-Snail); or from whole skin from E13.5 to P5 animals, including newborn (nb). Equal amounts of proteins were then resolved by SDS-PAGE through 12% gels and subjected to Western blotting using either an affinity-purified Snail polyclonal antiserum, which we generated, or anti-tubulin (loading control).
(C–E) Immunohistochemistry shows expression of Snail protein in the nuclei of cells within the hair and skin. (C) E13.5 skin with a single layered epidermis (epi) shows no Snail expression. (D) The first morphological sign that cells have adopted a hair follicle fate is a cluster of cells called a placode in E16.5 skin. Snail is not expressed at this stage of development. (E) Snail is expressed in the hair bud of E17.5 skin but not in later stages of development such as the germ or peg.
(F) Immunofluorescence with anti-Ki67 (green) identifies the proliferating cells of the skin, restricted to the basal layer of the epidermis and developing hair follicles. Anti-β4 int labeling reveals the presence of the hemidesmosomal integrin β4, restricted to the base of cells adhering to the underlying basement membrane. The white dotted line marks the outermost surface of the skin.
(G) Immunohistochemistry with pMAPK marks a subset of proliferating cells within the epidermis and hair bud. Anti-pMAPK labeling was consistently robust within the hair bud.
(H) Immunofluorescence with anti-laminin 5 (lam5), which demarcates the basement membrane, and anti-E-cadherin (E-cad), a component of AJs. At the leading edge of the growing bud, cell-cell borders show markedly diminished anti-E-cadherin labeling (arrowheads). To determine whether this transient nature of Snail mRNA expression is reflected at the protein level, we generated an antibody against the N-terminal sequence that resides upstream of the more conserved zinc finger domains. |
| T3054 |
12759-12761 |
TO |
denotes |
To |
| T3055 |
12762-12771 |
VB |
denotes |
determine |
| T3057 |
12772-12779 |
IN |
denotes |
whether |
| T3059 |
12780-12784 |
DT |
denotes |
this |
| T3061 |
12785-12794 |
JJ |
denotes |
transient |
| T3060 |
12795-12801 |
NN |
denotes |
nature |
| T3062 |
12802-12804 |
IN |
denotes |
of |
| T3063 |
12805-12810 |
NN |
denotes |
Snail |
| T3065 |
12811-12815 |
NN |
denotes |
mRNA |
| T3064 |
12816-12826 |
NN |
denotes |
expression |
| T3066 |
12827-12829 |
VBZ |
denotes |
is |
| T3058 |
12830-12839 |
VBN |
denotes |
reflected |
| T3067 |
12840-12842 |
IN |
denotes |
at |
| T3068 |
12843-12846 |
DT |
denotes |
the |
| T3070 |
12847-12854 |
NN |
denotes |
protein |
| T3069 |
12855-12860 |
NN |
denotes |
level |
| T3071 |
12860-12862 |
, |
denotes |
, |
| T3072 |
12862-12864 |
PRP |
denotes |
we |
| T3056 |
12865-12874 |
VBD |
denotes |
generated |
| T3073 |
12875-12877 |
DT |
denotes |
an |
| T3074 |
12878-12886 |
NN |
denotes |
antibody |
| T3075 |
12887-12894 |
IN |
denotes |
against |
| T3076 |
12895-12898 |
DT |
denotes |
the |
| T3078 |
12899-12900 |
NN |
denotes |
N |
| T3080 |
12900-12901 |
HYPH |
denotes |
- |
| T3079 |
12901-12909 |
JJ |
denotes |
terminal |
| T3077 |
12910-12918 |
NN |
denotes |
sequence |
| T3081 |
12919-12923 |
WDT |
denotes |
that |
| T3082 |
12924-12931 |
VBZ |
denotes |
resides |
| T3083 |
12932-12940 |
RB |
denotes |
upstream |
| T3084 |
12941-12943 |
IN |
denotes |
of |
| T3085 |
12944-12947 |
DT |
denotes |
the |
| T3087 |
12948-12952 |
RBR |
denotes |
more |
| T3088 |
12953-12962 |
VBN |
denotes |
conserved |
| T3089 |
12963-12967 |
NN |
denotes |
zinc |
| T3090 |
12968-12974 |
NN |
denotes |
finger |
| T3086 |
12975-12982 |
NNS |
denotes |
domains |
| T3091 |
12982-12983 |
. |
denotes |
. |
| T3092 |
12983-13238 |
sentence |
denotes |
As judged by Western blot analysis, the antibody did not detect endogenous proteins from cultured keratinocytes, but it did yield a band of the expected size from keratinocytes transiently expressing a hemagglutinin (HA)-tagged Snail protein (Figure 1B). |
| T3093 |
12984-12986 |
IN |
denotes |
As |
| T3094 |
12987-12993 |
VBN |
denotes |
judged |
| T3096 |
12994-12996 |
IN |
denotes |
by |
| T3097 |
12997-13004 |
NNP |
denotes |
Western |
| T3098 |
13005-13009 |
NN |
denotes |
blot |
| T3099 |
13010-13018 |
NN |
denotes |
analysis |
| T3100 |
13018-13020 |
, |
denotes |
, |
| T3101 |
13020-13023 |
DT |
denotes |
the |
| T3102 |
13024-13032 |
NN |
denotes |
antibody |
| T3103 |
13033-13036 |
VBD |
denotes |
did |
| T3104 |
13037-13040 |
RB |
denotes |
not |
| T3095 |
13041-13047 |
VB |
denotes |
detect |
| T3105 |
13048-13058 |
JJ |
denotes |
endogenous |
| T3106 |
13059-13067 |
NN |
denotes |
proteins |
| T3107 |
13068-13072 |
IN |
denotes |
from |
| T3108 |
13073-13081 |
VBN |
denotes |
cultured |
| T3109 |
13082-13095 |
NNS |
denotes |
keratinocytes |
| T3110 |
13095-13097 |
, |
denotes |
, |
| T3111 |
13097-13100 |
CC |
denotes |
but |
| T3112 |
13101-13103 |
PRP |
denotes |
it |
| T3114 |
13104-13107 |
VBD |
denotes |
did |
| T3113 |
13108-13113 |
VB |
denotes |
yield |
| T3115 |
13114-13115 |
DT |
denotes |
a |
| T3116 |
13116-13120 |
NN |
denotes |
band |
| T3117 |
13121-13123 |
IN |
denotes |
of |
| T3118 |
13124-13127 |
DT |
denotes |
the |
| T3120 |
13128-13136 |
VBN |
denotes |
expected |
| T3119 |
13137-13141 |
NN |
denotes |
size |
| T3121 |
13142-13146 |
IN |
denotes |
from |
| T3122 |
13147-13160 |
NNS |
denotes |
keratinocytes |
| T3123 |
13161-13172 |
RB |
denotes |
transiently |
| T3124 |
13173-13183 |
VBG |
denotes |
expressing |
| T3125 |
13184-13185 |
DT |
denotes |
a |
| T3127 |
13186-13199 |
NN |
denotes |
hemagglutinin |
| T3129 |
13200-13201 |
-LRB- |
denotes |
( |
| T3130 |
13201-13203 |
NN |
denotes |
HA |
| T3131 |
13203-13204 |
-RRB- |
denotes |
) |
| T3132 |
13204-13205 |
HYPH |
denotes |
- |
| T3128 |
13205-13211 |
VBN |
denotes |
tagged |
| T3133 |
13212-13217 |
NN |
denotes |
Snail |
| T3126 |
13218-13225 |
NN |
denotes |
protein |
| T3134 |
13226-13227 |
-LRB- |
denotes |
( |
| T3136 |
13227-13233 |
NN |
denotes |
Figure |
| T3135 |
13234-13236 |
NN |
denotes |
1B |
| T3137 |
13236-13237 |
-RRB- |
denotes |
) |
| T3138 |
13237-13238 |
. |
denotes |
. |
| T3139 |
13238-13555 |
sentence |
denotes |
The antibody also recognized a band corresponding to the size of endogenous Snail (approximately 28 kDa) in lysates from embryonic mouse skin, the temporal appearance of which corresponded to the waves of hair follicle morphogenesis from E15.5 to newborn when over 90% of the hair on the mouse is formed (Figure 1B). |
| T3140 |
13239-13242 |
DT |
denotes |
The |
| T3141 |
13243-13251 |
NN |
denotes |
antibody |
| T3143 |
13252-13256 |
RB |
denotes |
also |
| T3142 |
13257-13267 |
VBD |
denotes |
recognized |
| T3144 |
13268-13269 |
DT |
denotes |
a |
| T3145 |
13270-13274 |
NN |
denotes |
band |
| T3146 |
13275-13288 |
VBG |
denotes |
corresponding |
| T3147 |
13289-13291 |
IN |
denotes |
to |
| T3148 |
13292-13295 |
DT |
denotes |
the |
| T3149 |
13296-13300 |
NN |
denotes |
size |
| T3150 |
13301-13303 |
IN |
denotes |
of |
| T3151 |
13304-13314 |
JJ |
denotes |
endogenous |
| T3152 |
13315-13320 |
NN |
denotes |
Snail |
| T3153 |
13321-13322 |
-LRB- |
denotes |
( |
| T3154 |
13322-13335 |
RB |
denotes |
approximately |
| T3155 |
13336-13338 |
CD |
denotes |
28 |
| T3156 |
13339-13342 |
NN |
denotes |
kDa |
| T3157 |
13342-13343 |
-RRB- |
denotes |
) |
| T3158 |
13344-13346 |
IN |
denotes |
in |
| T3159 |
13347-13354 |
NNS |
denotes |
lysates |
| T3160 |
13355-13359 |
IN |
denotes |
from |
| T3161 |
13360-13369 |
JJ |
denotes |
embryonic |
| T3163 |
13370-13375 |
NN |
denotes |
mouse |
| T3162 |
13376-13380 |
NN |
denotes |
skin |
| T3164 |
13380-13382 |
, |
denotes |
, |
| T3165 |
13382-13385 |
DT |
denotes |
the |
| T3167 |
13386-13394 |
JJ |
denotes |
temporal |
| T3166 |
13395-13405 |
NN |
denotes |
appearance |
| T3169 |
13406-13408 |
IN |
denotes |
of |
| T3170 |
13409-13414 |
WDT |
denotes |
which |
| T3168 |
13415-13427 |
VBD |
denotes |
corresponded |
| T3171 |
13428-13430 |
IN |
denotes |
to |
| T3172 |
13431-13434 |
DT |
denotes |
the |
| T3173 |
13435-13440 |
NNS |
denotes |
waves |
| T3174 |
13441-13443 |
IN |
denotes |
of |
| T3175 |
13444-13448 |
NN |
denotes |
hair |
| T3176 |
13449-13457 |
NN |
denotes |
follicle |
| T3177 |
13458-13471 |
NN |
denotes |
morphogenesis |
| T3178 |
13472-13476 |
IN |
denotes |
from |
| T3179 |
13477-13482 |
NN |
denotes |
E15.5 |
| T3180 |
13483-13485 |
IN |
denotes |
to |
| T3181 |
13486-13493 |
JJ |
denotes |
newborn |
| T3182 |
13494-13498 |
WRB |
denotes |
when |
| T3184 |
13499-13503 |
IN |
denotes |
over |
| T3185 |
13504-13506 |
CD |
denotes |
90 |
| T3186 |
13506-13507 |
NN |
denotes |
% |
| T3187 |
13508-13510 |
IN |
denotes |
of |
| T3188 |
13511-13514 |
DT |
denotes |
the |
| T3189 |
13515-13519 |
NN |
denotes |
hair |
| T3190 |
13520-13522 |
IN |
denotes |
on |
| T3191 |
13523-13526 |
DT |
denotes |
the |
| T3192 |
13527-13532 |
NN |
denotes |
mouse |
| T3193 |
13533-13535 |
VBZ |
denotes |
is |
| T3183 |
13536-13542 |
VBN |
denotes |
formed |
| T3194 |
13543-13544 |
-LRB- |
denotes |
( |
| T3196 |
13544-13550 |
NN |
denotes |
Figure |
| T3195 |
13551-13553 |
NN |
denotes |
1B |
| T3197 |
13553-13554 |
-RRB- |
denotes |
) |
| T3198 |
13554-13555 |
. |
denotes |
. |
| T3199 |
13555-13849 |
sentence |
denotes |
Consistent with the Western blot data, immunohistochemical analysis did not detect Snail in single-layered E13.5 epidermis (Figure 1C) nor in the placode, which is the earliest morphological sign of the commitment of multipotent cells of the embryonic ectoderm to a hair cell fate (Figure 1D). |
| T3200 |
13556-13566 |
JJ |
denotes |
Consistent |
| T3202 |
13567-13571 |
IN |
denotes |
with |
| T3203 |
13572-13575 |
DT |
denotes |
the |
| T3205 |
13576-13583 |
NNP |
denotes |
Western |
| T3206 |
13584-13588 |
NN |
denotes |
blot |
| T3204 |
13589-13593 |
NNS |
denotes |
data |
| T3207 |
13593-13595 |
, |
denotes |
, |
| T3208 |
13595-13614 |
JJ |
denotes |
immunohistochemical |
| T3209 |
13615-13623 |
NN |
denotes |
analysis |
| T3210 |
13624-13627 |
VBD |
denotes |
did |
| T3211 |
13628-13631 |
RB |
denotes |
not |
| T3201 |
13632-13638 |
VB |
denotes |
detect |
| T3212 |
13639-13644 |
NN |
denotes |
Snail |
| T3213 |
13645-13647 |
IN |
denotes |
in |
| T3214 |
13648-13654 |
JJ |
denotes |
single |
| T3216 |
13654-13655 |
HYPH |
denotes |
- |
| T3215 |
13655-13662 |
JJ |
denotes |
layered |
| T3218 |
13663-13668 |
NN |
denotes |
E13.5 |
| T3217 |
13669-13678 |
NN |
denotes |
epidermis |
| T3219 |
13679-13680 |
-LRB- |
denotes |
( |
| T3221 |
13680-13686 |
NN |
denotes |
Figure |
| T3220 |
13687-13689 |
NN |
denotes |
1C |
| T3222 |
13689-13690 |
-RRB- |
denotes |
) |
| T3223 |
13691-13694 |
CC |
denotes |
nor |
| T3224 |
13695-13697 |
IN |
denotes |
in |
| T3225 |
13698-13701 |
DT |
denotes |
the |
| T3226 |
13702-13709 |
NN |
denotes |
placode |
| T3227 |
13709-13711 |
, |
denotes |
, |
| T3228 |
13711-13716 |
WDT |
denotes |
which |
| T3229 |
13717-13719 |
VBZ |
denotes |
is |
| T3230 |
13720-13723 |
DT |
denotes |
the |
| T3232 |
13724-13732 |
JJS |
denotes |
earliest |
| T3233 |
13733-13746 |
JJ |
denotes |
morphological |
| T3231 |
13747-13751 |
NN |
denotes |
sign |
| T3234 |
13752-13754 |
IN |
denotes |
of |
| T3235 |
13755-13758 |
DT |
denotes |
the |
| T3236 |
13759-13769 |
NN |
denotes |
commitment |
| T3237 |
13770-13772 |
IN |
denotes |
of |
| T3238 |
13773-13784 |
JJ |
denotes |
multipotent |
| T3239 |
13785-13790 |
NNS |
denotes |
cells |
| T3240 |
13791-13793 |
IN |
denotes |
of |
| T3241 |
13794-13797 |
DT |
denotes |
the |
| T3243 |
13798-13807 |
JJ |
denotes |
embryonic |
| T3242 |
13808-13816 |
NN |
denotes |
ectoderm |
| T3244 |
13817-13819 |
IN |
denotes |
to |
| T3245 |
13820-13821 |
DT |
denotes |
a |
| T3247 |
13822-13826 |
NN |
denotes |
hair |
| T3248 |
13827-13831 |
NN |
denotes |
cell |
| T3246 |
13832-13836 |
NN |
denotes |
fate |
| T3249 |
13837-13838 |
-LRB- |
denotes |
( |
| T3251 |
13838-13844 |
NN |
denotes |
Figure |
| T3250 |
13845-13847 |
NN |
denotes |
1D |
| T3252 |
13847-13848 |
-RRB- |
denotes |
) |
| T3253 |
13848-13849 |
. |
denotes |
. |
| T3254 |
13849-14011 |
sentence |
denotes |
Consistent with the in situ hybridization results, anti-Snail antibody labeled only hair buds and not follicles at more mature stages of development (Figure 1E). |
| T3255 |
13850-13860 |
JJ |
denotes |
Consistent |
| T3257 |
13861-13865 |
IN |
denotes |
with |
| T3258 |
13866-13869 |
DT |
denotes |
the |
| T3260 |
13870-13872 |
FW |
denotes |
in |
| T3261 |
13873-13877 |
FW |
denotes |
situ |
| T3262 |
13878-13891 |
NN |
denotes |
hybridization |
| T3259 |
13892-13899 |
NNS |
denotes |
results |
| T3263 |
13899-13901 |
, |
denotes |
, |
| T3264 |
13901-13911 |
JJ |
denotes |
anti-Snail |
| T3265 |
13912-13920 |
NN |
denotes |
antibody |
| T3256 |
13921-13928 |
VBD |
denotes |
labeled |
| T3266 |
13929-13933 |
RB |
denotes |
only |
| T3268 |
13934-13938 |
NN |
denotes |
hair |
| T3267 |
13939-13943 |
NNS |
denotes |
buds |
| T3269 |
13944-13947 |
CC |
denotes |
and |
| T3270 |
13948-13951 |
RB |
denotes |
not |
| T3271 |
13952-13961 |
NNS |
denotes |
follicles |
| T3272 |
13962-13964 |
IN |
denotes |
at |
| T3273 |
13965-13969 |
RBR |
denotes |
more |
| T3275 |
13970-13976 |
JJ |
denotes |
mature |
| T3274 |
13977-13983 |
NNS |
denotes |
stages |
| T3276 |
13984-13986 |
IN |
denotes |
of |
| T3277 |
13987-13998 |
NN |
denotes |
development |
| T3278 |
13999-14000 |
-LRB- |
denotes |
( |
| T3280 |
14000-14006 |
NN |
denotes |
Figure |
| T3279 |
14007-14009 |
NN |
denotes |
1E |
| T3281 |
14009-14010 |
-RRB- |
denotes |
) |
| T3282 |
14010-14011 |
. |
denotes |
. |
| T3283 |
14011-14099 |
sentence |
denotes |
Taken together, the anti-Snail antibody appeared to be specific for its target protein. |
| T3284 |
14012-14017 |
VBN |
denotes |
Taken |
| T3286 |
14018-14026 |
RB |
denotes |
together |
| T3287 |
14026-14028 |
, |
denotes |
, |
| T3288 |
14028-14031 |
DT |
denotes |
the |
| T3290 |
14032-14042 |
JJ |
denotes |
anti-Snail |
| T3289 |
14043-14051 |
NN |
denotes |
antibody |
| T3285 |
14052-14060 |
VBD |
denotes |
appeared |
| T3291 |
14061-14063 |
TO |
denotes |
to |
| T3292 |
14064-14066 |
VB |
denotes |
be |
| T3293 |
14067-14075 |
JJ |
denotes |
specific |
| T3294 |
14076-14079 |
IN |
denotes |
for |
| T3295 |
14080-14083 |
PRP$ |
denotes |
its |
| T3297 |
14084-14090 |
NN |
denotes |
target |
| T3296 |
14091-14098 |
NN |
denotes |
protein |
| T3298 |
14098-14099 |
. |
denotes |
. |
| T3299 |
14099-14215 |
sentence |
denotes |
It did not detect other Snail family members known to be expressed in keratinocytes and/or skin (unpublished data). |
| T3300 |
14100-14102 |
PRP |
denotes |
It |
| T3302 |
14103-14106 |
VBD |
denotes |
did |
| T3303 |
14107-14110 |
RB |
denotes |
not |
| T3301 |
14111-14117 |
VB |
denotes |
detect |
| T3304 |
14118-14123 |
JJ |
denotes |
other |
| T3306 |
14124-14129 |
NN |
denotes |
Snail |
| T3307 |
14130-14136 |
NN |
denotes |
family |
| T3305 |
14137-14144 |
NNS |
denotes |
members |
| T3308 |
14145-14150 |
VBN |
denotes |
known |
| T3309 |
14151-14153 |
TO |
denotes |
to |
| T3311 |
14154-14156 |
VB |
denotes |
be |
| T3310 |
14157-14166 |
VBN |
denotes |
expressed |
| T3312 |
14167-14169 |
IN |
denotes |
in |
| T3313 |
14170-14183 |
NNS |
denotes |
keratinocytes |
| T3314 |
14184-14187 |
CC |
denotes |
and |
| T3315 |
14187-14188 |
HYPH |
denotes |
/ |
| T3316 |
14188-14190 |
CC |
denotes |
or |
| T3317 |
14191-14195 |
NN |
denotes |
skin |
| T3318 |
14196-14197 |
-LRB- |
denotes |
( |
| T3320 |
14197-14208 |
JJ |
denotes |
unpublished |
| T3319 |
14209-14213 |
NNS |
denotes |
data |
| T3321 |
14213-14214 |
-RRB- |
denotes |
) |
| T3322 |
14214-14215 |
. |
denotes |
. |
| T3323 |
14215-14377 |
sentence |
denotes |
Furthermore, the immunohistochemical data paralleled our Snail in situ hybridization data revealing transient Snail expression at the hair bud stage (Figure 1A). |
| T3324 |
14216-14227 |
RB |
denotes |
Furthermore |
| T3326 |
14227-14229 |
, |
denotes |
, |
| T3327 |
14229-14232 |
DT |
denotes |
the |
| T3329 |
14233-14252 |
JJ |
denotes |
immunohistochemical |
| T3328 |
14253-14257 |
NNS |
denotes |
data |
| T3325 |
14258-14268 |
VBD |
denotes |
paralleled |
| T3330 |
14269-14272 |
PRP$ |
denotes |
our |
| T3332 |
14273-14278 |
NN |
denotes |
Snail |
| T3334 |
14279-14281 |
FW |
denotes |
in |
| T3335 |
14282-14286 |
FW |
denotes |
situ |
| T3333 |
14287-14300 |
NN |
denotes |
hybridization |
| T3331 |
14301-14305 |
NNS |
denotes |
data |
| T3336 |
14306-14315 |
VBG |
denotes |
revealing |
| T3337 |
14316-14325 |
JJ |
denotes |
transient |
| T3339 |
14326-14331 |
NN |
denotes |
Snail |
| T3338 |
14332-14342 |
NN |
denotes |
expression |
| T3340 |
14343-14345 |
IN |
denotes |
at |
| T3341 |
14346-14349 |
DT |
denotes |
the |
| T3343 |
14350-14354 |
NN |
denotes |
hair |
| T3344 |
14355-14358 |
NN |
denotes |
bud |
| T3342 |
14359-14364 |
NN |
denotes |
stage |
| T3345 |
14365-14366 |
-LRB- |
denotes |
( |
| T3347 |
14366-14372 |
NN |
denotes |
Figure |
| T3346 |
14373-14375 |
NN |
denotes |
1A |
| T3348 |
14375-14376 |
-RRB- |
denotes |
) |
| T3349 |
14376-14377 |
. |
denotes |
. |
| T3350 |
14377-14489 |
sentence |
denotes |
As judged by immunohistochemistry, Snail protein was localized to the nuclei of the hair bud cells (Figure 1E). |
| T3351 |
14378-14380 |
IN |
denotes |
As |
| T3352 |
14381-14387 |
VBN |
denotes |
judged |
| T3354 |
14388-14390 |
IN |
denotes |
by |
| T3355 |
14391-14411 |
NN |
denotes |
immunohistochemistry |
| T3356 |
14411-14413 |
, |
denotes |
, |
| T3357 |
14413-14418 |
NN |
denotes |
Snail |
| T3358 |
14419-14426 |
NN |
denotes |
protein |
| T3359 |
14427-14430 |
VBD |
denotes |
was |
| T3353 |
14431-14440 |
VBN |
denotes |
localized |
| T3360 |
14441-14443 |
IN |
denotes |
to |
| T3361 |
14444-14447 |
DT |
denotes |
the |
| T3362 |
14448-14454 |
NNS |
denotes |
nuclei |
| T3363 |
14455-14457 |
IN |
denotes |
of |
| T3364 |
14458-14461 |
DT |
denotes |
the |
| T3366 |
14462-14466 |
NN |
denotes |
hair |
| T3367 |
14467-14470 |
NN |
denotes |
bud |
| T3365 |
14471-14476 |
NNS |
denotes |
cells |
| T3368 |
14477-14478 |
-LRB- |
denotes |
( |
| T3370 |
14478-14484 |
NN |
denotes |
Figure |
| T3369 |
14485-14487 |
NN |
denotes |
1E |
| T3371 |
14487-14488 |
-RRB- |
denotes |
) |
| T3372 |
14488-14489 |
. |
denotes |
. |
| T3373 |
14489-14585 |
sentence |
denotes |
This feature was consistent with Snail's known function as a transcriptional repressor [12,13]. |
| T3374 |
14490-14494 |
DT |
denotes |
This |
| T3375 |
14495-14502 |
NN |
denotes |
feature |
| T3376 |
14503-14506 |
VBD |
denotes |
was |
| T3377 |
14507-14517 |
JJ |
denotes |
consistent |
| T3378 |
14518-14522 |
IN |
denotes |
with |
| T3379 |
14523-14528 |
NN |
denotes |
Snail |
| T3381 |
14528-14530 |
POS |
denotes |
's |
| T3382 |
14531-14536 |
VBN |
denotes |
known |
| T3380 |
14537-14545 |
NN |
denotes |
function |
| T3383 |
14546-14548 |
IN |
denotes |
as |
| T3384 |
14549-14550 |
DT |
denotes |
a |
| T3386 |
14551-14566 |
JJ |
denotes |
transcriptional |
| T3385 |
14567-14576 |
NN |
denotes |
repressor |
| T3387 |
14577-14578 |
-LRB- |
denotes |
[ |
| T3389 |
14578-14580 |
CD |
denotes |
12 |
| T3390 |
14580-14581 |
, |
denotes |
, |
| T3388 |
14581-14583 |
CD |
denotes |
13 |
| T3391 |
14583-14584 |
-RRB- |
denotes |
] |
| T3392 |
14584-14585 |
. |
denotes |
. |
| T3393 |
14585-14697 |
sentence |
denotes |
Additionally, anti-Snail labeling was detected in only three of the four major waves of follicle morphogenesis. |
| T3394 |
14586-14598 |
RB |
denotes |
Additionally |
| T3396 |
14598-14600 |
, |
denotes |
, |
| T3397 |
14600-14610 |
JJ |
denotes |
anti-Snail |
| T3398 |
14611-14619 |
NN |
denotes |
labeling |
| T3399 |
14620-14623 |
VBD |
denotes |
was |
| T3395 |
14624-14632 |
VBN |
denotes |
detected |
| T3400 |
14633-14635 |
IN |
denotes |
in |
| T3401 |
14636-14640 |
RB |
denotes |
only |
| T3403 |
14641-14646 |
CD |
denotes |
three |
| T3404 |
14647-14649 |
IN |
denotes |
of |
| T3405 |
14650-14653 |
DT |
denotes |
the |
| T3402 |
14654-14658 |
CD |
denotes |
four |
| T3407 |
14659-14664 |
JJ |
denotes |
major |
| T3406 |
14665-14670 |
NNS |
denotes |
waves |
| T3408 |
14671-14673 |
IN |
denotes |
of |
| T3409 |
14674-14682 |
NN |
denotes |
follicle |
| T3410 |
14683-14696 |
NN |
denotes |
morphogenesis |
| T3411 |
14696-14697 |
. |
denotes |
. |
| T3412 |
14697-14871 |
sentence |
denotes |
Snail was not found in the buds of guard hairs that are the earliest of all hairs to form (at E13.5), and which constitute less than 5% of the mouse coat (unpublished data). |
| T3413 |
14698-14703 |
NN |
denotes |
Snail |
| T3415 |
14704-14707 |
VBD |
denotes |
was |
| T3416 |
14708-14711 |
RB |
denotes |
not |
| T3414 |
14712-14717 |
VBN |
denotes |
found |
| T3417 |
14718-14720 |
IN |
denotes |
in |
| T3418 |
14721-14724 |
DT |
denotes |
the |
| T3419 |
14725-14729 |
NNS |
denotes |
buds |
| T3420 |
14730-14732 |
IN |
denotes |
of |
| T3421 |
14733-14738 |
NN |
denotes |
guard |
| T3422 |
14739-14744 |
NNS |
denotes |
hairs |
| T3423 |
14745-14749 |
WDT |
denotes |
that |
| T3424 |
14750-14753 |
VBP |
denotes |
are |
| T3425 |
14754-14757 |
DT |
denotes |
the |
| T3426 |
14758-14766 |
JJS |
denotes |
earliest |
| T3427 |
14767-14769 |
IN |
denotes |
of |
| T3428 |
14770-14773 |
DT |
denotes |
all |
| T3429 |
14774-14779 |
NNS |
denotes |
hairs |
| T3430 |
14780-14782 |
TO |
denotes |
to |
| T3431 |
14783-14787 |
VB |
denotes |
form |
| T3432 |
14788-14789 |
-LRB- |
denotes |
( |
| T3433 |
14789-14791 |
IN |
denotes |
at |
| T3434 |
14792-14797 |
NN |
denotes |
E13.5 |
| T3435 |
14797-14798 |
-RRB- |
denotes |
) |
| T3436 |
14798-14800 |
, |
denotes |
, |
| T3437 |
14800-14803 |
CC |
denotes |
and |
| T3438 |
14804-14809 |
WDT |
denotes |
which |
| T3439 |
14810-14820 |
VBP |
denotes |
constitute |
| T3440 |
14821-14825 |
JJR |
denotes |
less |
| T3442 |
14826-14830 |
IN |
denotes |
than |
| T3441 |
14831-14832 |
CD |
denotes |
5 |
| T3443 |
14832-14833 |
NN |
denotes |
% |
| T3444 |
14834-14836 |
IN |
denotes |
of |
| T3445 |
14837-14840 |
DT |
denotes |
the |
| T3447 |
14841-14846 |
NN |
denotes |
mouse |
| T3446 |
14847-14851 |
NN |
denotes |
coat |
| T3448 |
14852-14853 |
-LRB- |
denotes |
( |
| T3450 |
14853-14864 |
JJ |
denotes |
unpublished |
| T3449 |
14865-14869 |
NNS |
denotes |
data |
| T3451 |
14869-14870 |
-RRB- |
denotes |
) |
| T3452 |
14870-14871 |
. |
denotes |
. |
| T3453 |
14871-15112 |
sentence |
denotes |
As judged by immunofluorescence with antibodies against the proliferating nuclear antigen Ki67, the timing of Snail expression coincided with the stage at which the developing follicle enhanced its proliferation and down-growth (Figure 1F). |
| T3454 |
14872-14874 |
IN |
denotes |
As |
| T3455 |
14875-14881 |
VBN |
denotes |
judged |
| T3457 |
14882-14884 |
IN |
denotes |
by |
| T3458 |
14885-14903 |
NN |
denotes |
immunofluorescence |
| T3459 |
14904-14908 |
IN |
denotes |
with |
| T3460 |
14909-14919 |
NNS |
denotes |
antibodies |
| T3461 |
14920-14927 |
IN |
denotes |
against |
| T3462 |
14928-14931 |
DT |
denotes |
the |
| T3464 |
14932-14945 |
VBG |
denotes |
proliferating |
| T3465 |
14946-14953 |
JJ |
denotes |
nuclear |
| T3463 |
14954-14961 |
NN |
denotes |
antigen |
| T3466 |
14962-14966 |
NN |
denotes |
Ki67 |
| T3467 |
14966-14968 |
, |
denotes |
, |
| T3468 |
14968-14971 |
DT |
denotes |
the |
| T3469 |
14972-14978 |
NN |
denotes |
timing |
| T3470 |
14979-14981 |
IN |
denotes |
of |
| T3471 |
14982-14987 |
NN |
denotes |
Snail |
| T3472 |
14988-14998 |
NN |
denotes |
expression |
| T3456 |
14999-15008 |
VBD |
denotes |
coincided |
| T3473 |
15009-15013 |
IN |
denotes |
with |
| T3474 |
15014-15017 |
DT |
denotes |
the |
| T3475 |
15018-15023 |
NN |
denotes |
stage |
| T3476 |
15024-15026 |
IN |
denotes |
at |
| T3478 |
15027-15032 |
WDT |
denotes |
which |
| T3479 |
15033-15036 |
DT |
denotes |
the |
| T3481 |
15037-15047 |
VBG |
denotes |
developing |
| T3480 |
15048-15056 |
NN |
denotes |
follicle |
| T3477 |
15057-15065 |
VBD |
denotes |
enhanced |
| T3482 |
15066-15069 |
PRP$ |
denotes |
its |
| T3483 |
15070-15083 |
NN |
denotes |
proliferation |
| T3484 |
15084-15087 |
CC |
denotes |
and |
| T3485 |
15088-15092 |
JJ |
denotes |
down |
| T3487 |
15092-15093 |
HYPH |
denotes |
- |
| T3486 |
15093-15099 |
NN |
denotes |
growth |
| T3488 |
15100-15101 |
-LRB- |
denotes |
( |
| T3490 |
15101-15107 |
NN |
denotes |
Figure |
| T3489 |
15108-15110 |
NN |
denotes |
1F |
| T3491 |
15110-15111 |
-RRB- |
denotes |
) |
| T3492 |
15111-15112 |
. |
denotes |
. |
| T3493 |
15112-15334 |
sentence |
denotes |
Immunohistochemistry with antibodies against the active (phosphorylated) form of MAPK (pMAPK) marked a subset of the proliferating (Ki67-positive) cells, and pMAPK-positive cells were enriched in the hair bud (Figure 1G). |
| T3494 |
15113-15133 |
NN |
denotes |
Immunohistochemistry |
| T3496 |
15134-15138 |
IN |
denotes |
with |
| T3497 |
15139-15149 |
NNS |
denotes |
antibodies |
| T3498 |
15150-15157 |
IN |
denotes |
against |
| T3499 |
15158-15161 |
DT |
denotes |
the |
| T3501 |
15162-15168 |
JJ |
denotes |
active |
| T3502 |
15169-15170 |
-LRB- |
denotes |
( |
| T3503 |
15170-15184 |
VBN |
denotes |
phosphorylated |
| T3504 |
15184-15185 |
-RRB- |
denotes |
) |
| T3500 |
15186-15190 |
NN |
denotes |
form |
| T3505 |
15191-15193 |
IN |
denotes |
of |
| T3506 |
15194-15198 |
NN |
denotes |
MAPK |
| T3507 |
15199-15200 |
-LRB- |
denotes |
( |
| T3508 |
15200-15205 |
NN |
denotes |
pMAPK |
| T3509 |
15205-15206 |
-RRB- |
denotes |
) |
| T3495 |
15207-15213 |
VBD |
denotes |
marked |
| T3510 |
15214-15215 |
DT |
denotes |
a |
| T3511 |
15216-15222 |
NN |
denotes |
subset |
| T3512 |
15223-15225 |
IN |
denotes |
of |
| T3513 |
15226-15229 |
DT |
denotes |
the |
| T3515 |
15230-15243 |
VBG |
denotes |
proliferating |
| T3516 |
15244-15245 |
-LRB- |
denotes |
( |
| T3517 |
15245-15249 |
NN |
denotes |
Ki67 |
| T3519 |
15249-15250 |
HYPH |
denotes |
- |
| T3518 |
15250-15258 |
JJ |
denotes |
positive |
| T3520 |
15258-15259 |
-RRB- |
denotes |
) |
| T3514 |
15260-15265 |
NNS |
denotes |
cells |
| T3521 |
15265-15267 |
, |
denotes |
, |
| T3522 |
15267-15270 |
CC |
denotes |
and |
| T3523 |
15271-15276 |
NN |
denotes |
pMAPK |
| T3525 |
15276-15277 |
HYPH |
denotes |
- |
| T3524 |
15277-15285 |
JJ |
denotes |
positive |
| T3526 |
15286-15291 |
NNS |
denotes |
cells |
| T3528 |
15292-15296 |
VBD |
denotes |
were |
| T3527 |
15297-15305 |
VBN |
denotes |
enriched |
| T3529 |
15306-15308 |
IN |
denotes |
in |
| T3530 |
15309-15312 |
DT |
denotes |
the |
| T3532 |
15313-15317 |
NN |
denotes |
hair |
| T3531 |
15318-15321 |
NN |
denotes |
bud |
| T3533 |
15322-15323 |
-LRB- |
denotes |
( |
| T3535 |
15323-15329 |
NN |
denotes |
Figure |
| T3534 |
15330-15332 |
NN |
denotes |
1G |
| T3536 |
15332-15333 |
-RRB- |
denotes |
) |
| T3537 |
15333-15334 |
. |
denotes |
. |
| T3538 |
15334-15530 |
sentence |
denotes |
The timing of Snail induction and Ki67 and pMAPK enrichment in the hair bud appeared to follow closely the induction of LEF-1/β-catenin activity, known to initiate in the hair placode stage [20]. |
| T3539 |
15335-15338 |
DT |
denotes |
The |
| T3540 |
15339-15345 |
NN |
denotes |
timing |
| T3542 |
15346-15348 |
IN |
denotes |
of |
| T3543 |
15349-15354 |
NN |
denotes |
Snail |
| T3544 |
15355-15364 |
NN |
denotes |
induction |
| T3545 |
15365-15368 |
CC |
denotes |
and |
| T3546 |
15369-15373 |
NN |
denotes |
Ki67 |
| T3548 |
15374-15377 |
CC |
denotes |
and |
| T3549 |
15378-15383 |
NN |
denotes |
pMAPK |
| T3547 |
15384-15394 |
NN |
denotes |
enrichment |
| T3550 |
15395-15397 |
IN |
denotes |
in |
| T3551 |
15398-15401 |
DT |
denotes |
the |
| T3553 |
15402-15406 |
NN |
denotes |
hair |
| T3552 |
15407-15410 |
NN |
denotes |
bud |
| T3541 |
15411-15419 |
VBD |
denotes |
appeared |
| T3554 |
15420-15422 |
TO |
denotes |
to |
| T3555 |
15423-15429 |
VB |
denotes |
follow |
| T3556 |
15430-15437 |
RB |
denotes |
closely |
| T3557 |
15438-15441 |
DT |
denotes |
the |
| T3558 |
15442-15451 |
NN |
denotes |
induction |
| T3559 |
15452-15454 |
IN |
denotes |
of |
| T3560 |
15455-15458 |
NN |
denotes |
LEF |
| T3562 |
15458-15459 |
HYPH |
denotes |
- |
| T3563 |
15459-15460 |
CD |
denotes |
1 |
| T3564 |
15460-15461 |
HYPH |
denotes |
/ |
| T3565 |
15461-15462 |
NN |
denotes |
β |
| T3567 |
15462-15463 |
HYPH |
denotes |
- |
| T3566 |
15463-15470 |
NN |
denotes |
catenin |
| T3561 |
15471-15479 |
NN |
denotes |
activity |
| T3568 |
15479-15481 |
, |
denotes |
, |
| T3569 |
15481-15486 |
VBN |
denotes |
known |
| T3570 |
15487-15489 |
TO |
denotes |
to |
| T3571 |
15490-15498 |
VB |
denotes |
initiate |
| T3572 |
15499-15501 |
IN |
denotes |
in |
| T3573 |
15502-15505 |
DT |
denotes |
the |
| T3575 |
15506-15510 |
NN |
denotes |
hair |
| T3576 |
15511-15518 |
NN |
denotes |
placode |
| T3574 |
15519-15524 |
NN |
denotes |
stage |
| T3577 |
15525-15526 |
-LRB- |
denotes |
[ |
| T3578 |
15526-15528 |
CD |
denotes |
20 |
| T3579 |
15528-15529 |
-RRB- |
denotes |
] |
| T3580 |
15529-15530 |
. |
denotes |
. |
| T3581 |
15530-15642 |
sentence |
denotes |
However, like placodes, hair buds exhibited down-regulation in E-cadherin expression (Figure 1H; see also [4]). |
| T3582 |
15531-15538 |
RB |
denotes |
However |
| T3584 |
15538-15540 |
, |
denotes |
, |
| T3585 |
15540-15544 |
IN |
denotes |
like |
| T3586 |
15545-15553 |
NNS |
denotes |
placodes |
| T3587 |
15553-15555 |
, |
denotes |
, |
| T3588 |
15555-15559 |
NN |
denotes |
hair |
| T3589 |
15560-15564 |
NNS |
denotes |
buds |
| T3583 |
15565-15574 |
VBD |
denotes |
exhibited |
| T3590 |
15575-15579 |
JJ |
denotes |
down |
| T3592 |
15579-15580 |
HYPH |
denotes |
- |
| T3591 |
15580-15590 |
NN |
denotes |
regulation |
| T3593 |
15591-15593 |
IN |
denotes |
in |
| T3594 |
15594-15595 |
NN |
denotes |
E |
| T3596 |
15595-15596 |
HYPH |
denotes |
- |
| T3595 |
15596-15604 |
NN |
denotes |
cadherin |
| T3597 |
15605-15615 |
NN |
denotes |
expression |
| T3598 |
15616-15617 |
-LRB- |
denotes |
( |
| T3600 |
15617-15623 |
NN |
denotes |
Figure |
| T3599 |
15624-15626 |
NN |
denotes |
1H |
| T3601 |
15626-15627 |
: |
denotes |
; |
| T3602 |
15628-15631 |
VB |
denotes |
see |
| T3603 |
15632-15636 |
RB |
denotes |
also |
| T3604 |
15637-15638 |
-LRB- |
denotes |
[ |
| T3605 |
15638-15639 |
CD |
denotes |
4 |
| T3606 |
15639-15640 |
-RRB- |
denotes |
] |
| T3607 |
15640-15641 |
-RRB- |
denotes |
) |
| T3608 |
15641-15642 |
. |
denotes |
. |
| T3910 |
15644-15653 |
JJ |
denotes |
Sustained |
| T3911 |
15654-15664 |
NN |
denotes |
Expression |
| T3913 |
15665-15667 |
IN |
denotes |
of |
| T3914 |
15668-15673 |
NN |
denotes |
Snail |
| T3912 |
15674-15681 |
VBZ |
denotes |
Results |
| T3915 |
15682-15684 |
IN |
denotes |
in |
| T3916 |
15685-15694 |
JJ |
denotes |
Epidermal |
| T3917 |
15695-15713 |
NN |
denotes |
Hyperproliferation |
| T3918 |
15714-15717 |
CC |
denotes |
and |
| T3919 |
15718-15733 |
NN |
denotes |
Differentiation |
| T3920 |
15734-15741 |
NNS |
denotes |
Defects |
| T3921 |
15742-15744 |
IN |
denotes |
in |
| T3922 |
15745-15747 |
NN |
denotes |
Tg |
| T3924 |
15748-15753 |
NN |
denotes |
Mouse |
| T3923 |
15754-15758 |
NN |
denotes |
Skin |
| T3925 |
15758-15966 |
sentence |
denotes |
The striking spike of Snail expression coincident with hair bud formation and enhanced proliferation prompted us to examine the consequences of ectopically expressing Snail elsewhere in mouse skin epidermis. |
| T3926 |
15759-15762 |
DT |
denotes |
The |
| T3928 |
15763-15771 |
JJ |
denotes |
striking |
| T3927 |
15772-15777 |
NN |
denotes |
spike |
| T3930 |
15778-15780 |
IN |
denotes |
of |
| T3931 |
15781-15786 |
NN |
denotes |
Snail |
| T3932 |
15787-15797 |
NN |
denotes |
expression |
| T3933 |
15798-15808 |
JJ |
denotes |
coincident |
| T3934 |
15809-15813 |
IN |
denotes |
with |
| T3935 |
15814-15818 |
NN |
denotes |
hair |
| T3936 |
15819-15822 |
NN |
denotes |
bud |
| T3937 |
15823-15832 |
NN |
denotes |
formation |
| T3938 |
15833-15836 |
CC |
denotes |
and |
| T3939 |
15837-15845 |
VBN |
denotes |
enhanced |
| T3940 |
15846-15859 |
NN |
denotes |
proliferation |
| T3929 |
15860-15868 |
VBD |
denotes |
prompted |
| T3941 |
15869-15871 |
PRP |
denotes |
us |
| T3942 |
15872-15874 |
TO |
denotes |
to |
| T3943 |
15875-15882 |
VB |
denotes |
examine |
| T3944 |
15883-15886 |
DT |
denotes |
the |
| T3945 |
15887-15899 |
NNS |
denotes |
consequences |
| T3946 |
15900-15902 |
IN |
denotes |
of |
| T3947 |
15903-15914 |
RB |
denotes |
ectopically |
| T3948 |
15915-15925 |
VBG |
denotes |
expressing |
| T3949 |
15926-15931 |
NN |
denotes |
Snail |
| T3950 |
15932-15941 |
RB |
denotes |
elsewhere |
| T3951 |
15942-15944 |
IN |
denotes |
in |
| T3952 |
15945-15950 |
NN |
denotes |
mouse |
| T3954 |
15951-15955 |
NN |
denotes |
skin |
| T3953 |
15956-15965 |
NN |
denotes |
epidermis |
| T3955 |
15965-15966 |
. |
denotes |
. |
| T3956 |
15966-16100 |
sentence |
denotes |
To distinguish Tg from endogenous Snail, we used the HA-epitope, shown previously not to alter Snail's transcriptional activity [12]. |
| T3957 |
15967-15969 |
TO |
denotes |
To |
| T3958 |
15970-15981 |
VB |
denotes |
distinguish |
| T3960 |
15982-15984 |
NN |
denotes |
Tg |
| T3961 |
15985-15989 |
IN |
denotes |
from |
| T3962 |
15990-16000 |
JJ |
denotes |
endogenous |
| T3963 |
16001-16006 |
NN |
denotes |
Snail |
| T3964 |
16006-16008 |
, |
denotes |
, |
| T3965 |
16008-16010 |
PRP |
denotes |
we |
| T3959 |
16011-16015 |
VBD |
denotes |
used |
| T3966 |
16016-16019 |
DT |
denotes |
the |
| T3968 |
16020-16022 |
NN |
denotes |
HA |
| T3969 |
16022-16023 |
HYPH |
denotes |
- |
| T3967 |
16023-16030 |
NN |
denotes |
epitope |
| T3970 |
16030-16032 |
, |
denotes |
, |
| T3971 |
16032-16037 |
VBN |
denotes |
shown |
| T3972 |
16038-16048 |
RB |
denotes |
previously |
| T3973 |
16049-16052 |
RB |
denotes |
not |
| T3975 |
16053-16055 |
TO |
denotes |
to |
| T3974 |
16056-16061 |
VB |
denotes |
alter |
| T3976 |
16062-16067 |
NNP |
denotes |
Snail |
| T3978 |
16067-16069 |
POS |
denotes |
's |
| T3979 |
16070-16085 |
JJ |
denotes |
transcriptional |
| T3977 |
16086-16094 |
NN |
denotes |
activity |
| T3980 |
16095-16096 |
-LRB- |
denotes |
[ |
| T3981 |
16096-16098 |
CD |
denotes |
12 |
| T3982 |
16098-16099 |
-RRB- |
denotes |
] |
| T3983 |
16099-16100 |
. |
denotes |
. |
| T3984 |
16100-16212 |
sentence |
denotes |
Of 20 K14-Snail[HA] Tg animals generated, three expressed the transgene and all exhibited analogous phenotypes. |
| T3985 |
16101-16103 |
IN |
denotes |
Of |
| T3987 |
16104-16106 |
CD |
denotes |
20 |
| T3989 |
16107-16110 |
NN |
denotes |
K14 |
| T3991 |
16110-16111 |
HYPH |
denotes |
- |
| T3990 |
16111-16116 |
NN |
denotes |
Snail |
| T3992 |
16116-16117 |
-LRB- |
denotes |
[ |
| T3993 |
16117-16119 |
NN |
denotes |
HA |
| T3994 |
16119-16120 |
-RRB- |
denotes |
] |
| T3995 |
16121-16123 |
NN |
denotes |
Tg |
| T3988 |
16124-16131 |
NNS |
denotes |
animals |
| T3996 |
16132-16141 |
VBN |
denotes |
generated |
| T3997 |
16141-16143 |
, |
denotes |
, |
| T3998 |
16143-16148 |
CD |
denotes |
three |
| T3986 |
16149-16158 |
VBD |
denotes |
expressed |
| T3999 |
16159-16162 |
DT |
denotes |
the |
| T4000 |
16163-16172 |
NN |
denotes |
transgene |
| T4001 |
16173-16176 |
CC |
denotes |
and |
| T4002 |
16177-16180 |
DT |
denotes |
all |
| T4003 |
16181-16190 |
VBD |
denotes |
exhibited |
| T4004 |
16191-16200 |
JJ |
denotes |
analogous |
| T4005 |
16201-16211 |
NNS |
denotes |
phenotypes |
| T4006 |
16211-16212 |
. |
denotes |
. |
| T4007 |
16212-16304 |
sentence |
denotes |
Mice that integrated the transgene at the single-cell stage died at or shortly after birth. |
| T4008 |
16213-16217 |
NNS |
denotes |
Mice |
| T4010 |
16218-16222 |
WDT |
denotes |
that |
| T4011 |
16223-16233 |
VBD |
denotes |
integrated |
| T4012 |
16234-16237 |
DT |
denotes |
the |
| T4013 |
16238-16247 |
NN |
denotes |
transgene |
| T4014 |
16248-16250 |
IN |
denotes |
at |
| T4015 |
16251-16254 |
DT |
denotes |
the |
| T4017 |
16255-16261 |
JJ |
denotes |
single |
| T4019 |
16261-16262 |
HYPH |
denotes |
- |
| T4018 |
16262-16266 |
NN |
denotes |
cell |
| T4016 |
16267-16272 |
NN |
denotes |
stage |
| T4009 |
16273-16277 |
VBD |
denotes |
died |
| T4020 |
16278-16280 |
IN |
denotes |
at |
| T4021 |
16281-16283 |
CC |
denotes |
or |
| T4022 |
16284-16291 |
RB |
denotes |
shortly |
| T4023 |
16292-16297 |
IN |
denotes |
after |
| T4024 |
16298-16303 |
NN |
denotes |
birth |
| T4025 |
16303-16304 |
. |
denotes |
. |
| T4026 |
16304-16461 |
sentence |
denotes |
The three surviving full-Tg founder mice harbored transgene integrations that gave stable transmission of mosaic Snail gene expression through the germline. |
| T4027 |
16305-16308 |
DT |
denotes |
The |
| T4029 |
16309-16314 |
CD |
denotes |
three |
| T4030 |
16315-16324 |
VBG |
denotes |
surviving |
| T4031 |
16325-16329 |
JJ |
denotes |
full |
| T4033 |
16329-16330 |
HYPH |
denotes |
- |
| T4032 |
16330-16332 |
NN |
denotes |
Tg |
| T4034 |
16333-16340 |
NN |
denotes |
founder |
| T4028 |
16341-16345 |
NNS |
denotes |
mice |
| T4035 |
16346-16354 |
VBD |
denotes |
harbored |
| T4036 |
16355-16364 |
NN |
denotes |
transgene |
| T4037 |
16365-16377 |
NNS |
denotes |
integrations |
| T4038 |
16378-16382 |
WDT |
denotes |
that |
| T4039 |
16383-16387 |
VBD |
denotes |
gave |
| T4040 |
16388-16394 |
JJ |
denotes |
stable |
| T4041 |
16395-16407 |
NN |
denotes |
transmission |
| T4042 |
16408-16410 |
IN |
denotes |
of |
| T4043 |
16411-16417 |
JJ |
denotes |
mosaic |
| T4045 |
16418-16423 |
NN |
denotes |
Snail |
| T4044 |
16424-16428 |
NN |
denotes |
gene |
| T4046 |
16429-16439 |
NN |
denotes |
expression |
| T4047 |
16440-16447 |
IN |
denotes |
through |
| T4048 |
16448-16451 |
DT |
denotes |
the |
| T4049 |
16452-16460 |
NN |
denotes |
germline |
| T4050 |
16460-16461 |
. |
denotes |
. |
| T4051 |
16461-16572 |
sentence |
denotes |
Progressively poor health necessitated our sacrificing most offspring from these lines within a year of birth. |
| T4052 |
16462-16475 |
RB |
denotes |
Progressively |
| T4053 |
16476-16480 |
JJ |
denotes |
poor |
| T4054 |
16481-16487 |
NN |
denotes |
health |
| T4055 |
16488-16500 |
VBD |
denotes |
necessitated |
| T4056 |
16501-16504 |
PRP$ |
denotes |
our |
| T4057 |
16505-16516 |
VBG |
denotes |
sacrificing |
| T4058 |
16517-16521 |
JJS |
denotes |
most |
| T4059 |
16522-16531 |
NN |
denotes |
offspring |
| T4060 |
16532-16536 |
IN |
denotes |
from |
| T4061 |
16537-16542 |
DT |
denotes |
these |
| T4062 |
16543-16548 |
NNS |
denotes |
lines |
| T4063 |
16549-16555 |
IN |
denotes |
within |
| T4064 |
16556-16557 |
DT |
denotes |
a |
| T4065 |
16558-16562 |
NN |
denotes |
year |
| T4066 |
16563-16565 |
IN |
denotes |
of |
| T4067 |
16566-16571 |
NN |
denotes |
birth |
| T4068 |
16571-16572 |
. |
denotes |
. |
| T4069 |
16572-16686 |
sentence |
denotes |
As Snail Tg animals grew, they became distinguished by their small size, short tails, and flaky skin (Figure 2A). |
| T4070 |
16573-16575 |
IN |
denotes |
As |
| T4072 |
16576-16581 |
NN |
denotes |
Snail |
| T4074 |
16582-16584 |
NN |
denotes |
Tg |
| T4073 |
16585-16592 |
NNS |
denotes |
animals |
| T4071 |
16593-16597 |
VBD |
denotes |
grew |
| T4076 |
16597-16599 |
, |
denotes |
, |
| T4077 |
16599-16603 |
PRP |
denotes |
they |
| T4075 |
16604-16610 |
VBD |
denotes |
became |
| T4078 |
16611-16624 |
JJ |
denotes |
distinguished |
| T4079 |
16625-16627 |
IN |
denotes |
by |
| T4080 |
16628-16633 |
PRP$ |
denotes |
their |
| T4082 |
16634-16639 |
JJ |
denotes |
small |
| T4081 |
16640-16644 |
NN |
denotes |
size |
| T4083 |
16644-16646 |
, |
denotes |
, |
| T4084 |
16646-16651 |
JJ |
denotes |
short |
| T4085 |
16652-16657 |
NNS |
denotes |
tails |
| T4086 |
16657-16659 |
, |
denotes |
, |
| T4087 |
16659-16662 |
CC |
denotes |
and |
| T4088 |
16663-16668 |
JJ |
denotes |
flaky |
| T4089 |
16669-16673 |
NN |
denotes |
skin |
| T4090 |
16674-16675 |
-LRB- |
denotes |
( |
| T4092 |
16675-16681 |
NN |
denotes |
Figure |
| T4091 |
16682-16684 |
NN |
denotes |
2A |
| T4093 |
16684-16685 |
-RRB- |
denotes |
) |
| T4094 |
16685-16686 |
. |
denotes |
. |
| T4095 |
16686-16797 |
sentence |
denotes |
Histological analyses of 3-d old (P3) mice revealed mosaic patches marked by epidermal thickening (Figure 2B). |
| T4096 |
16687-16699 |
JJ |
denotes |
Histological |
| T4097 |
16700-16708 |
NNS |
denotes |
analyses |
| T4099 |
16709-16711 |
IN |
denotes |
of |
| T4100 |
16712-16713 |
CD |
denotes |
3 |
| T4102 |
16713-16714 |
HYPH |
denotes |
- |
| T4101 |
16714-16715 |
NN |
denotes |
d |
| T4103 |
16716-16719 |
JJ |
denotes |
old |
| T4105 |
16720-16721 |
-LRB- |
denotes |
( |
| T4106 |
16721-16723 |
JJ |
denotes |
P3 |
| T4107 |
16723-16724 |
-RRB- |
denotes |
) |
| T4104 |
16725-16729 |
NNS |
denotes |
mice |
| T4098 |
16730-16738 |
VBD |
denotes |
revealed |
| T4108 |
16739-16745 |
NN |
denotes |
mosaic |
| T4109 |
16746-16753 |
NNS |
denotes |
patches |
| T4110 |
16754-16760 |
VBN |
denotes |
marked |
| T4111 |
16761-16763 |
IN |
denotes |
by |
| T4112 |
16764-16773 |
JJ |
denotes |
epidermal |
| T4113 |
16774-16784 |
NN |
denotes |
thickening |
| T4114 |
16785-16786 |
-LRB- |
denotes |
( |
| T4116 |
16786-16792 |
NN |
denotes |
Figure |
| T4115 |
16793-16795 |
NN |
denotes |
2B |
| T4117 |
16795-16796 |
-RRB- |
denotes |
) |
| T4118 |
16796-16797 |
. |
denotes |
. |
| T4119 |
16797-16952 |
sentence |
denotes |
The mosaic morphology was reflected at the level of Tg Snail protein, with only the hyperthickened regions expressing nuclear HA-tagged Snail (Figure 2C). |
| T4120 |
16798-16801 |
DT |
denotes |
The |
| T4122 |
16802-16808 |
NN |
denotes |
mosaic |
| T4121 |
16809-16819 |
NN |
denotes |
morphology |
| T4124 |
16820-16823 |
VBD |
denotes |
was |
| T4123 |
16824-16833 |
VBN |
denotes |
reflected |
| T4125 |
16834-16836 |
IN |
denotes |
at |
| T4126 |
16837-16840 |
DT |
denotes |
the |
| T4127 |
16841-16846 |
NN |
denotes |
level |
| T4128 |
16847-16849 |
IN |
denotes |
of |
| T4129 |
16850-16852 |
NN |
denotes |
Tg |
| T4131 |
16853-16858 |
NN |
denotes |
Snail |
| T4130 |
16859-16866 |
NN |
denotes |
protein |
| T4132 |
16866-16868 |
, |
denotes |
, |
| T4133 |
16868-16872 |
IN |
denotes |
with |
| T4135 |
16873-16877 |
RB |
denotes |
only |
| T4137 |
16878-16881 |
DT |
denotes |
the |
| T4138 |
16882-16896 |
VBN |
denotes |
hyperthickened |
| T4136 |
16897-16904 |
NNS |
denotes |
regions |
| T4134 |
16905-16915 |
VBG |
denotes |
expressing |
| T4139 |
16916-16923 |
JJ |
denotes |
nuclear |
| T4141 |
16924-16926 |
NN |
denotes |
HA |
| T4143 |
16926-16927 |
HYPH |
denotes |
- |
| T4142 |
16927-16933 |
VBN |
denotes |
tagged |
| T4140 |
16934-16939 |
NN |
denotes |
Snail |
| T4144 |
16940-16941 |
-LRB- |
denotes |
( |
| T4146 |
16941-16947 |
NN |
denotes |
Figure |
| T4145 |
16948-16950 |
NN |
denotes |
2C |
| T4147 |
16950-16951 |
-RRB- |
denotes |
) |
| T4148 |
16951-16952 |
. |
denotes |
. |
| T4149 |
16952-17112 |
sentence |
denotes |
These hyperthickened areas were marked by excessive proliferation, as revealed by antibodies against the proliferating nuclear antigen Ki67 (Figure 2D and 2E). |
| T4150 |
16953-16958 |
DT |
denotes |
These |
| T4152 |
16959-16973 |
VBN |
denotes |
hyperthickened |
| T4151 |
16974-16979 |
NNS |
denotes |
areas |
| T4154 |
16980-16984 |
VBD |
denotes |
were |
| T4153 |
16985-16991 |
VBN |
denotes |
marked |
| T4155 |
16992-16994 |
IN |
denotes |
by |
| T4156 |
16995-17004 |
JJ |
denotes |
excessive |
| T4157 |
17005-17018 |
NN |
denotes |
proliferation |
| T4158 |
17018-17020 |
, |
denotes |
, |
| T4159 |
17020-17022 |
IN |
denotes |
as |
| T4160 |
17023-17031 |
VBN |
denotes |
revealed |
| T4161 |
17032-17034 |
IN |
denotes |
by |
| T4162 |
17035-17045 |
NNS |
denotes |
antibodies |
| T4163 |
17046-17053 |
IN |
denotes |
against |
| T4164 |
17054-17057 |
DT |
denotes |
the |
| T4166 |
17058-17071 |
VBG |
denotes |
proliferating |
| T4167 |
17072-17079 |
JJ |
denotes |
nuclear |
| T4165 |
17080-17087 |
NN |
denotes |
antigen |
| T4168 |
17088-17092 |
NN |
denotes |
Ki67 |
| T4169 |
17093-17094 |
-LRB- |
denotes |
( |
| T4171 |
17094-17100 |
NN |
denotes |
Figure |
| T4170 |
17101-17103 |
NN |
denotes |
2D |
| T4172 |
17104-17107 |
CC |
denotes |
and |
| T4173 |
17108-17110 |
NN |
denotes |
2E |
| T4174 |
17110-17111 |
-RRB- |
denotes |
) |
| T4175 |
17111-17112 |
. |
denotes |
. |
| T4176 |
17112-17325 |
sentence |
denotes |
Activated, pMAPK-positive cells were also prevalent in these areas (Figure 2F and 2G), as were cells expressing keratin 6, a keratin induced in the suprabasal layers of hyperproliferative skin (Figure 2H and 2I). |
| T4177 |
17113-17122 |
VBN |
denotes |
Activated |
| T4179 |
17122-17124 |
, |
denotes |
, |
| T4180 |
17124-17129 |
NN |
denotes |
pMAPK |
| T4182 |
17129-17130 |
HYPH |
denotes |
- |
| T4181 |
17130-17138 |
JJ |
denotes |
positive |
| T4178 |
17139-17144 |
NNS |
denotes |
cells |
| T4183 |
17145-17149 |
VBD |
denotes |
were |
| T4184 |
17150-17154 |
RB |
denotes |
also |
| T4185 |
17155-17164 |
JJ |
denotes |
prevalent |
| T4186 |
17165-17167 |
IN |
denotes |
in |
| T4187 |
17168-17173 |
DT |
denotes |
these |
| T4188 |
17174-17179 |
NNS |
denotes |
areas |
| T4189 |
17180-17181 |
-LRB- |
denotes |
( |
| T4191 |
17181-17187 |
NN |
denotes |
Figure |
| T4190 |
17188-17190 |
NN |
denotes |
2F |
| T4192 |
17191-17194 |
CC |
denotes |
and |
| T4193 |
17195-17197 |
NN |
denotes |
2G |
| T4194 |
17197-17198 |
-RRB- |
denotes |
) |
| T4195 |
17198-17200 |
, |
denotes |
, |
| T4196 |
17200-17202 |
IN |
denotes |
as |
| T4197 |
17203-17207 |
VBD |
denotes |
were |
| T4198 |
17208-17213 |
NNS |
denotes |
cells |
| T4199 |
17214-17224 |
VBG |
denotes |
expressing |
| T4200 |
17225-17232 |
NN |
denotes |
keratin |
| T4201 |
17233-17234 |
CD |
denotes |
6 |
| T4202 |
17234-17236 |
, |
denotes |
, |
| T4203 |
17236-17237 |
DT |
denotes |
a |
| T4204 |
17238-17245 |
NN |
denotes |
keratin |
| T4205 |
17246-17253 |
VBN |
denotes |
induced |
| T4206 |
17254-17256 |
IN |
denotes |
in |
| T4207 |
17257-17260 |
DT |
denotes |
the |
| T4209 |
17261-17271 |
JJ |
denotes |
suprabasal |
| T4208 |
17272-17278 |
NNS |
denotes |
layers |
| T4210 |
17279-17281 |
IN |
denotes |
of |
| T4211 |
17282-17300 |
JJ |
denotes |
hyperproliferative |
| T4212 |
17301-17305 |
NN |
denotes |
skin |
| T4213 |
17306-17307 |
-LRB- |
denotes |
( |
| T4215 |
17307-17313 |
NN |
denotes |
Figure |
| T4214 |
17314-17316 |
NN |
denotes |
2H |
| T4216 |
17317-17320 |
CC |
denotes |
and |
| T4217 |
17321-17323 |
NN |
denotes |
2I |
| T4218 |
17323-17324 |
-RRB- |
denotes |
) |
| T4219 |
17324-17325 |
. |
denotes |
. |
| T4220 |
17325-19464 |
sentence |
denotes |
Figure 2 Misexpression of Snail in Mouse Skin Epidermis Results in Hyperproliferation
Three different surviving Tg founder mice harbored a K14-Snail transgene that was integrated into a locus that resulted in inheritable, mosaic expression of the transgene in skin epidermis. All displayed similar abnormalities, as did their offspring.
(A) P16 WT and K14-Snail Tg mice. Insets denote magnified tail segments, which displayed a mosaic, flaky appearance in Tg mice. Size differences appeared with age, and are likely due to K14-promoter activity in the tongue and oral epithelium, resulting in progressive defects and reduced food intake. Hence, skin sections from young (P3) mice were analyzed (B–I).
(B) Hematoxylin- and eosin-stained Tg skin section. Double arrows demarcate the border of mosaic histology, with seemingly normal epidermis (epi) and a mature hair follicle (hf) at left and hyperthickened epidermis at right.
(C) Immunofluorescence of Tg skin section labeled with antibodies as color-coded on frame. Double arrows demarcate the border of mosaic anti-Snail (green), revealing Snail expression coincident with regions of hyperthickened epidermis (at left) and absent in regions of normal epidermis (at right).
(D–I) Sections of P3 WT or Tg skin (affected region) subjected to either immunofluorescence (D, E, H, and I) or immunohistochemistry (F and G) with antibodies as indicated on the panel. Anti-keratin 5 indicates K5, normally restricted to the basal layer of the epidermis; anti-keratin 6 detects keratin 6, expressed in postnatal epidermis under conditions such as wounding, in which hyperproliferation occurs. All other antibodies are as in the legend to Figure 2. Comparison of D and E provide representative examples that illustrate that pMAPK is found in only a subset of all proliferating (Ki67-positive) cells. Note also the presence of Ki67- (E) and pMAPK-positive (G) cells in some suprabasal areas; Ki67-positive cells colabeled with anti-Snail (E). Expression of the Snail transgene did not block terminal differentiation in the hyperproliferative epidermis, but it distorted it markedly (Figure 3A–3H). |
| T4221 |
19310-19320 |
NN |
denotes |
Expression |
| T4223 |
19321-19323 |
IN |
denotes |
of |
| T4224 |
19324-19327 |
DT |
denotes |
the |
| T4226 |
19328-19333 |
NN |
denotes |
Snail |
| T4225 |
19334-19343 |
NN |
denotes |
transgene |
| T4227 |
19344-19347 |
VBD |
denotes |
did |
| T4228 |
19348-19351 |
RB |
denotes |
not |
| T4222 |
19352-19357 |
VB |
denotes |
block |
| T4229 |
19358-19366 |
JJ |
denotes |
terminal |
| T4230 |
19367-19382 |
NN |
denotes |
differentiation |
| T4231 |
19383-19385 |
IN |
denotes |
in |
| T4232 |
19386-19389 |
DT |
denotes |
the |
| T4234 |
19390-19408 |
JJ |
denotes |
hyperproliferative |
| T4233 |
19409-19418 |
NN |
denotes |
epidermis |
| T4235 |
19418-19420 |
, |
denotes |
, |
| T4236 |
19420-19423 |
CC |
denotes |
but |
| T4237 |
19424-19426 |
PRP |
denotes |
it |
| T4238 |
19427-19436 |
VBD |
denotes |
distorted |
| T4239 |
19437-19439 |
PRP |
denotes |
it |
| T4240 |
19440-19448 |
RB |
denotes |
markedly |
| T4241 |
19449-19450 |
-LRB- |
denotes |
( |
| T4243 |
19450-19456 |
NN |
denotes |
Figure |
| T4242 |
19457-19459 |
NN |
denotes |
3A |
| T4244 |
19459-19460 |
SYM |
denotes |
– |
| T4245 |
19460-19462 |
NN |
denotes |
3H |
| T4246 |
19462-19463 |
-RRB- |
denotes |
) |
| T4247 |
19463-19464 |
. |
denotes |
. |
| T4248 |
19464-19601 |
sentence |
denotes |
Typical of most hyperproliferating conditions, Snail expression led to a large expansion in layers with spinous and granular morphology. |
| T4249 |
19465-19472 |
JJ |
denotes |
Typical |
| T4251 |
19473-19475 |
IN |
denotes |
of |
| T4252 |
19476-19480 |
JJS |
denotes |
most |
| T4254 |
19481-19499 |
NN |
denotes |
hyperproliferating |
| T4253 |
19500-19510 |
NNS |
denotes |
conditions |
| T4255 |
19510-19512 |
, |
denotes |
, |
| T4256 |
19512-19517 |
NN |
denotes |
Snail |
| T4257 |
19518-19528 |
NN |
denotes |
expression |
| T4250 |
19529-19532 |
VBD |
denotes |
led |
| T4258 |
19533-19535 |
IN |
denotes |
to |
| T4259 |
19536-19537 |
DT |
denotes |
a |
| T4261 |
19538-19543 |
JJ |
denotes |
large |
| T4260 |
19544-19553 |
NN |
denotes |
expansion |
| T4262 |
19554-19556 |
IN |
denotes |
in |
| T4263 |
19557-19563 |
NNS |
denotes |
layers |
| T4264 |
19564-19568 |
IN |
denotes |
with |
| T4265 |
19569-19576 |
JJ |
denotes |
spinous |
| T4267 |
19577-19580 |
CC |
denotes |
and |
| T4268 |
19581-19589 |
JJ |
denotes |
granular |
| T4266 |
19590-19600 |
NN |
denotes |
morphology |
| T4269 |
19600-19601 |
. |
denotes |
. |
| T4270 |
19601-19744 |
sentence |
denotes |
Additionally, however, was a marked and variable expansion of keratin 5 (K5), normally restricted to the innermost basal layer (see Figure 3). |
| T4271 |
19602-19614 |
RB |
denotes |
Additionally |
| T4273 |
19614-19616 |
, |
denotes |
, |
| T4274 |
19616-19623 |
RB |
denotes |
however |
| T4275 |
19623-19625 |
, |
denotes |
, |
| T4272 |
19625-19628 |
VBD |
denotes |
was |
| T4276 |
19629-19630 |
DT |
denotes |
a |
| T4278 |
19631-19637 |
JJ |
denotes |
marked |
| T4279 |
19638-19641 |
CC |
denotes |
and |
| T4280 |
19642-19650 |
JJ |
denotes |
variable |
| T4277 |
19651-19660 |
NN |
denotes |
expansion |
| T4281 |
19661-19663 |
IN |
denotes |
of |
| T4282 |
19664-19671 |
NN |
denotes |
keratin |
| T4283 |
19672-19673 |
CD |
denotes |
5 |
| T4284 |
19674-19675 |
-LRB- |
denotes |
( |
| T4285 |
19675-19677 |
NN |
denotes |
K5 |
| T4286 |
19677-19678 |
-RRB- |
denotes |
) |
| T4287 |
19678-19680 |
, |
denotes |
, |
| T4288 |
19680-19688 |
RB |
denotes |
normally |
| T4289 |
19689-19699 |
VBN |
denotes |
restricted |
| T4290 |
19700-19702 |
IN |
denotes |
to |
| T4291 |
19703-19706 |
DT |
denotes |
the |
| T4293 |
19707-19716 |
JJS |
denotes |
innermost |
| T4294 |
19717-19722 |
JJ |
denotes |
basal |
| T4292 |
19723-19728 |
NN |
denotes |
layer |
| T4295 |
19729-19730 |
-LRB- |
denotes |
( |
| T4296 |
19730-19733 |
VB |
denotes |
see |
| T4297 |
19734-19740 |
NN |
denotes |
Figure |
| T4298 |
19741-19742 |
CD |
denotes |
3 |
| T4299 |
19742-19743 |
-RRB- |
denotes |
) |
| T4300 |
19743-19744 |
. |
denotes |
. |
| T4301 |
19744-20053 |
sentence |
denotes |
Although the failure of Snail-null mice to develop past gastrulation [21] precluded our ability to study the loss of Snail function in skin development, a good correlation emerged between the expression of Snail protein and the extension of K5, Ki67, and pMAPK suprabasally (compare data in Figures 2 and 3). |
| T4302 |
19745-19753 |
IN |
denotes |
Although |
| T4304 |
19754-19757 |
DT |
denotes |
the |
| T4305 |
19758-19765 |
NN |
denotes |
failure |
| T4306 |
19766-19768 |
IN |
denotes |
of |
| T4307 |
19769-19774 |
NN |
denotes |
Snail |
| T4309 |
19774-19775 |
HYPH |
denotes |
- |
| T4310 |
19775-19779 |
JJ |
denotes |
null |
| T4308 |
19780-19784 |
NNS |
denotes |
mice |
| T4311 |
19785-19787 |
TO |
denotes |
to |
| T4312 |
19788-19795 |
VB |
denotes |
develop |
| T4313 |
19796-19800 |
JJ |
denotes |
past |
| T4314 |
19801-19813 |
NN |
denotes |
gastrulation |
| T4315 |
19814-19815 |
-LRB- |
denotes |
[ |
| T4316 |
19815-19817 |
CD |
denotes |
21 |
| T4317 |
19817-19818 |
-RRB- |
denotes |
] |
| T4303 |
19819-19828 |
VBD |
denotes |
precluded |
| T4319 |
19829-19832 |
PRP$ |
denotes |
our |
| T4320 |
19833-19840 |
NN |
denotes |
ability |
| T4321 |
19841-19843 |
TO |
denotes |
to |
| T4322 |
19844-19849 |
VB |
denotes |
study |
| T4323 |
19850-19853 |
DT |
denotes |
the |
| T4324 |
19854-19858 |
NN |
denotes |
loss |
| T4325 |
19859-19861 |
IN |
denotes |
of |
| T4326 |
19862-19867 |
NN |
denotes |
Snail |
| T4327 |
19868-19876 |
NN |
denotes |
function |
| T4328 |
19877-19879 |
IN |
denotes |
in |
| T4329 |
19880-19884 |
NN |
denotes |
skin |
| T4330 |
19885-19896 |
NN |
denotes |
development |
| T4331 |
19896-19898 |
, |
denotes |
, |
| T4332 |
19898-19899 |
DT |
denotes |
a |
| T4334 |
19900-19904 |
JJ |
denotes |
good |
| T4333 |
19905-19916 |
NN |
denotes |
correlation |
| T4318 |
19917-19924 |
VBD |
denotes |
emerged |
| T4335 |
19925-19932 |
IN |
denotes |
between |
| T4336 |
19933-19936 |
DT |
denotes |
the |
| T4337 |
19937-19947 |
NN |
denotes |
expression |
| T4338 |
19948-19950 |
IN |
denotes |
of |
| T4339 |
19951-19956 |
NN |
denotes |
Snail |
| T4340 |
19957-19964 |
NN |
denotes |
protein |
| T4341 |
19965-19968 |
CC |
denotes |
and |
| T4342 |
19969-19972 |
DT |
denotes |
the |
| T4343 |
19973-19982 |
NN |
denotes |
extension |
| T4344 |
19983-19985 |
IN |
denotes |
of |
| T4345 |
19986-19988 |
NN |
denotes |
K5 |
| T4346 |
19988-19990 |
, |
denotes |
, |
| T4347 |
19990-19994 |
NN |
denotes |
Ki67 |
| T4348 |
19994-19996 |
, |
denotes |
, |
| T4349 |
19996-19999 |
CC |
denotes |
and |
| T4350 |
20000-20005 |
NN |
denotes |
pMAPK |
| T4351 |
20006-20018 |
RB |
denotes |
suprabasally |
| T4352 |
20019-20020 |
-LRB- |
denotes |
( |
| T4353 |
20020-20027 |
VB |
denotes |
compare |
| T4354 |
20028-20032 |
NNS |
denotes |
data |
| T4355 |
20033-20035 |
IN |
denotes |
in |
| T4356 |
20036-20043 |
NNS |
denotes |
Figures |
| T4357 |
20044-20045 |
CD |
denotes |
2 |
| T4358 |
20046-20049 |
CC |
denotes |
and |
| T4359 |
20050-20051 |
CD |
denotes |
3 |
| T4360 |
20051-20052 |
-RRB- |
denotes |
) |
| T4361 |
20052-20053 |
. |
denotes |
. |
| T4362 |
20053-22035 |
sentence |
denotes |
Figure 3 Alterations in the Differentiation Program and Basement Membrane Organization in Snail-Expressing Tg Epidermis
(A–H) Immunofluorescence of skin sections from P3 WT and Tg mice. Shown are affected areas of Tg skin; in areas where Snail protein was not expressed, stainings were normal. Sections were labeled with antibodies as indicated and color-coded on each frame. Antibodies are against markers of normal epidermal differentiation, and include K5 (a basally expressed keratin), K1 (a suprabasal keratin, expressed in spinous layer cells), involucrin (Inv; a suprabasally expressed cornified envelope protein found in upper spinous and granular layer cells), loricrin (Lor; a cornified envelope protein expressed in the granular layer), and filaggrin (Fil; a protein that bundles keratin filaments in the granular layer and stratum corneum). Note abnormal extension of anti-K5 suprabasally, often present in anti-K1 positive suprabasal Tg cells.
(I–N) Immunohistochemistry (I and J) or immunofluorescence (K–N) of sections of P30 Wt (I, K, and M) and Tg (J, L, and N) (affected areas) skins using the antibodies indicated. Note that with age, affected areas of the Tg epidermis became increasingly undulating, often exhibiting papilloma-like invaginations (J). Insets in I and J are magnified views of the boxed areas, illustrating the absence (Wt) or presence (Tg) of nuclear anti-cyclin D staining. With age, affected areas of the Tg epidermis also displayed perturbations within the basement membrane, as judged by antibody labeling against either basement membrane (K and L) or hemidesmosomal (M and N) components. Double arrows in L demarcate mosaic zones, revealing that perturbations were restricted to hyperthickened, i.e., Snail-positive zones (to left of double arrows). Other abbreviations are as noted in the legend to Figure 2. The changes in hyperproliferation and differentiation were not initially accompanied by gross signs of epithelial invaginations. |
| T4363 |
21907-21910 |
DT |
denotes |
The |
| T4364 |
21911-21918 |
NNS |
denotes |
changes |
| T4366 |
21919-21921 |
IN |
denotes |
in |
| T4367 |
21922-21940 |
NN |
denotes |
hyperproliferation |
| T4368 |
21941-21944 |
CC |
denotes |
and |
| T4369 |
21945-21960 |
NN |
denotes |
differentiation |
| T4370 |
21961-21965 |
VBD |
denotes |
were |
| T4371 |
21966-21969 |
RB |
denotes |
not |
| T4372 |
21970-21979 |
RB |
denotes |
initially |
| T4365 |
21980-21991 |
VBN |
denotes |
accompanied |
| T4373 |
21992-21994 |
IN |
denotes |
by |
| T4374 |
21995-22000 |
JJ |
denotes |
gross |
| T4375 |
22001-22006 |
NNS |
denotes |
signs |
| T4376 |
22007-22009 |
IN |
denotes |
of |
| T4377 |
22010-22020 |
JJ |
denotes |
epithelial |
| T4378 |
22021-22034 |
NNS |
denotes |
invaginations |
| T4379 |
22034-22035 |
. |
denotes |
. |
| T4380 |
22035-22229 |
sentence |
denotes |
With age, however, epidermal folds and undulations developed in areas where Snail was expressed, and proliferative markers persisted in these regions (Figure 3I and 3J; anti-cyclin D staining). |
| T4381 |
22036-22040 |
IN |
denotes |
With |
| T4383 |
22041-22044 |
NN |
denotes |
age |
| T4384 |
22044-22046 |
, |
denotes |
, |
| T4385 |
22046-22053 |
RB |
denotes |
however |
| T4386 |
22053-22055 |
, |
denotes |
, |
| T4387 |
22055-22064 |
JJ |
denotes |
epidermal |
| T4388 |
22065-22070 |
NNS |
denotes |
folds |
| T4389 |
22071-22074 |
CC |
denotes |
and |
| T4390 |
22075-22086 |
NNS |
denotes |
undulations |
| T4382 |
22087-22096 |
VBN |
denotes |
developed |
| T4391 |
22097-22099 |
IN |
denotes |
in |
| T4392 |
22100-22105 |
NNS |
denotes |
areas |
| T4393 |
22106-22111 |
WRB |
denotes |
where |
| T4395 |
22112-22117 |
NN |
denotes |
Snail |
| T4396 |
22118-22121 |
VBD |
denotes |
was |
| T4394 |
22122-22131 |
VBN |
denotes |
expressed |
| T4397 |
22131-22133 |
, |
denotes |
, |
| T4398 |
22133-22136 |
CC |
denotes |
and |
| T4399 |
22137-22150 |
JJ |
denotes |
proliferative |
| T4400 |
22151-22158 |
NNS |
denotes |
markers |
| T4401 |
22159-22168 |
VBD |
denotes |
persisted |
| T4402 |
22169-22171 |
IN |
denotes |
in |
| T4403 |
22172-22177 |
DT |
denotes |
these |
| T4404 |
22178-22185 |
NNS |
denotes |
regions |
| T4405 |
22186-22187 |
-LRB- |
denotes |
( |
| T4407 |
22187-22193 |
NN |
denotes |
Figure |
| T4408 |
22194-22196 |
NN |
denotes |
3I |
| T4409 |
22197-22200 |
CC |
denotes |
and |
| T4410 |
22201-22203 |
NN |
denotes |
3J |
| T4411 |
22203-22204 |
: |
denotes |
; |
| T4412 |
22205-22216 |
JJ |
denotes |
anti-cyclin |
| T4413 |
22217-22218 |
NN |
denotes |
D |
| T4406 |
22219-22227 |
NN |
denotes |
staining |
| T4414 |
22227-22228 |
-RRB- |
denotes |
) |
| T4415 |
22228-22229 |
. |
denotes |
. |
| T4416 |
22229-22341 |
sentence |
denotes |
The undulations were accompanied by partial dissolution of the underlying basement membrane (Figure 3K and 3L). |
| T4417 |
22230-22233 |
DT |
denotes |
The |
| T4418 |
22234-22245 |
NNS |
denotes |
undulations |
| T4420 |
22246-22250 |
VBD |
denotes |
were |
| T4419 |
22251-22262 |
VBN |
denotes |
accompanied |
| T4421 |
22263-22265 |
IN |
denotes |
by |
| T4422 |
22266-22273 |
JJ |
denotes |
partial |
| T4423 |
22274-22285 |
NN |
denotes |
dissolution |
| T4424 |
22286-22288 |
IN |
denotes |
of |
| T4425 |
22289-22292 |
DT |
denotes |
the |
| T4427 |
22293-22303 |
JJ |
denotes |
underlying |
| T4428 |
22304-22312 |
NN |
denotes |
basement |
| T4426 |
22313-22321 |
NN |
denotes |
membrane |
| T4429 |
22322-22323 |
-LRB- |
denotes |
( |
| T4431 |
22323-22329 |
NN |
denotes |
Figure |
| T4430 |
22330-22332 |
NN |
denotes |
3K |
| T4432 |
22333-22336 |
CC |
denotes |
and |
| T4433 |
22337-22339 |
NN |
denotes |
3L |
| T4434 |
22339-22340 |
-RRB- |
denotes |
) |
| T4435 |
22340-22341 |
. |
denotes |
. |
| T4436 |
22341-22541 |
sentence |
denotes |
Aberrant staining was also observed with antibodies against components of the hemidesmosomes, which provide strong adhesion of basal epidermal cells to the underlying basal lamina (Figure 3M and 3N). |
| T4437 |
22342-22350 |
JJ |
denotes |
Aberrant |
| T4438 |
22351-22359 |
NN |
denotes |
staining |
| T4440 |
22360-22363 |
VBD |
denotes |
was |
| T4441 |
22364-22368 |
RB |
denotes |
also |
| T4439 |
22369-22377 |
VBN |
denotes |
observed |
| T4442 |
22378-22382 |
IN |
denotes |
with |
| T4443 |
22383-22393 |
NNS |
denotes |
antibodies |
| T4444 |
22394-22401 |
IN |
denotes |
against |
| T4445 |
22402-22412 |
NNS |
denotes |
components |
| T4446 |
22413-22415 |
IN |
denotes |
of |
| T4447 |
22416-22419 |
DT |
denotes |
the |
| T4448 |
22420-22434 |
NNS |
denotes |
hemidesmosomes |
| T4449 |
22434-22436 |
, |
denotes |
, |
| T4450 |
22436-22441 |
WDT |
denotes |
which |
| T4451 |
22442-22449 |
VBP |
denotes |
provide |
| T4452 |
22450-22456 |
JJ |
denotes |
strong |
| T4453 |
22457-22465 |
NN |
denotes |
adhesion |
| T4454 |
22466-22468 |
IN |
denotes |
of |
| T4455 |
22469-22474 |
JJ |
denotes |
basal |
| T4457 |
22475-22484 |
JJ |
denotes |
epidermal |
| T4456 |
22485-22490 |
NNS |
denotes |
cells |
| T4458 |
22491-22493 |
IN |
denotes |
to |
| T4459 |
22494-22497 |
DT |
denotes |
the |
| T4461 |
22498-22508 |
JJ |
denotes |
underlying |
| T4462 |
22509-22514 |
JJ |
denotes |
basal |
| T4460 |
22515-22521 |
NN |
denotes |
lamina |
| T4463 |
22522-22523 |
-LRB- |
denotes |
( |
| T4465 |
22523-22529 |
NN |
denotes |
Figure |
| T4464 |
22530-22532 |
NN |
denotes |
3M |
| T4466 |
22533-22536 |
CC |
denotes |
and |
| T4467 |
22537-22539 |
NN |
denotes |
3N |
| T4468 |
22539-22540 |
-RRB- |
denotes |
) |
| T4469 |
22540-22541 |
. |
denotes |
. |
| T4470 |
22541-22696 |
sentence |
denotes |
Interestingly, similar types of alterations occur in the basement membrane in the hair bud of embryonic and newborn mice when Snail is normally expressed. |
| T4471 |
22542-22555 |
RB |
denotes |
Interestingly |
| T4473 |
22555-22557 |
, |
denotes |
, |
| T4474 |
22557-22564 |
JJ |
denotes |
similar |
| T4475 |
22565-22570 |
NNS |
denotes |
types |
| T4476 |
22571-22573 |
IN |
denotes |
of |
| T4477 |
22574-22585 |
NNS |
denotes |
alterations |
| T4472 |
22586-22591 |
VBP |
denotes |
occur |
| T4478 |
22592-22594 |
IN |
denotes |
in |
| T4479 |
22595-22598 |
DT |
denotes |
the |
| T4481 |
22599-22607 |
NN |
denotes |
basement |
| T4480 |
22608-22616 |
NN |
denotes |
membrane |
| T4482 |
22617-22619 |
IN |
denotes |
in |
| T4483 |
22620-22623 |
DT |
denotes |
the |
| T4485 |
22624-22628 |
NN |
denotes |
hair |
| T4484 |
22629-22632 |
NN |
denotes |
bud |
| T4486 |
22633-22635 |
IN |
denotes |
of |
| T4487 |
22636-22645 |
JJ |
denotes |
embryonic |
| T4489 |
22646-22649 |
CC |
denotes |
and |
| T4490 |
22650-22657 |
JJ |
denotes |
newborn |
| T4488 |
22658-22662 |
NNS |
denotes |
mice |
| T4491 |
22663-22667 |
WRB |
denotes |
when |
| T4493 |
22668-22673 |
NN |
denotes |
Snail |
| T4494 |
22674-22676 |
VBZ |
denotes |
is |
| T4495 |
22677-22685 |
RB |
denotes |
normally |
| T4492 |
22686-22695 |
VBN |
denotes |
expressed |
| T4496 |
22695-22696 |
. |
denotes |
. |
| T4497 |
22696-22933 |
sentence |
denotes |
The fact that the basement membrane separating the epidermis from the dermis is altered only in the adult Tg animals suggests the involvement of intermediary factors not as readily available in the epidermis as they are in the follicle. |
| T4498 |
22697-22700 |
DT |
denotes |
The |
| T4499 |
22701-22705 |
NN |
denotes |
fact |
| T4501 |
22706-22710 |
IN |
denotes |
that |
| T4503 |
22711-22714 |
DT |
denotes |
the |
| T4505 |
22715-22723 |
NN |
denotes |
basement |
| T4504 |
22724-22732 |
NN |
denotes |
membrane |
| T4506 |
22733-22743 |
VBG |
denotes |
separating |
| T4507 |
22744-22747 |
DT |
denotes |
the |
| T4508 |
22748-22757 |
NN |
denotes |
epidermis |
| T4509 |
22758-22762 |
IN |
denotes |
from |
| T4510 |
22763-22766 |
DT |
denotes |
the |
| T4511 |
22767-22773 |
NN |
denotes |
dermis |
| T4512 |
22774-22776 |
VBZ |
denotes |
is |
| T4502 |
22777-22784 |
VBN |
denotes |
altered |
| T4513 |
22785-22789 |
RB |
denotes |
only |
| T4514 |
22790-22792 |
IN |
denotes |
in |
| T4515 |
22793-22796 |
DT |
denotes |
the |
| T4517 |
22797-22802 |
JJ |
denotes |
adult |
| T4518 |
22803-22805 |
NN |
denotes |
Tg |
| T4516 |
22806-22813 |
NNS |
denotes |
animals |
| T4500 |
22814-22822 |
VBZ |
denotes |
suggests |
| T4519 |
22823-22826 |
DT |
denotes |
the |
| T4520 |
22827-22838 |
NN |
denotes |
involvement |
| T4521 |
22839-22841 |
IN |
denotes |
of |
| T4522 |
22842-22854 |
JJ |
denotes |
intermediary |
| T4523 |
22855-22862 |
NNS |
denotes |
factors |
| T4524 |
22863-22866 |
RB |
denotes |
not |
| T4526 |
22867-22869 |
RB |
denotes |
as |
| T4527 |
22870-22877 |
RB |
denotes |
readily |
| T4525 |
22878-22887 |
JJ |
denotes |
available |
| T4528 |
22888-22890 |
IN |
denotes |
in |
| T4529 |
22891-22894 |
DT |
denotes |
the |
| T4530 |
22895-22904 |
NN |
denotes |
epidermis |
| T4531 |
22905-22907 |
IN |
denotes |
as |
| T4533 |
22908-22912 |
PRP |
denotes |
they |
| T4532 |
22913-22916 |
VBP |
denotes |
are |
| T4534 |
22917-22919 |
IN |
denotes |
in |
| T4535 |
22920-22923 |
DT |
denotes |
the |
| T4536 |
22924-22932 |
NN |
denotes |
follicle |
| T4537 |
22932-22933 |
. |
denotes |
. |
| T5218 |
22935-22943 |
JJ |
denotes |
Possible |
| T5219 |
22944-22949 |
NNS |
denotes |
Links |
| T5220 |
22950-22957 |
IN |
denotes |
between |
| T5221 |
22958-22967 |
JJ |
denotes |
Epidermal |
| T5222 |
22968-22986 |
NN |
denotes |
Hyperproliferation |
| T5223 |
22987-22990 |
CC |
denotes |
and |
| T5224 |
22991-22995 |
JJ |
denotes |
Down |
| T5226 |
22995-22996 |
HYPH |
denotes |
- |
| T5225 |
22996-23006 |
NN |
denotes |
regulation |
| T5227 |
23007-23009 |
IN |
denotes |
of |
| T5228 |
23010-23012 |
NN |
denotes |
AJ |
| T5229 |
23013-23021 |
NNS |
denotes |
Proteins |
| T5230 |
23022-23024 |
IN |
denotes |
in |
| T5231 |
23025-23030 |
NN |
denotes |
Snail |
| T5233 |
23031-23033 |
NN |
denotes |
Tg |
| T5232 |
23034-23038 |
NNS |
denotes |
Mice |
| T5234 |
23038-23358 |
sentence |
denotes |
Given that the E-cadherin promoter is a direct target for Snail-mediated repression in vitro [4,12,13], and that E-cadherin was down-regulated in Snail-expressing hair buds, we examined the status of E-cadherin and other AJ proteins within regions of hyperproliferative epidermis where Tg Snail was present (Figure 4A). |
| T5235 |
23039-23044 |
VBN |
denotes |
Given |
| T5237 |
23045-23049 |
IN |
denotes |
that |
| T5239 |
23050-23053 |
DT |
denotes |
the |
| T5241 |
23054-23055 |
NN |
denotes |
E |
| T5243 |
23055-23056 |
HYPH |
denotes |
- |
| T5242 |
23056-23064 |
NN |
denotes |
cadherin |
| T5240 |
23065-23073 |
NN |
denotes |
promoter |
| T5238 |
23074-23076 |
VBZ |
denotes |
is |
| T5244 |
23077-23078 |
DT |
denotes |
a |
| T5246 |
23079-23085 |
JJ |
denotes |
direct |
| T5245 |
23086-23092 |
NN |
denotes |
target |
| T5247 |
23093-23096 |
IN |
denotes |
for |
| T5248 |
23097-23102 |
NN |
denotes |
Snail |
| T5250 |
23102-23103 |
HYPH |
denotes |
- |
| T5249 |
23103-23111 |
VBN |
denotes |
mediated |
| T5251 |
23112-23122 |
NN |
denotes |
repression |
| T5252 |
23123-23125 |
FW |
denotes |
in |
| T5253 |
23126-23131 |
FW |
denotes |
vitro |
| T5254 |
23132-23133 |
-LRB- |
denotes |
[ |
| T5256 |
23133-23134 |
CD |
denotes |
4 |
| T5257 |
23134-23135 |
, |
denotes |
, |
| T5258 |
23135-23137 |
CD |
denotes |
12 |
| T5259 |
23137-23138 |
, |
denotes |
, |
| T5255 |
23138-23140 |
CD |
denotes |
13 |
| T5260 |
23140-23141 |
-RRB- |
denotes |
] |
| T5261 |
23141-23143 |
, |
denotes |
, |
| T5262 |
23143-23146 |
CC |
denotes |
and |
| T5263 |
23147-23151 |
IN |
denotes |
that |
| T5265 |
23152-23153 |
NN |
denotes |
E |
| T5267 |
23153-23154 |
HYPH |
denotes |
- |
| T5266 |
23154-23162 |
NN |
denotes |
cadherin |
| T5268 |
23163-23166 |
VBD |
denotes |
was |
| T5269 |
23167-23171 |
RB |
denotes |
down |
| T5270 |
23171-23172 |
HYPH |
denotes |
- |
| T5264 |
23172-23181 |
VBN |
denotes |
regulated |
| T5271 |
23182-23184 |
IN |
denotes |
in |
| T5272 |
23185-23190 |
NN |
denotes |
Snail |
| T5274 |
23190-23191 |
HYPH |
denotes |
- |
| T5273 |
23191-23201 |
VBG |
denotes |
expressing |
| T5276 |
23202-23206 |
NN |
denotes |
hair |
| T5275 |
23207-23211 |
NNS |
denotes |
buds |
| T5277 |
23211-23213 |
, |
denotes |
, |
| T5278 |
23213-23215 |
PRP |
denotes |
we |
| T5236 |
23216-23224 |
VBD |
denotes |
examined |
| T5279 |
23225-23228 |
DT |
denotes |
the |
| T5280 |
23229-23235 |
NN |
denotes |
status |
| T5281 |
23236-23238 |
IN |
denotes |
of |
| T5282 |
23239-23240 |
NN |
denotes |
E |
| T5284 |
23240-23241 |
HYPH |
denotes |
- |
| T5283 |
23241-23249 |
NN |
denotes |
cadherin |
| T5285 |
23250-23253 |
CC |
denotes |
and |
| T5286 |
23254-23259 |
JJ |
denotes |
other |
| T5288 |
23260-23262 |
NN |
denotes |
AJ |
| T5287 |
23263-23271 |
NN |
denotes |
proteins |
| T5289 |
23272-23278 |
IN |
denotes |
within |
| T5290 |
23279-23286 |
NNS |
denotes |
regions |
| T5291 |
23287-23289 |
IN |
denotes |
of |
| T5292 |
23290-23308 |
JJ |
denotes |
hyperproliferative |
| T5293 |
23309-23318 |
NN |
denotes |
epidermis |
| T5294 |
23319-23324 |
WRB |
denotes |
where |
| T5296 |
23325-23327 |
NN |
denotes |
Tg |
| T5297 |
23328-23333 |
NN |
denotes |
Snail |
| T5295 |
23334-23337 |
VBD |
denotes |
was |
| T5298 |
23338-23345 |
JJ |
denotes |
present |
| T5299 |
23346-23347 |
-LRB- |
denotes |
( |
| T5301 |
23347-23353 |
NN |
denotes |
Figure |
| T5300 |
23354-23356 |
NN |
denotes |
4A |
| T5302 |
23356-23357 |
-RRB- |
denotes |
) |
| T5303 |
23357-23358 |
. |
denotes |
. |
| T5304 |
23358-23458 |
sentence |
denotes |
In these regions, immunofluorescence staining of E-cadherin and α-catenin were markedly diminished. |
| T5305 |
23359-23361 |
IN |
denotes |
In |
| T5307 |
23362-23367 |
DT |
denotes |
these |
| T5308 |
23368-23375 |
NNS |
denotes |
regions |
| T5309 |
23375-23377 |
, |
denotes |
, |
| T5310 |
23377-23395 |
NN |
denotes |
immunofluorescence |
| T5311 |
23396-23404 |
NN |
denotes |
staining |
| T5312 |
23405-23407 |
IN |
denotes |
of |
| T5313 |
23408-23409 |
NN |
denotes |
E |
| T5315 |
23409-23410 |
HYPH |
denotes |
- |
| T5314 |
23410-23418 |
NN |
denotes |
cadherin |
| T5316 |
23419-23422 |
CC |
denotes |
and |
| T5317 |
23423-23424 |
NN |
denotes |
α |
| T5319 |
23424-23425 |
HYPH |
denotes |
- |
| T5318 |
23425-23432 |
NN |
denotes |
catenin |
| T5320 |
23433-23437 |
VBD |
denotes |
were |
| T5321 |
23438-23446 |
RB |
denotes |
markedly |
| T5306 |
23447-23457 |
VBN |
denotes |
diminished |
| T5322 |
23457-23458 |
. |
denotes |
. |
| T5323 |
23458-23572 |
sentence |
denotes |
In contrast, the intensity of antibody staining for two other AJ proteins, β-catenin and Ajuba, was still strong. |
| T5324 |
23459-23461 |
IN |
denotes |
In |
| T5326 |
23462-23470 |
NN |
denotes |
contrast |
| T5327 |
23470-23472 |
, |
denotes |
, |
| T5328 |
23472-23475 |
DT |
denotes |
the |
| T5329 |
23476-23485 |
NN |
denotes |
intensity |
| T5330 |
23486-23488 |
IN |
denotes |
of |
| T5331 |
23489-23497 |
NN |
denotes |
antibody |
| T5332 |
23498-23506 |
NN |
denotes |
staining |
| T5333 |
23507-23510 |
IN |
denotes |
for |
| T5334 |
23511-23514 |
CD |
denotes |
two |
| T5336 |
23515-23520 |
JJ |
denotes |
other |
| T5337 |
23521-23523 |
NN |
denotes |
AJ |
| T5335 |
23524-23532 |
NN |
denotes |
proteins |
| T5338 |
23532-23534 |
, |
denotes |
, |
| T5339 |
23534-23535 |
NN |
denotes |
β |
| T5341 |
23535-23536 |
HYPH |
denotes |
- |
| T5340 |
23536-23543 |
NN |
denotes |
catenin |
| T5342 |
23544-23547 |
CC |
denotes |
and |
| T5343 |
23548-23553 |
NN |
denotes |
Ajuba |
| T5344 |
23553-23555 |
, |
denotes |
, |
| T5325 |
23555-23558 |
VBD |
denotes |
was |
| T5345 |
23559-23564 |
RB |
denotes |
still |
| T5346 |
23565-23571 |
JJ |
denotes |
strong |
| T5347 |
23571-23572 |
. |
denotes |
. |
| T5348 |
23572-23760 |
sentence |
denotes |
Interestingly, however, despite appreciable immunofluorescence, localization of β-catenin and Ajuba appeared to be largely cytoplasmic rather than at cell-cell borders (Figure 4A insets). |
| T5349 |
23573-23586 |
RB |
denotes |
Interestingly |
| T5351 |
23586-23588 |
, |
denotes |
, |
| T5352 |
23588-23595 |
RB |
denotes |
however |
| T5353 |
23595-23597 |
, |
denotes |
, |
| T5354 |
23597-23604 |
IN |
denotes |
despite |
| T5355 |
23605-23616 |
JJ |
denotes |
appreciable |
| T5356 |
23617-23635 |
NN |
denotes |
immunofluorescence |
| T5357 |
23635-23637 |
, |
denotes |
, |
| T5358 |
23637-23649 |
NN |
denotes |
localization |
| T5359 |
23650-23652 |
IN |
denotes |
of |
| T5360 |
23653-23654 |
NN |
denotes |
β |
| T5362 |
23654-23655 |
HYPH |
denotes |
- |
| T5361 |
23655-23662 |
NN |
denotes |
catenin |
| T5363 |
23663-23666 |
CC |
denotes |
and |
| T5364 |
23667-23672 |
NN |
denotes |
Ajuba |
| T5350 |
23673-23681 |
VBD |
denotes |
appeared |
| T5365 |
23682-23684 |
TO |
denotes |
to |
| T5366 |
23685-23687 |
VB |
denotes |
be |
| T5367 |
23688-23695 |
RB |
denotes |
largely |
| T5368 |
23696-23707 |
JJ |
denotes |
cytoplasmic |
| T5369 |
23708-23714 |
RB |
denotes |
rather |
| T5370 |
23715-23719 |
IN |
denotes |
than |
| T5371 |
23720-23722 |
IN |
denotes |
at |
| T5372 |
23723-23727 |
NN |
denotes |
cell |
| T5374 |
23727-23728 |
HYPH |
denotes |
- |
| T5373 |
23728-23732 |
NN |
denotes |
cell |
| T5375 |
23733-23740 |
NNS |
denotes |
borders |
| T5376 |
23741-23742 |
-LRB- |
denotes |
( |
| T5378 |
23742-23748 |
NN |
denotes |
Figure |
| T5379 |
23749-23751 |
NN |
denotes |
4A |
| T5377 |
23752-23758 |
NNS |
denotes |
insets |
| T5380 |
23758-23759 |
-RRB- |
denotes |
) |
| T5381 |
23759-23760 |
. |
denotes |
. |
| T5382 |
23760-27837 |
sentence |
denotes |
Figure 4 Snail-Mediated Remodeling of AJs Contributes to Hyperproliferation
(A) Immunofluorescence of skin sections from P30 Wt and Tg mice. Shown are affected areas of Tg skin; in areas where Snail protein was not expressed, stainings were normal. Antibodies used are against AJ proteins and include E-cadherin (E-cad), the transmembrane core protein; β-catenin (β-cat), which binds E-cadherin at AJs and which can also participate as a transcription cofactor when associated with LEF-1/TCF proteins in the nucleus; α-catenin (α-cat) which binds to both β-catenin and Ajuba, a close relative of zyxin; and Ajuba, which can associate with proteins that bind to the actin cytoskeleton, as well as with Grb-2, a mediator of the GTP nucleotide-exchange protein Sos, involved in activation of the Ras-MAPK signaling cascade. In Snail-expressing Tg regions, there was a reduced staining with anti-E-cad and anti-α-cat and a more diffuse staining with anti-Ajuba. Insets in the panels for β-catenin and Ajuba staining are magnified views of the boxed areas. Arrows mark membrane localization of the protein and asterisks mark cells with elevated levels of cytoplasmic β-catenin or Ajuba.
(B) Western blot analyses of protein extracts from P30 Wt and Tg back and ear skins. Antibodies are as in (A) except anti-P-cad, which detects P-cadherin, whose expression in the hair follicle was not affected, and anti-tubulin, which detects tubulin, a control for equal protein loadings. Note that the reductions seen in E-cadherin and α-catenin are likely to be underestimates of the actual differences in affected regions, since the Tg skin expressed Snail mosaically.
(C) In the presence of elevated Snail, α-catenin levels can be restored by overexpression of E-cadherin. Keratinocytes were transfected with either HA-tagged Snail (Snail[HA]; images on the left) or Snail(HA) and Ecad(HA) (images on the right). 2 d after transfection, cells were switched from low-calcium growth medium to high-calcium medium for 6 h to induce AJ formation. Cells were stained with antibodies as indicated on the panels. Arrowheads point to sites of intercellular contact between a Snail-transfected keratinocyte and its neighboring untransfected cell.
(D) Reintroduction of E-cadherin in keratinocytes expressing Snail returns pMAPK to basal levels. Keratinocytes were transfected with control vector (K14), or Snail(HA), or Snail(HA) + E-cad(HA). After 2 d, cells were serum starved for 4 h and whole cell lysates were made and Western blotted with antibodies to pMAPK, HA to recognize the HA-tagged Snail and E-cadherin protein, 20or tubulin as a loading control.
(E) Ajuba interacts with Grb-2 under conditions where α-catenin levels are reduced. Protein extracts were made from skins of P30 Wt and K14-Snail Tg P30 mice (blots on the left) and of newborn Wt and K14-Cre/α-catenin (fl/fl) conditionally null animals (blots on the right) [7]. Equal amounts of protein extracts were treated with anti-Grb-2 antibody (+) or control isotype antibody (–), and following centrifugation, immunoprecipitates were subjected to SDS-PAGE and Western blot analysis with anti-Ajuba and anti-Grb-2 antibodies. Note the presence of Ajuba only under conditions where levels of α-catenin and other AJ proteins were aberrantly low or absent.
(F) Transgene expression of excess Ajuba or the Grb-2-interacting domain (pre-LIM) of Ajuba in keratinocytes results in the activation of the Ras-MAPK pathway. Primary newborn mouse keratinocytes were transfected with either the empty K14 expression vector (K14), or the expression vector driving Snail, full length Ajuba, or the pre-LIM domain of Ajuba in the absence or presence of a peptide inhibitor (inh) that disrupts the interaction between Grb-2 and Sos. 48 h posttransfection, protein extracts were prepared and subjected to SDS-PAGE and Western blot analyses with antibodies against pMAPK, total MAPK, Ajuba (also recognizing the smaller, pre-LIM domain), and Snail. Architectural differences in the epidermis made Western blot analyses somewhat difficult to gauge. |
| T5383 |
27739-27752 |
JJ |
denotes |
Architectural |
| T5384 |
27753-27764 |
NNS |
denotes |
differences |
| T5386 |
27765-27767 |
IN |
denotes |
in |
| T5387 |
27768-27771 |
DT |
denotes |
the |
| T5388 |
27772-27781 |
NN |
denotes |
epidermis |
| T5385 |
27782-27786 |
VBD |
denotes |
made |
| T5389 |
27787-27794 |
NNP |
denotes |
Western |
| T5390 |
27795-27799 |
NN |
denotes |
blot |
| T5391 |
27800-27808 |
NNS |
denotes |
analyses |
| T5393 |
27809-27817 |
RB |
denotes |
somewhat |
| T5392 |
27818-27827 |
JJ |
denotes |
difficult |
| T5394 |
27828-27830 |
TO |
denotes |
to |
| T5395 |
27831-27836 |
VB |
denotes |
gauge |
| T5396 |
27836-27837 |
. |
denotes |
. |
| T5397 |
27837-27963 |
sentence |
denotes |
However, in regions such as ear skin, where the highest levels of Snail protein were expressed, the effects were accentuated. |
| T5398 |
27838-27845 |
RB |
denotes |
However |
| T5400 |
27845-27847 |
, |
denotes |
, |
| T5401 |
27847-27849 |
IN |
denotes |
in |
| T5402 |
27850-27857 |
NNS |
denotes |
regions |
| T5403 |
27858-27862 |
JJ |
denotes |
such |
| T5404 |
27863-27865 |
IN |
denotes |
as |
| T5405 |
27866-27869 |
NN |
denotes |
ear |
| T5406 |
27870-27874 |
NN |
denotes |
skin |
| T5407 |
27874-27876 |
, |
denotes |
, |
| T5408 |
27876-27881 |
WRB |
denotes |
where |
| T5410 |
27882-27885 |
DT |
denotes |
the |
| T5412 |
27886-27893 |
JJS |
denotes |
highest |
| T5411 |
27894-27900 |
NNS |
denotes |
levels |
| T5413 |
27901-27903 |
IN |
denotes |
of |
| T5414 |
27904-27909 |
NN |
denotes |
Snail |
| T5415 |
27910-27917 |
NN |
denotes |
protein |
| T5416 |
27918-27922 |
VBD |
denotes |
were |
| T5409 |
27923-27932 |
VBN |
denotes |
expressed |
| T5417 |
27932-27934 |
, |
denotes |
, |
| T5418 |
27934-27937 |
DT |
denotes |
the |
| T5419 |
27938-27945 |
NNS |
denotes |
effects |
| T5420 |
27946-27950 |
VBD |
denotes |
were |
| T5399 |
27951-27962 |
VBN |
denotes |
accentuated |
| T5421 |
27962-27963 |
. |
denotes |
. |
| T5422 |
27963-28155 |
sentence |
denotes |
In both back skin and ear skin, overall levels of E-cadherin and α-catenin were reduced, under conditions where β-catenin and Ajuba levels remained unchanged relative to controls (Figure 4B). |
| T5423 |
27964-27966 |
IN |
denotes |
In |
| T5425 |
27967-27971 |
CC |
denotes |
both |
| T5427 |
27972-27976 |
NN |
denotes |
back |
| T5426 |
27977-27981 |
NN |
denotes |
skin |
| T5428 |
27982-27985 |
CC |
denotes |
and |
| T5429 |
27986-27989 |
NN |
denotes |
ear |
| T5430 |
27990-27994 |
NN |
denotes |
skin |
| T5431 |
27994-27996 |
, |
denotes |
, |
| T5432 |
27996-28003 |
JJ |
denotes |
overall |
| T5433 |
28004-28010 |
NNS |
denotes |
levels |
| T5434 |
28011-28013 |
IN |
denotes |
of |
| T5435 |
28014-28015 |
NN |
denotes |
E |
| T5437 |
28015-28016 |
HYPH |
denotes |
- |
| T5436 |
28016-28024 |
NN |
denotes |
cadherin |
| T5438 |
28025-28028 |
CC |
denotes |
and |
| T5439 |
28029-28030 |
NN |
denotes |
α |
| T5441 |
28030-28031 |
HYPH |
denotes |
- |
| T5440 |
28031-28038 |
NN |
denotes |
catenin |
| T5442 |
28039-28043 |
VBD |
denotes |
were |
| T5424 |
28044-28051 |
VBN |
denotes |
reduced |
| T5443 |
28051-28053 |
, |
denotes |
, |
| T5444 |
28053-28058 |
IN |
denotes |
under |
| T5445 |
28059-28069 |
NNS |
denotes |
conditions |
| T5446 |
28070-28075 |
WRB |
denotes |
where |
| T5448 |
28076-28077 |
NN |
denotes |
β |
| T5450 |
28077-28078 |
HYPH |
denotes |
- |
| T5449 |
28078-28085 |
NN |
denotes |
catenin |
| T5452 |
28086-28089 |
CC |
denotes |
and |
| T5453 |
28090-28095 |
NN |
denotes |
Ajuba |
| T5451 |
28096-28102 |
NNS |
denotes |
levels |
| T5447 |
28103-28111 |
VBD |
denotes |
remained |
| T5454 |
28112-28121 |
JJ |
denotes |
unchanged |
| T5455 |
28122-28130 |
JJ |
denotes |
relative |
| T5456 |
28131-28133 |
IN |
denotes |
to |
| T5457 |
28134-28142 |
NNS |
denotes |
controls |
| T5458 |
28143-28144 |
-LRB- |
denotes |
( |
| T5460 |
28144-28150 |
NN |
denotes |
Figure |
| T5459 |
28151-28153 |
NN |
denotes |
4B |
| T5461 |
28153-28154 |
-RRB- |
denotes |
) |
| T5462 |
28154-28155 |
. |
denotes |
. |
| T5463 |
28155-28260 |
sentence |
denotes |
Taken together, these data were consistent with our results obtained from immunofluorescence microscopy. |
| T5464 |
28156-28161 |
VBN |
denotes |
Taken |
| T5466 |
28162-28170 |
RB |
denotes |
together |
| T5467 |
28170-28172 |
, |
denotes |
, |
| T5468 |
28172-28177 |
DT |
denotes |
these |
| T5469 |
28178-28182 |
NNS |
denotes |
data |
| T5465 |
28183-28187 |
VBD |
denotes |
were |
| T5470 |
28188-28198 |
JJ |
denotes |
consistent |
| T5471 |
28199-28203 |
IN |
denotes |
with |
| T5472 |
28204-28207 |
PRP$ |
denotes |
our |
| T5473 |
28208-28215 |
NNS |
denotes |
results |
| T5474 |
28216-28224 |
VBN |
denotes |
obtained |
| T5475 |
28225-28229 |
IN |
denotes |
from |
| T5476 |
28230-28248 |
NN |
denotes |
immunofluorescence |
| T5477 |
28249-28259 |
NN |
denotes |
microscopy |
| T5478 |
28259-28260 |
. |
denotes |
. |
| T5479 |
28260-28456 |
sentence |
denotes |
A priori, the decrease in α-catenin levels could be due to either direct transcriptional repression by Snail or perturbations in AJ formation caused by the decrease in E-cadherin gene expression. |
| T5480 |
28261-28262 |
FW |
denotes |
A |
| T5481 |
28263-28269 |
FW |
denotes |
priori |
| T5483 |
28269-28271 |
, |
denotes |
, |
| T5484 |
28271-28274 |
DT |
denotes |
the |
| T5485 |
28275-28283 |
NN |
denotes |
decrease |
| T5486 |
28284-28286 |
IN |
denotes |
in |
| T5487 |
28287-28288 |
NN |
denotes |
α |
| T5489 |
28288-28289 |
HYPH |
denotes |
- |
| T5488 |
28289-28296 |
NN |
denotes |
catenin |
| T5490 |
28297-28303 |
NNS |
denotes |
levels |
| T5491 |
28304-28309 |
MD |
denotes |
could |
| T5482 |
28310-28312 |
VB |
denotes |
be |
| T5492 |
28313-28316 |
IN |
denotes |
due |
| T5493 |
28317-28319 |
IN |
denotes |
to |
| T5494 |
28320-28326 |
CC |
denotes |
either |
| T5496 |
28327-28333 |
JJ |
denotes |
direct |
| T5497 |
28334-28349 |
JJ |
denotes |
transcriptional |
| T5495 |
28350-28360 |
NN |
denotes |
repression |
| T5498 |
28361-28363 |
IN |
denotes |
by |
| T5499 |
28364-28369 |
NN |
denotes |
Snail |
| T5500 |
28370-28372 |
CC |
denotes |
or |
| T5501 |
28373-28386 |
NNS |
denotes |
perturbations |
| T5502 |
28387-28389 |
IN |
denotes |
in |
| T5503 |
28390-28392 |
NN |
denotes |
AJ |
| T5504 |
28393-28402 |
NN |
denotes |
formation |
| T5505 |
28403-28409 |
VBN |
denotes |
caused |
| T5506 |
28410-28412 |
IN |
denotes |
by |
| T5507 |
28413-28416 |
DT |
denotes |
the |
| T5508 |
28417-28425 |
NN |
denotes |
decrease |
| T5509 |
28426-28428 |
IN |
denotes |
in |
| T5510 |
28429-28430 |
NN |
denotes |
E |
| T5512 |
28430-28431 |
HYPH |
denotes |
- |
| T5511 |
28431-28439 |
NN |
denotes |
cadherin |
| T5514 |
28440-28444 |
NN |
denotes |
gene |
| T5513 |
28445-28455 |
NN |
denotes |
expression |
| T5515 |
28455-28456 |
. |
denotes |
. |
| T5516 |
28456-28626 |
sentence |
denotes |
To distinguish between these possibilities, we tested whether α-catenin levels could be restored by exogenous expression of E-cadherin in Snail-expressing keratinocytes. |
| T5517 |
28457-28459 |
TO |
denotes |
To |
| T5518 |
28460-28471 |
VB |
denotes |
distinguish |
| T5520 |
28472-28479 |
IN |
denotes |
between |
| T5521 |
28480-28485 |
DT |
denotes |
these |
| T5522 |
28486-28499 |
NNS |
denotes |
possibilities |
| T5523 |
28499-28501 |
, |
denotes |
, |
| T5524 |
28501-28503 |
PRP |
denotes |
we |
| T5519 |
28504-28510 |
VBD |
denotes |
tested |
| T5525 |
28511-28518 |
IN |
denotes |
whether |
| T5527 |
28519-28520 |
NN |
denotes |
α |
| T5529 |
28520-28521 |
HYPH |
denotes |
- |
| T5528 |
28521-28528 |
NN |
denotes |
catenin |
| T5530 |
28529-28535 |
NNS |
denotes |
levels |
| T5531 |
28536-28541 |
MD |
denotes |
could |
| T5532 |
28542-28544 |
VB |
denotes |
be |
| T5526 |
28545-28553 |
VBN |
denotes |
restored |
| T5533 |
28554-28556 |
IN |
denotes |
by |
| T5534 |
28557-28566 |
JJ |
denotes |
exogenous |
| T5535 |
28567-28577 |
NN |
denotes |
expression |
| T5536 |
28578-28580 |
IN |
denotes |
of |
| T5537 |
28581-28582 |
NN |
denotes |
E |
| T5539 |
28582-28583 |
HYPH |
denotes |
- |
| T5538 |
28583-28591 |
NN |
denotes |
cadherin |
| T5540 |
28592-28594 |
IN |
denotes |
in |
| T5541 |
28595-28600 |
NN |
denotes |
Snail |
| T5543 |
28600-28601 |
HYPH |
denotes |
- |
| T5542 |
28601-28611 |
VBG |
denotes |
expressing |
| T5544 |
28612-28625 |
NNS |
denotes |
keratinocytes |
| T5545 |
28625-28626 |
. |
denotes |
. |
| T5546 |
28626-28781 |
sentence |
denotes |
As shown in Figure 4C, transiently transfected keratinocytes expressing HA-tagged Snail displayed a loss of E-cadherin and α-catenin at cell-cell borders. |
| T5547 |
28627-28629 |
IN |
denotes |
As |
| T5548 |
28630-28635 |
VBN |
denotes |
shown |
| T5550 |
28636-28638 |
IN |
denotes |
in |
| T5551 |
28639-28645 |
NN |
denotes |
Figure |
| T5552 |
28646-28648 |
NN |
denotes |
4C |
| T5553 |
28648-28650 |
, |
denotes |
, |
| T5554 |
28650-28661 |
RB |
denotes |
transiently |
| T5555 |
28662-28673 |
VBN |
denotes |
transfected |
| T5556 |
28674-28687 |
NNS |
denotes |
keratinocytes |
| T5557 |
28688-28698 |
VBG |
denotes |
expressing |
| T5558 |
28699-28701 |
NN |
denotes |
HA |
| T5560 |
28701-28702 |
HYPH |
denotes |
- |
| T5559 |
28702-28708 |
VBN |
denotes |
tagged |
| T5561 |
28709-28714 |
NN |
denotes |
Snail |
| T5549 |
28715-28724 |
VBD |
denotes |
displayed |
| T5562 |
28725-28726 |
DT |
denotes |
a |
| T5563 |
28727-28731 |
NN |
denotes |
loss |
| T5564 |
28732-28734 |
IN |
denotes |
of |
| T5565 |
28735-28736 |
NN |
denotes |
E |
| T5567 |
28736-28737 |
HYPH |
denotes |
- |
| T5566 |
28737-28745 |
NN |
denotes |
cadherin |
| T5568 |
28746-28749 |
CC |
denotes |
and |
| T5569 |
28750-28751 |
NN |
denotes |
α |
| T5571 |
28751-28752 |
HYPH |
denotes |
- |
| T5570 |
28752-28759 |
NN |
denotes |
catenin |
| T5572 |
28760-28762 |
IN |
denotes |
at |
| T5573 |
28763-28767 |
NN |
denotes |
cell |
| T5575 |
28767-28768 |
HYPH |
denotes |
- |
| T5574 |
28768-28772 |
NN |
denotes |
cell |
| T5576 |
28773-28780 |
NNS |
denotes |
borders |
| T5577 |
28780-28781 |
. |
denotes |
. |
| T5578 |
28781-28971 |
sentence |
denotes |
Coexpression of exogenous HA-tagged E-cadherin not only enabled cell-cell border localization of E-cadherin protein, but also rescued the cell-cell border staining of α-catenin (Figure 4C). |
| T5579 |
28782-28794 |
NN |
denotes |
Coexpression |
| T5581 |
28795-28797 |
IN |
denotes |
of |
| T5582 |
28798-28807 |
JJ |
denotes |
exogenous |
| T5584 |
28808-28810 |
NN |
denotes |
HA |
| T5586 |
28810-28811 |
HYPH |
denotes |
- |
| T5585 |
28811-28817 |
VBN |
denotes |
tagged |
| T5587 |
28818-28819 |
NN |
denotes |
E |
| T5588 |
28819-28820 |
HYPH |
denotes |
- |
| T5583 |
28820-28828 |
NN |
denotes |
cadherin |
| T5589 |
28829-28832 |
RB |
denotes |
not |
| T5590 |
28833-28837 |
RB |
denotes |
only |
| T5580 |
28838-28845 |
VBD |
denotes |
enabled |
| T5591 |
28846-28850 |
NN |
denotes |
cell |
| T5593 |
28850-28851 |
HYPH |
denotes |
- |
| T5592 |
28851-28855 |
NN |
denotes |
cell |
| T5595 |
28856-28862 |
NN |
denotes |
border |
| T5594 |
28863-28875 |
NN |
denotes |
localization |
| T5596 |
28876-28878 |
IN |
denotes |
of |
| T5597 |
28879-28880 |
NN |
denotes |
E |
| T5599 |
28880-28881 |
HYPH |
denotes |
- |
| T5598 |
28881-28889 |
NN |
denotes |
cadherin |
| T5600 |
28890-28897 |
NN |
denotes |
protein |
| T5601 |
28897-28899 |
, |
denotes |
, |
| T5602 |
28899-28902 |
CC |
denotes |
but |
| T5603 |
28903-28907 |
RB |
denotes |
also |
| T5604 |
28908-28915 |
VBD |
denotes |
rescued |
| T5605 |
28916-28919 |
DT |
denotes |
the |
| T5607 |
28920-28924 |
NN |
denotes |
cell |
| T5609 |
28924-28925 |
HYPH |
denotes |
- |
| T5608 |
28925-28929 |
NN |
denotes |
cell |
| T5610 |
28930-28936 |
NN |
denotes |
border |
| T5606 |
28937-28945 |
NN |
denotes |
staining |
| T5611 |
28946-28948 |
IN |
denotes |
of |
| T5612 |
28949-28950 |
NN |
denotes |
α |
| T5614 |
28950-28951 |
HYPH |
denotes |
- |
| T5613 |
28951-28958 |
NN |
denotes |
catenin |
| T5615 |
28959-28960 |
-LRB- |
denotes |
( |
| T5617 |
28960-28966 |
NN |
denotes |
Figure |
| T5616 |
28967-28969 |
NN |
denotes |
4C |
| T5618 |
28969-28970 |
-RRB- |
denotes |
) |
| T5619 |
28970-28971 |
. |
denotes |
. |
| T5620 |
28971-29131 |
sentence |
denotes |
The ability to restore α-catenin expression and localization under these conditions argues against the notion that Snail transcriptionally represses α-catenin. |
| T5621 |
28972-28975 |
DT |
denotes |
The |
| T5622 |
28976-28983 |
NN |
denotes |
ability |
| T5624 |
28984-28986 |
TO |
denotes |
to |
| T5625 |
28987-28994 |
VB |
denotes |
restore |
| T5626 |
28995-28996 |
NN |
denotes |
α |
| T5628 |
28996-28997 |
HYPH |
denotes |
- |
| T5627 |
28997-29004 |
NN |
denotes |
catenin |
| T5629 |
29005-29015 |
NN |
denotes |
expression |
| T5630 |
29016-29019 |
CC |
denotes |
and |
| T5631 |
29020-29032 |
NN |
denotes |
localization |
| T5632 |
29033-29038 |
IN |
denotes |
under |
| T5633 |
29039-29044 |
DT |
denotes |
these |
| T5634 |
29045-29055 |
NNS |
denotes |
conditions |
| T5623 |
29056-29062 |
VBZ |
denotes |
argues |
| T5635 |
29063-29070 |
IN |
denotes |
against |
| T5636 |
29071-29074 |
DT |
denotes |
the |
| T5637 |
29075-29081 |
NN |
denotes |
notion |
| T5638 |
29082-29086 |
IN |
denotes |
that |
| T5640 |
29087-29092 |
NN |
denotes |
Snail |
| T5641 |
29093-29110 |
RB |
denotes |
transcriptionally |
| T5639 |
29111-29120 |
VBZ |
denotes |
represses |
| T5642 |
29121-29122 |
NN |
denotes |
α |
| T5644 |
29122-29123 |
HYPH |
denotes |
- |
| T5643 |
29123-29130 |
NN |
denotes |
catenin |
| T5645 |
29130-29131 |
. |
denotes |
. |
| T5646 |
29131-29262 |
sentence |
denotes |
Rather, the findings are consistent with a previous report that E-cadherin is required for the translation of α-catenin mRNA [22]. |
| T5647 |
29132-29138 |
RB |
denotes |
Rather |
| T5649 |
29138-29140 |
, |
denotes |
, |
| T5650 |
29140-29143 |
DT |
denotes |
the |
| T5651 |
29144-29152 |
NNS |
denotes |
findings |
| T5648 |
29153-29156 |
VBP |
denotes |
are |
| T5652 |
29157-29167 |
JJ |
denotes |
consistent |
| T5653 |
29168-29172 |
IN |
denotes |
with |
| T5654 |
29173-29174 |
DT |
denotes |
a |
| T5656 |
29175-29183 |
JJ |
denotes |
previous |
| T5655 |
29184-29190 |
NN |
denotes |
report |
| T5657 |
29191-29195 |
IN |
denotes |
that |
| T5659 |
29196-29197 |
NN |
denotes |
E |
| T5661 |
29197-29198 |
HYPH |
denotes |
- |
| T5660 |
29198-29206 |
NN |
denotes |
cadherin |
| T5662 |
29207-29209 |
VBZ |
denotes |
is |
| T5658 |
29210-29218 |
VBN |
denotes |
required |
| T5663 |
29219-29222 |
IN |
denotes |
for |
| T5664 |
29223-29226 |
DT |
denotes |
the |
| T5665 |
29227-29238 |
NN |
denotes |
translation |
| T5666 |
29239-29241 |
IN |
denotes |
of |
| T5667 |
29242-29243 |
NN |
denotes |
α |
| T5669 |
29243-29244 |
HYPH |
denotes |
- |
| T5668 |
29244-29251 |
NN |
denotes |
catenin |
| T5670 |
29252-29256 |
NN |
denotes |
mRNA |
| T5671 |
29257-29258 |
-LRB- |
denotes |
[ |
| T5672 |
29258-29260 |
CD |
denotes |
22 |
| T5673 |
29260-29261 |
-RRB- |
denotes |
] |
| T5674 |
29261-29262 |
. |
denotes |
. |
| T5675 |
29262-29453 |
sentence |
denotes |
Despite the reductions in AJ markers, Tg skin still displayed sealed membranes and intercellular junctions that were largely intact, as judged by ultrastructural analyses (unpublished data). |
| T5676 |
29263-29270 |
IN |
denotes |
Despite |
| T5678 |
29271-29274 |
DT |
denotes |
the |
| T5679 |
29275-29285 |
NNS |
denotes |
reductions |
| T5680 |
29286-29288 |
IN |
denotes |
in |
| T5681 |
29289-29291 |
NN |
denotes |
AJ |
| T5682 |
29292-29299 |
NNS |
denotes |
markers |
| T5683 |
29299-29301 |
, |
denotes |
, |
| T5684 |
29301-29303 |
NN |
denotes |
Tg |
| T5685 |
29304-29308 |
NN |
denotes |
skin |
| T5686 |
29309-29314 |
RB |
denotes |
still |
| T5677 |
29315-29324 |
VBD |
denotes |
displayed |
| T5687 |
29325-29331 |
JJ |
denotes |
sealed |
| T5688 |
29332-29341 |
NNS |
denotes |
membranes |
| T5689 |
29342-29345 |
CC |
denotes |
and |
| T5690 |
29346-29359 |
JJ |
denotes |
intercellular |
| T5691 |
29360-29369 |
NNS |
denotes |
junctions |
| T5692 |
29370-29374 |
WDT |
denotes |
that |
| T5693 |
29375-29379 |
VBD |
denotes |
were |
| T5694 |
29380-29387 |
RB |
denotes |
largely |
| T5695 |
29388-29394 |
JJ |
denotes |
intact |
| T5696 |
29394-29396 |
, |
denotes |
, |
| T5697 |
29396-29398 |
IN |
denotes |
as |
| T5698 |
29399-29405 |
VBN |
denotes |
judged |
| T5699 |
29406-29408 |
IN |
denotes |
by |
| T5700 |
29409-29424 |
JJ |
denotes |
ultrastructural |
| T5701 |
29425-29433 |
NNS |
denotes |
analyses |
| T5702 |
29434-29435 |
-LRB- |
denotes |
( |
| T5704 |
29435-29446 |
JJ |
denotes |
unpublished |
| T5703 |
29447-29451 |
NNS |
denotes |
data |
| T5705 |
29451-29452 |
-RRB- |
denotes |
) |
| T5706 |
29452-29453 |
. |
denotes |
. |
| T5707 |
29453-29651 |
sentence |
denotes |
In this respect, the skin epithelium resembled that of the hair bud, where the down-regulation in junction proteins is permissive for cell-cell remodeling without abrogating intercellular adhesion. |
| T5708 |
29454-29456 |
IN |
denotes |
In |
| T5710 |
29457-29461 |
DT |
denotes |
this |
| T5711 |
29462-29469 |
NN |
denotes |
respect |
| T5712 |
29469-29471 |
, |
denotes |
, |
| T5713 |
29471-29474 |
DT |
denotes |
the |
| T5715 |
29475-29479 |
NN |
denotes |
skin |
| T5714 |
29480-29490 |
NN |
denotes |
epithelium |
| T5709 |
29491-29500 |
VBD |
denotes |
resembled |
| T5716 |
29501-29505 |
DT |
denotes |
that |
| T5717 |
29506-29508 |
IN |
denotes |
of |
| T5718 |
29509-29512 |
DT |
denotes |
the |
| T5720 |
29513-29517 |
NN |
denotes |
hair |
| T5719 |
29518-29521 |
NN |
denotes |
bud |
| T5721 |
29521-29523 |
, |
denotes |
, |
| T5722 |
29523-29528 |
WRB |
denotes |
where |
| T5724 |
29529-29532 |
DT |
denotes |
the |
| T5726 |
29533-29537 |
JJ |
denotes |
down |
| T5727 |
29537-29538 |
HYPH |
denotes |
- |
| T5725 |
29538-29548 |
NN |
denotes |
regulation |
| T5728 |
29549-29551 |
IN |
denotes |
in |
| T5729 |
29552-29560 |
NN |
denotes |
junction |
| T5730 |
29561-29569 |
NN |
denotes |
proteins |
| T5723 |
29570-29572 |
VBZ |
denotes |
is |
| T5731 |
29573-29583 |
JJ |
denotes |
permissive |
| T5732 |
29584-29587 |
IN |
denotes |
for |
| T5733 |
29588-29592 |
NN |
denotes |
cell |
| T5735 |
29592-29593 |
HYPH |
denotes |
- |
| T5734 |
29593-29597 |
NN |
denotes |
cell |
| T5736 |
29598-29608 |
NN |
denotes |
remodeling |
| T5737 |
29609-29616 |
IN |
denotes |
without |
| T5738 |
29617-29627 |
VBG |
denotes |
abrogating |
| T5739 |
29628-29641 |
JJ |
denotes |
intercellular |
| T5740 |
29642-29650 |
NN |
denotes |
adhesion |
| T5741 |
29650-29651 |
. |
denotes |
. |
| T5742 |
29651-29851 |
sentence |
denotes |
The similarities between Snail Tg epidermis and hair buds extended to the hyperproliferative state, leading us to wonder whether the down-regulation of AJ proteins might contribute to this condition. |
| T5743 |
29652-29655 |
DT |
denotes |
The |
| T5744 |
29656-29668 |
NNS |
denotes |
similarities |
| T5746 |
29669-29676 |
IN |
denotes |
between |
| T5747 |
29677-29682 |
NN |
denotes |
Snail |
| T5749 |
29683-29685 |
NN |
denotes |
Tg |
| T5748 |
29686-29695 |
NN |
denotes |
epidermis |
| T5750 |
29696-29699 |
CC |
denotes |
and |
| T5751 |
29700-29704 |
NN |
denotes |
hair |
| T5752 |
29705-29709 |
NNS |
denotes |
buds |
| T5745 |
29710-29718 |
VBD |
denotes |
extended |
| T5753 |
29719-29721 |
IN |
denotes |
to |
| T5754 |
29722-29725 |
DT |
denotes |
the |
| T5756 |
29726-29744 |
JJ |
denotes |
hyperproliferative |
| T5755 |
29745-29750 |
NN |
denotes |
state |
| T5757 |
29750-29752 |
, |
denotes |
, |
| T5758 |
29752-29759 |
VBG |
denotes |
leading |
| T5759 |
29760-29762 |
PRP |
denotes |
us |
| T5760 |
29763-29765 |
TO |
denotes |
to |
| T5761 |
29766-29772 |
VB |
denotes |
wonder |
| T5762 |
29773-29780 |
IN |
denotes |
whether |
| T5764 |
29781-29784 |
DT |
denotes |
the |
| T5766 |
29785-29789 |
JJ |
denotes |
down |
| T5767 |
29789-29790 |
HYPH |
denotes |
- |
| T5765 |
29790-29800 |
NN |
denotes |
regulation |
| T5768 |
29801-29803 |
IN |
denotes |
of |
| T5769 |
29804-29806 |
NN |
denotes |
AJ |
| T5770 |
29807-29815 |
NN |
denotes |
proteins |
| T5771 |
29816-29821 |
MD |
denotes |
might |
| T5763 |
29822-29832 |
VB |
denotes |
contribute |
| T5772 |
29833-29835 |
IN |
denotes |
to |
| T5773 |
29836-29840 |
DT |
denotes |
this |
| T5774 |
29841-29850 |
NN |
denotes |
condition |
| T5775 |
29850-29851 |
. |
denotes |
. |
| T5776 |
29851-30061 |
sentence |
denotes |
Given the increase in pMAPK staining in Snail Tg epidermis (see Figure 2G), we used pMAPK levels as our assay to test whether the loss of E-cadherin contributed to the Snail-mediated increase in proliferation. |
| T5777 |
29852-29857 |
VBN |
denotes |
Given |
| T5779 |
29858-29861 |
DT |
denotes |
the |
| T5780 |
29862-29870 |
NN |
denotes |
increase |
| T5781 |
29871-29873 |
IN |
denotes |
in |
| T5782 |
29874-29879 |
NN |
denotes |
pMAPK |
| T5783 |
29880-29888 |
NN |
denotes |
staining |
| T5784 |
29889-29891 |
IN |
denotes |
in |
| T5785 |
29892-29897 |
NN |
denotes |
Snail |
| T5787 |
29898-29900 |
NN |
denotes |
Tg |
| T5786 |
29901-29910 |
NN |
denotes |
epidermis |
| T5788 |
29911-29912 |
-LRB- |
denotes |
( |
| T5789 |
29912-29915 |
VB |
denotes |
see |
| T5790 |
29916-29922 |
NN |
denotes |
Figure |
| T5791 |
29923-29925 |
NN |
denotes |
2G |
| T5792 |
29925-29926 |
-RRB- |
denotes |
) |
| T5793 |
29926-29928 |
, |
denotes |
, |
| T5794 |
29928-29930 |
PRP |
denotes |
we |
| T5778 |
29931-29935 |
VBD |
denotes |
used |
| T5795 |
29936-29941 |
NN |
denotes |
pMAPK |
| T5796 |
29942-29948 |
NNS |
denotes |
levels |
| T5797 |
29949-29951 |
IN |
denotes |
as |
| T5798 |
29952-29955 |
PRP$ |
denotes |
our |
| T5799 |
29956-29961 |
NN |
denotes |
assay |
| T5800 |
29962-29964 |
TO |
denotes |
to |
| T5801 |
29965-29969 |
VB |
denotes |
test |
| T5802 |
29970-29977 |
IN |
denotes |
whether |
| T5804 |
29978-29981 |
DT |
denotes |
the |
| T5805 |
29982-29986 |
NN |
denotes |
loss |
| T5806 |
29987-29989 |
IN |
denotes |
of |
| T5807 |
29990-29991 |
NN |
denotes |
E |
| T5809 |
29991-29992 |
HYPH |
denotes |
- |
| T5808 |
29992-30000 |
NN |
denotes |
cadherin |
| T5803 |
30001-30012 |
VBD |
denotes |
contributed |
| T5810 |
30013-30015 |
IN |
denotes |
to |
| T5811 |
30016-30019 |
DT |
denotes |
the |
| T5813 |
30020-30025 |
NN |
denotes |
Snail |
| T5815 |
30025-30026 |
HYPH |
denotes |
- |
| T5814 |
30026-30034 |
VBN |
denotes |
mediated |
| T5812 |
30035-30043 |
NN |
denotes |
increase |
| T5816 |
30044-30046 |
IN |
denotes |
in |
| T5817 |
30047-30060 |
NN |
denotes |
proliferation |
| T5818 |
30060-30061 |
. |
denotes |
. |
| T5819 |
30061-30234 |
sentence |
denotes |
Consistent with our in vivo observations, transfected keratinocytes expressing Snail exhibited a substantial increase in pMAPK levels relative to control cells (Figure 4D). |
| T5820 |
30062-30072 |
JJ |
denotes |
Consistent |
| T5822 |
30073-30077 |
IN |
denotes |
with |
| T5823 |
30078-30081 |
PRP$ |
denotes |
our |
| T5825 |
30082-30084 |
FW |
denotes |
in |
| T5826 |
30085-30089 |
FW |
denotes |
vivo |
| T5824 |
30090-30102 |
NNS |
denotes |
observations |
| T5827 |
30102-30104 |
, |
denotes |
, |
| T5828 |
30104-30115 |
VBN |
denotes |
transfected |
| T5829 |
30116-30129 |
NNS |
denotes |
keratinocytes |
| T5830 |
30130-30140 |
VBG |
denotes |
expressing |
| T5831 |
30141-30146 |
NN |
denotes |
Snail |
| T5821 |
30147-30156 |
VBD |
denotes |
exhibited |
| T5832 |
30157-30158 |
DT |
denotes |
a |
| T5834 |
30159-30170 |
JJ |
denotes |
substantial |
| T5833 |
30171-30179 |
NN |
denotes |
increase |
| T5835 |
30180-30182 |
IN |
denotes |
in |
| T5836 |
30183-30188 |
NN |
denotes |
pMAPK |
| T5837 |
30189-30195 |
NNS |
denotes |
levels |
| T5838 |
30196-30204 |
JJ |
denotes |
relative |
| T5839 |
30205-30207 |
IN |
denotes |
to |
| T5840 |
30208-30215 |
NN |
denotes |
control |
| T5841 |
30216-30221 |
NNS |
denotes |
cells |
| T5842 |
30222-30223 |
-LRB- |
denotes |
( |
| T5844 |
30223-30229 |
NN |
denotes |
Figure |
| T5843 |
30230-30232 |
NN |
denotes |
4D |
| T5845 |
30232-30233 |
-RRB- |
denotes |
) |
| T5846 |
30233-30234 |
. |
denotes |
. |
| T5847 |
30234-30306 |
sentence |
denotes |
Coexpression of E-cadherin with Snail appeared to abrogate this effect. |
| T5848 |
30235-30247 |
NN |
denotes |
Coexpression |
| T5850 |
30248-30250 |
IN |
denotes |
of |
| T5851 |
30251-30252 |
NN |
denotes |
E |
| T5853 |
30252-30253 |
HYPH |
denotes |
- |
| T5852 |
30253-30261 |
NN |
denotes |
cadherin |
| T5854 |
30262-30266 |
IN |
denotes |
with |
| T5855 |
30267-30272 |
NN |
denotes |
Snail |
| T5849 |
30273-30281 |
VBD |
denotes |
appeared |
| T5856 |
30282-30284 |
TO |
denotes |
to |
| T5857 |
30285-30293 |
VB |
denotes |
abrogate |
| T5858 |
30294-30298 |
DT |
denotes |
this |
| T5859 |
30299-30305 |
NN |
denotes |
effect |
| T5860 |
30305-30306 |
. |
denotes |
. |
| T5861 |
30306-30517 |
sentence |
denotes |
Together, these findings raised the possibility that an AJ-associated protein that is normally sequestered at the plasma membrane may participate in a proliferation signaling pathway when AJs are deconstructed. |
| T5862 |
30307-30315 |
RB |
denotes |
Together |
| T5864 |
30315-30317 |
, |
denotes |
, |
| T5865 |
30317-30322 |
DT |
denotes |
these |
| T5866 |
30323-30331 |
NNS |
denotes |
findings |
| T5863 |
30332-30338 |
VBD |
denotes |
raised |
| T5867 |
30339-30342 |
DT |
denotes |
the |
| T5868 |
30343-30354 |
NN |
denotes |
possibility |
| T5869 |
30355-30359 |
IN |
denotes |
that |
| T5871 |
30360-30362 |
DT |
denotes |
an |
| T5873 |
30363-30365 |
NN |
denotes |
AJ |
| T5875 |
30365-30366 |
HYPH |
denotes |
- |
| T5874 |
30366-30376 |
VBN |
denotes |
associated |
| T5872 |
30377-30384 |
NN |
denotes |
protein |
| T5876 |
30385-30389 |
WDT |
denotes |
that |
| T5878 |
30390-30392 |
VBZ |
denotes |
is |
| T5879 |
30393-30401 |
RB |
denotes |
normally |
| T5877 |
30402-30413 |
VBN |
denotes |
sequestered |
| T5880 |
30414-30416 |
IN |
denotes |
at |
| T5881 |
30417-30420 |
DT |
denotes |
the |
| T5883 |
30421-30427 |
NN |
denotes |
plasma |
| T5882 |
30428-30436 |
NN |
denotes |
membrane |
| T5884 |
30437-30440 |
MD |
denotes |
may |
| T5870 |
30441-30452 |
VB |
denotes |
participate |
| T5885 |
30453-30455 |
IN |
denotes |
in |
| T5886 |
30456-30457 |
DT |
denotes |
a |
| T5888 |
30458-30471 |
NN |
denotes |
proliferation |
| T5889 |
30472-30481 |
NN |
denotes |
signaling |
| T5887 |
30482-30489 |
NN |
denotes |
pathway |
| T5890 |
30490-30494 |
WRB |
denotes |
when |
| T5892 |
30495-30498 |
NNS |
denotes |
AJs |
| T5893 |
30499-30502 |
VBP |
denotes |
are |
| T5891 |
30503-30516 |
VBN |
denotes |
deconstructed |
| T5894 |
30516-30517 |
. |
denotes |
. |
| T5895 |
30517-30757 |
sentence |
denotes |
Numerous studies have correlated a down-regulation of E-cadherin with a translocation of β-catenin to the nucleus and a transactivation of genes that are regulated by the LEF-1/T cell factor (TCF) family of DNA binding proteins [23,24,25]. |
| T5896 |
30518-30526 |
JJ |
denotes |
Numerous |
| T5897 |
30527-30534 |
NNS |
denotes |
studies |
| T5899 |
30535-30539 |
VBP |
denotes |
have |
| T5898 |
30540-30550 |
VBN |
denotes |
correlated |
| T5900 |
30551-30552 |
DT |
denotes |
a |
| T5902 |
30553-30557 |
JJ |
denotes |
down |
| T5903 |
30557-30558 |
HYPH |
denotes |
- |
| T5901 |
30558-30568 |
NN |
denotes |
regulation |
| T5904 |
30569-30571 |
IN |
denotes |
of |
| T5905 |
30572-30573 |
NN |
denotes |
E |
| T5907 |
30573-30574 |
HYPH |
denotes |
- |
| T5906 |
30574-30582 |
NN |
denotes |
cadherin |
| T5908 |
30583-30587 |
IN |
denotes |
with |
| T5909 |
30588-30589 |
DT |
denotes |
a |
| T5910 |
30590-30603 |
NN |
denotes |
translocation |
| T5911 |
30604-30606 |
IN |
denotes |
of |
| T5912 |
30607-30608 |
NN |
denotes |
β |
| T5914 |
30608-30609 |
HYPH |
denotes |
- |
| T5913 |
30609-30616 |
NN |
denotes |
catenin |
| T5915 |
30617-30619 |
IN |
denotes |
to |
| T5916 |
30620-30623 |
DT |
denotes |
the |
| T5917 |
30624-30631 |
NN |
denotes |
nucleus |
| T5918 |
30632-30635 |
CC |
denotes |
and |
| T5919 |
30636-30637 |
DT |
denotes |
a |
| T5920 |
30638-30653 |
NN |
denotes |
transactivation |
| T5921 |
30654-30656 |
IN |
denotes |
of |
| T5922 |
30657-30662 |
NNS |
denotes |
genes |
| T5923 |
30663-30667 |
WDT |
denotes |
that |
| T5925 |
30668-30671 |
VBP |
denotes |
are |
| T5924 |
30672-30681 |
VBN |
denotes |
regulated |
| T5926 |
30682-30684 |
IN |
denotes |
by |
| T5927 |
30685-30688 |
DT |
denotes |
the |
| T5929 |
30689-30692 |
NN |
denotes |
LEF |
| T5930 |
30692-30693 |
HYPH |
denotes |
- |
| T5931 |
30693-30694 |
CD |
denotes |
1 |
| T5932 |
30694-30695 |
HYPH |
denotes |
/ |
| T5933 |
30695-30696 |
NN |
denotes |
T |
| T5934 |
30697-30701 |
NN |
denotes |
cell |
| T5935 |
30702-30708 |
NN |
denotes |
factor |
| T5936 |
30709-30710 |
-LRB- |
denotes |
( |
| T5937 |
30710-30713 |
NN |
denotes |
TCF |
| T5938 |
30713-30714 |
-RRB- |
denotes |
) |
| T5928 |
30715-30721 |
NN |
denotes |
family |
| T5939 |
30722-30724 |
IN |
denotes |
of |
| T5940 |
30725-30728 |
NN |
denotes |
DNA |
| T5941 |
30729-30736 |
VBG |
denotes |
binding |
| T5942 |
30737-30745 |
NN |
denotes |
proteins |
| T5943 |
30746-30747 |
-LRB- |
denotes |
[ |
| T5945 |
30747-30749 |
CD |
denotes |
23 |
| T5946 |
30749-30750 |
, |
denotes |
, |
| T5947 |
30750-30752 |
CD |
denotes |
24 |
| T5948 |
30752-30753 |
, |
denotes |
, |
| T5944 |
30753-30755 |
CD |
denotes |
25 |
| T5949 |
30755-30756 |
-RRB- |
denotes |
] |
| T5950 |
30756-30757 |
. |
denotes |
. |
| T5951 |
30757-30963 |
sentence |
denotes |
The presence of nuclear cyclin D in hyperproliferative Snail Tg epidermis was particularly intriguing since prior studies have reported cyclin D gene as a direct target of TCF/β-catenin transcription [26]. |
| T5952 |
30758-30761 |
DT |
denotes |
The |
| T5953 |
30762-30770 |
NN |
denotes |
presence |
| T5955 |
30771-30773 |
IN |
denotes |
of |
| T5956 |
30774-30781 |
JJ |
denotes |
nuclear |
| T5958 |
30782-30788 |
NN |
denotes |
cyclin |
| T5957 |
30789-30790 |
NN |
denotes |
D |
| T5959 |
30791-30793 |
IN |
denotes |
in |
| T5960 |
30794-30812 |
JJ |
denotes |
hyperproliferative |
| T5962 |
30813-30818 |
NN |
denotes |
Snail |
| T5963 |
30819-30821 |
NN |
denotes |
Tg |
| T5961 |
30822-30831 |
NN |
denotes |
epidermis |
| T5954 |
30832-30835 |
VBD |
denotes |
was |
| T5964 |
30836-30848 |
RB |
denotes |
particularly |
| T5965 |
30849-30859 |
JJ |
denotes |
intriguing |
| T5966 |
30860-30865 |
IN |
denotes |
since |
| T5968 |
30866-30871 |
JJ |
denotes |
prior |
| T5969 |
30872-30879 |
NNS |
denotes |
studies |
| T5970 |
30880-30884 |
VBP |
denotes |
have |
| T5967 |
30885-30893 |
VBN |
denotes |
reported |
| T5971 |
30894-30900 |
NN |
denotes |
cyclin |
| T5972 |
30901-30902 |
NN |
denotes |
D |
| T5973 |
30903-30907 |
NN |
denotes |
gene |
| T5974 |
30908-30910 |
IN |
denotes |
as |
| T5975 |
30911-30912 |
DT |
denotes |
a |
| T5977 |
30913-30919 |
JJ |
denotes |
direct |
| T5976 |
30920-30926 |
NN |
denotes |
target |
| T5978 |
30927-30929 |
IN |
denotes |
of |
| T5979 |
30930-30933 |
NN |
denotes |
TCF |
| T5981 |
30933-30934 |
HYPH |
denotes |
/ |
| T5980 |
30934-30935 |
NN |
denotes |
β |
| T5983 |
30935-30936 |
HYPH |
denotes |
- |
| T5984 |
30936-30943 |
NN |
denotes |
catenin |
| T5982 |
30944-30957 |
NN |
denotes |
transcription |
| T5985 |
30958-30959 |
-LRB- |
denotes |
[ |
| T5986 |
30959-30961 |
CD |
denotes |
26 |
| T5987 |
30961-30962 |
-RRB- |
denotes |
] |
| T5988 |
30962-30963 |
. |
denotes |
. |
| T5989 |
30963-31173 |
sentence |
denotes |
This said, we did not detect nuclear β-catenin in our Tg epidermis, and mating the Snail Tg mice against the TOPGal reporter mouse [20] gave no signs of ectopic LEF-1/Tcf/β-catenin activity (unpublished data). |
| T5990 |
30964-30968 |
DT |
denotes |
This |
| T5991 |
30969-30973 |
VBN |
denotes |
said |
| T5993 |
30973-30975 |
, |
denotes |
, |
| T5994 |
30975-30977 |
PRP |
denotes |
we |
| T5995 |
30978-30981 |
VBD |
denotes |
did |
| T5996 |
30982-30985 |
RB |
denotes |
not |
| T5992 |
30986-30992 |
VB |
denotes |
detect |
| T5997 |
30993-31000 |
JJ |
denotes |
nuclear |
| T5999 |
31001-31002 |
NN |
denotes |
β |
| T6000 |
31002-31003 |
HYPH |
denotes |
- |
| T5998 |
31003-31010 |
NN |
denotes |
catenin |
| T6001 |
31011-31013 |
IN |
denotes |
in |
| T6002 |
31014-31017 |
PRP$ |
denotes |
our |
| T6004 |
31018-31020 |
NN |
denotes |
Tg |
| T6003 |
31021-31030 |
NN |
denotes |
epidermis |
| T6005 |
31030-31032 |
, |
denotes |
, |
| T6006 |
31032-31035 |
CC |
denotes |
and |
| T6007 |
31036-31042 |
VBG |
denotes |
mating |
| T6009 |
31043-31046 |
DT |
denotes |
the |
| T6011 |
31047-31052 |
NN |
denotes |
Snail |
| T6012 |
31053-31055 |
NN |
denotes |
Tg |
| T6010 |
31056-31060 |
NNS |
denotes |
mice |
| T6013 |
31061-31068 |
IN |
denotes |
against |
| T6014 |
31069-31072 |
DT |
denotes |
the |
| T6016 |
31073-31079 |
NN |
denotes |
TOPGal |
| T6017 |
31080-31088 |
NN |
denotes |
reporter |
| T6015 |
31089-31094 |
NN |
denotes |
mouse |
| T6018 |
31095-31096 |
-LRB- |
denotes |
[ |
| T6019 |
31096-31098 |
CD |
denotes |
20 |
| T6020 |
31098-31099 |
-RRB- |
denotes |
] |
| T6008 |
31100-31104 |
VBD |
denotes |
gave |
| T6021 |
31105-31107 |
DT |
denotes |
no |
| T6022 |
31108-31113 |
NNS |
denotes |
signs |
| T6023 |
31114-31116 |
IN |
denotes |
of |
| T6024 |
31117-31124 |
JJ |
denotes |
ectopic |
| T6026 |
31125-31128 |
NN |
denotes |
LEF |
| T6027 |
31128-31129 |
HYPH |
denotes |
- |
| T6028 |
31129-31130 |
CD |
denotes |
1 |
| T6029 |
31130-31131 |
HYPH |
denotes |
/ |
| T6030 |
31131-31134 |
NN |
denotes |
Tcf |
| T6031 |
31134-31135 |
HYPH |
denotes |
/ |
| T6032 |
31135-31136 |
NN |
denotes |
β |
| T6034 |
31136-31137 |
HYPH |
denotes |
- |
| T6033 |
31137-31144 |
NN |
denotes |
catenin |
| T6025 |
31145-31153 |
NN |
denotes |
activity |
| T6035 |
31154-31155 |
-LRB- |
denotes |
( |
| T6037 |
31155-31166 |
JJ |
denotes |
unpublished |
| T6036 |
31167-31171 |
NNS |
denotes |
data |
| T6038 |
31171-31172 |
-RRB- |
denotes |
) |
| T6039 |
31172-31173 |
. |
denotes |
. |
| T6040 |
31173-31314 |
sentence |
denotes |
We next turned to the presence of cytoplasmic Ajuba for a possible mechanistic link to the proliferative increase in our Snail Tg epidermis. |
| T6041 |
31174-31176 |
PRP |
denotes |
We |
| T6043 |
31177-31181 |
RB |
denotes |
next |
| T6042 |
31182-31188 |
VBD |
denotes |
turned |
| T6044 |
31189-31191 |
IN |
denotes |
to |
| T6045 |
31192-31195 |
DT |
denotes |
the |
| T6046 |
31196-31204 |
NN |
denotes |
presence |
| T6047 |
31205-31207 |
IN |
denotes |
of |
| T6048 |
31208-31219 |
JJ |
denotes |
cytoplasmic |
| T6049 |
31220-31225 |
NN |
denotes |
Ajuba |
| T6050 |
31226-31229 |
IN |
denotes |
for |
| T6051 |
31230-31231 |
DT |
denotes |
a |
| T6053 |
31232-31240 |
JJ |
denotes |
possible |
| T6054 |
31241-31252 |
JJ |
denotes |
mechanistic |
| T6052 |
31253-31257 |
NN |
denotes |
link |
| T6055 |
31258-31260 |
IN |
denotes |
to |
| T6056 |
31261-31264 |
DT |
denotes |
the |
| T6058 |
31265-31278 |
JJ |
denotes |
proliferative |
| T6057 |
31279-31287 |
NN |
denotes |
increase |
| T6059 |
31288-31290 |
IN |
denotes |
in |
| T6060 |
31291-31294 |
PRP$ |
denotes |
our |
| T6062 |
31295-31300 |
NN |
denotes |
Snail |
| T6063 |
31301-31303 |
NN |
denotes |
Tg |
| T6061 |
31304-31313 |
NN |
denotes |
epidermis |
| T6064 |
31313-31314 |
. |
denotes |
. |
| T6065 |
31314-31564 |
sentence |
denotes |
In addition to its documented ability to bind α-catenin [10], Ajuba can also associate with growth factor receptor-bound protein-2 (Grb-2)/son of sevenless (Sos), the nucleotide exchange factor for Ras, which is upstream from activation of MAPK [9]. |
| T6066 |
31315-31317 |
IN |
denotes |
In |
| T6068 |
31318-31326 |
NN |
denotes |
addition |
| T6069 |
31327-31329 |
IN |
denotes |
to |
| T6070 |
31330-31333 |
PRP$ |
denotes |
its |
| T6072 |
31334-31344 |
VBN |
denotes |
documented |
| T6071 |
31345-31352 |
NN |
denotes |
ability |
| T6073 |
31353-31355 |
TO |
denotes |
to |
| T6074 |
31356-31360 |
VB |
denotes |
bind |
| T6075 |
31361-31362 |
NN |
denotes |
α |
| T6077 |
31362-31363 |
HYPH |
denotes |
- |
| T6076 |
31363-31370 |
NN |
denotes |
catenin |
| T6078 |
31371-31372 |
-LRB- |
denotes |
[ |
| T6079 |
31372-31374 |
CD |
denotes |
10 |
| T6080 |
31374-31375 |
-RRB- |
denotes |
] |
| T6081 |
31375-31377 |
, |
denotes |
, |
| T6082 |
31377-31382 |
NN |
denotes |
Ajuba |
| T6083 |
31383-31386 |
MD |
denotes |
can |
| T6084 |
31387-31391 |
RB |
denotes |
also |
| T6067 |
31392-31401 |
VB |
denotes |
associate |
| T6085 |
31402-31406 |
IN |
denotes |
with |
| T6086 |
31407-31413 |
NN |
denotes |
growth |
| T6087 |
31414-31420 |
NN |
denotes |
factor |
| T6088 |
31421-31429 |
NN |
denotes |
receptor |
| T6090 |
31429-31430 |
HYPH |
denotes |
- |
| T6089 |
31430-31435 |
JJ |
denotes |
bound |
| T6091 |
31436-31443 |
NN |
denotes |
protein |
| T6092 |
31443-31444 |
HYPH |
denotes |
- |
| T6093 |
31444-31445 |
CD |
denotes |
2 |
| T6094 |
31446-31447 |
-LRB- |
denotes |
( |
| T6095 |
31447-31450 |
NN |
denotes |
Grb |
| T6096 |
31450-31451 |
HYPH |
denotes |
- |
| T6097 |
31451-31452 |
CD |
denotes |
2 |
| T6098 |
31452-31453 |
-RRB- |
denotes |
) |
| T6099 |
31453-31454 |
HYPH |
denotes |
/ |
| T6100 |
31454-31457 |
NN |
denotes |
son |
| T6101 |
31458-31460 |
IN |
denotes |
of |
| T6102 |
31461-31470 |
NN |
denotes |
sevenless |
| T6103 |
31471-31472 |
-LRB- |
denotes |
( |
| T6104 |
31472-31475 |
NN |
denotes |
Sos |
| T6105 |
31475-31476 |
-RRB- |
denotes |
) |
| T6106 |
31476-31478 |
, |
denotes |
, |
| T6107 |
31478-31481 |
DT |
denotes |
the |
| T6109 |
31482-31492 |
NN |
denotes |
nucleotide |
| T6110 |
31493-31501 |
NN |
denotes |
exchange |
| T6108 |
31502-31508 |
NN |
denotes |
factor |
| T6111 |
31509-31512 |
IN |
denotes |
for |
| T6112 |
31513-31516 |
NN |
denotes |
Ras |
| T6113 |
31516-31518 |
, |
denotes |
, |
| T6114 |
31518-31523 |
WDT |
denotes |
which |
| T6115 |
31524-31526 |
VBZ |
denotes |
is |
| T6116 |
31527-31535 |
RB |
denotes |
upstream |
| T6117 |
31536-31540 |
IN |
denotes |
from |
| T6118 |
31541-31551 |
NN |
denotes |
activation |
| T6119 |
31552-31554 |
IN |
denotes |
of |
| T6120 |
31555-31559 |
NN |
denotes |
MAPK |
| T6121 |
31560-31561 |
-LRB- |
denotes |
[ |
| T6122 |
31561-31562 |
CD |
denotes |
9 |
| T6123 |
31562-31563 |
-RRB- |
denotes |
] |
| T6124 |
31563-31564 |
. |
denotes |
. |
| T6125 |
31564-31722 |
sentence |
denotes |
Given the increase in pMAPK staining in Tg skin, we examined the possibility that Ajuba might have changed its binding partner in Snail-expressing epidermis. |
| T6126 |
31565-31570 |
VBN |
denotes |
Given |
| T6128 |
31571-31574 |
DT |
denotes |
the |
| T6129 |
31575-31583 |
NN |
denotes |
increase |
| T6130 |
31584-31586 |
IN |
denotes |
in |
| T6131 |
31587-31592 |
NN |
denotes |
pMAPK |
| T6132 |
31593-31601 |
NN |
denotes |
staining |
| T6133 |
31602-31604 |
IN |
denotes |
in |
| T6134 |
31605-31607 |
NN |
denotes |
Tg |
| T6135 |
31608-31612 |
NN |
denotes |
skin |
| T6136 |
31612-31614 |
, |
denotes |
, |
| T6137 |
31614-31616 |
PRP |
denotes |
we |
| T6127 |
31617-31625 |
VBD |
denotes |
examined |
| T6138 |
31626-31629 |
DT |
denotes |
the |
| T6139 |
31630-31641 |
NN |
denotes |
possibility |
| T6140 |
31642-31646 |
IN |
denotes |
that |
| T6142 |
31647-31652 |
NN |
denotes |
Ajuba |
| T6143 |
31653-31658 |
MD |
denotes |
might |
| T6144 |
31659-31663 |
VB |
denotes |
have |
| T6141 |
31664-31671 |
VBN |
denotes |
changed |
| T6145 |
31672-31675 |
PRP$ |
denotes |
its |
| T6147 |
31676-31683 |
NN |
denotes |
binding |
| T6146 |
31684-31691 |
NN |
denotes |
partner |
| T6148 |
31692-31694 |
IN |
denotes |
in |
| T6149 |
31695-31700 |
NN |
denotes |
Snail |
| T6151 |
31700-31701 |
HYPH |
denotes |
- |
| T6150 |
31701-31711 |
VBG |
denotes |
expressing |
| T6152 |
31712-31721 |
NN |
denotes |
epidermis |
| T6153 |
31721-31722 |
. |
denotes |
. |
| T6154 |
31722-31911 |
sentence |
denotes |
Interestingly, Ajuba was readily detected in anti-Grb-2 immunoprecipitates of protein lysates from skins of Snail Tg mice but not from the corresponding wild-type (WT) animals (Figure 4E). |
| T6155 |
31723-31736 |
RB |
denotes |
Interestingly |
| T6157 |
31736-31738 |
, |
denotes |
, |
| T6158 |
31738-31743 |
NN |
denotes |
Ajuba |
| T6159 |
31744-31747 |
VBD |
denotes |
was |
| T6160 |
31748-31755 |
RB |
denotes |
readily |
| T6156 |
31756-31764 |
VBN |
denotes |
detected |
| T6161 |
31765-31767 |
IN |
denotes |
in |
| T6162 |
31768-31776 |
JJ |
denotes |
anti-Grb |
| T6164 |
31776-31777 |
HYPH |
denotes |
- |
| T6165 |
31777-31778 |
CD |
denotes |
2 |
| T6163 |
31779-31797 |
NNS |
denotes |
immunoprecipitates |
| T6166 |
31798-31800 |
IN |
denotes |
of |
| T6167 |
31801-31808 |
NN |
denotes |
protein |
| T6168 |
31809-31816 |
NNS |
denotes |
lysates |
| T6169 |
31817-31821 |
IN |
denotes |
from |
| T6170 |
31822-31827 |
NNS |
denotes |
skins |
| T6171 |
31828-31830 |
IN |
denotes |
of |
| T6172 |
31831-31836 |
NN |
denotes |
Snail |
| T6174 |
31837-31839 |
NN |
denotes |
Tg |
| T6173 |
31840-31844 |
NNS |
denotes |
mice |
| T6175 |
31845-31848 |
CC |
denotes |
but |
| T6176 |
31849-31852 |
RB |
denotes |
not |
| T6177 |
31853-31857 |
IN |
denotes |
from |
| T6178 |
31858-31861 |
DT |
denotes |
the |
| T6180 |
31862-31875 |
JJ |
denotes |
corresponding |
| T6181 |
31876-31880 |
JJ |
denotes |
wild |
| T6183 |
31880-31881 |
HYPH |
denotes |
- |
| T6182 |
31881-31885 |
NN |
denotes |
type |
| T6184 |
31886-31887 |
-LRB- |
denotes |
( |
| T6185 |
31887-31889 |
NN |
denotes |
WT |
| T6186 |
31889-31890 |
-RRB- |
denotes |
) |
| T6179 |
31891-31898 |
NNS |
denotes |
animals |
| T6187 |
31899-31900 |
-LRB- |
denotes |
( |
| T6189 |
31900-31906 |
NN |
denotes |
Figure |
| T6188 |
31907-31909 |
NN |
denotes |
4E |
| T6190 |
31909-31910 |
-RRB- |
denotes |
) |
| T6191 |
31910-31911 |
. |
denotes |
. |
| T6192 |
31911-32138 |
sentence |
denotes |
When these experiments were repeated with α-catenin-null epidermis, a similar Grb-2-Ajuba association was detected, and again, this interaction was not detected in the protein extracts from control littermate skin (Figure 4E). |
| T6193 |
31912-31916 |
WRB |
denotes |
When |
| T6195 |
31917-31922 |
DT |
denotes |
these |
| T6196 |
31923-31934 |
NNS |
denotes |
experiments |
| T6197 |
31935-31939 |
VBD |
denotes |
were |
| T6194 |
31940-31948 |
VBN |
denotes |
repeated |
| T6199 |
31949-31953 |
IN |
denotes |
with |
| T6200 |
31954-31955 |
NN |
denotes |
α |
| T6202 |
31955-31956 |
HYPH |
denotes |
- |
| T6201 |
31956-31963 |
NN |
denotes |
catenin |
| T6204 |
31963-31964 |
HYPH |
denotes |
- |
| T6203 |
31964-31968 |
JJ |
denotes |
null |
| T6205 |
31969-31978 |
NN |
denotes |
epidermis |
| T6206 |
31978-31980 |
, |
denotes |
, |
| T6207 |
31980-31981 |
DT |
denotes |
a |
| T6209 |
31982-31989 |
JJ |
denotes |
similar |
| T6210 |
31990-31993 |
NN |
denotes |
Grb |
| T6212 |
31993-31994 |
HYPH |
denotes |
- |
| T6213 |
31994-31995 |
CD |
denotes |
2 |
| T6214 |
31995-31996 |
HYPH |
denotes |
- |
| T6211 |
31996-32001 |
NN |
denotes |
Ajuba |
| T6208 |
32002-32013 |
NN |
denotes |
association |
| T6215 |
32014-32017 |
VBD |
denotes |
was |
| T6198 |
32018-32026 |
VBN |
denotes |
detected |
| T6216 |
32026-32028 |
, |
denotes |
, |
| T6217 |
32028-32031 |
CC |
denotes |
and |
| T6218 |
32032-32037 |
RB |
denotes |
again |
| T6220 |
32037-32039 |
, |
denotes |
, |
| T6221 |
32039-32043 |
DT |
denotes |
this |
| T6222 |
32044-32055 |
NN |
denotes |
interaction |
| T6223 |
32056-32059 |
VBD |
denotes |
was |
| T6224 |
32060-32063 |
RB |
denotes |
not |
| T6219 |
32064-32072 |
VBN |
denotes |
detected |
| T6225 |
32073-32075 |
IN |
denotes |
in |
| T6226 |
32076-32079 |
DT |
denotes |
the |
| T6228 |
32080-32087 |
NN |
denotes |
protein |
| T6227 |
32088-32096 |
NNS |
denotes |
extracts |
| T6229 |
32097-32101 |
IN |
denotes |
from |
| T6230 |
32102-32109 |
NN |
denotes |
control |
| T6232 |
32110-32120 |
NN |
denotes |
littermate |
| T6231 |
32121-32125 |
NN |
denotes |
skin |
| T6233 |
32126-32127 |
-LRB- |
denotes |
( |
| T6235 |
32127-32133 |
NN |
denotes |
Figure |
| T6234 |
32134-32136 |
NN |
denotes |
4E |
| T6236 |
32136-32137 |
-RRB- |
denotes |
) |
| T6237 |
32137-32138 |
. |
denotes |
. |
| T6238 |
32138-32346 |
sentence |
denotes |
Together, these data demonstrate that the reduction in α-catenin levels, either by Snail-mediated down-regulation of E-cadherin or by α-catenin conditional targeting, allows Ajuba to interact with Grb-2/Sos. |
| T6239 |
32139-32147 |
RB |
denotes |
Together |
| T6241 |
32147-32149 |
, |
denotes |
, |
| T6242 |
32149-32154 |
DT |
denotes |
these |
| T6243 |
32155-32159 |
NNS |
denotes |
data |
| T6240 |
32160-32171 |
VBP |
denotes |
demonstrate |
| T6244 |
32172-32176 |
IN |
denotes |
that |
| T6246 |
32177-32180 |
DT |
denotes |
the |
| T6247 |
32181-32190 |
NN |
denotes |
reduction |
| T6248 |
32191-32193 |
IN |
denotes |
in |
| T6249 |
32194-32195 |
NN |
denotes |
α |
| T6251 |
32195-32196 |
HYPH |
denotes |
- |
| T6250 |
32196-32203 |
NN |
denotes |
catenin |
| T6252 |
32204-32210 |
NNS |
denotes |
levels |
| T6253 |
32210-32212 |
, |
denotes |
, |
| T6254 |
32212-32218 |
CC |
denotes |
either |
| T6255 |
32219-32221 |
IN |
denotes |
by |
| T6256 |
32222-32227 |
NN |
denotes |
Snail |
| T6258 |
32227-32228 |
HYPH |
denotes |
- |
| T6257 |
32228-32236 |
VBN |
denotes |
mediated |
| T6260 |
32237-32241 |
JJ |
denotes |
down |
| T6261 |
32241-32242 |
HYPH |
denotes |
- |
| T6259 |
32242-32252 |
NN |
denotes |
regulation |
| T6262 |
32253-32255 |
IN |
denotes |
of |
| T6263 |
32256-32257 |
NN |
denotes |
E |
| T6265 |
32257-32258 |
HYPH |
denotes |
- |
| T6264 |
32258-32266 |
NN |
denotes |
cadherin |
| T6266 |
32267-32269 |
CC |
denotes |
or |
| T6267 |
32270-32272 |
IN |
denotes |
by |
| T6268 |
32273-32274 |
NN |
denotes |
α |
| T6270 |
32274-32275 |
HYPH |
denotes |
- |
| T6269 |
32275-32282 |
NN |
denotes |
catenin |
| T6271 |
32283-32294 |
JJ |
denotes |
conditional |
| T6272 |
32295-32304 |
NN |
denotes |
targeting |
| T6273 |
32304-32306 |
, |
denotes |
, |
| T6245 |
32306-32312 |
VBZ |
denotes |
allows |
| T6274 |
32313-32318 |
NN |
denotes |
Ajuba |
| T6276 |
32319-32321 |
TO |
denotes |
to |
| T6275 |
32322-32330 |
VB |
denotes |
interact |
| T6277 |
32331-32335 |
IN |
denotes |
with |
| T6278 |
32336-32339 |
NN |
denotes |
Grb |
| T6279 |
32339-32340 |
HYPH |
denotes |
- |
| T6280 |
32340-32341 |
CD |
denotes |
2 |
| T6281 |
32341-32342 |
HYPH |
denotes |
/ |
| T6282 |
32342-32345 |
NN |
denotes |
Sos |
| T6283 |
32345-32346 |
. |
denotes |
. |
| T6284 |
32346-32624 |
sentence |
denotes |
If the competition between Grb-2/Sos and α-catenin for Ajuba is functionally relevant to the hyperproliferative state of a keratinocyte, then overexpression of Ajuba would be expected to bypass the competition and promote activation of the Ras-MAPK pathway in WT keratinocytes. |
| T6285 |
32347-32349 |
IN |
denotes |
If |
| T6287 |
32350-32353 |
DT |
denotes |
the |
| T6288 |
32354-32365 |
NN |
denotes |
competition |
| T6289 |
32366-32373 |
IN |
denotes |
between |
| T6290 |
32374-32377 |
NN |
denotes |
Grb |
| T6291 |
32377-32378 |
HYPH |
denotes |
- |
| T6292 |
32378-32379 |
CD |
denotes |
2 |
| T6293 |
32379-32380 |
HYPH |
denotes |
/ |
| T6294 |
32380-32383 |
NN |
denotes |
Sos |
| T6295 |
32384-32387 |
CC |
denotes |
and |
| T6296 |
32388-32389 |
NN |
denotes |
α |
| T6298 |
32389-32390 |
HYPH |
denotes |
- |
| T6297 |
32390-32397 |
NN |
denotes |
catenin |
| T6299 |
32398-32401 |
IN |
denotes |
for |
| T6300 |
32402-32407 |
NN |
denotes |
Ajuba |
| T6286 |
32408-32410 |
VBZ |
denotes |
is |
| T6302 |
32411-32423 |
RB |
denotes |
functionally |
| T6303 |
32424-32432 |
JJ |
denotes |
relevant |
| T6304 |
32433-32435 |
IN |
denotes |
to |
| T6305 |
32436-32439 |
DT |
denotes |
the |
| T6307 |
32440-32458 |
JJ |
denotes |
hyperproliferative |
| T6306 |
32459-32464 |
NN |
denotes |
state |
| T6308 |
32465-32467 |
IN |
denotes |
of |
| T6309 |
32468-32469 |
DT |
denotes |
a |
| T6310 |
32470-32482 |
NN |
denotes |
keratinocyte |
| T6311 |
32482-32484 |
, |
denotes |
, |
| T6312 |
32484-32488 |
RB |
denotes |
then |
| T6313 |
32489-32503 |
NN |
denotes |
overexpression |
| T6314 |
32504-32506 |
IN |
denotes |
of |
| T6315 |
32507-32512 |
NN |
denotes |
Ajuba |
| T6316 |
32513-32518 |
MD |
denotes |
would |
| T6317 |
32519-32521 |
VB |
denotes |
be |
| T6301 |
32522-32530 |
VBN |
denotes |
expected |
| T6318 |
32531-32533 |
TO |
denotes |
to |
| T6319 |
32534-32540 |
VB |
denotes |
bypass |
| T6320 |
32541-32544 |
DT |
denotes |
the |
| T6321 |
32545-32556 |
NN |
denotes |
competition |
| T6322 |
32557-32560 |
CC |
denotes |
and |
| T6323 |
32561-32568 |
VB |
denotes |
promote |
| T6324 |
32569-32579 |
NN |
denotes |
activation |
| T6325 |
32580-32582 |
IN |
denotes |
of |
| T6326 |
32583-32586 |
DT |
denotes |
the |
| T6328 |
32587-32590 |
NN |
denotes |
Ras |
| T6330 |
32590-32591 |
HYPH |
denotes |
- |
| T6329 |
32591-32595 |
NN |
denotes |
MAPK |
| T6327 |
32596-32603 |
NN |
denotes |
pathway |
| T6331 |
32604-32606 |
IN |
denotes |
in |
| T6332 |
32607-32609 |
NN |
denotes |
WT |
| T6333 |
32610-32623 |
NNS |
denotes |
keratinocytes |
| T6334 |
32623-32624 |
. |
denotes |
. |
| T6335 |
32624-32855 |
sentence |
denotes |
Indeed, when serum-starved keratinocytes were transiently transfected with an Ajuba expression vector, the levels of pMAPK were not only elevated but also comparable to those transfected with the K14-HASnail transgene (Figure 4F). |
| T6336 |
32625-32631 |
RB |
denotes |
Indeed |
| T6338 |
32631-32633 |
, |
denotes |
, |
| T6339 |
32633-32637 |
WRB |
denotes |
when |
| T6341 |
32638-32643 |
NN |
denotes |
serum |
| T6343 |
32643-32644 |
HYPH |
denotes |
- |
| T6342 |
32644-32651 |
VBN |
denotes |
starved |
| T6344 |
32652-32665 |
NNS |
denotes |
keratinocytes |
| T6345 |
32666-32670 |
VBD |
denotes |
were |
| T6346 |
32671-32682 |
RB |
denotes |
transiently |
| T6340 |
32683-32694 |
VBN |
denotes |
transfected |
| T6347 |
32695-32699 |
IN |
denotes |
with |
| T6348 |
32700-32702 |
DT |
denotes |
an |
| T6350 |
32703-32708 |
NN |
denotes |
Ajuba |
| T6351 |
32709-32719 |
NN |
denotes |
expression |
| T6349 |
32720-32726 |
NN |
denotes |
vector |
| T6352 |
32726-32728 |
, |
denotes |
, |
| T6353 |
32728-32731 |
DT |
denotes |
the |
| T6354 |
32732-32738 |
NNS |
denotes |
levels |
| T6355 |
32739-32741 |
IN |
denotes |
of |
| T6356 |
32742-32747 |
NN |
denotes |
pMAPK |
| T6337 |
32748-32752 |
VBD |
denotes |
were |
| T6357 |
32753-32756 |
RB |
denotes |
not |
| T6359 |
32757-32761 |
RB |
denotes |
only |
| T6358 |
32762-32770 |
JJ |
denotes |
elevated |
| T6360 |
32771-32774 |
CC |
denotes |
but |
| T6361 |
32775-32779 |
RB |
denotes |
also |
| T6362 |
32780-32790 |
JJ |
denotes |
comparable |
| T6363 |
32791-32793 |
IN |
denotes |
to |
| T6364 |
32794-32799 |
DT |
denotes |
those |
| T6365 |
32800-32811 |
VBN |
denotes |
transfected |
| T6366 |
32812-32816 |
IN |
denotes |
with |
| T6367 |
32817-32820 |
DT |
denotes |
the |
| T6369 |
32821-32824 |
NN |
denotes |
K14 |
| T6371 |
32824-32825 |
HYPH |
denotes |
- |
| T6370 |
32825-32832 |
NN |
denotes |
HASnail |
| T6368 |
32833-32842 |
NN |
denotes |
transgene |
| T6372 |
32843-32844 |
-LRB- |
denotes |
( |
| T6374 |
32844-32850 |
NN |
denotes |
Figure |
| T6373 |
32851-32853 |
NN |
denotes |
4F |
| T6375 |
32853-32854 |
-RRB- |
denotes |
) |
| T6376 |
32854-32855 |
. |
denotes |
. |
| T6377 |
32855-33037 |
sentence |
denotes |
This activation was abolished when cells were treated with a small peptide inhibitor that specifically interrupts the Grb-2/Sos interaction (Figure 4F; see lanes marked “inh”) [27]. |
| T6378 |
32856-32860 |
DT |
denotes |
This |
| T6379 |
32861-32871 |
NN |
denotes |
activation |
| T6381 |
32872-32875 |
VBD |
denotes |
was |
| T6380 |
32876-32885 |
VBN |
denotes |
abolished |
| T6382 |
32886-32890 |
WRB |
denotes |
when |
| T6384 |
32891-32896 |
NNS |
denotes |
cells |
| T6385 |
32897-32901 |
VBD |
denotes |
were |
| T6383 |
32902-32909 |
VBN |
denotes |
treated |
| T6386 |
32910-32914 |
IN |
denotes |
with |
| T6387 |
32915-32916 |
DT |
denotes |
a |
| T6389 |
32917-32922 |
JJ |
denotes |
small |
| T6390 |
32923-32930 |
NN |
denotes |
peptide |
| T6388 |
32931-32940 |
NN |
denotes |
inhibitor |
| T6391 |
32941-32945 |
WDT |
denotes |
that |
| T6393 |
32946-32958 |
RB |
denotes |
specifically |
| T6392 |
32959-32969 |
VBZ |
denotes |
interrupts |
| T6394 |
32970-32973 |
DT |
denotes |
the |
| T6396 |
32974-32977 |
NN |
denotes |
Grb |
| T6397 |
32977-32978 |
HYPH |
denotes |
- |
| T6398 |
32978-32979 |
CD |
denotes |
2 |
| T6399 |
32979-32980 |
HYPH |
denotes |
/ |
| T6400 |
32980-32983 |
NN |
denotes |
Sos |
| T6395 |
32984-32995 |
NN |
denotes |
interaction |
| T6401 |
32996-32997 |
-LRB- |
denotes |
( |
| T6403 |
32997-33003 |
NN |
denotes |
Figure |
| T6402 |
33004-33006 |
NN |
denotes |
4F |
| T6404 |
33006-33007 |
: |
denotes |
; |
| T6405 |
33008-33011 |
VB |
denotes |
see |
| T6406 |
33012-33017 |
NNS |
denotes |
lanes |
| T6407 |
33018-33024 |
VBN |
denotes |
marked |
| T6408 |
33025-33026 |
`` |
denotes |
“ |
| T6409 |
33026-33029 |
NN |
denotes |
inh |
| T6410 |
33029-33030 |
'' |
denotes |
” |
| T6411 |
33030-33031 |
-RRB- |
denotes |
) |
| T6412 |
33032-33033 |
-LRB- |
denotes |
[ |
| T6413 |
33033-33035 |
CD |
denotes |
27 |
| T6414 |
33035-33036 |
-RRB- |
denotes |
] |
| T6415 |
33036-33037 |
. |
denotes |
. |
| T6416 |
33037-33131 |
sentence |
denotes |
Ajuba's pre-LIM domain is the segment that associates with Grb-2's Src-homology 3 domain [9]. |
| T6417 |
33038-33043 |
NN |
denotes |
Ajuba |
| T6419 |
33043-33045 |
POS |
denotes |
's |
| T6420 |
33046-33053 |
JJ |
denotes |
pre-LIM |
| T6418 |
33054-33060 |
NN |
denotes |
domain |
| T6421 |
33061-33063 |
VBZ |
denotes |
is |
| T6422 |
33064-33067 |
DT |
denotes |
the |
| T6423 |
33068-33075 |
NN |
denotes |
segment |
| T6424 |
33076-33080 |
WDT |
denotes |
that |
| T6425 |
33081-33091 |
VBZ |
denotes |
associates |
| T6426 |
33092-33096 |
IN |
denotes |
with |
| T6427 |
33097-33100 |
NN |
denotes |
Grb |
| T6429 |
33100-33101 |
HYPH |
denotes |
- |
| T6430 |
33101-33102 |
CD |
denotes |
2 |
| T6431 |
33102-33104 |
POS |
denotes |
's |
| T6432 |
33105-33108 |
NN |
denotes |
Src |
| T6434 |
33108-33109 |
HYPH |
denotes |
- |
| T6433 |
33109-33117 |
NN |
denotes |
homology |
| T6435 |
33118-33119 |
CD |
denotes |
3 |
| T6428 |
33120-33126 |
NN |
denotes |
domain |
| T6436 |
33127-33128 |
-LRB- |
denotes |
[ |
| T6437 |
33128-33129 |
CD |
denotes |
9 |
| T6438 |
33129-33130 |
-RRB- |
denotes |
] |
| T6439 |
33130-33131 |
. |
denotes |
. |
| T6440 |
33131-33256 |
sentence |
denotes |
When this domain was overexpressed in serum-starved keratinocytes, a comparable elevation in pMAPK was observed (Figure 4F). |
| T6441 |
33132-33136 |
WRB |
denotes |
When |
| T6443 |
33137-33141 |
DT |
denotes |
this |
| T6444 |
33142-33148 |
NN |
denotes |
domain |
| T6445 |
33149-33152 |
VBD |
denotes |
was |
| T6442 |
33153-33166 |
VBN |
denotes |
overexpressed |
| T6447 |
33167-33169 |
IN |
denotes |
in |
| T6448 |
33170-33175 |
NN |
denotes |
serum |
| T6450 |
33175-33176 |
HYPH |
denotes |
- |
| T6449 |
33176-33183 |
VBN |
denotes |
starved |
| T6451 |
33184-33197 |
NNS |
denotes |
keratinocytes |
| T6452 |
33197-33199 |
, |
denotes |
, |
| T6453 |
33199-33200 |
DT |
denotes |
a |
| T6455 |
33201-33211 |
JJ |
denotes |
comparable |
| T6454 |
33212-33221 |
NN |
denotes |
elevation |
| T6456 |
33222-33224 |
IN |
denotes |
in |
| T6457 |
33225-33230 |
NN |
denotes |
pMAPK |
| T6458 |
33231-33234 |
VBD |
denotes |
was |
| T6446 |
33235-33243 |
VBN |
denotes |
observed |
| T6459 |
33244-33245 |
-LRB- |
denotes |
( |
| T6461 |
33245-33251 |
NN |
denotes |
Figure |
| T6460 |
33252-33254 |
NN |
denotes |
4F |
| T6462 |
33254-33255 |
-RRB- |
denotes |
) |
| T6463 |
33255-33256 |
. |
denotes |
. |
| T6464 |
33256-33360 |
sentence |
denotes |
As expected, the small peptide inhibitor that interrupts the Grb-2/Sos association blocked the effects. |
| T6465 |
33257-33259 |
IN |
denotes |
As |
| T6466 |
33260-33268 |
VBN |
denotes |
expected |
| T6468 |
33268-33270 |
, |
denotes |
, |
| T6469 |
33270-33273 |
DT |
denotes |
the |
| T6471 |
33274-33279 |
JJ |
denotes |
small |
| T6472 |
33280-33287 |
NN |
denotes |
peptide |
| T6470 |
33288-33297 |
NN |
denotes |
inhibitor |
| T6473 |
33298-33302 |
WDT |
denotes |
that |
| T6474 |
33303-33313 |
VBZ |
denotes |
interrupts |
| T6475 |
33314-33317 |
DT |
denotes |
the |
| T6477 |
33318-33321 |
NN |
denotes |
Grb |
| T6478 |
33321-33322 |
HYPH |
denotes |
- |
| T6479 |
33322-33323 |
CD |
denotes |
2 |
| T6480 |
33323-33324 |
HYPH |
denotes |
/ |
| T6481 |
33324-33327 |
NN |
denotes |
Sos |
| T6476 |
33328-33339 |
NN |
denotes |
association |
| T6467 |
33340-33347 |
VBD |
denotes |
blocked |
| T6482 |
33348-33351 |
DT |
denotes |
the |
| T6483 |
33352-33359 |
NNS |
denotes |
effects |
| T6484 |
33359-33360 |
. |
denotes |
. |
| T6485 |
33360-33585 |
sentence |
denotes |
These data suggested that by elevating cytosolic Ajuba levels, Ajuba's pre-LIM domain may associate with Grb-2/Sos in a manner that stimulates its nucleotide exchange activity and leads to activation of the Ras-MAPK pathway. |
| T6486 |
33361-33366 |
DT |
denotes |
These |
| T6487 |
33367-33371 |
NNS |
denotes |
data |
| T6488 |
33372-33381 |
VBD |
denotes |
suggested |
| T6489 |
33382-33386 |
IN |
denotes |
that |
| T6491 |
33387-33389 |
IN |
denotes |
by |
| T6492 |
33390-33399 |
VBG |
denotes |
elevating |
| T6493 |
33400-33409 |
JJ |
denotes |
cytosolic |
| T6495 |
33410-33415 |
NN |
denotes |
Ajuba |
| T6494 |
33416-33422 |
NNS |
denotes |
levels |
| T6496 |
33422-33424 |
, |
denotes |
, |
| T6497 |
33424-33429 |
NN |
denotes |
Ajuba |
| T6499 |
33429-33431 |
POS |
denotes |
's |
| T6500 |
33432-33439 |
JJ |
denotes |
pre-LIM |
| T6498 |
33440-33446 |
NN |
denotes |
domain |
| T6501 |
33447-33450 |
MD |
denotes |
may |
| T6490 |
33451-33460 |
VB |
denotes |
associate |
| T6502 |
33461-33465 |
IN |
denotes |
with |
| T6503 |
33466-33469 |
NN |
denotes |
Grb |
| T6504 |
33469-33470 |
HYPH |
denotes |
- |
| T6505 |
33470-33471 |
CD |
denotes |
2 |
| T6506 |
33471-33472 |
HYPH |
denotes |
/ |
| T6507 |
33472-33475 |
NN |
denotes |
Sos |
| T6508 |
33476-33478 |
IN |
denotes |
in |
| T6509 |
33479-33480 |
DT |
denotes |
a |
| T6510 |
33481-33487 |
NN |
denotes |
manner |
| T6511 |
33488-33492 |
WDT |
denotes |
that |
| T6512 |
33493-33503 |
VBZ |
denotes |
stimulates |
| T6513 |
33504-33507 |
PRP$ |
denotes |
its |
| T6515 |
33508-33518 |
NN |
denotes |
nucleotide |
| T6516 |
33519-33527 |
NN |
denotes |
exchange |
| T6514 |
33528-33536 |
NN |
denotes |
activity |
| T6517 |
33537-33540 |
CC |
denotes |
and |
| T6518 |
33541-33546 |
VBZ |
denotes |
leads |
| T6519 |
33547-33549 |
IN |
denotes |
to |
| T6520 |
33550-33560 |
NN |
denotes |
activation |
| T6521 |
33561-33563 |
IN |
denotes |
of |
| T6522 |
33564-33567 |
DT |
denotes |
the |
| T6524 |
33568-33571 |
NN |
denotes |
Ras |
| T6526 |
33571-33572 |
HYPH |
denotes |
- |
| T6525 |
33572-33576 |
NN |
denotes |
MAPK |
| T6523 |
33577-33584 |
NN |
denotes |
pathway |
| T6527 |
33584-33585 |
. |
denotes |
. |
| T6528 |
33585-33795 |
sentence |
denotes |
Although this pathway provides one mechanism by which Snail expression and proliferation may be coupled in skin epithelium, proliferative circuitries involving AJs are known to be complex and often interwoven. |
| T6529 |
33586-33594 |
IN |
denotes |
Although |
| T6531 |
33595-33599 |
DT |
denotes |
this |
| T6532 |
33600-33607 |
NN |
denotes |
pathway |
| T6530 |
33608-33616 |
VBZ |
denotes |
provides |
| T6534 |
33617-33620 |
CD |
denotes |
one |
| T6535 |
33621-33630 |
NN |
denotes |
mechanism |
| T6536 |
33631-33633 |
IN |
denotes |
by |
| T6538 |
33634-33639 |
WDT |
denotes |
which |
| T6539 |
33640-33645 |
NN |
denotes |
Snail |
| T6540 |
33646-33656 |
NN |
denotes |
expression |
| T6541 |
33657-33660 |
CC |
denotes |
and |
| T6542 |
33661-33674 |
NN |
denotes |
proliferation |
| T6543 |
33675-33678 |
MD |
denotes |
may |
| T6544 |
33679-33681 |
VB |
denotes |
be |
| T6537 |
33682-33689 |
VBN |
denotes |
coupled |
| T6545 |
33690-33692 |
IN |
denotes |
in |
| T6546 |
33693-33697 |
NN |
denotes |
skin |
| T6547 |
33698-33708 |
NN |
denotes |
epithelium |
| T6548 |
33708-33710 |
, |
denotes |
, |
| T6549 |
33710-33723 |
JJ |
denotes |
proliferative |
| T6550 |
33724-33735 |
NNS |
denotes |
circuitries |
| T6551 |
33736-33745 |
VBG |
denotes |
involving |
| T6552 |
33746-33749 |
NNS |
denotes |
AJs |
| T6553 |
33750-33753 |
VBP |
denotes |
are |
| T6533 |
33754-33759 |
VBN |
denotes |
known |
| T6554 |
33760-33762 |
TO |
denotes |
to |
| T6555 |
33763-33765 |
VB |
denotes |
be |
| T6556 |
33766-33773 |
JJ |
denotes |
complex |
| T6557 |
33774-33777 |
CC |
denotes |
and |
| T6558 |
33778-33783 |
RB |
denotes |
often |
| T6559 |
33784-33794 |
VBN |
denotes |
interwoven |
| T6560 |
33794-33795 |
. |
denotes |
. |
| T6561 |
33795-33900 |
sentence |
denotes |
Future studies will be needed to systematically dissect these putative intricacies at a molecular level. |
| T6562 |
33796-33802 |
JJ |
denotes |
Future |
| T6563 |
33803-33810 |
NNS |
denotes |
studies |
| T6565 |
33811-33815 |
MD |
denotes |
will |
| T6566 |
33816-33818 |
VB |
denotes |
be |
| T6564 |
33819-33825 |
VBN |
denotes |
needed |
| T6567 |
33826-33828 |
TO |
denotes |
to |
| T6569 |
33829-33843 |
RB |
denotes |
systematically |
| T6568 |
33844-33851 |
VB |
denotes |
dissect |
| T6570 |
33852-33857 |
DT |
denotes |
these |
| T6572 |
33858-33866 |
JJ |
denotes |
putative |
| T6571 |
33867-33878 |
NNS |
denotes |
intricacies |
| T6573 |
33879-33881 |
IN |
denotes |
at |
| T6574 |
33882-33883 |
DT |
denotes |
a |
| T6576 |
33884-33893 |
JJ |
denotes |
molecular |
| T6575 |
33894-33899 |
NN |
denotes |
level |
| T6577 |
33899-33900 |
. |
denotes |
. |
| T7354 |
33902-33909 |
VBG |
denotes |
Probing |
| T7356 |
33910-33913 |
DT |
denotes |
the |
| T7357 |
33914-33924 |
NN |
denotes |
Regulation |
| T7358 |
33925-33927 |
IN |
denotes |
of |
| T7359 |
33928-33933 |
NN |
denotes |
Snail |
| T7360 |
33934-33938 |
NN |
denotes |
Gene |
| T7361 |
33939-33949 |
NN |
denotes |
Expression |
| T7355 |
33950-33957 |
VBZ |
denotes |
Reveals |
| T7362 |
33958-33960 |
DT |
denotes |
an |
| T7364 |
33961-33970 |
JJ |
denotes |
Essential |
| T7363 |
33971-33975 |
NN |
denotes |
Link |
| T7365 |
33976-33978 |
IN |
denotes |
to |
| T7366 |
33979-33982 |
NN |
denotes |
TGF |
| T7368 |
33982-33983 |
HYPH |
denotes |
- |
| T7367 |
33983-33985 |
NN |
denotes |
β2 |
| T7369 |
33986-33995 |
NN |
denotes |
Signaling |
| T7370 |
33996-33998 |
IN |
denotes |
in |
| T7371 |
33999-34002 |
DT |
denotes |
the |
| T7373 |
34003-34013 |
VBG |
denotes |
Developing |
| T7374 |
34014-34018 |
NN |
denotes |
Hair |
| T7372 |
34019-34022 |
NN |
denotes |
Bud |
| T7375 |
34022-34155 |
sentence |
denotes |
The temporal spike of Snail mRNA expression in the hair bud prompted us to consider what factor(s) may be regulating the Snail gene. |
| T7376 |
34023-34026 |
DT |
denotes |
The |
| T7378 |
34027-34035 |
JJ |
denotes |
temporal |
| T7377 |
34036-34041 |
NN |
denotes |
spike |
| T7380 |
34042-34044 |
IN |
denotes |
of |
| T7381 |
34045-34050 |
NN |
denotes |
Snail |
| T7383 |
34051-34055 |
NN |
denotes |
mRNA |
| T7382 |
34056-34066 |
NN |
denotes |
expression |
| T7384 |
34067-34069 |
IN |
denotes |
in |
| T7385 |
34070-34073 |
DT |
denotes |
the |
| T7387 |
34074-34078 |
NN |
denotes |
hair |
| T7386 |
34079-34082 |
NN |
denotes |
bud |
| T7379 |
34083-34091 |
VBD |
denotes |
prompted |
| T7388 |
34092-34094 |
PRP |
denotes |
us |
| T7389 |
34095-34097 |
TO |
denotes |
to |
| T7390 |
34098-34106 |
VB |
denotes |
consider |
| T7391 |
34107-34111 |
WDT |
denotes |
what |
| T7392 |
34112-34118 |
NN |
denotes |
factor |
| T7394 |
34118-34119 |
-LRB- |
denotes |
( |
| T7395 |
34119-34120 |
AFX |
denotes |
s |
| T7396 |
34120-34121 |
-RRB- |
denotes |
) |
| T7397 |
34122-34125 |
MD |
denotes |
may |
| T7398 |
34126-34128 |
VB |
denotes |
be |
| T7393 |
34129-34139 |
VBG |
denotes |
regulating |
| T7399 |
34140-34143 |
DT |
denotes |
the |
| T7401 |
34144-34149 |
NN |
denotes |
Snail |
| T7400 |
34150-34154 |
NN |
denotes |
gene |
| T7402 |
34154-34155 |
. |
denotes |
. |
| T7403 |
34155-34379 |
sentence |
denotes |
A variety of extracellular signals have an impact on the cell type-specific expression of different Snail family members, and many of them, including Wnts, BMPs, FGFs, and TGF-βs, also affect hair bud development [2,16,28]. |
| T7404 |
34156-34157 |
DT |
denotes |
A |
| T7405 |
34158-34165 |
NN |
denotes |
variety |
| T7407 |
34166-34168 |
IN |
denotes |
of |
| T7408 |
34169-34182 |
JJ |
denotes |
extracellular |
| T7409 |
34183-34190 |
NNS |
denotes |
signals |
| T7406 |
34191-34195 |
VBP |
denotes |
have |
| T7410 |
34196-34198 |
DT |
denotes |
an |
| T7411 |
34199-34205 |
NN |
denotes |
impact |
| T7412 |
34206-34208 |
IN |
denotes |
on |
| T7413 |
34209-34212 |
DT |
denotes |
the |
| T7415 |
34213-34217 |
NN |
denotes |
cell |
| T7416 |
34218-34222 |
NN |
denotes |
type |
| T7418 |
34222-34223 |
HYPH |
denotes |
- |
| T7417 |
34223-34231 |
JJ |
denotes |
specific |
| T7414 |
34232-34242 |
NN |
denotes |
expression |
| T7419 |
34243-34245 |
IN |
denotes |
of |
| T7420 |
34246-34255 |
JJ |
denotes |
different |
| T7422 |
34256-34261 |
NN |
denotes |
Snail |
| T7423 |
34262-34268 |
NN |
denotes |
family |
| T7421 |
34269-34276 |
NNS |
denotes |
members |
| T7424 |
34276-34278 |
, |
denotes |
, |
| T7425 |
34278-34281 |
CC |
denotes |
and |
| T7426 |
34282-34286 |
JJ |
denotes |
many |
| T7428 |
34287-34289 |
IN |
denotes |
of |
| T7429 |
34290-34294 |
PRP |
denotes |
them |
| T7430 |
34294-34296 |
, |
denotes |
, |
| T7431 |
34296-34305 |
VBG |
denotes |
including |
| T7432 |
34306-34310 |
NNS |
denotes |
Wnts |
| T7433 |
34310-34312 |
, |
denotes |
, |
| T7434 |
34312-34316 |
NNS |
denotes |
BMPs |
| T7435 |
34316-34318 |
, |
denotes |
, |
| T7436 |
34318-34322 |
NNS |
denotes |
FGFs |
| T7437 |
34322-34324 |
, |
denotes |
, |
| T7438 |
34324-34327 |
CC |
denotes |
and |
| T7439 |
34328-34331 |
NN |
denotes |
TGF |
| T7441 |
34331-34332 |
HYPH |
denotes |
- |
| T7440 |
34332-34334 |
NNS |
denotes |
βs |
| T7442 |
34334-34336 |
, |
denotes |
, |
| T7443 |
34336-34340 |
RB |
denotes |
also |
| T7427 |
34341-34347 |
VBP |
denotes |
affect |
| T7444 |
34348-34352 |
NN |
denotes |
hair |
| T7445 |
34353-34356 |
NN |
denotes |
bud |
| T7446 |
34357-34368 |
NN |
denotes |
development |
| T7447 |
34369-34370 |
-LRB- |
denotes |
[ |
| T7449 |
34370-34371 |
CD |
denotes |
2 |
| T7450 |
34371-34372 |
, |
denotes |
, |
| T7451 |
34372-34374 |
CD |
denotes |
16 |
| T7452 |
34374-34375 |
, |
denotes |
, |
| T7448 |
34375-34377 |
CD |
denotes |
28 |
| T7453 |
34377-34378 |
-RRB- |
denotes |
] |
| T7454 |
34378-34379 |
. |
denotes |
. |
| T7455 |
34379-34607 |
sentence |
denotes |
Since Snail is not expressed in cultured skin keratinocytes that secrete active BMPs and FGFs (see Figure 1B), we focused our attention on Wnt and TGF-β signaling as more likely candidates for Snail induction in this cell type. |
| T7456 |
34380-34385 |
IN |
denotes |
Since |
| T7458 |
34386-34391 |
NN |
denotes |
Snail |
| T7459 |
34392-34394 |
VBZ |
denotes |
is |
| T7460 |
34395-34398 |
RB |
denotes |
not |
| T7457 |
34399-34408 |
VBN |
denotes |
expressed |
| T7462 |
34409-34411 |
IN |
denotes |
in |
| T7463 |
34412-34420 |
VBN |
denotes |
cultured |
| T7465 |
34421-34425 |
NN |
denotes |
skin |
| T7464 |
34426-34439 |
NNS |
denotes |
keratinocytes |
| T7466 |
34440-34444 |
WDT |
denotes |
that |
| T7467 |
34445-34452 |
VBP |
denotes |
secrete |
| T7468 |
34453-34459 |
JJ |
denotes |
active |
| T7469 |
34460-34464 |
NNS |
denotes |
BMPs |
| T7470 |
34465-34468 |
CC |
denotes |
and |
| T7471 |
34469-34473 |
NNS |
denotes |
FGFs |
| T7472 |
34474-34475 |
-LRB- |
denotes |
( |
| T7473 |
34475-34478 |
VB |
denotes |
see |
| T7474 |
34479-34485 |
NN |
denotes |
Figure |
| T7475 |
34486-34488 |
NN |
denotes |
1B |
| T7476 |
34488-34489 |
-RRB- |
denotes |
) |
| T7477 |
34489-34491 |
, |
denotes |
, |
| T7478 |
34491-34493 |
PRP |
denotes |
we |
| T7461 |
34494-34501 |
VBD |
denotes |
focused |
| T7479 |
34502-34505 |
PRP$ |
denotes |
our |
| T7480 |
34506-34515 |
NN |
denotes |
attention |
| T7481 |
34516-34518 |
IN |
denotes |
on |
| T7482 |
34519-34522 |
NN |
denotes |
Wnt |
| T7484 |
34523-34526 |
CC |
denotes |
and |
| T7485 |
34527-34530 |
NN |
denotes |
TGF |
| T7487 |
34530-34531 |
HYPH |
denotes |
- |
| T7486 |
34531-34532 |
NN |
denotes |
β |
| T7483 |
34533-34542 |
NN |
denotes |
signaling |
| T7488 |
34543-34545 |
IN |
denotes |
as |
| T7489 |
34546-34550 |
RBR |
denotes |
more |
| T7490 |
34551-34557 |
JJ |
denotes |
likely |
| T7491 |
34558-34568 |
NNS |
denotes |
candidates |
| T7492 |
34569-34572 |
IN |
denotes |
for |
| T7493 |
34573-34578 |
NN |
denotes |
Snail |
| T7494 |
34579-34588 |
NN |
denotes |
induction |
| T7495 |
34589-34591 |
IN |
denotes |
in |
| T7496 |
34592-34596 |
DT |
denotes |
this |
| T7498 |
34597-34601 |
NN |
denotes |
cell |
| T7497 |
34602-34606 |
NN |
denotes |
type |
| T7499 |
34606-34607 |
. |
denotes |
. |
| T7500 |
34607-34806 |
sentence |
denotes |
Previously, we showed that effective transmission of a Wnt-3a signal in cultured keratinocytes can be achieved through their exposure to the BMP inhibitor noggin, which induces LEF-1 expression [4]. |
| T7501 |
34608-34618 |
RB |
denotes |
Previously |
| T7503 |
34618-34620 |
, |
denotes |
, |
| T7504 |
34620-34622 |
PRP |
denotes |
we |
| T7502 |
34623-34629 |
VBD |
denotes |
showed |
| T7505 |
34630-34634 |
IN |
denotes |
that |
| T7507 |
34635-34644 |
JJ |
denotes |
effective |
| T7508 |
34645-34657 |
NN |
denotes |
transmission |
| T7509 |
34658-34660 |
IN |
denotes |
of |
| T7510 |
34661-34662 |
DT |
denotes |
a |
| T7512 |
34663-34666 |
NN |
denotes |
Wnt |
| T7513 |
34666-34667 |
HYPH |
denotes |
- |
| T7514 |
34667-34669 |
CD |
denotes |
3a |
| T7511 |
34670-34676 |
NN |
denotes |
signal |
| T7515 |
34677-34679 |
IN |
denotes |
in |
| T7516 |
34680-34688 |
VBN |
denotes |
cultured |
| T7517 |
34689-34702 |
NNS |
denotes |
keratinocytes |
| T7518 |
34703-34706 |
MD |
denotes |
can |
| T7519 |
34707-34709 |
VB |
denotes |
be |
| T7506 |
34710-34718 |
VBN |
denotes |
achieved |
| T7520 |
34719-34726 |
IN |
denotes |
through |
| T7521 |
34727-34732 |
PRP$ |
denotes |
their |
| T7522 |
34733-34741 |
NN |
denotes |
exposure |
| T7523 |
34742-34744 |
IN |
denotes |
to |
| T7524 |
34745-34748 |
DT |
denotes |
the |
| T7526 |
34749-34752 |
NN |
denotes |
BMP |
| T7525 |
34753-34762 |
NN |
denotes |
inhibitor |
| T7527 |
34763-34769 |
NN |
denotes |
noggin |
| T7528 |
34769-34771 |
, |
denotes |
, |
| T7529 |
34771-34776 |
WDT |
denotes |
which |
| T7530 |
34777-34784 |
VBZ |
denotes |
induces |
| T7531 |
34785-34788 |
NN |
denotes |
LEF |
| T7533 |
34788-34789 |
HYPH |
denotes |
- |
| T7534 |
34789-34790 |
CD |
denotes |
1 |
| T7532 |
34791-34801 |
NN |
denotes |
expression |
| T7535 |
34802-34803 |
-LRB- |
denotes |
[ |
| T7536 |
34803-34804 |
CD |
denotes |
4 |
| T7537 |
34804-34805 |
-RRB- |
denotes |
] |
| T7538 |
34805-34806 |
. |
denotes |
. |
| T7539 |
34806-34941 |
sentence |
denotes |
In vitro, these conditions down-regulated the E-cadherin promoter and induced a LEF-1/β-catenin-sensitive reporter gene, TOPFLASH [4]. |
| T7540 |
34807-34809 |
FW |
denotes |
In |
| T7541 |
34810-34815 |
FW |
denotes |
vitro |
| T7543 |
34815-34817 |
, |
denotes |
, |
| T7544 |
34817-34822 |
DT |
denotes |
these |
| T7545 |
34823-34833 |
NNS |
denotes |
conditions |
| T7546 |
34834-34838 |
RB |
denotes |
down |
| T7547 |
34838-34839 |
HYPH |
denotes |
- |
| T7542 |
34839-34848 |
VBD |
denotes |
regulated |
| T7548 |
34849-34852 |
DT |
denotes |
the |
| T7550 |
34853-34854 |
NN |
denotes |
E |
| T7552 |
34854-34855 |
HYPH |
denotes |
- |
| T7551 |
34855-34863 |
NN |
denotes |
cadherin |
| T7549 |
34864-34872 |
NN |
denotes |
promoter |
| T7553 |
34873-34876 |
CC |
denotes |
and |
| T7554 |
34877-34884 |
VBD |
denotes |
induced |
| T7555 |
34885-34886 |
DT |
denotes |
a |
| T7557 |
34887-34890 |
NN |
denotes |
LEF |
| T7559 |
34890-34891 |
HYPH |
denotes |
- |
| T7560 |
34891-34892 |
CD |
denotes |
1 |
| T7561 |
34892-34893 |
HYPH |
denotes |
/ |
| T7562 |
34893-34894 |
NN |
denotes |
β |
| T7564 |
34894-34895 |
HYPH |
denotes |
- |
| T7563 |
34895-34902 |
NN |
denotes |
catenin |
| T7565 |
34902-34903 |
HYPH |
denotes |
- |
| T7558 |
34903-34912 |
JJ |
denotes |
sensitive |
| T7566 |
34913-34921 |
NN |
denotes |
reporter |
| T7556 |
34922-34926 |
NN |
denotes |
gene |
| T7567 |
34926-34928 |
, |
denotes |
, |
| T7568 |
34928-34936 |
NN |
denotes |
TOPFLASH |
| T7569 |
34937-34938 |
-LRB- |
denotes |
[ |
| T7570 |
34938-34939 |
CD |
denotes |
4 |
| T7571 |
34939-34940 |
-RRB- |
denotes |
] |
| T7572 |
34940-34941 |
. |
denotes |
. |
| T7573 |
34941-35020 |
sentence |
denotes |
In contrast, Snail expression was not induced by these conditions (Figure 5A). |
| T7574 |
34942-34944 |
IN |
denotes |
In |
| T7576 |
34945-34953 |
NN |
denotes |
contrast |
| T7577 |
34953-34955 |
, |
denotes |
, |
| T7578 |
34955-34960 |
NN |
denotes |
Snail |
| T7579 |
34961-34971 |
NN |
denotes |
expression |
| T7580 |
34972-34975 |
VBD |
denotes |
was |
| T7581 |
34976-34979 |
RB |
denotes |
not |
| T7575 |
34980-34987 |
VBN |
denotes |
induced |
| T7582 |
34988-34990 |
IN |
denotes |
by |
| T7583 |
34991-34996 |
DT |
denotes |
these |
| T7584 |
34997-35007 |
NNS |
denotes |
conditions |
| T7585 |
35008-35009 |
-LRB- |
denotes |
( |
| T7587 |
35009-35015 |
NN |
denotes |
Figure |
| T7586 |
35016-35018 |
NN |
denotes |
5A |
| T7588 |
35018-35019 |
-RRB- |
denotes |
) |
| T7589 |
35019-35020 |
. |
denotes |
. |
| T7590 |
35020-35224 |
sentence |
denotes |
Thus, despite essential roles for Wnts and noggin in hair follicle specification [4,29,30], our studies did not support an essential role for these signals in governing Snail expression in keratinocytes. |
| T7591 |
35021-35025 |
RB |
denotes |
Thus |
| T7593 |
35025-35027 |
, |
denotes |
, |
| T7594 |
35027-35034 |
IN |
denotes |
despite |
| T7595 |
35035-35044 |
JJ |
denotes |
essential |
| T7596 |
35045-35050 |
NNS |
denotes |
roles |
| T7597 |
35051-35054 |
IN |
denotes |
for |
| T7598 |
35055-35059 |
NNS |
denotes |
Wnts |
| T7599 |
35060-35063 |
CC |
denotes |
and |
| T7600 |
35064-35070 |
NN |
denotes |
noggin |
| T7601 |
35071-35073 |
IN |
denotes |
in |
| T7602 |
35074-35078 |
NN |
denotes |
hair |
| T7603 |
35079-35087 |
NN |
denotes |
follicle |
| T7604 |
35088-35101 |
NN |
denotes |
specification |
| T7605 |
35102-35103 |
-LRB- |
denotes |
[ |
| T7607 |
35103-35104 |
CD |
denotes |
4 |
| T7608 |
35104-35105 |
, |
denotes |
, |
| T7609 |
35105-35107 |
CD |
denotes |
29 |
| T7610 |
35107-35108 |
, |
denotes |
, |
| T7606 |
35108-35110 |
CD |
denotes |
30 |
| T7611 |
35110-35111 |
-RRB- |
denotes |
] |
| T7612 |
35111-35113 |
, |
denotes |
, |
| T7613 |
35113-35116 |
PRP$ |
denotes |
our |
| T7614 |
35117-35124 |
NNS |
denotes |
studies |
| T7615 |
35125-35128 |
VBD |
denotes |
did |
| T7616 |
35129-35132 |
RB |
denotes |
not |
| T7592 |
35133-35140 |
VB |
denotes |
support |
| T7617 |
35141-35143 |
DT |
denotes |
an |
| T7619 |
35144-35153 |
JJ |
denotes |
essential |
| T7618 |
35154-35158 |
NN |
denotes |
role |
| T7620 |
35159-35162 |
IN |
denotes |
for |
| T7621 |
35163-35168 |
DT |
denotes |
these |
| T7622 |
35169-35176 |
NNS |
denotes |
signals |
| T7623 |
35177-35179 |
IN |
denotes |
in |
| T7624 |
35180-35189 |
VBG |
denotes |
governing |
| T7625 |
35190-35195 |
NN |
denotes |
Snail |
| T7626 |
35196-35206 |
NN |
denotes |
expression |
| T7627 |
35207-35209 |
IN |
denotes |
in |
| T7628 |
35210-35223 |
NNS |
denotes |
keratinocytes |
| T7629 |
35223-35224 |
. |
denotes |
. |
| T7630 |
35224-37423 |
sentence |
denotes |
Figure 5 TGF-β2, but Not Wnt/noggin, Transiently Induces Snail Expression In Vitro
(A) Failure of Wnt and noggin signaling to induce Snail in cultured keratinocytes. Primary mouse keratinocytes were treated with Wnt- and/or noggin-conditioned medium (+) or the corresponding control medium (–). These conditions are known to activate the LEF-1/β-catenin reporter TOPGal and down-regulate the E-cadherin promoter (see [4] for details). Using Western blot analyses, cellular proteins were then analyzed for Snail, LEF-1, β-catenin, and tubulin. Proteins from keratinocytes transfected with K14-Snail were used as a positive control for Snail expression.
(B) TGF-β2 can induce Snail protein. Primary keratinocytes were treated for the indicated times with recombinant TGF-β2 (+) or heat inactivated TGF-β2 (–).Total cellular proteins were then isolated and analyzed by Western blot for Snail, pSMAD2 (reflective of activated TGF- signaling), and tubulin. Note the activation of Snail expression, peaking at 2 h post-TGF-β2 treatment and then disappearing thereafter.
(C) Snail mRNA expression is transiently induced by TGF-β2. The experiment in (B) was repeated, and this time, total RNAs were isolated from keratinocytes treated with TGF-β2 for the indicated times. RT-PCR was then used with (+) or without (–) reverse transcriptase (RT) and with primer sets specific for Snail and GAPDH mRNAs. Note that Snail mRNA expression also peaked at 2 h, paralleling Snail protein.
(D) TGF-β2 treatment results in enhanced activity of a Snail promoter-β-galactosidase reporter. Keratinocytes were transfected with a β-galactosidase reporter driven by a Snail promoter that is either WT (wt prom) or harbors a mutation in a putative pSMAD2/pSMAD4 binding site (mt prom). At 2 d posttransfection, cells were treated with either TGF-β or heat-inactivated TGF-β2 (inact) for the times indicated. β-galactosidase assays were then conducted, and results are reported as fold increase over a basal level of activity of 1. The experiment was repeated three times in triplicate, and error bars reflect variations in the results. TGF-β1 has been shown to induce Snail family members in hepatocytes and heart [15, 31]. |
| T7631 |
37336-37339 |
NN |
denotes |
TGF |
| T7633 |
37339-37340 |
HYPH |
denotes |
- |
| T7632 |
37340-37342 |
NN |
denotes |
β1 |
| T7635 |
37343-37346 |
VBZ |
denotes |
has |
| T7636 |
37347-37351 |
VBN |
denotes |
been |
| T7634 |
37352-37357 |
VBN |
denotes |
shown |
| T7637 |
37358-37360 |
TO |
denotes |
to |
| T7638 |
37361-37367 |
VB |
denotes |
induce |
| T7639 |
37368-37373 |
NN |
denotes |
Snail |
| T7641 |
37374-37380 |
NN |
denotes |
family |
| T7640 |
37381-37388 |
NNS |
denotes |
members |
| T7642 |
37389-37391 |
IN |
denotes |
in |
| T7643 |
37392-37403 |
NNS |
denotes |
hepatocytes |
| T7644 |
37404-37407 |
CC |
denotes |
and |
| T7645 |
37408-37413 |
NN |
denotes |
heart |
| T7646 |
37414-37415 |
-LRB- |
denotes |
[ |
| T7648 |
37415-37417 |
CD |
denotes |
15 |
| T7649 |
37417-37419 |
, |
denotes |
, |
| T7647 |
37419-37421 |
CD |
denotes |
31 |
| T7650 |
37421-37422 |
-RRB- |
denotes |
] |
| T7651 |
37422-37423 |
. |
denotes |
. |
| T7652 |
37423-37582 |
sentence |
denotes |
In keratinocytes, however, TGF-β1 inhibits keratinocyte growth and seems to be involved in triggering the destructive phase of the cycling hair follicle [32]. |
| T7653 |
37424-37426 |
IN |
denotes |
In |
| T7655 |
37427-37440 |
NNS |
denotes |
keratinocytes |
| T7656 |
37440-37442 |
, |
denotes |
, |
| T7657 |
37442-37449 |
RB |
denotes |
however |
| T7658 |
37449-37451 |
, |
denotes |
, |
| T7659 |
37451-37454 |
NN |
denotes |
TGF |
| T7661 |
37454-37455 |
HYPH |
denotes |
- |
| T7660 |
37455-37457 |
NN |
denotes |
β1 |
| T7654 |
37458-37466 |
VBZ |
denotes |
inhibits |
| T7662 |
37467-37479 |
NN |
denotes |
keratinocyte |
| T7663 |
37480-37486 |
NN |
denotes |
growth |
| T7664 |
37487-37490 |
CC |
denotes |
and |
| T7665 |
37491-37496 |
VBZ |
denotes |
seems |
| T7666 |
37497-37499 |
TO |
denotes |
to |
| T7668 |
37500-37502 |
VB |
denotes |
be |
| T7667 |
37503-37511 |
VBN |
denotes |
involved |
| T7669 |
37512-37514 |
IN |
denotes |
in |
| T7670 |
37515-37525 |
VBG |
denotes |
triggering |
| T7671 |
37526-37529 |
DT |
denotes |
the |
| T7673 |
37530-37541 |
JJ |
denotes |
destructive |
| T7672 |
37542-37547 |
NN |
denotes |
phase |
| T7674 |
37548-37550 |
IN |
denotes |
of |
| T7675 |
37551-37554 |
DT |
denotes |
the |
| T7677 |
37555-37562 |
VBG |
denotes |
cycling |
| T7678 |
37563-37567 |
NN |
denotes |
hair |
| T7676 |
37568-37576 |
NN |
denotes |
follicle |
| T7679 |
37577-37578 |
-LRB- |
denotes |
[ |
| T7680 |
37578-37580 |
CD |
denotes |
32 |
| T7681 |
37580-37581 |
-RRB- |
denotes |
] |
| T7682 |
37581-37582 |
. |
denotes |
. |
| T7683 |
37582-37738 |
sentence |
denotes |
Of the loss-of-function mutations generated in each of the TGF-β genes, only the TGF-β2 null state blocked follicle development at the hair bud stage [32]. |
| T7684 |
37583-37585 |
IN |
denotes |
Of |
| T7686 |
37586-37589 |
DT |
denotes |
the |
| T7688 |
37590-37594 |
NN |
denotes |
loss |
| T7689 |
37594-37595 |
HYPH |
denotes |
- |
| T7690 |
37595-37597 |
IN |
denotes |
of |
| T7691 |
37597-37598 |
HYPH |
denotes |
- |
| T7692 |
37598-37606 |
NN |
denotes |
function |
| T7687 |
37607-37616 |
NNS |
denotes |
mutations |
| T7693 |
37617-37626 |
VBN |
denotes |
generated |
| T7694 |
37627-37629 |
IN |
denotes |
in |
| T7695 |
37630-37634 |
DT |
denotes |
each |
| T7696 |
37635-37637 |
IN |
denotes |
of |
| T7697 |
37638-37641 |
DT |
denotes |
the |
| T7699 |
37642-37645 |
NN |
denotes |
TGF |
| T7701 |
37645-37646 |
HYPH |
denotes |
- |
| T7700 |
37646-37647 |
NN |
denotes |
β |
| T7698 |
37648-37653 |
NNS |
denotes |
genes |
| T7702 |
37653-37655 |
, |
denotes |
, |
| T7703 |
37655-37659 |
RB |
denotes |
only |
| T7705 |
37660-37663 |
DT |
denotes |
the |
| T7706 |
37664-37667 |
NN |
denotes |
TGF |
| T7708 |
37667-37668 |
HYPH |
denotes |
- |
| T7707 |
37668-37670 |
NN |
denotes |
β2 |
| T7709 |
37671-37675 |
JJ |
denotes |
null |
| T7704 |
37676-37681 |
NN |
denotes |
state |
| T7685 |
37682-37689 |
VBD |
denotes |
blocked |
| T7710 |
37690-37698 |
NN |
denotes |
follicle |
| T7711 |
37699-37710 |
NN |
denotes |
development |
| T7712 |
37711-37713 |
IN |
denotes |
at |
| T7713 |
37714-37717 |
DT |
denotes |
the |
| T7715 |
37718-37722 |
NN |
denotes |
hair |
| T7716 |
37723-37726 |
NN |
denotes |
bud |
| T7714 |
37727-37732 |
NN |
denotes |
stage |
| T7717 |
37733-37734 |
-LRB- |
denotes |
[ |
| T7718 |
37734-37736 |
CD |
denotes |
32 |
| T7719 |
37736-37737 |
-RRB- |
denotes |
] |
| T7720 |
37737-37738 |
. |
denotes |
. |
| T7721 |
37738-37902 |
sentence |
denotes |
Thus, we turned towards addressing whether TGF-β2 might be involved in regulating Snail expression in keratinocytes isolated from the basal layer of the epidermis. |
| T7722 |
37739-37743 |
RB |
denotes |
Thus |
| T7724 |
37743-37745 |
, |
denotes |
, |
| T7725 |
37745-37747 |
PRP |
denotes |
we |
| T7723 |
37748-37754 |
VBD |
denotes |
turned |
| T7726 |
37755-37762 |
IN |
denotes |
towards |
| T7727 |
37763-37773 |
VBG |
denotes |
addressing |
| T7728 |
37774-37781 |
IN |
denotes |
whether |
| T7730 |
37782-37785 |
NN |
denotes |
TGF |
| T7732 |
37785-37786 |
HYPH |
denotes |
- |
| T7731 |
37786-37788 |
NN |
denotes |
β2 |
| T7733 |
37789-37794 |
MD |
denotes |
might |
| T7734 |
37795-37797 |
VB |
denotes |
be |
| T7729 |
37798-37806 |
VBN |
denotes |
involved |
| T7735 |
37807-37809 |
IN |
denotes |
in |
| T7736 |
37810-37820 |
VBG |
denotes |
regulating |
| T7737 |
37821-37826 |
NN |
denotes |
Snail |
| T7738 |
37827-37837 |
NN |
denotes |
expression |
| T7739 |
37838-37840 |
IN |
denotes |
in |
| T7740 |
37841-37854 |
NNS |
denotes |
keratinocytes |
| T7741 |
37855-37863 |
VBN |
denotes |
isolated |
| T7742 |
37864-37868 |
IN |
denotes |
from |
| T7743 |
37869-37872 |
DT |
denotes |
the |
| T7745 |
37873-37878 |
JJ |
denotes |
basal |
| T7744 |
37879-37884 |
NN |
denotes |
layer |
| T7746 |
37885-37887 |
IN |
denotes |
of |
| T7747 |
37888-37891 |
DT |
denotes |
the |
| T7748 |
37892-37901 |
NN |
denotes |
epidermis |
| T7749 |
37901-37902 |
. |
denotes |
. |
| T7750 |
37902-38133 |
sentence |
denotes |
Though there is no cell culture system available to specifically study placodal cells, these keratinocytes are their progenitors and are the closest approximation available to study the behavior of epithelial cells of the placode. |
| T7751 |
37903-37909 |
IN |
denotes |
Though |
| T7753 |
37910-37915 |
EX |
denotes |
there |
| T7752 |
37916-37918 |
VBZ |
denotes |
is |
| T7755 |
37919-37921 |
DT |
denotes |
no |
| T7757 |
37922-37926 |
NN |
denotes |
cell |
| T7758 |
37927-37934 |
NN |
denotes |
culture |
| T7756 |
37935-37941 |
NN |
denotes |
system |
| T7759 |
37942-37951 |
JJ |
denotes |
available |
| T7760 |
37952-37954 |
TO |
denotes |
to |
| T7762 |
37955-37967 |
RB |
denotes |
specifically |
| T7761 |
37968-37973 |
VB |
denotes |
study |
| T7763 |
37974-37982 |
JJ |
denotes |
placodal |
| T7764 |
37983-37988 |
NNS |
denotes |
cells |
| T7765 |
37988-37990 |
, |
denotes |
, |
| T7766 |
37990-37995 |
DT |
denotes |
these |
| T7767 |
37996-38009 |
NNS |
denotes |
keratinocytes |
| T7754 |
38010-38013 |
VBP |
denotes |
are |
| T7768 |
38014-38019 |
PRP$ |
denotes |
their |
| T7769 |
38020-38031 |
NNS |
denotes |
progenitors |
| T7770 |
38032-38035 |
CC |
denotes |
and |
| T7771 |
38036-38039 |
VBP |
denotes |
are |
| T7772 |
38040-38043 |
DT |
denotes |
the |
| T7774 |
38044-38051 |
JJS |
denotes |
closest |
| T7773 |
38052-38065 |
NN |
denotes |
approximation |
| T7775 |
38066-38075 |
JJ |
denotes |
available |
| T7776 |
38076-38078 |
TO |
denotes |
to |
| T7777 |
38079-38084 |
VB |
denotes |
study |
| T7778 |
38085-38088 |
DT |
denotes |
the |
| T7779 |
38089-38097 |
NN |
denotes |
behavior |
| T7780 |
38098-38100 |
IN |
denotes |
of |
| T7781 |
38101-38111 |
JJ |
denotes |
epithelial |
| T7782 |
38112-38117 |
NNS |
denotes |
cells |
| T7783 |
38118-38120 |
IN |
denotes |
of |
| T7784 |
38121-38124 |
DT |
denotes |
the |
| T7785 |
38125-38132 |
NN |
denotes |
placode |
| T7786 |
38132-38133 |
. |
denotes |
. |
| T7787 |
38133-38281 |
sentence |
denotes |
Interestingly, treatment of cultured keratinocytes with as little as 5 ng/ml of TGF-β2 caused a rapid and transient induction of Snail (Figure 5B). |
| T7788 |
38134-38147 |
RB |
denotes |
Interestingly |
| T7790 |
38147-38149 |
, |
denotes |
, |
| T7791 |
38149-38158 |
NN |
denotes |
treatment |
| T7792 |
38159-38161 |
IN |
denotes |
of |
| T7793 |
38162-38170 |
VBN |
denotes |
cultured |
| T7794 |
38171-38184 |
NNS |
denotes |
keratinocytes |
| T7795 |
38185-38189 |
IN |
denotes |
with |
| T7796 |
38190-38192 |
RB |
denotes |
as |
| T7798 |
38193-38199 |
JJ |
denotes |
little |
| T7799 |
38200-38202 |
IN |
denotes |
as |
| T7797 |
38203-38204 |
CD |
denotes |
5 |
| T7800 |
38205-38207 |
NN |
denotes |
ng |
| T7801 |
38207-38208 |
SYM |
denotes |
/ |
| T7802 |
38208-38210 |
NN |
denotes |
ml |
| T7803 |
38211-38213 |
IN |
denotes |
of |
| T7804 |
38214-38217 |
NN |
denotes |
TGF |
| T7806 |
38217-38218 |
HYPH |
denotes |
- |
| T7805 |
38218-38220 |
NN |
denotes |
β2 |
| T7789 |
38221-38227 |
VBD |
denotes |
caused |
| T7807 |
38228-38229 |
DT |
denotes |
a |
| T7809 |
38230-38235 |
JJ |
denotes |
rapid |
| T7810 |
38236-38239 |
CC |
denotes |
and |
| T7811 |
38240-38249 |
JJ |
denotes |
transient |
| T7808 |
38250-38259 |
NN |
denotes |
induction |
| T7812 |
38260-38262 |
IN |
denotes |
of |
| T7813 |
38263-38268 |
NN |
denotes |
Snail |
| T7814 |
38269-38270 |
-LRB- |
denotes |
( |
| T7816 |
38270-38276 |
NN |
denotes |
Figure |
| T7815 |
38277-38279 |
NN |
denotes |
5B |
| T7817 |
38279-38280 |
-RRB- |
denotes |
) |
| T7818 |
38280-38281 |
. |
denotes |
. |
| T7819 |
38281-38394 |
sentence |
denotes |
Following this treatment, Snail protein was detected within 30 min, peaked at 2 h, and then declined thereafter. |
| T7820 |
38282-38291 |
VBG |
denotes |
Following |
| T7822 |
38292-38296 |
DT |
denotes |
this |
| T7823 |
38297-38306 |
NN |
denotes |
treatment |
| T7824 |
38306-38308 |
, |
denotes |
, |
| T7825 |
38308-38313 |
NN |
denotes |
Snail |
| T7826 |
38314-38321 |
NN |
denotes |
protein |
| T7827 |
38322-38325 |
VBD |
denotes |
was |
| T7821 |
38326-38334 |
VBN |
denotes |
detected |
| T7828 |
38335-38341 |
IN |
denotes |
within |
| T7829 |
38342-38344 |
CD |
denotes |
30 |
| T7830 |
38345-38348 |
NN |
denotes |
min |
| T7831 |
38348-38350 |
, |
denotes |
, |
| T7832 |
38350-38356 |
VBD |
denotes |
peaked |
| T7833 |
38357-38359 |
IN |
denotes |
at |
| T7834 |
38360-38361 |
CD |
denotes |
2 |
| T7835 |
38362-38363 |
NN |
denotes |
h |
| T7836 |
38363-38365 |
, |
denotes |
, |
| T7837 |
38365-38368 |
CC |
denotes |
and |
| T7838 |
38369-38373 |
RB |
denotes |
then |
| T7839 |
38374-38382 |
VBD |
denotes |
declined |
| T7840 |
38383-38393 |
RB |
denotes |
thereafter |
| T7841 |
38393-38394 |
. |
denotes |
. |
| T7842 |
38394-38586 |
sentence |
denotes |
The induction of Snail appeared to be specific for the active form of the growth factor, as pretreatment of TGF-β2 for 10 min at 100 °C obliterated the response [Figure 5B, lanes marked (–)]. |
| T7843 |
38395-38398 |
DT |
denotes |
The |
| T7844 |
38399-38408 |
NN |
denotes |
induction |
| T7846 |
38409-38411 |
IN |
denotes |
of |
| T7847 |
38412-38417 |
NN |
denotes |
Snail |
| T7845 |
38418-38426 |
VBD |
denotes |
appeared |
| T7848 |
38427-38429 |
TO |
denotes |
to |
| T7849 |
38430-38432 |
VB |
denotes |
be |
| T7850 |
38433-38441 |
JJ |
denotes |
specific |
| T7851 |
38442-38445 |
IN |
denotes |
for |
| T7852 |
38446-38449 |
DT |
denotes |
the |
| T7854 |
38450-38456 |
JJ |
denotes |
active |
| T7853 |
38457-38461 |
NN |
denotes |
form |
| T7855 |
38462-38464 |
IN |
denotes |
of |
| T7856 |
38465-38468 |
DT |
denotes |
the |
| T7858 |
38469-38475 |
NN |
denotes |
growth |
| T7857 |
38476-38482 |
NN |
denotes |
factor |
| T7859 |
38482-38484 |
, |
denotes |
, |
| T7860 |
38484-38486 |
IN |
denotes |
as |
| T7862 |
38487-38499 |
NN |
denotes |
pretreatment |
| T7863 |
38500-38502 |
IN |
denotes |
of |
| T7864 |
38503-38506 |
NN |
denotes |
TGF |
| T7866 |
38506-38507 |
HYPH |
denotes |
- |
| T7865 |
38507-38509 |
NN |
denotes |
β2 |
| T7867 |
38510-38513 |
IN |
denotes |
for |
| T7868 |
38514-38516 |
CD |
denotes |
10 |
| T7869 |
38517-38520 |
NN |
denotes |
min |
| T7870 |
38521-38523 |
IN |
denotes |
at |
| T7871 |
38524-38527 |
CD |
denotes |
100 |
| T7872 |
38528-38530 |
NN |
denotes |
°C |
| T7861 |
38531-38542 |
VBD |
denotes |
obliterated |
| T7873 |
38543-38546 |
DT |
denotes |
the |
| T7874 |
38547-38555 |
NN |
denotes |
response |
| T7875 |
38556-38557 |
-LRB- |
denotes |
[ |
| T7877 |
38557-38563 |
NN |
denotes |
Figure |
| T7878 |
38564-38566 |
NN |
denotes |
5B |
| T7879 |
38566-38568 |
, |
denotes |
, |
| T7876 |
38568-38573 |
NNS |
denotes |
lanes |
| T7880 |
38574-38580 |
VBN |
denotes |
marked |
| T7881 |
38581-38582 |
-LRB- |
denotes |
( |
| T7882 |
38582-38583 |
SYM |
denotes |
– |
| T7883 |
38583-38584 |
-RRB- |
denotes |
) |
| T7884 |
38584-38585 |
-RRB- |
denotes |
] |
| T7885 |
38585-38586 |
. |
denotes |
. |
| T7886 |
38586-38824 |
sentence |
denotes |
By contrast, although TGF-β receptor activation remained elevated during the duration of the experiment (as measured by the sustained phosphorylation of the downstream effector SMAD2) Snail expression could not be maintained (Figure 5B). |
| T7887 |
38587-38589 |
IN |
denotes |
By |
| T7889 |
38590-38598 |
NN |
denotes |
contrast |
| T7890 |
38598-38600 |
, |
denotes |
, |
| T7891 |
38600-38608 |
IN |
denotes |
although |
| T7893 |
38609-38612 |
NN |
denotes |
TGF |
| T7895 |
38612-38613 |
HYPH |
denotes |
- |
| T7894 |
38613-38614 |
NN |
denotes |
β |
| T7896 |
38615-38623 |
NN |
denotes |
receptor |
| T7897 |
38624-38634 |
NN |
denotes |
activation |
| T7892 |
38635-38643 |
VBD |
denotes |
remained |
| T7898 |
38644-38652 |
JJ |
denotes |
elevated |
| T7899 |
38653-38659 |
IN |
denotes |
during |
| T7900 |
38660-38663 |
DT |
denotes |
the |
| T7901 |
38664-38672 |
NN |
denotes |
duration |
| T7902 |
38673-38675 |
IN |
denotes |
of |
| T7903 |
38676-38679 |
DT |
denotes |
the |
| T7904 |
38680-38690 |
NN |
denotes |
experiment |
| T7905 |
38691-38692 |
-LRB- |
denotes |
( |
| T7906 |
38692-38694 |
IN |
denotes |
as |
| T7907 |
38695-38703 |
VBN |
denotes |
measured |
| T7908 |
38704-38706 |
IN |
denotes |
by |
| T7909 |
38707-38710 |
DT |
denotes |
the |
| T7911 |
38711-38720 |
JJ |
denotes |
sustained |
| T7910 |
38721-38736 |
NN |
denotes |
phosphorylation |
| T7912 |
38737-38739 |
IN |
denotes |
of |
| T7913 |
38740-38743 |
DT |
denotes |
the |
| T7915 |
38744-38754 |
JJ |
denotes |
downstream |
| T7914 |
38755-38763 |
NN |
denotes |
effector |
| T7916 |
38764-38769 |
NN |
denotes |
SMAD2 |
| T7917 |
38769-38770 |
-RRB- |
denotes |
) |
| T7918 |
38771-38776 |
NN |
denotes |
Snail |
| T7919 |
38777-38787 |
NN |
denotes |
expression |
| T7920 |
38788-38793 |
MD |
denotes |
could |
| T7921 |
38794-38797 |
RB |
denotes |
not |
| T7922 |
38798-38800 |
VB |
denotes |
be |
| T7888 |
38801-38811 |
VBN |
denotes |
maintained |
| T7923 |
38812-38813 |
-LRB- |
denotes |
( |
| T7925 |
38813-38819 |
NN |
denotes |
Figure |
| T7924 |
38820-38822 |
NN |
denotes |
5B |
| T7926 |
38822-38823 |
-RRB- |
denotes |
) |
| T7927 |
38823-38824 |
. |
denotes |
. |
| T7928 |
38824-38972 |
sentence |
denotes |
Thus, although Snail expression correlated with phosphorylated SMAD2 (pSMAD2) induction, its decline seemed to rely on secondary downstream events. |
| T7929 |
38825-38829 |
RB |
denotes |
Thus |
| T7931 |
38829-38831 |
, |
denotes |
, |
| T7932 |
38831-38839 |
IN |
denotes |
although |
| T7934 |
38840-38845 |
NN |
denotes |
Snail |
| T7935 |
38846-38856 |
NN |
denotes |
expression |
| T7933 |
38857-38867 |
VBD |
denotes |
correlated |
| T7936 |
38868-38872 |
IN |
denotes |
with |
| T7937 |
38873-38887 |
VBN |
denotes |
phosphorylated |
| T7938 |
38888-38893 |
NN |
denotes |
SMAD2 |
| T7940 |
38894-38895 |
-LRB- |
denotes |
( |
| T7941 |
38895-38901 |
NN |
denotes |
pSMAD2 |
| T7942 |
38901-38902 |
-RRB- |
denotes |
) |
| T7939 |
38903-38912 |
NN |
denotes |
induction |
| T7943 |
38912-38914 |
, |
denotes |
, |
| T7944 |
38914-38917 |
PRP$ |
denotes |
its |
| T7945 |
38918-38925 |
NN |
denotes |
decline |
| T7930 |
38926-38932 |
VBD |
denotes |
seemed |
| T7946 |
38933-38935 |
TO |
denotes |
to |
| T7947 |
38936-38940 |
VB |
denotes |
rely |
| T7948 |
38941-38943 |
IN |
denotes |
on |
| T7949 |
38944-38953 |
JJ |
denotes |
secondary |
| T7951 |
38954-38964 |
JJ |
denotes |
downstream |
| T7950 |
38965-38971 |
NNS |
denotes |
events |
| T7952 |
38971-38972 |
. |
denotes |
. |
| T7953 |
38972-39154 |
sentence |
denotes |
The rapid kinetics of Snail expression were reflected at the mRNA level, suggesting that Snail promoter activity in keratinocytes might be sensitive to TGF-β2 signaling (Figure 5C). |
| T7954 |
38973-38976 |
DT |
denotes |
The |
| T7956 |
38977-38982 |
JJ |
denotes |
rapid |
| T7955 |
38983-38991 |
NNS |
denotes |
kinetics |
| T7958 |
38992-38994 |
IN |
denotes |
of |
| T7959 |
38995-39000 |
NN |
denotes |
Snail |
| T7960 |
39001-39011 |
NN |
denotes |
expression |
| T7961 |
39012-39016 |
VBD |
denotes |
were |
| T7957 |
39017-39026 |
VBN |
denotes |
reflected |
| T7962 |
39027-39029 |
IN |
denotes |
at |
| T7963 |
39030-39033 |
DT |
denotes |
the |
| T7965 |
39034-39038 |
NN |
denotes |
mRNA |
| T7964 |
39039-39044 |
NN |
denotes |
level |
| T7966 |
39044-39046 |
, |
denotes |
, |
| T7967 |
39046-39056 |
VBG |
denotes |
suggesting |
| T7968 |
39057-39061 |
IN |
denotes |
that |
| T7970 |
39062-39067 |
NN |
denotes |
Snail |
| T7971 |
39068-39076 |
NN |
denotes |
promoter |
| T7972 |
39077-39085 |
NN |
denotes |
activity |
| T7973 |
39086-39088 |
IN |
denotes |
in |
| T7974 |
39089-39102 |
NNS |
denotes |
keratinocytes |
| T7975 |
39103-39108 |
MD |
denotes |
might |
| T7969 |
39109-39111 |
VB |
denotes |
be |
| T7976 |
39112-39121 |
JJ |
denotes |
sensitive |
| T7977 |
39122-39124 |
IN |
denotes |
to |
| T7978 |
39125-39128 |
NN |
denotes |
TGF |
| T7980 |
39128-39129 |
HYPH |
denotes |
- |
| T7979 |
39129-39131 |
NN |
denotes |
β2 |
| T7981 |
39132-39141 |
NN |
denotes |
signaling |
| T7982 |
39142-39143 |
-LRB- |
denotes |
( |
| T7984 |
39143-39149 |
NN |
denotes |
Figure |
| T7983 |
39150-39152 |
NN |
denotes |
5C |
| T7985 |
39152-39153 |
-RRB- |
denotes |
) |
| T7986 |
39153-39154 |
. |
denotes |
. |
| T7987 |
39154-39381 |
sentence |
denotes |
To test this possibility, we engineered a transgene driving the β-galactosidase reporter under the control of approximately 2.2 kb of promoter sequence located 5′ from the transcription initiation site of the mouse Snail gene. |
| T7988 |
39155-39157 |
TO |
denotes |
To |
| T7989 |
39158-39162 |
VB |
denotes |
test |
| T7991 |
39163-39167 |
DT |
denotes |
this |
| T7992 |
39168-39179 |
NN |
denotes |
possibility |
| T7993 |
39179-39181 |
, |
denotes |
, |
| T7994 |
39181-39183 |
PRP |
denotes |
we |
| T7990 |
39184-39194 |
VBD |
denotes |
engineered |
| T7995 |
39195-39196 |
DT |
denotes |
a |
| T7996 |
39197-39206 |
NN |
denotes |
transgene |
| T7997 |
39207-39214 |
VBG |
denotes |
driving |
| T7998 |
39215-39218 |
DT |
denotes |
the |
| T8000 |
39219-39220 |
NN |
denotes |
β |
| T8002 |
39220-39221 |
HYPH |
denotes |
- |
| T8001 |
39221-39234 |
NN |
denotes |
galactosidase |
| T7999 |
39235-39243 |
NN |
denotes |
reporter |
| T8003 |
39244-39249 |
IN |
denotes |
under |
| T8004 |
39250-39253 |
DT |
denotes |
the |
| T8005 |
39254-39261 |
NN |
denotes |
control |
| T8006 |
39262-39264 |
IN |
denotes |
of |
| T8007 |
39265-39278 |
RB |
denotes |
approximately |
| T8008 |
39279-39282 |
CD |
denotes |
2.2 |
| T8009 |
39283-39285 |
NN |
denotes |
kb |
| T8010 |
39286-39288 |
IN |
denotes |
of |
| T8011 |
39289-39297 |
NN |
denotes |
promoter |
| T8012 |
39298-39306 |
NN |
denotes |
sequence |
| T8013 |
39307-39314 |
VBN |
denotes |
located |
| T8014 |
39315-39316 |
CD |
denotes |
5 |
| T8015 |
39316-39317 |
SYM |
denotes |
′ |
| T8016 |
39318-39322 |
IN |
denotes |
from |
| T8017 |
39323-39326 |
DT |
denotes |
the |
| T8019 |
39327-39340 |
NN |
denotes |
transcription |
| T8020 |
39341-39351 |
NN |
denotes |
initiation |
| T8018 |
39352-39356 |
NN |
denotes |
site |
| T8021 |
39357-39359 |
IN |
denotes |
of |
| T8022 |
39360-39363 |
DT |
denotes |
the |
| T8024 |
39364-39369 |
NN |
denotes |
mouse |
| T8025 |
39370-39375 |
NN |
denotes |
Snail |
| T8023 |
39376-39380 |
NN |
denotes |
gene |
| T8026 |
39380-39381 |
. |
denotes |
. |
| T8027 |
39381-39581 |
sentence |
denotes |
At 2 d after transient transfection, keratinocytes were treated with TGF-β2 (t = 0) and then assayed for transgene activity over the same time course in which we had observed Snail protein induction. |
| T8028 |
39382-39384 |
IN |
denotes |
At |
| T8030 |
39385-39386 |
CD |
denotes |
2 |
| T8031 |
39387-39388 |
NN |
denotes |
d |
| T8032 |
39389-39394 |
IN |
denotes |
after |
| T8033 |
39395-39404 |
JJ |
denotes |
transient |
| T8034 |
39405-39417 |
NN |
denotes |
transfection |
| T8035 |
39417-39419 |
, |
denotes |
, |
| T8036 |
39419-39432 |
NNS |
denotes |
keratinocytes |
| T8037 |
39433-39437 |
VBD |
denotes |
were |
| T8029 |
39438-39445 |
VBN |
denotes |
treated |
| T8038 |
39446-39450 |
IN |
denotes |
with |
| T8039 |
39451-39454 |
NN |
denotes |
TGF |
| T8041 |
39454-39455 |
HYPH |
denotes |
- |
| T8040 |
39455-39457 |
NN |
denotes |
β2 |
| T8042 |
39458-39459 |
-LRB- |
denotes |
( |
| T8044 |
39459-39460 |
NN |
denotes |
t |
| T8045 |
39461-39462 |
SYM |
denotes |
= |
| T8043 |
39463-39464 |
CD |
denotes |
0 |
| T8046 |
39464-39465 |
-RRB- |
denotes |
) |
| T8047 |
39466-39469 |
CC |
denotes |
and |
| T8048 |
39470-39474 |
RB |
denotes |
then |
| T8049 |
39475-39482 |
VBN |
denotes |
assayed |
| T8050 |
39483-39486 |
IN |
denotes |
for |
| T8051 |
39487-39496 |
NN |
denotes |
transgene |
| T8052 |
39497-39505 |
NN |
denotes |
activity |
| T8053 |
39506-39510 |
IN |
denotes |
over |
| T8054 |
39511-39514 |
DT |
denotes |
the |
| T8056 |
39515-39519 |
JJ |
denotes |
same |
| T8057 |
39520-39524 |
NN |
denotes |
time |
| T8055 |
39525-39531 |
NN |
denotes |
course |
| T8058 |
39532-39534 |
IN |
denotes |
in |
| T8060 |
39535-39540 |
WDT |
denotes |
which |
| T8061 |
39541-39543 |
PRP |
denotes |
we |
| T8062 |
39544-39547 |
VBD |
denotes |
had |
| T8059 |
39548-39556 |
VBN |
denotes |
observed |
| T8063 |
39557-39562 |
NN |
denotes |
Snail |
| T8064 |
39563-39570 |
NN |
denotes |
protein |
| T8065 |
39571-39580 |
NN |
denotes |
induction |
| T8066 |
39580-39581 |
. |
denotes |
. |
| T8067 |
39581-39640 |
sentence |
denotes |
The results of this experiment are presented in Figure 5D. |
| T8068 |
39582-39585 |
DT |
denotes |
The |
| T8069 |
39586-39593 |
NNS |
denotes |
results |
| T8071 |
39594-39596 |
IN |
denotes |
of |
| T8072 |
39597-39601 |
DT |
denotes |
this |
| T8073 |
39602-39612 |
NN |
denotes |
experiment |
| T8074 |
39613-39616 |
VBP |
denotes |
are |
| T8070 |
39617-39626 |
VBN |
denotes |
presented |
| T8075 |
39627-39629 |
IN |
denotes |
in |
| T8076 |
39630-39636 |
NN |
denotes |
Figure |
| T8077 |
39637-39639 |
NN |
denotes |
5D |
| T8078 |
39639-39640 |
. |
denotes |
. |
| T8079 |
39640-39800 |
sentence |
denotes |
Within 0.5 h of TGF-β2 treatment, Snail promoter activity had increased 3-fold, and by 2 h, it peaked to approximately 10-fold over control levels (Figure 5D). |
| T8080 |
39641-39647 |
IN |
denotes |
Within |
| T8082 |
39648-39651 |
CD |
denotes |
0.5 |
| T8083 |
39652-39653 |
NN |
denotes |
h |
| T8084 |
39654-39656 |
IN |
denotes |
of |
| T8085 |
39657-39660 |
NN |
denotes |
TGF |
| T8087 |
39660-39661 |
HYPH |
denotes |
- |
| T8086 |
39661-39663 |
NN |
denotes |
β2 |
| T8088 |
39664-39673 |
NN |
denotes |
treatment |
| T8089 |
39673-39675 |
, |
denotes |
, |
| T8090 |
39675-39680 |
NN |
denotes |
Snail |
| T8091 |
39681-39689 |
NN |
denotes |
promoter |
| T8092 |
39690-39698 |
NN |
denotes |
activity |
| T8093 |
39699-39702 |
VBD |
denotes |
had |
| T8081 |
39703-39712 |
VBN |
denotes |
increased |
| T8094 |
39713-39719 |
RB |
denotes |
3-fold |
| T8095 |
39719-39721 |
, |
denotes |
, |
| T8096 |
39721-39724 |
CC |
denotes |
and |
| T8097 |
39725-39727 |
IN |
denotes |
by |
| T8099 |
39728-39729 |
CD |
denotes |
2 |
| T8100 |
39730-39731 |
NN |
denotes |
h |
| T8101 |
39731-39733 |
, |
denotes |
, |
| T8102 |
39733-39735 |
PRP |
denotes |
it |
| T8098 |
39736-39742 |
VBD |
denotes |
peaked |
| T8103 |
39743-39745 |
IN |
denotes |
to |
| T8104 |
39746-39759 |
RB |
denotes |
approximately |
| T8105 |
39760-39767 |
RB |
denotes |
10-fold |
| T8106 |
39768-39772 |
IN |
denotes |
over |
| T8107 |
39773-39780 |
NN |
denotes |
control |
| T8108 |
39781-39787 |
NNS |
denotes |
levels |
| T8109 |
39788-39789 |
-LRB- |
denotes |
( |
| T8111 |
39789-39795 |
NN |
denotes |
Figure |
| T8110 |
39796-39798 |
NN |
denotes |
5D |
| T8112 |
39798-39799 |
-RRB- |
denotes |
) |
| T8113 |
39799-39800 |
. |
denotes |
. |
| T8114 |
39800-39909 |
sentence |
denotes |
Thereafter, Snail promoter activity rapidly returned to the basal levels seen in unstimulated keratinocytes. |
| T8115 |
39801-39811 |
RB |
denotes |
Thereafter |
| T8117 |
39811-39813 |
, |
denotes |
, |
| T8118 |
39813-39818 |
NN |
denotes |
Snail |
| T8119 |
39819-39827 |
NN |
denotes |
promoter |
| T8120 |
39828-39836 |
NN |
denotes |
activity |
| T8121 |
39837-39844 |
RB |
denotes |
rapidly |
| T8116 |
39845-39853 |
VBD |
denotes |
returned |
| T8122 |
39854-39856 |
IN |
denotes |
to |
| T8123 |
39857-39860 |
DT |
denotes |
the |
| T8125 |
39861-39866 |
JJ |
denotes |
basal |
| T8124 |
39867-39873 |
NNS |
denotes |
levels |
| T8126 |
39874-39878 |
VBN |
denotes |
seen |
| T8127 |
39879-39881 |
IN |
denotes |
in |
| T8128 |
39882-39894 |
JJ |
denotes |
unstimulated |
| T8129 |
39895-39908 |
NNS |
denotes |
keratinocytes |
| T8130 |
39908-39909 |
. |
denotes |
. |
| T8131 |
39909-40012 |
sentence |
denotes |
The kinetics of Snail promoter activity closely paralleled those observed for Snail protein induction. |
| T8132 |
39910-39913 |
DT |
denotes |
The |
| T8133 |
39914-39922 |
NNS |
denotes |
kinetics |
| T8135 |
39923-39925 |
IN |
denotes |
of |
| T8136 |
39926-39931 |
NN |
denotes |
Snail |
| T8137 |
39932-39940 |
NN |
denotes |
promoter |
| T8138 |
39941-39949 |
NN |
denotes |
activity |
| T8139 |
39950-39957 |
RB |
denotes |
closely |
| T8134 |
39958-39968 |
VBD |
denotes |
paralleled |
| T8140 |
39969-39974 |
DT |
denotes |
those |
| T8141 |
39975-39983 |
VBN |
denotes |
observed |
| T8142 |
39984-39987 |
IN |
denotes |
for |
| T8143 |
39988-39993 |
NN |
denotes |
Snail |
| T8144 |
39994-40001 |
NN |
denotes |
protein |
| T8145 |
40002-40011 |
NN |
denotes |
induction |
| T8146 |
40011-40012 |
. |
denotes |
. |
| T8147 |
40012-40284 |
sentence |
denotes |
Moreover, the stimulatory effects appeared to be specific to TGF-β2, since they were abrogated either by heat inactivation of the TGF-β2 protein or by mutation of a putative SMAD binding element located about 1.8 kb 5′ from the Snail transcription start site (Figure 5D). |
| T8148 |
40013-40021 |
RB |
denotes |
Moreover |
| T8150 |
40021-40023 |
, |
denotes |
, |
| T8151 |
40023-40026 |
DT |
denotes |
the |
| T8153 |
40027-40038 |
JJ |
denotes |
stimulatory |
| T8152 |
40039-40046 |
NNS |
denotes |
effects |
| T8149 |
40047-40055 |
VBD |
denotes |
appeared |
| T8154 |
40056-40058 |
TO |
denotes |
to |
| T8155 |
40059-40061 |
VB |
denotes |
be |
| T8156 |
40062-40070 |
JJ |
denotes |
specific |
| T8157 |
40071-40073 |
IN |
denotes |
to |
| T8158 |
40074-40077 |
NN |
denotes |
TGF |
| T8160 |
40077-40078 |
HYPH |
denotes |
- |
| T8159 |
40078-40080 |
NN |
denotes |
β2 |
| T8161 |
40080-40082 |
, |
denotes |
, |
| T8162 |
40082-40087 |
IN |
denotes |
since |
| T8164 |
40088-40092 |
PRP |
denotes |
they |
| T8165 |
40093-40097 |
VBD |
denotes |
were |
| T8163 |
40098-40107 |
VBN |
denotes |
abrogated |
| T8166 |
40108-40114 |
CC |
denotes |
either |
| T8167 |
40115-40117 |
IN |
denotes |
by |
| T8168 |
40118-40122 |
NN |
denotes |
heat |
| T8169 |
40123-40135 |
NN |
denotes |
inactivation |
| T8170 |
40136-40138 |
IN |
denotes |
of |
| T8171 |
40139-40142 |
DT |
denotes |
the |
| T8173 |
40143-40146 |
NN |
denotes |
TGF |
| T8175 |
40146-40147 |
HYPH |
denotes |
- |
| T8174 |
40147-40149 |
NN |
denotes |
β2 |
| T8172 |
40150-40157 |
NN |
denotes |
protein |
| T8176 |
40158-40160 |
CC |
denotes |
or |
| T8177 |
40161-40163 |
IN |
denotes |
by |
| T8178 |
40164-40172 |
NN |
denotes |
mutation |
| T8179 |
40173-40175 |
IN |
denotes |
of |
| T8180 |
40176-40177 |
DT |
denotes |
a |
| T8182 |
40178-40186 |
JJ |
denotes |
putative |
| T8183 |
40187-40191 |
NN |
denotes |
SMAD |
| T8184 |
40192-40199 |
NN |
denotes |
binding |
| T8181 |
40200-40207 |
NN |
denotes |
element |
| T8185 |
40208-40215 |
VBN |
denotes |
located |
| T8186 |
40216-40221 |
IN |
denotes |
about |
| T8187 |
40222-40225 |
CD |
denotes |
1.8 |
| T8188 |
40226-40228 |
NN |
denotes |
kb |
| T8189 |
40229-40230 |
CD |
denotes |
5 |
| T8190 |
40230-40231 |
SYM |
denotes |
′ |
| T8191 |
40232-40236 |
IN |
denotes |
from |
| T8192 |
40237-40240 |
DT |
denotes |
the |
| T8194 |
40241-40246 |
NN |
denotes |
Snail |
| T8195 |
40247-40260 |
NN |
denotes |
transcription |
| T8196 |
40261-40266 |
NN |
denotes |
start |
| T8193 |
40267-40271 |
NN |
denotes |
site |
| T8197 |
40272-40273 |
-LRB- |
denotes |
( |
| T8199 |
40273-40279 |
NN |
denotes |
Figure |
| T8198 |
40280-40282 |
NN |
denotes |
5D |
| T8200 |
40282-40283 |
-RRB- |
denotes |
) |
| T8201 |
40283-40284 |
. |
denotes |
. |
| T8202 |
40284-40523 |
sentence |
denotes |
Taken together, these results suggested that in keratinocytes, TGF-β2 signaling results in a pSMAD2-dependent transient activation of the Snail gene, and that maintenance of Snail protein relies, in part, upon sustained promoter activity. |
| T8203 |
40285-40290 |
VBN |
denotes |
Taken |
| T8205 |
40291-40299 |
RB |
denotes |
together |
| T8206 |
40299-40301 |
, |
denotes |
, |
| T8207 |
40301-40306 |
DT |
denotes |
these |
| T8208 |
40307-40314 |
NNS |
denotes |
results |
| T8204 |
40315-40324 |
VBD |
denotes |
suggested |
| T8209 |
40325-40329 |
IN |
denotes |
that |
| T8211 |
40330-40332 |
IN |
denotes |
in |
| T8212 |
40333-40346 |
NNS |
denotes |
keratinocytes |
| T8213 |
40346-40348 |
, |
denotes |
, |
| T8214 |
40348-40351 |
NN |
denotes |
TGF |
| T8216 |
40351-40352 |
HYPH |
denotes |
- |
| T8215 |
40352-40354 |
NN |
denotes |
β2 |
| T8217 |
40355-40364 |
NN |
denotes |
signaling |
| T8210 |
40365-40372 |
VBZ |
denotes |
results |
| T8218 |
40373-40375 |
IN |
denotes |
in |
| T8219 |
40376-40377 |
DT |
denotes |
a |
| T8221 |
40378-40384 |
NN |
denotes |
pSMAD2 |
| T8223 |
40384-40385 |
HYPH |
denotes |
- |
| T8222 |
40385-40394 |
JJ |
denotes |
dependent |
| T8224 |
40395-40404 |
JJ |
denotes |
transient |
| T8220 |
40405-40415 |
NN |
denotes |
activation |
| T8225 |
40416-40418 |
IN |
denotes |
of |
| T8226 |
40419-40422 |
DT |
denotes |
the |
| T8228 |
40423-40428 |
NN |
denotes |
Snail |
| T8227 |
40429-40433 |
NN |
denotes |
gene |
| T8229 |
40433-40435 |
, |
denotes |
, |
| T8230 |
40435-40438 |
CC |
denotes |
and |
| T8231 |
40439-40443 |
IN |
denotes |
that |
| T8233 |
40444-40455 |
NN |
denotes |
maintenance |
| T8234 |
40456-40458 |
IN |
denotes |
of |
| T8235 |
40459-40464 |
NN |
denotes |
Snail |
| T8236 |
40465-40472 |
NN |
denotes |
protein |
| T8232 |
40473-40479 |
VBZ |
denotes |
relies |
| T8237 |
40479-40481 |
, |
denotes |
, |
| T8238 |
40481-40483 |
IN |
denotes |
in |
| T8239 |
40484-40488 |
NN |
denotes |
part |
| T8240 |
40488-40490 |
, |
denotes |
, |
| T8241 |
40490-40494 |
IN |
denotes |
upon |
| T8242 |
40495-40504 |
JJ |
denotes |
sustained |
| T8244 |
40505-40513 |
NN |
denotes |
promoter |
| T8243 |
40514-40522 |
NN |
denotes |
activity |
| T8245 |
40522-40523 |
. |
denotes |
. |
| T8246 |
40523-40746 |
sentence |
denotes |
The brevity of Snail gene and protein induction in TGF-β2 treated cultured keratinocytes resembled the temporal appearance of Snail mRNA and protein at the initiation of hair follicle morphogenesis in embryonic mouse skin. |
| T8247 |
40524-40527 |
DT |
denotes |
The |
| T8248 |
40528-40535 |
NN |
denotes |
brevity |
| T8250 |
40536-40538 |
IN |
denotes |
of |
| T8251 |
40539-40544 |
NN |
denotes |
Snail |
| T8252 |
40545-40549 |
NN |
denotes |
gene |
| T8254 |
40550-40553 |
CC |
denotes |
and |
| T8255 |
40554-40561 |
NN |
denotes |
protein |
| T8253 |
40562-40571 |
NN |
denotes |
induction |
| T8256 |
40572-40574 |
IN |
denotes |
in |
| T8257 |
40575-40578 |
NN |
denotes |
TGF |
| T8259 |
40578-40579 |
HYPH |
denotes |
- |
| T8258 |
40579-40581 |
NN |
denotes |
β2 |
| T8260 |
40582-40589 |
VBN |
denotes |
treated |
| T8262 |
40590-40598 |
VBN |
denotes |
cultured |
| T8261 |
40599-40612 |
NNS |
denotes |
keratinocytes |
| T8249 |
40613-40622 |
VBD |
denotes |
resembled |
| T8263 |
40623-40626 |
DT |
denotes |
the |
| T8265 |
40627-40635 |
JJ |
denotes |
temporal |
| T8264 |
40636-40646 |
NN |
denotes |
appearance |
| T8266 |
40647-40649 |
IN |
denotes |
of |
| T8267 |
40650-40655 |
NN |
denotes |
Snail |
| T8268 |
40656-40660 |
NN |
denotes |
mRNA |
| T8269 |
40661-40664 |
CC |
denotes |
and |
| T8270 |
40665-40672 |
NN |
denotes |
protein |
| T8271 |
40673-40675 |
IN |
denotes |
at |
| T8272 |
40676-40679 |
DT |
denotes |
the |
| T8273 |
40680-40690 |
NN |
denotes |
initiation |
| T8274 |
40691-40693 |
IN |
denotes |
of |
| T8275 |
40694-40698 |
NN |
denotes |
hair |
| T8276 |
40699-40707 |
NN |
denotes |
follicle |
| T8277 |
40708-40721 |
NN |
denotes |
morphogenesis |
| T8278 |
40722-40724 |
IN |
denotes |
in |
| T8279 |
40725-40734 |
JJ |
denotes |
embryonic |
| T8281 |
40735-40740 |
NN |
denotes |
mouse |
| T8280 |
40741-40745 |
NN |
denotes |
skin |
| T8282 |
40745-40746 |
. |
denotes |
. |
| T8283 |
40746-40912 |
sentence |
denotes |
To test whether TGF-β2 might be required for Snail induction in hair bud formation in vivo, we first analyzed whether TGF-β2 was expressed in or around the hair bud. |
| T8284 |
40747-40749 |
TO |
denotes |
To |
| T8285 |
40750-40754 |
VB |
denotes |
test |
| T8287 |
40755-40762 |
IN |
denotes |
whether |
| T8289 |
40763-40766 |
NN |
denotes |
TGF |
| T8291 |
40766-40767 |
HYPH |
denotes |
- |
| T8290 |
40767-40769 |
NN |
denotes |
β2 |
| T8292 |
40770-40775 |
MD |
denotes |
might |
| T8293 |
40776-40778 |
VB |
denotes |
be |
| T8288 |
40779-40787 |
VBN |
denotes |
required |
| T8294 |
40788-40791 |
IN |
denotes |
for |
| T8295 |
40792-40797 |
NN |
denotes |
Snail |
| T8296 |
40798-40807 |
NN |
denotes |
induction |
| T8297 |
40808-40810 |
IN |
denotes |
in |
| T8298 |
40811-40815 |
NN |
denotes |
hair |
| T8299 |
40816-40819 |
NN |
denotes |
bud |
| T8300 |
40820-40829 |
NN |
denotes |
formation |
| T8301 |
40830-40832 |
FW |
denotes |
in |
| T8302 |
40833-40837 |
FW |
denotes |
vivo |
| T8303 |
40837-40839 |
, |
denotes |
, |
| T8304 |
40839-40841 |
PRP |
denotes |
we |
| T8305 |
40842-40847 |
RB |
denotes |
first |
| T8286 |
40848-40856 |
VBD |
denotes |
analyzed |
| T8306 |
40857-40864 |
IN |
denotes |
whether |
| T8308 |
40865-40868 |
NN |
denotes |
TGF |
| T8310 |
40868-40869 |
HYPH |
denotes |
- |
| T8309 |
40869-40871 |
NN |
denotes |
β2 |
| T8311 |
40872-40875 |
VBD |
denotes |
was |
| T8307 |
40876-40885 |
VBN |
denotes |
expressed |
| T8312 |
40886-40888 |
IN |
denotes |
in |
| T8313 |
40889-40891 |
CC |
denotes |
or |
| T8314 |
40892-40898 |
IN |
denotes |
around |
| T8315 |
40899-40902 |
DT |
denotes |
the |
| T8317 |
40903-40907 |
NN |
denotes |
hair |
| T8316 |
40908-40911 |
NN |
denotes |
bud |
| T8318 |
40911-40912 |
. |
denotes |
. |
| T8319 |
40912-41022 |
sentence |
denotes |
Consistent with previous observations [33], an anti-TGF-β2 antibody labeled developing hair buds (Figure 6A). |
| T8320 |
40913-40923 |
JJ |
denotes |
Consistent |
| T8322 |
40924-40928 |
IN |
denotes |
with |
| T8323 |
40929-40937 |
JJ |
denotes |
previous |
| T8324 |
40938-40950 |
NNS |
denotes |
observations |
| T8325 |
40951-40952 |
-LRB- |
denotes |
[ |
| T8326 |
40952-40954 |
CD |
denotes |
33 |
| T8327 |
40954-40955 |
-RRB- |
denotes |
] |
| T8328 |
40955-40957 |
, |
denotes |
, |
| T8329 |
40957-40959 |
DT |
denotes |
an |
| T8331 |
40960-40968 |
JJ |
denotes |
anti-TGF |
| T8333 |
40968-40969 |
HYPH |
denotes |
- |
| T8332 |
40969-40971 |
NN |
denotes |
β2 |
| T8330 |
40972-40980 |
NN |
denotes |
antibody |
| T8321 |
40981-40988 |
VBD |
denotes |
labeled |
| T8334 |
40989-40999 |
VBG |
denotes |
developing |
| T8336 |
41000-41004 |
NN |
denotes |
hair |
| T8335 |
41005-41009 |
NNS |
denotes |
buds |
| T8337 |
41010-41011 |
-LRB- |
denotes |
( |
| T8339 |
41011-41017 |
NN |
denotes |
Figure |
| T8338 |
41018-41020 |
NN |
denotes |
6A |
| T8340 |
41020-41021 |
-RRB- |
denotes |
) |
| T8341 |
41021-41022 |
. |
denotes |
. |
| T8342 |
41022-41178 |
sentence |
denotes |
This labeling appeared to be specific as judged by the lack of staining in follicle buds from mice homozygous for a TGF-β2 null mutation (Figure 6A; [34]). |
| T8343 |
41023-41027 |
DT |
denotes |
This |
| T8344 |
41028-41036 |
NN |
denotes |
labeling |
| T8345 |
41037-41045 |
VBD |
denotes |
appeared |
| T8346 |
41046-41048 |
TO |
denotes |
to |
| T8347 |
41049-41051 |
VB |
denotes |
be |
| T8348 |
41052-41060 |
JJ |
denotes |
specific |
| T8349 |
41061-41063 |
IN |
denotes |
as |
| T8350 |
41064-41070 |
VBN |
denotes |
judged |
| T8351 |
41071-41073 |
IN |
denotes |
by |
| T8352 |
41074-41077 |
DT |
denotes |
the |
| T8353 |
41078-41082 |
NN |
denotes |
lack |
| T8354 |
41083-41085 |
IN |
denotes |
of |
| T8355 |
41086-41094 |
NN |
denotes |
staining |
| T8356 |
41095-41097 |
IN |
denotes |
in |
| T8357 |
41098-41106 |
NN |
denotes |
follicle |
| T8358 |
41107-41111 |
NNS |
denotes |
buds |
| T8359 |
41112-41116 |
IN |
denotes |
from |
| T8360 |
41117-41121 |
NNS |
denotes |
mice |
| T8361 |
41122-41132 |
JJ |
denotes |
homozygous |
| T8362 |
41133-41136 |
IN |
denotes |
for |
| T8363 |
41137-41138 |
DT |
denotes |
a |
| T8365 |
41139-41142 |
NN |
denotes |
TGF |
| T8367 |
41142-41143 |
HYPH |
denotes |
- |
| T8366 |
41143-41145 |
NN |
denotes |
β2 |
| T8368 |
41146-41150 |
JJ |
denotes |
null |
| T8364 |
41151-41159 |
NN |
denotes |
mutation |
| T8369 |
41160-41161 |
-LRB- |
denotes |
( |
| T8371 |
41161-41167 |
NN |
denotes |
Figure |
| T8372 |
41168-41170 |
NN |
denotes |
6A |
| T8373 |
41170-41171 |
: |
denotes |
; |
| T8374 |
41172-41173 |
-LRB- |
denotes |
[ |
| T8370 |
41173-41175 |
CD |
denotes |
34 |
| T8375 |
41175-41176 |
-RRB- |
denotes |
] |
| T8376 |
41176-41177 |
-RRB- |
denotes |
) |
| T8377 |
41177-41178 |
. |
denotes |
. |
| T8378 |
41178-41311 |
sentence |
denotes |
Moreover, the downstream effector of TGF-β2 signaling, pSMAD2, was also expressed in WT, but not TGF-β2-null, hair buds (Figure 6B). |
| T8379 |
41179-41187 |
RB |
denotes |
Moreover |
| T8381 |
41187-41189 |
, |
denotes |
, |
| T8382 |
41189-41192 |
DT |
denotes |
the |
| T8384 |
41193-41203 |
JJ |
denotes |
downstream |
| T8383 |
41204-41212 |
NN |
denotes |
effector |
| T8385 |
41213-41215 |
IN |
denotes |
of |
| T8386 |
41216-41219 |
NN |
denotes |
TGF |
| T8388 |
41219-41220 |
HYPH |
denotes |
- |
| T8387 |
41220-41222 |
NN |
denotes |
β2 |
| T8389 |
41223-41232 |
NN |
denotes |
signaling |
| T8390 |
41232-41234 |
, |
denotes |
, |
| T8391 |
41234-41240 |
NN |
denotes |
pSMAD2 |
| T8392 |
41240-41242 |
, |
denotes |
, |
| T8393 |
41242-41245 |
VBD |
denotes |
was |
| T8394 |
41246-41250 |
RB |
denotes |
also |
| T8380 |
41251-41260 |
VBN |
denotes |
expressed |
| T8395 |
41261-41263 |
IN |
denotes |
in |
| T8396 |
41264-41266 |
NN |
denotes |
WT |
| T8398 |
41266-41268 |
, |
denotes |
, |
| T8399 |
41268-41271 |
CC |
denotes |
but |
| T8400 |
41272-41275 |
RB |
denotes |
not |
| T8401 |
41276-41279 |
NN |
denotes |
TGF |
| T8403 |
41279-41280 |
HYPH |
denotes |
- |
| T8402 |
41280-41282 |
NN |
denotes |
β2 |
| T8405 |
41282-41283 |
HYPH |
denotes |
- |
| T8404 |
41283-41287 |
JJ |
denotes |
null |
| T8406 |
41287-41289 |
, |
denotes |
, |
| T8407 |
41289-41293 |
NN |
denotes |
hair |
| T8397 |
41294-41298 |
NNS |
denotes |
buds |
| T8408 |
41299-41300 |
-LRB- |
denotes |
( |
| T8410 |
41300-41306 |
NN |
denotes |
Figure |
| T8409 |
41307-41309 |
NN |
denotes |
6B |
| T8411 |
41309-41310 |
-RRB- |
denotes |
) |
| T8412 |
41310-41311 |
. |
denotes |
. |
| T8413 |
41311-41464 |
sentence |
denotes |
Together, these data underscore the importance of the TGF-β2 isoform despite expression of both TGF-β1 and TGF-β2 in developing hair buds at this stage. |
| T8414 |
41312-41320 |
RB |
denotes |
Together |
| T8416 |
41320-41322 |
, |
denotes |
, |
| T8417 |
41322-41327 |
DT |
denotes |
these |
| T8418 |
41328-41332 |
NNS |
denotes |
data |
| T8415 |
41333-41343 |
VBP |
denotes |
underscore |
| T8419 |
41344-41347 |
DT |
denotes |
the |
| T8420 |
41348-41358 |
NN |
denotes |
importance |
| T8421 |
41359-41361 |
IN |
denotes |
of |
| T8422 |
41362-41365 |
DT |
denotes |
the |
| T8424 |
41366-41369 |
NN |
denotes |
TGF |
| T8426 |
41369-41370 |
HYPH |
denotes |
- |
| T8425 |
41370-41372 |
NN |
denotes |
β2 |
| T8423 |
41373-41380 |
NN |
denotes |
isoform |
| T8427 |
41381-41388 |
IN |
denotes |
despite |
| T8428 |
41389-41399 |
NN |
denotes |
expression |
| T8429 |
41400-41402 |
IN |
denotes |
of |
| T8430 |
41403-41407 |
CC |
denotes |
both |
| T8432 |
41408-41411 |
NN |
denotes |
TGF |
| T8433 |
41411-41412 |
HYPH |
denotes |
- |
| T8431 |
41412-41414 |
NN |
denotes |
β1 |
| T8434 |
41415-41418 |
CC |
denotes |
and |
| T8435 |
41419-41422 |
NN |
denotes |
TGF |
| T8437 |
41422-41423 |
HYPH |
denotes |
- |
| T8436 |
41423-41425 |
NN |
denotes |
β2 |
| T8438 |
41426-41428 |
IN |
denotes |
in |
| T8439 |
41429-41439 |
VBG |
denotes |
developing |
| T8441 |
41440-41444 |
NN |
denotes |
hair |
| T8440 |
41445-41449 |
NNS |
denotes |
buds |
| T8442 |
41450-41452 |
IN |
denotes |
at |
| T8443 |
41453-41457 |
DT |
denotes |
this |
| T8444 |
41458-41463 |
NN |
denotes |
stage |
| T8445 |
41463-41464 |
. |
denotes |
. |
| T8446 |
41464-42595 |
sentence |
denotes |
Figure 6 TGF-β2 Is Necessary to Induce Snail Expression and Regulate Proliferation and E-Cadherin in the Hair Bud
(A–D) Skins from TGF-β2 WT or KO E17.5 embryos were analyzed for expression of TGF-β2 protein (A), which is present in the epidermis and dermis as previously described [33] and in the hair bud, pSMAD2 (B), Snail (C), and Snail mRNA (D). Arrows point to the hair buds.
(E) Western blot analyses of Snail expression in the skins of 2-wk-old K14-Smad2 transgenic (SMAD2 TG) and WT littermate (WT) mice. Antibody to tubulin was used as a control for equal protein loadings. The K14-Smad2 Tg mouse was previously shown to possess activated TGF-β signaling [35].
(F–G) Proliferation markers Ki67 (F) and pMAPK (G) are diminished in TGF-β2-null hair relative to its WT counterpart.
(H–J) TGF-β2-null hair fails to down-regulate E-cadherin (H). Wnt and noggin signaling pathways are still intact in the TGF-β2 null hair as nuclear LEF-1 (I) and nuclear β-catenin (J) are still expressed. To further explore the possible relation between Snail and TGF-β2, we examined the status of Snail expression in TGF-β2-null hair buds. |
| T8447 |
42460-42462 |
TO |
denotes |
To |
| T8449 |
42463-42470 |
RB |
denotes |
further |
| T8448 |
42471-42478 |
VB |
denotes |
explore |
| T8451 |
42479-42482 |
DT |
denotes |
the |
| T8453 |
42483-42491 |
JJ |
denotes |
possible |
| T8452 |
42492-42500 |
NN |
denotes |
relation |
| T8454 |
42501-42508 |
IN |
denotes |
between |
| T8455 |
42509-42514 |
NN |
denotes |
Snail |
| T8456 |
42515-42518 |
CC |
denotes |
and |
| T8457 |
42519-42522 |
NN |
denotes |
TGF |
| T8459 |
42522-42523 |
HYPH |
denotes |
- |
| T8458 |
42523-42525 |
NN |
denotes |
β2 |
| T8460 |
42525-42527 |
, |
denotes |
, |
| T8461 |
42527-42529 |
PRP |
denotes |
we |
| T8450 |
42530-42538 |
VBD |
denotes |
examined |
| T8462 |
42539-42542 |
DT |
denotes |
the |
| T8463 |
42543-42549 |
NN |
denotes |
status |
| T8464 |
42550-42552 |
IN |
denotes |
of |
| T8465 |
42553-42558 |
NN |
denotes |
Snail |
| T8466 |
42559-42569 |
NN |
denotes |
expression |
| T8467 |
42570-42572 |
IN |
denotes |
in |
| T8468 |
42573-42576 |
NN |
denotes |
TGF |
| T8470 |
42576-42577 |
HYPH |
denotes |
- |
| T8469 |
42577-42579 |
NN |
denotes |
β2 |
| T8472 |
42579-42580 |
HYPH |
denotes |
- |
| T8471 |
42580-42584 |
JJ |
denotes |
null |
| T8474 |
42585-42589 |
NN |
denotes |
hair |
| T8473 |
42590-42594 |
NNS |
denotes |
buds |
| T8475 |
42594-42595 |
. |
denotes |
. |
| T8476 |
42595-42748 |
sentence |
denotes |
As judged by immunohistochemistry, Snail protein was absent from E17.5 skin of TGF-β2-null embryos but not from that of control littermates (Figure 6C). |
| T8477 |
42596-42598 |
IN |
denotes |
As |
| T8478 |
42599-42605 |
VBN |
denotes |
judged |
| T8480 |
42606-42608 |
IN |
denotes |
by |
| T8481 |
42609-42629 |
NN |
denotes |
immunohistochemistry |
| T8482 |
42629-42631 |
, |
denotes |
, |
| T8483 |
42631-42636 |
NN |
denotes |
Snail |
| T8484 |
42637-42644 |
NN |
denotes |
protein |
| T8479 |
42645-42648 |
VBD |
denotes |
was |
| T8485 |
42649-42655 |
JJ |
denotes |
absent |
| T8486 |
42656-42660 |
IN |
denotes |
from |
| T8487 |
42661-42666 |
NN |
denotes |
E17.5 |
| T8488 |
42667-42671 |
NN |
denotes |
skin |
| T8489 |
42672-42674 |
IN |
denotes |
of |
| T8490 |
42675-42678 |
NN |
denotes |
TGF |
| T8492 |
42678-42679 |
HYPH |
denotes |
- |
| T8491 |
42679-42681 |
NN |
denotes |
β2 |
| T8494 |
42681-42682 |
HYPH |
denotes |
- |
| T8493 |
42682-42686 |
JJ |
denotes |
null |
| T8495 |
42687-42694 |
NNS |
denotes |
embryos |
| T8496 |
42695-42698 |
CC |
denotes |
but |
| T8497 |
42699-42702 |
RB |
denotes |
not |
| T8498 |
42703-42707 |
IN |
denotes |
from |
| T8499 |
42708-42712 |
DT |
denotes |
that |
| T8500 |
42713-42715 |
IN |
denotes |
of |
| T8501 |
42716-42723 |
NN |
denotes |
control |
| T8502 |
42724-42735 |
NNS |
denotes |
littermates |
| T8503 |
42736-42737 |
-LRB- |
denotes |
( |
| T8505 |
42737-42743 |
NN |
denotes |
Figure |
| T8504 |
42744-42746 |
NN |
denotes |
6C |
| T8506 |
42746-42747 |
-RRB- |
denotes |
) |
| T8507 |
42747-42748 |
. |
denotes |
. |
| T8508 |
42748-42983 |
sentence |
denotes |
This effect appeared to be exerted at the transcriptional level, since Snail mRNAs were also not found in TGF-β2 null hair buds under conditions in which the signal was readily detected in the hair buds of littermate skin (Figure 6D). |
| T8509 |
42749-42753 |
DT |
denotes |
This |
| T8510 |
42754-42760 |
NN |
denotes |
effect |
| T8511 |
42761-42769 |
VBD |
denotes |
appeared |
| T8512 |
42770-42772 |
TO |
denotes |
to |
| T8514 |
42773-42775 |
VB |
denotes |
be |
| T8513 |
42776-42783 |
VBN |
denotes |
exerted |
| T8515 |
42784-42786 |
IN |
denotes |
at |
| T8516 |
42787-42790 |
DT |
denotes |
the |
| T8518 |
42791-42806 |
JJ |
denotes |
transcriptional |
| T8517 |
42807-42812 |
NN |
denotes |
level |
| T8519 |
42812-42814 |
, |
denotes |
, |
| T8520 |
42814-42819 |
IN |
denotes |
since |
| T8522 |
42820-42825 |
NN |
denotes |
Snail |
| T8523 |
42826-42831 |
NNS |
denotes |
mRNAs |
| T8524 |
42832-42836 |
VBD |
denotes |
were |
| T8525 |
42837-42841 |
RB |
denotes |
also |
| T8526 |
42842-42845 |
RB |
denotes |
not |
| T8521 |
42846-42851 |
VBN |
denotes |
found |
| T8527 |
42852-42854 |
IN |
denotes |
in |
| T8528 |
42855-42858 |
NN |
denotes |
TGF |
| T8530 |
42858-42859 |
HYPH |
denotes |
- |
| T8529 |
42859-42861 |
NN |
denotes |
β2 |
| T8531 |
42862-42866 |
JJ |
denotes |
null |
| T8533 |
42867-42871 |
NN |
denotes |
hair |
| T8532 |
42872-42876 |
NNS |
denotes |
buds |
| T8534 |
42877-42882 |
IN |
denotes |
under |
| T8535 |
42883-42893 |
NNS |
denotes |
conditions |
| T8536 |
42894-42896 |
IN |
denotes |
in |
| T8538 |
42897-42902 |
WDT |
denotes |
which |
| T8539 |
42903-42906 |
DT |
denotes |
the |
| T8540 |
42907-42913 |
NN |
denotes |
signal |
| T8541 |
42914-42917 |
VBD |
denotes |
was |
| T8542 |
42918-42925 |
RB |
denotes |
readily |
| T8537 |
42926-42934 |
VBN |
denotes |
detected |
| T8543 |
42935-42937 |
IN |
denotes |
in |
| T8544 |
42938-42941 |
DT |
denotes |
the |
| T8546 |
42942-42946 |
NN |
denotes |
hair |
| T8545 |
42947-42951 |
NNS |
denotes |
buds |
| T8547 |
42952-42954 |
IN |
denotes |
of |
| T8548 |
42955-42965 |
NN |
denotes |
littermate |
| T8549 |
42966-42970 |
NN |
denotes |
skin |
| T8550 |
42971-42972 |
-LRB- |
denotes |
( |
| T8552 |
42972-42978 |
NN |
denotes |
Figure |
| T8551 |
42979-42981 |
NN |
denotes |
6D |
| T8553 |
42981-42982 |
-RRB- |
denotes |
) |
| T8554 |
42982-42983 |
. |
denotes |
. |
| T8555 |
42983-43194 |
sentence |
denotes |
Conversely, in 2-wk-old K14-Smad2 Tg mice, which display elevated TGF-β signaling in skin [35], Snail protein was readily detected by Western blot analyses, where it was not found in postnatal skin (Figure 6E). |
| T8556 |
42984-42994 |
RB |
denotes |
Conversely |
| T8558 |
42994-42996 |
, |
denotes |
, |
| T8559 |
42996-42998 |
IN |
denotes |
in |
| T8560 |
42999-43000 |
CD |
denotes |
2 |
| T8562 |
43000-43001 |
HYPH |
denotes |
- |
| T8561 |
43001-43003 |
NN |
denotes |
wk |
| T8564 |
43003-43004 |
HYPH |
denotes |
- |
| T8563 |
43004-43007 |
JJ |
denotes |
old |
| T8566 |
43008-43011 |
NN |
denotes |
K14 |
| T8568 |
43011-43012 |
HYPH |
denotes |
- |
| T8567 |
43012-43017 |
NN |
denotes |
Smad2 |
| T8569 |
43018-43020 |
NN |
denotes |
Tg |
| T8565 |
43021-43025 |
NNS |
denotes |
mice |
| T8570 |
43025-43027 |
, |
denotes |
, |
| T8571 |
43027-43032 |
WDT |
denotes |
which |
| T8572 |
43033-43040 |
VBP |
denotes |
display |
| T8573 |
43041-43049 |
VBN |
denotes |
elevated |
| T8575 |
43050-43053 |
NN |
denotes |
TGF |
| T8577 |
43053-43054 |
HYPH |
denotes |
- |
| T8576 |
43054-43055 |
NN |
denotes |
β |
| T8574 |
43056-43065 |
NN |
denotes |
signaling |
| T8578 |
43066-43068 |
IN |
denotes |
in |
| T8579 |
43069-43073 |
NN |
denotes |
skin |
| T8580 |
43074-43075 |
-LRB- |
denotes |
[ |
| T8581 |
43075-43077 |
CD |
denotes |
35 |
| T8582 |
43077-43078 |
-RRB- |
denotes |
] |
| T8583 |
43078-43080 |
, |
denotes |
, |
| T8584 |
43080-43085 |
NN |
denotes |
Snail |
| T8585 |
43086-43093 |
NN |
denotes |
protein |
| T8586 |
43094-43097 |
VBD |
denotes |
was |
| T8587 |
43098-43105 |
RB |
denotes |
readily |
| T8557 |
43106-43114 |
VBN |
denotes |
detected |
| T8588 |
43115-43117 |
IN |
denotes |
by |
| T8589 |
43118-43125 |
NNP |
denotes |
Western |
| T8590 |
43126-43130 |
NN |
denotes |
blot |
| T8591 |
43131-43139 |
NNS |
denotes |
analyses |
| T8592 |
43139-43141 |
, |
denotes |
, |
| T8593 |
43141-43146 |
WRB |
denotes |
where |
| T8595 |
43147-43149 |
PRP |
denotes |
it |
| T8596 |
43150-43153 |
VBD |
denotes |
was |
| T8597 |
43154-43157 |
RB |
denotes |
not |
| T8594 |
43158-43163 |
VBN |
denotes |
found |
| T8598 |
43164-43166 |
IN |
denotes |
in |
| T8599 |
43167-43176 |
JJ |
denotes |
postnatal |
| T8600 |
43177-43181 |
NN |
denotes |
skin |
| T8601 |
43182-43183 |
-LRB- |
denotes |
( |
| T8603 |
43183-43189 |
NN |
denotes |
Figure |
| T8602 |
43190-43192 |
NN |
denotes |
6E |
| T8604 |
43192-43193 |
-RRB- |
denotes |
) |
| T8605 |
43193-43194 |
. |
denotes |
. |
| T8606 |
43194-43378 |
sentence |
denotes |
Taken together, these results provide compelling evidence that TGF-β2 is functionally important for inducing Snail gene expression in a pSMAD-dependent manner in developing hair buds. |
| T8607 |
43195-43200 |
VBN |
denotes |
Taken |
| T8609 |
43201-43209 |
RB |
denotes |
together |
| T8610 |
43209-43211 |
, |
denotes |
, |
| T8611 |
43211-43216 |
DT |
denotes |
these |
| T8612 |
43217-43224 |
NNS |
denotes |
results |
| T8608 |
43225-43232 |
VBP |
denotes |
provide |
| T8613 |
43233-43243 |
JJ |
denotes |
compelling |
| T8614 |
43244-43252 |
NN |
denotes |
evidence |
| T8615 |
43253-43257 |
IN |
denotes |
that |
| T8617 |
43258-43261 |
NN |
denotes |
TGF |
| T8619 |
43261-43262 |
HYPH |
denotes |
- |
| T8618 |
43262-43264 |
NN |
denotes |
β2 |
| T8616 |
43265-43267 |
VBZ |
denotes |
is |
| T8620 |
43268-43280 |
RB |
denotes |
functionally |
| T8621 |
43281-43290 |
JJ |
denotes |
important |
| T8622 |
43291-43294 |
IN |
denotes |
for |
| T8623 |
43295-43303 |
VBG |
denotes |
inducing |
| T8624 |
43304-43309 |
NN |
denotes |
Snail |
| T8626 |
43310-43314 |
NN |
denotes |
gene |
| T8625 |
43315-43325 |
NN |
denotes |
expression |
| T8627 |
43326-43328 |
IN |
denotes |
in |
| T8628 |
43329-43330 |
DT |
denotes |
a |
| T8630 |
43331-43336 |
NN |
denotes |
pSMAD |
| T8632 |
43336-43337 |
HYPH |
denotes |
- |
| T8631 |
43337-43346 |
JJ |
denotes |
dependent |
| T8629 |
43347-43353 |
NN |
denotes |
manner |
| T8633 |
43354-43356 |
IN |
denotes |
in |
| T8634 |
43357-43367 |
VBG |
denotes |
developing |
| T8636 |
43368-43372 |
NN |
denotes |
hair |
| T8635 |
43373-43377 |
NNS |
denotes |
buds |
| T8637 |
43377-43378 |
. |
denotes |
. |
| T8638 |
43378-43482 |
sentence |
denotes |
Whether pMARK activity also contributes to Snail induction was not addressed in the present study [15]. |
| T8639 |
43379-43386 |
IN |
denotes |
Whether |
| T8641 |
43387-43392 |
NN |
denotes |
pMARK |
| T8642 |
43393-43401 |
NN |
denotes |
activity |
| T8643 |
43402-43406 |
RB |
denotes |
also |
| T8640 |
43407-43418 |
VBZ |
denotes |
contributes |
| T8645 |
43419-43421 |
IN |
denotes |
to |
| T8646 |
43422-43427 |
NN |
denotes |
Snail |
| T8647 |
43428-43437 |
NN |
denotes |
induction |
| T8648 |
43438-43441 |
VBD |
denotes |
was |
| T8649 |
43442-43445 |
RB |
denotes |
not |
| T8644 |
43446-43455 |
VBN |
denotes |
addressed |
| T8650 |
43456-43458 |
IN |
denotes |
in |
| T8651 |
43459-43462 |
DT |
denotes |
the |
| T8653 |
43463-43470 |
JJ |
denotes |
present |
| T8652 |
43471-43476 |
NN |
denotes |
study |
| T8654 |
43477-43478 |
-LRB- |
denotes |
[ |
| T8655 |
43478-43480 |
CD |
denotes |
15 |
| T8656 |
43480-43481 |
-RRB- |
denotes |
] |
| T8657 |
43481-43482 |
. |
denotes |
. |
| T8658 |
43482-43592 |
sentence |
denotes |
Although some hair buds still formed in TGF-β2 null skin, their number was reduced by approximately 50% [32]. |
| T8659 |
43483-43491 |
IN |
denotes |
Although |
| T8661 |
43492-43496 |
DT |
denotes |
some |
| T8663 |
43497-43501 |
NN |
denotes |
hair |
| T8662 |
43502-43506 |
NNS |
denotes |
buds |
| T8664 |
43507-43512 |
RB |
denotes |
still |
| T8660 |
43513-43519 |
VBD |
denotes |
formed |
| T8666 |
43520-43522 |
IN |
denotes |
in |
| T8667 |
43523-43526 |
NN |
denotes |
TGF |
| T8669 |
43526-43527 |
HYPH |
denotes |
- |
| T8668 |
43527-43529 |
NN |
denotes |
β2 |
| T8670 |
43530-43534 |
JJ |
denotes |
null |
| T8671 |
43535-43539 |
NN |
denotes |
skin |
| T8672 |
43539-43541 |
, |
denotes |
, |
| T8673 |
43541-43546 |
PRP$ |
denotes |
their |
| T8674 |
43547-43553 |
NN |
denotes |
number |
| T8675 |
43554-43557 |
VBD |
denotes |
was |
| T8665 |
43558-43565 |
VBN |
denotes |
reduced |
| T8676 |
43566-43568 |
IN |
denotes |
by |
| T8677 |
43569-43582 |
RB |
denotes |
approximately |
| T8678 |
43583-43585 |
CD |
denotes |
50 |
| T8679 |
43585-43586 |
NN |
denotes |
% |
| T8680 |
43587-43588 |
-LRB- |
denotes |
[ |
| T8681 |
43588-43590 |
CD |
denotes |
32 |
| T8682 |
43590-43591 |
-RRB- |
denotes |
] |
| T8683 |
43591-43592 |
. |
denotes |
. |
| T8684 |
43592-43760 |
sentence |
denotes |
Thus, although the pathway mediated by TGF-β2 signaling impacts the earliest step of epithelial invagination, it does not appear to be essential for bud morphogenesis. |
| T8685 |
43593-43597 |
RB |
denotes |
Thus |
| T8687 |
43597-43599 |
, |
denotes |
, |
| T8688 |
43599-43607 |
IN |
denotes |
although |
| T8690 |
43608-43611 |
DT |
denotes |
the |
| T8691 |
43612-43619 |
NN |
denotes |
pathway |
| T8692 |
43620-43628 |
VBN |
denotes |
mediated |
| T8693 |
43629-43631 |
IN |
denotes |
by |
| T8694 |
43632-43635 |
NN |
denotes |
TGF |
| T8696 |
43635-43636 |
HYPH |
denotes |
- |
| T8695 |
43636-43638 |
NN |
denotes |
β2 |
| T8697 |
43639-43648 |
NN |
denotes |
signaling |
| T8689 |
43649-43656 |
VBZ |
denotes |
impacts |
| T8698 |
43657-43660 |
DT |
denotes |
the |
| T8700 |
43661-43669 |
JJS |
denotes |
earliest |
| T8699 |
43670-43674 |
NN |
denotes |
step |
| T8701 |
43675-43677 |
IN |
denotes |
of |
| T8702 |
43678-43688 |
JJ |
denotes |
epithelial |
| T8703 |
43689-43701 |
NN |
denotes |
invagination |
| T8704 |
43701-43703 |
, |
denotes |
, |
| T8705 |
43703-43705 |
PRP |
denotes |
it |
| T8706 |
43706-43710 |
VBZ |
denotes |
does |
| T8707 |
43711-43714 |
RB |
denotes |
not |
| T8686 |
43715-43721 |
VB |
denotes |
appear |
| T8708 |
43722-43724 |
TO |
denotes |
to |
| T8709 |
43725-43727 |
VB |
denotes |
be |
| T8710 |
43728-43737 |
JJ |
denotes |
essential |
| T8711 |
43738-43741 |
IN |
denotes |
for |
| T8712 |
43742-43745 |
NN |
denotes |
bud |
| T8713 |
43746-43759 |
NN |
denotes |
morphogenesis |
| T8714 |
43759-43760 |
. |
denotes |
. |
| T8715 |
43760-44034 |
sentence |
denotes |
Consistent with this notion, basement membrane remodeling still took place in the TGF-β2-null buds, as judged by immunofluorescence with antibodies against β4 integrin, an integral component of keratinocyte-mediated adhesion to its underlying basement membrane (Figure 6F). |
| T8716 |
43761-43771 |
JJ |
denotes |
Consistent |
| T8718 |
43772-43776 |
IN |
denotes |
with |
| T8719 |
43777-43781 |
DT |
denotes |
this |
| T8720 |
43782-43788 |
NN |
denotes |
notion |
| T8721 |
43788-43790 |
, |
denotes |
, |
| T8722 |
43790-43798 |
NN |
denotes |
basement |
| T8723 |
43799-43807 |
NN |
denotes |
membrane |
| T8724 |
43808-43818 |
NN |
denotes |
remodeling |
| T8725 |
43819-43824 |
RB |
denotes |
still |
| T8717 |
43825-43829 |
VBD |
denotes |
took |
| T8726 |
43830-43835 |
RP |
denotes |
place |
| T8727 |
43836-43838 |
IN |
denotes |
in |
| T8728 |
43839-43842 |
DT |
denotes |
the |
| T8730 |
43843-43846 |
NN |
denotes |
TGF |
| T8732 |
43846-43847 |
HYPH |
denotes |
- |
| T8731 |
43847-43849 |
NN |
denotes |
β2 |
| T8734 |
43849-43850 |
HYPH |
denotes |
- |
| T8733 |
43850-43854 |
JJ |
denotes |
null |
| T8729 |
43855-43859 |
NNS |
denotes |
buds |
| T8735 |
43859-43861 |
, |
denotes |
, |
| T8736 |
43861-43863 |
IN |
denotes |
as |
| T8737 |
43864-43870 |
VBN |
denotes |
judged |
| T8738 |
43871-43873 |
IN |
denotes |
by |
| T8739 |
43874-43892 |
NN |
denotes |
immunofluorescence |
| T8740 |
43893-43897 |
IN |
denotes |
with |
| T8741 |
43898-43908 |
NNS |
denotes |
antibodies |
| T8742 |
43909-43916 |
IN |
denotes |
against |
| T8743 |
43917-43919 |
NN |
denotes |
β4 |
| T8744 |
43920-43928 |
NN |
denotes |
integrin |
| T8745 |
43928-43930 |
, |
denotes |
, |
| T8746 |
43930-43932 |
DT |
denotes |
an |
| T8748 |
43933-43941 |
JJ |
denotes |
integral |
| T8747 |
43942-43951 |
NN |
denotes |
component |
| T8749 |
43952-43954 |
IN |
denotes |
of |
| T8750 |
43955-43967 |
NN |
denotes |
keratinocyte |
| T8752 |
43967-43968 |
HYPH |
denotes |
- |
| T8751 |
43968-43976 |
VBN |
denotes |
mediated |
| T8753 |
43977-43985 |
NN |
denotes |
adhesion |
| T8754 |
43986-43988 |
IN |
denotes |
to |
| T8755 |
43989-43992 |
PRP$ |
denotes |
its |
| T8757 |
43993-44003 |
JJ |
denotes |
underlying |
| T8758 |
44004-44012 |
NN |
denotes |
basement |
| T8756 |
44013-44021 |
NN |
denotes |
membrane |
| T8759 |
44022-44023 |
-LRB- |
denotes |
( |
| T8761 |
44023-44029 |
NN |
denotes |
Figure |
| T8760 |
44030-44032 |
NN |
denotes |
6F |
| T8762 |
44032-44033 |
-RRB- |
denotes |
) |
| T8763 |
44033-44034 |
. |
denotes |
. |
| T8764 |
44034-44245 |
sentence |
denotes |
In contrast, TGF-β2 signaling appeared to be an important factor for the early proliferation that occurs in the developing hair buds, as judged by anti-Ki67 and anti-pMAPK immunofluorescence (Figure 6F and 6G). |
| T8765 |
44035-44037 |
IN |
denotes |
In |
| T8767 |
44038-44046 |
NN |
denotes |
contrast |
| T8768 |
44046-44048 |
, |
denotes |
, |
| T8769 |
44048-44051 |
NN |
denotes |
TGF |
| T8771 |
44051-44052 |
HYPH |
denotes |
- |
| T8770 |
44052-44054 |
NN |
denotes |
β2 |
| T8772 |
44055-44064 |
NN |
denotes |
signaling |
| T8766 |
44065-44073 |
VBD |
denotes |
appeared |
| T8773 |
44074-44076 |
TO |
denotes |
to |
| T8774 |
44077-44079 |
VB |
denotes |
be |
| T8775 |
44080-44082 |
DT |
denotes |
an |
| T8777 |
44083-44092 |
JJ |
denotes |
important |
| T8776 |
44093-44099 |
NN |
denotes |
factor |
| T8778 |
44100-44103 |
IN |
denotes |
for |
| T8779 |
44104-44107 |
DT |
denotes |
the |
| T8781 |
44108-44113 |
JJ |
denotes |
early |
| T8780 |
44114-44127 |
NN |
denotes |
proliferation |
| T8782 |
44128-44132 |
WDT |
denotes |
that |
| T8783 |
44133-44139 |
VBZ |
denotes |
occurs |
| T8784 |
44140-44142 |
IN |
denotes |
in |
| T8785 |
44143-44146 |
DT |
denotes |
the |
| T8787 |
44147-44157 |
VBG |
denotes |
developing |
| T8788 |
44158-44162 |
NN |
denotes |
hair |
| T8786 |
44163-44167 |
NNS |
denotes |
buds |
| T8789 |
44167-44169 |
, |
denotes |
, |
| T8790 |
44169-44171 |
IN |
denotes |
as |
| T8791 |
44172-44178 |
VBN |
denotes |
judged |
| T8792 |
44179-44181 |
IN |
denotes |
by |
| T8793 |
44182-44191 |
JJ |
denotes |
anti-Ki67 |
| T8795 |
44192-44195 |
CC |
denotes |
and |
| T8796 |
44196-44206 |
JJ |
denotes |
anti-pMAPK |
| T8794 |
44207-44225 |
NN |
denotes |
immunofluorescence |
| T8797 |
44226-44227 |
-LRB- |
denotes |
( |
| T8799 |
44227-44233 |
NN |
denotes |
Figure |
| T8798 |
44234-44236 |
NN |
denotes |
6F |
| T8800 |
44237-44240 |
CC |
denotes |
and |
| T8801 |
44241-44243 |
NN |
denotes |
6G |
| T8802 |
44243-44244 |
-RRB- |
denotes |
) |
| T8803 |
44244-44245 |
. |
denotes |
. |
| T8804 |
44245-44417 |
sentence |
denotes |
If TGF-β2 stimulates Snail expression in developing buds, loss of this morphogen would be expected to affect the expression of genes that are typically repressed by Snail. |
| T8805 |
44246-44248 |
IN |
denotes |
If |
| T8807 |
44249-44252 |
NN |
denotes |
TGF |
| T8809 |
44252-44253 |
HYPH |
denotes |
- |
| T8808 |
44253-44255 |
NN |
denotes |
β2 |
| T8806 |
44256-44266 |
VBZ |
denotes |
stimulates |
| T8811 |
44267-44272 |
NN |
denotes |
Snail |
| T8812 |
44273-44283 |
NN |
denotes |
expression |
| T8813 |
44284-44286 |
IN |
denotes |
in |
| T8814 |
44287-44297 |
VBG |
denotes |
developing |
| T8815 |
44298-44302 |
NNS |
denotes |
buds |
| T8816 |
44302-44304 |
, |
denotes |
, |
| T8817 |
44304-44308 |
NN |
denotes |
loss |
| T8818 |
44309-44311 |
IN |
denotes |
of |
| T8819 |
44312-44316 |
DT |
denotes |
this |
| T8820 |
44317-44326 |
NN |
denotes |
morphogen |
| T8821 |
44327-44332 |
MD |
denotes |
would |
| T8822 |
44333-44335 |
VB |
denotes |
be |
| T8810 |
44336-44344 |
VBN |
denotes |
expected |
| T8823 |
44345-44347 |
TO |
denotes |
to |
| T8824 |
44348-44354 |
VB |
denotes |
affect |
| T8825 |
44355-44358 |
DT |
denotes |
the |
| T8826 |
44359-44369 |
NN |
denotes |
expression |
| T8827 |
44370-44372 |
IN |
denotes |
of |
| T8828 |
44373-44378 |
NNS |
denotes |
genes |
| T8829 |
44379-44383 |
WDT |
denotes |
that |
| T8831 |
44384-44387 |
VBP |
denotes |
are |
| T8832 |
44388-44397 |
RB |
denotes |
typically |
| T8830 |
44398-44407 |
VBN |
denotes |
repressed |
| T8833 |
44408-44410 |
IN |
denotes |
by |
| T8834 |
44411-44416 |
NN |
denotes |
Snail |
| T8835 |
44416-44417 |
. |
denotes |
. |
| T8836 |
44417-44562 |
sentence |
denotes |
Since a major target for Snail-mediated repression is the E-cadherin gene [12,13], we investigated the status of E-cadherin in TGF-β2-null buds. |
| T8837 |
44418-44423 |
IN |
denotes |
Since |
| T8839 |
44424-44425 |
DT |
denotes |
a |
| T8841 |
44426-44431 |
JJ |
denotes |
major |
| T8840 |
44432-44438 |
NN |
denotes |
target |
| T8842 |
44439-44442 |
IN |
denotes |
for |
| T8843 |
44443-44448 |
NN |
denotes |
Snail |
| T8845 |
44448-44449 |
HYPH |
denotes |
- |
| T8844 |
44449-44457 |
VBN |
denotes |
mediated |
| T8846 |
44458-44468 |
NN |
denotes |
repression |
| T8838 |
44469-44471 |
VBZ |
denotes |
is |
| T8848 |
44472-44475 |
DT |
denotes |
the |
| T8850 |
44476-44477 |
NN |
denotes |
E |
| T8852 |
44477-44478 |
HYPH |
denotes |
- |
| T8851 |
44478-44486 |
NN |
denotes |
cadherin |
| T8849 |
44487-44491 |
NN |
denotes |
gene |
| T8853 |
44492-44493 |
-LRB- |
denotes |
[ |
| T8855 |
44493-44495 |
CD |
denotes |
12 |
| T8856 |
44495-44496 |
, |
denotes |
, |
| T8854 |
44496-44498 |
CD |
denotes |
13 |
| T8857 |
44498-44499 |
-RRB- |
denotes |
] |
| T8858 |
44499-44501 |
, |
denotes |
, |
| T8859 |
44501-44503 |
PRP |
denotes |
we |
| T8847 |
44504-44516 |
VBD |
denotes |
investigated |
| T8860 |
44517-44520 |
DT |
denotes |
the |
| T8861 |
44521-44527 |
NN |
denotes |
status |
| T8862 |
44528-44530 |
IN |
denotes |
of |
| T8863 |
44531-44532 |
NN |
denotes |
E |
| T8865 |
44532-44533 |
HYPH |
denotes |
- |
| T8864 |
44533-44541 |
NN |
denotes |
cadherin |
| T8866 |
44542-44544 |
IN |
denotes |
in |
| T8867 |
44545-44548 |
NN |
denotes |
TGF |
| T8869 |
44548-44549 |
HYPH |
denotes |
- |
| T8868 |
44549-44551 |
NN |
denotes |
β2 |
| T8871 |
44551-44552 |
HYPH |
denotes |
- |
| T8870 |
44552-44556 |
JJ |
denotes |
null |
| T8872 |
44557-44561 |
NNS |
denotes |
buds |
| T8873 |
44561-44562 |
. |
denotes |
. |
| T8874 |
44562-44697 |
sentence |
denotes |
As shown in Figure 6H, hair buds in TGF-β2 null skin displayed elevated immunofluorescence staining relative to their WT counterparts. |
| T8875 |
44563-44565 |
IN |
denotes |
As |
| T8876 |
44566-44571 |
VBN |
denotes |
shown |
| T8878 |
44572-44574 |
IN |
denotes |
in |
| T8879 |
44575-44581 |
NN |
denotes |
Figure |
| T8880 |
44582-44584 |
NN |
denotes |
6H |
| T8881 |
44584-44586 |
, |
denotes |
, |
| T8882 |
44586-44590 |
NN |
denotes |
hair |
| T8883 |
44591-44595 |
NNS |
denotes |
buds |
| T8884 |
44596-44598 |
IN |
denotes |
in |
| T8885 |
44599-44602 |
NN |
denotes |
TGF |
| T8887 |
44602-44603 |
HYPH |
denotes |
- |
| T8886 |
44603-44605 |
NN |
denotes |
β2 |
| T8888 |
44606-44610 |
JJ |
denotes |
null |
| T8889 |
44611-44615 |
NN |
denotes |
skin |
| T8877 |
44616-44625 |
VBD |
denotes |
displayed |
| T8890 |
44626-44634 |
JJ |
denotes |
elevated |
| T8892 |
44635-44653 |
NN |
denotes |
immunofluorescence |
| T8891 |
44654-44662 |
NN |
denotes |
staining |
| T8893 |
44663-44671 |
JJ |
denotes |
relative |
| T8894 |
44672-44674 |
IN |
denotes |
to |
| T8895 |
44675-44680 |
PRP$ |
denotes |
their |
| T8897 |
44681-44683 |
NN |
denotes |
WT |
| T8896 |
44684-44696 |
NNS |
denotes |
counterparts |
| T8898 |
44696-44697 |
. |
denotes |
. |
| T8899 |
44697-44946 |
sentence |
denotes |
Previously we demonstrated that the concerted action of the extracellular signals Wnt and noggin are required for the generation of a LEF-1/β-catenin transcription complex to repress E-cadherin transcription at the onset of hair fate specification. |
| T8900 |
44698-44708 |
RB |
denotes |
Previously |
| T8902 |
44709-44711 |
PRP |
denotes |
we |
| T8901 |
44712-44724 |
VBD |
denotes |
demonstrated |
| T8903 |
44725-44729 |
IN |
denotes |
that |
| T8905 |
44730-44733 |
DT |
denotes |
the |
| T8907 |
44734-44743 |
JJ |
denotes |
concerted |
| T8906 |
44744-44750 |
NN |
denotes |
action |
| T8908 |
44751-44753 |
IN |
denotes |
of |
| T8909 |
44754-44757 |
DT |
denotes |
the |
| T8911 |
44758-44771 |
JJ |
denotes |
extracellular |
| T8910 |
44772-44779 |
NNS |
denotes |
signals |
| T8912 |
44780-44783 |
NN |
denotes |
Wnt |
| T8913 |
44784-44787 |
CC |
denotes |
and |
| T8914 |
44788-44794 |
NN |
denotes |
noggin |
| T8915 |
44795-44798 |
VBP |
denotes |
are |
| T8904 |
44799-44807 |
VBN |
denotes |
required |
| T8916 |
44808-44811 |
IN |
denotes |
for |
| T8918 |
44812-44815 |
DT |
denotes |
the |
| T8919 |
44816-44826 |
NN |
denotes |
generation |
| T8920 |
44827-44829 |
IN |
denotes |
of |
| T8921 |
44830-44831 |
DT |
denotes |
a |
| T8923 |
44832-44835 |
NN |
denotes |
LEF |
| T8924 |
44835-44836 |
HYPH |
denotes |
- |
| T8925 |
44836-44837 |
CD |
denotes |
1 |
| T8926 |
44837-44838 |
HYPH |
denotes |
/ |
| T8927 |
44838-44839 |
NN |
denotes |
β |
| T8929 |
44839-44840 |
HYPH |
denotes |
- |
| T8928 |
44840-44847 |
NN |
denotes |
catenin |
| T8930 |
44848-44861 |
NN |
denotes |
transcription |
| T8922 |
44862-44869 |
NN |
denotes |
complex |
| T8931 |
44870-44872 |
TO |
denotes |
to |
| T8917 |
44873-44880 |
VB |
denotes |
repress |
| T8932 |
44881-44882 |
NN |
denotes |
E |
| T8934 |
44882-44883 |
HYPH |
denotes |
- |
| T8933 |
44883-44891 |
NN |
denotes |
cadherin |
| T8935 |
44892-44905 |
NN |
denotes |
transcription |
| T8936 |
44906-44908 |
IN |
denotes |
at |
| T8937 |
44909-44912 |
DT |
denotes |
the |
| T8938 |
44913-44918 |
NN |
denotes |
onset |
| T8939 |
44919-44921 |
IN |
denotes |
of |
| T8940 |
44922-44926 |
NN |
denotes |
hair |
| T8941 |
44927-44931 |
NN |
denotes |
fate |
| T8942 |
44932-44945 |
NN |
denotes |
specification |
| T8943 |
44945-44946 |
. |
denotes |
. |
| T8944 |
44946-45113 |
sentence |
denotes |
As shown in Figure 6I and 6J, both WT and TGF-β2 null buds exhibited nuclear LEF-1 and β-catenin localization, signs that the Wnt-noggin signaling pathway was intact. |
| T8945 |
44947-44949 |
IN |
denotes |
As |
| T8946 |
44950-44955 |
VBN |
denotes |
shown |
| T8948 |
44956-44958 |
IN |
denotes |
in |
| T8949 |
44959-44965 |
NN |
denotes |
Figure |
| T8950 |
44966-44968 |
NN |
denotes |
6I |
| T8951 |
44969-44972 |
CC |
denotes |
and |
| T8952 |
44973-44975 |
NN |
denotes |
6J |
| T8953 |
44975-44977 |
, |
denotes |
, |
| T8954 |
44977-44981 |
CC |
denotes |
both |
| T8955 |
44982-44984 |
NN |
denotes |
WT |
| T8957 |
44985-44988 |
CC |
denotes |
and |
| T8958 |
44989-44992 |
NN |
denotes |
TGF |
| T8960 |
44992-44993 |
HYPH |
denotes |
- |
| T8959 |
44993-44995 |
NN |
denotes |
β2 |
| T8956 |
44996-45000 |
JJ |
denotes |
null |
| T8961 |
45001-45005 |
NNS |
denotes |
buds |
| T8947 |
45006-45015 |
VBD |
denotes |
exhibited |
| T8962 |
45016-45023 |
JJ |
denotes |
nuclear |
| T8964 |
45024-45027 |
NN |
denotes |
LEF |
| T8965 |
45027-45028 |
HYPH |
denotes |
- |
| T8966 |
45028-45029 |
CD |
denotes |
1 |
| T8967 |
45030-45033 |
CC |
denotes |
and |
| T8968 |
45034-45035 |
NN |
denotes |
β |
| T8970 |
45035-45036 |
HYPH |
denotes |
- |
| T8969 |
45036-45043 |
NN |
denotes |
catenin |
| T8963 |
45044-45056 |
NN |
denotes |
localization |
| T8971 |
45056-45058 |
, |
denotes |
, |
| T8972 |
45058-45063 |
NNS |
denotes |
signs |
| T8973 |
45064-45068 |
IN |
denotes |
that |
| T8975 |
45069-45072 |
DT |
denotes |
the |
| T8977 |
45073-45076 |
NN |
denotes |
Wnt |
| T8979 |
45076-45077 |
HYPH |
denotes |
- |
| T8978 |
45077-45083 |
NN |
denotes |
noggin |
| T8980 |
45084-45093 |
NN |
denotes |
signaling |
| T8976 |
45094-45101 |
NN |
denotes |
pathway |
| T8974 |
45102-45105 |
VBD |
denotes |
was |
| T8981 |
45106-45112 |
JJ |
denotes |
intact |
| T8982 |
45112-45113 |
. |
denotes |
. |
| T8983 |
45113-45254 |
sentence |
denotes |
These data suggest that during hair follicle morphogenesis, TGF-β2 functions subsequently to Wnt/noggin-mediated determination of hair fate. |
| T8984 |
45114-45119 |
DT |
denotes |
These |
| T8985 |
45120-45124 |
NNS |
denotes |
data |
| T8986 |
45125-45132 |
VBP |
denotes |
suggest |
| T8987 |
45133-45137 |
IN |
denotes |
that |
| T8989 |
45138-45144 |
IN |
denotes |
during |
| T8990 |
45145-45149 |
NN |
denotes |
hair |
| T8991 |
45150-45158 |
NN |
denotes |
follicle |
| T8992 |
45159-45172 |
NN |
denotes |
morphogenesis |
| T8993 |
45172-45174 |
, |
denotes |
, |
| T8994 |
45174-45177 |
NN |
denotes |
TGF |
| T8996 |
45177-45178 |
HYPH |
denotes |
- |
| T8995 |
45178-45180 |
NN |
denotes |
β2 |
| T8988 |
45181-45190 |
VBZ |
denotes |
functions |
| T8997 |
45191-45203 |
RB |
denotes |
subsequently |
| T8998 |
45204-45206 |
IN |
denotes |
to |
| T8999 |
45207-45210 |
NN |
denotes |
Wnt |
| T9001 |
45210-45211 |
HYPH |
denotes |
/ |
| T9000 |
45211-45217 |
NN |
denotes |
noggin |
| T9003 |
45217-45218 |
HYPH |
denotes |
- |
| T9002 |
45218-45226 |
VBN |
denotes |
mediated |
| T9004 |
45227-45240 |
NN |
denotes |
determination |
| T9005 |
45241-45243 |
IN |
denotes |
of |
| T9006 |
45244-45248 |
NN |
denotes |
hair |
| T9007 |
45249-45253 |
NN |
denotes |
fate |
| T9008 |
45253-45254 |
. |
denotes |
. |
| T9009 |
45254-45472 |
sentence |
denotes |
Moreover, through activation of Snail gene expression, TGF-β2 appears to work in tandem with these other morphogens to down-regulate E-cadherin levels, which contributes to the activation of proliferative circuitries. |
| T9010 |
45255-45263 |
RB |
denotes |
Moreover |
| T9012 |
45263-45265 |
, |
denotes |
, |
| T9013 |
45265-45272 |
IN |
denotes |
through |
| T9014 |
45273-45283 |
NN |
denotes |
activation |
| T9015 |
45284-45286 |
IN |
denotes |
of |
| T9016 |
45287-45292 |
NN |
denotes |
Snail |
| T9018 |
45293-45297 |
NN |
denotes |
gene |
| T9017 |
45298-45308 |
NN |
denotes |
expression |
| T9019 |
45308-45310 |
, |
denotes |
, |
| T9020 |
45310-45313 |
NN |
denotes |
TGF |
| T9022 |
45313-45314 |
HYPH |
denotes |
- |
| T9021 |
45314-45316 |
NN |
denotes |
β2 |
| T9011 |
45317-45324 |
VBZ |
denotes |
appears |
| T9023 |
45325-45327 |
TO |
denotes |
to |
| T9024 |
45328-45332 |
VB |
denotes |
work |
| T9025 |
45333-45335 |
IN |
denotes |
in |
| T9026 |
45336-45342 |
NN |
denotes |
tandem |
| T9027 |
45343-45347 |
IN |
denotes |
with |
| T9028 |
45348-45353 |
DT |
denotes |
these |
| T9030 |
45354-45359 |
JJ |
denotes |
other |
| T9029 |
45360-45370 |
NNS |
denotes |
morphogens |
| T9031 |
45371-45373 |
TO |
denotes |
to |
| T9033 |
45374-45378 |
RB |
denotes |
down |
| T9034 |
45378-45379 |
HYPH |
denotes |
- |
| T9032 |
45379-45387 |
VB |
denotes |
regulate |
| T9035 |
45388-45389 |
NN |
denotes |
E |
| T9037 |
45389-45390 |
HYPH |
denotes |
- |
| T9036 |
45390-45398 |
NN |
denotes |
cadherin |
| T9038 |
45399-45405 |
NNS |
denotes |
levels |
| T9039 |
45405-45407 |
, |
denotes |
, |
| T9040 |
45407-45412 |
WDT |
denotes |
which |
| T9041 |
45413-45424 |
VBZ |
denotes |
contributes |
| T9042 |
45425-45427 |
IN |
denotes |
to |
| T9043 |
45428-45431 |
DT |
denotes |
the |
| T9044 |
45432-45442 |
NN |
denotes |
activation |
| T9045 |
45443-45445 |
IN |
denotes |
of |
| T9046 |
45446-45459 |
JJ |
denotes |
proliferative |
| T9047 |
45460-45471 |
NNS |
denotes |
circuitries |
| T9048 |
45471-45472 |
. |
denotes |
. |
| T9102 |
45485-45491 |
IN |
denotes |
During |
| T9104 |
45492-45499 |
NN |
denotes |
budding |
| T9105 |
45500-45513 |
NN |
denotes |
morphogenesis |
| T9106 |
45513-45515 |
, |
denotes |
, |
| T9107 |
45515-45527 |
VBG |
denotes |
intersecting |
| T9109 |
45528-45537 |
NN |
denotes |
signaling |
| T9108 |
45538-45546 |
NNS |
denotes |
networks |
| T9110 |
45547-45551 |
IN |
denotes |
from |
| T9111 |
45552-45555 |
DT |
denotes |
the |
| T9112 |
45556-45566 |
NN |
denotes |
epithelium |
| T9113 |
45567-45570 |
CC |
denotes |
and |
| T9114 |
45571-45581 |
NN |
denotes |
mesenchyme |
| T9103 |
45582-45588 |
VBP |
denotes |
govern |
| T9115 |
45589-45604 |
JJ |
denotes |
transcriptional |
| T9117 |
45604-45606 |
, |
denotes |
, |
| T9118 |
45606-45614 |
JJ |
denotes |
adhesive |
| T9119 |
45614-45616 |
, |
denotes |
, |
| T9120 |
45616-45624 |
NN |
denotes |
polarity |
| T9121 |
45624-45626 |
, |
denotes |
, |
| T9122 |
45626-45629 |
CC |
denotes |
and |
| T9123 |
45630-45638 |
NN |
denotes |
motility |
| T9116 |
45639-45647 |
NNS |
denotes |
programs |
| T9124 |
45648-45650 |
IN |
denotes |
in |
| T9125 |
45651-45656 |
DT |
denotes |
these |
| T9127 |
45657-45663 |
JJ |
denotes |
select |
| T9126 |
45664-45670 |
NNS |
denotes |
groups |
| T9128 |
45671-45673 |
IN |
denotes |
of |
| T9129 |
45674-45679 |
NNS |
denotes |
cells |
| T9130 |
45679-45680 |
. |
denotes |
. |
| T9131 |
45680-45801 |
sentence |
denotes |
The dynamic nuclear and cytosolic changes that take place during this time form the cornerstone for organ morphogenesis. |
| T9132 |
45681-45684 |
DT |
denotes |
The |
| T9134 |
45685-45692 |
JJ |
denotes |
dynamic |
| T9135 |
45693-45700 |
JJ |
denotes |
nuclear |
| T9136 |
45701-45704 |
CC |
denotes |
and |
| T9137 |
45705-45714 |
JJ |
denotes |
cytosolic |
| T9133 |
45715-45722 |
NNS |
denotes |
changes |
| T9139 |
45723-45727 |
WDT |
denotes |
that |
| T9140 |
45728-45732 |
VBP |
denotes |
take |
| T9141 |
45733-45738 |
NN |
denotes |
place |
| T9142 |
45739-45745 |
IN |
denotes |
during |
| T9143 |
45746-45750 |
DT |
denotes |
this |
| T9144 |
45751-45755 |
NN |
denotes |
time |
| T9138 |
45756-45760 |
VBP |
denotes |
form |
| T9145 |
45761-45764 |
DT |
denotes |
the |
| T9146 |
45765-45776 |
NN |
denotes |
cornerstone |
| T9147 |
45777-45780 |
IN |
denotes |
for |
| T9148 |
45781-45786 |
NN |
denotes |
organ |
| T9149 |
45787-45800 |
NN |
denotes |
morphogenesis |
| T9150 |
45800-45801 |
. |
denotes |
. |
| T9151 |
45801-46122 |
sentence |
denotes |
Two major challenges in understanding the mechanisms underlying a particular budding process are to order the temporal sequence of external cues involved and then to dissect how the cells of the developing bud translate these signals into the downstream events of cellular remodeling, proliferation, and differentiation. |
| T9152 |
45802-45805 |
CD |
denotes |
Two |
| T9154 |
45806-45811 |
JJ |
denotes |
major |
| T9153 |
45812-45822 |
NNS |
denotes |
challenges |
| T9156 |
45823-45825 |
IN |
denotes |
in |
| T9157 |
45826-45839 |
VBG |
denotes |
understanding |
| T9158 |
45840-45843 |
DT |
denotes |
the |
| T9159 |
45844-45854 |
NNS |
denotes |
mechanisms |
| T9160 |
45855-45865 |
VBG |
denotes |
underlying |
| T9161 |
45866-45867 |
DT |
denotes |
a |
| T9163 |
45868-45878 |
JJ |
denotes |
particular |
| T9164 |
45879-45886 |
NN |
denotes |
budding |
| T9162 |
45887-45894 |
NN |
denotes |
process |
| T9155 |
45895-45898 |
VBP |
denotes |
are |
| T9165 |
45899-45901 |
TO |
denotes |
to |
| T9166 |
45902-45907 |
VB |
denotes |
order |
| T9167 |
45908-45911 |
DT |
denotes |
the |
| T9169 |
45912-45920 |
JJ |
denotes |
temporal |
| T9168 |
45921-45929 |
NN |
denotes |
sequence |
| T9170 |
45930-45932 |
IN |
denotes |
of |
| T9171 |
45933-45941 |
JJ |
denotes |
external |
| T9172 |
45942-45946 |
NNS |
denotes |
cues |
| T9173 |
45947-45955 |
VBN |
denotes |
involved |
| T9174 |
45956-45959 |
CC |
denotes |
and |
| T9175 |
45960-45964 |
RB |
denotes |
then |
| T9177 |
45965-45967 |
TO |
denotes |
to |
| T9176 |
45968-45975 |
VB |
denotes |
dissect |
| T9178 |
45976-45979 |
WRB |
denotes |
how |
| T9180 |
45980-45983 |
DT |
denotes |
the |
| T9181 |
45984-45989 |
NNS |
denotes |
cells |
| T9182 |
45990-45992 |
IN |
denotes |
of |
| T9183 |
45993-45996 |
DT |
denotes |
the |
| T9185 |
45997-46007 |
VBG |
denotes |
developing |
| T9184 |
46008-46011 |
NN |
denotes |
bud |
| T9179 |
46012-46021 |
VB |
denotes |
translate |
| T9186 |
46022-46027 |
DT |
denotes |
these |
| T9187 |
46028-46035 |
NNS |
denotes |
signals |
| T9188 |
46036-46040 |
IN |
denotes |
into |
| T9189 |
46041-46044 |
DT |
denotes |
the |
| T9191 |
46045-46055 |
JJ |
denotes |
downstream |
| T9190 |
46056-46062 |
NNS |
denotes |
events |
| T9192 |
46063-46065 |
IN |
denotes |
of |
| T9193 |
46066-46074 |
JJ |
denotes |
cellular |
| T9194 |
46075-46085 |
NN |
denotes |
remodeling |
| T9195 |
46085-46087 |
, |
denotes |
, |
| T9196 |
46087-46100 |
NN |
denotes |
proliferation |
| T9197 |
46100-46102 |
, |
denotes |
, |
| T9198 |
46102-46105 |
CC |
denotes |
and |
| T9199 |
46106-46121 |
NN |
denotes |
differentiation |
| T9200 |
46121-46122 |
. |
denotes |
. |
| T9201 |
46122-46246 |
sentence |
denotes |
Our studies here provide some insights into how these events are orchestrated during hair bud formation in developing skin. |
| T9202 |
46123-46126 |
PRP$ |
denotes |
Our |
| T9203 |
46127-46134 |
NNS |
denotes |
studies |
| T9205 |
46135-46139 |
RB |
denotes |
here |
| T9204 |
46140-46147 |
VBP |
denotes |
provide |
| T9206 |
46148-46152 |
DT |
denotes |
some |
| T9207 |
46153-46161 |
NNS |
denotes |
insights |
| T9208 |
46162-46166 |
IN |
denotes |
into |
| T9209 |
46167-46170 |
WRB |
denotes |
how |
| T9211 |
46171-46176 |
DT |
denotes |
these |
| T9212 |
46177-46183 |
NNS |
denotes |
events |
| T9213 |
46184-46187 |
VBP |
denotes |
are |
| T9210 |
46188-46200 |
VBN |
denotes |
orchestrated |
| T9214 |
46201-46207 |
IN |
denotes |
during |
| T9215 |
46208-46212 |
NN |
denotes |
hair |
| T9216 |
46213-46216 |
NN |
denotes |
bud |
| T9217 |
46217-46226 |
NN |
denotes |
formation |
| T9218 |
46227-46229 |
IN |
denotes |
in |
| T9219 |
46230-46240 |
VBG |
denotes |
developing |
| T9220 |
46241-46245 |
NN |
denotes |
skin |
| T9221 |
46245-46246 |
. |
denotes |
. |
| T9653 |
46248-46257 |
NN |
denotes |
Signaling |
| T9654 |
46258-46264 |
IN |
denotes |
during |
| T9655 |
46265-46270 |
JJ |
denotes |
Early |
| T9657 |
46271-46275 |
NN |
denotes |
Hair |
| T9658 |
46276-46284 |
NN |
denotes |
Follicle |
| T9656 |
46285-46298 |
NN |
denotes |
Morphogenesis |
| T9659 |
46298-46624 |
sentence |
denotes |
Recent studies on hair bud morphogenesis suggest that Wnt signals likely from the epithelium and BMP inhibitory signals from the underlying mesenchyme converge to produce an active transcription factor complex involving β-catenin and LEF-1, which in turn plays a key role in specifying the hair follicle fate [4,29,30,36,37]. |
| T9660 |
46299-46305 |
JJ |
denotes |
Recent |
| T9661 |
46306-46313 |
NNS |
denotes |
studies |
| T9663 |
46314-46316 |
IN |
denotes |
on |
| T9664 |
46317-46321 |
NN |
denotes |
hair |
| T9665 |
46322-46325 |
NN |
denotes |
bud |
| T9666 |
46326-46339 |
NN |
denotes |
morphogenesis |
| T9662 |
46340-46347 |
VBP |
denotes |
suggest |
| T9667 |
46348-46352 |
IN |
denotes |
that |
| T9669 |
46353-46356 |
NN |
denotes |
Wnt |
| T9670 |
46357-46364 |
NNS |
denotes |
signals |
| T9671 |
46365-46371 |
RB |
denotes |
likely |
| T9672 |
46372-46376 |
IN |
denotes |
from |
| T9673 |
46377-46380 |
DT |
denotes |
the |
| T9674 |
46381-46391 |
NN |
denotes |
epithelium |
| T9675 |
46392-46395 |
CC |
denotes |
and |
| T9676 |
46396-46399 |
NN |
denotes |
BMP |
| T9678 |
46400-46410 |
JJ |
denotes |
inhibitory |
| T9677 |
46411-46418 |
NNS |
denotes |
signals |
| T9679 |
46419-46423 |
IN |
denotes |
from |
| T9680 |
46424-46427 |
DT |
denotes |
the |
| T9682 |
46428-46438 |
VBG |
denotes |
underlying |
| T9681 |
46439-46449 |
NN |
denotes |
mesenchyme |
| T9668 |
46450-46458 |
VBP |
denotes |
converge |
| T9683 |
46459-46461 |
TO |
denotes |
to |
| T9684 |
46462-46469 |
VB |
denotes |
produce |
| T9685 |
46470-46472 |
DT |
denotes |
an |
| T9687 |
46473-46479 |
JJ |
denotes |
active |
| T9688 |
46480-46493 |
NN |
denotes |
transcription |
| T9689 |
46494-46500 |
NN |
denotes |
factor |
| T9686 |
46501-46508 |
NN |
denotes |
complex |
| T9690 |
46509-46518 |
VBG |
denotes |
involving |
| T9691 |
46519-46520 |
NN |
denotes |
β |
| T9693 |
46520-46521 |
HYPH |
denotes |
- |
| T9692 |
46521-46528 |
NN |
denotes |
catenin |
| T9694 |
46529-46532 |
CC |
denotes |
and |
| T9695 |
46533-46536 |
NN |
denotes |
LEF |
| T9696 |
46536-46537 |
HYPH |
denotes |
- |
| T9697 |
46537-46538 |
CD |
denotes |
1 |
| T9698 |
46538-46540 |
, |
denotes |
, |
| T9699 |
46540-46545 |
WDT |
denotes |
which |
| T9701 |
46546-46548 |
IN |
denotes |
in |
| T9702 |
46549-46553 |
NN |
denotes |
turn |
| T9700 |
46554-46559 |
VBZ |
denotes |
plays |
| T9703 |
46560-46561 |
DT |
denotes |
a |
| T9705 |
46562-46565 |
JJ |
denotes |
key |
| T9704 |
46566-46570 |
NN |
denotes |
role |
| T9706 |
46571-46573 |
IN |
denotes |
in |
| T9707 |
46574-46584 |
VBG |
denotes |
specifying |
| T9708 |
46585-46588 |
DT |
denotes |
the |
| T9710 |
46589-46593 |
NN |
denotes |
hair |
| T9711 |
46594-46602 |
NN |
denotes |
follicle |
| T9709 |
46603-46607 |
NN |
denotes |
fate |
| T9712 |
46608-46609 |
-LRB- |
denotes |
[ |
| T9714 |
46609-46610 |
CD |
denotes |
4 |
| T9715 |
46610-46611 |
, |
denotes |
, |
| T9716 |
46611-46613 |
CD |
denotes |
29 |
| T9717 |
46613-46614 |
, |
denotes |
, |
| T9718 |
46614-46616 |
CD |
denotes |
30 |
| T9719 |
46616-46617 |
, |
denotes |
, |
| T9720 |
46617-46619 |
CD |
denotes |
36 |
| T9721 |
46619-46620 |
, |
denotes |
, |
| T9713 |
46620-46622 |
CD |
denotes |
37 |
| T9722 |
46622-46623 |
-RRB- |
denotes |
] |
| T9723 |
46623-46624 |
. |
denotes |
. |
| T9724 |
46624-46883 |
sentence |
denotes |
Sonic hedgehog (Shh) and TGF-β2 signaling also play essential roles in follicle morphogenesis, but in contrast to β-catenin null skin, in which follicle invaginations are absent [30], some hair buds still form in the absence of LEF-1, Shh, or TGF-β2 [32,38]. |
| T9725 |
46625-46630 |
JJ |
denotes |
Sonic |
| T9726 |
46631-46639 |
NN |
denotes |
hedgehog |
| T9728 |
46640-46641 |
-LRB- |
denotes |
( |
| T9729 |
46641-46644 |
NN |
denotes |
Shh |
| T9730 |
46644-46645 |
-RRB- |
denotes |
) |
| T9731 |
46646-46649 |
CC |
denotes |
and |
| T9732 |
46650-46653 |
NN |
denotes |
TGF |
| T9734 |
46653-46654 |
HYPH |
denotes |
- |
| T9733 |
46654-46656 |
NN |
denotes |
β2 |
| T9735 |
46657-46666 |
NN |
denotes |
signaling |
| T9736 |
46667-46671 |
RB |
denotes |
also |
| T9727 |
46672-46676 |
VBP |
denotes |
play |
| T9737 |
46677-46686 |
JJ |
denotes |
essential |
| T9738 |
46687-46692 |
NNS |
denotes |
roles |
| T9739 |
46693-46695 |
IN |
denotes |
in |
| T9740 |
46696-46704 |
NN |
denotes |
follicle |
| T9741 |
46705-46718 |
NN |
denotes |
morphogenesis |
| T9742 |
46718-46720 |
, |
denotes |
, |
| T9743 |
46720-46723 |
CC |
denotes |
but |
| T9744 |
46724-46726 |
IN |
denotes |
in |
| T9746 |
46727-46735 |
NN |
denotes |
contrast |
| T9747 |
46736-46738 |
IN |
denotes |
to |
| T9748 |
46739-46740 |
NN |
denotes |
β |
| T9750 |
46740-46741 |
HYPH |
denotes |
- |
| T9749 |
46741-46748 |
NN |
denotes |
catenin |
| T9751 |
46749-46753 |
JJ |
denotes |
null |
| T9752 |
46754-46758 |
NN |
denotes |
skin |
| T9753 |
46758-46760 |
, |
denotes |
, |
| T9754 |
46760-46762 |
IN |
denotes |
in |
| T9756 |
46763-46768 |
WDT |
denotes |
which |
| T9757 |
46769-46777 |
NN |
denotes |
follicle |
| T9758 |
46778-46791 |
NNS |
denotes |
invaginations |
| T9755 |
46792-46795 |
VBP |
denotes |
are |
| T9759 |
46796-46802 |
JJ |
denotes |
absent |
| T9760 |
46803-46804 |
-LRB- |
denotes |
[ |
| T9761 |
46804-46806 |
CD |
denotes |
30 |
| T9762 |
46806-46807 |
-RRB- |
denotes |
] |
| T9763 |
46807-46809 |
, |
denotes |
, |
| T9764 |
46809-46813 |
DT |
denotes |
some |
| T9766 |
46814-46818 |
NN |
denotes |
hair |
| T9765 |
46819-46823 |
NNS |
denotes |
buds |
| T9767 |
46824-46829 |
RB |
denotes |
still |
| T9745 |
46830-46834 |
VBP |
denotes |
form |
| T9768 |
46835-46837 |
IN |
denotes |
in |
| T9769 |
46838-46841 |
DT |
denotes |
the |
| T9770 |
46842-46849 |
NN |
denotes |
absence |
| T9771 |
46850-46852 |
IN |
denotes |
of |
| T9772 |
46853-46856 |
NN |
denotes |
LEF |
| T9773 |
46856-46857 |
HYPH |
denotes |
- |
| T9774 |
46857-46858 |
CD |
denotes |
1 |
| T9775 |
46858-46860 |
, |
denotes |
, |
| T9776 |
46860-46863 |
NN |
denotes |
Shh |
| T9777 |
46863-46865 |
, |
denotes |
, |
| T9778 |
46865-46867 |
CC |
denotes |
or |
| T9779 |
46868-46871 |
NN |
denotes |
TGF |
| T9781 |
46871-46872 |
HYPH |
denotes |
- |
| T9780 |
46872-46874 |
NN |
denotes |
β2 |
| T9782 |
46875-46876 |
-LRB- |
denotes |
[ |
| T9784 |
46876-46878 |
CD |
denotes |
32 |
| T9785 |
46878-46879 |
, |
denotes |
, |
| T9783 |
46879-46881 |
CD |
denotes |
38 |
| T9786 |
46881-46882 |
-RRB- |
denotes |
] |
| T9787 |
46882-46883 |
. |
denotes |
. |
| T9788 |
46883-47066 |
sentence |
denotes |
These likely reflect the first wave of follicle (i.e., guard hair) morphogenesis, which accounts for a small number (fewer than 5%) of hairs and is under distinct regulatory control. |
| T9789 |
46884-46889 |
DT |
denotes |
These |
| T9791 |
46890-46896 |
RB |
denotes |
likely |
| T9790 |
46897-46904 |
VBP |
denotes |
reflect |
| T9792 |
46905-46908 |
DT |
denotes |
the |
| T9794 |
46909-46914 |
JJ |
denotes |
first |
| T9793 |
46915-46919 |
NN |
denotes |
wave |
| T9795 |
46920-46922 |
IN |
denotes |
of |
| T9796 |
46923-46931 |
NN |
denotes |
follicle |
| T9798 |
46932-46933 |
-LRB- |
denotes |
( |
| T9800 |
46933-46937 |
FW |
denotes |
i.e. |
| T9801 |
46937-46939 |
, |
denotes |
, |
| T9802 |
46939-46944 |
NN |
denotes |
guard |
| T9799 |
46945-46949 |
NN |
denotes |
hair |
| T9803 |
46949-46950 |
-RRB- |
denotes |
) |
| T9797 |
46951-46964 |
NN |
denotes |
morphogenesis |
| T9804 |
46964-46966 |
, |
denotes |
, |
| T9805 |
46966-46971 |
WDT |
denotes |
which |
| T9806 |
46972-46980 |
VBZ |
denotes |
accounts |
| T9807 |
46981-46984 |
IN |
denotes |
for |
| T9808 |
46985-46986 |
DT |
denotes |
a |
| T9810 |
46987-46992 |
JJ |
denotes |
small |
| T9809 |
46993-46999 |
NN |
denotes |
number |
| T9811 |
47000-47001 |
-LRB- |
denotes |
( |
| T9812 |
47001-47006 |
JJR |
denotes |
fewer |
| T9814 |
47007-47011 |
IN |
denotes |
than |
| T9813 |
47012-47013 |
CD |
denotes |
5 |
| T9815 |
47013-47014 |
NN |
denotes |
% |
| T9816 |
47014-47015 |
-RRB- |
denotes |
) |
| T9817 |
47016-47018 |
IN |
denotes |
of |
| T9818 |
47019-47024 |
NNS |
denotes |
hairs |
| T9819 |
47025-47028 |
CC |
denotes |
and |
| T9820 |
47029-47031 |
VBZ |
denotes |
is |
| T9821 |
47032-47037 |
IN |
denotes |
under |
| T9822 |
47038-47046 |
JJ |
denotes |
distinct |
| T9824 |
47047-47057 |
JJ |
denotes |
regulatory |
| T9823 |
47058-47065 |
NN |
denotes |
control |
| T9825 |
47065-47066 |
. |
denotes |
. |
| T9826 |
47066-47230 |
sentence |
denotes |
Guard hairs form in the absence of LEF-1 and TGF-β2, and we have found that they also fail to express Snail at the budding stage of development (unpublished data). |
| T9827 |
47067-47072 |
NN |
denotes |
Guard |
| T9828 |
47073-47078 |
NNS |
denotes |
hairs |
| T9829 |
47079-47083 |
VBP |
denotes |
form |
| T9830 |
47084-47086 |
IN |
denotes |
in |
| T9831 |
47087-47090 |
DT |
denotes |
the |
| T9832 |
47091-47098 |
NN |
denotes |
absence |
| T9833 |
47099-47101 |
IN |
denotes |
of |
| T9834 |
47102-47105 |
NN |
denotes |
LEF |
| T9835 |
47105-47106 |
HYPH |
denotes |
- |
| T9836 |
47106-47107 |
CD |
denotes |
1 |
| T9837 |
47108-47111 |
CC |
denotes |
and |
| T9838 |
47112-47115 |
NN |
denotes |
TGF |
| T9840 |
47115-47116 |
HYPH |
denotes |
- |
| T9839 |
47116-47118 |
NN |
denotes |
β2 |
| T9841 |
47118-47120 |
, |
denotes |
, |
| T9842 |
47120-47123 |
CC |
denotes |
and |
| T9843 |
47124-47126 |
PRP |
denotes |
we |
| T9845 |
47127-47131 |
VBP |
denotes |
have |
| T9844 |
47132-47137 |
VBN |
denotes |
found |
| T9846 |
47138-47142 |
IN |
denotes |
that |
| T9848 |
47143-47147 |
PRP |
denotes |
they |
| T9849 |
47148-47152 |
RB |
denotes |
also |
| T9847 |
47153-47157 |
VBP |
denotes |
fail |
| T9850 |
47158-47160 |
TO |
denotes |
to |
| T9851 |
47161-47168 |
VB |
denotes |
express |
| T9852 |
47169-47174 |
NN |
denotes |
Snail |
| T9853 |
47175-47177 |
IN |
denotes |
at |
| T9854 |
47178-47181 |
DT |
denotes |
the |
| T9856 |
47182-47189 |
NN |
denotes |
budding |
| T9855 |
47190-47195 |
NN |
denotes |
stage |
| T9857 |
47196-47198 |
IN |
denotes |
of |
| T9858 |
47199-47210 |
NN |
denotes |
development |
| T9859 |
47211-47212 |
-LRB- |
denotes |
( |
| T9861 |
47212-47223 |
JJ |
denotes |
unpublished |
| T9860 |
47224-47228 |
NNS |
denotes |
data |
| T9862 |
47228-47229 |
-RRB- |
denotes |
) |
| T9863 |
47229-47230 |
. |
denotes |
. |
| T9864 |
47230-47299 |
sentence |
denotes |
How E-cadherin is regulated in guard hairs remains to be determined. |
| T9865 |
47231-47234 |
WRB |
denotes |
How |
| T9867 |
47235-47236 |
NN |
denotes |
E |
| T9869 |
47236-47237 |
HYPH |
denotes |
- |
| T9868 |
47237-47245 |
NN |
denotes |
cadherin |
| T9870 |
47246-47248 |
VBZ |
denotes |
is |
| T9866 |
47249-47258 |
VBN |
denotes |
regulated |
| T9872 |
47259-47261 |
IN |
denotes |
in |
| T9873 |
47262-47267 |
NN |
denotes |
guard |
| T9874 |
47268-47273 |
NNS |
denotes |
hairs |
| T9871 |
47274-47281 |
VBZ |
denotes |
remains |
| T9875 |
47282-47284 |
TO |
denotes |
to |
| T9877 |
47285-47287 |
VB |
denotes |
be |
| T9876 |
47288-47298 |
VBN |
denotes |
determined |
| T9878 |
47298-47299 |
. |
denotes |
. |
| T9879 |
47299-47533 |
sentence |
denotes |
Several candidates include other Snail family members such as Slug or twist, or alternatively, transcription factors involving β-catenin and a different member of the LEF-1/TCF/Sry-type HMG box (commonly known as SOX) family [39,40]. |
| T9880 |
47300-47307 |
JJ |
denotes |
Several |
| T9881 |
47308-47318 |
NNS |
denotes |
candidates |
| T9882 |
47319-47326 |
VBP |
denotes |
include |
| T9883 |
47327-47332 |
JJ |
denotes |
other |
| T9885 |
47333-47338 |
NN |
denotes |
Snail |
| T9886 |
47339-47345 |
NN |
denotes |
family |
| T9884 |
47346-47353 |
NNS |
denotes |
members |
| T9887 |
47354-47358 |
JJ |
denotes |
such |
| T9888 |
47359-47361 |
IN |
denotes |
as |
| T9889 |
47362-47366 |
NN |
denotes |
Slug |
| T9890 |
47367-47369 |
CC |
denotes |
or |
| T9891 |
47370-47375 |
NN |
denotes |
twist |
| T9892 |
47375-47377 |
, |
denotes |
, |
| T9893 |
47377-47379 |
CC |
denotes |
or |
| T9894 |
47380-47393 |
RB |
denotes |
alternatively |
| T9896 |
47393-47395 |
, |
denotes |
, |
| T9897 |
47395-47408 |
NN |
denotes |
transcription |
| T9895 |
47409-47416 |
NNS |
denotes |
factors |
| T9898 |
47417-47426 |
VBG |
denotes |
involving |
| T9899 |
47427-47428 |
NN |
denotes |
β |
| T9901 |
47428-47429 |
HYPH |
denotes |
- |
| T9900 |
47429-47436 |
NN |
denotes |
catenin |
| T9902 |
47437-47440 |
CC |
denotes |
and |
| T9903 |
47441-47442 |
DT |
denotes |
a |
| T9905 |
47443-47452 |
JJ |
denotes |
different |
| T9904 |
47453-47459 |
NN |
denotes |
member |
| T9906 |
47460-47462 |
IN |
denotes |
of |
| T9907 |
47463-47466 |
DT |
denotes |
the |
| T9909 |
47467-47470 |
NN |
denotes |
LEF |
| T9911 |
47470-47471 |
HYPH |
denotes |
- |
| T9912 |
47471-47472 |
CD |
denotes |
1 |
| T9913 |
47472-47473 |
HYPH |
denotes |
/ |
| T9914 |
47473-47476 |
NN |
denotes |
TCF |
| T9915 |
47476-47477 |
HYPH |
denotes |
/ |
| T9916 |
47477-47480 |
NN |
denotes |
Sry |
| T9918 |
47480-47481 |
HYPH |
denotes |
- |
| T9917 |
47481-47485 |
NN |
denotes |
type |
| T9919 |
47486-47489 |
NN |
denotes |
HMG |
| T9910 |
47490-47493 |
NN |
denotes |
box |
| T9920 |
47494-47495 |
-LRB- |
denotes |
( |
| T9922 |
47495-47503 |
RB |
denotes |
commonly |
| T9921 |
47504-47509 |
VBN |
denotes |
known |
| T9923 |
47510-47512 |
IN |
denotes |
as |
| T9924 |
47513-47516 |
NN |
denotes |
SOX |
| T9925 |
47516-47517 |
-RRB- |
denotes |
) |
| T9908 |
47518-47524 |
NN |
denotes |
family |
| T9926 |
47525-47526 |
-LRB- |
denotes |
[ |
| T9928 |
47526-47528 |
CD |
denotes |
39 |
| T9929 |
47528-47529 |
, |
denotes |
, |
| T9927 |
47529-47531 |
CD |
denotes |
40 |
| T9930 |
47531-47532 |
-RRB- |
denotes |
] |
| T9931 |
47532-47533 |
. |
denotes |
. |
| T9932 |
47533-47676 |
sentence |
denotes |
Further investigation will be required to determine whether the signaling pathway we have elucidated here is a theme with multiple variations. |
| T9933 |
47534-47541 |
JJ |
denotes |
Further |
| T9934 |
47542-47555 |
NN |
denotes |
investigation |
| T9936 |
47556-47560 |
MD |
denotes |
will |
| T9937 |
47561-47563 |
VB |
denotes |
be |
| T9935 |
47564-47572 |
VBN |
denotes |
required |
| T9938 |
47573-47575 |
TO |
denotes |
to |
| T9939 |
47576-47585 |
VB |
denotes |
determine |
| T9940 |
47586-47593 |
IN |
denotes |
whether |
| T9942 |
47594-47597 |
DT |
denotes |
the |
| T9944 |
47598-47607 |
NN |
denotes |
signaling |
| T9943 |
47608-47615 |
NN |
denotes |
pathway |
| T9945 |
47616-47618 |
PRP |
denotes |
we |
| T9947 |
47619-47623 |
VBP |
denotes |
have |
| T9946 |
47624-47634 |
VBN |
denotes |
elucidated |
| T9948 |
47635-47639 |
RB |
denotes |
here |
| T9941 |
47640-47642 |
VBZ |
denotes |
is |
| T9949 |
47643-47644 |
DT |
denotes |
a |
| T9950 |
47645-47650 |
NN |
denotes |
theme |
| T9951 |
47651-47655 |
IN |
denotes |
with |
| T9952 |
47656-47664 |
JJ |
denotes |
multiple |
| T9953 |
47665-47675 |
NNS |
denotes |
variations |
| T9954 |
47675-47676 |
. |
denotes |
. |
| T9955 |
47676-47758 |
sentence |
denotes |
TGF-βs are known to promote withdrawal of keratinocytes from the cell cycle [41]. |
| T9956 |
47677-47680 |
NN |
denotes |
TGF |
| T9958 |
47680-47681 |
HYPH |
denotes |
- |
| T9957 |
47681-47683 |
NNS |
denotes |
βs |
| T9960 |
47684-47687 |
VBP |
denotes |
are |
| T9959 |
47688-47693 |
VBN |
denotes |
known |
| T9961 |
47694-47696 |
TO |
denotes |
to |
| T9962 |
47697-47704 |
VB |
denotes |
promote |
| T9963 |
47705-47715 |
NN |
denotes |
withdrawal |
| T9964 |
47716-47718 |
IN |
denotes |
of |
| T9965 |
47719-47732 |
NNS |
denotes |
keratinocytes |
| T9966 |
47733-47737 |
IN |
denotes |
from |
| T9967 |
47738-47741 |
DT |
denotes |
the |
| T9969 |
47742-47746 |
NN |
denotes |
cell |
| T9968 |
47747-47752 |
NN |
denotes |
cycle |
| T9970 |
47753-47754 |
-LRB- |
denotes |
[ |
| T9971 |
47754-47756 |
CD |
denotes |
41 |
| T9972 |
47756-47757 |
-RRB- |
denotes |
] |
| T9973 |
47757-47758 |
. |
denotes |
. |
| T9974 |
47758-48040 |
sentence |
denotes |
Hence, when TGF-β2 protein was detected at the transition between the growing and destructive phases of the adult hair cycle, research initially and naturally focused on a role for this family member in cessation of growth and/or triggering apoptosis ([42] and references therein). |
| T9975 |
47759-47764 |
RB |
denotes |
Hence |
| T9977 |
47764-47766 |
, |
denotes |
, |
| T9978 |
47766-47770 |
WRB |
denotes |
when |
| T9980 |
47771-47774 |
NN |
denotes |
TGF |
| T9982 |
47774-47775 |
HYPH |
denotes |
- |
| T9981 |
47775-47777 |
NN |
denotes |
β2 |
| T9983 |
47778-47785 |
NN |
denotes |
protein |
| T9984 |
47786-47789 |
VBD |
denotes |
was |
| T9979 |
47790-47798 |
VBN |
denotes |
detected |
| T9985 |
47799-47801 |
IN |
denotes |
at |
| T9986 |
47802-47805 |
DT |
denotes |
the |
| T9987 |
47806-47816 |
NN |
denotes |
transition |
| T9988 |
47817-47824 |
IN |
denotes |
between |
| T9989 |
47825-47828 |
DT |
denotes |
the |
| T9991 |
47829-47836 |
NN |
denotes |
growing |
| T9993 |
47837-47840 |
CC |
denotes |
and |
| T9992 |
47841-47852 |
JJ |
denotes |
destructive |
| T9990 |
47853-47859 |
NNS |
denotes |
phases |
| T9994 |
47860-47862 |
IN |
denotes |
of |
| T9995 |
47863-47866 |
DT |
denotes |
the |
| T9997 |
47867-47872 |
JJ |
denotes |
adult |
| T9998 |
47873-47877 |
NN |
denotes |
hair |
| T9996 |
47878-47883 |
NN |
denotes |
cycle |
| T9999 |
47883-47885 |
, |
denotes |
, |
| T10000 |
47885-47893 |
NN |
denotes |
research |
| T10001 |
47894-47903 |
RB |
denotes |
initially |
| T10002 |
47904-47907 |
CC |
denotes |
and |
| T10003 |
47908-47917 |
RB |
denotes |
naturally |
| T9976 |
47918-47925 |
VBD |
denotes |
focused |
| T10004 |
47926-47928 |
IN |
denotes |
on |
| T10005 |
47929-47930 |
DT |
denotes |
a |
| T10006 |
47931-47935 |
NN |
denotes |
role |
| T10007 |
47936-47939 |
IN |
denotes |
for |
| T10008 |
47940-47944 |
DT |
denotes |
this |
| T10010 |
47945-47951 |
NN |
denotes |
family |
| T10009 |
47952-47958 |
NN |
denotes |
member |
| T10011 |
47959-47961 |
IN |
denotes |
in |
| T10012 |
47962-47971 |
NN |
denotes |
cessation |
| T10013 |
47972-47974 |
IN |
denotes |
of |
| T10014 |
47975-47981 |
NN |
denotes |
growth |
| T10015 |
47982-47985 |
CC |
denotes |
and |
| T10016 |
47985-47986 |
HYPH |
denotes |
/ |
| T10017 |
47986-47988 |
CC |
denotes |
or |
| T10018 |
47989-47999 |
VBG |
denotes |
triggering |
| T10019 |
48000-48009 |
NN |
denotes |
apoptosis |
| T10020 |
48010-48011 |
-LRB- |
denotes |
( |
| T10022 |
48011-48012 |
-LRB- |
denotes |
[ |
| T10021 |
48012-48014 |
CD |
denotes |
42 |
| T10023 |
48014-48015 |
-RRB- |
denotes |
] |
| T10024 |
48016-48019 |
CC |
denotes |
and |
| T10025 |
48020-48030 |
NNS |
denotes |
references |
| T10026 |
48031-48038 |
RB |
denotes |
therein |
| T10027 |
48038-48039 |
-RRB- |
denotes |
) |
| T10028 |
48039-48040 |
. |
denotes |
. |
| T10029 |
48040-48231 |
sentence |
denotes |
However, in contrast to TGF-β1-null skin, which exhibits an extended growing phase of postnatal hair follicles, TGF-β2-null skin displays an embryonic block in follicle bud progression [32]. |
| T10030 |
48041-48048 |
RB |
denotes |
However |
| T10032 |
48048-48050 |
, |
denotes |
, |
| T10033 |
48050-48052 |
IN |
denotes |
in |
| T10034 |
48053-48061 |
NN |
denotes |
contrast |
| T10035 |
48062-48064 |
IN |
denotes |
to |
| T10036 |
48065-48068 |
NN |
denotes |
TGF |
| T10038 |
48068-48069 |
HYPH |
denotes |
- |
| T10037 |
48069-48071 |
NN |
denotes |
β1 |
| T10040 |
48071-48072 |
HYPH |
denotes |
- |
| T10039 |
48072-48076 |
JJ |
denotes |
null |
| T10041 |
48077-48081 |
NN |
denotes |
skin |
| T10042 |
48081-48083 |
, |
denotes |
, |
| T10043 |
48083-48088 |
WDT |
denotes |
which |
| T10044 |
48089-48097 |
VBZ |
denotes |
exhibits |
| T10045 |
48098-48100 |
DT |
denotes |
an |
| T10047 |
48101-48109 |
JJ |
denotes |
extended |
| T10048 |
48110-48117 |
NN |
denotes |
growing |
| T10046 |
48118-48123 |
NN |
denotes |
phase |
| T10049 |
48124-48126 |
IN |
denotes |
of |
| T10050 |
48127-48136 |
JJ |
denotes |
postnatal |
| T10052 |
48137-48141 |
NN |
denotes |
hair |
| T10051 |
48142-48151 |
NNS |
denotes |
follicles |
| T10053 |
48151-48153 |
, |
denotes |
, |
| T10054 |
48153-48156 |
NN |
denotes |
TGF |
| T10056 |
48156-48157 |
HYPH |
denotes |
- |
| T10055 |
48157-48159 |
NN |
denotes |
β2 |
| T10058 |
48159-48160 |
HYPH |
denotes |
- |
| T10057 |
48160-48164 |
JJ |
denotes |
null |
| T10059 |
48165-48169 |
NN |
denotes |
skin |
| T10031 |
48170-48178 |
VBZ |
denotes |
displays |
| T10060 |
48179-48181 |
DT |
denotes |
an |
| T10062 |
48182-48191 |
JJ |
denotes |
embryonic |
| T10061 |
48192-48197 |
NN |
denotes |
block |
| T10063 |
48198-48200 |
IN |
denotes |
in |
| T10064 |
48201-48209 |
NN |
denotes |
follicle |
| T10065 |
48210-48213 |
NN |
denotes |
bud |
| T10066 |
48214-48225 |
NN |
denotes |
progression |
| T10067 |
48226-48227 |
-LRB- |
denotes |
[ |
| T10068 |
48227-48229 |
CD |
denotes |
32 |
| T10069 |
48229-48230 |
-RRB- |
denotes |
] |
| T10070 |
48230-48231 |
. |
denotes |
. |
| T10071 |
48231-48502 |
sentence |
denotes |
Although this phenotype is consistent with TGF-β2's embryonic expression patterns [33], about 50% of TGF-β2 null buds appear unable to progress to the down-growth phase, a feature that cannot be explained readily on the basis of previously established effects of TGF-βs. |
| T10072 |
48232-48240 |
IN |
denotes |
Although |
| T10074 |
48241-48245 |
DT |
denotes |
this |
| T10075 |
48246-48255 |
NN |
denotes |
phenotype |
| T10073 |
48256-48258 |
VBZ |
denotes |
is |
| T10077 |
48259-48269 |
JJ |
denotes |
consistent |
| T10078 |
48270-48274 |
IN |
denotes |
with |
| T10079 |
48275-48278 |
NN |
denotes |
TGF |
| T10081 |
48278-48279 |
HYPH |
denotes |
- |
| T10080 |
48279-48281 |
NN |
denotes |
β2 |
| T10083 |
48281-48283 |
POS |
denotes |
's |
| T10084 |
48284-48293 |
JJ |
denotes |
embryonic |
| T10085 |
48294-48304 |
NN |
denotes |
expression |
| T10082 |
48305-48313 |
NNS |
denotes |
patterns |
| T10086 |
48314-48315 |
-LRB- |
denotes |
[ |
| T10087 |
48315-48317 |
CD |
denotes |
33 |
| T10088 |
48317-48318 |
-RRB- |
denotes |
] |
| T10089 |
48318-48320 |
, |
denotes |
, |
| T10090 |
48320-48325 |
IN |
denotes |
about |
| T10091 |
48326-48328 |
CD |
denotes |
50 |
| T10092 |
48328-48329 |
NN |
denotes |
% |
| T10093 |
48330-48332 |
IN |
denotes |
of |
| T10094 |
48333-48336 |
NN |
denotes |
TGF |
| T10096 |
48336-48337 |
HYPH |
denotes |
- |
| T10095 |
48337-48339 |
NN |
denotes |
β2 |
| T10097 |
48340-48344 |
JJ |
denotes |
null |
| T10098 |
48345-48349 |
NNS |
denotes |
buds |
| T10076 |
48350-48356 |
VBP |
denotes |
appear |
| T10099 |
48357-48363 |
JJ |
denotes |
unable |
| T10100 |
48364-48366 |
TO |
denotes |
to |
| T10101 |
48367-48375 |
VB |
denotes |
progress |
| T10102 |
48376-48378 |
IN |
denotes |
to |
| T10103 |
48379-48382 |
DT |
denotes |
the |
| T10105 |
48383-48387 |
JJ |
denotes |
down |
| T10107 |
48387-48388 |
HYPH |
denotes |
- |
| T10106 |
48388-48394 |
NN |
denotes |
growth |
| T10104 |
48395-48400 |
NN |
denotes |
phase |
| T10108 |
48400-48402 |
, |
denotes |
, |
| T10109 |
48402-48403 |
DT |
denotes |
a |
| T10110 |
48404-48411 |
NN |
denotes |
feature |
| T10111 |
48412-48416 |
WDT |
denotes |
that |
| T10113 |
48417-48420 |
MD |
denotes |
can |
| T10114 |
48420-48423 |
RB |
denotes |
not |
| T10115 |
48424-48426 |
VB |
denotes |
be |
| T10112 |
48427-48436 |
VBN |
denotes |
explained |
| T10116 |
48437-48444 |
RB |
denotes |
readily |
| T10117 |
48445-48447 |
IN |
denotes |
on |
| T10118 |
48448-48451 |
DT |
denotes |
the |
| T10119 |
48452-48457 |
NN |
denotes |
basis |
| T10120 |
48458-48460 |
IN |
denotes |
of |
| T10121 |
48461-48471 |
RB |
denotes |
previously |
| T10122 |
48472-48483 |
VBN |
denotes |
established |
| T10123 |
48484-48491 |
NNS |
denotes |
effects |
| T10124 |
48492-48494 |
IN |
denotes |
of |
| T10125 |
48495-48498 |
NN |
denotes |
TGF |
| T10127 |
48498-48499 |
HYPH |
denotes |
- |
| T10126 |
48499-48501 |
NNS |
denotes |
βs |
| T10128 |
48501-48502 |
. |
denotes |
. |
| T10129 |
48502-48777 |
sentence |
denotes |
Our finding that TGF-β2 is upstream from Ki67 expression and MAPK activation lends further support to the notion that hair follicle keratinocytes at this early stage of development react to TGF-β2 signaling in a fashion opposite to that typically expected for TGF-β factors. |
| T10130 |
48503-48506 |
PRP$ |
denotes |
Our |
| T10131 |
48507-48514 |
NN |
denotes |
finding |
| T10133 |
48515-48519 |
IN |
denotes |
that |
| T10135 |
48520-48523 |
NN |
denotes |
TGF |
| T10137 |
48523-48524 |
HYPH |
denotes |
- |
| T10136 |
48524-48526 |
NN |
denotes |
β2 |
| T10134 |
48527-48529 |
VBZ |
denotes |
is |
| T10138 |
48530-48538 |
RB |
denotes |
upstream |
| T10139 |
48539-48543 |
IN |
denotes |
from |
| T10140 |
48544-48548 |
NN |
denotes |
Ki67 |
| T10141 |
48549-48559 |
NN |
denotes |
expression |
| T10142 |
48560-48563 |
CC |
denotes |
and |
| T10143 |
48564-48568 |
NN |
denotes |
MAPK |
| T10144 |
48569-48579 |
NN |
denotes |
activation |
| T10132 |
48580-48585 |
VBZ |
denotes |
lends |
| T10145 |
48586-48593 |
JJ |
denotes |
further |
| T10146 |
48594-48601 |
NN |
denotes |
support |
| T10147 |
48602-48604 |
IN |
denotes |
to |
| T10148 |
48605-48608 |
DT |
denotes |
the |
| T10149 |
48609-48615 |
NN |
denotes |
notion |
| T10150 |
48616-48620 |
IN |
denotes |
that |
| T10152 |
48621-48625 |
NN |
denotes |
hair |
| T10153 |
48626-48634 |
NN |
denotes |
follicle |
| T10154 |
48635-48648 |
NNS |
denotes |
keratinocytes |
| T10155 |
48649-48651 |
IN |
denotes |
at |
| T10156 |
48652-48656 |
DT |
denotes |
this |
| T10158 |
48657-48662 |
JJ |
denotes |
early |
| T10157 |
48663-48668 |
NN |
denotes |
stage |
| T10159 |
48669-48671 |
IN |
denotes |
of |
| T10160 |
48672-48683 |
NN |
denotes |
development |
| T10151 |
48684-48689 |
VBP |
denotes |
react |
| T10161 |
48690-48692 |
IN |
denotes |
to |
| T10162 |
48693-48696 |
NN |
denotes |
TGF |
| T10164 |
48696-48697 |
HYPH |
denotes |
- |
| T10163 |
48697-48699 |
NN |
denotes |
β2 |
| T10165 |
48700-48709 |
NN |
denotes |
signaling |
| T10166 |
48710-48712 |
IN |
denotes |
in |
| T10167 |
48713-48714 |
DT |
denotes |
a |
| T10168 |
48715-48722 |
NN |
denotes |
fashion |
| T10169 |
48723-48731 |
JJ |
denotes |
opposite |
| T10170 |
48732-48734 |
IN |
denotes |
to |
| T10171 |
48735-48739 |
DT |
denotes |
that |
| T10172 |
48740-48749 |
RB |
denotes |
typically |
| T10173 |
48750-48758 |
VBN |
denotes |
expected |
| T10174 |
48759-48762 |
IN |
denotes |
for |
| T10175 |
48763-48766 |
NN |
denotes |
TGF |
| T10177 |
48766-48767 |
HYPH |
denotes |
- |
| T10176 |
48767-48768 |
NN |
denotes |
β |
| T10178 |
48769-48776 |
NNS |
denotes |
factors |
| T10179 |
48776-48777 |
. |
denotes |
. |
| T10180 |
48777-48895 |
sentence |
denotes |
This said, based upon pSMAD2 immunohistochemistry, the immediate steps of downstream signaling appeared to be intact. |
| T10181 |
48778-48782 |
DT |
denotes |
This |
| T10182 |
48783-48787 |
VBN |
denotes |
said |
| T10184 |
48787-48789 |
, |
denotes |
, |
| T10185 |
48789-48794 |
VBN |
denotes |
based |
| T10186 |
48795-48799 |
IN |
denotes |
upon |
| T10187 |
48800-48806 |
NN |
denotes |
pSMAD2 |
| T10188 |
48807-48827 |
NN |
denotes |
immunohistochemistry |
| T10189 |
48827-48829 |
, |
denotes |
, |
| T10190 |
48829-48832 |
DT |
denotes |
the |
| T10192 |
48833-48842 |
JJ |
denotes |
immediate |
| T10191 |
48843-48848 |
NNS |
denotes |
steps |
| T10193 |
48849-48851 |
IN |
denotes |
of |
| T10194 |
48852-48862 |
JJ |
denotes |
downstream |
| T10195 |
48863-48872 |
NN |
denotes |
signaling |
| T10183 |
48873-48881 |
VBD |
denotes |
appeared |
| T10196 |
48882-48884 |
TO |
denotes |
to |
| T10197 |
48885-48887 |
VB |
denotes |
be |
| T10198 |
48888-48894 |
JJ |
denotes |
intact |
| T10199 |
48894-48895 |
. |
denotes |
. |
| T10200 |
48895-49031 |
sentence |
denotes |
Thus, we surmise that the proliferative outcome is likely to be rooted in differences in the repertoire of activated SMAD target genes. |
| T10201 |
48896-48900 |
RB |
denotes |
Thus |
| T10203 |
48900-48902 |
, |
denotes |
, |
| T10204 |
48902-48904 |
PRP |
denotes |
we |
| T10202 |
48905-48912 |
VBP |
denotes |
surmise |
| T10205 |
48913-48917 |
IN |
denotes |
that |
| T10207 |
48918-48921 |
DT |
denotes |
the |
| T10209 |
48922-48935 |
JJ |
denotes |
proliferative |
| T10208 |
48936-48943 |
NN |
denotes |
outcome |
| T10206 |
48944-48946 |
VBZ |
denotes |
is |
| T10210 |
48947-48953 |
JJ |
denotes |
likely |
| T10211 |
48954-48956 |
TO |
denotes |
to |
| T10213 |
48957-48959 |
VB |
denotes |
be |
| T10212 |
48960-48966 |
VBN |
denotes |
rooted |
| T10214 |
48967-48969 |
IN |
denotes |
in |
| T10215 |
48970-48981 |
NNS |
denotes |
differences |
| T10216 |
48982-48984 |
IN |
denotes |
in |
| T10217 |
48985-48988 |
DT |
denotes |
the |
| T10218 |
48989-48999 |
NN |
denotes |
repertoire |
| T10219 |
49000-49002 |
IN |
denotes |
of |
| T10220 |
49003-49012 |
VBN |
denotes |
activated |
| T10222 |
49013-49017 |
NN |
denotes |
SMAD |
| T10223 |
49018-49024 |
NN |
denotes |
target |
| T10221 |
49025-49030 |
NNS |
denotes |
genes |
| T10224 |
49030-49031 |
. |
denotes |
. |
| T10225 |
49031-49296 |
sentence |
denotes |
In this regard, the positive effects of TGF-β2 on proliferation within the hair bud may be more analogous to what has been seen in progression of squamous cell carcinoma to metastatic carcinoma [43] rather than that typically observed for keratinocytes [44,45,46]. |
| T10226 |
49032-49034 |
IN |
denotes |
In |
| T10228 |
49035-49039 |
DT |
denotes |
this |
| T10229 |
49040-49046 |
NN |
denotes |
regard |
| T10230 |
49046-49048 |
, |
denotes |
, |
| T10231 |
49048-49051 |
DT |
denotes |
the |
| T10233 |
49052-49060 |
JJ |
denotes |
positive |
| T10232 |
49061-49068 |
NNS |
denotes |
effects |
| T10234 |
49069-49071 |
IN |
denotes |
of |
| T10235 |
49072-49075 |
NN |
denotes |
TGF |
| T10237 |
49075-49076 |
HYPH |
denotes |
- |
| T10236 |
49076-49078 |
NN |
denotes |
β2 |
| T10238 |
49079-49081 |
IN |
denotes |
on |
| T10239 |
49082-49095 |
NN |
denotes |
proliferation |
| T10240 |
49096-49102 |
IN |
denotes |
within |
| T10241 |
49103-49106 |
DT |
denotes |
the |
| T10243 |
49107-49111 |
NN |
denotes |
hair |
| T10242 |
49112-49115 |
NN |
denotes |
bud |
| T10244 |
49116-49119 |
MD |
denotes |
may |
| T10227 |
49120-49122 |
VB |
denotes |
be |
| T10245 |
49123-49127 |
RBR |
denotes |
more |
| T10246 |
49128-49137 |
JJ |
denotes |
analogous |
| T10247 |
49138-49140 |
IN |
denotes |
to |
| T10248 |
49141-49145 |
WP |
denotes |
what |
| T10250 |
49146-49149 |
VBZ |
denotes |
has |
| T10251 |
49150-49154 |
VBN |
denotes |
been |
| T10249 |
49155-49159 |
VBN |
denotes |
seen |
| T10252 |
49160-49162 |
IN |
denotes |
in |
| T10253 |
49163-49174 |
NN |
denotes |
progression |
| T10254 |
49175-49177 |
IN |
denotes |
of |
| T10255 |
49178-49186 |
JJ |
denotes |
squamous |
| T10256 |
49187-49191 |
NN |
denotes |
cell |
| T10257 |
49192-49201 |
NN |
denotes |
carcinoma |
| T10258 |
49202-49204 |
IN |
denotes |
to |
| T10259 |
49205-49215 |
JJ |
denotes |
metastatic |
| T10260 |
49216-49225 |
NN |
denotes |
carcinoma |
| T10261 |
49226-49227 |
-LRB- |
denotes |
[ |
| T10262 |
49227-49229 |
CD |
denotes |
43 |
| T10263 |
49229-49230 |
-RRB- |
denotes |
] |
| T10264 |
49231-49237 |
RB |
denotes |
rather |
| T10265 |
49238-49242 |
IN |
denotes |
than |
| T10266 |
49243-49247 |
DT |
denotes |
that |
| T10267 |
49248-49257 |
RB |
denotes |
typically |
| T10268 |
49258-49266 |
VBN |
denotes |
observed |
| T10269 |
49267-49270 |
IN |
denotes |
for |
| T10270 |
49271-49284 |
NNS |
denotes |
keratinocytes |
| T10271 |
49285-49286 |
-LRB- |
denotes |
[ |
| T10273 |
49286-49288 |
CD |
denotes |
44 |
| T10274 |
49288-49289 |
, |
denotes |
, |
| T10275 |
49289-49291 |
CD |
denotes |
45 |
| T10276 |
49291-49292 |
, |
denotes |
, |
| T10272 |
49292-49294 |
CD |
denotes |
46 |
| T10277 |
49294-49295 |
-RRB- |
denotes |
] |
| T10278 |
49295-49296 |
. |
denotes |
. |
| T10279 |
49296-49490 |
sentence |
denotes |
The prior identification of the Snail gene as a potential target of TGF-β signaling [15] was intriguing, given the temporal wave of Snail gene expression that occurs in the developing hair bud. |
| T10280 |
49297-49300 |
DT |
denotes |
The |
| T10282 |
49301-49306 |
JJ |
denotes |
prior |
| T10281 |
49307-49321 |
NN |
denotes |
identification |
| T10284 |
49322-49324 |
IN |
denotes |
of |
| T10285 |
49325-49328 |
DT |
denotes |
the |
| T10287 |
49329-49334 |
NN |
denotes |
Snail |
| T10286 |
49335-49339 |
NN |
denotes |
gene |
| T10288 |
49340-49342 |
IN |
denotes |
as |
| T10289 |
49343-49344 |
DT |
denotes |
a |
| T10291 |
49345-49354 |
JJ |
denotes |
potential |
| T10290 |
49355-49361 |
NN |
denotes |
target |
| T10292 |
49362-49364 |
IN |
denotes |
of |
| T10293 |
49365-49368 |
NN |
denotes |
TGF |
| T10295 |
49368-49369 |
HYPH |
denotes |
- |
| T10294 |
49369-49370 |
NN |
denotes |
β |
| T10296 |
49371-49380 |
NN |
denotes |
signaling |
| T10297 |
49381-49382 |
-LRB- |
denotes |
[ |
| T10298 |
49382-49384 |
CD |
denotes |
15 |
| T10299 |
49384-49385 |
-RRB- |
denotes |
] |
| T10283 |
49386-49389 |
VBD |
denotes |
was |
| T10300 |
49390-49400 |
JJ |
denotes |
intriguing |
| T10301 |
49400-49402 |
, |
denotes |
, |
| T10302 |
49402-49407 |
VBN |
denotes |
given |
| T10303 |
49408-49411 |
DT |
denotes |
the |
| T10305 |
49412-49420 |
JJ |
denotes |
temporal |
| T10304 |
49421-49425 |
NN |
denotes |
wave |
| T10306 |
49426-49428 |
IN |
denotes |
of |
| T10307 |
49429-49434 |
NN |
denotes |
Snail |
| T10309 |
49435-49439 |
NN |
denotes |
gene |
| T10308 |
49440-49450 |
NN |
denotes |
expression |
| T10310 |
49451-49455 |
WDT |
denotes |
that |
| T10311 |
49456-49462 |
VBZ |
denotes |
occurs |
| T10312 |
49463-49465 |
IN |
denotes |
in |
| T10313 |
49466-49469 |
DT |
denotes |
the |
| T10315 |
49470-49480 |
VBG |
denotes |
developing |
| T10316 |
49481-49485 |
NN |
denotes |
hair |
| T10314 |
49486-49489 |
NN |
denotes |
bud |
| T10317 |
49489-49490 |
. |
denotes |
. |
| T10318 |
49490-49661 |
sentence |
denotes |
The additional correlation between epithelial hyperproliferation and Snail transgene expression further fostered our interest in a possible link between TGF-β2 and Snail. |
| T10319 |
49491-49494 |
DT |
denotes |
The |
| T10321 |
49495-49505 |
JJ |
denotes |
additional |
| T10320 |
49506-49517 |
NN |
denotes |
correlation |
| T10323 |
49518-49525 |
IN |
denotes |
between |
| T10324 |
49526-49536 |
JJ |
denotes |
epithelial |
| T10325 |
49537-49555 |
NN |
denotes |
hyperproliferation |
| T10326 |
49556-49559 |
CC |
denotes |
and |
| T10327 |
49560-49565 |
NN |
denotes |
Snail |
| T10329 |
49566-49575 |
NN |
denotes |
transgene |
| T10328 |
49576-49586 |
NN |
denotes |
expression |
| T10330 |
49587-49594 |
RB |
denotes |
further |
| T10322 |
49595-49603 |
VBD |
denotes |
fostered |
| T10331 |
49604-49607 |
PRP$ |
denotes |
our |
| T10332 |
49608-49616 |
NN |
denotes |
interest |
| T10333 |
49617-49619 |
IN |
denotes |
in |
| T10334 |
49620-49621 |
DT |
denotes |
a |
| T10336 |
49622-49630 |
JJ |
denotes |
possible |
| T10335 |
49631-49635 |
NN |
denotes |
link |
| T10337 |
49636-49643 |
IN |
denotes |
between |
| T10338 |
49644-49647 |
NN |
denotes |
TGF |
| T10340 |
49647-49648 |
HYPH |
denotes |
- |
| T10339 |
49648-49650 |
NN |
denotes |
β2 |
| T10341 |
49651-49654 |
CC |
denotes |
and |
| T10342 |
49655-49660 |
NN |
denotes |
Snail |
| T10343 |
49660-49661 |
. |
denotes |
. |
| T10344 |
49661-49839 |
sentence |
denotes |
Our functional studies demonstrate that without TGF-β2, Snail expression is abolished in the mutant hair buds, and conversely, in K14-Smad2 skin, Snail is ectopically activated. |
| T10345 |
49662-49665 |
PRP$ |
denotes |
Our |
| T10347 |
49666-49676 |
JJ |
denotes |
functional |
| T10346 |
49677-49684 |
NNS |
denotes |
studies |
| T10348 |
49685-49696 |
VBP |
denotes |
demonstrate |
| T10349 |
49697-49701 |
IN |
denotes |
that |
| T10351 |
49702-49709 |
IN |
denotes |
without |
| T10352 |
49710-49713 |
NN |
denotes |
TGF |
| T10354 |
49713-49714 |
HYPH |
denotes |
- |
| T10353 |
49714-49716 |
NN |
denotes |
β2 |
| T10355 |
49716-49718 |
, |
denotes |
, |
| T10356 |
49718-49723 |
NN |
denotes |
Snail |
| T10357 |
49724-49734 |
NN |
denotes |
expression |
| T10358 |
49735-49737 |
VBZ |
denotes |
is |
| T10350 |
49738-49747 |
VBN |
denotes |
abolished |
| T10359 |
49748-49750 |
IN |
denotes |
in |
| T10360 |
49751-49754 |
DT |
denotes |
the |
| T10362 |
49755-49761 |
NN |
denotes |
mutant |
| T10363 |
49762-49766 |
NN |
denotes |
hair |
| T10361 |
49767-49771 |
NNS |
denotes |
buds |
| T10364 |
49771-49773 |
, |
denotes |
, |
| T10365 |
49773-49776 |
CC |
denotes |
and |
| T10366 |
49777-49787 |
RB |
denotes |
conversely |
| T10368 |
49787-49789 |
, |
denotes |
, |
| T10369 |
49789-49791 |
IN |
denotes |
in |
| T10370 |
49792-49795 |
NN |
denotes |
K14 |
| T10372 |
49795-49796 |
HYPH |
denotes |
- |
| T10371 |
49796-49801 |
NN |
denotes |
Smad2 |
| T10373 |
49802-49806 |
NN |
denotes |
skin |
| T10374 |
49806-49808 |
, |
denotes |
, |
| T10375 |
49808-49813 |
NN |
denotes |
Snail |
| T10376 |
49814-49816 |
VBZ |
denotes |
is |
| T10377 |
49817-49828 |
RB |
denotes |
ectopically |
| T10367 |
49829-49838 |
VBN |
denotes |
activated |
| T10378 |
49838-49839 |
. |
denotes |
. |
| T10379 |
49839-50070 |
sentence |
denotes |
Moreover, our in vitro studies indicate that even sustained TGF-β2 exposure may cause only a transient induction of Snail, offering a possible explanation as to why Snail is so briefly expressed during hair follicle morphogenesis. |
| T10380 |
49840-49848 |
RB |
denotes |
Moreover |
| T10382 |
49848-49850 |
, |
denotes |
, |
| T10383 |
49850-49853 |
PRP$ |
denotes |
our |
| T10385 |
49854-49856 |
FW |
denotes |
in |
| T10386 |
49857-49862 |
FW |
denotes |
vitro |
| T10384 |
49863-49870 |
NNS |
denotes |
studies |
| T10381 |
49871-49879 |
VBP |
denotes |
indicate |
| T10387 |
49880-49884 |
IN |
denotes |
that |
| T10389 |
49885-49889 |
RB |
denotes |
even |
| T10391 |
49890-49899 |
JJ |
denotes |
sustained |
| T10392 |
49900-49903 |
NN |
denotes |
TGF |
| T10394 |
49903-49904 |
HYPH |
denotes |
- |
| T10393 |
49904-49906 |
NN |
denotes |
β2 |
| T10390 |
49907-49915 |
NN |
denotes |
exposure |
| T10395 |
49916-49919 |
MD |
denotes |
may |
| T10388 |
49920-49925 |
VB |
denotes |
cause |
| T10396 |
49926-49930 |
RB |
denotes |
only |
| T10398 |
49931-49932 |
DT |
denotes |
a |
| T10399 |
49933-49942 |
JJ |
denotes |
transient |
| T10397 |
49943-49952 |
NN |
denotes |
induction |
| T10400 |
49953-49955 |
IN |
denotes |
of |
| T10401 |
49956-49961 |
NN |
denotes |
Snail |
| T10402 |
49961-49963 |
, |
denotes |
, |
| T10403 |
49963-49971 |
VBG |
denotes |
offering |
| T10404 |
49972-49973 |
DT |
denotes |
a |
| T10406 |
49974-49982 |
JJ |
denotes |
possible |
| T10405 |
49983-49994 |
NN |
denotes |
explanation |
| T10407 |
49995-49997 |
IN |
denotes |
as |
| T10408 |
49998-50000 |
IN |
denotes |
to |
| T10409 |
50001-50004 |
WRB |
denotes |
why |
| T10411 |
50005-50010 |
NN |
denotes |
Snail |
| T10412 |
50011-50013 |
VBZ |
denotes |
is |
| T10413 |
50014-50016 |
RB |
denotes |
so |
| T10414 |
50017-50024 |
RB |
denotes |
briefly |
| T10410 |
50025-50034 |
VBN |
denotes |
expressed |
| T10415 |
50035-50041 |
IN |
denotes |
during |
| T10416 |
50042-50046 |
NN |
denotes |
hair |
| T10417 |
50047-50055 |
NN |
denotes |
follicle |
| T10418 |
50056-50069 |
NN |
denotes |
morphogenesis |
| T10419 |
50069-50070 |
. |
denotes |
. |
| T10420 |
50070-50387 |
sentence |
denotes |
An additional point worth mentioning is that prolonged expression of Tg Snail in postnatal skin resulted in morphological and biochemical signs of epithelial to mesenchymal transitions (unpublished data), underscoring why transient Snail expression may be so important during normal hair follicle morphogenesis [18]. |
| T10421 |
50071-50073 |
DT |
denotes |
An |
| T10423 |
50074-50084 |
JJ |
denotes |
additional |
| T10422 |
50085-50090 |
NN |
denotes |
point |
| T10425 |
50091-50096 |
JJ |
denotes |
worth |
| T10426 |
50097-50107 |
VBG |
denotes |
mentioning |
| T10424 |
50108-50110 |
VBZ |
denotes |
is |
| T10427 |
50111-50115 |
IN |
denotes |
that |
| T10429 |
50116-50125 |
VBN |
denotes |
prolonged |
| T10430 |
50126-50136 |
NN |
denotes |
expression |
| T10431 |
50137-50139 |
IN |
denotes |
of |
| T10432 |
50140-50142 |
NN |
denotes |
Tg |
| T10433 |
50143-50148 |
NN |
denotes |
Snail |
| T10434 |
50149-50151 |
IN |
denotes |
in |
| T10435 |
50152-50161 |
JJ |
denotes |
postnatal |
| T10436 |
50162-50166 |
NN |
denotes |
skin |
| T10428 |
50167-50175 |
VBD |
denotes |
resulted |
| T10437 |
50176-50178 |
IN |
denotes |
in |
| T10438 |
50179-50192 |
JJ |
denotes |
morphological |
| T10440 |
50193-50196 |
CC |
denotes |
and |
| T10441 |
50197-50208 |
JJ |
denotes |
biochemical |
| T10439 |
50209-50214 |
NNS |
denotes |
signs |
| T10442 |
50215-50217 |
IN |
denotes |
of |
| T10443 |
50218-50228 |
JJ |
denotes |
epithelial |
| T10445 |
50229-50231 |
IN |
denotes |
to |
| T10446 |
50232-50243 |
JJ |
denotes |
mesenchymal |
| T10444 |
50244-50255 |
NNS |
denotes |
transitions |
| T10447 |
50256-50257 |
-LRB- |
denotes |
( |
| T10449 |
50257-50268 |
JJ |
denotes |
unpublished |
| T10448 |
50269-50273 |
NNS |
denotes |
data |
| T10450 |
50273-50274 |
-RRB- |
denotes |
) |
| T10451 |
50274-50276 |
, |
denotes |
, |
| T10452 |
50276-50288 |
VBG |
denotes |
underscoring |
| T10453 |
50289-50292 |
WRB |
denotes |
why |
| T10455 |
50293-50302 |
JJ |
denotes |
transient |
| T10457 |
50303-50308 |
NN |
denotes |
Snail |
| T10456 |
50309-50319 |
NN |
denotes |
expression |
| T10458 |
50320-50323 |
MD |
denotes |
may |
| T10454 |
50324-50326 |
VB |
denotes |
be |
| T10459 |
50327-50329 |
RB |
denotes |
so |
| T10460 |
50330-50339 |
JJ |
denotes |
important |
| T10461 |
50340-50346 |
IN |
denotes |
during |
| T10462 |
50347-50353 |
JJ |
denotes |
normal |
| T10464 |
50354-50358 |
NN |
denotes |
hair |
| T10465 |
50359-50367 |
NN |
denotes |
follicle |
| T10463 |
50368-50381 |
NN |
denotes |
morphogenesis |
| T10466 |
50382-50383 |
-LRB- |
denotes |
[ |
| T10467 |
50383-50385 |
CD |
denotes |
18 |
| T10468 |
50385-50386 |
-RRB- |
denotes |
] |
| T10469 |
50386-50387 |
. |
denotes |
. |
| T10470 |
50387-50520 |
sentence |
denotes |
At first glance, the sparsity in hair coat of K14-Snail Tg mice seemed indicative of a defect in follicle formation (see Figure 2A). |
| T10471 |
50388-50390 |
IN |
denotes |
At |
| T10473 |
50391-50396 |
JJ |
denotes |
first |
| T10474 |
50397-50403 |
NN |
denotes |
glance |
| T10475 |
50403-50405 |
, |
denotes |
, |
| T10476 |
50405-50408 |
DT |
denotes |
the |
| T10477 |
50409-50417 |
NN |
denotes |
sparsity |
| T10478 |
50418-50420 |
IN |
denotes |
in |
| T10479 |
50421-50425 |
NN |
denotes |
hair |
| T10480 |
50426-50430 |
NN |
denotes |
coat |
| T10481 |
50431-50433 |
IN |
denotes |
of |
| T10482 |
50434-50437 |
NN |
denotes |
K14 |
| T10484 |
50437-50438 |
HYPH |
denotes |
- |
| T10483 |
50438-50443 |
NN |
denotes |
Snail |
| T10486 |
50444-50446 |
NN |
denotes |
Tg |
| T10485 |
50447-50451 |
NNS |
denotes |
mice |
| T10472 |
50452-50458 |
VBD |
denotes |
seemed |
| T10487 |
50459-50469 |
JJ |
denotes |
indicative |
| T10488 |
50470-50472 |
IN |
denotes |
of |
| T10489 |
50473-50474 |
DT |
denotes |
a |
| T10490 |
50475-50481 |
NN |
denotes |
defect |
| T10491 |
50482-50484 |
IN |
denotes |
in |
| T10492 |
50485-50493 |
NN |
denotes |
follicle |
| T10493 |
50494-50503 |
NN |
denotes |
formation |
| T10494 |
50504-50505 |
-LRB- |
denotes |
( |
| T10495 |
50505-50508 |
VB |
denotes |
see |
| T10496 |
50509-50515 |
NN |
denotes |
Figure |
| T10497 |
50516-50518 |
NN |
denotes |
2A |
| T10498 |
50518-50519 |
-RRB- |
denotes |
) |
| T10499 |
50519-50520 |
. |
denotes |
. |
| T10500 |
50520-50620 |
sentence |
denotes |
Closer inspection, however, revealed that not all hairs penetrated the hyperthickened Tg epidermis. |
| T10501 |
50521-50527 |
JJR |
denotes |
Closer |
| T10502 |
50528-50538 |
NN |
denotes |
inspection |
| T10504 |
50538-50540 |
, |
denotes |
, |
| T10505 |
50540-50547 |
RB |
denotes |
however |
| T10506 |
50547-50549 |
, |
denotes |
, |
| T10503 |
50549-50557 |
VBD |
denotes |
revealed |
| T10507 |
50558-50562 |
IN |
denotes |
that |
| T10509 |
50563-50566 |
RB |
denotes |
not |
| T10511 |
50567-50570 |
DT |
denotes |
all |
| T10510 |
50571-50576 |
NNS |
denotes |
hairs |
| T10508 |
50577-50587 |
VBD |
denotes |
penetrated |
| T10512 |
50588-50591 |
DT |
denotes |
the |
| T10514 |
50592-50606 |
VBN |
denotes |
hyperthickened |
| T10515 |
50607-50609 |
NN |
denotes |
Tg |
| T10513 |
50610-50619 |
NN |
denotes |
epidermis |
| T10516 |
50619-50620 |
. |
denotes |
. |
| T10517 |
50620-50711 |
sentence |
denotes |
Several factors may contribute to the seemingly normal follicle development in these mice. |
| T10518 |
50621-50628 |
JJ |
denotes |
Several |
| T10519 |
50629-50636 |
NNS |
denotes |
factors |
| T10521 |
50637-50640 |
MD |
denotes |
may |
| T10520 |
50641-50651 |
VB |
denotes |
contribute |
| T10522 |
50652-50654 |
IN |
denotes |
to |
| T10523 |
50655-50658 |
DT |
denotes |
the |
| T10525 |
50659-50668 |
RB |
denotes |
seemingly |
| T10526 |
50669-50675 |
JJ |
denotes |
normal |
| T10527 |
50676-50684 |
NN |
denotes |
follicle |
| T10524 |
50685-50696 |
NN |
denotes |
development |
| T10528 |
50697-50699 |
IN |
denotes |
in |
| T10529 |
50700-50705 |
DT |
denotes |
these |
| T10530 |
50706-50710 |
NNS |
denotes |
mice |
| T10531 |
50710-50711 |
. |
denotes |
. |
| T10532 |
50711-50975 |
sentence |
denotes |
One obvious factor is the K14 promoter, which is elevated in the basal layer of the epidermis and the outer root sheath (ORS) of the hair follicle, but is markedly down-regulated in developing embryonic hair buds as well as in the postnatal hair progenitor cells. |
| T10533 |
50712-50715 |
CD |
denotes |
One |
| T10535 |
50716-50723 |
JJ |
denotes |
obvious |
| T10534 |
50724-50730 |
NN |
denotes |
factor |
| T10536 |
50731-50733 |
VBZ |
denotes |
is |
| T10537 |
50734-50737 |
DT |
denotes |
the |
| T10539 |
50738-50741 |
NN |
denotes |
K14 |
| T10538 |
50742-50750 |
NN |
denotes |
promoter |
| T10540 |
50750-50752 |
, |
denotes |
, |
| T10541 |
50752-50757 |
WDT |
denotes |
which |
| T10542 |
50758-50760 |
VBZ |
denotes |
is |
| T10543 |
50761-50769 |
JJ |
denotes |
elevated |
| T10544 |
50770-50772 |
IN |
denotes |
in |
| T10545 |
50773-50776 |
DT |
denotes |
the |
| T10547 |
50777-50782 |
JJ |
denotes |
basal |
| T10546 |
50783-50788 |
NN |
denotes |
layer |
| T10548 |
50789-50791 |
IN |
denotes |
of |
| T10549 |
50792-50795 |
DT |
denotes |
the |
| T10550 |
50796-50805 |
NN |
denotes |
epidermis |
| T10551 |
50806-50809 |
CC |
denotes |
and |
| T10552 |
50810-50813 |
DT |
denotes |
the |
| T10554 |
50814-50819 |
JJ |
denotes |
outer |
| T10555 |
50820-50824 |
NN |
denotes |
root |
| T10553 |
50825-50831 |
NN |
denotes |
sheath |
| T10556 |
50832-50833 |
-LRB- |
denotes |
( |
| T10557 |
50833-50836 |
NN |
denotes |
ORS |
| T10558 |
50836-50837 |
-RRB- |
denotes |
) |
| T10559 |
50838-50840 |
IN |
denotes |
of |
| T10560 |
50841-50844 |
DT |
denotes |
the |
| T10562 |
50845-50849 |
NN |
denotes |
hair |
| T10561 |
50850-50858 |
NN |
denotes |
follicle |
| T10563 |
50858-50860 |
, |
denotes |
, |
| T10564 |
50860-50863 |
CC |
denotes |
but |
| T10565 |
50864-50866 |
VBZ |
denotes |
is |
| T10567 |
50867-50875 |
RB |
denotes |
markedly |
| T10568 |
50876-50880 |
RB |
denotes |
down |
| T10569 |
50880-50881 |
HYPH |
denotes |
- |
| T10566 |
50881-50890 |
VBN |
denotes |
regulated |
| T10570 |
50891-50893 |
IN |
denotes |
in |
| T10571 |
50894-50904 |
JJ |
denotes |
developing |
| T10573 |
50905-50914 |
JJ |
denotes |
embryonic |
| T10574 |
50915-50919 |
NN |
denotes |
hair |
| T10572 |
50920-50924 |
NNS |
denotes |
buds |
| T10575 |
50925-50927 |
RB |
denotes |
as |
| T10577 |
50928-50932 |
RB |
denotes |
well |
| T10576 |
50933-50935 |
IN |
denotes |
as |
| T10578 |
50936-50938 |
IN |
denotes |
in |
| T10579 |
50939-50942 |
DT |
denotes |
the |
| T10581 |
50943-50952 |
JJ |
denotes |
postnatal |
| T10582 |
50953-50957 |
NN |
denotes |
hair |
| T10583 |
50958-50968 |
NN |
denotes |
progenitor |
| T10580 |
50969-50974 |
NNS |
denotes |
cells |
| T10584 |
50974-50975 |
. |
denotes |
. |
| T10585 |
50975-51135 |
sentence |
denotes |
The K14 promoter is also less active in the ORS than epidermis and hence this might also account for the lack of apparent response of the ORS to ectopic Snail. |
| T10586 |
50976-50979 |
DT |
denotes |
The |
| T10588 |
50980-50983 |
NN |
denotes |
K14 |
| T10587 |
50984-50992 |
NN |
denotes |
promoter |
| T10589 |
50993-50995 |
VBZ |
denotes |
is |
| T10590 |
50996-51000 |
RB |
denotes |
also |
| T10591 |
51001-51005 |
RBR |
denotes |
less |
| T10592 |
51006-51012 |
JJ |
denotes |
active |
| T10593 |
51013-51015 |
IN |
denotes |
in |
| T10594 |
51016-51019 |
DT |
denotes |
the |
| T10595 |
51020-51023 |
NN |
denotes |
ORS |
| T10596 |
51024-51028 |
IN |
denotes |
than |
| T10597 |
51029-51038 |
NN |
denotes |
epidermis |
| T10598 |
51039-51042 |
CC |
denotes |
and |
| T10599 |
51043-51048 |
RB |
denotes |
hence |
| T10601 |
51049-51053 |
DT |
denotes |
this |
| T10602 |
51054-51059 |
MD |
denotes |
might |
| T10603 |
51060-51064 |
RB |
denotes |
also |
| T10600 |
51065-51072 |
VB |
denotes |
account |
| T10604 |
51073-51076 |
IN |
denotes |
for |
| T10605 |
51077-51080 |
DT |
denotes |
the |
| T10606 |
51081-51085 |
NN |
denotes |
lack |
| T10607 |
51086-51088 |
IN |
denotes |
of |
| T10608 |
51089-51097 |
JJ |
denotes |
apparent |
| T10609 |
51098-51106 |
NN |
denotes |
response |
| T10610 |
51107-51109 |
IN |
denotes |
of |
| T10611 |
51110-51113 |
DT |
denotes |
the |
| T10612 |
51114-51117 |
NN |
denotes |
ORS |
| T10613 |
51118-51120 |
IN |
denotes |
to |
| T10614 |
51121-51128 |
JJ |
denotes |
ectopic |
| T10615 |
51129-51134 |
NN |
denotes |
Snail |
| T10616 |
51134-51135 |
. |
denotes |
. |
| T10617 |
51135-51386 |
sentence |
denotes |
Additional contributing factors could be the multiplicity of Snail family members and their differential expression, the saturation, and/or diversity of regulatory mechanisms that govern AJ formation, migration, and proliferation in the follicle ORS. |
| T10618 |
51136-51146 |
JJ |
denotes |
Additional |
| T10620 |
51147-51159 |
VBG |
denotes |
contributing |
| T10619 |
51160-51167 |
NNS |
denotes |
factors |
| T10622 |
51168-51173 |
MD |
denotes |
could |
| T10621 |
51174-51176 |
VB |
denotes |
be |
| T10623 |
51177-51180 |
DT |
denotes |
the |
| T10624 |
51181-51193 |
NN |
denotes |
multiplicity |
| T10625 |
51194-51196 |
IN |
denotes |
of |
| T10626 |
51197-51202 |
NN |
denotes |
Snail |
| T10628 |
51203-51209 |
NN |
denotes |
family |
| T10627 |
51210-51217 |
NNS |
denotes |
members |
| T10629 |
51218-51221 |
CC |
denotes |
and |
| T10630 |
51222-51227 |
PRP$ |
denotes |
their |
| T10632 |
51228-51240 |
JJ |
denotes |
differential |
| T10631 |
51241-51251 |
NN |
denotes |
expression |
| T10633 |
51251-51253 |
, |
denotes |
, |
| T10634 |
51253-51256 |
DT |
denotes |
the |
| T10635 |
51257-51267 |
NN |
denotes |
saturation |
| T10636 |
51267-51269 |
, |
denotes |
, |
| T10637 |
51269-51272 |
CC |
denotes |
and |
| T10638 |
51272-51273 |
HYPH |
denotes |
/ |
| T10639 |
51273-51275 |
CC |
denotes |
or |
| T10640 |
51276-51285 |
NN |
denotes |
diversity |
| T10641 |
51286-51288 |
IN |
denotes |
of |
| T10642 |
51289-51299 |
JJ |
denotes |
regulatory |
| T10643 |
51300-51310 |
NNS |
denotes |
mechanisms |
| T10644 |
51311-51315 |
WDT |
denotes |
that |
| T10645 |
51316-51322 |
VBP |
denotes |
govern |
| T10646 |
51323-51325 |
NN |
denotes |
AJ |
| T10647 |
51326-51335 |
NN |
denotes |
formation |
| T10648 |
51335-51337 |
, |
denotes |
, |
| T10649 |
51337-51346 |
NN |
denotes |
migration |
| T10650 |
51346-51348 |
, |
denotes |
, |
| T10651 |
51348-51351 |
CC |
denotes |
and |
| T10652 |
51352-51365 |
NN |
denotes |
proliferation |
| T10653 |
51366-51368 |
IN |
denotes |
in |
| T10654 |
51369-51372 |
DT |
denotes |
the |
| T10656 |
51373-51381 |
NN |
denotes |
follicle |
| T10655 |
51382-51385 |
NN |
denotes |
ORS |
| T10657 |
51385-51386 |
. |
denotes |
. |
| T10658 |
51386-51521 |
sentence |
denotes |
Distinguishing between these possibilities must await the generation of mice harboring skin-specific loss-of-function Snail mutations. |
| T10659 |
51387-51401 |
VBG |
denotes |
Distinguishing |
| T10661 |
51402-51409 |
IN |
denotes |
between |
| T10662 |
51410-51415 |
DT |
denotes |
these |
| T10663 |
51416-51429 |
NNS |
denotes |
possibilities |
| T10664 |
51430-51434 |
MD |
denotes |
must |
| T10660 |
51435-51440 |
VB |
denotes |
await |
| T10665 |
51441-51444 |
DT |
denotes |
the |
| T10666 |
51445-51455 |
NN |
denotes |
generation |
| T10667 |
51456-51458 |
IN |
denotes |
of |
| T10668 |
51459-51463 |
NNS |
denotes |
mice |
| T10669 |
51464-51473 |
VBG |
denotes |
harboring |
| T10670 |
51474-51478 |
NN |
denotes |
skin |
| T10672 |
51478-51479 |
HYPH |
denotes |
- |
| T10671 |
51479-51487 |
JJ |
denotes |
specific |
| T10674 |
51488-51492 |
NN |
denotes |
loss |
| T10675 |
51492-51493 |
HYPH |
denotes |
- |
| T10676 |
51493-51495 |
IN |
denotes |
of |
| T10677 |
51495-51496 |
HYPH |
denotes |
- |
| T10678 |
51496-51504 |
NN |
denotes |
function |
| T10679 |
51505-51510 |
NN |
denotes |
Snail |
| T10673 |
51511-51520 |
NNS |
denotes |
mutations |
| T10680 |
51520-51521 |
. |
denotes |
. |
| T11057 |
51523-51528 |
NNS |
denotes |
Links |
| T11058 |
51529-51536 |
IN |
denotes |
between |
| T11059 |
51537-51546 |
NN |
denotes |
Signaling |
| T11060 |
51546-51548 |
, |
denotes |
, |
| T11061 |
51548-51563 |
JJ |
denotes |
Transcriptional |
| T11062 |
51564-51572 |
NNS |
denotes |
Cascades |
| T11063 |
51572-51574 |
, |
denotes |
, |
| T11064 |
51574-51584 |
JJ |
denotes |
Epithelial |
| T11065 |
51585-51595 |
NN |
denotes |
Remodeling |
| T11066 |
51595-51597 |
, |
denotes |
, |
| T11067 |
51597-51600 |
CC |
denotes |
and |
| T11068 |
51601-51614 |
NN |
denotes |
Proliferation |
| T11069 |
51615-51617 |
IN |
denotes |
in |
| T11070 |
51618-51621 |
DT |
denotes |
the |
| T11072 |
51622-51626 |
NN |
denotes |
Hair |
| T11071 |
51627-51630 |
NN |
denotes |
Bud |
| T11073 |
51630-51827 |
sentence |
denotes |
Previously, we discovered that early during hair follicle morphogenesis, E-cadherin gene expression is down-regulated concomitantly with the invagination of developing bud cells into the skin [4]. |
| T11074 |
51631-51641 |
RB |
denotes |
Previously |
| T11076 |
51641-51643 |
, |
denotes |
, |
| T11077 |
51643-51645 |
PRP |
denotes |
we |
| T11075 |
51646-51656 |
VBD |
denotes |
discovered |
| T11078 |
51657-51661 |
IN |
denotes |
that |
| T11080 |
51662-51667 |
RB |
denotes |
early |
| T11081 |
51668-51674 |
IN |
denotes |
during |
| T11082 |
51675-51679 |
NN |
denotes |
hair |
| T11083 |
51680-51688 |
NN |
denotes |
follicle |
| T11084 |
51689-51702 |
NN |
denotes |
morphogenesis |
| T11085 |
51702-51704 |
, |
denotes |
, |
| T11086 |
51704-51705 |
NN |
denotes |
E |
| T11088 |
51705-51706 |
HYPH |
denotes |
- |
| T11087 |
51706-51714 |
NN |
denotes |
cadherin |
| T11090 |
51715-51719 |
NN |
denotes |
gene |
| T11089 |
51720-51730 |
NN |
denotes |
expression |
| T11091 |
51731-51733 |
VBZ |
denotes |
is |
| T11092 |
51734-51738 |
RB |
denotes |
down |
| T11093 |
51738-51739 |
HYPH |
denotes |
- |
| T11079 |
51739-51748 |
VBN |
denotes |
regulated |
| T11094 |
51749-51762 |
RB |
denotes |
concomitantly |
| T11095 |
51763-51767 |
IN |
denotes |
with |
| T11096 |
51768-51771 |
DT |
denotes |
the |
| T11097 |
51772-51784 |
NN |
denotes |
invagination |
| T11098 |
51785-51787 |
IN |
denotes |
of |
| T11099 |
51788-51798 |
JJ |
denotes |
developing |
| T11101 |
51799-51802 |
NN |
denotes |
bud |
| T11100 |
51803-51808 |
NNS |
denotes |
cells |
| T11102 |
51809-51813 |
IN |
denotes |
into |
| T11103 |
51814-51817 |
DT |
denotes |
the |
| T11104 |
51818-51822 |
NN |
denotes |
skin |
| T11105 |
51823-51824 |
-LRB- |
denotes |
[ |
| T11106 |
51824-51825 |
CD |
denotes |
4 |
| T11107 |
51825-51826 |
-RRB- |
denotes |
] |
| T11108 |
51826-51827 |
. |
denotes |
. |
| T11109 |
51827-52046 |
sentence |
denotes |
Because the timing of this event correlated with the activation of a LEF-1/β-catenin transcription factor complex [20], we were intrigued by the presence of a putative LEF-1/TCF binding site in the E-cadherin promoter. |
| T11110 |
51828-51835 |
IN |
denotes |
Because |
| T11112 |
51836-51839 |
DT |
denotes |
the |
| T11113 |
51840-51846 |
NN |
denotes |
timing |
| T11114 |
51847-51849 |
IN |
denotes |
of |
| T11115 |
51850-51854 |
DT |
denotes |
this |
| T11116 |
51855-51860 |
NN |
denotes |
event |
| T11111 |
51861-51871 |
VBD |
denotes |
correlated |
| T11118 |
51872-51876 |
IN |
denotes |
with |
| T11119 |
51877-51880 |
DT |
denotes |
the |
| T11120 |
51881-51891 |
NN |
denotes |
activation |
| T11121 |
51892-51894 |
IN |
denotes |
of |
| T11122 |
51895-51896 |
DT |
denotes |
a |
| T11124 |
51897-51900 |
NN |
denotes |
LEF |
| T11126 |
51900-51901 |
HYPH |
denotes |
- |
| T11127 |
51901-51902 |
CD |
denotes |
1 |
| T11128 |
51902-51903 |
HYPH |
denotes |
/ |
| T11129 |
51903-51904 |
NN |
denotes |
β |
| T11131 |
51904-51905 |
HYPH |
denotes |
- |
| T11130 |
51905-51912 |
NN |
denotes |
catenin |
| T11132 |
51913-51926 |
NN |
denotes |
transcription |
| T11125 |
51927-51933 |
NN |
denotes |
factor |
| T11123 |
51934-51941 |
NN |
denotes |
complex |
| T11133 |
51942-51943 |
-LRB- |
denotes |
[ |
| T11134 |
51943-51945 |
CD |
denotes |
20 |
| T11135 |
51945-51946 |
-RRB- |
denotes |
] |
| T11136 |
51946-51948 |
, |
denotes |
, |
| T11137 |
51948-51950 |
PRP |
denotes |
we |
| T11138 |
51951-51955 |
VBD |
denotes |
were |
| T11117 |
51956-51965 |
VBN |
denotes |
intrigued |
| T11139 |
51966-51968 |
IN |
denotes |
by |
| T11140 |
51969-51972 |
DT |
denotes |
the |
| T11141 |
51973-51981 |
NN |
denotes |
presence |
| T11142 |
51982-51984 |
IN |
denotes |
of |
| T11143 |
51985-51986 |
DT |
denotes |
a |
| T11145 |
51987-51995 |
JJ |
denotes |
putative |
| T11146 |
51996-51999 |
NN |
denotes |
LEF |
| T11147 |
51999-52000 |
HYPH |
denotes |
- |
| T11148 |
52000-52001 |
CD |
denotes |
1 |
| T11149 |
52001-52002 |
HYPH |
denotes |
/ |
| T11150 |
52002-52005 |
NN |
denotes |
TCF |
| T11151 |
52006-52013 |
NN |
denotes |
binding |
| T11144 |
52014-52018 |
NN |
denotes |
site |
| T11152 |
52019-52021 |
IN |
denotes |
in |
| T11153 |
52022-52025 |
DT |
denotes |
the |
| T11155 |
52026-52027 |
NN |
denotes |
E |
| T11157 |
52027-52028 |
HYPH |
denotes |
- |
| T11156 |
52028-52036 |
NN |
denotes |
cadherin |
| T11154 |
52037-52045 |
NN |
denotes |
promoter |
| T11158 |
52045-52046 |
. |
denotes |
. |
| T11159 |
52046-52223 |
sentence |
denotes |
This prompted an investigation that subsequently led to our discovery that LEF-1/β-catenin can contribute to repression of E-cadherin gene expression in skin keratinocytes [4]. |
| T11160 |
52047-52051 |
DT |
denotes |
This |
| T11161 |
52052-52060 |
VBD |
denotes |
prompted |
| T11162 |
52061-52063 |
DT |
denotes |
an |
| T11163 |
52064-52077 |
NN |
denotes |
investigation |
| T11164 |
52078-52082 |
WDT |
denotes |
that |
| T11166 |
52083-52095 |
RB |
denotes |
subsequently |
| T11165 |
52096-52099 |
VBD |
denotes |
led |
| T11167 |
52100-52102 |
IN |
denotes |
to |
| T11168 |
52103-52106 |
PRP$ |
denotes |
our |
| T11169 |
52107-52116 |
NN |
denotes |
discovery |
| T11170 |
52117-52121 |
IN |
denotes |
that |
| T11172 |
52122-52125 |
NN |
denotes |
LEF |
| T11173 |
52125-52126 |
HYPH |
denotes |
- |
| T11174 |
52126-52127 |
CD |
denotes |
1 |
| T11175 |
52127-52128 |
HYPH |
denotes |
/ |
| T11176 |
52128-52129 |
NN |
denotes |
β |
| T11178 |
52129-52130 |
HYPH |
denotes |
- |
| T11177 |
52130-52137 |
NN |
denotes |
catenin |
| T11179 |
52138-52141 |
MD |
denotes |
can |
| T11171 |
52142-52152 |
VB |
denotes |
contribute |
| T11180 |
52153-52155 |
IN |
denotes |
to |
| T11181 |
52156-52166 |
NN |
denotes |
repression |
| T11182 |
52167-52169 |
IN |
denotes |
of |
| T11183 |
52170-52171 |
NN |
denotes |
E |
| T11185 |
52171-52172 |
HYPH |
denotes |
- |
| T11184 |
52172-52180 |
NN |
denotes |
cadherin |
| T11187 |
52181-52185 |
NN |
denotes |
gene |
| T11186 |
52186-52196 |
NN |
denotes |
expression |
| T11188 |
52197-52199 |
IN |
denotes |
in |
| T11189 |
52200-52204 |
NN |
denotes |
skin |
| T11190 |
52205-52218 |
NNS |
denotes |
keratinocytes |
| T11191 |
52219-52220 |
-LRB- |
denotes |
[ |
| T11192 |
52220-52221 |
CD |
denotes |
4 |
| T11193 |
52221-52222 |
-RRB- |
denotes |
] |
| T11194 |
52222-52223 |
. |
denotes |
. |
| T11195 |
52223-52475 |
sentence |
denotes |
In the course of these studies, we also noted that Snail can also contribute to this process in keratinocytes in vitro, and our present studies revealed that Snail is expressed at the right place and time to be physiologically relevant in the process. |
| T11196 |
52224-52226 |
IN |
denotes |
In |
| T11198 |
52227-52230 |
DT |
denotes |
the |
| T11199 |
52231-52237 |
NN |
denotes |
course |
| T11200 |
52238-52240 |
IN |
denotes |
of |
| T11201 |
52241-52246 |
DT |
denotes |
these |
| T11202 |
52247-52254 |
NNS |
denotes |
studies |
| T11203 |
52254-52256 |
, |
denotes |
, |
| T11204 |
52256-52258 |
PRP |
denotes |
we |
| T11205 |
52259-52263 |
RB |
denotes |
also |
| T11197 |
52264-52269 |
VBD |
denotes |
noted |
| T11206 |
52270-52274 |
IN |
denotes |
that |
| T11208 |
52275-52280 |
NN |
denotes |
Snail |
| T11209 |
52281-52284 |
MD |
denotes |
can |
| T11210 |
52285-52289 |
RB |
denotes |
also |
| T11207 |
52290-52300 |
VB |
denotes |
contribute |
| T11211 |
52301-52303 |
IN |
denotes |
to |
| T11212 |
52304-52308 |
DT |
denotes |
this |
| T11213 |
52309-52316 |
NN |
denotes |
process |
| T11214 |
52317-52319 |
IN |
denotes |
in |
| T11215 |
52320-52333 |
NNS |
denotes |
keratinocytes |
| T11216 |
52334-52336 |
FW |
denotes |
in |
| T11217 |
52337-52342 |
FW |
denotes |
vitro |
| T11218 |
52342-52344 |
, |
denotes |
, |
| T11219 |
52344-52347 |
CC |
denotes |
and |
| T11220 |
52348-52351 |
PRP$ |
denotes |
our |
| T11222 |
52352-52359 |
JJ |
denotes |
present |
| T11221 |
52360-52367 |
NNS |
denotes |
studies |
| T11223 |
52368-52376 |
VBD |
denotes |
revealed |
| T11224 |
52377-52381 |
IN |
denotes |
that |
| T11226 |
52382-52387 |
NN |
denotes |
Snail |
| T11227 |
52388-52390 |
VBZ |
denotes |
is |
| T11225 |
52391-52400 |
VBN |
denotes |
expressed |
| T11228 |
52401-52403 |
IN |
denotes |
at |
| T11229 |
52404-52407 |
DT |
denotes |
the |
| T11231 |
52408-52413 |
JJ |
denotes |
right |
| T11230 |
52414-52419 |
NN |
denotes |
place |
| T11232 |
52420-52423 |
CC |
denotes |
and |
| T11233 |
52424-52428 |
NN |
denotes |
time |
| T11234 |
52429-52431 |
TO |
denotes |
to |
| T11235 |
52432-52434 |
VB |
denotes |
be |
| T11236 |
52435-52450 |
RB |
denotes |
physiologically |
| T11237 |
52451-52459 |
JJ |
denotes |
relevant |
| T11238 |
52460-52462 |
IN |
denotes |
in |
| T11239 |
52463-52466 |
DT |
denotes |
the |
| T11240 |
52467-52474 |
NN |
denotes |
process |
| T11241 |
52474-52475 |
. |
denotes |
. |
| T11242 |
52475-52627 |
sentence |
denotes |
In noggin-null embryonic skin, LEF-1 expression and subsequent activation of the LEF-1/β-catenin reporter gene is abrogated in the developing placodes. |
| T11243 |
52476-52478 |
IN |
denotes |
In |
| T11245 |
52479-52485 |
NN |
denotes |
noggin |
| T11247 |
52485-52486 |
HYPH |
denotes |
- |
| T11246 |
52486-52490 |
JJ |
denotes |
null |
| T11249 |
52491-52500 |
JJ |
denotes |
embryonic |
| T11248 |
52501-52505 |
NN |
denotes |
skin |
| T11250 |
52505-52507 |
, |
denotes |
, |
| T11251 |
52507-52510 |
NN |
denotes |
LEF |
| T11253 |
52510-52511 |
HYPH |
denotes |
- |
| T11254 |
52511-52512 |
CD |
denotes |
1 |
| T11252 |
52513-52523 |
NN |
denotes |
expression |
| T11255 |
52524-52527 |
CC |
denotes |
and |
| T11256 |
52528-52538 |
JJ |
denotes |
subsequent |
| T11257 |
52539-52549 |
NN |
denotes |
activation |
| T11258 |
52550-52552 |
IN |
denotes |
of |
| T11259 |
52553-52556 |
DT |
denotes |
the |
| T11261 |
52557-52560 |
NN |
denotes |
LEF |
| T11262 |
52560-52561 |
HYPH |
denotes |
- |
| T11263 |
52561-52562 |
CD |
denotes |
1 |
| T11264 |
52562-52563 |
HYPH |
denotes |
/ |
| T11265 |
52563-52564 |
NN |
denotes |
β |
| T11267 |
52564-52565 |
HYPH |
denotes |
- |
| T11266 |
52565-52572 |
NN |
denotes |
catenin |
| T11268 |
52573-52581 |
NN |
denotes |
reporter |
| T11260 |
52582-52586 |
NN |
denotes |
gene |
| T11269 |
52587-52589 |
VBZ |
denotes |
is |
| T11244 |
52590-52599 |
VBN |
denotes |
abrogated |
| T11270 |
52600-52602 |
IN |
denotes |
in |
| T11271 |
52603-52606 |
DT |
denotes |
the |
| T11273 |
52607-52617 |
VBG |
denotes |
developing |
| T11272 |
52618-52626 |
NNS |
denotes |
placodes |
| T11274 |
52626-52627 |
. |
denotes |
. |
| T11275 |
52627-52790 |
sentence |
denotes |
The corresponding failure of E-cadherin down-regulation underscores the importance of Wnt/noggin signaling in regulating this event in follicle morphogenesis [4]. |
| T11276 |
52628-52631 |
DT |
denotes |
The |
| T11278 |
52632-52645 |
VBG |
denotes |
corresponding |
| T11277 |
52646-52653 |
NN |
denotes |
failure |
| T11280 |
52654-52656 |
IN |
denotes |
of |
| T11281 |
52657-52658 |
NN |
denotes |
E |
| T11283 |
52658-52659 |
HYPH |
denotes |
- |
| T11282 |
52659-52667 |
NN |
denotes |
cadherin |
| T11285 |
52668-52672 |
JJ |
denotes |
down |
| T11286 |
52672-52673 |
HYPH |
denotes |
- |
| T11284 |
52673-52683 |
NN |
denotes |
regulation |
| T11279 |
52684-52695 |
VBZ |
denotes |
underscores |
| T11287 |
52696-52699 |
DT |
denotes |
the |
| T11288 |
52700-52710 |
NN |
denotes |
importance |
| T11289 |
52711-52713 |
IN |
denotes |
of |
| T11290 |
52714-52717 |
NN |
denotes |
Wnt |
| T11292 |
52717-52718 |
HYPH |
denotes |
/ |
| T11291 |
52718-52724 |
NN |
denotes |
noggin |
| T11293 |
52725-52734 |
NN |
denotes |
signaling |
| T11294 |
52735-52737 |
IN |
denotes |
in |
| T11295 |
52738-52748 |
VBG |
denotes |
regulating |
| T11296 |
52749-52753 |
DT |
denotes |
this |
| T11297 |
52754-52759 |
NN |
denotes |
event |
| T11298 |
52760-52762 |
IN |
denotes |
in |
| T11299 |
52763-52771 |
NN |
denotes |
follicle |
| T11300 |
52772-52785 |
NN |
denotes |
morphogenesis |
| T11301 |
52786-52787 |
-LRB- |
denotes |
[ |
| T11302 |
52787-52788 |
CD |
denotes |
4 |
| T11303 |
52788-52789 |
-RRB- |
denotes |
] |
| T11304 |
52789-52790 |
. |
denotes |
. |
| T11305 |
52790-52993 |
sentence |
denotes |
Conditional gene targeting studies will be necessary to establish whether Snail family members also contribute to the down-regulation in E-cadherin gene expression that occurs during follicle formation. |
| T11306 |
52791-52802 |
JJ |
denotes |
Conditional |
| T11308 |
52803-52807 |
NN |
denotes |
gene |
| T11309 |
52808-52817 |
NN |
denotes |
targeting |
| T11307 |
52818-52825 |
NNS |
denotes |
studies |
| T11311 |
52826-52830 |
MD |
denotes |
will |
| T11310 |
52831-52833 |
VB |
denotes |
be |
| T11312 |
52834-52843 |
JJ |
denotes |
necessary |
| T11313 |
52844-52846 |
TO |
denotes |
to |
| T11314 |
52847-52856 |
VB |
denotes |
establish |
| T11315 |
52857-52864 |
IN |
denotes |
whether |
| T11317 |
52865-52870 |
NN |
denotes |
Snail |
| T11319 |
52871-52877 |
NN |
denotes |
family |
| T11318 |
52878-52885 |
NNS |
denotes |
members |
| T11320 |
52886-52890 |
RB |
denotes |
also |
| T11316 |
52891-52901 |
VBP |
denotes |
contribute |
| T11321 |
52902-52904 |
IN |
denotes |
to |
| T11322 |
52905-52908 |
DT |
denotes |
the |
| T11324 |
52909-52913 |
JJ |
denotes |
down |
| T11325 |
52913-52914 |
HYPH |
denotes |
- |
| T11323 |
52914-52924 |
NN |
denotes |
regulation |
| T11326 |
52925-52927 |
IN |
denotes |
in |
| T11327 |
52928-52929 |
NN |
denotes |
E |
| T11329 |
52929-52930 |
HYPH |
denotes |
- |
| T11328 |
52930-52938 |
NN |
denotes |
cadherin |
| T11331 |
52939-52943 |
NN |
denotes |
gene |
| T11330 |
52944-52954 |
NN |
denotes |
expression |
| T11332 |
52955-52959 |
WDT |
denotes |
that |
| T11333 |
52960-52966 |
VBZ |
denotes |
occurs |
| T11334 |
52967-52973 |
IN |
denotes |
during |
| T11335 |
52974-52982 |
NN |
denotes |
follicle |
| T11336 |
52983-52992 |
NN |
denotes |
formation |
| T11337 |
52992-52993 |
. |
denotes |
. |
| T11338 |
52993-53162 |
sentence |
denotes |
However, it is intriguing that K14-Snail Tg epidermis displayed a marked down-regulation in E-cadherin expression, thereby demonstrating its potential to do so in skin. |
| T11339 |
52994-53001 |
RB |
denotes |
However |
| T11341 |
53001-53003 |
, |
denotes |
, |
| T11342 |
53003-53005 |
PRP |
denotes |
it |
| T11340 |
53006-53008 |
VBZ |
denotes |
is |
| T11343 |
53009-53019 |
VBG |
denotes |
intriguing |
| T11344 |
53020-53024 |
IN |
denotes |
that |
| T11346 |
53025-53028 |
NN |
denotes |
K14 |
| T11348 |
53028-53029 |
HYPH |
denotes |
- |
| T11347 |
53029-53034 |
NN |
denotes |
Snail |
| T11350 |
53035-53037 |
NN |
denotes |
Tg |
| T11349 |
53038-53047 |
NN |
denotes |
epidermis |
| T11345 |
53048-53057 |
VBD |
denotes |
displayed |
| T11351 |
53058-53059 |
DT |
denotes |
a |
| T11353 |
53060-53066 |
JJ |
denotes |
marked |
| T11354 |
53067-53071 |
JJ |
denotes |
down |
| T11355 |
53071-53072 |
HYPH |
denotes |
- |
| T11352 |
53072-53082 |
NN |
denotes |
regulation |
| T11356 |
53083-53085 |
IN |
denotes |
in |
| T11357 |
53086-53087 |
NN |
denotes |
E |
| T11359 |
53087-53088 |
HYPH |
denotes |
- |
| T11358 |
53088-53096 |
NN |
denotes |
cadherin |
| T11360 |
53097-53107 |
NN |
denotes |
expression |
| T11361 |
53107-53109 |
, |
denotes |
, |
| T11362 |
53109-53116 |
RB |
denotes |
thereby |
| T11363 |
53117-53130 |
VBG |
denotes |
demonstrating |
| T11364 |
53131-53134 |
PRP$ |
denotes |
its |
| T11365 |
53135-53144 |
NN |
denotes |
potential |
| T11366 |
53145-53147 |
TO |
denotes |
to |
| T11367 |
53148-53150 |
VB |
denotes |
do |
| T11368 |
53151-53153 |
RB |
denotes |
so |
| T11369 |
53154-53156 |
IN |
denotes |
in |
| T11370 |
53157-53161 |
NN |
denotes |
skin |
| T11371 |
53161-53162 |
. |
denotes |
. |
| T11372 |
53162-53315 |
sentence |
denotes |
Our prior findings showed that by elevating E-cadherin levels or by conditionally ablating α-catenin, hair follicle morphogenesis can be impaired [4,7]. |
| T11373 |
53163-53166 |
PRP$ |
denotes |
Our |
| T11375 |
53167-53172 |
JJ |
denotes |
prior |
| T11374 |
53173-53181 |
NNS |
denotes |
findings |
| T11376 |
53182-53188 |
VBD |
denotes |
showed |
| T11377 |
53189-53193 |
IN |
denotes |
that |
| T11379 |
53194-53196 |
IN |
denotes |
by |
| T11380 |
53197-53206 |
VBG |
denotes |
elevating |
| T11381 |
53207-53208 |
NN |
denotes |
E |
| T11383 |
53208-53209 |
HYPH |
denotes |
- |
| T11382 |
53209-53217 |
NN |
denotes |
cadherin |
| T11384 |
53218-53224 |
NNS |
denotes |
levels |
| T11385 |
53225-53227 |
CC |
denotes |
or |
| T11386 |
53228-53230 |
IN |
denotes |
by |
| T11387 |
53231-53244 |
RB |
denotes |
conditionally |
| T11388 |
53245-53253 |
VBG |
denotes |
ablating |
| T11389 |
53254-53255 |
NN |
denotes |
α |
| T11391 |
53255-53256 |
HYPH |
denotes |
- |
| T11390 |
53256-53263 |
NN |
denotes |
catenin |
| T11392 |
53263-53265 |
, |
denotes |
, |
| T11393 |
53265-53269 |
NN |
denotes |
hair |
| T11394 |
53270-53278 |
NN |
denotes |
follicle |
| T11395 |
53279-53292 |
NN |
denotes |
morphogenesis |
| T11396 |
53293-53296 |
MD |
denotes |
can |
| T11397 |
53297-53299 |
VB |
denotes |
be |
| T11378 |
53300-53308 |
VBN |
denotes |
impaired |
| T11398 |
53309-53310 |
-LRB- |
denotes |
[ |
| T11400 |
53310-53311 |
CD |
denotes |
4 |
| T11401 |
53311-53312 |
, |
denotes |
, |
| T11399 |
53312-53313 |
CD |
denotes |
7 |
| T11402 |
53313-53314 |
-RRB- |
denotes |
] |
| T11403 |
53314-53315 |
. |
denotes |
. |
| T11404 |
53315-53645 |
sentence |
denotes |
The marked epidermal hyperproliferation seen in the K14-Snail Tg skin, coupled with the converse suppression of proliferation and Snail in TGF-β2-null hair buds led us to wonder whether the down-regulation of E-cadherin during follicle morphogenesis might have a direct impact on elevating the proliferative state of these cells. |
| T11405 |
53316-53319 |
DT |
denotes |
The |
| T11407 |
53320-53326 |
JJ |
denotes |
marked |
| T11408 |
53327-53336 |
JJ |
denotes |
epidermal |
| T11406 |
53337-53355 |
NN |
denotes |
hyperproliferation |
| T11410 |
53356-53360 |
VBN |
denotes |
seen |
| T11411 |
53361-53363 |
IN |
denotes |
in |
| T11412 |
53364-53367 |
DT |
denotes |
the |
| T11414 |
53368-53371 |
NN |
denotes |
K14 |
| T11416 |
53371-53372 |
HYPH |
denotes |
- |
| T11415 |
53372-53377 |
NN |
denotes |
Snail |
| T11417 |
53378-53380 |
NN |
denotes |
Tg |
| T11413 |
53381-53385 |
NN |
denotes |
skin |
| T11418 |
53385-53387 |
, |
denotes |
, |
| T11419 |
53387-53394 |
VBN |
denotes |
coupled |
| T11420 |
53395-53399 |
IN |
denotes |
with |
| T11421 |
53400-53403 |
DT |
denotes |
the |
| T11423 |
53404-53412 |
JJ |
denotes |
converse |
| T11422 |
53413-53424 |
NN |
denotes |
suppression |
| T11424 |
53425-53427 |
IN |
denotes |
of |
| T11425 |
53428-53441 |
NN |
denotes |
proliferation |
| T11426 |
53442-53445 |
CC |
denotes |
and |
| T11427 |
53446-53451 |
NN |
denotes |
Snail |
| T11428 |
53452-53454 |
IN |
denotes |
in |
| T11429 |
53455-53458 |
NN |
denotes |
TGF |
| T11431 |
53458-53459 |
HYPH |
denotes |
- |
| T11430 |
53459-53461 |
NN |
denotes |
β2 |
| T11433 |
53461-53462 |
HYPH |
denotes |
- |
| T11432 |
53462-53466 |
JJ |
denotes |
null |
| T11435 |
53467-53471 |
NN |
denotes |
hair |
| T11434 |
53472-53476 |
NNS |
denotes |
buds |
| T11409 |
53477-53480 |
VBD |
denotes |
led |
| T11436 |
53481-53483 |
PRP |
denotes |
us |
| T11437 |
53484-53486 |
TO |
denotes |
to |
| T11438 |
53487-53493 |
VB |
denotes |
wonder |
| T11439 |
53494-53501 |
IN |
denotes |
whether |
| T11441 |
53502-53505 |
DT |
denotes |
the |
| T11443 |
53506-53510 |
JJ |
denotes |
down |
| T11444 |
53510-53511 |
HYPH |
denotes |
- |
| T11442 |
53511-53521 |
NN |
denotes |
regulation |
| T11445 |
53522-53524 |
IN |
denotes |
of |
| T11446 |
53525-53526 |
NN |
denotes |
E |
| T11448 |
53526-53527 |
HYPH |
denotes |
- |
| T11447 |
53527-53535 |
NN |
denotes |
cadherin |
| T11449 |
53536-53542 |
IN |
denotes |
during |
| T11450 |
53543-53551 |
NN |
denotes |
follicle |
| T11451 |
53552-53565 |
NN |
denotes |
morphogenesis |
| T11452 |
53566-53571 |
MD |
denotes |
might |
| T11440 |
53572-53576 |
VB |
denotes |
have |
| T11453 |
53577-53578 |
DT |
denotes |
a |
| T11455 |
53579-53585 |
JJ |
denotes |
direct |
| T11454 |
53586-53592 |
NN |
denotes |
impact |
| T11456 |
53593-53595 |
IN |
denotes |
on |
| T11457 |
53596-53605 |
VBG |
denotes |
elevating |
| T11458 |
53606-53609 |
DT |
denotes |
the |
| T11460 |
53610-53623 |
JJ |
denotes |
proliferative |
| T11459 |
53624-53629 |
NN |
denotes |
state |
| T11461 |
53630-53632 |
IN |
denotes |
of |
| T11462 |
53633-53638 |
DT |
denotes |
these |
| T11463 |
53639-53644 |
NNS |
denotes |
cells |
| T11464 |
53644-53645 |
. |
denotes |
. |
| T11465 |
53645-53827 |
sentence |
denotes |
Our Tg studies suggested that, at least in part through its regulation of E-cadherin, Snail is able to influence the subcellular localization of a variety of AJ-associated proteins. |
| T11466 |
53646-53649 |
PRP$ |
denotes |
Our |
| T11468 |
53650-53652 |
NN |
denotes |
Tg |
| T11467 |
53653-53660 |
NNS |
denotes |
studies |
| T11469 |
53661-53670 |
VBD |
denotes |
suggested |
| T11470 |
53671-53675 |
IN |
denotes |
that |
| T11472 |
53675-53677 |
, |
denotes |
, |
| T11473 |
53677-53679 |
RB |
denotes |
at |
| T11474 |
53680-53685 |
RBS |
denotes |
least |
| T11475 |
53686-53688 |
IN |
denotes |
in |
| T11477 |
53689-53693 |
NN |
denotes |
part |
| T11476 |
53694-53701 |
IN |
denotes |
through |
| T11478 |
53702-53705 |
PRP$ |
denotes |
its |
| T11479 |
53706-53716 |
NN |
denotes |
regulation |
| T11480 |
53717-53719 |
IN |
denotes |
of |
| T11481 |
53720-53721 |
NN |
denotes |
E |
| T11483 |
53721-53722 |
HYPH |
denotes |
- |
| T11482 |
53722-53730 |
NN |
denotes |
cadherin |
| T11484 |
53730-53732 |
, |
denotes |
, |
| T11485 |
53732-53737 |
NN |
denotes |
Snail |
| T11471 |
53738-53740 |
VBZ |
denotes |
is |
| T11486 |
53741-53745 |
JJ |
denotes |
able |
| T11487 |
53746-53748 |
TO |
denotes |
to |
| T11488 |
53749-53758 |
VB |
denotes |
influence |
| T11489 |
53759-53762 |
DT |
denotes |
the |
| T11491 |
53763-53774 |
JJ |
denotes |
subcellular |
| T11490 |
53775-53787 |
NN |
denotes |
localization |
| T11492 |
53788-53790 |
IN |
denotes |
of |
| T11493 |
53791-53792 |
DT |
denotes |
a |
| T11494 |
53793-53800 |
NN |
denotes |
variety |
| T11495 |
53801-53803 |
IN |
denotes |
of |
| T11496 |
53804-53806 |
NN |
denotes |
AJ |
| T11498 |
53806-53807 |
HYPH |
denotes |
- |
| T11497 |
53807-53817 |
VBN |
denotes |
associated |
| T11499 |
53818-53826 |
NN |
denotes |
proteins |
| T11500 |
53826-53827 |
. |
denotes |
. |
| T11501 |
53827-53957 |
sentence |
denotes |
One of these appears to be Ajuba, which was previously shown to have the dual capacity to bind Grb-2 as well as α-catenin [9,10]. |
| T11502 |
53828-53831 |
CD |
denotes |
One |
| T11504 |
53832-53834 |
IN |
denotes |
of |
| T11505 |
53835-53840 |
DT |
denotes |
these |
| T11503 |
53841-53848 |
VBZ |
denotes |
appears |
| T11506 |
53849-53851 |
TO |
denotes |
to |
| T11507 |
53852-53854 |
VB |
denotes |
be |
| T11508 |
53855-53860 |
NN |
denotes |
Ajuba |
| T11509 |
53860-53862 |
, |
denotes |
, |
| T11510 |
53862-53867 |
WDT |
denotes |
which |
| T11512 |
53868-53871 |
VBD |
denotes |
was |
| T11513 |
53872-53882 |
RB |
denotes |
previously |
| T11511 |
53883-53888 |
VBN |
denotes |
shown |
| T11514 |
53889-53891 |
TO |
denotes |
to |
| T11515 |
53892-53896 |
VB |
denotes |
have |
| T11516 |
53897-53900 |
DT |
denotes |
the |
| T11518 |
53901-53905 |
JJ |
denotes |
dual |
| T11517 |
53906-53914 |
NN |
denotes |
capacity |
| T11519 |
53915-53917 |
TO |
denotes |
to |
| T11520 |
53918-53922 |
VB |
denotes |
bind |
| T11521 |
53923-53926 |
NN |
denotes |
Grb |
| T11522 |
53926-53927 |
HYPH |
denotes |
- |
| T11523 |
53927-53928 |
CD |
denotes |
2 |
| T11524 |
53929-53931 |
RB |
denotes |
as |
| T11526 |
53932-53936 |
RB |
denotes |
well |
| T11525 |
53937-53939 |
IN |
denotes |
as |
| T11527 |
53940-53941 |
NN |
denotes |
α |
| T11529 |
53941-53942 |
HYPH |
denotes |
- |
| T11528 |
53942-53949 |
NN |
denotes |
catenin |
| T11530 |
53950-53951 |
-LRB- |
denotes |
[ |
| T11532 |
53951-53952 |
CD |
denotes |
9 |
| T11533 |
53952-53953 |
, |
denotes |
, |
| T11531 |
53953-53955 |
CD |
denotes |
10 |
| T11534 |
53955-53956 |
-RRB- |
denotes |
] |
| T11535 |
53956-53957 |
. |
denotes |
. |
| T11536 |
53957-54185 |
sentence |
denotes |
Our studies revealed that in skin keratinocytes that either harbor a conditional null mutation in α-catenin or that overexpress Snail, Ajuba develops an interaction with Grb-2 that is otherwise not observed in WT keratinocytes. |
| T11537 |
53958-53961 |
PRP$ |
denotes |
Our |
| T11538 |
53962-53969 |
NNS |
denotes |
studies |
| T11539 |
53970-53978 |
VBD |
denotes |
revealed |
| T11540 |
53979-53983 |
IN |
denotes |
that |
| T11542 |
53984-53986 |
IN |
denotes |
in |
| T11543 |
53987-53991 |
NN |
denotes |
skin |
| T11544 |
53992-54005 |
NNS |
denotes |
keratinocytes |
| T11545 |
54006-54010 |
WDT |
denotes |
that |
| T11547 |
54011-54017 |
CC |
denotes |
either |
| T11546 |
54018-54024 |
VBP |
denotes |
harbor |
| T11548 |
54025-54026 |
DT |
denotes |
a |
| T11550 |
54027-54038 |
JJ |
denotes |
conditional |
| T11551 |
54039-54043 |
JJ |
denotes |
null |
| T11549 |
54044-54052 |
NN |
denotes |
mutation |
| T11552 |
54053-54055 |
IN |
denotes |
in |
| T11553 |
54056-54057 |
NN |
denotes |
α |
| T11555 |
54057-54058 |
HYPH |
denotes |
- |
| T11554 |
54058-54065 |
NN |
denotes |
catenin |
| T11556 |
54066-54068 |
CC |
denotes |
or |
| T11557 |
54069-54073 |
WDT |
denotes |
that |
| T11558 |
54074-54085 |
VBP |
denotes |
overexpress |
| T11559 |
54086-54091 |
NN |
denotes |
Snail |
| T11560 |
54091-54093 |
, |
denotes |
, |
| T11561 |
54093-54098 |
NN |
denotes |
Ajuba |
| T11541 |
54099-54107 |
VBZ |
denotes |
develops |
| T11562 |
54108-54110 |
DT |
denotes |
an |
| T11563 |
54111-54122 |
NN |
denotes |
interaction |
| T11564 |
54123-54127 |
IN |
denotes |
with |
| T11565 |
54128-54131 |
NN |
denotes |
Grb |
| T11566 |
54131-54132 |
HYPH |
denotes |
- |
| T11567 |
54132-54133 |
CD |
denotes |
2 |
| T11568 |
54134-54138 |
WDT |
denotes |
that |
| T11570 |
54139-54141 |
VBZ |
denotes |
is |
| T11571 |
54142-54151 |
RB |
denotes |
otherwise |
| T11572 |
54152-54155 |
RB |
denotes |
not |
| T11569 |
54156-54164 |
VBN |
denotes |
observed |
| T11573 |
54165-54167 |
IN |
denotes |
in |
| T11574 |
54168-54170 |
NN |
denotes |
WT |
| T11575 |
54171-54184 |
NNS |
denotes |
keratinocytes |
| T11576 |
54184-54185 |
. |
denotes |
. |
| T11577 |
54185-54489 |
sentence |
denotes |
The corresponding abilities of either Snail-transfected or Ajuba-transfected keratinocytes to exhibit elevated activation of the Ras-MAPK pathway suggest that the Grb-2 association of Ajuba under conditions of reduced levels of AJ proteins may be directly relevant to the parallel in hyperproliferation. |
| T11578 |
54186-54189 |
DT |
denotes |
The |
| T11580 |
54190-54203 |
VBG |
denotes |
corresponding |
| T11579 |
54204-54213 |
NNS |
denotes |
abilities |
| T11582 |
54214-54216 |
IN |
denotes |
of |
| T11583 |
54217-54223 |
CC |
denotes |
either |
| T11585 |
54224-54229 |
NN |
denotes |
Snail |
| T11587 |
54229-54230 |
HYPH |
denotes |
- |
| T11586 |
54230-54241 |
VBN |
denotes |
transfected |
| T11588 |
54242-54244 |
CC |
denotes |
or |
| T11589 |
54245-54250 |
NN |
denotes |
Ajuba |
| T11591 |
54250-54251 |
HYPH |
denotes |
- |
| T11590 |
54251-54262 |
VBN |
denotes |
transfected |
| T11584 |
54263-54276 |
NNS |
denotes |
keratinocytes |
| T11592 |
54277-54279 |
TO |
denotes |
to |
| T11593 |
54280-54287 |
VB |
denotes |
exhibit |
| T11594 |
54288-54296 |
JJ |
denotes |
elevated |
| T11595 |
54297-54307 |
NN |
denotes |
activation |
| T11596 |
54308-54310 |
IN |
denotes |
of |
| T11597 |
54311-54314 |
DT |
denotes |
the |
| T11599 |
54315-54318 |
NN |
denotes |
Ras |
| T11601 |
54318-54319 |
HYPH |
denotes |
- |
| T11600 |
54319-54323 |
NN |
denotes |
MAPK |
| T11598 |
54324-54331 |
NN |
denotes |
pathway |
| T11581 |
54332-54339 |
VBP |
denotes |
suggest |
| T11602 |
54340-54344 |
IN |
denotes |
that |
| T11604 |
54345-54348 |
DT |
denotes |
the |
| T11606 |
54349-54352 |
NN |
denotes |
Grb |
| T11607 |
54352-54353 |
HYPH |
denotes |
- |
| T11608 |
54353-54354 |
CD |
denotes |
2 |
| T11605 |
54355-54366 |
NN |
denotes |
association |
| T11609 |
54367-54369 |
IN |
denotes |
of |
| T11610 |
54370-54375 |
NN |
denotes |
Ajuba |
| T11611 |
54376-54381 |
IN |
denotes |
under |
| T11612 |
54382-54392 |
NNS |
denotes |
conditions |
| T11613 |
54393-54395 |
IN |
denotes |
of |
| T11614 |
54396-54403 |
JJ |
denotes |
reduced |
| T11615 |
54404-54410 |
NNS |
denotes |
levels |
| T11616 |
54411-54413 |
IN |
denotes |
of |
| T11617 |
54414-54416 |
NN |
denotes |
AJ |
| T11618 |
54417-54425 |
NN |
denotes |
proteins |
| T11619 |
54426-54429 |
MD |
denotes |
may |
| T11603 |
54430-54432 |
VB |
denotes |
be |
| T11620 |
54433-54441 |
RB |
denotes |
directly |
| T11621 |
54442-54450 |
JJ |
denotes |
relevant |
| T11622 |
54451-54453 |
IN |
denotes |
to |
| T11623 |
54454-54457 |
DT |
denotes |
the |
| T11624 |
54458-54466 |
NN |
denotes |
parallel |
| T11625 |
54467-54469 |
IN |
denotes |
in |
| T11626 |
54470-54488 |
NN |
denotes |
hyperproliferation |
| T11627 |
54488-54489 |
. |
denotes |
. |
| T11628 |
54489-54676 |
sentence |
denotes |
In stable epithelial (i.e., Madin-Darby canine kidney, or MDCK) cell lines, Snail has been shown to block cell cycle progression and promote motility and shape changes for invasion [47]. |
| T11629 |
54490-54492 |
IN |
denotes |
In |
| T11631 |
54493-54499 |
JJ |
denotes |
stable |
| T11633 |
54500-54510 |
JJ |
denotes |
epithelial |
| T11634 |
54511-54512 |
-LRB- |
denotes |
( |
| T11636 |
54512-54516 |
FW |
denotes |
i.e. |
| T11637 |
54516-54518 |
, |
denotes |
, |
| T11638 |
54518-54523 |
NNP |
denotes |
Madin |
| T11640 |
54523-54524 |
HYPH |
denotes |
- |
| T11639 |
54524-54529 |
NNP |
denotes |
Darby |
| T11641 |
54530-54536 |
JJ |
denotes |
canine |
| T11635 |
54537-54543 |
NN |
denotes |
kidney |
| T11642 |
54543-54545 |
, |
denotes |
, |
| T11643 |
54545-54547 |
CC |
denotes |
or |
| T11644 |
54548-54552 |
NN |
denotes |
MDCK |
| T11645 |
54552-54553 |
-RRB- |
denotes |
) |
| T11646 |
54554-54558 |
NN |
denotes |
cell |
| T11632 |
54559-54564 |
NNS |
denotes |
lines |
| T11647 |
54564-54566 |
, |
denotes |
, |
| T11648 |
54566-54571 |
NN |
denotes |
Snail |
| T11649 |
54572-54575 |
VBZ |
denotes |
has |
| T11650 |
54576-54580 |
VBN |
denotes |
been |
| T11630 |
54581-54586 |
VBN |
denotes |
shown |
| T11651 |
54587-54589 |
TO |
denotes |
to |
| T11652 |
54590-54595 |
VB |
denotes |
block |
| T11653 |
54596-54600 |
NN |
denotes |
cell |
| T11654 |
54601-54606 |
NN |
denotes |
cycle |
| T11655 |
54607-54618 |
NN |
denotes |
progression |
| T11656 |
54619-54622 |
CC |
denotes |
and |
| T11657 |
54623-54630 |
VB |
denotes |
promote |
| T11658 |
54631-54639 |
NN |
denotes |
motility |
| T11660 |
54640-54643 |
CC |
denotes |
and |
| T11661 |
54644-54649 |
NN |
denotes |
shape |
| T11659 |
54650-54657 |
NNS |
denotes |
changes |
| T11662 |
54658-54661 |
IN |
denotes |
for |
| T11663 |
54662-54670 |
NN |
denotes |
invasion |
| T11664 |
54671-54672 |
-LRB- |
denotes |
[ |
| T11665 |
54672-54674 |
CD |
denotes |
47 |
| T11666 |
54674-54675 |
-RRB- |
denotes |
] |
| T11667 |
54675-54676 |
. |
denotes |
. |
| T11668 |
54676-54846 |
sentence |
denotes |
While our in vivo studies are consistent with a role for Snail in motility and epithelial remodeling, they differ with respect to Snail's apparent proliferative effects. |
| T11669 |
54677-54682 |
IN |
denotes |
While |
| T11671 |
54683-54686 |
PRP$ |
denotes |
our |
| T11673 |
54687-54689 |
FW |
denotes |
in |
| T11674 |
54690-54694 |
FW |
denotes |
vivo |
| T11672 |
54695-54702 |
NNS |
denotes |
studies |
| T11670 |
54703-54706 |
VBP |
denotes |
are |
| T11676 |
54707-54717 |
JJ |
denotes |
consistent |
| T11677 |
54718-54722 |
IN |
denotes |
with |
| T11678 |
54723-54724 |
DT |
denotes |
a |
| T11679 |
54725-54729 |
NN |
denotes |
role |
| T11680 |
54730-54733 |
IN |
denotes |
for |
| T11681 |
54734-54739 |
NN |
denotes |
Snail |
| T11682 |
54740-54742 |
IN |
denotes |
in |
| T11683 |
54743-54751 |
NN |
denotes |
motility |
| T11685 |
54752-54755 |
CC |
denotes |
and |
| T11686 |
54756-54766 |
JJ |
denotes |
epithelial |
| T11684 |
54767-54777 |
NN |
denotes |
remodeling |
| T11687 |
54777-54779 |
, |
denotes |
, |
| T11688 |
54779-54783 |
PRP |
denotes |
they |
| T11675 |
54784-54790 |
VBP |
denotes |
differ |
| T11689 |
54791-54795 |
IN |
denotes |
with |
| T11690 |
54796-54803 |
NN |
denotes |
respect |
| T11691 |
54804-54806 |
IN |
denotes |
to |
| T11692 |
54807-54812 |
NN |
denotes |
Snail |
| T11694 |
54812-54814 |
POS |
denotes |
's |
| T11695 |
54815-54823 |
JJ |
denotes |
apparent |
| T11696 |
54824-54837 |
JJ |
denotes |
proliferative |
| T11693 |
54838-54845 |
NNS |
denotes |
effects |
| T11697 |
54845-54846 |
. |
denotes |
. |
| T11698 |
54846-54956 |
sentence |
denotes |
A priori, this could be simply due to variations in the response of different cell types to Snail expression. |
| T11699 |
54847-54848 |
FW |
denotes |
A |
| T11700 |
54849-54855 |
FW |
denotes |
priori |
| T11702 |
54855-54857 |
, |
denotes |
, |
| T11703 |
54857-54861 |
DT |
denotes |
this |
| T11704 |
54862-54867 |
MD |
denotes |
could |
| T11701 |
54868-54870 |
VB |
denotes |
be |
| T11705 |
54871-54877 |
RB |
denotes |
simply |
| T11706 |
54878-54881 |
IN |
denotes |
due |
| T11707 |
54882-54884 |
IN |
denotes |
to |
| T11708 |
54885-54895 |
NNS |
denotes |
variations |
| T11709 |
54896-54898 |
IN |
denotes |
in |
| T11710 |
54899-54902 |
DT |
denotes |
the |
| T11711 |
54903-54911 |
NN |
denotes |
response |
| T11712 |
54912-54914 |
IN |
denotes |
of |
| T11713 |
54915-54924 |
JJ |
denotes |
different |
| T11715 |
54925-54929 |
NN |
denotes |
cell |
| T11714 |
54930-54935 |
NNS |
denotes |
types |
| T11716 |
54936-54938 |
IN |
denotes |
to |
| T11717 |
54939-54944 |
NN |
denotes |
Snail |
| T11718 |
54945-54955 |
NN |
denotes |
expression |
| T11719 |
54955-54956 |
. |
denotes |
. |
| T11720 |
54956-55115 |
sentence |
denotes |
Alternatively, these differences may be relevant to the benefit of using mouse models to reveal functions not always recapitulated in stable cell line models. |
| T11721 |
54957-54970 |
RB |
denotes |
Alternatively |
| T11723 |
54970-54972 |
, |
denotes |
, |
| T11724 |
54972-54977 |
DT |
denotes |
these |
| T11725 |
54978-54989 |
NNS |
denotes |
differences |
| T11726 |
54990-54993 |
MD |
denotes |
may |
| T11722 |
54994-54996 |
VB |
denotes |
be |
| T11727 |
54997-55005 |
JJ |
denotes |
relevant |
| T11728 |
55006-55008 |
IN |
denotes |
to |
| T11729 |
55009-55012 |
DT |
denotes |
the |
| T11730 |
55013-55020 |
NN |
denotes |
benefit |
| T11731 |
55021-55023 |
IN |
denotes |
of |
| T11732 |
55024-55029 |
VBG |
denotes |
using |
| T11733 |
55030-55035 |
NN |
denotes |
mouse |
| T11734 |
55036-55042 |
NNS |
denotes |
models |
| T11735 |
55043-55045 |
TO |
denotes |
to |
| T11736 |
55046-55052 |
VB |
denotes |
reveal |
| T11737 |
55053-55062 |
NNS |
denotes |
functions |
| T11738 |
55063-55066 |
RB |
denotes |
not |
| T11740 |
55067-55073 |
RB |
denotes |
always |
| T11739 |
55074-55087 |
VBN |
denotes |
recapitulated |
| T11741 |
55088-55090 |
IN |
denotes |
in |
| T11742 |
55091-55097 |
JJ |
denotes |
stable |
| T11744 |
55098-55102 |
NN |
denotes |
cell |
| T11745 |
55103-55107 |
NN |
denotes |
line |
| T11743 |
55108-55114 |
NNS |
denotes |
models |
| T11746 |
55114-55115 |
. |
denotes |
. |
| T11747 |
55115-55198 |
sentence |
denotes |
Future studies should highlight the underlying reasons for these opposing results. |
| T11748 |
55116-55122 |
JJ |
denotes |
Future |
| T11749 |
55123-55130 |
NNS |
denotes |
studies |
| T11751 |
55131-55137 |
MD |
denotes |
should |
| T11750 |
55138-55147 |
VB |
denotes |
highlight |
| T11752 |
55148-55151 |
DT |
denotes |
the |
| T11754 |
55152-55162 |
JJ |
denotes |
underlying |
| T11753 |
55163-55170 |
NNS |
denotes |
reasons |
| T11755 |
55171-55174 |
IN |
denotes |
for |
| T11756 |
55175-55180 |
DT |
denotes |
these |
| T11758 |
55181-55189 |
VBG |
denotes |
opposing |
| T11757 |
55190-55197 |
NNS |
denotes |
results |
| T11759 |
55197-55198 |
. |
denotes |
. |
| T11760 |
55198-55383 |
sentence |
denotes |
Irrespective of these differences, our in vivo studies do not stand alone, as there are many situations in which a down-regulation in AJ proteins correlate with enhanced proliferation. |
| T11761 |
55199-55211 |
JJ |
denotes |
Irrespective |
| T11763 |
55212-55214 |
IN |
denotes |
of |
| T11764 |
55215-55220 |
DT |
denotes |
these |
| T11765 |
55221-55232 |
NNS |
denotes |
differences |
| T11766 |
55232-55234 |
, |
denotes |
, |
| T11767 |
55234-55237 |
PRP$ |
denotes |
our |
| T11769 |
55238-55240 |
FW |
denotes |
in |
| T11770 |
55241-55245 |
FW |
denotes |
vivo |
| T11768 |
55246-55253 |
NNS |
denotes |
studies |
| T11771 |
55254-55256 |
VBP |
denotes |
do |
| T11772 |
55257-55260 |
RB |
denotes |
not |
| T11762 |
55261-55266 |
VB |
denotes |
stand |
| T11773 |
55267-55272 |
RB |
denotes |
alone |
| T11774 |
55272-55274 |
, |
denotes |
, |
| T11775 |
55274-55276 |
IN |
denotes |
as |
| T11777 |
55277-55282 |
EX |
denotes |
there |
| T11776 |
55283-55286 |
VBP |
denotes |
are |
| T11778 |
55287-55291 |
JJ |
denotes |
many |
| T11779 |
55292-55302 |
NNS |
denotes |
situations |
| T11780 |
55303-55305 |
IN |
denotes |
in |
| T11782 |
55306-55311 |
WDT |
denotes |
which |
| T11783 |
55312-55313 |
DT |
denotes |
a |
| T11785 |
55314-55318 |
JJ |
denotes |
down |
| T11786 |
55318-55319 |
HYPH |
denotes |
- |
| T11784 |
55319-55329 |
NN |
denotes |
regulation |
| T11787 |
55330-55332 |
IN |
denotes |
in |
| T11788 |
55333-55335 |
NN |
denotes |
AJ |
| T11789 |
55336-55344 |
NN |
denotes |
proteins |
| T11781 |
55345-55354 |
VBP |
denotes |
correlate |
| T11790 |
55355-55359 |
IN |
denotes |
with |
| T11791 |
55360-55368 |
VBN |
denotes |
enhanced |
| T11792 |
55369-55382 |
NN |
denotes |
proliferation |
| T11793 |
55382-55383 |
. |
denotes |
. |
| T11794 |
55383-55533 |
sentence |
denotes |
In fact, a myriad of diverse mechanisms have been implicated in activating epithelial proliferation upon down-regulation of AJ proteins [7,23,24,48]. |
| T11795 |
55384-55386 |
IN |
denotes |
In |
| T11797 |
55387-55391 |
NN |
denotes |
fact |
| T11798 |
55391-55393 |
, |
denotes |
, |
| T11799 |
55393-55394 |
DT |
denotes |
a |
| T11800 |
55395-55401 |
NN |
denotes |
myriad |
| T11801 |
55402-55404 |
IN |
denotes |
of |
| T11802 |
55405-55412 |
JJ |
denotes |
diverse |
| T11803 |
55413-55423 |
NNS |
denotes |
mechanisms |
| T11804 |
55424-55428 |
VBP |
denotes |
have |
| T11805 |
55429-55433 |
VBN |
denotes |
been |
| T11796 |
55434-55444 |
VBN |
denotes |
implicated |
| T11806 |
55445-55447 |
IN |
denotes |
in |
| T11807 |
55448-55458 |
VBG |
denotes |
activating |
| T11808 |
55459-55469 |
JJ |
denotes |
epithelial |
| T11809 |
55470-55483 |
NN |
denotes |
proliferation |
| T11810 |
55484-55488 |
IN |
denotes |
upon |
| T11811 |
55489-55493 |
JJ |
denotes |
down |
| T11813 |
55493-55494 |
HYPH |
denotes |
- |
| T11812 |
55494-55504 |
NN |
denotes |
regulation |
| T11814 |
55505-55507 |
IN |
denotes |
of |
| T11815 |
55508-55510 |
NN |
denotes |
AJ |
| T11816 |
55511-55519 |
NN |
denotes |
proteins |
| T11817 |
55520-55521 |
-LRB- |
denotes |
[ |
| T11819 |
55521-55522 |
CD |
denotes |
7 |
| T11820 |
55522-55523 |
, |
denotes |
, |
| T11821 |
55523-55525 |
CD |
denotes |
23 |
| T11822 |
55525-55526 |
, |
denotes |
, |
| T11823 |
55526-55528 |
CD |
denotes |
24 |
| T11824 |
55528-55529 |
, |
denotes |
, |
| T11818 |
55529-55531 |
CD |
denotes |
48 |
| T11825 |
55531-55532 |
-RRB- |
denotes |
] |
| T11826 |
55532-55533 |
. |
denotes |
. |
| T11827 |
55533-55628 |
sentence |
denotes |
Sifting through these converging pathways is likely to be a difficult and painstaking process. |
| T11828 |
55534-55541 |
VBG |
denotes |
Sifting |
| T11830 |
55542-55549 |
IN |
denotes |
through |
| T11831 |
55550-55555 |
DT |
denotes |
these |
| T11833 |
55556-55566 |
VBG |
denotes |
converging |
| T11832 |
55567-55575 |
NNS |
denotes |
pathways |
| T11829 |
55576-55578 |
VBZ |
denotes |
is |
| T11834 |
55579-55585 |
JJ |
denotes |
likely |
| T11835 |
55586-55588 |
TO |
denotes |
to |
| T11836 |
55589-55591 |
VB |
denotes |
be |
| T11837 |
55592-55593 |
DT |
denotes |
a |
| T11839 |
55594-55603 |
JJ |
denotes |
difficult |
| T11840 |
55604-55607 |
CC |
denotes |
and |
| T11841 |
55608-55619 |
JJ |
denotes |
painstaking |
| T11838 |
55620-55627 |
NN |
denotes |
process |
| T11842 |
55627-55628 |
. |
denotes |
. |
| T11843 |
55628-55913 |
sentence |
denotes |
This said, by identifying the status of different players involved in specific cell types and at specific stages in development, our mechanistic understanding of how intercellular remodeling is linked to proliferation in epithelial morphogenesis should begin to surface in the future. |
| T11844 |
55629-55633 |
DT |
denotes |
This |
| T11845 |
55634-55638 |
VBD |
denotes |
said |
| T11847 |
55638-55640 |
, |
denotes |
, |
| T11848 |
55640-55642 |
IN |
denotes |
by |
| T11849 |
55643-55654 |
VBG |
denotes |
identifying |
| T11850 |
55655-55658 |
DT |
denotes |
the |
| T11851 |
55659-55665 |
NN |
denotes |
status |
| T11852 |
55666-55668 |
IN |
denotes |
of |
| T11853 |
55669-55678 |
JJ |
denotes |
different |
| T11854 |
55679-55686 |
NNS |
denotes |
players |
| T11855 |
55687-55695 |
VBN |
denotes |
involved |
| T11856 |
55696-55698 |
IN |
denotes |
in |
| T11857 |
55699-55707 |
JJ |
denotes |
specific |
| T11859 |
55708-55712 |
NN |
denotes |
cell |
| T11858 |
55713-55718 |
NNS |
denotes |
types |
| T11860 |
55719-55722 |
CC |
denotes |
and |
| T11861 |
55723-55725 |
IN |
denotes |
at |
| T11862 |
55726-55734 |
JJ |
denotes |
specific |
| T11863 |
55735-55741 |
NNS |
denotes |
stages |
| T11864 |
55742-55744 |
IN |
denotes |
in |
| T11865 |
55745-55756 |
NN |
denotes |
development |
| T11866 |
55756-55758 |
, |
denotes |
, |
| T11867 |
55758-55761 |
PRP$ |
denotes |
our |
| T11869 |
55762-55773 |
JJ |
denotes |
mechanistic |
| T11868 |
55774-55787 |
NN |
denotes |
understanding |
| T11870 |
55788-55790 |
IN |
denotes |
of |
| T11871 |
55791-55794 |
WRB |
denotes |
how |
| T11873 |
55795-55808 |
JJ |
denotes |
intercellular |
| T11874 |
55809-55819 |
NN |
denotes |
remodeling |
| T11875 |
55820-55822 |
VBZ |
denotes |
is |
| T11872 |
55823-55829 |
VBN |
denotes |
linked |
| T11876 |
55830-55832 |
IN |
denotes |
to |
| T11877 |
55833-55846 |
NN |
denotes |
proliferation |
| T11878 |
55847-55849 |
IN |
denotes |
in |
| T11879 |
55850-55860 |
JJ |
denotes |
epithelial |
| T11880 |
55861-55874 |
NN |
denotes |
morphogenesis |
| T11881 |
55875-55881 |
MD |
denotes |
should |
| T11846 |
55882-55887 |
VB |
denotes |
begin |
| T11882 |
55888-55890 |
TO |
denotes |
to |
| T11883 |
55891-55898 |
VB |
denotes |
surface |
| T11884 |
55899-55901 |
IN |
denotes |
in |
| T11885 |
55902-55905 |
DT |
denotes |
the |
| T11886 |
55906-55912 |
NN |
denotes |
future |
| T11887 |
55912-55913 |
. |
denotes |
. |
| T11888 |
55913-56079 |
sentence |
denotes |
Elucidating the molecular mechanisms through which these networks converge is also a prerequisite for understanding how these processes go awry during tumorigenesis. |
| T11889 |
55914-55925 |
VBG |
denotes |
Elucidating |
| T11891 |
55926-55929 |
DT |
denotes |
the |
| T11893 |
55930-55939 |
JJ |
denotes |
molecular |
| T11892 |
55940-55950 |
NNS |
denotes |
mechanisms |
| T11894 |
55951-55958 |
IN |
denotes |
through |
| T11896 |
55959-55964 |
WDT |
denotes |
which |
| T11897 |
55965-55970 |
DT |
denotes |
these |
| T11898 |
55971-55979 |
NNS |
denotes |
networks |
| T11895 |
55980-55988 |
VBP |
denotes |
converge |
| T11890 |
55989-55991 |
VBZ |
denotes |
is |
| T11899 |
55992-55996 |
RB |
denotes |
also |
| T11900 |
55997-55998 |
DT |
denotes |
a |
| T11901 |
55999-56011 |
NN |
denotes |
prerequisite |
| T11902 |
56012-56015 |
IN |
denotes |
for |
| T11903 |
56016-56029 |
VBG |
denotes |
understanding |
| T11904 |
56030-56033 |
WRB |
denotes |
how |
| T11906 |
56034-56039 |
DT |
denotes |
these |
| T11907 |
56040-56049 |
NNS |
denotes |
processes |
| T11905 |
56050-56052 |
VBP |
denotes |
go |
| T11908 |
56053-56057 |
RB |
denotes |
awry |
| T11909 |
56058-56064 |
IN |
denotes |
during |
| T11910 |
56065-56078 |
NN |
denotes |
tumorigenesis |
| T11911 |
56078-56079 |
. |
denotes |
. |
| T12021 |
56104-56112 |
NNS |
denotes |
Reagents |
| T12022 |
56112-57203 |
sentence |
denotes |
Primary antibodies used were against: E-cadherin (M. Takeichi, Kyoto University, Japan); α-catenin, β-catenin, pMAPK, tubulin (Sigma, St. Louis, Missouri, United States), Ajuba (G. Longmore, Washington University, St. Louis, Missouri, United States); β4 integrin/CD104 (BD Pharmingen, San Diego, California, United States), laminin 5 (R. Burgeson, Harvard University, Cambridge, Massachusetts, United States), K5, K1, loricrin (Fuchs Lab), involucrin, fillagrin (Covance, Berkeley, California, United States), MAPK, pSMAD2 (Cell Signaling, Beverly, Massachusetts, United States); Grb-2 (Santa Cruz Biotech, Santa Cruz, California, United States); P-cadherin (Zymed Laboratories, South San Francisco, California, United States); HA (Roche Biochemicals), vimentin (Chemicon, Temecula, California, United States), Ki67 (Novo Castra, Newcastle Upon Tyne, United Kingdom), keratin 6 (P. Coulombe, John Hopkins University, Baltimore, Maryland, United States), cyclin D (Oncogene, San Diego, California, United States), and TGF-β2 (L. Gold, New York University, New York, New York, United States). |
| T12023 |
56113-56120 |
JJ |
denotes |
Primary |
| T12024 |
56121-56131 |
NNS |
denotes |
antibodies |
| T12026 |
56132-56136 |
VBN |
denotes |
used |
| T12025 |
56137-56141 |
VBD |
denotes |
were |
| T12027 |
56142-56149 |
IN |
denotes |
against |
| T12028 |
56149-56151 |
: |
denotes |
: |
| T12029 |
56151-56152 |
NN |
denotes |
E |
| T12031 |
56152-56153 |
HYPH |
denotes |
- |
| T12030 |
56153-56161 |
NN |
denotes |
cadherin |
| T12032 |
56162-56163 |
-LRB- |
denotes |
( |
| T12034 |
56163-56165 |
NNP |
denotes |
M. |
| T12033 |
56166-56174 |
NNP |
denotes |
Takeichi |
| T12035 |
56174-56176 |
, |
denotes |
, |
| T12036 |
56176-56181 |
NNP |
denotes |
Kyoto |
| T12037 |
56182-56192 |
NNP |
denotes |
University |
| T12038 |
56192-56194 |
, |
denotes |
, |
| T12039 |
56194-56199 |
NNP |
denotes |
Japan |
| T12040 |
56199-56200 |
-RRB- |
denotes |
) |
| T12041 |
56200-56201 |
: |
denotes |
; |
| T12042 |
56202-56203 |
NN |
denotes |
α |
| T12044 |
56203-56204 |
HYPH |
denotes |
- |
| T12043 |
56204-56211 |
NN |
denotes |
catenin |
| T12045 |
56211-56213 |
, |
denotes |
, |
| T12046 |
56213-56214 |
NN |
denotes |
β |
| T12048 |
56214-56215 |
HYPH |
denotes |
- |
| T12047 |
56215-56222 |
NN |
denotes |
catenin |
| T12049 |
56222-56224 |
, |
denotes |
, |
| T12050 |
56224-56229 |
NN |
denotes |
pMAPK |
| T12051 |
56229-56231 |
, |
denotes |
, |
| T12052 |
56231-56238 |
NN |
denotes |
tubulin |
| T12053 |
56239-56240 |
-LRB- |
denotes |
( |
| T12054 |
56240-56245 |
NNP |
denotes |
Sigma |
| T12055 |
56245-56247 |
, |
denotes |
, |
| T12056 |
56247-56250 |
NNP |
denotes |
St. |
| T12057 |
56251-56256 |
NNP |
denotes |
Louis |
| T12058 |
56256-56258 |
, |
denotes |
, |
| T12059 |
56258-56266 |
NNP |
denotes |
Missouri |
| T12060 |
56266-56268 |
, |
denotes |
, |
| T12061 |
56268-56274 |
NNP |
denotes |
United |
| T12062 |
56275-56281 |
NNP |
denotes |
States |
| T12063 |
56281-56282 |
-RRB- |
denotes |
) |
| T12064 |
56282-56284 |
, |
denotes |
, |
| T12065 |
56284-56289 |
NN |
denotes |
Ajuba |
| T12066 |
56290-56291 |
-LRB- |
denotes |
( |
| T12068 |
56291-56293 |
NNP |
denotes |
G. |
| T12067 |
56294-56302 |
NNP |
denotes |
Longmore |
| T12069 |
56302-56304 |
, |
denotes |
, |
| T12070 |
56304-56314 |
NNP |
denotes |
Washington |
| T12071 |
56315-56325 |
NNP |
denotes |
University |
| T12072 |
56325-56327 |
, |
denotes |
, |
| T12073 |
56327-56330 |
NNP |
denotes |
St. |
| T12074 |
56331-56336 |
NNP |
denotes |
Louis |
| T12075 |
56336-56338 |
, |
denotes |
, |
| T12076 |
56338-56346 |
NNP |
denotes |
Missouri |
| T12077 |
56346-56348 |
, |
denotes |
, |
| T12078 |
56348-56354 |
NNP |
denotes |
United |
| T12079 |
56355-56361 |
NNP |
denotes |
States |
| T12080 |
56361-56362 |
-RRB- |
denotes |
) |
| T12081 |
56362-56363 |
: |
denotes |
; |
| T12082 |
56364-56366 |
NN |
denotes |
β4 |
| T12083 |
56367-56375 |
NN |
denotes |
integrin |
| T12084 |
56375-56376 |
HYPH |
denotes |
/ |
| T12085 |
56376-56381 |
NN |
denotes |
CD104 |
| T12086 |
56382-56383 |
-LRB- |
denotes |
( |
| T12088 |
56383-56385 |
NNP |
denotes |
BD |
| T12087 |
56386-56396 |
NNP |
denotes |
Pharmingen |
| T12089 |
56396-56398 |
, |
denotes |
, |
| T12090 |
56398-56401 |
NNP |
denotes |
San |
| T12091 |
56402-56407 |
NNP |
denotes |
Diego |
| T12092 |
56407-56409 |
, |
denotes |
, |
| T12093 |
56409-56419 |
NNP |
denotes |
California |
| T12094 |
56419-56421 |
, |
denotes |
, |
| T12095 |
56421-56427 |
NNP |
denotes |
United |
| T12096 |
56428-56434 |
NNP |
denotes |
States |
| T12097 |
56434-56435 |
-RRB- |
denotes |
) |
| T12098 |
56435-56437 |
, |
denotes |
, |
| T12099 |
56437-56444 |
NN |
denotes |
laminin |
| T12100 |
56445-56446 |
CD |
denotes |
5 |
| T12101 |
56447-56448 |
-LRB- |
denotes |
( |
| T12103 |
56448-56450 |
NNP |
denotes |
R. |
| T12102 |
56451-56459 |
NNP |
denotes |
Burgeson |
| T12104 |
56459-56461 |
, |
denotes |
, |
| T12105 |
56461-56468 |
NNP |
denotes |
Harvard |
| T12106 |
56469-56479 |
NNP |
denotes |
University |
| T12107 |
56479-56481 |
, |
denotes |
, |
| T12108 |
56481-56490 |
NNP |
denotes |
Cambridge |
| T12109 |
56490-56492 |
, |
denotes |
, |
| T12110 |
56492-56505 |
NNP |
denotes |
Massachusetts |
| T12111 |
56505-56507 |
, |
denotes |
, |
| T12112 |
56507-56513 |
NNP |
denotes |
United |
| T12113 |
56514-56520 |
NNP |
denotes |
States |
| T12114 |
56520-56521 |
-RRB- |
denotes |
) |
| T12115 |
56521-56523 |
, |
denotes |
, |
| T12116 |
56523-56525 |
NN |
denotes |
K5 |
| T12117 |
56525-56527 |
, |
denotes |
, |
| T12118 |
56527-56529 |
NN |
denotes |
K1 |
| T12119 |
56529-56531 |
, |
denotes |
, |
| T12120 |
56531-56539 |
NN |
denotes |
loricrin |
| T12121 |
56540-56541 |
-LRB- |
denotes |
( |
| T12123 |
56541-56546 |
NNP |
denotes |
Fuchs |
| T12122 |
56547-56550 |
NNP |
denotes |
Lab |
| T12124 |
56550-56551 |
-RRB- |
denotes |
) |
| T12125 |
56551-56553 |
, |
denotes |
, |
| T12126 |
56553-56563 |
NN |
denotes |
involucrin |
| T12127 |
56563-56565 |
, |
denotes |
, |
| T12128 |
56565-56574 |
NN |
denotes |
fillagrin |
| T12129 |
56575-56576 |
-LRB- |
denotes |
( |
| T12130 |
56576-56583 |
NNP |
denotes |
Covance |
| T12131 |
56583-56585 |
, |
denotes |
, |
| T12132 |
56585-56593 |
NNP |
denotes |
Berkeley |
| T12133 |
56593-56595 |
, |
denotes |
, |
| T12134 |
56595-56605 |
NNP |
denotes |
California |
| T12135 |
56605-56607 |
, |
denotes |
, |
| T12136 |
56607-56613 |
NNP |
denotes |
United |
| T12137 |
56614-56620 |
NNP |
denotes |
States |
| T12138 |
56620-56621 |
-RRB- |
denotes |
) |
| T12139 |
56621-56623 |
, |
denotes |
, |
| T12140 |
56623-56627 |
NN |
denotes |
MAPK |
| T12141 |
56627-56629 |
, |
denotes |
, |
| T12142 |
56629-56635 |
NN |
denotes |
pSMAD2 |
| T12143 |
56636-56637 |
-LRB- |
denotes |
( |
| T12145 |
56637-56641 |
NNP |
denotes |
Cell |
| T12144 |
56642-56651 |
NNP |
denotes |
Signaling |
| T12146 |
56651-56653 |
, |
denotes |
, |
| T12147 |
56653-56660 |
NNP |
denotes |
Beverly |
| T12148 |
56660-56662 |
, |
denotes |
, |
| T12149 |
56662-56675 |
NNP |
denotes |
Massachusetts |
| T12150 |
56675-56677 |
, |
denotes |
, |
| T12151 |
56677-56683 |
NNP |
denotes |
United |
| T12152 |
56684-56690 |
NNP |
denotes |
States |
| T12153 |
56690-56691 |
-RRB- |
denotes |
) |
| T12154 |
56691-56692 |
: |
denotes |
; |
| T12155 |
56693-56696 |
NN |
denotes |
Grb |
| T12156 |
56696-56697 |
HYPH |
denotes |
- |
| T12157 |
56697-56698 |
CD |
denotes |
2 |
| T12158 |
56699-56700 |
-LRB- |
denotes |
( |
| T12160 |
56700-56705 |
NNP |
denotes |
Santa |
| T12161 |
56706-56710 |
NNP |
denotes |
Cruz |
| T12159 |
56711-56718 |
NNP |
denotes |
Biotech |
| T12162 |
56718-56720 |
, |
denotes |
, |
| T12163 |
56720-56725 |
NNP |
denotes |
Santa |
| T12164 |
56726-56730 |
NNP |
denotes |
Cruz |
| T12165 |
56730-56732 |
, |
denotes |
, |
| T12166 |
56732-56742 |
NNP |
denotes |
California |
| T12167 |
56742-56744 |
, |
denotes |
, |
| T12168 |
56744-56750 |
NNP |
denotes |
United |
| T12169 |
56751-56757 |
NNP |
denotes |
States |
| T12170 |
56757-56758 |
-RRB- |
denotes |
) |
| T12171 |
56758-56759 |
: |
denotes |
; |
| T12172 |
56760-56761 |
NN |
denotes |
P |
| T12174 |
56761-56762 |
HYPH |
denotes |
- |
| T12173 |
56762-56770 |
NN |
denotes |
cadherin |
| T12175 |
56771-56772 |
-LRB- |
denotes |
( |
| T12177 |
56772-56777 |
NNP |
denotes |
Zymed |
| T12176 |
56778-56790 |
NNP |
denotes |
Laboratories |
| T12178 |
56790-56792 |
, |
denotes |
, |
| T12179 |
56792-56797 |
JJ |
denotes |
South |
| T12181 |
56798-56801 |
NNP |
denotes |
San |
| T12180 |
56802-56811 |
NNP |
denotes |
Francisco |
| T12182 |
56811-56813 |
, |
denotes |
, |
| T12183 |
56813-56823 |
NNP |
denotes |
California |
| T12184 |
56823-56825 |
, |
denotes |
, |
| T12185 |
56825-56831 |
NNP |
denotes |
United |
| T12186 |
56832-56838 |
NNP |
denotes |
States |
| T12187 |
56838-56839 |
-RRB- |
denotes |
) |
| T12188 |
56839-56840 |
: |
denotes |
; |
| T12189 |
56841-56843 |
NN |
denotes |
HA |
| T12190 |
56844-56845 |
-LRB- |
denotes |
( |
| T12192 |
56845-56850 |
NNP |
denotes |
Roche |
| T12191 |
56851-56863 |
NNP |
denotes |
Biochemicals |
| T12193 |
56863-56864 |
-RRB- |
denotes |
) |
| T12194 |
56864-56866 |
, |
denotes |
, |
| T12195 |
56866-56874 |
NN |
denotes |
vimentin |
| T12196 |
56875-56876 |
-LRB- |
denotes |
( |
| T12197 |
56876-56884 |
NNP |
denotes |
Chemicon |
| T12198 |
56884-56886 |
, |
denotes |
, |
| T12199 |
56886-56894 |
NNP |
denotes |
Temecula |
| T12200 |
56894-56896 |
, |
denotes |
, |
| T12201 |
56896-56906 |
NNP |
denotes |
California |
| T12202 |
56906-56908 |
, |
denotes |
, |
| T12203 |
56908-56914 |
NNP |
denotes |
United |
| T12204 |
56915-56921 |
NNP |
denotes |
States |
| T12205 |
56921-56922 |
-RRB- |
denotes |
) |
| T12206 |
56922-56924 |
, |
denotes |
, |
| T12207 |
56924-56928 |
NN |
denotes |
Ki67 |
| T12208 |
56929-56930 |
-LRB- |
denotes |
( |
| T12210 |
56930-56934 |
NNP |
denotes |
Novo |
| T12209 |
56935-56941 |
NNP |
denotes |
Castra |
| T12211 |
56941-56943 |
, |
denotes |
, |
| T12212 |
56943-56952 |
NNP |
denotes |
Newcastle |
| T12213 |
56953-56957 |
IN |
denotes |
Upon |
| T12214 |
56958-56962 |
NNP |
denotes |
Tyne |
| T12215 |
56962-56964 |
, |
denotes |
, |
| T12216 |
56964-56970 |
NNP |
denotes |
United |
| T12217 |
56971-56978 |
NNP |
denotes |
Kingdom |
| T12218 |
56978-56979 |
-RRB- |
denotes |
) |
| T12219 |
56979-56981 |
, |
denotes |
, |
| T12220 |
56981-56988 |
NN |
denotes |
keratin |
| T12221 |
56989-56990 |
CD |
denotes |
6 |
| T12222 |
56991-56992 |
-LRB- |
denotes |
( |
| T12224 |
56992-56994 |
NNP |
denotes |
P. |
| T12223 |
56995-57003 |
NNP |
denotes |
Coulombe |
| T12225 |
57003-57005 |
, |
denotes |
, |
| T12226 |
57005-57009 |
NNP |
denotes |
John |
| T12227 |
57010-57017 |
NNP |
denotes |
Hopkins |
| T12228 |
57018-57028 |
NNP |
denotes |
University |
| T12229 |
57028-57030 |
, |
denotes |
, |
| T12230 |
57030-57039 |
NNP |
denotes |
Baltimore |
| T12231 |
57039-57041 |
, |
denotes |
, |
| T12232 |
57041-57049 |
NNP |
denotes |
Maryland |
| T12233 |
57049-57051 |
, |
denotes |
, |
| T12234 |
57051-57057 |
NNP |
denotes |
United |
| T12235 |
57058-57064 |
NNP |
denotes |
States |
| T12236 |
57064-57065 |
-RRB- |
denotes |
) |
| T12237 |
57065-57067 |
, |
denotes |
, |
| T12238 |
57067-57073 |
NN |
denotes |
cyclin |
| T12239 |
57074-57075 |
NN |
denotes |
D |
| T12240 |
57076-57077 |
-LRB- |
denotes |
( |
| T12241 |
57077-57085 |
NNP |
denotes |
Oncogene |
| T12242 |
57085-57087 |
, |
denotes |
, |
| T12243 |
57087-57090 |
NNP |
denotes |
San |
| T12244 |
57091-57096 |
NNP |
denotes |
Diego |
| T12245 |
57096-57098 |
, |
denotes |
, |
| T12246 |
57098-57108 |
NNP |
denotes |
California |
| T12247 |
57108-57110 |
, |
denotes |
, |
| T12248 |
57110-57116 |
NNP |
denotes |
United |
| T12249 |
57117-57123 |
NNP |
denotes |
States |
| T12250 |
57123-57124 |
-RRB- |
denotes |
) |
| T12251 |
57124-57126 |
, |
denotes |
, |
| T12252 |
57126-57129 |
CC |
denotes |
and |
| T12253 |
57130-57133 |
NN |
denotes |
TGF |
| T12255 |
57133-57134 |
HYPH |
denotes |
- |
| T12254 |
57134-57136 |
NN |
denotes |
β2 |
| T12256 |
57137-57138 |
-LRB- |
denotes |
( |
| T12258 |
57138-57140 |
NNP |
denotes |
L. |
| T12257 |
57141-57145 |
NNP |
denotes |
Gold |
| T12259 |
57145-57147 |
, |
denotes |
, |
| T12260 |
57147-57150 |
NNP |
denotes |
New |
| T12261 |
57151-57155 |
NNP |
denotes |
York |
| T12262 |
57156-57166 |
NNP |
denotes |
University |
| T12263 |
57166-57168 |
, |
denotes |
, |
| T12264 |
57168-57171 |
NNP |
denotes |
New |
| T12265 |
57172-57176 |
NNP |
denotes |
York |
| T12266 |
57176-57178 |
, |
denotes |
, |
| T12267 |
57178-57181 |
NNP |
denotes |
New |
| T12268 |
57182-57186 |
NNP |
denotes |
York |
| T12269 |
57186-57188 |
, |
denotes |
, |
| T12270 |
57188-57194 |
NNP |
denotes |
United |
| T12271 |
57195-57201 |
NNP |
denotes |
States |
| T12272 |
57201-57202 |
-RRB- |
denotes |
) |
| T12273 |
57202-57203 |
. |
denotes |
. |
| T12274 |
57203-57337 |
sentence |
denotes |
FITC-, Texas Red-, or HRP-conjugated secondary antibodies were from Jackson ImmunoResearch (West Grove, Pennsylvania, United States). |
| T12275 |
57204-57208 |
NN |
denotes |
FITC |
| T12277 |
57208-57209 |
HYPH |
denotes |
- |
| T12278 |
57209-57211 |
, |
denotes |
, |
| T12279 |
57211-57216 |
NNP |
denotes |
Texas |
| T12280 |
57217-57220 |
NNP |
denotes |
Red |
| T12281 |
57220-57221 |
HYPH |
denotes |
- |
| T12282 |
57221-57223 |
, |
denotes |
, |
| T12283 |
57223-57225 |
CC |
denotes |
or |
| T12284 |
57226-57229 |
NN |
denotes |
HRP |
| T12285 |
57229-57230 |
HYPH |
denotes |
- |
| T12276 |
57230-57240 |
VBN |
denotes |
conjugated |
| T12287 |
57241-57250 |
JJ |
denotes |
secondary |
| T12286 |
57251-57261 |
NNS |
denotes |
antibodies |
| T12288 |
57262-57266 |
VBD |
denotes |
were |
| T12289 |
57267-57271 |
IN |
denotes |
from |
| T12290 |
57272-57279 |
NNP |
denotes |
Jackson |
| T12291 |
57280-57294 |
NNP |
denotes |
ImmunoResearch |
| T12292 |
57295-57296 |
-LRB- |
denotes |
( |
| T12294 |
57296-57300 |
NNP |
denotes |
West |
| T12293 |
57301-57306 |
NNP |
denotes |
Grove |
| T12295 |
57306-57308 |
, |
denotes |
, |
| T12296 |
57308-57320 |
NNP |
denotes |
Pennsylvania |
| T12297 |
57320-57322 |
, |
denotes |
, |
| T12298 |
57322-57328 |
NNP |
denotes |
United |
| T12299 |
57329-57335 |
NNP |
denotes |
States |
| T12300 |
57335-57336 |
-RRB- |
denotes |
) |
| T12301 |
57336-57337 |
. |
denotes |
. |
| T12302 |
57337-57434 |
sentence |
denotes |
Biotinylated secondary antibodies were from Vector Labs (Burlingame, California, United States). |
| T12303 |
57338-57350 |
VBN |
denotes |
Biotinylated |
| T12305 |
57351-57360 |
JJ |
denotes |
secondary |
| T12304 |
57361-57371 |
NNS |
denotes |
antibodies |
| T12306 |
57372-57376 |
VBD |
denotes |
were |
| T12307 |
57377-57381 |
IN |
denotes |
from |
| T12308 |
57382-57388 |
NNP |
denotes |
Vector |
| T12309 |
57389-57393 |
NNP |
denotes |
Labs |
| T12310 |
57394-57395 |
-LRB- |
denotes |
( |
| T12311 |
57395-57405 |
NNP |
denotes |
Burlingame |
| T12312 |
57405-57407 |
, |
denotes |
, |
| T12313 |
57407-57417 |
NNP |
denotes |
California |
| T12314 |
57417-57419 |
, |
denotes |
, |
| T12315 |
57419-57425 |
NNP |
denotes |
United |
| T12316 |
57426-57432 |
NNP |
denotes |
States |
| T12317 |
57432-57433 |
-RRB- |
denotes |
) |
| T12318 |
57433-57434 |
. |
denotes |
. |
| T12319 |
57434-57497 |
sentence |
denotes |
Dilutions were according to the manufacturer's recommendation. |
| T12320 |
57435-57444 |
NNS |
denotes |
Dilutions |
| T12321 |
57445-57449 |
VBD |
denotes |
were |
| T12322 |
57450-57459 |
VBG |
denotes |
according |
| T12323 |
57460-57462 |
IN |
denotes |
to |
| T12324 |
57463-57466 |
DT |
denotes |
the |
| T12325 |
57467-57479 |
NN |
denotes |
manufacturer |
| T12327 |
57479-57481 |
POS |
denotes |
's |
| T12326 |
57482-57496 |
NN |
denotes |
recommendation |
| T12328 |
57496-57497 |
. |
denotes |
. |
| T12329 |
57497-57672 |
sentence |
denotes |
The Snail antibody was generated in Guinea pigs by inoculating them with the N-terminal sequence of murine Snail fused to GST (Covance, Princeton, New Jersey, United States). |
| T12330 |
57498-57501 |
DT |
denotes |
The |
| T12332 |
57502-57507 |
NN |
denotes |
Snail |
| T12331 |
57508-57516 |
NN |
denotes |
antibody |
| T12334 |
57517-57520 |
VBD |
denotes |
was |
| T12333 |
57521-57530 |
VBN |
denotes |
generated |
| T12335 |
57531-57533 |
IN |
denotes |
in |
| T12336 |
57534-57540 |
NN |
denotes |
Guinea |
| T12337 |
57541-57545 |
NNS |
denotes |
pigs |
| T12338 |
57546-57548 |
IN |
denotes |
by |
| T12339 |
57549-57560 |
VBG |
denotes |
inoculating |
| T12340 |
57561-57565 |
PRP |
denotes |
them |
| T12341 |
57566-57570 |
IN |
denotes |
with |
| T12342 |
57571-57574 |
DT |
denotes |
the |
| T12344 |
57575-57576 |
NN |
denotes |
N |
| T12346 |
57576-57577 |
HYPH |
denotes |
- |
| T12345 |
57577-57585 |
JJ |
denotes |
terminal |
| T12343 |
57586-57594 |
NN |
denotes |
sequence |
| T12347 |
57595-57597 |
IN |
denotes |
of |
| T12348 |
57598-57604 |
JJ |
denotes |
murine |
| T12349 |
57605-57610 |
NN |
denotes |
Snail |
| T12350 |
57611-57616 |
VBN |
denotes |
fused |
| T12351 |
57617-57619 |
IN |
denotes |
to |
| T12352 |
57620-57623 |
NN |
denotes |
GST |
| T12353 |
57624-57625 |
-LRB- |
denotes |
( |
| T12354 |
57625-57632 |
NNP |
denotes |
Covance |
| T12355 |
57632-57634 |
, |
denotes |
, |
| T12356 |
57634-57643 |
NNP |
denotes |
Princeton |
| T12357 |
57643-57645 |
, |
denotes |
, |
| T12358 |
57645-57648 |
NNP |
denotes |
New |
| T12359 |
57649-57655 |
NNP |
denotes |
Jersey |
| T12360 |
57655-57657 |
, |
denotes |
, |
| T12361 |
57657-57663 |
NNP |
denotes |
United |
| T12362 |
57664-57670 |
NNP |
denotes |
States |
| T12363 |
57670-57671 |
-RRB- |
denotes |
) |
| T12364 |
57671-57672 |
. |
denotes |
. |
| T12365 |
57672-57761 |
sentence |
denotes |
Recombinant human TGF-β2 was purchased from R&D (Minneapolis, Minnesota, United States). |
| T12366 |
57673-57684 |
JJ |
denotes |
Recombinant |
| T12368 |
57685-57690 |
JJ |
denotes |
human |
| T12369 |
57691-57694 |
NN |
denotes |
TGF |
| T12370 |
57694-57695 |
HYPH |
denotes |
- |
| T12367 |
57695-57697 |
NN |
denotes |
β2 |
| T12372 |
57698-57701 |
VBD |
denotes |
was |
| T12371 |
57702-57711 |
VBN |
denotes |
purchased |
| T12373 |
57712-57716 |
IN |
denotes |
from |
| T12374 |
57717-57718 |
NNP |
denotes |
R |
| T12375 |
57718-57719 |
CC |
denotes |
& |
| T12376 |
57719-57720 |
NNP |
denotes |
D |
| T12377 |
57721-57722 |
-LRB- |
denotes |
( |
| T12378 |
57722-57733 |
NNP |
denotes |
Minneapolis |
| T12379 |
57733-57735 |
, |
denotes |
, |
| T12380 |
57735-57744 |
NNP |
denotes |
Minnesota |
| T12381 |
57744-57746 |
, |
denotes |
, |
| T12382 |
57746-57752 |
NNP |
denotes |
United |
| T12383 |
57753-57759 |
NNP |
denotes |
States |
| T12384 |
57759-57760 |
-RRB- |
denotes |
) |
| T12385 |
57760-57761 |
. |
denotes |
. |
| T12386 |
57761-57856 |
sentence |
denotes |
Heat inactivated TGF-β2 was generated by heating the recombinant protein at 100 °C for 10 min. |
| T12387 |
57762-57766 |
NN |
denotes |
Heat |
| T12388 |
57767-57778 |
VBN |
denotes |
inactivated |
| T12390 |
57779-57782 |
NN |
denotes |
TGF |
| T12391 |
57782-57783 |
HYPH |
denotes |
- |
| T12389 |
57783-57785 |
NN |
denotes |
β2 |
| T12393 |
57786-57789 |
VBD |
denotes |
was |
| T12392 |
57790-57799 |
VBN |
denotes |
generated |
| T12394 |
57800-57802 |
IN |
denotes |
by |
| T12395 |
57803-57810 |
VBG |
denotes |
heating |
| T12396 |
57811-57814 |
DT |
denotes |
the |
| T12398 |
57815-57826 |
JJ |
denotes |
recombinant |
| T12397 |
57827-57834 |
NN |
denotes |
protein |
| T12399 |
57835-57837 |
IN |
denotes |
at |
| T12400 |
57838-57841 |
CD |
denotes |
100 |
| T12401 |
57842-57844 |
NN |
denotes |
°C |
| T12402 |
57845-57848 |
IN |
denotes |
for |
| T12403 |
57849-57851 |
CD |
denotes |
10 |
| T12404 |
57852-57855 |
NN |
denotes |
min |
| T12405 |
57855-57856 |
. |
denotes |
. |
| T12464 |
57858-57862 |
NNS |
denotes |
Mice |
| T12465 |
57862-58065 |
sentence |
denotes |
The K14-Snail Tg mouse was generated by digesting the pcDNA3-mm Snail-HA plasmid (G. de Herreros, Universitat Pompeu, Fabra, Barcelona, Spain) with BamHI and NotI and subcloned into the K14 vector [49]. |
| T12466 |
57863-57866 |
DT |
denotes |
The |
| T12468 |
57867-57870 |
NN |
denotes |
K14 |
| T12470 |
57870-57871 |
HYPH |
denotes |
- |
| T12469 |
57871-57876 |
NN |
denotes |
Snail |
| T12471 |
57877-57879 |
NN |
denotes |
Tg |
| T12467 |
57880-57885 |
NN |
denotes |
mouse |
| T12473 |
57886-57889 |
VBD |
denotes |
was |
| T12472 |
57890-57899 |
VBN |
denotes |
generated |
| T12474 |
57900-57902 |
IN |
denotes |
by |
| T12475 |
57903-57912 |
VBG |
denotes |
digesting |
| T12476 |
57913-57916 |
DT |
denotes |
the |
| T12478 |
57917-57923 |
NN |
denotes |
pcDNA3 |
| T12480 |
57923-57924 |
HYPH |
denotes |
- |
| T12479 |
57924-57926 |
NN |
denotes |
mm |
| T12481 |
57927-57932 |
NN |
denotes |
Snail |
| T12483 |
57932-57933 |
HYPH |
denotes |
- |
| T12482 |
57933-57935 |
NN |
denotes |
HA |
| T12477 |
57936-57943 |
NN |
denotes |
plasmid |
| T12484 |
57944-57945 |
-LRB- |
denotes |
( |
| T12486 |
57945-57947 |
NNP |
denotes |
G. |
| T12487 |
57948-57950 |
NNP |
denotes |
de |
| T12485 |
57951-57959 |
NNP |
denotes |
Herreros |
| T12488 |
57959-57961 |
, |
denotes |
, |
| T12489 |
57961-57972 |
NNP |
denotes |
Universitat |
| T12490 |
57973-57979 |
NNP |
denotes |
Pompeu |
| T12491 |
57979-57981 |
, |
denotes |
, |
| T12492 |
57981-57986 |
NNP |
denotes |
Fabra |
| T12493 |
57986-57988 |
, |
denotes |
, |
| T12494 |
57988-57997 |
NNP |
denotes |
Barcelona |
| T12495 |
57997-57999 |
, |
denotes |
, |
| T12496 |
57999-58004 |
NNP |
denotes |
Spain |
| T12497 |
58004-58005 |
-RRB- |
denotes |
) |
| T12498 |
58006-58010 |
IN |
denotes |
with |
| T12499 |
58011-58016 |
NN |
denotes |
BamHI |
| T12500 |
58017-58020 |
CC |
denotes |
and |
| T12501 |
58021-58025 |
NN |
denotes |
NotI |
| T12502 |
58026-58029 |
CC |
denotes |
and |
| T12503 |
58030-58039 |
VBN |
denotes |
subcloned |
| T12504 |
58040-58044 |
IN |
denotes |
into |
| T12505 |
58045-58048 |
DT |
denotes |
the |
| T12507 |
58049-58052 |
NN |
denotes |
K14 |
| T12506 |
58053-58059 |
NN |
denotes |
vector |
| T12508 |
58060-58061 |
-LRB- |
denotes |
[ |
| T12509 |
58061-58063 |
CD |
denotes |
49 |
| T12510 |
58063-58064 |
-RRB- |
denotes |
] |
| T12511 |
58064-58065 |
. |
denotes |
. |
| T12512 |
58065-58146 |
sentence |
denotes |
The linearized construct was injected into the nucleus of embryos from CD1 mice. |
| T12513 |
58066-58069 |
DT |
denotes |
The |
| T12515 |
58070-58080 |
VBN |
denotes |
linearized |
| T12514 |
58081-58090 |
NN |
denotes |
construct |
| T12517 |
58091-58094 |
VBD |
denotes |
was |
| T12516 |
58095-58103 |
VBN |
denotes |
injected |
| T12518 |
58104-58108 |
IN |
denotes |
into |
| T12519 |
58109-58112 |
DT |
denotes |
the |
| T12520 |
58113-58120 |
NN |
denotes |
nucleus |
| T12521 |
58121-58123 |
IN |
denotes |
of |
| T12522 |
58124-58131 |
NNS |
denotes |
embryos |
| T12523 |
58132-58136 |
IN |
denotes |
from |
| T12524 |
58137-58140 |
NN |
denotes |
CD1 |
| T12525 |
58141-58145 |
NNS |
denotes |
mice |
| T12526 |
58145-58146 |
. |
denotes |
. |
| T12527 |
58146-58204 |
sentence |
denotes |
The K14-Smad 2 Tg mouse was reported in Ito et al., 2001. |
| T12528 |
58147-58150 |
DT |
denotes |
The |
| T12530 |
58151-58154 |
NN |
denotes |
K14 |
| T12532 |
58154-58155 |
HYPH |
denotes |
- |
| T12531 |
58155-58159 |
NN |
denotes |
Smad |
| T12533 |
58160-58161 |
CD |
denotes |
2 |
| T12534 |
58162-58164 |
NN |
denotes |
Tg |
| T12529 |
58165-58170 |
NN |
denotes |
mouse |
| T12536 |
58171-58174 |
VBD |
denotes |
was |
| T12535 |
58175-58183 |
VBN |
denotes |
reported |
| T12537 |
58184-58186 |
IN |
denotes |
in |
| T12538 |
58187-58190 |
NNP |
denotes |
Ito |
| T12539 |
58191-58193 |
FW |
denotes |
et |
| T12540 |
58194-58197 |
FW |
denotes |
al. |
| T12541 |
58197-58199 |
, |
denotes |
, |
| T12542 |
58199-58203 |
CD |
denotes |
2001 |
| T12543 |
58203-58204 |
. |
denotes |
. |
| T12544 |
58204-58258 |
sentence |
denotes |
The TGF-β2 knockout (KO) mouse was described in [34]. |
| T12545 |
58205-58208 |
DT |
denotes |
The |
| T12547 |
58209-58212 |
NN |
denotes |
TGF |
| T12549 |
58212-58213 |
HYPH |
denotes |
- |
| T12548 |
58213-58215 |
NN |
denotes |
β2 |
| T12550 |
58216-58224 |
NN |
denotes |
knockout |
| T12551 |
58225-58226 |
-LRB- |
denotes |
( |
| T12552 |
58226-58228 |
NN |
denotes |
KO |
| T12553 |
58228-58229 |
-RRB- |
denotes |
) |
| T12546 |
58230-58235 |
NN |
denotes |
mouse |
| T12555 |
58236-58239 |
VBD |
denotes |
was |
| T12554 |
58240-58249 |
VBN |
denotes |
described |
| T12556 |
58250-58252 |
IN |
denotes |
in |
| T12557 |
58253-58254 |
-LRB- |
denotes |
[ |
| T12558 |
58254-58256 |
NN |
denotes |
34 |
| T12559 |
58256-58257 |
-RRB- |
denotes |
] |
| T12560 |
58257-58258 |
. |
denotes |
. |
| T12561 |
58258-58333 |
sentence |
denotes |
The shh KO mouse [38] and TOPGal mouse [20] have previously been reported. |
| T12562 |
58259-58262 |
DT |
denotes |
The |
| T12564 |
58263-58266 |
NN |
denotes |
shh |
| T12565 |
58267-58269 |
NN |
denotes |
KO |
| T12563 |
58270-58275 |
NN |
denotes |
mouse |
| T12567 |
58276-58277 |
-LRB- |
denotes |
[ |
| T12568 |
58277-58279 |
CD |
denotes |
38 |
| T12569 |
58279-58280 |
-RRB- |
denotes |
] |
| T12570 |
58281-58284 |
CC |
denotes |
and |
| T12571 |
58285-58291 |
NN |
denotes |
TOPGal |
| T12572 |
58292-58297 |
NN |
denotes |
mouse |
| T12573 |
58298-58299 |
-LRB- |
denotes |
[ |
| T12574 |
58299-58301 |
CD |
denotes |
20 |
| T12575 |
58301-58302 |
-RRB- |
denotes |
] |
| T12576 |
58303-58307 |
VBP |
denotes |
have |
| T12577 |
58308-58318 |
RB |
denotes |
previously |
| T12578 |
58319-58323 |
VBN |
denotes |
been |
| T12566 |
58324-58332 |
VBN |
denotes |
reported |
| T12579 |
58332-58333 |
. |
denotes |
. |
| T12687 |
58335-58342 |
NNP |
denotes |
Western |
| T12688 |
58343-58347 |
NN |
denotes |
blot |
| T12689 |
58348-58351 |
CC |
denotes |
and |
| T12690 |
58352-58371 |
NN |
denotes |
immunoprecipitation |
| T12691 |
58371-58677 |
sentence |
denotes |
Protein extracts from primary keratinocytes were generated either by lysing cells in lysis buffer (1% NP-40, 1% sodium deoxycholate, 20 mM Tris-Cl [pH 7.4], 140 mM NaCl containing 1 mM sodium vanadate, 2 mM phenylmethylsulfonyl fluoride, and protease inhibitors) or directly in Laemmli bβuffer and boiled. |
| T12692 |
58372-58379 |
NN |
denotes |
Protein |
| T12693 |
58380-58388 |
NNS |
denotes |
extracts |
| T12695 |
58389-58393 |
IN |
denotes |
from |
| T12696 |
58394-58401 |
JJ |
denotes |
primary |
| T12697 |
58402-58415 |
NNS |
denotes |
keratinocytes |
| T12698 |
58416-58420 |
VBD |
denotes |
were |
| T12694 |
58421-58430 |
VBN |
denotes |
generated |
| T12699 |
58431-58437 |
CC |
denotes |
either |
| T12700 |
58438-58440 |
IN |
denotes |
by |
| T12701 |
58441-58447 |
VBG |
denotes |
lysing |
| T12702 |
58448-58453 |
NNS |
denotes |
cells |
| T12703 |
58454-58456 |
IN |
denotes |
in |
| T12704 |
58457-58462 |
NN |
denotes |
lysis |
| T12705 |
58463-58469 |
NN |
denotes |
buffer |
| T12706 |
58470-58471 |
-LRB- |
denotes |
( |
| T12708 |
58471-58472 |
CD |
denotes |
1 |
| T12709 |
58472-58473 |
NN |
denotes |
% |
| T12707 |
58474-58476 |
NN |
denotes |
NP |
| T12710 |
58476-58477 |
HYPH |
denotes |
- |
| T12711 |
58477-58479 |
CD |
denotes |
40 |
| T12712 |
58479-58481 |
, |
denotes |
, |
| T12713 |
58481-58482 |
CD |
denotes |
1 |
| T12714 |
58482-58483 |
NN |
denotes |
% |
| T12716 |
58484-58490 |
NN |
denotes |
sodium |
| T12715 |
58491-58503 |
NN |
denotes |
deoxycholate |
| T12717 |
58503-58505 |
, |
denotes |
, |
| T12718 |
58505-58507 |
CD |
denotes |
20 |
| T12719 |
58508-58510 |
NN |
denotes |
mM |
| T12721 |
58511-58515 |
NN |
denotes |
Tris |
| T12722 |
58515-58516 |
HYPH |
denotes |
- |
| T12720 |
58516-58518 |
NN |
denotes |
Cl |
| T12723 |
58519-58520 |
-LRB- |
denotes |
[ |
| T12724 |
58520-58522 |
NN |
denotes |
pH |
| T12725 |
58523-58526 |
CD |
denotes |
7.4 |
| T12726 |
58526-58527 |
-RRB- |
denotes |
] |
| T12727 |
58527-58529 |
, |
denotes |
, |
| T12728 |
58529-58532 |
CD |
denotes |
140 |
| T12729 |
58533-58535 |
NN |
denotes |
mM |
| T12730 |
58536-58540 |
NN |
denotes |
NaCl |
| T12731 |
58541-58551 |
VBG |
denotes |
containing |
| T12732 |
58552-58553 |
CD |
denotes |
1 |
| T12733 |
58554-58556 |
NN |
denotes |
mM |
| T12735 |
58557-58563 |
NN |
denotes |
sodium |
| T12734 |
58564-58572 |
NN |
denotes |
vanadate |
| T12736 |
58572-58574 |
, |
denotes |
, |
| T12737 |
58574-58575 |
CD |
denotes |
2 |
| T12738 |
58576-58578 |
NN |
denotes |
mM |
| T12740 |
58579-58599 |
NN |
denotes |
phenylmethylsulfonyl |
| T12739 |
58600-58608 |
NN |
denotes |
fluoride |
| T12741 |
58608-58610 |
, |
denotes |
, |
| T12742 |
58610-58613 |
CC |
denotes |
and |
| T12743 |
58614-58622 |
NN |
denotes |
protease |
| T12744 |
58623-58633 |
NNS |
denotes |
inhibitors |
| T12745 |
58633-58634 |
-RRB- |
denotes |
) |
| T12746 |
58635-58637 |
CC |
denotes |
or |
| T12747 |
58638-58646 |
RB |
denotes |
directly |
| T12748 |
58647-58649 |
IN |
denotes |
in |
| T12749 |
58650-58657 |
NNP |
denotes |
Laemmli |
| T12750 |
58658-58665 |
NN |
denotes |
bβuffer |
| T12751 |
58666-58669 |
CC |
denotes |
and |
| T12752 |
58670-58676 |
VBN |
denotes |
boiled |
| T12753 |
58676-58677 |
. |
denotes |
. |
| T12754 |
58677-58826 |
sentence |
denotes |
For skin tissue: Frozen tissue was pulverized in a liquid nitrogen-cooled Gevebesmascher and the powder scraped into a chilled microcentrifuge tube. |
| T12755 |
58678-58681 |
IN |
denotes |
For |
| T12757 |
58682-58686 |
NN |
denotes |
skin |
| T12758 |
58687-58693 |
NN |
denotes |
tissue |
| T12759 |
58693-58695 |
: |
denotes |
: |
| T12760 |
58695-58701 |
JJ |
denotes |
Frozen |
| T12761 |
58702-58708 |
NN |
denotes |
tissue |
| T12762 |
58709-58712 |
VBD |
denotes |
was |
| T12756 |
58713-58723 |
VBN |
denotes |
pulverized |
| T12763 |
58724-58726 |
IN |
denotes |
in |
| T12764 |
58727-58728 |
DT |
denotes |
a |
| T12766 |
58729-58735 |
JJ |
denotes |
liquid |
| T12767 |
58736-58744 |
NN |
denotes |
nitrogen |
| T12769 |
58744-58745 |
HYPH |
denotes |
- |
| T12768 |
58745-58751 |
VBN |
denotes |
cooled |
| T12765 |
58752-58766 |
NN |
denotes |
Gevebesmascher |
| T12770 |
58767-58770 |
CC |
denotes |
and |
| T12771 |
58771-58774 |
DT |
denotes |
the |
| T12772 |
58775-58781 |
NN |
denotes |
powder |
| T12773 |
58782-58789 |
VBN |
denotes |
scraped |
| T12774 |
58790-58794 |
IN |
denotes |
into |
| T12775 |
58795-58796 |
DT |
denotes |
a |
| T12777 |
58797-58804 |
JJ |
denotes |
chilled |
| T12778 |
58805-58820 |
NN |
denotes |
microcentrifuge |
| T12776 |
58821-58825 |
NN |
denotes |
tube |
| T12779 |
58825-58826 |
. |
denotes |
. |
| T12780 |
58826-58983 |
sentence |
denotes |
RIPA buffer (1% Triton X-100 in PBS with 10 mM EDTA, 150 mN NaCl, 1% sodium deoxycholate, and 0.1% SDS) and protease inhibitors or Laemmli buffer was added. |
| T12781 |
58827-58831 |
NN |
denotes |
RIPA |
| T12782 |
58832-58838 |
NN |
denotes |
buffer |
| T12784 |
58839-58840 |
-LRB- |
denotes |
( |
| T12786 |
58840-58841 |
CD |
denotes |
1 |
| T12787 |
58841-58842 |
NN |
denotes |
% |
| T12788 |
58843-58849 |
NN |
denotes |
Triton |
| T12785 |
58850-58851 |
NN |
denotes |
X |
| T12789 |
58851-58852 |
HYPH |
denotes |
- |
| T12790 |
58852-58855 |
CD |
denotes |
100 |
| T12791 |
58856-58858 |
IN |
denotes |
in |
| T12792 |
58859-58862 |
NN |
denotes |
PBS |
| T12793 |
58863-58867 |
IN |
denotes |
with |
| T12794 |
58868-58870 |
CD |
denotes |
10 |
| T12795 |
58871-58873 |
NN |
denotes |
mM |
| T12796 |
58874-58878 |
NN |
denotes |
EDTA |
| T12797 |
58878-58880 |
, |
denotes |
, |
| T12798 |
58880-58883 |
CD |
denotes |
150 |
| T12799 |
58884-58886 |
NN |
denotes |
mN |
| T12800 |
58887-58891 |
NN |
denotes |
NaCl |
| T12801 |
58891-58893 |
, |
denotes |
, |
| T12802 |
58893-58894 |
CD |
denotes |
1 |
| T12803 |
58894-58895 |
NN |
denotes |
% |
| T12805 |
58896-58902 |
NN |
denotes |
sodium |
| T12804 |
58903-58915 |
NN |
denotes |
deoxycholate |
| T12806 |
58915-58917 |
, |
denotes |
, |
| T12807 |
58917-58920 |
CC |
denotes |
and |
| T12808 |
58921-58924 |
CD |
denotes |
0.1 |
| T12809 |
58924-58925 |
NN |
denotes |
% |
| T12810 |
58926-58929 |
NN |
denotes |
SDS |
| T12811 |
58929-58930 |
-RRB- |
denotes |
) |
| T12812 |
58931-58934 |
CC |
denotes |
and |
| T12813 |
58935-58943 |
NN |
denotes |
protease |
| T12814 |
58944-58954 |
NNS |
denotes |
inhibitors |
| T12815 |
58955-58957 |
CC |
denotes |
or |
| T12816 |
58958-58965 |
NNP |
denotes |
Laemmli |
| T12817 |
58966-58972 |
NN |
denotes |
buffer |
| T12818 |
58973-58976 |
VBD |
denotes |
was |
| T12783 |
58977-58982 |
VBN |
denotes |
added |
| T12819 |
58982-58983 |
. |
denotes |
. |
| T12820 |
58983-59077 |
sentence |
denotes |
The cell suspension was sonicated three times for 15 s and centrifuged at 14,000 rpm at 4 °C. |
| T12821 |
58984-58987 |
DT |
denotes |
The |
| T12823 |
58988-58992 |
NN |
denotes |
cell |
| T12822 |
58993-59003 |
NN |
denotes |
suspension |
| T12825 |
59004-59007 |
VBD |
denotes |
was |
| T12824 |
59008-59017 |
VBN |
denotes |
sonicated |
| T12826 |
59018-59023 |
CD |
denotes |
three |
| T12827 |
59024-59029 |
NNS |
denotes |
times |
| T12828 |
59030-59033 |
IN |
denotes |
for |
| T12829 |
59034-59036 |
CD |
denotes |
15 |
| T12830 |
59037-59038 |
NN |
denotes |
s |
| T12831 |
59039-59042 |
CC |
denotes |
and |
| T12832 |
59043-59054 |
VBN |
denotes |
centrifuged |
| T12833 |
59055-59057 |
IN |
denotes |
at |
| T12834 |
59058-59064 |
CD |
denotes |
14,000 |
| T12835 |
59065-59068 |
NN |
denotes |
rpm |
| T12836 |
59069-59071 |
IN |
denotes |
at |
| T12837 |
59072-59073 |
CD |
denotes |
4 |
| T12838 |
59074-59076 |
NN |
denotes |
°C |
| T12839 |
59076-59077 |
. |
denotes |
. |
| T12840 |
59077-59152 |
sentence |
denotes |
The supernatant was separated from the pellet and used in the experiments. |
| T12841 |
59078-59081 |
DT |
denotes |
The |
| T12842 |
59082-59093 |
NN |
denotes |
supernatant |
| T12844 |
59094-59097 |
VBD |
denotes |
was |
| T12843 |
59098-59107 |
VBN |
denotes |
separated |
| T12845 |
59108-59112 |
IN |
denotes |
from |
| T12846 |
59113-59116 |
DT |
denotes |
the |
| T12847 |
59117-59123 |
NN |
denotes |
pellet |
| T12848 |
59124-59127 |
CC |
denotes |
and |
| T12849 |
59128-59132 |
VBN |
denotes |
used |
| T12850 |
59133-59135 |
IN |
denotes |
in |
| T12851 |
59136-59139 |
DT |
denotes |
the |
| T12852 |
59140-59151 |
NNS |
denotes |
experiments |
| T12853 |
59151-59152 |
. |
denotes |
. |
| T12854 |
59152-59343 |
sentence |
denotes |
Extracts subjected to immunoprecipitation were precleared with Protein G Sepharose (Amersham, Piscataway, New York, United States) and incubated with antibody with rocking overnight at 4 °C. |
| T12855 |
59153-59161 |
NNS |
denotes |
Extracts |
| T12857 |
59162-59171 |
VBN |
denotes |
subjected |
| T12858 |
59172-59174 |
IN |
denotes |
to |
| T12859 |
59175-59194 |
NN |
denotes |
immunoprecipitation |
| T12860 |
59195-59199 |
VBD |
denotes |
were |
| T12856 |
59200-59210 |
VBN |
denotes |
precleared |
| T12861 |
59211-59215 |
IN |
denotes |
with |
| T12862 |
59216-59223 |
NN |
denotes |
Protein |
| T12863 |
59224-59225 |
NN |
denotes |
G |
| T12864 |
59226-59235 |
NN |
denotes |
Sepharose |
| T12865 |
59236-59237 |
-LRB- |
denotes |
( |
| T12866 |
59237-59245 |
NNP |
denotes |
Amersham |
| T12867 |
59245-59247 |
, |
denotes |
, |
| T12868 |
59247-59257 |
NNP |
denotes |
Piscataway |
| T12869 |
59257-59259 |
, |
denotes |
, |
| T12870 |
59259-59262 |
NNP |
denotes |
New |
| T12871 |
59263-59267 |
NNP |
denotes |
York |
| T12872 |
59267-59269 |
, |
denotes |
, |
| T12873 |
59269-59275 |
NNP |
denotes |
United |
| T12874 |
59276-59282 |
NNP |
denotes |
States |
| T12875 |
59282-59283 |
-RRB- |
denotes |
) |
| T12876 |
59284-59287 |
CC |
denotes |
and |
| T12877 |
59288-59297 |
VBN |
denotes |
incubated |
| T12878 |
59298-59302 |
IN |
denotes |
with |
| T12879 |
59303-59311 |
NN |
denotes |
antibody |
| T12880 |
59312-59316 |
IN |
denotes |
with |
| T12881 |
59317-59324 |
NN |
denotes |
rocking |
| T12882 |
59325-59334 |
RB |
denotes |
overnight |
| T12883 |
59335-59337 |
IN |
denotes |
at |
| T12884 |
59338-59339 |
CD |
denotes |
4 |
| T12885 |
59340-59342 |
NN |
denotes |
°C |
| T12886 |
59342-59343 |
. |
denotes |
. |
| T12887 |
59343-59430 |
sentence |
denotes |
Protein G Sepharose was added and samples were incubated for 1 h at 4 °C with rocking. |
| T12888 |
59344-59351 |
NN |
denotes |
Protein |
| T12889 |
59352-59353 |
NN |
denotes |
G |
| T12890 |
59354-59363 |
NN |
denotes |
Sepharose |
| T12892 |
59364-59367 |
VBD |
denotes |
was |
| T12891 |
59368-59373 |
VBN |
denotes |
added |
| T12893 |
59374-59377 |
CC |
denotes |
and |
| T12894 |
59378-59385 |
NNS |
denotes |
samples |
| T12896 |
59386-59390 |
VBD |
denotes |
were |
| T12895 |
59391-59400 |
VBN |
denotes |
incubated |
| T12897 |
59401-59404 |
IN |
denotes |
for |
| T12898 |
59405-59406 |
CD |
denotes |
1 |
| T12899 |
59407-59408 |
NN |
denotes |
h |
| T12900 |
59409-59411 |
IN |
denotes |
at |
| T12901 |
59412-59413 |
CD |
denotes |
4 |
| T12902 |
59414-59416 |
NN |
denotes |
°C |
| T12903 |
59417-59421 |
IN |
denotes |
with |
| T12904 |
59422-59429 |
NN |
denotes |
rocking |
| T12905 |
59429-59430 |
. |
denotes |
. |
| T12906 |
59430-59603 |
sentence |
denotes |
Samples were washed three times for 5 min each in lysis buffer, and the Protein G Sepharose-antibody-antigen pellet was resuspended in Laemmli buffer and boiled for 10 min. |
| T12907 |
59431-59438 |
NNS |
denotes |
Samples |
| T12909 |
59439-59443 |
VBD |
denotes |
were |
| T12908 |
59444-59450 |
VBN |
denotes |
washed |
| T12910 |
59451-59456 |
CD |
denotes |
three |
| T12911 |
59457-59462 |
NNS |
denotes |
times |
| T12912 |
59463-59466 |
IN |
denotes |
for |
| T12913 |
59467-59468 |
CD |
denotes |
5 |
| T12914 |
59469-59472 |
NN |
denotes |
min |
| T12915 |
59473-59477 |
RB |
denotes |
each |
| T12916 |
59478-59480 |
IN |
denotes |
in |
| T12917 |
59481-59486 |
NN |
denotes |
lysis |
| T12918 |
59487-59493 |
NN |
denotes |
buffer |
| T12919 |
59493-59495 |
, |
denotes |
, |
| T12920 |
59495-59498 |
CC |
denotes |
and |
| T12921 |
59499-59502 |
DT |
denotes |
the |
| T12923 |
59503-59510 |
NN |
denotes |
Protein |
| T12924 |
59511-59512 |
NN |
denotes |
G |
| T12926 |
59513-59522 |
NN |
denotes |
Sepharose |
| T12927 |
59522-59523 |
HYPH |
denotes |
- |
| T12928 |
59523-59531 |
NN |
denotes |
antibody |
| T12929 |
59531-59532 |
HYPH |
denotes |
- |
| T12925 |
59532-59539 |
NN |
denotes |
antigen |
| T12922 |
59540-59546 |
NN |
denotes |
pellet |
| T12931 |
59547-59550 |
VBD |
denotes |
was |
| T12930 |
59551-59562 |
VBN |
denotes |
resuspended |
| T12932 |
59563-59565 |
IN |
denotes |
in |
| T12933 |
59566-59573 |
NNP |
denotes |
Laemmli |
| T12934 |
59574-59580 |
NN |
denotes |
buffer |
| T12935 |
59581-59584 |
CC |
denotes |
and |
| T12936 |
59585-59591 |
VBN |
denotes |
boiled |
| T12937 |
59592-59595 |
IN |
denotes |
for |
| T12938 |
59596-59598 |
CD |
denotes |
10 |
| T12939 |
59599-59602 |
NN |
denotes |
min |
| T12940 |
59602-59603 |
. |
denotes |
. |
| T12941 |
59603-59749 |
sentence |
denotes |
Samples were run on SDS-PAGE and transferred to nitrocellulose membrane (Schleicher and Schuell Bioscience, Keene, New Hampshire, United States). |
| T12942 |
59604-59611 |
NNS |
denotes |
Samples |
| T12944 |
59612-59616 |
VBD |
denotes |
were |
| T12943 |
59617-59620 |
VBN |
denotes |
run |
| T12945 |
59621-59623 |
IN |
denotes |
on |
| T12946 |
59624-59627 |
NN |
denotes |
SDS |
| T12948 |
59627-59628 |
HYPH |
denotes |
- |
| T12947 |
59628-59632 |
NN |
denotes |
PAGE |
| T12949 |
59633-59636 |
CC |
denotes |
and |
| T12950 |
59637-59648 |
VBN |
denotes |
transferred |
| T12951 |
59649-59651 |
IN |
denotes |
to |
| T12952 |
59652-59666 |
NN |
denotes |
nitrocellulose |
| T12953 |
59667-59675 |
NN |
denotes |
membrane |
| T12954 |
59676-59677 |
-LRB- |
denotes |
( |
| T12956 |
59677-59687 |
NNP |
denotes |
Schleicher |
| T12957 |
59688-59691 |
CC |
denotes |
and |
| T12958 |
59692-59699 |
NNP |
denotes |
Schuell |
| T12955 |
59700-59710 |
NNP |
denotes |
Bioscience |
| T12959 |
59710-59712 |
, |
denotes |
, |
| T12960 |
59712-59717 |
NNP |
denotes |
Keene |
| T12961 |
59717-59719 |
, |
denotes |
, |
| T12962 |
59719-59722 |
NNP |
denotes |
New |
| T12963 |
59723-59732 |
NNP |
denotes |
Hampshire |
| T12964 |
59732-59734 |
, |
denotes |
, |
| T12965 |
59734-59740 |
NNP |
denotes |
United |
| T12966 |
59741-59747 |
NNP |
denotes |
States |
| T12967 |
59747-59748 |
-RRB- |
denotes |
) |
| T12968 |
59748-59749 |
. |
denotes |
. |
| T12969 |
59749-59840 |
sentence |
denotes |
Western blot signals were developed using the enhanced chemiluminescence kit from Amersham |
| T12970 |
59750-59757 |
NNP |
denotes |
Western |
| T12971 |
59758-59762 |
NN |
denotes |
blot |
| T12972 |
59763-59770 |
NNS |
denotes |
signals |
| T12974 |
59771-59775 |
VBD |
denotes |
were |
| T12973 |
59776-59785 |
VBN |
denotes |
developed |
| T12975 |
59786-59791 |
VBG |
denotes |
using |
| T12976 |
59792-59795 |
DT |
denotes |
the |
| T12978 |
59796-59804 |
VBN |
denotes |
enhanced |
| T12979 |
59805-59822 |
NN |
denotes |
chemiluminescence |
| T12977 |
59823-59826 |
NN |
denotes |
kit |
| T12980 |
59827-59831 |
IN |
denotes |
from |
| T12981 |
59832-59840 |
NNP |
denotes |
Amersham |
| T13041 |
59842-59846 |
NN |
denotes |
Cell |
| T13042 |
59847-59854 |
NN |
denotes |
culture |
| T13043 |
59854-59940 |
sentence |
denotes |
Primary keratinocytes were culture in low-calcium medium as previously described [4]. |
| T13044 |
59855-59862 |
JJ |
denotes |
Primary |
| T13045 |
59863-59876 |
NNS |
denotes |
keratinocytes |
| T13047 |
59877-59881 |
VBD |
denotes |
were |
| T13046 |
59882-59889 |
VBN |
denotes |
culture |
| T13048 |
59890-59892 |
IN |
denotes |
in |
| T13049 |
59893-59896 |
JJ |
denotes |
low |
| T13051 |
59896-59897 |
HYPH |
denotes |
- |
| T13050 |
59897-59904 |
NN |
denotes |
calcium |
| T13052 |
59905-59911 |
NN |
denotes |
medium |
| T13053 |
59912-59914 |
IN |
denotes |
as |
| T13055 |
59915-59925 |
RB |
denotes |
previously |
| T13054 |
59926-59935 |
VBN |
denotes |
described |
| T13056 |
59936-59937 |
-LRB- |
denotes |
[ |
| T13057 |
59937-59938 |
CD |
denotes |
4 |
| T13058 |
59938-59939 |
-RRB- |
denotes |
] |
| T13059 |
59939-59940 |
. |
denotes |
. |
| T13060 |
59940-60090 |
sentence |
denotes |
Transient transfections were carried out with FuGENE6 reagent (Roche, Indianapolis, Indiana, United States) according to the manufacturer's protocol. |
| T13061 |
59941-59950 |
JJ |
denotes |
Transient |
| T13062 |
59951-59964 |
NNS |
denotes |
transfections |
| T13064 |
59965-59969 |
VBD |
denotes |
were |
| T13063 |
59970-59977 |
VBN |
denotes |
carried |
| T13065 |
59978-59981 |
RP |
denotes |
out |
| T13066 |
59982-59986 |
IN |
denotes |
with |
| T13067 |
59987-59994 |
NN |
denotes |
FuGENE6 |
| T13068 |
59995-60002 |
NN |
denotes |
reagent |
| T13069 |
60003-60004 |
-LRB- |
denotes |
( |
| T13070 |
60004-60009 |
NNP |
denotes |
Roche |
| T13071 |
60009-60011 |
, |
denotes |
, |
| T13072 |
60011-60023 |
NNP |
denotes |
Indianapolis |
| T13073 |
60023-60025 |
, |
denotes |
, |
| T13074 |
60025-60032 |
NNP |
denotes |
Indiana |
| T13075 |
60032-60034 |
, |
denotes |
, |
| T13076 |
60034-60040 |
NNP |
denotes |
United |
| T13077 |
60041-60047 |
NNP |
denotes |
States |
| T13078 |
60047-60048 |
-RRB- |
denotes |
) |
| T13079 |
60049-60058 |
VBG |
denotes |
according |
| T13080 |
60059-60061 |
IN |
denotes |
to |
| T13081 |
60062-60065 |
DT |
denotes |
the |
| T13082 |
60066-60078 |
NN |
denotes |
manufacturer |
| T13084 |
60078-60080 |
POS |
denotes |
's |
| T13083 |
60081-60089 |
NN |
denotes |
protocol |
| T13085 |
60089-60090 |
. |
denotes |
. |
| T13086 |
60090-60352 |
sentence |
denotes |
Measurement of β-galactosidase or luciferase levels in promoter activity studies were carried out with the Galacto-Lite assay kit (TROPIX, Bedford, Massachusetts, United States) and the Dual luciferase (Promega, Madison, Wisconsin, United States), respectively. |
| T13087 |
60091-60102 |
NN |
denotes |
Measurement |
| T13089 |
60103-60105 |
IN |
denotes |
of |
| T13090 |
60106-60107 |
NN |
denotes |
β |
| T13092 |
60107-60108 |
HYPH |
denotes |
- |
| T13091 |
60108-60121 |
NN |
denotes |
galactosidase |
| T13094 |
60122-60124 |
CC |
denotes |
or |
| T13095 |
60125-60135 |
NN |
denotes |
luciferase |
| T13093 |
60136-60142 |
NNS |
denotes |
levels |
| T13096 |
60143-60145 |
IN |
denotes |
in |
| T13097 |
60146-60154 |
NN |
denotes |
promoter |
| T13098 |
60155-60163 |
NN |
denotes |
activity |
| T13099 |
60164-60171 |
NNS |
denotes |
studies |
| T13100 |
60172-60176 |
VBD |
denotes |
were |
| T13088 |
60177-60184 |
VBN |
denotes |
carried |
| T13101 |
60185-60188 |
RP |
denotes |
out |
| T13102 |
60189-60193 |
IN |
denotes |
with |
| T13103 |
60194-60197 |
DT |
denotes |
the |
| T13105 |
60198-60205 |
NNP |
denotes |
Galacto |
| T13107 |
60205-60206 |
HYPH |
denotes |
- |
| T13106 |
60206-60210 |
NNP |
denotes |
Lite |
| T13108 |
60211-60216 |
NN |
denotes |
assay |
| T13104 |
60217-60220 |
NN |
denotes |
kit |
| T13109 |
60221-60222 |
-LRB- |
denotes |
( |
| T13110 |
60222-60228 |
NNP |
denotes |
TROPIX |
| T13111 |
60228-60230 |
, |
denotes |
, |
| T13112 |
60230-60237 |
NNP |
denotes |
Bedford |
| T13113 |
60237-60239 |
, |
denotes |
, |
| T13114 |
60239-60252 |
NNP |
denotes |
Massachusetts |
| T13115 |
60252-60254 |
, |
denotes |
, |
| T13116 |
60254-60260 |
NNP |
denotes |
United |
| T13117 |
60261-60267 |
NNP |
denotes |
States |
| T13118 |
60267-60268 |
-RRB- |
denotes |
) |
| T13119 |
60269-60272 |
CC |
denotes |
and |
| T13120 |
60273-60276 |
DT |
denotes |
the |
| T13122 |
60277-60281 |
JJ |
denotes |
Dual |
| T13121 |
60282-60292 |
NN |
denotes |
luciferase |
| T13123 |
60293-60294 |
-LRB- |
denotes |
( |
| T13124 |
60294-60301 |
NNP |
denotes |
Promega |
| T13125 |
60301-60303 |
, |
denotes |
, |
| T13126 |
60303-60310 |
NNP |
denotes |
Madison |
| T13127 |
60310-60312 |
, |
denotes |
, |
| T13128 |
60312-60321 |
NNP |
denotes |
Wisconsin |
| T13129 |
60321-60323 |
, |
denotes |
, |
| T13130 |
60323-60329 |
NNP |
denotes |
United |
| T13131 |
60330-60336 |
NNP |
denotes |
States |
| T13132 |
60336-60337 |
-RRB- |
denotes |
) |
| T13133 |
60337-60339 |
, |
denotes |
, |
| T13134 |
60339-60351 |
RB |
denotes |
respectively |
| T13135 |
60351-60352 |
. |
denotes |
. |
| T13136 |
60352-60440 |
sentence |
denotes |
Runella luciferase was cotransfected into cells to correct for transfection efficiency. |
| T13137 |
60353-60360 |
NN |
denotes |
Runella |
| T13138 |
60361-60371 |
NN |
denotes |
luciferase |
| T13140 |
60372-60375 |
VBD |
denotes |
was |
| T13139 |
60376-60389 |
VBN |
denotes |
cotransfected |
| T13141 |
60390-60394 |
IN |
denotes |
into |
| T13142 |
60395-60400 |
NNS |
denotes |
cells |
| T13143 |
60401-60403 |
TO |
denotes |
to |
| T13144 |
60404-60411 |
VB |
denotes |
correct |
| T13145 |
60412-60415 |
IN |
denotes |
for |
| T13146 |
60416-60428 |
NN |
denotes |
transfection |
| T13147 |
60429-60439 |
NN |
denotes |
efficiency |
| T13148 |
60439-60440 |
. |
denotes |
. |
| T13149 |
60440-60511 |
sentence |
denotes |
Experiments were done in triplicate and repeated at least three times. |
| T13150 |
60441-60452 |
NNS |
denotes |
Experiments |
| T13152 |
60453-60457 |
VBD |
denotes |
were |
| T13151 |
60458-60462 |
VBN |
denotes |
done |
| T13153 |
60463-60465 |
IN |
denotes |
in |
| T13154 |
60466-60476 |
NN |
denotes |
triplicate |
| T13155 |
60477-60480 |
CC |
denotes |
and |
| T13156 |
60481-60489 |
VBN |
denotes |
repeated |
| T13157 |
60490-60492 |
RB |
denotes |
at |
| T13159 |
60493-60498 |
RBS |
denotes |
least |
| T13158 |
60499-60504 |
CD |
denotes |
three |
| T13160 |
60505-60510 |
NNS |
denotes |
times |
| T13161 |
60510-60511 |
. |
denotes |
. |
| T13162 |
60511-60606 |
sentence |
denotes |
Measurements were done on a luminometer (MGM Instruments, Hamden, Connecticut, United States). |
| T13163 |
60512-60524 |
NNS |
denotes |
Measurements |
| T13165 |
60525-60529 |
VBD |
denotes |
were |
| T13164 |
60530-60534 |
VBN |
denotes |
done |
| T13166 |
60535-60537 |
IN |
denotes |
on |
| T13167 |
60538-60539 |
DT |
denotes |
a |
| T13168 |
60540-60551 |
NN |
denotes |
luminometer |
| T13169 |
60552-60553 |
-LRB- |
denotes |
( |
| T13171 |
60553-60556 |
NNP |
denotes |
MGM |
| T13170 |
60557-60568 |
NNP |
denotes |
Instruments |
| T13172 |
60568-60570 |
, |
denotes |
, |
| T13173 |
60570-60576 |
NNP |
denotes |
Hamden |
| T13174 |
60576-60578 |
, |
denotes |
, |
| T13175 |
60578-60589 |
NNP |
denotes |
Connecticut |
| T13176 |
60589-60591 |
, |
denotes |
, |
| T13177 |
60591-60597 |
NNP |
denotes |
United |
| T13178 |
60598-60604 |
NNP |
denotes |
States |
| T13179 |
60604-60605 |
-RRB- |
denotes |
) |
| T13180 |
60605-60606 |
. |
denotes |
. |
| T13181 |
60606-60766 |
sentence |
denotes |
For experiments measuring phosphorylation of MAPK, keratinocytes were serum starved for 3 h prior to harvesting of cells by incubation in medium lacking serum. |
| T13182 |
60607-60610 |
IN |
denotes |
For |
| T13184 |
60611-60622 |
NNS |
denotes |
experiments |
| T13185 |
60623-60632 |
VBG |
denotes |
measuring |
| T13186 |
60633-60648 |
NN |
denotes |
phosphorylation |
| T13187 |
60649-60651 |
IN |
denotes |
of |
| T13188 |
60652-60656 |
NN |
denotes |
MAPK |
| T13189 |
60656-60658 |
, |
denotes |
, |
| T13190 |
60658-60671 |
NNS |
denotes |
keratinocytes |
| T13191 |
60672-60676 |
VBD |
denotes |
were |
| T13192 |
60677-60682 |
NN |
denotes |
serum |
| T13183 |
60683-60690 |
VBN |
denotes |
starved |
| T13193 |
60691-60694 |
IN |
denotes |
for |
| T13194 |
60695-60696 |
CD |
denotes |
3 |
| T13195 |
60697-60698 |
NN |
denotes |
h |
| T13196 |
60699-60704 |
JJ |
denotes |
prior |
| T13197 |
60705-60707 |
IN |
denotes |
to |
| T13198 |
60708-60718 |
NN |
denotes |
harvesting |
| T13199 |
60719-60721 |
IN |
denotes |
of |
| T13200 |
60722-60727 |
NNS |
denotes |
cells |
| T13201 |
60728-60730 |
IN |
denotes |
by |
| T13202 |
60731-60741 |
NN |
denotes |
incubation |
| T13203 |
60742-60744 |
IN |
denotes |
in |
| T13204 |
60745-60751 |
NN |
denotes |
medium |
| T13205 |
60752-60759 |
VBG |
denotes |
lacking |
| T13206 |
60760-60765 |
NN |
denotes |
serum |
| T13207 |
60765-60766 |
. |
denotes |
. |
| T13208 |
60766-60855 |
sentence |
denotes |
Treatment of cells with Wnt- and noggin-conditioned medium was previously described [4]. |
| T13209 |
60767-60776 |
NN |
denotes |
Treatment |
| T13211 |
60777-60779 |
IN |
denotes |
of |
| T13212 |
60780-60785 |
NNS |
denotes |
cells |
| T13213 |
60786-60790 |
IN |
denotes |
with |
| T13214 |
60791-60794 |
NN |
denotes |
Wnt |
| T13216 |
60794-60795 |
HYPH |
denotes |
- |
| T13217 |
60796-60799 |
CC |
denotes |
and |
| T13218 |
60800-60806 |
NN |
denotes |
noggin |
| T13219 |
60806-60807 |
HYPH |
denotes |
- |
| T13215 |
60807-60818 |
VBN |
denotes |
conditioned |
| T13220 |
60819-60825 |
NN |
denotes |
medium |
| T13221 |
60826-60829 |
VBD |
denotes |
was |
| T13222 |
60830-60840 |
RB |
denotes |
previously |
| T13210 |
60841-60850 |
VBN |
denotes |
described |
| T13223 |
60851-60852 |
-LRB- |
denotes |
[ |
| T13224 |
60852-60853 |
CD |
denotes |
4 |
| T13225 |
60853-60854 |
-RRB- |
denotes |
] |
| T13226 |
60854-60855 |
. |
denotes |
. |
| T13308 |
60857-60867 |
NNS |
denotes |
Constructs |
| T13309 |
60867-61148 |
sentence |
denotes |
The 2.2-kb murine Snail promoter was generated by PCR using a forward primer with an XbaI linker sequence, 5′- TCTAGAATTGTTTGCTGCTGTATGGTCTTC-3′, along with a reverse primer with a BglII linker sequence, 5′- AGATCTGTTGGCCAGAGCGACCTAG- GTAG-3′, and mouse genomic DNA as a template. |
| T13310 |
60868-60871 |
DT |
denotes |
The |
| T13312 |
60872-60875 |
CD |
denotes |
2.2 |
| T13314 |
60875-60876 |
HYPH |
denotes |
- |
| T13313 |
60876-60878 |
NN |
denotes |
kb |
| T13315 |
60879-60885 |
JJ |
denotes |
murine |
| T13316 |
60886-60891 |
NN |
denotes |
Snail |
| T13311 |
60892-60900 |
NN |
denotes |
promoter |
| T13318 |
60901-60904 |
VBD |
denotes |
was |
| T13317 |
60905-60914 |
VBN |
denotes |
generated |
| T13319 |
60915-60917 |
IN |
denotes |
by |
| T13320 |
60918-60921 |
NN |
denotes |
PCR |
| T13321 |
60922-60927 |
VBG |
denotes |
using |
| T13322 |
60928-60929 |
DT |
denotes |
a |
| T13324 |
60930-60937 |
JJ |
denotes |
forward |
| T13323 |
60938-60944 |
NN |
denotes |
primer |
| T13325 |
60945-60949 |
IN |
denotes |
with |
| T13326 |
60950-60952 |
DT |
denotes |
an |
| T13328 |
60953-60957 |
NN |
denotes |
XbaI |
| T13329 |
60958-60964 |
NN |
denotes |
linker |
| T13327 |
60965-60973 |
NN |
denotes |
sequence |
| T13330 |
60973-60975 |
, |
denotes |
, |
| T13331 |
60975-60976 |
CD |
denotes |
5 |
| T13333 |
60976-60977 |
SYM |
denotes |
′ |
| T13334 |
60977-60978 |
HYPH |
denotes |
- |
| T13332 |
60979-61009 |
NN |
denotes |
TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
| T13335 |
61009-61010 |
HYPH |
denotes |
- |
| T13336 |
61010-61011 |
CD |
denotes |
3 |
| T13337 |
61011-61012 |
SYM |
denotes |
′ |
| T13338 |
61012-61014 |
, |
denotes |
, |
| T13339 |
61014-61019 |
IN |
denotes |
along |
| T13340 |
61020-61024 |
IN |
denotes |
with |
| T13341 |
61025-61026 |
DT |
denotes |
a |
| T13343 |
61027-61034 |
JJ |
denotes |
reverse |
| T13342 |
61035-61041 |
NN |
denotes |
primer |
| T13344 |
61042-61046 |
IN |
denotes |
with |
| T13345 |
61047-61048 |
DT |
denotes |
a |
| T13347 |
61049-61054 |
NN |
denotes |
BglII |
| T13348 |
61055-61061 |
NN |
denotes |
linker |
| T13346 |
61062-61070 |
NN |
denotes |
sequence |
| T13349 |
61070-61072 |
, |
denotes |
, |
| T13350 |
61072-61073 |
CD |
denotes |
5 |
| T13352 |
61073-61074 |
SYM |
denotes |
′ |
| T13353 |
61074-61075 |
HYPH |
denotes |
- |
| T13354 |
61076-61101 |
NN |
denotes |
AGATCTGTTGGCCAGAGCGACCTAG |
| T13355 |
61101-61102 |
HYPH |
denotes |
- |
| T13351 |
61103-61107 |
NN |
denotes |
GTAG |
| T13356 |
61107-61108 |
HYPH |
denotes |
- |
| T13357 |
61108-61109 |
CD |
denotes |
3 |
| T13358 |
61109-61110 |
SYM |
denotes |
′ |
| T13359 |
61110-61112 |
, |
denotes |
, |
| T13360 |
61112-61115 |
CC |
denotes |
and |
| T13361 |
61116-61121 |
NN |
denotes |
mouse |
| T13363 |
61122-61129 |
JJ |
denotes |
genomic |
| T13362 |
61130-61133 |
NN |
denotes |
DNA |
| T13364 |
61134-61136 |
IN |
denotes |
as |
| T13365 |
61137-61138 |
DT |
denotes |
a |
| T13366 |
61139-61147 |
NN |
denotes |
template |
| T13367 |
61147-61148 |
. |
denotes |
. |
| T13368 |
61148-61340 |
sentence |
denotes |
The PCR product was purified with the Gel Extraction Kit (Qiagen, Valencia, California, United States) and ligated into pCRII-TOPO TA vector (Invitrogen, Carlsbad, California, United States). |
| T13369 |
61149-61152 |
DT |
denotes |
The |
| T13371 |
61153-61156 |
NN |
denotes |
PCR |
| T13370 |
61157-61164 |
NN |
denotes |
product |
| T13373 |
61165-61168 |
VBD |
denotes |
was |
| T13372 |
61169-61177 |
VBN |
denotes |
purified |
| T13374 |
61178-61182 |
IN |
denotes |
with |
| T13375 |
61183-61186 |
DT |
denotes |
the |
| T13377 |
61187-61190 |
NN |
denotes |
Gel |
| T13378 |
61191-61201 |
NN |
denotes |
Extraction |
| T13376 |
61202-61205 |
NN |
denotes |
Kit |
| T13379 |
61206-61207 |
-LRB- |
denotes |
( |
| T13380 |
61207-61213 |
NNP |
denotes |
Qiagen |
| T13381 |
61213-61215 |
, |
denotes |
, |
| T13382 |
61215-61223 |
NNP |
denotes |
Valencia |
| T13383 |
61223-61225 |
, |
denotes |
, |
| T13384 |
61225-61235 |
NNP |
denotes |
California |
| T13385 |
61235-61237 |
, |
denotes |
, |
| T13386 |
61237-61243 |
NNP |
denotes |
United |
| T13387 |
61244-61250 |
NNP |
denotes |
States |
| T13388 |
61250-61251 |
-RRB- |
denotes |
) |
| T13389 |
61252-61255 |
CC |
denotes |
and |
| T13390 |
61256-61263 |
VBN |
denotes |
ligated |
| T13391 |
61264-61268 |
IN |
denotes |
into |
| T13392 |
61269-61274 |
NN |
denotes |
pCRII |
| T13394 |
61274-61275 |
HYPH |
denotes |
- |
| T13393 |
61275-61279 |
NN |
denotes |
TOPO |
| T13396 |
61280-61282 |
NN |
denotes |
TA |
| T13395 |
61283-61289 |
NN |
denotes |
vector |
| T13397 |
61290-61291 |
-LRB- |
denotes |
( |
| T13398 |
61291-61301 |
NNP |
denotes |
Invitrogen |
| T13399 |
61301-61303 |
, |
denotes |
, |
| T13400 |
61303-61311 |
NNP |
denotes |
Carlsbad |
| T13401 |
61311-61313 |
, |
denotes |
, |
| T13402 |
61313-61323 |
NNP |
denotes |
California |
| T13403 |
61323-61325 |
, |
denotes |
, |
| T13404 |
61325-61331 |
NNP |
denotes |
United |
| T13405 |
61332-61338 |
NNP |
denotes |
States |
| T13406 |
61338-61339 |
-RRB- |
denotes |
) |
| T13407 |
61339-61340 |
. |
denotes |
. |
| T13408 |
61340-61521 |
sentence |
denotes |
The promoter was verified by sequencing and digested with XbaI and BglII and subcloned into the pβ-gal BASIC vector (BD Biosciences Clontech, Palo Alto, California, United States). |
| T13409 |
61341-61344 |
DT |
denotes |
The |
| T13410 |
61345-61353 |
NN |
denotes |
promoter |
| T13412 |
61354-61357 |
VBD |
denotes |
was |
| T13411 |
61358-61366 |
VBN |
denotes |
verified |
| T13413 |
61367-61369 |
IN |
denotes |
by |
| T13414 |
61370-61380 |
NN |
denotes |
sequencing |
| T13415 |
61381-61384 |
CC |
denotes |
and |
| T13416 |
61385-61393 |
VBN |
denotes |
digested |
| T13417 |
61394-61398 |
IN |
denotes |
with |
| T13418 |
61399-61403 |
NN |
denotes |
XbaI |
| T13419 |
61404-61407 |
CC |
denotes |
and |
| T13420 |
61408-61413 |
NN |
denotes |
BglII |
| T13421 |
61414-61417 |
CC |
denotes |
and |
| T13422 |
61418-61427 |
VBN |
denotes |
subcloned |
| T13423 |
61428-61432 |
IN |
denotes |
into |
| T13424 |
61433-61436 |
DT |
denotes |
the |
| T13426 |
61437-61439 |
NN |
denotes |
pβ |
| T13428 |
61439-61440 |
HYPH |
denotes |
- |
| T13427 |
61440-61443 |
NN |
denotes |
gal |
| T13429 |
61444-61449 |
NN |
denotes |
BASIC |
| T13425 |
61450-61456 |
NN |
denotes |
vector |
| T13430 |
61457-61458 |
-LRB- |
denotes |
( |
| T13432 |
61458-61460 |
NNP |
denotes |
BD |
| T13433 |
61461-61472 |
NNP |
denotes |
Biosciences |
| T13431 |
61473-61481 |
NNP |
denotes |
Clontech |
| T13434 |
61481-61483 |
, |
denotes |
, |
| T13435 |
61483-61487 |
NNP |
denotes |
Palo |
| T13436 |
61488-61492 |
NNP |
denotes |
Alto |
| T13437 |
61492-61494 |
, |
denotes |
, |
| T13438 |
61494-61504 |
NNP |
denotes |
California |
| T13439 |
61504-61506 |
, |
denotes |
, |
| T13440 |
61506-61512 |
NNP |
denotes |
United |
| T13441 |
61513-61519 |
NNP |
denotes |
States |
| T13442 |
61519-61520 |
-RRB- |
denotes |
) |
| T13443 |
61520-61521 |
. |
denotes |
. |
| T13444 |
61521-61815 |
sentence |
denotes |
The point mutations in the SMAD binding element was generated with the Quik-Change Kit (Stratagene, La Jolla, California, United States) using the forward primer 5′- GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC-3′ and the reverse primer 5′- GCTTTT- CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC-3′. |
| T13445 |
61522-61525 |
DT |
denotes |
The |
| T13447 |
61526-61531 |
NN |
denotes |
point |
| T13446 |
61532-61541 |
NNS |
denotes |
mutations |
| T13449 |
61542-61544 |
IN |
denotes |
in |
| T13450 |
61545-61548 |
DT |
denotes |
the |
| T13452 |
61549-61553 |
NN |
denotes |
SMAD |
| T13453 |
61554-61561 |
NN |
denotes |
binding |
| T13451 |
61562-61569 |
NN |
denotes |
element |
| T13454 |
61570-61573 |
VBD |
denotes |
was |
| T13448 |
61574-61583 |
VBN |
denotes |
generated |
| T13455 |
61584-61588 |
IN |
denotes |
with |
| T13456 |
61589-61592 |
DT |
denotes |
the |
| T13458 |
61593-61597 |
NNP |
denotes |
Quik |
| T13460 |
61597-61598 |
HYPH |
denotes |
- |
| T13459 |
61598-61604 |
NNP |
denotes |
Change |
| T13457 |
61605-61608 |
NNP |
denotes |
Kit |
| T13461 |
61609-61610 |
-LRB- |
denotes |
( |
| T13462 |
61610-61620 |
NNP |
denotes |
Stratagene |
| T13463 |
61620-61622 |
, |
denotes |
, |
| T13464 |
61622-61624 |
NNP |
denotes |
La |
| T13465 |
61625-61630 |
NNP |
denotes |
Jolla |
| T13466 |
61630-61632 |
, |
denotes |
, |
| T13467 |
61632-61642 |
NNP |
denotes |
California |
| T13468 |
61642-61644 |
, |
denotes |
, |
| T13469 |
61644-61650 |
NNP |
denotes |
United |
| T13470 |
61651-61657 |
NNP |
denotes |
States |
| T13471 |
61657-61658 |
-RRB- |
denotes |
) |
| T13472 |
61659-61664 |
VBG |
denotes |
using |
| T13473 |
61665-61668 |
DT |
denotes |
the |
| T13475 |
61669-61676 |
JJ |
denotes |
forward |
| T13474 |
61677-61683 |
NN |
denotes |
primer |
| T13476 |
61684-61685 |
CD |
denotes |
5 |
| T13478 |
61685-61686 |
SYM |
denotes |
′ |
| T13479 |
61686-61687 |
HYPH |
denotes |
- |
| T13477 |
61688-61733 |
NN |
denotes |
GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
| T13480 |
61733-61734 |
HYPH |
denotes |
- |
| T13481 |
61734-61735 |
CD |
denotes |
3 |
| T13482 |
61735-61736 |
SYM |
denotes |
′ |
| T13483 |
61737-61740 |
CC |
denotes |
and |
| T13484 |
61741-61744 |
DT |
denotes |
the |
| T13486 |
61745-61752 |
JJ |
denotes |
reverse |
| T13485 |
61753-61759 |
NN |
denotes |
primer |
| T13487 |
61760-61761 |
CD |
denotes |
5 |
| T13489 |
61761-61762 |
SYM |
denotes |
′ |
| T13490 |
61762-61763 |
HYPH |
denotes |
- |
| T13491 |
61764-61770 |
NN |
denotes |
GCTTTT |
| T13492 |
61770-61771 |
HYPH |
denotes |
- |
| T13488 |
61772-61811 |
NN |
denotes |
CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
| T13493 |
61811-61812 |
HYPH |
denotes |
- |
| T13494 |
61812-61813 |
CD |
denotes |
3 |
| T13495 |
61813-61814 |
SYM |
denotes |
′ |
| T13496 |
61814-61815 |
. |
denotes |
. |
| T13497 |
61815-62048 |
sentence |
denotes |
The probes for the Snail in situ hybridization were generated against the 3′ UTR by PCR using the forward primer 5′- ACCTTCTCCCGCATGTCCTTGCTCC-3′ and the reverse primer 5′- CTGCTGAGGCATGGTTACAGCTGG-3′, and genomic DNA as a template. |
| T13498 |
61816-61819 |
DT |
denotes |
The |
| T13499 |
61820-61826 |
NNS |
denotes |
probes |
| T13501 |
61827-61830 |
IN |
denotes |
for |
| T13502 |
61831-61834 |
DT |
denotes |
the |
| T13504 |
61835-61840 |
NN |
denotes |
Snail |
| T13505 |
61841-61843 |
FW |
denotes |
in |
| T13506 |
61844-61848 |
FW |
denotes |
situ |
| T13503 |
61849-61862 |
NN |
denotes |
hybridization |
| T13507 |
61863-61867 |
VBD |
denotes |
were |
| T13500 |
61868-61877 |
VBN |
denotes |
generated |
| T13508 |
61878-61885 |
IN |
denotes |
against |
| T13509 |
61886-61889 |
DT |
denotes |
the |
| T13511 |
61890-61891 |
CD |
denotes |
3 |
| T13512 |
61891-61892 |
SYM |
denotes |
′ |
| T13510 |
61893-61896 |
NN |
denotes |
UTR |
| T13513 |
61897-61899 |
IN |
denotes |
by |
| T13514 |
61900-61903 |
NN |
denotes |
PCR |
| T13515 |
61904-61909 |
VBG |
denotes |
using |
| T13516 |
61910-61913 |
DT |
denotes |
the |
| T13518 |
61914-61921 |
JJ |
denotes |
forward |
| T13517 |
61922-61928 |
NN |
denotes |
primer |
| T13519 |
61929-61930 |
CD |
denotes |
5 |
| T13521 |
61930-61931 |
SYM |
denotes |
′ |
| T13522 |
61931-61932 |
HYPH |
denotes |
- |
| T13520 |
61933-61958 |
NN |
denotes |
ACCTTCTCCCGCATGTCCTTGCTCC |
| T13523 |
61958-61959 |
HYPH |
denotes |
- |
| T13524 |
61959-61960 |
CD |
denotes |
3 |
| T13525 |
61960-61961 |
SYM |
denotes |
′ |
| T13526 |
61962-61965 |
CC |
denotes |
and |
| T13527 |
61966-61969 |
DT |
denotes |
the |
| T13529 |
61970-61977 |
JJ |
denotes |
reverse |
| T13528 |
61978-61984 |
NN |
denotes |
primer |
| T13530 |
61985-61986 |
CD |
denotes |
5 |
| T13532 |
61986-61987 |
SYM |
denotes |
′ |
| T13533 |
61987-61988 |
HYPH |
denotes |
- |
| T13531 |
61989-62013 |
NN |
denotes |
CTGCTGAGGCATGGTTACAGCTGG |
| T13534 |
62013-62014 |
HYPH |
denotes |
- |
| T13535 |
62014-62015 |
CD |
denotes |
3 |
| T13536 |
62015-62016 |
SYM |
denotes |
′ |
| T13537 |
62016-62018 |
, |
denotes |
, |
| T13538 |
62018-62021 |
CC |
denotes |
and |
| T13539 |
62022-62029 |
JJ |
denotes |
genomic |
| T13540 |
62030-62033 |
NN |
denotes |
DNA |
| T13541 |
62034-62036 |
IN |
denotes |
as |
| T13542 |
62037-62038 |
DT |
denotes |
a |
| T13543 |
62039-62047 |
NN |
denotes |
template |
| T13544 |
62047-62048 |
. |
denotes |
. |
| T13545 |
62048-62120 |
sentence |
denotes |
The PCR product was gel purified and ligated into pCRII-TOPO TA vector. |
| T13546 |
62049-62052 |
DT |
denotes |
The |
| T13548 |
62053-62056 |
NN |
denotes |
PCR |
| T13547 |
62057-62064 |
NN |
denotes |
product |
| T13550 |
62065-62068 |
VBD |
denotes |
was |
| T13551 |
62069-62072 |
NN |
denotes |
gel |
| T13549 |
62073-62081 |
VBN |
denotes |
purified |
| T13552 |
62082-62085 |
CC |
denotes |
and |
| T13553 |
62086-62093 |
VBN |
denotes |
ligated |
| T13554 |
62094-62098 |
IN |
denotes |
into |
| T13555 |
62099-62104 |
NN |
denotes |
pCRII |
| T13557 |
62104-62105 |
HYPH |
denotes |
- |
| T13556 |
62105-62109 |
NN |
denotes |
TOPO |
| T13559 |
62110-62112 |
NN |
denotes |
TA |
| T13558 |
62113-62119 |
NN |
denotes |
vector |
| T13560 |
62119-62120 |
. |
denotes |
. |
| T13561 |
62120-62281 |
sentence |
denotes |
The pre-LIM domain of Ajuba was generated essentially as described [9], but was fused to GFP by subcloning from the pEGFP-N1 20 vector (BD Biosciences Clontech) |
| T13562 |
62121-62124 |
DT |
denotes |
The |
| T13564 |
62125-62132 |
JJ |
denotes |
pre-LIM |
| T13563 |
62133-62139 |
NN |
denotes |
domain |
| T13566 |
62140-62142 |
IN |
denotes |
of |
| T13567 |
62143-62148 |
NN |
denotes |
Ajuba |
| T13568 |
62149-62152 |
VBD |
denotes |
was |
| T13565 |
62153-62162 |
VBN |
denotes |
generated |
| T13569 |
62163-62174 |
RB |
denotes |
essentially |
| T13570 |
62175-62177 |
IN |
denotes |
as |
| T13571 |
62178-62187 |
VBN |
denotes |
described |
| T13572 |
62188-62189 |
-LRB- |
denotes |
[ |
| T13573 |
62189-62190 |
CD |
denotes |
9 |
| T13574 |
62190-62191 |
-RRB- |
denotes |
] |
| T13575 |
62191-62193 |
, |
denotes |
, |
| T13576 |
62193-62196 |
CC |
denotes |
but |
| T13577 |
62197-62200 |
VBD |
denotes |
was |
| T13578 |
62201-62206 |
VBN |
denotes |
fused |
| T13579 |
62207-62209 |
IN |
denotes |
to |
| T13580 |
62210-62213 |
NN |
denotes |
GFP |
| T13581 |
62214-62216 |
IN |
denotes |
by |
| T13582 |
62217-62227 |
VBG |
denotes |
subcloning |
| T13583 |
62228-62232 |
IN |
denotes |
from |
| T13584 |
62233-62236 |
DT |
denotes |
the |
| T13586 |
62237-62242 |
NN |
denotes |
pEGFP |
| T13588 |
62242-62243 |
HYPH |
denotes |
- |
| T13587 |
62243-62245 |
NN |
denotes |
N1 |
| T13589 |
62246-62248 |
CD |
denotes |
20 |
| T13585 |
62249-62255 |
NN |
denotes |
vector |
| T13590 |
62256-62257 |
-LRB- |
denotes |
( |
| T13592 |
62257-62259 |
NNP |
denotes |
BD |
| T13593 |
62260-62271 |
NNP |
denotes |
Biosciences |
| T13591 |
62272-62280 |
NNP |
denotes |
Clontech |
| T13594 |
62280-62281 |
-RRB- |
denotes |
) |
| T13649 |
62283-62285 |
FW |
denotes |
In |
| T13650 |
62286-62290 |
FW |
denotes |
situ |
| T13651 |
62291-62304 |
NN |
denotes |
hybridization |
| T13652 |
62304-62467 |
sentence |
denotes |
The pCRII-TOPO TA vector containing a region of the 3′ UTR of Snail was used as a template to generate digoxigenin-labeled sense and antisense riboprobes (Roche). |
| T13653 |
62305-62308 |
DT |
denotes |
The |
| T13655 |
62309-62314 |
NN |
denotes |
pCRII |
| T13657 |
62314-62315 |
HYPH |
denotes |
- |
| T13656 |
62315-62319 |
NN |
denotes |
TOPO |
| T13658 |
62320-62322 |
NN |
denotes |
TA |
| T13654 |
62323-62329 |
NN |
denotes |
vector |
| T13660 |
62330-62340 |
VBG |
denotes |
containing |
| T13661 |
62341-62342 |
DT |
denotes |
a |
| T13662 |
62343-62349 |
NN |
denotes |
region |
| T13663 |
62350-62352 |
IN |
denotes |
of |
| T13664 |
62353-62356 |
DT |
denotes |
the |
| T13666 |
62357-62358 |
CD |
denotes |
3 |
| T13667 |
62358-62359 |
SYM |
denotes |
′ |
| T13665 |
62360-62363 |
NN |
denotes |
UTR |
| T13668 |
62364-62366 |
IN |
denotes |
of |
| T13669 |
62367-62372 |
NN |
denotes |
Snail |
| T13670 |
62373-62376 |
VBD |
denotes |
was |
| T13659 |
62377-62381 |
VBN |
denotes |
used |
| T13671 |
62382-62384 |
IN |
denotes |
as |
| T13672 |
62385-62386 |
DT |
denotes |
a |
| T13673 |
62387-62395 |
NN |
denotes |
template |
| T13674 |
62396-62398 |
TO |
denotes |
to |
| T13675 |
62399-62407 |
VB |
denotes |
generate |
| T13676 |
62408-62419 |
NN |
denotes |
digoxigenin |
| T13678 |
62419-62420 |
HYPH |
denotes |
- |
| T13677 |
62420-62427 |
VBN |
denotes |
labeled |
| T13680 |
62428-62433 |
NN |
denotes |
sense |
| T13681 |
62434-62437 |
CC |
denotes |
and |
| T13682 |
62438-62447 |
NN |
denotes |
antisense |
| T13679 |
62448-62458 |
NNS |
denotes |
riboprobes |
| T13683 |
62459-62460 |
-LRB- |
denotes |
( |
| T13684 |
62460-62465 |
NNP |
denotes |
Roche |
| T13685 |
62465-62466 |
-RRB- |
denotes |
) |
| T13686 |
62466-62467 |
. |
denotes |
. |
| T13687 |
62467-62533 |
sentence |
denotes |
The respective probes were obtained by XhoI and BamH1 digestions. |
| T13688 |
62468-62471 |
DT |
denotes |
The |
| T13690 |
62472-62482 |
JJ |
denotes |
respective |
| T13689 |
62483-62489 |
NNS |
denotes |
probes |
| T13692 |
62490-62494 |
VBD |
denotes |
were |
| T13691 |
62495-62503 |
VBN |
denotes |
obtained |
| T13693 |
62504-62506 |
IN |
denotes |
by |
| T13694 |
62507-62511 |
NN |
denotes |
XhoI |
| T13696 |
62512-62515 |
CC |
denotes |
and |
| T13697 |
62516-62521 |
NN |
denotes |
BamH1 |
| T13695 |
62522-62532 |
NNS |
denotes |
digestions |
| T13698 |
62532-62533 |
. |
denotes |
. |
| T13699 |
62533-62619 |
sentence |
denotes |
In situ hybridizations were performed on 10-μm thick sections of E17.5 mouse embryos. |
| T13700 |
62534-62536 |
FW |
denotes |
In |
| T13701 |
62537-62541 |
FW |
denotes |
situ |
| T13702 |
62542-62556 |
NNS |
denotes |
hybridizations |
| T13704 |
62557-62561 |
VBD |
denotes |
were |
| T13703 |
62562-62571 |
VBN |
denotes |
performed |
| T13705 |
62572-62574 |
IN |
denotes |
on |
| T13706 |
62575-62577 |
CD |
denotes |
10 |
| T13708 |
62577-62578 |
HYPH |
denotes |
- |
| T13707 |
62578-62580 |
NN |
denotes |
μm |
| T13709 |
62581-62586 |
JJ |
denotes |
thick |
| T13710 |
62587-62595 |
NNS |
denotes |
sections |
| T13711 |
62596-62598 |
IN |
denotes |
of |
| T13712 |
62599-62604 |
NN |
denotes |
E17.5 |
| T13714 |
62605-62610 |
NN |
denotes |
mouse |
| T13713 |
62611-62618 |
NNS |
denotes |
embryos |
| T13715 |
62618-62619 |
. |
denotes |
. |
| T13716 |
62619-62902 |
sentence |
denotes |
The sections were fixed with 4% PFA for 10 min at room temperature, prehybridized at room temperature for 4.5 h, hybridized with the probe (2 μg/ml) at 55 °C for 12–14 h, blocked with 10% NGS, and treated with anti-dig Fab-AP antibody (Roche #1093274) at a 1:2,500 dilution for 3 h. |
| T13717 |
62620-62623 |
DT |
denotes |
The |
| T13718 |
62624-62632 |
NNS |
denotes |
sections |
| T13720 |
62633-62637 |
VBD |
denotes |
were |
| T13719 |
62638-62643 |
VBN |
denotes |
fixed |
| T13721 |
62644-62648 |
IN |
denotes |
with |
| T13722 |
62649-62650 |
CD |
denotes |
4 |
| T13723 |
62650-62651 |
NN |
denotes |
% |
| T13724 |
62652-62655 |
NN |
denotes |
PFA |
| T13725 |
62656-62659 |
IN |
denotes |
for |
| T13726 |
62660-62662 |
CD |
denotes |
10 |
| T13727 |
62663-62666 |
NN |
denotes |
min |
| T13728 |
62667-62669 |
IN |
denotes |
at |
| T13729 |
62670-62674 |
NN |
denotes |
room |
| T13730 |
62675-62686 |
NN |
denotes |
temperature |
| T13731 |
62686-62688 |
, |
denotes |
, |
| T13732 |
62688-62701 |
VBN |
denotes |
prehybridized |
| T13733 |
62702-62704 |
IN |
denotes |
at |
| T13734 |
62705-62709 |
NN |
denotes |
room |
| T13735 |
62710-62721 |
NN |
denotes |
temperature |
| T13736 |
62722-62725 |
IN |
denotes |
for |
| T13737 |
62726-62729 |
CD |
denotes |
4.5 |
| T13738 |
62730-62731 |
NN |
denotes |
h |
| T13739 |
62731-62733 |
, |
denotes |
, |
| T13740 |
62733-62743 |
VBN |
denotes |
hybridized |
| T13741 |
62744-62748 |
IN |
denotes |
with |
| T13742 |
62749-62752 |
DT |
denotes |
the |
| T13743 |
62753-62758 |
NN |
denotes |
probe |
| T13744 |
62759-62760 |
-LRB- |
denotes |
( |
| T13746 |
62760-62761 |
CD |
denotes |
2 |
| T13745 |
62762-62764 |
NN |
denotes |
μg |
| T13747 |
62764-62765 |
SYM |
denotes |
/ |
| T13748 |
62765-62767 |
NN |
denotes |
ml |
| T13749 |
62767-62768 |
-RRB- |
denotes |
) |
| T13750 |
62769-62771 |
IN |
denotes |
at |
| T13751 |
62772-62774 |
CD |
denotes |
55 |
| T13752 |
62775-62777 |
NN |
denotes |
°C |
| T13753 |
62778-62781 |
IN |
denotes |
for |
| T13754 |
62782-62784 |
CD |
denotes |
12 |
| T13756 |
62784-62785 |
SYM |
denotes |
– |
| T13755 |
62785-62787 |
CD |
denotes |
14 |
| T13757 |
62788-62789 |
NN |
denotes |
h |
| T13758 |
62789-62791 |
, |
denotes |
, |
| T13759 |
62791-62798 |
VBN |
denotes |
blocked |
| T13760 |
62799-62803 |
IN |
denotes |
with |
| T13761 |
62804-62806 |
CD |
denotes |
10 |
| T13762 |
62806-62807 |
NN |
denotes |
% |
| T13763 |
62808-62811 |
NN |
denotes |
NGS |
| T13764 |
62811-62813 |
, |
denotes |
, |
| T13765 |
62813-62816 |
CC |
denotes |
and |
| T13766 |
62817-62824 |
VBN |
denotes |
treated |
| T13767 |
62825-62829 |
IN |
denotes |
with |
| T13768 |
62830-62838 |
JJ |
denotes |
anti-dig |
| T13770 |
62839-62842 |
NN |
denotes |
Fab |
| T13772 |
62842-62843 |
HYPH |
denotes |
- |
| T13771 |
62843-62845 |
NN |
denotes |
AP |
| T13769 |
62846-62854 |
NN |
denotes |
antibody |
| T13773 |
62855-62856 |
-LRB- |
denotes |
( |
| T13774 |
62856-62861 |
NNP |
denotes |
Roche |
| T13775 |
62862-62863 |
SYM |
denotes |
# |
| T13776 |
62863-62870 |
CD |
denotes |
1093274 |
| T13777 |
62870-62871 |
-RRB- |
denotes |
) |
| T13778 |
62872-62874 |
IN |
denotes |
at |
| T13779 |
62875-62876 |
DT |
denotes |
a |
| T13781 |
62877-62878 |
CD |
denotes |
1 |
| T13783 |
62878-62879 |
SYM |
denotes |
: |
| T13782 |
62879-62884 |
CD |
denotes |
2,500 |
| T13780 |
62885-62893 |
NN |
denotes |
dilution |
| T13784 |
62894-62897 |
IN |
denotes |
for |
| T13785 |
62898-62899 |
CD |
denotes |
3 |
| T13786 |
62900-62901 |
NN |
denotes |
h |
| T13787 |
62901-62902 |
. |
denotes |
. |
| T13788 |
62902-62984 |
sentence |
denotes |
The sections were incubated with NBT and BCIP until adequate signal was detected. |
| T13789 |
62903-62906 |
DT |
denotes |
The |
| T13790 |
62907-62915 |
NNS |
denotes |
sections |
| T13792 |
62916-62920 |
VBD |
denotes |
were |
| T13791 |
62921-62930 |
VBN |
denotes |
incubated |
| T13793 |
62931-62935 |
IN |
denotes |
with |
| T13794 |
62936-62939 |
NN |
denotes |
NBT |
| T13795 |
62940-62943 |
CC |
denotes |
and |
| T13796 |
62944-62948 |
NN |
denotes |
BCIP |
| T13797 |
62949-62954 |
IN |
denotes |
until |
| T13799 |
62955-62963 |
JJ |
denotes |
adequate |
| T13800 |
62964-62970 |
NN |
denotes |
signal |
| T13801 |
62971-62974 |
VBD |
denotes |
was |
| T13798 |
62975-62983 |
VBN |
denotes |
detected |
| T13802 |
62983-62984 |
. |
denotes |
. |
| T13828 |
62986-63004 |
NN |
denotes |
Immunofluorescence |
| T13829 |
63005-63008 |
CC |
denotes |
and |
| T13830 |
63009-63029 |
NN |
denotes |
immunohistochemistry |
| T13831 |
63029-63127 |
sentence |
denotes |
Tissue samples for immunofluorescence were frozen in OCT and sectioned 10 μm thick on a cryostat. |
| T13832 |
63030-63036 |
NN |
denotes |
Tissue |
| T13833 |
63037-63044 |
NNS |
denotes |
samples |
| T13835 |
63045-63048 |
IN |
denotes |
for |
| T13836 |
63049-63067 |
NN |
denotes |
immunofluorescence |
| T13837 |
63068-63072 |
VBD |
denotes |
were |
| T13834 |
63073-63079 |
VBN |
denotes |
frozen |
| T13838 |
63080-63082 |
IN |
denotes |
in |
| T13839 |
63083-63086 |
NN |
denotes |
OCT |
| T13840 |
63087-63090 |
CC |
denotes |
and |
| T13841 |
63091-63100 |
VBN |
denotes |
sectioned |
| T13842 |
63101-63103 |
CD |
denotes |
10 |
| T13843 |
63104-63106 |
NN |
denotes |
μm |
| T13844 |
63107-63112 |
JJ |
denotes |
thick |
| T13845 |
63113-63115 |
IN |
denotes |
on |
| T13846 |
63116-63117 |
DT |
denotes |
a |
| T13847 |
63118-63126 |
NN |
denotes |
cryostat |
| T13848 |
63126-63127 |
. |
denotes |
. |
| T13849 |
63127-63240 |
sentence |
denotes |
Sections were fixed in 4% paraformaldehyde for 10 min at room temperature, blocked, and stained with antibodies. |
| T13850 |
63128-63136 |
NNS |
denotes |
Sections |
| T13852 |
63137-63141 |
VBD |
denotes |
were |
| T13851 |
63142-63147 |
VBN |
denotes |
fixed |
| T13853 |
63148-63150 |
IN |
denotes |
in |
| T13854 |
63151-63152 |
CD |
denotes |
4 |
| T13855 |
63152-63153 |
NN |
denotes |
% |
| T13856 |
63154-63170 |
NN |
denotes |
paraformaldehyde |
| T13857 |
63171-63174 |
IN |
denotes |
for |
| T13858 |
63175-63177 |
CD |
denotes |
10 |
| T13859 |
63178-63181 |
NN |
denotes |
min |
| T13860 |
63182-63184 |
IN |
denotes |
at |
| T13861 |
63185-63189 |
NN |
denotes |
room |
| T13862 |
63190-63201 |
NN |
denotes |
temperature |
| T13863 |
63201-63203 |
, |
denotes |
, |
| T13864 |
63203-63210 |
VBN |
denotes |
blocked |
| T13865 |
63210-63212 |
, |
denotes |
, |
| T13866 |
63212-63215 |
CC |
denotes |
and |
| T13867 |
63216-63223 |
VBN |
denotes |
stained |
| T13868 |
63224-63228 |
IN |
denotes |
with |
| T13869 |
63229-63239 |
NNS |
denotes |
antibodies |
| T13870 |
63239-63240 |
. |
denotes |
. |
| T13871 |
63240-63353 |
sentence |
denotes |
Tissue samples for immunohistochemistry were fixed in 4% paraformaldehyde, dehydrated, and embedded in paraffin. |
| T13872 |
63241-63247 |
NN |
denotes |
Tissue |
| T13873 |
63248-63255 |
NNS |
denotes |
samples |
| T13875 |
63256-63259 |
IN |
denotes |
for |
| T13876 |
63260-63280 |
NN |
denotes |
immunohistochemistry |
| T13877 |
63281-63285 |
VBD |
denotes |
were |
| T13874 |
63286-63291 |
VBN |
denotes |
fixed |
| T13878 |
63292-63294 |
IN |
denotes |
in |
| T13879 |
63295-63296 |
CD |
denotes |
4 |
| T13880 |
63296-63297 |
NN |
denotes |
% |
| T13881 |
63298-63314 |
NN |
denotes |
paraformaldehyde |
| T13882 |
63314-63316 |
, |
denotes |
, |
| T13883 |
63316-63326 |
VBN |
denotes |
dehydrated |
| T13884 |
63326-63328 |
, |
denotes |
, |
| T13885 |
63328-63331 |
CC |
denotes |
and |
| T13886 |
63332-63340 |
VBN |
denotes |
embedded |
| T13887 |
63341-63343 |
IN |
denotes |
in |
| T13888 |
63344-63352 |
NN |
denotes |
paraffin |
| T13889 |
63352-63353 |
. |
denotes |
. |
| T13890 |
63353-63453 |
sentence |
denotes |
Samples were sectioned on a microtome (10 μm thick) and rehydrated prior to staining with antibody. |
| T13891 |
63354-63361 |
NNS |
denotes |
Samples |
| T13893 |
63362-63366 |
VBD |
denotes |
were |
| T13892 |
63367-63376 |
VBN |
denotes |
sectioned |
| T13894 |
63377-63379 |
IN |
denotes |
on |
| T13895 |
63380-63381 |
DT |
denotes |
a |
| T13896 |
63382-63391 |
NN |
denotes |
microtome |
| T13897 |
63392-63393 |
-LRB- |
denotes |
( |
| T13899 |
63393-63395 |
CD |
denotes |
10 |
| T13900 |
63396-63398 |
NN |
denotes |
μm |
| T13898 |
63399-63404 |
JJ |
denotes |
thick |
| T13901 |
63404-63405 |
-RRB- |
denotes |
) |
| T13902 |
63406-63409 |
CC |
denotes |
and |
| T13903 |
63410-63420 |
VBD |
denotes |
rehydrated |
| T13904 |
63421-63426 |
IN |
denotes |
prior |
| T13905 |
63427-63429 |
IN |
denotes |
to |
| T13906 |
63430-63438 |
VBG |
denotes |
staining |
| T13907 |
63439-63443 |
IN |
denotes |
with |
| T13908 |
63444-63452 |
NN |
denotes |
antibody |
| T13909 |
63452-63453 |
. |
denotes |
. |
| T13910 |
63453-63639 |
sentence |
denotes |
Samples stained with Snail, pMAPK, pSmad2, and cyclin D were antigen unmasked with 10 mM sodium citrate (pH 6) in an Antigen Retriever 2100 (Pickcell Laboratories, Leiden, Netherlands). |
| T13911 |
63454-63461 |
NNS |
denotes |
Samples |
| T13913 |
63462-63469 |
VBN |
denotes |
stained |
| T13914 |
63470-63474 |
IN |
denotes |
with |
| T13915 |
63475-63480 |
NN |
denotes |
Snail |
| T13916 |
63480-63482 |
, |
denotes |
, |
| T13917 |
63482-63487 |
NN |
denotes |
pMAPK |
| T13918 |
63487-63489 |
, |
denotes |
, |
| T13919 |
63489-63495 |
NN |
denotes |
pSmad2 |
| T13920 |
63495-63497 |
, |
denotes |
, |
| T13921 |
63497-63500 |
CC |
denotes |
and |
| T13922 |
63501-63507 |
NN |
denotes |
cyclin |
| T13923 |
63508-63509 |
NN |
denotes |
D |
| T13924 |
63510-63514 |
VBD |
denotes |
were |
| T13925 |
63515-63522 |
NN |
denotes |
antigen |
| T13912 |
63523-63531 |
VBN |
denotes |
unmasked |
| T13926 |
63532-63536 |
IN |
denotes |
with |
| T13927 |
63537-63539 |
CD |
denotes |
10 |
| T13928 |
63540-63542 |
NN |
denotes |
mM |
| T13930 |
63543-63549 |
NN |
denotes |
sodium |
| T13929 |
63550-63557 |
NN |
denotes |
citrate |
| T13931 |
63558-63559 |
-LRB- |
denotes |
( |
| T13932 |
63559-63561 |
NN |
denotes |
pH |
| T13933 |
63562-63563 |
CD |
denotes |
6 |
| T13934 |
63563-63564 |
-RRB- |
denotes |
) |
| T13935 |
63565-63567 |
IN |
denotes |
in |
| T13936 |
63568-63570 |
DT |
denotes |
an |
| T13938 |
63571-63578 |
NNP |
denotes |
Antigen |
| T13937 |
63579-63588 |
NNP |
denotes |
Retriever |
| T13939 |
63589-63593 |
CD |
denotes |
2100 |
| T13940 |
63594-63595 |
-LRB- |
denotes |
( |
| T13942 |
63595-63603 |
NNP |
denotes |
Pickcell |
| T13941 |
63604-63616 |
NNP |
denotes |
Laboratories |
| T13943 |
63616-63618 |
, |
denotes |
, |
| T13944 |
63618-63624 |
NNP |
denotes |
Leiden |
| T13945 |
63624-63626 |
, |
denotes |
, |
| T13946 |
63626-63637 |
NNP |
denotes |
Netherlands |
| T13947 |
63637-63638 |
-RRB- |
denotes |
) |
| T13948 |
63638-63639 |
. |
denotes |
. |
| T13949 |
63639-63748 |
sentence |
denotes |
The DAB substrate kit (Vector Labs) was used according to manufacturer's instructions to develop the signal. |
| T13950 |
63640-63643 |
DT |
denotes |
The |
| T13952 |
63644-63647 |
NN |
denotes |
DAB |
| T13953 |
63648-63657 |
NN |
denotes |
substrate |
| T13951 |
63658-63661 |
NN |
denotes |
kit |
| T13955 |
63662-63663 |
-LRB- |
denotes |
( |
| T13957 |
63663-63669 |
NNP |
denotes |
Vector |
| T13956 |
63670-63674 |
NNPS |
denotes |
Labs |
| T13958 |
63674-63675 |
-RRB- |
denotes |
) |
| T13959 |
63676-63679 |
VBD |
denotes |
was |
| T13954 |
63680-63684 |
VBN |
denotes |
used |
| T13960 |
63685-63694 |
VBG |
denotes |
according |
| T13961 |
63695-63697 |
IN |
denotes |
to |
| T13962 |
63698-63710 |
NN |
denotes |
manufacturer |
| T13964 |
63710-63712 |
POS |
denotes |
's |
| T13963 |
63713-63725 |
NNS |
denotes |
instructions |
| T13965 |
63726-63728 |
TO |
denotes |
to |
| T13966 |
63729-63736 |
VB |
denotes |
develop |
| T13967 |
63737-63740 |
DT |
denotes |
the |
| T13968 |
63741-63747 |
NN |
denotes |
signal |
| T13969 |
63747-63748 |
. |
denotes |
. |
| T14008 |
63750-63752 |
NN |
denotes |
RT |
| T14010 |
63752-63753 |
HYPH |
denotes |
- |
| T14009 |
63753-63756 |
NN |
denotes |
PCR |
| T14011 |
63756-63875 |
sentence |
denotes |
RNA was extracted from keratinocytes or skin tissue with Trizol (Invitrogen) according to the manufacturer's protocol. |
| T14012 |
63757-63760 |
NN |
denotes |
RNA |
| T14014 |
63761-63764 |
VBD |
denotes |
was |
| T14013 |
63765-63774 |
VBN |
denotes |
extracted |
| T14015 |
63775-63779 |
IN |
denotes |
from |
| T14016 |
63780-63793 |
NNS |
denotes |
keratinocytes |
| T14017 |
63794-63796 |
CC |
denotes |
or |
| T14018 |
63797-63801 |
NN |
denotes |
skin |
| T14019 |
63802-63808 |
NN |
denotes |
tissue |
| T14020 |
63809-63813 |
IN |
denotes |
with |
| T14021 |
63814-63820 |
NN |
denotes |
Trizol |
| T14022 |
63821-63822 |
-LRB- |
denotes |
( |
| T14023 |
63822-63832 |
NNP |
denotes |
Invitrogen |
| T14024 |
63832-63833 |
-RRB- |
denotes |
) |
| T14025 |
63834-63843 |
VBG |
denotes |
according |
| T14026 |
63844-63846 |
IN |
denotes |
to |
| T14027 |
63847-63850 |
DT |
denotes |
the |
| T14028 |
63851-63863 |
NN |
denotes |
manufacturer |
| T14030 |
63863-63865 |
POS |
denotes |
's |
| T14029 |
63866-63874 |
NN |
denotes |
protocol |
| T14031 |
63874-63875 |
. |
denotes |
. |
| T14032 |
63875-63958 |
sentence |
denotes |
cDNA was generated using oligo-dT primers and the Superscript II kit (Invitrogen). |
| T14033 |
63876-63880 |
NN |
denotes |
cDNA |
| T14035 |
63881-63884 |
VBD |
denotes |
was |
| T14034 |
63885-63894 |
VBN |
denotes |
generated |
| T14036 |
63895-63900 |
VBG |
denotes |
using |
| T14037 |
63901-63906 |
NN |
denotes |
oligo |
| T14039 |
63906-63907 |
HYPH |
denotes |
- |
| T14038 |
63907-63909 |
NN |
denotes |
dT |
| T14040 |
63910-63917 |
NNS |
denotes |
primers |
| T14041 |
63918-63921 |
CC |
denotes |
and |
| T14042 |
63922-63925 |
DT |
denotes |
the |
| T14044 |
63926-63937 |
NNP |
denotes |
Superscript |
| T14045 |
63938-63940 |
CD |
denotes |
II |
| T14043 |
63941-63944 |
NN |
denotes |
kit |
| T14046 |
63945-63946 |
-LRB- |
denotes |
( |
| T14047 |
63946-63956 |
NNP |
denotes |
Invitrogen |
| T14048 |
63956-63957 |
-RRB- |
denotes |
) |
| T14049 |
63957-63958 |
. |
denotes |
. |
| T14050 |
63958-64171 |
sentence |
denotes |
The primers used for PCR were Snail forward: 5′- CAGCTGGCCAGGCTCTCGGT-3′; Snail reverse: 5′- GCGAGGGCCTCCGGAGCA-3′; GAPDH forward 5′- CGTAGACAAAATGGTGAAGGTCGG-3′; and GAPDH reverse: 5′- AAGCAGTTGGTGGTGCAGGATG-3′. |
| T14051 |
63959-63962 |
DT |
denotes |
The |
| T14052 |
63963-63970 |
NNS |
denotes |
primers |
| T14054 |
63971-63975 |
VBN |
denotes |
used |
| T14055 |
63976-63979 |
IN |
denotes |
for |
| T14056 |
63980-63983 |
NN |
denotes |
PCR |
| T14053 |
63984-63988 |
VBD |
denotes |
were |
| T14057 |
63989-63994 |
NN |
denotes |
Snail |
| T14058 |
63995-64002 |
NN |
denotes |
forward |
| T14059 |
64002-64004 |
: |
denotes |
: |
| T14060 |
64004-64005 |
CD |
denotes |
5 |
| T14062 |
64005-64006 |
SYM |
denotes |
′ |
| T14063 |
64006-64007 |
HYPH |
denotes |
- |
| T14061 |
64008-64028 |
NN |
denotes |
CAGCTGGCCAGGCTCTCGGT |
| T14064 |
64028-64029 |
HYPH |
denotes |
- |
| T14065 |
64029-64030 |
CD |
denotes |
3 |
| T14066 |
64030-64031 |
SYM |
denotes |
′ |
| T14067 |
64031-64032 |
: |
denotes |
; |
| T14068 |
64033-64038 |
NN |
denotes |
Snail |
| T14069 |
64039-64046 |
NN |
denotes |
reverse |
| T14070 |
64046-64048 |
: |
denotes |
: |
| T14071 |
64048-64049 |
CD |
denotes |
5 |
| T14073 |
64049-64050 |
SYM |
denotes |
′ |
| T14074 |
64050-64051 |
HYPH |
denotes |
- |
| T14072 |
64052-64070 |
NN |
denotes |
GCGAGGGCCTCCGGAGCA |
| T14075 |
64070-64071 |
HYPH |
denotes |
- |
| T14076 |
64071-64072 |
CD |
denotes |
3 |
| T14077 |
64072-64073 |
SYM |
denotes |
′ |
| T14078 |
64073-64074 |
: |
denotes |
; |
| T14079 |
64075-64080 |
NN |
denotes |
GAPDH |
| T14080 |
64081-64088 |
NN |
denotes |
forward |
| T14081 |
64089-64090 |
CD |
denotes |
5 |
| T14083 |
64090-64091 |
SYM |
denotes |
′ |
| T14084 |
64091-64092 |
HYPH |
denotes |
- |
| T14082 |
64093-64117 |
NN |
denotes |
CGTAGACAAAATGGTGAAGGTCGG |
| T14085 |
64117-64118 |
HYPH |
denotes |
- |
| T14086 |
64118-64119 |
CD |
denotes |
3 |
| T14087 |
64119-64120 |
SYM |
denotes |
′ |
| T14088 |
64120-64121 |
: |
denotes |
; |
| T14089 |
64122-64125 |
CC |
denotes |
and |
| T14090 |
64126-64131 |
NN |
denotes |
GAPDH |
| T14091 |
64132-64139 |
NN |
denotes |
reverse |
| T14092 |
64139-64141 |
: |
denotes |
: |
| T14093 |
64141-64142 |
CD |
denotes |
5 |
| T14095 |
64142-64143 |
SYM |
denotes |
′ |
| T14096 |
64143-64144 |
HYPH |
denotes |
- |
| T14094 |
64145-64167 |
NN |
denotes |
AAGCAGTTGGTGGTGCAGGATG |
| T14097 |
64167-64168 |
HYPH |
denotes |
- |
| T14098 |
64168-64169 |
CD |
denotes |
3 |
| T14099 |
64169-64170 |
SYM |
denotes |
′ |
| T14100 |
64170-64171 |
. |
denotes |
. |
| R10 |
T157 |
T158 |
compound |
Hair,Follicle |
| R100 |
T254 |
T253 |
punct |
-,activated |
| R1000 |
T1864 |
T1862 |
pobj |
proximity,by |
| R1001 |
T1865 |
T1864 |
amod |
close,proximity |
| R1002 |
T1757 |
T1756 |
pobj |
proteins,of |
| R1003 |
T1866 |
T1864 |
prep |
of,proximity |
| R1004 |
T1867 |
T1868 |
det |
the,site |
| R1005 |
T1758 |
T1731 |
punct |
),protein |
| R1006 |
T1759 |
T1731 |
punct |
", ",protein |
| R1007 |
T1868 |
T1866 |
pobj |
site,of |
| R1008 |
T1869 |
T1868 |
nmod |
LEF,site |
| R1009 |
T1870 |
T1869 |
punct |
-,LEF |
| R101 |
T255 |
T250 |
nmod |
protein,kinase |
| R1010 |
T1760 |
T1761 |
dep |
which,appears |
| R1011 |
T1871 |
T1869 |
nummod |
1,LEF |
| R1012 |
T1872 |
T1869 |
punct |
/,LEF |
| R1013 |
T1761 |
T1731 |
relcl |
appears,protein |
| R1014 |
T1873 |
T1874 |
compound |
β,catenin |
| R1015 |
T1762 |
T1763 |
aux |
to,function |
| R1016 |
T1874 |
T1869 |
appos |
catenin,LEF |
| R1017 |
T1875 |
T1874 |
punct |
-,catenin |
| R1018 |
T1876 |
T1868 |
compound |
binding,site |
| R1019 |
T1763 |
T1761 |
xcomp |
function,appears |
| R102 |
T256 |
T250 |
punct |
(,kinase |
| R1020 |
T1877 |
T1864 |
prep |
to,proximity |
| R1021 |
T1878 |
T1879 |
det |
a,site |
| R1022 |
T1879 |
T1877 |
pobj |
site,to |
| R1023 |
T1764 |
T1763 |
advmod |
dually,function |
| R1024 |
T1880 |
T1879 |
acl |
known,site |
| R1025 |
T1881 |
T1882 |
aux |
to,bind |
| R1026 |
T1765 |
T1763 |
prep |
in,function |
| R1027 |
T1882 |
T1880 |
xcomp |
bind,known |
| R1028 |
T1883 |
T1884 |
det |
the,family |
| R1029 |
T1884 |
T1882 |
dobj |
family,bind |
| R103 |
T257 |
T250 |
appos |
MAPK,kinase |
| R1030 |
T1766 |
T1765 |
preconj |
both,in |
| R1031 |
T1767 |
T1765 |
conj |
adhesion,in |
| R1032 |
T1768 |
T1765 |
cc |
and,in |
| R1033 |
T1769 |
T1765 |
conj |
in,in |
| R1034 |
T1885 |
T1886 |
compound |
Snail,Slug |
| R1035 |
T1886 |
T1884 |
compound |
Slug,family |
| R1036 |
T1770 |
T1769 |
pobj |
activation,in |
| R1037 |
T1887 |
T1886 |
punct |
/,Slug |
| R1038 |
T1888 |
T1884 |
prep |
of,family |
| R1039 |
T1889 |
T1890 |
nmod |
zinc,finger |
| R104 |
T258 |
T248 |
punct |
),pathway |
| R1040 |
T1771 |
T1770 |
prep |
of,activation |
| R1041 |
T1890 |
T1891 |
nmod |
finger,proteins |
| R1042 |
T1891 |
T1888 |
pobj |
proteins,of |
| R1043 |
T1772 |
T1773 |
det |
the,pathway |
| R1044 |
T1892 |
T1893 |
amod |
transcriptional,repressor |
| R1045 |
T1893 |
T1891 |
compound |
repressor,proteins |
| R1046 |
T1894 |
T1895 |
punct |
[,15 |
| R1047 |
T1773 |
T1771 |
pobj |
pathway,of |
| R1048 |
T1895 |
T1846 |
parataxis |
15,intrigued |
| R1049 |
T1896 |
T1895 |
nummod |
12,15 |
| R105 |
T259 |
T246 |
prep |
in,activate |
| R1050 |
T1897 |
T1895 |
punct |
",",15 |
| R1051 |
T1898 |
T1895 |
nummod |
13,15 |
| R1052 |
T1899 |
T1895 |
punct |
",",15 |
| R1053 |
T1900 |
T1895 |
nummod |
14,15 |
| R1054 |
T1774 |
T1773 |
nmod |
Ras,pathway |
| R1055 |
T1901 |
T1895 |
punct |
",",15 |
| R1056 |
T1902 |
T1895 |
punct |
],15 |
| R1057 |
T1903 |
T1846 |
punct |
.,intrigued |
| R1058 |
T1775 |
T1774 |
punct |
-,Ras |
| R1059 |
T1905 |
T1906 |
preconj |
Both,activity |
| R106 |
T260 |
T261 |
det |
the,bud |
| R1060 |
T1776 |
T1777 |
npadvmod |
mitogen,activated |
| R1061 |
T1906 |
T1907 |
nsubj |
activity,play |
| R1062 |
T1908 |
T1906 |
prep |
of,activity |
| R1063 |
T1777 |
T1779 |
amod |
activated,kinase |
| R1064 |
T1909 |
T1908 |
pobj |
Snail,of |
| R1065 |
T1910 |
T1906 |
cc |
and,activity |
| R1066 |
T1911 |
T1912 |
compound |
down,regulation |
| R1067 |
T1778 |
T1777 |
punct |
-,activated |
| R1068 |
T1912 |
T1906 |
conj |
regulation,activity |
| R1069 |
T1913 |
T1912 |
punct |
-,regulation |
| R107 |
T261 |
T259 |
pobj |
bud,in |
| R1070 |
T1914 |
T1912 |
prep |
of,regulation |
| R1071 |
T1779 |
T1774 |
appos |
kinase,Ras |
| R1072 |
T1915 |
T1916 |
compound |
E,cadherin |
| R1073 |
T1916 |
T1914 |
pobj |
cadherin,of |
| R1074 |
T1991 |
T1988 |
acl |
tune,ability |
| R1075 |
T1917 |
T1916 |
punct |
-,cadherin |
| R1076 |
T1918 |
T1919 |
amod |
pivotal,roles |
| R1077 |
T1919 |
T1907 |
dobj |
roles,play |
| R1078 |
T1920 |
T1907 |
prep |
in,play |
| R1079 |
T1992 |
T1991 |
advmod |
fine,tune |
| R108 |
T262 |
T229 |
punct |
.,found |
| R1080 |
T1921 |
T1922 |
amod |
epithelial,transitions |
| R1081 |
T1922 |
T1920 |
pobj |
transitions,in |
| R1082 |
T1923 |
T1921 |
prep |
to,epithelial |
| R1083 |
T1993 |
T1991 |
punct |
-,tune |
| R1084 |
T1924 |
T1923 |
amod |
mesenchymal,to |
| R1085 |
T1925 |
T1922 |
punct |
(,transitions |
| R1086 |
T1994 |
T1995 |
compound |
cadherin,expression |
| R1087 |
T1926 |
T1922 |
appos |
EMTs,transitions |
| R1088 |
T1927 |
T1922 |
punct |
),transitions |
| R1089 |
T1928 |
T1922 |
punct |
", ",transitions |
| R109 |
T264 |
T265 |
prep |
In,leads |
| R1090 |
T1995 |
T1991 |
dobj |
expression,tune |
| R1091 |
T1929 |
T1922 |
acl |
typified,transitions |
| R1092 |
T1930 |
T1929 |
agent |
by,typified |
| R1093 |
T1931 |
T1932 |
det |
the,transformation |
| R1094 |
T1996 |
T1991 |
prep |
at,tune |
| R1095 |
T1932 |
T1930 |
pobj |
transformation,by |
| R1096 |
T1933 |
T1932 |
prep |
of,transformation |
| R1097 |
T1934 |
T1935 |
amod |
polarized,cells |
| R1098 |
T1997 |
T1998 |
det |
the,level |
| R1099 |
T1935 |
T1933 |
pobj |
cells,of |
| R11 |
T158 |
T159 |
compound |
Follicle,Morphogenesis |
| R110 |
T266 |
T267 |
det |
the,epidermis |
| R1100 |
T1936 |
T1935 |
punct |
", ",cells |
| R1101 |
T1937 |
T1935 |
amod |
adhering,cells |
| R1102 |
T1938 |
T1935 |
amod |
epithelial,cells |
| R1103 |
T1939 |
T1932 |
prep |
into,transformation |
| R1104 |
T1998 |
T1996 |
pobj |
level,at |
| R1105 |
T1940 |
T1941 |
amod |
motile,cells |
| R1106 |
T1941 |
T1939 |
pobj |
cells,into |
| R1107 |
T1999 |
T1998 |
amod |
transcriptional,level |
| R1108 |
T1942 |
T1941 |
amod |
mesenchymal,cells |
| R1109 |
T1943 |
T1944 |
punct |
[,17 |
| R111 |
T267 |
T264 |
pobj |
epidermis,In |
| R1110 |
T1944 |
T1907 |
parataxis |
17,play |
| R1111 |
T2000 |
T1985 |
punct |
", ",seems |
| R1112 |
T1945 |
T1944 |
nummod |
16,17 |
| R1113 |
T1946 |
T1944 |
punct |
",",17 |
| R1114 |
T1947 |
T1944 |
punct |
],17 |
| R1115 |
T2001 |
T1985 |
nsubj |
Snail,seems |
| R1116 |
T1948 |
T1907 |
punct |
.,play |
| R1117 |
T1950 |
T1951 |
compound |
Bud,formation |
| R1118 |
T2002 |
T2003 |
aux |
to,have |
| R1119 |
T1951 |
T1952 |
nsubj |
formation,differs |
| R112 |
T268 |
T265 |
punct |
", ",leads |
| R1120 |
T2003 |
T1985 |
xcomp |
have,seems |
| R1121 |
T1953 |
T1952 |
prep |
from,differs |
| R1122 |
T1954 |
T1955 |
det |
an,EMT |
| R1123 |
T2004 |
T2005 |
det |
an,effect |
| R1124 |
T1955 |
T1953 |
pobj |
EMT,from |
| R1125 |
T1956 |
T1957 |
mark |
in,needs |
| R1126 |
T2005 |
T2003 |
dobj |
effect,have |
| R1127 |
T2006 |
T2005 |
amod |
additive,effect |
| R1128 |
T1957 |
T1952 |
advcl |
needs,differs |
| R1129 |
T1958 |
T1957 |
mark |
that,needs |
| R113 |
T269 |
T270 |
compound |
Snail,misexpression |
| R1130 |
T1959 |
T1960 |
compound |
E,cadherin |
| R1131 |
T2007 |
T2003 |
prep |
with,have |
| R1132 |
T1960 |
T1962 |
compound |
cadherin,activity |
| R1133 |
T1961 |
T1960 |
punct |
-,cadherin |
| R1134 |
T1962 |
T1957 |
nsubj |
activity,needs |
| R1135 |
T2008 |
T2007 |
pobj |
LEF,with |
| R1136 |
T1963 |
T1964 |
aux |
to,regulated |
| R1137 |
T1964 |
T1957 |
xcomp |
regulated,needs |
| R1138 |
T1965 |
T1964 |
aux |
be,regulated |
| R1139 |
T2009 |
T2008 |
punct |
-,LEF |
| R114 |
T270 |
T265 |
nsubj |
misexpression,leads |
| R1140 |
T1966 |
T1964 |
advmod |
down,regulated |
| R1141 |
T1967 |
T1964 |
punct |
-,regulated |
| R1142 |
T2010 |
T2008 |
nummod |
1,LEF |
| R1143 |
T1968 |
T1964 |
cc |
but,regulated |
| R1144 |
T1969 |
T1968 |
neg |
not,but |
| R1145 |
T2011 |
T2008 |
punct |
/,LEF |
| R1146 |
T1970 |
T1964 |
conj |
prevented,regulated |
| R1147 |
T1971 |
T1964 |
punct |
", ",regulated |
| R1148 |
T1972 |
T1973 |
mark |
so,remodeled |
| R1149 |
T2012 |
T2013 |
compound |
β,catenin |
| R115 |
T271 |
T265 |
prep |
to,leads |
| R1150 |
T1973 |
T1964 |
advcl |
remodeled,regulated |
| R1151 |
T1974 |
T1973 |
mark |
that,remodeled |
| R1152 |
T2013 |
T2008 |
appos |
catenin,LEF |
| R1153 |
T1975 |
T1976 |
amod |
adhesive,junctions |
| R1154 |
T1976 |
T1973 |
nsubjpass |
junctions,remodeled |
| R1155 |
T1977 |
T1973 |
auxpass |
are,remodeled |
| R1156 |
T1978 |
T1979 |
advmod |
rather,than |
| R1157 |
T1979 |
T1973 |
cc |
than,remodeled |
| R1158 |
T1980 |
T1981 |
advmod |
quantitatively,impaired |
| R1159 |
T1981 |
T1973 |
conj |
impaired,remodeled |
| R116 |
T272 |
T271 |
pobj |
hyperproliferation,to |
| R1160 |
T2014 |
T2013 |
punct |
-,catenin |
| R1161 |
T1982 |
T1952 |
punct |
.,differs |
| R1162 |
T2015 |
T2003 |
prep |
in,have |
| R1163 |
T1984 |
T1985 |
advcl |
Supportive,seems |
| R1164 |
T1986 |
T1984 |
prep |
of,Supportive |
| R1165 |
T2016 |
T2017 |
advmod |
negatively,modulating |
| R1166 |
T1987 |
T1988 |
det |
an,ability |
| R1167 |
T1988 |
T1986 |
pobj |
ability,of |
| R1168 |
T1989 |
T1988 |
amod |
underlying,ability |
| R1169 |
T2017 |
T2015 |
pcomp |
modulating,in |
| R117 |
T273 |
T272 |
cc |
and,hyperproliferation |
| R1170 |
T1990 |
T1991 |
aux |
to,tune |
| R1171 |
T2018 |
T2019 |
compound |
E,cadherin |
| R1172 |
T2019 |
T2021 |
compound |
cadherin,promoter |
| R1173 |
T2020 |
T2019 |
punct |
-,cadherin |
| R1174 |
T2021 |
T2022 |
compound |
promoter,activity |
| R1175 |
T2022 |
T2017 |
dobj |
activity,modulating |
| R1176 |
T2023 |
T2024 |
punct |
[,4 |
| R1177 |
T2097 |
T2096 |
acl |
associated,features |
| R1178 |
T2098 |
T2097 |
prep |
with,associated |
| R1179 |
T2024 |
T1985 |
parataxis |
4,seems |
| R118 |
T274 |
T275 |
det |
a,reduction |
| R1180 |
T2099 |
T2100 |
compound |
hair,bud |
| R1181 |
T2100 |
T2101 |
compound |
bud,formation |
| R1182 |
T2025 |
T2024 |
punct |
],4 |
| R1183 |
T2101 |
T2098 |
pobj |
formation,with |
| R1184 |
T2102 |
T2096 |
punct |
", ",features |
| R1185 |
T2103 |
T2096 |
prep |
including,features |
| R1186 |
T2026 |
T1985 |
punct |
.,seems |
| R1187 |
T2104 |
T2105 |
compound |
down,regulation |
| R1188 |
T2105 |
T2103 |
pobj |
regulation,including |
| R1189 |
T2028 |
T2029 |
prep |
In,discovered |
| R119 |
T275 |
T272 |
conj |
reduction,hyperproliferation |
| R1190 |
T2106 |
T2105 |
punct |
-,regulation |
| R1191 |
T2107 |
T2105 |
prep |
of,regulation |
| R1192 |
T2108 |
T2109 |
compound |
E,cadherin |
| R1193 |
T2109 |
T2107 |
pobj |
cadherin,of |
| R1194 |
T2030 |
T2031 |
det |
the,study |
| R1195 |
T2110 |
T2109 |
punct |
-,cadherin |
| R1196 |
T2111 |
T2105 |
punct |
", ",regulation |
| R1197 |
T2112 |
T2113 |
amod |
increased,proliferation |
| R1198 |
T2113 |
T2105 |
conj |
proliferation,regulation |
| R1199 |
T2031 |
T2028 |
pobj |
study,In |
| R12 |
T159 |
T156 |
pobj |
Morphogenesis,in |
| R120 |
T276 |
T275 |
prep |
in,reduction |
| R1200 |
T2114 |
T2113 |
punct |
", ",proliferation |
| R1201 |
T2115 |
T2113 |
cc |
and,proliferation |
| R1202 |
T2032 |
T2031 |
amod |
present,study |
| R1203 |
T2116 |
T2117 |
amod |
repressed,differentiation |
| R1204 |
T2117 |
T2113 |
conj |
differentiation,proliferation |
| R1205 |
T2118 |
T2117 |
amod |
terminal,differentiation |
| R1206 |
T2119 |
T2084 |
punct |
.,appears |
| R1207 |
T2033 |
T2029 |
punct |
", ",discovered |
| R1208 |
T2121 |
T2122 |
mark |
Although,reflected |
| R1209 |
T2034 |
T2029 |
nsubj |
we,discovered |
| R121 |
T277 |
T278 |
amod |
intercellular,adhesion |
| R1210 |
T2122 |
T2133 |
advcl |
reflected,appear |
| R1211 |
T2123 |
T2124 |
det |
the,spike |
| R1212 |
T2035 |
T2036 |
mark |
that,expressed |
| R1213 |
T2124 |
T2122 |
nsubjpass |
spike,reflected |
| R1214 |
T2125 |
T2124 |
amod |
temporal,spike |
| R1215 |
T2036 |
T2029 |
ccomp |
expressed,discovered |
| R1216 |
T2126 |
T2124 |
prep |
of,spike |
| R1217 |
T2127 |
T2126 |
pobj |
Snail,of |
| R1218 |
T2037 |
T2036 |
nsubjpass |
Snail,expressed |
| R1219 |
T2128 |
T2124 |
prep |
in,spike |
| R122 |
T278 |
T276 |
pobj |
adhesion,in |
| R1220 |
T2129 |
T2130 |
det |
the,bud |
| R1221 |
T2130 |
T2128 |
pobj |
bud,in |
| R1222 |
T2038 |
T2036 |
auxpass |
is,expressed |
| R1223 |
T2131 |
T2130 |
compound |
hair,bud |
| R1224 |
T2132 |
T2122 |
auxpass |
is,reflected |
| R1225 |
T2039 |
T2036 |
advmod |
briefly,expressed |
| R1226 |
T2134 |
T2122 |
prep |
at,reflected |
| R1227 |
T2135 |
T2136 |
det |
the,level |
| R1228 |
T2136 |
T2134 |
pobj |
level,at |
| R1229 |
T2040 |
T2036 |
prep |
at,expressed |
| R123 |
T279 |
T265 |
punct |
.,leads |
| R1230 |
T2137 |
T2136 |
compound |
mRNA,level |
| R1231 |
T2138 |
T2122 |
cc |
and,reflected |
| R1232 |
T2139 |
T2122 |
conj |
seems,reflected |
| R1233 |
T2041 |
T2042 |
det |
an,stage |
| R1234 |
T2140 |
T2141 |
aux |
to,follow |
| R1235 |
T2141 |
T2139 |
xcomp |
follow,seems |
| R1236 |
T2142 |
T2143 |
compound |
Wnt,signaling |
| R1237 |
T2042 |
T2040 |
pobj |
stage,at |
| R1238 |
T2143 |
T2141 |
dobj |
signaling,follow |
| R1239 |
T2144 |
T2143 |
cc |
and,signaling |
| R124 |
T281 |
T282 |
advmod |
When,regulated |
| R1240 |
T2043 |
T2042 |
amod |
early,stage |
| R1241 |
T2145 |
T2146 |
compound |
BMP,inhibition |
| R1242 |
T2146 |
T2143 |
conj |
inhibition,signaling |
| R1243 |
T2147 |
T2133 |
punct |
", ",appear |
| R1244 |
T2044 |
T2042 |
prep |
of,stage |
| R1245 |
T2148 |
T2149 |
nmod |
LEF,activation |
| R1246 |
T2149 |
T2133 |
nsubj |
activation,appear |
| R1247 |
T2045 |
T2046 |
compound |
hair,bud |
| R1248 |
T2150 |
T2148 |
punct |
-,LEF |
| R1249 |
T2151 |
T2148 |
nummod |
1,LEF |
| R125 |
T282 |
T290 |
advcl |
regulated,released |
| R1250 |
T2152 |
T2148 |
punct |
/,LEF |
| R1251 |
T2046 |
T2047 |
compound |
bud,formation |
| R1252 |
T2153 |
T2154 |
compound |
β,catenin |
| R1253 |
T2154 |
T2148 |
appos |
catenin,LEF |
| R1254 |
T2155 |
T2154 |
punct |
-,catenin |
| R1255 |
T2047 |
T2044 |
pobj |
formation,of |
| R1256 |
T2156 |
T2133 |
aux |
does,appear |
| R1257 |
T2157 |
T2133 |
neg |
not,appear |
| R1258 |
T2158 |
T2159 |
aux |
to,induce |
| R1259 |
T2159 |
T2133 |
xcomp |
induce,appear |
| R126 |
T283 |
T284 |
compound |
E,cadherin |
| R1260 |
T2160 |
T2161 |
compound |
Snail,expression |
| R1261 |
T2161 |
T2159 |
dobj |
expression,induce |
| R1262 |
T2162 |
T2161 |
compound |
gene,expression |
| R1263 |
T2048 |
T2042 |
punct |
", ",stage |
| R1264 |
T2163 |
T2159 |
prep |
in,induce |
| R1265 |
T2164 |
T2165 |
amod |
embryonic,keratinocytes |
| R1266 |
T2165 |
T2163 |
pobj |
keratinocytes,in |
| R1267 |
T2166 |
T2165 |
compound |
skin,keratinocytes |
| R1268 |
T2049 |
T2050 |
advmod |
when,take |
| R1269 |
T2167 |
T2133 |
punct |
.,appear |
| R127 |
T284 |
T282 |
nsubjpass |
cadherin,regulated |
| R1270 |
T2050 |
T2042 |
relcl |
take,stage |
| R1271 |
T2169 |
T2170 |
prep |
In,provide |
| R1272 |
T2171 |
T2169 |
pobj |
contrast,In |
| R1273 |
T2051 |
T2052 |
compound |
E,cadherin |
| R1274 |
T2172 |
T2170 |
punct |
", ",provide |
| R1275 |
T2173 |
T2170 |
nsubj |
we,provide |
| R1276 |
T2174 |
T2175 |
advmod |
in,vitro |
| R1277 |
T2052 |
T2050 |
nsubj |
cadherin,take |
| R1278 |
T2175 |
T2176 |
amod |
vitro,evidence |
| R1279 |
T2176 |
T2170 |
dobj |
evidence,provide |
| R128 |
T285 |
T284 |
punct |
-,cadherin |
| R1280 |
T2053 |
T2052 |
punct |
-,cadherin |
| R1281 |
T2177 |
T2175 |
punct |
", ",vitro |
| R1282 |
T2178 |
T2175 |
conj |
transgenic,vitro |
| R1283 |
T2179 |
T2180 |
punct |
(,Tg |
| R1284 |
T2054 |
T2055 |
amod |
down,regulation |
| R1285 |
T2180 |
T2178 |
parataxis |
Tg,transgenic |
| R1286 |
T2181 |
T2180 |
punct |
),Tg |
| R1287 |
T2182 |
T2178 |
punct |
", ",transgenic |
| R1288 |
T2055 |
T2052 |
appos |
regulation,cadherin |
| R1289 |
T2183 |
T2178 |
cc |
and,transgenic |
| R129 |
T286 |
T282 |
auxpass |
is,regulated |
| R1290 |
T2184 |
T2185 |
npadvmod |
gene,targeting |
| R1291 |
T2056 |
T2055 |
punct |
-,regulation |
| R1292 |
T2185 |
T2178 |
conj |
targeting,transgenic |
| R1293 |
T2186 |
T2187 |
aux |
to,show |
| R1294 |
T2057 |
T2055 |
cc |
and,regulation |
| R1295 |
T2187 |
T2170 |
advcl |
show,provide |
| R1296 |
T2188 |
T2189 |
mark |
that,are |
| R1297 |
T2058 |
T2055 |
conj |
activation,regulation |
| R1298 |
T2059 |
T2058 |
prep |
of,activation |
| R1299 |
T2189 |
T2187 |
ccomp |
are,show |
| R13 |
T162 |
T163 |
prep |
In,exchange |
| R130 |
T287 |
T282 |
advmod |
transcriptionally,regulated |
| R1300 |
T2190 |
T2191 |
nmod |
TGF,β2 |
| R1301 |
T2060 |
T2059 |
pobj |
proliferation,of |
| R1302 |
T2191 |
T2193 |
nmod |
β2,signaling |
| R1303 |
T2192 |
T2191 |
punct |
-,β2 |
| R1304 |
T2193 |
T2189 |
nsubj |
signaling,are |
| R1305 |
T2061 |
T2050 |
dobj |
place,take |
| R1306 |
T2194 |
T2191 |
cc |
and,β2 |
| R1307 |
T2195 |
T2196 |
amod |
small,phenotype |
| R1308 |
T2196 |
T2197 |
npadvmod |
phenotype,related |
| R1309 |
T2197 |
T2204 |
amod |
related,protein |
| R131 |
T288 |
T282 |
advmod |
down,regulated |
| R1310 |
T2198 |
T2196 |
punct |
–,phenotype |
| R1311 |
T2199 |
T2196 |
cc |
and,phenotype |
| R1312 |
T2062 |
T2029 |
punct |
.,discovered |
| R1313 |
T2200 |
T2196 |
conj |
mothers,phenotype |
| R1314 |
T2201 |
T2200 |
prep |
against,mothers |
| R1315 |
T2202 |
T2201 |
pobj |
decapentaplegic,against |
| R1316 |
T2064 |
T2065 |
advmod |
Thereafter,disappears |
| R1317 |
T2066 |
T2065 |
punct |
", ",disappears |
| R1318 |
T2203 |
T2197 |
punct |
–,related |
| R1319 |
T2204 |
T2191 |
conj |
protein,β2 |
| R132 |
T289 |
T282 |
punct |
-,regulated |
| R1320 |
T2067 |
T2065 |
nsubj |
Snail,disappears |
| R1321 |
T2205 |
T2204 |
nummod |
2,protein |
| R1322 |
T2206 |
T2204 |
punct |
(,protein |
| R1323 |
T2207 |
T2204 |
appos |
SMAD2,protein |
| R1324 |
T2068 |
T2065 |
cc |
and,disappears |
| R1325 |
T2208 |
T2193 |
punct |
),signaling |
| R1326 |
T2209 |
T2210 |
amod |
upstream,inducers |
| R1327 |
T2069 |
T2065 |
conj |
remains,disappears |
| R1328 |
T2210 |
T2189 |
attr |
inducers,are |
| R1329 |
T2211 |
T2210 |
prep |
of,inducers |
| R133 |
T291 |
T290 |
punct |
", ",released |
| R1330 |
T2212 |
T2213 |
compound |
Snail,expression |
| R1331 |
T2070 |
T2069 |
acomp |
absent,remains |
| R1332 |
T2213 |
T2211 |
pobj |
expression,of |
| R1333 |
T2214 |
T2213 |
compound |
gene,expression |
| R1334 |
T2071 |
T2069 |
prep |
during,remains |
| R1335 |
T2215 |
T2189 |
prep |
in,are |
| R1336 |
T2216 |
T2217 |
compound |
skin,epithelium |
| R1337 |
T2072 |
T2073 |
amod |
subsequent,growth |
| R1338 |
T2217 |
T2215 |
pobj |
epithelium,in |
| R1339 |
T2218 |
T2170 |
punct |
.,provide |
| R134 |
T292 |
T293 |
amod |
associated,proteins |
| R1340 |
T2073 |
T2071 |
pobj |
growth,during |
| R1341 |
T2220 |
T2221 |
prep |
In,form |
| R1342 |
T2074 |
T2073 |
nmod |
follicle,growth |
| R1343 |
T2222 |
T2223 |
det |
the,absence |
| R1344 |
T2223 |
T2220 |
pobj |
absence,In |
| R1345 |
T2075 |
T2073 |
amod |
down,growth |
| R1346 |
T2224 |
T2223 |
prep |
of,absence |
| R1347 |
T2225 |
T2226 |
compound |
TGF,β2 |
| R1348 |
T2226 |
T2228 |
compound |
β2,signaling |
| R1349 |
T2076 |
T2073 |
punct |
-,growth |
| R135 |
T293 |
T290 |
nsubjpass |
proteins,released |
| R1350 |
T2227 |
T2226 |
punct |
-,β2 |
| R1351 |
T2077 |
T2073 |
cc |
and,growth |
| R1352 |
T2228 |
T2224 |
pobj |
signaling,of |
| R1353 |
T2229 |
T2228 |
cc |
and,signaling |
| R1354 |
T2230 |
T2231 |
compound |
Snail,expression |
| R1355 |
T2078 |
T2073 |
conj |
maturation,growth |
| R1356 |
T2231 |
T2228 |
conj |
expression,signaling |
| R1357 |
T2232 |
T2231 |
compound |
gene,expression |
| R1358 |
T2079 |
T2065 |
punct |
.,disappears |
| R1359 |
T2233 |
T2221 |
punct |
", ",form |
| R136 |
T294 |
T293 |
compound |
adhesion,proteins |
| R1360 |
T2234 |
T2235 |
compound |
hair,placodes |
| R1361 |
T2235 |
T2221 |
nsubj |
placodes,form |
| R1362 |
T2236 |
T2221 |
aux |
can,form |
| R1363 |
T2237 |
T2221 |
punct |
", ",form |
| R1364 |
T2238 |
T2221 |
cc |
but,form |
| R1365 |
T2081 |
T2082 |
det |
This,pattern |
| R1366 |
T2239 |
T2240 |
amod |
further,growth |
| R1367 |
T2240 |
T2244 |
nsubjpass |
growth,blocked |
| R1368 |
T2241 |
T2240 |
nmod |
follicle,growth |
| R1369 |
T2242 |
T2240 |
amod |
down,growth |
| R137 |
T295 |
T293 |
prep |
with,proteins |
| R1370 |
T2082 |
T2084 |
nsubj |
pattern,appears |
| R1371 |
T2243 |
T2240 |
punct |
-,growth |
| R1372 |
T2244 |
T2221 |
conj |
blocked,form |
| R1373 |
T2245 |
T2244 |
auxpass |
is,blocked |
| R1374 |
T2083 |
T2082 |
amod |
exquisite,pattern |
| R1375 |
T2246 |
T2221 |
punct |
.,form |
| R1376 |
T2085 |
T2086 |
aux |
to,be |
| R1377 |
T2248 |
T2249 |
poss |
Our,studies |
| R1378 |
T2249 |
T2250 |
nsubj |
studies,point |
| R1379 |
T2251 |
T2250 |
prep |
to,point |
| R138 |
T296 |
T297 |
amod |
dual,functions |
| R1380 |
T2086 |
T2084 |
xcomp |
be,appears |
| R1381 |
T2252 |
T2253 |
det |
the,view |
| R1382 |
T2253 |
T2251 |
pobj |
view,to |
| R1383 |
T2087 |
T2088 |
advmod |
functionally,relevant |
| R1384 |
T2254 |
T2255 |
mark |
that,functions |
| R1385 |
T2255 |
T2253 |
acl |
functions,view |
| R1386 |
T2256 |
T2255 |
nsubj |
Snail,functions |
| R1387 |
T2088 |
T2086 |
acomp |
relevant,be |
| R1388 |
T2257 |
T2255 |
advmod |
likely,functions |
| R1389 |
T2258 |
T2255 |
advmod |
downstream,functions |
| R139 |
T297 |
T295 |
pobj |
functions,with |
| R1390 |
T2259 |
T2258 |
prep |
of,downstream |
| R1391 |
T2089 |
T2090 |
mark |
since,affects |
| R1392 |
T2260 |
T2261 |
compound |
cell,fate |
| R1393 |
T2261 |
T2262 |
compound |
fate,specification |
| R1394 |
T2090 |
T2086 |
advcl |
affects,be |
| R1395 |
T2262 |
T2259 |
pobj |
specification,of |
| R1396 |
T2263 |
T2250 |
punct |
", ",point |
| R1397 |
T2264 |
T2250 |
prep |
at,point |
| R1398 |
T2091 |
T2090 |
csubj |
altering,affects |
| R1399 |
T2265 |
T2266 |
det |
a,stage |
| R14 |
T164 |
T165 |
det |
a,theme |
| R140 |
T298 |
T297 |
prep |
in,functions |
| R1400 |
T2266 |
T2264 |
pobj |
stage,at |
| R1401 |
T2092 |
T2091 |
dobj |
it,altering |
| R1402 |
T2267 |
T2268 |
advmod |
where,begins |
| R1403 |
T2268 |
T2266 |
relcl |
begins,stage |
| R1404 |
T2093 |
T2094 |
advmod |
in,vivo |
| R1405 |
T2269 |
T2270 |
det |
the,bud |
| R1406 |
T2270 |
T2268 |
nsubj |
bud,begins |
| R1407 |
T2094 |
T2091 |
advmod |
vivo,altering |
| R1408 |
T2271 |
T2272 |
aux |
to,exhibit |
| R1409 |
T2272 |
T2268 |
xcomp |
exhibit,begins |
| R141 |
T299 |
T298 |
pobj |
signaling,in |
| R1410 |
T2273 |
T2274 |
amod |
enhanced,proliferation |
| R1411 |
T2095 |
T2090 |
advmod |
correspondingly,affects |
| R1412 |
T2274 |
T2272 |
dobj |
proliferation,exhibit |
| R1413 |
T2275 |
T2274 |
cc |
and,proliferation |
| R1414 |
T2276 |
T2274 |
conj |
migration,proliferation |
| R1415 |
T2277 |
T2250 |
punct |
.,point |
| R1416 |
T2096 |
T2090 |
dobj |
features,affects |
| R142 |
T300 |
T290 |
auxpass |
are,released |
| R143 |
T301 |
T290 |
prep |
from,released |
| R1433 |
T2702 |
T2703 |
compound |
Snail,mRNA |
| R1434 |
T2703 |
T2704 |
nsubjpass |
mRNA,Expressed |
| R1435 |
T2705 |
T2703 |
cc |
and,mRNA |
| R1436 |
T2706 |
T2703 |
conj |
Protein,mRNA |
| R1437 |
T2707 |
T2704 |
auxpass |
Are,Expressed |
| R1438 |
T2708 |
T2704 |
advmod |
Transiently,Expressed |
| R1439 |
T2709 |
T2704 |
prep |
at,Expressed |
| R144 |
T302 |
T303 |
compound |
cell,cell |
| R1440 |
T2710 |
T2711 |
det |
the,Stage |
| R1441 |
T2711 |
T2709 |
pobj |
Stage,at |
| R1442 |
T2712 |
T2713 |
compound |
Hair,Bud |
| R1443 |
T2713 |
T2711 |
compound |
Bud,Stage |
| R1444 |
T2714 |
T2711 |
prep |
of,Stage |
| R1445 |
T2715 |
T2716 |
compound |
Follicle,Morphogenesis |
| R1446 |
T2716 |
T2714 |
pobj |
Morphogenesis,of |
| R1447 |
T2718 |
T2719 |
mark |
Although,associated |
| R1448 |
T2719 |
T2726 |
advcl |
associated,participate |
| R1449 |
T2720 |
T2721 |
compound |
Snail,members |
| R145 |
T303 |
T305 |
compound |
cell,contacts |
| R1450 |
T2721 |
T2719 |
nsubjpass |
members,associated |
| R1451 |
T2722 |
T2721 |
compound |
family,members |
| R1452 |
T2723 |
T2719 |
auxpass |
are,associated |
| R1453 |
T2724 |
T2725 |
advmod |
most,frequently |
| R1454 |
T2725 |
T2719 |
advmod |
frequently,associated |
| R1455 |
T2727 |
T2719 |
prep |
with,associated |
| R1456 |
T2728 |
T2727 |
pobj |
EMTs,with |
| R1457 |
T2729 |
T2726 |
punct |
", ",participate |
| R1458 |
T2730 |
T2726 |
nsubj |
they,participate |
| R1459 |
T2731 |
T2726 |
advmod |
also,participate |
| R146 |
T304 |
T303 |
punct |
-,cell |
| R1460 |
T2732 |
T2726 |
prep |
in,participate |
| R1461 |
T2733 |
T2734 |
amod |
many,processes |
| R1462 |
T2734 |
T2732 |
pobj |
processes,in |
| R1463 |
T2735 |
T2734 |
amod |
malignant,processes |
| R1464 |
T2736 |
T2734 |
acl |
involving,processes |
| R1465 |
T2737 |
T2738 |
det |
a,regulation |
| R1466 |
T2738 |
T2736 |
dobj |
regulation,involving |
| R1467 |
T2739 |
T2738 |
amod |
down,regulation |
| R1468 |
T2740 |
T2738 |
punct |
-,regulation |
| R1469 |
T2741 |
T2738 |
cc |
but,regulation |
| R147 |
T305 |
T301 |
pobj |
contacts,from |
| R1470 |
T2742 |
T2741 |
neg |
not,but |
| R1471 |
T2743 |
T2744 |
det |
a,abrogation |
| R1472 |
T2744 |
T2738 |
conj |
abrogation,regulation |
| R1473 |
T2745 |
T2744 |
amod |
quantitative,abrogation |
| R1474 |
T2746 |
T2738 |
prep |
of,regulation |
| R1475 |
T2747 |
T2748 |
amod |
intercellular,junctions |
| R1476 |
T2748 |
T2746 |
pobj |
junctions,of |
| R1477 |
T2749 |
T2750 |
punct |
[,18 |
| R1478 |
T2750 |
T2726 |
parataxis |
18,participate |
| R1479 |
T2751 |
T2750 |
punct |
],18 |
| R148 |
T306 |
T290 |
punct |
", ",released |
| R1480 |
T2752 |
T2726 |
punct |
.,participate |
| R1481 |
T2754 |
T2755 |
det |
The,range |
| R1482 |
T2755 |
T2756 |
nsubj |
range,includes |
| R1483 |
T2757 |
T2755 |
prep |
of,range |
| R1484 |
T2758 |
T2759 |
amod |
developmental,processes |
| R1485 |
T2759 |
T2757 |
pobj |
processes,of |
| R1486 |
T2760 |
T2761 |
prep |
in,implicated |
| R1487 |
T2761 |
T2759 |
relcl |
implicated,processes |
| R1488 |
T2762 |
T2760 |
pobj |
which,in |
| R1489 |
T2763 |
T2764 |
compound |
Snail,members |
| R149 |
T307 |
T308 |
det |
a,process |
| R1490 |
T2764 |
T2761 |
nsubjpass |
members,implicated |
| R1491 |
T2765 |
T2764 |
compound |
family,members |
| R1492 |
T2766 |
T2761 |
aux |
have,implicated |
| R1493 |
T2767 |
T2761 |
auxpass |
been,implicated |
| R1494 |
T2768 |
T2756 |
advmod |
thus,includes |
| R1495 |
T2769 |
T2770 |
det |
the,type |
| R1496 |
T2770 |
T2756 |
dobj |
type,includes |
| R1497 |
T2771 |
T2770 |
prep |
of,type |
| R1498 |
T2772 |
T2773 |
amod |
epithelial,remodeling |
| R1499 |
T2773 |
T2771 |
pobj |
remodeling,of |
| R15 |
T165 |
T162 |
pobj |
theme,In |
| R150 |
T308 |
T290 |
npadvmod |
process,released |
| R1500 |
T2774 |
T2775 |
dep |
that,observed |
| R1501 |
T2775 |
T2770 |
relcl |
observed,type |
| R1502 |
T2776 |
T2775 |
auxpass |
is,observed |
| R1503 |
T2777 |
T2775 |
prep |
in,observed |
| R1504 |
T2778 |
T2779 |
compound |
hair,follicle |
| R1505 |
T2779 |
T2780 |
compound |
follicle,bud |
| R1506 |
T2780 |
T2781 |
compound |
bud,formation |
| R1507 |
T2781 |
T2777 |
pobj |
formation,in |
| R1508 |
T2782 |
T2756 |
punct |
.,includes |
| R1509 |
T2784 |
T2785 |
prep |
Given,turned |
| R151 |
T309 |
T310 |
dep |
which,demonstrate |
| R1510 |
T2786 |
T2787 |
poss |
our,observation |
| R1511 |
T2787 |
T2784 |
pobj |
observation,Given |
| R1512 |
T2788 |
T2787 |
amod |
prior,observation |
| R1513 |
T2789 |
T2790 |
mark |
that,participate |
| R1514 |
T2790 |
T2787 |
acl |
participate,observation |
| R1515 |
T2791 |
T2792 |
advmod |
exogenously,added |
| R1516 |
T2792 |
T2793 |
amod |
added,Snail |
| R1517 |
T2793 |
T2790 |
nsubj |
Snail,participate |
| R1518 |
T2794 |
T2790 |
aux |
can,participate |
| R1519 |
T2795 |
T2790 |
prep |
with,participate |
| R152 |
T310 |
T308 |
relcl |
demonstrate,process |
| R1520 |
T2796 |
T2795 |
pobj |
LEF,with |
| R1521 |
T2797 |
T2796 |
punct |
-,LEF |
| R1522 |
T2798 |
T2796 |
nummod |
1,LEF |
| R1523 |
T2799 |
T2796 |
punct |
/,LEF |
| R1524 |
T2800 |
T2801 |
compound |
β,catenin |
| R1525 |
T2801 |
T2796 |
appos |
catenin,LEF |
| R1526 |
T2802 |
T2801 |
punct |
-,catenin |
| R1527 |
T2803 |
T2790 |
prep |
in,participate |
| R1528 |
T2804 |
T2805 |
advmod |
down,regulating |
| R1529 |
T2805 |
T2803 |
pcomp |
regulating,in |
| R153 |
T311 |
T310 |
nsubj |
we,demonstrate |
| R1530 |
T2806 |
T2805 |
punct |
-,regulating |
| R1531 |
T2807 |
T2808 |
compound |
E,cadherin |
| R1532 |
T2808 |
T2810 |
compound |
cadherin,expression |
| R1533 |
T2809 |
T2808 |
punct |
-,cadherin |
| R1534 |
T2810 |
T2805 |
dobj |
expression,regulating |
| R1535 |
T2811 |
T2790 |
prep |
in,participate |
| R1536 |
T2812 |
T2811 |
pobj |
keratinocytes,in |
| R1537 |
T2813 |
T2814 |
punct |
[,4 |
| R1538 |
T2814 |
T2790 |
parataxis |
4,participate |
| R1539 |
T2815 |
T2814 |
punct |
],4 |
| R154 |
T312 |
T310 |
advcl |
leads,demonstrate |
| R1540 |
T2816 |
T2787 |
punct |
", ",observation |
| R1541 |
T2817 |
T2787 |
acl |
coupled,observation |
| R1542 |
T2818 |
T2817 |
prep |
with,coupled |
| R1543 |
T2819 |
T2820 |
det |
the,requirement |
| R1544 |
T2820 |
T2818 |
pobj |
requirement,with |
| R1545 |
T2821 |
T2820 |
amod |
established,requirement |
| R1546 |
T2822 |
T2820 |
prep |
for,requirement |
| R1547 |
T2823 |
T2822 |
pobj |
LEF,for |
| R1548 |
T2824 |
T2823 |
punct |
-,LEF |
| R1549 |
T2825 |
T2823 |
nummod |
1,LEF |
| R155 |
T313 |
T312 |
prep |
to,leads |
| R1550 |
T2826 |
T2823 |
punct |
/,LEF |
| R1551 |
T2827 |
T2828 |
compound |
β,catenin |
| R1552 |
T2828 |
T2823 |
appos |
catenin,LEF |
| R1553 |
T2829 |
T2828 |
punct |
-,catenin |
| R1554 |
T2830 |
T2820 |
prep |
in,requirement |
| R1555 |
T2831 |
T2832 |
compound |
hair,follicle |
| R1556 |
T2832 |
T2833 |
compound |
follicle,morphogenesis |
| R1557 |
T2833 |
T2830 |
pobj |
morphogenesis,in |
| R1558 |
T2834 |
T2835 |
punct |
[,19 |
| R1559 |
T2835 |
T2817 |
parataxis |
19,coupled |
| R156 |
T314 |
T315 |
compound |
Ras,MAPK |
| R1560 |
T2836 |
T2835 |
nummod |
4,19 |
| R1561 |
T2837 |
T2835 |
punct |
",",19 |
| R1562 |
T2838 |
T2835 |
punct |
],19 |
| R1563 |
T2839 |
T2785 |
punct |
", ",turned |
| R1564 |
T2840 |
T2785 |
nsubj |
we,turned |
| R1565 |
T2841 |
T2785 |
prep |
to,turned |
| R1566 |
T2842 |
T2841 |
pcomp |
addressing,to |
| R1567 |
T2843 |
T2844 |
mark |
whether,participate |
| R1568 |
T2844 |
T2842 |
ccomp |
participate,addressing |
| R1569 |
T2845 |
T2846 |
compound |
Snail,Slug |
| R157 |
T315 |
T317 |
compound |
MAPK,activation |
| R1570 |
T2846 |
T2848 |
compound |
Slug,members |
| R1571 |
T2847 |
T2846 |
punct |
/,Slug |
| R1572 |
T2848 |
T2844 |
nsubj |
members,participate |
| R1573 |
T2849 |
T2848 |
compound |
family,members |
| R1574 |
T2850 |
T2844 |
aux |
might,participate |
| R1575 |
T2851 |
T2844 |
advmod |
also,participate |
| R1576 |
T2852 |
T2844 |
prep |
in,participate |
| R1577 |
T2853 |
T2854 |
det |
the,process |
| R1578 |
T2854 |
T2852 |
pobj |
process,in |
| R1579 |
T2855 |
T2785 |
punct |
.,turned |
| R158 |
T316 |
T315 |
punct |
-,MAPK |
| R1580 |
T2857 |
T2858 |
compound |
PCR,analyses |
| R1581 |
T2858 |
T2859 |
nsubj |
analyses,identified |
| R1582 |
T2860 |
T2861 |
amod |
transient,expression |
| R1583 |
T2861 |
T2859 |
dobj |
expression,identified |
| R1584 |
T2862 |
T2861 |
compound |
Snail,expression |
| R1585 |
T2863 |
T2861 |
compound |
mRNA,expression |
| R1586 |
T2864 |
T2859 |
prep |
during,identified |
| R1587 |
T2865 |
T2866 |
det |
a,period |
| R1588 |
T2866 |
T2864 |
pobj |
period,during |
| R1589 |
T2867 |
T2866 |
prep |
of,period |
| R159 |
T317 |
T313 |
pobj |
activation,to |
| R1590 |
T2868 |
T2869 |
compound |
skin,embryogenesis |
| R1591 |
T2869 |
T2867 |
pobj |
embryogenesis,of |
| R1592 |
T2870 |
T2871 |
advmod |
when,forming |
| R1593 |
T2871 |
T2866 |
advcl |
forming,period |
| R1594 |
T2872 |
T2871 |
nsubj |
waves,forming |
| R1595 |
T2873 |
T2872 |
prep |
of,waves |
| R1596 |
T2874 |
T2875 |
compound |
hair,follicles |
| R1597 |
T2875 |
T2873 |
pobj |
follicles,of |
| R1598 |
T2876 |
T2871 |
aux |
are,forming |
| R1599 |
T2877 |
T2878 |
punct |
(,data |
| R16 |
T166 |
T165 |
amod |
common,theme |
| R160 |
T318 |
T290 |
punct |
.,released |
| R1600 |
T2878 |
T2859 |
meta |
data,identified |
| R1601 |
T2879 |
T2878 |
amod |
unpublished,data |
| R1602 |
T2880 |
T2878 |
punct |
),data |
| R1603 |
T2881 |
T2859 |
punct |
.,identified |
| R1604 |
T2882 |
T2883 |
aux |
To,pinpoint |
| R1605 |
T2883 |
T2885 |
advcl |
pinpoint,conducted |
| R1606 |
T2886 |
T2883 |
advmod |
specifically,pinpoint |
| R1607 |
T2887 |
T2888 |
advmod |
where,expressed |
| R1608 |
T2888 |
T2883 |
advcl |
expressed,pinpoint |
| R1609 |
T2889 |
T2890 |
compound |
Snail,mRNA |
| R161 |
T320 |
T321 |
det |
These,studies |
| R1610 |
T2890 |
T2888 |
nsubjpass |
mRNA,expressed |
| R1611 |
T2891 |
T2888 |
auxpass |
is,expressed |
| R1612 |
T2892 |
T2888 |
prep |
in,expressed |
| R1613 |
T2893 |
T2894 |
det |
the,skin |
| R1614 |
T2894 |
T2892 |
pobj |
skin,in |
| R1615 |
T2895 |
T2894 |
amod |
developing,skin |
| R1616 |
T2896 |
T2885 |
punct |
", ",conducted |
| R1617 |
T2897 |
T2885 |
nsubj |
we,conducted |
| R1618 |
T2898 |
T2899 |
advmod |
in,situ |
| R1619 |
T2899 |
T2900 |
amod |
situ,hybridization |
| R162 |
T321 |
T322 |
nsubj |
studies,provide |
| R1620 |
T2900 |
T2885 |
dobj |
hybridization,conducted |
| R1621 |
T2901 |
T2885 |
advcl |
using,conducted |
| R1622 |
T2902 |
T2903 |
det |
a,probe |
| R1623 |
T2903 |
T2901 |
dobj |
probe,using |
| R1624 |
T2904 |
T2903 |
compound |
cRNA,probe |
| R1625 |
T2905 |
T2903 |
amod |
unique,probe |
| R1626 |
T2906 |
T2905 |
prep |
to,unique |
| R1627 |
T2907 |
T2908 |
det |
the,region |
| R1628 |
T2908 |
T2906 |
pobj |
region,to |
| R1629 |
T2909 |
T2908 |
nmod |
Snail,region |
| R163 |
T323 |
T322 |
dobj |
insights,provide |
| R1630 |
T2910 |
T2908 |
nummod |
3,region |
| R1631 |
T2911 |
T2910 |
punct |
′,3 |
| R1632 |
T2912 |
T2908 |
amod |
untranslated,region |
| R1633 |
T2913 |
T2908 |
punct |
(,region |
| R1634 |
T2914 |
T2908 |
appos |
UTR,region |
| R1635 |
T2915 |
T2908 |
punct |
),region |
| R1636 |
T2916 |
T2885 |
punct |
.,conducted |
| R1637 |
T2918 |
T2919 |
amod |
Embryonic,day |
| R1638 |
T2919 |
T2920 |
nsubjpass |
day,chosen |
| R1639 |
T2921 |
T2919 |
nummod |
17.5,day |
| R164 |
T324 |
T323 |
prep |
into,insights |
| R1640 |
T2922 |
T2919 |
punct |
(,day |
| R1641 |
T2923 |
T2919 |
appos |
E17.5,day |
| R1642 |
T2924 |
T2920 |
punct |
),chosen |
| R1643 |
T2925 |
T2920 |
auxpass |
was,chosen |
| R1644 |
T2926 |
T2920 |
punct |
", ",chosen |
| R1645 |
T2927 |
T2928 |
mark |
since,enabled |
| R1646 |
T2928 |
T2920 |
advcl |
enabled,chosen |
| R1647 |
T2929 |
T2930 |
det |
the,waves |
| R1648 |
T2930 |
T2928 |
nsubj |
waves,enabled |
| R1649 |
T2931 |
T2930 |
amod |
multiple,waves |
| R165 |
T325 |
T326 |
advmod |
how,stimulated |
| R1650 |
T2932 |
T2930 |
prep |
of,waves |
| R1651 |
T2933 |
T2934 |
compound |
follicle,morphogenesis |
| R1652 |
T2934 |
T2932 |
pobj |
morphogenesis,of |
| R1653 |
T2935 |
T2930 |
acl |
occurring,waves |
| R1654 |
T2936 |
T2935 |
prep |
at,occurring |
| R1655 |
T2937 |
T2938 |
det |
this,time |
| R1656 |
T2938 |
T2936 |
pobj |
time,at |
| R1657 |
T2939 |
T2928 |
dobj |
us,enabled |
| R1658 |
T2940 |
T2941 |
aux |
to,evaluate |
| R1659 |
T2941 |
T2928 |
xcomp |
evaluate,enabled |
| R166 |
T326 |
T324 |
pcomp |
stimulated,into |
| R1660 |
T2942 |
T2943 |
compound |
Snail,expression |
| R1661 |
T2943 |
T2941 |
dobj |
expression,evaluate |
| R1662 |
T2944 |
T2941 |
prep |
at,evaluate |
| R1663 |
T2945 |
T2946 |
amod |
different,stages |
| R1664 |
T2946 |
T2944 |
pobj |
stages,at |
| R1665 |
T2947 |
T2946 |
prep |
of,stages |
| R1666 |
T2948 |
T2949 |
det |
the,process |
| R1667 |
T2949 |
T2947 |
pobj |
process,of |
| R1668 |
T2950 |
T2920 |
punct |
.,chosen |
| R1669 |
T2952 |
T2953 |
mark |
As,shown |
| R167 |
T327 |
T328 |
amod |
multipotent,cells |
| R1670 |
T2953 |
T2954 |
advcl |
shown,detected |
| R1671 |
T2955 |
T2953 |
prep |
in,shown |
| R1672 |
T2956 |
T2957 |
compound |
Figure,1A |
| R1673 |
T2957 |
T2955 |
pobj |
1A,in |
| R1674 |
T2958 |
T2954 |
punct |
", ",detected |
| R1675 |
T2959 |
T2960 |
amod |
specific,hybridization |
| R1676 |
T2960 |
T2954 |
nsubjpass |
hybridization,detected |
| R1677 |
T2961 |
T2954 |
auxpass |
was,detected |
| R1678 |
T2962 |
T2954 |
prep |
within,detected |
| R1679 |
T2963 |
T2964 |
det |
the,epithelium |
| R168 |
T328 |
T326 |
nsubjpass |
cells,stimulated |
| R1680 |
T2964 |
T2962 |
pobj |
epithelium,within |
| R1681 |
T2965 |
T2964 |
prep |
of,epithelium |
| R1682 |
T2966 |
T2967 |
amod |
nascent,buds |
| R1683 |
T2967 |
T2965 |
pobj |
buds,of |
| R1684 |
T2968 |
T2967 |
compound |
hair,buds |
| R1685 |
T2969 |
T2954 |
punct |
.,detected |
| R1686 |
T2971 |
T2972 |
prep |
By,exhibited |
| R1687 |
T2973 |
T2971 |
pobj |
contrast,By |
| R1688 |
T2974 |
T2972 |
punct |
", ",exhibited |
| R1689 |
T2975 |
T2976 |
mark |
as,progressed |
| R169 |
T329 |
T328 |
prep |
within,cells |
| R1690 |
T2976 |
T2972 |
advcl |
progressed,exhibited |
| R1691 |
T2977 |
T2976 |
nsubj |
follicles,progressed |
| R1692 |
T2978 |
T2976 |
advmod |
further,progressed |
| R1693 |
T2979 |
T2976 |
prep |
through,progressed |
| R1694 |
T2980 |
T2981 |
poss |
their,development |
| R1695 |
T2981 |
T2979 |
pobj |
development,through |
| R1696 |
T2982 |
T2983 |
punct |
(,stages |
| R1697 |
T2983 |
T2976 |
parataxis |
stages,progressed |
| R1698 |
T2984 |
T2983 |
advmod |
e.g.,stages |
| R1699 |
T2985 |
T2983 |
punct |
", ",stages |
| R17 |
T167 |
T165 |
prep |
of,theme |
| R170 |
T330 |
T331 |
det |
a,sheet |
| R1700 |
T2986 |
T2983 |
nmod |
germ,stages |
| R1701 |
T2987 |
T2986 |
cc |
and,germ |
| R1702 |
T2988 |
T2986 |
conj |
peg,germ |
| R1703 |
T2989 |
T2983 |
punct |
),stages |
| R1704 |
T2990 |
T2972 |
punct |
", ",exhibited |
| R1705 |
T2991 |
T2972 |
nsubj |
they,exhibited |
| R1706 |
T2992 |
T2993 |
det |
no,signs |
| R1707 |
T2993 |
T2972 |
dobj |
signs,exhibited |
| R1708 |
T2994 |
T2993 |
prep |
of,signs |
| R1709 |
T2995 |
T2994 |
pobj |
hybridization,of |
| R171 |
T331 |
T329 |
pobj |
sheet,within |
| R1710 |
T2996 |
T2997 |
punct |
(,1A |
| R1711 |
T2997 |
T2972 |
parataxis |
1A,exhibited |
| R1712 |
T2998 |
T2997 |
compound |
Figure,1A |
| R1713 |
T2999 |
T2997 |
punct |
),1A |
| R1714 |
T3000 |
T2972 |
punct |
.,exhibited |
| R1715 |
T3002 |
T3003 |
det |
The,nature |
| R1716 |
T3003 |
T3005 |
nsubj |
nature,was |
| R1717 |
T3004 |
T3003 |
amod |
transient,nature |
| R1718 |
T3006 |
T3003 |
prep |
of,nature |
| R1719 |
T3007 |
T3008 |
compound |
Snail,expression |
| R172 |
T332 |
T326 |
auxpass |
are,stimulated |
| R1720 |
T3008 |
T3006 |
pobj |
expression,of |
| R1721 |
T3009 |
T3008 |
compound |
mRNA,expression |
| R1722 |
T3010 |
T3008 |
prep |
during,expression |
| R1723 |
T3011 |
T3012 |
compound |
follicle,development |
| R1724 |
T3012 |
T3010 |
pobj |
development,during |
| R1725 |
T3013 |
T3014 |
advmod |
most,apparent |
| R1726 |
T3014 |
T3005 |
acomp |
apparent,was |
| R1727 |
T3015 |
T3005 |
prep |
in,was |
| R1728 |
T3016 |
T3017 |
amod |
hybridized,sections |
| R1729 |
T3017 |
T3015 |
pobj |
sections,in |
| R173 |
T333 |
T334 |
aux |
to,undergo |
| R1730 |
T3018 |
T3017 |
compound |
skin,sections |
| R1731 |
T3019 |
T3017 |
acl |
containing,sections |
| R1732 |
T3020 |
T3019 |
dobj |
follicles,containing |
| R1733 |
T3021 |
T3020 |
prep |
from,follicles |
| R1734 |
T3022 |
T3023 |
nummod |
two,waves |
| R1735 |
T3023 |
T3021 |
pobj |
waves,from |
| R1736 |
T3024 |
T3023 |
amod |
different,waves |
| R1737 |
T3025 |
T3023 |
prep |
of,waves |
| R1738 |
T3026 |
T3025 |
pobj |
morphogenesis,of |
| R1739 |
T3027 |
T3028 |
punct |
(,shown |
| R174 |
T334 |
T326 |
advcl |
undergo,stimulated |
| R1740 |
T3028 |
T3005 |
parataxis |
shown,was |
| R1741 |
T3029 |
T3028 |
mark |
as,shown |
| R1742 |
T3030 |
T3028 |
prep |
in,shown |
| R1743 |
T3031 |
T3030 |
pobj |
Figure,in |
| R1744 |
T3032 |
T3031 |
nummod |
1,Figure |
| R1745 |
T3033 |
T3028 |
punct |
),shown |
| R1746 |
T3034 |
T3005 |
punct |
.,was |
| R1747 |
T3036 |
T3037 |
amod |
Hybridizing,buds |
| R1748 |
T3037 |
T3039 |
nsubj |
buds,appeared |
| R1749 |
T3038 |
T3037 |
compound |
hair,buds |
| R175 |
T335 |
T336 |
amod |
transcriptional,changes |
| R1750 |
T3040 |
T3037 |
prep |
from,buds |
| R1751 |
T3041 |
T3042 |
det |
a,wave |
| R1752 |
T3042 |
T3040 |
pobj |
wave,from |
| R1753 |
T3043 |
T3042 |
amod |
later,wave |
| R1754 |
T3044 |
T3039 |
oprd |
juxtaposed,appeared |
| R1755 |
T3045 |
T3044 |
prep |
with,juxtaposed |
| R1756 |
T3046 |
T3047 |
amod |
nonhybridizing,follicles |
| R1757 |
T3047 |
T3045 |
pobj |
follicles,with |
| R1758 |
T3048 |
T3047 |
prep |
from,follicles |
| R1759 |
T3049 |
T3050 |
det |
an,wave |
| R176 |
T336 |
T334 |
dobj |
changes,undergo |
| R1760 |
T3050 |
T3048 |
pobj |
wave,from |
| R1761 |
T3051 |
T3050 |
amod |
earlier,wave |
| R1762 |
T3052 |
T3039 |
punct |
.,appeared |
| R1763 |
T3054 |
T3055 |
aux |
To,determine |
| R1764 |
T3055 |
T3056 |
advcl |
determine,generated |
| R1765 |
T3057 |
T3058 |
mark |
whether,reflected |
| R1766 |
T3058 |
T3055 |
ccomp |
reflected,determine |
| R1767 |
T3059 |
T3060 |
det |
this,nature |
| R1768 |
T3060 |
T3058 |
nsubjpass |
nature,reflected |
| R1769 |
T3061 |
T3060 |
amod |
transient,nature |
| R177 |
T337 |
T338 |
dep |
that,result |
| R1770 |
T3062 |
T3060 |
prep |
of,nature |
| R1771 |
T3063 |
T3064 |
compound |
Snail,expression |
| R1772 |
T3064 |
T3062 |
pobj |
expression,of |
| R1773 |
T3065 |
T3064 |
compound |
mRNA,expression |
| R1774 |
T3066 |
T3058 |
auxpass |
is,reflected |
| R1775 |
T3067 |
T3058 |
prep |
at,reflected |
| R1776 |
T3068 |
T3069 |
det |
the,level |
| R1777 |
T3069 |
T3067 |
pobj |
level,at |
| R1778 |
T3070 |
T3069 |
compound |
protein,level |
| R1779 |
T3071 |
T3056 |
punct |
", ",generated |
| R178 |
T338 |
T336 |
relcl |
result,changes |
| R1780 |
T3072 |
T3056 |
nsubj |
we,generated |
| R1781 |
T3073 |
T3074 |
det |
an,antibody |
| R1782 |
T3074 |
T3056 |
dobj |
antibody,generated |
| R1783 |
T3075 |
T3074 |
prep |
against,antibody |
| R1784 |
T3076 |
T3077 |
det |
the,sequence |
| R1785 |
T3077 |
T3075 |
pobj |
sequence,against |
| R1786 |
T3078 |
T3079 |
npadvmod |
N,terminal |
| R1787 |
T3079 |
T3077 |
amod |
terminal,sequence |
| R1788 |
T3080 |
T3079 |
punct |
-,terminal |
| R1789 |
T3081 |
T3082 |
dep |
that,resides |
| R179 |
T339 |
T338 |
prep |
in,result |
| R1790 |
T3082 |
T3077 |
relcl |
resides,sequence |
| R1791 |
T3083 |
T3082 |
advmod |
upstream,resides |
| R1792 |
T3084 |
T3083 |
prep |
of,upstream |
| R1793 |
T3085 |
T3086 |
det |
the,domains |
| R1794 |
T3086 |
T3084 |
pobj |
domains,of |
| R1795 |
T3087 |
T3088 |
advmod |
more,conserved |
| R1796 |
T3088 |
T3086 |
amod |
conserved,domains |
| R1797 |
T3089 |
T3090 |
compound |
zinc,finger |
| R1798 |
T3090 |
T3086 |
compound |
finger,domains |
| R1799 |
T3091 |
T3056 |
punct |
.,generated |
| R18 |
T168 |
T167 |
pobj |
organogenesis,of |
| R180 |
T340 |
T339 |
pobj |
proliferation,in |
| R1800 |
T3093 |
T3094 |
mark |
As,judged |
| R1801 |
T3094 |
T3095 |
advcl |
judged,detect |
| R1802 |
T3096 |
T3094 |
prep |
by,judged |
| R1803 |
T3097 |
T3098 |
compound |
Western,blot |
| R1804 |
T3098 |
T3099 |
compound |
blot,analysis |
| R1805 |
T3099 |
T3096 |
pobj |
analysis,by |
| R1806 |
T3100 |
T3095 |
punct |
", ",detect |
| R1807 |
T3101 |
T3102 |
det |
the,antibody |
| R1808 |
T3102 |
T3095 |
nsubj |
antibody,detect |
| R1809 |
T3103 |
T3095 |
aux |
did,detect |
| R181 |
T341 |
T340 |
punct |
", ",proliferation |
| R1810 |
T3104 |
T3095 |
neg |
not,detect |
| R1811 |
T3105 |
T3106 |
amod |
endogenous,proteins |
| R1812 |
T3106 |
T3095 |
dobj |
proteins,detect |
| R1813 |
T3107 |
T3106 |
prep |
from,proteins |
| R1814 |
T3108 |
T3109 |
amod |
cultured,keratinocytes |
| R1815 |
T3109 |
T3107 |
pobj |
keratinocytes,from |
| R1816 |
T3110 |
T3095 |
punct |
", ",detect |
| R1817 |
T3111 |
T3095 |
cc |
but,detect |
| R1818 |
T3112 |
T3113 |
nsubj |
it,yield |
| R1819 |
T3113 |
T3095 |
conj |
yield,detect |
| R182 |
T342 |
T343 |
amod |
junctional,remodeling |
| R1820 |
T3114 |
T3113 |
aux |
did,yield |
| R1821 |
T3115 |
T3116 |
det |
a,band |
| R1822 |
T3116 |
T3113 |
dobj |
band,yield |
| R1823 |
T3117 |
T3116 |
prep |
of,band |
| R1824 |
T3118 |
T3119 |
det |
the,size |
| R1825 |
T3119 |
T3117 |
pobj |
size,of |
| R1826 |
T3120 |
T3119 |
amod |
expected,size |
| R1827 |
T3121 |
T3113 |
prep |
from,yield |
| R1828 |
T3122 |
T3121 |
pobj |
keratinocytes,from |
| R1829 |
T3123 |
T3124 |
advmod |
transiently,expressing |
| R183 |
T343 |
T340 |
conj |
remodeling,proliferation |
| R1830 |
T3124 |
T3122 |
acl |
expressing,keratinocytes |
| R1831 |
T3125 |
T3126 |
det |
a,protein |
| R1832 |
T3126 |
T3124 |
dobj |
protein,expressing |
| R1833 |
T3127 |
T3128 |
npadvmod |
hemagglutinin,tagged |
| R1834 |
T3128 |
T3126 |
amod |
tagged,protein |
| R1835 |
T3129 |
T3127 |
punct |
(,hemagglutinin |
| R1836 |
T3130 |
T3127 |
appos |
HA,hemagglutinin |
| R1837 |
T3131 |
T3128 |
punct |
),tagged |
| R1838 |
T3132 |
T3128 |
punct |
-,tagged |
| R1839 |
T3133 |
T3126 |
compound |
Snail,protein |
| R184 |
T344 |
T343 |
punct |
", ",remodeling |
| R1840 |
T3134 |
T3135 |
punct |
(,1B |
| R1841 |
T3135 |
T3113 |
parataxis |
1B,yield |
| R1842 |
T3136 |
T3135 |
compound |
Figure,1B |
| R1843 |
T3137 |
T3135 |
punct |
),1B |
| R1844 |
T3138 |
T3095 |
punct |
.,detect |
| R1845 |
T3140 |
T3141 |
det |
The,antibody |
| R1846 |
T3141 |
T3142 |
nsubj |
antibody,recognized |
| R1847 |
T3143 |
T3142 |
advmod |
also,recognized |
| R1848 |
T3144 |
T3145 |
det |
a,band |
| R1849 |
T3145 |
T3142 |
dobj |
band,recognized |
| R185 |
T345 |
T343 |
cc |
and,remodeling |
| R1850 |
T3146 |
T3145 |
acl |
corresponding,band |
| R1851 |
T3147 |
T3146 |
prep |
to,corresponding |
| R1852 |
T3148 |
T3149 |
det |
the,size |
| R1853 |
T3149 |
T3147 |
pobj |
size,to |
| R1854 |
T3150 |
T3149 |
prep |
of,size |
| R1855 |
T3151 |
T3152 |
amod |
endogenous,Snail |
| R1856 |
T3152 |
T3150 |
pobj |
Snail,of |
| R1857 |
T3153 |
T3149 |
punct |
(,size |
| R1858 |
T3154 |
T3155 |
advmod |
approximately,28 |
| R1859 |
T3155 |
T3156 |
nummod |
28,kDa |
| R186 |
T346 |
T347 |
compound |
bud,formation |
| R1860 |
T3156 |
T3149 |
appos |
kDa,size |
| R1861 |
T3157 |
T3149 |
punct |
),size |
| R1862 |
T3158 |
T3149 |
prep |
in,size |
| R1863 |
T3159 |
T3158 |
pobj |
lysates,in |
| R1864 |
T3160 |
T3159 |
prep |
from,lysates |
| R1865 |
T3161 |
T3162 |
amod |
embryonic,skin |
| R1866 |
T3162 |
T3160 |
pobj |
skin,from |
| R1867 |
T3163 |
T3162 |
compound |
mouse,skin |
| R1868 |
T3164 |
T3145 |
punct |
", ",band |
| R1869 |
T3165 |
T3166 |
det |
the,appearance |
| R187 |
T347 |
T343 |
conj |
formation,remodeling |
| R1870 |
T3166 |
T3168 |
dep |
appearance,corresponded |
| R1871 |
T3167 |
T3166 |
amod |
temporal,appearance |
| R1872 |
T3168 |
T3145 |
relcl |
corresponded,band |
| R1873 |
T3169 |
T3166 |
prep |
of,appearance |
| R1874 |
T3170 |
T3169 |
pobj |
which,of |
| R1875 |
T3171 |
T3168 |
prep |
to,corresponded |
| R1876 |
T3172 |
T3173 |
det |
the,waves |
| R1877 |
T3173 |
T3171 |
pobj |
waves,to |
| R1878 |
T3174 |
T3173 |
prep |
of,waves |
| R1879 |
T3175 |
T3176 |
compound |
hair,follicle |
| R188 |
T348 |
T322 |
punct |
.,provide |
| R1880 |
T3176 |
T3177 |
compound |
follicle,morphogenesis |
| R1881 |
T3177 |
T3174 |
pobj |
morphogenesis,of |
| R1882 |
T3178 |
T3173 |
prep |
from,waves |
| R1883 |
T3179 |
T3178 |
pobj |
E15.5,from |
| R1884 |
T3180 |
T3178 |
prep |
to,from |
| R1885 |
T3181 |
T3180 |
amod |
newborn,to |
| R1886 |
T3182 |
T3183 |
advmod |
when,formed |
| R1887 |
T3183 |
T3173 |
relcl |
formed,waves |
| R1888 |
T3184 |
T3185 |
quantmod |
over,90 |
| R1889 |
T3185 |
T3186 |
nummod |
90,% |
| R189 |
T350 |
T351 |
det |
This,pathway |
| R1890 |
T3186 |
T3183 |
nsubjpass |
%,formed |
| R1891 |
T3187 |
T3186 |
prep |
of,% |
| R1892 |
T3188 |
T3189 |
det |
the,hair |
| R1893 |
T3189 |
T3187 |
pobj |
hair,of |
| R1894 |
T3190 |
T3189 |
prep |
on,hair |
| R1895 |
T3191 |
T3192 |
det |
the,mouse |
| R1896 |
T3192 |
T3190 |
pobj |
mouse,on |
| R1897 |
T3193 |
T3183 |
auxpass |
is,formed |
| R1898 |
T3194 |
T3195 |
punct |
(,1B |
| R1899 |
T3195 |
T3142 |
parataxis |
1B,recognized |
| R19 |
T169 |
T163 |
punct |
", ",exchange |
| R190 |
T351 |
T354 |
nsubj |
pathway,weaves |
| R1900 |
T3196 |
T3195 |
compound |
Figure,1B |
| R1901 |
T3197 |
T3195 |
punct |
),1B |
| R1902 |
T3198 |
T3142 |
punct |
.,recognized |
| R1903 |
T3200 |
T3201 |
advcl |
Consistent,detect |
| R1904 |
T3202 |
T3200 |
prep |
with,Consistent |
| R1905 |
T3203 |
T3204 |
det |
the,data |
| R1906 |
T3204 |
T3202 |
pobj |
data,with |
| R1907 |
T3205 |
T3206 |
compound |
Western,blot |
| R1908 |
T3206 |
T3204 |
compound |
blot,data |
| R1909 |
T3207 |
T3201 |
punct |
", ",detect |
| R191 |
T352 |
T351 |
amod |
novel,pathway |
| R1910 |
T3208 |
T3209 |
amod |
immunohistochemical,analysis |
| R1911 |
T3209 |
T3201 |
nsubj |
analysis,detect |
| R1912 |
T3210 |
T3201 |
aux |
did,detect |
| R1913 |
T3211 |
T3201 |
neg |
not,detect |
| R1914 |
T3212 |
T3201 |
dobj |
Snail,detect |
| R1915 |
T3213 |
T3201 |
prep |
in,detect |
| R1916 |
T3214 |
T3215 |
amod |
single,layered |
| R1917 |
T3215 |
T3217 |
amod |
layered,epidermis |
| R1918 |
T3216 |
T3215 |
punct |
-,layered |
| R1919 |
T3217 |
T3213 |
pobj |
epidermis,in |
| R192 |
T353 |
T351 |
compound |
signaling,pathway |
| R1920 |
T3218 |
T3217 |
compound |
E13.5,epidermis |
| R1921 |
T3219 |
T3220 |
punct |
(,1C |
| R1922 |
T3220 |
T3217 |
parataxis |
1C,epidermis |
| R1923 |
T3221 |
T3220 |
compound |
Figure,1C |
| R1924 |
T3222 |
T3220 |
punct |
),1C |
| R1925 |
T3223 |
T3213 |
cc |
nor,in |
| R1926 |
T3224 |
T3213 |
conj |
in,in |
| R1927 |
T3225 |
T3226 |
det |
the,placode |
| R1928 |
T3226 |
T3224 |
pobj |
placode,in |
| R1929 |
T3227 |
T3201 |
punct |
", ",detect |
| R193 |
T355 |
T354 |
advmod |
further,weaves |
| R1930 |
T3228 |
T3229 |
dep |
which,is |
| R1931 |
T3229 |
T3201 |
advcl |
is,detect |
| R1932 |
T3230 |
T3231 |
det |
the,sign |
| R1933 |
T3231 |
T3229 |
attr |
sign,is |
| R1934 |
T3232 |
T3231 |
amod |
earliest,sign |
| R1935 |
T3233 |
T3231 |
amod |
morphological,sign |
| R1936 |
T3234 |
T3231 |
prep |
of,sign |
| R1937 |
T3235 |
T3236 |
det |
the,commitment |
| R1938 |
T3236 |
T3234 |
pobj |
commitment,of |
| R1939 |
T3237 |
T3236 |
prep |
of,commitment |
| R194 |
T356 |
T354 |
prt |
together,weaves |
| R1940 |
T3238 |
T3239 |
amod |
multipotent,cells |
| R1941 |
T3239 |
T3237 |
pobj |
cells,of |
| R1942 |
T3240 |
T3239 |
prep |
of,cells |
| R1943 |
T3241 |
T3242 |
det |
the,ectoderm |
| R1944 |
T3242 |
T3240 |
pobj |
ectoderm,of |
| R1945 |
T3243 |
T3242 |
amod |
embryonic,ectoderm |
| R1946 |
T3244 |
T3236 |
prep |
to,commitment |
| R1947 |
T3245 |
T3246 |
det |
a,fate |
| R1948 |
T3246 |
T3244 |
pobj |
fate,to |
| R1949 |
T3247 |
T3248 |
compound |
hair,cell |
| R195 |
T357 |
T358 |
det |
the,web |
| R1950 |
T3248 |
T3246 |
compound |
cell,fate |
| R1951 |
T3249 |
T3250 |
punct |
(,1D |
| R1952 |
T3250 |
T3201 |
parataxis |
1D,detect |
| R1953 |
T3251 |
T3250 |
compound |
Figure,1D |
| R1954 |
T3252 |
T3250 |
punct |
),1D |
| R1955 |
T3253 |
T3201 |
punct |
.,detect |
| R1956 |
T3255 |
T3256 |
advcl |
Consistent,labeled |
| R1957 |
T3257 |
T3255 |
prep |
with,Consistent |
| R1958 |
T3258 |
T3259 |
det |
the,results |
| R1959 |
T3259 |
T3257 |
pobj |
results,with |
| R196 |
T358 |
T354 |
dobj |
web,weaves |
| R1960 |
T3260 |
T3261 |
advmod |
in,situ |
| R1961 |
T3261 |
T3259 |
amod |
situ,results |
| R1962 |
T3262 |
T3259 |
compound |
hybridization,results |
| R1963 |
T3263 |
T3256 |
punct |
", ",labeled |
| R1964 |
T3264 |
T3265 |
amod |
anti-Snail,antibody |
| R1965 |
T3265 |
T3256 |
nsubj |
antibody,labeled |
| R1966 |
T3266 |
T3267 |
advmod |
only,buds |
| R1967 |
T3267 |
T3256 |
dobj |
buds,labeled |
| R1968 |
T3268 |
T3267 |
compound |
hair,buds |
| R1969 |
T3269 |
T3267 |
cc |
and,buds |
| R197 |
T359 |
T358 |
prep |
of,web |
| R1970 |
T3270 |
T3269 |
neg |
not,and |
| R1971 |
T3271 |
T3267 |
conj |
follicles,buds |
| R1972 |
T3272 |
T3256 |
prep |
at,labeled |
| R1973 |
T3273 |
T3274 |
advmod |
more,stages |
| R1974 |
T3274 |
T3272 |
pobj |
stages,at |
| R1975 |
T3275 |
T3274 |
amod |
mature,stages |
| R1976 |
T3276 |
T3274 |
prep |
of,stages |
| R1977 |
T3277 |
T3276 |
pobj |
development,of |
| R1978 |
T3278 |
T3279 |
punct |
(,1E |
| R1979 |
T3279 |
T3256 |
parataxis |
1E,labeled |
| R198 |
T360 |
T361 |
amod |
different,morphogens |
| R1980 |
T3280 |
T3279 |
compound |
Figure,1E |
| R1981 |
T3281 |
T3279 |
punct |
),1E |
| R1982 |
T3282 |
T3256 |
punct |
.,labeled |
| R1983 |
T3284 |
T3285 |
advcl |
Taken,appeared |
| R1984 |
T3286 |
T3284 |
advmod |
together,Taken |
| R1985 |
T3287 |
T3285 |
punct |
", ",appeared |
| R1986 |
T3288 |
T3289 |
det |
the,antibody |
| R1987 |
T3289 |
T3285 |
nsubj |
antibody,appeared |
| R1988 |
T3290 |
T3289 |
amod |
anti-Snail,antibody |
| R1989 |
T3291 |
T3292 |
aux |
to,be |
| R199 |
T361 |
T359 |
pobj |
morphogens,of |
| R1990 |
T3292 |
T3285 |
xcomp |
be,appeared |
| R1991 |
T3293 |
T3292 |
acomp |
specific,be |
| R1992 |
T3294 |
T3293 |
prep |
for,specific |
| R1993 |
T3295 |
T3296 |
poss |
its,protein |
| R1994 |
T3296 |
T3294 |
pobj |
protein,for |
| R1995 |
T3297 |
T3296 |
compound |
target,protein |
| R1996 |
T3298 |
T3285 |
punct |
.,appeared |
| R1997 |
T3300 |
T3301 |
nsubj |
It,detect |
| R1998 |
T3302 |
T3301 |
aux |
did,detect |
| R1999 |
T3303 |
T3301 |
neg |
not,detect |
| R2 |
T149 |
T147 |
compound |
Signaling,Pathway |
| R20 |
T170 |
T171 |
amod |
certain,cells |
| R200 |
T362 |
T361 |
cc |
and,morphogens |
| R2000 |
T3304 |
T3305 |
amod |
other,members |
| R2001 |
T3305 |
T3301 |
dobj |
members,detect |
| R2002 |
T3306 |
T3305 |
compound |
Snail,members |
| R2003 |
T3307 |
T3305 |
compound |
family,members |
| R2004 |
T3308 |
T3305 |
acl |
known,members |
| R2005 |
T3309 |
T3310 |
aux |
to,expressed |
| R2006 |
T3310 |
T3308 |
xcomp |
expressed,known |
| R2007 |
T3311 |
T3310 |
auxpass |
be,expressed |
| R2008 |
T3312 |
T3310 |
prep |
in,expressed |
| R2009 |
T3313 |
T3312 |
pobj |
keratinocytes,in |
| R201 |
T363 |
T364 |
amod |
downstream,events |
| R2010 |
T3314 |
T3313 |
cc |
and,keratinocytes |
| R2011 |
T3315 |
T3314 |
punct |
/,and |
| R2012 |
T3316 |
T3314 |
cc |
or,and |
| R2013 |
T3317 |
T3313 |
conj |
skin,keratinocytes |
| R2014 |
T3318 |
T3319 |
punct |
(,data |
| R2015 |
T3319 |
T3308 |
meta |
data,known |
| R2016 |
T3320 |
T3319 |
amod |
unpublished,data |
| R2017 |
T3321 |
T3319 |
punct |
),data |
| R2018 |
T3322 |
T3301 |
punct |
.,detect |
| R2019 |
T3324 |
T3325 |
advmod |
Furthermore,paralleled |
| R202 |
T364 |
T361 |
conj |
events,morphogens |
| R2020 |
T3326 |
T3325 |
punct |
", ",paralleled |
| R2021 |
T3327 |
T3328 |
det |
the,data |
| R2022 |
T3328 |
T3325 |
nsubj |
data,paralleled |
| R2023 |
T3329 |
T3328 |
amod |
immunohistochemical,data |
| R2024 |
T3330 |
T3331 |
poss |
our,data |
| R2025 |
T3331 |
T3325 |
dobj |
data,paralleled |
| R2026 |
T3332 |
T3333 |
nmod |
Snail,hybridization |
| R2027 |
T3333 |
T3331 |
compound |
hybridization,data |
| R2028 |
T3334 |
T3335 |
advmod |
in,situ |
| R2029 |
T3335 |
T3333 |
amod |
situ,hybridization |
| R203 |
T365 |
T364 |
amod |
transcriptional,events |
| R2030 |
T3336 |
T3325 |
advcl |
revealing,paralleled |
| R2031 |
T3337 |
T3338 |
amod |
transient,expression |
| R2032 |
T3338 |
T3336 |
dobj |
expression,revealing |
| R2033 |
T3339 |
T3338 |
compound |
Snail,expression |
| R2034 |
T3340 |
T3336 |
prep |
at,revealing |
| R2035 |
T3341 |
T3342 |
det |
the,stage |
| R2036 |
T3342 |
T3340 |
pobj |
stage,at |
| R2037 |
T3343 |
T3344 |
compound |
hair,bud |
| R2038 |
T3344 |
T3342 |
compound |
bud,stage |
| R2039 |
T3345 |
T3346 |
punct |
(,1A |
| R204 |
T366 |
T367 |
dep |
that,guide |
| R2040 |
T3346 |
T3325 |
parataxis |
1A,paralleled |
| R2041 |
T3347 |
T3346 |
compound |
Figure,1A |
| R2042 |
T3348 |
T3346 |
punct |
),1A |
| R2043 |
T3349 |
T3325 |
punct |
.,paralleled |
| R2044 |
T3351 |
T3352 |
mark |
As,judged |
| R2045 |
T3352 |
T3353 |
advcl |
judged,localized |
| R2046 |
T3354 |
T3352 |
prep |
by,judged |
| R2047 |
T3355 |
T3354 |
pobj |
immunohistochemistry,by |
| R2048 |
T3356 |
T3353 |
punct |
", ",localized |
| R2049 |
T3357 |
T3358 |
compound |
Snail,protein |
| R205 |
T367 |
T358 |
relcl |
guide,web |
| R2050 |
T3358 |
T3353 |
nsubjpass |
protein,localized |
| R2051 |
T3359 |
T3353 |
auxpass |
was,localized |
| R2052 |
T3360 |
T3353 |
prep |
to,localized |
| R2053 |
T3361 |
T3362 |
det |
the,nuclei |
| R2054 |
T3362 |
T3360 |
pobj |
nuclei,to |
| R2055 |
T3363 |
T3362 |
prep |
of,nuclei |
| R2056 |
T3364 |
T3365 |
det |
the,cells |
| R2057 |
T3365 |
T3363 |
pobj |
cells,of |
| R2058 |
T3366 |
T3367 |
compound |
hair,bud |
| R2059 |
T3367 |
T3365 |
compound |
bud,cells |
| R206 |
T368 |
T369 |
compound |
hair,bud |
| R2060 |
T3368 |
T3369 |
punct |
(,1E |
| R2061 |
T3369 |
T3353 |
parataxis |
1E,localized |
| R2062 |
T3370 |
T3369 |
compound |
Figure,1E |
| R2063 |
T3371 |
T3369 |
punct |
),1E |
| R2064 |
T3372 |
T3353 |
punct |
.,localized |
| R2065 |
T3374 |
T3375 |
det |
This,feature |
| R2066 |
T3375 |
T3376 |
nsubj |
feature,was |
| R2067 |
T3377 |
T3376 |
acomp |
consistent,was |
| R2068 |
T3378 |
T3377 |
prep |
with,consistent |
| R2069 |
T3379 |
T3380 |
poss |
Snail,function |
| R207 |
T369 |
T370 |
compound |
bud,formation |
| R2070 |
T3380 |
T3378 |
pobj |
function,with |
| R2071 |
T3381 |
T3379 |
case |
's,Snail |
| R2072 |
T3382 |
T3380 |
amod |
known,function |
| R2073 |
T3383 |
T3380 |
prep |
as,function |
| R2074 |
T3384 |
T3385 |
det |
a,repressor |
| R2075 |
T3385 |
T3383 |
pobj |
repressor,as |
| R2076 |
T3386 |
T3385 |
amod |
transcriptional,repressor |
| R2077 |
T3387 |
T3388 |
punct |
[,13 |
| R2078 |
T3388 |
T3376 |
parataxis |
13,was |
| R2079 |
T3389 |
T3388 |
nummod |
12,13 |
| R208 |
T370 |
T367 |
dobj |
formation,guide |
| R2080 |
T3390 |
T3388 |
punct |
",",13 |
| R2081 |
T3391 |
T3388 |
punct |
],13 |
| R2082 |
T3392 |
T3376 |
punct |
.,was |
| R2083 |
T3394 |
T3395 |
advmod |
Additionally,detected |
| R2084 |
T3396 |
T3395 |
punct |
", ",detected |
| R2085 |
T3397 |
T3398 |
amod |
anti-Snail,labeling |
| R2086 |
T3398 |
T3395 |
nsubjpass |
labeling,detected |
| R2087 |
T3399 |
T3395 |
auxpass |
was,detected |
| R2088 |
T3400 |
T3395 |
prep |
in,detected |
| R2089 |
T3401 |
T3402 |
advmod |
only,four |
| R209 |
T371 |
T367 |
prep |
within,guide |
| R2090 |
T3402 |
T3406 |
nummod |
four,waves |
| R2091 |
T3403 |
T3402 |
quantmod |
three,four |
| R2092 |
T3404 |
T3402 |
quantmod |
of,four |
| R2093 |
T3405 |
T3402 |
quantmod |
the,four |
| R2094 |
T3406 |
T3400 |
pobj |
waves,in |
| R2095 |
T3407 |
T3406 |
amod |
major,waves |
| R2096 |
T3408 |
T3406 |
prep |
of,waves |
| R2097 |
T3409 |
T3410 |
compound |
follicle,morphogenesis |
| R2098 |
T3410 |
T3408 |
pobj |
morphogenesis,of |
| R2099 |
T3411 |
T3395 |
punct |
.,detected |
| R21 |
T171 |
T163 |
nsubj |
cells,exchange |
| R210 |
T372 |
T373 |
det |
the,skin |
| R2100 |
T3413 |
T3414 |
nsubjpass |
Snail,found |
| R2101 |
T3415 |
T3414 |
auxpass |
was,found |
| R2102 |
T3416 |
T3414 |
neg |
not,found |
| R2103 |
T3417 |
T3414 |
prep |
in,found |
| R2104 |
T3418 |
T3419 |
det |
the,buds |
| R2105 |
T3419 |
T3417 |
pobj |
buds,in |
| R2106 |
T3420 |
T3419 |
prep |
of,buds |
| R2107 |
T3421 |
T3422 |
compound |
guard,hairs |
| R2108 |
T3422 |
T3420 |
pobj |
hairs,of |
| R2109 |
T3423 |
T3424 |
dep |
that,are |
| R211 |
T373 |
T371 |
pobj |
skin,within |
| R2110 |
T3424 |
T3422 |
advcl |
are,hairs |
| R2111 |
T3425 |
T3426 |
det |
the,earliest |
| R2112 |
T3426 |
T3424 |
attr |
earliest,are |
| R2113 |
T3427 |
T3426 |
prep |
of,earliest |
| R2114 |
T3428 |
T3429 |
det |
all,hairs |
| R2115 |
T3429 |
T3427 |
pobj |
hairs,of |
| R2116 |
T3430 |
T3431 |
aux |
to,form |
| R2117 |
T3431 |
T3429 |
advcl |
form,hairs |
| R2118 |
T3432 |
T3433 |
punct |
(,at |
| R2119 |
T3433 |
T3426 |
parataxis |
at,earliest |
| R212 |
T374 |
T373 |
amod |
developing,skin |
| R2120 |
T3434 |
T3433 |
pobj |
E13.5,at |
| R2121 |
T3435 |
T3433 |
punct |
),at |
| R2122 |
T3436 |
T3424 |
punct |
", ",are |
| R2123 |
T3437 |
T3424 |
cc |
and,are |
| R2124 |
T3438 |
T3439 |
dep |
which,constitute |
| R2125 |
T3439 |
T3424 |
conj |
constitute,are |
| R2126 |
T3440 |
T3441 |
amod |
less,5 |
| R2127 |
T3441 |
T3443 |
nummod |
5,% |
| R2128 |
T3442 |
T3441 |
quantmod |
than,5 |
| R2129 |
T3443 |
T3439 |
dobj |
%,constitute |
| R213 |
T375 |
T354 |
punct |
.,weaves |
| R2130 |
T3444 |
T3443 |
prep |
of,% |
| R2131 |
T3445 |
T3446 |
det |
the,coat |
| R2132 |
T3446 |
T3444 |
pobj |
coat,of |
| R2133 |
T3447 |
T3446 |
compound |
mouse,coat |
| R2134 |
T3448 |
T3449 |
punct |
(,data |
| R2135 |
T3449 |
T3414 |
meta |
data,found |
| R2136 |
T3450 |
T3449 |
amod |
unpublished,data |
| R2137 |
T3451 |
T3449 |
punct |
),data |
| R2138 |
T3452 |
T3414 |
punct |
.,found |
| R2139 |
T3454 |
T3455 |
mark |
As,judged |
| R214 |
T146 |
T147 |
det |
A,Pathway |
| R2140 |
T3455 |
T3456 |
advcl |
judged,coincided |
| R2141 |
T3457 |
T3455 |
prep |
by,judged |
| R2142 |
T3458 |
T3457 |
pobj |
immunofluorescence,by |
| R2143 |
T3459 |
T3458 |
prep |
with,immunofluorescence |
| R2144 |
T3460 |
T3459 |
pobj |
antibodies,with |
| R2145 |
T3461 |
T3460 |
prep |
against,antibodies |
| R2146 |
T3462 |
T3463 |
det |
the,antigen |
| R2147 |
T3463 |
T3461 |
pobj |
antigen,against |
| R2148 |
T3464 |
T3463 |
amod |
proliferating,antigen |
| R2149 |
T3465 |
T3463 |
amod |
nuclear,antigen |
| R2150 |
T3466 |
T3463 |
appos |
Ki67,antigen |
| R2151 |
T3467 |
T3456 |
punct |
", ",coincided |
| R2152 |
T3468 |
T3469 |
det |
the,timing |
| R2153 |
T3469 |
T3456 |
nsubj |
timing,coincided |
| R2154 |
T3470 |
T3469 |
prep |
of,timing |
| R2155 |
T3471 |
T3472 |
compound |
Snail,expression |
| R2156 |
T3472 |
T3470 |
pobj |
expression,of |
| R2157 |
T3473 |
T3456 |
prep |
with,coincided |
| R2158 |
T3474 |
T3475 |
det |
the,stage |
| R2159 |
T3475 |
T3473 |
pobj |
stage,with |
| R2160 |
T3476 |
T3477 |
prep |
at,enhanced |
| R2161 |
T3477 |
T3475 |
relcl |
enhanced,stage |
| R2162 |
T3478 |
T3476 |
pobj |
which,at |
| R2163 |
T3479 |
T3480 |
det |
the,follicle |
| R2164 |
T3480 |
T3477 |
nsubj |
follicle,enhanced |
| R2165 |
T3481 |
T3480 |
amod |
developing,follicle |
| R2166 |
T3482 |
T3483 |
poss |
its,proliferation |
| R2167 |
T3483 |
T3477 |
dobj |
proliferation,enhanced |
| R2168 |
T3484 |
T3483 |
cc |
and,proliferation |
| R2169 |
T3485 |
T3486 |
amod |
down,growth |
| R2170 |
T3486 |
T3483 |
conj |
growth,proliferation |
| R2171 |
T3487 |
T3486 |
punct |
-,growth |
| R2172 |
T3488 |
T3489 |
punct |
(,1F |
| R2173 |
T3489 |
T3456 |
parataxis |
1F,coincided |
| R2174 |
T3490 |
T3489 |
compound |
Figure,1F |
| R2175 |
T3491 |
T3489 |
punct |
),1F |
| R2176 |
T3492 |
T3456 |
punct |
.,coincided |
| R2177 |
T3494 |
T3495 |
nsubj |
Immunohistochemistry,marked |
| R2178 |
T3496 |
T3494 |
prep |
with,Immunohistochemistry |
| R2179 |
T3497 |
T3496 |
pobj |
antibodies,with |
| R2180 |
T3498 |
T3497 |
prep |
against,antibodies |
| R2181 |
T3499 |
T3500 |
det |
the,form |
| R2182 |
T3500 |
T3498 |
pobj |
form,against |
| R2183 |
T3501 |
T3500 |
amod |
active,form |
| R2184 |
T3502 |
T3500 |
punct |
(,form |
| R2185 |
T3503 |
T3500 |
amod |
phosphorylated,form |
| R2186 |
T3504 |
T3500 |
punct |
),form |
| R2187 |
T3505 |
T3500 |
prep |
of,form |
| R2188 |
T3506 |
T3505 |
pobj |
MAPK,of |
| R2189 |
T3507 |
T3500 |
punct |
(,form |
| R2190 |
T3508 |
T3500 |
appos |
pMAPK,form |
| R2191 |
T3509 |
T3495 |
punct |
),marked |
| R2192 |
T3510 |
T3511 |
det |
a,subset |
| R2193 |
T3511 |
T3495 |
dobj |
subset,marked |
| R2194 |
T3512 |
T3511 |
prep |
of,subset |
| R2195 |
T3513 |
T3514 |
det |
the,cells |
| R2196 |
T3514 |
T3512 |
pobj |
cells,of |
| R2197 |
T3601 |
T3599 |
punct |
;,1H |
| R2198 |
T3515 |
T3514 |
amod |
proliferating,cells |
| R2199 |
T3602 |
T3599 |
advcl |
see,1H |
| R22 |
T172 |
T171 |
prep |
within,cells |
| R2200 |
T3516 |
T3514 |
punct |
(,cells |
| R2201 |
T3603 |
T3602 |
advmod |
also,see |
| R2202 |
T3604 |
T3602 |
punct |
[,see |
| R2203 |
T3517 |
T3518 |
npadvmod |
Ki67,positive |
| R2204 |
T3605 |
T3602 |
dobj |
4,see |
| R2205 |
T3606 |
T3599 |
punct |
],1H |
| R2206 |
T3607 |
T3599 |
punct |
),1H |
| R2207 |
T3518 |
T3514 |
amod |
positive,cells |
| R2208 |
T3608 |
T3583 |
punct |
.,exhibited |
| R2209 |
T3519 |
T3518 |
punct |
-,positive |
| R2210 |
T3520 |
T3514 |
punct |
),cells |
| R2211 |
T3521 |
T3495 |
punct |
", ",marked |
| R2212 |
T3522 |
T3495 |
cc |
and,marked |
| R2213 |
T3523 |
T3524 |
npadvmod |
pMAPK,positive |
| R2214 |
T3524 |
T3526 |
amod |
positive,cells |
| R2215 |
T3525 |
T3524 |
punct |
-,positive |
| R2216 |
T3526 |
T3527 |
nsubjpass |
cells,enriched |
| R2217 |
T3527 |
T3495 |
conj |
enriched,marked |
| R2218 |
T3528 |
T3527 |
auxpass |
were,enriched |
| R2219 |
T3529 |
T3527 |
prep |
in,enriched |
| R2220 |
T3530 |
T3531 |
det |
the,bud |
| R2221 |
T3531 |
T3529 |
pobj |
bud,in |
| R2222 |
T3532 |
T3531 |
compound |
hair,bud |
| R2223 |
T3533 |
T3534 |
punct |
(,1G |
| R2224 |
T3534 |
T3527 |
parataxis |
1G,enriched |
| R2225 |
T3535 |
T3534 |
compound |
Figure,1G |
| R2226 |
T3536 |
T3534 |
punct |
),1G |
| R2227 |
T3537 |
T3527 |
punct |
.,enriched |
| R2228 |
T3539 |
T3540 |
det |
The,timing |
| R2229 |
T3540 |
T3541 |
nsubj |
timing,appeared |
| R2230 |
T3542 |
T3540 |
prep |
of,timing |
| R2231 |
T3543 |
T3544 |
compound |
Snail,induction |
| R2232 |
T3544 |
T3542 |
pobj |
induction,of |
| R2233 |
T3545 |
T3544 |
cc |
and,induction |
| R2234 |
T3546 |
T3547 |
nmod |
Ki67,enrichment |
| R2235 |
T3547 |
T3544 |
conj |
enrichment,induction |
| R2236 |
T3548 |
T3546 |
cc |
and,Ki67 |
| R2237 |
T3549 |
T3546 |
conj |
pMAPK,Ki67 |
| R2238 |
T3550 |
T3540 |
prep |
in,timing |
| R2239 |
T3551 |
T3552 |
det |
the,bud |
| R2240 |
T3552 |
T3550 |
pobj |
bud,in |
| R2241 |
T3553 |
T3552 |
compound |
hair,bud |
| R2242 |
T3554 |
T3555 |
aux |
to,follow |
| R2243 |
T3555 |
T3541 |
xcomp |
follow,appeared |
| R2244 |
T3556 |
T3555 |
advmod |
closely,follow |
| R2245 |
T3557 |
T3558 |
det |
the,induction |
| R2246 |
T3558 |
T3555 |
dobj |
induction,follow |
| R2247 |
T3559 |
T3558 |
prep |
of,induction |
| R2248 |
T3560 |
T3561 |
nmod |
LEF,activity |
| R2249 |
T3561 |
T3559 |
pobj |
activity,of |
| R2250 |
T3562 |
T3560 |
punct |
-,LEF |
| R2251 |
T3563 |
T3560 |
nummod |
1,LEF |
| R2252 |
T3564 |
T3560 |
punct |
/,LEF |
| R2253 |
T3565 |
T3566 |
compound |
β,catenin |
| R2254 |
T3566 |
T3560 |
appos |
catenin,LEF |
| R2255 |
T3567 |
T3566 |
punct |
-,catenin |
| R2256 |
T3568 |
T3561 |
punct |
", ",activity |
| R2257 |
T3569 |
T3561 |
acl |
known,activity |
| R2258 |
T3570 |
T3571 |
aux |
to,initiate |
| R2259 |
T3571 |
T3569 |
xcomp |
initiate,known |
| R2260 |
T3572 |
T3571 |
prep |
in,initiate |
| R2261 |
T3573 |
T3574 |
det |
the,stage |
| R2262 |
T3574 |
T3572 |
pobj |
stage,in |
| R2263 |
T3575 |
T3576 |
compound |
hair,placode |
| R2264 |
T3576 |
T3574 |
compound |
placode,stage |
| R2265 |
T3577 |
T3578 |
punct |
[,20 |
| R2266 |
T3578 |
T3555 |
parataxis |
20,follow |
| R2267 |
T3579 |
T3578 |
punct |
],20 |
| R2268 |
T3580 |
T3541 |
punct |
.,appeared |
| R2269 |
T3582 |
T3583 |
advmod |
However,exhibited |
| R227 |
T1019 |
T1020 |
amod |
Mammalian,development |
| R2270 |
T3584 |
T3583 |
punct |
", ",exhibited |
| R2271 |
T3585 |
T3583 |
prep |
like,exhibited |
| R2272 |
T3586 |
T3585 |
pobj |
placodes,like |
| R2273 |
T3587 |
T3583 |
punct |
", ",exhibited |
| R2274 |
T3588 |
T3589 |
compound |
hair,buds |
| R2275 |
T3589 |
T3583 |
nsubj |
buds,exhibited |
| R2276 |
T3590 |
T3591 |
amod |
down,regulation |
| R2277 |
T3591 |
T3583 |
dobj |
regulation,exhibited |
| R2278 |
T3592 |
T3591 |
punct |
-,regulation |
| R2279 |
T3593 |
T3591 |
prep |
in,regulation |
| R228 |
T1020 |
T1021 |
nsubj |
development,involves |
| R2280 |
T3594 |
T3595 |
compound |
E,cadherin |
| R2281 |
T3595 |
T3597 |
compound |
cadherin,expression |
| R2282 |
T3596 |
T3595 |
punct |
-,cadherin |
| R2283 |
T3597 |
T3593 |
pobj |
expression,in |
| R2284 |
T3598 |
T3599 |
punct |
(,1H |
| R2285 |
T3599 |
T3583 |
parataxis |
1H,exhibited |
| R2286 |
T3600 |
T3599 |
compound |
Figure,1H |
| R2289 |
T3910 |
T3911 |
amod |
Sustained,Expression |
| R229 |
T1022 |
T1023 |
det |
the,morphogenesis |
| R2290 |
T3911 |
T3912 |
nsubj |
Expression,Results |
| R2291 |
T3913 |
T3911 |
prep |
of,Expression |
| R2292 |
T3914 |
T3913 |
pobj |
Snail,of |
| R2293 |
T3915 |
T3912 |
prep |
in,Results |
| R2294 |
T3916 |
T3917 |
amod |
Epidermal,Hyperproliferation |
| R2295 |
T3917 |
T3915 |
pobj |
Hyperproliferation,in |
| R2296 |
T3918 |
T3917 |
cc |
and,Hyperproliferation |
| R2297 |
T3919 |
T3920 |
compound |
Differentiation,Defects |
| R2298 |
T3920 |
T3917 |
conj |
Defects,Hyperproliferation |
| R2299 |
T3921 |
T3912 |
prep |
in,Results |
| R23 |
T173 |
T174 |
det |
a,sheet |
| R230 |
T1023 |
T1021 |
dobj |
morphogenesis,involves |
| R2300 |
T3922 |
T3923 |
compound |
Tg,Skin |
| R2301 |
T3923 |
T3921 |
pobj |
Skin,in |
| R2302 |
T3924 |
T3923 |
compound |
Mouse,Skin |
| R2303 |
T3926 |
T3927 |
det |
The,spike |
| R2304 |
T3927 |
T3929 |
nsubj |
spike,prompted |
| R2305 |
T3928 |
T3927 |
amod |
striking,spike |
| R2306 |
T3930 |
T3927 |
prep |
of,spike |
| R2307 |
T3931 |
T3932 |
compound |
Snail,expression |
| R2308 |
T3932 |
T3930 |
pobj |
expression,of |
| R2309 |
T3933 |
T3927 |
amod |
coincident,spike |
| R231 |
T1024 |
T1023 |
prep |
of,morphogenesis |
| R2310 |
T3934 |
T3933 |
prep |
with,coincident |
| R2311 |
T3935 |
T3936 |
compound |
hair,bud |
| R2312 |
T3936 |
T3937 |
compound |
bud,formation |
| R2313 |
T3937 |
T3934 |
pobj |
formation,with |
| R2314 |
T3938 |
T3937 |
cc |
and,formation |
| R2315 |
T3939 |
T3940 |
amod |
enhanced,proliferation |
| R2316 |
T3940 |
T3937 |
conj |
proliferation,formation |
| R2317 |
T3941 |
T3929 |
dobj |
us,prompted |
| R2318 |
T3942 |
T3943 |
aux |
to,examine |
| R2319 |
T3943 |
T3929 |
xcomp |
examine,prompted |
| R232 |
T1025 |
T1026 |
amod |
complex,structures |
| R2320 |
T3944 |
T3945 |
det |
the,consequences |
| R2321 |
T3945 |
T3943 |
dobj |
consequences,examine |
| R2322 |
T3946 |
T3945 |
prep |
of,consequences |
| R2323 |
T3947 |
T3948 |
advmod |
ectopically,expressing |
| R2324 |
T3948 |
T3946 |
pcomp |
expressing,of |
| R2325 |
T3949 |
T3948 |
dobj |
Snail,expressing |
| R2326 |
T3950 |
T3948 |
advmod |
elsewhere,expressing |
| R2327 |
T3951 |
T3950 |
prep |
in,elsewhere |
| R2328 |
T3952 |
T3953 |
compound |
mouse,epidermis |
| R2329 |
T3953 |
T3951 |
pobj |
epidermis,in |
| R233 |
T1026 |
T1024 |
pobj |
structures,of |
| R2330 |
T3954 |
T3953 |
compound |
skin,epidermis |
| R2331 |
T3955 |
T3929 |
punct |
.,prompted |
| R2332 |
T3957 |
T3958 |
aux |
To,distinguish |
| R2333 |
T3958 |
T3959 |
advcl |
distinguish,used |
| R2334 |
T3960 |
T3958 |
dobj |
Tg,distinguish |
| R2335 |
T3961 |
T3958 |
prep |
from,distinguish |
| R2336 |
T3962 |
T3963 |
amod |
endogenous,Snail |
| R2337 |
T3963 |
T3961 |
pobj |
Snail,from |
| R2338 |
T3964 |
T3959 |
punct |
", ",used |
| R2339 |
T3965 |
T3959 |
nsubj |
we,used |
| R234 |
T1027 |
T1028 |
advmod |
three,dimensional |
| R2340 |
T3966 |
T3967 |
det |
the,epitope |
| R2341 |
T3967 |
T3959 |
dobj |
epitope,used |
| R2342 |
T3968 |
T3967 |
compound |
HA,epitope |
| R2343 |
T3969 |
T3967 |
punct |
-,epitope |
| R2344 |
T3970 |
T3967 |
punct |
", ",epitope |
| R2345 |
T3971 |
T3967 |
acl |
shown,epitope |
| R2346 |
T3972 |
T3971 |
advmod |
previously,shown |
| R2347 |
T3973 |
T3974 |
neg |
not,alter |
| R2348 |
T3974 |
T3971 |
xcomp |
alter,shown |
| R2349 |
T3975 |
T3974 |
aux |
to,alter |
| R235 |
T1028 |
T1026 |
amod |
dimensional,structures |
| R2350 |
T3976 |
T3977 |
poss |
Snail,activity |
| R2351 |
T3977 |
T3974 |
dobj |
activity,alter |
| R2352 |
T3978 |
T3976 |
case |
's,Snail |
| R2353 |
T3979 |
T3977 |
amod |
transcriptional,activity |
| R2354 |
T3980 |
T3981 |
punct |
[,12 |
| R2355 |
T3981 |
T3959 |
parataxis |
12,used |
| R2356 |
T3982 |
T3981 |
punct |
],12 |
| R2357 |
T3983 |
T3959 |
punct |
.,used |
| R2358 |
T3985 |
T3986 |
prep |
Of,expressed |
| R2359 |
T3987 |
T3988 |
nummod |
20,animals |
| R236 |
T1029 |
T1028 |
punct |
-,dimensional |
| R2360 |
T3988 |
T3985 |
pobj |
animals,Of |
| R2361 |
T3989 |
T3990 |
nmod |
K14,Snail |
| R2362 |
T3990 |
T3988 |
nmod |
Snail,animals |
| R2363 |
T3991 |
T3990 |
punct |
-,Snail |
| R2364 |
T3992 |
T3988 |
punct |
[,animals |
| R2365 |
T3993 |
T3988 |
nmod |
HA,animals |
| R2366 |
T3994 |
T3988 |
punct |
],animals |
| R2367 |
T3995 |
T3988 |
compound |
Tg,animals |
| R2368 |
T3996 |
T3988 |
acl |
generated,animals |
| R2369 |
T3997 |
T3986 |
punct |
", ",expressed |
| R237 |
T1030 |
T1023 |
prep |
from,morphogenesis |
| R2370 |
T3998 |
T3986 |
nsubj |
three,expressed |
| R2371 |
T3999 |
T4000 |
det |
the,transgene |
| R2372 |
T4000 |
T3986 |
dobj |
transgene,expressed |
| R2373 |
T4001 |
T3986 |
cc |
and,expressed |
| R2374 |
T4002 |
T4003 |
nsubj |
all,exhibited |
| R2375 |
T4003 |
T3986 |
conj |
exhibited,expressed |
| R2376 |
T4004 |
T4005 |
amod |
analogous,phenotypes |
| R2377 |
T4005 |
T4003 |
dobj |
phenotypes,exhibited |
| R2378 |
T4006 |
T3986 |
punct |
.,expressed |
| R2379 |
T4008 |
T4009 |
nsubj |
Mice,died |
| R238 |
T1031 |
T1032 |
advmod |
seemingly,uniform |
| R2380 |
T4010 |
T4011 |
dep |
that,integrated |
| R2381 |
T4011 |
T4008 |
relcl |
integrated,Mice |
| R2382 |
T4012 |
T4013 |
det |
the,transgene |
| R2383 |
T4013 |
T4011 |
dobj |
transgene,integrated |
| R2384 |
T4014 |
T4011 |
prep |
at,integrated |
| R2385 |
T4015 |
T4016 |
det |
the,stage |
| R2386 |
T4016 |
T4014 |
pobj |
stage,at |
| R2387 |
T4017 |
T4018 |
amod |
single,cell |
| R2388 |
T4018 |
T4016 |
compound |
cell,stage |
| R2389 |
T4019 |
T4018 |
punct |
-,cell |
| R239 |
T1032 |
T1033 |
amod |
uniform,sheets |
| R2390 |
T4020 |
T4009 |
prep |
at,died |
| R2391 |
T4021 |
T4020 |
cc |
or,at |
| R2392 |
T4022 |
T4023 |
advmod |
shortly,after |
| R2393 |
T4023 |
T4020 |
conj |
after,at |
| R2394 |
T4024 |
T4023 |
pobj |
birth,after |
| R2395 |
T4025 |
T4009 |
punct |
.,died |
| R2396 |
T4027 |
T4028 |
det |
The,mice |
| R2397 |
T4028 |
T4035 |
nsubj |
mice,harbored |
| R2398 |
T4029 |
T4028 |
nummod |
three,mice |
| R2399 |
T4030 |
T4028 |
amod |
surviving,mice |
| R24 |
T174 |
T172 |
pobj |
sheet,within |
| R240 |
T1033 |
T1030 |
pobj |
sheets,from |
| R2400 |
T4031 |
T4032 |
amod |
full,Tg |
| R2401 |
T4032 |
T4028 |
compound |
Tg,mice |
| R2402 |
T4033 |
T4032 |
punct |
-,Tg |
| R2403 |
T4034 |
T4028 |
compound |
founder,mice |
| R2404 |
T4036 |
T4037 |
compound |
transgene,integrations |
| R2405 |
T4037 |
T4035 |
dobj |
integrations,harbored |
| R2406 |
T4038 |
T4039 |
dep |
that,gave |
| R2407 |
T4039 |
T4037 |
relcl |
gave,integrations |
| R2408 |
T4040 |
T4041 |
amod |
stable,transmission |
| R2409 |
T4041 |
T4039 |
dobj |
transmission,gave |
| R241 |
T1034 |
T1033 |
cc |
or,sheets |
| R2410 |
T4042 |
T4041 |
prep |
of,transmission |
| R2411 |
T4043 |
T4044 |
amod |
mosaic,gene |
| R2412 |
T4044 |
T4046 |
compound |
gene,expression |
| R2413 |
T4045 |
T4044 |
compound |
Snail,gene |
| R2414 |
T4046 |
T4042 |
pobj |
expression,of |
| R2415 |
T4047 |
T4039 |
prep |
through,gave |
| R2416 |
T4048 |
T4049 |
det |
the,germline |
| R2417 |
T4049 |
T4047 |
pobj |
germline,through |
| R2418 |
T4050 |
T4035 |
punct |
.,harbored |
| R2419 |
T4052 |
T4053 |
advmod |
Progressively,poor |
| R242 |
T1035 |
T1033 |
conj |
masses,sheets |
| R2420 |
T4053 |
T4054 |
amod |
poor,health |
| R2421 |
T4054 |
T4055 |
nsubj |
health,necessitated |
| R2422 |
T4056 |
T4057 |
nsubj |
our,sacrificing |
| R2423 |
T4057 |
T4055 |
ccomp |
sacrificing,necessitated |
| R2424 |
T4058 |
T4059 |
amod |
most,offspring |
| R2425 |
T4059 |
T4057 |
dobj |
offspring,sacrificing |
| R2426 |
T4060 |
T4059 |
prep |
from,offspring |
| R2427 |
T4061 |
T4062 |
det |
these,lines |
| R2428 |
T4062 |
T4060 |
pobj |
lines,from |
| R2429 |
T4063 |
T4057 |
prep |
within,sacrificing |
| R243 |
T1036 |
T1033 |
prep |
of,sheets |
| R2430 |
T4064 |
T4065 |
det |
a,year |
| R2431 |
T4065 |
T4063 |
pobj |
year,within |
| R2432 |
T4066 |
T4065 |
prep |
of,year |
| R2433 |
T4067 |
T4066 |
pobj |
birth,of |
| R2434 |
T4068 |
T4055 |
punct |
.,necessitated |
| R2435 |
T4070 |
T4071 |
mark |
As,grew |
| R2436 |
T4071 |
T4075 |
advcl |
grew,became |
| R2437 |
T4072 |
T4073 |
compound |
Snail,animals |
| R2438 |
T4073 |
T4071 |
nsubj |
animals,grew |
| R2439 |
T4074 |
T4073 |
compound |
Tg,animals |
| R244 |
T1037 |
T1036 |
pobj |
cells,of |
| R2440 |
T4076 |
T4075 |
punct |
", ",became |
| R2441 |
T4077 |
T4075 |
nsubj |
they,became |
| R2442 |
T4078 |
T4075 |
acomp |
distinguished,became |
| R2443 |
T4079 |
T4078 |
prep |
by,distinguished |
| R2444 |
T4080 |
T4081 |
poss |
their,size |
| R2445 |
T4081 |
T4079 |
pobj |
size,by |
| R2446 |
T4082 |
T4081 |
amod |
small,size |
| R2447 |
T4083 |
T4081 |
punct |
", ",size |
| R2448 |
T4084 |
T4085 |
amod |
short,tails |
| R2449 |
T4085 |
T4081 |
conj |
tails,size |
| R245 |
T1038 |
T1021 |
punct |
.,involves |
| R2450 |
T4086 |
T4085 |
punct |
", ",tails |
| R2451 |
T4087 |
T4085 |
cc |
and,tails |
| R2452 |
T4088 |
T4089 |
amod |
flaky,skin |
| R2453 |
T4089 |
T4085 |
conj |
skin,tails |
| R2454 |
T4090 |
T4091 |
punct |
(,2A |
| R2455 |
T4091 |
T4075 |
parataxis |
2A,became |
| R2456 |
T4092 |
T4091 |
compound |
Figure,2A |
| R2457 |
T4093 |
T4091 |
punct |
),2A |
| R2458 |
T4094 |
T4075 |
punct |
.,became |
| R2459 |
T4096 |
T4097 |
amod |
Histological,analyses |
| R246 |
T1040 |
T1041 |
det |
A,structure |
| R2460 |
T4097 |
T4098 |
nsubj |
analyses,revealed |
| R2461 |
T4099 |
T4097 |
prep |
of,analyses |
| R2462 |
T4100 |
T4101 |
nummod |
3,d |
| R2463 |
T4101 |
T4103 |
npadvmod |
d,old |
| R2464 |
T4102 |
T4101 |
punct |
-,d |
| R2465 |
T4103 |
T4104 |
amod |
old,mice |
| R2466 |
T4104 |
T4099 |
pobj |
mice,of |
| R2467 |
T4105 |
T4106 |
punct |
(,P3 |
| R2468 |
T4106 |
T4103 |
parataxis |
P3,old |
| R2469 |
T4107 |
T4106 |
punct |
),P3 |
| R247 |
T1041 |
T1046 |
nsubj |
structure,initiates |
| R2470 |
T4108 |
T4109 |
compound |
mosaic,patches |
| R2471 |
T4109 |
T4098 |
dobj |
patches,revealed |
| R2472 |
T4110 |
T4109 |
acl |
marked,patches |
| R2473 |
T4111 |
T4110 |
agent |
by,marked |
| R2474 |
T4112 |
T4113 |
amod |
epidermal,thickening |
| R2475 |
T4113 |
T4111 |
pobj |
thickening,by |
| R2476 |
T4114 |
T4115 |
punct |
(,2B |
| R2477 |
T4115 |
T4098 |
parataxis |
2B,revealed |
| R2478 |
T4116 |
T4115 |
compound |
Figure,2B |
| R2479 |
T4117 |
T4115 |
punct |
),2B |
| R248 |
T1042 |
T1041 |
amod |
simple,structure |
| R2480 |
T4118 |
T4098 |
punct |
.,revealed |
| R2481 |
T4120 |
T4121 |
det |
The,morphology |
| R2482 |
T4121 |
T4123 |
nsubjpass |
morphology,reflected |
| R2483 |
T4122 |
T4121 |
compound |
mosaic,morphology |
| R2484 |
T4124 |
T4123 |
auxpass |
was,reflected |
| R2485 |
T4125 |
T4123 |
prep |
at,reflected |
| R2486 |
T4126 |
T4127 |
det |
the,level |
| R2487 |
T4127 |
T4125 |
pobj |
level,at |
| R2488 |
T4128 |
T4127 |
prep |
of,level |
| R2489 |
T4129 |
T4130 |
compound |
Tg,protein |
| R249 |
T1043 |
T1044 |
npadvmod |
bud,like |
| R2490 |
T4130 |
T4128 |
pobj |
protein,of |
| R2491 |
T4131 |
T4130 |
compound |
Snail,protein |
| R2492 |
T4132 |
T4123 |
punct |
", ",reflected |
| R2493 |
T4133 |
T4134 |
mark |
with,expressing |
| R2494 |
T4134 |
T4123 |
advcl |
expressing,reflected |
| R2495 |
T4135 |
T4136 |
advmod |
only,regions |
| R2496 |
T4136 |
T4134 |
nsubj |
regions,expressing |
| R2497 |
T4137 |
T4136 |
det |
the,regions |
| R2498 |
T4138 |
T4136 |
amod |
hyperthickened,regions |
| R2499 |
T4139 |
T4140 |
amod |
nuclear,Snail |
| R25 |
T175 |
T174 |
amod |
multipotent,sheet |
| R250 |
T1044 |
T1041 |
amod |
like,structure |
| R2500 |
T4140 |
T4134 |
dobj |
Snail,expressing |
| R2501 |
T4141 |
T4142 |
npadvmod |
HA,tagged |
| R2502 |
T4142 |
T4140 |
amod |
tagged,Snail |
| R2503 |
T4143 |
T4142 |
punct |
-,tagged |
| R2504 |
T4144 |
T4145 |
punct |
(,2C |
| R2505 |
T4145 |
T4123 |
parataxis |
2C,reflected |
| R2506 |
T4146 |
T4145 |
compound |
Figure,2C |
| R2507 |
T4147 |
T4145 |
punct |
),2C |
| R2508 |
T4148 |
T4123 |
punct |
.,reflected |
| R2509 |
T4150 |
T4151 |
det |
These,areas |
| R251 |
T1045 |
T1044 |
punct |
-,like |
| R2510 |
T4151 |
T4153 |
nsubjpass |
areas,marked |
| R2511 |
T4152 |
T4151 |
amod |
hyperthickened,areas |
| R2512 |
T4154 |
T4153 |
auxpass |
were,marked |
| R2513 |
T4155 |
T4153 |
agent |
by,marked |
| R2514 |
T4156 |
T4157 |
amod |
excessive,proliferation |
| R2515 |
T4157 |
T4155 |
pobj |
proliferation,by |
| R2516 |
T4158 |
T4153 |
punct |
", ",marked |
| R2517 |
T4159 |
T4160 |
mark |
as,revealed |
| R2518 |
T4160 |
T4153 |
advcl |
revealed,marked |
| R2519 |
T4161 |
T4160 |
agent |
by,revealed |
| R252 |
T1047 |
T1048 |
det |
the,formation |
| R2520 |
T4162 |
T4161 |
pobj |
antibodies,by |
| R2521 |
T4163 |
T4162 |
prep |
against,antibodies |
| R2522 |
T4164 |
T4165 |
det |
the,antigen |
| R2523 |
T4165 |
T4163 |
pobj |
antigen,against |
| R2524 |
T4166 |
T4165 |
amod |
proliferating,antigen |
| R2525 |
T4167 |
T4165 |
amod |
nuclear,antigen |
| R2526 |
T4168 |
T4165 |
appos |
Ki67,antigen |
| R2527 |
T4169 |
T4170 |
punct |
(,2D |
| R2528 |
T4170 |
T4153 |
parataxis |
2D,marked |
| R2529 |
T4171 |
T4170 |
compound |
Figure,2D |
| R253 |
T1048 |
T1046 |
dobj |
formation,initiates |
| R2530 |
T4172 |
T4170 |
cc |
and,2D |
| R2531 |
T4173 |
T4170 |
conj |
2E,2D |
| R2532 |
T4174 |
T4170 |
punct |
),2D |
| R2533 |
T4175 |
T4153 |
punct |
.,marked |
| R2534 |
T4177 |
T4178 |
amod |
Activated,cells |
| R2535 |
T4178 |
T4183 |
nsubj |
cells,were |
| R2536 |
T4179 |
T4178 |
punct |
", ",cells |
| R2537 |
T4180 |
T4181 |
npadvmod |
pMAPK,positive |
| R2538 |
T4181 |
T4178 |
amod |
positive,cells |
| R2539 |
T4182 |
T4181 |
punct |
-,positive |
| R254 |
T1049 |
T1048 |
prep |
of,formation |
| R2540 |
T4184 |
T4183 |
advmod |
also,were |
| R2541 |
T4185 |
T4183 |
acomp |
prevalent,were |
| R2542 |
T4186 |
T4183 |
prep |
in,were |
| R2543 |
T4187 |
T4188 |
det |
these,areas |
| R2544 |
T4188 |
T4186 |
pobj |
areas,in |
| R2545 |
T4189 |
T4190 |
punct |
(,2F |
| R2546 |
T4190 |
T4183 |
parataxis |
2F,were |
| R2547 |
T4191 |
T4190 |
compound |
Figure,2F |
| R2548 |
T4192 |
T4190 |
cc |
and,2F |
| R2549 |
T4193 |
T4190 |
conj |
2G,2F |
| R255 |
T1050 |
T1051 |
amod |
many,organs |
| R2550 |
T4194 |
T4190 |
punct |
),2F |
| R2551 |
T4195 |
T4183 |
punct |
", ",were |
| R2552 |
T4196 |
T4197 |
mark |
as,were |
| R2553 |
T4197 |
T4183 |
advcl |
were,were |
| R2554 |
T4198 |
T4197 |
nsubj |
cells,were |
| R2555 |
T4199 |
T4198 |
acl |
expressing,cells |
| R2556 |
T4200 |
T4199 |
dobj |
keratin,expressing |
| R2557 |
T4201 |
T4200 |
nummod |
6,keratin |
| R2558 |
T4202 |
T4200 |
punct |
", ",keratin |
| R2559 |
T4203 |
T4204 |
det |
a,keratin |
| R256 |
T1051 |
T1049 |
pobj |
organs,of |
| R2560 |
T4204 |
T4200 |
appos |
keratin,keratin |
| R2561 |
T4205 |
T4204 |
acl |
induced,keratin |
| R2562 |
T4206 |
T4205 |
prep |
in,induced |
| R2563 |
T4207 |
T4208 |
det |
the,layers |
| R2564 |
T4208 |
T4206 |
pobj |
layers,in |
| R2565 |
T4209 |
T4208 |
amod |
suprabasal,layers |
| R2566 |
T4210 |
T4208 |
prep |
of,layers |
| R2567 |
T4211 |
T4212 |
amod |
hyperproliferative,skin |
| R2568 |
T4212 |
T4210 |
pobj |
skin,of |
| R2569 |
T4213 |
T4214 |
punct |
(,2H |
| R257 |
T1052 |
T1051 |
punct |
", ",organs |
| R2570 |
T4214 |
T4183 |
parataxis |
2H,were |
| R2571 |
T4215 |
T4214 |
compound |
Figure,2H |
| R2572 |
T4216 |
T4214 |
cc |
and,2H |
| R2573 |
T4217 |
T4214 |
conj |
2I,2H |
| R2574 |
T4218 |
T4214 |
punct |
),2H |
| R2575 |
T4219 |
T4183 |
punct |
.,were |
| R2576 |
T4221 |
T4222 |
nsubj |
Expression,block |
| R2577 |
T4223 |
T4221 |
prep |
of,Expression |
| R2578 |
T4224 |
T4225 |
det |
the,transgene |
| R2579 |
T4225 |
T4223 |
pobj |
transgene,of |
| R258 |
T1053 |
T1051 |
prep |
including,organs |
| R2580 |
T4226 |
T4225 |
compound |
Snail,transgene |
| R2581 |
T4227 |
T4222 |
aux |
did,block |
| R2582 |
T4228 |
T4222 |
neg |
not,block |
| R2583 |
T4229 |
T4230 |
amod |
terminal,differentiation |
| R2584 |
T4230 |
T4222 |
dobj |
differentiation,block |
| R2585 |
T4231 |
T4222 |
prep |
in,block |
| R2586 |
T4232 |
T4233 |
det |
the,epidermis |
| R2587 |
T4233 |
T4231 |
pobj |
epidermis,in |
| R2588 |
T4234 |
T4233 |
amod |
hyperproliferative,epidermis |
| R2589 |
T4235 |
T4222 |
punct |
", ",block |
| R259 |
T1054 |
T1053 |
pobj |
lungs,including |
| R2590 |
T4236 |
T4222 |
cc |
but,block |
| R2591 |
T4237 |
T4238 |
nsubj |
it,distorted |
| R2592 |
T4238 |
T4222 |
conj |
distorted,block |
| R2593 |
T4239 |
T4238 |
dobj |
it,distorted |
| R2594 |
T4240 |
T4238 |
advmod |
markedly,distorted |
| R2595 |
T4241 |
T4242 |
punct |
(,3A |
| R2596 |
T4242 |
T4238 |
parataxis |
3A,distorted |
| R2597 |
T4243 |
T4242 |
compound |
Figure,3A |
| R2598 |
T4244 |
T4245 |
punct |
–,3H |
| R2599 |
T4245 |
T4242 |
prep |
3H,3A |
| R26 |
T176 |
T174 |
amod |
epithelial,sheet |
| R260 |
T1055 |
T1054 |
punct |
", ",lungs |
| R2600 |
T4246 |
T4242 |
punct |
),3A |
| R2601 |
T4247 |
T4238 |
punct |
.,distorted |
| R2602 |
T4249 |
T4250 |
advcl |
Typical,led |
| R2603 |
T4251 |
T4249 |
prep |
of,Typical |
| R2604 |
T4252 |
T4253 |
amod |
most,conditions |
| R2605 |
T4253 |
T4251 |
pobj |
conditions,of |
| R2606 |
T4254 |
T4253 |
compound |
hyperproliferating,conditions |
| R2607 |
T4255 |
T4250 |
punct |
", ",led |
| R2608 |
T4256 |
T4257 |
compound |
Snail,expression |
| R2609 |
T4257 |
T4250 |
nsubj |
expression,led |
| R261 |
T1056 |
T1057 |
amod |
spinal,cord |
| R2610 |
T4258 |
T4250 |
prep |
to,led |
| R2611 |
T4259 |
T4260 |
det |
a,expansion |
| R2612 |
T4260 |
T4258 |
pobj |
expansion,to |
| R2613 |
T4261 |
T4260 |
amod |
large,expansion |
| R2614 |
T4262 |
T4250 |
prep |
in,led |
| R2615 |
T4263 |
T4262 |
pobj |
layers,in |
| R2616 |
T4264 |
T4263 |
prep |
with,layers |
| R2617 |
T4265 |
T4266 |
amod |
spinous,morphology |
| R2618 |
T4266 |
T4264 |
pobj |
morphology,with |
| R2619 |
T4267 |
T4265 |
cc |
and,spinous |
| R262 |
T1057 |
T1054 |
conj |
cord,lungs |
| R2620 |
T4268 |
T4265 |
conj |
granular,spinous |
| R2621 |
T4269 |
T4250 |
punct |
.,led |
| R2622 |
T4271 |
T4272 |
advmod |
Additionally,was |
| R2623 |
T4273 |
T4272 |
punct |
", ",was |
| R2624 |
T4274 |
T4272 |
advmod |
however,was |
| R2625 |
T4275 |
T4272 |
punct |
", ",was |
| R2626 |
T4276 |
T4277 |
det |
a,expansion |
| R2627 |
T4277 |
T4272 |
attr |
expansion,was |
| R2628 |
T4278 |
T4277 |
amod |
marked,expansion |
| R2629 |
T4279 |
T4278 |
cc |
and,marked |
| R263 |
T1058 |
T1057 |
punct |
", ",cord |
| R2630 |
T4280 |
T4278 |
conj |
variable,marked |
| R2631 |
T4281 |
T4277 |
prep |
of,expansion |
| R2632 |
T4282 |
T4281 |
pobj |
keratin,of |
| R2633 |
T4283 |
T4282 |
nummod |
5,keratin |
| R2634 |
T4284 |
T4282 |
punct |
(,keratin |
| R2635 |
T4285 |
T4282 |
appos |
K5,keratin |
| R2636 |
T4286 |
T4282 |
punct |
),keratin |
| R2637 |
T4287 |
T4282 |
punct |
", ",keratin |
| R2638 |
T4288 |
T4289 |
advmod |
normally,restricted |
| R2639 |
T4289 |
T4282 |
acl |
restricted,keratin |
| R264 |
T1059 |
T1060 |
amod |
mammary,glands |
| R2640 |
T4290 |
T4289 |
prep |
to,restricted |
| R2641 |
T4291 |
T4292 |
det |
the,layer |
| R2642 |
T4292 |
T4290 |
pobj |
layer,to |
| R2643 |
T4293 |
T4292 |
amod |
innermost,layer |
| R2644 |
T4294 |
T4292 |
amod |
basal,layer |
| R2645 |
T4295 |
T4296 |
punct |
(,see |
| R2646 |
T4296 |
T4272 |
parataxis |
see,was |
| R2647 |
T4297 |
T4296 |
dobj |
Figure,see |
| R2648 |
T4298 |
T4297 |
nummod |
3,Figure |
| R2649 |
T4299 |
T4296 |
punct |
),see |
| R265 |
T1060 |
T1057 |
conj |
glands,cord |
| R2650 |
T4300 |
T4272 |
punct |
.,was |
| R2651 |
T4302 |
T4303 |
mark |
Although,precluded |
| R2652 |
T4303 |
T4318 |
advcl |
precluded,emerged |
| R2653 |
T4304 |
T4305 |
det |
the,failure |
| R2654 |
T4305 |
T4303 |
nsubj |
failure,precluded |
| R2655 |
T4306 |
T4305 |
prep |
of,failure |
| R2656 |
T4307 |
T4308 |
nmod |
Snail,mice |
| R2657 |
T4308 |
T4306 |
pobj |
mice,of |
| R2658 |
T4309 |
T4307 |
punct |
-,Snail |
| R2659 |
T4310 |
T4307 |
amod |
null,Snail |
| R266 |
T1061 |
T1060 |
punct |
", ",glands |
| R2660 |
T4311 |
T4312 |
aux |
to,develop |
| R2661 |
T4312 |
T4305 |
acl |
develop,failure |
| R2662 |
T4313 |
T4314 |
amod |
past,gastrulation |
| R2663 |
T4314 |
T4312 |
dobj |
gastrulation,develop |
| R2664 |
T4315 |
T4316 |
punct |
[,21 |
| R2665 |
T4316 |
T4305 |
parataxis |
21,failure |
| R2666 |
T4317 |
T4316 |
punct |
],21 |
| R2667 |
T4319 |
T4320 |
poss |
our,ability |
| R2668 |
T4320 |
T4303 |
dobj |
ability,precluded |
| R2669 |
T4321 |
T4322 |
aux |
to,study |
| R267 |
T1062 |
T1060 |
cc |
and,glands |
| R2670 |
T4322 |
T4320 |
acl |
study,ability |
| R2671 |
T4323 |
T4324 |
det |
the,loss |
| R2672 |
T4324 |
T4322 |
dobj |
loss,study |
| R2673 |
T4325 |
T4324 |
prep |
of,loss |
| R2674 |
T4326 |
T4327 |
compound |
Snail,function |
| R2675 |
T4327 |
T4325 |
pobj |
function,of |
| R2676 |
T4328 |
T4324 |
prep |
in,loss |
| R2677 |
T4329 |
T4330 |
compound |
skin,development |
| R2678 |
T4330 |
T4328 |
pobj |
development,in |
| R2679 |
T4331 |
T4318 |
punct |
", ",emerged |
| R268 |
T1063 |
T1064 |
compound |
hair,follicles |
| R2680 |
T4332 |
T4333 |
det |
a,correlation |
| R2681 |
T4333 |
T4318 |
nsubj |
correlation,emerged |
| R2682 |
T4334 |
T4333 |
amod |
good,correlation |
| R2683 |
T4335 |
T4318 |
prep |
between,emerged |
| R2684 |
T4336 |
T4337 |
det |
the,expression |
| R2685 |
T4337 |
T4335 |
pobj |
expression,between |
| R2686 |
T4338 |
T4337 |
prep |
of,expression |
| R2687 |
T4339 |
T4340 |
compound |
Snail,protein |
| R2688 |
T4340 |
T4338 |
pobj |
protein,of |
| R2689 |
T4341 |
T4337 |
cc |
and,expression |
| R269 |
T1064 |
T1060 |
conj |
follicles,glands |
| R2690 |
T4342 |
T4343 |
det |
the,extension |
| R2691 |
T4343 |
T4337 |
conj |
extension,expression |
| R2692 |
T4344 |
T4343 |
prep |
of,extension |
| R2693 |
T4345 |
T4344 |
pobj |
K5,of |
| R2694 |
T4346 |
T4345 |
punct |
", ",K5 |
| R2695 |
T4347 |
T4345 |
conj |
Ki67,K5 |
| R2696 |
T4348 |
T4347 |
punct |
", ",Ki67 |
| R2697 |
T4349 |
T4347 |
cc |
and,Ki67 |
| R2698 |
T4350 |
T4347 |
conj |
pMAPK,Ki67 |
| R2699 |
T4351 |
T4343 |
advmod |
suprabasally,extension |
| R27 |
T177 |
T163 |
dobj |
signals,exchange |
| R270 |
T1065 |
T1066 |
punct |
[,1 |
| R2700 |
T4352 |
T4353 |
punct |
(,compare |
| R2701 |
T4353 |
T4318 |
parataxis |
compare,emerged |
| R2702 |
T4354 |
T4353 |
dobj |
data,compare |
| R2703 |
T4355 |
T4353 |
prep |
in,compare |
| R2704 |
T4356 |
T4357 |
nmod |
Figures,2 |
| R2705 |
T4357 |
T4355 |
pobj |
2,in |
| R2706 |
T4358 |
T4357 |
cc |
and,2 |
| R2707 |
T4359 |
T4357 |
conj |
3,2 |
| R2708 |
T4360 |
T4353 |
punct |
),compare |
| R2709 |
T4361 |
T4318 |
punct |
.,emerged |
| R271 |
T1066 |
T1046 |
parataxis |
1,initiates |
| R2710 |
T4363 |
T4364 |
det |
The,changes |
| R2711 |
T4364 |
T4365 |
nsubjpass |
changes,accompanied |
| R2712 |
T4366 |
T4364 |
prep |
in,changes |
| R2713 |
T4367 |
T4366 |
pobj |
hyperproliferation,in |
| R2714 |
T4368 |
T4367 |
cc |
and,hyperproliferation |
| R2715 |
T4369 |
T4367 |
conj |
differentiation,hyperproliferation |
| R2716 |
T4370 |
T4365 |
auxpass |
were,accompanied |
| R2717 |
T4371 |
T4365 |
neg |
not,accompanied |
| R2718 |
T4372 |
T4365 |
advmod |
initially,accompanied |
| R2719 |
T4373 |
T4365 |
agent |
by,accompanied |
| R272 |
T1067 |
T1066 |
punct |
],1 |
| R2720 |
T4374 |
T4375 |
amod |
gross,signs |
| R2721 |
T4375 |
T4373 |
pobj |
signs,by |
| R2722 |
T4376 |
T4375 |
prep |
of,signs |
| R2723 |
T4377 |
T4378 |
amod |
epithelial,invaginations |
| R2724 |
T4378 |
T4376 |
pobj |
invaginations,of |
| R2725 |
T4379 |
T4365 |
punct |
.,accompanied |
| R2726 |
T4381 |
T4382 |
prep |
With,developed |
| R2727 |
T4383 |
T4381 |
pobj |
age,With |
| R2728 |
T4384 |
T4382 |
punct |
", ",developed |
| R2729 |
T4385 |
T4382 |
advmod |
however,developed |
| R273 |
T1068 |
T1046 |
punct |
.,initiates |
| R2730 |
T4386 |
T4382 |
punct |
", ",developed |
| R2731 |
T4387 |
T4388 |
amod |
epidermal,folds |
| R2732 |
T4388 |
T4382 |
nsubj |
folds,developed |
| R2733 |
T4389 |
T4388 |
cc |
and,folds |
| R2734 |
T4390 |
T4388 |
conj |
undulations,folds |
| R2735 |
T4391 |
T4382 |
prep |
in,developed |
| R2736 |
T4392 |
T4391 |
pobj |
areas,in |
| R2737 |
T4393 |
T4394 |
advmod |
where,expressed |
| R2738 |
T4394 |
T4392 |
relcl |
expressed,areas |
| R2739 |
T4395 |
T4394 |
nsubjpass |
Snail,expressed |
| R274 |
T1070 |
T1071 |
det |
The,cells |
| R2740 |
T4396 |
T4394 |
auxpass |
was,expressed |
| R2741 |
T4397 |
T4382 |
punct |
", ",developed |
| R2742 |
T4398 |
T4382 |
cc |
and,developed |
| R2743 |
T4399 |
T4400 |
amod |
proliferative,markers |
| R2744 |
T4400 |
T4401 |
nsubj |
markers,persisted |
| R2745 |
T4401 |
T4382 |
conj |
persisted,developed |
| R2746 |
T4402 |
T4401 |
prep |
in,persisted |
| R2747 |
T4403 |
T4404 |
det |
these,regions |
| R2748 |
T4404 |
T4402 |
pobj |
regions,in |
| R2749 |
T4405 |
T4406 |
punct |
(,staining |
| R275 |
T1071 |
T1076 |
nsubjpass |
cells,attached |
| R2750 |
T4406 |
T4401 |
parataxis |
staining,persisted |
| R2751 |
T4407 |
T4408 |
compound |
Figure,3I |
| R2752 |
T4408 |
T4406 |
dep |
3I,staining |
| R2753 |
T4409 |
T4408 |
cc |
and,3I |
| R2754 |
T4410 |
T4408 |
conj |
3J,3I |
| R2755 |
T4411 |
T4406 |
punct |
;,staining |
| R2756 |
T4412 |
T4413 |
amod |
anti-cyclin,D |
| R2757 |
T4413 |
T4406 |
compound |
D,staining |
| R2758 |
T4414 |
T4406 |
punct |
),staining |
| R2759 |
T4415 |
T4382 |
punct |
.,developed |
| R276 |
T1072 |
T1071 |
amod |
multipotent,cells |
| R2760 |
T4417 |
T4418 |
det |
The,undulations |
| R2761 |
T4418 |
T4419 |
nsubjpass |
undulations,accompanied |
| R2762 |
T4420 |
T4419 |
auxpass |
were,accompanied |
| R2763 |
T4421 |
T4419 |
agent |
by,accompanied |
| R2764 |
T4422 |
T4423 |
amod |
partial,dissolution |
| R2765 |
T4423 |
T4421 |
pobj |
dissolution,by |
| R2766 |
T4424 |
T4423 |
prep |
of,dissolution |
| R2767 |
T4425 |
T4426 |
det |
the,membrane |
| R2768 |
T4426 |
T4424 |
pobj |
membrane,of |
| R2769 |
T4427 |
T4426 |
amod |
underlying,membrane |
| R277 |
T1073 |
T1071 |
punct |
", ",cells |
| R2770 |
T4428 |
T4426 |
compound |
basement,membrane |
| R2771 |
T4429 |
T4430 |
punct |
(,3K |
| R2772 |
T4430 |
T4419 |
parataxis |
3K,accompanied |
| R2773 |
T4431 |
T4430 |
compound |
Figure,3K |
| R2774 |
T4432 |
T4430 |
cc |
and,3K |
| R2775 |
T4433 |
T4430 |
conj |
3L,3K |
| R2776 |
T4434 |
T4430 |
punct |
),3K |
| R2777 |
T4435 |
T4419 |
punct |
.,accompanied |
| R2778 |
T4437 |
T4438 |
amod |
Aberrant,staining |
| R2779 |
T4438 |
T4439 |
nsubjpass |
staining,observed |
| R278 |
T1074 |
T1071 |
amod |
adhering,cells |
| R2780 |
T4440 |
T4439 |
auxpass |
was,observed |
| R2781 |
T4441 |
T4439 |
advmod |
also,observed |
| R2782 |
T4442 |
T4439 |
prep |
with,observed |
| R2783 |
T4443 |
T4442 |
pobj |
antibodies,with |
| R2784 |
T4444 |
T4443 |
prep |
against,antibodies |
| R2785 |
T4445 |
T4444 |
pobj |
components,against |
| R2786 |
T4446 |
T4445 |
prep |
of,components |
| R2787 |
T4447 |
T4448 |
det |
the,hemidesmosomes |
| R2788 |
T4448 |
T4446 |
pobj |
hemidesmosomes,of |
| R2789 |
T4449 |
T4445 |
punct |
", ",components |
| R279 |
T1075 |
T1071 |
amod |
epithelial,cells |
| R2790 |
T4450 |
T4451 |
dep |
which,provide |
| R2791 |
T4451 |
T4445 |
relcl |
provide,components |
| R2792 |
T4452 |
T4453 |
amod |
strong,adhesion |
| R2793 |
T4453 |
T4451 |
dobj |
adhesion,provide |
| R2794 |
T4454 |
T4453 |
prep |
of,adhesion |
| R2795 |
T4455 |
T4456 |
amod |
basal,cells |
| R2796 |
T4456 |
T4454 |
pobj |
cells,of |
| R2797 |
T4457 |
T4456 |
amod |
epidermal,cells |
| R2798 |
T4458 |
T4451 |
prep |
to,provide |
| R2799 |
T4459 |
T4460 |
det |
the,lamina |
| R28 |
T178 |
T163 |
prep |
with,exchange |
| R280 |
T1077 |
T1076 |
auxpass |
are,attached |
| R2800 |
T4460 |
T4458 |
pobj |
lamina,to |
| R2801 |
T4461 |
T4460 |
amod |
underlying,lamina |
| R2802 |
T4462 |
T4460 |
amod |
basal,lamina |
| R2803 |
T4463 |
T4464 |
punct |
(,3M |
| R2804 |
T4464 |
T4439 |
parataxis |
3M,observed |
| R2805 |
T4465 |
T4464 |
compound |
Figure,3M |
| R2806 |
T4466 |
T4464 |
cc |
and,3M |
| R2807 |
T4467 |
T4464 |
conj |
3N,3M |
| R2808 |
T4468 |
T4464 |
punct |
),3M |
| R2809 |
T4469 |
T4439 |
punct |
.,observed |
| R281 |
T1078 |
T1076 |
advmod |
typically,attached |
| R2810 |
T4471 |
T4472 |
advmod |
Interestingly,occur |
| R2811 |
T4473 |
T4472 |
punct |
", ",occur |
| R2812 |
T4474 |
T4475 |
amod |
similar,types |
| R2813 |
T4475 |
T4472 |
nsubj |
types,occur |
| R2814 |
T4476 |
T4475 |
prep |
of,types |
| R2815 |
T4477 |
T4476 |
pobj |
alterations,of |
| R2816 |
T4478 |
T4472 |
prep |
in,occur |
| R2817 |
T4479 |
T4480 |
det |
the,membrane |
| R2818 |
T4480 |
T4478 |
pobj |
membrane,in |
| R2819 |
T4481 |
T4480 |
compound |
basement,membrane |
| R282 |
T1079 |
T1076 |
prep |
to,attached |
| R2820 |
T4482 |
T4472 |
prep |
in,occur |
| R2821 |
T4483 |
T4484 |
det |
the,bud |
| R2822 |
T4484 |
T4482 |
pobj |
bud,in |
| R2823 |
T4485 |
T4484 |
compound |
hair,bud |
| R2824 |
T4486 |
T4484 |
prep |
of,bud |
| R2825 |
T4487 |
T4488 |
amod |
embryonic,mice |
| R2826 |
T4488 |
T4486 |
pobj |
mice,of |
| R2827 |
T4489 |
T4487 |
cc |
and,embryonic |
| R2828 |
T4490 |
T4487 |
conj |
newborn,embryonic |
| R2829 |
T4491 |
T4492 |
advmod |
when,expressed |
| R283 |
T1080 |
T1081 |
det |
an,lamina |
| R2830 |
T4492 |
T4472 |
advcl |
expressed,occur |
| R2831 |
T4493 |
T4492 |
nsubjpass |
Snail,expressed |
| R2832 |
T4494 |
T4492 |
auxpass |
is,expressed |
| R2833 |
T4495 |
T4492 |
advmod |
normally,expressed |
| R2834 |
T4496 |
T4472 |
punct |
.,occur |
| R2835 |
T4498 |
T4499 |
det |
The,fact |
| R2836 |
T4499 |
T4500 |
nsubj |
fact,suggests |
| R2837 |
T4501 |
T4502 |
mark |
that,altered |
| R2838 |
T4502 |
T4499 |
acl |
altered,fact |
| R2839 |
T4503 |
T4504 |
det |
the,membrane |
| R284 |
T1081 |
T1079 |
pobj |
lamina,to |
| R2840 |
T4504 |
T4502 |
nsubjpass |
membrane,altered |
| R2841 |
T4505 |
T4504 |
compound |
basement,membrane |
| R2842 |
T4506 |
T4504 |
acl |
separating,membrane |
| R2843 |
T4507 |
T4508 |
det |
the,epidermis |
| R2844 |
T4508 |
T4506 |
dobj |
epidermis,separating |
| R2845 |
T4509 |
T4506 |
prep |
from,separating |
| R2846 |
T4510 |
T4511 |
det |
the,dermis |
| R2847 |
T4511 |
T4509 |
pobj |
dermis,from |
| R2848 |
T4512 |
T4502 |
auxpass |
is,altered |
| R2849 |
T4513 |
T4514 |
advmod |
only,in |
| R285 |
T1082 |
T1081 |
amod |
underlying,lamina |
| R2850 |
T4514 |
T4502 |
prep |
in,altered |
| R2851 |
T4515 |
T4516 |
det |
the,animals |
| R2852 |
T4516 |
T4514 |
pobj |
animals,in |
| R2853 |
T4517 |
T4516 |
amod |
adult,animals |
| R2854 |
T4518 |
T4516 |
compound |
Tg,animals |
| R2855 |
T4519 |
T4520 |
det |
the,involvement |
| R2856 |
T4520 |
T4500 |
dobj |
involvement,suggests |
| R2857 |
T4521 |
T4520 |
prep |
of,involvement |
| R2858 |
T4522 |
T4523 |
amod |
intermediary,factors |
| R2859 |
T4523 |
T4521 |
pobj |
factors,of |
| R286 |
T1083 |
T1081 |
amod |
basal,lamina |
| R2860 |
T4524 |
T4525 |
neg |
not,available |
| R2861 |
T4525 |
T4523 |
relcl |
available,factors |
| R2862 |
T4526 |
T4527 |
advmod |
as,readily |
| R2863 |
T4527 |
T4525 |
advmod |
readily,available |
| R2864 |
T4528 |
T4525 |
prep |
in,available |
| R2865 |
T4529 |
T4530 |
det |
the,epidermis |
| R2866 |
T4530 |
T4528 |
pobj |
epidermis,in |
| R2867 |
T4531 |
T4532 |
mark |
as,are |
| R2868 |
T4532 |
T4525 |
advcl |
are,available |
| R2869 |
T4533 |
T4532 |
nsubj |
they,are |
| R287 |
T1084 |
T1085 |
dep |
that,polarizes |
| R2870 |
T4534 |
T4532 |
prep |
in,are |
| R2871 |
T4535 |
T4536 |
det |
the,follicle |
| R2872 |
T4536 |
T4534 |
pobj |
follicle,in |
| R2873 |
T4537 |
T4500 |
punct |
.,suggests |
| R2878 |
T5218 |
T5219 |
amod |
Possible,Links |
| R2879 |
T5220 |
T5219 |
prep |
between,Links |
| R288 |
T1085 |
T1081 |
relcl |
polarizes,lamina |
| R2880 |
T5221 |
T5222 |
amod |
Epidermal,Hyperproliferation |
| R2881 |
T5222 |
T5220 |
pobj |
Hyperproliferation,between |
| R2882 |
T5223 |
T5222 |
cc |
and,Hyperproliferation |
| R2883 |
T5224 |
T5225 |
amod |
Down,regulation |
| R2884 |
T5225 |
T5222 |
conj |
regulation,Hyperproliferation |
| R2885 |
T5226 |
T5225 |
punct |
-,regulation |
| R2886 |
T5227 |
T5225 |
prep |
of,regulation |
| R2887 |
T5228 |
T5229 |
compound |
AJ,Proteins |
| R2888 |
T5229 |
T5227 |
pobj |
Proteins,of |
| R2889 |
T5230 |
T5219 |
prep |
in,Links |
| R289 |
T1086 |
T1087 |
det |
the,sheet |
| R2890 |
T5231 |
T5232 |
compound |
Snail,Mice |
| R2891 |
T5232 |
T5230 |
pobj |
Mice,in |
| R2892 |
T5233 |
T5232 |
compound |
Tg,Mice |
| R2893 |
T5235 |
T5236 |
prep |
Given,examined |
| R2894 |
T5237 |
T5238 |
mark |
that,is |
| R2895 |
T5238 |
T5235 |
pcomp |
is,Given |
| R2896 |
T5239 |
T5240 |
det |
the,promoter |
| R2897 |
T5240 |
T5238 |
nsubj |
promoter,is |
| R2898 |
T5241 |
T5242 |
compound |
E,cadherin |
| R2899 |
T5242 |
T5240 |
compound |
cadherin,promoter |
| R29 |
T179 |
T180 |
poss |
their,neighbors |
| R290 |
T1087 |
T1085 |
dobj |
sheet,polarizes |
| R2900 |
T5243 |
T5242 |
punct |
-,cadherin |
| R2901 |
T5244 |
T5245 |
det |
a,target |
| R2902 |
T5245 |
T5238 |
attr |
target,is |
| R2903 |
T5246 |
T5245 |
amod |
direct,target |
| R2904 |
T5247 |
T5245 |
prep |
for,target |
| R2905 |
T5248 |
T5249 |
npadvmod |
Snail,mediated |
| R2906 |
T5249 |
T5251 |
amod |
mediated,repression |
| R2907 |
T5250 |
T5249 |
punct |
-,mediated |
| R2908 |
T5251 |
T5247 |
pobj |
repression,for |
| R2909 |
T5252 |
T5253 |
advmod |
in,vitro |
| R291 |
T1088 |
T1087 |
amod |
epithelial,sheet |
| R2910 |
T5253 |
T5238 |
advmod |
vitro,is |
| R2911 |
T5254 |
T5255 |
punct |
[,13 |
| R2912 |
T5255 |
T5238 |
parataxis |
13,is |
| R2913 |
T5256 |
T5255 |
nummod |
4,13 |
| R2914 |
T5257 |
T5255 |
punct |
",",13 |
| R2915 |
T5258 |
T5255 |
nummod |
12,13 |
| R2916 |
T5259 |
T5255 |
punct |
",",13 |
| R2917 |
T5260 |
T5255 |
punct |
],13 |
| R2918 |
T5261 |
T5238 |
punct |
", ",is |
| R2919 |
T5262 |
T5238 |
cc |
and,is |
| R292 |
T1089 |
T1085 |
cc |
and,polarizes |
| R2920 |
T5263 |
T5264 |
mark |
that,regulated |
| R2921 |
T5264 |
T5238 |
conj |
regulated,is |
| R2922 |
T5265 |
T5266 |
compound |
E,cadherin |
| R2923 |
T5266 |
T5264 |
nsubjpass |
cadherin,regulated |
| R2924 |
T5267 |
T5266 |
punct |
-,cadherin |
| R2925 |
T5268 |
T5264 |
auxpass |
was,regulated |
| R2926 |
T5269 |
T5264 |
advmod |
down,regulated |
| R2927 |
T5270 |
T5264 |
punct |
-,regulated |
| R2928 |
T5271 |
T5264 |
prep |
in,regulated |
| R2929 |
T5272 |
T5273 |
npadvmod |
Snail,expressing |
| R293 |
T1090 |
T1085 |
conj |
separates,polarizes |
| R2930 |
T5273 |
T5275 |
amod |
expressing,buds |
| R2931 |
T5274 |
T5273 |
punct |
-,expressing |
| R2932 |
T5275 |
T5271 |
pobj |
buds,in |
| R2933 |
T5276 |
T5275 |
compound |
hair,buds |
| R2934 |
T5277 |
T5236 |
punct |
", ",examined |
| R2935 |
T5278 |
T5236 |
nsubj |
we,examined |
| R2936 |
T5279 |
T5280 |
det |
the,status |
| R2937 |
T5280 |
T5236 |
dobj |
status,examined |
| R2938 |
T5281 |
T5280 |
prep |
of,status |
| R2939 |
T5282 |
T5283 |
compound |
E,cadherin |
| R294 |
T1091 |
T1090 |
dobj |
it,separates |
| R2940 |
T5283 |
T5281 |
pobj |
cadherin,of |
| R2941 |
T5284 |
T5283 |
punct |
-,cadherin |
| R2942 |
T5285 |
T5283 |
cc |
and,cadherin |
| R2943 |
T5286 |
T5287 |
amod |
other,proteins |
| R2944 |
T5287 |
T5283 |
conj |
proteins,cadherin |
| R2945 |
T5288 |
T5287 |
compound |
AJ,proteins |
| R2946 |
T5289 |
T5236 |
prep |
within,examined |
| R2947 |
T5290 |
T5289 |
pobj |
regions,within |
| R2948 |
T5291 |
T5290 |
prep |
of,regions |
| R2949 |
T5292 |
T5293 |
amod |
hyperproliferative,epidermis |
| R295 |
T1092 |
T1090 |
prep |
from,separates |
| R2950 |
T5293 |
T5291 |
pobj |
epidermis,of |
| R2951 |
T5294 |
T5295 |
advmod |
where,was |
| R2952 |
T5295 |
T5290 |
relcl |
was,regions |
| R2953 |
T5296 |
T5297 |
compound |
Tg,Snail |
| R2954 |
T5297 |
T5295 |
nsubj |
Snail,was |
| R2955 |
T5298 |
T5295 |
acomp |
present,was |
| R2956 |
T5299 |
T5300 |
punct |
(,4A |
| R2957 |
T5300 |
T5236 |
parataxis |
4A,examined |
| R2958 |
T5301 |
T5300 |
compound |
Figure,4A |
| R2959 |
T5302 |
T5300 |
punct |
),4A |
| R296 |
T1093 |
T1094 |
amod |
surrounding,mesenchyme |
| R2960 |
T5303 |
T5236 |
punct |
.,examined |
| R2961 |
T5305 |
T5306 |
prep |
In,diminished |
| R2962 |
T5307 |
T5308 |
det |
these,regions |
| R2963 |
T5308 |
T5305 |
pobj |
regions,In |
| R2964 |
T5309 |
T5306 |
punct |
", ",diminished |
| R2965 |
T5310 |
T5311 |
compound |
immunofluorescence,staining |
| R2966 |
T5311 |
T5306 |
nsubjpass |
staining,diminished |
| R2967 |
T5312 |
T5311 |
prep |
of,staining |
| R2968 |
T5313 |
T5314 |
compound |
E,cadherin |
| R2969 |
T5314 |
T5312 |
pobj |
cadherin,of |
| R297 |
T1094 |
T1092 |
pobj |
mesenchyme,from |
| R2970 |
T5315 |
T5314 |
punct |
-,cadherin |
| R2971 |
T5316 |
T5314 |
cc |
and,cadherin |
| R2972 |
T5317 |
T5318 |
compound |
α,catenin |
| R2973 |
T5318 |
T5314 |
conj |
catenin,cadherin |
| R2974 |
T5319 |
T5318 |
punct |
-,catenin |
| R2975 |
T5320 |
T5306 |
auxpass |
were,diminished |
| R2976 |
T5321 |
T5306 |
advmod |
markedly,diminished |
| R2977 |
T5322 |
T5306 |
punct |
.,diminished |
| R2978 |
T5324 |
T5325 |
prep |
In,was |
| R2979 |
T5326 |
T5324 |
pobj |
contrast,In |
| R298 |
T1095 |
T1076 |
punct |
.,attached |
| R2980 |
T5327 |
T5325 |
punct |
", ",was |
| R2981 |
T5328 |
T5329 |
det |
the,intensity |
| R2982 |
T5329 |
T5325 |
nsubj |
intensity,was |
| R2983 |
T5330 |
T5329 |
prep |
of,intensity |
| R2984 |
T5331 |
T5332 |
compound |
antibody,staining |
| R2985 |
T5332 |
T5330 |
pobj |
staining,of |
| R2986 |
T5333 |
T5329 |
prep |
for,intensity |
| R2987 |
T5334 |
T5335 |
nummod |
two,proteins |
| R2988 |
T5335 |
T5333 |
pobj |
proteins,for |
| R2989 |
T5336 |
T5335 |
amod |
other,proteins |
| R299 |
T1097 |
T1098 |
amod |
Budding,morphogenesis |
| R2990 |
T5337 |
T5335 |
compound |
AJ,proteins |
| R2991 |
T5338 |
T5335 |
punct |
", ",proteins |
| R2992 |
T5339 |
T5340 |
compound |
β,catenin |
| R2993 |
T5340 |
T5335 |
appos |
catenin,proteins |
| R2994 |
T5341 |
T5340 |
punct |
-,catenin |
| R2995 |
T5342 |
T5340 |
cc |
and,catenin |
| R2996 |
T5343 |
T5340 |
conj |
Ajuba,catenin |
| R2997 |
T5344 |
T5325 |
punct |
", ",was |
| R2998 |
T5345 |
T5325 |
advmod |
still,was |
| R2999 |
T5346 |
T5325 |
acomp |
strong,was |
| R3 |
T150 |
T147 |
acl |
Involving,Pathway |
| R30 |
T180 |
T178 |
pobj |
neighbors,with |
| R300 |
T1098 |
T1099 |
nsubjpass |
morphogenesis,guided |
| R3000 |
T5347 |
T5325 |
punct |
.,was |
| R3001 |
T5349 |
T5350 |
advmod |
Interestingly,appeared |
| R3002 |
T5351 |
T5350 |
punct |
", ",appeared |
| R3003 |
T5352 |
T5350 |
advmod |
however,appeared |
| R3004 |
T5353 |
T5350 |
punct |
", ",appeared |
| R3005 |
T5354 |
T5350 |
prep |
despite,appeared |
| R3006 |
T5355 |
T5356 |
amod |
appreciable,immunofluorescence |
| R3007 |
T5356 |
T5354 |
pobj |
immunofluorescence,despite |
| R3008 |
T5357 |
T5350 |
punct |
", ",appeared |
| R3009 |
T5358 |
T5350 |
nsubj |
localization,appeared |
| R301 |
T1100 |
T1099 |
auxpass |
is,guided |
| R3010 |
T5359 |
T5358 |
prep |
of,localization |
| R3011 |
T5360 |
T5361 |
compound |
β,catenin |
| R3012 |
T5361 |
T5359 |
pobj |
catenin,of |
| R3013 |
T5362 |
T5361 |
punct |
-,catenin |
| R3014 |
T5363 |
T5361 |
cc |
and,catenin |
| R3015 |
T5364 |
T5361 |
conj |
Ajuba,catenin |
| R3016 |
T5365 |
T5366 |
aux |
to,be |
| R3017 |
T5366 |
T5350 |
xcomp |
be,appeared |
| R3018 |
T5367 |
T5368 |
advmod |
largely,cytoplasmic |
| R3019 |
T5368 |
T5366 |
acomp |
cytoplasmic,be |
| R302 |
T1101 |
T1099 |
agent |
by,guided |
| R3020 |
T5369 |
T5370 |
advmod |
rather,than |
| R3021 |
T5370 |
T5368 |
cc |
than,cytoplasmic |
| R3022 |
T5371 |
T5368 |
conj |
at,cytoplasmic |
| R3023 |
T5372 |
T5373 |
compound |
cell,cell |
| R3024 |
T5373 |
T5375 |
compound |
cell,borders |
| R3025 |
T5374 |
T5373 |
punct |
-,cell |
| R3026 |
T5375 |
T5371 |
pobj |
borders,at |
| R3027 |
T5376 |
T5377 |
punct |
(,insets |
| R3028 |
T5377 |
T5350 |
parataxis |
insets,appeared |
| R3029 |
T5378 |
T5379 |
compound |
Figure,4A |
| R303 |
T1102 |
T1103 |
det |
a,exchange |
| R3030 |
T5379 |
T5377 |
compound |
4A,insets |
| R3031 |
T5380 |
T5377 |
punct |
),insets |
| R3032 |
T5381 |
T5350 |
punct |
.,appeared |
| R3033 |
T5383 |
T5384 |
amod |
Architectural,differences |
| R3034 |
T5384 |
T5385 |
nsubj |
differences,made |
| R3035 |
T5386 |
T5384 |
prep |
in,differences |
| R3036 |
T5387 |
T5388 |
det |
the,epidermis |
| R3037 |
T5388 |
T5386 |
pobj |
epidermis,in |
| R3038 |
T5389 |
T5390 |
compound |
Western,blot |
| R3039 |
T5390 |
T5391 |
compound |
blot,analyses |
| R304 |
T1103 |
T1101 |
pobj |
exchange,by |
| R3040 |
T5391 |
T5392 |
nsubj |
analyses,difficult |
| R3041 |
T5392 |
T5385 |
ccomp |
difficult,made |
| R3042 |
T5393 |
T5392 |
advmod |
somewhat,difficult |
| R3043 |
T5394 |
T5395 |
aux |
to,gauge |
| R3044 |
T5395 |
T5392 |
advcl |
gauge,difficult |
| R3045 |
T5396 |
T5385 |
punct |
.,made |
| R3046 |
T5398 |
T5399 |
advmod |
However,accentuated |
| R3047 |
T5400 |
T5399 |
punct |
", ",accentuated |
| R3048 |
T5401 |
T5399 |
prep |
in,accentuated |
| R3049 |
T5402 |
T5401 |
pobj |
regions,in |
| R305 |
T1104 |
T1103 |
amod |
reciprocal,exchange |
| R3050 |
T5403 |
T5404 |
amod |
such,as |
| R3051 |
T5404 |
T5402 |
prep |
as,regions |
| R3052 |
T5405 |
T5406 |
compound |
ear,skin |
| R3053 |
T5406 |
T5404 |
pobj |
skin,as |
| R3054 |
T5407 |
T5402 |
punct |
", ",regions |
| R3055 |
T5408 |
T5409 |
advmod |
where,expressed |
| R3056 |
T5409 |
T5402 |
relcl |
expressed,regions |
| R3057 |
T5410 |
T5411 |
det |
the,levels |
| R3058 |
T5411 |
T5409 |
nsubjpass |
levels,expressed |
| R3059 |
T5412 |
T5411 |
amod |
highest,levels |
| R306 |
T1105 |
T1103 |
prep |
of,exchange |
| R3060 |
T5413 |
T5411 |
prep |
of,levels |
| R3061 |
T5414 |
T5415 |
compound |
Snail,protein |
| R3062 |
T5415 |
T5413 |
pobj |
protein,of |
| R3063 |
T5416 |
T5409 |
auxpass |
were,expressed |
| R3064 |
T5417 |
T5399 |
punct |
", ",accentuated |
| R3065 |
T5418 |
T5419 |
det |
the,effects |
| R3066 |
T5419 |
T5399 |
nsubjpass |
effects,accentuated |
| R3067 |
T5420 |
T5399 |
auxpass |
were,accentuated |
| R3068 |
T5421 |
T5399 |
punct |
.,accentuated |
| R3069 |
T5423 |
T5424 |
prep |
In,reduced |
| R307 |
T1106 |
T1105 |
pobj |
signals,of |
| R3070 |
T5425 |
T5426 |
preconj |
both,skin |
| R3071 |
T5426 |
T5423 |
pobj |
skin,In |
| R3072 |
T5427 |
T5426 |
compound |
back,skin |
| R3073 |
T5428 |
T5426 |
cc |
and,skin |
| R3074 |
T5429 |
T5430 |
compound |
ear,skin |
| R3075 |
T5430 |
T5426 |
conj |
skin,skin |
| R3076 |
T5431 |
T5424 |
punct |
", ",reduced |
| R3077 |
T5432 |
T5433 |
amod |
overall,levels |
| R3078 |
T5433 |
T5424 |
nsubjpass |
levels,reduced |
| R3079 |
T5434 |
T5433 |
prep |
of,levels |
| R308 |
T1107 |
T1103 |
prep |
between,exchange |
| R3080 |
T5435 |
T5436 |
compound |
E,cadherin |
| R3081 |
T5436 |
T5434 |
pobj |
cadherin,of |
| R3082 |
T5437 |
T5436 |
punct |
-,cadherin |
| R3083 |
T5438 |
T5436 |
cc |
and,cadherin |
| R3084 |
T5439 |
T5440 |
compound |
α,catenin |
| R3085 |
T5440 |
T5436 |
conj |
catenin,cadherin |
| R3086 |
T5441 |
T5440 |
punct |
-,catenin |
| R3087 |
T5442 |
T5424 |
auxpass |
were,reduced |
| R3088 |
T5443 |
T5424 |
punct |
", ",reduced |
| R3089 |
T5444 |
T5424 |
prep |
under,reduced |
| R309 |
T1108 |
T1107 |
pobj |
epithelium,between |
| R3090 |
T5445 |
T5444 |
pobj |
conditions,under |
| R3091 |
T5446 |
T5447 |
advmod |
where,remained |
| R3092 |
T5447 |
T5445 |
relcl |
remained,conditions |
| R3093 |
T5448 |
T5449 |
nmod |
β,catenin |
| R3094 |
T5449 |
T5451 |
nmod |
catenin,levels |
| R3095 |
T5450 |
T5449 |
punct |
-,catenin |
| R3096 |
T5451 |
T5447 |
nsubj |
levels,remained |
| R3097 |
T5452 |
T5449 |
cc |
and,catenin |
| R3098 |
T5453 |
T5449 |
conj |
Ajuba,catenin |
| R3099 |
T5454 |
T5447 |
acomp |
unchanged,remained |
| R31 |
T181 |
T163 |
cc |
and,exchange |
| R310 |
T1109 |
T1108 |
cc |
and,epithelium |
| R3100 |
T5455 |
T5447 |
advcl |
relative,remained |
| R3101 |
T5456 |
T5455 |
prep |
to,relative |
| R3102 |
T5457 |
T5456 |
pobj |
controls,to |
| R3103 |
T5458 |
T5459 |
punct |
(,4B |
| R3104 |
T5459 |
T5424 |
parataxis |
4B,reduced |
| R3105 |
T5460 |
T5459 |
compound |
Figure,4B |
| R3106 |
T5461 |
T5459 |
punct |
),4B |
| R3107 |
T5462 |
T5424 |
punct |
.,reduced |
| R3108 |
T5464 |
T5465 |
advcl |
Taken,were |
| R3109 |
T5466 |
T5464 |
advmod |
together,Taken |
| R311 |
T1110 |
T1108 |
conj |
mesenchyme,epithelium |
| R3110 |
T5467 |
T5465 |
punct |
", ",were |
| R3111 |
T5468 |
T5469 |
det |
these,data |
| R3112 |
T5469 |
T5465 |
nsubj |
data,were |
| R3113 |
T5470 |
T5465 |
acomp |
consistent,were |
| R3114 |
T5471 |
T5470 |
prep |
with,consistent |
| R3115 |
T5472 |
T5473 |
poss |
our,results |
| R3116 |
T5473 |
T5471 |
pobj |
results,with |
| R3117 |
T5474 |
T5473 |
acl |
obtained,results |
| R3118 |
T5475 |
T5474 |
prep |
from,obtained |
| R3119 |
T5476 |
T5477 |
compound |
immunofluorescence,microscopy |
| R312 |
T1111 |
T1112 |
aux |
to,specify |
| R3120 |
T5477 |
T5475 |
pobj |
microscopy,from |
| R3121 |
T5478 |
T5465 |
punct |
.,were |
| R3122 |
T5480 |
T5481 |
advmod |
A,priori |
| R3123 |
T5481 |
T5482 |
advmod |
priori,be |
| R3124 |
T5483 |
T5482 |
punct |
", ",be |
| R3125 |
T5484 |
T5485 |
det |
the,decrease |
| R3126 |
T5485 |
T5482 |
nsubj |
decrease,be |
| R3127 |
T5486 |
T5485 |
prep |
in,decrease |
| R3128 |
T5487 |
T5488 |
compound |
α,catenin |
| R3129 |
T5488 |
T5490 |
compound |
catenin,levels |
| R313 |
T1112 |
T1103 |
advcl |
specify,exchange |
| R3130 |
T5489 |
T5488 |
punct |
-,catenin |
| R3131 |
T5490 |
T5486 |
pobj |
levels,in |
| R3132 |
T5491 |
T5482 |
aux |
could,be |
| R3133 |
T5492 |
T5482 |
prep |
due,be |
| R3134 |
T5493 |
T5492 |
pcomp |
to,due |
| R3135 |
T5494 |
T5495 |
preconj |
either,repression |
| R3136 |
T5495 |
T5492 |
pobj |
repression,due |
| R3137 |
T5496 |
T5495 |
amod |
direct,repression |
| R3138 |
T5497 |
T5495 |
amod |
transcriptional,repression |
| R3139 |
T5498 |
T5495 |
prep |
by,repression |
| R314 |
T1113 |
T1114 |
det |
the,identity |
| R3140 |
T5499 |
T5498 |
pobj |
Snail,by |
| R3141 |
T5500 |
T5495 |
cc |
or,repression |
| R3142 |
T5501 |
T5495 |
conj |
perturbations,repression |
| R3143 |
T5502 |
T5501 |
prep |
in,perturbations |
| R3144 |
T5503 |
T5504 |
compound |
AJ,formation |
| R3145 |
T5504 |
T5502 |
pobj |
formation,in |
| R3146 |
T5505 |
T5501 |
acl |
caused,perturbations |
| R3147 |
T5506 |
T5505 |
agent |
by,caused |
| R3148 |
T5507 |
T5508 |
det |
the,decrease |
| R3149 |
T5508 |
T5506 |
pobj |
decrease,by |
| R315 |
T1114 |
T1112 |
dobj |
identity,specify |
| R3150 |
T5509 |
T5508 |
prep |
in,decrease |
| R3151 |
T5510 |
T5511 |
compound |
E,cadherin |
| R3152 |
T5511 |
T5513 |
compound |
cadherin,expression |
| R3153 |
T5512 |
T5511 |
punct |
-,cadherin |
| R3154 |
T5513 |
T5509 |
pobj |
expression,in |
| R3155 |
T5514 |
T5513 |
compound |
gene,expression |
| R3156 |
T5515 |
T5482 |
punct |
.,be |
| R3157 |
T5517 |
T5518 |
aux |
To,distinguish |
| R3158 |
T5518 |
T5519 |
advcl |
distinguish,tested |
| R3159 |
T5520 |
T5518 |
prep |
between,distinguish |
| R316 |
T1115 |
T1114 |
prep |
of,identity |
| R3160 |
T5521 |
T5522 |
det |
these,possibilities |
| R3161 |
T5522 |
T5520 |
pobj |
possibilities,between |
| R3162 |
T5523 |
T5519 |
punct |
", ",tested |
| R3163 |
T5524 |
T5519 |
nsubj |
we,tested |
| R3164 |
T5525 |
T5526 |
mark |
whether,restored |
| R3165 |
T5526 |
T5519 |
ccomp |
restored,tested |
| R3166 |
T5527 |
T5528 |
compound |
α,catenin |
| R3167 |
T5528 |
T5530 |
compound |
catenin,levels |
| R3168 |
T5529 |
T5528 |
punct |
-,catenin |
| R3169 |
T5530 |
T5526 |
nsubjpass |
levels,restored |
| R317 |
T1116 |
T1117 |
det |
the,organ |
| R3170 |
T5531 |
T5526 |
aux |
could,restored |
| R3171 |
T5532 |
T5526 |
auxpass |
be,restored |
| R3172 |
T5533 |
T5526 |
agent |
by,restored |
| R3173 |
T5534 |
T5535 |
amod |
exogenous,expression |
| R3174 |
T5535 |
T5533 |
pobj |
expression,by |
| R3175 |
T5536 |
T5535 |
prep |
of,expression |
| R3176 |
T5537 |
T5538 |
compound |
E,cadherin |
| R3177 |
T5538 |
T5536 |
pobj |
cadherin,of |
| R3178 |
T5539 |
T5538 |
punct |
-,cadherin |
| R3179 |
T5540 |
T5526 |
prep |
in,restored |
| R318 |
T1117 |
T1115 |
pobj |
organ,of |
| R3180 |
T5541 |
T5542 |
npadvmod |
Snail,expressing |
| R3181 |
T5542 |
T5544 |
amod |
expressing,keratinocytes |
| R3182 |
T5543 |
T5542 |
punct |
-,expressing |
| R3183 |
T5544 |
T5540 |
pobj |
keratinocytes,in |
| R3184 |
T5545 |
T5519 |
punct |
.,tested |
| R3185 |
T5547 |
T5548 |
mark |
As,shown |
| R3186 |
T5548 |
T5549 |
advcl |
shown,displayed |
| R3187 |
T5550 |
T5548 |
prep |
in,shown |
| R3188 |
T5551 |
T5552 |
compound |
Figure,4C |
| R3189 |
T5552 |
T5550 |
pobj |
4C,in |
| R319 |
T1118 |
T1119 |
dep |
that,form |
| R3190 |
T5553 |
T5549 |
punct |
", ",displayed |
| R3191 |
T5554 |
T5555 |
advmod |
transiently,transfected |
| R3192 |
T5555 |
T5556 |
amod |
transfected,keratinocytes |
| R3193 |
T5556 |
T5549 |
nsubj |
keratinocytes,displayed |
| R3194 |
T5557 |
T5556 |
acl |
expressing,keratinocytes |
| R3195 |
T5558 |
T5559 |
npadvmod |
HA,tagged |
| R3196 |
T5559 |
T5561 |
amod |
tagged,Snail |
| R3197 |
T5560 |
T5559 |
punct |
-,tagged |
| R3198 |
T5561 |
T5557 |
dobj |
Snail,expressing |
| R3199 |
T5562 |
T5563 |
det |
a,loss |
| R32 |
T182 |
T163 |
conj |
develop,exchange |
| R320 |
T1119 |
T1117 |
relcl |
form,organ |
| R3200 |
T5563 |
T5549 |
dobj |
loss,displayed |
| R3201 |
T5564 |
T5563 |
prep |
of,loss |
| R3202 |
T5565 |
T5566 |
compound |
E,cadherin |
| R3203 |
T5566 |
T5564 |
pobj |
cadherin,of |
| R3204 |
T5567 |
T5566 |
punct |
-,cadherin |
| R3205 |
T5568 |
T5566 |
cc |
and,cadherin |
| R3206 |
T5569 |
T5570 |
compound |
α,catenin |
| R3207 |
T5570 |
T5566 |
conj |
catenin,cadherin |
| R3208 |
T5571 |
T5570 |
punct |
-,catenin |
| R3209 |
T5572 |
T5549 |
prep |
at,displayed |
| R321 |
T1120 |
T1119 |
aux |
will,form |
| R3210 |
T5573 |
T5574 |
compound |
cell,cell |
| R3211 |
T5574 |
T5576 |
compound |
cell,borders |
| R3212 |
T5575 |
T5574 |
punct |
-,cell |
| R3213 |
T5576 |
T5572 |
pobj |
borders,at |
| R3214 |
T5577 |
T5549 |
punct |
.,displayed |
| R3215 |
T5579 |
T5580 |
nsubj |
Coexpression,enabled |
| R3216 |
T5581 |
T5579 |
prep |
of,Coexpression |
| R3217 |
T5582 |
T5583 |
amod |
exogenous,cadherin |
| R3218 |
T5583 |
T5581 |
pobj |
cadherin,of |
| R3219 |
T5584 |
T5585 |
npadvmod |
HA,tagged |
| R322 |
T1121 |
T1112 |
cc |
and,specify |
| R3220 |
T5585 |
T5583 |
amod |
tagged,cadherin |
| R3221 |
T5586 |
T5585 |
punct |
-,tagged |
| R3222 |
T5587 |
T5583 |
compound |
E,cadherin |
| R3223 |
T5588 |
T5583 |
punct |
-,cadherin |
| R3224 |
T5589 |
T5580 |
preconj |
not,enabled |
| R3225 |
T5590 |
T5589 |
advmod |
only,not |
| R3226 |
T5591 |
T5592 |
compound |
cell,cell |
| R3227 |
T5592 |
T5594 |
compound |
cell,localization |
| R3228 |
T5593 |
T5592 |
punct |
-,cell |
| R3229 |
T5594 |
T5580 |
dobj |
localization,enabled |
| R323 |
T1122 |
T1123 |
aux |
to,govern |
| R3230 |
T5595 |
T5594 |
compound |
border,localization |
| R3231 |
T5596 |
T5594 |
prep |
of,localization |
| R3232 |
T5597 |
T5598 |
compound |
E,cadherin |
| R3233 |
T5598 |
T5600 |
compound |
cadherin,protein |
| R3234 |
T5599 |
T5598 |
punct |
-,cadherin |
| R3235 |
T5600 |
T5596 |
pobj |
protein,of |
| R3236 |
T5601 |
T5580 |
punct |
", ",enabled |
| R3237 |
T5602 |
T5580 |
cc |
but,enabled |
| R3238 |
T5603 |
T5602 |
advmod |
also,but |
| R3239 |
T5604 |
T5580 |
conj |
rescued,enabled |
| R324 |
T1123 |
T1112 |
conj |
govern,specify |
| R3240 |
T5605 |
T5606 |
det |
the,staining |
| R3241 |
T5606 |
T5604 |
dobj |
staining,rescued |
| R3242 |
T5607 |
T5608 |
compound |
cell,cell |
| R3243 |
T5608 |
T5606 |
compound |
cell,staining |
| R3244 |
T5609 |
T5608 |
punct |
-,cell |
| R3245 |
T5610 |
T5606 |
compound |
border,staining |
| R3246 |
T5611 |
T5606 |
prep |
of,staining |
| R3247 |
T5612 |
T5613 |
compound |
α,catenin |
| R3248 |
T5613 |
T5611 |
pobj |
catenin,of |
| R3249 |
T5614 |
T5613 |
punct |
-,catenin |
| R325 |
T1124 |
T1125 |
poss |
its,growth |
| R3250 |
T5615 |
T5616 |
punct |
(,4C |
| R3251 |
T5616 |
T5604 |
parataxis |
4C,rescued |
| R3252 |
T5617 |
T5616 |
compound |
Figure,4C |
| R3253 |
T5618 |
T5616 |
punct |
),4C |
| R3254 |
T5619 |
T5580 |
punct |
.,enabled |
| R3255 |
T5621 |
T5622 |
det |
The,ability |
| R3256 |
T5622 |
T5623 |
nsubj |
ability,argues |
| R3257 |
T5624 |
T5625 |
aux |
to,restore |
| R3258 |
T5625 |
T5622 |
acl |
restore,ability |
| R3259 |
T5626 |
T5627 |
compound |
α,catenin |
| R326 |
T1125 |
T1123 |
dobj |
growth,govern |
| R3260 |
T5627 |
T5625 |
dobj |
catenin,restore |
| R3261 |
T5628 |
T5627 |
punct |
-,catenin |
| R3262 |
T5629 |
T5627 |
appos |
expression,catenin |
| R3263 |
T5630 |
T5629 |
cc |
and,expression |
| R3264 |
T5631 |
T5629 |
conj |
localization,expression |
| R3265 |
T5632 |
T5625 |
prep |
under,restore |
| R3266 |
T5633 |
T5634 |
det |
these,conditions |
| R3267 |
T5634 |
T5632 |
pobj |
conditions,under |
| R3268 |
T5635 |
T5623 |
prep |
against,argues |
| R3269 |
T5636 |
T5637 |
det |
the,notion |
| R327 |
T1126 |
T1099 |
punct |
.,guided |
| R3270 |
T5637 |
T5635 |
pobj |
notion,against |
| R3271 |
T5638 |
T5639 |
mark |
that,represses |
| R3272 |
T5639 |
T5637 |
acl |
represses,notion |
| R3273 |
T5640 |
T5639 |
nsubj |
Snail,represses |
| R3274 |
T5641 |
T5639 |
advmod |
transcriptionally,represses |
| R3275 |
T5642 |
T5643 |
compound |
α,catenin |
| R3276 |
T5643 |
T5639 |
dobj |
catenin,represses |
| R3277 |
T5644 |
T5643 |
punct |
-,catenin |
| R3278 |
T5645 |
T5623 |
punct |
.,argues |
| R3279 |
T5647 |
T5648 |
advmod |
Rather,are |
| R328 |
T1128 |
T1129 |
prep |
At,are |
| R3280 |
T5649 |
T5648 |
punct |
", ",are |
| R3281 |
T5650 |
T5651 |
det |
the,findings |
| R3282 |
T5651 |
T5648 |
nsubj |
findings,are |
| R3283 |
T5652 |
T5648 |
acomp |
consistent,are |
| R3284 |
T5653 |
T5652 |
prep |
with,consistent |
| R3285 |
T5654 |
T5655 |
det |
a,report |
| R3286 |
T5655 |
T5653 |
pobj |
report,with |
| R3287 |
T5656 |
T5655 |
amod |
previous,report |
| R3288 |
T5657 |
T5658 |
mark |
that,required |
| R3289 |
T5658 |
T5655 |
acl |
required,report |
| R329 |
T1130 |
T1131 |
det |
the,helm |
| R3290 |
T5659 |
T5660 |
compound |
E,cadherin |
| R3291 |
T5660 |
T5658 |
nsubjpass |
cadherin,required |
| R3292 |
T5661 |
T5660 |
punct |
-,cadherin |
| R3293 |
T5662 |
T5658 |
auxpass |
is,required |
| R3294 |
T5663 |
T5658 |
prep |
for,required |
| R3295 |
T5664 |
T5665 |
det |
the,translation |
| R3296 |
T5665 |
T5663 |
pobj |
translation,for |
| R3297 |
T5666 |
T5665 |
prep |
of,translation |
| R3298 |
T5667 |
T5668 |
compound |
α,catenin |
| R3299 |
T5668 |
T5670 |
compound |
catenin,mRNA |
| R33 |
T183 |
T182 |
prep |
into,develop |
| R330 |
T1131 |
T1128 |
pobj |
helm,At |
| R3300 |
T5669 |
T5668 |
punct |
-,catenin |
| R3301 |
T5670 |
T5666 |
pobj |
mRNA,of |
| R3302 |
T5671 |
T5672 |
punct |
[,22 |
| R3303 |
T5672 |
T5648 |
parataxis |
22,are |
| R3304 |
T5673 |
T5672 |
punct |
],22 |
| R3305 |
T5674 |
T5648 |
punct |
.,are |
| R3306 |
T5676 |
T5677 |
prep |
Despite,displayed |
| R3307 |
T5678 |
T5679 |
det |
the,reductions |
| R3308 |
T5679 |
T5676 |
pobj |
reductions,Despite |
| R3309 |
T5680 |
T5679 |
prep |
in,reductions |
| R331 |
T1132 |
T1131 |
prep |
of,helm |
| R3310 |
T5681 |
T5682 |
compound |
AJ,markers |
| R3311 |
T5682 |
T5680 |
pobj |
markers,in |
| R3312 |
T5683 |
T5677 |
punct |
", ",displayed |
| R3313 |
T5684 |
T5685 |
compound |
Tg,skin |
| R3314 |
T5685 |
T5677 |
nsubj |
skin,displayed |
| R3315 |
T5686 |
T5677 |
advmod |
still,displayed |
| R3316 |
T5687 |
T5688 |
amod |
sealed,membranes |
| R3317 |
T5688 |
T5677 |
dobj |
membranes,displayed |
| R3318 |
T5689 |
T5688 |
cc |
and,membranes |
| R3319 |
T5690 |
T5691 |
amod |
intercellular,junctions |
| R332 |
T1133 |
T1134 |
det |
these,pathways |
| R3320 |
T5691 |
T5688 |
conj |
junctions,membranes |
| R3321 |
T5692 |
T5693 |
dep |
that,were |
| R3322 |
T5693 |
T5691 |
relcl |
were,junctions |
| R3323 |
T5694 |
T5693 |
advmod |
largely,were |
| R3324 |
T5695 |
T5693 |
acomp |
intact,were |
| R3325 |
T5696 |
T5693 |
punct |
", ",were |
| R3326 |
T5697 |
T5698 |
mark |
as,judged |
| R3327 |
T5698 |
T5693 |
advcl |
judged,were |
| R3328 |
T5699 |
T5698 |
prep |
by,judged |
| R3329 |
T5700 |
T5701 |
amod |
ultrastructural,analyses |
| R333 |
T1134 |
T1132 |
pobj |
pathways,of |
| R3330 |
T5701 |
T5699 |
pobj |
analyses,by |
| R3331 |
T5702 |
T5703 |
punct |
(,data |
| R3332 |
T5703 |
T5677 |
meta |
data,displayed |
| R3333 |
T5704 |
T5703 |
amod |
unpublished,data |
| R3334 |
T5705 |
T5703 |
punct |
),data |
| R3335 |
T5706 |
T5677 |
punct |
.,displayed |
| R3336 |
T5708 |
T5709 |
prep |
In,resembled |
| R3337 |
T5710 |
T5711 |
det |
this,respect |
| R3338 |
T5711 |
T5708 |
pobj |
respect,In |
| R3339 |
T5712 |
T5709 |
punct |
", ",resembled |
| R334 |
T1135 |
T1136 |
amod |
molecular,communication |
| R3340 |
T5713 |
T5714 |
det |
the,epithelium |
| R3341 |
T5714 |
T5709 |
nsubj |
epithelium,resembled |
| R3342 |
T5715 |
T5714 |
compound |
skin,epithelium |
| R3343 |
T5716 |
T5709 |
dobj |
that,resembled |
| R3344 |
T5717 |
T5716 |
prep |
of,that |
| R3345 |
T5718 |
T5719 |
det |
the,bud |
| R3346 |
T5719 |
T5717 |
pobj |
bud,of |
| R3347 |
T5720 |
T5719 |
compound |
hair,bud |
| R3348 |
T5721 |
T5719 |
punct |
", ",bud |
| R3349 |
T5722 |
T5723 |
advmod |
where,is |
| R335 |
T1136 |
T1134 |
compound |
communication,pathways |
| R3350 |
T5723 |
T5719 |
relcl |
is,bud |
| R3351 |
T5724 |
T5725 |
det |
the,regulation |
| R3352 |
T5725 |
T5723 |
nsubj |
regulation,is |
| R3353 |
T5726 |
T5725 |
amod |
down,regulation |
| R3354 |
T5727 |
T5725 |
punct |
-,regulation |
| R3355 |
T5728 |
T5725 |
prep |
in,regulation |
| R3356 |
T5729 |
T5730 |
compound |
junction,proteins |
| R3357 |
T5730 |
T5728 |
pobj |
proteins,in |
| R3358 |
T5731 |
T5723 |
acomp |
permissive,is |
| R3359 |
T5732 |
T5723 |
prep |
for,is |
| R336 |
T1137 |
T1129 |
nsubj |
Wnts,are |
| R3360 |
T5733 |
T5734 |
compound |
cell,cell |
| R3361 |
T5734 |
T5736 |
compound |
cell,remodeling |
| R3362 |
T5735 |
T5734 |
punct |
-,cell |
| R3363 |
T5736 |
T5732 |
pobj |
remodeling,for |
| R3364 |
T5737 |
T5723 |
prep |
without,is |
| R3365 |
T5738 |
T5737 |
pcomp |
abrogating,without |
| R3366 |
T5739 |
T5740 |
amod |
intercellular,adhesion |
| R3367 |
T5740 |
T5738 |
dobj |
adhesion,abrogating |
| R3368 |
T5741 |
T5709 |
punct |
.,resembled |
| R3369 |
T5743 |
T5744 |
det |
The,similarities |
| R337 |
T1138 |
T1137 |
punct |
", ",Wnts |
| R3370 |
T5744 |
T5745 |
nsubj |
similarities,extended |
| R3371 |
T5746 |
T5744 |
prep |
between,similarities |
| R3372 |
T5747 |
T5748 |
compound |
Snail,epidermis |
| R3373 |
T5748 |
T5746 |
pobj |
epidermis,between |
| R3374 |
T5749 |
T5748 |
compound |
Tg,epidermis |
| R3375 |
T5750 |
T5748 |
cc |
and,epidermis |
| R3376 |
T5751 |
T5752 |
compound |
hair,buds |
| R3377 |
T5752 |
T5748 |
conj |
buds,epidermis |
| R3378 |
T5753 |
T5745 |
prep |
to,extended |
| R3379 |
T5754 |
T5755 |
det |
the,state |
| R338 |
T1139 |
T1140 |
nmod |
bone,proteins |
| R3380 |
T5755 |
T5753 |
pobj |
state,to |
| R3381 |
T5756 |
T5755 |
amod |
hyperproliferative,state |
| R3382 |
T5757 |
T5745 |
punct |
", ",extended |
| R3383 |
T5758 |
T5745 |
advcl |
leading,extended |
| R3384 |
T5759 |
T5758 |
dobj |
us,leading |
| R3385 |
T5760 |
T5761 |
aux |
to,wonder |
| R3386 |
T5761 |
T5758 |
xcomp |
wonder,leading |
| R3387 |
T5762 |
T5763 |
mark |
whether,contribute |
| R3388 |
T5763 |
T5761 |
ccomp |
contribute,wonder |
| R3389 |
T5764 |
T5765 |
det |
the,regulation |
| R339 |
T1140 |
T1137 |
appos |
proteins,Wnts |
| R3390 |
T5765 |
T5763 |
nsubj |
regulation,contribute |
| R3391 |
T5766 |
T5765 |
amod |
down,regulation |
| R3392 |
T5767 |
T5765 |
punct |
-,regulation |
| R3393 |
T5768 |
T5765 |
prep |
of,regulation |
| R3394 |
T5769 |
T5770 |
compound |
AJ,proteins |
| R3395 |
T5770 |
T5768 |
pobj |
proteins,of |
| R3396 |
T5771 |
T5763 |
aux |
might,contribute |
| R3397 |
T5772 |
T5763 |
prep |
to,contribute |
| R3398 |
T5773 |
T5774 |
det |
this,condition |
| R3399 |
T5774 |
T5772 |
pobj |
condition,to |
| R34 |
T184 |
T185 |
det |
a,structure |
| R340 |
T1141 |
T1140 |
amod |
morphogenic,proteins |
| R3400 |
T5775 |
T5745 |
punct |
.,extended |
| R3401 |
T5777 |
T5778 |
prep |
Given,used |
| R3402 |
T5779 |
T5780 |
det |
the,increase |
| R3403 |
T5780 |
T5777 |
pobj |
increase,Given |
| R3404 |
T5781 |
T5780 |
prep |
in,increase |
| R3405 |
T5782 |
T5783 |
compound |
pMAPK,staining |
| R3406 |
T5783 |
T5781 |
pobj |
staining,in |
| R3407 |
T5784 |
T5780 |
prep |
in,increase |
| R3408 |
T5785 |
T5786 |
compound |
Snail,epidermis |
| R3409 |
T5786 |
T5784 |
pobj |
epidermis,in |
| R341 |
T1142 |
T1140 |
punct |
(,proteins |
| R3410 |
T5787 |
T5786 |
compound |
Tg,epidermis |
| R3411 |
T5788 |
T5789 |
punct |
(,see |
| R3412 |
T5789 |
T5780 |
parataxis |
see,increase |
| R3413 |
T5790 |
T5791 |
compound |
Figure,2G |
| R3414 |
T5791 |
T5789 |
dobj |
2G,see |
| R3415 |
T5792 |
T5789 |
punct |
),see |
| R3416 |
T5793 |
T5778 |
punct |
", ",used |
| R3417 |
T5794 |
T5778 |
nsubj |
we,used |
| R3418 |
T5795 |
T5796 |
compound |
pMAPK,levels |
| R3419 |
T5796 |
T5778 |
dobj |
levels,used |
| R342 |
T1143 |
T1140 |
appos |
BMPs,proteins |
| R3420 |
T5797 |
T5778 |
prep |
as,used |
| R3421 |
T5798 |
T5799 |
poss |
our,assay |
| R3422 |
T5799 |
T5797 |
pobj |
assay,as |
| R3423 |
T5800 |
T5801 |
aux |
to,test |
| R3424 |
T5801 |
T5778 |
advcl |
test,used |
| R3425 |
T5802 |
T5803 |
mark |
whether,contributed |
| R3426 |
T5803 |
T5801 |
ccomp |
contributed,test |
| R3427 |
T5804 |
T5805 |
det |
the,loss |
| R3428 |
T5805 |
T5803 |
nsubj |
loss,contributed |
| R3429 |
T5806 |
T5805 |
prep |
of,loss |
| R343 |
T1144 |
T1137 |
punct |
),Wnts |
| R3430 |
T5807 |
T5808 |
compound |
E,cadherin |
| R3431 |
T5808 |
T5806 |
pobj |
cadherin,of |
| R3432 |
T5809 |
T5808 |
punct |
-,cadherin |
| R3433 |
T5810 |
T5803 |
prep |
to,contributed |
| R3434 |
T5811 |
T5812 |
det |
the,increase |
| R3435 |
T5812 |
T5810 |
pobj |
increase,to |
| R3436 |
T5813 |
T5814 |
npadvmod |
Snail,mediated |
| R3437 |
T5814 |
T5812 |
amod |
mediated,increase |
| R3438 |
T5815 |
T5814 |
punct |
-,mediated |
| R3439 |
T5816 |
T5812 |
prep |
in,increase |
| R344 |
T1145 |
T1137 |
punct |
", ",Wnts |
| R3440 |
T5817 |
T5816 |
pobj |
proliferation,in |
| R3441 |
T5818 |
T5778 |
punct |
.,used |
| R3442 |
T5820 |
T5821 |
advcl |
Consistent,exhibited |
| R3443 |
T5822 |
T5820 |
prep |
with,Consistent |
| R3444 |
T5823 |
T5824 |
poss |
our,observations |
| R3445 |
T5824 |
T5822 |
pobj |
observations,with |
| R3446 |
T5825 |
T5826 |
advmod |
in,vivo |
| R3447 |
T5826 |
T5824 |
amod |
vivo,observations |
| R3448 |
T5827 |
T5821 |
punct |
", ",exhibited |
| R3449 |
T5828 |
T5829 |
amod |
transfected,keratinocytes |
| R345 |
T1146 |
T1147 |
amod |
transforming,βs |
| R3450 |
T5829 |
T5821 |
nsubj |
keratinocytes,exhibited |
| R3451 |
T5830 |
T5829 |
acl |
expressing,keratinocytes |
| R3452 |
T5831 |
T5830 |
dobj |
Snail,expressing |
| R3453 |
T5832 |
T5833 |
det |
a,increase |
| R3454 |
T5833 |
T5821 |
dobj |
increase,exhibited |
| R3455 |
T5834 |
T5833 |
amod |
substantial,increase |
| R3456 |
T5835 |
T5833 |
prep |
in,increase |
| R3457 |
T5836 |
T5837 |
compound |
pMAPK,levels |
| R3458 |
T5837 |
T5835 |
pobj |
levels,in |
| R3459 |
T5838 |
T5833 |
amod |
relative,increase |
| R346 |
T1147 |
T1137 |
appos |
βs,Wnts |
| R3460 |
T5839 |
T5838 |
prep |
to,relative |
| R3461 |
T5840 |
T5841 |
compound |
control,cells |
| R3462 |
T5841 |
T5839 |
pobj |
cells,to |
| R3463 |
T5842 |
T5843 |
punct |
(,4D |
| R3464 |
T5843 |
T5821 |
parataxis |
4D,exhibited |
| R3465 |
T5844 |
T5843 |
compound |
Figure,4D |
| R3466 |
T5845 |
T5843 |
punct |
),4D |
| R3467 |
T5846 |
T5821 |
punct |
.,exhibited |
| R3468 |
T5848 |
T5849 |
nsubj |
Coexpression,appeared |
| R3469 |
T5850 |
T5848 |
prep |
of,Coexpression |
| R347 |
T1148 |
T1147 |
compound |
growth,βs |
| R3470 |
T5851 |
T5852 |
compound |
E,cadherin |
| R3471 |
T5852 |
T5850 |
pobj |
cadherin,of |
| R3472 |
T5853 |
T5852 |
punct |
-,cadherin |
| R3473 |
T5854 |
T5848 |
prep |
with,Coexpression |
| R3474 |
T5855 |
T5854 |
pobj |
Snail,with |
| R3475 |
T5856 |
T5857 |
aux |
to,abrogate |
| R3476 |
T5857 |
T5849 |
xcomp |
abrogate,appeared |
| R3477 |
T5858 |
T5859 |
det |
this,effect |
| R3478 |
T5859 |
T5857 |
dobj |
effect,abrogate |
| R3479 |
T5860 |
T5849 |
punct |
.,appeared |
| R348 |
T1149 |
T1147 |
compound |
factor,βs |
| R3480 |
T5862 |
T5863 |
advmod |
Together,raised |
| R3481 |
T5864 |
T5863 |
punct |
", ",raised |
| R3482 |
T5865 |
T5866 |
det |
these,findings |
| R3483 |
T5866 |
T5863 |
nsubj |
findings,raised |
| R3484 |
T5867 |
T5868 |
det |
the,possibility |
| R3485 |
T5868 |
T5863 |
dobj |
possibility,raised |
| R3486 |
T5869 |
T5870 |
mark |
that,participate |
| R3487 |
T5870 |
T5868 |
acl |
participate,possibility |
| R3488 |
T5871 |
T5872 |
det |
an,protein |
| R3489 |
T5872 |
T5870 |
nsubj |
protein,participate |
| R349 |
T1150 |
T1147 |
punct |
(,βs |
| R3490 |
T5873 |
T5874 |
npadvmod |
AJ,associated |
| R3491 |
T5874 |
T5872 |
amod |
associated,protein |
| R3492 |
T5875 |
T5874 |
punct |
-,associated |
| R3493 |
T5876 |
T5877 |
dep |
that,sequestered |
| R3494 |
T5877 |
T5872 |
relcl |
sequestered,protein |
| R3495 |
T5878 |
T5877 |
auxpass |
is,sequestered |
| R3496 |
T5879 |
T5877 |
advmod |
normally,sequestered |
| R3497 |
T5880 |
T5877 |
prep |
at,sequestered |
| R3498 |
T5881 |
T5882 |
det |
the,membrane |
| R3499 |
T5882 |
T5880 |
pobj |
membrane,at |
| R35 |
T185 |
T183 |
pobj |
structure,into |
| R350 |
T1151 |
T1152 |
compound |
TGF,βs |
| R3500 |
T5883 |
T5882 |
compound |
plasma,membrane |
| R3501 |
T5884 |
T5870 |
aux |
may,participate |
| R3502 |
T5885 |
T5870 |
prep |
in,participate |
| R3503 |
T5886 |
T5887 |
det |
a,pathway |
| R3504 |
T5887 |
T5885 |
pobj |
pathway,in |
| R3505 |
T5888 |
T5887 |
compound |
proliferation,pathway |
| R3506 |
T5889 |
T5887 |
compound |
signaling,pathway |
| R3507 |
T5890 |
T5891 |
advmod |
when,deconstructed |
| R3508 |
T5891 |
T5870 |
advcl |
deconstructed,participate |
| R3509 |
T5892 |
T5891 |
nsubjpass |
AJs,deconstructed |
| R351 |
T1152 |
T1147 |
appos |
βs,βs |
| R3510 |
T5893 |
T5891 |
auxpass |
are,deconstructed |
| R3511 |
T5894 |
T5863 |
punct |
.,raised |
| R3512 |
T5896 |
T5897 |
amod |
Numerous,studies |
| R3513 |
T5897 |
T5898 |
nsubj |
studies,correlated |
| R3514 |
T5899 |
T5898 |
aux |
have,correlated |
| R3515 |
T5900 |
T5901 |
det |
a,regulation |
| R3516 |
T5901 |
T5898 |
dobj |
regulation,correlated |
| R3517 |
T5902 |
T5901 |
amod |
down,regulation |
| R3518 |
T5903 |
T5901 |
punct |
-,regulation |
| R3519 |
T5904 |
T5901 |
prep |
of,regulation |
| R352 |
T1153 |
T1152 |
punct |
-,βs |
| R3520 |
T5905 |
T5906 |
compound |
E,cadherin |
| R3521 |
T5906 |
T5904 |
pobj |
cadherin,of |
| R3522 |
T5907 |
T5906 |
punct |
-,cadherin |
| R3523 |
T5908 |
T5898 |
prep |
with,correlated |
| R3524 |
T5909 |
T5910 |
det |
a,translocation |
| R3525 |
T5910 |
T5908 |
pobj |
translocation,with |
| R3526 |
T5911 |
T5910 |
prep |
of,translocation |
| R3527 |
T5912 |
T5913 |
compound |
β,catenin |
| R3528 |
T5913 |
T5911 |
pobj |
catenin,of |
| R3529 |
T5914 |
T5913 |
punct |
-,catenin |
| R353 |
T1154 |
T1137 |
punct |
),Wnts |
| R3530 |
T5915 |
T5910 |
prep |
to,translocation |
| R3531 |
T5916 |
T5917 |
det |
the,nucleus |
| R3532 |
T5917 |
T5915 |
pobj |
nucleus,to |
| R3533 |
T5918 |
T5910 |
cc |
and,translocation |
| R3534 |
T5919 |
T5920 |
det |
a,transactivation |
| R3535 |
T5920 |
T5910 |
conj |
transactivation,translocation |
| R3536 |
T5921 |
T5920 |
prep |
of,transactivation |
| R3537 |
T5922 |
T5921 |
pobj |
genes,of |
| R3538 |
T5923 |
T5924 |
dep |
that,regulated |
| R3539 |
T5924 |
T5922 |
relcl |
regulated,genes |
| R354 |
T1155 |
T1137 |
punct |
", ",Wnts |
| R3540 |
T5925 |
T5924 |
auxpass |
are,regulated |
| R3541 |
T5926 |
T5924 |
agent |
by,regulated |
| R3542 |
T5927 |
T5928 |
det |
the,family |
| R3543 |
T5928 |
T5926 |
pobj |
family,by |
| R3544 |
T5929 |
T5928 |
nmod |
LEF,family |
| R3545 |
T5930 |
T5929 |
punct |
-,LEF |
| R3546 |
T5931 |
T5929 |
nummod |
1,LEF |
| R3547 |
T5932 |
T5929 |
punct |
/,LEF |
| R3548 |
T5933 |
T5934 |
compound |
T,cell |
| R3549 |
T5934 |
T5935 |
compound |
cell,factor |
| R355 |
T1156 |
T1137 |
cc |
and,Wnts |
| R3550 |
T5935 |
T5929 |
appos |
factor,LEF |
| R3551 |
T5936 |
T5935 |
punct |
(,factor |
| R3552 |
T5937 |
T5935 |
appos |
TCF,factor |
| R3553 |
T5938 |
T5928 |
punct |
),family |
| R3554 |
T5939 |
T5928 |
prep |
of,family |
| R3555 |
T5940 |
T5941 |
npadvmod |
DNA,binding |
| R3556 |
T5941 |
T5942 |
amod |
binding,proteins |
| R3557 |
T5942 |
T5939 |
pobj |
proteins,of |
| R3558 |
T5943 |
T5944 |
punct |
[,25 |
| R3559 |
T5944 |
T5898 |
parataxis |
25,correlated |
| R356 |
T1157 |
T1158 |
compound |
fibroblast,factors |
| R3560 |
T5945 |
T5944 |
nummod |
23,25 |
| R3561 |
T5946 |
T5944 |
punct |
",",25 |
| R3562 |
T5947 |
T5944 |
nummod |
24,25 |
| R3563 |
T5948 |
T5944 |
punct |
",",25 |
| R3564 |
T5949 |
T5944 |
punct |
],25 |
| R3565 |
T5950 |
T5898 |
punct |
.,correlated |
| R3566 |
T5952 |
T5953 |
det |
The,presence |
| R3567 |
T5953 |
T5954 |
nsubj |
presence,was |
| R3568 |
T5955 |
T5953 |
prep |
of,presence |
| R3569 |
T5956 |
T5957 |
amod |
nuclear,D |
| R357 |
T1158 |
T1137 |
conj |
factors,Wnts |
| R3570 |
T5957 |
T5955 |
pobj |
D,of |
| R3571 |
T5958 |
T5957 |
compound |
cyclin,D |
| R3572 |
T5959 |
T5953 |
prep |
in,presence |
| R3573 |
T5960 |
T5961 |
amod |
hyperproliferative,epidermis |
| R3574 |
T5961 |
T5959 |
pobj |
epidermis,in |
| R3575 |
T5962 |
T5961 |
compound |
Snail,epidermis |
| R3576 |
T5963 |
T5961 |
compound |
Tg,epidermis |
| R3577 |
T5964 |
T5965 |
advmod |
particularly,intriguing |
| R3578 |
T5965 |
T5954 |
acomp |
intriguing,was |
| R3579 |
T5966 |
T5967 |
mark |
since,reported |
| R358 |
T1159 |
T1158 |
compound |
growth,factors |
| R3580 |
T5967 |
T5954 |
advcl |
reported,was |
| R3581 |
T5968 |
T5969 |
amod |
prior,studies |
| R3582 |
T5969 |
T5967 |
nsubj |
studies,reported |
| R3583 |
T5970 |
T5967 |
aux |
have,reported |
| R3584 |
T5971 |
T5972 |
compound |
cyclin,D |
| R3585 |
T5972 |
T5973 |
compound |
D,gene |
| R3586 |
T5973 |
T5967 |
dobj |
gene,reported |
| R3587 |
T5974 |
T5967 |
prep |
as,reported |
| R3588 |
T5975 |
T5976 |
det |
a,target |
| R3589 |
T5976 |
T5974 |
pobj |
target,as |
| R359 |
T1160 |
T1158 |
punct |
(,factors |
| R3590 |
T5977 |
T5976 |
amod |
direct,target |
| R3591 |
T5978 |
T5976 |
prep |
of,target |
| R3592 |
T5979 |
T5980 |
nmod |
TCF,β |
| R3593 |
T5980 |
T5982 |
nmod |
β,transcription |
| R3594 |
T5981 |
T5980 |
punct |
/,β |
| R3595 |
T5982 |
T5978 |
pobj |
transcription,of |
| R3596 |
T5983 |
T5980 |
punct |
-,β |
| R3597 |
T5984 |
T5980 |
appos |
catenin,β |
| R3598 |
T5985 |
T5986 |
punct |
[,26 |
| R3599 |
T5986 |
T5954 |
parataxis |
26,was |
| R36 |
T186 |
T185 |
compound |
bud,structure |
| R360 |
T1161 |
T1158 |
appos |
FGFs,factors |
| R3600 |
T5987 |
T5986 |
punct |
],26 |
| R3601 |
T5988 |
T5954 |
punct |
.,was |
| R3602 |
T5990 |
T5991 |
nsubj |
This,said |
| R3603 |
T5991 |
T5992 |
advcl |
said,detect |
| R3604 |
T5993 |
T5992 |
punct |
", ",detect |
| R3605 |
T5994 |
T5992 |
nsubj |
we,detect |
| R3606 |
T5995 |
T5992 |
aux |
did,detect |
| R3607 |
T5996 |
T5992 |
neg |
not,detect |
| R3608 |
T5997 |
T5998 |
amod |
nuclear,catenin |
| R3609 |
T5998 |
T5992 |
dobj |
catenin,detect |
| R361 |
T1162 |
T1129 |
punct |
),are |
| R3610 |
T5999 |
T5998 |
compound |
β,catenin |
| R3611 |
T6000 |
T5998 |
punct |
-,catenin |
| R3612 |
T6001 |
T5992 |
prep |
in,detect |
| R3613 |
T6002 |
T6003 |
poss |
our,epidermis |
| R3614 |
T6003 |
T6001 |
pobj |
epidermis,in |
| R3615 |
T6004 |
T6003 |
compound |
Tg,epidermis |
| R3616 |
T6005 |
T5992 |
punct |
", ",detect |
| R3617 |
T6006 |
T5992 |
cc |
and,detect |
| R3618 |
T6007 |
T6008 |
csubj |
mating,gave |
| R3619 |
T6008 |
T5992 |
conj |
gave,detect |
| R362 |
T1163 |
T1129 |
punct |
.,are |
| R3620 |
T6009 |
T6010 |
det |
the,mice |
| R3621 |
T6010 |
T6007 |
dobj |
mice,mating |
| R3622 |
T6011 |
T6010 |
compound |
Snail,mice |
| R3623 |
T6012 |
T6010 |
compound |
Tg,mice |
| R3624 |
T6013 |
T6007 |
prep |
against,mating |
| R3625 |
T6014 |
T6015 |
det |
the,mouse |
| R3626 |
T6015 |
T6013 |
pobj |
mouse,against |
| R3627 |
T6016 |
T6015 |
compound |
TOPGal,mouse |
| R3628 |
T6017 |
T6015 |
compound |
reporter,mouse |
| R3629 |
T6018 |
T6019 |
punct |
[,20 |
| R363 |
T1165 |
T1166 |
prep |
Through,trigger |
| R3630 |
T6019 |
T6007 |
parataxis |
20,mating |
| R3631 |
T6020 |
T6019 |
punct |
],20 |
| R3632 |
T6021 |
T6022 |
det |
no,signs |
| R3633 |
T6022 |
T6008 |
dobj |
signs,gave |
| R3634 |
T6023 |
T6022 |
prep |
of,signs |
| R3635 |
T6024 |
T6025 |
amod |
ectopic,activity |
| R3636 |
T6025 |
T6023 |
pobj |
activity,of |
| R3637 |
T6026 |
T6025 |
nmod |
LEF,activity |
| R3638 |
T6027 |
T6026 |
punct |
-,LEF |
| R3639 |
T6028 |
T6026 |
nummod |
1,LEF |
| R364 |
T1167 |
T1165 |
pobj |
activation,Through |
| R3640 |
T6029 |
T6026 |
punct |
/,LEF |
| R3641 |
T6030 |
T6026 |
appos |
Tcf,LEF |
| R3642 |
T6031 |
T6026 |
punct |
/,LEF |
| R3643 |
T6032 |
T6033 |
compound |
β,catenin |
| R3644 |
T6033 |
T6026 |
appos |
catenin,LEF |
| R3645 |
T6034 |
T6033 |
punct |
-,catenin |
| R3646 |
T6035 |
T6036 |
punct |
(,data |
| R3647 |
T6036 |
T6008 |
meta |
data,gave |
| R3648 |
T6037 |
T6036 |
amod |
unpublished,data |
| R3649 |
T6038 |
T6036 |
punct |
),data |
| R365 |
T1168 |
T1167 |
prep |
of,activation |
| R3650 |
T6039 |
T5992 |
punct |
.,detect |
| R3651 |
T6041 |
T6042 |
nsubj |
We,turned |
| R3652 |
T6043 |
T6042 |
advmod |
next,turned |
| R3653 |
T6044 |
T6042 |
prep |
to,turned |
| R3654 |
T6045 |
T6046 |
det |
the,presence |
| R3655 |
T6093 |
T6091 |
nummod |
2,protein |
| R3656 |
T6046 |
T6044 |
pobj |
presence,to |
| R3657 |
T6094 |
T6091 |
punct |
(,protein |
| R3658 |
T6095 |
T6091 |
appos |
Grb,protein |
| R3659 |
T6047 |
T6046 |
prep |
of,presence |
| R366 |
T1169 |
T1170 |
compound |
cell,surface |
| R3660 |
T6096 |
T6095 |
punct |
-,Grb |
| R3661 |
T6097 |
T6095 |
nummod |
2,Grb |
| R3662 |
T6048 |
T6049 |
amod |
cytoplasmic,Ajuba |
| R3663 |
T6098 |
T6091 |
punct |
),protein |
| R3664 |
T6099 |
T6091 |
punct |
/,protein |
| R3665 |
T6100 |
T6091 |
appos |
son,protein |
| R3666 |
T6049 |
T6047 |
pobj |
Ajuba,of |
| R3667 |
T6101 |
T6100 |
prep |
of,son |
| R3668 |
T6102 |
T6101 |
pobj |
sevenless,of |
| R3669 |
T6103 |
T6100 |
punct |
(,son |
| R367 |
T1170 |
T1171 |
compound |
surface,receptors |
| R3670 |
T6050 |
T6042 |
prep |
for,turned |
| R3671 |
T6104 |
T6100 |
appos |
Sos,son |
| R3672 |
T6105 |
T6091 |
punct |
),protein |
| R3673 |
T6106 |
T6091 |
punct |
", ",protein |
| R3674 |
T6051 |
T6052 |
det |
a,link |
| R3675 |
T6107 |
T6108 |
det |
the,factor |
| R3676 |
T6108 |
T6091 |
appos |
factor,protein |
| R3677 |
T6109 |
T6108 |
compound |
nucleotide,factor |
| R3678 |
T6052 |
T6050 |
pobj |
link,for |
| R3679 |
T6110 |
T6108 |
compound |
exchange,factor |
| R368 |
T1171 |
T1168 |
pobj |
receptors,of |
| R3680 |
T6111 |
T6108 |
prep |
for,factor |
| R3681 |
T6112 |
T6111 |
pobj |
Ras,for |
| R3682 |
T6053 |
T6052 |
amod |
possible,link |
| R3683 |
T6113 |
T6112 |
punct |
", ",Ras |
| R3684 |
T6114 |
T6115 |
dep |
which,is |
| R3685 |
T6115 |
T6112 |
relcl |
is,Ras |
| R3686 |
T6054 |
T6052 |
amod |
mechanistic,link |
| R3687 |
T6116 |
T6115 |
advmod |
upstream,is |
| R3688 |
T6117 |
T6116 |
prep |
from,upstream |
| R3689 |
T6118 |
T6117 |
pobj |
activation,from |
| R369 |
T1172 |
T1171 |
compound |
transmembrane,receptors |
| R3690 |
T6119 |
T6118 |
prep |
of,activation |
| R3691 |
T6055 |
T6052 |
prep |
to,link |
| R3692 |
T6120 |
T6119 |
pobj |
MAPK,of |
| R3693 |
T6121 |
T6122 |
punct |
[,9 |
| R3694 |
T6056 |
T6057 |
det |
the,increase |
| R3695 |
T6122 |
T6067 |
parataxis |
9,associate |
| R3696 |
T6123 |
T6122 |
punct |
],9 |
| R3697 |
T6124 |
T6067 |
punct |
.,associate |
| R3698 |
T6057 |
T6055 |
pobj |
increase,to |
| R3699 |
T6126 |
T6127 |
prep |
Given,examined |
| R37 |
T187 |
T163 |
punct |
.,exchange |
| R370 |
T1173 |
T1166 |
punct |
", ",trigger |
| R3700 |
T6058 |
T6057 |
amod |
proliferative,increase |
| R3701 |
T6128 |
T6129 |
det |
the,increase |
| R3702 |
T6129 |
T6126 |
pobj |
increase,Given |
| R3703 |
T6130 |
T6129 |
prep |
in,increase |
| R3704 |
T6131 |
T6132 |
compound |
pMAPK,staining |
| R3705 |
T6059 |
T6057 |
prep |
in,increase |
| R3706 |
T6132 |
T6130 |
pobj |
staining,in |
| R3707 |
T6060 |
T6061 |
poss |
our,epidermis |
| R3708 |
T6133 |
T6129 |
prep |
in,increase |
| R3709 |
T6134 |
T6135 |
compound |
Tg,skin |
| R371 |
T1174 |
T1175 |
det |
these,molecules |
| R3710 |
T6061 |
T6059 |
pobj |
epidermis,in |
| R3711 |
T6135 |
T6133 |
pobj |
skin,in |
| R3712 |
T6136 |
T6127 |
punct |
", ",examined |
| R3713 |
T6137 |
T6127 |
nsubj |
we,examined |
| R3714 |
T6062 |
T6061 |
compound |
Snail,epidermis |
| R3715 |
T6138 |
T6139 |
det |
the,possibility |
| R3716 |
T6139 |
T6127 |
dobj |
possibility,examined |
| R3717 |
T6140 |
T6141 |
mark |
that,changed |
| R3718 |
T6063 |
T6061 |
compound |
Tg,epidermis |
| R3719 |
T6141 |
T6139 |
acl |
changed,possibility |
| R372 |
T1175 |
T1166 |
nsubj |
molecules,trigger |
| R3720 |
T6142 |
T6141 |
nsubj |
Ajuba,changed |
| R3721 |
T6143 |
T6141 |
aux |
might,changed |
| R3722 |
T6064 |
T6042 |
punct |
.,turned |
| R3723 |
T6144 |
T6141 |
aux |
have,changed |
| R3724 |
T6145 |
T6146 |
poss |
its,partner |
| R3725 |
T6146 |
T6141 |
dobj |
partner,changed |
| R3726 |
T6066 |
T6067 |
prep |
In,associate |
| R3727 |
T6147 |
T6146 |
compound |
binding,partner |
| R3728 |
T6148 |
T6141 |
prep |
in,changed |
| R3729 |
T6149 |
T6150 |
npadvmod |
Snail,expressing |
| R373 |
T1176 |
T1175 |
amod |
external,molecules |
| R3730 |
T6150 |
T6152 |
amod |
expressing,epidermis |
| R3731 |
T6151 |
T6150 |
punct |
-,expressing |
| R3732 |
T6068 |
T6066 |
pobj |
addition,In |
| R3733 |
T6152 |
T6148 |
pobj |
epidermis,in |
| R3734 |
T6153 |
T6127 |
punct |
.,examined |
| R3735 |
T6155 |
T6156 |
advmod |
Interestingly,detected |
| R3736 |
T6069 |
T6068 |
prep |
to,addition |
| R3737 |
T6157 |
T6156 |
punct |
", ",detected |
| R3738 |
T6070 |
T6071 |
poss |
its,ability |
| R3739 |
T6158 |
T6156 |
nsubjpass |
Ajuba,detected |
| R374 |
T1177 |
T1175 |
compound |
signaling,molecules |
| R3740 |
T6159 |
T6156 |
auxpass |
was,detected |
| R3741 |
T6160 |
T6156 |
advmod |
readily,detected |
| R3742 |
T6071 |
T6069 |
pobj |
ability,to |
| R3743 |
T6161 |
T6156 |
prep |
in,detected |
| R3744 |
T6162 |
T6163 |
amod |
anti-Grb,immunoprecipitates |
| R3745 |
T6163 |
T6161 |
pobj |
immunoprecipitates,in |
| R3746 |
T6072 |
T6071 |
amod |
documented,ability |
| R3747 |
T6164 |
T6162 |
punct |
-,anti-Grb |
| R3748 |
T6165 |
T6162 |
advmod |
2,anti-Grb |
| R3749 |
T6073 |
T6074 |
aux |
to,bind |
| R375 |
T1178 |
T1179 |
amod |
distinct,cascades |
| R3750 |
T6166 |
T6163 |
prep |
of,immunoprecipitates |
| R3751 |
T6167 |
T6168 |
compound |
protein,lysates |
| R3752 |
T6168 |
T6166 |
pobj |
lysates,of |
| R3753 |
T6074 |
T6071 |
acl |
bind,ability |
| R3754 |
T6169 |
T6168 |
prep |
from,lysates |
| R3755 |
T6170 |
T6169 |
pobj |
skins,from |
| R3756 |
T6171 |
T6170 |
prep |
of,skins |
| R3757 |
T6075 |
T6076 |
compound |
α,catenin |
| R3758 |
T6172 |
T6173 |
compound |
Snail,mice |
| R3759 |
T6173 |
T6171 |
pobj |
mice,of |
| R376 |
T1179 |
T1166 |
dobj |
cascades,trigger |
| R3760 |
T6076 |
T6074 |
dobj |
catenin,bind |
| R3761 |
T6174 |
T6173 |
compound |
Tg,mice |
| R3762 |
T6175 |
T6169 |
cc |
but,from |
| R3763 |
T6176 |
T6175 |
neg |
not,but |
| R3764 |
T6077 |
T6076 |
punct |
-,catenin |
| R3765 |
T6177 |
T6169 |
conj |
from,from |
| R3766 |
T6178 |
T6179 |
det |
the,animals |
| R3767 |
T6078 |
T6079 |
punct |
[,10 |
| R3768 |
T6179 |
T6177 |
pobj |
animals,from |
| R3769 |
T6180 |
T6179 |
amod |
corresponding,animals |
| R377 |
T1180 |
T1179 |
prep |
of,cascades |
| R3770 |
T6181 |
T6182 |
amod |
wild,type |
| R3771 |
T6079 |
T6068 |
parataxis |
10,addition |
| R3772 |
T6182 |
T6179 |
nmod |
type,animals |
| R3773 |
T6183 |
T6182 |
punct |
-,type |
| R3774 |
T6184 |
T6182 |
punct |
(,type |
| R3775 |
T6080 |
T6079 |
punct |
],10 |
| R3776 |
T6185 |
T6182 |
appos |
WT,type |
| R3777 |
T6186 |
T6179 |
punct |
),animals |
| R3778 |
T6081 |
T6067 |
punct |
", ",associate |
| R3779 |
T6187 |
T6188 |
punct |
(,4E |
| R378 |
T1181 |
T1182 |
amod |
intracellular,events |
| R3780 |
T6188 |
T6156 |
parataxis |
4E,detected |
| R3781 |
T6189 |
T6188 |
compound |
Figure,4E |
| R3782 |
T6082 |
T6067 |
nsubj |
Ajuba,associate |
| R3783 |
T6190 |
T6188 |
punct |
),4E |
| R3784 |
T6191 |
T6156 |
punct |
.,detected |
| R3785 |
T6083 |
T6067 |
aux |
can,associate |
| R3786 |
T6193 |
T6194 |
advmod |
When,repeated |
| R3787 |
T6194 |
T6198 |
advcl |
repeated,detected |
| R3788 |
T6195 |
T6196 |
det |
these,experiments |
| R3789 |
T6084 |
T6067 |
advmod |
also,associate |
| R379 |
T1182 |
T1180 |
pobj |
events,of |
| R3790 |
T6196 |
T6194 |
nsubjpass |
experiments,repeated |
| R3791 |
T6197 |
T6194 |
auxpass |
were,repeated |
| R3792 |
T6085 |
T6067 |
prep |
with,associate |
| R3793 |
T6086 |
T6087 |
compound |
growth,factor |
| R3794 |
T6087 |
T6088 |
compound |
factor,receptor |
| R3795 |
T6199 |
T6194 |
prep |
with,repeated |
| R3796 |
T6088 |
T6089 |
npadvmod |
receptor,bound |
| R3797 |
T6200 |
T6201 |
compound |
α,catenin |
| R3798 |
T6201 |
T6203 |
npadvmod |
catenin,null |
| R3799 |
T6202 |
T6201 |
punct |
-,catenin |
| R38 |
T189 |
T190 |
advcl |
Using,employed |
| R380 |
T1183 |
T1184 |
dep |
that,culminate |
| R3800 |
T6089 |
T6091 |
amod |
bound,protein |
| R3801 |
T6203 |
T6205 |
amod |
null,epidermis |
| R3802 |
T6204 |
T6203 |
punct |
-,null |
| R3803 |
T6205 |
T6199 |
pobj |
epidermis,with |
| R3804 |
T6090 |
T6089 |
punct |
-,bound |
| R3805 |
T6206 |
T6198 |
punct |
", ",detected |
| R3806 |
T6207 |
T6208 |
det |
a,association |
| R3807 |
T6208 |
T6198 |
nsubjpass |
association,detected |
| R3808 |
T6209 |
T6208 |
amod |
similar,association |
| R3809 |
T6210 |
T6211 |
nmod |
Grb,Ajuba |
| R381 |
T1184 |
T1179 |
relcl |
culminate,cascades |
| R3810 |
T6211 |
T6208 |
compound |
Ajuba,association |
| R3811 |
T6091 |
T6085 |
pobj |
protein,with |
| R3812 |
T6212 |
T6211 |
punct |
-,Ajuba |
| R3813 |
T6213 |
T6211 |
nummod |
2,Ajuba |
| R3814 |
T6214 |
T6211 |
punct |
-,Ajuba |
| R3815 |
T6215 |
T6198 |
auxpass |
was,detected |
| R3816 |
T6092 |
T6091 |
punct |
-,protein |
| R3817 |
T6216 |
T6198 |
punct |
", ",detected |
| R3818 |
T6217 |
T6198 |
cc |
and,detected |
| R3819 |
T6218 |
T6219 |
advmod |
again,detected |
| R382 |
T1185 |
T1184 |
prep |
in,culminate |
| R3820 |
T6303 |
T6286 |
acomp |
relevant,is |
| R3821 |
T6219 |
T6198 |
conj |
detected,detected |
| R3822 |
T6220 |
T6219 |
punct |
", ",detected |
| R3823 |
T6221 |
T6222 |
det |
this,interaction |
| R3824 |
T6222 |
T6219 |
nsubjpass |
interaction,detected |
| R3825 |
T6223 |
T6219 |
auxpass |
was,detected |
| R3826 |
T6304 |
T6303 |
prep |
to,relevant |
| R3827 |
T6224 |
T6219 |
neg |
not,detected |
| R3828 |
T6225 |
T6219 |
prep |
in,detected |
| R3829 |
T6226 |
T6227 |
det |
the,extracts |
| R383 |
T1186 |
T1185 |
pobj |
changes,in |
| R3830 |
T6227 |
T6225 |
pobj |
extracts,in |
| R3831 |
T6305 |
T6306 |
det |
the,state |
| R3832 |
T6228 |
T6227 |
compound |
protein,extracts |
| R3833 |
T6229 |
T6227 |
prep |
from,extracts |
| R3834 |
T6230 |
T6231 |
compound |
control,skin |
| R3835 |
T6306 |
T6304 |
pobj |
state,to |
| R3836 |
T6231 |
T6229 |
pobj |
skin,from |
| R3837 |
T6232 |
T6231 |
compound |
littermate,skin |
| R3838 |
T6233 |
T6234 |
punct |
(,4E |
| R3839 |
T6307 |
T6306 |
amod |
hyperproliferative,state |
| R384 |
T1187 |
T1186 |
prep |
in,changes |
| R3840 |
T6234 |
T6219 |
parataxis |
4E,detected |
| R3841 |
T6235 |
T6234 |
compound |
Figure,4E |
| R3842 |
T6236 |
T6234 |
punct |
),4E |
| R3843 |
T6308 |
T6306 |
prep |
of,state |
| R3844 |
T6237 |
T6198 |
punct |
.,detected |
| R3845 |
T6239 |
T6240 |
advmod |
Together,demonstrate |
| R3846 |
T6309 |
T6310 |
det |
a,keratinocyte |
| R3847 |
T6241 |
T6240 |
punct |
", ",demonstrate |
| R3848 |
T6242 |
T6243 |
det |
these,data |
| R3849 |
T6243 |
T6240 |
nsubj |
data,demonstrate |
| R385 |
T1188 |
T1189 |
compound |
gene,expression |
| R3850 |
T6310 |
T6308 |
pobj |
keratinocyte,of |
| R3851 |
T6244 |
T6245 |
mark |
that,allows |
| R3852 |
T6311 |
T6301 |
punct |
", ",expected |
| R3853 |
T6245 |
T6240 |
ccomp |
allows,demonstrate |
| R3854 |
T6246 |
T6247 |
det |
the,reduction |
| R3855 |
T6312 |
T6301 |
advmod |
then,expected |
| R3856 |
T6247 |
T6245 |
nsubj |
reduction,allows |
| R3857 |
T6248 |
T6247 |
prep |
in,reduction |
| R3858 |
T6249 |
T6250 |
compound |
α,catenin |
| R3859 |
T6250 |
T6252 |
compound |
catenin,levels |
| R386 |
T1189 |
T1187 |
pobj |
expression,in |
| R3860 |
T6251 |
T6250 |
punct |
-,catenin |
| R3861 |
T6252 |
T6248 |
pobj |
levels,in |
| R3862 |
T6253 |
T6247 |
punct |
", ",reduction |
| R3863 |
T6313 |
T6301 |
nsubjpass |
overexpression,expected |
| R3864 |
T6254 |
T6255 |
preconj |
either,by |
| R3865 |
T6255 |
T6247 |
prep |
by,reduction |
| R3866 |
T6256 |
T6257 |
npadvmod |
Snail,mediated |
| R3867 |
T6314 |
T6313 |
prep |
of,overexpression |
| R3868 |
T6257 |
T6259 |
amod |
mediated,regulation |
| R3869 |
T6258 |
T6257 |
punct |
-,mediated |
| R387 |
T1190 |
T1189 |
punct |
", ",expression |
| R3870 |
T6259 |
T6255 |
pobj |
regulation,by |
| R3871 |
T6315 |
T6314 |
pobj |
Ajuba,of |
| R3872 |
T6260 |
T6259 |
amod |
down,regulation |
| R3873 |
T6261 |
T6259 |
punct |
-,regulation |
| R3874 |
T6262 |
T6259 |
prep |
of,regulation |
| R3875 |
T6316 |
T6301 |
aux |
would,expected |
| R3876 |
T6263 |
T6264 |
compound |
E,cadherin |
| R3877 |
T6264 |
T6262 |
pobj |
cadherin,of |
| R3878 |
T6265 |
T6264 |
punct |
-,cadherin |
| R3879 |
T6317 |
T6301 |
auxpass |
be,expected |
| R388 |
T1191 |
T1189 |
conj |
growth,expression |
| R3880 |
T6266 |
T6255 |
cc |
or,by |
| R3881 |
T6267 |
T6255 |
conj |
by,by |
| R3882 |
T6268 |
T6269 |
compound |
α,catenin |
| R3883 |
T6318 |
T6319 |
aux |
to,bypass |
| R3884 |
T6269 |
T6271 |
npadvmod |
catenin,conditional |
| R3885 |
T6270 |
T6269 |
punct |
-,catenin |
| R3886 |
T6271 |
T6272 |
amod |
conditional,targeting |
| R3887 |
T6319 |
T6301 |
xcomp |
bypass,expected |
| R3888 |
T6272 |
T6267 |
pobj |
targeting,by |
| R3889 |
T6273 |
T6245 |
punct |
", ",allows |
| R389 |
T1192 |
T1191 |
punct |
", ",growth |
| R3890 |
T6274 |
T6275 |
nsubj |
Ajuba,interact |
| R3891 |
T6320 |
T6321 |
det |
the,competition |
| R3892 |
T6275 |
T6245 |
ccomp |
interact,allows |
| R3893 |
T6276 |
T6275 |
aux |
to,interact |
| R3894 |
T6277 |
T6275 |
prep |
with,interact |
| R3895 |
T6321 |
T6319 |
dobj |
competition,bypass |
| R3896 |
T6278 |
T6277 |
pobj |
Grb,with |
| R3897 |
T6279 |
T6278 |
punct |
-,Grb |
| R3898 |
T6280 |
T6278 |
nummod |
2,Grb |
| R3899 |
T6281 |
T6278 |
punct |
/,Grb |
| R39 |
T191 |
T192 |
compound |
hair,bud |
| R390 |
T1193 |
T1191 |
cc |
and,growth |
| R3900 |
T6322 |
T6319 |
cc |
and,bypass |
| R3901 |
T6282 |
T6278 |
appos |
Sos,Grb |
| R3902 |
T6283 |
T6240 |
punct |
.,demonstrate |
| R3903 |
T6323 |
T6319 |
conj |
promote,bypass |
| R3904 |
T6285 |
T6286 |
mark |
If,is |
| R3905 |
T6286 |
T6301 |
advcl |
is,expected |
| R3906 |
T6287 |
T6288 |
det |
the,competition |
| R3907 |
T6324 |
T6323 |
dobj |
activation,promote |
| R3908 |
T6288 |
T6286 |
nsubj |
competition,is |
| R3909 |
T6289 |
T6288 |
prep |
between,competition |
| R391 |
T1194 |
T1191 |
conj |
differentiation,growth |
| R3910 |
T6290 |
T6289 |
pobj |
Grb,between |
| R3911 |
T6291 |
T6290 |
punct |
-,Grb |
| R3912 |
T6292 |
T6290 |
nummod |
2,Grb |
| R3913 |
T6293 |
T6290 |
punct |
/,Grb |
| R3914 |
T6294 |
T6290 |
appos |
Sos,Grb |
| R3915 |
T6325 |
T6324 |
prep |
of,activation |
| R3916 |
T6295 |
T6290 |
cc |
and,Grb |
| R3917 |
T6296 |
T6297 |
compound |
α,catenin |
| R3918 |
T6297 |
T6290 |
conj |
catenin,Grb |
| R3919 |
T6326 |
T6327 |
det |
the,pathway |
| R392 |
T1195 |
T1196 |
punct |
[,2 |
| R3920 |
T6298 |
T6297 |
punct |
-,catenin |
| R3921 |
T6299 |
T6288 |
prep |
for,competition |
| R3922 |
T6300 |
T6299 |
pobj |
Ajuba,for |
| R3923 |
T6327 |
T6325 |
pobj |
pathway,of |
| R3924 |
T6302 |
T6303 |
advmod |
functionally,relevant |
| R3925 |
T6328 |
T6329 |
compound |
Ras,MAPK |
| R3926 |
T6329 |
T6327 |
compound |
MAPK,pathway |
| R3927 |
T6330 |
T6329 |
punct |
-,MAPK |
| R3928 |
T6331 |
T6324 |
prep |
in,activation |
| R3929 |
T6409 |
T6407 |
oprd |
inh,marked |
| R393 |
T1196 |
T1166 |
parataxis |
2,trigger |
| R3930 |
T6410 |
T6405 |
punct |
”,see |
| R3931 |
T6332 |
T6333 |
compound |
WT,keratinocytes |
| R3932 |
T6411 |
T6402 |
punct |
),4F |
| R3933 |
T6412 |
T6413 |
punct |
[,27 |
| R3934 |
T6413 |
T6380 |
parataxis |
27,abolished |
| R3935 |
T6333 |
T6331 |
pobj |
keratinocytes,in |
| R3936 |
T6414 |
T6413 |
punct |
],27 |
| R3937 |
T6415 |
T6380 |
punct |
.,abolished |
| R3938 |
T6334 |
T6301 |
punct |
.,expected |
| R3939 |
T6417 |
T6418 |
poss |
Ajuba,domain |
| R394 |
T1197 |
T1196 |
punct |
],2 |
| R3940 |
T6418 |
T6421 |
nsubj |
domain,is |
| R3941 |
T6419 |
T6417 |
case |
's,Ajuba |
| R3942 |
T6336 |
T6337 |
advmod |
Indeed,were |
| R3943 |
T6420 |
T6418 |
amod |
pre-LIM,domain |
| R3944 |
T6422 |
T6423 |
det |
the,segment |
| R3945 |
T6423 |
T6421 |
attr |
segment,is |
| R3946 |
T6338 |
T6337 |
punct |
", ",were |
| R3947 |
T6424 |
T6425 |
dep |
that,associates |
| R3948 |
T6339 |
T6340 |
advmod |
when,transfected |
| R3949 |
T6425 |
T6423 |
relcl |
associates,segment |
| R395 |
T1198 |
T1166 |
punct |
.,trigger |
| R3950 |
T6426 |
T6425 |
prep |
with,associates |
| R3951 |
T6340 |
T6337 |
advcl |
transfected,were |
| R3952 |
T6427 |
T6428 |
poss |
Grb,domain |
| R3953 |
T6428 |
T6426 |
pobj |
domain,with |
| R3954 |
T6429 |
T6427 |
punct |
-,Grb |
| R3955 |
T6341 |
T6342 |
npadvmod |
serum,starved |
| R3956 |
T6430 |
T6427 |
nummod |
2,Grb |
| R3957 |
T6431 |
T6427 |
case |
's,Grb |
| R3958 |
T6432 |
T6433 |
nmod |
Src,homology |
| R3959 |
T6433 |
T6428 |
nmod |
homology,domain |
| R396 |
T1200 |
T1201 |
advmod |
How,collaborates |
| R3960 |
T6342 |
T6344 |
amod |
starved,keratinocytes |
| R3961 |
T6434 |
T6433 |
punct |
-,homology |
| R3962 |
T6435 |
T6433 |
nummod |
3,homology |
| R3963 |
T6436 |
T6437 |
punct |
[,9 |
| R3964 |
T6437 |
T6421 |
parataxis |
9,is |
| R3965 |
T6438 |
T6437 |
punct |
],9 |
| R3966 |
T6439 |
T6421 |
punct |
.,is |
| R3967 |
T6343 |
T6342 |
punct |
-,starved |
| R3968 |
T6441 |
T6442 |
advmod |
When,overexpressed |
| R3969 |
T6442 |
T6446 |
advcl |
overexpressed,observed |
| R397 |
T1201 |
T1206 |
csubj |
collaborates,has |
| R3970 |
T6344 |
T6340 |
nsubjpass |
keratinocytes,transfected |
| R3971 |
T6443 |
T6444 |
det |
this,domain |
| R3972 |
T6444 |
T6442 |
nsubjpass |
domain,overexpressed |
| R3973 |
T6445 |
T6442 |
auxpass |
was,overexpressed |
| R3974 |
T6345 |
T6340 |
auxpass |
were,transfected |
| R3975 |
T6447 |
T6442 |
prep |
in,overexpressed |
| R3976 |
T6448 |
T6449 |
npadvmod |
serum,starved |
| R3977 |
T6346 |
T6340 |
advmod |
transiently,transfected |
| R3978 |
T6449 |
T6451 |
amod |
starved,keratinocytes |
| R3979 |
T6450 |
T6449 |
punct |
-,starved |
| R398 |
T1202 |
T1203 |
det |
this,constellation |
| R3980 |
T6451 |
T6447 |
pobj |
keratinocytes,in |
| R3981 |
T6347 |
T6340 |
prep |
with,transfected |
| R3982 |
T6452 |
T6446 |
punct |
", ",observed |
| R3983 |
T6453 |
T6454 |
det |
a,elevation |
| R3984 |
T6454 |
T6446 |
nsubjpass |
elevation,observed |
| R3985 |
T6348 |
T6349 |
det |
an,vector |
| R3986 |
T6455 |
T6454 |
amod |
comparable,elevation |
| R3987 |
T6456 |
T6454 |
prep |
in,elevation |
| R3988 |
T6457 |
T6456 |
pobj |
pMAPK,in |
| R3989 |
T6458 |
T6446 |
auxpass |
was,observed |
| R399 |
T1203 |
T1201 |
nsubj |
constellation,collaborates |
| R3990 |
T6349 |
T6347 |
pobj |
vector,with |
| R3991 |
T6459 |
T6460 |
punct |
(,4F |
| R3992 |
T6460 |
T6446 |
parataxis |
4F,observed |
| R3993 |
T6461 |
T6460 |
compound |
Figure,4F |
| R3994 |
T6350 |
T6351 |
compound |
Ajuba,expression |
| R3995 |
T6462 |
T6460 |
punct |
),4F |
| R3996 |
T6463 |
T6446 |
punct |
.,observed |
| R3997 |
T6351 |
T6349 |
compound |
expression,vector |
| R3998 |
T6465 |
T6466 |
mark |
As,expected |
| R3999 |
T6466 |
T6467 |
advcl |
expected,blocked |
| R4 |
T151 |
T152 |
compound |
TGF,β2 |
| R40 |
T192 |
T193 |
compound |
bud,morphogenesis |
| R400 |
T1204 |
T1203 |
prep |
of,constellation |
| R4000 |
T6352 |
T6337 |
punct |
", ",were |
| R4001 |
T6468 |
T6467 |
punct |
", ",blocked |
| R4002 |
T6469 |
T6470 |
det |
the,inhibitor |
| R4003 |
T6470 |
T6467 |
nsubj |
inhibitor,blocked |
| R4004 |
T6471 |
T6470 |
amod |
small,inhibitor |
| R4005 |
T6353 |
T6354 |
det |
the,levels |
| R4006 |
T6472 |
T6470 |
compound |
peptide,inhibitor |
| R4007 |
T6473 |
T6474 |
dep |
that,interrupts |
| R4008 |
T6474 |
T6470 |
relcl |
interrupts,inhibitor |
| R4009 |
T6354 |
T6337 |
nsubj |
levels,were |
| R401 |
T1205 |
T1204 |
pobj |
signals,of |
| R4010 |
T6475 |
T6476 |
det |
the,association |
| R4011 |
T6476 |
T6474 |
dobj |
association,interrupts |
| R4012 |
T6477 |
T6476 |
nmod |
Grb,association |
| R4013 |
T6478 |
T6477 |
punct |
-,Grb |
| R4014 |
T6479 |
T6477 |
nummod |
2,Grb |
| R4015 |
T6355 |
T6354 |
prep |
of,levels |
| R4016 |
T6480 |
T6477 |
punct |
/,Grb |
| R4017 |
T6481 |
T6477 |
appos |
Sos,Grb |
| R4018 |
T6482 |
T6483 |
det |
the,effects |
| R4019 |
T6483 |
T6467 |
dobj |
effects,blocked |
| R402 |
T1207 |
T1201 |
prep |
in,collaborates |
| R4020 |
T6356 |
T6355 |
pobj |
pMAPK,of |
| R4021 |
T6484 |
T6467 |
punct |
.,blocked |
| R4022 |
T6486 |
T6487 |
det |
These,data |
| R4023 |
T6357 |
T6358 |
preconj |
not,elevated |
| R4024 |
T6487 |
T6488 |
nsubj |
data,suggested |
| R4025 |
T6489 |
T6490 |
mark |
that,associate |
| R4026 |
T6358 |
T6337 |
acomp |
elevated,were |
| R4027 |
T6490 |
T6488 |
ccomp |
associate,suggested |
| R4028 |
T6491 |
T6490 |
prep |
by,associate |
| R4029 |
T6492 |
T6491 |
pcomp |
elevating,by |
| R403 |
T1208 |
T1207 |
pcomp |
tailoring,in |
| R4030 |
T6493 |
T6494 |
amod |
cytosolic,levels |
| R4031 |
T6359 |
T6357 |
advmod |
only,not |
| R4032 |
T6494 |
T6492 |
dobj |
levels,elevating |
| R4033 |
T6495 |
T6494 |
compound |
Ajuba,levels |
| R4034 |
T6496 |
T6490 |
punct |
", ",associate |
| R4035 |
T6360 |
T6358 |
cc |
but,elevated |
| R4036 |
T6497 |
T6498 |
poss |
Ajuba,domain |
| R4037 |
T6498 |
T6490 |
nsubj |
domain,associate |
| R4038 |
T6499 |
T6497 |
case |
's,Ajuba |
| R4039 |
T6500 |
T6498 |
amod |
pre-LIM,domain |
| R404 |
T1209 |
T1210 |
det |
each,process |
| R4040 |
T6361 |
T6360 |
advmod |
also,but |
| R4041 |
T6501 |
T6490 |
aux |
may,associate |
| R4042 |
T6502 |
T6490 |
prep |
with,associate |
| R4043 |
T6503 |
T6502 |
pobj |
Grb,with |
| R4044 |
T6362 |
T6358 |
conj |
comparable,elevated |
| R4045 |
T6504 |
T6503 |
punct |
-,Grb |
| R4046 |
T6505 |
T6503 |
nummod |
2,Grb |
| R4047 |
T6506 |
T6503 |
punct |
/,Grb |
| R4048 |
T6363 |
T6362 |
prep |
to,comparable |
| R4049 |
T6507 |
T6503 |
appos |
Sos,Grb |
| R405 |
T1210 |
T1208 |
dobj |
process,tailoring |
| R4050 |
T6508 |
T6490 |
prep |
in,associate |
| R4051 |
T6509 |
T6510 |
det |
a,manner |
| R4052 |
T6364 |
T6363 |
pobj |
those,to |
| R4053 |
T6510 |
T6508 |
pobj |
manner,in |
| R4054 |
T6511 |
T6512 |
dep |
that,stimulates |
| R4055 |
T6365 |
T6364 |
acl |
transfected,those |
| R4056 |
T6512 |
T6510 |
relcl |
stimulates,manner |
| R4057 |
T6513 |
T6514 |
poss |
its,activity |
| R4058 |
T6366 |
T6365 |
prep |
with,transfected |
| R4059 |
T6367 |
T6368 |
det |
the,transgene |
| R406 |
T1211 |
T1210 |
compound |
budding,process |
| R4060 |
T6368 |
T6366 |
pobj |
transgene,with |
| R4061 |
T6514 |
T6512 |
dobj |
activity,stimulates |
| R4062 |
T6515 |
T6514 |
compound |
nucleotide,activity |
| R4063 |
T6516 |
T6514 |
compound |
exchange,activity |
| R4064 |
T6369 |
T6370 |
compound |
K14,HASnail |
| R4065 |
T6517 |
T6512 |
cc |
and,stimulates |
| R4066 |
T6518 |
T6512 |
conj |
leads,stimulates |
| R4067 |
T6370 |
T6368 |
compound |
HASnail,transgene |
| R4068 |
T6519 |
T6518 |
prep |
to,leads |
| R4069 |
T6520 |
T6519 |
pobj |
activation,to |
| R407 |
T1212 |
T1213 |
mark |
so,executes |
| R4070 |
T6521 |
T6520 |
prep |
of,activation |
| R4071 |
T6371 |
T6370 |
punct |
-,HASnail |
| R4072 |
T6522 |
T6523 |
det |
the,pathway |
| R4073 |
T6523 |
T6521 |
pobj |
pathway,of |
| R4074 |
T6524 |
T6525 |
compound |
Ras,MAPK |
| R4075 |
T6372 |
T6373 |
punct |
(,4F |
| R4076 |
T6525 |
T6523 |
compound |
MAPK,pathway |
| R4077 |
T6526 |
T6525 |
punct |
-,MAPK |
| R4078 |
T6527 |
T6488 |
punct |
.,suggested |
| R4079 |
T6373 |
T6337 |
parataxis |
4F,were |
| R408 |
T1213 |
T1208 |
advcl |
executes,tailoring |
| R4080 |
T6529 |
T6530 |
mark |
Although,provides |
| R4081 |
T6530 |
T6533 |
advcl |
provides,known |
| R4082 |
T6374 |
T6373 |
compound |
Figure,4F |
| R4083 |
T6531 |
T6532 |
det |
this,pathway |
| R4084 |
T6532 |
T6530 |
nsubj |
pathway,provides |
| R4085 |
T6375 |
T6373 |
punct |
),4F |
| R4086 |
T6534 |
T6535 |
nummod |
one,mechanism |
| R4087 |
T6535 |
T6530 |
dobj |
mechanism,provides |
| R4088 |
T6536 |
T6537 |
prep |
by,coupled |
| R4089 |
T6537 |
T6535 |
relcl |
coupled,mechanism |
| R409 |
T1214 |
T1213 |
mark |
that,executes |
| R4090 |
T6376 |
T6337 |
punct |
.,were |
| R4091 |
T6538 |
T6536 |
pobj |
which,by |
| R4092 |
T6539 |
T6540 |
compound |
Snail,expression |
| R4093 |
T6540 |
T6537 |
nsubjpass |
expression,coupled |
| R4094 |
T6378 |
T6379 |
det |
This,activation |
| R4095 |
T6541 |
T6540 |
cc |
and,expression |
| R4096 |
T6542 |
T6540 |
conj |
proliferation,expression |
| R4097 |
T6543 |
T6537 |
aux |
may,coupled |
| R4098 |
T6544 |
T6537 |
auxpass |
be,coupled |
| R4099 |
T6379 |
T6380 |
nsubjpass |
activation,abolished |
| R41 |
T193 |
T189 |
dobj |
morphogenesis,Using |
| R410 |
T1215 |
T1213 |
nsubj |
it,executes |
| R4100 |
T6545 |
T6537 |
prep |
in,coupled |
| R4101 |
T6546 |
T6547 |
compound |
skin,epithelium |
| R4102 |
T6547 |
T6545 |
pobj |
epithelium,in |
| R4103 |
T6381 |
T6380 |
auxpass |
was,abolished |
| R4104 |
T6548 |
T6533 |
punct |
", ",known |
| R4105 |
T6549 |
T6550 |
amod |
proliferative,circuitries |
| R4106 |
T6550 |
T6533 |
nsubjpass |
circuitries,known |
| R4107 |
T6551 |
T6550 |
acl |
involving,circuitries |
| R4108 |
T6382 |
T6383 |
advmod |
when,treated |
| R4109 |
T6552 |
T6551 |
dobj |
AJs,involving |
| R411 |
T1216 |
T1217 |
det |
a,program |
| R4110 |
T6553 |
T6533 |
auxpass |
are,known |
| R4111 |
T6554 |
T6555 |
aux |
to,be |
| R4112 |
T6555 |
T6533 |
xcomp |
be,known |
| R4113 |
T6383 |
T6380 |
advcl |
treated,abolished |
| R4114 |
T6556 |
T6555 |
acomp |
complex,be |
| R4115 |
T6557 |
T6556 |
cc |
and,complex |
| R4116 |
T6558 |
T6559 |
advmod |
often,interwoven |
| R4117 |
T6559 |
T6556 |
conj |
interwoven,complex |
| R4118 |
T6560 |
T6533 |
punct |
.,known |
| R4119 |
T6384 |
T6383 |
nsubjpass |
cells,treated |
| R412 |
T1217 |
T1213 |
dobj |
program,executes |
| R4120 |
T6562 |
T6563 |
amod |
Future,studies |
| R4121 |
T6563 |
T6564 |
nsubjpass |
studies,needed |
| R4122 |
T6385 |
T6383 |
auxpass |
were,treated |
| R4123 |
T6565 |
T6564 |
aux |
will,needed |
| R4124 |
T6566 |
T6564 |
auxpass |
be,needed |
| R4125 |
T6567 |
T6568 |
aux |
to,dissect |
| R4126 |
T6386 |
T6383 |
prep |
with,treated |
| R4127 |
T6568 |
T6564 |
advcl |
dissect,needed |
| R4128 |
T6569 |
T6568 |
advmod |
systematically,dissect |
| R4129 |
T6570 |
T6571 |
det |
these,intricacies |
| R413 |
T1218 |
T1217 |
amod |
distinct,program |
| R4130 |
T6387 |
T6388 |
det |
a,inhibitor |
| R4131 |
T6571 |
T6568 |
dobj |
intricacies,dissect |
| R4132 |
T6572 |
T6571 |
amod |
putative,intricacies |
| R4133 |
T6573 |
T6568 |
prep |
at,dissect |
| R4134 |
T6388 |
T6386 |
pobj |
inhibitor,with |
| R4135 |
T6574 |
T6575 |
det |
a,level |
| R4136 |
T6575 |
T6573 |
pobj |
level,at |
| R4137 |
T6576 |
T6575 |
amod |
molecular,level |
| R4138 |
T6389 |
T6388 |
amod |
small,inhibitor |
| R4139 |
T6577 |
T6564 |
punct |
.,needed |
| R414 |
T1219 |
T1217 |
amod |
morphogenetic,program |
| R4140 |
T6390 |
T6388 |
compound |
peptide,inhibitor |
| R4141 |
T6391 |
T6392 |
dep |
that,interrupts |
| R4142 |
T6392 |
T6388 |
relcl |
interrupts,inhibitor |
| R4143 |
T6393 |
T6392 |
advmod |
specifically,interrupts |
| R4144 |
T6394 |
T6395 |
det |
the,interaction |
| R4145 |
T6395 |
T6392 |
dobj |
interaction,interrupts |
| R4146 |
T6396 |
T6395 |
nmod |
Grb,interaction |
| R4147 |
T6397 |
T6396 |
punct |
-,Grb |
| R4148 |
T6398 |
T6396 |
nummod |
2,Grb |
| R4149 |
T6399 |
T6396 |
punct |
/,Grb |
| R415 |
T1220 |
T1221 |
advmod |
yet,defined |
| R4150 |
T6400 |
T6396 |
appos |
Sos,Grb |
| R4151 |
T6401 |
T6402 |
punct |
(,4F |
| R4152 |
T6402 |
T6380 |
parataxis |
4F,abolished |
| R4153 |
T6403 |
T6402 |
compound |
Figure,4F |
| R4154 |
T6404 |
T6402 |
punct |
;,4F |
| R4155 |
T6405 |
T6402 |
advcl |
see,4F |
| R4156 |
T6406 |
T6405 |
dobj |
lanes,see |
| R4157 |
T6407 |
T6406 |
acl |
marked,lanes |
| R4158 |
T6408 |
T6409 |
punct |
“,inh |
| R416 |
T1221 |
T1206 |
xcomp |
defined,has |
| R417 |
T1222 |
T1221 |
aux |
to,defined |
| R4172 |
T7354 |
T7355 |
csubj |
Probing,Reveals |
| R4173 |
T7356 |
T7357 |
det |
the,Regulation |
| R4174 |
T7357 |
T7354 |
dobj |
Regulation,Probing |
| R4175 |
T7358 |
T7357 |
prep |
of,Regulation |
| R4176 |
T7359 |
T7360 |
compound |
Snail,Gene |
| R4177 |
T7360 |
T7361 |
compound |
Gene,Expression |
| R4178 |
T7361 |
T7358 |
pobj |
Expression,of |
| R4179 |
T7362 |
T7363 |
det |
an,Link |
| R418 |
T1223 |
T1221 |
auxpass |
be,defined |
| R4180 |
T7363 |
T7355 |
dobj |
Link,Reveals |
| R4181 |
T7364 |
T7363 |
amod |
Essential,Link |
| R4182 |
T7365 |
T7363 |
prep |
to,Link |
| R4183 |
T7366 |
T7367 |
compound |
TGF,β2 |
| R4184 |
T7367 |
T7369 |
compound |
β2,Signaling |
| R4185 |
T7368 |
T7367 |
punct |
-,β2 |
| R4186 |
T7369 |
T7365 |
pobj |
Signaling,to |
| R4187 |
T7370 |
T7355 |
prep |
in,Reveals |
| R4188 |
T7371 |
T7372 |
det |
the,Bud |
| R4189 |
T7372 |
T7370 |
pobj |
Bud,in |
| R419 |
T1224 |
T1221 |
advmod |
comprehensively,defined |
| R4190 |
T7373 |
T7372 |
amod |
Developing,Bud |
| R4191 |
T7374 |
T7372 |
compound |
Hair,Bud |
| R4192 |
T7376 |
T7377 |
det |
The,spike |
| R4193 |
T7377 |
T7379 |
nsubj |
spike,prompted |
| R4194 |
T7378 |
T7377 |
amod |
temporal,spike |
| R4195 |
T7380 |
T7377 |
prep |
of,spike |
| R4196 |
T7381 |
T7382 |
compound |
Snail,expression |
| R4197 |
T7382 |
T7380 |
pobj |
expression,of |
| R4198 |
T7383 |
T7382 |
compound |
mRNA,expression |
| R4199 |
T7384 |
T7377 |
prep |
in,spike |
| R42 |
T194 |
T189 |
prep |
as,Using |
| R420 |
T1225 |
T1206 |
punct |
.,has |
| R4200 |
T7385 |
T7386 |
det |
the,bud |
| R4201 |
T7386 |
T7384 |
pobj |
bud,in |
| R4202 |
T7387 |
T7386 |
compound |
hair,bud |
| R4203 |
T7388 |
T7379 |
dobj |
us,prompted |
| R4204 |
T7389 |
T7390 |
aux |
to,consider |
| R4205 |
T7390 |
T7379 |
xcomp |
consider,prompted |
| R4206 |
T7391 |
T7392 |
det |
what,factor |
| R4207 |
T7392 |
T7393 |
dep |
factor,regulating |
| R4208 |
T7393 |
T7390 |
ccomp |
regulating,consider |
| R4209 |
T7394 |
T7392 |
punct |
(,factor |
| R421 |
T1227 |
T1228 |
advmod |
However,appears |
| R4210 |
T7395 |
T7392 |
nmod |
s,factor |
| R4211 |
T7396 |
T7392 |
punct |
),factor |
| R4212 |
T7397 |
T7393 |
aux |
may,regulating |
| R4213 |
T7398 |
T7393 |
aux |
be,regulating |
| R4214 |
T7399 |
T7400 |
det |
the,gene |
| R4215 |
T7400 |
T7393 |
dobj |
gene,regulating |
| R4216 |
T7401 |
T7400 |
compound |
Snail,gene |
| R4217 |
T7402 |
T7379 |
punct |
.,prompted |
| R4218 |
T7404 |
T7405 |
det |
A,variety |
| R4219 |
T7405 |
T7406 |
nsubj |
variety,have |
| R422 |
T1229 |
T1228 |
punct |
", ",appears |
| R4220 |
T7407 |
T7405 |
prep |
of,variety |
| R4221 |
T7408 |
T7409 |
amod |
extracellular,signals |
| R4222 |
T7409 |
T7407 |
pobj |
signals,of |
| R4223 |
T7410 |
T7411 |
det |
an,impact |
| R4224 |
T7411 |
T7406 |
dobj |
impact,have |
| R4225 |
T7412 |
T7411 |
prep |
on,impact |
| R4226 |
T7413 |
T7414 |
det |
the,expression |
| R4227 |
T7414 |
T7412 |
pobj |
expression,on |
| R4228 |
T7415 |
T7416 |
compound |
cell,type |
| R4229 |
T7416 |
T7417 |
npadvmod |
type,specific |
| R423 |
T1230 |
T1231 |
det |
the,process |
| R4230 |
T7417 |
T7414 |
amod |
specific,expression |
| R4231 |
T7418 |
T7417 |
punct |
-,specific |
| R4232 |
T7419 |
T7414 |
prep |
of,expression |
| R4233 |
T7420 |
T7421 |
amod |
different,members |
| R4234 |
T7421 |
T7419 |
pobj |
members,of |
| R4235 |
T7422 |
T7423 |
compound |
Snail,family |
| R4236 |
T7423 |
T7421 |
compound |
family,members |
| R4237 |
T7424 |
T7406 |
punct |
", ",have |
| R4238 |
T7425 |
T7406 |
cc |
and,have |
| R4239 |
T7426 |
T7427 |
nsubj |
many,affect |
| R424 |
T1231 |
T1228 |
nsubj |
process,appears |
| R4240 |
T7427 |
T7406 |
conj |
affect,have |
| R4241 |
T7428 |
T7426 |
prep |
of,many |
| R4242 |
T7429 |
T7428 |
pobj |
them,of |
| R4243 |
T7430 |
T7426 |
punct |
", ",many |
| R4244 |
T7431 |
T7426 |
prep |
including,many |
| R4245 |
T7432 |
T7431 |
pobj |
Wnts,including |
| R4246 |
T7433 |
T7432 |
punct |
", ",Wnts |
| R4247 |
T7434 |
T7432 |
conj |
BMPs,Wnts |
| R4248 |
T7435 |
T7434 |
punct |
", ",BMPs |
| R4249 |
T7436 |
T7434 |
conj |
FGFs,BMPs |
| R425 |
T1232 |
T1233 |
aux |
to,patterned |
| R4250 |
T7437 |
T7436 |
punct |
", ",FGFs |
| R4251 |
T7438 |
T7436 |
cc |
and,FGFs |
| R4252 |
T7439 |
T7440 |
compound |
TGF,βs |
| R4253 |
T7440 |
T7436 |
conj |
βs,FGFs |
| R4254 |
T7441 |
T7440 |
punct |
-,βs |
| R4255 |
T7442 |
T7427 |
punct |
", ",affect |
| R4256 |
T7443 |
T7427 |
advmod |
also,affect |
| R4257 |
T7444 |
T7445 |
compound |
hair,bud |
| R4258 |
T7445 |
T7446 |
compound |
bud,development |
| R4259 |
T7446 |
T7427 |
dobj |
development,affect |
| R426 |
T1233 |
T1228 |
xcomp |
patterned,appears |
| R4260 |
T7447 |
T7448 |
punct |
[,28 |
| R4261 |
T7448 |
T7427 |
parataxis |
28,affect |
| R4262 |
T7449 |
T7448 |
nummod |
2,28 |
| R4263 |
T7450 |
T7448 |
punct |
",",28 |
| R4264 |
T7451 |
T7448 |
nummod |
16,28 |
| R4265 |
T7452 |
T7448 |
punct |
",",28 |
| R4266 |
T7453 |
T7448 |
punct |
],28 |
| R4267 |
T7454 |
T7427 |
punct |
.,affect |
| R4268 |
T7456 |
T7457 |
mark |
Since,expressed |
| R4269 |
T7457 |
T7461 |
advcl |
expressed,focused |
| R427 |
T1234 |
T1233 |
auxpass |
be,patterned |
| R4270 |
T7458 |
T7457 |
nsubjpass |
Snail,expressed |
| R4271 |
T7459 |
T7457 |
auxpass |
is,expressed |
| R4272 |
T7460 |
T7457 |
neg |
not,expressed |
| R4273 |
T7462 |
T7457 |
prep |
in,expressed |
| R4274 |
T7463 |
T7464 |
amod |
cultured,keratinocytes |
| R4275 |
T7464 |
T7462 |
pobj |
keratinocytes,in |
| R4276 |
T7465 |
T7464 |
compound |
skin,keratinocytes |
| R4277 |
T7466 |
T7467 |
dep |
that,secrete |
| R4278 |
T7467 |
T7464 |
relcl |
secrete,keratinocytes |
| R4279 |
T7468 |
T7469 |
amod |
active,BMPs |
| R428 |
T1235 |
T1233 |
prep |
at,patterned |
| R4280 |
T7469 |
T7467 |
dobj |
BMPs,secrete |
| R4281 |
T7470 |
T7469 |
cc |
and,BMPs |
| R4282 |
T7471 |
T7469 |
conj |
FGFs,BMPs |
| R4283 |
T7472 |
T7473 |
punct |
(,see |
| R4284 |
T7473 |
T7457 |
parataxis |
see,expressed |
| R4285 |
T7474 |
T7475 |
compound |
Figure,1B |
| R4286 |
T7475 |
T7473 |
dobj |
1B,see |
| R4287 |
T7476 |
T7473 |
punct |
),see |
| R4288 |
T7477 |
T7461 |
punct |
", ",focused |
| R4289 |
T7478 |
T7461 |
nsubj |
we,focused |
| R429 |
T1236 |
T1237 |
det |
the,stages |
| R4290 |
T7479 |
T7480 |
poss |
our,attention |
| R4291 |
T7480 |
T7461 |
dobj |
attention,focused |
| R4292 |
T7481 |
T7461 |
prep |
on,focused |
| R4293 |
T7482 |
T7483 |
nmod |
Wnt,signaling |
| R4294 |
T7483 |
T7481 |
pobj |
signaling,on |
| R4295 |
T7484 |
T7482 |
cc |
and,Wnt |
| R4296 |
T7485 |
T7486 |
compound |
TGF,β |
| R4297 |
T7486 |
T7482 |
conj |
β,Wnt |
| R4298 |
T7487 |
T7486 |
punct |
-,β |
| R4299 |
T7488 |
T7483 |
prep |
as,signaling |
| R43 |
T195 |
T196 |
det |
a,paradigm |
| R430 |
T1237 |
T1235 |
pobj |
stages,at |
| R4300 |
T7489 |
T7490 |
advmod |
more,likely |
| R4301 |
T7490 |
T7491 |
amod |
likely,candidates |
| R4302 |
T7491 |
T7488 |
pobj |
candidates,as |
| R4303 |
T7492 |
T7491 |
prep |
for,candidates |
| R4304 |
T7493 |
T7494 |
compound |
Snail,induction |
| R4305 |
T7494 |
T7492 |
pobj |
induction,for |
| R4306 |
T7495 |
T7491 |
prep |
in,candidates |
| R4307 |
T7496 |
T7497 |
det |
this,type |
| R4308 |
T7497 |
T7495 |
pobj |
type,in |
| R4309 |
T7498 |
T7497 |
compound |
cell,type |
| R431 |
T1238 |
T1237 |
amod |
initial,stages |
| R4310 |
T7499 |
T7461 |
punct |
.,focused |
| R4311 |
T7501 |
T7502 |
advmod |
Previously,showed |
| R4312 |
T7503 |
T7502 |
punct |
", ",showed |
| R4313 |
T7504 |
T7502 |
nsubj |
we,showed |
| R4314 |
T7505 |
T7506 |
mark |
that,achieved |
| R4315 |
T7506 |
T7502 |
ccomp |
achieved,showed |
| R4316 |
T7507 |
T7508 |
amod |
effective,transmission |
| R4317 |
T7508 |
T7506 |
nsubjpass |
transmission,achieved |
| R4318 |
T7509 |
T7508 |
prep |
of,transmission |
| R4319 |
T7510 |
T7511 |
det |
a,signal |
| R432 |
T1239 |
T1237 |
prep |
of,stages |
| R4320 |
T7511 |
T7509 |
pobj |
signal,of |
| R4321 |
T7512 |
T7511 |
nmod |
Wnt,signal |
| R4322 |
T7513 |
T7512 |
punct |
-,Wnt |
| R4323 |
T7514 |
T7512 |
nummod |
3a,Wnt |
| R4324 |
T7515 |
T7508 |
prep |
in,transmission |
| R4325 |
T7516 |
T7517 |
amod |
cultured,keratinocytes |
| R4326 |
T7517 |
T7515 |
pobj |
keratinocytes,in |
| R4327 |
T7518 |
T7506 |
aux |
can,achieved |
| R4328 |
T7519 |
T7506 |
auxpass |
be,achieved |
| R4329 |
T7520 |
T7506 |
prep |
through,achieved |
| R433 |
T1240 |
T1241 |
compound |
bud,formation |
| R4330 |
T7521 |
T7522 |
poss |
their,exposure |
| R4331 |
T7522 |
T7520 |
pobj |
exposure,through |
| R4332 |
T7523 |
T7522 |
prep |
to,exposure |
| R4333 |
T7524 |
T7525 |
det |
the,inhibitor |
| R4334 |
T7525 |
T7523 |
pobj |
inhibitor,to |
| R4335 |
T7526 |
T7525 |
compound |
BMP,inhibitor |
| R4336 |
T7527 |
T7525 |
appos |
noggin,inhibitor |
| R4337 |
T7528 |
T7525 |
punct |
", ",inhibitor |
| R4338 |
T7529 |
T7530 |
dep |
which,induces |
| R4339 |
T7530 |
T7525 |
relcl |
induces,inhibitor |
| R434 |
T1241 |
T1239 |
pobj |
formation,of |
| R4340 |
T7531 |
T7532 |
nmod |
LEF,expression |
| R4341 |
T7532 |
T7530 |
dobj |
expression,induces |
| R4342 |
T7533 |
T7531 |
punct |
-,LEF |
| R4343 |
T7534 |
T7531 |
nummod |
1,LEF |
| R4344 |
T7535 |
T7536 |
punct |
[,4 |
| R4345 |
T7536 |
T7502 |
parataxis |
4,showed |
| R4346 |
T7537 |
T7536 |
punct |
],4 |
| R4347 |
T7538 |
T7502 |
punct |
.,showed |
| R4348 |
T7540 |
T7541 |
advmod |
In,vitro |
| R4349 |
T7541 |
T7542 |
advmod |
vitro,regulated |
| R435 |
T1242 |
T1228 |
punct |
", ",appears |
| R4350 |
T7543 |
T7542 |
punct |
", ",regulated |
| R4351 |
T7544 |
T7545 |
det |
these,conditions |
| R4352 |
T7545 |
T7542 |
nsubj |
conditions,regulated |
| R4353 |
T7546 |
T7542 |
advmod |
down,regulated |
| R4354 |
T7547 |
T7542 |
punct |
-,regulated |
| R4355 |
T7548 |
T7549 |
det |
the,promoter |
| R4356 |
T7549 |
T7542 |
dobj |
promoter,regulated |
| R4357 |
T7550 |
T7551 |
compound |
E,cadherin |
| R4358 |
T7551 |
T7549 |
compound |
cadherin,promoter |
| R4359 |
T7552 |
T7551 |
punct |
-,cadherin |
| R436 |
T1243 |
T1244 |
mark |
since,differ |
| R4360 |
T7553 |
T7542 |
cc |
and,regulated |
| R4361 |
T7554 |
T7542 |
conj |
induced,regulated |
| R4362 |
T7555 |
T7556 |
det |
a,gene |
| R4363 |
T7556 |
T7554 |
dobj |
gene,induced |
| R4364 |
T7557 |
T7558 |
npadvmod |
LEF,sensitive |
| R4365 |
T7558 |
T7556 |
amod |
sensitive,gene |
| R4366 |
T7559 |
T7557 |
punct |
-,LEF |
| R4367 |
T7560 |
T7557 |
nummod |
1,LEF |
| R4368 |
T7561 |
T7557 |
punct |
/,LEF |
| R4369 |
T7562 |
T7563 |
compound |
β,catenin |
| R437 |
T1244 |
T1228 |
advcl |
differ,appears |
| R4370 |
T7563 |
T7557 |
appos |
catenin,LEF |
| R4371 |
T7564 |
T7563 |
punct |
-,catenin |
| R4372 |
T7565 |
T7558 |
punct |
-,sensitive |
| R4373 |
T7566 |
T7556 |
compound |
reporter,gene |
| R4374 |
T7567 |
T7556 |
punct |
", ",gene |
| R4375 |
T7568 |
T7556 |
appos |
TOPFLASH,gene |
| R4376 |
T7569 |
T7570 |
punct |
[,4 |
| R4377 |
T7570 |
T7554 |
parataxis |
4,induced |
| R4378 |
T7571 |
T7570 |
punct |
],4 |
| R4379 |
T7572 |
T7542 |
punct |
.,regulated |
| R438 |
T1245 |
T1246 |
det |
the,importance |
| R4380 |
T7574 |
T7575 |
prep |
In,induced |
| R4381 |
T7576 |
T7574 |
pobj |
contrast,In |
| R4382 |
T7577 |
T7575 |
punct |
", ",induced |
| R4383 |
T7578 |
T7579 |
compound |
Snail,expression |
| R4384 |
T7579 |
T7575 |
nsubjpass |
expression,induced |
| R4385 |
T7580 |
T7575 |
auxpass |
was,induced |
| R4386 |
T7581 |
T7575 |
neg |
not,induced |
| R4387 |
T7582 |
T7575 |
agent |
by,induced |
| R4388 |
T7583 |
T7584 |
det |
these,conditions |
| R4389 |
T7584 |
T7582 |
pobj |
conditions,by |
| R439 |
T1246 |
T1244 |
nsubj |
importance,differ |
| R4390 |
T7585 |
T7586 |
punct |
(,5A |
| R4391 |
T7586 |
T7575 |
parataxis |
5A,induced |
| R4392 |
T7587 |
T7586 |
compound |
Figure,5A |
| R4393 |
T7588 |
T7586 |
punct |
),5A |
| R4394 |
T7589 |
T7575 |
punct |
.,induced |
| R4395 |
T7591 |
T7592 |
advmod |
Thus,support |
| R4396 |
T7593 |
T7592 |
punct |
", ",support |
| R4397 |
T7594 |
T7592 |
prep |
despite,support |
| R4398 |
T7595 |
T7596 |
amod |
essential,roles |
| R4399 |
T7596 |
T7594 |
pobj |
roles,despite |
| R44 |
T196 |
T194 |
pobj |
paradigm,as |
| R440 |
T1247 |
T1246 |
amod |
relative,importance |
| R4400 |
T7597 |
T7596 |
prep |
for,roles |
| R4401 |
T7598 |
T7597 |
pobj |
Wnts,for |
| R4402 |
T7599 |
T7598 |
cc |
and,Wnts |
| R4403 |
T7600 |
T7598 |
conj |
noggin,Wnts |
| R4404 |
T7601 |
T7596 |
prep |
in,roles |
| R4405 |
T7602 |
T7603 |
compound |
hair,follicle |
| R4406 |
T7603 |
T7604 |
compound |
follicle,specification |
| R4407 |
T7604 |
T7601 |
pobj |
specification,in |
| R4408 |
T7605 |
T7606 |
punct |
[,30 |
| R4409 |
T7606 |
T7596 |
parataxis |
30,roles |
| R441 |
T1248 |
T1246 |
prep |
of,importance |
| R4410 |
T7607 |
T7606 |
nummod |
4,30 |
| R4411 |
T7608 |
T7606 |
punct |
",",30 |
| R4412 |
T7609 |
T7606 |
nummod |
29,30 |
| R4413 |
T7610 |
T7606 |
punct |
",",30 |
| R4414 |
T7611 |
T7606 |
punct |
],30 |
| R4415 |
T7612 |
T7592 |
punct |
", ",support |
| R4416 |
T7613 |
T7614 |
poss |
our,studies |
| R4417 |
T7614 |
T7592 |
nsubj |
studies,support |
| R4418 |
T7615 |
T7592 |
aux |
did,support |
| R4419 |
T7616 |
T7592 |
neg |
not,support |
| R442 |
T1249 |
T1250 |
det |
these,pathways |
| R4420 |
T7617 |
T7618 |
det |
an,role |
| R4421 |
T7618 |
T7592 |
dobj |
role,support |
| R4422 |
T7619 |
T7618 |
amod |
essential,role |
| R4423 |
T7620 |
T7618 |
prep |
for,role |
| R4424 |
T7621 |
T7622 |
det |
these,signals |
| R4425 |
T7622 |
T7620 |
pobj |
signals,for |
| R4426 |
T7623 |
T7618 |
prep |
in,role |
| R4427 |
T7624 |
T7623 |
pcomp |
governing,in |
| R4428 |
T7625 |
T7626 |
compound |
Snail,expression |
| R4429 |
T7626 |
T7624 |
dobj |
expression,governing |
| R443 |
T1250 |
T1248 |
pobj |
pathways,of |
| R4430 |
T7627 |
T7624 |
prep |
in,governing |
| R4431 |
T7628 |
T7627 |
pobj |
keratinocytes,in |
| R4432 |
T7629 |
T7592 |
punct |
.,support |
| R4433 |
T7631 |
T7632 |
compound |
TGF,β1 |
| R4434 |
T7632 |
T7634 |
nsubjpass |
β1,shown |
| R4435 |
T7633 |
T7632 |
punct |
-,β1 |
| R4436 |
T7635 |
T7634 |
aux |
has,shown |
| R4437 |
T7636 |
T7634 |
auxpass |
been,shown |
| R4438 |
T7637 |
T7638 |
aux |
to,induce |
| R4439 |
T7638 |
T7634 |
xcomp |
induce,shown |
| R444 |
T1251 |
T1250 |
cc |
and,pathways |
| R4440 |
T7639 |
T7640 |
compound |
Snail,members |
| R4441 |
T7640 |
T7638 |
dobj |
members,induce |
| R4442 |
T7641 |
T7640 |
compound |
family,members |
| R4443 |
T7642 |
T7638 |
prep |
in,induce |
| R4444 |
T7643 |
T7642 |
pobj |
hepatocytes,in |
| R4445 |
T7644 |
T7643 |
cc |
and,hepatocytes |
| R4446 |
T7645 |
T7643 |
conj |
heart,hepatocytes |
| R4447 |
T7646 |
T7647 |
punct |
[,31 |
| R4448 |
T7647 |
T7634 |
parataxis |
31,shown |
| R4449 |
T7648 |
T7647 |
nummod |
15,31 |
| R445 |
T1252 |
T1253 |
poss |
their,effectors |
| R4450 |
T7649 |
T7647 |
punct |
", ",31 |
| R4451 |
T7650 |
T7647 |
punct |
],31 |
| R4452 |
T7651 |
T7634 |
punct |
.,shown |
| R4453 |
T7653 |
T7654 |
prep |
In,inhibits |
| R4454 |
T7655 |
T7653 |
pobj |
keratinocytes,In |
| R4455 |
T7656 |
T7654 |
punct |
", ",inhibits |
| R4456 |
T7657 |
T7654 |
advmod |
however,inhibits |
| R4457 |
T7658 |
T7654 |
punct |
", ",inhibits |
| R4458 |
T7659 |
T7660 |
compound |
TGF,β1 |
| R4459 |
T7660 |
T7654 |
nsubj |
β1,inhibits |
| R446 |
T1253 |
T1250 |
conj |
effectors,pathways |
| R4460 |
T7661 |
T7660 |
punct |
-,β1 |
| R4461 |
T7662 |
T7663 |
compound |
keratinocyte,growth |
| R4462 |
T7663 |
T7654 |
dobj |
growth,inhibits |
| R4463 |
T7664 |
T7654 |
cc |
and,inhibits |
| R4464 |
T7665 |
T7654 |
conj |
seems,inhibits |
| R4465 |
T7666 |
T7667 |
aux |
to,involved |
| R4466 |
T7667 |
T7665 |
xcomp |
involved,seems |
| R4467 |
T7668 |
T7667 |
auxpass |
be,involved |
| R4468 |
T7669 |
T7667 |
prep |
in,involved |
| R4469 |
T7670 |
T7669 |
pcomp |
triggering,in |
| R447 |
T1254 |
T1253 |
amod |
downstream,effectors |
| R4470 |
T7671 |
T7672 |
det |
the,phase |
| R4471 |
T7672 |
T7670 |
dobj |
phase,triggering |
| R4472 |
T7673 |
T7672 |
amod |
destructive,phase |
| R4473 |
T7674 |
T7672 |
prep |
of,phase |
| R4474 |
T7675 |
T7676 |
det |
the,follicle |
| R4475 |
T7676 |
T7674 |
pobj |
follicle,of |
| R4476 |
T7677 |
T7676 |
amod |
cycling,follicle |
| R4477 |
T7678 |
T7676 |
compound |
hair,follicle |
| R4478 |
T7679 |
T7680 |
punct |
[,32 |
| R4479 |
T7680 |
T7665 |
parataxis |
32,seems |
| R448 |
T1255 |
T1256 |
mark |
as,begin |
| R4480 |
T7681 |
T7680 |
punct |
],32 |
| R4481 |
T7682 |
T7654 |
punct |
.,inhibits |
| R4482 |
T7684 |
T7685 |
prep |
Of,blocked |
| R4483 |
T7686 |
T7687 |
det |
the,mutations |
| R4484 |
T7687 |
T7684 |
pobj |
mutations,Of |
| R4485 |
T7688 |
T7687 |
nmod |
loss,mutations |
| R4486 |
T7689 |
T7688 |
punct |
-,loss |
| R4487 |
T7690 |
T7688 |
prep |
of,loss |
| R4488 |
T7691 |
T7690 |
punct |
-,of |
| R4489 |
T7692 |
T7690 |
pobj |
function,of |
| R449 |
T1256 |
T1244 |
advcl |
begin,differ |
| R4490 |
T7693 |
T7687 |
acl |
generated,mutations |
| R4491 |
T7694 |
T7693 |
prep |
in,generated |
| R4492 |
T7695 |
T7694 |
pobj |
each,in |
| R4493 |
T7696 |
T7695 |
prep |
of,each |
| R4494 |
T7697 |
T7698 |
det |
the,genes |
| R4495 |
T7698 |
T7696 |
pobj |
genes,of |
| R4496 |
T7699 |
T7700 |
compound |
TGF,β |
| R4497 |
T7700 |
T7698 |
compound |
β,genes |
| R4498 |
T7701 |
T7700 |
punct |
-,β |
| R4499 |
T7702 |
T7685 |
punct |
", ",blocked |
| R45 |
T197 |
T190 |
punct |
", ",employed |
| R450 |
T1257 |
T1256 |
nsubj |
buds,begin |
| R4500 |
T7703 |
T7704 |
advmod |
only,state |
| R4501 |
T7704 |
T7685 |
nsubj |
state,blocked |
| R4502 |
T7705 |
T7704 |
det |
the,state |
| R4503 |
T7706 |
T7707 |
nmod |
TGF,β2 |
| R4504 |
T7707 |
T7704 |
nmod |
β2,state |
| R4505 |
T7708 |
T7707 |
punct |
-,β2 |
| R4506 |
T7709 |
T7704 |
amod |
null,state |
| R4507 |
T7710 |
T7711 |
compound |
follicle,development |
| R4508 |
T7711 |
T7685 |
dobj |
development,blocked |
| R4509 |
T7712 |
T7685 |
prep |
at,blocked |
| R451 |
T1258 |
T1259 |
aux |
to,develop |
| R4510 |
T7713 |
T7714 |
det |
the,stage |
| R4511 |
T7714 |
T7712 |
pobj |
stage,at |
| R4512 |
T7715 |
T7716 |
compound |
hair,bud |
| R4513 |
T7716 |
T7714 |
compound |
bud,stage |
| R4514 |
T7717 |
T7718 |
punct |
[,32 |
| R4515 |
T7718 |
T7685 |
parataxis |
32,blocked |
| R4516 |
T7719 |
T7718 |
punct |
],32 |
| R4517 |
T7720 |
T7685 |
punct |
.,blocked |
| R4518 |
T7722 |
T7723 |
advmod |
Thus,turned |
| R4519 |
T7724 |
T7723 |
punct |
", ",turned |
| R452 |
T1259 |
T1256 |
xcomp |
develop,begin |
| R4520 |
T7725 |
T7723 |
nsubj |
we,turned |
| R4521 |
T7726 |
T7723 |
prep |
towards,turned |
| R4522 |
T7727 |
T7726 |
pcomp |
addressing,towards |
| R4523 |
T7728 |
T7729 |
mark |
whether,involved |
| R4524 |
T7729 |
T7727 |
ccomp |
involved,addressing |
| R4525 |
T7730 |
T7731 |
compound |
TGF,β2 |
| R4526 |
T7731 |
T7729 |
nsubjpass |
β2,involved |
| R4527 |
T7732 |
T7731 |
punct |
-,β2 |
| R4528 |
T7733 |
T7729 |
aux |
might,involved |
| R4529 |
T7734 |
T7729 |
auxpass |
be,involved |
| R453 |
T1260 |
T1256 |
cc |
and,begin |
| R4530 |
T7735 |
T7729 |
prep |
in,involved |
| R4531 |
T7736 |
T7735 |
pcomp |
regulating,in |
| R4532 |
T7737 |
T7738 |
compound |
Snail,expression |
| R4533 |
T7738 |
T7736 |
dobj |
expression,regulating |
| R4534 |
T7739 |
T7736 |
prep |
in,regulating |
| R4535 |
T7740 |
T7739 |
pobj |
keratinocytes,in |
| R4536 |
T7741 |
T7740 |
acl |
isolated,keratinocytes |
| R4537 |
T7742 |
T7741 |
prep |
from,isolated |
| R4538 |
T7743 |
T7744 |
det |
the,layer |
| R4539 |
T7744 |
T7742 |
pobj |
layer,from |
| R454 |
T1261 |
T1262 |
compound |
cell,fates |
| R4540 |
T7745 |
T7744 |
amod |
basal,layer |
| R4541 |
T7746 |
T7744 |
prep |
of,layer |
| R4542 |
T7747 |
T7748 |
det |
the,epidermis |
| R4543 |
T7748 |
T7746 |
pobj |
epidermis,of |
| R4544 |
T7749 |
T7723 |
punct |
.,turned |
| R4545 |
T7751 |
T7752 |
mark |
Though,is |
| R4546 |
T7752 |
T7754 |
advcl |
is,are |
| R4547 |
T7753 |
T7752 |
expl |
there,is |
| R4548 |
T7755 |
T7756 |
det |
no,system |
| R4549 |
T7756 |
T7752 |
attr |
system,is |
| R455 |
T1262 |
T1263 |
nsubjpass |
fates,specified |
| R4550 |
T7757 |
T7758 |
compound |
cell,culture |
| R4551 |
T7758 |
T7756 |
compound |
culture,system |
| R4552 |
T7759 |
T7756 |
amod |
available,system |
| R4553 |
T7760 |
T7761 |
aux |
to,study |
| R4554 |
T7761 |
T7759 |
xcomp |
study,available |
| R4555 |
T7762 |
T7761 |
advmod |
specifically,study |
| R4556 |
T7763 |
T7764 |
amod |
placodal,cells |
| R4557 |
T7764 |
T7761 |
dobj |
cells,study |
| R4558 |
T7765 |
T7754 |
punct |
", ",are |
| R4559 |
T7766 |
T7767 |
det |
these,keratinocytes |
| R456 |
T1263 |
T1256 |
conj |
specified,begin |
| R4560 |
T7767 |
T7754 |
nsubj |
keratinocytes,are |
| R4561 |
T7768 |
T7769 |
poss |
their,progenitors |
| R4562 |
T7769 |
T7754 |
attr |
progenitors,are |
| R4563 |
T7770 |
T7754 |
cc |
and,are |
| R4564 |
T7771 |
T7754 |
conj |
are,are |
| R4565 |
T7772 |
T7773 |
det |
the,approximation |
| R4566 |
T7773 |
T7771 |
attr |
approximation,are |
| R4567 |
T7774 |
T7773 |
amod |
closest,approximation |
| R4568 |
T7775 |
T7773 |
amod |
available,approximation |
| R4569 |
T7776 |
T7777 |
aux |
to,study |
| R457 |
T1264 |
T1263 |
auxpass |
are,specified |
| R4570 |
T7777 |
T7775 |
xcomp |
study,available |
| R4571 |
T7778 |
T7779 |
det |
the,behavior |
| R4572 |
T7779 |
T7777 |
dobj |
behavior,study |
| R4573 |
T7780 |
T7779 |
prep |
of,behavior |
| R4574 |
T7781 |
T7782 |
amod |
epithelial,cells |
| R4575 |
T7782 |
T7780 |
pobj |
cells,of |
| R4576 |
T7783 |
T7782 |
prep |
of,cells |
| R4577 |
T7784 |
T7785 |
det |
the,placode |
| R4578 |
T7785 |
T7783 |
pobj |
placode,of |
| R4579 |
T7786 |
T7754 |
punct |
.,are |
| R458 |
T1265 |
T1228 |
punct |
.,appears |
| R4580 |
T7788 |
T7789 |
advmod |
Interestingly,caused |
| R4581 |
T7790 |
T7789 |
punct |
", ",caused |
| R4582 |
T7791 |
T7789 |
nsubj |
treatment,caused |
| R4583 |
T7792 |
T7791 |
prep |
of,treatment |
| R4584 |
T7793 |
T7794 |
amod |
cultured,keratinocytes |
| R4585 |
T7794 |
T7792 |
pobj |
keratinocytes,of |
| R4586 |
T7795 |
T7791 |
prep |
with,treatment |
| R4587 |
T7796 |
T7797 |
advmod |
as,5 |
| R4588 |
T7797 |
T7800 |
nummod |
5,ng |
| R4589 |
T7798 |
T7797 |
amod |
little,5 |
| R459 |
T1267 |
T1268 |
det |
The,development |
| R4590 |
T7799 |
T7797 |
quantmod |
as,5 |
| R4591 |
T7800 |
T7795 |
pobj |
ng,with |
| R4592 |
T7801 |
T7802 |
punct |
/,ml |
| R4593 |
T7802 |
T7800 |
prep |
ml,ng |
| R4594 |
T7803 |
T7800 |
prep |
of,ng |
| R4595 |
T7804 |
T7805 |
compound |
TGF,β2 |
| R4596 |
T7805 |
T7803 |
pobj |
β2,of |
| R4597 |
T7806 |
T7805 |
punct |
-,β2 |
| R4598 |
T7807 |
T7808 |
det |
a,induction |
| R4599 |
T7808 |
T7789 |
dobj |
induction,caused |
| R46 |
T198 |
T190 |
nsubj |
we,employed |
| R460 |
T1268 |
T1269 |
nsubj |
development,requires |
| R4600 |
T7809 |
T7808 |
amod |
rapid,induction |
| R4601 |
T7810 |
T7809 |
cc |
and,rapid |
| R4602 |
T7811 |
T7809 |
conj |
transient,rapid |
| R4603 |
T7812 |
T7808 |
prep |
of,induction |
| R4604 |
T7813 |
T7812 |
pobj |
Snail,of |
| R4605 |
T7814 |
T7815 |
punct |
(,5B |
| R4606 |
T7815 |
T7789 |
parataxis |
5B,caused |
| R4607 |
T7816 |
T7815 |
compound |
Figure,5B |
| R4608 |
T7817 |
T7815 |
punct |
),5B |
| R4609 |
T7818 |
T7789 |
punct |
.,caused |
| R461 |
T1270 |
T1268 |
prep |
of,development |
| R4610 |
T7820 |
T7821 |
prep |
Following,detected |
| R4611 |
T7822 |
T7823 |
det |
this,treatment |
| R4612 |
T7823 |
T7820 |
pobj |
treatment,Following |
| R4613 |
T7824 |
T7821 |
punct |
", ",detected |
| R4614 |
T7825 |
T7826 |
compound |
Snail,protein |
| R4615 |
T7826 |
T7821 |
nsubjpass |
protein,detected |
| R4616 |
T7827 |
T7821 |
auxpass |
was,detected |
| R4617 |
T7828 |
T7821 |
prep |
within,detected |
| R4618 |
T7829 |
T7830 |
nummod |
30,min |
| R4619 |
T7830 |
T7828 |
pobj |
min,within |
| R462 |
T1271 |
T1272 |
det |
a,bud |
| R4620 |
T7831 |
T7821 |
punct |
", ",detected |
| R4621 |
T7832 |
T7821 |
conj |
peaked,detected |
| R4622 |
T7833 |
T7832 |
prep |
at,peaked |
| R4623 |
T7834 |
T7835 |
nummod |
2,h |
| R4624 |
T7835 |
T7833 |
pobj |
h,at |
| R4625 |
T7836 |
T7832 |
punct |
", ",peaked |
| R4626 |
T7837 |
T7832 |
cc |
and,peaked |
| R4627 |
T7838 |
T7839 |
advmod |
then,declined |
| R4628 |
T7839 |
T7832 |
conj |
declined,peaked |
| R4629 |
T7840 |
T7839 |
advmod |
thereafter,declined |
| R463 |
T1272 |
T1270 |
pobj |
bud,of |
| R4630 |
T7841 |
T7821 |
punct |
.,detected |
| R4631 |
T7843 |
T7844 |
det |
The,induction |
| R4632 |
T7844 |
T7845 |
nsubj |
induction,appeared |
| R4633 |
T7846 |
T7844 |
prep |
of,induction |
| R4634 |
T7847 |
T7846 |
pobj |
Snail,of |
| R4635 |
T7848 |
T7849 |
aux |
to,be |
| R4636 |
T7849 |
T7845 |
xcomp |
be,appeared |
| R4637 |
T7850 |
T7849 |
acomp |
specific,be |
| R4638 |
T7851 |
T7850 |
prep |
for,specific |
| R4639 |
T7852 |
T7853 |
det |
the,form |
| R464 |
T1273 |
T1274 |
det |
a,number |
| R4640 |
T7853 |
T7851 |
pobj |
form,for |
| R4641 |
T7854 |
T7853 |
amod |
active,form |
| R4642 |
T7855 |
T7853 |
prep |
of,form |
| R4643 |
T7856 |
T7857 |
det |
the,factor |
| R4644 |
T7857 |
T7855 |
pobj |
factor,of |
| R4645 |
T7858 |
T7857 |
compound |
growth,factor |
| R4646 |
T7859 |
T7849 |
punct |
", ",be |
| R4647 |
T7860 |
T7861 |
mark |
as,obliterated |
| R4648 |
T7861 |
T7849 |
advcl |
obliterated,be |
| R4649 |
T7862 |
T7861 |
nsubj |
pretreatment,obliterated |
| R465 |
T1274 |
T1269 |
dobj |
number,requires |
| R4650 |
T7863 |
T7862 |
prep |
of,pretreatment |
| R4651 |
T7864 |
T7865 |
compound |
TGF,β2 |
| R4652 |
T7865 |
T7863 |
pobj |
β2,of |
| R4653 |
T7866 |
T7865 |
punct |
-,β2 |
| R4654 |
T7867 |
T7862 |
prep |
for,pretreatment |
| R4655 |
T7868 |
T7869 |
nummod |
10,min |
| R4656 |
T7869 |
T7867 |
pobj |
min,for |
| R4657 |
T7870 |
T7862 |
prep |
at,pretreatment |
| R4658 |
T7871 |
T7872 |
nummod |
100,°C |
| R4659 |
T7872 |
T7870 |
pobj |
°C,at |
| R466 |
T1275 |
T1274 |
prep |
of,number |
| R4660 |
T7873 |
T7874 |
det |
the,response |
| R4661 |
T7874 |
T7861 |
dobj |
response,obliterated |
| R4662 |
T7875 |
T7876 |
punct |
[,lanes |
| R4663 |
T7876 |
T7849 |
parataxis |
lanes,be |
| R4664 |
T7877 |
T7878 |
compound |
Figure,5B |
| R4665 |
T7878 |
T7876 |
dep |
5B,lanes |
| R4666 |
T7879 |
T7876 |
punct |
", ",lanes |
| R4667 |
T7880 |
T7876 |
acl |
marked,lanes |
| R4668 |
T7881 |
T7880 |
punct |
(,marked |
| R4669 |
T7882 |
T7880 |
oprd |
–,marked |
| R467 |
T1276 |
T1277 |
amod |
coordinated,changes |
| R4670 |
T7883 |
T7876 |
punct |
),lanes |
| R4671 |
T7884 |
T7876 |
punct |
],lanes |
| R4672 |
T7885 |
T7845 |
punct |
.,appeared |
| R4673 |
T7887 |
T7888 |
prep |
By,maintained |
| R4674 |
T7889 |
T7887 |
pobj |
contrast,By |
| R4675 |
T7890 |
T7888 |
punct |
", ",maintained |
| R4676 |
T7891 |
T7892 |
mark |
although,remained |
| R4677 |
T7892 |
T7888 |
advcl |
remained,maintained |
| R4678 |
T7893 |
T7894 |
compound |
TGF,β |
| R4679 |
T7894 |
T7896 |
compound |
β,receptor |
| R468 |
T1277 |
T1275 |
pobj |
changes,of |
| R4680 |
T7895 |
T7894 |
punct |
-,β |
| R4681 |
T7896 |
T7897 |
compound |
receptor,activation |
| R4682 |
T7897 |
T7892 |
nsubj |
activation,remained |
| R4683 |
T7898 |
T7892 |
acomp |
elevated,remained |
| R4684 |
T7899 |
T7892 |
prep |
during,remained |
| R4685 |
T7900 |
T7901 |
det |
the,duration |
| R4686 |
T7901 |
T7899 |
pobj |
duration,during |
| R4687 |
T7902 |
T7901 |
prep |
of,duration |
| R4688 |
T7903 |
T7904 |
det |
the,experiment |
| R4689 |
T7904 |
T7902 |
pobj |
experiment,of |
| R469 |
T1278 |
T1277 |
prep |
in,changes |
| R4690 |
T7905 |
T7892 |
punct |
(,remained |
| R4691 |
T7906 |
T7907 |
mark |
as,measured |
| R4692 |
T7907 |
T7892 |
advcl |
measured,remained |
| R4693 |
T7908 |
T7907 |
prep |
by,measured |
| R4694 |
T7909 |
T7910 |
det |
the,phosphorylation |
| R4695 |
T7910 |
T7908 |
pobj |
phosphorylation,by |
| R4696 |
T7911 |
T7910 |
amod |
sustained,phosphorylation |
| R4697 |
T7912 |
T7910 |
prep |
of,phosphorylation |
| R4698 |
T7913 |
T7914 |
det |
the,effector |
| R4699 |
T7914 |
T7912 |
pobj |
effector,of |
| R47 |
T199 |
T200 |
compound |
mutant,mouse |
| R470 |
T1279 |
T1280 |
det |
the,behavior |
| R4700 |
T7915 |
T7914 |
amod |
downstream,effector |
| R4701 |
T7916 |
T7914 |
appos |
SMAD2,effector |
| R4702 |
T7917 |
T7888 |
punct |
),maintained |
| R4703 |
T7918 |
T7919 |
compound |
Snail,expression |
| R4704 |
T7919 |
T7888 |
nsubjpass |
expression,maintained |
| R4705 |
T7920 |
T7888 |
aux |
could,maintained |
| R4706 |
T7921 |
T7888 |
neg |
not,maintained |
| R4707 |
T7922 |
T7888 |
auxpass |
be,maintained |
| R4708 |
T7923 |
T7924 |
punct |
(,5B |
| R4709 |
T7924 |
T7888 |
parataxis |
5B,maintained |
| R471 |
T1280 |
T1278 |
pobj |
behavior,in |
| R4710 |
T7925 |
T7924 |
compound |
Figure,5B |
| R4711 |
T7926 |
T7924 |
punct |
),5B |
| R4712 |
T7927 |
T7888 |
punct |
.,maintained |
| R4713 |
T7929 |
T7930 |
advmod |
Thus,seemed |
| R4714 |
T7931 |
T7930 |
punct |
", ",seemed |
| R4715 |
T7932 |
T7933 |
mark |
although,correlated |
| R4716 |
T7933 |
T7930 |
advcl |
correlated,seemed |
| R4717 |
T7934 |
T7935 |
compound |
Snail,expression |
| R4718 |
T7935 |
T7933 |
nsubj |
expression,correlated |
| R4719 |
T7936 |
T7933 |
prep |
with,correlated |
| R472 |
T1281 |
T1280 |
prep |
of,behavior |
| R4720 |
T7937 |
T7938 |
amod |
phosphorylated,SMAD2 |
| R4721 |
T7938 |
T7939 |
nmod |
SMAD2,induction |
| R4722 |
T7939 |
T7936 |
pobj |
induction,with |
| R4723 |
T7940 |
T7938 |
punct |
(,SMAD2 |
| R4724 |
T7941 |
T7938 |
appos |
pSMAD2,SMAD2 |
| R4725 |
T7942 |
T7939 |
punct |
),induction |
| R4726 |
T7943 |
T7930 |
punct |
", ",seemed |
| R4727 |
T7944 |
T7945 |
poss |
its,decline |
| R4728 |
T7945 |
T7930 |
nsubj |
decline,seemed |
| R4729 |
T7946 |
T7947 |
aux |
to,rely |
| R473 |
T1282 |
T1283 |
det |
the,cells |
| R4730 |
T7947 |
T7930 |
xcomp |
rely,seemed |
| R4731 |
T7948 |
T7947 |
prep |
on,rely |
| R4732 |
T7949 |
T7950 |
amod |
secondary,events |
| R4733 |
T7950 |
T7948 |
pobj |
events,on |
| R4734 |
T7951 |
T7950 |
amod |
downstream,events |
| R4735 |
T7952 |
T7930 |
punct |
.,seemed |
| R4736 |
T7954 |
T7955 |
det |
The,kinetics |
| R4737 |
T7955 |
T7957 |
nsubjpass |
kinetics,reflected |
| R4738 |
T7956 |
T7955 |
amod |
rapid,kinetics |
| R4739 |
T7958 |
T7955 |
prep |
of,kinetics |
| R474 |
T1283 |
T1281 |
pobj |
cells,of |
| R4740 |
T7959 |
T7960 |
compound |
Snail,expression |
| R4741 |
T7960 |
T7958 |
pobj |
expression,of |
| R4742 |
T7961 |
T7957 |
auxpass |
were,reflected |
| R4743 |
T7962 |
T7957 |
prep |
at,reflected |
| R4744 |
T7963 |
T7964 |
det |
the,level |
| R4745 |
T7964 |
T7962 |
pobj |
level,at |
| R4746 |
T7965 |
T7964 |
compound |
mRNA,level |
| R4747 |
T7966 |
T7957 |
punct |
", ",reflected |
| R4748 |
T7967 |
T7957 |
advcl |
suggesting,reflected |
| R4749 |
T7968 |
T7969 |
mark |
that,be |
| R475 |
T1284 |
T1283 |
amod |
targeted,cells |
| R4750 |
T7969 |
T7967 |
ccomp |
be,suggesting |
| R4751 |
T7970 |
T7971 |
compound |
Snail,promoter |
| R4752 |
T7971 |
T7972 |
compound |
promoter,activity |
| R4753 |
T7972 |
T7969 |
nsubj |
activity,be |
| R4754 |
T7973 |
T7972 |
prep |
in,activity |
| R4755 |
T7974 |
T7973 |
pobj |
keratinocytes,in |
| R4756 |
T7975 |
T7969 |
aux |
might,be |
| R4757 |
T7976 |
T7969 |
acomp |
sensitive,be |
| R4758 |
T7977 |
T7976 |
prep |
to,sensitive |
| R4759 |
T7978 |
T7979 |
compound |
TGF,β2 |
| R476 |
T1285 |
T1280 |
prep |
within,behavior |
| R4760 |
T7979 |
T7981 |
compound |
β2,signaling |
| R4761 |
T7980 |
T7979 |
punct |
-,β2 |
| R4762 |
T7981 |
T7977 |
pobj |
signaling,to |
| R4763 |
T7982 |
T7983 |
punct |
(,5C |
| R4764 |
T7983 |
T7957 |
parataxis |
5C,reflected |
| R4765 |
T7984 |
T7983 |
compound |
Figure,5C |
| R4766 |
T7985 |
T7983 |
punct |
),5C |
| R4767 |
T7986 |
T7957 |
punct |
.,reflected |
| R4768 |
T7988 |
T7989 |
aux |
To,test |
| R4769 |
T7989 |
T7990 |
advcl |
test,engineered |
| R477 |
T1286 |
T1287 |
det |
an,sheet |
| R4770 |
T7991 |
T7992 |
det |
this,possibility |
| R4771 |
T7992 |
T7989 |
dobj |
possibility,test |
| R4772 |
T7993 |
T7990 |
punct |
", ",engineered |
| R4773 |
T7994 |
T7990 |
nsubj |
we,engineered |
| R4774 |
T7995 |
T7996 |
det |
a,transgene |
| R4775 |
T7996 |
T7990 |
dobj |
transgene,engineered |
| R4776 |
T7997 |
T7996 |
acl |
driving,transgene |
| R4777 |
T7998 |
T7999 |
det |
the,reporter |
| R4778 |
T7999 |
T7997 |
dobj |
reporter,driving |
| R4779 |
T8000 |
T8001 |
compound |
β,galactosidase |
| R478 |
T1287 |
T1285 |
pobj |
sheet,within |
| R4780 |
T8001 |
T7999 |
compound |
galactosidase,reporter |
| R4781 |
T8002 |
T8001 |
punct |
-,galactosidase |
| R4782 |
T8003 |
T7997 |
prep |
under,driving |
| R4783 |
T8004 |
T8005 |
det |
the,control |
| R4784 |
T8005 |
T8003 |
pobj |
control,under |
| R4785 |
T8006 |
T8005 |
prep |
of,control |
| R4786 |
T8007 |
T8008 |
advmod |
approximately,2.2 |
| R4787 |
T8008 |
T8009 |
nummod |
2.2,kb |
| R4788 |
T8009 |
T8006 |
pobj |
kb,of |
| R4789 |
T8010 |
T8009 |
prep |
of,kb |
| R479 |
T1288 |
T1287 |
amod |
epithelial,sheet |
| R4790 |
T8011 |
T8012 |
compound |
promoter,sequence |
| R4791 |
T8012 |
T8010 |
pobj |
sequence,of |
| R4792 |
T8013 |
T8012 |
acl |
located,sequence |
| R4793 |
T8014 |
T8013 |
npadvmod |
5,located |
| R4794 |
T8015 |
T8014 |
punct |
′,5 |
| R4795 |
T8016 |
T8014 |
prep |
from,5 |
| R4796 |
T8017 |
T8018 |
det |
the,site |
| R4797 |
T8018 |
T8016 |
pobj |
site,from |
| R4798 |
T8019 |
T8018 |
compound |
transcription,site |
| R4799 |
T8020 |
T8018 |
compound |
initiation,site |
| R48 |
T200 |
T201 |
compound |
mouse,models |
| R480 |
T1289 |
T1269 |
punct |
.,requires |
| R4800 |
T8021 |
T8018 |
prep |
of,site |
| R4801 |
T8022 |
T8023 |
det |
the,gene |
| R4802 |
T8023 |
T8021 |
pobj |
gene,of |
| R4803 |
T8024 |
T8023 |
compound |
mouse,gene |
| R4804 |
T8025 |
T8023 |
compound |
Snail,gene |
| R4805 |
T8026 |
T7990 |
punct |
.,engineered |
| R4806 |
T8028 |
T8029 |
prep |
At,treated |
| R4807 |
T8030 |
T8031 |
nummod |
2,d |
| R4808 |
T8031 |
T8028 |
pobj |
d,At |
| R4809 |
T8032 |
T8031 |
prep |
after,d |
| R481 |
T1291 |
T1292 |
det |
The,process |
| R4810 |
T8033 |
T8034 |
amod |
transient,transfection |
| R4811 |
T8034 |
T8032 |
pobj |
transfection,after |
| R4812 |
T8035 |
T8029 |
punct |
", ",treated |
| R4813 |
T8036 |
T8029 |
nsubjpass |
keratinocytes,treated |
| R4814 |
T8037 |
T8029 |
auxpass |
were,treated |
| R4815 |
T8038 |
T8029 |
prep |
with,treated |
| R4816 |
T8039 |
T8040 |
compound |
TGF,β2 |
| R4817 |
T8040 |
T8038 |
pobj |
β2,with |
| R4818 |
T8041 |
T8040 |
punct |
-,β2 |
| R4819 |
T8042 |
T8043 |
punct |
(,0 |
| R482 |
T1292 |
T1293 |
nsubjpass |
process,accompanied |
| R4820 |
T8043 |
T8029 |
parataxis |
0,treated |
| R4821 |
T8044 |
T8043 |
nsubj |
t,0 |
| R4822 |
T8045 |
T8043 |
punct |
=,0 |
| R4823 |
T8046 |
T8043 |
punct |
),0 |
| R4824 |
T8047 |
T8029 |
cc |
and,treated |
| R4825 |
T8048 |
T8049 |
advmod |
then,assayed |
| R4826 |
T8049 |
T8029 |
conj |
assayed,treated |
| R4827 |
T8050 |
T8049 |
prep |
for,assayed |
| R4828 |
T8051 |
T8052 |
compound |
transgene,activity |
| R4829 |
T8052 |
T8050 |
pobj |
activity,for |
| R483 |
T1294 |
T1293 |
aux |
must,accompanied |
| R4830 |
T8053 |
T8049 |
prep |
over,assayed |
| R4831 |
T8054 |
T8055 |
det |
the,course |
| R4832 |
T8055 |
T8053 |
pobj |
course,over |
| R4833 |
T8056 |
T8055 |
amod |
same,course |
| R4834 |
T8057 |
T8055 |
compound |
time,course |
| R4835 |
T8058 |
T8059 |
prep |
in,observed |
| R4836 |
T8059 |
T8055 |
relcl |
observed,course |
| R4837 |
T8060 |
T8058 |
pobj |
which,in |
| R4838 |
T8061 |
T8059 |
nsubj |
we,observed |
| R4839 |
T8062 |
T8059 |
aux |
had,observed |
| R484 |
T1295 |
T1293 |
auxpass |
be,accompanied |
| R4840 |
T8063 |
T8064 |
compound |
Snail,protein |
| R4841 |
T8064 |
T8065 |
compound |
protein,induction |
| R4842 |
T8065 |
T8059 |
dobj |
induction,observed |
| R4843 |
T8066 |
T8029 |
punct |
.,treated |
| R4844 |
T8068 |
T8069 |
det |
The,results |
| R4845 |
T8069 |
T8070 |
nsubjpass |
results,presented |
| R4846 |
T8071 |
T8069 |
prep |
of,results |
| R4847 |
T8072 |
T8073 |
det |
this,experiment |
| R4848 |
T8073 |
T8071 |
pobj |
experiment,of |
| R4849 |
T8074 |
T8070 |
auxpass |
are,presented |
| R485 |
T1296 |
T1293 |
prep |
by,accompanied |
| R4850 |
T8075 |
T8070 |
prep |
in,presented |
| R4851 |
T8076 |
T8077 |
compound |
Figure,5D |
| R4852 |
T8077 |
T8075 |
pobj |
5D,in |
| R4853 |
T8078 |
T8070 |
punct |
.,presented |
| R4854 |
T8080 |
T8081 |
prep |
Within,increased |
| R4855 |
T8082 |
T8083 |
nummod |
0.5,h |
| R4856 |
T8083 |
T8080 |
pobj |
h,Within |
| R4857 |
T8084 |
T8083 |
prep |
of,h |
| R4858 |
T8085 |
T8086 |
compound |
TGF,β2 |
| R4859 |
T8086 |
T8088 |
compound |
β2,treatment |
| R486 |
T1297 |
T1296 |
pobj |
alterations,by |
| R4860 |
T8087 |
T8086 |
punct |
-,β2 |
| R4861 |
T8088 |
T8084 |
pobj |
treatment,of |
| R4862 |
T8089 |
T8081 |
punct |
", ",increased |
| R4863 |
T8090 |
T8091 |
compound |
Snail,promoter |
| R4864 |
T8091 |
T8092 |
compound |
promoter,activity |
| R4865 |
T8092 |
T8081 |
nsubj |
activity,increased |
| R4866 |
T8093 |
T8081 |
aux |
had,increased |
| R4867 |
T8094 |
T8081 |
advmod |
3-fold,increased |
| R4868 |
T8095 |
T8081 |
punct |
", ",increased |
| R4869 |
T8096 |
T8081 |
cc |
and,increased |
| R487 |
T1298 |
T1297 |
prep |
in,alterations |
| R4870 |
T8097 |
T8098 |
prep |
by,peaked |
| R4871 |
T8098 |
T8081 |
conj |
peaked,increased |
| R4872 |
T8099 |
T8100 |
nummod |
2,h |
| R4873 |
T8100 |
T8097 |
pobj |
h,by |
| R4874 |
T8101 |
T8098 |
punct |
", ",peaked |
| R4875 |
T8102 |
T8098 |
nsubj |
it,peaked |
| R4876 |
T8103 |
T8098 |
prep |
to,peaked |
| R4877 |
T8104 |
T8105 |
advmod |
approximately,10-fold |
| R4878 |
T8105 |
T8103 |
pcomp |
10-fold,to |
| R4879 |
T8106 |
T8105 |
prep |
over,10-fold |
| R488 |
T1299 |
T1300 |
det |
the,proliferation |
| R4880 |
T8107 |
T8108 |
compound |
control,levels |
| R4881 |
T8108 |
T8106 |
pobj |
levels,over |
| R4882 |
T8109 |
T8110 |
punct |
(,5D |
| R4883 |
T8110 |
T8098 |
parataxis |
5D,peaked |
| R4884 |
T8111 |
T8110 |
compound |
Figure,5D |
| R4885 |
T8112 |
T8110 |
punct |
),5D |
| R4886 |
T8113 |
T8098 |
punct |
.,peaked |
| R4887 |
T8115 |
T8116 |
advmod |
Thereafter,returned |
| R4888 |
T8117 |
T8116 |
punct |
", ",returned |
| R4889 |
T8118 |
T8119 |
compound |
Snail,promoter |
| R489 |
T1300 |
T1298 |
pobj |
proliferation,in |
| R4890 |
T8119 |
T8120 |
compound |
promoter,activity |
| R4891 |
T8120 |
T8116 |
nsubj |
activity,returned |
| R4892 |
T8121 |
T8116 |
advmod |
rapidly,returned |
| R4893 |
T8122 |
T8116 |
prep |
to,returned |
| R4894 |
T8123 |
T8124 |
det |
the,levels |
| R4895 |
T8124 |
T8122 |
pobj |
levels,to |
| R4896 |
T8125 |
T8124 |
amod |
basal,levels |
| R4897 |
T8126 |
T8124 |
acl |
seen,levels |
| R4898 |
T8127 |
T8126 |
prep |
in,seen |
| R4899 |
T8128 |
T8129 |
amod |
unstimulated,keratinocytes |
| R49 |
T201 |
T190 |
dobj |
models,employed |
| R490 |
T1301 |
T1300 |
punct |
", ",proliferation |
| R4900 |
T8129 |
T8127 |
pobj |
keratinocytes,in |
| R4901 |
T8130 |
T8116 |
punct |
.,returned |
| R4902 |
T8132 |
T8133 |
det |
The,kinetics |
| R4903 |
T8133 |
T8134 |
nsubj |
kinetics,paralleled |
| R4904 |
T8135 |
T8133 |
prep |
of,kinetics |
| R4905 |
T8136 |
T8137 |
compound |
Snail,promoter |
| R4906 |
T8137 |
T8138 |
compound |
promoter,activity |
| R4907 |
T8138 |
T8135 |
pobj |
activity,of |
| R4908 |
T8139 |
T8134 |
advmod |
closely,paralleled |
| R4909 |
T8140 |
T8134 |
dobj |
those,paralleled |
| R491 |
T1302 |
T1300 |
conj |
polarity,proliferation |
| R4910 |
T8141 |
T8140 |
acl |
observed,those |
| R4911 |
T8142 |
T8141 |
prep |
for,observed |
| R4912 |
T8143 |
T8144 |
compound |
Snail,protein |
| R4913 |
T8144 |
T8145 |
compound |
protein,induction |
| R4914 |
T8145 |
T8142 |
pobj |
induction,for |
| R4915 |
T8146 |
T8134 |
punct |
.,paralleled |
| R4916 |
T8148 |
T8149 |
advmod |
Moreover,appeared |
| R4917 |
T8150 |
T8149 |
punct |
", ",appeared |
| R4918 |
T8151 |
T8152 |
det |
the,effects |
| R4919 |
T8152 |
T8149 |
nsubj |
effects,appeared |
| R492 |
T1303 |
T1302 |
punct |
", ",polarity |
| R4920 |
T8153 |
T8152 |
amod |
stimulatory,effects |
| R4921 |
T8154 |
T8155 |
aux |
to,be |
| R4922 |
T8155 |
T8149 |
xcomp |
be,appeared |
| R4923 |
T8156 |
T8155 |
acomp |
specific,be |
| R4924 |
T8157 |
T8156 |
prep |
to,specific |
| R4925 |
T8158 |
T8159 |
compound |
TGF,β2 |
| R4926 |
T8159 |
T8157 |
pobj |
β2,to |
| R4927 |
T8160 |
T8159 |
punct |
-,β2 |
| R4928 |
T8161 |
T8155 |
punct |
", ",be |
| R4929 |
T8162 |
T8163 |
mark |
since,abrogated |
| R493 |
T1304 |
T1302 |
conj |
shape,polarity |
| R4930 |
T8163 |
T8155 |
advcl |
abrogated,be |
| R4931 |
T8164 |
T8163 |
nsubjpass |
they,abrogated |
| R4932 |
T8165 |
T8163 |
auxpass |
were,abrogated |
| R4933 |
T8166 |
T8167 |
preconj |
either,by |
| R4934 |
T8167 |
T8163 |
prep |
by,abrogated |
| R4935 |
T8168 |
T8169 |
compound |
heat,inactivation |
| R4936 |
T8169 |
T8167 |
pobj |
inactivation,by |
| R4937 |
T8170 |
T8169 |
prep |
of,inactivation |
| R4938 |
T8171 |
T8172 |
det |
the,protein |
| R4939 |
T8172 |
T8170 |
pobj |
protein,of |
| R494 |
T1305 |
T1304 |
punct |
", ",shape |
| R4940 |
T8173 |
T8174 |
compound |
TGF,β2 |
| R4941 |
T8174 |
T8172 |
compound |
β2,protein |
| R4942 |
T8175 |
T8174 |
punct |
-,β2 |
| R4943 |
T8176 |
T8167 |
cc |
or,by |
| R4944 |
T8177 |
T8167 |
conj |
by,by |
| R4945 |
T8178 |
T8177 |
pobj |
mutation,by |
| R4946 |
T8179 |
T8178 |
prep |
of,mutation |
| R4947 |
T8180 |
T8181 |
det |
a,element |
| R4948 |
T8181 |
T8179 |
pobj |
element,of |
| R4949 |
T8182 |
T8181 |
amod |
putative,element |
| R495 |
T1306 |
T1304 |
cc |
and,shape |
| R4950 |
T8183 |
T8184 |
compound |
SMAD,binding |
| R4951 |
T8184 |
T8181 |
compound |
binding,element |
| R4952 |
T8185 |
T8181 |
acl |
located,element |
| R4953 |
T8186 |
T8187 |
quantmod |
about,1.8 |
| R4954 |
T8187 |
T8188 |
nummod |
1.8,kb |
| R4955 |
T8188 |
T8185 |
npadvmod |
kb,located |
| R4956 |
T8189 |
T8188 |
nummod |
5,kb |
| R4957 |
T8190 |
T8188 |
punct |
′,kb |
| R4958 |
T8191 |
T8188 |
prep |
from,kb |
| R4959 |
T8192 |
T8193 |
det |
the,site |
| R496 |
T1307 |
T1304 |
conj |
adhesiveness,shape |
| R4960 |
T8193 |
T8191 |
pobj |
site,from |
| R4961 |
T8194 |
T8193 |
compound |
Snail,site |
| R4962 |
T8195 |
T8193 |
compound |
transcription,site |
| R4963 |
T8196 |
T8193 |
compound |
start,site |
| R4964 |
T8197 |
T8198 |
punct |
(,5D |
| R4965 |
T8198 |
T8163 |
parataxis |
5D,abrogated |
| R4966 |
T8199 |
T8198 |
compound |
Figure,5D |
| R4967 |
T8200 |
T8198 |
punct |
),5D |
| R4968 |
T8201 |
T8149 |
punct |
.,appeared |
| R4969 |
T8203 |
T8204 |
advcl |
Taken,suggested |
| R497 |
T1308 |
T1300 |
prep |
of,proliferation |
| R4970 |
T8205 |
T8203 |
advmod |
together,Taken |
| R4971 |
T8206 |
T8204 |
punct |
", ",suggested |
| R4972 |
T8207 |
T8208 |
det |
these,results |
| R4973 |
T8208 |
T8204 |
nsubj |
results,suggested |
| R4974 |
T8209 |
T8210 |
mark |
that,results |
| R4975 |
T8210 |
T8204 |
advcl |
results,suggested |
| R4976 |
T8211 |
T8210 |
prep |
in,results |
| R4977 |
T8212 |
T8211 |
pobj |
keratinocytes,in |
| R4978 |
T8213 |
T8210 |
punct |
", ",results |
| R4979 |
T8214 |
T8215 |
compound |
TGF,β2 |
| R498 |
T1309 |
T1310 |
amod |
selected,cells |
| R4980 |
T8215 |
T8217 |
compound |
β2,signaling |
| R4981 |
T8216 |
T8215 |
punct |
-,β2 |
| R4982 |
T8217 |
T8210 |
nsubj |
signaling,results |
| R4983 |
T8218 |
T8210 |
prep |
in,results |
| R4984 |
T8219 |
T8220 |
det |
a,activation |
| R4985 |
T8220 |
T8218 |
pobj |
activation,in |
| R4986 |
T8221 |
T8222 |
npadvmod |
pSMAD2,dependent |
| R4987 |
T8222 |
T8220 |
amod |
dependent,activation |
| R4988 |
T8223 |
T8222 |
punct |
-,dependent |
| R4989 |
T8224 |
T8220 |
amod |
transient,activation |
| R499 |
T1310 |
T1308 |
pobj |
cells,of |
| R4990 |
T8225 |
T8220 |
prep |
of,activation |
| R4991 |
T8226 |
T8227 |
det |
the,gene |
| R4992 |
T8227 |
T8225 |
pobj |
gene,of |
| R4993 |
T8228 |
T8227 |
compound |
Snail,gene |
| R4994 |
T8229 |
T8210 |
punct |
", ",results |
| R4995 |
T8230 |
T8210 |
cc |
and,results |
| R4996 |
T8231 |
T8232 |
mark |
that,relies |
| R4997 |
T8232 |
T8210 |
conj |
relies,results |
| R4998 |
T8233 |
T8232 |
nsubj |
maintenance,relies |
| R4999 |
T8234 |
T8233 |
prep |
of,maintenance |
| R5 |
T152 |
T150 |
dobj |
β2,Involving |
| R50 |
T202 |
T201 |
cc |
and,models |
| R500 |
T1311 |
T1296 |
punct |
", ",by |
| R5000 |
T8235 |
T8236 |
compound |
Snail,protein |
| R5001 |
T8236 |
T8234 |
pobj |
protein,of |
| R5002 |
T8237 |
T8232 |
punct |
", ",relies |
| R5003 |
T8238 |
T8232 |
prep |
in,relies |
| R5004 |
T8239 |
T8238 |
pobj |
part,in |
| R5005 |
T8240 |
T8232 |
punct |
", ",relies |
| R5006 |
T8241 |
T8232 |
prep |
upon,relies |
| R5007 |
T8242 |
T8243 |
amod |
sustained,activity |
| R5008 |
T8243 |
T8241 |
pobj |
activity,upon |
| R5009 |
T8244 |
T8243 |
compound |
promoter,activity |
| R501 |
T1312 |
T1313 |
advmod |
as,as |
| R5010 |
T8245 |
T8204 |
punct |
.,suggested |
| R5011 |
T8247 |
T8248 |
det |
The,brevity |
| R5012 |
T8248 |
T8249 |
nsubj |
brevity,resembled |
| R5013 |
T8250 |
T8248 |
prep |
of,brevity |
| R5014 |
T8251 |
T8252 |
nmod |
Snail,gene |
| R5015 |
T8252 |
T8253 |
nmod |
gene,induction |
| R5016 |
T8253 |
T8250 |
pobj |
induction,of |
| R5017 |
T8254 |
T8252 |
cc |
and,gene |
| R5018 |
T8255 |
T8252 |
conj |
protein,gene |
| R5019 |
T8256 |
T8253 |
prep |
in,induction |
| R502 |
T1313 |
T1296 |
cc |
as,by |
| R5020 |
T8257 |
T8258 |
compound |
TGF,β2 |
| R5021 |
T8258 |
T8260 |
npadvmod |
β2,treated |
| R5022 |
T8259 |
T8258 |
punct |
-,β2 |
| R5023 |
T8260 |
T8261 |
amod |
treated,keratinocytes |
| R5024 |
T8261 |
T8256 |
pobj |
keratinocytes,in |
| R5025 |
T8262 |
T8261 |
amod |
cultured,keratinocytes |
| R5026 |
T8263 |
T8264 |
det |
the,appearance |
| R5027 |
T8264 |
T8249 |
dobj |
appearance,resembled |
| R5028 |
T8265 |
T8264 |
amod |
temporal,appearance |
| R5029 |
T8266 |
T8264 |
prep |
of,appearance |
| R503 |
T1314 |
T1313 |
advmod |
well,as |
| R5030 |
T8267 |
T8268 |
compound |
Snail,mRNA |
| R5031 |
T8268 |
T8266 |
pobj |
mRNA,of |
| R5032 |
T8269 |
T8268 |
cc |
and,mRNA |
| R5033 |
T8270 |
T8268 |
conj |
protein,mRNA |
| R5034 |
T8271 |
T8264 |
prep |
at,appearance |
| R5035 |
T8272 |
T8273 |
det |
the,initiation |
| R5036 |
T8273 |
T8271 |
pobj |
initiation,at |
| R5037 |
T8274 |
T8273 |
prep |
of,initiation |
| R5038 |
T8275 |
T8276 |
compound |
hair,follicle |
| R5039 |
T8276 |
T8277 |
compound |
follicle,morphogenesis |
| R504 |
T1315 |
T1296 |
conj |
by,by |
| R5040 |
T8277 |
T8274 |
pobj |
morphogenesis,of |
| R5041 |
T8278 |
T8249 |
prep |
in,resembled |
| R5042 |
T8279 |
T8280 |
amod |
embryonic,skin |
| R5043 |
T8280 |
T8278 |
pobj |
skin,in |
| R5044 |
T8281 |
T8280 |
compound |
mouse,skin |
| R5045 |
T8282 |
T8249 |
punct |
.,resembled |
| R5046 |
T8284 |
T8285 |
aux |
To,test |
| R5047 |
T8285 |
T8286 |
advcl |
test,analyzed |
| R5048 |
T8287 |
T8288 |
mark |
whether,required |
| R5049 |
T8288 |
T8285 |
ccomp |
required,test |
| R505 |
T1316 |
T1315 |
pobj |
modifications,by |
| R5050 |
T8289 |
T8290 |
compound |
TGF,β2 |
| R5051 |
T8290 |
T8288 |
nsubjpass |
β2,required |
| R5052 |
T8291 |
T8290 |
punct |
-,β2 |
| R5053 |
T8292 |
T8288 |
aux |
might,required |
| R5054 |
T8293 |
T8288 |
auxpass |
be,required |
| R5055 |
T8294 |
T8288 |
prep |
for,required |
| R5056 |
T8295 |
T8296 |
compound |
Snail,induction |
| R5057 |
T8296 |
T8294 |
pobj |
induction,for |
| R5058 |
T8297 |
T8296 |
prep |
in,induction |
| R5059 |
T8298 |
T8299 |
compound |
hair,bud |
| R506 |
T1317 |
T1316 |
prep |
in,modifications |
| R5060 |
T8299 |
T8300 |
compound |
bud,formation |
| R5061 |
T8300 |
T8297 |
pobj |
formation,in |
| R5062 |
T8301 |
T8302 |
advmod |
in,vivo |
| R5063 |
T8302 |
T8288 |
advmod |
vivo,required |
| R5064 |
T8303 |
T8286 |
punct |
", ",analyzed |
| R5065 |
T8304 |
T8286 |
nsubj |
we,analyzed |
| R5066 |
T8305 |
T8286 |
advmod |
first,analyzed |
| R5067 |
T8306 |
T8307 |
mark |
whether,expressed |
| R5068 |
T8307 |
T8286 |
ccomp |
expressed,analyzed |
| R5069 |
T8308 |
T8309 |
compound |
TGF,β2 |
| R507 |
T1318 |
T1319 |
poss |
their,lamina |
| R5070 |
T8309 |
T8307 |
nsubjpass |
β2,expressed |
| R5071 |
T8310 |
T8309 |
punct |
-,β2 |
| R5072 |
T8311 |
T8307 |
auxpass |
was,expressed |
| R5073 |
T8312 |
T8307 |
prep |
in,expressed |
| R5074 |
T8313 |
T8312 |
cc |
or,in |
| R5075 |
T8314 |
T8312 |
conj |
around,in |
| R5076 |
T8315 |
T8316 |
det |
the,bud |
| R5077 |
T8316 |
T8314 |
pobj |
bud,around |
| R5078 |
T8317 |
T8316 |
compound |
hair,bud |
| R5079 |
T8318 |
T8286 |
punct |
.,analyzed |
| R508 |
T1319 |
T1317 |
pobj |
lamina,in |
| R5080 |
T8320 |
T8321 |
advcl |
Consistent,labeled |
| R5081 |
T8322 |
T8320 |
prep |
with,Consistent |
| R5082 |
T8323 |
T8324 |
amod |
previous,observations |
| R5083 |
T8324 |
T8322 |
pobj |
observations,with |
| R5084 |
T8325 |
T8326 |
punct |
[,33 |
| R5085 |
T8326 |
T8320 |
parataxis |
33,Consistent |
| R5086 |
T8327 |
T8326 |
punct |
],33 |
| R5087 |
T8328 |
T8321 |
punct |
", ",labeled |
| R5088 |
T8329 |
T8330 |
det |
an,antibody |
| R5089 |
T8330 |
T8321 |
nsubj |
antibody,labeled |
| R509 |
T1320 |
T1319 |
amod |
underlying,lamina |
| R5090 |
T8331 |
T8332 |
amod |
anti-TGF,β2 |
| R5091 |
T8332 |
T8330 |
compound |
β2,antibody |
| R5092 |
T8333 |
T8332 |
punct |
-,β2 |
| R5093 |
T8334 |
T8335 |
amod |
developing,buds |
| R5094 |
T8335 |
T8321 |
dobj |
buds,labeled |
| R5095 |
T8336 |
T8335 |
compound |
hair,buds |
| R5096 |
T8337 |
T8338 |
punct |
(,6A |
| R5097 |
T8338 |
T8321 |
parataxis |
6A,labeled |
| R5098 |
T8339 |
T8338 |
compound |
Figure,6A |
| R5099 |
T8340 |
T8338 |
punct |
),6A |
| R51 |
T203 |
T204 |
amod |
cultured,keratinocytes |
| R510 |
T1321 |
T1319 |
amod |
basal,lamina |
| R5100 |
T8341 |
T8321 |
punct |
.,labeled |
| R5101 |
T8343 |
T8344 |
det |
This,labeling |
| R5102 |
T8344 |
T8345 |
nsubj |
labeling,appeared |
| R5103 |
T8346 |
T8347 |
aux |
to,be |
| R5104 |
T8347 |
T8345 |
xcomp |
be,appeared |
| R5105 |
T8348 |
T8347 |
acomp |
specific,be |
| R5106 |
T8349 |
T8350 |
mark |
as,judged |
| R5107 |
T8350 |
T8347 |
advcl |
judged,be |
| R5108 |
T8351 |
T8350 |
prep |
by,judged |
| R5109 |
T8352 |
T8353 |
det |
the,lack |
| R511 |
T1322 |
T1293 |
punct |
.,accompanied |
| R5110 |
T8353 |
T8351 |
pobj |
lack,by |
| R5111 |
T8354 |
T8353 |
prep |
of,lack |
| R5112 |
T8355 |
T8354 |
pobj |
staining,of |
| R5113 |
T8356 |
T8353 |
prep |
in,lack |
| R5114 |
T8357 |
T8358 |
compound |
follicle,buds |
| R5115 |
T8358 |
T8356 |
pobj |
buds,in |
| R5116 |
T8359 |
T8358 |
prep |
from,buds |
| R5117 |
T8360 |
T8359 |
pobj |
mice,from |
| R5118 |
T8361 |
T8360 |
amod |
homozygous,mice |
| R5119 |
T8362 |
T8361 |
prep |
for,homozygous |
| R512 |
T1324 |
T1325 |
advmod |
Thus,orchestrated |
| R5120 |
T8363 |
T8364 |
det |
a,mutation |
| R5121 |
T8364 |
T8362 |
pobj |
mutation,for |
| R5122 |
T8365 |
T8366 |
nmod |
TGF,β2 |
| R5123 |
T8366 |
T8364 |
nmod |
β2,mutation |
| R5124 |
T8367 |
T8366 |
punct |
-,β2 |
| R5125 |
T8368 |
T8364 |
amod |
null,mutation |
| R5126 |
T8369 |
T8370 |
punct |
(,34 |
| R5127 |
T8370 |
T8345 |
parataxis |
34,appeared |
| R5128 |
T8371 |
T8372 |
compound |
Figure,6A |
| R5129 |
T8372 |
T8370 |
dep |
6A,34 |
| R513 |
T1326 |
T1325 |
punct |
", ",orchestrated |
| R5130 |
T8373 |
T8370 |
punct |
;,34 |
| R5131 |
T8374 |
T8370 |
punct |
[,34 |
| R5132 |
T8375 |
T8370 |
punct |
],34 |
| R5133 |
T8376 |
T8370 |
punct |
),34 |
| R5134 |
T8377 |
T8345 |
punct |
.,appeared |
| R5135 |
T8379 |
T8380 |
advmod |
Moreover,expressed |
| R5136 |
T8381 |
T8380 |
punct |
", ",expressed |
| R5137 |
T8382 |
T8383 |
det |
the,effector |
| R5138 |
T8383 |
T8380 |
nsubjpass |
effector,expressed |
| R5139 |
T8384 |
T8383 |
amod |
downstream,effector |
| R514 |
T1327 |
T1328 |
amod |
extracellular,crosstalk |
| R5140 |
T8385 |
T8383 |
prep |
of,effector |
| R5141 |
T8386 |
T8387 |
compound |
TGF,β2 |
| R5142 |
T8387 |
T8389 |
compound |
β2,signaling |
| R5143 |
T8388 |
T8387 |
punct |
-,β2 |
| R5144 |
T8389 |
T8385 |
pobj |
signaling,of |
| R5145 |
T8390 |
T8383 |
punct |
", ",effector |
| R5146 |
T8391 |
T8383 |
appos |
pSMAD2,effector |
| R5147 |
T8392 |
T8380 |
punct |
", ",expressed |
| R5148 |
T8393 |
T8380 |
auxpass |
was,expressed |
| R5149 |
T8394 |
T8380 |
advmod |
also,expressed |
| R515 |
T1328 |
T1325 |
nsubjpass |
crosstalk,orchestrated |
| R5150 |
T8395 |
T8380 |
prep |
in,expressed |
| R5151 |
T8396 |
T8397 |
nmod |
WT,buds |
| R5152 |
T8397 |
T8395 |
pobj |
buds,in |
| R5153 |
T8398 |
T8396 |
punct |
", ",WT |
| R5154 |
T8399 |
T8396 |
cc |
but,WT |
| R5155 |
T8400 |
T8399 |
neg |
not,but |
| R5156 |
T8401 |
T8402 |
compound |
TGF,β2 |
| R5157 |
T8402 |
T8404 |
npadvmod |
β2,null |
| R5158 |
T8403 |
T8402 |
punct |
-,β2 |
| R5159 |
T8404 |
T8396 |
conj |
null,WT |
| R516 |
T1329 |
T1330 |
amod |
epithelial,mesenchymal |
| R5160 |
T8405 |
T8404 |
punct |
-,null |
| R5161 |
T8406 |
T8397 |
punct |
", ",buds |
| R5162 |
T8407 |
T8397 |
compound |
hair,buds |
| R5163 |
T8408 |
T8409 |
punct |
(,6B |
| R5164 |
T8409 |
T8380 |
parataxis |
6B,expressed |
| R5165 |
T8410 |
T8409 |
compound |
Figure,6B |
| R5166 |
T8411 |
T8409 |
punct |
),6B |
| R5167 |
T8412 |
T8380 |
punct |
.,expressed |
| R5168 |
T8414 |
T8415 |
advmod |
Together,underscore |
| R5169 |
T8416 |
T8415 |
punct |
", ",underscore |
| R517 |
T1330 |
T1328 |
amod |
mesenchymal,crosstalk |
| R5170 |
T8417 |
T8418 |
det |
these,data |
| R5171 |
T8418 |
T8415 |
nsubj |
data,underscore |
| R5172 |
T8419 |
T8420 |
det |
the,importance |
| R5173 |
T8420 |
T8415 |
dobj |
importance,underscore |
| R5174 |
T8421 |
T8420 |
prep |
of,importance |
| R5175 |
T8422 |
T8423 |
det |
the,isoform |
| R5176 |
T8423 |
T8421 |
pobj |
isoform,of |
| R5177 |
T8424 |
T8425 |
compound |
TGF,β2 |
| R5178 |
T8425 |
T8423 |
compound |
β2,isoform |
| R5179 |
T8426 |
T8425 |
punct |
-,β2 |
| R518 |
T1331 |
T1330 |
punct |
-,mesenchymal |
| R5180 |
T8427 |
T8415 |
prep |
despite,underscore |
| R5181 |
T8428 |
T8427 |
pobj |
expression,despite |
| R5182 |
T8429 |
T8428 |
prep |
of,expression |
| R5183 |
T8430 |
T8431 |
preconj |
both,β1 |
| R5184 |
T8431 |
T8429 |
pobj |
β1,of |
| R5185 |
T8432 |
T8431 |
compound |
TGF,β1 |
| R5186 |
T8433 |
T8431 |
punct |
-,β1 |
| R5187 |
T8434 |
T8431 |
cc |
and,β1 |
| R5188 |
T8435 |
T8436 |
compound |
TGF,β2 |
| R5189 |
T8436 |
T8431 |
conj |
β2,β1 |
| R519 |
T1332 |
T1325 |
aux |
must,orchestrated |
| R5190 |
T8437 |
T8436 |
punct |
-,β2 |
| R5191 |
T8438 |
T8428 |
prep |
in,expression |
| R5192 |
T8439 |
T8440 |
amod |
developing,buds |
| R5193 |
T8440 |
T8438 |
pobj |
buds,in |
| R5194 |
T8441 |
T8440 |
compound |
hair,buds |
| R5195 |
T8442 |
T8428 |
prep |
at,expression |
| R5196 |
T8443 |
T8444 |
det |
this,stage |
| R5197 |
T8444 |
T8442 |
pobj |
stage,at |
| R5198 |
T8445 |
T8415 |
punct |
.,underscore |
| R5199 |
T8447 |
T8448 |
aux |
To,explore |
| R52 |
T204 |
T201 |
conj |
keratinocytes,models |
| R520 |
T1333 |
T1325 |
auxpass |
be,orchestrated |
| R5200 |
T8448 |
T8450 |
advcl |
explore,examined |
| R5201 |
T8449 |
T8448 |
advmod |
further,explore |
| R5202 |
T8451 |
T8452 |
det |
the,relation |
| R5203 |
T8452 |
T8448 |
dobj |
relation,explore |
| R5204 |
T8453 |
T8452 |
amod |
possible,relation |
| R5205 |
T8454 |
T8452 |
prep |
between,relation |
| R5206 |
T8455 |
T8454 |
pobj |
Snail,between |
| R5207 |
T8456 |
T8455 |
cc |
and,Snail |
| R5208 |
T8457 |
T8458 |
compound |
TGF,β2 |
| R5209 |
T8458 |
T8455 |
conj |
β2,Snail |
| R521 |
T1334 |
T1325 |
advmod |
intricately,orchestrated |
| R5210 |
T8459 |
T8458 |
punct |
-,β2 |
| R5211 |
T8460 |
T8450 |
punct |
", ",examined |
| R5212 |
T8461 |
T8450 |
nsubj |
we,examined |
| R5213 |
T8462 |
T8463 |
det |
the,status |
| R5214 |
T8463 |
T8450 |
dobj |
status,examined |
| R5215 |
T8464 |
T8463 |
prep |
of,status |
| R5216 |
T8465 |
T8466 |
compound |
Snail,expression |
| R5217 |
T8466 |
T8464 |
pobj |
expression,of |
| R5218 |
T8467 |
T8463 |
prep |
in,status |
| R5219 |
T8468 |
T8469 |
compound |
TGF,β2 |
| R522 |
T1335 |
T1336 |
aux |
to,couple |
| R5220 |
T8469 |
T8471 |
npadvmod |
β2,null |
| R5221 |
T8470 |
T8469 |
punct |
-,β2 |
| R5222 |
T8471 |
T8473 |
amod |
null,buds |
| R5223 |
T8472 |
T8471 |
punct |
-,null |
| R5224 |
T8473 |
T8467 |
pobj |
buds,in |
| R5225 |
T8474 |
T8473 |
compound |
hair,buds |
| R5226 |
T8475 |
T8450 |
punct |
.,examined |
| R5227 |
T8477 |
T8478 |
mark |
As,judged |
| R5228 |
T8478 |
T8479 |
advcl |
judged,was |
| R5229 |
T8480 |
T8478 |
prep |
by,judged |
| R523 |
T1336 |
T1325 |
advcl |
couple,orchestrated |
| R5230 |
T8481 |
T8480 |
pobj |
immunohistochemistry,by |
| R5231 |
T8482 |
T8479 |
punct |
", ",was |
| R5232 |
T8483 |
T8484 |
compound |
Snail,protein |
| R5233 |
T8484 |
T8479 |
nsubj |
protein,was |
| R5234 |
T8485 |
T8479 |
acomp |
absent,was |
| R5235 |
T8486 |
T8485 |
prep |
from,absent |
| R5236 |
T8487 |
T8488 |
compound |
E17.5,skin |
| R5237 |
T8488 |
T8486 |
pobj |
skin,from |
| R5238 |
T8489 |
T8488 |
prep |
of,skin |
| R5239 |
T8490 |
T8491 |
compound |
TGF,β2 |
| R524 |
T1337 |
T1338 |
det |
the,determination |
| R5240 |
T8491 |
T8493 |
npadvmod |
β2,null |
| R5241 |
T8492 |
T8491 |
punct |
-,β2 |
| R5242 |
T8493 |
T8495 |
amod |
null,embryos |
| R5243 |
T8494 |
T8493 |
punct |
-,null |
| R5244 |
T8495 |
T8489 |
pobj |
embryos,of |
| R5245 |
T8496 |
T8486 |
cc |
but,from |
| R5246 |
T8497 |
T8496 |
neg |
not,but |
| R5247 |
T8498 |
T8486 |
conj |
from,from |
| R5248 |
T8499 |
T8498 |
pobj |
that,from |
| R5249 |
T8500 |
T8499 |
prep |
of,that |
| R525 |
T1338 |
T1336 |
dobj |
determination,couple |
| R5250 |
T8501 |
T8502 |
compound |
control,littermates |
| R5251 |
T8502 |
T8500 |
pobj |
littermates,of |
| R5252 |
T8503 |
T8504 |
punct |
(,6C |
| R5253 |
T8504 |
T8479 |
parataxis |
6C,was |
| R5254 |
T8505 |
T8504 |
compound |
Figure,6C |
| R5255 |
T8506 |
T8504 |
punct |
),6C |
| R5256 |
T8507 |
T8479 |
punct |
.,was |
| R5257 |
T8509 |
T8510 |
det |
This,effect |
| R5258 |
T8510 |
T8511 |
nsubj |
effect,appeared |
| R5259 |
T8512 |
T8513 |
aux |
to,exerted |
| R526 |
T1339 |
T1338 |
prep |
of,determination |
| R5260 |
T8513 |
T8511 |
xcomp |
exerted,appeared |
| R5261 |
T8514 |
T8513 |
auxpass |
be,exerted |
| R5262 |
T8515 |
T8513 |
prep |
at,exerted |
| R5263 |
T8516 |
T8517 |
det |
the,level |
| R5264 |
T8517 |
T8515 |
pobj |
level,at |
| R5265 |
T8518 |
T8517 |
amod |
transcriptional,level |
| R5266 |
T8519 |
T8511 |
punct |
", ",appeared |
| R5267 |
T8520 |
T8521 |
mark |
since,found |
| R5268 |
T8521 |
T8511 |
advcl |
found,appeared |
| R5269 |
T8522 |
T8523 |
compound |
Snail,mRNAs |
| R527 |
T1340 |
T1341 |
amod |
distinct,fates |
| R5270 |
T8523 |
T8521 |
nsubjpass |
mRNAs,found |
| R5271 |
T8524 |
T8521 |
auxpass |
were,found |
| R5272 |
T8525 |
T8521 |
advmod |
also,found |
| R5273 |
T8526 |
T8521 |
neg |
not,found |
| R5274 |
T8527 |
T8521 |
prep |
in,found |
| R5275 |
T8528 |
T8529 |
compound |
TGF,β2 |
| R5276 |
T8529 |
T8531 |
npadvmod |
β2,null |
| R5277 |
T8530 |
T8529 |
punct |
-,β2 |
| R5278 |
T8531 |
T8532 |
amod |
null,buds |
| R5279 |
T8532 |
T8527 |
pobj |
buds,in |
| R528 |
T1341 |
T1339 |
pobj |
fates,of |
| R5280 |
T8533 |
T8532 |
compound |
hair,buds |
| R5281 |
T8534 |
T8521 |
prep |
under,found |
| R5282 |
T8535 |
T8534 |
pobj |
conditions,under |
| R5283 |
T8536 |
T8537 |
prep |
in,detected |
| R5284 |
T8537 |
T8535 |
relcl |
detected,conditions |
| R5285 |
T8538 |
T8536 |
pobj |
which,in |
| R5286 |
T8539 |
T8540 |
det |
the,signal |
| R5287 |
T8559 |
T8557 |
prep |
in,detected |
| R5288 |
T8540 |
T8537 |
nsubjpass |
signal,detected |
| R5289 |
T8541 |
T8537 |
auxpass |
was,detected |
| R529 |
T1342 |
T1341 |
compound |
cell,fates |
| R5290 |
T8560 |
T8561 |
nummod |
2,wk |
| R5291 |
T8561 |
T8563 |
npadvmod |
wk,old |
| R5292 |
T8542 |
T8537 |
advmod |
readily,detected |
| R5293 |
T8562 |
T8561 |
punct |
-,wk |
| R5294 |
T8563 |
T8565 |
amod |
old,mice |
| R5295 |
T8564 |
T8563 |
punct |
-,old |
| R5296 |
T8543 |
T8537 |
prep |
in,detected |
| R5297 |
T8565 |
T8559 |
pobj |
mice,in |
| R5298 |
T8566 |
T8567 |
compound |
K14,Smad2 |
| R5299 |
T8567 |
T8565 |
compound |
Smad2,mice |
| R53 |
T205 |
T206 |
aux |
to,dissect |
| R530 |
T1343 |
T1336 |
prep |
with,couple |
| R5300 |
T8568 |
T8567 |
punct |
-,Smad2 |
| R5301 |
T8569 |
T8565 |
compound |
Tg,mice |
| R5302 |
T8544 |
T8545 |
det |
the,buds |
| R5303 |
T8570 |
T8565 |
punct |
", ",mice |
| R5304 |
T8571 |
T8572 |
dep |
which,display |
| R5305 |
T8572 |
T8565 |
relcl |
display,mice |
| R5306 |
T8545 |
T8543 |
pobj |
buds,in |
| R5307 |
T8573 |
T8574 |
amod |
elevated,signaling |
| R5308 |
T8546 |
T8545 |
compound |
hair,buds |
| R5309 |
T8574 |
T8572 |
dobj |
signaling,display |
| R531 |
T1344 |
T1345 |
det |
the,remodeling |
| R5310 |
T8575 |
T8576 |
compound |
TGF,β |
| R5311 |
T8547 |
T8545 |
prep |
of,buds |
| R5312 |
T8576 |
T8574 |
compound |
β,signaling |
| R5313 |
T8577 |
T8576 |
punct |
-,β |
| R5314 |
T8578 |
T8572 |
prep |
in,display |
| R5315 |
T8548 |
T8549 |
compound |
littermate,skin |
| R5316 |
T8549 |
T8547 |
pobj |
skin,of |
| R5317 |
T8579 |
T8578 |
pobj |
skin,in |
| R5318 |
T8580 |
T8581 |
punct |
[,35 |
| R5319 |
T8550 |
T8551 |
punct |
(,6D |
| R532 |
T1345 |
T1343 |
pobj |
remodeling,with |
| R5320 |
T8581 |
T8559 |
parataxis |
35,in |
| R5321 |
T8582 |
T8581 |
punct |
],35 |
| R5322 |
T8583 |
T8557 |
punct |
", ",detected |
| R5323 |
T8551 |
T8521 |
parataxis |
6D,found |
| R5324 |
T8584 |
T8585 |
compound |
Snail,protein |
| R5325 |
T8585 |
T8557 |
nsubjpass |
protein,detected |
| R5326 |
T8552 |
T8551 |
compound |
Figure,6D |
| R5327 |
T8586 |
T8557 |
auxpass |
was,detected |
| R5328 |
T8587 |
T8557 |
advmod |
readily,detected |
| R5329 |
T8553 |
T8551 |
punct |
),6D |
| R533 |
T1346 |
T1345 |
amod |
contemporaneous,remodeling |
| R5330 |
T8588 |
T8557 |
prep |
by,detected |
| R5331 |
T8554 |
T8511 |
punct |
.,appeared |
| R5332 |
T8589 |
T8590 |
compound |
Western,blot |
| R5333 |
T8590 |
T8591 |
compound |
blot,analyses |
| R5334 |
T8591 |
T8588 |
pobj |
analyses,by |
| R5335 |
T8592 |
T8557 |
punct |
", ",detected |
| R5336 |
T8593 |
T8594 |
advmod |
where,found |
| R5337 |
T8556 |
T8557 |
advmod |
Conversely,detected |
| R5338 |
T8594 |
T8557 |
advcl |
found,detected |
| R5339 |
T8595 |
T8594 |
nsubjpass |
it,found |
| R534 |
T1347 |
T1345 |
prep |
of,remodeling |
| R5340 |
T8596 |
T8594 |
auxpass |
was,found |
| R5341 |
T8597 |
T8594 |
neg |
not,found |
| R5342 |
T8558 |
T8557 |
punct |
", ",detected |
| R5343 |
T8598 |
T8594 |
prep |
in,found |
| R5344 |
T8599 |
T8600 |
amod |
postnatal,skin |
| R5345 |
T8600 |
T8598 |
pobj |
skin,in |
| R5346 |
T8601 |
T8602 |
punct |
(,6E |
| R5347 |
T8664 |
T8660 |
advmod |
still,formed |
| R5348 |
T8602 |
T8557 |
parataxis |
6E,detected |
| R5349 |
T8603 |
T8602 |
compound |
Figure,6E |
| R535 |
T1348 |
T1349 |
det |
the,properties |
| R5350 |
T8604 |
T8602 |
punct |
),6E |
| R5351 |
T8605 |
T8557 |
punct |
.,detected |
| R5352 |
T8607 |
T8608 |
advcl |
Taken,provide |
| R5353 |
T8609 |
T8607 |
advmod |
together,Taken |
| R5354 |
T8610 |
T8608 |
punct |
", ",provide |
| R5355 |
T8611 |
T8612 |
det |
these,results |
| R5356 |
T8666 |
T8660 |
prep |
in,formed |
| R5357 |
T8612 |
T8608 |
nsubj |
results,provide |
| R5358 |
T8613 |
T8614 |
amod |
compelling,evidence |
| R5359 |
T8614 |
T8608 |
dobj |
evidence,provide |
| R536 |
T1349 |
T1347 |
pobj |
properties,of |
| R5360 |
T8615 |
T8616 |
mark |
that,is |
| R5361 |
T8616 |
T8614 |
acl |
is,evidence |
| R5362 |
T8667 |
T8668 |
compound |
TGF,β2 |
| R5363 |
T8617 |
T8618 |
compound |
TGF,β2 |
| R5364 |
T8618 |
T8616 |
nsubj |
β2,is |
| R5365 |
T8619 |
T8618 |
punct |
-,β2 |
| R5366 |
T8668 |
T8670 |
npadvmod |
β2,null |
| R5367 |
T8620 |
T8621 |
advmod |
functionally,important |
| R5368 |
T8621 |
T8616 |
acomp |
important,is |
| R5369 |
T8669 |
T8668 |
punct |
-,β2 |
| R537 |
T1350 |
T1349 |
amod |
physical,properties |
| R5370 |
T8622 |
T8621 |
prep |
for,important |
| R5371 |
T8623 |
T8622 |
pcomp |
inducing,for |
| R5372 |
T8624 |
T8625 |
compound |
Snail,expression |
| R5373 |
T8670 |
T8671 |
amod |
null,skin |
| R5374 |
T8625 |
T8623 |
dobj |
expression,inducing |
| R5375 |
T8626 |
T8625 |
compound |
gene,expression |
| R5376 |
T8627 |
T8623 |
prep |
in,inducing |
| R5377 |
T8671 |
T8666 |
pobj |
skin,in |
| R5378 |
T8628 |
T8629 |
det |
a,manner |
| R5379 |
T8629 |
T8627 |
pobj |
manner,in |
| R538 |
T1351 |
T1350 |
cc |
and,physical |
| R5380 |
T8672 |
T8665 |
punct |
", ",reduced |
| R5381 |
T8630 |
T8631 |
npadvmod |
pSMAD,dependent |
| R5382 |
T8631 |
T8629 |
amod |
dependent,manner |
| R5383 |
T8632 |
T8631 |
punct |
-,dependent |
| R5384 |
T8673 |
T8674 |
poss |
their,number |
| R5385 |
T8633 |
T8623 |
prep |
in,inducing |
| R5386 |
T8634 |
T8635 |
amod |
developing,buds |
| R5387 |
T8635 |
T8633 |
pobj |
buds,in |
| R5388 |
T8674 |
T8665 |
nsubjpass |
number,reduced |
| R5389 |
T8636 |
T8635 |
compound |
hair,buds |
| R539 |
T1352 |
T1350 |
conj |
structural,physical |
| R5390 |
T8637 |
T8608 |
punct |
.,provide |
| R5391 |
T8675 |
T8665 |
auxpass |
was,reduced |
| R5392 |
T8639 |
T8640 |
mark |
Whether,contributes |
| R5393 |
T8640 |
T8644 |
csubjpass |
contributes,addressed |
| R5394 |
T8676 |
T8665 |
prep |
by,reduced |
| R5395 |
T8641 |
T8642 |
compound |
pMARK,activity |
| R5396 |
T8642 |
T8640 |
nsubj |
activity,contributes |
| R5397 |
T8643 |
T8640 |
advmod |
also,contributes |
| R5398 |
T8677 |
T8678 |
advmod |
approximately,50 |
| R5399 |
T8645 |
T8640 |
prep |
to,contributes |
| R54 |
T206 |
T190 |
advcl |
dissect,employed |
| R540 |
T1353 |
T1349 |
prep |
of,properties |
| R5400 |
T8646 |
T8647 |
compound |
Snail,induction |
| R5401 |
T8647 |
T8645 |
pobj |
induction,to |
| R5402 |
T8648 |
T8644 |
auxpass |
was,addressed |
| R5403 |
T8649 |
T8644 |
neg |
not,addressed |
| R5404 |
T8678 |
T8679 |
nummod |
50,% |
| R5405 |
T8650 |
T8644 |
prep |
in,addressed |
| R5406 |
T8651 |
T8652 |
det |
the,study |
| R5407 |
T8652 |
T8650 |
pobj |
study,in |
| R5408 |
T8679 |
T8676 |
pobj |
%,by |
| R5409 |
T8653 |
T8652 |
amod |
present,study |
| R541 |
T1354 |
T1355 |
det |
the,cell |
| R5410 |
T8654 |
T8655 |
punct |
[,15 |
| R5411 |
T8655 |
T8644 |
parataxis |
15,addressed |
| R5412 |
T8680 |
T8681 |
punct |
[,32 |
| R5413 |
T8656 |
T8655 |
punct |
],15 |
| R5414 |
T8657 |
T8644 |
punct |
.,addressed |
| R5415 |
T8681 |
T8665 |
parataxis |
32,reduced |
| R5416 |
T8659 |
T8660 |
mark |
Although,formed |
| R5417 |
T8660 |
T8665 |
advcl |
formed,reduced |
| R5418 |
T8661 |
T8662 |
det |
some,buds |
| R5419 |
T8682 |
T8681 |
punct |
],32 |
| R542 |
T1355 |
T1353 |
pobj |
cell,of |
| R5420 |
T8662 |
T8660 |
nsubj |
buds,formed |
| R5421 |
T8663 |
T8662 |
compound |
hair,buds |
| R5422 |
T8683 |
T8665 |
punct |
.,reduced |
| R5423 |
T8685 |
T8686 |
advmod |
Thus,appear |
| R5424 |
T8687 |
T8686 |
punct |
", ",appear |
| R5425 |
T8770 |
T8772 |
compound |
β2,signaling |
| R5426 |
T8688 |
T8689 |
mark |
although,impacts |
| R5427 |
T8689 |
T8686 |
advcl |
impacts,appear |
| R5428 |
T8771 |
T8770 |
punct |
-,β2 |
| R5429 |
T8772 |
T8766 |
nsubj |
signaling,appeared |
| R543 |
T1356 |
T1325 |
punct |
.,orchestrated |
| R5430 |
T8690 |
T8691 |
det |
the,pathway |
| R5431 |
T8773 |
T8774 |
aux |
to,be |
| R5432 |
T8774 |
T8766 |
xcomp |
be,appeared |
| R5433 |
T8775 |
T8776 |
det |
an,factor |
| R5434 |
T8691 |
T8689 |
nsubj |
pathway,impacts |
| R5435 |
T8776 |
T8774 |
attr |
factor,be |
| R5436 |
T8777 |
T8776 |
amod |
important,factor |
| R5437 |
T8692 |
T8691 |
acl |
mediated,pathway |
| R5438 |
T8778 |
T8776 |
prep |
for,factor |
| R5439 |
T8779 |
T8780 |
det |
the,proliferation |
| R544 |
T1358 |
T1359 |
prep |
Among,offer |
| R5440 |
T8693 |
T8692 |
prep |
by,mediated |
| R5441 |
T8780 |
T8778 |
pobj |
proliferation,for |
| R5442 |
T8781 |
T8780 |
amod |
early,proliferation |
| R5443 |
T8782 |
T8783 |
dep |
that,occurs |
| R5444 |
T8694 |
T8695 |
compound |
TGF,β2 |
| R5445 |
T8783 |
T8780 |
relcl |
occurs,proliferation |
| R5446 |
T8784 |
T8783 |
prep |
in,occurs |
| R5447 |
T8695 |
T8697 |
compound |
β2,signaling |
| R5448 |
T8785 |
T8786 |
det |
the,buds |
| R5449 |
T8786 |
T8784 |
pobj |
buds,in |
| R545 |
T1360 |
T1361 |
det |
the,organs |
| R5450 |
T8787 |
T8786 |
amod |
developing,buds |
| R5451 |
T8696 |
T8695 |
punct |
-,β2 |
| R5452 |
T8788 |
T8786 |
compound |
hair,buds |
| R5453 |
T8789 |
T8774 |
punct |
", ",be |
| R5454 |
T8790 |
T8791 |
mark |
as,judged |
| R5455 |
T8791 |
T8774 |
advcl |
judged,be |
| R5456 |
T8792 |
T8791 |
prep |
by,judged |
| R5457 |
T8793 |
T8794 |
amod |
anti-Ki67,immunofluorescence |
| R5458 |
T8697 |
T8693 |
pobj |
signaling,by |
| R5459 |
T8794 |
T8792 |
pobj |
immunofluorescence,by |
| R546 |
T1361 |
T1358 |
pobj |
organs,Among |
| R5460 |
T8795 |
T8793 |
cc |
and,anti-Ki67 |
| R5461 |
T8698 |
T8699 |
det |
the,step |
| R5462 |
T8796 |
T8793 |
conj |
anti-pMAPK,anti-Ki67 |
| R5463 |
T8797 |
T8798 |
punct |
(,6F |
| R5464 |
T8798 |
T8774 |
parataxis |
6F,be |
| R5465 |
T8699 |
T8689 |
dobj |
step,impacts |
| R5466 |
T8799 |
T8798 |
compound |
Figure,6F |
| R5467 |
T8800 |
T8798 |
cc |
and,6F |
| R5468 |
T8801 |
T8798 |
conj |
6G,6F |
| R5469 |
T8700 |
T8699 |
amod |
earliest,step |
| R547 |
T1362 |
T1361 |
amod |
few,organs |
| R5470 |
T8802 |
T8798 |
punct |
),6F |
| R5471 |
T8803 |
T8766 |
punct |
.,appeared |
| R5472 |
T8701 |
T8699 |
prep |
of,step |
| R5473 |
T8805 |
T8806 |
mark |
If,stimulates |
| R5474 |
T8806 |
T8810 |
advcl |
stimulates,expected |
| R5475 |
T8702 |
T8703 |
amod |
epithelial,invagination |
| R5476 |
T8807 |
T8808 |
compound |
TGF,β2 |
| R5477 |
T8808 |
T8806 |
nsubj |
β2,stimulates |
| R5478 |
T8809 |
T8808 |
punct |
-,β2 |
| R5479 |
T8703 |
T8701 |
pobj |
invagination,of |
| R548 |
T1363 |
T1361 |
amod |
dispensable,organs |
| R5480 |
T8811 |
T8812 |
compound |
Snail,expression |
| R5481 |
T8812 |
T8806 |
dobj |
expression,stimulates |
| R5482 |
T8704 |
T8686 |
punct |
", ",appear |
| R5483 |
T8813 |
T8806 |
prep |
in,stimulates |
| R5484 |
T8814 |
T8815 |
amod |
developing,buds |
| R5485 |
T8815 |
T8813 |
pobj |
buds,in |
| R5486 |
T8705 |
T8686 |
nsubj |
it,appear |
| R5487 |
T8816 |
T8810 |
punct |
", ",expected |
| R5488 |
T8817 |
T8810 |
nsubjpass |
loss,expected |
| R5489 |
T8818 |
T8817 |
prep |
of,loss |
| R549 |
T1364 |
T1359 |
punct |
", ",offer |
| R5490 |
T8706 |
T8686 |
aux |
does,appear |
| R5491 |
T8819 |
T8820 |
det |
this,morphogen |
| R5492 |
T8820 |
T8818 |
pobj |
morphogen,of |
| R5493 |
T8707 |
T8686 |
neg |
not,appear |
| R5494 |
T8821 |
T8810 |
aux |
would,expected |
| R5495 |
T8822 |
T8810 |
auxpass |
be,expected |
| R5496 |
T8823 |
T8824 |
aux |
to,affect |
| R5497 |
T8708 |
T8709 |
aux |
to,be |
| R5498 |
T8824 |
T8810 |
xcomp |
affect,expected |
| R5499 |
T8825 |
T8826 |
det |
the,expression |
| R55 |
T207 |
T208 |
det |
the,contributions |
| R550 |
T1365 |
T1366 |
compound |
hair,follicles |
| R5500 |
T8826 |
T8824 |
dobj |
expression,affect |
| R5501 |
T8709 |
T8686 |
xcomp |
be,appear |
| R5502 |
T8827 |
T8826 |
prep |
of,expression |
| R5503 |
T8828 |
T8827 |
pobj |
genes,of |
| R5504 |
T8829 |
T8830 |
dep |
that,repressed |
| R5505 |
T8830 |
T8828 |
relcl |
repressed,genes |
| R5506 |
T8831 |
T8830 |
auxpass |
are,repressed |
| R5507 |
T8832 |
T8830 |
advmod |
typically,repressed |
| R5508 |
T8710 |
T8709 |
acomp |
essential,be |
| R5509 |
T8833 |
T8830 |
agent |
by,repressed |
| R551 |
T1366 |
T1359 |
nsubj |
follicles,offer |
| R5510 |
T8834 |
T8833 |
pobj |
Snail,by |
| R5511 |
T8835 |
T8810 |
punct |
.,expected |
| R5512 |
T8711 |
T8710 |
prep |
for,essential |
| R5513 |
T8712 |
T8713 |
compound |
bud,morphogenesis |
| R5514 |
T8837 |
T8838 |
mark |
Since,is |
| R5515 |
T8713 |
T8711 |
pobj |
morphogenesis,for |
| R5516 |
T8838 |
T8847 |
advcl |
is,investigated |
| R5517 |
T8839 |
T8840 |
det |
a,target |
| R5518 |
T8714 |
T8686 |
punct |
.,appear |
| R5519 |
T8840 |
T8838 |
nsubj |
target,is |
| R552 |
T1367 |
T1368 |
det |
an,system |
| R5520 |
T8841 |
T8840 |
amod |
major,target |
| R5521 |
T8842 |
T8840 |
prep |
for,target |
| R5522 |
T8843 |
T8844 |
npadvmod |
Snail,mediated |
| R5523 |
T8716 |
T8717 |
advcl |
Consistent,took |
| R5524 |
T8844 |
T8846 |
amod |
mediated,repression |
| R5525 |
T8845 |
T8844 |
punct |
-,mediated |
| R5526 |
T8846 |
T8842 |
pobj |
repression,for |
| R5527 |
T8718 |
T8716 |
prep |
with,Consistent |
| R5528 |
T8848 |
T8849 |
det |
the,gene |
| R5529 |
T8849 |
T8838 |
attr |
gene,is |
| R553 |
T1368 |
T1359 |
dobj |
system,offer |
| R5530 |
T8850 |
T8851 |
compound |
E,cadherin |
| R5531 |
T8719 |
T8720 |
det |
this,notion |
| R5532 |
T8720 |
T8718 |
pobj |
notion,with |
| R5533 |
T8721 |
T8717 |
punct |
", ",took |
| R5534 |
T8851 |
T8849 |
compound |
cadherin,gene |
| R5535 |
T8722 |
T8723 |
compound |
basement,membrane |
| R5536 |
T8723 |
T8724 |
compound |
membrane,remodeling |
| R5537 |
T8852 |
T8851 |
punct |
-,cadherin |
| R5538 |
T8853 |
T8854 |
punct |
[,13 |
| R5539 |
T8854 |
T8838 |
parataxis |
13,is |
| R554 |
T1369 |
T1368 |
amod |
excellent,system |
| R5540 |
T8724 |
T8717 |
nsubj |
remodeling,took |
| R5541 |
T8855 |
T8854 |
nummod |
12,13 |
| R5542 |
T8856 |
T8854 |
punct |
",",13 |
| R5543 |
T8725 |
T8717 |
advmod |
still,took |
| R5544 |
T8857 |
T8854 |
punct |
],13 |
| R5545 |
T8858 |
T8847 |
punct |
", ",investigated |
| R5546 |
T8859 |
T8847 |
nsubj |
we,investigated |
| R5547 |
T8726 |
T8717 |
dobj |
place,took |
| R5548 |
T8860 |
T8861 |
det |
the,status |
| R5549 |
T8861 |
T8847 |
dobj |
status,investigated |
| R555 |
T1370 |
T1368 |
compound |
model,system |
| R5550 |
T8727 |
T8717 |
prep |
in,took |
| R5551 |
T8862 |
T8861 |
prep |
of,status |
| R5552 |
T8863 |
T8864 |
compound |
E,cadherin |
| R5553 |
T8864 |
T8862 |
pobj |
cadherin,of |
| R5554 |
T8728 |
T8729 |
det |
the,buds |
| R5555 |
T8865 |
T8864 |
punct |
-,cadherin |
| R5556 |
T8866 |
T8847 |
prep |
in,investigated |
| R5557 |
T8867 |
T8868 |
compound |
TGF,β2 |
| R5558 |
T8868 |
T8870 |
npadvmod |
β2,null |
| R5559 |
T8869 |
T8868 |
punct |
-,β2 |
| R556 |
T1371 |
T1372 |
aux |
to,study |
| R5560 |
T8870 |
T8872 |
amod |
null,buds |
| R5561 |
T8729 |
T8727 |
pobj |
buds,in |
| R5562 |
T8871 |
T8870 |
punct |
-,null |
| R5563 |
T8872 |
T8866 |
pobj |
buds,in |
| R5564 |
T8873 |
T8847 |
punct |
.,investigated |
| R5565 |
T8730 |
T8731 |
compound |
TGF,β2 |
| R5566 |
T8875 |
T8876 |
mark |
As,shown |
| R5567 |
T8731 |
T8733 |
npadvmod |
β2,null |
| R5568 |
T8732 |
T8731 |
punct |
-,β2 |
| R5569 |
T8733 |
T8729 |
amod |
null,buds |
| R557 |
T1372 |
T1368 |
advcl |
study,system |
| R5570 |
T8734 |
T8733 |
punct |
-,null |
| R5571 |
T8876 |
T8877 |
advcl |
shown,displayed |
| R5572 |
T8735 |
T8717 |
punct |
", ",took |
| R5573 |
T8878 |
T8876 |
prep |
in,shown |
| R5574 |
T8736 |
T8737 |
mark |
as,judged |
| R5575 |
T8879 |
T8880 |
compound |
Figure,6H |
| R5576 |
T8880 |
T8878 |
pobj |
6H,in |
| R5577 |
T8881 |
T8877 |
punct |
", ",displayed |
| R5578 |
T8737 |
T8717 |
advcl |
judged,took |
| R5579 |
T8882 |
T8883 |
compound |
hair,buds |
| R558 |
T1373 |
T1374 |
amod |
epithelial,bud |
| R5580 |
T8883 |
T8877 |
nsubj |
buds,displayed |
| R5581 |
T8884 |
T8883 |
prep |
in,buds |
| R5582 |
T8738 |
T8737 |
prep |
by,judged |
| R5583 |
T8885 |
T8886 |
compound |
TGF,β2 |
| R5584 |
T8886 |
T8888 |
npadvmod |
β2,null |
| R5585 |
T8887 |
T8886 |
punct |
-,β2 |
| R5586 |
T8739 |
T8738 |
pobj |
immunofluorescence,by |
| R5587 |
T8888 |
T8889 |
amod |
null,skin |
| R5588 |
T8889 |
T8884 |
pobj |
skin,in |
| R5589 |
T8740 |
T8739 |
prep |
with,immunofluorescence |
| R559 |
T1374 |
T1375 |
compound |
bud,formation |
| R5590 |
T8890 |
T8891 |
amod |
elevated,staining |
| R5591 |
T8891 |
T8877 |
dobj |
staining,displayed |
| R5592 |
T8892 |
T8891 |
compound |
immunofluorescence,staining |
| R5593 |
T8741 |
T8740 |
pobj |
antibodies,with |
| R5594 |
T8893 |
T8877 |
advcl |
relative,displayed |
| R5595 |
T8894 |
T8893 |
prep |
to,relative |
| R5596 |
T8895 |
T8896 |
poss |
their,counterparts |
| R5597 |
T8742 |
T8741 |
prep |
against,antibodies |
| R5598 |
T8896 |
T8894 |
pobj |
counterparts,to |
| R5599 |
T8897 |
T8896 |
compound |
WT,counterparts |
| R56 |
T208 |
T206 |
dobj |
contributions,dissect |
| R560 |
T1375 |
T1372 |
dobj |
formation,study |
| R5600 |
T8898 |
T8877 |
punct |
.,displayed |
| R5601 |
T8743 |
T8744 |
compound |
β4,integrin |
| R5602 |
T8900 |
T8901 |
advmod |
Previously,demonstrated |
| R5603 |
T8744 |
T8742 |
pobj |
integrin,against |
| R5604 |
T8902 |
T8901 |
nsubj |
we,demonstrated |
| R5605 |
T8903 |
T8904 |
mark |
that,required |
| R5606 |
T8745 |
T8744 |
punct |
", ",integrin |
| R5607 |
T8904 |
T8901 |
ccomp |
required,demonstrated |
| R5608 |
T8905 |
T8906 |
det |
the,action |
| R5609 |
T8906 |
T8904 |
nsubjpass |
action,required |
| R561 |
T1376 |
T1359 |
punct |
.,offer |
| R5610 |
T8907 |
T8906 |
amod |
concerted,action |
| R5611 |
T8908 |
T8906 |
prep |
of,action |
| R5612 |
T8746 |
T8747 |
det |
an,component |
| R5613 |
T8909 |
T8910 |
det |
the,signals |
| R5614 |
T8910 |
T8908 |
pobj |
signals,of |
| R5615 |
T8911 |
T8910 |
amod |
extracellular,signals |
| R5616 |
T8747 |
T8744 |
appos |
component,integrin |
| R5617 |
T8912 |
T8910 |
appos |
Wnt,signals |
| R5618 |
T8913 |
T8912 |
cc |
and,Wnt |
| R5619 |
T8914 |
T8912 |
conj |
noggin,Wnt |
| R562 |
T1378 |
T1379 |
amod |
Mammalian,epithelium |
| R5620 |
T8748 |
T8747 |
amod |
integral,component |
| R5621 |
T8915 |
T8904 |
auxpass |
are,required |
| R5622 |
T8916 |
T8917 |
mark |
for,repress |
| R5623 |
T8749 |
T8747 |
prep |
of,component |
| R5624 |
T8750 |
T8751 |
npadvmod |
keratinocyte,mediated |
| R5625 |
T8917 |
T8904 |
advcl |
repress,required |
| R5626 |
T8918 |
T8919 |
det |
the,generation |
| R5627 |
T8751 |
T8753 |
amod |
mediated,adhesion |
| R5628 |
T8919 |
T8917 |
nsubj |
generation,repress |
| R5629 |
T8920 |
T8919 |
prep |
of,generation |
| R563 |
T1379 |
T1381 |
nsubj |
epithelium,begins |
| R5630 |
T8921 |
T8922 |
det |
a,complex |
| R5631 |
T8752 |
T8751 |
punct |
-,mediated |
| R5632 |
T8922 |
T8920 |
pobj |
complex,of |
| R5633 |
T8923 |
T8922 |
nmod |
LEF,complex |
| R5634 |
T8924 |
T8923 |
punct |
-,LEF |
| R5635 |
T8753 |
T8749 |
pobj |
adhesion,of |
| R5636 |
T8925 |
T8923 |
nummod |
1,LEF |
| R5637 |
T8926 |
T8923 |
punct |
/,LEF |
| R5638 |
T8927 |
T8928 |
compound |
β,catenin |
| R5639 |
T8754 |
T8753 |
prep |
to,adhesion |
| R564 |
T1380 |
T1379 |
compound |
skin,epithelium |
| R5640 |
T8928 |
T8923 |
appos |
catenin,LEF |
| R5641 |
T8929 |
T8928 |
punct |
-,catenin |
| R5642 |
T8755 |
T8756 |
poss |
its,membrane |
| R5643 |
T8930 |
T8922 |
compound |
transcription,complex |
| R5644 |
T8931 |
T8917 |
aux |
to,repress |
| R5645 |
T8932 |
T8933 |
compound |
E,cadherin |
| R5646 |
T8756 |
T8754 |
pobj |
membrane,to |
| R5647 |
T8933 |
T8935 |
compound |
cadherin,transcription |
| R5648 |
T8934 |
T8933 |
punct |
-,cadherin |
| R5649 |
T8757 |
T8756 |
amod |
underlying,membrane |
| R565 |
T1382 |
T1381 |
prep |
as,begins |
| R5650 |
T8935 |
T8917 |
dobj |
transcription,repress |
| R5651 |
T8936 |
T8917 |
prep |
at,repress |
| R5652 |
T8937 |
T8938 |
det |
the,onset |
| R5653 |
T8758 |
T8756 |
compound |
basement,membrane |
| R5654 |
T8938 |
T8936 |
pobj |
onset,at |
| R5655 |
T8939 |
T8938 |
prep |
of,onset |
| R5656 |
T8759 |
T8760 |
punct |
(,6F |
| R5657 |
T8940 |
T8941 |
compound |
hair,fate |
| R5658 |
T8941 |
T8942 |
compound |
fate,specification |
| R5659 |
T8942 |
T8939 |
pobj |
specification,of |
| R566 |
T1383 |
T1384 |
det |
a,sheet |
| R5660 |
T8943 |
T8901 |
punct |
.,demonstrated |
| R5661 |
T8760 |
T8717 |
parataxis |
6F,took |
| R5662 |
T8945 |
T8946 |
mark |
As,shown |
| R5663 |
T8946 |
T8947 |
advcl |
shown,exhibited |
| R5664 |
T8948 |
T8946 |
prep |
in,shown |
| R5665 |
T8761 |
T8760 |
compound |
Figure,6F |
| R5666 |
T8949 |
T8950 |
compound |
Figure,6I |
| R5667 |
T8950 |
T8948 |
pobj |
6I,in |
| R5668 |
T8762 |
T8760 |
punct |
),6F |
| R5669 |
T8951 |
T8950 |
cc |
and,6I |
| R567 |
T1384 |
T1382 |
pobj |
sheet,as |
| R5670 |
T8952 |
T8950 |
conj |
6J,6I |
| R5671 |
T8953 |
T8947 |
punct |
", ",exhibited |
| R5672 |
T8763 |
T8717 |
punct |
.,took |
| R5673 |
T8954 |
T8955 |
preconj |
both,WT |
| R5674 |
T8955 |
T8956 |
npadvmod |
WT,null |
| R5675 |
T8765 |
T8766 |
prep |
In,appeared |
| R5676 |
T8956 |
T8961 |
amod |
null,buds |
| R5677 |
T8957 |
T8955 |
cc |
and,WT |
| R5678 |
T8958 |
T8959 |
compound |
TGF,β2 |
| R5679 |
T8959 |
T8955 |
conj |
β2,WT |
| R568 |
T1385 |
T1384 |
amod |
single,sheet |
| R5680 |
T8960 |
T8959 |
punct |
-,β2 |
| R5681 |
T8767 |
T8765 |
pobj |
contrast,In |
| R5682 |
T8961 |
T8947 |
nsubj |
buds,exhibited |
| R5683 |
T8962 |
T8963 |
amod |
nuclear,localization |
| R5684 |
T8963 |
T8947 |
dobj |
localization,exhibited |
| R5685 |
T8964 |
T8963 |
nmod |
LEF,localization |
| R5686 |
T8768 |
T8766 |
punct |
", ",appeared |
| R5687 |
T8965 |
T8964 |
punct |
-,LEF |
| R5688 |
T8966 |
T8964 |
nummod |
1,LEF |
| R5689 |
T8967 |
T8964 |
cc |
and,LEF |
| R569 |
T1386 |
T1384 |
prep |
of,sheet |
| R5690 |
T8769 |
T8770 |
compound |
TGF,β2 |
| R5691 |
T8968 |
T8969 |
compound |
β,catenin |
| R5692 |
T8969 |
T8964 |
conj |
catenin,LEF |
| R5693 |
T8970 |
T8969 |
punct |
-,catenin |
| R5694 |
T8982 |
T8947 |
punct |
.,exhibited |
| R5695 |
T8971 |
T8947 |
punct |
", ",exhibited |
| R5696 |
T8972 |
T8947 |
npadvmod |
signs,exhibited |
| R5697 |
T8973 |
T8974 |
mark |
that,was |
| R5698 |
T8974 |
T8972 |
acl |
was,signs |
| R5699 |
T8975 |
T8976 |
det |
the,pathway |
| R57 |
T209 |
T208 |
prep |
of,contributions |
| R570 |
T1387 |
T1388 |
amod |
multipotent,cells |
| R5700 |
T8976 |
T8974 |
nsubj |
pathway,was |
| R5701 |
T8977 |
T8978 |
compound |
Wnt,noggin |
| R5702 |
T8984 |
T8985 |
det |
These,data |
| R5703 |
T8978 |
T8976 |
compound |
noggin,pathway |
| R5704 |
T8979 |
T8978 |
punct |
-,noggin |
| R5705 |
T8980 |
T8976 |
compound |
signaling,pathway |
| R5706 |
T8981 |
T8974 |
acomp |
intact,was |
| R5707 |
T8985 |
T8986 |
nsubj |
data,suggest |
| R5708 |
T8987 |
T8988 |
mark |
that,functions |
| R5709 |
T8988 |
T8986 |
ccomp |
functions,suggest |
| R571 |
T1388 |
T1386 |
pobj |
cells,of |
| R5710 |
T8989 |
T8988 |
prep |
during,functions |
| R5711 |
T8990 |
T8991 |
compound |
hair,follicle |
| R5712 |
T8991 |
T8992 |
compound |
follicle,morphogenesis |
| R5713 |
T8992 |
T8989 |
pobj |
morphogenesis,during |
| R5714 |
T8993 |
T8988 |
punct |
", ",functions |
| R5715 |
T8994 |
T8995 |
compound |
TGF,β2 |
| R5716 |
T8995 |
T8988 |
nsubj |
β2,functions |
| R5717 |
T8996 |
T8995 |
punct |
-,β2 |
| R5718 |
T8997 |
T8988 |
advmod |
subsequently,functions |
| R5719 |
T8998 |
T8997 |
prep |
to,subsequently |
| R572 |
T1389 |
T1388 |
amod |
ectodermal,cells |
| R5720 |
T8999 |
T9000 |
compound |
Wnt,noggin |
| R5721 |
T9000 |
T9002 |
npadvmod |
noggin,mediated |
| R5722 |
T9001 |
T9000 |
punct |
/,noggin |
| R5723 |
T9002 |
T9004 |
amod |
mediated,determination |
| R5724 |
T9003 |
T9002 |
punct |
-,mediated |
| R5725 |
T9004 |
T8998 |
pobj |
determination,to |
| R5726 |
T9005 |
T9004 |
prep |
of,determination |
| R5727 |
T9006 |
T9007 |
compound |
hair,fate |
| R5728 |
T9007 |
T9005 |
pobj |
fate,of |
| R5729 |
T9008 |
T8986 |
punct |
.,suggest |
| R573 |
T1390 |
T1381 |
punct |
.,begins |
| R5730 |
T9010 |
T9011 |
advmod |
Moreover,appears |
| R5731 |
T9012 |
T9011 |
punct |
", ",appears |
| R5732 |
T9013 |
T9011 |
prep |
through,appears |
| R5733 |
T9014 |
T9013 |
pobj |
activation,through |
| R5734 |
T9015 |
T9014 |
prep |
of,activation |
| R5735 |
T9016 |
T9017 |
compound |
Snail,expression |
| R5736 |
T9017 |
T9015 |
pobj |
expression,of |
| R5737 |
T9018 |
T9017 |
compound |
gene,expression |
| R5738 |
T9019 |
T9011 |
punct |
", ",appears |
| R5739 |
T9020 |
T9021 |
compound |
TGF,β2 |
| R574 |
T1392 |
T1393 |
prep |
During,populate |
| R5740 |
T9021 |
T9011 |
nsubj |
β2,appears |
| R5741 |
T9022 |
T9021 |
punct |
-,β2 |
| R5742 |
T9023 |
T9024 |
aux |
to,work |
| R5743 |
T9024 |
T9011 |
xcomp |
work,appears |
| R5744 |
T9025 |
T9024 |
prep |
in,work |
| R5745 |
T9026 |
T9025 |
pobj |
tandem,in |
| R5746 |
T9027 |
T9026 |
prep |
with,tandem |
| R5747 |
T9028 |
T9029 |
det |
these,morphogens |
| R5748 |
T9029 |
T9027 |
pobj |
morphogens,with |
| R5749 |
T9030 |
T9029 |
amod |
other,morphogens |
| R575 |
T1394 |
T1392 |
pobj |
development,During |
| R5750 |
T9031 |
T9032 |
aux |
to,regulate |
| R5751 |
T9032 |
T9024 |
advcl |
regulate,work |
| R5752 |
T9033 |
T9032 |
advmod |
down,regulate |
| R5753 |
T9034 |
T9032 |
punct |
-,regulate |
| R5754 |
T9035 |
T9036 |
compound |
E,cadherin |
| R5755 |
T9036 |
T9038 |
compound |
cadherin,levels |
| R5756 |
T9037 |
T9036 |
punct |
-,cadherin |
| R5757 |
T9038 |
T9032 |
dobj |
levels,regulate |
| R5758 |
T9039 |
T9024 |
punct |
", ",work |
| R5759 |
T9040 |
T9041 |
dep |
which,contributes |
| R576 |
T1395 |
T1393 |
punct |
", ",populate |
| R5760 |
T9041 |
T9024 |
advcl |
contributes,work |
| R5761 |
T9042 |
T9041 |
prep |
to,contributes |
| R5762 |
T9043 |
T9044 |
det |
the,activation |
| R5763 |
T9044 |
T9042 |
pobj |
activation,to |
| R5764 |
T9045 |
T9044 |
prep |
of,activation |
| R5765 |
T9046 |
T9047 |
amod |
proliferative,circuitries |
| R5766 |
T9047 |
T9045 |
pobj |
circuitries,of |
| R5767 |
T9048 |
T9011 |
punct |
.,appears |
| R577 |
T1396 |
T1397 |
amod |
specialized,cells |
| R5772 |
T9102 |
T9103 |
prep |
During,govern |
| R5773 |
T9104 |
T9105 |
compound |
budding,morphogenesis |
| R5774 |
T9105 |
T9102 |
pobj |
morphogenesis,During |
| R5775 |
T9106 |
T9103 |
punct |
", ",govern |
| R5776 |
T9107 |
T9108 |
amod |
intersecting,networks |
| R5777 |
T9108 |
T9103 |
nsubj |
networks,govern |
| R5778 |
T9109 |
T9108 |
compound |
signaling,networks |
| R5779 |
T9110 |
T9108 |
prep |
from,networks |
| R578 |
T1397 |
T1393 |
nsubj |
cells,populate |
| R5780 |
T9111 |
T9112 |
det |
the,epithelium |
| R5781 |
T9112 |
T9110 |
pobj |
epithelium,from |
| R5782 |
T9113 |
T9112 |
cc |
and,epithelium |
| R5783 |
T9114 |
T9112 |
conj |
mesenchyme,epithelium |
| R5784 |
T9115 |
T9116 |
amod |
transcriptional,programs |
| R5785 |
T9116 |
T9103 |
dobj |
programs,govern |
| R5786 |
T9117 |
T9115 |
punct |
", ",transcriptional |
| R5787 |
T9118 |
T9115 |
conj |
adhesive,transcriptional |
| R5788 |
T9119 |
T9118 |
punct |
", ",adhesive |
| R5789 |
T9120 |
T9118 |
conj |
polarity,adhesive |
| R579 |
T1398 |
T1397 |
amod |
mesenchymal,cells |
| R5790 |
T9121 |
T9120 |
punct |
", ",polarity |
| R5791 |
T9122 |
T9120 |
cc |
and,polarity |
| R5792 |
T9123 |
T9120 |
conj |
motility,polarity |
| R5793 |
T9124 |
T9103 |
prep |
in,govern |
| R5794 |
T9125 |
T9126 |
det |
these,groups |
| R5795 |
T9126 |
T9124 |
pobj |
groups,in |
| R5796 |
T9127 |
T9126 |
amod |
select,groups |
| R5797 |
T9128 |
T9126 |
prep |
of,groups |
| R5798 |
T9129 |
T9128 |
pobj |
cells,of |
| R5799 |
T9130 |
T9103 |
punct |
.,govern |
| R58 |
T210 |
T211 |
amod |
multiple,cues |
| R580 |
T1399 |
T1400 |
det |
the,skin |
| R5800 |
T9132 |
T9133 |
det |
The,changes |
| R5801 |
T9133 |
T9138 |
nsubj |
changes,form |
| R5802 |
T9134 |
T9133 |
amod |
dynamic,changes |
| R5803 |
T9135 |
T9133 |
amod |
nuclear,changes |
| R5804 |
T9136 |
T9135 |
cc |
and,nuclear |
| R5805 |
T9137 |
T9135 |
conj |
cytosolic,nuclear |
| R5806 |
T9139 |
T9140 |
dep |
that,take |
| R5807 |
T9140 |
T9133 |
relcl |
take,changes |
| R5808 |
T9141 |
T9140 |
dobj |
place,take |
| R5809 |
T9142 |
T9140 |
prep |
during,take |
| R581 |
T1400 |
T1393 |
dobj |
skin,populate |
| R5810 |
T9143 |
T9144 |
det |
this,time |
| R5811 |
T9144 |
T9142 |
pobj |
time,during |
| R5812 |
T9145 |
T9146 |
det |
the,cornerstone |
| R5813 |
T9146 |
T9138 |
dobj |
cornerstone,form |
| R5814 |
T9147 |
T9146 |
prep |
for,cornerstone |
| R5815 |
T9148 |
T9149 |
compound |
organ,morphogenesis |
| R5816 |
T9149 |
T9147 |
pobj |
morphogenesis,for |
| R5817 |
T9150 |
T9138 |
punct |
.,form |
| R5818 |
T9152 |
T9153 |
nummod |
Two,challenges |
| R5819 |
T9153 |
T9155 |
nsubj |
challenges,are |
| R582 |
T1401 |
T1393 |
prep |
in,populate |
| R5820 |
T9154 |
T9153 |
amod |
major,challenges |
| R5821 |
T9156 |
T9153 |
prep |
in,challenges |
| R5822 |
T9157 |
T9156 |
pcomp |
understanding,in |
| R5823 |
T9158 |
T9159 |
det |
the,mechanisms |
| R5824 |
T9159 |
T9157 |
dobj |
mechanisms,understanding |
| R5825 |
T9160 |
T9159 |
acl |
underlying,mechanisms |
| R5826 |
T9161 |
T9162 |
det |
a,process |
| R5827 |
T9162 |
T9160 |
dobj |
process,underlying |
| R5828 |
T9163 |
T9162 |
amod |
particular,process |
| R5829 |
T9164 |
T9162 |
compound |
budding,process |
| R583 |
T1402 |
T1403 |
det |
a,pattern |
| R5830 |
T9165 |
T9166 |
aux |
to,order |
| R5831 |
T9166 |
T9155 |
xcomp |
order,are |
| R5832 |
T9167 |
T9168 |
det |
the,sequence |
| R5833 |
T9168 |
T9166 |
dobj |
sequence,order |
| R5834 |
T9169 |
T9168 |
amod |
temporal,sequence |
| R5835 |
T9170 |
T9168 |
prep |
of,sequence |
| R5836 |
T9171 |
T9172 |
amod |
external,cues |
| R5837 |
T9172 |
T9170 |
pobj |
cues,of |
| R5838 |
T9173 |
T9172 |
acl |
involved,cues |
| R5839 |
T9174 |
T9166 |
cc |
and,order |
| R584 |
T1403 |
T1401 |
pobj |
pattern,in |
| R5840 |
T9175 |
T9176 |
advmod |
then,dissect |
| R5841 |
T9176 |
T9166 |
conj |
dissect,order |
| R5842 |
T9177 |
T9176 |
aux |
to,dissect |
| R5843 |
T9178 |
T9179 |
advmod |
how,translate |
| R5844 |
T9179 |
T9176 |
ccomp |
translate,dissect |
| R5845 |
T9180 |
T9181 |
det |
the,cells |
| R5846 |
T9181 |
T9179 |
nsubj |
cells,translate |
| R5847 |
T9182 |
T9181 |
prep |
of,cells |
| R5848 |
T9183 |
T9184 |
det |
the,bud |
| R5849 |
T9184 |
T9182 |
pobj |
bud,of |
| R585 |
T1404 |
T1405 |
advmod |
spatially,defined |
| R5850 |
T9185 |
T9184 |
amod |
developing,bud |
| R5851 |
T9186 |
T9187 |
det |
these,signals |
| R5852 |
T9187 |
T9179 |
dobj |
signals,translate |
| R5853 |
T9188 |
T9179 |
prep |
into,translate |
| R5854 |
T9189 |
T9190 |
det |
the,events |
| R5855 |
T9190 |
T9188 |
pobj |
events,into |
| R5856 |
T9191 |
T9190 |
amod |
downstream,events |
| R5857 |
T9192 |
T9190 |
prep |
of,events |
| R5858 |
T9193 |
T9194 |
amod |
cellular,remodeling |
| R5859 |
T9194 |
T9192 |
pobj |
remodeling,of |
| R586 |
T1405 |
T1403 |
amod |
defined,pattern |
| R5860 |
T9195 |
T9194 |
punct |
", ",remodeling |
| R5861 |
T9196 |
T9194 |
conj |
proliferation,remodeling |
| R5862 |
T9197 |
T9196 |
punct |
", ",proliferation |
| R5863 |
T9198 |
T9196 |
cc |
and,proliferation |
| R5864 |
T9199 |
T9196 |
conj |
differentiation,proliferation |
| R5865 |
T9200 |
T9155 |
punct |
.,are |
| R5866 |
T9202 |
T9203 |
poss |
Our,studies |
| R5867 |
T9203 |
T9204 |
nsubj |
studies,provide |
| R5868 |
T9205 |
T9203 |
advmod |
here,studies |
| R5869 |
T9206 |
T9207 |
det |
some,insights |
| R587 |
T1406 |
T1407 |
aux |
to,initiate |
| R5870 |
T9207 |
T9204 |
dobj |
insights,provide |
| R5871 |
T9208 |
T9207 |
prep |
into,insights |
| R5872 |
T9209 |
T9210 |
advmod |
how,orchestrated |
| R5873 |
T9210 |
T9208 |
pcomp |
orchestrated,into |
| R5874 |
T9211 |
T9212 |
det |
these,events |
| R5875 |
T9212 |
T9210 |
nsubjpass |
events,orchestrated |
| R5876 |
T9213 |
T9210 |
auxpass |
are,orchestrated |
| R5877 |
T9214 |
T9210 |
prep |
during,orchestrated |
| R5878 |
T9215 |
T9216 |
compound |
hair,bud |
| R5879 |
T9216 |
T9217 |
compound |
bud,formation |
| R588 |
T1407 |
T1393 |
advcl |
initiate,populate |
| R5880 |
T9217 |
T9214 |
pobj |
formation,during |
| R5881 |
T9218 |
T9210 |
prep |
in,orchestrated |
| R5882 |
T9219 |
T9220 |
amod |
developing,skin |
| R5883 |
T9220 |
T9218 |
pobj |
skin,in |
| R5884 |
T9221 |
T9204 |
punct |
.,provide |
| R589 |
T1408 |
T1409 |
det |
the,crosstalk |
| R5895 |
T9654 |
T9653 |
prep |
during,Signaling |
| R5896 |
T9655 |
T9656 |
amod |
Early,Morphogenesis |
| R5897 |
T9656 |
T9654 |
pobj |
Morphogenesis,during |
| R5898 |
T9657 |
T9658 |
compound |
Hair,Follicle |
| R5899 |
T9658 |
T9656 |
compound |
Follicle,Morphogenesis |
| R59 |
T211 |
T209 |
pobj |
cues,of |
| R590 |
T1409 |
T1407 |
dobj |
crosstalk,initiate |
| R5900 |
T9660 |
T9661 |
amod |
Recent,studies |
| R5901 |
T9661 |
T9662 |
nsubj |
studies,suggest |
| R5902 |
T9663 |
T9661 |
prep |
on,studies |
| R5903 |
T9664 |
T9665 |
compound |
hair,bud |
| R5904 |
T9665 |
T9666 |
compound |
bud,morphogenesis |
| R5905 |
T9666 |
T9663 |
pobj |
morphogenesis,on |
| R5906 |
T9667 |
T9668 |
mark |
that,converge |
| R5907 |
T9668 |
T9662 |
ccomp |
converge,suggest |
| R5908 |
T9669 |
T9670 |
compound |
Wnt,signals |
| R5909 |
T9670 |
T9668 |
nsubj |
signals,converge |
| R591 |
T1410 |
T1409 |
amod |
complex,crosstalk |
| R5910 |
T9671 |
T9672 |
advmod |
likely,from |
| R5911 |
T9672 |
T9670 |
prep |
from,signals |
| R5912 |
T9673 |
T9674 |
det |
the,epithelium |
| R5913 |
T9674 |
T9672 |
pobj |
epithelium,from |
| R5914 |
T9675 |
T9670 |
cc |
and,signals |
| R5915 |
T9676 |
T9677 |
nmod |
BMP,signals |
| R5916 |
T9677 |
T9670 |
conj |
signals,signals |
| R5917 |
T9678 |
T9677 |
amod |
inhibitory,signals |
| R5918 |
T9679 |
T9677 |
prep |
from,signals |
| R5919 |
T9680 |
T9681 |
det |
the,mesenchyme |
| R592 |
T1411 |
T1412 |
amod |
epithelial,mesenchymal |
| R5920 |
T9681 |
T9679 |
pobj |
mesenchyme,from |
| R5921 |
T9682 |
T9681 |
amod |
underlying,mesenchyme |
| R5922 |
T9683 |
T9684 |
aux |
to,produce |
| R5923 |
T9684 |
T9668 |
advcl |
produce,converge |
| R5924 |
T9685 |
T9686 |
det |
an,complex |
| R5925 |
T9686 |
T9684 |
dobj |
complex,produce |
| R5926 |
T9687 |
T9686 |
amod |
active,complex |
| R5927 |
T9688 |
T9689 |
compound |
transcription,factor |
| R5928 |
T9689 |
T9686 |
compound |
factor,complex |
| R5929 |
T9690 |
T9686 |
acl |
involving,complex |
| R593 |
T1412 |
T1409 |
amod |
mesenchymal,crosstalk |
| R5930 |
T9691 |
T9692 |
compound |
β,catenin |
| R5931 |
T9692 |
T9690 |
dobj |
catenin,involving |
| R5932 |
T9693 |
T9692 |
punct |
-,catenin |
| R5933 |
T9694 |
T9692 |
cc |
and,catenin |
| R5934 |
T9695 |
T9692 |
conj |
LEF,catenin |
| R5935 |
T9696 |
T9695 |
punct |
-,LEF |
| R5936 |
T9697 |
T9695 |
nummod |
1,LEF |
| R5937 |
T9698 |
T9686 |
punct |
", ",complex |
| R5938 |
T9699 |
T9700 |
dep |
which,plays |
| R5939 |
T9700 |
T9686 |
relcl |
plays,complex |
| R594 |
T1413 |
T1412 |
punct |
-,mesenchymal |
| R5940 |
T9701 |
T9700 |
prep |
in,plays |
| R5941 |
T9702 |
T9701 |
pobj |
turn,in |
| R5942 |
T9703 |
T9704 |
det |
a,role |
| R5943 |
T9704 |
T9700 |
dobj |
role,plays |
| R5944 |
T9705 |
T9704 |
amod |
key,role |
| R5945 |
T9706 |
T9700 |
prep |
in,plays |
| R5946 |
T9707 |
T9706 |
pcomp |
specifying,in |
| R5947 |
T9708 |
T9709 |
det |
the,fate |
| R5948 |
T9709 |
T9707 |
dobj |
fate,specifying |
| R5949 |
T9710 |
T9711 |
compound |
hair,follicle |
| R595 |
T1414 |
T1415 |
dep |
that,specify |
| R5950 |
T9711 |
T9709 |
compound |
follicle,fate |
| R5951 |
T9712 |
T9713 |
punct |
[,37 |
| R5952 |
T9713 |
T9684 |
parataxis |
37,produce |
| R5953 |
T9714 |
T9713 |
nummod |
4,37 |
| R5954 |
T9715 |
T9713 |
punct |
",",37 |
| R5955 |
T9716 |
T9713 |
nummod |
29,37 |
| R5956 |
T9717 |
T9713 |
punct |
",",37 |
| R5957 |
T9718 |
T9713 |
nummod |
30,37 |
| R5958 |
T9719 |
T9713 |
punct |
",",37 |
| R5959 |
T9720 |
T9713 |
nummod |
36,37 |
| R596 |
T1415 |
T1409 |
relcl |
specify,crosstalk |
| R5960 |
T9721 |
T9713 |
punct |
",",37 |
| R5961 |
T9722 |
T9713 |
punct |
],37 |
| R5962 |
T9723 |
T9662 |
punct |
.,suggest |
| R5963 |
T9725 |
T9726 |
amod |
Sonic,hedgehog |
| R5964 |
T9726 |
T9727 |
nsubj |
hedgehog,play |
| R5965 |
T9728 |
T9726 |
punct |
(,hedgehog |
| R5966 |
T9729 |
T9726 |
appos |
Shh,hedgehog |
| R5967 |
T9730 |
T9726 |
punct |
),hedgehog |
| R5968 |
T9731 |
T9726 |
cc |
and,hedgehog |
| R5969 |
T9732 |
T9733 |
compound |
TGF,β2 |
| R597 |
T1416 |
T1415 |
aux |
will,specify |
| R5970 |
T9733 |
T9735 |
compound |
β2,signaling |
| R5971 |
T9734 |
T9733 |
punct |
-,β2 |
| R5972 |
T9735 |
T9726 |
conj |
signaling,hedgehog |
| R5973 |
T9736 |
T9727 |
advmod |
also,play |
| R5974 |
T9737 |
T9738 |
amod |
essential,roles |
| R5975 |
T9738 |
T9727 |
dobj |
roles,play |
| R5976 |
T9739 |
T9727 |
prep |
in,play |
| R5977 |
T9740 |
T9741 |
compound |
follicle,morphogenesis |
| R5978 |
T9741 |
T9739 |
pobj |
morphogenesis,in |
| R5979 |
T9742 |
T9727 |
punct |
", ",play |
| R598 |
T1417 |
T1418 |
det |
the,bud |
| R5980 |
T9743 |
T9727 |
cc |
but,play |
| R5981 |
T9744 |
T9745 |
prep |
in,form |
| R5982 |
T9745 |
T9727 |
conj |
form,play |
| R5983 |
T9746 |
T9744 |
pobj |
contrast,in |
| R5984 |
T9747 |
T9746 |
prep |
to,contrast |
| R5985 |
T9748 |
T9749 |
compound |
β,catenin |
| R5986 |
T9749 |
T9751 |
npadvmod |
catenin,null |
| R5987 |
T9750 |
T9749 |
punct |
-,catenin |
| R5988 |
T9751 |
T9752 |
amod |
null,skin |
| R5989 |
T9752 |
T9747 |
pobj |
skin,to |
| R599 |
T1418 |
T1415 |
dobj |
bud,specify |
| R5990 |
T9753 |
T9752 |
punct |
", ",skin |
| R5991 |
T9754 |
T9755 |
prep |
in,are |
| R5992 |
T9755 |
T9752 |
relcl |
are,skin |
| R5993 |
T9756 |
T9754 |
pobj |
which,in |
| R5994 |
T9757 |
T9758 |
compound |
follicle,invaginations |
| R5995 |
T9758 |
T9755 |
nsubj |
invaginations,are |
| R5996 |
T9759 |
T9755 |
acomp |
absent,are |
| R5997 |
T9760 |
T9761 |
punct |
[,30 |
| R5998 |
T9761 |
T9747 |
parataxis |
30,to |
| R5999 |
T9762 |
T9761 |
punct |
],30 |
| R6 |
T153 |
T152 |
punct |
-,β2 |
| R60 |
T212 |
T211 |
amod |
extracellular,cues |
| R600 |
T1419 |
T1420 |
punct |
[,3 |
| R6000 |
T9763 |
T9745 |
punct |
", ",form |
| R6001 |
T9764 |
T9765 |
det |
some,buds |
| R6002 |
T9765 |
T9745 |
nsubj |
buds,form |
| R6003 |
T9766 |
T9765 |
compound |
hair,buds |
| R6004 |
T9767 |
T9745 |
advmod |
still,form |
| R6005 |
T9768 |
T9745 |
prep |
in,form |
| R6006 |
T9769 |
T9770 |
det |
the,absence |
| R6007 |
T9770 |
T9768 |
pobj |
absence,in |
| R6008 |
T9771 |
T9770 |
prep |
of,absence |
| R6009 |
T9772 |
T9771 |
pobj |
LEF,of |
| R601 |
T1420 |
T1393 |
parataxis |
3,populate |
| R6010 |
T9773 |
T9772 |
punct |
-,LEF |
| R6011 |
T9774 |
T9772 |
nummod |
1,LEF |
| R6012 |
T9775 |
T9772 |
punct |
", ",LEF |
| R6013 |
T9776 |
T9772 |
conj |
Shh,LEF |
| R6014 |
T9777 |
T9776 |
punct |
", ",Shh |
| R6015 |
T9778 |
T9776 |
cc |
or,Shh |
| R6016 |
T9779 |
T9780 |
compound |
TGF,β2 |
| R6017 |
T9780 |
T9776 |
conj |
β2,Shh |
| R6018 |
T9781 |
T9780 |
punct |
-,β2 |
| R6019 |
T9782 |
T9783 |
punct |
[,38 |
| R602 |
T1421 |
T1420 |
punct |
],3 |
| R6020 |
T9783 |
T9745 |
parataxis |
38,form |
| R6021 |
T9784 |
T9783 |
nummod |
32,38 |
| R6022 |
T9785 |
T9783 |
punct |
",",38 |
| R6023 |
T9786 |
T9783 |
punct |
],38 |
| R6024 |
T9787 |
T9745 |
punct |
.,form |
| R6025 |
T9789 |
T9790 |
nsubj |
These,reflect |
| R6026 |
T9791 |
T9790 |
advmod |
likely,reflect |
| R6027 |
T9792 |
T9793 |
det |
the,wave |
| R6028 |
T9793 |
T9790 |
dobj |
wave,reflect |
| R6029 |
T9794 |
T9793 |
amod |
first,wave |
| R603 |
T1422 |
T1393 |
punct |
.,populate |
| R6030 |
T9795 |
T9793 |
prep |
of,wave |
| R6031 |
T9796 |
T9797 |
nmod |
follicle,morphogenesis |
| R6032 |
T9797 |
T9795 |
pobj |
morphogenesis,of |
| R6033 |
T9798 |
T9799 |
punct |
(,hair |
| R6034 |
T9799 |
T9797 |
parataxis |
hair,morphogenesis |
| R6035 |
T9800 |
T9799 |
advmod |
i.e.,hair |
| R6036 |
T9801 |
T9799 |
punct |
", ",hair |
| R6037 |
T9802 |
T9799 |
compound |
guard,hair |
| R6038 |
T9803 |
T9799 |
punct |
),hair |
| R6039 |
T9804 |
T9793 |
punct |
", ",wave |
| R604 |
T1424 |
T1425 |
mark |
Once,committed |
| R6040 |
T9805 |
T9806 |
dep |
which,accounts |
| R6041 |
T9806 |
T9793 |
relcl |
accounts,wave |
| R6042 |
T9807 |
T9806 |
prep |
for,accounts |
| R6043 |
T9808 |
T9809 |
det |
a,number |
| R6044 |
T9809 |
T9807 |
pobj |
number,for |
| R6045 |
T9810 |
T9809 |
amod |
small,number |
| R6046 |
T9811 |
T9809 |
punct |
(,number |
| R6047 |
T9812 |
T9813 |
amod |
fewer,5 |
| R6048 |
T9813 |
T9815 |
nummod |
5,% |
| R6049 |
T9814 |
T9813 |
quantmod |
than,5 |
| R605 |
T1425 |
T1426 |
advcl |
committed,instructs |
| R6050 |
T9815 |
T9809 |
appos |
%,number |
| R6051 |
T9816 |
T9809 |
punct |
),number |
| R6052 |
T9817 |
T9809 |
prep |
of,number |
| R6053 |
T9818 |
T9817 |
pobj |
hairs,of |
| R6054 |
T9819 |
T9806 |
cc |
and,accounts |
| R6055 |
T9820 |
T9806 |
conj |
is,accounts |
| R6056 |
T9821 |
T9820 |
prep |
under,is |
| R6057 |
T9822 |
T9823 |
amod |
distinct,control |
| R6058 |
T9823 |
T9821 |
pobj |
control,under |
| R6059 |
T9824 |
T9823 |
amod |
regulatory,control |
| R606 |
T1427 |
T1426 |
punct |
", ",instructs |
| R6060 |
T9825 |
T9790 |
punct |
.,reflect |
| R6061 |
T9827 |
T9828 |
compound |
Guard,hairs |
| R6062 |
T9828 |
T9829 |
nsubj |
hairs,form |
| R6063 |
T9830 |
T9829 |
prep |
in,form |
| R6064 |
T9831 |
T9832 |
det |
the,absence |
| R6065 |
T9832 |
T9830 |
pobj |
absence,in |
| R6066 |
T9833 |
T9832 |
prep |
of,absence |
| R6067 |
T9834 |
T9833 |
pobj |
LEF,of |
| R6068 |
T9835 |
T9834 |
punct |
-,LEF |
| R6069 |
T9836 |
T9834 |
nummod |
1,LEF |
| R607 |
T1428 |
T1429 |
det |
a,cluster |
| R6070 |
T9837 |
T9834 |
cc |
and,LEF |
| R6071 |
T9838 |
T9839 |
compound |
TGF,β2 |
| R6072 |
T9839 |
T9834 |
conj |
β2,LEF |
| R6073 |
T9840 |
T9839 |
punct |
-,β2 |
| R6074 |
T9841 |
T9829 |
punct |
", ",form |
| R6075 |
T9842 |
T9829 |
cc |
and,form |
| R6076 |
T9843 |
T9844 |
nsubj |
we,found |
| R6077 |
T9844 |
T9829 |
conj |
found,form |
| R6078 |
T9845 |
T9844 |
aux |
have,found |
| R6079 |
T9846 |
T9847 |
mark |
that,fail |
| R608 |
T1429 |
T1426 |
nsubj |
cluster,instructs |
| R6080 |
T9847 |
T9844 |
ccomp |
fail,found |
| R6081 |
T9848 |
T9847 |
nsubj |
they,fail |
| R6082 |
T9849 |
T9847 |
advmod |
also,fail |
| R6083 |
T9850 |
T9851 |
aux |
to,express |
| R6084 |
T9851 |
T9847 |
xcomp |
express,fail |
| R6085 |
T9852 |
T9851 |
dobj |
Snail,express |
| R6086 |
T9853 |
T9847 |
prep |
at,fail |
| R6087 |
T9854 |
T9855 |
det |
the,stage |
| R6088 |
T9855 |
T9853 |
pobj |
stage,at |
| R6089 |
T9856 |
T9855 |
compound |
budding,stage |
| R609 |
T1430 |
T1429 |
amod |
small,cluster |
| R6090 |
T9857 |
T9855 |
prep |
of,stage |
| R6091 |
T9858 |
T9857 |
pobj |
development,of |
| R6092 |
T9859 |
T9860 |
punct |
(,data |
| R6093 |
T9860 |
T9844 |
meta |
data,found |
| R6094 |
T9861 |
T9860 |
amod |
unpublished,data |
| R6095 |
T9862 |
T9860 |
punct |
),data |
| R6096 |
T9863 |
T9844 |
punct |
.,found |
| R6097 |
T9865 |
T9866 |
advmod |
How,regulated |
| R6098 |
T9866 |
T9871 |
csubj |
regulated,remains |
| R6099 |
T9867 |
T9868 |
compound |
E,cadherin |
| R61 |
T213 |
T208 |
prep |
in,contributions |
| R610 |
T1431 |
T1429 |
prep |
of,cluster |
| R6100 |
T9868 |
T9866 |
nsubjpass |
cadherin,regulated |
| R6101 |
T9869 |
T9868 |
punct |
-,cadherin |
| R6102 |
T9870 |
T9866 |
auxpass |
is,regulated |
| R6103 |
T9872 |
T9866 |
prep |
in,regulated |
| R6104 |
T9873 |
T9874 |
compound |
guard,hairs |
| R6105 |
T9874 |
T9872 |
pobj |
hairs,in |
| R6106 |
T9875 |
T9876 |
aux |
to,determined |
| R6107 |
T9876 |
T9871 |
xcomp |
determined,remains |
| R6108 |
T9877 |
T9876 |
auxpass |
be,determined |
| R6109 |
T9878 |
T9871 |
punct |
.,remains |
| R611 |
T1432 |
T1433 |
amod |
epithelial,cells |
| R6110 |
T9880 |
T9881 |
amod |
Several,candidates |
| R6111 |
T9881 |
T9882 |
nsubj |
candidates,include |
| R6112 |
T9883 |
T9884 |
amod |
other,members |
| R6113 |
T9884 |
T9882 |
dobj |
members,include |
| R6114 |
T9885 |
T9884 |
compound |
Snail,members |
| R6115 |
T9886 |
T9884 |
compound |
family,members |
| R6116 |
T9887 |
T9888 |
amod |
such,as |
| R6117 |
T9888 |
T9884 |
prep |
as,members |
| R6118 |
T9889 |
T9888 |
pobj |
Slug,as |
| R6119 |
T9890 |
T9889 |
cc |
or,Slug |
| R612 |
T1433 |
T1431 |
pobj |
cells,of |
| R6120 |
T9891 |
T9889 |
conj |
twist,Slug |
| R6121 |
T9892 |
T9884 |
punct |
", ",members |
| R6122 |
T9893 |
T9884 |
cc |
or,members |
| R6123 |
T9894 |
T9895 |
advmod |
alternatively,factors |
| R6124 |
T9895 |
T9884 |
conj |
factors,members |
| R6125 |
T9896 |
T9895 |
punct |
", ",factors |
| R6126 |
T9897 |
T9895 |
compound |
transcription,factors |
| R6127 |
T9898 |
T9895 |
acl |
involving,factors |
| R6128 |
T9899 |
T9900 |
compound |
β,catenin |
| R6129 |
T9900 |
T9898 |
dobj |
catenin,involving |
| R613 |
T1434 |
T1429 |
punct |
", ",cluster |
| R6130 |
T9901 |
T9900 |
punct |
-,catenin |
| R6131 |
T9902 |
T9900 |
cc |
and,catenin |
| R6132 |
T9903 |
T9904 |
det |
a,member |
| R6133 |
T9904 |
T9900 |
conj |
member,catenin |
| R6134 |
T9905 |
T9904 |
amod |
different,member |
| R6135 |
T9906 |
T9904 |
prep |
of,member |
| R6136 |
T9907 |
T9908 |
det |
the,family |
| R6137 |
T9908 |
T9906 |
pobj |
family,of |
| R6138 |
T9909 |
T9910 |
nmod |
LEF,box |
| R6139 |
T9910 |
T9908 |
nmod |
box,family |
| R614 |
T1435 |
T1436 |
det |
the,placode |
| R6140 |
T9911 |
T9909 |
punct |
-,LEF |
| R6141 |
T9912 |
T9909 |
nummod |
1,LEF |
| R6142 |
T9913 |
T9909 |
punct |
/,LEF |
| R6143 |
T9914 |
T9909 |
appos |
TCF,LEF |
| R6144 |
T9915 |
T9909 |
punct |
/,LEF |
| R6145 |
T9916 |
T9917 |
compound |
Sry,type |
| R6146 |
T9917 |
T9909 |
appos |
type,LEF |
| R6147 |
T9918 |
T9917 |
punct |
-,type |
| R6148 |
T9919 |
T9910 |
nmod |
HMG,box |
| R6149 |
T9920 |
T9921 |
punct |
(,known |
| R615 |
T1436 |
T1429 |
appos |
placode,cluster |
| R6150 |
T9921 |
T9910 |
parataxis |
known,box |
| R6151 |
T9922 |
T9921 |
advmod |
commonly,known |
| R6152 |
T9923 |
T9921 |
prep |
as,known |
| R6153 |
T9924 |
T9923 |
pobj |
SOX,as |
| R6154 |
T9925 |
T9921 |
punct |
),known |
| R6155 |
T9926 |
T9927 |
punct |
[,40 |
| R6156 |
T9927 |
T9882 |
parataxis |
40,include |
| R6157 |
T9928 |
T9927 |
nummod |
39,40 |
| R6158 |
T9929 |
T9927 |
punct |
",",40 |
| R6159 |
T9930 |
T9927 |
punct |
],40 |
| R616 |
T1437 |
T1426 |
punct |
", ",instructs |
| R6160 |
T9931 |
T9882 |
punct |
.,include |
| R6161 |
T9933 |
T9934 |
amod |
Further,investigation |
| R6162 |
T9934 |
T9935 |
nsubjpass |
investigation,required |
| R6163 |
T9936 |
T9935 |
aux |
will,required |
| R6164 |
T9937 |
T9935 |
auxpass |
be,required |
| R6165 |
T9938 |
T9939 |
aux |
to,determine |
| R6166 |
T9939 |
T9935 |
advcl |
determine,required |
| R6167 |
T9940 |
T9941 |
mark |
whether,is |
| R6168 |
T9941 |
T9939 |
ccomp |
is,determine |
| R6169 |
T9942 |
T9943 |
det |
the,pathway |
| R617 |
T1438 |
T1439 |
det |
a,group |
| R6170 |
T9943 |
T9941 |
nsubj |
pathway,is |
| R6171 |
T9944 |
T9943 |
compound |
signaling,pathway |
| R6172 |
T9945 |
T9946 |
nsubj |
we,elucidated |
| R6173 |
T9946 |
T9943 |
advcl |
elucidated,pathway |
| R6174 |
T9947 |
T9946 |
aux |
have,elucidated |
| R6175 |
T9948 |
T9946 |
advmod |
here,elucidated |
| R6176 |
T9949 |
T9950 |
det |
a,theme |
| R6177 |
T9950 |
T9941 |
attr |
theme,is |
| R6178 |
T9951 |
T9950 |
prep |
with,theme |
| R6179 |
T9952 |
T9953 |
amod |
multiple,variations |
| R618 |
T1439 |
T1440 |
nsubj |
group,condense |
| R6180 |
T9953 |
T9951 |
pobj |
variations,with |
| R6181 |
T9954 |
T9935 |
punct |
.,required |
| R6182 |
T9956 |
T9957 |
compound |
TGF,βs |
| R6183 |
T9957 |
T9959 |
nsubjpass |
βs,known |
| R6184 |
T9958 |
T9957 |
punct |
-,βs |
| R6185 |
T9960 |
T9959 |
auxpass |
are,known |
| R6186 |
T9961 |
T9962 |
aux |
to,promote |
| R6187 |
T9962 |
T9959 |
xcomp |
promote,known |
| R6188 |
T9963 |
T9962 |
dobj |
withdrawal,promote |
| R6189 |
T9964 |
T9963 |
prep |
of,withdrawal |
| R619 |
T1440 |
T1426 |
ccomp |
condense,instructs |
| R6190 |
T9965 |
T9964 |
pobj |
keratinocytes,of |
| R6191 |
T9966 |
T9963 |
prep |
from,withdrawal |
| R6192 |
T9967 |
T9968 |
det |
the,cycle |
| R6193 |
T9968 |
T9966 |
pobj |
cycle,from |
| R6194 |
T9969 |
T9968 |
compound |
cell,cycle |
| R6195 |
T9970 |
T9971 |
punct |
[,41 |
| R6196 |
T9971 |
T9959 |
parataxis |
41,known |
| R6197 |
T9972 |
T9971 |
punct |
],41 |
| R6198 |
T9973 |
T9959 |
punct |
.,known |
| R6199 |
T9975 |
T9976 |
advmod |
Hence,focused |
| R62 |
T214 |
T213 |
pcomp |
orchestrating,in |
| R620 |
T1441 |
T1439 |
prep |
of,group |
| R6200 |
T9977 |
T9976 |
punct |
", ",focused |
| R6201 |
T9978 |
T9979 |
advmod |
when,detected |
| R6202 |
T9979 |
T9976 |
advcl |
detected,focused |
| R6203 |
T9980 |
T9981 |
compound |
TGF,β2 |
| R6204 |
T9981 |
T9983 |
compound |
β2,protein |
| R6205 |
T9982 |
T9981 |
punct |
-,β2 |
| R6206 |
T9983 |
T9979 |
nsubjpass |
protein,detected |
| R6207 |
T9984 |
T9979 |
auxpass |
was,detected |
| R6208 |
T9985 |
T9979 |
prep |
at,detected |
| R6209 |
T9986 |
T9987 |
det |
the,transition |
| R621 |
T1442 |
T1443 |
amod |
underlying,cells |
| R6210 |
T9987 |
T9985 |
pobj |
transition,at |
| R6211 |
T9988 |
T9987 |
prep |
between,transition |
| R6212 |
T9989 |
T9990 |
det |
the,phases |
| R6213 |
T9990 |
T9988 |
pobj |
phases,between |
| R6214 |
T9991 |
T9992 |
npadvmod |
growing,destructive |
| R6215 |
T9992 |
T9990 |
amod |
destructive,phases |
| R6216 |
T9993 |
T9992 |
cc |
and,destructive |
| R6217 |
T9994 |
T9990 |
prep |
of,phases |
| R6218 |
T9995 |
T9996 |
det |
the,cycle |
| R6219 |
T9996 |
T9994 |
pobj |
cycle,of |
| R622 |
T1443 |
T1441 |
pobj |
cells,of |
| R6220 |
T9997 |
T9996 |
amod |
adult,cycle |
| R6221 |
T9998 |
T9996 |
compound |
hair,cycle |
| R6222 |
T9999 |
T9976 |
punct |
", ",focused |
| R6223 |
T10000 |
T9976 |
nsubj |
research,focused |
| R6224 |
T10001 |
T9976 |
advmod |
initially,focused |
| R6225 |
T10002 |
T10001 |
cc |
and,initially |
| R6226 |
T10003 |
T10001 |
conj |
naturally,initially |
| R6227 |
T10004 |
T9976 |
prep |
on,focused |
| R6228 |
T10005 |
T10006 |
det |
a,role |
| R6229 |
T10006 |
T10004 |
pobj |
role,on |
| R623 |
T1444 |
T1443 |
amod |
mesenchymal,cells |
| R6230 |
T10007 |
T10006 |
prep |
for,role |
| R6231 |
T10008 |
T10009 |
det |
this,member |
| R6232 |
T10009 |
T10007 |
pobj |
member,for |
| R6233 |
T10010 |
T10009 |
compound |
family,member |
| R6234 |
T10011 |
T10006 |
prep |
in,role |
| R6235 |
T10012 |
T10011 |
pobj |
cessation,in |
| R6236 |
T10013 |
T10012 |
prep |
of,cessation |
| R6237 |
T10014 |
T10013 |
pobj |
growth,of |
| R6238 |
T10015 |
T10012 |
cc |
and,cessation |
| R6239 |
T10016 |
T10015 |
punct |
/,and |
| R624 |
T1445 |
T1440 |
aux |
to,condense |
| R6240 |
T10017 |
T10015 |
cc |
or,and |
| R6241 |
T10018 |
T10012 |
conj |
triggering,cessation |
| R6242 |
T10019 |
T10018 |
dobj |
apoptosis,triggering |
| R6243 |
T10020 |
T10021 |
punct |
(,42 |
| R6244 |
T10021 |
T9976 |
parataxis |
42,focused |
| R6245 |
T10022 |
T10021 |
punct |
[,42 |
| R6246 |
T10023 |
T10021 |
punct |
],42 |
| R6247 |
T10024 |
T10021 |
cc |
and,42 |
| R6248 |
T10025 |
T10021 |
conj |
references,42 |
| R6249 |
T10026 |
T10025 |
advmod |
therein,references |
| R625 |
T1446 |
T1440 |
cc |
and,condense |
| R6250 |
T10027 |
T10021 |
punct |
),42 |
| R6251 |
T10028 |
T9976 |
punct |
.,focused |
| R6252 |
T10030 |
T10031 |
advmod |
However,displays |
| R6253 |
T10032 |
T10031 |
punct |
", ",displays |
| R6254 |
T10033 |
T10031 |
prep |
in,displays |
| R6255 |
T10034 |
T10033 |
pobj |
contrast,in |
| R6256 |
T10035 |
T10034 |
prep |
to,contrast |
| R6257 |
T10036 |
T10037 |
compound |
TGF,β1 |
| R6258 |
T10037 |
T10039 |
npadvmod |
β1,null |
| R6259 |
T10038 |
T10037 |
punct |
-,β1 |
| R626 |
T1447 |
T1440 |
conj |
form,condense |
| R6260 |
T10039 |
T10041 |
amod |
null,skin |
| R6261 |
T10040 |
T10039 |
punct |
-,null |
| R6262 |
T10041 |
T10035 |
pobj |
skin,to |
| R6263 |
T10042 |
T10041 |
punct |
", ",skin |
| R6264 |
T10043 |
T10044 |
dep |
which,exhibits |
| R6265 |
T10044 |
T10041 |
relcl |
exhibits,skin |
| R6266 |
T10045 |
T10046 |
det |
an,phase |
| R6267 |
T10046 |
T10044 |
dobj |
phase,exhibits |
| R6268 |
T10047 |
T10046 |
amod |
extended,phase |
| R6269 |
T10048 |
T10046 |
compound |
growing,phase |
| R627 |
T1448 |
T1449 |
det |
the,papilla |
| R6270 |
T10049 |
T10046 |
prep |
of,phase |
| R6271 |
T10050 |
T10051 |
amod |
postnatal,follicles |
| R6272 |
T10051 |
T10049 |
pobj |
follicles,of |
| R6273 |
T10052 |
T10051 |
compound |
hair,follicles |
| R6274 |
T10053 |
T10031 |
punct |
", ",displays |
| R6275 |
T10054 |
T10055 |
compound |
TGF,β2 |
| R6276 |
T10055 |
T10057 |
npadvmod |
β2,null |
| R6277 |
T10056 |
T10055 |
punct |
-,β2 |
| R6278 |
T10057 |
T10059 |
amod |
null,skin |
| R6279 |
T10058 |
T10057 |
punct |
-,null |
| R628 |
T1449 |
T1447 |
dobj |
papilla,form |
| R6280 |
T10059 |
T10031 |
nsubj |
skin,displays |
| R6281 |
T10060 |
T10061 |
det |
an,block |
| R6282 |
T10061 |
T10031 |
dobj |
block,displays |
| R6283 |
T10062 |
T10061 |
amod |
embryonic,block |
| R6284 |
T10063 |
T10061 |
prep |
in,block |
| R6285 |
T10064 |
T10065 |
compound |
follicle,bud |
| R6286 |
T10065 |
T10066 |
compound |
bud,progression |
| R6287 |
T10066 |
T10063 |
pobj |
progression,in |
| R6288 |
T10067 |
T10068 |
punct |
[,32 |
| R6289 |
T10068 |
T10031 |
parataxis |
32,displays |
| R629 |
T1450 |
T1449 |
amod |
nascent,papilla |
| R6290 |
T10069 |
T10068 |
punct |
],32 |
| R6291 |
T10070 |
T10031 |
punct |
.,displays |
| R6292 |
T10072 |
T10073 |
mark |
Although,is |
| R6293 |
T10073 |
T10076 |
advcl |
is,appear |
| R6294 |
T10074 |
T10075 |
det |
this,phenotype |
| R6295 |
T10075 |
T10073 |
nsubj |
phenotype,is |
| R6296 |
T10077 |
T10073 |
acomp |
consistent,is |
| R6297 |
T10078 |
T10077 |
prep |
with,consistent |
| R6298 |
T10079 |
T10080 |
compound |
TGF,β2 |
| R6299 |
T10080 |
T10082 |
poss |
β2,patterns |
| R63 |
T215 |
T216 |
compound |
adhesion,dynamics |
| R630 |
T1451 |
T1449 |
amod |
dermal,papilla |
| R6300 |
T10081 |
T10080 |
punct |
-,β2 |
| R6301 |
T10082 |
T10078 |
pobj |
patterns,with |
| R6302 |
T10083 |
T10080 |
case |
's,β2 |
| R6303 |
T10084 |
T10082 |
amod |
embryonic,patterns |
| R6304 |
T10085 |
T10082 |
compound |
expression,patterns |
| R6305 |
T10086 |
T10087 |
punct |
[,33 |
| R6306 |
T10087 |
T10073 |
parataxis |
33,is |
| R6307 |
T10088 |
T10087 |
punct |
],33 |
| R6308 |
T10089 |
T10076 |
punct |
", ",appear |
| R6309 |
T10090 |
T10091 |
quantmod |
about,50 |
| R631 |
T1452 |
T1449 |
punct |
", ",papilla |
| R6310 |
T10091 |
T10092 |
nummod |
50,% |
| R6311 |
T10092 |
T10076 |
nsubj |
%,appear |
| R6312 |
T10093 |
T10092 |
prep |
of,% |
| R6313 |
T10094 |
T10095 |
compound |
TGF,β2 |
| R6314 |
T10095 |
T10097 |
npadvmod |
β2,null |
| R6315 |
T10096 |
T10095 |
punct |
-,β2 |
| R6316 |
T10097 |
T10098 |
amod |
null,buds |
| R6317 |
T10098 |
T10093 |
pobj |
buds,of |
| R6318 |
T10099 |
T10076 |
oprd |
unable,appear |
| R6319 |
T10100 |
T10101 |
aux |
to,progress |
| R632 |
T1453 |
T1454 |
dep |
which,be |
| R6320 |
T10101 |
T10099 |
xcomp |
progress,unable |
| R6321 |
T10102 |
T10101 |
prep |
to,progress |
| R6322 |
T10103 |
T10104 |
det |
the,phase |
| R6323 |
T10104 |
T10102 |
pobj |
phase,to |
| R6324 |
T10105 |
T10106 |
amod |
down,growth |
| R6325 |
T10106 |
T10104 |
compound |
growth,phase |
| R6326 |
T10107 |
T10106 |
punct |
-,growth |
| R6327 |
T10108 |
T10099 |
punct |
", ",unable |
| R6328 |
T10109 |
T10110 |
det |
a,feature |
| R6329 |
T10110 |
T10099 |
npadvmod |
feature,unable |
| R633 |
T1454 |
T1449 |
relcl |
be,papilla |
| R6330 |
T10111 |
T10112 |
dep |
that,explained |
| R6331 |
T10112 |
T10110 |
relcl |
explained,feature |
| R6332 |
T10113 |
T10112 |
aux |
can,explained |
| R6333 |
T10114 |
T10112 |
neg |
not,explained |
| R6334 |
T10115 |
T10112 |
auxpass |
be,explained |
| R6335 |
T10116 |
T10112 |
advmod |
readily,explained |
| R6336 |
T10117 |
T10112 |
prep |
on,explained |
| R6337 |
T10118 |
T10119 |
det |
the,basis |
| R6338 |
T10119 |
T10117 |
pobj |
basis,on |
| R6339 |
T10120 |
T10119 |
prep |
of,basis |
| R634 |
T1455 |
T1454 |
aux |
will,be |
| R6340 |
T10121 |
T10122 |
advmod |
previously,established |
| R6341 |
T10122 |
T10123 |
amod |
established,effects |
| R6342 |
T10123 |
T10120 |
pobj |
effects,of |
| R6343 |
T10124 |
T10123 |
prep |
of,effects |
| R6344 |
T10125 |
T10126 |
compound |
TGF,βs |
| R6345 |
T10126 |
T10124 |
pobj |
βs,of |
| R6346 |
T10127 |
T10126 |
punct |
-,βs |
| R6347 |
T10128 |
T10076 |
punct |
.,appear |
| R6348 |
T10130 |
T10131 |
poss |
Our,finding |
| R6349 |
T10131 |
T10132 |
nsubj |
finding,lends |
| R635 |
T1456 |
T1457 |
det |
a,fixture |
| R6350 |
T10133 |
T10134 |
mark |
that,is |
| R6351 |
T10134 |
T10131 |
acl |
is,finding |
| R6352 |
T10135 |
T10136 |
compound |
TGF,β2 |
| R6353 |
T10136 |
T10134 |
nsubj |
β2,is |
| R6354 |
T10137 |
T10136 |
punct |
-,β2 |
| R6355 |
T10138 |
T10134 |
advmod |
upstream,is |
| R6356 |
T10139 |
T10138 |
prep |
from,upstream |
| R6357 |
T10140 |
T10141 |
compound |
Ki67,expression |
| R6358 |
T10141 |
T10139 |
pobj |
expression,from |
| R6359 |
T10142 |
T10141 |
cc |
and,expression |
| R636 |
T1457 |
T1454 |
attr |
fixture,be |
| R6360 |
T10143 |
T10144 |
compound |
MAPK,activation |
| R6361 |
T10144 |
T10141 |
conj |
activation,expression |
| R6362 |
T10145 |
T10146 |
amod |
further,support |
| R6363 |
T10146 |
T10132 |
dobj |
support,lends |
| R6364 |
T10147 |
T10132 |
dative |
to,lends |
| R6365 |
T10148 |
T10149 |
det |
the,notion |
| R6366 |
T10149 |
T10147 |
pobj |
notion,to |
| R6367 |
T10150 |
T10151 |
mark |
that,react |
| R6368 |
T10151 |
T10149 |
acl |
react,notion |
| R6369 |
T10152 |
T10153 |
compound |
hair,follicle |
| R637 |
T1458 |
T1457 |
amod |
permanent,fixture |
| R6370 |
T10153 |
T10154 |
compound |
follicle,keratinocytes |
| R6371 |
T10154 |
T10151 |
nsubj |
keratinocytes,react |
| R6372 |
T10155 |
T10154 |
prep |
at,keratinocytes |
| R6373 |
T10156 |
T10157 |
det |
this,stage |
| R6374 |
T10157 |
T10155 |
pobj |
stage,at |
| R6375 |
T10158 |
T10157 |
amod |
early,stage |
| R6376 |
T10159 |
T10157 |
prep |
of,stage |
| R6377 |
T10160 |
T10159 |
pobj |
development,of |
| R6378 |
T10161 |
T10151 |
prep |
to,react |
| R6379 |
T10162 |
T10163 |
compound |
TGF,β2 |
| R638 |
T1459 |
T1457 |
prep |
of,fixture |
| R6380 |
T10163 |
T10165 |
compound |
β2,signaling |
| R6381 |
T10164 |
T10163 |
punct |
-,β2 |
| R6382 |
T10165 |
T10161 |
pobj |
signaling,to |
| R6383 |
T10166 |
T10151 |
prep |
in,react |
| R6384 |
T10167 |
T10168 |
det |
a,fashion |
| R6385 |
T10168 |
T10166 |
pobj |
fashion,in |
| R6386 |
T10169 |
T10168 |
amod |
opposite,fashion |
| R6387 |
T10170 |
T10169 |
prep |
to,opposite |
| R6388 |
T10171 |
T10170 |
pobj |
that,to |
| R6389 |
T10172 |
T10173 |
advmod |
typically,expected |
| R639 |
T1460 |
T1461 |
det |
the,follicle |
| R6390 |
T10173 |
T10171 |
acl |
expected,that |
| R6391 |
T10174 |
T10173 |
prep |
for,expected |
| R6392 |
T10175 |
T10176 |
compound |
TGF,β |
| R6393 |
T10176 |
T10178 |
compound |
β,factors |
| R6394 |
T10177 |
T10176 |
punct |
-,β |
| R6395 |
T10178 |
T10174 |
pobj |
factors,for |
| R6396 |
T10179 |
T10132 |
punct |
.,lends |
| R6397 |
T10181 |
T10182 |
nsubj |
This,said |
| R6398 |
T10182 |
T10183 |
advcl |
said,appeared |
| R6399 |
T10184 |
T10183 |
punct |
", ",appeared |
| R64 |
T216 |
T214 |
dobj |
dynamics,orchestrating |
| R640 |
T1461 |
T1459 |
pobj |
follicle,of |
| R6400 |
T10185 |
T10183 |
prep |
based,appeared |
| R6401 |
T10186 |
T10185 |
prep |
upon,based |
| R6402 |
T10187 |
T10188 |
compound |
pSMAD2,immunohistochemistry |
| R6403 |
T10188 |
T10186 |
pobj |
immunohistochemistry,upon |
| R6404 |
T10189 |
T10183 |
punct |
", ",appeared |
| R6405 |
T10190 |
T10191 |
det |
the,steps |
| R6406 |
T10191 |
T10183 |
nsubj |
steps,appeared |
| R6407 |
T10192 |
T10191 |
amod |
immediate,steps |
| R6408 |
T10193 |
T10191 |
prep |
of,steps |
| R6409 |
T10194 |
T10195 |
amod |
downstream,signaling |
| R641 |
T1462 |
T1461 |
compound |
hair,follicle |
| R6410 |
T10195 |
T10193 |
pobj |
signaling,of |
| R6411 |
T10196 |
T10197 |
aux |
to,be |
| R6412 |
T10197 |
T10183 |
xcomp |
be,appeared |
| R6413 |
T10198 |
T10197 |
acomp |
intact,be |
| R6414 |
T10199 |
T10183 |
punct |
.,appeared |
| R6415 |
T10201 |
T10202 |
advmod |
Thus,surmise |
| R6416 |
T10203 |
T10202 |
punct |
", ",surmise |
| R6417 |
T10204 |
T10202 |
nsubj |
we,surmise |
| R6418 |
T10205 |
T10206 |
mark |
that,is |
| R6419 |
T10206 |
T10202 |
ccomp |
is,surmise |
| R642 |
T1463 |
T1426 |
punct |
.,instructs |
| R6420 |
T10207 |
T10208 |
det |
the,outcome |
| R6421 |
T10208 |
T10206 |
nsubj |
outcome,is |
| R6422 |
T10209 |
T10208 |
amod |
proliferative,outcome |
| R6423 |
T10210 |
T10206 |
acomp |
likely,is |
| R6424 |
T10211 |
T10212 |
aux |
to,rooted |
| R6425 |
T10212 |
T10210 |
xcomp |
rooted,likely |
| R6426 |
T10213 |
T10212 |
auxpass |
be,rooted |
| R6427 |
T10214 |
T10212 |
prep |
in,rooted |
| R6428 |
T10215 |
T10214 |
pobj |
differences,in |
| R6429 |
T10216 |
T10215 |
prep |
in,differences |
| R643 |
T1465 |
T1466 |
amod |
Subsequent,exchanges |
| R6430 |
T10217 |
T10218 |
det |
the,repertoire |
| R6431 |
T10218 |
T10216 |
pobj |
repertoire,in |
| R6432 |
T10219 |
T10218 |
prep |
of,repertoire |
| R6433 |
T10220 |
T10221 |
amod |
activated,genes |
| R6434 |
T10221 |
T10219 |
pobj |
genes,of |
| R6435 |
T10222 |
T10221 |
compound |
SMAD,genes |
| R6436 |
T10223 |
T10221 |
compound |
target,genes |
| R6437 |
T10224 |
T10202 |
punct |
.,surmise |
| R6438 |
T10226 |
T10227 |
prep |
In,be |
| R6439 |
T10228 |
T10229 |
det |
this,regard |
| R644 |
T1466 |
T1467 |
nsubj |
exchanges,result |
| R6440 |
T10229 |
T10226 |
pobj |
regard,In |
| R6441 |
T10230 |
T10227 |
punct |
", ",be |
| R6442 |
T10231 |
T10232 |
det |
the,effects |
| R6443 |
T10232 |
T10227 |
nsubj |
effects,be |
| R6444 |
T10233 |
T10232 |
amod |
positive,effects |
| R6445 |
T10234 |
T10232 |
prep |
of,effects |
| R6446 |
T10235 |
T10236 |
compound |
TGF,β2 |
| R6447 |
T10236 |
T10234 |
pobj |
β2,of |
| R6448 |
T10237 |
T10236 |
punct |
-,β2 |
| R6449 |
T10238 |
T10232 |
prep |
on,effects |
| R645 |
T1468 |
T1466 |
prep |
between,exchanges |
| R6450 |
T10239 |
T10238 |
pobj |
proliferation,on |
| R6451 |
T10240 |
T10232 |
prep |
within,effects |
| R6452 |
T10241 |
T10242 |
det |
the,bud |
| R6453 |
T10242 |
T10240 |
pobj |
bud,within |
| R6454 |
T10243 |
T10242 |
compound |
hair,bud |
| R6455 |
T10244 |
T10227 |
aux |
may,be |
| R6456 |
T10245 |
T10246 |
advmod |
more,analogous |
| R6457 |
T10246 |
T10227 |
acomp |
analogous,be |
| R6458 |
T10247 |
T10246 |
prep |
to,analogous |
| R6459 |
T10248 |
T10249 |
dep |
what,seen |
| R646 |
T1469 |
T1470 |
det |
the,placode |
| R6460 |
T10249 |
T10247 |
pobj |
seen,to |
| R6461 |
T10250 |
T10249 |
aux |
has,seen |
| R6462 |
T10251 |
T10249 |
auxpass |
been,seen |
| R6463 |
T10252 |
T10249 |
prep |
in,seen |
| R6464 |
T10253 |
T10252 |
pobj |
progression,in |
| R6465 |
T10254 |
T10253 |
prep |
of,progression |
| R6466 |
T10255 |
T10256 |
amod |
squamous,cell |
| R6467 |
T10256 |
T10257 |
compound |
cell,carcinoma |
| R6468 |
T10257 |
T10254 |
pobj |
carcinoma,of |
| R6469 |
T10258 |
T10253 |
prep |
to,progression |
| R647 |
T1470 |
T1468 |
pobj |
placode,between |
| R6470 |
T10259 |
T10260 |
amod |
metastatic,carcinoma |
| R6471 |
T10260 |
T10258 |
pobj |
carcinoma,to |
| R6472 |
T10261 |
T10262 |
punct |
[,43 |
| R6473 |
T10262 |
T10249 |
parataxis |
43,seen |
| R6474 |
T10263 |
T10262 |
punct |
],43 |
| R6475 |
T10264 |
T10265 |
advmod |
rather,than |
| R6476 |
T10265 |
T10249 |
cc |
than,seen |
| R6477 |
T10266 |
T10249 |
conj |
that,seen |
| R6478 |
T10267 |
T10268 |
advmod |
typically,observed |
| R6479 |
T10268 |
T10266 |
acl |
observed,that |
| R648 |
T1471 |
T1470 |
cc |
and,placode |
| R6480 |
T10269 |
T10268 |
prep |
for,observed |
| R6481 |
T10270 |
T10269 |
pobj |
keratinocytes,for |
| R6482 |
T10271 |
T10272 |
punct |
[,46 |
| R6483 |
T10272 |
T10227 |
parataxis |
46,be |
| R6484 |
T10273 |
T10272 |
nummod |
44,46 |
| R6485 |
T10274 |
T10272 |
punct |
",",46 |
| R6486 |
T10275 |
T10272 |
nummod |
45,46 |
| R6487 |
T10276 |
T10272 |
punct |
",",46 |
| R6488 |
T10277 |
T10272 |
punct |
],46 |
| R6489 |
T10278 |
T10227 |
punct |
.,be |
| R649 |
T1472 |
T1473 |
amod |
nascent,papilla |
| R6490 |
T10280 |
T10281 |
det |
The,identification |
| R6491 |
T10281 |
T10283 |
nsubj |
identification,was |
| R6492 |
T10282 |
T10281 |
amod |
prior,identification |
| R6493 |
T10284 |
T10281 |
prep |
of,identification |
| R6494 |
T10285 |
T10286 |
det |
the,gene |
| R6495 |
T10286 |
T10284 |
pobj |
gene,of |
| R6496 |
T10287 |
T10286 |
compound |
Snail,gene |
| R6497 |
T10288 |
T10281 |
prep |
as,identification |
| R6498 |
T10289 |
T10290 |
det |
a,target |
| R6499 |
T10290 |
T10288 |
pobj |
target,as |
| R65 |
T217 |
T216 |
cc |
and,dynamics |
| R650 |
T1473 |
T1470 |
conj |
papilla,placode |
| R6500 |
T10291 |
T10290 |
amod |
potential,target |
| R6501 |
T10292 |
T10290 |
prep |
of,target |
| R6502 |
T10293 |
T10294 |
compound |
TGF,β |
| R6503 |
T10294 |
T10296 |
compound |
β,signaling |
| R6504 |
T10295 |
T10294 |
punct |
-,β |
| R6505 |
T10296 |
T10292 |
pobj |
signaling,of |
| R6506 |
T10297 |
T10298 |
punct |
[,15 |
| R6507 |
T10298 |
T10281 |
parataxis |
15,identification |
| R6508 |
T10299 |
T10298 |
punct |
],15 |
| R6509 |
T10300 |
T10283 |
acomp |
intriguing,was |
| R651 |
T1474 |
T1473 |
amod |
dermal,papilla |
| R6510 |
T10301 |
T10283 |
punct |
", ",was |
| R6511 |
T10302 |
T10283 |
prep |
given,was |
| R6512 |
T10303 |
T10304 |
det |
the,wave |
| R6513 |
T10304 |
T10302 |
pobj |
wave,given |
| R6514 |
T10305 |
T10304 |
amod |
temporal,wave |
| R6515 |
T10306 |
T10304 |
prep |
of,wave |
| R6516 |
T10307 |
T10308 |
compound |
Snail,expression |
| R6517 |
T10308 |
T10306 |
pobj |
expression,of |
| R6518 |
T10309 |
T10308 |
compound |
gene,expression |
| R6519 |
T10310 |
T10311 |
dep |
that,occurs |
| R652 |
T1475 |
T1467 |
prep |
in,result |
| R6520 |
T10311 |
T10304 |
relcl |
occurs,wave |
| R6521 |
T10312 |
T10311 |
prep |
in,occurs |
| R6522 |
T10313 |
T10314 |
det |
the,bud |
| R6523 |
T10314 |
T10312 |
pobj |
bud,in |
| R6524 |
T10315 |
T10314 |
amod |
developing,bud |
| R6525 |
T10316 |
T10314 |
compound |
hair,bud |
| R6526 |
T10317 |
T10283 |
punct |
.,was |
| R6527 |
T10319 |
T10320 |
det |
The,correlation |
| R6528 |
T10320 |
T10322 |
nsubj |
correlation,fostered |
| R6529 |
T10321 |
T10320 |
amod |
additional,correlation |
| R653 |
T1476 |
T1477 |
amod |
further,growth |
| R6530 |
T10323 |
T10320 |
prep |
between,correlation |
| R6531 |
T10324 |
T10325 |
amod |
epithelial,hyperproliferation |
| R6532 |
T10325 |
T10323 |
pobj |
hyperproliferation,between |
| R6533 |
T10326 |
T10325 |
cc |
and,hyperproliferation |
| R6534 |
T10327 |
T10328 |
compound |
Snail,expression |
| R6535 |
T10328 |
T10325 |
conj |
expression,hyperproliferation |
| R6536 |
T10329 |
T10328 |
compound |
transgene,expression |
| R6537 |
T10330 |
T10322 |
advmod |
further,fostered |
| R6538 |
T10331 |
T10332 |
poss |
our,interest |
| R6539 |
T10332 |
T10322 |
dobj |
interest,fostered |
| R654 |
T1477 |
T1475 |
pobj |
growth,in |
| R6540 |
T10333 |
T10332 |
prep |
in,interest |
| R6541 |
T10334 |
T10335 |
det |
a,link |
| R6542 |
T10335 |
T10333 |
pobj |
link,in |
| R6543 |
T10336 |
T10335 |
amod |
possible,link |
| R6544 |
T10337 |
T10335 |
prep |
between,link |
| R6545 |
T10338 |
T10339 |
compound |
TGF,β2 |
| R6546 |
T10339 |
T10337 |
pobj |
β2,between |
| R6547 |
T10340 |
T10339 |
punct |
-,β2 |
| R6548 |
T10341 |
T10339 |
cc |
and,β2 |
| R6549 |
T10342 |
T10339 |
conj |
Snail,β2 |
| R655 |
T1478 |
T1477 |
prep |
of,growth |
| R6550 |
T10343 |
T10322 |
punct |
.,fostered |
| R6551 |
T10345 |
T10346 |
poss |
Our,studies |
| R6552 |
T10346 |
T10348 |
nsubj |
studies,demonstrate |
| R6553 |
T10347 |
T10346 |
amod |
functional,studies |
| R6554 |
T10349 |
T10350 |
mark |
that,abolished |
| R6555 |
T10350 |
T10348 |
ccomp |
abolished,demonstrate |
| R6556 |
T10351 |
T10350 |
prep |
without,abolished |
| R6557 |
T10352 |
T10353 |
compound |
TGF,β2 |
| R6558 |
T10353 |
T10351 |
pobj |
β2,without |
| R6559 |
T10354 |
T10353 |
punct |
-,β2 |
| R656 |
T1479 |
T1480 |
det |
the,follicle |
| R6560 |
T10355 |
T10350 |
punct |
", ",abolished |
| R6561 |
T10356 |
T10357 |
compound |
Snail,expression |
| R6562 |
T10357 |
T10350 |
nsubjpass |
expression,abolished |
| R6563 |
T10358 |
T10350 |
auxpass |
is,abolished |
| R6564 |
T10359 |
T10350 |
prep |
in,abolished |
| R6565 |
T10360 |
T10361 |
det |
the,buds |
| R6566 |
T10361 |
T10359 |
pobj |
buds,in |
| R6567 |
T10362 |
T10361 |
compound |
mutant,buds |
| R6568 |
T10363 |
T10361 |
compound |
hair,buds |
| R6569 |
T10364 |
T10350 |
punct |
", ",abolished |
| R657 |
T1480 |
T1478 |
pobj |
follicle,of |
| R6570 |
T10365 |
T10350 |
cc |
and,abolished |
| R6571 |
T10366 |
T10367 |
advmod |
conversely,activated |
| R6572 |
T10367 |
T10350 |
conj |
activated,abolished |
| R6573 |
T10368 |
T10367 |
punct |
", ",activated |
| R6574 |
T10369 |
T10367 |
prep |
in,activated |
| R6575 |
T10370 |
T10371 |
compound |
K14,Smad2 |
| R6576 |
T10371 |
T10373 |
compound |
Smad2,skin |
| R6577 |
T10372 |
T10371 |
punct |
-,Smad2 |
| R6578 |
T10373 |
T10369 |
pobj |
skin,in |
| R6579 |
T10374 |
T10367 |
punct |
", ",activated |
| R658 |
T1481 |
T1477 |
prep |
into,growth |
| R6580 |
T10375 |
T10367 |
nsubjpass |
Snail,activated |
| R6581 |
T10376 |
T10367 |
auxpass |
is,activated |
| R6582 |
T10377 |
T10367 |
advmod |
ectopically,activated |
| R6583 |
T10378 |
T10348 |
punct |
.,demonstrate |
| R6584 |
T10380 |
T10381 |
advmod |
Moreover,indicate |
| R6585 |
T10382 |
T10381 |
punct |
", ",indicate |
| R6586 |
T10383 |
T10384 |
poss |
our,studies |
| R6587 |
T10384 |
T10381 |
nsubj |
studies,indicate |
| R6588 |
T10385 |
T10386 |
advmod |
in,vitro |
| R6589 |
T10386 |
T10384 |
amod |
vitro,studies |
| R659 |
T1482 |
T1483 |
det |
the,dermis |
| R6590 |
T10387 |
T10388 |
mark |
that,cause |
| R6591 |
T10388 |
T10381 |
ccomp |
cause,indicate |
| R6592 |
T10389 |
T10390 |
advmod |
even,exposure |
| R6593 |
T10390 |
T10388 |
nsubj |
exposure,cause |
| R6594 |
T10391 |
T10390 |
amod |
sustained,exposure |
| R6595 |
T10392 |
T10393 |
compound |
TGF,β2 |
| R6596 |
T10393 |
T10390 |
compound |
β2,exposure |
| R6597 |
T10394 |
T10393 |
punct |
-,β2 |
| R6598 |
T10395 |
T10388 |
aux |
may,cause |
| R6599 |
T10396 |
T10397 |
advmod |
only,induction |
| R66 |
T218 |
T216 |
conj |
proliferation,dynamics |
| R660 |
T1483 |
T1481 |
pobj |
dermis,into |
| R6600 |
T10397 |
T10388 |
dobj |
induction,cause |
| R6601 |
T10398 |
T10397 |
det |
a,induction |
| R6602 |
T10399 |
T10397 |
amod |
transient,induction |
| R6603 |
T10400 |
T10397 |
prep |
of,induction |
| R6604 |
T10401 |
T10400 |
pobj |
Snail,of |
| R6605 |
T10402 |
T10381 |
punct |
", ",indicate |
| R6606 |
T10403 |
T10381 |
advcl |
offering,indicate |
| R6607 |
T10404 |
T10405 |
det |
a,explanation |
| R6608 |
T10405 |
T10403 |
dobj |
explanation,offering |
| R6609 |
T10406 |
T10405 |
amod |
possible,explanation |
| R661 |
T1484 |
T1483 |
amod |
underlying,dermis |
| R6610 |
T10407 |
T10405 |
prep |
as,explanation |
| R6611 |
T10408 |
T10407 |
prep |
to,as |
| R6612 |
T10409 |
T10410 |
advmod |
why,expressed |
| R6613 |
T10410 |
T10408 |
pcomp |
expressed,to |
| R6614 |
T10411 |
T10410 |
nsubjpass |
Snail,expressed |
| R6615 |
T10412 |
T10410 |
auxpass |
is,expressed |
| R6616 |
T10413 |
T10414 |
advmod |
so,briefly |
| R6617 |
T10414 |
T10410 |
advmod |
briefly,expressed |
| R6618 |
T10415 |
T10410 |
prep |
during,expressed |
| R6619 |
T10416 |
T10417 |
compound |
hair,follicle |
| R662 |
T1485 |
T1477 |
punct |
", ",growth |
| R6620 |
T10417 |
T10418 |
compound |
follicle,morphogenesis |
| R6621 |
T10418 |
T10415 |
pobj |
morphogenesis,during |
| R6622 |
T10419 |
T10381 |
punct |
.,indicate |
| R6623 |
T10421 |
T10422 |
det |
An,point |
| R6624 |
T10422 |
T10424 |
nsubj |
point,is |
| R6625 |
T10423 |
T10422 |
amod |
additional,point |
| R6626 |
T10425 |
T10422 |
amod |
worth,point |
| R6627 |
T10426 |
T10425 |
advcl |
mentioning,worth |
| R6628 |
T10427 |
T10428 |
mark |
that,resulted |
| R6629 |
T10428 |
T10424 |
ccomp |
resulted,is |
| R663 |
T1486 |
T1477 |
cc |
or,growth |
| R6630 |
T10429 |
T10430 |
amod |
prolonged,expression |
| R6631 |
T10430 |
T10428 |
nsubj |
expression,resulted |
| R6632 |
T10431 |
T10430 |
prep |
of,expression |
| R6633 |
T10432 |
T10433 |
compound |
Tg,Snail |
| R6634 |
T10433 |
T10431 |
pobj |
Snail,of |
| R6635 |
T10434 |
T10430 |
prep |
in,expression |
| R6636 |
T10435 |
T10436 |
amod |
postnatal,skin |
| R6637 |
T10436 |
T10434 |
pobj |
skin,in |
| R6638 |
T10437 |
T10428 |
prep |
in,resulted |
| R6639 |
T10438 |
T10439 |
amod |
morphological,signs |
| R664 |
T1487 |
T1488 |
amod |
down,growth |
| R6640 |
T10439 |
T10437 |
pobj |
signs,in |
| R6641 |
T10440 |
T10438 |
cc |
and,morphological |
| R6642 |
T10441 |
T10438 |
conj |
biochemical,morphological |
| R6643 |
T10442 |
T10439 |
prep |
of,signs |
| R6644 |
T10443 |
T10444 |
amod |
epithelial,transitions |
| R6645 |
T10444 |
T10442 |
pobj |
transitions,of |
| R6646 |
T10445 |
T10443 |
prep |
to,epithelial |
| R6647 |
T10446 |
T10445 |
amod |
mesenchymal,to |
| R6648 |
T10447 |
T10448 |
punct |
(,data |
| R6649 |
T10448 |
T10428 |
meta |
data,resulted |
| R665 |
T1488 |
T1477 |
conj |
growth,growth |
| R6650 |
T10449 |
T10448 |
amod |
unpublished,data |
| R6651 |
T10450 |
T10448 |
punct |
),data |
| R6652 |
T10451 |
T10428 |
punct |
", ",resulted |
| R6653 |
T10452 |
T10428 |
advcl |
underscoring,resulted |
| R6654 |
T10453 |
T10454 |
advmod |
why,be |
| R6655 |
T10454 |
T10452 |
ccomp |
be,underscoring |
| R6656 |
T10455 |
T10456 |
amod |
transient,expression |
| R6657 |
T10456 |
T10454 |
nsubj |
expression,be |
| R6658 |
T10457 |
T10456 |
compound |
Snail,expression |
| R6659 |
T10458 |
T10454 |
aux |
may,be |
| R666 |
T1489 |
T1488 |
punct |
-,growth |
| R6660 |
T10459 |
T10460 |
advmod |
so,important |
| R6661 |
T10460 |
T10454 |
acomp |
important,be |
| R6662 |
T10461 |
T10454 |
prep |
during,be |
| R6663 |
T10462 |
T10463 |
amod |
normal,morphogenesis |
| R6664 |
T10463 |
T10461 |
pobj |
morphogenesis,during |
| R6665 |
T10464 |
T10465 |
compound |
hair,follicle |
| R6666 |
T10465 |
T10463 |
compound |
follicle,morphogenesis |
| R6667 |
T10466 |
T10467 |
punct |
[,18 |
| R6668 |
T10467 |
T10424 |
parataxis |
18,is |
| R6669 |
T10468 |
T10467 |
punct |
],18 |
| R667 |
T1490 |
T1488 |
punct |
", ",growth |
| R6670 |
T10469 |
T10424 |
punct |
.,is |
| R6671 |
T10471 |
T10472 |
prep |
At,seemed |
| R6672 |
T10473 |
T10474 |
amod |
first,glance |
| R6673 |
T10474 |
T10471 |
pobj |
glance,At |
| R6674 |
T10475 |
T10472 |
punct |
", ",seemed |
| R6675 |
T10476 |
T10477 |
det |
the,sparsity |
| R6676 |
T10477 |
T10472 |
nsubj |
sparsity,seemed |
| R6677 |
T10478 |
T10477 |
prep |
in,sparsity |
| R6678 |
T10479 |
T10480 |
compound |
hair,coat |
| R6679 |
T10480 |
T10478 |
pobj |
coat,in |
| R668 |
T1491 |
T1488 |
cc |
and,growth |
| R6680 |
T10481 |
T10480 |
prep |
of,coat |
| R6681 |
T10482 |
T10483 |
compound |
K14,Snail |
| R6682 |
T10483 |
T10485 |
compound |
Snail,mice |
| R6683 |
T10484 |
T10483 |
punct |
-,Snail |
| R6684 |
T10485 |
T10481 |
pobj |
mice,of |
| R6685 |
T10486 |
T10485 |
compound |
Tg,mice |
| R6686 |
T10487 |
T10472 |
oprd |
indicative,seemed |
| R6687 |
T10488 |
T10487 |
prep |
of,indicative |
| R6688 |
T10489 |
T10490 |
det |
a,defect |
| R6689 |
T10490 |
T10488 |
pobj |
defect,of |
| R669 |
T1492 |
T1493 |
amod |
eventual,differentiation |
| R6690 |
T10491 |
T10490 |
prep |
in,defect |
| R6691 |
T10492 |
T10493 |
compound |
follicle,formation |
| R6692 |
T10493 |
T10491 |
pobj |
formation,in |
| R6693 |
T10494 |
T10495 |
punct |
(,see |
| R6694 |
T10495 |
T10472 |
parataxis |
see,seemed |
| R6695 |
T10496 |
T10497 |
compound |
Figure,2A |
| R6696 |
T10497 |
T10495 |
dobj |
2A,see |
| R6697 |
T10498 |
T10495 |
punct |
),see |
| R6698 |
T10499 |
T10472 |
punct |
.,seemed |
| R6699 |
T10501 |
T10502 |
amod |
Closer,inspection |
| R67 |
T219 |
T220 |
aux |
to,shape |
| R670 |
T1493 |
T1488 |
conj |
differentiation,growth |
| R6700 |
T10502 |
T10503 |
nsubj |
inspection,revealed |
| R6701 |
T10504 |
T10503 |
punct |
", ",revealed |
| R6702 |
T10505 |
T10503 |
advmod |
however,revealed |
| R6703 |
T10506 |
T10503 |
punct |
", ",revealed |
| R6704 |
T10507 |
T10508 |
mark |
that,penetrated |
| R6705 |
T10508 |
T10503 |
ccomp |
penetrated,revealed |
| R6706 |
T10509 |
T10510 |
neg |
not,hairs |
| R6707 |
T10510 |
T10508 |
nsubj |
hairs,penetrated |
| R6708 |
T10511 |
T10510 |
det |
all,hairs |
| R6709 |
T10512 |
T10513 |
det |
the,epidermis |
| R671 |
T1494 |
T1493 |
prep |
into,differentiation |
| R6710 |
T10513 |
T10508 |
dobj |
epidermis,penetrated |
| R6711 |
T10514 |
T10513 |
amod |
hyperthickened,epidermis |
| R6712 |
T10515 |
T10513 |
compound |
Tg,epidermis |
| R6713 |
T10516 |
T10503 |
punct |
.,revealed |
| R6714 |
T10518 |
T10519 |
amod |
Several,factors |
| R6715 |
T10519 |
T10520 |
nsubj |
factors,contribute |
| R6716 |
T10521 |
T10520 |
aux |
may,contribute |
| R6717 |
T10522 |
T10520 |
prep |
to,contribute |
| R6718 |
T10523 |
T10524 |
det |
the,development |
| R6719 |
T10524 |
T10522 |
pobj |
development,to |
| R672 |
T1495 |
T1496 |
det |
the,layers |
| R6720 |
T10525 |
T10526 |
advmod |
seemingly,normal |
| R6721 |
T10526 |
T10524 |
amod |
normal,development |
| R6722 |
T10527 |
T10524 |
compound |
follicle,development |
| R6723 |
T10528 |
T10524 |
prep |
in,development |
| R6724 |
T10529 |
T10530 |
det |
these,mice |
| R6725 |
T10530 |
T10528 |
pobj |
mice,in |
| R6726 |
T10531 |
T10520 |
punct |
.,contribute |
| R6727 |
T10533 |
T10534 |
nummod |
One,factor |
| R6728 |
T10534 |
T10536 |
nsubj |
factor,is |
| R6729 |
T10535 |
T10534 |
amod |
obvious,factor |
| R673 |
T1496 |
T1494 |
pobj |
layers,into |
| R6730 |
T10537 |
T10538 |
det |
the,promoter |
| R6731 |
T10538 |
T10536 |
attr |
promoter,is |
| R6732 |
T10539 |
T10538 |
compound |
K14,promoter |
| R6733 |
T10540 |
T10538 |
punct |
", ",promoter |
| R6734 |
T10541 |
T10542 |
dep |
which,is |
| R6735 |
T10542 |
T10538 |
relcl |
is,promoter |
| R6736 |
T10543 |
T10542 |
acomp |
elevated,is |
| R6737 |
T10544 |
T10542 |
prep |
in,is |
| R6738 |
T10545 |
T10546 |
det |
the,layer |
| R6739 |
T10546 |
T10544 |
pobj |
layer,in |
| R674 |
T1497 |
T1496 |
nummod |
six,layers |
| R6740 |
T10547 |
T10546 |
amod |
basal,layer |
| R6741 |
T10548 |
T10546 |
prep |
of,layer |
| R6742 |
T10549 |
T10550 |
det |
the,epidermis |
| R6743 |
T10550 |
T10548 |
pobj |
epidermis,of |
| R6744 |
T10551 |
T10546 |
cc |
and,layer |
| R6745 |
T10552 |
T10553 |
det |
the,sheath |
| R6746 |
T10553 |
T10546 |
conj |
sheath,layer |
| R6747 |
T10554 |
T10553 |
amod |
outer,sheath |
| R6748 |
T10555 |
T10553 |
compound |
root,sheath |
| R6749 |
T10556 |
T10553 |
punct |
(,sheath |
| R675 |
T1498 |
T1496 |
amod |
concentric,layers |
| R6750 |
T10557 |
T10553 |
appos |
ORS,sheath |
| R6751 |
T10558 |
T10553 |
punct |
),sheath |
| R6752 |
T10559 |
T10553 |
prep |
of,sheath |
| R6753 |
T10560 |
T10561 |
det |
the,follicle |
| R6754 |
T10561 |
T10559 |
pobj |
follicle,of |
| R6755 |
T10562 |
T10561 |
compound |
hair,follicle |
| R6756 |
T10563 |
T10536 |
punct |
", ",is |
| R6757 |
T10564 |
T10536 |
cc |
but,is |
| R6758 |
T10565 |
T10566 |
auxpass |
is,regulated |
| R6759 |
T10566 |
T10536 |
conj |
regulated,is |
| R676 |
T1499 |
T1496 |
prep |
of,layers |
| R6760 |
T10567 |
T10566 |
advmod |
markedly,regulated |
| R6761 |
T10568 |
T10566 |
advmod |
down,regulated |
| R6762 |
T10569 |
T10566 |
punct |
-,regulated |
| R6763 |
T10570 |
T10566 |
prep |
in,regulated |
| R6764 |
T10571 |
T10572 |
amod |
developing,buds |
| R6765 |
T10572 |
T10570 |
pobj |
buds,in |
| R6766 |
T10573 |
T10572 |
amod |
embryonic,buds |
| R6767 |
T10574 |
T10572 |
compound |
hair,buds |
| R6768 |
T10575 |
T10576 |
advmod |
as,as |
| R6769 |
T10576 |
T10570 |
cc |
as,in |
| R677 |
T1500 |
T1501 |
det |
the,follicle |
| R6770 |
T10577 |
T10576 |
advmod |
well,as |
| R6771 |
T10578 |
T10570 |
conj |
in,in |
| R6772 |
T10579 |
T10580 |
det |
the,cells |
| R6773 |
T10580 |
T10578 |
pobj |
cells,in |
| R6774 |
T10581 |
T10580 |
amod |
postnatal,cells |
| R6775 |
T10582 |
T10580 |
compound |
hair,cells |
| R6776 |
T10583 |
T10580 |
compound |
progenitor,cells |
| R6777 |
T10584 |
T10536 |
punct |
.,is |
| R6778 |
T10586 |
T10587 |
det |
The,promoter |
| R6779 |
T10587 |
T10589 |
nsubj |
promoter,is |
| R678 |
T1501 |
T1499 |
pobj |
follicle,of |
| R6780 |
T10588 |
T10587 |
compound |
K14,promoter |
| R6781 |
T10590 |
T10589 |
advmod |
also,is |
| R6782 |
T10591 |
T10592 |
advmod |
less,active |
| R6783 |
T10592 |
T10589 |
acomp |
active,is |
| R6784 |
T10593 |
T10592 |
prep |
in,active |
| R6785 |
T10594 |
T10595 |
det |
the,ORS |
| R6786 |
T10595 |
T10593 |
pobj |
ORS,in |
| R6787 |
T10596 |
T10592 |
prep |
than,active |
| R6788 |
T10597 |
T10596 |
pcomp |
epidermis,than |
| R6789 |
T10598 |
T10589 |
cc |
and,is |
| R679 |
T1502 |
T1501 |
amod |
mature,follicle |
| R6790 |
T10599 |
T10600 |
advmod |
hence,account |
| R6791 |
T10600 |
T10589 |
conj |
account,is |
| R6792 |
T10601 |
T10600 |
nsubj |
this,account |
| R6793 |
T10602 |
T10600 |
aux |
might,account |
| R6794 |
T10603 |
T10600 |
advmod |
also,account |
| R6795 |
T10604 |
T10600 |
prep |
for,account |
| R6796 |
T10605 |
T10606 |
det |
the,lack |
| R6797 |
T10606 |
T10604 |
pobj |
lack,for |
| R6798 |
T10607 |
T10606 |
prep |
of,lack |
| R6799 |
T10608 |
T10609 |
amod |
apparent,response |
| R68 |
T220 |
T214 |
advcl |
shape,orchestrating |
| R680 |
T1503 |
T1467 |
punct |
.,result |
| R6800 |
T10609 |
T10607 |
pobj |
response,of |
| R6801 |
T10610 |
T10609 |
prep |
of,response |
| R6802 |
T10611 |
T10612 |
det |
the,ORS |
| R6803 |
T10612 |
T10610 |
pobj |
ORS,of |
| R6804 |
T10613 |
T10609 |
prep |
to,response |
| R6805 |
T10614 |
T10615 |
amod |
ectopic,Snail |
| R6806 |
T10615 |
T10613 |
pobj |
Snail,to |
| R6807 |
T10616 |
T10600 |
punct |
.,account |
| R6808 |
T10618 |
T10619 |
amod |
Additional,factors |
| R6809 |
T10619 |
T10621 |
nsubj |
factors,be |
| R681 |
T1505 |
T1506 |
advmod |
Previously,delineated |
| R6810 |
T10620 |
T10619 |
amod |
contributing,factors |
| R6811 |
T10622 |
T10621 |
aux |
could,be |
| R6812 |
T10623 |
T10624 |
det |
the,multiplicity |
| R6813 |
T10624 |
T10621 |
attr |
multiplicity,be |
| R6814 |
T10625 |
T10624 |
prep |
of,multiplicity |
| R6815 |
T10626 |
T10627 |
compound |
Snail,members |
| R6816 |
T10627 |
T10625 |
pobj |
members,of |
| R6817 |
T10628 |
T10627 |
compound |
family,members |
| R6818 |
T10629 |
T10627 |
cc |
and,members |
| R6819 |
T10630 |
T10631 |
poss |
their,expression |
| R682 |
T1507 |
T1506 |
punct |
", ",delineated |
| R6820 |
T10631 |
T10627 |
conj |
expression,members |
| R6821 |
T10632 |
T10631 |
amod |
differential,expression |
| R6822 |
T10633 |
T10627 |
punct |
", ",members |
| R6823 |
T10634 |
T10635 |
det |
the,saturation |
| R6824 |
T10635 |
T10627 |
appos |
saturation,members |
| R6825 |
T10636 |
T10635 |
punct |
", ",saturation |
| R6826 |
T10637 |
T10635 |
cc |
and,saturation |
| R6827 |
T10638 |
T10637 |
punct |
/,and |
| R6828 |
T10639 |
T10637 |
cc |
or,and |
| R6829 |
T10640 |
T10635 |
conj |
diversity,saturation |
| R683 |
T1508 |
T1506 |
nsubj |
we,delineated |
| R6830 |
T10641 |
T10635 |
prep |
of,saturation |
| R6831 |
T10642 |
T10643 |
amod |
regulatory,mechanisms |
| R6832 |
T10643 |
T10641 |
pobj |
mechanisms,of |
| R6833 |
T10644 |
T10645 |
dep |
that,govern |
| R6834 |
T10645 |
T10643 |
relcl |
govern,mechanisms |
| R6835 |
T10646 |
T10647 |
compound |
AJ,formation |
| R6836 |
T10647 |
T10645 |
dobj |
formation,govern |
| R6837 |
T10648 |
T10647 |
punct |
", ",formation |
| R6838 |
T10649 |
T10647 |
conj |
migration,formation |
| R6839 |
T10650 |
T10649 |
punct |
", ",migration |
| R684 |
T1509 |
T1510 |
advmod |
how,function |
| R6840 |
T10651 |
T10649 |
cc |
and,migration |
| R6841 |
T10652 |
T10649 |
conj |
proliferation,migration |
| R6842 |
T10653 |
T10645 |
prep |
in,govern |
| R6843 |
T10654 |
T10655 |
det |
the,ORS |
| R6844 |
T10655 |
T10653 |
pobj |
ORS,in |
| R6845 |
T10656 |
T10655 |
compound |
follicle,ORS |
| R6846 |
T10657 |
T10621 |
punct |
.,be |
| R6847 |
T10659 |
T10660 |
csubj |
Distinguishing,await |
| R6848 |
T10661 |
T10659 |
prep |
between,Distinguishing |
| R6849 |
T10662 |
T10663 |
det |
these,possibilities |
| R685 |
T1510 |
T1506 |
ccomp |
function,delineated |
| R6850 |
T10663 |
T10661 |
pobj |
possibilities,between |
| R6851 |
T10664 |
T10660 |
aux |
must,await |
| R6852 |
T10665 |
T10666 |
det |
the,generation |
| R6853 |
T10666 |
T10660 |
dobj |
generation,await |
| R6854 |
T10667 |
T10666 |
prep |
of,generation |
| R6855 |
T10668 |
T10667 |
pobj |
mice,of |
| R6856 |
T10669 |
T10668 |
acl |
harboring,mice |
| R6857 |
T10670 |
T10671 |
npadvmod |
skin,specific |
| R6858 |
T10671 |
T10673 |
amod |
specific,mutations |
| R6859 |
T10672 |
T10671 |
punct |
-,specific |
| R686 |
T1511 |
T1512 |
nummod |
two,signals |
| R6860 |
T10673 |
T10669 |
dobj |
mutations,harboring |
| R6861 |
T10674 |
T10673 |
nmod |
loss,mutations |
| R6862 |
T10675 |
T10674 |
punct |
-,loss |
| R6863 |
T10676 |
T10674 |
prep |
of,loss |
| R6864 |
T10677 |
T10676 |
punct |
-,of |
| R6865 |
T10678 |
T10676 |
pobj |
function,of |
| R6866 |
T10679 |
T10673 |
compound |
Snail,mutations |
| R6867 |
T10680 |
T10660 |
punct |
.,await |
| R687 |
T1512 |
T1510 |
nsubj |
signals,function |
| R6876 |
T11058 |
T11057 |
prep |
between,Links |
| R6877 |
T11059 |
T11058 |
pobj |
Signaling,between |
| R6878 |
T11060 |
T11059 |
punct |
", ",Signaling |
| R6879 |
T11061 |
T11062 |
amod |
Transcriptional,Cascades |
| R688 |
T1513 |
T1512 |
amod |
respective,signals |
| R6880 |
T11062 |
T11059 |
conj |
Cascades,Signaling |
| R6881 |
T11063 |
T11062 |
punct |
", ",Cascades |
| R6882 |
T11064 |
T11065 |
amod |
Epithelial,Remodeling |
| R6883 |
T11065 |
T11062 |
conj |
Remodeling,Cascades |
| R6884 |
T11066 |
T11065 |
punct |
", ",Remodeling |
| R6885 |
T11067 |
T11065 |
cc |
and,Remodeling |
| R6886 |
T11068 |
T11065 |
conj |
Proliferation,Remodeling |
| R6887 |
T11069 |
T11057 |
prep |
in,Links |
| R6888 |
T11070 |
T11071 |
det |
the,Bud |
| R6889 |
T11071 |
T11069 |
pobj |
Bud,in |
| R689 |
T1514 |
T1512 |
amod |
epithelial,signals |
| R6890 |
T11072 |
T11071 |
compound |
Hair,Bud |
| R6891 |
T11074 |
T11075 |
advmod |
Previously,discovered |
| R6892 |
T11076 |
T11075 |
punct |
", ",discovered |
| R6893 |
T11077 |
T11075 |
nsubj |
we,discovered |
| R6894 |
T11078 |
T11079 |
mark |
that,regulated |
| R6895 |
T11079 |
T11075 |
ccomp |
regulated,discovered |
| R6896 |
T11080 |
T11079 |
advmod |
early,regulated |
| R6897 |
T11081 |
T11080 |
prep |
during,early |
| R6898 |
T11082 |
T11083 |
compound |
hair,follicle |
| R6899 |
T11083 |
T11084 |
compound |
follicle,morphogenesis |
| R69 |
T221 |
T222 |
det |
the,cluster |
| R690 |
T1515 |
T1514 |
cc |
and,epithelial |
| R6900 |
T11084 |
T11081 |
pobj |
morphogenesis,during |
| R6901 |
T11085 |
T11079 |
punct |
", ",regulated |
| R6902 |
T11086 |
T11087 |
compound |
E,cadherin |
| R6903 |
T11087 |
T11089 |
compound |
cadherin,expression |
| R6904 |
T11088 |
T11087 |
punct |
-,cadherin |
| R6905 |
T11089 |
T11079 |
nsubjpass |
expression,regulated |
| R6906 |
T11090 |
T11089 |
compound |
gene,expression |
| R6907 |
T11091 |
T11079 |
auxpass |
is,regulated |
| R6908 |
T11092 |
T11079 |
advmod |
down,regulated |
| R6909 |
T11093 |
T11079 |
punct |
-,regulated |
| R691 |
T1516 |
T1514 |
conj |
mesenchymal,epithelial |
| R6910 |
T11094 |
T11079 |
advmod |
concomitantly,regulated |
| R6911 |
T11095 |
T11079 |
prep |
with,regulated |
| R6912 |
T11096 |
T11097 |
det |
the,invagination |
| R6913 |
T11097 |
T11095 |
pobj |
invagination,with |
| R6914 |
T11098 |
T11097 |
prep |
of,invagination |
| R6915 |
T11099 |
T11100 |
amod |
developing,cells |
| R6916 |
T11100 |
T11098 |
pobj |
cells,of |
| R6917 |
T11101 |
T11100 |
compound |
bud,cells |
| R6918 |
T11102 |
T11097 |
prep |
into,invagination |
| R6919 |
T11103 |
T11104 |
det |
the,skin |
| R692 |
T1517 |
T1512 |
punct |
", ",signals |
| R6920 |
T11104 |
T11102 |
pobj |
skin,into |
| R6921 |
T11105 |
T11106 |
punct |
[,4 |
| R6922 |
T11106 |
T11075 |
parataxis |
4,discovered |
| R6923 |
T11107 |
T11106 |
punct |
],4 |
| R6924 |
T11108 |
T11075 |
punct |
.,discovered |
| R6925 |
T11110 |
T11111 |
mark |
Because,correlated |
| R6926 |
T11111 |
T11117 |
advcl |
correlated,intrigued |
| R6927 |
T11112 |
T11113 |
det |
the,timing |
| R6928 |
T11113 |
T11111 |
nsubj |
timing,correlated |
| R6929 |
T11114 |
T11113 |
prep |
of,timing |
| R693 |
T1518 |
T1512 |
appos |
Wnts,signals |
| R6930 |
T11115 |
T11116 |
det |
this,event |
| R6931 |
T11116 |
T11114 |
pobj |
event,of |
| R6932 |
T11118 |
T11111 |
prep |
with,correlated |
| R6933 |
T11119 |
T11120 |
det |
the,activation |
| R6934 |
T11120 |
T11118 |
pobj |
activation,with |
| R6935 |
T11121 |
T11120 |
prep |
of,activation |
| R6936 |
T11122 |
T11123 |
det |
a,complex |
| R6937 |
T11123 |
T11121 |
pobj |
complex,of |
| R6938 |
T11124 |
T11125 |
nmod |
LEF,factor |
| R6939 |
T11125 |
T11123 |
compound |
factor,complex |
| R694 |
T1519 |
T1518 |
cc |
and,Wnts |
| R6940 |
T11126 |
T11124 |
punct |
-,LEF |
| R6941 |
T11127 |
T11124 |
nummod |
1,LEF |
| R6942 |
T11128 |
T11124 |
punct |
/,LEF |
| R6943 |
T11129 |
T11130 |
compound |
β,catenin |
| R6944 |
T11130 |
T11124 |
appos |
catenin,LEF |
| R6945 |
T11131 |
T11130 |
punct |
-,catenin |
| R6946 |
T11132 |
T11125 |
compound |
transcription,factor |
| R6947 |
T11133 |
T11134 |
punct |
[,20 |
| R6948 |
T11134 |
T11111 |
parataxis |
20,correlated |
| R6949 |
T11135 |
T11134 |
punct |
],20 |
| R695 |
T1520 |
T1521 |
det |
the,factor |
| R6950 |
T11136 |
T11117 |
punct |
", ",intrigued |
| R6951 |
T11137 |
T11117 |
nsubjpass |
we,intrigued |
| R6952 |
T11138 |
T11117 |
auxpass |
were,intrigued |
| R6953 |
T11139 |
T11117 |
agent |
by,intrigued |
| R6954 |
T11140 |
T11141 |
det |
the,presence |
| R6955 |
T11141 |
T11139 |
pobj |
presence,by |
| R6956 |
T11142 |
T11141 |
prep |
of,presence |
| R6957 |
T11143 |
T11144 |
det |
a,site |
| R6958 |
T11144 |
T11142 |
pobj |
site,of |
| R6959 |
T11145 |
T11144 |
amod |
putative,site |
| R696 |
T1521 |
T1518 |
conj |
factor,Wnts |
| R6960 |
T11146 |
T11144 |
nmod |
LEF,site |
| R6961 |
T11147 |
T11146 |
punct |
-,LEF |
| R6962 |
T11148 |
T11146 |
nummod |
1,LEF |
| R6963 |
T11149 |
T11146 |
punct |
/,LEF |
| R6964 |
T11150 |
T11146 |
appos |
TCF,LEF |
| R6965 |
T11151 |
T11144 |
compound |
binding,site |
| R6966 |
T11152 |
T11141 |
prep |
in,presence |
| R6967 |
T11153 |
T11154 |
det |
the,promoter |
| R6968 |
T11154 |
T11152 |
pobj |
promoter,in |
| R6969 |
T11155 |
T11156 |
compound |
E,cadherin |
| R697 |
T1522 |
T1523 |
npadvmod |
BMP,inhibitory |
| R6970 |
T11156 |
T11154 |
compound |
cadherin,promoter |
| R6971 |
T11157 |
T11156 |
punct |
-,cadherin |
| R6972 |
T11158 |
T11117 |
punct |
.,intrigued |
| R6973 |
T11160 |
T11161 |
nsubj |
This,prompted |
| R6974 |
T11162 |
T11163 |
det |
an,investigation |
| R6975 |
T11163 |
T11161 |
dobj |
investigation,prompted |
| R6976 |
T11164 |
T11165 |
dep |
that,led |
| R6977 |
T11165 |
T11163 |
relcl |
led,investigation |
| R6978 |
T11166 |
T11165 |
advmod |
subsequently,led |
| R6979 |
T11167 |
T11165 |
prep |
to,led |
| R698 |
T1523 |
T1521 |
amod |
inhibitory,factor |
| R6980 |
T11168 |
T11169 |
poss |
our,discovery |
| R6981 |
T11169 |
T11167 |
pobj |
discovery,to |
| R6982 |
T11170 |
T11171 |
mark |
that,contribute |
| R6983 |
T11171 |
T11169 |
acl |
contribute,discovery |
| R6984 |
T11172 |
T11171 |
nsubj |
LEF,contribute |
| R6985 |
T11173 |
T11172 |
punct |
-,LEF |
| R6986 |
T11174 |
T11172 |
nummod |
1,LEF |
| R6987 |
T11175 |
T11172 |
punct |
/,LEF |
| R6988 |
T11176 |
T11177 |
compound |
β,catenin |
| R6989 |
T11177 |
T11172 |
appos |
catenin,LEF |
| R699 |
T1524 |
T1523 |
punct |
-,inhibitory |
| R6990 |
T11178 |
T11177 |
punct |
-,catenin |
| R6991 |
T11179 |
T11171 |
aux |
can,contribute |
| R6992 |
T11180 |
T11171 |
prep |
to,contribute |
| R6993 |
T11181 |
T11180 |
pobj |
repression,to |
| R6994 |
T11182 |
T11181 |
prep |
of,repression |
| R6995 |
T11183 |
T11184 |
compound |
E,cadherin |
| R6996 |
T11184 |
T11186 |
compound |
cadherin,expression |
| R6997 |
T11185 |
T11184 |
punct |
-,cadherin |
| R6998 |
T11186 |
T11182 |
pobj |
expression,of |
| R6999 |
T11187 |
T11186 |
compound |
gene,expression |
| R7 |
T154 |
T152 |
cc |
and,β2 |
| R70 |
T222 |
T220 |
dobj |
cluster,shape |
| R700 |
T1525 |
T1521 |
appos |
noggin,factor |
| R7000 |
T11188 |
T11171 |
prep |
in,contribute |
| R7001 |
T11189 |
T11190 |
compound |
skin,keratinocytes |
| R7002 |
T11190 |
T11188 |
pobj |
keratinocytes,in |
| R7003 |
T11191 |
T11192 |
punct |
[,4 |
| R7004 |
T11192 |
T11161 |
parataxis |
4,prompted |
| R7005 |
T11193 |
T11192 |
punct |
],4 |
| R7006 |
T11194 |
T11161 |
punct |
.,prompted |
| R7007 |
T11196 |
T11197 |
prep |
In,noted |
| R7008 |
T11198 |
T11199 |
det |
the,course |
| R7009 |
T11199 |
T11196 |
pobj |
course,In |
| R701 |
T1526 |
T1510 |
punct |
", ",function |
| R7010 |
T11200 |
T11199 |
prep |
of,course |
| R7011 |
T11201 |
T11202 |
det |
these,studies |
| R7012 |
T11202 |
T11200 |
pobj |
studies,of |
| R7013 |
T11203 |
T11197 |
punct |
", ",noted |
| R7014 |
T11204 |
T11197 |
nsubj |
we,noted |
| R7015 |
T11205 |
T11197 |
advmod |
also,noted |
| R7016 |
T11206 |
T11207 |
mark |
that,contribute |
| R7017 |
T11207 |
T11197 |
ccomp |
contribute,noted |
| R7018 |
T11208 |
T11207 |
nsubj |
Snail,contribute |
| R7019 |
T11209 |
T11207 |
aux |
can,contribute |
| R702 |
T1527 |
T1510 |
prep |
in,function |
| R7020 |
T11210 |
T11207 |
advmod |
also,contribute |
| R7021 |
T11211 |
T11207 |
prep |
to,contribute |
| R7022 |
T11212 |
T11213 |
det |
this,process |
| R7023 |
T11213 |
T11211 |
pobj |
process,to |
| R7024 |
T11214 |
T11207 |
prep |
in,contribute |
| R7025 |
T11215 |
T11214 |
pobj |
keratinocytes,in |
| R7026 |
T11216 |
T11217 |
advmod |
in,vitro |
| R7027 |
T11217 |
T11207 |
advmod |
vitro,contribute |
| R7028 |
T11218 |
T11197 |
punct |
", ",noted |
| R7029 |
T11219 |
T11197 |
cc |
and,noted |
| R703 |
T1528 |
T1527 |
pobj |
concert,in |
| R7030 |
T11220 |
T11221 |
poss |
our,studies |
| R7031 |
T11221 |
T11223 |
nsubj |
studies,revealed |
| R7032 |
T11222 |
T11221 |
amod |
present,studies |
| R7033 |
T11223 |
T11197 |
conj |
revealed,noted |
| R7034 |
T11224 |
T11225 |
mark |
that,expressed |
| R7035 |
T11225 |
T11223 |
ccomp |
expressed,revealed |
| R7036 |
T11226 |
T11225 |
nsubjpass |
Snail,expressed |
| R7037 |
T11227 |
T11225 |
auxpass |
is,expressed |
| R7038 |
T11228 |
T11225 |
prep |
at,expressed |
| R7039 |
T11229 |
T11230 |
det |
the,place |
| R704 |
T1529 |
T1530 |
aux |
to,induce |
| R7040 |
T11230 |
T11228 |
pobj |
place,at |
| R7041 |
T11231 |
T11230 |
amod |
right,place |
| R7042 |
T11232 |
T11230 |
cc |
and,place |
| R7043 |
T11233 |
T11230 |
conj |
time,place |
| R7044 |
T11234 |
T11235 |
aux |
to,be |
| R7045 |
T11235 |
T11230 |
advcl |
be,place |
| R7046 |
T11236 |
T11237 |
advmod |
physiologically,relevant |
| R7047 |
T11237 |
T11235 |
acomp |
relevant,be |
| R7048 |
T11238 |
T11235 |
prep |
in,be |
| R7049 |
T11239 |
T11240 |
det |
the,process |
| R705 |
T1530 |
T1510 |
advcl |
induce,function |
| R7050 |
T11240 |
T11238 |
pobj |
process,in |
| R7051 |
T11241 |
T11223 |
punct |
.,revealed |
| R7052 |
T11243 |
T11244 |
prep |
In,abrogated |
| R7053 |
T11245 |
T11246 |
npadvmod |
noggin,null |
| R7054 |
T11246 |
T11248 |
amod |
null,skin |
| R7055 |
T11247 |
T11246 |
punct |
-,null |
| R7056 |
T11248 |
T11243 |
pobj |
skin,In |
| R7057 |
T11249 |
T11248 |
amod |
embryonic,skin |
| R7058 |
T11250 |
T11244 |
punct |
", ",abrogated |
| R7059 |
T11251 |
T11252 |
nmod |
LEF,expression |
| R706 |
T1531 |
T1532 |
amod |
lymphoid,factor |
| R7060 |
T11252 |
T11244 |
nsubjpass |
expression,abrogated |
| R7061 |
T11253 |
T11251 |
punct |
-,LEF |
| R7062 |
T11254 |
T11251 |
nummod |
1,LEF |
| R7063 |
T11255 |
T11252 |
cc |
and,expression |
| R7064 |
T11256 |
T11257 |
amod |
subsequent,activation |
| R7065 |
T11257 |
T11252 |
conj |
activation,expression |
| R7066 |
T11258 |
T11257 |
prep |
of,activation |
| R7067 |
T11259 |
T11260 |
det |
the,gene |
| R7068 |
T11260 |
T11258 |
pobj |
gene,of |
| R7069 |
T11261 |
T11260 |
nmod |
LEF,gene |
| R707 |
T1532 |
T1534 |
npadvmod |
factor,mediated |
| R7070 |
T11262 |
T11261 |
punct |
-,LEF |
| R7071 |
T11263 |
T11261 |
nummod |
1,LEF |
| R7072 |
T11264 |
T11261 |
punct |
/,LEF |
| R7073 |
T11265 |
T11266 |
compound |
β,catenin |
| R7074 |
T11266 |
T11261 |
appos |
catenin,LEF |
| R7075 |
T11267 |
T11266 |
punct |
-,catenin |
| R7076 |
T11268 |
T11260 |
compound |
reporter,gene |
| R7077 |
T11269 |
T11244 |
auxpass |
is,abrogated |
| R7078 |
T11270 |
T11244 |
prep |
in,abrogated |
| R7079 |
T11271 |
T11272 |
det |
the,placodes |
| R708 |
T1533 |
T1532 |
compound |
enhancer,factor |
| R7080 |
T11272 |
T11270 |
pobj |
placodes,in |
| R7081 |
T11273 |
T11272 |
amod |
developing,placodes |
| R7082 |
T11274 |
T11244 |
punct |
.,abrogated |
| R7083 |
T11276 |
T11277 |
det |
The,failure |
| R7084 |
T11277 |
T11279 |
nsubj |
failure,underscores |
| R7085 |
T11278 |
T11277 |
amod |
corresponding,failure |
| R7086 |
T11280 |
T11277 |
prep |
of,failure |
| R7087 |
T11281 |
T11282 |
nmod |
E,cadherin |
| R7088 |
T11282 |
T11284 |
nmod |
cadherin,regulation |
| R7089 |
T11283 |
T11282 |
punct |
-,cadherin |
| R709 |
T1534 |
T1551 |
amod |
mediated,transcription |
| R7090 |
T11284 |
T11280 |
pobj |
regulation,of |
| R7091 |
T11285 |
T11284 |
amod |
down,regulation |
| R7092 |
T11286 |
T11284 |
punct |
-,regulation |
| R7093 |
T11287 |
T11288 |
det |
the,importance |
| R7094 |
T11288 |
T11279 |
dobj |
importance,underscores |
| R7095 |
T11289 |
T11288 |
prep |
of,importance |
| R7096 |
T11290 |
T11291 |
compound |
Wnt,noggin |
| R7097 |
T11291 |
T11293 |
compound |
noggin,signaling |
| R7098 |
T11292 |
T11291 |
punct |
/,noggin |
| R7099 |
T11293 |
T11289 |
pobj |
signaling,of |
| R71 |
T223 |
T222 |
prep |
of,cluster |
| R710 |
T1535 |
T1532 |
punct |
-,factor |
| R7100 |
T11294 |
T11288 |
prep |
in,importance |
| R7101 |
T11295 |
T11294 |
pcomp |
regulating,in |
| R7102 |
T11296 |
T11297 |
det |
this,event |
| R7103 |
T11297 |
T11295 |
dobj |
event,regulating |
| R7104 |
T11298 |
T11295 |
prep |
in,regulating |
| R7105 |
T11299 |
T11300 |
compound |
follicle,morphogenesis |
| R7106 |
T11300 |
T11298 |
pobj |
morphogenesis,in |
| R7107 |
T11301 |
T11302 |
punct |
[,4 |
| R7108 |
T11302 |
T11279 |
parataxis |
4,underscores |
| R7109 |
T11303 |
T11302 |
punct |
],4 |
| R711 |
T1536 |
T1532 |
nummod |
1,factor |
| R7110 |
T11304 |
T11279 |
punct |
.,underscores |
| R7111 |
T11306 |
T11307 |
amod |
Conditional,studies |
| R7112 |
T11307 |
T11310 |
nsubj |
studies,be |
| R7113 |
T11308 |
T11309 |
compound |
gene,targeting |
| R7114 |
T11309 |
T11307 |
compound |
targeting,studies |
| R7115 |
T11311 |
T11310 |
aux |
will,be |
| R7116 |
T11312 |
T11310 |
acomp |
necessary,be |
| R7117 |
T11313 |
T11314 |
aux |
to,establish |
| R7118 |
T11314 |
T11310 |
advcl |
establish,be |
| R7119 |
T11315 |
T11316 |
mark |
whether,contribute |
| R712 |
T1537 |
T1532 |
punct |
/,factor |
| R7120 |
T11316 |
T11314 |
ccomp |
contribute,establish |
| R7121 |
T11317 |
T11318 |
compound |
Snail,members |
| R7122 |
T11318 |
T11316 |
nsubj |
members,contribute |
| R7123 |
T11319 |
T11318 |
compound |
family,members |
| R7124 |
T11320 |
T11316 |
advmod |
also,contribute |
| R7125 |
T11321 |
T11316 |
prep |
to,contribute |
| R7126 |
T11322 |
T11323 |
det |
the,regulation |
| R7127 |
T11323 |
T11321 |
pobj |
regulation,to |
| R7128 |
T11324 |
T11323 |
amod |
down,regulation |
| R7129 |
T11325 |
T11323 |
punct |
-,regulation |
| R713 |
T1538 |
T1539 |
compound |
β,catenin |
| R7130 |
T11326 |
T11323 |
prep |
in,regulation |
| R7131 |
T11327 |
T11328 |
compound |
E,cadherin |
| R7132 |
T11328 |
T11330 |
compound |
cadherin,expression |
| R7133 |
T11329 |
T11328 |
punct |
-,cadherin |
| R7134 |
T11330 |
T11326 |
pobj |
expression,in |
| R7135 |
T11331 |
T11330 |
compound |
gene,expression |
| R7136 |
T11332 |
T11333 |
dep |
that,occurs |
| R7137 |
T11333 |
T11323 |
relcl |
occurs,regulation |
| R7138 |
T11334 |
T11333 |
prep |
during,occurs |
| R7139 |
T11335 |
T11336 |
compound |
follicle,formation |
| R714 |
T1539 |
T1532 |
appos |
catenin,factor |
| R7140 |
T11336 |
T11334 |
pobj |
formation,during |
| R7141 |
T11337 |
T11310 |
punct |
.,be |
| R7142 |
T11339 |
T11340 |
advmod |
However,is |
| R7143 |
T11341 |
T11340 |
punct |
", ",is |
| R7144 |
T11342 |
T11340 |
nsubj |
it,is |
| R7145 |
T11343 |
T11340 |
acomp |
intriguing,is |
| R7146 |
T11344 |
T11345 |
mark |
that,displayed |
| R7147 |
T11345 |
T11340 |
ccomp |
displayed,is |
| R7148 |
T11346 |
T11347 |
compound |
K14,Snail |
| R7149 |
T11347 |
T11349 |
compound |
Snail,epidermis |
| R715 |
T1540 |
T1539 |
punct |
-,catenin |
| R7150 |
T11348 |
T11347 |
punct |
-,Snail |
| R7151 |
T11349 |
T11345 |
nsubj |
epidermis,displayed |
| R7152 |
T11350 |
T11349 |
compound |
Tg,epidermis |
| R7153 |
T11351 |
T11352 |
det |
a,regulation |
| R7154 |
T11352 |
T11345 |
dobj |
regulation,displayed |
| R7155 |
T11353 |
T11352 |
amod |
marked,regulation |
| R7156 |
T11354 |
T11352 |
amod |
down,regulation |
| R7157 |
T11355 |
T11352 |
punct |
-,regulation |
| R7158 |
T11356 |
T11352 |
prep |
in,regulation |
| R7159 |
T11357 |
T11358 |
compound |
E,cadherin |
| R716 |
T1541 |
T1532 |
punct |
(,factor |
| R7160 |
T11358 |
T11360 |
compound |
cadherin,expression |
| R7161 |
T11359 |
T11358 |
punct |
-,cadherin |
| R7162 |
T11360 |
T11356 |
pobj |
expression,in |
| R7163 |
T11361 |
T11345 |
punct |
", ",displayed |
| R7164 |
T11362 |
T11363 |
advmod |
thereby,demonstrating |
| R7165 |
T11363 |
T11345 |
advcl |
demonstrating,displayed |
| R7166 |
T11364 |
T11365 |
poss |
its,potential |
| R7167 |
T11365 |
T11363 |
dobj |
potential,demonstrating |
| R7168 |
T11366 |
T11367 |
aux |
to,do |
| R7169 |
T11367 |
T11365 |
acl |
do,potential |
| R717 |
T1542 |
T1532 |
appos |
LEF,factor |
| R7170 |
T11368 |
T11367 |
advmod |
so,do |
| R7171 |
T11369 |
T11367 |
prep |
in,do |
| R7172 |
T11370 |
T11369 |
pobj |
skin,in |
| R7173 |
T11371 |
T11340 |
punct |
.,is |
| R7174 |
T11373 |
T11374 |
poss |
Our,findings |
| R7175 |
T11374 |
T11376 |
nsubj |
findings,showed |
| R7176 |
T11375 |
T11374 |
amod |
prior,findings |
| R7177 |
T11377 |
T11378 |
mark |
that,impaired |
| R7178 |
T11378 |
T11376 |
ccomp |
impaired,showed |
| R7179 |
T11379 |
T11378 |
prep |
by,impaired |
| R718 |
T1543 |
T1542 |
punct |
-,LEF |
| R7180 |
T11380 |
T11379 |
pcomp |
elevating,by |
| R7181 |
T11381 |
T11382 |
compound |
E,cadherin |
| R7182 |
T11382 |
T11384 |
compound |
cadherin,levels |
| R7183 |
T11383 |
T11382 |
punct |
-,cadherin |
| R7184 |
T11384 |
T11380 |
dobj |
levels,elevating |
| R7185 |
T11385 |
T11379 |
cc |
or,by |
| R7186 |
T11386 |
T11379 |
conj |
by,by |
| R7187 |
T11387 |
T11388 |
advmod |
conditionally,ablating |
| R7188 |
T11388 |
T11386 |
pcomp |
ablating,by |
| R7189 |
T11389 |
T11390 |
compound |
α,catenin |
| R719 |
T1544 |
T1542 |
nummod |
1,LEF |
| R7190 |
T11390 |
T11388 |
dobj |
catenin,ablating |
| R7191 |
T11391 |
T11390 |
punct |
-,catenin |
| R7192 |
T11392 |
T11378 |
punct |
", ",impaired |
| R7193 |
T11393 |
T11394 |
compound |
hair,follicle |
| R7194 |
T11394 |
T11395 |
compound |
follicle,morphogenesis |
| R7195 |
T11395 |
T11378 |
nsubjpass |
morphogenesis,impaired |
| R7196 |
T11396 |
T11378 |
aux |
can,impaired |
| R7197 |
T11397 |
T11378 |
auxpass |
be,impaired |
| R7198 |
T11398 |
T11399 |
punct |
[,7 |
| R7199 |
T11399 |
T11376 |
parataxis |
7,showed |
| R72 |
T224 |
T223 |
pobj |
cells,of |
| R720 |
T1545 |
T1542 |
punct |
/,LEF |
| R7200 |
T11400 |
T11399 |
nummod |
4,7 |
| R7201 |
T11401 |
T11399 |
punct |
",",7 |
| R7202 |
T11402 |
T11399 |
punct |
],7 |
| R7203 |
T11403 |
T11376 |
punct |
.,showed |
| R7204 |
T11405 |
T11406 |
det |
The,hyperproliferation |
| R7205 |
T11406 |
T11409 |
nsubj |
hyperproliferation,led |
| R7206 |
T11407 |
T11406 |
amod |
marked,hyperproliferation |
| R7207 |
T11408 |
T11406 |
amod |
epidermal,hyperproliferation |
| R7208 |
T11410 |
T11406 |
acl |
seen,hyperproliferation |
| R7209 |
T11411 |
T11410 |
prep |
in,seen |
| R721 |
T1546 |
T1547 |
compound |
β,catenin |
| R7210 |
T11412 |
T11413 |
det |
the,skin |
| R7211 |
T11413 |
T11411 |
pobj |
skin,in |
| R7212 |
T11414 |
T11415 |
compound |
K14,Snail |
| R7213 |
T11415 |
T11413 |
compound |
Snail,skin |
| R7214 |
T11416 |
T11415 |
punct |
-,Snail |
| R7215 |
T11417 |
T11413 |
compound |
Tg,skin |
| R7216 |
T11418 |
T11406 |
punct |
", ",hyperproliferation |
| R7217 |
T11419 |
T11406 |
acl |
coupled,hyperproliferation |
| R7218 |
T11420 |
T11419 |
prep |
with,coupled |
| R7219 |
T11421 |
T11422 |
det |
the,suppression |
| R722 |
T1547 |
T1542 |
appos |
catenin,LEF |
| R7220 |
T11422 |
T11420 |
pobj |
suppression,with |
| R7221 |
T11423 |
T11422 |
amod |
converse,suppression |
| R7222 |
T11424 |
T11422 |
prep |
of,suppression |
| R7223 |
T11425 |
T11424 |
pobj |
proliferation,of |
| R7224 |
T11426 |
T11425 |
cc |
and,proliferation |
| R7225 |
T11427 |
T11425 |
conj |
Snail,proliferation |
| R7226 |
T11428 |
T11422 |
prep |
in,suppression |
| R7227 |
T11429 |
T11430 |
compound |
TGF,β2 |
| R7228 |
T11430 |
T11432 |
npadvmod |
β2,null |
| R7229 |
T11431 |
T11430 |
punct |
-,β2 |
| R723 |
T1548 |
T1547 |
punct |
-,catenin |
| R7230 |
T11432 |
T11434 |
amod |
null,buds |
| R7231 |
T11433 |
T11432 |
punct |
-,null |
| R7232 |
T11434 |
T11428 |
pobj |
buds,in |
| R7233 |
T11435 |
T11434 |
compound |
hair,buds |
| R7234 |
T11436 |
T11409 |
dobj |
us,led |
| R7235 |
T11437 |
T11438 |
aux |
to,wonder |
| R7236 |
T11438 |
T11409 |
xcomp |
wonder,led |
| R7237 |
T11439 |
T11440 |
mark |
whether,have |
| R7238 |
T11440 |
T11438 |
ccomp |
have,wonder |
| R7239 |
T11441 |
T11442 |
det |
the,regulation |
| R724 |
T1549 |
T1534 |
punct |
),mediated |
| R7240 |
T11442 |
T11440 |
nsubj |
regulation,have |
| R7241 |
T11443 |
T11442 |
amod |
down,regulation |
| R7242 |
T11444 |
T11442 |
punct |
-,regulation |
| R7243 |
T11445 |
T11442 |
prep |
of,regulation |
| R7244 |
T11446 |
T11447 |
compound |
E,cadherin |
| R7245 |
T11447 |
T11445 |
pobj |
cadherin,of |
| R7246 |
T11448 |
T11447 |
punct |
-,cadherin |
| R7247 |
T11449 |
T11442 |
prep |
during,regulation |
| R7248 |
T11450 |
T11451 |
compound |
follicle,morphogenesis |
| R7249 |
T11451 |
T11449 |
pobj |
morphogenesis,during |
| R725 |
T1550 |
T1534 |
punct |
-,mediated |
| R7250 |
T11452 |
T11440 |
aux |
might,have |
| R7251 |
T11453 |
T11454 |
det |
a,impact |
| R7252 |
T11454 |
T11440 |
dobj |
impact,have |
| R7253 |
T11455 |
T11454 |
amod |
direct,impact |
| R7254 |
T11456 |
T11454 |
prep |
on,impact |
| R7255 |
T11457 |
T11456 |
pcomp |
elevating,on |
| R7256 |
T11458 |
T11459 |
det |
the,state |
| R7257 |
T11459 |
T11457 |
dobj |
state,elevating |
| R7258 |
T11460 |
T11459 |
amod |
proliferative,state |
| R7259 |
T11461 |
T11459 |
prep |
of,state |
| R726 |
T1551 |
T1530 |
dobj |
transcription,induce |
| R7260 |
T11462 |
T11463 |
det |
these,cells |
| R7261 |
T11463 |
T11461 |
pobj |
cells,of |
| R7262 |
T11464 |
T11409 |
punct |
.,led |
| R7263 |
T11466 |
T11467 |
poss |
Our,studies |
| R7264 |
T11467 |
T11469 |
nsubj |
studies,suggested |
| R7265 |
T11468 |
T11467 |
compound |
Tg,studies |
| R7266 |
T11470 |
T11471 |
mark |
that,is |
| R7267 |
T11471 |
T11469 |
ccomp |
is,suggested |
| R7268 |
T11472 |
T11471 |
punct |
", ",is |
| R7269 |
T11473 |
T11474 |
advmod |
at,least |
| R727 |
T1552 |
T1551 |
compound |
gene,transcription |
| R7270 |
T11474 |
T11475 |
advmod |
least,in |
| R7271 |
T11475 |
T11476 |
prep |
in,through |
| R7272 |
T11476 |
T11471 |
prep |
through,is |
| R7273 |
T11477 |
T11475 |
pobj |
part,in |
| R7274 |
T11478 |
T11479 |
poss |
its,regulation |
| R7275 |
T11479 |
T11476 |
pobj |
regulation,through |
| R7276 |
T11480 |
T11479 |
prep |
of,regulation |
| R7277 |
T11481 |
T11482 |
compound |
E,cadherin |
| R7278 |
T11482 |
T11480 |
pobj |
cadherin,of |
| R7279 |
T11483 |
T11482 |
punct |
-,cadherin |
| R728 |
T1553 |
T1530 |
prep |
within,induce |
| R7280 |
T11484 |
T11471 |
punct |
", ",is |
| R7281 |
T11485 |
T11471 |
nsubj |
Snail,is |
| R7282 |
T11486 |
T11471 |
acomp |
able,is |
| R7283 |
T11487 |
T11488 |
aux |
to,influence |
| R7284 |
T11488 |
T11486 |
xcomp |
influence,able |
| R7285 |
T11489 |
T11490 |
det |
the,localization |
| R7286 |
T11490 |
T11488 |
dobj |
localization,influence |
| R7287 |
T11491 |
T11490 |
amod |
subcellular,localization |
| R7288 |
T11492 |
T11490 |
prep |
of,localization |
| R7289 |
T11493 |
T11494 |
det |
a,variety |
| R729 |
T1554 |
T1555 |
det |
the,placode |
| R7290 |
T11494 |
T11492 |
pobj |
variety,of |
| R7291 |
T11495 |
T11494 |
prep |
of,variety |
| R7292 |
T11496 |
T11497 |
npadvmod |
AJ,associated |
| R7293 |
T11497 |
T11499 |
amod |
associated,proteins |
| R7294 |
T11498 |
T11497 |
punct |
-,associated |
| R7295 |
T11499 |
T11495 |
pobj |
proteins,of |
| R7296 |
T11500 |
T11469 |
punct |
.,suggested |
| R7297 |
T11502 |
T11503 |
nsubj |
One,appears |
| R7298 |
T11504 |
T11502 |
prep |
of,One |
| R7299 |
T11505 |
T11504 |
pobj |
these,of |
| R73 |
T225 |
T222 |
acl |
involved,cluster |
| R730 |
T1555 |
T1553 |
pobj |
placode,within |
| R7300 |
T11506 |
T11507 |
aux |
to,be |
| R7301 |
T11507 |
T11503 |
xcomp |
be,appears |
| R7302 |
T11508 |
T11507 |
attr |
Ajuba,be |
| R7303 |
T11509 |
T11508 |
punct |
", ",Ajuba |
| R7304 |
T11510 |
T11511 |
dep |
which,shown |
| R7305 |
T11511 |
T11508 |
relcl |
shown,Ajuba |
| R7306 |
T11512 |
T11511 |
auxpass |
was,shown |
| R7307 |
T11513 |
T11511 |
advmod |
previously,shown |
| R7308 |
T11514 |
T11515 |
aux |
to,have |
| R7309 |
T11515 |
T11511 |
xcomp |
have,shown |
| R731 |
T1556 |
T1555 |
compound |
follicle,placode |
| R7310 |
T11516 |
T11517 |
det |
the,capacity |
| R7311 |
T11517 |
T11515 |
dobj |
capacity,have |
| R7312 |
T11518 |
T11517 |
amod |
dual,capacity |
| R7313 |
T11519 |
T11520 |
aux |
to,bind |
| R7314 |
T11520 |
T11517 |
acl |
bind,capacity |
| R7315 |
T11521 |
T11520 |
dobj |
Grb,bind |
| R7316 |
T11522 |
T11521 |
punct |
-,Grb |
| R7317 |
T11523 |
T11521 |
nummod |
2,Grb |
| R7318 |
T11524 |
T11525 |
advmod |
as,as |
| R7319 |
T11525 |
T11521 |
cc |
as,Grb |
| R732 |
T1557 |
T1558 |
punct |
[,4 |
| R7320 |
T11526 |
T11525 |
advmod |
well,as |
| R7321 |
T11527 |
T11528 |
compound |
α,catenin |
| R7322 |
T11528 |
T11521 |
conj |
catenin,Grb |
| R7323 |
T11529 |
T11528 |
punct |
-,catenin |
| R7324 |
T11530 |
T11531 |
punct |
[,10 |
| R7325 |
T11531 |
T11503 |
parataxis |
10,appears |
| R7326 |
T11532 |
T11531 |
nummod |
9,10 |
| R7327 |
T11533 |
T11531 |
punct |
",",10 |
| R7328 |
T11534 |
T11531 |
punct |
],10 |
| R7329 |
T11535 |
T11503 |
punct |
.,appears |
| R733 |
T1558 |
T1506 |
parataxis |
4,delineated |
| R7330 |
T11537 |
T11538 |
poss |
Our,studies |
| R7331 |
T11538 |
T11539 |
nsubj |
studies,revealed |
| R7332 |
T11540 |
T11541 |
mark |
that,develops |
| R7333 |
T11541 |
T11539 |
ccomp |
develops,revealed |
| R7334 |
T11542 |
T11541 |
prep |
in,develops |
| R7335 |
T11543 |
T11544 |
compound |
skin,keratinocytes |
| R7336 |
T11544 |
T11542 |
pobj |
keratinocytes,in |
| R7337 |
T11545 |
T11546 |
dep |
that,harbor |
| R7338 |
T11546 |
T11544 |
advcl |
harbor,keratinocytes |
| R7339 |
T11547 |
T11546 |
preconj |
either,harbor |
| R734 |
T1559 |
T1558 |
punct |
],4 |
| R7340 |
T11548 |
T11549 |
det |
a,mutation |
| R7341 |
T11549 |
T11546 |
dobj |
mutation,harbor |
| R7342 |
T11550 |
T11549 |
amod |
conditional,mutation |
| R7343 |
T11551 |
T11549 |
amod |
null,mutation |
| R7344 |
T11552 |
T11546 |
prep |
in,harbor |
| R7345 |
T11553 |
T11554 |
compound |
α,catenin |
| R7346 |
T11554 |
T11552 |
pobj |
catenin,in |
| R7347 |
T11555 |
T11554 |
punct |
-,catenin |
| R7348 |
T11556 |
T11546 |
cc |
or,harbor |
| R7349 |
T11557 |
T11558 |
dep |
that,overexpress |
| R735 |
T1560 |
T1506 |
punct |
.,delineated |
| R7350 |
T11558 |
T11546 |
conj |
overexpress,harbor |
| R7351 |
T11559 |
T11558 |
dobj |
Snail,overexpress |
| R7352 |
T11560 |
T11541 |
punct |
", ",develops |
| R7353 |
T11561 |
T11541 |
nsubj |
Ajuba,develops |
| R7354 |
T11562 |
T11563 |
det |
an,interaction |
| R7355 |
T11563 |
T11541 |
dobj |
interaction,develops |
| R7356 |
T11564 |
T11563 |
prep |
with,interaction |
| R7357 |
T11565 |
T11564 |
pobj |
Grb,with |
| R7358 |
T11566 |
T11565 |
punct |
-,Grb |
| R7359 |
T11567 |
T11565 |
nummod |
2,Grb |
| R736 |
T1562 |
T1563 |
det |
The,changes |
| R7360 |
T11568 |
T11569 |
dep |
that,observed |
| R7361 |
T11569 |
T11563 |
relcl |
observed,interaction |
| R7362 |
T11570 |
T11569 |
auxpass |
is,observed |
| R7363 |
T11571 |
T11569 |
advmod |
otherwise,observed |
| R7364 |
T11572 |
T11569 |
neg |
not,observed |
| R7365 |
T11573 |
T11569 |
prep |
in,observed |
| R7366 |
T11574 |
T11575 |
compound |
WT,keratinocytes |
| R7367 |
T11575 |
T11573 |
pobj |
keratinocytes,in |
| R7368 |
T11576 |
T11539 |
punct |
.,revealed |
| R7369 |
T11578 |
T11579 |
det |
The,abilities |
| R737 |
T1563 |
T1565 |
nsubj |
changes,include |
| R7370 |
T11579 |
T11581 |
nsubj |
abilities,suggest |
| R7371 |
T11580 |
T11579 |
amod |
corresponding,abilities |
| R7372 |
T11582 |
T11579 |
prep |
of,abilities |
| R7373 |
T11583 |
T11584 |
preconj |
either,keratinocytes |
| R7374 |
T11584 |
T11582 |
pobj |
keratinocytes,of |
| R7375 |
T11585 |
T11586 |
npadvmod |
Snail,transfected |
| R7376 |
T11586 |
T11584 |
amod |
transfected,keratinocytes |
| R7377 |
T11587 |
T11586 |
punct |
-,transfected |
| R7378 |
T11588 |
T11586 |
cc |
or,transfected |
| R7379 |
T11589 |
T11590 |
npadvmod |
Ajuba,transfected |
| R738 |
T1564 |
T1563 |
amod |
downstream,changes |
| R7380 |
T11590 |
T11586 |
conj |
transfected,transfected |
| R7381 |
T11591 |
T11590 |
punct |
-,transfected |
| R7382 |
T11592 |
T11593 |
aux |
to,exhibit |
| R7383 |
T11593 |
T11579 |
acl |
exhibit,abilities |
| R7384 |
T11594 |
T11595 |
amod |
elevated,activation |
| R7385 |
T11595 |
T11593 |
dobj |
activation,exhibit |
| R7386 |
T11596 |
T11595 |
prep |
of,activation |
| R7387 |
T11597 |
T11598 |
det |
the,pathway |
| R7388 |
T11598 |
T11596 |
pobj |
pathway,of |
| R7389 |
T11599 |
T11600 |
compound |
Ras,MAPK |
| R739 |
T1566 |
T1563 |
acl |
elicited,changes |
| R7390 |
T11600 |
T11598 |
compound |
MAPK,pathway |
| R7391 |
T11601 |
T11600 |
punct |
-,MAPK |
| R7392 |
T11602 |
T11603 |
mark |
that,be |
| R7393 |
T11603 |
T11581 |
ccomp |
be,suggest |
| R7394 |
T11604 |
T11605 |
det |
the,association |
| R7395 |
T11605 |
T11603 |
nsubj |
association,be |
| R7396 |
T11606 |
T11605 |
nmod |
Grb,association |
| R7397 |
T11607 |
T11606 |
punct |
-,Grb |
| R7398 |
T11608 |
T11606 |
nummod |
2,Grb |
| R7399 |
T11609 |
T11605 |
prep |
of,association |
| R74 |
T226 |
T190 |
punct |
.,employed |
| R740 |
T1567 |
T1566 |
prep |
through,elicited |
| R7400 |
T11610 |
T11609 |
pobj |
Ajuba,of |
| R7401 |
T11611 |
T11603 |
prep |
under,be |
| R7402 |
T11612 |
T11611 |
pobj |
conditions,under |
| R7403 |
T11613 |
T11612 |
prep |
of,conditions |
| R7404 |
T11614 |
T11615 |
amod |
reduced,levels |
| R7405 |
T11615 |
T11613 |
pobj |
levels,of |
| R7406 |
T11616 |
T11615 |
prep |
of,levels |
| R7407 |
T11617 |
T11618 |
compound |
AJ,proteins |
| R7408 |
T11618 |
T11616 |
pobj |
proteins,of |
| R7409 |
T11619 |
T11603 |
aux |
may,be |
| R741 |
T1568 |
T1567 |
pobj |
convergence,through |
| R7410 |
T11620 |
T11621 |
advmod |
directly,relevant |
| R7411 |
T11621 |
T11603 |
acomp |
relevant,be |
| R7412 |
T11622 |
T11621 |
prep |
to,relevant |
| R7413 |
T11623 |
T11624 |
det |
the,parallel |
| R7414 |
T11624 |
T11622 |
pobj |
parallel,to |
| R7415 |
T11625 |
T11624 |
prep |
in,parallel |
| R7416 |
T11626 |
T11625 |
pobj |
hyperproliferation,in |
| R7417 |
T11627 |
T11581 |
punct |
.,suggest |
| R7418 |
T11629 |
T11630 |
prep |
In,shown |
| R7419 |
T11631 |
T11632 |
amod |
stable,lines |
| R742 |
T1569 |
T1568 |
prep |
of,convergence |
| R7420 |
T11632 |
T11629 |
pobj |
lines,In |
| R7421 |
T11633 |
T11632 |
amod |
epithelial,lines |
| R7422 |
T11634 |
T11635 |
punct |
(,kidney |
| R7423 |
T11635 |
T11632 |
parataxis |
kidney,lines |
| R7424 |
T11636 |
T11635 |
advmod |
i.e.,kidney |
| R7425 |
T11637 |
T11635 |
punct |
", ",kidney |
| R7426 |
T11638 |
T11639 |
nmod |
Madin,Darby |
| R7427 |
T11639 |
T11635 |
nmod |
Darby,kidney |
| R7428 |
T11640 |
T11639 |
punct |
-,Darby |
| R7429 |
T11641 |
T11635 |
amod |
canine,kidney |
| R743 |
T1675 |
T1677 |
compound |
cell,contact |
| R7430 |
T11642 |
T11635 |
punct |
", ",kidney |
| R7431 |
T11643 |
T11635 |
cc |
or,kidney |
| R7432 |
T11644 |
T11635 |
conj |
MDCK,kidney |
| R7433 |
T11645 |
T11635 |
punct |
),kidney |
| R7434 |
T11646 |
T11632 |
compound |
cell,lines |
| R7435 |
T11647 |
T11630 |
punct |
", ",shown |
| R7436 |
T11648 |
T11630 |
nsubjpass |
Snail,shown |
| R7437 |
T11649 |
T11630 |
aux |
has,shown |
| R7438 |
T11650 |
T11630 |
auxpass |
been,shown |
| R7439 |
T11651 |
T11652 |
aux |
to,block |
| R744 |
T1676 |
T1675 |
punct |
-,cell |
| R7440 |
T11652 |
T11630 |
xcomp |
block,shown |
| R7441 |
T11653 |
T11654 |
compound |
cell,cycle |
| R7442 |
T11654 |
T11655 |
compound |
cycle,progression |
| R7443 |
T11655 |
T11652 |
dobj |
progression,block |
| R7444 |
T11656 |
T11652 |
cc |
and,block |
| R7445 |
T11657 |
T11652 |
conj |
promote,block |
| R7446 |
T11658 |
T11659 |
nmod |
motility,changes |
| R7447 |
T11659 |
T11657 |
dobj |
changes,promote |
| R7448 |
T11660 |
T11658 |
cc |
and,motility |
| R7449 |
T11661 |
T11658 |
conj |
shape,motility |
| R745 |
T1677 |
T1673 |
pobj |
contact,of |
| R7450 |
T11662 |
T11657 |
prep |
for,promote |
| R7451 |
T11663 |
T11662 |
pobj |
invasion,for |
| R7452 |
T11664 |
T11665 |
punct |
[,47 |
| R7453 |
T11665 |
T11630 |
parataxis |
47,shown |
| R7454 |
T11666 |
T11665 |
punct |
],47 |
| R7455 |
T11667 |
T11630 |
punct |
.,shown |
| R7456 |
T11669 |
T11670 |
mark |
While,are |
| R7457 |
T11670 |
T11675 |
advcl |
are,differ |
| R7458 |
T11671 |
T11672 |
poss |
our,studies |
| R7459 |
T11672 |
T11670 |
nsubj |
studies,are |
| R746 |
T1678 |
T1671 |
punct |
", ",recruit |
| R7460 |
T11673 |
T11674 |
advmod |
in,vivo |
| R7461 |
T11674 |
T11672 |
amod |
vivo,studies |
| R7462 |
T11676 |
T11670 |
acomp |
consistent,are |
| R7463 |
T11677 |
T11676 |
prep |
with,consistent |
| R7464 |
T11678 |
T11679 |
det |
a,role |
| R7465 |
T11679 |
T11677 |
pobj |
role,with |
| R7466 |
T11680 |
T11679 |
prep |
for,role |
| R7467 |
T11681 |
T11680 |
pobj |
Snail,for |
| R7468 |
T11682 |
T11679 |
prep |
in,role |
| R7469 |
T11683 |
T11684 |
nmod |
motility,remodeling |
| R747 |
T1679 |
T1671 |
advmod |
however,recruit |
| R7470 |
T11684 |
T11682 |
pobj |
remodeling,in |
| R7471 |
T11685 |
T11683 |
cc |
and,motility |
| R7472 |
T11686 |
T11683 |
conj |
epithelial,motility |
| R7473 |
T11687 |
T11675 |
punct |
", ",differ |
| R7474 |
T11688 |
T11675 |
nsubj |
they,differ |
| R7475 |
T11689 |
T11675 |
prep |
with,differ |
| R7476 |
T11690 |
T11689 |
pobj |
respect,with |
| R7477 |
T11691 |
T11690 |
prep |
to,respect |
| R7478 |
T11692 |
T11693 |
poss |
Snail,effects |
| R7479 |
T11693 |
T11691 |
pobj |
effects,to |
| R748 |
T1570 |
T1571 |
det |
these,pathways |
| R7480 |
T11694 |
T11692 |
case |
's,Snail |
| R7481 |
T11695 |
T11693 |
amod |
apparent,effects |
| R7482 |
T11696 |
T11693 |
amod |
proliferative,effects |
| R7483 |
T11697 |
T11675 |
punct |
.,differ |
| R7484 |
T11699 |
T11700 |
advmod |
A,priori |
| R7485 |
T11700 |
T11701 |
advmod |
priori,be |
| R7486 |
T11702 |
T11701 |
punct |
", ",be |
| R7487 |
T11703 |
T11701 |
nsubj |
this,be |
| R7488 |
T11704 |
T11701 |
aux |
could,be |
| R7489 |
T11705 |
T11701 |
advmod |
simply,be |
| R749 |
T1680 |
T1671 |
punct |
", ",recruit |
| R7490 |
T11706 |
T11701 |
prep |
due,be |
| R7491 |
T11707 |
T11706 |
pcomp |
to,due |
| R7492 |
T11708 |
T11706 |
pobj |
variations,due |
| R7493 |
T11709 |
T11708 |
prep |
in,variations |
| R7494 |
T11710 |
T11711 |
det |
the,response |
| R7495 |
T11711 |
T11709 |
pobj |
response,in |
| R7496 |
T11712 |
T11711 |
prep |
of,response |
| R7497 |
T11713 |
T11714 |
amod |
different,types |
| R7498 |
T11714 |
T11712 |
pobj |
types,of |
| R7499 |
T11715 |
T11714 |
compound |
cell,types |
| R75 |
T228 |
T229 |
nsubj |
We,found |
| R750 |
T1571 |
T1569 |
pobj |
pathways,of |
| R7500 |
T11716 |
T11711 |
prep |
to,response |
| R7501 |
T11717 |
T11718 |
compound |
Snail,expression |
| R7502 |
T11718 |
T11716 |
pobj |
expression,to |
| R7503 |
T11719 |
T11701 |
punct |
.,be |
| R7504 |
T11721 |
T11722 |
advmod |
Alternatively,be |
| R7505 |
T11723 |
T11722 |
punct |
", ",be |
| R7506 |
T11724 |
T11725 |
det |
these,differences |
| R7507 |
T11725 |
T11722 |
nsubj |
differences,be |
| R7508 |
T11726 |
T11722 |
aux |
may,be |
| R7509 |
T11727 |
T11722 |
acomp |
relevant,be |
| R751 |
T1681 |
T1682 |
nmod |
E,cadherin |
| R7510 |
T11728 |
T11727 |
prep |
to,relevant |
| R7511 |
T11729 |
T11730 |
det |
the,benefit |
| R7512 |
T11730 |
T11728 |
pobj |
benefit,to |
| R7513 |
T11731 |
T11730 |
prep |
of,benefit |
| R7514 |
T11732 |
T11731 |
pcomp |
using,of |
| R7515 |
T11733 |
T11734 |
compound |
mouse,models |
| R7516 |
T11734 |
T11732 |
dobj |
models,using |
| R7517 |
T11735 |
T11736 |
aux |
to,reveal |
| R7518 |
T11736 |
T11732 |
advcl |
reveal,using |
| R7519 |
T11737 |
T11736 |
dobj |
functions,reveal |
| R752 |
T1572 |
T1571 |
nummod |
two,pathways |
| R7520 |
T11738 |
T11739 |
neg |
not,recapitulated |
| R7521 |
T11739 |
T11737 |
acl |
recapitulated,functions |
| R7522 |
T11740 |
T11739 |
advmod |
always,recapitulated |
| R7523 |
T11741 |
T11739 |
prep |
in,recapitulated |
| R7524 |
T11742 |
T11743 |
amod |
stable,models |
| R7525 |
T11743 |
T11741 |
pobj |
models,in |
| R7526 |
T11744 |
T11745 |
compound |
cell,line |
| R7527 |
T11745 |
T11743 |
compound |
line,models |
| R7528 |
T11746 |
T11722 |
punct |
.,be |
| R7529 |
T11748 |
T11749 |
amod |
Future,studies |
| R753 |
T1573 |
T1571 |
amod |
early,pathways |
| R7530 |
T11749 |
T11750 |
nsubj |
studies,highlight |
| R7531 |
T11751 |
T11750 |
aux |
should,highlight |
| R7532 |
T11752 |
T11753 |
det |
the,reasons |
| R7533 |
T11753 |
T11750 |
dobj |
reasons,highlight |
| R7534 |
T11754 |
T11753 |
amod |
underlying,reasons |
| R7535 |
T11755 |
T11753 |
prep |
for,reasons |
| R7536 |
T11756 |
T11757 |
det |
these,results |
| R7537 |
T11757 |
T11755 |
pobj |
results,for |
| R7538 |
T11758 |
T11757 |
amod |
opposing,results |
| R7539 |
T11759 |
T11750 |
punct |
.,highlight |
| R754 |
T1682 |
T1684 |
nmod |
cadherin,complexes |
| R7540 |
T11761 |
T11762 |
advcl |
Irrespective,stand |
| R7541 |
T11763 |
T11761 |
prep |
of,Irrespective |
| R7542 |
T11764 |
T11765 |
det |
these,differences |
| R7543 |
T11765 |
T11763 |
pobj |
differences,of |
| R7544 |
T11766 |
T11762 |
punct |
", ",stand |
| R7545 |
T11767 |
T11768 |
poss |
our,studies |
| R7546 |
T11768 |
T11762 |
nsubj |
studies,stand |
| R7547 |
T11769 |
T11770 |
advmod |
in,vivo |
| R7548 |
T11770 |
T11768 |
amod |
vivo,studies |
| R7549 |
T11771 |
T11762 |
aux |
do,stand |
| R755 |
T1574 |
T1571 |
compound |
signaling,pathways |
| R7550 |
T11772 |
T11762 |
neg |
not,stand |
| R7551 |
T11773 |
T11762 |
advmod |
alone,stand |
| R7552 |
T11774 |
T11762 |
punct |
", ",stand |
| R7553 |
T11775 |
T11776 |
mark |
as,are |
| R7554 |
T11776 |
T11762 |
advcl |
are,stand |
| R7555 |
T11777 |
T11776 |
expl |
there,are |
| R7556 |
T11778 |
T11779 |
amod |
many,situations |
| R7557 |
T11779 |
T11776 |
attr |
situations,are |
| R7558 |
T11780 |
T11781 |
prep |
in,correlate |
| R7559 |
T11781 |
T11779 |
relcl |
correlate,situations |
| R756 |
T1575 |
T1576 |
amod |
down,regulation |
| R7560 |
T11782 |
T11780 |
pobj |
which,in |
| R7561 |
T11783 |
T11784 |
det |
a,regulation |
| R7562 |
T11784 |
T11781 |
nsubj |
regulation,correlate |
| R7563 |
T11785 |
T11784 |
amod |
down,regulation |
| R7564 |
T11786 |
T11784 |
punct |
-,regulation |
| R7565 |
T11787 |
T11784 |
prep |
in,regulation |
| R7566 |
T11788 |
T11789 |
compound |
AJ,proteins |
| R7567 |
T11789 |
T11787 |
pobj |
proteins,in |
| R7568 |
T11790 |
T11781 |
prep |
with,correlate |
| R7569 |
T11791 |
T11792 |
amod |
enhanced,proliferation |
| R757 |
T1683 |
T1682 |
punct |
-,cadherin |
| R7570 |
T11792 |
T11790 |
pobj |
proliferation,with |
| R7571 |
T11793 |
T11762 |
punct |
.,stand |
| R7572 |
T11795 |
T11796 |
prep |
In,implicated |
| R7573 |
T11797 |
T11795 |
pobj |
fact,In |
| R7574 |
T11798 |
T11796 |
punct |
", ",implicated |
| R7575 |
T11799 |
T11800 |
det |
a,myriad |
| R7576 |
T11800 |
T11796 |
nsubjpass |
myriad,implicated |
| R7577 |
T11801 |
T11800 |
prep |
of,myriad |
| R7578 |
T11802 |
T11803 |
amod |
diverse,mechanisms |
| R7579 |
T11803 |
T11801 |
pobj |
mechanisms,of |
| R758 |
T1576 |
T1565 |
dobj |
regulation,include |
| R7580 |
T11804 |
T11796 |
aux |
have,implicated |
| R7581 |
T11805 |
T11796 |
auxpass |
been,implicated |
| R7582 |
T11806 |
T11796 |
prep |
in,implicated |
| R7583 |
T11807 |
T11806 |
pcomp |
activating,in |
| R7584 |
T11808 |
T11809 |
amod |
epithelial,proliferation |
| R7585 |
T11809 |
T11807 |
dobj |
proliferation,activating |
| R7586 |
T11810 |
T11807 |
prep |
upon,activating |
| R7587 |
T11811 |
T11812 |
amod |
down,regulation |
| R7588 |
T11812 |
T11810 |
pobj |
regulation,upon |
| R7589 |
T11813 |
T11812 |
punct |
-,regulation |
| R759 |
T1577 |
T1576 |
punct |
-,regulation |
| R7590 |
T11814 |
T11812 |
prep |
of,regulation |
| R7591 |
T11815 |
T11816 |
compound |
AJ,proteins |
| R7592 |
T11816 |
T11814 |
pobj |
proteins,of |
| R7593 |
T11817 |
T11818 |
punct |
[,48 |
| R7594 |
T11818 |
T11796 |
parataxis |
48,implicated |
| R7595 |
T11819 |
T11818 |
nummod |
7,48 |
| R7596 |
T11820 |
T11818 |
punct |
",",48 |
| R7597 |
T11821 |
T11818 |
nummod |
23,48 |
| R7598 |
T11822 |
T11818 |
punct |
",",48 |
| R7599 |
T11823 |
T11818 |
nummod |
24,48 |
| R76 |
T230 |
T231 |
mark |
that,is |
| R760 |
T1578 |
T1576 |
prep |
of,regulation |
| R7600 |
T11824 |
T11818 |
punct |
",",48 |
| R7601 |
T11825 |
T11818 |
punct |
],48 |
| R7602 |
T11826 |
T11796 |
punct |
.,implicated |
| R7603 |
T11828 |
T11829 |
csubj |
Sifting,is |
| R7604 |
T11830 |
T11828 |
prep |
through,Sifting |
| R7605 |
T11831 |
T11832 |
det |
these,pathways |
| R7606 |
T11832 |
T11830 |
pobj |
pathways,through |
| R7607 |
T11833 |
T11832 |
amod |
converging,pathways |
| R7608 |
T11834 |
T11829 |
acomp |
likely,is |
| R7609 |
T11835 |
T11836 |
aux |
to,be |
| R761 |
T1684 |
T1671 |
nsubj |
complexes,recruit |
| R7610 |
T11836 |
T11834 |
xcomp |
be,likely |
| R7611 |
T11837 |
T11838 |
det |
a,process |
| R7612 |
T11838 |
T11836 |
attr |
process,be |
| R7613 |
T11839 |
T11838 |
amod |
difficult,process |
| R7614 |
T11840 |
T11839 |
cc |
and,difficult |
| R7615 |
T11841 |
T11839 |
conj |
painstaking,difficult |
| R7616 |
T11842 |
T11829 |
punct |
.,is |
| R7617 |
T11844 |
T11845 |
nsubj |
This,said |
| R7618 |
T11845 |
T11846 |
advcl |
said,begin |
| R7619 |
T11847 |
T11846 |
punct |
", ",begin |
| R762 |
T1579 |
T1580 |
det |
the,gene |
| R7620 |
T11848 |
T11846 |
prep |
by,begin |
| R7621 |
T11849 |
T11848 |
pcomp |
identifying,by |
| R7622 |
T11850 |
T11851 |
det |
the,status |
| R7623 |
T11851 |
T11849 |
dobj |
status,identifying |
| R7624 |
T11852 |
T11851 |
prep |
of,status |
| R7625 |
T11853 |
T11854 |
amod |
different,players |
| R7626 |
T11854 |
T11852 |
pobj |
players,of |
| R7627 |
T11855 |
T11854 |
acl |
involved,players |
| R7628 |
T11856 |
T11849 |
prep |
in,identifying |
| R7629 |
T11857 |
T11858 |
amod |
specific,types |
| R763 |
T1580 |
T1578 |
pobj |
gene,of |
| R7630 |
T11858 |
T11856 |
pobj |
types,in |
| R7631 |
T11859 |
T11858 |
compound |
cell,types |
| R7632 |
T11860 |
T11856 |
cc |
and,in |
| R7633 |
T11861 |
T11856 |
conj |
at,in |
| R7634 |
T11862 |
T11863 |
amod |
specific,stages |
| R7635 |
T11863 |
T11861 |
pobj |
stages,at |
| R7636 |
T11864 |
T11863 |
prep |
in,stages |
| R7637 |
T11865 |
T11864 |
pobj |
development,in |
| R7638 |
T11866 |
T11846 |
punct |
", ",begin |
| R7639 |
T11867 |
T11868 |
poss |
our,understanding |
| R764 |
T1685 |
T1682 |
punct |
-,cadherin |
| R7640 |
T11868 |
T11846 |
nsubj |
understanding,begin |
| R7641 |
T11869 |
T11868 |
amod |
mechanistic,understanding |
| R7642 |
T11870 |
T11868 |
prep |
of,understanding |
| R7643 |
T11871 |
T11872 |
advmod |
how,linked |
| R7644 |
T11872 |
T11870 |
pcomp |
linked,of |
| R7645 |
T11873 |
T11874 |
amod |
intercellular,remodeling |
| R7646 |
T11874 |
T11872 |
nsubjpass |
remodeling,linked |
| R7647 |
T11875 |
T11872 |
auxpass |
is,linked |
| R7648 |
T11876 |
T11872 |
prep |
to,linked |
| R7649 |
T11877 |
T11876 |
pobj |
proliferation,to |
| R765 |
T1581 |
T1580 |
acl |
encoding,gene |
| R7650 |
T11878 |
T11872 |
prep |
in,linked |
| R7651 |
T11879 |
T11880 |
amod |
epithelial,morphogenesis |
| R7652 |
T11880 |
T11878 |
pobj |
morphogenesis,in |
| R7653 |
T11881 |
T11846 |
aux |
should,begin |
| R7654 |
T11882 |
T11883 |
aux |
to,surface |
| R7655 |
T11883 |
T11846 |
xcomp |
surface,begin |
| R7656 |
T11884 |
T11883 |
prep |
in,surface |
| R7657 |
T11885 |
T11886 |
det |
the,future |
| R7658 |
T11886 |
T11884 |
pobj |
future,in |
| R7659 |
T11887 |
T11846 |
punct |
.,begin |
| R766 |
T1582 |
T1583 |
compound |
E,cadherin |
| R7660 |
T11889 |
T11890 |
csubj |
Elucidating,is |
| R7661 |
T11891 |
T11892 |
det |
the,mechanisms |
| R7662 |
T11892 |
T11889 |
dobj |
mechanisms,Elucidating |
| R7663 |
T11893 |
T11892 |
amod |
molecular,mechanisms |
| R7664 |
T11894 |
T11895 |
prep |
through,converge |
| R7665 |
T11895 |
T11892 |
relcl |
converge,mechanisms |
| R7666 |
T11896 |
T11894 |
pobj |
which,through |
| R7667 |
T11897 |
T11898 |
det |
these,networks |
| R7668 |
T11898 |
T11895 |
nsubj |
networks,converge |
| R7669 |
T11899 |
T11890 |
advmod |
also,is |
| R767 |
T1583 |
T1581 |
dobj |
cadherin,encoding |
| R7670 |
T11900 |
T11901 |
det |
a,prerequisite |
| R7671 |
T11901 |
T11890 |
attr |
prerequisite,is |
| R7672 |
T11902 |
T11901 |
prep |
for,prerequisite |
| R7673 |
T11903 |
T11902 |
pcomp |
understanding,for |
| R7674 |
T11904 |
T11905 |
advmod |
how,go |
| R7675 |
T11905 |
T11903 |
ccomp |
go,understanding |
| R7676 |
T11906 |
T11907 |
det |
these,processes |
| R7677 |
T11907 |
T11905 |
nsubj |
processes,go |
| R7678 |
T11908 |
T11905 |
advmod |
awry,go |
| R7679 |
T11909 |
T11905 |
prep |
during,go |
| R768 |
T1686 |
T1687 |
compound |
β,catenin |
| R7680 |
T11910 |
T11909 |
pobj |
tumorigenesis,during |
| R7681 |
T11911 |
T11890 |
punct |
.,is |
| R7682 |
T12023 |
T12024 |
amod |
Primary,antibodies |
| R7683 |
T12024 |
T12025 |
nsubj |
antibodies,were |
| R7684 |
T12026 |
T12024 |
acl |
used,antibodies |
| R7685 |
T12027 |
T12025 |
prep |
against,were |
| R7686 |
T12028 |
T12027 |
punct |
: ,against |
| R7687 |
T12029 |
T12030 |
compound |
E,cadherin |
| R7688 |
T12030 |
T12027 |
pobj |
cadherin,against |
| R7689 |
T12031 |
T12030 |
punct |
-,cadherin |
| R769 |
T1584 |
T1583 |
punct |
-,cadherin |
| R7690 |
T12032 |
T12033 |
punct |
(,Takeichi |
| R7691 |
T12033 |
T12030 |
parataxis |
Takeichi,cadherin |
| R7692 |
T12034 |
T12033 |
compound |
M.,Takeichi |
| R7693 |
T12035 |
T12033 |
punct |
", ",Takeichi |
| R7694 |
T12036 |
T12037 |
compound |
Kyoto,University |
| R7695 |
T12037 |
T12033 |
npadvmod |
University,Takeichi |
| R7696 |
T12038 |
T12033 |
punct |
", ",Takeichi |
| R7697 |
T12039 |
T12033 |
npadvmod |
Japan,Takeichi |
| R7698 |
T12040 |
T12033 |
punct |
),Takeichi |
| R7699 |
T12041 |
T12030 |
punct |
;,cadherin |
| R77 |
T231 |
T229 |
ccomp |
is,found |
| R770 |
T1585 |
T1583 |
punct |
", ",cadherin |
| R7700 |
T12042 |
T12043 |
compound |
α,catenin |
| R7701 |
T12043 |
T12030 |
conj |
catenin,cadherin |
| R7702 |
T12044 |
T12043 |
punct |
-,catenin |
| R7703 |
T12045 |
T12043 |
punct |
", ",catenin |
| R7704 |
T12046 |
T12047 |
compound |
β,catenin |
| R7705 |
T12047 |
T12043 |
appos |
catenin,catenin |
| R7706 |
T12048 |
T12047 |
punct |
-,catenin |
| R7707 |
T12049 |
T12043 |
punct |
", ",catenin |
| R7708 |
T12050 |
T12043 |
appos |
pMAPK,catenin |
| R7709 |
T12051 |
T12043 |
punct |
", ",catenin |
| R771 |
T1586 |
T1587 |
det |
the,cadherin |
| R7710 |
T12052 |
T12043 |
appos |
tubulin,catenin |
| R7711 |
T12053 |
T12054 |
punct |
(,Sigma |
| R7712 |
T12054 |
T12043 |
parataxis |
Sigma,catenin |
| R7713 |
T12055 |
T12054 |
punct |
", ",Sigma |
| R7714 |
T12056 |
T12057 |
compound |
St.,Louis |
| R7715 |
T12057 |
T12054 |
npadvmod |
Louis,Sigma |
| R7716 |
T12058 |
T12054 |
punct |
", ",Sigma |
| R7717 |
T12059 |
T12054 |
npadvmod |
Missouri,Sigma |
| R7718 |
T12060 |
T12054 |
punct |
", ",Sigma |
| R7719 |
T12061 |
T12062 |
compound |
United,States |
| R772 |
T1687 |
T1682 |
appos |
catenin,cadherin |
| R7720 |
T12062 |
T12054 |
npadvmod |
States,Sigma |
| R7721 |
T12063 |
T12054 |
punct |
),Sigma |
| R7722 |
T12064 |
T12043 |
punct |
", ",catenin |
| R7723 |
T12065 |
T12043 |
conj |
Ajuba,catenin |
| R7724 |
T12066 |
T12067 |
punct |
(,Longmore |
| R7725 |
T12067 |
T12065 |
parataxis |
Longmore,Ajuba |
| R7726 |
T12068 |
T12067 |
compound |
G.,Longmore |
| R7727 |
T12069 |
T12067 |
punct |
", ",Longmore |
| R7728 |
T12070 |
T12071 |
compound |
Washington,University |
| R7729 |
T12071 |
T12067 |
npadvmod |
University,Longmore |
| R773 |
T1587 |
T1583 |
appos |
cadherin,cadherin |
| R7730 |
T12072 |
T12067 |
punct |
", ",Longmore |
| R7731 |
T12073 |
T12074 |
compound |
St.,Louis |
| R7732 |
T12074 |
T12067 |
npadvmod |
Louis,Longmore |
| R7733 |
T12075 |
T12067 |
punct |
", ",Longmore |
| R7734 |
T12076 |
T12067 |
npadvmod |
Missouri,Longmore |
| R7735 |
T12077 |
T12067 |
punct |
", ",Longmore |
| R7736 |
T12078 |
T12079 |
compound |
United,States |
| R7737 |
T12079 |
T12067 |
npadvmod |
States,Longmore |
| R7738 |
T12080 |
T12067 |
punct |
),Longmore |
| R7739 |
T12081 |
T12065 |
punct |
;,Ajuba |
| R774 |
T1588 |
T1587 |
amod |
prototypical,cadherin |
| R7740 |
T12082 |
T12083 |
compound |
β4,integrin |
| R7741 |
T12083 |
T12065 |
conj |
integrin,Ajuba |
| R7742 |
T12084 |
T12083 |
punct |
/,integrin |
| R7743 |
T12085 |
T12083 |
appos |
CD104,integrin |
| R7744 |
T12086 |
T12087 |
punct |
(,Pharmingen |
| R7745 |
T12087 |
T12083 |
parataxis |
Pharmingen,integrin |
| R7746 |
T12088 |
T12087 |
compound |
BD,Pharmingen |
| R7747 |
T12089 |
T12087 |
punct |
", ",Pharmingen |
| R7748 |
T12090 |
T12091 |
compound |
San,Diego |
| R7749 |
T12091 |
T12087 |
npadvmod |
Diego,Pharmingen |
| R775 |
T1688 |
T1687 |
punct |
-,catenin |
| R7750 |
T12092 |
T12087 |
punct |
", ",Pharmingen |
| R7751 |
T12093 |
T12087 |
npadvmod |
California,Pharmingen |
| R7752 |
T12094 |
T12087 |
punct |
", ",Pharmingen |
| R7753 |
T12095 |
T12096 |
compound |
United,States |
| R7754 |
T12096 |
T12087 |
npadvmod |
States,Pharmingen |
| R7755 |
T12097 |
T12087 |
punct |
),Pharmingen |
| R7756 |
T12098 |
T12083 |
punct |
", ",integrin |
| R7757 |
T12099 |
T12083 |
conj |
laminin,integrin |
| R7758 |
T12100 |
T12099 |
nummod |
5,laminin |
| R7759 |
T12101 |
T12102 |
punct |
(,Burgeson |
| R776 |
T1589 |
T1587 |
amod |
epithelial,cadherin |
| R7760 |
T12102 |
T12099 |
parataxis |
Burgeson,laminin |
| R7761 |
T12103 |
T12102 |
compound |
R.,Burgeson |
| R7762 |
T12104 |
T12102 |
punct |
", ",Burgeson |
| R7763 |
T12105 |
T12106 |
compound |
Harvard,University |
| R7764 |
T12106 |
T12102 |
npadvmod |
University,Burgeson |
| R7765 |
T12107 |
T12102 |
punct |
", ",Burgeson |
| R7766 |
T12108 |
T12102 |
npadvmod |
Cambridge,Burgeson |
| R7767 |
T12109 |
T12102 |
punct |
", ",Burgeson |
| R7768 |
T12110 |
T12102 |
npadvmod |
Massachusetts,Burgeson |
| R7769 |
T12111 |
T12102 |
punct |
", ",Burgeson |
| R777 |
T1590 |
T1591 |
dep |
that,forms |
| R7770 |
T12112 |
T12113 |
compound |
United,States |
| R7771 |
T12113 |
T12102 |
npadvmod |
States,Burgeson |
| R7772 |
T12114 |
T12102 |
punct |
),Burgeson |
| R7773 |
T12115 |
T12099 |
punct |
", ",laminin |
| R7774 |
T12116 |
T12099 |
conj |
K5,laminin |
| R7775 |
T12117 |
T12116 |
punct |
", ",K5 |
| R7776 |
T12118 |
T12116 |
conj |
K1,K5 |
| R7777 |
T12119 |
T12118 |
punct |
", ",K1 |
| R7778 |
T12120 |
T12118 |
conj |
loricrin,K1 |
| R7779 |
T12121 |
T12122 |
punct |
(,Lab |
| R778 |
T1591 |
T1587 |
relcl |
forms,cadherin |
| R7780 |
T12122 |
T12120 |
parataxis |
Lab,loricrin |
| R7781 |
T12123 |
T12122 |
compound |
Fuchs,Lab |
| R7782 |
T12124 |
T12122 |
punct |
),Lab |
| R7783 |
T12125 |
T12120 |
punct |
", ",loricrin |
| R7784 |
T12126 |
T12120 |
conj |
involucrin,loricrin |
| R7785 |
T12127 |
T12126 |
punct |
", ",involucrin |
| R7786 |
T12128 |
T12126 |
conj |
fillagrin,involucrin |
| R7787 |
T12129 |
T12130 |
punct |
(,Covance |
| R7788 |
T12130 |
T12128 |
parataxis |
Covance,fillagrin |
| R7789 |
T12131 |
T12130 |
punct |
", ",Covance |
| R779 |
T1689 |
T1690 |
compound |
α,catenin |
| R7790 |
T12132 |
T12130 |
npadvmod |
Berkeley,Covance |
| R7791 |
T12133 |
T12130 |
punct |
", ",Covance |
| R7792 |
T12134 |
T12130 |
npadvmod |
California,Covance |
| R7793 |
T12135 |
T12130 |
punct |
", ",Covance |
| R7794 |
T12136 |
T12137 |
compound |
United,States |
| R7795 |
T12137 |
T12130 |
npadvmod |
States,Covance |
| R7796 |
T12138 |
T12130 |
punct |
),Covance |
| R7797 |
T12139 |
T12128 |
punct |
", ",fillagrin |
| R7798 |
T12140 |
T12128 |
conj |
MAPK,fillagrin |
| R7799 |
T12141 |
T12140 |
punct |
", ",MAPK |
| R78 |
T232 |
T231 |
csubj |
transforming,is |
| R780 |
T1592 |
T1593 |
det |
the,core |
| R7800 |
T12142 |
T12140 |
conj |
pSMAD2,MAPK |
| R7801 |
T12143 |
T12144 |
punct |
(,Signaling |
| R7802 |
T12144 |
T12142 |
parataxis |
Signaling,pSMAD2 |
| R7803 |
T12145 |
T12144 |
compound |
Cell,Signaling |
| R7804 |
T12146 |
T12144 |
punct |
", ",Signaling |
| R7805 |
T12147 |
T12144 |
npadvmod |
Beverly,Signaling |
| R7806 |
T12148 |
T12144 |
punct |
", ",Signaling |
| R7807 |
T12149 |
T12144 |
npadvmod |
Massachusetts,Signaling |
| R7808 |
T12150 |
T12144 |
punct |
", ",Signaling |
| R7809 |
T12151 |
T12152 |
compound |
United,States |
| R781 |
T1593 |
T1591 |
dobj |
core,forms |
| R7810 |
T12152 |
T12144 |
npadvmod |
States,Signaling |
| R7811 |
T12153 |
T12144 |
punct |
),Signaling |
| R7812 |
T12154 |
T12142 |
punct |
;,pSMAD2 |
| R7813 |
T12155 |
T12142 |
conj |
Grb,pSMAD2 |
| R7814 |
T12156 |
T12155 |
punct |
-,Grb |
| R7815 |
T12157 |
T12155 |
nummod |
2,Grb |
| R7816 |
T12158 |
T12159 |
punct |
(,Biotech |
| R7817 |
T12159 |
T12155 |
parataxis |
Biotech,Grb |
| R7818 |
T12160 |
T12161 |
compound |
Santa,Cruz |
| R7819 |
T12161 |
T12159 |
compound |
Cruz,Biotech |
| R782 |
T1690 |
T1671 |
dobj |
catenin,recruit |
| R7820 |
T12162 |
T12159 |
punct |
", ",Biotech |
| R7821 |
T12163 |
T12164 |
compound |
Santa,Cruz |
| R7822 |
T12164 |
T12159 |
npadvmod |
Cruz,Biotech |
| R7823 |
T12165 |
T12159 |
punct |
", ",Biotech |
| R7824 |
T12166 |
T12159 |
npadvmod |
California,Biotech |
| R7825 |
T12167 |
T12159 |
punct |
", ",Biotech |
| R7826 |
T12168 |
T12169 |
compound |
United,States |
| R7827 |
T12169 |
T12159 |
npadvmod |
States,Biotech |
| R7828 |
T12170 |
T12159 |
punct |
),Biotech |
| R7829 |
T12171 |
T12155 |
punct |
;,Grb |
| R783 |
T1594 |
T1593 |
amod |
transmembrane,core |
| R7830 |
T12172 |
T12173 |
compound |
P,cadherin |
| R7831 |
T12173 |
T12155 |
conj |
cadherin,Grb |
| R7832 |
T12174 |
T12173 |
punct |
-,cadherin |
| R7833 |
T12175 |
T12176 |
punct |
(,Laboratories |
| R7834 |
T12176 |
T12173 |
parataxis |
Laboratories,cadherin |
| R7835 |
T12177 |
T12176 |
compound |
Zymed,Laboratories |
| R7836 |
T12178 |
T12176 |
punct |
", ",Laboratories |
| R7837 |
T12179 |
T12180 |
amod |
South,Francisco |
| R7838 |
T12180 |
T12176 |
npadvmod |
Francisco,Laboratories |
| R7839 |
T12181 |
T12180 |
compound |
San,Francisco |
| R784 |
T1595 |
T1593 |
prep |
of,core |
| R7840 |
T12182 |
T12176 |
punct |
", ",Laboratories |
| R7841 |
T12183 |
T12176 |
npadvmod |
California,Laboratories |
| R7842 |
T12184 |
T12176 |
punct |
", ",Laboratories |
| R7843 |
T12185 |
T12186 |
compound |
United,States |
| R7844 |
T12186 |
T12176 |
npadvmod |
States,Laboratories |
| R7845 |
T12187 |
T12176 |
punct |
),Laboratories |
| R7846 |
T12188 |
T12173 |
punct |
;,cadherin |
| R7847 |
T12189 |
T12173 |
conj |
HA,cadherin |
| R7848 |
T12190 |
T12191 |
punct |
(,Biochemicals |
| R7849 |
T12191 |
T12189 |
parataxis |
Biochemicals,HA |
| R785 |
T1596 |
T1597 |
amod |
intercellular,junctions |
| R7850 |
T12192 |
T12191 |
compound |
Roche,Biochemicals |
| R7851 |
T12193 |
T12191 |
punct |
),Biochemicals |
| R7852 |
T12194 |
T12189 |
punct |
", ",HA |
| R7853 |
T12195 |
T12189 |
conj |
vimentin,HA |
| R7854 |
T12196 |
T12197 |
punct |
(,Chemicon |
| R7855 |
T12197 |
T12195 |
parataxis |
Chemicon,vimentin |
| R7856 |
T12198 |
T12197 |
punct |
", ",Chemicon |
| R7857 |
T12199 |
T12197 |
npadvmod |
Temecula,Chemicon |
| R7858 |
T12200 |
T12197 |
punct |
", ",Chemicon |
| R7859 |
T12201 |
T12197 |
npadvmod |
California,Chemicon |
| R786 |
T1691 |
T1690 |
punct |
-,catenin |
| R7860 |
T12202 |
T12197 |
punct |
", ",Chemicon |
| R7861 |
T12203 |
T12204 |
compound |
United,States |
| R7862 |
T12204 |
T12197 |
npadvmod |
States,Chemicon |
| R7863 |
T12205 |
T12197 |
punct |
),Chemicon |
| R7864 |
T12206 |
T12195 |
punct |
", ",vimentin |
| R7865 |
T12207 |
T12195 |
conj |
Ki67,vimentin |
| R7866 |
T12208 |
T12209 |
punct |
(,Castra |
| R7867 |
T12209 |
T12207 |
parataxis |
Castra,Ki67 |
| R7868 |
T12210 |
T12209 |
compound |
Novo,Castra |
| R7869 |
T12211 |
T12209 |
punct |
", ",Castra |
| R787 |
T1597 |
T1595 |
pobj |
junctions,of |
| R7870 |
T12212 |
T12209 |
npadvmod |
Newcastle,Castra |
| R7871 |
T12213 |
T12212 |
prep |
Upon,Newcastle |
| R7872 |
T12214 |
T12213 |
pobj |
Tyne,Upon |
| R7873 |
T12215 |
T12209 |
punct |
", ",Castra |
| R7874 |
T12216 |
T12217 |
compound |
United,Kingdom |
| R7875 |
T12217 |
T12209 |
npadvmod |
Kingdom,Castra |
| R7876 |
T12218 |
T12209 |
punct |
),Castra |
| R7877 |
T12219 |
T12207 |
punct |
", ",Ki67 |
| R7878 |
T12220 |
T12207 |
conj |
keratin,Ki67 |
| R7879 |
T12221 |
T12220 |
nummod |
6,keratin |
| R788 |
T1598 |
T1597 |
compound |
adherens,junctions |
| R7880 |
T12222 |
T12223 |
punct |
(,Coulombe |
| R7881 |
T12223 |
T12220 |
parataxis |
Coulombe,keratin |
| R7882 |
T12224 |
T12223 |
compound |
P.,Coulombe |
| R7883 |
T12225 |
T12223 |
punct |
", ",Coulombe |
| R7884 |
T12226 |
T12227 |
compound |
John,Hopkins |
| R7885 |
T12227 |
T12228 |
compound |
Hopkins,University |
| R7886 |
T12228 |
T12223 |
npadvmod |
University,Coulombe |
| R7887 |
T12229 |
T12223 |
punct |
", ",Coulombe |
| R7888 |
T12230 |
T12223 |
npadvmod |
Baltimore,Coulombe |
| R7889 |
T12231 |
T12223 |
punct |
", ",Coulombe |
| R789 |
T1599 |
T1597 |
punct |
(,junctions |
| R7890 |
T12232 |
T12223 |
npadvmod |
Maryland,Coulombe |
| R7891 |
T12233 |
T12223 |
punct |
", ",Coulombe |
| R7892 |
T12234 |
T12235 |
compound |
United,States |
| R7893 |
T12235 |
T12223 |
npadvmod |
States,Coulombe |
| R7894 |
T12236 |
T12223 |
punct |
),Coulombe |
| R7895 |
T12237 |
T12220 |
punct |
", ",keratin |
| R7896 |
T12238 |
T12239 |
compound |
cyclin,D |
| R7897 |
T12239 |
T12220 |
conj |
D,keratin |
| R7898 |
T12240 |
T12241 |
punct |
(,Oncogene |
| R7899 |
T12241 |
T12239 |
parataxis |
Oncogene,D |
| R79 |
T233 |
T234 |
compound |
growth,β2 |
| R790 |
T1692 |
T1690 |
punct |
", ",catenin |
| R7900 |
T12242 |
T12241 |
punct |
", ",Oncogene |
| R7901 |
T12243 |
T12244 |
compound |
San,Diego |
| R7902 |
T12244 |
T12241 |
npadvmod |
Diego,Oncogene |
| R7903 |
T12245 |
T12241 |
punct |
", ",Oncogene |
| R7904 |
T12246 |
T12241 |
npadvmod |
California,Oncogene |
| R7905 |
T12247 |
T12241 |
punct |
", ",Oncogene |
| R7906 |
T12248 |
T12249 |
compound |
United,States |
| R7907 |
T12249 |
T12241 |
npadvmod |
States,Oncogene |
| R7908 |
T12250 |
T12241 |
punct |
),Oncogene |
| R7909 |
T12251 |
T12239 |
punct |
", ",D |
| R791 |
T1600 |
T1597 |
appos |
AJs,junctions |
| R7910 |
T12252 |
T12239 |
cc |
and,D |
| R7911 |
T12253 |
T12254 |
compound |
TGF,β2 |
| R7912 |
T12254 |
T12239 |
conj |
β2,D |
| R7913 |
T12255 |
T12254 |
punct |
-,β2 |
| R7914 |
T12256 |
T12257 |
punct |
(,Gold |
| R7915 |
T12257 |
T12254 |
parataxis |
Gold,β2 |
| R7916 |
T12258 |
T12257 |
compound |
L.,Gold |
| R7917 |
T12259 |
T12257 |
punct |
", ",Gold |
| R7918 |
T12260 |
T12261 |
compound |
New,York |
| R7919 |
T12261 |
T12262 |
compound |
York,University |
| R792 |
T1601 |
T1565 |
punct |
),include |
| R7920 |
T12262 |
T12257 |
npadvmod |
University,Gold |
| R7921 |
T12263 |
T12257 |
punct |
", ",Gold |
| R7922 |
T12264 |
T12265 |
compound |
New,York |
| R7923 |
T12265 |
T12257 |
npadvmod |
York,Gold |
| R7924 |
T12266 |
T12257 |
punct |
", ",Gold |
| R7925 |
T12267 |
T12268 |
compound |
New,York |
| R7926 |
T12268 |
T12257 |
npadvmod |
York,Gold |
| R7927 |
T12269 |
T12257 |
punct |
", ",Gold |
| R7928 |
T12270 |
T12271 |
compound |
United,States |
| R7929 |
T12271 |
T12257 |
npadvmod |
States,Gold |
| R793 |
T1602 |
T1603 |
punct |
[,5 |
| R7930 |
T12272 |
T12257 |
punct |
),Gold |
| R7931 |
T12273 |
T12025 |
punct |
.,were |
| R7932 |
T12275 |
T12276 |
npadvmod |
FITC,conjugated |
| R7933 |
T12276 |
T12286 |
amod |
conjugated,antibodies |
| R7934 |
T12277 |
T12275 |
punct |
-,FITC |
| R7935 |
T12278 |
T12275 |
punct |
", ",FITC |
| R7936 |
T12279 |
T12280 |
compound |
Texas,Red |
| R7937 |
T12280 |
T12275 |
conj |
Red,FITC |
| R7938 |
T12281 |
T12280 |
punct |
-,Red |
| R7939 |
T12282 |
T12280 |
punct |
", ",Red |
| R794 |
T1603 |
T1565 |
parataxis |
5,include |
| R7940 |
T12283 |
T12280 |
cc |
or,Red |
| R7941 |
T12284 |
T12280 |
conj |
HRP,Red |
| R7942 |
T12285 |
T12276 |
punct |
-,conjugated |
| R7943 |
T12286 |
T12288 |
nsubj |
antibodies,were |
| R7944 |
T12287 |
T12286 |
amod |
secondary,antibodies |
| R7945 |
T12289 |
T12288 |
prep |
from,were |
| R7946 |
T12290 |
T12291 |
compound |
Jackson,ImmunoResearch |
| R7947 |
T12291 |
T12289 |
pobj |
ImmunoResearch,from |
| R7948 |
T12292 |
T12293 |
punct |
(,Grove |
| R7949 |
T12293 |
T12291 |
parataxis |
Grove,ImmunoResearch |
| R795 |
T1604 |
T1603 |
punct |
],5 |
| R7950 |
T12294 |
T12293 |
compound |
West,Grove |
| R7951 |
T12295 |
T12293 |
punct |
", ",Grove |
| R7952 |
T12296 |
T12293 |
npadvmod |
Pennsylvania,Grove |
| R7953 |
T12297 |
T12293 |
punct |
", ",Grove |
| R7954 |
T12298 |
T12299 |
compound |
United,States |
| R7955 |
T12299 |
T12293 |
npadvmod |
States,Grove |
| R7956 |
T12300 |
T12293 |
punct |
),Grove |
| R7957 |
T12301 |
T12288 |
punct |
.,were |
| R7958 |
T12303 |
T12304 |
amod |
Biotinylated,antibodies |
| R7959 |
T12304 |
T12306 |
nsubj |
antibodies,were |
| R796 |
T1693 |
T1694 |
dep |
which,coordinates |
| R7960 |
T12305 |
T12304 |
amod |
secondary,antibodies |
| R7961 |
T12307 |
T12306 |
prep |
from,were |
| R7962 |
T12308 |
T12309 |
compound |
Vector,Labs |
| R7963 |
T12309 |
T12307 |
pobj |
Labs,from |
| R7964 |
T12310 |
T12311 |
punct |
(,Burlingame |
| R7965 |
T12311 |
T12309 |
parataxis |
Burlingame,Labs |
| R7966 |
T12312 |
T12311 |
punct |
", ",Burlingame |
| R7967 |
T12313 |
T12311 |
npadvmod |
California,Burlingame |
| R7968 |
T12314 |
T12311 |
punct |
", ",Burlingame |
| R7969 |
T12315 |
T12316 |
compound |
United,States |
| R797 |
T1605 |
T1565 |
punct |
.,include |
| R7970 |
T12316 |
T12311 |
npadvmod |
States,Burlingame |
| R7971 |
T12317 |
T12311 |
punct |
),Burlingame |
| R7972 |
T12318 |
T12306 |
punct |
.,were |
| R7973 |
T12320 |
T12321 |
nsubj |
Dilutions,were |
| R7974 |
T12322 |
T12321 |
prep |
according,were |
| R7975 |
T12323 |
T12322 |
prep |
to,according |
| R7976 |
T12324 |
T12325 |
det |
the,manufacturer |
| R7977 |
T12325 |
T12326 |
poss |
manufacturer,recommendation |
| R7978 |
T12326 |
T12323 |
pobj |
recommendation,to |
| R7979 |
T12327 |
T12325 |
case |
's,manufacturer |
| R798 |
T1607 |
T1608 |
nsubj |
We,showed |
| R7980 |
T12328 |
T12321 |
punct |
.,were |
| R7981 |
T12330 |
T12331 |
det |
The,antibody |
| R7982 |
T12331 |
T12333 |
nsubjpass |
antibody,generated |
| R7983 |
T12332 |
T12331 |
compound |
Snail,antibody |
| R7984 |
T12334 |
T12333 |
auxpass |
was,generated |
| R7985 |
T12335 |
T12333 |
prep |
in,generated |
| R7986 |
T12336 |
T12337 |
compound |
Guinea,pigs |
| R7987 |
T12337 |
T12335 |
pobj |
pigs,in |
| R7988 |
T12338 |
T12333 |
prep |
by,generated |
| R7989 |
T12339 |
T12338 |
pcomp |
inoculating,by |
| R799 |
T1694 |
T1690 |
relcl |
coordinates,catenin |
| R7990 |
T12340 |
T12339 |
dobj |
them,inoculating |
| R7991 |
T12341 |
T12339 |
prep |
with,inoculating |
| R7992 |
T12342 |
T12343 |
det |
the,sequence |
| R7993 |
T12343 |
T12341 |
pobj |
sequence,with |
| R7994 |
T12344 |
T12345 |
npadvmod |
N,terminal |
| R7995 |
T12345 |
T12343 |
amod |
terminal,sequence |
| R7996 |
T12346 |
T12345 |
punct |
-,terminal |
| R7997 |
T12347 |
T12343 |
prep |
of,sequence |
| R7998 |
T12348 |
T12349 |
amod |
murine,Snail |
| R7999 |
T12349 |
T12347 |
pobj |
Snail,of |
| R8 |
T155 |
T152 |
conj |
Snail,β2 |
| R80 |
T234 |
T236 |
compound |
β2,signaling |
| R800 |
T1609 |
T1608 |
advmod |
subsequently,showed |
| R8000 |
T12350 |
T12343 |
acl |
fused,sequence |
| R8001 |
T12351 |
T12350 |
prep |
to,fused |
| R8002 |
T12352 |
T12351 |
pobj |
GST,to |
| R8003 |
T12353 |
T12354 |
punct |
(,Covance |
| R8004 |
T12354 |
T12352 |
parataxis |
Covance,GST |
| R8005 |
T12355 |
T12354 |
punct |
", ",Covance |
| R8006 |
T12356 |
T12354 |
npadvmod |
Princeton,Covance |
| R8007 |
T12357 |
T12354 |
punct |
", ",Covance |
| R8008 |
T12358 |
T12359 |
compound |
New,Jersey |
| R8009 |
T12359 |
T12354 |
npadvmod |
Jersey,Covance |
| R801 |
T1695 |
T1694 |
prep |
in,coordinates |
| R8010 |
T12360 |
T12354 |
punct |
", ",Covance |
| R8011 |
T12361 |
T12362 |
compound |
United,States |
| R8012 |
T12362 |
T12354 |
npadvmod |
States,Covance |
| R8013 |
T12363 |
T12354 |
punct |
),Covance |
| R8014 |
T12364 |
T12333 |
punct |
.,generated |
| R8015 |
T12366 |
T12367 |
amod |
Recombinant,β2 |
| R8016 |
T12367 |
T12371 |
nsubjpass |
β2,purchased |
| R8017 |
T12368 |
T12367 |
amod |
human,β2 |
| R8018 |
T12369 |
T12367 |
compound |
TGF,β2 |
| R8019 |
T12370 |
T12367 |
punct |
-,β2 |
| R802 |
T1610 |
T1611 |
mark |
that,blocked |
| R8020 |
T12372 |
T12371 |
auxpass |
was,purchased |
| R8021 |
T12373 |
T12371 |
prep |
from,purchased |
| R8022 |
T12374 |
T12373 |
pobj |
R,from |
| R8023 |
T12375 |
T12374 |
cc |
&,R |
| R8024 |
T12376 |
T12374 |
conj |
D,R |
| R8025 |
T12377 |
T12378 |
punct |
(,Minneapolis |
| R8026 |
T12378 |
T12376 |
parataxis |
Minneapolis,D |
| R8027 |
T12379 |
T12378 |
punct |
", ",Minneapolis |
| R8028 |
T12380 |
T12378 |
npadvmod |
Minnesota,Minneapolis |
| R8029 |
T12381 |
T12378 |
punct |
", ",Minneapolis |
| R803 |
T1696 |
T1695 |
pobj |
turn,in |
| R8030 |
T12382 |
T12383 |
compound |
United,States |
| R8031 |
T12383 |
T12378 |
npadvmod |
States,Minneapolis |
| R8032 |
T12384 |
T12378 |
punct |
),Minneapolis |
| R8033 |
T12385 |
T12371 |
punct |
.,purchased |
| R8034 |
T12387 |
T12388 |
npadvmod |
Heat,inactivated |
| R8035 |
T12388 |
T12389 |
amod |
inactivated,β2 |
| R8036 |
T12389 |
T12392 |
nsubjpass |
β2,generated |
| R8037 |
T12390 |
T12389 |
compound |
TGF,β2 |
| R8038 |
T12391 |
T12389 |
punct |
-,β2 |
| R8039 |
T12393 |
T12392 |
auxpass |
was,generated |
| R804 |
T1611 |
T1608 |
ccomp |
blocked,showed |
| R8040 |
T12394 |
T12392 |
prep |
by,generated |
| R8041 |
T12395 |
T12394 |
pcomp |
heating,by |
| R8042 |
T12396 |
T12397 |
det |
the,protein |
| R8043 |
T12397 |
T12395 |
dobj |
protein,heating |
| R8044 |
T12398 |
T12397 |
amod |
recombinant,protein |
| R8045 |
T12399 |
T12395 |
prep |
at,heating |
| R8046 |
T12400 |
T12401 |
nummod |
100,°C |
| R8047 |
T12401 |
T12399 |
pobj |
°C,at |
| R8048 |
T12402 |
T12395 |
prep |
for,heating |
| R8049 |
T12403 |
T12404 |
nummod |
10,min |
| R805 |
T1697 |
T1698 |
det |
the,dynamics |
| R8050 |
T12404 |
T12402 |
pobj |
min,for |
| R8051 |
T12405 |
T12392 |
punct |
.,generated |
| R8052 |
T12466 |
T12467 |
det |
The,mouse |
| R8053 |
T12467 |
T12472 |
nsubjpass |
mouse,generated |
| R8054 |
T12468 |
T12469 |
compound |
K14,Snail |
| R8055 |
T12469 |
T12467 |
compound |
Snail,mouse |
| R8056 |
T12470 |
T12469 |
punct |
-,Snail |
| R8057 |
T12471 |
T12467 |
compound |
Tg,mouse |
| R8058 |
T12473 |
T12472 |
auxpass |
was,generated |
| R8059 |
T12474 |
T12472 |
prep |
by,generated |
| R806 |
T1612 |
T1613 |
advmod |
when,elevated |
| R8060 |
T12475 |
T12474 |
pcomp |
digesting,by |
| R8061 |
T12476 |
T12477 |
det |
the,plasmid |
| R8062 |
T12477 |
T12475 |
dobj |
plasmid,digesting |
| R8063 |
T12478 |
T12479 |
compound |
pcDNA3,mm |
| R8064 |
T12479 |
T12477 |
compound |
mm,plasmid |
| R8065 |
T12480 |
T12479 |
punct |
-,mm |
| R8066 |
T12481 |
T12482 |
compound |
Snail,HA |
| R8067 |
T12482 |
T12477 |
compound |
HA,plasmid |
| R8068 |
T12483 |
T12482 |
punct |
-,HA |
| R8069 |
T12484 |
T12485 |
punct |
(,Herreros |
| R807 |
T1613 |
T1611 |
advcl |
elevated,blocked |
| R8070 |
T12485 |
T12477 |
parataxis |
Herreros,plasmid |
| R8071 |
T12486 |
T12485 |
compound |
G.,Herreros |
| R8072 |
T12487 |
T12485 |
compound |
de,Herreros |
| R8073 |
T12488 |
T12485 |
punct |
", ",Herreros |
| R8074 |
T12489 |
T12490 |
compound |
Universitat,Pompeu |
| R8075 |
T12490 |
T12485 |
npadvmod |
Pompeu,Herreros |
| R8076 |
T12491 |
T12485 |
punct |
", ",Herreros |
| R8077 |
T12492 |
T12485 |
npadvmod |
Fabra,Herreros |
| R8078 |
T12493 |
T12485 |
punct |
", ",Herreros |
| R8079 |
T12494 |
T12485 |
npadvmod |
Barcelona,Herreros |
| R808 |
T1698 |
T1694 |
dobj |
dynamics,coordinates |
| R8080 |
T12495 |
T12485 |
punct |
", ",Herreros |
| R8081 |
T12496 |
T12485 |
npadvmod |
Spain,Herreros |
| R8082 |
T12497 |
T12485 |
punct |
),Herreros |
| R8083 |
T12498 |
T12475 |
prep |
with,digesting |
| R8084 |
T12499 |
T12498 |
pobj |
BamHI,with |
| R8085 |
T12500 |
T12499 |
cc |
and,BamHI |
| R8086 |
T12501 |
T12499 |
conj |
NotI,BamHI |
| R8087 |
T12502 |
T12472 |
cc |
and,generated |
| R8088 |
T12503 |
T12472 |
conj |
subcloned,generated |
| R8089 |
T12504 |
T12503 |
prep |
into,subcloned |
| R809 |
T1614 |
T1615 |
compound |
E,cadherin |
| R8090 |
T12505 |
T12506 |
det |
the,vector |
| R8091 |
T12506 |
T12504 |
pobj |
vector,into |
| R8092 |
T12507 |
T12506 |
compound |
K14,vector |
| R8093 |
T12508 |
T12509 |
punct |
[,49 |
| R8094 |
T12509 |
T12503 |
parataxis |
49,subcloned |
| R8095 |
T12510 |
T12509 |
punct |
],49 |
| R8096 |
T12511 |
T12472 |
punct |
.,generated |
| R8097 |
T12513 |
T12514 |
det |
The,construct |
| R8098 |
T12514 |
T12516 |
nsubjpass |
construct,injected |
| R8099 |
T12515 |
T12514 |
amod |
linearized,construct |
| R81 |
T235 |
T234 |
compound |
factor,β2 |
| R810 |
T1615 |
T1613 |
nsubjpass |
cadherin,elevated |
| R8100 |
T12517 |
T12516 |
auxpass |
was,injected |
| R8101 |
T12518 |
T12516 |
prep |
into,injected |
| R8102 |
T12519 |
T12520 |
det |
the,nucleus |
| R8103 |
T12520 |
T12518 |
pobj |
nucleus,into |
| R8104 |
T12521 |
T12520 |
prep |
of,nucleus |
| R8105 |
T12522 |
T12521 |
pobj |
embryos,of |
| R8106 |
T12523 |
T12522 |
prep |
from,embryos |
| R8107 |
T12524 |
T12525 |
compound |
CD1,mice |
| R8108 |
T12525 |
T12523 |
pobj |
mice,from |
| R8109 |
T12526 |
T12516 |
punct |
.,injected |
| R811 |
T1616 |
T1615 |
punct |
-,cadherin |
| R8110 |
T12528 |
T12529 |
det |
The,mouse |
| R8111 |
T12529 |
T12535 |
nsubjpass |
mouse,reported |
| R8112 |
T12530 |
T12531 |
nmod |
K14,Smad |
| R8113 |
T12531 |
T12529 |
nmod |
Smad,mouse |
| R8114 |
T12532 |
T12531 |
punct |
-,Smad |
| R8115 |
T12533 |
T12534 |
nummod |
2,Tg |
| R8116 |
T12534 |
T12529 |
compound |
Tg,mouse |
| R8117 |
T12536 |
T12535 |
auxpass |
was,reported |
| R8118 |
T12537 |
T12535 |
prep |
in,reported |
| R8119 |
T12538 |
T12537 |
pobj |
Ito,in |
| R812 |
T1699 |
T1698 |
amod |
associated,dynamics |
| R8120 |
T12539 |
T12540 |
advmod |
et,al. |
| R8121 |
T12540 |
T12538 |
advmod |
al.,Ito |
| R8122 |
T12541 |
T12538 |
punct |
", ",Ito |
| R8123 |
T12542 |
T12538 |
npadvmod |
2001,Ito |
| R8124 |
T12543 |
T12535 |
punct |
.,reported |
| R8125 |
T12545 |
T12546 |
det |
The,mouse |
| R8126 |
T12546 |
T12554 |
nsubjpass |
mouse,described |
| R8127 |
T12547 |
T12548 |
nmod |
TGF,β2 |
| R8128 |
T12548 |
T12546 |
nmod |
β2,mouse |
| R8129 |
T12549 |
T12548 |
punct |
-,β2 |
| R813 |
T1617 |
T1613 |
auxpass |
is,elevated |
| R8130 |
T12550 |
T12548 |
appos |
knockout,β2 |
| R8131 |
T12551 |
T12550 |
punct |
(,knockout |
| R8132 |
T12552 |
T12550 |
appos |
KO,knockout |
| R8133 |
T12553 |
T12546 |
punct |
),mouse |
| R8134 |
T12555 |
T12554 |
auxpass |
was,described |
| R8135 |
T12556 |
T12554 |
prep |
in,described |
| R8136 |
T12557 |
T12558 |
punct |
[,34 |
| R8137 |
T12558 |
T12556 |
pobj |
34,in |
| R8138 |
T12559 |
T12554 |
punct |
],described |
| R8139 |
T12560 |
T12554 |
punct |
.,described |
| R814 |
T1618 |
T1613 |
advmod |
transgenically,elevated |
| R8140 |
T12562 |
T12563 |
det |
The,mouse |
| R8141 |
T12563 |
T12566 |
nsubjpass |
mouse,reported |
| R8142 |
T12564 |
T12565 |
compound |
shh,KO |
| R8143 |
T12565 |
T12563 |
compound |
KO,mouse |
| R8144 |
T12567 |
T12568 |
punct |
[,38 |
| R8145 |
T12568 |
T12563 |
parataxis |
38,mouse |
| R8146 |
T12569 |
T12568 |
punct |
],38 |
| R8147 |
T12570 |
T12563 |
cc |
and,mouse |
| R8148 |
T12571 |
T12572 |
compound |
TOPGal,mouse |
| R8149 |
T12572 |
T12563 |
conj |
mouse,mouse |
| R815 |
T1700 |
T1698 |
compound |
actin,dynamics |
| R8150 |
T12573 |
T12574 |
punct |
[,20 |
| R8151 |
T12574 |
T12572 |
parataxis |
20,mouse |
| R8152 |
T12575 |
T12574 |
punct |
],20 |
| R8153 |
T12576 |
T12566 |
aux |
have,reported |
| R8154 |
T12577 |
T12566 |
advmod |
previously,reported |
| R8155 |
T12578 |
T12566 |
auxpass |
been,reported |
| R8156 |
T12579 |
T12566 |
punct |
.,reported |
| R8157 |
T12687 |
T12688 |
compound |
Western,blot |
| R8158 |
T12689 |
T12688 |
cc |
and,blot |
| R8159 |
T12690 |
T12688 |
conj |
immunoprecipitation,blot |
| R816 |
T1619 |
T1613 |
prep |
in,elevated |
| R8160 |
T12692 |
T12693 |
compound |
Protein,extracts |
| R8161 |
T12693 |
T12694 |
nsubjpass |
extracts,generated |
| R8162 |
T12695 |
T12693 |
prep |
from,extracts |
| R8163 |
T12696 |
T12697 |
amod |
primary,keratinocytes |
| R8164 |
T12697 |
T12695 |
pobj |
keratinocytes,from |
| R8165 |
T12698 |
T12694 |
auxpass |
were,generated |
| R8166 |
T12699 |
T12700 |
preconj |
either,by |
| R8167 |
T12700 |
T12694 |
prep |
by,generated |
| R8168 |
T12701 |
T12700 |
pcomp |
lysing,by |
| R8169 |
T12702 |
T12701 |
dobj |
cells,lysing |
| R817 |
T1620 |
T1621 |
compound |
mouse,skin |
| R8170 |
T12703 |
T12701 |
prep |
in,lysing |
| R8171 |
T12704 |
T12705 |
compound |
lysis,buffer |
| R8172 |
T12705 |
T12703 |
pobj |
buffer,in |
| R8173 |
T12706 |
T12707 |
punct |
(,NP |
| R8174 |
T12707 |
T12705 |
parataxis |
NP,buffer |
| R8175 |
T12708 |
T12709 |
nummod |
1,% |
| R8176 |
T12709 |
T12707 |
compound |
%,NP |
| R8177 |
T12710 |
T12707 |
punct |
-,NP |
| R8178 |
T12711 |
T12707 |
nummod |
40,NP |
| R8179 |
T12712 |
T12707 |
punct |
", ",NP |
| R818 |
T1621 |
T1619 |
pobj |
skin,in |
| R8180 |
T12713 |
T12714 |
nummod |
1,% |
| R8181 |
T12714 |
T12715 |
compound |
%,deoxycholate |
| R8182 |
T12715 |
T12707 |
conj |
deoxycholate,NP |
| R8183 |
T12716 |
T12715 |
compound |
sodium,deoxycholate |
| R8184 |
T12717 |
T12715 |
punct |
", ",deoxycholate |
| R8185 |
T12718 |
T12719 |
nummod |
20,mM |
| R8186 |
T12719 |
T12720 |
compound |
mM,Cl |
| R8187 |
T12720 |
T12715 |
conj |
Cl,deoxycholate |
| R8188 |
T12721 |
T12720 |
compound |
Tris,Cl |
| R8189 |
T12722 |
T12720 |
punct |
-,Cl |
| R819 |
T1701 |
T1698 |
compound |
polymerization,dynamics |
| R8190 |
T12723 |
T12720 |
punct |
[,Cl |
| R8191 |
T12724 |
T12720 |
npadvmod |
pH,Cl |
| R8192 |
T12725 |
T12724 |
nummod |
7.4,pH |
| R8193 |
T12726 |
T12720 |
punct |
],Cl |
| R8194 |
T12727 |
T12720 |
punct |
", ",Cl |
| R8195 |
T12728 |
T12729 |
nummod |
140,mM |
| R8196 |
T12729 |
T12730 |
compound |
mM,NaCl |
| R8197 |
T12730 |
T12720 |
conj |
NaCl,Cl |
| R8198 |
T12731 |
T12730 |
acl |
containing,NaCl |
| R8199 |
T12732 |
T12733 |
nummod |
1,mM |
| R82 |
T236 |
T232 |
dobj |
signaling,transforming |
| R820 |
T1622 |
T1611 |
punct |
", ",blocked |
| R8200 |
T12733 |
T12734 |
compound |
mM,vanadate |
| R8201 |
T12734 |
T12731 |
dobj |
vanadate,containing |
| R8202 |
T12735 |
T12734 |
compound |
sodium,vanadate |
| R8203 |
T12736 |
T12730 |
punct |
", ",NaCl |
| R8204 |
T12737 |
T12738 |
nummod |
2,mM |
| R8205 |
T12738 |
T12739 |
compound |
mM,fluoride |
| R8206 |
T12739 |
T12730 |
conj |
fluoride,NaCl |
| R8207 |
T12740 |
T12739 |
compound |
phenylmethylsulfonyl,fluoride |
| R8208 |
T12741 |
T12739 |
punct |
", ",fluoride |
| R8209 |
T12742 |
T12739 |
cc |
and,fluoride |
| R821 |
T1623 |
T1624 |
compound |
hair,follicle |
| R8210 |
T12743 |
T12744 |
compound |
protease,inhibitors |
| R8211 |
T12744 |
T12739 |
conj |
inhibitors,fluoride |
| R8212 |
T12745 |
T12707 |
punct |
),NP |
| R8213 |
T12746 |
T12703 |
cc |
or,in |
| R8214 |
T12747 |
T12748 |
advmod |
directly,in |
| R8215 |
T12748 |
T12703 |
conj |
in,in |
| R8216 |
T12749 |
T12750 |
compound |
Laemmli,bβuffer |
| R8217 |
T12750 |
T12748 |
pobj |
bβuffer,in |
| R8218 |
T12751 |
T12694 |
cc |
and,generated |
| R8219 |
T12752 |
T12694 |
conj |
boiled,generated |
| R822 |
T1624 |
T1625 |
compound |
follicle,morphogenesis |
| R8220 |
T12753 |
T12694 |
punct |
.,generated |
| R8221 |
T12755 |
T12756 |
prep |
For,pulverized |
| R8222 |
T12757 |
T12758 |
compound |
skin,tissue |
| R8223 |
T12758 |
T12755 |
pobj |
tissue,For |
| R8224 |
T12759 |
T12756 |
punct |
: ,pulverized |
| R8225 |
T12760 |
T12761 |
amod |
Frozen,tissue |
| R8226 |
T12761 |
T12756 |
nsubjpass |
tissue,pulverized |
| R8227 |
T12762 |
T12756 |
auxpass |
was,pulverized |
| R8228 |
T12763 |
T12756 |
prep |
in,pulverized |
| R8229 |
T12764 |
T12765 |
det |
a,Gevebesmascher |
| R823 |
T1702 |
T1698 |
amod |
necessary,dynamics |
| R8230 |
T12765 |
T12763 |
pobj |
Gevebesmascher,in |
| R8231 |
T12766 |
T12767 |
amod |
liquid,nitrogen |
| R8232 |
T12767 |
T12768 |
npadvmod |
nitrogen,cooled |
| R8233 |
T12768 |
T12765 |
amod |
cooled,Gevebesmascher |
| R8234 |
T12769 |
T12768 |
punct |
-,cooled |
| R8235 |
T12770 |
T12756 |
cc |
and,pulverized |
| R8236 |
T12771 |
T12772 |
det |
the,powder |
| R8237 |
T12772 |
T12773 |
nsubj |
powder,scraped |
| R8238 |
T12773 |
T12756 |
conj |
scraped,pulverized |
| R8239 |
T12774 |
T12773 |
prep |
into,scraped |
| R824 |
T1625 |
T1611 |
nsubjpass |
morphogenesis,blocked |
| R8240 |
T12775 |
T12776 |
det |
a,tube |
| R8241 |
T12776 |
T12774 |
pobj |
tube,into |
| R8242 |
T12777 |
T12776 |
amod |
chilled,tube |
| R8243 |
T12778 |
T12776 |
compound |
microcentrifuge,tube |
| R8244 |
T12779 |
T12756 |
punct |
.,pulverized |
| R8245 |
T12781 |
T12782 |
compound |
RIPA,buffer |
| R8246 |
T12782 |
T12783 |
nsubjpass |
buffer,added |
| R8247 |
T12784 |
T12785 |
punct |
(,X |
| R8248 |
T12785 |
T12782 |
parataxis |
X,buffer |
| R8249 |
T12786 |
T12787 |
nummod |
1,% |
| R825 |
T1626 |
T1611 |
auxpass |
is,blocked |
| R8250 |
T12787 |
T12785 |
compound |
%,X |
| R8251 |
T12788 |
T12785 |
compound |
Triton,X |
| R8252 |
T12789 |
T12785 |
punct |
-,X |
| R8253 |
T12790 |
T12785 |
nummod |
100,X |
| R8254 |
T12791 |
T12785 |
prep |
in,X |
| R8255 |
T12792 |
T12791 |
pobj |
PBS,in |
| R8256 |
T12793 |
T12785 |
prep |
with,X |
| R8257 |
T12794 |
T12795 |
nummod |
10,mM |
| R8258 |
T12795 |
T12796 |
compound |
mM,EDTA |
| R8259 |
T12796 |
T12793 |
pobj |
EDTA,with |
| R826 |
T1627 |
T1611 |
punct |
", ",blocked |
| R8260 |
T12797 |
T12796 |
punct |
", ",EDTA |
| R8261 |
T12798 |
T12799 |
nummod |
150,mN |
| R8262 |
T12799 |
T12800 |
compound |
mN,NaCl |
| R8263 |
T12800 |
T12796 |
conj |
NaCl,EDTA |
| R8264 |
T12801 |
T12800 |
punct |
", ",NaCl |
| R8265 |
T12802 |
T12803 |
nummod |
1,% |
| R8266 |
T12803 |
T12804 |
compound |
%,deoxycholate |
| R8267 |
T12804 |
T12800 |
conj |
deoxycholate,NaCl |
| R8268 |
T12805 |
T12804 |
compound |
sodium,deoxycholate |
| R8269 |
T12806 |
T12804 |
punct |
", ",deoxycholate |
| R827 |
T1703 |
T1704 |
aux |
to,stabilize |
| R8270 |
T12807 |
T12804 |
cc |
and,deoxycholate |
| R8271 |
T12808 |
T12809 |
nummod |
0.1,% |
| R8272 |
T12809 |
T12810 |
compound |
%,SDS |
| R8273 |
T12810 |
T12804 |
conj |
SDS,deoxycholate |
| R8274 |
T12811 |
T12785 |
punct |
),X |
| R8275 |
T12812 |
T12782 |
cc |
and,buffer |
| R8276 |
T12813 |
T12814 |
compound |
protease,inhibitors |
| R8277 |
T12814 |
T12782 |
conj |
inhibitors,buffer |
| R8278 |
T12815 |
T12814 |
cc |
or,inhibitors |
| R8279 |
T12816 |
T12817 |
compound |
Laemmli,buffer |
| R828 |
T1628 |
T1611 |
advcl |
suggesting,blocked |
| R8280 |
T12817 |
T12814 |
conj |
buffer,inhibitors |
| R8281 |
T12818 |
T12783 |
auxpass |
was,added |
| R8282 |
T12819 |
T12783 |
punct |
.,added |
| R8283 |
T12821 |
T12822 |
det |
The,suspension |
| R8284 |
T12822 |
T12824 |
nsubjpass |
suspension,sonicated |
| R8285 |
T12823 |
T12822 |
compound |
cell,suspension |
| R8286 |
T12825 |
T12824 |
auxpass |
was,sonicated |
| R8287 |
T12826 |
T12827 |
nummod |
three,times |
| R8288 |
T12827 |
T12824 |
npadvmod |
times,sonicated |
| R8289 |
T12828 |
T12824 |
prep |
for,sonicated |
| R829 |
T1629 |
T1630 |
mark |
that,is |
| R8290 |
T12829 |
T12830 |
nummod |
15,s |
| R8291 |
T12830 |
T12828 |
pobj |
s,for |
| R8292 |
T12831 |
T12824 |
cc |
and,sonicated |
| R8293 |
T12832 |
T12824 |
conj |
centrifuged,sonicated |
| R8294 |
T12833 |
T12832 |
prep |
at,centrifuged |
| R8295 |
T12834 |
T12835 |
nummod |
"14,000",rpm |
| R8296 |
T12835 |
T12833 |
pobj |
rpm,at |
| R8297 |
T12836 |
T12832 |
prep |
at,centrifuged |
| R8298 |
T12837 |
T12838 |
nummod |
4,°C |
| R8299 |
T12838 |
T12836 |
pobj |
°C,at |
| R83 |
T237 |
T231 |
acomp |
necessary,is |
| R830 |
T1630 |
T1628 |
ccomp |
is,suggesting |
| R8300 |
T12839 |
T12824 |
punct |
.,sonicated |
| R8301 |
T12841 |
T12842 |
det |
The,supernatant |
| R8302 |
T12842 |
T12843 |
nsubjpass |
supernatant,separated |
| R8303 |
T12844 |
T12843 |
auxpass |
was,separated |
| R8304 |
T12845 |
T12843 |
prep |
from,separated |
| R8305 |
T12846 |
T12847 |
det |
the,pellet |
| R8306 |
T12847 |
T12845 |
pobj |
pellet,from |
| R8307 |
T12848 |
T12843 |
cc |
and,separated |
| R8308 |
T12849 |
T12843 |
conj |
used,separated |
| R8309 |
T12850 |
T12849 |
prep |
in,used |
| R831 |
T1704 |
T1702 |
xcomp |
stabilize,necessary |
| R8310 |
T12851 |
T12852 |
det |
the,experiments |
| R8311 |
T12852 |
T12850 |
pobj |
experiments,in |
| R8312 |
T12853 |
T12843 |
punct |
.,separated |
| R8313 |
T12855 |
T12856 |
nsubjpass |
Extracts,precleared |
| R8314 |
T12857 |
T12855 |
acl |
subjected,Extracts |
| R8315 |
T12858 |
T12857 |
prep |
to,subjected |
| R8316 |
T12859 |
T12858 |
pobj |
immunoprecipitation,to |
| R8317 |
T12860 |
T12856 |
auxpass |
were,precleared |
| R8318 |
T12861 |
T12856 |
prep |
with,precleared |
| R8319 |
T12862 |
T12863 |
compound |
Protein,G |
| R832 |
T1631 |
T1632 |
nmod |
E,cadherin |
| R8320 |
T12863 |
T12864 |
compound |
G,Sepharose |
| R8321 |
T12864 |
T12861 |
pobj |
Sepharose,with |
| R8322 |
T12865 |
T12866 |
punct |
(,Amersham |
| R8323 |
T12866 |
T12864 |
parataxis |
Amersham,Sepharose |
| R8324 |
T12867 |
T12866 |
punct |
", ",Amersham |
| R8325 |
T12868 |
T12866 |
npadvmod |
Piscataway,Amersham |
| R8326 |
T12869 |
T12866 |
punct |
", ",Amersham |
| R8327 |
T12870 |
T12871 |
compound |
New,York |
| R8328 |
T12871 |
T12866 |
npadvmod |
York,Amersham |
| R8329 |
T12872 |
T12866 |
punct |
", ",Amersham |
| R833 |
T1632 |
T1634 |
nmod |
cadherin,regulation |
| R8330 |
T12873 |
T12874 |
compound |
United,States |
| R8331 |
T12874 |
T12866 |
npadvmod |
States,Amersham |
| R8332 |
T12875 |
T12866 |
punct |
),Amersham |
| R8333 |
T12876 |
T12856 |
cc |
and,precleared |
| R8334 |
T12877 |
T12856 |
conj |
incubated,precleared |
| R8335 |
T12878 |
T12877 |
prep |
with,incubated |
| R8336 |
T12879 |
T12878 |
pobj |
antibody,with |
| R8337 |
T12880 |
T12877 |
prep |
with,incubated |
| R8338 |
T12881 |
T12880 |
pobj |
rocking,with |
| R8339 |
T12882 |
T12877 |
advmod |
overnight,incubated |
| R834 |
T1705 |
T1706 |
amod |
nascent,AJs |
| R8340 |
T12883 |
T12877 |
prep |
at,incubated |
| R8341 |
T12884 |
T12885 |
nummod |
4,°C |
| R8342 |
T12885 |
T12883 |
pobj |
°C,at |
| R8343 |
T12886 |
T12856 |
punct |
.,precleared |
| R8344 |
T12888 |
T12889 |
compound |
Protein,G |
| R8345 |
T12889 |
T12890 |
compound |
G,Sepharose |
| R8346 |
T12890 |
T12891 |
nsubjpass |
Sepharose,added |
| R8347 |
T12892 |
T12891 |
auxpass |
was,added |
| R8348 |
T12893 |
T12891 |
cc |
and,added |
| R8349 |
T12894 |
T12895 |
nsubjpass |
samples,incubated |
| R835 |
T1633 |
T1632 |
punct |
-,cadherin |
| R8350 |
T12895 |
T12891 |
conj |
incubated,added |
| R8351 |
T12896 |
T12895 |
auxpass |
were,incubated |
| R8352 |
T12897 |
T12895 |
prep |
for,incubated |
| R8353 |
T12898 |
T12899 |
nummod |
1,h |
| R8354 |
T12899 |
T12897 |
pobj |
h,for |
| R8355 |
T12900 |
T12895 |
prep |
at,incubated |
| R8356 |
T12901 |
T12902 |
nummod |
4,°C |
| R8357 |
T12902 |
T12900 |
pobj |
°C,at |
| R8358 |
T12903 |
T12895 |
prep |
with,incubated |
| R8359 |
T12904 |
T12903 |
pobj |
rocking,with |
| R836 |
T1634 |
T1630 |
nsubj |
regulation,is |
| R8360 |
T12905 |
T12895 |
punct |
.,incubated |
| R8361 |
T12907 |
T12908 |
nsubjpass |
Samples,washed |
| R8362 |
T12909 |
T12908 |
auxpass |
were,washed |
| R8363 |
T12910 |
T12911 |
nummod |
three,times |
| R8364 |
T12911 |
T12908 |
npadvmod |
times,washed |
| R8365 |
T12912 |
T12908 |
prep |
for,washed |
| R8366 |
T12913 |
T12914 |
nummod |
5,min |
| R8367 |
T12914 |
T12912 |
pobj |
min,for |
| R8368 |
T12915 |
T12914 |
advmod |
each,min |
| R8369 |
T12916 |
T12908 |
prep |
in,washed |
| R837 |
T1635 |
T1634 |
amod |
down,regulation |
| R8370 |
T12917 |
T12918 |
compound |
lysis,buffer |
| R8371 |
T12918 |
T12916 |
pobj |
buffer,in |
| R8372 |
T12919 |
T12908 |
punct |
", ",washed |
| R8373 |
T12920 |
T12908 |
cc |
and,washed |
| R8374 |
T12921 |
T12922 |
det |
the,pellet |
| R8375 |
T12922 |
T12930 |
nsubjpass |
pellet,resuspended |
| R8376 |
T12923 |
T12924 |
compound |
Protein,G |
| R8377 |
T12924 |
T12925 |
compound |
G,antigen |
| R8378 |
T12925 |
T12922 |
compound |
antigen,pellet |
| R8379 |
T12926 |
T12925 |
compound |
Sepharose,antigen |
| R838 |
T1706 |
T1704 |
dobj |
AJs,stabilize |
| R8380 |
T12927 |
T12925 |
punct |
-,antigen |
| R8381 |
T12928 |
T12925 |
compound |
antibody,antigen |
| R8382 |
T12929 |
T12925 |
punct |
-,antigen |
| R8383 |
T12930 |
T12908 |
conj |
resuspended,washed |
| R8384 |
T12931 |
T12930 |
auxpass |
was,resuspended |
| R8385 |
T12932 |
T12930 |
prep |
in,resuspended |
| R8386 |
T12933 |
T12934 |
compound |
Laemmli,buffer |
| R8387 |
T12934 |
T12932 |
pobj |
buffer,in |
| R8388 |
T12935 |
T12930 |
cc |
and,resuspended |
| R8389 |
T12936 |
T12930 |
conj |
boiled,resuspended |
| R839 |
T1636 |
T1634 |
punct |
-,regulation |
| R8390 |
T12937 |
T12936 |
prep |
for,boiled |
| R8391 |
T12938 |
T12939 |
nummod |
10,min |
| R8392 |
T12939 |
T12937 |
pobj |
min,for |
| R8393 |
T12940 |
T12930 |
punct |
.,resuspended |
| R8394 |
T12942 |
T12943 |
nsubjpass |
Samples,run |
| R8395 |
T12944 |
T12943 |
auxpass |
were,run |
| R8396 |
T12945 |
T12943 |
prep |
on,run |
| R8397 |
T12946 |
T12947 |
compound |
SDS,PAGE |
| R8398 |
T12947 |
T12945 |
pobj |
PAGE,on |
| R8399 |
T12948 |
T12947 |
punct |
-,PAGE |
| R84 |
T238 |
T239 |
aux |
to,induce |
| R840 |
T1637 |
T1638 |
det |
a,event |
| R8400 |
T12949 |
T12943 |
cc |
and,run |
| R8401 |
T12950 |
T12943 |
conj |
transferred,run |
| R8402 |
T12951 |
T12950 |
prep |
to,transferred |
| R8403 |
T12952 |
T12953 |
compound |
nitrocellulose,membrane |
| R8404 |
T12953 |
T12951 |
pobj |
membrane,to |
| R8405 |
T12954 |
T12955 |
punct |
(,Bioscience |
| R8406 |
T12955 |
T12953 |
parataxis |
Bioscience,membrane |
| R8407 |
T12956 |
T12955 |
nmod |
Schleicher,Bioscience |
| R8408 |
T12957 |
T12956 |
cc |
and,Schleicher |
| R8409 |
T12958 |
T12956 |
conj |
Schuell,Schleicher |
| R841 |
T1638 |
T1630 |
attr |
event,is |
| R8410 |
T12959 |
T12955 |
punct |
", ",Bioscience |
| R8411 |
T12960 |
T12955 |
npadvmod |
Keene,Bioscience |
| R8412 |
T12961 |
T12955 |
punct |
", ",Bioscience |
| R8413 |
T12962 |
T12963 |
compound |
New,Hampshire |
| R8414 |
T12963 |
T12955 |
npadvmod |
Hampshire,Bioscience |
| R8415 |
T12964 |
T12955 |
punct |
", ",Bioscience |
| R8416 |
T12965 |
T12966 |
compound |
United,States |
| R8417 |
T12966 |
T12955 |
npadvmod |
States,Bioscience |
| R8418 |
T12967 |
T12955 |
punct |
),Bioscience |
| R8419 |
T12968 |
T12943 |
punct |
.,run |
| R842 |
T1639 |
T1638 |
amod |
critical,event |
| R8420 |
T12970 |
T12971 |
compound |
Western,blot |
| R8421 |
T12971 |
T12972 |
compound |
blot,signals |
| R8422 |
T12972 |
T12973 |
nsubjpass |
signals,developed |
| R8423 |
T12974 |
T12973 |
auxpass |
were,developed |
| R8424 |
T12975 |
T12973 |
advcl |
using,developed |
| R8425 |
T12976 |
T12977 |
det |
the,kit |
| R8426 |
T12977 |
T12975 |
dobj |
kit,using |
| R8427 |
T12978 |
T12977 |
amod |
enhanced,kit |
| R8428 |
T12979 |
T12977 |
compound |
chemiluminescence,kit |
| R8429 |
T12980 |
T12977 |
prep |
from,kit |
| R843 |
T1640 |
T1638 |
prep |
in,event |
| R8430 |
T12981 |
T12980 |
pobj |
Amersham,from |
| R8431 |
T13041 |
T13042 |
compound |
Cell,culture |
| R8432 |
T13044 |
T13045 |
amod |
Primary,keratinocytes |
| R8433 |
T13045 |
T13046 |
nsubjpass |
keratinocytes,culture |
| R8434 |
T13047 |
T13046 |
auxpass |
were,culture |
| R8435 |
T13048 |
T13046 |
prep |
in,culture |
| R8436 |
T13049 |
T13050 |
amod |
low,calcium |
| R8437 |
T13050 |
T13052 |
compound |
calcium,medium |
| R8438 |
T13051 |
T13050 |
punct |
-,calcium |
| R8439 |
T13052 |
T13048 |
pobj |
medium,in |
| R844 |
T1707 |
T1704 |
cc |
and,stabilize |
| R8440 |
T13053 |
T13054 |
mark |
as,described |
| R8441 |
T13054 |
T13046 |
advcl |
described,culture |
| R8442 |
T13055 |
T13054 |
advmod |
previously,described |
| R8443 |
T13056 |
T13057 |
punct |
[,4 |
| R8444 |
T13057 |
T13046 |
parataxis |
4,culture |
| R8445 |
T13058 |
T13057 |
punct |
],4 |
| R8446 |
T13059 |
T13046 |
punct |
.,culture |
| R8447 |
T13061 |
T13062 |
amod |
Transient,transfections |
| R8448 |
T13062 |
T13063 |
nsubjpass |
transfections,carried |
| R8449 |
T13064 |
T13063 |
auxpass |
were,carried |
| R845 |
T1708 |
T1704 |
conj |
integrate,stabilize |
| R8450 |
T13065 |
T13063 |
prt |
out,carried |
| R8451 |
T13066 |
T13063 |
prep |
with,carried |
| R8452 |
T13067 |
T13068 |
compound |
FuGENE6,reagent |
| R8453 |
T13068 |
T13066 |
pobj |
reagent,with |
| R8454 |
T13069 |
T13070 |
punct |
(,Roche |
| R8455 |
T13070 |
T13068 |
parataxis |
Roche,reagent |
| R8456 |
T13071 |
T13070 |
punct |
", ",Roche |
| R8457 |
T13072 |
T13070 |
npadvmod |
Indianapolis,Roche |
| R8458 |
T13073 |
T13070 |
punct |
", ",Roche |
| R8459 |
T13074 |
T13070 |
npadvmod |
Indiana,Roche |
| R846 |
T1641 |
T1640 |
pcomp |
governing,in |
| R8460 |
T13075 |
T13070 |
punct |
", ",Roche |
| R8461 |
T13076 |
T13077 |
compound |
United,States |
| R8462 |
T13077 |
T13070 |
npadvmod |
States,Roche |
| R8463 |
T13078 |
T13070 |
punct |
),Roche |
| R8464 |
T13079 |
T13063 |
prep |
according,carried |
| R8465 |
T13080 |
T13079 |
prep |
to,according |
| R8466 |
T13081 |
T13082 |
det |
the,manufacturer |
| R8467 |
T13082 |
T13083 |
poss |
manufacturer,protocol |
| R8468 |
T13083 |
T13080 |
pobj |
protocol,to |
| R8469 |
T13084 |
T13082 |
case |
's,manufacturer |
| R847 |
T1709 |
T1710 |
det |
the,cytoskeleton |
| R8470 |
T13085 |
T13063 |
punct |
.,carried |
| R8471 |
T13087 |
T13088 |
nsubjpass |
Measurement,carried |
| R8472 |
T13089 |
T13087 |
prep |
of,Measurement |
| R8473 |
T13090 |
T13091 |
nmod |
β,galactosidase |
| R8474 |
T13091 |
T13093 |
nmod |
galactosidase,levels |
| R8475 |
T13092 |
T13091 |
punct |
-,galactosidase |
| R8476 |
T13093 |
T13089 |
pobj |
levels,of |
| R8477 |
T13094 |
T13091 |
cc |
or,galactosidase |
| R8478 |
T13095 |
T13091 |
conj |
luciferase,galactosidase |
| R8479 |
T13096 |
T13088 |
prep |
in,carried |
| R848 |
T1642 |
T1643 |
det |
the,dynamics |
| R8480 |
T13097 |
T13098 |
compound |
promoter,activity |
| R8481 |
T13098 |
T13099 |
compound |
activity,studies |
| R8482 |
T13099 |
T13096 |
pobj |
studies,in |
| R8483 |
T13100 |
T13088 |
auxpass |
were,carried |
| R8484 |
T13101 |
T13088 |
prt |
out,carried |
| R8485 |
T13102 |
T13088 |
prep |
with,carried |
| R8486 |
T13103 |
T13104 |
det |
the,kit |
| R8487 |
T13104 |
T13102 |
pobj |
kit,with |
| R8488 |
T13105 |
T13106 |
compound |
Galacto,Lite |
| R8489 |
T13106 |
T13104 |
compound |
Lite,kit |
| R849 |
T1643 |
T1641 |
dobj |
dynamics,governing |
| R8490 |
T13107 |
T13106 |
punct |
-,Lite |
| R8491 |
T13108 |
T13104 |
compound |
assay,kit |
| R8492 |
T13109 |
T13110 |
punct |
(,TROPIX |
| R8493 |
T13110 |
T13104 |
parataxis |
TROPIX,kit |
| R8494 |
T13111 |
T13110 |
punct |
", ",TROPIX |
| R8495 |
T13112 |
T13110 |
npadvmod |
Bedford,TROPIX |
| R8496 |
T13113 |
T13110 |
punct |
", ",TROPIX |
| R8497 |
T13114 |
T13110 |
npadvmod |
Massachusetts,TROPIX |
| R8498 |
T13115 |
T13110 |
punct |
", ",TROPIX |
| R8499 |
T13116 |
T13117 |
compound |
United,States |
| R85 |
T239 |
T231 |
advcl |
induce,is |
| R850 |
T1644 |
T1643 |
compound |
adhesion,dynamics |
| R8500 |
T13117 |
T13110 |
npadvmod |
States,TROPIX |
| R8501 |
T13118 |
T13110 |
punct |
),TROPIX |
| R8502 |
T13119 |
T13104 |
cc |
and,kit |
| R8503 |
T13120 |
T13121 |
det |
the,luciferase |
| R8504 |
T13121 |
T13104 |
conj |
luciferase,kit |
| R8505 |
T13122 |
T13121 |
amod |
Dual,luciferase |
| R8506 |
T13123 |
T13124 |
punct |
(,Promega |
| R8507 |
T13124 |
T13121 |
parataxis |
Promega,luciferase |
| R8508 |
T13125 |
T13124 |
punct |
", ",Promega |
| R8509 |
T13126 |
T13124 |
npadvmod |
Madison,Promega |
| R851 |
T1710 |
T1708 |
dobj |
cytoskeleton,integrate |
| R8510 |
T13127 |
T13124 |
punct |
", ",Promega |
| R8511 |
T13128 |
T13124 |
npadvmod |
Wisconsin,Promega |
| R8512 |
T13129 |
T13124 |
punct |
", ",Promega |
| R8513 |
T13130 |
T13131 |
compound |
United,States |
| R8514 |
T13131 |
T13124 |
npadvmod |
States,Promega |
| R8515 |
T13132 |
T13124 |
punct |
),Promega |
| R8516 |
T13133 |
T13121 |
punct |
", ",luciferase |
| R8517 |
T13134 |
T13088 |
advmod |
respectively,carried |
| R8518 |
T13135 |
T13088 |
punct |
.,carried |
| R8519 |
T13137 |
T13138 |
compound |
Runella,luciferase |
| R852 |
T1645 |
T1643 |
amod |
necessary,dynamics |
| R8520 |
T13138 |
T13139 |
nsubjpass |
luciferase,cotransfected |
| R8521 |
T13140 |
T13139 |
auxpass |
was,cotransfected |
| R8522 |
T13141 |
T13139 |
prep |
into,cotransfected |
| R8523 |
T13142 |
T13141 |
pobj |
cells,into |
| R8524 |
T13143 |
T13144 |
aux |
to,correct |
| R8525 |
T13144 |
T13139 |
advcl |
correct,cotransfected |
| R8526 |
T13145 |
T13144 |
prep |
for,correct |
| R8527 |
T13146 |
T13147 |
compound |
transfection,efficiency |
| R8528 |
T13147 |
T13145 |
pobj |
efficiency,for |
| R8529 |
T13148 |
T13139 |
punct |
.,cotransfected |
| R853 |
T1646 |
T1645 |
prep |
for,necessary |
| R8530 |
T13150 |
T13151 |
nsubjpass |
Experiments,done |
| R8531 |
T13152 |
T13151 |
auxpass |
were,done |
| R8532 |
T13153 |
T13151 |
prep |
in,done |
| R8533 |
T13154 |
T13153 |
pobj |
triplicate,in |
| R8534 |
T13155 |
T13151 |
cc |
and,done |
| R8535 |
T13156 |
T13151 |
conj |
repeated,done |
| R8536 |
T13157 |
T13158 |
advmod |
at,three |
| R8537 |
T13158 |
T13160 |
nummod |
three,times |
| R8538 |
T13159 |
T13158 |
advmod |
least,three |
| R8539 |
T13160 |
T13156 |
npadvmod |
times,repeated |
| R854 |
T1647 |
T1648 |
compound |
budding,morphogenesis |
| R8540 |
T13161 |
T13151 |
punct |
.,done |
| R8541 |
T13163 |
T13164 |
nsubjpass |
Measurements,done |
| R8542 |
T13165 |
T13164 |
auxpass |
were,done |
| R8543 |
T13166 |
T13164 |
prep |
on,done |
| R8544 |
T13167 |
T13168 |
det |
a,luminometer |
| R8545 |
T13168 |
T13166 |
pobj |
luminometer,on |
| R8546 |
T13169 |
T13170 |
punct |
(,Instruments |
| R8547 |
T13170 |
T13168 |
parataxis |
Instruments,luminometer |
| R8548 |
T13171 |
T13170 |
compound |
MGM,Instruments |
| R8549 |
T13172 |
T13170 |
punct |
", ",Instruments |
| R855 |
T1711 |
T1708 |
prep |
across,integrate |
| R8550 |
T13173 |
T13170 |
npadvmod |
Hamden,Instruments |
| R8551 |
T13174 |
T13170 |
punct |
", ",Instruments |
| R8552 |
T13175 |
T13170 |
npadvmod |
Connecticut,Instruments |
| R8553 |
T13176 |
T13170 |
punct |
", ",Instruments |
| R8554 |
T13177 |
T13178 |
compound |
United,States |
| R8555 |
T13178 |
T13170 |
npadvmod |
States,Instruments |
| R8556 |
T13179 |
T13170 |
punct |
),Instruments |
| R8557 |
T13180 |
T13164 |
punct |
.,done |
| R8558 |
T13182 |
T13183 |
prep |
For,starved |
| R8559 |
T13184 |
T13182 |
pobj |
experiments,For |
| R856 |
T1648 |
T1646 |
pobj |
morphogenesis,for |
| R8560 |
T13185 |
T13184 |
acl |
measuring,experiments |
| R8561 |
T13186 |
T13185 |
dobj |
phosphorylation,measuring |
| R8562 |
T13187 |
T13186 |
prep |
of,phosphorylation |
| R8563 |
T13188 |
T13187 |
pobj |
MAPK,of |
| R8564 |
T13189 |
T13183 |
punct |
", ",starved |
| R8565 |
T13190 |
T13183 |
nsubjpass |
keratinocytes,starved |
| R8566 |
T13191 |
T13183 |
auxpass |
were,starved |
| R8567 |
T13192 |
T13183 |
dep |
serum,starved |
| R8568 |
T13193 |
T13183 |
prep |
for,starved |
| R8569 |
T13194 |
T13195 |
nummod |
3,h |
| R857 |
T1649 |
T1650 |
punct |
[,4 |
| R8570 |
T13195 |
T13193 |
pobj |
h,for |
| R8571 |
T13196 |
T13197 |
amod |
prior,to |
| R8572 |
T13197 |
T13183 |
prep |
to,starved |
| R8573 |
T13198 |
T13197 |
pobj |
harvesting,to |
| R8574 |
T13199 |
T13198 |
prep |
of,harvesting |
| R8575 |
T13200 |
T13199 |
pobj |
cells,of |
| R8576 |
T13201 |
T13198 |
prep |
by,harvesting |
| R8577 |
T13202 |
T13201 |
pobj |
incubation,by |
| R8578 |
T13203 |
T13202 |
prep |
in,incubation |
| R8579 |
T13204 |
T13203 |
pobj |
medium,in |
| R858 |
T1712 |
T1713 |
det |
an,sheet |
| R8580 |
T13205 |
T13204 |
acl |
lacking,medium |
| R8581 |
T13206 |
T13205 |
dobj |
serum,lacking |
| R8582 |
T13207 |
T13183 |
punct |
.,starved |
| R8583 |
T13209 |
T13210 |
nsubjpass |
Treatment,described |
| R8584 |
T13211 |
T13209 |
prep |
of,Treatment |
| R8585 |
T13212 |
T13211 |
pobj |
cells,of |
| R8586 |
T13213 |
T13209 |
prep |
with,Treatment |
| R8587 |
T13214 |
T13215 |
npadvmod |
Wnt,conditioned |
| R8588 |
T13215 |
T13220 |
amod |
conditioned,medium |
| R8589 |
T13216 |
T13214 |
punct |
-,Wnt |
| R859 |
T1650 |
T1608 |
parataxis |
4,showed |
| R8590 |
T13217 |
T13214 |
cc |
and,Wnt |
| R8591 |
T13218 |
T13214 |
conj |
noggin,Wnt |
| R8592 |
T13219 |
T13215 |
punct |
-,conditioned |
| R8593 |
T13220 |
T13213 |
pobj |
medium,with |
| R8594 |
T13221 |
T13210 |
auxpass |
was,described |
| R8595 |
T13222 |
T13210 |
advmod |
previously,described |
| R8596 |
T13223 |
T13224 |
punct |
[,4 |
| R8597 |
T13224 |
T13210 |
parataxis |
4,described |
| R8598 |
T13225 |
T13224 |
punct |
],4 |
| R8599 |
T13226 |
T13210 |
punct |
.,described |
| R86 |
T240 |
T239 |
advmod |
transiently,induce |
| R860 |
T1651 |
T1650 |
punct |
],4 |
| R8600 |
T13310 |
T13311 |
det |
The,promoter |
| R8601 |
T13311 |
T13317 |
nsubjpass |
promoter,generated |
| R8602 |
T13312 |
T13313 |
nummod |
2.2,kb |
| R8603 |
T13313 |
T13311 |
nmod |
kb,promoter |
| R8604 |
T13314 |
T13313 |
punct |
-,kb |
| R8605 |
T13315 |
T13311 |
amod |
murine,promoter |
| R8606 |
T13316 |
T13311 |
compound |
Snail,promoter |
| R8607 |
T13318 |
T13317 |
auxpass |
was,generated |
| R8608 |
T13319 |
T13317 |
prep |
by,generated |
| R8609 |
T13320 |
T13319 |
pobj |
PCR,by |
| R861 |
T1652 |
T1608 |
punct |
.,showed |
| R8610 |
T13321 |
T13317 |
advcl |
using,generated |
| R8611 |
T13322 |
T13323 |
det |
a,primer |
| R8612 |
T13323 |
T13321 |
dobj |
primer,using |
| R8613 |
T13324 |
T13323 |
amod |
forward,primer |
| R8614 |
T13325 |
T13321 |
prep |
with,using |
| R8615 |
T13326 |
T13327 |
det |
an,sequence |
| R8616 |
T13327 |
T13325 |
pobj |
sequence,with |
| R8617 |
T13328 |
T13327 |
compound |
XbaI,sequence |
| R8618 |
T13329 |
T13327 |
compound |
linker,sequence |
| R8619 |
T13330 |
T13327 |
punct |
", ",sequence |
| R862 |
T1713 |
T1711 |
pobj |
sheet,across |
| R8620 |
T13331 |
T13332 |
nummod |
5,TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
| R8621 |
T13332 |
T13327 |
appos |
TCTAGAATTGTTTGCTGCTGTATGGTCTTC,sequence |
| R8622 |
T13333 |
T13331 |
punct |
′,5 |
| R8623 |
T13334 |
T13332 |
punct |
-,TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
| R8624 |
T13335 |
T13332 |
punct |
-,TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
| R8625 |
T13336 |
T13332 |
nummod |
3,TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
| R8626 |
T13337 |
T13332 |
punct |
′,TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
| R8627 |
T13338 |
T13327 |
punct |
", ",sequence |
| R8628 |
T13339 |
T13327 |
cc |
along,sequence |
| R8629 |
T13340 |
T13339 |
dep |
with,along |
| R863 |
T1654 |
T1655 |
prep |
Like,binds |
| R8630 |
T13341 |
T13342 |
det |
a,primer |
| R8631 |
T13342 |
T13327 |
conj |
primer,sequence |
| R8632 |
T13343 |
T13342 |
amod |
reverse,primer |
| R8633 |
T13344 |
T13342 |
prep |
with,primer |
| R8634 |
T13345 |
T13346 |
det |
a,sequence |
| R8635 |
T13346 |
T13344 |
pobj |
sequence,with |
| R8636 |
T13347 |
T13346 |
compound |
BglII,sequence |
| R8637 |
T13348 |
T13346 |
compound |
linker,sequence |
| R8638 |
T13349 |
T13346 |
punct |
", ",sequence |
| R8639 |
T13350 |
T13351 |
nummod |
5,GTAG |
| R864 |
T1714 |
T1713 |
amod |
epithelial,sheet |
| R8640 |
T13351 |
T13346 |
appos |
GTAG,sequence |
| R8641 |
T13352 |
T13350 |
punct |
′,5 |
| R8642 |
T13353 |
T13351 |
punct |
-,GTAG |
| R8643 |
T13354 |
T13351 |
compound |
AGATCTGTTGGCCAGAGCGACCTAG,GTAG |
| R8644 |
T13355 |
T13351 |
punct |
-,GTAG |
| R8645 |
T13356 |
T13351 |
punct |
-,GTAG |
| R8646 |
T13357 |
T13351 |
nummod |
3,GTAG |
| R8647 |
T13358 |
T13351 |
punct |
′,GTAG |
| R8648 |
T13359 |
T13342 |
punct |
", ",primer |
| R8649 |
T13360 |
T13342 |
cc |
and,primer |
| R865 |
T1656 |
T1654 |
pobj |
LEF,Like |
| R8650 |
T13361 |
T13362 |
nmod |
mouse,DNA |
| R8651 |
T13362 |
T13342 |
conj |
DNA,primer |
| R8652 |
T13363 |
T13362 |
amod |
genomic,DNA |
| R8653 |
T13364 |
T13362 |
prep |
as,DNA |
| R8654 |
T13365 |
T13366 |
det |
a,template |
| R8655 |
T13366 |
T13364 |
pobj |
template,as |
| R8656 |
T13367 |
T13317 |
punct |
.,generated |
| R8657 |
T13369 |
T13370 |
det |
The,product |
| R8658 |
T13370 |
T13372 |
nsubjpass |
product,purified |
| R8659 |
T13371 |
T13370 |
compound |
PCR,product |
| R866 |
T1657 |
T1656 |
punct |
-,LEF |
| R8660 |
T13373 |
T13372 |
auxpass |
was,purified |
| R8661 |
T13374 |
T13372 |
prep |
with,purified |
| R8662 |
T13375 |
T13376 |
det |
the,Kit |
| R8663 |
T13376 |
T13374 |
pobj |
Kit,with |
| R8664 |
T13377 |
T13378 |
compound |
Gel,Extraction |
| R8665 |
T13378 |
T13376 |
compound |
Extraction,Kit |
| R8666 |
T13379 |
T13380 |
punct |
(,Qiagen |
| R8667 |
T13380 |
T13376 |
parataxis |
Qiagen,Kit |
| R8668 |
T13381 |
T13380 |
punct |
", ",Qiagen |
| R8669 |
T13382 |
T13380 |
npadvmod |
Valencia,Qiagen |
| R867 |
T1715 |
T1716 |
punct |
[,8 |
| R8670 |
T13383 |
T13380 |
punct |
", ",Qiagen |
| R8671 |
T13384 |
T13380 |
npadvmod |
California,Qiagen |
| R8672 |
T13385 |
T13380 |
punct |
", ",Qiagen |
| R8673 |
T13386 |
T13387 |
compound |
United,States |
| R8674 |
T13387 |
T13380 |
npadvmod |
States,Qiagen |
| R8675 |
T13388 |
T13380 |
punct |
),Qiagen |
| R8676 |
T13389 |
T13372 |
cc |
and,purified |
| R8677 |
T13390 |
T13372 |
conj |
ligated,purified |
| R8678 |
T13391 |
T13390 |
prep |
into,ligated |
| R8679 |
T13392 |
T13393 |
compound |
pCRII,TOPO |
| R868 |
T1658 |
T1656 |
nummod |
1,LEF |
| R8680 |
T13393 |
T13395 |
compound |
TOPO,vector |
| R8681 |
T13394 |
T13393 |
punct |
-,TOPO |
| R8682 |
T13395 |
T13391 |
pobj |
vector,into |
| R8683 |
T13396 |
T13395 |
compound |
TA,vector |
| R8684 |
T13397 |
T13398 |
punct |
(,Invitrogen |
| R8685 |
T13398 |
T13395 |
parataxis |
Invitrogen,vector |
| R8686 |
T13399 |
T13398 |
punct |
", ",Invitrogen |
| R8687 |
T13400 |
T13398 |
npadvmod |
Carlsbad,Invitrogen |
| R8688 |
T13401 |
T13398 |
punct |
", ",Invitrogen |
| R8689 |
T13402 |
T13398 |
npadvmod |
California,Invitrogen |
| R869 |
T1659 |
T1655 |
punct |
", ",binds |
| R8690 |
T13403 |
T13398 |
punct |
", ",Invitrogen |
| R8691 |
T13404 |
T13405 |
compound |
United,States |
| R8692 |
T13405 |
T13398 |
npadvmod |
States,Invitrogen |
| R8693 |
T13406 |
T13398 |
punct |
),Invitrogen |
| R8694 |
T13407 |
T13372 |
punct |
.,purified |
| R8695 |
T13409 |
T13410 |
det |
The,promoter |
| R8696 |
T13410 |
T13411 |
nsubjpass |
promoter,verified |
| R8697 |
T13412 |
T13411 |
auxpass |
was,verified |
| R8698 |
T13413 |
T13411 |
prep |
by,verified |
| R8699 |
T13414 |
T13413 |
pobj |
sequencing,by |
| R87 |
T241 |
T242 |
det |
the,Snail |
| R870 |
T1660 |
T1661 |
compound |
E,cadherin |
| R8700 |
T13415 |
T13411 |
cc |
and,verified |
| R8701 |
T13416 |
T13411 |
conj |
digested,verified |
| R8702 |
T13417 |
T13416 |
prep |
with,digested |
| R8703 |
T13418 |
T13417 |
pobj |
XbaI,with |
| R8704 |
T13419 |
T13418 |
cc |
and,XbaI |
| R8705 |
T13420 |
T13418 |
conj |
BglII,XbaI |
| R8706 |
T13421 |
T13416 |
cc |
and,digested |
| R8707 |
T13422 |
T13416 |
conj |
subcloned,digested |
| R8708 |
T13423 |
T13422 |
prep |
into,subcloned |
| R8709 |
T13424 |
T13425 |
det |
the,vector |
| R871 |
T1661 |
T1655 |
nsubj |
cadherin,binds |
| R8710 |
T13425 |
T13423 |
pobj |
vector,into |
| R8711 |
T13426 |
T13427 |
compound |
pβ,gal |
| R8712 |
T13427 |
T13425 |
compound |
gal,vector |
| R8713 |
T13428 |
T13427 |
punct |
-,gal |
| R8714 |
T13429 |
T13425 |
compound |
BASIC,vector |
| R8715 |
T13430 |
T13431 |
punct |
(,Clontech |
| R8716 |
T13431 |
T13425 |
parataxis |
Clontech,vector |
| R8717 |
T13432 |
T13431 |
compound |
BD,Clontech |
| R8718 |
T13433 |
T13431 |
compound |
Biosciences,Clontech |
| R8719 |
T13434 |
T13431 |
punct |
", ",Clontech |
| R872 |
T1716 |
T1694 |
parataxis |
8,coordinates |
| R8720 |
T13435 |
T13436 |
compound |
Palo,Alto |
| R8721 |
T13436 |
T13431 |
npadvmod |
Alto,Clontech |
| R8722 |
T13437 |
T13431 |
punct |
", ",Clontech |
| R8723 |
T13438 |
T13431 |
npadvmod |
California,Clontech |
| R8724 |
T13439 |
T13431 |
punct |
", ",Clontech |
| R8725 |
T13440 |
T13441 |
compound |
United,States |
| R8726 |
T13441 |
T13431 |
npadvmod |
States,Clontech |
| R8727 |
T13442 |
T13431 |
punct |
),Clontech |
| R8728 |
T13443 |
T13411 |
punct |
.,verified |
| R8729 |
T13445 |
T13446 |
det |
The,mutations |
| R873 |
T1662 |
T1661 |
punct |
-,cadherin |
| R8730 |
T13446 |
T13448 |
nsubjpass |
mutations,generated |
| R8731 |
T13447 |
T13446 |
compound |
point,mutations |
| R8732 |
T13449 |
T13446 |
prep |
in,mutations |
| R8733 |
T13450 |
T13451 |
det |
the,element |
| R8734 |
T13451 |
T13449 |
pobj |
element,in |
| R8735 |
T13452 |
T13451 |
compound |
SMAD,element |
| R8736 |
T13453 |
T13451 |
compound |
binding,element |
| R8737 |
T13454 |
T13448 |
auxpass |
was,generated |
| R8738 |
T13455 |
T13448 |
prep |
with,generated |
| R8739 |
T13456 |
T13457 |
det |
the,Kit |
| R874 |
T1663 |
T1655 |
advmod |
also,binds |
| R8740 |
T13457 |
T13455 |
pobj |
Kit,with |
| R8741 |
T13458 |
T13459 |
compound |
Quik,Change |
| R8742 |
T13459 |
T13457 |
compound |
Change,Kit |
| R8743 |
T13460 |
T13459 |
punct |
-,Change |
| R8744 |
T13461 |
T13462 |
punct |
(,Stratagene |
| R8745 |
T13462 |
T13457 |
parataxis |
Stratagene,Kit |
| R8746 |
T13463 |
T13462 |
punct |
", ",Stratagene |
| R8747 |
T13464 |
T13465 |
compound |
La,Jolla |
| R8748 |
T13465 |
T13462 |
npadvmod |
Jolla,Stratagene |
| R8749 |
T13466 |
T13462 |
punct |
", ",Stratagene |
| R875 |
T1717 |
T1716 |
nummod |
6,8 |
| R8750 |
T13467 |
T13462 |
npadvmod |
California,Stratagene |
| R8751 |
T13468 |
T13462 |
punct |
", ",Stratagene |
| R8752 |
T13469 |
T13470 |
compound |
United,States |
| R8753 |
T13470 |
T13462 |
npadvmod |
States,Stratagene |
| R8754 |
T13471 |
T13462 |
punct |
),Stratagene |
| R8755 |
T13472 |
T13448 |
advcl |
using,generated |
| R8756 |
T13473 |
T13474 |
det |
the,primer |
| R8757 |
T13474 |
T13472 |
dobj |
primer,using |
| R8758 |
T13475 |
T13474 |
amod |
forward,primer |
| R8759 |
T13476 |
T13477 |
nummod |
5,GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
| R876 |
T1664 |
T1655 |
prep |
to,binds |
| R8760 |
T13477 |
T13474 |
appos |
GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC,primer |
| R8761 |
T13478 |
T13476 |
punct |
′,5 |
| R8762 |
T13479 |
T13477 |
punct |
-,GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
| R8763 |
T13480 |
T13477 |
punct |
-,GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
| R8764 |
T13481 |
T13477 |
nummod |
3,GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
| R8765 |
T13482 |
T13477 |
punct |
′,GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
| R8766 |
T13483 |
T13474 |
cc |
and,primer |
| R8767 |
T13484 |
T13485 |
det |
the,primer |
| R8768 |
T13485 |
T13474 |
conj |
primer,primer |
| R8769 |
T13486 |
T13485 |
amod |
reverse,primer |
| R877 |
T1665 |
T1666 |
compound |
β,catenin |
| R8770 |
T13487 |
T13488 |
nummod |
5,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
| R8771 |
T13488 |
T13485 |
appos |
CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC,primer |
| R8772 |
T13489 |
T13487 |
punct |
′,5 |
| R8773 |
T13490 |
T13488 |
punct |
-,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
| R8774 |
T13491 |
T13488 |
compound |
GCTTTT,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
| R8775 |
T13492 |
T13488 |
punct |
-,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
| R8776 |
T13493 |
T13488 |
punct |
-,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
| R8777 |
T13494 |
T13488 |
nummod |
3,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
| R8778 |
T13495 |
T13488 |
punct |
′,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
| R8779 |
T13496 |
T13448 |
punct |
.,generated |
| R878 |
T1666 |
T1664 |
pobj |
catenin,to |
| R8780 |
T13498 |
T13499 |
det |
The,probes |
| R8781 |
T13499 |
T13500 |
nsubjpass |
probes,generated |
| R8782 |
T13501 |
T13499 |
prep |
for,probes |
| R8783 |
T13502 |
T13503 |
det |
the,hybridization |
| R8784 |
T13503 |
T13501 |
pobj |
hybridization,for |
| R8785 |
T13504 |
T13503 |
nmod |
Snail,hybridization |
| R8786 |
T13505 |
T13506 |
advmod |
in,situ |
| R8787 |
T13506 |
T13503 |
amod |
situ,hybridization |
| R8788 |
T13507 |
T13500 |
auxpass |
were,generated |
| R8789 |
T13508 |
T13500 |
prep |
against,generated |
| R879 |
T1718 |
T1716 |
punct |
",",8 |
| R8790 |
T13509 |
T13510 |
det |
the,UTR |
| R8791 |
T13510 |
T13508 |
pobj |
UTR,against |
| R8792 |
T13511 |
T13510 |
nummod |
3,UTR |
| R8793 |
T13512 |
T13511 |
punct |
′,3 |
| R8794 |
T13513 |
T13500 |
prep |
by,generated |
| R8795 |
T13514 |
T13513 |
pobj |
PCR,by |
| R8796 |
T13515 |
T13500 |
advcl |
using,generated |
| R8797 |
T13516 |
T13517 |
det |
the,primer |
| R8798 |
T13517 |
T13515 |
dobj |
primer,using |
| R8799 |
T13518 |
T13517 |
amod |
forward,primer |
| R88 |
T242 |
T239 |
dobj |
Snail,induce |
| R880 |
T1667 |
T1666 |
punct |
-,catenin |
| R8800 |
T13519 |
T13520 |
nummod |
5,ACCTTCTCCCGCATGTCCTTGCTCC |
| R8801 |
T13520 |
T13517 |
appos |
ACCTTCTCCCGCATGTCCTTGCTCC,primer |
| R8802 |
T13521 |
T13519 |
punct |
′,5 |
| R8803 |
T13522 |
T13520 |
punct |
-,ACCTTCTCCCGCATGTCCTTGCTCC |
| R8804 |
T13523 |
T13520 |
punct |
-,ACCTTCTCCCGCATGTCCTTGCTCC |
| R8805 |
T13524 |
T13520 |
nummod |
3,ACCTTCTCCCGCATGTCCTTGCTCC |
| R8806 |
T13525 |
T13520 |
punct |
′,ACCTTCTCCCGCATGTCCTTGCTCC |
| R8807 |
T13526 |
T13517 |
cc |
and,primer |
| R8808 |
T13527 |
T13528 |
det |
the,primer |
| R8809 |
T13528 |
T13517 |
conj |
primer,primer |
| R881 |
T1668 |
T1655 |
punct |
.,binds |
| R8810 |
T13529 |
T13528 |
amod |
reverse,primer |
| R8811 |
T13530 |
T13531 |
nummod |
5,CTGCTGAGGCATGGTTACAGCTGG |
| R8812 |
T13531 |
T13528 |
appos |
CTGCTGAGGCATGGTTACAGCTGG,primer |
| R8813 |
T13532 |
T13530 |
punct |
′,5 |
| R8814 |
T13533 |
T13531 |
punct |
-,CTGCTGAGGCATGGTTACAGCTGG |
| R8815 |
T13534 |
T13531 |
punct |
-,CTGCTGAGGCATGGTTACAGCTGG |
| R8816 |
T13535 |
T13531 |
nummod |
3,CTGCTGAGGCATGGTTACAGCTGG |
| R8817 |
T13536 |
T13531 |
punct |
′,CTGCTGAGGCATGGTTACAGCTGG |
| R8818 |
T13537 |
T13528 |
punct |
", ",primer |
| R8819 |
T13538 |
T13528 |
cc |
and,primer |
| R882 |
T1719 |
T1716 |
nummod |
7,8 |
| R8820 |
T13539 |
T13540 |
amod |
genomic,DNA |
| R8821 |
T13540 |
T13528 |
conj |
DNA,primer |
| R8822 |
T13541 |
T13540 |
prep |
as,DNA |
| R8823 |
T13542 |
T13543 |
det |
a,template |
| R8824 |
T13543 |
T13541 |
pobj |
template,as |
| R8825 |
T13544 |
T13500 |
punct |
.,generated |
| R8826 |
T13546 |
T13547 |
det |
The,product |
| R8827 |
T13547 |
T13549 |
nsubjpass |
product,purified |
| R8828 |
T13548 |
T13547 |
compound |
PCR,product |
| R8829 |
T13550 |
T13549 |
auxpass |
was,purified |
| R883 |
T1670 |
T1671 |
prep |
At,recruit |
| R8830 |
T13551 |
T13549 |
dep |
gel,purified |
| R8831 |
T13552 |
T13549 |
cc |
and,purified |
| R8832 |
T13553 |
T13549 |
conj |
ligated,purified |
| R8833 |
T13554 |
T13553 |
prep |
into,ligated |
| R8834 |
T13555 |
T13556 |
compound |
pCRII,TOPO |
| R8835 |
T13556 |
T13558 |
compound |
TOPO,vector |
| R8836 |
T13557 |
T13556 |
punct |
-,TOPO |
| R8837 |
T13558 |
T13554 |
pobj |
vector,into |
| R8838 |
T13559 |
T13558 |
compound |
TA,vector |
| R8839 |
T13560 |
T13549 |
punct |
.,purified |
| R884 |
T1720 |
T1716 |
punct |
",",8 |
| R8840 |
T13562 |
T13563 |
det |
The,domain |
| R8841 |
T13563 |
T13565 |
nsubjpass |
domain,generated |
| R8842 |
T13564 |
T13563 |
amod |
pre-LIM,domain |
| R8843 |
T13566 |
T13563 |
prep |
of,domain |
| R8844 |
T13567 |
T13566 |
pobj |
Ajuba,of |
| R8845 |
T13568 |
T13565 |
auxpass |
was,generated |
| R8846 |
T13569 |
T13565 |
advmod |
essentially,generated |
| R8847 |
T13570 |
T13571 |
mark |
as,described |
| R8848 |
T13571 |
T13565 |
advcl |
described,generated |
| R8849 |
T13572 |
T13573 |
punct |
[,9 |
| R885 |
T1672 |
T1670 |
pobj |
sites,At |
| R8850 |
T13573 |
T13571 |
parataxis |
9,described |
| R8851 |
T13574 |
T13573 |
punct |
],9 |
| R8852 |
T13575 |
T13565 |
punct |
", ",generated |
| R8853 |
T13576 |
T13565 |
cc |
but,generated |
| R8854 |
T13577 |
T13578 |
auxpass |
was,fused |
| R8855 |
T13578 |
T13565 |
conj |
fused,generated |
| R8856 |
T13579 |
T13578 |
prep |
to,fused |
| R8857 |
T13580 |
T13579 |
pobj |
GFP,to |
| R8858 |
T13581 |
T13578 |
prep |
by,fused |
| R8859 |
T13582 |
T13581 |
pcomp |
subcloning,by |
| R886 |
T1673 |
T1672 |
prep |
of,sites |
| R8860 |
T13583 |
T13582 |
prep |
from,subcloning |
| R8861 |
T13584 |
T13585 |
det |
the,vector |
| R8862 |
T13585 |
T13583 |
pobj |
vector,from |
| R8863 |
T13586 |
T13587 |
nmod |
pEGFP,N1 |
| R8864 |
T13587 |
T13585 |
nmod |
N1,vector |
| R8865 |
T13588 |
T13587 |
punct |
-,N1 |
| R8866 |
T13589 |
T13585 |
nummod |
20,vector |
| R8867 |
T13590 |
T13591 |
punct |
(,Clontech |
| R8868 |
T13591 |
T13585 |
parataxis |
Clontech,vector |
| R8869 |
T13592 |
T13591 |
compound |
BD,Clontech |
| R887 |
T1674 |
T1675 |
compound |
cell,cell |
| R8870 |
T13593 |
T13591 |
compound |
Biosciences,Clontech |
| R8871 |
T13594 |
T13591 |
punct |
),Clontech |
| R8874 |
T13649 |
T13650 |
advmod |
In,situ |
| R8875 |
T13650 |
T13651 |
amod |
situ,hybridization |
| R8876 |
T13653 |
T13654 |
det |
The,vector |
| R8877 |
T13654 |
T13659 |
nsubjpass |
vector,used |
| R8878 |
T13655 |
T13656 |
compound |
pCRII,TOPO |
| R8879 |
T13656 |
T13654 |
compound |
TOPO,vector |
| R888 |
T1721 |
T1716 |
punct |
],8 |
| R8880 |
T13657 |
T13656 |
punct |
-,TOPO |
| R8881 |
T13658 |
T13654 |
compound |
TA,vector |
| R8882 |
T13660 |
T13654 |
acl |
containing,vector |
| R8883 |
T13661 |
T13662 |
det |
a,region |
| R8884 |
T13662 |
T13660 |
dobj |
region,containing |
| R8885 |
T13663 |
T13662 |
prep |
of,region |
| R8886 |
T13664 |
T13665 |
det |
the,UTR |
| R8887 |
T13665 |
T13663 |
pobj |
UTR,of |
| R8888 |
T13666 |
T13665 |
nummod |
3,UTR |
| R8889 |
T13667 |
T13666 |
punct |
′,3 |
| R889 |
T1722 |
T1671 |
punct |
.,recruit |
| R8890 |
T13668 |
T13665 |
prep |
of,UTR |
| R8891 |
T13669 |
T13668 |
pobj |
Snail,of |
| R8892 |
T13670 |
T13659 |
auxpass |
was,used |
| R8893 |
T13671 |
T13659 |
prep |
as,used |
| R8894 |
T13672 |
T13673 |
det |
a,template |
| R8895 |
T13673 |
T13671 |
pobj |
template,as |
| R8896 |
T13674 |
T13675 |
aux |
to,generate |
| R8897 |
T13675 |
T13659 |
advcl |
generate,used |
| R8898 |
T13676 |
T13677 |
npadvmod |
digoxigenin,labeled |
| R8899 |
T13677 |
T13679 |
amod |
labeled,riboprobes |
| R89 |
T243 |
T242 |
compound |
transcription,Snail |
| R890 |
T1724 |
T1725 |
compound |
α,Catenin |
| R8900 |
T13678 |
T13677 |
punct |
-,labeled |
| R8901 |
T13679 |
T13675 |
dobj |
riboprobes,generate |
| R8902 |
T13680 |
T13679 |
nmod |
sense,riboprobes |
| R8903 |
T13681 |
T13680 |
cc |
and,sense |
| R8904 |
T13682 |
T13680 |
conj |
antisense,sense |
| R8905 |
T13683 |
T13684 |
punct |
(,Roche |
| R8906 |
T13684 |
T13679 |
parataxis |
Roche,riboprobes |
| R8907 |
T13685 |
T13684 |
punct |
),Roche |
| R8908 |
T13686 |
T13659 |
punct |
.,used |
| R8909 |
T13688 |
T13689 |
det |
The,probes |
| R891 |
T1725 |
T1727 |
nsubj |
Catenin,binds |
| R8910 |
T13689 |
T13691 |
nsubjpass |
probes,obtained |
| R8911 |
T13690 |
T13689 |
amod |
respective,probes |
| R8912 |
T13692 |
T13691 |
auxpass |
were,obtained |
| R8913 |
T13693 |
T13691 |
prep |
by,obtained |
| R8914 |
T13694 |
T13695 |
nmod |
XhoI,digestions |
| R8915 |
T13695 |
T13693 |
pobj |
digestions,by |
| R8916 |
T13696 |
T13694 |
cc |
and,XhoI |
| R8917 |
T13697 |
T13694 |
conj |
BamH1,XhoI |
| R8918 |
T13698 |
T13691 |
punct |
.,obtained |
| R8919 |
T13700 |
T13701 |
advmod |
In,situ |
| R892 |
T1726 |
T1725 |
punct |
-,Catenin |
| R8920 |
T13701 |
T13702 |
amod |
situ,hybridizations |
| R8921 |
T13702 |
T13703 |
nsubjpass |
hybridizations,performed |
| R8922 |
T13704 |
T13703 |
auxpass |
were,performed |
| R8923 |
T13705 |
T13703 |
prep |
on,performed |
| R8924 |
T13706 |
T13707 |
nummod |
10,μm |
| R8925 |
T13707 |
T13709 |
npadvmod |
μm,thick |
| R8926 |
T13708 |
T13707 |
punct |
-,μm |
| R8927 |
T13709 |
T13710 |
amod |
thick,sections |
| R8928 |
T13710 |
T13705 |
pobj |
sections,on |
| R8929 |
T13711 |
T13710 |
prep |
of,sections |
| R893 |
T1780 |
T1779 |
compound |
protein,kinase |
| R8930 |
T13712 |
T13713 |
compound |
E17.5,embryos |
| R8931 |
T13713 |
T13711 |
pobj |
embryos,of |
| R8932 |
T13714 |
T13713 |
compound |
mouse,embryos |
| R8933 |
T13715 |
T13703 |
punct |
.,performed |
| R8934 |
T13717 |
T13718 |
det |
The,sections |
| R8935 |
T13718 |
T13719 |
nsubjpass |
sections,fixed |
| R8936 |
T13720 |
T13719 |
auxpass |
were,fixed |
| R8937 |
T13721 |
T13719 |
prep |
with,fixed |
| R8938 |
T13722 |
T13723 |
nummod |
4,% |
| R8939 |
T13723 |
T13724 |
compound |
%,PFA |
| R894 |
T1781 |
T1779 |
punct |
(,kinase |
| R8940 |
T13724 |
T13721 |
pobj |
PFA,with |
| R8941 |
T13725 |
T13719 |
prep |
for,fixed |
| R8942 |
T13726 |
T13727 |
nummod |
10,min |
| R8943 |
T13727 |
T13725 |
pobj |
min,for |
| R8944 |
T13728 |
T13719 |
prep |
at,fixed |
| R8945 |
T13729 |
T13730 |
compound |
room,temperature |
| R8946 |
T13730 |
T13728 |
pobj |
temperature,at |
| R8947 |
T13731 |
T13719 |
punct |
", ",fixed |
| R8948 |
T13732 |
T13719 |
conj |
prehybridized,fixed |
| R8949 |
T13733 |
T13732 |
prep |
at,prehybridized |
| R895 |
T1782 |
T1779 |
appos |
MAPK,kinase |
| R8950 |
T13734 |
T13735 |
compound |
room,temperature |
| R8951 |
T13735 |
T13733 |
pobj |
temperature,at |
| R8952 |
T13736 |
T13732 |
prep |
for,prehybridized |
| R8953 |
T13737 |
T13738 |
nummod |
4.5,h |
| R8954 |
T13738 |
T13736 |
pobj |
h,for |
| R8955 |
T13739 |
T13732 |
punct |
", ",prehybridized |
| R8956 |
T13740 |
T13732 |
conj |
hybridized,prehybridized |
| R8957 |
T13741 |
T13740 |
prep |
with,hybridized |
| R8958 |
T13742 |
T13743 |
det |
the,probe |
| R8959 |
T13743 |
T13741 |
pobj |
probe,with |
| R896 |
T1728 |
T1727 |
advmod |
also,binds |
| R8960 |
T13744 |
T13745 |
punct |
(,μg |
| R8961 |
T13745 |
T13743 |
parataxis |
μg,probe |
| R8962 |
T13746 |
T13745 |
nummod |
2,μg |
| R8963 |
T13747 |
T13748 |
punct |
/,ml |
| R8964 |
T13748 |
T13745 |
prep |
ml,μg |
| R8965 |
T13749 |
T13745 |
punct |
),μg |
| R8966 |
T13750 |
T13740 |
prep |
at,hybridized |
| R8967 |
T13751 |
T13752 |
nummod |
55,°C |
| R8968 |
T13752 |
T13750 |
pobj |
°C,at |
| R8969 |
T13753 |
T13740 |
prep |
for,hybridized |
| R897 |
T1783 |
T1773 |
punct |
),pathway |
| R8970 |
T13754 |
T13755 |
quantmod |
12,14 |
| R8971 |
T13755 |
T13757 |
nummod |
14,h |
| R8972 |
T13756 |
T13755 |
punct |
–,14 |
| R8973 |
T13757 |
T13753 |
pobj |
h,for |
| R8974 |
T13758 |
T13740 |
punct |
", ",hybridized |
| R8975 |
T13759 |
T13740 |
conj |
blocked,hybridized |
| R8976 |
T13760 |
T13759 |
prep |
with,blocked |
| R8977 |
T13761 |
T13762 |
nummod |
10,% |
| R8978 |
T13762 |
T13763 |
compound |
%,NGS |
| R8979 |
T13763 |
T13760 |
pobj |
NGS,with |
| R898 |
T1784 |
T1785 |
punct |
[,10 |
| R8980 |
T13764 |
T13759 |
punct |
", ",blocked |
| R8981 |
T13765 |
T13759 |
cc |
and,blocked |
| R8982 |
T13766 |
T13759 |
conj |
treated,blocked |
| R8983 |
T13767 |
T13766 |
prep |
with,treated |
| R8984 |
T13768 |
T13769 |
amod |
anti-dig,antibody |
| R8985 |
T13769 |
T13767 |
pobj |
antibody,with |
| R8986 |
T13770 |
T13771 |
compound |
Fab,AP |
| R8987 |
T13771 |
T13769 |
compound |
AP,antibody |
| R8988 |
T13772 |
T13771 |
punct |
-,AP |
| R8989 |
T13773 |
T13774 |
punct |
(,Roche |
| R899 |
T1729 |
T1727 |
prep |
to,binds |
| R8990 |
T13774 |
T13769 |
parataxis |
Roche,antibody |
| R8991 |
T13775 |
T13774 |
punct |
#,Roche |
| R8992 |
T13776 |
T13774 |
nummod |
1093274,Roche |
| R8993 |
T13777 |
T13774 |
punct |
),Roche |
| R8994 |
T13778 |
T13766 |
prep |
at,treated |
| R8995 |
T13779 |
T13780 |
det |
a,dilution |
| R8996 |
T13780 |
T13778 |
pobj |
dilution,at |
| R8997 |
T13781 |
T13782 |
quantmod |
1,"2,500" |
| R8998 |
T13782 |
T13780 |
nummod |
"2,500",dilution |
| R8999 |
T13783 |
T13782 |
punct |
:,"2,500" |
| R9 |
T156 |
T147 |
prep |
in,Pathway |
| R90 |
T244 |
T242 |
compound |
factor,Snail |
| R900 |
T1785 |
T1727 |
parataxis |
10,binds |
| R9000 |
T13784 |
T13766 |
prep |
for,treated |
| R9001 |
T13785 |
T13786 |
nummod |
3,h |
| R9002 |
T13786 |
T13784 |
pobj |
h,for |
| R9003 |
T13787 |
T13719 |
punct |
.,fixed |
| R9004 |
T13789 |
T13790 |
det |
The,sections |
| R9005 |
T13790 |
T13791 |
nsubjpass |
sections,incubated |
| R9006 |
T13792 |
T13791 |
auxpass |
were,incubated |
| R9007 |
T13793 |
T13791 |
prep |
with,incubated |
| R9008 |
T13794 |
T13793 |
pobj |
NBT,with |
| R9009 |
T13795 |
T13794 |
cc |
and,NBT |
| R901 |
T1786 |
T1785 |
nummod |
9,10 |
| R9010 |
T13796 |
T13794 |
conj |
BCIP,NBT |
| R9011 |
T13797 |
T13798 |
mark |
until,detected |
| R9012 |
T13798 |
T13791 |
advcl |
detected,incubated |
| R9013 |
T13799 |
T13800 |
amod |
adequate,signal |
| R9014 |
T13800 |
T13798 |
nsubjpass |
signal,detected |
| R9015 |
T13801 |
T13798 |
auxpass |
was,detected |
| R9016 |
T13802 |
T13791 |
punct |
.,incubated |
| R9017 |
T13829 |
T13828 |
cc |
and,Immunofluorescence |
| R9018 |
T13830 |
T13828 |
conj |
immunohistochemistry,Immunofluorescence |
| R9019 |
T13832 |
T13833 |
compound |
Tissue,samples |
| R902 |
T1730 |
T1731 |
det |
the,protein |
| R9020 |
T13833 |
T13834 |
nsubjpass |
samples,frozen |
| R9021 |
T13835 |
T13833 |
prep |
for,samples |
| R9022 |
T13836 |
T13835 |
pobj |
immunofluorescence,for |
| R9023 |
T13837 |
T13834 |
auxpass |
were,frozen |
| R9024 |
T13838 |
T13834 |
prep |
in,frozen |
| R9025 |
T13839 |
T13838 |
pobj |
OCT,in |
| R9026 |
T13840 |
T13834 |
cc |
and,frozen |
| R9027 |
T13841 |
T13834 |
conj |
sectioned,frozen |
| R9028 |
T13842 |
T13843 |
nummod |
10,μm |
| R9029 |
T13843 |
T13844 |
npadvmod |
μm,thick |
| R903 |
T1787 |
T1785 |
punct |
",",10 |
| R9030 |
T13844 |
T13841 |
advcl |
thick,sectioned |
| R9031 |
T13845 |
T13841 |
prep |
on,sectioned |
| R9032 |
T13846 |
T13847 |
det |
a,cryostat |
| R9033 |
T13847 |
T13845 |
pobj |
cryostat,on |
| R9034 |
T13848 |
T13834 |
punct |
.,frozen |
| R9035 |
T13850 |
T13851 |
nsubjpass |
Sections,fixed |
| R9036 |
T13852 |
T13851 |
auxpass |
were,fixed |
| R9037 |
T13853 |
T13851 |
prep |
in,fixed |
| R9038 |
T13854 |
T13855 |
nummod |
4,% |
| R9039 |
T13855 |
T13856 |
compound |
%,paraformaldehyde |
| R904 |
T1788 |
T1785 |
punct |
],10 |
| R9040 |
T13856 |
T13853 |
pobj |
paraformaldehyde,in |
| R9041 |
T13857 |
T13851 |
prep |
for,fixed |
| R9042 |
T13858 |
T13859 |
nummod |
10,min |
| R9043 |
T13859 |
T13857 |
pobj |
min,for |
| R9044 |
T13860 |
T13851 |
prep |
at,fixed |
| R9045 |
T13861 |
T13862 |
compound |
room,temperature |
| R9046 |
T13862 |
T13860 |
pobj |
temperature,at |
| R9047 |
T13863 |
T13851 |
punct |
", ",fixed |
| R9048 |
T13864 |
T13851 |
conj |
blocked,fixed |
| R9049 |
T13865 |
T13864 |
punct |
", ",blocked |
| R905 |
T1731 |
T1729 |
pobj |
protein,to |
| R9050 |
T13866 |
T13864 |
cc |
and,blocked |
| R9051 |
T13867 |
T13864 |
conj |
stained,blocked |
| R9052 |
T13868 |
T13867 |
prep |
with,stained |
| R9053 |
T13869 |
T13868 |
pobj |
antibodies,with |
| R9054 |
T13870 |
T13851 |
punct |
.,fixed |
| R9055 |
T13872 |
T13873 |
compound |
Tissue,samples |
| R9056 |
T13873 |
T13874 |
nsubjpass |
samples,fixed |
| R9057 |
T13875 |
T13873 |
prep |
for,samples |
| R9058 |
T13876 |
T13875 |
pobj |
immunohistochemistry,for |
| R9059 |
T13877 |
T13874 |
auxpass |
were,fixed |
| R906 |
T1789 |
T1727 |
punct |
.,binds |
| R9060 |
T13878 |
T13874 |
prep |
in,fixed |
| R9061 |
T13879 |
T13880 |
nummod |
4,% |
| R9062 |
T13880 |
T13881 |
compound |
%,paraformaldehyde |
| R9063 |
T13881 |
T13878 |
pobj |
paraformaldehyde,in |
| R9064 |
T13882 |
T13874 |
punct |
", ",fixed |
| R9065 |
T13883 |
T13874 |
conj |
dehydrated,fixed |
| R9066 |
T13884 |
T13883 |
punct |
", ",dehydrated |
| R9067 |
T13885 |
T13883 |
cc |
and,dehydrated |
| R9068 |
T13886 |
T13883 |
conj |
embedded,dehydrated |
| R9069 |
T13887 |
T13886 |
prep |
in,embedded |
| R907 |
T1732 |
T1731 |
nmod |
class,protein |
| R9070 |
T13888 |
T13887 |
pobj |
paraffin,in |
| R9071 |
T13889 |
T13874 |
punct |
.,fixed |
| R9072 |
T13891 |
T13892 |
nsubjpass |
Samples,sectioned |
| R9073 |
T13893 |
T13892 |
auxpass |
were,sectioned |
| R9074 |
T13894 |
T13892 |
prep |
on,sectioned |
| R9075 |
T13895 |
T13896 |
det |
a,microtome |
| R9076 |
T13896 |
T13894 |
pobj |
microtome,on |
| R9077 |
T13897 |
T13898 |
punct |
(,thick |
| R9078 |
T13898 |
T13892 |
parataxis |
thick,sectioned |
| R9079 |
T13899 |
T13900 |
nummod |
10,μm |
| R908 |
T1791 |
T1792 |
prep |
Through,appear |
| R9080 |
T13900 |
T13898 |
npadvmod |
μm,thick |
| R9081 |
T13901 |
T13898 |
punct |
),thick |
| R9082 |
T13902 |
T13892 |
cc |
and,sectioned |
| R9083 |
T13903 |
T13892 |
conj |
rehydrated,sectioned |
| R9084 |
T13904 |
T13903 |
prep |
prior,rehydrated |
| R9085 |
T13905 |
T13904 |
pcomp |
to,prior |
| R9086 |
T13906 |
T13904 |
pcomp |
staining,prior |
| R9087 |
T13907 |
T13906 |
prep |
with,staining |
| R9088 |
T13908 |
T13907 |
pobj |
antibody,with |
| R9089 |
T13909 |
T13892 |
punct |
.,sectioned |
| R909 |
T1793 |
T1794 |
det |
these,links |
| R9090 |
T13911 |
T13912 |
nsubjpass |
Samples,unmasked |
| R9091 |
T13913 |
T13911 |
acl |
stained,Samples |
| R9092 |
T13914 |
T13913 |
prep |
with,stained |
| R9093 |
T13915 |
T13914 |
pobj |
Snail,with |
| R9094 |
T13916 |
T13915 |
punct |
", ",Snail |
| R9095 |
T13917 |
T13915 |
conj |
pMAPK,Snail |
| R9096 |
T13918 |
T13917 |
punct |
", ",pMAPK |
| R9097 |
T13919 |
T13917 |
conj |
pSmad2,pMAPK |
| R9098 |
T13920 |
T13919 |
punct |
", ",pSmad2 |
| R9099 |
T13921 |
T13919 |
cc |
and,pSmad2 |
| R91 |
T245 |
T239 |
cc |
and,induce |
| R910 |
T1733 |
T1732 |
nummod |
III,class |
| R9100 |
T13922 |
T13923 |
compound |
cyclin,D |
| R9101 |
T13923 |
T13919 |
conj |
D,pSmad2 |
| R9102 |
T13924 |
T13912 |
auxpass |
were,unmasked |
| R9103 |
T13925 |
T13912 |
dep |
antigen,unmasked |
| R9104 |
T13926 |
T13912 |
prep |
with,unmasked |
| R9105 |
T13927 |
T13928 |
nummod |
10,mM |
| R9106 |
T13928 |
T13929 |
compound |
mM,citrate |
| R9107 |
T13929 |
T13926 |
pobj |
citrate,with |
| R9108 |
T13930 |
T13929 |
compound |
sodium,citrate |
| R9109 |
T13931 |
T13929 |
punct |
(,citrate |
| R911 |
T1794 |
T1791 |
pobj |
links,Through |
| R9110 |
T13932 |
T13929 |
npadvmod |
pH,citrate |
| R9111 |
T13933 |
T13932 |
nummod |
6,pH |
| R9112 |
T13934 |
T13929 |
punct |
),citrate |
| R9113 |
T13935 |
T13912 |
prep |
in,unmasked |
| R9114 |
T13936 |
T13937 |
det |
an,Retriever |
| R9115 |
T13937 |
T13935 |
pobj |
Retriever,in |
| R9116 |
T13938 |
T13937 |
compound |
Antigen,Retriever |
| R9117 |
T13939 |
T13937 |
nummod |
2100,Retriever |
| R9118 |
T13940 |
T13941 |
punct |
(,Laboratories |
| R9119 |
T13941 |
T13937 |
parataxis |
Laboratories,Retriever |
| R912 |
T1795 |
T1792 |
punct |
", ",appear |
| R9120 |
T13942 |
T13941 |
compound |
Pickcell,Laboratories |
| R9121 |
T13943 |
T13941 |
punct |
", ",Laboratories |
| R9122 |
T13944 |
T13941 |
npadvmod |
Leiden,Laboratories |
| R9123 |
T13945 |
T13941 |
punct |
", ",Laboratories |
| R9124 |
T13946 |
T13941 |
npadvmod |
Netherlands,Laboratories |
| R9125 |
T13947 |
T13941 |
punct |
),Laboratories |
| R9126 |
T13948 |
T13912 |
punct |
.,unmasked |
| R9127 |
T13950 |
T13951 |
det |
The,kit |
| R9128 |
T13951 |
T13954 |
nsubjpass |
kit,used |
| R9129 |
T13952 |
T13953 |
compound |
DAB,substrate |
| R913 |
T1734 |
T1731 |
nmod |
Lin,protein |
| R9130 |
T13953 |
T13951 |
compound |
substrate,kit |
| R9131 |
T13955 |
T13956 |
punct |
(,Labs |
| R9132 |
T13956 |
T13951 |
parataxis |
Labs,kit |
| R9133 |
T13957 |
T13956 |
compound |
Vector,Labs |
| R9134 |
T13958 |
T13956 |
punct |
),Labs |
| R9135 |
T13959 |
T13954 |
auxpass |
was,used |
| R9136 |
T13960 |
T13954 |
prep |
according,used |
| R9137 |
T13961 |
T13960 |
prep |
to,according |
| R9138 |
T13962 |
T13963 |
poss |
manufacturer,instructions |
| R9139 |
T13963 |
T13961 |
pobj |
instructions,to |
| R914 |
T1796 |
T1792 |
nsubj |
AJs,appear |
| R9140 |
T13964 |
T13962 |
case |
's,manufacturer |
| R9141 |
T13965 |
T13966 |
aux |
to,develop |
| R9142 |
T13966 |
T13954 |
advcl |
develop,used |
| R9143 |
T13967 |
T13968 |
det |
the,signal |
| R9144 |
T13968 |
T13966 |
dobj |
signal,develop |
| R9145 |
T13969 |
T13954 |
punct |
.,used |
| R9146 |
T14008 |
T14009 |
compound |
RT,PCR |
| R9147 |
T14010 |
T14009 |
punct |
-,PCR |
| R9148 |
T14012 |
T14013 |
nsubjpass |
RNA,extracted |
| R9149 |
T14014 |
T14013 |
auxpass |
was,extracted |
| R915 |
T1797 |
T1792 |
oprd |
able,appear |
| R9150 |
T14015 |
T14013 |
prep |
from,extracted |
| R9151 |
T14016 |
T14015 |
pobj |
keratinocytes,from |
| R9152 |
T14017 |
T14016 |
cc |
or,keratinocytes |
| R9153 |
T14018 |
T14019 |
compound |
skin,tissue |
| R9154 |
T14019 |
T14016 |
conj |
tissue,keratinocytes |
| R9155 |
T14020 |
T14013 |
prep |
with,extracted |
| R9156 |
T14021 |
T14020 |
pobj |
Trizol,with |
| R9157 |
T14022 |
T14023 |
punct |
(,Invitrogen |
| R9158 |
T14023 |
T14021 |
parataxis |
Invitrogen,Trizol |
| R9159 |
T14024 |
T14023 |
punct |
),Invitrogen |
| R916 |
T1798 |
T1799 |
aux |
to,couple |
| R9160 |
T14025 |
T14013 |
prep |
according,extracted |
| R9161 |
T14026 |
T14025 |
prep |
to,according |
| R9162 |
T14027 |
T14028 |
det |
the,manufacturer |
| R9163 |
T14028 |
T14029 |
poss |
manufacturer,protocol |
| R9164 |
T14029 |
T14026 |
pobj |
protocol,to |
| R9165 |
T14030 |
T14028 |
case |
's,manufacturer |
| R9166 |
T14031 |
T14013 |
punct |
.,extracted |
| R9167 |
T14033 |
T14034 |
nsubjpass |
cDNA,generated |
| R9168 |
T14035 |
T14034 |
auxpass |
was,generated |
| R9169 |
T14036 |
T14034 |
advcl |
using,generated |
| R917 |
T1735 |
T1734 |
punct |
-,Lin |
| R9170 |
T14037 |
T14038 |
compound |
oligo,dT |
| R9171 |
T14038 |
T14040 |
compound |
dT,primers |
| R9172 |
T14039 |
T14038 |
punct |
-,dT |
| R9173 |
T14040 |
T14036 |
dobj |
primers,using |
| R9174 |
T14041 |
T14040 |
cc |
and,primers |
| R9175 |
T14042 |
T14043 |
det |
the,kit |
| R9176 |
T14043 |
T14040 |
conj |
kit,primers |
| R9177 |
T14044 |
T14043 |
nmod |
Superscript,kit |
| R9178 |
T14045 |
T14044 |
nummod |
II,Superscript |
| R9179 |
T14046 |
T14047 |
punct |
(,Invitrogen |
| R918 |
T1799 |
T1797 |
xcomp |
couple,able |
| R9180 |
T14047 |
T14043 |
parataxis |
Invitrogen,kit |
| R9181 |
T14048 |
T14047 |
punct |
),Invitrogen |
| R9182 |
T14049 |
T14034 |
punct |
.,generated |
| R9183 |
T14051 |
T14052 |
det |
The,primers |
| R9184 |
T14052 |
T14053 |
nsubj |
primers,were |
| R9185 |
T14054 |
T14052 |
acl |
used,primers |
| R9186 |
T14055 |
T14054 |
prep |
for,used |
| R9187 |
T14056 |
T14055 |
pobj |
PCR,for |
| R9188 |
T14057 |
T14058 |
compound |
Snail,forward |
| R9189 |
T14058 |
T14053 |
attr |
forward,were |
| R919 |
T1800 |
T1799 |
dobj |
adhesion,couple |
| R9190 |
T14059 |
T14058 |
punct |
: ,forward |
| R9191 |
T14060 |
T14061 |
nummod |
5,CAGCTGGCCAGGCTCTCGGT |
| R9192 |
T14061 |
T14058 |
appos |
CAGCTGGCCAGGCTCTCGGT,forward |
| R9193 |
T14062 |
T14060 |
punct |
′,5 |
| R9194 |
T14063 |
T14061 |
punct |
-,CAGCTGGCCAGGCTCTCGGT |
| R9195 |
T14064 |
T14061 |
punct |
-,CAGCTGGCCAGGCTCTCGGT |
| R9196 |
T14065 |
T14061 |
nummod |
3,CAGCTGGCCAGGCTCTCGGT |
| R9197 |
T14066 |
T14061 |
punct |
′,CAGCTGGCCAGGCTCTCGGT |
| R9198 |
T14067 |
T14058 |
punct |
;,forward |
| R9199 |
T14068 |
T14069 |
compound |
Snail,reverse |
| R92 |
T246 |
T239 |
conj |
activate,induce |
| R920 |
T1736 |
T1734 |
nummod |
1,Lin |
| R9200 |
T14069 |
T14058 |
conj |
reverse,forward |
| R9201 |
T14070 |
T14069 |
punct |
: ,reverse |
| R9202 |
T14071 |
T14072 |
nummod |
5,GCGAGGGCCTCCGGAGCA |
| R9203 |
T14072 |
T14069 |
appos |
GCGAGGGCCTCCGGAGCA,reverse |
| R9204 |
T14073 |
T14071 |
punct |
′,5 |
| R9205 |
T14074 |
T14072 |
punct |
-,GCGAGGGCCTCCGGAGCA |
| R9206 |
T14075 |
T14072 |
punct |
-,GCGAGGGCCTCCGGAGCA |
| R9207 |
T14076 |
T14072 |
nummod |
3,GCGAGGGCCTCCGGAGCA |
| R9208 |
T14077 |
T14072 |
punct |
′,GCGAGGGCCTCCGGAGCA |
| R9209 |
T14078 |
T14069 |
punct |
;,reverse |
| R921 |
T1801 |
T1799 |
prep |
with,couple |
| R9210 |
T14079 |
T14080 |
compound |
GAPDH,forward |
| R9211 |
T14080 |
T14069 |
conj |
forward,reverse |
| R9212 |
T14081 |
T14082 |
nummod |
5,CGTAGACAAAATGGTGAAGGTCGG |
| R9213 |
T14082 |
T14080 |
appos |
CGTAGACAAAATGGTGAAGGTCGG,forward |
| R9214 |
T14083 |
T14081 |
punct |
′,5 |
| R9215 |
T14084 |
T14082 |
punct |
-,CGTAGACAAAATGGTGAAGGTCGG |
| R9216 |
T14085 |
T14082 |
punct |
-,CGTAGACAAAATGGTGAAGGTCGG |
| R9217 |
T14086 |
T14082 |
nummod |
3,CGTAGACAAAATGGTGAAGGTCGG |
| R9218 |
T14087 |
T14082 |
punct |
′,CGTAGACAAAATGGTGAAGGTCGG |
| R9219 |
T14088 |
T14080 |
punct |
;,forward |
| R922 |
T1802 |
T1803 |
amod |
cytoskeletal,dynamics |
| R9220 |
T14089 |
T14080 |
cc |
and,forward |
| R9221 |
T14090 |
T14091 |
compound |
GAPDH,reverse |
| R9222 |
T14091 |
T14080 |
conj |
reverse,forward |
| R9223 |
T14092 |
T14091 |
punct |
: ,reverse |
| R9224 |
T14093 |
T14094 |
nummod |
5,AAGCAGTTGGTGGTGCAGGATG |
| R9225 |
T14094 |
T14091 |
appos |
AAGCAGTTGGTGGTGCAGGATG,reverse |
| R9226 |
T14095 |
T14093 |
punct |
′,5 |
| R9227 |
T14096 |
T14094 |
punct |
-,AAGCAGTTGGTGGTGCAGGATG |
| R9228 |
T14097 |
T14094 |
punct |
-,AAGCAGTTGGTGGTGCAGGATG |
| R9229 |
T14098 |
T14094 |
nummod |
3,AAGCAGTTGGTGGTGCAGGATG |
| R923 |
T1803 |
T1801 |
pobj |
dynamics,with |
| R9230 |
T14099 |
T14094 |
punct |
′,AAGCAGTTGGTGGTGCAGGATG |
| R9231 |
T14100 |
T14053 |
punct |
.,were |
| R924 |
T1737 |
T1734 |
punct |
", ",Lin |
| R925 |
T1804 |
T1805 |
advmod |
as,as |
| R926 |
T1805 |
T1801 |
cc |
as,with |
| R927 |
T1806 |
T1805 |
advmod |
well,as |
| R928 |
T1738 |
T1734 |
appos |
Isl,Lin |
| R929 |
T1807 |
T1801 |
conj |
with,with |
| R93 |
T247 |
T248 |
det |
the,pathway |
| R930 |
T1808 |
T1809 |
amod |
nuclear,signaling |
| R931 |
T1739 |
T1738 |
punct |
-,Isl |
| R932 |
T1809 |
T1807 |
pobj |
signaling,with |
| R933 |
T1810 |
T1808 |
cc |
and,nuclear |
| R934 |
T1811 |
T1808 |
conj |
cytoplasmic,nuclear |
| R935 |
T1740 |
T1738 |
nummod |
1,Isl |
| R936 |
T1812 |
T1792 |
punct |
.,appear |
| R937 |
T1814 |
T1815 |
nsubj |
This,provides |
| R938 |
T1741 |
T1734 |
punct |
", ",Lin |
| R939 |
T1816 |
T1817 |
det |
a,framework |
| R94 |
T248 |
T246 |
dobj |
pathway,activate |
| R940 |
T1742 |
T1734 |
appos |
Mec,Lin |
| R941 |
T1817 |
T1815 |
dobj |
framework,provides |
| R942 |
T1818 |
T1817 |
prep |
for,framework |
| R943 |
T1819 |
T1818 |
pcomp |
conceptualizing,for |
| R944 |
T1820 |
T1821 |
advmod |
why,appear |
| R945 |
T1821 |
T1819 |
ccomp |
appear,conceptualizing |
| R946 |
T1822 |
T1823 |
compound |
E,cadherin |
| R947 |
T1743 |
T1742 |
punct |
-,Mec |
| R948 |
T1823 |
T1825 |
compound |
cadherin,levels |
| R949 |
T1824 |
T1823 |
punct |
-,cadherin |
| R95 |
T249 |
T250 |
nmod |
Ras,kinase |
| R950 |
T1825 |
T1821 |
nsubj |
levels,appear |
| R951 |
T1826 |
T1827 |
aux |
to,impact |
| R952 |
T1744 |
T1742 |
nummod |
3,Mec |
| R953 |
T1827 |
T1821 |
xcomp |
impact,appear |
| R954 |
T1828 |
T1827 |
prep |
upon,impact |
| R955 |
T1745 |
T1734 |
punct |
(,Lin |
| R956 |
T1829 |
T1830 |
det |
a,plethora |
| R957 |
T1830 |
T1828 |
pobj |
plethora,upon |
| R958 |
T1831 |
T1830 |
prep |
of,plethora |
| R959 |
T1746 |
T1734 |
appos |
LIM,Lin |
| R96 |
T250 |
T248 |
nmod |
kinase,pathway |
| R960 |
T1832 |
T1833 |
amod |
developmental,processes |
| R961 |
T1833 |
T1831 |
pobj |
processes,of |
| R962 |
T1834 |
T1835 |
punct |
(,reviewed |
| R963 |
T1747 |
T1731 |
punct |
),protein |
| R964 |
T1835 |
T1815 |
parataxis |
reviewed,provides |
| R965 |
T1836 |
T1835 |
prep |
in,reviewed |
| R966 |
T1837 |
T1836 |
punct |
[,in |
| R967 |
T1748 |
T1731 |
appos |
Ajuba,protein |
| R968 |
T1838 |
T1836 |
pobj |
11,in |
| R969 |
T1839 |
T1835 |
punct |
],reviewed |
| R97 |
T251 |
T250 |
punct |
-,kinase |
| R970 |
T1840 |
T1835 |
punct |
),reviewed |
| R971 |
T1749 |
T1731 |
punct |
(,protein |
| R972 |
T1841 |
T1815 |
punct |
.,provides |
| R973 |
T1750 |
T1751 |
det |
a,member |
| R974 |
T1843 |
T1844 |
mark |
As,probed |
| R975 |
T1844 |
T1846 |
advcl |
probed,intrigued |
| R976 |
T1845 |
T1844 |
nsubj |
we,probed |
| R977 |
T1751 |
T1731 |
appos |
member,protein |
| R978 |
T1847 |
T1848 |
advmod |
more,deeply |
| R979 |
T1848 |
T1844 |
advmod |
deeply,probed |
| R98 |
T252 |
T253 |
npadvmod |
mitogen,activated |
| R980 |
T1752 |
T1751 |
prep |
of,member |
| R981 |
T1849 |
T1844 |
prep |
into,probed |
| R982 |
T1850 |
T1851 |
det |
the,mechanisms |
| R983 |
T1851 |
T1849 |
pobj |
mechanisms,into |
| R984 |
T1753 |
T1754 |
det |
the,family |
| R985 |
T1852 |
T1851 |
amod |
underlying,mechanisms |
| R986 |
T1853 |
T1851 |
acl |
governing,mechanisms |
| R987 |
T1854 |
T1855 |
compound |
E,cadherin |
| R988 |
T1754 |
T1752 |
pobj |
family,of |
| R989 |
T1855 |
T1857 |
compound |
cadherin,promoter |
| R99 |
T253 |
T250 |
amod |
activated,kinase |
| R990 |
T1856 |
T1855 |
punct |
-,cadherin |
| R991 |
T1857 |
T1858 |
compound |
promoter,activity |
| R992 |
T1755 |
T1754 |
compound |
zyxin,family |
| R993 |
T1858 |
T1853 |
dobj |
activity,governing |
| R994 |
T1859 |
T1846 |
punct |
", ",intrigued |
| R995 |
T1756 |
T1754 |
prep |
of,family |
| R996 |
T1860 |
T1846 |
nsubjpass |
we,intrigued |
| R997 |
T1861 |
T1846 |
auxpass |
were,intrigued |
| R998 |
T1862 |
T1846 |
agent |
by,intrigued |
| R999 |
T1863 |
T1864 |
det |
the,proximity |