Id |
Subject |
Object |
Predicate |
Lexical cue |
T11321 |
0-1 |
DT |
denotes |
A |
T11323 |
2-7 |
NN |
denotes |
mouse |
T11325 |
8-13 |
NN |
denotes |
129x1 |
T11327 |
13-14 |
HYPH |
denotes |
/ |
T11326 |
14-17 |
NN |
denotes |
SvJ |
T11324 |
18-21 |
NN |
denotes |
BAC |
T11322 |
22-29 |
NN |
denotes |
library |
T11329 |
30-31 |
-LRB- |
denotes |
( |
T11330 |
31-41 |
NNP |
denotes |
Invitrogen |
T11331 |
41-42 |
-RRB- |
denotes |
) |
T11332 |
43-46 |
VBD |
denotes |
was |
T11328 |
47-55 |
VBN |
denotes |
screened |
T11333 |
56-58 |
TO |
denotes |
to |
T11334 |
59-67 |
VB |
denotes |
identify |
T11335 |
68-69 |
DT |
denotes |
a |
T11337 |
70-73 |
CD |
denotes |
140 |
T11339 |
73-74 |
HYPH |
denotes |
- |
T11338 |
74-76 |
NN |
denotes |
kb |
T11336 |
77-80 |
NN |
denotes |
BAC |
T11340 |
81-85 |
IN |
denotes |
from |
T11341 |
86-89 |
DT |
denotes |
the |
T11343 |
90-94 |
NN |
denotes |
Gdf5 |
T11342 |
95-100 |
NN |
denotes |
locus |
T11344 |
100-101 |
. |
denotes |
. |
T11345 |
101-388 |
sentence |
denotes |
This BAC was modified using a homologous recombination system in E. coli (Yang et al. 1997) to place nuclear-localized Cre recombinase (from plasmid pML78, gift of Gail Martin) followed by IRES-hPLAP (from plasmid 1726, gift of Oliver Bogler) directly behind the ATG start site of Gdf5. |
T11346 |
102-106 |
DT |
denotes |
This |
T11347 |
107-110 |
NN |
denotes |
BAC |
T11349 |
111-114 |
VBD |
denotes |
was |
T11348 |
115-123 |
VBN |
denotes |
modified |
T11350 |
124-129 |
VBG |
denotes |
using |
T11351 |
130-131 |
DT |
denotes |
a |
T11353 |
132-142 |
JJ |
denotes |
homologous |
T11354 |
143-156 |
NN |
denotes |
recombination |
T11352 |
157-163 |
NN |
denotes |
system |
T11355 |
164-166 |
IN |
denotes |
in |
T11356 |
167-169 |
NNP |
denotes |
E. |
T11357 |
170-174 |
NNP |
denotes |
coli |
T11358 |
175-176 |
-LRB- |
denotes |
( |
T11359 |
176-180 |
NNP |
denotes |
Yang |
T11360 |
181-183 |
FW |
denotes |
et |
T11361 |
184-187 |
FW |
denotes |
al. |
T11362 |
188-192 |
CD |
denotes |
1997 |
T11363 |
192-193 |
-RRB- |
denotes |
) |
T11364 |
194-196 |
TO |
denotes |
to |
T11365 |
197-202 |
VB |
denotes |
place |
T11366 |
203-210 |
JJ |
denotes |
nuclear |
T11368 |
210-211 |
HYPH |
denotes |
- |
T11367 |
211-220 |
VBN |
denotes |
localized |
T11370 |
221-224 |
NN |
denotes |
Cre |
T11369 |
225-236 |
NN |
denotes |
recombinase |
T11371 |
237-238 |
-LRB- |
denotes |
( |
T11372 |
238-242 |
IN |
denotes |
from |
T11373 |
243-250 |
NN |
denotes |
plasmid |
T11374 |
251-256 |
NN |
denotes |
pML78 |
T11375 |
256-258 |
, |
denotes |
, |
T11376 |
258-262 |
NN |
denotes |
gift |
T11377 |
263-265 |
IN |
denotes |
of |
T11378 |
266-270 |
NNP |
denotes |
Gail |
T11379 |
271-277 |
NNP |
denotes |
Martin |
T11380 |
277-278 |
-RRB- |
denotes |
) |
T11381 |
279-287 |
VBN |
denotes |
followed |
T11382 |
288-290 |
IN |
denotes |
by |
T11383 |
291-295 |
NN |
denotes |
IRES |
T11385 |
295-296 |
HYPH |
denotes |
- |
T11384 |
296-301 |
NN |
denotes |
hPLAP |
T11386 |
302-303 |
-LRB- |
denotes |
( |
T11387 |
303-307 |
IN |
denotes |
from |
T11388 |
308-315 |
NN |
denotes |
plasmid |
T11389 |
316-320 |
CD |
denotes |
1726 |
T11390 |
320-322 |
, |
denotes |
, |
T11391 |
322-326 |
NN |
denotes |
gift |
T11392 |
327-329 |
IN |
denotes |
of |
T11393 |
330-336 |
NNP |
denotes |
Oliver |
T11394 |
337-343 |
NNP |
denotes |
Bogler |
T11395 |
343-344 |
-RRB- |
denotes |
) |
T11396 |
345-353 |
RB |
denotes |
directly |
T11397 |
354-360 |
IN |
denotes |
behind |
T11398 |
361-364 |
DT |
denotes |
the |
T11400 |
365-368 |
NN |
denotes |
ATG |
T11401 |
369-374 |
NN |
denotes |
start |
T11399 |
375-379 |
NN |
denotes |
site |
T11402 |
380-382 |
IN |
denotes |
of |
T11403 |
383-387 |
NN |
denotes |
Gdf5 |
T11404 |
387-388 |
. |
denotes |
. |
T11405 |
388-509 |
sentence |
denotes |
In the process, 583 bp of the first exon of Gdf5 was removed and no functional GDF5 protein is predicted to be produced. |
T11406 |
389-391 |
IN |
denotes |
In |
T11408 |
392-395 |
DT |
denotes |
the |
T11409 |
396-403 |
NN |
denotes |
process |
T11410 |
403-405 |
, |
denotes |
, |
T11411 |
405-408 |
CD |
denotes |
583 |
T11412 |
409-411 |
NNS |
denotes |
bp |
T11413 |
412-414 |
IN |
denotes |
of |
T11414 |
415-418 |
DT |
denotes |
the |
T11416 |
419-424 |
JJ |
denotes |
first |
T11415 |
425-429 |
NN |
denotes |
exon |
T11417 |
430-432 |
IN |
denotes |
of |
T11418 |
433-437 |
NN |
denotes |
Gdf5 |
T11419 |
438-441 |
VBD |
denotes |
was |
T11407 |
442-449 |
VBN |
denotes |
removed |
T11420 |
450-453 |
CC |
denotes |
and |
T11421 |
454-456 |
DT |
denotes |
no |
T11423 |
457-467 |
JJ |
denotes |
functional |
T11424 |
468-472 |
NN |
denotes |
GDF5 |
T11422 |
473-480 |
NN |
denotes |
protein |
T11426 |
481-483 |
VBZ |
denotes |
is |
T11425 |
484-493 |
VBN |
denotes |
predicted |
T11427 |
494-496 |
TO |
denotes |
to |
T11429 |
497-499 |
VB |
denotes |
be |
T11428 |
500-508 |
VBN |
denotes |
produced |
T11430 |
508-509 |
. |
denotes |
. |
T11431 |
509-801 |
sentence |
denotes |
The 5′ homology arm was subcloned from a PCR product tailed with XhoI and Bsp120I restriction sites that contains 781 bp of 5′ genomic Gdf5 sequence ending at the ATG translation start site (forward primer 5′-CTGTCTCGAGATGAGGTGGAGGTGAAGACCCC-3′; reverse 5′-GTTTGGGCCCATCCTCTGGCCAGCCGCTG-3′). |
T11432 |
510-513 |
DT |
denotes |
The |
T11434 |
514-515 |
CD |
denotes |
5 |
T11435 |
515-516 |
SYM |
denotes |
′ |
T11436 |
517-525 |
NN |
denotes |
homology |
T11433 |
526-529 |
NN |
denotes |
arm |
T11438 |
530-533 |
VBD |
denotes |
was |
T11437 |
534-543 |
VBN |
denotes |
subcloned |
T11439 |
544-548 |
IN |
denotes |
from |
T11440 |
549-550 |
DT |
denotes |
a |
T11442 |
551-554 |
NN |
denotes |
PCR |
T11441 |
555-562 |
NN |
denotes |
product |
T11443 |
563-569 |
VBN |
denotes |
tailed |
T11444 |
570-574 |
IN |
denotes |
with |
T11445 |
575-579 |
NN |
denotes |
XhoI |
T11447 |
580-583 |
CC |
denotes |
and |
T11448 |
584-591 |
NN |
denotes |
Bsp120I |
T11449 |
592-603 |
NN |
denotes |
restriction |
T11446 |
604-609 |
NNS |
denotes |
sites |
T11450 |
610-614 |
WDT |
denotes |
that |
T11451 |
615-623 |
VBZ |
denotes |
contains |
T11452 |
624-627 |
CD |
denotes |
781 |
T11453 |
628-630 |
NNS |
denotes |
bp |
T11454 |
631-633 |
IN |
denotes |
of |
T11455 |
634-635 |
CD |
denotes |
5 |
T11457 |
635-636 |
SYM |
denotes |
′ |
T11458 |
637-644 |
JJ |
denotes |
genomic |
T11459 |
645-649 |
NN |
denotes |
Gdf5 |
T11456 |
650-658 |
NN |
denotes |
sequence |
T11460 |
659-665 |
VBG |
denotes |
ending |
T11461 |
666-668 |
IN |
denotes |
at |
T11462 |
669-672 |
DT |
denotes |
the |
T11464 |
673-676 |
NN |
denotes |
ATG |
T11465 |
677-688 |
NN |
denotes |
translation |
T11466 |
689-694 |
NN |
denotes |
start |
T11463 |
695-699 |
NN |
denotes |
site |
T11467 |
700-701 |
-LRB- |
denotes |
( |
T11469 |
701-708 |
JJ |
denotes |
forward |
T11470 |
709-715 |
NN |
denotes |
primer |
T11472 |
716-717 |
CD |
denotes |
5 |
T11473 |
717-718 |
SYM |
denotes |
′ |
T11474 |
718-719 |
HYPH |
denotes |
- |
T11471 |
719-751 |
NN |
denotes |
CTGTCTCGAGATGAGGTGGAGGTGAAGACCCC |
T11475 |
751-752 |
HYPH |
denotes |
- |
T11476 |
752-753 |
CD |
denotes |
3 |
T11477 |
753-754 |
SYM |
denotes |
′ |
T11478 |
754-755 |
: |
denotes |
; |
T11479 |
756-763 |
JJ |
denotes |
reverse |
T11480 |
764-765 |
CD |
denotes |
5 |
T11481 |
765-766 |
SYM |
denotes |
′ |
T11482 |
766-767 |
HYPH |
denotes |
- |
T11468 |
767-796 |
NN |
denotes |
GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
T11483 |
796-797 |
HYPH |
denotes |
- |
T11484 |
797-798 |
CD |
denotes |
3 |
T11485 |
798-799 |
SYM |
denotes |
′ |
T11486 |
799-800 |
-RRB- |
denotes |
) |
T11487 |
800-801 |
. |
denotes |
. |
T11488 |
801-866 |
sentence |
denotes |
Cre was subcloned from a 1.1-kb Bsp120I/EcoRI fragment of pML78. |
T11489 |
802-805 |
NN |
denotes |
Cre |
T11491 |
806-809 |
VBD |
denotes |
was |
T11490 |
810-819 |
VBN |
denotes |
subcloned |
T11492 |
820-824 |
IN |
denotes |
from |
T11493 |
825-826 |
DT |
denotes |
a |
T11495 |
827-830 |
CD |
denotes |
1.1 |
T11497 |
830-831 |
HYPH |
denotes |
- |
T11496 |
831-833 |
NN |
denotes |
kb |
T11498 |
834-841 |
NN |
denotes |
Bsp120I |
T11500 |
841-842 |
HYPH |
denotes |
/ |
T11499 |
842-847 |
NN |
denotes |
EcoRI |
T11494 |
848-856 |
NN |
denotes |
fragment |
T11501 |
857-859 |
IN |
denotes |
of |
T11502 |
860-865 |
NN |
denotes |
pML78 |
T11503 |
865-866 |
. |
denotes |
. |
T11504 |
866-1113 |
sentence |
denotes |
IRES hPLAP was subcloned from a 2.1-kb PCR product tailed with EcoRI and SpeI sites that contains the hPLAP translation stop site (forward primer 5′-ATCTCTCGAGGAATTCTCCACCATATTGCCGTCTTTTG-3′; reverse 5′-AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG-3′). |
T11505 |
867-871 |
NN |
denotes |
IRES |
T11506 |
872-877 |
NN |
denotes |
hPLAP |
T11508 |
878-881 |
VBD |
denotes |
was |
T11507 |
882-891 |
VBN |
denotes |
subcloned |
T11509 |
892-896 |
IN |
denotes |
from |
T11510 |
897-898 |
DT |
denotes |
a |
T11512 |
899-902 |
CD |
denotes |
2.1 |
T11514 |
902-903 |
HYPH |
denotes |
- |
T11513 |
903-905 |
NN |
denotes |
kb |
T11515 |
906-909 |
NN |
denotes |
PCR |
T11511 |
910-917 |
NN |
denotes |
product |
T11516 |
918-924 |
VBN |
denotes |
tailed |
T11517 |
925-929 |
IN |
denotes |
with |
T11518 |
930-935 |
NN |
denotes |
EcoRI |
T11520 |
936-939 |
CC |
denotes |
and |
T11521 |
940-944 |
NN |
denotes |
SpeI |
T11519 |
945-950 |
NNS |
denotes |
sites |
T11522 |
951-955 |
WDT |
denotes |
that |
T11523 |
956-964 |
VBZ |
denotes |
contains |
T11524 |
965-968 |
DT |
denotes |
the |
T11526 |
969-974 |
NN |
denotes |
hPLAP |
T11527 |
975-986 |
NN |
denotes |
translation |
T11528 |
987-991 |
NN |
denotes |
stop |
T11525 |
992-996 |
NN |
denotes |
site |
T11529 |
997-998 |
-LRB- |
denotes |
( |
T11531 |
998-1005 |
JJ |
denotes |
forward |
T11532 |
1006-1012 |
NN |
denotes |
primer |
T11534 |
1013-1014 |
CD |
denotes |
5 |
T11535 |
1014-1015 |
SYM |
denotes |
′ |
T11536 |
1015-1016 |
HYPH |
denotes |
- |
T11533 |
1016-1054 |
NN |
denotes |
ATCTCTCGAGGAATTCTCCACCATATTGCCGTCTTTTG |
T11537 |
1054-1055 |
HYPH |
denotes |
- |
T11538 |
1055-1056 |
CD |
denotes |
3 |
T11539 |
1056-1057 |
SYM |
denotes |
′ |
T11540 |
1057-1058 |
: |
denotes |
; |
T11541 |
1059-1066 |
JJ |
denotes |
reverse |
T11542 |
1067-1068 |
CD |
denotes |
5 |
T11543 |
1068-1069 |
SYM |
denotes |
′ |
T11544 |
1069-1070 |
HYPH |
denotes |
- |
T11530 |
1070-1108 |
NN |
denotes |
AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
T11545 |
1108-1109 |
HYPH |
denotes |
- |
T11546 |
1109-1110 |
CD |
denotes |
3 |
T11547 |
1110-1111 |
SYM |
denotes |
′ |
T11548 |
1111-1112 |
-RRB- |
denotes |
) |
T11549 |
1112-1113 |
. |
denotes |
. |
T11550 |
1113-1281 |
sentence |
denotes |
The 3′ homology arm was subcloned from a 0.8-kb PCR product amplified from a 0.9-kb XhoI Gdf5 genomic subclone containing part of the first exon and downstream intron. |
T11551 |
1114-1117 |
DT |
denotes |
The |
T11553 |
1118-1119 |
CD |
denotes |
3 |
T11554 |
1119-1120 |
SYM |
denotes |
′ |
T11555 |
1121-1129 |
NN |
denotes |
homology |
T11552 |
1130-1133 |
NN |
denotes |
arm |
T11557 |
1134-1137 |
VBD |
denotes |
was |
T11556 |
1138-1147 |
VBN |
denotes |
subcloned |
T11558 |
1148-1152 |
IN |
denotes |
from |
T11559 |
1153-1154 |
DT |
denotes |
a |
T11561 |
1155-1158 |
CD |
denotes |
0.8 |
T11563 |
1158-1159 |
HYPH |
denotes |
- |
T11562 |
1159-1161 |
NN |
denotes |
kb |
T11564 |
1162-1165 |
NN |
denotes |
PCR |
T11560 |
1166-1173 |
NN |
denotes |
product |
T11565 |
1174-1183 |
VBN |
denotes |
amplified |
T11566 |
1184-1188 |
IN |
denotes |
from |
T11567 |
1189-1190 |
DT |
denotes |
a |
T11569 |
1191-1194 |
CD |
denotes |
0.9 |
T11571 |
1194-1195 |
HYPH |
denotes |
- |
T11570 |
1195-1197 |
NN |
denotes |
kb |
T11572 |
1198-1202 |
NN |
denotes |
XhoI |
T11573 |
1203-1207 |
NN |
denotes |
Gdf5 |
T11574 |
1208-1215 |
JJ |
denotes |
genomic |
T11568 |
1216-1224 |
NN |
denotes |
subclone |
T11575 |
1225-1235 |
VBG |
denotes |
containing |
T11576 |
1236-1240 |
NN |
denotes |
part |
T11577 |
1241-1243 |
IN |
denotes |
of |
T11578 |
1244-1247 |
DT |
denotes |
the |
T11580 |
1248-1253 |
JJ |
denotes |
first |
T11579 |
1254-1258 |
NN |
denotes |
exon |
T11581 |
1259-1262 |
CC |
denotes |
and |
T11582 |
1263-1273 |
JJ |
denotes |
downstream |
T11583 |
1274-1280 |
NN |
denotes |
intron |
T11584 |
1280-1281 |
. |
denotes |
. |
T11585 |
1281-1596 |
sentence |
denotes |
The forward primer contains the 3′ end of the first exon and is tailed with a SpeI site; the reverse primer is from the T7 promoter of the vector containing the 0.9-kb subclone and flanks the intronic XhoI site (forward primer 5′-CTAAACTAGTCACCAGCTTTATTGACAAAGG-3′; reverse 5′-GATTTCTAGAGTAATACGACTCACTATAGGGC-3′). |
T11586 |
1282-1285 |
DT |
denotes |
The |
T11588 |
1286-1293 |
JJ |
denotes |
forward |
T11587 |
1294-1300 |
NN |
denotes |
primer |
T11589 |
1301-1309 |
VBZ |
denotes |
contains |
T11591 |
1310-1313 |
DT |
denotes |
the |
T11593 |
1314-1315 |
CD |
denotes |
3 |
T11594 |
1315-1316 |
SYM |
denotes |
′ |
T11592 |
1317-1320 |
NN |
denotes |
end |
T11595 |
1321-1323 |
IN |
denotes |
of |
T11596 |
1324-1327 |
DT |
denotes |
the |
T11598 |
1328-1333 |
JJ |
denotes |
first |
T11597 |
1334-1338 |
NN |
denotes |
exon |
T11599 |
1339-1342 |
CC |
denotes |
and |
T11600 |
1343-1345 |
VBZ |
denotes |
is |
T11601 |
1346-1352 |
VBN |
denotes |
tailed |
T11602 |
1353-1357 |
IN |
denotes |
with |
T11603 |
1358-1359 |
DT |
denotes |
a |
T11605 |
1360-1364 |
NN |
denotes |
SpeI |
T11604 |
1365-1369 |
NN |
denotes |
site |
T11606 |
1369-1370 |
: |
denotes |
; |
T11607 |
1371-1374 |
DT |
denotes |
the |
T11609 |
1375-1382 |
JJ |
denotes |
reverse |
T11608 |
1383-1389 |
NN |
denotes |
primer |
T11590 |
1390-1392 |
VBZ |
denotes |
is |
T11610 |
1393-1397 |
IN |
denotes |
from |
T11611 |
1398-1401 |
DT |
denotes |
the |
T11613 |
1402-1404 |
NN |
denotes |
T7 |
T11612 |
1405-1413 |
NN |
denotes |
promoter |
T11614 |
1414-1416 |
IN |
denotes |
of |
T11615 |
1417-1420 |
DT |
denotes |
the |
T11616 |
1421-1427 |
NN |
denotes |
vector |
T11617 |
1428-1438 |
VBG |
denotes |
containing |
T11618 |
1439-1442 |
DT |
denotes |
the |
T11620 |
1443-1446 |
CD |
denotes |
0.9 |
T11622 |
1446-1447 |
HYPH |
denotes |
- |
T11621 |
1447-1449 |
NN |
denotes |
kb |
T11619 |
1450-1458 |
NN |
denotes |
subclone |
T11623 |
1459-1462 |
CC |
denotes |
and |
T11624 |
1463-1469 |
VBZ |
denotes |
flanks |
T11625 |
1470-1473 |
DT |
denotes |
the |
T11627 |
1474-1482 |
JJ |
denotes |
intronic |
T11628 |
1483-1487 |
NN |
denotes |
XhoI |
T11626 |
1488-1492 |
NN |
denotes |
site |
T11629 |
1493-1494 |
-LRB- |
denotes |
( |
T11631 |
1494-1501 |
JJ |
denotes |
forward |
T11632 |
1502-1508 |
NN |
denotes |
primer |
T11634 |
1509-1510 |
CD |
denotes |
5 |
T11635 |
1510-1511 |
SYM |
denotes |
′ |
T11636 |
1511-1512 |
HYPH |
denotes |
- |
T11633 |
1512-1543 |
NN |
denotes |
CTAAACTAGTCACCAGCTTTATTGACAAAGG |
T11637 |
1543-1544 |
HYPH |
denotes |
- |
T11638 |
1544-1545 |
CD |
denotes |
3 |
T11639 |
1545-1546 |
SYM |
denotes |
′ |
T11640 |
1546-1547 |
: |
denotes |
; |
T11641 |
1548-1555 |
JJ |
denotes |
reverse |
T11642 |
1556-1557 |
CD |
denotes |
5 |
T11643 |
1557-1558 |
SYM |
denotes |
′ |
T11644 |
1558-1559 |
HYPH |
denotes |
- |
T11630 |
1559-1591 |
NN |
denotes |
GATTTCTAGAGTAATACGACTCACTATAGGGC |
T11645 |
1591-1592 |
HYPH |
denotes |
- |
T11646 |
1592-1593 |
CD |
denotes |
3 |
T11647 |
1593-1594 |
SYM |
denotes |
′ |
T11648 |
1594-1595 |
-RRB- |
denotes |
) |
T11649 |
1595-1596 |
. |
denotes |
. |
T11650 |
1596-1817 |
sentence |
denotes |
The targeting construct was built and verified in pBSSK (Stratagene, La Jolla, California, United States), then digested with XhoI and subcloned into pSV1, the vector used for homologous recombination (Yang et al. 1997). |
T11651 |
1597-1600 |
DT |
denotes |
The |
T11653 |
1601-1610 |
NN |
denotes |
targeting |
T11652 |
1611-1620 |
NN |
denotes |
construct |
T11655 |
1621-1624 |
VBD |
denotes |
was |
T11654 |
1625-1630 |
VBN |
denotes |
built |
T11656 |
1631-1634 |
CC |
denotes |
and |
T11657 |
1635-1643 |
VBN |
denotes |
verified |
T11658 |
1644-1646 |
IN |
denotes |
in |
T11659 |
1647-1652 |
NN |
denotes |
pBSSK |
T11660 |
1653-1654 |
-LRB- |
denotes |
( |
T11661 |
1654-1664 |
NNP |
denotes |
Stratagene |
T11662 |
1664-1666 |
, |
denotes |
, |
T11663 |
1666-1668 |
NNP |
denotes |
La |
T11664 |
1669-1674 |
NNP |
denotes |
Jolla |
T11665 |
1674-1676 |
, |
denotes |
, |
T11666 |
1676-1686 |
NNP |
denotes |
California |
T11667 |
1686-1688 |
, |
denotes |
, |
T11668 |
1688-1694 |
NNP |
denotes |
United |
T11669 |
1695-1701 |
NNP |
denotes |
States |
T11670 |
1701-1702 |
-RRB- |
denotes |
) |
T11671 |
1702-1704 |
, |
denotes |
, |
T11672 |
1704-1708 |
RB |
denotes |
then |
T11673 |
1709-1717 |
VBN |
denotes |
digested |
T11674 |
1718-1722 |
IN |
denotes |
with |
T11675 |
1723-1727 |
NN |
denotes |
XhoI |
T11676 |
1728-1731 |
CC |
denotes |
and |
T11677 |
1732-1741 |
VBN |
denotes |
subcloned |
T11678 |
1742-1746 |
IN |
denotes |
into |
T11679 |
1747-1751 |
NN |
denotes |
pSV1 |
T11680 |
1751-1753 |
, |
denotes |
, |
T11681 |
1753-1756 |
DT |
denotes |
the |
T11682 |
1757-1763 |
NN |
denotes |
vector |
T11683 |
1764-1768 |
VBN |
denotes |
used |
T11684 |
1769-1772 |
IN |
denotes |
for |
T11685 |
1773-1783 |
JJ |
denotes |
homologous |
T11686 |
1784-1797 |
NN |
denotes |
recombination |
T11687 |
1798-1799 |
-LRB- |
denotes |
( |
T11688 |
1799-1803 |
NNP |
denotes |
Yang |
T11689 |
1804-1806 |
FW |
denotes |
et |
T11690 |
1807-1810 |
FW |
denotes |
al. |
T11691 |
1811-1815 |
CD |
denotes |
1997 |
T11692 |
1815-1816 |
-RRB- |
denotes |
) |
T11693 |
1816-1817 |
. |
denotes |
. |
T11694 |
1817-1965 |
sentence |
denotes |
Southern blotting, PCR, and DNA sequence analysis confirmed the appropriate targeting construct and BAC modifications were made (unpublished data). |
T11695 |
1818-1826 |
NNP |
denotes |
Southern |
T11696 |
1827-1835 |
NN |
denotes |
blotting |
T11698 |
1835-1837 |
, |
denotes |
, |
T11699 |
1837-1840 |
NN |
denotes |
PCR |
T11700 |
1840-1842 |
, |
denotes |
, |
T11701 |
1842-1845 |
CC |
denotes |
and |
T11702 |
1846-1849 |
NN |
denotes |
DNA |
T11703 |
1850-1858 |
NN |
denotes |
sequence |
T11697 |
1859-1867 |
NN |
denotes |
analysis |
T11704 |
1868-1877 |
VBD |
denotes |
confirmed |
T11705 |
1878-1881 |
DT |
denotes |
the |
T11707 |
1882-1893 |
JJ |
denotes |
appropriate |
T11708 |
1894-1903 |
NN |
denotes |
targeting |
T11706 |
1904-1913 |
NN |
denotes |
construct |
T11710 |
1914-1917 |
CC |
denotes |
and |
T11711 |
1918-1921 |
NN |
denotes |
BAC |
T11712 |
1922-1935 |
NNS |
denotes |
modifications |
T11713 |
1936-1940 |
VBD |
denotes |
were |
T11709 |
1941-1945 |
VBN |
denotes |
made |
T11714 |
1946-1947 |
-LRB- |
denotes |
( |
T11716 |
1947-1958 |
JJ |
denotes |
unpublished |
T11715 |
1959-1963 |
NNS |
denotes |
data |
T11717 |
1963-1964 |
-RRB- |
denotes |
) |
T11718 |
1964-1965 |
. |
denotes |
. |
R7272 |
T11321 |
T11322 |
det |
A,library |
R7273 |
T11322 |
T11328 |
nsubjpass |
library,screened |
R7274 |
T11323 |
T11324 |
compound |
mouse,BAC |
R7275 |
T11324 |
T11322 |
compound |
BAC,library |
R7276 |
T11325 |
T11326 |
compound |
129x1,SvJ |
R7277 |
T11326 |
T11324 |
compound |
SvJ,BAC |
R7278 |
T11327 |
T11326 |
punct |
/,SvJ |
R7279 |
T11329 |
T11330 |
punct |
(,Invitrogen |
R7280 |
T11330 |
T11322 |
parataxis |
Invitrogen,library |
R7281 |
T11331 |
T11330 |
punct |
),Invitrogen |
R7282 |
T11332 |
T11328 |
auxpass |
was,screened |
R7283 |
T11333 |
T11334 |
aux |
to,identify |
R7284 |
T11334 |
T11328 |
advcl |
identify,screened |
R7285 |
T11335 |
T11336 |
det |
a,BAC |
R7286 |
T11336 |
T11334 |
dobj |
BAC,identify |
R7287 |
T11337 |
T11338 |
nummod |
140,kb |
R7288 |
T11338 |
T11336 |
compound |
kb,BAC |
R7289 |
T11339 |
T11338 |
punct |
-,kb |
R7290 |
T11340 |
T11336 |
prep |
from,BAC |
R7291 |
T11341 |
T11342 |
det |
the,locus |
R7292 |
T11342 |
T11340 |
pobj |
locus,from |
R7293 |
T11343 |
T11342 |
compound |
Gdf5,locus |
R7294 |
T11344 |
T11328 |
punct |
.,screened |
R7295 |
T11346 |
T11347 |
det |
This,BAC |
R7296 |
T11347 |
T11348 |
nsubjpass |
BAC,modified |
R7297 |
T11349 |
T11348 |
auxpass |
was,modified |
R7298 |
T11350 |
T11348 |
advcl |
using,modified |
R7299 |
T11351 |
T11352 |
det |
a,system |
R7300 |
T11352 |
T11350 |
dobj |
system,using |
R7301 |
T11353 |
T11354 |
amod |
homologous,recombination |
R7302 |
T11354 |
T11352 |
compound |
recombination,system |
R7303 |
T11355 |
T11350 |
prep |
in,using |
R7304 |
T11356 |
T11357 |
compound |
E.,coli |
R7305 |
T11357 |
T11355 |
pobj |
coli,in |
R7306 |
T11358 |
T11359 |
punct |
(,Yang |
R7307 |
T11359 |
T11350 |
meta |
Yang,using |
R7308 |
T11360 |
T11359 |
nmod |
et,Yang |
R7309 |
T11361 |
T11359 |
nmod |
al.,Yang |
R7310 |
T11362 |
T11359 |
nummod |
1997,Yang |
R7311 |
T11363 |
T11359 |
punct |
),Yang |
R7312 |
T11364 |
T11365 |
aux |
to,place |
R7313 |
T11365 |
T11350 |
advcl |
place,using |
R7314 |
T11366 |
T11367 |
amod |
nuclear,localized |
R7315 |
T11367 |
T11369 |
amod |
localized,recombinase |
R7316 |
T11368 |
T11367 |
punct |
-,localized |
R7317 |
T11369 |
T11365 |
dobj |
recombinase,place |
R7318 |
T11370 |
T11369 |
compound |
Cre,recombinase |
R7319 |
T11371 |
T11369 |
punct |
(,recombinase |
R7320 |
T11372 |
T11369 |
prep |
from,recombinase |
R7321 |
T11373 |
T11374 |
compound |
plasmid,pML78 |
R7322 |
T11374 |
T11372 |
pobj |
pML78,from |
R7323 |
T11375 |
T11376 |
punct |
", ",gift |
R7324 |
T11376 |
T11374 |
parataxis |
gift,pML78 |
R7325 |
T11377 |
T11376 |
prep |
of,gift |
R7326 |
T11378 |
T11379 |
compound |
Gail,Martin |
R7327 |
T11379 |
T11377 |
pobj |
Martin,of |
R7328 |
T11380 |
T11369 |
punct |
),recombinase |
R7329 |
T11381 |
T11369 |
acl |
followed,recombinase |
R7330 |
T11382 |
T11381 |
agent |
by,followed |
R7331 |
T11383 |
T11384 |
compound |
IRES,hPLAP |
R7332 |
T11384 |
T11382 |
pobj |
hPLAP,by |
R7333 |
T11385 |
T11384 |
punct |
-,hPLAP |
R7334 |
T11386 |
T11384 |
punct |
(,hPLAP |
R7335 |
T11387 |
T11384 |
prep |
from,hPLAP |
R7336 |
T11388 |
T11387 |
pobj |
plasmid,from |
R7337 |
T11389 |
T11388 |
nummod |
1726,plasmid |
R7338 |
T11390 |
T11388 |
punct |
", ",plasmid |
R7339 |
T11391 |
T11388 |
parataxis |
gift,plasmid |
R7340 |
T11392 |
T11391 |
prep |
of,gift |
R7341 |
T11393 |
T11394 |
compound |
Oliver,Bogler |
R7342 |
T11394 |
T11392 |
pobj |
Bogler,of |
R7343 |
T11395 |
T11384 |
punct |
),hPLAP |
R7344 |
T11396 |
T11397 |
advmod |
directly,behind |
R7345 |
T11397 |
T11384 |
prep |
behind,hPLAP |
R7346 |
T11398 |
T11399 |
det |
the,site |
R7347 |
T11399 |
T11397 |
pobj |
site,behind |
R7348 |
T11400 |
T11399 |
compound |
ATG,site |
R7349 |
T11401 |
T11399 |
compound |
start,site |
R7350 |
T11402 |
T11399 |
prep |
of,site |
R7351 |
T11403 |
T11402 |
pobj |
Gdf5,of |
R7352 |
T11404 |
T11348 |
punct |
.,modified |
R7353 |
T11406 |
T11407 |
prep |
In,removed |
R7354 |
T11408 |
T11409 |
det |
the,process |
R7355 |
T11409 |
T11406 |
pobj |
process,In |
R7356 |
T11410 |
T11407 |
punct |
", ",removed |
R7357 |
T11411 |
T11412 |
nummod |
583,bp |
R7358 |
T11412 |
T11407 |
nsubjpass |
bp,removed |
R7359 |
T11413 |
T11412 |
prep |
of,bp |
R7360 |
T11414 |
T11415 |
det |
the,exon |
R7361 |
T11415 |
T11413 |
pobj |
exon,of |
R7362 |
T11416 |
T11415 |
amod |
first,exon |
R7363 |
T11417 |
T11415 |
prep |
of,exon |
R7364 |
T11418 |
T11417 |
pobj |
Gdf5,of |
R7365 |
T11419 |
T11407 |
auxpass |
was,removed |
R7366 |
T11420 |
T11407 |
cc |
and,removed |
R7367 |
T11421 |
T11422 |
det |
no,protein |
R7368 |
T11422 |
T11425 |
nsubjpass |
protein,predicted |
R7369 |
T11423 |
T11422 |
amod |
functional,protein |
R7370 |
T11424 |
T11422 |
compound |
GDF5,protein |
R7371 |
T11425 |
T11407 |
conj |
predicted,removed |
R7372 |
T11426 |
T11425 |
auxpass |
is,predicted |
R7373 |
T11427 |
T11428 |
aux |
to,produced |
R7374 |
T11428 |
T11425 |
xcomp |
produced,predicted |
R7375 |
T11429 |
T11428 |
auxpass |
be,produced |
R7376 |
T11430 |
T11425 |
punct |
.,predicted |
R7377 |
T11432 |
T11433 |
det |
The,arm |
R7378 |
T11433 |
T11437 |
nsubjpass |
arm,subcloned |
R7379 |
T11434 |
T11433 |
nummod |
5,arm |
R7380 |
T11435 |
T11434 |
punct |
′,5 |
R7381 |
T11436 |
T11433 |
compound |
homology,arm |
R7382 |
T11438 |
T11437 |
auxpass |
was,subcloned |
R7383 |
T11439 |
T11437 |
prep |
from,subcloned |
R7384 |
T11440 |
T11441 |
det |
a,product |
R7385 |
T11441 |
T11439 |
pobj |
product,from |
R7386 |
T11442 |
T11441 |
compound |
PCR,product |
R7387 |
T11443 |
T11441 |
acl |
tailed,product |
R7388 |
T11444 |
T11443 |
prep |
with,tailed |
R7389 |
T11445 |
T11446 |
nmod |
XhoI,sites |
R7390 |
T11446 |
T11444 |
pobj |
sites,with |
R7391 |
T11447 |
T11445 |
cc |
and,XhoI |
R7392 |
T11448 |
T11445 |
conj |
Bsp120I,XhoI |
R7393 |
T11449 |
T11446 |
compound |
restriction,sites |
R7394 |
T11450 |
T11451 |
dep |
that,contains |
R7395 |
T11451 |
T11441 |
relcl |
contains,product |
R7396 |
T11452 |
T11453 |
nummod |
781,bp |
R7397 |
T11453 |
T11451 |
dobj |
bp,contains |
R7398 |
T11454 |
T11453 |
prep |
of,bp |
R7399 |
T11455 |
T11456 |
nummod |
5,sequence |
R7400 |
T11456 |
T11454 |
pobj |
sequence,of |
R7401 |
T11457 |
T11455 |
punct |
′,5 |
R7402 |
T11458 |
T11456 |
amod |
genomic,sequence |
R7403 |
T11459 |
T11456 |
compound |
Gdf5,sequence |
R7404 |
T11460 |
T11456 |
acl |
ending,sequence |
R7405 |
T11461 |
T11460 |
prep |
at,ending |
R7406 |
T11462 |
T11463 |
det |
the,site |
R7407 |
T11463 |
T11461 |
pobj |
site,at |
R7408 |
T11464 |
T11465 |
compound |
ATG,translation |
R7409 |
T11465 |
T11463 |
compound |
translation,site |
R7410 |
T11466 |
T11463 |
compound |
start,site |
R7411 |
T11467 |
T11468 |
punct |
(,GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
R7412 |
T11468 |
T11460 |
parataxis |
GTTTGGGCCCATCCTCTGGCCAGCCGCTG,ending |
R7413 |
T11469 |
T11470 |
amod |
forward,primer |
R7414 |
T11470 |
T11471 |
dep |
primer,CTGTCTCGAGATGAGGTGGAGGTGAAGACCCC |
R7415 |
T11471 |
T11468 |
dep |
CTGTCTCGAGATGAGGTGGAGGTGAAGACCCC,GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
R7416 |
T11472 |
T11471 |
nummod |
5,CTGTCTCGAGATGAGGTGGAGGTGAAGACCCC |
R7417 |
T11473 |
T11472 |
punct |
′,5 |
R7418 |
T11474 |
T11471 |
punct |
-,CTGTCTCGAGATGAGGTGGAGGTGAAGACCCC |
R7419 |
T11475 |
T11471 |
punct |
-,CTGTCTCGAGATGAGGTGGAGGTGAAGACCCC |
R7420 |
T11476 |
T11471 |
nummod |
3,CTGTCTCGAGATGAGGTGGAGGTGAAGACCCC |
R7421 |
T11477 |
T11471 |
punct |
′,CTGTCTCGAGATGAGGTGGAGGTGAAGACCCC |
R7422 |
T11478 |
T11468 |
punct |
;,GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
R7423 |
T11479 |
T11468 |
amod |
reverse,GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
R7424 |
T11480 |
T11468 |
nummod |
5,GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
R7425 |
T11481 |
T11480 |
punct |
′,5 |
R7426 |
T11482 |
T11468 |
punct |
-,GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
R7427 |
T11483 |
T11468 |
punct |
-,GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
R7428 |
T11484 |
T11468 |
nummod |
3,GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
R7429 |
T11485 |
T11468 |
punct |
′,GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
R7430 |
T11486 |
T11468 |
punct |
),GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
R7431 |
T11487 |
T11437 |
punct |
.,subcloned |
R7432 |
T11489 |
T11490 |
nsubjpass |
Cre,subcloned |
R7433 |
T11491 |
T11490 |
auxpass |
was,subcloned |
R7434 |
T11492 |
T11490 |
prep |
from,subcloned |
R7435 |
T11493 |
T11494 |
det |
a,fragment |
R7436 |
T11494 |
T11492 |
pobj |
fragment,from |
R7437 |
T11495 |
T11496 |
nummod |
1.1,kb |
R7438 |
T11496 |
T11494 |
compound |
kb,fragment |
R7439 |
T11497 |
T11496 |
punct |
-,kb |
R7440 |
T11498 |
T11499 |
compound |
Bsp120I,EcoRI |
R7441 |
T11499 |
T11494 |
compound |
EcoRI,fragment |
R7442 |
T11500 |
T11499 |
punct |
/,EcoRI |
R7443 |
T11501 |
T11494 |
prep |
of,fragment |
R7444 |
T11502 |
T11501 |
pobj |
pML78,of |
R7445 |
T11503 |
T11490 |
punct |
.,subcloned |
R7446 |
T11505 |
T11506 |
compound |
IRES,hPLAP |
R7447 |
T11506 |
T11507 |
nsubjpass |
hPLAP,subcloned |
R7448 |
T11508 |
T11507 |
auxpass |
was,subcloned |
R7449 |
T11509 |
T11507 |
prep |
from,subcloned |
R7450 |
T11510 |
T11511 |
det |
a,product |
R7451 |
T11511 |
T11509 |
pobj |
product,from |
R7452 |
T11512 |
T11513 |
nummod |
2.1,kb |
R7453 |
T11513 |
T11511 |
compound |
kb,product |
R7454 |
T11514 |
T11513 |
punct |
-,kb |
R7455 |
T11515 |
T11511 |
compound |
PCR,product |
R7456 |
T11516 |
T11511 |
acl |
tailed,product |
R7457 |
T11517 |
T11516 |
prep |
with,tailed |
R7458 |
T11518 |
T11519 |
nmod |
EcoRI,sites |
R7459 |
T11519 |
T11517 |
pobj |
sites,with |
R7460 |
T11520 |
T11518 |
cc |
and,EcoRI |
R7461 |
T11521 |
T11518 |
conj |
SpeI,EcoRI |
R7462 |
T11522 |
T11523 |
dep |
that,contains |
R7463 |
T11523 |
T11511 |
relcl |
contains,product |
R7464 |
T11524 |
T11525 |
det |
the,site |
R7465 |
T11525 |
T11523 |
dobj |
site,contains |
R7466 |
T11526 |
T11527 |
compound |
hPLAP,translation |
R7467 |
T11527 |
T11525 |
compound |
translation,site |
R7468 |
T11528 |
T11525 |
compound |
stop,site |
R7469 |
T11529 |
T11530 |
punct |
(,AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
R7470 |
T11530 |
T11525 |
parataxis |
AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG,site |
R7471 |
T11531 |
T11532 |
amod |
forward,primer |
R7472 |
T11532 |
T11533 |
dep |
primer,ATCTCTCGAGGAATTCTCCACCATATTGCCGTCTTTTG |
R7473 |
T11533 |
T11530 |
dep |
ATCTCTCGAGGAATTCTCCACCATATTGCCGTCTTTTG,AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
R7474 |
T11534 |
T11533 |
nummod |
5,ATCTCTCGAGGAATTCTCCACCATATTGCCGTCTTTTG |
R7475 |
T11535 |
T11534 |
punct |
′,5 |
R7476 |
T11536 |
T11533 |
punct |
-,ATCTCTCGAGGAATTCTCCACCATATTGCCGTCTTTTG |
R7477 |
T11537 |
T11533 |
punct |
-,ATCTCTCGAGGAATTCTCCACCATATTGCCGTCTTTTG |
R7478 |
T11538 |
T11533 |
nummod |
3,ATCTCTCGAGGAATTCTCCACCATATTGCCGTCTTTTG |
R7479 |
T11539 |
T11533 |
punct |
′,ATCTCTCGAGGAATTCTCCACCATATTGCCGTCTTTTG |
R7480 |
T11540 |
T11530 |
punct |
;,AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
R7481 |
T11541 |
T11530 |
amod |
reverse,AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
R7482 |
T11542 |
T11530 |
nummod |
5,AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
R7483 |
T11543 |
T11542 |
punct |
′,5 |
R7484 |
T11544 |
T11530 |
punct |
-,AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
R7485 |
T11545 |
T11530 |
punct |
-,AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
R7486 |
T11546 |
T11530 |
nummod |
3,AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
R7487 |
T11547 |
T11530 |
punct |
′,AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
R7488 |
T11548 |
T11530 |
punct |
),AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
R7489 |
T11549 |
T11507 |
punct |
.,subcloned |
R7490 |
T11551 |
T11552 |
det |
The,arm |
R7491 |
T11552 |
T11556 |
nsubjpass |
arm,subcloned |
R7492 |
T11553 |
T11552 |
nummod |
3,arm |
R7493 |
T11554 |
T11553 |
punct |
′,3 |
R7494 |
T11555 |
T11552 |
compound |
homology,arm |
R7495 |
T11557 |
T11556 |
auxpass |
was,subcloned |
R7496 |
T11558 |
T11556 |
prep |
from,subcloned |
R7497 |
T11559 |
T11560 |
det |
a,product |
R7498 |
T11560 |
T11558 |
pobj |
product,from |
R7499 |
T11561 |
T11562 |
nummod |
0.8,kb |
R7500 |
T11562 |
T11560 |
compound |
kb,product |
R7501 |
T11563 |
T11562 |
punct |
-,kb |
R7502 |
T11564 |
T11560 |
compound |
PCR,product |
R7503 |
T11565 |
T11560 |
acl |
amplified,product |
R7504 |
T11566 |
T11565 |
prep |
from,amplified |
R7505 |
T11567 |
T11568 |
det |
a,subclone |
R7506 |
T11568 |
T11566 |
pobj |
subclone,from |
R7507 |
T11569 |
T11570 |
nummod |
0.9,kb |
R7508 |
T11570 |
T11568 |
nmod |
kb,subclone |
R7509 |
T11571 |
T11570 |
punct |
-,kb |
R7510 |
T11572 |
T11573 |
nmod |
XhoI,Gdf5 |
R7511 |
T11573 |
T11568 |
nmod |
Gdf5,subclone |
R7512 |
T11574 |
T11568 |
amod |
genomic,subclone |
R7513 |
T11575 |
T11568 |
acl |
containing,subclone |
R7514 |
T11576 |
T11575 |
dobj |
part,containing |
R7515 |
T11577 |
T11576 |
prep |
of,part |
R7516 |
T11578 |
T11579 |
det |
the,exon |
R7517 |
T11579 |
T11577 |
pobj |
exon,of |
R7518 |
T11580 |
T11579 |
amod |
first,exon |
R7519 |
T11581 |
T11579 |
cc |
and,exon |
R7520 |
T11582 |
T11583 |
amod |
downstream,intron |
R7521 |
T11583 |
T11579 |
conj |
intron,exon |
R7522 |
T11584 |
T11556 |
punct |
.,subcloned |
R7523 |
T11586 |
T11587 |
det |
The,primer |
R7524 |
T11587 |
T11589 |
nsubj |
primer,contains |
R7525 |
T11588 |
T11587 |
amod |
forward,primer |
R7526 |
T11589 |
T11590 |
ccomp |
contains,is |
R7527 |
T11591 |
T11592 |
det |
the,end |
R7528 |
T11592 |
T11589 |
dobj |
end,contains |
R7529 |
T11593 |
T11592 |
nummod |
3,end |
R7530 |
T11594 |
T11593 |
punct |
′,3 |
R7531 |
T11595 |
T11592 |
prep |
of,end |
R7532 |
T11596 |
T11597 |
det |
the,exon |
R7533 |
T11597 |
T11595 |
pobj |
exon,of |
R7534 |
T11598 |
T11597 |
amod |
first,exon |
R7535 |
T11599 |
T11589 |
cc |
and,contains |
R7536 |
T11600 |
T11601 |
auxpass |
is,tailed |
R7537 |
T11601 |
T11589 |
conj |
tailed,contains |
R7538 |
T11602 |
T11601 |
prep |
with,tailed |
R7539 |
T11603 |
T11604 |
det |
a,site |
R7540 |
T11604 |
T11602 |
pobj |
site,with |
R7541 |
T11605 |
T11604 |
compound |
SpeI,site |
R7542 |
T11606 |
T11590 |
punct |
;,is |
R7543 |
T11607 |
T11608 |
det |
the,primer |
R7544 |
T11608 |
T11590 |
nsubj |
primer,is |
R7545 |
T11609 |
T11608 |
amod |
reverse,primer |
R7546 |
T11610 |
T11590 |
prep |
from,is |
R7547 |
T11611 |
T11612 |
det |
the,promoter |
R7548 |
T11612 |
T11610 |
pobj |
promoter,from |
R7549 |
T11613 |
T11612 |
compound |
T7,promoter |
R7550 |
T11614 |
T11612 |
prep |
of,promoter |
R7551 |
T11615 |
T11616 |
det |
the,vector |
R7552 |
T11616 |
T11614 |
pobj |
vector,of |
R7553 |
T11617 |
T11616 |
acl |
containing,vector |
R7554 |
T11618 |
T11619 |
det |
the,subclone |
R7555 |
T11619 |
T11617 |
dobj |
subclone,containing |
R7556 |
T11620 |
T11621 |
nummod |
0.9,kb |
R7557 |
T11621 |
T11619 |
compound |
kb,subclone |
R7558 |
T11622 |
T11621 |
punct |
-,kb |
R7559 |
T11623 |
T11590 |
cc |
and,is |
R7560 |
T11624 |
T11590 |
conj |
flanks,is |
R7561 |
T11625 |
T11626 |
det |
the,site |
R7562 |
T11626 |
T11624 |
dobj |
site,flanks |
R7563 |
T11627 |
T11628 |
amod |
intronic,XhoI |
R7564 |
T11628 |
T11626 |
compound |
XhoI,site |
R7565 |
T11629 |
T11630 |
punct |
(,GATTTCTAGAGTAATACGACTCACTATAGGGC |
R7566 |
T11630 |
T11626 |
parataxis |
GATTTCTAGAGTAATACGACTCACTATAGGGC,site |
R7567 |
T11631 |
T11632 |
amod |
forward,primer |
R7568 |
T11632 |
T11633 |
dep |
primer,CTAAACTAGTCACCAGCTTTATTGACAAAGG |
R7569 |
T11633 |
T11630 |
dep |
CTAAACTAGTCACCAGCTTTATTGACAAAGG,GATTTCTAGAGTAATACGACTCACTATAGGGC |
R7570 |
T11634 |
T11633 |
nummod |
5,CTAAACTAGTCACCAGCTTTATTGACAAAGG |
R7571 |
T11635 |
T11634 |
punct |
′,5 |
R7572 |
T11636 |
T11633 |
punct |
-,CTAAACTAGTCACCAGCTTTATTGACAAAGG |
R7573 |
T11637 |
T11633 |
punct |
-,CTAAACTAGTCACCAGCTTTATTGACAAAGG |
R7574 |
T11638 |
T11633 |
nummod |
3,CTAAACTAGTCACCAGCTTTATTGACAAAGG |
R7575 |
T11639 |
T11633 |
punct |
′,CTAAACTAGTCACCAGCTTTATTGACAAAGG |
R7576 |
T11640 |
T11630 |
punct |
;,GATTTCTAGAGTAATACGACTCACTATAGGGC |
R7577 |
T11641 |
T11630 |
amod |
reverse,GATTTCTAGAGTAATACGACTCACTATAGGGC |
R7578 |
T11642 |
T11630 |
nummod |
5,GATTTCTAGAGTAATACGACTCACTATAGGGC |
R7579 |
T11643 |
T11642 |
punct |
′,5 |
R7580 |
T11644 |
T11630 |
punct |
-,GATTTCTAGAGTAATACGACTCACTATAGGGC |
R7581 |
T11645 |
T11630 |
punct |
-,GATTTCTAGAGTAATACGACTCACTATAGGGC |
R7582 |
T11646 |
T11630 |
nummod |
3,GATTTCTAGAGTAATACGACTCACTATAGGGC |
R7583 |
T11647 |
T11630 |
punct |
′,GATTTCTAGAGTAATACGACTCACTATAGGGC |
R7584 |
T11648 |
T11630 |
punct |
),GATTTCTAGAGTAATACGACTCACTATAGGGC |
R7585 |
T11649 |
T11590 |
punct |
.,is |
R7586 |
T11651 |
T11652 |
det |
The,construct |
R7587 |
T11652 |
T11654 |
nsubjpass |
construct,built |
R7588 |
T11653 |
T11652 |
compound |
targeting,construct |
R7589 |
T11655 |
T11654 |
auxpass |
was,built |
R7590 |
T11656 |
T11654 |
cc |
and,built |
R7591 |
T11657 |
T11654 |
conj |
verified,built |
R7592 |
T11658 |
T11657 |
prep |
in,verified |
R7593 |
T11659 |
T11658 |
pobj |
pBSSK,in |
R7594 |
T11660 |
T11661 |
punct |
(,Stratagene |
R7595 |
T11661 |
T11659 |
parataxis |
Stratagene,pBSSK |
R7596 |
T11662 |
T11661 |
punct |
", ",Stratagene |
R7597 |
T11663 |
T11664 |
compound |
La,Jolla |
R7598 |
T11664 |
T11661 |
npadvmod |
Jolla,Stratagene |
R7599 |
T11665 |
T11661 |
punct |
", ",Stratagene |
R7600 |
T11666 |
T11661 |
npadvmod |
California,Stratagene |
R7601 |
T11667 |
T11661 |
punct |
", ",Stratagene |
R7602 |
T11668 |
T11669 |
compound |
United,States |
R7603 |
T11669 |
T11661 |
npadvmod |
States,Stratagene |
R7604 |
T11670 |
T11661 |
punct |
),Stratagene |
R7605 |
T11671 |
T11654 |
punct |
", ",built |
R7606 |
T11672 |
T11673 |
advmod |
then,digested |
R7607 |
T11673 |
T11654 |
conj |
digested,built |
R7608 |
T11674 |
T11673 |
prep |
with,digested |
R7609 |
T11675 |
T11674 |
pobj |
XhoI,with |
R7610 |
T11676 |
T11673 |
cc |
and,digested |
R7611 |
T11677 |
T11673 |
conj |
subcloned,digested |
R7612 |
T11678 |
T11677 |
prep |
into,subcloned |
R7613 |
T11679 |
T11678 |
pobj |
pSV1,into |
R7614 |
T11680 |
T11679 |
punct |
", ",pSV1 |
R7615 |
T11681 |
T11682 |
det |
the,vector |
R7616 |
T11682 |
T11679 |
appos |
vector,pSV1 |
R7617 |
T11683 |
T11682 |
acl |
used,vector |
R7618 |
T11684 |
T11683 |
prep |
for,used |
R7619 |
T11685 |
T11686 |
amod |
homologous,recombination |
R7620 |
T11686 |
T11684 |
pobj |
recombination,for |
R7621 |
T11687 |
T11688 |
punct |
(,Yang |
R7622 |
T11688 |
T11683 |
meta |
Yang,used |
R7623 |
T11689 |
T11688 |
nmod |
et,Yang |
R7624 |
T11690 |
T11688 |
nmod |
al.,Yang |
R7625 |
T11691 |
T11688 |
nummod |
1997,Yang |
R7626 |
T11692 |
T11688 |
punct |
),Yang |
R7627 |
T11693 |
T11654 |
punct |
.,built |
R7628 |
T11695 |
T11696 |
nmod |
Southern,blotting |
R7629 |
T11696 |
T11697 |
nmod |
blotting,analysis |
R7630 |
T11697 |
T11704 |
nsubj |
analysis,confirmed |
R7631 |
T11698 |
T11696 |
punct |
", ",blotting |
R7632 |
T11699 |
T11696 |
conj |
PCR,blotting |
R7633 |
T11700 |
T11699 |
punct |
", ",PCR |
R7634 |
T11701 |
T11699 |
cc |
and,PCR |
R7635 |
T11702 |
T11703 |
compound |
DNA,sequence |
R7636 |
T11703 |
T11699 |
conj |
sequence,PCR |
R7637 |
T11705 |
T11706 |
det |
the,construct |
R7638 |
T11706 |
T11709 |
nsubjpass |
construct,made |
R7639 |
T11707 |
T11706 |
amod |
appropriate,construct |
R7640 |
T11708 |
T11706 |
compound |
targeting,construct |
R7641 |
T11709 |
T11704 |
advcl |
made,confirmed |
R7642 |
T11710 |
T11706 |
cc |
and,construct |
R7643 |
T11711 |
T11712 |
compound |
BAC,modifications |
R7644 |
T11712 |
T11706 |
conj |
modifications,construct |
R7645 |
T11713 |
T11709 |
auxpass |
were,made |
R7646 |
T11714 |
T11715 |
punct |
(,data |
R7647 |
T11715 |
T11709 |
meta |
data,made |
R7648 |
T11716 |
T11715 |
amod |
unpublished,data |
R7649 |
T11717 |
T11715 |
punct |
),data |
R7650 |
T11718 |
T11704 |
punct |
.,confirmed |