Id |
Subject |
Object |
Predicate |
Lexical cue |
T11313 |
23-33 |
NN |
denotes |
Generation |
T11314 |
34-36 |
IN |
denotes |
of |
T11315 |
37-41 |
NN |
denotes |
Gdf5 |
T11317 |
41-42 |
HYPH |
denotes |
- |
T11316 |
42-45 |
NN |
denotes |
Cre |
T11318 |
46-56 |
JJ |
denotes |
transgenic |
T11319 |
57-61 |
NNS |
denotes |
mice |
T11320 |
61-163 |
sentence |
denotes |
A mouse 129x1/SvJ BAC library (Invitrogen) was screened to identify a 140-kb BAC from the Gdf5 locus. |
T11321 |
62-63 |
DT |
denotes |
A |
T11323 |
64-69 |
NN |
denotes |
mouse |
T11325 |
70-75 |
NN |
denotes |
129x1 |
T11327 |
75-76 |
HYPH |
denotes |
/ |
T11326 |
76-79 |
NN |
denotes |
SvJ |
T11324 |
80-83 |
NN |
denotes |
BAC |
T11322 |
84-91 |
NN |
denotes |
library |
T11329 |
92-93 |
-LRB- |
denotes |
( |
T11330 |
93-103 |
NNP |
denotes |
Invitrogen |
T11331 |
103-104 |
-RRB- |
denotes |
) |
T11332 |
105-108 |
VBD |
denotes |
was |
T11328 |
109-117 |
VBN |
denotes |
screened |
T11333 |
118-120 |
TO |
denotes |
to |
T11334 |
121-129 |
VB |
denotes |
identify |
T11335 |
130-131 |
DT |
denotes |
a |
T11337 |
132-135 |
CD |
denotes |
140 |
T11339 |
135-136 |
HYPH |
denotes |
- |
T11338 |
136-138 |
NN |
denotes |
kb |
T11336 |
139-142 |
NN |
denotes |
BAC |
T11340 |
143-147 |
IN |
denotes |
from |
T11341 |
148-151 |
DT |
denotes |
the |
T11343 |
152-156 |
NN |
denotes |
Gdf5 |
T11342 |
157-162 |
NN |
denotes |
locus |
T11344 |
162-163 |
. |
denotes |
. |
T11345 |
163-450 |
sentence |
denotes |
This BAC was modified using a homologous recombination system in E. coli (Yang et al. 1997) to place nuclear-localized Cre recombinase (from plasmid pML78, gift of Gail Martin) followed by IRES-hPLAP (from plasmid 1726, gift of Oliver Bogler) directly behind the ATG start site of Gdf5. |
T11346 |
164-168 |
DT |
denotes |
This |
T11347 |
169-172 |
NN |
denotes |
BAC |
T11349 |
173-176 |
VBD |
denotes |
was |
T11348 |
177-185 |
VBN |
denotes |
modified |
T11350 |
186-191 |
VBG |
denotes |
using |
T11351 |
192-193 |
DT |
denotes |
a |
T11353 |
194-204 |
JJ |
denotes |
homologous |
T11354 |
205-218 |
NN |
denotes |
recombination |
T11352 |
219-225 |
NN |
denotes |
system |
T11355 |
226-228 |
IN |
denotes |
in |
T11356 |
229-231 |
NNP |
denotes |
E. |
T11357 |
232-236 |
NNP |
denotes |
coli |
T11358 |
237-238 |
-LRB- |
denotes |
( |
T11359 |
238-242 |
NNP |
denotes |
Yang |
T11360 |
243-245 |
FW |
denotes |
et |
T11361 |
246-249 |
FW |
denotes |
al. |
T11362 |
250-254 |
CD |
denotes |
1997 |
T11363 |
254-255 |
-RRB- |
denotes |
) |
T11364 |
256-258 |
TO |
denotes |
to |
T11365 |
259-264 |
VB |
denotes |
place |
T11366 |
265-272 |
JJ |
denotes |
nuclear |
T11368 |
272-273 |
HYPH |
denotes |
- |
T11367 |
273-282 |
VBN |
denotes |
localized |
T11370 |
283-286 |
NN |
denotes |
Cre |
T11369 |
287-298 |
NN |
denotes |
recombinase |
T11371 |
299-300 |
-LRB- |
denotes |
( |
T11372 |
300-304 |
IN |
denotes |
from |
T11373 |
305-312 |
NN |
denotes |
plasmid |
T11374 |
313-318 |
NN |
denotes |
pML78 |
T11375 |
318-320 |
, |
denotes |
, |
T11376 |
320-324 |
NN |
denotes |
gift |
T11377 |
325-327 |
IN |
denotes |
of |
T11378 |
328-332 |
NNP |
denotes |
Gail |
T11379 |
333-339 |
NNP |
denotes |
Martin |
T11380 |
339-340 |
-RRB- |
denotes |
) |
T11381 |
341-349 |
VBN |
denotes |
followed |
T11382 |
350-352 |
IN |
denotes |
by |
T11383 |
353-357 |
NN |
denotes |
IRES |
T11385 |
357-358 |
HYPH |
denotes |
- |
T11384 |
358-363 |
NN |
denotes |
hPLAP |
T11386 |
364-365 |
-LRB- |
denotes |
( |
T11387 |
365-369 |
IN |
denotes |
from |
T11388 |
370-377 |
NN |
denotes |
plasmid |
T11389 |
378-382 |
CD |
denotes |
1726 |
T11390 |
382-384 |
, |
denotes |
, |
T11391 |
384-388 |
NN |
denotes |
gift |
T11392 |
389-391 |
IN |
denotes |
of |
T11393 |
392-398 |
NNP |
denotes |
Oliver |
T11394 |
399-405 |
NNP |
denotes |
Bogler |
T11395 |
405-406 |
-RRB- |
denotes |
) |
T11396 |
407-415 |
RB |
denotes |
directly |
T11397 |
416-422 |
IN |
denotes |
behind |
T11398 |
423-426 |
DT |
denotes |
the |
T11400 |
427-430 |
NN |
denotes |
ATG |
T11401 |
431-436 |
NN |
denotes |
start |
T11399 |
437-441 |
NN |
denotes |
site |
T11402 |
442-444 |
IN |
denotes |
of |
T11403 |
445-449 |
NN |
denotes |
Gdf5 |
T11404 |
449-450 |
. |
denotes |
. |
T11405 |
450-571 |
sentence |
denotes |
In the process, 583 bp of the first exon of Gdf5 was removed and no functional GDF5 protein is predicted to be produced. |
T11406 |
451-453 |
IN |
denotes |
In |
T11408 |
454-457 |
DT |
denotes |
the |
T11409 |
458-465 |
NN |
denotes |
process |
T11410 |
465-467 |
, |
denotes |
, |
T11411 |
467-470 |
CD |
denotes |
583 |
T11412 |
471-473 |
NNS |
denotes |
bp |
T11413 |
474-476 |
IN |
denotes |
of |
T11414 |
477-480 |
DT |
denotes |
the |
T11416 |
481-486 |
JJ |
denotes |
first |
T11415 |
487-491 |
NN |
denotes |
exon |
T11417 |
492-494 |
IN |
denotes |
of |
T11418 |
495-499 |
NN |
denotes |
Gdf5 |
T11419 |
500-503 |
VBD |
denotes |
was |
T11407 |
504-511 |
VBN |
denotes |
removed |
T11420 |
512-515 |
CC |
denotes |
and |
T11421 |
516-518 |
DT |
denotes |
no |
T11423 |
519-529 |
JJ |
denotes |
functional |
T11424 |
530-534 |
NN |
denotes |
GDF5 |
T11422 |
535-542 |
NN |
denotes |
protein |
T11426 |
543-545 |
VBZ |
denotes |
is |
T11425 |
546-555 |
VBN |
denotes |
predicted |
T11427 |
556-558 |
TO |
denotes |
to |
T11429 |
559-561 |
VB |
denotes |
be |
T11428 |
562-570 |
VBN |
denotes |
produced |
T11430 |
570-571 |
. |
denotes |
. |
T11431 |
571-863 |
sentence |
denotes |
The 5′ homology arm was subcloned from a PCR product tailed with XhoI and Bsp120I restriction sites that contains 781 bp of 5′ genomic Gdf5 sequence ending at the ATG translation start site (forward primer 5′-CTGTCTCGAGATGAGGTGGAGGTGAAGACCCC-3′; reverse 5′-GTTTGGGCCCATCCTCTGGCCAGCCGCTG-3′). |
T11432 |
572-575 |
DT |
denotes |
The |
T11434 |
576-577 |
CD |
denotes |
5 |
T11435 |
577-578 |
SYM |
denotes |
′ |
T11436 |
579-587 |
NN |
denotes |
homology |
T11433 |
588-591 |
NN |
denotes |
arm |
T11438 |
592-595 |
VBD |
denotes |
was |
T11437 |
596-605 |
VBN |
denotes |
subcloned |
T11439 |
606-610 |
IN |
denotes |
from |
T11440 |
611-612 |
DT |
denotes |
a |
T11442 |
613-616 |
NN |
denotes |
PCR |
T11441 |
617-624 |
NN |
denotes |
product |
T11443 |
625-631 |
VBN |
denotes |
tailed |
T11444 |
632-636 |
IN |
denotes |
with |
T11445 |
637-641 |
NN |
denotes |
XhoI |
T11447 |
642-645 |
CC |
denotes |
and |
T11448 |
646-653 |
NN |
denotes |
Bsp120I |
T11449 |
654-665 |
NN |
denotes |
restriction |
T11446 |
666-671 |
NNS |
denotes |
sites |
T11450 |
672-676 |
WDT |
denotes |
that |
T11451 |
677-685 |
VBZ |
denotes |
contains |
T11452 |
686-689 |
CD |
denotes |
781 |
T11453 |
690-692 |
NNS |
denotes |
bp |
T11454 |
693-695 |
IN |
denotes |
of |
T11455 |
696-697 |
CD |
denotes |
5 |
T11457 |
697-698 |
SYM |
denotes |
′ |
T11458 |
699-706 |
JJ |
denotes |
genomic |
T11459 |
707-711 |
NN |
denotes |
Gdf5 |
T11456 |
712-720 |
NN |
denotes |
sequence |
T11460 |
721-727 |
VBG |
denotes |
ending |
T11461 |
728-730 |
IN |
denotes |
at |
T11462 |
731-734 |
DT |
denotes |
the |
T11464 |
735-738 |
NN |
denotes |
ATG |
T11465 |
739-750 |
NN |
denotes |
translation |
T11466 |
751-756 |
NN |
denotes |
start |
T11463 |
757-761 |
NN |
denotes |
site |
T11467 |
762-763 |
-LRB- |
denotes |
( |
T11469 |
763-770 |
JJ |
denotes |
forward |
T11470 |
771-777 |
NN |
denotes |
primer |
T11472 |
778-779 |
CD |
denotes |
5 |
T11473 |
779-780 |
SYM |
denotes |
′ |
T11474 |
780-781 |
HYPH |
denotes |
- |
T11471 |
781-813 |
NN |
denotes |
CTGTCTCGAGATGAGGTGGAGGTGAAGACCCC |
T11475 |
813-814 |
HYPH |
denotes |
- |
T11476 |
814-815 |
CD |
denotes |
3 |
T11477 |
815-816 |
SYM |
denotes |
′ |
T11478 |
816-817 |
: |
denotes |
; |
T11479 |
818-825 |
JJ |
denotes |
reverse |
T11480 |
826-827 |
CD |
denotes |
5 |
T11481 |
827-828 |
SYM |
denotes |
′ |
T11482 |
828-829 |
HYPH |
denotes |
- |
T11468 |
829-858 |
NN |
denotes |
GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
T11483 |
858-859 |
HYPH |
denotes |
- |
T11484 |
859-860 |
CD |
denotes |
3 |
T11485 |
860-861 |
SYM |
denotes |
′ |
T11486 |
861-862 |
-RRB- |
denotes |
) |
T11487 |
862-863 |
. |
denotes |
. |
T11488 |
863-928 |
sentence |
denotes |
Cre was subcloned from a 1.1-kb Bsp120I/EcoRI fragment of pML78. |
T11489 |
864-867 |
NN |
denotes |
Cre |
T11491 |
868-871 |
VBD |
denotes |
was |
T11490 |
872-881 |
VBN |
denotes |
subcloned |
T11492 |
882-886 |
IN |
denotes |
from |
T11493 |
887-888 |
DT |
denotes |
a |
T11495 |
889-892 |
CD |
denotes |
1.1 |
T11497 |
892-893 |
HYPH |
denotes |
- |
T11496 |
893-895 |
NN |
denotes |
kb |
T11498 |
896-903 |
NN |
denotes |
Bsp120I |
T11500 |
903-904 |
HYPH |
denotes |
/ |
T11499 |
904-909 |
NN |
denotes |
EcoRI |
T11494 |
910-918 |
NN |
denotes |
fragment |
T11501 |
919-921 |
IN |
denotes |
of |
T11502 |
922-927 |
NN |
denotes |
pML78 |
T11503 |
927-928 |
. |
denotes |
. |
T11504 |
928-1175 |
sentence |
denotes |
IRES hPLAP was subcloned from a 2.1-kb PCR product tailed with EcoRI and SpeI sites that contains the hPLAP translation stop site (forward primer 5′-ATCTCTCGAGGAATTCTCCACCATATTGCCGTCTTTTG-3′; reverse 5′-AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG-3′). |
T11505 |
929-933 |
NN |
denotes |
IRES |
T11506 |
934-939 |
NN |
denotes |
hPLAP |
T11508 |
940-943 |
VBD |
denotes |
was |
T11507 |
944-953 |
VBN |
denotes |
subcloned |
T11509 |
954-958 |
IN |
denotes |
from |
T11510 |
959-960 |
DT |
denotes |
a |
T11512 |
961-964 |
CD |
denotes |
2.1 |
T11514 |
964-965 |
HYPH |
denotes |
- |
T11513 |
965-967 |
NN |
denotes |
kb |
T11515 |
968-971 |
NN |
denotes |
PCR |
T11511 |
972-979 |
NN |
denotes |
product |
T11516 |
980-986 |
VBN |
denotes |
tailed |
T11517 |
987-991 |
IN |
denotes |
with |
T11518 |
992-997 |
NN |
denotes |
EcoRI |
T11520 |
998-1001 |
CC |
denotes |
and |
T11521 |
1002-1006 |
NN |
denotes |
SpeI |
T11519 |
1007-1012 |
NNS |
denotes |
sites |
T11522 |
1013-1017 |
WDT |
denotes |
that |
T11523 |
1018-1026 |
VBZ |
denotes |
contains |
T11524 |
1027-1030 |
DT |
denotes |
the |
T11526 |
1031-1036 |
NN |
denotes |
hPLAP |
T11527 |
1037-1048 |
NN |
denotes |
translation |
T11528 |
1049-1053 |
NN |
denotes |
stop |
T11525 |
1054-1058 |
NN |
denotes |
site |
T11529 |
1059-1060 |
-LRB- |
denotes |
( |
T11531 |
1060-1067 |
JJ |
denotes |
forward |
T11532 |
1068-1074 |
NN |
denotes |
primer |
T11534 |
1075-1076 |
CD |
denotes |
5 |
T11535 |
1076-1077 |
SYM |
denotes |
′ |
T11536 |
1077-1078 |
HYPH |
denotes |
- |
T11533 |
1078-1116 |
NN |
denotes |
ATCTCTCGAGGAATTCTCCACCATATTGCCGTCTTTTG |
T11537 |
1116-1117 |
HYPH |
denotes |
- |
T11538 |
1117-1118 |
CD |
denotes |
3 |
T11539 |
1118-1119 |
SYM |
denotes |
′ |
T11540 |
1119-1120 |
: |
denotes |
; |
T11541 |
1121-1128 |
JJ |
denotes |
reverse |
T11542 |
1129-1130 |
CD |
denotes |
5 |
T11543 |
1130-1131 |
SYM |
denotes |
′ |
T11544 |
1131-1132 |
HYPH |
denotes |
- |
T11530 |
1132-1170 |
NN |
denotes |
AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
T11545 |
1170-1171 |
HYPH |
denotes |
- |
T11546 |
1171-1172 |
CD |
denotes |
3 |
T11547 |
1172-1173 |
SYM |
denotes |
′ |
T11548 |
1173-1174 |
-RRB- |
denotes |
) |
T11549 |
1174-1175 |
. |
denotes |
. |
T11550 |
1175-1343 |
sentence |
denotes |
The 3′ homology arm was subcloned from a 0.8-kb PCR product amplified from a 0.9-kb XhoI Gdf5 genomic subclone containing part of the first exon and downstream intron. |
T11551 |
1176-1179 |
DT |
denotes |
The |
T11553 |
1180-1181 |
CD |
denotes |
3 |
T11554 |
1181-1182 |
SYM |
denotes |
′ |
T11555 |
1183-1191 |
NN |
denotes |
homology |
T11552 |
1192-1195 |
NN |
denotes |
arm |
T11557 |
1196-1199 |
VBD |
denotes |
was |
T11556 |
1200-1209 |
VBN |
denotes |
subcloned |
T11558 |
1210-1214 |
IN |
denotes |
from |
T11559 |
1215-1216 |
DT |
denotes |
a |
T11561 |
1217-1220 |
CD |
denotes |
0.8 |
T11563 |
1220-1221 |
HYPH |
denotes |
- |
T11562 |
1221-1223 |
NN |
denotes |
kb |
T11564 |
1224-1227 |
NN |
denotes |
PCR |
T11560 |
1228-1235 |
NN |
denotes |
product |
T11565 |
1236-1245 |
VBN |
denotes |
amplified |
T11566 |
1246-1250 |
IN |
denotes |
from |
T11567 |
1251-1252 |
DT |
denotes |
a |
T11569 |
1253-1256 |
CD |
denotes |
0.9 |
T11571 |
1256-1257 |
HYPH |
denotes |
- |
T11570 |
1257-1259 |
NN |
denotes |
kb |
T11572 |
1260-1264 |
NN |
denotes |
XhoI |
T11573 |
1265-1269 |
NN |
denotes |
Gdf5 |
T11574 |
1270-1277 |
JJ |
denotes |
genomic |
T11568 |
1278-1286 |
NN |
denotes |
subclone |
T11575 |
1287-1297 |
VBG |
denotes |
containing |
T11576 |
1298-1302 |
NN |
denotes |
part |
T11577 |
1303-1305 |
IN |
denotes |
of |
T11578 |
1306-1309 |
DT |
denotes |
the |
T11580 |
1310-1315 |
JJ |
denotes |
first |
T11579 |
1316-1320 |
NN |
denotes |
exon |
T11581 |
1321-1324 |
CC |
denotes |
and |
T11582 |
1325-1335 |
JJ |
denotes |
downstream |
T11583 |
1336-1342 |
NN |
denotes |
intron |
T11584 |
1342-1343 |
. |
denotes |
. |
T11585 |
1343-1658 |
sentence |
denotes |
The forward primer contains the 3′ end of the first exon and is tailed with a SpeI site; the reverse primer is from the T7 promoter of the vector containing the 0.9-kb subclone and flanks the intronic XhoI site (forward primer 5′-CTAAACTAGTCACCAGCTTTATTGACAAAGG-3′; reverse 5′-GATTTCTAGAGTAATACGACTCACTATAGGGC-3′). |
T11586 |
1344-1347 |
DT |
denotes |
The |
T11588 |
1348-1355 |
JJ |
denotes |
forward |
T11587 |
1356-1362 |
NN |
denotes |
primer |
T11589 |
1363-1371 |
VBZ |
denotes |
contains |
T11591 |
1372-1375 |
DT |
denotes |
the |
T11593 |
1376-1377 |
CD |
denotes |
3 |
T11594 |
1377-1378 |
SYM |
denotes |
′ |
T11592 |
1379-1382 |
NN |
denotes |
end |
T11595 |
1383-1385 |
IN |
denotes |
of |
T11596 |
1386-1389 |
DT |
denotes |
the |
T11598 |
1390-1395 |
JJ |
denotes |
first |
T11597 |
1396-1400 |
NN |
denotes |
exon |
T11599 |
1401-1404 |
CC |
denotes |
and |
T11600 |
1405-1407 |
VBZ |
denotes |
is |
T11601 |
1408-1414 |
VBN |
denotes |
tailed |
T11602 |
1415-1419 |
IN |
denotes |
with |
T11603 |
1420-1421 |
DT |
denotes |
a |
T11605 |
1422-1426 |
NN |
denotes |
SpeI |
T11604 |
1427-1431 |
NN |
denotes |
site |
T11606 |
1431-1432 |
: |
denotes |
; |
T11607 |
1433-1436 |
DT |
denotes |
the |
T11609 |
1437-1444 |
JJ |
denotes |
reverse |
T11608 |
1445-1451 |
NN |
denotes |
primer |
T11590 |
1452-1454 |
VBZ |
denotes |
is |
T11610 |
1455-1459 |
IN |
denotes |
from |
T11611 |
1460-1463 |
DT |
denotes |
the |
T11613 |
1464-1466 |
NN |
denotes |
T7 |
T11612 |
1467-1475 |
NN |
denotes |
promoter |
T11614 |
1476-1478 |
IN |
denotes |
of |
T11615 |
1479-1482 |
DT |
denotes |
the |
T11616 |
1483-1489 |
NN |
denotes |
vector |
T11617 |
1490-1500 |
VBG |
denotes |
containing |
T11618 |
1501-1504 |
DT |
denotes |
the |
T11620 |
1505-1508 |
CD |
denotes |
0.9 |
T11622 |
1508-1509 |
HYPH |
denotes |
- |
T11621 |
1509-1511 |
NN |
denotes |
kb |
T11619 |
1512-1520 |
NN |
denotes |
subclone |
T11623 |
1521-1524 |
CC |
denotes |
and |
T11624 |
1525-1531 |
VBZ |
denotes |
flanks |
T11625 |
1532-1535 |
DT |
denotes |
the |
T11627 |
1536-1544 |
JJ |
denotes |
intronic |
T11628 |
1545-1549 |
NN |
denotes |
XhoI |
T11626 |
1550-1554 |
NN |
denotes |
site |
T11629 |
1555-1556 |
-LRB- |
denotes |
( |
T11631 |
1556-1563 |
JJ |
denotes |
forward |
T11632 |
1564-1570 |
NN |
denotes |
primer |
T11634 |
1571-1572 |
CD |
denotes |
5 |
T11635 |
1572-1573 |
SYM |
denotes |
′ |
T11636 |
1573-1574 |
HYPH |
denotes |
- |
T11633 |
1574-1605 |
NN |
denotes |
CTAAACTAGTCACCAGCTTTATTGACAAAGG |
T11637 |
1605-1606 |
HYPH |
denotes |
- |
T11638 |
1606-1607 |
CD |
denotes |
3 |
T11639 |
1607-1608 |
SYM |
denotes |
′ |
T11640 |
1608-1609 |
: |
denotes |
; |
T11641 |
1610-1617 |
JJ |
denotes |
reverse |
T11642 |
1618-1619 |
CD |
denotes |
5 |
T11643 |
1619-1620 |
SYM |
denotes |
′ |
T11644 |
1620-1621 |
HYPH |
denotes |
- |
T11630 |
1621-1653 |
NN |
denotes |
GATTTCTAGAGTAATACGACTCACTATAGGGC |
T11645 |
1653-1654 |
HYPH |
denotes |
- |
T11646 |
1654-1655 |
CD |
denotes |
3 |
T11647 |
1655-1656 |
SYM |
denotes |
′ |
T11648 |
1656-1657 |
-RRB- |
denotes |
) |
T11649 |
1657-1658 |
. |
denotes |
. |
T11650 |
1658-1879 |
sentence |
denotes |
The targeting construct was built and verified in pBSSK (Stratagene, La Jolla, California, United States), then digested with XhoI and subcloned into pSV1, the vector used for homologous recombination (Yang et al. 1997). |
T11651 |
1659-1662 |
DT |
denotes |
The |
T11653 |
1663-1672 |
NN |
denotes |
targeting |
T11652 |
1673-1682 |
NN |
denotes |
construct |
T11655 |
1683-1686 |
VBD |
denotes |
was |
T11654 |
1687-1692 |
VBN |
denotes |
built |
T11656 |
1693-1696 |
CC |
denotes |
and |
T11657 |
1697-1705 |
VBN |
denotes |
verified |
T11658 |
1706-1708 |
IN |
denotes |
in |
T11659 |
1709-1714 |
NN |
denotes |
pBSSK |
T11660 |
1715-1716 |
-LRB- |
denotes |
( |
T11661 |
1716-1726 |
NNP |
denotes |
Stratagene |
T11662 |
1726-1728 |
, |
denotes |
, |
T11663 |
1728-1730 |
NNP |
denotes |
La |
T11664 |
1731-1736 |
NNP |
denotes |
Jolla |
T11665 |
1736-1738 |
, |
denotes |
, |
T11666 |
1738-1748 |
NNP |
denotes |
California |
T11667 |
1748-1750 |
, |
denotes |
, |
T11668 |
1750-1756 |
NNP |
denotes |
United |
T11669 |
1757-1763 |
NNP |
denotes |
States |
T11670 |
1763-1764 |
-RRB- |
denotes |
) |
T11671 |
1764-1766 |
, |
denotes |
, |
T11672 |
1766-1770 |
RB |
denotes |
then |
T11673 |
1771-1779 |
VBN |
denotes |
digested |
T11674 |
1780-1784 |
IN |
denotes |
with |
T11675 |
1785-1789 |
NN |
denotes |
XhoI |
T11676 |
1790-1793 |
CC |
denotes |
and |
T11677 |
1794-1803 |
VBN |
denotes |
subcloned |
T11678 |
1804-1808 |
IN |
denotes |
into |
T11679 |
1809-1813 |
NN |
denotes |
pSV1 |
T11680 |
1813-1815 |
, |
denotes |
, |
T11681 |
1815-1818 |
DT |
denotes |
the |
T11682 |
1819-1825 |
NN |
denotes |
vector |
T11683 |
1826-1830 |
VBN |
denotes |
used |
T11684 |
1831-1834 |
IN |
denotes |
for |
T11685 |
1835-1845 |
JJ |
denotes |
homologous |
T11686 |
1846-1859 |
NN |
denotes |
recombination |
T11687 |
1860-1861 |
-LRB- |
denotes |
( |
T11688 |
1861-1865 |
NNP |
denotes |
Yang |
T11689 |
1866-1868 |
FW |
denotes |
et |
T11690 |
1869-1872 |
FW |
denotes |
al. |
T11691 |
1873-1877 |
CD |
denotes |
1997 |
T11692 |
1877-1878 |
-RRB- |
denotes |
) |
T11693 |
1878-1879 |
. |
denotes |
. |
T11694 |
1879-2027 |
sentence |
denotes |
Southern blotting, PCR, and DNA sequence analysis confirmed the appropriate targeting construct and BAC modifications were made (unpublished data). |
T11695 |
1880-1888 |
NNP |
denotes |
Southern |
T11696 |
1889-1897 |
NN |
denotes |
blotting |
T11698 |
1897-1899 |
, |
denotes |
, |
T11699 |
1899-1902 |
NN |
denotes |
PCR |
T11700 |
1902-1904 |
, |
denotes |
, |
T11701 |
1904-1907 |
CC |
denotes |
and |
T11702 |
1908-1911 |
NN |
denotes |
DNA |
T11703 |
1912-1920 |
NN |
denotes |
sequence |
T11697 |
1921-1929 |
NN |
denotes |
analysis |
T11704 |
1930-1939 |
VBD |
denotes |
confirmed |
T11705 |
1940-1943 |
DT |
denotes |
the |
T11707 |
1944-1955 |
JJ |
denotes |
appropriate |
T11708 |
1956-1965 |
NN |
denotes |
targeting |
T11706 |
1966-1975 |
NN |
denotes |
construct |
T11710 |
1976-1979 |
CC |
denotes |
and |
T11711 |
1980-1983 |
NN |
denotes |
BAC |
T11712 |
1984-1997 |
NNS |
denotes |
modifications |
T11713 |
1998-2002 |
VBD |
denotes |
were |
T11709 |
2003-2007 |
VBN |
denotes |
made |
T11714 |
2008-2009 |
-LRB- |
denotes |
( |
T11716 |
2009-2020 |
JJ |
denotes |
unpublished |
T11715 |
2021-2025 |
NNS |
denotes |
data |
T11717 |
2025-2026 |
-RRB- |
denotes |
) |
T11718 |
2026-2027 |
. |
denotes |
. |
T11719 |
2027-2229 |
sentence |
denotes |
Before the modified BAC was injected to produce transgenic animals, a loxP site present in the BAC vector, pBeloBAC11, was removed to prevent the addition of undesired Cre target sites into the genome. |
T11720 |
2028-2034 |
IN |
denotes |
Before |
T11722 |
2035-2038 |
DT |
denotes |
the |
T11724 |
2039-2047 |
VBN |
denotes |
modified |
T11723 |
2048-2051 |
NN |
denotes |
BAC |
T11725 |
2052-2055 |
VBD |
denotes |
was |
T11721 |
2056-2064 |
VBN |
denotes |
injected |
T11727 |
2065-2067 |
TO |
denotes |
to |
T11728 |
2068-2075 |
VB |
denotes |
produce |
T11729 |
2076-2086 |
JJ |
denotes |
transgenic |
T11730 |
2087-2094 |
NNS |
denotes |
animals |
T11731 |
2094-2096 |
, |
denotes |
, |
T11732 |
2096-2097 |
DT |
denotes |
a |
T11734 |
2098-2102 |
NN |
denotes |
loxP |
T11733 |
2103-2107 |
NN |
denotes |
site |
T11735 |
2108-2115 |
JJ |
denotes |
present |
T11736 |
2116-2118 |
IN |
denotes |
in |
T11737 |
2119-2122 |
DT |
denotes |
the |
T11739 |
2123-2126 |
NN |
denotes |
BAC |
T11738 |
2127-2133 |
NN |
denotes |
vector |
T11740 |
2133-2135 |
, |
denotes |
, |
T11741 |
2135-2145 |
NN |
denotes |
pBeloBAC11 |
T11742 |
2145-2147 |
, |
denotes |
, |
T11743 |
2147-2150 |
VBD |
denotes |
was |
T11726 |
2151-2158 |
VBN |
denotes |
removed |
T11744 |
2159-2161 |
TO |
denotes |
to |
T11745 |
2162-2169 |
VB |
denotes |
prevent |
T11746 |
2170-2173 |
DT |
denotes |
the |
T11747 |
2174-2182 |
NN |
denotes |
addition |
T11748 |
2183-2185 |
IN |
denotes |
of |
T11749 |
2186-2195 |
JJ |
denotes |
undesired |
T11751 |
2196-2199 |
NN |
denotes |
Cre |
T11752 |
2200-2206 |
NN |
denotes |
target |
T11750 |
2207-2212 |
NNS |
denotes |
sites |
T11753 |
2213-2217 |
IN |
denotes |
into |
T11754 |
2218-2221 |
DT |
denotes |
the |
T11755 |
2222-2228 |
NN |
denotes |
genome |
T11756 |
2228-2229 |
. |
denotes |
. |
T11757 |
2229-2384 |
sentence |
denotes |
To do this, BAC DNA was prepared by CsCl separation, digested with NotI to free the insert from the vector, and size-fractionated over a sucrose gradient. |
T11758 |
2230-2232 |
TO |
denotes |
To |
T11759 |
2233-2235 |
VB |
denotes |
do |
T11761 |
2236-2240 |
DT |
denotes |
this |
T11762 |
2240-2242 |
, |
denotes |
, |
T11763 |
2242-2245 |
NN |
denotes |
BAC |
T11764 |
2246-2249 |
NN |
denotes |
DNA |
T11765 |
2250-2253 |
VBD |
denotes |
was |
T11760 |
2254-2262 |
VBN |
denotes |
prepared |
T11766 |
2263-2265 |
IN |
denotes |
by |
T11767 |
2266-2270 |
NN |
denotes |
CsCl |
T11768 |
2271-2281 |
NN |
denotes |
separation |
T11769 |
2281-2283 |
, |
denotes |
, |
T11770 |
2283-2291 |
VBN |
denotes |
digested |
T11771 |
2292-2296 |
IN |
denotes |
with |
T11772 |
2297-2301 |
NN |
denotes |
NotI |
T11773 |
2302-2304 |
TO |
denotes |
to |
T11774 |
2305-2309 |
VB |
denotes |
free |
T11775 |
2310-2313 |
DT |
denotes |
the |
T11776 |
2314-2320 |
NN |
denotes |
insert |
T11777 |
2321-2325 |
IN |
denotes |
from |
T11778 |
2326-2329 |
DT |
denotes |
the |
T11779 |
2330-2336 |
NN |
denotes |
vector |
T11780 |
2336-2338 |
, |
denotes |
, |
T11781 |
2338-2341 |
CC |
denotes |
and |
T11782 |
2342-2346 |
NN |
denotes |
size |
T11784 |
2346-2347 |
HYPH |
denotes |
- |
T11783 |
2347-2359 |
VBN |
denotes |
fractionated |
T11785 |
2360-2364 |
IN |
denotes |
over |
T11786 |
2365-2366 |
DT |
denotes |
a |
T11788 |
2367-2374 |
NN |
denotes |
sucrose |
T11787 |
2375-2383 |
NN |
denotes |
gradient |
T11789 |
2383-2384 |
. |
denotes |
. |
T11790 |
2384-2495 |
sentence |
denotes |
Aliquots of fractions were run on a pulse-field gel and Southern blotted using vector-specific DNA as a probe. |
T11791 |
2385-2393 |
NNS |
denotes |
Aliquots |
T11793 |
2394-2396 |
IN |
denotes |
of |
T11794 |
2397-2406 |
NNS |
denotes |
fractions |
T11795 |
2407-2411 |
VBD |
denotes |
were |
T11792 |
2412-2415 |
VBN |
denotes |
run |
T11796 |
2416-2418 |
IN |
denotes |
on |
T11797 |
2419-2420 |
DT |
denotes |
a |
T11799 |
2421-2426 |
NN |
denotes |
pulse |
T11801 |
2426-2427 |
HYPH |
denotes |
- |
T11800 |
2427-2432 |
NN |
denotes |
field |
T11798 |
2433-2436 |
NN |
denotes |
gel |
T11802 |
2437-2440 |
CC |
denotes |
and |
T11803 |
2441-2449 |
NNP |
denotes |
Southern |
T11804 |
2450-2457 |
VBN |
denotes |
blotted |
T11805 |
2458-2463 |
VBG |
denotes |
using |
T11806 |
2464-2470 |
NN |
denotes |
vector |
T11808 |
2470-2471 |
HYPH |
denotes |
- |
T11809 |
2471-2479 |
JJ |
denotes |
specific |
T11807 |
2480-2483 |
NN |
denotes |
DNA |
T11810 |
2484-2486 |
IN |
denotes |
as |
T11811 |
2487-2488 |
DT |
denotes |
a |
T11812 |
2489-2494 |
NN |
denotes |
probe |
T11813 |
2494-2495 |
. |
denotes |
. |
T11814 |
2495-2745 |
sentence |
denotes |
Fractions containing unsheared insert and almost no detectable vector DNA were dialyzed in microinjection buffer (10 mM Tris [pH 7.4] with 0.15 mM EDTA [pH 8.0]) using Centriprep-30 concentrators (Millipore, Billerica, Massachusetts, United States). |
T11815 |
2496-2505 |
NNS |
denotes |
Fractions |
T11817 |
2506-2516 |
VBG |
denotes |
containing |
T11818 |
2517-2526 |
JJ |
denotes |
unsheared |
T11819 |
2527-2533 |
NN |
denotes |
insert |
T11820 |
2534-2537 |
CC |
denotes |
and |
T11821 |
2538-2544 |
RB |
denotes |
almost |
T11823 |
2545-2547 |
DT |
denotes |
no |
T11824 |
2548-2558 |
JJ |
denotes |
detectable |
T11825 |
2559-2565 |
NN |
denotes |
vector |
T11822 |
2566-2569 |
NN |
denotes |
DNA |
T11826 |
2570-2574 |
VBD |
denotes |
were |
T11816 |
2575-2583 |
VBN |
denotes |
dialyzed |
T11827 |
2584-2586 |
IN |
denotes |
in |
T11828 |
2587-2601 |
NN |
denotes |
microinjection |
T11829 |
2602-2608 |
NN |
denotes |
buffer |
T11830 |
2609-2610 |
-LRB- |
denotes |
( |
T11832 |
2610-2612 |
CD |
denotes |
10 |
T11833 |
2613-2615 |
NN |
denotes |
mM |
T11831 |
2616-2620 |
NN |
denotes |
Tris |
T11834 |
2621-2622 |
-LRB- |
denotes |
[ |
T11835 |
2622-2624 |
NN |
denotes |
pH |
T11836 |
2625-2628 |
CD |
denotes |
7.4 |
T11837 |
2628-2629 |
-RRB- |
denotes |
] |
T11838 |
2630-2634 |
IN |
denotes |
with |
T11839 |
2635-2639 |
CD |
denotes |
0.15 |
T11840 |
2640-2642 |
NN |
denotes |
mM |
T11841 |
2643-2647 |
NN |
denotes |
EDTA |
T11842 |
2648-2649 |
-LRB- |
denotes |
[ |
T11843 |
2649-2651 |
NN |
denotes |
pH |
T11844 |
2652-2655 |
CD |
denotes |
8.0 |
T11845 |
2655-2656 |
-RRB- |
denotes |
] |
T11846 |
2656-2657 |
-RRB- |
denotes |
) |
T11847 |
2658-2663 |
VBG |
denotes |
using |
T11848 |
2664-2674 |
NN |
denotes |
Centriprep |
T11850 |
2674-2675 |
HYPH |
denotes |
- |
T11851 |
2675-2677 |
CD |
denotes |
30 |
T11849 |
2678-2691 |
NNS |
denotes |
concentrators |
T11852 |
2692-2693 |
-LRB- |
denotes |
( |
T11853 |
2693-2702 |
NNP |
denotes |
Millipore |
T11854 |
2702-2704 |
, |
denotes |
, |
T11855 |
2704-2713 |
NNP |
denotes |
Billerica |
T11856 |
2713-2715 |
, |
denotes |
, |
T11857 |
2715-2728 |
NNP |
denotes |
Massachusetts |
T11858 |
2728-2730 |
, |
denotes |
, |
T11859 |
2730-2736 |
NNP |
denotes |
United |
T11860 |
2737-2743 |
NNP |
denotes |
States |
T11861 |
2743-2744 |
-RRB- |
denotes |
) |
T11862 |
2744-2745 |
. |
denotes |
. |
T11863 |
2745-2899 |
sentence |
denotes |
This purified insert DNA was adjusted to 1 ng/μl and injected into the pronucleus of fertilized eggs from FVB/N mice by the Stanford Transgenic Facility. |
T11864 |
2746-2750 |
DT |
denotes |
This |
T11866 |
2751-2759 |
VBN |
denotes |
purified |
T11867 |
2760-2766 |
NN |
denotes |
insert |
T11865 |
2767-2770 |
NN |
denotes |
DNA |
T11869 |
2771-2774 |
VBD |
denotes |
was |
T11868 |
2775-2783 |
VBN |
denotes |
adjusted |
T11870 |
2784-2786 |
IN |
denotes |
to |
T11871 |
2787-2788 |
CD |
denotes |
1 |
T11872 |
2789-2791 |
NN |
denotes |
ng |
T11873 |
2791-2792 |
SYM |
denotes |
/ |
T11874 |
2792-2794 |
NN |
denotes |
μl |
T11875 |
2795-2798 |
CC |
denotes |
and |
T11876 |
2799-2807 |
VBN |
denotes |
injected |
T11877 |
2808-2812 |
IN |
denotes |
into |
T11878 |
2813-2816 |
DT |
denotes |
the |
T11879 |
2817-2827 |
NN |
denotes |
pronucleus |
T11880 |
2828-2830 |
IN |
denotes |
of |
T11881 |
2831-2841 |
VBN |
denotes |
fertilized |
T11882 |
2842-2846 |
NNS |
denotes |
eggs |
T11883 |
2847-2851 |
IN |
denotes |
from |
T11884 |
2852-2855 |
NN |
denotes |
FVB |
T11886 |
2855-2856 |
HYPH |
denotes |
/ |
T11885 |
2856-2857 |
NN |
denotes |
N |
T11887 |
2858-2862 |
NNS |
denotes |
mice |
T11888 |
2863-2865 |
IN |
denotes |
by |
T11889 |
2866-2869 |
DT |
denotes |
the |
T11891 |
2870-2878 |
NNP |
denotes |
Stanford |
T11892 |
2879-2889 |
NNP |
denotes |
Transgenic |
T11890 |
2890-2898 |
NNP |
denotes |
Facility |
T11893 |
2898-2899 |
. |
denotes |
. |
T11894 |
2899-3248 |
sentence |
denotes |
Transgenic founder mice were identified by PCR using Cre-specific primers 5′-GCCTGCATTACCGGTCGATGCAACGA-3′ and 5′-GTGGCAGATGGCGCGGCAACACCATT-3′, which amplify a 725-bp product, and were assessed for absence of BAC vector using vector-specific primers 5′-CGGAGTCTGATGCGGTTGCGATG-3′ and 5′-AGTGCTGTTCCCTGGTGCTTCCTC-3′, which amplify a 465-bp product. |
T11895 |
2900-2910 |
JJ |
denotes |
Transgenic |
T11897 |
2911-2918 |
NN |
denotes |
founder |
T11896 |
2919-2923 |
NNS |
denotes |
mice |
T11899 |
2924-2928 |
VBD |
denotes |
were |
T11898 |
2929-2939 |
VBN |
denotes |
identified |
T11900 |
2940-2942 |
IN |
denotes |
by |
T11901 |
2943-2946 |
NN |
denotes |
PCR |
T11902 |
2947-2952 |
VBG |
denotes |
using |
T11903 |
2953-2956 |
NN |
denotes |
Cre |
T11905 |
2956-2957 |
HYPH |
denotes |
- |
T11904 |
2957-2965 |
JJ |
denotes |
specific |
T11907 |
2966-2973 |
NNS |
denotes |
primers |
T11908 |
2974-2975 |
CD |
denotes |
5 |
T11909 |
2975-2976 |
SYM |
denotes |
′ |
T11910 |
2976-2977 |
HYPH |
denotes |
- |
T11906 |
2977-3003 |
NN |
denotes |
GCCTGCATTACCGGTCGATGCAACGA |
T11911 |
3003-3004 |
HYPH |
denotes |
- |
T11912 |
3004-3005 |
CD |
denotes |
3 |
T11913 |
3005-3006 |
SYM |
denotes |
′ |
T11914 |
3007-3010 |
CC |
denotes |
and |
T11915 |
3011-3012 |
CD |
denotes |
5 |
T11917 |
3012-3013 |
SYM |
denotes |
′ |
T11918 |
3013-3014 |
HYPH |
denotes |
- |
T11916 |
3014-3040 |
NN |
denotes |
GTGGCAGATGGCGCGGCAACACCATT |
T11919 |
3040-3041 |
HYPH |
denotes |
- |
T11920 |
3041-3042 |
CD |
denotes |
3 |
T11921 |
3042-3043 |
SYM |
denotes |
′ |
T11922 |
3043-3045 |
, |
denotes |
, |
T11923 |
3045-3050 |
WDT |
denotes |
which |
T11924 |
3051-3058 |
VBP |
denotes |
amplify |
T11925 |
3059-3060 |
DT |
denotes |
a |
T11927 |
3061-3064 |
CD |
denotes |
725 |
T11929 |
3064-3065 |
HYPH |
denotes |
- |
T11928 |
3065-3067 |
NN |
denotes |
bp |
T11926 |
3068-3075 |
NN |
denotes |
product |
T11930 |
3075-3077 |
, |
denotes |
, |
T11931 |
3077-3080 |
CC |
denotes |
and |
T11932 |
3081-3085 |
VBD |
denotes |
were |
T11933 |
3086-3094 |
VBN |
denotes |
assessed |
T11934 |
3095-3098 |
IN |
denotes |
for |
T11935 |
3099-3106 |
NN |
denotes |
absence |
T11936 |
3107-3109 |
IN |
denotes |
of |
T11937 |
3110-3113 |
NN |
denotes |
BAC |
T11938 |
3114-3120 |
NN |
denotes |
vector |
T11939 |
3121-3126 |
VBG |
denotes |
using |
T11940 |
3127-3133 |
NN |
denotes |
vector |
T11942 |
3133-3134 |
HYPH |
denotes |
- |
T11943 |
3134-3142 |
JJ |
denotes |
specific |
T11941 |
3143-3150 |
NNS |
denotes |
primers |
T11944 |
3151-3152 |
CD |
denotes |
5 |
T11946 |
3152-3153 |
SYM |
denotes |
′ |
T11947 |
3153-3154 |
HYPH |
denotes |
- |
T11945 |
3154-3177 |
NN |
denotes |
CGGAGTCTGATGCGGTTGCGATG |
T11948 |
3177-3178 |
HYPH |
denotes |
- |
T11949 |
3178-3179 |
CD |
denotes |
3 |
T11950 |
3179-3180 |
SYM |
denotes |
′ |
T11951 |
3181-3184 |
CC |
denotes |
and |
T11952 |
3185-3186 |
CD |
denotes |
5 |
T11954 |
3186-3187 |
SYM |
denotes |
′ |
T11955 |
3187-3188 |
HYPH |
denotes |
- |
T11953 |
3188-3212 |
NN |
denotes |
AGTGCTGTTCCCTGGTGCTTCCTC |
T11956 |
3212-3213 |
HYPH |
denotes |
- |
T11957 |
3213-3214 |
CD |
denotes |
3 |
T11958 |
3214-3215 |
SYM |
denotes |
′ |
T11959 |
3215-3217 |
, |
denotes |
, |
T11960 |
3217-3222 |
WDT |
denotes |
which |
T11961 |
3223-3230 |
VBP |
denotes |
amplify |
T11962 |
3231-3232 |
DT |
denotes |
a |
T11964 |
3233-3236 |
CD |
denotes |
465 |
T11966 |
3236-3237 |
HYPH |
denotes |
- |
T11965 |
3237-3239 |
NN |
denotes |
bp |
T11963 |
3240-3247 |
NN |
denotes |
product |
T11967 |
3247-3248 |
. |
denotes |
. |
T11968 |
3248-3332 |
sentence |
denotes |
Three lines of Gdf5-Cre mice were established and maintained on the FVB background. |
T11969 |
3249-3254 |
CD |
denotes |
Three |
T11970 |
3255-3260 |
NNS |
denotes |
lines |
T11972 |
3261-3263 |
IN |
denotes |
of |
T11973 |
3264-3268 |
NN |
denotes |
Gdf5 |
T11975 |
3268-3269 |
HYPH |
denotes |
- |
T11974 |
3269-3272 |
NN |
denotes |
Cre |
T11976 |
3273-3277 |
NNS |
denotes |
mice |
T11977 |
3278-3282 |
VBD |
denotes |
were |
T11971 |
3283-3294 |
VBN |
denotes |
established |
T11978 |
3295-3298 |
CC |
denotes |
and |
T11979 |
3299-3309 |
VBN |
denotes |
maintained |
T11980 |
3310-3312 |
IN |
denotes |
on |
T11981 |
3313-3316 |
DT |
denotes |
the |
T11983 |
3317-3320 |
NN |
denotes |
FVB |
T11982 |
3321-3331 |
NN |
denotes |
background |
T11984 |
3331-3332 |
. |
denotes |
. |
T11985 |
3332-3434 |
sentence |
denotes |
Matings with R26R Cre-inducible LACZ reporter mice (Soriano 1999) were used to test for Cre activity. |
T11986 |
3333-3340 |
NNS |
denotes |
Matings |
T11988 |
3341-3345 |
IN |
denotes |
with |
T11989 |
3346-3350 |
NN |
denotes |
R26R |
T11990 |
3351-3354 |
NN |
denotes |
Cre |
T11992 |
3354-3355 |
HYPH |
denotes |
- |
T11991 |
3355-3364 |
JJ |
denotes |
inducible |
T11994 |
3365-3369 |
NN |
denotes |
LACZ |
T11995 |
3370-3378 |
NN |
denotes |
reporter |
T11993 |
3379-3383 |
NNS |
denotes |
mice |
T11996 |
3384-3385 |
-LRB- |
denotes |
( |
T11997 |
3385-3392 |
NNP |
denotes |
Soriano |
T11998 |
3393-3397 |
CD |
denotes |
1999 |
T11999 |
3397-3398 |
-RRB- |
denotes |
) |
T12000 |
3399-3403 |
VBD |
denotes |
were |
T11987 |
3404-3408 |
VBN |
denotes |
used |
T12001 |
3409-3411 |
TO |
denotes |
to |
T12002 |
3412-3416 |
VB |
denotes |
test |
T12003 |
3417-3420 |
IN |
denotes |
for |
T12004 |
3421-3424 |
NN |
denotes |
Cre |
T12005 |
3425-3433 |
NN |
denotes |
activity |
T12006 |
3433-3434 |
. |
denotes |
. |
T12007 |
3434-3571 |
sentence |
denotes |
Staining for LACZ and HPLAP on whole embryos or sections of embryos was accomplished following established protocols (Lobe et al. 1999). |
T12008 |
3435-3443 |
VBG |
denotes |
Staining |
T12010 |
3444-3447 |
IN |
denotes |
for |
T12011 |
3448-3452 |
NN |
denotes |
LACZ |
T12012 |
3453-3456 |
CC |
denotes |
and |
T12013 |
3457-3462 |
NN |
denotes |
HPLAP |
T12014 |
3463-3465 |
IN |
denotes |
on |
T12015 |
3466-3471 |
JJ |
denotes |
whole |
T12016 |
3472-3479 |
NNS |
denotes |
embryos |
T12017 |
3480-3482 |
CC |
denotes |
or |
T12018 |
3483-3491 |
NNS |
denotes |
sections |
T12019 |
3492-3494 |
IN |
denotes |
of |
T12020 |
3495-3502 |
NNS |
denotes |
embryos |
T12021 |
3503-3506 |
VBD |
denotes |
was |
T12009 |
3507-3519 |
VBN |
denotes |
accomplished |
T12022 |
3520-3529 |
VBG |
denotes |
following |
T12023 |
3530-3541 |
VBN |
denotes |
established |
T12024 |
3542-3551 |
NNS |
denotes |
protocols |
T12025 |
3552-3553 |
-LRB- |
denotes |
( |
T12026 |
3553-3557 |
NNP |
denotes |
Lobe |
T12027 |
3558-3560 |
FW |
denotes |
et |
T12028 |
3561-3564 |
FW |
denotes |
al. |
T12029 |
3565-3569 |
CD |
denotes |
1999 |
T12030 |
3569-3570 |
-RRB- |
denotes |
) |
T12031 |
3570-3571 |
. |
denotes |
. |
T12032 |
3571-3720 |
sentence |
denotes |
The red LACZ substrate (see Figure 1E) is 6-chloro-3-indoxyl-beta-D-galactopyranoside (Biosynth International, Naperville, Illinois, United States). |
T12033 |
3572-3575 |
DT |
denotes |
The |
T12035 |
3576-3579 |
JJ |
denotes |
red |
T12036 |
3580-3584 |
NN |
denotes |
LACZ |
T12034 |
3585-3594 |
NN |
denotes |
substrate |
T12038 |
3595-3596 |
-LRB- |
denotes |
( |
T12039 |
3596-3599 |
VB |
denotes |
see |
T12040 |
3600-3606 |
NN |
denotes |
Figure |
T12041 |
3607-3609 |
CD |
denotes |
1E |
T12042 |
3609-3610 |
-RRB- |
denotes |
) |
T12037 |
3611-3613 |
VBZ |
denotes |
is |
T12043 |
3614-3615 |
CD |
denotes |
6 |
T12045 |
3615-3616 |
HYPH |
denotes |
- |
T12046 |
3616-3622 |
NN |
denotes |
chloro |
T12047 |
3622-3623 |
HYPH |
denotes |
- |
T12048 |
3623-3624 |
CD |
denotes |
3 |
T12049 |
3624-3625 |
HYPH |
denotes |
- |
T12050 |
3625-3632 |
NN |
denotes |
indoxyl |
T12051 |
3632-3633 |
HYPH |
denotes |
- |
T12052 |
3633-3637 |
NN |
denotes |
beta |
T12053 |
3637-3638 |
HYPH |
denotes |
- |
T12054 |
3638-3639 |
NN |
denotes |
D |
T12055 |
3639-3640 |
HYPH |
denotes |
- |
T12044 |
3640-3657 |
NN |
denotes |
galactopyranoside |
T12056 |
3658-3659 |
-LRB- |
denotes |
( |
T12058 |
3659-3667 |
NNP |
denotes |
Biosynth |
T12057 |
3668-3681 |
NNP |
denotes |
International |
T12059 |
3681-3683 |
, |
denotes |
, |
T12060 |
3683-3693 |
NNP |
denotes |
Naperville |
T12061 |
3693-3695 |
, |
denotes |
, |
T12062 |
3695-3703 |
NNP |
denotes |
Illinois |
T12063 |
3703-3705 |
, |
denotes |
, |
T12064 |
3705-3711 |
NNP |
denotes |
United |
T12065 |
3712-3718 |
NNP |
denotes |
States |
T12066 |
3718-3719 |
-RRB- |
denotes |
) |
T12067 |
3719-3720 |
. |
denotes |
. |
T12177 |
3722-3729 |
JJ |
denotes |
General |
T12178 |
3730-3746 |
NN |
denotes |
characterization |
T12179 |
3747-3749 |
IN |
denotes |
of |
T12180 |
3750-3756 |
NN |
denotes |
Bmpr1a |
T12181 |
3757-3763 |
JJ |
denotes |
mutant |
T12182 |
3764-3768 |
NNS |
denotes |
mice |
T12183 |
3768-3925 |
sentence |
denotes |
Bmpr1a null and floxed alleles (Ahn et al. 2001; Mishina et al. 2002) were obtained on a mixed 129 and C57BL/6 background and maintained by random breeding. |
T12184 |
3769-3775 |
NN |
denotes |
Bmpr1a |
T12185 |
3776-3780 |
JJ |
denotes |
null |
T12187 |
3781-3784 |
CC |
denotes |
and |
T12188 |
3785-3791 |
VBN |
denotes |
floxed |
T12186 |
3792-3799 |
NNS |
denotes |
alleles |
T12190 |
3800-3801 |
-LRB- |
denotes |
( |
T12191 |
3801-3804 |
NNP |
denotes |
Ahn |
T12192 |
3805-3807 |
FW |
denotes |
et |
T12193 |
3808-3811 |
FW |
denotes |
al. |
T12194 |
3812-3816 |
CD |
denotes |
2001 |
T12195 |
3816-3817 |
: |
denotes |
; |
T12196 |
3818-3825 |
NNP |
denotes |
Mishina |
T12197 |
3826-3828 |
FW |
denotes |
et |
T12198 |
3829-3832 |
FW |
denotes |
al. |
T12199 |
3833-3837 |
CD |
denotes |
2002 |
T12200 |
3837-3838 |
-RRB- |
denotes |
) |
T12201 |
3839-3843 |
VBD |
denotes |
were |
T12189 |
3844-3852 |
VBN |
denotes |
obtained |
T12202 |
3853-3855 |
IN |
denotes |
on |
T12203 |
3856-3857 |
DT |
denotes |
a |
T12205 |
3858-3863 |
VBN |
denotes |
mixed |
T12206 |
3864-3867 |
CD |
denotes |
129 |
T12207 |
3868-3871 |
CC |
denotes |
and |
T12208 |
3872-3877 |
NN |
denotes |
C57BL |
T12209 |
3877-3878 |
HYPH |
denotes |
/ |
T12210 |
3878-3879 |
CD |
denotes |
6 |
T12204 |
3880-3890 |
NN |
denotes |
background |
T12211 |
3891-3894 |
CC |
denotes |
and |
T12212 |
3895-3905 |
VBN |
denotes |
maintained |
T12213 |
3906-3908 |
IN |
denotes |
by |
T12214 |
3909-3915 |
JJ |
denotes |
random |
T12215 |
3916-3924 |
NN |
denotes |
breeding |
T12216 |
3924-3925 |
. |
denotes |
. |
T12217 |
3925-4027 |
sentence |
denotes |
Mice carrying the null and floxed alleles were typically mated to Gdf5-Cre mice as shown in Figure 3. |
T12218 |
3926-3930 |
NNS |
denotes |
Mice |
T12220 |
3931-3939 |
VBG |
denotes |
carrying |
T12221 |
3940-3943 |
DT |
denotes |
the |
T12223 |
3944-3948 |
JJ |
denotes |
null |
T12224 |
3949-3952 |
CC |
denotes |
and |
T12225 |
3953-3959 |
VBN |
denotes |
floxed |
T12222 |
3960-3967 |
NNS |
denotes |
alleles |
T12226 |
3968-3972 |
VBD |
denotes |
were |
T12227 |
3973-3982 |
RB |
denotes |
typically |
T12219 |
3983-3988 |
VBN |
denotes |
mated |
T12228 |
3989-3991 |
IN |
denotes |
to |
T12229 |
3992-3996 |
NN |
denotes |
Gdf5 |
T12231 |
3996-3997 |
HYPH |
denotes |
- |
T12230 |
3997-4000 |
NN |
denotes |
Cre |
T12232 |
4001-4005 |
NNS |
denotes |
mice |
T12233 |
4006-4008 |
IN |
denotes |
as |
T12234 |
4009-4014 |
VBN |
denotes |
shown |
T12235 |
4015-4017 |
IN |
denotes |
in |
T12236 |
4018-4024 |
NN |
denotes |
Figure |
T12237 |
4025-4026 |
CD |
denotes |
3 |
T12238 |
4026-4027 |
. |
denotes |
. |
T12239 |
4027-4179 |
sentence |
denotes |
The resulting mice are on a mixed 129; C57Bl/6; FVB/N background, with both controls and mutant animals generated as littermates from the same matings. |
T12240 |
4028-4031 |
DT |
denotes |
The |
T12242 |
4032-4041 |
VBG |
denotes |
resulting |
T12241 |
4042-4046 |
NNS |
denotes |
mice |
T12243 |
4047-4050 |
VBP |
denotes |
are |
T12244 |
4051-4053 |
IN |
denotes |
on |
T12245 |
4054-4055 |
DT |
denotes |
a |
T12247 |
4056-4061 |
VBN |
denotes |
mixed |
T12248 |
4062-4065 |
CD |
denotes |
129 |
T12249 |
4065-4066 |
: |
denotes |
; |
T12250 |
4067-4072 |
NN |
denotes |
C57Bl |
T12251 |
4072-4073 |
HYPH |
denotes |
/ |
T12252 |
4073-4074 |
CD |
denotes |
6 |
T12253 |
4074-4075 |
: |
denotes |
; |
T12254 |
4076-4079 |
NN |
denotes |
FVB |
T12256 |
4079-4080 |
HYPH |
denotes |
/ |
T12255 |
4080-4081 |
NN |
denotes |
N |
T12246 |
4082-4092 |
NN |
denotes |
background |
T12257 |
4092-4094 |
, |
denotes |
, |
T12258 |
4094-4098 |
IN |
denotes |
with |
T12260 |
4099-4103 |
CC |
denotes |
both |
T12261 |
4104-4112 |
NNS |
denotes |
controls |
T12262 |
4113-4116 |
CC |
denotes |
and |
T12263 |
4117-4123 |
NN |
denotes |
mutant |
T12264 |
4124-4131 |
NNS |
denotes |
animals |
T12259 |
4132-4141 |
VBN |
denotes |
generated |
T12265 |
4142-4144 |
IN |
denotes |
as |
T12266 |
4145-4156 |
NNS |
denotes |
littermates |
T12267 |
4157-4161 |
IN |
denotes |
from |
T12268 |
4162-4165 |
DT |
denotes |
the |
T12270 |
4166-4170 |
JJ |
denotes |
same |
T12269 |
4171-4178 |
NNS |
denotes |
matings |
T12271 |
4178-4179 |
. |
denotes |
. |
T12272 |
4179-4271 |
sentence |
denotes |
Whole-mount skeletal preparations were made from 34- to 36-d-old mice (Lufkin et al. 1992). |
T12273 |
4180-4185 |
JJ |
denotes |
Whole |
T12275 |
4185-4186 |
HYPH |
denotes |
- |
T12274 |
4186-4191 |
NN |
denotes |
mount |
T12277 |
4192-4200 |
JJ |
denotes |
skeletal |
T12276 |
4201-4213 |
NNS |
denotes |
preparations |
T12279 |
4214-4218 |
VBD |
denotes |
were |
T12278 |
4219-4223 |
VBN |
denotes |
made |
T12280 |
4224-4228 |
IN |
denotes |
from |
T12281 |
4229-4231 |
CD |
denotes |
34 |
T12283 |
4231-4232 |
HYPH |
denotes |
- |
T12284 |
4233-4235 |
IN |
denotes |
to |
T12282 |
4236-4238 |
CD |
denotes |
36 |
T12286 |
4238-4239 |
HYPH |
denotes |
- |
T12285 |
4239-4240 |
NN |
denotes |
d |
T12288 |
4240-4241 |
HYPH |
denotes |
- |
T12287 |
4241-4244 |
JJ |
denotes |
old |
T12289 |
4245-4249 |
NNS |
denotes |
mice |
T12290 |
4250-4251 |
-LRB- |
denotes |
( |
T12291 |
4251-4257 |
NNP |
denotes |
Lufkin |
T12292 |
4258-4260 |
FW |
denotes |
et |
T12293 |
4261-4264 |
FW |
denotes |
al. |
T12294 |
4265-4269 |
CD |
denotes |
1992 |
T12295 |
4269-4270 |
-RRB- |
denotes |
) |
T12296 |
4270-4271 |
. |
denotes |
. |
T12297 |
4271-4495 |
sentence |
denotes |
Pairs of ears from euthanized 6-mo-old animals were removed, pinned, photographed, projected, and measured from the base of the curve formed between the tragus and antitragus to the farthest point at the edge of the pinnae. |
T12298 |
4272-4277 |
NNS |
denotes |
Pairs |
T12300 |
4278-4280 |
IN |
denotes |
of |
T12301 |
4281-4285 |
NNS |
denotes |
ears |
T12302 |
4286-4290 |
IN |
denotes |
from |
T12303 |
4291-4301 |
VBN |
denotes |
euthanized |
T12305 |
4302-4303 |
CD |
denotes |
6 |
T12307 |
4303-4304 |
HYPH |
denotes |
- |
T12306 |
4304-4306 |
NN |
denotes |
mo |
T12309 |
4306-4307 |
HYPH |
denotes |
- |
T12308 |
4307-4310 |
JJ |
denotes |
old |
T12304 |
4311-4318 |
NNS |
denotes |
animals |
T12310 |
4319-4323 |
VBD |
denotes |
were |
T12299 |
4324-4331 |
VBN |
denotes |
removed |
T12311 |
4331-4333 |
, |
denotes |
, |
T12312 |
4333-4339 |
VBN |
denotes |
pinned |
T12313 |
4339-4341 |
, |
denotes |
, |
T12314 |
4341-4353 |
VBN |
denotes |
photographed |
T12315 |
4353-4355 |
, |
denotes |
, |
T12316 |
4355-4364 |
VBN |
denotes |
projected |
T12317 |
4364-4366 |
, |
denotes |
, |
T12318 |
4366-4369 |
CC |
denotes |
and |
T12319 |
4370-4378 |
VBN |
denotes |
measured |
T12320 |
4379-4383 |
IN |
denotes |
from |
T12321 |
4384-4387 |
DT |
denotes |
the |
T12322 |
4388-4392 |
NN |
denotes |
base |
T12323 |
4393-4395 |
IN |
denotes |
of |
T12324 |
4396-4399 |
DT |
denotes |
the |
T12325 |
4400-4405 |
NN |
denotes |
curve |
T12326 |
4406-4412 |
VBN |
denotes |
formed |
T12327 |
4413-4420 |
IN |
denotes |
between |
T12328 |
4421-4424 |
DT |
denotes |
the |
T12329 |
4425-4431 |
NN |
denotes |
tragus |
T12330 |
4432-4435 |
CC |
denotes |
and |
T12331 |
4436-4446 |
NN |
denotes |
antitragus |
T12332 |
4447-4449 |
IN |
denotes |
to |
T12333 |
4450-4453 |
DT |
denotes |
the |
T12335 |
4454-4462 |
JJS |
denotes |
farthest |
T12334 |
4463-4468 |
NN |
denotes |
point |
T12336 |
4469-4471 |
IN |
denotes |
at |
T12337 |
4472-4475 |
DT |
denotes |
the |
T12338 |
4476-4480 |
NN |
denotes |
edge |
T12339 |
4481-4483 |
IN |
denotes |
of |
T12340 |
4484-4487 |
DT |
denotes |
the |
T12341 |
4488-4494 |
NNS |
denotes |
pinnae |
T12342 |
4494-4495 |
. |
denotes |
. |
T12343 |
4495-4674 |
sentence |
denotes |
Grasping ability in 6-mo-old mice was measured by placing animals on a slender rod and timing how long they could remain suspended on the rod, to a maximum time allowed of 2 min. |
T12344 |
4496-4504 |
NN |
denotes |
Grasping |
T12345 |
4505-4512 |
NN |
denotes |
ability |
T12347 |
4513-4515 |
IN |
denotes |
in |
T12348 |
4516-4517 |
CD |
denotes |
6 |
T12350 |
4517-4518 |
HYPH |
denotes |
- |
T12349 |
4518-4520 |
NN |
denotes |
mo |
T12352 |
4520-4521 |
HYPH |
denotes |
- |
T12351 |
4521-4524 |
JJ |
denotes |
old |
T12353 |
4525-4529 |
NNS |
denotes |
mice |
T12354 |
4530-4533 |
VBD |
denotes |
was |
T12346 |
4534-4542 |
VBN |
denotes |
measured |
T12355 |
4543-4545 |
IN |
denotes |
by |
T12356 |
4546-4553 |
VBG |
denotes |
placing |
T12357 |
4554-4561 |
NNS |
denotes |
animals |
T12358 |
4562-4564 |
IN |
denotes |
on |
T12359 |
4565-4566 |
DT |
denotes |
a |
T12361 |
4567-4574 |
JJ |
denotes |
slender |
T12360 |
4575-4578 |
NN |
denotes |
rod |
T12362 |
4579-4582 |
CC |
denotes |
and |
T12363 |
4583-4589 |
VBG |
denotes |
timing |
T12364 |
4590-4593 |
WRB |
denotes |
how |
T12365 |
4594-4598 |
RB |
denotes |
long |
T12367 |
4599-4603 |
PRP |
denotes |
they |
T12368 |
4604-4609 |
MD |
denotes |
could |
T12366 |
4610-4616 |
VB |
denotes |
remain |
T12369 |
4617-4626 |
JJ |
denotes |
suspended |
T12370 |
4627-4629 |
IN |
denotes |
on |
T12371 |
4630-4633 |
DT |
denotes |
the |
T12372 |
4634-4637 |
NN |
denotes |
rod |
T12373 |
4637-4639 |
, |
denotes |
, |
T12374 |
4639-4641 |
IN |
denotes |
to |
T12375 |
4642-4643 |
DT |
denotes |
a |
T12377 |
4644-4651 |
JJ |
denotes |
maximum |
T12376 |
4652-4656 |
NN |
denotes |
time |
T12378 |
4657-4664 |
VBN |
denotes |
allowed |
T12379 |
4665-4667 |
IN |
denotes |
of |
T12380 |
4668-4669 |
CD |
denotes |
2 |
T12381 |
4670-4673 |
NN |
denotes |
min |
T12382 |
4673-4674 |
. |
denotes |
. |
T12383 |
4674-4738 |
sentence |
denotes |
Data from five consecutive trials for each mouse were averaged. |
T12384 |
4675-4679 |
NNS |
denotes |
Data |
T12386 |
4680-4684 |
IN |
denotes |
from |
T12387 |
4685-4689 |
CD |
denotes |
five |
T12389 |
4690-4701 |
JJ |
denotes |
consecutive |
T12388 |
4702-4708 |
NNS |
denotes |
trials |
T12390 |
4709-4712 |
IN |
denotes |
for |
T12391 |
4713-4717 |
DT |
denotes |
each |
T12392 |
4718-4723 |
NN |
denotes |
mouse |
T12393 |
4724-4728 |
VBD |
denotes |
were |
T12385 |
4729-4737 |
VBN |
denotes |
averaged |
T12394 |
4737-4738 |
. |
denotes |
. |
T12395 |
4738-4870 |
sentence |
denotes |
Range of motion assays were conducted on the MT/P1 and P1/P2 joints of the second hindlimb digit from euthanized 18-wk-old animals. |
T12396 |
4739-4744 |
NN |
denotes |
Range |
T12398 |
4745-4747 |
IN |
denotes |
of |
T12399 |
4748-4754 |
NN |
denotes |
motion |
T12397 |
4755-4761 |
NNS |
denotes |
assays |
T12401 |
4762-4766 |
VBD |
denotes |
were |
T12400 |
4767-4776 |
VBN |
denotes |
conducted |
T12402 |
4777-4779 |
IN |
denotes |
on |
T12403 |
4780-4783 |
DT |
denotes |
the |
T12405 |
4784-4786 |
NN |
denotes |
MT |
T12407 |
4786-4787 |
HYPH |
denotes |
/ |
T12406 |
4787-4789 |
NN |
denotes |
P1 |
T12408 |
4790-4793 |
CC |
denotes |
and |
T12409 |
4794-4796 |
NN |
denotes |
P1 |
T12411 |
4796-4797 |
HYPH |
denotes |
/ |
T12410 |
4797-4799 |
NN |
denotes |
P2 |
T12404 |
4800-4806 |
NNS |
denotes |
joints |
T12412 |
4807-4809 |
IN |
denotes |
of |
T12413 |
4810-4813 |
DT |
denotes |
the |
T12415 |
4814-4820 |
JJ |
denotes |
second |
T12416 |
4821-4829 |
NN |
denotes |
hindlimb |
T12414 |
4830-4835 |
NN |
denotes |
digit |
T12417 |
4836-4840 |
IN |
denotes |
from |
T12418 |
4841-4851 |
VBN |
denotes |
euthanized |
T12420 |
4852-4854 |
CD |
denotes |
18 |
T12422 |
4854-4855 |
HYPH |
denotes |
- |
T12421 |
4855-4857 |
NN |
denotes |
wk |
T12424 |
4857-4858 |
HYPH |
denotes |
- |
T12423 |
4858-4861 |
JJ |
denotes |
old |
T12419 |
4862-4869 |
NNS |
denotes |
animals |
T12425 |
4869-4870 |
. |
denotes |
. |
T12426 |
4870-5045 |
sentence |
denotes |
Forceps were used to bend the joint to its natural stopping position, and the resulting angle was measured to the nearest 10° under 12.5× magnification using a 360° reticule. |
T12427 |
4871-4878 |
NNS |
denotes |
Forceps |
T12429 |
4879-4883 |
VBD |
denotes |
were |
T12428 |
4884-4888 |
VBN |
denotes |
used |
T12430 |
4889-4891 |
TO |
denotes |
to |
T12431 |
4892-4896 |
VB |
denotes |
bend |
T12432 |
4897-4900 |
DT |
denotes |
the |
T12433 |
4901-4906 |
NN |
denotes |
joint |
T12434 |
4907-4909 |
IN |
denotes |
to |
T12435 |
4910-4913 |
PRP$ |
denotes |
its |
T12437 |
4914-4921 |
JJ |
denotes |
natural |
T12438 |
4922-4930 |
NN |
denotes |
stopping |
T12436 |
4931-4939 |
NN |
denotes |
position |
T12439 |
4939-4941 |
, |
denotes |
, |
T12440 |
4941-4944 |
CC |
denotes |
and |
T12441 |
4945-4948 |
DT |
denotes |
the |
T12443 |
4949-4958 |
VBG |
denotes |
resulting |
T12442 |
4959-4964 |
NN |
denotes |
angle |
T12445 |
4965-4968 |
VBD |
denotes |
was |
T12444 |
4969-4977 |
VBN |
denotes |
measured |
T12446 |
4978-4980 |
IN |
denotes |
to |
T12447 |
4981-4984 |
DT |
denotes |
the |
T12449 |
4985-4992 |
JJS |
denotes |
nearest |
T12450 |
4993-4995 |
CD |
denotes |
10 |
T12448 |
4995-4996 |
NNS |
denotes |
° |
T12451 |
4997-5002 |
IN |
denotes |
under |
T12452 |
5003-5007 |
CD |
denotes |
12.5 |
T12454 |
5007-5008 |
SYM |
denotes |
× |
T12453 |
5009-5022 |
NN |
denotes |
magnification |
T12455 |
5023-5028 |
VBG |
denotes |
using |
T12456 |
5029-5030 |
DT |
denotes |
a |
T12458 |
5031-5034 |
CD |
denotes |
360 |
T12459 |
5034-5035 |
NN |
denotes |
° |
T12457 |
5036-5044 |
NN |
denotes |
reticule |
T12460 |
5044-5045 |
. |
denotes |
. |
T12461 |
5045-5114 |
sentence |
denotes |
Analysis described in this section occurred on animals lacking R26R. |
T12462 |
5046-5054 |
NN |
denotes |
Analysis |
T12464 |
5055-5064 |
VBN |
denotes |
described |
T12465 |
5065-5067 |
IN |
denotes |
in |
T12466 |
5068-5072 |
DT |
denotes |
this |
T12467 |
5073-5080 |
NN |
denotes |
section |
T12463 |
5081-5089 |
VBD |
denotes |
occurred |
T12468 |
5090-5092 |
IN |
denotes |
on |
T12469 |
5093-5100 |
NNS |
denotes |
animals |
T12470 |
5101-5108 |
VBG |
denotes |
lacking |
T12471 |
5109-5113 |
NN |
denotes |
R26R |
T12472 |
5113-5114 |
. |
denotes |
. |
T12473 |
5114-5293 |
sentence |
denotes |
Control mice included all nonmutant genotypes generated by Parent 1 being heterozygous for Gdf5-Cre and Bmpr1anull and Parent 2 being heterozygous for Bmpr1afloxP (see Figure 3). |
T12474 |
5115-5122 |
NN |
denotes |
Control |
T12475 |
5123-5127 |
NNS |
denotes |
mice |
T12476 |
5128-5136 |
VBD |
denotes |
included |
T12477 |
5137-5140 |
DT |
denotes |
all |
T12479 |
5141-5150 |
JJ |
denotes |
nonmutant |
T12478 |
5151-5160 |
NNS |
denotes |
genotypes |
T12480 |
5161-5170 |
VBN |
denotes |
generated |
T12481 |
5171-5173 |
IN |
denotes |
by |
T12482 |
5174-5180 |
NN |
denotes |
Parent |
T12484 |
5181-5182 |
CD |
denotes |
1 |
T12483 |
5183-5188 |
VBG |
denotes |
being |
T12485 |
5189-5201 |
JJ |
denotes |
heterozygous |
T12486 |
5202-5205 |
IN |
denotes |
for |
T12487 |
5206-5210 |
NN |
denotes |
Gdf5 |
T12489 |
5210-5211 |
HYPH |
denotes |
- |
T12488 |
5211-5214 |
NN |
denotes |
Cre |
T12490 |
5215-5218 |
CC |
denotes |
and |
T12491 |
5219-5229 |
NN |
denotes |
Bmpr1anull |
T12492 |
5230-5233 |
CC |
denotes |
and |
T12493 |
5234-5240 |
NN |
denotes |
Parent |
T12495 |
5241-5242 |
CD |
denotes |
2 |
T12494 |
5243-5248 |
VBG |
denotes |
being |
T12496 |
5249-5261 |
JJ |
denotes |
heterozygous |
T12497 |
5262-5265 |
IN |
denotes |
for |
T12498 |
5266-5277 |
NN |
denotes |
Bmpr1afloxP |
T12499 |
5278-5279 |
-LRB- |
denotes |
( |
T12500 |
5279-5282 |
VB |
denotes |
see |
T12501 |
5283-5289 |
NN |
denotes |
Figure |
T12502 |
5290-5291 |
CD |
denotes |
3 |
T12503 |
5291-5292 |
-RRB- |
denotes |
) |
T12504 |
5292-5293 |
. |
denotes |
. |
T12505 |
5293-5420 |
sentence |
denotes |
All statistical analysis used the Student's t-test or Welch's t-test, and values listed are mean ± standard error of the mean. |
T12506 |
5294-5297 |
DT |
denotes |
All |
T12508 |
5298-5309 |
JJ |
denotes |
statistical |
T12507 |
5310-5318 |
NN |
denotes |
analysis |
T12509 |
5319-5323 |
VBD |
denotes |
used |
T12510 |
5324-5327 |
DT |
denotes |
the |
T12511 |
5328-5335 |
NNP |
denotes |
Student |
T12513 |
5335-5337 |
POS |
denotes |
's |
T12514 |
5338-5339 |
NN |
denotes |
t |
T12515 |
5339-5340 |
HYPH |
denotes |
- |
T12512 |
5340-5344 |
NN |
denotes |
test |
T12516 |
5345-5347 |
CC |
denotes |
or |
T12517 |
5348-5353 |
NNP |
denotes |
Welch |
T12519 |
5353-5355 |
POS |
denotes |
's |
T12520 |
5356-5357 |
NN |
denotes |
t |
T12521 |
5357-5358 |
HYPH |
denotes |
- |
T12518 |
5358-5362 |
NN |
denotes |
test |
T12522 |
5362-5364 |
, |
denotes |
, |
T12523 |
5364-5367 |
CC |
denotes |
and |
T12524 |
5368-5374 |
NNS |
denotes |
values |
T12526 |
5375-5381 |
VBN |
denotes |
listed |
T12525 |
5382-5385 |
VBP |
denotes |
are |
T12527 |
5386-5390 |
JJ |
denotes |
mean |
T12528 |
5391-5392 |
SYM |
denotes |
± |
T12529 |
5393-5401 |
JJ |
denotes |
standard |
T12530 |
5402-5407 |
NN |
denotes |
error |
T12531 |
5408-5410 |
IN |
denotes |
of |
T12532 |
5411-5414 |
DT |
denotes |
the |
T12533 |
5415-5419 |
NN |
denotes |
mean |
T12534 |
5419-5420 |
. |
denotes |
. |
T12651 |
5422-5426 |
NN |
denotes |
Cell |
T12652 |
5427-5432 |
NN |
denotes |
death |
T12653 |
5433-5436 |
CC |
denotes |
and |
T12654 |
5437-5450 |
NN |
denotes |
proliferation |
T12655 |
5451-5457 |
NNS |
denotes |
assays |
T12656 |
5457-5593 |
sentence |
denotes |
Limbs from mutant and control animals at E13.5 and E14.5 were dissected and frozen in OCT (Sakura Finetek,Torrence, CA, United States). |
T12657 |
5458-5463 |
NNS |
denotes |
Limbs |
T12659 |
5464-5468 |
IN |
denotes |
from |
T12660 |
5469-5475 |
JJ |
denotes |
mutant |
T12662 |
5476-5479 |
CC |
denotes |
and |
T12663 |
5480-5487 |
NN |
denotes |
control |
T12661 |
5488-5495 |
NNS |
denotes |
animals |
T12664 |
5496-5498 |
IN |
denotes |
at |
T12665 |
5499-5504 |
NN |
denotes |
E13.5 |
T12666 |
5505-5508 |
CC |
denotes |
and |
T12667 |
5509-5514 |
NN |
denotes |
E14.5 |
T12668 |
5515-5519 |
VBD |
denotes |
were |
T12658 |
5520-5529 |
VBN |
denotes |
dissected |
T12669 |
5530-5533 |
CC |
denotes |
and |
T12670 |
5534-5540 |
VBN |
denotes |
frozen |
T12671 |
5541-5543 |
IN |
denotes |
in |
T12672 |
5544-5547 |
NN |
denotes |
OCT |
T12673 |
5548-5549 |
-LRB- |
denotes |
( |
T12675 |
5549-5555 |
NNP |
denotes |
Sakura |
T12674 |
5556-5563 |
NNP |
denotes |
Finetek |
T12676 |
5563-5564 |
, |
denotes |
, |
T12677 |
5564-5572 |
NNP |
denotes |
Torrence |
T12678 |
5572-5574 |
, |
denotes |
, |
T12679 |
5574-5576 |
NNP |
denotes |
CA |
T12680 |
5576-5578 |
, |
denotes |
, |
T12681 |
5578-5584 |
NNP |
denotes |
United |
T12682 |
5585-5591 |
NNP |
denotes |
States |
T12683 |
5591-5592 |
-RRB- |
denotes |
) |
T12684 |
5592-5593 |
. |
denotes |
. |
T12685 |
5593-5723 |
sentence |
denotes |
Cryosections of tissue were assayed by TUNEL using the In Situ Cell Death Detection Kit, Fluorescein (Roche, Basel, Switzerland). |
T12686 |
5594-5606 |
NNS |
denotes |
Cryosections |
T12688 |
5607-5609 |
IN |
denotes |
of |
T12689 |
5610-5616 |
NN |
denotes |
tissue |
T12690 |
5617-5621 |
VBD |
denotes |
were |
T12687 |
5622-5629 |
VBN |
denotes |
assayed |
T12691 |
5630-5632 |
IN |
denotes |
by |
T12692 |
5633-5638 |
NN |
denotes |
TUNEL |
T12693 |
5639-5644 |
VBG |
denotes |
using |
T12694 |
5645-5648 |
DT |
denotes |
the |
T12696 |
5649-5651 |
FW |
denotes |
In |
T12697 |
5652-5656 |
FW |
denotes |
Situ |
T12699 |
5657-5661 |
NN |
denotes |
Cell |
T12700 |
5662-5667 |
NN |
denotes |
Death |
T12698 |
5668-5677 |
NN |
denotes |
Detection |
T12695 |
5678-5681 |
NN |
denotes |
Kit |
T12701 |
5681-5683 |
, |
denotes |
, |
T12702 |
5683-5694 |
NNP |
denotes |
Fluorescein |
T12703 |
5695-5696 |
-LRB- |
denotes |
( |
T12704 |
5696-5701 |
NNP |
denotes |
Roche |
T12705 |
5701-5703 |
, |
denotes |
, |
T12706 |
5703-5708 |
NNP |
denotes |
Basel |
T12707 |
5708-5710 |
, |
denotes |
, |
T12708 |
5710-5721 |
NNP |
denotes |
Switzerland |
T12709 |
5721-5722 |
-RRB- |
denotes |
) |
T12710 |
5722-5723 |
. |
denotes |
. |
T12711 |
5723-6027 |
sentence |
denotes |
Following TUNEL, slides were washed in PBS, blocked with PBS + 0.05% Tween-20 + 5% goat serum, washed again, and incubated with a 1:200 dilution of a rabbit anti-phospho-histone-H3 antibody called Mitosis Marker (Upstate Biotechnology, Lake Placid, New York, United States) to identify cells in mitosis. |
T12712 |
5724-5733 |
VBG |
denotes |
Following |
T12714 |
5734-5739 |
NN |
denotes |
TUNEL |
T12715 |
5739-5741 |
, |
denotes |
, |
T12716 |
5741-5747 |
NNS |
denotes |
slides |
T12717 |
5748-5752 |
VBD |
denotes |
were |
T12713 |
5753-5759 |
VBN |
denotes |
washed |
T12718 |
5760-5762 |
IN |
denotes |
in |
T12719 |
5763-5766 |
NN |
denotes |
PBS |
T12720 |
5766-5768 |
, |
denotes |
, |
T12721 |
5768-5775 |
VBN |
denotes |
blocked |
T12722 |
5776-5780 |
IN |
denotes |
with |
T12723 |
5781-5784 |
NN |
denotes |
PBS |
T12724 |
5785-5786 |
SYM |
denotes |
+ |
T12725 |
5787-5791 |
CD |
denotes |
0.05 |
T12726 |
5791-5792 |
NN |
denotes |
% |
T12727 |
5793-5798 |
NN |
denotes |
Tween |
T12728 |
5798-5799 |
HYPH |
denotes |
- |
T12729 |
5799-5801 |
CD |
denotes |
20 |
T12730 |
5802-5803 |
SYM |
denotes |
+ |
T12731 |
5804-5805 |
CD |
denotes |
5 |
T12732 |
5805-5806 |
NN |
denotes |
% |
T12734 |
5807-5811 |
NN |
denotes |
goat |
T12733 |
5812-5817 |
NN |
denotes |
serum |
T12735 |
5817-5819 |
, |
denotes |
, |
T12736 |
5819-5825 |
VBD |
denotes |
washed |
T12737 |
5826-5831 |
RB |
denotes |
again |
T12738 |
5831-5833 |
, |
denotes |
, |
T12739 |
5833-5836 |
CC |
denotes |
and |
T12740 |
5837-5846 |
VBN |
denotes |
incubated |
T12741 |
5847-5851 |
IN |
denotes |
with |
T12742 |
5852-5853 |
DT |
denotes |
a |
T12744 |
5854-5855 |
CD |
denotes |
1 |
T12745 |
5855-5856 |
SYM |
denotes |
: |
T12746 |
5856-5859 |
CD |
denotes |
200 |
T12743 |
5860-5868 |
NN |
denotes |
dilution |
T12747 |
5869-5871 |
IN |
denotes |
of |
T12748 |
5872-5873 |
DT |
denotes |
a |
T12750 |
5874-5880 |
NN |
denotes |
rabbit |
T12751 |
5881-5901 |
JJ |
denotes |
anti-phospho-histone |
T12753 |
5901-5902 |
HYPH |
denotes |
- |
T12752 |
5902-5904 |
NN |
denotes |
H3 |
T12749 |
5905-5913 |
NN |
denotes |
antibody |
T12754 |
5914-5920 |
VBN |
denotes |
called |
T12755 |
5921-5928 |
NN |
denotes |
Mitosis |
T12756 |
5929-5935 |
NN |
denotes |
Marker |
T12757 |
5936-5937 |
-LRB- |
denotes |
( |
T12759 |
5937-5944 |
NNP |
denotes |
Upstate |
T12758 |
5945-5958 |
NNP |
denotes |
Biotechnology |
T12760 |
5958-5960 |
, |
denotes |
, |
T12761 |
5960-5964 |
NNP |
denotes |
Lake |
T12762 |
5965-5971 |
NNP |
denotes |
Placid |
T12763 |
5971-5973 |
, |
denotes |
, |
T12764 |
5973-5976 |
NNP |
denotes |
New |
T12765 |
5977-5981 |
NNP |
denotes |
York |
T12766 |
5981-5983 |
, |
denotes |
, |
T12767 |
5983-5989 |
NNP |
denotes |
United |
T12768 |
5990-5996 |
NNP |
denotes |
States |
T12769 |
5996-5997 |
-RRB- |
denotes |
) |
T12770 |
5998-6000 |
TO |
denotes |
to |
T12771 |
6001-6009 |
VB |
denotes |
identify |
T12772 |
6010-6015 |
NNS |
denotes |
cells |
T12773 |
6016-6018 |
IN |
denotes |
in |
T12774 |
6019-6026 |
NN |
denotes |
mitosis |
T12775 |
6026-6027 |
. |
denotes |
. |
T12776 |
6027-6103 |
sentence |
denotes |
Cy3-labeled anti-rabbit secondary antibody was used to detect the antibody. |
T12777 |
6028-6031 |
NN |
denotes |
Cy3 |
T12779 |
6031-6032 |
HYPH |
denotes |
- |
T12778 |
6032-6039 |
VBN |
denotes |
labeled |
T12781 |
6040-6051 |
JJ |
denotes |
anti-rabbit |
T12782 |
6052-6061 |
JJ |
denotes |
secondary |
T12780 |
6062-6070 |
NN |
denotes |
antibody |
T12784 |
6071-6074 |
VBD |
denotes |
was |
T12783 |
6075-6079 |
VBN |
denotes |
used |
T12785 |
6080-6082 |
TO |
denotes |
to |
T12786 |
6083-6089 |
VB |
denotes |
detect |
T12787 |
6090-6093 |
DT |
denotes |
the |
T12788 |
6094-6102 |
NN |
denotes |
antibody |
T12789 |
6102-6103 |
. |
denotes |
. |
T12790 |
6103-6276 |
sentence |
denotes |
Cell nuclei were labeled with DAPI, and slides were mounted in Vectamount (Vector Laboratories, Burlingame, California, United States) and visualized at 100× magnification. |
T12791 |
6104-6108 |
NN |
denotes |
Cell |
T12792 |
6109-6115 |
NNS |
denotes |
nuclei |
T12794 |
6116-6120 |
VBD |
denotes |
were |
T12793 |
6121-6128 |
VBN |
denotes |
labeled |
T12795 |
6129-6133 |
IN |
denotes |
with |
T12796 |
6134-6138 |
NN |
denotes |
DAPI |
T12797 |
6138-6140 |
, |
denotes |
, |
T12798 |
6140-6143 |
CC |
denotes |
and |
T12799 |
6144-6150 |
NNS |
denotes |
slides |
T12801 |
6151-6155 |
VBD |
denotes |
were |
T12800 |
6156-6163 |
VBN |
denotes |
mounted |
T12802 |
6164-6166 |
IN |
denotes |
in |
T12803 |
6167-6177 |
NNP |
denotes |
Vectamount |
T12804 |
6178-6179 |
-LRB- |
denotes |
( |
T12806 |
6179-6185 |
NNP |
denotes |
Vector |
T12805 |
6186-6198 |
NNP |
denotes |
Laboratories |
T12807 |
6198-6200 |
, |
denotes |
, |
T12808 |
6200-6210 |
NNP |
denotes |
Burlingame |
T12809 |
6210-6212 |
, |
denotes |
, |
T12810 |
6212-6222 |
NNP |
denotes |
California |
T12811 |
6222-6224 |
, |
denotes |
, |
T12812 |
6224-6230 |
NNP |
denotes |
United |
T12813 |
6231-6237 |
NNP |
denotes |
States |
T12814 |
6237-6238 |
-RRB- |
denotes |
) |
T12815 |
6239-6242 |
CC |
denotes |
and |
T12816 |
6243-6253 |
VBN |
denotes |
visualized |
T12817 |
6254-6256 |
IN |
denotes |
at |
T12818 |
6257-6260 |
CD |
denotes |
100 |
T12820 |
6260-6261 |
SYM |
denotes |
× |
T12819 |
6262-6275 |
NN |
denotes |
magnification |
T12821 |
6275-6276 |
. |
denotes |
. |
T12822 |
6276-6516 |
sentence |
denotes |
The area of selected anatomical sites were measured, and the number of TUNEL-labeled nuclear fragments and the number of Cy3-labeled nuclei were counted from three 10-μm sections spanning 50 μm, from three control and three mutant animals. |
T12823 |
6277-6280 |
DT |
denotes |
The |
T12824 |
6281-6285 |
NN |
denotes |
area |
T12826 |
6286-6288 |
IN |
denotes |
of |
T12827 |
6289-6297 |
VBN |
denotes |
selected |
T12829 |
6298-6308 |
JJ |
denotes |
anatomical |
T12828 |
6309-6314 |
NNS |
denotes |
sites |
T12830 |
6315-6319 |
VBD |
denotes |
were |
T12825 |
6320-6328 |
VBN |
denotes |
measured |
T12831 |
6328-6330 |
, |
denotes |
, |
T12832 |
6330-6333 |
CC |
denotes |
and |
T12833 |
6334-6337 |
DT |
denotes |
the |
T12834 |
6338-6344 |
NN |
denotes |
number |
T12836 |
6345-6347 |
IN |
denotes |
of |
T12837 |
6348-6353 |
NN |
denotes |
TUNEL |
T12839 |
6353-6354 |
HYPH |
denotes |
- |
T12838 |
6354-6361 |
VBN |
denotes |
labeled |
T12841 |
6362-6369 |
JJ |
denotes |
nuclear |
T12840 |
6370-6379 |
NNS |
denotes |
fragments |
T12842 |
6380-6383 |
CC |
denotes |
and |
T12843 |
6384-6387 |
DT |
denotes |
the |
T12844 |
6388-6394 |
NN |
denotes |
number |
T12845 |
6395-6397 |
IN |
denotes |
of |
T12846 |
6398-6401 |
NN |
denotes |
Cy3 |
T12848 |
6401-6402 |
HYPH |
denotes |
- |
T12847 |
6402-6409 |
VBN |
denotes |
labeled |
T12849 |
6410-6416 |
NNS |
denotes |
nuclei |
T12850 |
6417-6421 |
VBD |
denotes |
were |
T12835 |
6422-6429 |
VBN |
denotes |
counted |
T12851 |
6430-6434 |
IN |
denotes |
from |
T12852 |
6435-6440 |
CD |
denotes |
three |
T12854 |
6441-6443 |
CD |
denotes |
10 |
T12856 |
6443-6444 |
HYPH |
denotes |
- |
T12855 |
6444-6446 |
NN |
denotes |
μm |
T12853 |
6447-6455 |
NNS |
denotes |
sections |
T12857 |
6456-6464 |
VBG |
denotes |
spanning |
T12858 |
6465-6467 |
CD |
denotes |
50 |
T12859 |
6468-6470 |
NN |
denotes |
μm |
T12860 |
6470-6472 |
, |
denotes |
, |
T12861 |
6472-6476 |
IN |
denotes |
from |
T12862 |
6477-6482 |
CD |
denotes |
three |
T12863 |
6483-6490 |
NN |
denotes |
control |
T12864 |
6491-6494 |
CC |
denotes |
and |
T12865 |
6495-6500 |
CD |
denotes |
three |
T12866 |
6501-6507 |
NN |
denotes |
mutant |
T12867 |
6508-6515 |
NNS |
denotes |
animals |
T12868 |
6515-6516 |
. |
denotes |
. |
T12869 |
6516-6688 |
sentence |
denotes |
The number of labeled cells in the metacarpal-phalangeal and metatarsal-phalangeal joints was counted in a 290 μm × 365 μm rectangle placed around the center of the joint. |
T12870 |
6517-6520 |
DT |
denotes |
The |
T12871 |
6521-6527 |
NN |
denotes |
number |
T12873 |
6528-6530 |
IN |
denotes |
of |
T12874 |
6531-6538 |
VBN |
denotes |
labeled |
T12875 |
6539-6544 |
NNS |
denotes |
cells |
T12876 |
6545-6547 |
IN |
denotes |
in |
T12877 |
6548-6551 |
DT |
denotes |
the |
T12879 |
6552-6562 |
JJ |
denotes |
metacarpal |
T12881 |
6562-6563 |
HYPH |
denotes |
- |
T12880 |
6563-6573 |
JJ |
denotes |
phalangeal |
T12882 |
6574-6577 |
CC |
denotes |
and |
T12883 |
6578-6588 |
JJ |
denotes |
metatarsal |
T12885 |
6588-6589 |
HYPH |
denotes |
- |
T12884 |
6589-6599 |
JJ |
denotes |
phalangeal |
T12878 |
6600-6606 |
NNS |
denotes |
joints |
T12886 |
6607-6610 |
VBD |
denotes |
was |
T12872 |
6611-6618 |
VBN |
denotes |
counted |
T12887 |
6619-6621 |
IN |
denotes |
in |
T12888 |
6622-6623 |
DT |
denotes |
a |
T12890 |
6624-6627 |
CD |
denotes |
290 |
T12891 |
6628-6630 |
NN |
denotes |
μm |
T12892 |
6631-6632 |
SYM |
denotes |
× |
T12894 |
6633-6636 |
CD |
denotes |
365 |
T12893 |
6637-6639 |
NN |
denotes |
μm |
T12889 |
6640-6649 |
NN |
denotes |
rectangle |
T12895 |
6650-6656 |
VBN |
denotes |
placed |
T12896 |
6657-6663 |
IN |
denotes |
around |
T12897 |
6664-6667 |
DT |
denotes |
the |
T12898 |
6668-6674 |
NN |
denotes |
center |
T12899 |
6675-6677 |
IN |
denotes |
of |
T12900 |
6678-6681 |
DT |
denotes |
the |
T12901 |
6682-6687 |
NN |
denotes |
joint |
T12902 |
6687-6688 |
. |
denotes |
. |
T12903 |
6688-6843 |
sentence |
denotes |
The posterior region of the fifth digit was defined by drawing a line from the tip of the digit down 2.15 mm and across to the lateral edge of the tissue. |
T12904 |
6689-6692 |
DT |
denotes |
The |
T12906 |
6693-6702 |
JJ |
denotes |
posterior |
T12905 |
6703-6709 |
NN |
denotes |
region |
T12908 |
6710-6712 |
IN |
denotes |
of |
T12909 |
6713-6716 |
DT |
denotes |
the |
T12911 |
6717-6722 |
JJ |
denotes |
fifth |
T12910 |
6723-6728 |
NN |
denotes |
digit |
T12912 |
6729-6732 |
VBD |
denotes |
was |
T12907 |
6733-6740 |
VBN |
denotes |
defined |
T12913 |
6741-6743 |
IN |
denotes |
by |
T12914 |
6744-6751 |
VBG |
denotes |
drawing |
T12915 |
6752-6753 |
DT |
denotes |
a |
T12916 |
6754-6758 |
NN |
denotes |
line |
T12917 |
6759-6763 |
IN |
denotes |
from |
T12918 |
6764-6767 |
DT |
denotes |
the |
T12919 |
6768-6771 |
NN |
denotes |
tip |
T12920 |
6772-6774 |
IN |
denotes |
of |
T12921 |
6775-6778 |
DT |
denotes |
the |
T12922 |
6779-6784 |
NN |
denotes |
digit |
T12923 |
6785-6789 |
IN |
denotes |
down |
T12924 |
6790-6794 |
CD |
denotes |
2.15 |
T12925 |
6795-6797 |
NN |
denotes |
mm |
T12926 |
6798-6801 |
CC |
denotes |
and |
T12927 |
6802-6808 |
IN |
denotes |
across |
T12928 |
6809-6811 |
IN |
denotes |
to |
T12929 |
6812-6815 |
DT |
denotes |
the |
T12931 |
6816-6823 |
JJ |
denotes |
lateral |
T12930 |
6824-6828 |
NN |
denotes |
edge |
T12932 |
6829-6831 |
IN |
denotes |
of |
T12933 |
6832-6835 |
DT |
denotes |
the |
T12934 |
6836-6842 |
NN |
denotes |
tissue |
T12935 |
6842-6843 |
. |
denotes |
. |
T12936 |
6843-6901 |
sentence |
denotes |
For this analysis, the R26R Cre reporter was not present. |
T12937 |
6844-6847 |
IN |
denotes |
For |
T12939 |
6848-6852 |
DT |
denotes |
this |
T12940 |
6853-6861 |
NN |
denotes |
analysis |
T12941 |
6861-6863 |
, |
denotes |
, |
T12942 |
6863-6866 |
DT |
denotes |
the |
T12944 |
6867-6871 |
NN |
denotes |
R26R |
T12945 |
6872-6875 |
NN |
denotes |
Cre |
T12943 |
6876-6884 |
NN |
denotes |
reporter |
T12938 |
6885-6888 |
VBD |
denotes |
was |
T12946 |
6889-6892 |
RB |
denotes |
not |
T12947 |
6893-6900 |
JJ |
denotes |
present |
T12948 |
6900-6901 |
. |
denotes |
. |
T13137 |
6903-6912 |
NN |
denotes |
Histology |
T13138 |
6913-6916 |
CC |
denotes |
and |
T13139 |
6917-6931 |
NN |
denotes |
histochemistry |
T13140 |
6931-7262 |
sentence |
denotes |
Tissue from animals ranging from stages E14.5 to P14 was prepared for analysis by fixing in 4% paraformaldehyde (PFA) in PBS for 45 min to 4 h depending on the stage; washing three times in PBS, once in PBS + 15% sucrose for 1 h, and once in PBS + 30% sucrose for 2 h to overnight depending on the stage; and then freezing in OCT. |
T13141 |
6932-6938 |
NN |
denotes |
Tissue |
T13143 |
6939-6943 |
IN |
denotes |
from |
T13144 |
6944-6951 |
NNS |
denotes |
animals |
T13145 |
6952-6959 |
VBG |
denotes |
ranging |
T13146 |
6960-6964 |
IN |
denotes |
from |
T13147 |
6965-6971 |
NNS |
denotes |
stages |
T13148 |
6972-6977 |
NN |
denotes |
E14.5 |
T13149 |
6978-6980 |
IN |
denotes |
to |
T13150 |
6981-6984 |
NN |
denotes |
P14 |
T13151 |
6985-6988 |
VBD |
denotes |
was |
T13142 |
6989-6997 |
VBN |
denotes |
prepared |
T13152 |
6998-7001 |
IN |
denotes |
for |
T13153 |
7002-7010 |
NN |
denotes |
analysis |
T13154 |
7011-7013 |
IN |
denotes |
by |
T13155 |
7014-7020 |
VBG |
denotes |
fixing |
T13156 |
7021-7023 |
IN |
denotes |
in |
T13157 |
7024-7025 |
CD |
denotes |
4 |
T13158 |
7025-7026 |
NN |
denotes |
% |
T13159 |
7027-7043 |
NN |
denotes |
paraformaldehyde |
T13160 |
7044-7045 |
-LRB- |
denotes |
( |
T13161 |
7045-7048 |
NN |
denotes |
PFA |
T13162 |
7048-7049 |
-RRB- |
denotes |
) |
T13163 |
7050-7052 |
IN |
denotes |
in |
T13164 |
7053-7056 |
NN |
denotes |
PBS |
T13165 |
7057-7060 |
IN |
denotes |
for |
T13166 |
7061-7063 |
CD |
denotes |
45 |
T13167 |
7064-7067 |
NN |
denotes |
min |
T13168 |
7068-7070 |
IN |
denotes |
to |
T13169 |
7071-7072 |
CD |
denotes |
4 |
T13170 |
7073-7074 |
NN |
denotes |
h |
T13171 |
7075-7084 |
VBG |
denotes |
depending |
T13172 |
7085-7087 |
IN |
denotes |
on |
T13173 |
7088-7091 |
DT |
denotes |
the |
T13174 |
7092-7097 |
NN |
denotes |
stage |
T13175 |
7097-7098 |
: |
denotes |
; |
T13176 |
7099-7106 |
VBG |
denotes |
washing |
T13177 |
7107-7112 |
CD |
denotes |
three |
T13178 |
7113-7118 |
NNS |
denotes |
times |
T13179 |
7119-7121 |
IN |
denotes |
in |
T13180 |
7122-7125 |
NN |
denotes |
PBS |
T13181 |
7125-7127 |
, |
denotes |
, |
T13182 |
7127-7131 |
RB |
denotes |
once |
T13183 |
7132-7134 |
IN |
denotes |
in |
T13184 |
7135-7138 |
NN |
denotes |
PBS |
T13185 |
7139-7140 |
SYM |
denotes |
+ |
T13186 |
7141-7143 |
CD |
denotes |
15 |
T13187 |
7143-7144 |
NN |
denotes |
% |
T13188 |
7145-7152 |
NN |
denotes |
sucrose |
T13189 |
7153-7156 |
IN |
denotes |
for |
T13190 |
7157-7158 |
CD |
denotes |
1 |
T13191 |
7159-7160 |
NN |
denotes |
h |
T13192 |
7160-7162 |
, |
denotes |
, |
T13193 |
7162-7165 |
CC |
denotes |
and |
T13194 |
7166-7170 |
RB |
denotes |
once |
T13195 |
7171-7173 |
IN |
denotes |
in |
T13196 |
7174-7177 |
NN |
denotes |
PBS |
T13197 |
7178-7179 |
SYM |
denotes |
+ |
T13198 |
7180-7182 |
CD |
denotes |
30 |
T13199 |
7182-7183 |
NN |
denotes |
% |
T13200 |
7184-7191 |
NN |
denotes |
sucrose |
T13201 |
7192-7195 |
IN |
denotes |
for |
T13202 |
7196-7197 |
CD |
denotes |
2 |
T13203 |
7198-7199 |
NN |
denotes |
h |
T13204 |
7200-7202 |
IN |
denotes |
to |
T13205 |
7203-7212 |
NN |
denotes |
overnight |
T13206 |
7213-7222 |
VBG |
denotes |
depending |
T13207 |
7223-7225 |
IN |
denotes |
on |
T13208 |
7226-7229 |
DT |
denotes |
the |
T13209 |
7230-7235 |
NN |
denotes |
stage |
T13210 |
7235-7236 |
: |
denotes |
; |
T13211 |
7237-7240 |
CC |
denotes |
and |
T13212 |
7241-7245 |
RB |
denotes |
then |
T13213 |
7246-7254 |
VBG |
denotes |
freezing |
T13214 |
7255-7257 |
IN |
denotes |
in |
T13215 |
7258-7261 |
NN |
denotes |
OCT |
T13216 |
7261-7262 |
. |
denotes |
. |
T13217 |
7262-7436 |
sentence |
denotes |
Tissue from animals aged 7 wk to 9 mo was processed similarly to earlier stages except that it was decalcified in 0.5 M EDTA (pH 7.4) for 4 d prior to incubating in sucrose. |
T13218 |
7263-7269 |
NN |
denotes |
Tissue |
T13220 |
7270-7274 |
IN |
denotes |
from |
T13221 |
7275-7282 |
NNS |
denotes |
animals |
T13222 |
7283-7287 |
VBN |
denotes |
aged |
T13223 |
7288-7289 |
CD |
denotes |
7 |
T13224 |
7290-7292 |
NNS |
denotes |
wk |
T13225 |
7293-7295 |
IN |
denotes |
to |
T13226 |
7296-7297 |
CD |
denotes |
9 |
T13227 |
7298-7300 |
NNS |
denotes |
mo |
T13228 |
7301-7304 |
VBD |
denotes |
was |
T13219 |
7305-7314 |
VBN |
denotes |
processed |
T13229 |
7315-7324 |
RB |
denotes |
similarly |
T13230 |
7325-7327 |
IN |
denotes |
to |
T13231 |
7328-7335 |
JJR |
denotes |
earlier |
T13232 |
7336-7342 |
NNS |
denotes |
stages |
T13233 |
7343-7349 |
IN |
denotes |
except |
T13234 |
7350-7354 |
IN |
denotes |
that |
T13236 |
7355-7357 |
PRP |
denotes |
it |
T13237 |
7358-7361 |
VBD |
denotes |
was |
T13235 |
7362-7373 |
VBN |
denotes |
decalcified |
T13238 |
7374-7376 |
IN |
denotes |
in |
T13239 |
7377-7380 |
CD |
denotes |
0.5 |
T13240 |
7381-7382 |
NN |
denotes |
M |
T13241 |
7383-7387 |
NN |
denotes |
EDTA |
T13242 |
7388-7389 |
-LRB- |
denotes |
( |
T13243 |
7389-7391 |
NN |
denotes |
pH |
T13244 |
7392-7395 |
CD |
denotes |
7.4 |
T13245 |
7395-7396 |
-RRB- |
denotes |
) |
T13246 |
7397-7400 |
IN |
denotes |
for |
T13247 |
7401-7402 |
CD |
denotes |
4 |
T13248 |
7403-7404 |
NN |
denotes |
d |
T13249 |
7405-7410 |
JJ |
denotes |
prior |
T13250 |
7411-7413 |
IN |
denotes |
to |
T13251 |
7414-7424 |
VBG |
denotes |
incubating |
T13252 |
7425-7427 |
IN |
denotes |
in |
T13253 |
7428-7435 |
NN |
denotes |
sucrose |
T13254 |
7435-7436 |
. |
denotes |
. |
T13255 |
7436-7587 |
sentence |
denotes |
All solutions were prechilled and used at 4 °C with agitation, and skin from tissues of P0 or older mice was lacerated or removed prior to processing. |
T13256 |
7437-7440 |
DT |
denotes |
All |
T13257 |
7441-7450 |
NNS |
denotes |
solutions |
T13259 |
7451-7455 |
VBD |
denotes |
were |
T13258 |
7456-7466 |
VBN |
denotes |
prechilled |
T13260 |
7467-7470 |
CC |
denotes |
and |
T13261 |
7471-7475 |
VBN |
denotes |
used |
T13262 |
7476-7478 |
IN |
denotes |
at |
T13263 |
7479-7480 |
CD |
denotes |
4 |
T13264 |
7481-7483 |
NN |
denotes |
°C |
T13265 |
7484-7488 |
IN |
denotes |
with |
T13266 |
7489-7498 |
NN |
denotes |
agitation |
T13267 |
7498-7500 |
, |
denotes |
, |
T13268 |
7500-7503 |
CC |
denotes |
and |
T13269 |
7504-7508 |
NN |
denotes |
skin |
T13271 |
7509-7513 |
IN |
denotes |
from |
T13272 |
7514-7521 |
NNS |
denotes |
tissues |
T13273 |
7522-7524 |
IN |
denotes |
of |
T13274 |
7525-7527 |
NN |
denotes |
P0 |
T13276 |
7528-7530 |
CC |
denotes |
or |
T13277 |
7531-7536 |
JJR |
denotes |
older |
T13275 |
7537-7541 |
NNS |
denotes |
mice |
T13278 |
7542-7545 |
VBD |
denotes |
was |
T13270 |
7546-7555 |
VBN |
denotes |
lacerated |
T13279 |
7556-7558 |
CC |
denotes |
or |
T13280 |
7559-7566 |
VBN |
denotes |
removed |
T13281 |
7567-7572 |
JJ |
denotes |
prior |
T13282 |
7573-7575 |
IN |
denotes |
to |
T13283 |
7576-7586 |
NN |
denotes |
processing |
T13284 |
7586-7587 |
. |
denotes |
. |
T13285 |
7587-7641 |
sentence |
denotes |
Tissue was then cryosectioned at 12 μm and processed. |
T13286 |
7588-7594 |
NN |
denotes |
Tissue |
T13288 |
7595-7598 |
VBD |
denotes |
was |
T13289 |
7599-7603 |
RB |
denotes |
then |
T13287 |
7604-7617 |
VBN |
denotes |
cryosectioned |
T13290 |
7618-7620 |
IN |
denotes |
at |
T13291 |
7621-7623 |
CD |
denotes |
12 |
T13292 |
7624-7626 |
NN |
denotes |
μm |
T13293 |
7627-7630 |
CC |
denotes |
and |
T13294 |
7631-7640 |
VBN |
denotes |
processed |
T13295 |
7640-7641 |
. |
denotes |
. |
T13296 |
7641-7771 |
sentence |
denotes |
Staining of sections with Safranin O, Fast Green, and Harris' hematoxylin was carried out using standard histological procedures. |
T13297 |
7642-7650 |
NN |
denotes |
Staining |
T13299 |
7651-7653 |
IN |
denotes |
of |
T13300 |
7654-7662 |
NNS |
denotes |
sections |
T13301 |
7663-7667 |
IN |
denotes |
with |
T13302 |
7668-7676 |
NN |
denotes |
Safranin |
T13303 |
7677-7678 |
NN |
denotes |
O |
T13304 |
7678-7680 |
, |
denotes |
, |
T13305 |
7680-7684 |
JJ |
denotes |
Fast |
T13306 |
7685-7690 |
NN |
denotes |
Green |
T13307 |
7690-7692 |
, |
denotes |
, |
T13308 |
7692-7695 |
CC |
denotes |
and |
T13309 |
7696-7702 |
NNP |
denotes |
Harris |
T13311 |
7702-7703 |
POS |
denotes |
' |
T13310 |
7704-7715 |
NN |
denotes |
hematoxylin |
T13312 |
7716-7719 |
VBD |
denotes |
was |
T13298 |
7720-7727 |
VBN |
denotes |
carried |
T13313 |
7728-7731 |
RP |
denotes |
out |
T13314 |
7732-7737 |
VBG |
denotes |
using |
T13315 |
7738-7746 |
JJ |
denotes |
standard |
T13317 |
7747-7759 |
JJ |
denotes |
histological |
T13316 |
7760-7770 |
NNS |
denotes |
procedures |
T13318 |
7770-7771 |
. |
denotes |
. |
T13319 |
7771-8091 |
sentence |
denotes |
Detection of LACZ activity with X-Gal was performed as described (Lobe et al. 1999) and was followed by refixing in 4% PFA, rinsing with deionized water, counterstaining with Nuclear Fast Red (Vector Labs), rinsing with water again, and then mounting in Aquamount (Lerner Labs, Pittsburgh, Pennsylvania, United States). |
T13320 |
7772-7781 |
NN |
denotes |
Detection |
T13322 |
7782-7784 |
IN |
denotes |
of |
T13323 |
7785-7789 |
NN |
denotes |
LACZ |
T13324 |
7790-7798 |
NN |
denotes |
activity |
T13325 |
7799-7803 |
IN |
denotes |
with |
T13326 |
7804-7805 |
NN |
denotes |
X |
T13328 |
7805-7806 |
HYPH |
denotes |
- |
T13327 |
7806-7809 |
NN |
denotes |
Gal |
T13329 |
7810-7813 |
VBD |
denotes |
was |
T13321 |
7814-7823 |
VBN |
denotes |
performed |
T13330 |
7824-7826 |
IN |
denotes |
as |
T13331 |
7827-7836 |
VBN |
denotes |
described |
T13332 |
7837-7838 |
-LRB- |
denotes |
( |
T13333 |
7838-7842 |
NNP |
denotes |
Lobe |
T13334 |
7843-7845 |
FW |
denotes |
et |
T13335 |
7846-7849 |
FW |
denotes |
al. |
T13336 |
7850-7854 |
CD |
denotes |
1999 |
T13337 |
7854-7855 |
-RRB- |
denotes |
) |
T13338 |
7856-7859 |
CC |
denotes |
and |
T13339 |
7860-7863 |
VBD |
denotes |
was |
T13340 |
7864-7872 |
VBN |
denotes |
followed |
T13341 |
7873-7875 |
IN |
denotes |
by |
T13342 |
7876-7884 |
VBG |
denotes |
refixing |
T13343 |
7885-7887 |
IN |
denotes |
in |
T13344 |
7888-7889 |
CD |
denotes |
4 |
T13345 |
7889-7890 |
NN |
denotes |
% |
T13346 |
7891-7894 |
NN |
denotes |
PFA |
T13347 |
7894-7896 |
, |
denotes |
, |
T13348 |
7896-7903 |
VBG |
denotes |
rinsing |
T13349 |
7904-7908 |
IN |
denotes |
with |
T13350 |
7909-7918 |
VBN |
denotes |
deionized |
T13351 |
7919-7924 |
NN |
denotes |
water |
T13352 |
7924-7926 |
, |
denotes |
, |
T13353 |
7926-7941 |
VBG |
denotes |
counterstaining |
T13354 |
7942-7946 |
IN |
denotes |
with |
T13355 |
7947-7954 |
JJ |
denotes |
Nuclear |
T13357 |
7955-7959 |
JJ |
denotes |
Fast |
T13356 |
7960-7963 |
NN |
denotes |
Red |
T13358 |
7964-7965 |
-LRB- |
denotes |
( |
T13359 |
7965-7971 |
NNP |
denotes |
Vector |
T13360 |
7972-7976 |
NNP |
denotes |
Labs |
T13361 |
7976-7977 |
-RRB- |
denotes |
) |
T13362 |
7977-7979 |
, |
denotes |
, |
T13363 |
7979-7986 |
VBG |
denotes |
rinsing |
T13364 |
7987-7991 |
IN |
denotes |
with |
T13365 |
7992-7997 |
NN |
denotes |
water |
T13366 |
7998-8003 |
RB |
denotes |
again |
T13367 |
8003-8005 |
, |
denotes |
, |
T13368 |
8005-8008 |
CC |
denotes |
and |
T13369 |
8009-8013 |
RB |
denotes |
then |
T13370 |
8014-8022 |
VBG |
denotes |
mounting |
T13371 |
8023-8025 |
IN |
denotes |
in |
T13372 |
8026-8035 |
NN |
denotes |
Aquamount |
T13373 |
8036-8037 |
-LRB- |
denotes |
( |
T13375 |
8037-8043 |
NNP |
denotes |
Lerner |
T13374 |
8044-8048 |
NNP |
denotes |
Labs |
T13376 |
8048-8050 |
, |
denotes |
, |
T13377 |
8050-8060 |
NNP |
denotes |
Pittsburgh |
T13378 |
8060-8062 |
, |
denotes |
, |
T13379 |
8062-8074 |
NNP |
denotes |
Pennsylvania |
T13380 |
8074-8076 |
, |
denotes |
, |
T13381 |
8076-8082 |
NNP |
denotes |
United |
T13382 |
8083-8089 |
NNP |
denotes |
States |
T13383 |
8089-8090 |
-RRB- |
denotes |
) |
T13384 |
8090-8091 |
. |
denotes |
. |
T13385 |
8091-8567 |
sentence |
denotes |
RNA in situ hybridization was performed as described (Storm and Kingsley 1996), with the following modifications: (1) Prior to the acetylation step, sections were incubated with 10–20 μg/ml proteinase K for 30 s to 7 min at room temperature (depending on the developmental stage), followed by refixing in 4% PFA and washing three times in PBS; (2) prehybridization step was skipped, and (3) embryonic tissue sections used a different color development mix (Thut et al. 2001). |
T13386 |
8092-8095 |
NN |
denotes |
RNA |
T13388 |
8096-8098 |
FW |
denotes |
in |
T13389 |
8099-8103 |
FW |
denotes |
situ |
T13387 |
8104-8117 |
NN |
denotes |
hybridization |
T13391 |
8118-8121 |
VBD |
denotes |
was |
T13390 |
8122-8131 |
VBN |
denotes |
performed |
T13392 |
8132-8134 |
IN |
denotes |
as |
T13393 |
8135-8144 |
VBN |
denotes |
described |
T13394 |
8145-8146 |
-LRB- |
denotes |
( |
T13395 |
8146-8151 |
NNP |
denotes |
Storm |
T13396 |
8152-8155 |
CC |
denotes |
and |
T13397 |
8156-8164 |
NNP |
denotes |
Kingsley |
T13398 |
8165-8169 |
CD |
denotes |
1996 |
T13399 |
8169-8170 |
-RRB- |
denotes |
) |
T13400 |
8170-8172 |
, |
denotes |
, |
T13401 |
8172-8176 |
IN |
denotes |
with |
T13402 |
8177-8180 |
DT |
denotes |
the |
T13404 |
8181-8190 |
VBG |
denotes |
following |
T13403 |
8191-8204 |
NNS |
denotes |
modifications |
T13405 |
8204-8206 |
: |
denotes |
: |
T13406 |
8206-8207 |
-LRB- |
denotes |
( |
T13407 |
8207-8208 |
LS |
denotes |
1 |
T13409 |
8208-8209 |
-RRB- |
denotes |
) |
T13410 |
8210-8215 |
JJ |
denotes |
Prior |
T13411 |
8216-8218 |
IN |
denotes |
to |
T13412 |
8219-8222 |
DT |
denotes |
the |
T13414 |
8223-8234 |
NN |
denotes |
acetylation |
T13413 |
8235-8239 |
NN |
denotes |
step |
T13415 |
8239-8241 |
, |
denotes |
, |
T13416 |
8241-8249 |
NNS |
denotes |
sections |
T13417 |
8250-8254 |
VBD |
denotes |
were |
T13408 |
8255-8264 |
VBN |
denotes |
incubated |
T13418 |
8265-8269 |
IN |
denotes |
with |
T13419 |
8270-8272 |
CD |
denotes |
10 |
T13421 |
8272-8273 |
HYPH |
denotes |
– |
T13420 |
8273-8275 |
CD |
denotes |
20 |
T13422 |
8276-8278 |
NNS |
denotes |
μg |
T13424 |
8278-8279 |
SYM |
denotes |
/ |
T13425 |
8279-8281 |
NN |
denotes |
ml |
T13426 |
8282-8292 |
NN |
denotes |
proteinase |
T13423 |
8293-8294 |
NN |
denotes |
K |
T13427 |
8295-8298 |
IN |
denotes |
for |
T13428 |
8299-8301 |
CD |
denotes |
30 |
T13429 |
8302-8303 |
NN |
denotes |
s |
T13430 |
8304-8306 |
IN |
denotes |
to |
T13431 |
8307-8308 |
CD |
denotes |
7 |
T13432 |
8309-8312 |
NN |
denotes |
min |
T13433 |
8313-8315 |
IN |
denotes |
at |
T13434 |
8316-8320 |
NN |
denotes |
room |
T13435 |
8321-8332 |
NN |
denotes |
temperature |
T13436 |
8333-8334 |
-LRB- |
denotes |
( |
T13437 |
8334-8343 |
VBG |
denotes |
depending |
T13438 |
8344-8346 |
IN |
denotes |
on |
T13439 |
8347-8350 |
DT |
denotes |
the |
T13441 |
8351-8364 |
JJ |
denotes |
developmental |
T13440 |
8365-8370 |
NN |
denotes |
stage |
T13442 |
8370-8371 |
-RRB- |
denotes |
) |
T13443 |
8371-8373 |
, |
denotes |
, |
T13444 |
8373-8381 |
VBN |
denotes |
followed |
T13445 |
8382-8384 |
IN |
denotes |
by |
T13446 |
8385-8393 |
VBG |
denotes |
refixing |
T13447 |
8394-8396 |
IN |
denotes |
in |
T13448 |
8397-8398 |
CD |
denotes |
4 |
T13449 |
8398-8399 |
NN |
denotes |
% |
T13450 |
8400-8403 |
NN |
denotes |
PFA |
T13451 |
8404-8407 |
CC |
denotes |
and |
T13452 |
8408-8415 |
VBG |
denotes |
washing |
T13453 |
8416-8421 |
CD |
denotes |
three |
T13454 |
8422-8427 |
NNS |
denotes |
times |
T13455 |
8428-8430 |
IN |
denotes |
in |
T13456 |
8431-8434 |
NN |
denotes |
PBS |
T13457 |
8434-8435 |
: |
denotes |
; |
T13458 |
8436-8437 |
-LRB- |
denotes |
( |
T13459 |
8437-8438 |
LS |
denotes |
2 |
T13461 |
8438-8439 |
-RRB- |
denotes |
) |
T13462 |
8440-8456 |
NN |
denotes |
prehybridization |
T13463 |
8457-8461 |
NN |
denotes |
step |
T13464 |
8462-8465 |
VBD |
denotes |
was |
T13460 |
8466-8473 |
VBN |
denotes |
skipped |
T13465 |
8473-8475 |
, |
denotes |
, |
T13466 |
8475-8478 |
CC |
denotes |
and |
T13467 |
8479-8480 |
-LRB- |
denotes |
( |
T13468 |
8480-8481 |
LS |
denotes |
3 |
T13470 |
8481-8482 |
-RRB- |
denotes |
) |
T13471 |
8483-8492 |
JJ |
denotes |
embryonic |
T13472 |
8493-8499 |
NN |
denotes |
tissue |
T13473 |
8500-8508 |
NNS |
denotes |
sections |
T13469 |
8509-8513 |
VBD |
denotes |
used |
T13474 |
8514-8515 |
DT |
denotes |
a |
T13476 |
8516-8525 |
JJ |
denotes |
different |
T13477 |
8526-8531 |
NN |
denotes |
color |
T13478 |
8532-8543 |
NN |
denotes |
development |
T13475 |
8544-8547 |
NN |
denotes |
mix |
T13479 |
8548-8549 |
-LRB- |
denotes |
( |
T13480 |
8549-8553 |
NNP |
denotes |
Thut |
T13481 |
8554-8556 |
FW |
denotes |
et |
T13482 |
8557-8560 |
FW |
denotes |
al. |
T13483 |
8561-8565 |
CD |
denotes |
2001 |
T13484 |
8565-8566 |
-RRB- |
denotes |
) |
T13485 |
8566-8567 |
. |
denotes |
. |
T13486 |
8567-8830 |
sentence |
denotes |
Probes for the following genes have been published previously: Bmpr1a (Mishina et al. 1995), Col2a1 (Metsaranta et al. 1991), Col10a1 (Apte et al. 1992), Gdf5 (Storm and Kingsley 1996), Osteocalcin (Celeste et al. 1986), and Sox5 and Sox6 (Lefebvre et al. 1998). |
T13487 |
8568-8574 |
NNS |
denotes |
Probes |
T13489 |
8575-8578 |
IN |
denotes |
for |
T13490 |
8579-8582 |
DT |
denotes |
the |
T13492 |
8583-8592 |
VBG |
denotes |
following |
T13491 |
8593-8598 |
NNS |
denotes |
genes |
T13493 |
8599-8603 |
VBP |
denotes |
have |
T13494 |
8604-8608 |
VBN |
denotes |
been |
T13488 |
8609-8618 |
VBN |
denotes |
published |
T13495 |
8619-8629 |
RB |
denotes |
previously |
T13496 |
8629-8631 |
: |
denotes |
: |
T13497 |
8631-8637 |
NN |
denotes |
Bmpr1a |
T13498 |
8638-8639 |
-LRB- |
denotes |
( |
T13499 |
8639-8646 |
NNP |
denotes |
Mishina |
T13500 |
8647-8649 |
FW |
denotes |
et |
T13501 |
8650-8653 |
FW |
denotes |
al. |
T13502 |
8654-8658 |
CD |
denotes |
1995 |
T13503 |
8658-8659 |
-RRB- |
denotes |
) |
T13504 |
8659-8661 |
, |
denotes |
, |
T13505 |
8661-8667 |
NN |
denotes |
Col2a1 |
T13506 |
8668-8669 |
-LRB- |
denotes |
( |
T13507 |
8669-8679 |
NNP |
denotes |
Metsaranta |
T13508 |
8680-8682 |
FW |
denotes |
et |
T13509 |
8683-8686 |
FW |
denotes |
al. |
T13510 |
8687-8691 |
CD |
denotes |
1991 |
T13511 |
8691-8692 |
-RRB- |
denotes |
) |
T13512 |
8692-8694 |
, |
denotes |
, |
T13513 |
8694-8701 |
NN |
denotes |
Col10a1 |
T13514 |
8702-8703 |
-LRB- |
denotes |
( |
T13515 |
8703-8707 |
NNP |
denotes |
Apte |
T13516 |
8708-8710 |
FW |
denotes |
et |
T13517 |
8711-8714 |
FW |
denotes |
al. |
T13518 |
8715-8719 |
CD |
denotes |
1992 |
T13519 |
8719-8720 |
-RRB- |
denotes |
) |
T13520 |
8720-8722 |
, |
denotes |
, |
T13521 |
8722-8726 |
NN |
denotes |
Gdf5 |
T13522 |
8727-8728 |
-LRB- |
denotes |
( |
T13523 |
8728-8733 |
NNP |
denotes |
Storm |
T13524 |
8734-8737 |
CC |
denotes |
and |
T13525 |
8738-8746 |
NNP |
denotes |
Kingsley |
T13526 |
8747-8751 |
CD |
denotes |
1996 |
T13527 |
8751-8752 |
-RRB- |
denotes |
) |
T13528 |
8752-8754 |
, |
denotes |
, |
T13529 |
8754-8765 |
NN |
denotes |
Osteocalcin |
T13530 |
8766-8767 |
-LRB- |
denotes |
( |
T13531 |
8767-8774 |
NNP |
denotes |
Celeste |
T13532 |
8775-8777 |
FW |
denotes |
et |
T13533 |
8778-8781 |
FW |
denotes |
al. |
T13534 |
8782-8786 |
CD |
denotes |
1986 |
T13535 |
8786-8787 |
-RRB- |
denotes |
) |
T13536 |
8787-8789 |
, |
denotes |
, |
T13537 |
8789-8792 |
CC |
denotes |
and |
T13538 |
8793-8797 |
NN |
denotes |
Sox5 |
T13539 |
8798-8801 |
CC |
denotes |
and |
T13540 |
8802-8806 |
NN |
denotes |
Sox6 |
T13541 |
8807-8808 |
-LRB- |
denotes |
( |
T13542 |
8808-8816 |
NNP |
denotes |
Lefebvre |
T13543 |
8817-8819 |
FW |
denotes |
et |
T13544 |
8820-8823 |
FW |
denotes |
al. |
T13545 |
8824-8828 |
CD |
denotes |
1998 |
T13546 |
8828-8829 |
-RRB- |
denotes |
) |
T13547 |
8829-8830 |
. |
denotes |
. |
T13548 |
8830-9178 |
sentence |
denotes |
The following probe templates were gifts: Agg, Dr. Vicki Rosen, Genetics Institute; Bmp2 and Bmp4, Arend Sidow, Stanford University; Col1a1, Bjorn Olsen, Harvard Medical School; Bmpr1b, Col3a1, and Mat4 probes were made from ESTs with IMAGE clone numbers 5056341, 478480, and 406027, respectively (Invitrogen, Carlsbad, California, United States). |
T13549 |
8831-8834 |
DT |
denotes |
The |
T13551 |
8835-8844 |
VBG |
denotes |
following |
T13552 |
8845-8850 |
NN |
denotes |
probe |
T13550 |
8851-8860 |
NNS |
denotes |
templates |
T13553 |
8861-8865 |
VBD |
denotes |
were |
T13555 |
8866-8871 |
NNS |
denotes |
gifts |
T13556 |
8871-8873 |
: |
denotes |
: |
T13557 |
8873-8876 |
NN |
denotes |
Agg |
T13558 |
8876-8878 |
, |
denotes |
, |
T13559 |
8878-8881 |
NNP |
denotes |
Dr. |
T13561 |
8882-8887 |
NNP |
denotes |
Vicki |
T13560 |
8888-8893 |
NNP |
denotes |
Rosen |
T13562 |
8893-8895 |
, |
denotes |
, |
T13563 |
8895-8903 |
NNP |
denotes |
Genetics |
T13564 |
8904-8913 |
NNP |
denotes |
Institute |
T13565 |
8913-8914 |
: |
denotes |
; |
T13566 |
8915-8919 |
NN |
denotes |
Bmp2 |
T13567 |
8920-8923 |
CC |
denotes |
and |
T13568 |
8924-8928 |
NN |
denotes |
Bmp4 |
T13569 |
8928-8930 |
, |
denotes |
, |
T13570 |
8930-8935 |
NNP |
denotes |
Arend |
T13571 |
8936-8941 |
NNP |
denotes |
Sidow |
T13572 |
8941-8943 |
, |
denotes |
, |
T13573 |
8943-8951 |
NNP |
denotes |
Stanford |
T13574 |
8952-8962 |
NNP |
denotes |
University |
T13575 |
8962-8963 |
: |
denotes |
; |
T13576 |
8964-8970 |
NN |
denotes |
Col1a1 |
T13577 |
8970-8972 |
, |
denotes |
, |
T13578 |
8972-8977 |
NNP |
denotes |
Bjorn |
T13579 |
8978-8983 |
NNP |
denotes |
Olsen |
T13580 |
8983-8985 |
, |
denotes |
, |
T13581 |
8985-8992 |
NNP |
denotes |
Harvard |
T13583 |
8993-9000 |
NNP |
denotes |
Medical |
T13582 |
9001-9007 |
NNP |
denotes |
School |
T13584 |
9007-9008 |
: |
denotes |
; |
T13585 |
9009-9015 |
NN |
denotes |
Bmpr1b |
T13587 |
9015-9017 |
, |
denotes |
, |
T13588 |
9017-9023 |
NN |
denotes |
Col3a1 |
T13589 |
9023-9025 |
, |
denotes |
, |
T13590 |
9025-9028 |
CC |
denotes |
and |
T13591 |
9029-9033 |
NN |
denotes |
Mat4 |
T13586 |
9034-9040 |
NNS |
denotes |
probes |
T13592 |
9041-9045 |
VBD |
denotes |
were |
T13554 |
9046-9050 |
VBN |
denotes |
made |
T13593 |
9051-9055 |
IN |
denotes |
from |
T13594 |
9056-9060 |
NNS |
denotes |
ESTs |
T13595 |
9061-9065 |
IN |
denotes |
with |
T13596 |
9066-9071 |
NN |
denotes |
IMAGE |
T13598 |
9072-9077 |
NN |
denotes |
clone |
T13597 |
9078-9085 |
NNS |
denotes |
numbers |
T13599 |
9086-9093 |
CD |
denotes |
5056341 |
T13600 |
9093-9095 |
, |
denotes |
, |
T13601 |
9095-9101 |
CD |
denotes |
478480 |
T13602 |
9101-9103 |
, |
denotes |
, |
T13603 |
9103-9106 |
CC |
denotes |
and |
T13604 |
9107-9113 |
CD |
denotes |
406027 |
T13605 |
9113-9115 |
, |
denotes |
, |
T13606 |
9115-9127 |
RB |
denotes |
respectively |
T13607 |
9128-9129 |
-LRB- |
denotes |
( |
T13608 |
9129-9139 |
NNP |
denotes |
Invitrogen |
T13609 |
9139-9141 |
, |
denotes |
, |
T13610 |
9141-9149 |
NNP |
denotes |
Carlsbad |
T13611 |
9149-9151 |
, |
denotes |
, |
T13612 |
9151-9161 |
NNP |
denotes |
California |
T13613 |
9161-9163 |
, |
denotes |
, |
T13614 |
9163-9169 |
NNP |
denotes |
United |
T13615 |
9170-9176 |
NNP |
denotes |
States |
T13616 |
9176-9177 |
-RRB- |
denotes |
) |
T13617 |
9177-9178 |
. |
denotes |
. |
T13618 |
9178-9409 |
sentence |
denotes |
Sections for immunohistochemistry were fixed in 4% PFA, then digested with 942–2,000 U/ml type IV-S bovine hyaluronindase (Sigma, St. Louis, Missouri, United States) in PBS (pH 5) at 37 °C for 30 min to 2 h depending on the stage. |
T13619 |
9179-9187 |
NNS |
denotes |
Sections |
T13621 |
9188-9191 |
IN |
denotes |
for |
T13622 |
9192-9212 |
NN |
denotes |
immunohistochemistry |
T13623 |
9213-9217 |
VBD |
denotes |
were |
T13620 |
9218-9223 |
VBN |
denotes |
fixed |
T13624 |
9224-9226 |
IN |
denotes |
in |
T13625 |
9227-9228 |
CD |
denotes |
4 |
T13626 |
9228-9229 |
NN |
denotes |
% |
T13627 |
9230-9233 |
NN |
denotes |
PFA |
T13628 |
9233-9235 |
, |
denotes |
, |
T13629 |
9235-9239 |
RB |
denotes |
then |
T13630 |
9240-9248 |
VBN |
denotes |
digested |
T13631 |
9249-9253 |
IN |
denotes |
with |
T13632 |
9254-9257 |
CD |
denotes |
942 |
T13634 |
9257-9258 |
SYM |
denotes |
– |
T13633 |
9258-9263 |
CD |
denotes |
2,000 |
T13635 |
9264-9265 |
NNS |
denotes |
U |
T13637 |
9265-9266 |
SYM |
denotes |
/ |
T13638 |
9266-9268 |
NN |
denotes |
ml |
T13639 |
9269-9273 |
NN |
denotes |
type |
T13641 |
9274-9276 |
CD |
denotes |
IV |
T13642 |
9276-9277 |
HYPH |
denotes |
- |
T13640 |
9277-9278 |
NN |
denotes |
S |
T13643 |
9279-9285 |
JJ |
denotes |
bovine |
T13636 |
9286-9300 |
NN |
denotes |
hyaluronindase |
T13644 |
9301-9302 |
-LRB- |
denotes |
( |
T13645 |
9302-9307 |
NNP |
denotes |
Sigma |
T13646 |
9307-9309 |
, |
denotes |
, |
T13647 |
9309-9312 |
NNP |
denotes |
St. |
T13648 |
9313-9318 |
NNP |
denotes |
Louis |
T13649 |
9318-9320 |
, |
denotes |
, |
T13650 |
9320-9328 |
NNP |
denotes |
Missouri |
T13651 |
9328-9330 |
, |
denotes |
, |
T13652 |
9330-9336 |
NNP |
denotes |
United |
T13653 |
9337-9343 |
NNP |
denotes |
States |
T13654 |
9343-9344 |
-RRB- |
denotes |
) |
T13655 |
9345-9347 |
IN |
denotes |
in |
T13656 |
9348-9351 |
NNS |
denotes |
PBS |
T13657 |
9352-9353 |
-LRB- |
denotes |
( |
T13658 |
9353-9355 |
NN |
denotes |
pH |
T13659 |
9356-9357 |
CD |
denotes |
5 |
T13660 |
9357-9358 |
-RRB- |
denotes |
) |
T13661 |
9359-9361 |
IN |
denotes |
at |
T13662 |
9362-9364 |
CD |
denotes |
37 |
T13663 |
9365-9367 |
NN |
denotes |
°C |
T13664 |
9368-9371 |
IN |
denotes |
for |
T13665 |
9372-9374 |
CD |
denotes |
30 |
T13666 |
9375-9378 |
NN |
denotes |
min |
T13667 |
9379-9381 |
IN |
denotes |
to |
T13668 |
9382-9383 |
CD |
denotes |
2 |
T13669 |
9384-9385 |
NN |
denotes |
h |
T13670 |
9386-9395 |
VBG |
denotes |
depending |
T13671 |
9396-9398 |
IN |
denotes |
on |
T13672 |
9399-9402 |
DT |
denotes |
the |
T13673 |
9403-9408 |
NN |
denotes |
stage |
T13674 |
9408-9409 |
. |
denotes |
. |
T13675 |
9409-9707 |
sentence |
denotes |
Slides were then washed in PBS, treated with 0.3% hydrogen peroxide in 100% methanol for 30 min, washed, blocked with PBS + 0.05% Tween20 + 5% goat or fetal bovine serum, washed again, and incubated with primary antibodies in PBS + 0.05% Tween 20 + 1% goat or fetal bovine serum overnight at 4 °C. |
T13676 |
9410-9416 |
NNS |
denotes |
Slides |
T13678 |
9417-9421 |
VBD |
denotes |
were |
T13679 |
9422-9426 |
RB |
denotes |
then |
T13677 |
9427-9433 |
VBN |
denotes |
washed |
T13680 |
9434-9436 |
IN |
denotes |
in |
T13681 |
9437-9440 |
NN |
denotes |
PBS |
T13682 |
9440-9442 |
, |
denotes |
, |
T13683 |
9442-9449 |
VBN |
denotes |
treated |
T13684 |
9450-9454 |
IN |
denotes |
with |
T13685 |
9455-9458 |
CD |
denotes |
0.3 |
T13686 |
9458-9459 |
NN |
denotes |
% |
T13688 |
9460-9468 |
NN |
denotes |
hydrogen |
T13687 |
9469-9477 |
NN |
denotes |
peroxide |
T13689 |
9478-9480 |
IN |
denotes |
in |
T13690 |
9481-9484 |
CD |
denotes |
100 |
T13691 |
9484-9485 |
NN |
denotes |
% |
T13692 |
9486-9494 |
NN |
denotes |
methanol |
T13693 |
9495-9498 |
IN |
denotes |
for |
T13694 |
9499-9501 |
CD |
denotes |
30 |
T13695 |
9502-9505 |
NN |
denotes |
min |
T13696 |
9505-9507 |
, |
denotes |
, |
T13697 |
9507-9513 |
VBN |
denotes |
washed |
T13698 |
9513-9515 |
, |
denotes |
, |
T13699 |
9515-9522 |
VBN |
denotes |
blocked |
T13700 |
9523-9527 |
IN |
denotes |
with |
T13701 |
9528-9531 |
NN |
denotes |
PBS |
T13702 |
9532-9533 |
SYM |
denotes |
+ |
T13703 |
9534-9538 |
CD |
denotes |
0.05 |
T13704 |
9538-9539 |
NN |
denotes |
% |
T13705 |
9540-9547 |
NN |
denotes |
Tween20 |
T13706 |
9548-9549 |
SYM |
denotes |
+ |
T13707 |
9550-9551 |
CD |
denotes |
5 |
T13708 |
9551-9552 |
NN |
denotes |
% |
T13710 |
9553-9557 |
NN |
denotes |
goat |
T13711 |
9558-9560 |
CC |
denotes |
or |
T13712 |
9561-9566 |
JJ |
denotes |
fetal |
T13713 |
9567-9573 |
JJ |
denotes |
bovine |
T13709 |
9574-9579 |
NN |
denotes |
serum |
T13714 |
9579-9581 |
, |
denotes |
, |
T13715 |
9581-9587 |
VBD |
denotes |
washed |
T13716 |
9588-9593 |
RB |
denotes |
again |
T13717 |
9593-9595 |
, |
denotes |
, |
T13718 |
9595-9598 |
CC |
denotes |
and |
T13719 |
9599-9608 |
VBN |
denotes |
incubated |
T13720 |
9609-9613 |
IN |
denotes |
with |
T13721 |
9614-9621 |
JJ |
denotes |
primary |
T13722 |
9622-9632 |
NNS |
denotes |
antibodies |
T13723 |
9633-9635 |
IN |
denotes |
in |
T13724 |
9636-9639 |
NN |
denotes |
PBS |
T13725 |
9640-9641 |
SYM |
denotes |
+ |
T13726 |
9642-9646 |
CD |
denotes |
0.05 |
T13727 |
9646-9647 |
NN |
denotes |
% |
T13728 |
9648-9653 |
NN |
denotes |
Tween |
T13729 |
9654-9656 |
CD |
denotes |
20 |
T13730 |
9657-9658 |
SYM |
denotes |
+ |
T13731 |
9659-9660 |
CD |
denotes |
1 |
T13732 |
9660-9661 |
NN |
denotes |
% |
T13734 |
9662-9666 |
NN |
denotes |
goat |
T13735 |
9667-9669 |
CC |
denotes |
or |
T13736 |
9670-9675 |
JJ |
denotes |
fetal |
T13737 |
9676-9682 |
JJ |
denotes |
bovine |
T13733 |
9683-9688 |
NN |
denotes |
serum |
T13738 |
9689-9698 |
RB |
denotes |
overnight |
T13739 |
9699-9701 |
IN |
denotes |
at |
T13740 |
9702-9703 |
CD |
denotes |
4 |
T13741 |
9704-9706 |
NN |
denotes |
°C |
T13742 |
9706-9707 |
. |
denotes |
. |
T13743 |
9707-9873 |
sentence |
denotes |
Biotin-labeled secondary antibodies (Vector Labs) were tagged with HRP using the Vectastain Elite ABC kit (Vector Labs) followed by detection with DAB (Vector Labs). |
T13744 |
9708-9714 |
NN |
denotes |
Biotin |
T13746 |
9714-9715 |
HYPH |
denotes |
- |
T13745 |
9715-9722 |
VBN |
denotes |
labeled |
T13748 |
9723-9732 |
JJ |
denotes |
secondary |
T13747 |
9733-9743 |
NNS |
denotes |
antibodies |
T13750 |
9744-9745 |
-LRB- |
denotes |
( |
T13752 |
9745-9751 |
NN |
denotes |
Vector |
T13751 |
9752-9756 |
NNS |
denotes |
Labs |
T13753 |
9756-9757 |
-RRB- |
denotes |
) |
T13754 |
9758-9762 |
VBD |
denotes |
were |
T13749 |
9763-9769 |
VBN |
denotes |
tagged |
T13755 |
9770-9774 |
IN |
denotes |
with |
T13756 |
9775-9778 |
NN |
denotes |
HRP |
T13757 |
9779-9784 |
VBG |
denotes |
using |
T13758 |
9785-9788 |
DT |
denotes |
the |
T13760 |
9789-9799 |
NNP |
denotes |
Vectastain |
T13761 |
9800-9805 |
NNP |
denotes |
Elite |
T13762 |
9806-9809 |
NNP |
denotes |
ABC |
T13759 |
9810-9813 |
NN |
denotes |
kit |
T13763 |
9814-9815 |
-LRB- |
denotes |
( |
T13765 |
9815-9821 |
NNP |
denotes |
Vector |
T13764 |
9822-9826 |
NNPS |
denotes |
Labs |
T13766 |
9826-9827 |
-RRB- |
denotes |
) |
T13767 |
9828-9836 |
VBN |
denotes |
followed |
T13768 |
9837-9839 |
IN |
denotes |
by |
T13769 |
9840-9849 |
NN |
denotes |
detection |
T13770 |
9850-9854 |
IN |
denotes |
with |
T13771 |
9855-9858 |
NN |
denotes |
DAB |
T13772 |
9859-9860 |
-LRB- |
denotes |
( |
T13774 |
9860-9866 |
NNP |
denotes |
Vector |
T13773 |
9867-9871 |
NNPS |
denotes |
Labs |
T13775 |
9871-9872 |
-RRB- |
denotes |
) |
T13776 |
9872-9873 |
. |
denotes |
. |
T13777 |
9873-10144 |
sentence |
denotes |
Primary antibodies and dilutions used were: goat anti-mouse MMP13, 1:100 (Chemicon International, Temecula, California, United States); rabbit anti-human SOX9, 1:500 (Morais da Silva et al. 1996); rabbit anti-phosphorylated-SOX9 (SOX9.P), 1:10–1:250 (Huang et al. 2000). |
T13778 |
9874-9881 |
JJ |
denotes |
Primary |
T13779 |
9882-9892 |
NNS |
denotes |
antibodies |
T13781 |
9893-9896 |
CC |
denotes |
and |
T13782 |
9897-9906 |
NNS |
denotes |
dilutions |
T13783 |
9907-9911 |
VBN |
denotes |
used |
T13780 |
9912-9916 |
VBD |
denotes |
were |
T13784 |
9916-9918 |
: |
denotes |
: |
T13785 |
9918-9922 |
NN |
denotes |
goat |
T13787 |
9923-9933 |
JJ |
denotes |
anti-mouse |
T13786 |
9934-9939 |
NN |
denotes |
MMP13 |
T13788 |
9939-9941 |
, |
denotes |
, |
T13789 |
9941-9942 |
CD |
denotes |
1 |
T13790 |
9942-9943 |
SYM |
denotes |
: |
T13791 |
9943-9946 |
CD |
denotes |
100 |
T13792 |
9947-9948 |
-LRB- |
denotes |
( |
T13794 |
9948-9956 |
NNP |
denotes |
Chemicon |
T13793 |
9957-9970 |
NNP |
denotes |
International |
T13795 |
9970-9972 |
, |
denotes |
, |
T13796 |
9972-9980 |
NNP |
denotes |
Temecula |
T13797 |
9980-9982 |
, |
denotes |
, |
T13798 |
9982-9992 |
NNP |
denotes |
California |
T13799 |
9992-9994 |
, |
denotes |
, |
T13800 |
9994-10000 |
NNP |
denotes |
United |
T13801 |
10001-10007 |
NNP |
denotes |
States |
T13802 |
10007-10008 |
-RRB- |
denotes |
) |
T13803 |
10008-10009 |
: |
denotes |
; |
T13804 |
10010-10016 |
NN |
denotes |
rabbit |
T13806 |
10017-10027 |
JJ |
denotes |
anti-human |
T13805 |
10028-10032 |
NN |
denotes |
SOX9 |
T13807 |
10032-10034 |
, |
denotes |
, |
T13808 |
10034-10035 |
CD |
denotes |
1 |
T13809 |
10035-10036 |
SYM |
denotes |
: |
T13810 |
10036-10039 |
CD |
denotes |
500 |
T13811 |
10040-10041 |
-LRB- |
denotes |
( |
T13812 |
10041-10047 |
NNP |
denotes |
Morais |
T13813 |
10048-10050 |
NNP |
denotes |
da |
T13814 |
10051-10056 |
NNP |
denotes |
Silva |
T13815 |
10057-10059 |
FW |
denotes |
et |
T13816 |
10060-10063 |
FW |
denotes |
al. |
T13817 |
10064-10068 |
CD |
denotes |
1996 |
T13818 |
10068-10069 |
-RRB- |
denotes |
) |
T13819 |
10069-10070 |
: |
denotes |
; |
T13820 |
10071-10077 |
NN |
denotes |
rabbit |
T13822 |
10078-10097 |
VBN |
denotes |
anti-phosphorylated |
T13823 |
10097-10098 |
HYPH |
denotes |
- |
T13821 |
10098-10102 |
NN |
denotes |
SOX9 |
T13824 |
10103-10104 |
-LRB- |
denotes |
( |
T13825 |
10104-10108 |
NN |
denotes |
SOX9 |
T13827 |
10108-10109 |
, |
denotes |
. |
T13826 |
10109-10110 |
NN |
denotes |
P |
T13828 |
10110-10111 |
-RRB- |
denotes |
) |
T13829 |
10111-10113 |
, |
denotes |
, |
T13830 |
10113-10114 |
CD |
denotes |
1 |
T13831 |
10114-10115 |
SYM |
denotes |
: |
T13832 |
10115-10117 |
CD |
denotes |
10 |
T13833 |
10117-10118 |
SYM |
denotes |
– |
T13834 |
10118-10119 |
CD |
denotes |
1 |
T13835 |
10119-10120 |
SYM |
denotes |
: |
T13836 |
10120-10123 |
CD |
denotes |
250 |
T13837 |
10124-10125 |
-LRB- |
denotes |
( |
T13838 |
10125-10130 |
NNP |
denotes |
Huang |
T13839 |
10131-10133 |
FW |
denotes |
et |
T13840 |
10134-10137 |
FW |
denotes |
al. |
T13841 |
10138-10142 |
CD |
denotes |
2000 |
T13842 |
10142-10143 |
-RRB- |
denotes |
) |
T13843 |
10143-10144 |
. |
denotes |
. |
R7266 |
T11314 |
T11313 |
prep |
of,Generation |
R7267 |
T11315 |
T11316 |
compound |
Gdf5,Cre |
R7268 |
T11316 |
T11318 |
npadvmod |
Cre,transgenic |
R7269 |
T11317 |
T11316 |
punct |
-,Cre |
R7270 |
T11318 |
T11319 |
amod |
transgenic,mice |
R7271 |
T11319 |
T11314 |
pobj |
mice,of |
R7272 |
T11321 |
T11322 |
det |
A,library |
R7273 |
T11322 |
T11328 |
nsubjpass |
library,screened |
R7274 |
T11323 |
T11324 |
compound |
mouse,BAC |
R7275 |
T11324 |
T11322 |
compound |
BAC,library |
R7276 |
T11325 |
T11326 |
compound |
129x1,SvJ |
R7277 |
T11326 |
T11324 |
compound |
SvJ,BAC |
R7278 |
T11327 |
T11326 |
punct |
/,SvJ |
R7279 |
T11329 |
T11330 |
punct |
(,Invitrogen |
R7280 |
T11330 |
T11322 |
parataxis |
Invitrogen,library |
R7281 |
T11331 |
T11330 |
punct |
),Invitrogen |
R7282 |
T11332 |
T11328 |
auxpass |
was,screened |
R7283 |
T11333 |
T11334 |
aux |
to,identify |
R7284 |
T11334 |
T11328 |
advcl |
identify,screened |
R7285 |
T11335 |
T11336 |
det |
a,BAC |
R7286 |
T11336 |
T11334 |
dobj |
BAC,identify |
R7287 |
T11337 |
T11338 |
nummod |
140,kb |
R7288 |
T11338 |
T11336 |
compound |
kb,BAC |
R7289 |
T11339 |
T11338 |
punct |
-,kb |
R7290 |
T11340 |
T11336 |
prep |
from,BAC |
R7291 |
T11341 |
T11342 |
det |
the,locus |
R7292 |
T11342 |
T11340 |
pobj |
locus,from |
R7293 |
T11343 |
T11342 |
compound |
Gdf5,locus |
R7294 |
T11344 |
T11328 |
punct |
.,screened |
R7295 |
T11346 |
T11347 |
det |
This,BAC |
R7296 |
T11347 |
T11348 |
nsubjpass |
BAC,modified |
R7297 |
T11349 |
T11348 |
auxpass |
was,modified |
R7298 |
T11350 |
T11348 |
advcl |
using,modified |
R7299 |
T11351 |
T11352 |
det |
a,system |
R7300 |
T11352 |
T11350 |
dobj |
system,using |
R7301 |
T11353 |
T11354 |
amod |
homologous,recombination |
R7302 |
T11354 |
T11352 |
compound |
recombination,system |
R7303 |
T11355 |
T11350 |
prep |
in,using |
R7304 |
T11356 |
T11357 |
compound |
E.,coli |
R7305 |
T11357 |
T11355 |
pobj |
coli,in |
R7306 |
T11358 |
T11359 |
punct |
(,Yang |
R7307 |
T11359 |
T11350 |
meta |
Yang,using |
R7308 |
T11360 |
T11359 |
nmod |
et,Yang |
R7309 |
T11361 |
T11359 |
nmod |
al.,Yang |
R7310 |
T11362 |
T11359 |
nummod |
1997,Yang |
R7311 |
T11363 |
T11359 |
punct |
),Yang |
R7312 |
T11364 |
T11365 |
aux |
to,place |
R7313 |
T11365 |
T11350 |
advcl |
place,using |
R7314 |
T11366 |
T11367 |
amod |
nuclear,localized |
R7315 |
T11367 |
T11369 |
amod |
localized,recombinase |
R7316 |
T11368 |
T11367 |
punct |
-,localized |
R7317 |
T11369 |
T11365 |
dobj |
recombinase,place |
R7318 |
T11370 |
T11369 |
compound |
Cre,recombinase |
R7319 |
T11371 |
T11369 |
punct |
(,recombinase |
R7320 |
T11372 |
T11369 |
prep |
from,recombinase |
R7321 |
T11373 |
T11374 |
compound |
plasmid,pML78 |
R7322 |
T11374 |
T11372 |
pobj |
pML78,from |
R7323 |
T11375 |
T11376 |
punct |
", ",gift |
R7324 |
T11376 |
T11374 |
parataxis |
gift,pML78 |
R7325 |
T11377 |
T11376 |
prep |
of,gift |
R7326 |
T11378 |
T11379 |
compound |
Gail,Martin |
R7327 |
T11379 |
T11377 |
pobj |
Martin,of |
R7328 |
T11380 |
T11369 |
punct |
),recombinase |
R7329 |
T11381 |
T11369 |
acl |
followed,recombinase |
R7330 |
T11382 |
T11381 |
agent |
by,followed |
R7331 |
T11383 |
T11384 |
compound |
IRES,hPLAP |
R7332 |
T11384 |
T11382 |
pobj |
hPLAP,by |
R7333 |
T11385 |
T11384 |
punct |
-,hPLAP |
R7334 |
T11386 |
T11384 |
punct |
(,hPLAP |
R7335 |
T11387 |
T11384 |
prep |
from,hPLAP |
R7336 |
T11388 |
T11387 |
pobj |
plasmid,from |
R7337 |
T11389 |
T11388 |
nummod |
1726,plasmid |
R7338 |
T11390 |
T11388 |
punct |
", ",plasmid |
R7339 |
T11391 |
T11388 |
parataxis |
gift,plasmid |
R7340 |
T11392 |
T11391 |
prep |
of,gift |
R7341 |
T11393 |
T11394 |
compound |
Oliver,Bogler |
R7342 |
T11394 |
T11392 |
pobj |
Bogler,of |
R7343 |
T11395 |
T11384 |
punct |
),hPLAP |
R7344 |
T11396 |
T11397 |
advmod |
directly,behind |
R7345 |
T11397 |
T11384 |
prep |
behind,hPLAP |
R7346 |
T11398 |
T11399 |
det |
the,site |
R7347 |
T11399 |
T11397 |
pobj |
site,behind |
R7348 |
T11400 |
T11399 |
compound |
ATG,site |
R7349 |
T11401 |
T11399 |
compound |
start,site |
R7350 |
T11402 |
T11399 |
prep |
of,site |
R7351 |
T11403 |
T11402 |
pobj |
Gdf5,of |
R7352 |
T11404 |
T11348 |
punct |
.,modified |
R7353 |
T11406 |
T11407 |
prep |
In,removed |
R7354 |
T11408 |
T11409 |
det |
the,process |
R7355 |
T11409 |
T11406 |
pobj |
process,In |
R7356 |
T11410 |
T11407 |
punct |
", ",removed |
R7357 |
T11411 |
T11412 |
nummod |
583,bp |
R7358 |
T11412 |
T11407 |
nsubjpass |
bp,removed |
R7359 |
T11413 |
T11412 |
prep |
of,bp |
R7360 |
T11414 |
T11415 |
det |
the,exon |
R7361 |
T11415 |
T11413 |
pobj |
exon,of |
R7362 |
T11416 |
T11415 |
amod |
first,exon |
R7363 |
T11417 |
T11415 |
prep |
of,exon |
R7364 |
T11418 |
T11417 |
pobj |
Gdf5,of |
R7365 |
T11419 |
T11407 |
auxpass |
was,removed |
R7366 |
T11420 |
T11407 |
cc |
and,removed |
R7367 |
T11421 |
T11422 |
det |
no,protein |
R7368 |
T11422 |
T11425 |
nsubjpass |
protein,predicted |
R7369 |
T11423 |
T11422 |
amod |
functional,protein |
R7370 |
T11424 |
T11422 |
compound |
GDF5,protein |
R7371 |
T11425 |
T11407 |
conj |
predicted,removed |
R7372 |
T11426 |
T11425 |
auxpass |
is,predicted |
R7373 |
T11427 |
T11428 |
aux |
to,produced |
R7374 |
T11428 |
T11425 |
xcomp |
produced,predicted |
R7375 |
T11429 |
T11428 |
auxpass |
be,produced |
R7376 |
T11430 |
T11425 |
punct |
.,predicted |
R7377 |
T11432 |
T11433 |
det |
The,arm |
R7378 |
T11433 |
T11437 |
nsubjpass |
arm,subcloned |
R7379 |
T11434 |
T11433 |
nummod |
5,arm |
R7380 |
T11435 |
T11434 |
punct |
′,5 |
R7381 |
T11436 |
T11433 |
compound |
homology,arm |
R7382 |
T11438 |
T11437 |
auxpass |
was,subcloned |
R7383 |
T11439 |
T11437 |
prep |
from,subcloned |
R7384 |
T11440 |
T11441 |
det |
a,product |
R7385 |
T11441 |
T11439 |
pobj |
product,from |
R7386 |
T11442 |
T11441 |
compound |
PCR,product |
R7387 |
T11443 |
T11441 |
acl |
tailed,product |
R7388 |
T11444 |
T11443 |
prep |
with,tailed |
R7389 |
T11445 |
T11446 |
nmod |
XhoI,sites |
R7390 |
T11446 |
T11444 |
pobj |
sites,with |
R7391 |
T11447 |
T11445 |
cc |
and,XhoI |
R7392 |
T11448 |
T11445 |
conj |
Bsp120I,XhoI |
R7393 |
T11449 |
T11446 |
compound |
restriction,sites |
R7394 |
T11450 |
T11451 |
dep |
that,contains |
R7395 |
T11451 |
T11441 |
relcl |
contains,product |
R7396 |
T11452 |
T11453 |
nummod |
781,bp |
R7397 |
T11453 |
T11451 |
dobj |
bp,contains |
R7398 |
T11454 |
T11453 |
prep |
of,bp |
R7399 |
T11455 |
T11456 |
nummod |
5,sequence |
R7400 |
T11456 |
T11454 |
pobj |
sequence,of |
R7401 |
T11457 |
T11455 |
punct |
′,5 |
R7402 |
T11458 |
T11456 |
amod |
genomic,sequence |
R7403 |
T11459 |
T11456 |
compound |
Gdf5,sequence |
R7404 |
T11460 |
T11456 |
acl |
ending,sequence |
R7405 |
T11461 |
T11460 |
prep |
at,ending |
R7406 |
T11462 |
T11463 |
det |
the,site |
R7407 |
T11463 |
T11461 |
pobj |
site,at |
R7408 |
T11464 |
T11465 |
compound |
ATG,translation |
R7409 |
T11465 |
T11463 |
compound |
translation,site |
R7410 |
T11466 |
T11463 |
compound |
start,site |
R7411 |
T11467 |
T11468 |
punct |
(,GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
R7412 |
T11468 |
T11460 |
parataxis |
GTTTGGGCCCATCCTCTGGCCAGCCGCTG,ending |
R7413 |
T11469 |
T11470 |
amod |
forward,primer |
R7414 |
T11470 |
T11471 |
dep |
primer,CTGTCTCGAGATGAGGTGGAGGTGAAGACCCC |
R7415 |
T11471 |
T11468 |
dep |
CTGTCTCGAGATGAGGTGGAGGTGAAGACCCC,GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
R7416 |
T11472 |
T11471 |
nummod |
5,CTGTCTCGAGATGAGGTGGAGGTGAAGACCCC |
R7417 |
T11473 |
T11472 |
punct |
′,5 |
R7418 |
T11474 |
T11471 |
punct |
-,CTGTCTCGAGATGAGGTGGAGGTGAAGACCCC |
R7419 |
T11475 |
T11471 |
punct |
-,CTGTCTCGAGATGAGGTGGAGGTGAAGACCCC |
R7420 |
T11476 |
T11471 |
nummod |
3,CTGTCTCGAGATGAGGTGGAGGTGAAGACCCC |
R7421 |
T11477 |
T11471 |
punct |
′,CTGTCTCGAGATGAGGTGGAGGTGAAGACCCC |
R7422 |
T11478 |
T11468 |
punct |
;,GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
R7423 |
T11479 |
T11468 |
amod |
reverse,GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
R7424 |
T11480 |
T11468 |
nummod |
5,GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
R7425 |
T11481 |
T11480 |
punct |
′,5 |
R7426 |
T11482 |
T11468 |
punct |
-,GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
R7427 |
T11483 |
T11468 |
punct |
-,GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
R7428 |
T11484 |
T11468 |
nummod |
3,GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
R7429 |
T11485 |
T11468 |
punct |
′,GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
R7430 |
T11486 |
T11468 |
punct |
),GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
R7431 |
T11487 |
T11437 |
punct |
.,subcloned |
R7432 |
T11489 |
T11490 |
nsubjpass |
Cre,subcloned |
R7433 |
T11491 |
T11490 |
auxpass |
was,subcloned |
R7434 |
T11492 |
T11490 |
prep |
from,subcloned |
R7435 |
T11493 |
T11494 |
det |
a,fragment |
R7436 |
T11494 |
T11492 |
pobj |
fragment,from |
R7437 |
T11495 |
T11496 |
nummod |
1.1,kb |
R7438 |
T11496 |
T11494 |
compound |
kb,fragment |
R7439 |
T11497 |
T11496 |
punct |
-,kb |
R7440 |
T11498 |
T11499 |
compound |
Bsp120I,EcoRI |
R7441 |
T11499 |
T11494 |
compound |
EcoRI,fragment |
R7442 |
T11500 |
T11499 |
punct |
/,EcoRI |
R7443 |
T11501 |
T11494 |
prep |
of,fragment |
R7444 |
T11502 |
T11501 |
pobj |
pML78,of |
R7445 |
T11503 |
T11490 |
punct |
.,subcloned |
R7446 |
T11505 |
T11506 |
compound |
IRES,hPLAP |
R7447 |
T11506 |
T11507 |
nsubjpass |
hPLAP,subcloned |
R7448 |
T11508 |
T11507 |
auxpass |
was,subcloned |
R7449 |
T11509 |
T11507 |
prep |
from,subcloned |
R7450 |
T11510 |
T11511 |
det |
a,product |
R7451 |
T11511 |
T11509 |
pobj |
product,from |
R7452 |
T11512 |
T11513 |
nummod |
2.1,kb |
R7453 |
T11513 |
T11511 |
compound |
kb,product |
R7454 |
T11514 |
T11513 |
punct |
-,kb |
R7455 |
T11515 |
T11511 |
compound |
PCR,product |
R7456 |
T11516 |
T11511 |
acl |
tailed,product |
R7457 |
T11517 |
T11516 |
prep |
with,tailed |
R7458 |
T11518 |
T11519 |
nmod |
EcoRI,sites |
R7459 |
T11519 |
T11517 |
pobj |
sites,with |
R7460 |
T11520 |
T11518 |
cc |
and,EcoRI |
R7461 |
T11521 |
T11518 |
conj |
SpeI,EcoRI |
R7462 |
T11522 |
T11523 |
dep |
that,contains |
R7463 |
T11523 |
T11511 |
relcl |
contains,product |
R7464 |
T11524 |
T11525 |
det |
the,site |
R7465 |
T11525 |
T11523 |
dobj |
site,contains |
R7466 |
T11526 |
T11527 |
compound |
hPLAP,translation |
R7467 |
T11527 |
T11525 |
compound |
translation,site |
R7468 |
T11528 |
T11525 |
compound |
stop,site |
R7469 |
T11529 |
T11530 |
punct |
(,AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
R7470 |
T11530 |
T11525 |
parataxis |
AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG,site |
R7471 |
T11531 |
T11532 |
amod |
forward,primer |
R7472 |
T11532 |
T11533 |
dep |
primer,ATCTCTCGAGGAATTCTCCACCATATTGCCGTCTTTTG |
R7473 |
T11533 |
T11530 |
dep |
ATCTCTCGAGGAATTCTCCACCATATTGCCGTCTTTTG,AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
R7474 |
T11534 |
T11533 |
nummod |
5,ATCTCTCGAGGAATTCTCCACCATATTGCCGTCTTTTG |
R7475 |
T11535 |
T11534 |
punct |
′,5 |
R7476 |
T11536 |
T11533 |
punct |
-,ATCTCTCGAGGAATTCTCCACCATATTGCCGTCTTTTG |
R7477 |
T11537 |
T11533 |
punct |
-,ATCTCTCGAGGAATTCTCCACCATATTGCCGTCTTTTG |
R7478 |
T11538 |
T11533 |
nummod |
3,ATCTCTCGAGGAATTCTCCACCATATTGCCGTCTTTTG |
R7479 |
T11539 |
T11533 |
punct |
′,ATCTCTCGAGGAATTCTCCACCATATTGCCGTCTTTTG |
R7480 |
T11540 |
T11530 |
punct |
;,AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
R7481 |
T11541 |
T11530 |
amod |
reverse,AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
R7482 |
T11542 |
T11530 |
nummod |
5,AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
R7483 |
T11543 |
T11542 |
punct |
′,5 |
R7484 |
T11544 |
T11530 |
punct |
-,AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
R7485 |
T11545 |
T11530 |
punct |
-,AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
R7486 |
T11546 |
T11530 |
nummod |
3,AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
R7487 |
T11547 |
T11530 |
punct |
′,AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
R7488 |
T11548 |
T11530 |
punct |
),AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
R7489 |
T11549 |
T11507 |
punct |
.,subcloned |
R7490 |
T11551 |
T11552 |
det |
The,arm |
R7491 |
T11552 |
T11556 |
nsubjpass |
arm,subcloned |
R7492 |
T11553 |
T11552 |
nummod |
3,arm |
R7493 |
T11554 |
T11553 |
punct |
′,3 |
R7494 |
T11555 |
T11552 |
compound |
homology,arm |
R7495 |
T11557 |
T11556 |
auxpass |
was,subcloned |
R7496 |
T11558 |
T11556 |
prep |
from,subcloned |
R7497 |
T11559 |
T11560 |
det |
a,product |
R7498 |
T11560 |
T11558 |
pobj |
product,from |
R7499 |
T11561 |
T11562 |
nummod |
0.8,kb |
R7500 |
T11562 |
T11560 |
compound |
kb,product |
R7501 |
T11563 |
T11562 |
punct |
-,kb |
R7502 |
T11564 |
T11560 |
compound |
PCR,product |
R7503 |
T11565 |
T11560 |
acl |
amplified,product |
R7504 |
T11566 |
T11565 |
prep |
from,amplified |
R7505 |
T11567 |
T11568 |
det |
a,subclone |
R7506 |
T11568 |
T11566 |
pobj |
subclone,from |
R7507 |
T11569 |
T11570 |
nummod |
0.9,kb |
R7508 |
T11570 |
T11568 |
nmod |
kb,subclone |
R7509 |
T11571 |
T11570 |
punct |
-,kb |
R7510 |
T11572 |
T11573 |
nmod |
XhoI,Gdf5 |
R7511 |
T11573 |
T11568 |
nmod |
Gdf5,subclone |
R7512 |
T11574 |
T11568 |
amod |
genomic,subclone |
R7513 |
T11575 |
T11568 |
acl |
containing,subclone |
R7514 |
T11576 |
T11575 |
dobj |
part,containing |
R7515 |
T11577 |
T11576 |
prep |
of,part |
R7516 |
T11578 |
T11579 |
det |
the,exon |
R7517 |
T11579 |
T11577 |
pobj |
exon,of |
R7518 |
T11580 |
T11579 |
amod |
first,exon |
R7519 |
T11581 |
T11579 |
cc |
and,exon |
R7520 |
T11582 |
T11583 |
amod |
downstream,intron |
R7521 |
T11583 |
T11579 |
conj |
intron,exon |
R7522 |
T11584 |
T11556 |
punct |
.,subcloned |
R7523 |
T11586 |
T11587 |
det |
The,primer |
R7524 |
T11587 |
T11589 |
nsubj |
primer,contains |
R7525 |
T11588 |
T11587 |
amod |
forward,primer |
R7526 |
T11589 |
T11590 |
ccomp |
contains,is |
R7527 |
T11591 |
T11592 |
det |
the,end |
R7528 |
T11592 |
T11589 |
dobj |
end,contains |
R7529 |
T11593 |
T11592 |
nummod |
3,end |
R7530 |
T11594 |
T11593 |
punct |
′,3 |
R7531 |
T11595 |
T11592 |
prep |
of,end |
R7532 |
T11596 |
T11597 |
det |
the,exon |
R7533 |
T11597 |
T11595 |
pobj |
exon,of |
R7534 |
T11598 |
T11597 |
amod |
first,exon |
R7535 |
T11599 |
T11589 |
cc |
and,contains |
R7536 |
T11600 |
T11601 |
auxpass |
is,tailed |
R7537 |
T11601 |
T11589 |
conj |
tailed,contains |
R7538 |
T11602 |
T11601 |
prep |
with,tailed |
R7539 |
T11603 |
T11604 |
det |
a,site |
R7540 |
T11604 |
T11602 |
pobj |
site,with |
R7541 |
T11605 |
T11604 |
compound |
SpeI,site |
R7542 |
T11606 |
T11590 |
punct |
;,is |
R7543 |
T11607 |
T11608 |
det |
the,primer |
R7544 |
T11608 |
T11590 |
nsubj |
primer,is |
R7545 |
T11609 |
T11608 |
amod |
reverse,primer |
R7546 |
T11610 |
T11590 |
prep |
from,is |
R7547 |
T11611 |
T11612 |
det |
the,promoter |
R7548 |
T11612 |
T11610 |
pobj |
promoter,from |
R7549 |
T11613 |
T11612 |
compound |
T7,promoter |
R7550 |
T11614 |
T11612 |
prep |
of,promoter |
R7551 |
T11615 |
T11616 |
det |
the,vector |
R7552 |
T11616 |
T11614 |
pobj |
vector,of |
R7553 |
T11617 |
T11616 |
acl |
containing,vector |
R7554 |
T11618 |
T11619 |
det |
the,subclone |
R7555 |
T11619 |
T11617 |
dobj |
subclone,containing |
R7556 |
T11620 |
T11621 |
nummod |
0.9,kb |
R7557 |
T11621 |
T11619 |
compound |
kb,subclone |
R7558 |
T11622 |
T11621 |
punct |
-,kb |
R7559 |
T11623 |
T11590 |
cc |
and,is |
R7560 |
T11624 |
T11590 |
conj |
flanks,is |
R7561 |
T11625 |
T11626 |
det |
the,site |
R7562 |
T11626 |
T11624 |
dobj |
site,flanks |
R7563 |
T11627 |
T11628 |
amod |
intronic,XhoI |
R7564 |
T11628 |
T11626 |
compound |
XhoI,site |
R7565 |
T11629 |
T11630 |
punct |
(,GATTTCTAGAGTAATACGACTCACTATAGGGC |
R7566 |
T11630 |
T11626 |
parataxis |
GATTTCTAGAGTAATACGACTCACTATAGGGC,site |
R7567 |
T11631 |
T11632 |
amod |
forward,primer |
R7568 |
T11632 |
T11633 |
dep |
primer,CTAAACTAGTCACCAGCTTTATTGACAAAGG |
R7569 |
T11633 |
T11630 |
dep |
CTAAACTAGTCACCAGCTTTATTGACAAAGG,GATTTCTAGAGTAATACGACTCACTATAGGGC |
R7570 |
T11634 |
T11633 |
nummod |
5,CTAAACTAGTCACCAGCTTTATTGACAAAGG |
R7571 |
T11635 |
T11634 |
punct |
′,5 |
R7572 |
T11636 |
T11633 |
punct |
-,CTAAACTAGTCACCAGCTTTATTGACAAAGG |
R7573 |
T11637 |
T11633 |
punct |
-,CTAAACTAGTCACCAGCTTTATTGACAAAGG |
R7574 |
T11638 |
T11633 |
nummod |
3,CTAAACTAGTCACCAGCTTTATTGACAAAGG |
R7575 |
T11639 |
T11633 |
punct |
′,CTAAACTAGTCACCAGCTTTATTGACAAAGG |
R7576 |
T11640 |
T11630 |
punct |
;,GATTTCTAGAGTAATACGACTCACTATAGGGC |
R7577 |
T11641 |
T11630 |
amod |
reverse,GATTTCTAGAGTAATACGACTCACTATAGGGC |
R7578 |
T11642 |
T11630 |
nummod |
5,GATTTCTAGAGTAATACGACTCACTATAGGGC |
R7579 |
T11643 |
T11642 |
punct |
′,5 |
R7580 |
T11644 |
T11630 |
punct |
-,GATTTCTAGAGTAATACGACTCACTATAGGGC |
R7581 |
T11645 |
T11630 |
punct |
-,GATTTCTAGAGTAATACGACTCACTATAGGGC |
R7582 |
T11646 |
T11630 |
nummod |
3,GATTTCTAGAGTAATACGACTCACTATAGGGC |
R7583 |
T11647 |
T11630 |
punct |
′,GATTTCTAGAGTAATACGACTCACTATAGGGC |
R7584 |
T11648 |
T11630 |
punct |
),GATTTCTAGAGTAATACGACTCACTATAGGGC |
R7585 |
T11649 |
T11590 |
punct |
.,is |
R7586 |
T11651 |
T11652 |
det |
The,construct |
R7587 |
T11652 |
T11654 |
nsubjpass |
construct,built |
R7588 |
T11653 |
T11652 |
compound |
targeting,construct |
R7589 |
T11655 |
T11654 |
auxpass |
was,built |
R7590 |
T11656 |
T11654 |
cc |
and,built |
R7591 |
T11657 |
T11654 |
conj |
verified,built |
R7592 |
T11658 |
T11657 |
prep |
in,verified |
R7593 |
T11659 |
T11658 |
pobj |
pBSSK,in |
R7594 |
T11660 |
T11661 |
punct |
(,Stratagene |
R7595 |
T11661 |
T11659 |
parataxis |
Stratagene,pBSSK |
R7596 |
T11662 |
T11661 |
punct |
", ",Stratagene |
R7597 |
T11663 |
T11664 |
compound |
La,Jolla |
R7598 |
T11664 |
T11661 |
npadvmod |
Jolla,Stratagene |
R7599 |
T11665 |
T11661 |
punct |
", ",Stratagene |
R7600 |
T11666 |
T11661 |
npadvmod |
California,Stratagene |
R7601 |
T11667 |
T11661 |
punct |
", ",Stratagene |
R7602 |
T11668 |
T11669 |
compound |
United,States |
R7603 |
T11669 |
T11661 |
npadvmod |
States,Stratagene |
R7604 |
T11670 |
T11661 |
punct |
),Stratagene |
R7605 |
T11671 |
T11654 |
punct |
", ",built |
R7606 |
T11672 |
T11673 |
advmod |
then,digested |
R7607 |
T11673 |
T11654 |
conj |
digested,built |
R7608 |
T11674 |
T11673 |
prep |
with,digested |
R7609 |
T11675 |
T11674 |
pobj |
XhoI,with |
R7610 |
T11676 |
T11673 |
cc |
and,digested |
R7611 |
T11677 |
T11673 |
conj |
subcloned,digested |
R7612 |
T11678 |
T11677 |
prep |
into,subcloned |
R7613 |
T11679 |
T11678 |
pobj |
pSV1,into |
R7614 |
T11680 |
T11679 |
punct |
", ",pSV1 |
R7615 |
T11681 |
T11682 |
det |
the,vector |
R7616 |
T11682 |
T11679 |
appos |
vector,pSV1 |
R7617 |
T11683 |
T11682 |
acl |
used,vector |
R7618 |
T11684 |
T11683 |
prep |
for,used |
R7619 |
T11685 |
T11686 |
amod |
homologous,recombination |
R7620 |
T11686 |
T11684 |
pobj |
recombination,for |
R7621 |
T11687 |
T11688 |
punct |
(,Yang |
R7622 |
T11688 |
T11683 |
meta |
Yang,used |
R7623 |
T11689 |
T11688 |
nmod |
et,Yang |
R7624 |
T11690 |
T11688 |
nmod |
al.,Yang |
R7625 |
T11691 |
T11688 |
nummod |
1997,Yang |
R7626 |
T11692 |
T11688 |
punct |
),Yang |
R7627 |
T11693 |
T11654 |
punct |
.,built |
R7628 |
T11695 |
T11696 |
nmod |
Southern,blotting |
R7629 |
T11696 |
T11697 |
nmod |
blotting,analysis |
R7630 |
T11697 |
T11704 |
nsubj |
analysis,confirmed |
R7631 |
T11698 |
T11696 |
punct |
", ",blotting |
R7632 |
T11699 |
T11696 |
conj |
PCR,blotting |
R7633 |
T11700 |
T11699 |
punct |
", ",PCR |
R7634 |
T11701 |
T11699 |
cc |
and,PCR |
R7635 |
T11702 |
T11703 |
compound |
DNA,sequence |
R7636 |
T11703 |
T11699 |
conj |
sequence,PCR |
R7637 |
T11705 |
T11706 |
det |
the,construct |
R7638 |
T11706 |
T11709 |
nsubjpass |
construct,made |
R7639 |
T11707 |
T11706 |
amod |
appropriate,construct |
R7640 |
T11708 |
T11706 |
compound |
targeting,construct |
R7641 |
T11709 |
T11704 |
advcl |
made,confirmed |
R7642 |
T11710 |
T11706 |
cc |
and,construct |
R7643 |
T11711 |
T11712 |
compound |
BAC,modifications |
R7644 |
T11712 |
T11706 |
conj |
modifications,construct |
R7645 |
T11713 |
T11709 |
auxpass |
were,made |
R7646 |
T11714 |
T11715 |
punct |
(,data |
R7647 |
T11715 |
T11709 |
meta |
data,made |
R7648 |
T11716 |
T11715 |
amod |
unpublished,data |
R7649 |
T11717 |
T11715 |
punct |
),data |
R7650 |
T11718 |
T11704 |
punct |
.,confirmed |
R7651 |
T11720 |
T11721 |
mark |
Before,injected |
R7652 |
T11721 |
T11726 |
advcl |
injected,removed |
R7653 |
T11722 |
T11723 |
det |
the,BAC |
R7654 |
T11723 |
T11721 |
nsubjpass |
BAC,injected |
R7655 |
T11724 |
T11723 |
amod |
modified,BAC |
R7656 |
T11725 |
T11721 |
auxpass |
was,injected |
R7657 |
T11727 |
T11728 |
aux |
to,produce |
R7658 |
T11728 |
T11721 |
advcl |
produce,injected |
R7659 |
T11729 |
T11730 |
amod |
transgenic,animals |
R7660 |
T11730 |
T11728 |
dobj |
animals,produce |
R7661 |
T11731 |
T11726 |
punct |
", ",removed |
R7662 |
T11732 |
T11733 |
det |
a,site |
R7663 |
T11733 |
T11726 |
nsubjpass |
site,removed |
R7664 |
T11734 |
T11733 |
compound |
loxP,site |
R7665 |
T11735 |
T11733 |
relcl |
present,site |
R7666 |
T11736 |
T11735 |
prep |
in,present |
R7667 |
T11737 |
T11738 |
det |
the,vector |
R7668 |
T11738 |
T11736 |
pobj |
vector,in |
R7669 |
T11739 |
T11738 |
compound |
BAC,vector |
R7670 |
T11740 |
T11733 |
punct |
", ",site |
R7671 |
T11741 |
T11733 |
appos |
pBeloBAC11,site |
R7672 |
T11742 |
T11726 |
punct |
", ",removed |
R7673 |
T11743 |
T11726 |
auxpass |
was,removed |
R7674 |
T11744 |
T11745 |
aux |
to,prevent |
R7675 |
T11745 |
T11726 |
advcl |
prevent,removed |
R7676 |
T11746 |
T11747 |
det |
the,addition |
R7677 |
T11747 |
T11745 |
dobj |
addition,prevent |
R7678 |
T11748 |
T11747 |
prep |
of,addition |
R7679 |
T11749 |
T11750 |
amod |
undesired,sites |
R7680 |
T11750 |
T11748 |
pobj |
sites,of |
R7681 |
T11751 |
T11750 |
compound |
Cre,sites |
R7682 |
T11752 |
T11750 |
compound |
target,sites |
R7683 |
T11753 |
T11747 |
prep |
into,addition |
R7684 |
T11754 |
T11755 |
det |
the,genome |
R7685 |
T11755 |
T11753 |
pobj |
genome,into |
R7686 |
T11756 |
T11726 |
punct |
.,removed |
R7687 |
T11758 |
T11759 |
aux |
To,do |
R7688 |
T11759 |
T11760 |
advcl |
do,prepared |
R7689 |
T11761 |
T11759 |
dobj |
this,do |
R7690 |
T11762 |
T11760 |
punct |
", ",prepared |
R7691 |
T11763 |
T11764 |
compound |
BAC,DNA |
R7692 |
T11764 |
T11760 |
nsubjpass |
DNA,prepared |
R7693 |
T11765 |
T11760 |
auxpass |
was,prepared |
R7694 |
T11766 |
T11760 |
prep |
by,prepared |
R7695 |
T11767 |
T11768 |
compound |
CsCl,separation |
R7696 |
T11768 |
T11766 |
pobj |
separation,by |
R7697 |
T11769 |
T11760 |
punct |
", ",prepared |
R7698 |
T11770 |
T11760 |
conj |
digested,prepared |
R7699 |
T11771 |
T11770 |
prep |
with,digested |
R7700 |
T11772 |
T11771 |
pobj |
NotI,with |
R7701 |
T11773 |
T11774 |
aux |
to,free |
R7702 |
T11774 |
T11770 |
advcl |
free,digested |
R7703 |
T11775 |
T11776 |
det |
the,insert |
R7704 |
T11776 |
T11774 |
dobj |
insert,free |
R7705 |
T11777 |
T11774 |
prep |
from,free |
R7706 |
T11778 |
T11779 |
det |
the,vector |
R7707 |
T11779 |
T11777 |
pobj |
vector,from |
R7708 |
T11780 |
T11770 |
punct |
", ",digested |
R7709 |
T11781 |
T11770 |
cc |
and,digested |
R7710 |
T11782 |
T11783 |
dep |
size,fractionated |
R7711 |
T11783 |
T11770 |
conj |
fractionated,digested |
R7712 |
T11784 |
T11783 |
punct |
-,fractionated |
R7713 |
T11785 |
T11783 |
prep |
over,fractionated |
R7714 |
T11786 |
T11787 |
det |
a,gradient |
R7715 |
T11787 |
T11785 |
pobj |
gradient,over |
R7716 |
T11788 |
T11787 |
compound |
sucrose,gradient |
R7717 |
T11789 |
T11760 |
punct |
.,prepared |
R7718 |
T11791 |
T11792 |
nsubjpass |
Aliquots,run |
R7719 |
T11793 |
T11791 |
prep |
of,Aliquots |
R7720 |
T11794 |
T11793 |
pobj |
fractions,of |
R7721 |
T11795 |
T11792 |
auxpass |
were,run |
R7722 |
T11796 |
T11792 |
prep |
on,run |
R7723 |
T11797 |
T11798 |
det |
a,gel |
R7724 |
T11798 |
T11796 |
pobj |
gel,on |
R7725 |
T11799 |
T11800 |
compound |
pulse,field |
R7726 |
T11800 |
T11798 |
compound |
field,gel |
R7727 |
T11801 |
T11800 |
punct |
-,field |
R7728 |
T11802 |
T11792 |
cc |
and,run |
R7729 |
T11803 |
T11804 |
dep |
Southern,blotted |
R7730 |
T11804 |
T11792 |
conj |
blotted,run |
R7731 |
T11805 |
T11804 |
advcl |
using,blotted |
R7732 |
T11806 |
T11807 |
nmod |
vector,DNA |
R7733 |
T11807 |
T11805 |
dobj |
DNA,using |
R7734 |
T11808 |
T11806 |
punct |
-,vector |
R7735 |
T11809 |
T11806 |
amod |
specific,vector |
R7736 |
T11810 |
T11805 |
prep |
as,using |
R7737 |
T11811 |
T11812 |
det |
a,probe |
R7738 |
T11812 |
T11810 |
pobj |
probe,as |
R7739 |
T11813 |
T11792 |
punct |
.,run |
R7740 |
T11815 |
T11816 |
nsubjpass |
Fractions,dialyzed |
R7741 |
T11817 |
T11815 |
acl |
containing,Fractions |
R7742 |
T11818 |
T11819 |
amod |
unsheared,insert |
R7743 |
T11819 |
T11817 |
dobj |
insert,containing |
R7744 |
T11820 |
T11819 |
cc |
and,insert |
R7745 |
T11821 |
T11822 |
advmod |
almost,DNA |
R7746 |
T11822 |
T11819 |
conj |
DNA,insert |
R7747 |
T11823 |
T11822 |
det |
no,DNA |
R7748 |
T11824 |
T11822 |
amod |
detectable,DNA |
R7749 |
T11825 |
T11822 |
compound |
vector,DNA |
R7750 |
T11826 |
T11816 |
auxpass |
were,dialyzed |
R7751 |
T11827 |
T11816 |
prep |
in,dialyzed |
R7752 |
T11828 |
T11829 |
compound |
microinjection,buffer |
R7753 |
T11829 |
T11827 |
pobj |
buffer,in |
R7754 |
T11830 |
T11831 |
punct |
(,Tris |
R7755 |
T11831 |
T11829 |
parataxis |
Tris,buffer |
R7756 |
T11832 |
T11833 |
nummod |
10,mM |
R7757 |
T11833 |
T11831 |
compound |
mM,Tris |
R7758 |
T11834 |
T11831 |
punct |
[,Tris |
R7759 |
T11835 |
T11831 |
npadvmod |
pH,Tris |
R7760 |
T11836 |
T11835 |
nummod |
7.4,pH |
R7761 |
T11837 |
T11831 |
punct |
],Tris |
R7762 |
T11838 |
T11831 |
prep |
with,Tris |
R7763 |
T11839 |
T11840 |
nummod |
0.15,mM |
R7764 |
T11840 |
T11841 |
compound |
mM,EDTA |
R7765 |
T11841 |
T11838 |
pobj |
EDTA,with |
R7766 |
T11842 |
T11841 |
punct |
[,EDTA |
R7767 |
T11843 |
T11841 |
npadvmod |
pH,EDTA |
R7768 |
T11844 |
T11843 |
nummod |
8.0,pH |
R7769 |
T11845 |
T11841 |
punct |
],EDTA |
R7770 |
T11846 |
T11831 |
punct |
),Tris |
R7771 |
T11847 |
T11816 |
advcl |
using,dialyzed |
R7772 |
T11848 |
T11849 |
nmod |
Centriprep,concentrators |
R7773 |
T11849 |
T11847 |
dobj |
concentrators,using |
R7774 |
T11850 |
T11848 |
punct |
-,Centriprep |
R7775 |
T11851 |
T11848 |
nummod |
30,Centriprep |
R7776 |
T11852 |
T11853 |
punct |
(,Millipore |
R7777 |
T11853 |
T11849 |
parataxis |
Millipore,concentrators |
R7778 |
T11854 |
T11853 |
punct |
", ",Millipore |
R7779 |
T11855 |
T11853 |
npadvmod |
Billerica,Millipore |
R7780 |
T11856 |
T11853 |
punct |
", ",Millipore |
R7781 |
T11857 |
T11853 |
npadvmod |
Massachusetts,Millipore |
R7782 |
T11858 |
T11853 |
punct |
", ",Millipore |
R7783 |
T11859 |
T11860 |
compound |
United,States |
R7784 |
T11860 |
T11853 |
npadvmod |
States,Millipore |
R7785 |
T11861 |
T11853 |
punct |
),Millipore |
R7786 |
T11862 |
T11816 |
punct |
.,dialyzed |
R7787 |
T11864 |
T11865 |
det |
This,DNA |
R7788 |
T11865 |
T11868 |
nsubj |
DNA,adjusted |
R7789 |
T11866 |
T11865 |
amod |
purified,DNA |
R7790 |
T11867 |
T11865 |
compound |
insert,DNA |
R7791 |
T11869 |
T11868 |
aux |
was,adjusted |
R7792 |
T11870 |
T11868 |
prep |
to,adjusted |
R7793 |
T11871 |
T11872 |
nummod |
1,ng |
R7794 |
T11872 |
T11870 |
pobj |
ng,to |
R7795 |
T11873 |
T11874 |
punct |
/,μl |
R7796 |
T11874 |
T11872 |
prep |
μl,ng |
R7797 |
T11875 |
T11868 |
cc |
and,adjusted |
R7798 |
T11876 |
T11868 |
conj |
injected,adjusted |
R7799 |
T11877 |
T11876 |
prep |
into,injected |
R7800 |
T11878 |
T11879 |
det |
the,pronucleus |
R7801 |
T11879 |
T11877 |
pobj |
pronucleus,into |
R7802 |
T11880 |
T11879 |
prep |
of,pronucleus |
R7803 |
T11881 |
T11882 |
amod |
fertilized,eggs |
R7804 |
T11882 |
T11880 |
pobj |
eggs,of |
R7805 |
T11883 |
T11882 |
prep |
from,eggs |
R7806 |
T11884 |
T11885 |
compound |
FVB,N |
R7807 |
T11885 |
T11887 |
compound |
N,mice |
R7808 |
T11886 |
T11885 |
punct |
/,N |
R7809 |
T11887 |
T11883 |
pobj |
mice,from |
R7810 |
T11888 |
T11868 |
agent |
by,adjusted |
R7811 |
T11889 |
T11890 |
det |
the,Facility |
R7812 |
T11890 |
T11888 |
pobj |
Facility,by |
R7813 |
T11891 |
T11890 |
compound |
Stanford,Facility |
R7814 |
T11892 |
T11890 |
compound |
Transgenic,Facility |
R7815 |
T11893 |
T11868 |
punct |
.,adjusted |
R7816 |
T11895 |
T11896 |
amod |
Transgenic,mice |
R7817 |
T11896 |
T11898 |
nsubjpass |
mice,identified |
R7818 |
T11897 |
T11896 |
compound |
founder,mice |
R7819 |
T11899 |
T11898 |
auxpass |
were,identified |
R7820 |
T11900 |
T11898 |
prep |
by,identified |
R7821 |
T11901 |
T11900 |
pobj |
PCR,by |
R7822 |
T11902 |
T11901 |
acl |
using,PCR |
R7823 |
T11903 |
T11904 |
npadvmod |
Cre,specific |
R7824 |
T11904 |
T11906 |
amod |
specific,GCCTGCATTACCGGTCGATGCAACGA |
R7825 |
T11905 |
T11904 |
punct |
-,specific |
R7826 |
T11906 |
T11902 |
dobj |
GCCTGCATTACCGGTCGATGCAACGA,using |
R7827 |
T11907 |
T11906 |
nmod |
primers,GCCTGCATTACCGGTCGATGCAACGA |
R7828 |
T11908 |
T11906 |
nummod |
5,GCCTGCATTACCGGTCGATGCAACGA |
R7829 |
T11909 |
T11908 |
punct |
′,5 |
R7830 |
T11910 |
T11906 |
punct |
-,GCCTGCATTACCGGTCGATGCAACGA |
R7831 |
T11911 |
T11906 |
punct |
-,GCCTGCATTACCGGTCGATGCAACGA |
R7832 |
T11912 |
T11906 |
nummod |
3,GCCTGCATTACCGGTCGATGCAACGA |
R7833 |
T11913 |
T11906 |
punct |
′,GCCTGCATTACCGGTCGATGCAACGA |
R7834 |
T11914 |
T11906 |
cc |
and,GCCTGCATTACCGGTCGATGCAACGA |
R7835 |
T11915 |
T11916 |
nummod |
5,GTGGCAGATGGCGCGGCAACACCATT |
R7836 |
T11916 |
T11906 |
conj |
GTGGCAGATGGCGCGGCAACACCATT,GCCTGCATTACCGGTCGATGCAACGA |
R7837 |
T11917 |
T11915 |
punct |
′,5 |
R7838 |
T11918 |
T11916 |
punct |
-,GTGGCAGATGGCGCGGCAACACCATT |
R7839 |
T11919 |
T11916 |
punct |
-,GTGGCAGATGGCGCGGCAACACCATT |
R7840 |
T11920 |
T11916 |
nummod |
3,GTGGCAGATGGCGCGGCAACACCATT |
R7841 |
T11921 |
T11916 |
punct |
′,GTGGCAGATGGCGCGGCAACACCATT |
R7842 |
T11922 |
T11906 |
punct |
", ",GCCTGCATTACCGGTCGATGCAACGA |
R7843 |
T11923 |
T11924 |
dep |
which,amplify |
R7844 |
T11924 |
T11906 |
relcl |
amplify,GCCTGCATTACCGGTCGATGCAACGA |
R7845 |
T11925 |
T11926 |
det |
a,product |
R7846 |
T11926 |
T11924 |
dobj |
product,amplify |
R7847 |
T11927 |
T11928 |
nummod |
725,bp |
R7848 |
T11928 |
T11926 |
compound |
bp,product |
R7849 |
T11929 |
T11928 |
punct |
-,bp |
R7850 |
T11930 |
T11898 |
punct |
", ",identified |
R7851 |
T11931 |
T11898 |
cc |
and,identified |
R7852 |
T11932 |
T11933 |
auxpass |
were,assessed |
R7853 |
T11933 |
T11898 |
conj |
assessed,identified |
R7854 |
T11934 |
T11933 |
prep |
for,assessed |
R7855 |
T11935 |
T11934 |
pobj |
absence,for |
R7856 |
T11936 |
T11935 |
prep |
of,absence |
R7857 |
T11937 |
T11938 |
compound |
BAC,vector |
R7858 |
T11938 |
T11936 |
pobj |
vector,of |
R7859 |
T11939 |
T11933 |
advcl |
using,assessed |
R7860 |
T11940 |
T11941 |
nmod |
vector,primers |
R7861 |
T11941 |
T11939 |
dobj |
primers,using |
R7862 |
T11942 |
T11940 |
punct |
-,vector |
R7863 |
T11943 |
T11940 |
amod |
specific,vector |
R7864 |
T11944 |
T11945 |
nummod |
5,CGGAGTCTGATGCGGTTGCGATG |
R7865 |
T11945 |
T11941 |
appos |
CGGAGTCTGATGCGGTTGCGATG,primers |
R7866 |
T11946 |
T11944 |
punct |
′,5 |
R7867 |
T11947 |
T11945 |
punct |
-,CGGAGTCTGATGCGGTTGCGATG |
R7868 |
T11948 |
T11945 |
punct |
-,CGGAGTCTGATGCGGTTGCGATG |
R7869 |
T11949 |
T11945 |
nummod |
3,CGGAGTCTGATGCGGTTGCGATG |
R7870 |
T11950 |
T11945 |
punct |
′,CGGAGTCTGATGCGGTTGCGATG |
R7871 |
T11951 |
T11945 |
cc |
and,CGGAGTCTGATGCGGTTGCGATG |
R7872 |
T11952 |
T11953 |
nummod |
5,AGTGCTGTTCCCTGGTGCTTCCTC |
R7873 |
T11953 |
T11945 |
conj |
AGTGCTGTTCCCTGGTGCTTCCTC,CGGAGTCTGATGCGGTTGCGATG |
R7874 |
T11954 |
T11952 |
punct |
′,5 |
R7875 |
T11955 |
T11953 |
punct |
-,AGTGCTGTTCCCTGGTGCTTCCTC |
R7876 |
T11956 |
T11953 |
punct |
-,AGTGCTGTTCCCTGGTGCTTCCTC |
R7877 |
T11957 |
T11953 |
nummod |
3,AGTGCTGTTCCCTGGTGCTTCCTC |
R7878 |
T11958 |
T11953 |
punct |
′,AGTGCTGTTCCCTGGTGCTTCCTC |
R7879 |
T11959 |
T11941 |
punct |
", ",primers |
R7880 |
T11960 |
T11961 |
dep |
which,amplify |
R7881 |
T11961 |
T11941 |
relcl |
amplify,primers |
R7882 |
T11962 |
T11963 |
det |
a,product |
R7883 |
T11963 |
T11961 |
dobj |
product,amplify |
R7884 |
T11964 |
T11965 |
nummod |
465,bp |
R7885 |
T11965 |
T11963 |
compound |
bp,product |
R7886 |
T11966 |
T11965 |
punct |
-,bp |
R7887 |
T11967 |
T11898 |
punct |
.,identified |
R7888 |
T11969 |
T11970 |
nummod |
Three,lines |
R7889 |
T11970 |
T11971 |
nsubjpass |
lines,established |
R7890 |
T11972 |
T11970 |
prep |
of,lines |
R7891 |
T11973 |
T11974 |
compound |
Gdf5,Cre |
R7892 |
T11974 |
T11976 |
compound |
Cre,mice |
R7893 |
T11975 |
T11974 |
punct |
-,Cre |
R7894 |
T11976 |
T11972 |
pobj |
mice,of |
R7895 |
T11977 |
T11971 |
auxpass |
were,established |
R7896 |
T11978 |
T11971 |
cc |
and,established |
R7897 |
T11979 |
T11971 |
conj |
maintained,established |
R7898 |
T11980 |
T11979 |
prep |
on,maintained |
R7899 |
T11981 |
T11982 |
det |
the,background |
R7900 |
T11982 |
T11980 |
pobj |
background,on |
R7901 |
T11983 |
T11982 |
compound |
FVB,background |
R7902 |
T11984 |
T11971 |
punct |
.,established |
R7903 |
T11986 |
T11987 |
nsubjpass |
Matings,used |
R7904 |
T11988 |
T11986 |
prep |
with,Matings |
R7905 |
T11989 |
T11990 |
compound |
R26R,Cre |
R7906 |
T11990 |
T11991 |
npadvmod |
Cre,inducible |
R7907 |
T11991 |
T11993 |
amod |
inducible,mice |
R7908 |
T11992 |
T11991 |
punct |
-,inducible |
R7909 |
T11993 |
T11988 |
pobj |
mice,with |
R7910 |
T11994 |
T11995 |
compound |
LACZ,reporter |
R7911 |
T11995 |
T11993 |
compound |
reporter,mice |
R7912 |
T11996 |
T11997 |
punct |
(,Soriano |
R7913 |
T11997 |
T11993 |
meta |
Soriano,mice |
R7914 |
T11998 |
T11997 |
nummod |
1999,Soriano |
R7915 |
T11999 |
T11997 |
punct |
),Soriano |
R7916 |
T12000 |
T11987 |
auxpass |
were,used |
R7917 |
T12001 |
T12002 |
aux |
to,test |
R7918 |
T12002 |
T11987 |
advcl |
test,used |
R7919 |
T12003 |
T12002 |
prep |
for,test |
R7920 |
T12004 |
T12005 |
compound |
Cre,activity |
R7921 |
T12005 |
T12003 |
pobj |
activity,for |
R7922 |
T12006 |
T11987 |
punct |
.,used |
R7923 |
T12008 |
T12009 |
nsubjpass |
Staining,accomplished |
R7924 |
T12010 |
T12008 |
prep |
for,Staining |
R7925 |
T12011 |
T12010 |
pobj |
LACZ,for |
R7926 |
T12012 |
T12011 |
cc |
and,LACZ |
R7927 |
T12013 |
T12011 |
conj |
HPLAP,LACZ |
R7928 |
T12014 |
T12008 |
prep |
on,Staining |
R7929 |
T12015 |
T12016 |
amod |
whole,embryos |
R7930 |
T12016 |
T12014 |
pobj |
embryos,on |
R7931 |
T12017 |
T12016 |
cc |
or,embryos |
R7932 |
T12018 |
T12016 |
conj |
sections,embryos |
R7933 |
T12019 |
T12018 |
prep |
of,sections |
R7934 |
T12020 |
T12019 |
pobj |
embryos,of |
R7935 |
T12021 |
T12009 |
auxpass |
was,accomplished |
R7936 |
T12022 |
T12009 |
advcl |
following,accomplished |
R7937 |
T12023 |
T12024 |
amod |
established,protocols |
R7938 |
T12024 |
T12022 |
dobj |
protocols,following |
R7939 |
T12025 |
T12026 |
punct |
(,Lobe |
R7940 |
T12026 |
T12009 |
meta |
Lobe,accomplished |
R7941 |
T12027 |
T12026 |
nmod |
et,Lobe |
R7942 |
T12028 |
T12026 |
nmod |
al.,Lobe |
R7943 |
T12029 |
T12026 |
nummod |
1999,Lobe |
R7944 |
T12030 |
T12026 |
punct |
),Lobe |
R7945 |
T12031 |
T12009 |
punct |
.,accomplished |
R7946 |
T12033 |
T12034 |
det |
The,substrate |
R7947 |
T12034 |
T12037 |
nsubj |
substrate,is |
R7948 |
T12035 |
T12036 |
amod |
red,LACZ |
R7949 |
T12036 |
T12034 |
compound |
LACZ,substrate |
R7950 |
T12038 |
T12039 |
punct |
(,see |
R7951 |
T12039 |
T12034 |
parataxis |
see,substrate |
R7952 |
T12040 |
T12039 |
dobj |
Figure,see |
R7953 |
T12041 |
T12040 |
nummod |
1E,Figure |
R7954 |
T12042 |
T12039 |
punct |
),see |
R7955 |
T12043 |
T12044 |
nummod |
6,galactopyranoside |
R7956 |
T12044 |
T12037 |
attr |
galactopyranoside,is |
R7957 |
T12045 |
T12044 |
punct |
-,galactopyranoside |
R7958 |
T12046 |
T12044 |
nmod |
chloro,galactopyranoside |
R7959 |
T12047 |
T12044 |
punct |
-,galactopyranoside |
R7960 |
T12048 |
T12044 |
nummod |
3,galactopyranoside |
R7961 |
T12049 |
T12044 |
punct |
-,galactopyranoside |
R7962 |
T12050 |
T12044 |
compound |
indoxyl,galactopyranoside |
R7963 |
T12051 |
T12044 |
punct |
-,galactopyranoside |
R7964 |
T12052 |
T12044 |
compound |
beta,galactopyranoside |
R7965 |
T12053 |
T12044 |
punct |
-,galactopyranoside |
R7966 |
T12054 |
T12044 |
compound |
D,galactopyranoside |
R7967 |
T12055 |
T12044 |
punct |
-,galactopyranoside |
R7968 |
T12056 |
T12057 |
punct |
(,International |
R7969 |
T12057 |
T12037 |
parataxis |
International,is |
R7970 |
T12058 |
T12057 |
compound |
Biosynth,International |
R7971 |
T12059 |
T12057 |
punct |
", ",International |
R7972 |
T12060 |
T12057 |
npadvmod |
Naperville,International |
R7973 |
T12061 |
T12057 |
punct |
", ",International |
R7974 |
T12062 |
T12057 |
npadvmod |
Illinois,International |
R7975 |
T12063 |
T12057 |
punct |
", ",International |
R7976 |
T12064 |
T12065 |
compound |
United,States |
R7977 |
T12065 |
T12057 |
npadvmod |
States,International |
R7978 |
T12066 |
T12057 |
punct |
),International |
R7979 |
T12067 |
T12037 |
punct |
.,is |
R7980 |
T12177 |
T12178 |
amod |
General,characterization |
R7981 |
T12179 |
T12178 |
prep |
of,characterization |
R7982 |
T12180 |
T12181 |
npadvmod |
Bmpr1a,mutant |
R7983 |
T12181 |
T12182 |
amod |
mutant,mice |
R7984 |
T12182 |
T12179 |
pobj |
mice,of |
R7985 |
T12184 |
T12185 |
npadvmod |
Bmpr1a,null |
R7986 |
T12185 |
T12186 |
amod |
null,alleles |
R7987 |
T12186 |
T12189 |
nsubjpass |
alleles,obtained |
R7988 |
T12187 |
T12185 |
cc |
and,null |
R7989 |
T12188 |
T12185 |
conj |
floxed,null |
R7990 |
T12190 |
T12191 |
punct |
(,Ahn |
R7991 |
T12191 |
T12186 |
meta |
Ahn,alleles |
R7992 |
T12192 |
T12191 |
nmod |
et,Ahn |
R7993 |
T12193 |
T12191 |
nmod |
al.,Ahn |
R7994 |
T12194 |
T12191 |
nummod |
2001,Ahn |
R7995 |
T12195 |
T12191 |
punct |
;,Ahn |
R7996 |
T12196 |
T12191 |
nmod |
Mishina,Ahn |
R7997 |
T12197 |
T12191 |
nmod |
et,Ahn |
R7998 |
T12198 |
T12191 |
nmod |
al.,Ahn |
R7999 |
T12199 |
T12191 |
nummod |
2002,Ahn |
R8000 |
T12200 |
T12191 |
punct |
),Ahn |
R8001 |
T12201 |
T12189 |
auxpass |
were,obtained |
R8002 |
T12202 |
T12189 |
prep |
on,obtained |
R8003 |
T12203 |
T12204 |
det |
a,background |
R8004 |
T12204 |
T12202 |
pobj |
background,on |
R8005 |
T12205 |
T12204 |
amod |
mixed,background |
R8006 |
T12206 |
T12204 |
nummod |
129,background |
R8007 |
T12207 |
T12206 |
cc |
and,129 |
R8008 |
T12208 |
T12206 |
conj |
C57BL,129 |
R8009 |
T12209 |
T12208 |
punct |
/,C57BL |
R8010 |
T12210 |
T12208 |
nummod |
6,C57BL |
R8011 |
T12211 |
T12189 |
cc |
and,obtained |
R8012 |
T12212 |
T12189 |
conj |
maintained,obtained |
R8013 |
T12213 |
T12212 |
prep |
by,maintained |
R8014 |
T12214 |
T12215 |
amod |
random,breeding |
R8015 |
T12215 |
T12213 |
pobj |
breeding,by |
R8016 |
T12216 |
T12189 |
punct |
.,obtained |
R8017 |
T12218 |
T12219 |
nsubjpass |
Mice,mated |
R8018 |
T12220 |
T12218 |
acl |
carrying,Mice |
R8019 |
T12221 |
T12222 |
det |
the,alleles |
R8020 |
T12222 |
T12220 |
dobj |
alleles,carrying |
R8021 |
T12223 |
T12222 |
amod |
null,alleles |
R8022 |
T12224 |
T12223 |
cc |
and,null |
R8023 |
T12225 |
T12223 |
conj |
floxed,null |
R8024 |
T12226 |
T12219 |
auxpass |
were,mated |
R8025 |
T12227 |
T12219 |
advmod |
typically,mated |
R8026 |
T12228 |
T12219 |
prep |
to,mated |
R8027 |
T12229 |
T12230 |
compound |
Gdf5,Cre |
R8028 |
T12230 |
T12232 |
compound |
Cre,mice |
R8029 |
T12231 |
T12230 |
punct |
-,Cre |
R8030 |
T12232 |
T12228 |
pobj |
mice,to |
R8031 |
T12233 |
T12234 |
mark |
as,shown |
R8032 |
T12234 |
T12219 |
advcl |
shown,mated |
R8033 |
T12235 |
T12234 |
prep |
in,shown |
R8034 |
T12236 |
T12235 |
pobj |
Figure,in |
R8035 |
T12237 |
T12236 |
nummod |
3,Figure |
R8036 |
T12238 |
T12219 |
punct |
.,mated |
R8037 |
T12240 |
T12241 |
det |
The,mice |
R8038 |
T12241 |
T12243 |
nsubj |
mice,are |
R8039 |
T12242 |
T12241 |
amod |
resulting,mice |
R8040 |
T12244 |
T12243 |
prep |
on,are |
R8041 |
T12245 |
T12246 |
det |
a,background |
R8042 |
T12246 |
T12244 |
pobj |
background,on |
R8043 |
T12247 |
T12246 |
amod |
mixed,background |
R8044 |
T12248 |
T12246 |
nummod |
129,background |
R8045 |
T12249 |
T12248 |
punct |
;,129 |
R8046 |
T12250 |
T12248 |
appos |
C57Bl,129 |
R8047 |
T12251 |
T12250 |
punct |
/,C57Bl |
R8048 |
T12252 |
T12250 |
nummod |
6,C57Bl |
R8049 |
T12253 |
T12248 |
punct |
;,129 |
R8050 |
T12254 |
T12255 |
compound |
FVB,N |
R8051 |
T12255 |
T12248 |
appos |
N,129 |
R8052 |
T12256 |
T12255 |
punct |
/,N |
R8053 |
T12257 |
T12243 |
punct |
", ",are |
R8054 |
T12258 |
T12259 |
mark |
with,generated |
R8055 |
T12259 |
T12243 |
advcl |
generated,are |
R8056 |
T12260 |
T12261 |
preconj |
both,controls |
R8057 |
T12261 |
T12259 |
nsubj |
controls,generated |
R8058 |
T12262 |
T12261 |
cc |
and,controls |
R8059 |
T12263 |
T12264 |
compound |
mutant,animals |
R8060 |
T12264 |
T12261 |
conj |
animals,controls |
R8061 |
T12265 |
T12259 |
prep |
as,generated |
R8062 |
T12266 |
T12265 |
pobj |
littermates,as |
R8063 |
T12267 |
T12266 |
prep |
from,littermates |
R8064 |
T12268 |
T12269 |
det |
the,matings |
R8065 |
T12269 |
T12267 |
pobj |
matings,from |
R8066 |
T12270 |
T12269 |
amod |
same,matings |
R8067 |
T12271 |
T12243 |
punct |
.,are |
R8068 |
T12273 |
T12274 |
amod |
Whole,mount |
R8069 |
T12274 |
T12276 |
nmod |
mount,preparations |
R8070 |
T12275 |
T12274 |
punct |
-,mount |
R8071 |
T12276 |
T12278 |
nsubjpass |
preparations,made |
R8072 |
T12277 |
T12276 |
amod |
skeletal,preparations |
R8073 |
T12279 |
T12278 |
auxpass |
were,made |
R8074 |
T12280 |
T12278 |
prep |
from,made |
R8075 |
T12281 |
T12282 |
quantmod |
34,36 |
R8076 |
T12282 |
T12285 |
nummod |
36,d |
R8077 |
T12283 |
T12282 |
punct |
-,36 |
R8078 |
T12284 |
T12282 |
quantmod |
to,36 |
R8079 |
T12285 |
T12287 |
npadvmod |
d,old |
R8080 |
T12286 |
T12285 |
punct |
-,d |
R8081 |
T12287 |
T12289 |
amod |
old,mice |
R8082 |
T12288 |
T12287 |
punct |
-,old |
R8083 |
T12289 |
T12280 |
pobj |
mice,from |
R8084 |
T12290 |
T12291 |
punct |
(,Lufkin |
R8085 |
T12291 |
T12278 |
meta |
Lufkin,made |
R8086 |
T12292 |
T12291 |
nmod |
et,Lufkin |
R8087 |
T12293 |
T12291 |
nmod |
al.,Lufkin |
R8088 |
T12294 |
T12291 |
nummod |
1992,Lufkin |
R8089 |
T12295 |
T12291 |
punct |
),Lufkin |
R8090 |
T12296 |
T12278 |
punct |
.,made |
R8091 |
T12298 |
T12299 |
nsubjpass |
Pairs,removed |
R8092 |
T12300 |
T12298 |
prep |
of,Pairs |
R8093 |
T12301 |
T12300 |
pobj |
ears,of |
R8094 |
T12302 |
T12298 |
prep |
from,Pairs |
R8095 |
T12303 |
T12304 |
amod |
euthanized,animals |
R8096 |
T12304 |
T12302 |
pobj |
animals,from |
R8097 |
T12305 |
T12306 |
nummod |
6,mo |
R8098 |
T12306 |
T12308 |
npadvmod |
mo,old |
R8099 |
T12307 |
T12306 |
punct |
-,mo |
R8100 |
T12308 |
T12304 |
amod |
old,animals |
R8101 |
T12309 |
T12308 |
punct |
-,old |
R8102 |
T12310 |
T12299 |
auxpass |
were,removed |
R8103 |
T12311 |
T12299 |
punct |
", ",removed |
R8104 |
T12312 |
T12299 |
conj |
pinned,removed |
R8105 |
T12313 |
T12312 |
punct |
", ",pinned |
R8106 |
T12314 |
T12312 |
conj |
photographed,pinned |
R8107 |
T12315 |
T12314 |
punct |
", ",photographed |
R8108 |
T12316 |
T12314 |
conj |
projected,photographed |
R8109 |
T12317 |
T12316 |
punct |
", ",projected |
R8110 |
T12318 |
T12316 |
cc |
and,projected |
R8111 |
T12319 |
T12316 |
conj |
measured,projected |
R8112 |
T12320 |
T12319 |
prep |
from,measured |
R8113 |
T12321 |
T12322 |
det |
the,base |
R8114 |
T12322 |
T12320 |
pobj |
base,from |
R8115 |
T12323 |
T12322 |
prep |
of,base |
R8116 |
T12324 |
T12325 |
det |
the,curve |
R8117 |
T12325 |
T12323 |
pobj |
curve,of |
R8118 |
T12326 |
T12325 |
acl |
formed,curve |
R8119 |
T12327 |
T12326 |
prep |
between,formed |
R8120 |
T12328 |
T12329 |
det |
the,tragus |
R8121 |
T12329 |
T12327 |
pobj |
tragus,between |
R8122 |
T12330 |
T12329 |
cc |
and,tragus |
R8123 |
T12331 |
T12329 |
conj |
antitragus,tragus |
R8124 |
T12332 |
T12320 |
prep |
to,from |
R8125 |
T12333 |
T12334 |
det |
the,point |
R8126 |
T12334 |
T12332 |
pobj |
point,to |
R8127 |
T12335 |
T12334 |
amod |
farthest,point |
R8128 |
T12336 |
T12334 |
prep |
at,point |
R8129 |
T12337 |
T12338 |
det |
the,edge |
R8130 |
T12338 |
T12336 |
pobj |
edge,at |
R8131 |
T12339 |
T12338 |
prep |
of,edge |
R8132 |
T12340 |
T12341 |
det |
the,pinnae |
R8133 |
T12341 |
T12339 |
pobj |
pinnae,of |
R8134 |
T12342 |
T12299 |
punct |
.,removed |
R8135 |
T12344 |
T12345 |
compound |
Grasping,ability |
R8136 |
T12345 |
T12346 |
nsubjpass |
ability,measured |
R8137 |
T12347 |
T12345 |
prep |
in,ability |
R8138 |
T12348 |
T12349 |
nummod |
6,mo |
R8139 |
T12349 |
T12351 |
npadvmod |
mo,old |
R8140 |
T12350 |
T12349 |
punct |
-,mo |
R8141 |
T12351 |
T12353 |
amod |
old,mice |
R8142 |
T12352 |
T12351 |
punct |
-,old |
R8143 |
T12353 |
T12347 |
pobj |
mice,in |
R8144 |
T12354 |
T12346 |
auxpass |
was,measured |
R8145 |
T12355 |
T12346 |
prep |
by,measured |
R8146 |
T12356 |
T12355 |
pcomp |
placing,by |
R8147 |
T12357 |
T12356 |
dobj |
animals,placing |
R8148 |
T12358 |
T12356 |
prep |
on,placing |
R8149 |
T12359 |
T12360 |
det |
a,rod |
R8150 |
T12360 |
T12358 |
pobj |
rod,on |
R8151 |
T12361 |
T12360 |
amod |
slender,rod |
R8152 |
T12362 |
T12356 |
cc |
and,placing |
R8153 |
T12363 |
T12356 |
conj |
timing,placing |
R8154 |
T12364 |
T12365 |
advmod |
how,long |
R8155 |
T12365 |
T12366 |
advmod |
long,remain |
R8156 |
T12366 |
T12363 |
ccomp |
remain,timing |
R8157 |
T12367 |
T12366 |
nsubj |
they,remain |
R8158 |
T12368 |
T12366 |
aux |
could,remain |
R8159 |
T12369 |
T12366 |
oprd |
suspended,remain |
R8160 |
T12370 |
T12369 |
prep |
on,suspended |
R8161 |
T12371 |
T12372 |
det |
the,rod |
R8162 |
T12372 |
T12370 |
pobj |
rod,on |
R8163 |
T12373 |
T12363 |
punct |
", ",timing |
R8164 |
T12374 |
T12363 |
prep |
to,timing |
R8165 |
T12375 |
T12376 |
det |
a,time |
R8166 |
T12376 |
T12374 |
pobj |
time,to |
R8167 |
T12377 |
T12376 |
amod |
maximum,time |
R8168 |
T12378 |
T12376 |
acl |
allowed,time |
R8169 |
T12379 |
T12376 |
prep |
of,time |
R8170 |
T12380 |
T12381 |
nummod |
2,min |
R8171 |
T12381 |
T12379 |
pobj |
min,of |
R8172 |
T12382 |
T12346 |
punct |
.,measured |
R8173 |
T12384 |
T12385 |
nsubjpass |
Data,averaged |
R8174 |
T12386 |
T12384 |
prep |
from,Data |
R8175 |
T12387 |
T12388 |
nummod |
five,trials |
R8176 |
T12388 |
T12386 |
pobj |
trials,from |
R8177 |
T12389 |
T12388 |
amod |
consecutive,trials |
R8178 |
T12390 |
T12388 |
prep |
for,trials |
R8179 |
T12391 |
T12392 |
det |
each,mouse |
R8180 |
T12392 |
T12390 |
pobj |
mouse,for |
R8181 |
T12393 |
T12385 |
auxpass |
were,averaged |
R8182 |
T12394 |
T12385 |
punct |
.,averaged |
R8183 |
T12396 |
T12397 |
nmod |
Range,assays |
R8184 |
T12397 |
T12400 |
nsubjpass |
assays,conducted |
R8185 |
T12398 |
T12396 |
prep |
of,Range |
R8186 |
T12399 |
T12398 |
pobj |
motion,of |
R8187 |
T12401 |
T12400 |
auxpass |
were,conducted |
R8188 |
T12402 |
T12400 |
prep |
on,conducted |
R8189 |
T12403 |
T12404 |
det |
the,joints |
R8190 |
T12404 |
T12402 |
pobj |
joints,on |
R8191 |
T12405 |
T12406 |
nmod |
MT,P1 |
R8192 |
T12406 |
T12404 |
nmod |
P1,joints |
R8193 |
T12407 |
T12406 |
punct |
/,P1 |
R8194 |
T12408 |
T12406 |
cc |
and,P1 |
R8195 |
T12409 |
T12410 |
compound |
P1,P2 |
R8196 |
T12410 |
T12406 |
conj |
P2,P1 |
R8197 |
T12411 |
T12410 |
punct |
/,P2 |
R8198 |
T12412 |
T12404 |
prep |
of,joints |
R8199 |
T12413 |
T12414 |
det |
the,digit |
R8200 |
T12414 |
T12412 |
pobj |
digit,of |
R8201 |
T12415 |
T12414 |
amod |
second,digit |
R8202 |
T12416 |
T12414 |
compound |
hindlimb,digit |
R8203 |
T12417 |
T12404 |
prep |
from,joints |
R8204 |
T12418 |
T12419 |
amod |
euthanized,animals |
R8205 |
T12419 |
T12417 |
pobj |
animals,from |
R8206 |
T12420 |
T12421 |
nummod |
18,wk |
R8207 |
T12421 |
T12423 |
npadvmod |
wk,old |
R8208 |
T12422 |
T12421 |
punct |
-,wk |
R8209 |
T12423 |
T12419 |
amod |
old,animals |
R8210 |
T12424 |
T12423 |
punct |
-,old |
R8211 |
T12425 |
T12400 |
punct |
.,conducted |
R8212 |
T12427 |
T12428 |
nsubjpass |
Forceps,used |
R8213 |
T12429 |
T12428 |
auxpass |
were,used |
R8214 |
T12430 |
T12431 |
aux |
to,bend |
R8215 |
T12431 |
T12428 |
advcl |
bend,used |
R8216 |
T12432 |
T12433 |
det |
the,joint |
R8217 |
T12433 |
T12431 |
dobj |
joint,bend |
R8218 |
T12434 |
T12431 |
prep |
to,bend |
R8219 |
T12435 |
T12436 |
poss |
its,position |
R8220 |
T12436 |
T12434 |
pobj |
position,to |
R8221 |
T12437 |
T12436 |
amod |
natural,position |
R8222 |
T12438 |
T12436 |
compound |
stopping,position |
R8223 |
T12439 |
T12428 |
punct |
", ",used |
R8224 |
T12440 |
T12428 |
cc |
and,used |
R8225 |
T12441 |
T12442 |
det |
the,angle |
R8226 |
T12442 |
T12444 |
nsubjpass |
angle,measured |
R8227 |
T12443 |
T12442 |
amod |
resulting,angle |
R8228 |
T12444 |
T12428 |
conj |
measured,used |
R8229 |
T12445 |
T12444 |
auxpass |
was,measured |
R8230 |
T12446 |
T12444 |
prep |
to,measured |
R8231 |
T12447 |
T12448 |
det |
the,° |
R8232 |
T12448 |
T12446 |
pobj |
°,to |
R8233 |
T12449 |
T12448 |
amod |
nearest,° |
R8234 |
T12450 |
T12448 |
nummod |
10,° |
R8235 |
T12451 |
T12444 |
prep |
under,measured |
R8236 |
T12452 |
T12453 |
nummod |
12.5,magnification |
R8237 |
T12453 |
T12451 |
pobj |
magnification,under |
R8238 |
T12454 |
T12452 |
punct |
×,12.5 |
R8239 |
T12455 |
T12444 |
advcl |
using,measured |
R8240 |
T12456 |
T12457 |
det |
a,reticule |
R8241 |
T12457 |
T12455 |
dobj |
reticule,using |
R8242 |
T12458 |
T12459 |
nummod |
360,° |
R8243 |
T12459 |
T12457 |
compound |
°,reticule |
R8244 |
T12460 |
T12444 |
punct |
.,measured |
R8245 |
T12462 |
T12463 |
nsubj |
Analysis,occurred |
R8246 |
T12464 |
T12462 |
acl |
described,Analysis |
R8247 |
T12465 |
T12464 |
prep |
in,described |
R8248 |
T12466 |
T12467 |
det |
this,section |
R8249 |
T12467 |
T12465 |
pobj |
section,in |
R8250 |
T12468 |
T12463 |
prep |
on,occurred |
R8251 |
T12469 |
T12468 |
pobj |
animals,on |
R8252 |
T12470 |
T12469 |
acl |
lacking,animals |
R8253 |
T12471 |
T12470 |
dobj |
R26R,lacking |
R8254 |
T12472 |
T12463 |
punct |
.,occurred |
R8255 |
T12474 |
T12475 |
compound |
Control,mice |
R8256 |
T12475 |
T12476 |
nsubj |
mice,included |
R8257 |
T12477 |
T12478 |
det |
all,genotypes |
R8258 |
T12478 |
T12476 |
dobj |
genotypes,included |
R8259 |
T12479 |
T12478 |
amod |
nonmutant,genotypes |
R8260 |
T12480 |
T12478 |
acl |
generated,genotypes |
R8261 |
T12481 |
T12480 |
prep |
by,generated |
R8262 |
T12482 |
T12483 |
nsubj |
Parent,being |
R8263 |
T12483 |
T12481 |
pobj |
being,by |
R8264 |
T12484 |
T12482 |
nummod |
1,Parent |
R8265 |
T12485 |
T12483 |
acomp |
heterozygous,being |
R8266 |
T12486 |
T12485 |
prep |
for,heterozygous |
R8267 |
T12487 |
T12488 |
compound |
Gdf5,Cre |
R8268 |
T12488 |
T12486 |
pobj |
Cre,for |
R8269 |
T12489 |
T12488 |
punct |
-,Cre |
R8270 |
T12490 |
T12488 |
cc |
and,Cre |
R8271 |
T12491 |
T12488 |
conj |
Bmpr1anull,Cre |
R8272 |
T12492 |
T12483 |
cc |
and,being |
R8273 |
T12493 |
T12494 |
nsubj |
Parent,being |
R8274 |
T12494 |
T12483 |
conj |
being,being |
R8275 |
T12495 |
T12493 |
nummod |
2,Parent |
R8276 |
T12496 |
T12494 |
acomp |
heterozygous,being |
R8277 |
T12497 |
T12496 |
prep |
for,heterozygous |
R8278 |
T12498 |
T12497 |
pobj |
Bmpr1afloxP,for |
R8279 |
T12499 |
T12500 |
punct |
(,see |
R8280 |
T12500 |
T12494 |
parataxis |
see,being |
R8281 |
T12501 |
T12500 |
dobj |
Figure,see |
R8282 |
T12502 |
T12501 |
nummod |
3,Figure |
R8283 |
T12503 |
T12500 |
punct |
),see |
R8284 |
T12504 |
T12476 |
punct |
.,included |
R8285 |
T12506 |
T12507 |
det |
All,analysis |
R8286 |
T12507 |
T12509 |
nsubj |
analysis,used |
R8287 |
T12508 |
T12507 |
amod |
statistical,analysis |
R8288 |
T12510 |
T12511 |
det |
the,Student |
R8289 |
T12511 |
T12512 |
poss |
Student,test |
R8290 |
T12512 |
T12509 |
dobj |
test,used |
R8291 |
T12513 |
T12511 |
case |
's,Student |
R8292 |
T12514 |
T12512 |
compound |
t,test |
R8293 |
T12515 |
T12512 |
punct |
-,test |
R8294 |
T12516 |
T12512 |
cc |
or,test |
R8295 |
T12517 |
T12518 |
poss |
Welch,test |
R8296 |
T12518 |
T12512 |
conj |
test,test |
R8297 |
T12519 |
T12517 |
case |
's,Welch |
R8298 |
T12520 |
T12518 |
compound |
t,test |
R8299 |
T12521 |
T12518 |
punct |
-,test |
R8300 |
T12522 |
T12509 |
punct |
", ",used |
R8301 |
T12523 |
T12509 |
cc |
and,used |
R8302 |
T12524 |
T12525 |
nsubj |
values,are |
R8303 |
T12525 |
T12509 |
conj |
are,used |
R8304 |
T12526 |
T12524 |
acl |
listed,values |
R8305 |
T12527 |
T12525 |
attr |
mean,are |
R8306 |
T12528 |
T12527 |
punct |
±,mean |
R8307 |
T12529 |
T12530 |
amod |
standard,error |
R8308 |
T12530 |
T12527 |
appos |
error,mean |
R8309 |
T12531 |
T12530 |
prep |
of,error |
R8310 |
T12532 |
T12533 |
det |
the,mean |
R8311 |
T12533 |
T12531 |
pobj |
mean,of |
R8312 |
T12534 |
T12525 |
punct |
.,are |
R8319 |
T12651 |
T12652 |
compound |
Cell,death |
R8320 |
T12653 |
T12652 |
cc |
and,death |
R8321 |
T12654 |
T12655 |
compound |
proliferation,assays |
R8322 |
T12655 |
T12652 |
conj |
assays,death |
R8323 |
T12657 |
T12658 |
nsubjpass |
Limbs,dissected |
R8324 |
T12659 |
T12657 |
prep |
from,Limbs |
R8325 |
T12660 |
T12661 |
amod |
mutant,animals |
R8326 |
T12661 |
T12659 |
pobj |
animals,from |
R8327 |
T12662 |
T12660 |
cc |
and,mutant |
R8328 |
T12663 |
T12660 |
conj |
control,mutant |
R8329 |
T12664 |
T12657 |
prep |
at,Limbs |
R8330 |
T12665 |
T12664 |
pobj |
E13.5,at |
R8331 |
T12666 |
T12665 |
cc |
and,E13.5 |
R8332 |
T12667 |
T12665 |
conj |
E14.5,E13.5 |
R8333 |
T12668 |
T12658 |
auxpass |
were,dissected |
R8334 |
T12669 |
T12658 |
cc |
and,dissected |
R8335 |
T12670 |
T12658 |
conj |
frozen,dissected |
R8336 |
T12671 |
T12670 |
prep |
in,frozen |
R8337 |
T12672 |
T12671 |
pobj |
OCT,in |
R8338 |
T12673 |
T12674 |
punct |
(,Finetek |
R8339 |
T12674 |
T12670 |
parataxis |
Finetek,frozen |
R8340 |
T12675 |
T12674 |
compound |
Sakura,Finetek |
R8341 |
T12676 |
T12674 |
punct |
",",Finetek |
R8342 |
T12677 |
T12674 |
npadvmod |
Torrence,Finetek |
R8343 |
T12678 |
T12674 |
punct |
", ",Finetek |
R8344 |
T12679 |
T12674 |
npadvmod |
CA,Finetek |
R8345 |
T12680 |
T12674 |
punct |
", ",Finetek |
R8346 |
T12681 |
T12682 |
compound |
United,States |
R8347 |
T12682 |
T12674 |
npadvmod |
States,Finetek |
R8348 |
T12683 |
T12674 |
punct |
),Finetek |
R8349 |
T12684 |
T12658 |
punct |
.,dissected |
R8350 |
T12686 |
T12687 |
nsubjpass |
Cryosections,assayed |
R8351 |
T12688 |
T12686 |
prep |
of,Cryosections |
R8352 |
T12689 |
T12688 |
pobj |
tissue,of |
R8353 |
T12690 |
T12687 |
auxpass |
were,assayed |
R8354 |
T12691 |
T12687 |
prep |
by,assayed |
R8355 |
T12692 |
T12691 |
pobj |
TUNEL,by |
R8356 |
T12693 |
T12687 |
advcl |
using,assayed |
R8357 |
T12694 |
T12695 |
det |
the,Kit |
R8358 |
T12695 |
T12693 |
dobj |
Kit,using |
R8359 |
T12696 |
T12697 |
advmod |
In,Situ |
R8360 |
T12697 |
T12698 |
amod |
Situ,Detection |
R8361 |
T12698 |
T12695 |
compound |
Detection,Kit |
R8362 |
T12699 |
T12700 |
compound |
Cell,Death |
R8363 |
T12700 |
T12698 |
compound |
Death,Detection |
R8364 |
T12701 |
T12695 |
punct |
", ",Kit |
R8365 |
T12702 |
T12695 |
npadvmod |
Fluorescein,Kit |
R8366 |
T12703 |
T12702 |
punct |
(,Fluorescein |
R8367 |
T12704 |
T12702 |
npadvmod |
Roche,Fluorescein |
R8368 |
T12705 |
T12702 |
punct |
", ",Fluorescein |
R8369 |
T12706 |
T12702 |
npadvmod |
Basel,Fluorescein |
R8370 |
T12707 |
T12702 |
punct |
", ",Fluorescein |
R8371 |
T12708 |
T12702 |
npadvmod |
Switzerland,Fluorescein |
R8372 |
T12709 |
T12702 |
punct |
),Fluorescein |
R8373 |
T12710 |
T12687 |
punct |
.,assayed |
R8374 |
T12712 |
T12713 |
prep |
Following,washed |
R8375 |
T12714 |
T12712 |
pobj |
TUNEL,Following |
R8376 |
T12715 |
T12713 |
punct |
", ",washed |
R8377 |
T12716 |
T12713 |
nsubjpass |
slides,washed |
R8378 |
T12717 |
T12713 |
auxpass |
were,washed |
R8379 |
T12718 |
T12713 |
prep |
in,washed |
R8380 |
T12719 |
T12718 |
pobj |
PBS,in |
R8381 |
T12720 |
T12713 |
punct |
", ",washed |
R8382 |
T12721 |
T12713 |
conj |
blocked,washed |
R8383 |
T12722 |
T12721 |
prep |
with,blocked |
R8384 |
T12723 |
T12722 |
pobj |
PBS,with |
R8385 |
T12724 |
T12723 |
punct |
+,PBS |
R8386 |
T12725 |
T12726 |
nummod |
0.05,% |
R8387 |
T12726 |
T12727 |
compound |
%,Tween |
R8388 |
T12727 |
T12723 |
appos |
Tween,PBS |
R8389 |
T12728 |
T12727 |
punct |
-,Tween |
R8390 |
T12729 |
T12727 |
nummod |
20,Tween |
R8391 |
T12730 |
T12723 |
punct |
+,PBS |
R8392 |
T12731 |
T12732 |
nummod |
5,% |
R8393 |
T12732 |
T12733 |
compound |
%,serum |
R8394 |
T12733 |
T12723 |
appos |
serum,PBS |
R8395 |
T12734 |
T12733 |
compound |
goat,serum |
R8396 |
T12735 |
T12721 |
punct |
", ",blocked |
R8397 |
T12736 |
T12721 |
conj |
washed,blocked |
R8398 |
T12737 |
T12736 |
advmod |
again,washed |
R8399 |
T12738 |
T12736 |
punct |
", ",washed |
R8400 |
T12739 |
T12736 |
cc |
and,washed |
R8401 |
T12740 |
T12736 |
conj |
incubated,washed |
R8402 |
T12741 |
T12740 |
prep |
with,incubated |
R8403 |
T12742 |
T12743 |
det |
a,dilution |
R8404 |
T12743 |
T12741 |
pobj |
dilution,with |
R8405 |
T12744 |
T12743 |
nummod |
1,dilution |
R8406 |
T12745 |
T12746 |
punct |
:,200 |
R8407 |
T12746 |
T12744 |
prep |
200,1 |
R8408 |
T12747 |
T12743 |
prep |
of,dilution |
R8409 |
T12748 |
T12749 |
det |
a,antibody |
R8410 |
T12749 |
T12747 |
pobj |
antibody,of |
R8411 |
T12750 |
T12749 |
nmod |
rabbit,antibody |
R8412 |
T12751 |
T12752 |
amod |
anti-phospho-histone,H3 |
R8413 |
T12752 |
T12749 |
compound |
H3,antibody |
R8414 |
T12753 |
T12752 |
punct |
-,H3 |
R8415 |
T12754 |
T12749 |
acl |
called,antibody |
R8416 |
T12755 |
T12756 |
compound |
Mitosis,Marker |
R8417 |
T12756 |
T12754 |
oprd |
Marker,called |
R8418 |
T12757 |
T12758 |
punct |
(,Biotechnology |
R8419 |
T12758 |
T12756 |
parataxis |
Biotechnology,Marker |
R8420 |
T12759 |
T12758 |
compound |
Upstate,Biotechnology |
R8421 |
T12760 |
T12758 |
punct |
", ",Biotechnology |
R8422 |
T12761 |
T12762 |
compound |
Lake,Placid |
R8423 |
T12762 |
T12758 |
npadvmod |
Placid,Biotechnology |
R8424 |
T12763 |
T12758 |
punct |
", ",Biotechnology |
R8425 |
T12764 |
T12765 |
compound |
New,York |
R8426 |
T12765 |
T12758 |
npadvmod |
York,Biotechnology |
R8427 |
T12766 |
T12758 |
punct |
", ",Biotechnology |
R8428 |
T12767 |
T12768 |
compound |
United,States |
R8429 |
T12768 |
T12758 |
npadvmod |
States,Biotechnology |
R8430 |
T12769 |
T12758 |
punct |
),Biotechnology |
R8431 |
T12770 |
T12771 |
aux |
to,identify |
R8432 |
T12771 |
T12740 |
advcl |
identify,incubated |
R8433 |
T12772 |
T12771 |
dobj |
cells,identify |
R8434 |
T12773 |
T12772 |
prep |
in,cells |
R8435 |
T12774 |
T12773 |
pobj |
mitosis,in |
R8436 |
T12775 |
T12713 |
punct |
.,washed |
R8437 |
T12777 |
T12778 |
npadvmod |
Cy3,labeled |
R8438 |
T12778 |
T12780 |
amod |
labeled,antibody |
R8439 |
T12779 |
T12778 |
punct |
-,labeled |
R8440 |
T12780 |
T12783 |
nsubjpass |
antibody,used |
R8441 |
T12781 |
T12780 |
amod |
anti-rabbit,antibody |
R8442 |
T12782 |
T12780 |
amod |
secondary,antibody |
R8443 |
T12784 |
T12783 |
auxpass |
was,used |
R8444 |
T12785 |
T12786 |
aux |
to,detect |
R8445 |
T12786 |
T12783 |
advcl |
detect,used |
R8446 |
T12787 |
T12788 |
det |
the,antibody |
R8447 |
T12788 |
T12786 |
dobj |
antibody,detect |
R8448 |
T12789 |
T12783 |
punct |
.,used |
R8449 |
T12791 |
T12792 |
compound |
Cell,nuclei |
R8450 |
T12792 |
T12793 |
nsubjpass |
nuclei,labeled |
R8451 |
T12794 |
T12793 |
auxpass |
were,labeled |
R8452 |
T12795 |
T12793 |
prep |
with,labeled |
R8453 |
T12796 |
T12795 |
pobj |
DAPI,with |
R8454 |
T12797 |
T12793 |
punct |
", ",labeled |
R8455 |
T12798 |
T12793 |
cc |
and,labeled |
R8456 |
T12799 |
T12800 |
nsubjpass |
slides,mounted |
R8457 |
T12800 |
T12793 |
conj |
mounted,labeled |
R8458 |
T12801 |
T12800 |
auxpass |
were,mounted |
R8459 |
T12802 |
T12800 |
prep |
in,mounted |
R8460 |
T12803 |
T12802 |
pobj |
Vectamount,in |
R8461 |
T12804 |
T12805 |
punct |
(,Laboratories |
R8462 |
T12805 |
T12803 |
parataxis |
Laboratories,Vectamount |
R8463 |
T12806 |
T12805 |
compound |
Vector,Laboratories |
R8464 |
T12807 |
T12805 |
punct |
", ",Laboratories |
R8465 |
T12808 |
T12805 |
npadvmod |
Burlingame,Laboratories |
R8466 |
T12809 |
T12805 |
punct |
", ",Laboratories |
R8467 |
T12810 |
T12805 |
npadvmod |
California,Laboratories |
R8468 |
T12811 |
T12805 |
punct |
", ",Laboratories |
R8469 |
T12812 |
T12813 |
compound |
United,States |
R8470 |
T12813 |
T12805 |
npadvmod |
States,Laboratories |
R8471 |
T12814 |
T12805 |
punct |
),Laboratories |
R8472 |
T12815 |
T12800 |
cc |
and,mounted |
R8473 |
T12816 |
T12800 |
conj |
visualized,mounted |
R8474 |
T12817 |
T12816 |
prep |
at,visualized |
R8475 |
T12818 |
T12819 |
nummod |
100,magnification |
R8476 |
T12819 |
T12817 |
pobj |
magnification,at |
R8477 |
T12820 |
T12818 |
punct |
×,100 |
R8478 |
T12821 |
T12800 |
punct |
.,mounted |
R8479 |
T12823 |
T12824 |
det |
The,area |
R8480 |
T12824 |
T12825 |
nsubjpass |
area,measured |
R8481 |
T12826 |
T12824 |
prep |
of,area |
R8482 |
T12827 |
T12828 |
amod |
selected,sites |
R8483 |
T12828 |
T12826 |
pobj |
sites,of |
R8484 |
T12829 |
T12828 |
amod |
anatomical,sites |
R8485 |
T12830 |
T12825 |
auxpass |
were,measured |
R8486 |
T12831 |
T12825 |
punct |
", ",measured |
R8487 |
T12832 |
T12825 |
cc |
and,measured |
R8488 |
T12833 |
T12834 |
det |
the,number |
R8489 |
T12834 |
T12835 |
nsubjpass |
number,counted |
R8490 |
T12835 |
T12825 |
conj |
counted,measured |
R8491 |
T12836 |
T12834 |
prep |
of,number |
R8492 |
T12837 |
T12838 |
npadvmod |
TUNEL,labeled |
R8493 |
T12838 |
T12840 |
amod |
labeled,fragments |
R8494 |
T12839 |
T12838 |
punct |
-,labeled |
R8495 |
T12840 |
T12836 |
pobj |
fragments,of |
R8496 |
T12841 |
T12840 |
amod |
nuclear,fragments |
R8497 |
T12842 |
T12834 |
cc |
and,number |
R8498 |
T12843 |
T12844 |
det |
the,number |
R8499 |
T12844 |
T12834 |
conj |
number,number |
R8500 |
T12845 |
T12844 |
prep |
of,number |
R8501 |
T12846 |
T12847 |
npadvmod |
Cy3,labeled |
R8502 |
T12847 |
T12849 |
amod |
labeled,nuclei |
R8503 |
T12848 |
T12847 |
punct |
-,labeled |
R8504 |
T12849 |
T12845 |
pobj |
nuclei,of |
R8505 |
T12850 |
T12835 |
auxpass |
were,counted |
R8506 |
T12851 |
T12835 |
prep |
from,counted |
R8507 |
T12852 |
T12853 |
nummod |
three,sections |
R8508 |
T12853 |
T12851 |
pobj |
sections,from |
R8509 |
T12854 |
T12855 |
nummod |
10,μm |
R8510 |
T12855 |
T12853 |
compound |
μm,sections |
R8511 |
T12856 |
T12855 |
punct |
-,μm |
R8512 |
T12857 |
T12853 |
acl |
spanning,sections |
R8513 |
T12858 |
T12859 |
nummod |
50,μm |
R8514 |
T12859 |
T12857 |
dobj |
μm,spanning |
R8515 |
T12860 |
T12853 |
punct |
", ",sections |
R8516 |
T12861 |
T12853 |
prep |
from,sections |
R8517 |
T12862 |
T12863 |
nummod |
three,control |
R8518 |
T12863 |
T12861 |
pobj |
control,from |
R8519 |
T12864 |
T12863 |
cc |
and,control |
R8520 |
T12865 |
T12866 |
nummod |
three,mutant |
R8521 |
T12866 |
T12867 |
compound |
mutant,animals |
R8522 |
T12867 |
T12863 |
conj |
animals,control |
R8523 |
T12868 |
T12835 |
punct |
.,counted |
R8524 |
T12870 |
T12871 |
det |
The,number |
R8525 |
T12871 |
T12872 |
nsubjpass |
number,counted |
R8526 |
T12873 |
T12871 |
prep |
of,number |
R8527 |
T12874 |
T12875 |
amod |
labeled,cells |
R8528 |
T12875 |
T12873 |
pobj |
cells,of |
R8529 |
T12876 |
T12871 |
prep |
in,number |
R8530 |
T12877 |
T12878 |
det |
the,joints |
R8531 |
T12878 |
T12876 |
pobj |
joints,in |
R8532 |
T12879 |
T12880 |
amod |
metacarpal,phalangeal |
R8533 |
T12880 |
T12878 |
amod |
phalangeal,joints |
R8534 |
T12881 |
T12880 |
punct |
-,phalangeal |
R8535 |
T12882 |
T12880 |
cc |
and,phalangeal |
R8536 |
T12883 |
T12884 |
amod |
metatarsal,phalangeal |
R8537 |
T12884 |
T12880 |
conj |
phalangeal,phalangeal |
R8538 |
T12885 |
T12884 |
punct |
-,phalangeal |
R8539 |
T12886 |
T12872 |
auxpass |
was,counted |
R8540 |
T12887 |
T12872 |
prep |
in,counted |
R8541 |
T12888 |
T12889 |
det |
a,rectangle |
R8542 |
T12889 |
T12887 |
pobj |
rectangle,in |
R8543 |
T12890 |
T12891 |
nummod |
290,μm |
R8544 |
T12891 |
T12889 |
nmod |
μm,rectangle |
R8545 |
T12892 |
T12893 |
punct |
×,μm |
R8546 |
T12893 |
T12891 |
prep |
μm,μm |
R8547 |
T12894 |
T12893 |
nummod |
365,μm |
R8548 |
T12895 |
T12889 |
acl |
placed,rectangle |
R8549 |
T12896 |
T12895 |
prep |
around,placed |
R8550 |
T12897 |
T12898 |
det |
the,center |
R8551 |
T12898 |
T12896 |
pobj |
center,around |
R8552 |
T12899 |
T12898 |
prep |
of,center |
R8553 |
T12900 |
T12901 |
det |
the,joint |
R8554 |
T12901 |
T12899 |
pobj |
joint,of |
R8555 |
T12902 |
T12872 |
punct |
.,counted |
R8556 |
T12904 |
T12905 |
det |
The,region |
R8557 |
T12905 |
T12907 |
nsubjpass |
region,defined |
R8558 |
T12906 |
T12905 |
amod |
posterior,region |
R8559 |
T12908 |
T12905 |
prep |
of,region |
R8560 |
T12909 |
T12910 |
det |
the,digit |
R8561 |
T12910 |
T12908 |
pobj |
digit,of |
R8562 |
T12911 |
T12910 |
amod |
fifth,digit |
R8563 |
T12912 |
T12907 |
auxpass |
was,defined |
R8564 |
T12913 |
T12907 |
prep |
by,defined |
R8565 |
T12914 |
T12913 |
pcomp |
drawing,by |
R8566 |
T12915 |
T12916 |
det |
a,line |
R8567 |
T12916 |
T12914 |
dobj |
line,drawing |
R8568 |
T12917 |
T12914 |
prep |
from,drawing |
R8569 |
T12918 |
T12919 |
det |
the,tip |
R8570 |
T12919 |
T12917 |
pobj |
tip,from |
R8571 |
T12920 |
T12919 |
prep |
of,tip |
R8572 |
T12921 |
T12922 |
det |
the,digit |
R8573 |
T12922 |
T12920 |
pobj |
digit,of |
R8574 |
T12923 |
T12914 |
prep |
down,drawing |
R8575 |
T12924 |
T12925 |
nummod |
2.15,mm |
R8576 |
T12925 |
T12923 |
pobj |
mm,down |
R8577 |
T12926 |
T12923 |
cc |
and,down |
R8578 |
T12927 |
T12923 |
conj |
across,down |
R8579 |
T12928 |
T12927 |
prep |
to,across |
R8580 |
T12929 |
T12930 |
det |
the,edge |
R8581 |
T12930 |
T12928 |
pobj |
edge,to |
R8582 |
T12931 |
T12930 |
amod |
lateral,edge |
R8583 |
T12932 |
T12930 |
prep |
of,edge |
R8584 |
T12933 |
T12934 |
det |
the,tissue |
R8585 |
T12934 |
T12932 |
pobj |
tissue,of |
R8586 |
T12935 |
T12907 |
punct |
.,defined |
R8587 |
T12937 |
T12938 |
prep |
For,was |
R8588 |
T12939 |
T12940 |
det |
this,analysis |
R8589 |
T12940 |
T12937 |
pobj |
analysis,For |
R8590 |
T12941 |
T12938 |
punct |
", ",was |
R8591 |
T12942 |
T12943 |
det |
the,reporter |
R8592 |
T12943 |
T12938 |
nsubj |
reporter,was |
R8593 |
T12944 |
T12945 |
compound |
R26R,Cre |
R8594 |
T12945 |
T12943 |
compound |
Cre,reporter |
R8595 |
T12946 |
T12938 |
neg |
not,was |
R8596 |
T12947 |
T12938 |
acomp |
present,was |
R8597 |
T12948 |
T12938 |
punct |
.,was |
R8598 |
T13138 |
T13137 |
cc |
and,Histology |
R8599 |
T13139 |
T13137 |
conj |
histochemistry,Histology |
R8600 |
T13141 |
T13142 |
nsubjpass |
Tissue,prepared |
R8601 |
T13143 |
T13141 |
prep |
from,Tissue |
R8602 |
T13144 |
T13143 |
pobj |
animals,from |
R8603 |
T13145 |
T13144 |
acl |
ranging,animals |
R8604 |
T13146 |
T13145 |
prep |
from,ranging |
R8605 |
T13147 |
T13148 |
compound |
stages,E14.5 |
R8606 |
T13148 |
T13146 |
pobj |
E14.5,from |
R8607 |
T13149 |
T13146 |
prep |
to,from |
R8608 |
T13150 |
T13149 |
pobj |
P14,to |
R8609 |
T13151 |
T13142 |
auxpass |
was,prepared |
R8610 |
T13152 |
T13142 |
prep |
for,prepared |
R8611 |
T13153 |
T13152 |
pobj |
analysis,for |
R8612 |
T13154 |
T13142 |
prep |
by,prepared |
R8613 |
T13155 |
T13154 |
pcomp |
fixing,by |
R8614 |
T13156 |
T13155 |
prep |
in,fixing |
R8615 |
T13157 |
T13158 |
nummod |
4,% |
R8616 |
T13158 |
T13159 |
compound |
%,paraformaldehyde |
R8617 |
T13159 |
T13156 |
pobj |
paraformaldehyde,in |
R8618 |
T13160 |
T13161 |
punct |
(,PFA |
R8619 |
T13161 |
T13159 |
parataxis |
PFA,paraformaldehyde |
R8620 |
T13162 |
T13161 |
punct |
),PFA |
R8621 |
T13163 |
T13159 |
prep |
in,paraformaldehyde |
R8622 |
T13164 |
T13163 |
pobj |
PBS,in |
R8623 |
T13165 |
T13155 |
prep |
for,fixing |
R8624 |
T13166 |
T13167 |
nummod |
45,min |
R8625 |
T13167 |
T13165 |
pobj |
min,for |
R8626 |
T13168 |
T13167 |
prep |
to,min |
R8627 |
T13169 |
T13170 |
nummod |
4,h |
R8628 |
T13170 |
T13168 |
pobj |
h,to |
R8629 |
T13171 |
T13167 |
prep |
depending,min |
R8630 |
T13172 |
T13171 |
prep |
on,depending |
R8631 |
T13173 |
T13174 |
det |
the,stage |
R8632 |
T13174 |
T13172 |
pobj |
stage,on |
R8633 |
T13175 |
T13155 |
punct |
;,fixing |
R8634 |
T13176 |
T13155 |
conj |
washing,fixing |
R8635 |
T13177 |
T13178 |
nummod |
three,times |
R8636 |
T13178 |
T13176 |
npadvmod |
times,washing |
R8637 |
T13179 |
T13176 |
prep |
in,washing |
R8638 |
T13180 |
T13179 |
pobj |
PBS,in |
R8639 |
T13181 |
T13176 |
punct |
", ",washing |
R8640 |
T13182 |
T13176 |
conj |
once,washing |
R8641 |
T13183 |
T13182 |
prep |
in,once |
R8642 |
T13184 |
T13183 |
pobj |
PBS,in |
R8643 |
T13185 |
T13184 |
punct |
+,PBS |
R8644 |
T13186 |
T13187 |
nummod |
15,% |
R8645 |
T13187 |
T13188 |
compound |
%,sucrose |
R8646 |
T13188 |
T13184 |
appos |
sucrose,PBS |
R8647 |
T13189 |
T13182 |
prep |
for,once |
R8648 |
T13190 |
T13191 |
nummod |
1,h |
R8649 |
T13191 |
T13189 |
pobj |
h,for |
R8650 |
T13192 |
T13182 |
punct |
", ",once |
R8651 |
T13193 |
T13182 |
cc |
and,once |
R8652 |
T13194 |
T13182 |
conj |
once,once |
R8653 |
T13195 |
T13194 |
prep |
in,once |
R8654 |
T13196 |
T13195 |
pobj |
PBS,in |
R8655 |
T13197 |
T13196 |
punct |
+,PBS |
R8656 |
T13198 |
T13199 |
nummod |
30,% |
R8657 |
T13199 |
T13200 |
compound |
%,sucrose |
R8658 |
T13200 |
T13196 |
appos |
sucrose,PBS |
R8659 |
T13201 |
T13194 |
prep |
for,once |
R8660 |
T13202 |
T13203 |
nummod |
2,h |
R8661 |
T13203 |
T13201 |
pobj |
h,for |
R8662 |
T13204 |
T13203 |
prep |
to,h |
R8663 |
T13205 |
T13204 |
pobj |
overnight,to |
R8664 |
T13206 |
T13203 |
prep |
depending,h |
R8665 |
T13207 |
T13206 |
prep |
on,depending |
R8666 |
T13208 |
T13209 |
det |
the,stage |
R8667 |
T13209 |
T13207 |
pobj |
stage,on |
R8668 |
T13210 |
T13176 |
punct |
;,washing |
R8669 |
T13211 |
T13176 |
cc |
and,washing |
R8670 |
T13212 |
T13213 |
advmod |
then,freezing |
R8671 |
T13213 |
T13176 |
conj |
freezing,washing |
R8672 |
T13214 |
T13213 |
prep |
in,freezing |
R8673 |
T13215 |
T13214 |
pobj |
OCT,in |
R8674 |
T13216 |
T13142 |
punct |
.,prepared |
R8675 |
T13218 |
T13219 |
nsubjpass |
Tissue,processed |
R8676 |
T13220 |
T13218 |
prep |
from,Tissue |
R8677 |
T13221 |
T13220 |
pobj |
animals,from |
R8678 |
T13222 |
T13221 |
acl |
aged,animals |
R8679 |
T13223 |
T13224 |
nummod |
7,wk |
R8680 |
T13224 |
T13222 |
npadvmod |
wk,aged |
R8681 |
T13225 |
T13224 |
prep |
to,wk |
R8682 |
T13226 |
T13227 |
nummod |
9,mo |
R8683 |
T13227 |
T13225 |
pobj |
mo,to |
R8684 |
T13228 |
T13219 |
auxpass |
was,processed |
R8685 |
T13229 |
T13219 |
advmod |
similarly,processed |
R8686 |
T13230 |
T13229 |
prep |
to,similarly |
R8687 |
T13231 |
T13232 |
amod |
earlier,stages |
R8688 |
T13232 |
T13230 |
pobj |
stages,to |
R8689 |
T13233 |
T13219 |
prep |
except,processed |
R8690 |
T13234 |
T13235 |
mark |
that,decalcified |
R8691 |
T13235 |
T13233 |
pcomp |
decalcified,except |
R8692 |
T13236 |
T13235 |
nsubjpass |
it,decalcified |
R8693 |
T13237 |
T13235 |
auxpass |
was,decalcified |
R8694 |
T13238 |
T13235 |
prep |
in,decalcified |
R8695 |
T13239 |
T13240 |
nummod |
0.5,M |
R8696 |
T13240 |
T13241 |
compound |
M,EDTA |
R8697 |
T13241 |
T13238 |
pobj |
EDTA,in |
R8698 |
T13242 |
T13241 |
punct |
(,EDTA |
R8699 |
T13243 |
T13241 |
npadvmod |
pH,EDTA |
R8700 |
T13244 |
T13243 |
nummod |
7.4,pH |
R8701 |
T13245 |
T13241 |
punct |
),EDTA |
R8702 |
T13246 |
T13235 |
prep |
for,decalcified |
R8703 |
T13247 |
T13248 |
nummod |
4,d |
R8704 |
T13248 |
T13246 |
pobj |
d,for |
R8705 |
T13249 |
T13250 |
amod |
prior,to |
R8706 |
T13250 |
T13235 |
prep |
to,decalcified |
R8707 |
T13251 |
T13250 |
pcomp |
incubating,to |
R8708 |
T13252 |
T13251 |
prep |
in,incubating |
R8709 |
T13253 |
T13252 |
pobj |
sucrose,in |
R8710 |
T13254 |
T13219 |
punct |
.,processed |
R8711 |
T13256 |
T13257 |
det |
All,solutions |
R8712 |
T13257 |
T13258 |
nsubjpass |
solutions,prechilled |
R8713 |
T13259 |
T13258 |
auxpass |
were,prechilled |
R8714 |
T13260 |
T13258 |
cc |
and,prechilled |
R8715 |
T13261 |
T13258 |
conj |
used,prechilled |
R8716 |
T13262 |
T13261 |
prep |
at,used |
R8717 |
T13263 |
T13264 |
nummod |
4,°C |
R8718 |
T13264 |
T13262 |
pobj |
°C,at |
R8719 |
T13265 |
T13261 |
prep |
with,used |
R8720 |
T13266 |
T13265 |
pobj |
agitation,with |
R8721 |
T13267 |
T13258 |
punct |
", ",prechilled |
R8722 |
T13268 |
T13258 |
cc |
and,prechilled |
R8723 |
T13269 |
T13270 |
nsubjpass |
skin,lacerated |
R8724 |
T13270 |
T13258 |
conj |
lacerated,prechilled |
R8725 |
T13271 |
T13269 |
prep |
from,skin |
R8726 |
T13272 |
T13271 |
pobj |
tissues,from |
R8727 |
T13273 |
T13272 |
prep |
of,tissues |
R8728 |
T13274 |
T13275 |
nmod |
P0,mice |
R8729 |
T13275 |
T13273 |
pobj |
mice,of |
R8730 |
T13276 |
T13274 |
cc |
or,P0 |
R8731 |
T13277 |
T13274 |
conj |
older,P0 |
R8732 |
T13278 |
T13270 |
auxpass |
was,lacerated |
R8733 |
T13279 |
T13270 |
cc |
or,lacerated |
R8734 |
T13280 |
T13270 |
conj |
removed,lacerated |
R8735 |
T13281 |
T13282 |
amod |
prior,to |
R8736 |
T13282 |
T13280 |
prep |
to,removed |
R8737 |
T13283 |
T13282 |
pobj |
processing,to |
R8738 |
T13284 |
T13270 |
punct |
.,lacerated |
R8739 |
T13286 |
T13287 |
nsubjpass |
Tissue,cryosectioned |
R8740 |
T13288 |
T13287 |
auxpass |
was,cryosectioned |
R8741 |
T13289 |
T13287 |
advmod |
then,cryosectioned |
R8742 |
T13290 |
T13287 |
prep |
at,cryosectioned |
R8743 |
T13291 |
T13292 |
nummod |
12,μm |
R8744 |
T13292 |
T13290 |
pobj |
μm,at |
R8745 |
T13293 |
T13287 |
cc |
and,cryosectioned |
R8746 |
T13294 |
T13287 |
conj |
processed,cryosectioned |
R8747 |
T13295 |
T13287 |
punct |
.,cryosectioned |
R8748 |
T13297 |
T13298 |
nsubjpass |
Staining,carried |
R8749 |
T13299 |
T13297 |
prep |
of,Staining |
R8750 |
T13300 |
T13299 |
pobj |
sections,of |
R8751 |
T13301 |
T13297 |
prep |
with,Staining |
R8752 |
T13302 |
T13303 |
compound |
Safranin,O |
R8753 |
T13303 |
T13301 |
pobj |
O,with |
R8754 |
T13304 |
T13303 |
punct |
", ",O |
R8755 |
T13305 |
T13306 |
amod |
Fast,Green |
R8756 |
T13306 |
T13303 |
conj |
Green,O |
R8757 |
T13307 |
T13306 |
punct |
", ",Green |
R8758 |
T13308 |
T13306 |
cc |
and,Green |
R8759 |
T13309 |
T13310 |
poss |
Harris,hematoxylin |
R8760 |
T13310 |
T13306 |
conj |
hematoxylin,Green |
R8761 |
T13311 |
T13309 |
case |
',Harris |
R8762 |
T13312 |
T13298 |
auxpass |
was,carried |
R8763 |
T13313 |
T13298 |
prt |
out,carried |
R8764 |
T13314 |
T13298 |
advcl |
using,carried |
R8765 |
T13315 |
T13316 |
amod |
standard,procedures |
R8766 |
T13316 |
T13314 |
dobj |
procedures,using |
R8767 |
T13317 |
T13316 |
amod |
histological,procedures |
R8768 |
T13318 |
T13298 |
punct |
.,carried |
R8769 |
T13320 |
T13321 |
nsubjpass |
Detection,performed |
R8770 |
T13322 |
T13320 |
prep |
of,Detection |
R8771 |
T13323 |
T13324 |
compound |
LACZ,activity |
R8772 |
T13324 |
T13322 |
pobj |
activity,of |
R8773 |
T13325 |
T13320 |
prep |
with,Detection |
R8774 |
T13326 |
T13327 |
compound |
X,Gal |
R8775 |
T13327 |
T13325 |
pobj |
Gal,with |
R8776 |
T13328 |
T13327 |
punct |
-,Gal |
R8777 |
T13329 |
T13321 |
auxpass |
was,performed |
R8778 |
T13330 |
T13331 |
mark |
as,described |
R8779 |
T13331 |
T13321 |
advcl |
described,performed |
R8780 |
T13332 |
T13333 |
punct |
(,Lobe |
R8781 |
T13333 |
T13331 |
meta |
Lobe,described |
R8782 |
T13334 |
T13333 |
nmod |
et,Lobe |
R8783 |
T13335 |
T13333 |
nmod |
al.,Lobe |
R8784 |
T13336 |
T13333 |
nummod |
1999,Lobe |
R8785 |
T13337 |
T13333 |
punct |
),Lobe |
R8786 |
T13338 |
T13321 |
cc |
and,performed |
R8787 |
T13339 |
T13340 |
auxpass |
was,followed |
R8788 |
T13340 |
T13321 |
conj |
followed,performed |
R8789 |
T13341 |
T13340 |
agent |
by,followed |
R8790 |
T13342 |
T13341 |
pcomp |
refixing,by |
R8791 |
T13343 |
T13342 |
prep |
in,refixing |
R8792 |
T13344 |
T13345 |
nummod |
4,% |
R8793 |
T13345 |
T13346 |
compound |
%,PFA |
R8794 |
T13346 |
T13343 |
pobj |
PFA,in |
R8795 |
T13347 |
T13342 |
punct |
", ",refixing |
R8796 |
T13348 |
T13342 |
conj |
rinsing,refixing |
R8797 |
T13349 |
T13348 |
prep |
with,rinsing |
R8798 |
T13350 |
T13351 |
amod |
deionized,water |
R8799 |
T13351 |
T13349 |
pobj |
water,with |
R8800 |
T13352 |
T13348 |
punct |
", ",rinsing |
R8801 |
T13353 |
T13348 |
conj |
counterstaining,rinsing |
R8802 |
T13354 |
T13353 |
prep |
with,counterstaining |
R8803 |
T13355 |
T13356 |
amod |
Nuclear,Red |
R8804 |
T13356 |
T13354 |
pobj |
Red,with |
R8805 |
T13357 |
T13356 |
amod |
Fast,Red |
R8806 |
T13358 |
T13356 |
punct |
(,Red |
R8807 |
T13359 |
T13360 |
compound |
Vector,Labs |
R8808 |
T13360 |
T13356 |
npadvmod |
Labs,Red |
R8809 |
T13361 |
T13356 |
punct |
),Red |
R8810 |
T13362 |
T13353 |
punct |
", ",counterstaining |
R8811 |
T13363 |
T13353 |
conj |
rinsing,counterstaining |
R8812 |
T13364 |
T13363 |
prep |
with,rinsing |
R8813 |
T13365 |
T13364 |
pobj |
water,with |
R8814 |
T13366 |
T13363 |
advmod |
again,rinsing |
R8815 |
T13367 |
T13363 |
punct |
", ",rinsing |
R8816 |
T13368 |
T13363 |
cc |
and,rinsing |
R8817 |
T13369 |
T13370 |
advmod |
then,mounting |
R8818 |
T13370 |
T13363 |
conj |
mounting,rinsing |
R8819 |
T13371 |
T13370 |
prep |
in,mounting |
R8820 |
T13372 |
T13371 |
pobj |
Aquamount,in |
R8821 |
T13373 |
T13374 |
punct |
(,Labs |
R8822 |
T13374 |
T13372 |
parataxis |
Labs,Aquamount |
R8823 |
T13375 |
T13374 |
compound |
Lerner,Labs |
R8824 |
T13376 |
T13374 |
punct |
", ",Labs |
R8825 |
T13377 |
T13374 |
npadvmod |
Pittsburgh,Labs |
R8826 |
T13378 |
T13374 |
punct |
", ",Labs |
R8827 |
T13379 |
T13374 |
npadvmod |
Pennsylvania,Labs |
R8828 |
T13380 |
T13374 |
punct |
", ",Labs |
R8829 |
T13381 |
T13382 |
compound |
United,States |
R8830 |
T13382 |
T13374 |
npadvmod |
States,Labs |
R8831 |
T13383 |
T13374 |
punct |
),Labs |
R8832 |
T13384 |
T13321 |
punct |
.,performed |
R8833 |
T13386 |
T13387 |
nmod |
RNA,hybridization |
R8834 |
T13387 |
T13390 |
nsubjpass |
hybridization,performed |
R8835 |
T13388 |
T13389 |
advmod |
in,situ |
R8836 |
T13389 |
T13387 |
amod |
situ,hybridization |
R8837 |
T13391 |
T13390 |
auxpass |
was,performed |
R8838 |
T13392 |
T13393 |
mark |
as,described |
R8839 |
T13393 |
T13390 |
advcl |
described,performed |
R8840 |
T13394 |
T13395 |
punct |
(,Storm |
R8841 |
T13395 |
T13393 |
meta |
Storm,described |
R8842 |
T13396 |
T13395 |
cc |
and,Storm |
R8843 |
T13397 |
T13395 |
conj |
Kingsley,Storm |
R8844 |
T13398 |
T13397 |
nummod |
1996,Kingsley |
R8845 |
T13399 |
T13397 |
punct |
),Kingsley |
R8846 |
T13400 |
T13390 |
punct |
", ",performed |
R8847 |
T13401 |
T13390 |
prep |
with,performed |
R8848 |
T13402 |
T13403 |
det |
the,modifications |
R8849 |
T13403 |
T13401 |
pobj |
modifications,with |
R8850 |
T13404 |
T13403 |
amod |
following,modifications |
R8851 |
T13405 |
T13390 |
punct |
: ,performed |
R8852 |
T13406 |
T13407 |
punct |
(,1 |
R8853 |
T13407 |
T13408 |
meta |
1,incubated |
R8854 |
T13408 |
T13390 |
conj |
incubated,performed |
R8855 |
T13409 |
T13407 |
punct |
),1 |
R8856 |
T13410 |
T13411 |
amod |
Prior,to |
R8857 |
T13411 |
T13408 |
prep |
to,incubated |
R8858 |
T13412 |
T13413 |
det |
the,step |
R8859 |
T13413 |
T13411 |
pobj |
step,to |
R8860 |
T13414 |
T13413 |
compound |
acetylation,step |
R8861 |
T13415 |
T13408 |
punct |
", ",incubated |
R8862 |
T13416 |
T13408 |
nsubjpass |
sections,incubated |
R8863 |
T13417 |
T13408 |
auxpass |
were,incubated |
R8864 |
T13418 |
T13408 |
prep |
with,incubated |
R8865 |
T13419 |
T13420 |
compound |
10,20 |
R8866 |
T13420 |
T13422 |
nummod |
20,μg |
R8867 |
T13421 |
T13420 |
punct |
–,20 |
R8868 |
T13422 |
T13423 |
nmod |
μg,K |
R8869 |
T13423 |
T13418 |
pobj |
K,with |
R8870 |
T13424 |
T13425 |
punct |
/,ml |
R8871 |
T13425 |
T13422 |
prep |
ml,μg |
R8872 |
T13426 |
T13423 |
compound |
proteinase,K |
R8873 |
T13427 |
T13408 |
prep |
for,incubated |
R8874 |
T13428 |
T13429 |
nummod |
30,s |
R8875 |
T13429 |
T13427 |
pobj |
s,for |
R8876 |
T13430 |
T13429 |
prep |
to,s |
R8877 |
T13431 |
T13432 |
nummod |
7,min |
R8878 |
T13432 |
T13430 |
pobj |
min,to |
R8879 |
T13433 |
T13408 |
prep |
at,incubated |
R8880 |
T13434 |
T13435 |
compound |
room,temperature |
R8881 |
T13435 |
T13433 |
pobj |
temperature,at |
R8882 |
T13436 |
T13435 |
punct |
(,temperature |
R8883 |
T13437 |
T13435 |
prep |
depending,temperature |
R8884 |
T13438 |
T13437 |
prep |
on,depending |
R8885 |
T13439 |
T13440 |
det |
the,stage |
R8886 |
T13440 |
T13438 |
pobj |
stage,on |
R8887 |
T13441 |
T13440 |
amod |
developmental,stage |
R8888 |
T13442 |
T13435 |
punct |
),temperature |
R8889 |
T13443 |
T13408 |
punct |
", ",incubated |
R8890 |
T13444 |
T13408 |
advcl |
followed,incubated |
R8891 |
T13445 |
T13444 |
agent |
by,followed |
R8892 |
T13446 |
T13445 |
pcomp |
refixing,by |
R8893 |
T13447 |
T13446 |
prep |
in,refixing |
R8894 |
T13448 |
T13449 |
nummod |
4,% |
R8895 |
T13449 |
T13450 |
compound |
%,PFA |
R8896 |
T13450 |
T13447 |
pobj |
PFA,in |
R8897 |
T13451 |
T13446 |
cc |
and,refixing |
R8898 |
T13452 |
T13446 |
conj |
washing,refixing |
R8899 |
T13453 |
T13454 |
nummod |
three,times |
R8900 |
T13454 |
T13452 |
npadvmod |
times,washing |
R8901 |
T13455 |
T13452 |
prep |
in,washing |
R8902 |
T13456 |
T13455 |
pobj |
PBS,in |
R8903 |
T13457 |
T13408 |
punct |
;,incubated |
R8904 |
T13458 |
T13459 |
punct |
(,2 |
R8905 |
T13459 |
T13460 |
meta |
2,skipped |
R8906 |
T13460 |
T13408 |
conj |
skipped,incubated |
R8907 |
T13461 |
T13459 |
punct |
),2 |
R8908 |
T13462 |
T13463 |
compound |
prehybridization,step |
R8909 |
T13463 |
T13460 |
nsubjpass |
step,skipped |
R8910 |
T13464 |
T13460 |
auxpass |
was,skipped |
R8911 |
T13465 |
T13460 |
punct |
", ",skipped |
R8912 |
T13466 |
T13460 |
cc |
and,skipped |
R8913 |
T13467 |
T13468 |
punct |
(,3 |
R8914 |
T13468 |
T13469 |
meta |
3,used |
R8915 |
T13469 |
T13460 |
conj |
used,skipped |
R8916 |
T13470 |
T13468 |
punct |
),3 |
R8917 |
T13471 |
T13472 |
amod |
embryonic,tissue |
R8918 |
T13472 |
T13473 |
compound |
tissue,sections |
R8919 |
T13473 |
T13469 |
nsubj |
sections,used |
R8920 |
T13474 |
T13475 |
det |
a,mix |
R8921 |
T13475 |
T13469 |
dobj |
mix,used |
R8922 |
T13476 |
T13475 |
amod |
different,mix |
R8923 |
T13477 |
T13475 |
compound |
color,mix |
R8924 |
T13478 |
T13475 |
compound |
development,mix |
R8925 |
T13479 |
T13480 |
punct |
(,Thut |
R8926 |
T13480 |
T13469 |
meta |
Thut,used |
R8927 |
T13481 |
T13480 |
nmod |
et,Thut |
R8928 |
T13482 |
T13480 |
nmod |
al.,Thut |
R8929 |
T13483 |
T13480 |
nummod |
2001,Thut |
R8930 |
T13484 |
T13480 |
punct |
),Thut |
R8931 |
T13485 |
T13469 |
punct |
.,used |
R8932 |
T13487 |
T13488 |
nsubjpass |
Probes,published |
R8933 |
T13489 |
T13487 |
prep |
for,Probes |
R8934 |
T13490 |
T13491 |
det |
the,genes |
R8935 |
T13491 |
T13489 |
pobj |
genes,for |
R8936 |
T13492 |
T13491 |
amod |
following,genes |
R8937 |
T13493 |
T13488 |
aux |
have,published |
R8938 |
T13494 |
T13488 |
auxpass |
been,published |
R8939 |
T13495 |
T13488 |
advmod |
previously,published |
R8940 |
T13496 |
T13488 |
punct |
: ,published |
R8941 |
T13497 |
T13488 |
dobj |
Bmpr1a,published |
R8942 |
T13498 |
T13499 |
punct |
(,Mishina |
R8943 |
T13499 |
T13497 |
meta |
Mishina,Bmpr1a |
R8944 |
T13500 |
T13499 |
nmod |
et,Mishina |
R8945 |
T13501 |
T13499 |
nmod |
al.,Mishina |
R8946 |
T13502 |
T13499 |
nummod |
1995,Mishina |
R8947 |
T13503 |
T13499 |
punct |
),Mishina |
R8948 |
T13504 |
T13497 |
punct |
", ",Bmpr1a |
R8949 |
T13505 |
T13497 |
conj |
Col2a1,Bmpr1a |
R8950 |
T13506 |
T13507 |
punct |
(,Metsaranta |
R8951 |
T13507 |
T13505 |
meta |
Metsaranta,Col2a1 |
R8952 |
T13508 |
T13507 |
nmod |
et,Metsaranta |
R8953 |
T13509 |
T13507 |
nmod |
al.,Metsaranta |
R8954 |
T13510 |
T13507 |
nummod |
1991,Metsaranta |
R8955 |
T13511 |
T13507 |
punct |
),Metsaranta |
R8956 |
T13512 |
T13505 |
punct |
", ",Col2a1 |
R8957 |
T13513 |
T13505 |
conj |
Col10a1,Col2a1 |
R8958 |
T13514 |
T13515 |
punct |
(,Apte |
R8959 |
T13515 |
T13513 |
meta |
Apte,Col10a1 |
R8960 |
T13516 |
T13515 |
nmod |
et,Apte |
R8961 |
T13517 |
T13515 |
nmod |
al.,Apte |
R8962 |
T13518 |
T13515 |
nummod |
1992,Apte |
R8963 |
T13519 |
T13515 |
punct |
),Apte |
R8964 |
T13520 |
T13513 |
punct |
", ",Col10a1 |
R8965 |
T13521 |
T13513 |
conj |
Gdf5,Col10a1 |
R8966 |
T13522 |
T13523 |
punct |
(,Storm |
R8967 |
T13523 |
T13521 |
meta |
Storm,Gdf5 |
R8968 |
T13524 |
T13523 |
cc |
and,Storm |
R8969 |
T13525 |
T13523 |
conj |
Kingsley,Storm |
R8970 |
T13526 |
T13525 |
nummod |
1996,Kingsley |
R8971 |
T13527 |
T13525 |
punct |
),Kingsley |
R8972 |
T13528 |
T13521 |
punct |
", ",Gdf5 |
R8973 |
T13529 |
T13521 |
conj |
Osteocalcin,Gdf5 |
R8974 |
T13530 |
T13531 |
punct |
(,Celeste |
R8975 |
T13531 |
T13529 |
meta |
Celeste,Osteocalcin |
R8976 |
T13532 |
T13531 |
nmod |
et,Celeste |
R8977 |
T13533 |
T13531 |
nmod |
al.,Celeste |
R8978 |
T13534 |
T13531 |
nummod |
1986,Celeste |
R8979 |
T13535 |
T13531 |
punct |
),Celeste |
R8980 |
T13536 |
T13529 |
punct |
", ",Osteocalcin |
R8981 |
T13537 |
T13529 |
cc |
and,Osteocalcin |
R8982 |
T13538 |
T13529 |
conj |
Sox5,Osteocalcin |
R8983 |
T13539 |
T13538 |
cc |
and,Sox5 |
R8984 |
T13540 |
T13538 |
conj |
Sox6,Sox5 |
R8985 |
T13541 |
T13542 |
punct |
(,Lefebvre |
R8986 |
T13542 |
T13540 |
meta |
Lefebvre,Sox6 |
R8987 |
T13543 |
T13542 |
nmod |
et,Lefebvre |
R8988 |
T13544 |
T13542 |
nmod |
al.,Lefebvre |
R8989 |
T13545 |
T13542 |
nummod |
1998,Lefebvre |
R8990 |
T13546 |
T13542 |
punct |
),Lefebvre |
R8991 |
T13547 |
T13488 |
punct |
.,published |
R8992 |
T13549 |
T13550 |
det |
The,templates |
R8993 |
T13550 |
T13553 |
nsubj |
templates,were |
R8994 |
T13551 |
T13550 |
amod |
following,templates |
R8995 |
T13552 |
T13550 |
compound |
probe,templates |
R8996 |
T13553 |
T13554 |
ccomp |
were,made |
R8997 |
T13555 |
T13553 |
attr |
gifts,were |
R8998 |
T13556 |
T13553 |
punct |
: ,were |
R8999 |
T13557 |
T13553 |
dobj |
Agg,were |
R9000 |
T13558 |
T13557 |
punct |
", ",Agg |
R9001 |
T13559 |
T13560 |
compound |
Dr.,Rosen |
R9002 |
T13560 |
T13557 |
npadvmod |
Rosen,Agg |
R9003 |
T13561 |
T13560 |
compound |
Vicki,Rosen |
R9004 |
T13562 |
T13557 |
punct |
", ",Agg |
R9005 |
T13563 |
T13564 |
compound |
Genetics,Institute |
R9006 |
T13564 |
T13557 |
npadvmod |
Institute,Agg |
R9007 |
T13565 |
T13557 |
punct |
;,Agg |
R9008 |
T13566 |
T13557 |
appos |
Bmp2,Agg |
R9009 |
T13567 |
T13566 |
cc |
and,Bmp2 |
R9010 |
T13568 |
T13566 |
conj |
Bmp4,Bmp2 |
R9011 |
T13569 |
T13566 |
punct |
", ",Bmp2 |
R9012 |
T13570 |
T13571 |
compound |
Arend,Sidow |
R9013 |
T13571 |
T13566 |
npadvmod |
Sidow,Bmp2 |
R9014 |
T13572 |
T13566 |
punct |
", ",Bmp2 |
R9015 |
T13573 |
T13574 |
compound |
Stanford,University |
R9016 |
T13574 |
T13566 |
npadvmod |
University,Bmp2 |
R9017 |
T13575 |
T13557 |
punct |
;,Agg |
R9018 |
T13576 |
T13557 |
appos |
Col1a1,Agg |
R9019 |
T13577 |
T13576 |
punct |
", ",Col1a1 |
R9020 |
T13578 |
T13579 |
compound |
Bjorn,Olsen |
R9021 |
T13579 |
T13576 |
npadvmod |
Olsen,Col1a1 |
R9022 |
T13580 |
T13576 |
punct |
", ",Col1a1 |
R9023 |
T13581 |
T13582 |
compound |
Harvard,School |
R9024 |
T13582 |
T13576 |
npadvmod |
School,Col1a1 |
R9025 |
T13583 |
T13582 |
compound |
Medical,School |
R9026 |
T13584 |
T13554 |
punct |
;,made |
R9027 |
T13585 |
T13586 |
nmod |
Bmpr1b,probes |
R9028 |
T13586 |
T13554 |
nsubjpass |
probes,made |
R9029 |
T13587 |
T13585 |
punct |
", ",Bmpr1b |
R9030 |
T13588 |
T13585 |
conj |
Col3a1,Bmpr1b |
R9031 |
T13589 |
T13588 |
punct |
", ",Col3a1 |
R9032 |
T13590 |
T13588 |
cc |
and,Col3a1 |
R9033 |
T13591 |
T13588 |
conj |
Mat4,Col3a1 |
R9034 |
T13592 |
T13554 |
auxpass |
were,made |
R9035 |
T13593 |
T13554 |
prep |
from,made |
R9036 |
T13594 |
T13593 |
pobj |
ESTs,from |
R9037 |
T13595 |
T13594 |
prep |
with,ESTs |
R9038 |
T13596 |
T13597 |
compound |
IMAGE,numbers |
R9039 |
T13597 |
T13595 |
pobj |
numbers,with |
R9040 |
T13598 |
T13597 |
compound |
clone,numbers |
R9041 |
T13599 |
T13597 |
appos |
5056341,numbers |
R9042 |
T13600 |
T13599 |
punct |
", ",5056341 |
R9043 |
T13601 |
T13599 |
conj |
478480,5056341 |
R9044 |
T13602 |
T13601 |
punct |
", ",478480 |
R9045 |
T13603 |
T13601 |
cc |
and,478480 |
R9046 |
T13604 |
T13601 |
conj |
406027,478480 |
R9047 |
T13605 |
T13554 |
punct |
", ",made |
R9048 |
T13606 |
T13554 |
advmod |
respectively,made |
R9049 |
T13607 |
T13608 |
punct |
(,Invitrogen |
R9050 |
T13608 |
T13554 |
parataxis |
Invitrogen,made |
R9051 |
T13609 |
T13608 |
punct |
", ",Invitrogen |
R9052 |
T13610 |
T13608 |
npadvmod |
Carlsbad,Invitrogen |
R9053 |
T13611 |
T13608 |
punct |
", ",Invitrogen |
R9054 |
T13612 |
T13608 |
npadvmod |
California,Invitrogen |
R9055 |
T13613 |
T13608 |
punct |
", ",Invitrogen |
R9056 |
T13614 |
T13615 |
compound |
United,States |
R9057 |
T13615 |
T13608 |
npadvmod |
States,Invitrogen |
R9058 |
T13616 |
T13608 |
punct |
),Invitrogen |
R9059 |
T13617 |
T13554 |
punct |
.,made |
R9060 |
T13619 |
T13620 |
nsubjpass |
Sections,fixed |
R9061 |
T13621 |
T13619 |
prep |
for,Sections |
R9062 |
T13622 |
T13621 |
pobj |
immunohistochemistry,for |
R9063 |
T13623 |
T13620 |
auxpass |
were,fixed |
R9064 |
T13624 |
T13620 |
prep |
in,fixed |
R9065 |
T13625 |
T13626 |
nummod |
4,% |
R9066 |
T13626 |
T13627 |
compound |
%,PFA |
R9067 |
T13627 |
T13624 |
pobj |
PFA,in |
R9068 |
T13628 |
T13620 |
punct |
", ",fixed |
R9069 |
T13629 |
T13630 |
advmod |
then,digested |
R9070 |
T13630 |
T13620 |
dep |
digested,fixed |
R9071 |
T13631 |
T13630 |
prep |
with,digested |
R9072 |
T13632 |
T13633 |
quantmod |
942,"2,000" |
R9073 |
T13633 |
T13635 |
nummod |
"2,000",U |
R9074 |
T13634 |
T13633 |
punct |
–,"2,000" |
R9075 |
T13635 |
T13636 |
nmod |
U,hyaluronindase |
R9076 |
T13636 |
T13631 |
pobj |
hyaluronindase,with |
R9077 |
T13637 |
T13638 |
punct |
/,ml |
R9078 |
T13638 |
T13635 |
prep |
ml,U |
R9079 |
T13639 |
T13640 |
nmod |
type,S |
R9080 |
T13640 |
T13636 |
nmod |
S,hyaluronindase |
R9081 |
T13641 |
T13640 |
nummod |
IV,S |
R9082 |
T13642 |
T13640 |
punct |
-,S |
R9083 |
T13643 |
T13636 |
amod |
bovine,hyaluronindase |
R9084 |
T13644 |
T13645 |
punct |
(,Sigma |
R9085 |
T13645 |
T13636 |
parataxis |
Sigma,hyaluronindase |
R9086 |
T13646 |
T13645 |
punct |
", ",Sigma |
R9087 |
T13647 |
T13648 |
compound |
St.,Louis |
R9088 |
T13648 |
T13645 |
npadvmod |
Louis,Sigma |
R9089 |
T13649 |
T13645 |
punct |
", ",Sigma |
R9090 |
T13650 |
T13645 |
npadvmod |
Missouri,Sigma |
R9091 |
T13651 |
T13645 |
punct |
", ",Sigma |
R9092 |
T13652 |
T13653 |
compound |
United,States |
R9093 |
T13653 |
T13645 |
npadvmod |
States,Sigma |
R9094 |
T13654 |
T13645 |
punct |
),Sigma |
R9095 |
T13655 |
T13630 |
prep |
in,digested |
R9096 |
T13656 |
T13655 |
pobj |
PBS,in |
R9097 |
T13657 |
T13656 |
punct |
(,PBS |
R9098 |
T13658 |
T13656 |
npadvmod |
pH,PBS |
R9099 |
T13659 |
T13658 |
nummod |
5,pH |
R9100 |
T13660 |
T13656 |
punct |
),PBS |
R9101 |
T13661 |
T13630 |
prep |
at,digested |
R9102 |
T13662 |
T13663 |
nummod |
37,°C |
R9103 |
T13663 |
T13661 |
pobj |
°C,at |
R9104 |
T13664 |
T13630 |
prep |
for,digested |
R9105 |
T13665 |
T13666 |
nummod |
30,min |
R9106 |
T13666 |
T13664 |
pobj |
min,for |
R9107 |
T13667 |
T13666 |
prep |
to,min |
R9108 |
T13668 |
T13669 |
nummod |
2,h |
R9109 |
T13669 |
T13667 |
pobj |
h,to |
R9110 |
T13670 |
T13666 |
prep |
depending,min |
R9111 |
T13671 |
T13670 |
prep |
on,depending |
R9112 |
T13672 |
T13673 |
det |
the,stage |
R9113 |
T13673 |
T13671 |
pobj |
stage,on |
R9114 |
T13674 |
T13620 |
punct |
.,fixed |
R9115 |
T13676 |
T13677 |
nsubjpass |
Slides,washed |
R9116 |
T13678 |
T13677 |
auxpass |
were,washed |
R9117 |
T13679 |
T13677 |
advmod |
then,washed |
R9118 |
T13680 |
T13677 |
prep |
in,washed |
R9119 |
T13681 |
T13680 |
pobj |
PBS,in |
R9120 |
T13682 |
T13677 |
punct |
", ",washed |
R9121 |
T13683 |
T13677 |
conj |
treated,washed |
R9122 |
T13684 |
T13683 |
prep |
with,treated |
R9123 |
T13685 |
T13686 |
nummod |
0.3,% |
R9124 |
T13686 |
T13687 |
compound |
%,peroxide |
R9125 |
T13687 |
T13684 |
pobj |
peroxide,with |
R9126 |
T13688 |
T13687 |
compound |
hydrogen,peroxide |
R9127 |
T13689 |
T13683 |
prep |
in,treated |
R9128 |
T13690 |
T13691 |
nummod |
100,% |
R9129 |
T13691 |
T13692 |
compound |
%,methanol |
R9130 |
T13692 |
T13689 |
pobj |
methanol,in |
R9131 |
T13693 |
T13683 |
prep |
for,treated |
R9132 |
T13694 |
T13695 |
nummod |
30,min |
R9133 |
T13695 |
T13693 |
pobj |
min,for |
R9134 |
T13696 |
T13683 |
punct |
", ",treated |
R9135 |
T13697 |
T13683 |
conj |
washed,treated |
R9136 |
T13698 |
T13697 |
punct |
", ",washed |
R9137 |
T13699 |
T13697 |
conj |
blocked,washed |
R9138 |
T13700 |
T13699 |
prep |
with,blocked |
R9139 |
T13701 |
T13700 |
pobj |
PBS,with |
R9140 |
T13702 |
T13701 |
punct |
+,PBS |
R9141 |
T13703 |
T13704 |
nummod |
0.05,% |
R9142 |
T13704 |
T13705 |
compound |
%,Tween20 |
R9143 |
T13705 |
T13701 |
appos |
Tween20,PBS |
R9144 |
T13706 |
T13701 |
punct |
+,PBS |
R9145 |
T13707 |
T13708 |
nummod |
5,% |
R9146 |
T13708 |
T13709 |
nmod |
%,serum |
R9147 |
T13709 |
T13701 |
appos |
serum,PBS |
R9148 |
T13710 |
T13709 |
nmod |
goat,serum |
R9149 |
T13711 |
T13710 |
cc |
or,goat |
R9150 |
T13712 |
T13713 |
amod |
fetal,bovine |
R9151 |
T13713 |
T13710 |
conj |
bovine,goat |
R9152 |
T13714 |
T13699 |
punct |
", ",blocked |
R9153 |
T13715 |
T13699 |
conj |
washed,blocked |
R9154 |
T13716 |
T13715 |
advmod |
again,washed |
R9155 |
T13717 |
T13715 |
punct |
", ",washed |
R9156 |
T13718 |
T13715 |
cc |
and,washed |
R9157 |
T13719 |
T13715 |
conj |
incubated,washed |
R9158 |
T13720 |
T13719 |
prep |
with,incubated |
R9159 |
T13721 |
T13722 |
amod |
primary,antibodies |
R9160 |
T13722 |
T13720 |
pobj |
antibodies,with |
R9161 |
T13723 |
T13719 |
prep |
in,incubated |
R9162 |
T13724 |
T13723 |
pobj |
PBS,in |
R9163 |
T13725 |
T13724 |
punct |
+,PBS |
R9164 |
T13726 |
T13727 |
nummod |
0.05,% |
R9165 |
T13727 |
T13728 |
compound |
%,Tween |
R9166 |
T13728 |
T13724 |
appos |
Tween,PBS |
R9167 |
T13729 |
T13728 |
nummod |
20,Tween |
R9168 |
T13730 |
T13724 |
punct |
+,PBS |
R9169 |
T13731 |
T13732 |
nummod |
1,% |
R9170 |
T13732 |
T13733 |
nmod |
%,serum |
R9171 |
T13733 |
T13724 |
appos |
serum,PBS |
R9172 |
T13734 |
T13733 |
nmod |
goat,serum |
R9173 |
T13735 |
T13734 |
cc |
or,goat |
R9174 |
T13736 |
T13737 |
amod |
fetal,bovine |
R9175 |
T13737 |
T13734 |
conj |
bovine,goat |
R9176 |
T13738 |
T13719 |
advmod |
overnight,incubated |
R9177 |
T13739 |
T13719 |
prep |
at,incubated |
R9178 |
T13740 |
T13741 |
nummod |
4,°C |
R9179 |
T13741 |
T13739 |
pobj |
°C,at |
R9180 |
T13742 |
T13677 |
punct |
.,washed |
R9181 |
T13744 |
T13745 |
npadvmod |
Biotin,labeled |
R9182 |
T13745 |
T13747 |
amod |
labeled,antibodies |
R9183 |
T13746 |
T13745 |
punct |
-,labeled |
R9184 |
T13747 |
T13749 |
nsubjpass |
antibodies,tagged |
R9185 |
T13748 |
T13747 |
amod |
secondary,antibodies |
R9186 |
T13750 |
T13751 |
punct |
(,Labs |
R9187 |
T13751 |
T13747 |
parataxis |
Labs,antibodies |
R9188 |
T13752 |
T13751 |
compound |
Vector,Labs |
R9189 |
T13753 |
T13751 |
punct |
),Labs |
R9190 |
T13754 |
T13749 |
auxpass |
were,tagged |
R9191 |
T13755 |
T13749 |
prep |
with,tagged |
R9192 |
T13756 |
T13755 |
pobj |
HRP,with |
R9193 |
T13757 |
T13749 |
advcl |
using,tagged |
R9194 |
T13758 |
T13759 |
det |
the,kit |
R9195 |
T13759 |
T13757 |
dobj |
kit,using |
R9196 |
T13760 |
T13761 |
compound |
Vectastain,Elite |
R9197 |
T13761 |
T13759 |
compound |
Elite,kit |
R9198 |
T13762 |
T13759 |
compound |
ABC,kit |
R9199 |
T13763 |
T13764 |
punct |
(,Labs |
R9200 |
T13764 |
T13759 |
parataxis |
Labs,kit |
R9201 |
T13765 |
T13764 |
compound |
Vector,Labs |
R9202 |
T13766 |
T13764 |
punct |
),Labs |
R9203 |
T13767 |
T13749 |
advcl |
followed,tagged |
R9204 |
T13768 |
T13767 |
agent |
by,followed |
R9205 |
T13769 |
T13768 |
pobj |
detection,by |
R9206 |
T13770 |
T13769 |
prep |
with,detection |
R9207 |
T13771 |
T13770 |
pobj |
DAB,with |
R9208 |
T13772 |
T13773 |
punct |
(,Labs |
R9209 |
T13773 |
T13771 |
parataxis |
Labs,DAB |
R9210 |
T13774 |
T13773 |
compound |
Vector,Labs |
R9211 |
T13775 |
T13773 |
punct |
),Labs |
R9212 |
T13776 |
T13749 |
punct |
.,tagged |
R9213 |
T13778 |
T13779 |
amod |
Primary,antibodies |
R9214 |
T13779 |
T13780 |
nsubj |
antibodies,were |
R9215 |
T13781 |
T13779 |
cc |
and,antibodies |
R9216 |
T13782 |
T13779 |
conj |
dilutions,antibodies |
R9217 |
T13783 |
T13779 |
acl |
used,antibodies |
R9218 |
T13784 |
T13780 |
punct |
: ,were |
R9219 |
T13785 |
T13786 |
nmod |
goat,MMP13 |
R9220 |
T13786 |
T13780 |
attr |
MMP13,were |
R9221 |
T13787 |
T13785 |
amod |
anti-mouse,goat |
R9222 |
T13788 |
T13786 |
punct |
", ",MMP13 |
R9223 |
T13789 |
T13786 |
npadvmod |
1,MMP13 |
R9224 |
T13790 |
T13791 |
punct |
:,100 |
R9225 |
T13791 |
T13789 |
prep |
100,1 |
R9226 |
T13792 |
T13793 |
punct |
(,International |
R9227 |
T13793 |
T13789 |
parataxis |
International,1 |
R9228 |
T13794 |
T13793 |
compound |
Chemicon,International |
R9229 |
T13795 |
T13793 |
punct |
", ",International |
R9230 |
T13796 |
T13793 |
npadvmod |
Temecula,International |
R9231 |
T13797 |
T13793 |
punct |
", ",International |
R9232 |
T13798 |
T13793 |
npadvmod |
California,International |
R9233 |
T13799 |
T13793 |
punct |
", ",International |
R9234 |
T13800 |
T13801 |
compound |
United,States |
R9235 |
T13801 |
T13793 |
npadvmod |
States,International |
R9236 |
T13802 |
T13793 |
punct |
),International |
R9237 |
T13803 |
T13786 |
punct |
;,MMP13 |
R9238 |
T13804 |
T13805 |
nmod |
rabbit,SOX9 |
R9239 |
T13805 |
T13786 |
appos |
SOX9,MMP13 |
R9240 |
T13806 |
T13804 |
amod |
anti-human,rabbit |
R9241 |
T13807 |
T13805 |
punct |
", ",SOX9 |
R9242 |
T13808 |
T13805 |
npadvmod |
1,SOX9 |
R9243 |
T13809 |
T13810 |
punct |
:,500 |
R9244 |
T13810 |
T13808 |
prep |
500,1 |
R9245 |
T13811 |
T13812 |
punct |
(,Morais |
R9246 |
T13812 |
T13808 |
meta |
Morais,1 |
R9247 |
T13813 |
T13812 |
nmod |
da,Morais |
R9248 |
T13814 |
T13812 |
nmod |
Silva,Morais |
R9249 |
T13815 |
T13812 |
nmod |
et,Morais |
R9250 |
T13816 |
T13812 |
nmod |
al.,Morais |
R9251 |
T13817 |
T13812 |
nummod |
1996,Morais |
R9252 |
T13818 |
T13812 |
punct |
),Morais |
R9253 |
T13819 |
T13786 |
punct |
;,MMP13 |
R9254 |
T13820 |
T13821 |
nmod |
rabbit,SOX9 |
R9255 |
T13821 |
T13786 |
appos |
SOX9,MMP13 |
R9256 |
T13822 |
T13821 |
amod |
anti-phosphorylated,SOX9 |
R9257 |
T13823 |
T13821 |
punct |
-,SOX9 |
R9258 |
T13824 |
T13821 |
punct |
(,SOX9 |
R9259 |
T13825 |
T13826 |
nmod |
SOX9,P |
R9260 |
T13826 |
T13821 |
appos |
P,SOX9 |
R9261 |
T13827 |
T13826 |
punct |
.,P |
R9262 |
T13828 |
T13821 |
punct |
),SOX9 |
R9263 |
T13829 |
T13821 |
punct |
", ",SOX9 |
R9264 |
T13830 |
T13821 |
npadvmod |
1,SOX9 |
R9265 |
T13831 |
T13832 |
punct |
:,10 |
R9266 |
T13832 |
T13830 |
prep |
10,1 |
R9267 |
T13833 |
T13834 |
punct |
–,1 |
R9268 |
T13834 |
T13830 |
prep |
1,1 |
R9269 |
T13835 |
T13836 |
punct |
:,250 |
R9270 |
T13836 |
T13834 |
prep |
250,1 |
R9271 |
T13837 |
T13838 |
punct |
(,Huang |
R9272 |
T13838 |
T13780 |
meta |
Huang,were |
R9273 |
T13839 |
T13838 |
nmod |
et,Huang |
R9274 |
T13840 |
T13838 |
nmod |
al.,Huang |
R9275 |
T13841 |
T13838 |
nummod |
2000,Huang |
R9276 |
T13842 |
T13838 |
punct |
),Huang |
R9277 |
T13843 |
T13780 |
punct |
.,were |