Id |
Subject |
Object |
Predicate |
Lexical cue |
T10098 |
9-20 |
NN |
denotes |
Compilation |
T10099 |
21-24 |
CC |
denotes |
and |
T10100 |
25-33 |
NN |
denotes |
assembly |
T10101 |
34-36 |
IN |
denotes |
of |
T10102 |
37-47 |
RB |
denotes |
previously |
T10103 |
48-63 |
JJ |
denotes |
uncharacterized |
T10105 |
64-68 |
NN |
denotes |
TACC |
T10104 |
69-74 |
NNS |
denotes |
cDNAs |
T10106 |
75-78 |
CC |
denotes |
and |
T10107 |
79-84 |
NNS |
denotes |
genes |
T10108 |
84-282 |
sentence |
denotes |
Corresponding orthologous sequences for TACC, RHAMM, KLP, KIF, TPM and keratins families were identified initially using the TBLASTN program [36] to search the published genomic and cDNA databases. |
T10109 |
85-98 |
VBG |
denotes |
Corresponding |
T10111 |
99-110 |
JJ |
denotes |
orthologous |
T10110 |
111-120 |
NNS |
denotes |
sequences |
T10113 |
121-124 |
IN |
denotes |
for |
T10114 |
125-129 |
NN |
denotes |
TACC |
T10116 |
129-131 |
, |
denotes |
, |
T10117 |
131-136 |
NN |
denotes |
RHAMM |
T10118 |
136-138 |
, |
denotes |
, |
T10119 |
138-141 |
NN |
denotes |
KLP |
T10120 |
141-143 |
, |
denotes |
, |
T10121 |
143-146 |
NN |
denotes |
KIF |
T10122 |
146-148 |
, |
denotes |
, |
T10123 |
148-151 |
NN |
denotes |
TPM |
T10124 |
152-155 |
CC |
denotes |
and |
T10125 |
156-164 |
NNS |
denotes |
keratins |
T10115 |
165-173 |
NNS |
denotes |
families |
T10126 |
174-178 |
VBD |
denotes |
were |
T10112 |
179-189 |
VBN |
denotes |
identified |
T10127 |
190-199 |
RB |
denotes |
initially |
T10128 |
200-205 |
VBG |
denotes |
using |
T10129 |
206-209 |
DT |
denotes |
the |
T10131 |
210-217 |
NNP |
denotes |
TBLASTN |
T10130 |
218-225 |
NN |
denotes |
program |
T10132 |
226-227 |
-LRB- |
denotes |
[ |
T10133 |
227-229 |
CD |
denotes |
36 |
T10134 |
229-230 |
-RRB- |
denotes |
] |
T10135 |
231-233 |
TO |
denotes |
to |
T10136 |
234-240 |
VB |
denotes |
search |
T10137 |
241-244 |
DT |
denotes |
the |
T10139 |
245-254 |
VBN |
denotes |
published |
T10140 |
255-262 |
JJ |
denotes |
genomic |
T10141 |
263-266 |
CC |
denotes |
and |
T10142 |
267-271 |
NN |
denotes |
cDNA |
T10138 |
272-281 |
NNS |
denotes |
databases |
T10143 |
281-282 |
. |
denotes |
. |
T10144 |
282-402 |
sentence |
denotes |
For Takifugu rubripes, gene predictions were produced by the Ensembl automated pipeline [37] and the JGI blast server . |
T10145 |
283-286 |
IN |
denotes |
For |
T10147 |
287-295 |
NNP |
denotes |
Takifugu |
T10148 |
296-304 |
NNP |
denotes |
rubripes |
T10149 |
304-306 |
, |
denotes |
, |
T10150 |
306-310 |
NN |
denotes |
gene |
T10151 |
311-322 |
NNS |
denotes |
predictions |
T10152 |
323-327 |
VBD |
denotes |
were |
T10146 |
328-336 |
VBN |
denotes |
produced |
T10153 |
337-339 |
IN |
denotes |
by |
T10154 |
340-343 |
DT |
denotes |
the |
T10156 |
344-351 |
NNP |
denotes |
Ensembl |
T10157 |
352-361 |
VBN |
denotes |
automated |
T10155 |
362-370 |
NN |
denotes |
pipeline |
T10158 |
371-372 |
-LRB- |
denotes |
[ |
T10159 |
372-374 |
CD |
denotes |
37 |
T10160 |
374-375 |
-RRB- |
denotes |
] |
T10161 |
376-379 |
CC |
denotes |
and |
T10162 |
380-383 |
DT |
denotes |
the |
T10164 |
384-387 |
NN |
denotes |
JGI |
T10165 |
388-393 |
NN |
denotes |
blast |
T10163 |
394-400 |
NN |
denotes |
server |
T10166 |
401-402 |
. |
denotes |
. |
T10167 |
402-512 |
sentence |
denotes |
DNA sequences covering the homology regions were extracted and analyzed by Genscan to obtain potential exons. |
T10168 |
403-406 |
NN |
denotes |
DNA |
T10169 |
407-416 |
NNS |
denotes |
sequences |
T10171 |
417-425 |
VBG |
denotes |
covering |
T10172 |
426-429 |
DT |
denotes |
the |
T10174 |
430-438 |
NN |
denotes |
homology |
T10173 |
439-446 |
NNS |
denotes |
regions |
T10175 |
447-451 |
VBD |
denotes |
were |
T10170 |
452-461 |
VBN |
denotes |
extracted |
T10176 |
462-465 |
CC |
denotes |
and |
T10177 |
466-474 |
VBN |
denotes |
analyzed |
T10178 |
475-477 |
IN |
denotes |
by |
T10179 |
478-485 |
NNP |
denotes |
Genscan |
T10180 |
486-488 |
TO |
denotes |
to |
T10181 |
489-495 |
VB |
denotes |
obtain |
T10182 |
496-505 |
JJ |
denotes |
potential |
T10183 |
506-511 |
NNS |
denotes |
exons |
T10184 |
511-512 |
. |
denotes |
. |
T10185 |
512-655 |
sentence |
denotes |
In some cases, exons were added or modified based on the best similarity of translated peptides to the corresponding mouse and human proteins. |
T10186 |
513-515 |
IN |
denotes |
In |
T10188 |
516-520 |
DT |
denotes |
some |
T10189 |
521-526 |
NNS |
denotes |
cases |
T10190 |
526-528 |
, |
denotes |
, |
T10191 |
528-533 |
NNS |
denotes |
exons |
T10192 |
534-538 |
VBD |
denotes |
were |
T10187 |
539-544 |
VBN |
denotes |
added |
T10193 |
545-547 |
CC |
denotes |
or |
T10194 |
548-556 |
VBN |
denotes |
modified |
T10195 |
557-562 |
VBN |
denotes |
based |
T10196 |
563-565 |
IN |
denotes |
on |
T10197 |
566-569 |
DT |
denotes |
the |
T10199 |
570-574 |
JJS |
denotes |
best |
T10198 |
575-585 |
NN |
denotes |
similarity |
T10200 |
586-588 |
IN |
denotes |
of |
T10201 |
589-599 |
VBN |
denotes |
translated |
T10202 |
600-608 |
NNS |
denotes |
peptides |
T10203 |
609-611 |
IN |
denotes |
to |
T10204 |
612-615 |
DT |
denotes |
the |
T10206 |
616-629 |
VBG |
denotes |
corresponding |
T10207 |
630-635 |
NN |
denotes |
mouse |
T10208 |
636-639 |
CC |
denotes |
and |
T10209 |
640-645 |
JJ |
denotes |
human |
T10205 |
646-654 |
NN |
denotes |
proteins |
T10210 |
654-655 |
. |
denotes |
. |
T10211 |
655-833 |
sentence |
denotes |
For regions with low sequence similarity, genomic sequences from the fresh water pufferfish, Tetraodon nigroviridis were used as additional means to verify the predicted exons. |
T10212 |
656-659 |
IN |
denotes |
For |
T10214 |
660-667 |
NNS |
denotes |
regions |
T10215 |
668-672 |
IN |
denotes |
with |
T10216 |
673-676 |
JJ |
denotes |
low |
T10218 |
677-685 |
NN |
denotes |
sequence |
T10217 |
686-696 |
NN |
denotes |
similarity |
T10219 |
696-698 |
, |
denotes |
, |
T10220 |
698-705 |
JJ |
denotes |
genomic |
T10221 |
706-715 |
NNS |
denotes |
sequences |
T10222 |
717-721 |
IN |
denotes |
from |
T10223 |
722-725 |
DT |
denotes |
the |
T10225 |
726-731 |
JJ |
denotes |
fresh |
T10226 |
732-737 |
NN |
denotes |
water |
T10224 |
738-748 |
NN |
denotes |
pufferfish |
T10227 |
748-750 |
, |
denotes |
, |
T10228 |
750-759 |
NNP |
denotes |
Tetraodon |
T10229 |
760-772 |
NNP |
denotes |
nigroviridis |
T10230 |
773-777 |
VBD |
denotes |
were |
T10213 |
778-782 |
VBN |
denotes |
used |
T10231 |
783-785 |
IN |
denotes |
as |
T10232 |
786-796 |
JJ |
denotes |
additional |
T10233 |
797-802 |
NNS |
denotes |
means |
T10234 |
803-805 |
TO |
denotes |
to |
T10235 |
806-812 |
VB |
denotes |
verify |
T10236 |
813-816 |
DT |
denotes |
the |
T10238 |
817-826 |
VBN |
denotes |
predicted |
T10237 |
827-832 |
NNS |
denotes |
exons |
T10239 |
832-833 |
. |
denotes |
. |
T10240 |
833-1133 |
sentence |
denotes |
Due to the variability of the central region of vertebrate TACC3 cDNAs (see text), to further confirm prediction of the Takifugu rubripes TACC3, full length cDNAs corresponding to the Danio rerio TACC3 (IMAGE clones 2639991, 2640369 and 3724452) were also obtained from A.T.C.C. and fully sequenced. |
T10241 |
834-837 |
IN |
denotes |
Due |
T10243 |
838-840 |
IN |
denotes |
to |
T10244 |
841-844 |
DT |
denotes |
the |
T10245 |
845-856 |
NN |
denotes |
variability |
T10246 |
857-859 |
IN |
denotes |
of |
T10247 |
860-863 |
DT |
denotes |
the |
T10249 |
864-871 |
JJ |
denotes |
central |
T10248 |
872-878 |
NN |
denotes |
region |
T10250 |
879-881 |
IN |
denotes |
of |
T10251 |
882-892 |
NN |
denotes |
vertebrate |
T10253 |
893-898 |
NN |
denotes |
TACC3 |
T10252 |
899-904 |
NNS |
denotes |
cDNAs |
T10254 |
905-906 |
-LRB- |
denotes |
( |
T10255 |
906-909 |
VB |
denotes |
see |
T10256 |
910-914 |
NN |
denotes |
text |
T10257 |
914-915 |
-RRB- |
denotes |
) |
T10258 |
915-917 |
, |
denotes |
, |
T10259 |
917-919 |
TO |
denotes |
to |
T10261 |
920-927 |
RB |
denotes |
further |
T10260 |
928-935 |
VB |
denotes |
confirm |
T10262 |
936-946 |
NN |
denotes |
prediction |
T10263 |
947-949 |
IN |
denotes |
of |
T10264 |
950-953 |
DT |
denotes |
the |
T10266 |
954-962 |
NNP |
denotes |
Takifugu |
T10265 |
963-971 |
NNP |
denotes |
rubripes |
T10267 |
972-977 |
NN |
denotes |
TACC3 |
T10268 |
977-979 |
, |
denotes |
, |
T10269 |
979-983 |
JJ |
denotes |
full |
T10270 |
984-990 |
NN |
denotes |
length |
T10271 |
991-996 |
NNS |
denotes |
cDNAs |
T10272 |
997-1010 |
VBG |
denotes |
corresponding |
T10273 |
1011-1013 |
IN |
denotes |
to |
T10274 |
1014-1017 |
DT |
denotes |
the |
T10276 |
1018-1023 |
NNP |
denotes |
Danio |
T10277 |
1024-1029 |
NNP |
denotes |
rerio |
T10275 |
1030-1035 |
NN |
denotes |
TACC3 |
T10278 |
1036-1037 |
-LRB- |
denotes |
( |
T10280 |
1037-1042 |
NN |
denotes |
IMAGE |
T10281 |
1043-1049 |
NNS |
denotes |
clones |
T10279 |
1050-1057 |
CD |
denotes |
2639991 |
T10282 |
1057-1059 |
, |
denotes |
, |
T10283 |
1059-1066 |
CD |
denotes |
2640369 |
T10284 |
1067-1070 |
CC |
denotes |
and |
T10285 |
1071-1078 |
CD |
denotes |
3724452 |
T10286 |
1078-1079 |
-RRB- |
denotes |
) |
T10287 |
1080-1084 |
VBD |
denotes |
were |
T10288 |
1085-1089 |
RB |
denotes |
also |
T10242 |
1090-1098 |
VBN |
denotes |
obtained |
T10289 |
1099-1103 |
IN |
denotes |
from |
T10290 |
1104-1112 |
NN |
denotes |
A.T.C.C. |
T10291 |
1113-1116 |
CC |
denotes |
and |
T10292 |
1117-1122 |
RB |
denotes |
fully |
T10293 |
1123-1132 |
VBN |
denotes |
sequenced |
T10294 |
1132-1133 |
. |
denotes |
. |
T10295 |
1133-1311 |
sentence |
denotes |
Potential paralogous chromosomal segments and scaffold were identified by searching the public databases deposited at NCBI and at the Human Genome Mapping Project, Cambridge UK. |
T10296 |
1134-1143 |
JJ |
denotes |
Potential |
T10298 |
1144-1154 |
JJ |
denotes |
paralogous |
T10299 |
1155-1166 |
JJ |
denotes |
chromosomal |
T10297 |
1167-1175 |
NNS |
denotes |
segments |
T10301 |
1176-1179 |
CC |
denotes |
and |
T10302 |
1180-1188 |
NN |
denotes |
scaffold |
T10303 |
1189-1193 |
VBD |
denotes |
were |
T10300 |
1194-1204 |
VBN |
denotes |
identified |
T10304 |
1205-1207 |
IN |
denotes |
by |
T10305 |
1208-1217 |
VBG |
denotes |
searching |
T10306 |
1218-1221 |
DT |
denotes |
the |
T10308 |
1222-1228 |
JJ |
denotes |
public |
T10307 |
1229-1238 |
NNS |
denotes |
databases |
T10309 |
1239-1248 |
VBN |
denotes |
deposited |
T10310 |
1249-1251 |
IN |
denotes |
at |
T10311 |
1252-1256 |
NNP |
denotes |
NCBI |
T10312 |
1257-1260 |
CC |
denotes |
and |
T10313 |
1261-1263 |
IN |
denotes |
at |
T10314 |
1264-1267 |
DT |
denotes |
the |
T10316 |
1268-1273 |
NNP |
denotes |
Human |
T10317 |
1274-1280 |
NNP |
denotes |
Genome |
T10318 |
1281-1288 |
NNP |
denotes |
Mapping |
T10315 |
1289-1296 |
NNP |
denotes |
Project |
T10319 |
1296-1298 |
, |
denotes |
, |
T10320 |
1298-1307 |
NNP |
denotes |
Cambridge |
T10321 |
1308-1310 |
NNP |
denotes |
UK |
T10322 |
1310-1311 |
. |
denotes |
. |
T10439 |
1313-1320 |
NN |
denotes |
Cloning |
T10440 |
1321-1323 |
IN |
denotes |
of |
T10441 |
1324-1334 |
NN |
denotes |
vertebrate |
T10442 |
1335-1339 |
NN |
denotes |
TACC |
T10443 |
1340-1345 |
NNS |
denotes |
cDNAs |
T10444 |
1345-1610 |
sentence |
denotes |
The rabbit TACC3 was cloned by rt-PCR using the "TACC4" specific primer T4RACE2 [9] (5'-cccgaactgctccaggtaatcgatctc-3') and a consensus primer, T3con2, designed to the region encompassing the vertebrate TACC3 initiator methionine (5'-tatgagtctgcaggtcttaaacgac-3'). |
T10445 |
1346-1349 |
DT |
denotes |
The |
T10447 |
1350-1356 |
NN |
denotes |
rabbit |
T10446 |
1357-1362 |
NN |
denotes |
TACC3 |
T10449 |
1363-1366 |
VBD |
denotes |
was |
T10448 |
1367-1373 |
VBN |
denotes |
cloned |
T10450 |
1374-1376 |
IN |
denotes |
by |
T10451 |
1377-1379 |
NN |
denotes |
rt |
T10453 |
1379-1380 |
HYPH |
denotes |
- |
T10452 |
1380-1383 |
NN |
denotes |
PCR |
T10454 |
1384-1389 |
VBG |
denotes |
using |
T10455 |
1390-1393 |
DT |
denotes |
the |
T10457 |
1394-1395 |
`` |
denotes |
" |
T10459 |
1395-1400 |
NN |
denotes |
TACC4 |
T10460 |
1400-1401 |
'' |
denotes |
" |
T10458 |
1402-1410 |
JJ |
denotes |
specific |
T10456 |
1411-1417 |
NN |
denotes |
primer |
T10461 |
1418-1425 |
NN |
denotes |
T4RACE2 |
T10462 |
1426-1427 |
-LRB- |
denotes |
[ |
T10463 |
1427-1428 |
CD |
denotes |
9 |
T10464 |
1428-1429 |
-RRB- |
denotes |
] |
T10465 |
1430-1431 |
-LRB- |
denotes |
( |
T10467 |
1431-1432 |
CD |
denotes |
5 |
T10468 |
1432-1433 |
SYM |
denotes |
' |
T10469 |
1433-1434 |
HYPH |
denotes |
- |
T10466 |
1434-1461 |
NN |
denotes |
cccgaactgctccaggtaatcgatctc |
T10470 |
1461-1462 |
HYPH |
denotes |
- |
T10471 |
1462-1463 |
CD |
denotes |
3 |
T10472 |
1463-1464 |
SYM |
denotes |
' |
T10473 |
1464-1465 |
-RRB- |
denotes |
) |
T10474 |
1466-1469 |
CC |
denotes |
and |
T10475 |
1470-1471 |
DT |
denotes |
a |
T10477 |
1472-1481 |
NN |
denotes |
consensus |
T10476 |
1482-1488 |
NN |
denotes |
primer |
T10478 |
1488-1490 |
, |
denotes |
, |
T10479 |
1490-1496 |
NN |
denotes |
T3con2 |
T10480 |
1496-1498 |
, |
denotes |
, |
T10481 |
1498-1506 |
VBN |
denotes |
designed |
T10482 |
1507-1509 |
IN |
denotes |
to |
T10483 |
1510-1513 |
DT |
denotes |
the |
T10484 |
1514-1520 |
NN |
denotes |
region |
T10485 |
1521-1533 |
VBG |
denotes |
encompassing |
T10486 |
1534-1537 |
DT |
denotes |
the |
T10488 |
1538-1548 |
NN |
denotes |
vertebrate |
T10489 |
1549-1554 |
NN |
denotes |
TACC3 |
T10487 |
1555-1564 |
NN |
denotes |
initiator |
T10490 |
1565-1575 |
NN |
denotes |
methionine |
T10491 |
1576-1577 |
-LRB- |
denotes |
( |
T10493 |
1577-1578 |
CD |
denotes |
5 |
T10494 |
1578-1579 |
SYM |
denotes |
' |
T10495 |
1579-1580 |
HYPH |
denotes |
- |
T10492 |
1580-1605 |
NN |
denotes |
tatgagtctgcaggtcttaaacgac |
T10496 |
1605-1606 |
HYPH |
denotes |
- |
T10497 |
1606-1607 |
CD |
denotes |
3 |
T10498 |
1607-1608 |
SYM |
denotes |
' |
T10499 |
1608-1609 |
-RRB- |
denotes |
) |
T10500 |
1609-1610 |
. |
denotes |
. |
T10501 |
1610-1996 |
sentence |
denotes |
For cloning the mouse Tacc1X cDNA, the primers used were based upon the genomic sequence reported, and the sequence of the IMAGE cDNA clone 4933429K08: T1XF (5'-ccatgttcagtcattggcaggtc-3'), T1XF2 (5'-ctgcagaaccaacagttcaag-3'), T1XR1 (5'-agatctgtgacatcacagctc-3'), T1XR2 (5'-ctcgagtcagttagtcttatccagctt-3'), BB617F (5'-accaccaacttgagtacctg-3') and BB617R (5'-gtatcttgaactgttggttctg-3'). |
T10502 |
1611-1614 |
IN |
denotes |
For |
T10504 |
1615-1622 |
VBG |
denotes |
cloning |
T10505 |
1623-1626 |
DT |
denotes |
the |
T10507 |
1627-1632 |
NN |
denotes |
mouse |
T10508 |
1633-1639 |
NN |
denotes |
Tacc1X |
T10506 |
1640-1644 |
NN |
denotes |
cDNA |
T10509 |
1644-1646 |
, |
denotes |
, |
T10510 |
1646-1649 |
DT |
denotes |
the |
T10511 |
1650-1657 |
NNS |
denotes |
primers |
T10512 |
1658-1662 |
VBN |
denotes |
used |
T10513 |
1663-1667 |
VBD |
denotes |
were |
T10503 |
1668-1673 |
VBN |
denotes |
based |
T10514 |
1674-1678 |
IN |
denotes |
upon |
T10515 |
1679-1682 |
DT |
denotes |
the |
T10517 |
1683-1690 |
JJ |
denotes |
genomic |
T10516 |
1691-1699 |
NN |
denotes |
sequence |
T10518 |
1700-1708 |
VBN |
denotes |
reported |
T10519 |
1708-1710 |
, |
denotes |
, |
T10520 |
1710-1713 |
CC |
denotes |
and |
T10521 |
1714-1717 |
DT |
denotes |
the |
T10522 |
1718-1726 |
NN |
denotes |
sequence |
T10523 |
1727-1729 |
IN |
denotes |
of |
T10524 |
1730-1733 |
DT |
denotes |
the |
T10526 |
1734-1739 |
NN |
denotes |
IMAGE |
T10527 |
1740-1744 |
NN |
denotes |
cDNA |
T10525 |
1745-1750 |
NN |
denotes |
clone |
T10528 |
1751-1761 |
NN |
denotes |
4933429K08 |
T10529 |
1761-1763 |
: |
denotes |
: |
T10530 |
1763-1767 |
NN |
denotes |
T1XF |
T10531 |
1768-1769 |
-LRB- |
denotes |
( |
T10533 |
1769-1770 |
CD |
denotes |
5 |
T10534 |
1770-1771 |
SYM |
denotes |
' |
T10535 |
1771-1772 |
HYPH |
denotes |
- |
T10532 |
1772-1795 |
NN |
denotes |
ccatgttcagtcattggcaggtc |
T10536 |
1795-1796 |
HYPH |
denotes |
- |
T10537 |
1796-1797 |
CD |
denotes |
3 |
T10538 |
1797-1798 |
SYM |
denotes |
' |
T10539 |
1798-1799 |
-RRB- |
denotes |
) |
T10540 |
1799-1801 |
, |
denotes |
, |
T10541 |
1801-1806 |
NN |
denotes |
T1XF2 |
T10542 |
1807-1808 |
-LRB- |
denotes |
( |
T10544 |
1808-1809 |
CD |
denotes |
5 |
T10545 |
1809-1810 |
SYM |
denotes |
' |
T10546 |
1810-1811 |
HYPH |
denotes |
- |
T10543 |
1811-1832 |
NN |
denotes |
ctgcagaaccaacagttcaag |
T10547 |
1832-1833 |
HYPH |
denotes |
- |
T10548 |
1833-1834 |
CD |
denotes |
3 |
T10549 |
1834-1835 |
SYM |
denotes |
' |
T10550 |
1835-1836 |
-RRB- |
denotes |
) |
T10551 |
1836-1838 |
, |
denotes |
, |
T10552 |
1838-1843 |
NN |
denotes |
T1XR1 |
T10553 |
1844-1845 |
-LRB- |
denotes |
( |
T10555 |
1845-1846 |
CD |
denotes |
5 |
T10556 |
1846-1847 |
SYM |
denotes |
' |
T10557 |
1847-1848 |
HYPH |
denotes |
- |
T10554 |
1848-1869 |
NN |
denotes |
agatctgtgacatcacagctc |
T10558 |
1869-1870 |
HYPH |
denotes |
- |
T10559 |
1870-1871 |
CD |
denotes |
3 |
T10560 |
1871-1872 |
SYM |
denotes |
' |
T10561 |
1872-1873 |
-RRB- |
denotes |
) |
T10562 |
1873-1875 |
, |
denotes |
, |
T10563 |
1875-1880 |
NN |
denotes |
T1XR2 |
T10564 |
1881-1882 |
-LRB- |
denotes |
( |
T10566 |
1882-1883 |
CD |
denotes |
5 |
T10567 |
1883-1884 |
SYM |
denotes |
' |
T10568 |
1884-1885 |
HYPH |
denotes |
- |
T10565 |
1885-1912 |
NN |
denotes |
ctcgagtcagttagtcttatccagctt |
T10569 |
1912-1913 |
HYPH |
denotes |
- |
T10570 |
1913-1914 |
CD |
denotes |
3 |
T10571 |
1914-1915 |
SYM |
denotes |
' |
T10572 |
1915-1916 |
-RRB- |
denotes |
) |
T10573 |
1916-1918 |
, |
denotes |
, |
T10574 |
1918-1924 |
NN |
denotes |
BB617F |
T10575 |
1925-1926 |
-LRB- |
denotes |
( |
T10577 |
1926-1927 |
CD |
denotes |
5 |
T10578 |
1927-1928 |
SYM |
denotes |
' |
T10579 |
1928-1929 |
HYPH |
denotes |
- |
T10576 |
1929-1949 |
NN |
denotes |
accaccaacttgagtacctg |
T10580 |
1949-1950 |
HYPH |
denotes |
- |
T10581 |
1950-1951 |
CD |
denotes |
3 |
T10582 |
1951-1952 |
SYM |
denotes |
' |
T10583 |
1952-1953 |
-RRB- |
denotes |
) |
T10584 |
1954-1957 |
CC |
denotes |
and |
T10585 |
1958-1964 |
NN |
denotes |
BB617R |
T10586 |
1965-1966 |
-LRB- |
denotes |
( |
T10588 |
1966-1967 |
CD |
denotes |
5 |
T10589 |
1967-1968 |
SYM |
denotes |
' |
T10590 |
1968-1969 |
HYPH |
denotes |
- |
T10587 |
1969-1991 |
NN |
denotes |
gtatcttgaactgttggttctg |
T10591 |
1991-1992 |
HYPH |
denotes |
- |
T10592 |
1992-1993 |
CD |
denotes |
3 |
T10593 |
1993-1994 |
SYM |
denotes |
' |
T10594 |
1994-1995 |
-RRB- |
denotes |
) |
T10595 |
1995-1996 |
. |
denotes |
. |
T10596 |
1996-2203 |
sentence |
denotes |
For analysis of TACC1 splice variants, the forward primers used were located in exon 1b: EF (5'-gagagatgcgaaatcagcg-3'), Exon 1d: X3F (5'-agtcaaagaaggcatctgcag-3'), Exon 1a: 1DF (5'-ccaagttctgcgccatggg-3'). |
T10597 |
1997-2000 |
IN |
denotes |
For |
T10599 |
2001-2009 |
NN |
denotes |
analysis |
T10600 |
2010-2012 |
IN |
denotes |
of |
T10601 |
2013-2018 |
NN |
denotes |
TACC1 |
T10603 |
2019-2025 |
NN |
denotes |
splice |
T10602 |
2026-2034 |
NNS |
denotes |
variants |
T10604 |
2034-2036 |
, |
denotes |
, |
T10605 |
2036-2039 |
DT |
denotes |
the |
T10607 |
2040-2047 |
JJ |
denotes |
forward |
T10606 |
2048-2055 |
NNS |
denotes |
primers |
T10608 |
2056-2060 |
VBN |
denotes |
used |
T10609 |
2061-2065 |
VBD |
denotes |
were |
T10598 |
2066-2073 |
VBN |
denotes |
located |
T10610 |
2074-2076 |
IN |
denotes |
in |
T10611 |
2077-2081 |
NN |
denotes |
exon |
T10612 |
2082-2084 |
CD |
denotes |
1b |
T10613 |
2084-2086 |
: |
denotes |
: |
T10614 |
2086-2088 |
NN |
denotes |
EF |
T10616 |
2089-2090 |
-LRB- |
denotes |
( |
T10617 |
2090-2091 |
CD |
denotes |
5 |
T10618 |
2091-2092 |
SYM |
denotes |
' |
T10619 |
2092-2093 |
HYPH |
denotes |
- |
T10615 |
2093-2112 |
NN |
denotes |
gagagatgcgaaatcagcg |
T10620 |
2112-2113 |
HYPH |
denotes |
- |
T10621 |
2113-2114 |
CD |
denotes |
3 |
T10622 |
2114-2115 |
SYM |
denotes |
' |
T10623 |
2115-2116 |
-RRB- |
denotes |
) |
T10624 |
2116-2118 |
, |
denotes |
, |
T10625 |
2118-2122 |
NN |
denotes |
Exon |
T10626 |
2123-2125 |
CD |
denotes |
1d |
T10627 |
2125-2127 |
: |
denotes |
: |
T10628 |
2127-2130 |
NN |
denotes |
X3F |
T10630 |
2131-2132 |
-LRB- |
denotes |
( |
T10631 |
2132-2133 |
CD |
denotes |
5 |
T10632 |
2133-2134 |
SYM |
denotes |
' |
T10633 |
2134-2135 |
HYPH |
denotes |
- |
T10629 |
2135-2156 |
NN |
denotes |
agtcaaagaaggcatctgcag |
T10634 |
2156-2157 |
HYPH |
denotes |
- |
T10635 |
2157-2158 |
CD |
denotes |
3 |
T10636 |
2158-2159 |
SYM |
denotes |
' |
T10637 |
2159-2160 |
-RRB- |
denotes |
) |
T10638 |
2160-2162 |
, |
denotes |
, |
T10639 |
2162-2166 |
NN |
denotes |
Exon |
T10640 |
2167-2169 |
CD |
denotes |
1a |
T10641 |
2169-2171 |
: |
denotes |
: |
T10642 |
2171-2174 |
NN |
denotes |
1DF |
T10644 |
2175-2176 |
-LRB- |
denotes |
( |
T10645 |
2176-2177 |
CD |
denotes |
5 |
T10646 |
2177-2178 |
SYM |
denotes |
' |
T10647 |
2178-2179 |
HYPH |
denotes |
- |
T10643 |
2179-2198 |
NN |
denotes |
ccaagttctgcgccatggg |
T10648 |
2198-2199 |
HYPH |
denotes |
- |
T10649 |
2199-2200 |
CD |
denotes |
3 |
T10650 |
2200-2201 |
SYM |
denotes |
' |
T10651 |
2201-2202 |
-RRB- |
denotes |
) |
T10652 |
2202-2203 |
. |
denotes |
. |
T10653 |
2203-2462 |
sentence |
denotes |
The reverse primers used were: Exon 1: X1R (5'-ggatttggtctcggcttgcgaatc-3'), Exon 2: BX647R (5'-cttgtgattcttggcttttgg-3'), Exon 3: 6SPR (5'-gtcatcgcctcgtcctggagggc-3'), Exon 4a: 1DR (5'-aatttcacttgttcagtagtc-3'), Exon 5: 128R (5'-cctgcttctgaggatgaaaacgc-3'). |
T10654 |
2204-2207 |
DT |
denotes |
The |
T10656 |
2208-2215 |
JJ |
denotes |
reverse |
T10655 |
2216-2223 |
NNS |
denotes |
primers |
T10658 |
2224-2228 |
VBN |
denotes |
used |
T10657 |
2229-2233 |
VBD |
denotes |
were |
T10659 |
2233-2235 |
: |
denotes |
: |
T10660 |
2235-2239 |
NN |
denotes |
Exon |
T10661 |
2240-2241 |
CD |
denotes |
1 |
T10662 |
2241-2243 |
: |
denotes |
: |
T10663 |
2243-2246 |
NN |
denotes |
X1R |
T10665 |
2247-2248 |
-LRB- |
denotes |
( |
T10666 |
2248-2249 |
CD |
denotes |
5 |
T10667 |
2249-2250 |
SYM |
denotes |
' |
T10668 |
2250-2251 |
HYPH |
denotes |
- |
T10664 |
2251-2275 |
NN |
denotes |
ggatttggtctcggcttgcgaatc |
T10669 |
2275-2276 |
HYPH |
denotes |
- |
T10670 |
2276-2277 |
CD |
denotes |
3 |
T10671 |
2277-2278 |
SYM |
denotes |
' |
T10672 |
2278-2279 |
-RRB- |
denotes |
) |
T10673 |
2279-2281 |
, |
denotes |
, |
T10674 |
2281-2285 |
NN |
denotes |
Exon |
T10675 |
2286-2287 |
CD |
denotes |
2 |
T10676 |
2287-2289 |
: |
denotes |
: |
T10677 |
2289-2295 |
NN |
denotes |
BX647R |
T10679 |
2296-2297 |
-LRB- |
denotes |
( |
T10680 |
2297-2298 |
CD |
denotes |
5 |
T10681 |
2298-2299 |
SYM |
denotes |
' |
T10682 |
2299-2300 |
HYPH |
denotes |
- |
T10678 |
2300-2321 |
NN |
denotes |
cttgtgattcttggcttttgg |
T10683 |
2321-2322 |
HYPH |
denotes |
- |
T10684 |
2322-2323 |
CD |
denotes |
3 |
T10685 |
2323-2324 |
SYM |
denotes |
' |
T10686 |
2324-2325 |
-RRB- |
denotes |
) |
T10687 |
2325-2327 |
, |
denotes |
, |
T10688 |
2327-2331 |
NN |
denotes |
Exon |
T10689 |
2332-2333 |
CD |
denotes |
3 |
T10690 |
2333-2335 |
: |
denotes |
: |
T10691 |
2335-2339 |
NN |
denotes |
6SPR |
T10693 |
2340-2341 |
-LRB- |
denotes |
( |
T10694 |
2341-2342 |
CD |
denotes |
5 |
T10695 |
2342-2343 |
SYM |
denotes |
' |
T10696 |
2343-2344 |
HYPH |
denotes |
- |
T10692 |
2344-2367 |
NN |
denotes |
gtcatcgcctcgtcctggagggc |
T10697 |
2367-2368 |
HYPH |
denotes |
- |
T10698 |
2368-2369 |
CD |
denotes |
3 |
T10699 |
2369-2370 |
SYM |
denotes |
' |
T10700 |
2370-2371 |
-RRB- |
denotes |
) |
T10701 |
2371-2373 |
, |
denotes |
, |
T10702 |
2373-2377 |
NN |
denotes |
Exon |
T10703 |
2378-2380 |
NN |
denotes |
4a |
T10704 |
2380-2382 |
: |
denotes |
: |
T10705 |
2382-2385 |
NN |
denotes |
1DR |
T10707 |
2386-2387 |
-LRB- |
denotes |
( |
T10708 |
2387-2388 |
CD |
denotes |
5 |
T10709 |
2388-2389 |
SYM |
denotes |
' |
T10710 |
2389-2390 |
HYPH |
denotes |
- |
T10706 |
2390-2411 |
NN |
denotes |
aatttcacttgttcagtagtc |
T10711 |
2411-2412 |
HYPH |
denotes |
- |
T10712 |
2412-2413 |
CD |
denotes |
3 |
T10713 |
2413-2414 |
SYM |
denotes |
' |
T10714 |
2414-2415 |
-RRB- |
denotes |
) |
T10715 |
2415-2417 |
, |
denotes |
, |
T10716 |
2417-2421 |
NN |
denotes |
Exon |
T10717 |
2422-2423 |
CD |
denotes |
5 |
T10718 |
2423-2425 |
: |
denotes |
: |
T10719 |
2425-2429 |
NN |
denotes |
128R |
T10721 |
2430-2431 |
-LRB- |
denotes |
( |
T10722 |
2431-2432 |
CD |
denotes |
5 |
T10723 |
2432-2433 |
SYM |
denotes |
' |
T10724 |
2433-2434 |
HYPH |
denotes |
- |
T10720 |
2434-2457 |
NN |
denotes |
cctgcttctgaggatgaaaacgc |
T10725 |
2457-2458 |
HYPH |
denotes |
- |
T10726 |
2458-2459 |
CD |
denotes |
3 |
T10727 |
2459-2460 |
SYM |
denotes |
' |
T10728 |
2460-2461 |
-RRB- |
denotes |
) |
T10729 |
2461-2462 |
. |
denotes |
. |
T10730 |
2462-2595 |
sentence |
denotes |
Rabbit brain poly A+ mRNA, mouse testis and human brain total RNA were obtained from BD Bioscience Clontech (Palo Alto, CA, U.S.A.). |
T10731 |
2463-2469 |
NN |
denotes |
Rabbit |
T10732 |
2470-2475 |
NN |
denotes |
brain |
T10734 |
2476-2480 |
NN |
denotes |
poly |
T10735 |
2481-2483 |
NN |
denotes |
A+ |
T10733 |
2484-2488 |
NN |
denotes |
mRNA |
T10737 |
2488-2490 |
, |
denotes |
, |
T10738 |
2490-2495 |
NN |
denotes |
mouse |
T10739 |
2496-2502 |
NN |
denotes |
testis |
T10740 |
2503-2506 |
CC |
denotes |
and |
T10741 |
2507-2512 |
JJ |
denotes |
human |
T10742 |
2513-2518 |
NN |
denotes |
brain |
T10744 |
2519-2524 |
JJ |
denotes |
total |
T10743 |
2525-2528 |
NN |
denotes |
RNA |
T10745 |
2529-2533 |
VBD |
denotes |
were |
T10736 |
2534-2542 |
VBN |
denotes |
obtained |
T10746 |
2543-2547 |
IN |
denotes |
from |
T10747 |
2548-2550 |
NNP |
denotes |
BD |
T10749 |
2551-2561 |
NNP |
denotes |
Bioscience |
T10748 |
2562-2570 |
NNP |
denotes |
Clontech |
T10750 |
2571-2572 |
-LRB- |
denotes |
( |
T10751 |
2572-2576 |
NNP |
denotes |
Palo |
T10752 |
2577-2581 |
NNP |
denotes |
Alto |
T10753 |
2581-2583 |
, |
denotes |
, |
T10754 |
2583-2585 |
NNP |
denotes |
CA |
T10755 |
2585-2587 |
, |
denotes |
, |
T10756 |
2587-2593 |
NNP |
denotes |
U.S.A. |
T10757 |
2593-2594 |
-RRB- |
denotes |
) |
T10758 |
2594-2595 |
. |
denotes |
. |
T10759 |
2595-2765 |
sentence |
denotes |
Reverse transcription and PCR was performed as previously described, using either 1 μg of total RNA or 50 ng of poly A+ mRNA as template for first strand cDNA synthesis. |
T10760 |
2596-2603 |
JJ |
denotes |
Reverse |
T10761 |
2604-2617 |
NN |
denotes |
transcription |
T10763 |
2618-2621 |
CC |
denotes |
and |
T10764 |
2622-2625 |
NN |
denotes |
PCR |
T10765 |
2626-2629 |
VBD |
denotes |
was |
T10762 |
2630-2639 |
VBN |
denotes |
performed |
T10766 |
2640-2642 |
IN |
denotes |
as |
T10768 |
2643-2653 |
RB |
denotes |
previously |
T10767 |
2654-2663 |
VBN |
denotes |
described |
T10769 |
2663-2665 |
, |
denotes |
, |
T10770 |
2665-2670 |
VBG |
denotes |
using |
T10771 |
2671-2677 |
CC |
denotes |
either |
T10773 |
2678-2679 |
CD |
denotes |
1 |
T10772 |
2680-2682 |
NN |
denotes |
μg |
T10774 |
2683-2685 |
IN |
denotes |
of |
T10775 |
2686-2691 |
JJ |
denotes |
total |
T10776 |
2692-2695 |
NN |
denotes |
RNA |
T10777 |
2696-2698 |
CC |
denotes |
or |
T10778 |
2699-2701 |
CD |
denotes |
50 |
T10779 |
2702-2704 |
NNS |
denotes |
ng |
T10780 |
2705-2707 |
IN |
denotes |
of |
T10781 |
2708-2712 |
NN |
denotes |
poly |
T10782 |
2713-2715 |
NN |
denotes |
A+ |
T10783 |
2716-2720 |
NN |
denotes |
mRNA |
T10784 |
2721-2723 |
IN |
denotes |
as |
T10785 |
2724-2732 |
NN |
denotes |
template |
T10786 |
2733-2736 |
IN |
denotes |
for |
T10787 |
2737-2742 |
JJ |
denotes |
first |
T10788 |
2743-2749 |
NN |
denotes |
strand |
T10789 |
2750-2754 |
NN |
denotes |
cDNA |
T10790 |
2755-2764 |
NN |
denotes |
synthesis |
T10791 |
2764-2765 |
. |
denotes |
. |
T10792 |
2765-2881 |
sentence |
denotes |
PCR products were cloned into pCR2.1 (Invitrogen, Carlsbad CA, U.S.A.) and transformed into InvαF' competent cells. |
T10793 |
2766-2769 |
NN |
denotes |
PCR |
T10794 |
2770-2778 |
NNS |
denotes |
products |
T10796 |
2779-2783 |
VBD |
denotes |
were |
T10795 |
2784-2790 |
VBN |
denotes |
cloned |
T10797 |
2791-2795 |
IN |
denotes |
into |
T10798 |
2796-2802 |
NN |
denotes |
pCR2.1 |
T10799 |
2803-2804 |
-LRB- |
denotes |
( |
T10800 |
2804-2814 |
NNP |
denotes |
Invitrogen |
T10801 |
2814-2816 |
, |
denotes |
, |
T10802 |
2816-2824 |
NNP |
denotes |
Carlsbad |
T10803 |
2825-2827 |
NNP |
denotes |
CA |
T10804 |
2827-2829 |
, |
denotes |
, |
T10805 |
2829-2835 |
NNP |
denotes |
U.S.A. |
T10806 |
2835-2836 |
-RRB- |
denotes |
) |
T10807 |
2837-2840 |
CC |
denotes |
and |
T10808 |
2841-2852 |
VBN |
denotes |
transformed |
T10809 |
2853-2857 |
IN |
denotes |
into |
T10810 |
2858-2863 |
NN |
denotes |
InvαF |
T10812 |
2863-2864 |
POS |
denotes |
' |
T10811 |
2865-2874 |
JJ |
denotes |
competent |
T10813 |
2875-2880 |
NNS |
denotes |
cells |
T10814 |
2880-2881 |
. |
denotes |
. |
T10815 |
2881-2975 |
sentence |
denotes |
Plasmid inserts were sequenced by the Roswell Park Cancer Institute Biopolymer Core Facility. |
T10816 |
2882-2889 |
NN |
denotes |
Plasmid |
T10817 |
2890-2897 |
NNS |
denotes |
inserts |
T10819 |
2898-2902 |
VBD |
denotes |
were |
T10818 |
2903-2912 |
VBN |
denotes |
sequenced |
T10820 |
2913-2915 |
IN |
denotes |
by |
T10821 |
2916-2919 |
DT |
denotes |
the |
T10823 |
2920-2927 |
NNP |
denotes |
Roswell |
T10824 |
2928-2932 |
NNP |
denotes |
Park |
T10826 |
2933-2939 |
NNP |
denotes |
Cancer |
T10825 |
2940-2949 |
NNP |
denotes |
Institute |
T10827 |
2950-2960 |
NNP |
denotes |
Biopolymer |
T10828 |
2961-2965 |
NNP |
denotes |
Core |
T10822 |
2966-2974 |
NNP |
denotes |
Facility |
T10829 |
2974-2975 |
. |
denotes |
. |
T10982 |
2977-2987 |
NN |
denotes |
Deposition |
T10983 |
2988-2990 |
IN |
denotes |
of |
T10984 |
2991-3001 |
NN |
denotes |
nucleotide |
T10985 |
3002-3011 |
NNS |
denotes |
sequences |
T10986 |
3011-3363 |
sentence |
denotes |
Sequences from this article have been deposited in the GenBank database with the following accession numbers: Homo sapiens TACC1 short isoform S (AY177411), Mus musculus TACC1 short isoform S (AY177412), Mus musculus TACC1 long isoform A (AY177413), Mus musculus TACC2s (AY177410), Oryctolagus cuniculus TACC3 (AY161270), Danio rerio TACC3 (AY170618). |
T10987 |
3012-3021 |
NNS |
denotes |
Sequences |
T10989 |
3022-3026 |
IN |
denotes |
from |
T10990 |
3027-3031 |
DT |
denotes |
this |
T10991 |
3032-3039 |
NN |
denotes |
article |
T10992 |
3040-3044 |
VBP |
denotes |
have |
T10993 |
3045-3049 |
VBN |
denotes |
been |
T10988 |
3050-3059 |
VBN |
denotes |
deposited |
T10994 |
3060-3062 |
IN |
denotes |
in |
T10995 |
3063-3066 |
DT |
denotes |
the |
T10997 |
3067-3074 |
NNP |
denotes |
GenBank |
T10996 |
3075-3083 |
NN |
denotes |
database |
T10998 |
3084-3088 |
IN |
denotes |
with |
T10999 |
3089-3092 |
DT |
denotes |
the |
T11001 |
3093-3102 |
VBG |
denotes |
following |
T11002 |
3103-3112 |
NN |
denotes |
accession |
T11000 |
3113-3120 |
NNS |
denotes |
numbers |
T11003 |
3120-3122 |
: |
denotes |
: |
T11004 |
3122-3126 |
NNP |
denotes |
Homo |
T11005 |
3127-3134 |
NNP |
denotes |
sapiens |
T11007 |
3135-3140 |
NN |
denotes |
TACC1 |
T11008 |
3141-3146 |
JJ |
denotes |
short |
T11009 |
3147-3154 |
NN |
denotes |
isoform |
T11006 |
3155-3156 |
NN |
denotes |
S |
T11010 |
3157-3158 |
-LRB- |
denotes |
( |
T11011 |
3158-3166 |
NN |
denotes |
AY177411 |
T11012 |
3166-3167 |
-RRB- |
denotes |
) |
T11013 |
3167-3169 |
, |
denotes |
, |
T11014 |
3169-3172 |
NNP |
denotes |
Mus |
T11015 |
3173-3181 |
NNP |
denotes |
musculus |
T11017 |
3182-3187 |
NN |
denotes |
TACC1 |
T11018 |
3188-3193 |
JJ |
denotes |
short |
T11019 |
3194-3201 |
NN |
denotes |
isoform |
T11016 |
3202-3203 |
NN |
denotes |
S |
T11020 |
3204-3205 |
-LRB- |
denotes |
( |
T11021 |
3205-3213 |
NN |
denotes |
AY177412 |
T11022 |
3213-3214 |
-RRB- |
denotes |
) |
T11023 |
3214-3216 |
, |
denotes |
, |
T11024 |
3216-3219 |
NNP |
denotes |
Mus |
T11025 |
3220-3228 |
NNP |
denotes |
musculus |
T11027 |
3229-3234 |
NN |
denotes |
TACC1 |
T11028 |
3235-3239 |
JJ |
denotes |
long |
T11029 |
3240-3247 |
NN |
denotes |
isoform |
T11026 |
3248-3249 |
NN |
denotes |
A |
T11030 |
3250-3251 |
-LRB- |
denotes |
( |
T11031 |
3251-3259 |
NN |
denotes |
AY177413 |
T11032 |
3259-3260 |
-RRB- |
denotes |
) |
T11033 |
3260-3262 |
, |
denotes |
, |
T11034 |
3262-3265 |
NNP |
denotes |
Mus |
T11035 |
3266-3274 |
NNP |
denotes |
musculus |
T11036 |
3275-3281 |
NNS |
denotes |
TACC2s |
T11037 |
3282-3283 |
-LRB- |
denotes |
( |
T11038 |
3283-3291 |
NN |
denotes |
AY177410 |
T11039 |
3291-3292 |
-RRB- |
denotes |
) |
T11040 |
3292-3294 |
, |
denotes |
, |
T11041 |
3294-3305 |
NNP |
denotes |
Oryctolagus |
T11042 |
3306-3315 |
NNP |
denotes |
cuniculus |
T11043 |
3316-3321 |
NN |
denotes |
TACC3 |
T11044 |
3322-3323 |
-LRB- |
denotes |
( |
T11045 |
3323-3331 |
NN |
denotes |
AY161270 |
T11046 |
3331-3332 |
-RRB- |
denotes |
) |
T11047 |
3332-3334 |
, |
denotes |
, |
T11048 |
3334-3339 |
NNP |
denotes |
Danio |
T11049 |
3340-3345 |
NNP |
denotes |
rerio |
T11050 |
3346-3351 |
NN |
denotes |
TACC3 |
T11051 |
3352-3353 |
-LRB- |
denotes |
( |
T11052 |
3353-3361 |
NN |
denotes |
AY170618 |
T11053 |
3361-3362 |
-RRB- |
denotes |
) |
T11054 |
3362-3363 |
. |
denotes |
. |
T11055 |
3363-4077 |
sentence |
denotes |
Annotations submitted to the Third party annotation database at NCBI are as follows: Rattus norvegus TACC1 long isoform A (BK001653), Takifugu rubripes TACC1A (BK000666/BK000667), Takifugu rubripes TACC1B (BK000664), Mus musculus TACC2l (BK001495), Rattus norvegus TACC2l (BK001658), Rattus norvegus TACC2s (BK001657), Takifugu rubripes TACC2l (BK000690), Rattus norvegus TACC3 (BK001491), Gallus gallus TACC3 (BK001482), Silurana tropicalis TACC3 (BK001481),Takifugu rubripes TACC3 (BK000649), Takifugu rubripes RHAMM (BK000676), Ciona intestinalis RHAMM (BK001479), Takifugu rubripes Keratin (BK000677), Takifugu rubripes TPM1 (BAC10576), Ciona intestinalis Kif3b (BK001492), Ciona intestinalis klp2 (BK001493). |
T11056 |
3364-3375 |
NNS |
denotes |
Annotations |
T11058 |
3376-3385 |
VBN |
denotes |
submitted |
T11059 |
3386-3388 |
IN |
denotes |
to |
T11060 |
3389-3392 |
DT |
denotes |
the |
T11062 |
3393-3398 |
JJ |
denotes |
Third |
T11063 |
3399-3404 |
NN |
denotes |
party |
T11064 |
3405-3415 |
NN |
denotes |
annotation |
T11061 |
3416-3424 |
NN |
denotes |
database |
T11065 |
3425-3427 |
IN |
denotes |
at |
T11066 |
3428-3432 |
NNP |
denotes |
NCBI |
T11057 |
3433-3436 |
VBP |
denotes |
are |
T11067 |
3437-3439 |
IN |
denotes |
as |
T11068 |
3440-3447 |
VBZ |
denotes |
follows |
T11069 |
3447-3449 |
: |
denotes |
: |
T11070 |
3449-3455 |
NNP |
denotes |
Rattus |
T11071 |
3456-3464 |
NNP |
denotes |
norvegus |
T11073 |
3465-3470 |
NN |
denotes |
TACC1 |
T11074 |
3471-3475 |
JJ |
denotes |
long |
T11075 |
3476-3483 |
NN |
denotes |
isoform |
T11072 |
3484-3485 |
NN |
denotes |
A |
T11076 |
3486-3487 |
-LRB- |
denotes |
( |
T11077 |
3487-3495 |
NN |
denotes |
BK001653 |
T11078 |
3495-3496 |
-RRB- |
denotes |
) |
T11079 |
3496-3498 |
, |
denotes |
, |
T11080 |
3498-3506 |
NNP |
denotes |
Takifugu |
T11081 |
3507-3515 |
NNP |
denotes |
rubripes |
T11082 |
3516-3522 |
NN |
denotes |
TACC1A |
T11083 |
3523-3524 |
-LRB- |
denotes |
( |
T11085 |
3524-3532 |
NN |
denotes |
BK000666 |
T11086 |
3532-3533 |
HYPH |
denotes |
/ |
T11084 |
3533-3541 |
NN |
denotes |
BK000667 |
T11087 |
3541-3542 |
-RRB- |
denotes |
) |
T11088 |
3542-3544 |
, |
denotes |
, |
T11089 |
3544-3552 |
NNP |
denotes |
Takifugu |
T11090 |
3553-3561 |
NNP |
denotes |
rubripes |
T11091 |
3562-3568 |
NN |
denotes |
TACC1B |
T11092 |
3569-3570 |
-LRB- |
denotes |
( |
T11093 |
3570-3578 |
NN |
denotes |
BK000664 |
T11094 |
3578-3579 |
-RRB- |
denotes |
) |
T11095 |
3579-3581 |
, |
denotes |
, |
T11096 |
3581-3584 |
NNP |
denotes |
Mus |
T11097 |
3585-3593 |
NNP |
denotes |
musculus |
T11098 |
3594-3600 |
NN |
denotes |
TACC2l |
T11099 |
3601-3602 |
-LRB- |
denotes |
( |
T11100 |
3602-3610 |
NN |
denotes |
BK001495 |
T11101 |
3610-3611 |
-RRB- |
denotes |
) |
T11102 |
3611-3613 |
, |
denotes |
, |
T11103 |
3613-3619 |
NNP |
denotes |
Rattus |
T11104 |
3620-3628 |
NNP |
denotes |
norvegus |
T11105 |
3629-3635 |
NN |
denotes |
TACC2l |
T11106 |
3636-3637 |
-LRB- |
denotes |
( |
T11107 |
3637-3645 |
NN |
denotes |
BK001658 |
T11108 |
3645-3646 |
-RRB- |
denotes |
) |
T11109 |
3646-3648 |
, |
denotes |
, |
T11110 |
3648-3654 |
NNP |
denotes |
Rattus |
T11111 |
3655-3663 |
NNP |
denotes |
norvegus |
T11112 |
3664-3670 |
NNS |
denotes |
TACC2s |
T11113 |
3671-3672 |
-LRB- |
denotes |
( |
T11114 |
3672-3680 |
NN |
denotes |
BK001657 |
T11115 |
3680-3681 |
-RRB- |
denotes |
) |
T11116 |
3681-3683 |
, |
denotes |
, |
T11117 |
3683-3691 |
NNP |
denotes |
Takifugu |
T11118 |
3692-3700 |
NNP |
denotes |
rubripes |
T11119 |
3701-3707 |
NN |
denotes |
TACC2l |
T11120 |
3708-3709 |
-LRB- |
denotes |
( |
T11121 |
3709-3717 |
NN |
denotes |
BK000690 |
T11122 |
3717-3718 |
-RRB- |
denotes |
) |
T11123 |
3718-3720 |
, |
denotes |
, |
T11124 |
3720-3726 |
NNP |
denotes |
Rattus |
T11125 |
3727-3735 |
NNP |
denotes |
norvegus |
T11126 |
3736-3741 |
NN |
denotes |
TACC3 |
T11127 |
3742-3743 |
-LRB- |
denotes |
( |
T11128 |
3743-3751 |
NN |
denotes |
BK001491 |
T11129 |
3751-3752 |
-RRB- |
denotes |
) |
T11130 |
3752-3754 |
, |
denotes |
, |
T11131 |
3754-3760 |
NNP |
denotes |
Gallus |
T11132 |
3761-3767 |
NNP |
denotes |
gallus |
T11133 |
3768-3773 |
NN |
denotes |
TACC3 |
T11134 |
3774-3775 |
-LRB- |
denotes |
( |
T11135 |
3775-3783 |
NN |
denotes |
BK001482 |
T11136 |
3783-3784 |
-RRB- |
denotes |
) |
T11137 |
3784-3786 |
, |
denotes |
, |
T11138 |
3786-3794 |
NNP |
denotes |
Silurana |
T11139 |
3795-3805 |
NNP |
denotes |
tropicalis |
T11140 |
3806-3811 |
NN |
denotes |
TACC3 |
T11141 |
3812-3813 |
-LRB- |
denotes |
( |
T11142 |
3813-3821 |
NN |
denotes |
BK001481 |
T11143 |
3821-3822 |
-RRB- |
denotes |
) |
T11144 |
3822-3823 |
, |
denotes |
, |
T11145 |
3823-3831 |
NNP |
denotes |
Takifugu |
T11146 |
3832-3840 |
NNP |
denotes |
rubripes |
T11147 |
3841-3846 |
NN |
denotes |
TACC3 |
T11148 |
3847-3848 |
-LRB- |
denotes |
( |
T11149 |
3848-3856 |
NN |
denotes |
BK000649 |
T11150 |
3856-3857 |
-RRB- |
denotes |
) |
T11151 |
3857-3859 |
, |
denotes |
, |
T11152 |
3859-3867 |
NNP |
denotes |
Takifugu |
T11153 |
3868-3876 |
NNP |
denotes |
rubripes |
T11154 |
3877-3882 |
NN |
denotes |
RHAMM |
T11155 |
3883-3884 |
-LRB- |
denotes |
( |
T11156 |
3884-3892 |
NN |
denotes |
BK000676 |
T11157 |
3892-3893 |
-RRB- |
denotes |
) |
T11158 |
3893-3895 |
, |
denotes |
, |
T11159 |
3895-3900 |
NNP |
denotes |
Ciona |
T11160 |
3901-3913 |
NNP |
denotes |
intestinalis |
T11161 |
3914-3919 |
NN |
denotes |
RHAMM |
T11162 |
3920-3921 |
-LRB- |
denotes |
( |
T11163 |
3921-3929 |
NN |
denotes |
BK001479 |
T11164 |
3929-3930 |
-RRB- |
denotes |
) |
T11165 |
3930-3932 |
, |
denotes |
, |
T11166 |
3932-3940 |
NNP |
denotes |
Takifugu |
T11167 |
3941-3949 |
NNP |
denotes |
rubripes |
T11168 |
3950-3957 |
NN |
denotes |
Keratin |
T11169 |
3958-3959 |
-LRB- |
denotes |
( |
T11170 |
3959-3967 |
NN |
denotes |
BK000677 |
T11171 |
3967-3968 |
-RRB- |
denotes |
) |
T11172 |
3968-3970 |
, |
denotes |
, |
T11173 |
3970-3978 |
NNP |
denotes |
Takifugu |
T11174 |
3979-3987 |
NNP |
denotes |
rubripes |
T11175 |
3988-3992 |
NN |
denotes |
TPM1 |
T11176 |
3993-3994 |
-LRB- |
denotes |
( |
T11177 |
3994-4002 |
NN |
denotes |
BAC10576 |
T11178 |
4002-4003 |
-RRB- |
denotes |
) |
T11179 |
4003-4005 |
, |
denotes |
, |
T11180 |
4005-4010 |
NNP |
denotes |
Ciona |
T11181 |
4011-4023 |
NNP |
denotes |
intestinalis |
T11182 |
4024-4029 |
NN |
denotes |
Kif3b |
T11183 |
4030-4031 |
-LRB- |
denotes |
( |
T11184 |
4031-4039 |
NN |
denotes |
BK001492 |
T11185 |
4039-4040 |
-RRB- |
denotes |
) |
T11186 |
4040-4042 |
, |
denotes |
, |
T11187 |
4042-4047 |
NNP |
denotes |
Ciona |
T11188 |
4048-4060 |
NNP |
denotes |
intestinalis |
T11189 |
4061-4065 |
NN |
denotes |
klp2 |
T11190 |
4066-4067 |
-LRB- |
denotes |
( |
T11191 |
4067-4075 |
NN |
denotes |
BK001493 |
T11192 |
4075-4076 |
-RRB- |
denotes |
) |
T11193 |
4076-4077 |
. |
denotes |
. |
T11434 |
4079-4091 |
JJ |
denotes |
Phylogenetic |
T11435 |
4092-4100 |
NN |
denotes |
analysis |
T11436 |
4100-4584 |
sentence |
denotes |
In order to examine evolutionary relationships of proteins containing coiled coil domains, protein sequences representing the major members of this super family, including TACC, RHAMM, KLP, keratin and tropomyosin from available vertebrates and their recognizable orthologues from the urochordate Ciona intestinalis, Drosophila melanogaster, C. elegans and Saccharomyces cerevisiae were either directly retrieved from NCBI sequence databases, newly predicted or isolated (see above). |
T11437 |
4101-4103 |
IN |
denotes |
In |
T11439 |
4104-4109 |
NN |
denotes |
order |
T11440 |
4110-4112 |
TO |
denotes |
to |
T11441 |
4113-4120 |
VB |
denotes |
examine |
T11442 |
4121-4133 |
JJ |
denotes |
evolutionary |
T11443 |
4134-4147 |
NNS |
denotes |
relationships |
T11444 |
4148-4150 |
IN |
denotes |
of |
T11445 |
4151-4159 |
NN |
denotes |
proteins |
T11446 |
4160-4170 |
VBG |
denotes |
containing |
T11447 |
4171-4177 |
VBN |
denotes |
coiled |
T11448 |
4178-4182 |
NN |
denotes |
coil |
T11449 |
4183-4190 |
NNS |
denotes |
domains |
T11450 |
4190-4192 |
, |
denotes |
, |
T11451 |
4192-4199 |
NN |
denotes |
protein |
T11452 |
4200-4209 |
NNS |
denotes |
sequences |
T11453 |
4210-4222 |
VBG |
denotes |
representing |
T11454 |
4223-4226 |
DT |
denotes |
the |
T11456 |
4227-4232 |
JJ |
denotes |
major |
T11455 |
4233-4240 |
NNS |
denotes |
members |
T11457 |
4241-4243 |
IN |
denotes |
of |
T11458 |
4244-4248 |
DT |
denotes |
this |
T11460 |
4249-4254 |
JJ |
denotes |
super |
T11459 |
4255-4261 |
NN |
denotes |
family |
T11461 |
4261-4263 |
, |
denotes |
, |
T11462 |
4263-4272 |
VBG |
denotes |
including |
T11463 |
4273-4277 |
NN |
denotes |
TACC |
T11464 |
4277-4279 |
, |
denotes |
, |
T11465 |
4279-4284 |
NN |
denotes |
RHAMM |
T11466 |
4284-4286 |
, |
denotes |
, |
T11467 |
4286-4289 |
NN |
denotes |
KLP |
T11468 |
4289-4291 |
, |
denotes |
, |
T11469 |
4291-4298 |
NN |
denotes |
keratin |
T11470 |
4299-4302 |
CC |
denotes |
and |
T11471 |
4303-4314 |
NN |
denotes |
tropomyosin |
T11472 |
4315-4319 |
IN |
denotes |
from |
T11473 |
4320-4329 |
JJ |
denotes |
available |
T11474 |
4330-4341 |
NNS |
denotes |
vertebrates |
T11475 |
4342-4345 |
CC |
denotes |
and |
T11476 |
4346-4351 |
PRP$ |
denotes |
their |
T11478 |
4352-4364 |
JJ |
denotes |
recognizable |
T11477 |
4365-4376 |
NNS |
denotes |
orthologues |
T11479 |
4377-4381 |
IN |
denotes |
from |
T11480 |
4382-4385 |
DT |
denotes |
the |
T11481 |
4386-4397 |
NN |
denotes |
urochordate |
T11482 |
4398-4403 |
NNP |
denotes |
Ciona |
T11483 |
4404-4416 |
NNP |
denotes |
intestinalis |
T11484 |
4416-4418 |
, |
denotes |
, |
T11485 |
4418-4428 |
NNP |
denotes |
Drosophila |
T11486 |
4429-4441 |
NNP |
denotes |
melanogaster |
T11487 |
4441-4443 |
, |
denotes |
, |
T11488 |
4443-4445 |
NNP |
denotes |
C. |
T11489 |
4446-4453 |
NNP |
denotes |
elegans |
T11490 |
4454-4457 |
CC |
denotes |
and |
T11491 |
4458-4471 |
NNP |
denotes |
Saccharomyces |
T11492 |
4472-4482 |
NNP |
denotes |
cerevisiae |
T11493 |
4483-4487 |
VBD |
denotes |
were |
T11494 |
4488-4494 |
CC |
denotes |
either |
T11495 |
4495-4503 |
RB |
denotes |
directly |
T11438 |
4504-4513 |
VBN |
denotes |
retrieved |
T11496 |
4514-4518 |
IN |
denotes |
from |
T11497 |
4519-4523 |
NN |
denotes |
NCBI |
T11499 |
4524-4532 |
NN |
denotes |
sequence |
T11498 |
4533-4542 |
NNS |
denotes |
databases |
T11500 |
4542-4544 |
, |
denotes |
, |
T11501 |
4544-4549 |
RB |
denotes |
newly |
T11502 |
4550-4559 |
VBN |
denotes |
predicted |
T11503 |
4560-4562 |
CC |
denotes |
or |
T11504 |
4563-4571 |
VBN |
denotes |
isolated |
T11505 |
4572-4573 |
-LRB- |
denotes |
( |
T11506 |
4573-4576 |
VB |
denotes |
see |
T11507 |
4577-4582 |
RB |
denotes |
above |
T11508 |
4582-4583 |
-RRB- |
denotes |
) |
T11509 |
4583-4584 |
. |
denotes |
. |
T11510 |
4584-4914 |
sentence |
denotes |
Species abbreviations are as follows: hs (Homo sapiens), mm (Mus musculus), rn (Rattus norvegus), oc (Oryctolagus cuniculus), gg (Gallus gallus), xl (Xenopus laevis), st (Silurana tropicalis), tr (Takifugu rubripes), dr (Danio rerio), ci (Ciona intestinalis), dm (D. melanogaster), ce (C. elegans), sc (Saccharomyces cerevisiae). |
T11511 |
4585-4592 |
NN |
denotes |
Species |
T11512 |
4593-4606 |
NNS |
denotes |
abbreviations |
T11513 |
4607-4610 |
VBP |
denotes |
are |
T11514 |
4611-4613 |
IN |
denotes |
as |
T11515 |
4614-4621 |
VBZ |
denotes |
follows |
T11516 |
4621-4623 |
: |
denotes |
: |
T11517 |
4623-4625 |
NNP |
denotes |
hs |
T11518 |
4626-4627 |
-LRB- |
denotes |
( |
T11519 |
4627-4631 |
NNP |
denotes |
Homo |
T11520 |
4632-4639 |
NNP |
denotes |
sapiens |
T11521 |
4639-4640 |
-RRB- |
denotes |
) |
T11522 |
4640-4642 |
, |
denotes |
, |
T11523 |
4642-4644 |
NNP |
denotes |
mm |
T11524 |
4645-4646 |
-LRB- |
denotes |
( |
T11525 |
4646-4649 |
NNP |
denotes |
Mus |
T11526 |
4650-4658 |
NNP |
denotes |
musculus |
T11527 |
4658-4659 |
-RRB- |
denotes |
) |
T11528 |
4659-4661 |
, |
denotes |
, |
T11529 |
4661-4663 |
NNP |
denotes |
rn |
T11530 |
4664-4665 |
-LRB- |
denotes |
( |
T11531 |
4665-4671 |
NNP |
denotes |
Rattus |
T11532 |
4672-4680 |
NNP |
denotes |
norvegus |
T11533 |
4680-4681 |
-RRB- |
denotes |
) |
T11534 |
4681-4683 |
, |
denotes |
, |
T11535 |
4683-4685 |
NNP |
denotes |
oc |
T11536 |
4686-4687 |
-LRB- |
denotes |
( |
T11537 |
4687-4698 |
NNP |
denotes |
Oryctolagus |
T11538 |
4699-4708 |
NNP |
denotes |
cuniculus |
T11539 |
4708-4709 |
-RRB- |
denotes |
) |
T11540 |
4709-4711 |
, |
denotes |
, |
T11541 |
4711-4713 |
NNP |
denotes |
gg |
T11542 |
4714-4715 |
-LRB- |
denotes |
( |
T11543 |
4715-4721 |
NNP |
denotes |
Gallus |
T11544 |
4722-4728 |
NNP |
denotes |
gallus |
T11545 |
4728-4729 |
-RRB- |
denotes |
) |
T11546 |
4729-4731 |
, |
denotes |
, |
T11547 |
4731-4733 |
NNP |
denotes |
xl |
T11548 |
4734-4735 |
-LRB- |
denotes |
( |
T11549 |
4735-4742 |
NNP |
denotes |
Xenopus |
T11550 |
4743-4749 |
NNP |
denotes |
laevis |
T11551 |
4749-4750 |
-RRB- |
denotes |
) |
T11552 |
4750-4752 |
, |
denotes |
, |
T11553 |
4752-4754 |
NNP |
denotes |
st |
T11554 |
4755-4756 |
-LRB- |
denotes |
( |
T11555 |
4756-4764 |
NNP |
denotes |
Silurana |
T11556 |
4765-4775 |
NNP |
denotes |
tropicalis |
T11557 |
4775-4776 |
-RRB- |
denotes |
) |
T11558 |
4776-4778 |
, |
denotes |
, |
T11559 |
4778-4780 |
NNP |
denotes |
tr |
T11560 |
4781-4782 |
-LRB- |
denotes |
( |
T11561 |
4782-4790 |
NNP |
denotes |
Takifugu |
T11562 |
4791-4799 |
NNP |
denotes |
rubripes |
T11563 |
4799-4800 |
-RRB- |
denotes |
) |
T11564 |
4800-4802 |
, |
denotes |
, |
T11565 |
4802-4804 |
NNP |
denotes |
dr |
T11566 |
4805-4806 |
-LRB- |
denotes |
( |
T11567 |
4806-4811 |
NNP |
denotes |
Danio |
T11568 |
4812-4817 |
NNP |
denotes |
rerio |
T11569 |
4817-4818 |
-RRB- |
denotes |
) |
T11570 |
4818-4820 |
, |
denotes |
, |
T11571 |
4820-4822 |
NNP |
denotes |
ci |
T11572 |
4823-4824 |
-LRB- |
denotes |
( |
T11573 |
4824-4829 |
NNP |
denotes |
Ciona |
T11574 |
4830-4842 |
NNP |
denotes |
intestinalis |
T11575 |
4842-4843 |
-RRB- |
denotes |
) |
T11576 |
4843-4845 |
, |
denotes |
, |
T11577 |
4845-4847 |
NN |
denotes |
dm |
T11578 |
4848-4849 |
-LRB- |
denotes |
( |
T11579 |
4849-4851 |
NNP |
denotes |
D. |
T11580 |
4852-4864 |
NNP |
denotes |
melanogaster |
T11581 |
4864-4865 |
-RRB- |
denotes |
) |
T11582 |
4865-4867 |
, |
denotes |
, |
T11583 |
4867-4869 |
NNP |
denotes |
ce |
T11584 |
4870-4871 |
-LRB- |
denotes |
( |
T11585 |
4871-4873 |
NNP |
denotes |
C. |
T11586 |
4874-4881 |
NNP |
denotes |
elegans |
T11587 |
4881-4882 |
-RRB- |
denotes |
) |
T11588 |
4882-4884 |
, |
denotes |
, |
T11589 |
4884-4886 |
NNP |
denotes |
sc |
T11590 |
4887-4888 |
-LRB- |
denotes |
( |
T11591 |
4888-4901 |
NNP |
denotes |
Saccharomyces |
T11592 |
4902-4912 |
NNP |
denotes |
cerevisiae |
T11593 |
4912-4913 |
-RRB- |
denotes |
) |
T11594 |
4913-4914 |
. |
denotes |
. |
T11595 |
4914-5882 |
sentence |
denotes |
The sequences identified above and the following protein or predicted translations were used for phylogenetic analysis: hsTACC1A (NP_006274), hsTACC2l (AAO62630) hsTACC2s (AAO62629), hsTACC3 (NP_006333), mmTACC3 (Q9JJ11), xlMaskin (Q9PTG8), dmTACC (AAF52099), ceTAC1 (NP_497059), scSPC72 (NP_009352), hsRHAMM (NP_036616), mmRHAMM (NP_038580), rnRHAMM (NP_037096), drRHAMM (AAQ97980), hsKeratin (CAB76828), mmKeratin (A61368), rnKeratin (XP_235679), hsTPM1 (NP_000357), mmTPM1 (NP_077745), rnTPM1 (NP_62004, drTPM1 (NP_571180) dmTPM1 (P06754), ceTPM (NP_493540) scTPM1 (P17536), hsKLP2 (BAB03309), rnKIF15 (AAP44513), xlKLP2 (CAA08879), dmKLP2 (NP_476818), ceKLP18 (AA034669), hsKIF3A (Q9Y496), mmKIF3A (NP_032469), rnKIF3A (XP_340797), xlKIF3A (CAA08879), ceKLP11 (NP_741473), ciKIF3 (ci0100148992), hsKIF3B (NP_004789), mmKIF3B (NP_004789), rnKIF3B (XP_215883), dmKIF3B (NP_524029), hsKIF3C (NP_002245), mmKIF3C (NP_032471), rnKIF3C (NP_445938), dmKIF3C (NP_651939). |
T11596 |
4915-4918 |
DT |
denotes |
The |
T11597 |
4919-4928 |
NNS |
denotes |
sequences |
T11599 |
4929-4939 |
VBN |
denotes |
identified |
T11600 |
4940-4945 |
RB |
denotes |
above |
T11601 |
4946-4949 |
CC |
denotes |
and |
T11602 |
4950-4953 |
DT |
denotes |
the |
T11604 |
4954-4963 |
VBG |
denotes |
following |
T11605 |
4964-4971 |
NN |
denotes |
protein |
T11606 |
4972-4974 |
CC |
denotes |
or |
T11607 |
4975-4984 |
VBN |
denotes |
predicted |
T11603 |
4985-4997 |
NNS |
denotes |
translations |
T11608 |
4998-5002 |
VBD |
denotes |
were |
T11598 |
5003-5007 |
VBN |
denotes |
used |
T11609 |
5008-5011 |
IN |
denotes |
for |
T11610 |
5012-5024 |
JJ |
denotes |
phylogenetic |
T11611 |
5025-5033 |
NN |
denotes |
analysis |
T11612 |
5033-5035 |
: |
denotes |
: |
T11613 |
5035-5043 |
NN |
denotes |
hsTACC1A |
T11614 |
5044-5045 |
-LRB- |
denotes |
( |
T11615 |
5045-5054 |
NN |
denotes |
NP_006274 |
T11616 |
5054-5055 |
-RRB- |
denotes |
) |
T11617 |
5055-5057 |
, |
denotes |
, |
T11618 |
5057-5065 |
NN |
denotes |
hsTACC2l |
T11619 |
5066-5067 |
-LRB- |
denotes |
( |
T11620 |
5067-5075 |
NN |
denotes |
AAO62630 |
T11621 |
5075-5076 |
-RRB- |
denotes |
) |
T11622 |
5077-5085 |
NN |
denotes |
hsTACC2s |
T11623 |
5086-5087 |
-LRB- |
denotes |
( |
T11624 |
5087-5095 |
NN |
denotes |
AAO62629 |
T11625 |
5095-5096 |
-RRB- |
denotes |
) |
T11626 |
5096-5098 |
, |
denotes |
, |
T11627 |
5098-5105 |
NN |
denotes |
hsTACC3 |
T11628 |
5106-5107 |
-LRB- |
denotes |
( |
T11629 |
5107-5116 |
NN |
denotes |
NP_006333 |
T11630 |
5116-5117 |
-RRB- |
denotes |
) |
T11631 |
5117-5119 |
, |
denotes |
, |
T11632 |
5119-5126 |
NN |
denotes |
mmTACC3 |
T11633 |
5127-5128 |
-LRB- |
denotes |
( |
T11634 |
5128-5134 |
NN |
denotes |
Q9JJ11 |
T11635 |
5134-5135 |
-RRB- |
denotes |
) |
T11636 |
5135-5137 |
, |
denotes |
, |
T11637 |
5137-5145 |
NN |
denotes |
xlMaskin |
T11638 |
5146-5147 |
-LRB- |
denotes |
( |
T11639 |
5147-5153 |
NN |
denotes |
Q9PTG8 |
T11640 |
5153-5154 |
-RRB- |
denotes |
) |
T11641 |
5154-5156 |
, |
denotes |
, |
T11642 |
5156-5162 |
NN |
denotes |
dmTACC |
T11643 |
5163-5164 |
-LRB- |
denotes |
( |
T11644 |
5164-5172 |
NN |
denotes |
AAF52099 |
T11645 |
5172-5173 |
-RRB- |
denotes |
) |
T11646 |
5173-5175 |
, |
denotes |
, |
T11647 |
5175-5181 |
NN |
denotes |
ceTAC1 |
T11648 |
5182-5183 |
-LRB- |
denotes |
( |
T11649 |
5183-5192 |
NN |
denotes |
NP_497059 |
T11650 |
5192-5193 |
-RRB- |
denotes |
) |
T11651 |
5193-5195 |
, |
denotes |
, |
T11652 |
5195-5202 |
NN |
denotes |
scSPC72 |
T11653 |
5203-5204 |
-LRB- |
denotes |
( |
T11654 |
5204-5213 |
NN |
denotes |
NP_009352 |
T11655 |
5213-5214 |
-RRB- |
denotes |
) |
T11656 |
5214-5216 |
, |
denotes |
, |
T11657 |
5216-5223 |
NN |
denotes |
hsRHAMM |
T11658 |
5224-5225 |
-LRB- |
denotes |
( |
T11659 |
5225-5234 |
NN |
denotes |
NP_036616 |
T11660 |
5234-5235 |
-RRB- |
denotes |
) |
T11661 |
5235-5237 |
, |
denotes |
, |
T11662 |
5237-5244 |
NN |
denotes |
mmRHAMM |
T11663 |
5245-5246 |
-LRB- |
denotes |
( |
T11664 |
5246-5255 |
NN |
denotes |
NP_038580 |
T11665 |
5255-5256 |
-RRB- |
denotes |
) |
T11666 |
5256-5258 |
, |
denotes |
, |
T11667 |
5258-5265 |
NN |
denotes |
rnRHAMM |
T11668 |
5266-5267 |
-LRB- |
denotes |
( |
T11669 |
5267-5276 |
NN |
denotes |
NP_037096 |
T11670 |
5276-5277 |
-RRB- |
denotes |
) |
T11671 |
5277-5279 |
, |
denotes |
, |
T11672 |
5279-5286 |
NN |
denotes |
drRHAMM |
T11673 |
5287-5288 |
-LRB- |
denotes |
( |
T11674 |
5288-5296 |
NN |
denotes |
AAQ97980 |
T11675 |
5296-5297 |
-RRB- |
denotes |
) |
T11676 |
5297-5299 |
, |
denotes |
, |
T11677 |
5299-5308 |
NN |
denotes |
hsKeratin |
T11678 |
5309-5310 |
-LRB- |
denotes |
( |
T11679 |
5310-5318 |
NN |
denotes |
CAB76828 |
T11680 |
5318-5319 |
-RRB- |
denotes |
) |
T11681 |
5319-5321 |
, |
denotes |
, |
T11682 |
5321-5330 |
NN |
denotes |
mmKeratin |
T11683 |
5331-5332 |
-LRB- |
denotes |
( |
T11684 |
5332-5338 |
NN |
denotes |
A61368 |
T11685 |
5338-5339 |
-RRB- |
denotes |
) |
T11686 |
5339-5341 |
, |
denotes |
, |
T11687 |
5341-5350 |
NN |
denotes |
rnKeratin |
T11688 |
5351-5352 |
-LRB- |
denotes |
( |
T11689 |
5352-5361 |
NN |
denotes |
XP_235679 |
T11690 |
5361-5362 |
-RRB- |
denotes |
) |
T11691 |
5362-5364 |
, |
denotes |
, |
T11692 |
5364-5370 |
NN |
denotes |
hsTPM1 |
T11693 |
5371-5372 |
-LRB- |
denotes |
( |
T11694 |
5372-5381 |
NN |
denotes |
NP_000357 |
T11695 |
5381-5382 |
-RRB- |
denotes |
) |
T11696 |
5382-5384 |
, |
denotes |
, |
T11697 |
5384-5390 |
NN |
denotes |
mmTPM1 |
T11698 |
5391-5392 |
-LRB- |
denotes |
( |
T11699 |
5392-5401 |
NN |
denotes |
NP_077745 |
T11700 |
5401-5402 |
-RRB- |
denotes |
) |
T11701 |
5402-5404 |
, |
denotes |
, |
T11702 |
5404-5410 |
NN |
denotes |
rnTPM1 |
T11703 |
5411-5412 |
-LRB- |
denotes |
( |
T11704 |
5412-5420 |
NN |
denotes |
NP_62004 |
T11705 |
5420-5422 |
, |
denotes |
, |
T11706 |
5422-5428 |
NN |
denotes |
drTPM1 |
T11707 |
5429-5430 |
-LRB- |
denotes |
( |
T11708 |
5430-5439 |
NN |
denotes |
NP_571180 |
T11709 |
5439-5440 |
-RRB- |
denotes |
) |
T11710 |
5441-5447 |
NN |
denotes |
dmTPM1 |
T11711 |
5448-5449 |
-LRB- |
denotes |
( |
T11712 |
5449-5455 |
NN |
denotes |
P06754 |
T11713 |
5455-5456 |
-RRB- |
denotes |
) |
T11714 |
5456-5458 |
, |
denotes |
, |
T11715 |
5458-5463 |
NN |
denotes |
ceTPM |
T11716 |
5464-5465 |
-LRB- |
denotes |
( |
T11717 |
5465-5474 |
NN |
denotes |
NP_493540 |
T11718 |
5474-5475 |
-RRB- |
denotes |
) |
T11719 |
5476-5482 |
NN |
denotes |
scTPM1 |
T11720 |
5483-5484 |
-LRB- |
denotes |
( |
T11721 |
5484-5490 |
NN |
denotes |
P17536 |
T11722 |
5490-5491 |
-RRB- |
denotes |
) |
T11723 |
5491-5493 |
, |
denotes |
, |
T11724 |
5493-5499 |
NN |
denotes |
hsKLP2 |
T11725 |
5500-5501 |
-LRB- |
denotes |
( |
T11726 |
5501-5509 |
NN |
denotes |
BAB03309 |
T11727 |
5509-5510 |
-RRB- |
denotes |
) |
T11728 |
5510-5512 |
, |
denotes |
, |
T11729 |
5512-5519 |
NN |
denotes |
rnKIF15 |
T11730 |
5520-5521 |
-LRB- |
denotes |
( |
T11731 |
5521-5529 |
NN |
denotes |
AAP44513 |
T11732 |
5529-5530 |
-RRB- |
denotes |
) |
T11733 |
5530-5532 |
, |
denotes |
, |
T11734 |
5532-5538 |
NN |
denotes |
xlKLP2 |
T11735 |
5539-5540 |
-LRB- |
denotes |
( |
T11736 |
5540-5548 |
NN |
denotes |
CAA08879 |
T11737 |
5548-5549 |
-RRB- |
denotes |
) |
T11738 |
5549-5551 |
, |
denotes |
, |
T11739 |
5551-5557 |
NN |
denotes |
dmKLP2 |
T11740 |
5558-5559 |
-LRB- |
denotes |
( |
T11741 |
5559-5568 |
NN |
denotes |
NP_476818 |
T11742 |
5568-5569 |
-RRB- |
denotes |
) |
T11743 |
5569-5571 |
, |
denotes |
, |
T11744 |
5571-5578 |
NN |
denotes |
ceKLP18 |
T11745 |
5579-5580 |
-LRB- |
denotes |
( |
T11746 |
5580-5588 |
NN |
denotes |
AA034669 |
T11747 |
5588-5589 |
-RRB- |
denotes |
) |
T11748 |
5589-5591 |
, |
denotes |
, |
T11749 |
5591-5598 |
NN |
denotes |
hsKIF3A |
T11750 |
5599-5600 |
-LRB- |
denotes |
( |
T11751 |
5600-5606 |
NN |
denotes |
Q9Y496 |
T11752 |
5606-5607 |
-RRB- |
denotes |
) |
T11753 |
5607-5609 |
, |
denotes |
, |
T11754 |
5609-5616 |
NN |
denotes |
mmKIF3A |
T11755 |
5617-5618 |
-LRB- |
denotes |
( |
T11756 |
5618-5627 |
NN |
denotes |
NP_032469 |
T11757 |
5627-5628 |
-RRB- |
denotes |
) |
T11758 |
5628-5630 |
, |
denotes |
, |
T11759 |
5630-5637 |
NN |
denotes |
rnKIF3A |
T11760 |
5638-5639 |
-LRB- |
denotes |
( |
T11761 |
5639-5648 |
NN |
denotes |
XP_340797 |
T11762 |
5648-5649 |
-RRB- |
denotes |
) |
T11763 |
5649-5651 |
, |
denotes |
, |
T11764 |
5651-5658 |
NN |
denotes |
xlKIF3A |
T11765 |
5659-5660 |
-LRB- |
denotes |
( |
T11766 |
5660-5668 |
NN |
denotes |
CAA08879 |
T11767 |
5668-5669 |
-RRB- |
denotes |
) |
T11768 |
5669-5671 |
, |
denotes |
, |
T11769 |
5671-5678 |
NN |
denotes |
ceKLP11 |
T11770 |
5679-5680 |
-LRB- |
denotes |
( |
T11771 |
5680-5689 |
NN |
denotes |
NP_741473 |
T11772 |
5689-5690 |
-RRB- |
denotes |
) |
T11773 |
5690-5692 |
, |
denotes |
, |
T11774 |
5692-5698 |
NN |
denotes |
ciKIF3 |
T11775 |
5699-5700 |
-LRB- |
denotes |
( |
T11776 |
5700-5712 |
NN |
denotes |
ci0100148992 |
T11777 |
5712-5713 |
-RRB- |
denotes |
) |
T11778 |
5713-5715 |
, |
denotes |
, |
T11779 |
5715-5722 |
NN |
denotes |
hsKIF3B |
T11780 |
5723-5724 |
-LRB- |
denotes |
( |
T11781 |
5724-5733 |
NN |
denotes |
NP_004789 |
T11782 |
5733-5734 |
-RRB- |
denotes |
) |
T11783 |
5734-5736 |
, |
denotes |
, |
T11784 |
5736-5743 |
NN |
denotes |
mmKIF3B |
T11785 |
5744-5745 |
-LRB- |
denotes |
( |
T11786 |
5745-5754 |
NN |
denotes |
NP_004789 |
T11787 |
5754-5755 |
-RRB- |
denotes |
) |
T11788 |
5755-5757 |
, |
denotes |
, |
T11789 |
5757-5764 |
NN |
denotes |
rnKIF3B |
T11790 |
5765-5766 |
-LRB- |
denotes |
( |
T11791 |
5766-5775 |
NN |
denotes |
XP_215883 |
T11792 |
5775-5776 |
-RRB- |
denotes |
) |
T11793 |
5776-5778 |
, |
denotes |
, |
T11794 |
5778-5785 |
NN |
denotes |
dmKIF3B |
T11795 |
5786-5787 |
-LRB- |
denotes |
( |
T11796 |
5787-5796 |
NN |
denotes |
NP_524029 |
T11797 |
5796-5797 |
-RRB- |
denotes |
) |
T11798 |
5797-5799 |
, |
denotes |
, |
T11799 |
5799-5806 |
NN |
denotes |
hsKIF3C |
T11800 |
5807-5808 |
-LRB- |
denotes |
( |
T11801 |
5808-5817 |
NN |
denotes |
NP_002245 |
T11802 |
5817-5818 |
-RRB- |
denotes |
) |
T11803 |
5818-5820 |
, |
denotes |
, |
T11804 |
5820-5827 |
NN |
denotes |
mmKIF3C |
T11805 |
5828-5829 |
-LRB- |
denotes |
( |
T11806 |
5829-5838 |
NN |
denotes |
NP_032471 |
T11807 |
5838-5839 |
-RRB- |
denotes |
) |
T11808 |
5839-5841 |
, |
denotes |
, |
T11809 |
5841-5848 |
NN |
denotes |
rnKIF3C |
T11810 |
5849-5850 |
-LRB- |
denotes |
( |
T11811 |
5850-5859 |
NN |
denotes |
NP_445938 |
T11812 |
5859-5860 |
-RRB- |
denotes |
) |
T11813 |
5860-5862 |
, |
denotes |
, |
T11814 |
5862-5869 |
NN |
denotes |
dmKIF3C |
T11815 |
5870-5871 |
-LRB- |
denotes |
( |
T11816 |
5871-5880 |
NN |
denotes |
NP_651939 |
T11817 |
5880-5881 |
-RRB- |
denotes |
) |
T11818 |
5881-5882 |
. |
denotes |
. |
T11819 |
5882-5950 |
sentence |
denotes |
These protein sequences were initially aligned with CLUSTAL X [38]. |
T11820 |
5883-5888 |
DT |
denotes |
These |
T11822 |
5889-5896 |
NN |
denotes |
protein |
T11821 |
5897-5906 |
NNS |
denotes |
sequences |
T11824 |
5907-5911 |
VBD |
denotes |
were |
T11825 |
5912-5921 |
RB |
denotes |
initially |
T11823 |
5922-5929 |
VBN |
denotes |
aligned |
T11826 |
5930-5934 |
IN |
denotes |
with |
T11827 |
5935-5942 |
NNP |
denotes |
CLUSTAL |
T11828 |
5943-5944 |
NNP |
denotes |
X |
T11829 |
5945-5946 |
-LRB- |
denotes |
[ |
T11830 |
5946-5948 |
CD |
denotes |
38 |
T11831 |
5948-5949 |
-RRB- |
denotes |
] |
T11832 |
5949-5950 |
. |
denotes |
. |
T11833 |
5950-6286 |
sentence |
denotes |
Minor adjustments to certain regions of the alignment for optimization purposes were made based on pairwise alignments, the output saved in PHYLIP format, after which, the distances between proteins were calculated using Poisson correction and the Unrooted trees were inferred with the NJ method and then displayed using TreeView [39]. |
T11834 |
5951-5956 |
JJ |
denotes |
Minor |
T11835 |
5957-5968 |
NNS |
denotes |
adjustments |
T11837 |
5969-5971 |
IN |
denotes |
to |
T11838 |
5972-5979 |
JJ |
denotes |
certain |
T11839 |
5980-5987 |
NNS |
denotes |
regions |
T11840 |
5988-5990 |
IN |
denotes |
of |
T11841 |
5991-5994 |
DT |
denotes |
the |
T11842 |
5995-6004 |
NN |
denotes |
alignment |
T11843 |
6005-6008 |
IN |
denotes |
for |
T11844 |
6009-6021 |
NN |
denotes |
optimization |
T11845 |
6022-6030 |
NNS |
denotes |
purposes |
T11846 |
6031-6035 |
VBD |
denotes |
were |
T11836 |
6036-6040 |
VBN |
denotes |
made |
T11848 |
6041-6046 |
VBN |
denotes |
based |
T11849 |
6047-6049 |
IN |
denotes |
on |
T11850 |
6050-6058 |
JJ |
denotes |
pairwise |
T11851 |
6059-6069 |
NNS |
denotes |
alignments |
T11852 |
6069-6071 |
, |
denotes |
, |
T11853 |
6071-6074 |
DT |
denotes |
the |
T11854 |
6075-6081 |
NN |
denotes |
output |
T11847 |
6082-6087 |
VBD |
denotes |
saved |
T11855 |
6088-6090 |
IN |
denotes |
in |
T11856 |
6091-6097 |
NN |
denotes |
PHYLIP |
T11857 |
6098-6104 |
NN |
denotes |
format |
T11858 |
6104-6106 |
, |
denotes |
, |
T11859 |
6106-6111 |
IN |
denotes |
after |
T11861 |
6112-6117 |
WDT |
denotes |
which |
T11862 |
6117-6119 |
, |
denotes |
, |
T11863 |
6119-6122 |
DT |
denotes |
the |
T11864 |
6123-6132 |
NNS |
denotes |
distances |
T11865 |
6133-6140 |
IN |
denotes |
between |
T11866 |
6141-6149 |
NN |
denotes |
proteins |
T11867 |
6150-6154 |
VBD |
denotes |
were |
T11860 |
6155-6165 |
VBN |
denotes |
calculated |
T11868 |
6166-6171 |
VBG |
denotes |
using |
T11869 |
6172-6179 |
NNP |
denotes |
Poisson |
T11870 |
6180-6190 |
NN |
denotes |
correction |
T11871 |
6191-6194 |
CC |
denotes |
and |
T11872 |
6195-6198 |
DT |
denotes |
the |
T11874 |
6199-6207 |
JJ |
denotes |
Unrooted |
T11873 |
6208-6213 |
NNS |
denotes |
trees |
T11876 |
6214-6218 |
VBD |
denotes |
were |
T11875 |
6219-6227 |
VBN |
denotes |
inferred |
T11877 |
6228-6232 |
IN |
denotes |
with |
T11878 |
6233-6236 |
DT |
denotes |
the |
T11880 |
6237-6239 |
NN |
denotes |
NJ |
T11879 |
6240-6246 |
NN |
denotes |
method |
T11881 |
6247-6250 |
CC |
denotes |
and |
T11882 |
6251-6255 |
RB |
denotes |
then |
T11883 |
6256-6265 |
VBD |
denotes |
displayed |
T11884 |
6266-6271 |
VBG |
denotes |
using |
T11885 |
6272-6280 |
NNP |
denotes |
TreeView |
T11886 |
6281-6282 |
-LRB- |
denotes |
[ |
T11887 |
6282-6284 |
CD |
denotes |
39 |
T11888 |
6284-6285 |
-RRB- |
denotes |
] |
T11889 |
6285-6286 |
. |
denotes |
. |
T11890 |
6286-6352 |
sentence |
denotes |
Bootstrap values above 700 for 1000 trials are shown at the node. |
T11891 |
6287-6296 |
NN |
denotes |
Bootstrap |
T11892 |
6297-6303 |
NNS |
denotes |
values |
T11894 |
6304-6309 |
IN |
denotes |
above |
T11895 |
6310-6313 |
CD |
denotes |
700 |
T11896 |
6314-6317 |
IN |
denotes |
for |
T11897 |
6318-6322 |
CD |
denotes |
1000 |
T11898 |
6323-6329 |
NNS |
denotes |
trials |
T11899 |
6330-6333 |
VBP |
denotes |
are |
T11893 |
6334-6339 |
VBN |
denotes |
shown |
T11900 |
6340-6342 |
IN |
denotes |
at |
T11901 |
6343-6346 |
DT |
denotes |
the |
T11902 |
6347-6351 |
NN |
denotes |
node |
T11903 |
6351-6352 |
. |
denotes |
. |
T11904 |
6352-6528 |
sentence |
denotes |
To validate the tree, the same sequence set was analyzed with tools in the PHYLIP package [40], using PRODIST followed by FITCH or NEIGNBOR and tree displaying using TreeView. |
T11905 |
6353-6355 |
TO |
denotes |
To |
T11906 |
6356-6364 |
VB |
denotes |
validate |
T11908 |
6365-6368 |
DT |
denotes |
the |
T11909 |
6369-6373 |
NN |
denotes |
tree |
T11910 |
6373-6375 |
, |
denotes |
, |
T11911 |
6375-6378 |
DT |
denotes |
the |
T11913 |
6379-6383 |
JJ |
denotes |
same |
T11914 |
6384-6392 |
NN |
denotes |
sequence |
T11912 |
6393-6396 |
NN |
denotes |
set |
T11915 |
6397-6400 |
VBD |
denotes |
was |
T11907 |
6401-6409 |
VBN |
denotes |
analyzed |
T11916 |
6410-6414 |
IN |
denotes |
with |
T11917 |
6415-6420 |
NNS |
denotes |
tools |
T11918 |
6421-6423 |
IN |
denotes |
in |
T11919 |
6424-6427 |
DT |
denotes |
the |
T11921 |
6428-6434 |
NN |
denotes |
PHYLIP |
T11920 |
6435-6442 |
NN |
denotes |
package |
T11922 |
6443-6444 |
-LRB- |
denotes |
[ |
T11923 |
6444-6446 |
CD |
denotes |
40 |
T11924 |
6446-6447 |
-RRB- |
denotes |
] |
T11925 |
6447-6449 |
, |
denotes |
, |
T11926 |
6449-6454 |
VBG |
denotes |
using |
T11927 |
6455-6462 |
NN |
denotes |
PRODIST |
T11928 |
6463-6471 |
VBN |
denotes |
followed |
T11929 |
6472-6474 |
IN |
denotes |
by |
T11930 |
6475-6480 |
NN |
denotes |
FITCH |
T11931 |
6481-6483 |
CC |
denotes |
or |
T11932 |
6484-6492 |
NN |
denotes |
NEIGNBOR |
T11933 |
6493-6496 |
CC |
denotes |
and |
T11934 |
6497-6501 |
NN |
denotes |
tree |
T11935 |
6502-6512 |
VBG |
denotes |
displaying |
T11936 |
6513-6518 |
VBG |
denotes |
using |
T11937 |
6519-6527 |
NNP |
denotes |
TreeView |
T11938 |
6527-6528 |
. |
denotes |
. |
T11939 |
6528-6619 |
sentence |
denotes |
This additional method produced trees with essentially the same topology (data not shown). |
T11940 |
6529-6533 |
DT |
denotes |
This |
T11942 |
6534-6544 |
JJ |
denotes |
additional |
T11941 |
6545-6551 |
NN |
denotes |
method |
T11943 |
6552-6560 |
VBD |
denotes |
produced |
T11944 |
6561-6566 |
NNS |
denotes |
trees |
T11945 |
6567-6571 |
IN |
denotes |
with |
T11946 |
6572-6583 |
RB |
denotes |
essentially |
T11948 |
6584-6587 |
DT |
denotes |
the |
T11949 |
6588-6592 |
JJ |
denotes |
same |
T11947 |
6593-6601 |
NN |
denotes |
topology |
T11950 |
6602-6603 |
-LRB- |
denotes |
( |
T11952 |
6603-6607 |
NNS |
denotes |
data |
T11953 |
6608-6611 |
RB |
denotes |
not |
T11951 |
6612-6617 |
VBN |
denotes |
shown |
T11954 |
6617-6618 |
-RRB- |
denotes |
) |
T11955 |
6618-6619 |
. |
denotes |
. |
T12120 |
6621-6623 |
FW |
denotes |
In |
T12121 |
6624-6629 |
FW |
denotes |
vitro |
T12122 |
6630-6641 |
NN |
denotes |
interaction |
T12123 |
6642-6644 |
IN |
denotes |
of |
T12124 |
6645-6650 |
NN |
denotes |
TACC2 |
T12125 |
6651-6654 |
CC |
denotes |
and |
T12126 |
6655-6660 |
NN |
denotes |
RXRβ3 |
T12127 |
6660-6762 |
sentence |
denotes |
The TACC2 cDNA was cloned into GST fusion vector pGEX5X2 (Amersham Biosciences, Piscataway, NJ, USA). |
T12128 |
6661-6664 |
DT |
denotes |
The |
T12130 |
6665-6670 |
NN |
denotes |
TACC2 |
T12129 |
6671-6675 |
NN |
denotes |
cDNA |
T12132 |
6676-6679 |
VBD |
denotes |
was |
T12131 |
6680-6686 |
VBN |
denotes |
cloned |
T12133 |
6687-6691 |
IN |
denotes |
into |
T12134 |
6692-6695 |
NN |
denotes |
GST |
T12136 |
6696-6702 |
NN |
denotes |
fusion |
T12137 |
6703-6709 |
NN |
denotes |
vector |
T12135 |
6710-6717 |
NN |
denotes |
pGEX5X2 |
T12138 |
6718-6719 |
-LRB- |
denotes |
( |
T12140 |
6719-6727 |
NNP |
denotes |
Amersham |
T12139 |
6728-6739 |
NNP |
denotes |
Biosciences |
T12141 |
6739-6741 |
, |
denotes |
, |
T12142 |
6741-6751 |
NNP |
denotes |
Piscataway |
T12143 |
6751-6753 |
, |
denotes |
, |
T12144 |
6753-6755 |
NNP |
denotes |
NJ |
T12145 |
6755-6757 |
, |
denotes |
, |
T12146 |
6757-6760 |
NNP |
denotes |
USA |
T12147 |
6760-6761 |
-RRB- |
denotes |
) |
T12148 |
6761-6762 |
. |
denotes |
. |
T12149 |
6762-6875 |
sentence |
denotes |
GST and GST-TACC2 proteins were expressed in E. coli BL21(DE3) plys "S" with 1 mM IPTG at 37°C shaker for 2 hrs. |
T12150 |
6763-6766 |
NN |
denotes |
GST |
T12152 |
6767-6770 |
CC |
denotes |
and |
T12153 |
6771-6774 |
NN |
denotes |
GST |
T12155 |
6774-6775 |
HYPH |
denotes |
- |
T12154 |
6775-6780 |
NN |
denotes |
TACC2 |
T12151 |
6781-6789 |
NN |
denotes |
proteins |
T12157 |
6790-6794 |
VBD |
denotes |
were |
T12156 |
6795-6804 |
VBN |
denotes |
expressed |
T12158 |
6805-6807 |
IN |
denotes |
in |
T12159 |
6808-6810 |
NNP |
denotes |
E. |
T12160 |
6811-6815 |
NNP |
denotes |
coli |
T12162 |
6816-6820 |
NN |
denotes |
BL21 |
T12163 |
6820-6821 |
-LRB- |
denotes |
( |
T12164 |
6821-6824 |
NN |
denotes |
DE3 |
T12165 |
6824-6825 |
-RRB- |
denotes |
) |
T12166 |
6826-6830 |
NNS |
denotes |
plys |
T12167 |
6831-6832 |
`` |
denotes |
" |
T12161 |
6832-6833 |
NN |
denotes |
S |
T12168 |
6833-6834 |
'' |
denotes |
" |
T12169 |
6835-6839 |
IN |
denotes |
with |
T12170 |
6840-6841 |
CD |
denotes |
1 |
T12171 |
6842-6844 |
NN |
denotes |
mM |
T12172 |
6845-6849 |
NN |
denotes |
IPTG |
T12173 |
6850-6852 |
IN |
denotes |
at |
T12174 |
6853-6855 |
CD |
denotes |
37 |
T12175 |
6855-6857 |
NN |
denotes |
°C |
T12176 |
6858-6864 |
NN |
denotes |
shaker |
T12177 |
6865-6868 |
IN |
denotes |
for |
T12178 |
6869-6870 |
CD |
denotes |
2 |
T12179 |
6871-6874 |
NNS |
denotes |
hrs |
T12180 |
6874-6875 |
. |
denotes |
. |
T12181 |
6875-7025 |
sentence |
denotes |
Cells (50 ml) were harvested and resuspended in 5 ml of 20 mM Tris-HCl pH.8.0, 200 mM NaCl, 1 mM EDTA pH8.0, Protease inhibitor set III (Calbiochem). |
T12182 |
6876-6881 |
NNS |
denotes |
Cells |
T12184 |
6882-6883 |
-LRB- |
denotes |
( |
T12186 |
6883-6885 |
CD |
denotes |
50 |
T12185 |
6886-6888 |
NN |
denotes |
ml |
T12187 |
6888-6889 |
-RRB- |
denotes |
) |
T12188 |
6890-6894 |
VBD |
denotes |
were |
T12183 |
6895-6904 |
VBN |
denotes |
harvested |
T12189 |
6905-6908 |
CC |
denotes |
and |
T12190 |
6909-6920 |
VBN |
denotes |
resuspended |
T12191 |
6921-6923 |
IN |
denotes |
in |
T12192 |
6924-6925 |
CD |
denotes |
5 |
T12193 |
6926-6928 |
NN |
denotes |
ml |
T12194 |
6929-6931 |
IN |
denotes |
of |
T12195 |
6932-6934 |
CD |
denotes |
20 |
T12196 |
6935-6937 |
NN |
denotes |
mM |
T12198 |
6938-6942 |
NN |
denotes |
Tris |
T12199 |
6942-6943 |
HYPH |
denotes |
- |
T12197 |
6943-6946 |
NN |
denotes |
HCl |
T12200 |
6947-6953 |
NN |
denotes |
pH.8.0 |
T12201 |
6953-6955 |
, |
denotes |
, |
T12202 |
6955-6958 |
CD |
denotes |
200 |
T12203 |
6959-6961 |
NN |
denotes |
mM |
T12204 |
6962-6966 |
NN |
denotes |
NaCl |
T12205 |
6966-6968 |
, |
denotes |
, |
T12206 |
6968-6969 |
CD |
denotes |
1 |
T12207 |
6970-6972 |
NN |
denotes |
mM |
T12208 |
6973-6977 |
NN |
denotes |
EDTA |
T12209 |
6978-6983 |
NN |
denotes |
pH8.0 |
T12210 |
6983-6985 |
, |
denotes |
, |
T12211 |
6985-6993 |
NN |
denotes |
Protease |
T12212 |
6994-7003 |
NN |
denotes |
inhibitor |
T12213 |
7004-7007 |
NN |
denotes |
set |
T12214 |
7008-7011 |
CD |
denotes |
III |
T12215 |
7012-7013 |
-LRB- |
denotes |
( |
T12216 |
7013-7023 |
NNP |
denotes |
Calbiochem |
T12217 |
7023-7024 |
-RRB- |
denotes |
) |
T12218 |
7024-7025 |
. |
denotes |
. |
T12219 |
7025-7128 |
sentence |
denotes |
The cells were lysed by sonication and lysate cleared by centrifugation at 7500 rpm at 4°C for 15 min. |
T12220 |
7026-7029 |
DT |
denotes |
The |
T12221 |
7030-7035 |
NNS |
denotes |
cells |
T12223 |
7036-7040 |
VBD |
denotes |
were |
T12222 |
7041-7046 |
VBN |
denotes |
lysed |
T12224 |
7047-7049 |
IN |
denotes |
by |
T12225 |
7050-7060 |
NN |
denotes |
sonication |
T12226 |
7061-7064 |
CC |
denotes |
and |
T12227 |
7065-7071 |
NN |
denotes |
lysate |
T12228 |
7072-7079 |
VBN |
denotes |
cleared |
T12229 |
7080-7082 |
IN |
denotes |
by |
T12230 |
7083-7097 |
NN |
denotes |
centrifugation |
T12231 |
7098-7100 |
IN |
denotes |
at |
T12232 |
7101-7105 |
CD |
denotes |
7500 |
T12233 |
7106-7109 |
NN |
denotes |
rpm |
T12234 |
7110-7112 |
IN |
denotes |
at |
T12235 |
7113-7114 |
CD |
denotes |
4 |
T12236 |
7114-7116 |
NN |
denotes |
°C |
T12237 |
7117-7120 |
IN |
denotes |
for |
T12238 |
7121-7123 |
CD |
denotes |
15 |
T12239 |
7124-7127 |
NN |
denotes |
min |
T12240 |
7127-7128 |
. |
denotes |
. |
T12241 |
7128-7259 |
sentence |
denotes |
The cleared lysate was immobilized on glutathione sepharose beads in 3 ml of 20 mM Tris-HCl pH.8.0, 200 mM NaCl, 1 mM EDTA pH8.0). |
T12242 |
7129-7132 |
DT |
denotes |
The |
T12244 |
7133-7140 |
JJ |
denotes |
cleared |
T12243 |
7141-7147 |
NN |
denotes |
lysate |
T12246 |
7148-7151 |
VBD |
denotes |
was |
T12245 |
7152-7163 |
VBN |
denotes |
immobilized |
T12247 |
7164-7166 |
IN |
denotes |
on |
T12248 |
7167-7178 |
NN |
denotes |
glutathione |
T12249 |
7179-7188 |
NN |
denotes |
sepharose |
T12250 |
7189-7194 |
NNS |
denotes |
beads |
T12251 |
7195-7197 |
IN |
denotes |
in |
T12252 |
7198-7199 |
CD |
denotes |
3 |
T12253 |
7200-7202 |
NN |
denotes |
ml |
T12254 |
7203-7205 |
IN |
denotes |
of |
T12255 |
7206-7208 |
CD |
denotes |
20 |
T12256 |
7209-7211 |
NN |
denotes |
mM |
T12258 |
7212-7216 |
NN |
denotes |
Tris |
T12259 |
7216-7217 |
HYPH |
denotes |
- |
T12257 |
7217-7220 |
NN |
denotes |
HCl |
T12260 |
7221-7227 |
NN |
denotes |
pH.8.0 |
T12261 |
7227-7229 |
, |
denotes |
, |
T12262 |
7229-7232 |
CD |
denotes |
200 |
T12263 |
7233-7235 |
NN |
denotes |
mM |
T12264 |
7236-7240 |
NN |
denotes |
NaCl |
T12265 |
7240-7242 |
, |
denotes |
, |
T12266 |
7242-7243 |
CD |
denotes |
1 |
T12267 |
7244-7246 |
NN |
denotes |
mM |
T12268 |
7247-7251 |
NN |
denotes |
EDTA |
T12269 |
7252-7257 |
NN |
denotes |
pH8.0 |
T12270 |
7257-7258 |
-RRB- |
denotes |
) |
T12271 |
7258-7259 |
. |
denotes |
. |
T12272 |
7259-7500 |
sentence |
denotes |
RXRβ3 cDNA was cloned into pET 28C(+) (Invitrogen, Carlsbad, CA, USA) and protein synthesized by TNT quick coupled transcription/translation system kit (Promega) and radiolabeled with 35S methionine according to manufacturer's instructions. |
T12273 |
7260-7265 |
NN |
denotes |
RXRβ3 |
T12274 |
7266-7270 |
NN |
denotes |
cDNA |
T12276 |
7271-7274 |
VBD |
denotes |
was |
T12275 |
7275-7281 |
VBN |
denotes |
cloned |
T12277 |
7282-7286 |
IN |
denotes |
into |
T12278 |
7287-7290 |
NN |
denotes |
pET |
T12279 |
7291-7294 |
NN |
denotes |
28C |
T12280 |
7294-7295 |
-LRB- |
denotes |
( |
T12281 |
7295-7296 |
SYM |
denotes |
+ |
T12282 |
7296-7297 |
-RRB- |
denotes |
) |
T12283 |
7298-7299 |
-LRB- |
denotes |
( |
T12284 |
7299-7309 |
NNP |
denotes |
Invitrogen |
T12285 |
7309-7311 |
, |
denotes |
, |
T12286 |
7311-7319 |
NNP |
denotes |
Carlsbad |
T12287 |
7319-7321 |
, |
denotes |
, |
T12288 |
7321-7323 |
NNP |
denotes |
CA |
T12289 |
7323-7325 |
, |
denotes |
, |
T12290 |
7325-7328 |
NNP |
denotes |
USA |
T12291 |
7328-7329 |
-RRB- |
denotes |
) |
T12292 |
7330-7333 |
CC |
denotes |
and |
T12293 |
7334-7341 |
NN |
denotes |
protein |
T12294 |
7342-7353 |
VBN |
denotes |
synthesized |
T12295 |
7354-7356 |
IN |
denotes |
by |
T12296 |
7357-7360 |
NN |
denotes |
TNT |
T12298 |
7361-7366 |
RB |
denotes |
quick |
T12299 |
7367-7374 |
VBN |
denotes |
coupled |
T12300 |
7375-7388 |
NN |
denotes |
transcription |
T12302 |
7388-7389 |
HYPH |
denotes |
/ |
T12301 |
7389-7400 |
NN |
denotes |
translation |
T12303 |
7401-7407 |
NN |
denotes |
system |
T12297 |
7408-7411 |
NN |
denotes |
kit |
T12304 |
7412-7413 |
-LRB- |
denotes |
( |
T12305 |
7413-7420 |
NNP |
denotes |
Promega |
T12306 |
7420-7421 |
-RRB- |
denotes |
) |
T12307 |
7422-7425 |
CC |
denotes |
and |
T12308 |
7426-7438 |
VBN |
denotes |
radiolabeled |
T12309 |
7439-7443 |
IN |
denotes |
with |
T12310 |
7444-7447 |
NN |
denotes |
35S |
T12311 |
7448-7458 |
NN |
denotes |
methionine |
T12312 |
7459-7468 |
VBG |
denotes |
according |
T12313 |
7469-7471 |
IN |
denotes |
to |
T12314 |
7472-7484 |
NN |
denotes |
manufacturer |
T12316 |
7484-7486 |
POS |
denotes |
's |
T12315 |
7487-7499 |
NNS |
denotes |
instructions |
T12317 |
7499-7500 |
. |
denotes |
. |
T12318 |
7500-7674 |
sentence |
denotes |
100 μl of in vitro translated RXRβ3 protein in 1 ml of 20 mM Tris-HCl pH.8.0, 200 mM NaCl, 1 mM EDTA pH8.0 was incubated at 4°C with immobilized GST-TACC2 or GST for 90 min. |
T12319 |
7501-7504 |
CD |
denotes |
100 |
T12320 |
7505-7507 |
NN |
denotes |
μl |
T12322 |
7508-7510 |
IN |
denotes |
of |
T12323 |
7511-7513 |
FW |
denotes |
in |
T12324 |
7514-7519 |
FW |
denotes |
vitro |
T12325 |
7520-7530 |
VBN |
denotes |
translated |
T12327 |
7531-7536 |
NN |
denotes |
RXRβ3 |
T12326 |
7537-7544 |
NN |
denotes |
protein |
T12328 |
7545-7547 |
IN |
denotes |
in |
T12329 |
7548-7549 |
CD |
denotes |
1 |
T12330 |
7550-7552 |
NN |
denotes |
ml |
T12331 |
7553-7555 |
IN |
denotes |
of |
T12332 |
7556-7558 |
CD |
denotes |
20 |
T12333 |
7559-7561 |
NN |
denotes |
mM |
T12335 |
7562-7566 |
NN |
denotes |
Tris |
T12336 |
7566-7567 |
HYPH |
denotes |
- |
T12334 |
7567-7570 |
NN |
denotes |
HCl |
T12337 |
7571-7577 |
NN |
denotes |
pH.8.0 |
T12338 |
7577-7579 |
, |
denotes |
, |
T12339 |
7579-7582 |
CD |
denotes |
200 |
T12340 |
7583-7585 |
NN |
denotes |
mM |
T12341 |
7586-7590 |
NN |
denotes |
NaCl |
T12342 |
7590-7592 |
, |
denotes |
, |
T12343 |
7592-7593 |
CD |
denotes |
1 |
T12344 |
7594-7596 |
NN |
denotes |
mM |
T12345 |
7597-7601 |
NN |
denotes |
EDTA |
T12346 |
7602-7607 |
NN |
denotes |
pH8.0 |
T12347 |
7608-7611 |
VBD |
denotes |
was |
T12321 |
7612-7621 |
VBN |
denotes |
incubated |
T12348 |
7622-7624 |
IN |
denotes |
at |
T12349 |
7625-7626 |
CD |
denotes |
4 |
T12350 |
7626-7628 |
NN |
denotes |
°C |
T12351 |
7629-7633 |
IN |
denotes |
with |
T12352 |
7634-7645 |
VBN |
denotes |
immobilized |
T12354 |
7646-7649 |
NN |
denotes |
GST |
T12355 |
7649-7650 |
HYPH |
denotes |
- |
T12353 |
7650-7655 |
NN |
denotes |
TACC2 |
T12356 |
7656-7658 |
CC |
denotes |
or |
T12357 |
7659-7662 |
NN |
denotes |
GST |
T12358 |
7663-7666 |
IN |
denotes |
for |
T12359 |
7667-7669 |
CD |
denotes |
90 |
T12360 |
7670-7673 |
NN |
denotes |
min |
T12361 |
7673-7674 |
. |
denotes |
. |
T12362 |
7674-7781 |
sentence |
denotes |
Unbound RXRβ3 was removed by washing three times with 20 mM Tris-HCl pH.8.0, 200 mM NaCl, 1 mM EDTA pH8.0. |
T12363 |
7675-7682 |
JJ |
denotes |
Unbound |
T12364 |
7683-7688 |
NN |
denotes |
RXRβ3 |
T12366 |
7689-7692 |
VBD |
denotes |
was |
T12365 |
7693-7700 |
VBN |
denotes |
removed |
T12367 |
7701-7703 |
IN |
denotes |
by |
T12368 |
7704-7711 |
VBG |
denotes |
washing |
T12369 |
7712-7717 |
CD |
denotes |
three |
T12370 |
7718-7723 |
NNS |
denotes |
times |
T12371 |
7724-7728 |
IN |
denotes |
with |
T12372 |
7729-7731 |
CD |
denotes |
20 |
T12373 |
7732-7734 |
NN |
denotes |
mM |
T12375 |
7735-7739 |
NN |
denotes |
Tris |
T12376 |
7739-7740 |
HYPH |
denotes |
- |
T12374 |
7740-7743 |
NN |
denotes |
HCl |
T12377 |
7744-7750 |
NN |
denotes |
pH.8.0 |
T12378 |
7750-7752 |
, |
denotes |
, |
T12379 |
7752-7755 |
CD |
denotes |
200 |
T12380 |
7756-7758 |
NN |
denotes |
mM |
T12381 |
7759-7763 |
NN |
denotes |
NaCl |
T12382 |
7763-7765 |
, |
denotes |
, |
T12383 |
7765-7766 |
CD |
denotes |
1 |
T12384 |
7767-7769 |
NN |
denotes |
mM |
T12385 |
7770-7774 |
NN |
denotes |
EDTA |
T12386 |
7775-7780 |
NN |
denotes |
pH8.0 |
T12387 |
7780-7781 |
. |
denotes |
. |
T12388 |
7781-7925 |
sentence |
denotes |
Bound proteins were eluted from the beads at room temperature for 10 min in elution buffer (100 mM Tris HCl, pH8.0, 20 mM reduced glutathione). |
T12389 |
7782-7787 |
NN |
denotes |
Bound |
T12390 |
7788-7796 |
NN |
denotes |
proteins |
T12392 |
7797-7801 |
VBD |
denotes |
were |
T12391 |
7802-7808 |
VBN |
denotes |
eluted |
T12393 |
7809-7813 |
IN |
denotes |
from |
T12394 |
7814-7817 |
DT |
denotes |
the |
T12395 |
7818-7823 |
NNS |
denotes |
beads |
T12396 |
7824-7826 |
IN |
denotes |
at |
T12397 |
7827-7831 |
NN |
denotes |
room |
T12398 |
7832-7843 |
NN |
denotes |
temperature |
T12399 |
7844-7847 |
IN |
denotes |
for |
T12400 |
7848-7850 |
CD |
denotes |
10 |
T12401 |
7851-7854 |
NN |
denotes |
min |
T12402 |
7855-7857 |
IN |
denotes |
in |
T12403 |
7858-7865 |
NN |
denotes |
elution |
T12404 |
7866-7872 |
NN |
denotes |
buffer |
T12405 |
7873-7874 |
-LRB- |
denotes |
( |
T12407 |
7874-7877 |
CD |
denotes |
100 |
T12408 |
7878-7880 |
NN |
denotes |
mM |
T12409 |
7881-7885 |
NN |
denotes |
Tris |
T12406 |
7886-7889 |
NN |
denotes |
HCl |
T12410 |
7889-7891 |
, |
denotes |
, |
T12411 |
7891-7896 |
NN |
denotes |
pH8.0 |
T12412 |
7896-7898 |
, |
denotes |
, |
T12413 |
7898-7900 |
CD |
denotes |
20 |
T12414 |
7901-7903 |
NN |
denotes |
mM |
T12416 |
7904-7911 |
VBN |
denotes |
reduced |
T12415 |
7912-7923 |
NN |
denotes |
glutathione |
T12417 |
7923-7924 |
-RRB- |
denotes |
) |
T12418 |
7924-7925 |
. |
denotes |
. |
T12419 |
7925-7984 |
sentence |
denotes |
The proteins were analyzed on 12% SDS polyacrylamide gels. |
T12420 |
7926-7929 |
DT |
denotes |
The |
T12421 |
7930-7938 |
NN |
denotes |
proteins |
T12423 |
7939-7943 |
VBD |
denotes |
were |
T12422 |
7944-7952 |
VBN |
denotes |
analyzed |
T12424 |
7953-7955 |
IN |
denotes |
on |
T12425 |
7956-7958 |
CD |
denotes |
12 |
T12426 |
7958-7959 |
NN |
denotes |
% |
T12428 |
7960-7963 |
NN |
denotes |
SDS |
T12429 |
7964-7978 |
NN |
denotes |
polyacrylamide |
T12427 |
7979-7983 |
NNS |
denotes |
gels |
T12430 |
7983-7984 |
. |
denotes |
. |
T12431 |
7984-8054 |
sentence |
denotes |
Coomassie blue staining verified equal loading of GST fusion protein. |
T12432 |
7985-7994 |
NNP |
denotes |
Coomassie |
T12434 |
7995-7999 |
JJ |
denotes |
blue |
T12433 |
8000-8008 |
NN |
denotes |
staining |
T12435 |
8009-8017 |
VBD |
denotes |
verified |
T12436 |
8018-8023 |
JJ |
denotes |
equal |
T12437 |
8024-8031 |
NN |
denotes |
loading |
T12438 |
8032-8034 |
IN |
denotes |
of |
T12439 |
8035-8038 |
NN |
denotes |
GST |
T12441 |
8039-8045 |
NN |
denotes |
fusion |
T12440 |
8046-8053 |
NN |
denotes |
protein |
T12442 |
8053-8054 |
. |
denotes |
. |
T12443 |
8054-8088 |
sentence |
denotes |
Dried gels were autoradiographed. |
T12444 |
8055-8060 |
VBN |
denotes |
Dried |
T12445 |
8061-8065 |
NNS |
denotes |
gels |
T12447 |
8066-8070 |
VBD |
denotes |
were |
T12446 |
8071-8087 |
VBN |
denotes |
autoradiographed |
T12448 |
8087-8088 |
. |
denotes |
. |
R6478 |
T10099 |
T10098 |
cc |
and,Compilation |
R6479 |
T10100 |
T10098 |
conj |
assembly,Compilation |
R6480 |
T10101 |
T10098 |
prep |
of,Compilation |
R6481 |
T10102 |
T10103 |
advmod |
previously,uncharacterized |
R6482 |
T10103 |
T10104 |
amod |
uncharacterized,cDNAs |
R6483 |
T10104 |
T10101 |
pobj |
cDNAs,of |
R6484 |
T10105 |
T10104 |
compound |
TACC,cDNAs |
R6485 |
T10106 |
T10104 |
cc |
and,cDNAs |
R6486 |
T10107 |
T10104 |
conj |
genes,cDNAs |
R6487 |
T10109 |
T10110 |
amod |
Corresponding,sequences |
R6488 |
T10110 |
T10112 |
nsubjpass |
sequences,identified |
R6489 |
T10111 |
T10110 |
amod |
orthologous,sequences |
R6490 |
T10113 |
T10110 |
prep |
for,sequences |
R6491 |
T10114 |
T10115 |
nmod |
TACC,families |
R6492 |
T10115 |
T10113 |
pobj |
families,for |
R6493 |
T10116 |
T10114 |
punct |
", ",TACC |
R6494 |
T10117 |
T10114 |
conj |
RHAMM,TACC |
R6495 |
T10118 |
T10117 |
punct |
", ",RHAMM |
R6496 |
T10119 |
T10117 |
conj |
KLP,RHAMM |
R6497 |
T10120 |
T10119 |
punct |
", ",KLP |
R6498 |
T10121 |
T10119 |
conj |
KIF,KLP |
R6499 |
T10122 |
T10121 |
punct |
", ",KIF |
R6500 |
T10123 |
T10121 |
conj |
TPM,KIF |
R6501 |
T10124 |
T10123 |
cc |
and,TPM |
R6502 |
T10125 |
T10123 |
conj |
keratins,TPM |
R6503 |
T10126 |
T10112 |
auxpass |
were,identified |
R6504 |
T10127 |
T10112 |
advmod |
initially,identified |
R6505 |
T10128 |
T10112 |
advcl |
using,identified |
R6506 |
T10129 |
T10130 |
det |
the,program |
R6507 |
T10130 |
T10128 |
dobj |
program,using |
R6508 |
T10131 |
T10130 |
compound |
TBLASTN,program |
R6509 |
T10132 |
T10133 |
punct |
[,36 |
R6510 |
T10133 |
T10128 |
parataxis |
36,using |
R6511 |
T10134 |
T10133 |
punct |
],36 |
R6512 |
T10135 |
T10136 |
aux |
to,search |
R6513 |
T10136 |
T10128 |
advcl |
search,using |
R6514 |
T10137 |
T10138 |
det |
the,databases |
R6515 |
T10138 |
T10136 |
dobj |
databases,search |
R6516 |
T10139 |
T10138 |
amod |
published,databases |
R6517 |
T10140 |
T10138 |
amod |
genomic,databases |
R6518 |
T10141 |
T10140 |
cc |
and,genomic |
R6519 |
T10142 |
T10140 |
conj |
cDNA,genomic |
R6520 |
T10143 |
T10112 |
punct |
.,identified |
R6521 |
T10145 |
T10146 |
prep |
For,produced |
R6522 |
T10147 |
T10148 |
compound |
Takifugu,rubripes |
R6523 |
T10148 |
T10145 |
pobj |
rubripes,For |
R6524 |
T10149 |
T10146 |
punct |
", ",produced |
R6525 |
T10150 |
T10151 |
compound |
gene,predictions |
R6526 |
T10151 |
T10146 |
nsubjpass |
predictions,produced |
R6527 |
T10152 |
T10146 |
auxpass |
were,produced |
R6528 |
T10153 |
T10146 |
agent |
by,produced |
R6529 |
T10154 |
T10155 |
det |
the,pipeline |
R6530 |
T10155 |
T10153 |
pobj |
pipeline,by |
R6531 |
T10156 |
T10155 |
nmod |
Ensembl,pipeline |
R6532 |
T10157 |
T10155 |
amod |
automated,pipeline |
R6533 |
T10158 |
T10159 |
punct |
[,37 |
R6534 |
T10159 |
T10155 |
parataxis |
37,pipeline |
R6535 |
T10160 |
T10159 |
punct |
],37 |
R6536 |
T10161 |
T10155 |
cc |
and,pipeline |
R6537 |
T10162 |
T10163 |
det |
the,server |
R6538 |
T10163 |
T10155 |
conj |
server,pipeline |
R6539 |
T10164 |
T10163 |
compound |
JGI,server |
R6540 |
T10165 |
T10163 |
compound |
blast,server |
R6541 |
T10166 |
T10146 |
punct |
.,produced |
R6542 |
T10168 |
T10169 |
compound |
DNA,sequences |
R6543 |
T10169 |
T10170 |
nsubj |
sequences,extracted |
R6544 |
T10171 |
T10169 |
acl |
covering,sequences |
R6545 |
T10172 |
T10173 |
det |
the,regions |
R6546 |
T10173 |
T10171 |
dobj |
regions,covering |
R6547 |
T10174 |
T10173 |
compound |
homology,regions |
R6548 |
T10175 |
T10170 |
aux |
were,extracted |
R6549 |
T10176 |
T10170 |
cc |
and,extracted |
R6550 |
T10177 |
T10170 |
conj |
analyzed,extracted |
R6551 |
T10178 |
T10177 |
prep |
by,analyzed |
R6552 |
T10179 |
T10178 |
pobj |
Genscan,by |
R6553 |
T10180 |
T10181 |
aux |
to,obtain |
R6554 |
T10181 |
T10170 |
advcl |
obtain,extracted |
R6555 |
T10182 |
T10183 |
amod |
potential,exons |
R6556 |
T10183 |
T10181 |
dobj |
exons,obtain |
R6557 |
T10184 |
T10170 |
punct |
.,extracted |
R6558 |
T10186 |
T10187 |
prep |
In,added |
R6559 |
T10188 |
T10189 |
det |
some,cases |
R6560 |
T10189 |
T10186 |
pobj |
cases,In |
R6561 |
T10190 |
T10187 |
punct |
", ",added |
R6562 |
T10191 |
T10187 |
nsubjpass |
exons,added |
R6563 |
T10192 |
T10187 |
auxpass |
were,added |
R6564 |
T10193 |
T10187 |
cc |
or,added |
R6565 |
T10194 |
T10187 |
conj |
modified,added |
R6566 |
T10195 |
T10194 |
prep |
based,modified |
R6567 |
T10196 |
T10195 |
prep |
on,based |
R6568 |
T10197 |
T10198 |
det |
the,similarity |
R6569 |
T10198 |
T10196 |
pobj |
similarity,on |
R6570 |
T10199 |
T10198 |
amod |
best,similarity |
R6571 |
T10200 |
T10198 |
prep |
of,similarity |
R6572 |
T10201 |
T10202 |
amod |
translated,peptides |
R6573 |
T10202 |
T10200 |
pobj |
peptides,of |
R6574 |
T10203 |
T10198 |
prep |
to,similarity |
R6575 |
T10204 |
T10205 |
det |
the,proteins |
R6576 |
T10205 |
T10203 |
pobj |
proteins,to |
R6577 |
T10206 |
T10205 |
amod |
corresponding,proteins |
R6578 |
T10207 |
T10205 |
nmod |
mouse,proteins |
R6579 |
T10208 |
T10207 |
cc |
and,mouse |
R6580 |
T10209 |
T10207 |
conj |
human,mouse |
R6581 |
T10210 |
T10187 |
punct |
.,added |
R6582 |
T10212 |
T10213 |
prep |
For,used |
R6583 |
T10214 |
T10212 |
pobj |
regions,For |
R6584 |
T10215 |
T10214 |
prep |
with,regions |
R6585 |
T10216 |
T10217 |
amod |
low,similarity |
R6586 |
T10217 |
T10215 |
pobj |
similarity,with |
R6587 |
T10218 |
T10217 |
compound |
sequence,similarity |
R6588 |
T10219 |
T10213 |
punct |
", ",used |
R6589 |
T10220 |
T10221 |
amod |
genomic,sequences |
R6590 |
T10221 |
T10213 |
nsubjpass |
sequences,used |
R6591 |
T10222 |
T10221 |
prep |
from,sequences |
R6592 |
T10223 |
T10224 |
det |
the,pufferfish |
R6593 |
T10224 |
T10222 |
pobj |
pufferfish,from |
R6594 |
T10225 |
T10226 |
amod |
fresh,water |
R6595 |
T10226 |
T10224 |
compound |
water,pufferfish |
R6596 |
T10227 |
T10224 |
punct |
", ",pufferfish |
R6597 |
T10228 |
T10229 |
compound |
Tetraodon,nigroviridis |
R6598 |
T10229 |
T10224 |
appos |
nigroviridis,pufferfish |
R6599 |
T10230 |
T10213 |
auxpass |
were,used |
R6600 |
T10231 |
T10213 |
prep |
as,used |
R6601 |
T10232 |
T10233 |
amod |
additional,means |
R6602 |
T10233 |
T10231 |
pobj |
means,as |
R6603 |
T10234 |
T10235 |
aux |
to,verify |
R6604 |
T10235 |
T10233 |
advcl |
verify,means |
R6605 |
T10236 |
T10237 |
det |
the,exons |
R6606 |
T10237 |
T10235 |
dobj |
exons,verify |
R6607 |
T10238 |
T10237 |
amod |
predicted,exons |
R6608 |
T10239 |
T10213 |
punct |
.,used |
R6609 |
T10241 |
T10242 |
prep |
Due,obtained |
R6610 |
T10243 |
T10241 |
pcomp |
to,Due |
R6611 |
T10244 |
T10245 |
det |
the,variability |
R6612 |
T10245 |
T10241 |
pobj |
variability,Due |
R6613 |
T10246 |
T10245 |
prep |
of,variability |
R6614 |
T10247 |
T10248 |
det |
the,region |
R6615 |
T10248 |
T10246 |
pobj |
region,of |
R6616 |
T10249 |
T10248 |
amod |
central,region |
R6617 |
T10250 |
T10248 |
prep |
of,region |
R6618 |
T10251 |
T10252 |
compound |
vertebrate,cDNAs |
R6619 |
T10252 |
T10250 |
pobj |
cDNAs,of |
R6620 |
T10253 |
T10252 |
compound |
TACC3,cDNAs |
R6621 |
T10254 |
T10255 |
punct |
(,see |
R6622 |
T10255 |
T10245 |
parataxis |
see,variability |
R6623 |
T10256 |
T10255 |
dobj |
text,see |
R6624 |
T10257 |
T10255 |
punct |
),see |
R6625 |
T10258 |
T10242 |
punct |
", ",obtained |
R6626 |
T10259 |
T10260 |
aux |
to,confirm |
R6627 |
T10260 |
T10242 |
advcl |
confirm,obtained |
R6628 |
T10261 |
T10260 |
advmod |
further,confirm |
R6629 |
T10262 |
T10260 |
dobj |
prediction,confirm |
R6630 |
T10263 |
T10262 |
prep |
of,prediction |
R6631 |
T10264 |
T10265 |
det |
the,rubripes |
R6632 |
T10265 |
T10263 |
pobj |
rubripes,of |
R6633 |
T10266 |
T10265 |
compound |
Takifugu,rubripes |
R6634 |
T10267 |
T10265 |
appos |
TACC3,rubripes |
R6635 |
T10268 |
T10242 |
punct |
", ",obtained |
R6636 |
T10269 |
T10270 |
amod |
full,length |
R6637 |
T10270 |
T10271 |
compound |
length,cDNAs |
R6638 |
T10271 |
T10242 |
nsubjpass |
cDNAs,obtained |
R6639 |
T10272 |
T10271 |
acl |
corresponding,cDNAs |
R6640 |
T10273 |
T10272 |
prep |
to,corresponding |
R6641 |
T10274 |
T10275 |
det |
the,TACC3 |
R6642 |
T10275 |
T10273 |
pobj |
TACC3,to |
R6643 |
T10276 |
T10275 |
compound |
Danio,TACC3 |
R6644 |
T10277 |
T10275 |
compound |
rerio,TACC3 |
R6645 |
T10278 |
T10279 |
punct |
(,2639991 |
R6646 |
T10279 |
T10275 |
parataxis |
2639991,TACC3 |
R6647 |
T10280 |
T10279 |
nmod |
IMAGE,2639991 |
R6648 |
T10281 |
T10279 |
nmod |
clones,2639991 |
R6649 |
T10282 |
T10279 |
punct |
", ",2639991 |
R6650 |
T10283 |
T10279 |
conj |
2640369,2639991 |
R6651 |
T10284 |
T10283 |
cc |
and,2640369 |
R6652 |
T10285 |
T10283 |
conj |
3724452,2640369 |
R6653 |
T10286 |
T10279 |
punct |
),2639991 |
R6654 |
T10287 |
T10242 |
auxpass |
were,obtained |
R6655 |
T10288 |
T10242 |
advmod |
also,obtained |
R6656 |
T10289 |
T10242 |
prep |
from,obtained |
R6657 |
T10290 |
T10289 |
pobj |
A.T.C.C.,from |
R6658 |
T10291 |
T10242 |
cc |
and,obtained |
R6659 |
T10292 |
T10293 |
advmod |
fully,sequenced |
R6660 |
T10293 |
T10242 |
conj |
sequenced,obtained |
R6661 |
T10294 |
T10242 |
punct |
.,obtained |
R6662 |
T10296 |
T10297 |
amod |
Potential,segments |
R6663 |
T10297 |
T10300 |
nsubjpass |
segments,identified |
R6664 |
T10298 |
T10297 |
amod |
paralogous,segments |
R6665 |
T10299 |
T10297 |
amod |
chromosomal,segments |
R6666 |
T10301 |
T10297 |
cc |
and,segments |
R6667 |
T10302 |
T10297 |
conj |
scaffold,segments |
R6668 |
T10303 |
T10300 |
auxpass |
were,identified |
R6669 |
T10304 |
T10300 |
prep |
by,identified |
R6670 |
T10305 |
T10304 |
pcomp |
searching,by |
R6671 |
T10306 |
T10307 |
det |
the,databases |
R6672 |
T10307 |
T10305 |
dobj |
databases,searching |
R6673 |
T10308 |
T10307 |
amod |
public,databases |
R6674 |
T10309 |
T10307 |
acl |
deposited,databases |
R6675 |
T10310 |
T10309 |
prep |
at,deposited |
R6676 |
T10311 |
T10310 |
pobj |
NCBI,at |
R6677 |
T10312 |
T10310 |
cc |
and,at |
R6678 |
T10313 |
T10310 |
conj |
at,at |
R6679 |
T10314 |
T10315 |
det |
the,Project |
R6680 |
T10315 |
T10313 |
pobj |
Project,at |
R6681 |
T10316 |
T10317 |
compound |
Human,Genome |
R6682 |
T10317 |
T10315 |
compound |
Genome,Project |
R6683 |
T10318 |
T10315 |
compound |
Mapping,Project |
R6684 |
T10319 |
T10315 |
punct |
", ",Project |
R6685 |
T10320 |
T10315 |
npadvmod |
Cambridge,Project |
R6686 |
T10321 |
T10320 |
npadvmod |
UK,Cambridge |
R6687 |
T10322 |
T10300 |
punct |
.,identified |
R6688 |
T10440 |
T10439 |
prep |
of,Cloning |
R6689 |
T10441 |
T10442 |
compound |
vertebrate,TACC |
R6690 |
T10442 |
T10443 |
compound |
TACC,cDNAs |
R6691 |
T10443 |
T10440 |
pobj |
cDNAs,of |
R6692 |
T10445 |
T10446 |
det |
The,TACC3 |
R6693 |
T10446 |
T10448 |
nsubjpass |
TACC3,cloned |
R6694 |
T10447 |
T10446 |
compound |
rabbit,TACC3 |
R6695 |
T10449 |
T10448 |
auxpass |
was,cloned |
R6696 |
T10450 |
T10448 |
prep |
by,cloned |
R6697 |
T10451 |
T10452 |
compound |
rt,PCR |
R6698 |
T10452 |
T10450 |
pobj |
PCR,by |
R6699 |
T10453 |
T10452 |
punct |
-,PCR |
R6700 |
T10454 |
T10448 |
advcl |
using,cloned |
R6701 |
T10455 |
T10456 |
det |
the,primer |
R6702 |
T10456 |
T10454 |
dobj |
primer,using |
R6703 |
T10457 |
T10458 |
punct |
"""",specific |
R6704 |
T10458 |
T10456 |
amod |
specific,primer |
R6705 |
T10459 |
T10458 |
npadvmod |
TACC4,specific |
R6706 |
T10460 |
T10458 |
punct |
"""",specific |
R6707 |
T10461 |
T10456 |
appos |
T4RACE2,primer |
R6708 |
T10462 |
T10463 |
punct |
[,9 |
R6709 |
T10463 |
T10456 |
parataxis |
9,primer |
R6710 |
T10464 |
T10463 |
punct |
],9 |
R6711 |
T10465 |
T10466 |
punct |
(,cccgaactgctccaggtaatcgatctc |
R6712 |
T10466 |
T10456 |
parataxis |
cccgaactgctccaggtaatcgatctc,primer |
R6713 |
T10467 |
T10466 |
nummod |
5,cccgaactgctccaggtaatcgatctc |
R6714 |
T10468 |
T10467 |
punct |
',5 |
R6715 |
T10469 |
T10466 |
punct |
-,cccgaactgctccaggtaatcgatctc |
R6716 |
T10470 |
T10466 |
punct |
-,cccgaactgctccaggtaatcgatctc |
R6717 |
T10471 |
T10466 |
nummod |
3,cccgaactgctccaggtaatcgatctc |
R6718 |
T10472 |
T10466 |
punct |
',cccgaactgctccaggtaatcgatctc |
R6719 |
T10473 |
T10466 |
punct |
),cccgaactgctccaggtaatcgatctc |
R6720 |
T10474 |
T10456 |
cc |
and,primer |
R6721 |
T10475 |
T10476 |
det |
a,primer |
R6722 |
T10476 |
T10456 |
conj |
primer,primer |
R6723 |
T10477 |
T10476 |
compound |
consensus,primer |
R6724 |
T10478 |
T10476 |
punct |
", ",primer |
R6725 |
T10479 |
T10476 |
appos |
T3con2,primer |
R6726 |
T10480 |
T10476 |
punct |
", ",primer |
R6727 |
T10481 |
T10476 |
acl |
designed,primer |
R6728 |
T10482 |
T10481 |
prep |
to,designed |
R6729 |
T10483 |
T10484 |
det |
the,region |
R6730 |
T10484 |
T10482 |
pobj |
region,to |
R6731 |
T10485 |
T10484 |
acl |
encompassing,region |
R6732 |
T10486 |
T10487 |
det |
the,initiator |
R6733 |
T10487 |
T10485 |
dobj |
initiator,encompassing |
R6734 |
T10488 |
T10487 |
compound |
vertebrate,initiator |
R6735 |
T10489 |
T10487 |
compound |
TACC3,initiator |
R6736 |
T10490 |
T10487 |
appos |
methionine,initiator |
R6737 |
T10491 |
T10492 |
punct |
(,tatgagtctgcaggtcttaaacgac |
R6738 |
T10492 |
T10487 |
parataxis |
tatgagtctgcaggtcttaaacgac,initiator |
R6739 |
T10493 |
T10492 |
nummod |
5,tatgagtctgcaggtcttaaacgac |
R6740 |
T10494 |
T10493 |
punct |
',5 |
R6741 |
T10495 |
T10492 |
punct |
-,tatgagtctgcaggtcttaaacgac |
R6742 |
T10496 |
T10492 |
punct |
-,tatgagtctgcaggtcttaaacgac |
R6743 |
T10497 |
T10492 |
nummod |
3,tatgagtctgcaggtcttaaacgac |
R6744 |
T10498 |
T10492 |
punct |
',tatgagtctgcaggtcttaaacgac |
R6745 |
T10499 |
T10492 |
punct |
),tatgagtctgcaggtcttaaacgac |
R6746 |
T10500 |
T10448 |
punct |
.,cloned |
R6747 |
T10502 |
T10503 |
prep |
For,based |
R6748 |
T10504 |
T10502 |
pcomp |
cloning,For |
R6749 |
T10505 |
T10506 |
det |
the,cDNA |
R6750 |
T10506 |
T10504 |
dobj |
cDNA,cloning |
R6751 |
T10507 |
T10508 |
compound |
mouse,Tacc1X |
R6752 |
T10508 |
T10506 |
compound |
Tacc1X,cDNA |
R6753 |
T10509 |
T10503 |
punct |
", ",based |
R6754 |
T10510 |
T10511 |
det |
the,primers |
R6755 |
T10511 |
T10503 |
nsubjpass |
primers,based |
R6756 |
T10512 |
T10511 |
acl |
used,primers |
R6757 |
T10513 |
T10503 |
auxpass |
were,based |
R6758 |
T10514 |
T10503 |
prep |
upon,based |
R6759 |
T10515 |
T10516 |
det |
the,sequence |
R6760 |
T10516 |
T10514 |
pobj |
sequence,upon |
R6761 |
T10517 |
T10516 |
amod |
genomic,sequence |
R6762 |
T10518 |
T10516 |
acl |
reported,sequence |
R6763 |
T10519 |
T10516 |
punct |
", ",sequence |
R6764 |
T10520 |
T10516 |
cc |
and,sequence |
R6765 |
T10521 |
T10522 |
det |
the,sequence |
R6766 |
T10522 |
T10516 |
conj |
sequence,sequence |
R6767 |
T10523 |
T10522 |
prep |
of,sequence |
R6768 |
T10524 |
T10525 |
det |
the,clone |
R6769 |
T10525 |
T10523 |
pobj |
clone,of |
R6770 |
T10526 |
T10525 |
compound |
IMAGE,clone |
R6771 |
T10527 |
T10525 |
compound |
cDNA,clone |
R6772 |
T10528 |
T10525 |
appos |
4933429K08,clone |
R6773 |
T10529 |
T10522 |
punct |
: ,sequence |
R6774 |
T10530 |
T10522 |
appos |
T1XF,sequence |
R6775 |
T10531 |
T10532 |
punct |
(,ccatgttcagtcattggcaggtc |
R6776 |
T10532 |
T10530 |
parataxis |
ccatgttcagtcattggcaggtc,T1XF |
R6777 |
T10533 |
T10532 |
nummod |
5,ccatgttcagtcattggcaggtc |
R6778 |
T10534 |
T10533 |
punct |
',5 |
R6779 |
T10535 |
T10532 |
punct |
-,ccatgttcagtcattggcaggtc |
R6780 |
T10536 |
T10532 |
punct |
-,ccatgttcagtcattggcaggtc |
R6781 |
T10537 |
T10532 |
nummod |
3,ccatgttcagtcattggcaggtc |
R6782 |
T10538 |
T10532 |
punct |
',ccatgttcagtcattggcaggtc |
R6783 |
T10539 |
T10532 |
punct |
),ccatgttcagtcattggcaggtc |
R6784 |
T10540 |
T10530 |
punct |
", ",T1XF |
R6785 |
T10541 |
T10530 |
conj |
T1XF2,T1XF |
R6786 |
T10542 |
T10543 |
punct |
(,ctgcagaaccaacagttcaag |
R6787 |
T10543 |
T10541 |
parataxis |
ctgcagaaccaacagttcaag,T1XF2 |
R6788 |
T10544 |
T10543 |
nummod |
5,ctgcagaaccaacagttcaag |
R6789 |
T10545 |
T10544 |
punct |
',5 |
R6790 |
T10546 |
T10543 |
punct |
-,ctgcagaaccaacagttcaag |
R6791 |
T10547 |
T10543 |
punct |
-,ctgcagaaccaacagttcaag |
R6792 |
T10548 |
T10543 |
nummod |
3,ctgcagaaccaacagttcaag |
R6793 |
T10549 |
T10543 |
punct |
',ctgcagaaccaacagttcaag |
R6794 |
T10550 |
T10543 |
punct |
),ctgcagaaccaacagttcaag |
R6795 |
T10551 |
T10541 |
punct |
", ",T1XF2 |
R6796 |
T10552 |
T10541 |
conj |
T1XR1,T1XF2 |
R6797 |
T10553 |
T10554 |
punct |
(,agatctgtgacatcacagctc |
R6798 |
T10554 |
T10552 |
parataxis |
agatctgtgacatcacagctc,T1XR1 |
R6799 |
T10555 |
T10554 |
nummod |
5,agatctgtgacatcacagctc |
R6800 |
T10556 |
T10555 |
punct |
',5 |
R6801 |
T10557 |
T10554 |
punct |
-,agatctgtgacatcacagctc |
R6802 |
T10558 |
T10554 |
punct |
-,agatctgtgacatcacagctc |
R6803 |
T10559 |
T10554 |
nummod |
3,agatctgtgacatcacagctc |
R6804 |
T10560 |
T10554 |
punct |
',agatctgtgacatcacagctc |
R6805 |
T10561 |
T10554 |
punct |
),agatctgtgacatcacagctc |
R6806 |
T10562 |
T10552 |
punct |
", ",T1XR1 |
R6807 |
T10563 |
T10552 |
conj |
T1XR2,T1XR1 |
R6808 |
T10564 |
T10565 |
punct |
(,ctcgagtcagttagtcttatccagctt |
R6809 |
T10565 |
T10563 |
parataxis |
ctcgagtcagttagtcttatccagctt,T1XR2 |
R6810 |
T10566 |
T10565 |
nummod |
5,ctcgagtcagttagtcttatccagctt |
R6811 |
T10567 |
T10566 |
punct |
',5 |
R6812 |
T10568 |
T10565 |
punct |
-,ctcgagtcagttagtcttatccagctt |
R6813 |
T10569 |
T10565 |
punct |
-,ctcgagtcagttagtcttatccagctt |
R6814 |
T10570 |
T10565 |
nummod |
3,ctcgagtcagttagtcttatccagctt |
R6815 |
T10571 |
T10565 |
punct |
',ctcgagtcagttagtcttatccagctt |
R6816 |
T10572 |
T10565 |
punct |
),ctcgagtcagttagtcttatccagctt |
R6817 |
T10573 |
T10563 |
punct |
", ",T1XR2 |
R6818 |
T10574 |
T10563 |
conj |
BB617F,T1XR2 |
R6819 |
T10575 |
T10576 |
punct |
(,accaccaacttgagtacctg |
R6820 |
T10576 |
T10574 |
parataxis |
accaccaacttgagtacctg,BB617F |
R6821 |
T10577 |
T10576 |
nummod |
5,accaccaacttgagtacctg |
R6822 |
T10578 |
T10577 |
punct |
',5 |
R6823 |
T10579 |
T10576 |
punct |
-,accaccaacttgagtacctg |
R6824 |
T10580 |
T10576 |
punct |
-,accaccaacttgagtacctg |
R6825 |
T10581 |
T10576 |
nummod |
3,accaccaacttgagtacctg |
R6826 |
T10582 |
T10576 |
punct |
',accaccaacttgagtacctg |
R6827 |
T10583 |
T10576 |
punct |
),accaccaacttgagtacctg |
R6828 |
T10584 |
T10574 |
cc |
and,BB617F |
R6829 |
T10585 |
T10574 |
conj |
BB617R,BB617F |
R6830 |
T10586 |
T10587 |
punct |
(,gtatcttgaactgttggttctg |
R6831 |
T10587 |
T10585 |
parataxis |
gtatcttgaactgttggttctg,BB617R |
R6832 |
T10588 |
T10587 |
nummod |
5,gtatcttgaactgttggttctg |
R6833 |
T10589 |
T10588 |
punct |
',5 |
R6834 |
T10590 |
T10587 |
punct |
-,gtatcttgaactgttggttctg |
R6835 |
T10591 |
T10587 |
punct |
-,gtatcttgaactgttggttctg |
R6836 |
T10592 |
T10587 |
nummod |
3,gtatcttgaactgttggttctg |
R6837 |
T10593 |
T10587 |
punct |
',gtatcttgaactgttggttctg |
R6838 |
T10594 |
T10587 |
punct |
),gtatcttgaactgttggttctg |
R6839 |
T10595 |
T10503 |
punct |
.,based |
R6840 |
T10597 |
T10598 |
prep |
For,located |
R6841 |
T10599 |
T10597 |
pobj |
analysis,For |
R6842 |
T10600 |
T10599 |
prep |
of,analysis |
R6843 |
T10601 |
T10602 |
compound |
TACC1,variants |
R6844 |
T10602 |
T10600 |
pobj |
variants,of |
R6845 |
T10603 |
T10602 |
compound |
splice,variants |
R6846 |
T10604 |
T10598 |
punct |
", ",located |
R6847 |
T10605 |
T10606 |
det |
the,primers |
R6848 |
T10606 |
T10598 |
nsubjpass |
primers,located |
R6849 |
T10607 |
T10606 |
amod |
forward,primers |
R6850 |
T10608 |
T10606 |
acl |
used,primers |
R6851 |
T10609 |
T10598 |
auxpass |
were,located |
R6852 |
T10610 |
T10598 |
prep |
in,located |
R6853 |
T10611 |
T10610 |
pobj |
exon,in |
R6854 |
T10612 |
T10611 |
nummod |
1b,exon |
R6855 |
T10613 |
T10611 |
punct |
: ,exon |
R6856 |
T10614 |
T10615 |
dep |
EF,gagagatgcgaaatcagcg |
R6857 |
T10615 |
T10611 |
parataxis |
gagagatgcgaaatcagcg,exon |
R6858 |
T10616 |
T10615 |
punct |
(,gagagatgcgaaatcagcg |
R6859 |
T10617 |
T10615 |
nummod |
5,gagagatgcgaaatcagcg |
R6860 |
T10618 |
T10617 |
punct |
',5 |
R6861 |
T10619 |
T10615 |
punct |
-,gagagatgcgaaatcagcg |
R6862 |
T10620 |
T10615 |
punct |
-,gagagatgcgaaatcagcg |
R6863 |
T10621 |
T10615 |
nummod |
3,gagagatgcgaaatcagcg |
R6864 |
T10622 |
T10615 |
punct |
',gagagatgcgaaatcagcg |
R6865 |
T10623 |
T10615 |
punct |
),gagagatgcgaaatcagcg |
R6866 |
T10624 |
T10611 |
punct |
", ",exon |
R6867 |
T10625 |
T10611 |
appos |
Exon,exon |
R6868 |
T10626 |
T10625 |
nummod |
1d,Exon |
R6869 |
T10627 |
T10625 |
punct |
: ,Exon |
R6870 |
T10628 |
T10629 |
dep |
X3F,agtcaaagaaggcatctgcag |
R6871 |
T10629 |
T10625 |
parataxis |
agtcaaagaaggcatctgcag,Exon |
R6872 |
T10630 |
T10629 |
punct |
(,agtcaaagaaggcatctgcag |
R6873 |
T10631 |
T10629 |
nummod |
5,agtcaaagaaggcatctgcag |
R6874 |
T10632 |
T10631 |
punct |
',5 |
R6875 |
T10633 |
T10629 |
punct |
-,agtcaaagaaggcatctgcag |
R6876 |
T10634 |
T10629 |
punct |
-,agtcaaagaaggcatctgcag |
R6877 |
T10635 |
T10629 |
nummod |
3,agtcaaagaaggcatctgcag |
R6878 |
T10636 |
T10629 |
punct |
',agtcaaagaaggcatctgcag |
R6879 |
T10637 |
T10629 |
punct |
),agtcaaagaaggcatctgcag |
R6880 |
T10638 |
T10611 |
punct |
", ",exon |
R6881 |
T10639 |
T10611 |
appos |
Exon,exon |
R6882 |
T10640 |
T10639 |
nummod |
1a,Exon |
R6883 |
T10641 |
T10639 |
punct |
: ,Exon |
R6884 |
T10642 |
T10643 |
dep |
1DF,ccaagttctgcgccatggg |
R6885 |
T10643 |
T10639 |
parataxis |
ccaagttctgcgccatggg,Exon |
R6886 |
T10644 |
T10643 |
punct |
(,ccaagttctgcgccatggg |
R6887 |
T10645 |
T10643 |
nummod |
5,ccaagttctgcgccatggg |
R6888 |
T10646 |
T10645 |
punct |
',5 |
R6889 |
T10647 |
T10643 |
punct |
-,ccaagttctgcgccatggg |
R6890 |
T10648 |
T10643 |
punct |
-,ccaagttctgcgccatggg |
R6891 |
T10649 |
T10643 |
nummod |
3,ccaagttctgcgccatggg |
R6892 |
T10650 |
T10643 |
punct |
',ccaagttctgcgccatggg |
R6893 |
T10651 |
T10643 |
punct |
),ccaagttctgcgccatggg |
R6894 |
T10652 |
T10598 |
punct |
.,located |
R6895 |
T10654 |
T10655 |
det |
The,primers |
R6896 |
T10655 |
T10657 |
nsubj |
primers,were |
R6897 |
T10656 |
T10655 |
amod |
reverse,primers |
R6898 |
T10658 |
T10655 |
acl |
used,primers |
R6899 |
T10659 |
T10657 |
punct |
: ,were |
R6900 |
T10660 |
T10657 |
attr |
Exon,were |
R6901 |
T10661 |
T10660 |
nummod |
1,Exon |
R6902 |
T10662 |
T10660 |
punct |
: ,Exon |
R6903 |
T10663 |
T10664 |
dep |
X1R,ggatttggtctcggcttgcgaatc |
R6904 |
T10664 |
T10660 |
parataxis |
ggatttggtctcggcttgcgaatc,Exon |
R6905 |
T10665 |
T10664 |
punct |
(,ggatttggtctcggcttgcgaatc |
R6906 |
T10666 |
T10664 |
nummod |
5,ggatttggtctcggcttgcgaatc |
R6907 |
T10667 |
T10666 |
punct |
',5 |
R6908 |
T10668 |
T10664 |
punct |
-,ggatttggtctcggcttgcgaatc |
R6909 |
T10669 |
T10664 |
punct |
-,ggatttggtctcggcttgcgaatc |
R6910 |
T10670 |
T10664 |
nummod |
3,ggatttggtctcggcttgcgaatc |
R6911 |
T10671 |
T10664 |
punct |
',ggatttggtctcggcttgcgaatc |
R6912 |
T10672 |
T10664 |
punct |
),ggatttggtctcggcttgcgaatc |
R6913 |
T10673 |
T10660 |
punct |
", ",Exon |
R6914 |
T10674 |
T10660 |
appos |
Exon,Exon |
R6915 |
T10675 |
T10674 |
nummod |
2,Exon |
R6916 |
T10676 |
T10674 |
punct |
: ,Exon |
R6917 |
T10677 |
T10678 |
dep |
BX647R,cttgtgattcttggcttttgg |
R6918 |
T10678 |
T10674 |
parataxis |
cttgtgattcttggcttttgg,Exon |
R6919 |
T10679 |
T10678 |
punct |
(,cttgtgattcttggcttttgg |
R6920 |
T10680 |
T10678 |
nummod |
5,cttgtgattcttggcttttgg |
R6921 |
T10681 |
T10680 |
punct |
',5 |
R6922 |
T10682 |
T10678 |
punct |
-,cttgtgattcttggcttttgg |
R6923 |
T10683 |
T10678 |
punct |
-,cttgtgattcttggcttttgg |
R6924 |
T10684 |
T10678 |
nummod |
3,cttgtgattcttggcttttgg |
R6925 |
T10685 |
T10678 |
punct |
',cttgtgattcttggcttttgg |
R6926 |
T10686 |
T10678 |
punct |
),cttgtgattcttggcttttgg |
R6927 |
T10687 |
T10660 |
punct |
", ",Exon |
R6928 |
T10688 |
T10660 |
appos |
Exon,Exon |
R6929 |
T10689 |
T10688 |
nummod |
3,Exon |
R6930 |
T10690 |
T10688 |
punct |
: ,Exon |
R6931 |
T10691 |
T10692 |
dep |
6SPR,gtcatcgcctcgtcctggagggc |
R6932 |
T10692 |
T10688 |
parataxis |
gtcatcgcctcgtcctggagggc,Exon |
R6933 |
T10693 |
T10692 |
punct |
(,gtcatcgcctcgtcctggagggc |
R6934 |
T10694 |
T10692 |
nummod |
5,gtcatcgcctcgtcctggagggc |
R6935 |
T10695 |
T10694 |
punct |
',5 |
R6936 |
T10696 |
T10692 |
punct |
-,gtcatcgcctcgtcctggagggc |
R6937 |
T10697 |
T10692 |
punct |
-,gtcatcgcctcgtcctggagggc |
R6938 |
T10698 |
T10692 |
nummod |
3,gtcatcgcctcgtcctggagggc |
R6939 |
T10699 |
T10692 |
punct |
',gtcatcgcctcgtcctggagggc |
R6940 |
T10700 |
T10692 |
punct |
),gtcatcgcctcgtcctggagggc |
R6941 |
T10701 |
T10660 |
punct |
", ",Exon |
R6942 |
T10702 |
T10703 |
compound |
Exon,4a |
R6943 |
T10703 |
T10660 |
appos |
4a,Exon |
R6944 |
T10704 |
T10703 |
punct |
: ,4a |
R6945 |
T10705 |
T10706 |
dep |
1DR,aatttcacttgttcagtagtc |
R6946 |
T10706 |
T10703 |
parataxis |
aatttcacttgttcagtagtc,4a |
R6947 |
T10707 |
T10706 |
punct |
(,aatttcacttgttcagtagtc |
R6948 |
T10708 |
T10706 |
nummod |
5,aatttcacttgttcagtagtc |
R6949 |
T10709 |
T10708 |
punct |
',5 |
R6950 |
T10710 |
T10706 |
punct |
-,aatttcacttgttcagtagtc |
R6951 |
T10711 |
T10706 |
punct |
-,aatttcacttgttcagtagtc |
R6952 |
T10712 |
T10706 |
nummod |
3,aatttcacttgttcagtagtc |
R6953 |
T10713 |
T10706 |
punct |
',aatttcacttgttcagtagtc |
R6954 |
T10714 |
T10706 |
punct |
),aatttcacttgttcagtagtc |
R6955 |
T10715 |
T10660 |
punct |
", ",Exon |
R6956 |
T10716 |
T10660 |
appos |
Exon,Exon |
R6957 |
T10717 |
T10716 |
nummod |
5,Exon |
R6958 |
T10718 |
T10716 |
punct |
: ,Exon |
R6959 |
T10719 |
T10720 |
dep |
128R,cctgcttctgaggatgaaaacgc |
R6960 |
T10720 |
T10716 |
parataxis |
cctgcttctgaggatgaaaacgc,Exon |
R6961 |
T10721 |
T10720 |
punct |
(,cctgcttctgaggatgaaaacgc |
R6962 |
T10722 |
T10720 |
nummod |
5,cctgcttctgaggatgaaaacgc |
R6963 |
T10723 |
T10722 |
punct |
',5 |
R6964 |
T10724 |
T10720 |
punct |
-,cctgcttctgaggatgaaaacgc |
R6965 |
T10725 |
T10720 |
punct |
-,cctgcttctgaggatgaaaacgc |
R6966 |
T10726 |
T10720 |
nummod |
3,cctgcttctgaggatgaaaacgc |
R6967 |
T10727 |
T10720 |
punct |
',cctgcttctgaggatgaaaacgc |
R6968 |
T10728 |
T10720 |
punct |
),cctgcttctgaggatgaaaacgc |
R6969 |
T10729 |
T10657 |
punct |
.,were |
R6970 |
T10731 |
T10732 |
compound |
Rabbit,brain |
R6971 |
T10732 |
T10733 |
compound |
brain,mRNA |
R6972 |
T10733 |
T10736 |
nsubjpass |
mRNA,obtained |
R6973 |
T10734 |
T10733 |
compound |
poly,mRNA |
R6974 |
T10735 |
T10733 |
compound |
A+,mRNA |
R6975 |
T10737 |
T10733 |
punct |
", ",mRNA |
R6976 |
T10738 |
T10739 |
compound |
mouse,testis |
R6977 |
T10739 |
T10733 |
conj |
testis,mRNA |
R6978 |
T10740 |
T10739 |
cc |
and,testis |
R6979 |
T10741 |
T10742 |
amod |
human,brain |
R6980 |
T10742 |
T10743 |
nmod |
brain,RNA |
R6981 |
T10743 |
T10739 |
conj |
RNA,testis |
R6982 |
T10744 |
T10743 |
amod |
total,RNA |
R6983 |
T10745 |
T10736 |
auxpass |
were,obtained |
R6984 |
T10746 |
T10736 |
prep |
from,obtained |
R6985 |
T10747 |
T10748 |
compound |
BD,Clontech |
R6986 |
T10748 |
T10746 |
pobj |
Clontech,from |
R6987 |
T10749 |
T10748 |
compound |
Bioscience,Clontech |
R6988 |
T10750 |
T10748 |
punct |
(,Clontech |
R6989 |
T10751 |
T10752 |
compound |
Palo,Alto |
R6990 |
T10752 |
T10748 |
appos |
Alto,Clontech |
R6991 |
T10753 |
T10752 |
punct |
", ",Alto |
R6992 |
T10754 |
T10752 |
npadvmod |
CA,Alto |
R6993 |
T10755 |
T10752 |
punct |
", ",Alto |
R6994 |
T10756 |
T10752 |
npadvmod |
U.S.A.,Alto |
R6995 |
T10757 |
T10748 |
punct |
),Clontech |
R6996 |
T10758 |
T10736 |
punct |
.,obtained |
R6997 |
T10760 |
T10761 |
amod |
Reverse,transcription |
R6998 |
T10761 |
T10762 |
nsubjpass |
transcription,performed |
R6999 |
T10763 |
T10761 |
cc |
and,transcription |
R7000 |
T10764 |
T10761 |
conj |
PCR,transcription |
R7001 |
T10765 |
T10762 |
auxpass |
was,performed |
R7002 |
T10766 |
T10767 |
mark |
as,described |
R7003 |
T10767 |
T10762 |
advcl |
described,performed |
R7004 |
T10768 |
T10767 |
advmod |
previously,described |
R7005 |
T10769 |
T10762 |
punct |
", ",performed |
R7006 |
T10770 |
T10762 |
advcl |
using,performed |
R7007 |
T10771 |
T10772 |
preconj |
either,μg |
R7008 |
T10772 |
T10770 |
dobj |
μg,using |
R7009 |
T10773 |
T10772 |
nummod |
1,μg |
R7010 |
T10774 |
T10772 |
prep |
of,μg |
R7011 |
T10775 |
T10776 |
amod |
total,RNA |
R7012 |
T10776 |
T10774 |
pobj |
RNA,of |
R7013 |
T10777 |
T10772 |
cc |
or,μg |
R7014 |
T10778 |
T10779 |
nummod |
50,ng |
R7015 |
T10779 |
T10772 |
conj |
ng,μg |
R7016 |
T10780 |
T10779 |
prep |
of,ng |
R7017 |
T10781 |
T10782 |
compound |
poly,A+ |
R7018 |
T10782 |
T10783 |
compound |
A+,mRNA |
R7019 |
T10783 |
T10780 |
pobj |
mRNA,of |
R7020 |
T10784 |
T10770 |
prep |
as,using |
R7021 |
T10785 |
T10784 |
pobj |
template,as |
R7022 |
T10786 |
T10785 |
prep |
for,template |
R7023 |
T10787 |
T10788 |
amod |
first,strand |
R7024 |
T10788 |
T10789 |
compound |
strand,cDNA |
R7025 |
T10789 |
T10790 |
compound |
cDNA,synthesis |
R7026 |
T10790 |
T10786 |
pobj |
synthesis,for |
R7027 |
T10791 |
T10762 |
punct |
.,performed |
R7028 |
T10793 |
T10794 |
compound |
PCR,products |
R7029 |
T10794 |
T10795 |
nsubjpass |
products,cloned |
R7030 |
T10796 |
T10795 |
auxpass |
were,cloned |
R7031 |
T10797 |
T10795 |
prep |
into,cloned |
R7032 |
T10798 |
T10797 |
pobj |
pCR2.1,into |
R7033 |
T10799 |
T10800 |
punct |
(,Invitrogen |
R7034 |
T10800 |
T10798 |
parataxis |
Invitrogen,pCR2.1 |
R7035 |
T10801 |
T10800 |
punct |
", ",Invitrogen |
R7036 |
T10802 |
T10800 |
npadvmod |
Carlsbad,Invitrogen |
R7037 |
T10803 |
T10800 |
npadvmod |
CA,Invitrogen |
R7038 |
T10804 |
T10800 |
punct |
", ",Invitrogen |
R7039 |
T10805 |
T10800 |
npadvmod |
U.S.A.,Invitrogen |
R7040 |
T10806 |
T10800 |
punct |
),Invitrogen |
R7041 |
T10807 |
T10795 |
cc |
and,cloned |
R7042 |
T10808 |
T10795 |
conj |
transformed,cloned |
R7043 |
T10809 |
T10808 |
prep |
into,transformed |
R7044 |
T10810 |
T10811 |
poss |
InvαF,competent |
R7045 |
T10811 |
T10813 |
amod |
competent,cells |
R7046 |
T10812 |
T10810 |
case |
',InvαF |
R7047 |
T10813 |
T10809 |
pobj |
cells,into |
R7048 |
T10814 |
T10795 |
punct |
.,cloned |
R7049 |
T10816 |
T10817 |
compound |
Plasmid,inserts |
R7050 |
T10817 |
T10818 |
nsubjpass |
inserts,sequenced |
R7051 |
T10819 |
T10818 |
auxpass |
were,sequenced |
R7052 |
T10820 |
T10818 |
agent |
by,sequenced |
R7053 |
T10821 |
T10822 |
det |
the,Facility |
R7054 |
T10822 |
T10820 |
pobj |
Facility,by |
R7055 |
T10823 |
T10824 |
compound |
Roswell,Park |
R7056 |
T10824 |
T10825 |
compound |
Park,Institute |
R7057 |
T10825 |
T10822 |
compound |
Institute,Facility |
R7058 |
T10826 |
T10825 |
compound |
Cancer,Institute |
R7059 |
T10827 |
T10828 |
compound |
Biopolymer,Core |
R7060 |
T10828 |
T10822 |
compound |
Core,Facility |
R7061 |
T10829 |
T10818 |
punct |
.,sequenced |
R7062 |
T10983 |
T10982 |
prep |
of,Deposition |
R7063 |
T10984 |
T10985 |
compound |
nucleotide,sequences |
R7064 |
T10985 |
T10983 |
pobj |
sequences,of |
R7065 |
T10987 |
T10988 |
nsubjpass |
Sequences,deposited |
R7066 |
T10989 |
T10987 |
prep |
from,Sequences |
R7067 |
T10990 |
T10991 |
det |
this,article |
R7068 |
T10991 |
T10989 |
pobj |
article,from |
R7069 |
T10992 |
T10988 |
aux |
have,deposited |
R7070 |
T10993 |
T10988 |
auxpass |
been,deposited |
R7071 |
T10994 |
T10988 |
prep |
in,deposited |
R7072 |
T10995 |
T10996 |
det |
the,database |
R7073 |
T10996 |
T10994 |
pobj |
database,in |
R7074 |
T10997 |
T10996 |
compound |
GenBank,database |
R7075 |
T10998 |
T10988 |
prep |
with,deposited |
R7076 |
T10999 |
T11000 |
det |
the,numbers |
R7077 |
T11000 |
T10998 |
pobj |
numbers,with |
R7078 |
T11001 |
T11000 |
amod |
following,numbers |
R7079 |
T11002 |
T11000 |
compound |
accession,numbers |
R7080 |
T11003 |
T11000 |
punct |
: ,numbers |
R7081 |
T11004 |
T11005 |
nmod |
Homo,sapiens |
R7082 |
T11005 |
T11006 |
nmod |
sapiens,S |
R7083 |
T11006 |
T11000 |
appos |
S,numbers |
R7084 |
T11007 |
T11006 |
nmod |
TACC1,S |
R7085 |
T11008 |
T11009 |
amod |
short,isoform |
R7086 |
T11009 |
T11006 |
compound |
isoform,S |
R7087 |
T11010 |
T11011 |
punct |
(,AY177411 |
R7088 |
T11011 |
T11006 |
parataxis |
AY177411,S |
R7089 |
T11012 |
T11011 |
punct |
),AY177411 |
R7090 |
T11013 |
T11006 |
punct |
", ",S |
R7091 |
T11014 |
T11015 |
nmod |
Mus,musculus |
R7092 |
T11015 |
T11016 |
nmod |
musculus,S |
R7093 |
T11016 |
T11006 |
appos |
S,S |
R7094 |
T11017 |
T11016 |
nmod |
TACC1,S |
R7095 |
T11018 |
T11019 |
amod |
short,isoform |
R7096 |
T11019 |
T11016 |
compound |
isoform,S |
R7097 |
T11020 |
T11021 |
punct |
(,AY177412 |
R7098 |
T11021 |
T11016 |
parataxis |
AY177412,S |
R7099 |
T11022 |
T11021 |
punct |
),AY177412 |
R7100 |
T11023 |
T11006 |
punct |
", ",S |
R7101 |
T11024 |
T11025 |
nmod |
Mus,musculus |
R7102 |
T11025 |
T11026 |
nmod |
musculus,A |
R7103 |
T11026 |
T11006 |
appos |
A,S |
R7104 |
T11027 |
T11026 |
nmod |
TACC1,A |
R7105 |
T11028 |
T11029 |
amod |
long,isoform |
R7106 |
T11029 |
T11026 |
compound |
isoform,A |
R7107 |
T11030 |
T11031 |
punct |
(,AY177413 |
R7108 |
T11031 |
T11026 |
parataxis |
AY177413,A |
R7109 |
T11032 |
T11031 |
punct |
),AY177413 |
R7110 |
T11033 |
T11006 |
punct |
", ",S |
R7111 |
T11034 |
T11035 |
compound |
Mus,musculus |
R7112 |
T11035 |
T11036 |
compound |
musculus,TACC2s |
R7113 |
T11036 |
T11006 |
appos |
TACC2s,S |
R7114 |
T11037 |
T11038 |
punct |
(,AY177410 |
R7115 |
T11038 |
T11036 |
parataxis |
AY177410,TACC2s |
R7116 |
T11039 |
T11038 |
punct |
),AY177410 |
R7117 |
T11040 |
T11006 |
punct |
", ",S |
R7118 |
T11041 |
T11042 |
compound |
Oryctolagus,cuniculus |
R7119 |
T11042 |
T11043 |
compound |
cuniculus,TACC3 |
R7120 |
T11043 |
T11006 |
appos |
TACC3,S |
R7121 |
T11044 |
T11045 |
punct |
(,AY161270 |
R7122 |
T11045 |
T11043 |
parataxis |
AY161270,TACC3 |
R7123 |
T11046 |
T11045 |
punct |
),AY161270 |
R7124 |
T11047 |
T11006 |
punct |
", ",S |
R7125 |
T11048 |
T11049 |
compound |
Danio,rerio |
R7126 |
T11049 |
T11050 |
compound |
rerio,TACC3 |
R7127 |
T11050 |
T11006 |
appos |
TACC3,S |
R7128 |
T11051 |
T11052 |
punct |
(,AY170618 |
R7129 |
T11052 |
T11050 |
parataxis |
AY170618,TACC3 |
R7130 |
T11053 |
T11052 |
punct |
),AY170618 |
R7131 |
T11054 |
T10988 |
punct |
.,deposited |
R7132 |
T11056 |
T11057 |
nsubj |
Annotations,are |
R7133 |
T11058 |
T11056 |
acl |
submitted,Annotations |
R7134 |
T11059 |
T11058 |
prep |
to,submitted |
R7135 |
T11060 |
T11061 |
det |
the,database |
R7136 |
T11061 |
T11059 |
pobj |
database,to |
R7137 |
T11062 |
T11063 |
amod |
Third,party |
R7138 |
T11063 |
T11061 |
compound |
party,database |
R7139 |
T11064 |
T11061 |
compound |
annotation,database |
R7140 |
T11065 |
T11061 |
prep |
at,database |
R7141 |
T11066 |
T11065 |
pobj |
NCBI,at |
R7142 |
T11067 |
T11068 |
mark |
as,follows |
R7143 |
T11068 |
T11057 |
advcl |
follows,are |
R7144 |
T11069 |
T11057 |
punct |
: ,are |
R7145 |
T11070 |
T11071 |
nmod |
Rattus,norvegus |
R7146 |
T11071 |
T11072 |
nmod |
norvegus,A |
R7147 |
T11072 |
T11057 |
dep |
A,are |
R7148 |
T11073 |
T11072 |
nmod |
TACC1,A |
R7149 |
T11074 |
T11075 |
amod |
long,isoform |
R7150 |
T11075 |
T11072 |
compound |
isoform,A |
R7151 |
T11076 |
T11077 |
punct |
(,BK001653 |
R7152 |
T11077 |
T11072 |
parataxis |
BK001653,A |
R7153 |
T11078 |
T11077 |
punct |
),BK001653 |
R7154 |
T11079 |
T11072 |
punct |
", ",A |
R7155 |
T11080 |
T11081 |
compound |
Takifugu,rubripes |
R7156 |
T11081 |
T11082 |
compound |
rubripes,TACC1A |
R7157 |
T11082 |
T11072 |
appos |
TACC1A,A |
R7158 |
T11083 |
T11084 |
punct |
(,BK000667 |
R7159 |
T11084 |
T11082 |
parataxis |
BK000667,TACC1A |
R7160 |
T11085 |
T11084 |
compound |
BK000666,BK000667 |
R7161 |
T11086 |
T11084 |
punct |
/,BK000667 |
R7162 |
T11087 |
T11084 |
punct |
),BK000667 |
R7163 |
T11088 |
T11072 |
punct |
", ",A |
R7164 |
T11089 |
T11090 |
compound |
Takifugu,rubripes |
R7165 |
T11090 |
T11091 |
compound |
rubripes,TACC1B |
R7166 |
T11091 |
T11072 |
appos |
TACC1B,A |
R7167 |
T11092 |
T11093 |
punct |
(,BK000664 |
R7168 |
T11093 |
T11091 |
parataxis |
BK000664,TACC1B |
R7169 |
T11094 |
T11093 |
punct |
),BK000664 |
R7170 |
T11095 |
T11072 |
punct |
", ",A |
R7171 |
T11096 |
T11097 |
compound |
Mus,musculus |
R7172 |
T11097 |
T11098 |
compound |
musculus,TACC2l |
R7173 |
T11098 |
T11072 |
appos |
TACC2l,A |
R7174 |
T11099 |
T11100 |
punct |
(,BK001495 |
R7175 |
T11100 |
T11098 |
parataxis |
BK001495,TACC2l |
R7176 |
T11101 |
T11100 |
punct |
),BK001495 |
R7177 |
T11102 |
T11072 |
punct |
", ",A |
R7178 |
T11103 |
T11104 |
compound |
Rattus,norvegus |
R7179 |
T11104 |
T11105 |
compound |
norvegus,TACC2l |
R7180 |
T11105 |
T11072 |
appos |
TACC2l,A |
R7181 |
T11106 |
T11107 |
punct |
(,BK001658 |
R7182 |
T11107 |
T11105 |
parataxis |
BK001658,TACC2l |
R7183 |
T11108 |
T11107 |
punct |
),BK001658 |
R7184 |
T11109 |
T11072 |
punct |
", ",A |
R7185 |
T11110 |
T11111 |
compound |
Rattus,norvegus |
R7186 |
T11111 |
T11112 |
compound |
norvegus,TACC2s |
R7187 |
T11112 |
T11072 |
appos |
TACC2s,A |
R7188 |
T11113 |
T11114 |
punct |
(,BK001657 |
R7189 |
T11114 |
T11112 |
parataxis |
BK001657,TACC2s |
R7190 |
T11115 |
T11114 |
punct |
),BK001657 |
R7191 |
T11116 |
T11072 |
punct |
", ",A |
R7192 |
T11117 |
T11118 |
compound |
Takifugu,rubripes |
R7193 |
T11118 |
T11119 |
compound |
rubripes,TACC2l |
R7194 |
T11119 |
T11072 |
appos |
TACC2l,A |
R7195 |
T11120 |
T11121 |
punct |
(,BK000690 |
R7196 |
T11121 |
T11119 |
parataxis |
BK000690,TACC2l |
R7197 |
T11122 |
T11121 |
punct |
),BK000690 |
R7198 |
T11123 |
T11072 |
punct |
", ",A |
R7199 |
T11124 |
T11125 |
compound |
Rattus,norvegus |
R7200 |
T11125 |
T11126 |
compound |
norvegus,TACC3 |
R7201 |
T11126 |
T11072 |
appos |
TACC3,A |
R7202 |
T11127 |
T11128 |
punct |
(,BK001491 |
R7203 |
T11128 |
T11126 |
parataxis |
BK001491,TACC3 |
R7204 |
T11129 |
T11128 |
punct |
),BK001491 |
R7205 |
T11130 |
T11072 |
punct |
", ",A |
R7206 |
T11131 |
T11132 |
compound |
Gallus,gallus |
R7207 |
T11132 |
T11133 |
compound |
gallus,TACC3 |
R7208 |
T11133 |
T11072 |
appos |
TACC3,A |
R7209 |
T11134 |
T11135 |
punct |
(,BK001482 |
R7210 |
T11135 |
T11133 |
parataxis |
BK001482,TACC3 |
R7211 |
T11136 |
T11135 |
punct |
),BK001482 |
R7212 |
T11137 |
T11072 |
punct |
", ",A |
R7213 |
T11138 |
T11139 |
compound |
Silurana,tropicalis |
R7214 |
T11139 |
T11140 |
compound |
tropicalis,TACC3 |
R7215 |
T11140 |
T11072 |
appos |
TACC3,A |
R7216 |
T11141 |
T11142 |
punct |
(,BK001481 |
R7217 |
T11142 |
T11140 |
parataxis |
BK001481,TACC3 |
R7218 |
T11143 |
T11142 |
punct |
),BK001481 |
R7219 |
T11144 |
T11072 |
punct |
",",A |
R7220 |
T11145 |
T11146 |
compound |
Takifugu,rubripes |
R7221 |
T11146 |
T11147 |
compound |
rubripes,TACC3 |
R7222 |
T11147 |
T11072 |
appos |
TACC3,A |
R7223 |
T11148 |
T11149 |
punct |
(,BK000649 |
R7224 |
T11149 |
T11147 |
parataxis |
BK000649,TACC3 |
R7225 |
T11150 |
T11149 |
punct |
),BK000649 |
R7226 |
T11151 |
T11072 |
punct |
", ",A |
R7227 |
T11152 |
T11153 |
compound |
Takifugu,rubripes |
R7228 |
T11153 |
T11154 |
compound |
rubripes,RHAMM |
R7229 |
T11154 |
T11072 |
appos |
RHAMM,A |
R7230 |
T11155 |
T11156 |
punct |
(,BK000676 |
R7231 |
T11156 |
T11154 |
parataxis |
BK000676,RHAMM |
R7232 |
T11157 |
T11156 |
punct |
),BK000676 |
R7233 |
T11158 |
T11072 |
punct |
", ",A |
R7234 |
T11159 |
T11160 |
compound |
Ciona,intestinalis |
R7235 |
T11160 |
T11161 |
compound |
intestinalis,RHAMM |
R7236 |
T11161 |
T11072 |
appos |
RHAMM,A |
R7237 |
T11162 |
T11163 |
punct |
(,BK001479 |
R7238 |
T11163 |
T11161 |
parataxis |
BK001479,RHAMM |
R7239 |
T11164 |
T11163 |
punct |
),BK001479 |
R7240 |
T11165 |
T11072 |
punct |
", ",A |
R7241 |
T11166 |
T11167 |
compound |
Takifugu,rubripes |
R7242 |
T11167 |
T11168 |
compound |
rubripes,Keratin |
R7243 |
T11168 |
T11072 |
appos |
Keratin,A |
R7244 |
T11169 |
T11170 |
punct |
(,BK000677 |
R7245 |
T11170 |
T11168 |
parataxis |
BK000677,Keratin |
R7246 |
T11171 |
T11170 |
punct |
),BK000677 |
R7247 |
T11172 |
T11072 |
punct |
", ",A |
R7248 |
T11173 |
T11174 |
compound |
Takifugu,rubripes |
R7249 |
T11174 |
T11175 |
compound |
rubripes,TPM1 |
R7250 |
T11175 |
T11072 |
appos |
TPM1,A |
R7251 |
T11176 |
T11177 |
punct |
(,BAC10576 |
R7252 |
T11177 |
T11175 |
parataxis |
BAC10576,TPM1 |
R7253 |
T11178 |
T11177 |
punct |
),BAC10576 |
R7254 |
T11179 |
T11072 |
punct |
", ",A |
R7255 |
T11180 |
T11181 |
compound |
Ciona,intestinalis |
R7256 |
T11181 |
T11182 |
compound |
intestinalis,Kif3b |
R7257 |
T11182 |
T11072 |
appos |
Kif3b,A |
R7258 |
T11183 |
T11184 |
punct |
(,BK001492 |
R7259 |
T11184 |
T11182 |
parataxis |
BK001492,Kif3b |
R7260 |
T11185 |
T11184 |
punct |
),BK001492 |
R7261 |
T11186 |
T11072 |
punct |
", ",A |
R7262 |
T11187 |
T11188 |
compound |
Ciona,intestinalis |
R7263 |
T11188 |
T11189 |
compound |
intestinalis,klp2 |
R7264 |
T11189 |
T11072 |
appos |
klp2,A |
R7265 |
T11190 |
T11191 |
punct |
(,BK001493 |
R7266 |
T11191 |
T11189 |
parataxis |
BK001493,klp2 |
R7267 |
T11192 |
T11191 |
punct |
),BK001493 |
R7268 |
T11193 |
T11057 |
punct |
.,are |
R7269 |
T11434 |
T11435 |
amod |
Phylogenetic,analysis |
R7270 |
T11437 |
T11438 |
prep |
In,retrieved |
R7271 |
T11439 |
T11437 |
pobj |
order,In |
R7272 |
T11440 |
T11441 |
aux |
to,examine |
R7273 |
T11441 |
T11439 |
acl |
examine,order |
R7274 |
T11442 |
T11443 |
amod |
evolutionary,relationships |
R7275 |
T11443 |
T11441 |
dobj |
relationships,examine |
R7276 |
T11444 |
T11443 |
prep |
of,relationships |
R7277 |
T11445 |
T11444 |
pobj |
proteins,of |
R7278 |
T11446 |
T11445 |
acl |
containing,proteins |
R7279 |
T11447 |
T11448 |
amod |
coiled,coil |
R7280 |
T11448 |
T11449 |
compound |
coil,domains |
R7281 |
T11449 |
T11446 |
dobj |
domains,containing |
R7282 |
T11450 |
T11438 |
punct |
", ",retrieved |
R7283 |
T11451 |
T11452 |
compound |
protein,sequences |
R7284 |
T11452 |
T11438 |
nsubjpass |
sequences,retrieved |
R7285 |
T11453 |
T11452 |
acl |
representing,sequences |
R7286 |
T11454 |
T11455 |
det |
the,members |
R7287 |
T11455 |
T11453 |
dobj |
members,representing |
R7288 |
T11456 |
T11455 |
amod |
major,members |
R7289 |
T11457 |
T11455 |
prep |
of,members |
R7290 |
T11458 |
T11459 |
det |
this,family |
R7291 |
T11459 |
T11457 |
pobj |
family,of |
R7292 |
T11460 |
T11459 |
amod |
super,family |
R7293 |
T11461 |
T11452 |
punct |
", ",sequences |
R7294 |
T11462 |
T11452 |
prep |
including,sequences |
R7295 |
T11463 |
T11462 |
pobj |
TACC,including |
R7296 |
T11464 |
T11463 |
punct |
", ",TACC |
R7297 |
T11465 |
T11463 |
conj |
RHAMM,TACC |
R7298 |
T11466 |
T11465 |
punct |
", ",RHAMM |
R7299 |
T11467 |
T11465 |
conj |
KLP,RHAMM |
R7300 |
T11468 |
T11467 |
punct |
", ",KLP |
R7301 |
T11469 |
T11467 |
conj |
keratin,KLP |
R7302 |
T11470 |
T11469 |
cc |
and,keratin |
R7303 |
T11471 |
T11469 |
conj |
tropomyosin,keratin |
R7304 |
T11472 |
T11452 |
prep |
from,sequences |
R7305 |
T11473 |
T11474 |
amod |
available,vertebrates |
R7306 |
T11474 |
T11472 |
pobj |
vertebrates,from |
R7307 |
T11475 |
T11474 |
cc |
and,vertebrates |
R7308 |
T11476 |
T11477 |
poss |
their,orthologues |
R7309 |
T11477 |
T11474 |
conj |
orthologues,vertebrates |
R7310 |
T11478 |
T11477 |
amod |
recognizable,orthologues |
R7311 |
T11479 |
T11477 |
prep |
from,orthologues |
R7312 |
T11480 |
T11481 |
det |
the,urochordate |
R7313 |
T11481 |
T11479 |
pobj |
urochordate,from |
R7314 |
T11482 |
T11483 |
compound |
Ciona,intestinalis |
R7315 |
T11483 |
T11481 |
appos |
intestinalis,urochordate |
R7316 |
T11484 |
T11481 |
punct |
", ",urochordate |
R7317 |
T11485 |
T11486 |
compound |
Drosophila,melanogaster |
R7318 |
T11486 |
T11481 |
conj |
melanogaster,urochordate |
R7319 |
T11487 |
T11486 |
punct |
", ",melanogaster |
R7320 |
T11488 |
T11489 |
compound |
C.,elegans |
R7321 |
T11489 |
T11486 |
conj |
elegans,melanogaster |
R7322 |
T11490 |
T11489 |
cc |
and,elegans |
R7323 |
T11491 |
T11492 |
compound |
Saccharomyces,cerevisiae |
R7324 |
T11492 |
T11489 |
conj |
cerevisiae,elegans |
R7325 |
T11493 |
T11438 |
auxpass |
were,retrieved |
R7326 |
T11494 |
T11438 |
preconj |
either,retrieved |
R7327 |
T11495 |
T11438 |
advmod |
directly,retrieved |
R7328 |
T11496 |
T11438 |
prep |
from,retrieved |
R7329 |
T11497 |
T11498 |
compound |
NCBI,databases |
R7330 |
T11498 |
T11496 |
pobj |
databases,from |
R7331 |
T11499 |
T11498 |
compound |
sequence,databases |
R7332 |
T11500 |
T11498 |
punct |
", ",databases |
R7333 |
T11501 |
T11502 |
advmod |
newly,predicted |
R7334 |
T11502 |
T11498 |
acl |
predicted,databases |
R7335 |
T11503 |
T11438 |
cc |
or,retrieved |
R7336 |
T11504 |
T11438 |
conj |
isolated,retrieved |
R7337 |
T11505 |
T11506 |
punct |
(,see |
R7338 |
T11506 |
T11504 |
parataxis |
see,isolated |
R7339 |
T11507 |
T11506 |
advmod |
above,see |
R7340 |
T11508 |
T11506 |
punct |
),see |
R7341 |
T11509 |
T11438 |
punct |
.,retrieved |
R7342 |
T11511 |
T11512 |
compound |
Species,abbreviations |
R7343 |
T11512 |
T11513 |
nsubj |
abbreviations,are |
R7344 |
T11514 |
T11515 |
mark |
as,follows |
R7345 |
T11515 |
T11513 |
advcl |
follows,are |
R7346 |
T11516 |
T11513 |
punct |
: ,are |
R7347 |
T11517 |
T11513 |
dep |
hs,are |
R7348 |
T11518 |
T11517 |
punct |
(,hs |
R7349 |
T11519 |
T11520 |
compound |
Homo,sapiens |
R7350 |
T11520 |
T11517 |
appos |
sapiens,hs |
R7351 |
T11521 |
T11517 |
punct |
),hs |
R7352 |
T11522 |
T11517 |
punct |
", ",hs |
R7353 |
T11523 |
T11517 |
appos |
mm,hs |
R7354 |
T11524 |
T11523 |
punct |
(,mm |
R7355 |
T11525 |
T11526 |
compound |
Mus,musculus |
R7356 |
T11526 |
T11523 |
appos |
musculus,mm |
R7357 |
T11527 |
T11517 |
punct |
),hs |
R7358 |
T11528 |
T11517 |
punct |
", ",hs |
R7359 |
T11529 |
T11517 |
appos |
rn,hs |
R7360 |
T11530 |
T11529 |
punct |
(,rn |
R7361 |
T11531 |
T11532 |
compound |
Rattus,norvegus |
R7362 |
T11532 |
T11529 |
appos |
norvegus,rn |
R7363 |
T11533 |
T11517 |
punct |
),hs |
R7364 |
T11534 |
T11517 |
punct |
", ",hs |
R7365 |
T11535 |
T11517 |
appos |
oc,hs |
R7366 |
T11536 |
T11535 |
punct |
(,oc |
R7367 |
T11537 |
T11538 |
compound |
Oryctolagus,cuniculus |
R7368 |
T11538 |
T11535 |
appos |
cuniculus,oc |
R7369 |
T11539 |
T11517 |
punct |
),hs |
R7370 |
T11540 |
T11517 |
punct |
", ",hs |
R7371 |
T11541 |
T11517 |
appos |
gg,hs |
R7372 |
T11542 |
T11541 |
punct |
(,gg |
R7373 |
T11543 |
T11544 |
compound |
Gallus,gallus |
R7374 |
T11544 |
T11541 |
appos |
gallus,gg |
R7375 |
T11545 |
T11517 |
punct |
),hs |
R7376 |
T11546 |
T11517 |
punct |
", ",hs |
R7377 |
T11547 |
T11517 |
appos |
xl,hs |
R7378 |
T11548 |
T11547 |
punct |
(,xl |
R7379 |
T11549 |
T11550 |
compound |
Xenopus,laevis |
R7380 |
T11550 |
T11547 |
appos |
laevis,xl |
R7381 |
T11551 |
T11517 |
punct |
),hs |
R7382 |
T11552 |
T11517 |
punct |
", ",hs |
R7383 |
T11553 |
T11517 |
appos |
st,hs |
R7384 |
T11554 |
T11553 |
punct |
(,st |
R7385 |
T11555 |
T11556 |
compound |
Silurana,tropicalis |
R7386 |
T11556 |
T11553 |
appos |
tropicalis,st |
R7387 |
T11557 |
T11517 |
punct |
),hs |
R7388 |
T11558 |
T11517 |
punct |
", ",hs |
R7389 |
T11559 |
T11517 |
appos |
tr,hs |
R7390 |
T11560 |
T11559 |
punct |
(,tr |
R7391 |
T11561 |
T11562 |
compound |
Takifugu,rubripes |
R7392 |
T11562 |
T11559 |
appos |
rubripes,tr |
R7393 |
T11563 |
T11517 |
punct |
),hs |
R7394 |
T11564 |
T11517 |
punct |
", ",hs |
R7395 |
T11565 |
T11517 |
appos |
dr,hs |
R7396 |
T11566 |
T11565 |
punct |
(,dr |
R7397 |
T11567 |
T11568 |
compound |
Danio,rerio |
R7398 |
T11568 |
T11565 |
appos |
rerio,dr |
R7399 |
T11569 |
T11517 |
punct |
),hs |
R7400 |
T11570 |
T11517 |
punct |
", ",hs |
R7401 |
T11571 |
T11517 |
appos |
ci,hs |
R7402 |
T11572 |
T11571 |
punct |
(,ci |
R7403 |
T11573 |
T11574 |
compound |
Ciona,intestinalis |
R7404 |
T11574 |
T11571 |
appos |
intestinalis,ci |
R7405 |
T11575 |
T11517 |
punct |
),hs |
R7406 |
T11576 |
T11517 |
punct |
", ",hs |
R7407 |
T11577 |
T11517 |
appos |
dm,hs |
R7408 |
T11578 |
T11577 |
punct |
(,dm |
R7409 |
T11579 |
T11580 |
compound |
D.,melanogaster |
R7410 |
T11580 |
T11577 |
appos |
melanogaster,dm |
R7411 |
T11581 |
T11517 |
punct |
),hs |
R7412 |
T11582 |
T11517 |
punct |
", ",hs |
R7413 |
T11583 |
T11517 |
appos |
ce,hs |
R7414 |
T11584 |
T11583 |
punct |
(,ce |
R7415 |
T11585 |
T11586 |
compound |
C.,elegans |
R7416 |
T11586 |
T11583 |
appos |
elegans,ce |
R7417 |
T11587 |
T11517 |
punct |
),hs |
R7418 |
T11588 |
T11517 |
punct |
", ",hs |
R7419 |
T11589 |
T11517 |
appos |
sc,hs |
R7420 |
T11590 |
T11589 |
punct |
(,sc |
R7421 |
T11591 |
T11592 |
compound |
Saccharomyces,cerevisiae |
R7422 |
T11592 |
T11589 |
appos |
cerevisiae,sc |
R7423 |
T11593 |
T11517 |
punct |
),hs |
R7424 |
T11594 |
T11513 |
punct |
.,are |
R7425 |
T11596 |
T11597 |
det |
The,sequences |
R7426 |
T11597 |
T11598 |
nsubjpass |
sequences,used |
R7427 |
T11599 |
T11597 |
acl |
identified,sequences |
R7428 |
T11600 |
T11599 |
advmod |
above,identified |
R7429 |
T11601 |
T11597 |
cc |
and,sequences |
R7430 |
T11602 |
T11603 |
det |
the,translations |
R7431 |
T11603 |
T11597 |
conj |
translations,sequences |
R7432 |
T11604 |
T11603 |
amod |
following,translations |
R7433 |
T11605 |
T11603 |
nmod |
protein,translations |
R7434 |
T11606 |
T11605 |
cc |
or,protein |
R7435 |
T11607 |
T11605 |
conj |
predicted,protein |
R7436 |
T11608 |
T11598 |
auxpass |
were,used |
R7437 |
T11609 |
T11598 |
prep |
for,used |
R7438 |
T11610 |
T11611 |
amod |
phylogenetic,analysis |
R7439 |
T11611 |
T11609 |
pobj |
analysis,for |
R7440 |
T11612 |
T11598 |
punct |
: ,used |
R7441 |
T11613 |
T11598 |
dep |
hsTACC1A,used |
R7442 |
T11614 |
T11615 |
punct |
(,NP_006274 |
R7443 |
T11615 |
T11613 |
parataxis |
NP_006274,hsTACC1A |
R7444 |
T11616 |
T11615 |
punct |
),NP_006274 |
R7445 |
T11617 |
T11613 |
punct |
", ",hsTACC1A |
R7446 |
T11618 |
T11613 |
appos |
hsTACC2l,hsTACC1A |
R7447 |
T11619 |
T11620 |
punct |
(,AAO62630 |
R7448 |
T11620 |
T11618 |
parataxis |
AAO62630,hsTACC2l |
R7449 |
T11621 |
T11620 |
punct |
),AAO62630 |
R7450 |
T11622 |
T11613 |
appos |
hsTACC2s,hsTACC1A |
R7451 |
T11623 |
T11624 |
punct |
(,AAO62629 |
R7452 |
T11624 |
T11622 |
parataxis |
AAO62629,hsTACC2s |
R7453 |
T11625 |
T11624 |
punct |
),AAO62629 |
R7454 |
T11626 |
T11613 |
punct |
", ",hsTACC1A |
R7455 |
T11627 |
T11613 |
appos |
hsTACC3,hsTACC1A |
R7456 |
T11628 |
T11629 |
punct |
(,NP_006333 |
R7457 |
T11629 |
T11627 |
parataxis |
NP_006333,hsTACC3 |
R7458 |
T11630 |
T11629 |
punct |
),NP_006333 |
R7459 |
T11631 |
T11613 |
punct |
", ",hsTACC1A |
R7460 |
T11632 |
T11613 |
appos |
mmTACC3,hsTACC1A |
R7461 |
T11633 |
T11634 |
punct |
(,Q9JJ11 |
R7462 |
T11634 |
T11632 |
parataxis |
Q9JJ11,mmTACC3 |
R7463 |
T11635 |
T11634 |
punct |
),Q9JJ11 |
R7464 |
T11636 |
T11613 |
punct |
", ",hsTACC1A |
R7465 |
T11637 |
T11613 |
appos |
xlMaskin,hsTACC1A |
R7466 |
T11638 |
T11639 |
punct |
(,Q9PTG8 |
R7467 |
T11639 |
T11637 |
parataxis |
Q9PTG8,xlMaskin |
R7468 |
T11640 |
T11639 |
punct |
),Q9PTG8 |
R7469 |
T11641 |
T11613 |
punct |
", ",hsTACC1A |
R7470 |
T11642 |
T11613 |
appos |
dmTACC,hsTACC1A |
R7471 |
T11643 |
T11644 |
punct |
(,AAF52099 |
R7472 |
T11644 |
T11642 |
parataxis |
AAF52099,dmTACC |
R7473 |
T11645 |
T11644 |
punct |
),AAF52099 |
R7474 |
T11646 |
T11613 |
punct |
", ",hsTACC1A |
R7475 |
T11647 |
T11613 |
appos |
ceTAC1,hsTACC1A |
R7476 |
T11648 |
T11649 |
punct |
(,NP_497059 |
R7477 |
T11649 |
T11647 |
parataxis |
NP_497059,ceTAC1 |
R7478 |
T11650 |
T11649 |
punct |
),NP_497059 |
R7479 |
T11651 |
T11613 |
punct |
", ",hsTACC1A |
R7480 |
T11652 |
T11613 |
appos |
scSPC72,hsTACC1A |
R7481 |
T11653 |
T11654 |
punct |
(,NP_009352 |
R7482 |
T11654 |
T11652 |
parataxis |
NP_009352,scSPC72 |
R7483 |
T11655 |
T11654 |
punct |
),NP_009352 |
R7484 |
T11656 |
T11613 |
punct |
", ",hsTACC1A |
R7485 |
T11657 |
T11613 |
appos |
hsRHAMM,hsTACC1A |
R7486 |
T11658 |
T11659 |
punct |
(,NP_036616 |
R7487 |
T11659 |
T11657 |
parataxis |
NP_036616,hsRHAMM |
R7488 |
T11660 |
T11659 |
punct |
),NP_036616 |
R7489 |
T11661 |
T11613 |
punct |
", ",hsTACC1A |
R7490 |
T11662 |
T11613 |
appos |
mmRHAMM,hsTACC1A |
R7491 |
T11663 |
T11664 |
punct |
(,NP_038580 |
R7492 |
T11664 |
T11662 |
parataxis |
NP_038580,mmRHAMM |
R7493 |
T11665 |
T11664 |
punct |
),NP_038580 |
R7494 |
T11666 |
T11613 |
punct |
", ",hsTACC1A |
R7495 |
T11667 |
T11613 |
appos |
rnRHAMM,hsTACC1A |
R7496 |
T11668 |
T11669 |
punct |
(,NP_037096 |
R7497 |
T11669 |
T11667 |
parataxis |
NP_037096,rnRHAMM |
R7498 |
T11670 |
T11669 |
punct |
),NP_037096 |
R7499 |
T11671 |
T11613 |
punct |
", ",hsTACC1A |
R7500 |
T11672 |
T11613 |
appos |
drRHAMM,hsTACC1A |
R7501 |
T11673 |
T11674 |
punct |
(,AAQ97980 |
R7502 |
T11674 |
T11672 |
parataxis |
AAQ97980,drRHAMM |
R7503 |
T11675 |
T11674 |
punct |
),AAQ97980 |
R7504 |
T11676 |
T11613 |
punct |
", ",hsTACC1A |
R7505 |
T11677 |
T11613 |
appos |
hsKeratin,hsTACC1A |
R7506 |
T11678 |
T11679 |
punct |
(,CAB76828 |
R7507 |
T11679 |
T11677 |
parataxis |
CAB76828,hsKeratin |
R7508 |
T11680 |
T11679 |
punct |
),CAB76828 |
R7509 |
T11681 |
T11613 |
punct |
", ",hsTACC1A |
R7510 |
T11682 |
T11613 |
appos |
mmKeratin,hsTACC1A |
R7511 |
T11683 |
T11684 |
punct |
(,A61368 |
R7512 |
T11684 |
T11682 |
parataxis |
A61368,mmKeratin |
R7513 |
T11685 |
T11684 |
punct |
),A61368 |
R7514 |
T11686 |
T11613 |
punct |
", ",hsTACC1A |
R7515 |
T11687 |
T11613 |
appos |
rnKeratin,hsTACC1A |
R7516 |
T11688 |
T11689 |
punct |
(,XP_235679 |
R7517 |
T11689 |
T11687 |
parataxis |
XP_235679,rnKeratin |
R7518 |
T11690 |
T11689 |
punct |
),XP_235679 |
R7519 |
T11691 |
T11613 |
punct |
", ",hsTACC1A |
R7520 |
T11692 |
T11613 |
appos |
hsTPM1,hsTACC1A |
R7521 |
T11693 |
T11694 |
punct |
(,NP_000357 |
R7522 |
T11694 |
T11692 |
parataxis |
NP_000357,hsTPM1 |
R7523 |
T11695 |
T11694 |
punct |
),NP_000357 |
R7524 |
T11696 |
T11613 |
punct |
", ",hsTACC1A |
R7525 |
T11697 |
T11613 |
appos |
mmTPM1,hsTACC1A |
R7526 |
T11698 |
T11699 |
punct |
(,NP_077745 |
R7527 |
T11699 |
T11697 |
parataxis |
NP_077745,mmTPM1 |
R7528 |
T11700 |
T11699 |
punct |
),NP_077745 |
R7529 |
T11701 |
T11613 |
punct |
", ",hsTACC1A |
R7530 |
T11702 |
T11613 |
appos |
rnTPM1,hsTACC1A |
R7531 |
T11703 |
T11704 |
punct |
(,NP_62004 |
R7532 |
T11704 |
T11702 |
parataxis |
NP_62004,rnTPM1 |
R7533 |
T11705 |
T11613 |
punct |
", ",hsTACC1A |
R7534 |
T11706 |
T11613 |
appos |
drTPM1,hsTACC1A |
R7535 |
T11707 |
T11708 |
punct |
(,NP_571180 |
R7536 |
T11708 |
T11706 |
parataxis |
NP_571180,drTPM1 |
R7537 |
T11709 |
T11708 |
punct |
),NP_571180 |
R7538 |
T11710 |
T11613 |
appos |
dmTPM1,hsTACC1A |
R7539 |
T11711 |
T11712 |
punct |
(,P06754 |
R7540 |
T11712 |
T11710 |
parataxis |
P06754,dmTPM1 |
R7541 |
T11713 |
T11712 |
punct |
),P06754 |
R7542 |
T11714 |
T11613 |
punct |
", ",hsTACC1A |
R7543 |
T11715 |
T11613 |
appos |
ceTPM,hsTACC1A |
R7544 |
T11716 |
T11717 |
punct |
(,NP_493540 |
R7545 |
T11717 |
T11715 |
parataxis |
NP_493540,ceTPM |
R7546 |
T11718 |
T11717 |
punct |
),NP_493540 |
R7547 |
T11719 |
T11613 |
appos |
scTPM1,hsTACC1A |
R7548 |
T11720 |
T11721 |
punct |
(,P17536 |
R7549 |
T11721 |
T11719 |
parataxis |
P17536,scTPM1 |
R7550 |
T11722 |
T11721 |
punct |
),P17536 |
R7551 |
T11723 |
T11613 |
punct |
", ",hsTACC1A |
R7552 |
T11724 |
T11613 |
appos |
hsKLP2,hsTACC1A |
R7553 |
T11725 |
T11726 |
punct |
(,BAB03309 |
R7554 |
T11726 |
T11724 |
parataxis |
BAB03309,hsKLP2 |
R7555 |
T11727 |
T11726 |
punct |
),BAB03309 |
R7556 |
T11728 |
T11613 |
punct |
", ",hsTACC1A |
R7557 |
T11729 |
T11613 |
appos |
rnKIF15,hsTACC1A |
R7558 |
T11730 |
T11731 |
punct |
(,AAP44513 |
R7559 |
T11731 |
T11729 |
parataxis |
AAP44513,rnKIF15 |
R7560 |
T11732 |
T11731 |
punct |
),AAP44513 |
R7561 |
T11733 |
T11613 |
punct |
", ",hsTACC1A |
R7562 |
T11734 |
T11613 |
appos |
xlKLP2,hsTACC1A |
R7563 |
T11735 |
T11736 |
punct |
(,CAA08879 |
R7564 |
T11736 |
T11734 |
parataxis |
CAA08879,xlKLP2 |
R7565 |
T11737 |
T11736 |
punct |
),CAA08879 |
R7566 |
T11738 |
T11613 |
punct |
", ",hsTACC1A |
R7567 |
T11739 |
T11613 |
appos |
dmKLP2,hsTACC1A |
R7568 |
T11740 |
T11741 |
punct |
(,NP_476818 |
R7569 |
T11741 |
T11739 |
parataxis |
NP_476818,dmKLP2 |
R7570 |
T11742 |
T11741 |
punct |
),NP_476818 |
R7571 |
T11743 |
T11613 |
punct |
", ",hsTACC1A |
R7572 |
T11744 |
T11613 |
appos |
ceKLP18,hsTACC1A |
R7573 |
T11745 |
T11746 |
punct |
(,AA034669 |
R7574 |
T11746 |
T11744 |
parataxis |
AA034669,ceKLP18 |
R7575 |
T11747 |
T11746 |
punct |
),AA034669 |
R7576 |
T11748 |
T11613 |
punct |
", ",hsTACC1A |
R7577 |
T11749 |
T11613 |
appos |
hsKIF3A,hsTACC1A |
R7578 |
T11750 |
T11751 |
punct |
(,Q9Y496 |
R7579 |
T11751 |
T11749 |
parataxis |
Q9Y496,hsKIF3A |
R7580 |
T11752 |
T11751 |
punct |
),Q9Y496 |
R7581 |
T11753 |
T11613 |
punct |
", ",hsTACC1A |
R7582 |
T11754 |
T11613 |
appos |
mmKIF3A,hsTACC1A |
R7583 |
T11755 |
T11756 |
punct |
(,NP_032469 |
R7584 |
T11756 |
T11754 |
parataxis |
NP_032469,mmKIF3A |
R7585 |
T11757 |
T11756 |
punct |
),NP_032469 |
R7586 |
T11758 |
T11613 |
punct |
", ",hsTACC1A |
R7587 |
T11759 |
T11613 |
appos |
rnKIF3A,hsTACC1A |
R7588 |
T11760 |
T11761 |
punct |
(,XP_340797 |
R7589 |
T11761 |
T11759 |
parataxis |
XP_340797,rnKIF3A |
R7590 |
T11762 |
T11761 |
punct |
),XP_340797 |
R7591 |
T11763 |
T11613 |
punct |
", ",hsTACC1A |
R7592 |
T11764 |
T11613 |
appos |
xlKIF3A,hsTACC1A |
R7593 |
T11765 |
T11766 |
punct |
(,CAA08879 |
R7594 |
T11766 |
T11764 |
parataxis |
CAA08879,xlKIF3A |
R7595 |
T11767 |
T11766 |
punct |
),CAA08879 |
R7596 |
T11768 |
T11613 |
punct |
", ",hsTACC1A |
R7597 |
T11769 |
T11613 |
appos |
ceKLP11,hsTACC1A |
R7598 |
T11770 |
T11771 |
punct |
(,NP_741473 |
R7599 |
T11771 |
T11769 |
parataxis |
NP_741473,ceKLP11 |
R7600 |
T11772 |
T11771 |
punct |
),NP_741473 |
R7601 |
T11773 |
T11613 |
punct |
", ",hsTACC1A |
R7602 |
T11774 |
T11613 |
appos |
ciKIF3,hsTACC1A |
R7603 |
T11775 |
T11776 |
punct |
(,ci0100148992 |
R7604 |
T11776 |
T11774 |
parataxis |
ci0100148992,ciKIF3 |
R7605 |
T11777 |
T11776 |
punct |
),ci0100148992 |
R7606 |
T11778 |
T11613 |
punct |
", ",hsTACC1A |
R7607 |
T11779 |
T11613 |
appos |
hsKIF3B,hsTACC1A |
R7608 |
T11780 |
T11781 |
punct |
(,NP_004789 |
R7609 |
T11781 |
T11779 |
parataxis |
NP_004789,hsKIF3B |
R7610 |
T11782 |
T11781 |
punct |
),NP_004789 |
R7611 |
T11783 |
T11613 |
punct |
", ",hsTACC1A |
R7612 |
T11784 |
T11613 |
appos |
mmKIF3B,hsTACC1A |
R7613 |
T11785 |
T11786 |
punct |
(,NP_004789 |
R7614 |
T11786 |
T11784 |
parataxis |
NP_004789,mmKIF3B |
R7615 |
T11787 |
T11786 |
punct |
),NP_004789 |
R7616 |
T11788 |
T11613 |
punct |
", ",hsTACC1A |
R7617 |
T11789 |
T11613 |
appos |
rnKIF3B,hsTACC1A |
R7618 |
T11790 |
T11791 |
punct |
(,XP_215883 |
R7619 |
T11791 |
T11789 |
parataxis |
XP_215883,rnKIF3B |
R7620 |
T11792 |
T11791 |
punct |
),XP_215883 |
R7621 |
T11793 |
T11613 |
punct |
", ",hsTACC1A |
R7622 |
T11794 |
T11613 |
appos |
dmKIF3B,hsTACC1A |
R7623 |
T11795 |
T11796 |
punct |
(,NP_524029 |
R7624 |
T11796 |
T11794 |
parataxis |
NP_524029,dmKIF3B |
R7625 |
T11797 |
T11796 |
punct |
),NP_524029 |
R7626 |
T11798 |
T11613 |
punct |
", ",hsTACC1A |
R7627 |
T11799 |
T11613 |
appos |
hsKIF3C,hsTACC1A |
R7628 |
T11800 |
T11801 |
punct |
(,NP_002245 |
R7629 |
T11801 |
T11799 |
parataxis |
NP_002245,hsKIF3C |
R7630 |
T11802 |
T11801 |
punct |
),NP_002245 |
R7631 |
T11803 |
T11613 |
punct |
", ",hsTACC1A |
R7632 |
T11804 |
T11613 |
appos |
mmKIF3C,hsTACC1A |
R7633 |
T11805 |
T11806 |
punct |
(,NP_032471 |
R7634 |
T11806 |
T11804 |
parataxis |
NP_032471,mmKIF3C |
R7635 |
T11807 |
T11806 |
punct |
),NP_032471 |
R7636 |
T11808 |
T11613 |
punct |
", ",hsTACC1A |
R7637 |
T11809 |
T11613 |
appos |
rnKIF3C,hsTACC1A |
R7638 |
T11810 |
T11811 |
punct |
(,NP_445938 |
R7639 |
T11811 |
T11809 |
parataxis |
NP_445938,rnKIF3C |
R7640 |
T11812 |
T11811 |
punct |
),NP_445938 |
R7641 |
T11813 |
T11613 |
punct |
", ",hsTACC1A |
R7642 |
T11814 |
T11613 |
appos |
dmKIF3C,hsTACC1A |
R7643 |
T11815 |
T11816 |
punct |
(,NP_651939 |
R7644 |
T11816 |
T11814 |
parataxis |
NP_651939,dmKIF3C |
R7645 |
T11817 |
T11816 |
punct |
),NP_651939 |
R7646 |
T11818 |
T11598 |
punct |
.,used |
R7647 |
T11820 |
T11821 |
det |
These,sequences |
R7648 |
T11821 |
T11823 |
nsubjpass |
sequences,aligned |
R7649 |
T11822 |
T11821 |
compound |
protein,sequences |
R7650 |
T11824 |
T11823 |
auxpass |
were,aligned |
R7651 |
T11825 |
T11823 |
advmod |
initially,aligned |
R7652 |
T11826 |
T11823 |
prep |
with,aligned |
R7653 |
T11827 |
T11828 |
compound |
CLUSTAL,X |
R7654 |
T11828 |
T11826 |
pobj |
X,with |
R7655 |
T11829 |
T11830 |
punct |
[,38 |
R7656 |
T11830 |
T11823 |
parataxis |
38,aligned |
R7657 |
T11831 |
T11830 |
punct |
],38 |
R7658 |
T11832 |
T11823 |
punct |
.,aligned |
R7659 |
T11834 |
T11835 |
amod |
Minor,adjustments |
R7660 |
T11835 |
T11836 |
nsubjpass |
adjustments,made |
R7661 |
T11836 |
T11847 |
ccomp |
made,saved |
R7662 |
T11837 |
T11835 |
prep |
to,adjustments |
R7663 |
T11838 |
T11839 |
amod |
certain,regions |
R7664 |
T11839 |
T11837 |
pobj |
regions,to |
R7665 |
T11840 |
T11839 |
prep |
of,regions |
R7666 |
T11841 |
T11842 |
det |
the,alignment |
R7667 |
T11842 |
T11840 |
pobj |
alignment,of |
R7668 |
T11843 |
T11835 |
prep |
for,adjustments |
R7669 |
T11844 |
T11845 |
compound |
optimization,purposes |
R7670 |
T11845 |
T11843 |
pobj |
purposes,for |
R7671 |
T11846 |
T11836 |
auxpass |
were,made |
R7672 |
T11848 |
T11836 |
prep |
based,made |
R7673 |
T11849 |
T11848 |
prep |
on,based |
R7674 |
T11850 |
T11851 |
amod |
pairwise,alignments |
R7675 |
T11851 |
T11849 |
pobj |
alignments,on |
R7676 |
T11852 |
T11847 |
punct |
", ",saved |
R7677 |
T11853 |
T11854 |
det |
the,output |
R7678 |
T11854 |
T11847 |
nsubj |
output,saved |
R7679 |
T11855 |
T11847 |
prep |
in,saved |
R7680 |
T11856 |
T11857 |
compound |
PHYLIP,format |
R7681 |
T11857 |
T11855 |
pobj |
format,in |
R7682 |
T11858 |
T11847 |
punct |
", ",saved |
R7683 |
T11859 |
T11860 |
prep |
after,calculated |
R7684 |
T11860 |
T11847 |
advcl |
calculated,saved |
R7685 |
T11861 |
T11859 |
pobj |
which,after |
R7686 |
T11862 |
T11860 |
punct |
", ",calculated |
R7687 |
T11863 |
T11864 |
det |
the,distances |
R7688 |
T11864 |
T11860 |
nsubjpass |
distances,calculated |
R7689 |
T11865 |
T11864 |
prep |
between,distances |
R7690 |
T11866 |
T11865 |
pobj |
proteins,between |
R7691 |
T11867 |
T11860 |
auxpass |
were,calculated |
R7692 |
T11868 |
T11860 |
advcl |
using,calculated |
R7693 |
T11869 |
T11870 |
compound |
Poisson,correction |
R7694 |
T11870 |
T11868 |
dobj |
correction,using |
R7695 |
T11871 |
T11860 |
cc |
and,calculated |
R7696 |
T11872 |
T11873 |
det |
the,trees |
R7697 |
T11873 |
T11875 |
nsubjpass |
trees,inferred |
R7698 |
T11874 |
T11873 |
amod |
Unrooted,trees |
R7699 |
T11875 |
T11860 |
conj |
inferred,calculated |
R7700 |
T11876 |
T11875 |
auxpass |
were,inferred |
R7701 |
T11877 |
T11875 |
prep |
with,inferred |
R7702 |
T11878 |
T11879 |
det |
the,method |
R7703 |
T11879 |
T11877 |
pobj |
method,with |
R7704 |
T11880 |
T11879 |
compound |
NJ,method |
R7705 |
T11881 |
T11875 |
cc |
and,inferred |
R7706 |
T11882 |
T11883 |
advmod |
then,displayed |
R7707 |
T11883 |
T11875 |
conj |
displayed,inferred |
R7708 |
T11884 |
T11883 |
advcl |
using,displayed |
R7709 |
T11885 |
T11884 |
dobj |
TreeView,using |
R7710 |
T11886 |
T11887 |
punct |
[,39 |
R7711 |
T11887 |
T11883 |
parataxis |
39,displayed |
R7712 |
T11888 |
T11887 |
punct |
],39 |
R7713 |
T11889 |
T11847 |
punct |
.,saved |
R7714 |
T11891 |
T11892 |
compound |
Bootstrap,values |
R7715 |
T11892 |
T11893 |
nsubjpass |
values,shown |
R7716 |
T11894 |
T11892 |
prep |
above,values |
R7717 |
T11895 |
T11894 |
pobj |
700,above |
R7718 |
T11896 |
T11892 |
prep |
for,values |
R7719 |
T11897 |
T11898 |
nummod |
1000,trials |
R7720 |
T11898 |
T11896 |
pobj |
trials,for |
R7721 |
T11899 |
T11893 |
auxpass |
are,shown |
R7722 |
T11900 |
T11893 |
prep |
at,shown |
R7723 |
T11901 |
T11902 |
det |
the,node |
R7724 |
T11902 |
T11900 |
pobj |
node,at |
R7725 |
T11903 |
T11893 |
punct |
.,shown |
R7726 |
T11905 |
T11906 |
aux |
To,validate |
R7727 |
T11906 |
T11907 |
advcl |
validate,analyzed |
R7728 |
T11908 |
T11909 |
det |
the,tree |
R7729 |
T11909 |
T11906 |
dobj |
tree,validate |
R7730 |
T11910 |
T11907 |
punct |
", ",analyzed |
R7731 |
T11911 |
T11912 |
det |
the,set |
R7732 |
T11912 |
T11907 |
nsubjpass |
set,analyzed |
R7733 |
T11913 |
T11912 |
amod |
same,set |
R7734 |
T11914 |
T11912 |
compound |
sequence,set |
R7735 |
T11915 |
T11907 |
auxpass |
was,analyzed |
R7736 |
T11916 |
T11907 |
prep |
with,analyzed |
R7737 |
T11917 |
T11916 |
pobj |
tools,with |
R7738 |
T11918 |
T11917 |
prep |
in,tools |
R7739 |
T11919 |
T11920 |
det |
the,package |
R7740 |
T11920 |
T11918 |
pobj |
package,in |
R7741 |
T11921 |
T11920 |
compound |
PHYLIP,package |
R7742 |
T11922 |
T11923 |
punct |
[,40 |
R7743 |
T11923 |
T11907 |
parataxis |
40,analyzed |
R7744 |
T11924 |
T11923 |
punct |
],40 |
R7745 |
T11925 |
T11907 |
punct |
", ",analyzed |
R7746 |
T11926 |
T11907 |
advcl |
using,analyzed |
R7747 |
T11927 |
T11926 |
dobj |
PRODIST,using |
R7748 |
T11928 |
T11927 |
acl |
followed,PRODIST |
R7749 |
T11929 |
T11928 |
agent |
by,followed |
R7750 |
T11930 |
T11929 |
pobj |
FITCH,by |
R7751 |
T11931 |
T11930 |
cc |
or,FITCH |
R7752 |
T11932 |
T11930 |
conj |
NEIGNBOR,FITCH |
R7753 |
T11933 |
T11926 |
cc |
and,using |
R7754 |
T11934 |
T11935 |
dep |
tree,displaying |
R7755 |
T11935 |
T11926 |
conj |
displaying,using |
R7756 |
T11936 |
T11935 |
advcl |
using,displaying |
R7757 |
T11937 |
T11936 |
dobj |
TreeView,using |
R7758 |
T11938 |
T11907 |
punct |
.,analyzed |
R7759 |
T11940 |
T11941 |
det |
This,method |
R7760 |
T11941 |
T11943 |
nsubj |
method,produced |
R7761 |
T11942 |
T11941 |
amod |
additional,method |
R7762 |
T11944 |
T11943 |
dobj |
trees,produced |
R7763 |
T11945 |
T11944 |
prep |
with,trees |
R7764 |
T11946 |
T11947 |
advmod |
essentially,topology |
R7765 |
T11947 |
T11945 |
pobj |
topology,with |
R7766 |
T11948 |
T11947 |
det |
the,topology |
R7767 |
T11949 |
T11947 |
amod |
same,topology |
R7768 |
T11950 |
T11951 |
punct |
(,shown |
R7769 |
T11951 |
T11943 |
parataxis |
shown,produced |
R7770 |
T11952 |
T11951 |
nsubj |
data,shown |
R7771 |
T11953 |
T11951 |
neg |
not,shown |
R7772 |
T11954 |
T11951 |
punct |
),shown |
R7773 |
T11955 |
T11943 |
punct |
.,produced |
R7774 |
T12120 |
T12121 |
advmod |
In,vitro |
R7775 |
T12121 |
T12122 |
amod |
vitro,interaction |
R7776 |
T12123 |
T12122 |
prep |
of,interaction |
R7777 |
T12124 |
T12123 |
pobj |
TACC2,of |
R7778 |
T12125 |
T12124 |
cc |
and,TACC2 |
R7779 |
T12126 |
T12124 |
conj |
RXRβ3,TACC2 |
R7780 |
T12128 |
T12129 |
det |
The,cDNA |
R7781 |
T12129 |
T12131 |
nsubjpass |
cDNA,cloned |
R7782 |
T12130 |
T12129 |
compound |
TACC2,cDNA |
R7783 |
T12132 |
T12131 |
auxpass |
was,cloned |
R7784 |
T12133 |
T12131 |
prep |
into,cloned |
R7785 |
T12134 |
T12135 |
compound |
GST,pGEX5X2 |
R7786 |
T12135 |
T12133 |
pobj |
pGEX5X2,into |
R7787 |
T12136 |
T12135 |
compound |
fusion,pGEX5X2 |
R7788 |
T12137 |
T12135 |
compound |
vector,pGEX5X2 |
R7789 |
T12138 |
T12139 |
punct |
(,Biosciences |
R7790 |
T12139 |
T12131 |
parataxis |
Biosciences,cloned |
R7791 |
T12140 |
T12139 |
compound |
Amersham,Biosciences |
R7792 |
T12141 |
T12139 |
punct |
", ",Biosciences |
R7793 |
T12142 |
T12139 |
npadvmod |
Piscataway,Biosciences |
R7794 |
T12143 |
T12139 |
punct |
", ",Biosciences |
R7795 |
T12144 |
T12139 |
npadvmod |
NJ,Biosciences |
R7796 |
T12145 |
T12139 |
punct |
", ",Biosciences |
R7797 |
T12146 |
T12139 |
npadvmod |
USA,Biosciences |
R7798 |
T12147 |
T12139 |
punct |
),Biosciences |
R7799 |
T12148 |
T12131 |
punct |
.,cloned |
R7800 |
T12150 |
T12151 |
nmod |
GST,proteins |
R7801 |
T12151 |
T12156 |
nsubjpass |
proteins,expressed |
R7802 |
T12152 |
T12150 |
cc |
and,GST |
R7803 |
T12153 |
T12154 |
compound |
GST,TACC2 |
R7804 |
T12154 |
T12150 |
conj |
TACC2,GST |
R7805 |
T12155 |
T12154 |
punct |
-,TACC2 |
R7806 |
T12157 |
T12156 |
auxpass |
were,expressed |
R7807 |
T12158 |
T12156 |
prep |
in,expressed |
R7808 |
T12159 |
T12160 |
nmod |
E.,coli |
R7809 |
T12160 |
T12161 |
nmod |
coli,S |
R7810 |
T12161 |
T12158 |
pobj |
S,in |
R7811 |
T12162 |
T12161 |
nmod |
BL21,S |
R7812 |
T12163 |
T12164 |
punct |
(,DE3 |
R7813 |
T12164 |
T12161 |
parataxis |
DE3,S |
R7814 |
T12165 |
T12164 |
punct |
),DE3 |
R7815 |
T12166 |
T12161 |
nmod |
plys,S |
R7816 |
T12167 |
T12161 |
punct |
"""",S |
R7817 |
T12168 |
T12161 |
punct |
"""",S |
R7818 |
T12169 |
T12156 |
prep |
with,expressed |
R7819 |
T12170 |
T12171 |
nummod |
1,mM |
R7820 |
T12171 |
T12172 |
compound |
mM,IPTG |
R7821 |
T12172 |
T12169 |
pobj |
IPTG,with |
R7822 |
T12173 |
T12172 |
prep |
at,IPTG |
R7823 |
T12174 |
T12175 |
nummod |
37,°C |
R7824 |
T12175 |
T12176 |
compound |
°C,shaker |
R7825 |
T12176 |
T12173 |
pobj |
shaker,at |
R7826 |
T12177 |
T12172 |
prep |
for,IPTG |
R7827 |
T12178 |
T12179 |
nummod |
2,hrs |
R7828 |
T12179 |
T12177 |
pobj |
hrs,for |
R7829 |
T12180 |
T12156 |
punct |
.,expressed |
R7830 |
T12182 |
T12183 |
nsubjpass |
Cells,harvested |
R7831 |
T12184 |
T12185 |
punct |
(,ml |
R7832 |
T12185 |
T12182 |
parataxis |
ml,Cells |
R7833 |
T12186 |
T12185 |
nummod |
50,ml |
R7834 |
T12187 |
T12185 |
punct |
),ml |
R7835 |
T12188 |
T12183 |
auxpass |
were,harvested |
R7836 |
T12189 |
T12183 |
cc |
and,harvested |
R7837 |
T12190 |
T12183 |
conj |
resuspended,harvested |
R7838 |
T12191 |
T12190 |
prep |
in,resuspended |
R7839 |
T12192 |
T12193 |
nummod |
5,ml |
R7840 |
T12193 |
T12191 |
pobj |
ml,in |
R7841 |
T12194 |
T12193 |
prep |
of,ml |
R7842 |
T12195 |
T12196 |
nummod |
20,mM |
R7843 |
T12196 |
T12197 |
compound |
mM,HCl |
R7844 |
T12197 |
T12194 |
pobj |
HCl,of |
R7845 |
T12198 |
T12197 |
compound |
Tris,HCl |
R7846 |
T12199 |
T12197 |
punct |
-,HCl |
R7847 |
T12200 |
T12197 |
npadvmod |
pH.8.0,HCl |
R7848 |
T12201 |
T12197 |
punct |
", ",HCl |
R7849 |
T12202 |
T12203 |
nummod |
200,mM |
R7850 |
T12203 |
T12204 |
compound |
mM,NaCl |
R7851 |
T12204 |
T12197 |
appos |
NaCl,HCl |
R7852 |
T12205 |
T12197 |
punct |
", ",HCl |
R7853 |
T12206 |
T12207 |
nummod |
1,mM |
R7854 |
T12207 |
T12208 |
compound |
mM,EDTA |
R7855 |
T12208 |
T12197 |
appos |
EDTA,HCl |
R7856 |
T12209 |
T12208 |
npadvmod |
pH8.0,EDTA |
R7857 |
T12210 |
T12197 |
punct |
", ",HCl |
R7858 |
T12211 |
T12212 |
compound |
Protease,inhibitor |
R7859 |
T12212 |
T12213 |
compound |
inhibitor,set |
R7860 |
T12213 |
T12197 |
appos |
set,HCl |
R7861 |
T12214 |
T12213 |
nummod |
III,set |
R7862 |
T12215 |
T12216 |
punct |
(,Calbiochem |
R7863 |
T12216 |
T12213 |
parataxis |
Calbiochem,set |
R7864 |
T12217 |
T12216 |
punct |
),Calbiochem |
R7865 |
T12218 |
T12183 |
punct |
.,harvested |
R7866 |
T12220 |
T12221 |
det |
The,cells |
R7867 |
T12221 |
T12222 |
nsubjpass |
cells,lysed |
R7868 |
T12223 |
T12222 |
auxpass |
were,lysed |
R7869 |
T12224 |
T12222 |
prep |
by,lysed |
R7870 |
T12225 |
T12224 |
pobj |
sonication,by |
R7871 |
T12226 |
T12222 |
cc |
and,lysed |
R7872 |
T12227 |
T12228 |
nsubj |
lysate,cleared |
R7873 |
T12228 |
T12222 |
conj |
cleared,lysed |
R7874 |
T12229 |
T12228 |
prep |
by,cleared |
R7875 |
T12230 |
T12229 |
pobj |
centrifugation,by |
R7876 |
T12231 |
T12230 |
prep |
at,centrifugation |
R7877 |
T12232 |
T12233 |
nummod |
7500,rpm |
R7878 |
T12233 |
T12231 |
pobj |
rpm,at |
R7879 |
T12234 |
T12230 |
prep |
at,centrifugation |
R7880 |
T12235 |
T12236 |
nummod |
4,°C |
R7881 |
T12236 |
T12234 |
pobj |
°C,at |
R7882 |
T12237 |
T12230 |
prep |
for,centrifugation |
R7883 |
T12238 |
T12239 |
nummod |
15,min |
R7884 |
T12239 |
T12237 |
pobj |
min,for |
R7885 |
T12240 |
T12228 |
punct |
.,cleared |
R7886 |
T12242 |
T12243 |
det |
The,lysate |
R7887 |
T12243 |
T12245 |
nsubjpass |
lysate,immobilized |
R7888 |
T12244 |
T12243 |
amod |
cleared,lysate |
R7889 |
T12246 |
T12245 |
auxpass |
was,immobilized |
R7890 |
T12247 |
T12245 |
prep |
on,immobilized |
R7891 |
T12248 |
T12249 |
compound |
glutathione,sepharose |
R7892 |
T12249 |
T12250 |
compound |
sepharose,beads |
R7893 |
T12250 |
T12247 |
pobj |
beads,on |
R7894 |
T12251 |
T12245 |
prep |
in,immobilized |
R7895 |
T12252 |
T12253 |
nummod |
3,ml |
R7896 |
T12253 |
T12251 |
pobj |
ml,in |
R7897 |
T12254 |
T12253 |
prep |
of,ml |
R7898 |
T12255 |
T12256 |
nummod |
20,mM |
R7899 |
T12256 |
T12257 |
compound |
mM,HCl |
R7900 |
T12257 |
T12254 |
pobj |
HCl,of |
R7901 |
T12258 |
T12257 |
compound |
Tris,HCl |
R7902 |
T12259 |
T12257 |
punct |
-,HCl |
R7903 |
T12260 |
T12257 |
npadvmod |
pH.8.0,HCl |
R7904 |
T12261 |
T12257 |
punct |
", ",HCl |
R7905 |
T12262 |
T12263 |
nummod |
200,mM |
R7906 |
T12263 |
T12264 |
compound |
mM,NaCl |
R7907 |
T12264 |
T12257 |
appos |
NaCl,HCl |
R7908 |
T12265 |
T12257 |
punct |
", ",HCl |
R7909 |
T12266 |
T12267 |
nummod |
1,mM |
R7910 |
T12267 |
T12268 |
compound |
mM,EDTA |
R7911 |
T12268 |
T12257 |
appos |
EDTA,HCl |
R7912 |
T12269 |
T12268 |
npadvmod |
pH8.0,EDTA |
R7913 |
T12270 |
T12245 |
punct |
),immobilized |
R7914 |
T12271 |
T12245 |
punct |
.,immobilized |
R7915 |
T12273 |
T12274 |
compound |
RXRβ3,cDNA |
R7916 |
T12274 |
T12275 |
nsubjpass |
cDNA,cloned |
R7917 |
T12276 |
T12275 |
auxpass |
was,cloned |
R7918 |
T12277 |
T12275 |
prep |
into,cloned |
R7919 |
T12278 |
T12279 |
compound |
pET,28C |
R7920 |
T12279 |
T12277 |
pobj |
28C,into |
R7921 |
T12280 |
T12279 |
punct |
(,28C |
R7922 |
T12281 |
T12279 |
punct |
+,28C |
R7923 |
T12282 |
T12279 |
punct |
),28C |
R7924 |
T12283 |
T12284 |
punct |
(,Invitrogen |
R7925 |
T12284 |
T12279 |
parataxis |
Invitrogen,28C |
R7926 |
T12285 |
T12284 |
punct |
", ",Invitrogen |
R7927 |
T12286 |
T12284 |
npadvmod |
Carlsbad,Invitrogen |
R7928 |
T12287 |
T12284 |
punct |
", ",Invitrogen |
R7929 |
T12288 |
T12284 |
npadvmod |
CA,Invitrogen |
R7930 |
T12289 |
T12284 |
punct |
", ",Invitrogen |
R7931 |
T12290 |
T12284 |
npadvmod |
USA,Invitrogen |
R7932 |
T12291 |
T12284 |
punct |
),Invitrogen |
R7933 |
T12292 |
T12275 |
cc |
and,cloned |
R7934 |
T12293 |
T12294 |
nsubj |
protein,synthesized |
R7935 |
T12294 |
T12275 |
conj |
synthesized,cloned |
R7936 |
T12295 |
T12294 |
prep |
by,synthesized |
R7937 |
T12296 |
T12297 |
nmod |
TNT,kit |
R7938 |
T12297 |
T12295 |
pobj |
kit,by |
R7939 |
T12298 |
T12299 |
advmod |
quick,coupled |
R7940 |
T12299 |
T12297 |
amod |
coupled,kit |
R7941 |
T12300 |
T12301 |
compound |
transcription,translation |
R7942 |
T12301 |
T12297 |
compound |
translation,kit |
R7943 |
T12302 |
T12301 |
punct |
/,translation |
R7944 |
T12303 |
T12297 |
compound |
system,kit |
R7945 |
T12304 |
T12305 |
punct |
(,Promega |
R7946 |
T12305 |
T12297 |
parataxis |
Promega,kit |
R7947 |
T12306 |
T12305 |
punct |
),Promega |
R7948 |
T12307 |
T12294 |
cc |
and,synthesized |
R7949 |
T12308 |
T12294 |
conj |
radiolabeled,synthesized |
R7950 |
T12309 |
T12308 |
prep |
with,radiolabeled |
R7951 |
T12310 |
T12311 |
compound |
35S,methionine |
R7952 |
T12311 |
T12309 |
pobj |
methionine,with |
R7953 |
T12312 |
T12308 |
prep |
according,radiolabeled |
R7954 |
T12313 |
T12312 |
prep |
to,according |
R7955 |
T12314 |
T12315 |
poss |
manufacturer,instructions |
R7956 |
T12315 |
T12313 |
pobj |
instructions,to |
R7957 |
T12316 |
T12314 |
case |
's,manufacturer |
R7958 |
T12317 |
T12294 |
punct |
.,synthesized |
R7959 |
T12319 |
T12320 |
nummod |
100,μl |
R7960 |
T12320 |
T12321 |
nsubjpass |
μl,incubated |
R7961 |
T12322 |
T12320 |
prep |
of,μl |
R7962 |
T12323 |
T12324 |
advmod |
in,vitro |
R7963 |
T12324 |
T12325 |
advmod |
vitro,translated |
R7964 |
T12325 |
T12326 |
amod |
translated,protein |
R7965 |
T12326 |
T12322 |
pobj |
protein,of |
R7966 |
T12327 |
T12326 |
compound |
RXRβ3,protein |
R7967 |
T12328 |
T12320 |
prep |
in,μl |
R7968 |
T12329 |
T12330 |
nummod |
1,ml |
R7969 |
T12330 |
T12328 |
pobj |
ml,in |
R7970 |
T12331 |
T12330 |
prep |
of,ml |
R7971 |
T12332 |
T12333 |
nummod |
20,mM |
R7972 |
T12333 |
T12334 |
compound |
mM,HCl |
R7973 |
T12334 |
T12331 |
pobj |
HCl,of |
R7974 |
T12335 |
T12334 |
compound |
Tris,HCl |
R7975 |
T12336 |
T12334 |
punct |
-,HCl |
R7976 |
T12337 |
T12334 |
npadvmod |
pH.8.0,HCl |
R7977 |
T12338 |
T12334 |
punct |
", ",HCl |
R7978 |
T12339 |
T12340 |
nummod |
200,mM |
R7979 |
T12340 |
T12341 |
compound |
mM,NaCl |
R7980 |
T12341 |
T12334 |
appos |
NaCl,HCl |
R7981 |
T12342 |
T12334 |
punct |
", ",HCl |
R7982 |
T12343 |
T12344 |
nummod |
1,mM |
R7983 |
T12344 |
T12345 |
compound |
mM,EDTA |
R7984 |
T12345 |
T12334 |
appos |
EDTA,HCl |
R7985 |
T12346 |
T12345 |
npadvmod |
pH8.0,EDTA |
R7986 |
T12347 |
T12321 |
auxpass |
was,incubated |
R7987 |
T12348 |
T12321 |
prep |
at,incubated |
R7988 |
T12349 |
T12350 |
nummod |
4,°C |
R7989 |
T12350 |
T12348 |
pobj |
°C,at |
R7990 |
T12351 |
T12321 |
prep |
with,incubated |
R7991 |
T12352 |
T12353 |
amod |
immobilized,TACC2 |
R7992 |
T12353 |
T12351 |
pobj |
TACC2,with |
R7993 |
T12354 |
T12353 |
compound |
GST,TACC2 |
R7994 |
T12355 |
T12353 |
punct |
-,TACC2 |
R7995 |
T12356 |
T12353 |
cc |
or,TACC2 |
R7996 |
T12357 |
T12353 |
conj |
GST,TACC2 |
R7997 |
T12358 |
T12321 |
prep |
for,incubated |
R7998 |
T12359 |
T12360 |
nummod |
90,min |
R7999 |
T12360 |
T12358 |
pobj |
min,for |
R8000 |
T12361 |
T12321 |
punct |
.,incubated |
R8001 |
T12363 |
T12364 |
amod |
Unbound,RXRβ3 |
R8002 |
T12364 |
T12365 |
nsubjpass |
RXRβ3,removed |
R8003 |
T12366 |
T12365 |
auxpass |
was,removed |
R8004 |
T12367 |
T12365 |
prep |
by,removed |
R8005 |
T12368 |
T12367 |
pcomp |
washing,by |
R8006 |
T12369 |
T12370 |
nummod |
three,times |
R8007 |
T12370 |
T12368 |
npadvmod |
times,washing |
R8008 |
T12371 |
T12368 |
prep |
with,washing |
R8009 |
T12372 |
T12373 |
nummod |
20,mM |
R8010 |
T12373 |
T12374 |
compound |
mM,HCl |
R8011 |
T12374 |
T12371 |
pobj |
HCl,with |
R8012 |
T12375 |
T12374 |
compound |
Tris,HCl |
R8013 |
T12376 |
T12374 |
punct |
-,HCl |
R8014 |
T12377 |
T12374 |
npadvmod |
pH.8.0,HCl |
R8015 |
T12378 |
T12374 |
punct |
", ",HCl |
R8016 |
T12379 |
T12380 |
nummod |
200,mM |
R8017 |
T12380 |
T12381 |
compound |
mM,NaCl |
R8018 |
T12381 |
T12374 |
appos |
NaCl,HCl |
R8019 |
T12382 |
T12374 |
punct |
", ",HCl |
R8020 |
T12383 |
T12384 |
nummod |
1,mM |
R8021 |
T12384 |
T12385 |
compound |
mM,EDTA |
R8022 |
T12385 |
T12374 |
appos |
EDTA,HCl |
R8023 |
T12386 |
T12385 |
npadvmod |
pH8.0,EDTA |
R8024 |
T12387 |
T12365 |
punct |
.,removed |
R8025 |
T12389 |
T12390 |
compound |
Bound,proteins |
R8026 |
T12390 |
T12391 |
nsubjpass |
proteins,eluted |
R8027 |
T12392 |
T12391 |
auxpass |
were,eluted |
R8028 |
T12393 |
T12391 |
prep |
from,eluted |
R8029 |
T12394 |
T12395 |
det |
the,beads |
R8030 |
T12395 |
T12393 |
pobj |
beads,from |
R8031 |
T12396 |
T12391 |
prep |
at,eluted |
R8032 |
T12397 |
T12398 |
compound |
room,temperature |
R8033 |
T12398 |
T12396 |
pobj |
temperature,at |
R8034 |
T12399 |
T12391 |
prep |
for,eluted |
R8035 |
T12400 |
T12401 |
nummod |
10,min |
R8036 |
T12401 |
T12399 |
pobj |
min,for |
R8037 |
T12402 |
T12391 |
prep |
in,eluted |
R8038 |
T12403 |
T12404 |
compound |
elution,buffer |
R8039 |
T12404 |
T12402 |
pobj |
buffer,in |
R8040 |
T12405 |
T12406 |
punct |
(,HCl |
R8041 |
T12406 |
T12404 |
parataxis |
HCl,buffer |
R8042 |
T12407 |
T12408 |
nummod |
100,mM |
R8043 |
T12408 |
T12406 |
compound |
mM,HCl |
R8044 |
T12409 |
T12406 |
compound |
Tris,HCl |
R8045 |
T12410 |
T12406 |
punct |
", ",HCl |
R8046 |
T12411 |
T12406 |
npadvmod |
pH8.0,HCl |
R8047 |
T12412 |
T12406 |
punct |
", ",HCl |
R8048 |
T12413 |
T12414 |
nummod |
20,mM |
R8049 |
T12414 |
T12415 |
nmod |
mM,glutathione |
R8050 |
T12415 |
T12406 |
appos |
glutathione,HCl |
R8051 |
T12416 |
T12415 |
amod |
reduced,glutathione |
R8052 |
T12417 |
T12406 |
punct |
),HCl |
R8053 |
T12418 |
T12391 |
punct |
.,eluted |
R8054 |
T12420 |
T12421 |
det |
The,proteins |
R8055 |
T12421 |
T12422 |
nsubjpass |
proteins,analyzed |
R8056 |
T12423 |
T12422 |
auxpass |
were,analyzed |
R8057 |
T12424 |
T12422 |
prep |
on,analyzed |
R8058 |
T12425 |
T12426 |
nummod |
12,% |
R8059 |
T12426 |
T12427 |
compound |
%,gels |
R8060 |
T12427 |
T12424 |
pobj |
gels,on |
R8061 |
T12428 |
T12427 |
compound |
SDS,gels |
R8062 |
T12429 |
T12427 |
compound |
polyacrylamide,gels |
R8063 |
T12430 |
T12422 |
punct |
.,analyzed |
R8064 |
T12432 |
T12433 |
nmod |
Coomassie,staining |
R8065 |
T12433 |
T12435 |
nsubj |
staining,verified |
R8066 |
T12434 |
T12433 |
amod |
blue,staining |
R8067 |
T12436 |
T12437 |
amod |
equal,loading |
R8068 |
T12437 |
T12435 |
dobj |
loading,verified |
R8069 |
T12438 |
T12437 |
prep |
of,loading |
R8070 |
T12439 |
T12440 |
compound |
GST,protein |
R8071 |
T12440 |
T12438 |
pobj |
protein,of |
R8072 |
T12441 |
T12440 |
compound |
fusion,protein |
R8073 |
T12442 |
T12435 |
punct |
.,verified |
R8074 |
T12444 |
T12445 |
amod |
Dried,gels |
R8075 |
T12445 |
T12446 |
nsubjpass |
gels,autoradiographed |
R8076 |
T12447 |
T12446 |
auxpass |
were,autoradiographed |
R8077 |
T12448 |
T12446 |
punct |
.,autoradiographed |