Id |
Subject |
Object |
Predicate |
Lexical cue |
T2220 |
0-9 |
NN |
denotes |
Targeting |
T2221 |
10-16 |
NN |
denotes |
vector |
T2222 |
17-29 |
NN |
denotes |
construction |
T2223 |
30-33 |
CC |
denotes |
and |
T2224 |
34-44 |
NN |
denotes |
generation |
T2225 |
45-47 |
IN |
denotes |
of |
T2226 |
48-56 |
NN |
denotes |
knockout |
T2227 |
57-61 |
NNS |
denotes |
mice |
T2228 |
61-316 |
sentence |
denotes |
A mouse genomic bacterial artificial chromosome (BAC) library (CitbCJ7, ES cell line/129Sv, Research Genetics, Inc., Huntsville, AL, USA) was screened by using primers designed from the sequences of mouse Abcg5 and Abcg8 cDNA as previously reported [21]. |
T2229 |
62-63 |
DT |
denotes |
A |
T2231 |
64-69 |
NN |
denotes |
mouse |
T2232 |
70-77 |
JJ |
denotes |
genomic |
T2233 |
78-87 |
JJ |
denotes |
bacterial |
T2235 |
88-98 |
JJ |
denotes |
artificial |
T2234 |
99-109 |
NN |
denotes |
chromosome |
T2236 |
110-111 |
-LRB- |
denotes |
( |
T2237 |
111-114 |
NN |
denotes |
BAC |
T2238 |
114-115 |
-RRB- |
denotes |
) |
T2230 |
116-123 |
NN |
denotes |
library |
T2240 |
124-125 |
-LRB- |
denotes |
( |
T2242 |
125-132 |
NN |
denotes |
CitbCJ7 |
T2243 |
132-134 |
, |
denotes |
, |
T2244 |
134-136 |
NN |
denotes |
ES |
T2245 |
137-141 |
NN |
denotes |
cell |
T2247 |
142-146 |
NN |
denotes |
line |
T2248 |
146-147 |
HYPH |
denotes |
/ |
T2246 |
147-152 |
NN |
denotes |
129Sv |
T2249 |
152-154 |
, |
denotes |
, |
T2250 |
154-162 |
NNP |
denotes |
Research |
T2251 |
163-171 |
NNP |
denotes |
Genetics |
T2252 |
171-173 |
, |
denotes |
, |
T2253 |
173-177 |
NNP |
denotes |
Inc. |
T2254 |
177-179 |
, |
denotes |
, |
T2241 |
179-189 |
NNP |
denotes |
Huntsville |
T2255 |
189-191 |
, |
denotes |
, |
T2256 |
191-193 |
NNP |
denotes |
AL |
T2257 |
193-195 |
, |
denotes |
, |
T2258 |
195-198 |
NNP |
denotes |
USA |
T2259 |
198-199 |
-RRB- |
denotes |
) |
T2260 |
200-203 |
VBD |
denotes |
was |
T2239 |
204-212 |
VBN |
denotes |
screened |
T2261 |
213-215 |
IN |
denotes |
by |
T2262 |
216-221 |
VBG |
denotes |
using |
T2263 |
222-229 |
NNS |
denotes |
primers |
T2264 |
230-238 |
VBN |
denotes |
designed |
T2265 |
239-243 |
IN |
denotes |
from |
T2266 |
244-247 |
DT |
denotes |
the |
T2267 |
248-257 |
NNS |
denotes |
sequences |
T2268 |
258-260 |
IN |
denotes |
of |
T2269 |
261-266 |
NN |
denotes |
mouse |
T2271 |
267-272 |
NN |
denotes |
Abcg5 |
T2272 |
273-276 |
CC |
denotes |
and |
T2273 |
277-282 |
NN |
denotes |
Abcg8 |
T2270 |
283-287 |
NN |
denotes |
cDNA |
T2274 |
288-290 |
IN |
denotes |
as |
T2276 |
291-301 |
RB |
denotes |
previously |
T2275 |
302-310 |
VBN |
denotes |
reported |
T2277 |
311-312 |
-LRB- |
denotes |
[ |
T2278 |
312-314 |
CD |
denotes |
21 |
T2279 |
314-315 |
-RRB- |
denotes |
] |
T2280 |
315-316 |
. |
denotes |
. |
T2281 |
316-403 |
sentence |
denotes |
A positive BAC clone was used as a template to amplify genomic DNA fragments of Abcg8. |
T2282 |
317-318 |
DT |
denotes |
A |
T2284 |
319-327 |
JJ |
denotes |
positive |
T2285 |
328-331 |
NN |
denotes |
BAC |
T2283 |
332-337 |
NN |
denotes |
clone |
T2287 |
338-341 |
VBD |
denotes |
was |
T2286 |
342-346 |
VBN |
denotes |
used |
T2288 |
347-349 |
IN |
denotes |
as |
T2289 |
350-351 |
DT |
denotes |
a |
T2290 |
352-360 |
NN |
denotes |
template |
T2291 |
361-363 |
TO |
denotes |
to |
T2292 |
364-371 |
VB |
denotes |
amplify |
T2293 |
372-379 |
JJ |
denotes |
genomic |
T2295 |
380-383 |
NN |
denotes |
DNA |
T2294 |
384-393 |
NNS |
denotes |
fragments |
T2296 |
394-396 |
IN |
denotes |
of |
T2297 |
397-402 |
NN |
denotes |
Abcg8 |
T2298 |
402-403 |
. |
denotes |
. |
T2299 |
403-555 |
sentence |
denotes |
Long-fragment polymerase chain reaction (PCR) was performed using Expanded Long Template PCR system kit (Roche Applied Science, Indianapolis, IA, USA). |
T2300 |
404-408 |
JJ |
denotes |
Long |
T2302 |
408-409 |
HYPH |
denotes |
- |
T2301 |
409-417 |
NN |
denotes |
fragment |
T2304 |
418-428 |
NN |
denotes |
polymerase |
T2306 |
429-434 |
NN |
denotes |
chain |
T2305 |
435-443 |
NN |
denotes |
reaction |
T2307 |
444-445 |
-LRB- |
denotes |
( |
T2308 |
445-448 |
NN |
denotes |
PCR |
T2309 |
448-449 |
-RRB- |
denotes |
) |
T2310 |
450-453 |
VBD |
denotes |
was |
T2303 |
454-463 |
VBN |
denotes |
performed |
T2311 |
464-469 |
VBG |
denotes |
using |
T2312 |
470-478 |
NN |
denotes |
Expanded |
T2314 |
479-483 |
JJ |
denotes |
Long |
T2316 |
484-492 |
NN |
denotes |
Template |
T2315 |
493-496 |
NN |
denotes |
PCR |
T2313 |
497-503 |
NN |
denotes |
system |
T2317 |
504-507 |
NN |
denotes |
kit |
T2318 |
508-509 |
-LRB- |
denotes |
( |
T2320 |
509-514 |
NNP |
denotes |
Roche |
T2321 |
515-522 |
NNP |
denotes |
Applied |
T2319 |
523-530 |
NNP |
denotes |
Science |
T2322 |
530-532 |
, |
denotes |
, |
T2323 |
532-544 |
NNP |
denotes |
Indianapolis |
T2324 |
544-546 |
, |
denotes |
, |
T2325 |
546-548 |
NNP |
denotes |
IA |
T2326 |
548-550 |
, |
denotes |
, |
T2327 |
550-553 |
NNP |
denotes |
USA |
T2328 |
553-554 |
-RRB- |
denotes |
) |
T2329 |
554-555 |
. |
denotes |
. |
T2330 |
555-726 |
sentence |
denotes |
An approximately 4.5 kb 'long-arm' genomic fragment containing partial exon 1 to partial exon 3 was inserted into the Pml I restriction-cloning site A of OSDUPDEL vector. |
T2331 |
556-558 |
DT |
denotes |
An |
T2333 |
559-572 |
RB |
denotes |
approximately |
T2334 |
573-576 |
CD |
denotes |
4.5 |
T2335 |
577-579 |
NN |
denotes |
kb |
T2336 |
580-581 |
`` |
denotes |
' |
T2337 |
581-585 |
JJ |
denotes |
long |
T2339 |
585-586 |
HYPH |
denotes |
- |
T2338 |
586-589 |
NN |
denotes |
arm |
T2340 |
589-590 |
'' |
denotes |
' |
T2341 |
591-598 |
JJ |
denotes |
genomic |
T2332 |
599-607 |
NN |
denotes |
fragment |
T2343 |
608-618 |
VBG |
denotes |
containing |
T2344 |
619-626 |
JJ |
denotes |
partial |
T2345 |
627-631 |
NN |
denotes |
exon |
T2346 |
632-633 |
CD |
denotes |
1 |
T2347 |
634-636 |
IN |
denotes |
to |
T2348 |
637-644 |
JJ |
denotes |
partial |
T2349 |
645-649 |
NN |
denotes |
exon |
T2350 |
650-651 |
CD |
denotes |
3 |
T2351 |
652-655 |
VBD |
denotes |
was |
T2342 |
656-664 |
VBN |
denotes |
inserted |
T2352 |
665-669 |
IN |
denotes |
into |
T2353 |
670-673 |
DT |
denotes |
the |
T2355 |
674-677 |
NN |
denotes |
Pml |
T2356 |
678-679 |
CD |
denotes |
I |
T2357 |
680-691 |
NN |
denotes |
restriction |
T2359 |
691-692 |
HYPH |
denotes |
- |
T2358 |
692-699 |
VBG |
denotes |
cloning |
T2360 |
700-704 |
NN |
denotes |
site |
T2354 |
705-706 |
NN |
denotes |
A |
T2361 |
707-709 |
IN |
denotes |
of |
T2362 |
710-718 |
NN |
denotes |
OSDUPDEL |
T2363 |
719-725 |
NN |
denotes |
vector |
T2364 |
725-726 |
. |
denotes |
. |
T2365 |
726-856 |
sentence |
denotes |
The 'short-arm' genomic fragment, containing partial exon 4 to partial exon 6, was cloned into the Not I-Kpn I of cloning site B. |
T2366 |
727-730 |
DT |
denotes |
The |
T2368 |
731-732 |
`` |
denotes |
' |
T2369 |
732-737 |
NN |
denotes |
short |
T2371 |
737-738 |
HYPH |
denotes |
- |
T2370 |
738-741 |
NN |
denotes |
arm |
T2372 |
741-742 |
'' |
denotes |
' |
T2373 |
743-750 |
JJ |
denotes |
genomic |
T2367 |
751-759 |
NN |
denotes |
fragment |
T2375 |
759-761 |
, |
denotes |
, |
T2376 |
761-771 |
VBG |
denotes |
containing |
T2377 |
772-779 |
JJ |
denotes |
partial |
T2378 |
780-784 |
NN |
denotes |
exon |
T2379 |
785-786 |
CD |
denotes |
4 |
T2380 |
787-789 |
IN |
denotes |
to |
T2381 |
790-797 |
JJ |
denotes |
partial |
T2382 |
798-802 |
NN |
denotes |
exon |
T2383 |
803-804 |
CD |
denotes |
6 |
T2384 |
804-806 |
, |
denotes |
, |
T2385 |
806-809 |
VBD |
denotes |
was |
T2374 |
810-816 |
VBN |
denotes |
cloned |
T2386 |
817-821 |
IN |
denotes |
into |
T2387 |
822-825 |
DT |
denotes |
the |
T2389 |
826-829 |
NN |
denotes |
Not |
T2390 |
830-831 |
NN |
denotes |
I |
T2391 |
831-832 |
HYPH |
denotes |
- |
T2388 |
832-835 |
NN |
denotes |
Kpn |
T2392 |
836-837 |
CD |
denotes |
I |
T2393 |
838-840 |
IN |
denotes |
of |
T2394 |
841-848 |
VBG |
denotes |
cloning |
T2396 |
849-853 |
NN |
denotes |
site |
T2395 |
854-855 |
NN |
denotes |
B |
T2397 |
855-856 |
. |
denotes |
. |
T2398 |
856-1062 |
sentence |
denotes |
Homologous targeting would result in complete intron 3, partial exon 3 and partial exon 4 replacement by the neomycin-resistance cassette, resulting in the disruption of the ABC Walker A motif (Figure 1a). |
T2399 |
857-867 |
JJ |
denotes |
Homologous |
T2400 |
868-877 |
NN |
denotes |
targeting |
T2402 |
878-883 |
MD |
denotes |
would |
T2401 |
884-890 |
VB |
denotes |
result |
T2403 |
891-893 |
IN |
denotes |
in |
T2404 |
894-902 |
JJ |
denotes |
complete |
T2405 |
903-909 |
NN |
denotes |
intron |
T2406 |
910-911 |
CD |
denotes |
3 |
T2407 |
911-913 |
, |
denotes |
, |
T2408 |
913-920 |
JJ |
denotes |
partial |
T2409 |
921-925 |
NN |
denotes |
exon |
T2410 |
926-927 |
CD |
denotes |
3 |
T2411 |
928-931 |
CC |
denotes |
and |
T2412 |
932-939 |
JJ |
denotes |
partial |
T2413 |
940-944 |
NN |
denotes |
exon |
T2415 |
945-946 |
CD |
denotes |
4 |
T2414 |
947-958 |
NN |
denotes |
replacement |
T2416 |
959-961 |
IN |
denotes |
by |
T2417 |
962-965 |
DT |
denotes |
the |
T2419 |
966-974 |
NN |
denotes |
neomycin |
T2420 |
974-975 |
HYPH |
denotes |
- |
T2421 |
975-985 |
JJ |
denotes |
resistance |
T2418 |
986-994 |
NN |
denotes |
cassette |
T2422 |
994-996 |
, |
denotes |
, |
T2423 |
996-1005 |
VBG |
denotes |
resulting |
T2424 |
1006-1008 |
IN |
denotes |
in |
T2425 |
1009-1012 |
DT |
denotes |
the |
T2426 |
1013-1023 |
NN |
denotes |
disruption |
T2427 |
1024-1026 |
IN |
denotes |
of |
T2428 |
1027-1030 |
DT |
denotes |
the |
T2430 |
1031-1034 |
NN |
denotes |
ABC |
T2432 |
1035-1041 |
NN |
denotes |
Walker |
T2431 |
1042-1043 |
NN |
denotes |
A |
T2429 |
1044-1049 |
NN |
denotes |
motif |
T2433 |
1050-1051 |
-LRB- |
denotes |
( |
T2435 |
1051-1057 |
NN |
denotes |
Figure |
T2434 |
1058-1060 |
NN |
denotes |
1a |
T2436 |
1060-1061 |
-RRB- |
denotes |
) |
T2437 |
1061-1062 |
. |
denotes |
. |
T2438 |
1062-1209 |
sentence |
denotes |
ES cells (129/SvEvTac-cell line) were electroporated with the linearized targeting vector DNA and cultured on sub-confluent embryonic fibroblasts. |
T2439 |
1063-1065 |
NN |
denotes |
ES |
T2440 |
1066-1071 |
NNS |
denotes |
cells |
T2442 |
1072-1073 |
-LRB- |
denotes |
( |
T2444 |
1073-1076 |
CD |
denotes |
129 |
T2446 |
1076-1077 |
HYPH |
denotes |
/ |
T2445 |
1077-1084 |
NN |
denotes |
SvEvTac |
T2447 |
1084-1085 |
HYPH |
denotes |
- |
T2448 |
1085-1089 |
NN |
denotes |
cell |
T2443 |
1090-1094 |
NN |
denotes |
line |
T2449 |
1094-1095 |
-RRB- |
denotes |
) |
T2450 |
1096-1100 |
VBD |
denotes |
were |
T2441 |
1101-1115 |
VBN |
denotes |
electroporated |
T2451 |
1116-1120 |
IN |
denotes |
with |
T2452 |
1121-1124 |
DT |
denotes |
the |
T2454 |
1125-1135 |
VBN |
denotes |
linearized |
T2456 |
1136-1145 |
NN |
denotes |
targeting |
T2455 |
1146-1152 |
NN |
denotes |
vector |
T2453 |
1153-1156 |
NN |
denotes |
DNA |
T2457 |
1157-1160 |
CC |
denotes |
and |
T2458 |
1161-1169 |
VBN |
denotes |
cultured |
T2459 |
1170-1172 |
IN |
denotes |
on |
T2460 |
1173-1186 |
JJ |
denotes |
sub-confluent |
T2462 |
1187-1196 |
JJ |
denotes |
embryonic |
T2461 |
1197-1208 |
NNS |
denotes |
fibroblasts |
T2463 |
1208-1209 |
. |
denotes |
. |
T2464 |
1209-1345 |
sentence |
denotes |
Transfected cell colonies were selected by culturing cells in medium containing 200 μg/mL G418 (Life Technologies, Rockville, MD, USA). |
T2465 |
1210-1221 |
VBN |
denotes |
Transfected |
T2467 |
1222-1226 |
NN |
denotes |
cell |
T2466 |
1227-1235 |
NNS |
denotes |
colonies |
T2469 |
1236-1240 |
VBD |
denotes |
were |
T2468 |
1241-1249 |
VBN |
denotes |
selected |
T2470 |
1250-1252 |
IN |
denotes |
by |
T2471 |
1253-1262 |
VBG |
denotes |
culturing |
T2472 |
1263-1268 |
NNS |
denotes |
cells |
T2473 |
1269-1271 |
IN |
denotes |
in |
T2474 |
1272-1278 |
NN |
denotes |
medium |
T2475 |
1279-1289 |
VBG |
denotes |
containing |
T2476 |
1290-1293 |
CD |
denotes |
200 |
T2477 |
1294-1296 |
NN |
denotes |
μg |
T2479 |
1296-1297 |
SYM |
denotes |
/ |
T2480 |
1297-1299 |
NN |
denotes |
mL |
T2478 |
1300-1304 |
NN |
denotes |
G418 |
T2481 |
1305-1306 |
-LRB- |
denotes |
( |
T2483 |
1306-1310 |
NNP |
denotes |
Life |
T2482 |
1311-1323 |
NNP |
denotes |
Technologies |
T2484 |
1323-1325 |
, |
denotes |
, |
T2485 |
1325-1334 |
NNP |
denotes |
Rockville |
T2486 |
1334-1336 |
, |
denotes |
, |
T2487 |
1336-1338 |
NNP |
denotes |
MD |
T2488 |
1338-1340 |
, |
denotes |
, |
T2489 |
1340-1343 |
NNP |
denotes |
USA |
T2490 |
1343-1344 |
-RRB- |
denotes |
) |
T2491 |
1344-1345 |
. |
denotes |
. |
T2492 |
1345-1619 |
sentence |
denotes |
The ES cells were screened for homologous recombination by PCR with the forward primer, neoF (5'-GGGTCGTTTGTTCGGATCAA-3') from neo cassette, and reverse primer intron 6R (5'-ACCAGTTGGTCCTAGCTCGA-3'), which is located outside the targeting construct in mouse Abcg8 intron 6. |
T2493 |
1346-1349 |
DT |
denotes |
The |
T2495 |
1350-1352 |
NN |
denotes |
ES |
T2494 |
1353-1358 |
NNS |
denotes |
cells |
T2497 |
1359-1363 |
VBD |
denotes |
were |
T2496 |
1364-1372 |
VBN |
denotes |
screened |
T2498 |
1373-1376 |
IN |
denotes |
for |
T2499 |
1377-1387 |
JJ |
denotes |
homologous |
T2500 |
1388-1401 |
NN |
denotes |
recombination |
T2501 |
1402-1404 |
IN |
denotes |
by |
T2502 |
1405-1408 |
NN |
denotes |
PCR |
T2503 |
1409-1413 |
IN |
denotes |
with |
T2504 |
1414-1417 |
DT |
denotes |
the |
T2506 |
1418-1425 |
JJ |
denotes |
forward |
T2505 |
1426-1432 |
NN |
denotes |
primer |
T2507 |
1432-1434 |
, |
denotes |
, |
T2508 |
1434-1438 |
NN |
denotes |
neoF |
T2509 |
1439-1440 |
-LRB- |
denotes |
( |
T2510 |
1440-1441 |
CD |
denotes |
5 |
T2512 |
1441-1442 |
SYM |
denotes |
' |
T2513 |
1442-1443 |
HYPH |
denotes |
- |
T2511 |
1443-1463 |
NN |
denotes |
GGGTCGTTTGTTCGGATCAA |
T2514 |
1463-1464 |
HYPH |
denotes |
- |
T2515 |
1464-1465 |
CD |
denotes |
3 |
T2516 |
1465-1466 |
SYM |
denotes |
' |
T2517 |
1466-1467 |
-RRB- |
denotes |
) |
T2518 |
1468-1472 |
IN |
denotes |
from |
T2519 |
1473-1476 |
NN |
denotes |
neo |
T2520 |
1477-1485 |
NN |
denotes |
cassette |
T2521 |
1485-1487 |
, |
denotes |
, |
T2522 |
1487-1490 |
CC |
denotes |
and |
T2523 |
1491-1498 |
JJ |
denotes |
reverse |
T2524 |
1499-1505 |
NN |
denotes |
primer |
T2526 |
1506-1512 |
NN |
denotes |
intron |
T2525 |
1513-1515 |
NN |
denotes |
6R |
T2527 |
1516-1517 |
-LRB- |
denotes |
( |
T2528 |
1517-1518 |
CD |
denotes |
5 |
T2530 |
1518-1519 |
SYM |
denotes |
' |
T2531 |
1519-1520 |
HYPH |
denotes |
- |
T2529 |
1520-1540 |
NN |
denotes |
ACCAGTTGGTCCTAGCTCGA |
T2532 |
1540-1541 |
HYPH |
denotes |
- |
T2533 |
1541-1542 |
CD |
denotes |
3 |
T2534 |
1542-1543 |
SYM |
denotes |
' |
T2535 |
1543-1544 |
-RRB- |
denotes |
) |
T2536 |
1544-1546 |
, |
denotes |
, |
T2537 |
1546-1551 |
WDT |
denotes |
which |
T2539 |
1552-1554 |
VBZ |
denotes |
is |
T2538 |
1555-1562 |
VBN |
denotes |
located |
T2540 |
1563-1570 |
IN |
denotes |
outside |
T2541 |
1571-1574 |
DT |
denotes |
the |
T2543 |
1575-1584 |
VBG |
denotes |
targeting |
T2542 |
1585-1594 |
NN |
denotes |
construct |
T2544 |
1595-1597 |
IN |
denotes |
in |
T2545 |
1598-1603 |
NN |
denotes |
mouse |
T2547 |
1604-1609 |
NN |
denotes |
Abcg8 |
T2546 |
1610-1616 |
NN |
denotes |
intron |
T2548 |
1617-1618 |
CD |
denotes |
6 |
T2549 |
1618-1619 |
. |
denotes |
. |
T2550 |
1619-1823 |
sentence |
denotes |
Positively targeted ES cell clones were confirmed by Southern blotting, using ES cell DNA digested by BamHI and a probe comprising of a 562 bp PCR fragment from partial intron 2 and exon 3 of Abcg8 gene. |
T2551 |
1620-1630 |
RB |
denotes |
Positively |
T2552 |
1631-1639 |
VBN |
denotes |
targeted |
T2554 |
1640-1642 |
NN |
denotes |
ES |
T2555 |
1643-1647 |
NN |
denotes |
cell |
T2553 |
1648-1654 |
NNS |
denotes |
clones |
T2557 |
1655-1659 |
VBD |
denotes |
were |
T2556 |
1660-1669 |
VBN |
denotes |
confirmed |
T2558 |
1670-1672 |
IN |
denotes |
by |
T2559 |
1673-1681 |
NNP |
denotes |
Southern |
T2560 |
1682-1690 |
NN |
denotes |
blotting |
T2561 |
1690-1692 |
, |
denotes |
, |
T2562 |
1692-1697 |
VBG |
denotes |
using |
T2563 |
1698-1700 |
NN |
denotes |
ES |
T2564 |
1701-1705 |
NN |
denotes |
cell |
T2565 |
1706-1709 |
NN |
denotes |
DNA |
T2566 |
1710-1718 |
VBN |
denotes |
digested |
T2567 |
1719-1721 |
IN |
denotes |
by |
T2568 |
1722-1727 |
NN |
denotes |
BamHI |
T2569 |
1728-1731 |
CC |
denotes |
and |
T2570 |
1732-1733 |
DT |
denotes |
a |
T2571 |
1734-1739 |
NN |
denotes |
probe |
T2572 |
1740-1750 |
VBZ |
denotes |
comprising |
T2573 |
1751-1753 |
IN |
denotes |
of |
T2574 |
1754-1755 |
DT |
denotes |
a |
T2576 |
1756-1759 |
CD |
denotes |
562 |
T2577 |
1760-1762 |
NN |
denotes |
bp |
T2578 |
1763-1766 |
NN |
denotes |
PCR |
T2575 |
1767-1775 |
NN |
denotes |
fragment |
T2579 |
1776-1780 |
IN |
denotes |
from |
T2580 |
1781-1788 |
JJ |
denotes |
partial |
T2581 |
1789-1795 |
NN |
denotes |
intron |
T2582 |
1796-1797 |
CD |
denotes |
2 |
T2583 |
1798-1801 |
CC |
denotes |
and |
T2584 |
1802-1806 |
NN |
denotes |
exon |
T2585 |
1807-1808 |
CD |
denotes |
3 |
T2586 |
1809-1811 |
IN |
denotes |
of |
T2587 |
1812-1817 |
NN |
denotes |
Abcg8 |
T2588 |
1818-1822 |
NN |
denotes |
gene |
T2589 |
1822-1823 |
. |
denotes |
. |
T2590 |
1823-1944 |
sentence |
denotes |
Positively targeted ES cells were microinjected into C57BL6 blastocysts and transplanted into pseudopregnant recipients. |
T2591 |
1824-1834 |
RB |
denotes |
Positively |
T2592 |
1835-1843 |
VBN |
denotes |
targeted |
T2594 |
1844-1846 |
NN |
denotes |
ES |
T2593 |
1847-1852 |
NNS |
denotes |
cells |
T2596 |
1853-1857 |
VBD |
denotes |
were |
T2595 |
1858-1871 |
VBN |
denotes |
microinjected |
T2597 |
1872-1876 |
IN |
denotes |
into |
T2598 |
1877-1883 |
NN |
denotes |
C57BL6 |
T2599 |
1884-1895 |
NNS |
denotes |
blastocysts |
T2600 |
1896-1899 |
CC |
denotes |
and |
T2601 |
1900-1912 |
VBN |
denotes |
transplanted |
T2602 |
1913-1917 |
IN |
denotes |
into |
T2603 |
1918-1932 |
JJ |
denotes |
pseudopregnant |
T2604 |
1933-1943 |
NNS |
denotes |
recipients |
T2605 |
1943-1944 |
. |
denotes |
. |
T2606 |
1944-2140 |
sentence |
denotes |
Five highly chimeric mice (agouti coat color, three males and two females) were isolated and bred with C57BL/6J mice to generate germ-line transmission heterozygous mice of Abcg8 gene disruption. |
T2607 |
1945-1949 |
CD |
denotes |
Five |
T2609 |
1950-1956 |
RB |
denotes |
highly |
T2610 |
1957-1965 |
JJ |
denotes |
chimeric |
T2608 |
1966-1970 |
NNS |
denotes |
mice |
T2612 |
1971-1972 |
-LRB- |
denotes |
( |
T2614 |
1972-1978 |
JJ |
denotes |
agouti |
T2616 |
1979-1983 |
NN |
denotes |
coat |
T2615 |
1984-1989 |
NN |
denotes |
color |
T2617 |
1989-1991 |
, |
denotes |
, |
T2618 |
1991-1996 |
CD |
denotes |
three |
T2613 |
1997-2002 |
NNS |
denotes |
males |
T2619 |
2003-2006 |
CC |
denotes |
and |
T2620 |
2007-2010 |
CD |
denotes |
two |
T2621 |
2011-2018 |
NNS |
denotes |
females |
T2622 |
2018-2019 |
-RRB- |
denotes |
) |
T2623 |
2020-2024 |
VBD |
denotes |
were |
T2611 |
2025-2033 |
VBN |
denotes |
isolated |
T2624 |
2034-2037 |
CC |
denotes |
and |
T2625 |
2038-2042 |
VBN |
denotes |
bred |
T2626 |
2043-2047 |
IN |
denotes |
with |
T2627 |
2048-2053 |
NN |
denotes |
C57BL |
T2629 |
2053-2054 |
HYPH |
denotes |
/ |
T2628 |
2054-2056 |
NN |
denotes |
6J |
T2630 |
2057-2061 |
NNS |
denotes |
mice |
T2631 |
2062-2064 |
TO |
denotes |
to |
T2632 |
2065-2073 |
VB |
denotes |
generate |
T2633 |
2074-2078 |
NN |
denotes |
germ |
T2635 |
2078-2079 |
HYPH |
denotes |
- |
T2634 |
2079-2083 |
NN |
denotes |
line |
T2636 |
2084-2096 |
NN |
denotes |
transmission |
T2637 |
2097-2109 |
JJ |
denotes |
heterozygous |
T2638 |
2110-2114 |
NNS |
denotes |
mice |
T2639 |
2115-2117 |
IN |
denotes |
of |
T2640 |
2118-2123 |
NN |
denotes |
Abcg8 |
T2641 |
2124-2128 |
NN |
denotes |
gene |
T2642 |
2129-2139 |
NN |
denotes |
disruption |
T2643 |
2139-2140 |
. |
denotes |
. |
T2644 |
2140-2282 |
sentence |
denotes |
Heterozygous offspring mice were back-crossed to C57BL/6J mice (n > 5) to produce disrupted line and inter-crossed to generate knockout mice. |
T2645 |
2141-2153 |
JJ |
denotes |
Heterozygous |
T2647 |
2154-2163 |
NN |
denotes |
offspring |
T2646 |
2164-2168 |
NNS |
denotes |
mice |
T2649 |
2169-2173 |
VBD |
denotes |
were |
T2650 |
2174-2178 |
RB |
denotes |
back |
T2651 |
2178-2179 |
HYPH |
denotes |
- |
T2648 |
2179-2186 |
VBN |
denotes |
crossed |
T2652 |
2187-2189 |
IN |
denotes |
to |
T2653 |
2190-2195 |
NN |
denotes |
C57BL |
T2655 |
2195-2196 |
HYPH |
denotes |
/ |
T2654 |
2196-2198 |
NN |
denotes |
6J |
T2656 |
2199-2203 |
NNS |
denotes |
mice |
T2657 |
2204-2205 |
-LRB- |
denotes |
( |
T2659 |
2205-2206 |
NN |
denotes |
n |
T2660 |
2207-2208 |
SYM |
denotes |
> |
T2658 |
2209-2210 |
CD |
denotes |
5 |
T2661 |
2210-2211 |
-RRB- |
denotes |
) |
T2662 |
2212-2214 |
TO |
denotes |
to |
T2663 |
2215-2222 |
VB |
denotes |
produce |
T2664 |
2223-2232 |
VBN |
denotes |
disrupted |
T2665 |
2233-2237 |
NN |
denotes |
line |
T2666 |
2238-2241 |
CC |
denotes |
and |
T2667 |
2242-2255 |
VBN |
denotes |
inter-crossed |
T2668 |
2256-2258 |
TO |
denotes |
to |
T2669 |
2259-2267 |
VB |
denotes |
generate |
T2670 |
2268-2276 |
NN |
denotes |
knockout |
T2671 |
2277-2281 |
NNS |
denotes |
mice |
T2672 |
2281-2282 |
. |
denotes |
. |
R1242 |
T2220 |
T2221 |
compound |
Targeting,vector |
R1243 |
T2221 |
T2222 |
compound |
vector,construction |
R1244 |
T2223 |
T2222 |
cc |
and,construction |
R1245 |
T2224 |
T2222 |
conj |
generation,construction |
R1246 |
T2225 |
T2224 |
prep |
of,generation |
R1247 |
T2226 |
T2227 |
compound |
knockout,mice |
R1248 |
T2227 |
T2225 |
pobj |
mice,of |
R1249 |
T2229 |
T2230 |
det |
A,library |
R1250 |
T2230 |
T2239 |
nsubjpass |
library,screened |
R1251 |
T2231 |
T2232 |
npadvmod |
mouse,genomic |
R1252 |
T2232 |
T2230 |
amod |
genomic,library |
R1253 |
T2233 |
T2234 |
amod |
bacterial,chromosome |
R1254 |
T2234 |
T2230 |
nmod |
chromosome,library |
R1255 |
T2235 |
T2234 |
amod |
artificial,chromosome |
R1256 |
T2236 |
T2234 |
punct |
(,chromosome |
R1257 |
T2237 |
T2234 |
appos |
BAC,chromosome |
R1258 |
T2238 |
T2230 |
punct |
),library |
R1259 |
T2240 |
T2241 |
punct |
(,Huntsville |
R1260 |
T2241 |
T2230 |
parataxis |
Huntsville,library |
R1261 |
T2242 |
T2241 |
dep |
CitbCJ7,Huntsville |
R1262 |
T2243 |
T2241 |
punct |
", ",Huntsville |
R1263 |
T2244 |
T2245 |
compound |
ES,cell |
R1264 |
T2245 |
T2246 |
compound |
cell,129Sv |
R1265 |
T2246 |
T2241 |
dep |
129Sv,Huntsville |
R1266 |
T2247 |
T2246 |
compound |
line,129Sv |
R1267 |
T2248 |
T2246 |
punct |
/,129Sv |
R1268 |
T2249 |
T2241 |
punct |
", ",Huntsville |
R1269 |
T2250 |
T2251 |
compound |
Research,Genetics |
R1270 |
T2251 |
T2241 |
dep |
Genetics,Huntsville |
R1271 |
T2252 |
T2251 |
punct |
", ",Genetics |
R1272 |
T2253 |
T2251 |
amod |
Inc.,Genetics |
R1273 |
T2254 |
T2241 |
punct |
", ",Huntsville |
R1274 |
T2255 |
T2241 |
punct |
", ",Huntsville |
R1275 |
T2256 |
T2241 |
npadvmod |
AL,Huntsville |
R1276 |
T2257 |
T2241 |
punct |
", ",Huntsville |
R1277 |
T2258 |
T2241 |
npadvmod |
USA,Huntsville |
R1278 |
T2259 |
T2241 |
punct |
),Huntsville |
R1279 |
T2260 |
T2239 |
auxpass |
was,screened |
R1280 |
T2261 |
T2239 |
prep |
by,screened |
R1281 |
T2262 |
T2261 |
pcomp |
using,by |
R1282 |
T2263 |
T2262 |
dobj |
primers,using |
R1283 |
T2264 |
T2263 |
acl |
designed,primers |
R1284 |
T2265 |
T2264 |
prep |
from,designed |
R1285 |
T2266 |
T2267 |
det |
the,sequences |
R1286 |
T2267 |
T2265 |
pobj |
sequences,from |
R1287 |
T2268 |
T2267 |
prep |
of,sequences |
R1288 |
T2269 |
T2270 |
nmod |
mouse,cDNA |
R1289 |
T2270 |
T2268 |
pobj |
cDNA,of |
R1290 |
T2271 |
T2270 |
nmod |
Abcg5,cDNA |
R1291 |
T2272 |
T2271 |
cc |
and,Abcg5 |
R1292 |
T2273 |
T2271 |
conj |
Abcg8,Abcg5 |
R1293 |
T2274 |
T2275 |
mark |
as,reported |
R1294 |
T2275 |
T2262 |
advcl |
reported,using |
R1295 |
T2276 |
T2275 |
advmod |
previously,reported |
R1296 |
T2277 |
T2278 |
punct |
[,21 |
R1297 |
T2278 |
T2239 |
parataxis |
21,screened |
R1298 |
T2279 |
T2278 |
punct |
],21 |
R1299 |
T2280 |
T2239 |
punct |
.,screened |
R1300 |
T2282 |
T2283 |
det |
A,clone |
R1301 |
T2283 |
T2286 |
nsubjpass |
clone,used |
R1302 |
T2284 |
T2283 |
amod |
positive,clone |
R1303 |
T2285 |
T2283 |
compound |
BAC,clone |
R1304 |
T2287 |
T2286 |
auxpass |
was,used |
R1305 |
T2288 |
T2286 |
prep |
as,used |
R1306 |
T2289 |
T2290 |
det |
a,template |
R1307 |
T2290 |
T2288 |
pobj |
template,as |
R1308 |
T2291 |
T2292 |
aux |
to,amplify |
R1309 |
T2292 |
T2286 |
advcl |
amplify,used |
R1310 |
T2293 |
T2294 |
amod |
genomic,fragments |
R1311 |
T2294 |
T2292 |
dobj |
fragments,amplify |
R1312 |
T2295 |
T2294 |
compound |
DNA,fragments |
R1313 |
T2296 |
T2294 |
prep |
of,fragments |
R1314 |
T2297 |
T2296 |
pobj |
Abcg8,of |
R1315 |
T2298 |
T2286 |
punct |
.,used |
R1316 |
T2300 |
T2301 |
amod |
Long,fragment |
R1317 |
T2301 |
T2303 |
nsubjpass |
fragment,performed |
R1318 |
T2302 |
T2301 |
punct |
-,fragment |
R1319 |
T2304 |
T2305 |
compound |
polymerase,reaction |
R1320 |
T2305 |
T2301 |
appos |
reaction,fragment |
R1321 |
T2306 |
T2305 |
compound |
chain,reaction |
R1322 |
T2307 |
T2305 |
punct |
(,reaction |
R1323 |
T2308 |
T2305 |
appos |
PCR,reaction |
R1324 |
T2309 |
T2303 |
punct |
),performed |
R1325 |
T2310 |
T2303 |
auxpass |
was,performed |
R1326 |
T2311 |
T2303 |
advcl |
using,performed |
R1327 |
T2312 |
T2313 |
nmod |
Expanded,system |
R1328 |
T2313 |
T2317 |
compound |
system,kit |
R1329 |
T2314 |
T2315 |
amod |
Long,PCR |
R1330 |
T2315 |
T2313 |
compound |
PCR,system |
R1331 |
T2316 |
T2315 |
compound |
Template,PCR |
R1332 |
T2317 |
T2311 |
dobj |
kit,using |
R1333 |
T2318 |
T2319 |
punct |
(,Science |
R1334 |
T2319 |
T2317 |
parataxis |
Science,kit |
R1335 |
T2320 |
T2319 |
compound |
Roche,Science |
R1336 |
T2321 |
T2319 |
compound |
Applied,Science |
R1337 |
T2322 |
T2319 |
punct |
", ",Science |
R1338 |
T2323 |
T2319 |
npadvmod |
Indianapolis,Science |
R1339 |
T2324 |
T2319 |
punct |
", ",Science |
R1340 |
T2325 |
T2319 |
npadvmod |
IA,Science |
R1341 |
T2326 |
T2319 |
punct |
", ",Science |
R1342 |
T2327 |
T2319 |
npadvmod |
USA,Science |
R1343 |
T2328 |
T2319 |
punct |
),Science |
R1344 |
T2329 |
T2303 |
punct |
.,performed |
R1345 |
T2331 |
T2332 |
det |
An,fragment |
R1346 |
T2332 |
T2342 |
nsubjpass |
fragment,inserted |
R1347 |
T2333 |
T2334 |
advmod |
approximately,4.5 |
R1348 |
T2334 |
T2335 |
nummod |
4.5,kb |
R1349 |
T2335 |
T2332 |
nmod |
kb,fragment |
R1350 |
T2336 |
T2332 |
punct |
',fragment |
R1351 |
T2337 |
T2338 |
amod |
long,arm |
R1352 |
T2338 |
T2332 |
nmod |
arm,fragment |
R1353 |
T2339 |
T2338 |
punct |
-,arm |
R1354 |
T2340 |
T2332 |
punct |
',fragment |
R1355 |
T2341 |
T2332 |
amod |
genomic,fragment |
R1356 |
T2343 |
T2332 |
acl |
containing,fragment |
R1357 |
T2344 |
T2345 |
amod |
partial,exon |
R1358 |
T2345 |
T2343 |
dobj |
exon,containing |
R1359 |
T2346 |
T2345 |
nummod |
1,exon |
R1360 |
T2347 |
T2345 |
prep |
to,exon |
R1361 |
T2348 |
T2349 |
amod |
partial,exon |
R1362 |
T2349 |
T2347 |
pobj |
exon,to |
R1363 |
T2350 |
T2349 |
nummod |
3,exon |
R1364 |
T2351 |
T2342 |
auxpass |
was,inserted |
R1365 |
T2352 |
T2342 |
prep |
into,inserted |
R1366 |
T2353 |
T2354 |
det |
the,A |
R1367 |
T2354 |
T2352 |
pobj |
A,into |
R1368 |
T2355 |
T2354 |
nmod |
Pml,A |
R1369 |
T2356 |
T2355 |
nummod |
I,Pml |
R1370 |
T2357 |
T2358 |
npadvmod |
restriction,cloning |
R1371 |
T2358 |
T2354 |
amod |
cloning,A |
R1372 |
T2359 |
T2358 |
punct |
-,cloning |
R1373 |
T2360 |
T2354 |
compound |
site,A |
R1374 |
T2361 |
T2354 |
prep |
of,A |
R1375 |
T2362 |
T2363 |
compound |
OSDUPDEL,vector |
R1376 |
T2363 |
T2361 |
pobj |
vector,of |
R1377 |
T2364 |
T2342 |
punct |
.,inserted |
R1378 |
T2366 |
T2367 |
det |
The,fragment |
R1379 |
T2367 |
T2374 |
nsubjpass |
fragment,cloned |
R1380 |
T2368 |
T2367 |
punct |
',fragment |
R1381 |
T2369 |
T2370 |
nmod |
short,arm |
R1382 |
T2370 |
T2367 |
nmod |
arm,fragment |
R1383 |
T2371 |
T2370 |
punct |
-,arm |
R1384 |
T2372 |
T2367 |
punct |
',fragment |
R1385 |
T2373 |
T2367 |
amod |
genomic,fragment |
R1386 |
T2375 |
T2367 |
punct |
", ",fragment |
R1387 |
T2376 |
T2367 |
acl |
containing,fragment |
R1388 |
T2377 |
T2378 |
amod |
partial,exon |
R1389 |
T2378 |
T2376 |
dobj |
exon,containing |
R1390 |
T2379 |
T2378 |
nummod |
4,exon |
R1391 |
T2380 |
T2378 |
prep |
to,exon |
R1392 |
T2381 |
T2382 |
amod |
partial,exon |
R1393 |
T2382 |
T2380 |
pobj |
exon,to |
R1394 |
T2383 |
T2382 |
nummod |
6,exon |
R1395 |
T2384 |
T2374 |
punct |
", ",cloned |
R1396 |
T2385 |
T2374 |
auxpass |
was,cloned |
R1397 |
T2386 |
T2374 |
prep |
into,cloned |
R1398 |
T2387 |
T2388 |
det |
the,Kpn |
R1399 |
T2388 |
T2386 |
pobj |
Kpn,into |
R1400 |
T2389 |
T2390 |
compound |
Not,I |
R1401 |
T2390 |
T2388 |
compound |
I,Kpn |
R1402 |
T2391 |
T2388 |
punct |
-,Kpn |
R1403 |
T2392 |
T2388 |
nummod |
I,Kpn |
R1404 |
T2393 |
T2388 |
prep |
of,Kpn |
R1405 |
T2394 |
T2395 |
amod |
cloning,B |
R1406 |
T2395 |
T2393 |
pobj |
B,of |
R1407 |
T2396 |
T2395 |
compound |
site,B |
R1408 |
T2397 |
T2374 |
punct |
.,cloned |
R1409 |
T2399 |
T2400 |
amod |
Homologous,targeting |
R1410 |
T2400 |
T2401 |
nsubj |
targeting,result |
R1411 |
T2402 |
T2401 |
aux |
would,result |
R1412 |
T2403 |
T2401 |
prep |
in,result |
R1413 |
T2404 |
T2405 |
amod |
complete,intron |
R1414 |
T2405 |
T2403 |
pobj |
intron,in |
R1415 |
T2406 |
T2405 |
nummod |
3,intron |
R1416 |
T2407 |
T2405 |
punct |
", ",intron |
R1417 |
T2408 |
T2409 |
amod |
partial,exon |
R1418 |
T2409 |
T2405 |
conj |
exon,intron |
R1419 |
T2410 |
T2409 |
nummod |
3,exon |
R1420 |
T2411 |
T2409 |
cc |
and,exon |
R1421 |
T2412 |
T2413 |
amod |
partial,exon |
R1422 |
T2413 |
T2414 |
nmod |
exon,replacement |
R1423 |
T2414 |
T2409 |
conj |
replacement,exon |
R1424 |
T2415 |
T2413 |
nummod |
4,exon |
R1425 |
T2416 |
T2405 |
prep |
by,intron |
R1426 |
T2417 |
T2418 |
det |
the,cassette |
R1427 |
T2418 |
T2416 |
pobj |
cassette,by |
R1428 |
T2419 |
T2418 |
nmod |
neomycin,cassette |
R1429 |
T2420 |
T2419 |
punct |
-,neomycin |
R1430 |
T2421 |
T2419 |
amod |
resistance,neomycin |
R1431 |
T2422 |
T2401 |
punct |
", ",result |
R1432 |
T2423 |
T2401 |
advcl |
resulting,result |
R1433 |
T2424 |
T2423 |
prep |
in,resulting |
R1434 |
T2425 |
T2426 |
det |
the,disruption |
R1435 |
T2426 |
T2424 |
pobj |
disruption,in |
R1436 |
T2427 |
T2426 |
prep |
of,disruption |
R1437 |
T2428 |
T2429 |
det |
the,motif |
R1438 |
T2429 |
T2427 |
pobj |
motif,of |
R1439 |
T2430 |
T2431 |
compound |
ABC,A |
R1440 |
T2431 |
T2429 |
compound |
A,motif |
R1441 |
T2432 |
T2431 |
compound |
Walker,A |
R1442 |
T2433 |
T2434 |
punct |
(,1a |
R1443 |
T2434 |
T2401 |
parataxis |
1a,result |
R1444 |
T2435 |
T2434 |
compound |
Figure,1a |
R1445 |
T2436 |
T2434 |
punct |
),1a |
R1446 |
T2437 |
T2401 |
punct |
.,result |
R1447 |
T2439 |
T2440 |
compound |
ES,cells |
R1448 |
T2440 |
T2441 |
nsubjpass |
cells,electroporated |
R1449 |
T2442 |
T2443 |
punct |
(,line |
R1450 |
T2443 |
T2440 |
parataxis |
line,cells |
R1451 |
T2444 |
T2445 |
nummod |
129,SvEvTac |
R1452 |
T2445 |
T2443 |
compound |
SvEvTac,line |
R1453 |
T2446 |
T2445 |
punct |
/,SvEvTac |
R1454 |
T2447 |
T2443 |
punct |
-,line |
R1455 |
T2448 |
T2443 |
compound |
cell,line |
R1456 |
T2449 |
T2443 |
punct |
),line |
R1457 |
T2450 |
T2441 |
auxpass |
were,electroporated |
R1458 |
T2451 |
T2441 |
prep |
with,electroporated |
R1459 |
T2452 |
T2453 |
det |
the,DNA |
R1460 |
T2453 |
T2451 |
pobj |
DNA,with |
R1461 |
T2454 |
T2455 |
amod |
linearized,vector |
R1462 |
T2455 |
T2453 |
compound |
vector,DNA |
R1463 |
T2456 |
T2455 |
compound |
targeting,vector |
R1464 |
T2457 |
T2441 |
cc |
and,electroporated |
R1465 |
T2458 |
T2441 |
conj |
cultured,electroporated |
R1466 |
T2459 |
T2458 |
prep |
on,cultured |
R1467 |
T2460 |
T2461 |
amod |
sub-confluent,fibroblasts |
R1468 |
T2461 |
T2459 |
pobj |
fibroblasts,on |
R1469 |
T2462 |
T2461 |
amod |
embryonic,fibroblasts |
R1470 |
T2463 |
T2441 |
punct |
.,electroporated |
R1471 |
T2465 |
T2466 |
amod |
Transfected,colonies |
R1472 |
T2466 |
T2468 |
nsubjpass |
colonies,selected |
R1473 |
T2467 |
T2466 |
compound |
cell,colonies |
R1474 |
T2469 |
T2468 |
auxpass |
were,selected |
R1475 |
T2470 |
T2468 |
agent |
by,selected |
R1476 |
T2471 |
T2470 |
pcomp |
culturing,by |
R1477 |
T2472 |
T2471 |
dobj |
cells,culturing |
R1478 |
T2473 |
T2471 |
prep |
in,culturing |
R1479 |
T2474 |
T2473 |
pobj |
medium,in |
R1480 |
T2475 |
T2474 |
acl |
containing,medium |
R1481 |
T2476 |
T2477 |
nummod |
200,μg |
R1482 |
T2477 |
T2478 |
nmod |
μg,G418 |
R1483 |
T2478 |
T2475 |
dobj |
G418,containing |
R1484 |
T2479 |
T2480 |
punct |
/,mL |
R1485 |
T2480 |
T2477 |
prep |
mL,μg |
R1486 |
T2481 |
T2482 |
punct |
(,Technologies |
R1487 |
T2482 |
T2478 |
parataxis |
Technologies,G418 |
R1488 |
T2483 |
T2482 |
compound |
Life,Technologies |
R1489 |
T2484 |
T2482 |
punct |
", ",Technologies |
R1490 |
T2485 |
T2482 |
npadvmod |
Rockville,Technologies |
R1491 |
T2486 |
T2482 |
punct |
", ",Technologies |
R1492 |
T2487 |
T2482 |
npadvmod |
MD,Technologies |
R1493 |
T2488 |
T2482 |
punct |
", ",Technologies |
R1494 |
T2489 |
T2482 |
npadvmod |
USA,Technologies |
R1495 |
T2490 |
T2482 |
punct |
),Technologies |
R1496 |
T2491 |
T2468 |
punct |
.,selected |
R1497 |
T2493 |
T2494 |
det |
The,cells |
R1498 |
T2494 |
T2496 |
nsubjpass |
cells,screened |
R1499 |
T2495 |
T2494 |
compound |
ES,cells |
R1500 |
T2497 |
T2496 |
auxpass |
were,screened |
R1501 |
T2498 |
T2496 |
prep |
for,screened |
R1502 |
T2499 |
T2500 |
amod |
homologous,recombination |
R1503 |
T2500 |
T2498 |
pobj |
recombination,for |
R1504 |
T2501 |
T2496 |
prep |
by,screened |
R1505 |
T2502 |
T2501 |
pobj |
PCR,by |
R1506 |
T2503 |
T2496 |
prep |
with,screened |
R1507 |
T2504 |
T2505 |
det |
the,primer |
R1508 |
T2505 |
T2503 |
pobj |
primer,with |
R1509 |
T2506 |
T2505 |
amod |
forward,primer |
R1510 |
T2507 |
T2505 |
punct |
", ",primer |
R1511 |
T2508 |
T2505 |
appos |
neoF,primer |
R1512 |
T2509 |
T2508 |
punct |
(,neoF |
R1513 |
T2510 |
T2511 |
nummod |
5,GGGTCGTTTGTTCGGATCAA |
R1514 |
T2511 |
T2508 |
appos |
GGGTCGTTTGTTCGGATCAA,neoF |
R1515 |
T2512 |
T2511 |
punct |
',GGGTCGTTTGTTCGGATCAA |
R1516 |
T2513 |
T2511 |
punct |
-,GGGTCGTTTGTTCGGATCAA |
R1517 |
T2514 |
T2511 |
punct |
-,GGGTCGTTTGTTCGGATCAA |
R1518 |
T2515 |
T2511 |
nummod |
3,GGGTCGTTTGTTCGGATCAA |
R1519 |
T2516 |
T2511 |
punct |
',GGGTCGTTTGTTCGGATCAA |
R1520 |
T2517 |
T2508 |
punct |
),neoF |
R1521 |
T2518 |
T2508 |
prep |
from,neoF |
R1522 |
T2519 |
T2520 |
compound |
neo,cassette |
R1523 |
T2520 |
T2518 |
pobj |
cassette,from |
R1524 |
T2521 |
T2505 |
punct |
", ",primer |
R1525 |
T2522 |
T2505 |
cc |
and,primer |
R1526 |
T2523 |
T2524 |
amod |
reverse,primer |
R1527 |
T2524 |
T2525 |
compound |
primer,6R |
R1528 |
T2525 |
T2505 |
conj |
6R,primer |
R1529 |
T2526 |
T2525 |
compound |
intron,6R |
R1530 |
T2527 |
T2525 |
punct |
(,6R |
R1531 |
T2528 |
T2529 |
nummod |
5,ACCAGTTGGTCCTAGCTCGA |
R1532 |
T2529 |
T2525 |
appos |
ACCAGTTGGTCCTAGCTCGA,6R |
R1533 |
T2530 |
T2528 |
punct |
',5 |
R1534 |
T2531 |
T2529 |
punct |
-,ACCAGTTGGTCCTAGCTCGA |
R1535 |
T2532 |
T2529 |
punct |
-,ACCAGTTGGTCCTAGCTCGA |
R1536 |
T2533 |
T2529 |
nummod |
3,ACCAGTTGGTCCTAGCTCGA |
R1537 |
T2534 |
T2529 |
punct |
',ACCAGTTGGTCCTAGCTCGA |
R1538 |
T2535 |
T2525 |
punct |
),6R |
R1539 |
T2536 |
T2525 |
punct |
", ",6R |
R1540 |
T2537 |
T2538 |
dep |
which,located |
R1541 |
T2538 |
T2525 |
relcl |
located,6R |
R1542 |
T2539 |
T2538 |
auxpass |
is,located |
R1543 |
T2540 |
T2538 |
prep |
outside,located |
R1544 |
T2541 |
T2542 |
det |
the,construct |
R1545 |
T2542 |
T2540 |
pobj |
construct,outside |
R1546 |
T2543 |
T2542 |
amod |
targeting,construct |
R1547 |
T2544 |
T2538 |
prep |
in,located |
R1548 |
T2545 |
T2546 |
compound |
mouse,intron |
R1549 |
T2546 |
T2544 |
pobj |
intron,in |
R1550 |
T2547 |
T2546 |
compound |
Abcg8,intron |
R1551 |
T2548 |
T2546 |
nummod |
6,intron |
R1552 |
T2549 |
T2496 |
punct |
.,screened |
R1553 |
T2551 |
T2552 |
advmod |
Positively,targeted |
R1554 |
T2552 |
T2553 |
amod |
targeted,clones |
R1555 |
T2553 |
T2556 |
nsubjpass |
clones,confirmed |
R1556 |
T2554 |
T2555 |
compound |
ES,cell |
R1557 |
T2555 |
T2553 |
compound |
cell,clones |
R1558 |
T2557 |
T2556 |
auxpass |
were,confirmed |
R1559 |
T2558 |
T2556 |
prep |
by,confirmed |
R1560 |
T2559 |
T2560 |
compound |
Southern,blotting |
R1561 |
T2560 |
T2558 |
pobj |
blotting,by |
R1562 |
T2561 |
T2556 |
punct |
", ",confirmed |
R1563 |
T2562 |
T2556 |
advcl |
using,confirmed |
R1564 |
T2563 |
T2564 |
compound |
ES,cell |
R1565 |
T2564 |
T2565 |
compound |
cell,DNA |
R1566 |
T2565 |
T2562 |
dobj |
DNA,using |
R1567 |
T2566 |
T2565 |
acl |
digested,DNA |
R1568 |
T2567 |
T2566 |
prep |
by,digested |
R1569 |
T2568 |
T2567 |
pobj |
BamHI,by |
R1570 |
T2569 |
T2568 |
cc |
and,BamHI |
R1571 |
T2570 |
T2571 |
det |
a,probe |
R1572 |
T2571 |
T2568 |
conj |
probe,BamHI |
R1573 |
T2572 |
T2571 |
acl |
comprising,probe |
R1574 |
T2573 |
T2572 |
prep |
of,comprising |
R1575 |
T2574 |
T2575 |
det |
a,fragment |
R1576 |
T2575 |
T2573 |
pobj |
fragment,of |
R1577 |
T2576 |
T2577 |
nummod |
562,bp |
R1578 |
T2577 |
T2575 |
compound |
bp,fragment |
R1579 |
T2578 |
T2575 |
compound |
PCR,fragment |
R1580 |
T2579 |
T2575 |
prep |
from,fragment |
R1581 |
T2580 |
T2581 |
amod |
partial,intron |
R1582 |
T2581 |
T2579 |
pobj |
intron,from |
R1583 |
T2582 |
T2581 |
nummod |
2,intron |
R1584 |
T2583 |
T2581 |
cc |
and,intron |
R1585 |
T2584 |
T2581 |
conj |
exon,intron |
R1586 |
T2585 |
T2584 |
nummod |
3,exon |
R1587 |
T2586 |
T2581 |
prep |
of,intron |
R1588 |
T2587 |
T2588 |
compound |
Abcg8,gene |
R1589 |
T2588 |
T2586 |
pobj |
gene,of |
R1590 |
T2589 |
T2556 |
punct |
.,confirmed |
R1591 |
T2591 |
T2592 |
advmod |
Positively,targeted |
R1592 |
T2592 |
T2593 |
amod |
targeted,cells |
R1593 |
T2593 |
T2595 |
nsubjpass |
cells,microinjected |
R1594 |
T2594 |
T2593 |
compound |
ES,cells |
R1595 |
T2596 |
T2595 |
auxpass |
were,microinjected |
R1596 |
T2597 |
T2595 |
prep |
into,microinjected |
R1597 |
T2598 |
T2599 |
compound |
C57BL6,blastocysts |
R1598 |
T2599 |
T2597 |
pobj |
blastocysts,into |
R1599 |
T2600 |
T2595 |
cc |
and,microinjected |
R1600 |
T2601 |
T2595 |
conj |
transplanted,microinjected |
R1601 |
T2602 |
T2601 |
prep |
into,transplanted |
R1602 |
T2603 |
T2604 |
amod |
pseudopregnant,recipients |
R1603 |
T2604 |
T2602 |
pobj |
recipients,into |
R1604 |
T2605 |
T2595 |
punct |
.,microinjected |
R1605 |
T2607 |
T2608 |
nummod |
Five,mice |
R1606 |
T2608 |
T2611 |
nsubjpass |
mice,isolated |
R1607 |
T2609 |
T2610 |
advmod |
highly,chimeric |
R1608 |
T2610 |
T2608 |
amod |
chimeric,mice |
R1609 |
T2612 |
T2613 |
punct |
(,males |
R1610 |
T2613 |
T2608 |
parataxis |
males,mice |
R1611 |
T2614 |
T2615 |
amod |
agouti,color |
R1612 |
T2615 |
T2613 |
dep |
color,males |
R1613 |
T2616 |
T2615 |
compound |
coat,color |
R1614 |
T2617 |
T2613 |
punct |
", ",males |
R1615 |
T2618 |
T2613 |
nummod |
three,males |
R1616 |
T2619 |
T2613 |
cc |
and,males |
R1617 |
T2620 |
T2621 |
nummod |
two,females |
R1618 |
T2621 |
T2613 |
conj |
females,males |
R1619 |
T2622 |
T2613 |
punct |
),males |
R1620 |
T2623 |
T2611 |
auxpass |
were,isolated |
R1621 |
T2624 |
T2611 |
cc |
and,isolated |
R1622 |
T2625 |
T2611 |
conj |
bred,isolated |
R1623 |
T2626 |
T2625 |
prep |
with,bred |
R1624 |
T2627 |
T2628 |
compound |
C57BL,6J |
R1625 |
T2628 |
T2630 |
compound |
6J,mice |
R1626 |
T2629 |
T2628 |
punct |
/,6J |
R1627 |
T2630 |
T2626 |
pobj |
mice,with |
R1628 |
T2631 |
T2632 |
aux |
to,generate |
R1629 |
T2632 |
T2625 |
advcl |
generate,bred |
R1630 |
T2633 |
T2634 |
compound |
germ,line |
R1631 |
T2634 |
T2636 |
compound |
line,transmission |
R1632 |
T2635 |
T2634 |
punct |
-,line |
R1633 |
T2636 |
T2637 |
npadvmod |
transmission,heterozygous |
R1634 |
T2637 |
T2638 |
amod |
heterozygous,mice |
R1635 |
T2638 |
T2632 |
dobj |
mice,generate |
R1636 |
T2639 |
T2638 |
prep |
of,mice |
R1637 |
T2640 |
T2641 |
compound |
Abcg8,gene |
R1638 |
T2641 |
T2642 |
compound |
gene,disruption |
R1639 |
T2642 |
T2639 |
pobj |
disruption,of |
R1640 |
T2643 |
T2611 |
punct |
.,isolated |
R1641 |
T2645 |
T2646 |
amod |
Heterozygous,mice |
R1642 |
T2646 |
T2648 |
nsubjpass |
mice,crossed |
R1643 |
T2647 |
T2646 |
compound |
offspring,mice |
R1644 |
T2649 |
T2648 |
auxpass |
were,crossed |
R1645 |
T2650 |
T2648 |
advmod |
back,crossed |
R1646 |
T2651 |
T2648 |
punct |
-,crossed |
R1647 |
T2652 |
T2648 |
prep |
to,crossed |
R1648 |
T2653 |
T2654 |
compound |
C57BL,6J |
R1649 |
T2654 |
T2656 |
compound |
6J,mice |
R1650 |
T2655 |
T2654 |
punct |
/,6J |
R1651 |
T2656 |
T2652 |
pobj |
mice,to |
R1652 |
T2657 |
T2658 |
punct |
(,5 |
R1653 |
T2658 |
T2656 |
parataxis |
5,mice |
R1654 |
T2659 |
T2658 |
nsubj |
n,5 |
R1655 |
T2660 |
T2658 |
punct |
>,5 |
R1656 |
T2661 |
T2658 |
punct |
),5 |
R1657 |
T2662 |
T2663 |
aux |
to,produce |
R1658 |
T2663 |
T2648 |
advcl |
produce,crossed |
R1659 |
T2664 |
T2665 |
amod |
disrupted,line |
R1660 |
T2665 |
T2663 |
dobj |
line,produce |
R1661 |
T2666 |
T2648 |
cc |
and,crossed |
R1662 |
T2667 |
T2648 |
conj |
inter-crossed,crossed |
R1663 |
T2668 |
T2669 |
aux |
to,generate |
R1664 |
T2669 |
T2667 |
advcl |
generate,inter-crossed |
R1665 |
T2670 |
T2671 |
compound |
knockout,mice |
R1666 |
T2671 |
T2669 |
dobj |
mice,generate |
R1667 |
T2672 |
T2648 |
punct |
.,crossed |