| Id |
Subject |
Object |
Predicate |
Lexical cue |
| T12809 |
0-7 |
JJ |
denotes |
Coronal |
| T12810 |
8-16 |
NNS |
denotes |
sections |
| T12812 |
17-21 |
VBD |
denotes |
were |
| T12811 |
22-25 |
VBN |
denotes |
cut |
| T12813 |
26-30 |
IN |
denotes |
from |
| T12814 |
31-34 |
DT |
denotes |
the |
| T12816 |
35-44 |
JJ |
denotes |
olfactory |
| T12815 |
45-54 |
NNS |
denotes |
epithelia |
| T12817 |
55-57 |
IN |
denotes |
of |
| T12818 |
58-60 |
DT |
denotes |
an |
| T12820 |
61-66 |
JJ |
denotes |
adult |
| T12819 |
67-72 |
NN |
denotes |
mouse |
| T12821 |
73-74 |
-LRB- |
denotes |
( |
| T12822 |
74-80 |
NN |
denotes |
Figure |
| T12823 |
81-82 |
CD |
denotes |
4 |
| T12824 |
82-83 |
-RRB- |
denotes |
) |
| T12825 |
84-87 |
CC |
denotes |
and |
| T12826 |
88-89 |
DT |
denotes |
a |
| T12828 |
90-95 |
JJ |
denotes |
young |
| T12829 |
96-97 |
-LRB- |
denotes |
( |
| T12830 |
97-99 |
NN |
denotes |
P6 |
| T12831 |
99-100 |
-RRB- |
denotes |
) |
| T12832 |
101-106 |
NN |
denotes |
C57BL |
| T12833 |
106-107 |
HYPH |
denotes |
/ |
| T12834 |
107-108 |
CD |
denotes |
6 |
| T12827 |
109-114 |
NN |
denotes |
mouse |
| T12835 |
114-115 |
. |
denotes |
. |
| T12836 |
115-310 |
sentence |
denotes |
RNA in situ hybridization was carried out as described previously [15,53] with digoxigenin-labeled antisense riboprobes specific for the 3' UTRs of genes AY318555 (0.5 kb) and AY317365 (0.5 kb). |
| T12837 |
116-119 |
NN |
denotes |
RNA |
| T12839 |
120-122 |
FW |
denotes |
in |
| T12840 |
123-127 |
FW |
denotes |
situ |
| T12838 |
128-141 |
NN |
denotes |
hybridization |
| T12842 |
142-145 |
VBD |
denotes |
was |
| T12841 |
146-153 |
VBN |
denotes |
carried |
| T12843 |
154-157 |
RP |
denotes |
out |
| T12844 |
158-160 |
IN |
denotes |
as |
| T12845 |
161-170 |
VBN |
denotes |
described |
| T12846 |
171-181 |
RB |
denotes |
previously |
| T12847 |
182-183 |
-LRB- |
denotes |
[ |
| T12849 |
183-185 |
CD |
denotes |
15 |
| T12850 |
185-186 |
, |
denotes |
, |
| T12848 |
186-188 |
CD |
denotes |
53 |
| T12851 |
188-189 |
-RRB- |
denotes |
] |
| T12852 |
190-194 |
IN |
denotes |
with |
| T12853 |
195-206 |
NN |
denotes |
digoxigenin |
| T12855 |
206-207 |
HYPH |
denotes |
- |
| T12854 |
207-214 |
VBN |
denotes |
labeled |
| T12857 |
215-224 |
JJ |
denotes |
antisense |
| T12856 |
225-235 |
NNS |
denotes |
riboprobes |
| T12858 |
236-244 |
JJ |
denotes |
specific |
| T12859 |
245-248 |
IN |
denotes |
for |
| T12860 |
249-252 |
DT |
denotes |
the |
| T12862 |
253-254 |
CD |
denotes |
3 |
| T12863 |
254-255 |
SYM |
denotes |
' |
| T12861 |
256-260 |
NNS |
denotes |
UTRs |
| T12864 |
261-263 |
IN |
denotes |
of |
| T12865 |
264-269 |
NNS |
denotes |
genes |
| T12866 |
270-278 |
NN |
denotes |
AY318555 |
| T12867 |
279-280 |
-LRB- |
denotes |
( |
| T12869 |
280-283 |
CD |
denotes |
0.5 |
| T12868 |
284-286 |
NN |
denotes |
kb |
| T12870 |
286-287 |
-RRB- |
denotes |
) |
| T12871 |
288-291 |
CC |
denotes |
and |
| T12872 |
292-300 |
NN |
denotes |
AY317365 |
| T12873 |
301-302 |
-LRB- |
denotes |
( |
| T12875 |
302-305 |
CD |
denotes |
0.5 |
| T12874 |
306-308 |
NN |
denotes |
kb |
| T12876 |
308-309 |
-RRB- |
denotes |
) |
| T12877 |
309-310 |
. |
denotes |
. |
| T12878 |
310-544 |
sentence |
denotes |
Riboprobe sequences were generated by PCR using primer pairs 5'-TCTTCCAAACCTGGACCCCCC-3' and 5'-ATCTCTCCAGCACCTTACTTG-3' for AY318555 and primer pairs 5'-TAAGATGTAAGTGATAATTTAGATTACAGG-3' and 5'-TTTCTGCCTCAGCTATGACAG-3' for AY317365. |
| T12879 |
311-320 |
NN |
denotes |
Riboprobe |
| T12880 |
321-330 |
NNS |
denotes |
sequences |
| T12882 |
331-335 |
VBD |
denotes |
were |
| T12881 |
336-345 |
VBN |
denotes |
generated |
| T12883 |
346-348 |
IN |
denotes |
by |
| T12884 |
349-352 |
NN |
denotes |
PCR |
| T12885 |
353-358 |
VBG |
denotes |
using |
| T12886 |
359-365 |
NN |
denotes |
primer |
| T12887 |
366-371 |
NNS |
denotes |
pairs |
| T12888 |
372-373 |
CD |
denotes |
5 |
| T12890 |
373-374 |
SYM |
denotes |
' |
| T12891 |
374-375 |
HYPH |
denotes |
- |
| T12889 |
375-396 |
NN |
denotes |
TCTTCCAAACCTGGACCCCCC |
| T12892 |
396-397 |
HYPH |
denotes |
- |
| T12893 |
397-398 |
CD |
denotes |
3 |
| T12894 |
398-399 |
SYM |
denotes |
' |
| T12895 |
400-403 |
CC |
denotes |
and |
| T12896 |
404-405 |
CD |
denotes |
5 |
| T12898 |
405-406 |
SYM |
denotes |
' |
| T12899 |
406-407 |
HYPH |
denotes |
- |
| T12897 |
407-428 |
NN |
denotes |
ATCTCTCCAGCACCTTACTTG |
| T12900 |
428-429 |
HYPH |
denotes |
- |
| T12901 |
429-430 |
CD |
denotes |
3 |
| T12902 |
430-431 |
SYM |
denotes |
' |
| T12903 |
432-435 |
IN |
denotes |
for |
| T12904 |
436-444 |
NN |
denotes |
AY318555 |
| T12905 |
445-448 |
CC |
denotes |
and |
| T12906 |
449-455 |
NN |
denotes |
primer |
| T12907 |
456-461 |
NNS |
denotes |
pairs |
| T12908 |
462-463 |
CD |
denotes |
5 |
| T12910 |
463-464 |
SYM |
denotes |
' |
| T12911 |
464-465 |
HYPH |
denotes |
- |
| T12909 |
465-495 |
NN |
denotes |
TAAGATGTAAGTGATAATTTAGATTACAGG |
| T12912 |
495-496 |
HYPH |
denotes |
- |
| T12913 |
496-497 |
CD |
denotes |
3 |
| T12914 |
497-498 |
SYM |
denotes |
' |
| T12915 |
499-502 |
CC |
denotes |
and |
| T12916 |
503-504 |
CD |
denotes |
5 |
| T12918 |
504-505 |
SYM |
denotes |
' |
| T12919 |
505-506 |
HYPH |
denotes |
- |
| T12917 |
506-527 |
NN |
denotes |
TTTCTGCCTCAGCTATGACAG |
| T12920 |
527-528 |
HYPH |
denotes |
- |
| T12921 |
528-529 |
CD |
denotes |
3 |
| T12922 |
529-530 |
SYM |
denotes |
' |
| T12923 |
531-534 |
IN |
denotes |
for |
| T12924 |
535-543 |
NN |
denotes |
AY317365 |
| T12925 |
543-544 |
. |
denotes |
. |
| T12926 |
544-661 |
sentence |
denotes |
Hybridization was carried out in 50% formamide at 65°C, and slides were washed at high stringency (65°C, 0.2 × SSC). |
| T12927 |
545-558 |
NN |
denotes |
Hybridization |
| T12929 |
559-562 |
VBD |
denotes |
was |
| T12928 |
563-570 |
VBN |
denotes |
carried |
| T12930 |
571-574 |
RP |
denotes |
out |
| T12931 |
575-577 |
IN |
denotes |
in |
| T12932 |
578-580 |
CD |
denotes |
50 |
| T12933 |
580-581 |
NN |
denotes |
% |
| T12934 |
582-591 |
NN |
denotes |
formamide |
| T12935 |
592-594 |
IN |
denotes |
at |
| T12936 |
595-597 |
CD |
denotes |
65 |
| T12937 |
597-599 |
NNS |
denotes |
°C |
| T12938 |
599-601 |
, |
denotes |
, |
| T12939 |
601-604 |
CC |
denotes |
and |
| T12940 |
605-611 |
NNS |
denotes |
slides |
| T12942 |
612-616 |
VBD |
denotes |
were |
| T12941 |
617-623 |
VBN |
denotes |
washed |
| T12943 |
624-626 |
IN |
denotes |
at |
| T12944 |
627-631 |
JJ |
denotes |
high |
| T12945 |
632-642 |
NN |
denotes |
stringency |
| T12946 |
643-644 |
-LRB- |
denotes |
( |
| T12948 |
644-646 |
CD |
denotes |
65 |
| T12947 |
646-648 |
NNS |
denotes |
°C |
| T12949 |
648-650 |
, |
denotes |
, |
| T12950 |
650-653 |
CD |
denotes |
0.2 |
| T12952 |
654-655 |
SYM |
denotes |
× |
| T12951 |
656-659 |
NN |
denotes |
SSC |
| T12953 |
659-660 |
-RRB- |
denotes |
) |
| T12954 |
660-661 |
. |
denotes |
. |
| T12955 |
661-793 |
sentence |
denotes |
The probes each hybridize to only one band on a Southern blot, indicating that each probe only detects one olfactory receptor gene. |
| T12956 |
662-665 |
DT |
denotes |
The |
| T12957 |
666-672 |
NNS |
denotes |
probes |
| T12959 |
673-677 |
DT |
denotes |
each |
| T12958 |
678-687 |
VBP |
denotes |
hybridize |
| T12960 |
688-690 |
IN |
denotes |
to |
| T12961 |
691-695 |
RB |
denotes |
only |
| T12963 |
696-699 |
CD |
denotes |
one |
| T12962 |
700-704 |
NN |
denotes |
band |
| T12964 |
705-707 |
IN |
denotes |
on |
| T12965 |
708-709 |
DT |
denotes |
a |
| T12967 |
710-718 |
NNP |
denotes |
Southern |
| T12966 |
719-723 |
NN |
denotes |
blot |
| T12968 |
723-725 |
, |
denotes |
, |
| T12969 |
725-735 |
VBG |
denotes |
indicating |
| T12970 |
736-740 |
IN |
denotes |
that |
| T12972 |
741-745 |
DT |
denotes |
each |
| T12973 |
746-751 |
NN |
denotes |
probe |
| T12974 |
752-756 |
RB |
denotes |
only |
| T12971 |
757-764 |
VBZ |
denotes |
detects |
| T12975 |
765-768 |
CD |
denotes |
one |
| T12977 |
769-778 |
JJ |
denotes |
olfactory |
| T12978 |
779-787 |
NN |
denotes |
receptor |
| T12976 |
788-792 |
NN |
denotes |
gene |
| T12979 |
792-793 |
. |
denotes |
. |
| T12980 |
793-968 |
sentence |
denotes |
BLAST analyses show that the AY318555 probe is unique in Celera's mouse genome assembly (Release 13), and that the AY317365 probe is similar to only one other genomic region. |
| T12981 |
794-799 |
NN |
denotes |
BLAST |
| T12982 |
800-808 |
NNS |
denotes |
analyses |
| T12983 |
809-813 |
VBP |
denotes |
show |
| T12984 |
814-818 |
IN |
denotes |
that |
| T12986 |
819-822 |
DT |
denotes |
the |
| T12988 |
823-831 |
NN |
denotes |
AY318555 |
| T12987 |
832-837 |
NN |
denotes |
probe |
| T12985 |
838-840 |
VBZ |
denotes |
is |
| T12989 |
841-847 |
JJ |
denotes |
unique |
| T12990 |
848-850 |
IN |
denotes |
in |
| T12991 |
851-857 |
NNP |
denotes |
Celera |
| T12993 |
857-859 |
POS |
denotes |
's |
| T12994 |
860-865 |
NN |
denotes |
mouse |
| T12995 |
866-872 |
NN |
denotes |
genome |
| T12992 |
873-881 |
NN |
denotes |
assembly |
| T12996 |
882-883 |
-LRB- |
denotes |
( |
| T12997 |
883-890 |
NN |
denotes |
Release |
| T12998 |
891-893 |
CD |
denotes |
13 |
| T12999 |
893-894 |
-RRB- |
denotes |
) |
| T13000 |
894-896 |
, |
denotes |
, |
| T13001 |
896-899 |
CC |
denotes |
and |
| T13002 |
900-904 |
IN |
denotes |
that |
| T13004 |
905-908 |
DT |
denotes |
the |
| T13006 |
909-917 |
NN |
denotes |
AY317365 |
| T13005 |
918-923 |
NN |
denotes |
probe |
| T13003 |
924-926 |
VBZ |
denotes |
is |
| T13007 |
927-934 |
JJ |
denotes |
similar |
| T13008 |
935-937 |
IN |
denotes |
to |
| T13009 |
938-942 |
RB |
denotes |
only |
| T13011 |
943-946 |
CD |
denotes |
one |
| T13012 |
947-952 |
JJ |
denotes |
other |
| T13013 |
953-960 |
JJ |
denotes |
genomic |
| T13010 |
961-967 |
NN |
denotes |
region |
| T13014 |
967-968 |
. |
denotes |
. |
| T13015 |
968-1153 |
sentence |
denotes |
This potential cross-hybridizing region is over 10 Mb from the nearest olfactory receptor coding region and is thus highly unlikely to be included in any olfactory receptor transcript. |
| T13016 |
969-973 |
DT |
denotes |
This |
| T13018 |
974-983 |
JJ |
denotes |
potential |
| T13019 |
984-1001 |
JJ |
denotes |
cross-hybridizing |
| T13017 |
1002-1008 |
NN |
denotes |
region |
| T13020 |
1009-1011 |
VBZ |
denotes |
is |
| T13021 |
1012-1016 |
IN |
denotes |
over |
| T13022 |
1017-1019 |
CD |
denotes |
10 |
| T13023 |
1020-1022 |
NNS |
denotes |
Mb |
| T13024 |
1023-1027 |
IN |
denotes |
from |
| T13025 |
1028-1031 |
DT |
denotes |
the |
| T13027 |
1032-1039 |
JJS |
denotes |
nearest |
| T13028 |
1040-1049 |
JJ |
denotes |
olfactory |
| T13029 |
1050-1058 |
NN |
denotes |
receptor |
| T13030 |
1059-1065 |
NN |
denotes |
coding |
| T13026 |
1066-1072 |
NN |
denotes |
region |
| T13031 |
1073-1076 |
CC |
denotes |
and |
| T13032 |
1077-1079 |
VBZ |
denotes |
is |
| T13033 |
1080-1084 |
RB |
denotes |
thus |
| T13034 |
1085-1091 |
RB |
denotes |
highly |
| T13035 |
1092-1100 |
JJ |
denotes |
unlikely |
| T13036 |
1101-1103 |
TO |
denotes |
to |
| T13038 |
1104-1106 |
VB |
denotes |
be |
| T13037 |
1107-1115 |
VBN |
denotes |
included |
| T13039 |
1116-1118 |
IN |
denotes |
in |
| T13040 |
1119-1122 |
DT |
denotes |
any |
| T13042 |
1123-1132 |
JJ |
denotes |
olfactory |
| T13043 |
1133-1141 |
NN |
denotes |
receptor |
| T13041 |
1142-1152 |
NN |
denotes |
transcript |
| T13044 |
1152-1153 |
. |
denotes |
. |
| T13045 |
1153-1256 |
sentence |
denotes |
Low-power images are composed of three overlapping micrographs (40×) assembled in Adobe Photoshop 7.0. |
| T13046 |
1154-1157 |
JJ |
denotes |
Low |
| T13048 |
1157-1158 |
HYPH |
denotes |
- |
| T13047 |
1158-1163 |
NN |
denotes |
power |
| T13049 |
1164-1170 |
NNS |
denotes |
images |
| T13051 |
1171-1174 |
VBP |
denotes |
are |
| T13050 |
1175-1183 |
VBN |
denotes |
composed |
| T13052 |
1184-1186 |
IN |
denotes |
of |
| T13053 |
1187-1192 |
CD |
denotes |
three |
| T13055 |
1193-1204 |
VBG |
denotes |
overlapping |
| T13054 |
1205-1216 |
NNS |
denotes |
micrographs |
| T13056 |
1217-1218 |
-LRB- |
denotes |
( |
| T13057 |
1218-1220 |
CD |
denotes |
40 |
| T13058 |
1220-1221 |
SYM |
denotes |
× |
| T13059 |
1221-1222 |
-RRB- |
denotes |
) |
| T13060 |
1223-1232 |
VBN |
denotes |
assembled |
| T13061 |
1233-1235 |
IN |
denotes |
in |
| T13062 |
1236-1241 |
NNP |
denotes |
Adobe |
| T13063 |
1242-1251 |
NN |
denotes |
Photoshop |
| T13064 |
1252-1255 |
CD |
denotes |
7.0 |
| T13065 |
1255-1256 |
. |
denotes |
. |
| R8161 |
T12809 |
T12810 |
amod |
Coronal,sections |
| R8162 |
T12810 |
T12811 |
nsubjpass |
sections,cut |
| R8163 |
T12812 |
T12811 |
auxpass |
were,cut |
| R8164 |
T12813 |
T12811 |
prep |
from,cut |
| R8165 |
T12814 |
T12815 |
det |
the,epithelia |
| R8166 |
T12815 |
T12813 |
pobj |
epithelia,from |
| R8167 |
T12816 |
T12815 |
amod |
olfactory,epithelia |
| R8168 |
T12817 |
T12815 |
prep |
of,epithelia |
| R8169 |
T12818 |
T12819 |
det |
an,mouse |
| R8170 |
T12819 |
T12817 |
pobj |
mouse,of |
| R8171 |
T12820 |
T12819 |
amod |
adult,mouse |
| R8172 |
T12821 |
T12822 |
punct |
(,Figure |
| R8173 |
T12822 |
T12819 |
parataxis |
Figure,mouse |
| R8174 |
T12823 |
T12822 |
nummod |
4,Figure |
| R8175 |
T12824 |
T12822 |
punct |
),Figure |
| R8176 |
T12825 |
T12819 |
cc |
and,mouse |
| R8177 |
T12826 |
T12827 |
det |
a,mouse |
| R8178 |
T12827 |
T12819 |
conj |
mouse,mouse |
| R8179 |
T12828 |
T12827 |
amod |
young,mouse |
| R8180 |
T12829 |
T12830 |
punct |
(,P6 |
| R8181 |
T12830 |
T12828 |
parataxis |
P6,young |
| R8182 |
T12831 |
T12830 |
punct |
),P6 |
| R8183 |
T12832 |
T12827 |
nmod |
C57BL,mouse |
| R8184 |
T12833 |
T12832 |
punct |
/,C57BL |
| R8185 |
T12834 |
T12832 |
nummod |
6,C57BL |
| R8186 |
T12835 |
T12811 |
punct |
.,cut |
| R8187 |
T12837 |
T12838 |
nmod |
RNA,hybridization |
| R8188 |
T12838 |
T12841 |
nsubjpass |
hybridization,carried |
| R8189 |
T12839 |
T12840 |
advmod |
in,situ |
| R8190 |
T12840 |
T12838 |
amod |
situ,hybridization |
| R8191 |
T12842 |
T12841 |
auxpass |
was,carried |
| R8192 |
T12843 |
T12841 |
prt |
out,carried |
| R8193 |
T12844 |
T12845 |
mark |
as,described |
| R8194 |
T12845 |
T12841 |
advcl |
described,carried |
| R8195 |
T12846 |
T12845 |
advmod |
previously,described |
| R8196 |
T12847 |
T12848 |
punct |
[,53 |
| R8197 |
T12848 |
T12845 |
parataxis |
53,described |
| R8198 |
T12849 |
T12848 |
nummod |
15,53 |
| R8199 |
T12850 |
T12848 |
punct |
",",53 |
| R8200 |
T12851 |
T12848 |
punct |
],53 |
| R8201 |
T12852 |
T12841 |
prep |
with,carried |
| R8202 |
T12853 |
T12854 |
npadvmod |
digoxigenin,labeled |
| R8203 |
T12854 |
T12856 |
amod |
labeled,riboprobes |
| R8204 |
T12855 |
T12854 |
punct |
-,labeled |
| R8205 |
T12856 |
T12852 |
pobj |
riboprobes,with |
| R8206 |
T12857 |
T12856 |
amod |
antisense,riboprobes |
| R8207 |
T12858 |
T12856 |
amod |
specific,riboprobes |
| R8208 |
T12859 |
T12858 |
prep |
for,specific |
| R8209 |
T12860 |
T12861 |
det |
the,UTRs |
| R8210 |
T12861 |
T12859 |
pobj |
UTRs,for |
| R8211 |
T12862 |
T12861 |
nummod |
3,UTRs |
| R8212 |
T12863 |
T12862 |
punct |
',3 |
| R8213 |
T12864 |
T12861 |
prep |
of,UTRs |
| R8214 |
T12865 |
T12866 |
compound |
genes,AY318555 |
| R8215 |
T12866 |
T12864 |
pobj |
AY318555,of |
| R8216 |
T12867 |
T12868 |
punct |
(,kb |
| R8217 |
T12868 |
T12866 |
parataxis |
kb,AY318555 |
| R8218 |
T12869 |
T12868 |
nummod |
0.5,kb |
| R8219 |
T12870 |
T12868 |
punct |
),kb |
| R8220 |
T12871 |
T12866 |
cc |
and,AY318555 |
| R8221 |
T12872 |
T12866 |
conj |
AY317365,AY318555 |
| R8222 |
T12873 |
T12874 |
punct |
(,kb |
| R8223 |
T12874 |
T12872 |
parataxis |
kb,AY317365 |
| R8224 |
T12875 |
T12874 |
nummod |
0.5,kb |
| R8225 |
T12876 |
T12874 |
punct |
),kb |
| R8226 |
T12877 |
T12841 |
punct |
.,carried |
| R8227 |
T12879 |
T12880 |
compound |
Riboprobe,sequences |
| R8228 |
T12880 |
T12881 |
nsubjpass |
sequences,generated |
| R8229 |
T12882 |
T12881 |
auxpass |
were,generated |
| R8230 |
T12883 |
T12881 |
prep |
by,generated |
| R8231 |
T12884 |
T12883 |
pobj |
PCR,by |
| R8232 |
T12885 |
T12881 |
advcl |
using,generated |
| R8233 |
T12886 |
T12887 |
compound |
primer,pairs |
| R8234 |
T12887 |
T12885 |
dobj |
pairs,using |
| R8235 |
T12888 |
T12889 |
nummod |
5,TCTTCCAAACCTGGACCCCCC |
| R8236 |
T12889 |
T12887 |
appos |
TCTTCCAAACCTGGACCCCCC,pairs |
| R8237 |
T12890 |
T12888 |
punct |
',5 |
| R8238 |
T12891 |
T12889 |
punct |
-,TCTTCCAAACCTGGACCCCCC |
| R8239 |
T12892 |
T12889 |
punct |
-,TCTTCCAAACCTGGACCCCCC |
| R8240 |
T12893 |
T12889 |
nummod |
3,TCTTCCAAACCTGGACCCCCC |
| R8241 |
T12894 |
T12889 |
punct |
',TCTTCCAAACCTGGACCCCCC |
| R8242 |
T12895 |
T12889 |
cc |
and,TCTTCCAAACCTGGACCCCCC |
| R8243 |
T12896 |
T12897 |
nummod |
5,ATCTCTCCAGCACCTTACTTG |
| R8244 |
T12897 |
T12889 |
conj |
ATCTCTCCAGCACCTTACTTG,TCTTCCAAACCTGGACCCCCC |
| R8245 |
T12898 |
T12896 |
punct |
',5 |
| R8246 |
T12899 |
T12897 |
punct |
-,ATCTCTCCAGCACCTTACTTG |
| R8247 |
T12900 |
T12897 |
punct |
-,ATCTCTCCAGCACCTTACTTG |
| R8248 |
T12901 |
T12897 |
nummod |
3,ATCTCTCCAGCACCTTACTTG |
| R8249 |
T12902 |
T12897 |
punct |
',ATCTCTCCAGCACCTTACTTG |
| R8250 |
T12903 |
T12885 |
prep |
for,using |
| R8251 |
T12904 |
T12903 |
pobj |
AY318555,for |
| R8252 |
T12905 |
T12885 |
cc |
and,using |
| R8253 |
T12906 |
T12907 |
compound |
primer,pairs |
| R8254 |
T12907 |
T12885 |
conj |
pairs,using |
| R8255 |
T12908 |
T12909 |
nummod |
5,TAAGATGTAAGTGATAATTTAGATTACAGG |
| R8256 |
T12909 |
T12907 |
appos |
TAAGATGTAAGTGATAATTTAGATTACAGG,pairs |
| R8257 |
T12910 |
T12908 |
punct |
',5 |
| R8258 |
T12911 |
T12909 |
punct |
-,TAAGATGTAAGTGATAATTTAGATTACAGG |
| R8259 |
T12912 |
T12909 |
punct |
-,TAAGATGTAAGTGATAATTTAGATTACAGG |
| R8260 |
T12913 |
T12909 |
nummod |
3,TAAGATGTAAGTGATAATTTAGATTACAGG |
| R8261 |
T12914 |
T12909 |
punct |
',TAAGATGTAAGTGATAATTTAGATTACAGG |
| R8262 |
T12915 |
T12909 |
cc |
and,TAAGATGTAAGTGATAATTTAGATTACAGG |
| R8263 |
T12916 |
T12917 |
nummod |
5,TTTCTGCCTCAGCTATGACAG |
| R8264 |
T12917 |
T12909 |
conj |
TTTCTGCCTCAGCTATGACAG,TAAGATGTAAGTGATAATTTAGATTACAGG |
| R8265 |
T12918 |
T12916 |
punct |
',5 |
| R8266 |
T12919 |
T12917 |
punct |
-,TTTCTGCCTCAGCTATGACAG |
| R8267 |
T12920 |
T12917 |
punct |
-,TTTCTGCCTCAGCTATGACAG |
| R8268 |
T12921 |
T12917 |
nummod |
3,TTTCTGCCTCAGCTATGACAG |
| R8269 |
T12922 |
T12917 |
punct |
',TTTCTGCCTCAGCTATGACAG |
| R8270 |
T12923 |
T12907 |
prep |
for,pairs |
| R8271 |
T12924 |
T12923 |
pobj |
AY317365,for |
| R8272 |
T12925 |
T12881 |
punct |
.,generated |
| R8273 |
T12927 |
T12928 |
nsubjpass |
Hybridization,carried |
| R8274 |
T12929 |
T12928 |
auxpass |
was,carried |
| R8275 |
T12930 |
T12928 |
prt |
out,carried |
| R8276 |
T12931 |
T12928 |
prep |
in,carried |
| R8277 |
T12932 |
T12933 |
nummod |
50,% |
| R8278 |
T12933 |
T12934 |
compound |
%,formamide |
| R8279 |
T12934 |
T12931 |
pobj |
formamide,in |
| R8280 |
T12935 |
T12928 |
prep |
at,carried |
| R8281 |
T12936 |
T12937 |
nummod |
65,°C |
| R8282 |
T12937 |
T12935 |
pobj |
°C,at |
| R8283 |
T12938 |
T12928 |
punct |
", ",carried |
| R8284 |
T12939 |
T12928 |
cc |
and,carried |
| R8285 |
T12940 |
T12941 |
nsubjpass |
slides,washed |
| R8286 |
T12941 |
T12928 |
conj |
washed,carried |
| R8287 |
T12942 |
T12941 |
auxpass |
were,washed |
| R8288 |
T12943 |
T12941 |
prep |
at,washed |
| R8289 |
T12944 |
T12945 |
amod |
high,stringency |
| R8290 |
T12945 |
T12943 |
pobj |
stringency,at |
| R8291 |
T12946 |
T12947 |
punct |
(,°C |
| R8292 |
T12947 |
T12945 |
parataxis |
°C,stringency |
| R8293 |
T12948 |
T12947 |
nummod |
65,°C |
| R8294 |
T12949 |
T12947 |
punct |
", ",°C |
| R8295 |
T12950 |
T12951 |
nsubj |
0.2,SSC |
| R8296 |
T12951 |
T12947 |
ccomp |
SSC,°C |
| R8297 |
T12952 |
T12951 |
punct |
×,SSC |
| R8298 |
T12953 |
T12947 |
punct |
),°C |
| R8299 |
T12954 |
T12941 |
punct |
.,washed |
| R8300 |
T12956 |
T12957 |
det |
The,probes |
| R8301 |
T12957 |
T12958 |
nsubj |
probes,hybridize |
| R8302 |
T12959 |
T12957 |
appos |
each,probes |
| R8303 |
T12960 |
T12958 |
prep |
to,hybridize |
| R8304 |
T12961 |
T12962 |
advmod |
only,band |
| R8305 |
T12962 |
T12960 |
pobj |
band,to |
| R8306 |
T12963 |
T12962 |
nummod |
one,band |
| R8307 |
T12964 |
T12962 |
prep |
on,band |
| R8308 |
T12965 |
T12966 |
det |
a,blot |
| R8309 |
T12966 |
T12964 |
pobj |
blot,on |
| R8310 |
T12967 |
T12966 |
compound |
Southern,blot |
| R8311 |
T12968 |
T12958 |
punct |
", ",hybridize |
| R8312 |
T12969 |
T12958 |
advcl |
indicating,hybridize |
| R8313 |
T12970 |
T12971 |
mark |
that,detects |
| R8314 |
T12971 |
T12969 |
ccomp |
detects,indicating |
| R8315 |
T12972 |
T12973 |
det |
each,probe |
| R8316 |
T12973 |
T12971 |
nsubj |
probe,detects |
| R8317 |
T12974 |
T12971 |
advmod |
only,detects |
| R8318 |
T12975 |
T12976 |
nummod |
one,gene |
| R8319 |
T12976 |
T12971 |
dobj |
gene,detects |
| R8320 |
T12977 |
T12978 |
amod |
olfactory,receptor |
| R8321 |
T12978 |
T12976 |
compound |
receptor,gene |
| R8322 |
T12979 |
T12958 |
punct |
.,hybridize |
| R8323 |
T12981 |
T12982 |
compound |
BLAST,analyses |
| R8324 |
T12982 |
T12983 |
nsubj |
analyses,show |
| R8325 |
T12984 |
T12985 |
mark |
that,is |
| R8326 |
T12985 |
T12983 |
advcl |
is,show |
| R8327 |
T12986 |
T12987 |
det |
the,probe |
| R8328 |
T12987 |
T12985 |
nsubj |
probe,is |
| R8329 |
T12988 |
T12987 |
compound |
AY318555,probe |
| R8330 |
T12989 |
T12985 |
acomp |
unique,is |
| R8331 |
T12990 |
T12985 |
prep |
in,is |
| R8332 |
T12991 |
T12992 |
poss |
Celera,assembly |
| R8333 |
T12992 |
T12990 |
pobj |
assembly,in |
| R8334 |
T12993 |
T12991 |
case |
's,Celera |
| R8335 |
T12994 |
T12995 |
compound |
mouse,genome |
| R8336 |
T12995 |
T12992 |
compound |
genome,assembly |
| R8337 |
T12996 |
T12997 |
punct |
(,Release |
| R8338 |
T12997 |
T12985 |
parataxis |
Release,is |
| R8339 |
T12998 |
T12997 |
nummod |
13,Release |
| R8340 |
T12999 |
T12997 |
punct |
),Release |
| R8341 |
T13000 |
T12985 |
punct |
", ",is |
| R8342 |
T13001 |
T12985 |
cc |
and,is |
| R8343 |
T13002 |
T13003 |
mark |
that,is |
| R8344 |
T13003 |
T12985 |
conj |
is,is |
| R8345 |
T13004 |
T13005 |
det |
the,probe |
| R8346 |
T13005 |
T13003 |
nsubj |
probe,is |
| R8347 |
T13006 |
T13005 |
compound |
AY317365,probe |
| R8348 |
T13007 |
T13003 |
acomp |
similar,is |
| R8349 |
T13008 |
T13007 |
prep |
to,similar |
| R8350 |
T13009 |
T13010 |
advmod |
only,region |
| R8351 |
T13010 |
T13008 |
pobj |
region,to |
| R8352 |
T13011 |
T13010 |
nummod |
one,region |
| R8353 |
T13012 |
T13010 |
amod |
other,region |
| R8354 |
T13013 |
T13010 |
amod |
genomic,region |
| R8355 |
T13014 |
T12983 |
punct |
.,show |
| R8356 |
T13016 |
T13017 |
det |
This,region |
| R8357 |
T13017 |
T13020 |
nsubj |
region,is |
| R8358 |
T13018 |
T13017 |
amod |
potential,region |
| R8359 |
T13019 |
T13017 |
amod |
cross-hybridizing,region |
| R8360 |
T13021 |
T13022 |
quantmod |
over,10 |
| R8361 |
T13022 |
T13023 |
nummod |
10,Mb |
| R8362 |
T13023 |
T13024 |
npadvmod |
Mb,from |
| R8363 |
T13024 |
T13020 |
prep |
from,is |
| R8364 |
T13025 |
T13026 |
det |
the,region |
| R8365 |
T13026 |
T13024 |
pobj |
region,from |
| R8366 |
T13027 |
T13026 |
amod |
nearest,region |
| R8367 |
T13028 |
T13029 |
amod |
olfactory,receptor |
| R8368 |
T13029 |
T13026 |
compound |
receptor,region |
| R8369 |
T13030 |
T13026 |
compound |
coding,region |
| R8370 |
T13031 |
T13020 |
cc |
and,is |
| R8371 |
T13032 |
T13020 |
conj |
is,is |
| R8372 |
T13033 |
T13032 |
advmod |
thus,is |
| R8373 |
T13034 |
T13035 |
advmod |
highly,unlikely |
| R8374 |
T13035 |
T13032 |
acomp |
unlikely,is |
| R8375 |
T13036 |
T13037 |
aux |
to,included |
| R8376 |
T13037 |
T13035 |
xcomp |
included,unlikely |
| R8377 |
T13038 |
T13037 |
auxpass |
be,included |
| R8378 |
T13039 |
T13037 |
prep |
in,included |
| R8379 |
T13040 |
T13041 |
det |
any,transcript |
| R8380 |
T13041 |
T13039 |
pobj |
transcript,in |
| R8381 |
T13042 |
T13043 |
amod |
olfactory,receptor |
| R8382 |
T13043 |
T13041 |
compound |
receptor,transcript |
| R8383 |
T13044 |
T13020 |
punct |
.,is |
| R8384 |
T13046 |
T13047 |
amod |
Low,power |
| R8385 |
T13047 |
T13049 |
compound |
power,images |
| R8386 |
T13048 |
T13047 |
punct |
-,power |
| R8387 |
T13049 |
T13050 |
nsubjpass |
images,composed |
| R8388 |
T13051 |
T13050 |
auxpass |
are,composed |
| R8389 |
T13052 |
T13050 |
prep |
of,composed |
| R8390 |
T13053 |
T13054 |
nummod |
three,micrographs |
| R8391 |
T13054 |
T13052 |
pobj |
micrographs,of |
| R8392 |
T13055 |
T13054 |
amod |
overlapping,micrographs |
| R8393 |
T13056 |
T13057 |
punct |
(,40 |
| R8394 |
T13057 |
T13054 |
parataxis |
40,micrographs |
| R8395 |
T13058 |
T13057 |
punct |
×,40 |
| R8396 |
T13059 |
T13057 |
punct |
),40 |
| R8397 |
T13060 |
T13054 |
acl |
assembled,micrographs |
| R8398 |
T13061 |
T13060 |
prep |
in,assembled |
| R8399 |
T13062 |
T13063 |
compound |
Adobe,Photoshop |
| R8400 |
T13063 |
T13061 |
pobj |
Photoshop,in |
| R8401 |
T13064 |
T13063 |
nummod |
7.0,Photoshop |
| R8402 |
T13065 |
T13050 |
punct |
.,composed |
