| Id |
Subject |
Object |
Predicate |
Lexical cue |
| T13135 |
0-2 |
FW |
denotes |
In |
| T13136 |
3-7 |
FW |
denotes |
situ |
| T13137 |
8-21 |
NN |
denotes |
hybridization |
| T13139 |
22-25 |
VBD |
denotes |
was |
| T13138 |
26-33 |
VBN |
denotes |
carried |
| T13140 |
34-37 |
RP |
denotes |
out |
| T13141 |
38-40 |
IN |
denotes |
on |
| T13142 |
41-43 |
CD |
denotes |
12 |
| T13144 |
43-44 |
HYPH |
denotes |
- |
| T13143 |
44-46 |
NN |
denotes |
μm |
| T13146 |
47-55 |
NN |
denotes |
paraffin |
| T13145 |
56-64 |
NNS |
denotes |
sections |
| T13147 |
65-70 |
VBG |
denotes |
using |
| T13148 |
71-82 |
NN |
denotes |
digoxigenin |
| T13150 |
82-83 |
HYPH |
denotes |
- |
| T13149 |
83-90 |
VBN |
denotes |
labeled |
| T13152 |
91-94 |
NN |
denotes |
RNA |
| T13151 |
95-101 |
NNS |
denotes |
probes |
| T13153 |
102-103 |
-LRB- |
denotes |
( |
| T13155 |
103-108 |
NNP |
denotes |
Roche |
| T13154 |
109-120 |
NNP |
denotes |
Diagnostics |
| T13156 |
120-122 |
, |
denotes |
, |
| T13157 |
122-134 |
NNP |
denotes |
Indianapolis |
| T13158 |
134-136 |
, |
denotes |
, |
| T13159 |
136-143 |
NNP |
denotes |
Indiana |
| T13160 |
143-145 |
, |
denotes |
, |
| T13161 |
145-151 |
NNP |
denotes |
United |
| T13162 |
152-158 |
NNP |
denotes |
States |
| T13163 |
158-159 |
-RRB- |
denotes |
) |
| T13164 |
160-169 |
VBG |
denotes |
according |
| T13165 |
170-172 |
IN |
denotes |
to |
| T13166 |
173-181 |
JJ |
denotes |
standard |
| T13167 |
182-191 |
NNS |
denotes |
protocols |
| T13168 |
192-193 |
-LRB- |
denotes |
( |
| T13169 |
193-202 |
NNP |
denotes |
Wilkinson |
| T13170 |
203-206 |
CC |
denotes |
and |
| T13171 |
207-212 |
NNP |
denotes |
Nieto |
| T13172 |
213-217 |
CD |
denotes |
1993 |
| T13173 |
217-218 |
-RRB- |
denotes |
) |
| T13174 |
218-219 |
. |
denotes |
. |
| T13175 |
219-301 |
sentence |
denotes |
Embryos and postnatal skin samples were obtained from intercrosses of deH/+ mice. |
| T13176 |
220-227 |
NNS |
denotes |
Embryos |
| T13178 |
228-231 |
CC |
denotes |
and |
| T13179 |
232-241 |
JJ |
denotes |
postnatal |
| T13181 |
242-246 |
NN |
denotes |
skin |
| T13180 |
247-254 |
NNS |
denotes |
samples |
| T13182 |
255-259 |
VBD |
denotes |
were |
| T13177 |
260-268 |
VBN |
denotes |
obtained |
| T13183 |
269-273 |
IN |
denotes |
from |
| T13184 |
274-286 |
NNS |
denotes |
intercrosses |
| T13185 |
287-289 |
IN |
denotes |
of |
| T13186 |
290-293 |
NN |
denotes |
deH |
| T13188 |
293-294 |
HYPH |
denotes |
/ |
| T13189 |
294-295 |
SYM |
denotes |
+ |
| T13187 |
296-300 |
NNS |
denotes |
mice |
| T13190 |
300-301 |
. |
denotes |
. |
| T13191 |
301-432 |
sentence |
denotes |
Embryos E13.5 or younger were fixed for 24 h; those older than E13.5 and postnatal skin were fixed for 36–48 h prior to embedding. |
| T13192 |
302-309 |
NNS |
denotes |
Embryos |
| T13194 |
310-315 |
NN |
denotes |
E13.5 |
| T13195 |
316-318 |
CC |
denotes |
or |
| T13196 |
319-326 |
JJR |
denotes |
younger |
| T13197 |
327-331 |
VBD |
denotes |
were |
| T13193 |
332-337 |
VBN |
denotes |
fixed |
| T13199 |
338-341 |
IN |
denotes |
for |
| T13200 |
342-344 |
CD |
denotes |
24 |
| T13201 |
345-346 |
NN |
denotes |
h |
| T13202 |
346-347 |
: |
denotes |
; |
| T13203 |
348-353 |
DT |
denotes |
those |
| T13204 |
354-359 |
JJR |
denotes |
older |
| T13205 |
360-364 |
IN |
denotes |
than |
| T13206 |
365-370 |
NN |
denotes |
E13.5 |
| T13207 |
371-374 |
CC |
denotes |
and |
| T13208 |
375-384 |
JJ |
denotes |
postnatal |
| T13209 |
385-389 |
NN |
denotes |
skin |
| T13210 |
390-394 |
VBD |
denotes |
were |
| T13198 |
395-400 |
VBN |
denotes |
fixed |
| T13211 |
401-404 |
IN |
denotes |
for |
| T13212 |
405-407 |
CD |
denotes |
36 |
| T13214 |
407-408 |
SYM |
denotes |
– |
| T13213 |
408-410 |
CD |
denotes |
48 |
| T13215 |
411-412 |
NN |
denotes |
h |
| T13216 |
413-418 |
RB |
denotes |
prior |
| T13217 |
419-421 |
IN |
denotes |
to |
| T13218 |
422-431 |
VBG |
denotes |
embedding |
| T13219 |
431-432 |
. |
denotes |
. |
| T13220 |
432-707 |
sentence |
denotes |
The Tbx15 probe was generated by RT–PCR using primers GGCGGCTAAAATGAGTGAAC and TGCCTGCTTTGGTGATGAT (corresponds to exons 1 and 2), and the En1 probe was generated by PCR from genomic DNA using primers ACGCACCAGGAAGCTAAAGA and AGCAACGAAAACGAAACTGG (located in the last exon). |
| T13221 |
433-436 |
DT |
denotes |
The |
| T13223 |
437-442 |
NN |
denotes |
Tbx15 |
| T13222 |
443-448 |
NN |
denotes |
probe |
| T13225 |
449-452 |
VBD |
denotes |
was |
| T13224 |
453-462 |
VBN |
denotes |
generated |
| T13226 |
463-465 |
IN |
denotes |
by |
| T13227 |
466-468 |
NN |
denotes |
RT |
| T13229 |
468-469 |
HYPH |
denotes |
– |
| T13228 |
469-472 |
NN |
denotes |
PCR |
| T13230 |
473-478 |
VBG |
denotes |
using |
| T13231 |
479-486 |
NNS |
denotes |
primers |
| T13232 |
487-507 |
NN |
denotes |
GGCGGCTAAAATGAGTGAAC |
| T13233 |
508-511 |
CC |
denotes |
and |
| T13234 |
512-531 |
NN |
denotes |
TGCCTGCTTTGGTGATGAT |
| T13235 |
532-533 |
-LRB- |
denotes |
( |
| T13236 |
533-544 |
VBZ |
denotes |
corresponds |
| T13237 |
545-547 |
IN |
denotes |
to |
| T13238 |
548-553 |
NNS |
denotes |
exons |
| T13239 |
554-555 |
CD |
denotes |
1 |
| T13240 |
556-559 |
CC |
denotes |
and |
| T13241 |
560-561 |
CD |
denotes |
2 |
| T13242 |
561-562 |
-RRB- |
denotes |
) |
| T13243 |
562-564 |
, |
denotes |
, |
| T13244 |
564-567 |
CC |
denotes |
and |
| T13245 |
568-571 |
DT |
denotes |
the |
| T13247 |
572-575 |
NN |
denotes |
En1 |
| T13246 |
576-581 |
NN |
denotes |
probe |
| T13249 |
582-585 |
VBD |
denotes |
was |
| T13248 |
586-595 |
VBN |
denotes |
generated |
| T13250 |
596-598 |
IN |
denotes |
by |
| T13251 |
599-602 |
NN |
denotes |
PCR |
| T13252 |
603-607 |
IN |
denotes |
from |
| T13253 |
608-615 |
JJ |
denotes |
genomic |
| T13254 |
616-619 |
NN |
denotes |
DNA |
| T13255 |
620-625 |
VBG |
denotes |
using |
| T13256 |
626-633 |
NNS |
denotes |
primers |
| T13257 |
634-654 |
NN |
denotes |
ACGCACCAGGAAGCTAAAGA |
| T13258 |
655-658 |
CC |
denotes |
and |
| T13259 |
659-679 |
NN |
denotes |
AGCAACGAAAACGAAACTGG |
| T13260 |
680-681 |
-LRB- |
denotes |
( |
| T13261 |
681-688 |
VBN |
denotes |
located |
| T13262 |
689-691 |
IN |
denotes |
in |
| T13263 |
692-695 |
DT |
denotes |
the |
| T13265 |
696-700 |
JJ |
denotes |
last |
| T13264 |
701-705 |
NN |
denotes |
exon |
| T13266 |
705-706 |
-RRB- |
denotes |
) |
| T13267 |
706-707 |
. |
denotes |
. |
| T13268 |
707-768 |
sentence |
denotes |
The Agouti probe corresponds to the protein-coding sequence. |
| T13269 |
708-711 |
DT |
denotes |
The |
| T13271 |
712-718 |
NN |
denotes |
Agouti |
| T13270 |
719-724 |
NN |
denotes |
probe |
| T13272 |
725-736 |
VBZ |
denotes |
corresponds |
| T13273 |
737-739 |
IN |
denotes |
to |
| T13274 |
740-743 |
DT |
denotes |
the |
| T13276 |
744-751 |
NN |
denotes |
protein |
| T13278 |
751-752 |
HYPH |
denotes |
- |
| T13277 |
752-758 |
VBG |
denotes |
coding |
| T13275 |
759-767 |
NN |
denotes |
sequence |
| T13279 |
767-768 |
. |
denotes |
. |
| R9179 |
T13135 |
T13136 |
advmod |
In,situ |
| R9180 |
T13136 |
T13137 |
amod |
situ,hybridization |
| R9181 |
T13137 |
T13138 |
nsubjpass |
hybridization,carried |
| R9182 |
T13139 |
T13138 |
auxpass |
was,carried |
| R9183 |
T13140 |
T13138 |
prt |
out,carried |
| R9184 |
T13141 |
T13138 |
prep |
on,carried |
| R9185 |
T13142 |
T13143 |
nummod |
12,μm |
| R9186 |
T13143 |
T13145 |
compound |
μm,sections |
| R9187 |
T13144 |
T13143 |
punct |
-,μm |
| R9188 |
T13145 |
T13141 |
pobj |
sections,on |
| R9189 |
T13146 |
T13145 |
compound |
paraffin,sections |
| R9190 |
T13147 |
T13138 |
advcl |
using,carried |
| R9191 |
T13148 |
T13149 |
npadvmod |
digoxigenin,labeled |
| R9192 |
T13149 |
T13151 |
amod |
labeled,probes |
| R9193 |
T13150 |
T13149 |
punct |
-,labeled |
| R9194 |
T13151 |
T13147 |
dobj |
probes,using |
| R9195 |
T13152 |
T13151 |
compound |
RNA,probes |
| R9196 |
T13153 |
T13154 |
punct |
(,Diagnostics |
| R9197 |
T13154 |
T13151 |
parataxis |
Diagnostics,probes |
| R9198 |
T13155 |
T13154 |
compound |
Roche,Diagnostics |
| R9199 |
T13156 |
T13154 |
punct |
", ",Diagnostics |
| R9200 |
T13157 |
T13154 |
npadvmod |
Indianapolis,Diagnostics |
| R9201 |
T13158 |
T13154 |
punct |
", ",Diagnostics |
| R9202 |
T13159 |
T13154 |
npadvmod |
Indiana,Diagnostics |
| R9203 |
T13160 |
T13154 |
punct |
", ",Diagnostics |
| R9204 |
T13161 |
T13162 |
compound |
United,States |
| R9205 |
T13162 |
T13154 |
npadvmod |
States,Diagnostics |
| R9206 |
T13163 |
T13154 |
punct |
),Diagnostics |
| R9207 |
T13164 |
T13147 |
prep |
according,using |
| R9208 |
T13165 |
T13164 |
prep |
to,according |
| R9209 |
T13166 |
T13167 |
amod |
standard,protocols |
| R9210 |
T13167 |
T13165 |
pobj |
protocols,to |
| R9211 |
T13168 |
T13169 |
punct |
(,Wilkinson |
| R9212 |
T13169 |
T13167 |
meta |
Wilkinson,protocols |
| R9213 |
T13170 |
T13169 |
cc |
and,Wilkinson |
| R9214 |
T13171 |
T13169 |
conj |
Nieto,Wilkinson |
| R9215 |
T13172 |
T13171 |
nummod |
1993,Nieto |
| R9216 |
T13173 |
T13171 |
punct |
),Nieto |
| R9217 |
T13174 |
T13138 |
punct |
.,carried |
| R9218 |
T13176 |
T13177 |
nsubjpass |
Embryos,obtained |
| R9219 |
T13178 |
T13176 |
cc |
and,Embryos |
| R9220 |
T13179 |
T13180 |
amod |
postnatal,samples |
| R9221 |
T13180 |
T13176 |
conj |
samples,Embryos |
| R9222 |
T13181 |
T13180 |
compound |
skin,samples |
| R9223 |
T13182 |
T13177 |
auxpass |
were,obtained |
| R9224 |
T13183 |
T13177 |
prep |
from,obtained |
| R9225 |
T13184 |
T13183 |
pobj |
intercrosses,from |
| R9226 |
T13185 |
T13184 |
prep |
of,intercrosses |
| R9227 |
T13186 |
T13187 |
nmod |
deH,mice |
| R9228 |
T13187 |
T13185 |
pobj |
mice,of |
| R9229 |
T13188 |
T13186 |
punct |
/,deH |
| R9230 |
T13189 |
T13186 |
punct |
+,deH |
| R9231 |
T13190 |
T13177 |
punct |
.,obtained |
| R9232 |
T13192 |
T13193 |
nsubjpass |
Embryos,fixed |
| R9233 |
T13193 |
T13198 |
ccomp |
fixed,fixed |
| R9234 |
T13194 |
T13192 |
npadvmod |
E13.5,Embryos |
| R9235 |
T13195 |
T13194 |
cc |
or,E13.5 |
| R9236 |
T13196 |
T13194 |
conj |
younger,E13.5 |
| R9237 |
T13197 |
T13193 |
auxpass |
were,fixed |
| R9238 |
T13199 |
T13193 |
prep |
for,fixed |
| R9239 |
T13200 |
T13201 |
nummod |
24,h |
| R9240 |
T13201 |
T13199 |
pobj |
h,for |
| R9241 |
T13202 |
T13198 |
punct |
;,fixed |
| R9242 |
T13203 |
T13198 |
nsubjpass |
those,fixed |
| R9243 |
T13204 |
T13203 |
amod |
older,those |
| R9244 |
T13205 |
T13204 |
prep |
than,older |
| R9245 |
T13206 |
T13205 |
pobj |
E13.5,than |
| R9246 |
T13207 |
T13203 |
cc |
and,those |
| R9247 |
T13208 |
T13209 |
amod |
postnatal,skin |
| R9248 |
T13209 |
T13203 |
conj |
skin,those |
| R9249 |
T13210 |
T13198 |
auxpass |
were,fixed |
| R9250 |
T13211 |
T13198 |
prep |
for,fixed |
| R9251 |
T13212 |
T13213 |
quantmod |
36,48 |
| R9252 |
T13213 |
T13215 |
nummod |
48,h |
| R9253 |
T13214 |
T13213 |
punct |
–,48 |
| R9254 |
T13215 |
T13211 |
pobj |
h,for |
| R9255 |
T13216 |
T13198 |
advmod |
prior,fixed |
| R9256 |
T13217 |
T13216 |
prep |
to,prior |
| R9257 |
T13218 |
T13217 |
pobj |
embedding,to |
| R9258 |
T13219 |
T13198 |
punct |
.,fixed |
| R9259 |
T13221 |
T13222 |
det |
The,probe |
| R9260 |
T13222 |
T13224 |
nsubjpass |
probe,generated |
| R9261 |
T13223 |
T13222 |
compound |
Tbx15,probe |
| R9262 |
T13225 |
T13224 |
auxpass |
was,generated |
| R9263 |
T13226 |
T13224 |
prep |
by,generated |
| R9264 |
T13227 |
T13228 |
compound |
RT,PCR |
| R9265 |
T13228 |
T13226 |
pobj |
PCR,by |
| R9266 |
T13229 |
T13228 |
punct |
–,PCR |
| R9267 |
T13230 |
T13224 |
advcl |
using,generated |
| R9268 |
T13231 |
T13232 |
compound |
primers,GGCGGCTAAAATGAGTGAAC |
| R9269 |
T13232 |
T13230 |
dobj |
GGCGGCTAAAATGAGTGAAC,using |
| R9270 |
T13233 |
T13232 |
cc |
and,GGCGGCTAAAATGAGTGAAC |
| R9271 |
T13234 |
T13232 |
conj |
TGCCTGCTTTGGTGATGAT,GGCGGCTAAAATGAGTGAAC |
| R9272 |
T13235 |
T13236 |
punct |
(,corresponds |
| R9273 |
T13236 |
T13230 |
parataxis |
corresponds,using |
| R9274 |
T13237 |
T13236 |
prep |
to,corresponds |
| R9275 |
T13238 |
T13237 |
pobj |
exons,to |
| R9276 |
T13239 |
T13238 |
nummod |
1,exons |
| R9277 |
T13240 |
T13238 |
cc |
and,exons |
| R9278 |
T13241 |
T13238 |
conj |
2,exons |
| R9279 |
T13242 |
T13236 |
punct |
),corresponds |
| R9280 |
T13243 |
T13224 |
punct |
", ",generated |
| R9281 |
T13244 |
T13224 |
cc |
and,generated |
| R9282 |
T13245 |
T13246 |
det |
the,probe |
| R9283 |
T13246 |
T13248 |
nsubjpass |
probe,generated |
| R9284 |
T13247 |
T13246 |
compound |
En1,probe |
| R9285 |
T13248 |
T13224 |
conj |
generated,generated |
| R9286 |
T13249 |
T13248 |
auxpass |
was,generated |
| R9287 |
T13250 |
T13248 |
prep |
by,generated |
| R9288 |
T13251 |
T13250 |
pobj |
PCR,by |
| R9289 |
T13252 |
T13248 |
prep |
from,generated |
| R9290 |
T13253 |
T13254 |
amod |
genomic,DNA |
| R9291 |
T13254 |
T13252 |
pobj |
DNA,from |
| R9292 |
T13255 |
T13248 |
advcl |
using,generated |
| R9293 |
T13256 |
T13257 |
compound |
primers,ACGCACCAGGAAGCTAAAGA |
| R9294 |
T13257 |
T13255 |
dobj |
ACGCACCAGGAAGCTAAAGA,using |
| R9295 |
T13258 |
T13257 |
cc |
and,ACGCACCAGGAAGCTAAAGA |
| R9296 |
T13259 |
T13257 |
conj |
AGCAACGAAAACGAAACTGG,ACGCACCAGGAAGCTAAAGA |
| R9297 |
T13260 |
T13261 |
punct |
(,located |
| R9298 |
T13261 |
T13255 |
parataxis |
located,using |
| R9299 |
T13262 |
T13261 |
prep |
in,located |
| R9300 |
T13263 |
T13264 |
det |
the,exon |
| R9301 |
T13264 |
T13262 |
pobj |
exon,in |
| R9302 |
T13265 |
T13264 |
amod |
last,exon |
| R9303 |
T13266 |
T13261 |
punct |
),located |
| R9304 |
T13267 |
T13248 |
punct |
.,generated |
| R9305 |
T13269 |
T13270 |
det |
The,probe |
| R9306 |
T13270 |
T13272 |
nsubj |
probe,corresponds |
| R9307 |
T13271 |
T13270 |
compound |
Agouti,probe |
| R9308 |
T13273 |
T13272 |
prep |
to,corresponds |
| R9309 |
T13274 |
T13275 |
det |
the,sequence |
| R9310 |
T13275 |
T13273 |
pobj |
sequence,to |
| R9311 |
T13276 |
T13277 |
npadvmod |
protein,coding |
| R9312 |
T13277 |
T13275 |
amod |
coding,sequence |
| R9313 |
T13278 |
T13277 |
punct |
-,coding |
| R9314 |
T13279 |
T13272 |
punct |
.,corresponds |
