| Id |
Subject |
Object |
Predicate |
Lexical cue |
| T814 |
0-1 |
DT |
denotes |
A |
| T816 |
0-103 |
sentence |
denotes |
A Mammal-Specific Doublesex Homolog Associates with Male Sex Chromatin and Is Required for Male Meiosis |
| T817 |
2-8 |
NN |
denotes |
Mammal |
| T819 |
8-9 |
HYPH |
denotes |
- |
| T818 |
9-17 |
JJ |
denotes |
Specific |
| T820 |
18-27 |
NN |
denotes |
Doublesex |
| T815 |
28-35 |
NN |
denotes |
Homolog |
| T821 |
36-46 |
VBZ |
denotes |
Associates |
| T822 |
47-51 |
IN |
denotes |
with |
| T823 |
52-56 |
JJ |
denotes |
Male |
| T825 |
57-60 |
NN |
denotes |
Sex |
| T824 |
61-70 |
NN |
denotes |
Chromatin |
| T826 |
71-74 |
CC |
denotes |
and |
| T827 |
75-77 |
VBZ |
denotes |
Is |
| T828 |
78-86 |
VBN |
denotes |
Required |
| T829 |
87-90 |
IN |
denotes |
for |
| T830 |
91-95 |
JJ |
denotes |
Male |
| T831 |
96-103 |
NN |
denotes |
Meiosis |
| T832 |
103-274 |
sentence |
denotes |
A DM Domain Protein in Male Meiosis
Abstract
Gametogenesis is a sexually dimorphic process requiring profound differences in germ cell differentiation between the sexes. |
| T833 |
150-163 |
NN |
denotes |
Gametogenesis |
| T834 |
164-166 |
VBZ |
denotes |
is |
| T835 |
167-168 |
DT |
denotes |
a |
| T837 |
169-177 |
RB |
denotes |
sexually |
| T838 |
178-187 |
JJ |
denotes |
dimorphic |
| T836 |
188-195 |
NN |
denotes |
process |
| T839 |
196-205 |
VBG |
denotes |
requiring |
| T840 |
206-214 |
JJ |
denotes |
profound |
| T841 |
215-226 |
NNS |
denotes |
differences |
| T842 |
227-229 |
IN |
denotes |
in |
| T843 |
230-234 |
NN |
denotes |
germ |
| T844 |
235-239 |
NN |
denotes |
cell |
| T845 |
240-255 |
NN |
denotes |
differentiation |
| T846 |
256-263 |
IN |
denotes |
between |
| T847 |
264-267 |
DT |
denotes |
the |
| T848 |
268-273 |
NNS |
denotes |
sexes |
| T849 |
273-274 |
. |
denotes |
. |
| T850 |
274-447 |
sentence |
denotes |
In mammals, the presence of heteromorphic sex chromosomes in males creates additional sex-specific challenges, including incomplete X and Y pairing during meiotic prophase. |
| T851 |
275-277 |
IN |
denotes |
In |
| T853 |
278-285 |
NNS |
denotes |
mammals |
| T854 |
285-287 |
, |
denotes |
, |
| T855 |
287-290 |
DT |
denotes |
the |
| T856 |
291-299 |
NN |
denotes |
presence |
| T857 |
300-302 |
IN |
denotes |
of |
| T858 |
303-316 |
JJ |
denotes |
heteromorphic |
| T860 |
317-320 |
NN |
denotes |
sex |
| T859 |
321-332 |
NNS |
denotes |
chromosomes |
| T861 |
333-335 |
IN |
denotes |
in |
| T862 |
336-341 |
NNS |
denotes |
males |
| T852 |
342-349 |
VBZ |
denotes |
creates |
| T863 |
350-360 |
JJ |
denotes |
additional |
| T865 |
361-364 |
NN |
denotes |
sex |
| T867 |
364-365 |
HYPH |
denotes |
- |
| T866 |
365-373 |
JJ |
denotes |
specific |
| T864 |
374-384 |
NNS |
denotes |
challenges |
| T868 |
384-386 |
, |
denotes |
, |
| T869 |
386-395 |
VBG |
denotes |
including |
| T870 |
396-406 |
JJ |
denotes |
incomplete |
| T872 |
407-408 |
NN |
denotes |
X |
| T873 |
409-412 |
CC |
denotes |
and |
| T874 |
413-414 |
NN |
denotes |
Y |
| T871 |
415-422 |
NN |
denotes |
pairing |
| T875 |
423-429 |
IN |
denotes |
during |
| T876 |
430-437 |
JJ |
denotes |
meiotic |
| T877 |
438-446 |
NN |
denotes |
prophase |
| T878 |
446-447 |
. |
denotes |
. |
| T879 |
447-513 |
sentence |
denotes |
This triggers formation of a heterochromatin domain, the XY body. |
| T880 |
448-452 |
DT |
denotes |
This |
| T881 |
453-461 |
VBZ |
denotes |
triggers |
| T882 |
462-471 |
NN |
denotes |
formation |
| T883 |
472-474 |
IN |
denotes |
of |
| T884 |
475-476 |
DT |
denotes |
a |
| T886 |
477-492 |
NN |
denotes |
heterochromatin |
| T885 |
493-499 |
NN |
denotes |
domain |
| T887 |
499-501 |
, |
denotes |
, |
| T888 |
501-504 |
DT |
denotes |
the |
| T890 |
505-507 |
NN |
denotes |
XY |
| T889 |
508-512 |
NN |
denotes |
body |
| T891 |
512-513 |
. |
denotes |
. |
| T892 |
513-638 |
sentence |
denotes |
The XY body disassembles after prophase, but specialized sex chromatin persists, with further modification, through meiosis. |
| T893 |
514-517 |
DT |
denotes |
The |
| T895 |
518-520 |
NN |
denotes |
XY |
| T894 |
521-525 |
NN |
denotes |
body |
| T896 |
526-538 |
VBZ |
denotes |
disassembles |
| T897 |
539-544 |
IN |
denotes |
after |
| T898 |
545-553 |
NN |
denotes |
prophase |
| T899 |
553-555 |
, |
denotes |
, |
| T900 |
555-558 |
CC |
denotes |
but |
| T901 |
559-570 |
VBN |
denotes |
specialized |
| T903 |
571-574 |
NN |
denotes |
sex |
| T902 |
575-584 |
NN |
denotes |
chromatin |
| T904 |
585-593 |
VBZ |
denotes |
persists |
| T905 |
593-595 |
, |
denotes |
, |
| T906 |
595-599 |
IN |
denotes |
with |
| T907 |
600-607 |
JJ |
denotes |
further |
| T908 |
608-620 |
NN |
denotes |
modification |
| T909 |
620-622 |
, |
denotes |
, |
| T910 |
622-629 |
IN |
denotes |
through |
| T911 |
630-637 |
NN |
denotes |
meiosis |
| T912 |
637-638 |
. |
denotes |
. |
| T913 |
638-775 |
sentence |
denotes |
Here, we investigate the function of DMRT7, a mammal-specific protein related to the invertebrate sexual regulators Doublesex and MAB-3. |
| T914 |
639-643 |
RB |
denotes |
Here |
| T916 |
643-645 |
, |
denotes |
, |
| T917 |
645-647 |
PRP |
denotes |
we |
| T915 |
648-659 |
VBP |
denotes |
investigate |
| T918 |
660-663 |
DT |
denotes |
the |
| T919 |
664-672 |
NN |
denotes |
function |
| T920 |
673-675 |
IN |
denotes |
of |
| T921 |
676-681 |
NN |
denotes |
DMRT7 |
| T922 |
681-683 |
, |
denotes |
, |
| T923 |
683-684 |
DT |
denotes |
a |
| T925 |
685-691 |
NN |
denotes |
mammal |
| T927 |
691-692 |
HYPH |
denotes |
- |
| T926 |
692-700 |
JJ |
denotes |
specific |
| T924 |
701-708 |
NN |
denotes |
protein |
| T928 |
709-716 |
VBN |
denotes |
related |
| T929 |
717-719 |
IN |
denotes |
to |
| T930 |
720-723 |
DT |
denotes |
the |
| T932 |
724-736 |
NN |
denotes |
invertebrate |
| T933 |
737-743 |
JJ |
denotes |
sexual |
| T931 |
744-754 |
NNS |
denotes |
regulators |
| T934 |
755-764 |
NN |
denotes |
Doublesex |
| T935 |
765-768 |
CC |
denotes |
and |
| T936 |
769-772 |
NN |
denotes |
MAB |
| T937 |
772-773 |
HYPH |
denotes |
- |
| T938 |
773-774 |
CD |
denotes |
3 |
| T939 |
774-775 |
. |
denotes |
. |
| T940 |
775-911 |
sentence |
denotes |
We find that DMRT7 preferentially localizes to the XY body in the pachytene stage of meiotic prophase and is required for male meiosis. |
| T941 |
776-778 |
PRP |
denotes |
We |
| T942 |
779-783 |
VBP |
denotes |
find |
| T943 |
784-788 |
IN |
denotes |
that |
| T945 |
789-794 |
NN |
denotes |
DMRT7 |
| T946 |
795-809 |
RB |
denotes |
preferentially |
| T944 |
810-819 |
VBZ |
denotes |
localizes |
| T947 |
820-822 |
IN |
denotes |
to |
| T948 |
823-826 |
DT |
denotes |
the |
| T950 |
827-829 |
NN |
denotes |
XY |
| T949 |
830-834 |
NN |
denotes |
body |
| T951 |
835-837 |
IN |
denotes |
in |
| T952 |
838-841 |
DT |
denotes |
the |
| T954 |
842-851 |
NN |
denotes |
pachytene |
| T953 |
852-857 |
NN |
denotes |
stage |
| T955 |
858-860 |
IN |
denotes |
of |
| T956 |
861-868 |
JJ |
denotes |
meiotic |
| T957 |
869-877 |
NN |
denotes |
prophase |
| T958 |
878-881 |
CC |
denotes |
and |
| T959 |
882-884 |
VBZ |
denotes |
is |
| T960 |
885-893 |
VBN |
denotes |
required |
| T961 |
894-897 |
IN |
denotes |
for |
| T962 |
898-902 |
JJ |
denotes |
male |
| T963 |
903-910 |
NN |
denotes |
meiosis |
| T964 |
910-911 |
. |
denotes |
. |
| T965 |
911-1119 |
sentence |
denotes |
In Dmrt7 mutants, meiotic pairing and recombination appear normal, and a transcriptionally silenced XY body with appropriate chromatin marks is formed, but most germ cells undergo apoptosis during pachynema. |
| T966 |
912-914 |
IN |
denotes |
In |
| T968 |
915-920 |
NN |
denotes |
Dmrt7 |
| T969 |
921-928 |
NNS |
denotes |
mutants |
| T970 |
928-930 |
, |
denotes |
, |
| T971 |
930-937 |
JJ |
denotes |
meiotic |
| T972 |
938-945 |
NN |
denotes |
pairing |
| T973 |
946-949 |
CC |
denotes |
and |
| T974 |
950-963 |
NN |
denotes |
recombination |
| T967 |
964-970 |
VBP |
denotes |
appear |
| T975 |
971-977 |
JJ |
denotes |
normal |
| T976 |
977-979 |
, |
denotes |
, |
| T977 |
979-982 |
CC |
denotes |
and |
| T978 |
983-984 |
DT |
denotes |
a |
| T980 |
985-1002 |
RB |
denotes |
transcriptionally |
| T981 |
1003-1011 |
VBN |
denotes |
silenced |
| T982 |
1012-1014 |
NN |
denotes |
XY |
| T979 |
1015-1019 |
NN |
denotes |
body |
| T984 |
1020-1024 |
IN |
denotes |
with |
| T985 |
1025-1036 |
JJ |
denotes |
appropriate |
| T987 |
1037-1046 |
NN |
denotes |
chromatin |
| T986 |
1047-1052 |
NNS |
denotes |
marks |
| T988 |
1053-1055 |
VBZ |
denotes |
is |
| T983 |
1056-1062 |
VBN |
denotes |
formed |
| T989 |
1062-1064 |
, |
denotes |
, |
| T990 |
1064-1067 |
CC |
denotes |
but |
| T991 |
1068-1072 |
JJS |
denotes |
most |
| T993 |
1073-1077 |
NN |
denotes |
germ |
| T992 |
1078-1083 |
NNS |
denotes |
cells |
| T994 |
1084-1091 |
VBP |
denotes |
undergo |
| T995 |
1092-1101 |
NN |
denotes |
apoptosis |
| T996 |
1102-1108 |
IN |
denotes |
during |
| T997 |
1109-1118 |
NN |
denotes |
pachynema |
| T998 |
1118-1119 |
. |
denotes |
. |
| T999 |
1119-1390 |
sentence |
denotes |
A minority of mutant cells can progress to diplonema, but many of these escaping cells have abnormal sex chromatin lacking histone H3K9 di- and trimethylation and heterochromatin protein 1β accumulation, modifications that normally occur between pachynema and diplonema. |
| T1000 |
1120-1121 |
DT |
denotes |
A |
| T1001 |
1122-1130 |
NN |
denotes |
minority |
| T1003 |
1131-1133 |
IN |
denotes |
of |
| T1004 |
1134-1140 |
NN |
denotes |
mutant |
| T1005 |
1141-1146 |
NNS |
denotes |
cells |
| T1006 |
1147-1150 |
MD |
denotes |
can |
| T1002 |
1151-1159 |
VB |
denotes |
progress |
| T1007 |
1160-1162 |
IN |
denotes |
to |
| T1008 |
1163-1172 |
NN |
denotes |
diplonema |
| T1009 |
1172-1174 |
, |
denotes |
, |
| T1010 |
1174-1177 |
CC |
denotes |
but |
| T1011 |
1178-1182 |
JJ |
denotes |
many |
| T1013 |
1183-1185 |
IN |
denotes |
of |
| T1014 |
1186-1191 |
DT |
denotes |
these |
| T1016 |
1192-1200 |
VBG |
denotes |
escaping |
| T1015 |
1201-1206 |
NNS |
denotes |
cells |
| T1012 |
1207-1211 |
VBP |
denotes |
have |
| T1017 |
1212-1220 |
JJ |
denotes |
abnormal |
| T1019 |
1221-1224 |
NN |
denotes |
sex |
| T1018 |
1225-1234 |
NN |
denotes |
chromatin |
| T1020 |
1235-1242 |
VBG |
denotes |
lacking |
| T1021 |
1243-1250 |
NN |
denotes |
histone |
| T1023 |
1251-1255 |
NN |
denotes |
H3K9 |
| T1024 |
1256-1258 |
AFX |
denotes |
di |
| T1025 |
1258-1259 |
HYPH |
denotes |
- |
| T1026 |
1260-1263 |
CC |
denotes |
and |
| T1022 |
1264-1278 |
NN |
denotes |
trimethylation |
| T1027 |
1279-1282 |
CC |
denotes |
and |
| T1028 |
1283-1298 |
NN |
denotes |
heterochromatin |
| T1030 |
1299-1306 |
NN |
denotes |
protein |
| T1031 |
1307-1309 |
NN |
denotes |
1β |
| T1029 |
1310-1322 |
NN |
denotes |
accumulation |
| T1032 |
1322-1324 |
, |
denotes |
, |
| T1033 |
1324-1337 |
NNS |
denotes |
modifications |
| T1034 |
1338-1342 |
WDT |
denotes |
that |
| T1036 |
1343-1351 |
RB |
denotes |
normally |
| T1035 |
1352-1357 |
VBP |
denotes |
occur |
| T1037 |
1358-1365 |
IN |
denotes |
between |
| T1038 |
1366-1375 |
NN |
denotes |
pachynema |
| T1039 |
1376-1379 |
CC |
denotes |
and |
| T1040 |
1380-1389 |
NN |
denotes |
diplonema |
| T1041 |
1389-1390 |
. |
denotes |
. |
| T1042 |
1390-1614 |
sentence |
denotes |
Based on the localization of DMRT7 to the XY body and the sex chromatin defects observed in Dmrt7 mutants, we conclude that DMRT7 plays a role in the sex chromatin transformation that occurs between pachynema and diplonema. |
| T1043 |
1391-1396 |
VBN |
denotes |
Based |
| T1045 |
1397-1399 |
IN |
denotes |
on |
| T1046 |
1400-1403 |
DT |
denotes |
the |
| T1047 |
1404-1416 |
NN |
denotes |
localization |
| T1048 |
1417-1419 |
IN |
denotes |
of |
| T1049 |
1420-1425 |
NN |
denotes |
DMRT7 |
| T1050 |
1426-1428 |
IN |
denotes |
to |
| T1051 |
1429-1432 |
DT |
denotes |
the |
| T1053 |
1433-1435 |
NN |
denotes |
XY |
| T1052 |
1436-1440 |
NN |
denotes |
body |
| T1054 |
1441-1444 |
CC |
denotes |
and |
| T1055 |
1445-1448 |
DT |
denotes |
the |
| T1057 |
1449-1452 |
NN |
denotes |
sex |
| T1058 |
1453-1462 |
NN |
denotes |
chromatin |
| T1056 |
1463-1470 |
NNS |
denotes |
defects |
| T1059 |
1471-1479 |
VBN |
denotes |
observed |
| T1060 |
1480-1482 |
IN |
denotes |
in |
| T1061 |
1483-1488 |
NN |
denotes |
Dmrt7 |
| T1062 |
1489-1496 |
NNS |
denotes |
mutants |
| T1063 |
1496-1498 |
, |
denotes |
, |
| T1064 |
1498-1500 |
PRP |
denotes |
we |
| T1044 |
1501-1509 |
VBP |
denotes |
conclude |
| T1065 |
1510-1514 |
IN |
denotes |
that |
| T1067 |
1515-1520 |
NN |
denotes |
DMRT7 |
| T1066 |
1521-1526 |
VBZ |
denotes |
plays |
| T1068 |
1527-1528 |
DT |
denotes |
a |
| T1069 |
1529-1533 |
NN |
denotes |
role |
| T1070 |
1534-1536 |
IN |
denotes |
in |
| T1071 |
1537-1540 |
DT |
denotes |
the |
| T1073 |
1541-1544 |
NN |
denotes |
sex |
| T1074 |
1545-1554 |
NN |
denotes |
chromatin |
| T1072 |
1555-1569 |
NN |
denotes |
transformation |
| T1075 |
1570-1574 |
WDT |
denotes |
that |
| T1076 |
1575-1581 |
VBZ |
denotes |
occurs |
| T1077 |
1582-1589 |
IN |
denotes |
between |
| T1078 |
1590-1599 |
NN |
denotes |
pachynema |
| T1079 |
1600-1603 |
CC |
denotes |
and |
| T1080 |
1604-1613 |
NN |
denotes |
diplonema |
| T1081 |
1613-1614 |
. |
denotes |
. |
| T1082 |
1614-1748 |
sentence |
denotes |
We suggest that DMRT7 may help control the transition from meiotic sex chromosome inactivation to postmeiotic sex chromatin in males. |
| T1083 |
1615-1617 |
PRP |
denotes |
We |
| T1084 |
1618-1625 |
VBP |
denotes |
suggest |
| T1085 |
1626-1630 |
IN |
denotes |
that |
| T1087 |
1631-1636 |
NN |
denotes |
DMRT7 |
| T1088 |
1637-1640 |
MD |
denotes |
may |
| T1086 |
1641-1645 |
VB |
denotes |
help |
| T1089 |
1646-1653 |
VB |
denotes |
control |
| T1090 |
1654-1657 |
DT |
denotes |
the |
| T1091 |
1658-1668 |
NN |
denotes |
transition |
| T1092 |
1669-1673 |
IN |
denotes |
from |
| T1093 |
1674-1681 |
JJ |
denotes |
meiotic |
| T1095 |
1682-1685 |
NN |
denotes |
sex |
| T1094 |
1686-1696 |
NN |
denotes |
chromosome |
| T1096 |
1697-1709 |
NN |
denotes |
inactivation |
| T1097 |
1710-1712 |
IN |
denotes |
to |
| T1098 |
1713-1724 |
JJ |
denotes |
postmeiotic |
| T1100 |
1725-1728 |
NN |
denotes |
sex |
| T1099 |
1729-1738 |
NN |
denotes |
chromatin |
| T1101 |
1739-1741 |
IN |
denotes |
in |
| T1102 |
1742-1747 |
NNS |
denotes |
males |
| T1103 |
1747-1748 |
. |
denotes |
. |
| T1104 |
1748-1906 |
sentence |
denotes |
In addition, because it is found in all branches of mammals, but not in other vertebrates, Dmrt7 may shed light on evolution of meiosis and of sex chromatin. |
| T1105 |
1749-1751 |
IN |
denotes |
In |
| T1107 |
1752-1760 |
NN |
denotes |
addition |
| T1108 |
1760-1762 |
, |
denotes |
, |
| T1109 |
1762-1769 |
IN |
denotes |
because |
| T1111 |
1770-1772 |
PRP |
denotes |
it |
| T1112 |
1773-1775 |
VBZ |
denotes |
is |
| T1110 |
1776-1781 |
VBN |
denotes |
found |
| T1113 |
1782-1784 |
IN |
denotes |
in |
| T1114 |
1785-1788 |
DT |
denotes |
all |
| T1115 |
1789-1797 |
NNS |
denotes |
branches |
| T1116 |
1798-1800 |
IN |
denotes |
of |
| T1117 |
1801-1808 |
NNS |
denotes |
mammals |
| T1118 |
1808-1810 |
, |
denotes |
, |
| T1119 |
1810-1813 |
CC |
denotes |
but |
| T1120 |
1814-1817 |
RB |
denotes |
not |
| T1121 |
1818-1820 |
IN |
denotes |
in |
| T1122 |
1821-1826 |
JJ |
denotes |
other |
| T1123 |
1827-1838 |
NNS |
denotes |
vertebrates |
| T1124 |
1838-1840 |
, |
denotes |
, |
| T1125 |
1840-1845 |
NN |
denotes |
Dmrt7 |
| T1126 |
1846-1849 |
MD |
denotes |
may |
| T1106 |
1850-1854 |
VB |
denotes |
shed |
| T1127 |
1855-1860 |
NN |
denotes |
light |
| T1128 |
1861-1863 |
IN |
denotes |
on |
| T1129 |
1864-1873 |
NN |
denotes |
evolution |
| T1130 |
1874-1876 |
IN |
denotes |
of |
| T1131 |
1877-1884 |
NN |
denotes |
meiosis |
| T1132 |
1885-1888 |
CC |
denotes |
and |
| T1133 |
1889-1891 |
IN |
denotes |
of |
| T1134 |
1892-1895 |
NN |
denotes |
sex |
| T1135 |
1896-1905 |
NN |
denotes |
chromatin |
| T1136 |
1905-1906 |
. |
denotes |
. |
| T3987 |
3096-3102 |
JJ |
denotes |
Sexual |
| T3988 |
3103-3118 |
NN |
denotes |
differentiation |
| T3989 |
3119-3128 |
VBZ |
denotes |
generates |
| T3990 |
3129-3139 |
JJ |
denotes |
anatomical |
| T3992 |
3139-3141 |
, |
denotes |
, |
| T3993 |
3141-3154 |
JJ |
denotes |
physiological |
| T3994 |
3154-3156 |
, |
denotes |
, |
| T3995 |
3156-3159 |
CC |
denotes |
and |
| T3996 |
3160-3170 |
JJ |
denotes |
behavioral |
| T3991 |
3171-3182 |
NNS |
denotes |
dimorphisms |
| T3997 |
3183-3187 |
WDT |
denotes |
that |
| T3998 |
3188-3191 |
VBP |
denotes |
are |
| T3999 |
3192-3201 |
JJ |
denotes |
essential |
| T4000 |
3202-3205 |
IN |
denotes |
for |
| T4001 |
3206-3212 |
JJ |
denotes |
sexual |
| T4002 |
3213-3225 |
NN |
denotes |
reproduction |
| T4003 |
3225-3226 |
. |
denotes |
. |
| T4004 |
3226-3385 |
sentence |
denotes |
Many of these dimorphisms affect somatic cells, but the sexual dimorphisms that most directly mediate sexual reproduction are those of the gametes themselves. |
| T4005 |
3227-3231 |
JJ |
denotes |
Many |
| T4007 |
3232-3234 |
IN |
denotes |
of |
| T4008 |
3235-3240 |
DT |
denotes |
these |
| T4009 |
3241-3252 |
NNS |
denotes |
dimorphisms |
| T4006 |
3253-3259 |
VBP |
denotes |
affect |
| T4010 |
3260-3267 |
JJ |
denotes |
somatic |
| T4011 |
3268-3273 |
NNS |
denotes |
cells |
| T4012 |
3273-3275 |
, |
denotes |
, |
| T4013 |
3275-3278 |
CC |
denotes |
but |
| T4014 |
3279-3282 |
DT |
denotes |
the |
| T4016 |
3283-3289 |
JJ |
denotes |
sexual |
| T4015 |
3290-3301 |
NNS |
denotes |
dimorphisms |
| T4018 |
3302-3306 |
WDT |
denotes |
that |
| T4020 |
3307-3311 |
RBS |
denotes |
most |
| T4021 |
3312-3320 |
RB |
denotes |
directly |
| T4019 |
3321-3328 |
VB |
denotes |
mediate |
| T4022 |
3329-3335 |
JJ |
denotes |
sexual |
| T4023 |
3336-3348 |
NN |
denotes |
reproduction |
| T4017 |
3349-3352 |
VBP |
denotes |
are |
| T4024 |
3353-3358 |
DT |
denotes |
those |
| T4025 |
3359-3361 |
IN |
denotes |
of |
| T4026 |
3362-3365 |
DT |
denotes |
the |
| T4027 |
3366-3373 |
NNS |
denotes |
gametes |
| T4028 |
3374-3384 |
PRP |
denotes |
themselves |
| T4029 |
3384-3385 |
. |
denotes |
. |
| T4030 |
3385-3528 |
sentence |
denotes |
Gametes differ between the sexes in size and morphology, sometimes dramatically so, reflecting their very different roles in zygote formation. |
| T4031 |
3386-3393 |
NNS |
denotes |
Gametes |
| T4032 |
3394-3400 |
VBP |
denotes |
differ |
| T4033 |
3401-3408 |
IN |
denotes |
between |
| T4034 |
3409-3412 |
DT |
denotes |
the |
| T4035 |
3413-3418 |
NNS |
denotes |
sexes |
| T4036 |
3419-3421 |
IN |
denotes |
in |
| T4037 |
3422-3426 |
NN |
denotes |
size |
| T4038 |
3427-3430 |
CC |
denotes |
and |
| T4039 |
3431-3441 |
NN |
denotes |
morphology |
| T4040 |
3441-3443 |
, |
denotes |
, |
| T4041 |
3443-3452 |
RB |
denotes |
sometimes |
| T4043 |
3453-3465 |
RB |
denotes |
dramatically |
| T4042 |
3466-3468 |
RB |
denotes |
so |
| T4044 |
3468-3470 |
, |
denotes |
, |
| T4045 |
3470-3480 |
VBG |
denotes |
reflecting |
| T4046 |
3481-3486 |
PRP$ |
denotes |
their |
| T4048 |
3487-3491 |
RB |
denotes |
very |
| T4049 |
3492-3501 |
JJ |
denotes |
different |
| T4047 |
3502-3507 |
NNS |
denotes |
roles |
| T4050 |
3508-3510 |
IN |
denotes |
in |
| T4051 |
3511-3517 |
NN |
denotes |
zygote |
| T4052 |
3518-3527 |
NN |
denotes |
formation |
| T4053 |
3527-3528 |
. |
denotes |
. |
| T4054 |
3528-3676 |
sentence |
denotes |
Indeed, the morphology of the gametes is what defines sex: females are the sex that produces the larger gametes and males produce the smaller ones. |
| T4055 |
3529-3535 |
RB |
denotes |
Indeed |
| T4057 |
3535-3537 |
, |
denotes |
, |
| T4058 |
3537-3540 |
DT |
denotes |
the |
| T4059 |
3541-3551 |
NN |
denotes |
morphology |
| T4060 |
3552-3554 |
IN |
denotes |
of |
| T4061 |
3555-3558 |
DT |
denotes |
the |
| T4062 |
3559-3566 |
NNS |
denotes |
gametes |
| T4056 |
3567-3569 |
VBZ |
denotes |
is |
| T4064 |
3570-3574 |
WP |
denotes |
what |
| T4065 |
3575-3582 |
VBZ |
denotes |
defines |
| T4066 |
3583-3586 |
NN |
denotes |
sex |
| T4067 |
3586-3588 |
: |
denotes |
: |
| T4068 |
3588-3595 |
NNS |
denotes |
females |
| T4063 |
3596-3599 |
VBP |
denotes |
are |
| T4069 |
3600-3603 |
DT |
denotes |
the |
| T4070 |
3604-3607 |
NN |
denotes |
sex |
| T4071 |
3608-3612 |
WDT |
denotes |
that |
| T4072 |
3613-3621 |
VBZ |
denotes |
produces |
| T4073 |
3622-3625 |
DT |
denotes |
the |
| T4075 |
3626-3632 |
JJR |
denotes |
larger |
| T4074 |
3633-3640 |
NNS |
denotes |
gametes |
| T4076 |
3641-3644 |
CC |
denotes |
and |
| T4077 |
3645-3650 |
NNS |
denotes |
males |
| T4078 |
3651-3658 |
VBP |
denotes |
produce |
| T4079 |
3659-3662 |
DT |
denotes |
the |
| T4081 |
3663-3670 |
JJR |
denotes |
smaller |
| T4080 |
3671-3675 |
NNS |
denotes |
ones |
| T4082 |
3675-3676 |
. |
denotes |
. |
| T4083 |
3676-3811 |
sentence |
denotes |
Mammalian meiosis is regulated sex-specifically starting in embryogenesis and continuing through much of adult life (reviewed in [1]). |
| T4084 |
3677-3686 |
JJ |
denotes |
Mammalian |
| T4085 |
3687-3694 |
NN |
denotes |
meiosis |
| T4087 |
3695-3697 |
VBZ |
denotes |
is |
| T4086 |
3698-3707 |
VBN |
denotes |
regulated |
| T4088 |
3708-3711 |
NN |
denotes |
sex |
| T4090 |
3711-3712 |
HYPH |
denotes |
- |
| T4089 |
3712-3724 |
RB |
denotes |
specifically |
| T4091 |
3725-3733 |
VBG |
denotes |
starting |
| T4092 |
3734-3736 |
IN |
denotes |
in |
| T4093 |
3737-3750 |
NN |
denotes |
embryogenesis |
| T4094 |
3751-3754 |
CC |
denotes |
and |
| T4095 |
3755-3765 |
VBG |
denotes |
continuing |
| T4096 |
3766-3773 |
IN |
denotes |
through |
| T4097 |
3774-3778 |
JJ |
denotes |
much |
| T4098 |
3779-3781 |
IN |
denotes |
of |
| T4099 |
3782-3787 |
JJ |
denotes |
adult |
| T4100 |
3788-3792 |
NN |
denotes |
life |
| T4101 |
3793-3794 |
-LRB- |
denotes |
( |
| T4102 |
3794-3802 |
VBN |
denotes |
reviewed |
| T4103 |
3803-3805 |
IN |
denotes |
in |
| T4104 |
3806-3807 |
-LRB- |
denotes |
[ |
| T4105 |
3807-3808 |
CD |
denotes |
1 |
| T4106 |
3808-3809 |
-RRB- |
denotes |
] |
| T4107 |
3809-3810 |
-RRB- |
denotes |
) |
| T4108 |
3810-3811 |
. |
denotes |
. |
| T4109 |
3811-3897 |
sentence |
denotes |
For example, the timing and synchrony of meiosis are very different in the two sexes. |
| T4110 |
3812-3815 |
IN |
denotes |
For |
| T4112 |
3816-3823 |
NN |
denotes |
example |
| T4113 |
3823-3825 |
, |
denotes |
, |
| T4114 |
3825-3828 |
DT |
denotes |
the |
| T4115 |
3829-3835 |
NN |
denotes |
timing |
| T4116 |
3836-3839 |
CC |
denotes |
and |
| T4117 |
3840-3849 |
NN |
denotes |
synchrony |
| T4118 |
3850-3852 |
IN |
denotes |
of |
| T4119 |
3853-3860 |
NN |
denotes |
meiosis |
| T4111 |
3861-3864 |
VBP |
denotes |
are |
| T4120 |
3865-3869 |
RB |
denotes |
very |
| T4121 |
3870-3879 |
JJ |
denotes |
different |
| T4122 |
3880-3882 |
IN |
denotes |
in |
| T4123 |
3883-3886 |
DT |
denotes |
the |
| T4125 |
3887-3890 |
CD |
denotes |
two |
| T4124 |
3891-3896 |
NNS |
denotes |
sexes |
| T4126 |
3896-3897 |
. |
denotes |
. |
| T4127 |
3897-4003 |
sentence |
denotes |
In females, germ cells synchronously initiate meiosis in the embryo and arrest during meiotic prophase I. |
| T4128 |
3898-3900 |
IN |
denotes |
In |
| T4130 |
3901-3908 |
NNS |
denotes |
females |
| T4131 |
3908-3910 |
, |
denotes |
, |
| T4132 |
3910-3914 |
NN |
denotes |
germ |
| T4133 |
3915-3920 |
NNS |
denotes |
cells |
| T4134 |
3921-3934 |
RB |
denotes |
synchronously |
| T4129 |
3935-3943 |
VBP |
denotes |
initiate |
| T4135 |
3944-3951 |
NN |
denotes |
meiosis |
| T4136 |
3952-3954 |
IN |
denotes |
in |
| T4137 |
3955-3958 |
DT |
denotes |
the |
| T4138 |
3959-3965 |
NN |
denotes |
embryo |
| T4139 |
3966-3969 |
CC |
denotes |
and |
| T4140 |
3970-3976 |
VBP |
denotes |
arrest |
| T4141 |
3977-3983 |
IN |
denotes |
during |
| T4142 |
3984-3991 |
JJ |
denotes |
meiotic |
| T4143 |
3992-4000 |
NN |
denotes |
prophase |
| T4144 |
4001-4002 |
CD |
denotes |
I |
| T4145 |
4002-4003 |
. |
denotes |
. |
| T4146 |
4003-4159 |
sentence |
denotes |
After puberty, oocytes are selectively recruited for ovulation, when they proceed to metaphase II and then complete meiosis after fertilization occurs [2]. |
| T4147 |
4004-4009 |
IN |
denotes |
After |
| T4149 |
4010-4017 |
NN |
denotes |
puberty |
| T4150 |
4017-4019 |
, |
denotes |
, |
| T4151 |
4019-4026 |
NNS |
denotes |
oocytes |
| T4152 |
4027-4030 |
VBP |
denotes |
are |
| T4153 |
4031-4042 |
RB |
denotes |
selectively |
| T4148 |
4043-4052 |
VBN |
denotes |
recruited |
| T4154 |
4053-4056 |
IN |
denotes |
for |
| T4155 |
4057-4066 |
NN |
denotes |
ovulation |
| T4156 |
4066-4068 |
, |
denotes |
, |
| T4157 |
4068-4072 |
WRB |
denotes |
when |
| T4159 |
4073-4077 |
PRP |
denotes |
they |
| T4158 |
4078-4085 |
VBP |
denotes |
proceed |
| T4160 |
4086-4088 |
IN |
denotes |
to |
| T4161 |
4089-4098 |
NN |
denotes |
metaphase |
| T4162 |
4099-4101 |
CD |
denotes |
II |
| T4163 |
4102-4105 |
CC |
denotes |
and |
| T4164 |
4106-4110 |
RB |
denotes |
then |
| T4165 |
4111-4119 |
VBP |
denotes |
complete |
| T4166 |
4120-4127 |
NN |
denotes |
meiosis |
| T4167 |
4128-4133 |
IN |
denotes |
after |
| T4169 |
4134-4147 |
NN |
denotes |
fertilization |
| T4168 |
4148-4154 |
VBZ |
denotes |
occurs |
| T4170 |
4155-4156 |
-LRB- |
denotes |
[ |
| T4171 |
4156-4157 |
CD |
denotes |
2 |
| T4172 |
4157-4158 |
-RRB- |
denotes |
] |
| T4173 |
4158-4159 |
. |
denotes |
. |
| T4174 |
4159-4259 |
sentence |
denotes |
In contrast, male meiosis occurs entirely postnatally, without the arrest periods found in females. |
| T4175 |
4160-4162 |
IN |
denotes |
In |
| T4177 |
4163-4171 |
NN |
denotes |
contrast |
| T4178 |
4171-4173 |
, |
denotes |
, |
| T4179 |
4173-4177 |
JJ |
denotes |
male |
| T4180 |
4178-4185 |
NN |
denotes |
meiosis |
| T4176 |
4186-4192 |
VBZ |
denotes |
occurs |
| T4181 |
4193-4201 |
RB |
denotes |
entirely |
| T4182 |
4202-4213 |
RB |
denotes |
postnatally |
| T4183 |
4213-4215 |
, |
denotes |
, |
| T4184 |
4215-4222 |
IN |
denotes |
without |
| T4185 |
4223-4226 |
DT |
denotes |
the |
| T4187 |
4227-4233 |
NN |
denotes |
arrest |
| T4186 |
4234-4241 |
NNS |
denotes |
periods |
| T4188 |
4242-4247 |
VBN |
denotes |
found |
| T4189 |
4248-4250 |
IN |
denotes |
in |
| T4190 |
4251-4258 |
NNS |
denotes |
females |
| T4191 |
4258-4259 |
. |
denotes |
. |
| T4192 |
4259-4419 |
sentence |
denotes |
In females, each meiosis can produce a single haploid oocyte (and two extruded polar bodies), whereas each male meiosis can produce four haploid spermatocytes. |
| T4193 |
4260-4262 |
IN |
denotes |
In |
| T4195 |
4263-4270 |
NNS |
denotes |
females |
| T4196 |
4270-4272 |
, |
denotes |
, |
| T4197 |
4272-4276 |
DT |
denotes |
each |
| T4198 |
4277-4284 |
NN |
denotes |
meiosis |
| T4199 |
4285-4288 |
MD |
denotes |
can |
| T4194 |
4289-4296 |
VB |
denotes |
produce |
| T4200 |
4297-4298 |
DT |
denotes |
a |
| T4202 |
4299-4305 |
JJ |
denotes |
single |
| T4203 |
4306-4313 |
NN |
denotes |
haploid |
| T4201 |
4314-4320 |
NN |
denotes |
oocyte |
| T4204 |
4321-4322 |
-LRB- |
denotes |
( |
| T4205 |
4322-4325 |
CC |
denotes |
and |
| T4206 |
4326-4329 |
CD |
denotes |
two |
| T4208 |
4330-4338 |
VBN |
denotes |
extruded |
| T4209 |
4339-4344 |
JJ |
denotes |
polar |
| T4207 |
4345-4351 |
NNS |
denotes |
bodies |
| T4210 |
4351-4352 |
-RRB- |
denotes |
) |
| T4211 |
4352-4354 |
, |
denotes |
, |
| T4212 |
4354-4361 |
IN |
denotes |
whereas |
| T4214 |
4362-4366 |
DT |
denotes |
each |
| T4216 |
4367-4371 |
JJ |
denotes |
male |
| T4215 |
4372-4379 |
NN |
denotes |
meiosis |
| T4217 |
4380-4383 |
MD |
denotes |
can |
| T4213 |
4384-4391 |
VB |
denotes |
produce |
| T4218 |
4392-4396 |
CD |
denotes |
four |
| T4220 |
4397-4404 |
NN |
denotes |
haploid |
| T4219 |
4405-4418 |
NNS |
denotes |
spermatocytes |
| T4221 |
4418-4419 |
. |
denotes |
. |
| T4222 |
4419-4555 |
sentence |
denotes |
Other meiotic processes, such as recombination and chromosome pairing (synapsis), occur in both sexes but operate somewhat differently. |
| T4223 |
4420-4425 |
JJ |
denotes |
Other |
| T4225 |
4426-4433 |
JJ |
denotes |
meiotic |
| T4224 |
4434-4443 |
NNS |
denotes |
processes |
| T4227 |
4443-4445 |
, |
denotes |
, |
| T4228 |
4445-4449 |
JJ |
denotes |
such |
| T4229 |
4450-4452 |
IN |
denotes |
as |
| T4230 |
4453-4466 |
NN |
denotes |
recombination |
| T4231 |
4467-4470 |
CC |
denotes |
and |
| T4232 |
4471-4481 |
NN |
denotes |
chromosome |
| T4233 |
4482-4489 |
NN |
denotes |
pairing |
| T4234 |
4490-4491 |
-LRB- |
denotes |
( |
| T4235 |
4491-4499 |
NN |
denotes |
synapsis |
| T4236 |
4499-4500 |
-RRB- |
denotes |
) |
| T4237 |
4500-4502 |
, |
denotes |
, |
| T4226 |
4502-4507 |
VBP |
denotes |
occur |
| T4238 |
4508-4510 |
IN |
denotes |
in |
| T4239 |
4511-4515 |
CC |
denotes |
both |
| T4240 |
4516-4521 |
NNS |
denotes |
sexes |
| T4241 |
4522-4525 |
CC |
denotes |
but |
| T4242 |
4526-4533 |
VBP |
denotes |
operate |
| T4243 |
4534-4542 |
RB |
denotes |
somewhat |
| T4244 |
4543-4554 |
RB |
denotes |
differently |
| T4245 |
4554-4555 |
. |
denotes |
. |
| T4246 |
4555-4837 |
sentence |
denotes |
For example, there is a higher failure rate for meiosis in females, with human oocyte aneuploidy rates up to 25% versus about 2% in human sperm [3], and this may indicate that the checkpoints controlling and monitoring the events of meiotic progression in males are more stringent. |
| T4247 |
4556-4559 |
IN |
denotes |
For |
| T4249 |
4560-4567 |
NN |
denotes |
example |
| T4250 |
4567-4569 |
, |
denotes |
, |
| T4251 |
4569-4574 |
EX |
denotes |
there |
| T4248 |
4575-4577 |
VBZ |
denotes |
is |
| T4252 |
4578-4579 |
DT |
denotes |
a |
| T4254 |
4580-4586 |
JJR |
denotes |
higher |
| T4255 |
4587-4594 |
NN |
denotes |
failure |
| T4253 |
4595-4599 |
NN |
denotes |
rate |
| T4256 |
4600-4603 |
IN |
denotes |
for |
| T4257 |
4604-4611 |
NN |
denotes |
meiosis |
| T4258 |
4612-4614 |
IN |
denotes |
in |
| T4259 |
4615-4622 |
NNS |
denotes |
females |
| T4260 |
4622-4624 |
, |
denotes |
, |
| T4261 |
4624-4628 |
IN |
denotes |
with |
| T4262 |
4629-4634 |
JJ |
denotes |
human |
| T4264 |
4635-4641 |
NN |
denotes |
oocyte |
| T4265 |
4642-4652 |
NN |
denotes |
aneuploidy |
| T4263 |
4653-4658 |
NNS |
denotes |
rates |
| T4266 |
4659-4661 |
IN |
denotes |
up |
| T4268 |
4662-4664 |
IN |
denotes |
to |
| T4267 |
4665-4667 |
CD |
denotes |
25 |
| T4269 |
4667-4668 |
NN |
denotes |
% |
| T4270 |
4669-4675 |
CC |
denotes |
versus |
| T4271 |
4676-4681 |
IN |
denotes |
about |
| T4272 |
4682-4683 |
CD |
denotes |
2 |
| T4273 |
4683-4684 |
NN |
denotes |
% |
| T4274 |
4685-4687 |
IN |
denotes |
in |
| T4275 |
4688-4693 |
JJ |
denotes |
human |
| T4276 |
4694-4699 |
NN |
denotes |
sperm |
| T4277 |
4700-4701 |
-LRB- |
denotes |
[ |
| T4278 |
4701-4702 |
CD |
denotes |
3 |
| T4279 |
4702-4703 |
-RRB- |
denotes |
] |
| T4280 |
4703-4705 |
, |
denotes |
, |
| T4281 |
4705-4708 |
CC |
denotes |
and |
| T4282 |
4709-4713 |
DT |
denotes |
this |
| T4284 |
4714-4717 |
MD |
denotes |
may |
| T4283 |
4718-4726 |
VB |
denotes |
indicate |
| T4285 |
4727-4731 |
IN |
denotes |
that |
| T4287 |
4732-4735 |
DT |
denotes |
the |
| T4288 |
4736-4747 |
NNS |
denotes |
checkpoints |
| T4289 |
4748-4759 |
VBG |
denotes |
controlling |
| T4290 |
4760-4763 |
CC |
denotes |
and |
| T4291 |
4764-4774 |
VBG |
denotes |
monitoring |
| T4292 |
4775-4778 |
DT |
denotes |
the |
| T4293 |
4779-4785 |
NNS |
denotes |
events |
| T4294 |
4786-4788 |
IN |
denotes |
of |
| T4295 |
4789-4796 |
JJ |
denotes |
meiotic |
| T4296 |
4797-4808 |
NN |
denotes |
progression |
| T4297 |
4809-4811 |
IN |
denotes |
in |
| T4298 |
4812-4817 |
NNS |
denotes |
males |
| T4286 |
4818-4821 |
VBP |
denotes |
are |
| T4299 |
4822-4826 |
RBR |
denotes |
more |
| T4300 |
4827-4836 |
JJ |
denotes |
stringent |
| T4301 |
4836-4837 |
. |
denotes |
. |
| T4302 |
4837-5011 |
sentence |
denotes |
Consistent with this idea, genetic analysis of a number of meiotic regulatory genes in the mouse has demonstrated a much stronger requirement in males than in females [1,4]. |
| T4303 |
4838-4848 |
JJ |
denotes |
Consistent |
| T4305 |
4849-4853 |
IN |
denotes |
with |
| T4306 |
4854-4858 |
DT |
denotes |
this |
| T4307 |
4859-4863 |
NN |
denotes |
idea |
| T4308 |
4863-4865 |
, |
denotes |
, |
| T4309 |
4865-4872 |
JJ |
denotes |
genetic |
| T4310 |
4873-4881 |
NN |
denotes |
analysis |
| T4311 |
4882-4884 |
IN |
denotes |
of |
| T4312 |
4885-4886 |
DT |
denotes |
a |
| T4313 |
4887-4893 |
NN |
denotes |
number |
| T4314 |
4894-4896 |
IN |
denotes |
of |
| T4315 |
4897-4904 |
JJ |
denotes |
meiotic |
| T4317 |
4905-4915 |
JJ |
denotes |
regulatory |
| T4316 |
4916-4921 |
NNS |
denotes |
genes |
| T4318 |
4922-4924 |
IN |
denotes |
in |
| T4319 |
4925-4928 |
DT |
denotes |
the |
| T4320 |
4929-4934 |
NN |
denotes |
mouse |
| T4321 |
4935-4938 |
VBZ |
denotes |
has |
| T4304 |
4939-4951 |
VBN |
denotes |
demonstrated |
| T4322 |
4952-4953 |
DT |
denotes |
a |
| T4324 |
4954-4958 |
RB |
denotes |
much |
| T4325 |
4959-4967 |
JJR |
denotes |
stronger |
| T4323 |
4968-4979 |
NN |
denotes |
requirement |
| T4326 |
4980-4982 |
IN |
denotes |
in |
| T4327 |
4983-4988 |
NNS |
denotes |
males |
| T4328 |
4989-4993 |
IN |
denotes |
than |
| T4329 |
4994-4996 |
IN |
denotes |
in |
| T4330 |
4997-5004 |
NNS |
denotes |
females |
| T4331 |
5005-5006 |
-LRB- |
denotes |
[ |
| T4333 |
5006-5007 |
CD |
denotes |
1 |
| T4334 |
5007-5008 |
, |
denotes |
, |
| T4332 |
5008-5009 |
CD |
denotes |
4 |
| T4335 |
5009-5010 |
-RRB- |
denotes |
] |
| T4336 |
5010-5011 |
. |
denotes |
. |
| T4337 |
5011-5129 |
sentence |
denotes |
The existence of heteromorphic sex chromosomes, such as the XX/XY system of mammals, creates sex-specific challenges. |
| T4338 |
5012-5015 |
DT |
denotes |
The |
| T4339 |
5016-5025 |
NN |
denotes |
existence |
| T4341 |
5026-5028 |
IN |
denotes |
of |
| T4342 |
5029-5042 |
JJ |
denotes |
heteromorphic |
| T4344 |
5043-5046 |
NN |
denotes |
sex |
| T4343 |
5047-5058 |
NNS |
denotes |
chromosomes |
| T4345 |
5058-5060 |
, |
denotes |
, |
| T4346 |
5060-5064 |
JJ |
denotes |
such |
| T4347 |
5065-5067 |
IN |
denotes |
as |
| T4348 |
5068-5071 |
DT |
denotes |
the |
| T4350 |
5072-5074 |
NN |
denotes |
XX |
| T4352 |
5074-5075 |
HYPH |
denotes |
/ |
| T4351 |
5075-5077 |
NN |
denotes |
XY |
| T4349 |
5078-5084 |
NN |
denotes |
system |
| T4353 |
5085-5087 |
IN |
denotes |
of |
| T4354 |
5088-5095 |
NNS |
denotes |
mammals |
| T4355 |
5095-5097 |
, |
denotes |
, |
| T4340 |
5097-5104 |
VBZ |
denotes |
creates |
| T4356 |
5105-5108 |
NN |
denotes |
sex |
| T4358 |
5108-5109 |
HYPH |
denotes |
- |
| T4357 |
5109-5117 |
JJ |
denotes |
specific |
| T4359 |
5118-5128 |
NNS |
denotes |
challenges |
| T4360 |
5128-5129 |
. |
denotes |
. |
| T4361 |
5129-5301 |
sentence |
denotes |
One is the need for mechanisms to balance expression of sex-linked genes between the sexes, which in mammals is accomplished by X chromosome inactivation in females [5,6]. |
| T4362 |
5130-5133 |
CD |
denotes |
One |
| T4363 |
5134-5136 |
VBZ |
denotes |
is |
| T4364 |
5137-5140 |
DT |
denotes |
the |
| T4365 |
5141-5145 |
NN |
denotes |
need |
| T4366 |
5146-5149 |
IN |
denotes |
for |
| T4367 |
5150-5160 |
NNS |
denotes |
mechanisms |
| T4368 |
5161-5163 |
TO |
denotes |
to |
| T4369 |
5164-5171 |
VB |
denotes |
balance |
| T4370 |
5172-5182 |
NN |
denotes |
expression |
| T4371 |
5183-5185 |
IN |
denotes |
of |
| T4372 |
5186-5189 |
NN |
denotes |
sex |
| T4374 |
5189-5190 |
HYPH |
denotes |
- |
| T4373 |
5190-5196 |
VBN |
denotes |
linked |
| T4375 |
5197-5202 |
NNS |
denotes |
genes |
| T4376 |
5203-5210 |
IN |
denotes |
between |
| T4377 |
5211-5214 |
DT |
denotes |
the |
| T4378 |
5215-5220 |
NNS |
denotes |
sexes |
| T4379 |
5220-5222 |
, |
denotes |
, |
| T4380 |
5222-5227 |
WDT |
denotes |
which |
| T4382 |
5228-5230 |
IN |
denotes |
in |
| T4383 |
5231-5238 |
NNS |
denotes |
mammals |
| T4384 |
5239-5241 |
VBZ |
denotes |
is |
| T4381 |
5242-5254 |
VBN |
denotes |
accomplished |
| T4385 |
5255-5257 |
IN |
denotes |
by |
| T4386 |
5258-5259 |
NN |
denotes |
X |
| T4387 |
5260-5270 |
NN |
denotes |
chromosome |
| T4388 |
5271-5283 |
NN |
denotes |
inactivation |
| T4389 |
5284-5286 |
IN |
denotes |
in |
| T4390 |
5287-5294 |
NNS |
denotes |
females |
| T4391 |
5295-5296 |
-LRB- |
denotes |
[ |
| T4393 |
5296-5297 |
CD |
denotes |
5 |
| T4394 |
5297-5298 |
, |
denotes |
, |
| T4392 |
5298-5299 |
CD |
denotes |
6 |
| T4395 |
5299-5300 |
-RRB- |
denotes |
] |
| T4396 |
5300-5301 |
. |
denotes |
. |
| T4397 |
5301-5380 |
sentence |
denotes |
In male germ cells there is another sex-specific consideration during meiosis. |
| T4398 |
5302-5304 |
IN |
denotes |
In |
| T4400 |
5305-5309 |
JJ |
denotes |
male |
| T4402 |
5310-5314 |
NN |
denotes |
germ |
| T4401 |
5315-5320 |
NNS |
denotes |
cells |
| T4403 |
5321-5326 |
EX |
denotes |
there |
| T4399 |
5327-5329 |
VBZ |
denotes |
is |
| T4404 |
5330-5337 |
DT |
denotes |
another |
| T4406 |
5338-5341 |
NN |
denotes |
sex |
| T4408 |
5341-5342 |
HYPH |
denotes |
- |
| T4407 |
5342-5350 |
JJ |
denotes |
specific |
| T4405 |
5351-5364 |
NN |
denotes |
consideration |
| T4409 |
5365-5371 |
IN |
denotes |
during |
| T4410 |
5372-5379 |
NN |
denotes |
meiosis |
| T4411 |
5379-5380 |
. |
denotes |
. |
| T4412 |
5380-5609 |
sentence |
denotes |
In prophase I, when the homologous chromosomes synapse and homologous recombination occurs, X and Y chromosome pairing is limited to a region termed the pseudoautosomal region, leaving large portions of each chromosome unpaired. |
| T4413 |
5381-5383 |
IN |
denotes |
In |
| T4415 |
5384-5392 |
NN |
denotes |
prophase |
| T4416 |
5393-5394 |
CD |
denotes |
I |
| T4417 |
5394-5396 |
, |
denotes |
, |
| T4418 |
5396-5400 |
WRB |
denotes |
when |
| T4420 |
5401-5404 |
DT |
denotes |
the |
| T4422 |
5405-5415 |
JJ |
denotes |
homologous |
| T4421 |
5416-5427 |
NNS |
denotes |
chromosomes |
| T4419 |
5428-5435 |
VBP |
denotes |
synapse |
| T4423 |
5436-5439 |
CC |
denotes |
and |
| T4424 |
5440-5450 |
JJ |
denotes |
homologous |
| T4425 |
5451-5464 |
NN |
denotes |
recombination |
| T4426 |
5465-5471 |
VBZ |
denotes |
occurs |
| T4427 |
5471-5473 |
, |
denotes |
, |
| T4428 |
5473-5474 |
NN |
denotes |
X |
| T4430 |
5475-5478 |
CC |
denotes |
and |
| T4431 |
5479-5480 |
NN |
denotes |
Y |
| T4429 |
5481-5491 |
NN |
denotes |
chromosome |
| T4432 |
5492-5499 |
NN |
denotes |
pairing |
| T4433 |
5500-5502 |
VBZ |
denotes |
is |
| T4414 |
5503-5510 |
VBN |
denotes |
limited |
| T4434 |
5511-5513 |
IN |
denotes |
to |
| T4435 |
5514-5515 |
DT |
denotes |
a |
| T4436 |
5516-5522 |
NN |
denotes |
region |
| T4437 |
5523-5529 |
VBN |
denotes |
termed |
| T4438 |
5530-5533 |
DT |
denotes |
the |
| T4440 |
5534-5549 |
JJ |
denotes |
pseudoautosomal |
| T4439 |
5550-5556 |
NN |
denotes |
region |
| T4441 |
5556-5558 |
, |
denotes |
, |
| T4442 |
5558-5565 |
VBG |
denotes |
leaving |
| T4443 |
5566-5571 |
JJ |
denotes |
large |
| T4444 |
5572-5580 |
NNS |
denotes |
portions |
| T4445 |
5581-5583 |
IN |
denotes |
of |
| T4446 |
5584-5588 |
DT |
denotes |
each |
| T4447 |
5589-5599 |
NN |
denotes |
chromosome |
| T4448 |
5600-5608 |
JJ |
denotes |
unpaired |
| T4449 |
5608-5609 |
. |
denotes |
. |
| T4450 |
5609-5762 |
sentence |
denotes |
In eutherian and marsupial mammals, these unpaired chromosome regions are associated with a specialized chromatin domain termed the XY body or sex body. |
| T4451 |
5610-5612 |
IN |
denotes |
In |
| T4453 |
5613-5622 |
JJ |
denotes |
eutherian |
| T4455 |
5623-5626 |
CC |
denotes |
and |
| T4456 |
5627-5636 |
JJ |
denotes |
marsupial |
| T4454 |
5637-5644 |
NNS |
denotes |
mammals |
| T4457 |
5644-5646 |
, |
denotes |
, |
| T4458 |
5646-5651 |
DT |
denotes |
these |
| T4460 |
5652-5660 |
JJ |
denotes |
unpaired |
| T4461 |
5661-5671 |
NN |
denotes |
chromosome |
| T4459 |
5672-5679 |
NNS |
denotes |
regions |
| T4462 |
5680-5683 |
VBP |
denotes |
are |
| T4452 |
5684-5694 |
VBN |
denotes |
associated |
| T4463 |
5695-5699 |
IN |
denotes |
with |
| T4464 |
5700-5701 |
DT |
denotes |
a |
| T4466 |
5702-5713 |
VBN |
denotes |
specialized |
| T4467 |
5714-5723 |
NN |
denotes |
chromatin |
| T4465 |
5724-5730 |
NN |
denotes |
domain |
| T4468 |
5731-5737 |
VBN |
denotes |
termed |
| T4469 |
5738-5741 |
DT |
denotes |
the |
| T4471 |
5742-5744 |
NN |
denotes |
XY |
| T4470 |
5745-5749 |
NN |
denotes |
body |
| T4472 |
5750-5752 |
CC |
denotes |
or |
| T4473 |
5753-5756 |
NN |
denotes |
sex |
| T4474 |
5757-5761 |
NN |
denotes |
body |
| T4475 |
5761-5762 |
. |
denotes |
. |
| T4476 |
5762-5889 |
sentence |
denotes |
The function of the XY body is uncertain [7–11], but there is evidence that it is essential for male meiotic progression [12]. |
| T4477 |
5763-5766 |
DT |
denotes |
The |
| T4478 |
5767-5775 |
NN |
denotes |
function |
| T4480 |
5776-5778 |
IN |
denotes |
of |
| T4481 |
5779-5782 |
DT |
denotes |
the |
| T4483 |
5783-5785 |
NN |
denotes |
XY |
| T4482 |
5786-5790 |
NN |
denotes |
body |
| T4479 |
5791-5793 |
VBZ |
denotes |
is |
| T4484 |
5794-5803 |
JJ |
denotes |
uncertain |
| T4485 |
5804-5805 |
-LRB- |
denotes |
[ |
| T4486 |
5805-5806 |
CD |
denotes |
7 |
| T4487 |
5806-5807 |
SYM |
denotes |
– |
| T4488 |
5807-5809 |
CD |
denotes |
11 |
| T4489 |
5809-5810 |
-RRB- |
denotes |
] |
| T4490 |
5810-5812 |
, |
denotes |
, |
| T4491 |
5812-5815 |
CC |
denotes |
but |
| T4492 |
5816-5821 |
EX |
denotes |
there |
| T4493 |
5822-5824 |
VBZ |
denotes |
is |
| T4494 |
5825-5833 |
NN |
denotes |
evidence |
| T4495 |
5834-5838 |
IN |
denotes |
that |
| T4497 |
5839-5841 |
PRP |
denotes |
it |
| T4496 |
5842-5844 |
VBZ |
denotes |
is |
| T4498 |
5845-5854 |
JJ |
denotes |
essential |
| T4499 |
5855-5858 |
IN |
denotes |
for |
| T4500 |
5859-5863 |
JJ |
denotes |
male |
| T4502 |
5864-5871 |
JJ |
denotes |
meiotic |
| T4501 |
5872-5883 |
NN |
denotes |
progression |
| T4503 |
5884-5885 |
-LRB- |
denotes |
[ |
| T4504 |
5885-5887 |
CD |
denotes |
12 |
| T4505 |
5887-5888 |
-RRB- |
denotes |
] |
| T4506 |
5888-5889 |
. |
denotes |
. |
| T4507 |
5889-6093 |
sentence |
denotes |
Several proteins are reported to localize to the XY body, including BRCA1, ATR, the histone variant H3.3, and modified histones such as ubiquitinated H2A (Ub-H2A) and phosphorylated H2AX (γH2AX) [12–15]. |
| T4508 |
5890-5897 |
JJ |
denotes |
Several |
| T4509 |
5898-5906 |
NN |
denotes |
proteins |
| T4511 |
5907-5910 |
VBP |
denotes |
are |
| T4510 |
5911-5919 |
VBN |
denotes |
reported |
| T4512 |
5920-5922 |
TO |
denotes |
to |
| T4513 |
5923-5931 |
VB |
denotes |
localize |
| T4514 |
5932-5934 |
IN |
denotes |
to |
| T4515 |
5935-5938 |
DT |
denotes |
the |
| T4517 |
5939-5941 |
NN |
denotes |
XY |
| T4516 |
5942-5946 |
NN |
denotes |
body |
| T4518 |
5946-5948 |
, |
denotes |
, |
| T4519 |
5948-5957 |
VBG |
denotes |
including |
| T4520 |
5958-5963 |
NN |
denotes |
BRCA1 |
| T4521 |
5963-5965 |
, |
denotes |
, |
| T4522 |
5965-5968 |
NN |
denotes |
ATR |
| T4523 |
5968-5970 |
, |
denotes |
, |
| T4524 |
5970-5973 |
DT |
denotes |
the |
| T4526 |
5974-5981 |
NN |
denotes |
histone |
| T4527 |
5982-5989 |
NN |
denotes |
variant |
| T4525 |
5990-5994 |
NN |
denotes |
H3.3 |
| T4528 |
5994-5996 |
, |
denotes |
, |
| T4529 |
5996-5999 |
CC |
denotes |
and |
| T4530 |
6000-6008 |
VBN |
denotes |
modified |
| T4531 |
6009-6017 |
NNS |
denotes |
histones |
| T4532 |
6018-6022 |
JJ |
denotes |
such |
| T4533 |
6023-6025 |
IN |
denotes |
as |
| T4534 |
6026-6039 |
VBN |
denotes |
ubiquitinated |
| T4535 |
6040-6043 |
NN |
denotes |
H2A |
| T4536 |
6044-6045 |
-LRB- |
denotes |
( |
| T4537 |
6045-6047 |
NN |
denotes |
Ub |
| T4539 |
6047-6048 |
HYPH |
denotes |
- |
| T4538 |
6048-6051 |
NN |
denotes |
H2A |
| T4540 |
6051-6052 |
-RRB- |
denotes |
) |
| T4541 |
6053-6056 |
CC |
denotes |
and |
| T4542 |
6057-6071 |
VBN |
denotes |
phosphorylated |
| T4543 |
6072-6076 |
NN |
denotes |
H2AX |
| T4544 |
6077-6078 |
-LRB- |
denotes |
( |
| T4545 |
6078-6083 |
NN |
denotes |
γH2AX |
| T4546 |
6083-6084 |
-RRB- |
denotes |
) |
| T4547 |
6085-6086 |
-LRB- |
denotes |
[ |
| T4548 |
6086-6088 |
CD |
denotes |
12 |
| T4549 |
6088-6089 |
SYM |
denotes |
– |
| T4550 |
6089-6091 |
CD |
denotes |
15 |
| T4551 |
6091-6092 |
-RRB- |
denotes |
] |
| T4552 |
6092-6093 |
. |
denotes |
. |
| T4553 |
6093-6224 |
sentence |
denotes |
In the XY body, the sex chromosomes are transcriptionally silenced in a process termed meiotic sex chromosome inactivation (MSCI). |
| T4554 |
6094-6096 |
IN |
denotes |
In |
| T4556 |
6097-6100 |
DT |
denotes |
the |
| T4558 |
6101-6103 |
NN |
denotes |
XY |
| T4557 |
6104-6108 |
NN |
denotes |
body |
| T4559 |
6108-6110 |
, |
denotes |
, |
| T4560 |
6110-6113 |
DT |
denotes |
the |
| T4562 |
6114-6117 |
NN |
denotes |
sex |
| T4561 |
6118-6129 |
NNS |
denotes |
chromosomes |
| T4563 |
6130-6133 |
VBP |
denotes |
are |
| T4564 |
6134-6151 |
RB |
denotes |
transcriptionally |
| T4555 |
6152-6160 |
VBN |
denotes |
silenced |
| T4565 |
6161-6163 |
IN |
denotes |
in |
| T4566 |
6164-6165 |
DT |
denotes |
a |
| T4567 |
6166-6173 |
NN |
denotes |
process |
| T4568 |
6174-6180 |
VBN |
denotes |
termed |
| T4569 |
6181-6188 |
JJ |
denotes |
meiotic |
| T4571 |
6189-6192 |
NN |
denotes |
sex |
| T4572 |
6193-6203 |
NN |
denotes |
chromosome |
| T4570 |
6204-6216 |
NN |
denotes |
inactivation |
| T4573 |
6217-6218 |
-LRB- |
denotes |
( |
| T4574 |
6218-6222 |
NN |
denotes |
MSCI |
| T4575 |
6222-6223 |
-RRB- |
denotes |
) |
| T4576 |
6223-6224 |
. |
denotes |
. |
| T4577 |
6224-6353 |
sentence |
denotes |
The XY body disappears after pachynema; however, many sex-linked genes remain transcriptionally silent into spermiogenesis [16]. |
| T4578 |
6225-6228 |
DT |
denotes |
The |
| T4580 |
6229-6231 |
NN |
denotes |
XY |
| T4579 |
6232-6236 |
NN |
denotes |
body |
| T4581 |
6237-6247 |
VBZ |
denotes |
disappears |
| T4583 |
6248-6253 |
IN |
denotes |
after |
| T4584 |
6254-6263 |
NN |
denotes |
pachynema |
| T4585 |
6263-6264 |
: |
denotes |
; |
| T4586 |
6265-6272 |
RB |
denotes |
however |
| T4587 |
6272-6274 |
, |
denotes |
, |
| T4588 |
6274-6278 |
JJ |
denotes |
many |
| T4590 |
6279-6282 |
NN |
denotes |
sex |
| T4592 |
6282-6283 |
HYPH |
denotes |
- |
| T4591 |
6283-6289 |
VBN |
denotes |
linked |
| T4589 |
6290-6295 |
NNS |
denotes |
genes |
| T4582 |
6296-6302 |
VBP |
denotes |
remain |
| T4593 |
6303-6320 |
RB |
denotes |
transcriptionally |
| T4594 |
6321-6327 |
JJ |
denotes |
silent |
| T4595 |
6328-6332 |
IN |
denotes |
into |
| T4596 |
6333-6347 |
NN |
denotes |
spermiogenesis |
| T4597 |
6348-6349 |
-LRB- |
denotes |
[ |
| T4598 |
6349-6351 |
CD |
denotes |
16 |
| T4599 |
6351-6352 |
-RRB- |
denotes |
] |
| T4600 |
6352-6353 |
. |
denotes |
. |
| T4601 |
6353-6520 |
sentence |
denotes |
This maintenance of silencing is associated with a distinct set of chromatin marks that define a sex chromatin domain termed postmeiotic sex chromatin (PMSC) [16,17]. |
| T4602 |
6354-6358 |
DT |
denotes |
This |
| T4603 |
6359-6370 |
NN |
denotes |
maintenance |
| T4605 |
6371-6373 |
IN |
denotes |
of |
| T4606 |
6374-6383 |
NN |
denotes |
silencing |
| T4607 |
6384-6386 |
VBZ |
denotes |
is |
| T4604 |
6387-6397 |
VBN |
denotes |
associated |
| T4608 |
6398-6402 |
IN |
denotes |
with |
| T4609 |
6403-6404 |
DT |
denotes |
a |
| T4611 |
6405-6413 |
JJ |
denotes |
distinct |
| T4610 |
6414-6417 |
NN |
denotes |
set |
| T4612 |
6418-6420 |
IN |
denotes |
of |
| T4613 |
6421-6430 |
NN |
denotes |
chromatin |
| T4614 |
6431-6436 |
NNS |
denotes |
marks |
| T4615 |
6437-6441 |
WDT |
denotes |
that |
| T4616 |
6442-6448 |
VBP |
denotes |
define |
| T4617 |
6449-6450 |
DT |
denotes |
a |
| T4619 |
6451-6454 |
NN |
denotes |
sex |
| T4620 |
6455-6464 |
NN |
denotes |
chromatin |
| T4618 |
6465-6471 |
NN |
denotes |
domain |
| T4621 |
6472-6478 |
VBN |
denotes |
termed |
| T4622 |
6479-6490 |
JJ |
denotes |
postmeiotic |
| T4624 |
6491-6494 |
NN |
denotes |
sex |
| T4623 |
6495-6504 |
NN |
denotes |
chromatin |
| T4625 |
6505-6506 |
-LRB- |
denotes |
( |
| T4626 |
6506-6510 |
NN |
denotes |
PMSC |
| T4627 |
6510-6511 |
-RRB- |
denotes |
) |
| T4628 |
6512-6513 |
-LRB- |
denotes |
[ |
| T4630 |
6513-6515 |
CD |
denotes |
16 |
| T4631 |
6515-6516 |
, |
denotes |
, |
| T4629 |
6516-6518 |
CD |
denotes |
17 |
| T4632 |
6518-6519 |
-RRB- |
denotes |
] |
| T4633 |
6519-6520 |
. |
denotes |
. |
| T4634 |
6520-6816 |
sentence |
denotes |
Regulators of sexual differentiation have been identified in a number of organisms, but in contrast to many other developmental processes, such as axial patterning or development of many body parts, the molecular mechanisms that regulate sexual differentiation are highly variable between phyla. |
| T4635 |
6521-6531 |
NNS |
denotes |
Regulators |
| T4637 |
6532-6534 |
IN |
denotes |
of |
| T4638 |
6535-6541 |
JJ |
denotes |
sexual |
| T4639 |
6542-6557 |
NN |
denotes |
differentiation |
| T4640 |
6558-6562 |
VBP |
denotes |
have |
| T4641 |
6563-6567 |
VBN |
denotes |
been |
| T4636 |
6568-6578 |
VBN |
denotes |
identified |
| T4642 |
6579-6581 |
IN |
denotes |
in |
| T4643 |
6582-6583 |
DT |
denotes |
a |
| T4644 |
6584-6590 |
NN |
denotes |
number |
| T4645 |
6591-6593 |
IN |
denotes |
of |
| T4646 |
6594-6603 |
NNS |
denotes |
organisms |
| T4647 |
6603-6605 |
, |
denotes |
, |
| T4648 |
6605-6608 |
CC |
denotes |
but |
| T4649 |
6609-6611 |
IN |
denotes |
in |
| T4651 |
6612-6620 |
NN |
denotes |
contrast |
| T4652 |
6621-6623 |
IN |
denotes |
to |
| T4653 |
6624-6628 |
JJ |
denotes |
many |
| T4655 |
6629-6634 |
JJ |
denotes |
other |
| T4656 |
6635-6648 |
JJ |
denotes |
developmental |
| T4654 |
6649-6658 |
NNS |
denotes |
processes |
| T4657 |
6658-6660 |
, |
denotes |
, |
| T4658 |
6660-6664 |
JJ |
denotes |
such |
| T4659 |
6665-6667 |
IN |
denotes |
as |
| T4660 |
6668-6673 |
JJ |
denotes |
axial |
| T4661 |
6674-6684 |
NN |
denotes |
patterning |
| T4662 |
6685-6687 |
CC |
denotes |
or |
| T4663 |
6688-6699 |
NN |
denotes |
development |
| T4664 |
6700-6702 |
IN |
denotes |
of |
| T4665 |
6703-6707 |
JJ |
denotes |
many |
| T4667 |
6708-6712 |
NN |
denotes |
body |
| T4666 |
6713-6718 |
NNS |
denotes |
parts |
| T4668 |
6718-6720 |
, |
denotes |
, |
| T4669 |
6720-6723 |
DT |
denotes |
the |
| T4671 |
6724-6733 |
JJ |
denotes |
molecular |
| T4670 |
6734-6744 |
NNS |
denotes |
mechanisms |
| T4672 |
6745-6749 |
WDT |
denotes |
that |
| T4673 |
6750-6758 |
VBP |
denotes |
regulate |
| T4674 |
6759-6765 |
JJ |
denotes |
sexual |
| T4675 |
6766-6781 |
NN |
denotes |
differentiation |
| T4650 |
6782-6785 |
VBP |
denotes |
are |
| T4676 |
6786-6792 |
RB |
denotes |
highly |
| T4677 |
6793-6801 |
JJ |
denotes |
variable |
| T4678 |
6802-6809 |
IN |
denotes |
between |
| T4679 |
6810-6815 |
NNS |
denotes |
phyla |
| T4680 |
6815-6816 |
. |
denotes |
. |
| T4681 |
6816-6971 |
sentence |
denotes |
A notable exception involves genes related to doublesex (dsx) of Drosophila, which share a Doublesex/MAB-3 DNA-binding motif called the DM domain [18,19]. |
| T4682 |
6817-6818 |
DT |
denotes |
A |
| T4684 |
6819-6826 |
JJ |
denotes |
notable |
| T4683 |
6827-6836 |
NN |
denotes |
exception |
| T4685 |
6837-6845 |
VBZ |
denotes |
involves |
| T4686 |
6846-6851 |
NNS |
denotes |
genes |
| T4687 |
6852-6859 |
VBN |
denotes |
related |
| T4688 |
6860-6862 |
IN |
denotes |
to |
| T4689 |
6863-6872 |
NN |
denotes |
doublesex |
| T4690 |
6873-6874 |
-LRB- |
denotes |
( |
| T4691 |
6874-6877 |
NN |
denotes |
dsx |
| T4692 |
6877-6878 |
-RRB- |
denotes |
) |
| T4693 |
6879-6881 |
IN |
denotes |
of |
| T4694 |
6882-6892 |
NNP |
denotes |
Drosophila |
| T4695 |
6892-6894 |
, |
denotes |
, |
| T4696 |
6894-6899 |
WDT |
denotes |
which |
| T4697 |
6900-6905 |
VBP |
denotes |
share |
| T4698 |
6906-6907 |
DT |
denotes |
a |
| T4700 |
6908-6917 |
NN |
denotes |
Doublesex |
| T4702 |
6917-6918 |
HYPH |
denotes |
/ |
| T4701 |
6918-6921 |
NN |
denotes |
MAB |
| T4703 |
6921-6922 |
HYPH |
denotes |
- |
| T4704 |
6922-6923 |
CD |
denotes |
3 |
| T4705 |
6924-6927 |
NN |
denotes |
DNA |
| T4706 |
6927-6928 |
HYPH |
denotes |
- |
| T4707 |
6928-6935 |
VBG |
denotes |
binding |
| T4699 |
6936-6941 |
NN |
denotes |
motif |
| T4708 |
6942-6948 |
VBN |
denotes |
called |
| T4709 |
6949-6952 |
DT |
denotes |
the |
| T4711 |
6953-6955 |
NN |
denotes |
DM |
| T4710 |
6956-6962 |
NN |
denotes |
domain |
| T4712 |
6963-6964 |
-LRB- |
denotes |
[ |
| T4714 |
6964-6966 |
CD |
denotes |
18 |
| T4715 |
6966-6967 |
, |
denotes |
, |
| T4713 |
6967-6969 |
CD |
denotes |
19 |
| T4716 |
6969-6970 |
-RRB- |
denotes |
] |
| T4717 |
6970-6971 |
. |
denotes |
. |
| T4718 |
6971-7107 |
sentence |
denotes |
DM domain–encoding genes have been shown to regulate various aspects of sexual differentiation in insects, nematodes, and mammals [20]. |
| T4719 |
6972-6974 |
NN |
denotes |
DM |
| T4721 |
6975-6981 |
NN |
denotes |
domain |
| T4723 |
6981-6982 |
HYPH |
denotes |
– |
| T4722 |
6982-6990 |
VBG |
denotes |
encoding |
| T4720 |
6991-6996 |
NNS |
denotes |
genes |
| T4725 |
6997-7001 |
VBP |
denotes |
have |
| T4726 |
7002-7006 |
VBN |
denotes |
been |
| T4724 |
7007-7012 |
VBN |
denotes |
shown |
| T4727 |
7013-7015 |
TO |
denotes |
to |
| T4728 |
7016-7024 |
VB |
denotes |
regulate |
| T4729 |
7025-7032 |
JJ |
denotes |
various |
| T4730 |
7033-7040 |
NNS |
denotes |
aspects |
| T4731 |
7041-7043 |
IN |
denotes |
of |
| T4732 |
7044-7050 |
JJ |
denotes |
sexual |
| T4733 |
7051-7066 |
NN |
denotes |
differentiation |
| T4734 |
7067-7069 |
IN |
denotes |
in |
| T4735 |
7070-7077 |
NNS |
denotes |
insects |
| T4736 |
7077-7079 |
, |
denotes |
, |
| T4737 |
7079-7088 |
NNS |
denotes |
nematodes |
| T4738 |
7088-7090 |
, |
denotes |
, |
| T4739 |
7090-7093 |
CC |
denotes |
and |
| T4740 |
7094-7101 |
NNS |
denotes |
mammals |
| T4741 |
7102-7103 |
-LRB- |
denotes |
[ |
| T4742 |
7103-7105 |
CD |
denotes |
20 |
| T4743 |
7105-7106 |
-RRB- |
denotes |
] |
| T4744 |
7106-7107 |
. |
denotes |
. |
| T4745 |
7107-7419 |
sentence |
denotes |
The mab-3 gene of Caenorhabditis elegans has been shown to function analogously to DSX in several respects and can be functionally replaced by the male isoform of DSX, suggesting that the similarity in the sequence of these genes may stem from conservation of an ancestral DM domain sexual regulator [18,21,22]. |
| T4746 |
7108-7111 |
DT |
denotes |
The |
| T4748 |
7112-7115 |
NN |
denotes |
mab |
| T4749 |
7115-7116 |
HYPH |
denotes |
- |
| T4750 |
7116-7117 |
CD |
denotes |
3 |
| T4747 |
7118-7122 |
NN |
denotes |
gene |
| T4752 |
7123-7125 |
IN |
denotes |
of |
| T4753 |
7126-7140 |
NNP |
denotes |
Caenorhabditis |
| T4754 |
7141-7148 |
NNP |
denotes |
elegans |
| T4755 |
7149-7152 |
VBZ |
denotes |
has |
| T4756 |
7153-7157 |
VBN |
denotes |
been |
| T4751 |
7158-7163 |
VBN |
denotes |
shown |
| T4757 |
7164-7166 |
TO |
denotes |
to |
| T4758 |
7167-7175 |
VB |
denotes |
function |
| T4759 |
7176-7187 |
RB |
denotes |
analogously |
| T4760 |
7188-7190 |
IN |
denotes |
to |
| T4761 |
7191-7194 |
NN |
denotes |
DSX |
| T4762 |
7195-7197 |
IN |
denotes |
in |
| T4763 |
7198-7205 |
JJ |
denotes |
several |
| T4764 |
7206-7214 |
NNS |
denotes |
respects |
| T4765 |
7215-7218 |
CC |
denotes |
and |
| T4766 |
7219-7222 |
MD |
denotes |
can |
| T4768 |
7223-7225 |
VB |
denotes |
be |
| T4769 |
7226-7238 |
RB |
denotes |
functionally |
| T4767 |
7239-7247 |
VBN |
denotes |
replaced |
| T4770 |
7248-7250 |
IN |
denotes |
by |
| T4771 |
7251-7254 |
DT |
denotes |
the |
| T4773 |
7255-7259 |
JJ |
denotes |
male |
| T4772 |
7260-7267 |
NN |
denotes |
isoform |
| T4774 |
7268-7270 |
IN |
denotes |
of |
| T4775 |
7271-7274 |
NN |
denotes |
DSX |
| T4776 |
7274-7276 |
, |
denotes |
, |
| T4777 |
7276-7286 |
VBG |
denotes |
suggesting |
| T4778 |
7287-7291 |
IN |
denotes |
that |
| T4780 |
7292-7295 |
DT |
denotes |
the |
| T4781 |
7296-7306 |
NN |
denotes |
similarity |
| T4782 |
7307-7309 |
IN |
denotes |
in |
| T4783 |
7310-7313 |
DT |
denotes |
the |
| T4784 |
7314-7322 |
NN |
denotes |
sequence |
| T4785 |
7323-7325 |
IN |
denotes |
of |
| T4786 |
7326-7331 |
DT |
denotes |
these |
| T4787 |
7332-7337 |
NNS |
denotes |
genes |
| T4788 |
7338-7341 |
MD |
denotes |
may |
| T4779 |
7342-7346 |
VB |
denotes |
stem |
| T4789 |
7347-7351 |
IN |
denotes |
from |
| T4790 |
7352-7364 |
NN |
denotes |
conservation |
| T4791 |
7365-7367 |
IN |
denotes |
of |
| T4792 |
7368-7370 |
DT |
denotes |
an |
| T4794 |
7371-7380 |
JJ |
denotes |
ancestral |
| T4795 |
7381-7383 |
NN |
denotes |
DM |
| T4796 |
7384-7390 |
NN |
denotes |
domain |
| T4797 |
7391-7397 |
JJ |
denotes |
sexual |
| T4793 |
7398-7407 |
NN |
denotes |
regulator |
| T4798 |
7408-7409 |
-LRB- |
denotes |
[ |
| T4800 |
7409-7411 |
CD |
denotes |
18 |
| T4801 |
7411-7412 |
, |
denotes |
, |
| T4802 |
7412-7414 |
CD |
denotes |
21 |
| T4803 |
7414-7415 |
, |
denotes |
, |
| T4799 |
7415-7417 |
CD |
denotes |
22 |
| T4804 |
7417-7418 |
-RRB- |
denotes |
] |
| T4805 |
7418-7419 |
. |
denotes |
. |
| T4806 |
7419-7562 |
sentence |
denotes |
Vertebrates also have DM domain genes, and analysis to date, although limited, has shown that these genes also control sexual differentiation. |
| T4807 |
7420-7431 |
NNS |
denotes |
Vertebrates |
| T4809 |
7432-7436 |
RB |
denotes |
also |
| T4808 |
7437-7441 |
VBP |
denotes |
have |
| T4810 |
7442-7444 |
NN |
denotes |
DM |
| T4811 |
7445-7451 |
NN |
denotes |
domain |
| T4812 |
7452-7457 |
NNS |
denotes |
genes |
| T4813 |
7457-7459 |
, |
denotes |
, |
| T4814 |
7459-7462 |
CC |
denotes |
and |
| T4815 |
7463-7471 |
NN |
denotes |
analysis |
| T4817 |
7472-7474 |
IN |
denotes |
to |
| T4818 |
7475-7479 |
NN |
denotes |
date |
| T4819 |
7479-7481 |
, |
denotes |
, |
| T4820 |
7481-7489 |
IN |
denotes |
although |
| T4821 |
7490-7497 |
JJ |
denotes |
limited |
| T4822 |
7497-7499 |
, |
denotes |
, |
| T4823 |
7499-7502 |
VBZ |
denotes |
has |
| T4816 |
7503-7508 |
VBN |
denotes |
shown |
| T4824 |
7509-7513 |
IN |
denotes |
that |
| T4826 |
7514-7519 |
DT |
denotes |
these |
| T4827 |
7520-7525 |
NNS |
denotes |
genes |
| T4828 |
7526-7530 |
RB |
denotes |
also |
| T4825 |
7531-7538 |
VBP |
denotes |
control |
| T4829 |
7539-7545 |
JJ |
denotes |
sexual |
| T4830 |
7546-7561 |
NN |
denotes |
differentiation |
| T4831 |
7561-7562 |
. |
denotes |
. |
| T4832 |
7562-7680 |
sentence |
denotes |
Mammals have seven DM domain genes (Dmrt genes), several of which exhibit sexually dimorphic mRNA expression [23,24]. |
| T4833 |
7563-7570 |
NNS |
denotes |
Mammals |
| T4834 |
7571-7575 |
VBP |
denotes |
have |
| T4835 |
7576-7581 |
CD |
denotes |
seven |
| T4837 |
7582-7584 |
NN |
denotes |
DM |
| T4838 |
7585-7591 |
NN |
denotes |
domain |
| T4836 |
7592-7597 |
NNS |
denotes |
genes |
| T4839 |
7598-7599 |
-LRB- |
denotes |
( |
| T4841 |
7599-7603 |
NN |
denotes |
Dmrt |
| T4840 |
7604-7609 |
NNS |
denotes |
genes |
| T4842 |
7609-7610 |
-RRB- |
denotes |
) |
| T4843 |
7610-7612 |
, |
denotes |
, |
| T4844 |
7612-7619 |
JJ |
denotes |
several |
| T4846 |
7620-7622 |
IN |
denotes |
of |
| T4847 |
7623-7628 |
WDT |
denotes |
which |
| T4845 |
7629-7636 |
VBP |
denotes |
exhibit |
| T4848 |
7637-7645 |
RB |
denotes |
sexually |
| T4849 |
7646-7655 |
JJ |
denotes |
dimorphic |
| T4851 |
7656-7660 |
NN |
denotes |
mRNA |
| T4850 |
7661-7671 |
NN |
denotes |
expression |
| T4852 |
7672-7673 |
-LRB- |
denotes |
[ |
| T4854 |
7673-7675 |
CD |
denotes |
23 |
| T4855 |
7675-7676 |
, |
denotes |
, |
| T4853 |
7676-7678 |
CD |
denotes |
24 |
| T4856 |
7678-7679 |
-RRB- |
denotes |
] |
| T4857 |
7679-7680 |
. |
denotes |
. |
| T4858 |
7680-7947 |
sentence |
denotes |
The best studied of these genes, Dmrt1, is expressed in the differentiating male genital ridges and adult testis of mammals, birds, fish, and reptiles, and a recently duplicated Dmrt1 gene functions as the Y-linked testis-determining gene in the Medaka fish [25–29]. |
| T4859 |
7681-7684 |
DT |
denotes |
The |
| T4861 |
7685-7689 |
RBS |
denotes |
best |
| T4860 |
7690-7697 |
VBN |
denotes |
studied |
| T4863 |
7698-7700 |
IN |
denotes |
of |
| T4864 |
7701-7706 |
DT |
denotes |
these |
| T4865 |
7707-7712 |
NNS |
denotes |
genes |
| T4866 |
7712-7714 |
, |
denotes |
, |
| T4867 |
7714-7719 |
NN |
denotes |
Dmrt1 |
| T4868 |
7719-7721 |
, |
denotes |
, |
| T4869 |
7721-7723 |
VBZ |
denotes |
is |
| T4862 |
7724-7733 |
VBN |
denotes |
expressed |
| T4870 |
7734-7736 |
IN |
denotes |
in |
| T4871 |
7737-7740 |
DT |
denotes |
the |
| T4873 |
7741-7756 |
VBG |
denotes |
differentiating |
| T4874 |
7757-7761 |
JJ |
denotes |
male |
| T4875 |
7762-7769 |
JJ |
denotes |
genital |
| T4872 |
7770-7776 |
NNS |
denotes |
ridges |
| T4876 |
7777-7780 |
CC |
denotes |
and |
| T4877 |
7781-7786 |
JJ |
denotes |
adult |
| T4878 |
7787-7793 |
NN |
denotes |
testis |
| T4879 |
7794-7796 |
IN |
denotes |
of |
| T4880 |
7797-7804 |
NNS |
denotes |
mammals |
| T4881 |
7804-7806 |
, |
denotes |
, |
| T4882 |
7806-7811 |
NNS |
denotes |
birds |
| T4883 |
7811-7813 |
, |
denotes |
, |
| T4884 |
7813-7817 |
NNS |
denotes |
fish |
| T4885 |
7817-7819 |
, |
denotes |
, |
| T4886 |
7819-7822 |
CC |
denotes |
and |
| T4887 |
7823-7831 |
NNS |
denotes |
reptiles |
| T4888 |
7831-7833 |
, |
denotes |
, |
| T4889 |
7833-7836 |
CC |
denotes |
and |
| T4890 |
7837-7838 |
DT |
denotes |
a |
| T4892 |
7839-7847 |
RB |
denotes |
recently |
| T4893 |
7848-7858 |
VBN |
denotes |
duplicated |
| T4894 |
7859-7864 |
NN |
denotes |
Dmrt1 |
| T4891 |
7865-7869 |
NN |
denotes |
gene |
| T4895 |
7870-7879 |
VBZ |
denotes |
functions |
| T4896 |
7880-7882 |
IN |
denotes |
as |
| T4897 |
7883-7886 |
DT |
denotes |
the |
| T4899 |
7887-7888 |
NN |
denotes |
Y |
| T4901 |
7888-7889 |
HYPH |
denotes |
- |
| T4900 |
7889-7895 |
VBN |
denotes |
linked |
| T4902 |
7896-7902 |
NN |
denotes |
testis |
| T4904 |
7902-7903 |
HYPH |
denotes |
- |
| T4903 |
7903-7914 |
VBG |
denotes |
determining |
| T4898 |
7915-7919 |
NN |
denotes |
gene |
| T4905 |
7920-7922 |
IN |
denotes |
in |
| T4906 |
7923-7926 |
DT |
denotes |
the |
| T4908 |
7927-7933 |
NNP |
denotes |
Medaka |
| T4907 |
7934-7938 |
NN |
denotes |
fish |
| T4909 |
7939-7940 |
-LRB- |
denotes |
[ |
| T4910 |
7940-7942 |
CD |
denotes |
25 |
| T4911 |
7942-7943 |
SYM |
denotes |
– |
| T4912 |
7943-7945 |
CD |
denotes |
29 |
| T4913 |
7945-7946 |
-RRB- |
denotes |
] |
| T4914 |
7946-7947 |
. |
denotes |
. |
| T4915 |
7947-8100 |
sentence |
denotes |
Human DMRT1 maps to an autosomal locus, which, when hemizygous, is associated with defective testicular development and consequent XY feminization [30]. |
| T4916 |
7948-7953 |
JJ |
denotes |
Human |
| T4917 |
7954-7959 |
NN |
denotes |
DMRT1 |
| T4918 |
7960-7964 |
VBZ |
denotes |
maps |
| T4919 |
7965-7967 |
IN |
denotes |
to |
| T4920 |
7968-7970 |
DT |
denotes |
an |
| T4922 |
7971-7980 |
JJ |
denotes |
autosomal |
| T4921 |
7981-7986 |
NN |
denotes |
locus |
| T4923 |
7986-7988 |
, |
denotes |
, |
| T4924 |
7988-7993 |
WDT |
denotes |
which |
| T4926 |
7993-7995 |
, |
denotes |
, |
| T4927 |
7995-7999 |
WRB |
denotes |
when |
| T4928 |
8000-8010 |
JJ |
denotes |
hemizygous |
| T4929 |
8010-8012 |
, |
denotes |
, |
| T4930 |
8012-8014 |
VBZ |
denotes |
is |
| T4925 |
8015-8025 |
VBN |
denotes |
associated |
| T4931 |
8026-8030 |
IN |
denotes |
with |
| T4932 |
8031-8040 |
JJ |
denotes |
defective |
| T4934 |
8041-8051 |
JJ |
denotes |
testicular |
| T4933 |
8052-8063 |
NN |
denotes |
development |
| T4935 |
8064-8067 |
CC |
denotes |
and |
| T4936 |
8068-8078 |
JJ |
denotes |
consequent |
| T4938 |
8079-8081 |
NN |
denotes |
XY |
| T4937 |
8082-8094 |
NN |
denotes |
feminization |
| T4939 |
8095-8096 |
-LRB- |
denotes |
[ |
| T4940 |
8096-8098 |
CD |
denotes |
30 |
| T4941 |
8098-8099 |
-RRB- |
denotes |
] |
| T4942 |
8099-8100 |
. |
denotes |
. |
| T4943 |
8100-8252 |
sentence |
denotes |
Similarly, mice homozygous for a null mutation in Dmrt1 have severe defects in testis differentiation involving both germ cells and Sertoli cells [31]. |
| T4944 |
8101-8110 |
RB |
denotes |
Similarly |
| T4946 |
8110-8112 |
, |
denotes |
, |
| T4947 |
8112-8116 |
NNS |
denotes |
mice |
| T4948 |
8117-8127 |
JJ |
denotes |
homozygous |
| T4949 |
8128-8131 |
IN |
denotes |
for |
| T4950 |
8132-8133 |
DT |
denotes |
a |
| T4952 |
8134-8138 |
JJ |
denotes |
null |
| T4951 |
8139-8147 |
NN |
denotes |
mutation |
| T4953 |
8148-8150 |
IN |
denotes |
in |
| T4954 |
8151-8156 |
NN |
denotes |
Dmrt1 |
| T4945 |
8157-8161 |
VBP |
denotes |
have |
| T4955 |
8162-8168 |
JJ |
denotes |
severe |
| T4956 |
8169-8176 |
NNS |
denotes |
defects |
| T4957 |
8177-8179 |
IN |
denotes |
in |
| T4958 |
8180-8186 |
NN |
denotes |
testis |
| T4959 |
8187-8202 |
NN |
denotes |
differentiation |
| T4960 |
8203-8212 |
VBG |
denotes |
involving |
| T4961 |
8213-8217 |
CC |
denotes |
both |
| T4963 |
8218-8222 |
NN |
denotes |
germ |
| T4962 |
8223-8228 |
NNS |
denotes |
cells |
| T4964 |
8229-8232 |
CC |
denotes |
and |
| T4965 |
8233-8240 |
NN |
denotes |
Sertoli |
| T4966 |
8241-8246 |
NNS |
denotes |
cells |
| T4967 |
8247-8248 |
-LRB- |
denotes |
[ |
| T4968 |
8248-8250 |
CD |
denotes |
31 |
| T4969 |
8250-8251 |
-RRB- |
denotes |
] |
| T4970 |
8251-8252 |
. |
denotes |
. |
| T4971 |
8252-8380 |
sentence |
denotes |
Female mice mutant in Dmrt4 have polyovular follicles, indicating that this gene also plays a role in gonadal development [32]. |
| T4972 |
8253-8259 |
JJ |
denotes |
Female |
| T4973 |
8260-8264 |
NNS |
denotes |
mice |
| T4975 |
8265-8271 |
JJ |
denotes |
mutant |
| T4976 |
8272-8274 |
IN |
denotes |
in |
| T4977 |
8275-8280 |
NN |
denotes |
Dmrt4 |
| T4974 |
8281-8285 |
VBP |
denotes |
have |
| T4978 |
8286-8296 |
JJ |
denotes |
polyovular |
| T4979 |
8297-8306 |
NNS |
denotes |
follicles |
| T4980 |
8306-8308 |
, |
denotes |
, |
| T4981 |
8308-8318 |
VBG |
denotes |
indicating |
| T4982 |
8319-8323 |
IN |
denotes |
that |
| T4984 |
8324-8328 |
DT |
denotes |
this |
| T4985 |
8329-8333 |
NN |
denotes |
gene |
| T4986 |
8334-8338 |
RB |
denotes |
also |
| T4983 |
8339-8344 |
VBZ |
denotes |
plays |
| T4987 |
8345-8346 |
DT |
denotes |
a |
| T4988 |
8347-8351 |
NN |
denotes |
role |
| T4989 |
8352-8354 |
IN |
denotes |
in |
| T4990 |
8355-8362 |
JJ |
denotes |
gonadal |
| T4991 |
8363-8374 |
NN |
denotes |
development |
| T4992 |
8375-8376 |
-LRB- |
denotes |
[ |
| T4993 |
8376-8378 |
CD |
denotes |
32 |
| T4994 |
8378-8379 |
-RRB- |
denotes |
] |
| T4995 |
8379-8380 |
. |
denotes |
. |
| T4996 |
8380-8502 |
sentence |
denotes |
It appears from these studies that the involvement of DM domain genes in sexual differentiation is ancient and conserved. |
| T4997 |
8381-8383 |
PRP |
denotes |
It |
| T4998 |
8384-8391 |
VBZ |
denotes |
appears |
| T4999 |
8392-8396 |
IN |
denotes |
from |
| T5000 |
8397-8402 |
DT |
denotes |
these |
| T5001 |
8403-8410 |
NNS |
denotes |
studies |
| T5002 |
8411-8415 |
IN |
denotes |
that |
| T5004 |
8416-8419 |
DT |
denotes |
the |
| T5005 |
8420-8431 |
NN |
denotes |
involvement |
| T5006 |
8432-8434 |
IN |
denotes |
of |
| T5007 |
8435-8437 |
NN |
denotes |
DM |
| T5008 |
8438-8444 |
NN |
denotes |
domain |
| T5009 |
8445-8450 |
NNS |
denotes |
genes |
| T5010 |
8451-8453 |
IN |
denotes |
in |
| T5011 |
8454-8460 |
JJ |
denotes |
sexual |
| T5012 |
8461-8476 |
NN |
denotes |
differentiation |
| T5003 |
8477-8479 |
VBZ |
denotes |
is |
| T5013 |
8480-8487 |
JJ |
denotes |
ancient |
| T5014 |
8488-8491 |
CC |
denotes |
and |
| T5015 |
8492-8501 |
JJ |
denotes |
conserved |
| T5016 |
8501-8502 |
. |
denotes |
. |
| T5017 |
8502-8658 |
sentence |
denotes |
However, vertebrate Dmrt gene function is not limited to sexual differentiation: Dmrt2 is required in both sexes for segmentation in mice and fish [33–35]. |
| T5018 |
8503-8510 |
RB |
denotes |
However |
| T5020 |
8510-8512 |
, |
denotes |
, |
| T5021 |
8512-8522 |
NN |
denotes |
vertebrate |
| T5023 |
8523-8527 |
NN |
denotes |
Dmrt |
| T5024 |
8528-8532 |
NN |
denotes |
gene |
| T5022 |
8533-8541 |
NN |
denotes |
function |
| T5019 |
8542-8544 |
VBZ |
denotes |
is |
| T5026 |
8545-8548 |
RB |
denotes |
not |
| T5027 |
8549-8556 |
JJ |
denotes |
limited |
| T5028 |
8557-8559 |
IN |
denotes |
to |
| T5029 |
8560-8566 |
JJ |
denotes |
sexual |
| T5030 |
8567-8582 |
NN |
denotes |
differentiation |
| T5031 |
8582-8584 |
: |
denotes |
: |
| T5032 |
8584-8589 |
NN |
denotes |
Dmrt2 |
| T5033 |
8590-8592 |
VBZ |
denotes |
is |
| T5025 |
8593-8601 |
VBN |
denotes |
required |
| T5034 |
8602-8604 |
IN |
denotes |
in |
| T5035 |
8605-8609 |
DT |
denotes |
both |
| T5036 |
8610-8615 |
NNS |
denotes |
sexes |
| T5037 |
8616-8619 |
IN |
denotes |
for |
| T5038 |
8620-8632 |
NN |
denotes |
segmentation |
| T5039 |
8633-8635 |
IN |
denotes |
in |
| T5040 |
8636-8640 |
NNS |
denotes |
mice |
| T5041 |
8641-8644 |
CC |
denotes |
and |
| T5042 |
8645-8649 |
NNS |
denotes |
fish |
| T5043 |
8650-8651 |
-LRB- |
denotes |
[ |
| T5044 |
8651-8653 |
CD |
denotes |
33 |
| T5045 |
8653-8654 |
SYM |
denotes |
– |
| T5046 |
8654-8656 |
CD |
denotes |
35 |
| T5047 |
8656-8657 |
-RRB- |
denotes |
] |
| T5048 |
8657-8658 |
. |
denotes |
. |
| T5049 |
8658-8745 |
sentence |
denotes |
Here, we have investigated the expression and function of the Dmrt7 gene in the mouse. |
| T5050 |
8659-8663 |
RB |
denotes |
Here |
| T5052 |
8663-8665 |
, |
denotes |
, |
| T5053 |
8665-8667 |
PRP |
denotes |
we |
| T5054 |
8668-8672 |
VBP |
denotes |
have |
| T5051 |
8673-8685 |
VBN |
denotes |
investigated |
| T5055 |
8686-8689 |
DT |
denotes |
the |
| T5056 |
8690-8700 |
NN |
denotes |
expression |
| T5057 |
8701-8704 |
CC |
denotes |
and |
| T5058 |
8705-8713 |
NN |
denotes |
function |
| T5059 |
8714-8716 |
IN |
denotes |
of |
| T5060 |
8717-8720 |
DT |
denotes |
the |
| T5062 |
8721-8726 |
NN |
denotes |
Dmrt7 |
| T5061 |
8727-8731 |
NN |
denotes |
gene |
| T5063 |
8732-8734 |
IN |
denotes |
in |
| T5064 |
8735-8738 |
DT |
denotes |
the |
| T5065 |
8739-8744 |
NN |
denotes |
mouse |
| T5066 |
8744-8745 |
. |
denotes |
. |
| T5067 |
8745-8907 |
sentence |
denotes |
Dmrt7 is expressed only in the gonad, and, unlike the other Dmrt genes, appears to be present exclusively in mammals and not in nonmammalian vertebrates [23,36]. |
| T5068 |
8746-8751 |
NN |
denotes |
Dmrt7 |
| T5070 |
8752-8754 |
VBZ |
denotes |
is |
| T5069 |
8755-8764 |
VBN |
denotes |
expressed |
| T5071 |
8765-8769 |
RB |
denotes |
only |
| T5072 |
8770-8772 |
IN |
denotes |
in |
| T5073 |
8773-8776 |
DT |
denotes |
the |
| T5074 |
8777-8782 |
NN |
denotes |
gonad |
| T5075 |
8782-8784 |
, |
denotes |
, |
| T5076 |
8784-8787 |
CC |
denotes |
and |
| T5077 |
8787-8789 |
, |
denotes |
, |
| T5078 |
8789-8795 |
IN |
denotes |
unlike |
| T5080 |
8796-8799 |
DT |
denotes |
the |
| T5082 |
8800-8805 |
JJ |
denotes |
other |
| T5083 |
8806-8810 |
NN |
denotes |
Dmrt |
| T5081 |
8811-8816 |
NNS |
denotes |
genes |
| T5084 |
8816-8818 |
, |
denotes |
, |
| T5079 |
8818-8825 |
VBZ |
denotes |
appears |
| T5085 |
8826-8828 |
TO |
denotes |
to |
| T5086 |
8829-8831 |
VB |
denotes |
be |
| T5087 |
8832-8839 |
JJ |
denotes |
present |
| T5088 |
8840-8851 |
RB |
denotes |
exclusively |
| T5089 |
8852-8854 |
IN |
denotes |
in |
| T5090 |
8855-8862 |
NNS |
denotes |
mammals |
| T5091 |
8863-8866 |
CC |
denotes |
and |
| T5092 |
8867-8870 |
RB |
denotes |
not |
| T5093 |
8871-8873 |
IN |
denotes |
in |
| T5094 |
8874-8886 |
JJ |
denotes |
nonmammalian |
| T5095 |
8887-8898 |
NNS |
denotes |
vertebrates |
| T5096 |
8899-8900 |
-LRB- |
denotes |
[ |
| T5098 |
8900-8902 |
CD |
denotes |
23 |
| T5099 |
8902-8903 |
, |
denotes |
, |
| T5097 |
8903-8905 |
CD |
denotes |
36 |
| T5100 |
8905-8906 |
-RRB- |
denotes |
] |
| T5101 |
8906-8907 |
. |
denotes |
. |
| T5102 |
8907-9040 |
sentence |
denotes |
We find that DMRT7 protein is expressed only in germ cells and is selectively localized to the XY body of male pachytene germ cells. |
| T5103 |
8908-8910 |
PRP |
denotes |
We |
| T5104 |
8911-8915 |
VBP |
denotes |
find |
| T5105 |
8916-8920 |
IN |
denotes |
that |
| T5107 |
8921-8926 |
NN |
denotes |
DMRT7 |
| T5108 |
8927-8934 |
NN |
denotes |
protein |
| T5109 |
8935-8937 |
VBZ |
denotes |
is |
| T5106 |
8938-8947 |
VBN |
denotes |
expressed |
| T5110 |
8948-8952 |
RB |
denotes |
only |
| T5111 |
8953-8955 |
IN |
denotes |
in |
| T5112 |
8956-8960 |
NN |
denotes |
germ |
| T5113 |
8961-8966 |
NNS |
denotes |
cells |
| T5114 |
8967-8970 |
CC |
denotes |
and |
| T5115 |
8971-8973 |
VBZ |
denotes |
is |
| T5117 |
8974-8985 |
RB |
denotes |
selectively |
| T5116 |
8986-8995 |
VBN |
denotes |
localized |
| T5118 |
8996-8998 |
IN |
denotes |
to |
| T5119 |
8999-9002 |
DT |
denotes |
the |
| T5121 |
9003-9005 |
NN |
denotes |
XY |
| T5120 |
9006-9010 |
NN |
denotes |
body |
| T5122 |
9011-9013 |
IN |
denotes |
of |
| T5123 |
9014-9018 |
JJ |
denotes |
male |
| T5125 |
9019-9028 |
NN |
denotes |
pachytene |
| T5126 |
9029-9033 |
NN |
denotes |
germ |
| T5124 |
9034-9039 |
NNS |
denotes |
cells |
| T5127 |
9039-9040 |
. |
denotes |
. |
| T5128 |
9040-9126 |
sentence |
denotes |
To test its function, we generated a conditional null mutation of Dmrt7 in the mouse. |
| T5129 |
9041-9043 |
TO |
denotes |
To |
| T5130 |
9044-9048 |
VB |
denotes |
test |
| T5132 |
9049-9052 |
PRP$ |
denotes |
its |
| T5133 |
9053-9061 |
NN |
denotes |
function |
| T5134 |
9061-9063 |
, |
denotes |
, |
| T5135 |
9063-9065 |
PRP |
denotes |
we |
| T5131 |
9066-9075 |
VBD |
denotes |
generated |
| T5136 |
9076-9077 |
DT |
denotes |
a |
| T5138 |
9078-9089 |
JJ |
denotes |
conditional |
| T5139 |
9090-9094 |
JJ |
denotes |
null |
| T5137 |
9095-9103 |
NN |
denotes |
mutation |
| T5140 |
9104-9106 |
IN |
denotes |
of |
| T5141 |
9107-9112 |
NN |
denotes |
Dmrt7 |
| T5142 |
9113-9115 |
IN |
denotes |
in |
| T5143 |
9116-9119 |
DT |
denotes |
the |
| T5144 |
9120-9125 |
NN |
denotes |
mouse |
| T5145 |
9125-9126 |
. |
denotes |
. |
| T5146 |
9126-9261 |
sentence |
denotes |
We find that Dmrt7 is required in males for progression beyond the pachytene stage of meiotic prophase but is not required in females. |
| T5147 |
9127-9129 |
PRP |
denotes |
We |
| T5148 |
9130-9134 |
VBP |
denotes |
find |
| T5149 |
9135-9139 |
IN |
denotes |
that |
| T5151 |
9140-9145 |
NN |
denotes |
Dmrt7 |
| T5152 |
9146-9148 |
VBZ |
denotes |
is |
| T5150 |
9149-9157 |
VBN |
denotes |
required |
| T5153 |
9158-9160 |
IN |
denotes |
in |
| T5154 |
9161-9166 |
NNS |
denotes |
males |
| T5155 |
9167-9170 |
IN |
denotes |
for |
| T5156 |
9171-9182 |
NN |
denotes |
progression |
| T5157 |
9183-9189 |
IN |
denotes |
beyond |
| T5158 |
9190-9193 |
DT |
denotes |
the |
| T5160 |
9194-9203 |
NN |
denotes |
pachytene |
| T5159 |
9204-9209 |
NN |
denotes |
stage |
| T5161 |
9210-9212 |
IN |
denotes |
of |
| T5162 |
9213-9220 |
JJ |
denotes |
meiotic |
| T5163 |
9221-9229 |
NN |
denotes |
prophase |
| T5164 |
9230-9233 |
CC |
denotes |
but |
| T5165 |
9234-9236 |
VBZ |
denotes |
is |
| T5167 |
9237-9240 |
RB |
denotes |
not |
| T5166 |
9241-9249 |
VBN |
denotes |
required |
| T5168 |
9250-9252 |
IN |
denotes |
in |
| T5169 |
9253-9260 |
NNS |
denotes |
females |
| T5170 |
9260-9261 |
. |
denotes |
. |
| T5171 |
9261-9350 |
sentence |
denotes |
In rare mutant cells that survive to diplonema, we observed sex chromatin abnormalities. |
| T5172 |
9262-9264 |
IN |
denotes |
In |
| T5174 |
9265-9269 |
JJ |
denotes |
rare |
| T5176 |
9270-9276 |
NN |
denotes |
mutant |
| T5175 |
9277-9282 |
NNS |
denotes |
cells |
| T5177 |
9283-9287 |
WDT |
denotes |
that |
| T5178 |
9288-9295 |
VBP |
denotes |
survive |
| T5179 |
9296-9298 |
IN |
denotes |
to |
| T5180 |
9299-9308 |
NN |
denotes |
diplonema |
| T5181 |
9308-9310 |
, |
denotes |
, |
| T5182 |
9310-9312 |
PRP |
denotes |
we |
| T5173 |
9313-9321 |
VBD |
denotes |
observed |
| T5183 |
9322-9325 |
NN |
denotes |
sex |
| T5184 |
9326-9335 |
NN |
denotes |
chromatin |
| T5185 |
9336-9349 |
NNS |
denotes |
abnormalities |
| T5186 |
9349-9350 |
. |
denotes |
. |
| T5187 |
9350-9520 |
sentence |
denotes |
Based on these observations, we suggest that Dmrt7 plays a critical role in a male-specific chromatin transition between pachynema and diplonema during meiotic prophase. |
| T5188 |
9351-9356 |
VBN |
denotes |
Based |
| T5190 |
9357-9359 |
IN |
denotes |
on |
| T5191 |
9360-9365 |
DT |
denotes |
these |
| T5192 |
9366-9378 |
NNS |
denotes |
observations |
| T5193 |
9378-9380 |
, |
denotes |
, |
| T5194 |
9380-9382 |
PRP |
denotes |
we |
| T5189 |
9383-9390 |
VBP |
denotes |
suggest |
| T5195 |
9391-9395 |
IN |
denotes |
that |
| T5197 |
9396-9401 |
NN |
denotes |
Dmrt7 |
| T5196 |
9402-9407 |
VBZ |
denotes |
plays |
| T5198 |
9408-9409 |
DT |
denotes |
a |
| T5200 |
9410-9418 |
JJ |
denotes |
critical |
| T5199 |
9419-9423 |
NN |
denotes |
role |
| T5201 |
9424-9426 |
IN |
denotes |
in |
| T5202 |
9427-9428 |
DT |
denotes |
a |
| T5204 |
9429-9433 |
JJ |
denotes |
male |
| T5206 |
9433-9434 |
HYPH |
denotes |
- |
| T5205 |
9434-9442 |
JJ |
denotes |
specific |
| T5207 |
9443-9452 |
NN |
denotes |
chromatin |
| T5203 |
9453-9463 |
NN |
denotes |
transition |
| T5208 |
9464-9471 |
IN |
denotes |
between |
| T5209 |
9472-9481 |
NN |
denotes |
pachynema |
| T5210 |
9482-9485 |
CC |
denotes |
and |
| T5211 |
9486-9495 |
NN |
denotes |
diplonema |
| T5212 |
9496-9502 |
IN |
denotes |
during |
| T5213 |
9503-9510 |
JJ |
denotes |
meiotic |
| T5214 |
9511-9519 |
NN |
denotes |
prophase |
| T5215 |
9519-9520 |
. |
denotes |
. |
| T6759 |
9531-9541 |
NN |
denotes |
Expression |
| T6760 |
9542-9544 |
IN |
denotes |
of |
| T6761 |
9545-9550 |
NN |
denotes |
DMRT7 |
| T6762 |
9551-9559 |
NNS |
denotes |
Proteins |
| T6763 |
9560-9562 |
IN |
denotes |
in |
| T6764 |
9563-9569 |
NN |
denotes |
Testis |
| T6765 |
9569-9737 |
sentence |
denotes |
Our previous mRNA expression analysis suggested a possible meiotic function for Dmrt7, based on the expression of Dmrt7 mRNA in the fetal gonads of the two sexes [23]. |
| T6766 |
9570-9573 |
PRP$ |
denotes |
Our |
| T6768 |
9574-9582 |
JJ |
denotes |
previous |
| T6769 |
9583-9587 |
NN |
denotes |
mRNA |
| T6770 |
9588-9598 |
NN |
denotes |
expression |
| T6767 |
9599-9607 |
NN |
denotes |
analysis |
| T6771 |
9608-9617 |
VBD |
denotes |
suggested |
| T6772 |
9618-9619 |
DT |
denotes |
a |
| T6774 |
9620-9628 |
JJ |
denotes |
possible |
| T6775 |
9629-9636 |
JJ |
denotes |
meiotic |
| T6773 |
9637-9645 |
NN |
denotes |
function |
| T6776 |
9646-9649 |
IN |
denotes |
for |
| T6777 |
9650-9655 |
NN |
denotes |
Dmrt7 |
| T6778 |
9655-9657 |
, |
denotes |
, |
| T6779 |
9657-9662 |
VBN |
denotes |
based |
| T6780 |
9663-9665 |
IN |
denotes |
on |
| T6781 |
9666-9669 |
DT |
denotes |
the |
| T6782 |
9670-9680 |
NN |
denotes |
expression |
| T6783 |
9681-9683 |
IN |
denotes |
of |
| T6784 |
9684-9689 |
NN |
denotes |
Dmrt7 |
| T6785 |
9690-9694 |
NN |
denotes |
mRNA |
| T6786 |
9695-9697 |
IN |
denotes |
in |
| T6787 |
9698-9701 |
DT |
denotes |
the |
| T6789 |
9702-9707 |
JJ |
denotes |
fetal |
| T6788 |
9708-9714 |
NNS |
denotes |
gonads |
| T6790 |
9715-9717 |
IN |
denotes |
of |
| T6791 |
9718-9721 |
DT |
denotes |
the |
| T6793 |
9722-9725 |
CD |
denotes |
two |
| T6792 |
9726-9731 |
NNS |
denotes |
sexes |
| T6794 |
9732-9733 |
-LRB- |
denotes |
[ |
| T6795 |
9733-9735 |
CD |
denotes |
23 |
| T6796 |
9735-9736 |
-RRB- |
denotes |
] |
| T6797 |
9736-9737 |
. |
denotes |
. |
| T6798 |
9737-9981 |
sentence |
denotes |
In the fetal ovary, Dmrt7 mRNA was detected primarily from E13.5 to E15.5, the time during which meiosis progresses from pre-meiotic replication to the pachytene stage [4], whereas Dmrt7 expression in the non-meiotic fetal testis was very low. |
| T6799 |
9738-9740 |
IN |
denotes |
In |
| T6801 |
9741-9744 |
DT |
denotes |
the |
| T6803 |
9745-9750 |
JJ |
denotes |
fetal |
| T6802 |
9751-9756 |
NN |
denotes |
ovary |
| T6804 |
9756-9758 |
, |
denotes |
, |
| T6805 |
9758-9763 |
NN |
denotes |
Dmrt7 |
| T6806 |
9764-9768 |
NN |
denotes |
mRNA |
| T6807 |
9769-9772 |
VBD |
denotes |
was |
| T6800 |
9773-9781 |
VBN |
denotes |
detected |
| T6808 |
9782-9791 |
RB |
denotes |
primarily |
| T6809 |
9792-9796 |
IN |
denotes |
from |
| T6810 |
9797-9802 |
NN |
denotes |
E13.5 |
| T6811 |
9803-9805 |
IN |
denotes |
to |
| T6812 |
9806-9811 |
NN |
denotes |
E15.5 |
| T6813 |
9811-9813 |
, |
denotes |
, |
| T6814 |
9813-9816 |
DT |
denotes |
the |
| T6815 |
9817-9821 |
NN |
denotes |
time |
| T6816 |
9822-9828 |
IN |
denotes |
during |
| T6818 |
9829-9834 |
WDT |
denotes |
which |
| T6819 |
9835-9842 |
NN |
denotes |
meiosis |
| T6817 |
9843-9853 |
VBZ |
denotes |
progresses |
| T6820 |
9854-9858 |
IN |
denotes |
from |
| T6821 |
9859-9870 |
JJ |
denotes |
pre-meiotic |
| T6822 |
9871-9882 |
NN |
denotes |
replication |
| T6823 |
9883-9885 |
IN |
denotes |
to |
| T6824 |
9886-9889 |
DT |
denotes |
the |
| T6826 |
9890-9899 |
NN |
denotes |
pachytene |
| T6825 |
9900-9905 |
NN |
denotes |
stage |
| T6827 |
9906-9907 |
-LRB- |
denotes |
[ |
| T6828 |
9907-9908 |
CD |
denotes |
4 |
| T6829 |
9908-9909 |
-RRB- |
denotes |
] |
| T6830 |
9909-9911 |
, |
denotes |
, |
| T6831 |
9911-9918 |
IN |
denotes |
whereas |
| T6833 |
9919-9924 |
NN |
denotes |
Dmrt7 |
| T6834 |
9925-9935 |
NN |
denotes |
expression |
| T6835 |
9936-9938 |
IN |
denotes |
in |
| T6836 |
9939-9942 |
DT |
denotes |
the |
| T6838 |
9943-9954 |
JJ |
denotes |
non-meiotic |
| T6839 |
9955-9960 |
JJ |
denotes |
fetal |
| T6837 |
9961-9967 |
NN |
denotes |
testis |
| T6832 |
9968-9971 |
VBD |
denotes |
was |
| T6840 |
9972-9976 |
RB |
denotes |
very |
| T6841 |
9977-9980 |
JJ |
denotes |
low |
| T6842 |
9980-9981 |
. |
denotes |
. |
| T6843 |
9981-10267 |
sentence |
denotes |
Because this earlier work did not examine adult Dmrt7 expression, we first performed reverse transcriptase (RT)-PCR on mRNA from ten adult organs and detected strong Dmrt7 mRNA expression in the testis and a trace of expression in heart, but not in any other tissue tested (Figure 1A). |
| T6844 |
9982-9989 |
IN |
denotes |
Because |
| T6846 |
9990-9994 |
DT |
denotes |
this |
| T6848 |
9995-10002 |
JJR |
denotes |
earlier |
| T6847 |
10003-10007 |
NN |
denotes |
work |
| T6849 |
10008-10011 |
VBD |
denotes |
did |
| T6850 |
10012-10015 |
RB |
denotes |
not |
| T6845 |
10016-10023 |
VB |
denotes |
examine |
| T6852 |
10024-10029 |
JJ |
denotes |
adult |
| T6854 |
10030-10035 |
NN |
denotes |
Dmrt7 |
| T6853 |
10036-10046 |
NN |
denotes |
expression |
| T6855 |
10046-10048 |
, |
denotes |
, |
| T6856 |
10048-10050 |
PRP |
denotes |
we |
| T6857 |
10051-10056 |
RB |
denotes |
first |
| T6851 |
10057-10066 |
VBD |
denotes |
performed |
| T6858 |
10067-10074 |
JJ |
denotes |
reverse |
| T6859 |
10075-10088 |
NN |
denotes |
transcriptase |
| T6861 |
10089-10090 |
-LRB- |
denotes |
( |
| T6862 |
10090-10092 |
NN |
denotes |
RT |
| T6863 |
10092-10093 |
-RRB- |
denotes |
) |
| T6864 |
10093-10094 |
HYPH |
denotes |
- |
| T6860 |
10094-10097 |
NN |
denotes |
PCR |
| T6865 |
10098-10100 |
IN |
denotes |
on |
| T6866 |
10101-10105 |
NN |
denotes |
mRNA |
| T6867 |
10106-10110 |
IN |
denotes |
from |
| T6868 |
10111-10114 |
CD |
denotes |
ten |
| T6870 |
10115-10120 |
JJ |
denotes |
adult |
| T6869 |
10121-10127 |
NNS |
denotes |
organs |
| T6871 |
10128-10131 |
CC |
denotes |
and |
| T6872 |
10132-10140 |
VBN |
denotes |
detected |
| T6873 |
10141-10147 |
JJ |
denotes |
strong |
| T6875 |
10148-10153 |
NN |
denotes |
Dmrt7 |
| T6876 |
10154-10158 |
NN |
denotes |
mRNA |
| T6874 |
10159-10169 |
NN |
denotes |
expression |
| T6877 |
10170-10172 |
IN |
denotes |
in |
| T6878 |
10173-10176 |
DT |
denotes |
the |
| T6879 |
10177-10183 |
NN |
denotes |
testis |
| T6880 |
10184-10187 |
CC |
denotes |
and |
| T6881 |
10188-10189 |
DT |
denotes |
a |
| T6882 |
10190-10195 |
NN |
denotes |
trace |
| T6883 |
10196-10198 |
IN |
denotes |
of |
| T6884 |
10199-10209 |
NN |
denotes |
expression |
| T6885 |
10210-10212 |
IN |
denotes |
in |
| T6886 |
10213-10218 |
NN |
denotes |
heart |
| T6887 |
10218-10220 |
, |
denotes |
, |
| T6888 |
10220-10223 |
CC |
denotes |
but |
| T6889 |
10224-10227 |
RB |
denotes |
not |
| T6890 |
10228-10230 |
IN |
denotes |
in |
| T6891 |
10231-10234 |
DT |
denotes |
any |
| T6893 |
10235-10240 |
JJ |
denotes |
other |
| T6892 |
10241-10247 |
NN |
denotes |
tissue |
| T6894 |
10248-10254 |
VBN |
denotes |
tested |
| T6895 |
10255-10256 |
-LRB- |
denotes |
( |
| T6897 |
10256-10262 |
NN |
denotes |
Figure |
| T6896 |
10263-10265 |
NN |
denotes |
1A |
| T6898 |
10265-10266 |
-RRB- |
denotes |
) |
| T6899 |
10266-10267 |
. |
denotes |
. |
| T6900 |
10267-10534 |
sentence |
denotes |
We examined the timing of Dmrt7 mRNA expression during postnatal testis development and detected strong expression beginning at 2 wk, which roughly coincides with the onset of the pachytene stage during the first synchronous wave of spermatogenesis (Figure 1B) [37]. |
| T6901 |
10268-10270 |
PRP |
denotes |
We |
| T6902 |
10271-10279 |
VBD |
denotes |
examined |
| T6903 |
10280-10283 |
DT |
denotes |
the |
| T6904 |
10284-10290 |
NN |
denotes |
timing |
| T6905 |
10291-10293 |
IN |
denotes |
of |
| T6906 |
10294-10299 |
NN |
denotes |
Dmrt7 |
| T6908 |
10300-10304 |
NN |
denotes |
mRNA |
| T6907 |
10305-10315 |
NN |
denotes |
expression |
| T6909 |
10316-10322 |
IN |
denotes |
during |
| T6910 |
10323-10332 |
JJ |
denotes |
postnatal |
| T6912 |
10333-10339 |
NN |
denotes |
testis |
| T6911 |
10340-10351 |
NN |
denotes |
development |
| T6913 |
10352-10355 |
CC |
denotes |
and |
| T6914 |
10356-10364 |
VBD |
denotes |
detected |
| T6915 |
10365-10371 |
JJ |
denotes |
strong |
| T6916 |
10372-10382 |
NN |
denotes |
expression |
| T6917 |
10383-10392 |
VBG |
denotes |
beginning |
| T6918 |
10393-10395 |
IN |
denotes |
at |
| T6919 |
10396-10397 |
CD |
denotes |
2 |
| T6920 |
10398-10400 |
NNS |
denotes |
wk |
| T6921 |
10400-10402 |
, |
denotes |
, |
| T6922 |
10402-10407 |
WDT |
denotes |
which |
| T6924 |
10408-10415 |
RB |
denotes |
roughly |
| T6923 |
10416-10425 |
VBZ |
denotes |
coincides |
| T6925 |
10426-10430 |
IN |
denotes |
with |
| T6926 |
10431-10434 |
DT |
denotes |
the |
| T6927 |
10435-10440 |
NN |
denotes |
onset |
| T6928 |
10441-10443 |
IN |
denotes |
of |
| T6929 |
10444-10447 |
DT |
denotes |
the |
| T6931 |
10448-10457 |
NN |
denotes |
pachytene |
| T6930 |
10458-10463 |
NN |
denotes |
stage |
| T6932 |
10464-10470 |
IN |
denotes |
during |
| T6933 |
10471-10474 |
DT |
denotes |
the |
| T6935 |
10475-10480 |
JJ |
denotes |
first |
| T6936 |
10481-10492 |
JJ |
denotes |
synchronous |
| T6934 |
10493-10497 |
NN |
denotes |
wave |
| T6937 |
10498-10500 |
IN |
denotes |
of |
| T6938 |
10501-10516 |
NN |
denotes |
spermatogenesis |
| T6939 |
10517-10518 |
-LRB- |
denotes |
( |
| T6941 |
10518-10524 |
NN |
denotes |
Figure |
| T6940 |
10525-10527 |
NN |
denotes |
1B |
| T6942 |
10527-10528 |
-RRB- |
denotes |
) |
| T6943 |
10529-10530 |
-LRB- |
denotes |
[ |
| T6944 |
10530-10532 |
CD |
denotes |
37 |
| T6945 |
10532-10533 |
-RRB- |
denotes |
] |
| T6946 |
10533-10534 |
. |
denotes |
. |
| T6947 |
10534-10535 |
sentence |
denotes |
|
| T27759 |
10545-10555 |
NN |
denotes |
Expression |
| T27760 |
10556-10558 |
IN |
denotes |
of |
| T27761 |
10559-10564 |
NN |
denotes |
Dmrt7 |
| T27762 |
10565-10569 |
NN |
denotes |
mRNA |
| T27763 |
10570-10573 |
CC |
denotes |
and |
| T27764 |
10574-10581 |
NN |
denotes |
Protein |
| T27765 |
10581-10647 |
sentence |
denotes |
(A) RT-PCR analysis of Dmrt7 mRNA from ten organs of adult mouse. |
| T27766 |
10582-10583 |
-LRB- |
denotes |
( |
| T27767 |
10583-10584 |
LS |
denotes |
A |
| T27769 |
10584-10585 |
-RRB- |
denotes |
) |
| T27770 |
10586-10588 |
NN |
denotes |
RT |
| T27772 |
10588-10589 |
HYPH |
denotes |
- |
| T27771 |
10589-10592 |
NN |
denotes |
PCR |
| T27768 |
10593-10601 |
NN |
denotes |
analysis |
| T27773 |
10602-10604 |
IN |
denotes |
of |
| T27774 |
10605-10610 |
NN |
denotes |
Dmrt7 |
| T27775 |
10611-10615 |
NN |
denotes |
mRNA |
| T27776 |
10616-10620 |
IN |
denotes |
from |
| T27777 |
10621-10624 |
CD |
denotes |
ten |
| T27778 |
10625-10631 |
NNS |
denotes |
organs |
| T27779 |
10632-10634 |
IN |
denotes |
of |
| T27780 |
10635-10640 |
JJ |
denotes |
adult |
| T27781 |
10641-10646 |
NN |
denotes |
mouse |
| T27782 |
10646-10647 |
. |
denotes |
. |
| T27783 |
10647-10750 |
sentence |
denotes |
cDNA from each organ was amplified with primers specific for Dmrt7 (top row) and β-actin (bottom row). |
| T27784 |
10648-10652 |
NN |
denotes |
cDNA |
| T27786 |
10653-10657 |
IN |
denotes |
from |
| T27787 |
10658-10662 |
DT |
denotes |
each |
| T27788 |
10663-10668 |
NN |
denotes |
organ |
| T27789 |
10669-10672 |
VBD |
denotes |
was |
| T27785 |
10673-10682 |
VBN |
denotes |
amplified |
| T27790 |
10683-10687 |
IN |
denotes |
with |
| T27791 |
10688-10695 |
NNS |
denotes |
primers |
| T27792 |
10696-10704 |
JJ |
denotes |
specific |
| T27793 |
10705-10708 |
IN |
denotes |
for |
| T27794 |
10709-10714 |
NN |
denotes |
Dmrt7 |
| T27795 |
10715-10716 |
-LRB- |
denotes |
( |
| T27797 |
10716-10719 |
JJ |
denotes |
top |
| T27796 |
10720-10723 |
NN |
denotes |
row |
| T27798 |
10723-10724 |
-RRB- |
denotes |
) |
| T27799 |
10725-10728 |
CC |
denotes |
and |
| T27800 |
10729-10730 |
NN |
denotes |
β |
| T27802 |
10730-10731 |
HYPH |
denotes |
- |
| T27801 |
10731-10736 |
NN |
denotes |
actin |
| T27803 |
10737-10738 |
-LRB- |
denotes |
( |
| T27805 |
10738-10744 |
JJ |
denotes |
bottom |
| T27804 |
10745-10748 |
NN |
denotes |
row |
| T27806 |
10748-10749 |
-RRB- |
denotes |
) |
| T27807 |
10749-10750 |
. |
denotes |
. |
| T27808 |
10750-10819 |
sentence |
denotes |
(B) Dmrt7 mRNA expression during the first round of spermatogenesis. |
| T27809 |
10751-10752 |
-LRB- |
denotes |
( |
| T27810 |
10752-10753 |
LS |
denotes |
B |
| T27812 |
10753-10754 |
-RRB- |
denotes |
) |
| T27813 |
10755-10760 |
NN |
denotes |
Dmrt7 |
| T27814 |
10761-10765 |
NN |
denotes |
mRNA |
| T27811 |
10766-10776 |
NN |
denotes |
expression |
| T27815 |
10777-10783 |
IN |
denotes |
during |
| T27816 |
10784-10787 |
DT |
denotes |
the |
| T27818 |
10788-10793 |
JJ |
denotes |
first |
| T27817 |
10794-10799 |
NN |
denotes |
round |
| T27819 |
10800-10802 |
IN |
denotes |
of |
| T27820 |
10803-10818 |
NN |
denotes |
spermatogenesis |
| T27821 |
10818-10819 |
. |
denotes |
. |
| T27822 |
10819-10906 |
sentence |
denotes |
cDNAs obtained from testis at the indicated days after birth were amplified as in (A). |
| T27823 |
10820-10825 |
NNS |
denotes |
cDNAs |
| T27825 |
10826-10834 |
VBN |
denotes |
obtained |
| T27826 |
10835-10839 |
IN |
denotes |
from |
| T27827 |
10840-10846 |
NN |
denotes |
testis |
| T27828 |
10847-10849 |
IN |
denotes |
at |
| T27829 |
10850-10853 |
DT |
denotes |
the |
| T27831 |
10854-10863 |
VBN |
denotes |
indicated |
| T27830 |
10864-10868 |
NNS |
denotes |
days |
| T27832 |
10869-10874 |
IN |
denotes |
after |
| T27833 |
10875-10880 |
NN |
denotes |
birth |
| T27834 |
10881-10885 |
VBD |
denotes |
were |
| T27824 |
10886-10895 |
VBN |
denotes |
amplified |
| T27835 |
10896-10898 |
IN |
denotes |
as |
| T27836 |
10899-10901 |
IN |
denotes |
in |
| T27837 |
10902-10903 |
-LRB- |
denotes |
( |
| T27838 |
10903-10904 |
NN |
denotes |
A |
| T27839 |
10904-10905 |
-RRB- |
denotes |
) |
| T27840 |
10905-10906 |
. |
denotes |
. |
| T27841 |
10906-10936 |
sentence |
denotes |
(C) DMRT7 protein expression. |
| T27842 |
10907-10908 |
-LRB- |
denotes |
( |
| T27843 |
10908-10909 |
LS |
denotes |
C |
| T27845 |
10909-10910 |
-RRB- |
denotes |
) |
| T27846 |
10911-10916 |
NN |
denotes |
DMRT7 |
| T27847 |
10917-10924 |
NN |
denotes |
protein |
| T27844 |
10925-10935 |
NN |
denotes |
expression |
| T27848 |
10935-10936 |
. |
denotes |
. |
| T27849 |
10936-11049 |
sentence |
denotes |
Immunofluorescence of testis sections from 6-wk-old male stained with antibody to DMRT7 (green) and DAPI (blue). |
| T27850 |
10937-10955 |
NN |
denotes |
Immunofluorescence |
| T27851 |
10956-10958 |
IN |
denotes |
of |
| T27852 |
10959-10965 |
NN |
denotes |
testis |
| T27853 |
10966-10974 |
NNS |
denotes |
sections |
| T27854 |
10975-10979 |
IN |
denotes |
from |
| T27855 |
10980-10981 |
CD |
denotes |
6 |
| T27857 |
10981-10982 |
HYPH |
denotes |
- |
| T27856 |
10982-10984 |
NN |
denotes |
wk |
| T27859 |
10984-10985 |
HYPH |
denotes |
- |
| T27858 |
10985-10988 |
JJ |
denotes |
old |
| T27860 |
10989-10993 |
JJ |
denotes |
male |
| T27861 |
10994-11001 |
VBN |
denotes |
stained |
| T27862 |
11002-11006 |
IN |
denotes |
with |
| T27863 |
11007-11015 |
NN |
denotes |
antibody |
| T27864 |
11016-11018 |
IN |
denotes |
to |
| T27865 |
11019-11024 |
NN |
denotes |
DMRT7 |
| T27866 |
11025-11026 |
-LRB- |
denotes |
( |
| T27867 |
11026-11031 |
JJ |
denotes |
green |
| T27868 |
11031-11032 |
-RRB- |
denotes |
) |
| T27869 |
11033-11036 |
CC |
denotes |
and |
| T27870 |
11037-11041 |
NN |
denotes |
DAPI |
| T27871 |
11042-11043 |
-LRB- |
denotes |
( |
| T27872 |
11043-11047 |
JJ |
denotes |
blue |
| T27873 |
11047-11048 |
-RRB- |
denotes |
) |
| T27874 |
11048-11049 |
. |
denotes |
. |
| T27875 |
11049-11096 |
sentence |
denotes |
(D) DMRT7 subcellular localization to XY body. |
| T27876 |
11050-11051 |
-LRB- |
denotes |
( |
| T27877 |
11051-11052 |
LS |
denotes |
D |
| T27879 |
11052-11053 |
-RRB- |
denotes |
) |
| T27880 |
11054-11059 |
NN |
denotes |
DMRT7 |
| T27881 |
11060-11071 |
JJ |
denotes |
subcellular |
| T27878 |
11072-11084 |
NN |
denotes |
localization |
| T27882 |
11085-11087 |
IN |
denotes |
to |
| T27883 |
11088-11090 |
NN |
denotes |
XY |
| T27884 |
11091-11095 |
NN |
denotes |
body |
| T27885 |
11095-11096 |
. |
denotes |
. |
| T27886 |
11096-11190 |
sentence |
denotes |
Testis sections from 6-wk-old male stained with antibodies to DMRT7 (red) and SUMO-1 (green). |
| T27887 |
11097-11103 |
NN |
denotes |
Testis |
| T27888 |
11104-11112 |
NNS |
denotes |
sections |
| T27889 |
11113-11117 |
IN |
denotes |
from |
| T27890 |
11118-11119 |
CD |
denotes |
6 |
| T27892 |
11119-11120 |
HYPH |
denotes |
- |
| T27891 |
11120-11122 |
NN |
denotes |
wk |
| T27894 |
11122-11123 |
HYPH |
denotes |
- |
| T27893 |
11123-11126 |
JJ |
denotes |
old |
| T27895 |
11127-11131 |
JJ |
denotes |
male |
| T27896 |
11132-11139 |
VBN |
denotes |
stained |
| T27897 |
11140-11144 |
IN |
denotes |
with |
| T27898 |
11145-11155 |
NNS |
denotes |
antibodies |
| T27899 |
11156-11158 |
IN |
denotes |
to |
| T27900 |
11159-11164 |
NN |
denotes |
DMRT7 |
| T27901 |
11165-11166 |
-LRB- |
denotes |
( |
| T27902 |
11166-11169 |
JJ |
denotes |
red |
| T27903 |
11169-11170 |
-RRB- |
denotes |
) |
| T27904 |
11171-11174 |
CC |
denotes |
and |
| T27905 |
11175-11179 |
NN |
denotes |
SUMO |
| T27906 |
11179-11180 |
HYPH |
denotes |
- |
| T27907 |
11180-11181 |
CD |
denotes |
1 |
| T27908 |
11182-11183 |
-LRB- |
denotes |
( |
| T27909 |
11183-11188 |
JJ |
denotes |
green |
| T27910 |
11188-11189 |
-RRB- |
denotes |
) |
| T27911 |
11189-11190 |
. |
denotes |
. |
| T27912 |
11190-11226 |
sentence |
denotes |
SUMO-1 is localized to the XY body. |
| T27913 |
11191-11195 |
NN |
denotes |
SUMO |
| T27915 |
11195-11196 |
HYPH |
denotes |
- |
| T27916 |
11196-11197 |
CD |
denotes |
1 |
| T27917 |
11198-11200 |
VBZ |
denotes |
is |
| T27914 |
11201-11210 |
VBN |
denotes |
localized |
| T27918 |
11211-11213 |
IN |
denotes |
to |
| T27919 |
11214-11217 |
DT |
denotes |
the |
| T27921 |
11218-11220 |
NN |
denotes |
XY |
| T27920 |
11221-11225 |
NN |
denotes |
body |
| T27922 |
11225-11226 |
. |
denotes |
. |
| T27923 |
11226-11276 |
sentence |
denotes |
Right-most panel shows merge of other two panels. |
| T27924 |
11227-11237 |
JJ |
denotes |
Right-most |
| T27925 |
11238-11243 |
NN |
denotes |
panel |
| T27926 |
11244-11249 |
VBZ |
denotes |
shows |
| T27927 |
11250-11255 |
NN |
denotes |
merge |
| T27928 |
11256-11258 |
IN |
denotes |
of |
| T27929 |
11259-11264 |
JJ |
denotes |
other |
| T27931 |
11265-11268 |
CD |
denotes |
two |
| T27930 |
11269-11275 |
NNS |
denotes |
panels |
| T27932 |
11275-11276 |
. |
denotes |
. |
| T27933 |
11276-11353 |
sentence |
denotes |
Inserts show higher magnification of pachytene spermatocytes with XY bodies. |
| T27934 |
11277-11284 |
NNS |
denotes |
Inserts |
| T27935 |
11285-11289 |
VBP |
denotes |
show |
| T27936 |
11290-11296 |
JJR |
denotes |
higher |
| T27937 |
11297-11310 |
NN |
denotes |
magnification |
| T27938 |
11311-11313 |
IN |
denotes |
of |
| T27939 |
11314-11323 |
NN |
denotes |
pachytene |
| T27940 |
11324-11337 |
NNS |
denotes |
spermatocytes |
| T27941 |
11338-11342 |
IN |
denotes |
with |
| T27942 |
11343-11345 |
NN |
denotes |
XY |
| T27943 |
11346-11352 |
NNS |
denotes |
bodies |
| T27944 |
11352-11353 |
. |
denotes |
. |
| T6949 |
11354-11356 |
TO |
denotes |
To |
| T6948 |
11354-11466 |
sentence |
denotes |
To investigate DMRT7 protein expression, we generated an antibody against the C-terminal portion of the protein. |
| T6950 |
11357-11368 |
VB |
denotes |
investigate |
| T6952 |
11369-11374 |
NN |
denotes |
DMRT7 |
| T6954 |
11375-11382 |
NN |
denotes |
protein |
| T6953 |
11383-11393 |
NN |
denotes |
expression |
| T6955 |
11393-11395 |
, |
denotes |
, |
| T6956 |
11395-11397 |
PRP |
denotes |
we |
| T6951 |
11398-11407 |
VBD |
denotes |
generated |
| T6957 |
11408-11410 |
DT |
denotes |
an |
| T6958 |
11411-11419 |
NN |
denotes |
antibody |
| T6959 |
11420-11427 |
IN |
denotes |
against |
| T6960 |
11428-11431 |
DT |
denotes |
the |
| T6962 |
11432-11433 |
NN |
denotes |
C |
| T6964 |
11433-11434 |
HYPH |
denotes |
- |
| T6963 |
11434-11442 |
JJ |
denotes |
terminal |
| T6961 |
11443-11450 |
NN |
denotes |
portion |
| T6965 |
11451-11453 |
IN |
denotes |
of |
| T6966 |
11454-11457 |
DT |
denotes |
the |
| T6967 |
11458-11465 |
NN |
denotes |
protein |
| T6968 |
11465-11466 |
. |
denotes |
. |
| T6969 |
11466-11600 |
sentence |
denotes |
The antibody was raised against a unique region lacking the DM domain in order to avoid cross-reaction with other DM domain proteins. |
| T6970 |
11467-11470 |
DT |
denotes |
The |
| T6971 |
11471-11479 |
NN |
denotes |
antibody |
| T6973 |
11480-11483 |
VBD |
denotes |
was |
| T6972 |
11484-11490 |
VBN |
denotes |
raised |
| T6974 |
11491-11498 |
IN |
denotes |
against |
| T6975 |
11499-11500 |
DT |
denotes |
a |
| T6977 |
11501-11507 |
JJ |
denotes |
unique |
| T6976 |
11508-11514 |
NN |
denotes |
region |
| T6978 |
11515-11522 |
VBG |
denotes |
lacking |
| T6979 |
11523-11526 |
DT |
denotes |
the |
| T6981 |
11527-11529 |
NN |
denotes |
DM |
| T6980 |
11530-11536 |
NN |
denotes |
domain |
| T6982 |
11537-11539 |
IN |
denotes |
in |
| T6983 |
11540-11545 |
NN |
denotes |
order |
| T6984 |
11546-11548 |
TO |
denotes |
to |
| T6985 |
11549-11554 |
VB |
denotes |
avoid |
| T6986 |
11555-11569 |
NN |
denotes |
cross-reaction |
| T6987 |
11570-11574 |
IN |
denotes |
with |
| T6988 |
11575-11580 |
JJ |
denotes |
other |
| T6990 |
11581-11583 |
NN |
denotes |
DM |
| T6991 |
11584-11590 |
NN |
denotes |
domain |
| T6989 |
11591-11599 |
NN |
denotes |
proteins |
| T6992 |
11599-11600 |
. |
denotes |
. |
| T6993 |
11600-11876 |
sentence |
denotes |
Immunofluorescent staining with purified DMRT7 antisera showed that DMRT7 protein is expressed predominantly in mid- to late-pachytene spermatocytes (Figure 1C), as well as in sperm, and is not detectable in other germ cell types including spermatogonia and round spermatids. |
| T6994 |
11601-11618 |
JJ |
denotes |
Immunofluorescent |
| T6995 |
11619-11627 |
NN |
denotes |
staining |
| T6997 |
11628-11632 |
IN |
denotes |
with |
| T6998 |
11633-11641 |
VBN |
denotes |
purified |
| T7000 |
11642-11647 |
NN |
denotes |
DMRT7 |
| T6999 |
11648-11656 |
NNS |
denotes |
antisera |
| T6996 |
11657-11663 |
VBD |
denotes |
showed |
| T7001 |
11664-11668 |
IN |
denotes |
that |
| T7003 |
11669-11674 |
NN |
denotes |
DMRT7 |
| T7004 |
11675-11682 |
NN |
denotes |
protein |
| T7005 |
11683-11685 |
VBZ |
denotes |
is |
| T7002 |
11686-11695 |
VBN |
denotes |
expressed |
| T7006 |
11696-11709 |
RB |
denotes |
predominantly |
| T7007 |
11710-11712 |
IN |
denotes |
in |
| T7008 |
11713-11716 |
JJ |
denotes |
mid |
| T7010 |
11716-11717 |
HYPH |
denotes |
- |
| T7011 |
11718-11720 |
IN |
denotes |
to |
| T7012 |
11721-11725 |
JJ |
denotes |
late |
| T7013 |
11725-11726 |
HYPH |
denotes |
- |
| T7009 |
11726-11735 |
NN |
denotes |
pachytene |
| T7014 |
11736-11749 |
NNS |
denotes |
spermatocytes |
| T7015 |
11750-11751 |
-LRB- |
denotes |
( |
| T7017 |
11751-11757 |
NN |
denotes |
Figure |
| T7016 |
11758-11760 |
NN |
denotes |
1C |
| T7018 |
11760-11761 |
-RRB- |
denotes |
) |
| T7019 |
11761-11763 |
, |
denotes |
, |
| T7020 |
11763-11765 |
RB |
denotes |
as |
| T7022 |
11766-11770 |
RB |
denotes |
well |
| T7021 |
11771-11773 |
IN |
denotes |
as |
| T7023 |
11774-11776 |
IN |
denotes |
in |
| T7024 |
11777-11782 |
NN |
denotes |
sperm |
| T7025 |
11782-11784 |
, |
denotes |
, |
| T7026 |
11784-11787 |
CC |
denotes |
and |
| T7027 |
11788-11790 |
VBZ |
denotes |
is |
| T7028 |
11791-11794 |
RB |
denotes |
not |
| T7029 |
11795-11805 |
JJ |
denotes |
detectable |
| T7030 |
11806-11808 |
IN |
denotes |
in |
| T7031 |
11809-11814 |
JJ |
denotes |
other |
| T7033 |
11815-11819 |
NN |
denotes |
germ |
| T7034 |
11820-11824 |
NN |
denotes |
cell |
| T7032 |
11825-11830 |
NNS |
denotes |
types |
| T7035 |
11831-11840 |
VBG |
denotes |
including |
| T7036 |
11841-11854 |
NNS |
denotes |
spermatogonia |
| T7037 |
11855-11858 |
CC |
denotes |
and |
| T7038 |
11859-11864 |
JJ |
denotes |
round |
| T7039 |
11865-11875 |
NNS |
denotes |
spermatids |
| T7040 |
11875-11876 |
. |
denotes |
. |
| T7041 |
11876-11990 |
sentence |
denotes |
We did not detect DMRT7 protein in somatic cells such as Sertoli cells, peritubular myoid cells, or Leydig cells. |
| T7042 |
11877-11879 |
PRP |
denotes |
We |
| T7044 |
11880-11883 |
VBD |
denotes |
did |
| T7045 |
11884-11887 |
RB |
denotes |
not |
| T7043 |
11888-11894 |
VB |
denotes |
detect |
| T7046 |
11895-11900 |
NN |
denotes |
DMRT7 |
| T7047 |
11901-11908 |
NN |
denotes |
protein |
| T7048 |
11909-11911 |
IN |
denotes |
in |
| T7049 |
11912-11919 |
JJ |
denotes |
somatic |
| T7050 |
11920-11925 |
NNS |
denotes |
cells |
| T7051 |
11926-11930 |
JJ |
denotes |
such |
| T7052 |
11931-11933 |
IN |
denotes |
as |
| T7053 |
11934-11941 |
NNP |
denotes |
Sertoli |
| T7054 |
11942-11947 |
NNS |
denotes |
cells |
| T7055 |
11947-11949 |
, |
denotes |
, |
| T7056 |
11949-11960 |
JJ |
denotes |
peritubular |
| T7058 |
11961-11966 |
JJ |
denotes |
myoid |
| T7057 |
11967-11972 |
NNS |
denotes |
cells |
| T7059 |
11972-11974 |
, |
denotes |
, |
| T7060 |
11974-11976 |
CC |
denotes |
or |
| T7061 |
11977-11983 |
NNP |
denotes |
Leydig |
| T7062 |
11984-11989 |
NNS |
denotes |
cells |
| T7063 |
11989-11990 |
. |
denotes |
. |
| T7064 |
11990-12169 |
sentence |
denotes |
To more precisely determine the pachytene stages of DMRT7 expression, we double-stained with an antibody to GATA1, which is expressed in Sertoli cells from stages VII to IX [38]. |
| T7065 |
11991-11993 |
TO |
denotes |
To |
| T7067 |
11994-11998 |
RBR |
denotes |
more |
| T7068 |
11999-12008 |
RB |
denotes |
precisely |
| T7066 |
12009-12018 |
VB |
denotes |
determine |
| T7070 |
12019-12022 |
DT |
denotes |
the |
| T7072 |
12023-12032 |
NN |
denotes |
pachytene |
| T7071 |
12033-12039 |
NNS |
denotes |
stages |
| T7073 |
12040-12042 |
IN |
denotes |
of |
| T7074 |
12043-12048 |
NN |
denotes |
DMRT7 |
| T7075 |
12049-12059 |
NN |
denotes |
expression |
| T7076 |
12059-12061 |
, |
denotes |
, |
| T7077 |
12061-12063 |
PRP |
denotes |
we |
| T7078 |
12064-12070 |
RB |
denotes |
double |
| T7079 |
12070-12071 |
HYPH |
denotes |
- |
| T7069 |
12071-12078 |
VBN |
denotes |
stained |
| T7080 |
12079-12083 |
IN |
denotes |
with |
| T7081 |
12084-12086 |
DT |
denotes |
an |
| T7082 |
12087-12095 |
NN |
denotes |
antibody |
| T7083 |
12096-12098 |
IN |
denotes |
to |
| T7084 |
12099-12104 |
NN |
denotes |
GATA1 |
| T7085 |
12104-12106 |
, |
denotes |
, |
| T7086 |
12106-12111 |
WDT |
denotes |
which |
| T7088 |
12112-12114 |
VBZ |
denotes |
is |
| T7087 |
12115-12124 |
VBN |
denotes |
expressed |
| T7089 |
12125-12127 |
IN |
denotes |
in |
| T7090 |
12128-12135 |
NNP |
denotes |
Sertoli |
| T7091 |
12136-12141 |
NNS |
denotes |
cells |
| T7092 |
12142-12146 |
IN |
denotes |
from |
| T7093 |
12147-12153 |
NNS |
denotes |
stages |
| T7094 |
12154-12157 |
CD |
denotes |
VII |
| T7095 |
12158-12160 |
IN |
denotes |
to |
| T7096 |
12161-12163 |
CD |
denotes |
IX |
| T7097 |
12164-12165 |
-LRB- |
denotes |
[ |
| T7098 |
12165-12167 |
CD |
denotes |
38 |
| T7099 |
12167-12168 |
-RRB- |
denotes |
] |
| T7100 |
12168-12169 |
. |
denotes |
. |
| T7101 |
12169-12341 |
sentence |
denotes |
This confirmed that DMRT7 is expressed in mid- to late-pachytene spermatocytes, starting slightly earlier than stage VII and extending through stage IX (unpublished data). |
| T7102 |
12170-12174 |
DT |
denotes |
This |
| T7103 |
12175-12184 |
VBD |
denotes |
confirmed |
| T7104 |
12185-12189 |
IN |
denotes |
that |
| T7106 |
12190-12195 |
NN |
denotes |
DMRT7 |
| T7107 |
12196-12198 |
VBZ |
denotes |
is |
| T7105 |
12199-12208 |
VBN |
denotes |
expressed |
| T7108 |
12209-12211 |
IN |
denotes |
in |
| T7109 |
12212-12215 |
JJ |
denotes |
mid |
| T7111 |
12215-12216 |
HYPH |
denotes |
- |
| T7112 |
12217-12219 |
IN |
denotes |
to |
| T7113 |
12220-12224 |
JJ |
denotes |
late |
| T7114 |
12224-12225 |
HYPH |
denotes |
- |
| T7110 |
12225-12234 |
NN |
denotes |
pachytene |
| T7115 |
12235-12248 |
NNS |
denotes |
spermatocytes |
| T7116 |
12248-12250 |
, |
denotes |
, |
| T7117 |
12250-12258 |
VBG |
denotes |
starting |
| T7118 |
12259-12267 |
RB |
denotes |
slightly |
| T7119 |
12268-12275 |
RBR |
denotes |
earlier |
| T7120 |
12276-12280 |
IN |
denotes |
than |
| T7121 |
12281-12286 |
NN |
denotes |
stage |
| T7122 |
12287-12290 |
CD |
denotes |
VII |
| T7123 |
12291-12294 |
CC |
denotes |
and |
| T7124 |
12295-12304 |
VBG |
denotes |
extending |
| T7125 |
12305-12312 |
IN |
denotes |
through |
| T7126 |
12313-12318 |
NN |
denotes |
stage |
| T7127 |
12319-12321 |
CD |
denotes |
IX |
| T7128 |
12322-12323 |
-LRB- |
denotes |
( |
| T7130 |
12323-12334 |
JJ |
denotes |
unpublished |
| T7129 |
12335-12339 |
NNS |
denotes |
data |
| T7131 |
12339-12340 |
-RRB- |
denotes |
) |
| T7132 |
12340-12341 |
. |
denotes |
. |
| T7133 |
12341-12494 |
sentence |
denotes |
Within pachytene spermatocytes, DMRT7 is concentrated in the XY body, or sex body, a densely staining chromatin domain that harbors the sex chromosomes. |
| T7134 |
12342-12348 |
IN |
denotes |
Within |
| T7136 |
12349-12358 |
NN |
denotes |
pachytene |
| T7137 |
12359-12372 |
NNS |
denotes |
spermatocytes |
| T7138 |
12372-12374 |
, |
denotes |
, |
| T7139 |
12374-12379 |
NN |
denotes |
DMRT7 |
| T7140 |
12380-12382 |
VBZ |
denotes |
is |
| T7135 |
12383-12395 |
VBN |
denotes |
concentrated |
| T7141 |
12396-12398 |
IN |
denotes |
in |
| T7142 |
12399-12402 |
DT |
denotes |
the |
| T7144 |
12403-12405 |
NN |
denotes |
XY |
| T7143 |
12406-12410 |
NN |
denotes |
body |
| T7145 |
12410-12412 |
, |
denotes |
, |
| T7146 |
12412-12414 |
CC |
denotes |
or |
| T7147 |
12415-12418 |
NN |
denotes |
sex |
| T7148 |
12419-12423 |
NN |
denotes |
body |
| T7149 |
12423-12425 |
, |
denotes |
, |
| T7150 |
12425-12426 |
DT |
denotes |
a |
| T7152 |
12427-12434 |
RB |
denotes |
densely |
| T7153 |
12435-12443 |
VBG |
denotes |
staining |
| T7154 |
12444-12453 |
NN |
denotes |
chromatin |
| T7151 |
12454-12460 |
NN |
denotes |
domain |
| T7155 |
12461-12465 |
WDT |
denotes |
that |
| T7156 |
12466-12473 |
VBZ |
denotes |
harbors |
| T7157 |
12474-12477 |
DT |
denotes |
the |
| T7159 |
12478-12481 |
NN |
denotes |
sex |
| T7158 |
12482-12493 |
NNS |
denotes |
chromosomes |
| T7160 |
12493-12494 |
. |
denotes |
. |
| T7161 |
12494-12652 |
sentence |
denotes |
These undergo transcriptional inactivation and heterochromatinization as a result of their incomplete pairing during prophase of mammalian male meiosis [17]. |
| T7162 |
12495-12500 |
DT |
denotes |
These |
| T7163 |
12501-12508 |
VBP |
denotes |
undergo |
| T7164 |
12509-12524 |
JJ |
denotes |
transcriptional |
| T7165 |
12525-12537 |
NN |
denotes |
inactivation |
| T7166 |
12538-12541 |
CC |
denotes |
and |
| T7167 |
12542-12564 |
NN |
denotes |
heterochromatinization |
| T7168 |
12565-12567 |
IN |
denotes |
as |
| T7169 |
12568-12569 |
DT |
denotes |
a |
| T7170 |
12570-12576 |
NN |
denotes |
result |
| T7171 |
12577-12579 |
IN |
denotes |
of |
| T7172 |
12580-12585 |
PRP$ |
denotes |
their |
| T7174 |
12586-12596 |
JJ |
denotes |
incomplete |
| T7173 |
12597-12604 |
NN |
denotes |
pairing |
| T7175 |
12605-12611 |
IN |
denotes |
during |
| T7176 |
12612-12620 |
NN |
denotes |
prophase |
| T7177 |
12621-12623 |
IN |
denotes |
of |
| T7178 |
12624-12633 |
JJ |
denotes |
mammalian |
| T7180 |
12634-12638 |
JJ |
denotes |
male |
| T7179 |
12639-12646 |
NN |
denotes |
meiosis |
| T7181 |
12647-12648 |
-LRB- |
denotes |
[ |
| T7182 |
12648-12650 |
CD |
denotes |
17 |
| T7183 |
12650-12651 |
-RRB- |
denotes |
] |
| T7184 |
12651-12652 |
. |
denotes |
. |
| T7185 |
12652-12865 |
sentence |
denotes |
To verify DMRT7 protein expression in the XY body, we double-stained mouse testis sections for DMRT7 and small ubiquitin-related modifier 1 (SUMO-1), which is concentrated in the XY body during pachynema [39,40]. |
| T7186 |
12653-12655 |
TO |
denotes |
To |
| T7187 |
12656-12662 |
VB |
denotes |
verify |
| T7189 |
12663-12668 |
NN |
denotes |
DMRT7 |
| T7191 |
12669-12676 |
NN |
denotes |
protein |
| T7190 |
12677-12687 |
NN |
denotes |
expression |
| T7192 |
12688-12690 |
IN |
denotes |
in |
| T7193 |
12691-12694 |
DT |
denotes |
the |
| T7195 |
12695-12697 |
NN |
denotes |
XY |
| T7194 |
12698-12702 |
NN |
denotes |
body |
| T7196 |
12702-12704 |
, |
denotes |
, |
| T7197 |
12704-12706 |
PRP |
denotes |
we |
| T7198 |
12707-12713 |
RB |
denotes |
double |
| T7199 |
12713-12714 |
HYPH |
denotes |
- |
| T7188 |
12714-12721 |
VBD |
denotes |
stained |
| T7200 |
12722-12727 |
NN |
denotes |
mouse |
| T7201 |
12728-12734 |
NN |
denotes |
testis |
| T7202 |
12735-12743 |
NNS |
denotes |
sections |
| T7203 |
12744-12747 |
IN |
denotes |
for |
| T7204 |
12748-12753 |
NN |
denotes |
DMRT7 |
| T7205 |
12754-12757 |
CC |
denotes |
and |
| T7206 |
12758-12763 |
JJ |
denotes |
small |
| T7208 |
12764-12773 |
NN |
denotes |
ubiquitin |
| T7210 |
12773-12774 |
HYPH |
denotes |
- |
| T7209 |
12774-12781 |
VBN |
denotes |
related |
| T7207 |
12782-12790 |
NN |
denotes |
modifier |
| T7211 |
12791-12792 |
CD |
denotes |
1 |
| T7212 |
12793-12794 |
-LRB- |
denotes |
( |
| T7213 |
12794-12798 |
NN |
denotes |
SUMO |
| T7214 |
12798-12799 |
HYPH |
denotes |
- |
| T7215 |
12799-12800 |
CD |
denotes |
1 |
| T7216 |
12800-12801 |
-RRB- |
denotes |
) |
| T7217 |
12801-12803 |
, |
denotes |
, |
| T7218 |
12803-12808 |
WDT |
denotes |
which |
| T7220 |
12809-12811 |
VBZ |
denotes |
is |
| T7219 |
12812-12824 |
VBN |
denotes |
concentrated |
| T7221 |
12825-12827 |
IN |
denotes |
in |
| T7222 |
12828-12831 |
DT |
denotes |
the |
| T7224 |
12832-12834 |
NN |
denotes |
XY |
| T7223 |
12835-12839 |
NN |
denotes |
body |
| T7225 |
12840-12846 |
IN |
denotes |
during |
| T7226 |
12847-12856 |
NN |
denotes |
pachynema |
| T7227 |
12857-12858 |
-LRB- |
denotes |
[ |
| T7229 |
12858-12860 |
CD |
denotes |
39 |
| T7230 |
12860-12861 |
, |
denotes |
, |
| T7228 |
12861-12863 |
CD |
denotes |
40 |
| T7231 |
12863-12864 |
-RRB- |
denotes |
] |
| T7232 |
12864-12865 |
. |
denotes |
. |
| T7233 |
12865-12986 |
sentence |
denotes |
DMRT7 and SUMO-1 were colocalized, confirming that DMRT7 protein is preferentially localized to the XY body (Figure 1D). |
| T7234 |
12866-12871 |
NN |
denotes |
DMRT7 |
| T7236 |
12872-12875 |
CC |
denotes |
and |
| T7237 |
12876-12880 |
NN |
denotes |
SUMO |
| T7238 |
12880-12881 |
HYPH |
denotes |
- |
| T7239 |
12881-12882 |
CD |
denotes |
1 |
| T7240 |
12883-12887 |
VBD |
denotes |
were |
| T7235 |
12888-12899 |
VBN |
denotes |
colocalized |
| T7241 |
12899-12901 |
, |
denotes |
, |
| T7242 |
12901-12911 |
VBG |
denotes |
confirming |
| T7243 |
12912-12916 |
IN |
denotes |
that |
| T7245 |
12917-12922 |
NN |
denotes |
DMRT7 |
| T7246 |
12923-12930 |
NN |
denotes |
protein |
| T7247 |
12931-12933 |
VBZ |
denotes |
is |
| T7248 |
12934-12948 |
RB |
denotes |
preferentially |
| T7244 |
12949-12958 |
VBN |
denotes |
localized |
| T7249 |
12959-12961 |
IN |
denotes |
to |
| T7250 |
12962-12965 |
DT |
denotes |
the |
| T7252 |
12966-12968 |
NN |
denotes |
XY |
| T7251 |
12969-12973 |
NN |
denotes |
body |
| T7253 |
12974-12975 |
-LRB- |
denotes |
( |
| T7255 |
12975-12981 |
NN |
denotes |
Figure |
| T7254 |
12982-12984 |
NN |
denotes |
1D |
| T7256 |
12984-12985 |
-RRB- |
denotes |
) |
| T7257 |
12985-12986 |
. |
denotes |
. |
| T7258 |
12986-13118 |
sentence |
denotes |
We also confirmed XY body localization of DMRT7 by double staining for other markers including Ub-H2A and γH2AX (unpublished data). |
| T7259 |
12987-12989 |
PRP |
denotes |
We |
| T7261 |
12990-12994 |
RB |
denotes |
also |
| T7260 |
12995-13004 |
VBD |
denotes |
confirmed |
| T7262 |
13005-13007 |
NN |
denotes |
XY |
| T7264 |
13008-13012 |
NN |
denotes |
body |
| T7263 |
13013-13025 |
NN |
denotes |
localization |
| T7265 |
13026-13028 |
IN |
denotes |
of |
| T7266 |
13029-13034 |
NN |
denotes |
DMRT7 |
| T7267 |
13035-13037 |
IN |
denotes |
by |
| T7268 |
13038-13044 |
JJ |
denotes |
double |
| T7269 |
13045-13053 |
NN |
denotes |
staining |
| T7270 |
13054-13057 |
IN |
denotes |
for |
| T7271 |
13058-13063 |
JJ |
denotes |
other |
| T7272 |
13064-13071 |
NNS |
denotes |
markers |
| T7273 |
13072-13081 |
VBG |
denotes |
including |
| T7274 |
13082-13084 |
NN |
denotes |
Ub |
| T7276 |
13084-13085 |
HYPH |
denotes |
- |
| T7275 |
13085-13088 |
NN |
denotes |
H2A |
| T7277 |
13089-13092 |
CC |
denotes |
and |
| T7278 |
13093-13098 |
NN |
denotes |
γH2AX |
| T7279 |
13099-13100 |
-LRB- |
denotes |
( |
| T7281 |
13100-13111 |
JJ |
denotes |
unpublished |
| T7280 |
13112-13116 |
NNS |
denotes |
data |
| T7282 |
13116-13117 |
-RRB- |
denotes |
) |
| T7283 |
13117-13118 |
. |
denotes |
. |
| T7284 |
13118-13209 |
sentence |
denotes |
DMRT7 is not preferentially localized to the XY body at all stages but instead is dynamic. |
| T7285 |
13119-13124 |
NN |
denotes |
DMRT7 |
| T7287 |
13125-13127 |
VBZ |
denotes |
is |
| T7288 |
13128-13131 |
RB |
denotes |
not |
| T7289 |
13132-13146 |
RB |
denotes |
preferentially |
| T7286 |
13147-13156 |
VBN |
denotes |
localized |
| T7290 |
13157-13159 |
IN |
denotes |
to |
| T7291 |
13160-13163 |
DT |
denotes |
the |
| T7293 |
13164-13166 |
NN |
denotes |
XY |
| T7292 |
13167-13171 |
NN |
denotes |
body |
| T7294 |
13172-13174 |
IN |
denotes |
at |
| T7295 |
13175-13178 |
DT |
denotes |
all |
| T7296 |
13179-13185 |
NNS |
denotes |
stages |
| T7297 |
13186-13189 |
CC |
denotes |
but |
| T7298 |
13190-13197 |
RB |
denotes |
instead |
| T7299 |
13198-13200 |
VBZ |
denotes |
is |
| T7300 |
13201-13208 |
JJ |
denotes |
dynamic |
| T7301 |
13208-13209 |
. |
denotes |
. |
| T7302 |
13209-13411 |
sentence |
denotes |
Based on epithelial staging, it appears that DMRT7 localizes to the XY body from mid- to late-pachynema, becomes diffusely distributed in late-pachynema, and disappears in diplonema (unpublished data). |
| T7303 |
13210-13215 |
VBN |
denotes |
Based |
| T7305 |
13216-13218 |
IN |
denotes |
on |
| T7306 |
13219-13229 |
JJ |
denotes |
epithelial |
| T7307 |
13230-13237 |
NN |
denotes |
staging |
| T7308 |
13237-13239 |
, |
denotes |
, |
| T7309 |
13239-13241 |
PRP |
denotes |
it |
| T7304 |
13242-13249 |
VBZ |
denotes |
appears |
| T7310 |
13250-13254 |
IN |
denotes |
that |
| T7312 |
13255-13260 |
NN |
denotes |
DMRT7 |
| T7311 |
13261-13270 |
VBZ |
denotes |
localizes |
| T7313 |
13271-13273 |
IN |
denotes |
to |
| T7314 |
13274-13277 |
DT |
denotes |
the |
| T7316 |
13278-13280 |
NN |
denotes |
XY |
| T7315 |
13281-13285 |
NN |
denotes |
body |
| T7317 |
13286-13290 |
IN |
denotes |
from |
| T7318 |
13291-13294 |
JJ |
denotes |
mid |
| T7320 |
13294-13295 |
HYPH |
denotes |
- |
| T7321 |
13296-13298 |
IN |
denotes |
to |
| T7322 |
13299-13303 |
JJ |
denotes |
late |
| T7323 |
13303-13304 |
HYPH |
denotes |
- |
| T7319 |
13304-13313 |
NN |
denotes |
pachynema |
| T7324 |
13313-13315 |
, |
denotes |
, |
| T7325 |
13315-13322 |
VBZ |
denotes |
becomes |
| T7326 |
13323-13332 |
RB |
denotes |
diffusely |
| T7327 |
13333-13344 |
JJ |
denotes |
distributed |
| T7328 |
13345-13347 |
IN |
denotes |
in |
| T7329 |
13348-13352 |
JJ |
denotes |
late |
| T7331 |
13352-13353 |
HYPH |
denotes |
- |
| T7330 |
13353-13362 |
NN |
denotes |
pachynema |
| T7332 |
13362-13364 |
, |
denotes |
, |
| T7333 |
13364-13367 |
CC |
denotes |
and |
| T7334 |
13368-13378 |
VBZ |
denotes |
disappears |
| T7335 |
13379-13381 |
IN |
denotes |
in |
| T7336 |
13382-13391 |
NN |
denotes |
diplonema |
| T7337 |
13392-13393 |
-LRB- |
denotes |
( |
| T7339 |
13393-13404 |
JJ |
denotes |
unpublished |
| T7338 |
13405-13409 |
NNS |
denotes |
data |
| T7340 |
13409-13410 |
-RRB- |
denotes |
) |
| T7341 |
13410-13411 |
. |
denotes |
. |
| T7342 |
13411-13487 |
sentence |
denotes |
This localization was confirmed by staining of meiotic spreads (Figure S1). |
| T7343 |
13412-13416 |
DT |
denotes |
This |
| T7344 |
13417-13429 |
NN |
denotes |
localization |
| T7346 |
13430-13433 |
VBD |
denotes |
was |
| T7345 |
13434-13443 |
VBN |
denotes |
confirmed |
| T7347 |
13444-13446 |
IN |
denotes |
by |
| T7348 |
13447-13455 |
NN |
denotes |
staining |
| T7349 |
13456-13458 |
IN |
denotes |
of |
| T7350 |
13459-13466 |
JJ |
denotes |
meiotic |
| T7351 |
13467-13474 |
NNS |
denotes |
spreads |
| T7352 |
13475-13476 |
-LRB- |
denotes |
( |
| T7354 |
13476-13482 |
NN |
denotes |
Figure |
| T7353 |
13483-13485 |
NN |
denotes |
S1 |
| T7355 |
13485-13486 |
-RRB- |
denotes |
) |
| T7356 |
13486-13487 |
. |
denotes |
. |
| T7357 |
13487-13617 |
sentence |
denotes |
DMRT7 also is specifically localized in sperm, with antibody staining mainly in the perinuclear ring of the sperm head manchette. |
| T7358 |
13488-13493 |
NN |
denotes |
DMRT7 |
| T7360 |
13494-13498 |
RB |
denotes |
also |
| T7361 |
13499-13501 |
VBZ |
denotes |
is |
| T7362 |
13502-13514 |
RB |
denotes |
specifically |
| T7359 |
13515-13524 |
VBN |
denotes |
localized |
| T7363 |
13525-13527 |
IN |
denotes |
in |
| T7364 |
13528-13533 |
NN |
denotes |
sperm |
| T7365 |
13533-13535 |
, |
denotes |
, |
| T7366 |
13535-13539 |
IN |
denotes |
with |
| T7367 |
13540-13548 |
NN |
denotes |
antibody |
| T7368 |
13549-13557 |
NN |
denotes |
staining |
| T7369 |
13558-13564 |
RB |
denotes |
mainly |
| T7370 |
13565-13567 |
IN |
denotes |
in |
| T7371 |
13568-13571 |
DT |
denotes |
the |
| T7373 |
13572-13583 |
JJ |
denotes |
perinuclear |
| T7372 |
13584-13588 |
NN |
denotes |
ring |
| T7374 |
13589-13591 |
IN |
denotes |
of |
| T7375 |
13592-13595 |
DT |
denotes |
the |
| T7377 |
13596-13601 |
NN |
denotes |
sperm |
| T7378 |
13602-13606 |
NN |
denotes |
head |
| T7376 |
13607-13616 |
NN |
denotes |
manchette |
| T7379 |
13616-13617 |
. |
denotes |
. |
| T7380 |
13617-13745 |
sentence |
denotes |
This staining coincided with the epithelial stages in which DMRT7 localizes to the XY body in spermatocytes (Figure 1C and 1D). |
| T7381 |
13618-13622 |
DT |
denotes |
This |
| T7382 |
13623-13631 |
NN |
denotes |
staining |
| T7383 |
13632-13641 |
VBD |
denotes |
coincided |
| T7384 |
13642-13646 |
IN |
denotes |
with |
| T7385 |
13647-13650 |
DT |
denotes |
the |
| T7387 |
13651-13661 |
JJ |
denotes |
epithelial |
| T7386 |
13662-13668 |
NNS |
denotes |
stages |
| T7388 |
13669-13671 |
IN |
denotes |
in |
| T7390 |
13672-13677 |
WDT |
denotes |
which |
| T7391 |
13678-13683 |
NN |
denotes |
DMRT7 |
| T7389 |
13684-13693 |
VBZ |
denotes |
localizes |
| T7392 |
13694-13696 |
IN |
denotes |
to |
| T7393 |
13697-13700 |
DT |
denotes |
the |
| T7395 |
13701-13703 |
NN |
denotes |
XY |
| T7394 |
13704-13708 |
NN |
denotes |
body |
| T7396 |
13709-13711 |
IN |
denotes |
in |
| T7397 |
13712-13725 |
NNS |
denotes |
spermatocytes |
| T7398 |
13726-13727 |
-LRB- |
denotes |
( |
| T7400 |
13727-13733 |
NN |
denotes |
Figure |
| T7399 |
13734-13736 |
NN |
denotes |
1C |
| T7401 |
13737-13740 |
CC |
denotes |
and |
| T7402 |
13741-13743 |
NN |
denotes |
1D |
| T7403 |
13743-13744 |
-RRB- |
denotes |
) |
| T7404 |
13744-13745 |
. |
denotes |
. |
| T8160 |
13747-13755 |
VBN |
denotes |
Targeted |
| T8161 |
13756-13764 |
NN |
denotes |
Deletion |
| T8162 |
13765-13767 |
IN |
denotes |
of |
| T8163 |
13768-13773 |
NN |
denotes |
Dmrt7 |
| T8164 |
13773-13947 |
sentence |
denotes |
To establish the functional requirement for Dmrt7, we generated Dmrt7 −/− mice by targeted disruption in embryonic stem (ES) cells using a strategy diagrammed in Figure S2A. |
| T8165 |
13774-13776 |
TO |
denotes |
To |
| T8166 |
13777-13786 |
VB |
denotes |
establish |
| T8168 |
13787-13790 |
DT |
denotes |
the |
| T8170 |
13791-13801 |
JJ |
denotes |
functional |
| T8169 |
13802-13813 |
NN |
denotes |
requirement |
| T8171 |
13814-13817 |
IN |
denotes |
for |
| T8172 |
13818-13823 |
NN |
denotes |
Dmrt7 |
| T8173 |
13823-13825 |
, |
denotes |
, |
| T8174 |
13825-13827 |
PRP |
denotes |
we |
| T8167 |
13828-13837 |
VBD |
denotes |
generated |
| T8175 |
13838-13843 |
NN |
denotes |
Dmrt7 |
| T8177 |
13844-13845 |
SYM |
denotes |
− |
| T8178 |
13845-13846 |
HYPH |
denotes |
/ |
| T8179 |
13846-13847 |
SYM |
denotes |
− |
| T8176 |
13848-13852 |
NNS |
denotes |
mice |
| T8180 |
13853-13855 |
IN |
denotes |
by |
| T8181 |
13856-13864 |
VBN |
denotes |
targeted |
| T8182 |
13865-13875 |
NN |
denotes |
disruption |
| T8183 |
13876-13878 |
IN |
denotes |
in |
| T8184 |
13879-13888 |
JJ |
denotes |
embryonic |
| T8185 |
13889-13893 |
NN |
denotes |
stem |
| T8187 |
13894-13895 |
-LRB- |
denotes |
( |
| T8188 |
13895-13897 |
NN |
denotes |
ES |
| T8189 |
13897-13898 |
-RRB- |
denotes |
) |
| T8186 |
13899-13904 |
NNS |
denotes |
cells |
| T8190 |
13905-13910 |
VBG |
denotes |
using |
| T8191 |
13911-13912 |
DT |
denotes |
a |
| T8192 |
13913-13921 |
NN |
denotes |
strategy |
| T8193 |
13922-13932 |
VBN |
denotes |
diagrammed |
| T8194 |
13933-13935 |
IN |
denotes |
in |
| T8195 |
13936-13942 |
NN |
denotes |
Figure |
| T8196 |
13943-13946 |
NN |
denotes |
S2A |
| T8197 |
13946-13947 |
. |
denotes |
. |
| T8198 |
13947-14035 |
sentence |
denotes |
The Dmrt7 gene has nine exons with the DM domain encoded by the second and third exons. |
| T8199 |
13948-13951 |
DT |
denotes |
The |
| T8201 |
13952-13957 |
NN |
denotes |
Dmrt7 |
| T8200 |
13958-13962 |
NN |
denotes |
gene |
| T8202 |
13963-13966 |
VBZ |
denotes |
has |
| T8203 |
13967-13971 |
CD |
denotes |
nine |
| T8204 |
13972-13977 |
NNS |
denotes |
exons |
| T8205 |
13978-13982 |
IN |
denotes |
with |
| T8206 |
13983-13986 |
DT |
denotes |
the |
| T8208 |
13987-13989 |
NN |
denotes |
DM |
| T8207 |
13990-13996 |
NN |
denotes |
domain |
| T8209 |
13997-14004 |
VBN |
denotes |
encoded |
| T8210 |
14005-14007 |
IN |
denotes |
by |
| T8211 |
14008-14011 |
DT |
denotes |
the |
| T8213 |
14012-14018 |
JJ |
denotes |
second |
| T8214 |
14019-14022 |
CC |
denotes |
and |
| T8215 |
14023-14028 |
JJ |
denotes |
third |
| T8212 |
14029-14034 |
NNS |
denotes |
exons |
| T8216 |
14034-14035 |
. |
denotes |
. |
| T8217 |
14035-14318 |
sentence |
denotes |
Because the DM domain is essential for function of other genes, including mab-3, mab-23, and dsx [18,19,41], we generated a conditionally targeted “floxed” allele in which the DM domain–containing exons of Dmrt7 are flanked by recognition sites for the Cre recombinase (loxP sites). |
| T8218 |
14036-14043 |
IN |
denotes |
Because |
| T8220 |
14044-14047 |
DT |
denotes |
the |
| T8222 |
14048-14050 |
NN |
denotes |
DM |
| T8221 |
14051-14057 |
NN |
denotes |
domain |
| T8219 |
14058-14060 |
VBZ |
denotes |
is |
| T8224 |
14061-14070 |
JJ |
denotes |
essential |
| T8225 |
14071-14074 |
IN |
denotes |
for |
| T8226 |
14075-14083 |
NN |
denotes |
function |
| T8227 |
14084-14086 |
IN |
denotes |
of |
| T8228 |
14087-14092 |
JJ |
denotes |
other |
| T8229 |
14093-14098 |
NNS |
denotes |
genes |
| T8230 |
14098-14100 |
, |
denotes |
, |
| T8231 |
14100-14109 |
VBG |
denotes |
including |
| T8232 |
14110-14113 |
NN |
denotes |
mab |
| T8233 |
14113-14114 |
HYPH |
denotes |
- |
| T8234 |
14114-14115 |
CD |
denotes |
3 |
| T8235 |
14115-14117 |
, |
denotes |
, |
| T8236 |
14117-14120 |
NN |
denotes |
mab |
| T8237 |
14120-14121 |
HYPH |
denotes |
- |
| T8238 |
14121-14123 |
CD |
denotes |
23 |
| T8239 |
14123-14125 |
, |
denotes |
, |
| T8240 |
14125-14128 |
CC |
denotes |
and |
| T8241 |
14129-14132 |
NN |
denotes |
dsx |
| T8242 |
14133-14134 |
-LRB- |
denotes |
[ |
| T8244 |
14134-14136 |
CD |
denotes |
18 |
| T8245 |
14136-14137 |
, |
denotes |
, |
| T8246 |
14137-14139 |
CD |
denotes |
19 |
| T8247 |
14139-14140 |
, |
denotes |
, |
| T8243 |
14140-14142 |
CD |
denotes |
41 |
| T8248 |
14142-14143 |
-RRB- |
denotes |
] |
| T8249 |
14143-14145 |
, |
denotes |
, |
| T8250 |
14145-14147 |
PRP |
denotes |
we |
| T8223 |
14148-14157 |
VBD |
denotes |
generated |
| T8251 |
14158-14159 |
DT |
denotes |
a |
| T8253 |
14160-14173 |
RB |
denotes |
conditionally |
| T8254 |
14174-14182 |
VBN |
denotes |
targeted |
| T8255 |
14183-14184 |
`` |
denotes |
“ |
| T8256 |
14184-14190 |
VBN |
denotes |
floxed |
| T8257 |
14190-14191 |
'' |
denotes |
” |
| T8252 |
14192-14198 |
NN |
denotes |
allele |
| T8258 |
14199-14201 |
IN |
denotes |
in |
| T8260 |
14202-14207 |
WDT |
denotes |
which |
| T8261 |
14208-14211 |
DT |
denotes |
the |
| T8263 |
14212-14214 |
NN |
denotes |
DM |
| T8264 |
14215-14221 |
NN |
denotes |
domain |
| T8266 |
14221-14222 |
HYPH |
denotes |
– |
| T8265 |
14222-14232 |
VBG |
denotes |
containing |
| T8262 |
14233-14238 |
NNS |
denotes |
exons |
| T8267 |
14239-14241 |
IN |
denotes |
of |
| T8268 |
14242-14247 |
NN |
denotes |
Dmrt7 |
| T8269 |
14248-14251 |
VBP |
denotes |
are |
| T8259 |
14252-14259 |
VBN |
denotes |
flanked |
| T8270 |
14260-14262 |
IN |
denotes |
by |
| T8271 |
14263-14274 |
NN |
denotes |
recognition |
| T8272 |
14275-14280 |
NNS |
denotes |
sites |
| T8273 |
14281-14284 |
IN |
denotes |
for |
| T8274 |
14285-14288 |
DT |
denotes |
the |
| T8276 |
14289-14292 |
NN |
denotes |
Cre |
| T8275 |
14293-14304 |
NN |
denotes |
recombinase |
| T8277 |
14305-14306 |
-LRB- |
denotes |
( |
| T8279 |
14306-14310 |
NN |
denotes |
loxP |
| T8278 |
14311-14316 |
NNS |
denotes |
sites |
| T8280 |
14316-14317 |
-RRB- |
denotes |
) |
| T8281 |
14317-14318 |
. |
denotes |
. |
| T8282 |
14318-14426 |
sentence |
denotes |
The targeting vector also contained a neomycin resistance cassette (neo) flanked by Flpe recognition sites. |
| T8283 |
14319-14322 |
DT |
denotes |
The |
| T8285 |
14323-14332 |
NN |
denotes |
targeting |
| T8284 |
14333-14339 |
NN |
denotes |
vector |
| T8287 |
14340-14344 |
RB |
denotes |
also |
| T8286 |
14345-14354 |
VBD |
denotes |
contained |
| T8288 |
14355-14356 |
DT |
denotes |
a |
| T8290 |
14357-14365 |
NN |
denotes |
neomycin |
| T8291 |
14366-14376 |
NN |
denotes |
resistance |
| T8289 |
14377-14385 |
NN |
denotes |
cassette |
| T8292 |
14386-14387 |
-LRB- |
denotes |
( |
| T8293 |
14387-14390 |
NN |
denotes |
neo |
| T8294 |
14390-14391 |
-RRB- |
denotes |
) |
| T8295 |
14392-14399 |
VBN |
denotes |
flanked |
| T8296 |
14400-14402 |
IN |
denotes |
by |
| T8297 |
14403-14407 |
NN |
denotes |
Flpe |
| T8299 |
14408-14419 |
NN |
denotes |
recognition |
| T8298 |
14420-14425 |
NNS |
denotes |
sites |
| T8300 |
14425-14426 |
. |
denotes |
. |
| T8301 |
14426-14586 |
sentence |
denotes |
The removal of these sequences by Cre-mediated recombination eliminates the DM domain and the translational start site, thus generating a putative null allele. |
| T8302 |
14427-14430 |
DT |
denotes |
The |
| T8303 |
14431-14438 |
NN |
denotes |
removal |
| T8305 |
14439-14441 |
IN |
denotes |
of |
| T8306 |
14442-14447 |
DT |
denotes |
these |
| T8307 |
14448-14457 |
NNS |
denotes |
sequences |
| T8308 |
14458-14460 |
IN |
denotes |
by |
| T8309 |
14461-14464 |
NN |
denotes |
Cre |
| T8311 |
14464-14465 |
HYPH |
denotes |
- |
| T8310 |
14465-14473 |
VBN |
denotes |
mediated |
| T8312 |
14474-14487 |
NN |
denotes |
recombination |
| T8304 |
14488-14498 |
VBZ |
denotes |
eliminates |
| T8313 |
14499-14502 |
DT |
denotes |
the |
| T8315 |
14503-14505 |
NN |
denotes |
DM |
| T8314 |
14506-14512 |
NN |
denotes |
domain |
| T8316 |
14513-14516 |
CC |
denotes |
and |
| T8317 |
14517-14520 |
DT |
denotes |
the |
| T8319 |
14521-14534 |
JJ |
denotes |
translational |
| T8320 |
14535-14540 |
NN |
denotes |
start |
| T8318 |
14541-14545 |
NN |
denotes |
site |
| T8321 |
14545-14547 |
, |
denotes |
, |
| T8322 |
14547-14551 |
RB |
denotes |
thus |
| T8323 |
14552-14562 |
VBG |
denotes |
generating |
| T8324 |
14563-14564 |
DT |
denotes |
a |
| T8326 |
14565-14573 |
JJ |
denotes |
putative |
| T8327 |
14574-14578 |
JJ |
denotes |
null |
| T8325 |
14579-14585 |
NN |
denotes |
allele |
| T8328 |
14585-14586 |
. |
denotes |
. |
| T8329 |
14586-14738 |
sentence |
denotes |
We identified three homologously targeted ES cell clones by Southern blotting (Figure S2B) and injected cells from two clones into C57BL/6 blastocysts. |
| T8330 |
14587-14589 |
PRP |
denotes |
We |
| T8331 |
14590-14600 |
VBD |
denotes |
identified |
| T8332 |
14601-14606 |
CD |
denotes |
three |
| T8334 |
14607-14619 |
RB |
denotes |
homologously |
| T8335 |
14620-14628 |
VBN |
denotes |
targeted |
| T8336 |
14629-14631 |
NN |
denotes |
ES |
| T8337 |
14632-14636 |
NN |
denotes |
cell |
| T8333 |
14637-14643 |
NNS |
denotes |
clones |
| T8338 |
14644-14646 |
IN |
denotes |
by |
| T8339 |
14647-14655 |
NNP |
denotes |
Southern |
| T8340 |
14656-14664 |
NN |
denotes |
blotting |
| T8341 |
14665-14666 |
-LRB- |
denotes |
( |
| T8343 |
14666-14672 |
NN |
denotes |
Figure |
| T8342 |
14673-14676 |
NN |
denotes |
S2B |
| T8344 |
14676-14677 |
-RRB- |
denotes |
) |
| T8345 |
14678-14681 |
CC |
denotes |
and |
| T8346 |
14682-14690 |
VBD |
denotes |
injected |
| T8347 |
14691-14696 |
NNS |
denotes |
cells |
| T8348 |
14697-14701 |
IN |
denotes |
from |
| T8349 |
14702-14705 |
CD |
denotes |
two |
| T8350 |
14706-14712 |
NNS |
denotes |
clones |
| T8351 |
14713-14717 |
IN |
denotes |
into |
| T8352 |
14718-14723 |
NN |
denotes |
C57BL |
| T8354 |
14723-14724 |
HYPH |
denotes |
/ |
| T8355 |
14724-14725 |
CD |
denotes |
6 |
| T8353 |
14726-14737 |
NNS |
denotes |
blastocysts |
| T8356 |
14737-14738 |
. |
denotes |
. |
| T8357 |
14738-14831 |
sentence |
denotes |
Chimeric animals from both cell lines transmitted the targeted allele through the germ line. |
| T8358 |
14739-14747 |
JJ |
denotes |
Chimeric |
| T8359 |
14748-14755 |
NNS |
denotes |
animals |
| T8361 |
14756-14760 |
IN |
denotes |
from |
| T8362 |
14761-14765 |
DT |
denotes |
both |
| T8364 |
14766-14770 |
NN |
denotes |
cell |
| T8363 |
14771-14776 |
NNS |
denotes |
lines |
| T8360 |
14777-14788 |
VBD |
denotes |
transmitted |
| T8365 |
14789-14792 |
DT |
denotes |
the |
| T8367 |
14793-14801 |
VBN |
denotes |
targeted |
| T8366 |
14802-14808 |
NN |
denotes |
allele |
| T8368 |
14809-14816 |
IN |
denotes |
through |
| T8369 |
14817-14820 |
DT |
denotes |
the |
| T8371 |
14821-14825 |
NN |
denotes |
germ |
| T8370 |
14826-14830 |
NN |
denotes |
line |
| T8372 |
14830-14831 |
. |
denotes |
. |
| T8373 |
14831-15036 |
sentence |
denotes |
Targeted animals were bred to β-actin Cre mice to delete the DM domain–encoding exons, generating the Dmrt7− allele, or to Flpe transgenic mice to delete the neo cassette, generating the Dmrt7flox allele. |
| T8374 |
14832-14840 |
VBN |
denotes |
Targeted |
| T8375 |
14841-14848 |
NNS |
denotes |
animals |
| T8377 |
14849-14853 |
VBD |
denotes |
were |
| T8376 |
14854-14858 |
VBN |
denotes |
bred |
| T8378 |
14859-14861 |
IN |
denotes |
to |
| T8379 |
14862-14863 |
NN |
denotes |
β |
| T8381 |
14863-14864 |
HYPH |
denotes |
- |
| T8380 |
14864-14869 |
NN |
denotes |
actin |
| T8383 |
14870-14873 |
NN |
denotes |
Cre |
| T8382 |
14874-14878 |
NNS |
denotes |
mice |
| T8384 |
14879-14881 |
TO |
denotes |
to |
| T8385 |
14882-14888 |
VB |
denotes |
delete |
| T8386 |
14889-14892 |
DT |
denotes |
the |
| T8388 |
14893-14895 |
NN |
denotes |
DM |
| T8389 |
14896-14902 |
NN |
denotes |
domain |
| T8391 |
14902-14903 |
HYPH |
denotes |
– |
| T8390 |
14903-14911 |
VBG |
denotes |
encoding |
| T8387 |
14912-14917 |
NNS |
denotes |
exons |
| T8392 |
14917-14919 |
, |
denotes |
, |
| T8393 |
14919-14929 |
VBG |
denotes |
generating |
| T8394 |
14930-14933 |
DT |
denotes |
the |
| T8396 |
14934-14939 |
NN |
denotes |
Dmrt7 |
| T8397 |
14939-14940 |
HYPH |
denotes |
− |
| T8395 |
14941-14947 |
NN |
denotes |
allele |
| T8398 |
14947-14949 |
, |
denotes |
, |
| T8399 |
14949-14951 |
CC |
denotes |
or |
| T8400 |
14952-14954 |
IN |
denotes |
to |
| T8401 |
14955-14959 |
NN |
denotes |
Flpe |
| T8403 |
14960-14970 |
JJ |
denotes |
transgenic |
| T8402 |
14971-14975 |
NNS |
denotes |
mice |
| T8404 |
14976-14978 |
TO |
denotes |
to |
| T8405 |
14979-14985 |
VB |
denotes |
delete |
| T8406 |
14986-14989 |
DT |
denotes |
the |
| T8408 |
14990-14993 |
NN |
denotes |
neo |
| T8407 |
14994-15002 |
NN |
denotes |
cassette |
| T8409 |
15002-15004 |
, |
denotes |
, |
| T8410 |
15004-15014 |
VBG |
denotes |
generating |
| T8411 |
15015-15018 |
DT |
denotes |
the |
| T8413 |
15019-15028 |
NN |
denotes |
Dmrt7flox |
| T8412 |
15029-15035 |
NN |
denotes |
allele |
| T8414 |
15035-15036 |
. |
denotes |
. |
| T8415 |
15036-15092 |
sentence |
denotes |
Dmrt7+/− mice were interbred to generate Dmrt7−/− mice. |
| T8416 |
15037-15042 |
NN |
denotes |
Dmrt7 |
| T8418 |
15042-15043 |
SYM |
denotes |
+ |
| T8419 |
15043-15044 |
HYPH |
denotes |
/ |
| T8420 |
15044-15045 |
SYM |
denotes |
− |
| T8417 |
15046-15050 |
NNS |
denotes |
mice |
| T8422 |
15051-15055 |
VBD |
denotes |
were |
| T8421 |
15056-15065 |
VBN |
denotes |
interbred |
| T8423 |
15066-15068 |
TO |
denotes |
to |
| T8424 |
15069-15077 |
VB |
denotes |
generate |
| T8425 |
15078-15083 |
NN |
denotes |
Dmrt7 |
| T8427 |
15083-15084 |
SYM |
denotes |
− |
| T8428 |
15084-15085 |
HYPH |
denotes |
/ |
| T8429 |
15085-15086 |
SYM |
denotes |
− |
| T8426 |
15087-15091 |
NNS |
denotes |
mice |
| T8430 |
15091-15092 |
. |
denotes |
. |
| T8431 |
15092-15320 |
sentence |
denotes |
To confirm the lack of functional DMRT7 protein in Dmrt7−/−testes, we stained meiotic spreads from Dmrt7 mutants (Figure S1) and sections from mutant testes (Figure S2C) and carried out western blot analysis (unpublished data). |
| T8432 |
15093-15095 |
TO |
denotes |
To |
| T8433 |
15096-15103 |
VB |
denotes |
confirm |
| T8435 |
15104-15107 |
DT |
denotes |
the |
| T8436 |
15108-15112 |
NN |
denotes |
lack |
| T8437 |
15113-15115 |
IN |
denotes |
of |
| T8438 |
15116-15126 |
JJ |
denotes |
functional |
| T8440 |
15127-15132 |
NN |
denotes |
DMRT7 |
| T8439 |
15133-15140 |
NN |
denotes |
protein |
| T8441 |
15141-15143 |
IN |
denotes |
in |
| T8442 |
15144-15149 |
NN |
denotes |
Dmrt7 |
| T8444 |
15149-15150 |
SYM |
denotes |
− |
| T8445 |
15150-15151 |
HYPH |
denotes |
/ |
| T8446 |
15151-15152 |
SYM |
denotes |
− |
| T8443 |
15152-15158 |
NNS |
denotes |
testes |
| T8447 |
15158-15160 |
, |
denotes |
, |
| T8448 |
15160-15162 |
PRP |
denotes |
we |
| T8434 |
15163-15170 |
VBD |
denotes |
stained |
| T8449 |
15171-15178 |
JJ |
denotes |
meiotic |
| T8450 |
15179-15186 |
NNS |
denotes |
spreads |
| T8451 |
15187-15191 |
IN |
denotes |
from |
| T8452 |
15192-15197 |
NN |
denotes |
Dmrt7 |
| T8453 |
15198-15205 |
NNS |
denotes |
mutants |
| T8454 |
15206-15207 |
-LRB- |
denotes |
( |
| T8456 |
15207-15213 |
NN |
denotes |
Figure |
| T8455 |
15214-15216 |
NN |
denotes |
S1 |
| T8457 |
15216-15217 |
-RRB- |
denotes |
) |
| T8458 |
15218-15221 |
CC |
denotes |
and |
| T8459 |
15222-15230 |
NNS |
denotes |
sections |
| T8460 |
15231-15235 |
IN |
denotes |
from |
| T8461 |
15236-15242 |
NN |
denotes |
mutant |
| T8462 |
15243-15249 |
NNS |
denotes |
testes |
| T8463 |
15250-15251 |
-LRB- |
denotes |
( |
| T8465 |
15251-15257 |
NN |
denotes |
Figure |
| T8464 |
15258-15261 |
NN |
denotes |
S2C |
| T8466 |
15261-15262 |
-RRB- |
denotes |
) |
| T8467 |
15263-15266 |
CC |
denotes |
and |
| T8468 |
15267-15274 |
VBD |
denotes |
carried |
| T8469 |
15275-15278 |
RP |
denotes |
out |
| T8470 |
15279-15286 |
NNP |
denotes |
western |
| T8471 |
15287-15291 |
NN |
denotes |
blot |
| T8472 |
15292-15300 |
NN |
denotes |
analysis |
| T8473 |
15301-15302 |
-LRB- |
denotes |
( |
| T8475 |
15302-15313 |
JJ |
denotes |
unpublished |
| T8474 |
15314-15318 |
NNS |
denotes |
data |
| T8476 |
15318-15319 |
-RRB- |
denotes |
) |
| T8477 |
15319-15320 |
. |
denotes |
. |
| T8478 |
15320-15385 |
sentence |
denotes |
In each case, we detected no DMRT7 protein in the mutant testes. |
| T8479 |
15321-15323 |
IN |
denotes |
In |
| T8481 |
15324-15328 |
DT |
denotes |
each |
| T8482 |
15329-15333 |
NN |
denotes |
case |
| T8483 |
15333-15335 |
, |
denotes |
, |
| T8484 |
15335-15337 |
PRP |
denotes |
we |
| T8480 |
15338-15346 |
VBD |
denotes |
detected |
| T8485 |
15347-15349 |
DT |
denotes |
no |
| T8487 |
15350-15355 |
NN |
denotes |
DMRT7 |
| T8486 |
15356-15363 |
NN |
denotes |
protein |
| T8488 |
15364-15366 |
IN |
denotes |
in |
| T8489 |
15367-15370 |
DT |
denotes |
the |
| T8491 |
15371-15377 |
NN |
denotes |
mutant |
| T8490 |
15378-15384 |
NNS |
denotes |
testes |
| T8492 |
15384-15385 |
. |
denotes |
. |
| T9723 |
15387-15392 |
NN |
denotes |
Dmrt7 |
| T9725 |
15393-15395 |
VBZ |
denotes |
Is |
| T9724 |
15396-15404 |
VBN |
denotes |
Required |
| T9726 |
15405-15408 |
IN |
denotes |
for |
| T9727 |
15409-15413 |
JJ |
denotes |
Male |
| T9729 |
15414-15417 |
CC |
denotes |
but |
| T9730 |
15418-15421 |
RB |
denotes |
Not |
| T9731 |
15422-15428 |
JJ |
denotes |
Female |
| T9728 |
15429-15442 |
NN |
denotes |
Gametogenesis |
| T9732 |
15442-15564 |
sentence |
denotes |
Breeding of Dmrt7 heterozygotes produced homozygous mutant progeny of both sexes at the expected frequency (63/264; 23%). |
| T9733 |
15443-15451 |
NN |
denotes |
Breeding |
| T9735 |
15452-15454 |
IN |
denotes |
of |
| T9736 |
15455-15460 |
NN |
denotes |
Dmrt7 |
| T9737 |
15461-15474 |
NNS |
denotes |
heterozygotes |
| T9734 |
15475-15483 |
VBD |
denotes |
produced |
| T9738 |
15484-15494 |
JJ |
denotes |
homozygous |
| T9740 |
15495-15501 |
NN |
denotes |
mutant |
| T9739 |
15502-15509 |
NN |
denotes |
progeny |
| T9741 |
15510-15512 |
IN |
denotes |
of |
| T9742 |
15513-15517 |
DT |
denotes |
both |
| T9743 |
15518-15523 |
NNS |
denotes |
sexes |
| T9744 |
15524-15526 |
IN |
denotes |
at |
| T9745 |
15527-15530 |
DT |
denotes |
the |
| T9747 |
15531-15539 |
VBN |
denotes |
expected |
| T9746 |
15540-15549 |
NN |
denotes |
frequency |
| T9748 |
15550-15551 |
-LRB- |
denotes |
( |
| T9750 |
15551-15553 |
CD |
denotes |
63 |
| T9752 |
15553-15554 |
SYM |
denotes |
/ |
| T9751 |
15554-15557 |
CD |
denotes |
264 |
| T9753 |
15557-15558 |
: |
denotes |
; |
| T9754 |
15559-15561 |
CD |
denotes |
23 |
| T9749 |
15561-15562 |
NN |
denotes |
% |
| T9755 |
15562-15563 |
-RRB- |
denotes |
) |
| T9756 |
15563-15564 |
. |
denotes |
. |
| T9757 |
15564-15678 |
sentence |
denotes |
Male and female homozygous mutants were viable, grew to adulthood normally, and exhibited normal sexual behavior. |
| T9758 |
15565-15569 |
JJ |
denotes |
Male |
| T9760 |
15570-15573 |
CC |
denotes |
and |
| T9761 |
15574-15580 |
JJ |
denotes |
female |
| T9762 |
15581-15591 |
JJ |
denotes |
homozygous |
| T9759 |
15592-15599 |
NNS |
denotes |
mutants |
| T9763 |
15600-15604 |
VBD |
denotes |
were |
| T9764 |
15605-15611 |
JJ |
denotes |
viable |
| T9765 |
15611-15613 |
, |
denotes |
, |
| T9766 |
15613-15617 |
VBD |
denotes |
grew |
| T9767 |
15618-15620 |
IN |
denotes |
to |
| T9768 |
15621-15630 |
NN |
denotes |
adulthood |
| T9769 |
15631-15639 |
RB |
denotes |
normally |
| T9770 |
15639-15641 |
, |
denotes |
, |
| T9771 |
15641-15644 |
CC |
denotes |
and |
| T9772 |
15645-15654 |
VBD |
denotes |
exhibited |
| T9773 |
15655-15661 |
JJ |
denotes |
normal |
| T9775 |
15662-15668 |
JJ |
denotes |
sexual |
| T9774 |
15669-15677 |
NN |
denotes |
behavior |
| T9776 |
15677-15678 |
. |
denotes |
. |
| T9777 |
15678-15840 |
sentence |
denotes |
Female homozygotes were fertile, produced litters of normal size, and had no obvious ovarian abnormalities as judged by histological analysis (unpublished data). |
| T9778 |
15679-15685 |
JJ |
denotes |
Female |
| T9779 |
15686-15697 |
NNS |
denotes |
homozygotes |
| T9780 |
15698-15702 |
VBD |
denotes |
were |
| T9781 |
15703-15710 |
JJ |
denotes |
fertile |
| T9782 |
15710-15712 |
, |
denotes |
, |
| T9783 |
15712-15720 |
VBD |
denotes |
produced |
| T9784 |
15721-15728 |
NNS |
denotes |
litters |
| T9785 |
15729-15731 |
IN |
denotes |
of |
| T9786 |
15732-15738 |
JJ |
denotes |
normal |
| T9787 |
15739-15743 |
NN |
denotes |
size |
| T9788 |
15743-15745 |
, |
denotes |
, |
| T9789 |
15745-15748 |
CC |
denotes |
and |
| T9790 |
15749-15752 |
VBD |
denotes |
had |
| T9791 |
15753-15755 |
DT |
denotes |
no |
| T9793 |
15756-15763 |
JJ |
denotes |
obvious |
| T9794 |
15764-15771 |
JJ |
denotes |
ovarian |
| T9792 |
15772-15785 |
NNS |
denotes |
abnormalities |
| T9795 |
15786-15788 |
IN |
denotes |
as |
| T9796 |
15789-15795 |
VBN |
denotes |
judged |
| T9797 |
15796-15798 |
IN |
denotes |
by |
| T9798 |
15799-15811 |
JJ |
denotes |
histological |
| T9799 |
15812-15820 |
NN |
denotes |
analysis |
| T9800 |
15821-15822 |
-LRB- |
denotes |
( |
| T9802 |
15822-15833 |
JJ |
denotes |
unpublished |
| T9801 |
15834-15838 |
NNS |
denotes |
data |
| T9803 |
15838-15839 |
-RRB- |
denotes |
) |
| T9804 |
15839-15840 |
. |
denotes |
. |
| T9805 |
15840-16019 |
sentence |
denotes |
In contrast, Dmrt7 homozygous mutant males were completely infertile and had testes about one-third the weight of those of heterozygous or wild-type adult littermates (Figure 2). |
| T9806 |
15841-15843 |
IN |
denotes |
In |
| T9808 |
15844-15852 |
NN |
denotes |
contrast |
| T9809 |
15852-15854 |
, |
denotes |
, |
| T9810 |
15854-15859 |
NN |
denotes |
Dmrt7 |
| T9812 |
15860-15870 |
JJ |
denotes |
homozygous |
| T9811 |
15871-15877 |
NN |
denotes |
mutant |
| T9813 |
15878-15883 |
NNS |
denotes |
males |
| T9807 |
15884-15888 |
VBD |
denotes |
were |
| T9814 |
15889-15899 |
RB |
denotes |
completely |
| T9815 |
15900-15909 |
JJ |
denotes |
infertile |
| T9816 |
15910-15913 |
CC |
denotes |
and |
| T9817 |
15914-15917 |
VBD |
denotes |
had |
| T9818 |
15918-15924 |
NNS |
denotes |
testes |
| T9819 |
15925-15930 |
IN |
denotes |
about |
| T9820 |
15931-15934 |
CD |
denotes |
one |
| T9822 |
15934-15935 |
HYPH |
denotes |
- |
| T9823 |
15935-15940 |
NN |
denotes |
third |
| T9824 |
15941-15944 |
DT |
denotes |
the |
| T9821 |
15945-15951 |
NN |
denotes |
weight |
| T9825 |
15952-15954 |
IN |
denotes |
of |
| T9826 |
15955-15960 |
DT |
denotes |
those |
| T9827 |
15961-15963 |
IN |
denotes |
of |
| T9828 |
15964-15976 |
JJ |
denotes |
heterozygous |
| T9830 |
15977-15979 |
CC |
denotes |
or |
| T9831 |
15980-15984 |
JJ |
denotes |
wild |
| T9833 |
15984-15985 |
HYPH |
denotes |
- |
| T9832 |
15985-15989 |
NN |
denotes |
type |
| T9834 |
15990-15995 |
JJ |
denotes |
adult |
| T9829 |
15996-16007 |
NNS |
denotes |
littermates |
| T9835 |
16008-16009 |
-LRB- |
denotes |
( |
| T9836 |
16009-16015 |
NN |
denotes |
Figure |
| T9837 |
16016-16017 |
CD |
denotes |
2 |
| T9838 |
16017-16018 |
-RRB- |
denotes |
) |
| T9839 |
16018-16019 |
. |
denotes |
. |
| T9840 |
16019-16192 |
sentence |
denotes |
To determine when defective testis development begins in Dmrt7 mutants, we compared the testes of wild-type and mutant littermates during the first wave of spermatogenesis. |
| T9841 |
16020-16022 |
TO |
denotes |
To |
| T9842 |
16023-16032 |
VB |
denotes |
determine |
| T9844 |
16033-16037 |
WRB |
denotes |
when |
| T9846 |
16038-16047 |
JJ |
denotes |
defective |
| T9848 |
16048-16054 |
NN |
denotes |
testis |
| T9847 |
16055-16066 |
NN |
denotes |
development |
| T9845 |
16067-16073 |
VBZ |
denotes |
begins |
| T9849 |
16074-16076 |
IN |
denotes |
in |
| T9850 |
16077-16082 |
NN |
denotes |
Dmrt7 |
| T9851 |
16083-16090 |
NNS |
denotes |
mutants |
| T9852 |
16090-16092 |
, |
denotes |
, |
| T9853 |
16092-16094 |
PRP |
denotes |
we |
| T9843 |
16095-16103 |
VBD |
denotes |
compared |
| T9854 |
16104-16107 |
DT |
denotes |
the |
| T9855 |
16108-16114 |
NNS |
denotes |
testes |
| T9856 |
16115-16117 |
IN |
denotes |
of |
| T9857 |
16118-16122 |
JJ |
denotes |
wild |
| T9859 |
16122-16123 |
HYPH |
denotes |
- |
| T9858 |
16123-16127 |
NN |
denotes |
type |
| T9861 |
16128-16131 |
CC |
denotes |
and |
| T9862 |
16132-16138 |
NN |
denotes |
mutant |
| T9860 |
16139-16150 |
NNS |
denotes |
littermates |
| T9863 |
16151-16157 |
IN |
denotes |
during |
| T9864 |
16158-16161 |
DT |
denotes |
the |
| T9866 |
16162-16167 |
JJ |
denotes |
first |
| T9865 |
16168-16172 |
NN |
denotes |
wave |
| T9867 |
16173-16175 |
IN |
denotes |
of |
| T9868 |
16176-16191 |
NN |
denotes |
spermatogenesis |
| T9869 |
16191-16192 |
. |
denotes |
. |
| T9870 |
16192-16462 |
sentence |
denotes |
Prior to postnatal day 14 (P14), mutant testes appeared histologically normal and the testis weights were similar to those of heterozygous and wild-type littermates, indicating that spermatogonia and early meiotic germ cells form normally (Figure 2B; unpublished data). |
| T9871 |
16193-16198 |
IN |
denotes |
Prior |
| T9873 |
16199-16201 |
IN |
denotes |
to |
| T9874 |
16202-16211 |
JJ |
denotes |
postnatal |
| T9875 |
16212-16215 |
NN |
denotes |
day |
| T9876 |
16216-16218 |
CD |
denotes |
14 |
| T9877 |
16219-16220 |
-LRB- |
denotes |
( |
| T9878 |
16220-16223 |
NN |
denotes |
P14 |
| T9879 |
16223-16224 |
-RRB- |
denotes |
) |
| T9880 |
16224-16226 |
, |
denotes |
, |
| T9881 |
16226-16232 |
NN |
denotes |
mutant |
| T9882 |
16233-16239 |
NNS |
denotes |
testes |
| T9872 |
16240-16248 |
VBD |
denotes |
appeared |
| T9883 |
16249-16263 |
RB |
denotes |
histologically |
| T9884 |
16264-16270 |
JJ |
denotes |
normal |
| T9885 |
16271-16274 |
CC |
denotes |
and |
| T9886 |
16275-16278 |
DT |
denotes |
the |
| T9888 |
16279-16285 |
NN |
denotes |
testis |
| T9887 |
16286-16293 |
NNS |
denotes |
weights |
| T9889 |
16294-16298 |
VBD |
denotes |
were |
| T9890 |
16299-16306 |
JJ |
denotes |
similar |
| T9891 |
16307-16309 |
IN |
denotes |
to |
| T9892 |
16310-16315 |
DT |
denotes |
those |
| T9893 |
16316-16318 |
IN |
denotes |
of |
| T9894 |
16319-16331 |
JJ |
denotes |
heterozygous |
| T9896 |
16332-16335 |
CC |
denotes |
and |
| T9897 |
16336-16340 |
JJ |
denotes |
wild |
| T9899 |
16340-16341 |
HYPH |
denotes |
- |
| T9898 |
16341-16345 |
NN |
denotes |
type |
| T9895 |
16346-16357 |
NNS |
denotes |
littermates |
| T9900 |
16357-16359 |
, |
denotes |
, |
| T9901 |
16359-16369 |
VBG |
denotes |
indicating |
| T9902 |
16370-16374 |
IN |
denotes |
that |
| T9904 |
16375-16388 |
NNS |
denotes |
spermatogonia |
| T9905 |
16389-16392 |
CC |
denotes |
and |
| T9906 |
16393-16398 |
JJ |
denotes |
early |
| T9908 |
16399-16406 |
JJ |
denotes |
meiotic |
| T9909 |
16407-16411 |
NN |
denotes |
germ |
| T9907 |
16412-16417 |
NNS |
denotes |
cells |
| T9903 |
16418-16422 |
VBP |
denotes |
form |
| T9910 |
16423-16431 |
RB |
denotes |
normally |
| T9911 |
16432-16433 |
-LRB- |
denotes |
( |
| T9913 |
16433-16439 |
NN |
denotes |
Figure |
| T9914 |
16440-16442 |
NN |
denotes |
2B |
| T9915 |
16442-16443 |
: |
denotes |
; |
| T9916 |
16444-16455 |
JJ |
denotes |
unpublished |
| T9912 |
16456-16460 |
NNS |
denotes |
data |
| T9917 |
16460-16461 |
-RRB- |
denotes |
) |
| T9918 |
16461-16462 |
. |
denotes |
. |
| T9919 |
16462-16568 |
sentence |
denotes |
Thereafter, the testes of the Dmrt7 mutant mice ceased to grow and the weight difference was significant. |
| T9920 |
16463-16473 |
RB |
denotes |
Thereafter |
| T9922 |
16473-16475 |
, |
denotes |
, |
| T9923 |
16475-16478 |
DT |
denotes |
the |
| T9924 |
16479-16485 |
NNS |
denotes |
testes |
| T9925 |
16486-16488 |
IN |
denotes |
of |
| T9926 |
16489-16492 |
DT |
denotes |
the |
| T9928 |
16493-16498 |
NN |
denotes |
Dmrt7 |
| T9929 |
16499-16505 |
NN |
denotes |
mutant |
| T9927 |
16506-16510 |
NNS |
denotes |
mice |
| T9921 |
16511-16517 |
VBD |
denotes |
ceased |
| T9930 |
16518-16520 |
TO |
denotes |
to |
| T9931 |
16521-16525 |
VB |
denotes |
grow |
| T9932 |
16526-16529 |
CC |
denotes |
and |
| T9933 |
16530-16533 |
DT |
denotes |
the |
| T9935 |
16534-16540 |
NN |
denotes |
weight |
| T9934 |
16541-16551 |
NN |
denotes |
difference |
| T9936 |
16552-16555 |
VBD |
denotes |
was |
| T9937 |
16556-16567 |
JJ |
denotes |
significant |
| T9938 |
16567-16568 |
. |
denotes |
. |
| T9939 |
16568-16744 |
sentence |
denotes |
Microscopic examination of P21 and P42 Dmrt7 mutant testes revealed that germ cells arrest in pachynema, and later stages of germ cells are largely missing (Figure 2C and 2D). |
| T9940 |
16569-16580 |
JJ |
denotes |
Microscopic |
| T9941 |
16581-16592 |
NN |
denotes |
examination |
| T9943 |
16593-16595 |
IN |
denotes |
of |
| T9944 |
16596-16599 |
NN |
denotes |
P21 |
| T9946 |
16600-16603 |
CC |
denotes |
and |
| T9947 |
16604-16607 |
NN |
denotes |
P42 |
| T9948 |
16608-16613 |
NN |
denotes |
Dmrt7 |
| T9949 |
16614-16620 |
NN |
denotes |
mutant |
| T9945 |
16621-16627 |
NNS |
denotes |
testes |
| T9942 |
16628-16636 |
VBD |
denotes |
revealed |
| T9950 |
16637-16641 |
IN |
denotes |
that |
| T9952 |
16642-16646 |
NN |
denotes |
germ |
| T9953 |
16647-16652 |
NNS |
denotes |
cells |
| T9951 |
16653-16659 |
VBP |
denotes |
arrest |
| T9954 |
16660-16662 |
IN |
denotes |
in |
| T9955 |
16663-16672 |
NN |
denotes |
pachynema |
| T9956 |
16672-16674 |
, |
denotes |
, |
| T9957 |
16674-16677 |
CC |
denotes |
and |
| T9958 |
16678-16683 |
JJ |
denotes |
later |
| T9959 |
16684-16690 |
NNS |
denotes |
stages |
| T9961 |
16691-16693 |
IN |
denotes |
of |
| T9962 |
16694-16698 |
NN |
denotes |
germ |
| T9963 |
16699-16704 |
NNS |
denotes |
cells |
| T9960 |
16705-16708 |
VBP |
denotes |
are |
| T9964 |
16709-16716 |
RB |
denotes |
largely |
| T9965 |
16717-16724 |
JJ |
denotes |
missing |
| T9966 |
16725-16726 |
-LRB- |
denotes |
( |
| T9968 |
16726-16732 |
NN |
denotes |
Figure |
| T9967 |
16733-16735 |
NN |
denotes |
2C |
| T9969 |
16736-16739 |
CC |
denotes |
and |
| T9970 |
16740-16742 |
NN |
denotes |
2D |
| T9971 |
16742-16743 |
-RRB- |
denotes |
) |
| T9972 |
16743-16744 |
. |
denotes |
. |
| T9973 |
16744-16894 |
sentence |
denotes |
Dmrt7 mutant mice are deficient in postmeiotic spermatids and lack epididymal spermatozoa, although a few cells develop to the round spermatid stage. |
| T9974 |
16745-16750 |
NN |
denotes |
Dmrt7 |
| T9975 |
16751-16757 |
NN |
denotes |
mutant |
| T9976 |
16758-16762 |
NNS |
denotes |
mice |
| T9977 |
16763-16766 |
VBP |
denotes |
are |
| T9978 |
16767-16776 |
JJ |
denotes |
deficient |
| T9979 |
16777-16779 |
IN |
denotes |
in |
| T9980 |
16780-16791 |
JJ |
denotes |
postmeiotic |
| T9981 |
16792-16802 |
NNS |
denotes |
spermatids |
| T9982 |
16803-16806 |
CC |
denotes |
and |
| T9983 |
16807-16811 |
VBP |
denotes |
lack |
| T9984 |
16812-16822 |
JJ |
denotes |
epididymal |
| T9985 |
16823-16834 |
NNS |
denotes |
spermatozoa |
| T9986 |
16834-16836 |
, |
denotes |
, |
| T9987 |
16836-16844 |
IN |
denotes |
although |
| T9989 |
16845-16846 |
DT |
denotes |
a |
| T9991 |
16847-16850 |
JJ |
denotes |
few |
| T9990 |
16851-16856 |
NNS |
denotes |
cells |
| T9988 |
16857-16864 |
VBP |
denotes |
develop |
| T9992 |
16865-16867 |
IN |
denotes |
to |
| T9993 |
16868-16871 |
DT |
denotes |
the |
| T9995 |
16872-16877 |
JJ |
denotes |
round |
| T9996 |
16878-16887 |
NN |
denotes |
spermatid |
| T9994 |
16888-16893 |
NN |
denotes |
stage |
| T9997 |
16893-16894 |
. |
denotes |
. |
| T9998 |
16894-17000 |
sentence |
denotes |
These meiotic defects are in agreement with a recent preliminary analysis of another Dmrt7 mutation [42]. |
| T9999 |
16895-16900 |
DT |
denotes |
These |
| T10001 |
16901-16908 |
JJ |
denotes |
meiotic |
| T10000 |
16909-16916 |
NNS |
denotes |
defects |
| T10002 |
16917-16920 |
VBP |
denotes |
are |
| T10003 |
16921-16923 |
IN |
denotes |
in |
| T10004 |
16924-16933 |
NN |
denotes |
agreement |
| T10005 |
16934-16938 |
IN |
denotes |
with |
| T10006 |
16939-16940 |
DT |
denotes |
a |
| T10008 |
16941-16947 |
JJ |
denotes |
recent |
| T10009 |
16948-16959 |
JJ |
denotes |
preliminary |
| T10007 |
16960-16968 |
NN |
denotes |
analysis |
| T10010 |
16969-16971 |
IN |
denotes |
of |
| T10011 |
16972-16979 |
DT |
denotes |
another |
| T10013 |
16980-16985 |
NN |
denotes |
Dmrt7 |
| T10012 |
16986-16994 |
NN |
denotes |
mutation |
| T10014 |
16995-16996 |
-LRB- |
denotes |
[ |
| T10015 |
16996-16998 |
CD |
denotes |
42 |
| T10016 |
16998-16999 |
-RRB- |
denotes |
] |
| T10017 |
16999-17000 |
. |
denotes |
. |
| T10018 |
17000-17153 |
sentence |
denotes |
While some Dmrt7 mutant tubules are highly vacuolated and contain primarily Sertoli cells and spermatogonia, others have abundant primary spermatocytes. |
| T10019 |
17001-17006 |
IN |
denotes |
While |
| T10021 |
17007-17011 |
DT |
denotes |
some |
| T10023 |
17012-17017 |
NN |
denotes |
Dmrt7 |
| T10024 |
17018-17024 |
NN |
denotes |
mutant |
| T10022 |
17025-17032 |
NNS |
denotes |
tubules |
| T10020 |
17033-17036 |
VBP |
denotes |
are |
| T10026 |
17037-17043 |
RB |
denotes |
highly |
| T10027 |
17044-17054 |
JJ |
denotes |
vacuolated |
| T10028 |
17055-17058 |
CC |
denotes |
and |
| T10029 |
17059-17066 |
VBP |
denotes |
contain |
| T10030 |
17067-17076 |
RB |
denotes |
primarily |
| T10031 |
17077-17084 |
NNP |
denotes |
Sertoli |
| T10032 |
17085-17090 |
NNS |
denotes |
cells |
| T10033 |
17091-17094 |
CC |
denotes |
and |
| T10034 |
17095-17108 |
NNS |
denotes |
spermatogonia |
| T10035 |
17108-17110 |
, |
denotes |
, |
| T10036 |
17110-17116 |
NNS |
denotes |
others |
| T10025 |
17117-17121 |
VBP |
denotes |
have |
| T10037 |
17122-17130 |
JJ |
denotes |
abundant |
| T10039 |
17131-17138 |
JJ |
denotes |
primary |
| T10038 |
17139-17152 |
NNS |
denotes |
spermatocytes |
| T10040 |
17152-17153 |
. |
denotes |
. |
| T10041 |
17153-17294 |
sentence |
denotes |
In addition, some tubules contain multinucleated cells and cells with darkly stained nuclei that are typical of apoptotic cells (Figure 2D). |
| T10042 |
17154-17156 |
IN |
denotes |
In |
| T10044 |
17157-17165 |
NN |
denotes |
addition |
| T10045 |
17165-17167 |
, |
denotes |
, |
| T10046 |
17167-17171 |
DT |
denotes |
some |
| T10047 |
17172-17179 |
NNS |
denotes |
tubules |
| T10043 |
17180-17187 |
VBP |
denotes |
contain |
| T10048 |
17188-17202 |
JJ |
denotes |
multinucleated |
| T10049 |
17203-17208 |
NNS |
denotes |
cells |
| T10050 |
17209-17212 |
CC |
denotes |
and |
| T10051 |
17213-17218 |
NNS |
denotes |
cells |
| T10052 |
17219-17223 |
IN |
denotes |
with |
| T10053 |
17224-17230 |
RB |
denotes |
darkly |
| T10054 |
17231-17238 |
VBN |
denotes |
stained |
| T10055 |
17239-17245 |
NNS |
denotes |
nuclei |
| T10056 |
17246-17250 |
WDT |
denotes |
that |
| T10057 |
17251-17254 |
VBP |
denotes |
are |
| T10058 |
17255-17262 |
JJ |
denotes |
typical |
| T10059 |
17263-17265 |
IN |
denotes |
of |
| T10060 |
17266-17275 |
JJ |
denotes |
apoptotic |
| T10061 |
17276-17281 |
NNS |
denotes |
cells |
| T10062 |
17282-17283 |
-LRB- |
denotes |
( |
| T10064 |
17283-17289 |
NN |
denotes |
Figure |
| T10063 |
17290-17292 |
NN |
denotes |
2D |
| T10065 |
17292-17293 |
-RRB- |
denotes |
) |
| T10066 |
17293-17294 |
. |
denotes |
. |
| T10067 |
17294-18455 |
sentence |
denotes |
Figure 2 Reduced Testis Size and Germ Cell Apoptosis in Mice with Targeted Deletion in Dmrt7
(A) Testes from a 6-wk-old wild-type (+/+) mouse and a homozygous (−/−) Dmrt7 mutant littermate.
(B–D) Sections of testes from 14-d-old (B), 21-d-old (C), and 42-d-old mice (D) stained with hematoxylin and eosin. Wild-type is in left column and mutant in right. No significant difference is observed at 14 d (B), but by 21 d some tubules are lacking abundant spermatocytes (C, asterisk) or cells with typical apoptotic morphology are present (open arrowhead, C and D). Mutant tubules contain multinucleate cells (closed arrowhead, D).
(E and F) TUNEL labeling of Dmrt7-deficient mouse testes. Testes from wild-type and homozygous mutant littermates were analyzed by TUNEL labeling to detect apoptotic cells. Testis sections from 21-d-old (E) and 6-wk-old mice (F). Apoptotic cells (brown) are much more abundant in seminiferous tubules of homozygous Dmrt7 mutant mice relative to wild-type. Bars in (B–F) represent 100 μm. Since Dmrt7 mutant testes lack most post-pachytene cells, we used TUNEL analysis to test whether the missing cells are eliminated by apoptosis. |
| T28480 |
17305-17312 |
VBN |
denotes |
Reduced |
| T28482 |
17313-17319 |
NN |
denotes |
Testis |
| T28481 |
17320-17324 |
NN |
denotes |
Size |
| T28483 |
17325-17328 |
CC |
denotes |
and |
| T28484 |
17329-17333 |
NN |
denotes |
Germ |
| T28485 |
17334-17338 |
NN |
denotes |
Cell |
| T28486 |
17339-17348 |
NN |
denotes |
Apoptosis |
| T28487 |
17349-17351 |
IN |
denotes |
in |
| T28488 |
17352-17356 |
NNS |
denotes |
Mice |
| T28489 |
17357-17361 |
IN |
denotes |
with |
| T28490 |
17362-17370 |
VBN |
denotes |
Targeted |
| T28491 |
17371-17379 |
NN |
denotes |
Deletion |
| T28492 |
17380-17382 |
IN |
denotes |
in |
| T28493 |
17383-17388 |
NN |
denotes |
Dmrt7 |
| T28494 |
17388-17485 |
sentence |
denotes |
(A) Testes from a 6-wk-old wild-type (+/+) mouse and a homozygous (−/−) Dmrt7 mutant littermate. |
| T28495 |
17389-17390 |
-LRB- |
denotes |
( |
| T28496 |
17390-17391 |
LS |
denotes |
A |
| T28498 |
17391-17392 |
-RRB- |
denotes |
) |
| T28497 |
17393-17399 |
NNS |
denotes |
Testes |
| T28499 |
17400-17404 |
IN |
denotes |
from |
| T28500 |
17405-17406 |
DT |
denotes |
a |
| T28502 |
17407-17408 |
CD |
denotes |
6 |
| T28504 |
17408-17409 |
HYPH |
denotes |
- |
| T28503 |
17409-17411 |
NN |
denotes |
wk |
| T28506 |
17411-17412 |
HYPH |
denotes |
- |
| T28505 |
17412-17415 |
JJ |
denotes |
old |
| T28507 |
17416-17420 |
JJ |
denotes |
wild |
| T28509 |
17420-17421 |
HYPH |
denotes |
- |
| T28508 |
17421-17425 |
NN |
denotes |
type |
| T28510 |
17426-17427 |
-LRB- |
denotes |
( |
| T28512 |
17427-17428 |
SYM |
denotes |
+ |
| T28513 |
17428-17429 |
HYPH |
denotes |
/ |
| T28511 |
17429-17430 |
SYM |
denotes |
+ |
| T28514 |
17430-17431 |
-RRB- |
denotes |
) |
| T28501 |
17432-17437 |
NN |
denotes |
mouse |
| T28515 |
17438-17441 |
CC |
denotes |
and |
| T28516 |
17442-17443 |
DT |
denotes |
a |
| T28518 |
17444-17454 |
JJ |
denotes |
homozygous |
| T28519 |
17455-17456 |
-LRB- |
denotes |
( |
| T28521 |
17456-17457 |
SYM |
denotes |
− |
| T28522 |
17457-17458 |
HYPH |
denotes |
/ |
| T28520 |
17458-17459 |
SYM |
denotes |
− |
| T28523 |
17459-17460 |
-RRB- |
denotes |
) |
| T28524 |
17461-17466 |
NN |
denotes |
Dmrt7 |
| T28525 |
17467-17473 |
NN |
denotes |
mutant |
| T28517 |
17474-17484 |
NN |
denotes |
littermate |
| T28526 |
17484-17485 |
. |
denotes |
. |
| T28527 |
17485-17601 |
sentence |
denotes |
(B–D) Sections of testes from 14-d-old (B), 21-d-old (C), and 42-d-old mice (D) stained with hematoxylin and eosin. |
| T28528 |
17486-17487 |
-LRB- |
denotes |
( |
| T28529 |
17487-17488 |
LS |
denotes |
B |
| T28531 |
17488-17489 |
SYM |
denotes |
– |
| T28532 |
17489-17490 |
LS |
denotes |
D |
| T28533 |
17490-17491 |
-RRB- |
denotes |
) |
| T28530 |
17492-17500 |
NNS |
denotes |
Sections |
| T28534 |
17501-17503 |
IN |
denotes |
of |
| T28535 |
17504-17510 |
NNS |
denotes |
testes |
| T28536 |
17511-17515 |
IN |
denotes |
from |
| T28537 |
17516-17518 |
CD |
denotes |
14 |
| T28539 |
17518-17519 |
HYPH |
denotes |
- |
| T28538 |
17519-17520 |
NN |
denotes |
d |
| T28541 |
17520-17521 |
HYPH |
denotes |
- |
| T28540 |
17521-17524 |
JJ |
denotes |
old |
| T28543 |
17525-17526 |
-LRB- |
denotes |
( |
| T28544 |
17526-17527 |
NN |
denotes |
B |
| T28545 |
17527-17528 |
-RRB- |
denotes |
) |
| T28546 |
17528-17530 |
, |
denotes |
, |
| T28547 |
17530-17532 |
CD |
denotes |
21 |
| T28549 |
17532-17533 |
HYPH |
denotes |
- |
| T28548 |
17533-17534 |
NN |
denotes |
d |
| T28551 |
17534-17535 |
HYPH |
denotes |
- |
| T28550 |
17535-17538 |
JJ |
denotes |
old |
| T28552 |
17539-17540 |
-LRB- |
denotes |
( |
| T28553 |
17540-17541 |
NN |
denotes |
C |
| T28554 |
17541-17542 |
-RRB- |
denotes |
) |
| T28555 |
17542-17544 |
, |
denotes |
, |
| T28556 |
17544-17547 |
CC |
denotes |
and |
| T28557 |
17548-17550 |
CD |
denotes |
42 |
| T28559 |
17550-17551 |
HYPH |
denotes |
- |
| T28558 |
17551-17552 |
NN |
denotes |
d |
| T28561 |
17552-17553 |
HYPH |
denotes |
- |
| T28560 |
17553-17556 |
JJ |
denotes |
old |
| T28542 |
17557-17561 |
NNS |
denotes |
mice |
| T28562 |
17562-17563 |
-LRB- |
denotes |
( |
| T28563 |
17563-17564 |
NN |
denotes |
D |
| T28564 |
17564-17565 |
-RRB- |
denotes |
) |
| T28565 |
17566-17573 |
VBN |
denotes |
stained |
| T28566 |
17574-17578 |
IN |
denotes |
with |
| T28567 |
17579-17590 |
NN |
denotes |
hematoxylin |
| T28568 |
17591-17594 |
CC |
denotes |
and |
| T28569 |
17595-17600 |
NN |
denotes |
eosin |
| T28570 |
17600-17601 |
. |
denotes |
. |
| T28571 |
17601-17650 |
sentence |
denotes |
Wild-type is in left column and mutant in right. |
| T28572 |
17602-17606 |
JJ |
denotes |
Wild |
| T28574 |
17606-17607 |
HYPH |
denotes |
- |
| T28573 |
17607-17611 |
NN |
denotes |
type |
| T28575 |
17612-17614 |
VBZ |
denotes |
is |
| T28576 |
17615-17617 |
IN |
denotes |
in |
| T28577 |
17618-17622 |
JJ |
denotes |
left |
| T28578 |
17623-17629 |
NN |
denotes |
column |
| T28579 |
17630-17633 |
CC |
denotes |
and |
| T28580 |
17634-17640 |
NN |
denotes |
mutant |
| T28581 |
17641-17643 |
IN |
denotes |
in |
| T28582 |
17644-17649 |
JJ |
denotes |
right |
| T28583 |
17649-17650 |
. |
denotes |
. |
| T28584 |
17650-17857 |
sentence |
denotes |
No significant difference is observed at 14 d (B), but by 21 d some tubules are lacking abundant spermatocytes (C, asterisk) or cells with typical apoptotic morphology are present (open arrowhead, C and D). |
| T28585 |
17651-17653 |
DT |
denotes |
No |
| T28587 |
17654-17665 |
JJ |
denotes |
significant |
| T28586 |
17666-17676 |
NN |
denotes |
difference |
| T28589 |
17677-17679 |
VBZ |
denotes |
is |
| T28588 |
17680-17688 |
VBN |
denotes |
observed |
| T28590 |
17689-17691 |
IN |
denotes |
at |
| T28591 |
17692-17694 |
CD |
denotes |
14 |
| T28592 |
17695-17696 |
NNS |
denotes |
d |
| T28593 |
17697-17698 |
-LRB- |
denotes |
( |
| T28594 |
17698-17699 |
NN |
denotes |
B |
| T28595 |
17699-17700 |
-RRB- |
denotes |
) |
| T28596 |
17700-17702 |
, |
denotes |
, |
| T28597 |
17702-17705 |
CC |
denotes |
but |
| T28598 |
17706-17708 |
IN |
denotes |
by |
| T28600 |
17709-17711 |
CD |
denotes |
21 |
| T28601 |
17712-17713 |
NNS |
denotes |
d |
| T28602 |
17714-17718 |
DT |
denotes |
some |
| T28603 |
17719-17726 |
NNS |
denotes |
tubules |
| T28604 |
17727-17730 |
VBP |
denotes |
are |
| T28599 |
17731-17738 |
VBG |
denotes |
lacking |
| T28605 |
17739-17747 |
JJ |
denotes |
abundant |
| T28606 |
17748-17761 |
NNS |
denotes |
spermatocytes |
| T28607 |
17762-17763 |
-LRB- |
denotes |
( |
| T28609 |
17763-17764 |
NN |
denotes |
C |
| T28610 |
17764-17766 |
, |
denotes |
, |
| T28608 |
17766-17774 |
NN |
denotes |
asterisk |
| T28611 |
17774-17775 |
-RRB- |
denotes |
) |
| T28612 |
17776-17778 |
CC |
denotes |
or |
| T28613 |
17779-17784 |
NNS |
denotes |
cells |
| T28615 |
17785-17789 |
IN |
denotes |
with |
| T28616 |
17790-17797 |
JJ |
denotes |
typical |
| T28618 |
17798-17807 |
JJ |
denotes |
apoptotic |
| T28617 |
17808-17818 |
NN |
denotes |
morphology |
| T28614 |
17819-17822 |
VBP |
denotes |
are |
| T28619 |
17823-17830 |
JJ |
denotes |
present |
| T28620 |
17831-17832 |
-LRB- |
denotes |
( |
| T28622 |
17832-17836 |
JJ |
denotes |
open |
| T28623 |
17837-17846 |
NN |
denotes |
arrowhead |
| T28624 |
17846-17848 |
, |
denotes |
, |
| T28621 |
17848-17849 |
NN |
denotes |
C |
| T28625 |
17850-17853 |
CC |
denotes |
and |
| T28626 |
17854-17855 |
NN |
denotes |
D |
| T28627 |
17855-17856 |
-RRB- |
denotes |
) |
| T28628 |
17856-17857 |
. |
denotes |
. |
| T28629 |
17857-17923 |
sentence |
denotes |
Mutant tubules contain multinucleate cells (closed arrowhead, D). |
| T28630 |
17858-17864 |
NN |
denotes |
Mutant |
| T28631 |
17865-17872 |
NNS |
denotes |
tubules |
| T28632 |
17873-17880 |
VBP |
denotes |
contain |
| T28633 |
17881-17894 |
JJ |
denotes |
multinucleate |
| T28634 |
17895-17900 |
NNS |
denotes |
cells |
| T28635 |
17901-17902 |
-LRB- |
denotes |
( |
| T28637 |
17902-17908 |
VBN |
denotes |
closed |
| T28638 |
17909-17918 |
NN |
denotes |
arrowhead |
| T28639 |
17918-17920 |
, |
denotes |
, |
| T28636 |
17920-17921 |
NN |
denotes |
D |
| T28640 |
17921-17922 |
-RRB- |
denotes |
) |
| T28641 |
17922-17923 |
. |
denotes |
. |
| T28642 |
17923-17981 |
sentence |
denotes |
(E and F) TUNEL labeling of Dmrt7-deficient mouse testes. |
| T28643 |
17924-17925 |
-LRB- |
denotes |
( |
| T28644 |
17925-17926 |
LS |
denotes |
E |
| T28646 |
17927-17930 |
CC |
denotes |
and |
| T28647 |
17931-17932 |
LS |
denotes |
F |
| T28648 |
17932-17933 |
-RRB- |
denotes |
) |
| T28649 |
17934-17939 |
NN |
denotes |
TUNEL |
| T28645 |
17940-17948 |
NN |
denotes |
labeling |
| T28650 |
17949-17951 |
IN |
denotes |
of |
| T28651 |
17952-17957 |
NN |
denotes |
Dmrt7 |
| T28653 |
17957-17958 |
HYPH |
denotes |
- |
| T28652 |
17958-17967 |
JJ |
denotes |
deficient |
| T28655 |
17968-17973 |
NN |
denotes |
mouse |
| T28654 |
17974-17980 |
NNS |
denotes |
testes |
| T28656 |
17980-17981 |
. |
denotes |
. |
| T28657 |
17981-18096 |
sentence |
denotes |
Testes from wild-type and homozygous mutant littermates were analyzed by TUNEL labeling to detect apoptotic cells. |
| T28658 |
17982-17988 |
NNS |
denotes |
Testes |
| T28660 |
17989-17993 |
IN |
denotes |
from |
| T28661 |
17994-17998 |
JJ |
denotes |
wild |
| T28663 |
17998-17999 |
HYPH |
denotes |
- |
| T28662 |
17999-18003 |
NN |
denotes |
type |
| T28665 |
18004-18007 |
CC |
denotes |
and |
| T28666 |
18008-18018 |
JJ |
denotes |
homozygous |
| T28667 |
18019-18025 |
NN |
denotes |
mutant |
| T28664 |
18026-18037 |
NNS |
denotes |
littermates |
| T28668 |
18038-18042 |
VBD |
denotes |
were |
| T28659 |
18043-18051 |
VBN |
denotes |
analyzed |
| T28669 |
18052-18054 |
IN |
denotes |
by |
| T28670 |
18055-18060 |
NN |
denotes |
TUNEL |
| T28671 |
18061-18069 |
NN |
denotes |
labeling |
| T28672 |
18070-18072 |
TO |
denotes |
to |
| T28673 |
18073-18079 |
VB |
denotes |
detect |
| T28674 |
18080-18089 |
JJ |
denotes |
apoptotic |
| T28675 |
18090-18095 |
NNS |
denotes |
cells |
| T28676 |
18095-18096 |
. |
denotes |
. |
| T28677 |
18096-18153 |
sentence |
denotes |
Testis sections from 21-d-old (E) and 6-wk-old mice (F). |
| T28678 |
18097-18103 |
NN |
denotes |
Testis |
| T28679 |
18104-18112 |
NNS |
denotes |
sections |
| T28680 |
18113-18117 |
IN |
denotes |
from |
| T28681 |
18118-18120 |
CD |
denotes |
21 |
| T28683 |
18120-18121 |
HYPH |
denotes |
- |
| T28682 |
18121-18122 |
NN |
denotes |
d |
| T28685 |
18122-18123 |
HYPH |
denotes |
- |
| T28684 |
18123-18126 |
JJ |
denotes |
old |
| T28687 |
18127-18128 |
-LRB- |
denotes |
( |
| T28688 |
18128-18129 |
NN |
denotes |
E |
| T28689 |
18129-18130 |
-RRB- |
denotes |
) |
| T28690 |
18131-18134 |
CC |
denotes |
and |
| T28691 |
18135-18136 |
CD |
denotes |
6 |
| T28693 |
18136-18137 |
HYPH |
denotes |
- |
| T28692 |
18137-18139 |
NN |
denotes |
wk |
| T28695 |
18139-18140 |
HYPH |
denotes |
- |
| T28694 |
18140-18143 |
JJ |
denotes |
old |
| T28686 |
18144-18148 |
NNS |
denotes |
mice |
| T28696 |
18149-18150 |
-LRB- |
denotes |
( |
| T28697 |
18150-18151 |
NN |
denotes |
F |
| T28698 |
18151-18152 |
-RRB- |
denotes |
) |
| T28699 |
18152-18153 |
. |
denotes |
. |
| T28700 |
18153-18279 |
sentence |
denotes |
Apoptotic cells (brown) are much more abundant in seminiferous tubules of homozygous Dmrt7 mutant mice relative to wild-type. |
| T28701 |
18154-18163 |
JJ |
denotes |
Apoptotic |
| T28702 |
18164-18169 |
NNS |
denotes |
cells |
| T28704 |
18170-18171 |
-LRB- |
denotes |
( |
| T28705 |
18171-18176 |
JJ |
denotes |
brown |
| T28706 |
18176-18177 |
-RRB- |
denotes |
) |
| T28703 |
18178-18181 |
VBP |
denotes |
are |
| T28707 |
18182-18186 |
RB |
denotes |
much |
| T28708 |
18187-18191 |
RBR |
denotes |
more |
| T28709 |
18192-18200 |
JJ |
denotes |
abundant |
| T28710 |
18201-18203 |
IN |
denotes |
in |
| T28711 |
18204-18216 |
JJ |
denotes |
seminiferous |
| T28712 |
18217-18224 |
NNS |
denotes |
tubules |
| T28713 |
18225-18227 |
IN |
denotes |
of |
| T28714 |
18228-18238 |
JJ |
denotes |
homozygous |
| T28716 |
18239-18244 |
NN |
denotes |
Dmrt7 |
| T28717 |
18245-18251 |
NN |
denotes |
mutant |
| T28715 |
18252-18256 |
NNS |
denotes |
mice |
| T28718 |
18257-18265 |
JJ |
denotes |
relative |
| T28719 |
18266-18268 |
IN |
denotes |
to |
| T28720 |
18269-18273 |
JJ |
denotes |
wild |
| T28722 |
18273-18274 |
HYPH |
denotes |
- |
| T28721 |
18274-18278 |
NN |
denotes |
type |
| T28723 |
18278-18279 |
. |
denotes |
. |
| T28724 |
18279-18311 |
sentence |
denotes |
Bars in (B–F) represent 100 μm. |
| T28725 |
18280-18284 |
NNS |
denotes |
Bars |
| T28727 |
18285-18287 |
IN |
denotes |
in |
| T28728 |
18288-18289 |
-LRB- |
denotes |
( |
| T28729 |
18289-18290 |
NN |
denotes |
B |
| T28730 |
18290-18291 |
SYM |
denotes |
– |
| T28731 |
18291-18292 |
NN |
denotes |
F |
| T28732 |
18292-18293 |
-RRB- |
denotes |
) |
| T28726 |
18294-18303 |
VBP |
denotes |
represent |
| T28733 |
18304-18307 |
CD |
denotes |
100 |
| T28734 |
18308-18310 |
NNS |
denotes |
μm |
| T28735 |
18310-18311 |
. |
denotes |
. |
| T10068 |
18312-18317 |
IN |
denotes |
Since |
| T10070 |
18318-18323 |
NN |
denotes |
Dmrt7 |
| T10072 |
18324-18330 |
NN |
denotes |
mutant |
| T10071 |
18331-18337 |
NNS |
denotes |
testes |
| T10069 |
18338-18342 |
VBP |
denotes |
lack |
| T10074 |
18343-18347 |
RBS |
denotes |
most |
| T10076 |
18348-18362 |
JJ |
denotes |
post-pachytene |
| T10075 |
18363-18368 |
NNS |
denotes |
cells |
| T10077 |
18368-18370 |
, |
denotes |
, |
| T10078 |
18370-18372 |
PRP |
denotes |
we |
| T10073 |
18373-18377 |
VBD |
denotes |
used |
| T10079 |
18378-18383 |
NN |
denotes |
TUNEL |
| T10080 |
18384-18392 |
NN |
denotes |
analysis |
| T10081 |
18393-18395 |
TO |
denotes |
to |
| T10082 |
18396-18400 |
VB |
denotes |
test |
| T10083 |
18401-18408 |
IN |
denotes |
whether |
| T10085 |
18409-18412 |
DT |
denotes |
the |
| T10087 |
18413-18420 |
JJ |
denotes |
missing |
| T10086 |
18421-18426 |
NNS |
denotes |
cells |
| T10088 |
18427-18430 |
VBP |
denotes |
are |
| T10084 |
18431-18441 |
VBN |
denotes |
eliminated |
| T10089 |
18442-18444 |
IN |
denotes |
by |
| T10090 |
18445-18454 |
NN |
denotes |
apoptosis |
| T10091 |
18454-18455 |
. |
denotes |
. |
| T10092 |
18455-18561 |
sentence |
denotes |
At 3 wk, Dmrt7 mutant testes contain significantly more apoptotic cells than those of wild-type controls. |
| T10093 |
18456-18458 |
IN |
denotes |
At |
| T10095 |
18459-18460 |
CD |
denotes |
3 |
| T10096 |
18461-18463 |
NNS |
denotes |
wk |
| T10097 |
18463-18465 |
, |
denotes |
, |
| T10098 |
18465-18470 |
NN |
denotes |
Dmrt7 |
| T10099 |
18471-18477 |
NN |
denotes |
mutant |
| T10100 |
18478-18484 |
NNS |
denotes |
testes |
| T10094 |
18485-18492 |
VBP |
denotes |
contain |
| T10101 |
18493-18506 |
RB |
denotes |
significantly |
| T10102 |
18507-18511 |
JJR |
denotes |
more |
| T10104 |
18512-18521 |
JJ |
denotes |
apoptotic |
| T10103 |
18522-18527 |
NNS |
denotes |
cells |
| T10105 |
18528-18532 |
IN |
denotes |
than |
| T10106 |
18533-18538 |
DT |
denotes |
those |
| T10107 |
18539-18541 |
IN |
denotes |
of |
| T10108 |
18542-18546 |
JJ |
denotes |
wild |
| T10110 |
18546-18547 |
HYPH |
denotes |
- |
| T10109 |
18547-18551 |
NN |
denotes |
type |
| T10111 |
18552-18560 |
NNS |
denotes |
controls |
| T10112 |
18560-18561 |
. |
denotes |
. |
| T10113 |
18561-18728 |
sentence |
denotes |
The percentage of tubule sections with five or more apoptotic nuclei was about three times higher in Dmrt7 mutants compared with wild-type (20% versus 7%; Figure 2E). |
| T10114 |
18562-18565 |
DT |
denotes |
The |
| T10115 |
18566-18576 |
NN |
denotes |
percentage |
| T10117 |
18577-18579 |
IN |
denotes |
of |
| T10118 |
18580-18586 |
NN |
denotes |
tubule |
| T10119 |
18587-18595 |
NNS |
denotes |
sections |
| T10120 |
18596-18600 |
IN |
denotes |
with |
| T10121 |
18601-18605 |
CD |
denotes |
five |
| T10123 |
18606-18608 |
CC |
denotes |
or |
| T10124 |
18609-18613 |
JJR |
denotes |
more |
| T10125 |
18614-18623 |
JJ |
denotes |
apoptotic |
| T10122 |
18624-18630 |
NNS |
denotes |
nuclei |
| T10116 |
18631-18634 |
VBD |
denotes |
was |
| T10126 |
18635-18640 |
IN |
denotes |
about |
| T10127 |
18641-18646 |
CD |
denotes |
three |
| T10129 |
18647-18652 |
NNS |
denotes |
times |
| T10128 |
18653-18659 |
JJR |
denotes |
higher |
| T10130 |
18660-18662 |
IN |
denotes |
in |
| T10131 |
18663-18668 |
NN |
denotes |
Dmrt7 |
| T10132 |
18669-18676 |
NNS |
denotes |
mutants |
| T10133 |
18677-18685 |
VBN |
denotes |
compared |
| T10134 |
18686-18690 |
IN |
denotes |
with |
| T10135 |
18691-18695 |
JJ |
denotes |
wild |
| T10137 |
18695-18696 |
HYPH |
denotes |
- |
| T10136 |
18696-18700 |
NN |
denotes |
type |
| T10138 |
18701-18702 |
-LRB- |
denotes |
( |
| T10140 |
18702-18704 |
CD |
denotes |
20 |
| T10141 |
18704-18705 |
NN |
denotes |
% |
| T10142 |
18706-18712 |
CC |
denotes |
versus |
| T10143 |
18713-18714 |
CD |
denotes |
7 |
| T10144 |
18714-18715 |
NN |
denotes |
% |
| T10145 |
18715-18716 |
: |
denotes |
; |
| T10146 |
18717-18723 |
NN |
denotes |
Figure |
| T10139 |
18724-18726 |
NN |
denotes |
2E |
| T10147 |
18726-18727 |
-RRB- |
denotes |
) |
| T10148 |
18727-18728 |
. |
denotes |
. |
| T10149 |
18728-18812 |
sentence |
denotes |
A similar elevation of apoptosis was apparent in mutant testes at 7 wk (Figure 2F). |
| T10150 |
18729-18730 |
DT |
denotes |
A |
| T10152 |
18731-18738 |
JJ |
denotes |
similar |
| T10151 |
18739-18748 |
NN |
denotes |
elevation |
| T10154 |
18749-18751 |
IN |
denotes |
of |
| T10155 |
18752-18761 |
NN |
denotes |
apoptosis |
| T10153 |
18762-18765 |
VBD |
denotes |
was |
| T10156 |
18766-18774 |
JJ |
denotes |
apparent |
| T10157 |
18775-18777 |
IN |
denotes |
in |
| T10158 |
18778-18784 |
NN |
denotes |
mutant |
| T10159 |
18785-18791 |
NNS |
denotes |
testes |
| T10160 |
18792-18794 |
IN |
denotes |
at |
| T10161 |
18795-18796 |
CD |
denotes |
7 |
| T10162 |
18797-18799 |
NNS |
denotes |
wk |
| T10163 |
18800-18801 |
-LRB- |
denotes |
( |
| T10165 |
18801-18807 |
NN |
denotes |
Figure |
| T10164 |
18808-18810 |
NN |
denotes |
2F |
| T10166 |
18810-18811 |
-RRB- |
denotes |
) |
| T10167 |
18811-18812 |
. |
denotes |
. |
| T10168 |
18812-18974 |
sentence |
denotes |
In mutants, many apoptotic cells were in the middle of the tubules, whereas the apoptotic cells in wild-type occur mainly near the seminiferous tubule periphery. |
| T10169 |
18813-18815 |
IN |
denotes |
In |
| T10171 |
18816-18823 |
NNS |
denotes |
mutants |
| T10172 |
18823-18825 |
, |
denotes |
, |
| T10173 |
18825-18829 |
JJ |
denotes |
many |
| T10175 |
18830-18839 |
JJ |
denotes |
apoptotic |
| T10174 |
18840-18845 |
NNS |
denotes |
cells |
| T10170 |
18846-18850 |
VBD |
denotes |
were |
| T10176 |
18851-18853 |
IN |
denotes |
in |
| T10177 |
18854-18857 |
DT |
denotes |
the |
| T10178 |
18858-18864 |
NN |
denotes |
middle |
| T10179 |
18865-18867 |
IN |
denotes |
of |
| T10180 |
18868-18871 |
DT |
denotes |
the |
| T10181 |
18872-18879 |
NNS |
denotes |
tubules |
| T10182 |
18879-18881 |
, |
denotes |
, |
| T10183 |
18881-18888 |
IN |
denotes |
whereas |
| T10185 |
18889-18892 |
DT |
denotes |
the |
| T10187 |
18893-18902 |
JJ |
denotes |
apoptotic |
| T10186 |
18903-18908 |
NNS |
denotes |
cells |
| T10188 |
18909-18911 |
IN |
denotes |
in |
| T10189 |
18912-18916 |
JJ |
denotes |
wild |
| T10191 |
18916-18917 |
HYPH |
denotes |
- |
| T10190 |
18917-18921 |
NN |
denotes |
type |
| T10184 |
18922-18927 |
VBP |
denotes |
occur |
| T10192 |
18928-18934 |
RB |
denotes |
mainly |
| T10193 |
18935-18939 |
IN |
denotes |
near |
| T10194 |
18940-18943 |
DT |
denotes |
the |
| T10196 |
18944-18956 |
JJ |
denotes |
seminiferous |
| T10197 |
18957-18963 |
NN |
denotes |
tubule |
| T10195 |
18964-18973 |
NN |
denotes |
periphery |
| T10198 |
18973-18974 |
. |
denotes |
. |
| T10199 |
18974-19160 |
sentence |
denotes |
The numbers of Sertoli cells were not significantly different between wild-type and mutant testes, and we observed no difference in somatic cell apoptosis in mutants (unpublished data). |
| T10200 |
18975-18978 |
DT |
denotes |
The |
| T10201 |
18979-18986 |
NNS |
denotes |
numbers |
| T10203 |
18987-18989 |
IN |
denotes |
of |
| T10204 |
18990-18997 |
NNP |
denotes |
Sertoli |
| T10205 |
18998-19003 |
NNS |
denotes |
cells |
| T10202 |
19004-19008 |
VBD |
denotes |
were |
| T10206 |
19009-19012 |
RB |
denotes |
not |
| T10207 |
19013-19026 |
RB |
denotes |
significantly |
| T10208 |
19027-19036 |
JJ |
denotes |
different |
| T10209 |
19037-19044 |
IN |
denotes |
between |
| T10210 |
19045-19049 |
JJ |
denotes |
wild |
| T10212 |
19049-19050 |
HYPH |
denotes |
- |
| T10211 |
19050-19054 |
NN |
denotes |
type |
| T10214 |
19055-19058 |
CC |
denotes |
and |
| T10215 |
19059-19065 |
NN |
denotes |
mutant |
| T10213 |
19066-19072 |
NNS |
denotes |
testes |
| T10216 |
19072-19074 |
, |
denotes |
, |
| T10217 |
19074-19077 |
CC |
denotes |
and |
| T10218 |
19078-19080 |
PRP |
denotes |
we |
| T10219 |
19081-19089 |
VBD |
denotes |
observed |
| T10220 |
19090-19092 |
DT |
denotes |
no |
| T10221 |
19093-19103 |
NN |
denotes |
difference |
| T10222 |
19104-19106 |
IN |
denotes |
in |
| T10223 |
19107-19114 |
JJ |
denotes |
somatic |
| T10225 |
19115-19119 |
NN |
denotes |
cell |
| T10224 |
19120-19129 |
NN |
denotes |
apoptosis |
| T10226 |
19130-19132 |
IN |
denotes |
in |
| T10227 |
19133-19140 |
NNS |
denotes |
mutants |
| T10228 |
19141-19142 |
-LRB- |
denotes |
( |
| T10230 |
19142-19153 |
JJ |
denotes |
unpublished |
| T10229 |
19154-19158 |
NNS |
denotes |
data |
| T10231 |
19158-19159 |
-RRB- |
denotes |
) |
| T10232 |
19159-19160 |
. |
denotes |
. |
| T10233 |
19160-19336 |
sentence |
denotes |
From these results, we conclude that loss of Dmrt7 causes a block in meiotic progression, mainly in pachynema, leading to the elimination, by apoptosis, of the arrested cells. |
| T10234 |
19161-19165 |
IN |
denotes |
From |
| T10236 |
19166-19171 |
DT |
denotes |
these |
| T10237 |
19172-19179 |
NNS |
denotes |
results |
| T10238 |
19179-19181 |
, |
denotes |
, |
| T10239 |
19181-19183 |
PRP |
denotes |
we |
| T10235 |
19184-19192 |
VBP |
denotes |
conclude |
| T10240 |
19193-19197 |
IN |
denotes |
that |
| T10242 |
19198-19202 |
NN |
denotes |
loss |
| T10243 |
19203-19205 |
IN |
denotes |
of |
| T10244 |
19206-19211 |
NN |
denotes |
Dmrt7 |
| T10241 |
19212-19218 |
VBZ |
denotes |
causes |
| T10245 |
19219-19220 |
DT |
denotes |
a |
| T10246 |
19221-19226 |
NN |
denotes |
block |
| T10247 |
19227-19229 |
IN |
denotes |
in |
| T10248 |
19230-19237 |
JJ |
denotes |
meiotic |
| T10249 |
19238-19249 |
NN |
denotes |
progression |
| T10250 |
19249-19251 |
, |
denotes |
, |
| T10251 |
19251-19257 |
RB |
denotes |
mainly |
| T10252 |
19258-19260 |
IN |
denotes |
in |
| T10253 |
19261-19270 |
NN |
denotes |
pachynema |
| T10254 |
19270-19272 |
, |
denotes |
, |
| T10255 |
19272-19279 |
VBG |
denotes |
leading |
| T10256 |
19280-19282 |
IN |
denotes |
to |
| T10257 |
19283-19286 |
DT |
denotes |
the |
| T10258 |
19287-19298 |
NN |
denotes |
elimination |
| T10259 |
19298-19300 |
, |
denotes |
, |
| T10260 |
19300-19302 |
IN |
denotes |
by |
| T10261 |
19303-19312 |
NN |
denotes |
apoptosis |
| T10262 |
19312-19314 |
, |
denotes |
, |
| T10263 |
19314-19316 |
IN |
denotes |
of |
| T10264 |
19317-19320 |
DT |
denotes |
the |
| T10266 |
19321-19329 |
VBN |
denotes |
arrested |
| T10265 |
19330-19335 |
NNS |
denotes |
cells |
| T10267 |
19335-19336 |
. |
denotes |
. |
| T10945 |
19338-19347 |
NN |
denotes |
Pachytene |
| T10946 |
19348-19354 |
NN |
denotes |
Arrest |
| T10947 |
19355-19357 |
IN |
denotes |
of |
| T10948 |
19358-19363 |
NN |
denotes |
Dmrt7 |
| T10949 |
19364-19370 |
NN |
denotes |
Mutant |
| T10951 |
19371-19375 |
NN |
denotes |
Germ |
| T10950 |
19376-19381 |
NNS |
denotes |
Cells |
| T10952 |
19381-19541 |
sentence |
denotes |
To better define the spermatogenic stage at which Dmrt7−/− male germ cells arrest and die, we used antibodies against several stage-specific germ cell markers. |
| T10953 |
19382-19384 |
TO |
denotes |
To |
| T10955 |
19385-19391 |
RBR |
denotes |
better |
| T10954 |
19392-19398 |
VB |
denotes |
define |
| T10957 |
19399-19402 |
DT |
denotes |
the |
| T10959 |
19403-19416 |
JJ |
denotes |
spermatogenic |
| T10958 |
19417-19422 |
NN |
denotes |
stage |
| T10960 |
19423-19425 |
IN |
denotes |
at |
| T10962 |
19426-19431 |
WDT |
denotes |
which |
| T10963 |
19432-19437 |
NN |
denotes |
Dmrt7 |
| T10965 |
19437-19438 |
SYM |
denotes |
− |
| T10966 |
19438-19439 |
HYPH |
denotes |
/ |
| T10967 |
19439-19440 |
SYM |
denotes |
− |
| T10968 |
19441-19445 |
JJ |
denotes |
male |
| T10969 |
19446-19450 |
NN |
denotes |
germ |
| T10964 |
19451-19456 |
NNS |
denotes |
cells |
| T10961 |
19457-19463 |
VBP |
denotes |
arrest |
| T10970 |
19464-19467 |
CC |
denotes |
and |
| T10971 |
19468-19471 |
VBP |
denotes |
die |
| T10972 |
19471-19473 |
, |
denotes |
, |
| T10973 |
19473-19475 |
PRP |
denotes |
we |
| T10956 |
19476-19480 |
VBD |
denotes |
used |
| T10974 |
19481-19491 |
NNS |
denotes |
antibodies |
| T10975 |
19492-19499 |
IN |
denotes |
against |
| T10976 |
19500-19507 |
JJ |
denotes |
several |
| T10978 |
19508-19513 |
NN |
denotes |
stage |
| T10980 |
19513-19514 |
HYPH |
denotes |
- |
| T10979 |
19514-19522 |
JJ |
denotes |
specific |
| T10981 |
19523-19527 |
NN |
denotes |
germ |
| T10982 |
19528-19532 |
NN |
denotes |
cell |
| T10977 |
19533-19540 |
NNS |
denotes |
markers |
| T10983 |
19540-19541 |
. |
denotes |
. |
| T10984 |
19541-19592 |
sentence |
denotes |
TRA98 is expressed in PGCs and spermatogonia [43]. |
| T10985 |
19542-19547 |
NN |
denotes |
TRA98 |
| T10987 |
19548-19550 |
VBZ |
denotes |
is |
| T10986 |
19551-19560 |
VBN |
denotes |
expressed |
| T10988 |
19561-19563 |
IN |
denotes |
in |
| T10989 |
19564-19568 |
NNS |
denotes |
PGCs |
| T10990 |
19569-19572 |
CC |
denotes |
and |
| T10991 |
19573-19586 |
NNS |
denotes |
spermatogonia |
| T10992 |
19587-19588 |
-LRB- |
denotes |
[ |
| T10993 |
19588-19590 |
CD |
denotes |
43 |
| T10994 |
19590-19591 |
-RRB- |
denotes |
] |
| T10995 |
19591-19592 |
. |
denotes |
. |
| T10996 |
19592-19832 |
sentence |
denotes |
In the wild-type adult testis, strongly staining TRA98-positive cells form a layer one cell deep; however, in the mutant TRA98, strongly positive cells were abnormally organized, and some tubules had a layer several cells deep (Figure 3A). |
| T10997 |
19593-19595 |
IN |
denotes |
In |
| T10999 |
19596-19599 |
DT |
denotes |
the |
| T11001 |
19600-19604 |
JJ |
denotes |
wild |
| T11003 |
19604-19605 |
HYPH |
denotes |
- |
| T11002 |
19605-19609 |
NN |
denotes |
type |
| T11004 |
19610-19615 |
JJ |
denotes |
adult |
| T11000 |
19616-19622 |
NN |
denotes |
testis |
| T11005 |
19622-19624 |
, |
denotes |
, |
| T11006 |
19624-19632 |
RB |
denotes |
strongly |
| T11007 |
19633-19641 |
VBG |
denotes |
staining |
| T11009 |
19642-19647 |
NN |
denotes |
TRA98 |
| T11011 |
19647-19648 |
HYPH |
denotes |
- |
| T11010 |
19648-19656 |
JJ |
denotes |
positive |
| T11008 |
19657-19662 |
NNS |
denotes |
cells |
| T10998 |
19663-19667 |
VBP |
denotes |
form |
| T11013 |
19668-19669 |
DT |
denotes |
a |
| T11014 |
19670-19675 |
NN |
denotes |
layer |
| T11015 |
19676-19679 |
CD |
denotes |
one |
| T11016 |
19680-19684 |
NN |
denotes |
cell |
| T11017 |
19685-19689 |
JJ |
denotes |
deep |
| T11018 |
19689-19690 |
: |
denotes |
; |
| T11019 |
19691-19698 |
RB |
denotes |
however |
| T11020 |
19698-19700 |
, |
denotes |
, |
| T11021 |
19700-19702 |
IN |
denotes |
in |
| T11022 |
19703-19706 |
DT |
denotes |
the |
| T11024 |
19707-19713 |
NN |
denotes |
mutant |
| T11023 |
19714-19719 |
NN |
denotes |
TRA98 |
| T11025 |
19719-19721 |
, |
denotes |
, |
| T11026 |
19721-19729 |
RB |
denotes |
strongly |
| T11027 |
19730-19738 |
JJ |
denotes |
positive |
| T11028 |
19739-19744 |
NNS |
denotes |
cells |
| T11012 |
19745-19749 |
VBD |
denotes |
were |
| T11029 |
19750-19760 |
RB |
denotes |
abnormally |
| T11030 |
19761-19770 |
JJ |
denotes |
organized |
| T11031 |
19770-19772 |
, |
denotes |
, |
| T11032 |
19772-19775 |
CC |
denotes |
and |
| T11033 |
19776-19780 |
DT |
denotes |
some |
| T11034 |
19781-19788 |
NNS |
denotes |
tubules |
| T11035 |
19789-19792 |
VBD |
denotes |
had |
| T11036 |
19793-19794 |
DT |
denotes |
a |
| T11037 |
19795-19800 |
NN |
denotes |
layer |
| T11038 |
19801-19808 |
JJ |
denotes |
several |
| T11039 |
19809-19814 |
NNS |
denotes |
cells |
| T11040 |
19815-19819 |
JJ |
denotes |
deep |
| T11041 |
19820-19821 |
-LRB- |
denotes |
( |
| T11043 |
19821-19827 |
NN |
denotes |
Figure |
| T11042 |
19828-19830 |
NN |
denotes |
3A |
| T11044 |
19830-19831 |
-RRB- |
denotes |
) |
| T11045 |
19831-19832 |
. |
denotes |
. |
| T11046 |
19832-19923 |
sentence |
denotes |
The BC7 antibody recognizes spermatocytes in the leptotene to early-pachytene stages [44]. |
| T11047 |
19833-19836 |
DT |
denotes |
The |
| T11049 |
19837-19840 |
NN |
denotes |
BC7 |
| T11048 |
19841-19849 |
NN |
denotes |
antibody |
| T11050 |
19850-19860 |
VBZ |
denotes |
recognizes |
| T11051 |
19861-19874 |
NNS |
denotes |
spermatocytes |
| T11052 |
19875-19877 |
IN |
denotes |
in |
| T11053 |
19878-19881 |
DT |
denotes |
the |
| T11054 |
19882-19891 |
NN |
denotes |
leptotene |
| T11055 |
19892-19894 |
IN |
denotes |
to |
| T11056 |
19895-19900 |
JJ |
denotes |
early |
| T11058 |
19900-19901 |
HYPH |
denotes |
- |
| T11057 |
19901-19910 |
NN |
denotes |
pachytene |
| T11059 |
19911-19917 |
NNS |
denotes |
stages |
| T11060 |
19918-19919 |
-LRB- |
denotes |
[ |
| T11061 |
19919-19921 |
CD |
denotes |
44 |
| T11062 |
19921-19922 |
-RRB- |
denotes |
] |
| T11063 |
19922-19923 |
. |
denotes |
. |
| T11064 |
19923-20124 |
sentence |
denotes |
Dmrt7 mutant testes had BC7-positive cells in approximately normal numbers, but again abnormally organized, with many positive cells in the center rather than the periphery of the tubules (Figure 3B). |
| T11065 |
19924-19929 |
NN |
denotes |
Dmrt7 |
| T11066 |
19930-19936 |
NN |
denotes |
mutant |
| T11067 |
19937-19943 |
NNS |
denotes |
testes |
| T11068 |
19944-19947 |
VBD |
denotes |
had |
| T11069 |
19948-19951 |
NN |
denotes |
BC7 |
| T11071 |
19951-19952 |
HYPH |
denotes |
- |
| T11070 |
19952-19960 |
JJ |
denotes |
positive |
| T11072 |
19961-19966 |
NNS |
denotes |
cells |
| T11073 |
19967-19969 |
IN |
denotes |
in |
| T11074 |
19970-19983 |
RB |
denotes |
approximately |
| T11075 |
19984-19990 |
JJ |
denotes |
normal |
| T11076 |
19991-19998 |
NNS |
denotes |
numbers |
| T11077 |
19998-20000 |
, |
denotes |
, |
| T11078 |
20000-20003 |
CC |
denotes |
but |
| T11079 |
20004-20009 |
RB |
denotes |
again |
| T11081 |
20010-20020 |
RB |
denotes |
abnormally |
| T11080 |
20021-20030 |
VBN |
denotes |
organized |
| T11082 |
20030-20032 |
, |
denotes |
, |
| T11083 |
20032-20036 |
IN |
denotes |
with |
| T11084 |
20037-20041 |
JJ |
denotes |
many |
| T11086 |
20042-20050 |
JJ |
denotes |
positive |
| T11085 |
20051-20056 |
NNS |
denotes |
cells |
| T11087 |
20057-20059 |
IN |
denotes |
in |
| T11088 |
20060-20063 |
DT |
denotes |
the |
| T11089 |
20064-20070 |
NN |
denotes |
center |
| T11090 |
20071-20077 |
RB |
denotes |
rather |
| T11091 |
20078-20082 |
IN |
denotes |
than |
| T11092 |
20083-20086 |
DT |
denotes |
the |
| T11093 |
20087-20096 |
NN |
denotes |
periphery |
| T11094 |
20097-20099 |
IN |
denotes |
of |
| T11095 |
20100-20103 |
DT |
denotes |
the |
| T11096 |
20104-20111 |
NNS |
denotes |
tubules |
| T11097 |
20112-20113 |
-LRB- |
denotes |
( |
| T11099 |
20113-20119 |
NN |
denotes |
Figure |
| T11098 |
20120-20122 |
NN |
denotes |
3B |
| T11100 |
20122-20123 |
-RRB- |
denotes |
) |
| T11101 |
20123-20124 |
. |
denotes |
. |
| T11102 |
20124-20246 |
sentence |
denotes |
The TRA369 antibody recognizes a calmegin protein expressed in pachytene spermatocytes through elongated spermatids [45]. |
| T11103 |
20125-20128 |
DT |
denotes |
The |
| T11105 |
20129-20135 |
NN |
denotes |
TRA369 |
| T11104 |
20136-20144 |
NN |
denotes |
antibody |
| T11106 |
20145-20155 |
VBZ |
denotes |
recognizes |
| T11107 |
20156-20157 |
DT |
denotes |
a |
| T11109 |
20158-20166 |
NN |
denotes |
calmegin |
| T11108 |
20167-20174 |
NN |
denotes |
protein |
| T11110 |
20175-20184 |
VBN |
denotes |
expressed |
| T11111 |
20185-20187 |
IN |
denotes |
in |
| T11112 |
20188-20197 |
NN |
denotes |
pachytene |
| T11113 |
20198-20211 |
NNS |
denotes |
spermatocytes |
| T11114 |
20212-20219 |
IN |
denotes |
through |
| T11115 |
20220-20229 |
VBN |
denotes |
elongated |
| T11116 |
20230-20240 |
NNS |
denotes |
spermatids |
| T11117 |
20241-20242 |
-LRB- |
denotes |
[ |
| T11118 |
20242-20244 |
CD |
denotes |
45 |
| T11119 |
20244-20245 |
-RRB- |
denotes |
] |
| T11120 |
20245-20246 |
. |
denotes |
. |
| T11121 |
20246-20378 |
sentence |
denotes |
In contrast to the earlier stages, far fewer TRA369-positive cells were present in mutant testes relative to wild-type (Figure 3C). |
| T11122 |
20247-20249 |
IN |
denotes |
In |
| T11124 |
20250-20258 |
NN |
denotes |
contrast |
| T11125 |
20259-20261 |
IN |
denotes |
to |
| T11126 |
20262-20265 |
DT |
denotes |
the |
| T11128 |
20266-20273 |
JJR |
denotes |
earlier |
| T11127 |
20274-20280 |
NNS |
denotes |
stages |
| T11129 |
20280-20282 |
, |
denotes |
, |
| T11130 |
20282-20285 |
RB |
denotes |
far |
| T11131 |
20286-20291 |
JJR |
denotes |
fewer |
| T11133 |
20292-20298 |
NN |
denotes |
TRA369 |
| T11135 |
20298-20299 |
HYPH |
denotes |
- |
| T11134 |
20299-20307 |
JJ |
denotes |
positive |
| T11132 |
20308-20313 |
NNS |
denotes |
cells |
| T11123 |
20314-20318 |
VBD |
denotes |
were |
| T11136 |
20319-20326 |
JJ |
denotes |
present |
| T11137 |
20327-20329 |
IN |
denotes |
in |
| T11138 |
20330-20336 |
NN |
denotes |
mutant |
| T11139 |
20337-20343 |
NNS |
denotes |
testes |
| T11140 |
20344-20352 |
JJ |
denotes |
relative |
| T11141 |
20353-20355 |
IN |
denotes |
to |
| T11142 |
20356-20360 |
JJ |
denotes |
wild |
| T11144 |
20360-20361 |
HYPH |
denotes |
- |
| T11143 |
20361-20365 |
NN |
denotes |
type |
| T11145 |
20366-20367 |
-LRB- |
denotes |
( |
| T11147 |
20367-20373 |
NN |
denotes |
Figure |
| T11146 |
20374-20376 |
NN |
denotes |
3C |
| T11148 |
20376-20377 |
-RRB- |
denotes |
) |
| T11149 |
20377-20378 |
. |
denotes |
. |
| T11150 |
20378-20578 |
sentence |
denotes |
We also quantitated the number of cells at each meiotic stage using spermatocyte spreads, assaying chromosome-pairing status by staining for SYCP3, a component of the synaptonemal complex (Figure 4). |
| T11151 |
20379-20381 |
PRP |
denotes |
We |
| T11153 |
20382-20386 |
RB |
denotes |
also |
| T11152 |
20387-20398 |
VBD |
denotes |
quantitated |
| T11154 |
20399-20402 |
DT |
denotes |
the |
| T11155 |
20403-20409 |
NN |
denotes |
number |
| T11156 |
20410-20412 |
IN |
denotes |
of |
| T11157 |
20413-20418 |
NNS |
denotes |
cells |
| T11158 |
20419-20421 |
IN |
denotes |
at |
| T11159 |
20422-20426 |
DT |
denotes |
each |
| T11161 |
20427-20434 |
JJ |
denotes |
meiotic |
| T11160 |
20435-20440 |
NN |
denotes |
stage |
| T11162 |
20441-20446 |
VBG |
denotes |
using |
| T11163 |
20447-20459 |
NN |
denotes |
spermatocyte |
| T11164 |
20460-20467 |
NNS |
denotes |
spreads |
| T11165 |
20467-20469 |
, |
denotes |
, |
| T11166 |
20469-20477 |
VBG |
denotes |
assaying |
| T11167 |
20478-20488 |
NN |
denotes |
chromosome |
| T11169 |
20488-20489 |
HYPH |
denotes |
- |
| T11168 |
20489-20496 |
VBG |
denotes |
pairing |
| T11170 |
20497-20503 |
NN |
denotes |
status |
| T11171 |
20504-20506 |
IN |
denotes |
by |
| T11172 |
20507-20515 |
VBG |
denotes |
staining |
| T11173 |
20516-20519 |
IN |
denotes |
for |
| T11174 |
20520-20525 |
NN |
denotes |
SYCP3 |
| T11175 |
20525-20527 |
, |
denotes |
, |
| T11176 |
20527-20528 |
DT |
denotes |
a |
| T11177 |
20529-20538 |
NN |
denotes |
component |
| T11178 |
20539-20541 |
IN |
denotes |
of |
| T11179 |
20542-20545 |
DT |
denotes |
the |
| T11181 |
20546-20558 |
JJ |
denotes |
synaptonemal |
| T11180 |
20559-20566 |
NN |
denotes |
complex |
| T11182 |
20567-20568 |
-LRB- |
denotes |
( |
| T11183 |
20568-20574 |
NN |
denotes |
Figure |
| T11184 |
20575-20576 |
CD |
denotes |
4 |
| T11185 |
20576-20577 |
-RRB- |
denotes |
) |
| T11186 |
20577-20578 |
. |
denotes |
. |
| T11187 |
20578-20705 |
sentence |
denotes |
We found that Dmrt7 mutants accumulate pachytene cells but have greatly reduced numbers of cells in late-pachynema and beyond. |
| T11188 |
20579-20581 |
PRP |
denotes |
We |
| T11189 |
20582-20587 |
VBD |
denotes |
found |
| T11190 |
20588-20592 |
IN |
denotes |
that |
| T11192 |
20593-20598 |
NN |
denotes |
Dmrt7 |
| T11193 |
20599-20606 |
NNS |
denotes |
mutants |
| T11191 |
20607-20617 |
VBP |
denotes |
accumulate |
| T11194 |
20618-20627 |
NN |
denotes |
pachytene |
| T11195 |
20628-20633 |
NNS |
denotes |
cells |
| T11196 |
20634-20637 |
CC |
denotes |
but |
| T11197 |
20638-20642 |
VBP |
denotes |
have |
| T11198 |
20643-20650 |
RB |
denotes |
greatly |
| T11199 |
20651-20658 |
VBN |
denotes |
reduced |
| T11200 |
20659-20666 |
NNS |
denotes |
numbers |
| T11201 |
20667-20669 |
IN |
denotes |
of |
| T11202 |
20670-20675 |
NNS |
denotes |
cells |
| T11203 |
20676-20678 |
IN |
denotes |
in |
| T11204 |
20679-20683 |
JJ |
denotes |
late |
| T11206 |
20683-20684 |
HYPH |
denotes |
- |
| T11205 |
20684-20693 |
NN |
denotes |
pachynema |
| T11207 |
20694-20697 |
CC |
denotes |
and |
| T11208 |
20698-20704 |
RB |
denotes |
beyond |
| T11209 |
20704-20705 |
. |
denotes |
. |
| T11210 |
20705-20868 |
sentence |
denotes |
Together, these results confirm that the meiotic arrest in Dmrt7 mutants occurs primarily during pachynema and results in efficient elimination of arrested cells. |
| T11211 |
20706-20714 |
RB |
denotes |
Together |
| T11213 |
20714-20716 |
, |
denotes |
, |
| T11214 |
20716-20721 |
DT |
denotes |
these |
| T11215 |
20722-20729 |
NNS |
denotes |
results |
| T11212 |
20730-20737 |
VBP |
denotes |
confirm |
| T11216 |
20738-20742 |
IN |
denotes |
that |
| T11218 |
20743-20746 |
DT |
denotes |
the |
| T11220 |
20747-20754 |
JJ |
denotes |
meiotic |
| T11219 |
20755-20761 |
NN |
denotes |
arrest |
| T11221 |
20762-20764 |
IN |
denotes |
in |
| T11222 |
20765-20770 |
NN |
denotes |
Dmrt7 |
| T11223 |
20771-20778 |
NNS |
denotes |
mutants |
| T11217 |
20779-20785 |
VBZ |
denotes |
occurs |
| T11224 |
20786-20795 |
RB |
denotes |
primarily |
| T11225 |
20796-20802 |
IN |
denotes |
during |
| T11226 |
20803-20812 |
NN |
denotes |
pachynema |
| T11227 |
20813-20816 |
CC |
denotes |
and |
| T11228 |
20817-20824 |
VBZ |
denotes |
results |
| T11229 |
20825-20827 |
IN |
denotes |
in |
| T11230 |
20828-20837 |
JJ |
denotes |
efficient |
| T11231 |
20838-20849 |
NN |
denotes |
elimination |
| T11232 |
20850-20852 |
IN |
denotes |
of |
| T11233 |
20853-20861 |
VBN |
denotes |
arrested |
| T11234 |
20862-20867 |
NNS |
denotes |
cells |
| T11235 |
20867-20868 |
. |
denotes |
. |
| T28985 |
20879-20887 |
NN |
denotes |
Prophase |
| T28987 |
20888-20889 |
CD |
denotes |
I |
| T28986 |
20890-20896 |
NN |
denotes |
Arrest |
| T28988 |
20897-20899 |
IN |
denotes |
of |
| T28989 |
20900-20905 |
NN |
denotes |
Dmrt7 |
| T28990 |
20906-20912 |
NN |
denotes |
Mutant |
| T28992 |
20913-20917 |
NN |
denotes |
Germ |
| T28991 |
20918-20923 |
NNS |
denotes |
Cells |
| T28993 |
20923-21076 |
sentence |
denotes |
Testis sections from 6-wk-old wild-type (+/+) and Dmrt7 mutant (−/−) littermates stained with stage-specific antibodies specific to spermatogenic cells. |
| T28994 |
20924-20930 |
NN |
denotes |
Testis |
| T28995 |
20931-20939 |
NNS |
denotes |
sections |
| T28996 |
20940-20944 |
IN |
denotes |
from |
| T28997 |
20945-20946 |
CD |
denotes |
6 |
| T28999 |
20946-20947 |
HYPH |
denotes |
- |
| T28998 |
20947-20949 |
NN |
denotes |
wk |
| T29001 |
20949-20950 |
HYPH |
denotes |
- |
| T29000 |
20950-20953 |
JJ |
denotes |
old |
| T29003 |
20954-20958 |
JJ |
denotes |
wild |
| T29005 |
20958-20959 |
HYPH |
denotes |
- |
| T29004 |
20959-20963 |
NN |
denotes |
type |
| T29006 |
20964-20965 |
-LRB- |
denotes |
( |
| T29008 |
20965-20966 |
SYM |
denotes |
+ |
| T29009 |
20966-20967 |
HYPH |
denotes |
/ |
| T29007 |
20967-20968 |
SYM |
denotes |
+ |
| T29010 |
20968-20969 |
-RRB- |
denotes |
) |
| T29011 |
20970-20973 |
CC |
denotes |
and |
| T29012 |
20974-20979 |
NN |
denotes |
Dmrt7 |
| T29013 |
20980-20986 |
NN |
denotes |
mutant |
| T29014 |
20987-20988 |
-LRB- |
denotes |
( |
| T29016 |
20988-20989 |
SYM |
denotes |
− |
| T29017 |
20989-20990 |
HYPH |
denotes |
/ |
| T29015 |
20990-20991 |
SYM |
denotes |
− |
| T29018 |
20991-20992 |
-RRB- |
denotes |
) |
| T29002 |
20993-21004 |
NNS |
denotes |
littermates |
| T29019 |
21005-21012 |
VBN |
denotes |
stained |
| T29020 |
21013-21017 |
IN |
denotes |
with |
| T29021 |
21018-21023 |
NN |
denotes |
stage |
| T29023 |
21023-21024 |
HYPH |
denotes |
- |
| T29022 |
21024-21032 |
JJ |
denotes |
specific |
| T29024 |
21033-21043 |
NNS |
denotes |
antibodies |
| T29025 |
21044-21052 |
JJ |
denotes |
specific |
| T29026 |
21053-21055 |
IN |
denotes |
to |
| T29027 |
21056-21069 |
JJ |
denotes |
spermatogenic |
| T29028 |
21070-21075 |
NNS |
denotes |
cells |
| T29029 |
21075-21076 |
. |
denotes |
. |
| T29030 |
21076-21169 |
sentence |
denotes |
(A) TRA98 antibody strongly stains spermatogonia, which are present in wild-type and mutant. |
| T29031 |
21077-21078 |
-LRB- |
denotes |
( |
| T29032 |
21078-21079 |
LS |
denotes |
A |
| T29034 |
21079-21080 |
-RRB- |
denotes |
) |
| T29035 |
21081-21086 |
NN |
denotes |
TRA98 |
| T29036 |
21087-21095 |
NN |
denotes |
antibody |
| T29037 |
21096-21104 |
RB |
denotes |
strongly |
| T29033 |
21105-21111 |
VBZ |
denotes |
stains |
| T29038 |
21112-21125 |
NNS |
denotes |
spermatogonia |
| T29039 |
21125-21127 |
, |
denotes |
, |
| T29040 |
21127-21132 |
WDT |
denotes |
which |
| T29041 |
21133-21136 |
VBP |
denotes |
are |
| T29042 |
21137-21144 |
JJ |
denotes |
present |
| T29043 |
21145-21147 |
IN |
denotes |
in |
| T29044 |
21148-21152 |
JJ |
denotes |
wild |
| T29046 |
21152-21153 |
HYPH |
denotes |
- |
| T29045 |
21153-21157 |
NN |
denotes |
type |
| T29047 |
21158-21161 |
CC |
denotes |
and |
| T29048 |
21162-21168 |
NN |
denotes |
mutant |
| T29049 |
21168-21169 |
. |
denotes |
. |
| T29050 |
21169-21251 |
sentence |
denotes |
(B) BC7 antibody stains spermatocytes, which are present in wild-type and mutant. |
| T29051 |
21170-21171 |
-LRB- |
denotes |
( |
| T29052 |
21171-21172 |
LS |
denotes |
B |
| T29054 |
21172-21173 |
-RRB- |
denotes |
) |
| T29055 |
21174-21177 |
NN |
denotes |
BC7 |
| T29056 |
21178-21186 |
NN |
denotes |
antibody |
| T29053 |
21187-21193 |
VBZ |
denotes |
stains |
| T29057 |
21194-21207 |
NNS |
denotes |
spermatocytes |
| T29058 |
21207-21209 |
, |
denotes |
, |
| T29059 |
21209-21214 |
WDT |
denotes |
which |
| T29060 |
21215-21218 |
VBP |
denotes |
are |
| T29061 |
21219-21226 |
JJ |
denotes |
present |
| T29062 |
21227-21229 |
IN |
denotes |
in |
| T29063 |
21230-21234 |
JJ |
denotes |
wild |
| T29065 |
21234-21235 |
HYPH |
denotes |
- |
| T29064 |
21235-21239 |
NN |
denotes |
type |
| T29066 |
21240-21243 |
CC |
denotes |
and |
| T29067 |
21244-21250 |
NN |
denotes |
mutant |
| T29068 |
21250-21251 |
. |
denotes |
. |
| T29069 |
21251-21361 |
sentence |
denotes |
(C) TRA369 antibody stains pachytene and later germ cells, which are severely deficient in the mutant testis. |
| T29070 |
21252-21253 |
-LRB- |
denotes |
( |
| T29071 |
21253-21254 |
LS |
denotes |
C |
| T29073 |
21254-21255 |
-RRB- |
denotes |
) |
| T29074 |
21256-21262 |
NN |
denotes |
TRA369 |
| T29075 |
21263-21271 |
NN |
denotes |
antibody |
| T29072 |
21272-21278 |
VBZ |
denotes |
stains |
| T29076 |
21279-21288 |
NN |
denotes |
pachytene |
| T29078 |
21289-21292 |
CC |
denotes |
and |
| T29079 |
21293-21298 |
JJ |
denotes |
later |
| T29080 |
21299-21303 |
NN |
denotes |
germ |
| T29077 |
21304-21309 |
NNS |
denotes |
cells |
| T29081 |
21309-21311 |
, |
denotes |
, |
| T29082 |
21311-21316 |
WDT |
denotes |
which |
| T29083 |
21317-21320 |
VBP |
denotes |
are |
| T29084 |
21321-21329 |
RB |
denotes |
severely |
| T29085 |
21330-21339 |
JJ |
denotes |
deficient |
| T29086 |
21340-21342 |
IN |
denotes |
in |
| T29087 |
21343-21346 |
DT |
denotes |
the |
| T29089 |
21347-21353 |
NN |
denotes |
mutant |
| T29088 |
21354-21360 |
NN |
denotes |
testis |
| T29090 |
21360-21361 |
. |
denotes |
. |
| T29240 |
21372-21379 |
NN |
denotes |
Profile |
| T29241 |
21380-21382 |
IN |
denotes |
of |
| T29242 |
21383-21390 |
JJ |
denotes |
Meiotic |
| T29243 |
21391-21397 |
NN |
denotes |
Arrest |
| T29244 |
21398-21400 |
IN |
denotes |
in |
| T29245 |
21401-21406 |
NN |
denotes |
Dmrt7 |
| T29246 |
21407-21413 |
NN |
denotes |
Mutant |
| T29247 |
21414-21420 |
NN |
denotes |
Testis |
| T29248 |
21420-21681 |
sentence |
denotes |
Graph of distribution of meiotic stages of germ cells from heterozygous (n = 1,970) and homozygous mutant (n = 2,084) P26 testes, spread and stained for the synaptonemal complex protein SYCP3 to permit precise staging, which was performed as described [64,65]. |
| T29249 |
21421-21426 |
NN |
denotes |
Graph |
| T29250 |
21427-21429 |
IN |
denotes |
of |
| T29251 |
21430-21442 |
NN |
denotes |
distribution |
| T29252 |
21443-21445 |
IN |
denotes |
of |
| T29253 |
21446-21453 |
JJ |
denotes |
meiotic |
| T29254 |
21454-21460 |
NNS |
denotes |
stages |
| T29255 |
21461-21463 |
IN |
denotes |
of |
| T29256 |
21464-21468 |
NN |
denotes |
germ |
| T29257 |
21469-21474 |
NNS |
denotes |
cells |
| T29258 |
21475-21479 |
IN |
denotes |
from |
| T29259 |
21480-21492 |
JJ |
denotes |
heterozygous |
| T29261 |
21493-21494 |
-LRB- |
denotes |
( |
| T29263 |
21494-21495 |
NN |
denotes |
n |
| T29264 |
21496-21497 |
SYM |
denotes |
= |
| T29262 |
21498-21503 |
CD |
denotes |
1,970 |
| T29265 |
21503-21504 |
-RRB- |
denotes |
) |
| T29266 |
21505-21508 |
CC |
denotes |
and |
| T29267 |
21509-21519 |
JJ |
denotes |
homozygous |
| T29260 |
21520-21526 |
NN |
denotes |
mutant |
| T29269 |
21527-21528 |
-LRB- |
denotes |
( |
| T29271 |
21528-21529 |
NN |
denotes |
n |
| T29272 |
21530-21531 |
SYM |
denotes |
= |
| T29270 |
21532-21537 |
CD |
denotes |
2,084 |
| T29273 |
21537-21538 |
-RRB- |
denotes |
) |
| T29274 |
21539-21542 |
NN |
denotes |
P26 |
| T29268 |
21543-21549 |
NNS |
denotes |
testes |
| T29275 |
21549-21551 |
, |
denotes |
, |
| T29276 |
21551-21557 |
VBN |
denotes |
spread |
| T29277 |
21558-21561 |
CC |
denotes |
and |
| T29278 |
21562-21569 |
VBN |
denotes |
stained |
| T29279 |
21570-21573 |
IN |
denotes |
for |
| T29280 |
21574-21577 |
DT |
denotes |
the |
| T29282 |
21578-21590 |
JJ |
denotes |
synaptonemal |
| T29283 |
21591-21598 |
NN |
denotes |
complex |
| T29284 |
21599-21606 |
NN |
denotes |
protein |
| T29281 |
21607-21612 |
NN |
denotes |
SYCP3 |
| T29285 |
21613-21615 |
TO |
denotes |
to |
| T29286 |
21616-21622 |
VB |
denotes |
permit |
| T29287 |
21623-21630 |
JJ |
denotes |
precise |
| T29288 |
21631-21638 |
NN |
denotes |
staging |
| T29289 |
21638-21640 |
, |
denotes |
, |
| T29290 |
21640-21645 |
WDT |
denotes |
which |
| T29292 |
21646-21649 |
VBD |
denotes |
was |
| T29291 |
21650-21659 |
VBN |
denotes |
performed |
| T29293 |
21660-21662 |
IN |
denotes |
as |
| T29294 |
21663-21672 |
VBN |
denotes |
described |
| T29295 |
21673-21674 |
-LRB- |
denotes |
[ |
| T29297 |
21674-21676 |
CD |
denotes |
64 |
| T29298 |
21676-21677 |
, |
denotes |
, |
| T29296 |
21677-21679 |
CD |
denotes |
65 |
| T29299 |
21679-21680 |
-RRB- |
denotes |
] |
| T29300 |
21680-21681 |
. |
denotes |
. |
| T11774 |
21683-21689 |
JJ |
denotes |
Normal |
| T11776 |
21690-21697 |
JJ |
denotes |
Meiotic |
| T11775 |
21698-21706 |
NN |
denotes |
Prophase |
| T11777 |
21707-21709 |
IN |
denotes |
in |
| T11778 |
21710-21715 |
NN |
denotes |
Dmrt7 |
| T11779 |
21716-21722 |
NN |
denotes |
Mutant |
| T11781 |
21723-21727 |
NN |
denotes |
Germ |
| T11780 |
21728-21733 |
NNS |
denotes |
Cells |
| T11782 |
21733-21840 |
sentence |
denotes |
Defects in chromosome pairing, synapsis, or recombination can trigger pachytene arrest and apoptosis [46]. |
| T11783 |
21734-21741 |
NNS |
denotes |
Defects |
| T11785 |
21742-21744 |
IN |
denotes |
in |
| T11786 |
21745-21755 |
NN |
denotes |
chromosome |
| T11787 |
21756-21763 |
NN |
denotes |
pairing |
| T11788 |
21763-21765 |
, |
denotes |
, |
| T11789 |
21765-21773 |
NN |
denotes |
synapsis |
| T11790 |
21773-21775 |
, |
denotes |
, |
| T11791 |
21775-21777 |
CC |
denotes |
or |
| T11792 |
21778-21791 |
NN |
denotes |
recombination |
| T11793 |
21792-21795 |
MD |
denotes |
can |
| T11784 |
21796-21803 |
VB |
denotes |
trigger |
| T11794 |
21804-21813 |
NN |
denotes |
pachytene |
| T11795 |
21814-21820 |
NN |
denotes |
arrest |
| T11796 |
21821-21824 |
CC |
denotes |
and |
| T11797 |
21825-21834 |
NN |
denotes |
apoptosis |
| T11798 |
21835-21836 |
-LRB- |
denotes |
[ |
| T11799 |
21836-21838 |
CD |
denotes |
46 |
| T11800 |
21838-21839 |
-RRB- |
denotes |
] |
| T11801 |
21839-21840 |
. |
denotes |
. |
| T11802 |
21840-21899 |
sentence |
denotes |
We therefore examined these events in Dmrt7 mutant testes. |
| T11803 |
21841-21843 |
PRP |
denotes |
We |
| T11805 |
21844-21853 |
RB |
denotes |
therefore |
| T11804 |
21854-21862 |
VBD |
denotes |
examined |
| T11806 |
21863-21868 |
DT |
denotes |
these |
| T11807 |
21869-21875 |
NNS |
denotes |
events |
| T11808 |
21876-21878 |
IN |
denotes |
in |
| T11809 |
21879-21884 |
NN |
denotes |
Dmrt7 |
| T11810 |
21885-21891 |
NN |
denotes |
mutant |
| T11811 |
21892-21898 |
NNS |
denotes |
testes |
| T11812 |
21898-21899 |
. |
denotes |
. |
| T11813 |
21899-22117 |
sentence |
denotes |
To assess homolog synapsis, we used antibodies to SYCP1, a synaptonemal complex transverse element component, and SYCP3, a component of the axial element, which remains on the desynapsed axes during diplonema [47,48]. |
| T11814 |
21900-21902 |
TO |
denotes |
To |
| T11815 |
21903-21909 |
VB |
denotes |
assess |
| T11817 |
21910-21917 |
NN |
denotes |
homolog |
| T11818 |
21918-21926 |
NN |
denotes |
synapsis |
| T11819 |
21926-21928 |
, |
denotes |
, |
| T11820 |
21928-21930 |
PRP |
denotes |
we |
| T11816 |
21931-21935 |
VBD |
denotes |
used |
| T11821 |
21936-21946 |
NNS |
denotes |
antibodies |
| T11822 |
21947-21949 |
IN |
denotes |
to |
| T11823 |
21950-21955 |
NN |
denotes |
SYCP1 |
| T11824 |
21955-21957 |
, |
denotes |
, |
| T11825 |
21957-21958 |
DT |
denotes |
a |
| T11827 |
21959-21971 |
JJ |
denotes |
synaptonemal |
| T11828 |
21972-21979 |
NN |
denotes |
complex |
| T11829 |
21980-21990 |
NN |
denotes |
transverse |
| T11830 |
21991-21998 |
NN |
denotes |
element |
| T11826 |
21999-22008 |
NN |
denotes |
component |
| T11831 |
22008-22010 |
, |
denotes |
, |
| T11832 |
22010-22013 |
CC |
denotes |
and |
| T11833 |
22014-22019 |
NN |
denotes |
SYCP3 |
| T11834 |
22019-22021 |
, |
denotes |
, |
| T11835 |
22021-22022 |
DT |
denotes |
a |
| T11836 |
22023-22032 |
NN |
denotes |
component |
| T11837 |
22033-22035 |
IN |
denotes |
of |
| T11838 |
22036-22039 |
DT |
denotes |
the |
| T11840 |
22040-22045 |
JJ |
denotes |
axial |
| T11839 |
22046-22053 |
NN |
denotes |
element |
| T11841 |
22053-22055 |
, |
denotes |
, |
| T11842 |
22055-22060 |
WDT |
denotes |
which |
| T11843 |
22061-22068 |
VBZ |
denotes |
remains |
| T11844 |
22069-22071 |
IN |
denotes |
on |
| T11845 |
22072-22075 |
DT |
denotes |
the |
| T11847 |
22076-22086 |
VBN |
denotes |
desynapsed |
| T11846 |
22087-22091 |
NNS |
denotes |
axes |
| T11848 |
22092-22098 |
IN |
denotes |
during |
| T11849 |
22099-22108 |
NN |
denotes |
diplonema |
| T11850 |
22109-22110 |
-LRB- |
denotes |
[ |
| T11852 |
22110-22112 |
CD |
denotes |
47 |
| T11853 |
22112-22113 |
, |
denotes |
, |
| T11851 |
22113-22115 |
CD |
denotes |
48 |
| T11854 |
22115-22116 |
-RRB- |
denotes |
] |
| T11855 |
22116-22117 |
. |
denotes |
. |
| T11856 |
22117-22304 |
sentence |
denotes |
Formation of synaptonemal complexes in the mutant was indistinguishable from that in wild-type, as indicated by the proper accumulation of SYCP1 (unpublished data) and SYCP3 (Figure 5A). |
| T11857 |
22118-22127 |
NN |
denotes |
Formation |
| T11859 |
22128-22130 |
IN |
denotes |
of |
| T11860 |
22131-22143 |
JJ |
denotes |
synaptonemal |
| T11861 |
22144-22153 |
NNS |
denotes |
complexes |
| T11862 |
22154-22156 |
IN |
denotes |
in |
| T11863 |
22157-22160 |
DT |
denotes |
the |
| T11864 |
22161-22167 |
NN |
denotes |
mutant |
| T11858 |
22168-22171 |
VBD |
denotes |
was |
| T11865 |
22172-22189 |
JJ |
denotes |
indistinguishable |
| T11866 |
22190-22194 |
IN |
denotes |
from |
| T11867 |
22195-22199 |
DT |
denotes |
that |
| T11868 |
22200-22202 |
IN |
denotes |
in |
| T11869 |
22203-22207 |
JJ |
denotes |
wild |
| T11871 |
22207-22208 |
HYPH |
denotes |
- |
| T11870 |
22208-22212 |
NN |
denotes |
type |
| T11872 |
22212-22214 |
, |
denotes |
, |
| T11873 |
22214-22216 |
IN |
denotes |
as |
| T11874 |
22217-22226 |
VBN |
denotes |
indicated |
| T11875 |
22227-22229 |
IN |
denotes |
by |
| T11876 |
22230-22233 |
DT |
denotes |
the |
| T11878 |
22234-22240 |
JJ |
denotes |
proper |
| T11877 |
22241-22253 |
NN |
denotes |
accumulation |
| T11879 |
22254-22256 |
IN |
denotes |
of |
| T11880 |
22257-22262 |
NN |
denotes |
SYCP1 |
| T11881 |
22263-22264 |
-LRB- |
denotes |
( |
| T11883 |
22264-22275 |
JJ |
denotes |
unpublished |
| T11882 |
22276-22280 |
NNS |
denotes |
data |
| T11884 |
22280-22281 |
-RRB- |
denotes |
) |
| T11885 |
22282-22285 |
CC |
denotes |
and |
| T11886 |
22286-22291 |
NN |
denotes |
SYCP3 |
| T11887 |
22292-22293 |
-LRB- |
denotes |
( |
| T11889 |
22293-22299 |
NN |
denotes |
Figure |
| T11888 |
22300-22302 |
NN |
denotes |
5A |
| T11890 |
22302-22303 |
-RRB- |
denotes |
) |
| T11891 |
22303-22304 |
. |
denotes |
. |
| T11892 |
22304-22516 |
sentence |
denotes |
Likewise, the Dmrt7 mutant zygotene spermatocytes showed normal accumulation of the early recombination repair marker RAD51, suggesting that early meiotic recombination is not significantly affected (Figure 5B). |
| T11893 |
22305-22313 |
RB |
denotes |
Likewise |
| T11895 |
22313-22315 |
, |
denotes |
, |
| T11896 |
22315-22318 |
DT |
denotes |
the |
| T11898 |
22319-22324 |
NN |
denotes |
Dmrt7 |
| T11899 |
22325-22331 |
NN |
denotes |
mutant |
| T11900 |
22332-22340 |
NN |
denotes |
zygotene |
| T11897 |
22341-22354 |
NNS |
denotes |
spermatocytes |
| T11894 |
22355-22361 |
VBD |
denotes |
showed |
| T11901 |
22362-22368 |
JJ |
denotes |
normal |
| T11902 |
22369-22381 |
NN |
denotes |
accumulation |
| T11903 |
22382-22384 |
IN |
denotes |
of |
| T11904 |
22385-22388 |
DT |
denotes |
the |
| T11906 |
22389-22394 |
JJ |
denotes |
early |
| T11907 |
22395-22408 |
NN |
denotes |
recombination |
| T11908 |
22409-22415 |
NN |
denotes |
repair |
| T11909 |
22416-22422 |
NN |
denotes |
marker |
| T11905 |
22423-22428 |
NN |
denotes |
RAD51 |
| T11910 |
22428-22430 |
, |
denotes |
, |
| T11911 |
22430-22440 |
VBG |
denotes |
suggesting |
| T11912 |
22441-22445 |
IN |
denotes |
that |
| T11914 |
22446-22451 |
JJ |
denotes |
early |
| T11916 |
22452-22459 |
JJ |
denotes |
meiotic |
| T11915 |
22460-22473 |
NN |
denotes |
recombination |
| T11917 |
22474-22476 |
VBZ |
denotes |
is |
| T11918 |
22477-22480 |
RB |
denotes |
not |
| T11919 |
22481-22494 |
RB |
denotes |
significantly |
| T11913 |
22495-22503 |
VBN |
denotes |
affected |
| T11920 |
22504-22505 |
-LRB- |
denotes |
( |
| T11922 |
22505-22511 |
NN |
denotes |
Figure |
| T11921 |
22512-22514 |
NN |
denotes |
5B |
| T11923 |
22514-22515 |
-RRB- |
denotes |
) |
| T11924 |
22515-22516 |
. |
denotes |
. |
| T11925 |
22516-22693 |
sentence |
denotes |
Dmrt7 mutant spermatocytes exhibited the expected decline in the presence of RAD51 foci associated with the autosomal synaptonemal complexes (Figure 5B; unpublished data) [49]. |
| T11926 |
22517-22522 |
NN |
denotes |
Dmrt7 |
| T11927 |
22523-22529 |
NN |
denotes |
mutant |
| T11928 |
22530-22543 |
NNS |
denotes |
spermatocytes |
| T11929 |
22544-22553 |
VBD |
denotes |
exhibited |
| T11930 |
22554-22557 |
DT |
denotes |
the |
| T11932 |
22558-22566 |
VBN |
denotes |
expected |
| T11931 |
22567-22574 |
NN |
denotes |
decline |
| T11933 |
22575-22577 |
IN |
denotes |
in |
| T11934 |
22578-22581 |
DT |
denotes |
the |
| T11935 |
22582-22590 |
NN |
denotes |
presence |
| T11936 |
22591-22593 |
IN |
denotes |
of |
| T11937 |
22594-22599 |
NN |
denotes |
RAD51 |
| T11938 |
22600-22604 |
NNS |
denotes |
foci |
| T11939 |
22605-22615 |
VBN |
denotes |
associated |
| T11940 |
22616-22620 |
IN |
denotes |
with |
| T11941 |
22621-22624 |
DT |
denotes |
the |
| T11943 |
22625-22634 |
JJ |
denotes |
autosomal |
| T11944 |
22635-22647 |
JJ |
denotes |
synaptonemal |
| T11942 |
22648-22657 |
NNS |
denotes |
complexes |
| T11945 |
22658-22659 |
-LRB- |
denotes |
( |
| T11947 |
22659-22665 |
NN |
denotes |
Figure |
| T11948 |
22666-22668 |
NN |
denotes |
5B |
| T11949 |
22668-22669 |
: |
denotes |
; |
| T11950 |
22670-22681 |
JJ |
denotes |
unpublished |
| T11946 |
22682-22686 |
NNS |
denotes |
data |
| T11951 |
22686-22687 |
-RRB- |
denotes |
) |
| T11952 |
22688-22689 |
-LRB- |
denotes |
[ |
| T11953 |
22689-22691 |
CD |
denotes |
49 |
| T11954 |
22691-22692 |
-RRB- |
denotes |
] |
| T11955 |
22692-22693 |
. |
denotes |
. |
| T11956 |
22693-22824 |
sentence |
denotes |
The few surviving cells that progressed beyond pachynema also underwent apparently normal desynapsis during diplonema (Figure 5A). |
| T11957 |
22694-22697 |
DT |
denotes |
The |
| T11959 |
22698-22701 |
JJ |
denotes |
few |
| T11960 |
22702-22711 |
VBG |
denotes |
surviving |
| T11958 |
22712-22717 |
NNS |
denotes |
cells |
| T11962 |
22718-22722 |
WDT |
denotes |
that |
| T11963 |
22723-22733 |
VBD |
denotes |
progressed |
| T11964 |
22734-22740 |
IN |
denotes |
beyond |
| T11965 |
22741-22750 |
NN |
denotes |
pachynema |
| T11966 |
22751-22755 |
RB |
denotes |
also |
| T11961 |
22756-22765 |
VBD |
denotes |
underwent |
| T11967 |
22766-22776 |
RB |
denotes |
apparently |
| T11968 |
22777-22783 |
JJ |
denotes |
normal |
| T11969 |
22784-22794 |
NN |
denotes |
desynapsis |
| T11970 |
22795-22801 |
IN |
denotes |
during |
| T11971 |
22802-22811 |
NN |
denotes |
diplonema |
| T11972 |
22812-22813 |
-LRB- |
denotes |
( |
| T11974 |
22813-22819 |
NN |
denotes |
Figure |
| T11973 |
22820-22822 |
NN |
denotes |
5A |
| T11975 |
22822-22823 |
-RRB- |
denotes |
) |
| T11976 |
22823-22824 |
. |
denotes |
. |
| T11977 |
22824-22982 |
sentence |
denotes |
From these results, we conclude that chromosomal pairing, synapsis, recombination, and desynapsis during prophase I in Dmrt7 mutant males are grossly normal. |
| T11978 |
22825-22829 |
IN |
denotes |
From |
| T11980 |
22830-22835 |
DT |
denotes |
these |
| T11981 |
22836-22843 |
NNS |
denotes |
results |
| T11982 |
22843-22845 |
, |
denotes |
, |
| T11983 |
22845-22847 |
PRP |
denotes |
we |
| T11979 |
22848-22856 |
VBP |
denotes |
conclude |
| T11984 |
22857-22861 |
IN |
denotes |
that |
| T11986 |
22862-22873 |
JJ |
denotes |
chromosomal |
| T11987 |
22874-22881 |
NN |
denotes |
pairing |
| T11988 |
22881-22883 |
, |
denotes |
, |
| T11989 |
22883-22891 |
NN |
denotes |
synapsis |
| T11990 |
22891-22893 |
, |
denotes |
, |
| T11991 |
22893-22906 |
NN |
denotes |
recombination |
| T11992 |
22906-22908 |
, |
denotes |
, |
| T11993 |
22908-22911 |
CC |
denotes |
and |
| T11994 |
22912-22922 |
NN |
denotes |
desynapsis |
| T11995 |
22923-22929 |
IN |
denotes |
during |
| T11996 |
22930-22938 |
NN |
denotes |
prophase |
| T11997 |
22939-22940 |
CD |
denotes |
I |
| T11998 |
22941-22943 |
IN |
denotes |
in |
| T11999 |
22944-22949 |
NN |
denotes |
Dmrt7 |
| T12000 |
22950-22956 |
NN |
denotes |
mutant |
| T12001 |
22957-22962 |
NNS |
denotes |
males |
| T11985 |
22963-22966 |
VBP |
denotes |
are |
| T12002 |
22967-22974 |
RB |
denotes |
grossly |
| T12003 |
22975-22981 |
JJ |
denotes |
normal |
| T12004 |
22981-22982 |
. |
denotes |
. |
| T29623 |
22993-22999 |
JJ |
denotes |
Normal |
| T29624 |
23000-23008 |
NN |
denotes |
Synapsis |
| T29625 |
23009-23012 |
CC |
denotes |
and |
| T29626 |
23013-23026 |
NN |
denotes |
Recombination |
| T29627 |
23027-23029 |
IN |
denotes |
in |
| T29628 |
23030-23035 |
NN |
denotes |
Dmrt7 |
| T29629 |
23036-23042 |
NN |
denotes |
Mutant |
| T29631 |
23043-23047 |
NN |
denotes |
Germ |
| T29630 |
23048-23053 |
NNS |
denotes |
Cells |
| T29632 |
23053-23190 |
sentence |
denotes |
(A) Testicular cells from Dmrt7 heterozygous (+/−) or homozygous (−/−) mutant mice were spread and stained with antibody to SYCP3 (red). |
| T29633 |
23054-23055 |
-LRB- |
denotes |
( |
| T29634 |
23055-23056 |
LS |
denotes |
A |
| T29636 |
23056-23057 |
-RRB- |
denotes |
) |
| T29637 |
23058-23068 |
JJ |
denotes |
Testicular |
| T29638 |
23069-23074 |
NNS |
denotes |
cells |
| T29639 |
23075-23079 |
IN |
denotes |
from |
| T29640 |
23080-23085 |
NN |
denotes |
Dmrt7 |
| T29642 |
23086-23098 |
JJ |
denotes |
heterozygous |
| T29643 |
23099-23100 |
-LRB- |
denotes |
( |
| T29645 |
23100-23101 |
SYM |
denotes |
+ |
| T29646 |
23101-23102 |
HYPH |
denotes |
/ |
| T29644 |
23102-23103 |
SYM |
denotes |
− |
| T29647 |
23103-23104 |
-RRB- |
denotes |
) |
| T29648 |
23105-23107 |
CC |
denotes |
or |
| T29649 |
23108-23118 |
JJ |
denotes |
homozygous |
| T29650 |
23119-23120 |
-LRB- |
denotes |
( |
| T29652 |
23120-23121 |
SYM |
denotes |
− |
| T29653 |
23121-23122 |
HYPH |
denotes |
/ |
| T29651 |
23122-23123 |
SYM |
denotes |
− |
| T29654 |
23123-23124 |
-RRB- |
denotes |
) |
| T29641 |
23125-23131 |
NN |
denotes |
mutant |
| T29655 |
23132-23136 |
NNS |
denotes |
mice |
| T29656 |
23137-23141 |
VBD |
denotes |
were |
| T29635 |
23142-23148 |
VBN |
denotes |
spread |
| T29657 |
23149-23152 |
CC |
denotes |
and |
| T29658 |
23153-23160 |
VBN |
denotes |
stained |
| T29659 |
23161-23165 |
IN |
denotes |
with |
| T29660 |
23166-23174 |
NN |
denotes |
antibody |
| T29661 |
23175-23177 |
IN |
denotes |
to |
| T29662 |
23178-23183 |
NN |
denotes |
SYCP3 |
| T29663 |
23184-23185 |
-LRB- |
denotes |
( |
| T29664 |
23185-23188 |
JJ |
denotes |
red |
| T29665 |
23188-23189 |
-RRB- |
denotes |
) |
| T29666 |
23189-23190 |
. |
denotes |
. |
| T29667 |
23190-23292 |
sentence |
denotes |
The developmental stages of meiotic prophase based on SYCP3 organization are indicated in each panel. |
| T29668 |
23191-23194 |
DT |
denotes |
The |
| T29670 |
23195-23208 |
JJ |
denotes |
developmental |
| T29669 |
23209-23215 |
NNS |
denotes |
stages |
| T29672 |
23216-23218 |
IN |
denotes |
of |
| T29673 |
23219-23226 |
JJ |
denotes |
meiotic |
| T29674 |
23227-23235 |
NN |
denotes |
prophase |
| T29675 |
23236-23241 |
VBN |
denotes |
based |
| T29676 |
23242-23244 |
IN |
denotes |
on |
| T29677 |
23245-23250 |
NN |
denotes |
SYCP3 |
| T29678 |
23251-23263 |
NN |
denotes |
organization |
| T29679 |
23264-23267 |
VBP |
denotes |
are |
| T29671 |
23268-23277 |
VBN |
denotes |
indicated |
| T29680 |
23278-23280 |
IN |
denotes |
in |
| T29681 |
23281-23285 |
DT |
denotes |
each |
| T29682 |
23286-23291 |
NN |
denotes |
panel |
| T29683 |
23291-23292 |
. |
denotes |
. |
| T29684 |
23292-23443 |
sentence |
denotes |
By pachynema, all autosomes are fully synapsed, and the XY bivalent is synapsed only at the pseudoautosomal region in both wild-type and mutant cells. |
| T29685 |
23293-23295 |
IN |
denotes |
By |
| T29687 |
23296-23305 |
NN |
denotes |
pachynema |
| T29688 |
23305-23307 |
, |
denotes |
, |
| T29689 |
23307-23310 |
DT |
denotes |
all |
| T29690 |
23311-23320 |
NNS |
denotes |
autosomes |
| T29691 |
23321-23324 |
VBP |
denotes |
are |
| T29692 |
23325-23330 |
RB |
denotes |
fully |
| T29686 |
23331-23339 |
VBN |
denotes |
synapsed |
| T29693 |
23339-23341 |
, |
denotes |
, |
| T29694 |
23341-23344 |
CC |
denotes |
and |
| T29695 |
23345-23348 |
DT |
denotes |
the |
| T29696 |
23349-23351 |
NN |
denotes |
XY |
| T29698 |
23352-23360 |
JJ |
denotes |
bivalent |
| T29699 |
23361-23363 |
VBZ |
denotes |
is |
| T29697 |
23364-23372 |
VBN |
denotes |
synapsed |
| T29700 |
23373-23377 |
RB |
denotes |
only |
| T29701 |
23378-23380 |
IN |
denotes |
at |
| T29702 |
23381-23384 |
DT |
denotes |
the |
| T29704 |
23385-23400 |
JJ |
denotes |
pseudoautosomal |
| T29703 |
23401-23407 |
NN |
denotes |
region |
| T29705 |
23408-23410 |
IN |
denotes |
in |
| T29706 |
23411-23415 |
CC |
denotes |
both |
| T29708 |
23416-23420 |
JJ |
denotes |
wild |
| T29709 |
23420-23421 |
HYPH |
denotes |
- |
| T29707 |
23421-23425 |
NN |
denotes |
type |
| T29711 |
23426-23429 |
CC |
denotes |
and |
| T29712 |
23430-23436 |
NN |
denotes |
mutant |
| T29710 |
23437-23442 |
NNS |
denotes |
cells |
| T29713 |
23442-23443 |
. |
denotes |
. |
| T29714 |
23443-23559 |
sentence |
denotes |
(B) Testicular cells in zygonema and pachynema spread and stained with antibodies to RAD51 (green) and SYCP3 (red). |
| T29715 |
23444-23445 |
-LRB- |
denotes |
( |
| T29716 |
23445-23446 |
LS |
denotes |
B |
| T29718 |
23446-23447 |
-RRB- |
denotes |
) |
| T29719 |
23448-23458 |
JJ |
denotes |
Testicular |
| T29717 |
23459-23464 |
NNS |
denotes |
cells |
| T29720 |
23465-23467 |
IN |
denotes |
in |
| T29721 |
23468-23476 |
NN |
denotes |
zygonema |
| T29722 |
23477-23480 |
CC |
denotes |
and |
| T29723 |
23481-23490 |
NN |
denotes |
pachynema |
| T29724 |
23491-23497 |
VBN |
denotes |
spread |
| T29725 |
23498-23501 |
CC |
denotes |
and |
| T29726 |
23502-23509 |
VBN |
denotes |
stained |
| T29727 |
23510-23514 |
IN |
denotes |
with |
| T29728 |
23515-23525 |
NNS |
denotes |
antibodies |
| T29729 |
23526-23528 |
IN |
denotes |
to |
| T29730 |
23529-23534 |
NN |
denotes |
RAD51 |
| T29731 |
23535-23536 |
-LRB- |
denotes |
( |
| T29732 |
23536-23541 |
JJ |
denotes |
green |
| T29733 |
23541-23542 |
-RRB- |
denotes |
) |
| T29734 |
23543-23546 |
CC |
denotes |
and |
| T29735 |
23547-23552 |
NN |
denotes |
SYCP3 |
| T29736 |
23553-23554 |
-LRB- |
denotes |
( |
| T29737 |
23554-23557 |
JJ |
denotes |
red |
| T29738 |
23557-23558 |
-RRB- |
denotes |
) |
| T29739 |
23558-23559 |
. |
denotes |
. |
| T29740 |
23559-23651 |
sentence |
denotes |
Size and distribution of RAD51 foci are similar between wild-type and mutant spermatocytes. |
| T29741 |
23560-23564 |
NN |
denotes |
Size |
| T29743 |
23565-23568 |
CC |
denotes |
and |
| T29744 |
23569-23581 |
NN |
denotes |
distribution |
| T29745 |
23582-23584 |
IN |
denotes |
of |
| T29746 |
23585-23590 |
NN |
denotes |
RAD51 |
| T29747 |
23591-23595 |
NNS |
denotes |
foci |
| T29742 |
23596-23599 |
VBP |
denotes |
are |
| T29748 |
23600-23607 |
JJ |
denotes |
similar |
| T29749 |
23608-23615 |
IN |
denotes |
between |
| T29750 |
23616-23620 |
JJ |
denotes |
wild |
| T29752 |
23620-23621 |
HYPH |
denotes |
- |
| T29751 |
23621-23625 |
NN |
denotes |
type |
| T29754 |
23626-23629 |
CC |
denotes |
and |
| T29755 |
23630-23636 |
NN |
denotes |
mutant |
| T29753 |
23637-23650 |
NNS |
denotes |
spermatocytes |
| T29756 |
23650-23651 |
. |
denotes |
. |
| T13075 |
23653-23661 |
JJ |
denotes |
Abnormal |
| T13077 |
23662-23670 |
JJ |
denotes |
Cellular |
| T13076 |
23671-23683 |
NN |
denotes |
Organization |
| T13078 |
23684-23687 |
CC |
denotes |
and |
| T13079 |
23688-23691 |
DT |
denotes |
the |
| T13080 |
23692-23696 |
NN |
denotes |
Role |
| T13081 |
23697-23699 |
IN |
denotes |
of |
| T13082 |
23700-23707 |
NNP |
denotes |
Sertoli |
| T13083 |
23708-23713 |
NNS |
denotes |
Cells |
| T13084 |
23713-23838 |
sentence |
denotes |
Sertoli cells interact with germ cells during spermatogenesis and the interaction is critical for germ cell maturation [50]. |
| T13085 |
23714-23721 |
NNP |
denotes |
Sertoli |
| T13086 |
23722-23727 |
NNS |
denotes |
cells |
| T13087 |
23728-23736 |
VBP |
denotes |
interact |
| T13088 |
23737-23741 |
IN |
denotes |
with |
| T13089 |
23742-23746 |
NN |
denotes |
germ |
| T13090 |
23747-23752 |
NNS |
denotes |
cells |
| T13091 |
23753-23759 |
IN |
denotes |
during |
| T13092 |
23760-23775 |
NN |
denotes |
spermatogenesis |
| T13093 |
23776-23779 |
CC |
denotes |
and |
| T13094 |
23780-23783 |
DT |
denotes |
the |
| T13095 |
23784-23795 |
NN |
denotes |
interaction |
| T13096 |
23796-23798 |
VBZ |
denotes |
is |
| T13097 |
23799-23807 |
JJ |
denotes |
critical |
| T13098 |
23808-23811 |
IN |
denotes |
for |
| T13099 |
23812-23816 |
NN |
denotes |
germ |
| T13100 |
23817-23821 |
NN |
denotes |
cell |
| T13101 |
23822-23832 |
NN |
denotes |
maturation |
| T13102 |
23833-23834 |
-LRB- |
denotes |
[ |
| T13103 |
23834-23836 |
CD |
denotes |
50 |
| T13104 |
23836-23837 |
-RRB- |
denotes |
] |
| T13105 |
23837-23838 |
. |
denotes |
. |
| T13106 |
23838-24064 |
sentence |
denotes |
Although we did not detect DMRT7 expression in Sertoli cells by antibody staining, we nevertheless considered the possibility that Sertoli cell defects might contribute to the male-specific germ line failure of Dmrt7 mutants. |
| T13107 |
23839-23847 |
IN |
denotes |
Although |
| T13109 |
23848-23850 |
PRP |
denotes |
we |
| T13110 |
23851-23854 |
VBD |
denotes |
did |
| T13111 |
23855-23858 |
RB |
denotes |
not |
| T13108 |
23859-23865 |
VB |
denotes |
detect |
| T13113 |
23866-23871 |
NN |
denotes |
DMRT7 |
| T13114 |
23872-23882 |
NN |
denotes |
expression |
| T13115 |
23883-23885 |
IN |
denotes |
in |
| T13116 |
23886-23893 |
NNP |
denotes |
Sertoli |
| T13117 |
23894-23899 |
NNS |
denotes |
cells |
| T13118 |
23900-23902 |
IN |
denotes |
by |
| T13119 |
23903-23911 |
NN |
denotes |
antibody |
| T13120 |
23912-23920 |
NN |
denotes |
staining |
| T13121 |
23920-23922 |
, |
denotes |
, |
| T13122 |
23922-23924 |
PRP |
denotes |
we |
| T13123 |
23925-23937 |
RB |
denotes |
nevertheless |
| T13112 |
23938-23948 |
VBD |
denotes |
considered |
| T13124 |
23949-23952 |
DT |
denotes |
the |
| T13125 |
23953-23964 |
NN |
denotes |
possibility |
| T13126 |
23965-23969 |
IN |
denotes |
that |
| T13128 |
23970-23977 |
NNP |
denotes |
Sertoli |
| T13129 |
23978-23982 |
NN |
denotes |
cell |
| T13130 |
23983-23990 |
NNS |
denotes |
defects |
| T13131 |
23991-23996 |
MD |
denotes |
might |
| T13127 |
23997-24007 |
VB |
denotes |
contribute |
| T13132 |
24008-24010 |
IN |
denotes |
to |
| T13133 |
24011-24014 |
DT |
denotes |
the |
| T13135 |
24015-24019 |
JJ |
denotes |
male |
| T13137 |
24019-24020 |
HYPH |
denotes |
- |
| T13136 |
24020-24028 |
JJ |
denotes |
specific |
| T13138 |
24029-24033 |
NN |
denotes |
germ |
| T13139 |
24034-24038 |
NN |
denotes |
line |
| T13134 |
24039-24046 |
NN |
denotes |
failure |
| T13140 |
24047-24049 |
IN |
denotes |
of |
| T13141 |
24050-24055 |
NN |
denotes |
Dmrt7 |
| T13142 |
24056-24063 |
NNS |
denotes |
mutants |
| T13143 |
24063-24064 |
. |
denotes |
. |
| T13144 |
24064-24256 |
sentence |
denotes |
To characterize Sertoli cell differentiation, we examined expression of the Sertoli cell markers GATA4 (a marker of immature postnatal Sertoli cells) and GATA1 (a mature Sertoli cell marker). |
| T13145 |
24065-24067 |
TO |
denotes |
To |
| T13146 |
24068-24080 |
VB |
denotes |
characterize |
| T13148 |
24081-24088 |
NNP |
denotes |
Sertoli |
| T13149 |
24089-24093 |
NN |
denotes |
cell |
| T13150 |
24094-24109 |
NN |
denotes |
differentiation |
| T13151 |
24109-24111 |
, |
denotes |
, |
| T13152 |
24111-24113 |
PRP |
denotes |
we |
| T13147 |
24114-24122 |
VBD |
denotes |
examined |
| T13153 |
24123-24133 |
NN |
denotes |
expression |
| T13154 |
24134-24136 |
IN |
denotes |
of |
| T13155 |
24137-24140 |
DT |
denotes |
the |
| T13157 |
24141-24148 |
NNP |
denotes |
Sertoli |
| T13158 |
24149-24153 |
NN |
denotes |
cell |
| T13156 |
24154-24161 |
NNS |
denotes |
markers |
| T13159 |
24162-24167 |
NN |
denotes |
GATA4 |
| T13160 |
24168-24169 |
-LRB- |
denotes |
( |
| T13161 |
24169-24170 |
DT |
denotes |
a |
| T13162 |
24171-24177 |
NN |
denotes |
marker |
| T13163 |
24178-24180 |
IN |
denotes |
of |
| T13164 |
24181-24189 |
JJ |
denotes |
immature |
| T13166 |
24190-24199 |
JJ |
denotes |
postnatal |
| T13167 |
24200-24207 |
NNP |
denotes |
Sertoli |
| T13165 |
24208-24213 |
NNS |
denotes |
cells |
| T13168 |
24213-24214 |
-RRB- |
denotes |
) |
| T13169 |
24215-24218 |
CC |
denotes |
and |
| T13170 |
24219-24224 |
NN |
denotes |
GATA1 |
| T13171 |
24225-24226 |
-LRB- |
denotes |
( |
| T13172 |
24226-24227 |
DT |
denotes |
a |
| T13174 |
24228-24234 |
JJ |
denotes |
mature |
| T13175 |
24235-24242 |
NNP |
denotes |
Sertoli |
| T13176 |
24243-24247 |
NN |
denotes |
cell |
| T13173 |
24248-24254 |
NN |
denotes |
marker |
| T13177 |
24254-24255 |
-RRB- |
denotes |
) |
| T13178 |
24255-24256 |
. |
denotes |
. |
| T13179 |
24256-24414 |
sentence |
denotes |
The levels of these proteins appeared normal relative to wild-type at P14 and P42 (Figure 6A–6C), as did the androgen receptor (Figure S3; unpublished data). |
| T13180 |
24257-24260 |
DT |
denotes |
The |
| T13181 |
24261-24267 |
NNS |
denotes |
levels |
| T13183 |
24268-24270 |
IN |
denotes |
of |
| T13184 |
24271-24276 |
DT |
denotes |
these |
| T13185 |
24277-24285 |
NN |
denotes |
proteins |
| T13182 |
24286-24294 |
VBD |
denotes |
appeared |
| T13186 |
24295-24301 |
JJ |
denotes |
normal |
| T13187 |
24302-24310 |
JJ |
denotes |
relative |
| T13188 |
24311-24313 |
IN |
denotes |
to |
| T13189 |
24314-24318 |
JJ |
denotes |
wild |
| T13191 |
24318-24319 |
HYPH |
denotes |
- |
| T13190 |
24319-24323 |
NN |
denotes |
type |
| T13192 |
24324-24326 |
IN |
denotes |
at |
| T13193 |
24327-24330 |
NN |
denotes |
P14 |
| T13194 |
24331-24334 |
CC |
denotes |
and |
| T13195 |
24335-24338 |
NN |
denotes |
P42 |
| T13196 |
24339-24340 |
-LRB- |
denotes |
( |
| T13198 |
24340-24346 |
NN |
denotes |
Figure |
| T13197 |
24347-24349 |
NN |
denotes |
6A |
| T13199 |
24349-24350 |
SYM |
denotes |
– |
| T13200 |
24350-24352 |
NN |
denotes |
6C |
| T13201 |
24352-24353 |
-RRB- |
denotes |
) |
| T13202 |
24353-24355 |
, |
denotes |
, |
| T13203 |
24355-24357 |
IN |
denotes |
as |
| T13204 |
24358-24361 |
VBD |
denotes |
did |
| T13205 |
24362-24365 |
DT |
denotes |
the |
| T13207 |
24366-24374 |
NN |
denotes |
androgen |
| T13206 |
24375-24383 |
NN |
denotes |
receptor |
| T13208 |
24384-24385 |
-LRB- |
denotes |
( |
| T13210 |
24385-24391 |
NN |
denotes |
Figure |
| T13211 |
24392-24394 |
NN |
denotes |
S3 |
| T13212 |
24394-24395 |
: |
denotes |
; |
| T13213 |
24396-24407 |
JJ |
denotes |
unpublished |
| T13209 |
24408-24412 |
NNS |
denotes |
data |
| T13214 |
24412-24413 |
-RRB- |
denotes |
) |
| T13215 |
24413-24414 |
. |
denotes |
. |
| T13216 |
24414-24634 |
sentence |
denotes |
However, the organization of Sertoli cells in Dmrt7 mutant testes was abnormal: in some tubules GATA1-positive Sertoli cell nuclei were displaced from their usual close apposition with the basement membrane (Figure 6C). |
| T13217 |
24415-24422 |
RB |
denotes |
However |
| T13219 |
24422-24424 |
, |
denotes |
, |
| T13220 |
24424-24427 |
DT |
denotes |
the |
| T13221 |
24428-24440 |
NN |
denotes |
organization |
| T13222 |
24441-24443 |
IN |
denotes |
of |
| T13223 |
24444-24451 |
NNP |
denotes |
Sertoli |
| T13224 |
24452-24457 |
NNS |
denotes |
cells |
| T13225 |
24458-24460 |
IN |
denotes |
in |
| T13226 |
24461-24466 |
NN |
denotes |
Dmrt7 |
| T13228 |
24467-24473 |
NN |
denotes |
mutant |
| T13227 |
24474-24480 |
NNS |
denotes |
testes |
| T13218 |
24481-24484 |
VBD |
denotes |
was |
| T13230 |
24485-24493 |
JJ |
denotes |
abnormal |
| T13231 |
24493-24495 |
: |
denotes |
: |
| T13232 |
24495-24497 |
IN |
denotes |
in |
| T13233 |
24498-24502 |
DT |
denotes |
some |
| T13234 |
24503-24510 |
NNS |
denotes |
tubules |
| T13235 |
24511-24516 |
NN |
denotes |
GATA1 |
| T13237 |
24516-24517 |
HYPH |
denotes |
- |
| T13236 |
24517-24525 |
JJ |
denotes |
positive |
| T13239 |
24526-24533 |
NNP |
denotes |
Sertoli |
| T13240 |
24534-24538 |
NN |
denotes |
cell |
| T13238 |
24539-24545 |
NNS |
denotes |
nuclei |
| T13241 |
24546-24550 |
VBD |
denotes |
were |
| T13229 |
24551-24560 |
VBN |
denotes |
displaced |
| T13242 |
24561-24565 |
IN |
denotes |
from |
| T13243 |
24566-24571 |
PRP$ |
denotes |
their |
| T13245 |
24572-24577 |
JJ |
denotes |
usual |
| T13246 |
24578-24583 |
JJ |
denotes |
close |
| T13244 |
24584-24594 |
NN |
denotes |
apposition |
| T13247 |
24595-24599 |
IN |
denotes |
with |
| T13248 |
24600-24603 |
DT |
denotes |
the |
| T13250 |
24604-24612 |
NN |
denotes |
basement |
| T13249 |
24613-24621 |
NN |
denotes |
membrane |
| T13251 |
24622-24623 |
-LRB- |
denotes |
( |
| T13253 |
24623-24629 |
NN |
denotes |
Figure |
| T13252 |
24630-24632 |
NN |
denotes |
6C |
| T13254 |
24632-24633 |
-RRB- |
denotes |
) |
| T13255 |
24633-24634 |
. |
denotes |
. |
| T13256 |
24634-24797 |
sentence |
denotes |
In such tubules, nuclei of pre-meiotic germ cells and spermatocytes were packed close to the basal membrane and few germ cells were found in the adlumenal region. |
| T13257 |
24635-24637 |
IN |
denotes |
In |
| T13259 |
24638-24642 |
JJ |
denotes |
such |
| T13260 |
24643-24650 |
NNS |
denotes |
tubules |
| T13261 |
24650-24652 |
, |
denotes |
, |
| T13262 |
24652-24658 |
NNS |
denotes |
nuclei |
| T13263 |
24659-24661 |
IN |
denotes |
of |
| T13264 |
24662-24673 |
JJ |
denotes |
pre-meiotic |
| T13266 |
24674-24678 |
NN |
denotes |
germ |
| T13265 |
24679-24684 |
NNS |
denotes |
cells |
| T13267 |
24685-24688 |
CC |
denotes |
and |
| T13268 |
24689-24702 |
NNS |
denotes |
spermatocytes |
| T13269 |
24703-24707 |
VBD |
denotes |
were |
| T13258 |
24708-24714 |
VBN |
denotes |
packed |
| T13270 |
24715-24720 |
RB |
denotes |
close |
| T13271 |
24721-24723 |
IN |
denotes |
to |
| T13272 |
24724-24727 |
DT |
denotes |
the |
| T13274 |
24728-24733 |
JJ |
denotes |
basal |
| T13273 |
24734-24742 |
NN |
denotes |
membrane |
| T13275 |
24743-24746 |
CC |
denotes |
and |
| T13276 |
24747-24750 |
JJ |
denotes |
few |
| T13278 |
24751-24755 |
NN |
denotes |
germ |
| T13277 |
24756-24761 |
NNS |
denotes |
cells |
| T13280 |
24762-24766 |
VBD |
denotes |
were |
| T13279 |
24767-24772 |
VBN |
denotes |
found |
| T13281 |
24773-24775 |
IN |
denotes |
in |
| T13282 |
24776-24779 |
DT |
denotes |
the |
| T13284 |
24780-24789 |
JJ |
denotes |
adlumenal |
| T13283 |
24790-24796 |
NN |
denotes |
region |
| T13285 |
24796-24797 |
. |
denotes |
. |
| T13286 |
24797-26049 |
sentence |
denotes |
Figure 6 Abnormal Sertoli Cell Organization in Dmrt7 Mutant Testes
(A) Testes from P14 wild-type and Dmrt7 mutant mice were sectioned and stained with antibody to GATA4.
(B) P14 testis sections stained with antibody to GATA1. At P14, GATA4 and GATA1 levels are similar in wild-type and mutant Sertoli cell.
(C) Wild-type and mutant testis sections double-stained with antibody to GATA1 (red) and DAPI (blue). Most Sertoli cell nuclei were adjacent to the basal membrane in wild-type, but mutant Sertoli cells were displaced in some tubules (arrowhead). White dotted line indicates position of basal membranes.
(D) Testis sections from 10-wk-old wild-type and Sertoli cell-specific Dmrt7 mutant (SC-Dmrt7KO) mice stained with hematoxylin and eosin. Spermatogenesis and spermiogenesis are normal in SC-Dmrt7KO testis.
(E) Testis sections from 10-wk-old wild-type and SC-Dmrt7KO mice stained with antibodies to GATA1 (red) and smooth muscle actin (to outline seminiferous tubules; green). Sertoli cell nuclei are positioned normally near the basal membrane in SC-Dmrt7KO mice. The aberrant Sertoli cell organization in Dmrt7 mutant testes raised the possibility that the germ cell phenotype might indirectly result from defects in Sertoli cell function. |
| T30296 |
24808-24816 |
JJ |
denotes |
Abnormal |
| T30298 |
24817-24824 |
NNP |
denotes |
Sertoli |
| T30299 |
24825-24829 |
NN |
denotes |
Cell |
| T30297 |
24830-24842 |
NN |
denotes |
Organization |
| T30300 |
24843-24845 |
IN |
denotes |
in |
| T30301 |
24846-24851 |
NN |
denotes |
Dmrt7 |
| T30302 |
24852-24858 |
NN |
denotes |
Mutant |
| T30303 |
24859-24865 |
NNS |
denotes |
Testes |
| T30304 |
24865-24968 |
sentence |
denotes |
(A) Testes from P14 wild-type and Dmrt7 mutant mice were sectioned and stained with antibody to GATA4. |
| T30305 |
24866-24867 |
-LRB- |
denotes |
( |
| T30306 |
24867-24868 |
LS |
denotes |
A |
| T30308 |
24868-24869 |
-RRB- |
denotes |
) |
| T30309 |
24870-24876 |
NNS |
denotes |
Testes |
| T30310 |
24877-24881 |
IN |
denotes |
from |
| T30311 |
24882-24885 |
NN |
denotes |
P14 |
| T30313 |
24886-24890 |
JJ |
denotes |
wild |
| T30315 |
24890-24891 |
HYPH |
denotes |
- |
| T30314 |
24891-24895 |
NN |
denotes |
type |
| T30316 |
24896-24899 |
CC |
denotes |
and |
| T30317 |
24900-24905 |
NN |
denotes |
Dmrt7 |
| T30318 |
24906-24912 |
NN |
denotes |
mutant |
| T30312 |
24913-24917 |
NNS |
denotes |
mice |
| T30319 |
24918-24922 |
VBD |
denotes |
were |
| T30307 |
24923-24932 |
VBN |
denotes |
sectioned |
| T30320 |
24933-24936 |
CC |
denotes |
and |
| T30321 |
24937-24944 |
VBN |
denotes |
stained |
| T30322 |
24945-24949 |
IN |
denotes |
with |
| T30323 |
24950-24958 |
NN |
denotes |
antibody |
| T30324 |
24959-24961 |
IN |
denotes |
to |
| T30325 |
24962-24967 |
NN |
denotes |
GATA4 |
| T30326 |
24967-24968 |
. |
denotes |
. |
| T30327 |
24968-25024 |
sentence |
denotes |
(B) P14 testis sections stained with antibody to GATA1. |
| T30328 |
24969-24970 |
-LRB- |
denotes |
( |
| T30329 |
24970-24971 |
LS |
denotes |
B |
| T30331 |
24971-24972 |
-RRB- |
denotes |
) |
| T30332 |
24973-24976 |
NN |
denotes |
P14 |
| T30333 |
24977-24983 |
NN |
denotes |
testis |
| T30330 |
24984-24992 |
NNS |
denotes |
sections |
| T30334 |
24993-25000 |
VBN |
denotes |
stained |
| T30335 |
25001-25005 |
IN |
denotes |
with |
| T30336 |
25006-25014 |
NN |
denotes |
antibody |
| T30337 |
25015-25017 |
IN |
denotes |
to |
| T30338 |
25018-25023 |
NN |
denotes |
GATA1 |
| T30339 |
25023-25024 |
. |
denotes |
. |
| T30340 |
25024-25105 |
sentence |
denotes |
At P14, GATA4 and GATA1 levels are similar in wild-type and mutant Sertoli cell. |
| T30341 |
25025-25027 |
IN |
denotes |
At |
| T30343 |
25028-25031 |
NN |
denotes |
P14 |
| T30344 |
25031-25033 |
, |
denotes |
, |
| T30345 |
25033-25038 |
NN |
denotes |
GATA4 |
| T30347 |
25039-25042 |
CC |
denotes |
and |
| T30348 |
25043-25048 |
NN |
denotes |
GATA1 |
| T30346 |
25049-25055 |
NNS |
denotes |
levels |
| T30342 |
25056-25059 |
VBP |
denotes |
are |
| T30349 |
25060-25067 |
JJ |
denotes |
similar |
| T30350 |
25068-25070 |
IN |
denotes |
in |
| T30351 |
25071-25075 |
JJ |
denotes |
wild |
| T30353 |
25075-25076 |
HYPH |
denotes |
- |
| T30352 |
25076-25080 |
NN |
denotes |
type |
| T30355 |
25081-25084 |
CC |
denotes |
and |
| T30356 |
25085-25091 |
NN |
denotes |
mutant |
| T30357 |
25092-25099 |
NNP |
denotes |
Sertoli |
| T30354 |
25100-25104 |
NN |
denotes |
cell |
| T30358 |
25104-25105 |
. |
denotes |
. |
| T30359 |
25105-25207 |
sentence |
denotes |
(C) Wild-type and mutant testis sections double-stained with antibody to GATA1 (red) and DAPI (blue). |
| T30360 |
25106-25107 |
-LRB- |
denotes |
( |
| T30361 |
25107-25108 |
LS |
denotes |
C |
| T30363 |
25108-25109 |
-RRB- |
denotes |
) |
| T30364 |
25110-25114 |
JJ |
denotes |
Wild |
| T30366 |
25114-25115 |
HYPH |
denotes |
- |
| T30365 |
25115-25119 |
NN |
denotes |
type |
| T30367 |
25120-25123 |
CC |
denotes |
and |
| T30368 |
25124-25130 |
NN |
denotes |
mutant |
| T30369 |
25131-25137 |
NN |
denotes |
testis |
| T30362 |
25138-25146 |
NNS |
denotes |
sections |
| T30370 |
25147-25153 |
RB |
denotes |
double |
| T30372 |
25153-25154 |
HYPH |
denotes |
- |
| T30371 |
25154-25161 |
VBN |
denotes |
stained |
| T30373 |
25162-25166 |
IN |
denotes |
with |
| T30374 |
25167-25175 |
NN |
denotes |
antibody |
| T30375 |
25176-25178 |
IN |
denotes |
to |
| T30376 |
25179-25184 |
NN |
denotes |
GATA1 |
| T30377 |
25185-25186 |
-LRB- |
denotes |
( |
| T30378 |
25186-25189 |
JJ |
denotes |
red |
| T30379 |
25189-25190 |
-RRB- |
denotes |
) |
| T30380 |
25191-25194 |
CC |
denotes |
and |
| T30381 |
25195-25199 |
NN |
denotes |
DAPI |
| T30382 |
25200-25201 |
-LRB- |
denotes |
( |
| T30383 |
25201-25205 |
JJ |
denotes |
blue |
| T30384 |
25205-25206 |
-RRB- |
denotes |
) |
| T30385 |
25206-25207 |
. |
denotes |
. |
| T30386 |
25207-25351 |
sentence |
denotes |
Most Sertoli cell nuclei were adjacent to the basal membrane in wild-type, but mutant Sertoli cells were displaced in some tubules (arrowhead). |
| T30387 |
25208-25212 |
JJS |
denotes |
Most |
| T30389 |
25213-25220 |
NNP |
denotes |
Sertoli |
| T30390 |
25221-25225 |
NN |
denotes |
cell |
| T30388 |
25226-25232 |
NNS |
denotes |
nuclei |
| T30391 |
25233-25237 |
VBD |
denotes |
were |
| T30392 |
25238-25246 |
JJ |
denotes |
adjacent |
| T30393 |
25247-25249 |
IN |
denotes |
to |
| T30394 |
25250-25253 |
DT |
denotes |
the |
| T30396 |
25254-25259 |
JJ |
denotes |
basal |
| T30395 |
25260-25268 |
NN |
denotes |
membrane |
| T30397 |
25269-25271 |
IN |
denotes |
in |
| T30398 |
25272-25276 |
JJ |
denotes |
wild |
| T30400 |
25276-25277 |
HYPH |
denotes |
- |
| T30399 |
25277-25281 |
NN |
denotes |
type |
| T30401 |
25281-25283 |
, |
denotes |
, |
| T30402 |
25283-25286 |
CC |
denotes |
but |
| T30403 |
25287-25293 |
NN |
denotes |
mutant |
| T30405 |
25294-25301 |
NNP |
denotes |
Sertoli |
| T30404 |
25302-25307 |
NNS |
denotes |
cells |
| T30407 |
25308-25312 |
VBD |
denotes |
were |
| T30406 |
25313-25322 |
VBN |
denotes |
displaced |
| T30408 |
25323-25325 |
IN |
denotes |
in |
| T30409 |
25326-25330 |
DT |
denotes |
some |
| T30410 |
25331-25338 |
NNS |
denotes |
tubules |
| T30411 |
25339-25340 |
-LRB- |
denotes |
( |
| T30412 |
25340-25349 |
NN |
denotes |
arrowhead |
| T30413 |
25349-25350 |
-RRB- |
denotes |
) |
| T30414 |
25350-25351 |
. |
denotes |
. |
| T30415 |
25351-25408 |
sentence |
denotes |
White dotted line indicates position of basal membranes. |
| T30416 |
25352-25357 |
JJ |
denotes |
White |
| T30418 |
25358-25364 |
VBN |
denotes |
dotted |
| T30417 |
25365-25369 |
NN |
denotes |
line |
| T30419 |
25370-25379 |
VBZ |
denotes |
indicates |
| T30420 |
25380-25388 |
NN |
denotes |
position |
| T30421 |
25389-25391 |
IN |
denotes |
of |
| T30422 |
25392-25397 |
JJ |
denotes |
basal |
| T30423 |
25398-25407 |
NNS |
denotes |
membranes |
| T30424 |
25407-25408 |
. |
denotes |
. |
| T30425 |
25408-25546 |
sentence |
denotes |
(D) Testis sections from 10-wk-old wild-type and Sertoli cell-specific Dmrt7 mutant (SC-Dmrt7KO) mice stained with hematoxylin and eosin. |
| T30426 |
25409-25410 |
-LRB- |
denotes |
( |
| T30427 |
25410-25411 |
LS |
denotes |
D |
| T30429 |
25411-25412 |
-RRB- |
denotes |
) |
| T30430 |
25413-25419 |
NN |
denotes |
Testis |
| T30428 |
25420-25428 |
NNS |
denotes |
sections |
| T30431 |
25429-25433 |
IN |
denotes |
from |
| T30432 |
25434-25436 |
CD |
denotes |
10 |
| T30434 |
25436-25437 |
HYPH |
denotes |
- |
| T30433 |
25437-25439 |
NN |
denotes |
wk |
| T30436 |
25439-25440 |
HYPH |
denotes |
- |
| T30435 |
25440-25443 |
JJ |
denotes |
old |
| T30438 |
25444-25448 |
JJ |
denotes |
wild |
| T30440 |
25448-25449 |
HYPH |
denotes |
- |
| T30439 |
25449-25453 |
NN |
denotes |
type |
| T30441 |
25454-25457 |
CC |
denotes |
and |
| T30442 |
25458-25465 |
NNP |
denotes |
Sertoli |
| T30443 |
25466-25470 |
NN |
denotes |
cell |
| T30445 |
25470-25471 |
HYPH |
denotes |
- |
| T30444 |
25471-25479 |
JJ |
denotes |
specific |
| T30447 |
25480-25485 |
NN |
denotes |
Dmrt7 |
| T30446 |
25486-25492 |
NN |
denotes |
mutant |
| T30448 |
25493-25494 |
-LRB- |
denotes |
( |
| T30449 |
25494-25496 |
NN |
denotes |
SC |
| T30451 |
25496-25497 |
HYPH |
denotes |
- |
| T30450 |
25497-25504 |
NN |
denotes |
Dmrt7KO |
| T30452 |
25504-25505 |
-RRB- |
denotes |
) |
| T30437 |
25506-25510 |
NNS |
denotes |
mice |
| T30453 |
25511-25518 |
VBN |
denotes |
stained |
| T30454 |
25519-25523 |
IN |
denotes |
with |
| T30455 |
25524-25535 |
NN |
denotes |
hematoxylin |
| T30456 |
25536-25539 |
CC |
denotes |
and |
| T30457 |
25540-25545 |
NN |
denotes |
eosin |
| T30458 |
25545-25546 |
. |
denotes |
. |
| T30459 |
25546-25614 |
sentence |
denotes |
Spermatogenesis and spermiogenesis are normal in SC-Dmrt7KO testis. |
| T30460 |
25547-25562 |
NN |
denotes |
Spermatogenesis |
| T30462 |
25563-25566 |
CC |
denotes |
and |
| T30463 |
25567-25581 |
NN |
denotes |
spermiogenesis |
| T30461 |
25582-25585 |
VBP |
denotes |
are |
| T30464 |
25586-25592 |
JJ |
denotes |
normal |
| T30465 |
25593-25595 |
IN |
denotes |
in |
| T30466 |
25596-25598 |
NN |
denotes |
SC |
| T30468 |
25598-25599 |
HYPH |
denotes |
- |
| T30467 |
25599-25606 |
NN |
denotes |
Dmrt7KO |
| T30469 |
25607-25613 |
NN |
denotes |
testis |
| T30470 |
25613-25614 |
. |
denotes |
. |
| T30471 |
25614-25784 |
sentence |
denotes |
(E) Testis sections from 10-wk-old wild-type and SC-Dmrt7KO mice stained with antibodies to GATA1 (red) and smooth muscle actin (to outline seminiferous tubules; green). |
| T30472 |
25615-25616 |
-LRB- |
denotes |
( |
| T30473 |
25616-25617 |
LS |
denotes |
E |
| T30475 |
25617-25618 |
-RRB- |
denotes |
) |
| T30476 |
25619-25625 |
NN |
denotes |
Testis |
| T30474 |
25626-25634 |
NNS |
denotes |
sections |
| T30477 |
25635-25639 |
IN |
denotes |
from |
| T30478 |
25640-25642 |
CD |
denotes |
10 |
| T30480 |
25642-25643 |
HYPH |
denotes |
- |
| T30479 |
25643-25645 |
NN |
denotes |
wk |
| T30482 |
25645-25646 |
HYPH |
denotes |
- |
| T30481 |
25646-25649 |
JJ |
denotes |
old |
| T30484 |
25650-25654 |
JJ |
denotes |
wild |
| T30486 |
25654-25655 |
HYPH |
denotes |
- |
| T30485 |
25655-25659 |
NN |
denotes |
type |
| T30487 |
25660-25663 |
CC |
denotes |
and |
| T30488 |
25664-25666 |
NN |
denotes |
SC |
| T30490 |
25666-25667 |
HYPH |
denotes |
- |
| T30489 |
25667-25674 |
NN |
denotes |
Dmrt7KO |
| T30483 |
25675-25679 |
NNS |
denotes |
mice |
| T30491 |
25680-25687 |
VBN |
denotes |
stained |
| T30492 |
25688-25692 |
IN |
denotes |
with |
| T30493 |
25693-25703 |
NNS |
denotes |
antibodies |
| T30494 |
25704-25706 |
IN |
denotes |
to |
| T30495 |
25707-25712 |
NN |
denotes |
GATA1 |
| T30496 |
25713-25714 |
-LRB- |
denotes |
( |
| T30497 |
25714-25717 |
JJ |
denotes |
red |
| T30498 |
25717-25718 |
-RRB- |
denotes |
) |
| T30499 |
25719-25722 |
CC |
denotes |
and |
| T30500 |
25723-25729 |
JJ |
denotes |
smooth |
| T30502 |
25730-25736 |
NN |
denotes |
muscle |
| T30501 |
25737-25742 |
NN |
denotes |
actin |
| T30503 |
25743-25744 |
-LRB- |
denotes |
( |
| T30505 |
25744-25746 |
TO |
denotes |
to |
| T30504 |
25747-25754 |
VB |
denotes |
outline |
| T30506 |
25755-25767 |
JJ |
denotes |
seminiferous |
| T30507 |
25768-25775 |
NNS |
denotes |
tubules |
| T30508 |
25775-25776 |
: |
denotes |
; |
| T30509 |
25777-25782 |
JJ |
denotes |
green |
| T30510 |
25782-25783 |
-RRB- |
denotes |
) |
| T30511 |
25783-25784 |
. |
denotes |
. |
| T30512 |
25784-25872 |
sentence |
denotes |
Sertoli cell nuclei are positioned normally near the basal membrane in SC-Dmrt7KO mice. |
| T30513 |
25785-25792 |
NNP |
denotes |
Sertoli |
| T30514 |
25793-25797 |
NN |
denotes |
cell |
| T30515 |
25798-25804 |
NNS |
denotes |
nuclei |
| T30517 |
25805-25808 |
VBP |
denotes |
are |
| T30516 |
25809-25819 |
VBN |
denotes |
positioned |
| T30518 |
25820-25828 |
RB |
denotes |
normally |
| T30519 |
25829-25833 |
IN |
denotes |
near |
| T30520 |
25834-25837 |
DT |
denotes |
the |
| T30522 |
25838-25843 |
JJ |
denotes |
basal |
| T30521 |
25844-25852 |
NN |
denotes |
membrane |
| T30523 |
25853-25855 |
IN |
denotes |
in |
| T30524 |
25856-25858 |
NN |
denotes |
SC |
| T30526 |
25858-25859 |
HYPH |
denotes |
- |
| T30525 |
25859-25866 |
NN |
denotes |
Dmrt7KO |
| T30527 |
25867-25871 |
NNS |
denotes |
mice |
| T30528 |
25871-25872 |
. |
denotes |
. |
| T13287 |
25873-25876 |
DT |
denotes |
The |
| T13289 |
25877-25885 |
JJ |
denotes |
aberrant |
| T13290 |
25886-25893 |
NNP |
denotes |
Sertoli |
| T13291 |
25894-25898 |
NN |
denotes |
cell |
| T13288 |
25899-25911 |
NN |
denotes |
organization |
| T13293 |
25912-25914 |
IN |
denotes |
in |
| T13294 |
25915-25920 |
NN |
denotes |
Dmrt7 |
| T13296 |
25921-25927 |
NN |
denotes |
mutant |
| T13295 |
25928-25934 |
NNS |
denotes |
testes |
| T13292 |
25935-25941 |
VBD |
denotes |
raised |
| T13297 |
25942-25945 |
DT |
denotes |
the |
| T13298 |
25946-25957 |
NN |
denotes |
possibility |
| T13299 |
25958-25962 |
IN |
denotes |
that |
| T13301 |
25963-25966 |
DT |
denotes |
the |
| T13303 |
25967-25971 |
NN |
denotes |
germ |
| T13304 |
25972-25976 |
NN |
denotes |
cell |
| T13302 |
25977-25986 |
NN |
denotes |
phenotype |
| T13305 |
25987-25992 |
MD |
denotes |
might |
| T13306 |
25993-26003 |
RB |
denotes |
indirectly |
| T13300 |
26004-26010 |
VB |
denotes |
result |
| T13307 |
26011-26015 |
IN |
denotes |
from |
| T13308 |
26016-26023 |
NNS |
denotes |
defects |
| T13309 |
26024-26026 |
IN |
denotes |
in |
| T13310 |
26027-26034 |
NNP |
denotes |
Sertoli |
| T13311 |
26035-26039 |
NN |
denotes |
cell |
| T13312 |
26040-26048 |
NN |
denotes |
function |
| T13313 |
26048-26049 |
. |
denotes |
. |
| T13314 |
26049-26210 |
sentence |
denotes |
To test this possibility, we deleted Dmrt7 just in the Sertoli cell lineage by crossing mice carrying the floxed Dmrt7 allele with Dhh-Cre transgenic mice [51]. |
| T13315 |
26050-26052 |
TO |
denotes |
To |
| T13316 |
26053-26057 |
VB |
denotes |
test |
| T13318 |
26058-26062 |
DT |
denotes |
this |
| T13319 |
26063-26074 |
NN |
denotes |
possibility |
| T13320 |
26074-26076 |
, |
denotes |
, |
| T13321 |
26076-26078 |
PRP |
denotes |
we |
| T13317 |
26079-26086 |
VBD |
denotes |
deleted |
| T13322 |
26087-26092 |
NN |
denotes |
Dmrt7 |
| T13323 |
26093-26097 |
RB |
denotes |
just |
| T13324 |
26098-26100 |
IN |
denotes |
in |
| T13325 |
26101-26104 |
DT |
denotes |
the |
| T13327 |
26105-26112 |
NNP |
denotes |
Sertoli |
| T13328 |
26113-26117 |
NN |
denotes |
cell |
| T13326 |
26118-26125 |
NN |
denotes |
lineage |
| T13329 |
26126-26128 |
IN |
denotes |
by |
| T13330 |
26129-26137 |
VBG |
denotes |
crossing |
| T13331 |
26138-26142 |
NNS |
denotes |
mice |
| T13332 |
26143-26151 |
VBG |
denotes |
carrying |
| T13333 |
26152-26155 |
DT |
denotes |
the |
| T13335 |
26156-26162 |
VBN |
denotes |
floxed |
| T13336 |
26163-26168 |
NN |
denotes |
Dmrt7 |
| T13334 |
26169-26175 |
NN |
denotes |
allele |
| T13337 |
26176-26180 |
IN |
denotes |
with |
| T13338 |
26181-26184 |
NN |
denotes |
Dhh |
| T13340 |
26184-26185 |
HYPH |
denotes |
- |
| T13339 |
26185-26188 |
NN |
denotes |
Cre |
| T13341 |
26189-26199 |
JJ |
denotes |
transgenic |
| T13342 |
26200-26204 |
NNS |
denotes |
mice |
| T13343 |
26205-26206 |
-LRB- |
denotes |
[ |
| T13344 |
26206-26208 |
CD |
denotes |
51 |
| T13345 |
26208-26209 |
-RRB- |
denotes |
] |
| T13346 |
26209-26210 |
. |
denotes |
. |
| T13347 |
26210-26425 |
sentence |
denotes |
The Desert hedgehog (Dhh) promoter is active starting at about E12.5 in pre-Sertoli cells but not in germ cells, allowing deletion of Dmrt7 in Sertoli cells well before any likely requirement for its function [52]. |
| T13348 |
26211-26214 |
DT |
denotes |
The |
| T13350 |
26215-26221 |
NN |
denotes |
Desert |
| T13351 |
26222-26230 |
NN |
denotes |
hedgehog |
| T13352 |
26231-26232 |
-LRB- |
denotes |
( |
| T13353 |
26232-26235 |
NN |
denotes |
Dhh |
| T13354 |
26235-26236 |
-RRB- |
denotes |
) |
| T13349 |
26237-26245 |
NN |
denotes |
promoter |
| T13355 |
26246-26248 |
VBZ |
denotes |
is |
| T13356 |
26249-26255 |
JJ |
denotes |
active |
| T13357 |
26256-26264 |
VBG |
denotes |
starting |
| T13358 |
26265-26267 |
IN |
denotes |
at |
| T13359 |
26268-26273 |
IN |
denotes |
about |
| T13360 |
26274-26279 |
NN |
denotes |
E12.5 |
| T13361 |
26280-26282 |
IN |
denotes |
in |
| T13362 |
26283-26294 |
JJ |
denotes |
pre-Sertoli |
| T13363 |
26295-26300 |
NNS |
denotes |
cells |
| T13364 |
26301-26304 |
CC |
denotes |
but |
| T13365 |
26305-26308 |
RB |
denotes |
not |
| T13366 |
26309-26311 |
IN |
denotes |
in |
| T13367 |
26312-26316 |
NN |
denotes |
germ |
| T13368 |
26317-26322 |
NNS |
denotes |
cells |
| T13369 |
26322-26324 |
, |
denotes |
, |
| T13370 |
26324-26332 |
VBG |
denotes |
allowing |
| T13371 |
26333-26341 |
NN |
denotes |
deletion |
| T13372 |
26342-26344 |
IN |
denotes |
of |
| T13373 |
26345-26350 |
NN |
denotes |
Dmrt7 |
| T13374 |
26351-26353 |
IN |
denotes |
in |
| T13375 |
26354-26361 |
NNP |
denotes |
Sertoli |
| T13376 |
26362-26367 |
NNS |
denotes |
cells |
| T13377 |
26368-26372 |
RB |
denotes |
well |
| T13378 |
26373-26379 |
IN |
denotes |
before |
| T13379 |
26380-26383 |
DT |
denotes |
any |
| T13381 |
26384-26390 |
JJ |
denotes |
likely |
| T13380 |
26391-26402 |
NN |
denotes |
requirement |
| T13382 |
26403-26406 |
IN |
denotes |
for |
| T13383 |
26407-26410 |
PRP$ |
denotes |
its |
| T13384 |
26411-26419 |
NN |
denotes |
function |
| T13385 |
26420-26421 |
-LRB- |
denotes |
[ |
| T13386 |
26421-26423 |
CD |
denotes |
52 |
| T13387 |
26423-26424 |
-RRB- |
denotes |
] |
| T13388 |
26424-26425 |
. |
denotes |
. |
| T13389 |
26425-26637 |
sentence |
denotes |
Testicular size in Sertoli-targeted (SC-Dmrt7KO) animals was slightly reduced from that of wild-type, but histological analysis revealed no obvious difference between wild-type and SC-Dmrt7KO testes (Figure 6D). |
| T13390 |
26426-26436 |
JJ |
denotes |
Testicular |
| T13391 |
26437-26441 |
NN |
denotes |
size |
| T13393 |
26442-26444 |
IN |
denotes |
in |
| T13394 |
26445-26452 |
NNP |
denotes |
Sertoli |
| T13396 |
26452-26453 |
HYPH |
denotes |
- |
| T13395 |
26453-26461 |
VBN |
denotes |
targeted |
| T13398 |
26462-26463 |
-LRB- |
denotes |
( |
| T13400 |
26463-26465 |
NN |
denotes |
SC |
| T13401 |
26465-26466 |
HYPH |
denotes |
- |
| T13399 |
26466-26473 |
NN |
denotes |
Dmrt7KO |
| T13402 |
26473-26474 |
-RRB- |
denotes |
) |
| T13397 |
26475-26482 |
NNS |
denotes |
animals |
| T13403 |
26483-26486 |
VBD |
denotes |
was |
| T13404 |
26487-26495 |
RB |
denotes |
slightly |
| T13392 |
26496-26503 |
VBN |
denotes |
reduced |
| T13405 |
26504-26508 |
IN |
denotes |
from |
| T13406 |
26509-26513 |
DT |
denotes |
that |
| T13407 |
26514-26516 |
IN |
denotes |
of |
| T13408 |
26517-26521 |
JJ |
denotes |
wild |
| T13410 |
26521-26522 |
HYPH |
denotes |
- |
| T13409 |
26522-26526 |
NN |
denotes |
type |
| T13411 |
26526-26528 |
, |
denotes |
, |
| T13412 |
26528-26531 |
CC |
denotes |
but |
| T13413 |
26532-26544 |
JJ |
denotes |
histological |
| T13414 |
26545-26553 |
NN |
denotes |
analysis |
| T13415 |
26554-26562 |
VBD |
denotes |
revealed |
| T13416 |
26563-26565 |
DT |
denotes |
no |
| T13418 |
26566-26573 |
JJ |
denotes |
obvious |
| T13417 |
26574-26584 |
NN |
denotes |
difference |
| T13419 |
26585-26592 |
IN |
denotes |
between |
| T13420 |
26593-26597 |
JJ |
denotes |
wild |
| T13422 |
26597-26598 |
HYPH |
denotes |
- |
| T13421 |
26598-26602 |
NN |
denotes |
type |
| T13424 |
26603-26606 |
CC |
denotes |
and |
| T13425 |
26607-26609 |
NN |
denotes |
SC |
| T13427 |
26609-26610 |
HYPH |
denotes |
- |
| T13426 |
26610-26617 |
NN |
denotes |
Dmrt7KO |
| T13423 |
26618-26624 |
NNS |
denotes |
testes |
| T13428 |
26625-26626 |
-LRB- |
denotes |
( |
| T13430 |
26626-26632 |
NN |
denotes |
Figure |
| T13429 |
26633-26635 |
NN |
denotes |
6D |
| T13431 |
26635-26636 |
-RRB- |
denotes |
) |
| T13432 |
26636-26637 |
. |
denotes |
. |
| T13433 |
26637-26731 |
sentence |
denotes |
Spermatogenesis appeared normal, mature sperm were present, and SC-Dmrt7KO mice were fertile. |
| T13434 |
26638-26653 |
NN |
denotes |
Spermatogenesis |
| T13435 |
26654-26662 |
VBD |
denotes |
appeared |
| T13436 |
26663-26669 |
JJ |
denotes |
normal |
| T13437 |
26669-26671 |
, |
denotes |
, |
| T13438 |
26671-26677 |
JJ |
denotes |
mature |
| T13439 |
26678-26683 |
NN |
denotes |
sperm |
| T13440 |
26684-26688 |
VBD |
denotes |
were |
| T13441 |
26689-26696 |
JJ |
denotes |
present |
| T13442 |
26696-26698 |
, |
denotes |
, |
| T13443 |
26698-26701 |
CC |
denotes |
and |
| T13444 |
26702-26704 |
NN |
denotes |
SC |
| T13446 |
26704-26705 |
HYPH |
denotes |
- |
| T13445 |
26705-26712 |
NN |
denotes |
Dmrt7KO |
| T13447 |
26713-26717 |
NNS |
denotes |
mice |
| T13448 |
26718-26722 |
VBD |
denotes |
were |
| T13449 |
26723-26730 |
JJ |
denotes |
fertile |
| T13450 |
26730-26731 |
. |
denotes |
. |
| T13451 |
26731-26867 |
sentence |
denotes |
In addition, GATA1 staining showed that Sertoli cell nuclei were located adjacent to the basement membrane as in wild-type (Figure 6E). |
| T13452 |
26732-26734 |
IN |
denotes |
In |
| T13454 |
26735-26743 |
NN |
denotes |
addition |
| T13455 |
26743-26745 |
, |
denotes |
, |
| T13456 |
26745-26750 |
NN |
denotes |
GATA1 |
| T13457 |
26751-26759 |
NN |
denotes |
staining |
| T13453 |
26760-26766 |
VBD |
denotes |
showed |
| T13458 |
26767-26771 |
IN |
denotes |
that |
| T13460 |
26772-26779 |
NNP |
denotes |
Sertoli |
| T13461 |
26780-26784 |
NN |
denotes |
cell |
| T13462 |
26785-26791 |
NNS |
denotes |
nuclei |
| T13463 |
26792-26796 |
VBD |
denotes |
were |
| T13459 |
26797-26804 |
VBN |
denotes |
located |
| T13464 |
26805-26813 |
JJ |
denotes |
adjacent |
| T13465 |
26814-26816 |
IN |
denotes |
to |
| T13466 |
26817-26820 |
DT |
denotes |
the |
| T13468 |
26821-26829 |
NN |
denotes |
basement |
| T13467 |
26830-26838 |
NN |
denotes |
membrane |
| T13469 |
26839-26841 |
IN |
denotes |
as |
| T13470 |
26842-26844 |
IN |
denotes |
in |
| T13471 |
26845-26849 |
JJ |
denotes |
wild |
| T13473 |
26849-26850 |
HYPH |
denotes |
- |
| T13472 |
26850-26854 |
NN |
denotes |
type |
| T13474 |
26855-26856 |
-LRB- |
denotes |
( |
| T13476 |
26856-26862 |
NN |
denotes |
Figure |
| T13475 |
26863-26865 |
NN |
denotes |
6E |
| T13477 |
26865-26866 |
-RRB- |
denotes |
) |
| T13478 |
26866-26867 |
. |
denotes |
. |
| T13479 |
26867-26978 |
sentence |
denotes |
These results suggest the germ cell defects of Dmrt7 mutants are not caused by lack of Dmrt7 in Sertoli cells. |
| T13480 |
26868-26873 |
DT |
denotes |
These |
| T13481 |
26874-26881 |
NNS |
denotes |
results |
| T13482 |
26882-26889 |
VBP |
denotes |
suggest |
| T13483 |
26890-26893 |
DT |
denotes |
the |
| T13485 |
26894-26898 |
NN |
denotes |
germ |
| T13486 |
26899-26903 |
NN |
denotes |
cell |
| T13484 |
26904-26911 |
NNS |
denotes |
defects |
| T13488 |
26912-26914 |
IN |
denotes |
of |
| T13489 |
26915-26920 |
NN |
denotes |
Dmrt7 |
| T13490 |
26921-26928 |
NNS |
denotes |
mutants |
| T13491 |
26929-26932 |
VBP |
denotes |
are |
| T13492 |
26933-26936 |
RB |
denotes |
not |
| T13487 |
26937-26943 |
VBN |
denotes |
caused |
| T13493 |
26944-26946 |
IN |
denotes |
by |
| T13494 |
26947-26951 |
NN |
denotes |
lack |
| T13495 |
26952-26954 |
IN |
denotes |
of |
| T13496 |
26955-26960 |
NN |
denotes |
Dmrt7 |
| T13497 |
26961-26963 |
IN |
denotes |
in |
| T13498 |
26964-26971 |
NNP |
denotes |
Sertoli |
| T13499 |
26972-26977 |
NNS |
denotes |
cells |
| T13500 |
26977-26978 |
. |
denotes |
. |
| T13501 |
26978-27084 |
sentence |
denotes |
Rather, the abnormal organization of Sertoli cells appears to result from lack of Dmrt7 in the germ line. |
| T13502 |
26979-26985 |
RB |
denotes |
Rather |
| T13504 |
26985-26987 |
, |
denotes |
, |
| T13505 |
26987-26990 |
DT |
denotes |
the |
| T13507 |
26991-26999 |
JJ |
denotes |
abnormal |
| T13506 |
27000-27012 |
NN |
denotes |
organization |
| T13508 |
27013-27015 |
IN |
denotes |
of |
| T13509 |
27016-27023 |
NNP |
denotes |
Sertoli |
| T13510 |
27024-27029 |
NNS |
denotes |
cells |
| T13503 |
27030-27037 |
VBZ |
denotes |
appears |
| T13511 |
27038-27040 |
TO |
denotes |
to |
| T13512 |
27041-27047 |
VB |
denotes |
result |
| T13513 |
27048-27052 |
IN |
denotes |
from |
| T13514 |
27053-27057 |
NN |
denotes |
lack |
| T13515 |
27058-27060 |
IN |
denotes |
of |
| T13516 |
27061-27066 |
NN |
denotes |
Dmrt7 |
| T13517 |
27067-27069 |
IN |
denotes |
in |
| T13518 |
27070-27073 |
DT |
denotes |
the |
| T13520 |
27074-27078 |
NN |
denotes |
germ |
| T13519 |
27079-27083 |
NN |
denotes |
line |
| T13521 |
27083-27084 |
. |
denotes |
. |
| T14689 |
27086-27088 |
NN |
denotes |
XY |
| T14690 |
27089-27095 |
NNS |
denotes |
Bodies |
| T14691 |
27096-27100 |
VBP |
denotes |
Form |
| T14692 |
27101-27109 |
RB |
denotes |
Normally |
| T14693 |
27110-27112 |
IN |
denotes |
in |
| T14694 |
27113-27118 |
NN |
denotes |
Dmrt7 |
| T14695 |
27119-27125 |
NN |
denotes |
Mutant |
| T14696 |
27126-27131 |
NNS |
denotes |
Cells |
| T14697 |
27131-27324 |
sentence |
denotes |
The data presented so far indicate that Dmrt7 mutant germ cells undergo apparently normal early meiosis and then arrest during pachynema due to a strict requirement for Dmrt7 in the germ line. |
| T14698 |
27132-27135 |
DT |
denotes |
The |
| T14699 |
27136-27140 |
NNS |
denotes |
data |
| T14701 |
27141-27150 |
VBN |
denotes |
presented |
| T14702 |
27151-27153 |
RB |
denotes |
so |
| T14703 |
27154-27157 |
RB |
denotes |
far |
| T14700 |
27158-27166 |
VBP |
denotes |
indicate |
| T14704 |
27167-27171 |
IN |
denotes |
that |
| T14706 |
27172-27177 |
NN |
denotes |
Dmrt7 |
| T14708 |
27178-27184 |
NN |
denotes |
mutant |
| T14709 |
27185-27189 |
NN |
denotes |
germ |
| T14707 |
27190-27195 |
NNS |
denotes |
cells |
| T14705 |
27196-27203 |
VBP |
denotes |
undergo |
| T14710 |
27204-27214 |
RB |
denotes |
apparently |
| T14711 |
27215-27221 |
JJ |
denotes |
normal |
| T14713 |
27222-27227 |
JJ |
denotes |
early |
| T14712 |
27228-27235 |
NN |
denotes |
meiosis |
| T14714 |
27236-27239 |
CC |
denotes |
and |
| T14715 |
27240-27244 |
RB |
denotes |
then |
| T14716 |
27245-27251 |
VBP |
denotes |
arrest |
| T14717 |
27252-27258 |
IN |
denotes |
during |
| T14718 |
27259-27268 |
NN |
denotes |
pachynema |
| T14719 |
27269-27272 |
IN |
denotes |
due |
| T14720 |
27273-27275 |
IN |
denotes |
to |
| T14721 |
27276-27277 |
DT |
denotes |
a |
| T14723 |
27278-27284 |
JJ |
denotes |
strict |
| T14722 |
27285-27296 |
NN |
denotes |
requirement |
| T14724 |
27297-27300 |
IN |
denotes |
for |
| T14725 |
27301-27306 |
NN |
denotes |
Dmrt7 |
| T14726 |
27307-27309 |
IN |
denotes |
in |
| T14727 |
27310-27313 |
DT |
denotes |
the |
| T14729 |
27314-27318 |
NN |
denotes |
germ |
| T14728 |
27319-27323 |
NN |
denotes |
line |
| T14730 |
27323-27324 |
. |
denotes |
. |
| T14731 |
27324-27437 |
sentence |
denotes |
To better understand the basis of the meiotic arrest, we more closely examined meiotic germ cells in the mutant. |
| T14732 |
27325-27327 |
TO |
denotes |
To |
| T14734 |
27328-27334 |
RBR |
denotes |
better |
| T14733 |
27335-27345 |
VB |
denotes |
understand |
| T14736 |
27346-27349 |
DT |
denotes |
the |
| T14737 |
27350-27355 |
NN |
denotes |
basis |
| T14738 |
27356-27358 |
IN |
denotes |
of |
| T14739 |
27359-27362 |
DT |
denotes |
the |
| T14741 |
27363-27370 |
JJ |
denotes |
meiotic |
| T14740 |
27371-27377 |
NN |
denotes |
arrest |
| T14742 |
27377-27379 |
, |
denotes |
, |
| T14743 |
27379-27381 |
PRP |
denotes |
we |
| T14744 |
27382-27386 |
RBR |
denotes |
more |
| T14745 |
27387-27394 |
RB |
denotes |
closely |
| T14735 |
27395-27403 |
VBN |
denotes |
examined |
| T14746 |
27404-27411 |
JJ |
denotes |
meiotic |
| T14748 |
27412-27416 |
NN |
denotes |
germ |
| T14747 |
27417-27422 |
NNS |
denotes |
cells |
| T14749 |
27423-27425 |
IN |
denotes |
in |
| T14750 |
27426-27429 |
DT |
denotes |
the |
| T14751 |
27430-27436 |
NN |
denotes |
mutant |
| T14752 |
27436-27437 |
. |
denotes |
. |
| T14753 |
27437-27573 |
sentence |
denotes |
We focused on the XY body, which is thought to be essential for meiotic progression and is the site of preferential DMRT7 localization. |
| T14754 |
27438-27440 |
PRP |
denotes |
We |
| T14755 |
27441-27448 |
VBD |
denotes |
focused |
| T14756 |
27449-27451 |
IN |
denotes |
on |
| T14757 |
27452-27455 |
DT |
denotes |
the |
| T14759 |
27456-27458 |
NN |
denotes |
XY |
| T14758 |
27459-27463 |
NN |
denotes |
body |
| T14760 |
27463-27465 |
, |
denotes |
, |
| T14761 |
27465-27470 |
WDT |
denotes |
which |
| T14763 |
27471-27473 |
VBZ |
denotes |
is |
| T14762 |
27474-27481 |
VBN |
denotes |
thought |
| T14764 |
27482-27484 |
TO |
denotes |
to |
| T14765 |
27485-27487 |
VB |
denotes |
be |
| T14766 |
27488-27497 |
JJ |
denotes |
essential |
| T14767 |
27498-27501 |
IN |
denotes |
for |
| T14768 |
27502-27509 |
JJ |
denotes |
meiotic |
| T14769 |
27510-27521 |
NN |
denotes |
progression |
| T14770 |
27522-27525 |
CC |
denotes |
and |
| T14771 |
27526-27528 |
VBZ |
denotes |
is |
| T14772 |
27529-27532 |
DT |
denotes |
the |
| T14773 |
27533-27537 |
NN |
denotes |
site |
| T14774 |
27538-27540 |
IN |
denotes |
of |
| T14775 |
27541-27553 |
JJ |
denotes |
preferential |
| T14777 |
27554-27559 |
NN |
denotes |
DMRT7 |
| T14776 |
27560-27572 |
NN |
denotes |
localization |
| T14778 |
27572-27573 |
. |
denotes |
. |
| T14779 |
27573-27822 |
sentence |
denotes |
Condensation of the X and Y chromosomes begins in late-zygotene cells, and, by mid-pachynema (when homologous chromosome pairs are fully aligned) the sex chromatin forms a microscopically visible spherical structure near the nuclear periphery [53]. |
| T14780 |
27574-27586 |
NN |
denotes |
Condensation |
| T14782 |
27587-27589 |
IN |
denotes |
of |
| T14783 |
27590-27593 |
DT |
denotes |
the |
| T14785 |
27594-27595 |
NN |
denotes |
X |
| T14786 |
27596-27599 |
CC |
denotes |
and |
| T14787 |
27600-27601 |
NN |
denotes |
Y |
| T14784 |
27602-27613 |
NNS |
denotes |
chromosomes |
| T14781 |
27614-27620 |
VBZ |
denotes |
begins |
| T14788 |
27621-27623 |
IN |
denotes |
in |
| T14789 |
27624-27628 |
JJ |
denotes |
late |
| T14791 |
27628-27629 |
HYPH |
denotes |
- |
| T14790 |
27629-27637 |
NN |
denotes |
zygotene |
| T14792 |
27638-27643 |
NNS |
denotes |
cells |
| T14793 |
27643-27645 |
, |
denotes |
, |
| T14794 |
27645-27648 |
CC |
denotes |
and |
| T14795 |
27648-27650 |
, |
denotes |
, |
| T14796 |
27650-27652 |
IN |
denotes |
by |
| T14798 |
27653-27666 |
NN |
denotes |
mid-pachynema |
| T14799 |
27667-27668 |
-LRB- |
denotes |
( |
| T14801 |
27668-27672 |
WRB |
denotes |
when |
| T14802 |
27673-27683 |
JJ |
denotes |
homologous |
| T14804 |
27684-27694 |
NN |
denotes |
chromosome |
| T14803 |
27695-27700 |
NNS |
denotes |
pairs |
| T14805 |
27701-27704 |
VBP |
denotes |
are |
| T14806 |
27705-27710 |
RB |
denotes |
fully |
| T14800 |
27711-27718 |
VBN |
denotes |
aligned |
| T14807 |
27718-27719 |
-RRB- |
denotes |
) |
| T14808 |
27720-27723 |
DT |
denotes |
the |
| T14810 |
27724-27727 |
NN |
denotes |
sex |
| T14809 |
27728-27737 |
NN |
denotes |
chromatin |
| T14797 |
27738-27743 |
VBZ |
denotes |
forms |
| T14811 |
27744-27745 |
DT |
denotes |
a |
| T14813 |
27746-27761 |
RB |
denotes |
microscopically |
| T14814 |
27762-27769 |
JJ |
denotes |
visible |
| T14815 |
27770-27779 |
JJ |
denotes |
spherical |
| T14812 |
27780-27789 |
NN |
denotes |
structure |
| T14816 |
27790-27794 |
IN |
denotes |
near |
| T14817 |
27795-27798 |
DT |
denotes |
the |
| T14819 |
27799-27806 |
JJ |
denotes |
nuclear |
| T14818 |
27807-27816 |
NN |
denotes |
periphery |
| T14820 |
27817-27818 |
-LRB- |
denotes |
[ |
| T14821 |
27818-27820 |
CD |
denotes |
53 |
| T14822 |
27820-27821 |
-RRB- |
denotes |
] |
| T14823 |
27821-27822 |
. |
denotes |
. |
| T14824 |
27822-27950 |
sentence |
denotes |
We first asked whether DMRT7 is required for XY body formation by evaluating several characteristic XY body chromatin features. |
| T14825 |
27823-27825 |
PRP |
denotes |
We |
| T14827 |
27826-27831 |
RB |
denotes |
first |
| T14826 |
27832-27837 |
VBD |
denotes |
asked |
| T14828 |
27838-27845 |
IN |
denotes |
whether |
| T14830 |
27846-27851 |
NN |
denotes |
DMRT7 |
| T14831 |
27852-27854 |
VBZ |
denotes |
is |
| T14829 |
27855-27863 |
VBN |
denotes |
required |
| T14832 |
27864-27867 |
IN |
denotes |
for |
| T14833 |
27868-27870 |
NN |
denotes |
XY |
| T14834 |
27871-27875 |
NN |
denotes |
body |
| T14835 |
27876-27885 |
NN |
denotes |
formation |
| T14836 |
27886-27888 |
IN |
denotes |
by |
| T14837 |
27889-27899 |
VBG |
denotes |
evaluating |
| T14838 |
27900-27907 |
JJ |
denotes |
several |
| T14840 |
27908-27922 |
JJ |
denotes |
characteristic |
| T14841 |
27923-27925 |
NN |
denotes |
XY |
| T14842 |
27926-27930 |
NN |
denotes |
body |
| T14843 |
27931-27940 |
NN |
denotes |
chromatin |
| T14839 |
27941-27949 |
NNS |
denotes |
features |
| T14844 |
27949-27950 |
. |
denotes |
. |
| T14845 |
27950-28015 |
sentence |
denotes |
First, we tested γH2AX expression by immunofluorescent staining. |
| T14846 |
27951-27956 |
RB |
denotes |
First |
| T14848 |
27956-27958 |
, |
denotes |
, |
| T14849 |
27958-27960 |
PRP |
denotes |
we |
| T14847 |
27961-27967 |
VBD |
denotes |
tested |
| T14850 |
27968-27973 |
NN |
denotes |
γH2AX |
| T14851 |
27974-27984 |
NN |
denotes |
expression |
| T14852 |
27985-27987 |
IN |
denotes |
by |
| T14853 |
27988-28005 |
JJ |
denotes |
immunofluorescent |
| T14854 |
28006-28014 |
NN |
denotes |
staining |
| T14855 |
28014-28015 |
. |
denotes |
. |
| T14856 |
28015-28093 |
sentence |
denotes |
H2AX is a variant of H2A that is crucial for XY body formation and MSCI [12]. |
| T14857 |
28016-28020 |
NN |
denotes |
H2AX |
| T14858 |
28021-28023 |
VBZ |
denotes |
is |
| T14859 |
28024-28025 |
DT |
denotes |
a |
| T14860 |
28026-28033 |
NN |
denotes |
variant |
| T14861 |
28034-28036 |
IN |
denotes |
of |
| T14862 |
28037-28040 |
NN |
denotes |
H2A |
| T14863 |
28041-28045 |
WDT |
denotes |
that |
| T14864 |
28046-28048 |
VBZ |
denotes |
is |
| T14865 |
28049-28056 |
JJ |
denotes |
crucial |
| T14866 |
28057-28060 |
IN |
denotes |
for |
| T14867 |
28061-28063 |
NN |
denotes |
XY |
| T14868 |
28064-28068 |
NN |
denotes |
body |
| T14869 |
28069-28078 |
NN |
denotes |
formation |
| T14870 |
28079-28082 |
CC |
denotes |
and |
| T14871 |
28083-28087 |
NN |
denotes |
MSCI |
| T14872 |
28088-28089 |
-LRB- |
denotes |
[ |
| T14873 |
28089-28091 |
CD |
denotes |
12 |
| T14874 |
28091-28092 |
-RRB- |
denotes |
] |
| T14875 |
28092-28093 |
. |
denotes |
. |
| T14876 |
28093-28281 |
sentence |
denotes |
γH2AX localized normally to the XY body of DMRT7 mutant cells in meiotic spreads (Figure 7A), and many γH2AX-positive puncta were present in germ cells of Dmrt7 mutant testes (Figure 7B). |
| T14877 |
28094-28099 |
NN |
denotes |
γH2AX |
| T14878 |
28100-28109 |
VBD |
denotes |
localized |
| T14879 |
28110-28118 |
RB |
denotes |
normally |
| T14880 |
28119-28121 |
IN |
denotes |
to |
| T14881 |
28122-28125 |
DT |
denotes |
the |
| T14883 |
28126-28128 |
NN |
denotes |
XY |
| T14882 |
28129-28133 |
NN |
denotes |
body |
| T14884 |
28134-28136 |
IN |
denotes |
of |
| T14885 |
28137-28142 |
NN |
denotes |
DMRT7 |
| T14887 |
28143-28149 |
NN |
denotes |
mutant |
| T14886 |
28150-28155 |
NNS |
denotes |
cells |
| T14888 |
28156-28158 |
IN |
denotes |
in |
| T14889 |
28159-28166 |
JJ |
denotes |
meiotic |
| T14890 |
28167-28174 |
NNS |
denotes |
spreads |
| T14891 |
28175-28176 |
-LRB- |
denotes |
( |
| T14893 |
28176-28182 |
NN |
denotes |
Figure |
| T14892 |
28183-28185 |
NN |
denotes |
7A |
| T14894 |
28185-28186 |
-RRB- |
denotes |
) |
| T14895 |
28186-28188 |
, |
denotes |
, |
| T14896 |
28188-28191 |
CC |
denotes |
and |
| T14897 |
28192-28196 |
JJ |
denotes |
many |
| T14899 |
28197-28202 |
NN |
denotes |
γH2AX |
| T14901 |
28202-28203 |
HYPH |
denotes |
- |
| T14900 |
28203-28211 |
JJ |
denotes |
positive |
| T14898 |
28212-28218 |
NNS |
denotes |
puncta |
| T14902 |
28219-28223 |
VBD |
denotes |
were |
| T14903 |
28224-28231 |
JJ |
denotes |
present |
| T14904 |
28232-28234 |
IN |
denotes |
in |
| T14905 |
28235-28239 |
NN |
denotes |
germ |
| T14906 |
28240-28245 |
NNS |
denotes |
cells |
| T14907 |
28246-28248 |
IN |
denotes |
of |
| T14908 |
28249-28254 |
NN |
denotes |
Dmrt7 |
| T14909 |
28255-28261 |
NN |
denotes |
mutant |
| T14910 |
28262-28268 |
NNS |
denotes |
testes |
| T14911 |
28269-28270 |
-LRB- |
denotes |
( |
| T14913 |
28270-28276 |
NN |
denotes |
Figure |
| T14912 |
28277-28279 |
NN |
denotes |
7B |
| T14914 |
28279-28280 |
-RRB- |
denotes |
) |
| T14915 |
28280-28281 |
. |
denotes |
. |
| T14916 |
28281-28341 |
sentence |
denotes |
Next, we examined SUMO-1 localization in the mutant testis. |
| T14917 |
28282-28286 |
RB |
denotes |
Next |
| T14919 |
28286-28288 |
, |
denotes |
, |
| T14920 |
28288-28290 |
PRP |
denotes |
we |
| T14918 |
28291-28299 |
VBD |
denotes |
examined |
| T14921 |
28300-28304 |
NN |
denotes |
SUMO |
| T14923 |
28304-28305 |
HYPH |
denotes |
- |
| T14924 |
28305-28306 |
CD |
denotes |
1 |
| T14922 |
28307-28319 |
NN |
denotes |
localization |
| T14925 |
28320-28322 |
IN |
denotes |
in |
| T14926 |
28323-28326 |
DT |
denotes |
the |
| T14928 |
28327-28333 |
NN |
denotes |
mutant |
| T14927 |
28334-28340 |
NN |
denotes |
testis |
| T14929 |
28340-28341 |
. |
denotes |
. |
| T14930 |
28341-28478 |
sentence |
denotes |
SUMO-1 expression normally increases in the XY body of early- to mid-pachytene spermatocytes at the time of sex chromosome condensation. |
| T14931 |
28342-28346 |
NN |
denotes |
SUMO |
| T14933 |
28346-28347 |
HYPH |
denotes |
- |
| T14934 |
28347-28348 |
CD |
denotes |
1 |
| T14932 |
28349-28359 |
NN |
denotes |
expression |
| T14936 |
28360-28368 |
RB |
denotes |
normally |
| T14935 |
28369-28378 |
VBZ |
denotes |
increases |
| T14937 |
28379-28381 |
IN |
denotes |
in |
| T14938 |
28382-28385 |
DT |
denotes |
the |
| T14940 |
28386-28388 |
NN |
denotes |
XY |
| T14939 |
28389-28393 |
NN |
denotes |
body |
| T14941 |
28394-28396 |
IN |
denotes |
of |
| T14942 |
28397-28402 |
JJ |
denotes |
early |
| T14944 |
28402-28403 |
HYPH |
denotes |
- |
| T14945 |
28404-28406 |
IN |
denotes |
to |
| T14946 |
28407-28420 |
NN |
denotes |
mid-pachytene |
| T14943 |
28421-28434 |
NNS |
denotes |
spermatocytes |
| T14947 |
28435-28437 |
IN |
denotes |
at |
| T14948 |
28438-28441 |
DT |
denotes |
the |
| T14949 |
28442-28446 |
NN |
denotes |
time |
| T14950 |
28447-28449 |
IN |
denotes |
of |
| T14951 |
28450-28453 |
NN |
denotes |
sex |
| T14952 |
28454-28464 |
NN |
denotes |
chromosome |
| T14953 |
28465-28477 |
NN |
denotes |
condensation |
| T14954 |
28477-28478 |
. |
denotes |
. |
| T14955 |
28478-28611 |
sentence |
denotes |
Prior to the completion of the first meiotic division, SUMO-1 disappears from the XY body as the X and Y chromosomes desynapse [40]. |
| T14956 |
28479-28484 |
IN |
denotes |
Prior |
| T14958 |
28485-28487 |
IN |
denotes |
to |
| T14959 |
28488-28491 |
DT |
denotes |
the |
| T14960 |
28492-28502 |
NN |
denotes |
completion |
| T14961 |
28503-28505 |
IN |
denotes |
of |
| T14962 |
28506-28509 |
DT |
denotes |
the |
| T14964 |
28510-28515 |
JJ |
denotes |
first |
| T14965 |
28516-28523 |
JJ |
denotes |
meiotic |
| T14963 |
28524-28532 |
NN |
denotes |
division |
| T14966 |
28532-28534 |
, |
denotes |
, |
| T14967 |
28534-28538 |
NN |
denotes |
SUMO |
| T14968 |
28538-28539 |
HYPH |
denotes |
- |
| T14969 |
28539-28540 |
CD |
denotes |
1 |
| T14957 |
28541-28551 |
VBZ |
denotes |
disappears |
| T14970 |
28552-28556 |
IN |
denotes |
from |
| T14971 |
28557-28560 |
DT |
denotes |
the |
| T14973 |
28561-28563 |
NN |
denotes |
XY |
| T14972 |
28564-28568 |
NN |
denotes |
body |
| T14974 |
28569-28571 |
IN |
denotes |
as |
| T14976 |
28572-28575 |
DT |
denotes |
the |
| T14978 |
28576-28577 |
NN |
denotes |
X |
| T14979 |
28578-28581 |
CC |
denotes |
and |
| T14980 |
28582-28583 |
NN |
denotes |
Y |
| T14977 |
28584-28595 |
NNS |
denotes |
chromosomes |
| T14975 |
28596-28605 |
VBP |
denotes |
desynapse |
| T14981 |
28606-28607 |
-LRB- |
denotes |
[ |
| T14982 |
28607-28609 |
CD |
denotes |
40 |
| T14983 |
28609-28610 |
-RRB- |
denotes |
] |
| T14984 |
28610-28611 |
. |
denotes |
. |
| T14985 |
28611-28755 |
sentence |
denotes |
Punctate SUMO-1 localization was present in Dmrt7 mutant germ cells, again consistent with formation of a correctly marked XY body (Figure 7C). |
| T14986 |
28612-28620 |
JJ |
denotes |
Punctate |
| T14988 |
28621-28625 |
NN |
denotes |
SUMO |
| T14989 |
28625-28626 |
HYPH |
denotes |
- |
| T14990 |
28626-28627 |
CD |
denotes |
1 |
| T14987 |
28628-28640 |
NN |
denotes |
localization |
| T14991 |
28641-28644 |
VBD |
denotes |
was |
| T14992 |
28645-28652 |
JJ |
denotes |
present |
| T14993 |
28653-28655 |
IN |
denotes |
in |
| T14994 |
28656-28661 |
NN |
denotes |
Dmrt7 |
| T14996 |
28662-28668 |
NN |
denotes |
mutant |
| T14997 |
28669-28673 |
NN |
denotes |
germ |
| T14995 |
28674-28679 |
NNS |
denotes |
cells |
| T14998 |
28679-28681 |
, |
denotes |
, |
| T14999 |
28681-28686 |
RB |
denotes |
again |
| T15000 |
28687-28697 |
JJ |
denotes |
consistent |
| T15001 |
28698-28702 |
IN |
denotes |
with |
| T15002 |
28703-28712 |
NN |
denotes |
formation |
| T15003 |
28713-28715 |
IN |
denotes |
of |
| T15004 |
28716-28717 |
DT |
denotes |
a |
| T15006 |
28718-28727 |
RB |
denotes |
correctly |
| T15007 |
28728-28734 |
JJ |
denotes |
marked |
| T15008 |
28735-28737 |
NN |
denotes |
XY |
| T15005 |
28738-28742 |
NN |
denotes |
body |
| T15009 |
28743-28744 |
-LRB- |
denotes |
( |
| T15011 |
28744-28750 |
NN |
denotes |
Figure |
| T15010 |
28751-28753 |
NN |
denotes |
7C |
| T15012 |
28753-28754 |
-RRB- |
denotes |
) |
| T15013 |
28754-28755 |
. |
denotes |
. |
| T15014 |
28755-28904 |
sentence |
denotes |
However, some tubules in mutants had multiple layers of cells with SUMO-1-condensed spots (Figure 7C), rather than the normal single layer of cells. |
| T15015 |
28756-28763 |
RB |
denotes |
However |
| T15017 |
28763-28765 |
, |
denotes |
, |
| T15018 |
28765-28769 |
DT |
denotes |
some |
| T15019 |
28770-28777 |
NNS |
denotes |
tubules |
| T15020 |
28778-28780 |
IN |
denotes |
in |
| T15021 |
28781-28788 |
NNS |
denotes |
mutants |
| T15016 |
28789-28792 |
VBD |
denotes |
had |
| T15022 |
28793-28801 |
JJ |
denotes |
multiple |
| T15023 |
28802-28808 |
NNS |
denotes |
layers |
| T15024 |
28809-28811 |
IN |
denotes |
of |
| T15025 |
28812-28817 |
NNS |
denotes |
cells |
| T15026 |
28818-28822 |
IN |
denotes |
with |
| T15027 |
28823-28827 |
NN |
denotes |
SUMO |
| T15029 |
28827-28828 |
HYPH |
denotes |
- |
| T15030 |
28828-28829 |
CD |
denotes |
1 |
| T15031 |
28829-28830 |
HYPH |
denotes |
- |
| T15028 |
28830-28839 |
VBN |
denotes |
condensed |
| T15032 |
28840-28845 |
NNS |
denotes |
spots |
| T15033 |
28846-28847 |
-LRB- |
denotes |
( |
| T15035 |
28847-28853 |
NN |
denotes |
Figure |
| T15034 |
28854-28856 |
NN |
denotes |
7C |
| T15036 |
28856-28857 |
-RRB- |
denotes |
) |
| T15037 |
28857-28859 |
, |
denotes |
, |
| T15038 |
28859-28865 |
RB |
denotes |
rather |
| T15039 |
28866-28870 |
IN |
denotes |
than |
| T15040 |
28871-28874 |
DT |
denotes |
the |
| T15042 |
28875-28881 |
JJ |
denotes |
normal |
| T15043 |
28882-28888 |
JJ |
denotes |
single |
| T15041 |
28889-28894 |
NN |
denotes |
layer |
| T15044 |
28895-28897 |
IN |
denotes |
of |
| T15045 |
28898-28903 |
NNS |
denotes |
cells |
| T15046 |
28903-28904 |
. |
denotes |
. |
| T15047 |
28904-29077 |
sentence |
denotes |
This accumulation of XY body–containing cells also was apparent with γH2AX staining and is consistent with a developmental arrest of mutant cells in mid- to late-pachytene. |
| T15048 |
28905-28909 |
DT |
denotes |
This |
| T15049 |
28910-28922 |
NN |
denotes |
accumulation |
| T15051 |
28923-28925 |
IN |
denotes |
of |
| T15052 |
28926-28928 |
NN |
denotes |
XY |
| T15053 |
28929-28933 |
NN |
denotes |
body |
| T15055 |
28933-28934 |
HYPH |
denotes |
– |
| T15054 |
28934-28944 |
VBG |
denotes |
containing |
| T15056 |
28945-28950 |
NNS |
denotes |
cells |
| T15057 |
28951-28955 |
RB |
denotes |
also |
| T15050 |
28956-28959 |
VBD |
denotes |
was |
| T15058 |
28960-28968 |
JJ |
denotes |
apparent |
| T15059 |
28969-28973 |
IN |
denotes |
with |
| T15060 |
28974-28979 |
NN |
denotes |
γH2AX |
| T15061 |
28980-28988 |
NN |
denotes |
staining |
| T15062 |
28989-28992 |
CC |
denotes |
and |
| T15063 |
28993-28995 |
VBZ |
denotes |
is |
| T15064 |
28996-29006 |
JJ |
denotes |
consistent |
| T15065 |
29007-29011 |
IN |
denotes |
with |
| T15066 |
29012-29013 |
DT |
denotes |
a |
| T15068 |
29014-29027 |
JJ |
denotes |
developmental |
| T15067 |
29028-29034 |
NN |
denotes |
arrest |
| T15069 |
29035-29037 |
IN |
denotes |
of |
| T15070 |
29038-29044 |
NN |
denotes |
mutant |
| T15071 |
29045-29050 |
NNS |
denotes |
cells |
| T15072 |
29051-29053 |
IN |
denotes |
in |
| T15073 |
29054-29057 |
JJ |
denotes |
mid |
| T15075 |
29057-29058 |
HYPH |
denotes |
- |
| T15076 |
29059-29061 |
IN |
denotes |
to |
| T15077 |
29062-29066 |
JJ |
denotes |
late |
| T15078 |
29066-29067 |
HYPH |
denotes |
- |
| T15074 |
29067-29076 |
NN |
denotes |
pachytene |
| T15079 |
29076-29077 |
. |
denotes |
. |
| T15080 |
29077-29138 |
sentence |
denotes |
We also examined Ub-H2A localization in Dmrt7 mutant testes. |
| T15081 |
29078-29080 |
PRP |
denotes |
We |
| T15083 |
29081-29085 |
RB |
denotes |
also |
| T15082 |
29086-29094 |
VBD |
denotes |
examined |
| T15084 |
29095-29097 |
NN |
denotes |
Ub |
| T15086 |
29097-29098 |
HYPH |
denotes |
- |
| T15085 |
29098-29101 |
NN |
denotes |
H2A |
| T15087 |
29102-29114 |
NN |
denotes |
localization |
| T15088 |
29115-29117 |
IN |
denotes |
in |
| T15089 |
29118-29123 |
NN |
denotes |
Dmrt7 |
| T15090 |
29124-29130 |
NN |
denotes |
mutant |
| T15091 |
29131-29137 |
NNS |
denotes |
testes |
| T15092 |
29137-29138 |
. |
denotes |
. |
| T15093 |
29138-29346 |
sentence |
denotes |
In early-pachytene, Ub-H2A is concentrated in the XY body; by mid-pachytene Ub-H2A is observed throughout the entire nucleus, but it again becomes limited to the XY body in late-pachytene spermatocytes [13]. |
| T15094 |
29139-29141 |
IN |
denotes |
In |
| T15096 |
29142-29147 |
JJ |
denotes |
early |
| T15098 |
29147-29148 |
HYPH |
denotes |
- |
| T15097 |
29148-29157 |
NN |
denotes |
pachytene |
| T15099 |
29157-29159 |
, |
denotes |
, |
| T15100 |
29159-29161 |
NN |
denotes |
Ub |
| T15102 |
29161-29162 |
HYPH |
denotes |
- |
| T15101 |
29162-29165 |
NN |
denotes |
H2A |
| T15103 |
29166-29168 |
VBZ |
denotes |
is |
| T15095 |
29169-29181 |
VBN |
denotes |
concentrated |
| T15105 |
29182-29184 |
IN |
denotes |
in |
| T15106 |
29185-29188 |
DT |
denotes |
the |
| T15108 |
29189-29191 |
NN |
denotes |
XY |
| T15107 |
29192-29196 |
NN |
denotes |
body |
| T15109 |
29196-29197 |
: |
denotes |
; |
| T15110 |
29198-29200 |
IN |
denotes |
by |
| T15111 |
29201-29214 |
NN |
denotes |
mid-pachytene |
| T15112 |
29215-29217 |
NN |
denotes |
Ub |
| T15114 |
29217-29218 |
HYPH |
denotes |
- |
| T15113 |
29218-29221 |
NN |
denotes |
H2A |
| T15115 |
29222-29224 |
VBZ |
denotes |
is |
| T15104 |
29225-29233 |
VBN |
denotes |
observed |
| T15116 |
29234-29244 |
IN |
denotes |
throughout |
| T15117 |
29245-29248 |
DT |
denotes |
the |
| T15119 |
29249-29255 |
JJ |
denotes |
entire |
| T15118 |
29256-29263 |
NN |
denotes |
nucleus |
| T15120 |
29263-29265 |
, |
denotes |
, |
| T15121 |
29265-29268 |
CC |
denotes |
but |
| T15122 |
29269-29271 |
PRP |
denotes |
it |
| T15124 |
29272-29277 |
RB |
denotes |
again |
| T15123 |
29278-29285 |
VBZ |
denotes |
becomes |
| T15125 |
29286-29293 |
JJ |
denotes |
limited |
| T15126 |
29294-29296 |
IN |
denotes |
to |
| T15127 |
29297-29300 |
DT |
denotes |
the |
| T15129 |
29301-29303 |
NN |
denotes |
XY |
| T15128 |
29304-29308 |
NN |
denotes |
body |
| T15130 |
29309-29311 |
IN |
denotes |
in |
| T15131 |
29312-29316 |
JJ |
denotes |
late |
| T15133 |
29316-29317 |
HYPH |
denotes |
- |
| T15132 |
29317-29326 |
NN |
denotes |
pachytene |
| T15134 |
29327-29340 |
NNS |
denotes |
spermatocytes |
| T15135 |
29341-29342 |
-LRB- |
denotes |
[ |
| T15136 |
29342-29344 |
CD |
denotes |
13 |
| T15137 |
29344-29345 |
-RRB- |
denotes |
] |
| T15138 |
29345-29346 |
. |
denotes |
. |
| T15139 |
29346-29459 |
sentence |
denotes |
Analysis of nuclear spreads revealed that Ub-H2A localizes normally to the XY body in Dmrt7 mutants (Figure S4). |
| T15140 |
29347-29355 |
NN |
denotes |
Analysis |
| T15142 |
29356-29358 |
IN |
denotes |
of |
| T15143 |
29359-29366 |
JJ |
denotes |
nuclear |
| T15144 |
29367-29374 |
NNS |
denotes |
spreads |
| T15141 |
29375-29383 |
VBD |
denotes |
revealed |
| T15145 |
29384-29388 |
IN |
denotes |
that |
| T15147 |
29389-29391 |
NN |
denotes |
Ub |
| T15149 |
29391-29392 |
HYPH |
denotes |
- |
| T15148 |
29392-29395 |
NN |
denotes |
H2A |
| T15146 |
29396-29405 |
VBZ |
denotes |
localizes |
| T15150 |
29406-29414 |
RB |
denotes |
normally |
| T15151 |
29415-29417 |
IN |
denotes |
to |
| T15152 |
29418-29421 |
DT |
denotes |
the |
| T15154 |
29422-29424 |
NN |
denotes |
XY |
| T15153 |
29425-29429 |
NN |
denotes |
body |
| T15155 |
29430-29432 |
IN |
denotes |
in |
| T15156 |
29433-29438 |
NN |
denotes |
Dmrt7 |
| T15157 |
29439-29446 |
NNS |
denotes |
mutants |
| T15158 |
29447-29448 |
-LRB- |
denotes |
( |
| T15160 |
29448-29454 |
NN |
denotes |
Figure |
| T15159 |
29455-29457 |
NN |
denotes |
S4 |
| T15161 |
29457-29458 |
-RRB- |
denotes |
) |
| T15162 |
29458-29459 |
. |
denotes |
. |
| T15163 |
29459-29600 |
sentence |
denotes |
Collectively, these results indicate that Dmrt7 mutant germ cells can establish an XY body with at least some of the normal chromatin marks. |
| T15164 |
29460-29472 |
RB |
denotes |
Collectively |
| T15166 |
29472-29474 |
, |
denotes |
, |
| T15167 |
29474-29479 |
DT |
denotes |
these |
| T15168 |
29480-29487 |
NNS |
denotes |
results |
| T15165 |
29488-29496 |
VBP |
denotes |
indicate |
| T15169 |
29497-29501 |
IN |
denotes |
that |
| T15171 |
29502-29507 |
NN |
denotes |
Dmrt7 |
| T15173 |
29508-29514 |
NN |
denotes |
mutant |
| T15174 |
29515-29519 |
NN |
denotes |
germ |
| T15172 |
29520-29525 |
NNS |
denotes |
cells |
| T15175 |
29526-29529 |
MD |
denotes |
can |
| T15170 |
29530-29539 |
VB |
denotes |
establish |
| T15176 |
29540-29542 |
DT |
denotes |
an |
| T15178 |
29543-29545 |
NN |
denotes |
XY |
| T15177 |
29546-29550 |
NN |
denotes |
body |
| T15179 |
29551-29555 |
IN |
denotes |
with |
| T15180 |
29556-29558 |
RB |
denotes |
at |
| T15181 |
29559-29564 |
RBS |
denotes |
least |
| T15182 |
29565-29569 |
DT |
denotes |
some |
| T15183 |
29570-29572 |
IN |
denotes |
of |
| T15184 |
29573-29576 |
DT |
denotes |
the |
| T15186 |
29577-29583 |
JJ |
denotes |
normal |
| T15187 |
29584-29593 |
NN |
denotes |
chromatin |
| T15185 |
29594-29599 |
NNS |
denotes |
marks |
| T15188 |
29599-29600 |
. |
denotes |
. |
| T30803 |
29611-29613 |
NN |
denotes |
XY |
| T30804 |
29614-29618 |
NN |
denotes |
Body |
| T30805 |
29619-29624 |
VBZ |
denotes |
Forms |
| T30806 |
29625-29633 |
RB |
denotes |
Normally |
| T30807 |
29634-29640 |
IN |
denotes |
during |
| T30808 |
29641-29650 |
NN |
denotes |
Pachynema |
| T30809 |
29651-29653 |
IN |
denotes |
in |
| T30810 |
29654-29659 |
NN |
denotes |
Dmrt7 |
| T30811 |
29660-29666 |
NN |
denotes |
Mutant |
| T30812 |
29667-29671 |
NNS |
denotes |
Mice |
| T30813 |
29671-29761 |
sentence |
denotes |
(A) Testicular cells spread and stained with antibodies to γH2AX (red) and SYCP3 (green). |
| T30814 |
29672-29673 |
-LRB- |
denotes |
( |
| T30816 |
29673-29674 |
LS |
denotes |
A |
| T30817 |
29674-29675 |
-RRB- |
denotes |
) |
| T30818 |
29676-29686 |
JJ |
denotes |
Testicular |
| T30815 |
29687-29692 |
NNS |
denotes |
cells |
| T30819 |
29693-29699 |
VBN |
denotes |
spread |
| T30820 |
29700-29703 |
CC |
denotes |
and |
| T30821 |
29704-29711 |
VBN |
denotes |
stained |
| T30822 |
29712-29716 |
IN |
denotes |
with |
| T30823 |
29717-29727 |
NNS |
denotes |
antibodies |
| T30824 |
29728-29730 |
IN |
denotes |
to |
| T30825 |
29731-29736 |
NN |
denotes |
γH2AX |
| T30826 |
29737-29738 |
-LRB- |
denotes |
( |
| T30827 |
29738-29741 |
JJ |
denotes |
red |
| T30828 |
29741-29742 |
-RRB- |
denotes |
) |
| T30829 |
29743-29746 |
CC |
denotes |
and |
| T30830 |
29747-29752 |
NN |
denotes |
SYCP3 |
| T30831 |
29753-29754 |
-LRB- |
denotes |
( |
| T30832 |
29754-29759 |
JJ |
denotes |
green |
| T30833 |
29759-29760 |
-RRB- |
denotes |
) |
| T30834 |
29760-29761 |
. |
denotes |
. |
| T30835 |
29761-29854 |
sentence |
denotes |
In pachytene cells, γH2AX is concentrated in the XY body both in wild-type and Dmrt7 mutant. |
| T30836 |
29762-29764 |
IN |
denotes |
In |
| T30838 |
29765-29774 |
NN |
denotes |
pachytene |
| T30839 |
29775-29780 |
NNS |
denotes |
cells |
| T30840 |
29780-29782 |
, |
denotes |
, |
| T30841 |
29782-29787 |
NN |
denotes |
γH2AX |
| T30842 |
29788-29790 |
VBZ |
denotes |
is |
| T30837 |
29791-29803 |
VBN |
denotes |
concentrated |
| T30843 |
29804-29806 |
IN |
denotes |
in |
| T30844 |
29807-29810 |
DT |
denotes |
the |
| T30846 |
29811-29813 |
NN |
denotes |
XY |
| T30845 |
29814-29818 |
NN |
denotes |
body |
| T30847 |
29819-29823 |
CC |
denotes |
both |
| T30848 |
29824-29826 |
IN |
denotes |
in |
| T30849 |
29827-29831 |
JJ |
denotes |
wild |
| T30851 |
29831-29832 |
HYPH |
denotes |
- |
| T30850 |
29832-29836 |
NN |
denotes |
type |
| T30852 |
29837-29840 |
CC |
denotes |
and |
| T30853 |
29841-29846 |
NN |
denotes |
Dmrt7 |
| T30854 |
29847-29853 |
NN |
denotes |
mutant |
| T30855 |
29853-29854 |
. |
denotes |
. |
| T30856 |
29854-29936 |
sentence |
denotes |
(B) Testes from 6-wk-old mice sectioned and stained with antibody to γH2AX (red). |
| T30857 |
29855-29856 |
-LRB- |
denotes |
( |
| T30858 |
29856-29857 |
LS |
denotes |
B |
| T30860 |
29857-29858 |
-RRB- |
denotes |
) |
| T30859 |
29859-29865 |
NNS |
denotes |
Testes |
| T30861 |
29866-29870 |
IN |
denotes |
from |
| T30862 |
29871-29872 |
CD |
denotes |
6 |
| T30864 |
29872-29873 |
HYPH |
denotes |
- |
| T30863 |
29873-29875 |
NN |
denotes |
wk |
| T30866 |
29875-29876 |
HYPH |
denotes |
- |
| T30865 |
29876-29879 |
JJ |
denotes |
old |
| T30867 |
29880-29884 |
NNS |
denotes |
mice |
| T30868 |
29885-29894 |
VBN |
denotes |
sectioned |
| T30869 |
29895-29898 |
CC |
denotes |
and |
| T30870 |
29899-29906 |
VBN |
denotes |
stained |
| T30871 |
29907-29911 |
IN |
denotes |
with |
| T30872 |
29912-29920 |
NN |
denotes |
antibody |
| T30873 |
29921-29923 |
IN |
denotes |
to |
| T30874 |
29924-29929 |
NN |
denotes |
γH2AX |
| T30875 |
29930-29931 |
-LRB- |
denotes |
( |
| T30876 |
29931-29934 |
JJ |
denotes |
red |
| T30877 |
29934-29935 |
-RRB- |
denotes |
) |
| T30878 |
29935-29936 |
. |
denotes |
. |
| T30879 |
29936-30021 |
sentence |
denotes |
(C) Testes from 6-wk-old mice sectioned and stained with antibody to SUMO-1 (green). |
| T30880 |
29937-29938 |
-LRB- |
denotes |
( |
| T30881 |
29938-29939 |
LS |
denotes |
C |
| T30883 |
29939-29940 |
-RRB- |
denotes |
) |
| T30882 |
29941-29947 |
NNS |
denotes |
Testes |
| T30884 |
29948-29952 |
IN |
denotes |
from |
| T30885 |
29953-29954 |
CD |
denotes |
6 |
| T30887 |
29954-29955 |
HYPH |
denotes |
- |
| T30886 |
29955-29957 |
NN |
denotes |
wk |
| T30889 |
29957-29958 |
HYPH |
denotes |
- |
| T30888 |
29958-29961 |
JJ |
denotes |
old |
| T30890 |
29962-29966 |
NNS |
denotes |
mice |
| T30891 |
29967-29976 |
VBN |
denotes |
sectioned |
| T30892 |
29977-29980 |
CC |
denotes |
and |
| T30893 |
29981-29988 |
VBN |
denotes |
stained |
| T30894 |
29989-29993 |
IN |
denotes |
with |
| T30895 |
29994-30002 |
NN |
denotes |
antibody |
| T30896 |
30003-30005 |
IN |
denotes |
to |
| T30897 |
30006-30010 |
NN |
denotes |
SUMO |
| T30898 |
30010-30011 |
HYPH |
denotes |
- |
| T30899 |
30011-30012 |
CD |
denotes |
1 |
| T30900 |
30013-30014 |
-LRB- |
denotes |
( |
| T30901 |
30014-30019 |
JJ |
denotes |
green |
| T30902 |
30019-30020 |
-RRB- |
denotes |
) |
| T30903 |
30020-30021 |
. |
denotes |
. |
| T30904 |
30021-30105 |
sentence |
denotes |
Abundant pachytene cells with XY bodies are present in wild-type and mutant testes. |
| T30905 |
30022-30030 |
JJ |
denotes |
Abundant |
| T30907 |
30031-30040 |
NN |
denotes |
pachytene |
| T30906 |
30041-30046 |
NNS |
denotes |
cells |
| T30909 |
30047-30051 |
IN |
denotes |
with |
| T30910 |
30052-30054 |
NN |
denotes |
XY |
| T30911 |
30055-30061 |
NNS |
denotes |
bodies |
| T30908 |
30062-30065 |
VBP |
denotes |
are |
| T30912 |
30066-30073 |
JJ |
denotes |
present |
| T30913 |
30074-30076 |
IN |
denotes |
in |
| T30914 |
30077-30081 |
JJ |
denotes |
wild |
| T30916 |
30081-30082 |
HYPH |
denotes |
- |
| T30915 |
30082-30086 |
NN |
denotes |
type |
| T30918 |
30087-30090 |
CC |
denotes |
and |
| T30919 |
30091-30097 |
NN |
denotes |
mutant |
| T30917 |
30098-30104 |
NNS |
denotes |
testes |
| T30920 |
30104-30105 |
. |
denotes |
. |
| T17284 |
30107-30115 |
JJ |
denotes |
Abnormal |
| T17286 |
30116-30119 |
NN |
denotes |
Sex |
| T17285 |
30120-30129 |
NN |
denotes |
Chromatin |
| T17287 |
30130-30132 |
IN |
denotes |
in |
| T17288 |
30133-30138 |
NN |
denotes |
Dmrt7 |
| T17289 |
30139-30145 |
NN |
denotes |
Mutant |
| T17291 |
30146-30150 |
NN |
denotes |
Germ |
| T17290 |
30151-30156 |
NNS |
denotes |
Cells |
| T17292 |
30156-30317 |
sentence |
denotes |
Although the XY body can form during pachynema in Dmrt7 mutants, we considered the possibility that transcriptional silencing might not be properly established. |
| T17293 |
30157-30165 |
IN |
denotes |
Although |
| T17295 |
30166-30169 |
DT |
denotes |
the |
| T17297 |
30170-30172 |
NN |
denotes |
XY |
| T17296 |
30173-30177 |
NN |
denotes |
body |
| T17298 |
30178-30181 |
MD |
denotes |
can |
| T17294 |
30182-30186 |
VB |
denotes |
form |
| T17300 |
30187-30193 |
IN |
denotes |
during |
| T17301 |
30194-30203 |
NN |
denotes |
pachynema |
| T17302 |
30204-30206 |
IN |
denotes |
in |
| T17303 |
30207-30212 |
NN |
denotes |
Dmrt7 |
| T17304 |
30213-30220 |
NNS |
denotes |
mutants |
| T17305 |
30220-30222 |
, |
denotes |
, |
| T17306 |
30222-30224 |
PRP |
denotes |
we |
| T17299 |
30225-30235 |
VBD |
denotes |
considered |
| T17307 |
30236-30239 |
DT |
denotes |
the |
| T17308 |
30240-30251 |
NN |
denotes |
possibility |
| T17309 |
30252-30256 |
IN |
denotes |
that |
| T17311 |
30257-30272 |
JJ |
denotes |
transcriptional |
| T17312 |
30273-30282 |
NN |
denotes |
silencing |
| T17313 |
30283-30288 |
MD |
denotes |
might |
| T17314 |
30289-30292 |
RB |
denotes |
not |
| T17315 |
30293-30295 |
VB |
denotes |
be |
| T17316 |
30296-30304 |
RB |
denotes |
properly |
| T17310 |
30305-30316 |
VBN |
denotes |
established |
| T17317 |
30316-30317 |
. |
denotes |
. |
| T17318 |
30317-30460 |
sentence |
denotes |
This would be consistent with the Dmrt7 phenotype: pachytene cells that escape from MSCI normally are eliminated prior to late-pachytene [17]. |
| T17319 |
30318-30322 |
DT |
denotes |
This |
| T17321 |
30323-30328 |
MD |
denotes |
would |
| T17320 |
30329-30331 |
VB |
denotes |
be |
| T17323 |
30332-30342 |
JJ |
denotes |
consistent |
| T17324 |
30343-30347 |
IN |
denotes |
with |
| T17325 |
30348-30351 |
DT |
denotes |
the |
| T17327 |
30352-30357 |
NN |
denotes |
Dmrt7 |
| T17326 |
30358-30367 |
NN |
denotes |
phenotype |
| T17328 |
30367-30369 |
: |
denotes |
: |
| T17329 |
30369-30378 |
NN |
denotes |
pachytene |
| T17330 |
30379-30384 |
NNS |
denotes |
cells |
| T17331 |
30385-30389 |
WDT |
denotes |
that |
| T17332 |
30390-30396 |
VBP |
denotes |
escape |
| T17333 |
30397-30401 |
IN |
denotes |
from |
| T17334 |
30402-30406 |
NN |
denotes |
MSCI |
| T17335 |
30407-30415 |
RB |
denotes |
normally |
| T17336 |
30416-30419 |
VBP |
denotes |
are |
| T17322 |
30420-30430 |
VBN |
denotes |
eliminated |
| T17337 |
30431-30436 |
IN |
denotes |
prior |
| T17338 |
30437-30439 |
IN |
denotes |
to |
| T17339 |
30440-30444 |
JJ |
denotes |
late |
| T17341 |
30444-30445 |
HYPH |
denotes |
- |
| T17340 |
30445-30454 |
NN |
denotes |
pachytene |
| T17342 |
30455-30456 |
-LRB- |
denotes |
[ |
| T17343 |
30456-30458 |
CD |
denotes |
17 |
| T17344 |
30458-30459 |
-RRB- |
denotes |
] |
| T17345 |
30459-30460 |
. |
denotes |
. |
| T17346 |
30460-30682 |
sentence |
denotes |
Recently, MSCI has been shown to continue into meiosis II and spermiogenesis, apparently mediated by a distinct chromatin compartment termed postmeiotic sex chromatin (PMSC) that is established starting in diplonema [16]. |
| T17347 |
30461-30469 |
RB |
denotes |
Recently |
| T17349 |
30469-30471 |
, |
denotes |
, |
| T17350 |
30471-30475 |
NN |
denotes |
MSCI |
| T17351 |
30476-30479 |
VBZ |
denotes |
has |
| T17352 |
30480-30484 |
VBN |
denotes |
been |
| T17348 |
30485-30490 |
VBN |
denotes |
shown |
| T17353 |
30491-30493 |
TO |
denotes |
to |
| T17354 |
30494-30502 |
VB |
denotes |
continue |
| T17355 |
30503-30507 |
IN |
denotes |
into |
| T17356 |
30508-30515 |
NN |
denotes |
meiosis |
| T17357 |
30516-30518 |
CD |
denotes |
II |
| T17358 |
30519-30522 |
CC |
denotes |
and |
| T17359 |
30523-30537 |
NN |
denotes |
spermiogenesis |
| T17360 |
30537-30539 |
, |
denotes |
, |
| T17361 |
30539-30549 |
RB |
denotes |
apparently |
| T17362 |
30550-30558 |
VBN |
denotes |
mediated |
| T17363 |
30559-30561 |
IN |
denotes |
by |
| T17364 |
30562-30563 |
DT |
denotes |
a |
| T17366 |
30564-30572 |
JJ |
denotes |
distinct |
| T17367 |
30573-30582 |
NN |
denotes |
chromatin |
| T17365 |
30583-30594 |
NN |
denotes |
compartment |
| T17368 |
30595-30601 |
VBN |
denotes |
termed |
| T17369 |
30602-30613 |
JJ |
denotes |
postmeiotic |
| T17371 |
30614-30617 |
NN |
denotes |
sex |
| T17370 |
30618-30627 |
NN |
denotes |
chromatin |
| T17372 |
30628-30629 |
-LRB- |
denotes |
( |
| T17373 |
30629-30633 |
NN |
denotes |
PMSC |
| T17374 |
30633-30634 |
-RRB- |
denotes |
) |
| T17375 |
30635-30639 |
WDT |
denotes |
that |
| T17377 |
30640-30642 |
VBZ |
denotes |
is |
| T17376 |
30643-30654 |
VBN |
denotes |
established |
| T17378 |
30655-30663 |
VBG |
denotes |
starting |
| T17379 |
30664-30666 |
IN |
denotes |
in |
| T17380 |
30667-30676 |
NN |
denotes |
diplonema |
| T17381 |
30677-30678 |
-LRB- |
denotes |
[ |
| T17382 |
30678-30680 |
CD |
denotes |
16 |
| T17383 |
30680-30681 |
-RRB- |
denotes |
] |
| T17384 |
30681-30682 |
. |
denotes |
. |
| T17385 |
30682-30848 |
sentence |
denotes |
We therefore asked whether the pachytene germ cell death in Dmrt7 mutants is associated with a failure either to initiate or to maintain sex chromosome inactivation. |
| T17386 |
30683-30685 |
PRP |
denotes |
We |
| T17388 |
30686-30695 |
RB |
denotes |
therefore |
| T17387 |
30696-30701 |
VBD |
denotes |
asked |
| T17389 |
30702-30709 |
IN |
denotes |
whether |
| T17391 |
30710-30713 |
DT |
denotes |
the |
| T17393 |
30714-30723 |
NN |
denotes |
pachytene |
| T17394 |
30724-30728 |
NN |
denotes |
germ |
| T17395 |
30729-30733 |
NN |
denotes |
cell |
| T17392 |
30734-30739 |
NN |
denotes |
death |
| T17396 |
30740-30742 |
IN |
denotes |
in |
| T17397 |
30743-30748 |
NN |
denotes |
Dmrt7 |
| T17398 |
30749-30756 |
NNS |
denotes |
mutants |
| T17399 |
30757-30759 |
VBZ |
denotes |
is |
| T17390 |
30760-30770 |
VBN |
denotes |
associated |
| T17400 |
30771-30775 |
IN |
denotes |
with |
| T17401 |
30776-30777 |
DT |
denotes |
a |
| T17402 |
30778-30785 |
NN |
denotes |
failure |
| T17403 |
30786-30792 |
CC |
denotes |
either |
| T17405 |
30793-30795 |
TO |
denotes |
to |
| T17404 |
30796-30804 |
VB |
denotes |
initiate |
| T17406 |
30805-30807 |
CC |
denotes |
or |
| T17407 |
30808-30810 |
TO |
denotes |
to |
| T17408 |
30811-30819 |
VB |
denotes |
maintain |
| T17409 |
30820-30823 |
NN |
denotes |
sex |
| T17410 |
30824-30834 |
NN |
denotes |
chromosome |
| T17411 |
30835-30847 |
NN |
denotes |
inactivation |
| T17412 |
30847-30848 |
. |
denotes |
. |
| T17413 |
30848-30894 |
sentence |
denotes |
First, we examined the mid-pachytene XY body. |
| T17414 |
30849-30854 |
RB |
denotes |
First |
| T17416 |
30854-30856 |
, |
denotes |
, |
| T17417 |
30856-30858 |
PRP |
denotes |
we |
| T17415 |
30859-30867 |
VBD |
denotes |
examined |
| T17418 |
30868-30871 |
DT |
denotes |
the |
| T17420 |
30872-30885 |
JJ |
denotes |
mid-pachytene |
| T17421 |
30886-30888 |
NN |
denotes |
XY |
| T17419 |
30889-30893 |
NN |
denotes |
body |
| T17422 |
30893-30894 |
. |
denotes |
. |
| T17423 |
30894-31155 |
sentence |
denotes |
To examine XY transcriptional status, we carried out Cot-1 RNA fluorescence in situ hybridization (FISH) to detect nascent RNA polymerase II transcription, combined with DAPI staining to locate the XY body on spreads of seminiferous tubules (Figure 8A and 8B). |
| T17424 |
30895-30897 |
TO |
denotes |
To |
| T17425 |
30898-30905 |
VB |
denotes |
examine |
| T17427 |
30906-30908 |
NN |
denotes |
XY |
| T17429 |
30909-30924 |
JJ |
denotes |
transcriptional |
| T17428 |
30925-30931 |
NN |
denotes |
status |
| T17430 |
30931-30933 |
, |
denotes |
, |
| T17431 |
30933-30935 |
PRP |
denotes |
we |
| T17426 |
30936-30943 |
VBD |
denotes |
carried |
| T17432 |
30944-30947 |
RP |
denotes |
out |
| T17433 |
30948-30951 |
NN |
denotes |
Cot |
| T17435 |
30951-30952 |
HYPH |
denotes |
- |
| T17436 |
30952-30953 |
CD |
denotes |
1 |
| T17437 |
30954-30957 |
NN |
denotes |
RNA |
| T17438 |
30958-30970 |
NN |
denotes |
fluorescence |
| T17439 |
30971-30973 |
FW |
denotes |
in |
| T17440 |
30974-30978 |
FW |
denotes |
situ |
| T17434 |
30979-30992 |
NN |
denotes |
hybridization |
| T17441 |
30993-30994 |
-LRB- |
denotes |
( |
| T17442 |
30994-30998 |
NN |
denotes |
FISH |
| T17443 |
30998-30999 |
-RRB- |
denotes |
) |
| T17444 |
31000-31002 |
TO |
denotes |
to |
| T17445 |
31003-31009 |
VB |
denotes |
detect |
| T17446 |
31010-31017 |
JJ |
denotes |
nascent |
| T17448 |
31018-31021 |
NN |
denotes |
RNA |
| T17449 |
31022-31032 |
NN |
denotes |
polymerase |
| T17450 |
31033-31035 |
CD |
denotes |
II |
| T17447 |
31036-31049 |
NN |
denotes |
transcription |
| T17451 |
31049-31051 |
, |
denotes |
, |
| T17452 |
31051-31059 |
VBN |
denotes |
combined |
| T17453 |
31060-31064 |
IN |
denotes |
with |
| T17454 |
31065-31069 |
NN |
denotes |
DAPI |
| T17455 |
31070-31078 |
NN |
denotes |
staining |
| T17456 |
31079-31081 |
TO |
denotes |
to |
| T17457 |
31082-31088 |
VB |
denotes |
locate |
| T17458 |
31089-31092 |
DT |
denotes |
the |
| T17460 |
31093-31095 |
NN |
denotes |
XY |
| T17459 |
31096-31100 |
NN |
denotes |
body |
| T17461 |
31101-31103 |
IN |
denotes |
on |
| T17462 |
31104-31111 |
NNS |
denotes |
spreads |
| T17463 |
31112-31114 |
IN |
denotes |
of |
| T17464 |
31115-31127 |
JJ |
denotes |
seminiferous |
| T17465 |
31128-31135 |
NNS |
denotes |
tubules |
| T17466 |
31136-31137 |
-LRB- |
denotes |
( |
| T17468 |
31137-31143 |
NN |
denotes |
Figure |
| T17467 |
31144-31146 |
NN |
denotes |
8A |
| T17469 |
31147-31150 |
CC |
denotes |
and |
| T17470 |
31151-31153 |
NN |
denotes |
8B |
| T17471 |
31153-31154 |
-RRB- |
denotes |
) |
| T17472 |
31154-31155 |
. |
denotes |
. |
| T17473 |
31155-31335 |
sentence |
denotes |
In Dmrt7 mutants, the XY body was formed and excluded Cot-1 hybridization (Figure 8B), indicating that transcriptional silencing is established normally in mutant pachytene cells. |
| T17474 |
31156-31158 |
IN |
denotes |
In |
| T17476 |
31159-31164 |
NN |
denotes |
Dmrt7 |
| T17477 |
31165-31172 |
NNS |
denotes |
mutants |
| T17478 |
31172-31174 |
, |
denotes |
, |
| T17479 |
31174-31177 |
DT |
denotes |
the |
| T17481 |
31178-31180 |
NN |
denotes |
XY |
| T17480 |
31181-31185 |
NN |
denotes |
body |
| T17482 |
31186-31189 |
VBD |
denotes |
was |
| T17475 |
31190-31196 |
VBN |
denotes |
formed |
| T17483 |
31197-31200 |
CC |
denotes |
and |
| T17484 |
31201-31209 |
VBD |
denotes |
excluded |
| T17485 |
31210-31213 |
NN |
denotes |
Cot |
| T17487 |
31213-31214 |
HYPH |
denotes |
- |
| T17488 |
31214-31215 |
CD |
denotes |
1 |
| T17486 |
31216-31229 |
NN |
denotes |
hybridization |
| T17489 |
31230-31231 |
-LRB- |
denotes |
( |
| T17491 |
31231-31237 |
NN |
denotes |
Figure |
| T17490 |
31238-31240 |
NN |
denotes |
8B |
| T17492 |
31240-31241 |
-RRB- |
denotes |
) |
| T17493 |
31241-31243 |
, |
denotes |
, |
| T17494 |
31243-31253 |
VBG |
denotes |
indicating |
| T17495 |
31254-31258 |
IN |
denotes |
that |
| T17497 |
31259-31274 |
JJ |
denotes |
transcriptional |
| T17498 |
31275-31284 |
NN |
denotes |
silencing |
| T17499 |
31285-31287 |
VBZ |
denotes |
is |
| T17496 |
31288-31299 |
VBN |
denotes |
established |
| T17500 |
31300-31308 |
RB |
denotes |
normally |
| T17501 |
31309-31311 |
IN |
denotes |
in |
| T17502 |
31312-31318 |
NN |
denotes |
mutant |
| T17504 |
31319-31328 |
NN |
denotes |
pachytene |
| T17503 |
31329-31334 |
NNS |
denotes |
cells |
| T17505 |
31334-31335 |
. |
denotes |
. |
| T17506 |
31335-31493 |
sentence |
denotes |
We also examined expression of the Y-linked gene Rbmy, which normally is inactivated during pachytene and reactivated after secondary meiosis begins [54,55]. |
| T17507 |
31336-31338 |
PRP |
denotes |
We |
| T17509 |
31339-31343 |
RB |
denotes |
also |
| T17508 |
31344-31352 |
VBD |
denotes |
examined |
| T17510 |
31353-31363 |
NN |
denotes |
expression |
| T17511 |
31364-31366 |
IN |
denotes |
of |
| T17512 |
31367-31370 |
DT |
denotes |
the |
| T17514 |
31371-31372 |
NN |
denotes |
Y |
| T17516 |
31372-31373 |
HYPH |
denotes |
- |
| T17515 |
31373-31379 |
VBN |
denotes |
linked |
| T17513 |
31380-31384 |
NN |
denotes |
gene |
| T17517 |
31385-31389 |
NN |
denotes |
Rbmy |
| T17518 |
31389-31391 |
, |
denotes |
, |
| T17519 |
31391-31396 |
WDT |
denotes |
which |
| T17521 |
31397-31405 |
RB |
denotes |
normally |
| T17522 |
31406-31408 |
VBZ |
denotes |
is |
| T17520 |
31409-31420 |
VBN |
denotes |
inactivated |
| T17523 |
31421-31427 |
IN |
denotes |
during |
| T17524 |
31428-31437 |
NN |
denotes |
pachytene |
| T17525 |
31438-31441 |
CC |
denotes |
and |
| T17526 |
31442-31453 |
VBN |
denotes |
reactivated |
| T17527 |
31454-31459 |
IN |
denotes |
after |
| T17529 |
31460-31469 |
JJ |
denotes |
secondary |
| T17530 |
31470-31477 |
NN |
denotes |
meiosis |
| T17528 |
31478-31484 |
VBZ |
denotes |
begins |
| T17531 |
31485-31486 |
-LRB- |
denotes |
[ |
| T17533 |
31486-31488 |
CD |
denotes |
54 |
| T17534 |
31488-31489 |
, |
denotes |
, |
| T17532 |
31489-31491 |
CD |
denotes |
55 |
| T17535 |
31491-31492 |
-RRB- |
denotes |
] |
| T17536 |
31492-31493 |
. |
denotes |
. |
| T17537 |
31493-31636 |
sentence |
denotes |
Rbmy was inactivated normally in pachytene cells of Dmrt7 mutants, based on immunofluorescent staining with an anti-RBMY antibody (Figure S5). |
| T17538 |
31494-31498 |
NN |
denotes |
Rbmy |
| T17540 |
31499-31502 |
VBD |
denotes |
was |
| T17539 |
31503-31514 |
VBN |
denotes |
inactivated |
| T17541 |
31515-31523 |
RB |
denotes |
normally |
| T17542 |
31524-31526 |
IN |
denotes |
in |
| T17543 |
31527-31536 |
NN |
denotes |
pachytene |
| T17544 |
31537-31542 |
NNS |
denotes |
cells |
| T17545 |
31543-31545 |
IN |
denotes |
of |
| T17546 |
31546-31551 |
NN |
denotes |
Dmrt7 |
| T17547 |
31552-31559 |
NNS |
denotes |
mutants |
| T17548 |
31559-31561 |
, |
denotes |
, |
| T17549 |
31561-31566 |
VBN |
denotes |
based |
| T17550 |
31567-31569 |
IN |
denotes |
on |
| T17551 |
31570-31587 |
JJ |
denotes |
immunofluorescent |
| T17552 |
31588-31596 |
NN |
denotes |
staining |
| T17553 |
31597-31601 |
IN |
denotes |
with |
| T17554 |
31602-31604 |
DT |
denotes |
an |
| T17556 |
31605-31614 |
JJ |
denotes |
anti-RBMY |
| T17555 |
31615-31623 |
NN |
denotes |
antibody |
| T17557 |
31624-31625 |
-LRB- |
denotes |
( |
| T17559 |
31625-31631 |
NN |
denotes |
Figure |
| T17558 |
31632-31634 |
NN |
denotes |
S5 |
| T17560 |
31634-31635 |
-RRB- |
denotes |
) |
| T17561 |
31635-31636 |
. |
denotes |
. |
| T17562 |
31636-31833 |
sentence |
denotes |
We also examined heterochromatin protein 1 beta (HP1β), which normally localizes to the X centromere at mid-pachynema and then spreads through the XY body as it internalizes during diplonema [56]. |
| T17563 |
31637-31639 |
PRP |
denotes |
We |
| T17565 |
31640-31644 |
RB |
denotes |
also |
| T17564 |
31645-31653 |
VBD |
denotes |
examined |
| T17566 |
31654-31669 |
NN |
denotes |
heterochromatin |
| T17568 |
31670-31677 |
NN |
denotes |
protein |
| T17569 |
31678-31679 |
CD |
denotes |
1 |
| T17567 |
31680-31684 |
NN |
denotes |
beta |
| T17570 |
31685-31686 |
-LRB- |
denotes |
( |
| T17571 |
31686-31690 |
NN |
denotes |
HP1β |
| T17572 |
31690-31691 |
-RRB- |
denotes |
) |
| T17573 |
31691-31693 |
, |
denotes |
, |
| T17574 |
31693-31698 |
WDT |
denotes |
which |
| T17576 |
31699-31707 |
RB |
denotes |
normally |
| T17575 |
31708-31717 |
VBZ |
denotes |
localizes |
| T17577 |
31718-31720 |
IN |
denotes |
to |
| T17578 |
31721-31724 |
DT |
denotes |
the |
| T17580 |
31725-31726 |
NN |
denotes |
X |
| T17579 |
31727-31737 |
NN |
denotes |
centromere |
| T17581 |
31738-31740 |
IN |
denotes |
at |
| T17582 |
31741-31754 |
NN |
denotes |
mid-pachynema |
| T17583 |
31755-31758 |
CC |
denotes |
and |
| T17584 |
31759-31763 |
RB |
denotes |
then |
| T17585 |
31764-31771 |
VBZ |
denotes |
spreads |
| T17586 |
31772-31779 |
IN |
denotes |
through |
| T17587 |
31780-31783 |
DT |
denotes |
the |
| T17589 |
31784-31786 |
NN |
denotes |
XY |
| T17588 |
31787-31791 |
NN |
denotes |
body |
| T17590 |
31792-31794 |
IN |
denotes |
as |
| T17592 |
31795-31797 |
PRP |
denotes |
it |
| T17591 |
31798-31810 |
VBZ |
denotes |
internalizes |
| T17593 |
31811-31817 |
IN |
denotes |
during |
| T17594 |
31818-31827 |
NN |
denotes |
diplonema |
| T17595 |
31828-31829 |
-LRB- |
denotes |
[ |
| T17596 |
31829-31831 |
CD |
denotes |
56 |
| T17597 |
31831-31832 |
-RRB- |
denotes |
] |
| T17598 |
31832-31833 |
. |
denotes |
. |
| T17599 |
31833-31934 |
sentence |
denotes |
We found that HP1β localization is normal in DMRT7 mutant cells in mid-pachynema (Figure 8C and 8D). |
| T17600 |
31834-31836 |
PRP |
denotes |
We |
| T17601 |
31837-31842 |
VBD |
denotes |
found |
| T17602 |
31843-31847 |
IN |
denotes |
that |
| T17604 |
31848-31852 |
NN |
denotes |
HP1β |
| T17605 |
31853-31865 |
NN |
denotes |
localization |
| T17603 |
31866-31868 |
VBZ |
denotes |
is |
| T17606 |
31869-31875 |
JJ |
denotes |
normal |
| T17607 |
31876-31878 |
IN |
denotes |
in |
| T17608 |
31879-31884 |
NN |
denotes |
DMRT7 |
| T17610 |
31885-31891 |
NN |
denotes |
mutant |
| T17609 |
31892-31897 |
NNS |
denotes |
cells |
| T17611 |
31898-31900 |
IN |
denotes |
in |
| T17612 |
31901-31914 |
NN |
denotes |
mid-pachynema |
| T17613 |
31915-31916 |
-LRB- |
denotes |
( |
| T17615 |
31916-31922 |
NN |
denotes |
Figure |
| T17614 |
31923-31925 |
NN |
denotes |
8C |
| T17616 |
31926-31929 |
CC |
denotes |
and |
| T17617 |
31930-31932 |
NN |
denotes |
8D |
| T17618 |
31932-31933 |
-RRB- |
denotes |
) |
| T17619 |
31933-31934 |
. |
denotes |
. |
| T17620 |
31934-32050 |
sentence |
denotes |
These results suggest that XY body formation and initiation of MSCI both occur normally in Dmrt7 mutant germ cells. |
| T17621 |
31935-31940 |
DT |
denotes |
These |
| T17622 |
31941-31948 |
NNS |
denotes |
results |
| T17623 |
31949-31956 |
VBP |
denotes |
suggest |
| T17624 |
31957-31961 |
IN |
denotes |
that |
| T17626 |
31962-31964 |
NN |
denotes |
XY |
| T17628 |
31965-31969 |
NN |
denotes |
body |
| T17627 |
31970-31979 |
NN |
denotes |
formation |
| T17629 |
31980-31983 |
CC |
denotes |
and |
| T17630 |
31984-31994 |
NN |
denotes |
initiation |
| T17631 |
31995-31997 |
IN |
denotes |
of |
| T17632 |
31998-32002 |
NN |
denotes |
MSCI |
| T17633 |
32003-32007 |
DT |
denotes |
both |
| T17625 |
32008-32013 |
VBP |
denotes |
occur |
| T17634 |
32014-32022 |
RB |
denotes |
normally |
| T17635 |
32023-32025 |
IN |
denotes |
in |
| T17636 |
32026-32031 |
NN |
denotes |
Dmrt7 |
| T17637 |
32032-32038 |
NN |
denotes |
mutant |
| T17639 |
32039-32043 |
NN |
denotes |
germ |
| T17638 |
32044-32049 |
NNS |
denotes |
cells |
| T17640 |
32049-32050 |
. |
denotes |
. |
| T17641 |
32050-32051 |
sentence |
denotes |
|
| T31607 |
32061-32070 |
NN |
denotes |
Chromatin |
| T31608 |
32071-32084 |
NNS |
denotes |
Abnormalities |
| T31609 |
32085-32087 |
IN |
denotes |
in |
| T31610 |
32088-32093 |
NN |
denotes |
Dmrt7 |
| T31611 |
32094-32100 |
NN |
denotes |
Mutant |
| T31613 |
32101-32110 |
NN |
denotes |
Diplotene |
| T31614 |
32111-32115 |
NN |
denotes |
Germ |
| T31612 |
32116-32121 |
NNS |
denotes |
Cells |
| T31615 |
32121-32199 |
sentence |
denotes |
(A and B) MSCI occurs normally in mid-pachytene spermatocyte of Dmrt7 mutant. |
| T31616 |
32122-32123 |
-LRB- |
denotes |
( |
| T31617 |
32123-32124 |
LS |
denotes |
A |
| T31619 |
32125-32128 |
CC |
denotes |
and |
| T31620 |
32129-32130 |
LS |
denotes |
B |
| T31621 |
32130-32131 |
-RRB- |
denotes |
) |
| T31622 |
32132-32136 |
NN |
denotes |
MSCI |
| T31618 |
32137-32143 |
VBZ |
denotes |
occurs |
| T31623 |
32144-32152 |
RB |
denotes |
normally |
| T31624 |
32153-32155 |
IN |
denotes |
in |
| T31625 |
32156-32169 |
JJ |
denotes |
mid-pachytene |
| T31626 |
32170-32182 |
NN |
denotes |
spermatocyte |
| T31627 |
32183-32185 |
IN |
denotes |
of |
| T31628 |
32186-32191 |
NN |
denotes |
Dmrt7 |
| T31629 |
32192-32198 |
NN |
denotes |
mutant |
| T31630 |
32198-32199 |
. |
denotes |
. |
| T31631 |
32199-32238 |
sentence |
denotes |
Arrows indicate XY body in all panels. |
| T31632 |
32200-32206 |
NNS |
denotes |
Arrows |
| T31633 |
32207-32215 |
VBP |
denotes |
indicate |
| T31634 |
32216-32218 |
NN |
denotes |
XY |
| T31635 |
32219-32223 |
NN |
denotes |
body |
| T31636 |
32224-32226 |
IN |
denotes |
in |
| T31637 |
32227-32230 |
DT |
denotes |
all |
| T31638 |
32231-32237 |
NNS |
denotes |
panels |
| T31639 |
32237-32238 |
. |
denotes |
. |
| T31640 |
32238-32328 |
sentence |
denotes |
Cot-1 RNA FISH (red) reveals normal silencing of sex chromosome transcription in XY body. |
| T31641 |
32239-32242 |
NN |
denotes |
Cot |
| T31643 |
32242-32243 |
HYPH |
denotes |
- |
| T31644 |
32243-32244 |
CD |
denotes |
1 |
| T31645 |
32245-32248 |
NN |
denotes |
RNA |
| T31642 |
32249-32253 |
NN |
denotes |
FISH |
| T31647 |
32254-32255 |
-LRB- |
denotes |
( |
| T31648 |
32255-32258 |
JJ |
denotes |
red |
| T31649 |
32258-32259 |
-RRB- |
denotes |
) |
| T31646 |
32260-32267 |
VBZ |
denotes |
reveals |
| T31650 |
32268-32274 |
JJ |
denotes |
normal |
| T31651 |
32275-32284 |
NN |
denotes |
silencing |
| T31652 |
32285-32287 |
IN |
denotes |
of |
| T31653 |
32288-32291 |
NN |
denotes |
sex |
| T31655 |
32292-32302 |
NN |
denotes |
chromosome |
| T31654 |
32303-32316 |
NN |
denotes |
transcription |
| T31656 |
32317-32319 |
IN |
denotes |
in |
| T31657 |
32320-32322 |
NN |
denotes |
XY |
| T31658 |
32323-32327 |
NN |
denotes |
body |
| T31659 |
32327-32328 |
. |
denotes |
. |
| T31660 |
32328-32406 |
sentence |
denotes |
This is consistent with wild-type mid-pachynema as described previously [16]. |
| T31661 |
32329-32333 |
DT |
denotes |
This |
| T31662 |
32334-32336 |
VBZ |
denotes |
is |
| T31663 |
32337-32347 |
JJ |
denotes |
consistent |
| T31664 |
32348-32352 |
IN |
denotes |
with |
| T31665 |
32353-32357 |
JJ |
denotes |
wild |
| T31667 |
32357-32358 |
HYPH |
denotes |
- |
| T31666 |
32358-32362 |
NN |
denotes |
type |
| T31668 |
32363-32376 |
NN |
denotes |
mid-pachynema |
| T31669 |
32377-32379 |
IN |
denotes |
as |
| T31670 |
32380-32389 |
VBN |
denotes |
described |
| T31671 |
32390-32400 |
RB |
denotes |
previously |
| T31672 |
32401-32402 |
-LRB- |
denotes |
[ |
| T31673 |
32402-32404 |
CD |
denotes |
16 |
| T31674 |
32404-32405 |
-RRB- |
denotes |
] |
| T31675 |
32405-32406 |
. |
denotes |
. |
| T31676 |
32406-32466 |
sentence |
denotes |
(C and D) HP1β localization in mid-pachytene spermatocytes. |
| T31677 |
32407-32408 |
-LRB- |
denotes |
( |
| T31678 |
32408-32409 |
LS |
denotes |
C |
| T31680 |
32410-32413 |
CC |
denotes |
and |
| T31681 |
32414-32415 |
LS |
denotes |
D |
| T31682 |
32415-32416 |
-RRB- |
denotes |
) |
| T31683 |
32417-32421 |
NN |
denotes |
HP1β |
| T31679 |
32422-32434 |
NN |
denotes |
localization |
| T31684 |
32435-32437 |
IN |
denotes |
in |
| T31685 |
32438-32451 |
JJ |
denotes |
mid-pachytene |
| T31686 |
32452-32465 |
NNS |
denotes |
spermatocytes |
| T31687 |
32465-32466 |
. |
denotes |
. |
| T31688 |
32466-32553 |
sentence |
denotes |
HP1β localizes to X chromosome centromere (arrowhead) in wild-type (C) and mutant (D). |
| T31689 |
32467-32471 |
NN |
denotes |
HP1β |
| T31690 |
32472-32481 |
VBZ |
denotes |
localizes |
| T31691 |
32482-32484 |
IN |
denotes |
to |
| T31692 |
32485-32486 |
NN |
denotes |
X |
| T31693 |
32487-32497 |
NN |
denotes |
chromosome |
| T31694 |
32498-32508 |
NN |
denotes |
centromere |
| T31695 |
32509-32510 |
-LRB- |
denotes |
( |
| T31696 |
32510-32519 |
NN |
denotes |
arrowhead |
| T31697 |
32519-32520 |
-RRB- |
denotes |
) |
| T31698 |
32521-32523 |
IN |
denotes |
in |
| T31699 |
32524-32528 |
JJ |
denotes |
wild |
| T31701 |
32528-32529 |
HYPH |
denotes |
- |
| T31700 |
32529-32533 |
NN |
denotes |
type |
| T31702 |
32534-32535 |
-LRB- |
denotes |
( |
| T31703 |
32535-32536 |
NN |
denotes |
C |
| T31704 |
32536-32537 |
-RRB- |
denotes |
) |
| T31705 |
32538-32541 |
CC |
denotes |
and |
| T31706 |
32542-32548 |
NN |
denotes |
mutant |
| T31707 |
32549-32550 |
-LRB- |
denotes |
( |
| T31708 |
32550-32551 |
NN |
denotes |
D |
| T31709 |
32551-32552 |
-RRB- |
denotes |
) |
| T31710 |
32552-32553 |
. |
denotes |
. |
| T31711 |
32553-32597 |
sentence |
denotes |
(E and F) Cot-1 hybridization in diplotene. |
| T31712 |
32554-32555 |
-LRB- |
denotes |
( |
| T31713 |
32555-32556 |
LS |
denotes |
E |
| T31715 |
32557-32560 |
CC |
denotes |
and |
| T31716 |
32561-32562 |
LS |
denotes |
F |
| T31717 |
32562-32563 |
-RRB- |
denotes |
) |
| T31718 |
32564-32567 |
NN |
denotes |
Cot |
| T31719 |
32567-32568 |
HYPH |
denotes |
- |
| T31720 |
32568-32569 |
CD |
denotes |
1 |
| T31714 |
32570-32583 |
NN |
denotes |
hybridization |
| T31721 |
32584-32586 |
IN |
denotes |
in |
| T31722 |
32587-32596 |
NN |
denotes |
diplotene |
| T31723 |
32596-32597 |
. |
denotes |
. |
| T31724 |
32597-32686 |
sentence |
denotes |
Presumptive XY body, based on DAPI and γH2AX localization, is indicated by arrow in (F). |
| T31725 |
32598-32609 |
JJ |
denotes |
Presumptive |
| T31727 |
32610-32612 |
NN |
denotes |
XY |
| T31726 |
32613-32617 |
NN |
denotes |
body |
| T31729 |
32617-32619 |
, |
denotes |
, |
| T31730 |
32619-32624 |
VBN |
denotes |
based |
| T31731 |
32625-32627 |
IN |
denotes |
on |
| T31732 |
32628-32632 |
NN |
denotes |
DAPI |
| T31734 |
32633-32636 |
CC |
denotes |
and |
| T31735 |
32637-32642 |
NN |
denotes |
γH2AX |
| T31733 |
32643-32655 |
NN |
denotes |
localization |
| T31736 |
32655-32657 |
, |
denotes |
, |
| T31737 |
32657-32659 |
VBZ |
denotes |
is |
| T31728 |
32660-32669 |
VBN |
denotes |
indicated |
| T31738 |
32670-32672 |
IN |
denotes |
by |
| T31739 |
32673-32678 |
NN |
denotes |
arrow |
| T31740 |
32679-32681 |
IN |
denotes |
in |
| T31741 |
32682-32683 |
-LRB- |
denotes |
( |
| T31742 |
32683-32684 |
NN |
denotes |
F |
| T31743 |
32684-32685 |
-RRB- |
denotes |
) |
| T31744 |
32685-32686 |
. |
denotes |
. |
| T31745 |
32686-32715 |
sentence |
denotes |
(G and H) HP1β in diplotene. |
| T31746 |
32687-32688 |
-LRB- |
denotes |
( |
| T31747 |
32688-32689 |
LS |
denotes |
G |
| T31749 |
32690-32693 |
CC |
denotes |
and |
| T31750 |
32694-32695 |
LS |
denotes |
H |
| T31751 |
32695-32696 |
-RRB- |
denotes |
) |
| T31748 |
32697-32701 |
NN |
denotes |
HP1β |
| T31752 |
32702-32704 |
IN |
denotes |
in |
| T31753 |
32705-32714 |
NN |
denotes |
diplotene |
| T31754 |
32714-32715 |
. |
denotes |
. |
| T31755 |
32715-32849 |
sentence |
denotes |
Wild-type cell (E) has HP1β throughout XY body, whereas mutant cell (H) only has localization to X chromosome centromere (arrowhead). |
| T31756 |
32716-32720 |
JJ |
denotes |
Wild |
| T31758 |
32720-32721 |
HYPH |
denotes |
- |
| T31757 |
32721-32725 |
NN |
denotes |
type |
| T31759 |
32726-32730 |
NN |
denotes |
cell |
| T31761 |
32731-32732 |
-LRB- |
denotes |
( |
| T31762 |
32732-32733 |
NN |
denotes |
E |
| T31763 |
32733-32734 |
-RRB- |
denotes |
) |
| T31760 |
32735-32738 |
VBZ |
denotes |
has |
| T31764 |
32739-32743 |
NN |
denotes |
HP1β |
| T31765 |
32744-32754 |
IN |
denotes |
throughout |
| T31766 |
32755-32757 |
NN |
denotes |
XY |
| T31767 |
32758-32762 |
NN |
denotes |
body |
| T31768 |
32762-32764 |
, |
denotes |
, |
| T31769 |
32764-32771 |
IN |
denotes |
whereas |
| T31771 |
32772-32778 |
NN |
denotes |
mutant |
| T31772 |
32779-32783 |
NN |
denotes |
cell |
| T31773 |
32784-32785 |
-LRB- |
denotes |
( |
| T31774 |
32785-32786 |
NN |
denotes |
H |
| T31775 |
32786-32787 |
-RRB- |
denotes |
) |
| T31776 |
32788-32792 |
RB |
denotes |
only |
| T31770 |
32793-32796 |
VBZ |
denotes |
has |
| T31777 |
32797-32809 |
NN |
denotes |
localization |
| T31778 |
32810-32812 |
IN |
denotes |
to |
| T31779 |
32813-32814 |
NN |
denotes |
X |
| T31780 |
32815-32825 |
NN |
denotes |
chromosome |
| T31781 |
32826-32836 |
NN |
denotes |
centromere |
| T31782 |
32837-32838 |
-LRB- |
denotes |
( |
| T31783 |
32838-32847 |
NN |
denotes |
arrowhead |
| T31784 |
32847-32848 |
-RRB- |
denotes |
) |
| T31785 |
32848-32849 |
. |
denotes |
. |
| T31786 |
32849-32901 |
sentence |
denotes |
(I and J) H3-2meK9 localization in diplotene cells. |
| T31787 |
32850-32851 |
-LRB- |
denotes |
( |
| T31788 |
32851-32852 |
LS |
denotes |
I |
| T31790 |
32853-32856 |
CC |
denotes |
and |
| T31791 |
32857-32858 |
LS |
denotes |
J |
| T31792 |
32858-32859 |
-RRB- |
denotes |
) |
| T31793 |
32860-32862 |
NN |
denotes |
H3 |
| T31795 |
32862-32863 |
HYPH |
denotes |
- |
| T31794 |
32863-32868 |
NN |
denotes |
2meK9 |
| T31789 |
32869-32881 |
NN |
denotes |
localization |
| T31796 |
32882-32884 |
IN |
denotes |
in |
| T31797 |
32885-32894 |
NN |
denotes |
diplotene |
| T31798 |
32895-32900 |
NNS |
denotes |
cells |
| T31799 |
32900-32901 |
. |
denotes |
. |
| T31800 |
32901-32995 |
sentence |
denotes |
Mutant cell (J) lacks strong concentration of this mark to the XY body seen in wild-type (I). |
| T31801 |
32902-32908 |
NN |
denotes |
Mutant |
| T31802 |
32909-32913 |
NN |
denotes |
cell |
| T31804 |
32914-32915 |
-LRB- |
denotes |
( |
| T31805 |
32915-32916 |
NN |
denotes |
J |
| T31806 |
32916-32917 |
-RRB- |
denotes |
) |
| T31803 |
32918-32923 |
VBZ |
denotes |
lacks |
| T31807 |
32924-32930 |
JJ |
denotes |
strong |
| T31808 |
32931-32944 |
NN |
denotes |
concentration |
| T31809 |
32945-32947 |
IN |
denotes |
of |
| T31810 |
32948-32952 |
DT |
denotes |
this |
| T31811 |
32953-32957 |
NN |
denotes |
mark |
| T31812 |
32958-32960 |
IN |
denotes |
to |
| T31813 |
32961-32964 |
DT |
denotes |
the |
| T31815 |
32965-32967 |
NN |
denotes |
XY |
| T31814 |
32968-32972 |
NN |
denotes |
body |
| T31816 |
32973-32977 |
VBN |
denotes |
seen |
| T31817 |
32978-32980 |
IN |
denotes |
in |
| T31818 |
32981-32985 |
JJ |
denotes |
wild |
| T31820 |
32985-32986 |
HYPH |
denotes |
- |
| T31819 |
32986-32990 |
NN |
denotes |
type |
| T31821 |
32991-32992 |
-LRB- |
denotes |
( |
| T31822 |
32992-32993 |
NN |
denotes |
I |
| T31823 |
32993-32994 |
-RRB- |
denotes |
) |
| T31824 |
32994-32995 |
. |
denotes |
. |
| T31825 |
32995-33047 |
sentence |
denotes |
(K and L) H3-3meK9 localization in diplotene cells. |
| T31826 |
32996-32997 |
-LRB- |
denotes |
( |
| T31827 |
32997-32998 |
LS |
denotes |
K |
| T31829 |
32999-33002 |
CC |
denotes |
and |
| T31830 |
33003-33004 |
LS |
denotes |
L |
| T31831 |
33004-33005 |
-RRB- |
denotes |
) |
| T31832 |
33006-33008 |
NN |
denotes |
H3 |
| T31834 |
33008-33009 |
HYPH |
denotes |
- |
| T31833 |
33009-33014 |
NN |
denotes |
3meK9 |
| T31828 |
33015-33027 |
NN |
denotes |
localization |
| T31835 |
33028-33030 |
IN |
denotes |
in |
| T31836 |
33031-33040 |
NN |
denotes |
diplotene |
| T31837 |
33041-33046 |
NNS |
denotes |
cells |
| T31838 |
33046-33047 |
. |
denotes |
. |
| T31839 |
33047-33112 |
sentence |
denotes |
Mutant cell (L) has no localization of this mark to the XY body. |
| T31840 |
33048-33054 |
NN |
denotes |
Mutant |
| T31841 |
33055-33059 |
NN |
denotes |
cell |
| T31843 |
33060-33061 |
-LRB- |
denotes |
( |
| T31844 |
33061-33062 |
NN |
denotes |
L |
| T31845 |
33062-33063 |
-RRB- |
denotes |
) |
| T31842 |
33064-33067 |
VBZ |
denotes |
has |
| T31846 |
33068-33070 |
DT |
denotes |
no |
| T31847 |
33071-33083 |
NN |
denotes |
localization |
| T31848 |
33084-33086 |
IN |
denotes |
of |
| T31849 |
33087-33091 |
DT |
denotes |
this |
| T31850 |
33092-33096 |
NN |
denotes |
mark |
| T31851 |
33097-33099 |
IN |
denotes |
to |
| T31852 |
33100-33103 |
DT |
denotes |
the |
| T31854 |
33104-33106 |
NN |
denotes |
XY |
| T31853 |
33107-33111 |
NN |
denotes |
body |
| T31855 |
33111-33112 |
. |
denotes |
. |
| T31856 |
33112-33197 |
sentence |
denotes |
γH2AX localizes to autosomes in mutant cell, possibly indicating onset of apoptosis. |
| T31857 |
33113-33118 |
NN |
denotes |
γH2AX |
| T31858 |
33119-33128 |
VBZ |
denotes |
localizes |
| T31859 |
33129-33131 |
IN |
denotes |
to |
| T31860 |
33132-33141 |
NNS |
denotes |
autosomes |
| T31861 |
33142-33144 |
IN |
denotes |
in |
| T31862 |
33145-33151 |
NN |
denotes |
mutant |
| T31863 |
33152-33156 |
NN |
denotes |
cell |
| T31864 |
33156-33158 |
, |
denotes |
, |
| T31865 |
33158-33166 |
RB |
denotes |
possibly |
| T31866 |
33167-33177 |
VBG |
denotes |
indicating |
| T31867 |
33178-33183 |
NN |
denotes |
onset |
| T31868 |
33184-33186 |
IN |
denotes |
of |
| T31869 |
33187-33196 |
NN |
denotes |
apoptosis |
| T31870 |
33196-33197 |
. |
denotes |
. |
| T31871 |
33197-33280 |
sentence |
denotes |
(M) Example of mutant diplotene cell with normal HP1β accumulation to the XY body. |
| T31872 |
33198-33199 |
-LRB- |
denotes |
( |
| T31873 |
33199-33200 |
LS |
denotes |
M |
| T31875 |
33200-33201 |
-RRB- |
denotes |
) |
| T31874 |
33202-33209 |
NN |
denotes |
Example |
| T31876 |
33210-33212 |
IN |
denotes |
of |
| T31877 |
33213-33219 |
NN |
denotes |
mutant |
| T31879 |
33220-33229 |
NN |
denotes |
diplotene |
| T31878 |
33230-33234 |
NN |
denotes |
cell |
| T31880 |
33235-33239 |
IN |
denotes |
with |
| T31881 |
33240-33246 |
JJ |
denotes |
normal |
| T31883 |
33247-33251 |
NN |
denotes |
HP1β |
| T31882 |
33252-33264 |
NN |
denotes |
accumulation |
| T31884 |
33265-33267 |
IN |
denotes |
to |
| T31885 |
33268-33271 |
DT |
denotes |
the |
| T31887 |
33272-33274 |
NN |
denotes |
XY |
| T31886 |
33275-33279 |
NN |
denotes |
body |
| T31888 |
33279-33280 |
. |
denotes |
. |
| T31889 |
33280-33334 |
sentence |
denotes |
All images except those in (M) are single Z sections. |
| T31890 |
33281-33284 |
DT |
denotes |
All |
| T31891 |
33285-33291 |
NNS |
denotes |
images |
| T31893 |
33292-33298 |
IN |
denotes |
except |
| T31894 |
33299-33304 |
DT |
denotes |
those |
| T31895 |
33305-33307 |
IN |
denotes |
in |
| T31896 |
33308-33309 |
-LRB- |
denotes |
( |
| T31897 |
33309-33310 |
NN |
denotes |
M |
| T31898 |
33310-33311 |
-RRB- |
denotes |
) |
| T31892 |
33312-33315 |
VBP |
denotes |
are |
| T31899 |
33316-33322 |
JJ |
denotes |
single |
| T31900 |
33323-33324 |
NN |
denotes |
Z |
| T31901 |
33325-33333 |
NNS |
denotes |
sections |
| T31902 |
33333-33334 |
. |
denotes |
. |
| T17643 |
33335-33337 |
PRP |
denotes |
We |
| T17642 |
33335-33489 |
sentence |
denotes |
We next considered the possibility that sex chromatin is established normally but is not properly modified as cells exit pachynema and begin to form PMSC. |
| T17645 |
33338-33342 |
RB |
denotes |
next |
| T17644 |
33343-33353 |
VBD |
denotes |
considered |
| T17646 |
33354-33357 |
DT |
denotes |
the |
| T17647 |
33358-33369 |
NN |
denotes |
possibility |
| T17648 |
33370-33374 |
IN |
denotes |
that |
| T17650 |
33375-33378 |
NN |
denotes |
sex |
| T17651 |
33379-33388 |
NN |
denotes |
chromatin |
| T17652 |
33389-33391 |
VBZ |
denotes |
is |
| T17649 |
33392-33403 |
VBN |
denotes |
established |
| T17653 |
33404-33412 |
RB |
denotes |
normally |
| T17654 |
33413-33416 |
CC |
denotes |
but |
| T17655 |
33417-33419 |
VBZ |
denotes |
is |
| T17657 |
33420-33423 |
RB |
denotes |
not |
| T17658 |
33424-33432 |
RB |
denotes |
properly |
| T17656 |
33433-33441 |
VBN |
denotes |
modified |
| T17659 |
33442-33444 |
IN |
denotes |
as |
| T17661 |
33445-33450 |
NNS |
denotes |
cells |
| T17660 |
33451-33455 |
VBP |
denotes |
exit |
| T17662 |
33456-33465 |
NN |
denotes |
pachynema |
| T17663 |
33466-33469 |
CC |
denotes |
and |
| T17664 |
33470-33475 |
VB |
denotes |
begin |
| T17665 |
33476-33478 |
TO |
denotes |
to |
| T17666 |
33479-33483 |
VB |
denotes |
form |
| T17667 |
33484-33488 |
NN |
denotes |
PMSC |
| T17668 |
33488-33489 |
. |
denotes |
. |
| T17669 |
33489-33717 |
sentence |
denotes |
Although most Dmrt7 mutant cells are eliminated by apoptosis prior to diplonema, we were able to examine epigenetic markers of PMSC in rare Dmrt7 mutant spermatocytes that escaped pachytene arrest and progressed into diplonema. |
| T17670 |
33490-33498 |
IN |
denotes |
Although |
| T17672 |
33499-33503 |
JJS |
denotes |
most |
| T17674 |
33504-33509 |
NN |
denotes |
Dmrt7 |
| T17675 |
33510-33516 |
NN |
denotes |
mutant |
| T17673 |
33517-33522 |
NNS |
denotes |
cells |
| T17676 |
33523-33526 |
VBP |
denotes |
are |
| T17671 |
33527-33537 |
VBN |
denotes |
eliminated |
| T17678 |
33538-33540 |
IN |
denotes |
by |
| T17679 |
33541-33550 |
NN |
denotes |
apoptosis |
| T17680 |
33551-33556 |
IN |
denotes |
prior |
| T17681 |
33557-33559 |
IN |
denotes |
to |
| T17682 |
33560-33569 |
NN |
denotes |
diplonema |
| T17683 |
33569-33571 |
, |
denotes |
, |
| T17684 |
33571-33573 |
PRP |
denotes |
we |
| T17677 |
33574-33578 |
VBD |
denotes |
were |
| T17685 |
33579-33583 |
JJ |
denotes |
able |
| T17686 |
33584-33586 |
TO |
denotes |
to |
| T17687 |
33587-33594 |
VB |
denotes |
examine |
| T17688 |
33595-33605 |
JJ |
denotes |
epigenetic |
| T17689 |
33606-33613 |
NNS |
denotes |
markers |
| T17690 |
33614-33616 |
IN |
denotes |
of |
| T17691 |
33617-33621 |
NN |
denotes |
PMSC |
| T17692 |
33622-33624 |
IN |
denotes |
in |
| T17693 |
33625-33629 |
JJ |
denotes |
rare |
| T17695 |
33630-33635 |
NN |
denotes |
Dmrt7 |
| T17696 |
33636-33642 |
NN |
denotes |
mutant |
| T17694 |
33643-33656 |
NNS |
denotes |
spermatocytes |
| T17697 |
33657-33661 |
WDT |
denotes |
that |
| T17698 |
33662-33669 |
VBD |
denotes |
escaped |
| T17699 |
33670-33679 |
NN |
denotes |
pachytene |
| T17700 |
33680-33686 |
NN |
denotes |
arrest |
| T17701 |
33687-33690 |
CC |
denotes |
and |
| T17702 |
33691-33701 |
VBD |
denotes |
progressed |
| T17703 |
33702-33706 |
IN |
denotes |
into |
| T17704 |
33707-33716 |
NN |
denotes |
diplonema |
| T17705 |
33716-33717 |
. |
denotes |
. |
| T17706 |
33717-33782 |
sentence |
denotes |
First, we examined nascent transcription by Cot-1 hybridization. |
| T17707 |
33718-33723 |
RB |
denotes |
First |
| T17709 |
33723-33725 |
, |
denotes |
, |
| T17710 |
33725-33727 |
PRP |
denotes |
we |
| T17708 |
33728-33736 |
VBD |
denotes |
examined |
| T17711 |
33737-33744 |
JJ |
denotes |
nascent |
| T17712 |
33745-33758 |
NN |
denotes |
transcription |
| T17713 |
33759-33761 |
IN |
denotes |
by |
| T17714 |
33762-33765 |
NN |
denotes |
Cot |
| T17716 |
33765-33766 |
HYPH |
denotes |
- |
| T17717 |
33766-33767 |
CD |
denotes |
1 |
| T17715 |
33768-33781 |
NN |
denotes |
hybridization |
| T17718 |
33781-33782 |
. |
denotes |
. |
| T17719 |
33782-34007 |
sentence |
denotes |
Although heterochromatic regions generally showed lower Cot-1 signal than euchromatic regions (Figure 8E and 8F), in some mutant cells the sex chromatin appeared to be incompletely silenced relative to wild-type (Figure 8F). |
| T17720 |
33783-33791 |
IN |
denotes |
Although |
| T17722 |
33792-33807 |
JJ |
denotes |
heterochromatic |
| T17723 |
33808-33815 |
NNS |
denotes |
regions |
| T17724 |
33816-33825 |
RB |
denotes |
generally |
| T17721 |
33826-33832 |
VBD |
denotes |
showed |
| T17726 |
33833-33838 |
JJR |
denotes |
lower |
| T17728 |
33839-33842 |
NN |
denotes |
Cot |
| T17729 |
33842-33843 |
HYPH |
denotes |
- |
| T17730 |
33843-33844 |
CD |
denotes |
1 |
| T17727 |
33845-33851 |
NN |
denotes |
signal |
| T17731 |
33852-33856 |
IN |
denotes |
than |
| T17732 |
33857-33868 |
JJ |
denotes |
euchromatic |
| T17733 |
33869-33876 |
NNS |
denotes |
regions |
| T17734 |
33877-33878 |
-LRB- |
denotes |
( |
| T17736 |
33878-33884 |
NN |
denotes |
Figure |
| T17735 |
33885-33887 |
NN |
denotes |
8E |
| T17737 |
33888-33891 |
CC |
denotes |
and |
| T17738 |
33892-33894 |
NN |
denotes |
8F |
| T17739 |
33894-33895 |
-RRB- |
denotes |
) |
| T17740 |
33895-33897 |
, |
denotes |
, |
| T17741 |
33897-33899 |
IN |
denotes |
in |
| T17742 |
33900-33904 |
DT |
denotes |
some |
| T17744 |
33905-33911 |
NN |
denotes |
mutant |
| T17743 |
33912-33917 |
NNS |
denotes |
cells |
| T17745 |
33918-33921 |
DT |
denotes |
the |
| T17747 |
33922-33925 |
NN |
denotes |
sex |
| T17746 |
33926-33935 |
NN |
denotes |
chromatin |
| T17725 |
33936-33944 |
VBD |
denotes |
appeared |
| T17748 |
33945-33947 |
TO |
denotes |
to |
| T17749 |
33948-33950 |
VB |
denotes |
be |
| T17750 |
33951-33963 |
RB |
denotes |
incompletely |
| T17751 |
33964-33972 |
JJ |
denotes |
silenced |
| T17752 |
33973-33981 |
JJ |
denotes |
relative |
| T17753 |
33982-33984 |
IN |
denotes |
to |
| T17754 |
33985-33989 |
JJ |
denotes |
wild |
| T17756 |
33989-33990 |
HYPH |
denotes |
- |
| T17755 |
33990-33994 |
NN |
denotes |
type |
| T17757 |
33995-33996 |
-LRB- |
denotes |
( |
| T17759 |
33996-34002 |
NN |
denotes |
Figure |
| T17758 |
34003-34005 |
NN |
denotes |
8F |
| T17760 |
34005-34006 |
-RRB- |
denotes |
) |
| T17761 |
34006-34007 |
. |
denotes |
. |
| T17762 |
34007-34224 |
sentence |
denotes |
We also examined three epigenetic signatures of PMSC: histone H3 dimethylated or trimethylated at lysine-9 (H3-2meK9, H3-3meK9) and spreading of HP1β through the XY body [16,57,58] (S. H. Namekawa, unpublished data). |
| T17763 |
34008-34010 |
PRP |
denotes |
We |
| T17765 |
34011-34015 |
RB |
denotes |
also |
| T17764 |
34016-34024 |
VBD |
denotes |
examined |
| T17766 |
34025-34030 |
CD |
denotes |
three |
| T17768 |
34031-34041 |
JJ |
denotes |
epigenetic |
| T17767 |
34042-34052 |
NNS |
denotes |
signatures |
| T17769 |
34053-34055 |
IN |
denotes |
of |
| T17770 |
34056-34060 |
NN |
denotes |
PMSC |
| T17771 |
34060-34062 |
: |
denotes |
: |
| T17772 |
34062-34069 |
NN |
denotes |
histone |
| T17773 |
34070-34072 |
NN |
denotes |
H3 |
| T17774 |
34073-34085 |
VBN |
denotes |
dimethylated |
| T17775 |
34086-34088 |
CC |
denotes |
or |
| T17776 |
34089-34102 |
VBN |
denotes |
trimethylated |
| T17777 |
34103-34105 |
IN |
denotes |
at |
| T17778 |
34106-34112 |
NN |
denotes |
lysine |
| T17779 |
34112-34113 |
HYPH |
denotes |
- |
| T17780 |
34113-34114 |
CD |
denotes |
9 |
| T17781 |
34115-34116 |
-LRB- |
denotes |
( |
| T17783 |
34116-34118 |
NN |
denotes |
H3 |
| T17784 |
34118-34119 |
HYPH |
denotes |
- |
| T17782 |
34119-34124 |
NN |
denotes |
2meK9 |
| T17785 |
34124-34126 |
, |
denotes |
, |
| T17786 |
34126-34128 |
NN |
denotes |
H3 |
| T17788 |
34128-34129 |
HYPH |
denotes |
- |
| T17787 |
34129-34134 |
NN |
denotes |
3meK9 |
| T17789 |
34134-34135 |
-RRB- |
denotes |
) |
| T17790 |
34136-34139 |
CC |
denotes |
and |
| T17791 |
34140-34149 |
NN |
denotes |
spreading |
| T17792 |
34150-34152 |
IN |
denotes |
of |
| T17793 |
34153-34157 |
NN |
denotes |
HP1β |
| T17794 |
34158-34165 |
IN |
denotes |
through |
| T17795 |
34166-34169 |
DT |
denotes |
the |
| T17797 |
34170-34172 |
NN |
denotes |
XY |
| T17796 |
34173-34177 |
NN |
denotes |
body |
| T17798 |
34178-34179 |
-LRB- |
denotes |
[ |
| T17800 |
34179-34181 |
CD |
denotes |
16 |
| T17801 |
34181-34182 |
, |
denotes |
, |
| T17802 |
34182-34184 |
CD |
denotes |
57 |
| T17803 |
34184-34185 |
, |
denotes |
, |
| T17799 |
34185-34187 |
CD |
denotes |
58 |
| T17804 |
34187-34188 |
-RRB- |
denotes |
] |
| T17805 |
34189-34190 |
-LRB- |
denotes |
( |
| T17806 |
34190-34192 |
NNP |
denotes |
S. |
| T17807 |
34193-34195 |
NNP |
denotes |
H. |
| T17808 |
34196-34204 |
NNP |
denotes |
Namekawa |
| T17809 |
34204-34206 |
, |
denotes |
, |
| T17810 |
34206-34217 |
JJ |
denotes |
unpublished |
| T17811 |
34218-34222 |
NNS |
denotes |
data |
| T17812 |
34222-34223 |
-RRB- |
denotes |
) |
| T17813 |
34223-34224 |
. |
denotes |
. |
| T17814 |
34224-34321 |
sentence |
denotes |
We observed defects in sex chromatin localization of all three markers in Dmrt7 diplotene cells. |
| T17815 |
34225-34227 |
PRP |
denotes |
We |
| T17816 |
34228-34236 |
VBD |
denotes |
observed |
| T17817 |
34237-34244 |
NNS |
denotes |
defects |
| T17818 |
34245-34247 |
IN |
denotes |
in |
| T17819 |
34248-34251 |
NN |
denotes |
sex |
| T17820 |
34252-34261 |
NN |
denotes |
chromatin |
| T17821 |
34262-34274 |
NN |
denotes |
localization |
| T17822 |
34275-34277 |
IN |
denotes |
of |
| T17823 |
34278-34281 |
DT |
denotes |
all |
| T17825 |
34282-34287 |
CD |
denotes |
three |
| T17824 |
34288-34295 |
NNS |
denotes |
markers |
| T17826 |
34296-34298 |
IN |
denotes |
in |
| T17827 |
34299-34304 |
NN |
denotes |
Dmrt7 |
| T17828 |
34305-34314 |
NN |
denotes |
diplotene |
| T17829 |
34315-34320 |
NNS |
denotes |
cells |
| T17830 |
34320-34321 |
. |
denotes |
. |
| T17831 |
34321-34544 |
sentence |
denotes |
Although HP1β localization to the X chromosome centromere initially appeared normal at mid-pachynema, we observed Dmrt7 mutant diplotene cells that failed to show spreading of HP1β to the entire XY body (Figure 8G and 8H). |
| T17832 |
34322-34330 |
IN |
denotes |
Although |
| T17834 |
34331-34335 |
NN |
denotes |
HP1β |
| T17835 |
34336-34348 |
NN |
denotes |
localization |
| T17836 |
34349-34351 |
IN |
denotes |
to |
| T17837 |
34352-34355 |
DT |
denotes |
the |
| T17839 |
34356-34357 |
NN |
denotes |
X |
| T17840 |
34358-34368 |
NN |
denotes |
chromosome |
| T17838 |
34369-34379 |
NN |
denotes |
centromere |
| T17841 |
34380-34389 |
RB |
denotes |
initially |
| T17833 |
34390-34398 |
VBD |
denotes |
appeared |
| T17843 |
34399-34405 |
JJ |
denotes |
normal |
| T17844 |
34406-34408 |
IN |
denotes |
at |
| T17845 |
34409-34422 |
NN |
denotes |
mid-pachynema |
| T17846 |
34422-34424 |
, |
denotes |
, |
| T17847 |
34424-34426 |
PRP |
denotes |
we |
| T17842 |
34427-34435 |
VBD |
denotes |
observed |
| T17848 |
34436-34441 |
NN |
denotes |
Dmrt7 |
| T17850 |
34442-34448 |
NN |
denotes |
mutant |
| T17851 |
34449-34458 |
NN |
denotes |
diplotene |
| T17849 |
34459-34464 |
NNS |
denotes |
cells |
| T17852 |
34465-34469 |
WDT |
denotes |
that |
| T17853 |
34470-34476 |
VBD |
denotes |
failed |
| T17854 |
34477-34479 |
TO |
denotes |
to |
| T17855 |
34480-34484 |
VB |
denotes |
show |
| T17856 |
34485-34494 |
NN |
denotes |
spreading |
| T17857 |
34495-34497 |
IN |
denotes |
of |
| T17858 |
34498-34502 |
NN |
denotes |
HP1β |
| T17859 |
34503-34505 |
IN |
denotes |
to |
| T17860 |
34506-34509 |
DT |
denotes |
the |
| T17862 |
34510-34516 |
JJ |
denotes |
entire |
| T17863 |
34517-34519 |
NN |
denotes |
XY |
| T17861 |
34520-34524 |
NN |
denotes |
body |
| T17864 |
34525-34526 |
-LRB- |
denotes |
( |
| T17866 |
34526-34532 |
NN |
denotes |
Figure |
| T17865 |
34533-34535 |
NN |
denotes |
8G |
| T17867 |
34536-34539 |
CC |
denotes |
and |
| T17868 |
34540-34542 |
NN |
denotes |
8H |
| T17869 |
34542-34543 |
-RRB- |
denotes |
) |
| T17870 |
34543-34544 |
. |
denotes |
. |
| T17871 |
34544-34684 |
sentence |
denotes |
Similarly, we found Dmrt7 mutant diplotene cells lacking accumulation of H3-2meK9 and H3-3meK9 marks onto the sex chromatin (Figure 8I–8L). |
| T17872 |
34545-34554 |
RB |
denotes |
Similarly |
| T17874 |
34554-34556 |
, |
denotes |
, |
| T17875 |
34556-34558 |
PRP |
denotes |
we |
| T17873 |
34559-34564 |
VBD |
denotes |
found |
| T17876 |
34565-34570 |
NN |
denotes |
Dmrt7 |
| T17878 |
34571-34577 |
NN |
denotes |
mutant |
| T17879 |
34578-34587 |
NN |
denotes |
diplotene |
| T17877 |
34588-34593 |
NNS |
denotes |
cells |
| T17880 |
34594-34601 |
VBG |
denotes |
lacking |
| T17881 |
34602-34614 |
NN |
denotes |
accumulation |
| T17882 |
34615-34617 |
IN |
denotes |
of |
| T17883 |
34618-34620 |
NN |
denotes |
H3 |
| T17885 |
34620-34621 |
HYPH |
denotes |
- |
| T17884 |
34621-34626 |
NN |
denotes |
2meK9 |
| T17887 |
34627-34630 |
CC |
denotes |
and |
| T17888 |
34631-34633 |
NN |
denotes |
H3 |
| T17890 |
34633-34634 |
HYPH |
denotes |
- |
| T17889 |
34634-34639 |
NN |
denotes |
3meK9 |
| T17886 |
34640-34645 |
NNS |
denotes |
marks |
| T17891 |
34646-34650 |
IN |
denotes |
onto |
| T17892 |
34651-34654 |
DT |
denotes |
the |
| T17894 |
34655-34658 |
NN |
denotes |
sex |
| T17893 |
34659-34668 |
NN |
denotes |
chromatin |
| T17895 |
34669-34670 |
-LRB- |
denotes |
( |
| T17897 |
34670-34676 |
NN |
denotes |
Figure |
| T17896 |
34677-34679 |
NN |
denotes |
8I |
| T17898 |
34679-34680 |
SYM |
denotes |
– |
| T17899 |
34680-34682 |
NN |
denotes |
8L |
| T17900 |
34682-34683 |
-RRB- |
denotes |
) |
| T17901 |
34683-34684 |
. |
denotes |
. |
| T17902 |
34684-34792 |
sentence |
denotes |
Not all Dmrt7 mutant diplotene cells showed abnormal localization of HP1β to the sex chromatin (Figure 8M). |
| T17903 |
34685-34688 |
RB |
denotes |
Not |
| T17905 |
34689-34692 |
DT |
denotes |
all |
| T17906 |
34693-34698 |
NN |
denotes |
Dmrt7 |
| T17907 |
34699-34705 |
NN |
denotes |
mutant |
| T17908 |
34706-34715 |
NN |
denotes |
diplotene |
| T17904 |
34716-34721 |
NNS |
denotes |
cells |
| T17909 |
34722-34728 |
VBD |
denotes |
showed |
| T17910 |
34729-34737 |
JJ |
denotes |
abnormal |
| T17911 |
34738-34750 |
NN |
denotes |
localization |
| T17912 |
34751-34753 |
IN |
denotes |
of |
| T17913 |
34754-34758 |
NN |
denotes |
HP1β |
| T17914 |
34759-34761 |
IN |
denotes |
to |
| T17915 |
34762-34765 |
DT |
denotes |
the |
| T17917 |
34766-34769 |
NN |
denotes |
sex |
| T17916 |
34770-34779 |
NN |
denotes |
chromatin |
| T17918 |
34780-34781 |
-LRB- |
denotes |
( |
| T17920 |
34781-34787 |
NN |
denotes |
Figure |
| T17919 |
34788-34790 |
NN |
denotes |
8M |
| T17921 |
34790-34791 |
-RRB- |
denotes |
) |
| T17922 |
34791-34792 |
. |
denotes |
. |
| T17923 |
34792-34910 |
sentence |
denotes |
In one experiment, 11/27 mutant cells in diplonema lacked HP1β on the XY body, as compared with 2/22 wild-type cells. |
| T17924 |
34793-34795 |
IN |
denotes |
In |
| T17926 |
34796-34799 |
CD |
denotes |
one |
| T17927 |
34800-34810 |
NN |
denotes |
experiment |
| T17928 |
34810-34812 |
, |
denotes |
, |
| T17929 |
34812-34814 |
CD |
denotes |
11 |
| T17931 |
34814-34815 |
SYM |
denotes |
/ |
| T17930 |
34815-34817 |
CD |
denotes |
27 |
| T17933 |
34818-34824 |
NN |
denotes |
mutant |
| T17932 |
34825-34830 |
NNS |
denotes |
cells |
| T17934 |
34831-34833 |
IN |
denotes |
in |
| T17935 |
34834-34843 |
NN |
denotes |
diplonema |
| T17925 |
34844-34850 |
VBD |
denotes |
lacked |
| T17936 |
34851-34855 |
NN |
denotes |
HP1β |
| T17937 |
34856-34858 |
IN |
denotes |
on |
| T17938 |
34859-34862 |
DT |
denotes |
the |
| T17940 |
34863-34865 |
NN |
denotes |
XY |
| T17939 |
34866-34870 |
NN |
denotes |
body |
| T17941 |
34870-34872 |
, |
denotes |
, |
| T17942 |
34872-34874 |
IN |
denotes |
as |
| T17943 |
34875-34883 |
VBN |
denotes |
compared |
| T17944 |
34884-34888 |
IN |
denotes |
with |
| T17945 |
34889-34890 |
CD |
denotes |
2 |
| T17947 |
34890-34891 |
SYM |
denotes |
/ |
| T17946 |
34891-34893 |
CD |
denotes |
22 |
| T17949 |
34894-34898 |
JJ |
denotes |
wild |
| T17951 |
34898-34899 |
HYPH |
denotes |
- |
| T17950 |
34899-34903 |
NN |
denotes |
type |
| T17948 |
34904-34909 |
NNS |
denotes |
cells |
| T17952 |
34909-34910 |
. |
denotes |
. |
| T17953 |
34910-35022 |
sentence |
denotes |
We hypothesize that the mutant cells with normal HP1β may be those that can complete meiosis (Figures 4 and 5). |
| T17954 |
34911-34913 |
PRP |
denotes |
We |
| T17955 |
34914-34925 |
VBP |
denotes |
hypothesize |
| T17956 |
34926-34930 |
IN |
denotes |
that |
| T17958 |
34931-34934 |
DT |
denotes |
the |
| T17960 |
34935-34941 |
NN |
denotes |
mutant |
| T17959 |
34942-34947 |
NNS |
denotes |
cells |
| T17961 |
34948-34952 |
IN |
denotes |
with |
| T17962 |
34953-34959 |
JJ |
denotes |
normal |
| T17963 |
34960-34964 |
NN |
denotes |
HP1β |
| T17964 |
34965-34968 |
MD |
denotes |
may |
| T17957 |
34969-34971 |
VB |
denotes |
be |
| T17965 |
34972-34977 |
DT |
denotes |
those |
| T17966 |
34978-34982 |
WDT |
denotes |
that |
| T17968 |
34983-34986 |
MD |
denotes |
can |
| T17967 |
34987-34995 |
VB |
denotes |
complete |
| T17969 |
34996-35003 |
NN |
denotes |
meiosis |
| T17970 |
35004-35005 |
-LRB- |
denotes |
( |
| T17972 |
35005-35012 |
NNS |
denotes |
Figures |
| T17971 |
35013-35014 |
CD |
denotes |
4 |
| T17973 |
35015-35018 |
CC |
denotes |
and |
| T17974 |
35019-35020 |
CD |
denotes |
5 |
| T17975 |
35020-35021 |
-RRB- |
denotes |
) |
| T17976 |
35021-35022 |
. |
denotes |
. |
| T17977 |
35022-35144 |
sentence |
denotes |
Some of the mutant diplotene cells showing abnormal sex chromatin also had abnormal autosomal γH2AX staining (Figure 8L). |
| T17978 |
35023-35027 |
DT |
denotes |
Some |
| T17980 |
35028-35030 |
IN |
denotes |
of |
| T17981 |
35031-35034 |
DT |
denotes |
the |
| T17983 |
35035-35041 |
NN |
denotes |
mutant |
| T17984 |
35042-35051 |
NN |
denotes |
diplotene |
| T17982 |
35052-35057 |
NNS |
denotes |
cells |
| T17985 |
35058-35065 |
VBG |
denotes |
showing |
| T17986 |
35066-35074 |
JJ |
denotes |
abnormal |
| T17988 |
35075-35078 |
NN |
denotes |
sex |
| T17987 |
35079-35088 |
NN |
denotes |
chromatin |
| T17989 |
35089-35093 |
RB |
denotes |
also |
| T17979 |
35094-35097 |
VBD |
denotes |
had |
| T17990 |
35098-35106 |
JJ |
denotes |
abnormal |
| T17992 |
35107-35116 |
JJ |
denotes |
autosomal |
| T17993 |
35117-35122 |
NN |
denotes |
γH2AX |
| T17991 |
35123-35131 |
NN |
denotes |
staining |
| T17994 |
35132-35133 |
-LRB- |
denotes |
( |
| T17996 |
35133-35139 |
NN |
denotes |
Figure |
| T17995 |
35140-35142 |
NN |
denotes |
8L |
| T17997 |
35142-35143 |
-RRB- |
denotes |
) |
| T17998 |
35143-35144 |
. |
denotes |
. |
| T17999 |
35144-35296 |
sentence |
denotes |
γH2AX localizes to double-strand DNA breaks, so this staining may indicate that some diplotene mutant cells are approaching or entering apoptosis [59]. |
| T18000 |
35145-35150 |
NN |
denotes |
γH2AX |
| T18001 |
35151-35160 |
VBZ |
denotes |
localizes |
| T18002 |
35161-35163 |
IN |
denotes |
to |
| T18003 |
35164-35170 |
JJ |
denotes |
double |
| T18005 |
35170-35171 |
HYPH |
denotes |
- |
| T18004 |
35171-35177 |
NN |
denotes |
strand |
| T18006 |
35178-35181 |
NN |
denotes |
DNA |
| T18007 |
35182-35188 |
NNS |
denotes |
breaks |
| T18008 |
35188-35190 |
, |
denotes |
, |
| T18009 |
35190-35192 |
IN |
denotes |
so |
| T18011 |
35193-35197 |
DT |
denotes |
this |
| T18012 |
35198-35206 |
NN |
denotes |
staining |
| T18013 |
35207-35210 |
MD |
denotes |
may |
| T18010 |
35211-35219 |
VB |
denotes |
indicate |
| T18014 |
35220-35224 |
IN |
denotes |
that |
| T18016 |
35225-35229 |
DT |
denotes |
some |
| T18018 |
35230-35239 |
NN |
denotes |
diplotene |
| T18019 |
35240-35246 |
NN |
denotes |
mutant |
| T18017 |
35247-35252 |
NNS |
denotes |
cells |
| T18020 |
35253-35256 |
VBP |
denotes |
are |
| T18015 |
35257-35268 |
VBG |
denotes |
approaching |
| T18021 |
35269-35271 |
CC |
denotes |
or |
| T18022 |
35272-35280 |
VBG |
denotes |
entering |
| T18023 |
35281-35290 |
NN |
denotes |
apoptosis |
| T18024 |
35291-35292 |
-LRB- |
denotes |
[ |
| T18025 |
35292-35294 |
CD |
denotes |
59 |
| T18026 |
35294-35295 |
-RRB- |
denotes |
] |
| T18027 |
35295-35296 |
. |
denotes |
. |
| T18028 |
35296-35469 |
sentence |
denotes |
We did not observe sex chromatin defects prior to diplonema, but we cannot exclude the possibility that earlier defects exist and the affected cells are rapidly eliminated. |
| T18029 |
35297-35299 |
PRP |
denotes |
We |
| T18031 |
35300-35303 |
VBD |
denotes |
did |
| T18032 |
35304-35307 |
RB |
denotes |
not |
| T18030 |
35308-35315 |
VB |
denotes |
observe |
| T18033 |
35316-35319 |
NN |
denotes |
sex |
| T18035 |
35320-35329 |
NN |
denotes |
chromatin |
| T18034 |
35330-35337 |
NNS |
denotes |
defects |
| T18036 |
35338-35343 |
IN |
denotes |
prior |
| T18037 |
35344-35346 |
IN |
denotes |
to |
| T18038 |
35347-35356 |
NN |
denotes |
diplonema |
| T18039 |
35356-35358 |
, |
denotes |
, |
| T18040 |
35358-35361 |
CC |
denotes |
but |
| T18041 |
35362-35364 |
PRP |
denotes |
we |
| T18043 |
35365-35368 |
MD |
denotes |
can |
| T18044 |
35368-35371 |
RB |
denotes |
not |
| T18042 |
35372-35379 |
VB |
denotes |
exclude |
| T18045 |
35380-35383 |
DT |
denotes |
the |
| T18046 |
35384-35395 |
NN |
denotes |
possibility |
| T18047 |
35396-35400 |
IN |
denotes |
that |
| T18049 |
35401-35408 |
JJR |
denotes |
earlier |
| T18050 |
35409-35416 |
NNS |
denotes |
defects |
| T18048 |
35417-35422 |
VBP |
denotes |
exist |
| T18051 |
35423-35426 |
CC |
denotes |
and |
| T18052 |
35427-35430 |
DT |
denotes |
the |
| T18054 |
35431-35439 |
VBN |
denotes |
affected |
| T18053 |
35440-35445 |
NNS |
denotes |
cells |
| T18056 |
35446-35449 |
VBP |
denotes |
are |
| T18057 |
35450-35457 |
RB |
denotes |
rapidly |
| T18055 |
35458-35468 |
VBN |
denotes |
eliminated |
| T18058 |
35468-35469 |
. |
denotes |
. |
| T18059 |
35469-35549 |
sentence |
denotes |
In the preceding experiments, we staged cells based on XY body internalization. |
| T18060 |
35470-35472 |
IN |
denotes |
In |
| T18062 |
35473-35476 |
DT |
denotes |
the |
| T18064 |
35477-35486 |
VBG |
denotes |
preceding |
| T18063 |
35487-35498 |
NNS |
denotes |
experiments |
| T18065 |
35498-35500 |
, |
denotes |
, |
| T18066 |
35500-35502 |
PRP |
denotes |
we |
| T18061 |
35503-35509 |
VBD |
denotes |
staged |
| T18067 |
35510-35515 |
NNS |
denotes |
cells |
| T18068 |
35516-35521 |
VBN |
denotes |
based |
| T18069 |
35522-35524 |
IN |
denotes |
on |
| T18070 |
35525-35527 |
NN |
denotes |
XY |
| T18071 |
35528-35532 |
NN |
denotes |
body |
| T18072 |
35533-35548 |
NN |
denotes |
internalization |
| T18073 |
35548-35549 |
. |
denotes |
. |
| T18074 |
35549-35701 |
sentence |
denotes |
Because this process could be abnormal in the mutant cells, we also staged mutant cells by chromosome morphology using an antibody to SYCP3 (Figure 9). |
| T18075 |
35550-35557 |
IN |
denotes |
Because |
| T18077 |
35558-35562 |
DT |
denotes |
this |
| T18078 |
35563-35570 |
NN |
denotes |
process |
| T18079 |
35571-35576 |
MD |
denotes |
could |
| T18076 |
35577-35579 |
VB |
denotes |
be |
| T18081 |
35580-35588 |
JJ |
denotes |
abnormal |
| T18082 |
35589-35591 |
IN |
denotes |
in |
| T18083 |
35592-35595 |
DT |
denotes |
the |
| T18085 |
35596-35602 |
NN |
denotes |
mutant |
| T18084 |
35603-35608 |
NNS |
denotes |
cells |
| T18086 |
35608-35610 |
, |
denotes |
, |
| T18087 |
35610-35612 |
PRP |
denotes |
we |
| T18088 |
35613-35617 |
RB |
denotes |
also |
| T18080 |
35618-35624 |
VBD |
denotes |
staged |
| T18089 |
35625-35631 |
NN |
denotes |
mutant |
| T18090 |
35632-35637 |
NNS |
denotes |
cells |
| T18091 |
35638-35640 |
IN |
denotes |
by |
| T18092 |
35641-35651 |
NN |
denotes |
chromosome |
| T18093 |
35652-35662 |
NN |
denotes |
morphology |
| T18094 |
35663-35668 |
VBG |
denotes |
using |
| T18095 |
35669-35671 |
DT |
denotes |
an |
| T18096 |
35672-35680 |
NN |
denotes |
antibody |
| T18097 |
35681-35683 |
IN |
denotes |
to |
| T18098 |
35684-35689 |
NN |
denotes |
SYCP3 |
| T18099 |
35690-35691 |
-LRB- |
denotes |
( |
| T18100 |
35691-35697 |
NN |
denotes |
Figure |
| T18101 |
35698-35699 |
CD |
denotes |
9 |
| T18102 |
35699-35700 |
-RRB- |
denotes |
) |
| T18103 |
35700-35701 |
. |
denotes |
. |
| T18104 |
35701-35836 |
sentence |
denotes |
This independently identified Dmrt7 mutant diplotene cells lacking HP1β accumulation in the XY body, such as the example in Figure 9B. |
| T18105 |
35702-35706 |
DT |
denotes |
This |
| T18107 |
35707-35720 |
RB |
denotes |
independently |
| T18106 |
35721-35731 |
VBN |
denotes |
identified |
| T18108 |
35732-35737 |
NN |
denotes |
Dmrt7 |
| T18109 |
35738-35744 |
NN |
denotes |
mutant |
| T18111 |
35745-35754 |
NN |
denotes |
diplotene |
| T18110 |
35755-35760 |
NNS |
denotes |
cells |
| T18112 |
35761-35768 |
VBG |
denotes |
lacking |
| T18113 |
35769-35773 |
NN |
denotes |
HP1β |
| T18114 |
35774-35786 |
NN |
denotes |
accumulation |
| T18115 |
35787-35789 |
IN |
denotes |
in |
| T18116 |
35790-35793 |
DT |
denotes |
the |
| T18118 |
35794-35796 |
NN |
denotes |
XY |
| T18117 |
35797-35801 |
NN |
denotes |
body |
| T18119 |
35801-35803 |
, |
denotes |
, |
| T18120 |
35803-35807 |
JJ |
denotes |
such |
| T18121 |
35808-35810 |
IN |
denotes |
as |
| T18122 |
35811-35814 |
DT |
denotes |
the |
| T18123 |
35815-35822 |
NN |
denotes |
example |
| T18124 |
35823-35825 |
IN |
denotes |
in |
| T18125 |
35826-35832 |
NN |
denotes |
Figure |
| T18126 |
35833-35835 |
NN |
denotes |
9B |
| T18127 |
35835-35836 |
. |
denotes |
. |
| T18128 |
35836-36040 |
sentence |
denotes |
From these results, we conclude that Dmrt7 mutant cells establish a normal XY body in mid-pachynema, but then have multiple epigenetic defects in the sex chromatin transition from pachynema to diplonema. |
| T18129 |
35837-35841 |
IN |
denotes |
From |
| T18131 |
35842-35847 |
DT |
denotes |
these |
| T18132 |
35848-35855 |
NNS |
denotes |
results |
| T18133 |
35855-35857 |
, |
denotes |
, |
| T18134 |
35857-35859 |
PRP |
denotes |
we |
| T18130 |
35860-35868 |
VBP |
denotes |
conclude |
| T18135 |
35869-35873 |
IN |
denotes |
that |
| T18137 |
35874-35879 |
NN |
denotes |
Dmrt7 |
| T18139 |
35880-35886 |
NN |
denotes |
mutant |
| T18138 |
35887-35892 |
NNS |
denotes |
cells |
| T18136 |
35893-35902 |
VBP |
denotes |
establish |
| T18140 |
35903-35904 |
DT |
denotes |
a |
| T18142 |
35905-35911 |
JJ |
denotes |
normal |
| T18143 |
35912-35914 |
NN |
denotes |
XY |
| T18141 |
35915-35919 |
NN |
denotes |
body |
| T18144 |
35920-35922 |
IN |
denotes |
in |
| T18145 |
35923-35936 |
NN |
denotes |
mid-pachynema |
| T18146 |
35936-35938 |
, |
denotes |
, |
| T18147 |
35938-35941 |
CC |
denotes |
but |
| T18148 |
35942-35946 |
RB |
denotes |
then |
| T18149 |
35947-35951 |
VBP |
denotes |
have |
| T18150 |
35952-35960 |
JJ |
denotes |
multiple |
| T18152 |
35961-35971 |
JJ |
denotes |
epigenetic |
| T18151 |
35972-35979 |
NNS |
denotes |
defects |
| T18153 |
35980-35982 |
IN |
denotes |
in |
| T18154 |
35983-35986 |
DT |
denotes |
the |
| T18156 |
35987-35990 |
NN |
denotes |
sex |
| T18157 |
35991-36000 |
NN |
denotes |
chromatin |
| T18155 |
36001-36011 |
NN |
denotes |
transition |
| T18158 |
36012-36016 |
IN |
denotes |
from |
| T18159 |
36017-36026 |
NN |
denotes |
pachynema |
| T18160 |
36027-36029 |
IN |
denotes |
to |
| T18161 |
36030-36039 |
NN |
denotes |
diplonema |
| T18162 |
36039-36040 |
. |
denotes |
. |
| T32100 |
36051-36059 |
JJ |
denotes |
Abnormal |
| T32102 |
36060-36063 |
NN |
denotes |
Sex |
| T32101 |
36064-36073 |
NN |
denotes |
Chromatin |
| T32103 |
36074-36076 |
IN |
denotes |
in |
| T32104 |
36077-36082 |
NNS |
denotes |
Cells |
| T32105 |
36083-36089 |
VBN |
denotes |
Staged |
| T32106 |
36090-36092 |
IN |
denotes |
by |
| T32107 |
36093-36103 |
NN |
denotes |
Chromosome |
| T32109 |
36104-36111 |
VBG |
denotes |
Pairing |
| T32108 |
36112-36118 |
NN |
denotes |
Status |
| T32110 |
36118-36297 |
sentence |
denotes |
(A) Spread of wild-type germ cell stained with DAPI, anti-SYCP3, and anti-HP1β showing chromosome morphology typical of diplonema and internalized XY body with HP1β accumulation. |
| T32111 |
36119-36120 |
-LRB- |
denotes |
( |
| T32112 |
36120-36121 |
LS |
denotes |
A |
| T32114 |
36121-36122 |
-RRB- |
denotes |
) |
| T32113 |
36123-36129 |
NN |
denotes |
Spread |
| T32115 |
36130-36132 |
IN |
denotes |
of |
| T32116 |
36133-36137 |
JJ |
denotes |
wild |
| T32118 |
36137-36138 |
HYPH |
denotes |
- |
| T32117 |
36138-36142 |
NN |
denotes |
type |
| T32120 |
36143-36147 |
NN |
denotes |
germ |
| T32119 |
36148-36152 |
NN |
denotes |
cell |
| T32121 |
36153-36160 |
VBN |
denotes |
stained |
| T32122 |
36161-36165 |
IN |
denotes |
with |
| T32123 |
36166-36170 |
NN |
denotes |
DAPI |
| T32124 |
36170-36172 |
, |
denotes |
, |
| T32125 |
36172-36182 |
JJ |
denotes |
anti-SYCP3 |
| T32126 |
36182-36184 |
, |
denotes |
, |
| T32127 |
36184-36187 |
CC |
denotes |
and |
| T32128 |
36188-36197 |
JJ |
denotes |
anti-HP1β |
| T32129 |
36198-36205 |
VBG |
denotes |
showing |
| T32130 |
36206-36216 |
NN |
denotes |
chromosome |
| T32131 |
36217-36227 |
NN |
denotes |
morphology |
| T32132 |
36228-36235 |
JJ |
denotes |
typical |
| T32133 |
36236-36238 |
IN |
denotes |
of |
| T32134 |
36239-36248 |
NN |
denotes |
diplonema |
| T32135 |
36249-36252 |
CC |
denotes |
and |
| T32136 |
36253-36265 |
VBN |
denotes |
internalized |
| T32138 |
36266-36268 |
NN |
denotes |
XY |
| T32137 |
36269-36273 |
NN |
denotes |
body |
| T32139 |
36274-36278 |
IN |
denotes |
with |
| T32140 |
36279-36283 |
NN |
denotes |
HP1β |
| T32141 |
36284-36296 |
NN |
denotes |
accumulation |
| T32142 |
36296-36297 |
. |
denotes |
. |
| T32143 |
36297-36448 |
sentence |
denotes |
(B) Spread of Dmrt7 mutant germ cell showing normal diplotene chromosome morphology and internalized XY body, but no HP1β accumulation in the XY body. |
| T32144 |
36298-36299 |
-LRB- |
denotes |
( |
| T32145 |
36299-36300 |
LS |
denotes |
B |
| T32147 |
36300-36301 |
-RRB- |
denotes |
) |
| T32146 |
36302-36308 |
NN |
denotes |
Spread |
| T32148 |
36309-36311 |
IN |
denotes |
of |
| T32149 |
36312-36317 |
NN |
denotes |
Dmrt7 |
| T32150 |
36318-36324 |
NN |
denotes |
mutant |
| T32152 |
36325-36329 |
NN |
denotes |
germ |
| T32151 |
36330-36334 |
NN |
denotes |
cell |
| T32153 |
36335-36342 |
VBG |
denotes |
showing |
| T32154 |
36343-36349 |
JJ |
denotes |
normal |
| T32156 |
36350-36359 |
NN |
denotes |
diplotene |
| T32157 |
36360-36370 |
NN |
denotes |
chromosome |
| T32155 |
36371-36381 |
NN |
denotes |
morphology |
| T32158 |
36382-36385 |
CC |
denotes |
and |
| T32159 |
36386-36398 |
VBN |
denotes |
internalized |
| T32161 |
36399-36401 |
NN |
denotes |
XY |
| T32160 |
36402-36406 |
NN |
denotes |
body |
| T32162 |
36406-36408 |
, |
denotes |
, |
| T32163 |
36408-36411 |
CC |
denotes |
but |
| T32164 |
36412-36414 |
DT |
denotes |
no |
| T32166 |
36415-36419 |
NN |
denotes |
HP1β |
| T32165 |
36420-36432 |
NN |
denotes |
accumulation |
| T32167 |
36433-36435 |
IN |
denotes |
in |
| T32168 |
36436-36439 |
DT |
denotes |
the |
| T32170 |
36440-36442 |
NN |
denotes |
XY |
| T32169 |
36443-36447 |
NN |
denotes |
body |
| T32171 |
36447-36448 |
. |
denotes |
. |
| T32172 |
36448-36492 |
sentence |
denotes |
XY chromosome pairs are indicated by arrow. |
| T32173 |
36449-36451 |
NN |
denotes |
XY |
| T32175 |
36452-36462 |
NN |
denotes |
chromosome |
| T32174 |
36463-36468 |
NNS |
denotes |
pairs |
| T32177 |
36469-36472 |
VBP |
denotes |
are |
| T32176 |
36473-36482 |
VBN |
denotes |
indicated |
| T32178 |
36483-36485 |
IN |
denotes |
by |
| T32179 |
36486-36491 |
NN |
denotes |
arrow |
| T32180 |
36491-36492 |
. |
denotes |
. |
| T21499 |
36505-36507 |
IN |
denotes |
In |
| T21501 |
36508-36512 |
DT |
denotes |
this |
| T21502 |
36513-36518 |
NN |
denotes |
study |
| T21503 |
36518-36520 |
, |
denotes |
, |
| T21504 |
36520-36522 |
PRP |
denotes |
we |
| T21500 |
36523-36527 |
VBP |
denotes |
find |
| T21505 |
36528-36532 |
IN |
denotes |
that |
| T21507 |
36533-36536 |
DT |
denotes |
the |
| T21509 |
36537-36539 |
NN |
denotes |
DM |
| T21510 |
36540-36546 |
NN |
denotes |
domain |
| T21508 |
36547-36554 |
NN |
denotes |
protein |
| T21511 |
36555-36560 |
NN |
denotes |
DMRT7 |
| T21512 |
36561-36563 |
VBZ |
denotes |
is |
| T21506 |
36564-36572 |
VBN |
denotes |
required |
| T21513 |
36573-36576 |
IN |
denotes |
for |
| T21515 |
36577-36581 |
JJ |
denotes |
male |
| T21517 |
36582-36586 |
NN |
denotes |
germ |
| T21516 |
36587-36592 |
NNS |
denotes |
cells |
| T21518 |
36593-36595 |
TO |
denotes |
to |
| T21514 |
36596-36604 |
VB |
denotes |
complete |
| T21519 |
36605-36612 |
JJ |
denotes |
meiotic |
| T21520 |
36613-36621 |
NN |
denotes |
prophase |
| T21521 |
36622-36625 |
CC |
denotes |
but |
| T21522 |
36626-36628 |
VBZ |
denotes |
is |
| T21523 |
36629-36640 |
JJ |
denotes |
dispensable |
| T21524 |
36641-36643 |
IN |
denotes |
in |
| T21525 |
36644-36647 |
DT |
denotes |
the |
| T21527 |
36648-36654 |
JJ |
denotes |
female |
| T21528 |
36655-36659 |
NN |
denotes |
germ |
| T21526 |
36660-36664 |
NN |
denotes |
line |
| T21529 |
36664-36665 |
. |
denotes |
. |
| T21530 |
36665-36788 |
sentence |
denotes |
In males, DMRT7 expression is highest in pachytene spermatocytes, and the protein preferentially localizes to the XY body. |
| T21531 |
36666-36668 |
IN |
denotes |
In |
| T21533 |
36669-36674 |
NNS |
denotes |
males |
| T21534 |
36674-36676 |
, |
denotes |
, |
| T21535 |
36676-36681 |
NN |
denotes |
DMRT7 |
| T21536 |
36682-36692 |
NN |
denotes |
expression |
| T21532 |
36693-36695 |
VBZ |
denotes |
is |
| T21537 |
36696-36703 |
JJS |
denotes |
highest |
| T21538 |
36704-36706 |
IN |
denotes |
in |
| T21539 |
36707-36716 |
NN |
denotes |
pachytene |
| T21540 |
36717-36730 |
NNS |
denotes |
spermatocytes |
| T21541 |
36730-36732 |
, |
denotes |
, |
| T21542 |
36732-36735 |
CC |
denotes |
and |
| T21543 |
36736-36739 |
DT |
denotes |
the |
| T21544 |
36740-36747 |
NN |
denotes |
protein |
| T21546 |
36748-36762 |
RB |
denotes |
preferentially |
| T21545 |
36763-36772 |
VBZ |
denotes |
localizes |
| T21547 |
36773-36775 |
IN |
denotes |
to |
| T21548 |
36776-36779 |
DT |
denotes |
the |
| T21550 |
36780-36782 |
NN |
denotes |
XY |
| T21549 |
36783-36787 |
NN |
denotes |
body |
| T21551 |
36787-36788 |
. |
denotes |
. |
| T21552 |
36788-36982 |
sentence |
denotes |
Consistent with this expression, we found that most mutant male germ cells arrest in pachynema and undergo apoptosis, although a small proportion can progress to diplonema and sometimes beyond. |
| T21553 |
36789-36799 |
JJ |
denotes |
Consistent |
| T21555 |
36800-36804 |
IN |
denotes |
with |
| T21556 |
36805-36809 |
DT |
denotes |
this |
| T21557 |
36810-36820 |
NN |
denotes |
expression |
| T21558 |
36820-36822 |
, |
denotes |
, |
| T21559 |
36822-36824 |
PRP |
denotes |
we |
| T21554 |
36825-36830 |
VBD |
denotes |
found |
| T21560 |
36831-36835 |
IN |
denotes |
that |
| T21562 |
36836-36840 |
JJS |
denotes |
most |
| T21564 |
36841-36847 |
NN |
denotes |
mutant |
| T21565 |
36848-36852 |
JJ |
denotes |
male |
| T21566 |
36853-36857 |
NN |
denotes |
germ |
| T21563 |
36858-36863 |
NNS |
denotes |
cells |
| T21561 |
36864-36870 |
VBP |
denotes |
arrest |
| T21567 |
36871-36873 |
IN |
denotes |
in |
| T21568 |
36874-36883 |
NN |
denotes |
pachynema |
| T21569 |
36884-36887 |
CC |
denotes |
and |
| T21570 |
36888-36895 |
VBP |
denotes |
undergo |
| T21571 |
36896-36905 |
NN |
denotes |
apoptosis |
| T21572 |
36905-36907 |
, |
denotes |
, |
| T21573 |
36907-36915 |
IN |
denotes |
although |
| T21575 |
36916-36917 |
DT |
denotes |
a |
| T21577 |
36918-36923 |
JJ |
denotes |
small |
| T21576 |
36924-36934 |
NN |
denotes |
proportion |
| T21578 |
36935-36938 |
MD |
denotes |
can |
| T21574 |
36939-36947 |
VB |
denotes |
progress |
| T21579 |
36948-36950 |
IN |
denotes |
to |
| T21580 |
36951-36960 |
NN |
denotes |
diplonema |
| T21581 |
36961-36964 |
CC |
denotes |
and |
| T21582 |
36965-36974 |
RB |
denotes |
sometimes |
| T21583 |
36975-36981 |
RB |
denotes |
beyond |
| T21584 |
36981-36982 |
. |
denotes |
. |
| T21585 |
36982-37136 |
sentence |
denotes |
Examination of chromatin and nascent transcription in mutant cells that progressed to diplonema revealed sex chromatin abnormalities, as discussed below. |
| T21586 |
36983-36994 |
NN |
denotes |
Examination |
| T21588 |
36995-36997 |
IN |
denotes |
of |
| T21589 |
36998-37007 |
NN |
denotes |
chromatin |
| T21590 |
37008-37011 |
CC |
denotes |
and |
| T21591 |
37012-37019 |
JJ |
denotes |
nascent |
| T21592 |
37020-37033 |
NN |
denotes |
transcription |
| T21593 |
37034-37036 |
IN |
denotes |
in |
| T21594 |
37037-37043 |
NN |
denotes |
mutant |
| T21595 |
37044-37049 |
NNS |
denotes |
cells |
| T21596 |
37050-37054 |
WDT |
denotes |
that |
| T21597 |
37055-37065 |
VBD |
denotes |
progressed |
| T21598 |
37066-37068 |
IN |
denotes |
to |
| T21599 |
37069-37078 |
NN |
denotes |
diplonema |
| T21587 |
37079-37087 |
VBD |
denotes |
revealed |
| T21600 |
37088-37091 |
NN |
denotes |
sex |
| T21601 |
37092-37101 |
NN |
denotes |
chromatin |
| T21602 |
37102-37115 |
NNS |
denotes |
abnormalities |
| T21603 |
37115-37117 |
, |
denotes |
, |
| T21604 |
37117-37119 |
IN |
denotes |
as |
| T21605 |
37120-37129 |
VBN |
denotes |
discussed |
| T21606 |
37130-37135 |
RB |
denotes |
below |
| T21607 |
37135-37136 |
. |
denotes |
. |
| T21608 |
37136-37255 |
sentence |
denotes |
The pachytene stage of prophase involves tremendous chromosomal changes as the homologs align, synapse, and recombine. |
| T21609 |
37137-37140 |
DT |
denotes |
The |
| T21611 |
37141-37150 |
NN |
denotes |
pachytene |
| T21610 |
37151-37156 |
NN |
denotes |
stage |
| T21613 |
37157-37159 |
IN |
denotes |
of |
| T21614 |
37160-37168 |
NN |
denotes |
prophase |
| T21612 |
37169-37177 |
VBZ |
denotes |
involves |
| T21615 |
37178-37188 |
JJ |
denotes |
tremendous |
| T21617 |
37189-37200 |
JJ |
denotes |
chromosomal |
| T21616 |
37201-37208 |
NNS |
denotes |
changes |
| T21618 |
37209-37211 |
IN |
denotes |
as |
| T21620 |
37212-37215 |
DT |
denotes |
the |
| T21621 |
37216-37224 |
NNS |
denotes |
homologs |
| T21619 |
37225-37230 |
VBP |
denotes |
align |
| T21622 |
37230-37232 |
, |
denotes |
, |
| T21623 |
37232-37239 |
VBP |
denotes |
synapse |
| T21624 |
37239-37241 |
, |
denotes |
, |
| T21625 |
37241-37244 |
CC |
denotes |
and |
| T21626 |
37245-37254 |
VBP |
denotes |
recombine |
| T21627 |
37254-37255 |
. |
denotes |
. |
| T21628 |
37255-37371 |
sentence |
denotes |
During this period, at least one pachytene surveillance system exists to monitor key events of meiotic progression. |
| T21629 |
37256-37262 |
IN |
denotes |
During |
| T21631 |
37263-37267 |
DT |
denotes |
this |
| T21632 |
37268-37274 |
NN |
denotes |
period |
| T21633 |
37274-37276 |
, |
denotes |
, |
| T21634 |
37276-37278 |
RB |
denotes |
at |
| T21636 |
37279-37284 |
RBS |
denotes |
least |
| T21635 |
37285-37288 |
CD |
denotes |
one |
| T21638 |
37289-37298 |
NN |
denotes |
pachytene |
| T21639 |
37299-37311 |
NN |
denotes |
surveillance |
| T21637 |
37312-37318 |
NN |
denotes |
system |
| T21630 |
37319-37325 |
VBZ |
denotes |
exists |
| T21640 |
37326-37328 |
TO |
denotes |
to |
| T21641 |
37329-37336 |
VB |
denotes |
monitor |
| T21642 |
37337-37340 |
JJ |
denotes |
key |
| T21643 |
37341-37347 |
NNS |
denotes |
events |
| T21644 |
37348-37350 |
IN |
denotes |
of |
| T21645 |
37351-37358 |
JJ |
denotes |
meiotic |
| T21646 |
37359-37370 |
NN |
denotes |
progression |
| T21647 |
37370-37371 |
. |
denotes |
. |
| T21648 |
37371-37465 |
sentence |
denotes |
Cells in which any of these events is anomalous are efficiently eliminated by apoptosis [46]. |
| T21649 |
37372-37377 |
NNS |
denotes |
Cells |
| T21651 |
37378-37380 |
IN |
denotes |
in |
| T21653 |
37381-37386 |
WDT |
denotes |
which |
| T21654 |
37387-37390 |
DT |
denotes |
any |
| T21655 |
37391-37393 |
IN |
denotes |
of |
| T21656 |
37394-37399 |
DT |
denotes |
these |
| T21657 |
37400-37406 |
NNS |
denotes |
events |
| T21652 |
37407-37409 |
VBZ |
denotes |
is |
| T21658 |
37410-37419 |
JJ |
denotes |
anomalous |
| T21659 |
37420-37423 |
VBP |
denotes |
are |
| T21660 |
37424-37435 |
RB |
denotes |
efficiently |
| T21650 |
37436-37446 |
VBN |
denotes |
eliminated |
| T21661 |
37447-37449 |
IN |
denotes |
by |
| T21662 |
37450-37459 |
NN |
denotes |
apoptosis |
| T21663 |
37460-37461 |
-LRB- |
denotes |
[ |
| T21664 |
37461-37463 |
CD |
denotes |
46 |
| T21665 |
37463-37464 |
-RRB- |
denotes |
] |
| T21666 |
37464-37465 |
. |
denotes |
. |
| T21667 |
37465-37600 |
sentence |
denotes |
Another key event of pachynema in male mammals is the packaging of the sex chromosomes into the XY body and the establishment of MSCI. |
| T21668 |
37466-37473 |
DT |
denotes |
Another |
| T21670 |
37474-37477 |
JJ |
denotes |
key |
| T21669 |
37478-37483 |
NN |
denotes |
event |
| T21672 |
37484-37486 |
IN |
denotes |
of |
| T21673 |
37487-37496 |
NN |
denotes |
pachynema |
| T21674 |
37497-37499 |
IN |
denotes |
in |
| T21675 |
37500-37504 |
JJ |
denotes |
male |
| T21676 |
37505-37512 |
NNS |
denotes |
mammals |
| T21671 |
37513-37515 |
VBZ |
denotes |
is |
| T21677 |
37516-37519 |
DT |
denotes |
the |
| T21678 |
37520-37529 |
NN |
denotes |
packaging |
| T21679 |
37530-37532 |
IN |
denotes |
of |
| T21680 |
37533-37536 |
DT |
denotes |
the |
| T21682 |
37537-37540 |
NN |
denotes |
sex |
| T21681 |
37541-37552 |
NNS |
denotes |
chromosomes |
| T21683 |
37553-37557 |
IN |
denotes |
into |
| T21684 |
37558-37561 |
DT |
denotes |
the |
| T21686 |
37562-37564 |
NN |
denotes |
XY |
| T21685 |
37565-37569 |
NN |
denotes |
body |
| T21687 |
37570-37573 |
CC |
denotes |
and |
| T21688 |
37574-37577 |
DT |
denotes |
the |
| T21689 |
37578-37591 |
NN |
denotes |
establishment |
| T21690 |
37592-37594 |
IN |
denotes |
of |
| T21691 |
37595-37599 |
NN |
denotes |
MSCI |
| T21692 |
37599-37600 |
. |
denotes |
. |
| T21693 |
37600-37803 |
sentence |
denotes |
Examination of male meiosis in XYY mice and mice carrying a sex-chromosome-to-autosome translocation showed that cells in which a sex chromosome escapes MSCI are eliminated prior to late-pachynema [17]. |
| T21694 |
37601-37612 |
NN |
denotes |
Examination |
| T21696 |
37613-37615 |
IN |
denotes |
of |
| T21697 |
37616-37620 |
JJ |
denotes |
male |
| T21698 |
37621-37628 |
NN |
denotes |
meiosis |
| T21699 |
37629-37631 |
IN |
denotes |
in |
| T21700 |
37632-37635 |
NN |
denotes |
XYY |
| T21701 |
37636-37640 |
NNS |
denotes |
mice |
| T21702 |
37641-37644 |
CC |
denotes |
and |
| T21703 |
37645-37649 |
NNS |
denotes |
mice |
| T21704 |
37650-37658 |
VBG |
denotes |
carrying |
| T21705 |
37659-37660 |
DT |
denotes |
a |
| T21707 |
37661-37664 |
NN |
denotes |
sex |
| T21709 |
37664-37665 |
HYPH |
denotes |
- |
| T21708 |
37665-37675 |
NN |
denotes |
chromosome |
| T21710 |
37675-37676 |
HYPH |
denotes |
- |
| T21711 |
37676-37678 |
IN |
denotes |
to |
| T21712 |
37678-37679 |
HYPH |
denotes |
- |
| T21713 |
37679-37687 |
NN |
denotes |
autosome |
| T21706 |
37688-37701 |
NN |
denotes |
translocation |
| T21695 |
37702-37708 |
VBD |
denotes |
showed |
| T21714 |
37709-37713 |
IN |
denotes |
that |
| T21716 |
37714-37719 |
NNS |
denotes |
cells |
| T21717 |
37720-37722 |
IN |
denotes |
in |
| T21719 |
37723-37728 |
WDT |
denotes |
which |
| T21720 |
37729-37730 |
DT |
denotes |
a |
| T21722 |
37731-37734 |
NN |
denotes |
sex |
| T21721 |
37735-37745 |
NN |
denotes |
chromosome |
| T21718 |
37746-37753 |
VBZ |
denotes |
escapes |
| T21723 |
37754-37758 |
NN |
denotes |
MSCI |
| T21724 |
37759-37762 |
VBP |
denotes |
are |
| T21715 |
37763-37773 |
VBN |
denotes |
eliminated |
| T21725 |
37774-37779 |
IN |
denotes |
prior |
| T21726 |
37780-37782 |
IN |
denotes |
to |
| T21727 |
37783-37787 |
JJ |
denotes |
late |
| T21729 |
37787-37788 |
HYPH |
denotes |
- |
| T21728 |
37788-37797 |
NN |
denotes |
pachynema |
| T21730 |
37798-37799 |
-LRB- |
denotes |
[ |
| T21731 |
37799-37801 |
CD |
denotes |
17 |
| T21732 |
37801-37802 |
-RRB- |
denotes |
] |
| T21733 |
37802-37803 |
. |
denotes |
. |
| T21734 |
37803-37882 |
sentence |
denotes |
This indicates that the establishment of MSCI also is subject to surveillance. |
| T21735 |
37804-37808 |
DT |
denotes |
This |
| T21736 |
37809-37818 |
VBZ |
denotes |
indicates |
| T21737 |
37819-37823 |
IN |
denotes |
that |
| T21739 |
37824-37827 |
DT |
denotes |
the |
| T21740 |
37828-37841 |
NN |
denotes |
establishment |
| T21741 |
37842-37844 |
IN |
denotes |
of |
| T21742 |
37845-37849 |
NN |
denotes |
MSCI |
| T21743 |
37850-37854 |
RB |
denotes |
also |
| T21738 |
37855-37857 |
VBZ |
denotes |
is |
| T21744 |
37858-37865 |
JJ |
denotes |
subject |
| T21745 |
37866-37868 |
IN |
denotes |
to |
| T21746 |
37869-37881 |
NN |
denotes |
surveillance |
| T21747 |
37881-37882 |
. |
denotes |
. |
| T21748 |
37882-38092 |
sentence |
denotes |
Since the arrest and apoptosis of Dmrt7 mutant spermatocytes could result from perturbation of any of the critical pachytene events mentioned above, we tested whether they occur abnormally in the mutant cells. |
| T21749 |
37883-37888 |
IN |
denotes |
Since |
| T21751 |
37889-37892 |
DT |
denotes |
the |
| T21752 |
37893-37899 |
NN |
denotes |
arrest |
| T21753 |
37900-37903 |
CC |
denotes |
and |
| T21754 |
37904-37913 |
NN |
denotes |
apoptosis |
| T21755 |
37914-37916 |
IN |
denotes |
of |
| T21756 |
37917-37922 |
NN |
denotes |
Dmrt7 |
| T21757 |
37923-37929 |
NN |
denotes |
mutant |
| T21758 |
37930-37943 |
NNS |
denotes |
spermatocytes |
| T21759 |
37944-37949 |
MD |
denotes |
could |
| T21750 |
37950-37956 |
VB |
denotes |
result |
| T21761 |
37957-37961 |
IN |
denotes |
from |
| T21762 |
37962-37974 |
NN |
denotes |
perturbation |
| T21763 |
37975-37977 |
IN |
denotes |
of |
| T21764 |
37978-37981 |
DT |
denotes |
any |
| T21765 |
37982-37984 |
IN |
denotes |
of |
| T21766 |
37985-37988 |
DT |
denotes |
the |
| T21768 |
37989-37997 |
JJ |
denotes |
critical |
| T21769 |
37998-38007 |
NN |
denotes |
pachytene |
| T21767 |
38008-38014 |
NNS |
denotes |
events |
| T21770 |
38015-38024 |
VBN |
denotes |
mentioned |
| T21771 |
38025-38030 |
RB |
denotes |
above |
| T21772 |
38030-38032 |
, |
denotes |
, |
| T21773 |
38032-38034 |
PRP |
denotes |
we |
| T21760 |
38035-38041 |
VBD |
denotes |
tested |
| T21774 |
38042-38049 |
IN |
denotes |
whether |
| T21776 |
38050-38054 |
PRP |
denotes |
they |
| T21775 |
38055-38060 |
VBP |
denotes |
occur |
| T21777 |
38061-38071 |
RB |
denotes |
abnormally |
| T21778 |
38072-38074 |
IN |
denotes |
in |
| T21779 |
38075-38078 |
DT |
denotes |
the |
| T21781 |
38079-38085 |
NN |
denotes |
mutant |
| T21780 |
38086-38091 |
NNS |
denotes |
cells |
| T21782 |
38091-38092 |
. |
denotes |
. |
| T21783 |
38092-38182 |
sentence |
denotes |
We found that chromosomal synapsis and recombination appear normal in Dmrt7 mutant cells. |
| T21784 |
38093-38095 |
PRP |
denotes |
We |
| T21785 |
38096-38101 |
VBD |
denotes |
found |
| T21786 |
38102-38106 |
IN |
denotes |
that |
| T21788 |
38107-38118 |
JJ |
denotes |
chromosomal |
| T21789 |
38119-38127 |
NN |
denotes |
synapsis |
| T21790 |
38128-38131 |
CC |
denotes |
and |
| T21791 |
38132-38145 |
NN |
denotes |
recombination |
| T21787 |
38146-38152 |
VBP |
denotes |
appear |
| T21792 |
38153-38159 |
JJ |
denotes |
normal |
| T21793 |
38160-38162 |
IN |
denotes |
in |
| T21794 |
38163-38168 |
NN |
denotes |
Dmrt7 |
| T21795 |
38169-38175 |
NN |
denotes |
mutant |
| T21796 |
38176-38181 |
NNS |
denotes |
cells |
| T21797 |
38181-38182 |
. |
denotes |
. |
| T21798 |
38182-38266 |
sentence |
denotes |
We therefore focused on the XY body, the most prominent site of DMRT7 accumulation. |
| T21799 |
38183-38185 |
PRP |
denotes |
We |
| T21801 |
38186-38195 |
RB |
denotes |
therefore |
| T21800 |
38196-38203 |
VBD |
denotes |
focused |
| T21802 |
38204-38206 |
IN |
denotes |
on |
| T21803 |
38207-38210 |
DT |
denotes |
the |
| T21805 |
38211-38213 |
NN |
denotes |
XY |
| T21804 |
38214-38218 |
NN |
denotes |
body |
| T21806 |
38218-38220 |
, |
denotes |
, |
| T21807 |
38220-38223 |
DT |
denotes |
the |
| T21809 |
38224-38228 |
RBS |
denotes |
most |
| T21810 |
38229-38238 |
JJ |
denotes |
prominent |
| T21808 |
38239-38243 |
NN |
denotes |
site |
| T21811 |
38244-38246 |
IN |
denotes |
of |
| T21812 |
38247-38252 |
NN |
denotes |
DMRT7 |
| T21813 |
38253-38265 |
NN |
denotes |
accumulation |
| T21814 |
38265-38266 |
. |
denotes |
. |
| T21815 |
38266-38356 |
sentence |
denotes |
First, we tested whether the XY body forms and MSCI is established in Dmrt7 mutant cells. |
| T21816 |
38267-38272 |
RB |
denotes |
First |
| T21818 |
38272-38274 |
, |
denotes |
, |
| T21819 |
38274-38276 |
PRP |
denotes |
we |
| T21817 |
38277-38283 |
VBD |
denotes |
tested |
| T21820 |
38284-38291 |
IN |
denotes |
whether |
| T21822 |
38292-38295 |
DT |
denotes |
the |
| T21824 |
38296-38298 |
NN |
denotes |
XY |
| T21823 |
38299-38303 |
NN |
denotes |
body |
| T21821 |
38304-38309 |
VBZ |
denotes |
forms |
| T21825 |
38310-38313 |
CC |
denotes |
and |
| T21826 |
38314-38318 |
NN |
denotes |
MSCI |
| T21828 |
38319-38321 |
VBZ |
denotes |
is |
| T21827 |
38322-38333 |
VBN |
denotes |
established |
| T21829 |
38334-38336 |
IN |
denotes |
in |
| T21830 |
38337-38342 |
NN |
denotes |
Dmrt7 |
| T21831 |
38343-38349 |
NN |
denotes |
mutant |
| T21832 |
38350-38355 |
NNS |
denotes |
cells |
| T21833 |
38355-38356 |
. |
denotes |
. |
| T21834 |
38356-38499 |
sentence |
denotes |
Surprisingly, we found that these cells form an XY body with normal morphology and proper accumulation of all the chromatin marks we examined. |
| T21835 |
38357-38369 |
RB |
denotes |
Surprisingly |
| T21837 |
38369-38371 |
, |
denotes |
, |
| T21838 |
38371-38373 |
PRP |
denotes |
we |
| T21836 |
38374-38379 |
VBD |
denotes |
found |
| T21839 |
38380-38384 |
IN |
denotes |
that |
| T21841 |
38385-38390 |
DT |
denotes |
these |
| T21842 |
38391-38396 |
NNS |
denotes |
cells |
| T21840 |
38397-38401 |
VBP |
denotes |
form |
| T21843 |
38402-38404 |
DT |
denotes |
an |
| T21845 |
38405-38407 |
NN |
denotes |
XY |
| T21844 |
38408-38412 |
NN |
denotes |
body |
| T21846 |
38413-38417 |
IN |
denotes |
with |
| T21847 |
38418-38424 |
JJ |
denotes |
normal |
| T21848 |
38425-38435 |
NN |
denotes |
morphology |
| T21849 |
38436-38439 |
CC |
denotes |
and |
| T21850 |
38440-38446 |
JJ |
denotes |
proper |
| T21851 |
38447-38459 |
NN |
denotes |
accumulation |
| T21852 |
38460-38462 |
IN |
denotes |
of |
| T21853 |
38463-38466 |
PDT |
denotes |
all |
| T21855 |
38467-38470 |
DT |
denotes |
the |
| T21856 |
38471-38480 |
NN |
denotes |
chromatin |
| T21854 |
38481-38486 |
NNS |
denotes |
marks |
| T21857 |
38487-38489 |
PRP |
denotes |
we |
| T21858 |
38490-38498 |
VBD |
denotes |
examined |
| T21859 |
38498-38499 |
. |
denotes |
. |
| T21860 |
38499-38655 |
sentence |
denotes |
Moreover, Cot-1 hybridization and analysis of RBMY expression demonstrated that MSCI initiates normally in the XY body of mid-pachytene Dmrt7 mutant cells. |
| T21861 |
38500-38508 |
RB |
denotes |
Moreover |
| T21863 |
38508-38510 |
, |
denotes |
, |
| T21864 |
38510-38513 |
NN |
denotes |
Cot |
| T21866 |
38513-38514 |
HYPH |
denotes |
- |
| T21867 |
38514-38515 |
CD |
denotes |
1 |
| T21865 |
38516-38529 |
NN |
denotes |
hybridization |
| T21868 |
38530-38533 |
CC |
denotes |
and |
| T21869 |
38534-38542 |
NN |
denotes |
analysis |
| T21870 |
38543-38545 |
IN |
denotes |
of |
| T21871 |
38546-38550 |
NN |
denotes |
RBMY |
| T21872 |
38551-38561 |
NN |
denotes |
expression |
| T21862 |
38562-38574 |
VBD |
denotes |
demonstrated |
| T21873 |
38575-38579 |
IN |
denotes |
that |
| T21875 |
38580-38584 |
NN |
denotes |
MSCI |
| T21874 |
38585-38594 |
VBZ |
denotes |
initiates |
| T21876 |
38595-38603 |
RB |
denotes |
normally |
| T21877 |
38604-38606 |
IN |
denotes |
in |
| T21878 |
38607-38610 |
DT |
denotes |
the |
| T21880 |
38611-38613 |
NN |
denotes |
XY |
| T21879 |
38614-38618 |
NN |
denotes |
body |
| T21881 |
38619-38621 |
IN |
denotes |
of |
| T21882 |
38622-38635 |
NN |
denotes |
mid-pachytene |
| T21884 |
38636-38641 |
NN |
denotes |
Dmrt7 |
| T21885 |
38642-38648 |
NN |
denotes |
mutant |
| T21883 |
38649-38654 |
NNS |
denotes |
cells |
| T21886 |
38654-38655 |
. |
denotes |
. |
| T21887 |
38655-38818 |
sentence |
denotes |
We did, however, observe three specific defects in the sex chromatin of Dmrt7 mutant germ cells that avoided arrest in pachynema and were able to enter diplonema. |
| T21888 |
38656-38658 |
PRP |
denotes |
We |
| T21890 |
38659-38662 |
VBD |
denotes |
did |
| T21891 |
38662-38664 |
, |
denotes |
, |
| T21892 |
38664-38671 |
RB |
denotes |
however |
| T21893 |
38671-38673 |
, |
denotes |
, |
| T21889 |
38673-38680 |
VB |
denotes |
observe |
| T21894 |
38681-38686 |
CD |
denotes |
three |
| T21896 |
38687-38695 |
JJ |
denotes |
specific |
| T21895 |
38696-38703 |
NNS |
denotes |
defects |
| T21897 |
38704-38706 |
IN |
denotes |
in |
| T21898 |
38707-38710 |
DT |
denotes |
the |
| T21900 |
38711-38714 |
NN |
denotes |
sex |
| T21899 |
38715-38724 |
NN |
denotes |
chromatin |
| T21901 |
38725-38727 |
IN |
denotes |
of |
| T21902 |
38728-38733 |
NN |
denotes |
Dmrt7 |
| T21903 |
38734-38740 |
NN |
denotes |
mutant |
| T21905 |
38741-38745 |
NN |
denotes |
germ |
| T21904 |
38746-38751 |
NNS |
denotes |
cells |
| T21906 |
38752-38756 |
WDT |
denotes |
that |
| T21907 |
38757-38764 |
VBD |
denotes |
avoided |
| T21908 |
38765-38771 |
NN |
denotes |
arrest |
| T21909 |
38772-38774 |
IN |
denotes |
in |
| T21910 |
38775-38784 |
NN |
denotes |
pachynema |
| T21911 |
38785-38788 |
CC |
denotes |
and |
| T21912 |
38789-38793 |
VBD |
denotes |
were |
| T21913 |
38794-38798 |
JJ |
denotes |
able |
| T21914 |
38799-38801 |
TO |
denotes |
to |
| T21915 |
38802-38807 |
VB |
denotes |
enter |
| T21916 |
38808-38817 |
NN |
denotes |
diplonema |
| T21917 |
38817-38818 |
. |
denotes |
. |
| T21918 |
38818-39004 |
sentence |
denotes |
Normally cells accumulate H3-2meK9 and H3-3meK9 marks and HP1β protein on the sex chromatin as they progress to diplonema, but we observed mutant diplotene cells lacking these features. |
| T21919 |
38819-38827 |
RB |
denotes |
Normally |
| T21921 |
38828-38833 |
NNS |
denotes |
cells |
| T21920 |
38834-38844 |
VBP |
denotes |
accumulate |
| T21922 |
38845-38847 |
NN |
denotes |
H3 |
| T21924 |
38847-38848 |
HYPH |
denotes |
- |
| T21923 |
38848-38853 |
NN |
denotes |
2meK9 |
| T21926 |
38854-38857 |
CC |
denotes |
and |
| T21927 |
38858-38860 |
NN |
denotes |
H3 |
| T21929 |
38860-38861 |
HYPH |
denotes |
- |
| T21928 |
38861-38866 |
NN |
denotes |
3meK9 |
| T21925 |
38867-38872 |
NNS |
denotes |
marks |
| T21930 |
38873-38876 |
CC |
denotes |
and |
| T21931 |
38877-38881 |
NN |
denotes |
HP1β |
| T21932 |
38882-38889 |
NN |
denotes |
protein |
| T21933 |
38890-38892 |
IN |
denotes |
on |
| T21934 |
38893-38896 |
DT |
denotes |
the |
| T21936 |
38897-38900 |
NN |
denotes |
sex |
| T21935 |
38901-38910 |
NN |
denotes |
chromatin |
| T21937 |
38911-38913 |
IN |
denotes |
as |
| T21939 |
38914-38918 |
PRP |
denotes |
they |
| T21938 |
38919-38927 |
VBP |
denotes |
progress |
| T21940 |
38928-38930 |
IN |
denotes |
to |
| T21941 |
38931-38940 |
NN |
denotes |
diplonema |
| T21942 |
38940-38942 |
, |
denotes |
, |
| T21943 |
38942-38945 |
CC |
denotes |
but |
| T21944 |
38946-38948 |
PRP |
denotes |
we |
| T21945 |
38949-38957 |
VBD |
denotes |
observed |
| T21946 |
38958-38964 |
NN |
denotes |
mutant |
| T21948 |
38965-38974 |
NN |
denotes |
diplotene |
| T21947 |
38975-38980 |
NNS |
denotes |
cells |
| T21949 |
38981-38988 |
VBG |
denotes |
lacking |
| T21950 |
38989-38994 |
DT |
denotes |
these |
| T21951 |
38995-39003 |
NNS |
denotes |
features |
| T21952 |
39003-39004 |
. |
denotes |
. |
| T21953 |
39004-39170 |
sentence |
denotes |
Thus, although a minority of Dmrt7 mutant germ cells can progress from pachynema to diplonema, there are defects in sex chromatin modification during the transition. |
| T21954 |
39005-39009 |
RB |
denotes |
Thus |
| T21956 |
39009-39011 |
, |
denotes |
, |
| T21957 |
39011-39019 |
IN |
denotes |
although |
| T21959 |
39020-39021 |
DT |
denotes |
a |
| T21960 |
39022-39030 |
NN |
denotes |
minority |
| T21961 |
39031-39033 |
IN |
denotes |
of |
| T21962 |
39034-39039 |
NN |
denotes |
Dmrt7 |
| T21963 |
39040-39046 |
NN |
denotes |
mutant |
| T21965 |
39047-39051 |
NN |
denotes |
germ |
| T21964 |
39052-39057 |
NNS |
denotes |
cells |
| T21966 |
39058-39061 |
MD |
denotes |
can |
| T21958 |
39062-39070 |
VB |
denotes |
progress |
| T21967 |
39071-39075 |
IN |
denotes |
from |
| T21968 |
39076-39085 |
NN |
denotes |
pachynema |
| T21969 |
39086-39088 |
IN |
denotes |
to |
| T21970 |
39089-39098 |
NN |
denotes |
diplonema |
| T21971 |
39098-39100 |
, |
denotes |
, |
| T21972 |
39100-39105 |
EX |
denotes |
there |
| T21955 |
39106-39109 |
VBP |
denotes |
are |
| T21973 |
39110-39117 |
NNS |
denotes |
defects |
| T21974 |
39118-39120 |
IN |
denotes |
in |
| T21975 |
39121-39124 |
NN |
denotes |
sex |
| T21976 |
39125-39134 |
NN |
denotes |
chromatin |
| T21977 |
39135-39147 |
NN |
denotes |
modification |
| T21978 |
39148-39154 |
IN |
denotes |
during |
| T21979 |
39155-39158 |
DT |
denotes |
the |
| T21980 |
39159-39169 |
NN |
denotes |
transition |
| T21981 |
39169-39170 |
. |
denotes |
. |
| T21982 |
39170-39317 |
sentence |
denotes |
A function in male sex chromatin can reconcile the findings that DMRT7 is required for meiosis, but only in males, and is present only in mammals. |
| T21983 |
39171-39172 |
DT |
denotes |
A |
| T21984 |
39173-39181 |
NN |
denotes |
function |
| T21986 |
39182-39184 |
IN |
denotes |
in |
| T21987 |
39185-39189 |
JJ |
denotes |
male |
| T21989 |
39190-39193 |
NN |
denotes |
sex |
| T21988 |
39194-39203 |
NN |
denotes |
chromatin |
| T21990 |
39204-39207 |
MD |
denotes |
can |
| T21985 |
39208-39217 |
VB |
denotes |
reconcile |
| T21991 |
39218-39221 |
DT |
denotes |
the |
| T21992 |
39222-39230 |
NNS |
denotes |
findings |
| T21993 |
39231-39235 |
IN |
denotes |
that |
| T21995 |
39236-39241 |
NN |
denotes |
DMRT7 |
| T21996 |
39242-39244 |
VBZ |
denotes |
is |
| T21994 |
39245-39253 |
VBN |
denotes |
required |
| T21997 |
39254-39257 |
IN |
denotes |
for |
| T21998 |
39258-39265 |
NN |
denotes |
meiosis |
| T21999 |
39265-39267 |
, |
denotes |
, |
| T22000 |
39267-39270 |
CC |
denotes |
but |
| T22001 |
39271-39275 |
RB |
denotes |
only |
| T22002 |
39276-39278 |
IN |
denotes |
in |
| T22003 |
39279-39284 |
NNS |
denotes |
males |
| T22004 |
39284-39286 |
, |
denotes |
, |
| T22005 |
39286-39289 |
CC |
denotes |
and |
| T22006 |
39290-39292 |
VBZ |
denotes |
is |
| T22007 |
39293-39300 |
JJ |
denotes |
present |
| T22008 |
39301-39305 |
RB |
denotes |
only |
| T22009 |
39306-39308 |
IN |
denotes |
in |
| T22010 |
39309-39316 |
NNS |
denotes |
mammals |
| T22011 |
39316-39317 |
. |
denotes |
. |
| T22012 |
39317-39488 |
sentence |
denotes |
A proportion of mutant diplotene cells have apparently normal sex chromatin (for example, Figure 8M); these are likely to be the cells that can progress beyond diplonema. |
| T22013 |
39318-39319 |
DT |
denotes |
A |
| T22014 |
39320-39330 |
NN |
denotes |
proportion |
| T22016 |
39331-39333 |
IN |
denotes |
of |
| T22017 |
39334-39340 |
NN |
denotes |
mutant |
| T22019 |
39341-39350 |
NN |
denotes |
diplotene |
| T22018 |
39351-39356 |
NNS |
denotes |
cells |
| T22015 |
39357-39361 |
VBP |
denotes |
have |
| T22021 |
39362-39372 |
RB |
denotes |
apparently |
| T22022 |
39373-39379 |
JJ |
denotes |
normal |
| T22024 |
39380-39383 |
NN |
denotes |
sex |
| T22023 |
39384-39393 |
NN |
denotes |
chromatin |
| T22025 |
39394-39395 |
-LRB- |
denotes |
( |
| T22027 |
39395-39398 |
IN |
denotes |
for |
| T22028 |
39399-39406 |
NN |
denotes |
example |
| T22029 |
39406-39408 |
, |
denotes |
, |
| T22030 |
39408-39414 |
NN |
denotes |
Figure |
| T22026 |
39415-39417 |
NN |
denotes |
8M |
| T22031 |
39417-39418 |
-RRB- |
denotes |
) |
| T22032 |
39418-39419 |
: |
denotes |
; |
| T22033 |
39420-39425 |
DT |
denotes |
these |
| T22020 |
39426-39429 |
VBP |
denotes |
are |
| T22034 |
39430-39436 |
JJ |
denotes |
likely |
| T22035 |
39437-39439 |
TO |
denotes |
to |
| T22036 |
39440-39442 |
VB |
denotes |
be |
| T22037 |
39443-39446 |
DT |
denotes |
the |
| T22038 |
39447-39452 |
NNS |
denotes |
cells |
| T22039 |
39453-39457 |
WDT |
denotes |
that |
| T22041 |
39458-39461 |
MD |
denotes |
can |
| T22040 |
39462-39470 |
VB |
denotes |
progress |
| T22042 |
39471-39477 |
IN |
denotes |
beyond |
| T22043 |
39478-39487 |
NN |
denotes |
diplonema |
| T22044 |
39487-39488 |
. |
denotes |
. |
| T22045 |
39488-39697 |
sentence |
denotes |
Because most Dmrt7 mutant germ cells are eliminated by apoptosis around the time at which we observed sex chromatin defects, a simple model is that the apoptosis is a consequence of the sex chromatin defects. |
| T22046 |
39489-39496 |
IN |
denotes |
Because |
| T22048 |
39497-39501 |
JJS |
denotes |
most |
| T22050 |
39502-39507 |
NN |
denotes |
Dmrt7 |
| T22051 |
39508-39514 |
NN |
denotes |
mutant |
| T22052 |
39515-39519 |
NN |
denotes |
germ |
| T22049 |
39520-39525 |
NNS |
denotes |
cells |
| T22053 |
39526-39529 |
VBP |
denotes |
are |
| T22047 |
39530-39540 |
VBN |
denotes |
eliminated |
| T22055 |
39541-39543 |
IN |
denotes |
by |
| T22056 |
39544-39553 |
NN |
denotes |
apoptosis |
| T22057 |
39554-39560 |
IN |
denotes |
around |
| T22058 |
39561-39564 |
DT |
denotes |
the |
| T22059 |
39565-39569 |
NN |
denotes |
time |
| T22060 |
39570-39572 |
IN |
denotes |
at |
| T22062 |
39573-39578 |
WDT |
denotes |
which |
| T22063 |
39579-39581 |
PRP |
denotes |
we |
| T22061 |
39582-39590 |
VBD |
denotes |
observed |
| T22064 |
39591-39594 |
NN |
denotes |
sex |
| T22066 |
39595-39604 |
NN |
denotes |
chromatin |
| T22065 |
39605-39612 |
NNS |
denotes |
defects |
| T22067 |
39612-39614 |
, |
denotes |
, |
| T22068 |
39614-39615 |
DT |
denotes |
a |
| T22070 |
39616-39622 |
JJ |
denotes |
simple |
| T22069 |
39623-39628 |
NN |
denotes |
model |
| T22054 |
39629-39631 |
VBZ |
denotes |
is |
| T22071 |
39632-39636 |
IN |
denotes |
that |
| T22073 |
39637-39640 |
DT |
denotes |
the |
| T22074 |
39641-39650 |
NN |
denotes |
apoptosis |
| T22072 |
39651-39653 |
VBZ |
denotes |
is |
| T22075 |
39654-39655 |
DT |
denotes |
a |
| T22076 |
39656-39667 |
NN |
denotes |
consequence |
| T22077 |
39668-39670 |
IN |
denotes |
of |
| T22078 |
39671-39674 |
DT |
denotes |
the |
| T22080 |
39675-39678 |
NN |
denotes |
sex |
| T22081 |
39679-39688 |
NN |
denotes |
chromatin |
| T22079 |
39689-39696 |
NNS |
denotes |
defects |
| T22082 |
39696-39697 |
. |
denotes |
. |
| T22083 |
39697-39892 |
sentence |
denotes |
The reciprocal situation (sex chromatin defects caused by apoptosis) is possible, but seems unlikely, because we observed mutant cells with sex chromatin defects but no indications of apoptosis. |
| T22084 |
39698-39701 |
DT |
denotes |
The |
| T22086 |
39702-39712 |
JJ |
denotes |
reciprocal |
| T22085 |
39713-39722 |
NN |
denotes |
situation |
| T22088 |
39723-39724 |
-LRB- |
denotes |
( |
| T22090 |
39724-39727 |
NN |
denotes |
sex |
| T22091 |
39728-39737 |
NN |
denotes |
chromatin |
| T22089 |
39738-39745 |
NNS |
denotes |
defects |
| T22092 |
39746-39752 |
VBN |
denotes |
caused |
| T22093 |
39753-39755 |
IN |
denotes |
by |
| T22094 |
39756-39765 |
NN |
denotes |
apoptosis |
| T22095 |
39765-39766 |
-RRB- |
denotes |
) |
| T22087 |
39767-39769 |
VBZ |
denotes |
is |
| T22096 |
39770-39778 |
JJ |
denotes |
possible |
| T22097 |
39778-39780 |
, |
denotes |
, |
| T22098 |
39780-39783 |
CC |
denotes |
but |
| T22099 |
39784-39789 |
VBZ |
denotes |
seems |
| T22100 |
39790-39798 |
JJ |
denotes |
unlikely |
| T22101 |
39798-39800 |
, |
denotes |
, |
| T22102 |
39800-39807 |
IN |
denotes |
because |
| T22104 |
39808-39810 |
PRP |
denotes |
we |
| T22103 |
39811-39819 |
VBD |
denotes |
observed |
| T22105 |
39820-39826 |
NN |
denotes |
mutant |
| T22106 |
39827-39832 |
NNS |
denotes |
cells |
| T22107 |
39833-39837 |
IN |
denotes |
with |
| T22108 |
39838-39841 |
NN |
denotes |
sex |
| T22109 |
39842-39851 |
NN |
denotes |
chromatin |
| T22110 |
39852-39859 |
NNS |
denotes |
defects |
| T22111 |
39860-39863 |
CC |
denotes |
but |
| T22112 |
39864-39866 |
DT |
denotes |
no |
| T22113 |
39867-39878 |
NNS |
denotes |
indications |
| T22114 |
39879-39881 |
IN |
denotes |
of |
| T22115 |
39882-39891 |
NN |
denotes |
apoptosis |
| T22116 |
39891-39892 |
. |
denotes |
. |
| T22117 |
39892-39995 |
sentence |
denotes |
Alternatively, apoptosis and abnormal sex chromatin may be two independent consequences of Dmrt7 loss. |
| T22118 |
39893-39906 |
RB |
denotes |
Alternatively |
| T22120 |
39906-39908 |
, |
denotes |
, |
| T22121 |
39908-39917 |
NN |
denotes |
apoptosis |
| T22122 |
39918-39921 |
CC |
denotes |
and |
| T22123 |
39922-39930 |
JJ |
denotes |
abnormal |
| T22125 |
39931-39934 |
NN |
denotes |
sex |
| T22124 |
39935-39944 |
NN |
denotes |
chromatin |
| T22126 |
39945-39948 |
MD |
denotes |
may |
| T22119 |
39949-39951 |
VB |
denotes |
be |
| T22127 |
39952-39955 |
CD |
denotes |
two |
| T22129 |
39956-39967 |
JJ |
denotes |
independent |
| T22128 |
39968-39980 |
NNS |
denotes |
consequences |
| T22130 |
39981-39983 |
IN |
denotes |
of |
| T22131 |
39984-39989 |
NN |
denotes |
Dmrt7 |
| T22132 |
39990-39994 |
NN |
denotes |
loss |
| T22133 |
39994-39995 |
. |
denotes |
. |
| T22134 |
39995-40098 |
sentence |
denotes |
This question cannot be answered definitively until we know the detailed molecular mechanism of DMRT7. |
| T22135 |
39996-40000 |
DT |
denotes |
This |
| T22136 |
40001-40009 |
NN |
denotes |
question |
| T22138 |
40010-40013 |
MD |
denotes |
can |
| T22139 |
40013-40016 |
RB |
denotes |
not |
| T22140 |
40017-40019 |
VB |
denotes |
be |
| T22137 |
40020-40028 |
VBN |
denotes |
answered |
| T22141 |
40029-40041 |
RB |
denotes |
definitively |
| T22142 |
40042-40047 |
IN |
denotes |
until |
| T22144 |
40048-40050 |
PRP |
denotes |
we |
| T22143 |
40051-40055 |
VBP |
denotes |
know |
| T22145 |
40056-40059 |
DT |
denotes |
the |
| T22147 |
40060-40068 |
JJ |
denotes |
detailed |
| T22148 |
40069-40078 |
JJ |
denotes |
molecular |
| T22146 |
40079-40088 |
NN |
denotes |
mechanism |
| T22149 |
40089-40091 |
IN |
denotes |
of |
| T22150 |
40092-40097 |
NN |
denotes |
DMRT7 |
| T22151 |
40097-40098 |
. |
denotes |
. |
| T22152 |
40098-40380 |
sentence |
denotes |
A number of other proteins have been identified that interact with the XY body, including histone variants and modified histones, a testis-specific histone methyl transferase, chromobox proteins, an orphan receptor germ-cell nuclear factor, and recombination-related proteins [60]. |
| T22153 |
40099-40100 |
DT |
denotes |
A |
| T22154 |
40101-40107 |
NN |
denotes |
number |
| T22156 |
40108-40110 |
IN |
denotes |
of |
| T22157 |
40111-40116 |
JJ |
denotes |
other |
| T22158 |
40117-40125 |
NN |
denotes |
proteins |
| T22159 |
40126-40130 |
VBP |
denotes |
have |
| T22160 |
40131-40135 |
VBN |
denotes |
been |
| T22155 |
40136-40146 |
VBN |
denotes |
identified |
| T22161 |
40147-40151 |
WDT |
denotes |
that |
| T22162 |
40152-40160 |
VBP |
denotes |
interact |
| T22163 |
40161-40165 |
IN |
denotes |
with |
| T22164 |
40166-40169 |
DT |
denotes |
the |
| T22166 |
40170-40172 |
NN |
denotes |
XY |
| T22165 |
40173-40177 |
NN |
denotes |
body |
| T22167 |
40177-40179 |
, |
denotes |
, |
| T22168 |
40179-40188 |
VBG |
denotes |
including |
| T22169 |
40189-40196 |
NN |
denotes |
histone |
| T22170 |
40197-40205 |
NNS |
denotes |
variants |
| T22171 |
40206-40209 |
CC |
denotes |
and |
| T22172 |
40210-40218 |
VBN |
denotes |
modified |
| T22173 |
40219-40227 |
NNS |
denotes |
histones |
| T22174 |
40227-40229 |
, |
denotes |
, |
| T22175 |
40229-40230 |
DT |
denotes |
a |
| T22177 |
40231-40237 |
NN |
denotes |
testis |
| T22179 |
40237-40238 |
HYPH |
denotes |
- |
| T22178 |
40238-40246 |
JJ |
denotes |
specific |
| T22180 |
40247-40254 |
NN |
denotes |
histone |
| T22181 |
40255-40261 |
NN |
denotes |
methyl |
| T22176 |
40262-40273 |
NN |
denotes |
transferase |
| T22182 |
40273-40275 |
, |
denotes |
, |
| T22183 |
40275-40284 |
NN |
denotes |
chromobox |
| T22184 |
40285-40293 |
NN |
denotes |
proteins |
| T22185 |
40293-40295 |
, |
denotes |
, |
| T22186 |
40295-40297 |
DT |
denotes |
an |
| T22188 |
40298-40304 |
NN |
denotes |
orphan |
| T22189 |
40305-40313 |
NN |
denotes |
receptor |
| T22190 |
40314-40318 |
NN |
denotes |
germ |
| T22192 |
40318-40319 |
HYPH |
denotes |
- |
| T22191 |
40319-40323 |
NN |
denotes |
cell |
| T22193 |
40324-40331 |
JJ |
denotes |
nuclear |
| T22187 |
40332-40338 |
NN |
denotes |
factor |
| T22194 |
40338-40340 |
, |
denotes |
, |
| T22195 |
40340-40343 |
CC |
denotes |
and |
| T22196 |
40344-40357 |
NN |
denotes |
recombination |
| T22198 |
40357-40358 |
HYPH |
denotes |
- |
| T22197 |
40358-40365 |
VBN |
denotes |
related |
| T22199 |
40366-40374 |
NN |
denotes |
proteins |
| T22200 |
40375-40376 |
-LRB- |
denotes |
[ |
| T22201 |
40376-40378 |
CD |
denotes |
60 |
| T22202 |
40378-40379 |
-RRB- |
denotes |
] |
| T22203 |
40379-40380 |
. |
denotes |
. |
| T22204 |
40380-40486 |
sentence |
denotes |
A common feature of these proteins is involvement with heterochromatin and/or transcriptional repression. |
| T22205 |
40381-40382 |
DT |
denotes |
A |
| T22207 |
40383-40389 |
JJ |
denotes |
common |
| T22206 |
40390-40397 |
NN |
denotes |
feature |
| T22209 |
40398-40400 |
IN |
denotes |
of |
| T22210 |
40401-40406 |
DT |
denotes |
these |
| T22211 |
40407-40415 |
NN |
denotes |
proteins |
| T22208 |
40416-40418 |
VBZ |
denotes |
is |
| T22212 |
40419-40430 |
NN |
denotes |
involvement |
| T22213 |
40431-40435 |
IN |
denotes |
with |
| T22214 |
40436-40451 |
NN |
denotes |
heterochromatin |
| T22216 |
40452-40455 |
CC |
denotes |
and |
| T22217 |
40455-40456 |
HYPH |
denotes |
/ |
| T22218 |
40456-40458 |
CC |
denotes |
or |
| T22219 |
40459-40474 |
JJ |
denotes |
transcriptional |
| T22215 |
40475-40485 |
NN |
denotes |
repression |
| T22220 |
40485-40486 |
. |
denotes |
. |
| T22221 |
40486-40595 |
sentence |
denotes |
DMRT7 is unusual among XY body proteins in being related to highly site-specific transcriptional regulators. |
| T22222 |
40487-40492 |
NN |
denotes |
DMRT7 |
| T22223 |
40493-40495 |
VBZ |
denotes |
is |
| T22224 |
40496-40503 |
JJ |
denotes |
unusual |
| T22225 |
40504-40509 |
IN |
denotes |
among |
| T22226 |
40510-40512 |
NN |
denotes |
XY |
| T22228 |
40513-40517 |
NN |
denotes |
body |
| T22227 |
40518-40526 |
NN |
denotes |
proteins |
| T22229 |
40527-40529 |
IN |
denotes |
in |
| T22230 |
40530-40535 |
VBG |
denotes |
being |
| T22231 |
40536-40543 |
JJ |
denotes |
related |
| T22232 |
40544-40546 |
IN |
denotes |
to |
| T22233 |
40547-40553 |
RB |
denotes |
highly |
| T22235 |
40554-40558 |
NN |
denotes |
site |
| T22236 |
40558-40559 |
HYPH |
denotes |
- |
| T22234 |
40559-40567 |
JJ |
denotes |
specific |
| T22238 |
40568-40583 |
JJ |
denotes |
transcriptional |
| T22237 |
40584-40594 |
NNS |
denotes |
regulators |
| T22239 |
40594-40595 |
. |
denotes |
. |
| T22240 |
40595-40777 |
sentence |
denotes |
An attractive speculation is that DMRT7 may provide sequence specificity in recruiting other proteins, such as chromatin modifiers, to the XY body as part of the transition to PMSC. |
| T22241 |
40596-40598 |
DT |
denotes |
An |
| T22243 |
40599-40609 |
JJ |
denotes |
attractive |
| T22242 |
40610-40621 |
NN |
denotes |
speculation |
| T22244 |
40622-40624 |
VBZ |
denotes |
is |
| T22245 |
40625-40629 |
IN |
denotes |
that |
| T22247 |
40630-40635 |
NN |
denotes |
DMRT7 |
| T22248 |
40636-40639 |
MD |
denotes |
may |
| T22246 |
40640-40647 |
VB |
denotes |
provide |
| T22249 |
40648-40656 |
NN |
denotes |
sequence |
| T22250 |
40657-40668 |
NN |
denotes |
specificity |
| T22251 |
40669-40671 |
IN |
denotes |
in |
| T22252 |
40672-40682 |
VBG |
denotes |
recruiting |
| T22253 |
40683-40688 |
JJ |
denotes |
other |
| T22254 |
40689-40697 |
NN |
denotes |
proteins |
| T22255 |
40697-40699 |
, |
denotes |
, |
| T22256 |
40699-40703 |
JJ |
denotes |
such |
| T22257 |
40704-40706 |
IN |
denotes |
as |
| T22258 |
40707-40716 |
NN |
denotes |
chromatin |
| T22259 |
40717-40726 |
NNS |
denotes |
modifiers |
| T22260 |
40726-40728 |
, |
denotes |
, |
| T22261 |
40728-40730 |
IN |
denotes |
to |
| T22262 |
40731-40734 |
DT |
denotes |
the |
| T22264 |
40735-40737 |
NN |
denotes |
XY |
| T22263 |
40738-40742 |
NN |
denotes |
body |
| T22265 |
40743-40745 |
IN |
denotes |
as |
| T22266 |
40746-40750 |
NN |
denotes |
part |
| T22267 |
40751-40753 |
IN |
denotes |
of |
| T22268 |
40754-40757 |
DT |
denotes |
the |
| T22269 |
40758-40768 |
NN |
denotes |
transition |
| T22270 |
40769-40771 |
IN |
denotes |
to |
| T22271 |
40772-40776 |
NN |
denotes |
PMSC |
| T22272 |
40776-40777 |
. |
denotes |
. |
| T22273 |
40777-41001 |
sentence |
denotes |
Chromatin regulation may be a common mechanism for DM domain proteins, as we find that other DM domain proteins associate with chromatin modifying complexes (M. W. Murphy, D. Zarkower, and V. J. Bardwell, unpublished data). |
| T22274 |
40778-40787 |
NN |
denotes |
Chromatin |
| T22275 |
40788-40798 |
NN |
denotes |
regulation |
| T22277 |
40799-40802 |
MD |
denotes |
may |
| T22276 |
40803-40805 |
VB |
denotes |
be |
| T22278 |
40806-40807 |
DT |
denotes |
a |
| T22280 |
40808-40814 |
JJ |
denotes |
common |
| T22279 |
40815-40824 |
NN |
denotes |
mechanism |
| T22281 |
40825-40828 |
IN |
denotes |
for |
| T22282 |
40829-40831 |
NN |
denotes |
DM |
| T22284 |
40832-40838 |
NN |
denotes |
domain |
| T22283 |
40839-40847 |
NN |
denotes |
proteins |
| T22285 |
40847-40849 |
, |
denotes |
, |
| T22286 |
40849-40851 |
IN |
denotes |
as |
| T22288 |
40852-40854 |
PRP |
denotes |
we |
| T22287 |
40855-40859 |
VBP |
denotes |
find |
| T22289 |
40860-40864 |
IN |
denotes |
that |
| T22291 |
40865-40870 |
JJ |
denotes |
other |
| T22293 |
40871-40873 |
NN |
denotes |
DM |
| T22294 |
40874-40880 |
NN |
denotes |
domain |
| T22292 |
40881-40889 |
NN |
denotes |
proteins |
| T22290 |
40890-40899 |
VBP |
denotes |
associate |
| T22295 |
40900-40904 |
IN |
denotes |
with |
| T22296 |
40905-40914 |
NN |
denotes |
chromatin |
| T22297 |
40915-40924 |
NN |
denotes |
modifying |
| T22298 |
40925-40934 |
NNS |
denotes |
complexes |
| T22299 |
40935-40936 |
-LRB- |
denotes |
( |
| T22300 |
40936-40938 |
NNP |
denotes |
M. |
| T22301 |
40939-40941 |
NNP |
denotes |
W. |
| T22302 |
40942-40948 |
NNP |
denotes |
Murphy |
| T22303 |
40948-40950 |
, |
denotes |
, |
| T22304 |
40950-40952 |
NNP |
denotes |
D. |
| T22305 |
40953-40961 |
NNP |
denotes |
Zarkower |
| T22306 |
40961-40963 |
, |
denotes |
, |
| T22307 |
40963-40966 |
CC |
denotes |
and |
| T22308 |
40967-40969 |
NNP |
denotes |
V. |
| T22309 |
40970-40972 |
NNP |
denotes |
J. |
| T22310 |
40973-40981 |
NNP |
denotes |
Bardwell |
| T22311 |
40981-40983 |
, |
denotes |
, |
| T22312 |
40983-40994 |
JJ |
denotes |
unpublished |
| T22313 |
40995-40999 |
NNS |
denotes |
data |
| T22314 |
40999-41000 |
-RRB- |
denotes |
) |
| T22315 |
41000-41001 |
. |
denotes |
. |
| T22316 |
41001-41108 |
sentence |
denotes |
The finding that Dmrt7 is essential for mammalian meiosis expands the known functions of this gene family. |
| T22317 |
41002-41005 |
DT |
denotes |
The |
| T22318 |
41006-41013 |
NN |
denotes |
finding |
| T22320 |
41014-41018 |
IN |
denotes |
that |
| T22322 |
41019-41024 |
NN |
denotes |
Dmrt7 |
| T22321 |
41025-41027 |
VBZ |
denotes |
is |
| T22323 |
41028-41037 |
JJ |
denotes |
essential |
| T22324 |
41038-41041 |
IN |
denotes |
for |
| T22325 |
41042-41051 |
JJ |
denotes |
mammalian |
| T22326 |
41052-41059 |
NN |
denotes |
meiosis |
| T22319 |
41060-41067 |
VBZ |
denotes |
expands |
| T22327 |
41068-41071 |
DT |
denotes |
the |
| T22329 |
41072-41077 |
VBN |
denotes |
known |
| T22328 |
41078-41087 |
NNS |
denotes |
functions |
| T22330 |
41088-41090 |
IN |
denotes |
of |
| T22331 |
41091-41095 |
DT |
denotes |
this |
| T22333 |
41096-41100 |
NN |
denotes |
gene |
| T22332 |
41101-41107 |
NN |
denotes |
family |
| T22334 |
41107-41108 |
. |
denotes |
. |
| T22335 |
41108-41195 |
sentence |
denotes |
Invertebrate DM domain genes so far have only been found to function in somatic cells. |
| T22336 |
41109-41121 |
NN |
denotes |
Invertebrate |
| T22338 |
41122-41124 |
NN |
denotes |
DM |
| T22339 |
41125-41131 |
NN |
denotes |
domain |
| T22337 |
41132-41137 |
NNS |
denotes |
genes |
| T22341 |
41138-41140 |
RB |
denotes |
so |
| T22342 |
41141-41144 |
RB |
denotes |
far |
| T22343 |
41145-41149 |
VBP |
denotes |
have |
| T22344 |
41150-41154 |
RB |
denotes |
only |
| T22345 |
41155-41159 |
VBN |
denotes |
been |
| T22340 |
41160-41165 |
VBN |
denotes |
found |
| T22346 |
41166-41168 |
TO |
denotes |
to |
| T22347 |
41169-41177 |
VB |
denotes |
function |
| T22348 |
41178-41180 |
IN |
denotes |
in |
| T22349 |
41181-41188 |
JJ |
denotes |
somatic |
| T22350 |
41189-41194 |
NNS |
denotes |
cells |
| T22351 |
41194-41195 |
. |
denotes |
. |
| T22352 |
41195-41285 |
sentence |
denotes |
Two other DM domain genes, Dmrt1 and Dmrt4, do affect germ cell development in the mouse. |
| T22353 |
41196-41199 |
CD |
denotes |
Two |
| T22355 |
41200-41205 |
JJ |
denotes |
other |
| T22356 |
41206-41208 |
NN |
denotes |
DM |
| T22357 |
41209-41215 |
NN |
denotes |
domain |
| T22354 |
41216-41221 |
NNS |
denotes |
genes |
| T22359 |
41221-41223 |
, |
denotes |
, |
| T22360 |
41223-41228 |
NN |
denotes |
Dmrt1 |
| T22361 |
41229-41232 |
CC |
denotes |
and |
| T22362 |
41233-41238 |
NN |
denotes |
Dmrt4 |
| T22363 |
41238-41240 |
, |
denotes |
, |
| T22364 |
41240-41242 |
VBP |
denotes |
do |
| T22358 |
41243-41249 |
VB |
denotes |
affect |
| T22365 |
41250-41254 |
NN |
denotes |
germ |
| T22366 |
41255-41259 |
NN |
denotes |
cell |
| T22367 |
41260-41271 |
NN |
denotes |
development |
| T22368 |
41272-41274 |
IN |
denotes |
in |
| T22369 |
41275-41278 |
DT |
denotes |
the |
| T22370 |
41279-41284 |
NN |
denotes |
mouse |
| T22371 |
41284-41285 |
. |
denotes |
. |
| T22372 |
41285-41506 |
sentence |
denotes |
Dmrt1 is required in pre-meiotic male germ cells for differentiation of gonocytes into spermatogonia, as well as in Sertoli cells, but it is not expressed in meiotic cells [31] (S. Kim and D. Zarkower, unpublished data). |
| T22373 |
41286-41291 |
NN |
denotes |
Dmrt1 |
| T22375 |
41292-41294 |
VBZ |
denotes |
is |
| T22374 |
41295-41303 |
VBN |
denotes |
required |
| T22376 |
41304-41306 |
IN |
denotes |
in |
| T22377 |
41307-41318 |
JJ |
denotes |
pre-meiotic |
| T22379 |
41319-41323 |
JJ |
denotes |
male |
| T22380 |
41324-41328 |
NN |
denotes |
germ |
| T22378 |
41329-41334 |
NNS |
denotes |
cells |
| T22381 |
41335-41338 |
IN |
denotes |
for |
| T22382 |
41339-41354 |
NN |
denotes |
differentiation |
| T22383 |
41355-41357 |
IN |
denotes |
of |
| T22384 |
41358-41367 |
NNS |
denotes |
gonocytes |
| T22385 |
41368-41372 |
IN |
denotes |
into |
| T22386 |
41373-41386 |
NNS |
denotes |
spermatogonia |
| T22387 |
41386-41388 |
, |
denotes |
, |
| T22388 |
41388-41390 |
RB |
denotes |
as |
| T22390 |
41391-41395 |
RB |
denotes |
well |
| T22389 |
41396-41398 |
IN |
denotes |
as |
| T22391 |
41399-41401 |
IN |
denotes |
in |
| T22392 |
41402-41409 |
NNP |
denotes |
Sertoli |
| T22393 |
41410-41415 |
NNS |
denotes |
cells |
| T22394 |
41415-41417 |
, |
denotes |
, |
| T22395 |
41417-41420 |
CC |
denotes |
but |
| T22396 |
41421-41423 |
PRP |
denotes |
it |
| T22398 |
41424-41426 |
VBZ |
denotes |
is |
| T22399 |
41427-41430 |
RB |
denotes |
not |
| T22397 |
41431-41440 |
VBN |
denotes |
expressed |
| T22400 |
41441-41443 |
IN |
denotes |
in |
| T22401 |
41444-41451 |
JJ |
denotes |
meiotic |
| T22402 |
41452-41457 |
NNS |
denotes |
cells |
| T22403 |
41458-41459 |
-LRB- |
denotes |
[ |
| T22404 |
41459-41461 |
CD |
denotes |
31 |
| T22405 |
41461-41462 |
-RRB- |
denotes |
] |
| T22406 |
41463-41464 |
-LRB- |
denotes |
( |
| T22407 |
41464-41466 |
NNP |
denotes |
S. |
| T22408 |
41467-41470 |
NNP |
denotes |
Kim |
| T22409 |
41471-41474 |
CC |
denotes |
and |
| T22410 |
41475-41477 |
NNP |
denotes |
D. |
| T22411 |
41478-41486 |
NNP |
denotes |
Zarkower |
| T22412 |
41486-41488 |
, |
denotes |
, |
| T22413 |
41488-41499 |
JJ |
denotes |
unpublished |
| T22414 |
41500-41504 |
NNS |
denotes |
data |
| T22415 |
41504-41505 |
-RRB- |
denotes |
) |
| T22416 |
41505-41506 |
. |
denotes |
. |
| T22417 |
41506-41690 |
sentence |
denotes |
The requirement for DMRT1 in pre-meiotic germ cells and DMRT7 in meiotic germ cells demonstrates that DM domain proteins act at multiple critical points of male germ cell development. |
| T22418 |
41507-41510 |
DT |
denotes |
The |
| T22419 |
41511-41522 |
NN |
denotes |
requirement |
| T22421 |
41523-41526 |
IN |
denotes |
for |
| T22422 |
41527-41532 |
NN |
denotes |
DMRT1 |
| T22423 |
41533-41535 |
IN |
denotes |
in |
| T22424 |
41536-41547 |
JJ |
denotes |
pre-meiotic |
| T22426 |
41548-41552 |
NN |
denotes |
germ |
| T22425 |
41553-41558 |
NNS |
denotes |
cells |
| T22427 |
41559-41562 |
CC |
denotes |
and |
| T22428 |
41563-41568 |
NN |
denotes |
DMRT7 |
| T22429 |
41569-41571 |
IN |
denotes |
in |
| T22430 |
41572-41579 |
JJ |
denotes |
meiotic |
| T22432 |
41580-41584 |
NN |
denotes |
germ |
| T22431 |
41585-41590 |
NNS |
denotes |
cells |
| T22420 |
41591-41603 |
VBZ |
denotes |
demonstrates |
| T22433 |
41604-41608 |
IN |
denotes |
that |
| T22435 |
41609-41611 |
NN |
denotes |
DM |
| T22436 |
41612-41618 |
NN |
denotes |
domain |
| T22437 |
41619-41627 |
NN |
denotes |
proteins |
| T22434 |
41628-41631 |
VBP |
denotes |
act |
| T22438 |
41632-41634 |
IN |
denotes |
at |
| T22439 |
41635-41643 |
JJ |
denotes |
multiple |
| T22441 |
41644-41652 |
JJ |
denotes |
critical |
| T22440 |
41653-41659 |
NNS |
denotes |
points |
| T22442 |
41660-41662 |
IN |
denotes |
of |
| T22443 |
41663-41667 |
JJ |
denotes |
male |
| T22445 |
41668-41672 |
NN |
denotes |
germ |
| T22446 |
41673-41677 |
NN |
denotes |
cell |
| T22444 |
41678-41689 |
NN |
denotes |
development |
| T22447 |
41689-41690 |
. |
denotes |
. |
| T22448 |
41690-41868 |
sentence |
denotes |
Ovaries of Dmrt4 mutant females have polyovular follicles (follicles containing multiple oocytes), but it is unknown whether this reflects a defect in the germ line or the soma. |
| T22449 |
41691-41698 |
NNS |
denotes |
Ovaries |
| T22451 |
41699-41701 |
IN |
denotes |
of |
| T22452 |
41702-41707 |
NN |
denotes |
Dmrt4 |
| T22454 |
41708-41714 |
NN |
denotes |
mutant |
| T22453 |
41715-41722 |
NNS |
denotes |
females |
| T22450 |
41723-41727 |
VBP |
denotes |
have |
| T22455 |
41728-41738 |
JJ |
denotes |
polyovular |
| T22456 |
41739-41748 |
NNS |
denotes |
follicles |
| T22457 |
41749-41750 |
-LRB- |
denotes |
( |
| T22458 |
41750-41759 |
NNS |
denotes |
follicles |
| T22459 |
41760-41770 |
VBG |
denotes |
containing |
| T22460 |
41771-41779 |
JJ |
denotes |
multiple |
| T22461 |
41780-41787 |
NNS |
denotes |
oocytes |
| T22462 |
41787-41788 |
-RRB- |
denotes |
) |
| T22463 |
41788-41790 |
, |
denotes |
, |
| T22464 |
41790-41793 |
CC |
denotes |
but |
| T22465 |
41794-41796 |
PRP |
denotes |
it |
| T22466 |
41797-41799 |
VBZ |
denotes |
is |
| T22467 |
41800-41807 |
JJ |
denotes |
unknown |
| T22468 |
41808-41815 |
IN |
denotes |
whether |
| T22470 |
41816-41820 |
DT |
denotes |
this |
| T22469 |
41821-41829 |
VBZ |
denotes |
reflects |
| T22471 |
41830-41831 |
DT |
denotes |
a |
| T22472 |
41832-41838 |
NN |
denotes |
defect |
| T22473 |
41839-41841 |
IN |
denotes |
in |
| T22474 |
41842-41845 |
DT |
denotes |
the |
| T22476 |
41846-41850 |
NN |
denotes |
germ |
| T22475 |
41851-41855 |
NN |
denotes |
line |
| T22477 |
41856-41858 |
CC |
denotes |
or |
| T22478 |
41859-41862 |
DT |
denotes |
the |
| T22479 |
41863-41867 |
NN |
denotes |
soma |
| T22480 |
41867-41868 |
. |
denotes |
. |
| T22481 |
41868-42078 |
sentence |
denotes |
It is notable that at least three mammalian DM domain genes affect gonadal development only in one sex, given the similar roles of related proteins in directing sex-specific somatic development in other phyla. |
| T22482 |
41869-41871 |
PRP |
denotes |
It |
| T22483 |
41872-41874 |
VBZ |
denotes |
is |
| T22484 |
41875-41882 |
JJ |
denotes |
notable |
| T22485 |
41883-41887 |
IN |
denotes |
that |
| T22487 |
41888-41890 |
RB |
denotes |
at |
| T22489 |
41891-41896 |
RBS |
denotes |
least |
| T22488 |
41897-41902 |
CD |
denotes |
three |
| T22491 |
41903-41912 |
JJ |
denotes |
mammalian |
| T22492 |
41913-41915 |
NN |
denotes |
DM |
| T22493 |
41916-41922 |
NN |
denotes |
domain |
| T22490 |
41923-41928 |
NNS |
denotes |
genes |
| T22486 |
41929-41935 |
VBP |
denotes |
affect |
| T22494 |
41936-41943 |
JJ |
denotes |
gonadal |
| T22495 |
41944-41955 |
NN |
denotes |
development |
| T22496 |
41956-41960 |
RB |
denotes |
only |
| T22497 |
41961-41963 |
IN |
denotes |
in |
| T22498 |
41964-41967 |
CD |
denotes |
one |
| T22499 |
41968-41971 |
NN |
denotes |
sex |
| T22500 |
41971-41973 |
, |
denotes |
, |
| T22501 |
41973-41978 |
VBN |
denotes |
given |
| T22502 |
41979-41982 |
DT |
denotes |
the |
| T22504 |
41983-41990 |
JJ |
denotes |
similar |
| T22503 |
41991-41996 |
NNS |
denotes |
roles |
| T22505 |
41997-41999 |
IN |
denotes |
of |
| T22506 |
42000-42007 |
JJ |
denotes |
related |
| T22507 |
42008-42016 |
NN |
denotes |
proteins |
| T22508 |
42017-42019 |
IN |
denotes |
in |
| T22509 |
42020-42029 |
VBG |
denotes |
directing |
| T22510 |
42030-42033 |
NN |
denotes |
sex |
| T22512 |
42033-42034 |
HYPH |
denotes |
- |
| T22511 |
42034-42042 |
JJ |
denotes |
specific |
| T22514 |
42043-42050 |
JJ |
denotes |
somatic |
| T22513 |
42051-42062 |
NN |
denotes |
development |
| T22515 |
42063-42065 |
IN |
denotes |
in |
| T22516 |
42066-42071 |
JJ |
denotes |
other |
| T22517 |
42072-42077 |
NNS |
denotes |
phyla |
| T22518 |
42077-42078 |
. |
denotes |
. |
| T22519 |
42078-42252 |
sentence |
denotes |
Strikingly, Dmrt7 is present, not only in placental mammals, but also in marsupials and a monotreme (egg-laying mammal), the platypus, which has a clear Dmrt7 ortholog [36]. |
| T22520 |
42079-42089 |
RB |
denotes |
Strikingly |
| T22522 |
42089-42091 |
, |
denotes |
, |
| T22523 |
42091-42096 |
NN |
denotes |
Dmrt7 |
| T22521 |
42097-42099 |
VBZ |
denotes |
is |
| T22524 |
42100-42107 |
JJ |
denotes |
present |
| T22525 |
42107-42109 |
, |
denotes |
, |
| T22526 |
42109-42112 |
RB |
denotes |
not |
| T22528 |
42113-42117 |
RB |
denotes |
only |
| T22527 |
42118-42120 |
IN |
denotes |
in |
| T22529 |
42121-42130 |
JJ |
denotes |
placental |
| T22530 |
42131-42138 |
NNS |
denotes |
mammals |
| T22531 |
42138-42140 |
, |
denotes |
, |
| T22532 |
42140-42143 |
CC |
denotes |
but |
| T22533 |
42144-42148 |
RB |
denotes |
also |
| T22534 |
42149-42151 |
IN |
denotes |
in |
| T22535 |
42152-42162 |
NNS |
denotes |
marsupials |
| T22536 |
42163-42166 |
CC |
denotes |
and |
| T22537 |
42167-42168 |
DT |
denotes |
a |
| T22538 |
42169-42178 |
NN |
denotes |
monotreme |
| T22539 |
42179-42180 |
-LRB- |
denotes |
( |
| T22541 |
42180-42183 |
NN |
denotes |
egg |
| T22542 |
42183-42184 |
HYPH |
denotes |
- |
| T22543 |
42184-42190 |
VBG |
denotes |
laying |
| T22540 |
42191-42197 |
NN |
denotes |
mammal |
| T22544 |
42197-42198 |
-RRB- |
denotes |
) |
| T22545 |
42198-42200 |
, |
denotes |
, |
| T22546 |
42200-42203 |
DT |
denotes |
the |
| T22547 |
42204-42212 |
NN |
denotes |
platypus |
| T22548 |
42212-42214 |
, |
denotes |
, |
| T22549 |
42214-42219 |
WDT |
denotes |
which |
| T22550 |
42220-42223 |
VBZ |
denotes |
has |
| T22551 |
42224-42225 |
DT |
denotes |
a |
| T22553 |
42226-42231 |
JJ |
denotes |
clear |
| T22554 |
42232-42237 |
NN |
denotes |
Dmrt7 |
| T22552 |
42238-42246 |
NN |
denotes |
ortholog |
| T22555 |
42247-42248 |
-LRB- |
denotes |
[ |
| T22556 |
42248-42250 |
CD |
denotes |
36 |
| T22557 |
42250-42251 |
-RRB- |
denotes |
] |
| T22558 |
42251-42252 |
. |
denotes |
. |
| T22559 |
42252-42378 |
sentence |
denotes |
However, no close Dmrt7 ortholog has been reported in nonmammalian vertebrates, and our database searches did not reveal one. |
| T22560 |
42253-42260 |
RB |
denotes |
However |
| T22562 |
42260-42262 |
, |
denotes |
, |
| T22563 |
42262-42264 |
DT |
denotes |
no |
| T22565 |
42265-42270 |
JJ |
denotes |
close |
| T22566 |
42271-42276 |
NN |
denotes |
Dmrt7 |
| T22564 |
42277-42285 |
NN |
denotes |
ortholog |
| T22567 |
42286-42289 |
VBZ |
denotes |
has |
| T22568 |
42290-42294 |
VBN |
denotes |
been |
| T22561 |
42295-42303 |
VBN |
denotes |
reported |
| T22569 |
42304-42306 |
IN |
denotes |
in |
| T22570 |
42307-42319 |
JJ |
denotes |
nonmammalian |
| T22571 |
42320-42331 |
NNS |
denotes |
vertebrates |
| T22572 |
42331-42333 |
, |
denotes |
, |
| T22573 |
42333-42336 |
CC |
denotes |
and |
| T22574 |
42337-42340 |
PRP$ |
denotes |
our |
| T22576 |
42341-42349 |
NN |
denotes |
database |
| T22575 |
42350-42358 |
NNS |
denotes |
searches |
| T22578 |
42359-42362 |
VBD |
denotes |
did |
| T22579 |
42363-42366 |
RB |
denotes |
not |
| T22577 |
42367-42373 |
VB |
denotes |
reveal |
| T22580 |
42374-42377 |
CD |
denotes |
one |
| T22581 |
42377-42378 |
. |
denotes |
. |
| T22582 |
42378-42526 |
sentence |
denotes |
Thus, Dmrt7 likely arose, presumably by duplication and divergence of another Dmrt gene, shortly before or coincident with the mammalian radiation. |
| T22583 |
42379-42383 |
RB |
denotes |
Thus |
| T22585 |
42383-42385 |
, |
denotes |
, |
| T22586 |
42385-42390 |
NN |
denotes |
Dmrt7 |
| T22587 |
42391-42397 |
RB |
denotes |
likely |
| T22584 |
42398-42403 |
VBD |
denotes |
arose |
| T22588 |
42403-42405 |
, |
denotes |
, |
| T22589 |
42405-42415 |
RB |
denotes |
presumably |
| T22590 |
42416-42418 |
IN |
denotes |
by |
| T22591 |
42419-42430 |
NN |
denotes |
duplication |
| T22592 |
42431-42434 |
CC |
denotes |
and |
| T22593 |
42435-42445 |
NN |
denotes |
divergence |
| T22594 |
42446-42448 |
IN |
denotes |
of |
| T22595 |
42449-42456 |
DT |
denotes |
another |
| T22597 |
42457-42461 |
NN |
denotes |
Dmrt |
| T22596 |
42462-42466 |
NN |
denotes |
gene |
| T22598 |
42466-42468 |
, |
denotes |
, |
| T22599 |
42468-42475 |
RB |
denotes |
shortly |
| T22600 |
42476-42482 |
IN |
denotes |
before |
| T22601 |
42483-42485 |
CC |
denotes |
or |
| T22602 |
42486-42496 |
JJ |
denotes |
coincident |
| T22604 |
42497-42501 |
IN |
denotes |
with |
| T22605 |
42502-42505 |
DT |
denotes |
the |
| T22606 |
42506-42515 |
JJ |
denotes |
mammalian |
| T22603 |
42516-42525 |
NN |
denotes |
radiation |
| T22607 |
42525-42526 |
. |
denotes |
. |
| T22608 |
42526-42696 |
sentence |
denotes |
Monotremes have five X and five Y chromosomes, which form an extended pairing chain during meiosis and appear unrelated to the sex chromosomes of the other mammals [61]. |
| T22609 |
42527-42537 |
NNS |
denotes |
Monotremes |
| T22610 |
42538-42542 |
VBP |
denotes |
have |
| T22611 |
42543-42547 |
CD |
denotes |
five |
| T22612 |
42548-42549 |
NN |
denotes |
X |
| T22613 |
42550-42553 |
CC |
denotes |
and |
| T22614 |
42554-42558 |
CD |
denotes |
five |
| T22615 |
42559-42560 |
NN |
denotes |
Y |
| T22616 |
42561-42572 |
NNS |
denotes |
chromosomes |
| T22617 |
42572-42574 |
, |
denotes |
, |
| T22618 |
42574-42579 |
WDT |
denotes |
which |
| T22619 |
42580-42584 |
VBP |
denotes |
form |
| T22620 |
42585-42587 |
DT |
denotes |
an |
| T22622 |
42588-42596 |
VBN |
denotes |
extended |
| T22623 |
42597-42604 |
NN |
denotes |
pairing |
| T22621 |
42605-42610 |
NN |
denotes |
chain |
| T22624 |
42611-42617 |
IN |
denotes |
during |
| T22625 |
42618-42625 |
NN |
denotes |
meiosis |
| T22626 |
42626-42629 |
CC |
denotes |
and |
| T22627 |
42630-42636 |
VBP |
denotes |
appear |
| T22628 |
42637-42646 |
JJ |
denotes |
unrelated |
| T22629 |
42647-42649 |
IN |
denotes |
to |
| T22630 |
42650-42653 |
DT |
denotes |
the |
| T22632 |
42654-42657 |
NN |
denotes |
sex |
| T22631 |
42658-42669 |
NNS |
denotes |
chromosomes |
| T22633 |
42670-42672 |
IN |
denotes |
of |
| T22634 |
42673-42676 |
DT |
denotes |
the |
| T22636 |
42677-42682 |
JJ |
denotes |
other |
| T22635 |
42683-42690 |
NNS |
denotes |
mammals |
| T22637 |
42691-42692 |
-LRB- |
denotes |
[ |
| T22638 |
42692-42694 |
CD |
denotes |
61 |
| T22639 |
42694-42695 |
-RRB- |
denotes |
] |
| T22640 |
42695-42696 |
. |
denotes |
. |
| T22641 |
42696-42848 |
sentence |
denotes |
The presence of Dmrt7 in both lineages may support a common origin for either the sex chromosomes or the sex chromatin of monotremes and other mammals. |
| T22642 |
42697-42700 |
DT |
denotes |
The |
| T22643 |
42701-42709 |
NN |
denotes |
presence |
| T22645 |
42710-42712 |
IN |
denotes |
of |
| T22646 |
42713-42718 |
NN |
denotes |
Dmrt7 |
| T22647 |
42719-42721 |
IN |
denotes |
in |
| T22648 |
42722-42726 |
DT |
denotes |
both |
| T22649 |
42727-42735 |
NNS |
denotes |
lineages |
| T22650 |
42736-42739 |
MD |
denotes |
may |
| T22644 |
42740-42747 |
VB |
denotes |
support |
| T22651 |
42748-42749 |
DT |
denotes |
a |
| T22653 |
42750-42756 |
JJ |
denotes |
common |
| T22652 |
42757-42763 |
NN |
denotes |
origin |
| T22654 |
42764-42767 |
IN |
denotes |
for |
| T22655 |
42768-42774 |
CC |
denotes |
either |
| T22657 |
42775-42778 |
DT |
denotes |
the |
| T22658 |
42779-42782 |
NN |
denotes |
sex |
| T22656 |
42783-42794 |
NNS |
denotes |
chromosomes |
| T22659 |
42795-42797 |
CC |
denotes |
or |
| T22660 |
42798-42801 |
DT |
denotes |
the |
| T22662 |
42802-42805 |
NN |
denotes |
sex |
| T22661 |
42806-42815 |
NN |
denotes |
chromatin |
| T22663 |
42816-42818 |
IN |
denotes |
of |
| T22664 |
42819-42829 |
NNS |
denotes |
monotremes |
| T22665 |
42830-42833 |
CC |
denotes |
and |
| T22666 |
42834-42839 |
JJ |
denotes |
other |
| T22667 |
42840-42847 |
NNS |
denotes |
mammals |
| T22668 |
42847-42848 |
. |
denotes |
. |
| T22669 |
42848-43101 |
sentence |
denotes |
A plausible model is that Dmrt7 evolved during the establishment of mammalian sex determination to help cope with ancestral differences in gene dosage, chromosome pairing, recombination, or other meiotic issues arising from sex chromosome heteromorphy. |
| T22670 |
42849-42850 |
DT |
denotes |
A |
| T22672 |
42851-42860 |
JJ |
denotes |
plausible |
| T22671 |
42861-42866 |
NN |
denotes |
model |
| T22673 |
42867-42869 |
VBZ |
denotes |
is |
| T22674 |
42870-42874 |
IN |
denotes |
that |
| T22676 |
42875-42880 |
NN |
denotes |
Dmrt7 |
| T22675 |
42881-42888 |
VBD |
denotes |
evolved |
| T22677 |
42889-42895 |
IN |
denotes |
during |
| T22678 |
42896-42899 |
DT |
denotes |
the |
| T22679 |
42900-42913 |
NN |
denotes |
establishment |
| T22680 |
42914-42916 |
IN |
denotes |
of |
| T22681 |
42917-42926 |
JJ |
denotes |
mammalian |
| T22683 |
42927-42930 |
NN |
denotes |
sex |
| T22682 |
42931-42944 |
NN |
denotes |
determination |
| T22684 |
42945-42947 |
TO |
denotes |
to |
| T22686 |
42948-42952 |
VB |
denotes |
help |
| T22685 |
42953-42957 |
VB |
denotes |
cope |
| T22687 |
42958-42962 |
IN |
denotes |
with |
| T22688 |
42963-42972 |
JJ |
denotes |
ancestral |
| T22689 |
42973-42984 |
NNS |
denotes |
differences |
| T22690 |
42985-42987 |
IN |
denotes |
in |
| T22691 |
42988-42992 |
NN |
denotes |
gene |
| T22692 |
42993-42999 |
NN |
denotes |
dosage |
| T22693 |
42999-43001 |
, |
denotes |
, |
| T22694 |
43001-43011 |
NN |
denotes |
chromosome |
| T22695 |
43012-43019 |
NN |
denotes |
pairing |
| T22696 |
43019-43021 |
, |
denotes |
, |
| T22697 |
43021-43034 |
NN |
denotes |
recombination |
| T22698 |
43034-43036 |
, |
denotes |
, |
| T22699 |
43036-43038 |
CC |
denotes |
or |
| T22700 |
43039-43044 |
JJ |
denotes |
other |
| T22702 |
43045-43052 |
JJ |
denotes |
meiotic |
| T22701 |
43053-43059 |
NNS |
denotes |
issues |
| T22703 |
43060-43067 |
VBG |
denotes |
arising |
| T22704 |
43068-43072 |
IN |
denotes |
from |
| T22705 |
43073-43076 |
NN |
denotes |
sex |
| T22706 |
43077-43087 |
NN |
denotes |
chromosome |
| T22707 |
43088-43100 |
NN |
denotes |
heteromorphy |
| T22708 |
43100-43101 |
. |
denotes |
. |
| T22709 |
43101-43383 |
sentence |
denotes |
In this regard, we speculate that the recruitment of Dmrt7 during mammalian evolution may be analogous to the recruitment of chromatin regulatory complexes to achieve somatic dosage compensation during evolution of heteromorphic sex chromosomes in several phyla (reviewed in [62]). |
| T22710 |
43102-43104 |
IN |
denotes |
In |
| T22712 |
43105-43109 |
DT |
denotes |
this |
| T22713 |
43110-43116 |
NN |
denotes |
regard |
| T22714 |
43116-43118 |
, |
denotes |
, |
| T22715 |
43118-43120 |
PRP |
denotes |
we |
| T22711 |
43121-43130 |
VBP |
denotes |
speculate |
| T22716 |
43131-43135 |
IN |
denotes |
that |
| T22718 |
43136-43139 |
DT |
denotes |
the |
| T22719 |
43140-43151 |
NN |
denotes |
recruitment |
| T22720 |
43152-43154 |
IN |
denotes |
of |
| T22721 |
43155-43160 |
NN |
denotes |
Dmrt7 |
| T22722 |
43161-43167 |
IN |
denotes |
during |
| T22723 |
43168-43177 |
JJ |
denotes |
mammalian |
| T22724 |
43178-43187 |
NN |
denotes |
evolution |
| T22725 |
43188-43191 |
MD |
denotes |
may |
| T22717 |
43192-43194 |
VB |
denotes |
be |
| T22726 |
43195-43204 |
JJ |
denotes |
analogous |
| T22727 |
43205-43207 |
IN |
denotes |
to |
| T22728 |
43208-43211 |
DT |
denotes |
the |
| T22729 |
43212-43223 |
NN |
denotes |
recruitment |
| T22730 |
43224-43226 |
IN |
denotes |
of |
| T22731 |
43227-43236 |
NN |
denotes |
chromatin |
| T22733 |
43237-43247 |
JJ |
denotes |
regulatory |
| T22732 |
43248-43257 |
NNS |
denotes |
complexes |
| T22734 |
43258-43260 |
TO |
denotes |
to |
| T22735 |
43261-43268 |
VB |
denotes |
achieve |
| T22736 |
43269-43276 |
JJ |
denotes |
somatic |
| T22738 |
43277-43283 |
NN |
denotes |
dosage |
| T22737 |
43284-43296 |
NN |
denotes |
compensation |
| T22739 |
43297-43303 |
IN |
denotes |
during |
| T22740 |
43304-43313 |
NN |
denotes |
evolution |
| T22741 |
43314-43316 |
IN |
denotes |
of |
| T22742 |
43317-43330 |
JJ |
denotes |
heteromorphic |
| T22744 |
43331-43334 |
NN |
denotes |
sex |
| T22743 |
43335-43346 |
NNS |
denotes |
chromosomes |
| T22745 |
43347-43349 |
IN |
denotes |
in |
| T22746 |
43350-43357 |
JJ |
denotes |
several |
| T22747 |
43358-43363 |
NNS |
denotes |
phyla |
| T22748 |
43364-43365 |
-LRB- |
denotes |
( |
| T22749 |
43365-43373 |
VBN |
denotes |
reviewed |
| T22750 |
43374-43376 |
IN |
denotes |
in |
| T22751 |
43377-43378 |
-LRB- |
denotes |
[ |
| T22752 |
43378-43380 |
CD |
denotes |
62 |
| T22753 |
43380-43381 |
-RRB- |
denotes |
] |
| T22754 |
43381-43382 |
-RRB- |
denotes |
) |
| T22755 |
43382-43383 |
. |
denotes |
. |
| T22756 |
43383-43488 |
sentence |
denotes |
It will be of interest to determine whether DMRT7 localizes to sex chromosomes during monotreme meiosis. |
| T22757 |
43384-43386 |
PRP |
denotes |
It |
| T22759 |
43387-43391 |
MD |
denotes |
will |
| T22758 |
43392-43394 |
VB |
denotes |
be |
| T22760 |
43395-43397 |
IN |
denotes |
of |
| T22761 |
43398-43406 |
NN |
denotes |
interest |
| T22762 |
43407-43409 |
TO |
denotes |
to |
| T22763 |
43410-43419 |
VB |
denotes |
determine |
| T22764 |
43420-43427 |
IN |
denotes |
whether |
| T22766 |
43428-43433 |
NN |
denotes |
DMRT7 |
| T22765 |
43434-43443 |
VBZ |
denotes |
localizes |
| T22767 |
43444-43446 |
IN |
denotes |
to |
| T22768 |
43447-43450 |
NN |
denotes |
sex |
| T22769 |
43451-43462 |
NNS |
denotes |
chromosomes |
| T22770 |
43463-43469 |
IN |
denotes |
during |
| T22771 |
43470-43479 |
NN |
denotes |
monotreme |
| T22772 |
43480-43487 |
NN |
denotes |
meiosis |
| T22773 |
43487-43488 |
. |
denotes |
. |
| T22774 |
43488-43619 |
sentence |
denotes |
In summary, we have found that the mammal-specific DM domain protein DMRT7 is essential for meiotic prophase progression in males. |
| T22775 |
43489-43491 |
IN |
denotes |
In |
| T22777 |
43492-43499 |
NN |
denotes |
summary |
| T22778 |
43499-43501 |
, |
denotes |
, |
| T22779 |
43501-43503 |
PRP |
denotes |
we |
| T22780 |
43504-43508 |
VBP |
denotes |
have |
| T22776 |
43509-43514 |
VBN |
denotes |
found |
| T22781 |
43515-43519 |
IN |
denotes |
that |
| T22783 |
43520-43523 |
DT |
denotes |
the |
| T22785 |
43524-43530 |
NN |
denotes |
mammal |
| T22787 |
43530-43531 |
HYPH |
denotes |
- |
| T22786 |
43531-43539 |
JJ |
denotes |
specific |
| T22788 |
43540-43542 |
NN |
denotes |
DM |
| T22789 |
43543-43549 |
NN |
denotes |
domain |
| T22790 |
43550-43557 |
NN |
denotes |
protein |
| T22784 |
43558-43563 |
NN |
denotes |
DMRT7 |
| T22782 |
43564-43566 |
VBZ |
denotes |
is |
| T22791 |
43567-43576 |
JJ |
denotes |
essential |
| T22792 |
43577-43580 |
IN |
denotes |
for |
| T22793 |
43581-43588 |
JJ |
denotes |
meiotic |
| T22794 |
43589-43597 |
NN |
denotes |
prophase |
| T22795 |
43598-43609 |
NN |
denotes |
progression |
| T22796 |
43610-43612 |
IN |
denotes |
in |
| T22797 |
43613-43618 |
NNS |
denotes |
males |
| T22798 |
43618-43619 |
. |
denotes |
. |
| T22799 |
43619-43843 |
sentence |
denotes |
DMRT7 localizes to the sex chromosomes after they are assembled into specialized heterochromatin, and many Dmrt7 mutant cells have epigenetic defects in the modification of the sex chromatin between pachytene and diplotene. |
| T22800 |
43620-43625 |
NN |
denotes |
DMRT7 |
| T22801 |
43626-43635 |
VBZ |
denotes |
localizes |
| T22802 |
43636-43638 |
IN |
denotes |
to |
| T22803 |
43639-43642 |
DT |
denotes |
the |
| T22805 |
43643-43646 |
NN |
denotes |
sex |
| T22804 |
43647-43658 |
NNS |
denotes |
chromosomes |
| T22806 |
43659-43664 |
IN |
denotes |
after |
| T22808 |
43665-43669 |
PRP |
denotes |
they |
| T22809 |
43670-43673 |
VBP |
denotes |
are |
| T22807 |
43674-43683 |
VBN |
denotes |
assembled |
| T22810 |
43684-43688 |
IN |
denotes |
into |
| T22811 |
43689-43700 |
JJ |
denotes |
specialized |
| T22812 |
43701-43716 |
NN |
denotes |
heterochromatin |
| T22813 |
43716-43718 |
, |
denotes |
, |
| T22814 |
43718-43721 |
CC |
denotes |
and |
| T22815 |
43722-43726 |
JJ |
denotes |
many |
| T22817 |
43727-43732 |
NN |
denotes |
Dmrt7 |
| T22818 |
43733-43739 |
NN |
denotes |
mutant |
| T22816 |
43740-43745 |
NNS |
denotes |
cells |
| T22819 |
43746-43750 |
VBP |
denotes |
have |
| T22820 |
43751-43761 |
JJ |
denotes |
epigenetic |
| T22821 |
43762-43769 |
NNS |
denotes |
defects |
| T22822 |
43770-43772 |
IN |
denotes |
in |
| T22823 |
43773-43776 |
DT |
denotes |
the |
| T22824 |
43777-43789 |
NN |
denotes |
modification |
| T22825 |
43790-43792 |
IN |
denotes |
of |
| T22826 |
43793-43796 |
DT |
denotes |
the |
| T22828 |
43797-43800 |
NN |
denotes |
sex |
| T22827 |
43801-43810 |
NN |
denotes |
chromatin |
| T22829 |
43811-43818 |
IN |
denotes |
between |
| T22830 |
43819-43828 |
NN |
denotes |
pachytene |
| T22831 |
43829-43832 |
CC |
denotes |
and |
| T22832 |
43833-43842 |
NN |
denotes |
diplotene |
| T22833 |
43842-43843 |
. |
denotes |
. |
| T22834 |
43843-44043 |
sentence |
denotes |
Although Dmrt7 belongs to an ancient and conserved gene family, it is found only in mammals, and to our knowledge DMRT7 is the only example of a mammal-specific protein that is essential for meiosis. |
| T22835 |
43844-43852 |
IN |
denotes |
Although |
| T22837 |
43853-43858 |
NN |
denotes |
Dmrt7 |
| T22836 |
43859-43866 |
VBZ |
denotes |
belongs |
| T22839 |
43867-43869 |
IN |
denotes |
to |
| T22840 |
43870-43872 |
DT |
denotes |
an |
| T22842 |
43873-43880 |
JJ |
denotes |
ancient |
| T22843 |
43881-43884 |
CC |
denotes |
and |
| T22844 |
43885-43894 |
VBN |
denotes |
conserved |
| T22845 |
43895-43899 |
NN |
denotes |
gene |
| T22841 |
43900-43906 |
NN |
denotes |
family |
| T22846 |
43906-43908 |
, |
denotes |
, |
| T22847 |
43908-43910 |
PRP |
denotes |
it |
| T22848 |
43911-43913 |
VBZ |
denotes |
is |
| T22838 |
43914-43919 |
VBN |
denotes |
found |
| T22849 |
43920-43924 |
RB |
denotes |
only |
| T22850 |
43925-43927 |
IN |
denotes |
in |
| T22851 |
43928-43935 |
NNS |
denotes |
mammals |
| T22852 |
43935-43937 |
, |
denotes |
, |
| T22853 |
43937-43940 |
CC |
denotes |
and |
| T22854 |
43941-43943 |
IN |
denotes |
to |
| T22856 |
43944-43947 |
PRP$ |
denotes |
our |
| T22857 |
43948-43957 |
NN |
denotes |
knowledge |
| T22858 |
43958-43963 |
NN |
denotes |
DMRT7 |
| T22855 |
43964-43966 |
VBZ |
denotes |
is |
| T22859 |
43967-43970 |
DT |
denotes |
the |
| T22861 |
43971-43975 |
JJ |
denotes |
only |
| T22860 |
43976-43983 |
NN |
denotes |
example |
| T22862 |
43984-43986 |
IN |
denotes |
of |
| T22863 |
43987-43988 |
DT |
denotes |
a |
| T22865 |
43989-43995 |
NN |
denotes |
mammal |
| T22867 |
43995-43996 |
HYPH |
denotes |
- |
| T22866 |
43996-44004 |
JJ |
denotes |
specific |
| T22864 |
44005-44012 |
NN |
denotes |
protein |
| T22868 |
44013-44017 |
WDT |
denotes |
that |
| T22869 |
44018-44020 |
VBZ |
denotes |
is |
| T22870 |
44021-44030 |
JJ |
denotes |
essential |
| T22871 |
44031-44034 |
IN |
denotes |
for |
| T22872 |
44035-44042 |
NN |
denotes |
meiosis |
| T22873 |
44042-44043 |
. |
denotes |
. |
| T22874 |
44043-44168 |
sentence |
denotes |
It will be important to determine the precise mechanism by which DMRT7 affects sex chromatin regulation during male meiosis. |
| T22875 |
44044-44046 |
PRP |
denotes |
It |
| T22877 |
44047-44051 |
MD |
denotes |
will |
| T22876 |
44052-44054 |
VB |
denotes |
be |
| T22878 |
44055-44064 |
JJ |
denotes |
important |
| T22879 |
44065-44067 |
TO |
denotes |
to |
| T22880 |
44068-44077 |
VB |
denotes |
determine |
| T22881 |
44078-44081 |
DT |
denotes |
the |
| T22883 |
44082-44089 |
JJ |
denotes |
precise |
| T22882 |
44090-44099 |
NN |
denotes |
mechanism |
| T22884 |
44100-44102 |
IN |
denotes |
by |
| T22886 |
44103-44108 |
WDT |
denotes |
which |
| T22887 |
44109-44114 |
NN |
denotes |
DMRT7 |
| T22885 |
44115-44122 |
VBZ |
denotes |
affects |
| T22888 |
44123-44126 |
NN |
denotes |
sex |
| T22890 |
44127-44136 |
NN |
denotes |
chromatin |
| T22889 |
44137-44147 |
NN |
denotes |
regulation |
| T22891 |
44148-44154 |
IN |
denotes |
during |
| T22892 |
44155-44159 |
JJ |
denotes |
male |
| T22893 |
44160-44167 |
NN |
denotes |
meiosis |
| T22894 |
44167-44168 |
. |
denotes |
. |
| T23791 |
44193-44203 |
NN |
denotes |
Generation |
| T23792 |
44204-44206 |
IN |
denotes |
of |
| T23793 |
44207-44212 |
NN |
denotes |
Dmrt7 |
| T23794 |
44213-44217 |
NNS |
denotes |
mice |
| T23795 |
44217-44218 |
. |
denotes |
. |
| T23796 |
44218-44486 |
sentence |
denotes |
A mouse Dmrt7 cDNA fragment containing sequences from exon 8 was used to screen a mouse BAC library from the 129/SvJ strain (Stratagene, http://www.stratagene.com), and clones containing promoter sequences were isolated and sequenced to obtain Dmrt7 genomic sequence. |
| T23797 |
44219-44220 |
DT |
denotes |
A |
| T23799 |
44221-44226 |
NN |
denotes |
mouse |
| T23800 |
44227-44232 |
NN |
denotes |
Dmrt7 |
| T23801 |
44233-44237 |
NN |
denotes |
cDNA |
| T23798 |
44238-44246 |
NN |
denotes |
fragment |
| T23803 |
44247-44257 |
VBG |
denotes |
containing |
| T23804 |
44258-44267 |
NNS |
denotes |
sequences |
| T23805 |
44268-44272 |
IN |
denotes |
from |
| T23806 |
44273-44277 |
NN |
denotes |
exon |
| T23807 |
44278-44279 |
CD |
denotes |
8 |
| T23808 |
44280-44283 |
VBD |
denotes |
was |
| T23802 |
44284-44288 |
VBN |
denotes |
used |
| T23809 |
44289-44291 |
TO |
denotes |
to |
| T23810 |
44292-44298 |
VB |
denotes |
screen |
| T23811 |
44299-44300 |
DT |
denotes |
a |
| T23813 |
44301-44306 |
NN |
denotes |
mouse |
| T23814 |
44307-44310 |
NN |
denotes |
BAC |
| T23812 |
44311-44318 |
NN |
denotes |
library |
| T23815 |
44319-44323 |
IN |
denotes |
from |
| T23816 |
44324-44327 |
DT |
denotes |
the |
| T23818 |
44328-44331 |
CD |
denotes |
129 |
| T23820 |
44331-44332 |
HYPH |
denotes |
/ |
| T23819 |
44332-44335 |
NN |
denotes |
SvJ |
| T23817 |
44336-44342 |
NN |
denotes |
strain |
| T23821 |
44343-44344 |
-LRB- |
denotes |
( |
| T23822 |
44344-44354 |
NN |
denotes |
Stratagene |
| T23823 |
44354-44356 |
, |
denotes |
, |
| T23824 |
44356-44381 |
NN |
denotes |
http://www.stratagene.com |
| T23825 |
44381-44382 |
-RRB- |
denotes |
) |
| T23826 |
44382-44384 |
, |
denotes |
, |
| T23827 |
44384-44387 |
CC |
denotes |
and |
| T23828 |
44388-44394 |
NNS |
denotes |
clones |
| T23830 |
44395-44405 |
VBG |
denotes |
containing |
| T23831 |
44406-44414 |
NN |
denotes |
promoter |
| T23832 |
44415-44424 |
NNS |
denotes |
sequences |
| T23833 |
44425-44429 |
VBD |
denotes |
were |
| T23829 |
44430-44438 |
VBN |
denotes |
isolated |
| T23834 |
44439-44442 |
CC |
denotes |
and |
| T23835 |
44443-44452 |
VBN |
denotes |
sequenced |
| T23836 |
44453-44455 |
TO |
denotes |
to |
| T23837 |
44456-44462 |
VB |
denotes |
obtain |
| T23838 |
44463-44468 |
NN |
denotes |
Dmrt7 |
| T23840 |
44469-44476 |
JJ |
denotes |
genomic |
| T23839 |
44477-44485 |
NN |
denotes |
sequence |
| T23841 |
44485-44486 |
. |
denotes |
. |
| T23842 |
44486-44635 |
sentence |
denotes |
The targeting vector pDZ169 (diagrammed in Figure S2) was constructed by the following scheme: The vector pDZ157 was used as a backbone vector [31]. |
| T23843 |
44487-44490 |
DT |
denotes |
The |
| T23845 |
44491-44500 |
NN |
denotes |
targeting |
| T23844 |
44501-44507 |
NN |
denotes |
vector |
| T23847 |
44508-44514 |
NN |
denotes |
pDZ169 |
| T23848 |
44515-44516 |
-LRB- |
denotes |
( |
| T23849 |
44516-44526 |
VBN |
denotes |
diagrammed |
| T23850 |
44527-44529 |
IN |
denotes |
in |
| T23851 |
44530-44536 |
NN |
denotes |
Figure |
| T23852 |
44537-44539 |
NN |
denotes |
S2 |
| T23853 |
44539-44540 |
-RRB- |
denotes |
) |
| T23854 |
44541-44544 |
VBD |
denotes |
was |
| T23846 |
44545-44556 |
VBN |
denotes |
constructed |
| T23856 |
44557-44559 |
IN |
denotes |
by |
| T23857 |
44560-44563 |
DT |
denotes |
the |
| T23859 |
44564-44573 |
VBG |
denotes |
following |
| T23858 |
44574-44580 |
NN |
denotes |
scheme |
| T23860 |
44580-44582 |
: |
denotes |
: |
| T23861 |
44582-44585 |
DT |
denotes |
The |
| T23863 |
44586-44592 |
NN |
denotes |
vector |
| T23862 |
44593-44599 |
NN |
denotes |
pDZ157 |
| T23864 |
44600-44603 |
VBD |
denotes |
was |
| T23855 |
44604-44608 |
VBN |
denotes |
used |
| T23865 |
44609-44611 |
IN |
denotes |
as |
| T23866 |
44612-44613 |
DT |
denotes |
a |
| T23868 |
44614-44622 |
NN |
denotes |
backbone |
| T23867 |
44623-44629 |
NN |
denotes |
vector |
| T23869 |
44630-44631 |
-LRB- |
denotes |
[ |
| T23870 |
44631-44633 |
CD |
denotes |
31 |
| T23871 |
44633-44634 |
-RRB- |
denotes |
] |
| T23872 |
44634-44635 |
. |
denotes |
. |
| T23873 |
44635-44801 |
sentence |
denotes |
3′ to Pgk-neo and the loxP site, we inserted, as a XmaI/XmaI DNA fragment, the third intron of Dmrt7 (from 366 bp to 2,773 bp downstream of exon 3) generated by PCR. |
| T23874 |
44636-44637 |
CD |
denotes |
3 |
| T23876 |
44637-44638 |
SYM |
denotes |
′ |
| T23877 |
44639-44641 |
IN |
denotes |
to |
| T23878 |
44642-44645 |
NN |
denotes |
Pgk |
| T23880 |
44645-44646 |
HYPH |
denotes |
- |
| T23879 |
44646-44649 |
NN |
denotes |
neo |
| T23881 |
44650-44653 |
CC |
denotes |
and |
| T23882 |
44654-44657 |
DT |
denotes |
the |
| T23884 |
44658-44662 |
NN |
denotes |
loxP |
| T23883 |
44663-44667 |
NN |
denotes |
site |
| T23885 |
44667-44669 |
, |
denotes |
, |
| T23886 |
44669-44671 |
PRP |
denotes |
we |
| T23875 |
44672-44680 |
VBD |
denotes |
inserted |
| T23887 |
44680-44682 |
, |
denotes |
, |
| T23888 |
44682-44684 |
IN |
denotes |
as |
| T23889 |
44685-44686 |
DT |
denotes |
a |
| T23891 |
44687-44691 |
NN |
denotes |
XmaI |
| T23893 |
44691-44692 |
HYPH |
denotes |
/ |
| T23892 |
44692-44696 |
NN |
denotes |
XmaI |
| T23894 |
44697-44700 |
NN |
denotes |
DNA |
| T23890 |
44701-44709 |
NN |
denotes |
fragment |
| T23895 |
44709-44711 |
, |
denotes |
, |
| T23896 |
44711-44714 |
DT |
denotes |
the |
| T23898 |
44715-44720 |
JJ |
denotes |
third |
| T23897 |
44721-44727 |
NN |
denotes |
intron |
| T23899 |
44728-44730 |
IN |
denotes |
of |
| T23900 |
44731-44736 |
NN |
denotes |
Dmrt7 |
| T23901 |
44737-44738 |
-LRB- |
denotes |
( |
| T23903 |
44738-44742 |
IN |
denotes |
from |
| T23904 |
44743-44746 |
CD |
denotes |
366 |
| T23905 |
44747-44749 |
NNS |
denotes |
bp |
| T23906 |
44750-44752 |
IN |
denotes |
to |
| T23907 |
44753-44758 |
CD |
denotes |
2,773 |
| T23908 |
44759-44761 |
NNS |
denotes |
bp |
| T23902 |
44762-44772 |
RB |
denotes |
downstream |
| T23909 |
44773-44775 |
IN |
denotes |
of |
| T23910 |
44776-44780 |
NN |
denotes |
exon |
| T23911 |
44781-44782 |
CD |
denotes |
3 |
| T23912 |
44782-44783 |
-RRB- |
denotes |
) |
| T23913 |
44784-44793 |
VBN |
denotes |
generated |
| T23914 |
44794-44796 |
IN |
denotes |
by |
| T23915 |
44797-44800 |
NN |
denotes |
PCR |
| T23916 |
44800-44801 |
. |
denotes |
. |
| T23917 |
44801-44926 |
sentence |
denotes |
5′ to Pgk-neo, we inserted an EcoRI/NotI PCR fragment extending from 4,107 bp to 336 bp 5′ of the Dmrt7 translational start. |
| T23918 |
44802-44803 |
CD |
denotes |
5 |
| T23920 |
44803-44804 |
SYM |
denotes |
′ |
| T23921 |
44805-44807 |
IN |
denotes |
to |
| T23922 |
44808-44811 |
NN |
denotes |
Pgk |
| T23924 |
44811-44812 |
HYPH |
denotes |
- |
| T23923 |
44812-44815 |
NN |
denotes |
neo |
| T23925 |
44815-44817 |
, |
denotes |
, |
| T23926 |
44817-44819 |
PRP |
denotes |
we |
| T23919 |
44820-44828 |
VBD |
denotes |
inserted |
| T23927 |
44829-44831 |
DT |
denotes |
an |
| T23929 |
44832-44837 |
NN |
denotes |
EcoRI |
| T23931 |
44837-44838 |
HYPH |
denotes |
/ |
| T23930 |
44838-44842 |
NN |
denotes |
NotI |
| T23932 |
44843-44846 |
NN |
denotes |
PCR |
| T23928 |
44847-44855 |
NN |
denotes |
fragment |
| T23933 |
44856-44865 |
VBG |
denotes |
extending |
| T23934 |
44866-44870 |
IN |
denotes |
from |
| T23935 |
44871-44876 |
CD |
denotes |
4,107 |
| T23936 |
44877-44879 |
NNS |
denotes |
bp |
| T23937 |
44880-44882 |
IN |
denotes |
to |
| T23938 |
44883-44886 |
CD |
denotes |
336 |
| T23939 |
44887-44889 |
NNS |
denotes |
bp |
| T23940 |
44890-44891 |
CD |
denotes |
5 |
| T23941 |
44891-44892 |
SYM |
denotes |
′ |
| T23942 |
44893-44895 |
IN |
denotes |
of |
| T23943 |
44896-44899 |
DT |
denotes |
the |
| T23945 |
44900-44905 |
NN |
denotes |
Dmrt7 |
| T23946 |
44906-44919 |
JJ |
denotes |
translational |
| T23944 |
44920-44925 |
NN |
denotes |
start |
| T23947 |
44925-44926 |
. |
denotes |
. |
| T23948 |
44926-45017 |
sentence |
denotes |
Finally, we inserted a loxP site and NotI site 336 bp 5′ of the Dmrt7 translational start. |
| T23949 |
44927-44934 |
RB |
denotes |
Finally |
| T23951 |
44934-44936 |
, |
denotes |
, |
| T23952 |
44936-44938 |
PRP |
denotes |
we |
| T23950 |
44939-44947 |
VBD |
denotes |
inserted |
| T23953 |
44948-44949 |
DT |
denotes |
a |
| T23955 |
44950-44954 |
NN |
denotes |
loxP |
| T23954 |
44955-44959 |
NN |
denotes |
site |
| T23956 |
44960-44963 |
CC |
denotes |
and |
| T23957 |
44964-44968 |
NN |
denotes |
NotI |
| T23958 |
44969-44973 |
NN |
denotes |
site |
| T23959 |
44974-44977 |
CD |
denotes |
336 |
| T23960 |
44978-44980 |
NNS |
denotes |
bp |
| T23961 |
44981-44982 |
CD |
denotes |
5 |
| T23962 |
44982-44983 |
SYM |
denotes |
′ |
| T23963 |
44984-44986 |
IN |
denotes |
of |
| T23964 |
44987-44990 |
DT |
denotes |
the |
| T23966 |
44991-44996 |
NN |
denotes |
Dmrt7 |
| T23967 |
44997-45010 |
JJ |
denotes |
translational |
| T23965 |
45011-45016 |
NN |
denotes |
start |
| T23968 |
45016-45017 |
. |
denotes |
. |
| T23969 |
45017-45114 |
sentence |
denotes |
In the resulting vector, the second and third exons of Dmrt7 are flanked by loxP sites (floxed). |
| T23970 |
45018-45020 |
IN |
denotes |
In |
| T23972 |
45021-45024 |
DT |
denotes |
the |
| T23974 |
45025-45034 |
VBG |
denotes |
resulting |
| T23973 |
45035-45041 |
NN |
denotes |
vector |
| T23975 |
45041-45043 |
, |
denotes |
, |
| T23976 |
45043-45046 |
DT |
denotes |
the |
| T23978 |
45047-45053 |
JJ |
denotes |
second |
| T23979 |
45054-45057 |
CC |
denotes |
and |
| T23980 |
45058-45063 |
JJ |
denotes |
third |
| T23977 |
45064-45069 |
NNS |
denotes |
exons |
| T23981 |
45070-45072 |
IN |
denotes |
of |
| T23982 |
45073-45078 |
NN |
denotes |
Dmrt7 |
| T23983 |
45079-45082 |
VBP |
denotes |
are |
| T23971 |
45083-45090 |
VBN |
denotes |
flanked |
| T23984 |
45091-45093 |
IN |
denotes |
by |
| T23985 |
45094-45098 |
NN |
denotes |
loxP |
| T23986 |
45099-45104 |
NNS |
denotes |
sites |
| T23987 |
45105-45106 |
-LRB- |
denotes |
( |
| T23988 |
45106-45112 |
JJ |
denotes |
floxed |
| T23989 |
45112-45113 |
-RRB- |
denotes |
) |
| T23990 |
45113-45114 |
. |
denotes |
. |
| T23991 |
45114-45181 |
sentence |
denotes |
The Dmrt7-containing portions of pDZ169 were completely sequenced. |
| T23992 |
45115-45118 |
DT |
denotes |
The |
| T23994 |
45119-45124 |
NN |
denotes |
Dmrt7 |
| T23996 |
45124-45125 |
HYPH |
denotes |
- |
| T23995 |
45125-45135 |
VBG |
denotes |
containing |
| T23993 |
45136-45144 |
NNS |
denotes |
portions |
| T23998 |
45145-45147 |
IN |
denotes |
of |
| T23999 |
45148-45154 |
NN |
denotes |
pDZ169 |
| T24000 |
45155-45159 |
VBD |
denotes |
were |
| T24001 |
45160-45170 |
RB |
denotes |
completely |
| T23997 |
45171-45180 |
VBN |
denotes |
sequenced |
| T24002 |
45180-45181 |
. |
denotes |
. |
| T24003 |
45181-45294 |
sentence |
denotes |
pDZ169 was linearized with PmeI and electroporated into CJ7 ES cells (originally derived from the 129S1 strain). |
| T24004 |
45182-45188 |
NN |
denotes |
pDZ169 |
| T24006 |
45189-45192 |
VBD |
denotes |
was |
| T24005 |
45193-45203 |
VBN |
denotes |
linearized |
| T24007 |
45204-45208 |
IN |
denotes |
with |
| T24008 |
45209-45213 |
NN |
denotes |
PmeI |
| T24009 |
45214-45217 |
CC |
denotes |
and |
| T24010 |
45218-45232 |
VBN |
denotes |
electroporated |
| T24011 |
45233-45237 |
IN |
denotes |
into |
| T24012 |
45238-45241 |
NN |
denotes |
CJ7 |
| T24014 |
45242-45244 |
NN |
denotes |
ES |
| T24013 |
45245-45250 |
NNS |
denotes |
cells |
| T24015 |
45251-45252 |
-LRB- |
denotes |
( |
| T24016 |
45252-45262 |
RB |
denotes |
originally |
| T24017 |
45263-45270 |
VBN |
denotes |
derived |
| T24018 |
45271-45275 |
IN |
denotes |
from |
| T24019 |
45276-45279 |
DT |
denotes |
the |
| T24021 |
45280-45285 |
NN |
denotes |
129S1 |
| T24020 |
45286-45292 |
NN |
denotes |
strain |
| T24022 |
45292-45293 |
-RRB- |
denotes |
) |
| T24023 |
45293-45294 |
. |
denotes |
. |
| T24024 |
45294-45502 |
sentence |
denotes |
Three homologous recombinants were identified from 296 G418-resistant colonies by Southern hybridization by use of a DNA probe from the sequences upstream of exon 1 to screen genomic DNA digested with EcoRI. |
| T24025 |
45295-45300 |
CD |
denotes |
Three |
| T24027 |
45301-45311 |
JJ |
denotes |
homologous |
| T24026 |
45312-45324 |
NNS |
denotes |
recombinants |
| T24029 |
45325-45329 |
VBD |
denotes |
were |
| T24028 |
45330-45340 |
VBN |
denotes |
identified |
| T24030 |
45341-45345 |
IN |
denotes |
from |
| T24031 |
45346-45349 |
CD |
denotes |
296 |
| T24033 |
45350-45354 |
NN |
denotes |
G418 |
| T24035 |
45354-45355 |
HYPH |
denotes |
- |
| T24034 |
45355-45364 |
JJ |
denotes |
resistant |
| T24032 |
45365-45373 |
NNS |
denotes |
colonies |
| T24036 |
45374-45376 |
IN |
denotes |
by |
| T24037 |
45377-45385 |
NNP |
denotes |
Southern |
| T24038 |
45386-45399 |
NN |
denotes |
hybridization |
| T24039 |
45400-45402 |
IN |
denotes |
by |
| T24040 |
45403-45406 |
NN |
denotes |
use |
| T24041 |
45407-45409 |
IN |
denotes |
of |
| T24042 |
45410-45411 |
DT |
denotes |
a |
| T24044 |
45412-45415 |
NN |
denotes |
DNA |
| T24043 |
45416-45421 |
NN |
denotes |
probe |
| T24045 |
45422-45426 |
IN |
denotes |
from |
| T24046 |
45427-45430 |
DT |
denotes |
the |
| T24047 |
45431-45440 |
NNS |
denotes |
sequences |
| T24048 |
45441-45449 |
RB |
denotes |
upstream |
| T24049 |
45450-45452 |
IN |
denotes |
of |
| T24050 |
45453-45457 |
NN |
denotes |
exon |
| T24051 |
45458-45459 |
CD |
denotes |
1 |
| T24052 |
45460-45462 |
TO |
denotes |
to |
| T24053 |
45463-45469 |
VB |
denotes |
screen |
| T24054 |
45470-45477 |
JJ |
denotes |
genomic |
| T24055 |
45478-45481 |
NN |
denotes |
DNA |
| T24056 |
45482-45490 |
VBN |
denotes |
digested |
| T24057 |
45491-45495 |
IN |
denotes |
with |
| T24058 |
45496-45501 |
NN |
denotes |
EcoRI |
| T24059 |
45501-45502 |
. |
denotes |
. |
| T24060 |
45502-45604 |
sentence |
denotes |
Homologous recombination was confirmed on both ends of the targeted region by Southern hybridization. |
| T24061 |
45503-45513 |
JJ |
denotes |
Homologous |
| T24062 |
45514-45527 |
NN |
denotes |
recombination |
| T24064 |
45528-45531 |
VBD |
denotes |
was |
| T24063 |
45532-45541 |
VBN |
denotes |
confirmed |
| T24065 |
45542-45544 |
IN |
denotes |
on |
| T24066 |
45545-45549 |
DT |
denotes |
both |
| T24067 |
45550-45554 |
NNS |
denotes |
ends |
| T24068 |
45555-45557 |
IN |
denotes |
of |
| T24069 |
45558-45561 |
DT |
denotes |
the |
| T24071 |
45562-45570 |
VBN |
denotes |
targeted |
| T24070 |
45571-45577 |
NN |
denotes |
region |
| T24072 |
45578-45580 |
IN |
denotes |
by |
| T24073 |
45581-45589 |
NNP |
denotes |
Southern |
| T24074 |
45590-45603 |
NN |
denotes |
hybridization |
| T24075 |
45603-45604 |
. |
denotes |
. |
| T24076 |
45604-45738 |
sentence |
denotes |
Probes for Southern hybridization were made by PCR using primers DM5S10/DM5S11 (5′ probe) and DM5PR1/DM5PR2 (3′ probe), listed below. |
| T24077 |
45605-45611 |
NNS |
denotes |
Probes |
| T24079 |
45612-45615 |
IN |
denotes |
for |
| T24080 |
45616-45624 |
NNP |
denotes |
Southern |
| T24081 |
45625-45638 |
NN |
denotes |
hybridization |
| T24082 |
45639-45643 |
VBD |
denotes |
were |
| T24078 |
45644-45648 |
VBN |
denotes |
made |
| T24083 |
45649-45651 |
IN |
denotes |
by |
| T24084 |
45652-45655 |
NN |
denotes |
PCR |
| T24085 |
45656-45661 |
VBG |
denotes |
using |
| T24086 |
45662-45669 |
NNS |
denotes |
primers |
| T24088 |
45670-45676 |
NN |
denotes |
DM5S10 |
| T24089 |
45676-45677 |
HYPH |
denotes |
/ |
| T24087 |
45677-45683 |
NN |
denotes |
DM5S11 |
| T24090 |
45684-45685 |
-LRB- |
denotes |
( |
| T24092 |
45685-45686 |
CD |
denotes |
5 |
| T24093 |
45686-45687 |
SYM |
denotes |
′ |
| T24091 |
45688-45693 |
NN |
denotes |
probe |
| T24094 |
45693-45694 |
-RRB- |
denotes |
) |
| T24095 |
45695-45698 |
CC |
denotes |
and |
| T24096 |
45699-45705 |
NN |
denotes |
DM5PR1 |
| T24098 |
45705-45706 |
HYPH |
denotes |
/ |
| T24097 |
45706-45712 |
NN |
denotes |
DM5PR2 |
| T24099 |
45713-45714 |
-LRB- |
denotes |
( |
| T24101 |
45714-45715 |
CD |
denotes |
3 |
| T24102 |
45715-45716 |
SYM |
denotes |
′ |
| T24100 |
45717-45722 |
NN |
denotes |
probe |
| T24103 |
45722-45723 |
-RRB- |
denotes |
) |
| T24104 |
45723-45725 |
, |
denotes |
, |
| T24105 |
45725-45731 |
VBN |
denotes |
listed |
| T24106 |
45732-45737 |
RB |
denotes |
below |
| T24107 |
45737-45738 |
. |
denotes |
. |
| T24108 |
45738-45865 |
sentence |
denotes |
Two targeted ES cell clones containing the floxed allele Dmrt7neo were injected into C57Bl/6 blastocysts to generate chimeras. |
| T24109 |
45739-45742 |
CD |
denotes |
Two |
| T24111 |
45743-45751 |
VBN |
denotes |
targeted |
| T24112 |
45752-45754 |
NN |
denotes |
ES |
| T24113 |
45755-45759 |
NN |
denotes |
cell |
| T24110 |
45760-45766 |
NNS |
denotes |
clones |
| T24115 |
45767-45777 |
VBG |
denotes |
containing |
| T24116 |
45778-45781 |
DT |
denotes |
the |
| T24118 |
45782-45788 |
VBN |
denotes |
floxed |
| T24117 |
45789-45795 |
NN |
denotes |
allele |
| T24119 |
45796-45804 |
NN |
denotes |
Dmrt7neo |
| T24120 |
45805-45809 |
VBD |
denotes |
were |
| T24114 |
45810-45818 |
VBN |
denotes |
injected |
| T24121 |
45819-45823 |
IN |
denotes |
into |
| T24122 |
45824-45829 |
NN |
denotes |
C57Bl |
| T24124 |
45829-45830 |
HYPH |
denotes |
/ |
| T24125 |
45830-45831 |
CD |
denotes |
6 |
| T24123 |
45832-45843 |
NNS |
denotes |
blastocysts |
| T24126 |
45844-45846 |
TO |
denotes |
to |
| T24127 |
45847-45855 |
VB |
denotes |
generate |
| T24128 |
45856-45864 |
NNS |
denotes |
chimeras |
| T24129 |
45864-45865 |
. |
denotes |
. |
| T24130 |
45865-45956 |
sentence |
denotes |
Chimeric males were bred with C57Bl/6 females to generate heterozygotes carrying Dmrt7neo. |
| T24131 |
45866-45874 |
JJ |
denotes |
Chimeric |
| T24132 |
45875-45880 |
NNS |
denotes |
males |
| T24134 |
45881-45885 |
VBD |
denotes |
were |
| T24133 |
45886-45890 |
VBN |
denotes |
bred |
| T24135 |
45891-45895 |
IN |
denotes |
with |
| T24136 |
45896-45901 |
NN |
denotes |
C57Bl |
| T24138 |
45901-45902 |
HYPH |
denotes |
/ |
| T24139 |
45902-45903 |
CD |
denotes |
6 |
| T24137 |
45904-45911 |
NNS |
denotes |
females |
| T24140 |
45912-45914 |
TO |
denotes |
to |
| T24141 |
45915-45923 |
VB |
denotes |
generate |
| T24142 |
45924-45937 |
NNS |
denotes |
heterozygotes |
| T24143 |
45938-45946 |
VBG |
denotes |
carrying |
| T24144 |
45947-45955 |
NN |
denotes |
Dmrt7neo |
| T24145 |
45955-45956 |
. |
denotes |
. |
| T24146 |
45956-46175 |
sentence |
denotes |
Dmrt7+/Dmrt7neo females were bred with male β-actin-Cre transgenic mice to delete the floxed sequences and generate heterozygous Dmrt7− /+ deletion mutants, which were interbred to generate homozygous Dmrt7−/− mutants. |
| T24147 |
45957-45962 |
NN |
denotes |
Dmrt7 |
| T24149 |
45962-45963 |
SYM |
denotes |
+ |
| T24150 |
45963-45964 |
HYPH |
denotes |
/ |
| T24151 |
45964-45972 |
NN |
denotes |
Dmrt7neo |
| T24148 |
45973-45980 |
NNS |
denotes |
females |
| T24153 |
45981-45985 |
VBD |
denotes |
were |
| T24152 |
45986-45990 |
VBN |
denotes |
bred |
| T24154 |
45991-45995 |
IN |
denotes |
with |
| T24155 |
45996-46000 |
JJ |
denotes |
male |
| T24157 |
46001-46002 |
NN |
denotes |
β |
| T24159 |
46002-46003 |
HYPH |
denotes |
- |
| T24158 |
46003-46008 |
NN |
denotes |
actin |
| T24161 |
46008-46009 |
HYPH |
denotes |
- |
| T24160 |
46009-46012 |
NN |
denotes |
Cre |
| T24162 |
46013-46023 |
JJ |
denotes |
transgenic |
| T24156 |
46024-46028 |
NNS |
denotes |
mice |
| T24163 |
46029-46031 |
TO |
denotes |
to |
| T24164 |
46032-46038 |
VB |
denotes |
delete |
| T24165 |
46039-46042 |
DT |
denotes |
the |
| T24167 |
46043-46049 |
VBN |
denotes |
floxed |
| T24166 |
46050-46059 |
NNS |
denotes |
sequences |
| T24168 |
46060-46063 |
CC |
denotes |
and |
| T24169 |
46064-46072 |
VB |
denotes |
generate |
| T24170 |
46073-46085 |
JJ |
denotes |
heterozygous |
| T24172 |
46086-46091 |
NN |
denotes |
Dmrt7 |
| T24173 |
46091-46092 |
SYM |
denotes |
− |
| T24174 |
46093-46094 |
HYPH |
denotes |
/ |
| T24175 |
46094-46095 |
SYM |
denotes |
+ |
| T24176 |
46096-46104 |
NN |
denotes |
deletion |
| T24171 |
46105-46112 |
NNS |
denotes |
mutants |
| T24177 |
46112-46114 |
, |
denotes |
, |
| T24178 |
46114-46119 |
WDT |
denotes |
which |
| T24180 |
46120-46124 |
VBD |
denotes |
were |
| T24179 |
46125-46134 |
VBN |
denotes |
interbred |
| T24181 |
46135-46137 |
TO |
denotes |
to |
| T24182 |
46138-46146 |
VB |
denotes |
generate |
| T24183 |
46147-46157 |
JJ |
denotes |
homozygous |
| T24185 |
46158-46163 |
NN |
denotes |
Dmrt7 |
| T24186 |
46163-46164 |
SYM |
denotes |
− |
| T24187 |
46164-46165 |
HYPH |
denotes |
/ |
| T24188 |
46165-46166 |
SYM |
denotes |
− |
| T24184 |
46167-46174 |
NNS |
denotes |
mutants |
| T24189 |
46174-46175 |
. |
denotes |
. |
| T24486 |
46177-46187 |
NN |
denotes |
Genotyping |
| T24487 |
46188-46191 |
CC |
denotes |
and |
| T24488 |
46192-46194 |
NN |
denotes |
RT |
| T24490 |
46194-46195 |
HYPH |
denotes |
- |
| T24489 |
46195-46198 |
NN |
denotes |
PCR |
| T24491 |
46198-46199 |
. |
denotes |
. |
| T24492 |
46199-46258 |
sentence |
denotes |
For genotyping, tail-clip DNA was amplified for 35 cycles. |
| T24493 |
46200-46203 |
IN |
denotes |
For |
| T24495 |
46204-46214 |
NN |
denotes |
genotyping |
| T24496 |
46214-46216 |
, |
denotes |
, |
| T24497 |
46216-46220 |
NN |
denotes |
tail |
| T24499 |
46220-46221 |
HYPH |
denotes |
- |
| T24498 |
46221-46225 |
NN |
denotes |
clip |
| T24500 |
46226-46229 |
NN |
denotes |
DNA |
| T24501 |
46230-46233 |
VBD |
denotes |
was |
| T24494 |
46234-46243 |
VBN |
denotes |
amplified |
| T24502 |
46244-46247 |
IN |
denotes |
for |
| T24503 |
46248-46250 |
CD |
denotes |
35 |
| T24504 |
46251-46257 |
NNS |
denotes |
cycles |
| T24505 |
46257-46258 |
. |
denotes |
. |
| T24506 |
46258-46347 |
sentence |
denotes |
Chromosomal sex was determined by PCR with primers to the Y chromosome gene Zfy (below). |
| T24507 |
46259-46270 |
JJ |
denotes |
Chromosomal |
| T24508 |
46271-46274 |
NN |
denotes |
sex |
| T24510 |
46275-46278 |
VBD |
denotes |
was |
| T24509 |
46279-46289 |
VBN |
denotes |
determined |
| T24511 |
46290-46292 |
IN |
denotes |
by |
| T24512 |
46293-46296 |
NN |
denotes |
PCR |
| T24513 |
46297-46301 |
IN |
denotes |
with |
| T24514 |
46302-46309 |
NNS |
denotes |
primers |
| T24515 |
46310-46312 |
IN |
denotes |
to |
| T24516 |
46313-46316 |
DT |
denotes |
the |
| T24518 |
46317-46318 |
NN |
denotes |
Y |
| T24519 |
46319-46329 |
NN |
denotes |
chromosome |
| T24517 |
46330-46334 |
NN |
denotes |
gene |
| T24520 |
46335-46338 |
NN |
denotes |
Zfy |
| T24521 |
46339-46340 |
-LRB- |
denotes |
( |
| T24522 |
46340-46345 |
RB |
denotes |
below |
| T24523 |
46345-46346 |
-RRB- |
denotes |
) |
| T24524 |
46346-46347 |
. |
denotes |
. |
| T24525 |
46347-46459 |
sentence |
denotes |
The wild-type Dmrt7 allele Dmrt7+ was detected by PCR with DM5S4/DM5S5, with an annealing temperature of 60 °C. |
| T24526 |
46348-46351 |
DT |
denotes |
The |
| T24528 |
46352-46356 |
JJ |
denotes |
wild |
| T24530 |
46356-46357 |
HYPH |
denotes |
- |
| T24529 |
46357-46361 |
NN |
denotes |
type |
| T24531 |
46362-46367 |
NN |
denotes |
Dmrt7 |
| T24527 |
46368-46374 |
NN |
denotes |
allele |
| T24533 |
46375-46380 |
NN |
denotes |
Dmrt7 |
| T24534 |
46380-46381 |
SYM |
denotes |
+ |
| T24535 |
46382-46385 |
VBD |
denotes |
was |
| T24532 |
46386-46394 |
VBN |
denotes |
detected |
| T24536 |
46395-46397 |
IN |
denotes |
by |
| T24537 |
46398-46401 |
NN |
denotes |
PCR |
| T24538 |
46402-46406 |
IN |
denotes |
with |
| T24539 |
46407-46412 |
NN |
denotes |
DM5S4 |
| T24541 |
46412-46413 |
HYPH |
denotes |
/ |
| T24540 |
46413-46418 |
NN |
denotes |
DM5S5 |
| T24542 |
46418-46420 |
, |
denotes |
, |
| T24543 |
46420-46424 |
IN |
denotes |
with |
| T24544 |
46425-46427 |
DT |
denotes |
an |
| T24546 |
46428-46437 |
JJ |
denotes |
annealing |
| T24545 |
46438-46449 |
NN |
denotes |
temperature |
| T24547 |
46450-46452 |
IN |
denotes |
of |
| T24548 |
46453-46455 |
CD |
denotes |
60 |
| T24549 |
46456-46458 |
NN |
denotes |
°C |
| T24550 |
46458-46459 |
. |
denotes |
. |
| T24551 |
46459-46560 |
sentence |
denotes |
The Dmrt7flox allele was detected by PCR with DM5S5F/DM7KO7R with an annealing temperature of 62 °C. |
| T24552 |
46460-46463 |
DT |
denotes |
The |
| T24554 |
46464-46473 |
NN |
denotes |
Dmrt7flox |
| T24553 |
46474-46480 |
NN |
denotes |
allele |
| T24556 |
46481-46484 |
VBD |
denotes |
was |
| T24555 |
46485-46493 |
VBN |
denotes |
detected |
| T24557 |
46494-46496 |
IN |
denotes |
by |
| T24558 |
46497-46500 |
NN |
denotes |
PCR |
| T24559 |
46501-46505 |
IN |
denotes |
with |
| T24560 |
46506-46512 |
NN |
denotes |
DM5S5F |
| T24562 |
46512-46513 |
HYPH |
denotes |
/ |
| T24561 |
46513-46520 |
NN |
denotes |
DM7KO7R |
| T24563 |
46521-46525 |
IN |
denotes |
with |
| T24564 |
46526-46528 |
DT |
denotes |
an |
| T24566 |
46529-46538 |
JJ |
denotes |
annealing |
| T24565 |
46539-46550 |
NN |
denotes |
temperature |
| T24567 |
46551-46553 |
IN |
denotes |
of |
| T24568 |
46554-46556 |
CD |
denotes |
62 |
| T24569 |
46557-46559 |
NN |
denotes |
°C |
| T24570 |
46559-46560 |
. |
denotes |
. |
| T24571 |
46560-46664 |
sentence |
denotes |
The deleted Dmrt7 allele Dmrt7− was detected with DM5S3/DM7KO7R with an annealing temperature of 62 °C. |
| T24572 |
46561-46564 |
DT |
denotes |
The |
| T24574 |
46565-46572 |
VBN |
denotes |
deleted |
| T24575 |
46573-46578 |
NN |
denotes |
Dmrt7 |
| T24573 |
46579-46585 |
NN |
denotes |
allele |
| T24577 |
46586-46591 |
NN |
denotes |
Dmrt7 |
| T24578 |
46591-46592 |
SYM |
denotes |
− |
| T24579 |
46593-46596 |
VBD |
denotes |
was |
| T24576 |
46597-46605 |
VBN |
denotes |
detected |
| T24580 |
46606-46610 |
IN |
denotes |
with |
| T24581 |
46611-46616 |
NN |
denotes |
DM5S3 |
| T24583 |
46616-46617 |
HYPH |
denotes |
/ |
| T24582 |
46617-46624 |
NN |
denotes |
DM7KO7R |
| T24584 |
46625-46629 |
IN |
denotes |
with |
| T24585 |
46630-46632 |
DT |
denotes |
an |
| T24587 |
46633-46642 |
JJ |
denotes |
annealing |
| T24586 |
46643-46654 |
NN |
denotes |
temperature |
| T24588 |
46655-46657 |
IN |
denotes |
of |
| T24589 |
46658-46660 |
CD |
denotes |
62 |
| T24590 |
46661-46663 |
NN |
denotes |
°C |
| T24591 |
46663-46664 |
. |
denotes |
. |
| T24592 |
46664-46789 |
sentence |
denotes |
RT-PCR for Dmrt7 expression analysis was as described [23] using primers SK111/SK112 with an annealing temperature of 62 °C. |
| T24593 |
46665-46667 |
NN |
denotes |
RT |
| T24595 |
46667-46668 |
HYPH |
denotes |
- |
| T24594 |
46668-46671 |
NN |
denotes |
PCR |
| T24597 |
46672-46675 |
IN |
denotes |
for |
| T24598 |
46676-46681 |
NN |
denotes |
Dmrt7 |
| T24599 |
46682-46692 |
NN |
denotes |
expression |
| T24600 |
46693-46701 |
NN |
denotes |
analysis |
| T24596 |
46702-46705 |
VBD |
denotes |
was |
| T24601 |
46706-46708 |
IN |
denotes |
as |
| T24602 |
46709-46718 |
VBN |
denotes |
described |
| T24603 |
46719-46720 |
-LRB- |
denotes |
[ |
| T24604 |
46720-46722 |
CD |
denotes |
23 |
| T24605 |
46722-46723 |
-RRB- |
denotes |
] |
| T24606 |
46724-46729 |
VBG |
denotes |
using |
| T24607 |
46730-46737 |
NNS |
denotes |
primers |
| T24609 |
46738-46743 |
NN |
denotes |
SK111 |
| T24610 |
46743-46744 |
HYPH |
denotes |
/ |
| T24608 |
46744-46749 |
NN |
denotes |
SK112 |
| T24611 |
46750-46754 |
IN |
denotes |
with |
| T24612 |
46755-46757 |
DT |
denotes |
an |
| T24614 |
46758-46767 |
NN |
denotes |
annealing |
| T24613 |
46768-46779 |
NN |
denotes |
temperature |
| T24615 |
46780-46782 |
IN |
denotes |
of |
| T24616 |
46783-46785 |
CD |
denotes |
62 |
| T24617 |
46786-46788 |
NNS |
denotes |
°C |
| T24618 |
46788-46789 |
. |
denotes |
. |
| T24840 |
46791-46798 |
NNS |
denotes |
Primers |
| T24841 |
46798-46799 |
. |
denotes |
. |
| T24842 |
46799-46837 |
sentence |
denotes |
DM5S3: 5′-AGAGTGGATTGAATCGGATAGCTC-3′ |
| T24843 |
46800-46805 |
NN |
denotes |
DM5S3 |
| T24844 |
46805-46807 |
: |
denotes |
: |
| T24845 |
46807-46808 |
CD |
denotes |
5 |
| T24847 |
46808-46809 |
SYM |
denotes |
′ |
| T24848 |
46809-46810 |
HYPH |
denotes |
- |
| T24846 |
46810-46834 |
NN |
denotes |
AGAGTGGATTGAATCGGATAGCTC |
| T24849 |
46834-46835 |
HYPH |
denotes |
- |
| T24850 |
46835-46836 |
CD |
denotes |
3 |
| T24851 |
46836-46837 |
SYM |
denotes |
′ |
| T24852 |
46837-46875 |
sentence |
denotes |
DM5S4: 5′-AGGATCTTAGTGTCGAATGAATAC-3′ |
| T24853 |
46838-46843 |
NN |
denotes |
DM5S4 |
| T24854 |
46843-46845 |
: |
denotes |
: |
| T24855 |
46845-46846 |
CD |
denotes |
5 |
| T24857 |
46846-46847 |
SYM |
denotes |
′ |
| T24858 |
46847-46848 |
HYPH |
denotes |
- |
| T24856 |
46848-46872 |
NN |
denotes |
AGGATCTTAGTGTCGAATGAATAC |
| T24859 |
46872-46873 |
HYPH |
denotes |
- |
| T24860 |
46873-46874 |
CD |
denotes |
3 |
| T24861 |
46874-46875 |
SYM |
denotes |
′ |
| T24862 |
46875-46913 |
sentence |
denotes |
DM5S5: 5′-CCCTTATCCTCCTGCATCCAGATC-3′ |
| T24863 |
46876-46881 |
NN |
denotes |
DM5S5 |
| T24864 |
46881-46883 |
: |
denotes |
: |
| T24865 |
46883-46884 |
CD |
denotes |
5 |
| T24867 |
46884-46885 |
SYM |
denotes |
′ |
| T24868 |
46885-46886 |
HYPH |
denotes |
- |
| T24866 |
46886-46910 |
NN |
denotes |
CCCTTATCCTCCTGCATCCAGATC |
| T24869 |
46910-46911 |
HYPH |
denotes |
- |
| T24870 |
46911-46912 |
CD |
denotes |
3 |
| T24871 |
46912-46913 |
SYM |
denotes |
′ |
| T24872 |
46913-46952 |
sentence |
denotes |
DM5S10: 5′-CAGGCTATGGTTAGACTTGAGCAC-3′ |
| T24873 |
46914-46920 |
NN |
denotes |
DM5S10 |
| T24874 |
46920-46922 |
: |
denotes |
: |
| T24875 |
46922-46923 |
CD |
denotes |
5 |
| T24877 |
46923-46924 |
SYM |
denotes |
′ |
| T24878 |
46924-46925 |
HYPH |
denotes |
- |
| T24876 |
46925-46949 |
NN |
denotes |
CAGGCTATGGTTAGACTTGAGCAC |
| T24879 |
46949-46950 |
HYPH |
denotes |
- |
| T24880 |
46950-46951 |
CD |
denotes |
3 |
| T24881 |
46951-46952 |
SYM |
denotes |
′ |
| T24882 |
46952-46991 |
sentence |
denotes |
DM5S11: 5′-CATCACTCGCGGACAAAGATGCAG-3′ |
| T24883 |
46953-46959 |
NN |
denotes |
DM5S11 |
| T24884 |
46959-46961 |
: |
denotes |
: |
| T24885 |
46961-46962 |
CD |
denotes |
5 |
| T24887 |
46962-46963 |
SYM |
denotes |
′ |
| T24888 |
46963-46964 |
HYPH |
denotes |
- |
| T24886 |
46964-46988 |
NN |
denotes |
CATCACTCGCGGACAAAGATGCAG |
| T24889 |
46988-46989 |
HYPH |
denotes |
- |
| T24890 |
46989-46990 |
CD |
denotes |
3 |
| T24891 |
46990-46991 |
SYM |
denotes |
′ |
| T24892 |
46991-47030 |
sentence |
denotes |
DM5PR1: 5′-CTTCTGCTACAGCCACAGGTCTGG-3′ |
| T24893 |
46992-46998 |
NN |
denotes |
DM5PR1 |
| T24894 |
46998-47000 |
: |
denotes |
: |
| T24895 |
47000-47001 |
CD |
denotes |
5 |
| T24897 |
47001-47002 |
SYM |
denotes |
′ |
| T24898 |
47002-47003 |
HYPH |
denotes |
- |
| T24896 |
47003-47027 |
NN |
denotes |
CTTCTGCTACAGCCACAGGTCTGG |
| T24899 |
47027-47028 |
HYPH |
denotes |
- |
| T24900 |
47028-47029 |
CD |
denotes |
3 |
| T24901 |
47029-47030 |
SYM |
denotes |
′ |
| T24902 |
47030-47067 |
sentence |
denotes |
DM5PR2: 5′-GAATTCAACTAGTATCTGTCCC-3′ |
| T24903 |
47031-47037 |
NN |
denotes |
DM5PR2 |
| T24904 |
47037-47039 |
: |
denotes |
: |
| T24905 |
47039-47040 |
CD |
denotes |
5 |
| T24907 |
47040-47041 |
SYM |
denotes |
′ |
| T24908 |
47041-47042 |
HYPH |
denotes |
- |
| T24906 |
47042-47064 |
NN |
denotes |
GAATTCAACTAGTATCTGTCCC |
| T24909 |
47064-47065 |
HYPH |
denotes |
- |
| T24910 |
47065-47066 |
CD |
denotes |
3 |
| T24911 |
47066-47067 |
SYM |
denotes |
′ |
| T24912 |
47067-47108 |
sentence |
denotes |
DM7KO7R: 5′-CGAGGATCAAGCTCAGGTCACTAGG-3′ |
| T24913 |
47068-47075 |
NN |
denotes |
DM7KO7R |
| T24914 |
47075-47077 |
: |
denotes |
: |
| T24915 |
47077-47078 |
CD |
denotes |
5 |
| T24917 |
47078-47079 |
SYM |
denotes |
′ |
| T24918 |
47079-47080 |
HYPH |
denotes |
- |
| T24916 |
47080-47105 |
NN |
denotes |
CGAGGATCAAGCTCAGGTCACTAGG |
| T24919 |
47105-47106 |
HYPH |
denotes |
- |
| T24920 |
47106-47107 |
CD |
denotes |
3 |
| T24921 |
47107-47108 |
SYM |
denotes |
′ |
| T24922 |
47108-47147 |
sentence |
denotes |
DM5S5F: 5′-GATCTGGATGCAGGAGGATAAGGG-3′ |
| T24923 |
47109-47115 |
NN |
denotes |
DM5S5F |
| T24924 |
47115-47117 |
: |
denotes |
: |
| T24925 |
47117-47118 |
CD |
denotes |
5 |
| T24927 |
47118-47119 |
SYM |
denotes |
′ |
| T24928 |
47119-47120 |
HYPH |
denotes |
- |
| T24926 |
47120-47144 |
NN |
denotes |
GATCTGGATGCAGGAGGATAAGGG |
| T24929 |
47144-47145 |
HYPH |
denotes |
- |
| T24930 |
47145-47146 |
CD |
denotes |
3 |
| T24931 |
47146-47147 |
SYM |
denotes |
′ |
| T24932 |
47147-47186 |
sentence |
denotes |
ZFYF: 5′-CCTATTGCATGGACAGCAGTCTTATG-3′ |
| T24933 |
47148-47152 |
NN |
denotes |
ZFYF |
| T24934 |
47152-47154 |
: |
denotes |
: |
| T24935 |
47154-47155 |
CD |
denotes |
5 |
| T24937 |
47155-47156 |
SYM |
denotes |
′ |
| T24938 |
47156-47157 |
HYPH |
denotes |
- |
| T24936 |
47157-47183 |
NN |
denotes |
CCTATTGCATGGACAGCAGTCTTATG |
| T24939 |
47183-47184 |
HYPH |
denotes |
- |
| T24940 |
47184-47185 |
CD |
denotes |
3 |
| T24941 |
47185-47186 |
SYM |
denotes |
′ |
| T24942 |
47186-47226 |
sentence |
denotes |
ZFYR: 5′-GACTAGACATGTTCTTAACATCTGTCC-3′ |
| T24943 |
47187-47191 |
NN |
denotes |
ZFYR |
| T24944 |
47191-47193 |
: |
denotes |
: |
| T24945 |
47193-47194 |
CD |
denotes |
5 |
| T24947 |
47194-47195 |
SYM |
denotes |
′ |
| T24948 |
47195-47196 |
HYPH |
denotes |
- |
| T24946 |
47196-47223 |
NN |
denotes |
GACTAGACATGTTCTTAACATCTGTCC |
| T24949 |
47223-47224 |
HYPH |
denotes |
- |
| T24950 |
47224-47225 |
CD |
denotes |
3 |
| T24951 |
47225-47226 |
SYM |
denotes |
′ |
| T24952 |
47226-47264 |
sentence |
denotes |
SK111: 5′-CCCTTCTGGAAAAGAGAACATAGC-3′ |
| T24953 |
47227-47232 |
NN |
denotes |
SK111 |
| T24954 |
47232-47234 |
: |
denotes |
: |
| T24955 |
47234-47235 |
CD |
denotes |
5 |
| T24957 |
47235-47236 |
SYM |
denotes |
′ |
| T24958 |
47236-47237 |
HYPH |
denotes |
- |
| T24956 |
47237-47261 |
NN |
denotes |
CCCTTCTGGAAAAGAGAACATAGC |
| T24959 |
47261-47262 |
HYPH |
denotes |
- |
| T24960 |
47262-47263 |
CD |
denotes |
3 |
| T24961 |
47263-47264 |
SYM |
denotes |
′ |
| T24962 |
47264-47302 |
sentence |
denotes |
SK112: 5′-GCTCCAGGGGCCTGTGGCTGTAGC-3′ |
| T24963 |
47265-47270 |
NN |
denotes |
SK112 |
| T24964 |
47270-47272 |
: |
denotes |
: |
| T24965 |
47272-47273 |
CD |
denotes |
5 |
| T24967 |
47273-47274 |
SYM |
denotes |
′ |
| T24968 |
47274-47275 |
HYPH |
denotes |
- |
| T24966 |
47275-47299 |
NN |
denotes |
GCTCCAGGGGCCTGTGGCTGTAGC |
| T24969 |
47299-47300 |
HYPH |
denotes |
- |
| T24970 |
47300-47301 |
CD |
denotes |
3 |
| T24971 |
47301-47302 |
SYM |
denotes |
′ |
| T24972 |
47302-47339 |
sentence |
denotes |
β-actinF: 5′-TGCGTGACATCAAAGAGAAG-3′ |
| T24973 |
47303-47304 |
NN |
denotes |
β |
| T24975 |
47304-47305 |
HYPH |
denotes |
- |
| T24974 |
47305-47311 |
NN |
denotes |
actinF |
| T24976 |
47311-47313 |
: |
denotes |
: |
| T24977 |
47313-47314 |
CD |
denotes |
5 |
| T24979 |
47314-47315 |
SYM |
denotes |
′ |
| T24980 |
47315-47316 |
HYPH |
denotes |
- |
| T24978 |
47316-47336 |
NN |
denotes |
TGCGTGACATCAAAGAGAAG |
| T24981 |
47336-47337 |
HYPH |
denotes |
- |
| T24982 |
47337-47338 |
CD |
denotes |
3 |
| T24983 |
47338-47339 |
SYM |
denotes |
′ |
| T24984 |
47339-47375 |
sentence |
denotes |
β-actinR: 5′-GATGCCACAGGATTCCATA-3′ |
| T24985 |
47340-47341 |
NN |
denotes |
β |
| T24987 |
47341-47342 |
HYPH |
denotes |
- |
| T24986 |
47342-47348 |
NN |
denotes |
actinR |
| T24988 |
47348-47350 |
: |
denotes |
: |
| T24989 |
47350-47351 |
CD |
denotes |
5 |
| T24991 |
47351-47352 |
SYM |
denotes |
′ |
| T24992 |
47352-47353 |
HYPH |
denotes |
- |
| T24990 |
47353-47372 |
NN |
denotes |
GATGCCACAGGATTCCATA |
| T24993 |
47372-47373 |
HYPH |
denotes |
- |
| T24994 |
47373-47374 |
CD |
denotes |
3 |
| T24995 |
47374-47375 |
SYM |
denotes |
′ |
| T25223 |
47377-47389 |
JJ |
denotes |
Histological |
| T25224 |
47390-47398 |
NN |
denotes |
analysis |
| T25225 |
47399-47402 |
CC |
denotes |
and |
| T25226 |
47403-47408 |
NN |
denotes |
TUNEL |
| T25227 |
47409-47414 |
NN |
denotes |
assay |
| T25228 |
47414-47415 |
. |
denotes |
. |
| T25229 |
47415-47596 |
sentence |
denotes |
Dissected testes were fixed in Bouin's fixative or phosphate-buffered formalin overnight at 4 °C, progressively dehydrated in a graded ethanol series, and embedded in paraffin wax. |
| T25230 |
47416-47425 |
VBN |
denotes |
Dissected |
| T25231 |
47426-47432 |
NNS |
denotes |
testes |
| T25233 |
47433-47437 |
VBD |
denotes |
were |
| T25232 |
47438-47443 |
VBN |
denotes |
fixed |
| T25234 |
47444-47446 |
IN |
denotes |
in |
| T25235 |
47447-47452 |
NNP |
denotes |
Bouin |
| T25237 |
47452-47454 |
POS |
denotes |
's |
| T25236 |
47455-47463 |
NN |
denotes |
fixative |
| T25238 |
47464-47466 |
CC |
denotes |
or |
| T25239 |
47467-47476 |
NN |
denotes |
phosphate |
| T25241 |
47476-47477 |
HYPH |
denotes |
- |
| T25240 |
47477-47485 |
VBN |
denotes |
buffered |
| T25242 |
47486-47494 |
NN |
denotes |
formalin |
| T25243 |
47495-47504 |
RB |
denotes |
overnight |
| T25244 |
47505-47507 |
IN |
denotes |
at |
| T25245 |
47508-47509 |
CD |
denotes |
4 |
| T25246 |
47510-47512 |
NN |
denotes |
°C |
| T25247 |
47512-47514 |
, |
denotes |
, |
| T25248 |
47514-47527 |
RB |
denotes |
progressively |
| T25249 |
47528-47538 |
VBN |
denotes |
dehydrated |
| T25250 |
47539-47541 |
IN |
denotes |
in |
| T25251 |
47542-47543 |
DT |
denotes |
a |
| T25253 |
47544-47550 |
VBN |
denotes |
graded |
| T25254 |
47551-47558 |
NN |
denotes |
ethanol |
| T25252 |
47559-47565 |
NN |
denotes |
series |
| T25255 |
47565-47567 |
, |
denotes |
, |
| T25256 |
47567-47570 |
CC |
denotes |
and |
| T25257 |
47571-47579 |
VBN |
denotes |
embedded |
| T25258 |
47580-47582 |
IN |
denotes |
in |
| T25259 |
47583-47591 |
NN |
denotes |
paraffin |
| T25260 |
47592-47595 |
NN |
denotes |
wax |
| T25261 |
47595-47596 |
. |
denotes |
. |
| T25262 |
47596-47685 |
sentence |
denotes |
Sections (6 μm) were deparaffinized, rehydrated, and stained with hematoxylin and eosin. |
| T25263 |
47597-47605 |
NNS |
denotes |
Sections |
| T25265 |
47606-47607 |
-LRB- |
denotes |
( |
| T25267 |
47607-47608 |
CD |
denotes |
6 |
| T25266 |
47609-47611 |
NNS |
denotes |
μm |
| T25268 |
47611-47612 |
-RRB- |
denotes |
) |
| T25269 |
47613-47617 |
VBD |
denotes |
were |
| T25264 |
47618-47632 |
VBN |
denotes |
deparaffinized |
| T25270 |
47632-47634 |
, |
denotes |
, |
| T25271 |
47634-47644 |
VBN |
denotes |
rehydrated |
| T25272 |
47644-47646 |
, |
denotes |
, |
| T25273 |
47646-47649 |
CC |
denotes |
and |
| T25274 |
47650-47657 |
VBN |
denotes |
stained |
| T25275 |
47658-47662 |
IN |
denotes |
with |
| T25276 |
47663-47674 |
NN |
denotes |
hematoxylin |
| T25277 |
47675-47678 |
CC |
denotes |
and |
| T25278 |
47679-47684 |
NN |
denotes |
eosin |
| T25279 |
47684-47685 |
. |
denotes |
. |
| T25280 |
47685-47848 |
sentence |
denotes |
For TUNEL analyses, deparaffinized sections were treated with proteinase K for 15 min and quenched in 3.0% hydrogen peroxide in PBS for 5 min at room temperature. |
| T25281 |
47686-47689 |
IN |
denotes |
For |
| T25283 |
47690-47695 |
NN |
denotes |
TUNEL |
| T25284 |
47696-47704 |
NNS |
denotes |
analyses |
| T25285 |
47704-47706 |
, |
denotes |
, |
| T25286 |
47706-47720 |
VBN |
denotes |
deparaffinized |
| T25287 |
47721-47729 |
NNS |
denotes |
sections |
| T25288 |
47730-47734 |
VBD |
denotes |
were |
| T25282 |
47735-47742 |
VBN |
denotes |
treated |
| T25289 |
47743-47747 |
IN |
denotes |
with |
| T25290 |
47748-47758 |
NN |
denotes |
proteinase |
| T25291 |
47759-47760 |
NN |
denotes |
K |
| T25292 |
47761-47764 |
IN |
denotes |
for |
| T25293 |
47765-47767 |
CD |
denotes |
15 |
| T25294 |
47768-47771 |
NNS |
denotes |
min |
| T25295 |
47772-47775 |
CC |
denotes |
and |
| T25296 |
47776-47784 |
VBN |
denotes |
quenched |
| T25297 |
47785-47787 |
IN |
denotes |
in |
| T25298 |
47788-47791 |
CD |
denotes |
3.0 |
| T25299 |
47791-47792 |
NN |
denotes |
% |
| T25301 |
47793-47801 |
NN |
denotes |
hydrogen |
| T25300 |
47802-47810 |
NN |
denotes |
peroxide |
| T25302 |
47811-47813 |
IN |
denotes |
in |
| T25303 |
47814-47817 |
NN |
denotes |
PBS |
| T25304 |
47818-47821 |
IN |
denotes |
for |
| T25305 |
47822-47823 |
CD |
denotes |
5 |
| T25306 |
47824-47827 |
NNS |
denotes |
min |
| T25307 |
47828-47830 |
IN |
denotes |
at |
| T25308 |
47831-47835 |
NN |
denotes |
room |
| T25309 |
47836-47847 |
NN |
denotes |
temperature |
| T25310 |
47847-47848 |
. |
denotes |
. |
| T25311 |
47848-48011 |
sentence |
denotes |
Subsequently, nuclear staining in apoptotic cells was detected using ApopTag kit (Chemicon, http://www.chemicon.com) according to the manufacturer's instructions. |
| T25312 |
47849-47861 |
RB |
denotes |
Subsequently |
| T25314 |
47861-47863 |
, |
denotes |
, |
| T25315 |
47863-47870 |
JJ |
denotes |
nuclear |
| T25316 |
47871-47879 |
NN |
denotes |
staining |
| T25317 |
47880-47882 |
IN |
denotes |
in |
| T25318 |
47883-47892 |
JJ |
denotes |
apoptotic |
| T25319 |
47893-47898 |
NNS |
denotes |
cells |
| T25320 |
47899-47902 |
VBD |
denotes |
was |
| T25313 |
47903-47911 |
VBN |
denotes |
detected |
| T25321 |
47912-47917 |
VBG |
denotes |
using |
| T25322 |
47918-47925 |
NN |
denotes |
ApopTag |
| T25323 |
47926-47929 |
NN |
denotes |
kit |
| T25324 |
47930-47931 |
-LRB- |
denotes |
( |
| T25325 |
47931-47939 |
NNP |
denotes |
Chemicon |
| T25326 |
47939-47941 |
, |
denotes |
, |
| T25327 |
47941-47964 |
NN |
denotes |
http://www.chemicon.com |
| T25328 |
47964-47965 |
-RRB- |
denotes |
) |
| T25329 |
47966-47975 |
VBG |
denotes |
according |
| T25330 |
47976-47978 |
IN |
denotes |
to |
| T25331 |
47979-47982 |
DT |
denotes |
the |
| T25332 |
47983-47995 |
NN |
denotes |
manufacturer |
| T25334 |
47995-47997 |
POS |
denotes |
's |
| T25333 |
47998-48010 |
NNS |
denotes |
instructions |
| T25335 |
48010-48011 |
. |
denotes |
. |
| T25494 |
48013-48019 |
NN |
denotes |
Tissue |
| T25496 |
48020-48037 |
JJ |
denotes |
immunofluorescent |
| T25495 |
48038-48046 |
NN |
denotes |
staining |
| T25497 |
48046-48047 |
. |
denotes |
. |
| T25498 |
48047-48190 |
sentence |
denotes |
Slides with paraffin sections were washed in PBT (0.1% Tween 20 in PBS) and autoclaved in 10 mM citric acid (pH 6.0) to retrieve antigenicity. |
| T25499 |
48048-48054 |
NNS |
denotes |
Slides |
| T25501 |
48055-48059 |
IN |
denotes |
with |
| T25502 |
48060-48068 |
NN |
denotes |
paraffin |
| T25503 |
48069-48077 |
NNS |
denotes |
sections |
| T25504 |
48078-48082 |
VBD |
denotes |
were |
| T25500 |
48083-48089 |
VBN |
denotes |
washed |
| T25505 |
48090-48092 |
IN |
denotes |
in |
| T25506 |
48093-48096 |
NN |
denotes |
PBT |
| T25507 |
48097-48098 |
-LRB- |
denotes |
( |
| T25509 |
48098-48101 |
CD |
denotes |
0.1 |
| T25510 |
48101-48102 |
NN |
denotes |
% |
| T25508 |
48103-48108 |
NN |
denotes |
Tween |
| T25511 |
48109-48111 |
CD |
denotes |
20 |
| T25512 |
48112-48114 |
IN |
denotes |
in |
| T25513 |
48115-48118 |
NN |
denotes |
PBS |
| T25514 |
48118-48119 |
-RRB- |
denotes |
) |
| T25515 |
48120-48123 |
CC |
denotes |
and |
| T25516 |
48124-48134 |
VBN |
denotes |
autoclaved |
| T25517 |
48135-48137 |
IN |
denotes |
in |
| T25518 |
48138-48140 |
CD |
denotes |
10 |
| T25519 |
48141-48143 |
NN |
denotes |
mM |
| T25521 |
48144-48150 |
JJ |
denotes |
citric |
| T25520 |
48151-48155 |
NN |
denotes |
acid |
| T25522 |
48156-48157 |
-LRB- |
denotes |
( |
| T25523 |
48157-48159 |
NN |
denotes |
pH |
| T25524 |
48160-48163 |
CD |
denotes |
6.0 |
| T25525 |
48163-48164 |
-RRB- |
denotes |
) |
| T25526 |
48165-48167 |
TO |
denotes |
to |
| T25527 |
48168-48176 |
VB |
denotes |
retrieve |
| T25528 |
48177-48189 |
NN |
denotes |
antigenicity |
| T25529 |
48189-48190 |
. |
denotes |
. |
| T25530 |
48190-48410 |
sentence |
denotes |
Slides were blocked in 5% serum (matched to the species of the secondary antibody) in PBS for 1 h at room temperature and incubated with primary antibodies overnight at 4 °C prior to detection with secondary antibodies. |
| T25531 |
48191-48197 |
NNS |
denotes |
Slides |
| T25533 |
48198-48202 |
VBD |
denotes |
were |
| T25532 |
48203-48210 |
VBN |
denotes |
blocked |
| T25534 |
48211-48213 |
IN |
denotes |
in |
| T25535 |
48214-48215 |
CD |
denotes |
5 |
| T25536 |
48215-48216 |
NN |
denotes |
% |
| T25537 |
48217-48222 |
NN |
denotes |
serum |
| T25538 |
48223-48224 |
-LRB- |
denotes |
( |
| T25539 |
48224-48231 |
VBN |
denotes |
matched |
| T25540 |
48232-48234 |
IN |
denotes |
to |
| T25541 |
48235-48238 |
DT |
denotes |
the |
| T25542 |
48239-48246 |
NNS |
denotes |
species |
| T25543 |
48247-48249 |
IN |
denotes |
of |
| T25544 |
48250-48253 |
DT |
denotes |
the |
| T25546 |
48254-48263 |
JJ |
denotes |
secondary |
| T25545 |
48264-48272 |
NN |
denotes |
antibody |
| T25547 |
48272-48273 |
-RRB- |
denotes |
) |
| T25548 |
48274-48276 |
IN |
denotes |
in |
| T25549 |
48277-48280 |
NN |
denotes |
PBS |
| T25550 |
48281-48284 |
IN |
denotes |
for |
| T25551 |
48285-48286 |
CD |
denotes |
1 |
| T25552 |
48287-48288 |
NN |
denotes |
h |
| T25553 |
48289-48291 |
IN |
denotes |
at |
| T25554 |
48292-48296 |
NN |
denotes |
room |
| T25555 |
48297-48308 |
NN |
denotes |
temperature |
| T25556 |
48309-48312 |
CC |
denotes |
and |
| T25557 |
48313-48322 |
VBN |
denotes |
incubated |
| T25558 |
48323-48327 |
IN |
denotes |
with |
| T25559 |
48328-48335 |
JJ |
denotes |
primary |
| T25560 |
48336-48346 |
NNS |
denotes |
antibodies |
| T25561 |
48347-48356 |
RB |
denotes |
overnight |
| T25562 |
48357-48359 |
IN |
denotes |
at |
| T25563 |
48360-48361 |
CD |
denotes |
4 |
| T25564 |
48362-48364 |
NN |
denotes |
°C |
| T25565 |
48365-48370 |
IN |
denotes |
prior |
| T25566 |
48371-48373 |
IN |
denotes |
to |
| T25567 |
48374-48383 |
NN |
denotes |
detection |
| T25568 |
48384-48388 |
IN |
denotes |
with |
| T25569 |
48389-48398 |
JJ |
denotes |
secondary |
| T25570 |
48399-48409 |
NNS |
denotes |
antibodies |
| T25571 |
48409-48410 |
. |
denotes |
. |
| T26486 |
48412-48422 |
NNS |
denotes |
Antibodies |
| T26487 |
48422-48423 |
. |
denotes |
. |
| T26488 |
48423-48600 |
sentence |
denotes |
Rabbit polyclonal antibodies to DMRT7 were raised against a purified fusion protein containing glutathione-S-transferase (GST) fused to the C-terminal 279 amino acids of DMRT7. |
| T26489 |
48424-48430 |
NN |
denotes |
Rabbit |
| T26491 |
48431-48441 |
JJ |
denotes |
polyclonal |
| T26490 |
48442-48452 |
NNS |
denotes |
antibodies |
| T26493 |
48453-48455 |
IN |
denotes |
to |
| T26494 |
48456-48461 |
NN |
denotes |
DMRT7 |
| T26495 |
48462-48466 |
VBD |
denotes |
were |
| T26492 |
48467-48473 |
VBN |
denotes |
raised |
| T26496 |
48474-48481 |
IN |
denotes |
against |
| T26497 |
48482-48483 |
DT |
denotes |
a |
| T26499 |
48484-48492 |
VBN |
denotes |
purified |
| T26500 |
48493-48499 |
NN |
denotes |
fusion |
| T26498 |
48500-48507 |
NN |
denotes |
protein |
| T26501 |
48508-48518 |
VBG |
denotes |
containing |
| T26502 |
48519-48530 |
NN |
denotes |
glutathione |
| T26504 |
48530-48531 |
HYPH |
denotes |
- |
| T26505 |
48531-48532 |
NN |
denotes |
S |
| T26506 |
48532-48533 |
HYPH |
denotes |
- |
| T26503 |
48533-48544 |
NN |
denotes |
transferase |
| T26507 |
48545-48546 |
-LRB- |
denotes |
( |
| T26508 |
48546-48549 |
NN |
denotes |
GST |
| T26509 |
48549-48550 |
-RRB- |
denotes |
) |
| T26510 |
48551-48556 |
VBN |
denotes |
fused |
| T26511 |
48557-48559 |
IN |
denotes |
to |
| T26512 |
48560-48563 |
DT |
denotes |
the |
| T26514 |
48564-48565 |
NN |
denotes |
C |
| T26516 |
48565-48566 |
HYPH |
denotes |
- |
| T26515 |
48566-48574 |
JJ |
denotes |
terminal |
| T26517 |
48575-48578 |
CD |
denotes |
279 |
| T26518 |
48579-48584 |
NN |
denotes |
amino |
| T26513 |
48585-48590 |
NNS |
denotes |
acids |
| T26519 |
48591-48593 |
IN |
denotes |
of |
| T26520 |
48594-48599 |
NN |
denotes |
DMRT7 |
| T26521 |
48599-48600 |
. |
denotes |
. |
| T26522 |
48600-48740 |
sentence |
denotes |
Antibodies to GST were removed by GST-affigel 10 chromatography and the antiserum was then purified by GST-DMRT7-affigel 15 chromatography. |
| T26523 |
48601-48611 |
NNS |
denotes |
Antibodies |
| T26525 |
48612-48614 |
IN |
denotes |
to |
| T26526 |
48615-48618 |
NN |
denotes |
GST |
| T26527 |
48619-48623 |
VBD |
denotes |
were |
| T26524 |
48624-48631 |
VBN |
denotes |
removed |
| T26528 |
48632-48634 |
IN |
denotes |
by |
| T26529 |
48635-48638 |
NN |
denotes |
GST |
| T26531 |
48638-48639 |
HYPH |
denotes |
- |
| T26530 |
48639-48646 |
NN |
denotes |
affigel |
| T26533 |
48647-48649 |
CD |
denotes |
10 |
| T26532 |
48650-48664 |
NN |
denotes |
chromatography |
| T26534 |
48665-48668 |
CC |
denotes |
and |
| T26535 |
48669-48672 |
DT |
denotes |
the |
| T26536 |
48673-48682 |
NN |
denotes |
antiserum |
| T26538 |
48683-48686 |
VBD |
denotes |
was |
| T26539 |
48687-48691 |
RB |
denotes |
then |
| T26537 |
48692-48700 |
VBN |
denotes |
purified |
| T26540 |
48701-48703 |
IN |
denotes |
by |
| T26541 |
48704-48707 |
NN |
denotes |
GST |
| T26543 |
48707-48708 |
HYPH |
denotes |
- |
| T26542 |
48708-48713 |
NN |
denotes |
DMRT7 |
| T26545 |
48713-48714 |
HYPH |
denotes |
- |
| T26544 |
48714-48721 |
NN |
denotes |
affigel |
| T26547 |
48722-48724 |
CD |
denotes |
15 |
| T26546 |
48725-48739 |
NN |
denotes |
chromatography |
| T26548 |
48739-48740 |
. |
denotes |
. |
| T26549 |
48740-48890 |
sentence |
denotes |
DMRT7 antibody was used at 1:200 dilution with a goat anti-rabbit secondary antibody (Molecular Probes, http://www.invitrogen.com) at 1:200 dilution. |
| T26550 |
48741-48746 |
NN |
denotes |
DMRT7 |
| T26551 |
48747-48755 |
NN |
denotes |
antibody |
| T26553 |
48756-48759 |
VBD |
denotes |
was |
| T26552 |
48760-48764 |
VBN |
denotes |
used |
| T26554 |
48765-48767 |
IN |
denotes |
at |
| T26555 |
48768-48769 |
CD |
denotes |
1 |
| T26557 |
48769-48770 |
SYM |
denotes |
: |
| T26558 |
48770-48773 |
CD |
denotes |
200 |
| T26556 |
48774-48782 |
NN |
denotes |
dilution |
| T26559 |
48783-48787 |
IN |
denotes |
with |
| T26560 |
48788-48789 |
DT |
denotes |
a |
| T26562 |
48790-48794 |
NN |
denotes |
goat |
| T26563 |
48795-48806 |
JJ |
denotes |
anti-rabbit |
| T26564 |
48807-48816 |
JJ |
denotes |
secondary |
| T26561 |
48817-48825 |
NN |
denotes |
antibody |
| T26565 |
48826-48827 |
-LRB- |
denotes |
( |
| T26567 |
48827-48836 |
NNP |
denotes |
Molecular |
| T26566 |
48837-48843 |
NNP |
denotes |
Probes |
| T26568 |
48843-48845 |
, |
denotes |
, |
| T26569 |
48845-48870 |
NN |
denotes |
http://www.invitrogen.com |
| T26570 |
48870-48871 |
-RRB- |
denotes |
) |
| T26571 |
48872-48874 |
IN |
denotes |
at |
| T26572 |
48875-48876 |
CD |
denotes |
1 |
| T26574 |
48876-48877 |
SYM |
denotes |
: |
| T26575 |
48877-48880 |
CD |
denotes |
200 |
| T26573 |
48881-48889 |
NN |
denotes |
dilution |
| T26576 |
48889-48890 |
. |
denotes |
. |
| T26577 |
48890-49892 |
sentence |
denotes |
Other primary antibodies used for immunofluorescence were rat anti-GATA1 (1:200, Santa Cruz Biotechnology, http://www.scbt.com, sc-265), goat anti-GATA4 (1:200, Santa Cruz Biotechnology, sc-1237), rat anti-TRA98 (1:200, gift of H. Tanaka and Y. Nishimune), rat anti-BC7 (1:50, gift of H. Tanaka and Y. Nishimune), rat anti-TRA369 (1:200, gift of H. Tanaka and Y. Nishimune), rabbit anti-RAD51 (1:600 Calbiochem, http://www.calbiochem.com, PC130), mouse anti-GMP-1/SUMO-1 (1:200, Zymed, http://invitrogen.com, 33–2400), rabbit anti-phospho-H2AX (Ser139) (1:200, Upstate, http://www.millipore.com, 01–164), mouse anti-phospho-H2AX (1:200, Upstate, 05–636), mouse anti-SYCP3 (1:200, Abcam, http://www.abcam.com, ab12452), rabbit anti-HP1β (1:100, Abcam, ab10478), rabbit anti-H3-2meK9 (1:100, Upstate, 07–441), rabbit anti-H3-3meK9 (1:200, Upstate, 07–442), rabbit anti-AR (N-20) (1:200, Santa Cruz Biotechnology, sc-816), and mouse anti-αSMA clone 1A4 (1:800, Sigma, http://www.sigmaaldrich.com, A2547). |
| T26578 |
48891-48896 |
JJ |
denotes |
Other |
| T26580 |
48897-48904 |
JJ |
denotes |
primary |
| T26579 |
48905-48915 |
NNS |
denotes |
antibodies |
| T26582 |
48916-48920 |
VBN |
denotes |
used |
| T26583 |
48921-48924 |
IN |
denotes |
for |
| T26584 |
48925-48943 |
NN |
denotes |
immunofluorescence |
| T26581 |
48944-48948 |
VBD |
denotes |
were |
| T26585 |
48949-48952 |
NN |
denotes |
rat |
| T26586 |
48953-48963 |
JJ |
denotes |
anti-GATA1 |
| T26587 |
48964-48965 |
-LRB- |
denotes |
( |
| T26589 |
48965-48966 |
CD |
denotes |
1 |
| T26590 |
48966-48967 |
SYM |
denotes |
: |
| T26591 |
48967-48970 |
CD |
denotes |
200 |
| T26592 |
48970-48972 |
, |
denotes |
, |
| T26593 |
48972-48977 |
NNP |
denotes |
Santa |
| T26594 |
48978-48982 |
NNP |
denotes |
Cruz |
| T26595 |
48983-48996 |
NNP |
denotes |
Biotechnology |
| T26596 |
48996-48998 |
, |
denotes |
, |
| T26597 |
48998-49017 |
NN |
denotes |
http://www.scbt.com |
| T26598 |
49017-49019 |
, |
denotes |
, |
| T26599 |
49019-49021 |
NN |
denotes |
sc |
| T26600 |
49021-49022 |
HYPH |
denotes |
- |
| T26588 |
49022-49025 |
NN |
denotes |
265 |
| T26601 |
49025-49026 |
-RRB- |
denotes |
) |
| T26602 |
49026-49028 |
, |
denotes |
, |
| T26603 |
49028-49032 |
NN |
denotes |
goat |
| T26604 |
49033-49043 |
JJ |
denotes |
anti-GATA4 |
| T26605 |
49044-49045 |
-LRB- |
denotes |
( |
| T26607 |
49045-49046 |
CD |
denotes |
1 |
| T26608 |
49046-49047 |
SYM |
denotes |
: |
| T26609 |
49047-49050 |
CD |
denotes |
200 |
| T26610 |
49050-49052 |
, |
denotes |
, |
| T26611 |
49052-49057 |
NNP |
denotes |
Santa |
| T26612 |
49058-49062 |
NNP |
denotes |
Cruz |
| T26613 |
49063-49076 |
NNP |
denotes |
Biotechnology |
| T26614 |
49076-49078 |
, |
denotes |
, |
| T26606 |
49078-49080 |
NN |
denotes |
sc |
| T26615 |
49080-49081 |
HYPH |
denotes |
- |
| T26616 |
49081-49085 |
CD |
denotes |
1237 |
| T26617 |
49085-49086 |
-RRB- |
denotes |
) |
| T26618 |
49086-49088 |
, |
denotes |
, |
| T26619 |
49088-49091 |
NN |
denotes |
rat |
| T26620 |
49092-49102 |
JJ |
denotes |
anti-TRA98 |
| T26621 |
49103-49104 |
-LRB- |
denotes |
( |
| T26623 |
49104-49105 |
CD |
denotes |
1 |
| T26624 |
49105-49106 |
SYM |
denotes |
: |
| T26625 |
49106-49109 |
CD |
denotes |
200 |
| T26626 |
49109-49111 |
, |
denotes |
, |
| T26622 |
49111-49115 |
NN |
denotes |
gift |
| T26627 |
49116-49118 |
IN |
denotes |
of |
| T26628 |
49119-49121 |
NNP |
denotes |
H. |
| T26629 |
49122-49128 |
NNP |
denotes |
Tanaka |
| T26630 |
49129-49132 |
CC |
denotes |
and |
| T26631 |
49133-49135 |
NNP |
denotes |
Y. |
| T26632 |
49136-49145 |
NNP |
denotes |
Nishimune |
| T26633 |
49145-49146 |
-RRB- |
denotes |
) |
| T26634 |
49146-49148 |
, |
denotes |
, |
| T26635 |
49148-49151 |
NN |
denotes |
rat |
| T26636 |
49152-49160 |
JJ |
denotes |
anti-BC7 |
| T26637 |
49161-49162 |
-LRB- |
denotes |
( |
| T26639 |
49162-49163 |
CD |
denotes |
1 |
| T26640 |
49163-49164 |
SYM |
denotes |
: |
| T26641 |
49164-49166 |
CD |
denotes |
50 |
| T26642 |
49166-49168 |
, |
denotes |
, |
| T26638 |
49168-49172 |
NN |
denotes |
gift |
| T26643 |
49173-49175 |
IN |
denotes |
of |
| T26644 |
49176-49178 |
NNP |
denotes |
H. |
| T26645 |
49179-49185 |
NNP |
denotes |
Tanaka |
| T26646 |
49186-49189 |
CC |
denotes |
and |
| T26647 |
49190-49192 |
NNP |
denotes |
Y. |
| T26648 |
49193-49202 |
NNP |
denotes |
Nishimune |
| T26649 |
49202-49203 |
-RRB- |
denotes |
) |
| T26650 |
49203-49205 |
, |
denotes |
, |
| T26651 |
49205-49208 |
NN |
denotes |
rat |
| T26652 |
49209-49220 |
JJ |
denotes |
anti-TRA369 |
| T26653 |
49221-49222 |
-LRB- |
denotes |
( |
| T26655 |
49222-49223 |
CD |
denotes |
1 |
| T26656 |
49223-49224 |
SYM |
denotes |
: |
| T26657 |
49224-49227 |
CD |
denotes |
200 |
| T26658 |
49227-49229 |
, |
denotes |
, |
| T26654 |
49229-49233 |
NN |
denotes |
gift |
| T26659 |
49234-49236 |
IN |
denotes |
of |
| T26660 |
49237-49239 |
NNP |
denotes |
H. |
| T26661 |
49240-49246 |
NNP |
denotes |
Tanaka |
| T26662 |
49247-49250 |
CC |
denotes |
and |
| T26663 |
49251-49253 |
NNP |
denotes |
Y. |
| T26664 |
49254-49263 |
NNP |
denotes |
Nishimune |
| T26665 |
49263-49264 |
-RRB- |
denotes |
) |
| T26666 |
49264-49266 |
, |
denotes |
, |
| T26667 |
49266-49272 |
NN |
denotes |
rabbit |
| T26668 |
49273-49283 |
JJ |
denotes |
anti-RAD51 |
| T26669 |
49284-49285 |
-LRB- |
denotes |
( |
| T26671 |
49285-49286 |
CD |
denotes |
1 |
| T26672 |
49286-49287 |
SYM |
denotes |
: |
| T26673 |
49287-49290 |
CD |
denotes |
600 |
| T26674 |
49291-49301 |
NNP |
denotes |
Calbiochem |
| T26675 |
49301-49303 |
, |
denotes |
, |
| T26676 |
49303-49328 |
NN |
denotes |
http://www.calbiochem.com |
| T26677 |
49328-49330 |
, |
denotes |
, |
| T26670 |
49330-49335 |
NN |
denotes |
PC130 |
| T26678 |
49335-49336 |
-RRB- |
denotes |
) |
| T26679 |
49336-49338 |
, |
denotes |
, |
| T26680 |
49338-49343 |
NN |
denotes |
mouse |
| T26682 |
49344-49352 |
JJ |
denotes |
anti-GMP |
| T26683 |
49352-49353 |
HYPH |
denotes |
- |
| T26684 |
49353-49354 |
CD |
denotes |
1 |
| T26685 |
49354-49355 |
HYPH |
denotes |
/ |
| T26681 |
49355-49359 |
NN |
denotes |
SUMO |
| T26686 |
49359-49360 |
HYPH |
denotes |
- |
| T26687 |
49360-49361 |
CD |
denotes |
1 |
| T26688 |
49362-49363 |
-LRB- |
denotes |
( |
| T26690 |
49363-49364 |
CD |
denotes |
1 |
| T26691 |
49364-49365 |
SYM |
denotes |
: |
| T26692 |
49365-49368 |
CD |
denotes |
200 |
| T26693 |
49368-49370 |
, |
denotes |
, |
| T26694 |
49370-49375 |
NNP |
denotes |
Zymed |
| T26695 |
49375-49377 |
, |
denotes |
, |
| T26696 |
49377-49398 |
NN |
denotes |
http://invitrogen.com |
| T26697 |
49398-49400 |
, |
denotes |
, |
| T26689 |
49400-49402 |
CD |
denotes |
33 |
| T26698 |
49402-49403 |
SYM |
denotes |
– |
| T26699 |
49403-49407 |
CD |
denotes |
2400 |
| T26700 |
49407-49408 |
-RRB- |
denotes |
) |
| T26701 |
49408-49410 |
, |
denotes |
, |
| T26702 |
49410-49416 |
NN |
denotes |
rabbit |
| T26704 |
49417-49429 |
JJ |
denotes |
anti-phospho |
| T26705 |
49429-49430 |
HYPH |
denotes |
- |
| T26703 |
49430-49434 |
NN |
denotes |
H2AX |
| T26706 |
49435-49436 |
-LRB- |
denotes |
( |
| T26707 |
49436-49442 |
NN |
denotes |
Ser139 |
| T26708 |
49442-49443 |
-RRB- |
denotes |
) |
| T26709 |
49444-49445 |
-LRB- |
denotes |
( |
| T26711 |
49445-49446 |
CD |
denotes |
1 |
| T26712 |
49446-49447 |
SYM |
denotes |
: |
| T26713 |
49447-49450 |
CD |
denotes |
200 |
| T26714 |
49450-49452 |
, |
denotes |
, |
| T26715 |
49452-49459 |
NNP |
denotes |
Upstate |
| T26716 |
49459-49461 |
, |
denotes |
, |
| T26717 |
49461-49485 |
NN |
denotes |
http://www.millipore.com |
| T26718 |
49485-49487 |
, |
denotes |
, |
| T26710 |
49487-49489 |
CD |
denotes |
01 |
| T26719 |
49489-49490 |
SYM |
denotes |
– |
| T26720 |
49490-49493 |
CD |
denotes |
164 |
| T26721 |
49493-49494 |
-RRB- |
denotes |
) |
| T26722 |
49494-49496 |
, |
denotes |
, |
| T26723 |
49496-49501 |
NN |
denotes |
mouse |
| T26725 |
49502-49514 |
JJ |
denotes |
anti-phospho |
| T26726 |
49514-49515 |
HYPH |
denotes |
- |
| T26724 |
49515-49519 |
NN |
denotes |
H2AX |
| T26727 |
49520-49521 |
-LRB- |
denotes |
( |
| T26729 |
49521-49522 |
CD |
denotes |
1 |
| T26730 |
49522-49523 |
SYM |
denotes |
: |
| T26731 |
49523-49526 |
CD |
denotes |
200 |
| T26732 |
49526-49528 |
, |
denotes |
, |
| T26733 |
49528-49535 |
NNP |
denotes |
Upstate |
| T26734 |
49535-49537 |
, |
denotes |
, |
| T26728 |
49537-49539 |
CD |
denotes |
05 |
| T26735 |
49539-49540 |
SYM |
denotes |
– |
| T26736 |
49540-49543 |
CD |
denotes |
636 |
| T26737 |
49543-49544 |
-RRB- |
denotes |
) |
| T26738 |
49544-49546 |
, |
denotes |
, |
| T26739 |
49546-49551 |
NN |
denotes |
mouse |
| T26740 |
49552-49562 |
JJ |
denotes |
anti-SYCP3 |
| T26741 |
49563-49564 |
-LRB- |
denotes |
( |
| T26743 |
49564-49565 |
CD |
denotes |
1 |
| T26744 |
49565-49566 |
SYM |
denotes |
: |
| T26745 |
49566-49569 |
CD |
denotes |
200 |
| T26746 |
49569-49571 |
, |
denotes |
, |
| T26747 |
49571-49576 |
NNP |
denotes |
Abcam |
| T26748 |
49576-49578 |
, |
denotes |
, |
| T26749 |
49578-49598 |
NN |
denotes |
http://www.abcam.com |
| T26750 |
49598-49600 |
, |
denotes |
, |
| T26742 |
49600-49607 |
NN |
denotes |
ab12452 |
| T26751 |
49607-49608 |
-RRB- |
denotes |
) |
| T26752 |
49608-49610 |
, |
denotes |
, |
| T26753 |
49610-49616 |
NN |
denotes |
rabbit |
| T26754 |
49617-49626 |
JJ |
denotes |
anti-HP1β |
| T26755 |
49627-49628 |
-LRB- |
denotes |
( |
| T26757 |
49628-49629 |
CD |
denotes |
1 |
| T26758 |
49629-49630 |
SYM |
denotes |
: |
| T26759 |
49630-49633 |
CD |
denotes |
100 |
| T26760 |
49633-49635 |
, |
denotes |
, |
| T26761 |
49635-49640 |
NNP |
denotes |
Abcam |
| T26762 |
49640-49642 |
, |
denotes |
, |
| T26756 |
49642-49649 |
NN |
denotes |
ab10478 |
| T26763 |
49649-49650 |
-RRB- |
denotes |
) |
| T26764 |
49650-49652 |
, |
denotes |
, |
| T26765 |
49652-49658 |
NN |
denotes |
rabbit |
| T26767 |
49659-49666 |
JJ |
denotes |
anti-H3 |
| T26768 |
49666-49667 |
HYPH |
denotes |
- |
| T26766 |
49667-49672 |
NN |
denotes |
2meK9 |
| T26769 |
49673-49674 |
-LRB- |
denotes |
( |
| T26771 |
49674-49675 |
CD |
denotes |
1 |
| T26772 |
49675-49676 |
SYM |
denotes |
: |
| T26773 |
49676-49679 |
CD |
denotes |
100 |
| T26774 |
49679-49681 |
, |
denotes |
, |
| T26775 |
49681-49688 |
NNP |
denotes |
Upstate |
| T26776 |
49688-49690 |
, |
denotes |
, |
| T26770 |
49690-49692 |
CD |
denotes |
07 |
| T26777 |
49692-49693 |
SYM |
denotes |
– |
| T26778 |
49693-49696 |
CD |
denotes |
441 |
| T26779 |
49696-49697 |
-RRB- |
denotes |
) |
| T26780 |
49697-49699 |
, |
denotes |
, |
| T26781 |
49699-49705 |
NN |
denotes |
rabbit |
| T26783 |
49706-49713 |
JJ |
denotes |
anti-H3 |
| T26784 |
49713-49714 |
HYPH |
denotes |
- |
| T26782 |
49714-49719 |
NN |
denotes |
3meK9 |
| T26785 |
49720-49721 |
-LRB- |
denotes |
( |
| T26787 |
49721-49722 |
CD |
denotes |
1 |
| T26788 |
49722-49723 |
SYM |
denotes |
: |
| T26789 |
49723-49726 |
CD |
denotes |
200 |
| T26790 |
49726-49728 |
, |
denotes |
, |
| T26791 |
49728-49735 |
NNP |
denotes |
Upstate |
| T26792 |
49735-49737 |
, |
denotes |
, |
| T26786 |
49737-49739 |
CD |
denotes |
07 |
| T26793 |
49739-49740 |
SYM |
denotes |
– |
| T26794 |
49740-49743 |
CD |
denotes |
442 |
| T26795 |
49743-49744 |
-RRB- |
denotes |
) |
| T26796 |
49744-49746 |
, |
denotes |
, |
| T26797 |
49746-49752 |
NN |
denotes |
rabbit |
| T26798 |
49753-49760 |
JJ |
denotes |
anti-AR |
| T26799 |
49761-49762 |
-LRB- |
denotes |
( |
| T26800 |
49762-49763 |
NN |
denotes |
N |
| T26801 |
49763-49764 |
HYPH |
denotes |
- |
| T26802 |
49764-49766 |
CD |
denotes |
20 |
| T26803 |
49766-49767 |
-RRB- |
denotes |
) |
| T26804 |
49768-49769 |
-LRB- |
denotes |
( |
| T26806 |
49769-49770 |
CD |
denotes |
1 |
| T26807 |
49770-49771 |
SYM |
denotes |
: |
| T26808 |
49771-49774 |
CD |
denotes |
200 |
| T26809 |
49774-49776 |
, |
denotes |
, |
| T26810 |
49776-49781 |
NNP |
denotes |
Santa |
| T26811 |
49782-49786 |
NNP |
denotes |
Cruz |
| T26812 |
49787-49800 |
NNP |
denotes |
Biotechnology |
| T26813 |
49800-49802 |
, |
denotes |
, |
| T26805 |
49802-49804 |
NN |
denotes |
sc |
| T26814 |
49804-49805 |
HYPH |
denotes |
- |
| T26815 |
49805-49808 |
CD |
denotes |
816 |
| T26816 |
49808-49809 |
-RRB- |
denotes |
) |
| T26817 |
49809-49811 |
, |
denotes |
, |
| T26818 |
49811-49814 |
CC |
denotes |
and |
| T26819 |
49815-49820 |
NN |
denotes |
mouse |
| T26821 |
49821-49830 |
JJ |
denotes |
anti-αSMA |
| T26822 |
49831-49836 |
NN |
denotes |
clone |
| T26820 |
49837-49840 |
NN |
denotes |
1A4 |
| T26823 |
49841-49842 |
-LRB- |
denotes |
( |
| T26825 |
49842-49843 |
CD |
denotes |
1 |
| T26826 |
49843-49844 |
SYM |
denotes |
: |
| T26827 |
49844-49847 |
CD |
denotes |
800 |
| T26828 |
49847-49849 |
, |
denotes |
, |
| T26829 |
49849-49854 |
NNP |
denotes |
Sigma |
| T26830 |
49854-49856 |
, |
denotes |
, |
| T26831 |
49856-49883 |
NN |
denotes |
http://www.sigmaaldrich.com |
| T26832 |
49883-49885 |
, |
denotes |
, |
| T26824 |
49885-49890 |
NN |
denotes |
A2547 |
| T26833 |
49890-49891 |
-RRB- |
denotes |
) |
| T26834 |
49891-49892 |
. |
denotes |
. |
| T26835 |
49892-50068 |
sentence |
denotes |
Secondary antibodies used were goat anti-rabbit Alexa 488, goat anti-rabbit Alexa 594, goat anti-rat Alexa 594, and goat anti-mouse Alexa 488 (Molecular Probes) used at 1:250. |
| T26836 |
49893-49902 |
JJ |
denotes |
Secondary |
| T26837 |
49903-49913 |
NNS |
denotes |
antibodies |
| T26839 |
49914-49918 |
VBN |
denotes |
used |
| T26838 |
49919-49923 |
VBD |
denotes |
were |
| T26840 |
49924-49928 |
NN |
denotes |
goat |
| T26842 |
49929-49940 |
JJ |
denotes |
anti-rabbit |
| T26841 |
49941-49946 |
NNP |
denotes |
Alexa |
| T26843 |
49947-49950 |
CD |
denotes |
488 |
| T26844 |
49950-49952 |
, |
denotes |
, |
| T26845 |
49952-49956 |
NN |
denotes |
goat |
| T26847 |
49957-49968 |
JJ |
denotes |
anti-rabbit |
| T26846 |
49969-49974 |
NNP |
denotes |
Alexa |
| T26848 |
49975-49978 |
CD |
denotes |
594 |
| T26849 |
49978-49980 |
, |
denotes |
, |
| T26850 |
49980-49984 |
NN |
denotes |
goat |
| T26852 |
49985-49993 |
JJ |
denotes |
anti-rat |
| T26851 |
49994-49999 |
NNP |
denotes |
Alexa |
| T26853 |
50000-50003 |
CD |
denotes |
594 |
| T26854 |
50003-50005 |
, |
denotes |
, |
| T26855 |
50005-50008 |
CC |
denotes |
and |
| T26856 |
50009-50013 |
NN |
denotes |
goat |
| T26858 |
50014-50024 |
JJ |
denotes |
anti-mouse |
| T26857 |
50025-50030 |
NNP |
denotes |
Alexa |
| T26859 |
50031-50034 |
CD |
denotes |
488 |
| T26860 |
50035-50036 |
-LRB- |
denotes |
( |
| T26862 |
50036-50045 |
NNP |
denotes |
Molecular |
| T26861 |
50046-50052 |
NNP |
denotes |
Probes |
| T26863 |
50052-50053 |
-RRB- |
denotes |
) |
| T26864 |
50054-50058 |
VBN |
denotes |
used |
| T26865 |
50059-50061 |
IN |
denotes |
at |
| T26866 |
50062-50063 |
CD |
denotes |
1 |
| T26867 |
50063-50064 |
SYM |
denotes |
: |
| T26868 |
50064-50067 |
CD |
denotes |
250 |
| T26869 |
50067-50068 |
. |
denotes |
. |
| T26870 |
50068-50265 |
sentence |
denotes |
Donkey anti-goat FITC (Jackson ImmunoResearch Laboratories, http://www.jacksonimmuno.com) and donkey anti-rabbit Texas Red (Jackson) were used at 1:50 according to the manufacturer's instructions. |
| T26871 |
50069-50075 |
NN |
denotes |
Donkey |
| T26873 |
50076-50085 |
JJ |
denotes |
anti-goat |
| T26872 |
50086-50090 |
NN |
denotes |
FITC |
| T26875 |
50091-50092 |
-LRB- |
denotes |
( |
| T26877 |
50092-50099 |
NNP |
denotes |
Jackson |
| T26878 |
50100-50114 |
NNP |
denotes |
ImmunoResearch |
| T26876 |
50115-50127 |
NNP |
denotes |
Laboratories |
| T26879 |
50127-50129 |
, |
denotes |
, |
| T26880 |
50129-50157 |
NN |
denotes |
http://www.jacksonimmuno.com |
| T26881 |
50157-50158 |
-RRB- |
denotes |
) |
| T26882 |
50159-50162 |
CC |
denotes |
and |
| T26883 |
50163-50169 |
NN |
denotes |
donkey |
| T26885 |
50170-50181 |
JJ |
denotes |
anti-rabbit |
| T26886 |
50182-50187 |
NN |
denotes |
Texas |
| T26884 |
50188-50191 |
NN |
denotes |
Red |
| T26887 |
50192-50193 |
-LRB- |
denotes |
( |
| T26888 |
50193-50200 |
NNP |
denotes |
Jackson |
| T26889 |
50200-50201 |
-RRB- |
denotes |
) |
| T26890 |
50202-50206 |
VBD |
denotes |
were |
| T26874 |
50207-50211 |
VBN |
denotes |
used |
| T26891 |
50212-50214 |
IN |
denotes |
at |
| T26892 |
50215-50216 |
CD |
denotes |
1 |
| T26893 |
50216-50217 |
SYM |
denotes |
: |
| T26894 |
50217-50219 |
CD |
denotes |
50 |
| T26895 |
50220-50229 |
VBG |
denotes |
according |
| T26896 |
50230-50232 |
IN |
denotes |
to |
| T26897 |
50233-50236 |
DT |
denotes |
the |
| T26898 |
50237-50249 |
NN |
denotes |
manufacturer |
| T26900 |
50249-50251 |
POS |
denotes |
's |
| T26899 |
50252-50264 |
NNS |
denotes |
instructions |
| T26901 |
50264-50265 |
. |
denotes |
. |
| T27179 |
50267-50274 |
JJ |
denotes |
Meiotic |
| T27180 |
50275-50285 |
NN |
denotes |
chromosome |
| T27182 |
50286-50292 |
NN |
denotes |
spread |
| T27181 |
50293-50305 |
NNS |
denotes |
preparations |
| T27183 |
50306-50309 |
CC |
denotes |
and |
| T27184 |
50310-50314 |
NN |
denotes |
FISH |
| T27185 |
50314-50315 |
. |
denotes |
. |
| T27186 |
50315-50432 |
sentence |
denotes |
Meiotic chromosome spread preparations were made from 3-wk-old mice, prepared as described by Reinholdt et al. [63]. |
| T27187 |
50316-50323 |
JJ |
denotes |
Meiotic |
| T27188 |
50324-50334 |
NN |
denotes |
chromosome |
| T27190 |
50335-50341 |
NN |
denotes |
spread |
| T27189 |
50342-50354 |
NNS |
denotes |
preparations |
| T27192 |
50355-50359 |
VBD |
denotes |
were |
| T27191 |
50360-50364 |
VBN |
denotes |
made |
| T27193 |
50365-50369 |
IN |
denotes |
from |
| T27194 |
50370-50371 |
CD |
denotes |
3 |
| T27196 |
50371-50372 |
HYPH |
denotes |
- |
| T27195 |
50372-50374 |
NN |
denotes |
wk |
| T27198 |
50374-50375 |
HYPH |
denotes |
- |
| T27197 |
50375-50378 |
JJ |
denotes |
old |
| T27199 |
50379-50383 |
NNS |
denotes |
mice |
| T27200 |
50383-50385 |
, |
denotes |
, |
| T27201 |
50385-50393 |
VBN |
denotes |
prepared |
| T27202 |
50394-50396 |
IN |
denotes |
as |
| T27203 |
50397-50406 |
VBN |
denotes |
described |
| T27204 |
50407-50409 |
IN |
denotes |
by |
| T27205 |
50410-50419 |
NNP |
denotes |
Reinholdt |
| T27206 |
50420-50422 |
FW |
denotes |
et |
| T27207 |
50423-50426 |
FW |
denotes |
al. |
| T27208 |
50427-50428 |
-LRB- |
denotes |
[ |
| T27209 |
50428-50430 |
CD |
denotes |
63 |
| T27210 |
50430-50431 |
-RRB- |
denotes |
] |
| T27211 |
50431-50432 |
. |
denotes |
. |
| T27212 |
50432-50532 |
sentence |
denotes |
For analysis of PMSC and Cot-1 RNA FISH, meiotic slides were prepared as previously described [16]. |
| T27213 |
50433-50436 |
IN |
denotes |
For |
| T27215 |
50437-50445 |
NN |
denotes |
analysis |
| T27216 |
50446-50448 |
IN |
denotes |
of |
| T27217 |
50449-50453 |
NN |
denotes |
PMSC |
| T27218 |
50454-50457 |
CC |
denotes |
and |
| T27219 |
50458-50461 |
NN |
denotes |
Cot |
| T27221 |
50461-50462 |
HYPH |
denotes |
- |
| T27222 |
50462-50463 |
CD |
denotes |
1 |
| T27223 |
50464-50467 |
NN |
denotes |
RNA |
| T27220 |
50468-50472 |
NN |
denotes |
FISH |
| T27224 |
50472-50474 |
, |
denotes |
, |
| T27225 |
50474-50481 |
JJ |
denotes |
meiotic |
| T27226 |
50482-50488 |
NNS |
denotes |
slides |
| T27227 |
50489-50493 |
VBD |
denotes |
were |
| T27214 |
50494-50502 |
VBN |
denotes |
prepared |
| T27228 |
50503-50505 |
IN |
denotes |
as |
| T27230 |
50506-50516 |
RB |
denotes |
previously |
| T27229 |
50517-50526 |
VBN |
denotes |
described |
| T27231 |
50527-50528 |
-LRB- |
denotes |
[ |
| T27232 |
50528-50530 |
CD |
denotes |
16 |
| T27233 |
50530-50531 |
-RRB- |
denotes |
] |
| T27234 |
50531-50532 |
. |
denotes |
. |
| T27235 |
50532-50685 |
sentence |
denotes |
Slides containing chromosome spreads or meiotic spermatocytes were subjected to immunofluorescent staining or RNA FISH, as previously described [16,63]. |
| T27236 |
50533-50539 |
NNS |
denotes |
Slides |
| T27238 |
50540-50550 |
VBG |
denotes |
containing |
| T27239 |
50551-50561 |
NN |
denotes |
chromosome |
| T27240 |
50562-50569 |
NNS |
denotes |
spreads |
| T27241 |
50570-50572 |
CC |
denotes |
or |
| T27242 |
50573-50580 |
JJ |
denotes |
meiotic |
| T27243 |
50581-50594 |
NNS |
denotes |
spermatocytes |
| T27244 |
50595-50599 |
VBD |
denotes |
were |
| T27237 |
50600-50609 |
VBN |
denotes |
subjected |
| T27245 |
50610-50612 |
IN |
denotes |
to |
| T27246 |
50613-50630 |
JJ |
denotes |
immunofluorescent |
| T27247 |
50631-50639 |
NN |
denotes |
staining |
| T27248 |
50640-50642 |
CC |
denotes |
or |
| T27249 |
50643-50646 |
NN |
denotes |
RNA |
| T27250 |
50647-50651 |
NN |
denotes |
FISH |
| T27251 |
50651-50653 |
, |
denotes |
, |
| T27252 |
50653-50655 |
IN |
denotes |
as |
| T27254 |
50656-50666 |
RB |
denotes |
previously |
| T27253 |
50667-50676 |
VBN |
denotes |
described |
| T27255 |
50677-50678 |
-LRB- |
denotes |
[ |
| T27257 |
50678-50680 |
CD |
denotes |
16 |
| T27258 |
50680-50681 |
, |
denotes |
, |
| T27256 |
50681-50683 |
CD |
denotes |
63 |
| T27259 |
50683-50684 |
-RRB- |
denotes |
] |
| T27260 |
50684-50685 |
. |
denotes |
. |
| T27261 |
50685-50786 |
sentence |
denotes |
For combined RNA FISH/immunostaining, we carried out RNA FISH first, followed by immunofluorescence. |
| T27262 |
50686-50689 |
IN |
denotes |
For |
| T27264 |
50690-50698 |
VBN |
denotes |
combined |
| T27266 |
50699-50702 |
NN |
denotes |
RNA |
| T27265 |
50703-50707 |
NN |
denotes |
FISH |
| T27267 |
50707-50708 |
HYPH |
denotes |
/ |
| T27268 |
50708-50722 |
NN |
denotes |
immunostaining |
| T27269 |
50722-50724 |
, |
denotes |
, |
| T27270 |
50724-50726 |
PRP |
denotes |
we |
| T27263 |
50727-50734 |
VBD |
denotes |
carried |
| T27271 |
50735-50738 |
RP |
denotes |
out |
| T27272 |
50739-50742 |
NN |
denotes |
RNA |
| T27273 |
50743-50747 |
NN |
denotes |
FISH |
| T27274 |
50748-50753 |
RB |
denotes |
first |
| T27275 |
50753-50755 |
, |
denotes |
, |
| T27276 |
50755-50763 |
VBN |
denotes |
followed |
| T27277 |
50764-50766 |
IN |
denotes |
by |
| T27278 |
50767-50785 |
NN |
denotes |
immunofluorescence |
| T27279 |
50785-50786 |
. |
denotes |
. |
| T27280 |
50786-50870 |
sentence |
denotes |
DNA FISH was performed using chromosome painting (Cambio, http://www.cambio.co.uk). |
| T27281 |
50787-50790 |
NN |
denotes |
DNA |
| T27282 |
50791-50795 |
NN |
denotes |
FISH |
| T27284 |
50796-50799 |
VBD |
denotes |
was |
| T27283 |
50800-50809 |
VBN |
denotes |
performed |
| T27285 |
50810-50815 |
VBG |
denotes |
using |
| T27286 |
50816-50826 |
NN |
denotes |
chromosome |
| T27287 |
50827-50835 |
NN |
denotes |
painting |
| T27288 |
50836-50837 |
-LRB- |
denotes |
( |
| T27289 |
50837-50843 |
NNP |
denotes |
Cambio |
| T27290 |
50843-50845 |
, |
denotes |
, |
| T27291 |
50845-50868 |
NN |
denotes |
http://www.cambio.co.uk |
| T27292 |
50868-50869 |
-RRB- |
denotes |
) |
| T27293 |
50869-50870 |
. |
denotes |
. |
| T27294 |
50870-51022 |
sentence |
denotes |
Z-sections were captured by Zeiss Axioplan microscope (Zeiss, http://www.zeiss.com) and processed by Openlab (Improvision, http://www.improvision.com). |
| T27295 |
50871-50872 |
NN |
denotes |
Z |
| T27297 |
50872-50873 |
HYPH |
denotes |
- |
| T27296 |
50873-50881 |
NNS |
denotes |
sections |
| T27299 |
50882-50886 |
VBD |
denotes |
were |
| T27298 |
50887-50895 |
VBN |
denotes |
captured |
| T27300 |
50896-50898 |
IN |
denotes |
by |
| T27301 |
50899-50904 |
NNP |
denotes |
Zeiss |
| T27303 |
50905-50913 |
NNP |
denotes |
Axioplan |
| T27302 |
50914-50924 |
NN |
denotes |
microscope |
| T27304 |
50925-50926 |
-LRB- |
denotes |
( |
| T27305 |
50926-50931 |
NNP |
denotes |
Zeiss |
| T27306 |
50931-50933 |
, |
denotes |
, |
| T27307 |
50933-50953 |
NN |
denotes |
http://www.zeiss.com |
| T27308 |
50953-50954 |
-RRB- |
denotes |
) |
| T27309 |
50955-50958 |
CC |
denotes |
and |
| T27310 |
50959-50968 |
VBN |
denotes |
processed |
| T27311 |
50969-50971 |
IN |
denotes |
by |
| T27312 |
50972-50979 |
NNP |
denotes |
Openlab |
| T27313 |
50980-50981 |
-LRB- |
denotes |
( |
| T27314 |
50981-50992 |
NNP |
denotes |
Improvision |
| T27315 |
50992-50994 |
, |
denotes |
, |
| T27316 |
50994-51020 |
NN |
denotes |
http://www.improvision.com |
| T27317 |
51020-51021 |
-RRB- |
denotes |
) |
| T27318 |
51021-51022 |
. |
denotes |
. |
| R10 |
T820 |
T815 |
compound |
Doublesex,Homolog |
| R100 |
T980 |
T981 |
advmod |
transcriptionally,silenced |
| R1000 |
T4734 |
T4728 |
prep |
in,regulate |
| R1001 |
T4556 |
T4557 |
det |
the,body |
| R1002 |
T4735 |
T4734 |
pobj |
insects,in |
| R1003 |
T4736 |
T4735 |
punct |
", ",insects |
| R1004 |
T4737 |
T4735 |
conj |
nematodes,insects |
| R1005 |
T4557 |
T4554 |
pobj |
body,In |
| R1006 |
T4738 |
T4737 |
punct |
", ",nematodes |
| R1007 |
T4739 |
T4737 |
cc |
and,nematodes |
| R1008 |
T4740 |
T4737 |
conj |
mammals,nematodes |
| R1009 |
T4558 |
T4557 |
compound |
XY,body |
| R101 |
T981 |
T979 |
amod |
silenced,body |
| R1010 |
T4741 |
T4742 |
punct |
[,20 |
| R1011 |
T4742 |
T4724 |
parataxis |
20,shown |
| R1012 |
T4743 |
T4742 |
punct |
],20 |
| R1013 |
T4559 |
T4555 |
punct |
", ",silenced |
| R1014 |
T4744 |
T4724 |
punct |
.,shown |
| R1015 |
T4560 |
T4561 |
det |
the,chromosomes |
| R1016 |
T4746 |
T4747 |
det |
The,gene |
| R1017 |
T4561 |
T4555 |
nsubjpass |
chromosomes,silenced |
| R1018 |
T4747 |
T4751 |
nsubjpass |
gene,shown |
| R1019 |
T4562 |
T4561 |
compound |
sex,chromosomes |
| R102 |
T982 |
T979 |
compound |
XY,body |
| R1020 |
T4748 |
T4747 |
nmod |
mab,gene |
| R1021 |
T4749 |
T4748 |
punct |
-,mab |
| R1022 |
T4750 |
T4748 |
nummod |
3,mab |
| R1023 |
T4563 |
T4555 |
auxpass |
are,silenced |
| R1024 |
T4752 |
T4747 |
prep |
of,gene |
| R1025 |
T4564 |
T4555 |
advmod |
transcriptionally,silenced |
| R1026 |
T4753 |
T4754 |
compound |
Caenorhabditis,elegans |
| R1027 |
T4754 |
T4752 |
pobj |
elegans,of |
| R1028 |
T4755 |
T4751 |
aux |
has,shown |
| R1029 |
T4777 |
T4751 |
advcl |
suggesting,shown |
| R103 |
T854 |
T852 |
punct |
", ",creates |
| R1030 |
T4756 |
T4751 |
auxpass |
been,shown |
| R1031 |
T4757 |
T4758 |
aux |
to,function |
| R1032 |
T4758 |
T4751 |
xcomp |
function,shown |
| R1033 |
T4759 |
T4758 |
advmod |
analogously,function |
| R1034 |
T4778 |
T4779 |
mark |
that,stem |
| R1035 |
T4760 |
T4759 |
prep |
to,analogously |
| R1036 |
T4761 |
T4760 |
pobj |
DSX,to |
| R1037 |
T4762 |
T4758 |
prep |
in,function |
| R1038 |
T4779 |
T4777 |
ccomp |
stem,suggesting |
| R1039 |
T4763 |
T4764 |
amod |
several,respects |
| R104 |
T983 |
T967 |
conj |
formed,appear |
| R1040 |
T4764 |
T4762 |
pobj |
respects,in |
| R1041 |
T4765 |
T4751 |
cc |
and,shown |
| R1042 |
T4780 |
T4781 |
det |
the,similarity |
| R1043 |
T4766 |
T4767 |
aux |
can,replaced |
| R1044 |
T4767 |
T4751 |
conj |
replaced,shown |
| R1045 |
T4781 |
T4779 |
nsubj |
similarity,stem |
| R1046 |
T4768 |
T4767 |
auxpass |
be,replaced |
| R1047 |
T4769 |
T4767 |
advmod |
functionally,replaced |
| R1048 |
T4770 |
T4767 |
agent |
by,replaced |
| R1049 |
T4771 |
T4772 |
det |
the,isoform |
| R105 |
T984 |
T979 |
prep |
with,body |
| R1050 |
T4772 |
T4770 |
pobj |
isoform,by |
| R1051 |
T4773 |
T4772 |
amod |
male,isoform |
| R1052 |
T4774 |
T4772 |
prep |
of,isoform |
| R1053 |
T4782 |
T4781 |
prep |
in,similarity |
| R1054 |
T4775 |
T4774 |
pobj |
DSX,of |
| R1055 |
T4776 |
T4751 |
punct |
", ",shown |
| R1056 |
T4783 |
T4784 |
det |
the,sequence |
| R1057 |
T4784 |
T4782 |
pobj |
sequence,in |
| R1058 |
T4785 |
T4784 |
prep |
of,sequence |
| R1059 |
T4786 |
T4787 |
det |
these,genes |
| R106 |
T985 |
T986 |
amod |
appropriate,marks |
| R1060 |
T4883 |
T4882 |
punct |
", ",birds |
| R1061 |
T4787 |
T4785 |
pobj |
genes,of |
| R1062 |
T4884 |
T4882 |
conj |
fish,birds |
| R1063 |
T4788 |
T4779 |
aux |
may,stem |
| R1064 |
T4885 |
T4884 |
punct |
", ",fish |
| R1065 |
T4789 |
T4779 |
prep |
from,stem |
| R1066 |
T4886 |
T4884 |
cc |
and,fish |
| R1067 |
T4887 |
T4884 |
conj |
reptiles,fish |
| R1068 |
T4888 |
T4862 |
punct |
", ",expressed |
| R1069 |
T4889 |
T4862 |
cc |
and,expressed |
| R107 |
T986 |
T984 |
pobj |
marks,with |
| R1070 |
T4890 |
T4891 |
det |
a,gene |
| R1071 |
T4790 |
T4789 |
pobj |
conservation,from |
| R1072 |
T4891 |
T4895 |
nsubj |
gene,functions |
| R1073 |
T4892 |
T4893 |
advmod |
recently,duplicated |
| R1074 |
T4893 |
T4891 |
amod |
duplicated,gene |
| R1075 |
T4791 |
T4790 |
prep |
of,conservation |
| R1076 |
T4894 |
T4891 |
compound |
Dmrt1,gene |
| R1077 |
T4895 |
T4862 |
conj |
functions,expressed |
| R1078 |
T4896 |
T4895 |
prep |
as,functions |
| R1079 |
T4792 |
T4793 |
det |
an,regulator |
| R108 |
T855 |
T856 |
det |
the,presence |
| R1080 |
T4897 |
T4898 |
det |
the,gene |
| R1081 |
T4898 |
T4896 |
pobj |
gene,as |
| R1082 |
T4899 |
T4900 |
npadvmod |
Y,linked |
| R1083 |
T4793 |
T4791 |
pobj |
regulator,of |
| R1084 |
T4900 |
T4898 |
amod |
linked,gene |
| R1085 |
T4901 |
T4900 |
punct |
-,linked |
| R1086 |
T4794 |
T4793 |
amod |
ancestral,regulator |
| R1087 |
T4902 |
T4903 |
npadvmod |
testis,determining |
| R1088 |
T4903 |
T4898 |
amod |
determining,gene |
| R1089 |
T4904 |
T4903 |
punct |
-,determining |
| R109 |
T987 |
T986 |
compound |
chromatin,marks |
| R1090 |
T4795 |
T4796 |
nmod |
DM,domain |
| R1091 |
T4905 |
T4895 |
prep |
in,functions |
| R1092 |
T4906 |
T4907 |
det |
the,fish |
| R1093 |
T4907 |
T4905 |
pobj |
fish,in |
| R1094 |
T4796 |
T4793 |
nmod |
domain,regulator |
| R1095 |
T4908 |
T4907 |
compound |
Medaka,fish |
| R1096 |
T4909 |
T4910 |
punct |
[,25 |
| R1097 |
T4910 |
T4895 |
parataxis |
25,functions |
| R1098 |
T4797 |
T4793 |
amod |
sexual,regulator |
| R1099 |
T4911 |
T4912 |
punct |
–,29 |
| R11 |
T822 |
T821 |
prep |
with,Associates |
| R110 |
T988 |
T983 |
auxpass |
is,formed |
| R1100 |
T4912 |
T4910 |
prep |
29,25 |
| R1101 |
T4913 |
T4910 |
punct |
],25 |
| R1102 |
T4914 |
T4895 |
punct |
.,functions |
| R1103 |
T4916 |
T4917 |
amod |
Human,DMRT1 |
| R1104 |
T4798 |
T4799 |
punct |
[,22 |
| R1105 |
T4917 |
T4918 |
nsubj |
DMRT1,maps |
| R1106 |
T4919 |
T4918 |
prep |
to,maps |
| R1107 |
T4920 |
T4921 |
det |
an,locus |
| R1108 |
T4799 |
T4751 |
parataxis |
22,shown |
| R1109 |
T4921 |
T4919 |
pobj |
locus,to |
| R111 |
T989 |
T967 |
punct |
", ",appear |
| R1110 |
T4922 |
T4921 |
amod |
autosomal,locus |
| R1111 |
T4923 |
T4921 |
punct |
", ",locus |
| R1112 |
T4800 |
T4799 |
nummod |
18,22 |
| R1113 |
T4924 |
T4925 |
dep |
which,associated |
| R1114 |
T4925 |
T4921 |
relcl |
associated,locus |
| R1115 |
T4801 |
T4799 |
punct |
",",22 |
| R1116 |
T4926 |
T4925 |
punct |
", ",associated |
| R1117 |
T4927 |
T4928 |
advmod |
when,hemizygous |
| R1118 |
T4928 |
T4925 |
advcl |
hemizygous,associated |
| R1119 |
T4802 |
T4799 |
nummod |
21,22 |
| R112 |
T856 |
T852 |
nsubj |
presence,creates |
| R1120 |
T4929 |
T4925 |
punct |
", ",associated |
| R1121 |
T4930 |
T4925 |
auxpass |
is,associated |
| R1122 |
T4803 |
T4799 |
punct |
",",22 |
| R1123 |
T4931 |
T4925 |
prep |
with,associated |
| R1124 |
T4932 |
T4933 |
amod |
defective,development |
| R1125 |
T4933 |
T4931 |
pobj |
development,with |
| R1126 |
T4934 |
T4933 |
amod |
testicular,development |
| R1127 |
T4804 |
T4799 |
punct |
],22 |
| R1128 |
T4935 |
T4933 |
cc |
and,development |
| R1129 |
T4936 |
T4937 |
amod |
consequent,feminization |
| R113 |
T990 |
T967 |
cc |
but,appear |
| R1130 |
T4805 |
T4751 |
punct |
.,shown |
| R1131 |
T4937 |
T4933 |
conj |
feminization,development |
| R1132 |
T4938 |
T4937 |
compound |
XY,feminization |
| R1133 |
T4939 |
T4940 |
punct |
[,30 |
| R1134 |
T4807 |
T4808 |
nsubj |
Vertebrates,have |
| R1135 |
T4940 |
T4918 |
parataxis |
30,maps |
| R1136 |
T4941 |
T4940 |
punct |
],30 |
| R1137 |
T4942 |
T4918 |
punct |
.,maps |
| R1138 |
T4809 |
T4808 |
advmod |
also,have |
| R1139 |
T4944 |
T4945 |
advmod |
Similarly,have |
| R114 |
T991 |
T992 |
amod |
most,cells |
| R1140 |
T4946 |
T4945 |
punct |
", ",have |
| R1141 |
T4947 |
T4945 |
nsubj |
mice,have |
| R1142 |
T4810 |
T4811 |
compound |
DM,domain |
| R1143 |
T4948 |
T4947 |
amod |
homozygous,mice |
| R1144 |
T4949 |
T4948 |
prep |
for,homozygous |
| R1145 |
T4950 |
T4951 |
det |
a,mutation |
| R1146 |
T4811 |
T4812 |
compound |
domain,genes |
| R1147 |
T4951 |
T4949 |
pobj |
mutation,for |
| R1148 |
T4952 |
T4951 |
amod |
null,mutation |
| R1149 |
T4953 |
T4951 |
prep |
in,mutation |
| R115 |
T857 |
T856 |
prep |
of,presence |
| R1150 |
T4812 |
T4808 |
dobj |
genes,have |
| R1151 |
T4954 |
T4953 |
pobj |
Dmrt1,in |
| R1152 |
T4955 |
T4956 |
amod |
severe,defects |
| R1153 |
T4813 |
T4808 |
punct |
", ",have |
| R1154 |
T4956 |
T4945 |
dobj |
defects,have |
| R1155 |
T4957 |
T4956 |
prep |
in,defects |
| R1156 |
T4958 |
T4959 |
compound |
testis,differentiation |
| R1157 |
T4959 |
T4957 |
pobj |
differentiation,in |
| R1158 |
T4814 |
T4808 |
cc |
and,have |
| R1159 |
T4960 |
T4956 |
acl |
involving,defects |
| R116 |
T992 |
T994 |
nsubj |
cells,undergo |
| R1160 |
T4961 |
T4962 |
preconj |
both,cells |
| R1161 |
T4815 |
T4816 |
nsubj |
analysis,shown |
| R1162 |
T4962 |
T4960 |
dobj |
cells,involving |
| R1163 |
T4963 |
T4962 |
compound |
germ,cells |
| R1164 |
T4964 |
T4962 |
cc |
and,cells |
| R1165 |
T4816 |
T4808 |
conj |
shown,have |
| R1166 |
T4965 |
T4966 |
compound |
Sertoli,cells |
| R1167 |
T4966 |
T4962 |
conj |
cells,cells |
| R1168 |
T4817 |
T4815 |
prep |
to,analysis |
| R1169 |
T4967 |
T4968 |
punct |
[,31 |
| R117 |
T858 |
T859 |
amod |
heteromorphic,chromosomes |
| R1170 |
T4968 |
T4945 |
parataxis |
31,have |
| R1171 |
T4818 |
T4817 |
pobj |
date,to |
| R1172 |
T4969 |
T4968 |
punct |
],31 |
| R1173 |
T4970 |
T4945 |
punct |
.,have |
| R1174 |
T4819 |
T4816 |
punct |
", ",shown |
| R1175 |
T4972 |
T4973 |
amod |
Female,mice |
| R1176 |
T4973 |
T4974 |
nsubj |
mice,have |
| R1177 |
T4820 |
T4821 |
mark |
although,limited |
| R1178 |
T4975 |
T4973 |
relcl |
mutant,mice |
| R1179 |
T4821 |
T4816 |
advcl |
limited,shown |
| R118 |
T859 |
T857 |
pobj |
chromosomes,of |
| R1180 |
T4822 |
T4816 |
punct |
", ",shown |
| R1181 |
T4976 |
T4975 |
prep |
in,mutant |
| R1182 |
T4823 |
T4816 |
aux |
has,shown |
| R1183 |
T4977 |
T4976 |
pobj |
Dmrt4,in |
| R1184 |
T4978 |
T4979 |
amod |
polyovular,follicles |
| R1185 |
T4979 |
T4974 |
dobj |
follicles,have |
| R1186 |
T4824 |
T4825 |
mark |
that,control |
| R1187 |
T4980 |
T4974 |
punct |
", ",have |
| R1188 |
T4981 |
T4974 |
advcl |
indicating,have |
| R1189 |
T4825 |
T4816 |
ccomp |
control,shown |
| R119 |
T993 |
T992 |
compound |
germ,cells |
| R1190 |
T4982 |
T4983 |
mark |
that,plays |
| R1191 |
T4983 |
T4981 |
ccomp |
plays,indicating |
| R1192 |
T4984 |
T4985 |
det |
this,gene |
| R1193 |
T4826 |
T4827 |
det |
these,genes |
| R1194 |
T4985 |
T4983 |
nsubj |
gene,plays |
| R1195 |
T4986 |
T4983 |
advmod |
also,plays |
| R1196 |
T4827 |
T4825 |
nsubj |
genes,control |
| R1197 |
T4987 |
T4988 |
det |
a,role |
| R1198 |
T4988 |
T4983 |
dobj |
role,plays |
| R1199 |
T4828 |
T4825 |
advmod |
also,control |
| R12 |
T914 |
T915 |
advmod |
Here,investigate |
| R120 |
T994 |
T967 |
conj |
undergo,appear |
| R1200 |
T4829 |
T4830 |
amod |
sexual,differentiation |
| R1201 |
T4989 |
T4983 |
prep |
in,plays |
| R1202 |
T4830 |
T4825 |
dobj |
differentiation,control |
| R1203 |
T4990 |
T4991 |
amod |
gonadal,development |
| R1204 |
T4991 |
T4989 |
pobj |
development,in |
| R1205 |
T4831 |
T4816 |
punct |
.,shown |
| R1206 |
T4992 |
T4993 |
punct |
[,32 |
| R1207 |
T4993 |
T4974 |
parataxis |
32,have |
| R1208 |
T4994 |
T4993 |
punct |
],32 |
| R1209 |
T4995 |
T4974 |
punct |
.,have |
| R121 |
T860 |
T859 |
compound |
sex,chromosomes |
| R1210 |
T4997 |
T4998 |
nsubj |
It,appears |
| R1211 |
T4833 |
T4834 |
nsubj |
Mammals,have |
| R1212 |
T4999 |
T4998 |
prep |
from,appears |
| R1213 |
T5000 |
T5001 |
det |
these,studies |
| R1214 |
T5001 |
T4999 |
pobj |
studies,from |
| R1215 |
T4835 |
T4836 |
nummod |
seven,genes |
| R1216 |
T5002 |
T5003 |
mark |
that,is |
| R1217 |
T5003 |
T4998 |
ccomp |
is,appears |
| R1218 |
T5004 |
T5005 |
det |
the,involvement |
| R1219 |
T4836 |
T4834 |
dobj |
genes,have |
| R122 |
T995 |
T994 |
dobj |
apoptosis,undergo |
| R1220 |
T5005 |
T5003 |
nsubj |
involvement,is |
| R1221 |
T5006 |
T5005 |
prep |
of,involvement |
| R1222 |
T5007 |
T5008 |
compound |
DM,domain |
| R1223 |
T4837 |
T4838 |
compound |
DM,domain |
| R1224 |
T5008 |
T5009 |
compound |
domain,genes |
| R1225 |
T5009 |
T5006 |
pobj |
genes,of |
| R1226 |
T5010 |
T5005 |
prep |
in,involvement |
| R1227 |
T4838 |
T4836 |
compound |
domain,genes |
| R1228 |
T5011 |
T5012 |
amod |
sexual,differentiation |
| R1229 |
T5012 |
T5010 |
pobj |
differentiation,in |
| R123 |
T996 |
T994 |
prep |
during,undergo |
| R1230 |
T4839 |
T4840 |
punct |
(,genes |
| R1231 |
T5013 |
T5003 |
acomp |
ancient,is |
| R1232 |
T5014 |
T5013 |
cc |
and,ancient |
| R1233 |
T5015 |
T5013 |
conj |
conserved,ancient |
| R1234 |
T4840 |
T4836 |
parataxis |
genes,genes |
| R1235 |
T5016 |
T4998 |
punct |
.,appears |
| R1236 |
T5018 |
T5019 |
advmod |
However,is |
| R1237 |
T4841 |
T4840 |
compound |
Dmrt,genes |
| R1238 |
T5019 |
T5025 |
ccomp |
is,required |
| R1239 |
T5020 |
T5019 |
punct |
", ",is |
| R124 |
T997 |
T996 |
pobj |
pachynema,during |
| R1240 |
T4842 |
T4840 |
punct |
),genes |
| R1241 |
T5021 |
T5022 |
compound |
vertebrate,function |
| R1242 |
T5022 |
T5019 |
nsubj |
function,is |
| R1243 |
T5023 |
T5022 |
compound |
Dmrt,function |
| R1244 |
T4843 |
T4836 |
punct |
", ",genes |
| R1245 |
T5024 |
T5022 |
compound |
gene,function |
| R1246 |
T5026 |
T5019 |
neg |
not,is |
| R1247 |
T4844 |
T4845 |
dep |
several,exhibit |
| R1248 |
T5027 |
T5019 |
acomp |
limited,is |
| R1249 |
T5028 |
T5027 |
prep |
to,limited |
| R125 |
T861 |
T859 |
prep |
in,chromosomes |
| R1250 |
T4845 |
T4836 |
relcl |
exhibit,genes |
| R1251 |
T5029 |
T5030 |
amod |
sexual,differentiation |
| R1252 |
T5030 |
T5028 |
pobj |
differentiation,to |
| R1253 |
T5031 |
T5025 |
punct |
: ,required |
| R1254 |
T5032 |
T5025 |
nsubjpass |
Dmrt2,required |
| R1255 |
T4846 |
T4844 |
prep |
of,several |
| R1256 |
T5033 |
T5025 |
auxpass |
is,required |
| R1257 |
T5034 |
T5025 |
prep |
in,required |
| R1258 |
T4847 |
T4846 |
pobj |
which,of |
| R1259 |
T5035 |
T5036 |
det |
both,sexes |
| R126 |
T998 |
T994 |
punct |
.,undergo |
| R1260 |
T5036 |
T5034 |
pobj |
sexes,in |
| R1261 |
T5037 |
T5025 |
prep |
for,required |
| R1262 |
T5038 |
T5037 |
pobj |
segmentation,for |
| R1263 |
T5039 |
T5038 |
prep |
in,segmentation |
| R1264 |
T5040 |
T5039 |
pobj |
mice,in |
| R1265 |
T4848 |
T4849 |
advmod |
sexually,dimorphic |
| R1266 |
T5041 |
T5040 |
cc |
and,mice |
| R1267 |
T5042 |
T5040 |
conj |
fish,mice |
| R1268 |
T5043 |
T5044 |
punct |
[,33 |
| R1269 |
T5044 |
T5025 |
parataxis |
33,required |
| R127 |
T1000 |
T1001 |
det |
A,minority |
| R1270 |
T4849 |
T4850 |
amod |
dimorphic,expression |
| R1271 |
T5045 |
T5046 |
punct |
–,35 |
| R1272 |
T4850 |
T4845 |
dobj |
expression,exhibit |
| R1273 |
T5046 |
T5044 |
prep |
35,33 |
| R1274 |
T5047 |
T5044 |
punct |
],33 |
| R1275 |
T4851 |
T4850 |
compound |
mRNA,expression |
| R1276 |
T5048 |
T5025 |
punct |
.,required |
| R1277 |
T5050 |
T5051 |
advmod |
Here,investigated |
| R1278 |
T4852 |
T4853 |
punct |
[,24 |
| R1279 |
T5052 |
T5051 |
punct |
", ",investigated |
| R128 |
T1001 |
T1002 |
nsubj |
minority,progress |
| R1280 |
T5053 |
T5051 |
nsubj |
we,investigated |
| R1281 |
T4853 |
T4834 |
parataxis |
24,have |
| R1282 |
T5054 |
T5051 |
aux |
have,investigated |
| R1283 |
T5055 |
T5056 |
det |
the,expression |
| R1284 |
T5056 |
T5051 |
dobj |
expression,investigated |
| R1285 |
T4854 |
T4853 |
nummod |
23,24 |
| R1286 |
T5057 |
T5056 |
cc |
and,expression |
| R1287 |
T5058 |
T5056 |
conj |
function,expression |
| R1288 |
T4855 |
T4853 |
punct |
",",24 |
| R1289 |
T5059 |
T5056 |
prep |
of,expression |
| R129 |
T862 |
T861 |
pobj |
males,in |
| R1290 |
T5060 |
T5061 |
det |
the,gene |
| R1291 |
T5061 |
T5059 |
pobj |
gene,of |
| R1292 |
T4856 |
T4853 |
punct |
],24 |
| R1293 |
T5062 |
T5061 |
compound |
Dmrt7,gene |
| R1294 |
T5063 |
T5056 |
prep |
in,expression |
| R1295 |
T4857 |
T4834 |
punct |
.,have |
| R1296 |
T5064 |
T5065 |
det |
the,mouse |
| R1297 |
T5065 |
T5063 |
pobj |
mouse,in |
| R1298 |
T5066 |
T5051 |
punct |
.,investigated |
| R1299 |
T4859 |
T4860 |
det |
The,studied |
| R13 |
T823 |
T824 |
amod |
Male,Chromatin |
| R130 |
T1003 |
T1001 |
prep |
of,minority |
| R1300 |
T5068 |
T5069 |
nsubjpass |
Dmrt7,expressed |
| R1301 |
T4860 |
T4862 |
nsubjpass |
studied,expressed |
| R1302 |
T5070 |
T5069 |
auxpass |
is,expressed |
| R1303 |
T5071 |
T5069 |
advmod |
only,expressed |
| R1304 |
T5072 |
T5069 |
prep |
in,expressed |
| R1305 |
T4861 |
T4860 |
advmod |
best,studied |
| R1306 |
T5073 |
T5074 |
det |
the,gonad |
| R1307 |
T5074 |
T5072 |
pobj |
gonad,in |
| R1308 |
T4863 |
T4860 |
prep |
of,studied |
| R1309 |
T5075 |
T5069 |
punct |
", ",expressed |
| R131 |
T1004 |
T1005 |
compound |
mutant,cells |
| R1310 |
T5076 |
T5069 |
cc |
and,expressed |
| R1311 |
T5077 |
T5069 |
punct |
", ",expressed |
| R1312 |
T5078 |
T5079 |
prep |
unlike,appears |
| R1313 |
T4864 |
T4865 |
det |
these,genes |
| R1314 |
T5079 |
T5069 |
conj |
appears,expressed |
| R1315 |
T5080 |
T5081 |
det |
the,genes |
| R1316 |
T5081 |
T5078 |
pobj |
genes,unlike |
| R1317 |
T5082 |
T5081 |
amod |
other,genes |
| R1318 |
T5083 |
T5081 |
compound |
Dmrt,genes |
| R1319 |
T4865 |
T4863 |
pobj |
genes,of |
| R132 |
T863 |
T864 |
amod |
additional,challenges |
| R1320 |
T5084 |
T5079 |
punct |
", ",appears |
| R1321 |
T5085 |
T5086 |
aux |
to,be |
| R1322 |
T5086 |
T5079 |
xcomp |
be,appears |
| R1323 |
T4866 |
T4860 |
punct |
", ",studied |
| R1324 |
T5087 |
T5086 |
acomp |
present,be |
| R1325 |
T5088 |
T5089 |
advmod |
exclusively,in |
| R1326 |
T4867 |
T4860 |
appos |
Dmrt1,studied |
| R1327 |
T5089 |
T5086 |
prep |
in,be |
| R1328 |
T5090 |
T5089 |
pobj |
mammals,in |
| R1329 |
T5091 |
T5089 |
cc |
and,in |
| R133 |
T1005 |
T1003 |
pobj |
cells,of |
| R1330 |
T4868 |
T4862 |
punct |
", ",expressed |
| R1331 |
T5092 |
T5091 |
neg |
not,and |
| R1332 |
T5093 |
T5089 |
conj |
in,in |
| R1333 |
T4869 |
T4862 |
auxpass |
is,expressed |
| R1334 |
T5094 |
T5095 |
amod |
nonmammalian,vertebrates |
| R1335 |
T4870 |
T4862 |
prep |
in,expressed |
| R1336 |
T4871 |
T4872 |
det |
the,ridges |
| R1337 |
T5095 |
T5093 |
pobj |
vertebrates,in |
| R1338 |
T5096 |
T5097 |
punct |
[,36 |
| R1339 |
T4872 |
T4870 |
pobj |
ridges,in |
| R134 |
T1006 |
T1002 |
aux |
can,progress |
| R1340 |
T5097 |
T5079 |
parataxis |
36,appears |
| R1341 |
T5098 |
T5097 |
nummod |
23,36 |
| R1342 |
T5099 |
T5097 |
punct |
",",36 |
| R1343 |
T4873 |
T4872 |
amod |
differentiating,ridges |
| R1344 |
T5100 |
T5097 |
punct |
],36 |
| R1345 |
T5101 |
T5069 |
punct |
.,expressed |
| R1346 |
T4874 |
T4872 |
amod |
male,ridges |
| R1347 |
T5103 |
T5104 |
nsubj |
We,find |
| R1348 |
T4875 |
T4872 |
amod |
genital,ridges |
| R1349 |
T5105 |
T5106 |
mark |
that,expressed |
| R135 |
T1007 |
T1002 |
prep |
to,progress |
| R1350 |
T5106 |
T5104 |
ccomp |
expressed,find |
| R1351 |
T4876 |
T4872 |
cc |
and,ridges |
| R1352 |
T5107 |
T5108 |
compound |
DMRT7,protein |
| R1353 |
T5108 |
T5106 |
nsubjpass |
protein,expressed |
| R1354 |
T5109 |
T5106 |
auxpass |
is,expressed |
| R1355 |
T4877 |
T4878 |
amod |
adult,testis |
| R1356 |
T5110 |
T5106 |
advmod |
only,expressed |
| R1357 |
T5111 |
T5106 |
prep |
in,expressed |
| R1358 |
T5112 |
T5113 |
compound |
germ,cells |
| R1359 |
T4878 |
T4872 |
conj |
testis,ridges |
| R136 |
T864 |
T852 |
dobj |
challenges,creates |
| R1360 |
T5113 |
T5111 |
pobj |
cells,in |
| R1361 |
T5114 |
T5106 |
cc |
and,expressed |
| R1362 |
T5115 |
T5116 |
auxpass |
is,localized |
| R1363 |
T4879 |
T4872 |
prep |
of,ridges |
| R1364 |
T5116 |
T5106 |
conj |
localized,expressed |
| R1365 |
T5117 |
T5116 |
advmod |
selectively,localized |
| R1366 |
T5118 |
T5116 |
prep |
to,localized |
| R1367 |
T5119 |
T5120 |
det |
the,body |
| R1368 |
T5120 |
T5118 |
pobj |
body,to |
| R1369 |
T5121 |
T5120 |
compound |
XY,body |
| R137 |
T1008 |
T1007 |
pobj |
diplonema,to |
| R1370 |
T4880 |
T4879 |
pobj |
mammals,of |
| R1371 |
T5122 |
T5120 |
prep |
of,body |
| R1372 |
T5123 |
T5124 |
amod |
male,cells |
| R1373 |
T5124 |
T5122 |
pobj |
cells,of |
| R1374 |
T4881 |
T4880 |
punct |
", ",mammals |
| R1375 |
T5125 |
T5124 |
compound |
pachytene,cells |
| R1376 |
T5126 |
T5124 |
compound |
germ,cells |
| R1377 |
T4882 |
T4880 |
conj |
birds,mammals |
| R1378 |
T5127 |
T5104 |
punct |
.,find |
| R1379 |
T5129 |
T5130 |
aux |
To,test |
| R138 |
T1009 |
T1002 |
punct |
", ",progress |
| R1380 |
T5201 |
T5196 |
prep |
in,plays |
| R1381 |
T5130 |
T5131 |
advcl |
test,generated |
| R1382 |
T5132 |
T5133 |
poss |
its,function |
| R1383 |
T5133 |
T5130 |
dobj |
function,test |
| R1384 |
T5202 |
T5203 |
det |
a,transition |
| R1385 |
T5203 |
T5201 |
pobj |
transition,in |
| R1386 |
T5134 |
T5131 |
punct |
", ",generated |
| R1387 |
T5135 |
T5131 |
nsubj |
we,generated |
| R1388 |
T5204 |
T5205 |
amod |
male,specific |
| R1389 |
T5136 |
T5137 |
det |
a,mutation |
| R139 |
T1010 |
T1002 |
cc |
but,progress |
| R1390 |
T5137 |
T5131 |
dobj |
mutation,generated |
| R1391 |
T5205 |
T5203 |
amod |
specific,transition |
| R1392 |
T5206 |
T5205 |
punct |
-,specific |
| R1393 |
T5138 |
T5137 |
amod |
conditional,mutation |
| R1394 |
T5139 |
T5137 |
amod |
null,mutation |
| R1395 |
T5207 |
T5203 |
compound |
chromatin,transition |
| R1396 |
T5140 |
T5137 |
prep |
of,mutation |
| R1397 |
T5141 |
T5140 |
pobj |
Dmrt7,of |
| R1398 |
T5208 |
T5203 |
prep |
between,transition |
| R1399 |
T5142 |
T5131 |
prep |
in,generated |
| R14 |
T824 |
T822 |
pobj |
Chromatin,with |
| R140 |
T865 |
T866 |
npadvmod |
sex,specific |
| R1400 |
T5143 |
T5144 |
det |
the,mouse |
| R1401 |
T5144 |
T5142 |
pobj |
mouse,in |
| R1402 |
T5209 |
T5208 |
pobj |
pachynema,between |
| R1403 |
T5145 |
T5131 |
punct |
.,generated |
| R1404 |
T5210 |
T5209 |
cc |
and,pachynema |
| R1405 |
T5147 |
T5148 |
nsubj |
We,find |
| R1406 |
T5211 |
T5209 |
conj |
diplonema,pachynema |
| R1407 |
T5149 |
T5150 |
mark |
that,required |
| R1408 |
T5150 |
T5148 |
ccomp |
required,find |
| R1409 |
T5151 |
T5150 |
nsubjpass |
Dmrt7,required |
| R141 |
T1011 |
T1012 |
nsubj |
many,have |
| R1410 |
T5212 |
T5196 |
prep |
during,plays |
| R1411 |
T5152 |
T5150 |
auxpass |
is,required |
| R1412 |
T5153 |
T5150 |
prep |
in,required |
| R1413 |
T5154 |
T5153 |
pobj |
males,in |
| R1414 |
T5213 |
T5214 |
amod |
meiotic,prophase |
| R1415 |
T5155 |
T5150 |
prep |
for,required |
| R1416 |
T5156 |
T5155 |
pobj |
progression,for |
| R1417 |
T5157 |
T5156 |
prep |
beyond,progression |
| R1418 |
T5214 |
T5212 |
pobj |
prophase,during |
| R1419 |
T5158 |
T5159 |
det |
the,stage |
| R142 |
T1012 |
T1002 |
conj |
have,progress |
| R1420 |
T5159 |
T5157 |
pobj |
stage,beyond |
| R1421 |
T5160 |
T5159 |
compound |
pachytene,stage |
| R1422 |
T5161 |
T5159 |
prep |
of,stage |
| R1423 |
T5162 |
T5163 |
amod |
meiotic,prophase |
| R1424 |
T5163 |
T5161 |
pobj |
prophase,of |
| R1425 |
T5215 |
T5189 |
punct |
.,suggest |
| R1426 |
T5164 |
T5150 |
cc |
but,required |
| R1427 |
T5165 |
T5166 |
auxpass |
is,required |
| R1428 |
T5166 |
T5150 |
conj |
required,required |
| R1429 |
T5167 |
T5166 |
neg |
not,required |
| R143 |
T1013 |
T1011 |
prep |
of,many |
| R1430 |
T5168 |
T5166 |
prep |
in,required |
| R1431 |
T5169 |
T5168 |
pobj |
females,in |
| R1432 |
T5170 |
T5148 |
punct |
.,find |
| R1433 |
T5172 |
T5173 |
prep |
In,observed |
| R1434 |
T5174 |
T5175 |
amod |
rare,cells |
| R1435 |
T5175 |
T5172 |
pobj |
cells,In |
| R1436 |
T5176 |
T5175 |
compound |
mutant,cells |
| R1437 |
T5177 |
T5178 |
dep |
that,survive |
| R1438 |
T5178 |
T5175 |
relcl |
survive,cells |
| R1439 |
T5179 |
T5178 |
prep |
to,survive |
| R144 |
T1014 |
T1015 |
det |
these,cells |
| R1440 |
T5180 |
T5179 |
pobj |
diplonema,to |
| R1441 |
T5181 |
T5173 |
punct |
", ",observed |
| R1442 |
T5182 |
T5173 |
nsubj |
we,observed |
| R1443 |
T5183 |
T5184 |
compound |
sex,chromatin |
| R1444 |
T5184 |
T5185 |
compound |
chromatin,abnormalities |
| R1445 |
T5185 |
T5173 |
dobj |
abnormalities,observed |
| R1446 |
T5186 |
T5173 |
punct |
.,observed |
| R1447 |
T5188 |
T5189 |
prep |
Based,suggest |
| R1448 |
T5190 |
T5188 |
prep |
on,Based |
| R1449 |
T5191 |
T5192 |
det |
these,observations |
| R145 |
T866 |
T864 |
amod |
specific,challenges |
| R1450 |
T5192 |
T5190 |
pobj |
observations,on |
| R1451 |
T5193 |
T5189 |
punct |
", ",suggest |
| R1452 |
T5194 |
T5189 |
nsubj |
we,suggest |
| R1453 |
T5195 |
T5196 |
mark |
that,plays |
| R1454 |
T5196 |
T5189 |
ccomp |
plays,suggest |
| R1455 |
T5197 |
T5196 |
nsubj |
Dmrt7,plays |
| R1456 |
T5198 |
T5199 |
det |
a,role |
| R1457 |
T5199 |
T5196 |
dobj |
role,plays |
| R1458 |
T5200 |
T5199 |
amod |
critical,role |
| R1459 |
T6760 |
T6759 |
prep |
of,Expression |
| R146 |
T1015 |
T1013 |
pobj |
cells,of |
| R1460 |
T6761 |
T6762 |
compound |
DMRT7,Proteins |
| R1461 |
T6762 |
T6760 |
pobj |
Proteins,of |
| R1462 |
T6763 |
T6759 |
prep |
in,Expression |
| R1463 |
T6764 |
T6763 |
pobj |
Testis,in |
| R1464 |
T6766 |
T6767 |
poss |
Our,analysis |
| R1465 |
T6767 |
T6771 |
nsubj |
analysis,suggested |
| R1466 |
T6768 |
T6767 |
amod |
previous,analysis |
| R1467 |
T6769 |
T6770 |
compound |
mRNA,expression |
| R1468 |
T6770 |
T6767 |
compound |
expression,analysis |
| R1469 |
T6772 |
T6773 |
det |
a,function |
| R147 |
T1016 |
T1015 |
amod |
escaping,cells |
| R1470 |
T6773 |
T6771 |
dobj |
function,suggested |
| R1471 |
T6774 |
T6773 |
amod |
possible,function |
| R1472 |
T6775 |
T6773 |
amod |
meiotic,function |
| R1473 |
T6776 |
T6773 |
prep |
for,function |
| R1474 |
T6777 |
T6776 |
pobj |
Dmrt7,for |
| R1475 |
T6778 |
T6771 |
punct |
", ",suggested |
| R1476 |
T6779 |
T6771 |
prep |
based,suggested |
| R1477 |
T6780 |
T6779 |
prep |
on,based |
| R1478 |
T6781 |
T6782 |
det |
the,expression |
| R1479 |
T6782 |
T6780 |
pobj |
expression,on |
| R148 |
T1017 |
T1018 |
amod |
abnormal,chromatin |
| R1480 |
T6783 |
T6782 |
prep |
of,expression |
| R1481 |
T6784 |
T6785 |
compound |
Dmrt7,mRNA |
| R1482 |
T6785 |
T6783 |
pobj |
mRNA,of |
| R1483 |
T6786 |
T6782 |
prep |
in,expression |
| R1484 |
T6787 |
T6788 |
det |
the,gonads |
| R1485 |
T6788 |
T6786 |
pobj |
gonads,in |
| R1486 |
T6789 |
T6788 |
amod |
fetal,gonads |
| R1487 |
T6790 |
T6788 |
prep |
of,gonads |
| R1488 |
T6791 |
T6792 |
det |
the,sexes |
| R1489 |
T6792 |
T6790 |
pobj |
sexes,of |
| R149 |
T867 |
T866 |
punct |
-,specific |
| R1490 |
T6793 |
T6792 |
nummod |
two,sexes |
| R1491 |
T6794 |
T6795 |
punct |
[,23 |
| R1492 |
T6795 |
T6771 |
parataxis |
23,suggested |
| R1493 |
T6796 |
T6795 |
punct |
],23 |
| R1494 |
T6797 |
T6771 |
punct |
.,suggested |
| R1495 |
T6799 |
T6800 |
prep |
In,detected |
| R1496 |
T6801 |
T6802 |
det |
the,ovary |
| R1497 |
T6802 |
T6799 |
pobj |
ovary,In |
| R1498 |
T6803 |
T6802 |
amod |
fetal,ovary |
| R1499 |
T6804 |
T6800 |
punct |
", ",detected |
| R15 |
T916 |
T915 |
punct |
", ",investigate |
| R150 |
T1018 |
T1012 |
dobj |
chromatin,have |
| R1500 |
T6805 |
T6806 |
compound |
Dmrt7,mRNA |
| R1501 |
T6806 |
T6800 |
nsubjpass |
mRNA,detected |
| R1502 |
T6807 |
T6800 |
auxpass |
was,detected |
| R1503 |
T6808 |
T6800 |
advmod |
primarily,detected |
| R1504 |
T6809 |
T6800 |
prep |
from,detected |
| R1505 |
T6810 |
T6809 |
pobj |
E13.5,from |
| R1506 |
T6811 |
T6809 |
prep |
to,from |
| R1507 |
T6812 |
T6811 |
pobj |
E15.5,to |
| R1508 |
T6813 |
T6800 |
punct |
", ",detected |
| R1509 |
T6814 |
T6815 |
det |
the,time |
| R151 |
T868 |
T864 |
punct |
", ",challenges |
| R1510 |
T6815 |
T6800 |
npadvmod |
time,detected |
| R1511 |
T6816 |
T6817 |
prep |
during,progresses |
| R1512 |
T6817 |
T6815 |
relcl |
progresses,time |
| R1513 |
T6818 |
T6816 |
pobj |
which,during |
| R1514 |
T6819 |
T6817 |
nsubj |
meiosis,progresses |
| R1515 |
T6820 |
T6817 |
prep |
from,progresses |
| R1516 |
T6821 |
T6822 |
amod |
pre-meiotic,replication |
| R1517 |
T6822 |
T6820 |
pobj |
replication,from |
| R1518 |
T6823 |
T6820 |
prep |
to,from |
| R1519 |
T6824 |
T6825 |
det |
the,stage |
| R152 |
T869 |
T864 |
prep |
including,challenges |
| R1520 |
T6825 |
T6823 |
pobj |
stage,to |
| R1521 |
T6826 |
T6825 |
compound |
pachytene,stage |
| R1522 |
T6827 |
T6828 |
punct |
[,4 |
| R1523 |
T6828 |
T6800 |
parataxis |
4,detected |
| R1524 |
T6829 |
T6828 |
punct |
],4 |
| R1525 |
T6830 |
T6800 |
punct |
", ",detected |
| R1526 |
T6831 |
T6832 |
mark |
whereas,was |
| R1527 |
T6832 |
T6800 |
advcl |
was,detected |
| R1528 |
T6833 |
T6834 |
compound |
Dmrt7,expression |
| R1529 |
T6834 |
T6832 |
nsubj |
expression,was |
| R153 |
T870 |
T871 |
amod |
incomplete,pairing |
| R1530 |
T6835 |
T6834 |
prep |
in,expression |
| R1531 |
T6836 |
T6837 |
det |
the,testis |
| R1532 |
T6837 |
T6835 |
pobj |
testis,in |
| R1533 |
T6838 |
T6837 |
amod |
non-meiotic,testis |
| R1534 |
T6839 |
T6837 |
amod |
fetal,testis |
| R1535 |
T6840 |
T6841 |
advmod |
very,low |
| R1536 |
T6841 |
T6832 |
acomp |
low,was |
| R1537 |
T6842 |
T6800 |
punct |
.,detected |
| R1538 |
T6844 |
T6845 |
mark |
Because,examine |
| R1539 |
T6845 |
T6851 |
advcl |
examine,performed |
| R154 |
T871 |
T869 |
pobj |
pairing,including |
| R1540 |
T6846 |
T6847 |
det |
this,work |
| R1541 |
T6847 |
T6845 |
nsubj |
work,examine |
| R1542 |
T6848 |
T6847 |
amod |
earlier,work |
| R1543 |
T6849 |
T6845 |
aux |
did,examine |
| R1544 |
T6850 |
T6845 |
neg |
not,examine |
| R1545 |
T6852 |
T6853 |
amod |
adult,expression |
| R1546 |
T6853 |
T6845 |
dobj |
expression,examine |
| R1547 |
T6854 |
T6853 |
compound |
Dmrt7,expression |
| R1548 |
T6855 |
T6851 |
punct |
", ",performed |
| R1549 |
T6856 |
T6851 |
nsubj |
we,performed |
| R155 |
T1019 |
T1018 |
compound |
sex,chromatin |
| R1550 |
T6857 |
T6851 |
advmod |
first,performed |
| R1551 |
T6858 |
T6859 |
amod |
reverse,transcriptase |
| R1552 |
T6859 |
T6860 |
nmod |
transcriptase,PCR |
| R1553 |
T6860 |
T6851 |
dobj |
PCR,performed |
| R1554 |
T6861 |
T6859 |
punct |
(,transcriptase |
| R1555 |
T6862 |
T6859 |
appos |
RT,transcriptase |
| R1556 |
T6863 |
T6860 |
punct |
),PCR |
| R1557 |
T6864 |
T6860 |
punct |
-,PCR |
| R1558 |
T6865 |
T6860 |
prep |
on,PCR |
| R1559 |
T6866 |
T6865 |
pobj |
mRNA,on |
| R156 |
T1020 |
T1018 |
acl |
lacking,chromatin |
| R1560 |
T6867 |
T6866 |
prep |
from,mRNA |
| R1561 |
T6868 |
T6869 |
nummod |
ten,organs |
| R1562 |
T6869 |
T6867 |
pobj |
organs,from |
| R1563 |
T6870 |
T6869 |
amod |
adult,organs |
| R1564 |
T6871 |
T6851 |
cc |
and,performed |
| R1565 |
T6872 |
T6851 |
conj |
detected,performed |
| R1566 |
T6873 |
T6874 |
amod |
strong,expression |
| R1567 |
T6874 |
T6872 |
dobj |
expression,detected |
| R1568 |
T6875 |
T6874 |
compound |
Dmrt7,expression |
| R1569 |
T6876 |
T6874 |
compound |
mRNA,expression |
| R157 |
T1021 |
T1022 |
nmod |
histone,trimethylation |
| R1570 |
T6877 |
T6874 |
prep |
in,expression |
| R1571 |
T6878 |
T6879 |
det |
the,testis |
| R1572 |
T6879 |
T6877 |
pobj |
testis,in |
| R1573 |
T6880 |
T6874 |
cc |
and,expression |
| R1574 |
T6881 |
T6882 |
det |
a,trace |
| R1575 |
T6882 |
T6874 |
conj |
trace,expression |
| R1576 |
T6883 |
T6882 |
prep |
of,trace |
| R1577 |
T6884 |
T6883 |
pobj |
expression,of |
| R1578 |
T6885 |
T6882 |
prep |
in,trace |
| R1579 |
T6886 |
T6885 |
pobj |
heart,in |
| R158 |
T1022 |
T1020 |
dobj |
trimethylation,lacking |
| R1580 |
T6887 |
T6885 |
punct |
", ",in |
| R1581 |
T6888 |
T6885 |
cc |
but,in |
| R1582 |
T6889 |
T6888 |
neg |
not,but |
| R1583 |
T6890 |
T6885 |
conj |
in,in |
| R1584 |
T6891 |
T6892 |
det |
any,tissue |
| R1585 |
T6892 |
T6890 |
pobj |
tissue,in |
| R1586 |
T6893 |
T6892 |
amod |
other,tissue |
| R1587 |
T6894 |
T6892 |
acl |
tested,tissue |
| R1588 |
T6895 |
T6896 |
punct |
(,1A |
| R1589 |
T6896 |
T6872 |
parataxis |
1A,detected |
| R159 |
T1023 |
T1022 |
nmod |
H3K9,trimethylation |
| R1590 |
T6897 |
T6896 |
compound |
Figure,1A |
| R1591 |
T6898 |
T6896 |
punct |
),1A |
| R1592 |
T6899 |
T6851 |
punct |
.,performed |
| R1593 |
T6901 |
T6902 |
nsubj |
We,examined |
| R1594 |
T6903 |
T6904 |
det |
the,timing |
| R1595 |
T6904 |
T6902 |
dobj |
timing,examined |
| R1596 |
T6905 |
T6904 |
prep |
of,timing |
| R1597 |
T6906 |
T6907 |
compound |
Dmrt7,expression |
| R1598 |
T6907 |
T6905 |
pobj |
expression,of |
| R1599 |
T6908 |
T6907 |
compound |
mRNA,expression |
| R16 |
T825 |
T824 |
compound |
Sex,Chromatin |
| R160 |
T1024 |
T1022 |
nmod |
di,trimethylation |
| R1600 |
T6909 |
T6904 |
prep |
during,timing |
| R1601 |
T6910 |
T6911 |
amod |
postnatal,development |
| R1602 |
T6911 |
T6909 |
pobj |
development,during |
| R1603 |
T6912 |
T6911 |
compound |
testis,development |
| R1604 |
T6913 |
T6902 |
cc |
and,examined |
| R1605 |
T6914 |
T6902 |
conj |
detected,examined |
| R1606 |
T6915 |
T6916 |
amod |
strong,expression |
| R1607 |
T6916 |
T6914 |
dobj |
expression,detected |
| R1608 |
T6917 |
T6916 |
acl |
beginning,expression |
| R1609 |
T6918 |
T6917 |
prep |
at,beginning |
| R161 |
T1025 |
T1022 |
punct |
-,trimethylation |
| R1610 |
T6919 |
T6920 |
nummod |
2,wk |
| R1611 |
T6920 |
T6918 |
pobj |
wk,at |
| R1612 |
T6921 |
T6916 |
punct |
", ",expression |
| R1613 |
T6922 |
T6923 |
dep |
which,coincides |
| R1614 |
T6923 |
T6916 |
relcl |
coincides,expression |
| R1615 |
T6924 |
T6923 |
advmod |
roughly,coincides |
| R1616 |
T6925 |
T6923 |
prep |
with,coincides |
| R1617 |
T6926 |
T6927 |
det |
the,onset |
| R1618 |
T6927 |
T6925 |
pobj |
onset,with |
| R1619 |
T6928 |
T6927 |
prep |
of,onset |
| R162 |
T872 |
T871 |
nmod |
X,pairing |
| R1620 |
T6929 |
T6930 |
det |
the,stage |
| R1621 |
T6930 |
T6928 |
pobj |
stage,of |
| R1622 |
T6931 |
T6930 |
compound |
pachytene,stage |
| R1623 |
T6932 |
T6927 |
prep |
during,onset |
| R1624 |
T6933 |
T6934 |
det |
the,wave |
| R1625 |
T6934 |
T6932 |
pobj |
wave,during |
| R1626 |
T6935 |
T6934 |
amod |
first,wave |
| R1627 |
T6936 |
T6934 |
amod |
synchronous,wave |
| R1628 |
T6937 |
T6934 |
prep |
of,wave |
| R1629 |
T6938 |
T6937 |
pobj |
spermatogenesis,of |
| R163 |
T1026 |
T1022 |
cc |
and,trimethylation |
| R1630 |
T6939 |
T6940 |
punct |
(,1B |
| R1631 |
T6940 |
T6923 |
parataxis |
1B,coincides |
| R1632 |
T6941 |
T6940 |
compound |
Figure,1B |
| R1633 |
T6942 |
T6940 |
punct |
),1B |
| R1634 |
T6943 |
T6944 |
punct |
[,37 |
| R1635 |
T6944 |
T6914 |
parataxis |
37,detected |
| R1636 |
T6945 |
T6944 |
punct |
],37 |
| R1637 |
T6946 |
T6902 |
punct |
.,examined |
| R1638 |
T6949 |
T6950 |
aux |
To,investigate |
| R1639 |
T6950 |
T6951 |
advcl |
investigate,generated |
| R164 |
T1027 |
T1022 |
cc |
and,trimethylation |
| R1640 |
T6952 |
T6953 |
compound |
DMRT7,expression |
| R1641 |
T6953 |
T6950 |
dobj |
expression,investigate |
| R1642 |
T6954 |
T6953 |
compound |
protein,expression |
| R1643 |
T6955 |
T6951 |
punct |
", ",generated |
| R1644 |
T6956 |
T6951 |
nsubj |
we,generated |
| R1645 |
T6957 |
T6958 |
det |
an,antibody |
| R1646 |
T6958 |
T6951 |
dobj |
antibody,generated |
| R1647 |
T6959 |
T6958 |
prep |
against,antibody |
| R1648 |
T6960 |
T6961 |
det |
the,portion |
| R1649 |
T6961 |
T6959 |
pobj |
portion,against |
| R165 |
T1028 |
T1029 |
compound |
heterochromatin,accumulation |
| R1650 |
T6962 |
T6963 |
npadvmod |
C,terminal |
| R1651 |
T6963 |
T6961 |
amod |
terminal,portion |
| R1652 |
T6964 |
T6963 |
punct |
-,terminal |
| R1653 |
T6965 |
T6961 |
prep |
of,portion |
| R1654 |
T6966 |
T6967 |
det |
the,protein |
| R1655 |
T6967 |
T6965 |
pobj |
protein,of |
| R1656 |
T6968 |
T6951 |
punct |
.,generated |
| R1657 |
T6970 |
T6971 |
det |
The,antibody |
| R1658 |
T6971 |
T6972 |
nsubjpass |
antibody,raised |
| R1659 |
T6973 |
T6972 |
auxpass |
was,raised |
| R166 |
T873 |
T872 |
cc |
and,X |
| R1660 |
T6974 |
T6972 |
prep |
against,raised |
| R1661 |
T6975 |
T6976 |
det |
a,region |
| R1662 |
T6976 |
T6974 |
pobj |
region,against |
| R1663 |
T6977 |
T6976 |
amod |
unique,region |
| R1664 |
T6978 |
T6976 |
acl |
lacking,region |
| R1665 |
T6979 |
T6980 |
det |
the,domain |
| R1666 |
T6980 |
T6978 |
dobj |
domain,lacking |
| R1667 |
T6981 |
T6980 |
compound |
DM,domain |
| R1668 |
T6982 |
T6972 |
prep |
in,raised |
| R1669 |
T6983 |
T6982 |
pobj |
order,in |
| R167 |
T1029 |
T1022 |
conj |
accumulation,trimethylation |
| R1670 |
T6984 |
T6985 |
aux |
to,avoid |
| R1671 |
T6985 |
T6983 |
acl |
avoid,order |
| R1672 |
T6986 |
T6985 |
dobj |
cross-reaction,avoid |
| R1673 |
T6987 |
T6986 |
prep |
with,cross-reaction |
| R1674 |
T6988 |
T6989 |
amod |
other,proteins |
| R1675 |
T6989 |
T6987 |
pobj |
proteins,with |
| R1676 |
T6990 |
T6991 |
compound |
DM,domain |
| R1677 |
T6991 |
T6989 |
compound |
domain,proteins |
| R1678 |
T6992 |
T6972 |
punct |
.,raised |
| R1679 |
T6994 |
T6995 |
amod |
Immunofluorescent,staining |
| R168 |
T1030 |
T1029 |
compound |
protein,accumulation |
| R1680 |
T6995 |
T6996 |
nsubj |
staining,showed |
| R1681 |
T6997 |
T6995 |
prep |
with,staining |
| R1682 |
T6998 |
T6999 |
amod |
purified,antisera |
| R1683 |
T6999 |
T6997 |
pobj |
antisera,with |
| R1684 |
T7000 |
T6999 |
compound |
DMRT7,antisera |
| R1685 |
T7001 |
T7002 |
mark |
that,expressed |
| R1686 |
T7002 |
T6996 |
ccomp |
expressed,showed |
| R1687 |
T7003 |
T7004 |
compound |
DMRT7,protein |
| R1688 |
T7004 |
T7002 |
nsubjpass |
protein,expressed |
| R1689 |
T7005 |
T7002 |
auxpass |
is,expressed |
| R169 |
T1031 |
T1029 |
compound |
1β,accumulation |
| R1690 |
T7006 |
T7002 |
advmod |
predominantly,expressed |
| R1691 |
T7007 |
T7002 |
prep |
in,expressed |
| R1692 |
T7008 |
T7009 |
amod |
mid,pachytene |
| R1693 |
T7009 |
T7014 |
compound |
pachytene,spermatocytes |
| R1694 |
T7010 |
T7008 |
punct |
-,mid |
| R1695 |
T7011 |
T7008 |
prep |
to,mid |
| R1696 |
T7012 |
T7011 |
amod |
late,to |
| R1697 |
T7013 |
T7009 |
punct |
-,pachytene |
| R1698 |
T7014 |
T7007 |
pobj |
spermatocytes,in |
| R1699 |
T7015 |
T7016 |
punct |
(,1C |
| R17 |
T917 |
T915 |
nsubj |
we,investigate |
| R170 |
T1032 |
T1018 |
punct |
", ",chromatin |
| R1700 |
T7016 |
T7014 |
parataxis |
1C,spermatocytes |
| R1701 |
T7017 |
T7016 |
compound |
Figure,1C |
| R1702 |
T7018 |
T7016 |
punct |
),1C |
| R1703 |
T7019 |
T7007 |
punct |
", ",in |
| R1704 |
T7020 |
T7021 |
advmod |
as,as |
| R1705 |
T7021 |
T7007 |
cc |
as,in |
| R1706 |
T7022 |
T7021 |
advmod |
well,as |
| R1707 |
T7023 |
T7007 |
conj |
in,in |
| R1708 |
T7024 |
T7023 |
pobj |
sperm,in |
| R1709 |
T7025 |
T7002 |
punct |
", ",expressed |
| R171 |
T874 |
T872 |
conj |
Y,X |
| R1710 |
T7026 |
T7002 |
cc |
and,expressed |
| R1711 |
T7027 |
T7002 |
conj |
is,expressed |
| R1712 |
T7028 |
T7027 |
neg |
not,is |
| R1713 |
T7029 |
T7027 |
acomp |
detectable,is |
| R1714 |
T7030 |
T7027 |
prep |
in,is |
| R1715 |
T7031 |
T7032 |
amod |
other,types |
| R1716 |
T7032 |
T7030 |
pobj |
types,in |
| R1717 |
T7033 |
T7034 |
compound |
germ,cell |
| R1718 |
T7034 |
T7032 |
compound |
cell,types |
| R1719 |
T7035 |
T7032 |
prep |
including,types |
| R172 |
T1033 |
T1018 |
appos |
modifications,chromatin |
| R1720 |
T7036 |
T7035 |
pobj |
spermatogonia,including |
| R1721 |
T7037 |
T7036 |
cc |
and,spermatogonia |
| R1722 |
T7038 |
T7039 |
amod |
round,spermatids |
| R1723 |
T7039 |
T7036 |
conj |
spermatids,spermatogonia |
| R1724 |
T7040 |
T6996 |
punct |
.,showed |
| R1725 |
T7042 |
T7043 |
nsubj |
We,detect |
| R1726 |
T7044 |
T7043 |
aux |
did,detect |
| R1727 |
T7045 |
T7043 |
neg |
not,detect |
| R1728 |
T7046 |
T7047 |
compound |
DMRT7,protein |
| R1729 |
T7047 |
T7043 |
dobj |
protein,detect |
| R173 |
T1034 |
T1035 |
dep |
that,occur |
| R1730 |
T7048 |
T7043 |
prep |
in,detect |
| R1731 |
T7049 |
T7050 |
amod |
somatic,cells |
| R1732 |
T7050 |
T7048 |
pobj |
cells,in |
| R1733 |
T7051 |
T7052 |
amod |
such,as |
| R1734 |
T7052 |
T7050 |
prep |
as,cells |
| R1735 |
T7053 |
T7054 |
compound |
Sertoli,cells |
| R1736 |
T7054 |
T7052 |
pobj |
cells,as |
| R1737 |
T7055 |
T7054 |
punct |
", ",cells |
| R1738 |
T7056 |
T7057 |
amod |
peritubular,cells |
| R1739 |
T7057 |
T7054 |
conj |
cells,cells |
| R174 |
T1035 |
T1033 |
relcl |
occur,modifications |
| R1740 |
T7058 |
T7057 |
amod |
myoid,cells |
| R1741 |
T7059 |
T7057 |
punct |
", ",cells |
| R1742 |
T7060 |
T7057 |
cc |
or,cells |
| R1743 |
T7061 |
T7062 |
compound |
Leydig,cells |
| R1744 |
T7062 |
T7057 |
conj |
cells,cells |
| R1745 |
T7063 |
T7043 |
punct |
.,detect |
| R1746 |
T7065 |
T7066 |
aux |
To,determine |
| R1747 |
T7066 |
T7069 |
advcl |
determine,stained |
| R1748 |
T7067 |
T7068 |
advmod |
more,precisely |
| R1749 |
T7068 |
T7066 |
advmod |
precisely,determine |
| R175 |
T875 |
T852 |
prep |
during,creates |
| R1750 |
T7070 |
T7071 |
det |
the,stages |
| R1751 |
T7071 |
T7066 |
dobj |
stages,determine |
| R1752 |
T7072 |
T7071 |
compound |
pachytene,stages |
| R1753 |
T7073 |
T7071 |
prep |
of,stages |
| R1754 |
T7074 |
T7075 |
compound |
DMRT7,expression |
| R1755 |
T7075 |
T7073 |
pobj |
expression,of |
| R1756 |
T7076 |
T7069 |
punct |
", ",stained |
| R1757 |
T7077 |
T7069 |
nsubj |
we,stained |
| R1758 |
T7078 |
T7069 |
advmod |
double,stained |
| R1759 |
T7079 |
T7069 |
punct |
-,stained |
| R176 |
T1036 |
T1035 |
advmod |
normally,occur |
| R1760 |
T7080 |
T7069 |
prep |
with,stained |
| R1761 |
T7081 |
T7082 |
det |
an,antibody |
| R1762 |
T7082 |
T7080 |
pobj |
antibody,with |
| R1763 |
T7083 |
T7082 |
prep |
to,antibody |
| R1764 |
T7084 |
T7083 |
pobj |
GATA1,to |
| R1765 |
T7085 |
T7084 |
punct |
", ",GATA1 |
| R1766 |
T7086 |
T7087 |
dep |
which,expressed |
| R1767 |
T7087 |
T7084 |
relcl |
expressed,GATA1 |
| R1768 |
T7088 |
T7087 |
auxpass |
is,expressed |
| R1769 |
T7089 |
T7087 |
prep |
in,expressed |
| R177 |
T1037 |
T1035 |
prep |
between,occur |
| R1770 |
T7090 |
T7091 |
compound |
Sertoli,cells |
| R1771 |
T7091 |
T7089 |
pobj |
cells,in |
| R1772 |
T7092 |
T7091 |
prep |
from,cells |
| R1773 |
T7093 |
T7094 |
nmod |
stages,VII |
| R1774 |
T7094 |
T7092 |
pobj |
VII,from |
| R1775 |
T7095 |
T7094 |
prep |
to,VII |
| R1776 |
T7096 |
T7095 |
pobj |
IX,to |
| R1777 |
T7097 |
T7098 |
punct |
[,38 |
| R1778 |
T7098 |
T7069 |
parataxis |
38,stained |
| R1779 |
T7099 |
T7098 |
punct |
],38 |
| R178 |
T1038 |
T1037 |
pobj |
pachynema,between |
| R1780 |
T7100 |
T7069 |
punct |
.,stained |
| R1781 |
T7102 |
T7103 |
nsubj |
This,confirmed |
| R1782 |
T7104 |
T7105 |
mark |
that,expressed |
| R1783 |
T7105 |
T7103 |
ccomp |
expressed,confirmed |
| R1784 |
T7106 |
T7105 |
nsubjpass |
DMRT7,expressed |
| R1785 |
T7107 |
T7105 |
auxpass |
is,expressed |
| R1786 |
T7108 |
T7105 |
prep |
in,expressed |
| R1787 |
T7109 |
T7110 |
amod |
mid,pachytene |
| R1788 |
T7110 |
T7115 |
compound |
pachytene,spermatocytes |
| R1789 |
T7111 |
T7109 |
punct |
-,mid |
| R179 |
T876 |
T877 |
amod |
meiotic,prophase |
| R1790 |
T7112 |
T7109 |
prep |
to,mid |
| R1791 |
T7113 |
T7112 |
amod |
late,to |
| R1792 |
T7114 |
T7110 |
punct |
-,pachytene |
| R1793 |
T7115 |
T7108 |
pobj |
spermatocytes,in |
| R1794 |
T7116 |
T7105 |
punct |
", ",expressed |
| R1795 |
T7117 |
T7105 |
advcl |
starting,expressed |
| R1796 |
T7118 |
T7119 |
advmod |
slightly,earlier |
| R1797 |
T7119 |
T7117 |
advmod |
earlier,starting |
| R1798 |
T7120 |
T7119 |
prep |
than,earlier |
| R1799 |
T7121 |
T7120 |
pobj |
stage,than |
| R18 |
T918 |
T919 |
det |
the,function |
| R180 |
T1039 |
T1038 |
cc |
and,pachynema |
| R1800 |
T7122 |
T7121 |
nummod |
VII,stage |
| R1801 |
T7123 |
T7117 |
cc |
and,starting |
| R1802 |
T7124 |
T7117 |
conj |
extending,starting |
| R1803 |
T7125 |
T7124 |
prep |
through,extending |
| R1804 |
T7126 |
T7125 |
pobj |
stage,through |
| R1805 |
T7127 |
T7126 |
nummod |
IX,stage |
| R1806 |
T7128 |
T7129 |
punct |
(,data |
| R1807 |
T7129 |
T7103 |
meta |
data,confirmed |
| R1808 |
T7130 |
T7129 |
amod |
unpublished,data |
| R1809 |
T7131 |
T7129 |
punct |
),data |
| R181 |
T1040 |
T1038 |
conj |
diplonema,pachynema |
| R1810 |
T7132 |
T7103 |
punct |
.,confirmed |
| R1811 |
T7134 |
T7135 |
prep |
Within,concentrated |
| R1812 |
T7136 |
T7137 |
compound |
pachytene,spermatocytes |
| R1813 |
T7137 |
T7134 |
pobj |
spermatocytes,Within |
| R1814 |
T7138 |
T7135 |
punct |
", ",concentrated |
| R1815 |
T7139 |
T7135 |
nsubjpass |
DMRT7,concentrated |
| R1816 |
T7140 |
T7135 |
auxpass |
is,concentrated |
| R1817 |
T7141 |
T7135 |
prep |
in,concentrated |
| R1818 |
T7142 |
T7143 |
det |
the,body |
| R1819 |
T7143 |
T7141 |
pobj |
body,in |
| R182 |
T1041 |
T1012 |
punct |
.,have |
| R1820 |
T7144 |
T7143 |
compound |
XY,body |
| R1821 |
T7145 |
T7143 |
punct |
", ",body |
| R1822 |
T7146 |
T7143 |
cc |
or,body |
| R1823 |
T7147 |
T7148 |
compound |
sex,body |
| R1824 |
T7148 |
T7143 |
conj |
body,body |
| R1825 |
T7149 |
T7143 |
punct |
", ",body |
| R1826 |
T7150 |
T7151 |
det |
a,domain |
| R1827 |
T7151 |
T7143 |
appos |
domain,body |
| R1828 |
T7152 |
T7153 |
advmod |
densely,staining |
| R1829 |
T7153 |
T7151 |
amod |
staining,domain |
| R183 |
T877 |
T875 |
pobj |
prophase,during |
| R1830 |
T7154 |
T7151 |
compound |
chromatin,domain |
| R1831 |
T7155 |
T7156 |
dep |
that,harbors |
| R1832 |
T7156 |
T7151 |
relcl |
harbors,domain |
| R1833 |
T7157 |
T7158 |
det |
the,chromosomes |
| R1834 |
T7158 |
T7156 |
dobj |
chromosomes,harbors |
| R1835 |
T7159 |
T7158 |
compound |
sex,chromosomes |
| R1836 |
T7160 |
T7135 |
punct |
.,concentrated |
| R1837 |
T7162 |
T7163 |
nsubj |
These,undergo |
| R1838 |
T7164 |
T7165 |
amod |
transcriptional,inactivation |
| R1839 |
T7165 |
T7163 |
dobj |
inactivation,undergo |
| R184 |
T1043 |
T1044 |
prep |
Based,conclude |
| R1840 |
T7166 |
T7165 |
cc |
and,inactivation |
| R1841 |
T7167 |
T7165 |
conj |
heterochromatinization,inactivation |
| R1842 |
T7168 |
T7163 |
prep |
as,undergo |
| R1843 |
T7169 |
T7170 |
det |
a,result |
| R1844 |
T7170 |
T7168 |
pobj |
result,as |
| R1845 |
T7171 |
T7170 |
prep |
of,result |
| R1846 |
T7172 |
T7173 |
poss |
their,pairing |
| R1847 |
T7173 |
T7171 |
pobj |
pairing,of |
| R1848 |
T7174 |
T7173 |
amod |
incomplete,pairing |
| R1849 |
T7175 |
T7173 |
prep |
during,pairing |
| R185 |
T878 |
T852 |
punct |
.,creates |
| R1850 |
T7176 |
T7175 |
pobj |
prophase,during |
| R1851 |
T7177 |
T7176 |
prep |
of,prophase |
| R1852 |
T7178 |
T7179 |
amod |
mammalian,meiosis |
| R1853 |
T7179 |
T7177 |
pobj |
meiosis,of |
| R1854 |
T7180 |
T7179 |
amod |
male,meiosis |
| R1855 |
T7181 |
T7182 |
punct |
[,17 |
| R1856 |
T7182 |
T7163 |
parataxis |
17,undergo |
| R1857 |
T7183 |
T7182 |
punct |
],17 |
| R1858 |
T7184 |
T7163 |
punct |
.,undergo |
| R1859 |
T7186 |
T7187 |
aux |
To,verify |
| R186 |
T1045 |
T1043 |
prep |
on,Based |
| R1860 |
T7187 |
T7188 |
advcl |
verify,stained |
| R1861 |
T7189 |
T7190 |
compound |
DMRT7,expression |
| R1862 |
T7190 |
T7187 |
dobj |
expression,verify |
| R1863 |
T7191 |
T7190 |
compound |
protein,expression |
| R1864 |
T7192 |
T7187 |
prep |
in,verify |
| R1865 |
T7193 |
T7194 |
det |
the,body |
| R1866 |
T7194 |
T7192 |
pobj |
body,in |
| R1867 |
T7195 |
T7194 |
compound |
XY,body |
| R1868 |
T7196 |
T7188 |
punct |
", ",stained |
| R1869 |
T7197 |
T7188 |
nsubj |
we,stained |
| R187 |
T1046 |
T1047 |
det |
the,localization |
| R1870 |
T7198 |
T7188 |
advmod |
double,stained |
| R1871 |
T7199 |
T7188 |
punct |
-,stained |
| R1872 |
T7200 |
T7201 |
compound |
mouse,testis |
| R1873 |
T7201 |
T7202 |
compound |
testis,sections |
| R1874 |
T7202 |
T7188 |
dobj |
sections,stained |
| R1875 |
T7203 |
T7188 |
prep |
for,stained |
| R1876 |
T7204 |
T7203 |
pobj |
DMRT7,for |
| R1877 |
T7205 |
T7204 |
cc |
and,DMRT7 |
| R1878 |
T7206 |
T7207 |
amod |
small,modifier |
| R1879 |
T7207 |
T7204 |
conj |
modifier,DMRT7 |
| R188 |
T880 |
T881 |
nsubj |
This,triggers |
| R1880 |
T7208 |
T7209 |
npadvmod |
ubiquitin,related |
| R1881 |
T7209 |
T7207 |
amod |
related,modifier |
| R1882 |
T7210 |
T7209 |
punct |
-,related |
| R1883 |
T7211 |
T7207 |
nummod |
1,modifier |
| R1884 |
T7212 |
T7207 |
punct |
(,modifier |
| R1885 |
T7213 |
T7207 |
appos |
SUMO,modifier |
| R1886 |
T7214 |
T7213 |
punct |
-,SUMO |
| R1887 |
T7215 |
T7213 |
nummod |
1,SUMO |
| R1888 |
T7216 |
T7207 |
punct |
),modifier |
| R1889 |
T7217 |
T7207 |
punct |
", ",modifier |
| R189 |
T1047 |
T1045 |
pobj |
localization,on |
| R1890 |
T7218 |
T7219 |
dep |
which,concentrated |
| R1891 |
T7219 |
T7207 |
relcl |
concentrated,modifier |
| R1892 |
T7220 |
T7219 |
auxpass |
is,concentrated |
| R1893 |
T7221 |
T7219 |
prep |
in,concentrated |
| R1894 |
T7222 |
T7223 |
det |
the,body |
| R1895 |
T7223 |
T7221 |
pobj |
body,in |
| R1896 |
T7224 |
T7223 |
compound |
XY,body |
| R1897 |
T7225 |
T7219 |
prep |
during,concentrated |
| R1898 |
T7226 |
T7225 |
pobj |
pachynema,during |
| R1899 |
T7227 |
T7228 |
punct |
[,40 |
| R19 |
T919 |
T915 |
dobj |
function,investigate |
| R190 |
T882 |
T881 |
dobj |
formation,triggers |
| R1900 |
T7228 |
T7188 |
parataxis |
40,stained |
| R1901 |
T7229 |
T7228 |
nummod |
39,40 |
| R1902 |
T7230 |
T7228 |
punct |
",",40 |
| R1903 |
T7231 |
T7228 |
punct |
],40 |
| R1904 |
T7232 |
T7188 |
punct |
.,stained |
| R1905 |
T7234 |
T7235 |
nsubjpass |
DMRT7,colocalized |
| R1906 |
T7236 |
T7234 |
cc |
and,DMRT7 |
| R1907 |
T7237 |
T7234 |
conj |
SUMO,DMRT7 |
| R1908 |
T7238 |
T7237 |
punct |
-,SUMO |
| R1909 |
T7239 |
T7237 |
nummod |
1,SUMO |
| R191 |
T1048 |
T1047 |
prep |
of,localization |
| R1910 |
T7240 |
T7235 |
auxpass |
were,colocalized |
| R1911 |
T7241 |
T7235 |
punct |
", ",colocalized |
| R1912 |
T7242 |
T7235 |
advcl |
confirming,colocalized |
| R1913 |
T7243 |
T7244 |
mark |
that,localized |
| R1914 |
T7244 |
T7242 |
ccomp |
localized,confirming |
| R1915 |
T7245 |
T7246 |
compound |
DMRT7,protein |
| R1916 |
T7246 |
T7244 |
nsubjpass |
protein,localized |
| R1917 |
T7247 |
T7244 |
auxpass |
is,localized |
| R1918 |
T7248 |
T7244 |
advmod |
preferentially,localized |
| R1919 |
T7249 |
T7244 |
prep |
to,localized |
| R192 |
T1049 |
T1048 |
pobj |
DMRT7,of |
| R1920 |
T7250 |
T7251 |
det |
the,body |
| R1921 |
T7251 |
T7249 |
pobj |
body,to |
| R1922 |
T7252 |
T7251 |
compound |
XY,body |
| R1923 |
T7253 |
T7254 |
punct |
(,1D |
| R1924 |
T7254 |
T7235 |
parataxis |
1D,colocalized |
| R1925 |
T7255 |
T7254 |
compound |
Figure,1D |
| R1926 |
T7256 |
T7254 |
punct |
),1D |
| R1927 |
T7257 |
T7235 |
punct |
.,colocalized |
| R1928 |
T7259 |
T7260 |
nsubj |
We,confirmed |
| R1929 |
T7261 |
T7260 |
advmod |
also,confirmed |
| R193 |
T1050 |
T1047 |
prep |
to,localization |
| R1930 |
T7262 |
T7263 |
compound |
XY,localization |
| R1931 |
T7263 |
T7260 |
dobj |
localization,confirmed |
| R1932 |
T7264 |
T7263 |
compound |
body,localization |
| R1933 |
T7265 |
T7263 |
prep |
of,localization |
| R1934 |
T7266 |
T7265 |
pobj |
DMRT7,of |
| R1935 |
T7267 |
T7260 |
prep |
by,confirmed |
| R1936 |
T7268 |
T7269 |
amod |
double,staining |
| R1937 |
T7269 |
T7267 |
pobj |
staining,by |
| R1938 |
T7270 |
T7269 |
prep |
for,staining |
| R1939 |
T7271 |
T7272 |
amod |
other,markers |
| R194 |
T1051 |
T1052 |
det |
the,body |
| R1940 |
T7272 |
T7270 |
pobj |
markers,for |
| R1941 |
T7273 |
T7272 |
prep |
including,markers |
| R1942 |
T7274 |
T7275 |
compound |
Ub,H2A |
| R1943 |
T7275 |
T7273 |
pobj |
H2A,including |
| R1944 |
T7276 |
T7275 |
punct |
-,H2A |
| R1945 |
T7277 |
T7275 |
cc |
and,H2A |
| R1946 |
T7278 |
T7275 |
conj |
γH2AX,H2A |
| R1947 |
T7279 |
T7280 |
punct |
(,data |
| R1948 |
T7280 |
T7260 |
meta |
data,confirmed |
| R1949 |
T7281 |
T7280 |
amod |
unpublished,data |
| R195 |
T883 |
T882 |
prep |
of,formation |
| R1950 |
T7282 |
T7280 |
punct |
),data |
| R1951 |
T7283 |
T7260 |
punct |
.,confirmed |
| R1952 |
T7285 |
T7286 |
nsubjpass |
DMRT7,localized |
| R1953 |
T7287 |
T7286 |
auxpass |
is,localized |
| R1954 |
T7288 |
T7286 |
neg |
not,localized |
| R1955 |
T7289 |
T7286 |
advmod |
preferentially,localized |
| R1956 |
T7290 |
T7286 |
prep |
to,localized |
| R1957 |
T7291 |
T7292 |
det |
the,body |
| R1958 |
T7292 |
T7290 |
pobj |
body,to |
| R1959 |
T7293 |
T7292 |
compound |
XY,body |
| R196 |
T1052 |
T1050 |
pobj |
body,to |
| R1960 |
T7294 |
T7286 |
prep |
at,localized |
| R1961 |
T7295 |
T7296 |
det |
all,stages |
| R1962 |
T7296 |
T7294 |
pobj |
stages,at |
| R1963 |
T7297 |
T7286 |
cc |
but,localized |
| R1964 |
T7298 |
T7299 |
advmod |
instead,is |
| R1965 |
T7299 |
T7286 |
conj |
is,localized |
| R1966 |
T7300 |
T7299 |
acomp |
dynamic,is |
| R1967 |
T7301 |
T7286 |
punct |
.,localized |
| R1968 |
T7303 |
T7304 |
prep |
Based,appears |
| R1969 |
T7305 |
T7303 |
prep |
on,Based |
| R197 |
T1053 |
T1052 |
compound |
XY,body |
| R1970 |
T7306 |
T7307 |
amod |
epithelial,staging |
| R1971 |
T7307 |
T7305 |
pobj |
staging,on |
| R1972 |
T7308 |
T7304 |
punct |
", ",appears |
| R1973 |
T7309 |
T7304 |
nsubj |
it,appears |
| R1974 |
T7310 |
T7311 |
mark |
that,localizes |
| R1975 |
T7311 |
T7304 |
ccomp |
localizes,appears |
| R1976 |
T7312 |
T7311 |
nsubj |
DMRT7,localizes |
| R1977 |
T7313 |
T7311 |
prep |
to,localizes |
| R1978 |
T7314 |
T7315 |
det |
the,body |
| R1979 |
T7315 |
T7313 |
pobj |
body,to |
| R198 |
T1054 |
T1047 |
cc |
and,localization |
| R1980 |
T7316 |
T7315 |
compound |
XY,body |
| R1981 |
T7317 |
T7311 |
prep |
from,localizes |
| R1982 |
T7318 |
T7319 |
amod |
mid,pachynema |
| R1983 |
T7319 |
T7317 |
pobj |
pachynema,from |
| R1984 |
T7320 |
T7318 |
punct |
-,mid |
| R1985 |
T7321 |
T7318 |
prep |
to,mid |
| R1986 |
T7322 |
T7321 |
amod |
late,to |
| R1987 |
T7323 |
T7319 |
punct |
-,pachynema |
| R1988 |
T7324 |
T7311 |
punct |
", ",localizes |
| R1989 |
T7325 |
T7311 |
conj |
becomes,localizes |
| R199 |
T884 |
T885 |
det |
a,domain |
| R1990 |
T7326 |
T7327 |
advmod |
diffusely,distributed |
| R1991 |
T7327 |
T7325 |
acomp |
distributed,becomes |
| R1992 |
T7328 |
T7325 |
prep |
in,becomes |
| R1993 |
T7329 |
T7330 |
amod |
late,pachynema |
| R1994 |
T7330 |
T7328 |
pobj |
pachynema,in |
| R1995 |
T7331 |
T7330 |
punct |
-,pachynema |
| R1996 |
T7332 |
T7325 |
punct |
", ",becomes |
| R1997 |
T7333 |
T7325 |
cc |
and,becomes |
| R1998 |
T7334 |
T7325 |
conj |
disappears,becomes |
| R1999 |
T7335 |
T7334 |
prep |
in,disappears |
| R20 |
T826 |
T821 |
cc |
and,Associates |
| R200 |
T1055 |
T1056 |
det |
the,defects |
| R2000 |
T7336 |
T7335 |
pobj |
diplonema,in |
| R2001 |
T7337 |
T7338 |
punct |
(,data |
| R2002 |
T7338 |
T7304 |
meta |
data,appears |
| R2003 |
T7339 |
T7338 |
amod |
unpublished,data |
| R2004 |
T7340 |
T7338 |
punct |
),data |
| R2005 |
T7341 |
T7304 |
punct |
.,appears |
| R2006 |
T7343 |
T7344 |
det |
This,localization |
| R2007 |
T7344 |
T7345 |
nsubjpass |
localization,confirmed |
| R2008 |
T7346 |
T7345 |
auxpass |
was,confirmed |
| R2009 |
T7347 |
T7345 |
prep |
by,confirmed |
| R201 |
T1056 |
T1047 |
conj |
defects,localization |
| R2010 |
T7348 |
T7347 |
pobj |
staining,by |
| R2011 |
T7349 |
T7348 |
prep |
of,staining |
| R2012 |
T7350 |
T7351 |
amod |
meiotic,spreads |
| R2013 |
T7351 |
T7349 |
pobj |
spreads,of |
| R2014 |
T7352 |
T7353 |
punct |
(,S1 |
| R2015 |
T7353 |
T7345 |
parataxis |
S1,confirmed |
| R2016 |
T7354 |
T7353 |
compound |
Figure,S1 |
| R2017 |
T7355 |
T7353 |
punct |
),S1 |
| R2018 |
T7356 |
T7345 |
punct |
.,confirmed |
| R2019 |
T7358 |
T7359 |
nsubjpass |
DMRT7,localized |
| R202 |
T1057 |
T1058 |
compound |
sex,chromatin |
| R2020 |
T7360 |
T7359 |
advmod |
also,localized |
| R2021 |
T7361 |
T7359 |
auxpass |
is,localized |
| R2022 |
T7362 |
T7359 |
advmod |
specifically,localized |
| R2023 |
T7363 |
T7359 |
prep |
in,localized |
| R2024 |
T7364 |
T7363 |
pobj |
sperm,in |
| R2025 |
T7365 |
T7359 |
punct |
", ",localized |
| R2026 |
T7366 |
T7359 |
prep |
with,localized |
| R2027 |
T7367 |
T7368 |
compound |
antibody,staining |
| R2028 |
T7368 |
T7366 |
pobj |
staining,with |
| R2029 |
T7369 |
T7370 |
advmod |
mainly,in |
| R203 |
T885 |
T883 |
pobj |
domain,of |
| R2030 |
T7370 |
T7368 |
prep |
in,staining |
| R2031 |
T7371 |
T7372 |
det |
the,ring |
| R2032 |
T7372 |
T7370 |
pobj |
ring,in |
| R2033 |
T7373 |
T7372 |
amod |
perinuclear,ring |
| R2034 |
T7374 |
T7372 |
prep |
of,ring |
| R2035 |
T7375 |
T7376 |
det |
the,manchette |
| R2036 |
T7376 |
T7374 |
pobj |
manchette,of |
| R2037 |
T7377 |
T7378 |
compound |
sperm,head |
| R2038 |
T7378 |
T7376 |
compound |
head,manchette |
| R2039 |
T7379 |
T7359 |
punct |
.,localized |
| R204 |
T1058 |
T1056 |
compound |
chromatin,defects |
| R2040 |
T7381 |
T7382 |
det |
This,staining |
| R2041 |
T7382 |
T7383 |
nsubj |
staining,coincided |
| R2042 |
T7384 |
T7383 |
prep |
with,coincided |
| R2043 |
T7385 |
T7386 |
det |
the,stages |
| R2044 |
T7386 |
T7384 |
pobj |
stages,with |
| R2045 |
T7387 |
T7386 |
amod |
epithelial,stages |
| R2046 |
T7388 |
T7389 |
prep |
in,localizes |
| R2047 |
T7389 |
T7386 |
relcl |
localizes,stages |
| R2048 |
T7390 |
T7388 |
pobj |
which,in |
| R2049 |
T7391 |
T7389 |
nsubj |
DMRT7,localizes |
| R205 |
T1059 |
T1056 |
acl |
observed,defects |
| R2050 |
T7392 |
T7389 |
prep |
to,localizes |
| R2051 |
T7393 |
T7394 |
det |
the,body |
| R2052 |
T7394 |
T7392 |
pobj |
body,to |
| R2053 |
T7395 |
T7394 |
compound |
XY,body |
| R2054 |
T7396 |
T7394 |
prep |
in,body |
| R2055 |
T7397 |
T7396 |
pobj |
spermatocytes,in |
| R2056 |
T7398 |
T7399 |
punct |
(,1C |
| R2057 |
T7399 |
T7383 |
parataxis |
1C,coincided |
| R2058 |
T7400 |
T7399 |
compound |
Figure,1C |
| R2059 |
T7401 |
T7399 |
cc |
and,1C |
| R206 |
T1060 |
T1059 |
prep |
in,observed |
| R2060 |
T7402 |
T7399 |
conj |
1D,1C |
| R2061 |
T7403 |
T7399 |
punct |
),1C |
| R2062 |
T7404 |
T7383 |
punct |
.,coincided |
| R2067 |
T8160 |
T8161 |
amod |
Targeted,Deletion |
| R2068 |
T8162 |
T8161 |
prep |
of,Deletion |
| R2069 |
T8163 |
T8162 |
pobj |
Dmrt7,of |
| R207 |
T886 |
T885 |
compound |
heterochromatin,domain |
| R2070 |
T8165 |
T8166 |
aux |
To,establish |
| R2071 |
T8166 |
T8167 |
advcl |
establish,generated |
| R2072 |
T8168 |
T8169 |
det |
the,requirement |
| R2073 |
T8169 |
T8166 |
dobj |
requirement,establish |
| R2074 |
T8170 |
T8169 |
amod |
functional,requirement |
| R2075 |
T8171 |
T8169 |
prep |
for,requirement |
| R2076 |
T8172 |
T8171 |
pobj |
Dmrt7,for |
| R2077 |
T8173 |
T8167 |
punct |
", ",generated |
| R2078 |
T8174 |
T8167 |
nsubj |
we,generated |
| R2079 |
T8175 |
T8176 |
nmod |
Dmrt7,mice |
| R208 |
T1061 |
T1062 |
compound |
Dmrt7,mutants |
| R2080 |
T8176 |
T8167 |
dobj |
mice,generated |
| R2081 |
T8177 |
T8175 |
punct |
−,Dmrt7 |
| R2082 |
T8178 |
T8175 |
punct |
/,Dmrt7 |
| R2083 |
T8179 |
T8175 |
punct |
−,Dmrt7 |
| R2084 |
T8180 |
T8167 |
prep |
by,generated |
| R2085 |
T8181 |
T8182 |
amod |
targeted,disruption |
| R2086 |
T8182 |
T8180 |
pobj |
disruption,by |
| R2087 |
T8183 |
T8182 |
prep |
in,disruption |
| R2088 |
T8184 |
T8185 |
amod |
embryonic,stem |
| R2089 |
T8185 |
T8186 |
nmod |
stem,cells |
| R209 |
T1062 |
T1060 |
pobj |
mutants,in |
| R2090 |
T8186 |
T8183 |
pobj |
cells,in |
| R2091 |
T8187 |
T8185 |
punct |
(,stem |
| R2092 |
T8188 |
T8185 |
appos |
ES,stem |
| R2093 |
T8189 |
T8186 |
punct |
),cells |
| R2094 |
T8190 |
T8182 |
acl |
using,disruption |
| R2095 |
T8191 |
T8192 |
det |
a,strategy |
| R2096 |
T8192 |
T8190 |
dobj |
strategy,using |
| R2097 |
T8193 |
T8192 |
acl |
diagrammed,strategy |
| R2098 |
T8194 |
T8193 |
prep |
in,diagrammed |
| R2099 |
T8195 |
T8196 |
compound |
Figure,S2A |
| R21 |
T920 |
T919 |
prep |
of,function |
| R210 |
T1063 |
T1044 |
punct |
", ",conclude |
| R2100 |
T8196 |
T8194 |
pobj |
S2A,in |
| R2101 |
T8197 |
T8167 |
punct |
.,generated |
| R2102 |
T8199 |
T8200 |
det |
The,gene |
| R2103 |
T8200 |
T8202 |
nsubj |
gene,has |
| R2104 |
T8201 |
T8200 |
compound |
Dmrt7,gene |
| R2105 |
T8203 |
T8204 |
nummod |
nine,exons |
| R2106 |
T8204 |
T8202 |
dobj |
exons,has |
| R2107 |
T8205 |
T8204 |
prep |
with,exons |
| R2108 |
T8206 |
T8207 |
det |
the,domain |
| R2109 |
T8207 |
T8205 |
pobj |
domain,with |
| R211 |
T887 |
T885 |
punct |
", ",domain |
| R2110 |
T8208 |
T8207 |
compound |
DM,domain |
| R2111 |
T8209 |
T8207 |
acl |
encoded,domain |
| R2112 |
T8210 |
T8209 |
agent |
by,encoded |
| R2113 |
T8211 |
T8212 |
det |
the,exons |
| R2114 |
T8212 |
T8210 |
pobj |
exons,by |
| R2115 |
T8213 |
T8212 |
amod |
second,exons |
| R2116 |
T8214 |
T8213 |
cc |
and,second |
| R2117 |
T8215 |
T8213 |
conj |
third,second |
| R2118 |
T8216 |
T8202 |
punct |
.,has |
| R2119 |
T8218 |
T8219 |
mark |
Because,is |
| R212 |
T1064 |
T1044 |
nsubj |
we,conclude |
| R2120 |
T8219 |
T8223 |
advcl |
is,generated |
| R2121 |
T8220 |
T8221 |
det |
the,domain |
| R2122 |
T8221 |
T8219 |
nsubj |
domain,is |
| R2123 |
T8222 |
T8221 |
compound |
DM,domain |
| R2124 |
T8224 |
T8219 |
acomp |
essential,is |
| R2125 |
T8225 |
T8224 |
prep |
for,essential |
| R2126 |
T8226 |
T8225 |
pobj |
function,for |
| R2127 |
T8227 |
T8226 |
prep |
of,function |
| R2128 |
T8228 |
T8229 |
amod |
other,genes |
| R2129 |
T8229 |
T8227 |
pobj |
genes,of |
| R213 |
T1065 |
T1066 |
mark |
that,plays |
| R2130 |
T8230 |
T8229 |
punct |
", ",genes |
| R2131 |
T8231 |
T8229 |
prep |
including,genes |
| R2132 |
T8232 |
T8231 |
pobj |
mab,including |
| R2133 |
T8233 |
T8232 |
punct |
-,mab |
| R2134 |
T8234 |
T8232 |
nummod |
3,mab |
| R2135 |
T8235 |
T8232 |
punct |
", ",mab |
| R2136 |
T8236 |
T8232 |
conj |
mab,mab |
| R2137 |
T8237 |
T8236 |
punct |
-,mab |
| R2138 |
T8238 |
T8236 |
nummod |
23,mab |
| R2139 |
T8239 |
T8236 |
punct |
", ",mab |
| R214 |
T1066 |
T1044 |
ccomp |
plays,conclude |
| R2140 |
T8240 |
T8236 |
cc |
and,mab |
| R2141 |
T8241 |
T8236 |
conj |
dsx,mab |
| R2142 |
T8242 |
T8243 |
punct |
[,41 |
| R2143 |
T8243 |
T8219 |
parataxis |
41,is |
| R2144 |
T8244 |
T8243 |
nummod |
18,41 |
| R2145 |
T8245 |
T8243 |
punct |
",",41 |
| R2146 |
T8246 |
T8243 |
nummod |
19,41 |
| R2147 |
T8247 |
T8243 |
punct |
",",41 |
| R2148 |
T8248 |
T8243 |
punct |
],41 |
| R2149 |
T8249 |
T8223 |
punct |
", ",generated |
| R215 |
T1067 |
T1066 |
nsubj |
DMRT7,plays |
| R2150 |
T8250 |
T8223 |
nsubj |
we,generated |
| R2151 |
T8251 |
T8252 |
det |
a,allele |
| R2152 |
T8252 |
T8223 |
dobj |
allele,generated |
| R2153 |
T8253 |
T8254 |
advmod |
conditionally,targeted |
| R2154 |
T8254 |
T8252 |
amod |
targeted,allele |
| R2155 |
T8255 |
T8252 |
punct |
“,allele |
| R2156 |
T8256 |
T8252 |
amod |
floxed,allele |
| R2157 |
T8257 |
T8252 |
punct |
”,allele |
| R2158 |
T8258 |
T8259 |
prep |
in,flanked |
| R2159 |
T8259 |
T8252 |
relcl |
flanked,allele |
| R216 |
T888 |
T889 |
det |
the,body |
| R2160 |
T8260 |
T8258 |
pobj |
which,in |
| R2161 |
T8261 |
T8262 |
det |
the,exons |
| R2162 |
T8262 |
T8259 |
nsubjpass |
exons,flanked |
| R2163 |
T8263 |
T8262 |
nmod |
DM,exons |
| R2164 |
T8264 |
T8265 |
npadvmod |
domain,containing |
| R2165 |
T8265 |
T8262 |
amod |
containing,exons |
| R2166 |
T8266 |
T8265 |
punct |
–,containing |
| R2167 |
T8267 |
T8262 |
prep |
of,exons |
| R2168 |
T8268 |
T8267 |
pobj |
Dmrt7,of |
| R2169 |
T8269 |
T8259 |
auxpass |
are,flanked |
| R217 |
T1068 |
T1069 |
det |
a,role |
| R2170 |
T8270 |
T8259 |
prep |
by,flanked |
| R2171 |
T8271 |
T8272 |
compound |
recognition,sites |
| R2172 |
T8272 |
T8270 |
pobj |
sites,by |
| R2173 |
T8273 |
T8259 |
prep |
for,flanked |
| R2174 |
T8274 |
T8275 |
det |
the,recombinase |
| R2175 |
T8275 |
T8273 |
pobj |
recombinase,for |
| R2176 |
T8276 |
T8275 |
compound |
Cre,recombinase |
| R2177 |
T8277 |
T8278 |
punct |
(,sites |
| R2178 |
T8278 |
T8223 |
parataxis |
sites,generated |
| R2179 |
T8279 |
T8278 |
compound |
loxP,sites |
| R218 |
T1069 |
T1066 |
dobj |
role,plays |
| R2180 |
T8280 |
T8278 |
punct |
),sites |
| R2181 |
T8281 |
T8223 |
punct |
.,generated |
| R2182 |
T8283 |
T8284 |
det |
The,vector |
| R2183 |
T8284 |
T8286 |
nsubj |
vector,contained |
| R2184 |
T8285 |
T8284 |
compound |
targeting,vector |
| R2185 |
T8287 |
T8286 |
advmod |
also,contained |
| R2186 |
T8288 |
T8289 |
det |
a,cassette |
| R2187 |
T8289 |
T8286 |
dobj |
cassette,contained |
| R2188 |
T8290 |
T8289 |
compound |
neomycin,cassette |
| R2189 |
T8291 |
T8289 |
compound |
resistance,cassette |
| R219 |
T1070 |
T1066 |
prep |
in,plays |
| R2190 |
T8292 |
T8293 |
punct |
(,neo |
| R2191 |
T8293 |
T8289 |
parataxis |
neo,cassette |
| R2192 |
T8294 |
T8293 |
punct |
),neo |
| R2193 |
T8295 |
T8289 |
acl |
flanked,cassette |
| R2194 |
T8296 |
T8295 |
prep |
by,flanked |
| R2195 |
T8297 |
T8298 |
compound |
Flpe,sites |
| R2196 |
T8298 |
T8296 |
pobj |
sites,by |
| R2197 |
T8299 |
T8298 |
compound |
recognition,sites |
| R2198 |
T8300 |
T8286 |
punct |
.,contained |
| R2199 |
T8302 |
T8303 |
det |
The,removal |
| R22 |
T921 |
T920 |
pobj |
DMRT7,of |
| R220 |
T1071 |
T1072 |
det |
the,transformation |
| R2200 |
T8303 |
T8304 |
nsubj |
removal,eliminates |
| R2201 |
T8305 |
T8303 |
prep |
of,removal |
| R2202 |
T8306 |
T8307 |
det |
these,sequences |
| R2203 |
T8307 |
T8305 |
pobj |
sequences,of |
| R2204 |
T8308 |
T8303 |
prep |
by,removal |
| R2205 |
T8309 |
T8310 |
npadvmod |
Cre,mediated |
| R2206 |
T8310 |
T8312 |
amod |
mediated,recombination |
| R2207 |
T8311 |
T8310 |
punct |
-,mediated |
| R2208 |
T8312 |
T8308 |
pobj |
recombination,by |
| R2209 |
T8313 |
T8314 |
det |
the,domain |
| R221 |
T1072 |
T1070 |
pobj |
transformation,in |
| R2210 |
T8314 |
T8304 |
dobj |
domain,eliminates |
| R2211 |
T8315 |
T8314 |
compound |
DM,domain |
| R2212 |
T8316 |
T8314 |
cc |
and,domain |
| R2213 |
T8317 |
T8318 |
det |
the,site |
| R2214 |
T8318 |
T8314 |
conj |
site,domain |
| R2215 |
T8319 |
T8318 |
amod |
translational,site |
| R2216 |
T8320 |
T8318 |
compound |
start,site |
| R2217 |
T8321 |
T8304 |
punct |
", ",eliminates |
| R2218 |
T8322 |
T8323 |
advmod |
thus,generating |
| R2219 |
T8323 |
T8304 |
advcl |
generating,eliminates |
| R222 |
T889 |
T885 |
appos |
body,domain |
| R2220 |
T8324 |
T8325 |
det |
a,allele |
| R2221 |
T8325 |
T8323 |
dobj |
allele,generating |
| R2222 |
T8326 |
T8325 |
amod |
putative,allele |
| R2223 |
T8327 |
T8325 |
amod |
null,allele |
| R2224 |
T8328 |
T8304 |
punct |
.,eliminates |
| R2225 |
T8330 |
T8331 |
nsubj |
We,identified |
| R2226 |
T8332 |
T8333 |
nummod |
three,clones |
| R2227 |
T8333 |
T8331 |
dobj |
clones,identified |
| R2228 |
T8334 |
T8335 |
advmod |
homologously,targeted |
| R2229 |
T8335 |
T8333 |
amod |
targeted,clones |
| R223 |
T1073 |
T1074 |
compound |
sex,chromatin |
| R2230 |
T8336 |
T8337 |
compound |
ES,cell |
| R2231 |
T8337 |
T8333 |
compound |
cell,clones |
| R2232 |
T8338 |
T8331 |
prep |
by,identified |
| R2233 |
T8339 |
T8340 |
compound |
Southern,blotting |
| R2234 |
T8340 |
T8338 |
pobj |
blotting,by |
| R2235 |
T8341 |
T8342 |
punct |
(,S2B |
| R2236 |
T8342 |
T8331 |
parataxis |
S2B,identified |
| R2237 |
T8343 |
T8342 |
compound |
Figure,S2B |
| R2238 |
T8344 |
T8342 |
punct |
),S2B |
| R2239 |
T8345 |
T8331 |
cc |
and,identified |
| R224 |
T1074 |
T1072 |
compound |
chromatin,transformation |
| R2240 |
T8346 |
T8331 |
conj |
injected,identified |
| R2241 |
T8347 |
T8346 |
dobj |
cells,injected |
| R2242 |
T8348 |
T8347 |
prep |
from,cells |
| R2243 |
T8349 |
T8350 |
nummod |
two,clones |
| R2244 |
T8350 |
T8348 |
pobj |
clones,from |
| R2245 |
T8351 |
T8346 |
prep |
into,injected |
| R2246 |
T8352 |
T8353 |
nmod |
C57BL,blastocysts |
| R2247 |
T8353 |
T8351 |
pobj |
blastocysts,into |
| R2248 |
T8354 |
T8352 |
punct |
/,C57BL |
| R2249 |
T8355 |
T8352 |
nummod |
6,C57BL |
| R225 |
T1075 |
T1076 |
dep |
that,occurs |
| R2250 |
T8356 |
T8331 |
punct |
.,identified |
| R2251 |
T8358 |
T8359 |
amod |
Chimeric,animals |
| R2252 |
T8359 |
T8360 |
nsubj |
animals,transmitted |
| R2253 |
T8361 |
T8359 |
prep |
from,animals |
| R2254 |
T8362 |
T8363 |
det |
both,lines |
| R2255 |
T8363 |
T8361 |
pobj |
lines,from |
| R2256 |
T8364 |
T8363 |
compound |
cell,lines |
| R2257 |
T8365 |
T8366 |
det |
the,allele |
| R2258 |
T8366 |
T8360 |
dobj |
allele,transmitted |
| R2259 |
T8367 |
T8366 |
amod |
targeted,allele |
| R226 |
T890 |
T889 |
compound |
XY,body |
| R2260 |
T8368 |
T8360 |
prep |
through,transmitted |
| R2261 |
T8369 |
T8370 |
det |
the,line |
| R2262 |
T8370 |
T8368 |
pobj |
line,through |
| R2263 |
T8371 |
T8370 |
compound |
germ,line |
| R2264 |
T8372 |
T8360 |
punct |
.,transmitted |
| R2265 |
T8374 |
T8375 |
amod |
Targeted,animals |
| R2266 |
T8375 |
T8376 |
nsubjpass |
animals,bred |
| R2267 |
T8377 |
T8376 |
auxpass |
were,bred |
| R2268 |
T8378 |
T8376 |
prep |
to,bred |
| R2269 |
T8379 |
T8380 |
compound |
β,actin |
| R227 |
T1076 |
T1072 |
relcl |
occurs,transformation |
| R2270 |
T8380 |
T8382 |
compound |
actin,mice |
| R2271 |
T8381 |
T8380 |
punct |
-,actin |
| R2272 |
T8382 |
T8378 |
pobj |
mice,to |
| R2273 |
T8383 |
T8382 |
compound |
Cre,mice |
| R2274 |
T8384 |
T8385 |
aux |
to,delete |
| R2275 |
T8385 |
T8376 |
advcl |
delete,bred |
| R2276 |
T8386 |
T8387 |
det |
the,exons |
| R2277 |
T8387 |
T8385 |
dobj |
exons,delete |
| R2278 |
T8388 |
T8389 |
compound |
DM,domain |
| R2279 |
T8389 |
T8390 |
npadvmod |
domain,encoding |
| R228 |
T1077 |
T1076 |
prep |
between,occurs |
| R2280 |
T8390 |
T8387 |
amod |
encoding,exons |
| R2281 |
T8391 |
T8390 |
punct |
–,encoding |
| R2282 |
T8392 |
T8376 |
punct |
", ",bred |
| R2283 |
T8393 |
T8376 |
advcl |
generating,bred |
| R2284 |
T8394 |
T8395 |
det |
the,allele |
| R2285 |
T8395 |
T8393 |
dobj |
allele,generating |
| R2286 |
T8396 |
T8395 |
compound |
Dmrt7,allele |
| R2287 |
T8397 |
T8395 |
punct |
−,allele |
| R2288 |
T8398 |
T8376 |
punct |
", ",bred |
| R2289 |
T8399 |
T8376 |
cc |
or,bred |
| R229 |
T1078 |
T1077 |
pobj |
pachynema,between |
| R2290 |
T8400 |
T8376 |
conj |
to,bred |
| R2291 |
T8401 |
T8402 |
nmod |
Flpe,mice |
| R2292 |
T8402 |
T8400 |
pobj |
mice,to |
| R2293 |
T8403 |
T8402 |
amod |
transgenic,mice |
| R2294 |
T8404 |
T8405 |
aux |
to,delete |
| R2295 |
T8405 |
T8400 |
advcl |
delete,to |
| R2296 |
T8406 |
T8407 |
det |
the,cassette |
| R2297 |
T8407 |
T8405 |
dobj |
cassette,delete |
| R2298 |
T8408 |
T8407 |
compound |
neo,cassette |
| R2299 |
T8409 |
T8400 |
punct |
", ",to |
| R23 |
T827 |
T828 |
auxpass |
Is,Required |
| R230 |
T1079 |
T1078 |
cc |
and,pachynema |
| R2300 |
T8410 |
T8400 |
advcl |
generating,to |
| R2301 |
T8411 |
T8412 |
det |
the,allele |
| R2302 |
T8412 |
T8410 |
dobj |
allele,generating |
| R2303 |
T8413 |
T8412 |
compound |
Dmrt7flox,allele |
| R2304 |
T8414 |
T8376 |
punct |
.,bred |
| R2305 |
T8416 |
T8417 |
nmod |
Dmrt7,mice |
| R2306 |
T8417 |
T8421 |
nsubjpass |
mice,interbred |
| R2307 |
T8418 |
T8416 |
punct |
+,Dmrt7 |
| R2308 |
T8419 |
T8416 |
punct |
/,Dmrt7 |
| R2309 |
T8420 |
T8416 |
punct |
−,Dmrt7 |
| R231 |
T891 |
T881 |
punct |
.,triggers |
| R2310 |
T8422 |
T8421 |
auxpass |
were,interbred |
| R2311 |
T8423 |
T8424 |
aux |
to,generate |
| R2312 |
T8424 |
T8421 |
advcl |
generate,interbred |
| R2313 |
T8425 |
T8426 |
nmod |
Dmrt7,mice |
| R2314 |
T8426 |
T8424 |
dobj |
mice,generate |
| R2315 |
T8427 |
T8425 |
punct |
−,Dmrt7 |
| R2316 |
T8428 |
T8425 |
punct |
/,Dmrt7 |
| R2317 |
T8429 |
T8425 |
punct |
−,Dmrt7 |
| R2318 |
T8430 |
T8421 |
punct |
.,interbred |
| R2319 |
T8432 |
T8433 |
aux |
To,confirm |
| R232 |
T1080 |
T1078 |
conj |
diplonema,pachynema |
| R2320 |
T8433 |
T8434 |
advcl |
confirm,stained |
| R2321 |
T8435 |
T8436 |
det |
the,lack |
| R2322 |
T8436 |
T8433 |
dobj |
lack,confirm |
| R2323 |
T8437 |
T8436 |
prep |
of,lack |
| R2324 |
T8438 |
T8439 |
amod |
functional,protein |
| R2325 |
T8439 |
T8437 |
pobj |
protein,of |
| R2326 |
T8440 |
T8439 |
compound |
DMRT7,protein |
| R2327 |
T8441 |
T8439 |
prep |
in,protein |
| R2328 |
T8442 |
T8443 |
nmod |
Dmrt7,testes |
| R2329 |
T8443 |
T8441 |
pobj |
testes,in |
| R233 |
T1081 |
T1044 |
punct |
.,conclude |
| R2330 |
T8444 |
T8442 |
punct |
−,Dmrt7 |
| R2331 |
T8445 |
T8442 |
punct |
/,Dmrt7 |
| R2332 |
T8446 |
T8442 |
punct |
−,Dmrt7 |
| R2333 |
T8447 |
T8434 |
punct |
", ",stained |
| R2334 |
T8448 |
T8434 |
nsubj |
we,stained |
| R2335 |
T8449 |
T8450 |
amod |
meiotic,spreads |
| R2336 |
T8450 |
T8434 |
dobj |
spreads,stained |
| R2337 |
T8451 |
T8450 |
prep |
from,spreads |
| R2338 |
T8452 |
T8453 |
compound |
Dmrt7,mutants |
| R2339 |
T8453 |
T8451 |
pobj |
mutants,from |
| R234 |
T893 |
T894 |
det |
The,body |
| R2340 |
T8454 |
T8455 |
punct |
(,S1 |
| R2341 |
T8455 |
T8450 |
parataxis |
S1,spreads |
| R2342 |
T8456 |
T8455 |
compound |
Figure,S1 |
| R2343 |
T8457 |
T8455 |
punct |
),S1 |
| R2344 |
T8458 |
T8450 |
cc |
and,spreads |
| R2345 |
T8459 |
T8450 |
conj |
sections,spreads |
| R2346 |
T8460 |
T8459 |
prep |
from,sections |
| R2347 |
T8461 |
T8462 |
compound |
mutant,testes |
| R2348 |
T8462 |
T8460 |
pobj |
testes,from |
| R2349 |
T8463 |
T8464 |
punct |
(,S2C |
| R235 |
T1083 |
T1084 |
nsubj |
We,suggest |
| R2350 |
T8464 |
T8459 |
parataxis |
S2C,sections |
| R2351 |
T8465 |
T8464 |
compound |
Figure,S2C |
| R2352 |
T8466 |
T8464 |
punct |
),S2C |
| R2353 |
T8467 |
T8434 |
cc |
and,stained |
| R2354 |
T8468 |
T8434 |
conj |
carried,stained |
| R2355 |
T8469 |
T8468 |
prt |
out,carried |
| R2356 |
T8470 |
T8471 |
compound |
western,blot |
| R2357 |
T8471 |
T8472 |
compound |
blot,analysis |
| R2358 |
T8472 |
T8468 |
dobj |
analysis,carried |
| R2359 |
T8473 |
T8474 |
punct |
(,data |
| R236 |
T1085 |
T1086 |
mark |
that,help |
| R2360 |
T8474 |
T8468 |
meta |
data,carried |
| R2361 |
T8475 |
T8474 |
amod |
unpublished,data |
| R2362 |
T8476 |
T8474 |
punct |
),data |
| R2363 |
T8477 |
T8434 |
punct |
.,stained |
| R2364 |
T8479 |
T8480 |
prep |
In,detected |
| R2365 |
T8481 |
T8482 |
det |
each,case |
| R2366 |
T8482 |
T8479 |
pobj |
case,In |
| R2367 |
T8483 |
T8480 |
punct |
", ",detected |
| R2368 |
T8484 |
T8480 |
nsubj |
we,detected |
| R2369 |
T8485 |
T8486 |
det |
no,protein |
| R237 |
T894 |
T896 |
nsubj |
body,disassembles |
| R2370 |
T8486 |
T8480 |
dobj |
protein,detected |
| R2371 |
T8487 |
T8486 |
compound |
DMRT7,protein |
| R2372 |
T8488 |
T8480 |
prep |
in,detected |
| R2373 |
T8489 |
T8490 |
det |
the,testes |
| R2374 |
T8490 |
T8488 |
pobj |
testes,in |
| R2375 |
T8491 |
T8490 |
compound |
mutant,testes |
| R2376 |
T8492 |
T8480 |
punct |
.,detected |
| R238 |
T1086 |
T1084 |
ccomp |
help,suggest |
| R2383 |
T9723 |
T9724 |
nsubjpass |
Dmrt7,Required |
| R2384 |
T9725 |
T9724 |
auxpass |
Is,Required |
| R2385 |
T9726 |
T9724 |
prep |
for,Required |
| R2386 |
T9727 |
T9728 |
amod |
Male,Gametogenesis |
| R2387 |
T9728 |
T9726 |
pobj |
Gametogenesis,for |
| R2388 |
T9729 |
T9727 |
cc |
but,Male |
| R2389 |
T9730 |
T9729 |
neg |
Not,but |
| R239 |
T1087 |
T1086 |
nsubj |
DMRT7,help |
| R2390 |
T9731 |
T9727 |
conj |
Female,Male |
| R2391 |
T9733 |
T9734 |
nsubj |
Breeding,produced |
| R2392 |
T9735 |
T9733 |
prep |
of,Breeding |
| R2393 |
T9736 |
T9737 |
compound |
Dmrt7,heterozygotes |
| R2394 |
T9737 |
T9735 |
pobj |
heterozygotes,of |
| R2395 |
T9738 |
T9739 |
amod |
homozygous,progeny |
| R2396 |
T9739 |
T9734 |
dobj |
progeny,produced |
| R2397 |
T9740 |
T9739 |
compound |
mutant,progeny |
| R2398 |
T9741 |
T9739 |
prep |
of,progeny |
| R2399 |
T9742 |
T9743 |
det |
both,sexes |
| R24 |
T922 |
T921 |
punct |
", ",DMRT7 |
| R240 |
T1088 |
T1086 |
aux |
may,help |
| R2400 |
T9743 |
T9741 |
pobj |
sexes,of |
| R2401 |
T9744 |
T9734 |
prep |
at,produced |
| R2402 |
T9745 |
T9746 |
det |
the,frequency |
| R2403 |
T9746 |
T9744 |
pobj |
frequency,at |
| R2404 |
T9747 |
T9746 |
amod |
expected,frequency |
| R2405 |
T9748 |
T9749 |
punct |
(,% |
| R2406 |
T9749 |
T9734 |
parataxis |
%,produced |
| R2407 |
T9750 |
T9751 |
quantmod |
63,264 |
| R2408 |
T9751 |
T9749 |
dep |
264,% |
| R2409 |
T9752 |
T9751 |
punct |
/,264 |
| R241 |
T1089 |
T1086 |
xcomp |
control,help |
| R2410 |
T9753 |
T9749 |
punct |
;,% |
| R2411 |
T9754 |
T9749 |
nummod |
23,% |
| R2412 |
T9755 |
T9749 |
punct |
),% |
| R2413 |
T9756 |
T9734 |
punct |
.,produced |
| R2414 |
T9758 |
T9759 |
amod |
Male,mutants |
| R2415 |
T9759 |
T9763 |
nsubj |
mutants,were |
| R2416 |
T9760 |
T9758 |
cc |
and,Male |
| R2417 |
T9761 |
T9758 |
conj |
female,Male |
| R2418 |
T9762 |
T9759 |
amod |
homozygous,mutants |
| R2419 |
T9764 |
T9763 |
acomp |
viable,were |
| R242 |
T895 |
T894 |
compound |
XY,body |
| R2420 |
T9765 |
T9763 |
punct |
", ",were |
| R2421 |
T9766 |
T9763 |
conj |
grew,were |
| R2422 |
T9767 |
T9766 |
prep |
to,grew |
| R2423 |
T9768 |
T9767 |
pobj |
adulthood,to |
| R2424 |
T9769 |
T9766 |
advmod |
normally,grew |
| R2425 |
T9770 |
T9766 |
punct |
", ",grew |
| R2426 |
T9771 |
T9766 |
cc |
and,grew |
| R2427 |
T9772 |
T9766 |
conj |
exhibited,grew |
| R2428 |
T9773 |
T9774 |
amod |
normal,behavior |
| R2429 |
T9774 |
T9772 |
dobj |
behavior,exhibited |
| R243 |
T1090 |
T1091 |
det |
the,transition |
| R2430 |
T9775 |
T9774 |
amod |
sexual,behavior |
| R2431 |
T9776 |
T9763 |
punct |
.,were |
| R2432 |
T9778 |
T9779 |
amod |
Female,homozygotes |
| R2433 |
T9779 |
T9780 |
nsubj |
homozygotes,were |
| R2434 |
T9781 |
T9780 |
acomp |
fertile,were |
| R2435 |
T9782 |
T9780 |
punct |
", ",were |
| R2436 |
T9783 |
T9780 |
conj |
produced,were |
| R2437 |
T9784 |
T9783 |
dobj |
litters,produced |
| R2438 |
T9785 |
T9784 |
prep |
of,litters |
| R2439 |
T9786 |
T9787 |
amod |
normal,size |
| R244 |
T1091 |
T1089 |
dobj |
transition,control |
| R2440 |
T9787 |
T9785 |
pobj |
size,of |
| R2441 |
T9788 |
T9783 |
punct |
", ",produced |
| R2442 |
T9789 |
T9783 |
cc |
and,produced |
| R2443 |
T9790 |
T9783 |
conj |
had,produced |
| R2444 |
T9791 |
T9792 |
det |
no,abnormalities |
| R2445 |
T9792 |
T9790 |
dobj |
abnormalities,had |
| R2446 |
T9793 |
T9792 |
amod |
obvious,abnormalities |
| R2447 |
T9794 |
T9792 |
amod |
ovarian,abnormalities |
| R2448 |
T9795 |
T9796 |
mark |
as,judged |
| R2449 |
T9796 |
T9790 |
advcl |
judged,had |
| R245 |
T1092 |
T1091 |
prep |
from,transition |
| R2450 |
T9797 |
T9796 |
prep |
by,judged |
| R2451 |
T9798 |
T9799 |
amod |
histological,analysis |
| R2452 |
T9799 |
T9797 |
pobj |
analysis,by |
| R2453 |
T9800 |
T9801 |
punct |
(,data |
| R2454 |
T9801 |
T9790 |
meta |
data,had |
| R2455 |
T9802 |
T9801 |
amod |
unpublished,data |
| R2456 |
T9803 |
T9801 |
punct |
),data |
| R2457 |
T9804 |
T9780 |
punct |
.,were |
| R2458 |
T9806 |
T9807 |
prep |
In,were |
| R2459 |
T9808 |
T9806 |
pobj |
contrast,In |
| R246 |
T897 |
T896 |
prep |
after,disassembles |
| R2460 |
T9809 |
T9807 |
punct |
", ",were |
| R2461 |
T9810 |
T9811 |
nmod |
Dmrt7,mutant |
| R2462 |
T9811 |
T9813 |
compound |
mutant,males |
| R2463 |
T9812 |
T9811 |
amod |
homozygous,mutant |
| R2464 |
T9813 |
T9807 |
nsubj |
males,were |
| R2465 |
T9814 |
T9815 |
advmod |
completely,infertile |
| R2466 |
T9815 |
T9807 |
acomp |
infertile,were |
| R2467 |
T9816 |
T9807 |
cc |
and,were |
| R2468 |
T9817 |
T9807 |
conj |
had,were |
| R2469 |
T9818 |
T9817 |
dobj |
testes,had |
| R247 |
T1093 |
T1094 |
amod |
meiotic,chromosome |
| R2470 |
T9819 |
T9820 |
quantmod |
about,one |
| R2471 |
T9820 |
T9821 |
nummod |
one,weight |
| R2472 |
T9821 |
T9818 |
npadvmod |
weight,testes |
| R2473 |
T9822 |
T9820 |
punct |
-,one |
| R2474 |
T9823 |
T9820 |
quantmod |
third,one |
| R2475 |
T9824 |
T9821 |
det |
the,weight |
| R2476 |
T9825 |
T9821 |
prep |
of,weight |
| R2477 |
T9826 |
T9825 |
pobj |
those,of |
| R2478 |
T9827 |
T9826 |
prep |
of,those |
| R2479 |
T9828 |
T9829 |
amod |
heterozygous,littermates |
| R248 |
T1094 |
T1096 |
compound |
chromosome,inactivation |
| R2480 |
T9829 |
T9827 |
pobj |
littermates,of |
| R2481 |
T9830 |
T9828 |
cc |
or,heterozygous |
| R2482 |
T9831 |
T9832 |
amod |
wild,type |
| R2483 |
T9832 |
T9828 |
conj |
type,heterozygous |
| R2484 |
T9833 |
T9832 |
punct |
-,type |
| R2485 |
T9834 |
T9829 |
amod |
adult,littermates |
| R2486 |
T9835 |
T9836 |
punct |
(,Figure |
| R2487 |
T9836 |
T9817 |
parataxis |
Figure,had |
| R2488 |
T9837 |
T9836 |
nummod |
2,Figure |
| R2489 |
T9838 |
T9836 |
punct |
),Figure |
| R249 |
T1095 |
T1094 |
compound |
sex,chromosome |
| R2490 |
T9839 |
T9807 |
punct |
.,were |
| R2491 |
T9841 |
T9842 |
aux |
To,determine |
| R2492 |
T9842 |
T9843 |
advcl |
determine,compared |
| R2493 |
T9844 |
T9845 |
advmod |
when,begins |
| R2494 |
T9845 |
T9842 |
ccomp |
begins,determine |
| R2495 |
T9846 |
T9847 |
amod |
defective,development |
| R2496 |
T9847 |
T9845 |
nsubj |
development,begins |
| R2497 |
T9848 |
T9847 |
compound |
testis,development |
| R2498 |
T9849 |
T9845 |
prep |
in,begins |
| R2499 |
T9850 |
T9851 |
compound |
Dmrt7,mutants |
| R25 |
T923 |
T924 |
det |
a,protein |
| R250 |
T898 |
T897 |
pobj |
prophase,after |
| R2500 |
T9851 |
T9849 |
pobj |
mutants,in |
| R2501 |
T9852 |
T9843 |
punct |
", ",compared |
| R2502 |
T9853 |
T9843 |
nsubj |
we,compared |
| R2503 |
T9854 |
T9855 |
det |
the,testes |
| R2504 |
T9855 |
T9843 |
dobj |
testes,compared |
| R2505 |
T9856 |
T9855 |
prep |
of,testes |
| R2506 |
T9857 |
T9858 |
amod |
wild,type |
| R2507 |
T9858 |
T9860 |
nmod |
type,littermates |
| R2508 |
T9859 |
T9858 |
punct |
-,type |
| R2509 |
T9860 |
T9856 |
pobj |
littermates,of |
| R251 |
T899 |
T896 |
punct |
", ",disassembles |
| R2510 |
T9861 |
T9858 |
cc |
and,type |
| R2511 |
T9862 |
T9858 |
conj |
mutant,type |
| R2512 |
T9863 |
T9843 |
prep |
during,compared |
| R2513 |
T9864 |
T9865 |
det |
the,wave |
| R2514 |
T9865 |
T9863 |
pobj |
wave,during |
| R2515 |
T9866 |
T9865 |
amod |
first,wave |
| R2516 |
T9867 |
T9865 |
prep |
of,wave |
| R2517 |
T9868 |
T9867 |
pobj |
spermatogenesis,of |
| R2518 |
T9869 |
T9843 |
punct |
.,compared |
| R2519 |
T9871 |
T9872 |
prep |
Prior,appeared |
| R252 |
T900 |
T896 |
cc |
but,disassembles |
| R2520 |
T9873 |
T9871 |
prep |
to,Prior |
| R2521 |
T9874 |
T9875 |
amod |
postnatal,day |
| R2522 |
T9875 |
T9873 |
pobj |
day,to |
| R2523 |
T9876 |
T9875 |
nummod |
14,day |
| R2524 |
T9877 |
T9875 |
punct |
(,day |
| R2525 |
T9878 |
T9875 |
appos |
P14,day |
| R2526 |
T9879 |
T9872 |
punct |
),appeared |
| R2527 |
T9880 |
T9872 |
punct |
", ",appeared |
| R2528 |
T9881 |
T9882 |
compound |
mutant,testes |
| R2529 |
T9882 |
T9872 |
nsubj |
testes,appeared |
| R253 |
T1096 |
T1092 |
pobj |
inactivation,from |
| R2530 |
T9883 |
T9884 |
advmod |
histologically,normal |
| R2531 |
T9884 |
T9872 |
oprd |
normal,appeared |
| R2532 |
T9885 |
T9872 |
cc |
and,appeared |
| R2533 |
T9886 |
T9887 |
det |
the,weights |
| R2534 |
T9887 |
T9889 |
nsubj |
weights,were |
| R2535 |
T9888 |
T9887 |
compound |
testis,weights |
| R2536 |
T9889 |
T9872 |
conj |
were,appeared |
| R2537 |
T9890 |
T9889 |
acomp |
similar,were |
| R2538 |
T9891 |
T9890 |
prep |
to,similar |
| R2539 |
T9892 |
T9891 |
pobj |
those,to |
| R254 |
T1097 |
T1091 |
prep |
to,transition |
| R2540 |
T9893 |
T9892 |
prep |
of,those |
| R2541 |
T9894 |
T9895 |
amod |
heterozygous,littermates |
| R2542 |
T9895 |
T9893 |
pobj |
littermates,of |
| R2543 |
T9896 |
T9894 |
cc |
and,heterozygous |
| R2544 |
T9897 |
T9898 |
amod |
wild,type |
| R2545 |
T9898 |
T9894 |
conj |
type,heterozygous |
| R2546 |
T9899 |
T9898 |
punct |
-,type |
| R2547 |
T9900 |
T9889 |
punct |
", ",were |
| R2548 |
T9901 |
T9889 |
advcl |
indicating,were |
| R2549 |
T9902 |
T9903 |
mark |
that,form |
| R255 |
T901 |
T902 |
amod |
specialized,chromatin |
| R2550 |
T9903 |
T9901 |
ccomp |
form,indicating |
| R2551 |
T9904 |
T9903 |
nsubj |
spermatogonia,form |
| R2552 |
T9905 |
T9904 |
cc |
and,spermatogonia |
| R2553 |
T9906 |
T9907 |
amod |
early,cells |
| R2554 |
T9907 |
T9904 |
conj |
cells,spermatogonia |
| R2555 |
T9908 |
T9907 |
amod |
meiotic,cells |
| R2556 |
T9909 |
T9907 |
compound |
germ,cells |
| R2557 |
T9910 |
T9903 |
advmod |
normally,form |
| R2558 |
T9911 |
T9912 |
punct |
(,data |
| R2559 |
T9912 |
T9889 |
parataxis |
data,were |
| R256 |
T1098 |
T1099 |
amod |
postmeiotic,chromatin |
| R2560 |
T9913 |
T9914 |
compound |
Figure,2B |
| R2561 |
T9914 |
T9912 |
dep |
2B,data |
| R2562 |
T9915 |
T9912 |
punct |
;,data |
| R2563 |
T9916 |
T9912 |
amod |
unpublished,data |
| R2564 |
T9917 |
T9912 |
punct |
),data |
| R2565 |
T9918 |
T9889 |
punct |
.,were |
| R2566 |
T9920 |
T9921 |
advmod |
Thereafter,ceased |
| R2567 |
T9922 |
T9921 |
punct |
", ",ceased |
| R2568 |
T9923 |
T9924 |
det |
the,testes |
| R2569 |
T9924 |
T9921 |
nsubj |
testes,ceased |
| R257 |
T1099 |
T1097 |
pobj |
chromatin,to |
| R2570 |
T9925 |
T9924 |
prep |
of,testes |
| R2571 |
T9926 |
T9927 |
det |
the,mice |
| R2572 |
T9927 |
T9925 |
pobj |
mice,of |
| R2573 |
T9928 |
T9927 |
compound |
Dmrt7,mice |
| R2574 |
T9929 |
T9927 |
compound |
mutant,mice |
| R2575 |
T9930 |
T9931 |
aux |
to,grow |
| R2576 |
T9931 |
T9921 |
xcomp |
grow,ceased |
| R2577 |
T9932 |
T9921 |
cc |
and,ceased |
| R2578 |
T9933 |
T9934 |
det |
the,difference |
| R2579 |
T9934 |
T9936 |
nsubj |
difference,was |
| R258 |
T1100 |
T1099 |
compound |
sex,chromatin |
| R2580 |
T9935 |
T9934 |
compound |
weight,difference |
| R2581 |
T9936 |
T9921 |
conj |
was,ceased |
| R2582 |
T9937 |
T9936 |
acomp |
significant,was |
| R2583 |
T9938 |
T9921 |
punct |
.,ceased |
| R2584 |
T9940 |
T9941 |
amod |
Microscopic,examination |
| R2585 |
T9941 |
T9942 |
nsubj |
examination,revealed |
| R2586 |
T9943 |
T9941 |
prep |
of,examination |
| R2587 |
T9944 |
T9945 |
nmod |
P21,testes |
| R2588 |
T9945 |
T9943 |
pobj |
testes,of |
| R2589 |
T9946 |
T9944 |
cc |
and,P21 |
| R259 |
T902 |
T904 |
nsubj |
chromatin,persists |
| R2590 |
T9947 |
T9944 |
conj |
P42,P21 |
| R2591 |
T9948 |
T9949 |
compound |
Dmrt7,mutant |
| R2592 |
T9949 |
T9945 |
compound |
mutant,testes |
| R2593 |
T9950 |
T9951 |
mark |
that,arrest |
| R2594 |
T9951 |
T9942 |
ccomp |
arrest,revealed |
| R2595 |
T9952 |
T9953 |
compound |
germ,cells |
| R2596 |
T9953 |
T9951 |
nsubj |
cells,arrest |
| R2597 |
T9954 |
T9951 |
prep |
in,arrest |
| R2598 |
T9955 |
T9954 |
pobj |
pachynema,in |
| R2599 |
T9956 |
T9951 |
punct |
", ",arrest |
| R26 |
T828 |
T821 |
conj |
Required,Associates |
| R260 |
T1101 |
T1091 |
prep |
in,transition |
| R2600 |
T9957 |
T9951 |
cc |
and,arrest |
| R2601 |
T9958 |
T9959 |
amod |
later,stages |
| R2602 |
T9959 |
T9960 |
nsubj |
stages,are |
| R2603 |
T9960 |
T9951 |
conj |
are,arrest |
| R2604 |
T9961 |
T9959 |
prep |
of,stages |
| R2605 |
T9962 |
T9963 |
compound |
germ,cells |
| R2606 |
T9963 |
T9961 |
pobj |
cells,of |
| R2607 |
T9964 |
T9965 |
advmod |
largely,missing |
| R2608 |
T9965 |
T9960 |
acomp |
missing,are |
| R2609 |
T9966 |
T9967 |
punct |
(,2C |
| R261 |
T1102 |
T1101 |
pobj |
males,in |
| R2610 |
T9967 |
T9942 |
parataxis |
2C,revealed |
| R2611 |
T9968 |
T9967 |
compound |
Figure,2C |
| R2612 |
T9969 |
T9967 |
cc |
and,2C |
| R2613 |
T9970 |
T9967 |
conj |
2D,2C |
| R2614 |
T9971 |
T9967 |
punct |
),2C |
| R2615 |
T9972 |
T9942 |
punct |
.,revealed |
| R2616 |
T9974 |
T9975 |
compound |
Dmrt7,mutant |
| R2617 |
T9975 |
T9976 |
compound |
mutant,mice |
| R2618 |
T9976 |
T9977 |
nsubj |
mice,are |
| R2619 |
T9978 |
T9977 |
acomp |
deficient,are |
| R262 |
T1103 |
T1084 |
punct |
.,suggest |
| R2620 |
T9979 |
T9977 |
prep |
in,are |
| R2621 |
T9980 |
T9981 |
amod |
postmeiotic,spermatids |
| R2622 |
T9981 |
T9979 |
pobj |
spermatids,in |
| R2623 |
T9982 |
T9977 |
cc |
and,are |
| R2624 |
T9983 |
T9977 |
conj |
lack,are |
| R2625 |
T9984 |
T9985 |
amod |
epididymal,spermatozoa |
| R2626 |
T9985 |
T9983 |
dobj |
spermatozoa,lack |
| R2627 |
T9986 |
T9983 |
punct |
", ",lack |
| R2628 |
T9987 |
T9988 |
mark |
although,develop |
| R2629 |
T9988 |
T9983 |
advcl |
develop,lack |
| R263 |
T903 |
T902 |
compound |
sex,chromatin |
| R2630 |
T9989 |
T9990 |
det |
a,cells |
| R2631 |
T9990 |
T9988 |
nsubj |
cells,develop |
| R2632 |
T9991 |
T9990 |
amod |
few,cells |
| R2633 |
T9992 |
T9988 |
prep |
to,develop |
| R2634 |
T9993 |
T9994 |
det |
the,stage |
| R2635 |
T9994 |
T9992 |
pobj |
stage,to |
| R2636 |
T9995 |
T9994 |
amod |
round,stage |
| R2637 |
T9996 |
T9994 |
compound |
spermatid,stage |
| R2638 |
T9997 |
T9977 |
punct |
.,are |
| R2639 |
T9999 |
T10000 |
det |
These,defects |
| R264 |
T1105 |
T1106 |
prep |
In,shed |
| R2640 |
T10000 |
T10002 |
nsubj |
defects,are |
| R2641 |
T10001 |
T10000 |
amod |
meiotic,defects |
| R2642 |
T10003 |
T10002 |
prep |
in,are |
| R2643 |
T10004 |
T10003 |
pobj |
agreement,in |
| R2644 |
T10005 |
T10004 |
prep |
with,agreement |
| R2645 |
T10006 |
T10007 |
det |
a,analysis |
| R2646 |
T10007 |
T10005 |
pobj |
analysis,with |
| R2647 |
T10008 |
T10007 |
amod |
recent,analysis |
| R2648 |
T10009 |
T10007 |
amod |
preliminary,analysis |
| R2649 |
T10010 |
T10007 |
prep |
of,analysis |
| R265 |
T904 |
T896 |
conj |
persists,disassembles |
| R2650 |
T10011 |
T10012 |
det |
another,mutation |
| R2651 |
T10012 |
T10010 |
pobj |
mutation,of |
| R2652 |
T10013 |
T10012 |
compound |
Dmrt7,mutation |
| R2653 |
T10014 |
T10015 |
punct |
[,42 |
| R2654 |
T10015 |
T10002 |
parataxis |
42,are |
| R2655 |
T10016 |
T10015 |
punct |
],42 |
| R2656 |
T10017 |
T10002 |
punct |
.,are |
| R2657 |
T10019 |
T10020 |
mark |
While,are |
| R2658 |
T10020 |
T10025 |
advcl |
are,have |
| R2659 |
T10021 |
T10022 |
det |
some,tubules |
| R266 |
T1107 |
T1105 |
pobj |
addition,In |
| R2660 |
T10022 |
T10020 |
nsubj |
tubules,are |
| R2661 |
T10023 |
T10024 |
compound |
Dmrt7,mutant |
| R2662 |
T10024 |
T10022 |
compound |
mutant,tubules |
| R2663 |
T10026 |
T10027 |
advmod |
highly,vacuolated |
| R2664 |
T10027 |
T10020 |
acomp |
vacuolated,are |
| R2665 |
T10028 |
T10020 |
cc |
and,are |
| R2666 |
T10029 |
T10020 |
conj |
contain,are |
| R2667 |
T10030 |
T10029 |
advmod |
primarily,contain |
| R2668 |
T10031 |
T10032 |
compound |
Sertoli,cells |
| R2669 |
T10032 |
T10029 |
dobj |
cells,contain |
| R267 |
T1108 |
T1106 |
punct |
", ",shed |
| R2670 |
T10033 |
T10032 |
cc |
and,cells |
| R2671 |
T10034 |
T10032 |
conj |
spermatogonia,cells |
| R2672 |
T10035 |
T10025 |
punct |
", ",have |
| R2673 |
T10036 |
T10025 |
nsubj |
others,have |
| R2674 |
T10037 |
T10038 |
amod |
abundant,spermatocytes |
| R2675 |
T10038 |
T10025 |
dobj |
spermatocytes,have |
| R2676 |
T10039 |
T10038 |
amod |
primary,spermatocytes |
| R2677 |
T10040 |
T10025 |
punct |
.,have |
| R2678 |
T10042 |
T10043 |
prep |
In,contain |
| R2679 |
T10044 |
T10042 |
pobj |
addition,In |
| R268 |
T1109 |
T1110 |
mark |
because,found |
| R2680 |
T10045 |
T10043 |
punct |
", ",contain |
| R2681 |
T10046 |
T10047 |
det |
some,tubules |
| R2682 |
T10047 |
T10043 |
nsubj |
tubules,contain |
| R2683 |
T10048 |
T10049 |
amod |
multinucleated,cells |
| R2684 |
T10049 |
T10043 |
dobj |
cells,contain |
| R2685 |
T10050 |
T10049 |
cc |
and,cells |
| R2686 |
T10051 |
T10049 |
conj |
cells,cells |
| R2687 |
T10052 |
T10051 |
prep |
with,cells |
| R2688 |
T10053 |
T10054 |
advmod |
darkly,stained |
| R2689 |
T10054 |
T10055 |
amod |
stained,nuclei |
| R269 |
T1110 |
T1106 |
advcl |
found,shed |
| R2690 |
T10055 |
T10052 |
pobj |
nuclei,with |
| R2691 |
T10056 |
T10057 |
dep |
that,are |
| R2692 |
T10057 |
T10055 |
relcl |
are,nuclei |
| R2693 |
T10058 |
T10057 |
acomp |
typical,are |
| R2694 |
T10059 |
T10058 |
prep |
of,typical |
| R2695 |
T10060 |
T10061 |
amod |
apoptotic,cells |
| R2696 |
T10061 |
T10059 |
pobj |
cells,of |
| R2697 |
T10062 |
T10063 |
punct |
(,2D |
| R2698 |
T10063 |
T10043 |
parataxis |
2D,contain |
| R2699 |
T10064 |
T10063 |
compound |
Figure,2D |
| R27 |
T924 |
T921 |
appos |
protein,DMRT7 |
| R270 |
T1111 |
T1110 |
nsubjpass |
it,found |
| R2700 |
T10065 |
T10063 |
punct |
),2D |
| R2701 |
T10066 |
T10043 |
punct |
.,contain |
| R2702 |
T10068 |
T10069 |
mark |
Since,lack |
| R2703 |
T10069 |
T10073 |
advcl |
lack,used |
| R2704 |
T10070 |
T10071 |
compound |
Dmrt7,testes |
| R2705 |
T10071 |
T10069 |
nsubj |
testes,lack |
| R2706 |
T10072 |
T10071 |
compound |
mutant,testes |
| R2707 |
T10074 |
T10075 |
advmod |
most,cells |
| R2708 |
T10075 |
T10069 |
dobj |
cells,lack |
| R2709 |
T10076 |
T10075 |
amod |
post-pachytene,cells |
| R271 |
T905 |
T904 |
punct |
", ",persists |
| R2710 |
T10077 |
T10073 |
punct |
", ",used |
| R2711 |
T10078 |
T10073 |
nsubj |
we,used |
| R2712 |
T10079 |
T10080 |
compound |
TUNEL,analysis |
| R2713 |
T10080 |
T10073 |
dobj |
analysis,used |
| R2714 |
T10081 |
T10082 |
aux |
to,test |
| R2715 |
T10082 |
T10073 |
advcl |
test,used |
| R2716 |
T10083 |
T10084 |
mark |
whether,eliminated |
| R2717 |
T10084 |
T10082 |
ccomp |
eliminated,test |
| R2718 |
T10085 |
T10086 |
det |
the,cells |
| R2719 |
T10086 |
T10084 |
nsubjpass |
cells,eliminated |
| R272 |
T1112 |
T1110 |
auxpass |
is,found |
| R2720 |
T10087 |
T10086 |
amod |
missing,cells |
| R2721 |
T10088 |
T10084 |
auxpass |
are,eliminated |
| R2722 |
T10089 |
T10084 |
prep |
by,eliminated |
| R2723 |
T10090 |
T10089 |
pobj |
apoptosis,by |
| R2724 |
T10091 |
T10073 |
punct |
.,used |
| R2725 |
T10093 |
T10094 |
prep |
At,contain |
| R2726 |
T10095 |
T10096 |
nummod |
3,wk |
| R2727 |
T10096 |
T10093 |
pobj |
wk,At |
| R2728 |
T10097 |
T10094 |
punct |
", ",contain |
| R2729 |
T10098 |
T10099 |
compound |
Dmrt7,mutant |
| R273 |
T1113 |
T1110 |
prep |
in,found |
| R2730 |
T10099 |
T10100 |
compound |
mutant,testes |
| R2731 |
T10100 |
T10094 |
nsubj |
testes,contain |
| R2732 |
T10101 |
T10102 |
advmod |
significantly,more |
| R2733 |
T10102 |
T10103 |
amod |
more,cells |
| R2734 |
T10103 |
T10094 |
dobj |
cells,contain |
| R2735 |
T10104 |
T10103 |
amod |
apoptotic,cells |
| R2736 |
T10105 |
T10103 |
prep |
than,cells |
| R2737 |
T10106 |
T10105 |
pobj |
those,than |
| R2738 |
T10107 |
T10106 |
prep |
of,those |
| R2739 |
T10108 |
T10109 |
amod |
wild,type |
| R274 |
T1114 |
T1115 |
det |
all,branches |
| R2740 |
T10109 |
T10111 |
compound |
type,controls |
| R2741 |
T10110 |
T10109 |
punct |
-,type |
| R2742 |
T10111 |
T10107 |
pobj |
controls,of |
| R2743 |
T10112 |
T10094 |
punct |
.,contain |
| R2744 |
T10114 |
T10115 |
det |
The,percentage |
| R2745 |
T10115 |
T10116 |
nsubj |
percentage,was |
| R2746 |
T10117 |
T10115 |
prep |
of,percentage |
| R2747 |
T10118 |
T10119 |
compound |
tubule,sections |
| R2748 |
T10119 |
T10117 |
pobj |
sections,of |
| R2749 |
T10120 |
T10115 |
prep |
with,percentage |
| R275 |
T1115 |
T1113 |
pobj |
branches,in |
| R2750 |
T10121 |
T10122 |
nummod |
five,nuclei |
| R2751 |
T10122 |
T10120 |
pobj |
nuclei,with |
| R2752 |
T10123 |
T10121 |
cc |
or,five |
| R2753 |
T10124 |
T10121 |
conj |
more,five |
| R2754 |
T10125 |
T10122 |
amod |
apoptotic,nuclei |
| R2755 |
T10126 |
T10127 |
quantmod |
about,three |
| R2756 |
T10127 |
T10128 |
npadvmod |
three,higher |
| R2757 |
T10128 |
T10116 |
acomp |
higher,was |
| R2758 |
T10129 |
T10127 |
quantmod |
times,three |
| R2759 |
T10130 |
T10116 |
prep |
in,was |
| R276 |
T906 |
T904 |
prep |
with,persists |
| R2760 |
T10131 |
T10132 |
compound |
Dmrt7,mutants |
| R2761 |
T10132 |
T10130 |
pobj |
mutants,in |
| R2762 |
T10133 |
T10116 |
prep |
compared,was |
| R2763 |
T10134 |
T10133 |
prep |
with,compared |
| R2764 |
T10135 |
T10136 |
amod |
wild,type |
| R2765 |
T10136 |
T10134 |
pobj |
type,with |
| R2766 |
T10137 |
T10136 |
punct |
-,type |
| R2767 |
T10138 |
T10139 |
punct |
(,2E |
| R2768 |
T10139 |
T10116 |
parataxis |
2E,was |
| R2769 |
T10140 |
T10141 |
nummod |
20,% |
| R277 |
T1116 |
T1115 |
prep |
of,branches |
| R2770 |
T10141 |
T10139 |
dep |
%,2E |
| R2771 |
T10142 |
T10141 |
cc |
versus,% |
| R2772 |
T10143 |
T10144 |
nummod |
7,% |
| R2773 |
T10144 |
T10141 |
conj |
%,% |
| R2774 |
T10145 |
T10139 |
punct |
;,2E |
| R2775 |
T10146 |
T10139 |
compound |
Figure,2E |
| R2776 |
T10147 |
T10139 |
punct |
),2E |
| R2777 |
T10148 |
T10116 |
punct |
.,was |
| R2778 |
T10150 |
T10151 |
det |
A,elevation |
| R2779 |
T10151 |
T10153 |
nsubj |
elevation,was |
| R278 |
T1117 |
T1116 |
pobj |
mammals,of |
| R2780 |
T10152 |
T10151 |
amod |
similar,elevation |
| R2781 |
T10154 |
T10151 |
prep |
of,elevation |
| R2782 |
T10155 |
T10154 |
pobj |
apoptosis,of |
| R2783 |
T10156 |
T10153 |
acomp |
apparent,was |
| R2784 |
T10157 |
T10153 |
prep |
in,was |
| R2785 |
T10158 |
T10159 |
compound |
mutant,testes |
| R2786 |
T10159 |
T10157 |
pobj |
testes,in |
| R2787 |
T10160 |
T10153 |
prep |
at,was |
| R2788 |
T10161 |
T10162 |
nummod |
7,wk |
| R2789 |
T10162 |
T10160 |
pobj |
wk,at |
| R279 |
T1118 |
T1113 |
punct |
", ",in |
| R2790 |
T10163 |
T10164 |
punct |
(,2F |
| R2791 |
T10164 |
T10153 |
parataxis |
2F,was |
| R2792 |
T10165 |
T10164 |
compound |
Figure,2F |
| R2793 |
T10166 |
T10164 |
punct |
),2F |
| R2794 |
T10167 |
T10153 |
punct |
.,was |
| R2795 |
T10169 |
T10170 |
prep |
In,were |
| R2796 |
T10171 |
T10169 |
pobj |
mutants,In |
| R2797 |
T10172 |
T10170 |
punct |
", ",were |
| R2798 |
T10173 |
T10174 |
amod |
many,cells |
| R2799 |
T10174 |
T10170 |
nsubj |
cells,were |
| R28 |
T925 |
T926 |
npadvmod |
mammal,specific |
| R280 |
T1119 |
T1113 |
cc |
but,in |
| R2800 |
T10175 |
T10174 |
amod |
apoptotic,cells |
| R2801 |
T10176 |
T10170 |
prep |
in,were |
| R2802 |
T10177 |
T10178 |
det |
the,middle |
| R2803 |
T10178 |
T10176 |
pobj |
middle,in |
| R2804 |
T10179 |
T10178 |
prep |
of,middle |
| R2805 |
T10180 |
T10181 |
det |
the,tubules |
| R2806 |
T10181 |
T10179 |
pobj |
tubules,of |
| R2807 |
T10182 |
T10170 |
punct |
", ",were |
| R2808 |
T10183 |
T10184 |
mark |
whereas,occur |
| R2809 |
T10184 |
T10170 |
advcl |
occur,were |
| R281 |
T907 |
T908 |
amod |
further,modification |
| R2810 |
T10185 |
T10186 |
det |
the,cells |
| R2811 |
T10186 |
T10184 |
nsubj |
cells,occur |
| R2812 |
T10187 |
T10186 |
amod |
apoptotic,cells |
| R2813 |
T10188 |
T10186 |
prep |
in,cells |
| R2814 |
T10189 |
T10190 |
amod |
wild,type |
| R2815 |
T10190 |
T10188 |
pobj |
type,in |
| R2816 |
T10191 |
T10190 |
punct |
-,type |
| R2817 |
T10192 |
T10184 |
advmod |
mainly,occur |
| R2818 |
T10193 |
T10184 |
prep |
near,occur |
| R2819 |
T10194 |
T10195 |
det |
the,periphery |
| R282 |
T1120 |
T1119 |
neg |
not,but |
| R2820 |
T10195 |
T10193 |
pobj |
periphery,near |
| R2821 |
T10196 |
T10195 |
amod |
seminiferous,periphery |
| R2822 |
T10197 |
T10195 |
compound |
tubule,periphery |
| R2823 |
T10198 |
T10170 |
punct |
.,were |
| R2824 |
T10200 |
T10201 |
det |
The,numbers |
| R2825 |
T10201 |
T10202 |
nsubj |
numbers,were |
| R2826 |
T10203 |
T10201 |
prep |
of,numbers |
| R2827 |
T10204 |
T10205 |
compound |
Sertoli,cells |
| R2828 |
T10205 |
T10203 |
pobj |
cells,of |
| R2829 |
T10206 |
T10202 |
neg |
not,were |
| R283 |
T1121 |
T1113 |
conj |
in,in |
| R2830 |
T10207 |
T10208 |
advmod |
significantly,different |
| R2831 |
T10208 |
T10202 |
acomp |
different,were |
| R2832 |
T10209 |
T10208 |
prep |
between,different |
| R2833 |
T10210 |
T10211 |
amod |
wild,type |
| R2834 |
T10211 |
T10213 |
nmod |
type,testes |
| R2835 |
T10212 |
T10211 |
punct |
-,type |
| R2836 |
T10213 |
T10209 |
pobj |
testes,between |
| R2837 |
T10214 |
T10211 |
cc |
and,type |
| R2838 |
T10215 |
T10211 |
conj |
mutant,type |
| R2839 |
T10216 |
T10202 |
punct |
", ",were |
| R284 |
T1122 |
T1123 |
amod |
other,vertebrates |
| R2840 |
T10217 |
T10202 |
cc |
and,were |
| R2841 |
T10218 |
T10219 |
nsubj |
we,observed |
| R2842 |
T10219 |
T10202 |
conj |
observed,were |
| R2843 |
T10220 |
T10221 |
det |
no,difference |
| R2844 |
T10221 |
T10219 |
dobj |
difference,observed |
| R2845 |
T10222 |
T10221 |
prep |
in,difference |
| R2846 |
T10223 |
T10224 |
amod |
somatic,apoptosis |
| R2847 |
T10224 |
T10222 |
pobj |
apoptosis,in |
| R2848 |
T10225 |
T10224 |
compound |
cell,apoptosis |
| R2849 |
T10226 |
T10221 |
prep |
in,difference |
| R285 |
T908 |
T906 |
pobj |
modification,with |
| R2850 |
T10227 |
T10226 |
pobj |
mutants,in |
| R2851 |
T10228 |
T10229 |
punct |
(,data |
| R2852 |
T10229 |
T10219 |
meta |
data,observed |
| R2853 |
T10230 |
T10229 |
amod |
unpublished,data |
| R2854 |
T10231 |
T10229 |
punct |
),data |
| R2855 |
T10232 |
T10219 |
punct |
.,observed |
| R2856 |
T10234 |
T10235 |
prep |
From,conclude |
| R2857 |
T10236 |
T10237 |
det |
these,results |
| R2858 |
T10237 |
T10234 |
pobj |
results,From |
| R2859 |
T10238 |
T10235 |
punct |
", ",conclude |
| R286 |
T1123 |
T1121 |
pobj |
vertebrates,in |
| R2860 |
T10239 |
T10235 |
nsubj |
we,conclude |
| R2861 |
T10240 |
T10241 |
mark |
that,causes |
| R2862 |
T10241 |
T10235 |
ccomp |
causes,conclude |
| R2863 |
T10242 |
T10241 |
nsubj |
loss,causes |
| R2864 |
T10243 |
T10242 |
prep |
of,loss |
| R2865 |
T10244 |
T10243 |
pobj |
Dmrt7,of |
| R2866 |
T10245 |
T10246 |
det |
a,block |
| R2867 |
T10246 |
T10241 |
dobj |
block,causes |
| R2868 |
T10247 |
T10246 |
prep |
in,block |
| R2869 |
T10248 |
T10249 |
amod |
meiotic,progression |
| R287 |
T1124 |
T1106 |
punct |
", ",shed |
| R2870 |
T10249 |
T10247 |
pobj |
progression,in |
| R2871 |
T10250 |
T10241 |
punct |
", ",causes |
| R2872 |
T10251 |
T10252 |
advmod |
mainly,in |
| R2873 |
T10252 |
T10241 |
prep |
in,causes |
| R2874 |
T10253 |
T10252 |
pobj |
pachynema,in |
| R2875 |
T10254 |
T10241 |
punct |
", ",causes |
| R2876 |
T10255 |
T10241 |
advcl |
leading,causes |
| R2877 |
T10256 |
T10255 |
prep |
to,leading |
| R2878 |
T10257 |
T10258 |
det |
the,elimination |
| R2879 |
T10258 |
T10256 |
pobj |
elimination,to |
| R288 |
T1125 |
T1106 |
nsubj |
Dmrt7,shed |
| R2880 |
T10259 |
T10258 |
punct |
", ",elimination |
| R2881 |
T10260 |
T10258 |
prep |
by,elimination |
| R2882 |
T10261 |
T10260 |
pobj |
apoptosis,by |
| R2883 |
T10262 |
T10258 |
punct |
", ",elimination |
| R2884 |
T10263 |
T10258 |
prep |
of,elimination |
| R2885 |
T10264 |
T10265 |
det |
the,cells |
| R2886 |
T10265 |
T10263 |
pobj |
cells,of |
| R2887 |
T10266 |
T10265 |
amod |
arrested,cells |
| R2888 |
T10267 |
T10235 |
punct |
.,conclude |
| R2889 |
T10945 |
T10946 |
compound |
Pachytene,Arrest |
| R289 |
T909 |
T904 |
punct |
", ",persists |
| R2890 |
T10947 |
T10946 |
prep |
of,Arrest |
| R2891 |
T10948 |
T10949 |
compound |
Dmrt7,Mutant |
| R2892 |
T10949 |
T10950 |
compound |
Mutant,Cells |
| R2893 |
T10950 |
T10947 |
pobj |
Cells,of |
| R2894 |
T10951 |
T10950 |
compound |
Germ,Cells |
| R2895 |
T10953 |
T10954 |
aux |
To,define |
| R2896 |
T10954 |
T10956 |
advcl |
define,used |
| R2897 |
T10955 |
T10954 |
advmod |
better,define |
| R2898 |
T10957 |
T10958 |
det |
the,stage |
| R2899 |
T10958 |
T10954 |
dobj |
stage,define |
| R29 |
T829 |
T828 |
prep |
for,Required |
| R290 |
T910 |
T904 |
prep |
through,persists |
| R2900 |
T10959 |
T10958 |
amod |
spermatogenic,stage |
| R2901 |
T10960 |
T10961 |
prep |
at,arrest |
| R2902 |
T10961 |
T10958 |
relcl |
arrest,stage |
| R2903 |
T10962 |
T10960 |
pobj |
which,at |
| R2904 |
T10963 |
T10964 |
nmod |
Dmrt7,cells |
| R2905 |
T10964 |
T10961 |
nsubj |
cells,arrest |
| R2906 |
T10965 |
T10963 |
punct |
−,Dmrt7 |
| R2907 |
T10966 |
T10963 |
punct |
/,Dmrt7 |
| R2908 |
T10967 |
T10963 |
punct |
−,Dmrt7 |
| R2909 |
T10968 |
T10964 |
amod |
male,cells |
| R291 |
T1126 |
T1106 |
aux |
may,shed |
| R2910 |
T10969 |
T10964 |
compound |
germ,cells |
| R2911 |
T10970 |
T10961 |
cc |
and,arrest |
| R2912 |
T10971 |
T10961 |
conj |
die,arrest |
| R2913 |
T10972 |
T10956 |
punct |
", ",used |
| R2914 |
T10973 |
T10956 |
nsubj |
we,used |
| R2915 |
T10974 |
T10956 |
dobj |
antibodies,used |
| R2916 |
T10975 |
T10974 |
prep |
against,antibodies |
| R2917 |
T10976 |
T10977 |
amod |
several,markers |
| R2918 |
T10977 |
T10975 |
pobj |
markers,against |
| R2919 |
T10978 |
T10979 |
npadvmod |
stage,specific |
| R292 |
T1127 |
T1106 |
dobj |
light,shed |
| R2920 |
T10979 |
T10977 |
amod |
specific,markers |
| R2921 |
T10980 |
T10979 |
punct |
-,specific |
| R2922 |
T10981 |
T10982 |
compound |
germ,cell |
| R2923 |
T10982 |
T10977 |
compound |
cell,markers |
| R2924 |
T10983 |
T10956 |
punct |
.,used |
| R2925 |
T10985 |
T10986 |
nsubjpass |
TRA98,expressed |
| R2926 |
T10987 |
T10986 |
auxpass |
is,expressed |
| R2927 |
T10988 |
T10986 |
prep |
in,expressed |
| R2928 |
T10989 |
T10988 |
pobj |
PGCs,in |
| R2929 |
T10990 |
T10989 |
cc |
and,PGCs |
| R293 |
T911 |
T910 |
pobj |
meiosis,through |
| R2930 |
T10991 |
T10989 |
conj |
spermatogonia,PGCs |
| R2931 |
T10992 |
T10993 |
punct |
[,43 |
| R2932 |
T10993 |
T10986 |
parataxis |
43,expressed |
| R2933 |
T10994 |
T10993 |
punct |
],43 |
| R2934 |
T10995 |
T10986 |
punct |
.,expressed |
| R2935 |
T10997 |
T10998 |
prep |
In,form |
| R2936 |
T10998 |
T11012 |
ccomp |
form,were |
| R2937 |
T10999 |
T11000 |
det |
the,testis |
| R2938 |
T11000 |
T10997 |
pobj |
testis,In |
| R2939 |
T11001 |
T11002 |
amod |
wild,type |
| R294 |
T1128 |
T1106 |
prep |
on,shed |
| R2940 |
T11002 |
T11000 |
nmod |
type,testis |
| R2941 |
T11003 |
T11002 |
punct |
-,type |
| R2942 |
T11004 |
T11000 |
amod |
adult,testis |
| R2943 |
T11005 |
T10998 |
punct |
", ",form |
| R2944 |
T11006 |
T11007 |
advmod |
strongly,staining |
| R2945 |
T11007 |
T11008 |
amod |
staining,cells |
| R2946 |
T11008 |
T10998 |
nsubj |
cells,form |
| R2947 |
T11009 |
T11010 |
npadvmod |
TRA98,positive |
| R2948 |
T11010 |
T11008 |
amod |
positive,cells |
| R2949 |
T11011 |
T11010 |
punct |
-,positive |
| R295 |
T1129 |
T1128 |
pobj |
evolution,on |
| R2950 |
T11013 |
T11014 |
det |
a,layer |
| R2951 |
T11014 |
T10998 |
dobj |
layer,form |
| R2952 |
T11015 |
T11016 |
nummod |
one,cell |
| R2953 |
T11016 |
T11017 |
npadvmod |
cell,deep |
| R2954 |
T11017 |
T11014 |
amod |
deep,layer |
| R2955 |
T11018 |
T11012 |
punct |
;,were |
| R2956 |
T11019 |
T11012 |
advmod |
however,were |
| R2957 |
T11020 |
T11012 |
punct |
", ",were |
| R2958 |
T11021 |
T11012 |
prep |
in,were |
| R2959 |
T11022 |
T11023 |
det |
the,TRA98 |
| R296 |
T1130 |
T1129 |
prep |
of,evolution |
| R2960 |
T11023 |
T11021 |
pobj |
TRA98,in |
| R2961 |
T11024 |
T11023 |
compound |
mutant,TRA98 |
| R2962 |
T11025 |
T11012 |
punct |
", ",were |
| R2963 |
T11026 |
T11027 |
advmod |
strongly,positive |
| R2964 |
T11027 |
T11028 |
amod |
positive,cells |
| R2965 |
T11028 |
T11012 |
nsubj |
cells,were |
| R2966 |
T11029 |
T11030 |
advmod |
abnormally,organized |
| R2967 |
T11030 |
T11012 |
acomp |
organized,were |
| R2968 |
T11031 |
T11012 |
punct |
", ",were |
| R2969 |
T11032 |
T11012 |
cc |
and,were |
| R297 |
T912 |
T904 |
punct |
.,persists |
| R2970 |
T11033 |
T11034 |
det |
some,tubules |
| R2971 |
T11034 |
T11035 |
nsubj |
tubules,had |
| R2972 |
T11035 |
T11012 |
conj |
had,were |
| R2973 |
T11036 |
T11037 |
det |
a,layer |
| R2974 |
T11037 |
T11035 |
dobj |
layer,had |
| R2975 |
T11038 |
T11039 |
amod |
several,cells |
| R2976 |
T11039 |
T11040 |
npadvmod |
cells,deep |
| R2977 |
T11040 |
T11037 |
amod |
deep,layer |
| R2978 |
T11041 |
T11042 |
punct |
(,3A |
| R2979 |
T11042 |
T11012 |
parataxis |
3A,were |
| R298 |
T1131 |
T1130 |
pobj |
meiosis,of |
| R2980 |
T11043 |
T11042 |
compound |
Figure,3A |
| R2981 |
T11044 |
T11042 |
punct |
),3A |
| R2982 |
T11045 |
T11012 |
punct |
.,were |
| R2983 |
T11047 |
T11048 |
det |
The,antibody |
| R2984 |
T11048 |
T11050 |
nsubj |
antibody,recognizes |
| R2985 |
T11049 |
T11048 |
compound |
BC7,antibody |
| R2986 |
T11051 |
T11050 |
dobj |
spermatocytes,recognizes |
| R2987 |
T11052 |
T11050 |
prep |
in,recognizes |
| R2988 |
T11053 |
T11054 |
det |
the,leptotene |
| R2989 |
T11054 |
T11052 |
pobj |
leptotene,in |
| R299 |
T814 |
T815 |
det |
A,Homolog |
| R2990 |
T11055 |
T11050 |
prep |
to,recognizes |
| R2991 |
T11056 |
T11057 |
amod |
early,pachytene |
| R2992 |
T11057 |
T11059 |
compound |
pachytene,stages |
| R2993 |
T11058 |
T11057 |
punct |
-,pachytene |
| R2994 |
T11059 |
T11055 |
pobj |
stages,to |
| R2995 |
T11060 |
T11061 |
punct |
[,44 |
| R2996 |
T11061 |
T11050 |
parataxis |
44,recognizes |
| R2997 |
T11062 |
T11061 |
punct |
],44 |
| R2998 |
T11063 |
T11050 |
punct |
.,recognizes |
| R2999 |
T11065 |
T11066 |
compound |
Dmrt7,mutant |
| R30 |
T926 |
T924 |
amod |
specific,protein |
| R300 |
T1132 |
T1130 |
cc |
and,of |
| R3000 |
T11066 |
T11067 |
compound |
mutant,testes |
| R3001 |
T11067 |
T11068 |
nsubj |
testes,had |
| R3002 |
T11069 |
T11070 |
npadvmod |
BC7,positive |
| R3003 |
T11070 |
T11072 |
amod |
positive,cells |
| R3004 |
T11071 |
T11070 |
punct |
-,positive |
| R3005 |
T11072 |
T11068 |
dobj |
cells,had |
| R3006 |
T11073 |
T11072 |
prep |
in,cells |
| R3007 |
T11074 |
T11075 |
advmod |
approximately,normal |
| R3008 |
T11075 |
T11076 |
amod |
normal,numbers |
| R3009 |
T11076 |
T11073 |
pobj |
numbers,in |
| R301 |
T1133 |
T1130 |
conj |
of,of |
| R3010 |
T11077 |
T11073 |
punct |
", ",in |
| R3011 |
T11078 |
T11073 |
cc |
but,in |
| R3012 |
T11079 |
T11080 |
advmod |
again,organized |
| R3013 |
T11080 |
T11073 |
conj |
organized,in |
| R3014 |
T11081 |
T11080 |
advmod |
abnormally,organized |
| R3015 |
T11082 |
T11068 |
punct |
", ",had |
| R3016 |
T11083 |
T11068 |
prep |
with,had |
| R3017 |
T11084 |
T11085 |
amod |
many,cells |
| R3018 |
T11085 |
T11083 |
pobj |
cells,with |
| R3019 |
T11086 |
T11085 |
amod |
positive,cells |
| R302 |
T1134 |
T1135 |
compound |
sex,chromatin |
| R3020 |
T11087 |
T11085 |
prep |
in,cells |
| R3021 |
T11088 |
T11089 |
det |
the,center |
| R3022 |
T11089 |
T11087 |
pobj |
center,in |
| R3023 |
T11090 |
T11091 |
advmod |
rather,than |
| R3024 |
T11091 |
T11089 |
cc |
than,center |
| R3025 |
T11092 |
T11093 |
det |
the,periphery |
| R3026 |
T11093 |
T11089 |
conj |
periphery,center |
| R3027 |
T11094 |
T11089 |
prep |
of,center |
| R3028 |
T11095 |
T11096 |
det |
the,tubules |
| R3029 |
T11096 |
T11094 |
pobj |
tubules,of |
| R303 |
T1135 |
T1133 |
pobj |
chromatin,of |
| R3030 |
T11097 |
T11098 |
punct |
(,3B |
| R3031 |
T11098 |
T11068 |
parataxis |
3B,had |
| R3032 |
T11099 |
T11098 |
compound |
Figure,3B |
| R3033 |
T11100 |
T11098 |
punct |
),3B |
| R3034 |
T11101 |
T11068 |
punct |
.,had |
| R3035 |
T11103 |
T11104 |
det |
The,antibody |
| R3036 |
T11104 |
T11106 |
nsubj |
antibody,recognizes |
| R3037 |
T11105 |
T11104 |
compound |
TRA369,antibody |
| R3038 |
T11107 |
T11108 |
det |
a,protein |
| R3039 |
T11108 |
T11106 |
dobj |
protein,recognizes |
| R304 |
T1136 |
T1106 |
punct |
.,shed |
| R3040 |
T11109 |
T11108 |
compound |
calmegin,protein |
| R3041 |
T11110 |
T11108 |
acl |
expressed,protein |
| R3042 |
T11111 |
T11110 |
prep |
in,expressed |
| R3043 |
T11112 |
T11113 |
compound |
pachytene,spermatocytes |
| R3044 |
T11113 |
T11111 |
pobj |
spermatocytes,in |
| R3045 |
T11114 |
T11110 |
prep |
through,expressed |
| R3046 |
T11115 |
T11116 |
amod |
elongated,spermatids |
| R3047 |
T11116 |
T11114 |
pobj |
spermatids,through |
| R3048 |
T11117 |
T11118 |
punct |
[,45 |
| R3049 |
T11118 |
T11106 |
parataxis |
45,recognizes |
| R305 |
T815 |
T821 |
nsubj |
Homolog,Associates |
| R3050 |
T11119 |
T11118 |
punct |
],45 |
| R3051 |
T11120 |
T11106 |
punct |
.,recognizes |
| R3052 |
T11122 |
T11123 |
prep |
In,were |
| R3053 |
T11124 |
T11122 |
pobj |
contrast,In |
| R3054 |
T11125 |
T11124 |
prep |
to,contrast |
| R3055 |
T11126 |
T11127 |
det |
the,stages |
| R3056 |
T11127 |
T11125 |
pobj |
stages,to |
| R3057 |
T11128 |
T11127 |
amod |
earlier,stages |
| R3058 |
T11129 |
T11123 |
punct |
", ",were |
| R3059 |
T11130 |
T11131 |
advmod |
far,fewer |
| R3060 |
T11131 |
T11132 |
amod |
fewer,cells |
| R3061 |
T11132 |
T11123 |
nsubj |
cells,were |
| R3062 |
T11133 |
T11134 |
npadvmod |
TRA369,positive |
| R3063 |
T11134 |
T11132 |
amod |
positive,cells |
| R3064 |
T11135 |
T11134 |
punct |
-,positive |
| R3065 |
T11136 |
T11123 |
acomp |
present,were |
| R3066 |
T11137 |
T11136 |
prep |
in,present |
| R3067 |
T11138 |
T11139 |
compound |
mutant,testes |
| R3068 |
T11139 |
T11137 |
pobj |
testes,in |
| R3069 |
T11140 |
T11123 |
advcl |
relative,were |
| R3070 |
T11141 |
T11140 |
prep |
to,relative |
| R3071 |
T11142 |
T11143 |
amod |
wild,type |
| R3072 |
T11143 |
T11141 |
pobj |
type,to |
| R3073 |
T11144 |
T11143 |
punct |
-,type |
| R3074 |
T11145 |
T11146 |
punct |
(,3C |
| R3075 |
T11146 |
T11123 |
parataxis |
3C,were |
| R3076 |
T11147 |
T11146 |
compound |
Figure,3C |
| R3077 |
T11148 |
T11146 |
punct |
),3C |
| R3078 |
T11149 |
T11123 |
punct |
.,were |
| R3079 |
T11151 |
T11152 |
nsubj |
We,quantitated |
| R3080 |
T11153 |
T11152 |
advmod |
also,quantitated |
| R3081 |
T11154 |
T11155 |
det |
the,number |
| R3082 |
T11155 |
T11152 |
dobj |
number,quantitated |
| R3083 |
T11156 |
T11155 |
prep |
of,number |
| R3084 |
T11157 |
T11156 |
pobj |
cells,of |
| R3085 |
T11158 |
T11155 |
prep |
at,number |
| R3086 |
T11159 |
T11160 |
det |
each,stage |
| R3087 |
T11160 |
T11158 |
pobj |
stage,at |
| R3088 |
T11161 |
T11160 |
amod |
meiotic,stage |
| R3089 |
T11162 |
T11152 |
advcl |
using,quantitated |
| R3090 |
T11163 |
T11164 |
compound |
spermatocyte,spreads |
| R3091 |
T11164 |
T11162 |
dobj |
spreads,using |
| R3092 |
T11165 |
T11152 |
punct |
", ",quantitated |
| R3093 |
T11166 |
T11152 |
advcl |
assaying,quantitated |
| R3094 |
T11167 |
T11168 |
npadvmod |
chromosome,pairing |
| R3095 |
T11168 |
T11170 |
amod |
pairing,status |
| R3096 |
T11169 |
T11168 |
punct |
-,pairing |
| R3097 |
T11170 |
T11166 |
dobj |
status,assaying |
| R3098 |
T11171 |
T11166 |
prep |
by,assaying |
| R3099 |
T11172 |
T11171 |
pcomp |
staining,by |
| R31 |
T927 |
T926 |
punct |
-,specific |
| R3100 |
T11173 |
T11172 |
prep |
for,staining |
| R3101 |
T11174 |
T11173 |
pobj |
SYCP3,for |
| R3102 |
T11175 |
T11174 |
punct |
", ",SYCP3 |
| R3103 |
T11176 |
T11177 |
det |
a,component |
| R3104 |
T11177 |
T11174 |
appos |
component,SYCP3 |
| R3105 |
T11178 |
T11177 |
prep |
of,component |
| R3106 |
T11179 |
T11180 |
det |
the,complex |
| R3107 |
T11180 |
T11178 |
pobj |
complex,of |
| R3108 |
T11181 |
T11180 |
amod |
synaptonemal,complex |
| R3109 |
T11182 |
T11183 |
punct |
(,Figure |
| R3110 |
T11183 |
T11152 |
parataxis |
Figure,quantitated |
| R3111 |
T11184 |
T11183 |
nummod |
4,Figure |
| R3112 |
T11185 |
T11183 |
punct |
),Figure |
| R3113 |
T11186 |
T11152 |
punct |
.,quantitated |
| R3114 |
T11188 |
T11189 |
nsubj |
We,found |
| R3115 |
T11190 |
T11191 |
mark |
that,accumulate |
| R3116 |
T11191 |
T11189 |
ccomp |
accumulate,found |
| R3117 |
T11192 |
T11193 |
compound |
Dmrt7,mutants |
| R3118 |
T11193 |
T11191 |
nsubj |
mutants,accumulate |
| R3119 |
T11194 |
T11195 |
compound |
pachytene,cells |
| R3120 |
T11195 |
T11191 |
dobj |
cells,accumulate |
| R3121 |
T11196 |
T11191 |
cc |
but,accumulate |
| R3122 |
T11197 |
T11191 |
conj |
have,accumulate |
| R3123 |
T11198 |
T11199 |
advmod |
greatly,reduced |
| R3124 |
T11199 |
T11200 |
amod |
reduced,numbers |
| R3125 |
T11200 |
T11197 |
dobj |
numbers,have |
| R3126 |
T11201 |
T11200 |
prep |
of,numbers |
| R3127 |
T11202 |
T11201 |
pobj |
cells,of |
| R3128 |
T11203 |
T11197 |
prep |
in,have |
| R3129 |
T11204 |
T11205 |
amod |
late,pachynema |
| R313 |
T4035 |
T4033 |
pobj |
sexes,between |
| R3130 |
T11205 |
T11203 |
pobj |
pachynema,in |
| R3131 |
T11206 |
T11205 |
punct |
-,pachynema |
| R3132 |
T11207 |
T11203 |
cc |
and,in |
| R3133 |
T11208 |
T11203 |
conj |
beyond,in |
| R3134 |
T11209 |
T11189 |
punct |
.,found |
| R3135 |
T11211 |
T11212 |
advmod |
Together,confirm |
| R3136 |
T11213 |
T11212 |
punct |
", ",confirm |
| R3137 |
T11214 |
T11215 |
det |
these,results |
| R3138 |
T11215 |
T11212 |
nsubj |
results,confirm |
| R3139 |
T11216 |
T11217 |
mark |
that,occurs |
| R314 |
T3987 |
T3988 |
amod |
Sexual,differentiation |
| R3140 |
T11217 |
T11212 |
ccomp |
occurs,confirm |
| R3141 |
T11218 |
T11219 |
det |
the,arrest |
| R3142 |
T11219 |
T11217 |
nsubj |
arrest,occurs |
| R3143 |
T11220 |
T11219 |
amod |
meiotic,arrest |
| R3144 |
T11221 |
T11219 |
prep |
in,arrest |
| R3145 |
T11222 |
T11223 |
compound |
Dmrt7,mutants |
| R3146 |
T11223 |
T11221 |
pobj |
mutants,in |
| R3147 |
T11224 |
T11217 |
advmod |
primarily,occurs |
| R3148 |
T11225 |
T11217 |
prep |
during,occurs |
| R3149 |
T11226 |
T11225 |
pobj |
pachynema,during |
| R315 |
T3988 |
T3989 |
nsubj |
differentiation,generates |
| R3150 |
T11227 |
T11217 |
cc |
and,occurs |
| R3151 |
T11228 |
T11217 |
conj |
results,occurs |
| R3152 |
T11229 |
T11228 |
prep |
in,results |
| R3153 |
T11230 |
T11231 |
amod |
efficient,elimination |
| R3154 |
T11231 |
T11229 |
pobj |
elimination,in |
| R3155 |
T11232 |
T11231 |
prep |
of,elimination |
| R3156 |
T11233 |
T11234 |
amod |
arrested,cells |
| R3157 |
T11234 |
T11232 |
pobj |
cells,of |
| R3158 |
T11235 |
T11212 |
punct |
.,confirm |
| R3159 |
T11774 |
T11775 |
amod |
Normal,Prophase |
| R316 |
T3990 |
T3991 |
amod |
anatomical,dimorphisms |
| R3160 |
T11776 |
T11775 |
amod |
Meiotic,Prophase |
| R3161 |
T11777 |
T11775 |
prep |
in,Prophase |
| R3162 |
T11778 |
T11779 |
compound |
Dmrt7,Mutant |
| R3163 |
T11779 |
T11780 |
compound |
Mutant,Cells |
| R3164 |
T11780 |
T11777 |
pobj |
Cells,in |
| R3165 |
T11781 |
T11780 |
compound |
Germ,Cells |
| R3166 |
T11783 |
T11784 |
nsubj |
Defects,trigger |
| R3167 |
T11785 |
T11783 |
prep |
in,Defects |
| R3168 |
T11786 |
T11787 |
compound |
chromosome,pairing |
| R3169 |
T11787 |
T11785 |
pobj |
pairing,in |
| R317 |
T4036 |
T4032 |
prep |
in,differ |
| R3170 |
T11788 |
T11787 |
punct |
", ",pairing |
| R3171 |
T11789 |
T11787 |
conj |
synapsis,pairing |
| R3172 |
T11790 |
T11789 |
punct |
", ",synapsis |
| R3173 |
T11791 |
T11789 |
cc |
or,synapsis |
| R3174 |
T11792 |
T11789 |
conj |
recombination,synapsis |
| R3175 |
T11793 |
T11784 |
aux |
can,trigger |
| R3176 |
T11794 |
T11795 |
compound |
pachytene,arrest |
| R3177 |
T11795 |
T11784 |
dobj |
arrest,trigger |
| R3178 |
T11796 |
T11795 |
cc |
and,arrest |
| R3179 |
T11797 |
T11795 |
conj |
apoptosis,arrest |
| R318 |
T3991 |
T3989 |
dobj |
dimorphisms,generates |
| R3180 |
T11798 |
T11799 |
punct |
[,46 |
| R3181 |
T11799 |
T11784 |
parataxis |
46,trigger |
| R3182 |
T11800 |
T11799 |
punct |
],46 |
| R3183 |
T11801 |
T11784 |
punct |
.,trigger |
| R3184 |
T11803 |
T11804 |
nsubj |
We,examined |
| R3185 |
T11805 |
T11804 |
advmod |
therefore,examined |
| R3186 |
T11806 |
T11807 |
det |
these,events |
| R3187 |
T11807 |
T11804 |
dobj |
events,examined |
| R3188 |
T11808 |
T11804 |
prep |
in,examined |
| R3189 |
T11809 |
T11810 |
compound |
Dmrt7,mutant |
| R319 |
T3992 |
T3990 |
punct |
", ",anatomical |
| R3190 |
T11810 |
T11811 |
compound |
mutant,testes |
| R3191 |
T11811 |
T11808 |
pobj |
testes,in |
| R3192 |
T11812 |
T11804 |
punct |
.,examined |
| R3193 |
T11814 |
T11815 |
aux |
To,assess |
| R3194 |
T11815 |
T11816 |
advcl |
assess,used |
| R3195 |
T11817 |
T11818 |
compound |
homolog,synapsis |
| R3196 |
T11818 |
T11815 |
dobj |
synapsis,assess |
| R3197 |
T11819 |
T11816 |
punct |
", ",used |
| R3198 |
T11820 |
T11816 |
nsubj |
we,used |
| R3199 |
T11821 |
T11816 |
dobj |
antibodies,used |
| R32 |
T928 |
T924 |
acl |
related,protein |
| R320 |
T3993 |
T3990 |
conj |
physiological,anatomical |
| R3200 |
T11822 |
T11821 |
prep |
to,antibodies |
| R3201 |
T11823 |
T11822 |
pobj |
SYCP1,to |
| R3202 |
T11824 |
T11823 |
punct |
", ",SYCP1 |
| R3203 |
T11825 |
T11826 |
det |
a,component |
| R3204 |
T11826 |
T11823 |
appos |
component,SYCP1 |
| R3205 |
T11827 |
T11826 |
amod |
synaptonemal,component |
| R3206 |
T11828 |
T11826 |
compound |
complex,component |
| R3207 |
T11829 |
T11826 |
compound |
transverse,component |
| R3208 |
T11830 |
T11826 |
compound |
element,component |
| R3209 |
T11831 |
T11821 |
punct |
", ",antibodies |
| R321 |
T4037 |
T4036 |
pobj |
size,in |
| R3210 |
T11832 |
T11821 |
cc |
and,antibodies |
| R3211 |
T11833 |
T11821 |
conj |
SYCP3,antibodies |
| R3212 |
T11834 |
T11833 |
punct |
", ",SYCP3 |
| R3213 |
T11835 |
T11836 |
det |
a,component |
| R3214 |
T11836 |
T11833 |
appos |
component,SYCP3 |
| R3215 |
T11837 |
T11836 |
prep |
of,component |
| R3216 |
T11838 |
T11839 |
det |
the,element |
| R3217 |
T11839 |
T11837 |
pobj |
element,of |
| R3218 |
T11840 |
T11839 |
amod |
axial,element |
| R3219 |
T11841 |
T11836 |
punct |
", ",component |
| R322 |
T3994 |
T3993 |
punct |
", ",physiological |
| R3220 |
T11842 |
T11843 |
dep |
which,remains |
| R3221 |
T11843 |
T11836 |
relcl |
remains,component |
| R3222 |
T11844 |
T11843 |
prep |
on,remains |
| R3223 |
T11845 |
T11846 |
det |
the,axes |
| R3224 |
T11846 |
T11844 |
pobj |
axes,on |
| R3225 |
T11847 |
T11846 |
amod |
desynapsed,axes |
| R3226 |
T11848 |
T11843 |
prep |
during,remains |
| R3227 |
T11849 |
T11848 |
pobj |
diplonema,during |
| R3228 |
T11850 |
T11851 |
punct |
[,48 |
| R3229 |
T11851 |
T11816 |
parataxis |
48,used |
| R323 |
T3995 |
T3993 |
cc |
and,physiological |
| R3230 |
T11852 |
T11851 |
nummod |
47,48 |
| R3231 |
T11853 |
T11851 |
punct |
",",48 |
| R3232 |
T11854 |
T11851 |
punct |
],48 |
| R3233 |
T11855 |
T11816 |
punct |
.,used |
| R3234 |
T11857 |
T11858 |
nsubj |
Formation,was |
| R3235 |
T11859 |
T11857 |
prep |
of,Formation |
| R3236 |
T11860 |
T11861 |
amod |
synaptonemal,complexes |
| R3237 |
T11861 |
T11859 |
pobj |
complexes,of |
| R3238 |
T11862 |
T11857 |
prep |
in,Formation |
| R3239 |
T11863 |
T11864 |
det |
the,mutant |
| R324 |
T4038 |
T4037 |
cc |
and,size |
| R3240 |
T11864 |
T11862 |
pobj |
mutant,in |
| R3241 |
T11865 |
T11858 |
acomp |
indistinguishable,was |
| R3242 |
T11866 |
T11865 |
prep |
from,indistinguishable |
| R3243 |
T11867 |
T11866 |
pobj |
that,from |
| R3244 |
T11868 |
T11867 |
prep |
in,that |
| R3245 |
T11869 |
T11870 |
amod |
wild,type |
| R3246 |
T11870 |
T11868 |
pobj |
type,in |
| R3247 |
T11871 |
T11870 |
punct |
-,type |
| R3248 |
T11872 |
T11858 |
punct |
", ",was |
| R3249 |
T11873 |
T11874 |
mark |
as,indicated |
| R325 |
T4039 |
T4037 |
conj |
morphology,size |
| R3250 |
T11874 |
T11858 |
advcl |
indicated,was |
| R3251 |
T11875 |
T11874 |
prep |
by,indicated |
| R3252 |
T11876 |
T11877 |
det |
the,accumulation |
| R3253 |
T11877 |
T11875 |
pobj |
accumulation,by |
| R3254 |
T11878 |
T11877 |
amod |
proper,accumulation |
| R3255 |
T11879 |
T11877 |
prep |
of,accumulation |
| R3256 |
T11880 |
T11879 |
pobj |
SYCP1,of |
| R3257 |
T11881 |
T11882 |
punct |
(,data |
| R3258 |
T11882 |
T11880 |
parataxis |
data,SYCP1 |
| R3259 |
T11883 |
T11882 |
amod |
unpublished,data |
| R326 |
T3996 |
T3993 |
conj |
behavioral,physiological |
| R3260 |
T11884 |
T11882 |
punct |
),data |
| R3261 |
T11885 |
T11880 |
cc |
and,SYCP1 |
| R3262 |
T11886 |
T11880 |
conj |
SYCP3,SYCP1 |
| R3263 |
T11887 |
T11888 |
punct |
(,5A |
| R3264 |
T11888 |
T11858 |
parataxis |
5A,was |
| R3265 |
T11889 |
T11888 |
compound |
Figure,5A |
| R3266 |
T11890 |
T11888 |
punct |
),5A |
| R3267 |
T11891 |
T11858 |
punct |
.,was |
| R3268 |
T11893 |
T11894 |
advmod |
Likewise,showed |
| R3269 |
T11895 |
T11894 |
punct |
", ",showed |
| R327 |
T4040 |
T4032 |
punct |
", ",differ |
| R3270 |
T11896 |
T11897 |
det |
the,spermatocytes |
| R3271 |
T11897 |
T11894 |
nsubj |
spermatocytes,showed |
| R3272 |
T11898 |
T11899 |
compound |
Dmrt7,mutant |
| R3273 |
T11899 |
T11897 |
compound |
mutant,spermatocytes |
| R3274 |
T11900 |
T11897 |
compound |
zygotene,spermatocytes |
| R3275 |
T11901 |
T11902 |
amod |
normal,accumulation |
| R3276 |
T11902 |
T11894 |
dobj |
accumulation,showed |
| R3277 |
T11903 |
T11902 |
prep |
of,accumulation |
| R3278 |
T11904 |
T11905 |
det |
the,RAD51 |
| R3279 |
T11905 |
T11903 |
pobj |
RAD51,of |
| R328 |
T3997 |
T3998 |
dep |
that,are |
| R3280 |
T11906 |
T11905 |
amod |
early,RAD51 |
| R3281 |
T11907 |
T11905 |
compound |
recombination,RAD51 |
| R3282 |
T11908 |
T11909 |
compound |
repair,marker |
| R3283 |
T11909 |
T11905 |
compound |
marker,RAD51 |
| R3284 |
T11910 |
T11894 |
punct |
", ",showed |
| R3285 |
T11911 |
T11894 |
advcl |
suggesting,showed |
| R3286 |
T11912 |
T11913 |
mark |
that,affected |
| R3287 |
T11913 |
T11911 |
ccomp |
affected,suggesting |
| R3288 |
T11914 |
T11915 |
amod |
early,recombination |
| R3289 |
T11915 |
T11913 |
nsubjpass |
recombination,affected |
| R329 |
T3998 |
T3991 |
relcl |
are,dimorphisms |
| R3290 |
T11916 |
T11915 |
amod |
meiotic,recombination |
| R3291 |
T11917 |
T11913 |
auxpass |
is,affected |
| R3292 |
T11918 |
T11913 |
neg |
not,affected |
| R3293 |
T11919 |
T11913 |
advmod |
significantly,affected |
| R3294 |
T11920 |
T11921 |
punct |
(,5B |
| R3295 |
T11921 |
T11894 |
parataxis |
5B,showed |
| R3296 |
T11922 |
T11921 |
compound |
Figure,5B |
| R3297 |
T11923 |
T11921 |
punct |
),5B |
| R3298 |
T11924 |
T11894 |
punct |
.,showed |
| R3299 |
T11926 |
T11927 |
compound |
Dmrt7,mutant |
| R33 |
T929 |
T928 |
prep |
to,related |
| R330 |
T4041 |
T4042 |
advmod |
sometimes,so |
| R3300 |
T11927 |
T11928 |
compound |
mutant,spermatocytes |
| R3301 |
T11928 |
T11929 |
nsubj |
spermatocytes,exhibited |
| R3302 |
T11930 |
T11931 |
det |
the,decline |
| R3303 |
T11931 |
T11929 |
dobj |
decline,exhibited |
| R3304 |
T11932 |
T11931 |
amod |
expected,decline |
| R3305 |
T11933 |
T11931 |
prep |
in,decline |
| R3306 |
T11934 |
T11935 |
det |
the,presence |
| R3307 |
T11935 |
T11933 |
pobj |
presence,in |
| R3308 |
T11936 |
T11935 |
prep |
of,presence |
| R3309 |
T11937 |
T11938 |
compound |
RAD51,foci |
| R331 |
T3999 |
T3998 |
acomp |
essential,are |
| R3310 |
T11938 |
T11936 |
pobj |
foci,of |
| R3311 |
T11939 |
T11931 |
acl |
associated,decline |
| R3312 |
T11940 |
T11939 |
prep |
with,associated |
| R3313 |
T11941 |
T11942 |
det |
the,complexes |
| R3314 |
T11942 |
T11940 |
pobj |
complexes,with |
| R3315 |
T11943 |
T11942 |
amod |
autosomal,complexes |
| R3316 |
T11944 |
T11942 |
amod |
synaptonemal,complexes |
| R3317 |
T11945 |
T11946 |
punct |
(,data |
| R3318 |
T11946 |
T11929 |
parataxis |
data,exhibited |
| R3319 |
T11947 |
T11948 |
compound |
Figure,5B |
| R332 |
T4000 |
T3999 |
prep |
for,essential |
| R3320 |
T11948 |
T11946 |
dep |
5B,data |
| R3321 |
T11949 |
T11946 |
punct |
;,data |
| R3322 |
T11950 |
T11946 |
amod |
unpublished,data |
| R3323 |
T11951 |
T11946 |
punct |
),data |
| R3324 |
T11952 |
T11953 |
punct |
[,49 |
| R3325 |
T11953 |
T11929 |
parataxis |
49,exhibited |
| R3326 |
T11954 |
T11953 |
punct |
],49 |
| R3327 |
T11955 |
T11929 |
punct |
.,exhibited |
| R3328 |
T11957 |
T11958 |
det |
The,cells |
| R3329 |
T11958 |
T11961 |
nsubj |
cells,underwent |
| R333 |
T4001 |
T4002 |
amod |
sexual,reproduction |
| R3330 |
T11959 |
T11958 |
amod |
few,cells |
| R3331 |
T11960 |
T11958 |
amod |
surviving,cells |
| R3332 |
T11962 |
T11963 |
dep |
that,progressed |
| R3333 |
T11963 |
T11958 |
relcl |
progressed,cells |
| R3334 |
T11964 |
T11963 |
prep |
beyond,progressed |
| R3335 |
T11965 |
T11964 |
pobj |
pachynema,beyond |
| R3336 |
T11966 |
T11961 |
advmod |
also,underwent |
| R3337 |
T11967 |
T11968 |
advmod |
apparently,normal |
| R3338 |
T11968 |
T11969 |
amod |
normal,desynapsis |
| R3339 |
T11969 |
T11961 |
dobj |
desynapsis,underwent |
| R334 |
T4042 |
T4032 |
advmod |
so,differ |
| R3340 |
T11970 |
T11961 |
prep |
during,underwent |
| R3341 |
T11971 |
T11970 |
pobj |
diplonema,during |
| R3342 |
T11972 |
T11973 |
punct |
(,5A |
| R3343 |
T11973 |
T11961 |
parataxis |
5A,underwent |
| R3344 |
T11974 |
T11973 |
compound |
Figure,5A |
| R3345 |
T11975 |
T11973 |
punct |
),5A |
| R3346 |
T11976 |
T11961 |
punct |
.,underwent |
| R3347 |
T11978 |
T11979 |
prep |
From,conclude |
| R3348 |
T11980 |
T11981 |
det |
these,results |
| R3349 |
T11981 |
T11978 |
pobj |
results,From |
| R335 |
T4002 |
T4000 |
pobj |
reproduction,for |
| R3350 |
T11982 |
T11979 |
punct |
", ",conclude |
| R3351 |
T11983 |
T11979 |
nsubj |
we,conclude |
| R3352 |
T11984 |
T11985 |
mark |
that,are |
| R3353 |
T11985 |
T11979 |
ccomp |
are,conclude |
| R3354 |
T11986 |
T11987 |
amod |
chromosomal,pairing |
| R3355 |
T11987 |
T11985 |
nsubj |
pairing,are |
| R3356 |
T11988 |
T11987 |
punct |
", ",pairing |
| R3357 |
T11989 |
T11987 |
conj |
synapsis,pairing |
| R3358 |
T11990 |
T11989 |
punct |
", ",synapsis |
| R3359 |
T11991 |
T11989 |
conj |
recombination,synapsis |
| R336 |
T4003 |
T3989 |
punct |
.,generates |
| R3360 |
T11992 |
T11991 |
punct |
", ",recombination |
| R3361 |
T11993 |
T11991 |
cc |
and,recombination |
| R3362 |
T11994 |
T11991 |
conj |
desynapsis,recombination |
| R3363 |
T11995 |
T11987 |
prep |
during,pairing |
| R3364 |
T11996 |
T11995 |
pobj |
prophase,during |
| R3365 |
T11997 |
T11996 |
nummod |
I,prophase |
| R3366 |
T11998 |
T11987 |
prep |
in,pairing |
| R3367 |
T11999 |
T12000 |
compound |
Dmrt7,mutant |
| R3368 |
T12000 |
T12001 |
compound |
mutant,males |
| R3369 |
T12001 |
T11998 |
pobj |
males,in |
| R337 |
T4043 |
T4042 |
advmod |
dramatically,so |
| R3370 |
T12002 |
T12003 |
advmod |
grossly,normal |
| R3371 |
T12003 |
T11985 |
acomp |
normal,are |
| R3372 |
T12004 |
T11979 |
punct |
.,conclude |
| R3375 |
T13075 |
T13076 |
amod |
Abnormal,Organization |
| R3376 |
T13077 |
T13076 |
amod |
Cellular,Organization |
| R3377 |
T13078 |
T13076 |
cc |
and,Organization |
| R3378 |
T13079 |
T13080 |
det |
the,Role |
| R3379 |
T13080 |
T13076 |
conj |
Role,Organization |
| R338 |
T4005 |
T4006 |
nsubj |
Many,affect |
| R3380 |
T13081 |
T13080 |
prep |
of,Role |
| R3381 |
T13082 |
T13083 |
compound |
Sertoli,Cells |
| R3382 |
T13083 |
T13081 |
pobj |
Cells,of |
| R3383 |
T13085 |
T13086 |
compound |
Sertoli,cells |
| R3384 |
T13086 |
T13087 |
nsubj |
cells,interact |
| R3385 |
T13088 |
T13087 |
prep |
with,interact |
| R3386 |
T13089 |
T13090 |
compound |
germ,cells |
| R3387 |
T13090 |
T13088 |
pobj |
cells,with |
| R3388 |
T13091 |
T13087 |
prep |
during,interact |
| R3389 |
T13092 |
T13091 |
pobj |
spermatogenesis,during |
| R339 |
T4044 |
T4032 |
punct |
", ",differ |
| R3390 |
T13093 |
T13087 |
cc |
and,interact |
| R3391 |
T13094 |
T13095 |
det |
the,interaction |
| R3392 |
T13095 |
T13096 |
nsubj |
interaction,is |
| R3393 |
T13096 |
T13087 |
conj |
is,interact |
| R3394 |
T13097 |
T13096 |
acomp |
critical,is |
| R3395 |
T13098 |
T13097 |
prep |
for,critical |
| R3396 |
T13099 |
T13100 |
compound |
germ,cell |
| R3397 |
T13100 |
T13101 |
compound |
cell,maturation |
| R3398 |
T13101 |
T13098 |
pobj |
maturation,for |
| R3399 |
T13102 |
T13103 |
punct |
[,50 |
| R34 |
T830 |
T831 |
amod |
Male,Meiosis |
| R340 |
T4007 |
T4005 |
prep |
of,Many |
| R3400 |
T13103 |
T13096 |
parataxis |
50,is |
| R3401 |
T13104 |
T13103 |
punct |
],50 |
| R3402 |
T13105 |
T13096 |
punct |
.,is |
| R3403 |
T13107 |
T13108 |
mark |
Although,detect |
| R3404 |
T13108 |
T13112 |
advcl |
detect,considered |
| R3405 |
T13109 |
T13108 |
nsubj |
we,detect |
| R3406 |
T13110 |
T13108 |
aux |
did,detect |
| R3407 |
T13111 |
T13108 |
neg |
not,detect |
| R3408 |
T13113 |
T13114 |
compound |
DMRT7,expression |
| R3409 |
T13114 |
T13108 |
dobj |
expression,detect |
| R341 |
T4008 |
T4009 |
det |
these,dimorphisms |
| R3410 |
T13115 |
T13108 |
prep |
in,detect |
| R3411 |
T13116 |
T13117 |
compound |
Sertoli,cells |
| R3412 |
T13117 |
T13115 |
pobj |
cells,in |
| R3413 |
T13118 |
T13108 |
prep |
by,detect |
| R3414 |
T13119 |
T13120 |
compound |
antibody,staining |
| R3415 |
T13120 |
T13118 |
pobj |
staining,by |
| R3416 |
T13121 |
T13112 |
punct |
", ",considered |
| R3417 |
T13122 |
T13112 |
nsubj |
we,considered |
| R3418 |
T13123 |
T13112 |
advmod |
nevertheless,considered |
| R3419 |
T13124 |
T13125 |
det |
the,possibility |
| R342 |
T4009 |
T4007 |
pobj |
dimorphisms,of |
| R3420 |
T13125 |
T13112 |
dobj |
possibility,considered |
| R3421 |
T13126 |
T13127 |
mark |
that,contribute |
| R3422 |
T13127 |
T13125 |
acl |
contribute,possibility |
| R3423 |
T13128 |
T13129 |
compound |
Sertoli,cell |
| R3424 |
T13129 |
T13130 |
compound |
cell,defects |
| R3425 |
T13130 |
T13127 |
nsubj |
defects,contribute |
| R3426 |
T13131 |
T13127 |
aux |
might,contribute |
| R3427 |
T13132 |
T13127 |
prep |
to,contribute |
| R3428 |
T13133 |
T13134 |
det |
the,failure |
| R3429 |
T13134 |
T13132 |
pobj |
failure,to |
| R343 |
T4045 |
T4032 |
advcl |
reflecting,differ |
| R3430 |
T13135 |
T13136 |
amod |
male,specific |
| R3431 |
T13136 |
T13134 |
amod |
specific,failure |
| R3432 |
T13137 |
T13136 |
punct |
-,specific |
| R3433 |
T13138 |
T13139 |
compound |
germ,line |
| R3434 |
T13139 |
T13134 |
compound |
line,failure |
| R3435 |
T13140 |
T13134 |
prep |
of,failure |
| R3436 |
T13141 |
T13142 |
compound |
Dmrt7,mutants |
| R3437 |
T13142 |
T13140 |
pobj |
mutants,of |
| R3438 |
T13143 |
T13112 |
punct |
.,considered |
| R3439 |
T13145 |
T13146 |
aux |
To,characterize |
| R344 |
T4010 |
T4011 |
amod |
somatic,cells |
| R3440 |
T13146 |
T13147 |
advcl |
characterize,examined |
| R3441 |
T13148 |
T13149 |
compound |
Sertoli,cell |
| R3442 |
T13149 |
T13150 |
compound |
cell,differentiation |
| R3443 |
T13150 |
T13146 |
dobj |
differentiation,characterize |
| R3444 |
T13151 |
T13147 |
punct |
", ",examined |
| R3445 |
T13152 |
T13147 |
nsubj |
we,examined |
| R3446 |
T13153 |
T13147 |
dobj |
expression,examined |
| R3447 |
T13154 |
T13153 |
prep |
of,expression |
| R3448 |
T13155 |
T13156 |
det |
the,markers |
| R3449 |
T13156 |
T13154 |
pobj |
markers,of |
| R345 |
T4011 |
T4006 |
dobj |
cells,affect |
| R3450 |
T13157 |
T13158 |
compound |
Sertoli,cell |
| R3451 |
T13158 |
T13156 |
compound |
cell,markers |
| R3452 |
T13159 |
T13156 |
appos |
GATA4,markers |
| R3453 |
T13160 |
T13159 |
punct |
(,GATA4 |
| R3454 |
T13161 |
T13162 |
det |
a,marker |
| R3455 |
T13162 |
T13159 |
appos |
marker,GATA4 |
| R3456 |
T13163 |
T13162 |
prep |
of,marker |
| R3457 |
T13164 |
T13165 |
amod |
immature,cells |
| R3458 |
T13165 |
T13163 |
pobj |
cells,of |
| R3459 |
T13166 |
T13165 |
amod |
postnatal,cells |
| R346 |
T4012 |
T4006 |
punct |
", ",affect |
| R3460 |
T13167 |
T13165 |
compound |
Sertoli,cells |
| R3461 |
T13168 |
T13159 |
punct |
),GATA4 |
| R3462 |
T13169 |
T13159 |
cc |
and,GATA4 |
| R3463 |
T13170 |
T13159 |
conj |
GATA1,GATA4 |
| R3464 |
T13171 |
T13170 |
punct |
(,GATA1 |
| R3465 |
T13172 |
T13173 |
det |
a,marker |
| R3466 |
T13173 |
T13170 |
appos |
marker,GATA1 |
| R3467 |
T13174 |
T13173 |
amod |
mature,marker |
| R3468 |
T13175 |
T13176 |
compound |
Sertoli,cell |
| R3469 |
T13176 |
T13173 |
compound |
cell,marker |
| R347 |
T4046 |
T4047 |
poss |
their,roles |
| R3470 |
T13177 |
T13170 |
punct |
),GATA1 |
| R3471 |
T13178 |
T13147 |
punct |
.,examined |
| R3472 |
T13180 |
T13181 |
det |
The,levels |
| R3473 |
T13181 |
T13182 |
nsubj |
levels,appeared |
| R3474 |
T13183 |
T13181 |
prep |
of,levels |
| R3475 |
T13184 |
T13185 |
det |
these,proteins |
| R3476 |
T13185 |
T13183 |
pobj |
proteins,of |
| R3477 |
T13186 |
T13182 |
oprd |
normal,appeared |
| R3478 |
T13187 |
T13182 |
advcl |
relative,appeared |
| R3479 |
T13188 |
T13187 |
prep |
to,relative |
| R348 |
T4013 |
T4006 |
cc |
but,affect |
| R3480 |
T13189 |
T13190 |
amod |
wild,type |
| R3481 |
T13190 |
T13188 |
pobj |
type,to |
| R3482 |
T13191 |
T13190 |
punct |
-,type |
| R3483 |
T13192 |
T13190 |
prep |
at,type |
| R3484 |
T13193 |
T13192 |
pobj |
P14,at |
| R3485 |
T13194 |
T13193 |
cc |
and,P14 |
| R3486 |
T13195 |
T13193 |
conj |
P42,P14 |
| R3487 |
T13196 |
T13197 |
punct |
(,6A |
| R3488 |
T13197 |
T13182 |
parataxis |
6A,appeared |
| R3489 |
T13198 |
T13197 |
compound |
Figure,6A |
| R349 |
T4014 |
T4015 |
det |
the,dimorphisms |
| R3490 |
T13199 |
T13200 |
punct |
–,6C |
| R3491 |
T13200 |
T13197 |
prep |
6C,6A |
| R3492 |
T13201 |
T13197 |
punct |
),6A |
| R3493 |
T13202 |
T13182 |
punct |
", ",appeared |
| R3494 |
T13203 |
T13204 |
mark |
as,did |
| R3495 |
T13204 |
T13182 |
advcl |
did,appeared |
| R3496 |
T13205 |
T13206 |
det |
the,receptor |
| R3497 |
T13206 |
T13204 |
nsubj |
receptor,did |
| R3498 |
T13207 |
T13206 |
compound |
androgen,receptor |
| R3499 |
T13208 |
T13209 |
punct |
(,data |
| R35 |
T930 |
T931 |
det |
the,regulators |
| R350 |
T4015 |
T4017 |
nsubj |
dimorphisms,are |
| R3500 |
T13209 |
T13206 |
parataxis |
data,receptor |
| R3501 |
T13210 |
T13211 |
compound |
Figure,S3 |
| R3502 |
T13211 |
T13209 |
dep |
S3,data |
| R3503 |
T13212 |
T13209 |
punct |
;,data |
| R3504 |
T13213 |
T13209 |
amod |
unpublished,data |
| R3505 |
T13214 |
T13209 |
punct |
),data |
| R3506 |
T13215 |
T13182 |
punct |
.,appeared |
| R3507 |
T13217 |
T13218 |
advmod |
However,was |
| R3508 |
T13218 |
T13229 |
ccomp |
was,displaced |
| R3509 |
T13219 |
T13218 |
punct |
", ",was |
| R351 |
T4047 |
T4045 |
dobj |
roles,reflecting |
| R3510 |
T13220 |
T13221 |
det |
the,organization |
| R3511 |
T13221 |
T13218 |
nsubj |
organization,was |
| R3512 |
T13222 |
T13221 |
prep |
of,organization |
| R3513 |
T13223 |
T13224 |
compound |
Sertoli,cells |
| R3514 |
T13224 |
T13222 |
pobj |
cells,of |
| R3515 |
T13225 |
T13221 |
prep |
in,organization |
| R3516 |
T13226 |
T13227 |
compound |
Dmrt7,testes |
| R3517 |
T13227 |
T13225 |
pobj |
testes,in |
| R3518 |
T13228 |
T13227 |
compound |
mutant,testes |
| R3519 |
T13230 |
T13218 |
acomp |
abnormal,was |
| R352 |
T4016 |
T4015 |
amod |
sexual,dimorphisms |
| R3520 |
T13231 |
T13229 |
punct |
: ,displaced |
| R3521 |
T13232 |
T13229 |
prep |
in,displaced |
| R3522 |
T13233 |
T13234 |
det |
some,tubules |
| R3523 |
T13234 |
T13232 |
pobj |
tubules,in |
| R3524 |
T13235 |
T13236 |
npadvmod |
GATA1,positive |
| R3525 |
T13236 |
T13238 |
amod |
positive,nuclei |
| R3526 |
T13237 |
T13236 |
punct |
-,positive |
| R3527 |
T13238 |
T13229 |
nsubjpass |
nuclei,displaced |
| R3528 |
T13239 |
T13240 |
compound |
Sertoli,cell |
| R3529 |
T13240 |
T13238 |
compound |
cell,nuclei |
| R353 |
T4048 |
T4049 |
advmod |
very,different |
| R3530 |
T13241 |
T13229 |
auxpass |
were,displaced |
| R3531 |
T13242 |
T13229 |
prep |
from,displaced |
| R3532 |
T13243 |
T13244 |
poss |
their,apposition |
| R3533 |
T13244 |
T13242 |
pobj |
apposition,from |
| R3534 |
T13245 |
T13244 |
amod |
usual,apposition |
| R3535 |
T13246 |
T13244 |
amod |
close,apposition |
| R3536 |
T13247 |
T13244 |
prep |
with,apposition |
| R3537 |
T13248 |
T13249 |
det |
the,membrane |
| R3538 |
T13249 |
T13247 |
pobj |
membrane,with |
| R3539 |
T13250 |
T13249 |
compound |
basement,membrane |
| R354 |
T4017 |
T4006 |
conj |
are,affect |
| R3540 |
T13251 |
T13252 |
punct |
(,6C |
| R3541 |
T13252 |
T13229 |
parataxis |
6C,displaced |
| R3542 |
T13253 |
T13252 |
compound |
Figure,6C |
| R3543 |
T13254 |
T13252 |
punct |
),6C |
| R3544 |
T13255 |
T13229 |
punct |
.,displaced |
| R3545 |
T13257 |
T13258 |
prep |
In,packed |
| R3546 |
T13259 |
T13260 |
amod |
such,tubules |
| R3547 |
T13260 |
T13257 |
pobj |
tubules,In |
| R3548 |
T13261 |
T13258 |
punct |
", ",packed |
| R3549 |
T13262 |
T13258 |
nsubjpass |
nuclei,packed |
| R355 |
T4018 |
T4019 |
dep |
that,mediate |
| R3550 |
T13263 |
T13262 |
prep |
of,nuclei |
| R3551 |
T13264 |
T13265 |
amod |
pre-meiotic,cells |
| R3552 |
T13265 |
T13263 |
pobj |
cells,of |
| R3553 |
T13266 |
T13265 |
compound |
germ,cells |
| R3554 |
T13267 |
T13265 |
cc |
and,cells |
| R3555 |
T13268 |
T13265 |
conj |
spermatocytes,cells |
| R3556 |
T13269 |
T13258 |
auxpass |
were,packed |
| R3557 |
T13270 |
T13258 |
advmod |
close,packed |
| R3558 |
T13271 |
T13270 |
prep |
to,close |
| R3559 |
T13272 |
T13273 |
det |
the,membrane |
| R356 |
T4049 |
T4047 |
amod |
different,roles |
| R3560 |
T13273 |
T13271 |
pobj |
membrane,to |
| R3561 |
T13274 |
T13273 |
amod |
basal,membrane |
| R3562 |
T13275 |
T13258 |
cc |
and,packed |
| R3563 |
T13276 |
T13277 |
amod |
few,cells |
| R3564 |
T13277 |
T13279 |
nsubjpass |
cells,found |
| R3565 |
T13278 |
T13277 |
compound |
germ,cells |
| R3566 |
T13279 |
T13258 |
conj |
found,packed |
| R3567 |
T13280 |
T13279 |
auxpass |
were,found |
| R3568 |
T13281 |
T13279 |
prep |
in,found |
| R3569 |
T13282 |
T13283 |
det |
the,region |
| R357 |
T4019 |
T4015 |
relcl |
mediate,dimorphisms |
| R3570 |
T13283 |
T13281 |
pobj |
region,in |
| R3571 |
T13284 |
T13283 |
amod |
adlumenal,region |
| R3572 |
T13285 |
T13279 |
punct |
.,found |
| R3573 |
T13287 |
T13288 |
det |
The,organization |
| R3574 |
T13288 |
T13292 |
nsubj |
organization,raised |
| R3575 |
T13289 |
T13288 |
amod |
aberrant,organization |
| R3576 |
T13290 |
T13291 |
compound |
Sertoli,cell |
| R3577 |
T13291 |
T13288 |
compound |
cell,organization |
| R3578 |
T13293 |
T13288 |
prep |
in,organization |
| R3579 |
T13294 |
T13295 |
compound |
Dmrt7,testes |
| R358 |
T4020 |
T4021 |
advmod |
most,directly |
| R3580 |
T13295 |
T13293 |
pobj |
testes,in |
| R3581 |
T13296 |
T13295 |
compound |
mutant,testes |
| R3582 |
T13297 |
T13298 |
det |
the,possibility |
| R3583 |
T13298 |
T13292 |
dobj |
possibility,raised |
| R3584 |
T13299 |
T13300 |
mark |
that,result |
| R3585 |
T13300 |
T13298 |
acl |
result,possibility |
| R3586 |
T13301 |
T13302 |
det |
the,phenotype |
| R3587 |
T13302 |
T13300 |
nsubj |
phenotype,result |
| R3588 |
T13303 |
T13304 |
compound |
germ,cell |
| R3589 |
T13304 |
T13302 |
compound |
cell,phenotype |
| R359 |
T4021 |
T4019 |
advmod |
directly,mediate |
| R3590 |
T13305 |
T13300 |
aux |
might,result |
| R3591 |
T13306 |
T13300 |
advmod |
indirectly,result |
| R3592 |
T13307 |
T13300 |
prep |
from,result |
| R3593 |
T13308 |
T13307 |
pobj |
defects,from |
| R3594 |
T13309 |
T13308 |
prep |
in,defects |
| R3595 |
T13310 |
T13311 |
compound |
Sertoli,cell |
| R3596 |
T13311 |
T13312 |
compound |
cell,function |
| R3597 |
T13312 |
T13309 |
pobj |
function,in |
| R3598 |
T13313 |
T13292 |
punct |
.,raised |
| R3599 |
T13315 |
T13316 |
aux |
To,test |
| R36 |
T931 |
T929 |
pobj |
regulators,to |
| R360 |
T4022 |
T4023 |
amod |
sexual,reproduction |
| R3600 |
T13316 |
T13317 |
advcl |
test,deleted |
| R3601 |
T13318 |
T13319 |
det |
this,possibility |
| R3602 |
T13319 |
T13316 |
dobj |
possibility,test |
| R3603 |
T13320 |
T13317 |
punct |
", ",deleted |
| R3604 |
T13321 |
T13317 |
nsubj |
we,deleted |
| R3605 |
T13322 |
T13317 |
dobj |
Dmrt7,deleted |
| R3606 |
T13323 |
T13317 |
advmod |
just,deleted |
| R3607 |
T13324 |
T13317 |
prep |
in,deleted |
| R3608 |
T13325 |
T13326 |
det |
the,lineage |
| R3609 |
T13326 |
T13324 |
pobj |
lineage,in |
| R361 |
T4023 |
T4019 |
dobj |
reproduction,mediate |
| R3610 |
T13327 |
T13328 |
compound |
Sertoli,cell |
| R3611 |
T13328 |
T13326 |
compound |
cell,lineage |
| R3612 |
T13329 |
T13317 |
prep |
by,deleted |
| R3613 |
T13330 |
T13329 |
pcomp |
crossing,by |
| R3614 |
T13331 |
T13330 |
dobj |
mice,crossing |
| R3615 |
T13332 |
T13331 |
acl |
carrying,mice |
| R3616 |
T13333 |
T13334 |
det |
the,allele |
| R3617 |
T13334 |
T13332 |
dobj |
allele,carrying |
| R3618 |
T13335 |
T13334 |
amod |
floxed,allele |
| R3619 |
T13336 |
T13334 |
compound |
Dmrt7,allele |
| R362 |
T4024 |
T4017 |
attr |
those,are |
| R3620 |
T13337 |
T13330 |
prep |
with,crossing |
| R3621 |
T13338 |
T13339 |
compound |
Dhh,Cre |
| R3622 |
T13339 |
T13341 |
npadvmod |
Cre,transgenic |
| R3623 |
T13340 |
T13339 |
punct |
-,Cre |
| R3624 |
T13341 |
T13342 |
amod |
transgenic,mice |
| R3625 |
T13342 |
T13337 |
pobj |
mice,with |
| R3626 |
T13343 |
T13344 |
punct |
[,51 |
| R3627 |
T13344 |
T13317 |
parataxis |
51,deleted |
| R3628 |
T13345 |
T13344 |
punct |
],51 |
| R3629 |
T13346 |
T13317 |
punct |
.,deleted |
| R363 |
T4025 |
T4024 |
prep |
of,those |
| R3630 |
T13348 |
T13349 |
det |
The,promoter |
| R3631 |
T13349 |
T13355 |
nsubj |
promoter,is |
| R3632 |
T13350 |
T13351 |
nmod |
Desert,hedgehog |
| R3633 |
T13351 |
T13349 |
nmod |
hedgehog,promoter |
| R3634 |
T13352 |
T13351 |
punct |
(,hedgehog |
| R3635 |
T13353 |
T13351 |
appos |
Dhh,hedgehog |
| R3636 |
T13354 |
T13349 |
punct |
),promoter |
| R3637 |
T13356 |
T13355 |
attr |
active,is |
| R3638 |
T13357 |
T13355 |
advcl |
starting,is |
| R3639 |
T13358 |
T13357 |
prep |
at,starting |
| R364 |
T4026 |
T4027 |
det |
the,gametes |
| R3640 |
T13359 |
T13358 |
prep |
about,at |
| R3641 |
T13360 |
T13359 |
pobj |
E12.5,about |
| R3642 |
T13361 |
T13357 |
prep |
in,starting |
| R3643 |
T13362 |
T13363 |
amod |
pre-Sertoli,cells |
| R3644 |
T13363 |
T13361 |
pobj |
cells,in |
| R3645 |
T13364 |
T13361 |
cc |
but,in |
| R3646 |
T13365 |
T13364 |
neg |
not,but |
| R3647 |
T13366 |
T13361 |
conj |
in,in |
| R3648 |
T13367 |
T13368 |
compound |
germ,cells |
| R3649 |
T13368 |
T13366 |
pobj |
cells,in |
| R365 |
T4027 |
T4025 |
pobj |
gametes,of |
| R3650 |
T13369 |
T13355 |
punct |
", ",is |
| R3651 |
T13370 |
T13355 |
advcl |
allowing,is |
| R3652 |
T13371 |
T13370 |
dobj |
deletion,allowing |
| R3653 |
T13372 |
T13371 |
prep |
of,deletion |
| R3654 |
T13373 |
T13372 |
pobj |
Dmrt7,of |
| R3655 |
T13374 |
T13371 |
prep |
in,deletion |
| R3656 |
T13375 |
T13376 |
compound |
Sertoli,cells |
| R3657 |
T13376 |
T13374 |
pobj |
cells,in |
| R3658 |
T13377 |
T13378 |
advmod |
well,before |
| R3659 |
T13378 |
T13370 |
prep |
before,allowing |
| R366 |
T4028 |
T4027 |
appos |
themselves,gametes |
| R3660 |
T13379 |
T13380 |
det |
any,requirement |
| R3661 |
T13380 |
T13378 |
pobj |
requirement,before |
| R3662 |
T13381 |
T13380 |
amod |
likely,requirement |
| R3663 |
T13382 |
T13380 |
prep |
for,requirement |
| R3664 |
T13383 |
T13384 |
poss |
its,function |
| R3665 |
T13384 |
T13382 |
pobj |
function,for |
| R3666 |
T13385 |
T13386 |
punct |
[,52 |
| R3667 |
T13386 |
T13355 |
parataxis |
52,is |
| R3668 |
T13387 |
T13386 |
punct |
],52 |
| R3669 |
T13388 |
T13355 |
punct |
.,is |
| R367 |
T4029 |
T4017 |
punct |
.,are |
| R3670 |
T13390 |
T13391 |
amod |
Testicular,size |
| R3671 |
T13391 |
T13392 |
nsubjpass |
size,reduced |
| R3672 |
T13393 |
T13391 |
prep |
in,size |
| R3673 |
T13394 |
T13395 |
npadvmod |
Sertoli,targeted |
| R3674 |
T13395 |
T13397 |
amod |
targeted,animals |
| R3675 |
T13396 |
T13395 |
punct |
-,targeted |
| R3676 |
T13397 |
T13393 |
pobj |
animals,in |
| R3677 |
T13398 |
T13399 |
punct |
(,Dmrt7KO |
| R3678 |
T13399 |
T13397 |
parataxis |
Dmrt7KO,animals |
| R3679 |
T13400 |
T13399 |
compound |
SC,Dmrt7KO |
| R368 |
T4031 |
T4032 |
nsubj |
Gametes,differ |
| R3680 |
T13401 |
T13399 |
punct |
-,Dmrt7KO |
| R3681 |
T13402 |
T13399 |
punct |
),Dmrt7KO |
| R3682 |
T13403 |
T13392 |
auxpass |
was,reduced |
| R3683 |
T13404 |
T13392 |
advmod |
slightly,reduced |
| R3684 |
T13405 |
T13392 |
prep |
from,reduced |
| R3685 |
T13406 |
T13405 |
pobj |
that,from |
| R3686 |
T13407 |
T13406 |
prep |
of,that |
| R3687 |
T13408 |
T13409 |
amod |
wild,type |
| R3688 |
T13409 |
T13407 |
pobj |
type,of |
| R3689 |
T13410 |
T13409 |
punct |
-,type |
| R369 |
T4033 |
T4032 |
prep |
between,differ |
| R3690 |
T13411 |
T13392 |
punct |
", ",reduced |
| R3691 |
T13412 |
T13392 |
cc |
but,reduced |
| R3692 |
T13413 |
T13414 |
amod |
histological,analysis |
| R3693 |
T13414 |
T13415 |
nsubj |
analysis,revealed |
| R3694 |
T13415 |
T13392 |
conj |
revealed,reduced |
| R3695 |
T13416 |
T13417 |
det |
no,difference |
| R3696 |
T13417 |
T13415 |
dobj |
difference,revealed |
| R3697 |
T13418 |
T13417 |
amod |
obvious,difference |
| R3698 |
T13419 |
T13417 |
prep |
between,difference |
| R3699 |
T13420 |
T13421 |
amod |
wild,type |
| R37 |
T932 |
T931 |
nmod |
invertebrate,regulators |
| R370 |
T4034 |
T4035 |
det |
the,sexes |
| R3700 |
T13421 |
T13423 |
nmod |
type,testes |
| R3701 |
T13422 |
T13421 |
punct |
-,type |
| R3702 |
T13423 |
T13419 |
pobj |
testes,between |
| R3703 |
T13424 |
T13421 |
cc |
and,type |
| R3704 |
T13425 |
T13426 |
compound |
SC,Dmrt7KO |
| R3705 |
T13426 |
T13421 |
conj |
Dmrt7KO,type |
| R3706 |
T13427 |
T13426 |
punct |
-,Dmrt7KO |
| R3707 |
T13428 |
T13429 |
punct |
(,6D |
| R3708 |
T13429 |
T13415 |
parataxis |
6D,revealed |
| R3709 |
T13430 |
T13429 |
compound |
Figure,6D |
| R371 |
T4050 |
T4047 |
prep |
in,roles |
| R3710 |
T13431 |
T13429 |
punct |
),6D |
| R3711 |
T13432 |
T13415 |
punct |
.,revealed |
| R3712 |
T13434 |
T13435 |
nsubj |
Spermatogenesis,appeared |
| R3713 |
T13436 |
T13435 |
oprd |
normal,appeared |
| R3714 |
T13437 |
T13435 |
punct |
", ",appeared |
| R3715 |
T13438 |
T13439 |
amod |
mature,sperm |
| R3716 |
T13439 |
T13440 |
nsubj |
sperm,were |
| R3717 |
T13440 |
T13435 |
conj |
were,appeared |
| R3718 |
T13441 |
T13440 |
acomp |
present,were |
| R3719 |
T13442 |
T13440 |
punct |
", ",were |
| R372 |
T4051 |
T4052 |
compound |
zygote,formation |
| R3720 |
T13443 |
T13440 |
cc |
and,were |
| R3721 |
T13444 |
T13445 |
compound |
SC,Dmrt7KO |
| R3722 |
T13445 |
T13447 |
compound |
Dmrt7KO,mice |
| R3723 |
T13446 |
T13445 |
punct |
-,Dmrt7KO |
| R3724 |
T13447 |
T13448 |
nsubj |
mice,were |
| R3725 |
T13448 |
T13440 |
conj |
were,were |
| R3726 |
T13449 |
T13448 |
acomp |
fertile,were |
| R3727 |
T13450 |
T13448 |
punct |
.,were |
| R3728 |
T13452 |
T13453 |
prep |
In,showed |
| R3729 |
T13454 |
T13452 |
pobj |
addition,In |
| R373 |
T4141 |
T4140 |
prep |
during,arrest |
| R3730 |
T13455 |
T13453 |
punct |
", ",showed |
| R3731 |
T13456 |
T13457 |
compound |
GATA1,staining |
| R3732 |
T13457 |
T13453 |
nsubj |
staining,showed |
| R3733 |
T13458 |
T13459 |
mark |
that,located |
| R3734 |
T13459 |
T13453 |
ccomp |
located,showed |
| R3735 |
T13460 |
T13461 |
compound |
Sertoli,cell |
| R3736 |
T13461 |
T13462 |
compound |
cell,nuclei |
| R3737 |
T13462 |
T13459 |
nsubjpass |
nuclei,located |
| R3738 |
T13463 |
T13459 |
auxpass |
were,located |
| R3739 |
T13464 |
T13459 |
advcl |
adjacent,located |
| R374 |
T4052 |
T4050 |
pobj |
formation,in |
| R3740 |
T13465 |
T13464 |
prep |
to,adjacent |
| R3741 |
T13466 |
T13467 |
det |
the,membrane |
| R3742 |
T13467 |
T13465 |
pobj |
membrane,to |
| R3743 |
T13468 |
T13467 |
compound |
basement,membrane |
| R3744 |
T13469 |
T13459 |
prep |
as,located |
| R3745 |
T13470 |
T13469 |
prep |
in,as |
| R3746 |
T13471 |
T13472 |
amod |
wild,type |
| R3747 |
T13472 |
T13470 |
pobj |
type,in |
| R3748 |
T13473 |
T13472 |
punct |
-,type |
| R3749 |
T13474 |
T13475 |
punct |
(,6E |
| R375 |
T4142 |
T4143 |
amod |
meiotic,prophase |
| R3750 |
T13475 |
T13453 |
parataxis |
6E,showed |
| R3751 |
T13476 |
T13475 |
compound |
Figure,6E |
| R3752 |
T13477 |
T13475 |
punct |
),6E |
| R3753 |
T13478 |
T13453 |
punct |
.,showed |
| R3754 |
T13480 |
T13481 |
det |
These,results |
| R3755 |
T13481 |
T13482 |
nsubj |
results,suggest |
| R3756 |
T13483 |
T13484 |
det |
the,defects |
| R3757 |
T13484 |
T13487 |
nsubjpass |
defects,caused |
| R3758 |
T13485 |
T13486 |
compound |
germ,cell |
| R3759 |
T13486 |
T13484 |
compound |
cell,defects |
| R376 |
T4143 |
T4141 |
pobj |
prophase,during |
| R3760 |
T13487 |
T13482 |
advcl |
caused,suggest |
| R3761 |
T13488 |
T13484 |
prep |
of,defects |
| R3762 |
T13489 |
T13490 |
compound |
Dmrt7,mutants |
| R3763 |
T13490 |
T13488 |
pobj |
mutants,of |
| R3764 |
T13491 |
T13487 |
auxpass |
are,caused |
| R3765 |
T13492 |
T13487 |
neg |
not,caused |
| R3766 |
T13493 |
T13487 |
agent |
by,caused |
| R3767 |
T13494 |
T13493 |
pobj |
lack,by |
| R3768 |
T13495 |
T13494 |
prep |
of,lack |
| R3769 |
T13496 |
T13495 |
pobj |
Dmrt7,of |
| R377 |
T4144 |
T4143 |
nummod |
I,prophase |
| R3770 |
T13497 |
T13494 |
prep |
in,lack |
| R3771 |
T13498 |
T13499 |
compound |
Sertoli,cells |
| R3772 |
T13499 |
T13497 |
pobj |
cells,in |
| R3773 |
T13500 |
T13482 |
punct |
.,suggest |
| R3774 |
T13502 |
T13503 |
advmod |
Rather,appears |
| R3775 |
T13504 |
T13503 |
punct |
", ",appears |
| R3776 |
T13505 |
T13506 |
det |
the,organization |
| R3777 |
T13506 |
T13503 |
nsubj |
organization,appears |
| R3778 |
T13507 |
T13506 |
amod |
abnormal,organization |
| R3779 |
T13508 |
T13506 |
prep |
of,organization |
| R378 |
T4053 |
T4032 |
punct |
.,differ |
| R3780 |
T13509 |
T13510 |
compound |
Sertoli,cells |
| R3781 |
T13510 |
T13508 |
pobj |
cells,of |
| R3782 |
T13511 |
T13512 |
aux |
to,result |
| R3783 |
T13512 |
T13503 |
xcomp |
result,appears |
| R3784 |
T13513 |
T13512 |
prep |
from,result |
| R3785 |
T13514 |
T13513 |
pobj |
lack,from |
| R3786 |
T13515 |
T13514 |
prep |
of,lack |
| R3787 |
T13516 |
T13515 |
pobj |
Dmrt7,of |
| R3788 |
T13517 |
T13514 |
prep |
in,lack |
| R3789 |
T13518 |
T13519 |
det |
the,line |
| R379 |
T4145 |
T4129 |
punct |
.,initiate |
| R3790 |
T13519 |
T13517 |
pobj |
line,in |
| R3791 |
T13520 |
T13519 |
compound |
germ,line |
| R3792 |
T13521 |
T13503 |
punct |
.,appears |
| R3799 |
T14689 |
T14690 |
compound |
XY,Bodies |
| R38 |
T831 |
T829 |
pobj |
Meiosis,for |
| R380 |
T4055 |
T4056 |
advmod |
Indeed,is |
| R3800 |
T14690 |
T14691 |
nsubj |
Bodies,Form |
| R3801 |
T14692 |
T14691 |
advmod |
Normally,Form |
| R3802 |
T14693 |
T14691 |
prep |
in,Form |
| R3803 |
T14694 |
T14695 |
compound |
Dmrt7,Mutant |
| R3804 |
T14695 |
T14696 |
compound |
Mutant,Cells |
| R3805 |
T14696 |
T14693 |
pobj |
Cells,in |
| R3806 |
T14698 |
T14699 |
det |
The,data |
| R3807 |
T14699 |
T14700 |
nsubj |
data,indicate |
| R3808 |
T14701 |
T14699 |
acl |
presented,data |
| R3809 |
T14702 |
T14703 |
advmod |
so,far |
| R381 |
T4147 |
T4148 |
prep |
After,recruited |
| R3810 |
T14703 |
T14701 |
advmod |
far,presented |
| R3811 |
T14704 |
T14705 |
mark |
that,undergo |
| R3812 |
T14705 |
T14700 |
ccomp |
undergo,indicate |
| R3813 |
T14706 |
T14707 |
compound |
Dmrt7,cells |
| R3814 |
T14707 |
T14705 |
nsubj |
cells,undergo |
| R3815 |
T14708 |
T14707 |
compound |
mutant,cells |
| R3816 |
T14709 |
T14707 |
compound |
germ,cells |
| R3817 |
T14710 |
T14711 |
advmod |
apparently,normal |
| R3818 |
T14711 |
T14712 |
amod |
normal,meiosis |
| R3819 |
T14712 |
T14705 |
dobj |
meiosis,undergo |
| R382 |
T4149 |
T4147 |
pobj |
puberty,After |
| R3820 |
T14713 |
T14712 |
amod |
early,meiosis |
| R3821 |
T14714 |
T14705 |
cc |
and,undergo |
| R3822 |
T14715 |
T14716 |
advmod |
then,arrest |
| R3823 |
T14716 |
T14705 |
conj |
arrest,undergo |
| R3824 |
T14717 |
T14716 |
prep |
during,arrest |
| R3825 |
T14718 |
T14717 |
pobj |
pachynema,during |
| R3826 |
T14719 |
T14716 |
prep |
due,arrest |
| R3827 |
T14720 |
T14719 |
pcomp |
to,due |
| R3828 |
T14721 |
T14722 |
det |
a,requirement |
| R3829 |
T14722 |
T14719 |
pobj |
requirement,due |
| R383 |
T4150 |
T4148 |
punct |
", ",recruited |
| R3830 |
T14723 |
T14722 |
amod |
strict,requirement |
| R3831 |
T14724 |
T14722 |
prep |
for,requirement |
| R3832 |
T14725 |
T14724 |
pobj |
Dmrt7,for |
| R3833 |
T14726 |
T14722 |
prep |
in,requirement |
| R3834 |
T14727 |
T14728 |
det |
the,line |
| R3835 |
T14728 |
T14726 |
pobj |
line,in |
| R3836 |
T14729 |
T14728 |
compound |
germ,line |
| R3837 |
T14730 |
T14700 |
punct |
.,indicate |
| R3838 |
T14732 |
T14733 |
aux |
To,understand |
| R3839 |
T14733 |
T14735 |
advcl |
understand,examined |
| R384 |
T4056 |
T4063 |
ccomp |
is,are |
| R3840 |
T14734 |
T14733 |
advmod |
better,understand |
| R3841 |
T14736 |
T14737 |
det |
the,basis |
| R3842 |
T14737 |
T14733 |
dobj |
basis,understand |
| R3843 |
T14738 |
T14737 |
prep |
of,basis |
| R3844 |
T14739 |
T14740 |
det |
the,arrest |
| R3845 |
T14740 |
T14738 |
pobj |
arrest,of |
| R3846 |
T14741 |
T14740 |
amod |
meiotic,arrest |
| R3847 |
T14742 |
T14735 |
punct |
", ",examined |
| R3848 |
T14743 |
T14735 |
nsubj |
we,examined |
| R3849 |
T14744 |
T14745 |
advmod |
more,closely |
| R385 |
T4151 |
T4148 |
nsubjpass |
oocytes,recruited |
| R3850 |
T14745 |
T14735 |
advmod |
closely,examined |
| R3851 |
T14746 |
T14747 |
amod |
meiotic,cells |
| R3852 |
T14747 |
T14735 |
dobj |
cells,examined |
| R3853 |
T14748 |
T14747 |
compound |
germ,cells |
| R3854 |
T14749 |
T14735 |
prep |
in,examined |
| R3855 |
T14750 |
T14751 |
det |
the,mutant |
| R3856 |
T14751 |
T14749 |
pobj |
mutant,in |
| R3857 |
T14752 |
T14735 |
punct |
.,examined |
| R3858 |
T14754 |
T14755 |
nsubj |
We,focused |
| R3859 |
T14756 |
T14755 |
prep |
on,focused |
| R386 |
T4152 |
T4148 |
auxpass |
are,recruited |
| R3860 |
T14757 |
T14758 |
det |
the,body |
| R3861 |
T14758 |
T14756 |
pobj |
body,on |
| R3862 |
T14759 |
T14758 |
compound |
XY,body |
| R3863 |
T14760 |
T14758 |
punct |
", ",body |
| R3864 |
T14761 |
T14762 |
dep |
which,thought |
| R3865 |
T14762 |
T14758 |
relcl |
thought,body |
| R3866 |
T14763 |
T14762 |
auxpass |
is,thought |
| R3867 |
T14764 |
T14765 |
aux |
to,be |
| R3868 |
T14765 |
T14762 |
xcomp |
be,thought |
| R3869 |
T14766 |
T14765 |
acomp |
essential,be |
| R387 |
T4153 |
T4148 |
advmod |
selectively,recruited |
| R3870 |
T14767 |
T14766 |
prep |
for,essential |
| R3871 |
T14768 |
T14769 |
amod |
meiotic,progression |
| R3872 |
T14769 |
T14767 |
pobj |
progression,for |
| R3873 |
T14770 |
T14762 |
cc |
and,thought |
| R3874 |
T14771 |
T14762 |
conj |
is,thought |
| R3875 |
T14772 |
T14773 |
det |
the,site |
| R3876 |
T14773 |
T14771 |
attr |
site,is |
| R3877 |
T14774 |
T14773 |
prep |
of,site |
| R3878 |
T14775 |
T14776 |
amod |
preferential,localization |
| R3879 |
T14776 |
T14774 |
pobj |
localization,of |
| R388 |
T4154 |
T4148 |
prep |
for,recruited |
| R3880 |
T14777 |
T14776 |
compound |
DMRT7,localization |
| R3881 |
T14778 |
T14755 |
punct |
.,focused |
| R3882 |
T14780 |
T14781 |
nsubj |
Condensation,begins |
| R3883 |
T14782 |
T14780 |
prep |
of,Condensation |
| R3884 |
T14783 |
T14784 |
det |
the,chromosomes |
| R3885 |
T14784 |
T14782 |
pobj |
chromosomes,of |
| R3886 |
T14785 |
T14784 |
nmod |
X,chromosomes |
| R3887 |
T14786 |
T14785 |
cc |
and,X |
| R3888 |
T14787 |
T14785 |
conj |
Y,X |
| R3889 |
T14788 |
T14781 |
prep |
in,begins |
| R389 |
T4057 |
T4056 |
punct |
", ",is |
| R3890 |
T14789 |
T14790 |
amod |
late,zygotene |
| R3891 |
T14790 |
T14792 |
compound |
zygotene,cells |
| R3892 |
T14791 |
T14790 |
punct |
-,zygotene |
| R3893 |
T14792 |
T14788 |
pobj |
cells,in |
| R3894 |
T14793 |
T14781 |
punct |
", ",begins |
| R3895 |
T14794 |
T14781 |
cc |
and,begins |
| R3896 |
T14795 |
T14781 |
punct |
", ",begins |
| R3897 |
T14796 |
T14797 |
prep |
by,forms |
| R3898 |
T14797 |
T14781 |
conj |
forms,begins |
| R3899 |
T14798 |
T14796 |
pobj |
mid-pachynema,by |
| R39 |
T933 |
T931 |
amod |
sexual,regulators |
| R390 |
T4155 |
T4154 |
pobj |
ovulation,for |
| R3900 |
T14799 |
T14800 |
punct |
(,aligned |
| R3901 |
T14800 |
T14798 |
parataxis |
aligned,mid-pachynema |
| R3902 |
T14801 |
T14800 |
advmod |
when,aligned |
| R3903 |
T14802 |
T14803 |
amod |
homologous,pairs |
| R3904 |
T14803 |
T14800 |
nsubjpass |
pairs,aligned |
| R3905 |
T14804 |
T14803 |
compound |
chromosome,pairs |
| R3906 |
T14805 |
T14800 |
auxpass |
are,aligned |
| R3907 |
T14806 |
T14800 |
advmod |
fully,aligned |
| R3908 |
T14807 |
T14800 |
punct |
),aligned |
| R3909 |
T14808 |
T14809 |
det |
the,chromatin |
| R391 |
T4156 |
T4148 |
punct |
", ",recruited |
| R3910 |
T14809 |
T14797 |
nsubj |
chromatin,forms |
| R3911 |
T14810 |
T14809 |
compound |
sex,chromatin |
| R3912 |
T14811 |
T14812 |
det |
a,structure |
| R3913 |
T14812 |
T14797 |
dobj |
structure,forms |
| R3914 |
T14813 |
T14814 |
advmod |
microscopically,visible |
| R3915 |
T14814 |
T14812 |
amod |
visible,structure |
| R3916 |
T14815 |
T14812 |
amod |
spherical,structure |
| R3917 |
T14816 |
T14797 |
prep |
near,forms |
| R3918 |
T14817 |
T14818 |
det |
the,periphery |
| R3919 |
T14818 |
T14816 |
pobj |
periphery,near |
| R392 |
T4157 |
T4158 |
advmod |
when,proceed |
| R3920 |
T14819 |
T14818 |
amod |
nuclear,periphery |
| R3921 |
T14820 |
T14821 |
punct |
[,53 |
| R3922 |
T14821 |
T14797 |
parataxis |
53,forms |
| R3923 |
T14822 |
T14821 |
punct |
],53 |
| R3924 |
T14823 |
T14797 |
punct |
.,forms |
| R3925 |
T14825 |
T14826 |
nsubj |
We,asked |
| R3926 |
T14827 |
T14826 |
advmod |
first,asked |
| R3927 |
T14828 |
T14829 |
mark |
whether,required |
| R3928 |
T14829 |
T14826 |
ccomp |
required,asked |
| R3929 |
T14830 |
T14829 |
nsubjpass |
DMRT7,required |
| R393 |
T4158 |
T4148 |
advcl |
proceed,recruited |
| R3930 |
T14831 |
T14829 |
auxpass |
is,required |
| R3931 |
T14832 |
T14829 |
prep |
for,required |
| R3932 |
T14833 |
T14834 |
compound |
XY,body |
| R3933 |
T14834 |
T14835 |
compound |
body,formation |
| R3934 |
T14835 |
T14832 |
pobj |
formation,for |
| R3935 |
T14836 |
T14826 |
prep |
by,asked |
| R3936 |
T14837 |
T14836 |
pcomp |
evaluating,by |
| R3937 |
T14838 |
T14839 |
amod |
several,features |
| R3938 |
T14839 |
T14837 |
dobj |
features,evaluating |
| R3939 |
T14840 |
T14839 |
amod |
characteristic,features |
| R394 |
T4159 |
T4158 |
nsubj |
they,proceed |
| R3940 |
T14841 |
T14842 |
compound |
XY,body |
| R3941 |
T14842 |
T14839 |
compound |
body,features |
| R3942 |
T14843 |
T14839 |
compound |
chromatin,features |
| R3943 |
T14844 |
T14826 |
punct |
.,asked |
| R3944 |
T14846 |
T14847 |
advmod |
First,tested |
| R3945 |
T14848 |
T14847 |
punct |
", ",tested |
| R3946 |
T14849 |
T14847 |
nsubj |
we,tested |
| R3947 |
T14850 |
T14851 |
compound |
γH2AX,expression |
| R3948 |
T14851 |
T14847 |
dobj |
expression,tested |
| R3949 |
T14852 |
T14847 |
prep |
by,tested |
| R395 |
T4058 |
T4059 |
det |
the,morphology |
| R3950 |
T14853 |
T14854 |
amod |
immunofluorescent,staining |
| R3951 |
T14854 |
T14852 |
pobj |
staining,by |
| R3952 |
T14855 |
T14847 |
punct |
.,tested |
| R3953 |
T14857 |
T14858 |
nsubj |
H2AX,is |
| R3954 |
T14859 |
T14860 |
det |
a,variant |
| R3955 |
T14860 |
T14858 |
attr |
variant,is |
| R3956 |
T14861 |
T14860 |
prep |
of,variant |
| R3957 |
T14862 |
T14861 |
pobj |
H2A,of |
| R3958 |
T14863 |
T14864 |
dep |
that,is |
| R3959 |
T14864 |
T14860 |
relcl |
is,variant |
| R396 |
T4160 |
T4158 |
prep |
to,proceed |
| R3960 |
T14865 |
T14864 |
acomp |
crucial,is |
| R3961 |
T14866 |
T14865 |
prep |
for,crucial |
| R3962 |
T14867 |
T14868 |
compound |
XY,body |
| R3963 |
T14868 |
T14869 |
compound |
body,formation |
| R3964 |
T14869 |
T14866 |
pobj |
formation,for |
| R3965 |
T14870 |
T14869 |
cc |
and,formation |
| R3966 |
T14871 |
T14869 |
conj |
MSCI,formation |
| R3967 |
T14872 |
T14873 |
punct |
[,12 |
| R3968 |
T14873 |
T14858 |
parataxis |
12,is |
| R3969 |
T14874 |
T14873 |
punct |
],12 |
| R397 |
T4161 |
T4160 |
pobj |
metaphase,to |
| R3970 |
T14875 |
T14858 |
punct |
.,is |
| R3971 |
T14877 |
T14878 |
nsubj |
γH2AX,localized |
| R3972 |
T14879 |
T14878 |
advmod |
normally,localized |
| R3973 |
T14880 |
T14878 |
prep |
to,localized |
| R3974 |
T14881 |
T14882 |
det |
the,body |
| R3975 |
T14882 |
T14880 |
pobj |
body,to |
| R3976 |
T14883 |
T14882 |
compound |
XY,body |
| R3977 |
T14884 |
T14882 |
prep |
of,body |
| R3978 |
T14885 |
T14886 |
compound |
DMRT7,cells |
| R3979 |
T14886 |
T14884 |
pobj |
cells,of |
| R398 |
T4162 |
T4161 |
nummod |
II,metaphase |
| R3980 |
T14887 |
T14886 |
compound |
mutant,cells |
| R3981 |
T14888 |
T14878 |
prep |
in,localized |
| R3982 |
T14889 |
T14890 |
amod |
meiotic,spreads |
| R3983 |
T14890 |
T14888 |
pobj |
spreads,in |
| R3984 |
T14891 |
T14892 |
punct |
(,7A |
| R3985 |
T14892 |
T14878 |
parataxis |
7A,localized |
| R3986 |
T14893 |
T14892 |
compound |
Figure,7A |
| R3987 |
T14894 |
T14892 |
punct |
),7A |
| R3988 |
T14895 |
T14878 |
punct |
", ",localized |
| R3989 |
T14896 |
T14878 |
cc |
and,localized |
| R399 |
T4163 |
T4148 |
cc |
and,recruited |
| R3990 |
T14897 |
T14898 |
amod |
many,puncta |
| R3991 |
T14898 |
T14902 |
nsubj |
puncta,were |
| R3992 |
T14899 |
T14900 |
npadvmod |
γH2AX,positive |
| R3993 |
T14900 |
T14898 |
amod |
positive,puncta |
| R3994 |
T14901 |
T14900 |
punct |
-,positive |
| R3995 |
T14902 |
T14878 |
conj |
were,localized |
| R3996 |
T14903 |
T14902 |
acomp |
present,were |
| R3997 |
T14904 |
T14902 |
prep |
in,were |
| R3998 |
T14905 |
T14906 |
compound |
germ,cells |
| R3999 |
T14906 |
T14904 |
pobj |
cells,in |
| R40 |
T934 |
T931 |
appos |
Doublesex,regulators |
| R400 |
T4059 |
T4056 |
nsubj |
morphology,is |
| R4000 |
T14907 |
T14906 |
prep |
of,cells |
| R4001 |
T14908 |
T14909 |
compound |
Dmrt7,mutant |
| R4002 |
T14909 |
T14910 |
compound |
mutant,testes |
| R4003 |
T14910 |
T14907 |
pobj |
testes,of |
| R4004 |
T14911 |
T14912 |
punct |
(,7B |
| R4005 |
T14912 |
T14902 |
parataxis |
7B,were |
| R4006 |
T14913 |
T14912 |
compound |
Figure,7B |
| R4007 |
T14914 |
T14912 |
punct |
),7B |
| R4008 |
T14915 |
T14902 |
punct |
.,were |
| R4009 |
T14917 |
T14918 |
advmod |
Next,examined |
| R401 |
T4164 |
T4165 |
advmod |
then,complete |
| R4010 |
T14919 |
T14918 |
punct |
", ",examined |
| R4011 |
T14920 |
T14918 |
nsubj |
we,examined |
| R4012 |
T14921 |
T14922 |
nmod |
SUMO,localization |
| R4013 |
T14922 |
T14918 |
dobj |
localization,examined |
| R4014 |
T14923 |
T14921 |
punct |
-,SUMO |
| R4015 |
T14924 |
T14921 |
nummod |
1,SUMO |
| R4016 |
T14925 |
T14918 |
prep |
in,examined |
| R4017 |
T14926 |
T14927 |
det |
the,testis |
| R4018 |
T14927 |
T14925 |
pobj |
testis,in |
| R4019 |
T14928 |
T14927 |
compound |
mutant,testis |
| R402 |
T4165 |
T4148 |
conj |
complete,recruited |
| R4020 |
T14929 |
T14918 |
punct |
.,examined |
| R4021 |
T14931 |
T14932 |
nmod |
SUMO,expression |
| R4022 |
T14932 |
T14935 |
nsubj |
expression,increases |
| R4023 |
T14933 |
T14931 |
punct |
-,SUMO |
| R4024 |
T14934 |
T14931 |
nummod |
1,SUMO |
| R4025 |
T14936 |
T14935 |
advmod |
normally,increases |
| R4026 |
T14937 |
T14935 |
prep |
in,increases |
| R4027 |
T14938 |
T14939 |
det |
the,body |
| R4028 |
T14939 |
T14937 |
pobj |
body,in |
| R4029 |
T14940 |
T14939 |
compound |
XY,body |
| R403 |
T4060 |
T4059 |
prep |
of,morphology |
| R4030 |
T14941 |
T14939 |
prep |
of,body |
| R4031 |
T14942 |
T14943 |
amod |
early,spermatocytes |
| R4032 |
T14943 |
T14941 |
pobj |
spermatocytes,of |
| R4033 |
T14944 |
T14942 |
punct |
-,early |
| R4034 |
T14945 |
T14942 |
prep |
to,early |
| R4035 |
T14946 |
T14945 |
pobj |
mid-pachytene,to |
| R4036 |
T14947 |
T14935 |
prep |
at,increases |
| R4037 |
T14948 |
T14949 |
det |
the,time |
| R4038 |
T14949 |
T14947 |
pobj |
time,at |
| R4039 |
T14950 |
T14949 |
prep |
of,time |
| R404 |
T4166 |
T4165 |
dobj |
meiosis,complete |
| R4040 |
T14951 |
T14952 |
compound |
sex,chromosome |
| R4041 |
T14952 |
T14953 |
compound |
chromosome,condensation |
| R4042 |
T14953 |
T14950 |
pobj |
condensation,of |
| R4043 |
T14954 |
T14935 |
punct |
.,increases |
| R4044 |
T14956 |
T14957 |
prep |
Prior,disappears |
| R4045 |
T14958 |
T14956 |
prep |
to,Prior |
| R4046 |
T14959 |
T14960 |
det |
the,completion |
| R4047 |
T14960 |
T14958 |
pobj |
completion,to |
| R4048 |
T14961 |
T14960 |
prep |
of,completion |
| R4049 |
T14962 |
T14963 |
det |
the,division |
| R405 |
T4167 |
T4168 |
mark |
after,occurs |
| R4050 |
T14963 |
T14961 |
pobj |
division,of |
| R4051 |
T14964 |
T14963 |
amod |
first,division |
| R4052 |
T14965 |
T14963 |
amod |
meiotic,division |
| R4053 |
T14966 |
T14957 |
punct |
", ",disappears |
| R4054 |
T14967 |
T14957 |
nsubj |
SUMO,disappears |
| R4055 |
T14968 |
T14967 |
punct |
-,SUMO |
| R4056 |
T14969 |
T14967 |
nummod |
1,SUMO |
| R4057 |
T14970 |
T14957 |
prep |
from,disappears |
| R4058 |
T14971 |
T14972 |
det |
the,body |
| R4059 |
T14972 |
T14970 |
pobj |
body,from |
| R406 |
T4168 |
T4165 |
advcl |
occurs,complete |
| R4060 |
T14973 |
T14972 |
compound |
XY,body |
| R4061 |
T14974 |
T14975 |
mark |
as,desynapse |
| R4062 |
T14975 |
T14957 |
advcl |
desynapse,disappears |
| R4063 |
T14976 |
T14977 |
det |
the,chromosomes |
| R4064 |
T14977 |
T14975 |
nsubj |
chromosomes,desynapse |
| R4065 |
T14978 |
T14977 |
nmod |
X,chromosomes |
| R4066 |
T14979 |
T14978 |
cc |
and,X |
| R4067 |
T14980 |
T14978 |
conj |
Y,X |
| R4068 |
T14981 |
T14982 |
punct |
[,40 |
| R4069 |
T14982 |
T14957 |
parataxis |
40,disappears |
| R407 |
T4061 |
T4062 |
det |
the,gametes |
| R4070 |
T14983 |
T14982 |
punct |
],40 |
| R4071 |
T14984 |
T14957 |
punct |
.,disappears |
| R4072 |
T14986 |
T14987 |
amod |
Punctate,localization |
| R4073 |
T14987 |
T14991 |
nsubj |
localization,was |
| R4074 |
T14988 |
T14987 |
nmod |
SUMO,localization |
| R4075 |
T14989 |
T14988 |
punct |
-,SUMO |
| R4076 |
T14990 |
T14988 |
nummod |
1,SUMO |
| R4077 |
T14992 |
T14991 |
acomp |
present,was |
| R4078 |
T14993 |
T14991 |
prep |
in,was |
| R4079 |
T14994 |
T14995 |
compound |
Dmrt7,cells |
| R408 |
T4169 |
T4168 |
nsubj |
fertilization,occurs |
| R4080 |
T14995 |
T14993 |
pobj |
cells,in |
| R4081 |
T14996 |
T14995 |
compound |
mutant,cells |
| R4082 |
T14997 |
T14995 |
compound |
germ,cells |
| R4083 |
T14998 |
T14991 |
punct |
", ",was |
| R4084 |
T14999 |
T15000 |
advmod |
again,consistent |
| R4085 |
T15000 |
T14991 |
advcl |
consistent,was |
| R4086 |
T15001 |
T15000 |
prep |
with,consistent |
| R4087 |
T15002 |
T15001 |
pobj |
formation,with |
| R4088 |
T15003 |
T15002 |
prep |
of,formation |
| R4089 |
T15004 |
T15005 |
det |
a,body |
| R409 |
T4170 |
T4171 |
punct |
[,2 |
| R4090 |
T15005 |
T15003 |
pobj |
body,of |
| R4091 |
T15006 |
T15007 |
advmod |
correctly,marked |
| R4092 |
T15007 |
T15005 |
amod |
marked,body |
| R4093 |
T15008 |
T15005 |
compound |
XY,body |
| R4094 |
T15009 |
T15010 |
punct |
(,7C |
| R4095 |
T15010 |
T14991 |
parataxis |
7C,was |
| R4096 |
T15011 |
T15010 |
compound |
Figure,7C |
| R4097 |
T15012 |
T15010 |
punct |
),7C |
| R4098 |
T15013 |
T14991 |
punct |
.,was |
| R4099 |
T15015 |
T15016 |
advmod |
However,had |
| R41 |
T833 |
T834 |
nsubj |
Gametogenesis,is |
| R410 |
T4171 |
T4165 |
parataxis |
2,complete |
| R4100 |
T15017 |
T15016 |
punct |
", ",had |
| R4101 |
T15018 |
T15019 |
det |
some,tubules |
| R4102 |
T15019 |
T15016 |
nsubj |
tubules,had |
| R4103 |
T15020 |
T15019 |
prep |
in,tubules |
| R4104 |
T15021 |
T15020 |
pobj |
mutants,in |
| R4105 |
T15022 |
T15023 |
amod |
multiple,layers |
| R4106 |
T15023 |
T15016 |
dobj |
layers,had |
| R4107 |
T15024 |
T15023 |
prep |
of,layers |
| R4108 |
T15025 |
T15024 |
pobj |
cells,of |
| R4109 |
T15026 |
T15023 |
prep |
with,layers |
| R411 |
T4172 |
T4171 |
punct |
],2 |
| R4110 |
T15027 |
T15028 |
npadvmod |
SUMO,condensed |
| R4111 |
T15028 |
T15032 |
amod |
condensed,spots |
| R4112 |
T15029 |
T15027 |
punct |
-,SUMO |
| R4113 |
T15030 |
T15027 |
nummod |
1,SUMO |
| R4114 |
T15031 |
T15028 |
punct |
-,condensed |
| R4115 |
T15032 |
T15026 |
pobj |
spots,with |
| R4116 |
T15033 |
T15034 |
punct |
(,7C |
| R4117 |
T15034 |
T15032 |
parataxis |
7C,spots |
| R4118 |
T15035 |
T15034 |
compound |
Figure,7C |
| R4119 |
T15036 |
T15034 |
punct |
),7C |
| R412 |
T4173 |
T4148 |
punct |
.,recruited |
| R4120 |
T15037 |
T15032 |
punct |
", ",spots |
| R4121 |
T15038 |
T15039 |
advmod |
rather,than |
| R4122 |
T15039 |
T15032 |
cc |
than,spots |
| R4123 |
T15040 |
T15041 |
det |
the,layer |
| R4124 |
T15041 |
T15032 |
conj |
layer,spots |
| R4125 |
T15042 |
T15041 |
amod |
normal,layer |
| R4126 |
T15043 |
T15041 |
amod |
single,layer |
| R4127 |
T15044 |
T15041 |
prep |
of,layer |
| R4128 |
T15045 |
T15044 |
pobj |
cells,of |
| R4129 |
T15046 |
T15016 |
punct |
.,had |
| R413 |
T4175 |
T4176 |
prep |
In,occurs |
| R4130 |
T15048 |
T15049 |
det |
This,accumulation |
| R4131 |
T15049 |
T15050 |
nsubj |
accumulation,was |
| R4132 |
T15051 |
T15049 |
prep |
of,accumulation |
| R4133 |
T15052 |
T15053 |
compound |
XY,body |
| R4134 |
T15053 |
T15054 |
npadvmod |
body,containing |
| R4135 |
T15054 |
T15056 |
amod |
containing,cells |
| R4136 |
T15055 |
T15054 |
punct |
–,containing |
| R4137 |
T15056 |
T15051 |
pobj |
cells,of |
| R4138 |
T15057 |
T15050 |
advmod |
also,was |
| R4139 |
T15058 |
T15050 |
acomp |
apparent,was |
| R414 |
T4062 |
T4060 |
pobj |
gametes,of |
| R4140 |
T15059 |
T15050 |
prep |
with,was |
| R4141 |
T15060 |
T15061 |
compound |
γH2AX,staining |
| R4142 |
T15061 |
T15059 |
pobj |
staining,with |
| R4143 |
T15062 |
T15050 |
cc |
and,was |
| R4144 |
T15063 |
T15050 |
conj |
is,was |
| R4145 |
T15064 |
T15063 |
acomp |
consistent,is |
| R4146 |
T15065 |
T15064 |
prep |
with,consistent |
| R4147 |
T15066 |
T15067 |
det |
a,arrest |
| R4148 |
T15067 |
T15065 |
pobj |
arrest,with |
| R4149 |
T15068 |
T15067 |
amod |
developmental,arrest |
| R415 |
T4177 |
T4175 |
pobj |
contrast,In |
| R4150 |
T15069 |
T15067 |
prep |
of,arrest |
| R4151 |
T15070 |
T15071 |
compound |
mutant,cells |
| R4152 |
T15071 |
T15069 |
pobj |
cells,of |
| R4153 |
T15072 |
T15067 |
prep |
in,arrest |
| R4154 |
T15073 |
T15074 |
amod |
mid,pachytene |
| R4155 |
T15074 |
T15072 |
pobj |
pachytene,in |
| R4156 |
T15075 |
T15073 |
punct |
-,mid |
| R4157 |
T15076 |
T15073 |
prep |
to,mid |
| R4158 |
T15077 |
T15076 |
amod |
late,to |
| R4159 |
T15078 |
T15074 |
punct |
-,pachytene |
| R416 |
T4178 |
T4176 |
punct |
", ",occurs |
| R4160 |
T15079 |
T15050 |
punct |
.,was |
| R4161 |
T15081 |
T15082 |
nsubj |
We,examined |
| R4162 |
T15083 |
T15082 |
advmod |
also,examined |
| R4163 |
T15084 |
T15085 |
compound |
Ub,H2A |
| R4164 |
T15085 |
T15087 |
compound |
H2A,localization |
| R4165 |
T15086 |
T15085 |
punct |
-,H2A |
| R4166 |
T15087 |
T15082 |
dobj |
localization,examined |
| R4167 |
T15088 |
T15087 |
prep |
in,localization |
| R4168 |
T15089 |
T15090 |
compound |
Dmrt7,mutant |
| R4169 |
T15090 |
T15091 |
compound |
mutant,testes |
| R417 |
T4064 |
T4065 |
dep |
what,defines |
| R4170 |
T15091 |
T15088 |
pobj |
testes,in |
| R4171 |
T15092 |
T15082 |
punct |
.,examined |
| R4172 |
T15094 |
T15095 |
prep |
In,concentrated |
| R4173 |
T15095 |
T15104 |
ccomp |
concentrated,observed |
| R4174 |
T15096 |
T15097 |
amod |
early,pachytene |
| R4175 |
T15097 |
T15094 |
pobj |
pachytene,In |
| R4176 |
T15098 |
T15097 |
punct |
-,pachytene |
| R4177 |
T15099 |
T15095 |
punct |
", ",concentrated |
| R4178 |
T15100 |
T15101 |
compound |
Ub,H2A |
| R4179 |
T15101 |
T15095 |
nsubjpass |
H2A,concentrated |
| R418 |
T4179 |
T4180 |
amod |
male,meiosis |
| R4180 |
T15102 |
T15101 |
punct |
-,H2A |
| R4181 |
T15103 |
T15095 |
auxpass |
is,concentrated |
| R4182 |
T15105 |
T15095 |
prep |
in,concentrated |
| R4183 |
T15106 |
T15107 |
det |
the,body |
| R4184 |
T15107 |
T15105 |
pobj |
body,in |
| R4185 |
T15108 |
T15107 |
compound |
XY,body |
| R4186 |
T15109 |
T15104 |
punct |
;,observed |
| R4187 |
T15110 |
T15104 |
prep |
by,observed |
| R4188 |
T15111 |
T15110 |
pobj |
mid-pachytene,by |
| R4189 |
T15112 |
T15113 |
compound |
Ub,H2A |
| R419 |
T4180 |
T4176 |
nsubj |
meiosis,occurs |
| R4190 |
T15113 |
T15104 |
nsubjpass |
H2A,observed |
| R4191 |
T15114 |
T15113 |
punct |
-,H2A |
| R4192 |
T15115 |
T15104 |
auxpass |
is,observed |
| R4193 |
T15116 |
T15104 |
prep |
throughout,observed |
| R4194 |
T15117 |
T15118 |
det |
the,nucleus |
| R4195 |
T15118 |
T15116 |
pobj |
nucleus,throughout |
| R4196 |
T15119 |
T15118 |
amod |
entire,nucleus |
| R4197 |
T15120 |
T15104 |
punct |
", ",observed |
| R4198 |
T15121 |
T15104 |
cc |
but,observed |
| R4199 |
T15122 |
T15123 |
nsubj |
it,becomes |
| R42 |
T935 |
T934 |
cc |
and,Doublesex |
| R420 |
T4181 |
T4182 |
advmod |
entirely,postnatally |
| R4200 |
T15123 |
T15104 |
conj |
becomes,observed |
| R4201 |
T15124 |
T15123 |
advmod |
again,becomes |
| R4202 |
T15125 |
T15123 |
acomp |
limited,becomes |
| R4203 |
T15126 |
T15125 |
prep |
to,limited |
| R4204 |
T15127 |
T15128 |
det |
the,body |
| R4205 |
T15128 |
T15126 |
pobj |
body,to |
| R4206 |
T15129 |
T15128 |
compound |
XY,body |
| R4207 |
T15130 |
T15123 |
prep |
in,becomes |
| R4208 |
T15131 |
T15132 |
amod |
late,pachytene |
| R4209 |
T15132 |
T15134 |
compound |
pachytene,spermatocytes |
| R421 |
T4182 |
T4176 |
advmod |
postnatally,occurs |
| R4210 |
T15133 |
T15132 |
punct |
-,pachytene |
| R4211 |
T15134 |
T15130 |
pobj |
spermatocytes,in |
| R4212 |
T15135 |
T15136 |
punct |
[,13 |
| R4213 |
T15136 |
T15123 |
parataxis |
13,becomes |
| R4214 |
T15137 |
T15136 |
punct |
],13 |
| R4215 |
T15138 |
T15104 |
punct |
.,observed |
| R4216 |
T15140 |
T15141 |
nsubj |
Analysis,revealed |
| R4217 |
T15142 |
T15140 |
prep |
of,Analysis |
| R4218 |
T15143 |
T15144 |
amod |
nuclear,spreads |
| R4219 |
T15144 |
T15142 |
pobj |
spreads,of |
| R422 |
T4065 |
T4056 |
ccomp |
defines,is |
| R4220 |
T15145 |
T15146 |
mark |
that,localizes |
| R4221 |
T15146 |
T15141 |
ccomp |
localizes,revealed |
| R4222 |
T15147 |
T15148 |
compound |
Ub,H2A |
| R4223 |
T15148 |
T15146 |
nsubj |
H2A,localizes |
| R4224 |
T15149 |
T15148 |
punct |
-,H2A |
| R4225 |
T15150 |
T15146 |
advmod |
normally,localizes |
| R4226 |
T15151 |
T15146 |
prep |
to,localizes |
| R4227 |
T15152 |
T15153 |
det |
the,body |
| R4228 |
T15153 |
T15151 |
pobj |
body,to |
| R4229 |
T15154 |
T15153 |
compound |
XY,body |
| R423 |
T4183 |
T4176 |
punct |
", ",occurs |
| R4230 |
T15155 |
T15146 |
prep |
in,localizes |
| R4231 |
T15156 |
T15157 |
compound |
Dmrt7,mutants |
| R4232 |
T15157 |
T15155 |
pobj |
mutants,in |
| R4233 |
T15158 |
T15159 |
punct |
(,S4 |
| R4234 |
T15159 |
T15141 |
parataxis |
S4,revealed |
| R4235 |
T15160 |
T15159 |
compound |
Figure,S4 |
| R4236 |
T15161 |
T15159 |
punct |
),S4 |
| R4237 |
T15162 |
T15141 |
punct |
.,revealed |
| R4238 |
T15164 |
T15165 |
advmod |
Collectively,indicate |
| R4239 |
T15166 |
T15165 |
punct |
", ",indicate |
| R424 |
T4184 |
T4176 |
prep |
without,occurs |
| R4240 |
T15167 |
T15168 |
det |
these,results |
| R4241 |
T15168 |
T15165 |
nsubj |
results,indicate |
| R4242 |
T15169 |
T15170 |
mark |
that,establish |
| R4243 |
T15170 |
T15165 |
ccomp |
establish,indicate |
| R4244 |
T15171 |
T15172 |
compound |
Dmrt7,cells |
| R4245 |
T15172 |
T15170 |
nsubj |
cells,establish |
| R4246 |
T15173 |
T15172 |
compound |
mutant,cells |
| R4247 |
T15174 |
T15172 |
compound |
germ,cells |
| R4248 |
T15175 |
T15170 |
aux |
can,establish |
| R4249 |
T15176 |
T15177 |
det |
an,body |
| R425 |
T4066 |
T4065 |
dobj |
sex,defines |
| R4250 |
T15177 |
T15170 |
dobj |
body,establish |
| R4251 |
T15178 |
T15177 |
compound |
XY,body |
| R4252 |
T15179 |
T15170 |
prep |
with,establish |
| R4253 |
T15180 |
T15181 |
advmod |
at,least |
| R4254 |
T15181 |
T15182 |
advmod |
least,some |
| R4255 |
T15182 |
T15179 |
pobj |
some,with |
| R4256 |
T15183 |
T15182 |
prep |
of,some |
| R4257 |
T15184 |
T15185 |
det |
the,marks |
| R4258 |
T15185 |
T15183 |
pobj |
marks,of |
| R4259 |
T15186 |
T15185 |
amod |
normal,marks |
| R426 |
T4185 |
T4186 |
det |
the,periods |
| R4260 |
T15187 |
T15185 |
compound |
chromatin,marks |
| R4261 |
T15188 |
T15165 |
punct |
.,indicate |
| R4262 |
T17284 |
T17285 |
amod |
Abnormal,Chromatin |
| R4263 |
T17286 |
T17285 |
compound |
Sex,Chromatin |
| R4264 |
T17287 |
T17285 |
prep |
in,Chromatin |
| R4265 |
T17288 |
T17289 |
compound |
Dmrt7,Mutant |
| R4266 |
T17289 |
T17290 |
compound |
Mutant,Cells |
| R4267 |
T17290 |
T17287 |
pobj |
Cells,in |
| R4268 |
T17291 |
T17290 |
compound |
Germ,Cells |
| R4269 |
T17293 |
T17294 |
mark |
Although,form |
| R427 |
T4186 |
T4184 |
pobj |
periods,without |
| R4270 |
T17294 |
T17299 |
advcl |
form,considered |
| R4271 |
T17295 |
T17296 |
det |
the,body |
| R4272 |
T17296 |
T17294 |
nsubj |
body,form |
| R4273 |
T17297 |
T17296 |
compound |
XY,body |
| R4274 |
T17298 |
T17294 |
aux |
can,form |
| R4275 |
T17300 |
T17294 |
prep |
during,form |
| R4276 |
T17301 |
T17300 |
pobj |
pachynema,during |
| R4277 |
T17302 |
T17294 |
prep |
in,form |
| R4278 |
T17303 |
T17304 |
compound |
Dmrt7,mutants |
| R4279 |
T17304 |
T17302 |
pobj |
mutants,in |
| R428 |
T4187 |
T4186 |
compound |
arrest,periods |
| R4280 |
T17305 |
T17299 |
punct |
", ",considered |
| R4281 |
T17306 |
T17299 |
nsubj |
we,considered |
| R4282 |
T17307 |
T17308 |
det |
the,possibility |
| R4283 |
T17308 |
T17299 |
dobj |
possibility,considered |
| R4284 |
T17309 |
T17310 |
mark |
that,established |
| R4285 |
T17310 |
T17308 |
acl |
established,possibility |
| R4286 |
T17311 |
T17312 |
amod |
transcriptional,silencing |
| R4287 |
T17312 |
T17310 |
nsubjpass |
silencing,established |
| R4288 |
T17313 |
T17310 |
aux |
might,established |
| R4289 |
T17314 |
T17310 |
neg |
not,established |
| R429 |
T4067 |
T4063 |
punct |
: ,are |
| R4290 |
T17315 |
T17310 |
auxpass |
be,established |
| R4291 |
T17316 |
T17310 |
advmod |
properly,established |
| R4292 |
T17317 |
T17299 |
punct |
.,considered |
| R4293 |
T17319 |
T17320 |
nsubj |
This,be |
| R4294 |
T17320 |
T17322 |
ccomp |
be,eliminated |
| R4295 |
T17321 |
T17320 |
aux |
would,be |
| R4296 |
T17323 |
T17320 |
acomp |
consistent,be |
| R4297 |
T17324 |
T17323 |
prep |
with,consistent |
| R4298 |
T17325 |
T17326 |
det |
the,phenotype |
| R4299 |
T17326 |
T17324 |
pobj |
phenotype,with |
| R43 |
T936 |
T934 |
conj |
MAB,Doublesex |
| R430 |
T4188 |
T4186 |
acl |
found,periods |
| R4300 |
T17327 |
T17326 |
compound |
Dmrt7,phenotype |
| R4301 |
T17328 |
T17322 |
punct |
: ,eliminated |
| R4302 |
T17329 |
T17330 |
compound |
pachytene,cells |
| R4303 |
T17330 |
T17322 |
nsubjpass |
cells,eliminated |
| R4304 |
T17331 |
T17332 |
dep |
that,escape |
| R4305 |
T17332 |
T17330 |
relcl |
escape,cells |
| R4306 |
T17333 |
T17332 |
prep |
from,escape |
| R4307 |
T17334 |
T17333 |
pobj |
MSCI,from |
| R4308 |
T17335 |
T17322 |
advmod |
normally,eliminated |
| R4309 |
T17336 |
T17322 |
auxpass |
are,eliminated |
| R431 |
T4189 |
T4188 |
prep |
in,found |
| R4310 |
T17337 |
T17322 |
prep |
prior,eliminated |
| R4311 |
T17338 |
T17337 |
prep |
to,prior |
| R4312 |
T17339 |
T17340 |
amod |
late,pachytene |
| R4313 |
T17340 |
T17338 |
pobj |
pachytene,to |
| R4314 |
T17341 |
T17340 |
punct |
-,pachytene |
| R4315 |
T17342 |
T17343 |
punct |
[,17 |
| R4316 |
T17343 |
T17322 |
parataxis |
17,eliminated |
| R4317 |
T17344 |
T17343 |
punct |
],17 |
| R4318 |
T17345 |
T17322 |
punct |
.,eliminated |
| R4319 |
T17347 |
T17348 |
advmod |
Recently,shown |
| R432 |
T4190 |
T4189 |
pobj |
females,in |
| R4320 |
T17349 |
T17348 |
punct |
", ",shown |
| R4321 |
T17350 |
T17348 |
nsubjpass |
MSCI,shown |
| R4322 |
T17351 |
T17348 |
aux |
has,shown |
| R4323 |
T17352 |
T17348 |
auxpass |
been,shown |
| R4324 |
T17353 |
T17354 |
aux |
to,continue |
| R4325 |
T17354 |
T17348 |
xcomp |
continue,shown |
| R4326 |
T17355 |
T17354 |
prep |
into,continue |
| R4327 |
T17356 |
T17355 |
pobj |
meiosis,into |
| R4328 |
T17357 |
T17356 |
nummod |
II,meiosis |
| R4329 |
T17358 |
T17356 |
cc |
and,meiosis |
| R433 |
T4068 |
T4063 |
nsubj |
females,are |
| R4330 |
T17359 |
T17356 |
conj |
spermiogenesis,meiosis |
| R4331 |
T17360 |
T17354 |
punct |
", ",continue |
| R4332 |
T17361 |
T17362 |
advmod |
apparently,mediated |
| R4333 |
T17362 |
T17354 |
advcl |
mediated,continue |
| R4334 |
T17363 |
T17362 |
prep |
by,mediated |
| R4335 |
T17364 |
T17365 |
det |
a,compartment |
| R4336 |
T17365 |
T17363 |
pobj |
compartment,by |
| R4337 |
T17366 |
T17365 |
amod |
distinct,compartment |
| R4338 |
T17367 |
T17365 |
compound |
chromatin,compartment |
| R4339 |
T17368 |
T17365 |
acl |
termed,compartment |
| R434 |
T4069 |
T4070 |
det |
the,sex |
| R4340 |
T17369 |
T17370 |
amod |
postmeiotic,chromatin |
| R4341 |
T17370 |
T17368 |
oprd |
chromatin,termed |
| R4342 |
T17371 |
T17370 |
compound |
sex,chromatin |
| R4343 |
T17372 |
T17370 |
punct |
(,chromatin |
| R4344 |
T17373 |
T17370 |
appos |
PMSC,chromatin |
| R4345 |
T17374 |
T17365 |
punct |
),compartment |
| R4346 |
T17375 |
T17376 |
dep |
that,established |
| R4347 |
T17376 |
T17365 |
relcl |
established,compartment |
| R4348 |
T17377 |
T17376 |
auxpass |
is,established |
| R4349 |
T17378 |
T17376 |
advcl |
starting,established |
| R435 |
T4191 |
T4176 |
punct |
.,occurs |
| R4350 |
T17379 |
T17378 |
prep |
in,starting |
| R4351 |
T17380 |
T17379 |
pobj |
diplonema,in |
| R4352 |
T17381 |
T17382 |
punct |
[,16 |
| R4353 |
T17382 |
T17348 |
parataxis |
16,shown |
| R4354 |
T17383 |
T17382 |
punct |
],16 |
| R4355 |
T17384 |
T17348 |
punct |
.,shown |
| R4356 |
T17386 |
T17387 |
nsubj |
We,asked |
| R4357 |
T17388 |
T17387 |
advmod |
therefore,asked |
| R4358 |
T17389 |
T17390 |
mark |
whether,associated |
| R4359 |
T17390 |
T17387 |
ccomp |
associated,asked |
| R436 |
T4070 |
T4063 |
attr |
sex,are |
| R4360 |
T17391 |
T17392 |
det |
the,death |
| R4361 |
T17392 |
T17390 |
nsubjpass |
death,associated |
| R4362 |
T17393 |
T17392 |
compound |
pachytene,death |
| R4363 |
T17394 |
T17395 |
compound |
germ,cell |
| R4364 |
T17395 |
T17392 |
compound |
cell,death |
| R4365 |
T17396 |
T17392 |
prep |
in,death |
| R4366 |
T17397 |
T17398 |
compound |
Dmrt7,mutants |
| R4367 |
T17398 |
T17396 |
pobj |
mutants,in |
| R4368 |
T17399 |
T17390 |
auxpass |
is,associated |
| R4369 |
T17400 |
T17390 |
prep |
with,associated |
| R437 |
T4193 |
T4194 |
prep |
In,produce |
| R4370 |
T17401 |
T17402 |
det |
a,failure |
| R4371 |
T17402 |
T17400 |
pobj |
failure,with |
| R4372 |
T17403 |
T17404 |
preconj |
either,initiate |
| R4373 |
T17404 |
T17402 |
acl |
initiate,failure |
| R4374 |
T17405 |
T17404 |
aux |
to,initiate |
| R4375 |
T17406 |
T17404 |
cc |
or,initiate |
| R4376 |
T17407 |
T17408 |
aux |
to,maintain |
| R4377 |
T17408 |
T17404 |
conj |
maintain,initiate |
| R4378 |
T17409 |
T17410 |
compound |
sex,chromosome |
| R4379 |
T17410 |
T17411 |
compound |
chromosome,inactivation |
| R438 |
T4195 |
T4193 |
pobj |
females,In |
| R4380 |
T17411 |
T17408 |
dobj |
inactivation,maintain |
| R4381 |
T17412 |
T17387 |
punct |
.,asked |
| R4382 |
T17414 |
T17415 |
advmod |
First,examined |
| R4383 |
T17416 |
T17415 |
punct |
", ",examined |
| R4384 |
T17417 |
T17415 |
nsubj |
we,examined |
| R4385 |
T17418 |
T17419 |
det |
the,body |
| R4386 |
T17419 |
T17415 |
dobj |
body,examined |
| R4387 |
T17420 |
T17419 |
amod |
mid-pachytene,body |
| R4388 |
T17421 |
T17419 |
compound |
XY,body |
| R4389 |
T17422 |
T17415 |
punct |
.,examined |
| R439 |
T4071 |
T4072 |
dep |
that,produces |
| R4390 |
T17424 |
T17425 |
aux |
To,examine |
| R4391 |
T17425 |
T17426 |
advcl |
examine,carried |
| R4392 |
T17427 |
T17428 |
nmod |
XY,status |
| R4393 |
T17428 |
T17425 |
dobj |
status,examine |
| R4394 |
T17429 |
T17428 |
amod |
transcriptional,status |
| R4395 |
T17430 |
T17426 |
punct |
", ",carried |
| R4396 |
T17431 |
T17426 |
nsubj |
we,carried |
| R4397 |
T17432 |
T17426 |
prt |
out,carried |
| R4398 |
T17433 |
T17434 |
nmod |
Cot,hybridization |
| R4399 |
T17434 |
T17426 |
dobj |
hybridization,carried |
| R44 |
T937 |
T936 |
punct |
-,MAB |
| R440 |
T4196 |
T4194 |
punct |
", ",produce |
| R4400 |
T17435 |
T17433 |
punct |
-,Cot |
| R4401 |
T17436 |
T17433 |
nummod |
1,Cot |
| R4402 |
T17437 |
T17434 |
nmod |
RNA,hybridization |
| R4403 |
T17438 |
T17434 |
nmod |
fluorescence,hybridization |
| R4404 |
T17439 |
T17440 |
advmod |
in,situ |
| R4405 |
T17440 |
T17434 |
amod |
situ,hybridization |
| R4406 |
T17441 |
T17434 |
punct |
(,hybridization |
| R4407 |
T17442 |
T17434 |
appos |
FISH,hybridization |
| R4408 |
T17443 |
T17434 |
punct |
),hybridization |
| R4409 |
T17444 |
T17445 |
aux |
to,detect |
| R441 |
T4197 |
T4198 |
det |
each,meiosis |
| R4410 |
T17445 |
T17426 |
advcl |
detect,carried |
| R4411 |
T17446 |
T17447 |
amod |
nascent,transcription |
| R4412 |
T17447 |
T17445 |
dobj |
transcription,detect |
| R4413 |
T17448 |
T17449 |
nmod |
RNA,polymerase |
| R4414 |
T17449 |
T17447 |
nmod |
polymerase,transcription |
| R4415 |
T17450 |
T17449 |
nummod |
II,polymerase |
| R4416 |
T17451 |
T17447 |
punct |
", ",transcription |
| R4417 |
T17452 |
T17447 |
acl |
combined,transcription |
| R4418 |
T17453 |
T17452 |
prep |
with,combined |
| R4419 |
T17454 |
T17455 |
compound |
DAPI,staining |
| R442 |
T4072 |
T4070 |
relcl |
produces,sex |
| R4420 |
T17455 |
T17453 |
pobj |
staining,with |
| R4421 |
T17456 |
T17457 |
aux |
to,locate |
| R4422 |
T17457 |
T17426 |
advcl |
locate,carried |
| R4423 |
T17458 |
T17459 |
det |
the,body |
| R4424 |
T17459 |
T17457 |
dobj |
body,locate |
| R4425 |
T17460 |
T17459 |
compound |
XY,body |
| R4426 |
T17461 |
T17457 |
prep |
on,locate |
| R4427 |
T17462 |
T17461 |
pobj |
spreads,on |
| R4428 |
T17463 |
T17462 |
prep |
of,spreads |
| R4429 |
T17464 |
T17465 |
amod |
seminiferous,tubules |
| R443 |
T4198 |
T4194 |
nsubj |
meiosis,produce |
| R4430 |
T17465 |
T17463 |
pobj |
tubules,of |
| R4431 |
T17466 |
T17467 |
punct |
(,8A |
| R4432 |
T17467 |
T17426 |
parataxis |
8A,carried |
| R4433 |
T17468 |
T17467 |
compound |
Figure,8A |
| R4434 |
T17469 |
T17467 |
cc |
and,8A |
| R4435 |
T17470 |
T17467 |
conj |
8B,8A |
| R4436 |
T17471 |
T17467 |
punct |
),8A |
| R4437 |
T17472 |
T17426 |
punct |
.,carried |
| R4438 |
T17474 |
T17475 |
prep |
In,formed |
| R4439 |
T17476 |
T17477 |
compound |
Dmrt7,mutants |
| R444 |
T4073 |
T4074 |
det |
the,gametes |
| R4440 |
T17477 |
T17474 |
pobj |
mutants,In |
| R4441 |
T17478 |
T17475 |
punct |
", ",formed |
| R4442 |
T17479 |
T17480 |
det |
the,body |
| R4443 |
T17480 |
T17475 |
nsubjpass |
body,formed |
| R4444 |
T17481 |
T17480 |
compound |
XY,body |
| R4445 |
T17482 |
T17475 |
auxpass |
was,formed |
| R4446 |
T17483 |
T17475 |
cc |
and,formed |
| R4447 |
T17484 |
T17475 |
conj |
excluded,formed |
| R4448 |
T17485 |
T17486 |
nmod |
Cot,hybridization |
| R4449 |
T17486 |
T17484 |
dobj |
hybridization,excluded |
| R445 |
T4074 |
T4072 |
dobj |
gametes,produces |
| R4450 |
T17487 |
T17485 |
punct |
-,Cot |
| R4451 |
T17488 |
T17485 |
nummod |
1,Cot |
| R4452 |
T17489 |
T17490 |
punct |
(,8B |
| R4453 |
T17490 |
T17475 |
parataxis |
8B,formed |
| R4454 |
T17491 |
T17490 |
compound |
Figure,8B |
| R4455 |
T17492 |
T17490 |
punct |
),8B |
| R4456 |
T17493 |
T17475 |
punct |
", ",formed |
| R4457 |
T17494 |
T17475 |
advcl |
indicating,formed |
| R4458 |
T17495 |
T17496 |
mark |
that,established |
| R4459 |
T17496 |
T17494 |
ccomp |
established,indicating |
| R446 |
T4075 |
T4074 |
amod |
larger,gametes |
| R4460 |
T17497 |
T17498 |
amod |
transcriptional,silencing |
| R4461 |
T17498 |
T17496 |
nsubjpass |
silencing,established |
| R4462 |
T17499 |
T17496 |
auxpass |
is,established |
| R4463 |
T17500 |
T17496 |
advmod |
normally,established |
| R4464 |
T17501 |
T17496 |
prep |
in,established |
| R4465 |
T17502 |
T17503 |
compound |
mutant,cells |
| R4466 |
T17503 |
T17501 |
pobj |
cells,in |
| R4467 |
T17504 |
T17503 |
compound |
pachytene,cells |
| R4468 |
T17505 |
T17475 |
punct |
.,formed |
| R4469 |
T17507 |
T17508 |
nsubj |
We,examined |
| R447 |
T4199 |
T4194 |
aux |
can,produce |
| R4470 |
T17509 |
T17508 |
advmod |
also,examined |
| R4471 |
T17510 |
T17508 |
dobj |
expression,examined |
| R4472 |
T17511 |
T17510 |
prep |
of,expression |
| R4473 |
T17512 |
T17513 |
det |
the,gene |
| R4474 |
T17513 |
T17511 |
pobj |
gene,of |
| R4475 |
T17514 |
T17515 |
npadvmod |
Y,linked |
| R4476 |
T17515 |
T17513 |
amod |
linked,gene |
| R4477 |
T17516 |
T17515 |
punct |
-,linked |
| R4478 |
T17517 |
T17513 |
appos |
Rbmy,gene |
| R4479 |
T17518 |
T17513 |
punct |
", ",gene |
| R448 |
T4076 |
T4063 |
cc |
and,are |
| R4480 |
T17519 |
T17520 |
dep |
which,inactivated |
| R4481 |
T17520 |
T17513 |
relcl |
inactivated,gene |
| R4482 |
T17521 |
T17520 |
advmod |
normally,inactivated |
| R4483 |
T17522 |
T17520 |
auxpass |
is,inactivated |
| R4484 |
T17523 |
T17520 |
prep |
during,inactivated |
| R4485 |
T17524 |
T17523 |
pobj |
pachytene,during |
| R4486 |
T17525 |
T17520 |
cc |
and,inactivated |
| R4487 |
T17526 |
T17520 |
conj |
reactivated,inactivated |
| R4488 |
T17527 |
T17528 |
mark |
after,begins |
| R4489 |
T17528 |
T17526 |
advcl |
begins,reactivated |
| R449 |
T4200 |
T4201 |
det |
a,oocyte |
| R4490 |
T17529 |
T17530 |
amod |
secondary,meiosis |
| R4491 |
T17530 |
T17528 |
nsubj |
meiosis,begins |
| R4492 |
T17531 |
T17532 |
punct |
[,55 |
| R4493 |
T17532 |
T17508 |
parataxis |
55,examined |
| R4494 |
T17533 |
T17532 |
nummod |
54,55 |
| R4495 |
T17534 |
T17532 |
punct |
",",55 |
| R4496 |
T17535 |
T17532 |
punct |
],55 |
| R4497 |
T17536 |
T17508 |
punct |
.,examined |
| R4498 |
T17538 |
T17539 |
nsubjpass |
Rbmy,inactivated |
| R4499 |
T17540 |
T17539 |
auxpass |
was,inactivated |
| R45 |
T938 |
T936 |
nummod |
3,MAB |
| R450 |
T4077 |
T4078 |
nsubj |
males,produce |
| R4500 |
T17541 |
T17539 |
advmod |
normally,inactivated |
| R4501 |
T17542 |
T17539 |
prep |
in,inactivated |
| R4502 |
T17543 |
T17544 |
compound |
pachytene,cells |
| R4503 |
T17544 |
T17542 |
pobj |
cells,in |
| R4504 |
T17545 |
T17544 |
prep |
of,cells |
| R4505 |
T17546 |
T17547 |
compound |
Dmrt7,mutants |
| R4506 |
T17547 |
T17545 |
pobj |
mutants,of |
| R4507 |
T17548 |
T17539 |
punct |
", ",inactivated |
| R4508 |
T17549 |
T17539 |
prep |
based,inactivated |
| R4509 |
T17550 |
T17549 |
prep |
on,based |
| R451 |
T4201 |
T4194 |
dobj |
oocyte,produce |
| R4510 |
T17551 |
T17552 |
amod |
immunofluorescent,staining |
| R4511 |
T17552 |
T17550 |
pobj |
staining,on |
| R4512 |
T17553 |
T17552 |
prep |
with,staining |
| R4513 |
T17554 |
T17555 |
det |
an,antibody |
| R4514 |
T17555 |
T17553 |
pobj |
antibody,with |
| R4515 |
T17556 |
T17555 |
amod |
anti-RBMY,antibody |
| R4516 |
T17557 |
T17558 |
punct |
(,S5 |
| R4517 |
T17558 |
T17539 |
parataxis |
S5,inactivated |
| R4518 |
T17559 |
T17558 |
compound |
Figure,S5 |
| R4519 |
T17560 |
T17558 |
punct |
),S5 |
| R452 |
T4202 |
T4201 |
amod |
single,oocyte |
| R4520 |
T17561 |
T17539 |
punct |
.,inactivated |
| R4521 |
T17563 |
T17564 |
nsubj |
We,examined |
| R4522 |
T17565 |
T17564 |
advmod |
also,examined |
| R4523 |
T17566 |
T17567 |
nmod |
heterochromatin,beta |
| R4524 |
T17567 |
T17564 |
dobj |
beta,examined |
| R4525 |
T17568 |
T17567 |
nmod |
protein,beta |
| R4526 |
T17569 |
T17567 |
nummod |
1,beta |
| R4527 |
T17570 |
T17567 |
punct |
(,beta |
| R4528 |
T17571 |
T17567 |
appos |
HP1β,beta |
| R4529 |
T17572 |
T17567 |
punct |
),beta |
| R453 |
T4203 |
T4201 |
compound |
haploid,oocyte |
| R4530 |
T17573 |
T17567 |
punct |
", ",beta |
| R4531 |
T17574 |
T17575 |
dep |
which,localizes |
| R4532 |
T17575 |
T17567 |
relcl |
localizes,beta |
| R4533 |
T17576 |
T17575 |
advmod |
normally,localizes |
| R4534 |
T17577 |
T17575 |
prep |
to,localizes |
| R4535 |
T17578 |
T17579 |
det |
the,centromere |
| R4536 |
T17579 |
T17577 |
pobj |
centromere,to |
| R4537 |
T17580 |
T17579 |
compound |
X,centromere |
| R4538 |
T17581 |
T17575 |
prep |
at,localizes |
| R4539 |
T17582 |
T17581 |
pobj |
mid-pachynema,at |
| R454 |
T4078 |
T4063 |
conj |
produce,are |
| R4540 |
T17583 |
T17575 |
cc |
and,localizes |
| R4541 |
T17584 |
T17585 |
advmod |
then,spreads |
| R4542 |
T17585 |
T17575 |
conj |
spreads,localizes |
| R4543 |
T17586 |
T17585 |
prep |
through,spreads |
| R4544 |
T17587 |
T17588 |
det |
the,body |
| R4545 |
T17588 |
T17586 |
pobj |
body,through |
| R4546 |
T17589 |
T17588 |
compound |
XY,body |
| R4547 |
T17590 |
T17591 |
mark |
as,internalizes |
| R4548 |
T17591 |
T17585 |
advcl |
internalizes,spreads |
| R4549 |
T17592 |
T17591 |
nsubj |
it,internalizes |
| R455 |
T4204 |
T4201 |
punct |
(,oocyte |
| R4550 |
T17593 |
T17591 |
prep |
during,internalizes |
| R4551 |
T17594 |
T17593 |
pobj |
diplonema,during |
| R4552 |
T17595 |
T17596 |
punct |
[,56 |
| R4553 |
T17596 |
T17567 |
parataxis |
56,beta |
| R4554 |
T17597 |
T17596 |
punct |
],56 |
| R4555 |
T17598 |
T17564 |
punct |
.,examined |
| R4556 |
T17600 |
T17601 |
nsubj |
We,found |
| R4557 |
T17602 |
T17603 |
mark |
that,is |
| R4558 |
T17603 |
T17601 |
ccomp |
is,found |
| R4559 |
T17604 |
T17605 |
compound |
HP1β,localization |
| R456 |
T4205 |
T4201 |
cc |
and,oocyte |
| R4560 |
T17605 |
T17603 |
nsubj |
localization,is |
| R4561 |
T17606 |
T17603 |
acomp |
normal,is |
| R4562 |
T17607 |
T17603 |
prep |
in,is |
| R4563 |
T17608 |
T17609 |
compound |
DMRT7,cells |
| R4564 |
T17609 |
T17607 |
pobj |
cells,in |
| R4565 |
T17610 |
T17609 |
compound |
mutant,cells |
| R4566 |
T17611 |
T17603 |
prep |
in,is |
| R4567 |
T17612 |
T17611 |
pobj |
mid-pachynema,in |
| R4568 |
T17613 |
T17614 |
punct |
(,8C |
| R4569 |
T17614 |
T17601 |
parataxis |
8C,found |
| R457 |
T4079 |
T4080 |
det |
the,ones |
| R4570 |
T17615 |
T17614 |
compound |
Figure,8C |
| R4571 |
T17616 |
T17614 |
cc |
and,8C |
| R4572 |
T17617 |
T17614 |
conj |
8D,8C |
| R4573 |
T17618 |
T17614 |
punct |
),8C |
| R4574 |
T17619 |
T17601 |
punct |
.,found |
| R4575 |
T17621 |
T17622 |
det |
These,results |
| R4576 |
T17622 |
T17623 |
nsubj |
results,suggest |
| R4577 |
T17624 |
T17625 |
mark |
that,occur |
| R4578 |
T17625 |
T17623 |
ccomp |
occur,suggest |
| R4579 |
T17626 |
T17627 |
compound |
XY,formation |
| R458 |
T4206 |
T4207 |
nummod |
two,bodies |
| R4580 |
T17627 |
T17625 |
nsubj |
formation,occur |
| R4581 |
T17628 |
T17627 |
compound |
body,formation |
| R4582 |
T17629 |
T17627 |
cc |
and,formation |
| R4583 |
T17630 |
T17627 |
conj |
initiation,formation |
| R4584 |
T17631 |
T17627 |
prep |
of,formation |
| R4585 |
T17632 |
T17631 |
pobj |
MSCI,of |
| R4586 |
T17633 |
T17627 |
appos |
both,formation |
| R4587 |
T17634 |
T17625 |
advmod |
normally,occur |
| R4588 |
T17635 |
T17625 |
prep |
in,occur |
| R4589 |
T17636 |
T17637 |
compound |
Dmrt7,mutant |
| R459 |
T4207 |
T4201 |
conj |
bodies,oocyte |
| R4590 |
T17637 |
T17638 |
compound |
mutant,cells |
| R4591 |
T17638 |
T17635 |
pobj |
cells,in |
| R4592 |
T17639 |
T17638 |
compound |
germ,cells |
| R4593 |
T17640 |
T17623 |
punct |
.,suggest |
| R4594 |
T17643 |
T17644 |
nsubj |
We,considered |
| R4595 |
T17645 |
T17644 |
advmod |
next,considered |
| R4596 |
T17646 |
T17647 |
det |
the,possibility |
| R4597 |
T17647 |
T17644 |
dobj |
possibility,considered |
| R4598 |
T17648 |
T17649 |
mark |
that,established |
| R4599 |
T17649 |
T17647 |
acl |
established,possibility |
| R46 |
T835 |
T836 |
det |
a,process |
| R460 |
T4208 |
T4207 |
amod |
extruded,bodies |
| R4600 |
T17650 |
T17651 |
compound |
sex,chromatin |
| R4601 |
T17651 |
T17649 |
nsubjpass |
chromatin,established |
| R4602 |
T17652 |
T17649 |
auxpass |
is,established |
| R4603 |
T17653 |
T17649 |
advmod |
normally,established |
| R4604 |
T17654 |
T17649 |
cc |
but,established |
| R4605 |
T17655 |
T17656 |
auxpass |
is,modified |
| R4606 |
T17656 |
T17649 |
conj |
modified,established |
| R4607 |
T17657 |
T17656 |
neg |
not,modified |
| R4608 |
T17658 |
T17656 |
advmod |
properly,modified |
| R4609 |
T17659 |
T17660 |
mark |
as,exit |
| R461 |
T4080 |
T4078 |
dobj |
ones,produce |
| R4610 |
T17660 |
T17656 |
advcl |
exit,modified |
| R4611 |
T17661 |
T17660 |
nsubj |
cells,exit |
| R4612 |
T17662 |
T17660 |
dobj |
pachynema,exit |
| R4613 |
T17663 |
T17660 |
cc |
and,exit |
| R4614 |
T17664 |
T17660 |
conj |
begin,exit |
| R4615 |
T17665 |
T17666 |
aux |
to,form |
| R4616 |
T17666 |
T17664 |
xcomp |
form,begin |
| R4617 |
T17667 |
T17666 |
dobj |
PMSC,form |
| R4618 |
T17668 |
T17644 |
punct |
.,considered |
| R4619 |
T17670 |
T17671 |
mark |
Although,eliminated |
| R462 |
T4209 |
T4207 |
amod |
polar,bodies |
| R4620 |
T17671 |
T17677 |
advcl |
eliminated,were |
| R4621 |
T17672 |
T17673 |
amod |
most,cells |
| R4622 |
T17673 |
T17671 |
nsubjpass |
cells,eliminated |
| R4623 |
T17674 |
T17673 |
compound |
Dmrt7,cells |
| R4624 |
T17675 |
T17673 |
compound |
mutant,cells |
| R4625 |
T17676 |
T17671 |
auxpass |
are,eliminated |
| R4626 |
T17678 |
T17671 |
prep |
by,eliminated |
| R4627 |
T17679 |
T17678 |
pobj |
apoptosis,by |
| R4628 |
T17680 |
T17671 |
prep |
prior,eliminated |
| R4629 |
T17681 |
T17680 |
prep |
to,prior |
| R463 |
T4210 |
T4194 |
punct |
),produce |
| R4630 |
T17682 |
T17681 |
pobj |
diplonema,to |
| R4631 |
T17683 |
T17677 |
punct |
", ",were |
| R4632 |
T17684 |
T17677 |
nsubj |
we,were |
| R4633 |
T17685 |
T17677 |
acomp |
able,were |
| R4634 |
T17686 |
T17687 |
aux |
to,examine |
| R4635 |
T17687 |
T17685 |
xcomp |
examine,able |
| R4636 |
T17688 |
T17689 |
amod |
epigenetic,markers |
| R4637 |
T17689 |
T17687 |
dobj |
markers,examine |
| R4638 |
T17690 |
T17689 |
prep |
of,markers |
| R4639 |
T17691 |
T17690 |
pobj |
PMSC,of |
| R464 |
T4211 |
T4194 |
punct |
", ",produce |
| R4640 |
T17692 |
T17689 |
prep |
in,markers |
| R4641 |
T17693 |
T17694 |
amod |
rare,spermatocytes |
| R4642 |
T17694 |
T17692 |
pobj |
spermatocytes,in |
| R4643 |
T17695 |
T17696 |
compound |
Dmrt7,mutant |
| R4644 |
T17696 |
T17694 |
compound |
mutant,spermatocytes |
| R4645 |
T17697 |
T17698 |
dep |
that,escaped |
| R4646 |
T17698 |
T17694 |
relcl |
escaped,spermatocytes |
| R4647 |
T17699 |
T17700 |
compound |
pachytene,arrest |
| R4648 |
T17700 |
T17698 |
dobj |
arrest,escaped |
| R4649 |
T17701 |
T17698 |
cc |
and,escaped |
| R465 |
T4212 |
T4213 |
mark |
whereas,produce |
| R4650 |
T17702 |
T17698 |
conj |
progressed,escaped |
| R4651 |
T17703 |
T17702 |
prep |
into,progressed |
| R4652 |
T17704 |
T17703 |
pobj |
diplonema,into |
| R4653 |
T17705 |
T17677 |
punct |
.,were |
| R4654 |
T17707 |
T17708 |
advmod |
First,examined |
| R4655 |
T17709 |
T17708 |
punct |
", ",examined |
| R4656 |
T17710 |
T17708 |
nsubj |
we,examined |
| R4657 |
T17711 |
T17712 |
amod |
nascent,transcription |
| R4658 |
T17712 |
T17708 |
dobj |
transcription,examined |
| R4659 |
T17713 |
T17708 |
prep |
by,examined |
| R466 |
T4213 |
T4194 |
advcl |
produce,produce |
| R4660 |
T17714 |
T17715 |
nmod |
Cot,hybridization |
| R4661 |
T17715 |
T17713 |
pobj |
hybridization,by |
| R4662 |
T17716 |
T17714 |
punct |
-,Cot |
| R4663 |
T17717 |
T17714 |
nummod |
1,Cot |
| R4664 |
T17718 |
T17708 |
punct |
.,examined |
| R4665 |
T17720 |
T17721 |
mark |
Although,showed |
| R4666 |
T17721 |
T17725 |
advcl |
showed,appeared |
| R4667 |
T17722 |
T17723 |
amod |
heterochromatic,regions |
| R4668 |
T17723 |
T17721 |
nsubj |
regions,showed |
| R4669 |
T17724 |
T17721 |
advmod |
generally,showed |
| R467 |
T4214 |
T4215 |
det |
each,meiosis |
| R4670 |
T17726 |
T17727 |
amod |
lower,signal |
| R4671 |
T17727 |
T17721 |
dobj |
signal,showed |
| R4672 |
T17728 |
T17727 |
nmod |
Cot,signal |
| R4673 |
T17729 |
T17728 |
punct |
-,Cot |
| R4674 |
T17730 |
T17728 |
nummod |
1,Cot |
| R4675 |
T17731 |
T17727 |
prep |
than,signal |
| R4676 |
T17732 |
T17733 |
amod |
euchromatic,regions |
| R4677 |
T17733 |
T17731 |
pobj |
regions,than |
| R4678 |
T17734 |
T17735 |
punct |
(,8E |
| R4679 |
T17735 |
T17721 |
parataxis |
8E,showed |
| R468 |
T4081 |
T4080 |
amod |
smaller,ones |
| R4680 |
T17736 |
T17735 |
compound |
Figure,8E |
| R4681 |
T17737 |
T17735 |
cc |
and,8E |
| R4682 |
T17738 |
T17735 |
conj |
8F,8E |
| R4683 |
T17739 |
T17735 |
punct |
),8E |
| R4684 |
T17740 |
T17725 |
punct |
", ",appeared |
| R4685 |
T17741 |
T17725 |
prep |
in,appeared |
| R4686 |
T17742 |
T17743 |
det |
some,cells |
| R4687 |
T17743 |
T17741 |
pobj |
cells,in |
| R4688 |
T17744 |
T17743 |
compound |
mutant,cells |
| R4689 |
T17745 |
T17746 |
det |
the,chromatin |
| R469 |
T4215 |
T4213 |
nsubj |
meiosis,produce |
| R4690 |
T17746 |
T17725 |
nsubj |
chromatin,appeared |
| R4691 |
T17747 |
T17746 |
compound |
sex,chromatin |
| R4692 |
T17748 |
T17749 |
aux |
to,be |
| R4693 |
T17749 |
T17725 |
xcomp |
be,appeared |
| R4694 |
T17750 |
T17751 |
advmod |
incompletely,silenced |
| R4695 |
T17751 |
T17749 |
acomp |
silenced,be |
| R4696 |
T17752 |
T17749 |
advcl |
relative,be |
| R4697 |
T17753 |
T17752 |
prep |
to,relative |
| R4698 |
T17754 |
T17755 |
amod |
wild,type |
| R4699 |
T17755 |
T17753 |
pobj |
type,to |
| R47 |
T939 |
T915 |
punct |
.,investigate |
| R470 |
T4216 |
T4215 |
amod |
male,meiosis |
| R4700 |
T17756 |
T17755 |
punct |
-,type |
| R4701 |
T17757 |
T17758 |
punct |
(,8F |
| R4702 |
T17758 |
T17725 |
parataxis |
8F,appeared |
| R4703 |
T17759 |
T17758 |
compound |
Figure,8F |
| R4704 |
T17760 |
T17758 |
punct |
),8F |
| R4705 |
T17761 |
T17725 |
punct |
.,appeared |
| R4706 |
T17763 |
T17764 |
nsubj |
We,examined |
| R4707 |
T17765 |
T17764 |
advmod |
also,examined |
| R4708 |
T17766 |
T17767 |
nummod |
three,signatures |
| R4709 |
T17767 |
T17764 |
dobj |
signatures,examined |
| R471 |
T4217 |
T4213 |
aux |
can,produce |
| R4710 |
T17768 |
T17767 |
amod |
epigenetic,signatures |
| R4711 |
T17769 |
T17767 |
prep |
of,signatures |
| R4712 |
T17770 |
T17769 |
pobj |
PMSC,of |
| R4713 |
T17771 |
T17767 |
punct |
: ,signatures |
| R4714 |
T17772 |
T17773 |
compound |
histone,H3 |
| R4715 |
T17773 |
T17767 |
appos |
H3,signatures |
| R4716 |
T17774 |
T17773 |
acl |
dimethylated,H3 |
| R4717 |
T17775 |
T17774 |
cc |
or,dimethylated |
| R4718 |
T17776 |
T17774 |
conj |
trimethylated,dimethylated |
| R4719 |
T17777 |
T17776 |
prep |
at,trimethylated |
| R472 |
T4218 |
T4219 |
nummod |
four,spermatocytes |
| R4720 |
T17778 |
T17777 |
pobj |
lysine,at |
| R4721 |
T17779 |
T17778 |
punct |
-,lysine |
| R4722 |
T17780 |
T17778 |
nummod |
9,lysine |
| R4723 |
T17781 |
T17782 |
punct |
(,2meK9 |
| R4724 |
T17782 |
T17776 |
parataxis |
2meK9,trimethylated |
| R4725 |
T17783 |
T17782 |
compound |
H3,2meK9 |
| R4726 |
T17784 |
T17782 |
punct |
-,2meK9 |
| R4727 |
T17785 |
T17782 |
punct |
", ",2meK9 |
| R4728 |
T17786 |
T17787 |
compound |
H3,3meK9 |
| R4729 |
T17787 |
T17782 |
appos |
3meK9,2meK9 |
| R473 |
T4082 |
T4063 |
punct |
.,are |
| R4730 |
T17788 |
T17787 |
punct |
-,3meK9 |
| R4731 |
T17789 |
T17782 |
punct |
),2meK9 |
| R4732 |
T17790 |
T17773 |
cc |
and,H3 |
| R4733 |
T17791 |
T17773 |
conj |
spreading,H3 |
| R4734 |
T17792 |
T17791 |
prep |
of,spreading |
| R4735 |
T17793 |
T17792 |
pobj |
HP1β,of |
| R4736 |
T17794 |
T17791 |
prep |
through,spreading |
| R4737 |
T17795 |
T17796 |
det |
the,body |
| R4738 |
T17796 |
T17794 |
pobj |
body,through |
| R4739 |
T17797 |
T17796 |
compound |
XY,body |
| R474 |
T4219 |
T4213 |
dobj |
spermatocytes,produce |
| R4740 |
T17798 |
T17799 |
punct |
[,58 |
| R4741 |
T17799 |
T17764 |
parataxis |
58,examined |
| R4742 |
T17800 |
T17799 |
nummod |
16,58 |
| R4743 |
T17801 |
T17799 |
punct |
",",58 |
| R4744 |
T17802 |
T17799 |
nummod |
57,58 |
| R4745 |
T17803 |
T17799 |
punct |
",",58 |
| R4746 |
T17804 |
T17799 |
punct |
],58 |
| R4747 |
T17805 |
T17806 |
punct |
(,S. |
| R4748 |
T17806 |
T17764 |
meta |
S.,examined |
| R4749 |
T17807 |
T17806 |
nmod |
H.,S. |
| R475 |
T4220 |
T4219 |
compound |
haploid,spermatocytes |
| R4750 |
T17808 |
T17806 |
nmod |
Namekawa,S. |
| R4751 |
T17809 |
T17806 |
punct |
", ",S. |
| R4752 |
T17810 |
T17806 |
amod |
unpublished,S. |
| R4753 |
T17811 |
T17806 |
nmod |
data,S. |
| R4754 |
T17812 |
T17806 |
punct |
),S. |
| R4755 |
T17813 |
T17764 |
punct |
.,examined |
| R4756 |
T17815 |
T17816 |
nsubj |
We,observed |
| R4757 |
T17817 |
T17816 |
dobj |
defects,observed |
| R4758 |
T17818 |
T17817 |
prep |
in,defects |
| R4759 |
T17819 |
T17820 |
compound |
sex,chromatin |
| R476 |
T4221 |
T4194 |
punct |
.,produce |
| R4760 |
T17820 |
T17821 |
compound |
chromatin,localization |
| R4761 |
T17821 |
T17818 |
pobj |
localization,in |
| R4762 |
T17822 |
T17821 |
prep |
of,localization |
| R4763 |
T17823 |
T17824 |
det |
all,markers |
| R4764 |
T17824 |
T17822 |
pobj |
markers,of |
| R4765 |
T17825 |
T17824 |
nummod |
three,markers |
| R4766 |
T17826 |
T17824 |
prep |
in,markers |
| R4767 |
T17827 |
T17828 |
compound |
Dmrt7,diplotene |
| R4768 |
T17828 |
T17829 |
compound |
diplotene,cells |
| R4769 |
T17829 |
T17826 |
pobj |
cells,in |
| R477 |
T4084 |
T4085 |
amod |
Mammalian,meiosis |
| R4770 |
T17830 |
T17816 |
punct |
.,observed |
| R4771 |
T17832 |
T17833 |
mark |
Although,appeared |
| R4772 |
T17833 |
T17842 |
advcl |
appeared,observed |
| R4773 |
T17834 |
T17835 |
compound |
HP1β,localization |
| R4774 |
T17835 |
T17833 |
nsubj |
localization,appeared |
| R4775 |
T17836 |
T17835 |
prep |
to,localization |
| R4776 |
T17837 |
T17838 |
det |
the,centromere |
| R4777 |
T17838 |
T17836 |
pobj |
centromere,to |
| R4778 |
T17839 |
T17840 |
compound |
X,chromosome |
| R4779 |
T17840 |
T17838 |
compound |
chromosome,centromere |
| R478 |
T4223 |
T4224 |
amod |
Other,processes |
| R4780 |
T17841 |
T17833 |
advmod |
initially,appeared |
| R4781 |
T17843 |
T17833 |
oprd |
normal,appeared |
| R4782 |
T17844 |
T17833 |
prep |
at,appeared |
| R4783 |
T17845 |
T17844 |
pobj |
mid-pachynema,at |
| R4784 |
T17846 |
T17842 |
punct |
", ",observed |
| R4785 |
T17847 |
T17842 |
nsubj |
we,observed |
| R4786 |
T17848 |
T17849 |
compound |
Dmrt7,cells |
| R4787 |
T17849 |
T17842 |
dobj |
cells,observed |
| R4788 |
T17850 |
T17849 |
compound |
mutant,cells |
| R4789 |
T17851 |
T17849 |
compound |
diplotene,cells |
| R479 |
T4224 |
T4226 |
nsubj |
processes,occur |
| R4790 |
T17852 |
T17853 |
dep |
that,failed |
| R4791 |
T17853 |
T17849 |
relcl |
failed,cells |
| R4792 |
T17854 |
T17855 |
aux |
to,show |
| R4793 |
T17855 |
T17853 |
xcomp |
show,failed |
| R4794 |
T17856 |
T17855 |
dobj |
spreading,show |
| R4795 |
T17857 |
T17856 |
prep |
of,spreading |
| R4796 |
T17858 |
T17857 |
pobj |
HP1β,of |
| R4797 |
T17859 |
T17856 |
prep |
to,spreading |
| R4798 |
T17860 |
T17861 |
det |
the,body |
| R4799 |
T17861 |
T17859 |
pobj |
body,to |
| R48 |
T941 |
T942 |
nsubj |
We,find |
| R480 |
T4225 |
T4224 |
amod |
meiotic,processes |
| R4800 |
T17862 |
T17861 |
amod |
entire,body |
| R4801 |
T17863 |
T17861 |
compound |
XY,body |
| R4802 |
T17864 |
T17865 |
punct |
(,8G |
| R4803 |
T17865 |
T17842 |
parataxis |
8G,observed |
| R4804 |
T17866 |
T17865 |
compound |
Figure,8G |
| R4805 |
T17867 |
T17865 |
cc |
and,8G |
| R4806 |
T17868 |
T17865 |
conj |
8H,8G |
| R4807 |
T17869 |
T17865 |
punct |
),8G |
| R4808 |
T17870 |
T17842 |
punct |
.,observed |
| R4809 |
T17872 |
T17873 |
advmod |
Similarly,found |
| R481 |
T4227 |
T4224 |
punct |
", ",processes |
| R4810 |
T17874 |
T17873 |
punct |
", ",found |
| R4811 |
T17875 |
T17873 |
nsubj |
we,found |
| R4812 |
T17876 |
T17877 |
compound |
Dmrt7,cells |
| R4813 |
T17877 |
T17873 |
dobj |
cells,found |
| R4814 |
T17878 |
T17877 |
compound |
mutant,cells |
| R4815 |
T17879 |
T17877 |
compound |
diplotene,cells |
| R4816 |
T17880 |
T17877 |
acl |
lacking,cells |
| R4817 |
T17881 |
T17880 |
dobj |
accumulation,lacking |
| R4818 |
T17882 |
T17881 |
prep |
of,accumulation |
| R4819 |
T17883 |
T17884 |
nmod |
H3,2meK9 |
| R482 |
T4228 |
T4229 |
amod |
such,as |
| R4820 |
T17884 |
T17886 |
nmod |
2meK9,marks |
| R4821 |
T17885 |
T17884 |
punct |
-,2meK9 |
| R4822 |
T17886 |
T17882 |
pobj |
marks,of |
| R4823 |
T17887 |
T17884 |
cc |
and,2meK9 |
| R4824 |
T17888 |
T17889 |
compound |
H3,3meK9 |
| R4825 |
T17889 |
T17884 |
conj |
3meK9,2meK9 |
| R4826 |
T17890 |
T17889 |
punct |
-,3meK9 |
| R4827 |
T17891 |
T17886 |
prep |
onto,marks |
| R4828 |
T17892 |
T17893 |
det |
the,chromatin |
| R4829 |
T17893 |
T17891 |
pobj |
chromatin,onto |
| R483 |
T4085 |
T4086 |
nsubjpass |
meiosis,regulated |
| R4830 |
T17894 |
T17893 |
compound |
sex,chromatin |
| R4831 |
T17895 |
T17896 |
punct |
(,8I |
| R4832 |
T17896 |
T17873 |
parataxis |
8I,found |
| R4833 |
T17897 |
T17896 |
compound |
Figure,8I |
| R4834 |
T17898 |
T17899 |
punct |
–,8L |
| R4835 |
T17899 |
T17896 |
prep |
8L,8I |
| R4836 |
T17900 |
T17896 |
punct |
),8I |
| R4837 |
T17901 |
T17873 |
punct |
.,found |
| R4838 |
T17903 |
T17904 |
neg |
Not,cells |
| R4839 |
T17904 |
T17909 |
nsubj |
cells,showed |
| R484 |
T4229 |
T4224 |
prep |
as,processes |
| R4840 |
T17905 |
T17904 |
det |
all,cells |
| R4841 |
T17906 |
T17907 |
compound |
Dmrt7,mutant |
| R4842 |
T17907 |
T17904 |
compound |
mutant,cells |
| R4843 |
T17908 |
T17904 |
compound |
diplotene,cells |
| R4844 |
T17910 |
T17911 |
amod |
abnormal,localization |
| R4845 |
T17911 |
T17909 |
dobj |
localization,showed |
| R4846 |
T17912 |
T17911 |
prep |
of,localization |
| R4847 |
T17913 |
T17912 |
pobj |
HP1β,of |
| R4848 |
T17914 |
T17911 |
prep |
to,localization |
| R4849 |
T17915 |
T17916 |
det |
the,chromatin |
| R485 |
T4230 |
T4229 |
pobj |
recombination,as |
| R4850 |
T17916 |
T17914 |
pobj |
chromatin,to |
| R4851 |
T17917 |
T17916 |
compound |
sex,chromatin |
| R4852 |
T17918 |
T17919 |
punct |
(,8M |
| R4853 |
T17919 |
T17909 |
parataxis |
8M,showed |
| R4854 |
T17920 |
T17919 |
compound |
Figure,8M |
| R4855 |
T17921 |
T17919 |
punct |
),8M |
| R4856 |
T17922 |
T17909 |
punct |
.,showed |
| R4857 |
T17924 |
T17925 |
prep |
In,lacked |
| R4858 |
T17926 |
T17927 |
nummod |
one,experiment |
| R4859 |
T17927 |
T17924 |
pobj |
experiment,In |
| R486 |
T4231 |
T4230 |
cc |
and,recombination |
| R4860 |
T17928 |
T17925 |
punct |
", ",lacked |
| R4861 |
T17929 |
T17930 |
quantmod |
11,27 |
| R4862 |
T17930 |
T17932 |
nummod |
27,cells |
| R4863 |
T17931 |
T17930 |
punct |
/,27 |
| R4864 |
T17932 |
T17925 |
nsubj |
cells,lacked |
| R4865 |
T17933 |
T17932 |
compound |
mutant,cells |
| R4866 |
T17934 |
T17932 |
prep |
in,cells |
| R4867 |
T17935 |
T17934 |
pobj |
diplonema,in |
| R4868 |
T17936 |
T17925 |
dobj |
HP1β,lacked |
| R4869 |
T17937 |
T17925 |
prep |
on,lacked |
| R487 |
T4232 |
T4233 |
compound |
chromosome,pairing |
| R4870 |
T17938 |
T17939 |
det |
the,body |
| R4871 |
T17939 |
T17937 |
pobj |
body,on |
| R4872 |
T17940 |
T17939 |
compound |
XY,body |
| R4873 |
T17941 |
T17925 |
punct |
", ",lacked |
| R4874 |
T17942 |
T17943 |
mark |
as,compared |
| R4875 |
T17943 |
T17925 |
advcl |
compared,lacked |
| R4876 |
T17944 |
T17943 |
prep |
with,compared |
| R4877 |
T17945 |
T17946 |
quantmod |
2,22 |
| R4878 |
T17946 |
T17948 |
nummod |
22,cells |
| R4879 |
T17947 |
T17946 |
punct |
/,22 |
| R488 |
T4233 |
T4230 |
conj |
pairing,recombination |
| R4880 |
T17948 |
T17944 |
pobj |
cells,with |
| R4881 |
T17949 |
T17950 |
amod |
wild,type |
| R4882 |
T17950 |
T17948 |
compound |
type,cells |
| R4883 |
T17951 |
T17950 |
punct |
-,type |
| R4884 |
T17952 |
T17925 |
punct |
.,lacked |
| R4885 |
T17954 |
T17955 |
nsubj |
We,hypothesize |
| R4886 |
T17956 |
T17957 |
mark |
that,be |
| R4887 |
T17957 |
T17955 |
ccomp |
be,hypothesize |
| R4888 |
T17958 |
T17959 |
det |
the,cells |
| R4889 |
T17959 |
T17957 |
nsubj |
cells,be |
| R489 |
T4087 |
T4086 |
auxpass |
is,regulated |
| R4890 |
T17960 |
T17959 |
compound |
mutant,cells |
| R4891 |
T17961 |
T17959 |
prep |
with,cells |
| R4892 |
T17962 |
T17963 |
amod |
normal,HP1β |
| R4893 |
T17963 |
T17961 |
pobj |
HP1β,with |
| R4894 |
T17964 |
T17957 |
aux |
may,be |
| R4895 |
T17965 |
T17957 |
attr |
those,be |
| R4896 |
T17966 |
T17967 |
dep |
that,complete |
| R4897 |
T17967 |
T17965 |
relcl |
complete,those |
| R4898 |
T17968 |
T17967 |
aux |
can,complete |
| R4899 |
T17969 |
T17967 |
dobj |
meiosis,complete |
| R49 |
T836 |
T834 |
attr |
process,is |
| R490 |
T4234 |
T4235 |
punct |
(,synapsis |
| R4900 |
T17970 |
T17971 |
punct |
(,4 |
| R4901 |
T17971 |
T17955 |
parataxis |
4,hypothesize |
| R4902 |
T17972 |
T17971 |
nmod |
Figures,4 |
| R4903 |
T17973 |
T17971 |
cc |
and,4 |
| R4904 |
T17974 |
T17971 |
conj |
5,4 |
| R4905 |
T17975 |
T17971 |
punct |
),4 |
| R4906 |
T17976 |
T17955 |
punct |
.,hypothesize |
| R4907 |
T17978 |
T17979 |
nsubj |
Some,had |
| R4908 |
T17980 |
T17978 |
prep |
of,Some |
| R4909 |
T17981 |
T17982 |
det |
the,cells |
| R491 |
T4235 |
T4233 |
parataxis |
synapsis,pairing |
| R4910 |
T17982 |
T17980 |
pobj |
cells,of |
| R4911 |
T17983 |
T17982 |
compound |
mutant,cells |
| R4912 |
T17984 |
T17982 |
compound |
diplotene,cells |
| R4913 |
T17985 |
T17982 |
acl |
showing,cells |
| R4914 |
T17986 |
T17987 |
amod |
abnormal,chromatin |
| R4915 |
T17987 |
T17985 |
dobj |
chromatin,showing |
| R4916 |
T17988 |
T17987 |
compound |
sex,chromatin |
| R4917 |
T17989 |
T17979 |
advmod |
also,had |
| R4918 |
T17990 |
T17991 |
amod |
abnormal,staining |
| R4919 |
T17991 |
T17979 |
dobj |
staining,had |
| R492 |
T4236 |
T4235 |
punct |
),synapsis |
| R4920 |
T17992 |
T17991 |
amod |
autosomal,staining |
| R4921 |
T17993 |
T17991 |
compound |
γH2AX,staining |
| R4922 |
T17994 |
T17995 |
punct |
(,8L |
| R4923 |
T17995 |
T17979 |
parataxis |
8L,had |
| R4924 |
T17996 |
T17995 |
compound |
Figure,8L |
| R4925 |
T17997 |
T17995 |
punct |
),8L |
| R4926 |
T17998 |
T17979 |
punct |
.,had |
| R4927 |
T18000 |
T18001 |
nsubj |
γH2AX,localizes |
| R4928 |
T18002 |
T18001 |
prep |
to,localizes |
| R4929 |
T18003 |
T18004 |
amod |
double,strand |
| R493 |
T4237 |
T4226 |
punct |
", ",occur |
| R4930 |
T18004 |
T18006 |
compound |
strand,DNA |
| R4931 |
T18005 |
T18004 |
punct |
-,strand |
| R4932 |
T18006 |
T18007 |
compound |
DNA,breaks |
| R4933 |
T18007 |
T18002 |
pobj |
breaks,to |
| R4934 |
T18008 |
T18001 |
punct |
", ",localizes |
| R4935 |
T18009 |
T18010 |
mark |
so,indicate |
| R4936 |
T18010 |
T18001 |
advcl |
indicate,localizes |
| R4937 |
T18011 |
T18012 |
det |
this,staining |
| R4938 |
T18012 |
T18010 |
nsubj |
staining,indicate |
| R4939 |
T18013 |
T18010 |
aux |
may,indicate |
| R494 |
T4238 |
T4226 |
prep |
in,occur |
| R4940 |
T18014 |
T18015 |
mark |
that,approaching |
| R4941 |
T18015 |
T18010 |
ccomp |
approaching,indicate |
| R4942 |
T18016 |
T18017 |
det |
some,cells |
| R4943 |
T18017 |
T18015 |
nsubj |
cells,approaching |
| R4944 |
T18018 |
T18017 |
compound |
diplotene,cells |
| R4945 |
T18019 |
T18017 |
compound |
mutant,cells |
| R4946 |
T18020 |
T18015 |
aux |
are,approaching |
| R4947 |
T18021 |
T18015 |
cc |
or,approaching |
| R4948 |
T18022 |
T18015 |
conj |
entering,approaching |
| R4949 |
T18023 |
T18022 |
dobj |
apoptosis,entering |
| R495 |
T4088 |
T4089 |
npadvmod |
sex,specifically |
| R4950 |
T18024 |
T18025 |
punct |
[,59 |
| R4951 |
T18025 |
T18001 |
parataxis |
59,localizes |
| R4952 |
T18026 |
T18025 |
punct |
],59 |
| R4953 |
T18027 |
T18001 |
punct |
.,localizes |
| R4954 |
T18029 |
T18030 |
nsubj |
We,observe |
| R4955 |
T18031 |
T18030 |
aux |
did,observe |
| R4956 |
T18032 |
T18030 |
neg |
not,observe |
| R4957 |
T18033 |
T18034 |
compound |
sex,defects |
| R4958 |
T18034 |
T18030 |
dobj |
defects,observe |
| R4959 |
T18035 |
T18034 |
compound |
chromatin,defects |
| R496 |
T4239 |
T4240 |
preconj |
both,sexes |
| R4960 |
T18036 |
T18030 |
prep |
prior,observe |
| R4961 |
T18037 |
T18036 |
prep |
to,prior |
| R4962 |
T18038 |
T18037 |
pobj |
diplonema,to |
| R4963 |
T18039 |
T18030 |
punct |
", ",observe |
| R4964 |
T18040 |
T18030 |
cc |
but,observe |
| R4965 |
T18041 |
T18042 |
nsubj |
we,exclude |
| R4966 |
T18042 |
T18030 |
conj |
exclude,observe |
| R4967 |
T18043 |
T18042 |
aux |
can,exclude |
| R4968 |
T18044 |
T18042 |
neg |
not,exclude |
| R4969 |
T18045 |
T18046 |
det |
the,possibility |
| R497 |
T4240 |
T4238 |
pobj |
sexes,in |
| R4970 |
T18046 |
T18042 |
dobj |
possibility,exclude |
| R4971 |
T18047 |
T18048 |
mark |
that,exist |
| R4972 |
T18048 |
T18046 |
acl |
exist,possibility |
| R4973 |
T18049 |
T18050 |
amod |
earlier,defects |
| R4974 |
T18050 |
T18048 |
nsubj |
defects,exist |
| R4975 |
T18051 |
T18048 |
cc |
and,exist |
| R4976 |
T18052 |
T18053 |
det |
the,cells |
| R4977 |
T18053 |
T18055 |
nsubjpass |
cells,eliminated |
| R4978 |
T18054 |
T18053 |
amod |
affected,cells |
| R4979 |
T18055 |
T18048 |
conj |
eliminated,exist |
| R498 |
T4241 |
T4226 |
cc |
but,occur |
| R4980 |
T18056 |
T18055 |
auxpass |
are,eliminated |
| R4981 |
T18057 |
T18055 |
advmod |
rapidly,eliminated |
| R4982 |
T18058 |
T18042 |
punct |
.,exclude |
| R4983 |
T18060 |
T18061 |
prep |
In,staged |
| R4984 |
T18062 |
T18063 |
det |
the,experiments |
| R4985 |
T18063 |
T18060 |
pobj |
experiments,In |
| R4986 |
T18064 |
T18063 |
amod |
preceding,experiments |
| R4987 |
T18065 |
T18061 |
punct |
", ",staged |
| R4988 |
T18066 |
T18061 |
nsubj |
we,staged |
| R4989 |
T18067 |
T18061 |
dobj |
cells,staged |
| R499 |
T4089 |
T4086 |
advmod |
specifically,regulated |
| R4990 |
T18068 |
T18061 |
prep |
based,staged |
| R4991 |
T18069 |
T18068 |
prep |
on,based |
| R4992 |
T18070 |
T18071 |
compound |
XY,body |
| R4993 |
T18071 |
T18072 |
compound |
body,internalization |
| R4994 |
T18072 |
T18069 |
pobj |
internalization,on |
| R4995 |
T18073 |
T18061 |
punct |
.,staged |
| R4996 |
T18075 |
T18076 |
mark |
Because,be |
| R4997 |
T18076 |
T18080 |
advcl |
be,staged |
| R4998 |
T18077 |
T18078 |
det |
this,process |
| R4999 |
T18078 |
T18076 |
nsubj |
process,be |
| R5 |
T817 |
T818 |
npadvmod |
Mammal,Specific |
| R50 |
T943 |
T944 |
mark |
that,localizes |
| R500 |
T4242 |
T4226 |
conj |
operate,occur |
| R5000 |
T18079 |
T18076 |
aux |
could,be |
| R5001 |
T18081 |
T18076 |
acomp |
abnormal,be |
| R5002 |
T18082 |
T18076 |
prep |
in,be |
| R5003 |
T18083 |
T18084 |
det |
the,cells |
| R5004 |
T18084 |
T18082 |
pobj |
cells,in |
| R5005 |
T18085 |
T18084 |
compound |
mutant,cells |
| R5006 |
T18086 |
T18080 |
punct |
", ",staged |
| R5007 |
T18087 |
T18080 |
nsubj |
we,staged |
| R5008 |
T18088 |
T18080 |
advmod |
also,staged |
| R5009 |
T18089 |
T18090 |
compound |
mutant,cells |
| R501 |
T4243 |
T4244 |
advmod |
somewhat,differently |
| R5010 |
T18090 |
T18080 |
dobj |
cells,staged |
| R5011 |
T18091 |
T18080 |
prep |
by,staged |
| R5012 |
T18092 |
T18093 |
compound |
chromosome,morphology |
| R5013 |
T18093 |
T18091 |
pobj |
morphology,by |
| R5014 |
T18094 |
T18080 |
advcl |
using,staged |
| R5015 |
T18095 |
T18096 |
det |
an,antibody |
| R5016 |
T18096 |
T18094 |
dobj |
antibody,using |
| R5017 |
T18097 |
T18094 |
prep |
to,using |
| R5018 |
T18098 |
T18097 |
pobj |
SYCP3,to |
| R5019 |
T18099 |
T18100 |
punct |
(,Figure |
| R502 |
T4244 |
T4242 |
advmod |
differently,operate |
| R5020 |
T18100 |
T18080 |
parataxis |
Figure,staged |
| R5021 |
T18101 |
T18100 |
nummod |
9,Figure |
| R5022 |
T18102 |
T18100 |
punct |
),Figure |
| R5023 |
T18103 |
T18080 |
punct |
.,staged |
| R5024 |
T18105 |
T18106 |
nsubj |
This,identified |
| R5025 |
T18107 |
T18106 |
advmod |
independently,identified |
| R5026 |
T18108 |
T18109 |
compound |
Dmrt7,mutant |
| R5027 |
T18109 |
T18110 |
compound |
mutant,cells |
| R5028 |
T18110 |
T18106 |
dobj |
cells,identified |
| R5029 |
T18111 |
T18110 |
compound |
diplotene,cells |
| R503 |
T4090 |
T4089 |
punct |
-,specifically |
| R5030 |
T18112 |
T18110 |
acl |
lacking,cells |
| R5031 |
T18113 |
T18114 |
compound |
HP1β,accumulation |
| R5032 |
T18114 |
T18112 |
dobj |
accumulation,lacking |
| R5033 |
T18115 |
T18112 |
prep |
in,lacking |
| R5034 |
T18116 |
T18117 |
det |
the,body |
| R5035 |
T18117 |
T18115 |
pobj |
body,in |
| R5036 |
T18118 |
T18117 |
compound |
XY,body |
| R5037 |
T18119 |
T18110 |
punct |
", ",cells |
| R5038 |
T18120 |
T18121 |
amod |
such,as |
| R5039 |
T18121 |
T18110 |
prep |
as,cells |
| R504 |
T4245 |
T4226 |
punct |
.,occur |
| R5040 |
T18122 |
T18123 |
det |
the,example |
| R5041 |
T18123 |
T18121 |
pobj |
example,as |
| R5042 |
T18124 |
T18123 |
prep |
in,example |
| R5043 |
T18125 |
T18126 |
compound |
Figure,9B |
| R5044 |
T18126 |
T18124 |
pobj |
9B,in |
| R5045 |
T18127 |
T18106 |
punct |
.,identified |
| R5046 |
T18129 |
T18130 |
prep |
From,conclude |
| R5047 |
T18131 |
T18132 |
det |
these,results |
| R5048 |
T18132 |
T18129 |
pobj |
results,From |
| R5049 |
T18133 |
T18130 |
punct |
", ",conclude |
| R505 |
T4091 |
T4086 |
advcl |
starting,regulated |
| R5050 |
T18134 |
T18130 |
nsubj |
we,conclude |
| R5051 |
T18135 |
T18136 |
mark |
that,establish |
| R5052 |
T18136 |
T18130 |
ccomp |
establish,conclude |
| R5053 |
T18137 |
T18138 |
compound |
Dmrt7,cells |
| R5054 |
T18138 |
T18136 |
nsubj |
cells,establish |
| R5055 |
T18139 |
T18138 |
compound |
mutant,cells |
| R5056 |
T18140 |
T18141 |
det |
a,body |
| R5057 |
T18141 |
T18136 |
dobj |
body,establish |
| R5058 |
T18142 |
T18141 |
amod |
normal,body |
| R5059 |
T18143 |
T18141 |
compound |
XY,body |
| R506 |
T4092 |
T4091 |
prep |
in,starting |
| R5060 |
T18144 |
T18136 |
prep |
in,establish |
| R5061 |
T18145 |
T18144 |
pobj |
mid-pachynema,in |
| R5062 |
T18146 |
T18136 |
punct |
", ",establish |
| R5063 |
T18147 |
T18136 |
cc |
but,establish |
| R5064 |
T18148 |
T18149 |
advmod |
then,have |
| R5065 |
T18149 |
T18136 |
conj |
have,establish |
| R5066 |
T18150 |
T18151 |
amod |
multiple,defects |
| R5067 |
T18151 |
T18149 |
dobj |
defects,have |
| R5068 |
T18152 |
T18151 |
amod |
epigenetic,defects |
| R5069 |
T18153 |
T18149 |
prep |
in,have |
| R507 |
T4093 |
T4092 |
pobj |
embryogenesis,in |
| R5070 |
T18154 |
T18155 |
det |
the,transition |
| R5071 |
T18155 |
T18153 |
pobj |
transition,in |
| R5072 |
T18156 |
T18155 |
compound |
sex,transition |
| R5073 |
T18157 |
T18155 |
compound |
chromatin,transition |
| R5074 |
T18158 |
T18155 |
prep |
from,transition |
| R5075 |
T18159 |
T18158 |
pobj |
pachynema,from |
| R5076 |
T18160 |
T18155 |
prep |
to,transition |
| R5077 |
T18161 |
T18160 |
pobj |
diplonema,to |
| R5078 |
T18162 |
T18130 |
punct |
.,conclude |
| R508 |
T4247 |
T4248 |
prep |
For,is |
| R5083 |
T21499 |
T21500 |
prep |
In,find |
| R5084 |
T21501 |
T21502 |
det |
this,study |
| R5085 |
T21502 |
T21499 |
pobj |
study,In |
| R5086 |
T21503 |
T21500 |
punct |
", ",find |
| R5087 |
T21504 |
T21500 |
nsubj |
we,find |
| R5088 |
T21505 |
T21506 |
mark |
that,required |
| R5089 |
T21506 |
T21500 |
ccomp |
required,find |
| R509 |
T4094 |
T4091 |
cc |
and,starting |
| R5090 |
T21507 |
T21508 |
det |
the,protein |
| R5091 |
T21508 |
T21506 |
nsubjpass |
protein,required |
| R5092 |
T21509 |
T21510 |
compound |
DM,domain |
| R5093 |
T21510 |
T21508 |
compound |
domain,protein |
| R5094 |
T21511 |
T21508 |
appos |
DMRT7,protein |
| R5095 |
T21512 |
T21506 |
auxpass |
is,required |
| R5096 |
T21513 |
T21514 |
mark |
for,complete |
| R5097 |
T21514 |
T21506 |
advcl |
complete,required |
| R5098 |
T21515 |
T21516 |
amod |
male,cells |
| R5099 |
T21516 |
T21514 |
nsubj |
cells,complete |
| R51 |
T837 |
T838 |
advmod |
sexually,dimorphic |
| R510 |
T4249 |
T4247 |
pobj |
example,For |
| R5100 |
T21517 |
T21516 |
compound |
germ,cells |
| R5101 |
T21518 |
T21514 |
aux |
to,complete |
| R5102 |
T21519 |
T21520 |
amod |
meiotic,prophase |
| R5103 |
T21520 |
T21514 |
dobj |
prophase,complete |
| R5104 |
T21521 |
T21506 |
cc |
but,required |
| R5105 |
T21522 |
T21506 |
conj |
is,required |
| R5106 |
T21523 |
T21522 |
acomp |
dispensable,is |
| R5107 |
T21524 |
T21522 |
prep |
in,is |
| R5108 |
T21525 |
T21526 |
det |
the,line |
| R5109 |
T21526 |
T21524 |
pobj |
line,in |
| R511 |
T4250 |
T4248 |
punct |
", ",is |
| R5110 |
T21527 |
T21526 |
amod |
female,line |
| R5111 |
T21528 |
T21526 |
compound |
germ,line |
| R5112 |
T21529 |
T21500 |
punct |
.,find |
| R5113 |
T21531 |
T21532 |
prep |
In,is |
| R5114 |
T21533 |
T21531 |
pobj |
males,In |
| R5115 |
T21534 |
T21532 |
punct |
", ",is |
| R5116 |
T21535 |
T21536 |
compound |
DMRT7,expression |
| R5117 |
T21536 |
T21532 |
nsubj |
expression,is |
| R5118 |
T21537 |
T21532 |
acomp |
highest,is |
| R5119 |
T21538 |
T21532 |
prep |
in,is |
| R512 |
T4095 |
T4091 |
conj |
continuing,starting |
| R5120 |
T21539 |
T21540 |
compound |
pachytene,spermatocytes |
| R5121 |
T21540 |
T21538 |
pobj |
spermatocytes,in |
| R5122 |
T21541 |
T21532 |
punct |
", ",is |
| R5123 |
T21542 |
T21532 |
cc |
and,is |
| R5124 |
T21543 |
T21544 |
det |
the,protein |
| R5125 |
T21544 |
T21545 |
nsubj |
protein,localizes |
| R5126 |
T21545 |
T21532 |
conj |
localizes,is |
| R5127 |
T21546 |
T21545 |
advmod |
preferentially,localizes |
| R5128 |
T21547 |
T21545 |
prep |
to,localizes |
| R5129 |
T21548 |
T21549 |
det |
the,body |
| R513 |
T4251 |
T4248 |
expl |
there,is |
| R5130 |
T21549 |
T21547 |
pobj |
body,to |
| R5131 |
T21550 |
T21549 |
compound |
XY,body |
| R5132 |
T21551 |
T21532 |
punct |
.,is |
| R5133 |
T21553 |
T21554 |
advcl |
Consistent,found |
| R5134 |
T21555 |
T21553 |
prep |
with,Consistent |
| R5135 |
T21556 |
T21557 |
det |
this,expression |
| R5136 |
T21557 |
T21555 |
pobj |
expression,with |
| R5137 |
T21558 |
T21554 |
punct |
", ",found |
| R5138 |
T21559 |
T21554 |
nsubj |
we,found |
| R5139 |
T21560 |
T21561 |
mark |
that,arrest |
| R514 |
T4252 |
T4253 |
det |
a,rate |
| R5140 |
T21561 |
T21554 |
ccomp |
arrest,found |
| R5141 |
T21562 |
T21563 |
amod |
most,cells |
| R5142 |
T21563 |
T21561 |
nsubj |
cells,arrest |
| R5143 |
T21564 |
T21563 |
nmod |
mutant,cells |
| R5144 |
T21565 |
T21563 |
amod |
male,cells |
| R5145 |
T21566 |
T21563 |
compound |
germ,cells |
| R5146 |
T21567 |
T21561 |
prep |
in,arrest |
| R5147 |
T21568 |
T21567 |
pobj |
pachynema,in |
| R5148 |
T21569 |
T21561 |
cc |
and,arrest |
| R5149 |
T21570 |
T21561 |
conj |
undergo,arrest |
| R515 |
T4253 |
T4248 |
attr |
rate,is |
| R5150 |
T21571 |
T21570 |
dobj |
apoptosis,undergo |
| R5151 |
T21572 |
T21561 |
punct |
", ",arrest |
| R5152 |
T21573 |
T21574 |
mark |
although,progress |
| R5153 |
T21574 |
T21561 |
advcl |
progress,arrest |
| R5154 |
T21575 |
T21576 |
det |
a,proportion |
| R5155 |
T21576 |
T21574 |
nsubj |
proportion,progress |
| R5156 |
T21577 |
T21576 |
amod |
small,proportion |
| R5157 |
T21578 |
T21574 |
aux |
can,progress |
| R5158 |
T21579 |
T21574 |
prep |
to,progress |
| R5159 |
T21580 |
T21579 |
pobj |
diplonema,to |
| R516 |
T4096 |
T4095 |
prep |
through,continuing |
| R5160 |
T21581 |
T21579 |
cc |
and,to |
| R5161 |
T21582 |
T21583 |
advmod |
sometimes,beyond |
| R5162 |
T21583 |
T21579 |
conj |
beyond,to |
| R5163 |
T21584 |
T21554 |
punct |
.,found |
| R5164 |
T21586 |
T21587 |
nsubj |
Examination,revealed |
| R5165 |
T21588 |
T21586 |
prep |
of,Examination |
| R5166 |
T21589 |
T21588 |
pobj |
chromatin,of |
| R5167 |
T21590 |
T21589 |
cc |
and,chromatin |
| R5168 |
T21591 |
T21592 |
amod |
nascent,transcription |
| R5169 |
T21592 |
T21589 |
conj |
transcription,chromatin |
| R517 |
T4254 |
T4253 |
amod |
higher,rate |
| R5170 |
T21593 |
T21586 |
prep |
in,Examination |
| R5171 |
T21594 |
T21595 |
compound |
mutant,cells |
| R5172 |
T21595 |
T21593 |
pobj |
cells,in |
| R5173 |
T21596 |
T21597 |
dep |
that,progressed |
| R5174 |
T21597 |
T21595 |
relcl |
progressed,cells |
| R5175 |
T21598 |
T21597 |
prep |
to,progressed |
| R5176 |
T21599 |
T21598 |
pobj |
diplonema,to |
| R5177 |
T21600 |
T21601 |
compound |
sex,chromatin |
| R5178 |
T21601 |
T21602 |
compound |
chromatin,abnormalities |
| R5179 |
T21602 |
T21587 |
dobj |
abnormalities,revealed |
| R518 |
T4255 |
T4253 |
compound |
failure,rate |
| R5180 |
T21603 |
T21587 |
punct |
", ",revealed |
| R5181 |
T21604 |
T21605 |
mark |
as,discussed |
| R5182 |
T21605 |
T21587 |
advcl |
discussed,revealed |
| R5183 |
T21606 |
T21605 |
advmod |
below,discussed |
| R5184 |
T21607 |
T21587 |
punct |
.,revealed |
| R5185 |
T21609 |
T21610 |
det |
The,stage |
| R5186 |
T21610 |
T21612 |
nsubj |
stage,involves |
| R5187 |
T21611 |
T21610 |
compound |
pachytene,stage |
| R5188 |
T21613 |
T21610 |
prep |
of,stage |
| R5189 |
T21614 |
T21613 |
pobj |
prophase,of |
| R519 |
T4256 |
T4253 |
prep |
for,rate |
| R5190 |
T21615 |
T21616 |
amod |
tremendous,changes |
| R5191 |
T21616 |
T21612 |
dobj |
changes,involves |
| R5192 |
T21617 |
T21616 |
amod |
chromosomal,changes |
| R5193 |
T21618 |
T21619 |
mark |
as,align |
| R5194 |
T21619 |
T21612 |
advcl |
align,involves |
| R5195 |
T21620 |
T21621 |
det |
the,homologs |
| R5196 |
T21621 |
T21619 |
nsubj |
homologs,align |
| R5197 |
T21622 |
T21619 |
punct |
", ",align |
| R5198 |
T21623 |
T21619 |
conj |
synapse,align |
| R5199 |
T21624 |
T21623 |
punct |
", ",synapse |
| R52 |
T944 |
T942 |
ccomp |
localizes,find |
| R520 |
T4257 |
T4256 |
pobj |
meiosis,for |
| R5200 |
T21625 |
T21623 |
cc |
and,synapse |
| R5201 |
T21626 |
T21623 |
conj |
recombine,synapse |
| R5202 |
T21627 |
T21612 |
punct |
.,involves |
| R5203 |
T21629 |
T21630 |
prep |
During,exists |
| R5204 |
T21631 |
T21632 |
det |
this,period |
| R5205 |
T21632 |
T21629 |
pobj |
period,During |
| R5206 |
T21633 |
T21630 |
punct |
", ",exists |
| R5207 |
T21634 |
T21635 |
advmod |
at,one |
| R5208 |
T21635 |
T21637 |
nummod |
one,system |
| R5209 |
T21636 |
T21635 |
advmod |
least,one |
| R521 |
T4258 |
T4253 |
prep |
in,rate |
| R5210 |
T21637 |
T21630 |
nsubj |
system,exists |
| R5211 |
T21638 |
T21637 |
compound |
pachytene,system |
| R5212 |
T21639 |
T21637 |
compound |
surveillance,system |
| R5213 |
T21640 |
T21641 |
aux |
to,monitor |
| R5214 |
T21641 |
T21630 |
advcl |
monitor,exists |
| R5215 |
T21642 |
T21643 |
amod |
key,events |
| R5216 |
T21643 |
T21641 |
dobj |
events,monitor |
| R5217 |
T21644 |
T21643 |
prep |
of,events |
| R5218 |
T21645 |
T21646 |
amod |
meiotic,progression |
| R5219 |
T21646 |
T21644 |
pobj |
progression,of |
| R522 |
T4259 |
T4258 |
pobj |
females,in |
| R5220 |
T21647 |
T21630 |
punct |
.,exists |
| R5221 |
T21649 |
T21650 |
nsubjpass |
Cells,eliminated |
| R5222 |
T21651 |
T21652 |
prep |
in,is |
| R5223 |
T21652 |
T21649 |
relcl |
is,Cells |
| R5224 |
T21653 |
T21651 |
pobj |
which,in |
| R5225 |
T21654 |
T21652 |
nsubj |
any,is |
| R5226 |
T21655 |
T21654 |
prep |
of,any |
| R5227 |
T21656 |
T21657 |
det |
these,events |
| R5228 |
T21657 |
T21655 |
pobj |
events,of |
| R5229 |
T21658 |
T21652 |
acomp |
anomalous,is |
| R523 |
T4260 |
T4248 |
punct |
", ",is |
| R5230 |
T21659 |
T21650 |
auxpass |
are,eliminated |
| R5231 |
T21660 |
T21650 |
advmod |
efficiently,eliminated |
| R5232 |
T21661 |
T21650 |
agent |
by,eliminated |
| R5233 |
T21662 |
T21661 |
pobj |
apoptosis,by |
| R5234 |
T21663 |
T21664 |
punct |
[,46 |
| R5235 |
T21664 |
T21650 |
parataxis |
46,eliminated |
| R5236 |
T21665 |
T21664 |
punct |
],46 |
| R5237 |
T21666 |
T21650 |
punct |
.,eliminated |
| R5238 |
T21668 |
T21669 |
det |
Another,event |
| R5239 |
T21669 |
T21671 |
nsubj |
event,is |
| R524 |
T4097 |
T4096 |
pobj |
much,through |
| R5240 |
T21670 |
T21669 |
amod |
key,event |
| R5241 |
T21672 |
T21669 |
prep |
of,event |
| R5242 |
T21673 |
T21672 |
pobj |
pachynema,of |
| R5243 |
T21674 |
T21669 |
prep |
in,event |
| R5244 |
T21675 |
T21676 |
amod |
male,mammals |
| R5245 |
T21676 |
T21674 |
pobj |
mammals,in |
| R5246 |
T21677 |
T21678 |
det |
the,packaging |
| R5247 |
T21678 |
T21671 |
attr |
packaging,is |
| R5248 |
T21679 |
T21678 |
prep |
of,packaging |
| R5249 |
T21680 |
T21681 |
det |
the,chromosomes |
| R525 |
T4261 |
T4248 |
prep |
with,is |
| R5250 |
T21681 |
T21679 |
pobj |
chromosomes,of |
| R5251 |
T21682 |
T21681 |
compound |
sex,chromosomes |
| R5252 |
T21683 |
T21678 |
prep |
into,packaging |
| R5253 |
T21684 |
T21685 |
det |
the,body |
| R5254 |
T21685 |
T21683 |
pobj |
body,into |
| R5255 |
T21686 |
T21685 |
compound |
XY,body |
| R5256 |
T21687 |
T21678 |
cc |
and,packaging |
| R5257 |
T21688 |
T21689 |
det |
the,establishment |
| R5258 |
T21689 |
T21678 |
conj |
establishment,packaging |
| R5259 |
T21690 |
T21689 |
prep |
of,establishment |
| R526 |
T4262 |
T4263 |
amod |
human,rates |
| R5260 |
T21691 |
T21690 |
pobj |
MSCI,of |
| R5261 |
T21692 |
T21671 |
punct |
.,is |
| R5262 |
T21694 |
T21695 |
nsubj |
Examination,showed |
| R5263 |
T21696 |
T21694 |
prep |
of,Examination |
| R5264 |
T21697 |
T21698 |
amod |
male,meiosis |
| R5265 |
T21698 |
T21696 |
pobj |
meiosis,of |
| R5266 |
T21699 |
T21694 |
prep |
in,Examination |
| R5267 |
T21700 |
T21701 |
compound |
XYY,mice |
| R5268 |
T21701 |
T21699 |
pobj |
mice,in |
| R5269 |
T21702 |
T21701 |
cc |
and,mice |
| R527 |
T4263 |
T4261 |
pobj |
rates,with |
| R5270 |
T21703 |
T21701 |
conj |
mice,mice |
| R5271 |
T21704 |
T21703 |
acl |
carrying,mice |
| R5272 |
T21705 |
T21706 |
det |
a,translocation |
| R5273 |
T21706 |
T21704 |
dobj |
translocation,carrying |
| R5274 |
T21707 |
T21708 |
nmod |
sex,chromosome |
| R5275 |
T21708 |
T21706 |
nmod |
chromosome,translocation |
| R5276 |
T21709 |
T21708 |
punct |
-,chromosome |
| R5277 |
T21710 |
T21708 |
punct |
-,chromosome |
| R5278 |
T21711 |
T21708 |
prep |
to,chromosome |
| R5279 |
T21712 |
T21711 |
punct |
-,to |
| R528 |
T4098 |
T4097 |
prep |
of,much |
| R5280 |
T21713 |
T21711 |
pobj |
autosome,to |
| R5281 |
T21714 |
T21715 |
mark |
that,eliminated |
| R5282 |
T21715 |
T21695 |
ccomp |
eliminated,showed |
| R5283 |
T21716 |
T21715 |
nsubjpass |
cells,eliminated |
| R5284 |
T21717 |
T21718 |
prep |
in,escapes |
| R5285 |
T21718 |
T21716 |
relcl |
escapes,cells |
| R5286 |
T21719 |
T21717 |
pobj |
which,in |
| R5287 |
T21720 |
T21721 |
det |
a,chromosome |
| R5288 |
T21721 |
T21718 |
nsubj |
chromosome,escapes |
| R5289 |
T21722 |
T21721 |
compound |
sex,chromosome |
| R529 |
T4264 |
T4263 |
compound |
oocyte,rates |
| R5290 |
T21723 |
T21718 |
dobj |
MSCI,escapes |
| R5291 |
T21724 |
T21715 |
auxpass |
are,eliminated |
| R5292 |
T21725 |
T21715 |
prep |
prior,eliminated |
| R5293 |
T21726 |
T21725 |
prep |
to,prior |
| R5294 |
T21727 |
T21728 |
amod |
late,pachynema |
| R5295 |
T21728 |
T21726 |
pobj |
pachynema,to |
| R5296 |
T21729 |
T21728 |
punct |
-,pachynema |
| R5297 |
T21730 |
T21731 |
punct |
[,17 |
| R5298 |
T21731 |
T21695 |
parataxis |
17,showed |
| R5299 |
T21732 |
T21731 |
punct |
],17 |
| R53 |
T945 |
T944 |
nsubj |
DMRT7,localizes |
| R530 |
T4265 |
T4263 |
compound |
aneuploidy,rates |
| R5300 |
T21733 |
T21695 |
punct |
.,showed |
| R5301 |
T21735 |
T21736 |
nsubj |
This,indicates |
| R5302 |
T21737 |
T21738 |
mark |
that,is |
| R5303 |
T21738 |
T21736 |
ccomp |
is,indicates |
| R5304 |
T21739 |
T21740 |
det |
the,establishment |
| R5305 |
T21740 |
T21738 |
nsubj |
establishment,is |
| R5306 |
T21741 |
T21740 |
prep |
of,establishment |
| R5307 |
T21742 |
T21741 |
pobj |
MSCI,of |
| R5308 |
T21743 |
T21738 |
advmod |
also,is |
| R5309 |
T21744 |
T21738 |
acomp |
subject,is |
| R531 |
T4266 |
T4267 |
quantmod |
up,25 |
| R5310 |
T21745 |
T21744 |
prep |
to,subject |
| R5311 |
T21746 |
T21745 |
pobj |
surveillance,to |
| R5312 |
T21747 |
T21736 |
punct |
.,indicates |
| R5313 |
T21749 |
T21750 |
mark |
Since,result |
| R5314 |
T21750 |
T21760 |
advcl |
result,tested |
| R5315 |
T21751 |
T21752 |
det |
the,arrest |
| R5316 |
T21752 |
T21750 |
nsubj |
arrest,result |
| R5317 |
T21753 |
T21752 |
cc |
and,arrest |
| R5318 |
T21754 |
T21752 |
conj |
apoptosis,arrest |
| R5319 |
T21755 |
T21752 |
prep |
of,arrest |
| R532 |
T4099 |
T4100 |
amod |
adult,life |
| R5320 |
T21756 |
T21757 |
compound |
Dmrt7,mutant |
| R5321 |
T21757 |
T21758 |
compound |
mutant,spermatocytes |
| R5322 |
T21758 |
T21755 |
pobj |
spermatocytes,of |
| R5323 |
T21759 |
T21750 |
aux |
could,result |
| R5324 |
T21761 |
T21750 |
prep |
from,result |
| R5325 |
T21762 |
T21761 |
pobj |
perturbation,from |
| R5326 |
T21763 |
T21762 |
prep |
of,perturbation |
| R5327 |
T21764 |
T21763 |
pobj |
any,of |
| R5328 |
T21765 |
T21764 |
prep |
of,any |
| R5329 |
T21766 |
T21767 |
det |
the,events |
| R533 |
T4267 |
T4269 |
nummod |
25,% |
| R5330 |
T21767 |
T21765 |
pobj |
events,of |
| R5331 |
T21768 |
T21767 |
amod |
critical,events |
| R5332 |
T21769 |
T21767 |
compound |
pachytene,events |
| R5333 |
T21770 |
T21767 |
acl |
mentioned,events |
| R5334 |
T21771 |
T21770 |
advmod |
above,mentioned |
| R5335 |
T21772 |
T21760 |
punct |
", ",tested |
| R5336 |
T21773 |
T21760 |
nsubj |
we,tested |
| R5337 |
T21774 |
T21775 |
mark |
whether,occur |
| R5338 |
T21775 |
T21760 |
ccomp |
occur,tested |
| R5339 |
T21776 |
T21775 |
nsubj |
they,occur |
| R534 |
T4268 |
T4267 |
quantmod |
to,25 |
| R5340 |
T21777 |
T21775 |
advmod |
abnormally,occur |
| R5341 |
T21778 |
T21775 |
prep |
in,occur |
| R5342 |
T21779 |
T21780 |
det |
the,cells |
| R5343 |
T21780 |
T21778 |
pobj |
cells,in |
| R5344 |
T21781 |
T21780 |
compound |
mutant,cells |
| R5345 |
T21782 |
T21760 |
punct |
.,tested |
| R5346 |
T21784 |
T21785 |
nsubj |
We,found |
| R5347 |
T21786 |
T21787 |
mark |
that,appear |
| R5348 |
T21787 |
T21785 |
ccomp |
appear,found |
| R5349 |
T21788 |
T21789 |
amod |
chromosomal,synapsis |
| R535 |
T4269 |
T4263 |
npadvmod |
%,rates |
| R5350 |
T21789 |
T21787 |
nsubj |
synapsis,appear |
| R5351 |
T21790 |
T21789 |
cc |
and,synapsis |
| R5352 |
T21791 |
T21789 |
conj |
recombination,synapsis |
| R5353 |
T21792 |
T21787 |
oprd |
normal,appear |
| R5354 |
T21793 |
T21787 |
prep |
in,appear |
| R5355 |
T21794 |
T21795 |
compound |
Dmrt7,mutant |
| R5356 |
T21795 |
T21796 |
compound |
mutant,cells |
| R5357 |
T21796 |
T21793 |
pobj |
cells,in |
| R5358 |
T21797 |
T21785 |
punct |
.,found |
| R5359 |
T21799 |
T21800 |
nsubj |
We,focused |
| R536 |
T4100 |
T4098 |
pobj |
life,of |
| R5360 |
T21801 |
T21800 |
advmod |
therefore,focused |
| R5361 |
T21802 |
T21800 |
prep |
on,focused |
| R5362 |
T21803 |
T21804 |
det |
the,body |
| R5363 |
T21804 |
T21802 |
pobj |
body,on |
| R5364 |
T21805 |
T21804 |
compound |
XY,body |
| R5365 |
T21806 |
T21804 |
punct |
", ",body |
| R5366 |
T21807 |
T21808 |
det |
the,site |
| R5367 |
T21808 |
T21804 |
appos |
site,body |
| R5368 |
T21809 |
T21810 |
advmod |
most,prominent |
| R5369 |
T21810 |
T21808 |
amod |
prominent,site |
| R537 |
T4270 |
T4269 |
cc |
versus,% |
| R5370 |
T21811 |
T21808 |
prep |
of,site |
| R5371 |
T21812 |
T21813 |
compound |
DMRT7,accumulation |
| R5372 |
T21813 |
T21811 |
pobj |
accumulation,of |
| R5373 |
T21814 |
T21800 |
punct |
.,focused |
| R5374 |
T21816 |
T21817 |
advmod |
First,tested |
| R5375 |
T21818 |
T21817 |
punct |
", ",tested |
| R5376 |
T21819 |
T21817 |
nsubj |
we,tested |
| R5377 |
T21820 |
T21821 |
mark |
whether,forms |
| R5378 |
T21821 |
T21817 |
ccomp |
forms,tested |
| R5379 |
T21822 |
T21823 |
det |
the,body |
| R538 |
T4271 |
T4272 |
quantmod |
about,2 |
| R5380 |
T21823 |
T21821 |
nsubj |
body,forms |
| R5381 |
T21824 |
T21823 |
compound |
XY,body |
| R5382 |
T21825 |
T21821 |
cc |
and,forms |
| R5383 |
T21826 |
T21827 |
nsubjpass |
MSCI,established |
| R5384 |
T21827 |
T21821 |
conj |
established,forms |
| R5385 |
T21828 |
T21827 |
auxpass |
is,established |
| R5386 |
T21829 |
T21821 |
prep |
in,forms |
| R5387 |
T21830 |
T21831 |
compound |
Dmrt7,mutant |
| R5388 |
T21831 |
T21832 |
compound |
mutant,cells |
| R5389 |
T21832 |
T21829 |
pobj |
cells,in |
| R539 |
T4272 |
T4273 |
nummod |
2,% |
| R5390 |
T21833 |
T21817 |
punct |
.,tested |
| R5391 |
T21835 |
T21836 |
advmod |
Surprisingly,found |
| R5392 |
T21837 |
T21836 |
punct |
", ",found |
| R5393 |
T21838 |
T21836 |
nsubj |
we,found |
| R5394 |
T21839 |
T21840 |
mark |
that,form |
| R5395 |
T21840 |
T21836 |
ccomp |
form,found |
| R5396 |
T21841 |
T21842 |
det |
these,cells |
| R5397 |
T21842 |
T21840 |
nsubj |
cells,form |
| R5398 |
T21843 |
T21844 |
det |
an,body |
| R5399 |
T21844 |
T21840 |
dobj |
body,form |
| R54 |
T946 |
T944 |
advmod |
preferentially,localizes |
| R540 |
T4101 |
T4102 |
punct |
(,reviewed |
| R5400 |
T21845 |
T21844 |
compound |
XY,body |
| R5401 |
T21846 |
T21844 |
prep |
with,body |
| R5402 |
T21847 |
T21848 |
amod |
normal,morphology |
| R5403 |
T21848 |
T21846 |
pobj |
morphology,with |
| R5404 |
T21849 |
T21848 |
cc |
and,morphology |
| R5405 |
T21850 |
T21851 |
amod |
proper,accumulation |
| R5406 |
T21851 |
T21848 |
conj |
accumulation,morphology |
| R5407 |
T21852 |
T21851 |
prep |
of,accumulation |
| R5408 |
T21853 |
T21854 |
predet |
all,marks |
| R5409 |
T21854 |
T21852 |
pobj |
marks,of |
| R541 |
T4273 |
T4269 |
conj |
%,% |
| R5410 |
T21855 |
T21854 |
det |
the,marks |
| R5411 |
T21856 |
T21854 |
compound |
chromatin,marks |
| R5412 |
T21857 |
T21858 |
nsubj |
we,examined |
| R5413 |
T21858 |
T21854 |
advcl |
examined,marks |
| R5414 |
T21859 |
T21836 |
punct |
.,found |
| R5415 |
T21861 |
T21862 |
advmod |
Moreover,demonstrated |
| R5416 |
T21863 |
T21862 |
punct |
", ",demonstrated |
| R5417 |
T21864 |
T21865 |
nmod |
Cot,hybridization |
| R5418 |
T21865 |
T21862 |
nsubj |
hybridization,demonstrated |
| R5419 |
T21866 |
T21864 |
punct |
-,Cot |
| R542 |
T4274 |
T4273 |
prep |
in,% |
| R5420 |
T21867 |
T21864 |
nummod |
1,Cot |
| R5421 |
T21868 |
T21865 |
cc |
and,hybridization |
| R5422 |
T21869 |
T21865 |
conj |
analysis,hybridization |
| R5423 |
T21870 |
T21869 |
prep |
of,analysis |
| R5424 |
T21871 |
T21872 |
compound |
RBMY,expression |
| R5425 |
T21872 |
T21870 |
pobj |
expression,of |
| R5426 |
T21873 |
T21874 |
mark |
that,initiates |
| R5427 |
T21874 |
T21862 |
ccomp |
initiates,demonstrated |
| R5428 |
T21875 |
T21874 |
nsubj |
MSCI,initiates |
| R5429 |
T21876 |
T21874 |
advmod |
normally,initiates |
| R543 |
T4102 |
T4086 |
parataxis |
reviewed,regulated |
| R5430 |
T21877 |
T21874 |
prep |
in,initiates |
| R5431 |
T21878 |
T21879 |
det |
the,body |
| R5432 |
T21879 |
T21877 |
pobj |
body,in |
| R5433 |
T21880 |
T21879 |
compound |
XY,body |
| R5434 |
T21881 |
T21879 |
prep |
of,body |
| R5435 |
T21882 |
T21883 |
compound |
mid-pachytene,cells |
| R5436 |
T21883 |
T21881 |
pobj |
cells,of |
| R5437 |
T21884 |
T21885 |
compound |
Dmrt7,mutant |
| R5438 |
T21885 |
T21883 |
compound |
mutant,cells |
| R5439 |
T21886 |
T21862 |
punct |
.,demonstrated |
| R544 |
T4275 |
T4276 |
amod |
human,sperm |
| R5440 |
T21888 |
T21889 |
nsubj |
We,observe |
| R5441 |
T21890 |
T21889 |
aux |
did,observe |
| R5442 |
T21891 |
T21889 |
punct |
", ",observe |
| R5443 |
T21892 |
T21889 |
advmod |
however,observe |
| R5444 |
T21893 |
T21889 |
punct |
", ",observe |
| R5445 |
T21894 |
T21895 |
nummod |
three,defects |
| R5446 |
T21895 |
T21889 |
dobj |
defects,observe |
| R5447 |
T21896 |
T21895 |
amod |
specific,defects |
| R5448 |
T21897 |
T21889 |
prep |
in,observe |
| R5449 |
T21898 |
T21899 |
det |
the,chromatin |
| R545 |
T4276 |
T4274 |
pobj |
sperm,in |
| R5450 |
T21899 |
T21897 |
pobj |
chromatin,in |
| R5451 |
T21900 |
T21899 |
compound |
sex,chromatin |
| R5452 |
T21901 |
T21899 |
prep |
of,chromatin |
| R5453 |
T21902 |
T21903 |
compound |
Dmrt7,mutant |
| R5454 |
T21903 |
T21904 |
compound |
mutant,cells |
| R5455 |
T21904 |
T21901 |
pobj |
cells,of |
| R5456 |
T21905 |
T21904 |
compound |
germ,cells |
| R5457 |
T21906 |
T21907 |
dep |
that,avoided |
| R5458 |
T21907 |
T21904 |
relcl |
avoided,cells |
| R5459 |
T21908 |
T21907 |
dobj |
arrest,avoided |
| R546 |
T4103 |
T4102 |
prep |
in,reviewed |
| R5460 |
T21909 |
T21908 |
prep |
in,arrest |
| R5461 |
T21910 |
T21909 |
pobj |
pachynema,in |
| R5462 |
T21911 |
T21907 |
cc |
and,avoided |
| R5463 |
T21912 |
T21907 |
conj |
were,avoided |
| R5464 |
T21913 |
T21912 |
acomp |
able,were |
| R5465 |
T21914 |
T21915 |
aux |
to,enter |
| R5466 |
T21915 |
T21913 |
xcomp |
enter,able |
| R5467 |
T21916 |
T21915 |
dobj |
diplonema,enter |
| R5468 |
T21917 |
T21889 |
punct |
.,observe |
| R5469 |
T21919 |
T21920 |
advmod |
Normally,accumulate |
| R547 |
T4277 |
T4278 |
punct |
[,3 |
| R5470 |
T21921 |
T21920 |
nsubj |
cells,accumulate |
| R5471 |
T21922 |
T21923 |
nmod |
H3,2meK9 |
| R5472 |
T21923 |
T21925 |
nmod |
2meK9,marks |
| R5473 |
T21924 |
T21923 |
punct |
-,2meK9 |
| R5474 |
T21925 |
T21920 |
dobj |
marks,accumulate |
| R5475 |
T21926 |
T21923 |
cc |
and,2meK9 |
| R5476 |
T21927 |
T21928 |
compound |
H3,3meK9 |
| R5477 |
T21928 |
T21923 |
conj |
3meK9,2meK9 |
| R5478 |
T21929 |
T21928 |
punct |
-,3meK9 |
| R5479 |
T21930 |
T21925 |
cc |
and,marks |
| R548 |
T4104 |
T4103 |
punct |
[,in |
| R5480 |
T21931 |
T21932 |
compound |
HP1β,protein |
| R5481 |
T21932 |
T21925 |
conj |
protein,marks |
| R5482 |
T21933 |
T21920 |
prep |
on,accumulate |
| R5483 |
T21934 |
T21935 |
det |
the,chromatin |
| R5484 |
T21935 |
T21933 |
pobj |
chromatin,on |
| R5485 |
T21936 |
T21935 |
compound |
sex,chromatin |
| R5486 |
T21937 |
T21938 |
mark |
as,progress |
| R5487 |
T21938 |
T21920 |
advcl |
progress,accumulate |
| R5488 |
T21939 |
T21938 |
nsubj |
they,progress |
| R5489 |
T21940 |
T21938 |
prep |
to,progress |
| R549 |
T4278 |
T4248 |
parataxis |
3,is |
| R5490 |
T21941 |
T21940 |
pobj |
diplonema,to |
| R5491 |
T21942 |
T21920 |
punct |
", ",accumulate |
| R5492 |
T21943 |
T21920 |
cc |
but,accumulate |
| R5493 |
T21944 |
T21945 |
nsubj |
we,observed |
| R5494 |
T21945 |
T21920 |
conj |
observed,accumulate |
| R5495 |
T21946 |
T21947 |
compound |
mutant,cells |
| R5496 |
T21947 |
T21945 |
dobj |
cells,observed |
| R5497 |
T21948 |
T21947 |
compound |
diplotene,cells |
| R5498 |
T21949 |
T21947 |
acl |
lacking,cells |
| R5499 |
T21950 |
T21951 |
det |
these,features |
| R55 |
T947 |
T944 |
prep |
to,localizes |
| R550 |
T4279 |
T4278 |
punct |
],3 |
| R5500 |
T21951 |
T21949 |
dobj |
features,lacking |
| R5501 |
T21952 |
T21945 |
punct |
.,observed |
| R5502 |
T21954 |
T21955 |
advmod |
Thus,are |
| R5503 |
T21956 |
T21955 |
punct |
", ",are |
| R5504 |
T21957 |
T21958 |
mark |
although,progress |
| R5505 |
T21958 |
T21955 |
advcl |
progress,are |
| R5506 |
T21959 |
T21960 |
det |
a,minority |
| R5507 |
T21960 |
T21958 |
nsubj |
minority,progress |
| R5508 |
T21961 |
T21960 |
prep |
of,minority |
| R5509 |
T21962 |
T21963 |
compound |
Dmrt7,mutant |
| R551 |
T4280 |
T4248 |
punct |
", ",is |
| R5510 |
T21963 |
T21964 |
compound |
mutant,cells |
| R5511 |
T21964 |
T21961 |
pobj |
cells,of |
| R5512 |
T21965 |
T21964 |
compound |
germ,cells |
| R5513 |
T21966 |
T21958 |
aux |
can,progress |
| R5514 |
T21967 |
T21958 |
prep |
from,progress |
| R5515 |
T21968 |
T21967 |
pobj |
pachynema,from |
| R5516 |
T21969 |
T21958 |
prep |
to,progress |
| R5517 |
T21970 |
T21969 |
pobj |
diplonema,to |
| R5518 |
T21971 |
T21955 |
punct |
", ",are |
| R5519 |
T21972 |
T21955 |
expl |
there,are |
| R552 |
T4105 |
T4103 |
pobj |
1,in |
| R5520 |
T21973 |
T21955 |
attr |
defects,are |
| R5521 |
T21974 |
T21973 |
prep |
in,defects |
| R5522 |
T21975 |
T21976 |
compound |
sex,chromatin |
| R5523 |
T21976 |
T21977 |
compound |
chromatin,modification |
| R5524 |
T21977 |
T21974 |
pobj |
modification,in |
| R5525 |
T21978 |
T21955 |
prep |
during,are |
| R5526 |
T21979 |
T21980 |
det |
the,transition |
| R5527 |
T21980 |
T21978 |
pobj |
transition,during |
| R5528 |
T21981 |
T21955 |
punct |
.,are |
| R5529 |
T21983 |
T21984 |
det |
A,function |
| R553 |
T4281 |
T4248 |
cc |
and,is |
| R5530 |
T21984 |
T21985 |
nsubj |
function,reconcile |
| R5531 |
T21986 |
T21984 |
prep |
in,function |
| R5532 |
T21987 |
T21988 |
amod |
male,chromatin |
| R5533 |
T21988 |
T21986 |
pobj |
chromatin,in |
| R5534 |
T21989 |
T21988 |
compound |
sex,chromatin |
| R5535 |
T21990 |
T21985 |
aux |
can,reconcile |
| R5536 |
T21991 |
T21992 |
det |
the,findings |
| R5537 |
T21992 |
T21985 |
dobj |
findings,reconcile |
| R5538 |
T21993 |
T21994 |
mark |
that,required |
| R5539 |
T21994 |
T21992 |
acl |
required,findings |
| R554 |
T4282 |
T4283 |
nsubj |
this,indicate |
| R5540 |
T21995 |
T21994 |
nsubjpass |
DMRT7,required |
| R5541 |
T21996 |
T21994 |
auxpass |
is,required |
| R5542 |
T21997 |
T21994 |
prep |
for,required |
| R5543 |
T21998 |
T21997 |
pobj |
meiosis,for |
| R5544 |
T21999 |
T21994 |
punct |
", ",required |
| R5545 |
T22000 |
T21994 |
cc |
but,required |
| R5546 |
T22001 |
T22002 |
advmod |
only,in |
| R5547 |
T22002 |
T22000 |
prep |
in,but |
| R5548 |
T22003 |
T22002 |
pobj |
males,in |
| R5549 |
T22004 |
T21985 |
punct |
", ",reconcile |
| R555 |
T4283 |
T4248 |
conj |
indicate,is |
| R5550 |
T22005 |
T21985 |
cc |
and,reconcile |
| R5551 |
T22006 |
T21985 |
conj |
is,reconcile |
| R5552 |
T22007 |
T22006 |
acomp |
present,is |
| R5553 |
T22008 |
T22009 |
advmod |
only,in |
| R5554 |
T22009 |
T22006 |
prep |
in,is |
| R5555 |
T22010 |
T22009 |
pobj |
mammals,in |
| R5556 |
T22011 |
T21985 |
punct |
.,reconcile |
| R5557 |
T22013 |
T22014 |
det |
A,proportion |
| R5558 |
T22014 |
T22015 |
nsubj |
proportion,have |
| R5559 |
T22015 |
T22020 |
ccomp |
have,are |
| R556 |
T4106 |
T4102 |
punct |
],reviewed |
| R5560 |
T22016 |
T22014 |
prep |
of,proportion |
| R5561 |
T22017 |
T22018 |
compound |
mutant,cells |
| R5562 |
T22018 |
T22016 |
pobj |
cells,of |
| R5563 |
T22019 |
T22018 |
compound |
diplotene,cells |
| R5564 |
T22021 |
T22022 |
advmod |
apparently,normal |
| R5565 |
T22022 |
T22023 |
amod |
normal,chromatin |
| R5566 |
T22023 |
T22015 |
dobj |
chromatin,have |
| R5567 |
T22024 |
T22023 |
compound |
sex,chromatin |
| R5568 |
T22025 |
T22026 |
punct |
(,8M |
| R5569 |
T22026 |
T22015 |
parataxis |
8M,have |
| R557 |
T4284 |
T4283 |
aux |
may,indicate |
| R5570 |
T22027 |
T22026 |
prep |
for,8M |
| R5571 |
T22028 |
T22027 |
pobj |
example,for |
| R5572 |
T22029 |
T22026 |
punct |
", ",8M |
| R5573 |
T22030 |
T22026 |
compound |
Figure,8M |
| R5574 |
T22031 |
T22026 |
punct |
),8M |
| R5575 |
T22032 |
T22020 |
punct |
;,are |
| R5576 |
T22033 |
T22020 |
nsubj |
these,are |
| R5577 |
T22034 |
T22020 |
acomp |
likely,are |
| R5578 |
T22035 |
T22036 |
aux |
to,be |
| R5579 |
T22036 |
T22034 |
xcomp |
be,likely |
| R558 |
T4285 |
T4286 |
mark |
that,are |
| R5580 |
T22037 |
T22038 |
det |
the,cells |
| R5581 |
T22038 |
T22036 |
attr |
cells,be |
| R5582 |
T22039 |
T22040 |
dep |
that,progress |
| R5583 |
T22040 |
T22038 |
relcl |
progress,cells |
| R5584 |
T22041 |
T22040 |
aux |
can,progress |
| R5585 |
T22042 |
T22040 |
prep |
beyond,progress |
| R5586 |
T22043 |
T22042 |
pobj |
diplonema,beyond |
| R5587 |
T22044 |
T22020 |
punct |
.,are |
| R5588 |
T22046 |
T22047 |
mark |
Because,eliminated |
| R5589 |
T22047 |
T22054 |
advcl |
eliminated,is |
| R559 |
T4107 |
T4102 |
punct |
),reviewed |
| R5590 |
T22048 |
T22049 |
amod |
most,cells |
| R5591 |
T22049 |
T22047 |
nsubjpass |
cells,eliminated |
| R5592 |
T22050 |
T22051 |
compound |
Dmrt7,mutant |
| R5593 |
T22051 |
T22049 |
compound |
mutant,cells |
| R5594 |
T22052 |
T22049 |
compound |
germ,cells |
| R5595 |
T22053 |
T22047 |
auxpass |
are,eliminated |
| R5596 |
T22055 |
T22047 |
agent |
by,eliminated |
| R5597 |
T22056 |
T22055 |
pobj |
apoptosis,by |
| R5598 |
T22057 |
T22047 |
prep |
around,eliminated |
| R5599 |
T22058 |
T22059 |
det |
the,time |
| R56 |
T948 |
T949 |
det |
the,body |
| R560 |
T4286 |
T4283 |
ccomp |
are,indicate |
| R5600 |
T22059 |
T22057 |
pobj |
time,around |
| R5601 |
T22060 |
T22061 |
prep |
at,observed |
| R5602 |
T22061 |
T22059 |
relcl |
observed,time |
| R5603 |
T22062 |
T22060 |
pobj |
which,at |
| R5604 |
T22063 |
T22061 |
nsubj |
we,observed |
| R5605 |
T22064 |
T22065 |
compound |
sex,defects |
| R5606 |
T22065 |
T22061 |
dobj |
defects,observed |
| R5607 |
T22066 |
T22065 |
compound |
chromatin,defects |
| R5608 |
T22067 |
T22054 |
punct |
", ",is |
| R5609 |
T22068 |
T22069 |
det |
a,model |
| R561 |
T4287 |
T4288 |
det |
the,checkpoints |
| R5610 |
T22069 |
T22054 |
nsubj |
model,is |
| R5611 |
T22070 |
T22069 |
amod |
simple,model |
| R5612 |
T22071 |
T22072 |
mark |
that,is |
| R5613 |
T22072 |
T22054 |
ccomp |
is,is |
| R5614 |
T22073 |
T22074 |
det |
the,apoptosis |
| R5615 |
T22074 |
T22072 |
nsubj |
apoptosis,is |
| R5616 |
T22075 |
T22076 |
det |
a,consequence |
| R5617 |
T22076 |
T22072 |
attr |
consequence,is |
| R5618 |
T22077 |
T22076 |
prep |
of,consequence |
| R5619 |
T22078 |
T22079 |
det |
the,defects |
| R562 |
T4108 |
T4086 |
punct |
.,regulated |
| R5620 |
T22079 |
T22077 |
pobj |
defects,of |
| R5621 |
T22080 |
T22081 |
compound |
sex,chromatin |
| R5622 |
T22081 |
T22079 |
compound |
chromatin,defects |
| R5623 |
T22082 |
T22054 |
punct |
.,is |
| R5624 |
T22084 |
T22085 |
det |
The,situation |
| R5625 |
T22085 |
T22087 |
nsubj |
situation,is |
| R5626 |
T22086 |
T22085 |
amod |
reciprocal,situation |
| R5627 |
T22088 |
T22089 |
punct |
(,defects |
| R5628 |
T22089 |
T22085 |
parataxis |
defects,situation |
| R5629 |
T22090 |
T22089 |
compound |
sex,defects |
| R563 |
T4288 |
T4286 |
nsubj |
checkpoints,are |
| R5630 |
T22091 |
T22089 |
compound |
chromatin,defects |
| R5631 |
T22092 |
T22089 |
acl |
caused,defects |
| R5632 |
T22093 |
T22092 |
agent |
by,caused |
| R5633 |
T22094 |
T22093 |
pobj |
apoptosis,by |
| R5634 |
T22095 |
T22089 |
punct |
),defects |
| R5635 |
T22096 |
T22087 |
acomp |
possible,is |
| R5636 |
T22097 |
T22087 |
punct |
", ",is |
| R5637 |
T22098 |
T22087 |
cc |
but,is |
| R5638 |
T22099 |
T22087 |
conj |
seems,is |
| R5639 |
T22100 |
T22099 |
oprd |
unlikely,seems |
| R564 |
T4289 |
T4288 |
acl |
controlling,checkpoints |
| R5640 |
T22101 |
T22087 |
punct |
", ",is |
| R5641 |
T22102 |
T22103 |
mark |
because,observed |
| R5642 |
T22103 |
T22087 |
advcl |
observed,is |
| R5643 |
T22104 |
T22103 |
nsubj |
we,observed |
| R5644 |
T22105 |
T22106 |
compound |
mutant,cells |
| R5645 |
T22106 |
T22103 |
dobj |
cells,observed |
| R5646 |
T22107 |
T22106 |
prep |
with,cells |
| R5647 |
T22108 |
T22109 |
compound |
sex,chromatin |
| R5648 |
T22109 |
T22110 |
compound |
chromatin,defects |
| R5649 |
T22110 |
T22107 |
pobj |
defects,with |
| R565 |
T4290 |
T4289 |
cc |
and,controlling |
| R5650 |
T22111 |
T22110 |
cc |
but,defects |
| R5651 |
T22112 |
T22113 |
det |
no,indications |
| R5652 |
T22113 |
T22110 |
conj |
indications,defects |
| R5653 |
T22114 |
T22113 |
prep |
of,indications |
| R5654 |
T22115 |
T22114 |
pobj |
apoptosis,of |
| R5655 |
T22116 |
T22087 |
punct |
.,is |
| R5656 |
T22118 |
T22119 |
advmod |
Alternatively,be |
| R5657 |
T22120 |
T22119 |
punct |
", ",be |
| R5658 |
T22121 |
T22119 |
nsubj |
apoptosis,be |
| R5659 |
T22122 |
T22121 |
cc |
and,apoptosis |
| R566 |
T4110 |
T4111 |
prep |
For,are |
| R5660 |
T22123 |
T22124 |
amod |
abnormal,chromatin |
| R5661 |
T22124 |
T22121 |
conj |
chromatin,apoptosis |
| R5662 |
T22125 |
T22124 |
compound |
sex,chromatin |
| R5663 |
T22126 |
T22119 |
aux |
may,be |
| R5664 |
T22127 |
T22128 |
nummod |
two,consequences |
| R5665 |
T22128 |
T22119 |
attr |
consequences,be |
| R5666 |
T22129 |
T22128 |
amod |
independent,consequences |
| R5667 |
T22130 |
T22128 |
prep |
of,consequences |
| R5668 |
T22131 |
T22132 |
compound |
Dmrt7,loss |
| R5669 |
T22132 |
T22130 |
pobj |
loss,of |
| R567 |
T4291 |
T4289 |
conj |
monitoring,controlling |
| R5670 |
T22133 |
T22119 |
punct |
.,be |
| R5671 |
T22135 |
T22136 |
det |
This,question |
| R5672 |
T22136 |
T22137 |
nsubjpass |
question,answered |
| R5673 |
T22138 |
T22137 |
aux |
can,answered |
| R5674 |
T22394 |
T22374 |
punct |
", ",required |
| R5675 |
T22139 |
T22137 |
neg |
not,answered |
| R5676 |
T22395 |
T22374 |
cc |
but,required |
| R5677 |
T22396 |
T22397 |
nsubjpass |
it,expressed |
| R5678 |
T22140 |
T22137 |
auxpass |
be,answered |
| R5679 |
T22397 |
T22374 |
conj |
expressed,required |
| R568 |
T4292 |
T4293 |
det |
the,events |
| R5680 |
T22398 |
T22397 |
auxpass |
is,expressed |
| R5681 |
T22141 |
T22137 |
advmod |
definitively,answered |
| R5682 |
T22399 |
T22397 |
neg |
not,expressed |
| R5683 |
T22400 |
T22397 |
prep |
in,expressed |
| R5684 |
T22401 |
T22402 |
amod |
meiotic,cells |
| R5685 |
T22142 |
T22143 |
mark |
until,know |
| R5686 |
T22402 |
T22400 |
pobj |
cells,in |
| R5687 |
T22403 |
T22404 |
punct |
[,31 |
| R5688 |
T22404 |
T22397 |
parataxis |
31,expressed |
| R5689 |
T22143 |
T22137 |
advcl |
know,answered |
| R569 |
T4293 |
T4291 |
dobj |
events,monitoring |
| R5690 |
T22405 |
T22404 |
punct |
],31 |
| R5691 |
T22406 |
T22407 |
punct |
(,S. |
| R5692 |
T22407 |
T22397 |
meta |
S.,expressed |
| R5693 |
T22144 |
T22143 |
nsubj |
we,know |
| R5694 |
T22408 |
T22407 |
nmod |
Kim,S. |
| R5695 |
T22409 |
T22407 |
cc |
and,S. |
| R5696 |
T22410 |
T22407 |
conj |
D.,S. |
| R5697 |
T22145 |
T22146 |
det |
the,mechanism |
| R5698 |
T22411 |
T22410 |
nmod |
Zarkower,D. |
| R5699 |
T22412 |
T22410 |
punct |
", ",D. |
| R57 |
T949 |
T947 |
pobj |
body,to |
| R570 |
T4294 |
T4293 |
prep |
of,events |
| R5700 |
T22146 |
T22143 |
dobj |
mechanism,know |
| R5701 |
T22413 |
T22414 |
amod |
unpublished,data |
| R5702 |
T22414 |
T22410 |
conj |
data,D. |
| R5703 |
T22415 |
T22414 |
punct |
),data |
| R5704 |
T22147 |
T22146 |
amod |
detailed,mechanism |
| R5705 |
T22416 |
T22397 |
punct |
.,expressed |
| R5706 |
T22418 |
T22419 |
det |
The,requirement |
| R5707 |
T22148 |
T22146 |
amod |
molecular,mechanism |
| R5708 |
T22419 |
T22420 |
nsubj |
requirement,demonstrates |
| R5709 |
T22149 |
T22146 |
prep |
of,mechanism |
| R571 |
T4295 |
T4296 |
amod |
meiotic,progression |
| R5710 |
T22421 |
T22419 |
prep |
for,requirement |
| R5711 |
T22422 |
T22421 |
pobj |
DMRT1,for |
| R5712 |
T22423 |
T22422 |
prep |
in,DMRT1 |
| R5713 |
T22424 |
T22425 |
amod |
pre-meiotic,cells |
| R5714 |
T22425 |
T22423 |
pobj |
cells,in |
| R5715 |
T22150 |
T22149 |
pobj |
DMRT7,of |
| R5716 |
T22426 |
T22425 |
compound |
germ,cells |
| R5717 |
T22427 |
T22422 |
cc |
and,DMRT1 |
| R5718 |
T22428 |
T22422 |
conj |
DMRT7,DMRT1 |
| R5719 |
T22151 |
T22137 |
punct |
.,answered |
| R572 |
T4296 |
T4294 |
pobj |
progression,of |
| R5720 |
T22429 |
T22428 |
prep |
in,DMRT7 |
| R5721 |
T22430 |
T22431 |
amod |
meiotic,cells |
| R5722 |
T22431 |
T22429 |
pobj |
cells,in |
| R5723 |
T22153 |
T22154 |
det |
A,number |
| R5724 |
T22432 |
T22431 |
compound |
germ,cells |
| R5725 |
T22433 |
T22434 |
mark |
that,act |
| R5726 |
T22434 |
T22420 |
ccomp |
act,demonstrates |
| R5727 |
T22435 |
T22436 |
compound |
DM,domain |
| R5728 |
T22154 |
T22155 |
nsubjpass |
number,identified |
| R5729 |
T22436 |
T22437 |
compound |
domain,proteins |
| R573 |
T4297 |
T4291 |
prep |
in,monitoring |
| R5730 |
T22437 |
T22434 |
nsubj |
proteins,act |
| R5731 |
T22438 |
T22434 |
prep |
at,act |
| R5732 |
T22156 |
T22154 |
prep |
of,number |
| R5733 |
T22439 |
T22440 |
amod |
multiple,points |
| R5734 |
T22157 |
T22158 |
amod |
other,proteins |
| R5735 |
T22440 |
T22438 |
pobj |
points,at |
| R5736 |
T22441 |
T22440 |
amod |
critical,points |
| R5737 |
T22158 |
T22156 |
pobj |
proteins,of |
| R5738 |
T22442 |
T22440 |
prep |
of,points |
| R5739 |
T22443 |
T22444 |
amod |
male,development |
| R574 |
T4298 |
T4297 |
pobj |
males,in |
| R5740 |
T22159 |
T22155 |
aux |
have,identified |
| R5741 |
T22160 |
T22155 |
auxpass |
been,identified |
| R5742 |
T22444 |
T22442 |
pobj |
development,of |
| R5743 |
T22161 |
T22162 |
dep |
that,interact |
| R5744 |
T22162 |
T22155 |
ccomp |
interact,identified |
| R5745 |
T22445 |
T22446 |
compound |
germ,cell |
| R5746 |
T22163 |
T22162 |
prep |
with,interact |
| R5747 |
T22164 |
T22165 |
det |
the,body |
| R5748 |
T22446 |
T22444 |
compound |
cell,development |
| R5749 |
T22447 |
T22420 |
punct |
.,demonstrates |
| R575 |
T4299 |
T4300 |
advmod |
more,stringent |
| R5750 |
T22165 |
T22163 |
pobj |
body,with |
| R5751 |
T22449 |
T22450 |
nsubj |
Ovaries,have |
| R5752 |
T22166 |
T22165 |
compound |
XY,body |
| R5753 |
T22451 |
T22449 |
prep |
of,Ovaries |
| R5754 |
T22167 |
T22155 |
punct |
", ",identified |
| R5755 |
T22452 |
T22453 |
compound |
Dmrt4,females |
| R5756 |
T22453 |
T22451 |
pobj |
females,of |
| R5757 |
T22168 |
T22155 |
prep |
including,identified |
| R5758 |
T22454 |
T22453 |
compound |
mutant,females |
| R5759 |
T22455 |
T22456 |
amod |
polyovular,follicles |
| R576 |
T4112 |
T4110 |
pobj |
example,For |
| R5760 |
T22169 |
T22170 |
compound |
histone,variants |
| R5761 |
T22456 |
T22450 |
dobj |
follicles,have |
| R5762 |
T22170 |
T22168 |
pobj |
variants,including |
| R5763 |
T22457 |
T22456 |
punct |
(,follicles |
| R5764 |
T22171 |
T22170 |
cc |
and,variants |
| R5765 |
T22458 |
T22456 |
appos |
follicles,follicles |
| R5766 |
T22459 |
T22458 |
acl |
containing,follicles |
| R5767 |
T22460 |
T22461 |
amod |
multiple,oocytes |
| R5768 |
T22172 |
T22173 |
amod |
modified,histones |
| R5769 |
T22461 |
T22459 |
dobj |
oocytes,containing |
| R577 |
T4300 |
T4286 |
acomp |
stringent,are |
| R5770 |
T22462 |
T22456 |
punct |
),follicles |
| R5771 |
T22173 |
T22170 |
conj |
histones,variants |
| R5772 |
T22463 |
T22450 |
punct |
", ",have |
| R5773 |
T22464 |
T22450 |
cc |
but,have |
| R5774 |
T22465 |
T22466 |
nsubj |
it,is |
| R5775 |
T22174 |
T22173 |
punct |
", ",histones |
| R5776 |
T22466 |
T22450 |
conj |
is,have |
| R5777 |
T22175 |
T22176 |
det |
a,transferase |
| R5778 |
T22467 |
T22466 |
acomp |
unknown,is |
| R5779 |
T22176 |
T22173 |
conj |
transferase,histones |
| R578 |
T4301 |
T4283 |
punct |
.,indicate |
| R5780 |
T22468 |
T22469 |
mark |
whether,reflects |
| R5781 |
T22469 |
T22466 |
ccomp |
reflects,is |
| R5782 |
T22470 |
T22469 |
nsubj |
this,reflects |
| R5783 |
T22177 |
T22178 |
npadvmod |
testis,specific |
| R5784 |
T22471 |
T22472 |
det |
a,defect |
| R5785 |
T22472 |
T22469 |
dobj |
defect,reflects |
| R5786 |
T22178 |
T22176 |
amod |
specific,transferase |
| R5787 |
T22473 |
T22472 |
prep |
in,defect |
| R5788 |
T22474 |
T22475 |
det |
the,line |
| R5789 |
T22179 |
T22178 |
punct |
-,specific |
| R579 |
T4303 |
T4304 |
advcl |
Consistent,demonstrated |
| R5790 |
T22475 |
T22473 |
pobj |
line,in |
| R5791 |
T22476 |
T22475 |
compound |
germ,line |
| R5792 |
T22180 |
T22176 |
compound |
histone,transferase |
| R5793 |
T22477 |
T22475 |
cc |
or,line |
| R5794 |
T22478 |
T22479 |
det |
the,soma |
| R5795 |
T22181 |
T22176 |
compound |
methyl,transferase |
| R5796 |
T22479 |
T22475 |
conj |
soma,line |
| R5797 |
T22480 |
T22466 |
punct |
.,is |
| R5798 |
T22182 |
T22176 |
punct |
", ",transferase |
| R5799 |
T22482 |
T22483 |
nsubj |
It,is |
| R58 |
T838 |
T836 |
amod |
dimorphic,process |
| R580 |
T4305 |
T4303 |
prep |
with,Consistent |
| R5800 |
T22183 |
T22184 |
compound |
chromobox,proteins |
| R5801 |
T22484 |
T22483 |
acomp |
notable,is |
| R5802 |
T22485 |
T22486 |
mark |
that,affect |
| R5803 |
T22184 |
T22176 |
conj |
proteins,transferase |
| R5804 |
T22486 |
T22483 |
ccomp |
affect,is |
| R5805 |
T22487 |
T22488 |
advmod |
at,three |
| R5806 |
T22185 |
T22184 |
punct |
", ",proteins |
| R5807 |
T22488 |
T22490 |
nummod |
three,genes |
| R5808 |
T22489 |
T22488 |
advmod |
least,three |
| R5809 |
T22186 |
T22187 |
det |
an,factor |
| R581 |
T4113 |
T4111 |
punct |
", ",are |
| R5810 |
T22187 |
T22184 |
conj |
factor,proteins |
| R5811 |
T22490 |
T22486 |
nsubj |
genes,affect |
| R5812 |
T22188 |
T22189 |
nmod |
orphan,receptor |
| R5813 |
T22491 |
T22490 |
amod |
mammalian,genes |
| R5814 |
T22492 |
T22493 |
compound |
DM,domain |
| R5815 |
T22189 |
T22187 |
nmod |
receptor,factor |
| R5816 |
T22493 |
T22490 |
compound |
domain,genes |
| R5817 |
T22494 |
T22495 |
amod |
gonadal,development |
| R5818 |
T22495 |
T22486 |
dobj |
development,affect |
| R5819 |
T22496 |
T22497 |
advmod |
only,in |
| R582 |
T4306 |
T4307 |
det |
this,idea |
| R5820 |
T22190 |
T22191 |
nmod |
germ,cell |
| R5821 |
T22497 |
T22486 |
prep |
in,affect |
| R5822 |
T22498 |
T22499 |
nummod |
one,sex |
| R5823 |
T22191 |
T22187 |
nmod |
cell,factor |
| R5824 |
T22499 |
T22497 |
pobj |
sex,in |
| R5825 |
T22500 |
T22486 |
punct |
", ",affect |
| R5826 |
T22501 |
T22486 |
prep |
given,affect |
| R5827 |
T22192 |
T22191 |
punct |
-,cell |
| R5828 |
T22502 |
T22503 |
det |
the,roles |
| R5829 |
T22503 |
T22501 |
pobj |
roles,given |
| R583 |
T4307 |
T4305 |
pobj |
idea,with |
| R5830 |
T22193 |
T22187 |
amod |
nuclear,factor |
| R5831 |
T22504 |
T22503 |
amod |
similar,roles |
| R5832 |
T22505 |
T22503 |
prep |
of,roles |
| R5833 |
T22194 |
T22187 |
punct |
", ",factor |
| R5834 |
T22506 |
T22507 |
amod |
related,proteins |
| R5835 |
T22507 |
T22505 |
pobj |
proteins,of |
| R5836 |
T22195 |
T22187 |
cc |
and,factor |
| R5837 |
T22508 |
T22503 |
prep |
in,roles |
| R5838 |
T22196 |
T22197 |
npadvmod |
recombination,related |
| R5839 |
T22509 |
T22508 |
pcomp |
directing,in |
| R584 |
T4308 |
T4304 |
punct |
", ",demonstrated |
| R5840 |
T22510 |
T22511 |
npadvmod |
sex,specific |
| R5841 |
T22511 |
T22513 |
amod |
specific,development |
| R5842 |
T22512 |
T22511 |
punct |
-,specific |
| R5843 |
T22513 |
T22509 |
dobj |
development,directing |
| R5844 |
T22197 |
T22199 |
amod |
related,proteins |
| R5845 |
T22514 |
T22513 |
amod |
somatic,development |
| R5846 |
T22515 |
T22509 |
prep |
in,directing |
| R5847 |
T22516 |
T22517 |
amod |
other,phyla |
| R5848 |
T22198 |
T22197 |
punct |
-,related |
| R5849 |
T22517 |
T22515 |
pobj |
phyla,in |
| R585 |
T4309 |
T4310 |
amod |
genetic,analysis |
| R5850 |
T22518 |
T22483 |
punct |
.,is |
| R5851 |
T22199 |
T22187 |
conj |
proteins,factor |
| R5852 |
T22520 |
T22521 |
advmod |
Strikingly,is |
| R5853 |
T22200 |
T22201 |
punct |
[,60 |
| R5854 |
T22522 |
T22521 |
punct |
", ",is |
| R5855 |
T22201 |
T22155 |
parataxis |
60,identified |
| R5856 |
T22523 |
T22521 |
nsubj |
Dmrt7,is |
| R5857 |
T22524 |
T22521 |
acomp |
present,is |
| R5858 |
T22525 |
T22521 |
punct |
", ",is |
| R5859 |
T22202 |
T22201 |
punct |
],60 |
| R586 |
T4114 |
T4115 |
det |
the,timing |
| R5860 |
T22526 |
T22527 |
preconj |
not,in |
| R5861 |
T22527 |
T22521 |
prep |
in,is |
| R5862 |
T22203 |
T22155 |
punct |
.,identified |
| R5863 |
T22528 |
T22526 |
advmod |
only,not |
| R5864 |
T22529 |
T22530 |
amod |
placental,mammals |
| R5865 |
T22205 |
T22206 |
det |
A,feature |
| R5866 |
T22530 |
T22527 |
pobj |
mammals,in |
| R5867 |
T22531 |
T22527 |
punct |
", ",in |
| R5868 |
T22532 |
T22527 |
cc |
but,in |
| R5869 |
T22206 |
T22208 |
nsubj |
feature,is |
| R587 |
T4310 |
T4304 |
nsubj |
analysis,demonstrated |
| R5870 |
T22533 |
T22532 |
advmod |
also,but |
| R5871 |
T22534 |
T22527 |
conj |
in,in |
| R5872 |
T22535 |
T22534 |
pobj |
marsupials,in |
| R5873 |
T22536 |
T22535 |
cc |
and,marsupials |
| R5874 |
T22537 |
T22538 |
det |
a,monotreme |
| R5875 |
T22207 |
T22206 |
amod |
common,feature |
| R5876 |
T22538 |
T22535 |
conj |
monotreme,marsupials |
| R5877 |
T22539 |
T22540 |
punct |
(,mammal |
| R5878 |
T22209 |
T22206 |
prep |
of,feature |
| R5879 |
T22540 |
T22538 |
parataxis |
mammal,monotreme |
| R588 |
T4311 |
T4310 |
prep |
of,analysis |
| R5880 |
T22210 |
T22211 |
det |
these,proteins |
| R5881 |
T22541 |
T22540 |
nmod |
egg,mammal |
| R5882 |
T22542 |
T22541 |
punct |
-,egg |
| R5883 |
T22211 |
T22209 |
pobj |
proteins,of |
| R5884 |
T22543 |
T22541 |
amod |
laying,egg |
| R5885 |
T22544 |
T22540 |
punct |
),mammal |
| R5886 |
T22212 |
T22208 |
attr |
involvement,is |
| R5887 |
T22545 |
T22538 |
punct |
", ",monotreme |
| R5888 |
T22213 |
T22212 |
prep |
with,involvement |
| R5889 |
T22546 |
T22547 |
det |
the,platypus |
| R589 |
T4312 |
T4313 |
det |
a,number |
| R5890 |
T22547 |
T22538 |
appos |
platypus,monotreme |
| R5891 |
T22214 |
T22215 |
nmod |
heterochromatin,repression |
| R5892 |
T22215 |
T22213 |
pobj |
repression,with |
| R5893 |
T22548 |
T22547 |
punct |
", ",platypus |
| R5894 |
T22216 |
T22214 |
cc |
and,heterochromatin |
| R5895 |
T22549 |
T22550 |
dep |
which,has |
| R5896 |
T22217 |
T22216 |
punct |
/,and |
| R5897 |
T22550 |
T22547 |
relcl |
has,platypus |
| R5898 |
T22218 |
T22216 |
cc |
or,and |
| R5899 |
T22551 |
T22552 |
det |
a,ortholog |
| R59 |
T950 |
T949 |
compound |
XY,body |
| R590 |
T4313 |
T4311 |
pobj |
number,of |
| R5900 |
T22552 |
T22550 |
dobj |
ortholog,has |
| R5901 |
T22219 |
T22214 |
conj |
transcriptional,heterochromatin |
| R5902 |
T22553 |
T22552 |
amod |
clear,ortholog |
| R5903 |
T22554 |
T22552 |
compound |
Dmrt7,ortholog |
| R5904 |
T22220 |
T22208 |
punct |
.,is |
| R5905 |
T22555 |
T22556 |
punct |
[,36 |
| R5906 |
T22222 |
T22223 |
nsubj |
DMRT7,is |
| R5907 |
T22556 |
T22521 |
parataxis |
36,is |
| R5908 |
T22557 |
T22556 |
punct |
],36 |
| R5909 |
T22558 |
T22521 |
punct |
.,is |
| R591 |
T4314 |
T4313 |
prep |
of,number |
| R5910 |
T22224 |
T22223 |
acomp |
unusual,is |
| R5911 |
T22560 |
T22561 |
advmod |
However,reported |
| R5912 |
T22225 |
T22223 |
prep |
among,is |
| R5913 |
T22562 |
T22561 |
punct |
", ",reported |
| R5914 |
T22226 |
T22227 |
compound |
XY,proteins |
| R5915 |
T22563 |
T22564 |
det |
no,ortholog |
| R5916 |
T22564 |
T22561 |
nsubjpass |
ortholog,reported |
| R5917 |
T22227 |
T22225 |
pobj |
proteins,among |
| R5918 |
T22565 |
T22564 |
amod |
close,ortholog |
| R5919 |
T22566 |
T22564 |
compound |
Dmrt7,ortholog |
| R592 |
T4315 |
T4316 |
amod |
meiotic,genes |
| R5920 |
T22567 |
T22561 |
aux |
has,reported |
| R5921 |
T22228 |
T22227 |
compound |
body,proteins |
| R5922 |
T22568 |
T22561 |
auxpass |
been,reported |
| R5923 |
T22569 |
T22561 |
prep |
in,reported |
| R5924 |
T22570 |
T22571 |
amod |
nonmammalian,vertebrates |
| R5925 |
T22229 |
T22223 |
prep |
in,is |
| R5926 |
T22571 |
T22569 |
pobj |
vertebrates,in |
| R5927 |
T22572 |
T22561 |
punct |
", ",reported |
| R5928 |
T22573 |
T22561 |
cc |
and,reported |
| R5929 |
T22230 |
T22229 |
pcomp |
being,in |
| R593 |
T4115 |
T4111 |
nsubj |
timing,are |
| R5930 |
T22574 |
T22575 |
poss |
our,searches |
| R5931 |
T22575 |
T22577 |
nsubj |
searches,reveal |
| R5932 |
T22231 |
T22230 |
acomp |
related,being |
| R5933 |
T22576 |
T22575 |
compound |
database,searches |
| R5934 |
T22577 |
T22561 |
conj |
reveal,reported |
| R5935 |
T22232 |
T22231 |
prep |
to,related |
| R5936 |
T22578 |
T22577 |
aux |
did,reveal |
| R5937 |
T22579 |
T22577 |
neg |
not,reveal |
| R5938 |
T22233 |
T22234 |
advmod |
highly,specific |
| R5939 |
T22580 |
T22577 |
dobj |
one,reveal |
| R594 |
T4316 |
T4314 |
pobj |
genes,of |
| R5940 |
T22234 |
T22237 |
amod |
specific,regulators |
| R5941 |
T22581 |
T22577 |
punct |
.,reveal |
| R5942 |
T22583 |
T22584 |
advmod |
Thus,arose |
| R5943 |
T22235 |
T22234 |
npadvmod |
site,specific |
| R5944 |
T22585 |
T22584 |
punct |
", ",arose |
| R5945 |
T22236 |
T22234 |
punct |
-,specific |
| R5946 |
T22586 |
T22584 |
nsubj |
Dmrt7,arose |
| R5947 |
T22237 |
T22232 |
pobj |
regulators,to |
| R5948 |
T22587 |
T22584 |
advmod |
likely,arose |
| R5949 |
T22588 |
T22584 |
punct |
", ",arose |
| R595 |
T4317 |
T4316 |
amod |
regulatory,genes |
| R5950 |
T22238 |
T22237 |
amod |
transcriptional,regulators |
| R5951 |
T22589 |
T22590 |
advmod |
presumably,by |
| R5952 |
T22590 |
T22584 |
prep |
by,arose |
| R5953 |
T22239 |
T22223 |
punct |
.,is |
| R5954 |
T22591 |
T22590 |
pobj |
duplication,by |
| R5955 |
T22592 |
T22591 |
cc |
and,duplication |
| R5956 |
T22241 |
T22242 |
det |
An,speculation |
| R5957 |
T22593 |
T22591 |
conj |
divergence,duplication |
| R5958 |
T22594 |
T22591 |
prep |
of,duplication |
| R5959 |
T22242 |
T22244 |
nsubj |
speculation,is |
| R596 |
T4318 |
T4313 |
prep |
in,number |
| R5960 |
T22595 |
T22596 |
det |
another,gene |
| R5961 |
T22596 |
T22594 |
pobj |
gene,of |
| R5962 |
T22243 |
T22242 |
amod |
attractive,speculation |
| R5963 |
T22597 |
T22596 |
compound |
Dmrt,gene |
| R5964 |
T22598 |
T22584 |
punct |
", ",arose |
| R5965 |
T22245 |
T22246 |
mark |
that,provide |
| R5966 |
T22599 |
T22600 |
advmod |
shortly,before |
| R5967 |
T22600 |
T22584 |
prep |
before,arose |
| R5968 |
T22601 |
T22600 |
cc |
or,before |
| R5969 |
T22246 |
T22244 |
ccomp |
provide,is |
| R597 |
T4116 |
T4115 |
cc |
and,timing |
| R5970 |
T22602 |
T22603 |
ccomp |
coincident,radiation |
| R5971 |
T22603 |
T22600 |
conj |
radiation,before |
| R5972 |
T22247 |
T22246 |
nsubj |
DMRT7,provide |
| R5973 |
T22248 |
T22246 |
aux |
may,provide |
| R5974 |
T22249 |
T22250 |
compound |
sequence,specificity |
| R5975 |
T22604 |
T22602 |
prep |
with,coincident |
| R5976 |
T22605 |
T22603 |
det |
the,radiation |
| R5977 |
T22606 |
T22603 |
amod |
mammalian,radiation |
| R5978 |
T22607 |
T22584 |
punct |
.,arose |
| R5979 |
T22250 |
T22246 |
dobj |
specificity,provide |
| R598 |
T4319 |
T4320 |
det |
the,mouse |
| R5980 |
T22609 |
T22610 |
nsubj |
Monotremes,have |
| R5981 |
T22251 |
T22246 |
prep |
in,provide |
| R5982 |
T22611 |
T22612 |
nummod |
five,X |
| R5983 |
T22612 |
T22610 |
dobj |
X,have |
| R5984 |
T22613 |
T22612 |
cc |
and,X |
| R5985 |
T22252 |
T22251 |
pcomp |
recruiting,in |
| R5986 |
T22614 |
T22615 |
nummod |
five,Y |
| R5987 |
T22615 |
T22616 |
compound |
Y,chromosomes |
| R5988 |
T22616 |
T22612 |
conj |
chromosomes,X |
| R5989 |
T22253 |
T22254 |
amod |
other,proteins |
| R599 |
T4320 |
T4318 |
pobj |
mouse,in |
| R5990 |
T22617 |
T22612 |
punct |
", ",X |
| R5991 |
T22618 |
T22619 |
dep |
which,form |
| R5992 |
T22254 |
T22252 |
dobj |
proteins,recruiting |
| R5993 |
T22619 |
T22612 |
relcl |
form,X |
| R5994 |
T22620 |
T22621 |
det |
an,chain |
| R5995 |
T22255 |
T22254 |
punct |
", ",proteins |
| R5996 |
T22621 |
T22619 |
dobj |
chain,form |
| R5997 |
T22622 |
T22621 |
amod |
extended,chain |
| R5998 |
T22256 |
T22257 |
amod |
such,as |
| R5999 |
T22623 |
T22621 |
compound |
pairing,chain |
| R60 |
T951 |
T944 |
prep |
in,localizes |
| R600 |
T4321 |
T4304 |
aux |
has,demonstrated |
| R6000 |
T22624 |
T22619 |
prep |
during,form |
| R6001 |
T22625 |
T22624 |
pobj |
meiosis,during |
| R6002 |
T22257 |
T22254 |
prep |
as,proteins |
| R6003 |
T22626 |
T22619 |
cc |
and,form |
| R6004 |
T22627 |
T22619 |
conj |
appear,form |
| R6005 |
T22258 |
T22259 |
compound |
chromatin,modifiers |
| R6006 |
T22259 |
T22257 |
pobj |
modifiers,as |
| R6007 |
T22628 |
T22627 |
oprd |
unrelated,appear |
| R6008 |
T22260 |
T22252 |
punct |
", ",recruiting |
| R6009 |
T22629 |
T22628 |
prep |
to,unrelated |
| R601 |
T4322 |
T4323 |
det |
a,requirement |
| R6010 |
T22630 |
T22631 |
det |
the,chromosomes |
| R6011 |
T22261 |
T22252 |
prep |
to,recruiting |
| R6012 |
T22631 |
T22629 |
pobj |
chromosomes,to |
| R6013 |
T22632 |
T22631 |
compound |
sex,chromosomes |
| R6014 |
T22262 |
T22263 |
det |
the,body |
| R6015 |
T22633 |
T22631 |
prep |
of,chromosomes |
| R6016 |
T22634 |
T22635 |
det |
the,mammals |
| R6017 |
T22263 |
T22261 |
pobj |
body,to |
| R6018 |
T22635 |
T22633 |
pobj |
mammals,of |
| R6019 |
T22636 |
T22635 |
amod |
other,mammals |
| R602 |
T4117 |
T4115 |
conj |
synchrony,timing |
| R6020 |
T22264 |
T22263 |
compound |
XY,body |
| R6021 |
T22637 |
T22638 |
punct |
[,61 |
| R6022 |
T22638 |
T22612 |
parataxis |
61,X |
| R6023 |
T22265 |
T22252 |
prep |
as,recruiting |
| R6024 |
T22639 |
T22638 |
punct |
],61 |
| R6025 |
T22640 |
T22610 |
punct |
.,have |
| R6026 |
T22266 |
T22265 |
pobj |
part,as |
| R6027 |
T22642 |
T22643 |
det |
The,presence |
| R6028 |
T22643 |
T22644 |
nsubj |
presence,support |
| R6029 |
T22267 |
T22266 |
prep |
of,part |
| R603 |
T4323 |
T4304 |
dobj |
requirement,demonstrated |
| R6030 |
T22645 |
T22643 |
prep |
of,presence |
| R6031 |
T22646 |
T22645 |
pobj |
Dmrt7,of |
| R6032 |
T22647 |
T22643 |
prep |
in,presence |
| R6033 |
T22268 |
T22269 |
det |
the,transition |
| R6034 |
T22648 |
T22649 |
det |
both,lineages |
| R6035 |
T22649 |
T22647 |
pobj |
lineages,in |
| R6036 |
T22650 |
T22644 |
aux |
may,support |
| R6037 |
T22269 |
T22267 |
pobj |
transition,of |
| R6038 |
T22270 |
T22269 |
prep |
to,transition |
| R6039 |
T22651 |
T22652 |
det |
a,origin |
| R604 |
T4324 |
T4325 |
advmod |
much,stronger |
| R6040 |
T22652 |
T22644 |
dobj |
origin,support |
| R6041 |
T22271 |
T22270 |
pobj |
PMSC,to |
| R6042 |
T22653 |
T22652 |
amod |
common,origin |
| R6043 |
T22654 |
T22652 |
prep |
for,origin |
| R6044 |
T22272 |
T22244 |
punct |
.,is |
| R6045 |
T22655 |
T22656 |
preconj |
either,chromosomes |
| R6046 |
T22656 |
T22654 |
pobj |
chromosomes,for |
| R6047 |
T22274 |
T22275 |
compound |
Chromatin,regulation |
| R6048 |
T22657 |
T22656 |
det |
the,chromosomes |
| R6049 |
T22658 |
T22656 |
compound |
sex,chromosomes |
| R605 |
T4325 |
T4323 |
amod |
stronger,requirement |
| R6050 |
T22659 |
T22656 |
cc |
or,chromosomes |
| R6051 |
T22275 |
T22276 |
nsubj |
regulation,be |
| R6052 |
T22660 |
T22661 |
det |
the,chromatin |
| R6053 |
T22661 |
T22656 |
conj |
chromatin,chromosomes |
| R6054 |
T22277 |
T22276 |
aux |
may,be |
| R6055 |
T22662 |
T22661 |
compound |
sex,chromatin |
| R6056 |
T22663 |
T22656 |
prep |
of,chromosomes |
| R6057 |
T22664 |
T22663 |
pobj |
monotremes,of |
| R6058 |
T22278 |
T22279 |
det |
a,mechanism |
| R6059 |
T22665 |
T22664 |
cc |
and,monotremes |
| R606 |
T4326 |
T4304 |
prep |
in,demonstrated |
| R6060 |
T22666 |
T22667 |
amod |
other,mammals |
| R6061 |
T22279 |
T22276 |
attr |
mechanism,be |
| R6062 |
T22667 |
T22664 |
conj |
mammals,monotremes |
| R6063 |
T22668 |
T22644 |
punct |
.,support |
| R6064 |
T22280 |
T22279 |
amod |
common,mechanism |
| R6065 |
T22670 |
T22671 |
det |
A,model |
| R6066 |
T22671 |
T22673 |
nsubj |
model,is |
| R6067 |
T22281 |
T22279 |
prep |
for,mechanism |
| R6068 |
T22672 |
T22671 |
amod |
plausible,model |
| R6069 |
T22282 |
T22283 |
compound |
DM,proteins |
| R607 |
T4118 |
T4115 |
prep |
of,timing |
| R6070 |
T22674 |
T22675 |
mark |
that,evolved |
| R6071 |
T22675 |
T22673 |
ccomp |
evolved,is |
| R6072 |
T22676 |
T22675 |
nsubj |
Dmrt7,evolved |
| R6073 |
T22283 |
T22281 |
pobj |
proteins,for |
| R6074 |
T22677 |
T22675 |
prep |
during,evolved |
| R6075 |
T22678 |
T22679 |
det |
the,establishment |
| R6076 |
T22679 |
T22677 |
pobj |
establishment,during |
| R6077 |
T22680 |
T22679 |
prep |
of,establishment |
| R6078 |
T22681 |
T22682 |
amod |
mammalian,determination |
| R6079 |
T22284 |
T22283 |
compound |
domain,proteins |
| R608 |
T4327 |
T4326 |
pobj |
males,in |
| R6080 |
T22682 |
T22680 |
pobj |
determination,of |
| R6081 |
T22683 |
T22682 |
compound |
sex,determination |
| R6082 |
T22285 |
T22276 |
punct |
", ",be |
| R6083 |
T22684 |
T22685 |
aux |
to,cope |
| R6084 |
T22685 |
T22675 |
advcl |
cope,evolved |
| R6085 |
T22686 |
T22685 |
aux |
help,cope |
| R6086 |
T22687 |
T22685 |
prep |
with,cope |
| R6087 |
T22688 |
T22689 |
amod |
ancestral,differences |
| R6088 |
T22689 |
T22687 |
pobj |
differences,with |
| R6089 |
T22286 |
T22287 |
mark |
as,find |
| R609 |
T4328 |
T4304 |
prep |
than,demonstrated |
| R6090 |
T22690 |
T22689 |
prep |
in,differences |
| R6091 |
T22691 |
T22692 |
compound |
gene,dosage |
| R6092 |
T22692 |
T22690 |
pobj |
dosage,in |
| R6093 |
T22287 |
T22276 |
advcl |
find,be |
| R6094 |
T22693 |
T22692 |
punct |
", ",dosage |
| R6095 |
T22694 |
T22695 |
compound |
chromosome,pairing |
| R6096 |
T22695 |
T22692 |
conj |
pairing,dosage |
| R6097 |
T22288 |
T22287 |
nsubj |
we,find |
| R6098 |
T22696 |
T22695 |
punct |
", ",pairing |
| R6099 |
T22697 |
T22695 |
conj |
recombination,pairing |
| R61 |
T952 |
T953 |
det |
the,stage |
| R610 |
T4329 |
T4328 |
prep |
in,than |
| R6100 |
T22698 |
T22697 |
punct |
", ",recombination |
| R6101 |
T22289 |
T22290 |
mark |
that,associate |
| R6102 |
T22699 |
T22697 |
cc |
or,recombination |
| R6103 |
T22700 |
T22701 |
amod |
other,issues |
| R6104 |
T22701 |
T22697 |
conj |
issues,recombination |
| R6105 |
T22290 |
T22287 |
ccomp |
associate,find |
| R6106 |
T22702 |
T22701 |
amod |
meiotic,issues |
| R6107 |
T22703 |
T22701 |
acl |
arising,issues |
| R6108 |
T22704 |
T22703 |
prep |
from,arising |
| R6109 |
T22291 |
T22292 |
amod |
other,proteins |
| R611 |
T4330 |
T4329 |
pobj |
females,in |
| R6110 |
T22705 |
T22706 |
compound |
sex,chromosome |
| R6111 |
T22292 |
T22290 |
nsubj |
proteins,associate |
| R6112 |
T22293 |
T22294 |
compound |
DM,domain |
| R6113 |
T22706 |
T22707 |
compound |
chromosome,heteromorphy |
| R6114 |
T22294 |
T22292 |
compound |
domain,proteins |
| R6115 |
T22707 |
T22704 |
pobj |
heteromorphy,from |
| R6116 |
T22295 |
T22290 |
prep |
with,associate |
| R6117 |
T22708 |
T22673 |
punct |
.,is |
| R6118 |
T22296 |
T22297 |
compound |
chromatin,modifying |
| R6119 |
T22710 |
T22711 |
prep |
In,speculate |
| R612 |
T4119 |
T4118 |
pobj |
meiosis,of |
| R6120 |
T22712 |
T22713 |
det |
this,regard |
| R6121 |
T22297 |
T22298 |
compound |
modifying,complexes |
| R6122 |
T22713 |
T22710 |
pobj |
regard,In |
| R6123 |
T22298 |
T22295 |
pobj |
complexes,with |
| R6124 |
T22714 |
T22711 |
punct |
", ",speculate |
| R6125 |
T22299 |
T22300 |
punct |
(,M. |
| R6126 |
T22715 |
T22711 |
nsubj |
we,speculate |
| R6127 |
T22716 |
T22717 |
mark |
that,be |
| R6128 |
T22300 |
T22276 |
meta |
M.,be |
| R6129 |
T22717 |
T22711 |
ccomp |
be,speculate |
| R613 |
T4331 |
T4332 |
punct |
[,4 |
| R6130 |
T22301 |
T22300 |
nmod |
W.,M. |
| R6131 |
T22718 |
T22719 |
det |
the,recruitment |
| R6132 |
T22302 |
T22300 |
nmod |
Murphy,M. |
| R6133 |
T22719 |
T22717 |
nsubj |
recruitment,be |
| R6134 |
T22720 |
T22719 |
prep |
of,recruitment |
| R6135 |
T22721 |
T22720 |
pobj |
Dmrt7,of |
| R6136 |
T22722 |
T22719 |
prep |
during,recruitment |
| R6137 |
T22723 |
T22724 |
amod |
mammalian,evolution |
| R6138 |
T22303 |
T22300 |
punct |
", ",M. |
| R6139 |
T22724 |
T22722 |
pobj |
evolution,during |
| R614 |
T4332 |
T4304 |
parataxis |
4,demonstrated |
| R6140 |
T22725 |
T22717 |
aux |
may,be |
| R6141 |
T22304 |
T22300 |
conj |
D.,M. |
| R6142 |
T22726 |
T22717 |
acomp |
analogous,be |
| R6143 |
T22727 |
T22726 |
prep |
to,analogous |
| R6144 |
T22728 |
T22729 |
det |
the,recruitment |
| R6145 |
T22305 |
T22304 |
nmod |
Zarkower,D. |
| R6146 |
T22729 |
T22727 |
pobj |
recruitment,to |
| R6147 |
T22730 |
T22729 |
prep |
of,recruitment |
| R6148 |
T22306 |
T22304 |
punct |
", ",D. |
| R6149 |
T22731 |
T22732 |
nmod |
chromatin,complexes |
| R615 |
T4333 |
T4332 |
nummod |
1,4 |
| R6150 |
T22732 |
T22730 |
pobj |
complexes,of |
| R6151 |
T22733 |
T22732 |
amod |
regulatory,complexes |
| R6152 |
T22307 |
T22304 |
cc |
and,D. |
| R6153 |
T22734 |
T22735 |
aux |
to,achieve |
| R6154 |
T22735 |
T22729 |
advcl |
achieve,recruitment |
| R6155 |
T22308 |
T22304 |
conj |
V.,D. |
| R6156 |
T22736 |
T22737 |
amod |
somatic,compensation |
| R6157 |
T22737 |
T22735 |
dobj |
compensation,achieve |
| R6158 |
T22738 |
T22737 |
compound |
dosage,compensation |
| R6159 |
T22309 |
T22308 |
nmod |
J.,V. |
| R616 |
T4120 |
T4121 |
advmod |
very,different |
| R6160 |
T22739 |
T22735 |
prep |
during,achieve |
| R6161 |
T22740 |
T22739 |
pobj |
evolution,during |
| R6162 |
T22310 |
T22308 |
nmod |
Bardwell,V. |
| R6163 |
T22741 |
T22740 |
prep |
of,evolution |
| R6164 |
T22742 |
T22743 |
amod |
heteromorphic,chromosomes |
| R6165 |
T22311 |
T22308 |
punct |
", ",V. |
| R6166 |
T22743 |
T22741 |
pobj |
chromosomes,of |
| R6167 |
T22744 |
T22743 |
compound |
sex,chromosomes |
| R6168 |
T22312 |
T22313 |
amod |
unpublished,data |
| R6169 |
T22745 |
T22740 |
prep |
in,evolution |
| R617 |
T4334 |
T4332 |
punct |
",",4 |
| R6170 |
T22746 |
T22747 |
amod |
several,phyla |
| R6171 |
T22747 |
T22745 |
pobj |
phyla,in |
| R6172 |
T22313 |
T22308 |
conj |
data,V. |
| R6173 |
T22748 |
T22749 |
punct |
(,reviewed |
| R6174 |
T22749 |
T22711 |
parataxis |
reviewed,speculate |
| R6175 |
T22750 |
T22749 |
prep |
in,reviewed |
| R6176 |
T22314 |
T22313 |
punct |
),data |
| R6177 |
T22751 |
T22752 |
punct |
[,62 |
| R6178 |
T22752 |
T22750 |
pobj |
62,in |
| R6179 |
T22753 |
T22749 |
punct |
],reviewed |
| R618 |
T4335 |
T4332 |
punct |
],4 |
| R6180 |
T22754 |
T22749 |
punct |
),reviewed |
| R6181 |
T22755 |
T22711 |
punct |
.,speculate |
| R6182 |
T22315 |
T22276 |
punct |
.,be |
| R6183 |
T22317 |
T22318 |
det |
The,finding |
| R6184 |
T22757 |
T22758 |
nsubj |
It,be |
| R6185 |
T22318 |
T22319 |
nsubj |
finding,expands |
| R6186 |
T22759 |
T22758 |
aux |
will,be |
| R6187 |
T22320 |
T22321 |
mark |
that,is |
| R6188 |
T22321 |
T22318 |
acl |
is,finding |
| R6189 |
T22760 |
T22758 |
prep |
of,be |
| R619 |
T4336 |
T4304 |
punct |
.,demonstrated |
| R6190 |
T22322 |
T22321 |
nsubj |
Dmrt7,is |
| R6191 |
T22761 |
T22760 |
pobj |
interest,of |
| R6192 |
T22762 |
T22763 |
aux |
to,determine |
| R6193 |
T22763 |
T22758 |
xcomp |
determine,be |
| R6194 |
T22764 |
T22765 |
mark |
whether,localizes |
| R6195 |
T22323 |
T22321 |
acomp |
essential,is |
| R6196 |
T22765 |
T22763 |
ccomp |
localizes,determine |
| R6197 |
T22766 |
T22765 |
nsubj |
DMRT7,localizes |
| R6198 |
T22324 |
T22323 |
prep |
for,essential |
| R6199 |
T22767 |
T22765 |
prep |
to,localizes |
| R62 |
T839 |
T836 |
acl |
requiring,process |
| R620 |
T4121 |
T4111 |
acomp |
different,are |
| R6200 |
T22768 |
T22769 |
compound |
sex,chromosomes |
| R6201 |
T22325 |
T22326 |
amod |
mammalian,meiosis |
| R6202 |
T22769 |
T22767 |
pobj |
chromosomes,to |
| R6203 |
T22770 |
T22765 |
prep |
during,localizes |
| R6204 |
T22326 |
T22324 |
pobj |
meiosis,for |
| R6205 |
T22771 |
T22772 |
compound |
monotreme,meiosis |
| R6206 |
T22772 |
T22770 |
pobj |
meiosis,during |
| R6207 |
T22327 |
T22328 |
det |
the,functions |
| R6208 |
T22773 |
T22758 |
punct |
.,be |
| R6209 |
T22328 |
T22319 |
dobj |
functions,expands |
| R621 |
T4338 |
T4339 |
det |
The,existence |
| R6210 |
T22775 |
T22776 |
prep |
In,found |
| R6211 |
T22329 |
T22328 |
amod |
known,functions |
| R6212 |
T22777 |
T22775 |
pobj |
summary,In |
| R6213 |
T22778 |
T22776 |
punct |
", ",found |
| R6214 |
T22779 |
T22776 |
nsubj |
we,found |
| R6215 |
T22330 |
T22328 |
prep |
of,functions |
| R6216 |
T22780 |
T22776 |
aux |
have,found |
| R6217 |
T22781 |
T22782 |
mark |
that,is |
| R6218 |
T22782 |
T22776 |
ccomp |
is,found |
| R6219 |
T22331 |
T22332 |
det |
this,family |
| R622 |
T4339 |
T4340 |
nsubj |
existence,creates |
| R6220 |
T22783 |
T22784 |
det |
the,DMRT7 |
| R6221 |
T22784 |
T22782 |
nsubj |
DMRT7,is |
| R6222 |
T22332 |
T22330 |
pobj |
family,of |
| R6223 |
T22785 |
T22786 |
npadvmod |
mammal,specific |
| R6224 |
T22786 |
T22784 |
amod |
specific,DMRT7 |
| R6225 |
T22787 |
T22786 |
punct |
-,specific |
| R6226 |
T22333 |
T22332 |
compound |
gene,family |
| R6227 |
T22788 |
T22789 |
compound |
DM,domain |
| R6228 |
T22789 |
T22784 |
compound |
domain,DMRT7 |
| R6229 |
T22790 |
T22784 |
compound |
protein,DMRT7 |
| R623 |
T4122 |
T4111 |
prep |
in,are |
| R6230 |
T22334 |
T22319 |
punct |
.,expands |
| R6231 |
T22791 |
T22782 |
acomp |
essential,is |
| R6232 |
T22792 |
T22791 |
prep |
for,essential |
| R6233 |
T22336 |
T22337 |
compound |
Invertebrate,genes |
| R6234 |
T22793 |
T22794 |
amod |
meiotic,prophase |
| R6235 |
T22794 |
T22795 |
compound |
prophase,progression |
| R6236 |
T22795 |
T22792 |
pobj |
progression,for |
| R6237 |
T22337 |
T22340 |
nsubjpass |
genes,found |
| R6238 |
T22796 |
T22795 |
prep |
in,progression |
| R6239 |
T22797 |
T22796 |
pobj |
males,in |
| R624 |
T4341 |
T4339 |
prep |
of,existence |
| R6240 |
T22338 |
T22339 |
compound |
DM,domain |
| R6241 |
T22339 |
T22337 |
compound |
domain,genes |
| R6242 |
T22798 |
T22776 |
punct |
.,found |
| R6243 |
T22800 |
T22801 |
nsubj |
DMRT7,localizes |
| R6244 |
T22341 |
T22342 |
advmod |
so,far |
| R6245 |
T22802 |
T22801 |
prep |
to,localizes |
| R6246 |
T22803 |
T22804 |
det |
the,chromosomes |
| R6247 |
T22342 |
T22340 |
advmod |
far,found |
| R6248 |
T22804 |
T22802 |
pobj |
chromosomes,to |
| R6249 |
T22805 |
T22804 |
compound |
sex,chromosomes |
| R625 |
T4342 |
T4343 |
amod |
heteromorphic,chromosomes |
| R6250 |
T22806 |
T22807 |
mark |
after,assembled |
| R6251 |
T22343 |
T22340 |
aux |
have,found |
| R6252 |
T22807 |
T22801 |
advcl |
assembled,localizes |
| R6253 |
T22808 |
T22807 |
nsubjpass |
they,assembled |
| R6254 |
T22344 |
T22340 |
advmod |
only,found |
| R6255 |
T22809 |
T22807 |
auxpass |
are,assembled |
| R6256 |
T22810 |
T22807 |
prep |
into,assembled |
| R6257 |
T22345 |
T22340 |
auxpass |
been,found |
| R6258 |
T22811 |
T22812 |
amod |
specialized,heterochromatin |
| R6259 |
T22812 |
T22810 |
pobj |
heterochromatin,into |
| R626 |
T4343 |
T4341 |
pobj |
chromosomes,of |
| R6260 |
T22813 |
T22801 |
punct |
", ",localizes |
| R6261 |
T22346 |
T22347 |
aux |
to,function |
| R6262 |
T22814 |
T22801 |
cc |
and,localizes |
| R6263 |
T22815 |
T22816 |
amod |
many,cells |
| R6264 |
T22347 |
T22340 |
xcomp |
function,found |
| R6265 |
T22816 |
T22819 |
nsubj |
cells,have |
| R6266 |
T22817 |
T22816 |
compound |
Dmrt7,cells |
| R6267 |
T22348 |
T22347 |
prep |
in,function |
| R6268 |
T22818 |
T22816 |
compound |
mutant,cells |
| R6269 |
T22819 |
T22801 |
conj |
have,localizes |
| R627 |
T4344 |
T4343 |
compound |
sex,chromosomes |
| R6270 |
T22349 |
T22350 |
amod |
somatic,cells |
| R6271 |
T22820 |
T22821 |
amod |
epigenetic,defects |
| R6272 |
T22821 |
T22819 |
dobj |
defects,have |
| R6273 |
T22822 |
T22821 |
prep |
in,defects |
| R6274 |
T22350 |
T22348 |
pobj |
cells,in |
| R6275 |
T22823 |
T22824 |
det |
the,modification |
| R6276 |
T22824 |
T22822 |
pobj |
modification,in |
| R6277 |
T22351 |
T22340 |
punct |
.,found |
| R6278 |
T22825 |
T22824 |
prep |
of,modification |
| R6279 |
T22826 |
T22827 |
det |
the,chromatin |
| R628 |
T4345 |
T4343 |
punct |
", ",chromosomes |
| R6280 |
T22827 |
T22825 |
pobj |
chromatin,of |
| R6281 |
T22353 |
T22354 |
nummod |
Two,genes |
| R6282 |
T22828 |
T22827 |
compound |
sex,chromatin |
| R6283 |
T22829 |
T22824 |
prep |
between,modification |
| R6284 |
T22830 |
T22829 |
pobj |
pachytene,between |
| R6285 |
T22354 |
T22358 |
nsubj |
genes,affect |
| R6286 |
T22831 |
T22830 |
cc |
and,pachytene |
| R6287 |
T22832 |
T22830 |
conj |
diplotene,pachytene |
| R6288 |
T22833 |
T22819 |
punct |
.,have |
| R6289 |
T22355 |
T22354 |
amod |
other,genes |
| R629 |
T4346 |
T4347 |
amod |
such,as |
| R6290 |
T22356 |
T22357 |
compound |
DM,domain |
| R6291 |
T22357 |
T22354 |
compound |
domain,genes |
| R6292 |
T22835 |
T22836 |
mark |
Although,belongs |
| R6293 |
T22359 |
T22354 |
punct |
", ",genes |
| R6294 |
T22360 |
T22354 |
appos |
Dmrt1,genes |
| R6295 |
T22836 |
T22838 |
advcl |
belongs,found |
| R6296 |
T22837 |
T22836 |
nsubj |
Dmrt7,belongs |
| R6297 |
T22361 |
T22360 |
cc |
and,Dmrt1 |
| R6298 |
T22839 |
T22836 |
prep |
to,belongs |
| R6299 |
T22362 |
T22360 |
conj |
Dmrt4,Dmrt1 |
| R63 |
T953 |
T951 |
pobj |
stage,in |
| R630 |
T4123 |
T4124 |
det |
the,sexes |
| R6300 |
T22840 |
T22841 |
det |
an,family |
| R6301 |
T22363 |
T22358 |
punct |
", ",affect |
| R6302 |
T22841 |
T22839 |
pobj |
family,to |
| R6303 |
T22842 |
T22841 |
amod |
ancient,family |
| R6304 |
T22364 |
T22358 |
aux |
do,affect |
| R6305 |
T22843 |
T22842 |
cc |
and,ancient |
| R6306 |
T22844 |
T22842 |
conj |
conserved,ancient |
| R6307 |
T22365 |
T22366 |
compound |
germ,cell |
| R6308 |
T22845 |
T22841 |
compound |
gene,family |
| R6309 |
T22846 |
T22838 |
punct |
", ",found |
| R631 |
T4347 |
T4343 |
prep |
as,chromosomes |
| R6310 |
T22366 |
T22367 |
compound |
cell,development |
| R6311 |
T22847 |
T22838 |
nsubjpass |
it,found |
| R6312 |
T22848 |
T22838 |
auxpass |
is,found |
| R6313 |
T22367 |
T22358 |
dobj |
development,affect |
| R6314 |
T22849 |
T22850 |
advmod |
only,in |
| R6315 |
T22368 |
T22358 |
prep |
in,affect |
| R6316 |
T22850 |
T22838 |
prep |
in,found |
| R6317 |
T22851 |
T22850 |
pobj |
mammals,in |
| R6318 |
T22369 |
T22370 |
det |
the,mouse |
| R6319 |
T22852 |
T22838 |
punct |
", ",found |
| R632 |
T4348 |
T4349 |
det |
the,system |
| R6320 |
T22853 |
T22838 |
cc |
and,found |
| R6321 |
T22370 |
T22368 |
pobj |
mouse,in |
| R6322 |
T22854 |
T22855 |
prep |
to,is |
| R6323 |
T22855 |
T22838 |
conj |
is,found |
| R6324 |
T22856 |
T22857 |
poss |
our,knowledge |
| R6325 |
T22371 |
T22358 |
punct |
.,affect |
| R6326 |
T22857 |
T22854 |
pobj |
knowledge,to |
| R6327 |
T22858 |
T22855 |
nsubj |
DMRT7,is |
| R6328 |
T22373 |
T22374 |
nsubjpass |
Dmrt1,required |
| R6329 |
T22859 |
T22860 |
det |
the,example |
| R633 |
T4349 |
T4347 |
pobj |
system,as |
| R6330 |
T22860 |
T22855 |
attr |
example,is |
| R6331 |
T22375 |
T22374 |
auxpass |
is,required |
| R6332 |
T22861 |
T22860 |
amod |
only,example |
| R6333 |
T22862 |
T22860 |
prep |
of,example |
| R6334 |
T22376 |
T22374 |
prep |
in,required |
| R6335 |
T22377 |
T22378 |
amod |
pre-meiotic,cells |
| R6336 |
T22863 |
T22864 |
det |
a,protein |
| R6337 |
T22378 |
T22376 |
pobj |
cells,in |
| R6338 |
T22864 |
T22862 |
pobj |
protein,of |
| R6339 |
T22865 |
T22866 |
npadvmod |
mammal,specific |
| R634 |
T4124 |
T4122 |
pobj |
sexes,in |
| R6340 |
T22379 |
T22378 |
amod |
male,cells |
| R6341 |
T22866 |
T22864 |
amod |
specific,protein |
| R6342 |
T22867 |
T22866 |
punct |
-,specific |
| R6343 |
T22380 |
T22378 |
compound |
germ,cells |
| R6344 |
T22868 |
T22869 |
dep |
that,is |
| R6345 |
T22381 |
T22374 |
prep |
for,required |
| R6346 |
T22869 |
T22864 |
relcl |
is,protein |
| R6347 |
T22870 |
T22869 |
acomp |
essential,is |
| R6348 |
T22871 |
T22870 |
prep |
for,essential |
| R6349 |
T22872 |
T22871 |
pobj |
meiosis,for |
| R635 |
T4350 |
T4351 |
compound |
XX,XY |
| R6350 |
T22873 |
T22855 |
punct |
.,is |
| R6351 |
T22382 |
T22381 |
pobj |
differentiation,for |
| R6352 |
T22875 |
T22876 |
nsubj |
It,be |
| R6353 |
T22383 |
T22382 |
prep |
of,differentiation |
| R6354 |
T22877 |
T22876 |
aux |
will,be |
| R6355 |
T22384 |
T22383 |
pobj |
gonocytes,of |
| R6356 |
T22878 |
T22876 |
acomp |
important,be |
| R6357 |
T22879 |
T22880 |
aux |
to,determine |
| R6358 |
T22385 |
T22382 |
prep |
into,differentiation |
| R6359 |
T22880 |
T22876 |
xcomp |
determine,be |
| R636 |
T4351 |
T4349 |
compound |
XY,system |
| R6360 |
T22881 |
T22882 |
det |
the,mechanism |
| R6361 |
T22386 |
T22385 |
pobj |
spermatogonia,into |
| R6362 |
T22882 |
T22880 |
dobj |
mechanism,determine |
| R6363 |
T22387 |
T22374 |
punct |
", ",required |
| R6364 |
T22883 |
T22882 |
amod |
precise,mechanism |
| R6365 |
T22884 |
T22885 |
prep |
by,affects |
| R6366 |
T22388 |
T22389 |
advmod |
as,as |
| R6367 |
T22389 |
T22391 |
cc |
as,in |
| R6368 |
T22390 |
T22389 |
advmod |
well,as |
| R6369 |
T22885 |
T22882 |
relcl |
affects,mechanism |
| R637 |
T4352 |
T4351 |
punct |
/,XY |
| R6370 |
T22886 |
T22884 |
pobj |
which,by |
| R6371 |
T22391 |
T22374 |
prep |
in,required |
| R6372 |
T22887 |
T22885 |
nsubj |
DMRT7,affects |
| R6373 |
T22888 |
T22889 |
compound |
sex,regulation |
| R6374 |
T22392 |
T22393 |
compound |
Sertoli,cells |
| R6375 |
T22889 |
T22885 |
dobj |
regulation,affects |
| R6376 |
T22393 |
T22391 |
pobj |
cells,in |
| R6377 |
T22890 |
T22889 |
compound |
chromatin,regulation |
| R6378 |
T22891 |
T22885 |
prep |
during,affects |
| R6379 |
T22892 |
T22893 |
amod |
male,meiosis |
| R638 |
T4125 |
T4124 |
nummod |
two,sexes |
| R6380 |
T22893 |
T22891 |
pobj |
meiosis,during |
| R6381 |
T22894 |
T22876 |
punct |
.,be |
| R6382 |
T23792 |
T23791 |
prep |
of,Generation |
| R6383 |
T23793 |
T23794 |
compound |
Dmrt7,mice |
| R6384 |
T23794 |
T23792 |
pobj |
mice,of |
| R6385 |
T23795 |
T23791 |
punct |
.,Generation |
| R6386 |
T23797 |
T23798 |
det |
A,fragment |
| R6387 |
T23798 |
T23802 |
nsubjpass |
fragment,used |
| R6388 |
T23799 |
T23798 |
compound |
mouse,fragment |
| R6389 |
T23800 |
T23801 |
compound |
Dmrt7,cDNA |
| R639 |
T4126 |
T4111 |
punct |
.,are |
| R6390 |
T23801 |
T23798 |
compound |
cDNA,fragment |
| R6391 |
T23803 |
T23798 |
acl |
containing,fragment |
| R6392 |
T23804 |
T23803 |
dobj |
sequences,containing |
| R6393 |
T23805 |
T23804 |
prep |
from,sequences |
| R6394 |
T23806 |
T23805 |
pobj |
exon,from |
| R6395 |
T23807 |
T23806 |
nummod |
8,exon |
| R6396 |
T23808 |
T23802 |
auxpass |
was,used |
| R6397 |
T23809 |
T23810 |
aux |
to,screen |
| R6398 |
T23810 |
T23802 |
advcl |
screen,used |
| R6399 |
T23811 |
T23812 |
det |
a,library |
| R64 |
T954 |
T953 |
compound |
pachytene,stage |
| R640 |
T4128 |
T4129 |
prep |
In,initiate |
| R6400 |
T23812 |
T23810 |
dobj |
library,screen |
| R6401 |
T23813 |
T23812 |
compound |
mouse,library |
| R6402 |
T23814 |
T23812 |
compound |
BAC,library |
| R6403 |
T23815 |
T23812 |
prep |
from,library |
| R6404 |
T23816 |
T23817 |
det |
the,strain |
| R6405 |
T23817 |
T23815 |
pobj |
strain,from |
| R6406 |
T23818 |
T23819 |
nummod |
129,SvJ |
| R6407 |
T23819 |
T23817 |
compound |
SvJ,strain |
| R6408 |
T23820 |
T23819 |
punct |
/,SvJ |
| R6409 |
T23821 |
T23822 |
punct |
(,Stratagene |
| R641 |
T4353 |
T4349 |
prep |
of,system |
| R6410 |
T23822 |
T23802 |
parataxis |
Stratagene,used |
| R6411 |
T23823 |
T23822 |
punct |
", ",Stratagene |
| R6412 |
T23824 |
T23822 |
npadvmod |
http://www.stratagene.com,Stratagene |
| R6413 |
T23825 |
T23822 |
punct |
),Stratagene |
| R6414 |
T23826 |
T23802 |
punct |
", ",used |
| R6415 |
T23827 |
T23802 |
cc |
and,used |
| R6416 |
T23828 |
T23829 |
nsubjpass |
clones,isolated |
| R6417 |
T23829 |
T23802 |
conj |
isolated,used |
| R6418 |
T23830 |
T23828 |
acl |
containing,clones |
| R6419 |
T23831 |
T23832 |
compound |
promoter,sequences |
| R642 |
T4354 |
T4353 |
pobj |
mammals,of |
| R6420 |
T23832 |
T23830 |
dobj |
sequences,containing |
| R6421 |
T23833 |
T23829 |
auxpass |
were,isolated |
| R6422 |
T23834 |
T23829 |
cc |
and,isolated |
| R6423 |
T23835 |
T23829 |
conj |
sequenced,isolated |
| R6424 |
T23836 |
T23837 |
aux |
to,obtain |
| R6425 |
T23837 |
T23835 |
advcl |
obtain,sequenced |
| R6426 |
T23838 |
T23839 |
nmod |
Dmrt7,sequence |
| R6427 |
T23839 |
T23837 |
dobj |
sequence,obtain |
| R6428 |
T23840 |
T23839 |
amod |
genomic,sequence |
| R6429 |
T23841 |
T23829 |
punct |
.,isolated |
| R643 |
T4355 |
T4340 |
punct |
", ",creates |
| R6430 |
T23843 |
T23844 |
det |
The,vector |
| R6431 |
T23844 |
T23846 |
nsubjpass |
vector,constructed |
| R6432 |
T23845 |
T23844 |
compound |
targeting,vector |
| R6433 |
T23846 |
T23855 |
ccomp |
constructed,used |
| R6434 |
T23847 |
T23844 |
appos |
pDZ169,vector |
| R6435 |
T23848 |
T23844 |
punct |
(,vector |
| R6436 |
T23849 |
T23844 |
acl |
diagrammed,vector |
| R6437 |
T23850 |
T23849 |
prep |
in,diagrammed |
| R6438 |
T23851 |
T23852 |
compound |
Figure,S2 |
| R6439 |
T23852 |
T23850 |
pobj |
S2,in |
| R644 |
T4130 |
T4128 |
pobj |
females,In |
| R6440 |
T23853 |
T23844 |
punct |
),vector |
| R6441 |
T23854 |
T23846 |
auxpass |
was,constructed |
| R6442 |
T23856 |
T23846 |
prep |
by,constructed |
| R6443 |
T23857 |
T23858 |
det |
the,scheme |
| R6444 |
T23858 |
T23856 |
pobj |
scheme,by |
| R6445 |
T23859 |
T23858 |
amod |
following,scheme |
| R6446 |
T23860 |
T23855 |
punct |
: ,used |
| R6447 |
T23861 |
T23862 |
det |
The,pDZ157 |
| R6448 |
T23862 |
T23855 |
nsubjpass |
pDZ157,used |
| R6449 |
T23863 |
T23862 |
compound |
vector,pDZ157 |
| R645 |
T4356 |
T4357 |
npadvmod |
sex,specific |
| R6450 |
T23864 |
T23855 |
auxpass |
was,used |
| R6451 |
T23865 |
T23855 |
prep |
as,used |
| R6452 |
T23866 |
T23867 |
det |
a,vector |
| R6453 |
T23867 |
T23865 |
pobj |
vector,as |
| R6454 |
T23868 |
T23867 |
compound |
backbone,vector |
| R6455 |
T23869 |
T23870 |
punct |
[,31 |
| R6456 |
T23870 |
T23855 |
parataxis |
31,used |
| R6457 |
T23871 |
T23870 |
punct |
],31 |
| R6458 |
T23872 |
T23855 |
punct |
.,used |
| R6459 |
T23874 |
T23875 |
npadvmod |
3,inserted |
| R646 |
T4131 |
T4129 |
punct |
", ",initiate |
| R6460 |
T23876 |
T23874 |
punct |
′,3 |
| R6461 |
T23877 |
T23874 |
prep |
to,3 |
| R6462 |
T23878 |
T23879 |
compound |
Pgk,neo |
| R6463 |
T23879 |
T23877 |
pobj |
neo,to |
| R6464 |
T23880 |
T23879 |
punct |
-,neo |
| R6465 |
T23881 |
T23879 |
cc |
and,neo |
| R6466 |
T23882 |
T23883 |
det |
the,site |
| R6467 |
T23883 |
T23879 |
conj |
site,neo |
| R6468 |
T23884 |
T23883 |
compound |
loxP,site |
| R6469 |
T23885 |
T23875 |
punct |
", ",inserted |
| R647 |
T4357 |
T4359 |
amod |
specific,challenges |
| R6470 |
T23886 |
T23875 |
nsubj |
we,inserted |
| R6471 |
T23887 |
T23875 |
punct |
", ",inserted |
| R6472 |
T23888 |
T23875 |
prep |
as,inserted |
| R6473 |
T23889 |
T23890 |
det |
a,fragment |
| R6474 |
T23890 |
T23888 |
pobj |
fragment,as |
| R6475 |
T23891 |
T23892 |
compound |
XmaI,XmaI |
| R6476 |
T23892 |
T23890 |
compound |
XmaI,fragment |
| R6477 |
T23893 |
T23892 |
punct |
/,XmaI |
| R6478 |
T23894 |
T23890 |
compound |
DNA,fragment |
| R6479 |
T23895 |
T23875 |
punct |
", ",inserted |
| R648 |
T4358 |
T4357 |
punct |
-,specific |
| R6480 |
T23896 |
T23897 |
det |
the,intron |
| R6481 |
T23897 |
T23875 |
dobj |
intron,inserted |
| R6482 |
T23898 |
T23897 |
amod |
third,intron |
| R6483 |
T23899 |
T23897 |
prep |
of,intron |
| R6484 |
T23900 |
T23899 |
pobj |
Dmrt7,of |
| R6485 |
T23901 |
T23902 |
punct |
(,downstream |
| R6486 |
T23902 |
T23900 |
parataxis |
downstream,Dmrt7 |
| R6487 |
T23903 |
T23902 |
prep |
from,downstream |
| R6488 |
T23904 |
T23905 |
nummod |
366,bp |
| R6489 |
T23905 |
T23903 |
pobj |
bp,from |
| R649 |
T4132 |
T4133 |
compound |
germ,cells |
| R6490 |
T23906 |
T23903 |
prep |
to,from |
| R6491 |
T23907 |
T23908 |
nummod |
"2,773",bp |
| R6492 |
T23908 |
T23906 |
pobj |
bp,to |
| R6493 |
T23909 |
T23902 |
prep |
of,downstream |
| R6494 |
T23910 |
T23909 |
pobj |
exon,of |
| R6495 |
T23911 |
T23910 |
nummod |
3,exon |
| R6496 |
T23912 |
T23902 |
punct |
),downstream |
| R6497 |
T23913 |
T23897 |
acl |
generated,intron |
| R6498 |
T23914 |
T23913 |
prep |
by,generated |
| R6499 |
T23915 |
T23914 |
pobj |
PCR,by |
| R65 |
T840 |
T841 |
amod |
profound,differences |
| R650 |
T4359 |
T4340 |
dobj |
challenges,creates |
| R6500 |
T23916 |
T23875 |
punct |
.,inserted |
| R6501 |
T23918 |
T23919 |
npadvmod |
5,inserted |
| R6502 |
T23920 |
T23918 |
punct |
′,5 |
| R6503 |
T23921 |
T23918 |
prep |
to,5 |
| R6504 |
T23922 |
T23923 |
compound |
Pgk,neo |
| R6505 |
T23923 |
T23921 |
pobj |
neo,to |
| R6506 |
T23924 |
T23923 |
punct |
-,neo |
| R6507 |
T23925 |
T23919 |
punct |
", ",inserted |
| R6508 |
T23926 |
T23919 |
nsubj |
we,inserted |
| R6509 |
T23927 |
T23928 |
det |
an,fragment |
| R651 |
T4360 |
T4340 |
punct |
.,creates |
| R6510 |
T23928 |
T23919 |
dobj |
fragment,inserted |
| R6511 |
T23929 |
T23930 |
compound |
EcoRI,NotI |
| R6512 |
T23930 |
T23928 |
compound |
NotI,fragment |
| R6513 |
T23931 |
T23930 |
punct |
/,NotI |
| R6514 |
T23932 |
T23928 |
compound |
PCR,fragment |
| R6515 |
T23933 |
T23928 |
acl |
extending,fragment |
| R6516 |
T23934 |
T23933 |
prep |
from,extending |
| R6517 |
T23935 |
T23936 |
nummod |
"4,107",bp |
| R6518 |
T23936 |
T23934 |
pobj |
bp,from |
| R6519 |
T23937 |
T23934 |
prep |
to,from |
| R652 |
T4133 |
T4129 |
nsubj |
cells,initiate |
| R6520 |
T23938 |
T23939 |
nummod |
336,bp |
| R6521 |
T23939 |
T23937 |
pobj |
bp,to |
| R6522 |
T23940 |
T23933 |
npadvmod |
5,extending |
| R6523 |
T23941 |
T23940 |
punct |
′,5 |
| R6524 |
T23942 |
T23940 |
prep |
of,5 |
| R6525 |
T23943 |
T23944 |
det |
the,start |
| R6526 |
T23944 |
T23942 |
pobj |
start,of |
| R6527 |
T23945 |
T23944 |
nmod |
Dmrt7,start |
| R6528 |
T23946 |
T23944 |
amod |
translational,start |
| R6529 |
T23947 |
T23919 |
punct |
.,inserted |
| R653 |
T4134 |
T4129 |
advmod |
synchronously,initiate |
| R6530 |
T23949 |
T23950 |
advmod |
Finally,inserted |
| R6531 |
T23951 |
T23950 |
punct |
", ",inserted |
| R6532 |
T23952 |
T23950 |
nsubj |
we,inserted |
| R6533 |
T23953 |
T23954 |
det |
a,site |
| R6534 |
T23954 |
T23950 |
dobj |
site,inserted |
| R6535 |
T23955 |
T23954 |
compound |
loxP,site |
| R6536 |
T23956 |
T23954 |
cc |
and,site |
| R6537 |
T23957 |
T23958 |
compound |
NotI,site |
| R6538 |
T23958 |
T23954 |
conj |
site,site |
| R6539 |
T23959 |
T23960 |
nummod |
336,bp |
| R654 |
T4362 |
T4363 |
nsubj |
One,is |
| R6540 |
T23960 |
T23950 |
npadvmod |
bp,inserted |
| R6541 |
T23961 |
T23960 |
nummod |
5,bp |
| R6542 |
T23962 |
T23960 |
punct |
′,bp |
| R6543 |
T23963 |
T23960 |
prep |
of,bp |
| R6544 |
T23964 |
T23965 |
det |
the,start |
| R6545 |
T23965 |
T23963 |
pobj |
start,of |
| R6546 |
T23966 |
T23965 |
nmod |
Dmrt7,start |
| R6547 |
T23967 |
T23965 |
amod |
translational,start |
| R6548 |
T23968 |
T23950 |
punct |
.,inserted |
| R6549 |
T23970 |
T23971 |
prep |
In,flanked |
| R655 |
T4135 |
T4129 |
dobj |
meiosis,initiate |
| R6550 |
T23972 |
T23973 |
det |
the,vector |
| R6551 |
T23973 |
T23970 |
pobj |
vector,In |
| R6552 |
T23974 |
T23973 |
amod |
resulting,vector |
| R6553 |
T23975 |
T23971 |
punct |
", ",flanked |
| R6554 |
T23976 |
T23977 |
det |
the,exons |
| R6555 |
T23977 |
T23971 |
nsubjpass |
exons,flanked |
| R6556 |
T23978 |
T23977 |
amod |
second,exons |
| R6557 |
T23979 |
T23978 |
cc |
and,second |
| R6558 |
T23980 |
T23978 |
conj |
third,second |
| R6559 |
T23981 |
T23977 |
prep |
of,exons |
| R656 |
T4364 |
T4365 |
det |
the,need |
| R6560 |
T23982 |
T23981 |
pobj |
Dmrt7,of |
| R6561 |
T23983 |
T23971 |
auxpass |
are,flanked |
| R6562 |
T23984 |
T23971 |
agent |
by,flanked |
| R6563 |
T23985 |
T23986 |
compound |
loxP,sites |
| R6564 |
T23986 |
T23984 |
pobj |
sites,by |
| R6565 |
T23987 |
T23988 |
punct |
(,floxed |
| R6566 |
T23988 |
T23986 |
parataxis |
floxed,sites |
| R6567 |
T23989 |
T23988 |
punct |
),floxed |
| R6568 |
T23990 |
T23971 |
punct |
.,flanked |
| R6569 |
T23992 |
T23993 |
det |
The,portions |
| R657 |
T4365 |
T4363 |
attr |
need,is |
| R6570 |
T23993 |
T23997 |
nsubjpass |
portions,sequenced |
| R6571 |
T23994 |
T23995 |
npadvmod |
Dmrt7,containing |
| R6572 |
T23995 |
T23993 |
amod |
containing,portions |
| R6573 |
T23996 |
T23995 |
punct |
-,containing |
| R6574 |
T23998 |
T23993 |
prep |
of,portions |
| R6575 |
T23999 |
T23998 |
pobj |
pDZ169,of |
| R6576 |
T24000 |
T23997 |
auxpass |
were,sequenced |
| R6577 |
T24001 |
T23997 |
advmod |
completely,sequenced |
| R6578 |
T24002 |
T23997 |
punct |
.,sequenced |
| R6579 |
T24004 |
T24005 |
nsubjpass |
pDZ169,linearized |
| R658 |
T4136 |
T4129 |
prep |
in,initiate |
| R6580 |
T24006 |
T24005 |
auxpass |
was,linearized |
| R6581 |
T24007 |
T24005 |
prep |
with,linearized |
| R6582 |
T24008 |
T24007 |
pobj |
PmeI,with |
| R6583 |
T24009 |
T24005 |
cc |
and,linearized |
| R6584 |
T24010 |
T24005 |
conj |
electroporated,linearized |
| R6585 |
T24011 |
T24010 |
prep |
into,electroporated |
| R6586 |
T24012 |
T24013 |
compound |
CJ7,cells |
| R6587 |
T24013 |
T24011 |
pobj |
cells,into |
| R6588 |
T24014 |
T24013 |
compound |
ES,cells |
| R6589 |
T24015 |
T24013 |
punct |
(,cells |
| R659 |
T4366 |
T4365 |
prep |
for,need |
| R6590 |
T24016 |
T24017 |
advmod |
originally,derived |
| R6591 |
T24017 |
T24013 |
acl |
derived,cells |
| R6592 |
T24018 |
T24017 |
prep |
from,derived |
| R6593 |
T24019 |
T24020 |
det |
the,strain |
| R6594 |
T24020 |
T24018 |
pobj |
strain,from |
| R6595 |
T24021 |
T24020 |
compound |
129S1,strain |
| R6596 |
T24022 |
T24013 |
punct |
),cells |
| R6597 |
T24023 |
T24005 |
punct |
.,linearized |
| R6598 |
T24025 |
T24026 |
nummod |
Three,recombinants |
| R6599 |
T24026 |
T24028 |
nsubjpass |
recombinants,identified |
| R66 |
T955 |
T953 |
prep |
of,stage |
| R660 |
T4367 |
T4366 |
pobj |
mechanisms,for |
| R6600 |
T24027 |
T24026 |
amod |
homologous,recombinants |
| R6601 |
T24029 |
T24028 |
auxpass |
were,identified |
| R6602 |
T24030 |
T24028 |
prep |
from,identified |
| R6603 |
T24031 |
T24032 |
nummod |
296,colonies |
| R6604 |
T24032 |
T24030 |
pobj |
colonies,from |
| R6605 |
T24033 |
T24034 |
npadvmod |
G418,resistant |
| R6606 |
T24034 |
T24032 |
amod |
resistant,colonies |
| R6607 |
T24035 |
T24034 |
punct |
-,resistant |
| R6608 |
T24036 |
T24028 |
prep |
by,identified |
| R6609 |
T24037 |
T24038 |
compound |
Southern,hybridization |
| R661 |
T4368 |
T4369 |
aux |
to,balance |
| R6610 |
T24038 |
T24036 |
pobj |
hybridization,by |
| R6611 |
T24039 |
T24028 |
prep |
by,identified |
| R6612 |
T24040 |
T24039 |
pobj |
use,by |
| R6613 |
T24041 |
T24040 |
prep |
of,use |
| R6614 |
T24042 |
T24043 |
det |
a,probe |
| R6615 |
T24043 |
T24041 |
pobj |
probe,of |
| R6616 |
T24044 |
T24043 |
compound |
DNA,probe |
| R6617 |
T24045 |
T24043 |
prep |
from,probe |
| R6618 |
T24046 |
T24047 |
det |
the,sequences |
| R6619 |
T24047 |
T24045 |
pobj |
sequences,from |
| R662 |
T4137 |
T4138 |
det |
the,embryo |
| R6620 |
T24048 |
T24047 |
advmod |
upstream,sequences |
| R6621 |
T24049 |
T24048 |
prep |
of,upstream |
| R6622 |
T24050 |
T24049 |
pobj |
exon,of |
| R6623 |
T24051 |
T24050 |
nummod |
1,exon |
| R6624 |
T24052 |
T24053 |
aux |
to,screen |
| R6625 |
T24053 |
T24028 |
advcl |
screen,identified |
| R6626 |
T24054 |
T24055 |
amod |
genomic,DNA |
| R6627 |
T24055 |
T24053 |
dobj |
DNA,screen |
| R6628 |
T24056 |
T24055 |
acl |
digested,DNA |
| R6629 |
T24057 |
T24056 |
prep |
with,digested |
| R663 |
T4369 |
T4367 |
acl |
balance,mechanisms |
| R6630 |
T24058 |
T24057 |
pobj |
EcoRI,with |
| R6631 |
T24059 |
T24028 |
punct |
.,identified |
| R6632 |
T24061 |
T24062 |
amod |
Homologous,recombination |
| R6633 |
T24062 |
T24063 |
nsubjpass |
recombination,confirmed |
| R6634 |
T24064 |
T24063 |
auxpass |
was,confirmed |
| R6635 |
T24065 |
T24063 |
prep |
on,confirmed |
| R6636 |
T24066 |
T24067 |
det |
both,ends |
| R6637 |
T24067 |
T24065 |
pobj |
ends,on |
| R6638 |
T24068 |
T24067 |
prep |
of,ends |
| R6639 |
T24069 |
T24070 |
det |
the,region |
| R664 |
T4370 |
T4369 |
dobj |
expression,balance |
| R6640 |
T24070 |
T24068 |
pobj |
region,of |
| R6641 |
T24071 |
T24070 |
amod |
targeted,region |
| R6642 |
T24072 |
T24063 |
prep |
by,confirmed |
| R6643 |
T24073 |
T24074 |
compound |
Southern,hybridization |
| R6644 |
T24074 |
T24072 |
pobj |
hybridization,by |
| R6645 |
T24075 |
T24063 |
punct |
.,confirmed |
| R6646 |
T24077 |
T24078 |
nsubjpass |
Probes,made |
| R6647 |
T24079 |
T24077 |
prep |
for,Probes |
| R6648 |
T24080 |
T24081 |
compound |
Southern,hybridization |
| R6649 |
T24081 |
T24079 |
pobj |
hybridization,for |
| R665 |
T4138 |
T4136 |
pobj |
embryo,in |
| R6650 |
T24082 |
T24078 |
auxpass |
were,made |
| R6651 |
T24083 |
T24078 |
prep |
by,made |
| R6652 |
T24084 |
T24083 |
pobj |
PCR,by |
| R6653 |
T24085 |
T24078 |
advcl |
using,made |
| R6654 |
T24086 |
T24087 |
compound |
primers,DM5S11 |
| R6655 |
T24087 |
T24085 |
dobj |
DM5S11,using |
| R6656 |
T24088 |
T24087 |
compound |
DM5S10,DM5S11 |
| R6657 |
T24089 |
T24087 |
punct |
/,DM5S11 |
| R6658 |
T24090 |
T24091 |
punct |
(,probe |
| R6659 |
T24091 |
T24087 |
parataxis |
probe,DM5S11 |
| R666 |
T4371 |
T4370 |
prep |
of,expression |
| R6660 |
T24092 |
T24091 |
nummod |
5,probe |
| R6661 |
T24093 |
T24092 |
punct |
′,5 |
| R6662 |
T24094 |
T24091 |
punct |
),probe |
| R6663 |
T24095 |
T24087 |
cc |
and,DM5S11 |
| R6664 |
T24096 |
T24097 |
compound |
DM5PR1,DM5PR2 |
| R6665 |
T24097 |
T24087 |
conj |
DM5PR2,DM5S11 |
| R6666 |
T24098 |
T24097 |
punct |
/,DM5PR2 |
| R6667 |
T24099 |
T24100 |
punct |
(,probe |
| R6668 |
T24100 |
T24097 |
parataxis |
probe,DM5PR2 |
| R6669 |
T24101 |
T24100 |
nummod |
3,probe |
| R667 |
T4372 |
T4373 |
npadvmod |
sex,linked |
| R6670 |
T24102 |
T24101 |
punct |
′,3 |
| R6671 |
T24103 |
T24100 |
punct |
),probe |
| R6672 |
T24104 |
T24087 |
punct |
", ",DM5S11 |
| R6673 |
T24105 |
T24087 |
acl |
listed,DM5S11 |
| R6674 |
T24106 |
T24105 |
advmod |
below,listed |
| R6675 |
T24107 |
T24078 |
punct |
.,made |
| R6676 |
T24109 |
T24110 |
nummod |
Two,clones |
| R6677 |
T24110 |
T24114 |
nsubjpass |
clones,injected |
| R6678 |
T24111 |
T24110 |
amod |
targeted,clones |
| R6679 |
T24112 |
T24113 |
compound |
ES,cell |
| R668 |
T4373 |
T4375 |
amod |
linked,genes |
| R6680 |
T24113 |
T24110 |
compound |
cell,clones |
| R6681 |
T24115 |
T24110 |
acl |
containing,clones |
| R6682 |
T24116 |
T24117 |
det |
the,allele |
| R6683 |
T24117 |
T24115 |
dobj |
allele,containing |
| R6684 |
T24118 |
T24117 |
amod |
floxed,allele |
| R6685 |
T24119 |
T24117 |
appos |
Dmrt7neo,allele |
| R6686 |
T24120 |
T24114 |
auxpass |
were,injected |
| R6687 |
T24121 |
T24114 |
prep |
into,injected |
| R6688 |
T24122 |
T24123 |
nmod |
C57Bl,blastocysts |
| R6689 |
T24123 |
T24121 |
pobj |
blastocysts,into |
| R669 |
T4139 |
T4129 |
cc |
and,initiate |
| R6690 |
T24124 |
T24122 |
punct |
/,C57Bl |
| R6691 |
T24125 |
T24122 |
nummod |
6,C57Bl |
| R6692 |
T24126 |
T24127 |
aux |
to,generate |
| R6693 |
T24127 |
T24114 |
advcl |
generate,injected |
| R6694 |
T24128 |
T24127 |
dobj |
chimeras,generate |
| R6695 |
T24129 |
T24114 |
punct |
.,injected |
| R6696 |
T24131 |
T24132 |
amod |
Chimeric,males |
| R6697 |
T24132 |
T24133 |
nsubjpass |
males,bred |
| R6698 |
T24134 |
T24133 |
auxpass |
were,bred |
| R6699 |
T24135 |
T24133 |
prep |
with,bred |
| R67 |
T956 |
T957 |
amod |
meiotic,prophase |
| R670 |
T4374 |
T4373 |
punct |
-,linked |
| R6700 |
T24136 |
T24137 |
nmod |
C57Bl,females |
| R6701 |
T24137 |
T24135 |
pobj |
females,with |
| R6702 |
T24138 |
T24136 |
punct |
/,C57Bl |
| R6703 |
T24139 |
T24136 |
nummod |
6,C57Bl |
| R6704 |
T24140 |
T24141 |
aux |
to,generate |
| R6705 |
T24141 |
T24133 |
advcl |
generate,bred |
| R6706 |
T24142 |
T24141 |
dobj |
heterozygotes,generate |
| R6707 |
T24143 |
T24142 |
acl |
carrying,heterozygotes |
| R6708 |
T24144 |
T24143 |
dobj |
Dmrt7neo,carrying |
| R6709 |
T24145 |
T24133 |
punct |
.,bred |
| R671 |
T4375 |
T4371 |
pobj |
genes,of |
| R6710 |
T24147 |
T24148 |
nmod |
Dmrt7,females |
| R6711 |
T24148 |
T24152 |
nsubjpass |
females,bred |
| R6712 |
T24149 |
T24147 |
punct |
+,Dmrt7 |
| R6713 |
T24150 |
T24147 |
punct |
/,Dmrt7 |
| R6714 |
T24151 |
T24147 |
appos |
Dmrt7neo,Dmrt7 |
| R6715 |
T24153 |
T24152 |
auxpass |
were,bred |
| R6716 |
T24154 |
T24152 |
prep |
with,bred |
| R6717 |
T24155 |
T24156 |
amod |
male,mice |
| R6718 |
T24156 |
T24154 |
pobj |
mice,with |
| R6719 |
T24157 |
T24158 |
compound |
β,actin |
| R672 |
T4140 |
T4129 |
conj |
arrest,initiate |
| R6720 |
T24158 |
T24160 |
compound |
actin,Cre |
| R6721 |
T24159 |
T24158 |
punct |
-,actin |
| R6722 |
T24160 |
T24162 |
npadvmod |
Cre,transgenic |
| R6723 |
T24161 |
T24160 |
punct |
-,Cre |
| R6724 |
T24162 |
T24156 |
amod |
transgenic,mice |
| R6725 |
T24163 |
T24164 |
aux |
to,delete |
| R6726 |
T24164 |
T24152 |
advcl |
delete,bred |
| R6727 |
T24165 |
T24166 |
det |
the,sequences |
| R6728 |
T24166 |
T24164 |
dobj |
sequences,delete |
| R6729 |
T24167 |
T24166 |
amod |
floxed,sequences |
| R673 |
T4376 |
T4370 |
prep |
between,expression |
| R6730 |
T24168 |
T24164 |
cc |
and,delete |
| R6731 |
T24169 |
T24164 |
conj |
generate,delete |
| R6732 |
T24170 |
T24171 |
amod |
heterozygous,mutants |
| R6733 |
T24171 |
T24169 |
dobj |
mutants,generate |
| R6734 |
T24172 |
T24171 |
nmod |
Dmrt7,mutants |
| R6735 |
T24173 |
T24172 |
punct |
−,Dmrt7 |
| R6736 |
T24174 |
T24172 |
punct |
/,Dmrt7 |
| R6737 |
T24175 |
T24172 |
punct |
+,Dmrt7 |
| R6738 |
T24176 |
T24171 |
compound |
deletion,mutants |
| R6739 |
T24177 |
T24171 |
punct |
", ",mutants |
| R674 |
T4377 |
T4378 |
det |
the,sexes |
| R6740 |
T24178 |
T24179 |
dep |
which,interbred |
| R6741 |
T24179 |
T24171 |
relcl |
interbred,mutants |
| R6742 |
T24180 |
T24179 |
auxpass |
were,interbred |
| R6743 |
T24181 |
T24182 |
aux |
to,generate |
| R6744 |
T24182 |
T24179 |
advcl |
generate,interbred |
| R6745 |
T24183 |
T24184 |
amod |
homozygous,mutants |
| R6746 |
T24184 |
T24182 |
dobj |
mutants,generate |
| R6747 |
T24185 |
T24184 |
nmod |
Dmrt7,mutants |
| R6748 |
T24186 |
T24185 |
punct |
−,Dmrt7 |
| R6749 |
T24187 |
T24185 |
punct |
/,Dmrt7 |
| R675 |
T4378 |
T4376 |
pobj |
sexes,between |
| R6750 |
T24188 |
T24185 |
punct |
−,Dmrt7 |
| R6751 |
T24189 |
T24152 |
punct |
.,bred |
| R6752 |
T24487 |
T24486 |
cc |
and,Genotyping |
| R6753 |
T24488 |
T24489 |
compound |
RT,PCR |
| R6754 |
T24489 |
T24486 |
conj |
PCR,Genotyping |
| R6755 |
T24490 |
T24489 |
punct |
-,PCR |
| R6756 |
T24491 |
T24489 |
punct |
.,PCR |
| R6757 |
T24493 |
T24494 |
prep |
For,amplified |
| R6758 |
T24495 |
T24493 |
pobj |
genotyping,For |
| R6759 |
T24496 |
T24494 |
punct |
", ",amplified |
| R676 |
T4459 |
T4452 |
nsubjpass |
regions,associated |
| R6760 |
T24497 |
T24498 |
compound |
tail,clip |
| R6761 |
T24498 |
T24500 |
compound |
clip,DNA |
| R6762 |
T24499 |
T24498 |
punct |
-,clip |
| R6763 |
T24500 |
T24494 |
nsubjpass |
DNA,amplified |
| R6764 |
T24501 |
T24494 |
auxpass |
was,amplified |
| R6765 |
T24502 |
T24494 |
prep |
for,amplified |
| R6766 |
T24503 |
T24504 |
nummod |
35,cycles |
| R6767 |
T24504 |
T24502 |
pobj |
cycles,for |
| R6768 |
T24505 |
T24494 |
punct |
.,amplified |
| R6769 |
T24507 |
T24508 |
amod |
Chromosomal,sex |
| R677 |
T4379 |
T4370 |
punct |
", ",expression |
| R6770 |
T24508 |
T24509 |
nsubjpass |
sex,determined |
| R6771 |
T24510 |
T24509 |
auxpass |
was,determined |
| R6772 |
T24511 |
T24509 |
prep |
by,determined |
| R6773 |
T24512 |
T24511 |
pobj |
PCR,by |
| R6774 |
T24513 |
T24509 |
prep |
with,determined |
| R6775 |
T24514 |
T24513 |
pobj |
primers,with |
| R6776 |
T24515 |
T24514 |
prep |
to,primers |
| R6777 |
T24516 |
T24517 |
det |
the,gene |
| R6778 |
T24517 |
T24515 |
pobj |
gene,to |
| R6779 |
T24518 |
T24519 |
compound |
Y,chromosome |
| R678 |
T4380 |
T4381 |
dep |
which,accomplished |
| R6780 |
T24519 |
T24517 |
compound |
chromosome,gene |
| R6781 |
T24520 |
T24517 |
appos |
Zfy,gene |
| R6782 |
T24521 |
T24522 |
punct |
(,below |
| R6783 |
T24522 |
T24509 |
parataxis |
below,determined |
| R6784 |
T24523 |
T24522 |
punct |
),below |
| R6785 |
T24524 |
T24509 |
punct |
.,determined |
| R6786 |
T24526 |
T24527 |
det |
The,allele |
| R6787 |
T24527 |
T24532 |
nsubjpass |
allele,detected |
| R6788 |
T24528 |
T24529 |
amod |
wild,type |
| R6789 |
T24529 |
T24527 |
compound |
type,allele |
| R679 |
T4381 |
T4370 |
relcl |
accomplished,expression |
| R6790 |
T24530 |
T24529 |
punct |
-,type |
| R6791 |
T24531 |
T24527 |
compound |
Dmrt7,allele |
| R6792 |
T24533 |
T24527 |
appos |
Dmrt7,allele |
| R6793 |
T24534 |
T24533 |
punct |
+,Dmrt7 |
| R6794 |
T24535 |
T24532 |
auxpass |
was,detected |
| R6795 |
T24536 |
T24532 |
prep |
by,detected |
| R6796 |
T24537 |
T24536 |
pobj |
PCR,by |
| R6797 |
T24538 |
T24532 |
prep |
with,detected |
| R6798 |
T24539 |
T24540 |
compound |
DM5S4,DM5S5 |
| R6799 |
T24540 |
T24538 |
pobj |
DM5S5,with |
| R68 |
T957 |
T955 |
pobj |
prophase,of |
| R680 |
T4382 |
T4381 |
prep |
in,accomplished |
| R6800 |
T24541 |
T24540 |
punct |
/,DM5S5 |
| R6801 |
T24542 |
T24532 |
punct |
", ",detected |
| R6802 |
T24543 |
T24532 |
prep |
with,detected |
| R6803 |
T24544 |
T24545 |
det |
an,temperature |
| R6804 |
T24545 |
T24543 |
pobj |
temperature,with |
| R6805 |
T24546 |
T24545 |
amod |
annealing,temperature |
| R6806 |
T24547 |
T24545 |
prep |
of,temperature |
| R6807 |
T24548 |
T24549 |
nummod |
60,°C |
| R6808 |
T24549 |
T24547 |
pobj |
°C,of |
| R6809 |
T24550 |
T24532 |
punct |
.,detected |
| R681 |
T4383 |
T4382 |
pobj |
mammals,in |
| R6810 |
T24552 |
T24553 |
det |
The,allele |
| R6811 |
T24553 |
T24555 |
nsubjpass |
allele,detected |
| R6812 |
T24554 |
T24553 |
compound |
Dmrt7flox,allele |
| R6813 |
T24556 |
T24555 |
auxpass |
was,detected |
| R6814 |
T24557 |
T24555 |
prep |
by,detected |
| R6815 |
T24558 |
T24557 |
pobj |
PCR,by |
| R6816 |
T24559 |
T24555 |
prep |
with,detected |
| R6817 |
T24560 |
T24561 |
compound |
DM5S5F,DM7KO7R |
| R6818 |
T24561 |
T24559 |
pobj |
DM7KO7R,with |
| R6819 |
T24562 |
T24561 |
punct |
/,DM7KO7R |
| R682 |
T4384 |
T4381 |
auxpass |
is,accomplished |
| R6820 |
T24563 |
T24555 |
prep |
with,detected |
| R6821 |
T24564 |
T24565 |
det |
an,temperature |
| R6822 |
T24565 |
T24563 |
pobj |
temperature,with |
| R6823 |
T24566 |
T24565 |
amod |
annealing,temperature |
| R6824 |
T24567 |
T24565 |
prep |
of,temperature |
| R6825 |
T24568 |
T24569 |
nummod |
62,°C |
| R6826 |
T24569 |
T24567 |
pobj |
°C,of |
| R6827 |
T24570 |
T24555 |
punct |
.,detected |
| R6828 |
T24572 |
T24573 |
det |
The,allele |
| R6829 |
T24573 |
T24576 |
nsubjpass |
allele,detected |
| R683 |
T4385 |
T4381 |
prep |
by,accomplished |
| R6830 |
T24574 |
T24573 |
amod |
deleted,allele |
| R6831 |
T24575 |
T24573 |
compound |
Dmrt7,allele |
| R6832 |
T24577 |
T24573 |
appos |
Dmrt7,allele |
| R6833 |
T24578 |
T24577 |
punct |
−,Dmrt7 |
| R6834 |
T24579 |
T24576 |
auxpass |
was,detected |
| R6835 |
T24580 |
T24576 |
prep |
with,detected |
| R6836 |
T24581 |
T24582 |
compound |
DM5S3,DM7KO7R |
| R6837 |
T24582 |
T24580 |
pobj |
DM7KO7R,with |
| R6838 |
T24583 |
T24582 |
punct |
/,DM7KO7R |
| R6839 |
T24584 |
T24576 |
prep |
with,detected |
| R684 |
T4386 |
T4387 |
compound |
X,chromosome |
| R6840 |
T24585 |
T24586 |
det |
an,temperature |
| R6841 |
T24586 |
T24584 |
pobj |
temperature,with |
| R6842 |
T24587 |
T24586 |
amod |
annealing,temperature |
| R6843 |
T24588 |
T24586 |
prep |
of,temperature |
| R6844 |
T24589 |
T24590 |
nummod |
62,°C |
| R6845 |
T24590 |
T24588 |
pobj |
°C,of |
| R6846 |
T24591 |
T24576 |
punct |
.,detected |
| R6847 |
T24593 |
T24594 |
compound |
RT,PCR |
| R6848 |
T24594 |
T24596 |
nsubj |
PCR,was |
| R6849 |
T24595 |
T24594 |
punct |
-,PCR |
| R685 |
T4387 |
T4388 |
compound |
chromosome,inactivation |
| R6850 |
T24597 |
T24594 |
prep |
for,PCR |
| R6851 |
T24598 |
T24599 |
compound |
Dmrt7,expression |
| R6852 |
T24599 |
T24600 |
compound |
expression,analysis |
| R6853 |
T24600 |
T24597 |
pobj |
analysis,for |
| R6854 |
T24601 |
T24602 |
mark |
as,described |
| R6855 |
T24602 |
T24596 |
advcl |
described,was |
| R6856 |
T24603 |
T24604 |
punct |
[,23 |
| R6857 |
T24604 |
T24602 |
parataxis |
23,described |
| R6858 |
T24605 |
T24604 |
punct |
],23 |
| R6859 |
T24606 |
T24596 |
advcl |
using,was |
| R686 |
T4388 |
T4385 |
pobj |
inactivation,by |
| R6860 |
T24607 |
T24608 |
compound |
primers,SK112 |
| R6861 |
T24608 |
T24606 |
dobj |
SK112,using |
| R6862 |
T24609 |
T24608 |
compound |
SK111,SK112 |
| R6863 |
T24610 |
T24608 |
punct |
/,SK112 |
| R6864 |
T24611 |
T24606 |
prep |
with,using |
| R6865 |
T24612 |
T24613 |
det |
an,temperature |
| R6866 |
T24613 |
T24611 |
pobj |
temperature,with |
| R6867 |
T24614 |
T24613 |
compound |
annealing,temperature |
| R6868 |
T24615 |
T24613 |
prep |
of,temperature |
| R6869 |
T24616 |
T24617 |
nummod |
62,°C |
| R687 |
T4460 |
T4459 |
amod |
unpaired,regions |
| R6870 |
T24617 |
T24615 |
pobj |
°C,of |
| R6871 |
T24618 |
T24596 |
punct |
.,was |
| R6872 |
T24841 |
T24840 |
punct |
.,Primers |
| R6873 |
T24844 |
T24843 |
punct |
: ,DM5S3 |
| R6874 |
T24845 |
T24846 |
nummod |
5,AGAGTGGATTGAATCGGATAGCTC |
| R6875 |
T24846 |
T24843 |
appos |
AGAGTGGATTGAATCGGATAGCTC,DM5S3 |
| R6876 |
T24847 |
T24845 |
punct |
′,5 |
| R6877 |
T24848 |
T24846 |
punct |
-,AGAGTGGATTGAATCGGATAGCTC |
| R6878 |
T24849 |
T24846 |
punct |
-,AGAGTGGATTGAATCGGATAGCTC |
| R6879 |
T24850 |
T24846 |
nummod |
3,AGAGTGGATTGAATCGGATAGCTC |
| R688 |
T4389 |
T4388 |
prep |
in,inactivation |
| R6880 |
T24851 |
T24846 |
punct |
′,AGAGTGGATTGAATCGGATAGCTC |
| R6881 |
T24854 |
T24853 |
punct |
: ,DM5S4 |
| R6882 |
T24855 |
T24856 |
nummod |
5,AGGATCTTAGTGTCGAATGAATAC |
| R6883 |
T24856 |
T24853 |
appos |
AGGATCTTAGTGTCGAATGAATAC,DM5S4 |
| R6884 |
T24857 |
T24855 |
punct |
′,5 |
| R6885 |
T24858 |
T24856 |
punct |
-,AGGATCTTAGTGTCGAATGAATAC |
| R6886 |
T24859 |
T24856 |
punct |
-,AGGATCTTAGTGTCGAATGAATAC |
| R6887 |
T24860 |
T24856 |
nummod |
3,AGGATCTTAGTGTCGAATGAATAC |
| R6888 |
T24861 |
T24856 |
punct |
′,AGGATCTTAGTGTCGAATGAATAC |
| R6889 |
T24864 |
T24863 |
punct |
: ,DM5S5 |
| R689 |
T4390 |
T4389 |
pobj |
females,in |
| R6890 |
T24865 |
T24866 |
nummod |
5,CCCTTATCCTCCTGCATCCAGATC |
| R6891 |
T24866 |
T24863 |
appos |
CCCTTATCCTCCTGCATCCAGATC,DM5S5 |
| R6892 |
T24867 |
T24865 |
punct |
′,5 |
| R6893 |
T24868 |
T24866 |
punct |
-,CCCTTATCCTCCTGCATCCAGATC |
| R6894 |
T24869 |
T24866 |
punct |
-,CCCTTATCCTCCTGCATCCAGATC |
| R6895 |
T24870 |
T24866 |
nummod |
3,CCCTTATCCTCCTGCATCCAGATC |
| R6896 |
T24871 |
T24866 |
punct |
′,CCCTTATCCTCCTGCATCCAGATC |
| R6897 |
T24874 |
T24873 |
punct |
: ,DM5S10 |
| R6898 |
T24875 |
T24876 |
nummod |
5,CAGGCTATGGTTAGACTTGAGCAC |
| R6899 |
T24876 |
T24873 |
appos |
CAGGCTATGGTTAGACTTGAGCAC,DM5S10 |
| R69 |
T841 |
T839 |
dobj |
differences,requiring |
| R690 |
T4391 |
T4392 |
punct |
[,6 |
| R6900 |
T24877 |
T24875 |
punct |
′,5 |
| R6901 |
T24878 |
T24876 |
punct |
-,CAGGCTATGGTTAGACTTGAGCAC |
| R6902 |
T24879 |
T24876 |
punct |
-,CAGGCTATGGTTAGACTTGAGCAC |
| R6903 |
T24880 |
T24876 |
nummod |
3,CAGGCTATGGTTAGACTTGAGCAC |
| R6904 |
T24881 |
T24876 |
punct |
′,CAGGCTATGGTTAGACTTGAGCAC |
| R6905 |
T24884 |
T24883 |
punct |
: ,DM5S11 |
| R6906 |
T24885 |
T24886 |
nummod |
5,CATCACTCGCGGACAAAGATGCAG |
| R6907 |
T24886 |
T24883 |
appos |
CATCACTCGCGGACAAAGATGCAG,DM5S11 |
| R6908 |
T24887 |
T24885 |
punct |
′,5 |
| R6909 |
T24888 |
T24886 |
punct |
-,CATCACTCGCGGACAAAGATGCAG |
| R691 |
T4392 |
T4363 |
parataxis |
6,is |
| R6910 |
T24889 |
T24886 |
punct |
-,CATCACTCGCGGACAAAGATGCAG |
| R6911 |
T24890 |
T24886 |
nummod |
3,CATCACTCGCGGACAAAGATGCAG |
| R6912 |
T24891 |
T24886 |
punct |
′,CATCACTCGCGGACAAAGATGCAG |
| R6913 |
T24894 |
T24893 |
punct |
: ,DM5PR1 |
| R6914 |
T24895 |
T24896 |
nummod |
5,CTTCTGCTACAGCCACAGGTCTGG |
| R6915 |
T24896 |
T24893 |
appos |
CTTCTGCTACAGCCACAGGTCTGG,DM5PR1 |
| R6916 |
T24897 |
T24895 |
punct |
′,5 |
| R6917 |
T24898 |
T24896 |
punct |
-,CTTCTGCTACAGCCACAGGTCTGG |
| R6918 |
T24899 |
T24896 |
punct |
-,CTTCTGCTACAGCCACAGGTCTGG |
| R6919 |
T24900 |
T24896 |
nummod |
3,CTTCTGCTACAGCCACAGGTCTGG |
| R692 |
T4393 |
T4392 |
nummod |
5,6 |
| R6920 |
T24901 |
T24896 |
punct |
′,CTTCTGCTACAGCCACAGGTCTGG |
| R6921 |
T24904 |
T24903 |
punct |
: ,DM5PR2 |
| R6922 |
T24905 |
T24906 |
nummod |
5,GAATTCAACTAGTATCTGTCCC |
| R6923 |
T24906 |
T24903 |
appos |
GAATTCAACTAGTATCTGTCCC,DM5PR2 |
| R6924 |
T24907 |
T24905 |
punct |
′,5 |
| R6925 |
T24908 |
T24906 |
punct |
-,GAATTCAACTAGTATCTGTCCC |
| R6926 |
T24909 |
T24906 |
punct |
-,GAATTCAACTAGTATCTGTCCC |
| R6927 |
T24910 |
T24906 |
nummod |
3,GAATTCAACTAGTATCTGTCCC |
| R6928 |
T24911 |
T24906 |
punct |
′,GAATTCAACTAGTATCTGTCCC |
| R6929 |
T24914 |
T24913 |
punct |
: ,DM7KO7R |
| R693 |
T4461 |
T4459 |
compound |
chromosome,regions |
| R6930 |
T24915 |
T24916 |
nummod |
5,CGAGGATCAAGCTCAGGTCACTAGG |
| R6931 |
T24916 |
T24913 |
appos |
CGAGGATCAAGCTCAGGTCACTAGG,DM7KO7R |
| R6932 |
T24917 |
T24915 |
punct |
′,5 |
| R6933 |
T24918 |
T24916 |
punct |
-,CGAGGATCAAGCTCAGGTCACTAGG |
| R6934 |
T24919 |
T24916 |
punct |
-,CGAGGATCAAGCTCAGGTCACTAGG |
| R6935 |
T24920 |
T24916 |
nummod |
3,CGAGGATCAAGCTCAGGTCACTAGG |
| R6936 |
T24921 |
T24916 |
punct |
′,CGAGGATCAAGCTCAGGTCACTAGG |
| R6937 |
T24924 |
T24923 |
punct |
: ,DM5S5F |
| R6938 |
T24925 |
T24926 |
nummod |
5,GATCTGGATGCAGGAGGATAAGGG |
| R6939 |
T24926 |
T24923 |
appos |
GATCTGGATGCAGGAGGATAAGGG,DM5S5F |
| R694 |
T4394 |
T4392 |
punct |
",",6 |
| R6940 |
T24927 |
T24925 |
punct |
′,5 |
| R6941 |
T24928 |
T24926 |
punct |
-,GATCTGGATGCAGGAGGATAAGGG |
| R6942 |
T24929 |
T24926 |
punct |
-,GATCTGGATGCAGGAGGATAAGGG |
| R6943 |
T24930 |
T24926 |
nummod |
3,GATCTGGATGCAGGAGGATAAGGG |
| R6944 |
T24931 |
T24926 |
punct |
′,GATCTGGATGCAGGAGGATAAGGG |
| R6945 |
T24934 |
T24933 |
punct |
: ,ZFYF |
| R6946 |
T24935 |
T24936 |
nummod |
5,CCTATTGCATGGACAGCAGTCTTATG |
| R6947 |
T24936 |
T24933 |
appos |
CCTATTGCATGGACAGCAGTCTTATG,ZFYF |
| R6948 |
T24937 |
T24935 |
punct |
′,5 |
| R6949 |
T24938 |
T24936 |
punct |
-,CCTATTGCATGGACAGCAGTCTTATG |
| R695 |
T4395 |
T4392 |
punct |
],6 |
| R6950 |
T24939 |
T24936 |
punct |
-,CCTATTGCATGGACAGCAGTCTTATG |
| R6951 |
T24940 |
T24936 |
nummod |
3,CCTATTGCATGGACAGCAGTCTTATG |
| R6952 |
T24941 |
T24936 |
punct |
′,CCTATTGCATGGACAGCAGTCTTATG |
| R6953 |
T24944 |
T24943 |
punct |
: ,ZFYR |
| R6954 |
T24945 |
T24946 |
nummod |
5,GACTAGACATGTTCTTAACATCTGTCC |
| R6955 |
T24946 |
T24943 |
appos |
GACTAGACATGTTCTTAACATCTGTCC,ZFYR |
| R6956 |
T24947 |
T24945 |
punct |
′,5 |
| R6957 |
T24948 |
T24946 |
punct |
-,GACTAGACATGTTCTTAACATCTGTCC |
| R6958 |
T24949 |
T24946 |
punct |
-,GACTAGACATGTTCTTAACATCTGTCC |
| R6959 |
T24950 |
T24946 |
nummod |
3,GACTAGACATGTTCTTAACATCTGTCC |
| R696 |
T4396 |
T4363 |
punct |
.,is |
| R6960 |
T24951 |
T24946 |
punct |
′,GACTAGACATGTTCTTAACATCTGTCC |
| R6961 |
T24954 |
T24953 |
punct |
: ,SK111 |
| R6962 |
T24955 |
T24956 |
nummod |
5,CCCTTCTGGAAAAGAGAACATAGC |
| R6963 |
T24956 |
T24953 |
appos |
CCCTTCTGGAAAAGAGAACATAGC,SK111 |
| R6964 |
T24957 |
T24955 |
punct |
′,5 |
| R6965 |
T24958 |
T24956 |
punct |
-,CCCTTCTGGAAAAGAGAACATAGC |
| R6966 |
T24959 |
T24956 |
punct |
-,CCCTTCTGGAAAAGAGAACATAGC |
| R6967 |
T24960 |
T24956 |
nummod |
3,CCCTTCTGGAAAAGAGAACATAGC |
| R6968 |
T24961 |
T24956 |
punct |
′,CCCTTCTGGAAAAGAGAACATAGC |
| R6969 |
T24964 |
T24963 |
punct |
: ,SK112 |
| R697 |
T4398 |
T4399 |
prep |
In,is |
| R6970 |
T24965 |
T24966 |
nummod |
5,GCTCCAGGGGCCTGTGGCTGTAGC |
| R6971 |
T24966 |
T24963 |
appos |
GCTCCAGGGGCCTGTGGCTGTAGC,SK112 |
| R6972 |
T24967 |
T24965 |
punct |
′,5 |
| R6973 |
T24968 |
T24966 |
punct |
-,GCTCCAGGGGCCTGTGGCTGTAGC |
| R6974 |
T24969 |
T24966 |
punct |
-,GCTCCAGGGGCCTGTGGCTGTAGC |
| R6975 |
T24970 |
T24966 |
nummod |
3,GCTCCAGGGGCCTGTGGCTGTAGC |
| R6976 |
T24971 |
T24966 |
punct |
′,GCTCCAGGGGCCTGTGGCTGTAGC |
| R6977 |
T24973 |
T24974 |
compound |
β,actinF |
| R6978 |
T24975 |
T24974 |
punct |
-,actinF |
| R6979 |
T24976 |
T24974 |
punct |
: ,actinF |
| R698 |
T4462 |
T4452 |
auxpass |
are,associated |
| R6980 |
T24977 |
T24978 |
nummod |
5,TGCGTGACATCAAAGAGAAG |
| R6981 |
T24978 |
T24974 |
appos |
TGCGTGACATCAAAGAGAAG,actinF |
| R6982 |
T24979 |
T24977 |
punct |
′,5 |
| R6983 |
T24980 |
T24978 |
punct |
-,TGCGTGACATCAAAGAGAAG |
| R6984 |
T24981 |
T24978 |
punct |
-,TGCGTGACATCAAAGAGAAG |
| R6985 |
T24982 |
T24978 |
nummod |
3,TGCGTGACATCAAAGAGAAG |
| R6986 |
T24983 |
T24978 |
punct |
′,TGCGTGACATCAAAGAGAAG |
| R6987 |
T24985 |
T24986 |
compound |
β,actinR |
| R6988 |
T24987 |
T24986 |
punct |
-,actinR |
| R6989 |
T24988 |
T24986 |
punct |
: ,actinR |
| R699 |
T4400 |
T4401 |
amod |
male,cells |
| R6990 |
T24989 |
T24990 |
nummod |
5,GATGCCACAGGATTCCATA |
| R6991 |
T24990 |
T24986 |
appos |
GATGCCACAGGATTCCATA,actinR |
| R6992 |
T24991 |
T24989 |
punct |
′,5 |
| R6993 |
T24992 |
T24990 |
punct |
-,GATGCCACAGGATTCCATA |
| R6994 |
T24993 |
T24990 |
punct |
-,GATGCCACAGGATTCCATA |
| R6995 |
T24994 |
T24990 |
nummod |
3,GATGCCACAGGATTCCATA |
| R6996 |
T24995 |
T24990 |
punct |
′,GATGCCACAGGATTCCATA |
| R6997 |
T25223 |
T25224 |
amod |
Histological,analysis |
| R6998 |
T25225 |
T25224 |
cc |
and,analysis |
| R6999 |
T25226 |
T25227 |
compound |
TUNEL,assay |
| R70 |
T958 |
T944 |
cc |
and,localizes |
| R700 |
T4401 |
T4398 |
pobj |
cells,In |
| R7000 |
T25227 |
T25224 |
conj |
assay,analysis |
| R7001 |
T25228 |
T25227 |
punct |
.,assay |
| R7002 |
T25230 |
T25231 |
amod |
Dissected,testes |
| R7003 |
T25231 |
T25232 |
nsubjpass |
testes,fixed |
| R7004 |
T25233 |
T25232 |
auxpass |
were,fixed |
| R7005 |
T25234 |
T25232 |
prep |
in,fixed |
| R7006 |
T25235 |
T25236 |
poss |
Bouin,fixative |
| R7007 |
T25236 |
T25234 |
pobj |
fixative,in |
| R7008 |
T25237 |
T25235 |
case |
's,Bouin |
| R7009 |
T25238 |
T25236 |
cc |
or,fixative |
| R701 |
T4402 |
T4401 |
compound |
germ,cells |
| R7010 |
T25239 |
T25240 |
npadvmod |
phosphate,buffered |
| R7011 |
T25240 |
T25242 |
amod |
buffered,formalin |
| R7012 |
T25241 |
T25240 |
punct |
-,buffered |
| R7013 |
T25242 |
T25236 |
conj |
formalin,fixative |
| R7014 |
T25243 |
T25232 |
advmod |
overnight,fixed |
| R7015 |
T25244 |
T25232 |
prep |
at,fixed |
| R7016 |
T25245 |
T25246 |
nummod |
4,°C |
| R7017 |
T25246 |
T25244 |
pobj |
°C,at |
| R7018 |
T25247 |
T25232 |
punct |
", ",fixed |
| R7019 |
T25248 |
T25249 |
advmod |
progressively,dehydrated |
| R702 |
T4463 |
T4452 |
prep |
with,associated |
| R7020 |
T25249 |
T25232 |
conj |
dehydrated,fixed |
| R7021 |
T25250 |
T25249 |
prep |
in,dehydrated |
| R7022 |
T25251 |
T25252 |
det |
a,series |
| R7023 |
T25252 |
T25250 |
pobj |
series,in |
| R7024 |
T25253 |
T25252 |
amod |
graded,series |
| R7025 |
T25254 |
T25252 |
compound |
ethanol,series |
| R7026 |
T25255 |
T25249 |
punct |
", ",dehydrated |
| R7027 |
T25256 |
T25249 |
cc |
and,dehydrated |
| R7028 |
T25257 |
T25249 |
conj |
embedded,dehydrated |
| R7029 |
T25258 |
T25257 |
prep |
in,embedded |
| R703 |
T4403 |
T4399 |
expl |
there,is |
| R7030 |
T25259 |
T25260 |
compound |
paraffin,wax |
| R7031 |
T25260 |
T25258 |
pobj |
wax,in |
| R7032 |
T25261 |
T25232 |
punct |
.,fixed |
| R7033 |
T25263 |
T25264 |
nsubjpass |
Sections,deparaffinized |
| R7034 |
T25265 |
T25266 |
punct |
(,μm |
| R7035 |
T25266 |
T25263 |
parataxis |
μm,Sections |
| R7036 |
T25267 |
T25266 |
nummod |
6,μm |
| R7037 |
T25268 |
T25266 |
punct |
),μm |
| R7038 |
T25269 |
T25264 |
auxpass |
were,deparaffinized |
| R7039 |
T25270 |
T25264 |
punct |
", ",deparaffinized |
| R704 |
T4404 |
T4405 |
det |
another,consideration |
| R7040 |
T25271 |
T25264 |
conj |
rehydrated,deparaffinized |
| R7041 |
T25272 |
T25271 |
punct |
", ",rehydrated |
| R7042 |
T25273 |
T25271 |
cc |
and,rehydrated |
| R7043 |
T25274 |
T25271 |
conj |
stained,rehydrated |
| R7044 |
T25275 |
T25274 |
prep |
with,stained |
| R7045 |
T25276 |
T25275 |
pobj |
hematoxylin,with |
| R7046 |
T25277 |
T25276 |
cc |
and,hematoxylin |
| R7047 |
T25278 |
T25276 |
conj |
eosin,hematoxylin |
| R7048 |
T25279 |
T25264 |
punct |
.,deparaffinized |
| R7049 |
T25281 |
T25282 |
prep |
For,treated |
| R705 |
T4405 |
T4399 |
attr |
consideration,is |
| R7050 |
T25283 |
T25284 |
compound |
TUNEL,analyses |
| R7051 |
T25284 |
T25281 |
pobj |
analyses,For |
| R7052 |
T25285 |
T25282 |
punct |
", ",treated |
| R7053 |
T25286 |
T25287 |
amod |
deparaffinized,sections |
| R7054 |
T25287 |
T25282 |
nsubjpass |
sections,treated |
| R7055 |
T25288 |
T25282 |
auxpass |
were,treated |
| R7056 |
T25289 |
T25282 |
prep |
with,treated |
| R7057 |
T25290 |
T25291 |
compound |
proteinase,K |
| R7058 |
T25291 |
T25289 |
pobj |
K,with |
| R7059 |
T25292 |
T25282 |
prep |
for,treated |
| R706 |
T4464 |
T4465 |
det |
a,domain |
| R7060 |
T25293 |
T25294 |
nummod |
15,min |
| R7061 |
T25294 |
T25292 |
pobj |
min,for |
| R7062 |
T25295 |
T25282 |
cc |
and,treated |
| R7063 |
T25296 |
T25282 |
conj |
quenched,treated |
| R7064 |
T25297 |
T25296 |
prep |
in,quenched |
| R7065 |
T25298 |
T25299 |
nummod |
3.0,% |
| R7066 |
T25299 |
T25300 |
compound |
%,peroxide |
| R7067 |
T25300 |
T25297 |
pobj |
peroxide,in |
| R7068 |
T25301 |
T25300 |
compound |
hydrogen,peroxide |
| R7069 |
T25302 |
T25296 |
prep |
in,quenched |
| R707 |
T4406 |
T4407 |
npadvmod |
sex,specific |
| R7070 |
T25303 |
T25302 |
pobj |
PBS,in |
| R7071 |
T25304 |
T25296 |
prep |
for,quenched |
| R7072 |
T25305 |
T25306 |
nummod |
5,min |
| R7073 |
T25306 |
T25304 |
pobj |
min,for |
| R7074 |
T25307 |
T25296 |
prep |
at,quenched |
| R7075 |
T25308 |
T25309 |
compound |
room,temperature |
| R7076 |
T25309 |
T25307 |
pobj |
temperature,at |
| R7077 |
T25310 |
T25282 |
punct |
.,treated |
| R7078 |
T25312 |
T25313 |
advmod |
Subsequently,detected |
| R7079 |
T25314 |
T25313 |
punct |
", ",detected |
| R708 |
T4407 |
T4405 |
amod |
specific,consideration |
| R7080 |
T25315 |
T25316 |
amod |
nuclear,staining |
| R7081 |
T25316 |
T25313 |
nsubjpass |
staining,detected |
| R7082 |
T25317 |
T25316 |
prep |
in,staining |
| R7083 |
T25318 |
T25319 |
amod |
apoptotic,cells |
| R7084 |
T25319 |
T25317 |
pobj |
cells,in |
| R7085 |
T25320 |
T25313 |
auxpass |
was,detected |
| R7086 |
T25321 |
T25313 |
advcl |
using,detected |
| R7087 |
T25322 |
T25323 |
compound |
ApopTag,kit |
| R7088 |
T25323 |
T25321 |
dobj |
kit,using |
| R7089 |
T25324 |
T25325 |
punct |
(,Chemicon |
| R709 |
T4408 |
T4407 |
punct |
-,specific |
| R7090 |
T25325 |
T25323 |
parataxis |
Chemicon,kit |
| R7091 |
T25326 |
T25325 |
punct |
", ",Chemicon |
| R7092 |
T25327 |
T25325 |
npadvmod |
http://www.chemicon.com,Chemicon |
| R7093 |
T25328 |
T25325 |
punct |
),Chemicon |
| R7094 |
T25329 |
T25321 |
prep |
according,using |
| R7095 |
T25330 |
T25329 |
prep |
to,according |
| R7096 |
T25331 |
T25332 |
det |
the,manufacturer |
| R7097 |
T25332 |
T25333 |
poss |
manufacturer,instructions |
| R7098 |
T25333 |
T25330 |
pobj |
instructions,to |
| R7099 |
T25334 |
T25332 |
case |
's,manufacturer |
| R71 |
T959 |
T960 |
auxpass |
is,required |
| R710 |
T4465 |
T4463 |
pobj |
domain,with |
| R7100 |
T25335 |
T25313 |
punct |
.,detected |
| R7101 |
T25494 |
T25495 |
nmod |
Tissue,staining |
| R7102 |
T25496 |
T25495 |
amod |
immunofluorescent,staining |
| R7103 |
T25497 |
T25495 |
punct |
.,staining |
| R7104 |
T25499 |
T25500 |
nsubjpass |
Slides,washed |
| R7105 |
T25501 |
T25499 |
prep |
with,Slides |
| R7106 |
T25502 |
T25503 |
compound |
paraffin,sections |
| R7107 |
T25503 |
T25501 |
pobj |
sections,with |
| R7108 |
T25504 |
T25500 |
auxpass |
were,washed |
| R7109 |
T25505 |
T25500 |
prep |
in,washed |
| R711 |
T4409 |
T4399 |
prep |
during,is |
| R7110 |
T25506 |
T25505 |
pobj |
PBT,in |
| R7111 |
T25507 |
T25508 |
punct |
(,Tween |
| R7112 |
T25508 |
T25506 |
parataxis |
Tween,PBT |
| R7113 |
T25509 |
T25510 |
nummod |
0.1,% |
| R7114 |
T25510 |
T25508 |
compound |
%,Tween |
| R7115 |
T25511 |
T25508 |
nummod |
20,Tween |
| R7116 |
T25512 |
T25508 |
prep |
in,Tween |
| R7117 |
T25513 |
T25512 |
pobj |
PBS,in |
| R7118 |
T25514 |
T25508 |
punct |
),Tween |
| R7119 |
T25515 |
T25500 |
cc |
and,washed |
| R712 |
T4410 |
T4409 |
pobj |
meiosis,during |
| R7120 |
T25516 |
T25500 |
conj |
autoclaved,washed |
| R7121 |
T25517 |
T25516 |
prep |
in,autoclaved |
| R7122 |
T25518 |
T25519 |
nummod |
10,mM |
| R7123 |
T25519 |
T25520 |
nmod |
mM,acid |
| R7124 |
T25520 |
T25517 |
pobj |
acid,in |
| R7125 |
T25521 |
T25520 |
amod |
citric,acid |
| R7126 |
T25522 |
T25523 |
punct |
(,pH |
| R7127 |
T25523 |
T25520 |
parataxis |
pH,acid |
| R7128 |
T25524 |
T25523 |
nummod |
6.0,pH |
| R7129 |
T25525 |
T25523 |
punct |
),pH |
| R713 |
T4411 |
T4399 |
punct |
.,is |
| R7130 |
T25526 |
T25527 |
aux |
to,retrieve |
| R7131 |
T25527 |
T25516 |
advcl |
retrieve,autoclaved |
| R7132 |
T25528 |
T25527 |
dobj |
antigenicity,retrieve |
| R7133 |
T25529 |
T25500 |
punct |
.,washed |
| R7134 |
T25531 |
T25532 |
nsubjpass |
Slides,blocked |
| R7135 |
T25533 |
T25532 |
auxpass |
were,blocked |
| R7136 |
T25534 |
T25532 |
prep |
in,blocked |
| R7137 |
T25535 |
T25536 |
nummod |
5,% |
| R7138 |
T25536 |
T25537 |
compound |
%,serum |
| R7139 |
T25537 |
T25534 |
pobj |
serum,in |
| R714 |
T4466 |
T4465 |
amod |
specialized,domain |
| R7140 |
T25538 |
T25539 |
punct |
(,matched |
| R7141 |
T25539 |
T25537 |
parataxis |
matched,serum |
| R7142 |
T25540 |
T25539 |
prep |
to,matched |
| R7143 |
T25541 |
T25542 |
det |
the,species |
| R7144 |
T25542 |
T25540 |
pobj |
species,to |
| R7145 |
T25543 |
T25542 |
prep |
of,species |
| R7146 |
T25544 |
T25545 |
det |
the,antibody |
| R7147 |
T25545 |
T25543 |
pobj |
antibody,of |
| R7148 |
T25546 |
T25545 |
amod |
secondary,antibody |
| R7149 |
T25547 |
T25539 |
punct |
),matched |
| R715 |
T4413 |
T4414 |
prep |
In,limited |
| R7150 |
T25548 |
T25532 |
prep |
in,blocked |
| R7151 |
T25549 |
T25548 |
pobj |
PBS,in |
| R7152 |
T25550 |
T25532 |
prep |
for,blocked |
| R7153 |
T25551 |
T25552 |
nummod |
1,h |
| R7154 |
T25552 |
T25550 |
pobj |
h,for |
| R7155 |
T25553 |
T25532 |
prep |
at,blocked |
| R7156 |
T25554 |
T25555 |
compound |
room,temperature |
| R7157 |
T25555 |
T25553 |
pobj |
temperature,at |
| R7158 |
T25556 |
T25532 |
cc |
and,blocked |
| R7159 |
T25557 |
T25532 |
conj |
incubated,blocked |
| R716 |
T4467 |
T4465 |
compound |
chromatin,domain |
| R7160 |
T25558 |
T25557 |
prep |
with,incubated |
| R7161 |
T25559 |
T25560 |
amod |
primary,antibodies |
| R7162 |
T25560 |
T25558 |
pobj |
antibodies,with |
| R7163 |
T25561 |
T25557 |
advmod |
overnight,incubated |
| R7164 |
T25562 |
T25557 |
prep |
at,incubated |
| R7165 |
T25563 |
T25564 |
nummod |
4,°C |
| R7166 |
T25564 |
T25562 |
pobj |
°C,at |
| R7167 |
T25565 |
T25557 |
prep |
prior,incubated |
| R7168 |
T25566 |
T25565 |
prep |
to,prior |
| R7169 |
T25567 |
T25566 |
pobj |
detection,to |
| R717 |
T4415 |
T4413 |
pobj |
prophase,In |
| R7170 |
T25568 |
T25567 |
prep |
with,detection |
| R7171 |
T25569 |
T25570 |
amod |
secondary,antibodies |
| R7172 |
T25570 |
T25568 |
pobj |
antibodies,with |
| R7173 |
T25571 |
T25532 |
punct |
.,blocked |
| R7174 |
T26487 |
T26486 |
punct |
.,Antibodies |
| R7175 |
T26489 |
T26490 |
nmod |
Rabbit,antibodies |
| R7176 |
T26490 |
T26492 |
nsubjpass |
antibodies,raised |
| R7177 |
T26491 |
T26490 |
amod |
polyclonal,antibodies |
| R7178 |
T26493 |
T26490 |
prep |
to,antibodies |
| R7179 |
T26494 |
T26493 |
pobj |
DMRT7,to |
| R718 |
T4416 |
T4415 |
nummod |
I,prophase |
| R7180 |
T26495 |
T26492 |
auxpass |
were,raised |
| R7181 |
T26496 |
T26492 |
prep |
against,raised |
| R7182 |
T26497 |
T26498 |
det |
a,protein |
| R7183 |
T26498 |
T26496 |
pobj |
protein,against |
| R7184 |
T26499 |
T26498 |
amod |
purified,protein |
| R7185 |
T26500 |
T26498 |
compound |
fusion,protein |
| R7186 |
T26501 |
T26498 |
acl |
containing,protein |
| R7187 |
T26502 |
T26503 |
compound |
glutathione,transferase |
| R7188 |
T26503 |
T26501 |
dobj |
transferase,containing |
| R7189 |
T26504 |
T26503 |
punct |
-,transferase |
| R719 |
T4417 |
T4415 |
punct |
", ",prophase |
| R7190 |
T26505 |
T26503 |
compound |
S,transferase |
| R7191 |
T26506 |
T26503 |
punct |
-,transferase |
| R7192 |
T26507 |
T26503 |
punct |
(,transferase |
| R7193 |
T26508 |
T26503 |
appos |
GST,transferase |
| R7194 |
T26509 |
T26503 |
punct |
),transferase |
| R7195 |
T26510 |
T26503 |
acl |
fused,transferase |
| R7196 |
T26511 |
T26510 |
prep |
to,fused |
| R7197 |
T26512 |
T26513 |
det |
the,acids |
| R7198 |
T26513 |
T26511 |
pobj |
acids,to |
| R7199 |
T26514 |
T26515 |
npadvmod |
C,terminal |
| R72 |
T960 |
T944 |
conj |
required,localizes |
| R720 |
T4468 |
T4465 |
acl |
termed,domain |
| R7200 |
T26515 |
T26513 |
amod |
terminal,acids |
| R7201 |
T26516 |
T26515 |
punct |
-,terminal |
| R7202 |
T26517 |
T26513 |
nummod |
279,acids |
| R7203 |
T26518 |
T26513 |
compound |
amino,acids |
| R7204 |
T26519 |
T26513 |
prep |
of,acids |
| R7205 |
T26520 |
T26519 |
pobj |
DMRT7,of |
| R7206 |
T26521 |
T26492 |
punct |
.,raised |
| R7207 |
T26523 |
T26524 |
nsubjpass |
Antibodies,removed |
| R7208 |
T26525 |
T26523 |
prep |
to,Antibodies |
| R7209 |
T26526 |
T26525 |
pobj |
GST,to |
| R721 |
T4418 |
T4419 |
advmod |
when,synapse |
| R7210 |
T26527 |
T26524 |
auxpass |
were,removed |
| R7211 |
T26528 |
T26524 |
prep |
by,removed |
| R7212 |
T26529 |
T26530 |
nmod |
GST,affigel |
| R7213 |
T26530 |
T26532 |
nmod |
affigel,chromatography |
| R7214 |
T26531 |
T26530 |
punct |
-,affigel |
| R7215 |
T26532 |
T26528 |
pobj |
chromatography,by |
| R7216 |
T26533 |
T26530 |
nummod |
10,affigel |
| R7217 |
T26534 |
T26524 |
cc |
and,removed |
| R7218 |
T26535 |
T26536 |
det |
the,antiserum |
| R7219 |
T26536 |
T26537 |
nsubjpass |
antiserum,purified |
| R722 |
T4419 |
T4415 |
relcl |
synapse,prophase |
| R7220 |
T26537 |
T26524 |
conj |
purified,removed |
| R7221 |
T26538 |
T26537 |
auxpass |
was,purified |
| R7222 |
T26539 |
T26537 |
advmod |
then,purified |
| R7223 |
T26540 |
T26537 |
prep |
by,purified |
| R7224 |
T26541 |
T26542 |
nmod |
GST,DMRT7 |
| R7225 |
T26542 |
T26544 |
nmod |
DMRT7,affigel |
| R7226 |
T26543 |
T26542 |
punct |
-,DMRT7 |
| R7227 |
T26544 |
T26546 |
nmod |
affigel,chromatography |
| R7228 |
T26545 |
T26544 |
punct |
-,affigel |
| R7229 |
T26546 |
T26540 |
pobj |
chromatography,by |
| R723 |
T4420 |
T4421 |
det |
the,chromosomes |
| R7230 |
T26547 |
T26544 |
nummod |
15,affigel |
| R7231 |
T26548 |
T26537 |
punct |
.,purified |
| R7232 |
T26550 |
T26551 |
compound |
DMRT7,antibody |
| R7233 |
T26551 |
T26552 |
nsubjpass |
antibody,used |
| R7234 |
T26553 |
T26552 |
auxpass |
was,used |
| R7235 |
T26554 |
T26552 |
prep |
at,used |
| R7236 |
T26555 |
T26556 |
nummod |
1,dilution |
| R7237 |
T26556 |
T26554 |
pobj |
dilution,at |
| R7238 |
T26557 |
T26558 |
punct |
:,200 |
| R7239 |
T26558 |
T26555 |
prep |
200,1 |
| R724 |
T4469 |
T4470 |
det |
the,body |
| R7240 |
T26559 |
T26552 |
prep |
with,used |
| R7241 |
T26560 |
T26561 |
det |
a,antibody |
| R7242 |
T26561 |
T26559 |
pobj |
antibody,with |
| R7243 |
T26562 |
T26561 |
nmod |
goat,antibody |
| R7244 |
T26563 |
T26561 |
amod |
anti-rabbit,antibody |
| R7245 |
T26564 |
T26561 |
amod |
secondary,antibody |
| R7246 |
T26565 |
T26566 |
punct |
(,Probes |
| R7247 |
T26566 |
T26561 |
parataxis |
Probes,antibody |
| R7248 |
T26567 |
T26566 |
compound |
Molecular,Probes |
| R7249 |
T26568 |
T26566 |
punct |
", ",Probes |
| R725 |
T4421 |
T4419 |
nsubj |
chromosomes,synapse |
| R7250 |
T26569 |
T26566 |
npadvmod |
http://www.invitrogen.com,Probes |
| R7251 |
T26570 |
T26566 |
punct |
),Probes |
| R7252 |
T26571 |
T26561 |
prep |
at,antibody |
| R7253 |
T26572 |
T26573 |
nummod |
1,dilution |
| R7254 |
T26573 |
T26571 |
pobj |
dilution,at |
| R7255 |
T26574 |
T26575 |
punct |
:,200 |
| R7256 |
T26575 |
T26572 |
prep |
200,1 |
| R7257 |
T26576 |
T26552 |
punct |
.,used |
| R7258 |
T26578 |
T26579 |
amod |
Other,antibodies |
| R7259 |
T26579 |
T26581 |
nsubj |
antibodies,were |
| R726 |
T4422 |
T4421 |
amod |
homologous,chromosomes |
| R7260 |
T26580 |
T26579 |
amod |
primary,antibodies |
| R7261 |
T26582 |
T26579 |
acl |
used,antibodies |
| R7262 |
T26583 |
T26582 |
prep |
for,used |
| R7263 |
T26584 |
T26583 |
pobj |
immunofluorescence,for |
| R7264 |
T26585 |
T26581 |
attr |
rat,were |
| R7265 |
T26586 |
T26585 |
amod |
anti-GATA1,rat |
| R7266 |
T26587 |
T26588 |
punct |
(,265 |
| R7267 |
T26588 |
T26585 |
parataxis |
265,rat |
| R7268 |
T26589 |
T26588 |
dep |
1,265 |
| R7269 |
T26590 |
T26591 |
punct |
:,200 |
| R727 |
T4470 |
T4468 |
oprd |
body,termed |
| R7270 |
T26591 |
T26589 |
prep |
200,1 |
| R7271 |
T26592 |
T26588 |
punct |
", ",265 |
| R7272 |
T26593 |
T26594 |
compound |
Santa,Cruz |
| R7273 |
T26594 |
T26595 |
compound |
Cruz,Biotechnology |
| R7274 |
T26595 |
T26588 |
dep |
Biotechnology,265 |
| R7275 |
T26596 |
T26595 |
punct |
", ",Biotechnology |
| R7276 |
T26597 |
T26595 |
npadvmod |
http://www.scbt.com,Biotechnology |
| R7277 |
T26598 |
T26588 |
punct |
", ",265 |
| R7278 |
T26599 |
T26588 |
compound |
sc,265 |
| R7279 |
T26600 |
T26588 |
punct |
-,265 |
| R728 |
T4423 |
T4419 |
cc |
and,synapse |
| R7280 |
T26601 |
T26588 |
punct |
),265 |
| R7281 |
T26602 |
T26585 |
punct |
", ",rat |
| R7282 |
T26603 |
T26585 |
conj |
goat,rat |
| R7283 |
T26604 |
T26603 |
amod |
anti-GATA4,goat |
| R7284 |
T26605 |
T26606 |
punct |
(,sc |
| R7285 |
T26606 |
T26603 |
parataxis |
sc,goat |
| R7286 |
T26607 |
T26606 |
dep |
1,sc |
| R7287 |
T26608 |
T26609 |
punct |
:,200 |
| R7288 |
T26609 |
T26607 |
prep |
200,1 |
| R7289 |
T26610 |
T26606 |
punct |
", ",sc |
| R729 |
T4424 |
T4425 |
amod |
homologous,recombination |
| R7290 |
T26611 |
T26612 |
compound |
Santa,Cruz |
| R7291 |
T26612 |
T26613 |
compound |
Cruz,Biotechnology |
| R7292 |
T26613 |
T26606 |
dep |
Biotechnology,sc |
| R7293 |
T26614 |
T26606 |
punct |
", ",sc |
| R7294 |
T26615 |
T26606 |
punct |
-,sc |
| R7295 |
T26616 |
T26606 |
nummod |
1237,sc |
| R7296 |
T26617 |
T26606 |
punct |
),sc |
| R7297 |
T26618 |
T26603 |
punct |
", ",goat |
| R7298 |
T26619 |
T26603 |
conj |
rat,goat |
| R7299 |
T26620 |
T26619 |
amod |
anti-TRA98,rat |
| R73 |
T842 |
T841 |
prep |
in,differences |
| R730 |
T4471 |
T4470 |
compound |
XY,body |
| R7300 |
T26621 |
T26622 |
punct |
(,gift |
| R7301 |
T26622 |
T26619 |
parataxis |
gift,rat |
| R7302 |
T26623 |
T26622 |
dep |
1,gift |
| R7303 |
T26624 |
T26625 |
punct |
:,200 |
| R7304 |
T26625 |
T26623 |
prep |
200,1 |
| R7305 |
T26626 |
T26622 |
punct |
", ",gift |
| R7306 |
T26627 |
T26622 |
prep |
of,gift |
| R7307 |
T26628 |
T26629 |
compound |
H.,Tanaka |
| R7308 |
T26629 |
T26627 |
pobj |
Tanaka,of |
| R7309 |
T26630 |
T26629 |
cc |
and,Tanaka |
| R731 |
T4425 |
T4426 |
nsubj |
recombination,occurs |
| R7310 |
T26631 |
T26632 |
compound |
Y.,Nishimune |
| R7311 |
T26632 |
T26629 |
conj |
Nishimune,Tanaka |
| R7312 |
T26633 |
T26622 |
punct |
),gift |
| R7313 |
T26634 |
T26619 |
punct |
", ",rat |
| R7314 |
T26635 |
T26619 |
conj |
rat,rat |
| R7315 |
T26636 |
T26635 |
amod |
anti-BC7,rat |
| R7316 |
T26637 |
T26638 |
punct |
(,gift |
| R7317 |
T26638 |
T26635 |
parataxis |
gift,rat |
| R7318 |
T26639 |
T26638 |
dep |
1,gift |
| R7319 |
T26640 |
T26641 |
punct |
:,50 |
| R732 |
T4426 |
T4419 |
conj |
occurs,synapse |
| R7320 |
T26641 |
T26639 |
prep |
50,1 |
| R7321 |
T26642 |
T26638 |
punct |
", ",gift |
| R7322 |
T26643 |
T26638 |
prep |
of,gift |
| R7323 |
T26644 |
T26645 |
compound |
H.,Tanaka |
| R7324 |
T26645 |
T26643 |
pobj |
Tanaka,of |
| R7325 |
T26646 |
T26645 |
cc |
and,Tanaka |
| R7326 |
T26647 |
T26648 |
compound |
Y.,Nishimune |
| R7327 |
T26648 |
T26645 |
conj |
Nishimune,Tanaka |
| R7328 |
T26649 |
T26638 |
punct |
),gift |
| R7329 |
T26650 |
T26635 |
punct |
", ",rat |
| R733 |
T4427 |
T4414 |
punct |
", ",limited |
| R7330 |
T26651 |
T26635 |
conj |
rat,rat |
| R7331 |
T26652 |
T26651 |
amod |
anti-TRA369,rat |
| R7332 |
T26653 |
T26654 |
punct |
(,gift |
| R7333 |
T26654 |
T26651 |
parataxis |
gift,rat |
| R7334 |
T26655 |
T26654 |
dep |
1,gift |
| R7335 |
T26656 |
T26657 |
punct |
:,200 |
| R7336 |
T26657 |
T26655 |
prep |
200,1 |
| R7337 |
T26658 |
T26654 |
punct |
", ",gift |
| R7338 |
T26659 |
T26654 |
prep |
of,gift |
| R7339 |
T26660 |
T26661 |
compound |
H.,Tanaka |
| R734 |
T4428 |
T4429 |
nmod |
X,chromosome |
| R7340 |
T26661 |
T26659 |
pobj |
Tanaka,of |
| R7341 |
T26662 |
T26661 |
cc |
and,Tanaka |
| R7342 |
T26663 |
T26664 |
compound |
Y.,Nishimune |
| R7343 |
T26664 |
T26661 |
conj |
Nishimune,Tanaka |
| R7344 |
T26665 |
T26654 |
punct |
),gift |
| R7345 |
T26666 |
T26651 |
punct |
", ",rat |
| R7346 |
T26667 |
T26651 |
conj |
rabbit,rat |
| R7347 |
T26668 |
T26667 |
amod |
anti-RAD51,rabbit |
| R7348 |
T26669 |
T26670 |
punct |
(,PC130 |
| R7349 |
T26670 |
T26667 |
parataxis |
PC130,rabbit |
| R735 |
T4429 |
T4432 |
compound |
chromosome,pairing |
| R7350 |
T26671 |
T26670 |
dep |
1,PC130 |
| R7351 |
T26672 |
T26673 |
punct |
:,600 |
| R7352 |
T26673 |
T26671 |
prep |
600,1 |
| R7353 |
T26674 |
T26670 |
dep |
Calbiochem,PC130 |
| R7354 |
T26675 |
T26674 |
punct |
", ",Calbiochem |
| R7355 |
T26676 |
T26674 |
npadvmod |
http://www.calbiochem.com,Calbiochem |
| R7356 |
T26677 |
T26670 |
punct |
", ",PC130 |
| R7357 |
T26678 |
T26670 |
punct |
),PC130 |
| R7358 |
T26679 |
T26667 |
punct |
", ",rabbit |
| R7359 |
T26680 |
T26681 |
nmod |
mouse,SUMO |
| R736 |
T4430 |
T4428 |
cc |
and,X |
| R7360 |
T26681 |
T26667 |
conj |
SUMO,rabbit |
| R7361 |
T26682 |
T26681 |
amod |
anti-GMP,SUMO |
| R7362 |
T26683 |
T26681 |
punct |
-,SUMO |
| R7363 |
T26684 |
T26681 |
nummod |
1,SUMO |
| R7364 |
T26685 |
T26681 |
punct |
/,SUMO |
| R7365 |
T26686 |
T26681 |
punct |
-,SUMO |
| R7366 |
T26687 |
T26681 |
nummod |
1,SUMO |
| R7367 |
T26688 |
T26689 |
punct |
(,33 |
| R7368 |
T26689 |
T26681 |
parataxis |
33,SUMO |
| R7369 |
T26690 |
T26689 |
dep |
1,33 |
| R737 |
T4431 |
T4428 |
conj |
Y,X |
| R7370 |
T26691 |
T26692 |
punct |
:,200 |
| R7371 |
T26692 |
T26690 |
prep |
200,1 |
| R7372 |
T26693 |
T26689 |
punct |
", ",33 |
| R7373 |
T26694 |
T26689 |
dep |
Zymed,33 |
| R7374 |
T26695 |
T26694 |
punct |
", ",Zymed |
| R7375 |
T26696 |
T26694 |
npadvmod |
http://invitrogen.com,Zymed |
| R7376 |
T26697 |
T26689 |
punct |
", ",33 |
| R7377 |
T26698 |
T26699 |
punct |
–,2400 |
| R7378 |
T26699 |
T26689 |
prep |
2400,33 |
| R7379 |
T26700 |
T26689 |
punct |
),33 |
| R738 |
T4432 |
T4414 |
nsubjpass |
pairing,limited |
| R7380 |
T26701 |
T26681 |
punct |
", ",SUMO |
| R7381 |
T26702 |
T26703 |
nmod |
rabbit,H2AX |
| R7382 |
T26703 |
T26681 |
conj |
H2AX,SUMO |
| R7383 |
T26704 |
T26703 |
amod |
anti-phospho,H2AX |
| R7384 |
T26705 |
T26703 |
punct |
-,H2AX |
| R7385 |
T26706 |
T26707 |
punct |
(,Ser139 |
| R7386 |
T26707 |
T26703 |
parataxis |
Ser139,H2AX |
| R7387 |
T26708 |
T26707 |
punct |
),Ser139 |
| R7388 |
T26709 |
T26710 |
punct |
(,01 |
| R7389 |
T26710 |
T26703 |
parataxis |
01,H2AX |
| R739 |
T4433 |
T4414 |
auxpass |
is,limited |
| R7390 |
T26711 |
T26710 |
dep |
1,01 |
| R7391 |
T26712 |
T26713 |
punct |
:,200 |
| R7392 |
T26713 |
T26711 |
prep |
200,1 |
| R7393 |
T26714 |
T26710 |
punct |
", ",01 |
| R7394 |
T26715 |
T26710 |
dep |
Upstate,01 |
| R7395 |
T26716 |
T26715 |
punct |
", ",Upstate |
| R7396 |
T26717 |
T26715 |
npadvmod |
http://www.millipore.com,Upstate |
| R7397 |
T26718 |
T26710 |
punct |
", ",01 |
| R7398 |
T26719 |
T26720 |
punct |
–,164 |
| R7399 |
T26720 |
T26710 |
prep |
164,01 |
| R74 |
T961 |
T960 |
prep |
for,required |
| R740 |
T4472 |
T4470 |
cc |
or,body |
| R7400 |
T26721 |
T26710 |
punct |
),01 |
| R7401 |
T26722 |
T26703 |
punct |
", ",H2AX |
| R7402 |
T26723 |
T26724 |
nmod |
mouse,H2AX |
| R7403 |
T26724 |
T26703 |
conj |
H2AX,H2AX |
| R7404 |
T26725 |
T26724 |
amod |
anti-phospho,H2AX |
| R7405 |
T26726 |
T26724 |
punct |
-,H2AX |
| R7406 |
T26727 |
T26728 |
punct |
(,05 |
| R7407 |
T26728 |
T26724 |
parataxis |
05,H2AX |
| R7408 |
T26729 |
T26728 |
dep |
1,05 |
| R7409 |
T26730 |
T26731 |
punct |
:,200 |
| R741 |
T4434 |
T4414 |
prep |
to,limited |
| R7410 |
T26731 |
T26729 |
prep |
200,1 |
| R7411 |
T26732 |
T26728 |
punct |
", ",05 |
| R7412 |
T26733 |
T26728 |
dep |
Upstate,05 |
| R7413 |
T26734 |
T26728 |
punct |
", ",05 |
| R7414 |
T26735 |
T26736 |
punct |
–,636 |
| R7415 |
T26736 |
T26728 |
prep |
636,05 |
| R7416 |
T26737 |
T26728 |
punct |
),05 |
| R7417 |
T26738 |
T26724 |
punct |
", ",H2AX |
| R7418 |
T26739 |
T26724 |
conj |
mouse,H2AX |
| R7419 |
T26740 |
T26739 |
amod |
anti-SYCP3,mouse |
| R742 |
T4435 |
T4436 |
det |
a,region |
| R7420 |
T26741 |
T26742 |
punct |
(,ab12452 |
| R7421 |
T26742 |
T26739 |
parataxis |
ab12452,mouse |
| R7422 |
T26743 |
T26742 |
dep |
1,ab12452 |
| R7423 |
T26744 |
T26745 |
punct |
:,200 |
| R7424 |
T26745 |
T26743 |
prep |
200,1 |
| R7425 |
T26746 |
T26742 |
punct |
", ",ab12452 |
| R7426 |
T26747 |
T26742 |
dep |
Abcam,ab12452 |
| R7427 |
T26748 |
T26747 |
punct |
", ",Abcam |
| R7428 |
T26749 |
T26747 |
npadvmod |
http://www.abcam.com,Abcam |
| R7429 |
T26750 |
T26742 |
punct |
", ",ab12452 |
| R743 |
T4436 |
T4434 |
pobj |
region,to |
| R7430 |
T26751 |
T26742 |
punct |
),ab12452 |
| R7431 |
T26752 |
T26739 |
punct |
", ",mouse |
| R7432 |
T26753 |
T26739 |
conj |
rabbit,mouse |
| R7433 |
T26754 |
T26753 |
amod |
anti-HP1β,rabbit |
| R7434 |
T26755 |
T26756 |
punct |
(,ab10478 |
| R7435 |
T26756 |
T26753 |
parataxis |
ab10478,rabbit |
| R7436 |
T26757 |
T26756 |
dep |
1,ab10478 |
| R7437 |
T26758 |
T26759 |
punct |
:,100 |
| R7438 |
T26759 |
T26757 |
prep |
100,1 |
| R7439 |
T26760 |
T26756 |
punct |
", ",ab10478 |
| R744 |
T4437 |
T4436 |
acl |
termed,region |
| R7440 |
T26761 |
T26756 |
dep |
Abcam,ab10478 |
| R7441 |
T26762 |
T26756 |
punct |
", ",ab10478 |
| R7442 |
T26763 |
T26756 |
punct |
),ab10478 |
| R7443 |
T26764 |
T26753 |
punct |
", ",rabbit |
| R7444 |
T26765 |
T26766 |
nmod |
rabbit,2meK9 |
| R7445 |
T26766 |
T26753 |
conj |
2meK9,rabbit |
| R7446 |
T26767 |
T26766 |
amod |
anti-H3,2meK9 |
| R7447 |
T26768 |
T26766 |
punct |
-,2meK9 |
| R7448 |
T26769 |
T26770 |
punct |
(,07 |
| R7449 |
T26770 |
T26766 |
parataxis |
07,2meK9 |
| R745 |
T4473 |
T4474 |
compound |
sex,body |
| R7450 |
T26771 |
T26770 |
dep |
1,07 |
| R7451 |
T26772 |
T26773 |
punct |
:,100 |
| R7452 |
T26773 |
T26771 |
prep |
100,1 |
| R7453 |
T26774 |
T26770 |
punct |
", ",07 |
| R7454 |
T26775 |
T26770 |
dep |
Upstate,07 |
| R7455 |
T26776 |
T26770 |
punct |
", ",07 |
| R7456 |
T26777 |
T26778 |
punct |
–,441 |
| R7457 |
T26778 |
T26770 |
prep |
441,07 |
| R7458 |
T26779 |
T26770 |
punct |
),07 |
| R7459 |
T26780 |
T26766 |
punct |
", ",2meK9 |
| R746 |
T4438 |
T4439 |
det |
the,region |
| R7460 |
T26781 |
T26782 |
nmod |
rabbit,3meK9 |
| R7461 |
T26782 |
T26766 |
conj |
3meK9,2meK9 |
| R7462 |
T26783 |
T26782 |
amod |
anti-H3,3meK9 |
| R7463 |
T26784 |
T26782 |
punct |
-,3meK9 |
| R7464 |
T26785 |
T26786 |
punct |
(,07 |
| R7465 |
T26786 |
T26782 |
parataxis |
07,3meK9 |
| R7466 |
T26787 |
T26786 |
dep |
1,07 |
| R7467 |
T26788 |
T26789 |
punct |
:,200 |
| R7468 |
T26789 |
T26787 |
prep |
200,1 |
| R7469 |
T26790 |
T26786 |
punct |
", ",07 |
| R747 |
T4439 |
T4437 |
oprd |
region,termed |
| R7470 |
T26791 |
T26786 |
dep |
Upstate,07 |
| R7471 |
T26792 |
T26786 |
punct |
", ",07 |
| R7472 |
T26793 |
T26794 |
punct |
–,442 |
| R7473 |
T26794 |
T26786 |
prep |
442,07 |
| R7474 |
T26795 |
T26786 |
punct |
),07 |
| R7475 |
T26796 |
T26782 |
punct |
", ",3meK9 |
| R7476 |
T26797 |
T26782 |
conj |
rabbit,3meK9 |
| R7477 |
T26798 |
T26797 |
amod |
anti-AR,rabbit |
| R7478 |
T26799 |
T26800 |
punct |
(,N |
| R7479 |
T26800 |
T26797 |
parataxis |
N,rabbit |
| R748 |
T4440 |
T4439 |
amod |
pseudoautosomal,region |
| R7480 |
T26801 |
T26800 |
punct |
-,N |
| R7481 |
T26802 |
T26800 |
nummod |
20,N |
| R7482 |
T26803 |
T26800 |
punct |
),N |
| R7483 |
T26804 |
T26805 |
punct |
(,sc |
| R7484 |
T26805 |
T26797 |
parataxis |
sc,rabbit |
| R7485 |
T26806 |
T26805 |
dep |
1,sc |
| R7486 |
T26807 |
T26808 |
punct |
:,200 |
| R7487 |
T26808 |
T26806 |
prep |
200,1 |
| R7488 |
T26809 |
T26805 |
punct |
", ",sc |
| R7489 |
T26810 |
T26811 |
compound |
Santa,Cruz |
| R749 |
T4474 |
T4470 |
conj |
body,body |
| R7490 |
T26811 |
T26812 |
compound |
Cruz,Biotechnology |
| R7491 |
T26812 |
T26805 |
dep |
Biotechnology,sc |
| R7492 |
T26813 |
T26805 |
punct |
", ",sc |
| R7493 |
T26814 |
T26805 |
punct |
-,sc |
| R7494 |
T26815 |
T26805 |
nummod |
816,sc |
| R7495 |
T26816 |
T26805 |
punct |
),sc |
| R7496 |
T26817 |
T26797 |
punct |
", ",rabbit |
| R7497 |
T26818 |
T26797 |
cc |
and,rabbit |
| R7498 |
T26819 |
T26820 |
nmod |
mouse,1A4 |
| R7499 |
T26820 |
T26797 |
conj |
1A4,rabbit |
| R75 |
T843 |
T844 |
compound |
germ,cell |
| R750 |
T4441 |
T4414 |
punct |
", ",limited |
| R7500 |
T26821 |
T26820 |
amod |
anti-αSMA,1A4 |
| R7501 |
T26822 |
T26820 |
compound |
clone,1A4 |
| R7502 |
T26823 |
T26824 |
punct |
(,A2547 |
| R7503 |
T26824 |
T26820 |
parataxis |
A2547,1A4 |
| R7504 |
T26825 |
T26824 |
dep |
1,A2547 |
| R7505 |
T26826 |
T26827 |
punct |
:,800 |
| R7506 |
T26827 |
T26825 |
prep |
800,1 |
| R7507 |
T26828 |
T26824 |
punct |
", ",A2547 |
| R7508 |
T26829 |
T26824 |
dep |
Sigma,A2547 |
| R7509 |
T26830 |
T26829 |
punct |
", ",Sigma |
| R751 |
T4442 |
T4414 |
advcl |
leaving,limited |
| R7510 |
T26831 |
T26829 |
npadvmod |
http://www.sigmaaldrich.com,Sigma |
| R7511 |
T26832 |
T26824 |
punct |
", ",A2547 |
| R7512 |
T26833 |
T26824 |
punct |
),A2547 |
| R7513 |
T26834 |
T26581 |
punct |
.,were |
| R7514 |
T26836 |
T26837 |
amod |
Secondary,antibodies |
| R7515 |
T26837 |
T26838 |
nsubj |
antibodies,were |
| R7516 |
T26839 |
T26837 |
acl |
used,antibodies |
| R7517 |
T26840 |
T26841 |
nmod |
goat,Alexa |
| R7518 |
T26841 |
T26838 |
attr |
Alexa,were |
| R7519 |
T26842 |
T26841 |
amod |
anti-rabbit,Alexa |
| R752 |
T4443 |
T4444 |
amod |
large,portions |
| R7520 |
T26843 |
T26841 |
nummod |
488,Alexa |
| R7521 |
T26844 |
T26841 |
punct |
", ",Alexa |
| R7522 |
T26845 |
T26846 |
nmod |
goat,Alexa |
| R7523 |
T26846 |
T26841 |
conj |
Alexa,Alexa |
| R7524 |
T26847 |
T26846 |
amod |
anti-rabbit,Alexa |
| R7525 |
T26848 |
T26846 |
nummod |
594,Alexa |
| R7526 |
T26849 |
T26846 |
punct |
", ",Alexa |
| R7527 |
T26850 |
T26851 |
nmod |
goat,Alexa |
| R7528 |
T26851 |
T26846 |
conj |
Alexa,Alexa |
| R7529 |
T26852 |
T26851 |
amod |
anti-rat,Alexa |
| R753 |
T4475 |
T4452 |
punct |
.,associated |
| R7530 |
T26853 |
T26851 |
nummod |
594,Alexa |
| R7531 |
T26854 |
T26851 |
punct |
", ",Alexa |
| R7532 |
T26855 |
T26851 |
cc |
and,Alexa |
| R7533 |
T26856 |
T26857 |
nmod |
goat,Alexa |
| R7534 |
T26857 |
T26851 |
conj |
Alexa,Alexa |
| R7535 |
T26858 |
T26857 |
amod |
anti-mouse,Alexa |
| R7536 |
T26859 |
T26857 |
nummod |
488,Alexa |
| R7537 |
T26860 |
T26861 |
punct |
(,Probes |
| R7538 |
T26861 |
T26857 |
parataxis |
Probes,Alexa |
| R7539 |
T26862 |
T26861 |
compound |
Molecular,Probes |
| R754 |
T4444 |
T4442 |
dobj |
portions,leaving |
| R7540 |
T26863 |
T26861 |
punct |
),Probes |
| R7541 |
T26864 |
T26841 |
acl |
used,Alexa |
| R7542 |
T26865 |
T26864 |
prep |
at,used |
| R7543 |
T26866 |
T26865 |
pobj |
1,at |
| R7544 |
T26867 |
T26868 |
punct |
:,250 |
| R7545 |
T26868 |
T26866 |
prep |
250,1 |
| R7546 |
T26869 |
T26838 |
punct |
.,were |
| R7547 |
T26871 |
T26872 |
nmod |
Donkey,FITC |
| R7548 |
T26872 |
T26874 |
nsubjpass |
FITC,used |
| R7549 |
T26873 |
T26872 |
amod |
anti-goat,FITC |
| R755 |
T4445 |
T4444 |
prep |
of,portions |
| R7550 |
T26875 |
T26876 |
punct |
(,Laboratories |
| R7551 |
T26876 |
T26872 |
parataxis |
Laboratories,FITC |
| R7552 |
T26877 |
T26876 |
compound |
Jackson,Laboratories |
| R7553 |
T26878 |
T26876 |
compound |
ImmunoResearch,Laboratories |
| R7554 |
T26879 |
T26876 |
punct |
", ",Laboratories |
| R7555 |
T26880 |
T26876 |
npadvmod |
http://www.jacksonimmuno.com,Laboratories |
| R7556 |
T26881 |
T26876 |
punct |
),Laboratories |
| R7557 |
T26882 |
T26872 |
cc |
and,FITC |
| R7558 |
T26883 |
T26884 |
nmod |
donkey,Red |
| R7559 |
T26884 |
T26872 |
conj |
Red,FITC |
| R756 |
T4446 |
T4447 |
det |
each,chromosome |
| R7560 |
T26885 |
T26884 |
amod |
anti-rabbit,Red |
| R7561 |
T26886 |
T26884 |
compound |
Texas,Red |
| R7562 |
T26887 |
T26888 |
punct |
(,Jackson |
| R7563 |
T26888 |
T26884 |
parataxis |
Jackson,Red |
| R7564 |
T26889 |
T26888 |
punct |
),Jackson |
| R7565 |
T26890 |
T26874 |
auxpass |
were,used |
| R7566 |
T26891 |
T26874 |
prep |
at,used |
| R7567 |
T26892 |
T26891 |
pobj |
1,at |
| R7568 |
T26893 |
T26894 |
punct |
:,50 |
| R7569 |
T26894 |
T26892 |
prep |
50,1 |
| R757 |
T4477 |
T4478 |
det |
The,function |
| R7570 |
T26895 |
T26874 |
prep |
according,used |
| R7571 |
T26896 |
T26895 |
prep |
to,according |
| R7572 |
T26897 |
T26898 |
det |
the,manufacturer |
| R7573 |
T26898 |
T26899 |
poss |
manufacturer,instructions |
| R7574 |
T26899 |
T26896 |
pobj |
instructions,to |
| R7575 |
T26900 |
T26898 |
case |
's,manufacturer |
| R7576 |
T26901 |
T26874 |
punct |
.,used |
| R7577 |
T27179 |
T27180 |
amod |
Meiotic,chromosome |
| R7578 |
T27180 |
T27181 |
compound |
chromosome,preparations |
| R7579 |
T27182 |
T27181 |
compound |
spread,preparations |
| R758 |
T4447 |
T4445 |
pobj |
chromosome,of |
| R7580 |
T27183 |
T27181 |
cc |
and,preparations |
| R7581 |
T27184 |
T27181 |
conj |
FISH,preparations |
| R7582 |
T27185 |
T27184 |
punct |
.,FISH |
| R7583 |
T27187 |
T27188 |
amod |
Meiotic,chromosome |
| R7584 |
T27188 |
T27189 |
compound |
chromosome,preparations |
| R7585 |
T27189 |
T27191 |
nsubjpass |
preparations,made |
| R7586 |
T27190 |
T27189 |
compound |
spread,preparations |
| R7587 |
T27192 |
T27191 |
auxpass |
were,made |
| R7588 |
T27193 |
T27191 |
prep |
from,made |
| R7589 |
T27194 |
T27195 |
nummod |
3,wk |
| R759 |
T4478 |
T4479 |
nsubj |
function,is |
| R7590 |
T27195 |
T27197 |
npadvmod |
wk,old |
| R7591 |
T27196 |
T27195 |
punct |
-,wk |
| R7592 |
T27197 |
T27199 |
amod |
old,mice |
| R7593 |
T27198 |
T27197 |
punct |
-,old |
| R7594 |
T27199 |
T27193 |
pobj |
mice,from |
| R7595 |
T27200 |
T27191 |
punct |
", ",made |
| R7596 |
T27201 |
T27191 |
advcl |
prepared,made |
| R7597 |
T27202 |
T27203 |
mark |
as,described |
| R7598 |
T27203 |
T27201 |
advcl |
described,prepared |
| R7599 |
T27204 |
T27203 |
agent |
by,described |
| R76 |
T962 |
T963 |
amod |
male,meiosis |
| R760 |
T4448 |
T4442 |
oprd |
unpaired,leaving |
| R7600 |
T27205 |
T27204 |
pobj |
Reinholdt,by |
| R7601 |
T27206 |
T27207 |
advmod |
et,al. |
| R7602 |
T27207 |
T27205 |
advmod |
al.,Reinholdt |
| R7603 |
T27208 |
T27209 |
punct |
[,63 |
| R7604 |
T27209 |
T27191 |
parataxis |
63,made |
| R7605 |
T27210 |
T27209 |
punct |
],63 |
| R7606 |
T27211 |
T27191 |
punct |
.,made |
| R7607 |
T27213 |
T27214 |
prep |
For,prepared |
| R7608 |
T27215 |
T27213 |
pobj |
analysis,For |
| R7609 |
T27216 |
T27215 |
prep |
of,analysis |
| R761 |
T4449 |
T4414 |
punct |
.,limited |
| R7610 |
T27217 |
T27216 |
pobj |
PMSC,of |
| R7611 |
T27218 |
T27217 |
cc |
and,PMSC |
| R7612 |
T27219 |
T27220 |
nmod |
Cot,FISH |
| R7613 |
T27220 |
T27217 |
conj |
FISH,PMSC |
| R7614 |
T27221 |
T27219 |
punct |
-,Cot |
| R7615 |
T27222 |
T27219 |
nummod |
1,Cot |
| R7616 |
T27223 |
T27220 |
compound |
RNA,FISH |
| R7617 |
T27224 |
T27214 |
punct |
", ",prepared |
| R7618 |
T27225 |
T27226 |
amod |
meiotic,slides |
| R7619 |
T27226 |
T27214 |
nsubjpass |
slides,prepared |
| R762 |
T4480 |
T4478 |
prep |
of,function |
| R7620 |
T27227 |
T27214 |
auxpass |
were,prepared |
| R7621 |
T27228 |
T27229 |
mark |
as,described |
| R7622 |
T27229 |
T27214 |
advcl |
described,prepared |
| R7623 |
T27230 |
T27229 |
advmod |
previously,described |
| R7624 |
T27231 |
T27232 |
punct |
[,16 |
| R7625 |
T27232 |
T27214 |
parataxis |
16,prepared |
| R7626 |
T27233 |
T27232 |
punct |
],16 |
| R7627 |
T27234 |
T27214 |
punct |
.,prepared |
| R7628 |
T27236 |
T27237 |
nsubjpass |
Slides,subjected |
| R7629 |
T27238 |
T27236 |
acl |
containing,Slides |
| R763 |
T4451 |
T4452 |
prep |
In,associated |
| R7630 |
T27239 |
T27240 |
compound |
chromosome,spreads |
| R7631 |
T27240 |
T27238 |
dobj |
spreads,containing |
| R7632 |
T27241 |
T27240 |
cc |
or,spreads |
| R7633 |
T27242 |
T27243 |
amod |
meiotic,spermatocytes |
| R7634 |
T27243 |
T27240 |
conj |
spermatocytes,spreads |
| R7635 |
T27244 |
T27237 |
auxpass |
were,subjected |
| R7636 |
T27245 |
T27237 |
prep |
to,subjected |
| R7637 |
T27246 |
T27247 |
amod |
immunofluorescent,staining |
| R7638 |
T27247 |
T27245 |
pobj |
staining,to |
| R7639 |
T27248 |
T27247 |
cc |
or,staining |
| R764 |
T4453 |
T4454 |
amod |
eutherian,mammals |
| R7640 |
T27249 |
T27250 |
compound |
RNA,FISH |
| R7641 |
T27250 |
T27247 |
conj |
FISH,staining |
| R7642 |
T27251 |
T27237 |
punct |
", ",subjected |
| R7643 |
T27252 |
T27253 |
mark |
as,described |
| R7644 |
T27253 |
T27237 |
advcl |
described,subjected |
| R7645 |
T27254 |
T27253 |
advmod |
previously,described |
| R7646 |
T27255 |
T27256 |
punct |
[,63 |
| R7647 |
T27256 |
T27237 |
parataxis |
63,subjected |
| R7648 |
T27257 |
T27256 |
nummod |
16,63 |
| R7649 |
T27258 |
T27256 |
punct |
",",63 |
| R765 |
T4481 |
T4482 |
det |
the,body |
| R7650 |
T27259 |
T27256 |
punct |
],63 |
| R7651 |
T27260 |
T27237 |
punct |
.,subjected |
| R7652 |
T27262 |
T27263 |
prep |
For,carried |
| R7653 |
T27264 |
T27265 |
amod |
combined,FISH |
| R7654 |
T27265 |
T27262 |
pobj |
FISH,For |
| R7655 |
T27266 |
T27265 |
compound |
RNA,FISH |
| R7656 |
T27267 |
T27265 |
punct |
/,FISH |
| R7657 |
T27268 |
T27265 |
appos |
immunostaining,FISH |
| R7658 |
T27269 |
T27263 |
punct |
", ",carried |
| R7659 |
T27270 |
T27263 |
nsubj |
we,carried |
| R766 |
T4454 |
T4451 |
pobj |
mammals,In |
| R7660 |
T27271 |
T27263 |
prt |
out,carried |
| R7661 |
T27272 |
T27273 |
compound |
RNA,FISH |
| R7662 |
T27273 |
T27263 |
dobj |
FISH,carried |
| R7663 |
T27274 |
T27263 |
advmod |
first,carried |
| R7664 |
T27275 |
T27263 |
punct |
", ",carried |
| R7665 |
T27276 |
T27263 |
advcl |
followed,carried |
| R7666 |
T27277 |
T27276 |
agent |
by,followed |
| R7667 |
T27278 |
T27277 |
pobj |
immunofluorescence,by |
| R7668 |
T27279 |
T27263 |
punct |
.,carried |
| R7669 |
T27281 |
T27282 |
compound |
DNA,FISH |
| R767 |
T4455 |
T4453 |
cc |
and,eutherian |
| R7670 |
T27282 |
T27283 |
nsubjpass |
FISH,performed |
| R7671 |
T27284 |
T27283 |
auxpass |
was,performed |
| R7672 |
T27285 |
T27283 |
advcl |
using,performed |
| R7673 |
T27286 |
T27287 |
compound |
chromosome,painting |
| R7674 |
T27287 |
T27285 |
dobj |
painting,using |
| R7675 |
T27288 |
T27289 |
punct |
(,Cambio |
| R7676 |
T27289 |
T27287 |
parataxis |
Cambio,painting |
| R7677 |
T27290 |
T27289 |
punct |
", ",Cambio |
| R7678 |
T27291 |
T27289 |
npadvmod |
http://www.cambio.co.uk,Cambio |
| R7679 |
T27292 |
T27289 |
punct |
),Cambio |
| R768 |
T4456 |
T4453 |
conj |
marsupial,eutherian |
| R7680 |
T27293 |
T27283 |
punct |
.,performed |
| R7681 |
T27295 |
T27296 |
compound |
Z,sections |
| R7682 |
T27296 |
T27298 |
nsubjpass |
sections,captured |
| R7683 |
T27297 |
T27296 |
punct |
-,sections |
| R7684 |
T27299 |
T27298 |
auxpass |
were,captured |
| R7685 |
T27300 |
T27298 |
prep |
by,captured |
| R7686 |
T27301 |
T27302 |
compound |
Zeiss,microscope |
| R7687 |
T27302 |
T27300 |
pobj |
microscope,by |
| R7688 |
T27303 |
T27302 |
compound |
Axioplan,microscope |
| R7689 |
T27304 |
T27305 |
punct |
(,Zeiss |
| R769 |
T4482 |
T4480 |
pobj |
body,of |
| R7690 |
T27305 |
T27302 |
parataxis |
Zeiss,microscope |
| R7691 |
T27306 |
T27305 |
punct |
", ",Zeiss |
| R7692 |
T27307 |
T27305 |
npadvmod |
http://www.zeiss.com,Zeiss |
| R7693 |
T27308 |
T27305 |
punct |
),Zeiss |
| R7694 |
T27309 |
T27298 |
cc |
and,captured |
| R7695 |
T27310 |
T27298 |
conj |
processed,captured |
| R7696 |
T27311 |
T27310 |
prep |
by,processed |
| R7697 |
T27312 |
T27311 |
pobj |
Openlab,by |
| R7698 |
T27313 |
T27314 |
punct |
(,Improvision |
| R7699 |
T27314 |
T27312 |
parataxis |
Improvision,Openlab |
| R77 |
T844 |
T845 |
compound |
cell,differentiation |
| R770 |
T4457 |
T4452 |
punct |
", ",associated |
| R7700 |
T27315 |
T27314 |
punct |
", ",Improvision |
| R7701 |
T27316 |
T27314 |
npadvmod |
http://www.improvision.com,Improvision |
| R7702 |
T27317 |
T27314 |
punct |
),Improvision |
| R7703 |
T27318 |
T27298 |
punct |
.,captured |
| R7704 |
T27760 |
T27759 |
prep |
of,Expression |
| R7705 |
T27761 |
T27762 |
compound |
Dmrt7,mRNA |
| R7706 |
T27762 |
T27760 |
pobj |
mRNA,of |
| R7707 |
T27763 |
T27762 |
cc |
and,mRNA |
| R7708 |
T27764 |
T27762 |
conj |
Protein,mRNA |
| R7709 |
T27766 |
T27767 |
punct |
(,A |
| R771 |
T4458 |
T4459 |
det |
these,regions |
| R7710 |
T27767 |
T27768 |
meta |
A,analysis |
| R7711 |
T27769 |
T27767 |
punct |
),A |
| R7712 |
T27770 |
T27771 |
compound |
RT,PCR |
| R7713 |
T27771 |
T27768 |
compound |
PCR,analysis |
| R7714 |
T27772 |
T27771 |
punct |
-,PCR |
| R7715 |
T27773 |
T27768 |
prep |
of,analysis |
| R7716 |
T27774 |
T27775 |
compound |
Dmrt7,mRNA |
| R7717 |
T27775 |
T27773 |
pobj |
mRNA,of |
| R7718 |
T27776 |
T27775 |
prep |
from,mRNA |
| R7719 |
T27777 |
T27778 |
nummod |
ten,organs |
| R772 |
T4483 |
T4482 |
compound |
XY,body |
| R7720 |
T27778 |
T27776 |
pobj |
organs,from |
| R7721 |
T27779 |
T27778 |
prep |
of,organs |
| R7722 |
T27780 |
T27781 |
amod |
adult,mouse |
| R7723 |
T27781 |
T27779 |
pobj |
mouse,of |
| R7724 |
T27782 |
T27768 |
punct |
.,analysis |
| R7725 |
T27784 |
T27785 |
nsubjpass |
cDNA,amplified |
| R7726 |
T27786 |
T27784 |
prep |
from,cDNA |
| R7727 |
T27787 |
T27788 |
det |
each,organ |
| R7728 |
T27788 |
T27786 |
pobj |
organ,from |
| R7729 |
T27789 |
T27785 |
auxpass |
was,amplified |
| R773 |
T4484 |
T4479 |
acomp |
uncertain,is |
| R7730 |
T27790 |
T27785 |
prep |
with,amplified |
| R7731 |
T27791 |
T27790 |
pobj |
primers,with |
| R7732 |
T27792 |
T27791 |
amod |
specific,primers |
| R7733 |
T27793 |
T27792 |
prep |
for,specific |
| R7734 |
T27794 |
T27793 |
pobj |
Dmrt7,for |
| R7735 |
T27795 |
T27796 |
punct |
(,row |
| R7736 |
T27796 |
T27794 |
parataxis |
row,Dmrt7 |
| R7737 |
T27797 |
T27796 |
amod |
top,row |
| R7738 |
T27798 |
T27796 |
punct |
),row |
| R7739 |
T27799 |
T27794 |
cc |
and,Dmrt7 |
| R774 |
T4485 |
T4486 |
punct |
[,7 |
| R7740 |
T27800 |
T27801 |
compound |
β,actin |
| R7741 |
T27801 |
T27794 |
conj |
actin,Dmrt7 |
| R7742 |
T27802 |
T27801 |
punct |
-,actin |
| R7743 |
T27803 |
T27804 |
punct |
(,row |
| R7744 |
T27804 |
T27801 |
parataxis |
row,actin |
| R7745 |
T27805 |
T27804 |
amod |
bottom,row |
| R7746 |
T27806 |
T27804 |
punct |
),row |
| R7747 |
T27807 |
T27785 |
punct |
.,amplified |
| R7748 |
T27809 |
T27810 |
punct |
(,B |
| R7749 |
T27810 |
T27811 |
meta |
B,expression |
| R775 |
T4486 |
T4479 |
parataxis |
7,is |
| R7750 |
T27812 |
T27810 |
punct |
),B |
| R7751 |
T27813 |
T27811 |
compound |
Dmrt7,expression |
| R7752 |
T27814 |
T27811 |
compound |
mRNA,expression |
| R7753 |
T27815 |
T27811 |
prep |
during,expression |
| R7754 |
T27816 |
T27817 |
det |
the,round |
| R7755 |
T27817 |
T27815 |
pobj |
round,during |
| R7756 |
T27818 |
T27817 |
amod |
first,round |
| R7757 |
T27819 |
T27817 |
prep |
of,round |
| R7758 |
T27820 |
T27819 |
pobj |
spermatogenesis,of |
| R7759 |
T27821 |
T27811 |
punct |
.,expression |
| R776 |
T4487 |
T4488 |
punct |
–,11 |
| R7760 |
T27823 |
T27824 |
nsubjpass |
cDNAs,amplified |
| R7761 |
T27825 |
T27823 |
acl |
obtained,cDNAs |
| R7762 |
T27826 |
T27825 |
prep |
from,obtained |
| R7763 |
T27827 |
T27826 |
pobj |
testis,from |
| R7764 |
T27828 |
T27825 |
prep |
at,obtained |
| R7765 |
T27829 |
T27830 |
det |
the,days |
| R7766 |
T27830 |
T27828 |
pobj |
days,at |
| R7767 |
T27831 |
T27830 |
amod |
indicated,days |
| R7768 |
T27832 |
T27830 |
prep |
after,days |
| R7769 |
T27833 |
T27832 |
pobj |
birth,after |
| R777 |
T4565 |
T4555 |
prep |
in,silenced |
| R7770 |
T27834 |
T27824 |
auxpass |
were,amplified |
| R7771 |
T27835 |
T27824 |
prep |
as,amplified |
| R7772 |
T27836 |
T27835 |
prep |
in,as |
| R7773 |
T27837 |
T27836 |
punct |
(,in |
| R7774 |
T27838 |
T27836 |
pobj |
A,in |
| R7775 |
T27839 |
T27824 |
punct |
),amplified |
| R7776 |
T27840 |
T27824 |
punct |
.,amplified |
| R7777 |
T27842 |
T27843 |
punct |
(,C |
| R7778 |
T27843 |
T27844 |
meta |
C,expression |
| R7779 |
T27845 |
T27843 |
punct |
),C |
| R778 |
T4566 |
T4567 |
det |
a,process |
| R7780 |
T27846 |
T27844 |
compound |
DMRT7,expression |
| R7781 |
T27847 |
T27844 |
compound |
protein,expression |
| R7782 |
T27848 |
T27844 |
punct |
.,expression |
| R7783 |
T27851 |
T27850 |
prep |
of,Immunofluorescence |
| R7784 |
T27852 |
T27853 |
compound |
testis,sections |
| R7785 |
T27853 |
T27851 |
pobj |
sections,of |
| R7786 |
T27854 |
T27853 |
prep |
from,sections |
| R7787 |
T27855 |
T27856 |
nummod |
6,wk |
| R7788 |
T27856 |
T27858 |
npadvmod |
wk,old |
| R7789 |
T27857 |
T27856 |
punct |
-,wk |
| R779 |
T4488 |
T4486 |
prep |
11,7 |
| R7790 |
T27858 |
T27860 |
amod |
old,male |
| R7791 |
T27859 |
T27858 |
punct |
-,old |
| R7792 |
T27860 |
T27854 |
pobj |
male,from |
| R7793 |
T27861 |
T27850 |
acl |
stained,Immunofluorescence |
| R7794 |
T27862 |
T27861 |
prep |
with,stained |
| R7795 |
T27863 |
T27862 |
pobj |
antibody,with |
| R7796 |
T27864 |
T27863 |
prep |
to,antibody |
| R7797 |
T27865 |
T27864 |
pobj |
DMRT7,to |
| R7798 |
T27866 |
T27867 |
punct |
(,green |
| R7799 |
T27867 |
T27865 |
parataxis |
green,DMRT7 |
| R78 |
T963 |
T961 |
pobj |
meiosis,for |
| R780 |
T4567 |
T4565 |
pobj |
process,in |
| R7800 |
T27868 |
T27867 |
punct |
),green |
| R7801 |
T27869 |
T27865 |
cc |
and,DMRT7 |
| R7802 |
T27870 |
T27865 |
conj |
DAPI,DMRT7 |
| R7803 |
T27871 |
T27872 |
punct |
(,blue |
| R7804 |
T27872 |
T27870 |
parataxis |
blue,DAPI |
| R7805 |
T27873 |
T27872 |
punct |
),blue |
| R7806 |
T27874 |
T27850 |
punct |
.,Immunofluorescence |
| R7807 |
T27876 |
T27877 |
punct |
(,D |
| R7808 |
T27877 |
T27878 |
meta |
D,localization |
| R7809 |
T27879 |
T27878 |
punct |
),localization |
| R781 |
T4568 |
T4567 |
acl |
termed,process |
| R7810 |
T27880 |
T27878 |
nmod |
DMRT7,localization |
| R7811 |
T27881 |
T27878 |
amod |
subcellular,localization |
| R7812 |
T27882 |
T27878 |
prep |
to,localization |
| R7813 |
T27883 |
T27884 |
compound |
XY,body |
| R7814 |
T27884 |
T27882 |
pobj |
body,to |
| R7815 |
T27885 |
T27878 |
punct |
.,localization |
| R7816 |
T27887 |
T27888 |
compound |
Testis,sections |
| R7817 |
T27889 |
T27888 |
prep |
from,sections |
| R7818 |
T27890 |
T27891 |
nummod |
6,wk |
| R7819 |
T27891 |
T27893 |
npadvmod |
wk,old |
| R782 |
T4489 |
T4486 |
punct |
],7 |
| R7820 |
T27892 |
T27891 |
punct |
-,wk |
| R7821 |
T27893 |
T27895 |
amod |
old,male |
| R7822 |
T27894 |
T27893 |
punct |
-,old |
| R7823 |
T27895 |
T27889 |
pobj |
male,from |
| R7824 |
T27896 |
T27888 |
acl |
stained,sections |
| R7825 |
T27897 |
T27896 |
prep |
with,stained |
| R7826 |
T27898 |
T27897 |
pobj |
antibodies,with |
| R7827 |
T27899 |
T27898 |
prep |
to,antibodies |
| R7828 |
T27900 |
T27899 |
pobj |
DMRT7,to |
| R7829 |
T27901 |
T27902 |
punct |
(,red |
| R783 |
T4569 |
T4570 |
amod |
meiotic,inactivation |
| R7830 |
T27902 |
T27900 |
parataxis |
red,DMRT7 |
| R7831 |
T27903 |
T27902 |
punct |
),red |
| R7832 |
T27904 |
T27900 |
cc |
and,DMRT7 |
| R7833 |
T27905 |
T27900 |
conj |
SUMO,DMRT7 |
| R7834 |
T27906 |
T27905 |
punct |
-,SUMO |
| R7835 |
T27907 |
T27905 |
nummod |
1,SUMO |
| R7836 |
T27908 |
T27909 |
punct |
(,green |
| R7837 |
T27909 |
T27905 |
parataxis |
green,SUMO |
| R7838 |
T27910 |
T27909 |
punct |
),green |
| R7839 |
T27911 |
T27888 |
punct |
.,sections |
| R784 |
T4570 |
T4568 |
oprd |
inactivation,termed |
| R7840 |
T27913 |
T27914 |
nsubjpass |
SUMO,localized |
| R7841 |
T27915 |
T27913 |
punct |
-,SUMO |
| R7842 |
T27916 |
T27913 |
nummod |
1,SUMO |
| R7843 |
T27917 |
T27914 |
auxpass |
is,localized |
| R7844 |
T27918 |
T27914 |
prep |
to,localized |
| R7845 |
T27919 |
T27920 |
det |
the,body |
| R7846 |
T27920 |
T27918 |
pobj |
body,to |
| R7847 |
T27921 |
T27920 |
compound |
XY,body |
| R7848 |
T27922 |
T27914 |
punct |
.,localized |
| R7849 |
T27924 |
T27925 |
amod |
Right-most,panel |
| R785 |
T4571 |
T4570 |
compound |
sex,inactivation |
| R7850 |
T27925 |
T27926 |
nsubj |
panel,shows |
| R7851 |
T27927 |
T27926 |
dobj |
merge,shows |
| R7852 |
T27928 |
T27927 |
prep |
of,merge |
| R7853 |
T27929 |
T27930 |
amod |
other,panels |
| R7854 |
T27930 |
T27928 |
pobj |
panels,of |
| R7855 |
T27931 |
T27930 |
nummod |
two,panels |
| R7856 |
T27932 |
T27926 |
punct |
.,shows |
| R7857 |
T27934 |
T27935 |
nsubj |
Inserts,show |
| R7858 |
T27936 |
T27937 |
amod |
higher,magnification |
| R7859 |
T27937 |
T27935 |
dobj |
magnification,show |
| R786 |
T4572 |
T4570 |
compound |
chromosome,inactivation |
| R7860 |
T27938 |
T27937 |
prep |
of,magnification |
| R7861 |
T27939 |
T27940 |
compound |
pachytene,spermatocytes |
| R7862 |
T27940 |
T27938 |
pobj |
spermatocytes,of |
| R7863 |
T27941 |
T27940 |
prep |
with,spermatocytes |
| R7864 |
T27942 |
T27943 |
compound |
XY,bodies |
| R7865 |
T27943 |
T27941 |
pobj |
bodies,with |
| R7866 |
T27944 |
T27935 |
punct |
.,show |
| R7867 |
T28480 |
T28481 |
amod |
Reduced,Size |
| R7868 |
T28482 |
T28481 |
compound |
Testis,Size |
| R7869 |
T28483 |
T28481 |
cc |
and,Size |
| R787 |
T4573 |
T4570 |
punct |
(,inactivation |
| R7870 |
T28484 |
T28485 |
compound |
Germ,Cell |
| R7871 |
T28485 |
T28486 |
compound |
Cell,Apoptosis |
| R7872 |
T28486 |
T28481 |
conj |
Apoptosis,Size |
| R7873 |
T28487 |
T28481 |
prep |
in,Size |
| R7874 |
T28488 |
T28487 |
pobj |
Mice,in |
| R7875 |
T28489 |
T28488 |
prep |
with,Mice |
| R7876 |
T28490 |
T28491 |
amod |
Targeted,Deletion |
| R7877 |
T28491 |
T28489 |
pobj |
Deletion,with |
| R7878 |
T28492 |
T28491 |
prep |
in,Deletion |
| R7879 |
T28493 |
T28492 |
pobj |
Dmrt7,in |
| R788 |
T4574 |
T4570 |
appos |
MSCI,inactivation |
| R7880 |
T28495 |
T28496 |
punct |
(,A |
| R7881 |
T28496 |
T28497 |
meta |
A,Testes |
| R7882 |
T28498 |
T28496 |
punct |
),A |
| R7883 |
T28499 |
T28497 |
prep |
from,Testes |
| R7884 |
T28500 |
T28501 |
det |
a,mouse |
| R7885 |
T28501 |
T28499 |
pobj |
mouse,from |
| R7886 |
T28502 |
T28503 |
nummod |
6,wk |
| R7887 |
T28503 |
T28505 |
npadvmod |
wk,old |
| R7888 |
T28504 |
T28503 |
punct |
-,wk |
| R7889 |
T28505 |
T28501 |
amod |
old,mouse |
| R789 |
T4490 |
T4479 |
punct |
", ",is |
| R7890 |
T28506 |
T28505 |
punct |
-,old |
| R7891 |
T28507 |
T28508 |
amod |
wild,type |
| R7892 |
T28508 |
T28501 |
nmod |
type,mouse |
| R7893 |
T28509 |
T28508 |
punct |
-,type |
| R7894 |
T28510 |
T28511 |
punct |
(,+ |
| R7895 |
T28511 |
T28501 |
punct |
+,mouse |
| R7896 |
T28512 |
T28511 |
punct |
+,+ |
| R7897 |
T28513 |
T28511 |
punct |
/,+ |
| R7898 |
T28514 |
T28511 |
punct |
),+ |
| R7899 |
T28515 |
T28501 |
cc |
and,mouse |
| R79 |
T964 |
T942 |
punct |
.,find |
| R790 |
T4575 |
T4555 |
punct |
),silenced |
| R7900 |
T28516 |
T28517 |
det |
a,littermate |
| R7901 |
T28517 |
T28501 |
conj |
littermate,mouse |
| R7902 |
T28518 |
T28517 |
amod |
homozygous,littermate |
| R7903 |
T28519 |
T28520 |
punct |
(,− |
| R7904 |
T28520 |
T28518 |
punct |
−,homozygous |
| R7905 |
T28521 |
T28520 |
punct |
−,− |
| R7906 |
T28522 |
T28520 |
punct |
/,− |
| R7907 |
T28523 |
T28520 |
punct |
),− |
| R7908 |
T28524 |
T28525 |
compound |
Dmrt7,mutant |
| R7909 |
T28525 |
T28517 |
compound |
mutant,littermate |
| R791 |
T4576 |
T4555 |
punct |
.,silenced |
| R7910 |
T28526 |
T28497 |
punct |
.,Testes |
| R7911 |
T28528 |
T28529 |
punct |
(,B |
| R7912 |
T28529 |
T28530 |
meta |
B,Sections |
| R7913 |
T28531 |
T28529 |
punct |
–,B |
| R7914 |
T28532 |
T28529 |
dep |
D,B |
| R7915 |
T28533 |
T28529 |
punct |
),B |
| R7916 |
T28534 |
T28530 |
prep |
of,Sections |
| R7917 |
T28535 |
T28534 |
pobj |
testes,of |
| R7918 |
T28536 |
T28535 |
prep |
from,testes |
| R7919 |
T28537 |
T28538 |
nummod |
14,d |
| R792 |
T4491 |
T4479 |
cc |
but,is |
| R7920 |
T28538 |
T28540 |
npadvmod |
d,old |
| R7921 |
T28539 |
T28538 |
punct |
-,d |
| R7922 |
T28540 |
T28542 |
amod |
old,mice |
| R7923 |
T28541 |
T28540 |
punct |
-,old |
| R7924 |
T28542 |
T28536 |
pobj |
mice,from |
| R7925 |
T28543 |
T28544 |
punct |
(,B |
| R7926 |
T28544 |
T28540 |
parataxis |
B,old |
| R7927 |
T28545 |
T28544 |
punct |
),B |
| R7928 |
T28546 |
T28540 |
punct |
", ",old |
| R7929 |
T28547 |
T28548 |
nummod |
21,d |
| R793 |
T4578 |
T4579 |
det |
The,body |
| R7930 |
T28548 |
T28550 |
npadvmod |
d,old |
| R7931 |
T28549 |
T28548 |
punct |
-,d |
| R7932 |
T28550 |
T28540 |
conj |
old,old |
| R7933 |
T28551 |
T28550 |
punct |
-,old |
| R7934 |
T28552 |
T28553 |
punct |
(,C |
| R7935 |
T28553 |
T28550 |
parataxis |
C,old |
| R7936 |
T28554 |
T28553 |
punct |
),C |
| R7937 |
T28555 |
T28550 |
punct |
", ",old |
| R7938 |
T28556 |
T28550 |
cc |
and,old |
| R7939 |
T28557 |
T28558 |
nummod |
42,d |
| R794 |
T4579 |
T4581 |
nsubj |
body,disappears |
| R7940 |
T28558 |
T28560 |
npadvmod |
d,old |
| R7941 |
T28559 |
T28558 |
punct |
-,d |
| R7942 |
T28560 |
T28550 |
conj |
old,old |
| R7943 |
T28561 |
T28560 |
punct |
-,old |
| R7944 |
T28562 |
T28563 |
punct |
(,D |
| R7945 |
T28563 |
T28542 |
parataxis |
D,mice |
| R7946 |
T28564 |
T28563 |
punct |
),D |
| R7947 |
T28565 |
T28530 |
acl |
stained,Sections |
| R7948 |
T28566 |
T28565 |
prep |
with,stained |
| R7949 |
T28567 |
T28566 |
pobj |
hematoxylin,with |
| R795 |
T4580 |
T4579 |
compound |
XY,body |
| R7950 |
T28568 |
T28567 |
cc |
and,hematoxylin |
| R7951 |
T28569 |
T28567 |
conj |
eosin,hematoxylin |
| R7952 |
T28570 |
T28530 |
punct |
.,Sections |
| R7953 |
T28572 |
T28573 |
amod |
Wild,type |
| R7954 |
T28573 |
T28575 |
nsubj |
type,is |
| R7955 |
T28574 |
T28573 |
punct |
-,type |
| R7956 |
T28576 |
T28575 |
prep |
in,is |
| R7957 |
T28577 |
T28578 |
amod |
left,column |
| R7958 |
T28578 |
T28576 |
pobj |
column,in |
| R7959 |
T28579 |
T28575 |
cc |
and,is |
| R796 |
T4492 |
T4493 |
expl |
there,is |
| R7960 |
T28580 |
T28581 |
nsubj |
mutant,in |
| R7961 |
T28581 |
T28575 |
conj |
in,is |
| R7962 |
T28582 |
T28581 |
pobj |
right,in |
| R7963 |
T28583 |
T28581 |
punct |
.,in |
| R7964 |
T28585 |
T28586 |
det |
No,difference |
| R7965 |
T28586 |
T28588 |
nsubjpass |
difference,observed |
| R7966 |
T28587 |
T28586 |
amod |
significant,difference |
| R7967 |
T28589 |
T28588 |
auxpass |
is,observed |
| R7968 |
T28590 |
T28588 |
prep |
at,observed |
| R7969 |
T28591 |
T28592 |
nummod |
14,d |
| R797 |
T4581 |
T4582 |
ccomp |
disappears,remain |
| R7970 |
T28592 |
T28590 |
pobj |
d,at |
| R7971 |
T28593 |
T28594 |
punct |
(,B |
| R7972 |
T28594 |
T28588 |
parataxis |
B,observed |
| R7973 |
T28595 |
T28594 |
punct |
),B |
| R7974 |
T28596 |
T28588 |
punct |
", ",observed |
| R7975 |
T28597 |
T28588 |
cc |
but,observed |
| R7976 |
T28598 |
T28599 |
prep |
by,lacking |
| R7977 |
T28599 |
T28588 |
conj |
lacking,observed |
| R7978 |
T28600 |
T28601 |
nummod |
21,d |
| R7979 |
T28601 |
T28598 |
pobj |
d,by |
| R798 |
T4493 |
T4479 |
conj |
is,is |
| R7980 |
T28602 |
T28603 |
det |
some,tubules |
| R7981 |
T28603 |
T28599 |
nsubj |
tubules,lacking |
| R7982 |
T28604 |
T28599 |
aux |
are,lacking |
| R7983 |
T28605 |
T28606 |
amod |
abundant,spermatocytes |
| R7984 |
T28606 |
T28599 |
dobj |
spermatocytes,lacking |
| R7985 |
T28607 |
T28608 |
punct |
(,asterisk |
| R7986 |
T28608 |
T28599 |
parataxis |
asterisk,lacking |
| R7987 |
T28609 |
T28608 |
dep |
C,asterisk |
| R7988 |
T28610 |
T28608 |
punct |
", ",asterisk |
| R7989 |
T28611 |
T28608 |
punct |
),asterisk |
| R799 |
T4583 |
T4581 |
prep |
after,disappears |
| R7990 |
T28612 |
T28599 |
cc |
or,lacking |
| R7991 |
T28613 |
T28614 |
nsubj |
cells,are |
| R7992 |
T28614 |
T28599 |
conj |
are,lacking |
| R7993 |
T28615 |
T28613 |
prep |
with,cells |
| R7994 |
T28616 |
T28617 |
amod |
typical,morphology |
| R7995 |
T28617 |
T28615 |
pobj |
morphology,with |
| R7996 |
T28618 |
T28617 |
amod |
apoptotic,morphology |
| R7997 |
T28619 |
T28614 |
acomp |
present,are |
| R7998 |
T28620 |
T28621 |
punct |
(,C |
| R7999 |
T28621 |
T28614 |
parataxis |
C,are |
| R8 |
T818 |
T815 |
amod |
Specific,Homolog |
| R80 |
T845 |
T842 |
pobj |
differentiation,in |
| R800 |
T4584 |
T4583 |
pobj |
pachynema,after |
| R8000 |
T28622 |
T28623 |
amod |
open,arrowhead |
| R8001 |
T28623 |
T28621 |
dep |
arrowhead,C |
| R8002 |
T28624 |
T28621 |
punct |
", ",C |
| R8003 |
T28625 |
T28621 |
cc |
and,C |
| R8004 |
T28626 |
T28621 |
conj |
D,C |
| R8005 |
T28627 |
T28621 |
punct |
),C |
| R8006 |
T28628 |
T28599 |
punct |
.,lacking |
| R8007 |
T28630 |
T28631 |
compound |
Mutant,tubules |
| R8008 |
T28631 |
T28632 |
nsubj |
tubules,contain |
| R8009 |
T28633 |
T28634 |
amod |
multinucleate,cells |
| R801 |
T4585 |
T4582 |
punct |
;,remain |
| R8010 |
T28634 |
T28632 |
dobj |
cells,contain |
| R8011 |
T28635 |
T28636 |
punct |
(,D |
| R8012 |
T28636 |
T28632 |
parataxis |
D,contain |
| R8013 |
T28637 |
T28638 |
amod |
closed,arrowhead |
| R8014 |
T28638 |
T28636 |
dep |
arrowhead,D |
| R8015 |
T28639 |
T28636 |
punct |
", ",D |
| R8016 |
T28640 |
T28636 |
punct |
),D |
| R8017 |
T28641 |
T28632 |
punct |
.,contain |
| R8018 |
T28643 |
T28644 |
punct |
(,E |
| R8019 |
T28644 |
T28645 |
meta |
E,labeling |
| R802 |
T4494 |
T4493 |
attr |
evidence,is |
| R8020 |
T28646 |
T28644 |
cc |
and,E |
| R8021 |
T28647 |
T28644 |
conj |
F,E |
| R8022 |
T28648 |
T28647 |
punct |
),F |
| R8023 |
T28649 |
T28645 |
compound |
TUNEL,labeling |
| R8024 |
T28650 |
T28645 |
prep |
of,labeling |
| R8025 |
T28651 |
T28652 |
npadvmod |
Dmrt7,deficient |
| R8026 |
T28652 |
T28654 |
amod |
deficient,testes |
| R8027 |
T28653 |
T28652 |
punct |
-,deficient |
| R8028 |
T28654 |
T28650 |
pobj |
testes,of |
| R8029 |
T28655 |
T28654 |
compound |
mouse,testes |
| R803 |
T4586 |
T4582 |
advmod |
however,remain |
| R8030 |
T28656 |
T28645 |
punct |
.,labeling |
| R8031 |
T28658 |
T28659 |
nsubjpass |
Testes,analyzed |
| R8032 |
T28660 |
T28658 |
prep |
from,Testes |
| R8033 |
T28661 |
T28662 |
amod |
wild,type |
| R8034 |
T28662 |
T28664 |
nmod |
type,littermates |
| R8035 |
T28663 |
T28662 |
punct |
-,type |
| R8036 |
T28664 |
T28660 |
pobj |
littermates,from |
| R8037 |
T28665 |
T28662 |
cc |
and,type |
| R8038 |
T28666 |
T28662 |
conj |
homozygous,type |
| R8039 |
T28667 |
T28664 |
compound |
mutant,littermates |
| R804 |
T4587 |
T4582 |
punct |
", ",remain |
| R8040 |
T28668 |
T28659 |
auxpass |
were,analyzed |
| R8041 |
T28669 |
T28659 |
prep |
by,analyzed |
| R8042 |
T28670 |
T28671 |
compound |
TUNEL,labeling |
| R8043 |
T28671 |
T28669 |
pobj |
labeling,by |
| R8044 |
T28672 |
T28673 |
aux |
to,detect |
| R8045 |
T28673 |
T28659 |
advcl |
detect,analyzed |
| R8046 |
T28674 |
T28675 |
amod |
apoptotic,cells |
| R8047 |
T28675 |
T28673 |
dobj |
cells,detect |
| R8048 |
T28676 |
T28659 |
punct |
.,analyzed |
| R8049 |
T28678 |
T28679 |
compound |
Testis,sections |
| R805 |
T4495 |
T4496 |
mark |
that,is |
| R8050 |
T28680 |
T28679 |
prep |
from,sections |
| R8051 |
T28681 |
T28682 |
nummod |
21,d |
| R8052 |
T28682 |
T28684 |
npadvmod |
d,old |
| R8053 |
T28683 |
T28682 |
punct |
-,d |
| R8054 |
T28684 |
T28686 |
amod |
old,mice |
| R8055 |
T28685 |
T28684 |
punct |
-,old |
| R8056 |
T28686 |
T28680 |
pobj |
mice,from |
| R8057 |
T28687 |
T28688 |
punct |
(,E |
| R8058 |
T28688 |
T28684 |
parataxis |
E,old |
| R8059 |
T28689 |
T28688 |
punct |
),E |
| R806 |
T4496 |
T4494 |
acl |
is,evidence |
| R8060 |
T28690 |
T28684 |
cc |
and,old |
| R8061 |
T28691 |
T28692 |
nummod |
6,wk |
| R8062 |
T28692 |
T28694 |
npadvmod |
wk,old |
| R8063 |
T28693 |
T28692 |
punct |
-,wk |
| R8064 |
T28694 |
T28684 |
conj |
old,old |
| R8065 |
T28695 |
T28694 |
punct |
-,old |
| R8066 |
T28696 |
T28697 |
punct |
(,F |
| R8067 |
T28697 |
T28686 |
parataxis |
F,mice |
| R8068 |
T28698 |
T28697 |
punct |
),F |
| R8069 |
T28699 |
T28679 |
punct |
.,sections |
| R807 |
T4588 |
T4589 |
amod |
many,genes |
| R8070 |
T28701 |
T28702 |
amod |
Apoptotic,cells |
| R8071 |
T28702 |
T28703 |
nsubj |
cells,are |
| R8072 |
T28704 |
T28705 |
punct |
(,brown |
| R8073 |
T28705 |
T28702 |
parataxis |
brown,cells |
| R8074 |
T28706 |
T28705 |
punct |
),brown |
| R8075 |
T28707 |
T28708 |
advmod |
much,more |
| R8076 |
T28708 |
T28709 |
advmod |
more,abundant |
| R8077 |
T28709 |
T28703 |
acomp |
abundant,are |
| R8078 |
T28710 |
T28703 |
prep |
in,are |
| R8079 |
T28711 |
T28712 |
amod |
seminiferous,tubules |
| R808 |
T4589 |
T4582 |
nsubj |
genes,remain |
| R8080 |
T28712 |
T28710 |
pobj |
tubules,in |
| R8081 |
T28713 |
T28712 |
prep |
of,tubules |
| R8082 |
T28714 |
T28715 |
amod |
homozygous,mice |
| R8083 |
T28715 |
T28713 |
pobj |
mice,of |
| R8084 |
T28716 |
T28717 |
compound |
Dmrt7,mutant |
| R8085 |
T28717 |
T28715 |
compound |
mutant,mice |
| R8086 |
T28718 |
T28703 |
advcl |
relative,are |
| R8087 |
T28719 |
T28718 |
prep |
to,relative |
| R8088 |
T28720 |
T28721 |
amod |
wild,type |
| R8089 |
T28721 |
T28719 |
pobj |
type,to |
| R809 |
T4497 |
T4496 |
nsubj |
it,is |
| R8090 |
T28722 |
T28721 |
punct |
-,type |
| R8091 |
T28723 |
T28703 |
punct |
.,are |
| R8092 |
T28725 |
T28726 |
nsubj |
Bars,represent |
| R8093 |
T28727 |
T28725 |
prep |
in,Bars |
| R8094 |
T28728 |
T28729 |
punct |
(,B |
| R8095 |
T28729 |
T28727 |
pobj |
B,in |
| R8096 |
T28730 |
T28731 |
punct |
–,F |
| R8097 |
T28731 |
T28729 |
prep |
F,B |
| R8098 |
T28732 |
T28726 |
punct |
),represent |
| R8099 |
T28733 |
T28734 |
nummod |
100,μm |
| R81 |
T966 |
T967 |
prep |
In,appear |
| R810 |
T4590 |
T4591 |
npadvmod |
sex,linked |
| R8100 |
T28734 |
T28726 |
dobj |
μm,represent |
| R8101 |
T28735 |
T28726 |
punct |
.,represent |
| R8102 |
T28985 |
T28986 |
nmod |
Prophase,Arrest |
| R8103 |
T28987 |
T28985 |
nummod |
I,Prophase |
| R8104 |
T28988 |
T28986 |
prep |
of,Arrest |
| R8105 |
T28989 |
T28990 |
compound |
Dmrt7,Mutant |
| R8106 |
T28990 |
T28991 |
compound |
Mutant,Cells |
| R8107 |
T28991 |
T28988 |
pobj |
Cells,of |
| R8108 |
T28992 |
T28991 |
compound |
Germ,Cells |
| R8109 |
T28994 |
T28995 |
compound |
Testis,sections |
| R811 |
T4591 |
T4589 |
amod |
linked,genes |
| R8110 |
T28996 |
T28995 |
prep |
from,sections |
| R8111 |
T28997 |
T28998 |
nummod |
6,wk |
| R8112 |
T28998 |
T29000 |
npadvmod |
wk,old |
| R8113 |
T28999 |
T28998 |
punct |
-,wk |
| R8114 |
T29000 |
T29002 |
amod |
old,littermates |
| R8115 |
T29001 |
T29000 |
punct |
-,old |
| R8116 |
T29002 |
T28996 |
pobj |
littermates,from |
| R8117 |
T29003 |
T29004 |
amod |
wild,type |
| R8118 |
T29004 |
T29002 |
nmod |
type,littermates |
| R8119 |
T29005 |
T29004 |
punct |
-,type |
| R812 |
T4498 |
T4496 |
acomp |
essential,is |
| R8120 |
T29006 |
T29007 |
punct |
(,+ |
| R8121 |
T29007 |
T29004 |
punct |
+,type |
| R8122 |
T29008 |
T29007 |
punct |
+,+ |
| R8123 |
T29009 |
T29007 |
punct |
/,+ |
| R8124 |
T29010 |
T29007 |
punct |
),+ |
| R8125 |
T29011 |
T29004 |
cc |
and,type |
| R8126 |
T29012 |
T29013 |
compound |
Dmrt7,mutant |
| R8127 |
T29013 |
T29004 |
conj |
mutant,type |
| R8128 |
T29014 |
T29015 |
punct |
(,− |
| R8129 |
T29015 |
T29013 |
punct |
−,mutant |
| R813 |
T4592 |
T4591 |
punct |
-,linked |
| R8130 |
T29016 |
T29015 |
punct |
−,− |
| R8131 |
T29017 |
T29015 |
punct |
/,− |
| R8132 |
T29018 |
T29015 |
punct |
),− |
| R8133 |
T29019 |
T28995 |
acl |
stained,sections |
| R8134 |
T29020 |
T29019 |
prep |
with,stained |
| R8135 |
T29021 |
T29022 |
npadvmod |
stage,specific |
| R8136 |
T29022 |
T29024 |
amod |
specific,antibodies |
| R8137 |
T29023 |
T29022 |
punct |
-,specific |
| R8138 |
T29024 |
T29020 |
pobj |
antibodies,with |
| R8139 |
T29025 |
T29024 |
amod |
specific,antibodies |
| R814 |
T4593 |
T4594 |
advmod |
transcriptionally,silent |
| R8140 |
T29026 |
T29025 |
prep |
to,specific |
| R8141 |
T29027 |
T29028 |
amod |
spermatogenic,cells |
| R8142 |
T29028 |
T29026 |
pobj |
cells,to |
| R8143 |
T29029 |
T28995 |
punct |
.,sections |
| R8144 |
T29031 |
T29032 |
punct |
(,A |
| R8145 |
T29032 |
T29033 |
meta |
A,stains |
| R8146 |
T29034 |
T29032 |
punct |
),A |
| R8147 |
T29035 |
T29036 |
compound |
TRA98,antibody |
| R8148 |
T29036 |
T29033 |
nsubj |
antibody,stains |
| R8149 |
T29037 |
T29033 |
advmod |
strongly,stains |
| R815 |
T4594 |
T4582 |
acomp |
silent,remain |
| R8150 |
T29038 |
T29033 |
dobj |
spermatogonia,stains |
| R8151 |
T29039 |
T29038 |
punct |
", ",spermatogonia |
| R8152 |
T29040 |
T29041 |
dep |
which,are |
| R8153 |
T29041 |
T29038 |
relcl |
are,spermatogonia |
| R8154 |
T29042 |
T29041 |
acomp |
present,are |
| R8155 |
T29043 |
T29041 |
prep |
in,are |
| R8156 |
T29044 |
T29045 |
amod |
wild,type |
| R8157 |
T29045 |
T29043 |
pobj |
type,in |
| R8158 |
T29046 |
T29045 |
punct |
-,type |
| R8159 |
T29047 |
T29045 |
cc |
and,type |
| R816 |
T4499 |
T4498 |
prep |
for,essential |
| R8160 |
T29048 |
T29045 |
conj |
mutant,type |
| R8161 |
T29049 |
T29033 |
punct |
.,stains |
| R8162 |
T29051 |
T29052 |
punct |
(,B |
| R8163 |
T29052 |
T29053 |
meta |
B,stains |
| R8164 |
T29054 |
T29052 |
punct |
),B |
| R8165 |
T29055 |
T29056 |
compound |
BC7,antibody |
| R8166 |
T29056 |
T29053 |
nsubj |
antibody,stains |
| R8167 |
T29057 |
T29053 |
dobj |
spermatocytes,stains |
| R8168 |
T29058 |
T29057 |
punct |
", ",spermatocytes |
| R8169 |
T29059 |
T29060 |
dep |
which,are |
| R817 |
T4595 |
T4582 |
prep |
into,remain |
| R8170 |
T29060 |
T29057 |
relcl |
are,spermatocytes |
| R8171 |
T29061 |
T29060 |
acomp |
present,are |
| R8172 |
T29062 |
T29060 |
prep |
in,are |
| R8173 |
T29063 |
T29064 |
amod |
wild,type |
| R8174 |
T29064 |
T29062 |
pobj |
type,in |
| R8175 |
T29065 |
T29064 |
punct |
-,type |
| R8176 |
T29066 |
T29064 |
cc |
and,type |
| R8177 |
T29067 |
T29064 |
conj |
mutant,type |
| R8178 |
T29068 |
T29053 |
punct |
.,stains |
| R8179 |
T29070 |
T29071 |
punct |
(,C |
| R818 |
T4596 |
T4595 |
pobj |
spermiogenesis,into |
| R8180 |
T29071 |
T29072 |
meta |
C,stains |
| R8181 |
T29073 |
T29071 |
punct |
),C |
| R8182 |
T29074 |
T29075 |
compound |
TRA369,antibody |
| R8183 |
T29075 |
T29072 |
nsubj |
antibody,stains |
| R8184 |
T29076 |
T29077 |
nmod |
pachytene,cells |
| R8185 |
T29077 |
T29072 |
dobj |
cells,stains |
| R8186 |
T29078 |
T29076 |
cc |
and,pachytene |
| R8187 |
T29079 |
T29076 |
conj |
later,pachytene |
| R8188 |
T29080 |
T29077 |
compound |
germ,cells |
| R8189 |
T29081 |
T29077 |
punct |
", ",cells |
| R819 |
T4500 |
T4501 |
amod |
male,progression |
| R8190 |
T29082 |
T29083 |
dep |
which,are |
| R8191 |
T29083 |
T29077 |
relcl |
are,cells |
| R8192 |
T29084 |
T29085 |
advmod |
severely,deficient |
| R8193 |
T29085 |
T29083 |
acomp |
deficient,are |
| R8194 |
T29086 |
T29083 |
prep |
in,are |
| R8195 |
T29087 |
T29088 |
det |
the,testis |
| R8196 |
T29088 |
T29086 |
pobj |
testis,in |
| R8197 |
T29089 |
T29088 |
compound |
mutant,testis |
| R8198 |
T29090 |
T29072 |
punct |
.,stains |
| R82 |
T846 |
T841 |
prep |
between,differences |
| R820 |
T4597 |
T4598 |
punct |
[,16 |
| R8201 |
T29241 |
T29240 |
prep |
of,Profile |
| R8202 |
T29242 |
T29243 |
amod |
Meiotic,Arrest |
| R8203 |
T29243 |
T29241 |
pobj |
Arrest,of |
| R8204 |
T29244 |
T29240 |
prep |
in,Profile |
| R8205 |
T29245 |
T29246 |
compound |
Dmrt7,Mutant |
| R8206 |
T29246 |
T29247 |
compound |
Mutant,Testis |
| R8207 |
T29247 |
T29244 |
pobj |
Testis,in |
| R8208 |
T29250 |
T29249 |
prep |
of,Graph |
| R8209 |
T29251 |
T29250 |
pobj |
distribution,of |
| R821 |
T4598 |
T4582 |
parataxis |
16,remain |
| R8210 |
T29252 |
T29251 |
prep |
of,distribution |
| R8211 |
T29253 |
T29254 |
amod |
meiotic,stages |
| R8212 |
T29254 |
T29252 |
pobj |
stages,of |
| R8213 |
T29255 |
T29254 |
prep |
of,stages |
| R8214 |
T29256 |
T29257 |
compound |
germ,cells |
| R8215 |
T29257 |
T29255 |
pobj |
cells,of |
| R8216 |
T29258 |
T29251 |
prep |
from,distribution |
| R8217 |
T29259 |
T29260 |
amod |
heterozygous,mutant |
| R8218 |
T29260 |
T29268 |
nmod |
mutant,testes |
| R8219 |
T29261 |
T29262 |
punct |
(,"1,970" |
| R822 |
T4599 |
T4598 |
punct |
],16 |
| R8220 |
T29262 |
T29259 |
parataxis |
"1,970",heterozygous |
| R8221 |
T29263 |
T29262 |
nsubj |
n,"1,970" |
| R8222 |
T29264 |
T29262 |
punct |
=,"1,970" |
| R8223 |
T29265 |
T29262 |
punct |
),"1,970" |
| R8224 |
T29266 |
T29259 |
cc |
and,heterozygous |
| R8225 |
T29267 |
T29259 |
conj |
homozygous,heterozygous |
| R8226 |
T29268 |
T29258 |
pobj |
testes,from |
| R8227 |
T29269 |
T29270 |
punct |
(,"2,084" |
| R8228 |
T29270 |
T29260 |
parataxis |
"2,084",mutant |
| R8229 |
T29271 |
T29270 |
nsubj |
n,"2,084" |
| R823 |
T4501 |
T4499 |
pobj |
progression,for |
| R8230 |
T29272 |
T29270 |
punct |
=,"2,084" |
| R8231 |
T29273 |
T29270 |
punct |
),"2,084" |
| R8232 |
T29274 |
T29268 |
compound |
P26,testes |
| R8233 |
T29275 |
T29249 |
punct |
", ",Graph |
| R8234 |
T29276 |
T29249 |
acl |
spread,Graph |
| R8235 |
T29277 |
T29276 |
cc |
and,spread |
| R8236 |
T29278 |
T29276 |
conj |
stained,spread |
| R8237 |
T29279 |
T29278 |
prep |
for,stained |
| R8238 |
T29280 |
T29281 |
det |
the,SYCP3 |
| R8239 |
T29281 |
T29279 |
pobj |
SYCP3,for |
| R824 |
T4600 |
T4582 |
punct |
.,remain |
| R8240 |
T29282 |
T29281 |
amod |
synaptonemal,SYCP3 |
| R8241 |
T29283 |
T29284 |
compound |
complex,protein |
| R8242 |
T29284 |
T29281 |
compound |
protein,SYCP3 |
| R8243 |
T29285 |
T29286 |
aux |
to,permit |
| R8244 |
T29286 |
T29278 |
advcl |
permit,stained |
| R8245 |
T29287 |
T29288 |
amod |
precise,staging |
| R8246 |
T29288 |
T29286 |
dobj |
staging,permit |
| R8247 |
T29289 |
T29288 |
punct |
", ",staging |
| R8248 |
T29290 |
T29291 |
dep |
which,performed |
| R8249 |
T29291 |
T29288 |
relcl |
performed,staging |
| R825 |
T4602 |
T4603 |
det |
This,maintenance |
| R8250 |
T29292 |
T29291 |
auxpass |
was,performed |
| R8251 |
T29293 |
T29294 |
mark |
as,described |
| R8252 |
T29294 |
T29291 |
advcl |
described,performed |
| R8253 |
T29295 |
T29296 |
punct |
[,65 |
| R8254 |
T29296 |
T29278 |
parataxis |
65,stained |
| R8255 |
T29297 |
T29296 |
nummod |
64,65 |
| R8256 |
T29298 |
T29296 |
punct |
",",65 |
| R8257 |
T29299 |
T29296 |
punct |
],65 |
| R8258 |
T29300 |
T29249 |
punct |
.,Graph |
| R8259 |
T29623 |
T29624 |
amod |
Normal,Synapsis |
| R826 |
T4502 |
T4501 |
amod |
meiotic,progression |
| R8260 |
T29625 |
T29624 |
cc |
and,Synapsis |
| R8261 |
T29626 |
T29624 |
conj |
Recombination,Synapsis |
| R8262 |
T29627 |
T29624 |
prep |
in,Synapsis |
| R8263 |
T29628 |
T29629 |
compound |
Dmrt7,Mutant |
| R8264 |
T29629 |
T29630 |
compound |
Mutant,Cells |
| R8265 |
T29630 |
T29627 |
pobj |
Cells,in |
| R8266 |
T29631 |
T29630 |
compound |
Germ,Cells |
| R8267 |
T29633 |
T29634 |
punct |
(,A |
| R8268 |
T29634 |
T29635 |
meta |
A,spread |
| R8269 |
T29636 |
T29634 |
punct |
),A |
| R827 |
T4603 |
T4604 |
nsubjpass |
maintenance,associated |
| R8270 |
T29637 |
T29638 |
amod |
Testicular,cells |
| R8271 |
T29638 |
T29635 |
nsubjpass |
cells,spread |
| R8272 |
T29639 |
T29638 |
prep |
from,cells |
| R8273 |
T29640 |
T29641 |
nmod |
Dmrt7,mutant |
| R8274 |
T29641 |
T29655 |
compound |
mutant,mice |
| R8275 |
T29642 |
T29641 |
amod |
heterozygous,mutant |
| R8276 |
T29643 |
T29644 |
punct |
(,− |
| R8277 |
T29644 |
T29642 |
punct |
−,heterozygous |
| R8278 |
T29645 |
T29644 |
punct |
+,− |
| R8279 |
T29646 |
T29644 |
punct |
/,− |
| R828 |
T4503 |
T4504 |
punct |
[,12 |
| R8280 |
T29647 |
T29644 |
punct |
),− |
| R8281 |
T29648 |
T29642 |
cc |
or,heterozygous |
| R8282 |
T29649 |
T29642 |
conj |
homozygous,heterozygous |
| R8283 |
T29650 |
T29651 |
punct |
(,− |
| R8284 |
T29651 |
T29649 |
punct |
−,homozygous |
| R8285 |
T29652 |
T29651 |
punct |
−,− |
| R8286 |
T29653 |
T29651 |
punct |
/,− |
| R8287 |
T29654 |
T29651 |
punct |
),− |
| R8288 |
T29655 |
T29639 |
pobj |
mice,from |
| R8289 |
T29656 |
T29635 |
auxpass |
were,spread |
| R829 |
T4605 |
T4603 |
prep |
of,maintenance |
| R8290 |
T29657 |
T29635 |
cc |
and,spread |
| R8291 |
T29658 |
T29635 |
conj |
stained,spread |
| R8292 |
T29659 |
T29658 |
prep |
with,stained |
| R8293 |
T29660 |
T29659 |
pobj |
antibody,with |
| R8294 |
T29661 |
T29660 |
prep |
to,antibody |
| R8295 |
T29662 |
T29661 |
pobj |
SYCP3,to |
| R8296 |
T29663 |
T29664 |
punct |
(,red |
| R8297 |
T29664 |
T29658 |
parataxis |
red,stained |
| R8298 |
T29665 |
T29664 |
punct |
),red |
| R8299 |
T29666 |
T29635 |
punct |
.,spread |
| R83 |
T968 |
T969 |
compound |
Dmrt7,mutants |
| R830 |
T4606 |
T4605 |
pobj |
silencing,of |
| R8300 |
T29668 |
T29669 |
det |
The,stages |
| R8301 |
T29669 |
T29671 |
nsubjpass |
stages,indicated |
| R8302 |
T29670 |
T29669 |
amod |
developmental,stages |
| R8303 |
T29672 |
T29669 |
prep |
of,stages |
| R8304 |
T29673 |
T29674 |
amod |
meiotic,prophase |
| R8305 |
T29674 |
T29672 |
pobj |
prophase,of |
| R8306 |
T29675 |
T29669 |
prep |
based,stages |
| R8307 |
T29676 |
T29675 |
prep |
on,based |
| R8308 |
T29677 |
T29678 |
compound |
SYCP3,organization |
| R8309 |
T29678 |
T29676 |
pobj |
organization,on |
| R831 |
T4607 |
T4604 |
auxpass |
is,associated |
| R8310 |
T29679 |
T29671 |
auxpass |
are,indicated |
| R8311 |
T29680 |
T29671 |
prep |
in,indicated |
| R8312 |
T29681 |
T29682 |
det |
each,panel |
| R8313 |
T29682 |
T29680 |
pobj |
panel,in |
| R8314 |
T29683 |
T29671 |
punct |
.,indicated |
| R8315 |
T29685 |
T29686 |
prep |
By,synapsed |
| R8316 |
T29687 |
T29685 |
pobj |
pachynema,By |
| R8317 |
T29688 |
T29686 |
punct |
", ",synapsed |
| R8318 |
T29689 |
T29690 |
det |
all,autosomes |
| R8319 |
T29690 |
T29686 |
nsubjpass |
autosomes,synapsed |
| R832 |
T4504 |
T4493 |
parataxis |
12,is |
| R8320 |
T29691 |
T29686 |
auxpass |
are,synapsed |
| R8321 |
T29692 |
T29686 |
advmod |
fully,synapsed |
| R8322 |
T29693 |
T29686 |
punct |
", ",synapsed |
| R8323 |
T29694 |
T29686 |
cc |
and,synapsed |
| R8324 |
T29695 |
T29696 |
det |
the,XY |
| R8325 |
T29696 |
T29697 |
nsubjpass |
XY,synapsed |
| R8326 |
T29697 |
T29686 |
conj |
synapsed,synapsed |
| R8327 |
T29698 |
T29696 |
amod |
bivalent,XY |
| R8328 |
T29699 |
T29697 |
auxpass |
is,synapsed |
| R8329 |
T29700 |
T29701 |
advmod |
only,at |
| R833 |
T4608 |
T4604 |
prep |
with,associated |
| R8330 |
T29701 |
T29697 |
prep |
at,synapsed |
| R8331 |
T29702 |
T29703 |
det |
the,region |
| R8332 |
T29703 |
T29701 |
pobj |
region,at |
| R8333 |
T29704 |
T29703 |
amod |
pseudoautosomal,region |
| R8334 |
T29705 |
T29697 |
prep |
in,synapsed |
| R8335 |
T29706 |
T29707 |
preconj |
both,type |
| R8336 |
T29707 |
T29710 |
nmod |
type,cells |
| R8337 |
T29708 |
T29707 |
amod |
wild,type |
| R8338 |
T29709 |
T29707 |
punct |
-,type |
| R8339 |
T29710 |
T29705 |
pobj |
cells,in |
| R834 |
T4609 |
T4610 |
det |
a,set |
| R8340 |
T29711 |
T29707 |
cc |
and,type |
| R8341 |
T29712 |
T29707 |
conj |
mutant,type |
| R8342 |
T29713 |
T29686 |
punct |
.,synapsed |
| R8343 |
T29715 |
T29716 |
punct |
(,B |
| R8344 |
T29716 |
T29717 |
meta |
B,cells |
| R8345 |
T29718 |
T29716 |
punct |
),B |
| R8346 |
T29719 |
T29717 |
amod |
Testicular,cells |
| R8347 |
T29720 |
T29717 |
prep |
in,cells |
| R8348 |
T29721 |
T29720 |
pobj |
zygonema,in |
| R8349 |
T29722 |
T29721 |
cc |
and,zygonema |
| R835 |
T4505 |
T4504 |
punct |
],12 |
| R8350 |
T29723 |
T29721 |
conj |
pachynema,zygonema |
| R8351 |
T29724 |
T29717 |
acl |
spread,cells |
| R8352 |
T29725 |
T29724 |
cc |
and,spread |
| R8353 |
T29726 |
T29724 |
conj |
stained,spread |
| R8354 |
T29727 |
T29726 |
prep |
with,stained |
| R8355 |
T29728 |
T29727 |
pobj |
antibodies,with |
| R8356 |
T29729 |
T29728 |
prep |
to,antibodies |
| R8357 |
T29730 |
T29729 |
pobj |
RAD51,to |
| R8358 |
T29731 |
T29732 |
punct |
(,green |
| R8359 |
T29732 |
T29730 |
parataxis |
green,RAD51 |
| R836 |
T4610 |
T4608 |
pobj |
set,with |
| R8360 |
T29733 |
T29732 |
punct |
),green |
| R8361 |
T29734 |
T29730 |
cc |
and,RAD51 |
| R8362 |
T29735 |
T29730 |
conj |
SYCP3,RAD51 |
| R8363 |
T29736 |
T29737 |
punct |
(,red |
| R8364 |
T29737 |
T29735 |
parataxis |
red,SYCP3 |
| R8365 |
T29738 |
T29737 |
punct |
),red |
| R8366 |
T29739 |
T29717 |
punct |
.,cells |
| R8367 |
T29741 |
T29742 |
nsubj |
Size,are |
| R8368 |
T29743 |
T29741 |
cc |
and,Size |
| R8369 |
T29744 |
T29741 |
conj |
distribution,Size |
| R837 |
T4611 |
T4610 |
amod |
distinct,set |
| R8370 |
T29745 |
T29741 |
prep |
of,Size |
| R8371 |
T29746 |
T29747 |
compound |
RAD51,foci |
| R8372 |
T29747 |
T29745 |
pobj |
foci,of |
| R8373 |
T29748 |
T29742 |
acomp |
similar,are |
| R8374 |
T29749 |
T29742 |
prep |
between,are |
| R8375 |
T29750 |
T29751 |
amod |
wild,type |
| R8376 |
T29751 |
T29753 |
nmod |
type,spermatocytes |
| R8377 |
T29752 |
T29751 |
punct |
-,type |
| R8378 |
T29753 |
T29749 |
pobj |
spermatocytes,between |
| R8379 |
T29754 |
T29751 |
cc |
and,type |
| R838 |
T4612 |
T4610 |
prep |
of,set |
| R8380 |
T29755 |
T29751 |
conj |
mutant,type |
| R8381 |
T29756 |
T29742 |
punct |
.,are |
| R8382 |
T30296 |
T30297 |
amod |
Abnormal,Organization |
| R8383 |
T30298 |
T30299 |
compound |
Sertoli,Cell |
| R8384 |
T30299 |
T30297 |
compound |
Cell,Organization |
| R8385 |
T30300 |
T30297 |
prep |
in,Organization |
| R8386 |
T30301 |
T30302 |
compound |
Dmrt7,Mutant |
| R8387 |
T30302 |
T30303 |
compound |
Mutant,Testes |
| R8388 |
T30303 |
T30300 |
pobj |
Testes,in |
| R8389 |
T30305 |
T30306 |
punct |
(,A |
| R839 |
T4613 |
T4614 |
compound |
chromatin,marks |
| R8390 |
T30306 |
T30307 |
meta |
A,sectioned |
| R8391 |
T30308 |
T30306 |
punct |
),A |
| R8392 |
T30309 |
T30307 |
nsubjpass |
Testes,sectioned |
| R8393 |
T30310 |
T30309 |
prep |
from,Testes |
| R8394 |
T30311 |
T30312 |
nmod |
P14,mice |
| R8395 |
T30312 |
T30310 |
pobj |
mice,from |
| R8396 |
T30313 |
T30314 |
amod |
wild,type |
| R8397 |
T30314 |
T30312 |
nmod |
type,mice |
| R8398 |
T30315 |
T30314 |
punct |
-,type |
| R8399 |
T30316 |
T30314 |
cc |
and,type |
| R84 |
T969 |
T966 |
pobj |
mutants,In |
| R840 |
T4614 |
T4612 |
pobj |
marks,of |
| R8400 |
T30317 |
T30314 |
conj |
Dmrt7,type |
| R8401 |
T30318 |
T30312 |
compound |
mutant,mice |
| R8402 |
T30319 |
T30307 |
auxpass |
were,sectioned |
| R8403 |
T30320 |
T30307 |
cc |
and,sectioned |
| R8404 |
T30321 |
T30307 |
conj |
stained,sectioned |
| R8405 |
T30322 |
T30321 |
prep |
with,stained |
| R8406 |
T30323 |
T30322 |
pobj |
antibody,with |
| R8407 |
T30324 |
T30323 |
prep |
to,antibody |
| R8408 |
T30325 |
T30324 |
pobj |
GATA4,to |
| R8409 |
T30326 |
T30307 |
punct |
.,sectioned |
| R841 |
T4506 |
T4493 |
punct |
.,is |
| R8410 |
T30328 |
T30329 |
punct |
(,B |
| R8411 |
T30329 |
T30330 |
meta |
B,sections |
| R8412 |
T30331 |
T30329 |
punct |
),B |
| R8413 |
T30332 |
T30330 |
compound |
P14,sections |
| R8414 |
T30333 |
T30330 |
compound |
testis,sections |
| R8415 |
T30334 |
T30330 |
acl |
stained,sections |
| R8416 |
T30335 |
T30334 |
prep |
with,stained |
| R8417 |
T30336 |
T30335 |
pobj |
antibody,with |
| R8418 |
T30337 |
T30336 |
prep |
to,antibody |
| R8419 |
T30338 |
T30337 |
pobj |
GATA1,to |
| R842 |
T4615 |
T4616 |
dep |
that,define |
| R8420 |
T30339 |
T30330 |
punct |
.,sections |
| R8421 |
T30341 |
T30342 |
prep |
At,are |
| R8422 |
T30343 |
T30341 |
pobj |
P14,At |
| R8423 |
T30344 |
T30342 |
punct |
", ",are |
| R8424 |
T30345 |
T30346 |
nmod |
GATA4,levels |
| R8425 |
T30346 |
T30342 |
nsubj |
levels,are |
| R8426 |
T30347 |
T30345 |
cc |
and,GATA4 |
| R8427 |
T30348 |
T30345 |
conj |
GATA1,GATA4 |
| R8428 |
T30349 |
T30342 |
acomp |
similar,are |
| R8429 |
T30350 |
T30342 |
prep |
in,are |
| R843 |
T4616 |
T4610 |
relcl |
define,set |
| R8430 |
T30351 |
T30352 |
amod |
wild,type |
| R8431 |
T30352 |
T30354 |
nmod |
type,cell |
| R8432 |
T30353 |
T30352 |
punct |
-,type |
| R8433 |
T30354 |
T30350 |
pobj |
cell,in |
| R8434 |
T30355 |
T30352 |
cc |
and,type |
| R8435 |
T30356 |
T30352 |
conj |
mutant,type |
| R8436 |
T30357 |
T30354 |
compound |
Sertoli,cell |
| R8437 |
T30358 |
T30342 |
punct |
.,are |
| R8438 |
T30360 |
T30361 |
punct |
(,C |
| R8439 |
T30361 |
T30362 |
meta |
C,sections |
| R844 |
T4617 |
T4618 |
det |
a,domain |
| R8440 |
T30363 |
T30361 |
punct |
),C |
| R8441 |
T30364 |
T30365 |
amod |
Wild,type |
| R8442 |
T30365 |
T30362 |
nmod |
type,sections |
| R8443 |
T30366 |
T30365 |
punct |
-,type |
| R8444 |
T30367 |
T30365 |
cc |
and,type |
| R8445 |
T30368 |
T30365 |
conj |
mutant,type |
| R8446 |
T30369 |
T30362 |
compound |
testis,sections |
| R8447 |
T30370 |
T30371 |
advmod |
double,stained |
| R8448 |
T30371 |
T30362 |
acl |
stained,sections |
| R8449 |
T30372 |
T30371 |
punct |
-,stained |
| R845 |
T4508 |
T4509 |
amod |
Several,proteins |
| R8450 |
T30373 |
T30371 |
prep |
with,stained |
| R8451 |
T30374 |
T30373 |
pobj |
antibody,with |
| R8452 |
T30375 |
T30374 |
prep |
to,antibody |
| R8453 |
T30376 |
T30375 |
pobj |
GATA1,to |
| R8454 |
T30377 |
T30378 |
punct |
(,red |
| R8455 |
T30378 |
T30376 |
parataxis |
red,GATA1 |
| R8456 |
T30379 |
T30378 |
punct |
),red |
| R8457 |
T30380 |
T30376 |
cc |
and,GATA1 |
| R8458 |
T30381 |
T30376 |
conj |
DAPI,GATA1 |
| R8459 |
T30382 |
T30383 |
punct |
(,blue |
| R846 |
T4618 |
T4616 |
dobj |
domain,define |
| R8460 |
T30383 |
T30381 |
parataxis |
blue,DAPI |
| R8461 |
T30384 |
T30383 |
punct |
),blue |
| R8462 |
T30385 |
T30362 |
punct |
.,sections |
| R8463 |
T30387 |
T30388 |
amod |
Most,nuclei |
| R8464 |
T30388 |
T30391 |
nsubj |
nuclei,were |
| R8465 |
T30389 |
T30390 |
compound |
Sertoli,cell |
| R8466 |
T30390 |
T30388 |
compound |
cell,nuclei |
| R8467 |
T30392 |
T30391 |
acomp |
adjacent,were |
| R8468 |
T30393 |
T30392 |
prep |
to,adjacent |
| R8469 |
T30394 |
T30395 |
det |
the,membrane |
| R847 |
T4619 |
T4618 |
compound |
sex,domain |
| R8470 |
T30395 |
T30393 |
pobj |
membrane,to |
| R8471 |
T30396 |
T30395 |
amod |
basal,membrane |
| R8472 |
T30397 |
T30391 |
prep |
in,were |
| R8473 |
T30398 |
T30399 |
amod |
wild,type |
| R8474 |
T30399 |
T30397 |
pobj |
type,in |
| R8475 |
T30400 |
T30399 |
punct |
-,type |
| R8476 |
T30401 |
T30391 |
punct |
", ",were |
| R8477 |
T30402 |
T30391 |
cc |
but,were |
| R8478 |
T30403 |
T30404 |
compound |
mutant,cells |
| R8479 |
T30404 |
T30406 |
nsubjpass |
cells,displaced |
| R848 |
T4509 |
T4510 |
nsubjpass |
proteins,reported |
| R8480 |
T30405 |
T30404 |
compound |
Sertoli,cells |
| R8481 |
T30406 |
T30391 |
conj |
displaced,were |
| R8482 |
T30407 |
T30406 |
auxpass |
were,displaced |
| R8483 |
T30408 |
T30406 |
prep |
in,displaced |
| R8484 |
T30409 |
T30410 |
det |
some,tubules |
| R8485 |
T30410 |
T30408 |
pobj |
tubules,in |
| R8486 |
T30411 |
T30412 |
punct |
(,arrowhead |
| R8487 |
T30412 |
T30406 |
parataxis |
arrowhead,displaced |
| R8488 |
T30413 |
T30412 |
punct |
),arrowhead |
| R8489 |
T30414 |
T30406 |
punct |
.,displaced |
| R849 |
T4620 |
T4618 |
compound |
chromatin,domain |
| R8490 |
T30416 |
T30417 |
amod |
White,line |
| R8491 |
T30417 |
T30419 |
nsubj |
line,indicates |
| R8492 |
T30418 |
T30417 |
amod |
dotted,line |
| R8493 |
T30420 |
T30419 |
dobj |
position,indicates |
| R8494 |
T30421 |
T30420 |
prep |
of,position |
| R8495 |
T30422 |
T30423 |
amod |
basal,membranes |
| R8496 |
T30423 |
T30421 |
pobj |
membranes,of |
| R8497 |
T30424 |
T30419 |
punct |
.,indicates |
| R8498 |
T30426 |
T30427 |
punct |
(,D |
| R8499 |
T30427 |
T30428 |
meta |
D,sections |
| R85 |
T847 |
T848 |
det |
the,sexes |
| R850 |
T4621 |
T4618 |
acl |
termed,domain |
| R8500 |
T30429 |
T30427 |
punct |
),D |
| R8501 |
T30430 |
T30428 |
compound |
Testis,sections |
| R8502 |
T30431 |
T30428 |
prep |
from,sections |
| R8503 |
T30432 |
T30433 |
nummod |
10,wk |
| R8504 |
T30433 |
T30435 |
npadvmod |
wk,old |
| R8505 |
T30434 |
T30433 |
punct |
-,wk |
| R8506 |
T30435 |
T30437 |
amod |
old,mice |
| R8507 |
T30436 |
T30435 |
punct |
-,old |
| R8508 |
T30437 |
T30431 |
pobj |
mice,from |
| R8509 |
T30438 |
T30439 |
amod |
wild,type |
| R851 |
T4622 |
T4623 |
amod |
postmeiotic,chromatin |
| R8510 |
T30439 |
T30437 |
nmod |
type,mice |
| R8511 |
T30440 |
T30439 |
punct |
-,type |
| R8512 |
T30441 |
T30439 |
cc |
and,type |
| R8513 |
T30442 |
T30443 |
compound |
Sertoli,cell |
| R8514 |
T30443 |
T30444 |
npadvmod |
cell,specific |
| R8515 |
T30444 |
T30446 |
amod |
specific,mutant |
| R8516 |
T30445 |
T30444 |
punct |
-,specific |
| R8517 |
T30446 |
T30439 |
conj |
mutant,type |
| R8518 |
T30447 |
T30446 |
compound |
Dmrt7,mutant |
| R8519 |
T30448 |
T30446 |
punct |
(,mutant |
| R852 |
T4511 |
T4510 |
auxpass |
are,reported |
| R8520 |
T30449 |
T30450 |
compound |
SC,Dmrt7KO |
| R8521 |
T30450 |
T30446 |
appos |
Dmrt7KO,mutant |
| R8522 |
T30451 |
T30450 |
punct |
-,Dmrt7KO |
| R8523 |
T30452 |
T30437 |
punct |
),mice |
| R8524 |
T30453 |
T30428 |
acl |
stained,sections |
| R8525 |
T30454 |
T30453 |
prep |
with,stained |
| R8526 |
T30455 |
T30454 |
pobj |
hematoxylin,with |
| R8527 |
T30456 |
T30455 |
cc |
and,hematoxylin |
| R8528 |
T30457 |
T30455 |
conj |
eosin,hematoxylin |
| R8529 |
T30458 |
T30428 |
punct |
.,sections |
| R853 |
T4623 |
T4621 |
oprd |
chromatin,termed |
| R8530 |
T30460 |
T30461 |
nsubj |
Spermatogenesis,are |
| R8531 |
T30462 |
T30460 |
cc |
and,Spermatogenesis |
| R8532 |
T30463 |
T30460 |
conj |
spermiogenesis,Spermatogenesis |
| R8533 |
T30464 |
T30461 |
acomp |
normal,are |
| R8534 |
T30465 |
T30461 |
prep |
in,are |
| R8535 |
T30466 |
T30467 |
compound |
SC,Dmrt7KO |
| R8536 |
T30467 |
T30469 |
compound |
Dmrt7KO,testis |
| R8537 |
T30468 |
T30467 |
punct |
-,Dmrt7KO |
| R8538 |
T30469 |
T30465 |
pobj |
testis,in |
| R8539 |
T30470 |
T30461 |
punct |
.,are |
| R854 |
T4624 |
T4623 |
compound |
sex,chromatin |
| R8540 |
T30472 |
T30473 |
punct |
(,E |
| R8541 |
T30473 |
T30474 |
meta |
E,sections |
| R8542 |
T30475 |
T30473 |
punct |
),E |
| R8543 |
T30476 |
T30474 |
compound |
Testis,sections |
| R8544 |
T30477 |
T30474 |
prep |
from,sections |
| R8545 |
T30478 |
T30479 |
nummod |
10,wk |
| R8546 |
T30479 |
T30481 |
npadvmod |
wk,old |
| R8547 |
T30480 |
T30479 |
punct |
-,wk |
| R8548 |
T30481 |
T30483 |
amod |
old,mice |
| R8549 |
T30482 |
T30481 |
punct |
-,old |
| R855 |
T4625 |
T4623 |
punct |
(,chromatin |
| R8550 |
T30483 |
T30477 |
pobj |
mice,from |
| R8551 |
T30484 |
T30485 |
amod |
wild,type |
| R8552 |
T30485 |
T30483 |
nmod |
type,mice |
| R8553 |
T30486 |
T30485 |
punct |
-,type |
| R8554 |
T30487 |
T30485 |
cc |
and,type |
| R8555 |
T30488 |
T30489 |
compound |
SC,Dmrt7KO |
| R8556 |
T30489 |
T30485 |
conj |
Dmrt7KO,type |
| R8557 |
T30490 |
T30489 |
punct |
-,Dmrt7KO |
| R8558 |
T30491 |
T30474 |
acl |
stained,sections |
| R8559 |
T30492 |
T30491 |
prep |
with,stained |
| R856 |
T4512 |
T4513 |
aux |
to,localize |
| R8560 |
T30493 |
T30492 |
pobj |
antibodies,with |
| R8561 |
T30494 |
T30493 |
prep |
to,antibodies |
| R8562 |
T30495 |
T30494 |
pobj |
GATA1,to |
| R8563 |
T30496 |
T30497 |
punct |
(,red |
| R8564 |
T30497 |
T30493 |
parataxis |
red,antibodies |
| R8565 |
T30498 |
T30497 |
punct |
),red |
| R8566 |
T30499 |
T30493 |
cc |
and,antibodies |
| R8567 |
T30500 |
T30501 |
amod |
smooth,actin |
| R8568 |
T30501 |
T30493 |
conj |
actin,antibodies |
| R8569 |
T30502 |
T30501 |
compound |
muscle,actin |
| R857 |
T4626 |
T4623 |
appos |
PMSC,chromatin |
| R8570 |
T30503 |
T30504 |
punct |
(,outline |
| R8571 |
T30504 |
T30501 |
parataxis |
outline,actin |
| R8572 |
T30505 |
T30504 |
aux |
to,outline |
| R8573 |
T30506 |
T30507 |
amod |
seminiferous,tubules |
| R8574 |
T30507 |
T30504 |
dobj |
tubules,outline |
| R8575 |
T30508 |
T30504 |
punct |
;,outline |
| R8576 |
T30509 |
T30504 |
amod |
green,outline |
| R8577 |
T30510 |
T30504 |
punct |
),outline |
| R8578 |
T30511 |
T30474 |
punct |
.,sections |
| R8579 |
T30513 |
T30514 |
compound |
Sertoli,cell |
| R858 |
T4627 |
T4604 |
punct |
),associated |
| R8580 |
T30514 |
T30515 |
compound |
cell,nuclei |
| R8581 |
T30515 |
T30516 |
nsubjpass |
nuclei,positioned |
| R8582 |
T30517 |
T30516 |
auxpass |
are,positioned |
| R8583 |
T30518 |
T30516 |
advmod |
normally,positioned |
| R8584 |
T30519 |
T30516 |
prep |
near,positioned |
| R8585 |
T30520 |
T30521 |
det |
the,membrane |
| R8586 |
T30521 |
T30519 |
pobj |
membrane,near |
| R8587 |
T30522 |
T30521 |
amod |
basal,membrane |
| R8588 |
T30523 |
T30516 |
prep |
in,positioned |
| R8589 |
T30524 |
T30525 |
compound |
SC,Dmrt7KO |
| R859 |
T4628 |
T4629 |
punct |
[,17 |
| R8590 |
T30525 |
T30527 |
compound |
Dmrt7KO,mice |
| R8591 |
T30526 |
T30525 |
punct |
-,Dmrt7KO |
| R8592 |
T30527 |
T30523 |
pobj |
mice,in |
| R8593 |
T30528 |
T30516 |
punct |
.,positioned |
| R8594 |
T30803 |
T30804 |
compound |
XY,Body |
| R8595 |
T30804 |
T30805 |
nsubj |
Body,Forms |
| R8596 |
T30806 |
T30805 |
advmod |
Normally,Forms |
| R8597 |
T30807 |
T30805 |
prep |
during,Forms |
| R8598 |
T30808 |
T30807 |
pobj |
Pachynema,during |
| R8599 |
T30809 |
T30805 |
prep |
in,Forms |
| R86 |
T970 |
T967 |
punct |
", ",appear |
| R860 |
T4513 |
T4510 |
xcomp |
localize,reported |
| R8600 |
T30810 |
T30811 |
compound |
Dmrt7,Mutant |
| R8601 |
T30811 |
T30812 |
compound |
Mutant,Mice |
| R8602 |
T30812 |
T30809 |
pobj |
Mice,in |
| R8603 |
T30814 |
T30815 |
punct |
(,cells |
| R8604 |
T30816 |
T30815 |
meta |
A,cells |
| R8605 |
T30817 |
T30815 |
punct |
),cells |
| R8606 |
T30818 |
T30815 |
amod |
Testicular,cells |
| R8607 |
T30819 |
T30815 |
acl |
spread,cells |
| R8608 |
T30820 |
T30819 |
cc |
and,spread |
| R8609 |
T30821 |
T30819 |
conj |
stained,spread |
| R861 |
T4629 |
T4604 |
parataxis |
17,associated |
| R8610 |
T30822 |
T30821 |
prep |
with,stained |
| R8611 |
T30823 |
T30822 |
pobj |
antibodies,with |
| R8612 |
T30824 |
T30823 |
prep |
to,antibodies |
| R8613 |
T30825 |
T30824 |
pobj |
γH2AX,to |
| R8614 |
T30826 |
T30827 |
punct |
(,red |
| R8615 |
T30827 |
T30825 |
parataxis |
red,γH2AX |
| R8616 |
T30828 |
T30827 |
punct |
),red |
| R8617 |
T30829 |
T30825 |
cc |
and,γH2AX |
| R8618 |
T30830 |
T30825 |
conj |
SYCP3,γH2AX |
| R8619 |
T30831 |
T30832 |
punct |
(,green |
| R862 |
T4630 |
T4629 |
nummod |
16,17 |
| R8620 |
T30832 |
T30830 |
parataxis |
green,SYCP3 |
| R8621 |
T30833 |
T30832 |
punct |
),green |
| R8622 |
T30834 |
T30815 |
punct |
.,cells |
| R8623 |
T30836 |
T30837 |
prep |
In,concentrated |
| R8624 |
T30838 |
T30839 |
compound |
pachytene,cells |
| R8625 |
T30839 |
T30836 |
pobj |
cells,In |
| R8626 |
T30840 |
T30837 |
punct |
", ",concentrated |
| R8627 |
T30841 |
T30837 |
nsubjpass |
γH2AX,concentrated |
| R8628 |
T30842 |
T30837 |
auxpass |
is,concentrated |
| R8629 |
T30843 |
T30837 |
prep |
in,concentrated |
| R863 |
T4514 |
T4513 |
prep |
to,localize |
| R8630 |
T30844 |
T30845 |
det |
the,body |
| R8631 |
T30845 |
T30843 |
pobj |
body,in |
| R8632 |
T30846 |
T30845 |
compound |
XY,body |
| R8633 |
T30847 |
T30848 |
preconj |
both,in |
| R8634 |
T30848 |
T30837 |
prep |
in,concentrated |
| R8635 |
T30849 |
T30850 |
amod |
wild,type |
| R8636 |
T30850 |
T30848 |
pobj |
type,in |
| R8637 |
T30851 |
T30850 |
punct |
-,type |
| R8638 |
T30852 |
T30850 |
cc |
and,type |
| R8639 |
T30853 |
T30854 |
compound |
Dmrt7,mutant |
| R864 |
T4631 |
T4629 |
punct |
",",17 |
| R8640 |
T30854 |
T30850 |
conj |
mutant,type |
| R8641 |
T30855 |
T30837 |
punct |
.,concentrated |
| R8642 |
T30857 |
T30858 |
punct |
(,B |
| R8643 |
T30858 |
T30859 |
meta |
B,Testes |
| R8644 |
T30860 |
T30858 |
punct |
),B |
| R8645 |
T30861 |
T30859 |
prep |
from,Testes |
| R8646 |
T30862 |
T30863 |
nummod |
6,wk |
| R8647 |
T30863 |
T30865 |
npadvmod |
wk,old |
| R8648 |
T30864 |
T30863 |
punct |
-,wk |
| R8649 |
T30865 |
T30867 |
amod |
old,mice |
| R865 |
T4632 |
T4629 |
punct |
],17 |
| R8650 |
T30866 |
T30865 |
punct |
-,old |
| R8651 |
T30867 |
T30861 |
pobj |
mice,from |
| R8652 |
T30868 |
T30859 |
acl |
sectioned,Testes |
| R8653 |
T30869 |
T30868 |
cc |
and,sectioned |
| R8654 |
T30870 |
T30868 |
conj |
stained,sectioned |
| R8655 |
T30871 |
T30870 |
prep |
with,stained |
| R8656 |
T30872 |
T30871 |
pobj |
antibody,with |
| R8657 |
T30873 |
T30872 |
prep |
to,antibody |
| R8658 |
T30874 |
T30873 |
pobj |
γH2AX,to |
| R8659 |
T30875 |
T30876 |
punct |
(,red |
| R866 |
T4633 |
T4604 |
punct |
.,associated |
| R8660 |
T30876 |
T30870 |
parataxis |
red,stained |
| R8661 |
T30877 |
T30876 |
punct |
),red |
| R8662 |
T30878 |
T30859 |
punct |
.,Testes |
| R8663 |
T30880 |
T30881 |
punct |
(,C |
| R8664 |
T30881 |
T30882 |
meta |
C,Testes |
| R8665 |
T30883 |
T30881 |
punct |
),C |
| R8666 |
T30884 |
T30882 |
prep |
from,Testes |
| R8667 |
T30885 |
T30886 |
nummod |
6,wk |
| R8668 |
T30886 |
T30888 |
npadvmod |
wk,old |
| R8669 |
T30887 |
T30886 |
punct |
-,wk |
| R867 |
T4515 |
T4516 |
det |
the,body |
| R8670 |
T30888 |
T30890 |
amod |
old,mice |
| R8671 |
T30889 |
T30888 |
punct |
-,old |
| R8672 |
T30890 |
T30884 |
pobj |
mice,from |
| R8673 |
T30891 |
T30882 |
acl |
sectioned,Testes |
| R8674 |
T30892 |
T30891 |
cc |
and,sectioned |
| R8675 |
T30893 |
T30891 |
conj |
stained,sectioned |
| R8676 |
T30894 |
T30893 |
prep |
with,stained |
| R8677 |
T30895 |
T30894 |
pobj |
antibody,with |
| R8678 |
T30896 |
T30895 |
prep |
to,antibody |
| R8679 |
T30897 |
T30896 |
pobj |
SUMO,to |
| R868 |
T4635 |
T4636 |
nsubjpass |
Regulators,identified |
| R8680 |
T30898 |
T30897 |
punct |
-,SUMO |
| R8681 |
T30899 |
T30897 |
nummod |
1,SUMO |
| R8682 |
T30900 |
T30901 |
punct |
(,green |
| R8683 |
T30901 |
T30893 |
parataxis |
green,stained |
| R8684 |
T30902 |
T30901 |
punct |
),green |
| R8685 |
T30903 |
T30882 |
punct |
.,Testes |
| R8686 |
T30905 |
T30906 |
amod |
Abundant,cells |
| R8687 |
T30906 |
T30908 |
nsubj |
cells,are |
| R8688 |
T30907 |
T30906 |
compound |
pachytene,cells |
| R8689 |
T30909 |
T30906 |
prep |
with,cells |
| R869 |
T4516 |
T4514 |
pobj |
body,to |
| R8690 |
T30910 |
T30911 |
compound |
XY,bodies |
| R8691 |
T30911 |
T30909 |
pobj |
bodies,with |
| R8692 |
T30912 |
T30908 |
acomp |
present,are |
| R8693 |
T30913 |
T30908 |
prep |
in,are |
| R8694 |
T30914 |
T30915 |
amod |
wild,type |
| R8695 |
T30915 |
T30917 |
nmod |
type,testes |
| R8696 |
T30916 |
T30915 |
punct |
-,type |
| R8697 |
T30917 |
T30913 |
pobj |
testes,in |
| R8698 |
T30918 |
T30915 |
cc |
and,type |
| R8699 |
T30919 |
T30915 |
conj |
mutant,type |
| R87 |
T971 |
T972 |
amod |
meiotic,pairing |
| R870 |
T4637 |
T4635 |
prep |
of,Regulators |
| R8700 |
T30920 |
T30908 |
punct |
.,are |
| R8703 |
T31607 |
T31608 |
compound |
Chromatin,Abnormalities |
| R8704 |
T31609 |
T31608 |
prep |
in,Abnormalities |
| R8705 |
T31610 |
T31611 |
compound |
Dmrt7,Mutant |
| R8706 |
T31611 |
T31612 |
compound |
Mutant,Cells |
| R8707 |
T31612 |
T31609 |
pobj |
Cells,in |
| R8708 |
T31613 |
T31612 |
compound |
Diplotene,Cells |
| R8709 |
T31614 |
T31612 |
compound |
Germ,Cells |
| R871 |
T4638 |
T4639 |
amod |
sexual,differentiation |
| R8710 |
T31616 |
T31617 |
punct |
(,A |
| R8711 |
T31617 |
T31618 |
meta |
A,occurs |
| R8712 |
T31619 |
T31617 |
cc |
and,A |
| R8713 |
T31620 |
T31617 |
conj |
B,A |
| R8714 |
T31621 |
T31620 |
punct |
),B |
| R8715 |
T31622 |
T31618 |
nsubj |
MSCI,occurs |
| R8716 |
T31623 |
T31618 |
advmod |
normally,occurs |
| R8717 |
T31624 |
T31618 |
prep |
in,occurs |
| R8718 |
T31625 |
T31626 |
amod |
mid-pachytene,spermatocyte |
| R8719 |
T31626 |
T31624 |
pobj |
spermatocyte,in |
| R872 |
T4517 |
T4516 |
compound |
XY,body |
| R8720 |
T31627 |
T31626 |
prep |
of,spermatocyte |
| R8721 |
T31628 |
T31629 |
compound |
Dmrt7,mutant |
| R8722 |
T31629 |
T31627 |
pobj |
mutant,of |
| R8723 |
T31630 |
T31618 |
punct |
.,occurs |
| R8724 |
T31632 |
T31633 |
nsubj |
Arrows,indicate |
| R8725 |
T31634 |
T31635 |
compound |
XY,body |
| R8726 |
T31635 |
T31633 |
dobj |
body,indicate |
| R8727 |
T31636 |
T31633 |
prep |
in,indicate |
| R8728 |
T31637 |
T31638 |
det |
all,panels |
| R8729 |
T31638 |
T31636 |
pobj |
panels,in |
| R873 |
T4639 |
T4637 |
pobj |
differentiation,of |
| R8730 |
T31639 |
T31633 |
punct |
.,indicate |
| R8731 |
T31641 |
T31642 |
nmod |
Cot,FISH |
| R8732 |
T31642 |
T31646 |
nsubj |
FISH,reveals |
| R8733 |
T31643 |
T31641 |
punct |
-,Cot |
| R8734 |
T31644 |
T31641 |
nummod |
1,Cot |
| R8735 |
T31645 |
T31642 |
compound |
RNA,FISH |
| R8736 |
T31647 |
T31648 |
punct |
(,red |
| R8737 |
T31648 |
T31642 |
parataxis |
red,FISH |
| R8738 |
T31649 |
T31648 |
punct |
),red |
| R8739 |
T31650 |
T31651 |
amod |
normal,silencing |
| R874 |
T4640 |
T4636 |
aux |
have,identified |
| R8740 |
T31651 |
T31646 |
dobj |
silencing,reveals |
| R8741 |
T31652 |
T31651 |
prep |
of,silencing |
| R8742 |
T31653 |
T31654 |
compound |
sex,transcription |
| R8743 |
T31654 |
T31652 |
pobj |
transcription,of |
| R8744 |
T31655 |
T31654 |
compound |
chromosome,transcription |
| R8745 |
T31656 |
T31654 |
prep |
in,transcription |
| R8746 |
T31657 |
T31658 |
compound |
XY,body |
| R8747 |
T31658 |
T31656 |
pobj |
body,in |
| R8748 |
T31659 |
T31646 |
punct |
.,reveals |
| R8749 |
T31661 |
T31662 |
nsubj |
This,is |
| R875 |
T4518 |
T4510 |
punct |
", ",reported |
| R8750 |
T31663 |
T31662 |
acomp |
consistent,is |
| R8751 |
T31664 |
T31663 |
prep |
with,consistent |
| R8752 |
T31665 |
T31666 |
amod |
wild,type |
| R8753 |
T31666 |
T31668 |
compound |
type,mid-pachynema |
| R8754 |
T31667 |
T31666 |
punct |
-,type |
| R8755 |
T31668 |
T31664 |
pobj |
mid-pachynema,with |
| R8756 |
T31669 |
T31670 |
mark |
as,described |
| R8757 |
T31670 |
T31662 |
advcl |
described,is |
| R8758 |
T31671 |
T31670 |
advmod |
previously,described |
| R8759 |
T31672 |
T31673 |
punct |
[,16 |
| R876 |
T4641 |
T4636 |
auxpass |
been,identified |
| R8760 |
T31673 |
T31662 |
parataxis |
16,is |
| R8761 |
T31674 |
T31673 |
punct |
],16 |
| R8762 |
T31675 |
T31662 |
punct |
.,is |
| R8763 |
T31677 |
T31678 |
punct |
(,C |
| R8764 |
T31678 |
T31679 |
meta |
C,localization |
| R8765 |
T31680 |
T31678 |
cc |
and,C |
| R8766 |
T31681 |
T31678 |
conj |
D,C |
| R8767 |
T31682 |
T31681 |
punct |
),D |
| R8768 |
T31683 |
T31679 |
compound |
HP1β,localization |
| R8769 |
T31684 |
T31679 |
prep |
in,localization |
| R877 |
T4642 |
T4636 |
prep |
in,identified |
| R8770 |
T31685 |
T31686 |
amod |
mid-pachytene,spermatocytes |
| R8771 |
T31686 |
T31684 |
pobj |
spermatocytes,in |
| R8772 |
T31687 |
T31679 |
punct |
.,localization |
| R8773 |
T31689 |
T31690 |
nsubj |
HP1β,localizes |
| R8774 |
T31691 |
T31690 |
prep |
to,localizes |
| R8775 |
T31692 |
T31693 |
compound |
X,chromosome |
| R8776 |
T31693 |
T31694 |
compound |
chromosome,centromere |
| R8777 |
T31694 |
T31691 |
pobj |
centromere,to |
| R8778 |
T31695 |
T31696 |
punct |
(,arrowhead |
| R8779 |
T31696 |
T31690 |
parataxis |
arrowhead,localizes |
| R878 |
T4643 |
T4644 |
det |
a,number |
| R8780 |
T31697 |
T31696 |
punct |
),arrowhead |
| R8781 |
T31698 |
T31690 |
prep |
in,localizes |
| R8782 |
T31699 |
T31700 |
amod |
wild,type |
| R8783 |
T31700 |
T31698 |
pobj |
type,in |
| R8784 |
T31701 |
T31700 |
punct |
-,type |
| R8785 |
T31702 |
T31703 |
punct |
(,C |
| R8786 |
T31703 |
T31700 |
parataxis |
C,type |
| R8787 |
T31704 |
T31703 |
punct |
),C |
| R8788 |
T31705 |
T31700 |
cc |
and,type |
| R8789 |
T31706 |
T31700 |
conj |
mutant,type |
| R879 |
T4519 |
T4510 |
prep |
including,reported |
| R8790 |
T31707 |
T31708 |
punct |
(,D |
| R8791 |
T31708 |
T31706 |
parataxis |
D,mutant |
| R8792 |
T31709 |
T31708 |
punct |
),D |
| R8793 |
T31710 |
T31690 |
punct |
.,localizes |
| R8794 |
T31712 |
T31713 |
punct |
(,E |
| R8795 |
T31713 |
T31714 |
meta |
E,hybridization |
| R8796 |
T31715 |
T31713 |
cc |
and,E |
| R8797 |
T31716 |
T31713 |
conj |
F,E |
| R8798 |
T31717 |
T31716 |
punct |
),F |
| R8799 |
T31718 |
T31714 |
nmod |
Cot,hybridization |
| R88 |
T848 |
T846 |
pobj |
sexes,between |
| R880 |
T4644 |
T4642 |
pobj |
number,in |
| R8800 |
T31719 |
T31718 |
punct |
-,Cot |
| R8801 |
T31720 |
T31718 |
nummod |
1,Cot |
| R8802 |
T31721 |
T31714 |
prep |
in,hybridization |
| R8803 |
T31722 |
T31721 |
pobj |
diplotene,in |
| R8804 |
T31723 |
T31714 |
punct |
.,hybridization |
| R8805 |
T31725 |
T31726 |
amod |
Presumptive,body |
| R8806 |
T31726 |
T31728 |
nsubjpass |
body,indicated |
| R8807 |
T31727 |
T31726 |
compound |
XY,body |
| R8808 |
T31729 |
T31728 |
punct |
", ",indicated |
| R8809 |
T31730 |
T31728 |
prep |
based,indicated |
| R881 |
T4645 |
T4644 |
prep |
of,number |
| R8810 |
T31731 |
T31730 |
prep |
on,based |
| R8811 |
T31732 |
T31733 |
nmod |
DAPI,localization |
| R8812 |
T31733 |
T31731 |
pobj |
localization,on |
| R8813 |
T31734 |
T31732 |
cc |
and,DAPI |
| R8814 |
T31735 |
T31732 |
conj |
γH2AX,DAPI |
| R8815 |
T31736 |
T31728 |
punct |
", ",indicated |
| R8816 |
T31737 |
T31728 |
auxpass |
is,indicated |
| R8817 |
T31738 |
T31728 |
agent |
by,indicated |
| R8818 |
T31739 |
T31738 |
pobj |
arrow,by |
| R8819 |
T31740 |
T31739 |
prep |
in,arrow |
| R882 |
T4646 |
T4645 |
pobj |
organisms,of |
| R8820 |
T31741 |
T31742 |
punct |
(,F |
| R8821 |
T31742 |
T31740 |
pobj |
F,in |
| R8822 |
T31743 |
T31728 |
punct |
),indicated |
| R8823 |
T31744 |
T31728 |
punct |
.,indicated |
| R8824 |
T31746 |
T31747 |
punct |
(,G |
| R8825 |
T31747 |
T31748 |
meta |
G,HP1β |
| R8826 |
T31749 |
T31747 |
cc |
and,G |
| R8827 |
T31750 |
T31747 |
conj |
H,G |
| R8828 |
T31751 |
T31750 |
punct |
),H |
| R8829 |
T31752 |
T31748 |
prep |
in,HP1β |
| R883 |
T4520 |
T4519 |
pobj |
BRCA1,including |
| R8830 |
T31753 |
T31752 |
pobj |
diplotene,in |
| R8831 |
T31754 |
T31748 |
punct |
.,HP1β |
| R8832 |
T31756 |
T31757 |
amod |
Wild,type |
| R8833 |
T31757 |
T31759 |
compound |
type,cell |
| R8834 |
T31758 |
T31757 |
punct |
-,type |
| R8835 |
T31759 |
T31760 |
nsubj |
cell,has |
| R8836 |
T31761 |
T31762 |
punct |
(,E |
| R8837 |
T31762 |
T31759 |
parataxis |
E,cell |
| R8838 |
T31763 |
T31762 |
punct |
),E |
| R8839 |
T31764 |
T31760 |
dobj |
HP1β,has |
| R884 |
T4647 |
T4636 |
punct |
", ",identified |
| R8840 |
T31765 |
T31760 |
prep |
throughout,has |
| R8841 |
T31766 |
T31767 |
compound |
XY,body |
| R8842 |
T31767 |
T31765 |
pobj |
body,throughout |
| R8843 |
T31768 |
T31760 |
punct |
", ",has |
| R8844 |
T31769 |
T31770 |
mark |
whereas,has |
| R8845 |
T31770 |
T31760 |
advcl |
has,has |
| R8846 |
T31771 |
T31772 |
compound |
mutant,cell |
| R8847 |
T31772 |
T31770 |
nsubj |
cell,has |
| R8848 |
T31773 |
T31774 |
punct |
(,H |
| R8849 |
T31774 |
T31772 |
parataxis |
H,cell |
| R885 |
T4648 |
T4636 |
cc |
but,identified |
| R8850 |
T31775 |
T31774 |
punct |
),H |
| R8851 |
T31776 |
T31770 |
advmod |
only,has |
| R8852 |
T31777 |
T31770 |
dobj |
localization,has |
| R8853 |
T31778 |
T31777 |
prep |
to,localization |
| R8854 |
T31779 |
T31780 |
compound |
X,chromosome |
| R8855 |
T31780 |
T31781 |
compound |
chromosome,centromere |
| R8856 |
T31781 |
T31778 |
pobj |
centromere,to |
| R8857 |
T31782 |
T31783 |
punct |
(,arrowhead |
| R8858 |
T31783 |
T31777 |
parataxis |
arrowhead,localization |
| R8859 |
T31784 |
T31783 |
punct |
),arrowhead |
| R886 |
T4521 |
T4520 |
punct |
", ",BRCA1 |
| R8860 |
T31785 |
T31760 |
punct |
.,has |
| R8861 |
T31787 |
T31788 |
punct |
(,I |
| R8862 |
T31788 |
T31789 |
meta |
I,localization |
| R8863 |
T31790 |
T31788 |
cc |
and,I |
| R8864 |
T31791 |
T31788 |
conj |
J,I |
| R8865 |
T31792 |
T31791 |
punct |
),J |
| R8866 |
T31793 |
T31794 |
compound |
H3,2meK9 |
| R8867 |
T31794 |
T31789 |
compound |
2meK9,localization |
| R8868 |
T31795 |
T31794 |
punct |
-,2meK9 |
| R8869 |
T31796 |
T31789 |
prep |
in,localization |
| R887 |
T4649 |
T4650 |
prep |
in,are |
| R8870 |
T31797 |
T31798 |
compound |
diplotene,cells |
| R8871 |
T31798 |
T31796 |
pobj |
cells,in |
| R8872 |
T31799 |
T31789 |
punct |
.,localization |
| R8873 |
T31801 |
T31802 |
compound |
Mutant,cell |
| R8874 |
T31802 |
T31803 |
nsubj |
cell,lacks |
| R8875 |
T31804 |
T31805 |
punct |
(,J |
| R8876 |
T31805 |
T31802 |
parataxis |
J,cell |
| R8877 |
T31806 |
T31805 |
punct |
),J |
| R8878 |
T31807 |
T31808 |
amod |
strong,concentration |
| R8879 |
T31808 |
T31803 |
dobj |
concentration,lacks |
| R888 |
T4650 |
T4636 |
conj |
are,identified |
| R8880 |
T31809 |
T31808 |
prep |
of,concentration |
| R8881 |
T31810 |
T31811 |
det |
this,mark |
| R8882 |
T31811 |
T31809 |
pobj |
mark,of |
| R8883 |
T31812 |
T31808 |
prep |
to,concentration |
| R8884 |
T31813 |
T31814 |
det |
the,body |
| R8885 |
T31814 |
T31812 |
pobj |
body,to |
| R8886 |
T31815 |
T31814 |
compound |
XY,body |
| R8887 |
T31816 |
T31814 |
acl |
seen,body |
| R8888 |
T31817 |
T31816 |
prep |
in,seen |
| R8889 |
T31818 |
T31819 |
amod |
wild,type |
| R889 |
T4651 |
T4649 |
pobj |
contrast,in |
| R8890 |
T31819 |
T31817 |
pobj |
type,in |
| R8891 |
T31820 |
T31819 |
punct |
-,type |
| R8892 |
T31821 |
T31822 |
punct |
(,I |
| R8893 |
T31822 |
T31803 |
parataxis |
I,lacks |
| R8894 |
T31823 |
T31822 |
punct |
),I |
| R8895 |
T31824 |
T31803 |
punct |
.,lacks |
| R8896 |
T31826 |
T31827 |
punct |
(,K |
| R8897 |
T31827 |
T31828 |
meta |
K,localization |
| R8898 |
T31829 |
T31827 |
cc |
and,K |
| R8899 |
T31830 |
T31827 |
conj |
L,K |
| R89 |
T972 |
T967 |
nsubj |
pairing,appear |
| R890 |
T4652 |
T4651 |
prep |
to,contrast |
| R8900 |
T31831 |
T31830 |
punct |
),L |
| R8901 |
T31832 |
T31833 |
compound |
H3,3meK9 |
| R8902 |
T31833 |
T31828 |
compound |
3meK9,localization |
| R8903 |
T31834 |
T31833 |
punct |
-,3meK9 |
| R8904 |
T31835 |
T31828 |
prep |
in,localization |
| R8905 |
T31836 |
T31837 |
compound |
diplotene,cells |
| R8906 |
T31837 |
T31835 |
pobj |
cells,in |
| R8907 |
T31838 |
T31828 |
punct |
.,localization |
| R8908 |
T31840 |
T31841 |
compound |
Mutant,cell |
| R8909 |
T31841 |
T31842 |
nsubj |
cell,has |
| R891 |
T4653 |
T4654 |
amod |
many,processes |
| R8910 |
T31843 |
T31844 |
punct |
(,L |
| R8911 |
T31844 |
T31841 |
parataxis |
L,cell |
| R8912 |
T31845 |
T31844 |
punct |
),L |
| R8913 |
T31846 |
T31847 |
det |
no,localization |
| R8914 |
T31847 |
T31842 |
dobj |
localization,has |
| R8915 |
T31848 |
T31847 |
prep |
of,localization |
| R8916 |
T31849 |
T31850 |
det |
this,mark |
| R8917 |
T31850 |
T31848 |
pobj |
mark,of |
| R8918 |
T31851 |
T31847 |
prep |
to,localization |
| R8919 |
T31852 |
T31853 |
det |
the,body |
| R892 |
T4654 |
T4652 |
pobj |
processes,to |
| R8920 |
T31853 |
T31851 |
pobj |
body,to |
| R8921 |
T31854 |
T31853 |
compound |
XY,body |
| R8922 |
T31855 |
T31842 |
punct |
.,has |
| R8923 |
T31857 |
T31858 |
nsubj |
γH2AX,localizes |
| R8924 |
T31859 |
T31858 |
prep |
to,localizes |
| R8925 |
T31860 |
T31859 |
pobj |
autosomes,to |
| R8926 |
T31861 |
T31858 |
prep |
in,localizes |
| R8927 |
T31862 |
T31863 |
compound |
mutant,cell |
| R8928 |
T31863 |
T31861 |
pobj |
cell,in |
| R8929 |
T31864 |
T31858 |
punct |
", ",localizes |
| R893 |
T4522 |
T4520 |
conj |
ATR,BRCA1 |
| R8930 |
T31865 |
T31866 |
advmod |
possibly,indicating |
| R8931 |
T31866 |
T31858 |
advcl |
indicating,localizes |
| R8932 |
T31867 |
T31866 |
dobj |
onset,indicating |
| R8933 |
T31868 |
T31867 |
prep |
of,onset |
| R8934 |
T31869 |
T31868 |
pobj |
apoptosis,of |
| R8935 |
T31870 |
T31858 |
punct |
.,localizes |
| R8936 |
T31872 |
T31873 |
punct |
(,M |
| R8937 |
T31873 |
T31874 |
meta |
M,Example |
| R8938 |
T31875 |
T31873 |
punct |
),M |
| R8939 |
T31876 |
T31874 |
prep |
of,Example |
| R894 |
T4655 |
T4654 |
amod |
other,processes |
| R8940 |
T31877 |
T31878 |
compound |
mutant,cell |
| R8941 |
T31878 |
T31876 |
pobj |
cell,of |
| R8942 |
T31879 |
T31878 |
compound |
diplotene,cell |
| R8943 |
T31880 |
T31878 |
prep |
with,cell |
| R8944 |
T31881 |
T31882 |
amod |
normal,accumulation |
| R8945 |
T31882 |
T31880 |
pobj |
accumulation,with |
| R8946 |
T31883 |
T31882 |
compound |
HP1β,accumulation |
| R8947 |
T31884 |
T31882 |
prep |
to,accumulation |
| R8948 |
T31885 |
T31886 |
det |
the,body |
| R8949 |
T31886 |
T31884 |
pobj |
body,to |
| R895 |
T4656 |
T4654 |
amod |
developmental,processes |
| R8950 |
T31887 |
T31886 |
compound |
XY,body |
| R8951 |
T31888 |
T31874 |
punct |
.,Example |
| R8952 |
T31890 |
T31891 |
det |
All,images |
| R8953 |
T31891 |
T31892 |
nsubj |
images,are |
| R8954 |
T31893 |
T31891 |
prep |
except,images |
| R8955 |
T31894 |
T31893 |
pobj |
those,except |
| R8956 |
T31895 |
T31894 |
prep |
in,those |
| R8957 |
T31896 |
T31897 |
punct |
(,M |
| R8958 |
T31897 |
T31895 |
pobj |
M,in |
| R8959 |
T31898 |
T31892 |
punct |
),are |
| R896 |
T4523 |
T4522 |
punct |
", ",ATR |
| R8960 |
T31899 |
T31900 |
amod |
single,Z |
| R8961 |
T31900 |
T31901 |
compound |
Z,sections |
| R8962 |
T31901 |
T31892 |
attr |
sections,are |
| R8963 |
T31902 |
T31892 |
punct |
.,are |
| R8964 |
T32100 |
T32101 |
amod |
Abnormal,Chromatin |
| R8965 |
T32102 |
T32101 |
compound |
Sex,Chromatin |
| R8966 |
T32103 |
T32101 |
prep |
in,Chromatin |
| R8967 |
T32104 |
T32103 |
pobj |
Cells,in |
| R8968 |
T32105 |
T32101 |
acl |
Staged,Chromatin |
| R8969 |
T32106 |
T32105 |
prep |
by,Staged |
| R897 |
T4657 |
T4654 |
punct |
", ",processes |
| R8970 |
T32107 |
T32108 |
nmod |
Chromosome,Status |
| R8971 |
T32108 |
T32106 |
pobj |
Status,by |
| R8972 |
T32109 |
T32108 |
amod |
Pairing,Status |
| R8973 |
T32111 |
T32112 |
punct |
(,A |
| R8974 |
T32112 |
T32113 |
meta |
A,Spread |
| R8975 |
T32114 |
T32112 |
punct |
),A |
| R8976 |
T32115 |
T32113 |
prep |
of,Spread |
| R8977 |
T32116 |
T32117 |
amod |
wild,type |
| R8978 |
T32117 |
T32119 |
compound |
type,cell |
| R8979 |
T32118 |
T32117 |
punct |
-,type |
| R898 |
T4658 |
T4659 |
amod |
such,as |
| R8980 |
T32119 |
T32115 |
pobj |
cell,of |
| R8981 |
T32120 |
T32119 |
compound |
germ,cell |
| R8982 |
T32121 |
T32119 |
acl |
stained,cell |
| R8983 |
T32122 |
T32121 |
prep |
with,stained |
| R8984 |
T32123 |
T32122 |
pobj |
DAPI,with |
| R8985 |
T32124 |
T32123 |
punct |
", ",DAPI |
| R8986 |
T32125 |
T32123 |
amod |
anti-SYCP3,DAPI |
| R8987 |
T32126 |
T32123 |
punct |
", ",DAPI |
| R8988 |
T32127 |
T32123 |
cc |
and,DAPI |
| R8989 |
T32128 |
T32123 |
conj |
anti-HP1β,DAPI |
| R899 |
T4659 |
T4654 |
prep |
as,processes |
| R8990 |
T32129 |
T32113 |
acl |
showing,Spread |
| R8991 |
T32130 |
T32131 |
compound |
chromosome,morphology |
| R8992 |
T32131 |
T32129 |
dobj |
morphology,showing |
| R8993 |
T32132 |
T32131 |
amod |
typical,morphology |
| R8994 |
T32133 |
T32132 |
prep |
of,typical |
| R8995 |
T32134 |
T32133 |
pobj |
diplonema,of |
| R8996 |
T32135 |
T32131 |
cc |
and,morphology |
| R8997 |
T32136 |
T32137 |
amod |
internalized,body |
| R8998 |
T32137 |
T32131 |
conj |
body,morphology |
| R8999 |
T32138 |
T32137 |
compound |
XY,body |
| R9 |
T819 |
T818 |
punct |
-,Specific |
| R90 |
T973 |
T972 |
cc |
and,pairing |
| R900 |
T4524 |
T4525 |
det |
the,H3.3 |
| R9000 |
T32139 |
T32137 |
prep |
with,body |
| R9001 |
T32140 |
T32141 |
compound |
HP1β,accumulation |
| R9002 |
T32141 |
T32139 |
pobj |
accumulation,with |
| R9003 |
T32142 |
T32113 |
punct |
.,Spread |
| R9004 |
T32144 |
T32145 |
punct |
(,B |
| R9005 |
T32145 |
T32146 |
meta |
B,Spread |
| R9006 |
T32147 |
T32145 |
punct |
),B |
| R9007 |
T32148 |
T32146 |
prep |
of,Spread |
| R9008 |
T32149 |
T32150 |
compound |
Dmrt7,mutant |
| R9009 |
T32150 |
T32151 |
compound |
mutant,cell |
| R901 |
T4660 |
T4661 |
amod |
axial,patterning |
| R9010 |
T32151 |
T32148 |
pobj |
cell,of |
| R9011 |
T32152 |
T32151 |
compound |
germ,cell |
| R9012 |
T32153 |
T32146 |
acl |
showing,Spread |
| R9013 |
T32154 |
T32155 |
amod |
normal,morphology |
| R9014 |
T32155 |
T32153 |
dobj |
morphology,showing |
| R9015 |
T32156 |
T32155 |
compound |
diplotene,morphology |
| R9016 |
T32157 |
T32155 |
compound |
chromosome,morphology |
| R9017 |
T32158 |
T32155 |
cc |
and,morphology |
| R9018 |
T32159 |
T32160 |
amod |
internalized,body |
| R9019 |
T32160 |
T32155 |
conj |
body,morphology |
| R902 |
T4661 |
T4659 |
pobj |
patterning,as |
| R9020 |
T32161 |
T32160 |
compound |
XY,body |
| R9021 |
T32162 |
T32155 |
punct |
", ",morphology |
| R9022 |
T32163 |
T32155 |
cc |
but,morphology |
| R9023 |
T32164 |
T32165 |
det |
no,accumulation |
| R9024 |
T32165 |
T32155 |
conj |
accumulation,morphology |
| R9025 |
T32166 |
T32165 |
compound |
HP1β,accumulation |
| R9026 |
T32167 |
T32165 |
prep |
in,accumulation |
| R9027 |
T32168 |
T32169 |
det |
the,body |
| R9028 |
T32169 |
T32167 |
pobj |
body,in |
| R9029 |
T32170 |
T32169 |
compound |
XY,body |
| R903 |
T4662 |
T4661 |
cc |
or,patterning |
| R9030 |
T32171 |
T32146 |
punct |
.,Spread |
| R9031 |
T32173 |
T32174 |
compound |
XY,pairs |
| R9032 |
T32174 |
T32176 |
nsubjpass |
pairs,indicated |
| R9033 |
T32175 |
T32174 |
compound |
chromosome,pairs |
| R9034 |
T32177 |
T32176 |
auxpass |
are,indicated |
| R9035 |
T32178 |
T32176 |
agent |
by,indicated |
| R9036 |
T32179 |
T32178 |
pobj |
arrow,by |
| R9037 |
T32180 |
T32176 |
punct |
.,indicated |
| R904 |
T4525 |
T4522 |
conj |
H3.3,ATR |
| R905 |
T4663 |
T4661 |
conj |
development,patterning |
| R906 |
T4664 |
T4663 |
prep |
of,development |
| R907 |
T4665 |
T4666 |
amod |
many,parts |
| R908 |
T4526 |
T4525 |
compound |
histone,H3.3 |
| R909 |
T4666 |
T4664 |
pobj |
parts,of |
| R91 |
T849 |
T834 |
punct |
.,is |
| R910 |
T4667 |
T4666 |
compound |
body,parts |
| R911 |
T4668 |
T4650 |
punct |
", ",are |
| R912 |
T4527 |
T4525 |
compound |
variant,H3.3 |
| R913 |
T4669 |
T4670 |
det |
the,mechanisms |
| R914 |
T4670 |
T4650 |
nsubj |
mechanisms,are |
| R915 |
T4528 |
T4525 |
punct |
", ",H3.3 |
| R916 |
T4529 |
T4525 |
cc |
and,H3.3 |
| R917 |
T4530 |
T4531 |
amod |
modified,histones |
| R918 |
T4671 |
T4670 |
amod |
molecular,mechanisms |
| R919 |
T4531 |
T4525 |
conj |
histones,H3.3 |
| R92 |
T974 |
T972 |
conj |
recombination,pairing |
| R920 |
T4672 |
T4673 |
dep |
that,regulate |
| R921 |
T4673 |
T4670 |
relcl |
regulate,mechanisms |
| R922 |
T4674 |
T4675 |
amod |
sexual,differentiation |
| R923 |
T4532 |
T4533 |
amod |
such,as |
| R924 |
T4675 |
T4673 |
dobj |
differentiation,regulate |
| R925 |
T4676 |
T4677 |
advmod |
highly,variable |
| R926 |
T4533 |
T4531 |
prep |
as,histones |
| R927 |
T4677 |
T4650 |
acomp |
variable,are |
| R928 |
T4678 |
T4650 |
prep |
between,are |
| R929 |
T4679 |
T4678 |
pobj |
phyla,between |
| R93 |
T975 |
T967 |
oprd |
normal,appear |
| R930 |
T4534 |
T4535 |
amod |
ubiquitinated,H2A |
| R931 |
T4680 |
T4650 |
punct |
.,are |
| R932 |
T4535 |
T4533 |
pobj |
H2A,as |
| R933 |
T4682 |
T4683 |
det |
A,exception |
| R934 |
T4683 |
T4685 |
nsubj |
exception,involves |
| R935 |
T4684 |
T4683 |
amod |
notable,exception |
| R936 |
T4536 |
T4535 |
punct |
(,H2A |
| R937 |
T4686 |
T4685 |
dobj |
genes,involves |
| R938 |
T4537 |
T4538 |
compound |
Ub,H2A |
| R939 |
T4687 |
T4686 |
acl |
related,genes |
| R94 |
T976 |
T967 |
punct |
", ",appear |
| R940 |
T4688 |
T4687 |
prep |
to,related |
| R941 |
T4689 |
T4688 |
pobj |
doublesex,to |
| R942 |
T4538 |
T4535 |
appos |
H2A,H2A |
| R943 |
T4690 |
T4689 |
punct |
(,doublesex |
| R944 |
T4691 |
T4689 |
appos |
dsx,doublesex |
| R945 |
T4692 |
T4689 |
punct |
),doublesex |
| R946 |
T4693 |
T4689 |
prep |
of,doublesex |
| R947 |
T4694 |
T4693 |
pobj |
Drosophila,of |
| R948 |
T4695 |
T4686 |
punct |
", ",genes |
| R949 |
T4539 |
T4538 |
punct |
-,H2A |
| R95 |
T851 |
T852 |
prep |
In,creates |
| R950 |
T4696 |
T4697 |
dep |
which,share |
| R951 |
T4697 |
T4686 |
relcl |
share,genes |
| R952 |
T4540 |
T4535 |
punct |
),H2A |
| R953 |
T4698 |
T4699 |
det |
a,motif |
| R954 |
T4541 |
T4535 |
cc |
and,H2A |
| R955 |
T4699 |
T4697 |
dobj |
motif,share |
| R956 |
T4700 |
T4701 |
nmod |
Doublesex,MAB |
| R957 |
T4542 |
T4543 |
amod |
phosphorylated,H2AX |
| R958 |
T4701 |
T4699 |
nmod |
MAB,motif |
| R959 |
T4702 |
T4701 |
punct |
/,MAB |
| R96 |
T977 |
T967 |
cc |
and,appear |
| R960 |
T4543 |
T4535 |
conj |
H2AX,H2A |
| R961 |
T4703 |
T4701 |
punct |
-,MAB |
| R962 |
T4704 |
T4701 |
nummod |
3,MAB |
| R963 |
T4705 |
T4699 |
nmod |
DNA,motif |
| R964 |
T4544 |
T4543 |
punct |
(,H2AX |
| R965 |
T4706 |
T4705 |
punct |
-,DNA |
| R966 |
T4707 |
T4705 |
amod |
binding,DNA |
| R967 |
T4708 |
T4699 |
acl |
called,motif |
| R968 |
T4545 |
T4543 |
appos |
γH2AX,H2AX |
| R969 |
T4709 |
T4710 |
det |
the,domain |
| R97 |
T978 |
T979 |
det |
a,body |
| R970 |
T4710 |
T4708 |
oprd |
domain,called |
| R971 |
T4546 |
T4510 |
punct |
),reported |
| R972 |
T4711 |
T4710 |
compound |
DM,domain |
| R973 |
T4712 |
T4713 |
punct |
[,19 |
| R974 |
T4547 |
T4548 |
punct |
[,12 |
| R975 |
T4713 |
T4685 |
parataxis |
19,involves |
| R976 |
T4714 |
T4713 |
nummod |
18,19 |
| R977 |
T4715 |
T4713 |
punct |
",",19 |
| R978 |
T4548 |
T4510 |
parataxis |
12,reported |
| R979 |
T4716 |
T4713 |
punct |
],19 |
| R98 |
T979 |
T983 |
nsubjpass |
body,formed |
| R980 |
T4717 |
T4685 |
punct |
.,involves |
| R981 |
T4549 |
T4550 |
punct |
–,15 |
| R982 |
T4719 |
T4720 |
nmod |
DM,genes |
| R983 |
T4720 |
T4724 |
nsubjpass |
genes,shown |
| R984 |
T4550 |
T4548 |
prep |
15,12 |
| R985 |
T4721 |
T4722 |
npadvmod |
domain,encoding |
| R986 |
T4722 |
T4720 |
amod |
encoding,genes |
| R987 |
T4551 |
T4548 |
punct |
],12 |
| R988 |
T4723 |
T4722 |
punct |
–,encoding |
| R989 |
T4725 |
T4724 |
aux |
have,shown |
| R99 |
T853 |
T851 |
pobj |
mammals,In |
| R990 |
T4552 |
T4510 |
punct |
.,reported |
| R991 |
T4726 |
T4724 |
auxpass |
been,shown |
| R992 |
T4727 |
T4728 |
aux |
to,regulate |
| R993 |
T4728 |
T4724 |
xcomp |
regulate,shown |
| R994 |
T4554 |
T4555 |
prep |
In,silenced |
| R995 |
T4729 |
T4730 |
amod |
various,aspects |
| R996 |
T4730 |
T4728 |
dobj |
aspects,regulate |
| R997 |
T4731 |
T4730 |
prep |
of,aspects |
| R998 |
T4732 |
T4733 |
amod |
sexual,differentiation |
| R999 |
T4733 |
T4731 |
pobj |
differentiation,of |