Id |
Subject |
Object |
Predicate |
Lexical cue |
T4611 |
23-32 |
NN |
denotes |
Targeting |
T4612 |
33-42 |
NN |
denotes |
construct |
T4613 |
43-46 |
IN |
denotes |
for |
T4614 |
47-48 |
DT |
denotes |
a |
T4616 |
49-52 |
NN |
denotes |
p53 |
T4617 |
53-57 |
NN |
denotes |
RMCE |
T4619 |
57-58 |
HYPH |
denotes |
- |
T4618 |
58-63 |
JJ |
denotes |
ready |
T4615 |
64-69 |
NN |
denotes |
locus |
T4620 |
69-183 |
sentence |
denotes |
Details for plasmid construction are available upon request owing to space limitations mandating a brief outline. |
T4621 |
70-77 |
NNS |
denotes |
Details |
T4623 |
78-81 |
IN |
denotes |
for |
T4624 |
82-89 |
NN |
denotes |
plasmid |
T4625 |
90-102 |
NN |
denotes |
construction |
T4622 |
103-106 |
VBP |
denotes |
are |
T4626 |
107-116 |
JJ |
denotes |
available |
T4627 |
117-121 |
IN |
denotes |
upon |
T4628 |
122-129 |
NN |
denotes |
request |
T4629 |
130-135 |
VBG |
denotes |
owing |
T4630 |
136-138 |
IN |
denotes |
to |
T4631 |
139-144 |
NN |
denotes |
space |
T4632 |
145-156 |
NNS |
denotes |
limitations |
T4633 |
157-166 |
VBG |
denotes |
mandating |
T4634 |
167-168 |
DT |
denotes |
a |
T4636 |
169-174 |
JJ |
denotes |
brief |
T4635 |
175-182 |
NN |
denotes |
outline |
T4637 |
182-183 |
. |
denotes |
. |
T4638 |
183-329 |
sentence |
denotes |
We started from a plasmid L3-1L containing heterologous loxP sites (L3 is the mutant loxP257 recently described (14), 1L is an inverted WT loxP). |
T4639 |
184-186 |
PRP |
denotes |
We |
T4640 |
187-194 |
VBD |
denotes |
started |
T4641 |
195-199 |
IN |
denotes |
from |
T4642 |
200-201 |
DT |
denotes |
a |
T4644 |
202-209 |
NN |
denotes |
plasmid |
T4645 |
210-212 |
NN |
denotes |
L3 |
T4646 |
212-213 |
HYPH |
denotes |
- |
T4643 |
213-215 |
NN |
denotes |
1L |
T4647 |
216-226 |
VBG |
denotes |
containing |
T4648 |
227-239 |
JJ |
denotes |
heterologous |
T4650 |
240-244 |
NN |
denotes |
loxP |
T4649 |
245-250 |
NNS |
denotes |
sites |
T4651 |
251-252 |
-LRB- |
denotes |
( |
T4653 |
252-254 |
NN |
denotes |
L3 |
T4654 |
255-257 |
VBZ |
denotes |
is |
T4655 |
258-261 |
DT |
denotes |
the |
T4657 |
262-268 |
JJ |
denotes |
mutant |
T4656 |
269-276 |
NN |
denotes |
loxP257 |
T4658 |
277-285 |
RB |
denotes |
recently |
T4659 |
286-295 |
VBN |
denotes |
described |
T4660 |
296-297 |
-LRB- |
denotes |
( |
T4661 |
297-299 |
CD |
denotes |
14 |
T4662 |
299-300 |
-RRB- |
denotes |
) |
T4663 |
300-302 |
, |
denotes |
, |
T4664 |
302-304 |
NN |
denotes |
1L |
T4652 |
305-307 |
VBZ |
denotes |
is |
T4665 |
308-310 |
DT |
denotes |
an |
T4667 |
311-319 |
VBN |
denotes |
inverted |
T4668 |
320-322 |
NN |
denotes |
WT |
T4666 |
323-327 |
NN |
denotes |
loxP |
T4669 |
327-328 |
-RRB- |
denotes |
) |
T4670 |
328-329 |
. |
denotes |
. |
T4671 |
329-469 |
sentence |
denotes |
The WT loxP and loxP257 differ in their spacer sequences: the spacer sequence is 5′-ATGTATGC-3′ for WT loxP and 5′-AAGTCTCC-3′ for loxP257. |
T4672 |
330-333 |
DT |
denotes |
The |
T4674 |
334-336 |
NN |
denotes |
WT |
T4673 |
337-341 |
NN |
denotes |
loxP |
T4676 |
342-345 |
CC |
denotes |
and |
T4677 |
346-353 |
NN |
denotes |
loxP257 |
T4675 |
354-360 |
VBP |
denotes |
differ |
T4679 |
361-363 |
IN |
denotes |
in |
T4680 |
364-369 |
PRP$ |
denotes |
their |
T4682 |
370-376 |
NN |
denotes |
spacer |
T4681 |
377-386 |
NNS |
denotes |
sequences |
T4683 |
386-388 |
: |
denotes |
: |
T4684 |
388-391 |
DT |
denotes |
the |
T4686 |
392-398 |
NN |
denotes |
spacer |
T4685 |
399-407 |
NN |
denotes |
sequence |
T4678 |
408-410 |
VBZ |
denotes |
is |
T4687 |
411-412 |
CD |
denotes |
5 |
T4688 |
412-413 |
SYM |
denotes |
′ |
T4689 |
413-414 |
HYPH |
denotes |
- |
T4690 |
414-422 |
JJ |
denotes |
ATGTATGC |
T4691 |
422-423 |
HYPH |
denotes |
- |
T4692 |
423-424 |
CD |
denotes |
3 |
T4693 |
424-425 |
SYM |
denotes |
′ |
T4694 |
426-429 |
IN |
denotes |
for |
T4695 |
430-432 |
NN |
denotes |
WT |
T4696 |
433-437 |
NN |
denotes |
loxP |
T4697 |
438-441 |
CC |
denotes |
and |
T4698 |
442-443 |
CD |
denotes |
5 |
T4700 |
443-444 |
SYM |
denotes |
′ |
T4701 |
444-445 |
HYPH |
denotes |
- |
T4699 |
445-453 |
NN |
denotes |
AAGTCTCC |
T4702 |
453-454 |
HYPH |
denotes |
- |
T4703 |
454-455 |
CD |
denotes |
3 |
T4704 |
455-456 |
SYM |
denotes |
′ |
T4705 |
457-460 |
IN |
denotes |
for |
T4706 |
461-468 |
NN |
denotes |
loxP257 |
T4707 |
468-469 |
. |
denotes |
. |
T4708 |
469-773 |
sentence |
denotes |
The three mutations in the loxP257 spacer sequence prevent it to recombine with WT loxP, ensuring efficient RMCE in several cell lines: accurate RMCE with these loxP sites occurred with an average frequency of 81% at two loci in CHO cells and an average frequency of 69% at four loci in Hela cells (14). |
T4709 |
470-473 |
DT |
denotes |
The |
T4711 |
474-479 |
CD |
denotes |
three |
T4710 |
480-489 |
NNS |
denotes |
mutations |
T4713 |
490-492 |
IN |
denotes |
in |
T4714 |
493-496 |
DT |
denotes |
the |
T4716 |
497-504 |
NN |
denotes |
loxP257 |
T4717 |
505-511 |
NN |
denotes |
spacer |
T4715 |
512-520 |
NN |
denotes |
sequence |
T4712 |
521-528 |
VBP |
denotes |
prevent |
T4719 |
529-531 |
PRP |
denotes |
it |
T4721 |
532-534 |
TO |
denotes |
to |
T4720 |
535-544 |
VB |
denotes |
recombine |
T4722 |
545-549 |
IN |
denotes |
with |
T4723 |
550-552 |
NN |
denotes |
WT |
T4724 |
553-557 |
NN |
denotes |
loxP |
T4725 |
557-559 |
, |
denotes |
, |
T4726 |
559-567 |
VBG |
denotes |
ensuring |
T4727 |
568-577 |
JJ |
denotes |
efficient |
T4728 |
578-582 |
NN |
denotes |
RMCE |
T4729 |
583-585 |
IN |
denotes |
in |
T4730 |
586-593 |
JJ |
denotes |
several |
T4732 |
594-598 |
NN |
denotes |
cell |
T4731 |
599-604 |
NNS |
denotes |
lines |
T4733 |
604-606 |
: |
denotes |
: |
T4734 |
606-614 |
JJ |
denotes |
accurate |
T4735 |
615-619 |
NN |
denotes |
RMCE |
T4736 |
620-624 |
IN |
denotes |
with |
T4737 |
625-630 |
DT |
denotes |
these |
T4739 |
631-635 |
NN |
denotes |
loxP |
T4738 |
636-641 |
NNS |
denotes |
sites |
T4718 |
642-650 |
VBD |
denotes |
occurred |
T4740 |
651-655 |
IN |
denotes |
with |
T4741 |
656-658 |
DT |
denotes |
an |
T4743 |
659-666 |
JJ |
denotes |
average |
T4742 |
667-676 |
NN |
denotes |
frequency |
T4744 |
677-679 |
IN |
denotes |
of |
T4745 |
680-682 |
CD |
denotes |
81 |
T4746 |
682-683 |
NN |
denotes |
% |
T4747 |
684-686 |
IN |
denotes |
at |
T4748 |
687-690 |
CD |
denotes |
two |
T4749 |
691-695 |
NNS |
denotes |
loci |
T4750 |
696-698 |
IN |
denotes |
in |
T4751 |
699-702 |
NN |
denotes |
CHO |
T4752 |
703-708 |
NNS |
denotes |
cells |
T4753 |
709-712 |
CC |
denotes |
and |
T4754 |
713-715 |
DT |
denotes |
an |
T4756 |
716-723 |
JJ |
denotes |
average |
T4755 |
724-733 |
NN |
denotes |
frequency |
T4757 |
734-736 |
IN |
denotes |
of |
T4758 |
737-739 |
CD |
denotes |
69 |
T4759 |
739-740 |
NN |
denotes |
% |
T4760 |
741-743 |
IN |
denotes |
at |
T4761 |
744-748 |
CD |
denotes |
four |
T4762 |
749-753 |
NNS |
denotes |
loci |
T4763 |
754-756 |
IN |
denotes |
in |
T4764 |
757-761 |
NN |
denotes |
Hela |
T4765 |
762-767 |
NNS |
denotes |
cells |
T4766 |
768-769 |
-LRB- |
denotes |
( |
T4767 |
769-771 |
CD |
denotes |
14 |
T4768 |
771-772 |
-RRB- |
denotes |
) |
T4769 |
772-773 |
. |
denotes |
. |
T4770 |
773-897 |
sentence |
denotes |
The L3-1L plasmid was first modified to include a ClaI and a FseI site between the LoxP sites, leading to plasmid L3-CF-1L. |
T4771 |
774-777 |
DT |
denotes |
The |
T4773 |
778-780 |
NN |
denotes |
L3 |
T4775 |
780-781 |
HYPH |
denotes |
- |
T4774 |
781-783 |
NN |
denotes |
1L |
T4772 |
784-791 |
NN |
denotes |
plasmid |
T4777 |
792-795 |
VBD |
denotes |
was |
T4778 |
796-801 |
RB |
denotes |
first |
T4776 |
802-810 |
VBN |
denotes |
modified |
T4779 |
811-813 |
TO |
denotes |
to |
T4780 |
814-821 |
VB |
denotes |
include |
T4781 |
822-823 |
DT |
denotes |
a |
T4782 |
824-828 |
NN |
denotes |
ClaI |
T4783 |
829-832 |
CC |
denotes |
and |
T4784 |
833-834 |
DT |
denotes |
a |
T4786 |
835-839 |
NN |
denotes |
FseI |
T4785 |
840-844 |
NN |
denotes |
site |
T4787 |
845-852 |
IN |
denotes |
between |
T4788 |
853-856 |
DT |
denotes |
the |
T4790 |
857-861 |
NN |
denotes |
LoxP |
T4789 |
862-867 |
NNS |
denotes |
sites |
T4791 |
867-869 |
, |
denotes |
, |
T4792 |
869-876 |
VBG |
denotes |
leading |
T4793 |
877-879 |
IN |
denotes |
to |
T4794 |
880-887 |
NN |
denotes |
plasmid |
T4796 |
888-890 |
NN |
denotes |
L3 |
T4797 |
890-891 |
HYPH |
denotes |
- |
T4798 |
891-893 |
NN |
denotes |
CF |
T4799 |
893-894 |
HYPH |
denotes |
- |
T4795 |
894-896 |
NN |
denotes |
1L |
T4800 |
896-897 |
. |
denotes |
. |
T4801 |
897-1159 |
sentence |
denotes |
We next modified a puroΔTK plasmid (YTC37, a kind gift from A. Bradley) by using oligonucleotides to destroy a NotI site downstream of the puroΔTK gene and introduce a NotI site upstream, and a FseI site downstream of the gene (leading to plasmid CN-PuroΔTK-F). |
T4802 |
898-900 |
PRP |
denotes |
We |
T4804 |
901-905 |
RB |
denotes |
next |
T4803 |
906-914 |
VBD |
denotes |
modified |
T4805 |
915-916 |
DT |
denotes |
a |
T4807 |
917-924 |
NN |
denotes |
puroΔTK |
T4806 |
925-932 |
NN |
denotes |
plasmid |
T4808 |
933-934 |
-LRB- |
denotes |
( |
T4809 |
934-939 |
NN |
denotes |
YTC37 |
T4810 |
939-941 |
, |
denotes |
, |
T4811 |
941-942 |
DT |
denotes |
a |
T4813 |
943-947 |
NN |
denotes |
kind |
T4812 |
948-952 |
NN |
denotes |
gift |
T4814 |
953-957 |
IN |
denotes |
from |
T4815 |
958-960 |
NNP |
denotes |
A. |
T4816 |
961-968 |
NNP |
denotes |
Bradley |
T4817 |
968-969 |
-RRB- |
denotes |
) |
T4818 |
970-972 |
IN |
denotes |
by |
T4819 |
973-978 |
VBG |
denotes |
using |
T4820 |
979-995 |
NNS |
denotes |
oligonucleotides |
T4821 |
996-998 |
TO |
denotes |
to |
T4822 |
999-1006 |
VB |
denotes |
destroy |
T4823 |
1007-1008 |
DT |
denotes |
a |
T4825 |
1009-1013 |
NN |
denotes |
NotI |
T4824 |
1014-1018 |
NN |
denotes |
site |
T4826 |
1019-1029 |
RB |
denotes |
downstream |
T4827 |
1030-1032 |
IN |
denotes |
of |
T4828 |
1033-1036 |
DT |
denotes |
the |
T4830 |
1037-1044 |
NN |
denotes |
puroΔTK |
T4829 |
1045-1049 |
NN |
denotes |
gene |
T4831 |
1050-1053 |
CC |
denotes |
and |
T4832 |
1054-1063 |
VB |
denotes |
introduce |
T4833 |
1064-1065 |
DT |
denotes |
a |
T4835 |
1066-1070 |
NN |
denotes |
NotI |
T4834 |
1071-1075 |
NN |
denotes |
site |
T4836 |
1076-1084 |
RB |
denotes |
upstream |
T4837 |
1084-1086 |
, |
denotes |
, |
T4838 |
1086-1089 |
CC |
denotes |
and |
T4839 |
1090-1091 |
DT |
denotes |
a |
T4841 |
1092-1096 |
NN |
denotes |
FseI |
T4840 |
1097-1101 |
NN |
denotes |
site |
T4842 |
1102-1112 |
RB |
denotes |
downstream |
T4843 |
1113-1115 |
IN |
denotes |
of |
T4844 |
1116-1119 |
DT |
denotes |
the |
T4845 |
1120-1124 |
NN |
denotes |
gene |
T4846 |
1125-1126 |
-LRB- |
denotes |
( |
T4847 |
1126-1133 |
VBG |
denotes |
leading |
T4848 |
1134-1136 |
IN |
denotes |
to |
T4849 |
1137-1144 |
NN |
denotes |
plasmid |
T4851 |
1145-1147 |
NN |
denotes |
CN |
T4852 |
1147-1148 |
HYPH |
denotes |
- |
T4853 |
1148-1155 |
NN |
denotes |
PuroΔTK |
T4854 |
1155-1156 |
HYPH |
denotes |
- |
T4850 |
1156-1157 |
NN |
denotes |
F |
T4855 |
1157-1158 |
-RRB- |
denotes |
) |
T4856 |
1158-1159 |
. |
denotes |
. |
T4857 |
1159-1407 |
sentence |
denotes |
Next, a PmlI-MfeI 6.3 kb fragment from Trp53 was subcloned in a modified pBluescript KSII+ (pBS, Stratagene), and the resulting plasmid was digested with SwaI to introduce an EagI site, leading to p53PmlEag, a plasmid containing exons 2–11 of p53. |
T4858 |
1160-1164 |
RB |
denotes |
Next |
T4860 |
1164-1166 |
, |
denotes |
, |
T4861 |
1166-1167 |
DT |
denotes |
a |
T4863 |
1168-1172 |
NN |
denotes |
PmlI |
T4865 |
1172-1173 |
HYPH |
denotes |
- |
T4864 |
1173-1177 |
NN |
denotes |
MfeI |
T4866 |
1178-1181 |
CD |
denotes |
6.3 |
T4867 |
1182-1184 |
NN |
denotes |
kb |
T4862 |
1185-1193 |
NN |
denotes |
fragment |
T4868 |
1194-1198 |
IN |
denotes |
from |
T4869 |
1199-1204 |
NN |
denotes |
Trp53 |
T4870 |
1205-1208 |
VBD |
denotes |
was |
T4859 |
1209-1218 |
VBN |
denotes |
subcloned |
T4871 |
1219-1221 |
IN |
denotes |
in |
T4872 |
1222-1223 |
DT |
denotes |
a |
T4874 |
1224-1232 |
VBN |
denotes |
modified |
T4875 |
1233-1244 |
NN |
denotes |
pBluescript |
T4873 |
1245-1250 |
NN |
denotes |
KSII+ |
T4876 |
1251-1252 |
-LRB- |
denotes |
( |
T4877 |
1252-1255 |
NN |
denotes |
pBS |
T4878 |
1255-1257 |
, |
denotes |
, |
T4879 |
1257-1267 |
NNP |
denotes |
Stratagene |
T4880 |
1267-1268 |
-RRB- |
denotes |
) |
T4881 |
1268-1270 |
, |
denotes |
, |
T4882 |
1270-1273 |
CC |
denotes |
and |
T4883 |
1274-1277 |
DT |
denotes |
the |
T4885 |
1278-1287 |
VBG |
denotes |
resulting |
T4884 |
1288-1295 |
NN |
denotes |
plasmid |
T4887 |
1296-1299 |
VBD |
denotes |
was |
T4886 |
1300-1308 |
VBN |
denotes |
digested |
T4888 |
1309-1313 |
IN |
denotes |
with |
T4889 |
1314-1318 |
NN |
denotes |
SwaI |
T4890 |
1319-1321 |
TO |
denotes |
to |
T4891 |
1322-1331 |
VB |
denotes |
introduce |
T4892 |
1332-1334 |
DT |
denotes |
an |
T4894 |
1335-1339 |
NN |
denotes |
EagI |
T4893 |
1340-1344 |
NN |
denotes |
site |
T4895 |
1344-1346 |
, |
denotes |
, |
T4896 |
1346-1353 |
VBG |
denotes |
leading |
T4897 |
1354-1356 |
IN |
denotes |
to |
T4898 |
1357-1366 |
NN |
denotes |
p53PmlEag |
T4899 |
1366-1368 |
, |
denotes |
, |
T4900 |
1368-1369 |
DT |
denotes |
a |
T4901 |
1370-1377 |
NN |
denotes |
plasmid |
T4902 |
1378-1388 |
VBG |
denotes |
containing |
T4903 |
1389-1394 |
NNS |
denotes |
exons |
T4905 |
1395-1396 |
CD |
denotes |
2 |
T4906 |
1396-1397 |
HYPH |
denotes |
– |
T4904 |
1397-1399 |
CD |
denotes |
11 |
T4907 |
1400-1402 |
IN |
denotes |
of |
T4908 |
1403-1406 |
NN |
denotes |
p53 |
T4909 |
1406-1407 |
. |
denotes |
. |
T4910 |
1407-1652 |
sentence |
denotes |
We then inserted a 5.5 kb ClaI-EagI fragment from p53PmlEag in plasmid CN-PuroΔTK-F digested by ClaI and NotI, and inserted the resulting fragment between the loxP sites of L3-CF-1L by ClaI and FseI digestion, leading to L3-p53PmlEagPuroΔTK-1L. |
T4911 |
1408-1410 |
PRP |
denotes |
We |
T4913 |
1411-1415 |
RB |
denotes |
then |
T4912 |
1416-1424 |
VBD |
denotes |
inserted |
T4914 |
1425-1426 |
DT |
denotes |
a |
T4916 |
1427-1430 |
CD |
denotes |
5.5 |
T4917 |
1431-1433 |
NN |
denotes |
kb |
T4918 |
1434-1438 |
NN |
denotes |
ClaI |
T4920 |
1438-1439 |
HYPH |
denotes |
- |
T4919 |
1439-1443 |
NN |
denotes |
EagI |
T4915 |
1444-1452 |
NN |
denotes |
fragment |
T4921 |
1453-1457 |
IN |
denotes |
from |
T4922 |
1458-1467 |
NN |
denotes |
p53PmlEag |
T4923 |
1468-1470 |
IN |
denotes |
in |
T4924 |
1471-1478 |
NN |
denotes |
plasmid |
T4926 |
1479-1481 |
NN |
denotes |
CN |
T4927 |
1481-1482 |
HYPH |
denotes |
- |
T4928 |
1482-1489 |
NN |
denotes |
PuroΔTK |
T4929 |
1489-1490 |
HYPH |
denotes |
- |
T4925 |
1490-1491 |
NN |
denotes |
F |
T4930 |
1492-1500 |
VBN |
denotes |
digested |
T4931 |
1501-1503 |
IN |
denotes |
by |
T4932 |
1504-1508 |
NN |
denotes |
ClaI |
T4933 |
1509-1512 |
CC |
denotes |
and |
T4934 |
1513-1517 |
NN |
denotes |
NotI |
T4935 |
1517-1519 |
, |
denotes |
, |
T4936 |
1519-1522 |
CC |
denotes |
and |
T4937 |
1523-1531 |
VBD |
denotes |
inserted |
T4938 |
1532-1535 |
DT |
denotes |
the |
T4940 |
1536-1545 |
VBG |
denotes |
resulting |
T4939 |
1546-1554 |
NN |
denotes |
fragment |
T4941 |
1555-1562 |
IN |
denotes |
between |
T4942 |
1563-1566 |
DT |
denotes |
the |
T4944 |
1567-1571 |
NN |
denotes |
loxP |
T4943 |
1572-1577 |
NNS |
denotes |
sites |
T4945 |
1578-1580 |
IN |
denotes |
of |
T4946 |
1581-1583 |
NN |
denotes |
L3 |
T4948 |
1583-1584 |
HYPH |
denotes |
- |
T4949 |
1584-1586 |
NN |
denotes |
CF |
T4950 |
1586-1587 |
HYPH |
denotes |
- |
T4947 |
1587-1589 |
NN |
denotes |
1L |
T4951 |
1590-1592 |
IN |
denotes |
by |
T4952 |
1593-1597 |
NN |
denotes |
ClaI |
T4954 |
1598-1601 |
CC |
denotes |
and |
T4955 |
1602-1606 |
NN |
denotes |
FseI |
T4953 |
1607-1616 |
NN |
denotes |
digestion |
T4956 |
1616-1618 |
, |
denotes |
, |
T4957 |
1618-1625 |
VBG |
denotes |
leading |
T4958 |
1626-1628 |
IN |
denotes |
to |
T4959 |
1629-1631 |
NN |
denotes |
L3 |
T4961 |
1631-1632 |
HYPH |
denotes |
- |
T4962 |
1632-1648 |
NN |
denotes |
p53PmlEagPuroΔTK |
T4963 |
1648-1649 |
HYPH |
denotes |
- |
T4960 |
1649-1651 |
NN |
denotes |
1L |
T4964 |
1651-1652 |
. |
denotes |
. |
T4965 |
1652-2242 |
sentence |
denotes |
We next engineered a plasmid containing the region for 3′-homology downstream of the p53 gene and the DTA gene in two steps: (i) we performed a three-way ligation between a modified pBS digested by HindIII and NotI, a HindIII-EcoRI fragment from Trp53 for 3′homology and an EcoRI-NotI fragment containing the DTA gene, from plasmid pgkdtabpa (kind gift of P. Soriano), leading to plasmid 3′ + DTA and (ii) because the Bsu36I-EcoRI region downstream of p53 contains repetitive sequences (F. Toledo and G. M. Wahl, unpublished data), we later deleted this region, to obtain plasmid 3′ + DTA. |
T4966 |
1653-1655 |
PRP |
denotes |
We |
T4968 |
1656-1660 |
RB |
denotes |
next |
T4967 |
1661-1671 |
VBD |
denotes |
engineered |
T4970 |
1672-1673 |
DT |
denotes |
a |
T4971 |
1674-1681 |
NN |
denotes |
plasmid |
T4972 |
1682-1692 |
VBG |
denotes |
containing |
T4973 |
1693-1696 |
DT |
denotes |
the |
T4974 |
1697-1703 |
NN |
denotes |
region |
T4975 |
1704-1707 |
IN |
denotes |
for |
T4976 |
1708-1709 |
CD |
denotes |
3 |
T4977 |
1709-1710 |
SYM |
denotes |
′ |
T4978 |
1710-1711 |
SYM |
denotes |
- |
T4979 |
1711-1719 |
JJ |
denotes |
homology |
T4980 |
1720-1730 |
RB |
denotes |
downstream |
T4981 |
1731-1733 |
IN |
denotes |
of |
T4982 |
1734-1737 |
DT |
denotes |
the |
T4984 |
1738-1741 |
NN |
denotes |
p53 |
T4983 |
1742-1746 |
NN |
denotes |
gene |
T4985 |
1747-1750 |
CC |
denotes |
and |
T4986 |
1751-1754 |
DT |
denotes |
the |
T4988 |
1755-1758 |
NN |
denotes |
DTA |
T4987 |
1759-1763 |
NN |
denotes |
gene |
T4989 |
1764-1766 |
IN |
denotes |
in |
T4990 |
1767-1770 |
CD |
denotes |
two |
T4991 |
1771-1776 |
NNS |
denotes |
steps |
T4992 |
1776-1778 |
: |
denotes |
: |
T4993 |
1778-1779 |
-LRB- |
denotes |
( |
T4994 |
1779-1780 |
LS |
denotes |
i |
T4995 |
1780-1781 |
-RRB- |
denotes |
) |
T4996 |
1782-1784 |
PRP |
denotes |
we |
T4969 |
1785-1794 |
VBD |
denotes |
performed |
T4997 |
1795-1796 |
DT |
denotes |
a |
T4999 |
1797-1802 |
CD |
denotes |
three |
T5001 |
1802-1803 |
HYPH |
denotes |
- |
T5000 |
1803-1806 |
NN |
denotes |
way |
T4998 |
1807-1815 |
NN |
denotes |
ligation |
T5002 |
1816-1823 |
IN |
denotes |
between |
T5003 |
1824-1825 |
DT |
denotes |
a |
T5005 |
1826-1834 |
VBN |
denotes |
modified |
T5004 |
1835-1838 |
NN |
denotes |
pBS |
T5006 |
1839-1847 |
VBN |
denotes |
digested |
T5007 |
1848-1850 |
IN |
denotes |
by |
T5008 |
1851-1858 |
NN |
denotes |
HindIII |
T5009 |
1859-1862 |
CC |
denotes |
and |
T5010 |
1863-1867 |
NN |
denotes |
NotI |
T5011 |
1867-1869 |
, |
denotes |
, |
T5012 |
1869-1870 |
DT |
denotes |
a |
T5014 |
1871-1878 |
NN |
denotes |
HindIII |
T5016 |
1878-1879 |
HYPH |
denotes |
- |
T5015 |
1879-1884 |
NN |
denotes |
EcoRI |
T5013 |
1885-1893 |
NN |
denotes |
fragment |
T5017 |
1894-1898 |
IN |
denotes |
from |
T5018 |
1899-1904 |
NN |
denotes |
Trp53 |
T5019 |
1905-1908 |
IN |
denotes |
for |
T5020 |
1909-1910 |
CD |
denotes |
3 |
T5022 |
1910-1911 |
SYM |
denotes |
′ |
T5021 |
1911-1919 |
NN |
denotes |
homology |
T5023 |
1920-1923 |
CC |
denotes |
and |
T5024 |
1924-1926 |
DT |
denotes |
an |
T5026 |
1927-1932 |
NN |
denotes |
EcoRI |
T5028 |
1932-1933 |
HYPH |
denotes |
- |
T5027 |
1933-1937 |
NN |
denotes |
NotI |
T5025 |
1938-1946 |
NN |
denotes |
fragment |
T5029 |
1947-1957 |
VBG |
denotes |
containing |
T5030 |
1958-1961 |
DT |
denotes |
the |
T5032 |
1962-1965 |
NN |
denotes |
DTA |
T5031 |
1966-1970 |
NN |
denotes |
gene |
T5033 |
1970-1972 |
, |
denotes |
, |
T5034 |
1972-1976 |
IN |
denotes |
from |
T5035 |
1977-1984 |
NN |
denotes |
plasmid |
T5036 |
1985-1994 |
NN |
denotes |
pgkdtabpa |
T5037 |
1995-1996 |
-LRB- |
denotes |
( |
T5038 |
1996-2000 |
JJ |
denotes |
kind |
T5039 |
2001-2005 |
NN |
denotes |
gift |
T5040 |
2006-2008 |
IN |
denotes |
of |
T5041 |
2009-2011 |
NNP |
denotes |
P. |
T5042 |
2012-2019 |
NNP |
denotes |
Soriano |
T5043 |
2019-2020 |
-RRB- |
denotes |
) |
T5044 |
2020-2022 |
, |
denotes |
, |
T5045 |
2022-2029 |
VBG |
denotes |
leading |
T5046 |
2030-2032 |
IN |
denotes |
to |
T5047 |
2033-2040 |
NN |
denotes |
plasmid |
T5049 |
2041-2042 |
CD |
denotes |
3 |
T5050 |
2042-2043 |
SYM |
denotes |
′ |
T5051 |
2044-2045 |
SYM |
denotes |
+ |
T5048 |
2046-2049 |
NN |
denotes |
DTA |
T5052 |
2050-2053 |
CC |
denotes |
and |
T5053 |
2054-2055 |
-LRB- |
denotes |
( |
T5054 |
2055-2057 |
LS |
denotes |
ii |
T5056 |
2057-2058 |
-RRB- |
denotes |
) |
T5057 |
2059-2066 |
IN |
denotes |
because |
T5059 |
2067-2070 |
DT |
denotes |
the |
T5061 |
2071-2077 |
NN |
denotes |
Bsu36I |
T5063 |
2077-2078 |
HYPH |
denotes |
- |
T5062 |
2078-2083 |
NN |
denotes |
EcoRI |
T5060 |
2084-2090 |
NN |
denotes |
region |
T5064 |
2091-2101 |
RB |
denotes |
downstream |
T5065 |
2102-2104 |
IN |
denotes |
of |
T5066 |
2105-2108 |
NN |
denotes |
p53 |
T5058 |
2109-2117 |
VBZ |
denotes |
contains |
T5067 |
2118-2128 |
JJ |
denotes |
repetitive |
T5068 |
2129-2138 |
NNS |
denotes |
sequences |
T5069 |
2139-2140 |
-LRB- |
denotes |
( |
T5070 |
2140-2142 |
NNP |
denotes |
F. |
T5071 |
2143-2149 |
NNP |
denotes |
Toledo |
T5072 |
2150-2153 |
CC |
denotes |
and |
T5073 |
2154-2156 |
NNP |
denotes |
G. |
T5074 |
2157-2159 |
NNP |
denotes |
M. |
T5075 |
2160-2164 |
NNP |
denotes |
Wahl |
T5076 |
2164-2166 |
, |
denotes |
, |
T5077 |
2166-2177 |
JJ |
denotes |
unpublished |
T5078 |
2178-2182 |
NNS |
denotes |
data |
T5079 |
2182-2183 |
-RRB- |
denotes |
) |
T5080 |
2183-2185 |
, |
denotes |
, |
T5081 |
2185-2187 |
PRP |
denotes |
we |
T5082 |
2188-2193 |
RB |
denotes |
later |
T5055 |
2194-2201 |
VBD |
denotes |
deleted |
T5083 |
2202-2206 |
DT |
denotes |
this |
T5084 |
2207-2213 |
NN |
denotes |
region |
T5085 |
2213-2215 |
, |
denotes |
, |
T5086 |
2215-2217 |
TO |
denotes |
to |
T5087 |
2218-2224 |
VB |
denotes |
obtain |
T5088 |
2225-2232 |
NN |
denotes |
plasmid |
T5090 |
2233-2234 |
CD |
denotes |
3 |
T5091 |
2234-2235 |
SYM |
denotes |
′ |
T5092 |
2236-2237 |
SYM |
denotes |
+ |
T5089 |
2238-2241 |
NN |
denotes |
DTA |
T5093 |
2241-2242 |
. |
denotes |
. |
T5094 |
2242-2365 |
sentence |
denotes |
The 5′ homology consists of a 3.4 kb-long BamHI-PmlI fragment from intron 1 of p53 cloned in a modified pBS (plasmid p5′). |
T5095 |
2243-2246 |
DT |
denotes |
The |
T5097 |
2247-2248 |
CD |
denotes |
5 |
T5098 |
2248-2249 |
SYM |
denotes |
′ |
T5096 |
2250-2258 |
NN |
denotes |
homology |
T5099 |
2259-2267 |
VBZ |
denotes |
consists |
T5100 |
2268-2270 |
IN |
denotes |
of |
T5101 |
2271-2272 |
DT |
denotes |
a |
T5103 |
2273-2276 |
CD |
denotes |
3.4 |
T5104 |
2277-2279 |
NN |
denotes |
kb |
T5106 |
2279-2280 |
HYPH |
denotes |
- |
T5105 |
2280-2284 |
JJ |
denotes |
long |
T5107 |
2285-2290 |
NN |
denotes |
BamHI |
T5109 |
2290-2291 |
HYPH |
denotes |
- |
T5108 |
2291-2295 |
NN |
denotes |
PmlI |
T5102 |
2296-2304 |
NN |
denotes |
fragment |
T5110 |
2305-2309 |
IN |
denotes |
from |
T5111 |
2310-2316 |
NN |
denotes |
intron |
T5112 |
2317-2318 |
CD |
denotes |
1 |
T5113 |
2319-2321 |
IN |
denotes |
of |
T5114 |
2322-2325 |
NN |
denotes |
p53 |
T5115 |
2326-2332 |
VBN |
denotes |
cloned |
T5116 |
2333-2335 |
IN |
denotes |
in |
T5117 |
2336-2337 |
DT |
denotes |
a |
T5119 |
2338-2346 |
VBN |
denotes |
modified |
T5118 |
2347-2350 |
NN |
denotes |
pBS |
T5120 |
2351-2352 |
-LRB- |
denotes |
( |
T5121 |
2352-2359 |
NN |
denotes |
plasmid |
T5122 |
2360-2362 |
NN |
denotes |
p5 |
T5123 |
2362-2363 |
SYM |
denotes |
′ |
T5124 |
2363-2364 |
-RRB- |
denotes |
) |
T5125 |
2364-2365 |
. |
denotes |
. |
T5126 |
2365-2506 |
sentence |
denotes |
Finally, appropriate fragments from plasmids p5′, L3-p53PmlEagPuroΔTK-1L, and 3′ + DTA were assembled in a modified pSP72 plasmid (Promega). |
T5127 |
2366-2373 |
RB |
denotes |
Finally |
T5129 |
2373-2375 |
, |
denotes |
, |
T5130 |
2375-2386 |
JJ |
denotes |
appropriate |
T5131 |
2387-2396 |
NNS |
denotes |
fragments |
T5132 |
2397-2401 |
IN |
denotes |
from |
T5133 |
2402-2410 |
NNS |
denotes |
plasmids |
T5134 |
2411-2413 |
NN |
denotes |
p5 |
T5135 |
2413-2414 |
SYM |
denotes |
′ |
T5136 |
2414-2416 |
, |
denotes |
, |
T5137 |
2416-2418 |
NN |
denotes |
L3 |
T5139 |
2418-2419 |
HYPH |
denotes |
- |
T5140 |
2419-2435 |
NN |
denotes |
p53PmlEagPuroΔTK |
T5141 |
2435-2436 |
HYPH |
denotes |
- |
T5138 |
2436-2438 |
NN |
denotes |
1L |
T5142 |
2438-2440 |
, |
denotes |
, |
T5143 |
2440-2443 |
CC |
denotes |
and |
T5144 |
2444-2445 |
CD |
denotes |
3 |
T5146 |
2445-2446 |
SYM |
denotes |
′ |
T5147 |
2447-2448 |
SYM |
denotes |
+ |
T5145 |
2449-2452 |
NN |
denotes |
DTA |
T5148 |
2453-2457 |
VBD |
denotes |
were |
T5128 |
2458-2467 |
VBN |
denotes |
assembled |
T5149 |
2468-2470 |
IN |
denotes |
in |
T5150 |
2471-2472 |
DT |
denotes |
a |
T5152 |
2473-2481 |
VBN |
denotes |
modified |
T5153 |
2482-2487 |
NN |
denotes |
pSP72 |
T5151 |
2488-2495 |
NN |
denotes |
plasmid |
T5154 |
2496-2497 |
-LRB- |
denotes |
( |
T5155 |
2497-2504 |
NNP |
denotes |
Promega |
T5156 |
2504-2505 |
-RRB- |
denotes |
) |
T5157 |
2505-2506 |
. |
denotes |
. |
T5158 |
2506-2752 |
sentence |
denotes |
Plasmid Flox, the resulting targeting construct, was verified by restriction analysis, then sequenced using 30 primers chosen to precisely verify all p53 coding sequences, all exon–intron junctions and the sequences at and around the loxP sites. |
T5159 |
2507-2514 |
NN |
denotes |
Plasmid |
T5160 |
2515-2519 |
NN |
denotes |
Flox |
T5162 |
2519-2521 |
, |
denotes |
, |
T5163 |
2521-2524 |
DT |
denotes |
the |
T5165 |
2525-2534 |
VBG |
denotes |
resulting |
T5166 |
2535-2544 |
NN |
denotes |
targeting |
T5164 |
2545-2554 |
NN |
denotes |
construct |
T5167 |
2554-2556 |
, |
denotes |
, |
T5168 |
2556-2559 |
VBD |
denotes |
was |
T5161 |
2560-2568 |
VBN |
denotes |
verified |
T5169 |
2569-2571 |
IN |
denotes |
by |
T5170 |
2572-2583 |
NN |
denotes |
restriction |
T5171 |
2584-2592 |
NN |
denotes |
analysis |
T5172 |
2592-2594 |
, |
denotes |
, |
T5173 |
2594-2598 |
RB |
denotes |
then |
T5174 |
2599-2608 |
VBN |
denotes |
sequenced |
T5175 |
2609-2614 |
VBG |
denotes |
using |
T5176 |
2615-2617 |
CD |
denotes |
30 |
T5177 |
2618-2625 |
NNS |
denotes |
primers |
T5178 |
2626-2632 |
VBN |
denotes |
chosen |
T5179 |
2633-2635 |
TO |
denotes |
to |
T5181 |
2636-2645 |
RB |
denotes |
precisely |
T5180 |
2646-2652 |
VB |
denotes |
verify |
T5182 |
2653-2656 |
DT |
denotes |
all |
T5184 |
2657-2660 |
NN |
denotes |
p53 |
T5185 |
2661-2667 |
NN |
denotes |
coding |
T5183 |
2668-2677 |
NNS |
denotes |
sequences |
T5186 |
2677-2679 |
, |
denotes |
, |
T5187 |
2679-2682 |
DT |
denotes |
all |
T5189 |
2683-2687 |
NN |
denotes |
exon |
T5191 |
2687-2688 |
HYPH |
denotes |
– |
T5190 |
2688-2694 |
NN |
denotes |
intron |
T5188 |
2695-2704 |
NNS |
denotes |
junctions |
T5192 |
2705-2708 |
CC |
denotes |
and |
T5193 |
2709-2712 |
DT |
denotes |
the |
T5194 |
2713-2722 |
NNS |
denotes |
sequences |
T5195 |
2723-2725 |
IN |
denotes |
at |
T5196 |
2726-2729 |
CC |
denotes |
and |
T5197 |
2730-2736 |
IN |
denotes |
around |
T5198 |
2737-2740 |
DT |
denotes |
the |
T5200 |
2741-2745 |
NN |
denotes |
loxP |
T5199 |
2746-2751 |
NNS |
denotes |
sites |
T5201 |
2751-2752 |
. |
denotes |
. |
T5752 |
2754-2762 |
NN |
denotes |
Exchange |
T5753 |
2763-2773 |
NNS |
denotes |
constructs |
T5754 |
2773-2775 |
: |
denotes |
: |
T5755 |
2775-2781 |
VBG |
denotes |
making |
T5756 |
2782-2785 |
DT |
denotes |
the |
T5757 |
2786-2792 |
NN |
denotes |
p53GFP |
T5759 |
2793-2796 |
CC |
denotes |
and |
T5760 |
2797-2800 |
NN |
denotes |
p53 |
T5762 |
2800-2801 |
NN |
denotes |
Δ |
T5761 |
2801-2805 |
NN |
denotes |
PGFP |
T5758 |
2806-2814 |
NNS |
denotes |
plasmids |
T5763 |
2814-3038 |
sentence |
denotes |
To make a p53-GFP fusion protein, we first subcloned a SacII-HindIII fragment of the p53 locus (corresponding to part of exon 10 to sequences downstream of the gene) into pBS, then mutated the HindIII site into a FseI site. |
T5764 |
2815-2817 |
TO |
denotes |
To |
T5765 |
2818-2822 |
VB |
denotes |
make |
T5767 |
2823-2824 |
DT |
denotes |
a |
T5769 |
2825-2828 |
NN |
denotes |
p53 |
T5771 |
2828-2829 |
HYPH |
denotes |
- |
T5770 |
2829-2832 |
NN |
denotes |
GFP |
T5772 |
2833-2839 |
NN |
denotes |
fusion |
T5768 |
2840-2847 |
NN |
denotes |
protein |
T5773 |
2847-2849 |
, |
denotes |
, |
T5774 |
2849-2851 |
PRP |
denotes |
we |
T5775 |
2852-2857 |
RB |
denotes |
first |
T5766 |
2858-2867 |
VBD |
denotes |
subcloned |
T5776 |
2868-2869 |
DT |
denotes |
a |
T5778 |
2870-2875 |
NN |
denotes |
SacII |
T5780 |
2875-2876 |
HYPH |
denotes |
- |
T5779 |
2876-2883 |
NN |
denotes |
HindIII |
T5777 |
2884-2892 |
NN |
denotes |
fragment |
T5781 |
2893-2895 |
IN |
denotes |
of |
T5782 |
2896-2899 |
DT |
denotes |
the |
T5784 |
2900-2903 |
NN |
denotes |
p53 |
T5783 |
2904-2909 |
NN |
denotes |
locus |
T5785 |
2910-2911 |
-LRB- |
denotes |
( |
T5786 |
2911-2924 |
VBG |
denotes |
corresponding |
T5787 |
2925-2927 |
IN |
denotes |
to |
T5788 |
2928-2932 |
NN |
denotes |
part |
T5789 |
2933-2935 |
IN |
denotes |
of |
T5790 |
2936-2940 |
NN |
denotes |
exon |
T5791 |
2941-2943 |
CD |
denotes |
10 |
T5792 |
2944-2946 |
IN |
denotes |
to |
T5793 |
2947-2956 |
NNS |
denotes |
sequences |
T5794 |
2957-2967 |
RB |
denotes |
downstream |
T5795 |
2968-2970 |
IN |
denotes |
of |
T5796 |
2971-2974 |
DT |
denotes |
the |
T5797 |
2975-2979 |
NN |
denotes |
gene |
T5798 |
2979-2980 |
-RRB- |
denotes |
) |
T5799 |
2981-2985 |
IN |
denotes |
into |
T5800 |
2986-2989 |
NN |
denotes |
pBS |
T5801 |
2989-2991 |
, |
denotes |
, |
T5802 |
2991-2995 |
RB |
denotes |
then |
T5803 |
2996-3003 |
VBD |
denotes |
mutated |
T5804 |
3004-3007 |
DT |
denotes |
the |
T5806 |
3008-3015 |
NN |
denotes |
HindIII |
T5805 |
3016-3020 |
NN |
denotes |
site |
T5807 |
3021-3025 |
IN |
denotes |
into |
T5808 |
3026-3027 |
DT |
denotes |
a |
T5810 |
3028-3032 |
NN |
denotes |
FseI |
T5809 |
3033-3037 |
NN |
denotes |
site |
T5811 |
3037-3038 |
. |
denotes |
. |
T5812 |
3038-3429 |
sentence |
denotes |
We next mutated the C-terminal part of the p53 gene in two rounds of PCR mutagenesis, first with primers 5′-GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC-3′ and 5′-GACGGGATGCAGAGGGGATCCGTCTGAGTCAGGCCC-3′, which removed the stop codon and introduced a BamHI site, then with primers 5′-GACGGATCCCCTCTGAATTCCGTCCCCATCACCA-3′ and 5′-TGGTGATGGGGACGGAATACAGAGGGGATCCGTC-3′, which introduced an EcoRI site. |
T5813 |
3039-3041 |
PRP |
denotes |
We |
T5815 |
3042-3046 |
RB |
denotes |
next |
T5814 |
3047-3054 |
VBD |
denotes |
mutated |
T5816 |
3055-3058 |
DT |
denotes |
the |
T5818 |
3059-3060 |
NN |
denotes |
C |
T5820 |
3060-3061 |
HYPH |
denotes |
- |
T5819 |
3061-3069 |
JJ |
denotes |
terminal |
T5817 |
3070-3074 |
NN |
denotes |
part |
T5821 |
3075-3077 |
IN |
denotes |
of |
T5822 |
3078-3081 |
DT |
denotes |
the |
T5824 |
3082-3085 |
NN |
denotes |
p53 |
T5823 |
3086-3090 |
NN |
denotes |
gene |
T5825 |
3091-3093 |
IN |
denotes |
in |
T5826 |
3094-3097 |
CD |
denotes |
two |
T5827 |
3098-3104 |
NNS |
denotes |
rounds |
T5828 |
3105-3107 |
IN |
denotes |
of |
T5829 |
3108-3111 |
NN |
denotes |
PCR |
T5830 |
3112-3123 |
NN |
denotes |
mutagenesis |
T5831 |
3123-3125 |
, |
denotes |
, |
T5832 |
3125-3130 |
RB |
denotes |
first |
T5833 |
3131-3135 |
IN |
denotes |
with |
T5834 |
3136-3143 |
NNS |
denotes |
primers |
T5836 |
3144-3145 |
CD |
denotes |
5 |
T5837 |
3145-3146 |
SYM |
denotes |
′ |
T5838 |
3146-3147 |
HYPH |
denotes |
- |
T5835 |
3147-3183 |
NN |
denotes |
GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
T5839 |
3183-3184 |
HYPH |
denotes |
- |
T5840 |
3184-3185 |
CD |
denotes |
3 |
T5841 |
3185-3186 |
SYM |
denotes |
′ |
T5842 |
3187-3190 |
CC |
denotes |
and |
T5843 |
3191-3192 |
CD |
denotes |
5 |
T5845 |
3192-3193 |
SYM |
denotes |
′ |
T5846 |
3193-3194 |
HYPH |
denotes |
- |
T5844 |
3194-3230 |
NN |
denotes |
GACGGGATGCAGAGGGGATCCGTCTGAGTCAGGCCC |
T5847 |
3230-3231 |
HYPH |
denotes |
- |
T5848 |
3231-3232 |
CD |
denotes |
3 |
T5849 |
3232-3233 |
SYM |
denotes |
′ |
T5850 |
3233-3235 |
, |
denotes |
, |
T5851 |
3235-3240 |
WDT |
denotes |
which |
T5852 |
3241-3248 |
VBD |
denotes |
removed |
T5853 |
3249-3252 |
DT |
denotes |
the |
T5855 |
3253-3257 |
NN |
denotes |
stop |
T5854 |
3258-3263 |
NN |
denotes |
codon |
T5856 |
3264-3267 |
CC |
denotes |
and |
T5857 |
3268-3278 |
VBD |
denotes |
introduced |
T5858 |
3279-3280 |
DT |
denotes |
a |
T5860 |
3281-3286 |
NN |
denotes |
BamHI |
T5859 |
3287-3291 |
NN |
denotes |
site |
T5861 |
3291-3293 |
, |
denotes |
, |
T5862 |
3293-3297 |
RB |
denotes |
then |
T5863 |
3298-3302 |
IN |
denotes |
with |
T5864 |
3303-3310 |
NNS |
denotes |
primers |
T5866 |
3311-3312 |
CD |
denotes |
5 |
T5867 |
3312-3313 |
SYM |
denotes |
′ |
T5868 |
3313-3314 |
HYPH |
denotes |
- |
T5865 |
3314-3348 |
NN |
denotes |
GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
T5869 |
3348-3349 |
HYPH |
denotes |
- |
T5870 |
3349-3350 |
CD |
denotes |
3 |
T5871 |
3350-3351 |
SYM |
denotes |
′ |
T5872 |
3352-3355 |
CC |
denotes |
and |
T5873 |
3356-3357 |
CD |
denotes |
5 |
T5875 |
3357-3358 |
SYM |
denotes |
′ |
T5876 |
3358-3359 |
HYPH |
denotes |
- |
T5874 |
3359-3393 |
NN |
denotes |
TGGTGATGGGGACGGAATACAGAGGGGATCCGTC |
T5877 |
3393-3394 |
HYPH |
denotes |
- |
T5878 |
3394-3395 |
CD |
denotes |
3 |
T5879 |
3395-3396 |
SYM |
denotes |
′ |
T5880 |
3396-3398 |
, |
denotes |
, |
T5881 |
3398-3403 |
WDT |
denotes |
which |
T5882 |
3404-3414 |
VBD |
denotes |
introduced |
T5883 |
3415-3417 |
DT |
denotes |
an |
T5885 |
3418-3423 |
NN |
denotes |
EcoRI |
T5884 |
3424-3428 |
NN |
denotes |
site |
T5886 |
3428-3429 |
. |
denotes |
. |
T5887 |
3429-3616 |
sentence |
denotes |
We verified the sequence from the mutated plasmid, then digested it with BamHI and EcoRI, to insert in frame GFP sequences from a Bam HI-EcoRI fragment of plasmid phr-GFP-1 (Stratagene). |
T5888 |
3430-3432 |
PRP |
denotes |
We |
T5889 |
3433-3441 |
VBD |
denotes |
verified |
T5890 |
3442-3445 |
DT |
denotes |
the |
T5891 |
3446-3454 |
NN |
denotes |
sequence |
T5892 |
3455-3459 |
IN |
denotes |
from |
T5893 |
3460-3463 |
DT |
denotes |
the |
T5895 |
3464-3471 |
VBN |
denotes |
mutated |
T5894 |
3472-3479 |
NN |
denotes |
plasmid |
T5896 |
3479-3481 |
, |
denotes |
, |
T5897 |
3481-3485 |
RB |
denotes |
then |
T5898 |
3486-3494 |
VBD |
denotes |
digested |
T5899 |
3495-3497 |
PRP |
denotes |
it |
T5900 |
3498-3502 |
IN |
denotes |
with |
T5901 |
3503-3508 |
NN |
denotes |
BamHI |
T5902 |
3509-3512 |
CC |
denotes |
and |
T5903 |
3513-3518 |
NN |
denotes |
EcoRI |
T5904 |
3518-3520 |
, |
denotes |
, |
T5905 |
3520-3522 |
TO |
denotes |
to |
T5906 |
3523-3529 |
VB |
denotes |
insert |
T5907 |
3530-3532 |
IN |
denotes |
in |
T5908 |
3533-3538 |
NN |
denotes |
frame |
T5909 |
3539-3542 |
NN |
denotes |
GFP |
T5910 |
3543-3552 |
NNS |
denotes |
sequences |
T5911 |
3553-3557 |
IN |
denotes |
from |
T5912 |
3558-3559 |
DT |
denotes |
a |
T5914 |
3560-3563 |
NN |
denotes |
Bam |
T5916 |
3564-3566 |
NN |
denotes |
HI |
T5917 |
3566-3567 |
HYPH |
denotes |
- |
T5915 |
3567-3572 |
NN |
denotes |
EcoRI |
T5913 |
3573-3581 |
NN |
denotes |
fragment |
T5918 |
3582-3584 |
IN |
denotes |
of |
T5919 |
3585-3592 |
NN |
denotes |
plasmid |
T5921 |
3593-3596 |
NN |
denotes |
phr |
T5922 |
3596-3597 |
HYPH |
denotes |
- |
T5920 |
3597-3600 |
NN |
denotes |
GFP |
T5923 |
3600-3601 |
HYPH |
denotes |
- |
T5924 |
3601-3602 |
CD |
denotes |
1 |
T5925 |
3603-3604 |
-LRB- |
denotes |
( |
T5926 |
3604-3614 |
NNP |
denotes |
Stratagene |
T5927 |
3614-3615 |
-RRB- |
denotes |
) |
T5928 |
3615-3616 |
. |
denotes |
. |
T5929 |
3616-3859 |
sentence |
denotes |
We verified the sequence of this p53-GFP fusion fragment, then swapped it in the L3-p53PmlEagPuroΔTK-1L plasmid (see above) by HindIII and FseI digestion, resulting in the p53GFP exchange construct, the sequence which was verified before use. |
T5930 |
3617-3619 |
PRP |
denotes |
We |
T5931 |
3620-3628 |
VBD |
denotes |
verified |
T5932 |
3629-3632 |
DT |
denotes |
the |
T5933 |
3633-3641 |
NN |
denotes |
sequence |
T5934 |
3642-3644 |
IN |
denotes |
of |
T5935 |
3645-3649 |
DT |
denotes |
this |
T5937 |
3650-3653 |
NN |
denotes |
p53 |
T5939 |
3653-3654 |
HYPH |
denotes |
- |
T5938 |
3654-3657 |
NN |
denotes |
GFP |
T5940 |
3658-3664 |
NN |
denotes |
fusion |
T5936 |
3665-3673 |
NN |
denotes |
fragment |
T5941 |
3673-3675 |
, |
denotes |
, |
T5942 |
3675-3679 |
RB |
denotes |
then |
T5943 |
3680-3687 |
VBD |
denotes |
swapped |
T5944 |
3688-3690 |
PRP |
denotes |
it |
T5945 |
3691-3693 |
IN |
denotes |
in |
T5946 |
3694-3697 |
DT |
denotes |
the |
T5948 |
3698-3700 |
NN |
denotes |
L3 |
T5950 |
3700-3701 |
HYPH |
denotes |
- |
T5951 |
3701-3717 |
NN |
denotes |
p53PmlEagPuroΔTK |
T5952 |
3717-3718 |
HYPH |
denotes |
- |
T5949 |
3718-3720 |
NN |
denotes |
1L |
T5947 |
3721-3728 |
NN |
denotes |
plasmid |
T5953 |
3729-3730 |
-LRB- |
denotes |
( |
T5954 |
3730-3733 |
VB |
denotes |
see |
T5955 |
3734-3739 |
RB |
denotes |
above |
T5956 |
3739-3740 |
-RRB- |
denotes |
) |
T5957 |
3741-3743 |
IN |
denotes |
by |
T5958 |
3744-3751 |
NN |
denotes |
HindIII |
T5960 |
3752-3755 |
CC |
denotes |
and |
T5961 |
3756-3760 |
NN |
denotes |
FseI |
T5959 |
3761-3770 |
NN |
denotes |
digestion |
T5962 |
3770-3772 |
, |
denotes |
, |
T5963 |
3772-3781 |
VBG |
denotes |
resulting |
T5964 |
3782-3784 |
IN |
denotes |
in |
T5965 |
3785-3788 |
DT |
denotes |
the |
T5967 |
3789-3795 |
NN |
denotes |
p53GFP |
T5968 |
3796-3804 |
NN |
denotes |
exchange |
T5966 |
3805-3814 |
NN |
denotes |
construct |
T5969 |
3814-3816 |
, |
denotes |
, |
T5970 |
3816-3819 |
DT |
denotes |
the |
T5971 |
3820-3828 |
NN |
denotes |
sequence |
T5972 |
3829-3834 |
WDT |
denotes |
which |
T5974 |
3835-3838 |
VBD |
denotes |
was |
T5973 |
3839-3847 |
VBN |
denotes |
verified |
T5975 |
3848-3854 |
IN |
denotes |
before |
T5976 |
3855-3858 |
NN |
denotes |
use |
T5977 |
3858-3859 |
. |
denotes |
. |
T5978 |
3859-4035 |
sentence |
denotes |
The p53ΔPGFP exchange construct was engineered by combining sequences from the p53GFP exchange plasmid and sequences from the p53ΔP targeting construct described recently (5). |
T5979 |
3860-3863 |
DT |
denotes |
The |
T5981 |
3864-3872 |
NN |
denotes |
p53ΔPGFP |
T5982 |
3873-3881 |
NN |
denotes |
exchange |
T5980 |
3882-3891 |
NN |
denotes |
construct |
T5984 |
3892-3895 |
VBD |
denotes |
was |
T5983 |
3896-3906 |
VBN |
denotes |
engineered |
T5985 |
3907-3909 |
IN |
denotes |
by |
T5986 |
3910-3919 |
VBG |
denotes |
combining |
T5987 |
3920-3929 |
NNS |
denotes |
sequences |
T5988 |
3930-3934 |
IN |
denotes |
from |
T5989 |
3935-3938 |
DT |
denotes |
the |
T5991 |
3939-3945 |
NN |
denotes |
p53GFP |
T5992 |
3946-3954 |
NN |
denotes |
exchange |
T5990 |
3955-3962 |
NN |
denotes |
plasmid |
T5993 |
3963-3966 |
CC |
denotes |
and |
T5994 |
3967-3976 |
NNS |
denotes |
sequences |
T5995 |
3977-3981 |
IN |
denotes |
from |
T5996 |
3982-3985 |
DT |
denotes |
the |
T5998 |
3986-3991 |
NN |
denotes |
p53ΔP |
T5999 |
3992-4001 |
NN |
denotes |
targeting |
T5997 |
4002-4011 |
NN |
denotes |
construct |
T6000 |
4012-4021 |
VBN |
denotes |
described |
T6001 |
4022-4030 |
RB |
denotes |
recently |
T6002 |
4031-4032 |
-LRB- |
denotes |
( |
T6003 |
4032-4033 |
CD |
denotes |
5 |
T6004 |
4033-4034 |
-RRB- |
denotes |
) |
T6005 |
4034-4035 |
. |
denotes |
. |
T6006 |
4035-4078 |
sentence |
denotes |
Its sequence was also verified before use. |
T6007 |
4036-4039 |
PRP$ |
denotes |
Its |
T6008 |
4040-4048 |
NN |
denotes |
sequence |
T6010 |
4049-4052 |
VBD |
denotes |
was |
T6011 |
4053-4057 |
RB |
denotes |
also |
T6009 |
4058-4066 |
VBN |
denotes |
verified |
T6012 |
4067-4073 |
IN |
denotes |
before |
T6013 |
4074-4077 |
NN |
denotes |
use |
T6014 |
4077-4078 |
. |
denotes |
. |
T6352 |
4080-4089 |
NNS |
denotes |
Sequences |
T6353 |
4090-4093 |
CC |
denotes |
and |
T6354 |
4094-4097 |
NN |
denotes |
use |
T6355 |
4098-4100 |
IN |
denotes |
of |
T6356 |
4101-4104 |
NN |
denotes |
PCR |
T6357 |
4105-4112 |
NNS |
denotes |
primers |
T6358 |
4112-4912 |
sentence |
denotes |
a: 5′-CCCCGGCCCTCACCCTCATCTTCG-3′, from the PuΔTK gene, assays targeting of Flox plasmid; b: 5′-AACAAAACAAAACAGCAGCAACAA-3′, from sequences downstream of the p53 gene and outside Flox sequences, assays targeting of Flox and RMCE with p53GFP or p53ΔPGFP plasmids; c: 5′-TGAAGAGCAAGGGCGTGGTGAAGGA-3′, from GFP sequences, assays RMCE with p53GFP orp53ΔPGFP plasmids; d: 5′-CAAAAAATGGAAGGAAATCAGGAACTAA-3′, from p53 intron 3, and e: 5′-TCTAGACAGAGAAAAAAGAGGCATT-3′, from p53 intron 4, assay RMCE with p53ΔPGFP plasmid; f: 5′-ATGGGAGGCTGCCAGTCCTAACCC and g: 5′-GTGTTTCATTAGTTCCCCACCTTGAC-3′ amplify the WT p53 allele according to Taconic's procedures, h: 5′-TTTACGGAGCCCTGGCGCTCGATGT-3′ and i: 5′-GTGGGAGGGACAAAAGTTCGAGGCC-3′ amplify the Neo marker in the p53 KO allele according to Taconic's procedures. |
T6359 |
4113-4114 |
LS |
denotes |
a |
T6361 |
4114-4116 |
: |
denotes |
: |
T6362 |
4116-4117 |
CD |
denotes |
5 |
T6363 |
4117-4118 |
SYM |
denotes |
′ |
T6364 |
4118-4119 |
HYPH |
denotes |
- |
T6360 |
4119-4143 |
NN |
denotes |
CCCCGGCCCTCACCCTCATCTTCG |
T6366 |
4143-4144 |
HYPH |
denotes |
- |
T6367 |
4144-4145 |
CD |
denotes |
3 |
T6368 |
4145-4146 |
SYM |
denotes |
′ |
T6369 |
4146-4148 |
, |
denotes |
, |
T6370 |
4148-4152 |
IN |
denotes |
from |
T6371 |
4153-4156 |
DT |
denotes |
the |
T6373 |
4157-4162 |
NN |
denotes |
PuΔTK |
T6372 |
4163-4167 |
NN |
denotes |
gene |
T6374 |
4167-4169 |
, |
denotes |
, |
T6375 |
4169-4175 |
NNS |
denotes |
assays |
T6376 |
4176-4185 |
VBG |
denotes |
targeting |
T6377 |
4186-4188 |
IN |
denotes |
of |
T6378 |
4189-4193 |
NN |
denotes |
Flox |
T6379 |
4194-4201 |
NN |
denotes |
plasmid |
T6380 |
4201-4202 |
: |
denotes |
; |
T6381 |
4203-4204 |
LS |
denotes |
b |
T6383 |
4204-4206 |
: |
denotes |
: |
T6384 |
4206-4207 |
CD |
denotes |
5 |
T6385 |
4207-4208 |
SYM |
denotes |
′ |
T6386 |
4208-4209 |
HYPH |
denotes |
- |
T6382 |
4209-4233 |
NN |
denotes |
AACAAAACAAAACAGCAGCAACAA |
T6387 |
4233-4234 |
HYPH |
denotes |
- |
T6388 |
4234-4235 |
CD |
denotes |
3 |
T6389 |
4235-4236 |
SYM |
denotes |
′ |
T6390 |
4236-4238 |
, |
denotes |
, |
T6391 |
4238-4242 |
IN |
denotes |
from |
T6392 |
4243-4252 |
NNS |
denotes |
sequences |
T6393 |
4253-4263 |
RB |
denotes |
downstream |
T6395 |
4264-4266 |
IN |
denotes |
of |
T6396 |
4267-4270 |
DT |
denotes |
the |
T6398 |
4271-4274 |
NN |
denotes |
p53 |
T6397 |
4275-4279 |
NN |
denotes |
gene |
T6399 |
4280-4283 |
CC |
denotes |
and |
T6394 |
4284-4291 |
IN |
denotes |
outside |
T6400 |
4292-4296 |
NN |
denotes |
Flox |
T6401 |
4297-4306 |
NNS |
denotes |
sequences |
T6402 |
4306-4308 |
, |
denotes |
, |
T6403 |
4308-4314 |
NNS |
denotes |
assays |
T6404 |
4315-4324 |
VBG |
denotes |
targeting |
T6405 |
4325-4327 |
IN |
denotes |
of |
T6406 |
4328-4332 |
NN |
denotes |
Flox |
T6407 |
4333-4336 |
CC |
denotes |
and |
T6408 |
4337-4341 |
NN |
denotes |
RMCE |
T6409 |
4342-4346 |
IN |
denotes |
with |
T6410 |
4347-4353 |
NN |
denotes |
p53GFP |
T6412 |
4354-4356 |
CC |
denotes |
or |
T6413 |
4357-4365 |
NN |
denotes |
p53ΔPGFP |
T6411 |
4366-4374 |
NNS |
denotes |
plasmids |
T6414 |
4374-4375 |
: |
denotes |
; |
T6415 |
4376-4377 |
LS |
denotes |
c |
T6417 |
4377-4379 |
: |
denotes |
: |
T6418 |
4379-4380 |
CD |
denotes |
5 |
T6419 |
4380-4381 |
SYM |
denotes |
′ |
T6420 |
4381-4382 |
HYPH |
denotes |
- |
T6416 |
4382-4407 |
NN |
denotes |
TGAAGAGCAAGGGCGTGGTGAAGGA |
T6421 |
4407-4408 |
HYPH |
denotes |
- |
T6422 |
4408-4409 |
CD |
denotes |
3 |
T6423 |
4409-4410 |
SYM |
denotes |
′ |
T6424 |
4410-4412 |
, |
denotes |
, |
T6425 |
4412-4416 |
IN |
denotes |
from |
T6426 |
4417-4420 |
NN |
denotes |
GFP |
T6427 |
4421-4430 |
NNS |
denotes |
sequences |
T6428 |
4430-4432 |
, |
denotes |
, |
T6429 |
4432-4438 |
NNS |
denotes |
assays |
T6430 |
4439-4443 |
NN |
denotes |
RMCE |
T6431 |
4444-4448 |
IN |
denotes |
with |
T6432 |
4449-4455 |
NN |
denotes |
p53GFP |
T6433 |
4456-4466 |
NN |
denotes |
orp53ΔPGFP |
T6434 |
4467-4475 |
NNS |
denotes |
plasmids |
T6435 |
4475-4476 |
: |
denotes |
; |
T6436 |
4477-4478 |
LS |
denotes |
d |
T6438 |
4478-4480 |
: |
denotes |
: |
T6439 |
4480-4481 |
CD |
denotes |
5 |
T6440 |
4481-4482 |
SYM |
denotes |
′ |
T6441 |
4482-4483 |
HYPH |
denotes |
- |
T6437 |
4483-4511 |
NN |
denotes |
CAAAAAATGGAAGGAAATCAGGAACTAA |
T6442 |
4511-4512 |
HYPH |
denotes |
- |
T6443 |
4512-4513 |
CD |
denotes |
3 |
T6444 |
4513-4514 |
SYM |
denotes |
′ |
T6445 |
4514-4516 |
, |
denotes |
, |
T6446 |
4516-4520 |
IN |
denotes |
from |
T6447 |
4521-4524 |
NN |
denotes |
p53 |
T6448 |
4525-4531 |
NN |
denotes |
intron |
T6449 |
4532-4533 |
CD |
denotes |
3 |
T6450 |
4533-4535 |
, |
denotes |
, |
T6451 |
4535-4538 |
CC |
denotes |
and |
T6452 |
4539-4540 |
LS |
denotes |
e |
T6454 |
4540-4542 |
: |
denotes |
: |
T6455 |
4542-4543 |
CD |
denotes |
5 |
T6456 |
4543-4544 |
SYM |
denotes |
′ |
T6457 |
4544-4545 |
HYPH |
denotes |
- |
T6453 |
4545-4570 |
NN |
denotes |
TCTAGACAGAGAAAAAAGAGGCATT |
T6458 |
4570-4571 |
HYPH |
denotes |
- |
T6459 |
4571-4572 |
CD |
denotes |
3 |
T6460 |
4572-4573 |
SYM |
denotes |
′ |
T6461 |
4573-4575 |
, |
denotes |
, |
T6462 |
4575-4579 |
IN |
denotes |
from |
T6463 |
4580-4583 |
NN |
denotes |
p53 |
T6464 |
4584-4590 |
NN |
denotes |
intron |
T6465 |
4591-4592 |
CD |
denotes |
4 |
T6466 |
4592-4594 |
, |
denotes |
, |
T6467 |
4594-4599 |
NN |
denotes |
assay |
T6468 |
4600-4604 |
NN |
denotes |
RMCE |
T6469 |
4605-4609 |
IN |
denotes |
with |
T6470 |
4610-4618 |
NN |
denotes |
p53ΔPGFP |
T6471 |
4619-4626 |
NN |
denotes |
plasmid |
T6472 |
4626-4627 |
: |
denotes |
; |
T6473 |
4628-4629 |
LS |
denotes |
f |
T6475 |
4629-4631 |
: |
denotes |
: |
T6476 |
4631-4632 |
CD |
denotes |
5 |
T6477 |
4632-4633 |
SYM |
denotes |
′ |
T6478 |
4633-4634 |
HYPH |
denotes |
- |
T6474 |
4634-4658 |
NN |
denotes |
ATGGGAGGCTGCCAGTCCTAACCC |
T6479 |
4659-4662 |
CC |
denotes |
and |
T6480 |
4663-4664 |
LS |
denotes |
g |
T6482 |
4664-4666 |
: |
denotes |
: |
T6483 |
4666-4667 |
CD |
denotes |
5 |
T6484 |
4667-4668 |
SYM |
denotes |
′ |
T6485 |
4668-4669 |
HYPH |
denotes |
- |
T6481 |
4669-4695 |
NN |
denotes |
GTGTTTCATTAGTTCCCCACCTTGAC |
T6486 |
4695-4696 |
HYPH |
denotes |
- |
T6487 |
4696-4697 |
CD |
denotes |
3 |
T6488 |
4697-4698 |
SYM |
denotes |
′ |
T6365 |
4699-4706 |
VBP |
denotes |
amplify |
T6490 |
4707-4710 |
DT |
denotes |
the |
T6492 |
4711-4713 |
NN |
denotes |
WT |
T6493 |
4714-4717 |
NN |
denotes |
p53 |
T6491 |
4718-4724 |
NN |
denotes |
allele |
T6494 |
4725-4734 |
IN |
denotes |
according |
T6495 |
4735-4737 |
IN |
denotes |
to |
T6496 |
4738-4745 |
NNP |
denotes |
Taconic |
T6498 |
4745-4747 |
POS |
denotes |
's |
T6497 |
4748-4758 |
NNS |
denotes |
procedures |
T6499 |
4758-4760 |
, |
denotes |
, |
T6500 |
4760-4761 |
LS |
denotes |
h |
T6502 |
4761-4763 |
: |
denotes |
: |
T6503 |
4763-4764 |
CD |
denotes |
5 |
T6504 |
4764-4765 |
SYM |
denotes |
′ |
T6505 |
4765-4766 |
HYPH |
denotes |
- |
T6501 |
4766-4791 |
NN |
denotes |
TTTACGGAGCCCTGGCGCTCGATGT |
T6506 |
4791-4792 |
HYPH |
denotes |
- |
T6507 |
4792-4793 |
CD |
denotes |
3 |
T6508 |
4793-4794 |
SYM |
denotes |
′ |
T6509 |
4795-4798 |
CC |
denotes |
and |
T6510 |
4799-4800 |
LS |
denotes |
i |
T6512 |
4800-4802 |
: |
denotes |
: |
T6513 |
4802-4803 |
CD |
denotes |
5 |
T6514 |
4803-4804 |
SYM |
denotes |
′ |
T6515 |
4804-4805 |
HYPH |
denotes |
- |
T6511 |
4805-4830 |
NN |
denotes |
GTGGGAGGGACAAAAGTTCGAGGCC |
T6516 |
4830-4831 |
HYPH |
denotes |
- |
T6517 |
4831-4832 |
CD |
denotes |
3 |
T6518 |
4832-4833 |
SYM |
denotes |
′ |
T6489 |
4834-4841 |
VBP |
denotes |
amplify |
T6519 |
4842-4845 |
DT |
denotes |
the |
T6521 |
4846-4849 |
NN |
denotes |
Neo |
T6520 |
4850-4856 |
NN |
denotes |
marker |
T6522 |
4857-4859 |
IN |
denotes |
in |
T6523 |
4860-4863 |
DT |
denotes |
the |
T6525 |
4864-4867 |
NN |
denotes |
p53 |
T6526 |
4868-4870 |
NN |
denotes |
KO |
T6524 |
4871-4877 |
NN |
denotes |
allele |
T6527 |
4878-4887 |
IN |
denotes |
according |
T6528 |
4888-4890 |
IN |
denotes |
to |
T6529 |
4891-4898 |
NNP |
denotes |
Taconic |
T6531 |
4898-4900 |
POS |
denotes |
's |
T6530 |
4901-4911 |
NNS |
denotes |
procedures |
T6532 |
4911-4912 |
. |
denotes |
. |
T6727 |
4914-4918 |
NN |
denotes |
Cell |
T6728 |
4919-4926 |
NN |
denotes |
culture |
T6729 |
4927-4937 |
NNS |
denotes |
conditions |
T6730 |
4937-5065 |
sentence |
denotes |
Primary MEFs, isolated from 13.5 day embryos, were cultured in DMEM with 15% FBS, 100 mM BME, 2 mM l-glutamine and antibiotics. |
T6731 |
4938-4945 |
JJ |
denotes |
Primary |
T6732 |
4946-4950 |
NNS |
denotes |
MEFs |
T6734 |
4950-4952 |
, |
denotes |
, |
T6735 |
4952-4960 |
VBN |
denotes |
isolated |
T6736 |
4961-4965 |
IN |
denotes |
from |
T6737 |
4966-4970 |
CD |
denotes |
13.5 |
T6738 |
4971-4974 |
NN |
denotes |
day |
T6739 |
4975-4982 |
NNS |
denotes |
embryos |
T6740 |
4982-4984 |
, |
denotes |
, |
T6741 |
4984-4988 |
VBD |
denotes |
were |
T6733 |
4989-4997 |
VBN |
denotes |
cultured |
T6742 |
4998-5000 |
IN |
denotes |
in |
T6743 |
5001-5005 |
NN |
denotes |
DMEM |
T6744 |
5006-5010 |
IN |
denotes |
with |
T6745 |
5011-5013 |
CD |
denotes |
15 |
T6746 |
5013-5014 |
NN |
denotes |
% |
T6747 |
5015-5018 |
NN |
denotes |
FBS |
T6748 |
5018-5020 |
, |
denotes |
, |
T6749 |
5020-5023 |
CD |
denotes |
100 |
T6750 |
5024-5026 |
NN |
denotes |
mM |
T6751 |
5027-5030 |
NN |
denotes |
BME |
T6752 |
5030-5032 |
, |
denotes |
, |
T6753 |
5032-5033 |
CD |
denotes |
2 |
T6754 |
5034-5036 |
NN |
denotes |
mM |
T6756 |
5037-5038 |
NN |
denotes |
l |
T6757 |
5038-5039 |
HYPH |
denotes |
- |
T6755 |
5039-5048 |
NN |
denotes |
glutamine |
T6758 |
5049-5052 |
CC |
denotes |
and |
T6759 |
5053-5064 |
NNS |
denotes |
antibiotics |
T6760 |
5064-5065 |
. |
denotes |
. |
T6761 |
5065-5241 |
sentence |
denotes |
129/SvJae ES cells were grown in the same medium supplemented with 1000 U/ml ESGRO (Chemicon), on a layer of mitomycin C-treated SNLPuro-7/4 feeders (kind gift of A. Bradley). |
T6762 |
5066-5069 |
CD |
denotes |
129 |
T6764 |
5069-5070 |
HYPH |
denotes |
/ |
T6763 |
5070-5075 |
NN |
denotes |
SvJae |
T6766 |
5076-5078 |
NN |
denotes |
ES |
T6765 |
5079-5084 |
NNS |
denotes |
cells |
T6768 |
5085-5089 |
VBD |
denotes |
were |
T6767 |
5090-5095 |
VBN |
denotes |
grown |
T6769 |
5096-5098 |
IN |
denotes |
in |
T6770 |
5099-5102 |
DT |
denotes |
the |
T6772 |
5103-5107 |
JJ |
denotes |
same |
T6771 |
5108-5114 |
NN |
denotes |
medium |
T6773 |
5115-5127 |
VBN |
denotes |
supplemented |
T6774 |
5128-5132 |
IN |
denotes |
with |
T6775 |
5133-5137 |
CD |
denotes |
1000 |
T6776 |
5138-5139 |
NN |
denotes |
U |
T6778 |
5139-5140 |
SYM |
denotes |
/ |
T6779 |
5140-5142 |
NN |
denotes |
ml |
T6777 |
5143-5148 |
NN |
denotes |
ESGRO |
T6780 |
5149-5150 |
-LRB- |
denotes |
( |
T6781 |
5150-5158 |
NNP |
denotes |
Chemicon |
T6782 |
5158-5159 |
-RRB- |
denotes |
) |
T6783 |
5159-5161 |
, |
denotes |
, |
T6784 |
5161-5163 |
IN |
denotes |
on |
T6785 |
5164-5165 |
DT |
denotes |
a |
T6786 |
5166-5171 |
NN |
denotes |
layer |
T6787 |
5172-5174 |
IN |
denotes |
of |
T6788 |
5175-5184 |
NN |
denotes |
mitomycin |
T6789 |
5185-5186 |
NN |
denotes |
C |
T6791 |
5186-5187 |
HYPH |
denotes |
- |
T6790 |
5187-5194 |
JJ |
denotes |
treated |
T6793 |
5195-5202 |
NN |
denotes |
SNLPuro |
T6794 |
5202-5203 |
HYPH |
denotes |
- |
T6795 |
5203-5204 |
CD |
denotes |
7 |
T6796 |
5204-5205 |
HYPH |
denotes |
/ |
T6797 |
5205-5206 |
CD |
denotes |
4 |
T6792 |
5207-5214 |
NNS |
denotes |
feeders |
T6798 |
5215-5216 |
-LRB- |
denotes |
( |
T6800 |
5216-5220 |
JJ |
denotes |
kind |
T6799 |
5221-5225 |
NN |
denotes |
gift |
T6801 |
5226-5228 |
IN |
denotes |
of |
T6802 |
5229-5231 |
NNP |
denotes |
A. |
T6803 |
5232-5239 |
NNP |
denotes |
Bradley |
T6804 |
5239-5240 |
-RRB- |
denotes |
) |
T6805 |
5240-5241 |
. |
denotes |
. |
T6806 |
5241-5324 |
sentence |
denotes |
Selections were performed with 2 μg/ml puromycin, 0.2 μM FIAU or 2 μM ganciclovir. |
T6807 |
5242-5252 |
NNS |
denotes |
Selections |
T6809 |
5253-5257 |
VBD |
denotes |
were |
T6808 |
5258-5267 |
VBN |
denotes |
performed |
T6810 |
5268-5272 |
IN |
denotes |
with |
T6811 |
5273-5274 |
CD |
denotes |
2 |
T6812 |
5275-5277 |
NN |
denotes |
μg |
T6814 |
5277-5278 |
SYM |
denotes |
/ |
T6815 |
5278-5280 |
NN |
denotes |
ml |
T6813 |
5281-5290 |
NN |
denotes |
puromycin |
T6816 |
5290-5292 |
, |
denotes |
, |
T6817 |
5292-5295 |
CD |
denotes |
0.2 |
T6818 |
5296-5298 |
NN |
denotes |
μM |
T6819 |
5299-5303 |
NN |
denotes |
FIAU |
T6820 |
5304-5306 |
CC |
denotes |
or |
T6821 |
5307-5308 |
CD |
denotes |
2 |
T6822 |
5309-5311 |
NN |
denotes |
μM |
T6823 |
5312-5323 |
NN |
denotes |
ganciclovir |
T6824 |
5323-5324 |
. |
denotes |
. |
T6929 |
5326-5335 |
NN |
denotes |
Targeting |
T6931 |
5335-5336 |
HYPH |
denotes |
/ |
T6930 |
5336-5346 |
NN |
denotes |
genotyping |
T6932 |
5347-5349 |
IN |
denotes |
of |
T6933 |
5350-5353 |
DT |
denotes |
the |
T6935 |
5354-5358 |
JJ |
denotes |
RMCE |
T6937 |
5358-5359 |
HYPH |
denotes |
- |
T6936 |
5359-5364 |
JJ |
denotes |
ready |
T6934 |
5365-5370 |
NN |
denotes |
locus |
T6938 |
5370-5524 |
sentence |
denotes |
29/SvJae ES cells were electroporated with the Flox construct linearized with PmeI, and puromycin resistant clones were analyzed as described (Figure 2). |
T6939 |
5371-5373 |
CD |
denotes |
29 |
T6941 |
5373-5374 |
HYPH |
denotes |
/ |
T6940 |
5374-5379 |
NN |
denotes |
SvJae |
T6943 |
5380-5382 |
NN |
denotes |
ES |
T6942 |
5383-5388 |
NNS |
denotes |
cells |
T6945 |
5389-5393 |
VBD |
denotes |
were |
T6944 |
5394-5408 |
VBN |
denotes |
electroporated |
T6946 |
5409-5413 |
IN |
denotes |
with |
T6947 |
5414-5417 |
DT |
denotes |
the |
T6949 |
5418-5422 |
NN |
denotes |
Flox |
T6948 |
5423-5432 |
NN |
denotes |
construct |
T6950 |
5433-5443 |
VBN |
denotes |
linearized |
T6951 |
5444-5448 |
IN |
denotes |
with |
T6952 |
5449-5453 |
NN |
denotes |
PmeI |
T6953 |
5453-5455 |
, |
denotes |
, |
T6954 |
5455-5458 |
CC |
denotes |
and |
T6955 |
5459-5468 |
NN |
denotes |
puromycin |
T6956 |
5469-5478 |
JJ |
denotes |
resistant |
T6957 |
5479-5485 |
NNS |
denotes |
clones |
T6959 |
5486-5490 |
VBD |
denotes |
were |
T6958 |
5491-5499 |
VBN |
denotes |
analyzed |
T6960 |
5500-5502 |
IN |
denotes |
as |
T6961 |
5503-5512 |
VBN |
denotes |
described |
T6962 |
5513-5514 |
-LRB- |
denotes |
( |
T6963 |
5514-5520 |
NN |
denotes |
Figure |
T6964 |
5521-5522 |
CD |
denotes |
2 |
T6965 |
5522-5523 |
-RRB- |
denotes |
) |
T6966 |
5523-5524 |
. |
denotes |
. |
T6967 |
5524-5604 |
sentence |
denotes |
Two clones were injected into blastocysts and transmitted through the germline. |
T6968 |
5525-5528 |
CD |
denotes |
Two |
T6969 |
5529-5535 |
NNS |
denotes |
clones |
T6971 |
5536-5540 |
VBD |
denotes |
were |
T6970 |
5541-5549 |
VBN |
denotes |
injected |
T6972 |
5550-5554 |
IN |
denotes |
into |
T6973 |
5555-5566 |
NNS |
denotes |
blastocysts |
T6974 |
5567-5570 |
CC |
denotes |
and |
T6975 |
5571-5582 |
VBN |
denotes |
transmitted |
T6976 |
5583-5590 |
IN |
denotes |
through |
T6977 |
5591-5594 |
DT |
denotes |
the |
T6978 |
5595-5603 |
NN |
denotes |
germline |
T6979 |
5603-5604 |
. |
denotes |
. |
T7192 |
5606-5616 |
VBG |
denotes |
Performing |
T7193 |
5617-5621 |
NN |
denotes |
RMCE |
T7194 |
5622-5624 |
IN |
denotes |
in |
T7195 |
5625-5627 |
NN |
denotes |
ES |
T7196 |
5628-5633 |
NNS |
denotes |
cells |
T7197 |
5633-5848 |
sentence |
denotes |
A total of 8 × 105 p53RMCE/+ ES cells were grown without puromycin for 12 h, electroporated with 15 μg CMV-Cre plasmid (pOG231) and 200 μg of the exchange construct, and plated in T25 flasks at 105 cells per flask. |
T7198 |
5634-5635 |
DT |
denotes |
A |
T7199 |
5636-5641 |
NN |
denotes |
total |
T7201 |
5642-5644 |
IN |
denotes |
of |
T7202 |
5645-5646 |
CD |
denotes |
8 |
T7204 |
5647-5648 |
HYPH |
denotes |
× |
T7203 |
5649-5652 |
CD |
denotes |
105 |
T7206 |
5653-5660 |
NN |
denotes |
p53RMCE |
T7207 |
5660-5661 |
HYPH |
denotes |
/ |
T7208 |
5661-5662 |
SYM |
denotes |
+ |
T7209 |
5663-5665 |
NN |
denotes |
ES |
T7205 |
5666-5671 |
NNS |
denotes |
cells |
T7210 |
5672-5676 |
VBD |
denotes |
were |
T7200 |
5677-5682 |
VBN |
denotes |
grown |
T7211 |
5683-5690 |
IN |
denotes |
without |
T7212 |
5691-5700 |
NN |
denotes |
puromycin |
T7213 |
5701-5704 |
IN |
denotes |
for |
T7214 |
5705-5707 |
CD |
denotes |
12 |
T7215 |
5708-5709 |
NN |
denotes |
h |
T7216 |
5709-5711 |
, |
denotes |
, |
T7217 |
5711-5725 |
VBN |
denotes |
electroporated |
T7218 |
5726-5730 |
IN |
denotes |
with |
T7219 |
5731-5733 |
CD |
denotes |
15 |
T7221 |
5734-5736 |
NN |
denotes |
μg |
T7222 |
5737-5740 |
NN |
denotes |
CMV |
T7224 |
5740-5741 |
HYPH |
denotes |
- |
T7223 |
5741-5744 |
NN |
denotes |
Cre |
T7220 |
5745-5752 |
NN |
denotes |
plasmid |
T7225 |
5753-5754 |
-LRB- |
denotes |
( |
T7226 |
5754-5760 |
NN |
denotes |
pOG231 |
T7227 |
5760-5761 |
-RRB- |
denotes |
) |
T7228 |
5762-5765 |
CC |
denotes |
and |
T7229 |
5766-5769 |
CD |
denotes |
200 |
T7230 |
5770-5772 |
NN |
denotes |
μg |
T7231 |
5773-5775 |
IN |
denotes |
of |
T7232 |
5776-5779 |
DT |
denotes |
the |
T7234 |
5780-5788 |
NN |
denotes |
exchange |
T7233 |
5789-5798 |
NN |
denotes |
construct |
T7235 |
5798-5800 |
, |
denotes |
, |
T7236 |
5800-5803 |
CC |
denotes |
and |
T7237 |
5804-5810 |
VBN |
denotes |
plated |
T7238 |
5811-5813 |
IN |
denotes |
in |
T7239 |
5814-5817 |
NN |
denotes |
T25 |
T7240 |
5818-5824 |
NNS |
denotes |
flasks |
T7241 |
5825-5827 |
IN |
denotes |
at |
T7242 |
5828-5831 |
CD |
denotes |
105 |
T7243 |
5832-5837 |
NNS |
denotes |
cells |
T7244 |
5838-5841 |
IN |
denotes |
per |
T7245 |
5842-5847 |
NN |
denotes |
flask |
T7246 |
5847-5848 |
. |
denotes |
. |
T7247 |
5848-5909 |
sentence |
denotes |
FIAU was added to the medium 3–4 days after electroporation. |
T7248 |
5849-5853 |
NN |
denotes |
FIAU |
T7250 |
5854-5857 |
VBD |
denotes |
was |
T7249 |
5858-5863 |
VBN |
denotes |
added |
T7251 |
5864-5866 |
IN |
denotes |
to |
T7252 |
5867-5870 |
DT |
denotes |
the |
T7253 |
5871-5877 |
NN |
denotes |
medium |
T7254 |
5878-5879 |
CD |
denotes |
3 |
T7256 |
5879-5880 |
HYPH |
denotes |
– |
T7255 |
5880-5881 |
CD |
denotes |
4 |
T7257 |
5882-5886 |
NNS |
denotes |
days |
T7258 |
5887-5892 |
IN |
denotes |
after |
T7259 |
5893-5908 |
NN |
denotes |
electroporation |
T7260 |
5908-5909 |
. |
denotes |
. |
T7261 |
5909-6088 |
sentence |
denotes |
Individual clones, picked 10 days after electroporation, were grown in 96-well plates and expanded to generate duplicate plates for freezing and DNA analysis by PCR and Southern. |
T7262 |
5910-5920 |
JJ |
denotes |
Individual |
T7263 |
5921-5927 |
NNS |
denotes |
clones |
T7265 |
5927-5929 |
, |
denotes |
, |
T7266 |
5929-5935 |
VBN |
denotes |
picked |
T7267 |
5936-5938 |
CD |
denotes |
10 |
T7268 |
5939-5943 |
NNS |
denotes |
days |
T7269 |
5944-5949 |
IN |
denotes |
after |
T7270 |
5950-5965 |
NN |
denotes |
electroporation |
T7271 |
5965-5967 |
, |
denotes |
, |
T7272 |
5967-5971 |
VBD |
denotes |
were |
T7264 |
5972-5977 |
VBN |
denotes |
grown |
T7273 |
5978-5980 |
IN |
denotes |
in |
T7274 |
5981-5983 |
CD |
denotes |
96 |
T7276 |
5983-5984 |
HYPH |
denotes |
- |
T7275 |
5984-5988 |
NN |
denotes |
well |
T7277 |
5989-5995 |
NNS |
denotes |
plates |
T7278 |
5996-5999 |
CC |
denotes |
and |
T7279 |
6000-6008 |
VBN |
denotes |
expanded |
T7280 |
6009-6011 |
TO |
denotes |
to |
T7281 |
6012-6020 |
VB |
denotes |
generate |
T7282 |
6021-6030 |
JJ |
denotes |
duplicate |
T7283 |
6031-6037 |
NNS |
denotes |
plates |
T7284 |
6038-6041 |
IN |
denotes |
for |
T7285 |
6042-6050 |
VBG |
denotes |
freezing |
T7286 |
6051-6054 |
CC |
denotes |
and |
T7287 |
6055-6058 |
NN |
denotes |
DNA |
T7288 |
6059-6067 |
NN |
denotes |
analysis |
T7289 |
6068-6070 |
IN |
denotes |
by |
T7290 |
6071-6074 |
NN |
denotes |
PCR |
T7291 |
6075-6078 |
CC |
denotes |
and |
T7292 |
6079-6087 |
NNP |
denotes |
Southern |
T7293 |
6087-6088 |
. |
denotes |
. |
T7497 |
6090-6100 |
VBG |
denotes |
Performing |
T7498 |
6101-6105 |
NN |
denotes |
RMCE |
T7499 |
6106-6108 |
IN |
denotes |
in |
T7500 |
6109-6113 |
NNS |
denotes |
MEFs |
T7501 |
6113-6354 |
sentence |
denotes |
A total of 106 p53RMCE/− MEFs cells were grown without puromycin for 12 h, electroporated with 3 μg pOG231 and 30 μg exchange construct, and plated in a single 10 cm-dish, grown for 3 days then split in several dishes at 105 cells per dish. |
T7502 |
6114-6115 |
DT |
denotes |
A |
T7503 |
6116-6121 |
NN |
denotes |
total |
T7505 |
6122-6124 |
IN |
denotes |
of |
T7506 |
6125-6128 |
CD |
denotes |
106 |
T7508 |
6129-6136 |
NN |
denotes |
p53RMCE |
T7510 |
6136-6137 |
HYPH |
denotes |
/ |
T7511 |
6137-6138 |
SYM |
denotes |
− |
T7509 |
6139-6143 |
NNS |
denotes |
MEFs |
T7507 |
6144-6149 |
NNS |
denotes |
cells |
T7512 |
6150-6154 |
VBD |
denotes |
were |
T7504 |
6155-6160 |
VBN |
denotes |
grown |
T7513 |
6161-6168 |
IN |
denotes |
without |
T7514 |
6169-6178 |
NN |
denotes |
puromycin |
T7515 |
6179-6182 |
IN |
denotes |
for |
T7516 |
6183-6185 |
CD |
denotes |
12 |
T7517 |
6186-6187 |
NN |
denotes |
h |
T7518 |
6187-6189 |
, |
denotes |
, |
T7519 |
6189-6203 |
VBN |
denotes |
electroporated |
T7520 |
6204-6208 |
IN |
denotes |
with |
T7521 |
6209-6210 |
CD |
denotes |
3 |
T7522 |
6211-6213 |
NN |
denotes |
μg |
T7523 |
6214-6220 |
NN |
denotes |
pOG231 |
T7524 |
6221-6224 |
CC |
denotes |
and |
T7525 |
6225-6227 |
CD |
denotes |
30 |
T7526 |
6228-6230 |
NN |
denotes |
μg |
T7528 |
6231-6239 |
NN |
denotes |
exchange |
T7527 |
6240-6249 |
NN |
denotes |
construct |
T7529 |
6249-6251 |
, |
denotes |
, |
T7530 |
6251-6254 |
CC |
denotes |
and |
T7531 |
6255-6261 |
VBN |
denotes |
plated |
T7532 |
6262-6264 |
IN |
denotes |
in |
T7533 |
6265-6266 |
DT |
denotes |
a |
T7535 |
6267-6273 |
JJ |
denotes |
single |
T7536 |
6274-6276 |
CD |
denotes |
10 |
T7537 |
6277-6279 |
NN |
denotes |
cm |
T7538 |
6279-6280 |
HYPH |
denotes |
- |
T7534 |
6280-6284 |
NN |
denotes |
dish |
T7539 |
6284-6286 |
, |
denotes |
, |
T7540 |
6286-6291 |
VBN |
denotes |
grown |
T7541 |
6292-6295 |
IN |
denotes |
for |
T7542 |
6296-6297 |
CD |
denotes |
3 |
T7543 |
6298-6302 |
NNS |
denotes |
days |
T7544 |
6303-6307 |
RB |
denotes |
then |
T7545 |
6308-6313 |
VBN |
denotes |
split |
T7546 |
6314-6316 |
IN |
denotes |
in |
T7547 |
6317-6324 |
JJ |
denotes |
several |
T7548 |
6325-6331 |
NNS |
denotes |
dishes |
T7549 |
6332-6334 |
IN |
denotes |
at |
T7550 |
6335-6338 |
CD |
denotes |
105 |
T7551 |
6339-6344 |
NNS |
denotes |
cells |
T7552 |
6345-6348 |
IN |
denotes |
per |
T7553 |
6349-6353 |
NN |
denotes |
dish |
T7554 |
6353-6354 |
. |
denotes |
. |
T7555 |
6354-6442 |
sentence |
denotes |
FIAU or ganciclovir was added to the medium 4 days after electroporation, for 3–4 days. |
T7556 |
6355-6359 |
NN |
denotes |
FIAU |
T7558 |
6360-6362 |
CC |
denotes |
or |
T7559 |
6363-6374 |
NN |
denotes |
ganciclovir |
T7560 |
6375-6378 |
VBD |
denotes |
was |
T7557 |
6379-6384 |
VBN |
denotes |
added |
T7561 |
6385-6387 |
IN |
denotes |
to |
T7562 |
6388-6391 |
DT |
denotes |
the |
T7563 |
6392-6398 |
NN |
denotes |
medium |
T7564 |
6399-6400 |
CD |
denotes |
4 |
T7565 |
6401-6405 |
NNS |
denotes |
days |
T7566 |
6406-6411 |
IN |
denotes |
after |
T7567 |
6412-6427 |
NN |
denotes |
electroporation |
T7568 |
6427-6429 |
, |
denotes |
, |
T7569 |
6429-6432 |
IN |
denotes |
for |
T7570 |
6433-6434 |
CD |
denotes |
3 |
T7572 |
6434-6435 |
SYM |
denotes |
– |
T7571 |
6435-6436 |
CD |
denotes |
4 |
T7573 |
6437-6441 |
NNS |
denotes |
days |
T7574 |
6441-6442 |
. |
denotes |
. |
T7575 |
6442-6561 |
sentence |
denotes |
Clones, picked 10 days after electroporation, were grown in 24-well plates and expanded for freezing and DNA analysis. |
T7576 |
6443-6449 |
NNS |
denotes |
Clones |
T7578 |
6449-6451 |
, |
denotes |
, |
T7579 |
6451-6457 |
VBN |
denotes |
picked |
T7580 |
6458-6460 |
CD |
denotes |
10 |
T7581 |
6461-6465 |
NNS |
denotes |
days |
T7582 |
6466-6471 |
IN |
denotes |
after |
T7583 |
6472-6487 |
NN |
denotes |
electroporation |
T7584 |
6487-6489 |
, |
denotes |
, |
T7585 |
6489-6493 |
VBD |
denotes |
were |
T7577 |
6494-6499 |
VBN |
denotes |
grown |
T7586 |
6500-6502 |
IN |
denotes |
in |
T7587 |
6503-6505 |
CD |
denotes |
24 |
T7589 |
6505-6506 |
HYPH |
denotes |
- |
T7588 |
6506-6510 |
NN |
denotes |
well |
T7590 |
6511-6517 |
NNS |
denotes |
plates |
T7591 |
6518-6521 |
CC |
denotes |
and |
T7592 |
6522-6530 |
VBN |
denotes |
expanded |
T7593 |
6531-6534 |
IN |
denotes |
for |
T7594 |
6535-6543 |
NN |
denotes |
freezing |
T7595 |
6544-6547 |
CC |
denotes |
and |
T7596 |
6548-6551 |
NN |
denotes |
DNA |
T7597 |
6552-6560 |
NN |
denotes |
analysis |
T7598 |
6560-6561 |
. |
denotes |
. |
T8070 |
6563-6570 |
NNP |
denotes |
Western |
T8072 |
6570-6571 |
HYPH |
denotes |
- |
T8071 |
6571-6576 |
NNS |
denotes |
blots |
T8073 |
6576-6873 |
sentence |
denotes |
Cells, untreated or treated for 24 h with 0.5 μg/ml adriamycin, were lysed on the dish in a buffer consisting of 50 mM Tris (pH 8.0), 5 mM EDTA, 150 mM NaCl, 0.5% Nonidet P-40, 1 mM PMSF, 1 mM sodium vanadate, 10 mM NaF and Complete Mini Protease Inhibitors (Roche Diagnostics) at 4°C for 30 min. |
T8074 |
6577-6582 |
NNS |
denotes |
Cells |
T8076 |
6582-6584 |
, |
denotes |
, |
T8077 |
6584-6593 |
JJ |
denotes |
untreated |
T8078 |
6594-6596 |
CC |
denotes |
or |
T8079 |
6597-6604 |
VBN |
denotes |
treated |
T8080 |
6605-6608 |
IN |
denotes |
for |
T8081 |
6609-6611 |
CD |
denotes |
24 |
T8082 |
6612-6613 |
NN |
denotes |
h |
T8083 |
6614-6618 |
IN |
denotes |
with |
T8084 |
6619-6622 |
CD |
denotes |
0.5 |
T8085 |
6623-6625 |
NN |
denotes |
μg |
T8087 |
6625-6626 |
SYM |
denotes |
/ |
T8088 |
6626-6628 |
NN |
denotes |
ml |
T8086 |
6629-6639 |
NN |
denotes |
adriamycin |
T8089 |
6639-6641 |
, |
denotes |
, |
T8090 |
6641-6645 |
VBD |
denotes |
were |
T8075 |
6646-6651 |
VBN |
denotes |
lysed |
T8091 |
6652-6654 |
IN |
denotes |
on |
T8092 |
6655-6658 |
DT |
denotes |
the |
T8093 |
6659-6663 |
NN |
denotes |
dish |
T8094 |
6664-6666 |
IN |
denotes |
in |
T8095 |
6667-6668 |
DT |
denotes |
a |
T8096 |
6669-6675 |
NN |
denotes |
buffer |
T8097 |
6676-6686 |
VBG |
denotes |
consisting |
T8098 |
6687-6689 |
IN |
denotes |
of |
T8099 |
6690-6692 |
CD |
denotes |
50 |
T8100 |
6693-6695 |
NN |
denotes |
mM |
T8101 |
6696-6700 |
NN |
denotes |
Tris |
T8102 |
6701-6702 |
-LRB- |
denotes |
( |
T8103 |
6702-6704 |
NN |
denotes |
pH |
T8104 |
6705-6708 |
CD |
denotes |
8.0 |
T8105 |
6708-6709 |
-RRB- |
denotes |
) |
T8106 |
6709-6711 |
, |
denotes |
, |
T8107 |
6711-6712 |
CD |
denotes |
5 |
T8108 |
6713-6715 |
NN |
denotes |
mM |
T8109 |
6716-6720 |
NN |
denotes |
EDTA |
T8110 |
6720-6722 |
, |
denotes |
, |
T8111 |
6722-6725 |
CD |
denotes |
150 |
T8112 |
6726-6728 |
NN |
denotes |
mM |
T8113 |
6729-6733 |
NN |
denotes |
NaCl |
T8114 |
6733-6735 |
, |
denotes |
, |
T8115 |
6735-6738 |
CD |
denotes |
0.5 |
T8116 |
6738-6739 |
NN |
denotes |
% |
T8118 |
6740-6747 |
NN |
denotes |
Nonidet |
T8119 |
6748-6749 |
NN |
denotes |
P |
T8120 |
6749-6750 |
HYPH |
denotes |
- |
T8117 |
6750-6752 |
NN |
denotes |
40 |
T8121 |
6752-6754 |
, |
denotes |
, |
T8122 |
6754-6755 |
CD |
denotes |
1 |
T8123 |
6756-6758 |
NN |
denotes |
mM |
T8124 |
6759-6763 |
NN |
denotes |
PMSF |
T8125 |
6763-6765 |
, |
denotes |
, |
T8126 |
6765-6766 |
CD |
denotes |
1 |
T8127 |
6767-6769 |
NN |
denotes |
mM |
T8129 |
6770-6776 |
NN |
denotes |
sodium |
T8128 |
6777-6785 |
NN |
denotes |
vanadate |
T8130 |
6785-6787 |
, |
denotes |
, |
T8131 |
6787-6789 |
CD |
denotes |
10 |
T8132 |
6790-6792 |
NN |
denotes |
mM |
T8133 |
6793-6796 |
NNP |
denotes |
NaF |
T8134 |
6797-6800 |
CC |
denotes |
and |
T8135 |
6801-6809 |
NN |
denotes |
Complete |
T8136 |
6810-6814 |
NN |
denotes |
Mini |
T8138 |
6815-6823 |
NN |
denotes |
Protease |
T8137 |
6824-6834 |
NNS |
denotes |
Inhibitors |
T8139 |
6835-6836 |
-LRB- |
denotes |
( |
T8141 |
6836-6841 |
NNP |
denotes |
Roche |
T8140 |
6842-6853 |
NNP |
denotes |
Diagnostics |
T8142 |
6853-6854 |
-RRB- |
denotes |
) |
T8143 |
6855-6857 |
IN |
denotes |
at |
T8144 |
6858-6859 |
CD |
denotes |
4 |
T8145 |
6859-6861 |
NNS |
denotes |
°C |
T8146 |
6862-6865 |
IN |
denotes |
for |
T8147 |
6866-6868 |
CD |
denotes |
30 |
T8148 |
6869-6872 |
NN |
denotes |
min |
T8149 |
6872-6873 |
. |
denotes |
. |
T8150 |
6873-6935 |
sentence |
denotes |
Lysates were scraped, then spun at 6000× g at 4°C for 10 min. |
T8151 |
6874-6881 |
NNS |
denotes |
Lysates |
T8153 |
6882-6886 |
VBD |
denotes |
were |
T8152 |
6887-6894 |
VBN |
denotes |
scraped |
T8154 |
6894-6896 |
, |
denotes |
, |
T8155 |
6896-6900 |
RB |
denotes |
then |
T8156 |
6901-6905 |
VBN |
denotes |
spun |
T8157 |
6906-6908 |
IN |
denotes |
at |
T8158 |
6909-6913 |
CD |
denotes |
6000 |
T8160 |
6913-6914 |
SYM |
denotes |
× |
T8159 |
6915-6916 |
NN |
denotes |
g |
T8161 |
6917-6919 |
IN |
denotes |
at |
T8162 |
6920-6921 |
CD |
denotes |
4 |
T8163 |
6921-6923 |
NNS |
denotes |
°C |
T8164 |
6924-6927 |
IN |
denotes |
for |
T8165 |
6928-6930 |
CD |
denotes |
10 |
T8166 |
6931-6934 |
NN |
denotes |
min |
T8167 |
6934-6935 |
. |
denotes |
. |
T8168 |
6935-7027 |
sentence |
denotes |
Protein concentration in the supernatant was determined using the Bio-Rad DC protein assay. |
T8169 |
6936-6943 |
NN |
denotes |
Protein |
T8170 |
6944-6957 |
NN |
denotes |
concentration |
T8172 |
6958-6960 |
IN |
denotes |
in |
T8173 |
6961-6964 |
DT |
denotes |
the |
T8174 |
6965-6976 |
NN |
denotes |
supernatant |
T8175 |
6977-6980 |
VBD |
denotes |
was |
T8171 |
6981-6991 |
VBN |
denotes |
determined |
T8176 |
6992-6997 |
VBG |
denotes |
using |
T8177 |
6998-7001 |
DT |
denotes |
the |
T8179 |
7002-7005 |
NN |
denotes |
Bio |
T8181 |
7005-7006 |
HYPH |
denotes |
- |
T8180 |
7006-7009 |
NN |
denotes |
Rad |
T8182 |
7010-7012 |
NN |
denotes |
DC |
T8183 |
7013-7020 |
NN |
denotes |
protein |
T8178 |
7021-7026 |
NN |
denotes |
assay |
T8184 |
7026-7027 |
. |
denotes |
. |
T8185 |
7027-7182 |
sentence |
denotes |
Lysates were separated on single percentage SDS/PAGE gels, then electrophoretically transferred to poly(vinylidene difluoride), using standard procedures. |
T8186 |
7028-7035 |
NNS |
denotes |
Lysates |
T8188 |
7036-7040 |
VBD |
denotes |
were |
T8187 |
7041-7050 |
VBN |
denotes |
separated |
T8189 |
7051-7053 |
IN |
denotes |
on |
T8190 |
7054-7060 |
JJ |
denotes |
single |
T8191 |
7061-7071 |
NN |
denotes |
percentage |
T8193 |
7072-7075 |
NN |
denotes |
SDS |
T8195 |
7075-7076 |
HYPH |
denotes |
/ |
T8194 |
7076-7080 |
NN |
denotes |
PAGE |
T8192 |
7081-7085 |
NNS |
denotes |
gels |
T8196 |
7085-7087 |
, |
denotes |
, |
T8197 |
7087-7091 |
RB |
denotes |
then |
T8199 |
7092-7111 |
RB |
denotes |
electrophoretically |
T8198 |
7112-7123 |
VBN |
denotes |
transferred |
T8200 |
7124-7126 |
IN |
denotes |
to |
T8201 |
7127-7131 |
NN |
denotes |
poly |
T8202 |
7131-7132 |
-LRB- |
denotes |
( |
T8204 |
7132-7142 |
NN |
denotes |
vinylidene |
T8203 |
7143-7153 |
NN |
denotes |
difluoride |
T8205 |
7153-7154 |
-RRB- |
denotes |
) |
T8206 |
7154-7156 |
, |
denotes |
, |
T8207 |
7156-7161 |
VBG |
denotes |
using |
T8208 |
7162-7170 |
JJ |
denotes |
standard |
T8209 |
7171-7181 |
NNS |
denotes |
procedures |
T8210 |
7181-7182 |
. |
denotes |
. |
T8211 |
7182-7187 |
NNS |
denotes |
Blots |
T8213 |
7182-7401 |
sentence |
denotes |
Blots were incubated in 5% non-fat dried milk in TBST (0.02 M Tris, pH 7.6/0.35 M NaCl/0.1% Tween-20) for 1 h at room temperature before probing with primary antibodies against p53 (CM-5, Novacastra) and -actin (Sigma). |
T8214 |
7188-7192 |
VBD |
denotes |
were |
T8212 |
7193-7202 |
VBN |
denotes |
incubated |
T8215 |
7203-7205 |
IN |
denotes |
in |
T8216 |
7206-7207 |
CD |
denotes |
5 |
T8217 |
7207-7208 |
NN |
denotes |
% |
T8219 |
7209-7216 |
JJ |
denotes |
non-fat |
T8220 |
7217-7222 |
VBN |
denotes |
dried |
T8218 |
7223-7227 |
NN |
denotes |
milk |
T8221 |
7228-7230 |
IN |
denotes |
in |
T8222 |
7231-7235 |
NN |
denotes |
TBST |
T8223 |
7236-7237 |
-LRB- |
denotes |
( |
T8225 |
7237-7241 |
CD |
denotes |
0.02 |
T8226 |
7242-7243 |
NN |
denotes |
M |
T8227 |
7244-7248 |
NN |
denotes |
Tris |
T8228 |
7248-7250 |
, |
denotes |
, |
T8229 |
7250-7252 |
NN |
denotes |
pH |
T8230 |
7253-7256 |
CD |
denotes |
7.6 |
T8231 |
7256-7257 |
HYPH |
denotes |
/ |
T8232 |
7257-7261 |
CD |
denotes |
0.35 |
T8233 |
7262-7263 |
NN |
denotes |
M |
T8234 |
7264-7268 |
NN |
denotes |
NaCl |
T8235 |
7268-7269 |
HYPH |
denotes |
/ |
T8236 |
7269-7272 |
CD |
denotes |
0.1 |
T8237 |
7272-7273 |
NN |
denotes |
% |
T8224 |
7274-7279 |
NN |
denotes |
Tween |
T8238 |
7279-7280 |
HYPH |
denotes |
- |
T8239 |
7280-7282 |
CD |
denotes |
20 |
T8240 |
7282-7283 |
-RRB- |
denotes |
) |
T8241 |
7284-7287 |
IN |
denotes |
for |
T8242 |
7288-7289 |
CD |
denotes |
1 |
T8243 |
7290-7291 |
NN |
denotes |
h |
T8244 |
7292-7294 |
IN |
denotes |
at |
T8245 |
7295-7299 |
NN |
denotes |
room |
T8246 |
7300-7311 |
NN |
denotes |
temperature |
T8247 |
7312-7318 |
IN |
denotes |
before |
T8248 |
7319-7326 |
VBG |
denotes |
probing |
T8249 |
7327-7331 |
IN |
denotes |
with |
T8250 |
7332-7339 |
JJ |
denotes |
primary |
T8251 |
7340-7350 |
NNS |
denotes |
antibodies |
T8252 |
7351-7358 |
IN |
denotes |
against |
T8253 |
7359-7362 |
NN |
denotes |
p53 |
T8254 |
7363-7364 |
-LRB- |
denotes |
( |
T8256 |
7364-7366 |
NN |
denotes |
CM |
T8257 |
7366-7367 |
HYPH |
denotes |
- |
T8258 |
7367-7368 |
CD |
denotes |
5 |
T8259 |
7368-7370 |
, |
denotes |
, |
T8255 |
7370-7380 |
NNP |
denotes |
Novacastra |
T8260 |
7380-7381 |
-RRB- |
denotes |
) |
T8261 |
7382-7385 |
CC |
denotes |
and |
T8262 |
7386-7387 |
HYPH |
denotes |
- |
T8263 |
7387-7392 |
NN |
denotes |
actin |
T8264 |
7393-7394 |
-LRB- |
denotes |
( |
T8265 |
7394-7399 |
NNP |
denotes |
Sigma |
T8266 |
7399-7400 |
-RRB- |
denotes |
) |
T8267 |
7400-7401 |
. |
denotes |
. |
T8268 |
7401-7507 |
sentence |
denotes |
Secondary antibodies used include peroxidase-conjugated goat anti-mouse IgG and anti-rabbit IgG (Pierce). |
T8269 |
7402-7411 |
JJ |
denotes |
Secondary |
T8270 |
7412-7422 |
NNS |
denotes |
antibodies |
T8272 |
7423-7427 |
VBN |
denotes |
used |
T8271 |
7428-7435 |
VBP |
denotes |
include |
T8273 |
7436-7446 |
NN |
denotes |
peroxidase |
T8275 |
7446-7447 |
HYPH |
denotes |
- |
T8274 |
7447-7457 |
VBN |
denotes |
conjugated |
T8277 |
7458-7462 |
NN |
denotes |
goat |
T8278 |
7463-7473 |
NN |
denotes |
anti-mouse |
T8276 |
7474-7477 |
NN |
denotes |
IgG |
T8279 |
7478-7481 |
CC |
denotes |
and |
T8280 |
7482-7493 |
NN |
denotes |
anti-rabbit |
T8281 |
7494-7497 |
NN |
denotes |
IgG |
T8282 |
7498-7499 |
-LRB- |
denotes |
( |
T8283 |
7499-7505 |
NNP |
denotes |
Pierce |
T8284 |
7505-7506 |
-RRB- |
denotes |
) |
T8285 |
7506-7507 |
. |
denotes |
. |
T8286 |
7507-7624 |
sentence |
denotes |
Probed blots were incubated with Pierce Supersignal West Pico chemiluminescent substrate and exposed to X-ray films. |
T8287 |
7508-7514 |
VBN |
denotes |
Probed |
T8288 |
7515-7520 |
NNS |
denotes |
blots |
T8290 |
7521-7525 |
VBD |
denotes |
were |
T8289 |
7526-7535 |
VBN |
denotes |
incubated |
T8291 |
7536-7540 |
IN |
denotes |
with |
T8292 |
7541-7547 |
NNP |
denotes |
Pierce |
T8294 |
7548-7559 |
NNP |
denotes |
Supersignal |
T8295 |
7560-7564 |
NNP |
denotes |
West |
T8296 |
7565-7569 |
NNP |
denotes |
Pico |
T8297 |
7570-7586 |
JJ |
denotes |
chemiluminescent |
T8293 |
7587-7596 |
NN |
denotes |
substrate |
T8298 |
7597-7600 |
CC |
denotes |
and |
T8299 |
7601-7608 |
VBN |
denotes |
exposed |
T8300 |
7609-7611 |
IN |
denotes |
to |
T8301 |
7612-7617 |
NN |
denotes |
X-ray |
T8302 |
7618-7623 |
NNS |
denotes |
films |
T8303 |
7623-7624 |
. |
denotes |
. |
T8467 |
7626-7630 |
NN |
denotes |
Flow |
T8468 |
7631-7640 |
NN |
denotes |
cytometry |
T8469 |
7640-7751 |
sentence |
denotes |
Log phase cells were irradiated at RT with a 60 Co γ-irradiator at doses of 6 or 12 Gy and incubated for 24 h. |
T8470 |
7641-7644 |
NN |
denotes |
Log |
T8472 |
7645-7650 |
NN |
denotes |
phase |
T8471 |
7651-7656 |
NNS |
denotes |
cells |
T8474 |
7657-7661 |
VBD |
denotes |
were |
T8473 |
7662-7672 |
VBN |
denotes |
irradiated |
T8475 |
7673-7675 |
IN |
denotes |
at |
T8476 |
7676-7678 |
NN |
denotes |
RT |
T8477 |
7679-7683 |
IN |
denotes |
with |
T8478 |
7684-7685 |
DT |
denotes |
a |
T8480 |
7686-7688 |
CD |
denotes |
60 |
T8482 |
7689-7691 |
NN |
denotes |
Co |
T8481 |
7692-7693 |
NN |
denotes |
γ |
T8483 |
7693-7694 |
SYM |
denotes |
- |
T8479 |
7694-7704 |
NN |
denotes |
irradiator |
T8484 |
7705-7707 |
IN |
denotes |
at |
T8485 |
7708-7713 |
NNS |
denotes |
doses |
T8486 |
7714-7716 |
IN |
denotes |
of |
T8487 |
7717-7718 |
CD |
denotes |
6 |
T8489 |
7719-7721 |
CC |
denotes |
or |
T8490 |
7722-7724 |
CD |
denotes |
12 |
T8488 |
7725-7727 |
NN |
denotes |
Gy |
T8491 |
7728-7731 |
CC |
denotes |
and |
T8492 |
7732-7741 |
VBN |
denotes |
incubated |
T8493 |
7742-7745 |
IN |
denotes |
for |
T8494 |
7746-7748 |
CD |
denotes |
24 |
T8495 |
7749-7750 |
NN |
denotes |
h |
T8496 |
7750-7751 |
. |
denotes |
. |
T8497 |
7751-7944 |
sentence |
denotes |
Cells were then pulse-labeled for 1 h with BrdU (10 μM), fixed in 70% ethanol, double-stained with FITC anti-BrdU and propidium iodide, then sorted by using a Becton Dickinson FACScan machine. |
T8498 |
7752-7757 |
NNS |
denotes |
Cells |
T8500 |
7758-7762 |
VBD |
denotes |
were |
T8501 |
7763-7767 |
RB |
denotes |
then |
T8502 |
7768-7773 |
NN |
denotes |
pulse |
T8503 |
7773-7774 |
HYPH |
denotes |
- |
T8499 |
7774-7781 |
VBN |
denotes |
labeled |
T8504 |
7782-7785 |
IN |
denotes |
for |
T8505 |
7786-7787 |
CD |
denotes |
1 |
T8506 |
7788-7789 |
NN |
denotes |
h |
T8507 |
7790-7794 |
IN |
denotes |
with |
T8508 |
7795-7799 |
NN |
denotes |
BrdU |
T8509 |
7800-7801 |
-LRB- |
denotes |
( |
T8511 |
7801-7803 |
CD |
denotes |
10 |
T8510 |
7804-7806 |
NN |
denotes |
μM |
T8512 |
7806-7807 |
-RRB- |
denotes |
) |
T8513 |
7807-7809 |
, |
denotes |
, |
T8514 |
7809-7814 |
VBN |
denotes |
fixed |
T8515 |
7815-7817 |
IN |
denotes |
in |
T8516 |
7818-7820 |
CD |
denotes |
70 |
T8517 |
7820-7821 |
NN |
denotes |
% |
T8518 |
7822-7829 |
NN |
denotes |
ethanol |
T8519 |
7829-7831 |
, |
denotes |
, |
T8520 |
7831-7837 |
JJ |
denotes |
double |
T8522 |
7837-7838 |
HYPH |
denotes |
- |
T8521 |
7838-7845 |
VBN |
denotes |
stained |
T8523 |
7846-7850 |
IN |
denotes |
with |
T8524 |
7851-7855 |
NN |
denotes |
FITC |
T8525 |
7856-7865 |
NN |
denotes |
anti-BrdU |
T8526 |
7866-7869 |
CC |
denotes |
and |
T8527 |
7870-7879 |
NN |
denotes |
propidium |
T8528 |
7880-7886 |
NN |
denotes |
iodide |
T8529 |
7886-7888 |
, |
denotes |
, |
T8530 |
7888-7892 |
RB |
denotes |
then |
T8531 |
7893-7899 |
VBN |
denotes |
sorted |
T8532 |
7900-7902 |
IN |
denotes |
by |
T8533 |
7903-7908 |
VBG |
denotes |
using |
T8534 |
7909-7910 |
DT |
denotes |
a |
T8536 |
7911-7917 |
NNP |
denotes |
Becton |
T8537 |
7918-7927 |
NNP |
denotes |
Dickinson |
T8538 |
7928-7935 |
NNP |
denotes |
FACScan |
T8535 |
7936-7943 |
NN |
denotes |
machine |
T8539 |
7943-7944 |
. |
denotes |
. |
T8540 |
7944-8001 |
sentence |
denotes |
Data were analyzed using Becton Dickinson Cellquest Pro. |
T8541 |
7945-7949 |
NNS |
denotes |
Data |
T8543 |
7950-7954 |
VBD |
denotes |
were |
T8542 |
7955-7963 |
VBN |
denotes |
analyzed |
T8544 |
7964-7969 |
VBG |
denotes |
using |
T8545 |
7970-7976 |
NNP |
denotes |
Becton |
T8546 |
7977-7986 |
NNP |
denotes |
Dickinson |
T8548 |
7987-7996 |
NNP |
denotes |
Cellquest |
T8547 |
7997-8000 |
NNP |
denotes |
Pro |
T8549 |
8000-8001 |
. |
denotes |
. |
R1050 |
T4611 |
T4612 |
compound |
Targeting,construct |
R1051 |
T4613 |
T4612 |
prep |
for,construct |
R1052 |
T4614 |
T4615 |
det |
a,locus |
R1053 |
T4615 |
T4613 |
pobj |
locus,for |
R1054 |
T4616 |
T4615 |
nmod |
p53,locus |
R1055 |
T4617 |
T4618 |
npadvmod |
RMCE,ready |
R1056 |
T4618 |
T4615 |
amod |
ready,locus |
R1057 |
T4619 |
T4618 |
punct |
-,ready |
R1058 |
T4621 |
T4622 |
nsubj |
Details,are |
R1059 |
T4623 |
T4621 |
prep |
for,Details |
R1060 |
T4624 |
T4625 |
compound |
plasmid,construction |
R1061 |
T4625 |
T4623 |
pobj |
construction,for |
R1062 |
T4626 |
T4622 |
acomp |
available,are |
R1063 |
T4627 |
T4622 |
prep |
upon,are |
R1064 |
T4628 |
T4627 |
pobj |
request,upon |
R1065 |
T4629 |
T4622 |
prep |
owing,are |
R1066 |
T4630 |
T4629 |
prep |
to,owing |
R1067 |
T4631 |
T4632 |
compound |
space,limitations |
R1068 |
T4632 |
T4630 |
pobj |
limitations,to |
R1069 |
T4633 |
T4632 |
acl |
mandating,limitations |
R1070 |
T4634 |
T4635 |
det |
a,outline |
R1071 |
T4635 |
T4633 |
dobj |
outline,mandating |
R1072 |
T4636 |
T4635 |
amod |
brief,outline |
R1073 |
T4637 |
T4622 |
punct |
.,are |
R1074 |
T4639 |
T4640 |
nsubj |
We,started |
R1075 |
T4641 |
T4640 |
prep |
from,started |
R1076 |
T4642 |
T4643 |
det |
a,1L |
R1077 |
T4643 |
T4641 |
pobj |
1L,from |
R1078 |
T4644 |
T4643 |
compound |
plasmid,1L |
R1079 |
T4645 |
T4643 |
compound |
L3,1L |
R1080 |
T4646 |
T4643 |
punct |
-,1L |
R1081 |
T4647 |
T4643 |
acl |
containing,1L |
R1082 |
T4648 |
T4649 |
amod |
heterologous,sites |
R1083 |
T4649 |
T4647 |
dobj |
sites,containing |
R1084 |
T4650 |
T4649 |
compound |
loxP,sites |
R1085 |
T4651 |
T4652 |
punct |
(,is |
R1086 |
T4652 |
T4640 |
parataxis |
is,started |
R1087 |
T4653 |
T4654 |
nsubj |
L3,is |
R1088 |
T4654 |
T4652 |
ccomp |
is,is |
R1089 |
T4655 |
T4656 |
det |
the,loxP257 |
R1090 |
T4656 |
T4654 |
attr |
loxP257,is |
R1091 |
T4657 |
T4656 |
amod |
mutant,loxP257 |
R1092 |
T4658 |
T4659 |
advmod |
recently,described |
R1093 |
T4659 |
T4656 |
acl |
described,loxP257 |
R1094 |
T4660 |
T4661 |
punct |
(,14 |
R1095 |
T4661 |
T4654 |
parataxis |
14,is |
R1096 |
T4662 |
T4661 |
punct |
),14 |
R1097 |
T4663 |
T4652 |
punct |
", ",is |
R1098 |
T4664 |
T4652 |
nsubj |
1L,is |
R1099 |
T4665 |
T4666 |
det |
an,loxP |
R1100 |
T4666 |
T4652 |
attr |
loxP,is |
R1101 |
T4667 |
T4666 |
amod |
inverted,loxP |
R1102 |
T4668 |
T4666 |
compound |
WT,loxP |
R1103 |
T4669 |
T4652 |
punct |
),is |
R1104 |
T4670 |
T4640 |
punct |
.,started |
R1105 |
T4672 |
T4673 |
det |
The,loxP |
R1106 |
T4673 |
T4675 |
nsubj |
loxP,differ |
R1107 |
T4674 |
T4673 |
compound |
WT,loxP |
R1108 |
T4675 |
T4678 |
ccomp |
differ,is |
R1109 |
T4676 |
T4673 |
cc |
and,loxP |
R1110 |
T4677 |
T4673 |
conj |
loxP257,loxP |
R1111 |
T4679 |
T4675 |
prep |
in,differ |
R1112 |
T4680 |
T4681 |
poss |
their,sequences |
R1113 |
T4681 |
T4679 |
pobj |
sequences,in |
R1114 |
T4682 |
T4681 |
compound |
spacer,sequences |
R1115 |
T4683 |
T4678 |
punct |
: ,is |
R1116 |
T4684 |
T4685 |
det |
the,sequence |
R1117 |
T4685 |
T4678 |
nsubj |
sequence,is |
R1118 |
T4686 |
T4685 |
compound |
spacer,sequence |
R1119 |
T4687 |
T4678 |
attr |
5,is |
R1120 |
T4688 |
T4687 |
punct |
′,5 |
R1121 |
T4689 |
T4687 |
punct |
-,5 |
R1122 |
T4690 |
T4687 |
amod |
ATGTATGC,5 |
R1123 |
T4691 |
T4687 |
punct |
-,5 |
R1124 |
T4692 |
T4687 |
nummod |
3,5 |
R1125 |
T4693 |
T4687 |
punct |
′,5 |
R1126 |
T4694 |
T4687 |
prep |
for,5 |
R1127 |
T4695 |
T4696 |
compound |
WT,loxP |
R1128 |
T4696 |
T4694 |
pobj |
loxP,for |
R1129 |
T4697 |
T4687 |
cc |
and,5 |
R1130 |
T4698 |
T4699 |
nummod |
5,AAGTCTCC |
R1131 |
T4699 |
T4687 |
conj |
AAGTCTCC,5 |
R1132 |
T4700 |
T4698 |
punct |
′,5 |
R1133 |
T4701 |
T4699 |
punct |
-,AAGTCTCC |
R1134 |
T4702 |
T4699 |
punct |
-,AAGTCTCC |
R1135 |
T4703 |
T4699 |
nummod |
3,AAGTCTCC |
R1136 |
T4704 |
T4699 |
punct |
′,AAGTCTCC |
R1137 |
T4705 |
T4699 |
prep |
for,AAGTCTCC |
R1138 |
T4706 |
T4705 |
pobj |
loxP257,for |
R1139 |
T4707 |
T4678 |
punct |
.,is |
R1140 |
T4709 |
T4710 |
det |
The,mutations |
R1141 |
T4710 |
T4712 |
nsubj |
mutations,prevent |
R1142 |
T4711 |
T4710 |
nummod |
three,mutations |
R1143 |
T4712 |
T4718 |
ccomp |
prevent,occurred |
R1144 |
T4713 |
T4710 |
prep |
in,mutations |
R1145 |
T4714 |
T4715 |
det |
the,sequence |
R1146 |
T4715 |
T4713 |
pobj |
sequence,in |
R1147 |
T4716 |
T4715 |
compound |
loxP257,sequence |
R1148 |
T4717 |
T4715 |
compound |
spacer,sequence |
R1149 |
T4719 |
T4720 |
nsubj |
it,recombine |
R1150 |
T4720 |
T4712 |
ccomp |
recombine,prevent |
R1151 |
T4721 |
T4720 |
aux |
to,recombine |
R1152 |
T4722 |
T4720 |
prep |
with,recombine |
R1153 |
T4723 |
T4724 |
compound |
WT,loxP |
R1154 |
T4724 |
T4722 |
pobj |
loxP,with |
R1155 |
T4725 |
T4712 |
punct |
", ",prevent |
R1156 |
T4726 |
T4712 |
advcl |
ensuring,prevent |
R1157 |
T4727 |
T4728 |
amod |
efficient,RMCE |
R1158 |
T4728 |
T4726 |
dobj |
RMCE,ensuring |
R1159 |
T4729 |
T4726 |
prep |
in,ensuring |
R1160 |
T4730 |
T4731 |
amod |
several,lines |
R1161 |
T4731 |
T4729 |
pobj |
lines,in |
R1162 |
T4732 |
T4731 |
compound |
cell,lines |
R1163 |
T4733 |
T4718 |
punct |
: ,occurred |
R1164 |
T4734 |
T4735 |
amod |
accurate,RMCE |
R1165 |
T4735 |
T4718 |
nsubj |
RMCE,occurred |
R1166 |
T4736 |
T4735 |
prep |
with,RMCE |
R1167 |
T4737 |
T4738 |
det |
these,sites |
R1168 |
T4738 |
T4736 |
pobj |
sites,with |
R1169 |
T4739 |
T4738 |
compound |
loxP,sites |
R1170 |
T4740 |
T4718 |
prep |
with,occurred |
R1171 |
T4741 |
T4742 |
det |
an,frequency |
R1172 |
T4742 |
T4740 |
pobj |
frequency,with |
R1173 |
T4743 |
T4742 |
amod |
average,frequency |
R1174 |
T4744 |
T4742 |
prep |
of,frequency |
R1175 |
T4745 |
T4746 |
nummod |
81,% |
R1176 |
T4746 |
T4744 |
pobj |
%,of |
R1177 |
T4747 |
T4742 |
prep |
at,frequency |
R1178 |
T4748 |
T4749 |
nummod |
two,loci |
R1179 |
T4749 |
T4747 |
pobj |
loci,at |
R1180 |
T4750 |
T4749 |
prep |
in,loci |
R1181 |
T4751 |
T4752 |
compound |
CHO,cells |
R1182 |
T4752 |
T4750 |
pobj |
cells,in |
R1183 |
T4753 |
T4742 |
cc |
and,frequency |
R1184 |
T4754 |
T4755 |
det |
an,frequency |
R1185 |
T4755 |
T4742 |
conj |
frequency,frequency |
R1186 |
T4756 |
T4755 |
amod |
average,frequency |
R1187 |
T4757 |
T4755 |
prep |
of,frequency |
R1188 |
T4758 |
T4759 |
nummod |
69,% |
R1189 |
T4759 |
T4757 |
pobj |
%,of |
R1190 |
T4760 |
T4755 |
prep |
at,frequency |
R1191 |
T4761 |
T4762 |
nummod |
four,loci |
R1192 |
T4762 |
T4760 |
pobj |
loci,at |
R1193 |
T4763 |
T4762 |
prep |
in,loci |
R1194 |
T4764 |
T4765 |
compound |
Hela,cells |
R1195 |
T4765 |
T4763 |
pobj |
cells,in |
R1196 |
T4766 |
T4767 |
punct |
(,14 |
R1197 |
T4767 |
T4718 |
parataxis |
14,occurred |
R1198 |
T4768 |
T4767 |
punct |
),14 |
R1199 |
T4769 |
T4718 |
punct |
.,occurred |
R1200 |
T4771 |
T4772 |
det |
The,plasmid |
R1201 |
T4772 |
T4776 |
nsubjpass |
plasmid,modified |
R1202 |
T4773 |
T4774 |
compound |
L3,1L |
R1203 |
T4774 |
T4772 |
compound |
1L,plasmid |
R1204 |
T4775 |
T4774 |
punct |
-,1L |
R1205 |
T4777 |
T4776 |
auxpass |
was,modified |
R1206 |
T4778 |
T4776 |
advmod |
first,modified |
R1207 |
T4779 |
T4780 |
aux |
to,include |
R1208 |
T4780 |
T4776 |
advcl |
include,modified |
R1209 |
T4781 |
T4782 |
det |
a,ClaI |
R1210 |
T4782 |
T4780 |
dobj |
ClaI,include |
R1211 |
T4783 |
T4782 |
cc |
and,ClaI |
R1212 |
T4784 |
T4785 |
det |
a,site |
R1213 |
T4785 |
T4782 |
conj |
site,ClaI |
R1214 |
T4786 |
T4785 |
compound |
FseI,site |
R1215 |
T4787 |
T4780 |
prep |
between,include |
R1216 |
T4788 |
T4789 |
det |
the,sites |
R1217 |
T4789 |
T4787 |
pobj |
sites,between |
R1218 |
T4790 |
T4789 |
compound |
LoxP,sites |
R1219 |
T4791 |
T4776 |
punct |
", ",modified |
R1220 |
T4792 |
T4776 |
advcl |
leading,modified |
R1221 |
T4793 |
T4792 |
prep |
to,leading |
R1222 |
T4794 |
T4795 |
compound |
plasmid,1L |
R1223 |
T4795 |
T4793 |
pobj |
1L,to |
R1224 |
T4796 |
T4795 |
compound |
L3,1L |
R1225 |
T4797 |
T4795 |
punct |
-,1L |
R1226 |
T4798 |
T4795 |
compound |
CF,1L |
R1227 |
T4799 |
T4795 |
punct |
-,1L |
R1228 |
T4800 |
T4776 |
punct |
.,modified |
R1229 |
T4802 |
T4803 |
nsubj |
We,modified |
R1230 |
T4804 |
T4803 |
advmod |
next,modified |
R1231 |
T4805 |
T4806 |
det |
a,plasmid |
R1232 |
T4806 |
T4803 |
dobj |
plasmid,modified |
R1233 |
T4807 |
T4806 |
compound |
puroΔTK,plasmid |
R1234 |
T4808 |
T4806 |
punct |
(,plasmid |
R1235 |
T4809 |
T4806 |
appos |
YTC37,plasmid |
R1236 |
T4810 |
T4809 |
punct |
", ",YTC37 |
R1237 |
T4811 |
T4812 |
det |
a,gift |
R1238 |
T4812 |
T4809 |
appos |
gift,YTC37 |
R1239 |
T4813 |
T4812 |
compound |
kind,gift |
R1240 |
T4814 |
T4812 |
prep |
from,gift |
R1241 |
T4815 |
T4816 |
compound |
A.,Bradley |
R1242 |
T4816 |
T4814 |
pobj |
Bradley,from |
R1243 |
T4817 |
T4803 |
punct |
),modified |
R1244 |
T4818 |
T4803 |
prep |
by,modified |
R1245 |
T4819 |
T4818 |
pcomp |
using,by |
R1246 |
T4820 |
T4819 |
dobj |
oligonucleotides,using |
R1247 |
T4821 |
T4822 |
aux |
to,destroy |
R1248 |
T4822 |
T4819 |
advcl |
destroy,using |
R1249 |
T4823 |
T4824 |
det |
a,site |
R1250 |
T4824 |
T4822 |
dobj |
site,destroy |
R1251 |
T4825 |
T4824 |
compound |
NotI,site |
R1252 |
T4826 |
T4824 |
advmod |
downstream,site |
R1253 |
T4827 |
T4826 |
prep |
of,downstream |
R1254 |
T4828 |
T4829 |
det |
the,gene |
R1255 |
T4829 |
T4827 |
pobj |
gene,of |
R1256 |
T4830 |
T4829 |
compound |
puroΔTK,gene |
R1257 |
T4831 |
T4822 |
cc |
and,destroy |
R1258 |
T4832 |
T4822 |
conj |
introduce,destroy |
R1259 |
T4833 |
T4834 |
det |
a,site |
R1260 |
T4834 |
T4832 |
dobj |
site,introduce |
R1261 |
T4835 |
T4834 |
compound |
NotI,site |
R1262 |
T4836 |
T4832 |
advmod |
upstream,introduce |
R1263 |
T4837 |
T4832 |
punct |
", ",introduce |
R1264 |
T4838 |
T4832 |
cc |
and,introduce |
R1265 |
T4839 |
T4840 |
det |
a,site |
R1266 |
T4840 |
T4832 |
conj |
site,introduce |
R1267 |
T4841 |
T4840 |
compound |
FseI,site |
R1268 |
T4842 |
T4840 |
advmod |
downstream,site |
R1269 |
T4843 |
T4842 |
prep |
of,downstream |
R1270 |
T4844 |
T4845 |
det |
the,gene |
R1271 |
T4845 |
T4843 |
pobj |
gene,of |
R1272 |
T4846 |
T4847 |
punct |
(,leading |
R1273 |
T4847 |
T4840 |
parataxis |
leading,site |
R1274 |
T4848 |
T4847 |
prep |
to,leading |
R1275 |
T4849 |
T4850 |
compound |
plasmid,F |
R1276 |
T4850 |
T4848 |
pobj |
F,to |
R1277 |
T4851 |
T4850 |
compound |
CN,F |
R1278 |
T4852 |
T4850 |
punct |
-,F |
R1279 |
T4853 |
T4850 |
compound |
PuroΔTK,F |
R1280 |
T4854 |
T4850 |
punct |
-,F |
R1281 |
T4855 |
T4847 |
punct |
),leading |
R1282 |
T4856 |
T4803 |
punct |
.,modified |
R1283 |
T4858 |
T4859 |
advmod |
Next,subcloned |
R1284 |
T4860 |
T4859 |
punct |
", ",subcloned |
R1285 |
T4861 |
T4862 |
det |
a,fragment |
R1286 |
T4862 |
T4859 |
nsubjpass |
fragment,subcloned |
R1287 |
T4863 |
T4864 |
nmod |
PmlI,MfeI |
R1288 |
T4864 |
T4862 |
nmod |
MfeI,fragment |
R1289 |
T4865 |
T4864 |
punct |
-,MfeI |
R1290 |
T4866 |
T4867 |
nummod |
6.3,kb |
R1291 |
T4867 |
T4862 |
compound |
kb,fragment |
R1292 |
T4868 |
T4862 |
prep |
from,fragment |
R1293 |
T4869 |
T4868 |
pobj |
Trp53,from |
R1294 |
T4870 |
T4859 |
auxpass |
was,subcloned |
R1295 |
T4871 |
T4859 |
prep |
in,subcloned |
R1296 |
T4872 |
T4873 |
det |
a,KSII+ |
R1297 |
T4873 |
T4871 |
pobj |
KSII+,in |
R1298 |
T4874 |
T4873 |
amod |
modified,KSII+ |
R1299 |
T4875 |
T4873 |
compound |
pBluescript,KSII+ |
R1300 |
T4876 |
T4877 |
punct |
(,pBS |
R1301 |
T4877 |
T4873 |
parataxis |
pBS,KSII+ |
R1302 |
T4878 |
T4877 |
punct |
", ",pBS |
R1303 |
T4879 |
T4877 |
npadvmod |
Stratagene,pBS |
R1304 |
T4880 |
T4877 |
punct |
),pBS |
R1305 |
T4881 |
T4859 |
punct |
", ",subcloned |
R1306 |
T4882 |
T4859 |
cc |
and,subcloned |
R1307 |
T4883 |
T4884 |
det |
the,plasmid |
R1308 |
T4884 |
T4886 |
nsubjpass |
plasmid,digested |
R1309 |
T4885 |
T4884 |
amod |
resulting,plasmid |
R1310 |
T4886 |
T4859 |
conj |
digested,subcloned |
R1311 |
T4887 |
T4886 |
auxpass |
was,digested |
R1312 |
T4888 |
T4886 |
prep |
with,digested |
R1313 |
T4889 |
T4888 |
pobj |
SwaI,with |
R1314 |
T4890 |
T4891 |
aux |
to,introduce |
R1315 |
T4891 |
T4886 |
advcl |
introduce,digested |
R1316 |
T4892 |
T4893 |
det |
an,site |
R1317 |
T4893 |
T4891 |
dobj |
site,introduce |
R1318 |
T4894 |
T4893 |
compound |
EagI,site |
R1319 |
T4895 |
T4891 |
punct |
", ",introduce |
R1320 |
T4896 |
T4891 |
advcl |
leading,introduce |
R1321 |
T4897 |
T4896 |
prep |
to,leading |
R1322 |
T4898 |
T4897 |
pobj |
p53PmlEag,to |
R1323 |
T4899 |
T4898 |
punct |
", ",p53PmlEag |
R1324 |
T4900 |
T4901 |
det |
a,plasmid |
R1325 |
T4901 |
T4898 |
appos |
plasmid,p53PmlEag |
R1326 |
T4902 |
T4901 |
acl |
containing,plasmid |
R1327 |
T4903 |
T4904 |
nmod |
exons,11 |
R1328 |
T4904 |
T4902 |
dobj |
11,containing |
R1329 |
T4905 |
T4904 |
nummod |
2,11 |
R1330 |
T4906 |
T4904 |
punct |
–,11 |
R1331 |
T4907 |
T4904 |
prep |
of,11 |
R1332 |
T4908 |
T4907 |
pobj |
p53,of |
R1333 |
T4909 |
T4886 |
punct |
.,digested |
R1334 |
T4911 |
T4912 |
nsubj |
We,inserted |
R1335 |
T4913 |
T4912 |
advmod |
then,inserted |
R1336 |
T4914 |
T4915 |
det |
a,fragment |
R1337 |
T4915 |
T4912 |
dobj |
fragment,inserted |
R1338 |
T4916 |
T4917 |
nummod |
5.5,kb |
R1339 |
T4917 |
T4915 |
compound |
kb,fragment |
R1340 |
T4918 |
T4919 |
compound |
ClaI,EagI |
R1341 |
T4919 |
T4915 |
compound |
EagI,fragment |
R1342 |
T4920 |
T4919 |
punct |
-,EagI |
R1343 |
T4921 |
T4915 |
prep |
from,fragment |
R1344 |
T4922 |
T4921 |
pobj |
p53PmlEag,from |
R1345 |
T4923 |
T4915 |
prep |
in,fragment |
R1346 |
T4924 |
T4925 |
compound |
plasmid,F |
R1347 |
T4925 |
T4923 |
pobj |
F,in |
R1348 |
T4926 |
T4925 |
compound |
CN,F |
R1349 |
T4927 |
T4925 |
punct |
-,F |
R1350 |
T4928 |
T4925 |
compound |
PuroΔTK,F |
R1351 |
T4929 |
T4925 |
punct |
-,F |
R1352 |
T4930 |
T4915 |
acl |
digested,fragment |
R1353 |
T4931 |
T4930 |
agent |
by,digested |
R1354 |
T4932 |
T4931 |
pobj |
ClaI,by |
R1355 |
T4933 |
T4932 |
cc |
and,ClaI |
R1356 |
T4934 |
T4932 |
conj |
NotI,ClaI |
R1357 |
T4935 |
T4912 |
punct |
", ",inserted |
R1358 |
T4936 |
T4912 |
cc |
and,inserted |
R1359 |
T4937 |
T4912 |
conj |
inserted,inserted |
R1360 |
T4938 |
T4939 |
det |
the,fragment |
R1361 |
T4939 |
T4937 |
dobj |
fragment,inserted |
R1362 |
T4940 |
T4939 |
amod |
resulting,fragment |
R1363 |
T4941 |
T4937 |
prep |
between,inserted |
R1364 |
T4942 |
T4943 |
det |
the,sites |
R1365 |
T4943 |
T4941 |
pobj |
sites,between |
R1366 |
T4944 |
T4943 |
compound |
loxP,sites |
R1367 |
T4945 |
T4943 |
prep |
of,sites |
R1368 |
T4946 |
T4947 |
compound |
L3,1L |
R1369 |
T4947 |
T4945 |
pobj |
1L,of |
R1370 |
T4948 |
T4947 |
punct |
-,1L |
R1371 |
T4949 |
T4947 |
compound |
CF,1L |
R1372 |
T4950 |
T4947 |
punct |
-,1L |
R1373 |
T4951 |
T4937 |
prep |
by,inserted |
R1374 |
T4952 |
T4953 |
nmod |
ClaI,digestion |
R1375 |
T4953 |
T4951 |
pobj |
digestion,by |
R1376 |
T4954 |
T4952 |
cc |
and,ClaI |
R1377 |
T4955 |
T4952 |
conj |
FseI,ClaI |
R1378 |
T4956 |
T4937 |
punct |
", ",inserted |
R1379 |
T4957 |
T4937 |
advcl |
leading,inserted |
R1380 |
T4958 |
T4957 |
prep |
to,leading |
R1381 |
T4959 |
T4960 |
compound |
L3,1L |
R1382 |
T4960 |
T4958 |
pobj |
1L,to |
R1383 |
T4961 |
T4960 |
punct |
-,1L |
R1384 |
T4962 |
T4960 |
compound |
p53PmlEagPuroΔTK,1L |
R1385 |
T4963 |
T4960 |
punct |
-,1L |
R1386 |
T4964 |
T4912 |
punct |
.,inserted |
R1387 |
T4966 |
T4967 |
nsubj |
We,engineered |
R1388 |
T4967 |
T4969 |
ccomp |
engineered,performed |
R1389 |
T4968 |
T4967 |
advmod |
next,engineered |
R1390 |
T4970 |
T4971 |
det |
a,plasmid |
R1391 |
T4971 |
T4967 |
dobj |
plasmid,engineered |
R1392 |
T4972 |
T4971 |
acl |
containing,plasmid |
R1393 |
T4973 |
T4974 |
det |
the,region |
R1394 |
T4974 |
T4972 |
dobj |
region,containing |
R1395 |
T4975 |
T4974 |
prep |
for,region |
R1396 |
T4976 |
T4975 |
pobj |
3,for |
R1397 |
T4977 |
T4976 |
punct |
′,3 |
R1398 |
T4978 |
T4976 |
punct |
-,3 |
R1399 |
T4979 |
T4976 |
amod |
homology,3 |
R1400 |
T4980 |
T4972 |
advmod |
downstream,containing |
R1401 |
T4981 |
T4980 |
prep |
of,downstream |
R1402 |
T4982 |
T4983 |
det |
the,gene |
R1403 |
T4983 |
T4981 |
pobj |
gene,of |
R1404 |
T4984 |
T4983 |
compound |
p53,gene |
R1405 |
T4985 |
T4983 |
cc |
and,gene |
R1406 |
T4986 |
T4987 |
det |
the,gene |
R1407 |
T4987 |
T4983 |
conj |
gene,gene |
R1408 |
T4988 |
T4987 |
compound |
DTA,gene |
R1409 |
T4989 |
T4967 |
prep |
in,engineered |
R1410 |
T4990 |
T4991 |
nummod |
two,steps |
R1411 |
T4991 |
T4989 |
pobj |
steps,in |
R1412 |
T4992 |
T4969 |
punct |
: ,performed |
R1413 |
T4993 |
T4994 |
punct |
(,i |
R1414 |
T4994 |
T4969 |
meta |
i,performed |
R1415 |
T4995 |
T4994 |
punct |
),i |
R1416 |
T4996 |
T4969 |
nsubj |
we,performed |
R1417 |
T4997 |
T4998 |
det |
a,ligation |
R1418 |
T4998 |
T4969 |
dobj |
ligation,performed |
R1419 |
T4999 |
T5000 |
nummod |
three,way |
R1420 |
T5000 |
T4998 |
compound |
way,ligation |
R1421 |
T5001 |
T5000 |
punct |
-,way |
R1422 |
T5002 |
T4998 |
prep |
between,ligation |
R1423 |
T5003 |
T5004 |
det |
a,pBS |
R1424 |
T5004 |
T5002 |
pobj |
pBS,between |
R1425 |
T5005 |
T5004 |
amod |
modified,pBS |
R1426 |
T5006 |
T5004 |
acl |
digested,pBS |
R1427 |
T5007 |
T5006 |
agent |
by,digested |
R1428 |
T5008 |
T5007 |
pobj |
HindIII,by |
R1429 |
T5009 |
T5008 |
cc |
and,HindIII |
R1430 |
T5010 |
T5008 |
conj |
NotI,HindIII |
R1431 |
T5011 |
T5004 |
punct |
", ",pBS |
R1432 |
T5012 |
T5013 |
det |
a,fragment |
R1433 |
T5013 |
T5004 |
conj |
fragment,pBS |
R1434 |
T5014 |
T5015 |
compound |
HindIII,EcoRI |
R1435 |
T5015 |
T5013 |
compound |
EcoRI,fragment |
R1436 |
T5016 |
T5015 |
punct |
-,EcoRI |
R1437 |
T5017 |
T5013 |
prep |
from,fragment |
R1438 |
T5018 |
T5017 |
pobj |
Trp53,from |
R1439 |
T5019 |
T5013 |
prep |
for,fragment |
R1440 |
T5020 |
T5021 |
nummod |
3,homology |
R1441 |
T5021 |
T5019 |
pobj |
homology,for |
R1442 |
T5022 |
T5020 |
punct |
′,3 |
R1443 |
T5023 |
T5013 |
cc |
and,fragment |
R1444 |
T5024 |
T5025 |
det |
an,fragment |
R1445 |
T5025 |
T5013 |
conj |
fragment,fragment |
R1446 |
T5026 |
T5027 |
compound |
EcoRI,NotI |
R1447 |
T5027 |
T5025 |
compound |
NotI,fragment |
R1448 |
T5028 |
T5027 |
punct |
-,NotI |
R1449 |
T5029 |
T5025 |
acl |
containing,fragment |
R1450 |
T5030 |
T5031 |
det |
the,gene |
R1451 |
T5031 |
T5029 |
dobj |
gene,containing |
R1452 |
T5032 |
T5031 |
compound |
DTA,gene |
R1453 |
T5033 |
T5025 |
punct |
", ",fragment |
R1454 |
T5034 |
T5025 |
prep |
from,fragment |
R1455 |
T5035 |
T5036 |
compound |
plasmid,pgkdtabpa |
R1456 |
T5036 |
T5034 |
pobj |
pgkdtabpa,from |
R1457 |
T5037 |
T5025 |
punct |
(,fragment |
R1458 |
T5038 |
T5039 |
amod |
kind,gift |
R1459 |
T5039 |
T5025 |
appos |
gift,fragment |
R1460 |
T5040 |
T5039 |
prep |
of,gift |
R1461 |
T5041 |
T5042 |
compound |
P.,Soriano |
R1462 |
T5042 |
T5040 |
pobj |
Soriano,of |
R1463 |
T5043 |
T4969 |
punct |
),performed |
R1464 |
T5044 |
T4969 |
punct |
", ",performed |
R1465 |
T5045 |
T4969 |
advcl |
leading,performed |
R1466 |
T5046 |
T5045 |
prep |
to,leading |
R1467 |
T5047 |
T5048 |
nmod |
plasmid,DTA |
R1468 |
T5048 |
T5046 |
pobj |
DTA,to |
R1469 |
T5049 |
T5048 |
nummod |
3,DTA |
R1470 |
T5050 |
T5049 |
punct |
′,3 |
R1471 |
T5051 |
T5049 |
punct |
+,3 |
R1472 |
T5052 |
T4969 |
cc |
and,performed |
R1473 |
T5053 |
T5054 |
punct |
(,ii |
R1474 |
T5054 |
T5055 |
meta |
ii,deleted |
R1475 |
T5055 |
T4969 |
conj |
deleted,performed |
R1476 |
T5056 |
T5054 |
punct |
),ii |
R1477 |
T5057 |
T5058 |
mark |
because,contains |
R1478 |
T5058 |
T5055 |
advcl |
contains,deleted |
R1479 |
T5059 |
T5060 |
det |
the,region |
R1480 |
T5060 |
T5058 |
nsubj |
region,contains |
R1481 |
T5061 |
T5062 |
compound |
Bsu36I,EcoRI |
R1482 |
T5062 |
T5060 |
compound |
EcoRI,region |
R1483 |
T5063 |
T5062 |
punct |
-,EcoRI |
R1484 |
T5064 |
T5060 |
advmod |
downstream,region |
R1485 |
T5065 |
T5064 |
prep |
of,downstream |
R1486 |
T5066 |
T5065 |
pobj |
p53,of |
R1487 |
T5067 |
T5068 |
amod |
repetitive,sequences |
R1488 |
T5068 |
T5058 |
dobj |
sequences,contains |
R1489 |
T5069 |
T5070 |
punct |
(,F. |
R1490 |
T5070 |
T5058 |
meta |
F.,contains |
R1491 |
T5071 |
T5070 |
nmod |
Toledo,F. |
R1492 |
T5072 |
T5070 |
cc |
and,F. |
R1493 |
T5073 |
T5070 |
conj |
G.,F. |
R1494 |
T5074 |
T5073 |
nmod |
M.,G. |
R1495 |
T5075 |
T5073 |
nmod |
Wahl,G. |
R1496 |
T5076 |
T5073 |
punct |
", ",G. |
R1497 |
T5077 |
T5078 |
amod |
unpublished,data |
R1498 |
T5078 |
T5073 |
conj |
data,G. |
R1499 |
T5079 |
T5078 |
punct |
),data |
R1500 |
T5080 |
T5055 |
punct |
", ",deleted |
R1501 |
T5081 |
T5055 |
nsubj |
we,deleted |
R1502 |
T5082 |
T5055 |
advmod |
later,deleted |
R1503 |
T5083 |
T5084 |
det |
this,region |
R1504 |
T5084 |
T5055 |
dobj |
region,deleted |
R1505 |
T5085 |
T5055 |
punct |
", ",deleted |
R1506 |
T5086 |
T5087 |
aux |
to,obtain |
R1507 |
T5087 |
T5055 |
advcl |
obtain,deleted |
R1508 |
T5088 |
T5089 |
nmod |
plasmid,DTA |
R1509 |
T5089 |
T5087 |
dobj |
DTA,obtain |
R1510 |
T5090 |
T5089 |
nummod |
3,DTA |
R1511 |
T5091 |
T5090 |
punct |
′,3 |
R1512 |
T5092 |
T5090 |
punct |
+,3 |
R1513 |
T5093 |
T4969 |
punct |
.,performed |
R1514 |
T5095 |
T5096 |
det |
The,homology |
R1515 |
T5096 |
T5099 |
nsubj |
homology,consists |
R1516 |
T5097 |
T5096 |
nummod |
5,homology |
R1517 |
T5098 |
T5097 |
punct |
′,5 |
R1518 |
T5100 |
T5099 |
prep |
of,consists |
R1519 |
T5101 |
T5102 |
det |
a,fragment |
R1520 |
T5102 |
T5100 |
pobj |
fragment,of |
R1521 |
T5103 |
T5104 |
nummod |
3.4,kb |
R1522 |
T5104 |
T5105 |
npadvmod |
kb,long |
R1523 |
T5105 |
T5102 |
amod |
long,fragment |
R1524 |
T5106 |
T5105 |
punct |
-,long |
R1525 |
T5107 |
T5108 |
compound |
BamHI,PmlI |
R1526 |
T5108 |
T5102 |
compound |
PmlI,fragment |
R1527 |
T5109 |
T5108 |
punct |
-,PmlI |
R1528 |
T5110 |
T5102 |
prep |
from,fragment |
R1529 |
T5111 |
T5110 |
pobj |
intron,from |
R1530 |
T5112 |
T5111 |
nummod |
1,intron |
R1531 |
T5113 |
T5111 |
prep |
of,intron |
R1532 |
T5114 |
T5113 |
pobj |
p53,of |
R1533 |
T5115 |
T5102 |
acl |
cloned,fragment |
R1534 |
T5116 |
T5115 |
prep |
in,cloned |
R1535 |
T5117 |
T5118 |
det |
a,pBS |
R1536 |
T5118 |
T5116 |
pobj |
pBS,in |
R1537 |
T5119 |
T5118 |
amod |
modified,pBS |
R1538 |
T5120 |
T5118 |
punct |
(,pBS |
R1539 |
T5121 |
T5122 |
compound |
plasmid,p5 |
R1540 |
T5122 |
T5118 |
appos |
p5,pBS |
R1541 |
T5123 |
T5122 |
punct |
′,p5 |
R1542 |
T5124 |
T5099 |
punct |
),consists |
R1543 |
T5125 |
T5099 |
punct |
.,consists |
R1544 |
T5127 |
T5128 |
advmod |
Finally,assembled |
R1545 |
T5129 |
T5128 |
punct |
", ",assembled |
R1546 |
T5130 |
T5131 |
amod |
appropriate,fragments |
R1547 |
T5131 |
T5128 |
nsubjpass |
fragments,assembled |
R1548 |
T5132 |
T5131 |
prep |
from,fragments |
R1549 |
T5133 |
T5134 |
compound |
plasmids,p5 |
R1550 |
T5134 |
T5132 |
pobj |
p5,from |
R1551 |
T5135 |
T5134 |
punct |
′,p5 |
R1552 |
T5136 |
T5134 |
punct |
", ",p5 |
R1553 |
T5137 |
T5138 |
compound |
L3,1L |
R1554 |
T5138 |
T5134 |
conj |
1L,p5 |
R1555 |
T5139 |
T5138 |
punct |
-,1L |
R1556 |
T5140 |
T5138 |
compound |
p53PmlEagPuroΔTK,1L |
R1557 |
T5141 |
T5138 |
punct |
-,1L |
R1558 |
T5142 |
T5138 |
punct |
", ",1L |
R1559 |
T5143 |
T5138 |
cc |
and,1L |
R1560 |
T5144 |
T5145 |
nummod |
3,DTA |
R1561 |
T5145 |
T5138 |
conj |
DTA,1L |
R1562 |
T5146 |
T5144 |
punct |
′,3 |
R1563 |
T5147 |
T5144 |
punct |
+,3 |
R1564 |
T5148 |
T5128 |
auxpass |
were,assembled |
R1565 |
T5149 |
T5128 |
prep |
in,assembled |
R1566 |
T5150 |
T5151 |
det |
a,plasmid |
R1567 |
T5151 |
T5149 |
pobj |
plasmid,in |
R1568 |
T5152 |
T5151 |
amod |
modified,plasmid |
R1569 |
T5153 |
T5151 |
compound |
pSP72,plasmid |
R1570 |
T5154 |
T5155 |
punct |
(,Promega |
R1571 |
T5155 |
T5151 |
parataxis |
Promega,plasmid |
R1572 |
T5156 |
T5155 |
punct |
),Promega |
R1573 |
T5157 |
T5128 |
punct |
.,assembled |
R1574 |
T5159 |
T5160 |
compound |
Plasmid,Flox |
R1575 |
T5160 |
T5161 |
nsubjpass |
Flox,verified |
R1576 |
T5162 |
T5160 |
punct |
", ",Flox |
R1577 |
T5163 |
T5164 |
det |
the,construct |
R1578 |
T5164 |
T5160 |
appos |
construct,Flox |
R1579 |
T5165 |
T5164 |
amod |
resulting,construct |
R1580 |
T5166 |
T5164 |
compound |
targeting,construct |
R1581 |
T5167 |
T5161 |
punct |
", ",verified |
R1582 |
T5168 |
T5161 |
auxpass |
was,verified |
R1583 |
T5169 |
T5161 |
prep |
by,verified |
R1584 |
T5170 |
T5171 |
compound |
restriction,analysis |
R1585 |
T5171 |
T5169 |
pobj |
analysis,by |
R1586 |
T5172 |
T5161 |
punct |
", ",verified |
R1587 |
T5173 |
T5161 |
advmod |
then,verified |
R1588 |
T5174 |
T5161 |
dep |
sequenced,verified |
R1589 |
T5175 |
T5174 |
advcl |
using,sequenced |
R1590 |
T5176 |
T5177 |
nummod |
30,primers |
R1591 |
T5177 |
T5175 |
dobj |
primers,using |
R1592 |
T5178 |
T5177 |
acl |
chosen,primers |
R1593 |
T5179 |
T5180 |
aux |
to,verify |
R1594 |
T5180 |
T5178 |
advcl |
verify,chosen |
R1595 |
T5181 |
T5180 |
advmod |
precisely,verify |
R1596 |
T5182 |
T5183 |
det |
all,sequences |
R1597 |
T5183 |
T5180 |
dobj |
sequences,verify |
R1598 |
T5184 |
T5185 |
compound |
p53,coding |
R1599 |
T5185 |
T5183 |
compound |
coding,sequences |
R1600 |
T5186 |
T5183 |
punct |
", ",sequences |
R1601 |
T5187 |
T5188 |
det |
all,junctions |
R1602 |
T5188 |
T5183 |
conj |
junctions,sequences |
R1603 |
T5189 |
T5190 |
compound |
exon,intron |
R1604 |
T5190 |
T5188 |
compound |
intron,junctions |
R1605 |
T5191 |
T5190 |
punct |
–,intron |
R1606 |
T5192 |
T5188 |
cc |
and,junctions |
R1607 |
T5193 |
T5194 |
det |
the,sequences |
R1608 |
T5194 |
T5188 |
conj |
sequences,junctions |
R1609 |
T5195 |
T5194 |
prep |
at,sequences |
R1610 |
T5196 |
T5195 |
cc |
and,at |
R1611 |
T5197 |
T5195 |
conj |
around,at |
R1612 |
T5198 |
T5199 |
det |
the,sites |
R1613 |
T5199 |
T5197 |
pobj |
sites,around |
R1614 |
T5200 |
T5199 |
compound |
loxP,sites |
R1615 |
T5201 |
T5161 |
punct |
.,verified |
R1618 |
T5752 |
T5753 |
compound |
Exchange,constructs |
R1619 |
T5754 |
T5753 |
punct |
: ,constructs |
R1620 |
T5755 |
T5753 |
acl |
making,constructs |
R1621 |
T5756 |
T5757 |
det |
the,p53GFP |
R1622 |
T5757 |
T5758 |
nmod |
p53GFP,plasmids |
R1623 |
T5758 |
T5755 |
dobj |
plasmids,making |
R1624 |
T5759 |
T5757 |
cc |
and,p53GFP |
R1625 |
T5760 |
T5761 |
compound |
p53,PGFP |
R1626 |
T5761 |
T5757 |
conj |
PGFP,p53GFP |
R1627 |
T5762 |
T5761 |
compound |
Δ,PGFP |
R1628 |
T5764 |
T5765 |
aux |
To,make |
R1629 |
T5765 |
T5766 |
advcl |
make,subcloned |
R1630 |
T5767 |
T5768 |
det |
a,protein |
R1631 |
T5768 |
T5765 |
dobj |
protein,make |
R1632 |
T5769 |
T5770 |
compound |
p53,GFP |
R1633 |
T5770 |
T5768 |
compound |
GFP,protein |
R1634 |
T5771 |
T5770 |
punct |
-,GFP |
R1635 |
T5772 |
T5768 |
compound |
fusion,protein |
R1636 |
T5773 |
T5766 |
punct |
", ",subcloned |
R1637 |
T5774 |
T5766 |
nsubj |
we,subcloned |
R1638 |
T5775 |
T5766 |
advmod |
first,subcloned |
R1639 |
T5776 |
T5777 |
det |
a,fragment |
R1640 |
T5777 |
T5766 |
dobj |
fragment,subcloned |
R1641 |
T5778 |
T5779 |
compound |
SacII,HindIII |
R1642 |
T5779 |
T5777 |
compound |
HindIII,fragment |
R1643 |
T5780 |
T5779 |
punct |
-,HindIII |
R1644 |
T5781 |
T5777 |
prep |
of,fragment |
R1645 |
T5782 |
T5783 |
det |
the,locus |
R1646 |
T5783 |
T5781 |
pobj |
locus,of |
R1647 |
T5784 |
T5783 |
compound |
p53,locus |
R1648 |
T5785 |
T5777 |
punct |
(,fragment |
R1649 |
T5786 |
T5777 |
acl |
corresponding,fragment |
R1650 |
T5787 |
T5786 |
prep |
to,corresponding |
R1651 |
T5788 |
T5787 |
pobj |
part,to |
R1652 |
T5789 |
T5788 |
prep |
of,part |
R1653 |
T5790 |
T5789 |
pobj |
exon,of |
R1654 |
T5791 |
T5790 |
nummod |
10,exon |
R1655 |
T5792 |
T5786 |
prep |
to,corresponding |
R1656 |
T5793 |
T5792 |
pobj |
sequences,to |
R1657 |
T5794 |
T5793 |
advmod |
downstream,sequences |
R1658 |
T5795 |
T5794 |
prep |
of,downstream |
R1659 |
T5796 |
T5797 |
det |
the,gene |
R1660 |
T5797 |
T5795 |
pobj |
gene,of |
R1661 |
T5798 |
T5766 |
punct |
),subcloned |
R1662 |
T5799 |
T5766 |
prep |
into,subcloned |
R1663 |
T5800 |
T5799 |
pobj |
pBS,into |
R1664 |
T5801 |
T5766 |
punct |
", ",subcloned |
R1665 |
T5802 |
T5803 |
advmod |
then,mutated |
R1666 |
T5803 |
T5766 |
dep |
mutated,subcloned |
R1667 |
T5804 |
T5805 |
det |
the,site |
R1668 |
T5805 |
T5803 |
dobj |
site,mutated |
R1669 |
T5806 |
T5805 |
compound |
HindIII,site |
R1670 |
T5807 |
T5803 |
prep |
into,mutated |
R1671 |
T5808 |
T5809 |
det |
a,site |
R1672 |
T5809 |
T5807 |
pobj |
site,into |
R1673 |
T5810 |
T5809 |
compound |
FseI,site |
R1674 |
T5811 |
T5766 |
punct |
.,subcloned |
R1675 |
T5813 |
T5814 |
nsubj |
We,mutated |
R1676 |
T5815 |
T5814 |
advmod |
next,mutated |
R1677 |
T5816 |
T5817 |
det |
the,part |
R1678 |
T5817 |
T5814 |
dobj |
part,mutated |
R1679 |
T5818 |
T5819 |
npadvmod |
C,terminal |
R1680 |
T5819 |
T5817 |
amod |
terminal,part |
R1681 |
T5820 |
T5819 |
punct |
-,terminal |
R1682 |
T5821 |
T5817 |
prep |
of,part |
R1683 |
T5822 |
T5823 |
det |
the,gene |
R1684 |
T5823 |
T5821 |
pobj |
gene,of |
R1685 |
T5824 |
T5823 |
compound |
p53,gene |
R1686 |
T5825 |
T5814 |
prep |
in,mutated |
R1687 |
T5826 |
T5827 |
nummod |
two,rounds |
R1688 |
T5827 |
T5825 |
pobj |
rounds,in |
R1689 |
T5828 |
T5827 |
prep |
of,rounds |
R1690 |
T5829 |
T5830 |
compound |
PCR,mutagenesis |
R1691 |
T5830 |
T5828 |
pobj |
mutagenesis,of |
R1692 |
T5831 |
T5814 |
punct |
", ",mutated |
R1693 |
T5832 |
T5833 |
advmod |
first,with |
R1694 |
T5833 |
T5814 |
prep |
with,mutated |
R1695 |
T5834 |
T5835 |
nmod |
primers,GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1696 |
T5835 |
T5833 |
pobj |
GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC,with |
R1697 |
T5836 |
T5835 |
nummod |
5,GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1698 |
T5837 |
T5836 |
punct |
′,5 |
R1699 |
T5838 |
T5835 |
punct |
-,GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1700 |
T5839 |
T5835 |
punct |
-,GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1701 |
T5840 |
T5835 |
nummod |
3,GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1702 |
T5841 |
T5835 |
punct |
′,GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1703 |
T5842 |
T5835 |
cc |
and,GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1704 |
T5843 |
T5844 |
nummod |
5,GACGGGATGCAGAGGGGATCCGTCTGAGTCAGGCCC |
R1705 |
T5844 |
T5835 |
conj |
GACGGGATGCAGAGGGGATCCGTCTGAGTCAGGCCC,GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1706 |
T5845 |
T5843 |
punct |
′,5 |
R1707 |
T5846 |
T5844 |
punct |
-,GACGGGATGCAGAGGGGATCCGTCTGAGTCAGGCCC |
R1708 |
T5847 |
T5844 |
punct |
-,GACGGGATGCAGAGGGGATCCGTCTGAGTCAGGCCC |
R1709 |
T5848 |
T5844 |
nummod |
3,GACGGGATGCAGAGGGGATCCGTCTGAGTCAGGCCC |
R1710 |
T5849 |
T5844 |
punct |
′,GACGGGATGCAGAGGGGATCCGTCTGAGTCAGGCCC |
R1711 |
T5850 |
T5835 |
punct |
", ",GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1712 |
T5851 |
T5852 |
dep |
which,removed |
R1713 |
T5852 |
T5835 |
relcl |
removed,GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1714 |
T5853 |
T5854 |
det |
the,codon |
R1715 |
T5854 |
T5852 |
dobj |
codon,removed |
R1716 |
T5855 |
T5854 |
compound |
stop,codon |
R1717 |
T5856 |
T5852 |
cc |
and,removed |
R1718 |
T5857 |
T5852 |
conj |
introduced,removed |
R1719 |
T5858 |
T5859 |
det |
a,site |
R1720 |
T5859 |
T5857 |
dobj |
site,introduced |
R1721 |
T5860 |
T5859 |
compound |
BamHI,site |
R1722 |
T5861 |
T5833 |
punct |
", ",with |
R1723 |
T5862 |
T5863 |
advmod |
then,with |
R1724 |
T5863 |
T5833 |
prep |
with,with |
R1725 |
T5864 |
T5865 |
nmod |
primers,GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1726 |
T5865 |
T5863 |
pobj |
GACGGATCCCCTCTGAATTCCGTCCCCATCACCA,with |
R1727 |
T5866 |
T5865 |
nummod |
5,GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1728 |
T5867 |
T5866 |
punct |
′,5 |
R1729 |
T5868 |
T5865 |
punct |
-,GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1730 |
T5869 |
T5865 |
punct |
-,GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1731 |
T5870 |
T5865 |
nummod |
3,GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1732 |
T5871 |
T5865 |
punct |
′,GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1733 |
T5872 |
T5865 |
cc |
and,GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1734 |
T5873 |
T5874 |
nummod |
5,TGGTGATGGGGACGGAATACAGAGGGGATCCGTC |
R1735 |
T5874 |
T5865 |
conj |
TGGTGATGGGGACGGAATACAGAGGGGATCCGTC,GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1736 |
T5875 |
T5873 |
punct |
′,5 |
R1737 |
T5876 |
T5874 |
punct |
-,TGGTGATGGGGACGGAATACAGAGGGGATCCGTC |
R1738 |
T5877 |
T5874 |
punct |
-,TGGTGATGGGGACGGAATACAGAGGGGATCCGTC |
R1739 |
T5878 |
T5874 |
nummod |
3,TGGTGATGGGGACGGAATACAGAGGGGATCCGTC |
R1740 |
T5879 |
T5874 |
punct |
′,TGGTGATGGGGACGGAATACAGAGGGGATCCGTC |
R1741 |
T5880 |
T5865 |
punct |
", ",GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1742 |
T5881 |
T5882 |
dep |
which,introduced |
R1743 |
T5882 |
T5865 |
relcl |
introduced,GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1744 |
T5883 |
T5884 |
det |
an,site |
R1745 |
T5884 |
T5882 |
dobj |
site,introduced |
R1746 |
T5885 |
T5884 |
compound |
EcoRI,site |
R1747 |
T5886 |
T5814 |
punct |
.,mutated |
R1748 |
T5888 |
T5889 |
nsubj |
We,verified |
R1749 |
T5890 |
T5891 |
det |
the,sequence |
R1750 |
T5891 |
T5889 |
dobj |
sequence,verified |
R1751 |
T5892 |
T5891 |
prep |
from,sequence |
R1752 |
T5893 |
T5894 |
det |
the,plasmid |
R1753 |
T5894 |
T5892 |
pobj |
plasmid,from |
R1754 |
T5895 |
T5894 |
amod |
mutated,plasmid |
R1755 |
T5896 |
T5889 |
punct |
", ",verified |
R1756 |
T5897 |
T5898 |
advmod |
then,digested |
R1757 |
T5898 |
T5889 |
dep |
digested,verified |
R1758 |
T5899 |
T5898 |
dobj |
it,digested |
R1759 |
T5900 |
T5898 |
prep |
with,digested |
R1760 |
T5901 |
T5900 |
pobj |
BamHI,with |
R1761 |
T5902 |
T5901 |
cc |
and,BamHI |
R1762 |
T5903 |
T5901 |
conj |
EcoRI,BamHI |
R1763 |
T5904 |
T5889 |
punct |
", ",verified |
R1764 |
T5905 |
T5906 |
aux |
to,insert |
R1765 |
T5906 |
T5889 |
advcl |
insert,verified |
R1766 |
T5907 |
T5906 |
prep |
in,insert |
R1767 |
T5908 |
T5909 |
compound |
frame,GFP |
R1768 |
T5909 |
T5910 |
compound |
GFP,sequences |
R1769 |
T5910 |
T5907 |
pobj |
sequences,in |
R1770 |
T5911 |
T5910 |
prep |
from,sequences |
R1771 |
T5912 |
T5913 |
det |
a,fragment |
R1772 |
T5913 |
T5911 |
pobj |
fragment,from |
R1773 |
T5914 |
T5915 |
compound |
Bam,EcoRI |
R1774 |
T5915 |
T5913 |
compound |
EcoRI,fragment |
R1775 |
T5916 |
T5915 |
compound |
HI,EcoRI |
R1776 |
T5917 |
T5915 |
punct |
-,EcoRI |
R1777 |
T5918 |
T5913 |
prep |
of,fragment |
R1778 |
T5919 |
T5920 |
compound |
plasmid,GFP |
R1779 |
T5920 |
T5918 |
pobj |
GFP,of |
R1780 |
T5921 |
T5920 |
compound |
phr,GFP |
R1781 |
T5922 |
T5920 |
punct |
-,GFP |
R1782 |
T5923 |
T5920 |
punct |
-,GFP |
R1783 |
T5924 |
T5920 |
nummod |
1,GFP |
R1784 |
T5925 |
T5926 |
punct |
(,Stratagene |
R1785 |
T5926 |
T5913 |
parataxis |
Stratagene,fragment |
R1786 |
T5927 |
T5926 |
punct |
),Stratagene |
R1787 |
T5928 |
T5889 |
punct |
.,verified |
R1788 |
T5930 |
T5931 |
nsubj |
We,verified |
R1789 |
T5932 |
T5933 |
det |
the,sequence |
R1790 |
T5933 |
T5931 |
dobj |
sequence,verified |
R1791 |
T5934 |
T5933 |
prep |
of,sequence |
R1792 |
T5935 |
T5936 |
det |
this,fragment |
R1793 |
T5936 |
T5934 |
pobj |
fragment,of |
R1794 |
T5937 |
T5938 |
compound |
p53,GFP |
R1795 |
T5938 |
T5940 |
compound |
GFP,fusion |
R1796 |
T5939 |
T5938 |
punct |
-,GFP |
R1797 |
T5940 |
T5936 |
compound |
fusion,fragment |
R1798 |
T5941 |
T5931 |
punct |
", ",verified |
R1799 |
T5942 |
T5943 |
advmod |
then,swapped |
R1800 |
T5943 |
T5931 |
dep |
swapped,verified |
R1801 |
T5944 |
T5943 |
dobj |
it,swapped |
R1802 |
T5945 |
T5943 |
prep |
in,swapped |
R1803 |
T5946 |
T5947 |
det |
the,plasmid |
R1804 |
T5947 |
T5945 |
pobj |
plasmid,in |
R1805 |
T5948 |
T5949 |
compound |
L3,1L |
R1806 |
T5949 |
T5947 |
compound |
1L,plasmid |
R1807 |
T5950 |
T5949 |
punct |
-,1L |
R1808 |
T5951 |
T5949 |
compound |
p53PmlEagPuroΔTK,1L |
R1809 |
T5952 |
T5949 |
punct |
-,1L |
R1810 |
T5953 |
T5954 |
punct |
(,see |
R1811 |
T5954 |
T5943 |
parataxis |
see,swapped |
R1812 |
T5955 |
T5954 |
advmod |
above,see |
R1813 |
T5956 |
T5954 |
punct |
),see |
R1814 |
T5957 |
T5943 |
prep |
by,swapped |
R1815 |
T5958 |
T5959 |
nmod |
HindIII,digestion |
R1816 |
T5959 |
T5957 |
pobj |
digestion,by |
R1817 |
T5960 |
T5958 |
cc |
and,HindIII |
R1818 |
T5961 |
T5958 |
conj |
FseI,HindIII |
R1819 |
T5962 |
T5943 |
punct |
", ",swapped |
R1820 |
T5963 |
T5943 |
advcl |
resulting,swapped |
R1821 |
T5964 |
T5963 |
prep |
in,resulting |
R1822 |
T5965 |
T5966 |
det |
the,construct |
R1823 |
T5966 |
T5964 |
pobj |
construct,in |
R1824 |
T5967 |
T5968 |
compound |
p53GFP,exchange |
R1825 |
T5968 |
T5966 |
compound |
exchange,construct |
R1826 |
T5969 |
T5966 |
punct |
", ",construct |
R1827 |
T5970 |
T5971 |
det |
the,sequence |
R1828 |
T5971 |
T5966 |
appos |
sequence,construct |
R1829 |
T5972 |
T5973 |
dep |
which,verified |
R1830 |
T5973 |
T5971 |
relcl |
verified,sequence |
R1831 |
T5974 |
T5973 |
auxpass |
was,verified |
R1832 |
T5975 |
T5973 |
prep |
before,verified |
R1833 |
T5976 |
T5975 |
pobj |
use,before |
R1834 |
T5977 |
T5931 |
punct |
.,verified |
R1835 |
T5979 |
T5980 |
det |
The,construct |
R1836 |
T5980 |
T5983 |
nsubjpass |
construct,engineered |
R1837 |
T5981 |
T5982 |
compound |
p53ΔPGFP,exchange |
R1838 |
T5982 |
T5980 |
compound |
exchange,construct |
R1839 |
T5984 |
T5983 |
auxpass |
was,engineered |
R1840 |
T5985 |
T5983 |
prep |
by,engineered |
R1841 |
T5986 |
T5985 |
pcomp |
combining,by |
R1842 |
T5987 |
T5986 |
dobj |
sequences,combining |
R1843 |
T5988 |
T5987 |
prep |
from,sequences |
R1844 |
T5989 |
T5990 |
det |
the,plasmid |
R1845 |
T5990 |
T5988 |
pobj |
plasmid,from |
R1846 |
T5991 |
T5990 |
compound |
p53GFP,plasmid |
R1847 |
T5992 |
T5990 |
compound |
exchange,plasmid |
R1848 |
T5993 |
T5987 |
cc |
and,sequences |
R1849 |
T5994 |
T5987 |
conj |
sequences,sequences |
R1850 |
T5995 |
T5994 |
prep |
from,sequences |
R1851 |
T5996 |
T5997 |
det |
the,construct |
R1852 |
T5997 |
T5995 |
pobj |
construct,from |
R1853 |
T5998 |
T5997 |
compound |
p53ΔP,construct |
R1854 |
T5999 |
T5997 |
compound |
targeting,construct |
R1855 |
T6000 |
T5987 |
acl |
described,sequences |
R1856 |
T6001 |
T6000 |
advmod |
recently,described |
R1857 |
T6002 |
T6003 |
punct |
(,5 |
R1858 |
T6003 |
T5986 |
parataxis |
5,combining |
R1859 |
T6004 |
T6003 |
punct |
),5 |
R1860 |
T6005 |
T5983 |
punct |
.,engineered |
R1861 |
T6007 |
T6008 |
poss |
Its,sequence |
R1862 |
T6008 |
T6009 |
nsubjpass |
sequence,verified |
R1863 |
T6010 |
T6009 |
auxpass |
was,verified |
R1864 |
T6011 |
T6009 |
advmod |
also,verified |
R1865 |
T6012 |
T6009 |
prep |
before,verified |
R1866 |
T6013 |
T6012 |
pobj |
use,before |
R1867 |
T6014 |
T6009 |
punct |
.,verified |
R1868 |
T6353 |
T6352 |
cc |
and,Sequences |
R1869 |
T6354 |
T6352 |
conj |
use,Sequences |
R1870 |
T6355 |
T6352 |
prep |
of,Sequences |
R1871 |
T6356 |
T6357 |
compound |
PCR,primers |
R1872 |
T6357 |
T6355 |
pobj |
primers,of |
R1873 |
T6359 |
T6360 |
meta |
a,CCCCGGCCCTCACCCTCATCTTCG |
R1874 |
T6360 |
T6365 |
nsubj |
CCCCGGCCCTCACCCTCATCTTCG,amplify |
R1875 |
T6361 |
T6359 |
punct |
: ,a |
R1876 |
T6362 |
T6360 |
nummod |
5,CCCCGGCCCTCACCCTCATCTTCG |
R1877 |
T6363 |
T6362 |
punct |
′,5 |
R1878 |
T6364 |
T6360 |
punct |
-,CCCCGGCCCTCACCCTCATCTTCG |
R1879 |
T6365 |
T6489 |
ccomp |
amplify,amplify |
R1880 |
T6366 |
T6360 |
punct |
-,CCCCGGCCCTCACCCTCATCTTCG |
R1881 |
T6367 |
T6360 |
nummod |
3,CCCCGGCCCTCACCCTCATCTTCG |
R1882 |
T6368 |
T6360 |
punct |
′,CCCCGGCCCTCACCCTCATCTTCG |
R1883 |
T6369 |
T6360 |
punct |
", ",CCCCGGCCCTCACCCTCATCTTCG |
R1884 |
T6370 |
T6360 |
prep |
from,CCCCGGCCCTCACCCTCATCTTCG |
R1885 |
T6371 |
T6372 |
det |
the,gene |
R1886 |
T6372 |
T6370 |
pobj |
gene,from |
R1887 |
T6373 |
T6372 |
compound |
PuΔTK,gene |
R1888 |
T6374 |
T6360 |
punct |
", ",CCCCGGCCCTCACCCTCATCTTCG |
R1889 |
T6375 |
T6360 |
appos |
assays,CCCCGGCCCTCACCCTCATCTTCG |
R1890 |
T6376 |
T6375 |
acl |
targeting,assays |
R1891 |
T6377 |
T6376 |
prep |
of,targeting |
R1892 |
T6378 |
T6379 |
compound |
Flox,plasmid |
R1893 |
T6379 |
T6377 |
pobj |
plasmid,of |
R1894 |
T6380 |
T6360 |
punct |
;,CCCCGGCCCTCACCCTCATCTTCG |
R1895 |
T6381 |
T6382 |
meta |
b,AACAAAACAAAACAGCAGCAACAA |
R1896 |
T6382 |
T6360 |
conj |
AACAAAACAAAACAGCAGCAACAA,CCCCGGCCCTCACCCTCATCTTCG |
R1897 |
T6383 |
T6381 |
punct |
: ,b |
R1898 |
T6384 |
T6382 |
nummod |
5,AACAAAACAAAACAGCAGCAACAA |
R1899 |
T6385 |
T6384 |
punct |
′,5 |
R1900 |
T6386 |
T6382 |
punct |
-,AACAAAACAAAACAGCAGCAACAA |
R1901 |
T6387 |
T6382 |
punct |
-,AACAAAACAAAACAGCAGCAACAA |
R1902 |
T6388 |
T6382 |
nummod |
3,AACAAAACAAAACAGCAGCAACAA |
R1903 |
T6389 |
T6382 |
punct |
′,AACAAAACAAAACAGCAGCAACAA |
R1904 |
T6390 |
T6382 |
punct |
", ",AACAAAACAAAACAGCAGCAACAA |
R1905 |
T6391 |
T6382 |
prep |
from,AACAAAACAAAACAGCAGCAACAA |
R1906 |
T6392 |
T6391 |
pobj |
sequences,from |
R1907 |
T6393 |
T6394 |
advmod |
downstream,outside |
R1908 |
T6394 |
T6392 |
prep |
outside,sequences |
R1909 |
T6395 |
T6393 |
prep |
of,downstream |
R1910 |
T6396 |
T6397 |
det |
the,gene |
R1911 |
T6397 |
T6395 |
pobj |
gene,of |
R1912 |
T6398 |
T6397 |
compound |
p53,gene |
R1913 |
T6399 |
T6394 |
cc |
and,outside |
R1914 |
T6400 |
T6401 |
compound |
Flox,sequences |
R1915 |
T6401 |
T6394 |
pobj |
sequences,outside |
R1916 |
T6402 |
T6382 |
punct |
", ",AACAAAACAAAACAGCAGCAACAA |
R1917 |
T6403 |
T6382 |
appos |
assays,AACAAAACAAAACAGCAGCAACAA |
R1918 |
T6404 |
T6403 |
acl |
targeting,assays |
R1919 |
T6405 |
T6404 |
prep |
of,targeting |
R1920 |
T6406 |
T6405 |
pobj |
Flox,of |
R1921 |
T6407 |
T6406 |
cc |
and,Flox |
R1922 |
T6408 |
T6406 |
conj |
RMCE,Flox |
R1923 |
T6409 |
T6403 |
prep |
with,assays |
R1924 |
T6410 |
T6411 |
nmod |
p53GFP,plasmids |
R1925 |
T6411 |
T6409 |
pobj |
plasmids,with |
R1926 |
T6412 |
T6410 |
cc |
or,p53GFP |
R1927 |
T6413 |
T6410 |
conj |
p53ΔPGFP,p53GFP |
R1928 |
T6414 |
T6382 |
punct |
;,AACAAAACAAAACAGCAGCAACAA |
R1929 |
T6415 |
T6416 |
meta |
c,TGAAGAGCAAGGGCGTGGTGAAGGA |
R1930 |
T6416 |
T6382 |
conj |
TGAAGAGCAAGGGCGTGGTGAAGGA,AACAAAACAAAACAGCAGCAACAA |
R1931 |
T6417 |
T6415 |
punct |
: ,c |
R1932 |
T6418 |
T6416 |
nummod |
5,TGAAGAGCAAGGGCGTGGTGAAGGA |
R1933 |
T6419 |
T6418 |
punct |
′,5 |
R1934 |
T6420 |
T6416 |
punct |
-,TGAAGAGCAAGGGCGTGGTGAAGGA |
R1935 |
T6421 |
T6416 |
punct |
-,TGAAGAGCAAGGGCGTGGTGAAGGA |
R1936 |
T6422 |
T6416 |
nummod |
3,TGAAGAGCAAGGGCGTGGTGAAGGA |
R1937 |
T6423 |
T6416 |
punct |
′,TGAAGAGCAAGGGCGTGGTGAAGGA |
R1938 |
T6424 |
T6416 |
punct |
", ",TGAAGAGCAAGGGCGTGGTGAAGGA |
R1939 |
T6425 |
T6416 |
prep |
from,TGAAGAGCAAGGGCGTGGTGAAGGA |
R1940 |
T6426 |
T6427 |
compound |
GFP,sequences |
R1941 |
T6427 |
T6425 |
pobj |
sequences,from |
R1942 |
T6428 |
T6416 |
punct |
", ",TGAAGAGCAAGGGCGTGGTGAAGGA |
R1943 |
T6429 |
T6430 |
compound |
assays,RMCE |
R1944 |
T6430 |
T6416 |
appos |
RMCE,TGAAGAGCAAGGGCGTGGTGAAGGA |
R1945 |
T6431 |
T6430 |
prep |
with,RMCE |
R1946 |
T6432 |
T6433 |
compound |
p53GFP,orp53ΔPGFP |
R1947 |
T6433 |
T6434 |
compound |
orp53ΔPGFP,plasmids |
R1948 |
T6434 |
T6431 |
pobj |
plasmids,with |
R1949 |
T6435 |
T6416 |
punct |
;,TGAAGAGCAAGGGCGTGGTGAAGGA |
R1950 |
T6436 |
T6437 |
meta |
d,CAAAAAATGGAAGGAAATCAGGAACTAA |
R1951 |
T6437 |
T6416 |
conj |
CAAAAAATGGAAGGAAATCAGGAACTAA,TGAAGAGCAAGGGCGTGGTGAAGGA |
R1952 |
T6438 |
T6436 |
punct |
: ,d |
R1953 |
T6439 |
T6437 |
nummod |
5,CAAAAAATGGAAGGAAATCAGGAACTAA |
R1954 |
T6440 |
T6439 |
punct |
′,5 |
R1955 |
T6441 |
T6437 |
punct |
-,CAAAAAATGGAAGGAAATCAGGAACTAA |
R1956 |
T6442 |
T6437 |
punct |
-,CAAAAAATGGAAGGAAATCAGGAACTAA |
R1957 |
T6443 |
T6437 |
nummod |
3,CAAAAAATGGAAGGAAATCAGGAACTAA |
R1958 |
T6444 |
T6437 |
punct |
′,CAAAAAATGGAAGGAAATCAGGAACTAA |
R1959 |
T6445 |
T6437 |
punct |
", ",CAAAAAATGGAAGGAAATCAGGAACTAA |
R1960 |
T6446 |
T6437 |
prep |
from,CAAAAAATGGAAGGAAATCAGGAACTAA |
R1961 |
T6447 |
T6448 |
compound |
p53,intron |
R1962 |
T6448 |
T6446 |
pobj |
intron,from |
R1963 |
T6449 |
T6448 |
nummod |
3,intron |
R1964 |
T6450 |
T6437 |
punct |
", ",CAAAAAATGGAAGGAAATCAGGAACTAA |
R1965 |
T6451 |
T6437 |
cc |
and,CAAAAAATGGAAGGAAATCAGGAACTAA |
R1966 |
T6452 |
T6453 |
meta |
e,TCTAGACAGAGAAAAAAGAGGCATT |
R1967 |
T6453 |
T6437 |
conj |
TCTAGACAGAGAAAAAAGAGGCATT,CAAAAAATGGAAGGAAATCAGGAACTAA |
R1968 |
T6454 |
T6452 |
punct |
: ,e |
R1969 |
T6455 |
T6453 |
nummod |
5,TCTAGACAGAGAAAAAAGAGGCATT |
R1970 |
T6456 |
T6455 |
punct |
′,5 |
R1971 |
T6457 |
T6453 |
punct |
-,TCTAGACAGAGAAAAAAGAGGCATT |
R1972 |
T6458 |
T6453 |
punct |
-,TCTAGACAGAGAAAAAAGAGGCATT |
R1973 |
T6459 |
T6453 |
nummod |
3,TCTAGACAGAGAAAAAAGAGGCATT |
R1974 |
T6460 |
T6453 |
punct |
′,TCTAGACAGAGAAAAAAGAGGCATT |
R1975 |
T6461 |
T6453 |
punct |
", ",TCTAGACAGAGAAAAAAGAGGCATT |
R1976 |
T6462 |
T6453 |
prep |
from,TCTAGACAGAGAAAAAAGAGGCATT |
R1977 |
T6463 |
T6464 |
compound |
p53,intron |
R1978 |
T6464 |
T6462 |
pobj |
intron,from |
R1979 |
T6465 |
T6464 |
nummod |
4,intron |
R1980 |
T6466 |
T6453 |
punct |
", ",TCTAGACAGAGAAAAAAGAGGCATT |
R1981 |
T6467 |
T6468 |
compound |
assay,RMCE |
R1982 |
T6468 |
T6453 |
appos |
RMCE,TCTAGACAGAGAAAAAAGAGGCATT |
R1983 |
T6469 |
T6468 |
prep |
with,RMCE |
R1984 |
T6470 |
T6471 |
compound |
p53ΔPGFP,plasmid |
R1985 |
T6471 |
T6469 |
pobj |
plasmid,with |
R1986 |
T6472 |
T6453 |
punct |
;,TCTAGACAGAGAAAAAAGAGGCATT |
R1987 |
T6473 |
T6474 |
meta |
f,ATGGGAGGCTGCCAGTCCTAACCC |
R1988 |
T6474 |
T6453 |
conj |
ATGGGAGGCTGCCAGTCCTAACCC,TCTAGACAGAGAAAAAAGAGGCATT |
R1989 |
T6475 |
T6473 |
punct |
: ,f |
R1990 |
T6476 |
T6474 |
nummod |
5,ATGGGAGGCTGCCAGTCCTAACCC |
R1991 |
T6477 |
T6474 |
punct |
′,ATGGGAGGCTGCCAGTCCTAACCC |
R1992 |
T6478 |
T6474 |
punct |
-,ATGGGAGGCTGCCAGTCCTAACCC |
R1993 |
T6479 |
T6474 |
cc |
and,ATGGGAGGCTGCCAGTCCTAACCC |
R1994 |
T6480 |
T6481 |
meta |
g,GTGTTTCATTAGTTCCCCACCTTGAC |
R1995 |
T6481 |
T6474 |
conj |
GTGTTTCATTAGTTCCCCACCTTGAC,ATGGGAGGCTGCCAGTCCTAACCC |
R1996 |
T6482 |
T6480 |
punct |
: ,g |
R1997 |
T6483 |
T6481 |
nummod |
5,GTGTTTCATTAGTTCCCCACCTTGAC |
R1998 |
T6484 |
T6483 |
punct |
′,5 |
R1999 |
T6485 |
T6481 |
punct |
-,GTGTTTCATTAGTTCCCCACCTTGAC |
R2000 |
T6486 |
T6481 |
punct |
-,GTGTTTCATTAGTTCCCCACCTTGAC |
R2001 |
T6487 |
T6481 |
nummod |
3,GTGTTTCATTAGTTCCCCACCTTGAC |
R2002 |
T6488 |
T6481 |
punct |
′,GTGTTTCATTAGTTCCCCACCTTGAC |
R2003 |
T6490 |
T6491 |
det |
the,allele |
R2004 |
T6491 |
T6365 |
dobj |
allele,amplify |
R2005 |
T6492 |
T6493 |
compound |
WT,p53 |
R2006 |
T6493 |
T6491 |
compound |
p53,allele |
R2007 |
T6494 |
T6365 |
prep |
according,amplify |
R2008 |
T6495 |
T6494 |
prep |
to,according |
R2009 |
T6496 |
T6497 |
poss |
Taconic,procedures |
R2010 |
T6497 |
T6495 |
pobj |
procedures,to |
R2011 |
T6498 |
T6496 |
case |
's,Taconic |
R2012 |
T6499 |
T6489 |
punct |
", ",amplify |
R2013 |
T6500 |
T6501 |
meta |
h,TTTACGGAGCCCTGGCGCTCGATGT |
R2014 |
T6501 |
T6489 |
nsubj |
TTTACGGAGCCCTGGCGCTCGATGT,amplify |
R2015 |
T6502 |
T6500 |
punct |
: ,h |
R2016 |
T6503 |
T6501 |
nummod |
5,TTTACGGAGCCCTGGCGCTCGATGT |
R2017 |
T6504 |
T6501 |
punct |
′,TTTACGGAGCCCTGGCGCTCGATGT |
R2018 |
T6505 |
T6501 |
punct |
-,TTTACGGAGCCCTGGCGCTCGATGT |
R2019 |
T6506 |
T6501 |
punct |
-,TTTACGGAGCCCTGGCGCTCGATGT |
R2020 |
T6507 |
T6501 |
nummod |
3,TTTACGGAGCCCTGGCGCTCGATGT |
R2021 |
T6508 |
T6501 |
punct |
′,TTTACGGAGCCCTGGCGCTCGATGT |
R2022 |
T6509 |
T6501 |
cc |
and,TTTACGGAGCCCTGGCGCTCGATGT |
R2023 |
T6510 |
T6511 |
meta |
i,GTGGGAGGGACAAAAGTTCGAGGCC |
R2024 |
T6511 |
T6501 |
conj |
GTGGGAGGGACAAAAGTTCGAGGCC,TTTACGGAGCCCTGGCGCTCGATGT |
R2025 |
T6512 |
T6510 |
punct |
: ,i |
R2026 |
T6513 |
T6511 |
nummod |
5,GTGGGAGGGACAAAAGTTCGAGGCC |
R2027 |
T6514 |
T6511 |
punct |
′,GTGGGAGGGACAAAAGTTCGAGGCC |
R2028 |
T6515 |
T6511 |
punct |
-,GTGGGAGGGACAAAAGTTCGAGGCC |
R2029 |
T6516 |
T6511 |
punct |
-,GTGGGAGGGACAAAAGTTCGAGGCC |
R2030 |
T6517 |
T6511 |
nummod |
3,GTGGGAGGGACAAAAGTTCGAGGCC |
R2031 |
T6518 |
T6511 |
punct |
′,GTGGGAGGGACAAAAGTTCGAGGCC |
R2032 |
T6519 |
T6520 |
det |
the,marker |
R2033 |
T6520 |
T6489 |
dobj |
marker,amplify |
R2034 |
T6521 |
T6520 |
compound |
Neo,marker |
R2035 |
T6522 |
T6520 |
prep |
in,marker |
R2036 |
T6523 |
T6524 |
det |
the,allele |
R2037 |
T6524 |
T6522 |
pobj |
allele,in |
R2038 |
T6525 |
T6526 |
compound |
p53,KO |
R2039 |
T6526 |
T6524 |
compound |
KO,allele |
R2040 |
T6527 |
T6489 |
prep |
according,amplify |
R2041 |
T6528 |
T6527 |
prep |
to,according |
R2042 |
T6529 |
T6530 |
poss |
Taconic,procedures |
R2043 |
T6530 |
T6528 |
pobj |
procedures,to |
R2044 |
T6531 |
T6529 |
case |
's,Taconic |
R2045 |
T6532 |
T6489 |
punct |
.,amplify |
R2046 |
T6727 |
T6728 |
compound |
Cell,culture |
R2047 |
T6728 |
T6729 |
compound |
culture,conditions |
R2048 |
T6731 |
T6732 |
amod |
Primary,MEFs |
R2049 |
T6732 |
T6733 |
nsubjpass |
MEFs,cultured |
R2050 |
T6734 |
T6732 |
punct |
", ",MEFs |
R2051 |
T6735 |
T6732 |
acl |
isolated,MEFs |
R2052 |
T6736 |
T6735 |
prep |
from,isolated |
R2053 |
T6737 |
T6738 |
nummod |
13.5,day |
R2054 |
T6738 |
T6739 |
compound |
day,embryos |
R2055 |
T6739 |
T6736 |
pobj |
embryos,from |
R2056 |
T6740 |
T6733 |
punct |
", ",cultured |
R2057 |
T6741 |
T6733 |
auxpass |
were,cultured |
R2058 |
T6742 |
T6733 |
prep |
in,cultured |
R2059 |
T6743 |
T6742 |
pobj |
DMEM,in |
R2060 |
T6744 |
T6733 |
prep |
with,cultured |
R2061 |
T6745 |
T6746 |
nummod |
15,% |
R2062 |
T6746 |
T6747 |
compound |
%,FBS |
R2063 |
T6747 |
T6744 |
pobj |
FBS,with |
R2064 |
T6748 |
T6747 |
punct |
", ",FBS |
R2065 |
T6749 |
T6750 |
nummod |
100,mM |
R2066 |
T6750 |
T6751 |
compound |
mM,BME |
R2067 |
T6751 |
T6747 |
conj |
BME,FBS |
R2068 |
T6752 |
T6751 |
punct |
", ",BME |
R2069 |
T6753 |
T6754 |
nummod |
2,mM |
R2070 |
T6754 |
T6755 |
compound |
mM,glutamine |
R2071 |
T6755 |
T6751 |
conj |
glutamine,BME |
R2072 |
T6756 |
T6755 |
compound |
l,glutamine |
R2073 |
T6757 |
T6755 |
punct |
-,glutamine |
R2074 |
T6758 |
T6755 |
cc |
and,glutamine |
R2075 |
T6759 |
T6755 |
conj |
antibiotics,glutamine |
R2076 |
T6760 |
T6733 |
punct |
.,cultured |
R2077 |
T6762 |
T6763 |
nummod |
129,SvJae |
R2078 |
T6763 |
T6765 |
compound |
SvJae,cells |
R2079 |
T6764 |
T6763 |
punct |
/,SvJae |
R2080 |
T6765 |
T6767 |
nsubjpass |
cells,grown |
R2081 |
T6766 |
T6765 |
compound |
ES,cells |
R2082 |
T6768 |
T6767 |
auxpass |
were,grown |
R2083 |
T6769 |
T6767 |
prep |
in,grown |
R2084 |
T6770 |
T6771 |
det |
the,medium |
R2085 |
T6771 |
T6769 |
pobj |
medium,in |
R2086 |
T6772 |
T6771 |
amod |
same,medium |
R2087 |
T6773 |
T6771 |
acl |
supplemented,medium |
R2088 |
T6774 |
T6773 |
prep |
with,supplemented |
R2089 |
T6775 |
T6776 |
nummod |
1000,U |
R2090 |
T6776 |
T6777 |
nmod |
U,ESGRO |
R2091 |
T6777 |
T6774 |
pobj |
ESGRO,with |
R2092 |
T6778 |
T6779 |
punct |
/,ml |
R2093 |
T6779 |
T6776 |
prep |
ml,U |
R2094 |
T6780 |
T6781 |
punct |
(,Chemicon |
R2095 |
T6781 |
T6777 |
parataxis |
Chemicon,ESGRO |
R2096 |
T6782 |
T6781 |
punct |
),Chemicon |
R2097 |
T6783 |
T6767 |
punct |
", ",grown |
R2098 |
T6784 |
T6767 |
prep |
on,grown |
R2099 |
T6785 |
T6786 |
det |
a,layer |
R2100 |
T6786 |
T6784 |
pobj |
layer,on |
R2101 |
T6787 |
T6786 |
prep |
of,layer |
R2102 |
T6788 |
T6789 |
compound |
mitomycin,C |
R2103 |
T6789 |
T6790 |
npadvmod |
C,treated |
R2104 |
T6790 |
T6792 |
amod |
treated,feeders |
R2105 |
T6791 |
T6790 |
punct |
-,treated |
R2106 |
T6792 |
T6787 |
pobj |
feeders,of |
R2107 |
T6793 |
T6792 |
nmod |
SNLPuro,feeders |
R2108 |
T6794 |
T6793 |
punct |
-,SNLPuro |
R2109 |
T6795 |
T6793 |
nummod |
7,SNLPuro |
R2110 |
T6796 |
T6793 |
punct |
/,SNLPuro |
R2111 |
T6797 |
T6793 |
nummod |
4,SNLPuro |
R2112 |
T6798 |
T6799 |
punct |
(,gift |
R2113 |
T6799 |
T6786 |
parataxis |
gift,layer |
R2114 |
T6800 |
T6799 |
amod |
kind,gift |
R2115 |
T6801 |
T6799 |
prep |
of,gift |
R2116 |
T6802 |
T6803 |
compound |
A.,Bradley |
R2117 |
T6803 |
T6801 |
pobj |
Bradley,of |
R2118 |
T6804 |
T6799 |
punct |
),gift |
R2119 |
T6805 |
T6767 |
punct |
.,grown |
R2120 |
T6807 |
T6808 |
nsubjpass |
Selections,performed |
R2121 |
T6809 |
T6808 |
auxpass |
were,performed |
R2122 |
T6810 |
T6808 |
prep |
with,performed |
R2123 |
T6811 |
T6812 |
nummod |
2,μg |
R2124 |
T6812 |
T6813 |
nmod |
μg,puromycin |
R2125 |
T6813 |
T6810 |
pobj |
puromycin,with |
R2126 |
T6814 |
T6815 |
punct |
/,ml |
R2127 |
T6815 |
T6812 |
prep |
ml,μg |
R2128 |
T6816 |
T6813 |
punct |
", ",puromycin |
R2129 |
T6817 |
T6818 |
nummod |
0.2,μM |
R2130 |
T6818 |
T6819 |
compound |
μM,FIAU |
R2131 |
T6819 |
T6813 |
conj |
FIAU,puromycin |
R2132 |
T6820 |
T6819 |
cc |
or,FIAU |
R2133 |
T6821 |
T6822 |
nummod |
2,μM |
R2134 |
T6822 |
T6823 |
compound |
μM,ganciclovir |
R2135 |
T6823 |
T6819 |
conj |
ganciclovir,FIAU |
R2136 |
T6824 |
T6808 |
punct |
.,performed |
R2137 |
T6929 |
T6930 |
compound |
Targeting,genotyping |
R2138 |
T6931 |
T6930 |
punct |
/,genotyping |
R2139 |
T6932 |
T6930 |
prep |
of,genotyping |
R2140 |
T6933 |
T6934 |
det |
the,locus |
R2141 |
T6934 |
T6932 |
pobj |
locus,of |
R2142 |
T6935 |
T6936 |
amod |
RMCE,ready |
R2143 |
T6936 |
T6934 |
amod |
ready,locus |
R2144 |
T6937 |
T6936 |
punct |
-,ready |
R2145 |
T6939 |
T6940 |
nummod |
29,SvJae |
R2146 |
T6940 |
T6942 |
compound |
SvJae,cells |
R2147 |
T6941 |
T6940 |
punct |
/,SvJae |
R2148 |
T6942 |
T6944 |
nsubjpass |
cells,electroporated |
R2149 |
T6943 |
T6942 |
compound |
ES,cells |
R2150 |
T6945 |
T6944 |
auxpass |
were,electroporated |
R2151 |
T6946 |
T6944 |
prep |
with,electroporated |
R2152 |
T6947 |
T6948 |
det |
the,construct |
R2153 |
T6948 |
T6946 |
pobj |
construct,with |
R2154 |
T6949 |
T6948 |
compound |
Flox,construct |
R2155 |
T6950 |
T6948 |
acl |
linearized,construct |
R2156 |
T6951 |
T6950 |
prep |
with,linearized |
R2157 |
T6952 |
T6951 |
pobj |
PmeI,with |
R2158 |
T6953 |
T6944 |
punct |
", ",electroporated |
R2159 |
T6954 |
T6944 |
cc |
and,electroporated |
R2160 |
T6955 |
T6956 |
npadvmod |
puromycin,resistant |
R2161 |
T6956 |
T6957 |
amod |
resistant,clones |
R2162 |
T6957 |
T6958 |
nsubjpass |
clones,analyzed |
R2163 |
T6958 |
T6944 |
conj |
analyzed,electroporated |
R2164 |
T6959 |
T6958 |
auxpass |
were,analyzed |
R2165 |
T6960 |
T6961 |
mark |
as,described |
R2166 |
T6961 |
T6958 |
advcl |
described,analyzed |
R2167 |
T6962 |
T6963 |
punct |
(,Figure |
R2168 |
T6963 |
T6958 |
parataxis |
Figure,analyzed |
R2169 |
T6964 |
T6963 |
nummod |
2,Figure |
R2170 |
T6965 |
T6963 |
punct |
),Figure |
R2171 |
T6966 |
T6958 |
punct |
.,analyzed |
R2172 |
T6968 |
T6969 |
nummod |
Two,clones |
R2173 |
T6969 |
T6970 |
nsubjpass |
clones,injected |
R2174 |
T6971 |
T6970 |
auxpass |
were,injected |
R2175 |
T6972 |
T6970 |
prep |
into,injected |
R2176 |
T6973 |
T6972 |
pobj |
blastocysts,into |
R2177 |
T6974 |
T6970 |
cc |
and,injected |
R2178 |
T6975 |
T6970 |
conj |
transmitted,injected |
R2179 |
T6976 |
T6975 |
prep |
through,transmitted |
R2180 |
T6977 |
T6978 |
det |
the,germline |
R2181 |
T6978 |
T6976 |
pobj |
germline,through |
R2182 |
T6979 |
T6970 |
punct |
.,injected |
R2183 |
T7193 |
T7192 |
dobj |
RMCE,Performing |
R2184 |
T7194 |
T7192 |
prep |
in,Performing |
R2185 |
T7195 |
T7196 |
compound |
ES,cells |
R2186 |
T7196 |
T7194 |
pobj |
cells,in |
R2187 |
T7198 |
T7199 |
det |
A,total |
R2188 |
T7199 |
T7200 |
nsubjpass |
total,grown |
R2189 |
T7201 |
T7199 |
prep |
of,total |
R2190 |
T7202 |
T7203 |
compound |
8,105 |
R2191 |
T7203 |
T7205 |
nummod |
105,cells |
R2192 |
T7204 |
T7203 |
punct |
×,105 |
R2193 |
T7205 |
T7201 |
pobj |
cells,of |
R2194 |
T7206 |
T7205 |
nmod |
p53RMCE,cells |
R2195 |
T7207 |
T7206 |
punct |
/,p53RMCE |
R2196 |
T7208 |
T7206 |
punct |
+,p53RMCE |
R2197 |
T7209 |
T7205 |
compound |
ES,cells |
R2198 |
T7210 |
T7200 |
auxpass |
were,grown |
R2199 |
T7211 |
T7200 |
prep |
without,grown |
R2200 |
T7212 |
T7211 |
pobj |
puromycin,without |
R2201 |
T7213 |
T7200 |
prep |
for,grown |
R2202 |
T7214 |
T7215 |
nummod |
12,h |
R2203 |
T7215 |
T7213 |
pobj |
h,for |
R2204 |
T7216 |
T7200 |
punct |
", ",grown |
R2205 |
T7217 |
T7200 |
conj |
electroporated,grown |
R2206 |
T7218 |
T7217 |
prep |
with,electroporated |
R2207 |
T7219 |
T7220 |
nummod |
15,plasmid |
R2208 |
T7220 |
T7218 |
pobj |
plasmid,with |
R2209 |
T7221 |
T7220 |
compound |
μg,plasmid |
R2210 |
T7222 |
T7223 |
compound |
CMV,Cre |
R2211 |
T7223 |
T7220 |
compound |
Cre,plasmid |
R2212 |
T7224 |
T7223 |
punct |
-,Cre |
R2213 |
T7225 |
T7226 |
punct |
(,pOG231 |
R2214 |
T7226 |
T7220 |
parataxis |
pOG231,plasmid |
R2215 |
T7227 |
T7226 |
punct |
),pOG231 |
R2216 |
T7228 |
T7220 |
cc |
and,plasmid |
R2217 |
T7229 |
T7230 |
nummod |
200,μg |
R2218 |
T7230 |
T7220 |
conj |
μg,plasmid |
R2219 |
T7231 |
T7230 |
prep |
of,μg |
R2220 |
T7232 |
T7233 |
det |
the,construct |
R2221 |
T7233 |
T7231 |
pobj |
construct,of |
R2222 |
T7234 |
T7233 |
compound |
exchange,construct |
R2223 |
T7235 |
T7217 |
punct |
", ",electroporated |
R2224 |
T7236 |
T7217 |
cc |
and,electroporated |
R2225 |
T7237 |
T7217 |
conj |
plated,electroporated |
R2226 |
T7238 |
T7237 |
prep |
in,plated |
R2227 |
T7239 |
T7240 |
compound |
T25,flasks |
R2228 |
T7240 |
T7238 |
pobj |
flasks,in |
R2229 |
T7241 |
T7237 |
prep |
at,plated |
R2230 |
T7242 |
T7243 |
nummod |
105,cells |
R2231 |
T7243 |
T7241 |
pobj |
cells,at |
R2232 |
T7244 |
T7243 |
prep |
per,cells |
R2233 |
T7245 |
T7244 |
pobj |
flask,per |
R2234 |
T7246 |
T7200 |
punct |
.,grown |
R2235 |
T7248 |
T7249 |
nsubjpass |
FIAU,added |
R2236 |
T7250 |
T7249 |
auxpass |
was,added |
R2237 |
T7251 |
T7249 |
prep |
to,added |
R2238 |
T7252 |
T7253 |
det |
the,medium |
R2239 |
T7253 |
T7251 |
pobj |
medium,to |
R2240 |
T7254 |
T7255 |
compound |
3,4 |
R2241 |
T7255 |
T7257 |
nummod |
4,days |
R2242 |
T7256 |
T7255 |
punct |
–,4 |
R2243 |
T7257 |
T7258 |
npadvmod |
days,after |
R2244 |
T7258 |
T7249 |
prep |
after,added |
R2245 |
T7259 |
T7258 |
pobj |
electroporation,after |
R2246 |
T7260 |
T7249 |
punct |
.,added |
R2247 |
T7262 |
T7263 |
amod |
Individual,clones |
R2248 |
T7263 |
T7264 |
nsubjpass |
clones,grown |
R2249 |
T7265 |
T7263 |
punct |
", ",clones |
R2250 |
T7266 |
T7263 |
acl |
picked,clones |
R2251 |
T7267 |
T7268 |
nummod |
10,days |
R2252 |
T7268 |
T7266 |
npadvmod |
days,picked |
R2253 |
T7269 |
T7268 |
prep |
after,days |
R2254 |
T7270 |
T7269 |
pobj |
electroporation,after |
R2255 |
T7271 |
T7264 |
punct |
", ",grown |
R2256 |
T7272 |
T7264 |
auxpass |
were,grown |
R2257 |
T7273 |
T7264 |
prep |
in,grown |
R2258 |
T7274 |
T7275 |
nummod |
96,well |
R2259 |
T7275 |
T7277 |
compound |
well,plates |
R2260 |
T7276 |
T7275 |
punct |
-,well |
R2261 |
T7277 |
T7273 |
pobj |
plates,in |
R2262 |
T7278 |
T7264 |
cc |
and,grown |
R2263 |
T7279 |
T7264 |
conj |
expanded,grown |
R2264 |
T7280 |
T7281 |
aux |
to,generate |
R2265 |
T7281 |
T7279 |
advcl |
generate,expanded |
R2266 |
T7282 |
T7283 |
amod |
duplicate,plates |
R2267 |
T7283 |
T7281 |
dobj |
plates,generate |
R2268 |
T7284 |
T7283 |
prep |
for,plates |
R2269 |
T7285 |
T7284 |
pobj |
freezing,for |
R2270 |
T7286 |
T7285 |
cc |
and,freezing |
R2271 |
T7287 |
T7288 |
compound |
DNA,analysis |
R2272 |
T7288 |
T7285 |
conj |
analysis,freezing |
R2273 |
T7289 |
T7281 |
prep |
by,generate |
R2274 |
T7290 |
T7289 |
pobj |
PCR,by |
R2275 |
T7291 |
T7290 |
cc |
and,PCR |
R2276 |
T7292 |
T7290 |
conj |
Southern,PCR |
R2277 |
T7293 |
T7264 |
punct |
.,grown |
R2278 |
T7498 |
T7497 |
dobj |
RMCE,Performing |
R2279 |
T7499 |
T7497 |
prep |
in,Performing |
R2280 |
T7500 |
T7499 |
pobj |
MEFs,in |
R2281 |
T7502 |
T7503 |
det |
A,total |
R2282 |
T7503 |
T7504 |
nsubjpass |
total,grown |
R2283 |
T7505 |
T7503 |
prep |
of,total |
R2284 |
T7506 |
T7507 |
nummod |
106,cells |
R2285 |
T7507 |
T7505 |
pobj |
cells,of |
R2286 |
T7508 |
T7509 |
nmod |
p53RMCE,MEFs |
R2287 |
T7509 |
T7507 |
compound |
MEFs,cells |
R2288 |
T7510 |
T7509 |
punct |
/,MEFs |
R2289 |
T7511 |
T7509 |
punct |
−,MEFs |
R2290 |
T7512 |
T7504 |
auxpass |
were,grown |
R2291 |
T7513 |
T7504 |
prep |
without,grown |
R2292 |
T7514 |
T7513 |
pobj |
puromycin,without |
R2293 |
T7515 |
T7504 |
prep |
for,grown |
R2294 |
T7516 |
T7517 |
nummod |
12,h |
R2295 |
T7517 |
T7515 |
pobj |
h,for |
R2296 |
T7518 |
T7504 |
punct |
", ",grown |
R2297 |
T7519 |
T7504 |
conj |
electroporated,grown |
R2298 |
T7520 |
T7519 |
prep |
with,electroporated |
R2299 |
T7521 |
T7522 |
nummod |
3,μg |
R2300 |
T7522 |
T7523 |
compound |
μg,pOG231 |
R2301 |
T7523 |
T7520 |
pobj |
pOG231,with |
R2302 |
T7524 |
T7523 |
cc |
and,pOG231 |
R2303 |
T7525 |
T7526 |
nummod |
30,μg |
R2304 |
T7526 |
T7527 |
compound |
μg,construct |
R2305 |
T7527 |
T7523 |
conj |
construct,pOG231 |
R2306 |
T7528 |
T7527 |
compound |
exchange,construct |
R2307 |
T7529 |
T7519 |
punct |
", ",electroporated |
R2308 |
T7530 |
T7519 |
cc |
and,electroporated |
R2309 |
T7531 |
T7519 |
conj |
plated,electroporated |
R2310 |
T7532 |
T7531 |
prep |
in,plated |
R2311 |
T7533 |
T7534 |
det |
a,dish |
R2312 |
T7534 |
T7532 |
pobj |
dish,in |
R2313 |
T7535 |
T7534 |
amod |
single,dish |
R2314 |
T7536 |
T7537 |
nummod |
10,cm |
R2315 |
T7537 |
T7534 |
compound |
cm,dish |
R2316 |
T7538 |
T7534 |
punct |
-,dish |
R2317 |
T7539 |
T7531 |
punct |
", ",plated |
R2318 |
T7540 |
T7531 |
conj |
grown,plated |
R2319 |
T7541 |
T7540 |
prep |
for,grown |
R2320 |
T7542 |
T7543 |
nummod |
3,days |
R2321 |
T7543 |
T7541 |
pobj |
days,for |
R2322 |
T7544 |
T7545 |
advmod |
then,split |
R2323 |
T7545 |
T7540 |
dep |
split,grown |
R2324 |
T7546 |
T7545 |
prep |
in,split |
R2325 |
T7547 |
T7548 |
amod |
several,dishes |
R2326 |
T7548 |
T7546 |
pobj |
dishes,in |
R2327 |
T7549 |
T7545 |
prep |
at,split |
R2328 |
T7550 |
T7551 |
nummod |
105,cells |
R2329 |
T7551 |
T7549 |
pobj |
cells,at |
R2330 |
T7552 |
T7551 |
prep |
per,cells |
R2331 |
T7553 |
T7552 |
pobj |
dish,per |
R2332 |
T7554 |
T7504 |
punct |
.,grown |
R2333 |
T7556 |
T7557 |
nsubjpass |
FIAU,added |
R2334 |
T7558 |
T7556 |
cc |
or,FIAU |
R2335 |
T7559 |
T7556 |
conj |
ganciclovir,FIAU |
R2336 |
T7560 |
T7557 |
auxpass |
was,added |
R2337 |
T7561 |
T7557 |
prep |
to,added |
R2338 |
T7562 |
T7563 |
det |
the,medium |
R2339 |
T7563 |
T7561 |
pobj |
medium,to |
R2340 |
T7564 |
T7565 |
nummod |
4,days |
R2341 |
T7565 |
T7566 |
npadvmod |
days,after |
R2342 |
T7566 |
T7557 |
prep |
after,added |
R2343 |
T7567 |
T7566 |
pobj |
electroporation,after |
R2344 |
T7568 |
T7557 |
punct |
", ",added |
R2345 |
T7569 |
T7557 |
prep |
for,added |
R2346 |
T7570 |
T7571 |
quantmod |
3,4 |
R2347 |
T7571 |
T7573 |
nummod |
4,days |
R2348 |
T7572 |
T7571 |
punct |
–,4 |
R2349 |
T7573 |
T7569 |
pobj |
days,for |
R2350 |
T7574 |
T7557 |
punct |
.,added |
R2351 |
T7576 |
T7577 |
nsubjpass |
Clones,grown |
R2352 |
T7578 |
T7576 |
punct |
", ",Clones |
R2353 |
T7579 |
T7576 |
acl |
picked,Clones |
R2354 |
T7580 |
T7581 |
nummod |
10,days |
R2355 |
T7581 |
T7582 |
npadvmod |
days,after |
R2356 |
T7582 |
T7579 |
prep |
after,picked |
R2357 |
T7583 |
T7582 |
pobj |
electroporation,after |
R2358 |
T7584 |
T7577 |
punct |
", ",grown |
R2359 |
T7585 |
T7577 |
auxpass |
were,grown |
R2360 |
T7586 |
T7577 |
prep |
in,grown |
R2361 |
T7587 |
T7588 |
nummod |
24,well |
R2362 |
T7588 |
T7590 |
compound |
well,plates |
R2363 |
T7589 |
T7588 |
punct |
-,well |
R2364 |
T7590 |
T7586 |
pobj |
plates,in |
R2365 |
T7591 |
T7577 |
cc |
and,grown |
R2366 |
T7592 |
T7577 |
conj |
expanded,grown |
R2367 |
T7593 |
T7592 |
prep |
for,expanded |
R2368 |
T7594 |
T7593 |
pobj |
freezing,for |
R2369 |
T7595 |
T7594 |
cc |
and,freezing |
R2370 |
T7596 |
T7597 |
compound |
DNA,analysis |
R2371 |
T7597 |
T7594 |
conj |
analysis,freezing |
R2372 |
T7598 |
T7577 |
punct |
.,grown |
R2373 |
T8070 |
T8071 |
compound |
Western,blots |
R2374 |
T8072 |
T8071 |
punct |
-,blots |
R2375 |
T8074 |
T8075 |
nsubjpass |
Cells,lysed |
R2376 |
T8076 |
T8074 |
punct |
", ",Cells |
R2377 |
T8077 |
T8074 |
amod |
untreated,Cells |
R2378 |
T8078 |
T8077 |
cc |
or,untreated |
R2379 |
T8079 |
T8077 |
conj |
treated,untreated |
R2380 |
T8080 |
T8079 |
prep |
for,treated |
R2381 |
T8081 |
T8082 |
nummod |
24,h |
R2382 |
T8082 |
T8080 |
pobj |
h,for |
R2383 |
T8083 |
T8079 |
prep |
with,treated |
R2384 |
T8084 |
T8085 |
nummod |
0.5,μg |
R2385 |
T8085 |
T8086 |
nmod |
μg,adriamycin |
R2386 |
T8086 |
T8083 |
pobj |
adriamycin,with |
R2387 |
T8087 |
T8088 |
punct |
/,ml |
R2388 |
T8088 |
T8085 |
prep |
ml,μg |
R2389 |
T8089 |
T8075 |
punct |
", ",lysed |
R2390 |
T8090 |
T8075 |
auxpass |
were,lysed |
R2391 |
T8091 |
T8075 |
prep |
on,lysed |
R2392 |
T8092 |
T8093 |
det |
the,dish |
R2393 |
T8093 |
T8091 |
pobj |
dish,on |
R2394 |
T8094 |
T8075 |
prep |
in,lysed |
R2395 |
T8095 |
T8096 |
det |
a,buffer |
R2396 |
T8096 |
T8094 |
pobj |
buffer,in |
R2397 |
T8097 |
T8096 |
acl |
consisting,buffer |
R2398 |
T8098 |
T8097 |
prep |
of,consisting |
R2399 |
T8099 |
T8100 |
nummod |
50,mM |
R2400 |
T8100 |
T8101 |
compound |
mM,Tris |
R2401 |
T8101 |
T8098 |
pobj |
Tris,of |
R2402 |
T8102 |
T8103 |
punct |
(,pH |
R2403 |
T8103 |
T8101 |
parataxis |
pH,Tris |
R2404 |
T8104 |
T8103 |
nummod |
8.0,pH |
R2405 |
T8105 |
T8103 |
punct |
),pH |
R2406 |
T8106 |
T8101 |
punct |
", ",Tris |
R2407 |
T8107 |
T8108 |
nummod |
5,mM |
R2408 |
T8108 |
T8109 |
compound |
mM,EDTA |
R2409 |
T8109 |
T8101 |
conj |
EDTA,Tris |
R2410 |
T8110 |
T8109 |
punct |
", ",EDTA |
R2411 |
T8111 |
T8112 |
nummod |
150,mM |
R2412 |
T8112 |
T8113 |
compound |
mM,NaCl |
R2413 |
T8113 |
T8109 |
conj |
NaCl,EDTA |
R2414 |
T8114 |
T8113 |
punct |
", ",NaCl |
R2415 |
T8115 |
T8116 |
nummod |
0.5,% |
R2416 |
T8116 |
T8117 |
compound |
%,40 |
R2417 |
T8117 |
T8113 |
conj |
40,NaCl |
R2418 |
T8118 |
T8117 |
compound |
Nonidet,40 |
R2419 |
T8119 |
T8117 |
compound |
P,40 |
R2420 |
T8120 |
T8117 |
punct |
-,40 |
R2421 |
T8121 |
T8117 |
punct |
", ",40 |
R2422 |
T8122 |
T8123 |
nummod |
1,mM |
R2423 |
T8123 |
T8124 |
compound |
mM,PMSF |
R2424 |
T8124 |
T8117 |
conj |
PMSF,40 |
R2425 |
T8125 |
T8124 |
punct |
", ",PMSF |
R2426 |
T8126 |
T8127 |
nummod |
1,mM |
R2427 |
T8127 |
T8128 |
compound |
mM,vanadate |
R2428 |
T8128 |
T8124 |
conj |
vanadate,PMSF |
R2429 |
T8129 |
T8128 |
compound |
sodium,vanadate |
R2430 |
T8130 |
T8128 |
punct |
", ",vanadate |
R2431 |
T8131 |
T8132 |
nummod |
10,mM |
R2432 |
T8132 |
T8133 |
compound |
mM,NaF |
R2433 |
T8133 |
T8128 |
conj |
NaF,vanadate |
R2434 |
T8134 |
T8133 |
cc |
and,NaF |
R2435 |
T8135 |
T8136 |
compound |
Complete,Mini |
R2436 |
T8136 |
T8137 |
compound |
Mini,Inhibitors |
R2437 |
T8137 |
T8133 |
conj |
Inhibitors,NaF |
R2438 |
T8138 |
T8137 |
compound |
Protease,Inhibitors |
R2439 |
T8139 |
T8140 |
punct |
(,Diagnostics |
R2440 |
T8140 |
T8137 |
parataxis |
Diagnostics,Inhibitors |
R2441 |
T8141 |
T8140 |
compound |
Roche,Diagnostics |
R2442 |
T8142 |
T8140 |
punct |
),Diagnostics |
R2443 |
T8143 |
T8075 |
prep |
at,lysed |
R2444 |
T8144 |
T8145 |
nummod |
4,°C |
R2445 |
T8145 |
T8143 |
pobj |
°C,at |
R2446 |
T8146 |
T8075 |
prep |
for,lysed |
R2447 |
T8147 |
T8148 |
nummod |
30,min |
R2448 |
T8148 |
T8146 |
pobj |
min,for |
R2449 |
T8149 |
T8075 |
punct |
.,lysed |
R2450 |
T8151 |
T8152 |
nsubjpass |
Lysates,scraped |
R2451 |
T8153 |
T8152 |
auxpass |
were,scraped |
R2452 |
T8154 |
T8152 |
punct |
", ",scraped |
R2453 |
T8155 |
T8156 |
advmod |
then,spun |
R2454 |
T8156 |
T8152 |
dep |
spun,scraped |
R2455 |
T8157 |
T8156 |
prep |
at,spun |
R2456 |
T8158 |
T8159 |
nummod |
6000,g |
R2457 |
T8159 |
T8157 |
pobj |
g,at |
R2458 |
T8160 |
T8159 |
punct |
×,g |
R2459 |
T8161 |
T8156 |
prep |
at,spun |
R2460 |
T8162 |
T8163 |
nummod |
4,°C |
R2461 |
T8163 |
T8161 |
pobj |
°C,at |
R2462 |
T8164 |
T8156 |
prep |
for,spun |
R2463 |
T8165 |
T8166 |
nummod |
10,min |
R2464 |
T8166 |
T8164 |
pobj |
min,for |
R2465 |
T8167 |
T8152 |
punct |
.,scraped |
R2466 |
T8169 |
T8170 |
compound |
Protein,concentration |
R2467 |
T8170 |
T8171 |
nsubjpass |
concentration,determined |
R2468 |
T8172 |
T8170 |
prep |
in,concentration |
R2469 |
T8173 |
T8174 |
det |
the,supernatant |
R2470 |
T8174 |
T8172 |
pobj |
supernatant,in |
R2471 |
T8175 |
T8171 |
auxpass |
was,determined |
R2472 |
T8176 |
T8171 |
advcl |
using,determined |
R2473 |
T8177 |
T8178 |
det |
the,assay |
R2474 |
T8178 |
T8176 |
dobj |
assay,using |
R2475 |
T8179 |
T8180 |
compound |
Bio,Rad |
R2476 |
T8180 |
T8178 |
compound |
Rad,assay |
R2477 |
T8181 |
T8180 |
punct |
-,Rad |
R2478 |
T8182 |
T8178 |
compound |
DC,assay |
R2479 |
T8183 |
T8178 |
compound |
protein,assay |
R2480 |
T8184 |
T8171 |
punct |
.,determined |
R2481 |
T8186 |
T8187 |
nsubjpass |
Lysates,separated |
R2482 |
T8188 |
T8187 |
auxpass |
were,separated |
R2483 |
T8189 |
T8187 |
prep |
on,separated |
R2484 |
T8190 |
T8191 |
amod |
single,percentage |
R2485 |
T8191 |
T8192 |
compound |
percentage,gels |
R2486 |
T8192 |
T8189 |
pobj |
gels,on |
R2487 |
T8193 |
T8194 |
compound |
SDS,PAGE |
R2488 |
T8194 |
T8192 |
compound |
PAGE,gels |
R2489 |
T8195 |
T8194 |
punct |
/,PAGE |
R2490 |
T8196 |
T8187 |
punct |
", ",separated |
R2491 |
T8197 |
T8198 |
advmod |
then,transferred |
R2492 |
T8198 |
T8187 |
dep |
transferred,separated |
R2493 |
T8199 |
T8198 |
advmod |
electrophoretically,transferred |
R2494 |
T8200 |
T8198 |
prep |
to,transferred |
R2495 |
T8201 |
T8200 |
pobj |
poly,to |
R2496 |
T8202 |
T8203 |
punct |
(,difluoride |
R2497 |
T8203 |
T8201 |
parataxis |
difluoride,poly |
R2498 |
T8204 |
T8203 |
compound |
vinylidene,difluoride |
R2499 |
T8205 |
T8203 |
punct |
),difluoride |
R2500 |
T8206 |
T8198 |
punct |
", ",transferred |
R2501 |
T8207 |
T8198 |
advcl |
using,transferred |
R2502 |
T8208 |
T8209 |
amod |
standard,procedures |
R2503 |
T8209 |
T8207 |
dobj |
procedures,using |
R2504 |
T8210 |
T8187 |
punct |
.,separated |
R2505 |
T8211 |
T8212 |
nsubjpass |
Blots,incubated |
R2506 |
T8214 |
T8212 |
auxpass |
were,incubated |
R2507 |
T8215 |
T8212 |
prep |
in,incubated |
R2508 |
T8216 |
T8217 |
nummod |
5,% |
R2509 |
T8217 |
T8218 |
nmod |
%,milk |
R2510 |
T8218 |
T8215 |
pobj |
milk,in |
R2511 |
T8219 |
T8218 |
amod |
non-fat,milk |
R2512 |
T8220 |
T8218 |
amod |
dried,milk |
R2513 |
T8221 |
T8212 |
prep |
in,incubated |
R2514 |
T8222 |
T8221 |
pobj |
TBST,in |
R2515 |
T8223 |
T8224 |
punct |
(,Tween |
R2516 |
T8224 |
T8222 |
parataxis |
Tween,TBST |
R2517 |
T8225 |
T8226 |
nummod |
0.02,M |
R2518 |
T8226 |
T8227 |
compound |
M,Tris |
R2519 |
T8227 |
T8224 |
dep |
Tris,Tween |
R2520 |
T8228 |
T8224 |
punct |
", ",Tween |
R2521 |
T8229 |
T8224 |
nmod |
pH,Tween |
R2522 |
T8230 |
T8229 |
nummod |
7.6,pH |
R2523 |
T8231 |
T8224 |
punct |
/,Tween |
R2524 |
T8232 |
T8233 |
nummod |
0.35,M |
R2525 |
T8233 |
T8234 |
nmod |
M,NaCl |
R2526 |
T8234 |
T8224 |
nmod |
NaCl,Tween |
R2527 |
T8235 |
T8224 |
punct |
/,Tween |
R2528 |
T8236 |
T8237 |
nummod |
0.1,% |
R2529 |
T8237 |
T8224 |
compound |
%,Tween |
R2530 |
T8238 |
T8224 |
punct |
-,Tween |
R2531 |
T8239 |
T8224 |
nummod |
20,Tween |
R2532 |
T8240 |
T8224 |
punct |
),Tween |
R2533 |
T8241 |
T8212 |
prep |
for,incubated |
R2534 |
T8242 |
T8243 |
nummod |
1,h |
R2535 |
T8243 |
T8241 |
pobj |
h,for |
R2536 |
T8244 |
T8212 |
prep |
at,incubated |
R2537 |
T8245 |
T8246 |
compound |
room,temperature |
R2538 |
T8246 |
T8244 |
pobj |
temperature,at |
R2539 |
T8247 |
T8212 |
prep |
before,incubated |
R2540 |
T8248 |
T8247 |
pcomp |
probing,before |
R2541 |
T8249 |
T8248 |
prep |
with,probing |
R2542 |
T8250 |
T8251 |
amod |
primary,antibodies |
R2543 |
T8251 |
T8249 |
pobj |
antibodies,with |
R2544 |
T8252 |
T8251 |
prep |
against,antibodies |
R2545 |
T8253 |
T8252 |
pobj |
p53,against |
R2546 |
T8254 |
T8255 |
punct |
(,Novacastra |
R2547 |
T8255 |
T8253 |
parataxis |
Novacastra,p53 |
R2548 |
T8256 |
T8255 |
dep |
CM,Novacastra |
R2549 |
T8257 |
T8256 |
punct |
-,CM |
R2550 |
T8258 |
T8256 |
nummod |
5,CM |
R2551 |
T8259 |
T8255 |
punct |
", ",Novacastra |
R2552 |
T8260 |
T8255 |
punct |
),Novacastra |
R2553 |
T8261 |
T8253 |
cc |
and,p53 |
R2554 |
T8262 |
T8263 |
punct |
-,actin |
R2555 |
T8263 |
T8253 |
conj |
actin,p53 |
R2556 |
T8264 |
T8265 |
punct |
(,Sigma |
R2557 |
T8265 |
T8263 |
parataxis |
Sigma,actin |
R2558 |
T8266 |
T8265 |
punct |
),Sigma |
R2559 |
T8267 |
T8212 |
punct |
.,incubated |
R2560 |
T8269 |
T8270 |
amod |
Secondary,antibodies |
R2561 |
T8270 |
T8271 |
nsubj |
antibodies,include |
R2562 |
T8272 |
T8270 |
acl |
used,antibodies |
R2563 |
T8273 |
T8274 |
npadvmod |
peroxidase,conjugated |
R2564 |
T8274 |
T8276 |
amod |
conjugated,IgG |
R2565 |
T8275 |
T8274 |
punct |
-,conjugated |
R2566 |
T8276 |
T8271 |
dobj |
IgG,include |
R2567 |
T8277 |
T8276 |
compound |
goat,IgG |
R2568 |
T8278 |
T8276 |
compound |
anti-mouse,IgG |
R2569 |
T8279 |
T8276 |
cc |
and,IgG |
R2570 |
T8280 |
T8281 |
compound |
anti-rabbit,IgG |
R2571 |
T8281 |
T8276 |
conj |
IgG,IgG |
R2572 |
T8282 |
T8283 |
punct |
(,Pierce |
R2573 |
T8283 |
T8281 |
parataxis |
Pierce,IgG |
R2574 |
T8284 |
T8283 |
punct |
),Pierce |
R2575 |
T8285 |
T8271 |
punct |
.,include |
R2576 |
T8287 |
T8288 |
amod |
Probed,blots |
R2577 |
T8288 |
T8289 |
nsubjpass |
blots,incubated |
R2578 |
T8290 |
T8289 |
auxpass |
were,incubated |
R2579 |
T8291 |
T8289 |
prep |
with,incubated |
R2580 |
T8292 |
T8293 |
nmod |
Pierce,substrate |
R2581 |
T8293 |
T8291 |
pobj |
substrate,with |
R2582 |
T8294 |
T8295 |
nmod |
Supersignal,West |
R2583 |
T8295 |
T8293 |
nmod |
West,substrate |
R2584 |
T8296 |
T8293 |
nmod |
Pico,substrate |
R2585 |
T8297 |
T8293 |
amod |
chemiluminescent,substrate |
R2586 |
T8298 |
T8289 |
cc |
and,incubated |
R2587 |
T8299 |
T8289 |
conj |
exposed,incubated |
R2588 |
T8300 |
T8299 |
prep |
to,exposed |
R2589 |
T8301 |
T8302 |
compound |
X-ray,films |
R2590 |
T8302 |
T8300 |
pobj |
films,to |
R2591 |
T8303 |
T8289 |
punct |
.,incubated |
R2592 |
T8467 |
T8468 |
compound |
Flow,cytometry |
R2593 |
T8470 |
T8471 |
compound |
Log,cells |
R2594 |
T8471 |
T8473 |
nsubjpass |
cells,irradiated |
R2595 |
T8472 |
T8471 |
compound |
phase,cells |
R2596 |
T8474 |
T8473 |
auxpass |
were,irradiated |
R2597 |
T8475 |
T8473 |
prep |
at,irradiated |
R2598 |
T8476 |
T8475 |
pobj |
RT,at |
R2599 |
T8477 |
T8473 |
prep |
with,irradiated |
R2600 |
T8478 |
T8479 |
det |
a,irradiator |
R2601 |
T8479 |
T8477 |
pobj |
irradiator,with |
R2602 |
T8480 |
T8481 |
nummod |
60,γ |
R2603 |
T8481 |
T8479 |
nmod |
γ,irradiator |
R2604 |
T8482 |
T8481 |
nmod |
Co,γ |
R2605 |
T8483 |
T8481 |
punct |
-,γ |
R2606 |
T8484 |
T8473 |
prep |
at,irradiated |
R2607 |
T8485 |
T8484 |
pobj |
doses,at |
R2608 |
T8486 |
T8485 |
prep |
of,doses |
R2609 |
T8487 |
T8488 |
nummod |
6,Gy |
R2610 |
T8488 |
T8486 |
pobj |
Gy,of |
R2611 |
T8489 |
T8487 |
cc |
or,6 |
R2612 |
T8490 |
T8487 |
conj |
12,6 |
R2613 |
T8491 |
T8473 |
cc |
and,irradiated |
R2614 |
T8492 |
T8473 |
conj |
incubated,irradiated |
R2615 |
T8493 |
T8492 |
prep |
for,incubated |
R2616 |
T8494 |
T8495 |
nummod |
24,h |
R2617 |
T8495 |
T8493 |
pobj |
h,for |
R2618 |
T8496 |
T8473 |
punct |
.,irradiated |
R2619 |
T8498 |
T8499 |
nsubjpass |
Cells,labeled |
R2620 |
T8500 |
T8499 |
auxpass |
were,labeled |
R2621 |
T8501 |
T8499 |
advmod |
then,labeled |
R2622 |
T8502 |
T8499 |
dep |
pulse,labeled |
R2623 |
T8503 |
T8499 |
punct |
-,labeled |
R2624 |
T8504 |
T8499 |
prep |
for,labeled |
R2625 |
T8505 |
T8506 |
nummod |
1,h |
R2626 |
T8506 |
T8504 |
pobj |
h,for |
R2627 |
T8507 |
T8499 |
prep |
with,labeled |
R2628 |
T8508 |
T8507 |
pobj |
BrdU,with |
R2629 |
T8509 |
T8510 |
punct |
(,μM |
R2630 |
T8510 |
T8508 |
parataxis |
μM,BrdU |
R2631 |
T8511 |
T8510 |
nummod |
10,μM |
R2632 |
T8512 |
T8510 |
punct |
),μM |
R2633 |
T8513 |
T8499 |
punct |
", ",labeled |
R2634 |
T8514 |
T8499 |
dep |
fixed,labeled |
R2635 |
T8515 |
T8514 |
prep |
in,fixed |
R2636 |
T8516 |
T8517 |
nummod |
70,% |
R2637 |
T8517 |
T8518 |
compound |
%,ethanol |
R2638 |
T8518 |
T8515 |
pobj |
ethanol,in |
R2639 |
T8519 |
T8499 |
punct |
", ",labeled |
R2640 |
T8520 |
T8521 |
amod |
double,stained |
R2641 |
T8521 |
T8499 |
dep |
stained,labeled |
R2642 |
T8522 |
T8521 |
punct |
-,stained |
R2643 |
T8523 |
T8521 |
prep |
with,stained |
R2644 |
T8524 |
T8525 |
compound |
FITC,anti-BrdU |
R2645 |
T8525 |
T8523 |
pobj |
anti-BrdU,with |
R2646 |
T8526 |
T8525 |
cc |
and,anti-BrdU |
R2647 |
T8527 |
T8528 |
compound |
propidium,iodide |
R2648 |
T8528 |
T8525 |
conj |
iodide,anti-BrdU |
R2649 |
T8529 |
T8499 |
punct |
", ",labeled |
R2650 |
T8530 |
T8531 |
advmod |
then,sorted |
R2651 |
T8531 |
T8499 |
dep |
sorted,labeled |
R2652 |
T8532 |
T8531 |
prep |
by,sorted |
R2653 |
T8533 |
T8532 |
pcomp |
using,by |
R2654 |
T8534 |
T8535 |
det |
a,machine |
R2655 |
T8535 |
T8533 |
dobj |
machine,using |
R2656 |
T8536 |
T8537 |
compound |
Becton,Dickinson |
R2657 |
T8537 |
T8535 |
compound |
Dickinson,machine |
R2658 |
T8538 |
T8535 |
compound |
FACScan,machine |
R2659 |
T8539 |
T8499 |
punct |
.,labeled |
R2660 |
T8541 |
T8542 |
nsubjpass |
Data,analyzed |
R2661 |
T8543 |
T8542 |
auxpass |
were,analyzed |
R2662 |
T8544 |
T8542 |
advcl |
using,analyzed |
R2663 |
T8545 |
T8546 |
compound |
Becton,Dickinson |
R2664 |
T8546 |
T8547 |
compound |
Dickinson,Pro |
R2665 |
T8547 |
T8544 |
dobj |
Pro,using |
R2666 |
T8548 |
T8547 |
compound |
Cellquest,Pro |
R2667 |
T8549 |
T8542 |
punct |
.,analyzed |