PMC:1482699 / 35100-35314 4 Projects
Annnotations
| Id | Subject | Object | Predicate | Lexical cue |
|---|---|---|---|---|
| T20903 | 0-1 | -LRB- | denotes | ( |
| T20904 | 1-3 | NN | denotes | HG |
| T20906 | 3-4 | HYPH | denotes | - |
| T20905 | 4-5 | NN | denotes | F |
| T20907 | 5-7 | , | denotes | , |
| T20908 | 7-26 | NN | denotes | ctcctgtctgggctgtgag |
| T20909 | 27-30 | CC | denotes | and |
| T20910 | 31-33 | NN | denotes | HG |
| T20912 | 33-34 | HYPH | denotes | - |
| T20911 | 34-35 | NN | denotes | R |
| T20913 | 35-37 | , | denotes | , |
| T20914 | 37-57 | NN | denotes | caaaggcagaagtggggtaa |
| T20915 | 57-58 | -RRB- | denotes | ) |
| T20902 | 59-66 | VBD | denotes | spanned |
| T20916 | 67-70 | DT | denotes | the |
| T20918 | 71-73 | NN | denotes | hg |
| T20917 | 74-82 | NN | denotes | deletion |
| T20919 | 83-92 | VBG | denotes | producing |
| T20920 | 93-94 | DT | denotes | a |
| T20922 | 95-98 | CD | denotes | 447 |
| T20923 | 99-101 | NN | denotes | bp |
| T20921 | 102-109 | NN | denotes | product |
| T20924 | 110-112 | IN | denotes | in |
| T20925 | 113-115 | NN | denotes | hg |
| T20927 | 115-116 | HYPH | denotes | / |
| T20926 | 116-118 | NN | denotes | hg |
| T20929 | 119-122 | CC | denotes | and |
| T20930 | 123-124 | SYM | denotes | + |
| T20932 | 124-125 | HYPH | denotes | / |
| T20931 | 125-127 | NN | denotes | hg |
| T20928 | 128-132 | NNS | denotes | mice |
| T20933 | 132-133 | . | denotes | . |
| T20935 | 134-137 | DT | denotes | The |
| T20937 | 138-143 | JJ | denotes | other |
| T20936 | 144-147 | NN | denotes | set |
| T20939 | 148-149 | -LRB- | denotes | ( |
| T20940 | 149-158 | NN | denotes | CRADD3a.F |
| T20941 | 158-160 | , | denotes | , |
| T20942 | 160-180 | NN | denotes | gtccatcagcattcctgaaa |
| T20943 | 181-184 | CC | denotes | and |
| T20944 | 185-193 | NN | denotes | CRADD3.R |
| T20945 | 193-195 | , | denotes | , |
| R6504 | T20904 | T20905 | compound | HG,F |
| R6506 | T20906 | T20905 | punct | -,F |
| R6507 | T20907 | T20905 | punct | ", ",F |
| R6508 | T20908 | T20905 | appos | ctcctgtctgggctgtgag,F |
| R6509 | T20909 | T20905 | cc | and,F |
| R6510 | T20910 | T20911 | compound | HG,R |
| R6511 | T20911 | T20905 | conj | R,F |
| R6512 | T20912 | T20911 | punct | -,R |
| R6513 | T20913 | T20911 | punct | ", ",R |
| R6514 | T20914 | T20911 | appos | caaaggcagaagtggggtaa,R |
| R6515 | T20915 | T20902 | punct | ),spanned |
| R6516 | T20916 | T20917 | det | the,deletion |
| R6517 | T20917 | T20902 | dobj | deletion,spanned |
| R6518 | T20918 | T20917 | compound | hg,deletion |
| R6519 | T20919 | T20902 | advcl | producing,spanned |
| R6520 | T20920 | T20921 | det | a,product |
| R6521 | T20921 | T20919 | dobj | product,producing |
| R6522 | T20922 | T20923 | nummod | 447,bp |
| R6523 | T20923 | T20921 | compound | bp,product |
| R6524 | T20924 | T20919 | prep | in,producing |
| R6525 | T20925 | T20926 | nmod | hg,hg |
| R6526 | T20926 | T20928 | nmod | hg,mice |
| R6527 | T20927 | T20926 | punct | /,hg |
| R6528 | T20928 | T20924 | pobj | mice,in |
| R6529 | T20929 | T20926 | cc | and,hg |
| R6530 | T20930 | T20931 | punct | +,hg |
| R6531 | T20931 | T20926 | conj | hg,hg |
| R6532 | T20932 | T20931 | punct | /,hg |
| R6533 | T20933 | T20902 | punct | .,spanned |
| R6534 | T20935 | T20936 | det | The,set |
| R6536 | T20937 | T20936 | amod | other,set |
| R6537 | T20939 | T20936 | punct | (,set |
| R6538 | T20940 | T20936 | appos | CRADD3a.F,set |
| R6539 | T20941 | T20940 | punct | ", ",CRADD3a.F |
| R6540 | T20942 | T20940 | appos | gtccatcagcattcctgaaa,CRADD3a.F |
| R6541 | T20943 | T20940 | cc | and,CRADD3a.F |
| R6542 | T20944 | T20940 | conj | CRADD3.R,CRADD3a.F |
| R6543 | T20945 | T20944 | punct | ", ",CRADD3.R |