Id |
Subject |
Object |
Predicate |
Lexical cue |
T23217 |
9-18 |
NN |
denotes |
Isolation |
T23218 |
19-21 |
IN |
denotes |
of |
T23219 |
22-27 |
NN |
denotes |
mouse |
T23221 |
28-30 |
NN |
denotes |
mr |
T23223 |
30-31 |
HYPH |
denotes |
- |
T23222 |
31-32 |
NN |
denotes |
s |
T23220 |
33-37 |
NN |
denotes |
cDNA |
T23224 |
37-184 |
sentence |
denotes |
We used the bioinformatics method Digital Differential Display (NCBI, UniGene) to screen novel mouse genes expressed preferentially in the retina. |
T23225 |
38-40 |
PRP |
denotes |
We |
T23226 |
41-45 |
VBD |
denotes |
used |
T23227 |
46-49 |
DT |
denotes |
the |
T23229 |
50-64 |
NN |
denotes |
bioinformatics |
T23228 |
65-71 |
NN |
denotes |
method |
T23230 |
72-79 |
NNP |
denotes |
Digital |
T23232 |
80-92 |
NNP |
denotes |
Differential |
T23231 |
93-100 |
NNP |
denotes |
Display |
T23233 |
101-102 |
-LRB- |
denotes |
( |
T23234 |
102-106 |
NNP |
denotes |
NCBI |
T23235 |
106-108 |
, |
denotes |
, |
T23236 |
108-115 |
NNP |
denotes |
UniGene |
T23237 |
115-116 |
-RRB- |
denotes |
) |
T23238 |
117-119 |
TO |
denotes |
to |
T23239 |
120-126 |
VB |
denotes |
screen |
T23240 |
127-132 |
JJ |
denotes |
novel |
T23242 |
133-138 |
NN |
denotes |
mouse |
T23241 |
139-144 |
NNS |
denotes |
genes |
T23243 |
145-154 |
VBN |
denotes |
expressed |
T23244 |
155-169 |
RB |
denotes |
preferentially |
T23245 |
170-172 |
IN |
denotes |
in |
T23246 |
173-176 |
DT |
denotes |
the |
T23247 |
177-183 |
NN |
denotes |
retina |
T23248 |
183-184 |
. |
denotes |
. |
T23249 |
184-267 |
sentence |
denotes |
Some of the clusters in the UniGene database were mainly from mouse retinal cDNAs. |
T23250 |
185-189 |
DT |
denotes |
Some |
T23252 |
190-192 |
IN |
denotes |
of |
T23253 |
193-196 |
DT |
denotes |
the |
T23254 |
197-205 |
NNS |
denotes |
clusters |
T23255 |
206-208 |
IN |
denotes |
in |
T23256 |
209-212 |
DT |
denotes |
the |
T23258 |
213-220 |
NNP |
denotes |
UniGene |
T23257 |
221-229 |
NN |
denotes |
database |
T23251 |
230-234 |
VBD |
denotes |
were |
T23259 |
235-241 |
RB |
denotes |
mainly |
T23260 |
242-246 |
IN |
denotes |
from |
T23261 |
247-252 |
NN |
denotes |
mouse |
T23263 |
253-260 |
JJ |
denotes |
retinal |
T23262 |
261-266 |
NNS |
denotes |
cDNAs |
T23264 |
266-267 |
. |
denotes |
. |
T23265 |
267-365 |
sentence |
denotes |
One clone in these clusters (#Mm. 246385) has a weak homology with the polyhomeotic family genes. |
T23266 |
268-271 |
CD |
denotes |
One |
T23267 |
272-277 |
NN |
denotes |
clone |
T23269 |
278-280 |
IN |
denotes |
in |
T23270 |
281-286 |
DT |
denotes |
these |
T23271 |
287-295 |
NNS |
denotes |
clusters |
T23272 |
296-297 |
-LRB- |
denotes |
( |
T23274 |
297-298 |
SYM |
denotes |
# |
T23273 |
298-301 |
NNP |
denotes |
Mm. |
T23275 |
302-308 |
CD |
denotes |
246385 |
T23276 |
308-309 |
-RRB- |
denotes |
) |
T23268 |
310-313 |
VBZ |
denotes |
has |
T23277 |
314-315 |
DT |
denotes |
a |
T23279 |
316-320 |
JJ |
denotes |
weak |
T23278 |
321-329 |
NN |
denotes |
homology |
T23280 |
330-334 |
IN |
denotes |
with |
T23281 |
335-338 |
DT |
denotes |
the |
T23283 |
339-351 |
JJ |
denotes |
polyhomeotic |
T23284 |
352-358 |
NN |
denotes |
family |
T23282 |
359-364 |
NNS |
denotes |
genes |
T23285 |
364-365 |
. |
denotes |
. |
T23286 |
365-484 |
sentence |
denotes |
A 735-bp cDNA fragment of this clone, encoding amino acids 140–384 was amplified by RT-PCR from mouse P0 retinal cDNA. |
T23287 |
366-367 |
DT |
denotes |
A |
T23289 |
368-371 |
CD |
denotes |
735 |
T23291 |
371-372 |
HYPH |
denotes |
- |
T23290 |
372-374 |
NN |
denotes |
bp |
T23292 |
375-379 |
NN |
denotes |
cDNA |
T23288 |
380-388 |
NN |
denotes |
fragment |
T23294 |
389-391 |
IN |
denotes |
of |
T23295 |
392-396 |
DT |
denotes |
this |
T23296 |
397-402 |
NN |
denotes |
clone |
T23297 |
402-404 |
, |
denotes |
, |
T23298 |
404-412 |
VBG |
denotes |
encoding |
T23299 |
413-418 |
NN |
denotes |
amino |
T23301 |
419-424 |
NNS |
denotes |
acids |
T23300 |
425-428 |
CD |
denotes |
140 |
T23302 |
428-429 |
SYM |
denotes |
– |
T23303 |
429-432 |
CD |
denotes |
384 |
T23304 |
433-436 |
VBD |
denotes |
was |
T23293 |
437-446 |
VBN |
denotes |
amplified |
T23305 |
447-449 |
IN |
denotes |
by |
T23306 |
450-452 |
NN |
denotes |
RT |
T23308 |
452-453 |
HYPH |
denotes |
- |
T23307 |
453-456 |
NN |
denotes |
PCR |
T23309 |
457-461 |
IN |
denotes |
from |
T23310 |
462-467 |
NN |
denotes |
mouse |
T23312 |
468-470 |
NN |
denotes |
P0 |
T23313 |
471-478 |
JJ |
denotes |
retinal |
T23311 |
479-483 |
NN |
denotes |
cDNA |
T23314 |
483-484 |
. |
denotes |
. |
T23315 |
484-593 |
sentence |
denotes |
This fragment was used as the probe for library screening, in situ hybridization and Northern hybridization. |
T23316 |
485-489 |
DT |
denotes |
This |
T23317 |
490-498 |
NN |
denotes |
fragment |
T23319 |
499-502 |
VBD |
denotes |
was |
T23318 |
503-507 |
VBN |
denotes |
used |
T23320 |
508-510 |
IN |
denotes |
as |
T23321 |
511-514 |
DT |
denotes |
the |
T23322 |
515-520 |
NN |
denotes |
probe |
T23323 |
521-524 |
IN |
denotes |
for |
T23324 |
525-532 |
NN |
denotes |
library |
T23325 |
533-542 |
NN |
denotes |
screening |
T23326 |
542-544 |
, |
denotes |
, |
T23327 |
544-546 |
FW |
denotes |
in |
T23328 |
547-551 |
FW |
denotes |
situ |
T23329 |
552-565 |
NN |
denotes |
hybridization |
T23330 |
566-569 |
CC |
denotes |
and |
T23331 |
570-578 |
NNP |
denotes |
Northern |
T23332 |
579-592 |
NN |
denotes |
hybridization |
T23333 |
592-593 |
. |
denotes |
. |
T23334 |
593-673 |
sentence |
denotes |
A mouse P0-P3 retinal cDNA library was screened using this mouse cDNA fragment. |
T23335 |
594-595 |
DT |
denotes |
A |
T23337 |
596-601 |
NN |
denotes |
mouse |
T23338 |
602-604 |
NN |
denotes |
P0 |
T23339 |
604-605 |
SYM |
denotes |
- |
T23340 |
605-607 |
NN |
denotes |
P3 |
T23341 |
608-615 |
JJ |
denotes |
retinal |
T23342 |
616-620 |
NN |
denotes |
cDNA |
T23336 |
621-628 |
NN |
denotes |
library |
T23344 |
629-632 |
VBD |
denotes |
was |
T23343 |
633-641 |
VBN |
denotes |
screened |
T23345 |
642-647 |
VBG |
denotes |
using |
T23346 |
648-652 |
DT |
denotes |
this |
T23348 |
653-658 |
NN |
denotes |
mouse |
T23349 |
659-663 |
NN |
denotes |
cDNA |
T23347 |
664-672 |
NN |
denotes |
fragment |
T23350 |
672-673 |
. |
denotes |
. |
T23351 |
673-797 |
sentence |
denotes |
Positive bacteriophage clones were isolated and the full-length mr-s fragment was inserted into pBluescriptII (Stratagene). |
T23352 |
674-682 |
JJ |
denotes |
Positive |
T23354 |
683-696 |
NN |
denotes |
bacteriophage |
T23353 |
697-703 |
NNS |
denotes |
clones |
T23356 |
704-708 |
VBD |
denotes |
were |
T23355 |
709-717 |
VBN |
denotes |
isolated |
T23357 |
718-721 |
CC |
denotes |
and |
T23358 |
722-725 |
DT |
denotes |
the |
T23360 |
726-730 |
JJ |
denotes |
full |
T23362 |
730-731 |
HYPH |
denotes |
- |
T23361 |
731-737 |
NN |
denotes |
length |
T23363 |
738-740 |
NN |
denotes |
mr |
T23365 |
740-741 |
HYPH |
denotes |
- |
T23364 |
741-742 |
NN |
denotes |
s |
T23359 |
743-751 |
NN |
denotes |
fragment |
T23367 |
752-755 |
VBD |
denotes |
was |
T23366 |
756-764 |
VBN |
denotes |
inserted |
T23368 |
765-769 |
IN |
denotes |
into |
T23369 |
770-783 |
NNP |
denotes |
pBluescriptII |
T23370 |
784-785 |
-LRB- |
denotes |
( |
T23371 |
785-795 |
NNP |
denotes |
Stratagene |
T23372 |
795-796 |
-RRB- |
denotes |
) |
T23373 |
796-797 |
. |
denotes |
. |
T23374 |
797-874 |
sentence |
denotes |
DNA sequencing was performed on both strands by the cycle sequencing method. |
T23375 |
798-801 |
NN |
denotes |
DNA |
T23376 |
802-812 |
NN |
denotes |
sequencing |
T23378 |
813-816 |
VBD |
denotes |
was |
T23377 |
817-826 |
VBN |
denotes |
performed |
T23379 |
827-829 |
IN |
denotes |
on |
T23380 |
830-834 |
DT |
denotes |
both |
T23381 |
835-842 |
NNS |
denotes |
strands |
T23382 |
843-845 |
IN |
denotes |
by |
T23383 |
846-849 |
DT |
denotes |
the |
T23385 |
850-855 |
NN |
denotes |
cycle |
T23386 |
856-866 |
NN |
denotes |
sequencing |
T23384 |
867-873 |
NN |
denotes |
method |
T23387 |
873-874 |
. |
denotes |
. |
T23388 |
874-997 |
sentence |
denotes |
The nucleotide sequence for mr-s gene has been deposited in the GenBank database under GenBank Accession Number #AY458844. |
T23389 |
875-878 |
DT |
denotes |
The |
T23391 |
879-889 |
NN |
denotes |
nucleotide |
T23390 |
890-898 |
NN |
denotes |
sequence |
T23393 |
899-902 |
IN |
denotes |
for |
T23394 |
903-905 |
NN |
denotes |
mr |
T23396 |
905-906 |
HYPH |
denotes |
- |
T23395 |
906-907 |
NN |
denotes |
s |
T23397 |
908-912 |
NN |
denotes |
gene |
T23398 |
913-916 |
VBZ |
denotes |
has |
T23399 |
917-921 |
VBN |
denotes |
been |
T23392 |
922-931 |
VBN |
denotes |
deposited |
T23400 |
932-934 |
IN |
denotes |
in |
T23401 |
935-938 |
DT |
denotes |
the |
T23403 |
939-946 |
NNP |
denotes |
GenBank |
T23402 |
947-955 |
NN |
denotes |
database |
T23404 |
956-961 |
IN |
denotes |
under |
T23405 |
962-969 |
NNP |
denotes |
GenBank |
T23407 |
970-979 |
NNP |
denotes |
Accession |
T23408 |
980-986 |
NNP |
denotes |
Number |
T23409 |
987-988 |
SYM |
denotes |
# |
T23406 |
988-996 |
NN |
denotes |
AY458844 |
T23410 |
996-997 |
. |
denotes |
. |
T23508 |
999-1001 |
FW |
denotes |
In |
T23509 |
1002-1006 |
FW |
denotes |
situ |
T23510 |
1007-1020 |
NN |
denotes |
hybridization |
T23511 |
1020-1120 |
sentence |
denotes |
The 735-bp cDNA fragment of mr-s amplified by RT-PCR was used as a probe for in situ hybridization. |
T23512 |
1021-1024 |
DT |
denotes |
The |
T23514 |
1025-1028 |
CD |
denotes |
735 |
T23516 |
1028-1029 |
HYPH |
denotes |
- |
T23515 |
1029-1031 |
NN |
denotes |
bp |
T23517 |
1032-1036 |
NN |
denotes |
cDNA |
T23513 |
1037-1045 |
NN |
denotes |
fragment |
T23519 |
1046-1048 |
IN |
denotes |
of |
T23520 |
1049-1051 |
NN |
denotes |
mr |
T23522 |
1051-1052 |
HYPH |
denotes |
- |
T23521 |
1052-1053 |
NN |
denotes |
s |
T23523 |
1054-1063 |
VBN |
denotes |
amplified |
T23524 |
1064-1066 |
IN |
denotes |
by |
T23525 |
1067-1069 |
NN |
denotes |
RT |
T23527 |
1069-1070 |
HYPH |
denotes |
- |
T23526 |
1070-1073 |
NN |
denotes |
PCR |
T23528 |
1074-1077 |
VBD |
denotes |
was |
T23518 |
1078-1082 |
VBN |
denotes |
used |
T23529 |
1083-1085 |
IN |
denotes |
as |
T23530 |
1086-1087 |
DT |
denotes |
a |
T23531 |
1088-1093 |
NN |
denotes |
probe |
T23532 |
1094-1097 |
IN |
denotes |
for |
T23533 |
1098-1100 |
FW |
denotes |
in |
T23534 |
1101-1105 |
FW |
denotes |
situ |
T23535 |
1106-1119 |
NN |
denotes |
hybridization |
T23536 |
1119-1120 |
. |
denotes |
. |
T23537 |
1120-1186 |
sentence |
denotes |
In situ hybridization was performed as described previously [49]. |
T23538 |
1121-1123 |
FW |
denotes |
In |
T23539 |
1124-1128 |
FW |
denotes |
situ |
T23540 |
1129-1142 |
NN |
denotes |
hybridization |
T23542 |
1143-1146 |
VBD |
denotes |
was |
T23541 |
1147-1156 |
VBN |
denotes |
performed |
T23543 |
1157-1159 |
IN |
denotes |
as |
T23544 |
1160-1169 |
VBN |
denotes |
described |
T23545 |
1170-1180 |
RB |
denotes |
previously |
T23546 |
1181-1182 |
-LRB- |
denotes |
[ |
T23547 |
1182-1184 |
CD |
denotes |
49 |
T23548 |
1184-1185 |
-RRB- |
denotes |
] |
T23549 |
1185-1186 |
. |
denotes |
. |
T23802 |
1188-1192 |
NN |
denotes |
Cell |
T23803 |
1193-1200 |
NN |
denotes |
culture |
T23804 |
1201-1204 |
CC |
denotes |
and |
T23805 |
1205-1217 |
NN |
denotes |
transfection |
T23806 |
1217-1399 |
sentence |
denotes |
HEK293T cells were maintained at 37°C in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (Sigma), 100 IU/ml penicillin and 100 μg/ml streptomycin. |
T23807 |
1218-1225 |
NN |
denotes |
HEK293T |
T23808 |
1226-1231 |
NNS |
denotes |
cells |
T23810 |
1232-1236 |
VBD |
denotes |
were |
T23809 |
1237-1247 |
VBN |
denotes |
maintained |
T23811 |
1248-1250 |
IN |
denotes |
at |
T23812 |
1251-1253 |
CD |
denotes |
37 |
T23813 |
1253-1255 |
NN |
denotes |
°C |
T23814 |
1256-1258 |
IN |
denotes |
in |
T23815 |
1259-1267 |
NNP |
denotes |
Dulbecco |
T23817 |
1267-1269 |
POS |
denotes |
's |
T23818 |
1270-1278 |
VBN |
denotes |
modified |
T23819 |
1279-1284 |
NNP |
denotes |
Eagle |
T23820 |
1284-1286 |
POS |
denotes |
's |
T23816 |
1287-1293 |
NN |
denotes |
medium |
T23821 |
1294-1295 |
-LRB- |
denotes |
( |
T23822 |
1295-1299 |
NN |
denotes |
DMEM |
T23823 |
1299-1300 |
-RRB- |
denotes |
) |
T23824 |
1301-1313 |
VBN |
denotes |
supplemented |
T23825 |
1314-1318 |
IN |
denotes |
with |
T23826 |
1319-1321 |
CD |
denotes |
10 |
T23827 |
1321-1322 |
NN |
denotes |
% |
T23829 |
1323-1328 |
JJ |
denotes |
fetal |
T23830 |
1329-1335 |
JJ |
denotes |
bovine |
T23828 |
1336-1341 |
NN |
denotes |
serum |
T23831 |
1342-1343 |
-LRB- |
denotes |
( |
T23832 |
1343-1348 |
NNP |
denotes |
Sigma |
T23833 |
1348-1349 |
-RRB- |
denotes |
) |
T23834 |
1349-1351 |
, |
denotes |
, |
T23835 |
1351-1354 |
CD |
denotes |
100 |
T23836 |
1355-1357 |
NN |
denotes |
IU |
T23838 |
1357-1358 |
SYM |
denotes |
/ |
T23839 |
1358-1360 |
NN |
denotes |
ml |
T23837 |
1361-1371 |
NN |
denotes |
penicillin |
T23840 |
1372-1375 |
CC |
denotes |
and |
T23841 |
1376-1379 |
CD |
denotes |
100 |
T23842 |
1380-1382 |
NN |
denotes |
μg |
T23844 |
1382-1383 |
SYM |
denotes |
/ |
T23845 |
1383-1385 |
NN |
denotes |
ml |
T23843 |
1386-1398 |
NN |
denotes |
streptomycin |
T23846 |
1398-1399 |
. |
denotes |
. |
T23847 |
1399-1527 |
sentence |
denotes |
Transient transfection of HEK293T cells was carried out using calcium phosphate method or Fugene6 transfection reagent (Roche). |
T23848 |
1400-1409 |
JJ |
denotes |
Transient |
T23849 |
1410-1422 |
NN |
denotes |
transfection |
T23851 |
1423-1425 |
IN |
denotes |
of |
T23852 |
1426-1433 |
NN |
denotes |
HEK293T |
T23853 |
1434-1439 |
NNS |
denotes |
cells |
T23854 |
1440-1443 |
VBD |
denotes |
was |
T23850 |
1444-1451 |
VBN |
denotes |
carried |
T23855 |
1452-1455 |
RP |
denotes |
out |
T23856 |
1456-1461 |
VBG |
denotes |
using |
T23857 |
1462-1469 |
NN |
denotes |
calcium |
T23858 |
1470-1479 |
NN |
denotes |
phosphate |
T23859 |
1480-1486 |
NN |
denotes |
method |
T23860 |
1487-1489 |
CC |
denotes |
or |
T23861 |
1490-1497 |
NN |
denotes |
Fugene6 |
T23863 |
1498-1510 |
NN |
denotes |
transfection |
T23862 |
1511-1518 |
NN |
denotes |
reagent |
T23864 |
1519-1520 |
-LRB- |
denotes |
( |
T23865 |
1520-1525 |
NNP |
denotes |
Roche |
T23866 |
1525-1526 |
-RRB- |
denotes |
) |
T23867 |
1526-1527 |
. |
denotes |
. |
T23868 |
1527-1686 |
sentence |
denotes |
Y79 retinoblastoma cells were maintained in Iscove's modified Dulbecco's medium with 4 mM L-glutamine adjusted to contain 1.5 g/L sodium bicarbonate, 20% FBS. |
T23869 |
1528-1531 |
NN |
denotes |
Y79 |
T23871 |
1532-1546 |
NN |
denotes |
retinoblastoma |
T23870 |
1547-1552 |
NNS |
denotes |
cells |
T23873 |
1553-1557 |
VBD |
denotes |
were |
T23872 |
1558-1568 |
VBN |
denotes |
maintained |
T23874 |
1569-1571 |
IN |
denotes |
in |
T23875 |
1572-1578 |
NNP |
denotes |
Iscove |
T23877 |
1578-1580 |
POS |
denotes |
's |
T23878 |
1581-1589 |
VBN |
denotes |
modified |
T23879 |
1590-1598 |
NNP |
denotes |
Dulbecco |
T23880 |
1598-1600 |
POS |
denotes |
's |
T23876 |
1601-1607 |
NN |
denotes |
medium |
T23881 |
1608-1612 |
IN |
denotes |
with |
T23882 |
1613-1614 |
CD |
denotes |
4 |
T23883 |
1615-1617 |
NN |
denotes |
mM |
T23885 |
1618-1619 |
NN |
denotes |
L |
T23886 |
1619-1620 |
HYPH |
denotes |
- |
T23884 |
1620-1629 |
NN |
denotes |
glutamine |
T23887 |
1630-1638 |
VBN |
denotes |
adjusted |
T23888 |
1639-1641 |
TO |
denotes |
to |
T23889 |
1642-1649 |
VB |
denotes |
contain |
T23890 |
1650-1653 |
CD |
denotes |
1.5 |
T23891 |
1654-1655 |
NN |
denotes |
g |
T23893 |
1655-1656 |
SYM |
denotes |
/ |
T23894 |
1656-1657 |
NN |
denotes |
L |
T23895 |
1658-1664 |
NN |
denotes |
sodium |
T23892 |
1665-1676 |
NN |
denotes |
bicarbonate |
T23896 |
1676-1678 |
, |
denotes |
, |
T23897 |
1678-1680 |
CD |
denotes |
20 |
T23898 |
1680-1681 |
NN |
denotes |
% |
T23899 |
1682-1685 |
NN |
denotes |
FBS |
T23900 |
1685-1686 |
. |
denotes |
. |
T23901 |
1686-1752 |
sentence |
denotes |
Transient transfection was carried out using TransIt LT1 (Mirus). |
T23902 |
1687-1696 |
JJ |
denotes |
Transient |
T23903 |
1697-1709 |
NN |
denotes |
transfection |
T23905 |
1710-1713 |
VBD |
denotes |
was |
T23904 |
1714-1721 |
VBN |
denotes |
carried |
T23906 |
1722-1725 |
RP |
denotes |
out |
T23907 |
1726-1731 |
VBG |
denotes |
using |
T23908 |
1732-1739 |
NN |
denotes |
TransIt |
T23909 |
1740-1743 |
NN |
denotes |
LT1 |
T23910 |
1744-1745 |
-LRB- |
denotes |
( |
T23911 |
1745-1750 |
NNP |
denotes |
Mirus |
T23912 |
1750-1751 |
-RRB- |
denotes |
) |
T23913 |
1751-1752 |
. |
denotes |
. |
T24169 |
1754-1762 |
NNP |
denotes |
Northern |
T24171 |
1762-1763 |
HYPH |
denotes |
- |
T24170 |
1763-1767 |
NN |
denotes |
blot |
T24172 |
1768-1776 |
NN |
denotes |
analysis |
T24173 |
1776-1852 |
sentence |
denotes |
RNA was extracted from the tissues of adult mice using Trizol (Invitrogen). |
T24174 |
1777-1780 |
NN |
denotes |
RNA |
T24176 |
1781-1784 |
VBD |
denotes |
was |
T24175 |
1785-1794 |
VBN |
denotes |
extracted |
T24177 |
1795-1799 |
IN |
denotes |
from |
T24178 |
1800-1803 |
DT |
denotes |
the |
T24179 |
1804-1811 |
NNS |
denotes |
tissues |
T24180 |
1812-1814 |
IN |
denotes |
of |
T24181 |
1815-1820 |
JJ |
denotes |
adult |
T24182 |
1821-1825 |
NNS |
denotes |
mice |
T24183 |
1826-1831 |
VBG |
denotes |
using |
T24184 |
1832-1838 |
NNP |
denotes |
Trizol |
T24185 |
1839-1840 |
-LRB- |
denotes |
( |
T24186 |
1840-1850 |
NNP |
denotes |
Invitrogen |
T24187 |
1850-1851 |
-RRB- |
denotes |
) |
T24188 |
1851-1852 |
. |
denotes |
. |
T24189 |
1852-1989 |
sentence |
denotes |
A 5 μg of total RNA was electrophoresed in a 1.0% agarose-formaldehyde gel and transferred to a nylon membrane (Zeta-Probe GT, Bio-Rad). |
T24190 |
1853-1854 |
DT |
denotes |
A |
T24192 |
1855-1856 |
CD |
denotes |
5 |
T24191 |
1857-1859 |
NN |
denotes |
μg |
T24194 |
1860-1862 |
IN |
denotes |
of |
T24195 |
1863-1868 |
JJ |
denotes |
total |
T24196 |
1869-1872 |
NN |
denotes |
RNA |
T24197 |
1873-1876 |
VBD |
denotes |
was |
T24193 |
1877-1892 |
VBN |
denotes |
electrophoresed |
T24198 |
1893-1895 |
IN |
denotes |
in |
T24199 |
1896-1897 |
DT |
denotes |
a |
T24201 |
1898-1901 |
CD |
denotes |
1.0 |
T24202 |
1901-1902 |
NN |
denotes |
% |
T24203 |
1903-1910 |
NN |
denotes |
agarose |
T24205 |
1910-1911 |
HYPH |
denotes |
- |
T24204 |
1911-1923 |
NN |
denotes |
formaldehyde |
T24200 |
1924-1927 |
NN |
denotes |
gel |
T24206 |
1928-1931 |
CC |
denotes |
and |
T24207 |
1932-1943 |
VBN |
denotes |
transferred |
T24208 |
1944-1946 |
IN |
denotes |
to |
T24209 |
1947-1948 |
DT |
denotes |
a |
T24211 |
1949-1954 |
NN |
denotes |
nylon |
T24210 |
1955-1963 |
NN |
denotes |
membrane |
T24212 |
1964-1965 |
-LRB- |
denotes |
( |
T24214 |
1965-1969 |
NNP |
denotes |
Zeta |
T24216 |
1969-1970 |
HYPH |
denotes |
- |
T24215 |
1970-1975 |
NNP |
denotes |
Probe |
T24213 |
1976-1978 |
NNP |
denotes |
GT |
T24217 |
1978-1980 |
, |
denotes |
, |
T24218 |
1980-1983 |
NNP |
denotes |
Bio |
T24220 |
1983-1984 |
HYPH |
denotes |
- |
T24219 |
1984-1987 |
NNP |
denotes |
Rad |
T24221 |
1987-1988 |
-RRB- |
denotes |
) |
T24222 |
1988-1989 |
. |
denotes |
. |
T24223 |
1989-2085 |
sentence |
denotes |
The 735-bp cDNA fragment encoding the SAM domain of mr-s was used as a probe for hybridization. |
T24224 |
1990-1993 |
DT |
denotes |
The |
T24226 |
1994-1997 |
CD |
denotes |
735 |
T24228 |
1997-1998 |
HYPH |
denotes |
- |
T24227 |
1998-2000 |
NN |
denotes |
bp |
T24229 |
2001-2005 |
NN |
denotes |
cDNA |
T24225 |
2006-2014 |
NN |
denotes |
fragment |
T24231 |
2015-2023 |
VBG |
denotes |
encoding |
T24232 |
2024-2027 |
DT |
denotes |
the |
T24234 |
2028-2031 |
NN |
denotes |
SAM |
T24233 |
2032-2038 |
NN |
denotes |
domain |
T24235 |
2039-2041 |
IN |
denotes |
of |
T24236 |
2042-2044 |
NN |
denotes |
mr |
T24238 |
2044-2045 |
HYPH |
denotes |
- |
T24237 |
2045-2046 |
NN |
denotes |
s |
T24239 |
2047-2050 |
VBD |
denotes |
was |
T24230 |
2051-2055 |
VBN |
denotes |
used |
T24240 |
2056-2058 |
IN |
denotes |
as |
T24241 |
2059-2060 |
DT |
denotes |
a |
T24242 |
2061-2066 |
NN |
denotes |
probe |
T24243 |
2067-2070 |
IN |
denotes |
for |
T24244 |
2071-2084 |
NN |
denotes |
hybridization |
T24245 |
2084-2085 |
. |
denotes |
. |
T24246 |
2085-2155 |
sentence |
denotes |
Hybridization was performed according to the manufacturer's protocol. |
T24247 |
2086-2099 |
NN |
denotes |
Hybridization |
T24249 |
2100-2103 |
VBD |
denotes |
was |
T24248 |
2104-2113 |
VBN |
denotes |
performed |
T24250 |
2114-2123 |
VBG |
denotes |
according |
T24251 |
2124-2126 |
IN |
denotes |
to |
T24252 |
2127-2130 |
DT |
denotes |
the |
T24253 |
2131-2143 |
NN |
denotes |
manufacturer |
T24255 |
2143-2145 |
POS |
denotes |
's |
T24254 |
2146-2154 |
NN |
denotes |
protocol |
T24256 |
2154-2155 |
. |
denotes |
. |
T24257 |
2155-2295 |
sentence |
denotes |
Washes with increasing stringency were performed, the last being at 50°C in 0.1× standard saline citrate/0.1% sodium dodecyl sulfate (SDS). |
T24258 |
2156-2162 |
NNS |
denotes |
Washes |
T24260 |
2163-2167 |
IN |
denotes |
with |
T24261 |
2168-2178 |
VBG |
denotes |
increasing |
T24262 |
2179-2189 |
NN |
denotes |
stringency |
T24263 |
2190-2194 |
VBD |
denotes |
were |
T24259 |
2195-2204 |
VBN |
denotes |
performed |
T24264 |
2204-2206 |
, |
denotes |
, |
T24265 |
2206-2209 |
DT |
denotes |
the |
T24266 |
2210-2214 |
JJ |
denotes |
last |
T24267 |
2215-2220 |
VBG |
denotes |
being |
T24268 |
2221-2223 |
IN |
denotes |
at |
T24269 |
2224-2226 |
CD |
denotes |
50 |
T24270 |
2226-2228 |
NN |
denotes |
°C |
T24271 |
2229-2231 |
IN |
denotes |
in |
T24272 |
2232-2235 |
CD |
denotes |
0.1 |
T24274 |
2235-2236 |
SYM |
denotes |
× |
T24275 |
2237-2245 |
JJ |
denotes |
standard |
T24276 |
2246-2252 |
NN |
denotes |
saline |
T24273 |
2253-2260 |
NN |
denotes |
citrate |
T24277 |
2260-2261 |
SYM |
denotes |
/ |
T24279 |
2261-2264 |
CD |
denotes |
0.1 |
T24278 |
2264-2265 |
NN |
denotes |
% |
T24280 |
2266-2272 |
NN |
denotes |
sodium |
T24282 |
2273-2280 |
NN |
denotes |
dodecyl |
T24281 |
2281-2288 |
NN |
denotes |
sulfate |
T24283 |
2289-2290 |
-LRB- |
denotes |
( |
T24284 |
2290-2293 |
NN |
denotes |
SDS |
T24285 |
2293-2294 |
-RRB- |
denotes |
) |
T24286 |
2294-2295 |
. |
denotes |
. |
T24536 |
2297-2299 |
NN |
denotes |
RT |
T24538 |
2299-2300 |
HYPH |
denotes |
- |
T24537 |
2300-2303 |
NN |
denotes |
PCR |
T24539 |
2304-2312 |
NN |
denotes |
analysis |
T24540 |
2312-2366 |
sentence |
denotes |
Total RNA was isolated from each tissue using Trizol. |
T24541 |
2313-2318 |
JJ |
denotes |
Total |
T24542 |
2319-2322 |
NN |
denotes |
RNA |
T24544 |
2323-2326 |
VBD |
denotes |
was |
T24543 |
2327-2335 |
VBN |
denotes |
isolated |
T24545 |
2336-2340 |
IN |
denotes |
from |
T24546 |
2341-2345 |
DT |
denotes |
each |
T24547 |
2346-2352 |
NN |
denotes |
tissue |
T24548 |
2353-2358 |
VBG |
denotes |
using |
T24549 |
2359-2365 |
NN |
denotes |
Trizol |
T24550 |
2365-2366 |
. |
denotes |
. |
T24551 |
2366-2444 |
sentence |
denotes |
A 1 μg of total RNA was reverse transcribed using SuperscriptII (Invitrogen). |
T24552 |
2367-2368 |
DT |
denotes |
A |
T24554 |
2369-2370 |
CD |
denotes |
1 |
T24553 |
2371-2373 |
NN |
denotes |
μg |
T24556 |
2374-2376 |
IN |
denotes |
of |
T24557 |
2377-2382 |
JJ |
denotes |
total |
T24558 |
2383-2386 |
NN |
denotes |
RNA |
T24559 |
2387-2390 |
VBD |
denotes |
was |
T24560 |
2391-2398 |
JJ |
denotes |
reverse |
T24555 |
2399-2410 |
VBN |
denotes |
transcribed |
T24561 |
2411-2416 |
VBG |
denotes |
using |
T24562 |
2417-2430 |
NNP |
denotes |
SuperscriptII |
T24563 |
2431-2432 |
-LRB- |
denotes |
( |
T24564 |
2432-2442 |
NNP |
denotes |
Invitrogen |
T24565 |
2442-2443 |
-RRB- |
denotes |
) |
T24566 |
2443-2444 |
. |
denotes |
. |
T24567 |
2444-2585 |
sentence |
denotes |
RT-PCR primers, which span introns, for detection of mr-s cDNA were 5'-TGTCCAGCCCAGCCAACCCAAGGAGACGACA-3' and 5'-TGTGGTCTCCTCATCAGTGAAGA-3'. |
T24568 |
2445-2447 |
NN |
denotes |
RT |
T24570 |
2447-2448 |
HYPH |
denotes |
- |
T24569 |
2448-2451 |
NN |
denotes |
PCR |
T24571 |
2452-2459 |
NNS |
denotes |
primers |
T24573 |
2459-2461 |
, |
denotes |
, |
T24574 |
2461-2466 |
WDT |
denotes |
which |
T24575 |
2467-2471 |
VBP |
denotes |
span |
T24576 |
2472-2479 |
NNS |
denotes |
introns |
T24577 |
2479-2481 |
, |
denotes |
, |
T24578 |
2481-2484 |
IN |
denotes |
for |
T24579 |
2485-2494 |
NN |
denotes |
detection |
T24580 |
2495-2497 |
IN |
denotes |
of |
T24581 |
2498-2500 |
NN |
denotes |
mr |
T24583 |
2500-2501 |
HYPH |
denotes |
- |
T24582 |
2501-2502 |
NN |
denotes |
s |
T24584 |
2503-2507 |
NN |
denotes |
cDNA |
T24572 |
2508-2512 |
VBD |
denotes |
were |
T24585 |
2513-2514 |
CD |
denotes |
5 |
T24587 |
2514-2515 |
SYM |
denotes |
' |
T24588 |
2515-2516 |
HYPH |
denotes |
- |
T24586 |
2516-2547 |
NN |
denotes |
TGTCCAGCCCAGCCAACCCAAGGAGACGACA |
T24589 |
2547-2548 |
HYPH |
denotes |
- |
T24590 |
2548-2549 |
CD |
denotes |
3 |
T24591 |
2549-2550 |
SYM |
denotes |
' |
T24592 |
2551-2554 |
CC |
denotes |
and |
T24593 |
2555-2556 |
CD |
denotes |
5 |
T24595 |
2556-2557 |
SYM |
denotes |
' |
T24596 |
2557-2558 |
HYPH |
denotes |
- |
T24594 |
2558-2581 |
NN |
denotes |
TGTGGTCTCCTCATCAGTGAAGA |
T24597 |
2581-2582 |
HYPH |
denotes |
- |
T24598 |
2582-2583 |
CD |
denotes |
3 |
T24599 |
2583-2584 |
SYM |
denotes |
' |
T24600 |
2584-2585 |
. |
denotes |
. |
T24601 |
2585-2669 |
sentence |
denotes |
Product size was 292 bp (positions 965–1256 of Genbank Accession Number #AY458844). |
T24602 |
2586-2593 |
NN |
denotes |
Product |
T24603 |
2594-2598 |
NN |
denotes |
size |
T24604 |
2599-2602 |
VBD |
denotes |
was |
T24605 |
2603-2606 |
CD |
denotes |
292 |
T24606 |
2607-2609 |
NN |
denotes |
bp |
T24607 |
2610-2611 |
-LRB- |
denotes |
( |
T24609 |
2611-2620 |
NNS |
denotes |
positions |
T24608 |
2621-2624 |
CD |
denotes |
965 |
T24610 |
2624-2625 |
SYM |
denotes |
– |
T24611 |
2625-2629 |
CD |
denotes |
1256 |
T24612 |
2630-2632 |
IN |
denotes |
of |
T24613 |
2633-2640 |
NNP |
denotes |
Genbank |
T24615 |
2641-2650 |
NNP |
denotes |
Accession |
T24616 |
2651-2657 |
NNP |
denotes |
Number |
T24617 |
2658-2659 |
SYM |
denotes |
# |
T24614 |
2659-2667 |
NN |
denotes |
AY458844 |
T24618 |
2667-2668 |
-RRB- |
denotes |
) |
T24619 |
2668-2669 |
. |
denotes |
. |
T24620 |
2669-2854 |
sentence |
denotes |
Primer pairs for mouse G3PDH were 5'-ACCACAGTCCATGCCATCAC-3' and 5'-TCCACCACCCTGTTGCTGTA- 3' which amplified a 452-bp product (positions 587–1038 of Genbank Accession Number #BC85275). |
T24621 |
2670-2676 |
NN |
denotes |
Primer |
T24622 |
2677-2682 |
NNS |
denotes |
pairs |
T24624 |
2683-2686 |
IN |
denotes |
for |
T24625 |
2687-2692 |
NN |
denotes |
mouse |
T24626 |
2693-2698 |
NN |
denotes |
G3PDH |
T24623 |
2699-2703 |
VBD |
denotes |
were |
T24627 |
2704-2705 |
CD |
denotes |
5 |
T24629 |
2705-2706 |
SYM |
denotes |
' |
T24630 |
2706-2707 |
HYPH |
denotes |
- |
T24628 |
2707-2727 |
NN |
denotes |
ACCACAGTCCATGCCATCAC |
T24631 |
2727-2728 |
HYPH |
denotes |
- |
T24632 |
2728-2729 |
CD |
denotes |
3 |
T24633 |
2729-2730 |
SYM |
denotes |
' |
T24634 |
2731-2734 |
CC |
denotes |
and |
T24635 |
2735-2736 |
CD |
denotes |
5 |
T24637 |
2736-2737 |
SYM |
denotes |
' |
T24638 |
2737-2738 |
HYPH |
denotes |
- |
T24636 |
2738-2758 |
NN |
denotes |
TCCACCACCCTGTTGCTGTA |
T24639 |
2758-2759 |
HYPH |
denotes |
- |
T24640 |
2760-2761 |
CD |
denotes |
3 |
T24641 |
2761-2762 |
SYM |
denotes |
' |
T24642 |
2763-2768 |
WDT |
denotes |
which |
T24643 |
2769-2778 |
VBD |
denotes |
amplified |
T24644 |
2779-2780 |
DT |
denotes |
a |
T24646 |
2781-2784 |
CD |
denotes |
452 |
T24648 |
2784-2785 |
HYPH |
denotes |
- |
T24647 |
2785-2787 |
NN |
denotes |
bp |
T24645 |
2788-2795 |
NN |
denotes |
product |
T24649 |
2796-2797 |
-LRB- |
denotes |
( |
T24651 |
2797-2806 |
NNS |
denotes |
positions |
T24650 |
2807-2810 |
CD |
denotes |
587 |
T24652 |
2810-2811 |
SYM |
denotes |
– |
T24653 |
2811-2815 |
CD |
denotes |
1038 |
T24654 |
2816-2818 |
IN |
denotes |
of |
T24655 |
2819-2826 |
NNP |
denotes |
Genbank |
T24657 |
2827-2836 |
NN |
denotes |
Accession |
T24658 |
2837-2843 |
NN |
denotes |
Number |
T24659 |
2844-2845 |
SYM |
denotes |
# |
T24656 |
2845-2852 |
NN |
denotes |
BC85275 |
T24660 |
2852-2853 |
-RRB- |
denotes |
) |
T24661 |
2853-2854 |
. |
denotes |
. |
T25116 |
2856-2861 |
NN |
denotes |
Yeast |
T25118 |
2862-2865 |
CD |
denotes |
two |
T25120 |
2865-2866 |
HYPH |
denotes |
- |
T25119 |
2866-2872 |
NN |
denotes |
hybrid |
T25117 |
2873-2882 |
NN |
denotes |
screening |
T25121 |
2883-2886 |
CC |
denotes |
and |
T25122 |
2887-2891 |
NN |
denotes |
GAL4 |
T25123 |
2892-2897 |
NN |
denotes |
assay |
T25124 |
2897-3039 |
sentence |
denotes |
We carried out yeast two-hybrid experiments using the MATCHMAKER GAL4 two-hybrid system 3 (BD Bioscience) as recommended by the manufacturer. |
T25125 |
2898-2900 |
PRP |
denotes |
We |
T25126 |
2901-2908 |
VBD |
denotes |
carried |
T25127 |
2909-2912 |
RP |
denotes |
out |
T25128 |
2913-2918 |
NN |
denotes |
yeast |
T25130 |
2919-2922 |
CD |
denotes |
two |
T25132 |
2922-2923 |
HYPH |
denotes |
- |
T25131 |
2923-2929 |
NN |
denotes |
hybrid |
T25129 |
2930-2941 |
NNS |
denotes |
experiments |
T25133 |
2942-2947 |
VBG |
denotes |
using |
T25134 |
2948-2951 |
DT |
denotes |
the |
T25136 |
2952-2962 |
NNP |
denotes |
MATCHMAKER |
T25137 |
2963-2967 |
NN |
denotes |
GAL4 |
T25138 |
2968-2971 |
CD |
denotes |
two |
T25140 |
2971-2972 |
HYPH |
denotes |
- |
T25139 |
2972-2978 |
NN |
denotes |
hybrid |
T25135 |
2979-2985 |
NN |
denotes |
system |
T25141 |
2986-2987 |
CD |
denotes |
3 |
T25142 |
2988-2989 |
-LRB- |
denotes |
( |
T25144 |
2989-2991 |
NNP |
denotes |
BD |
T25143 |
2992-3002 |
NNP |
denotes |
Bioscience |
T25145 |
3002-3003 |
-RRB- |
denotes |
) |
T25146 |
3004-3006 |
IN |
denotes |
as |
T25147 |
3007-3018 |
VBN |
denotes |
recommended |
T25148 |
3019-3021 |
IN |
denotes |
by |
T25149 |
3022-3025 |
DT |
denotes |
the |
T25150 |
3026-3038 |
NN |
denotes |
manufacturer |
T25151 |
3038-3039 |
. |
denotes |
. |
T25152 |
3039-3176 |
sentence |
denotes |
We cloned the full-length mr-s into the pGBKT7 vector and used it to screen a library of mouse P0-P3 retinal cDNAs in the pGADT7 vector. |
T25153 |
3040-3042 |
PRP |
denotes |
We |
T25154 |
3043-3049 |
VBD |
denotes |
cloned |
T25155 |
3050-3053 |
DT |
denotes |
the |
T25157 |
3054-3058 |
JJ |
denotes |
full |
T25159 |
3058-3059 |
HYPH |
denotes |
- |
T25158 |
3059-3065 |
NN |
denotes |
length |
T25160 |
3066-3068 |
NN |
denotes |
mr |
T25161 |
3068-3069 |
HYPH |
denotes |
- |
T25156 |
3069-3070 |
NN |
denotes |
s |
T25162 |
3071-3075 |
IN |
denotes |
into |
T25163 |
3076-3079 |
DT |
denotes |
the |
T25165 |
3080-3086 |
NN |
denotes |
pGBKT7 |
T25164 |
3087-3093 |
NN |
denotes |
vector |
T25166 |
3094-3097 |
CC |
denotes |
and |
T25167 |
3098-3102 |
VBD |
denotes |
used |
T25168 |
3103-3105 |
PRP |
denotes |
it |
T25169 |
3106-3108 |
TO |
denotes |
to |
T25170 |
3109-3115 |
VB |
denotes |
screen |
T25171 |
3116-3117 |
DT |
denotes |
a |
T25172 |
3118-3125 |
NN |
denotes |
library |
T25173 |
3126-3128 |
IN |
denotes |
of |
T25174 |
3129-3134 |
NN |
denotes |
mouse |
T25176 |
3135-3137 |
NN |
denotes |
P0 |
T25177 |
3137-3138 |
SYM |
denotes |
- |
T25178 |
3138-3140 |
NN |
denotes |
P3 |
T25179 |
3141-3148 |
JJ |
denotes |
retinal |
T25175 |
3149-3154 |
NNS |
denotes |
cDNAs |
T25180 |
3155-3157 |
IN |
denotes |
in |
T25181 |
3158-3161 |
DT |
denotes |
the |
T25183 |
3162-3168 |
NN |
denotes |
pGADT7 |
T25182 |
3169-3175 |
NN |
denotes |
vector |
T25184 |
3175-3176 |
. |
denotes |
. |
T25185 |
3176-3301 |
sentence |
denotes |
Transformants that conferred growth were picked, isolated and re-introduced with the bait into AH109 to confirm interaction. |
T25186 |
3177-3190 |
NNS |
denotes |
Transformants |
T25188 |
3191-3195 |
WDT |
denotes |
that |
T25189 |
3196-3205 |
VBD |
denotes |
conferred |
T25190 |
3206-3212 |
NN |
denotes |
growth |
T25191 |
3213-3217 |
VBD |
denotes |
were |
T25187 |
3218-3224 |
VBN |
denotes |
picked |
T25192 |
3224-3226 |
, |
denotes |
, |
T25193 |
3226-3234 |
VBN |
denotes |
isolated |
T25194 |
3235-3238 |
CC |
denotes |
and |
T25195 |
3239-3252 |
VBN |
denotes |
re-introduced |
T25196 |
3253-3257 |
IN |
denotes |
with |
T25197 |
3258-3261 |
DT |
denotes |
the |
T25198 |
3262-3266 |
NN |
denotes |
bait |
T25199 |
3267-3271 |
IN |
denotes |
into |
T25200 |
3272-3277 |
NN |
denotes |
AH109 |
T25201 |
3278-3280 |
TO |
denotes |
to |
T25202 |
3281-3288 |
VB |
denotes |
confirm |
T25203 |
3289-3300 |
NN |
denotes |
interaction |
T25204 |
3300-3301 |
. |
denotes |
. |
T25205 |
3301-3387 |
sentence |
denotes |
Plasmid DNA was isolated from yeast using RPM Yeast Plasmid Isolation Kit (Qbiogene). |
T25206 |
3302-3309 |
NN |
denotes |
Plasmid |
T25207 |
3310-3313 |
NN |
denotes |
DNA |
T25209 |
3314-3317 |
VBD |
denotes |
was |
T25208 |
3318-3326 |
VBN |
denotes |
isolated |
T25210 |
3327-3331 |
IN |
denotes |
from |
T25211 |
3332-3337 |
NN |
denotes |
yeast |
T25212 |
3338-3343 |
VBG |
denotes |
using |
T25213 |
3344-3347 |
NN |
denotes |
RPM |
T25215 |
3348-3353 |
NN |
denotes |
Yeast |
T25216 |
3354-3361 |
NN |
denotes |
Plasmid |
T25217 |
3362-3371 |
NN |
denotes |
Isolation |
T25214 |
3372-3375 |
NN |
denotes |
Kit |
T25218 |
3376-3377 |
-LRB- |
denotes |
( |
T25219 |
3377-3385 |
NNP |
denotes |
Qbiogene |
T25220 |
3385-3386 |
-RRB- |
denotes |
) |
T25221 |
3386-3387 |
. |
denotes |
. |
T25222 |
3387-3562 |
sentence |
denotes |
In order to confirm the protein interactions, single colonies were picked and grown individually in synthetic complete media lacking leucine, tryptophan and containing X-gal. |
T25223 |
3388-3390 |
IN |
denotes |
In |
T25225 |
3391-3396 |
NN |
denotes |
order |
T25226 |
3397-3399 |
TO |
denotes |
to |
T25227 |
3400-3407 |
VB |
denotes |
confirm |
T25228 |
3408-3411 |
DT |
denotes |
the |
T25230 |
3412-3419 |
NN |
denotes |
protein |
T25229 |
3420-3432 |
NNS |
denotes |
interactions |
T25231 |
3432-3434 |
, |
denotes |
, |
T25232 |
3434-3440 |
JJ |
denotes |
single |
T25233 |
3441-3449 |
NNS |
denotes |
colonies |
T25234 |
3450-3454 |
VBD |
denotes |
were |
T25224 |
3455-3461 |
VBN |
denotes |
picked |
T25235 |
3462-3465 |
CC |
denotes |
and |
T25236 |
3466-3471 |
VBN |
denotes |
grown |
T25237 |
3472-3484 |
RB |
denotes |
individually |
T25238 |
3485-3487 |
IN |
denotes |
in |
T25239 |
3488-3497 |
JJ |
denotes |
synthetic |
T25241 |
3498-3506 |
JJ |
denotes |
complete |
T25240 |
3507-3512 |
NNS |
denotes |
media |
T25242 |
3513-3520 |
VBG |
denotes |
lacking |
T25243 |
3521-3528 |
NN |
denotes |
leucine |
T25245 |
3528-3530 |
, |
denotes |
, |
T25244 |
3530-3540 |
NN |
denotes |
tryptophan |
T25246 |
3541-3544 |
CC |
denotes |
and |
T25247 |
3545-3555 |
VBG |
denotes |
containing |
T25248 |
3556-3557 |
NN |
denotes |
X |
T25250 |
3557-3558 |
HYPH |
denotes |
- |
T25249 |
3558-3561 |
NN |
denotes |
gal |
T25251 |
3561-3562 |
. |
denotes |
. |
T25252 |
3562-3628 |
sentence |
denotes |
After 4–5 days, X-gal positive clones were selected and analyzed. |
T25253 |
3563-3568 |
IN |
denotes |
After |
T25255 |
3569-3570 |
CD |
denotes |
4 |
T25257 |
3570-3571 |
SYM |
denotes |
– |
T25256 |
3571-3572 |
CD |
denotes |
5 |
T25258 |
3573-3577 |
NNS |
denotes |
days |
T25259 |
3577-3579 |
, |
denotes |
, |
T25260 |
3579-3580 |
NN |
denotes |
X |
T25262 |
3580-3581 |
NN |
denotes |
- |
T25261 |
3581-3584 |
NN |
denotes |
gal |
T25263 |
3585-3593 |
JJ |
denotes |
positive |
T25264 |
3594-3600 |
NNS |
denotes |
clones |
T25265 |
3601-3605 |
VBD |
denotes |
were |
T25254 |
3606-3614 |
VBN |
denotes |
selected |
T25266 |
3615-3618 |
CC |
denotes |
and |
T25267 |
3619-3627 |
VBN |
denotes |
analyzed |
T25268 |
3627-3628 |
. |
denotes |
. |
T25269 |
3628-3800 |
sentence |
denotes |
To test self-interaction of mr-s, we subcloned the full-length, N-terminus (amino acids 1–400) and C-terminus (amino acids 391–542) of mr-s into pGBKT7 and pGADT7 vectors. |
T25270 |
3629-3631 |
TO |
denotes |
To |
T25271 |
3632-3636 |
VB |
denotes |
test |
T25273 |
3637-3641 |
NN |
denotes |
self |
T25275 |
3641-3642 |
HYPH |
denotes |
- |
T25274 |
3642-3653 |
NN |
denotes |
interaction |
T25276 |
3654-3656 |
IN |
denotes |
of |
T25277 |
3657-3659 |
NN |
denotes |
mr |
T25279 |
3659-3660 |
HYPH |
denotes |
- |
T25278 |
3660-3661 |
NN |
denotes |
s |
T25280 |
3661-3663 |
, |
denotes |
, |
T25281 |
3663-3665 |
PRP |
denotes |
we |
T25272 |
3666-3675 |
VBD |
denotes |
subcloned |
T25282 |
3676-3679 |
DT |
denotes |
the |
T25284 |
3680-3684 |
JJ |
denotes |
full |
T25285 |
3684-3685 |
HYPH |
denotes |
- |
T25283 |
3685-3691 |
NN |
denotes |
length |
T25286 |
3691-3693 |
, |
denotes |
, |
T25287 |
3693-3694 |
NN |
denotes |
N |
T25289 |
3694-3695 |
HYPH |
denotes |
- |
T25288 |
3695-3703 |
NN |
denotes |
terminus |
T25290 |
3704-3705 |
-LRB- |
denotes |
( |
T25292 |
3705-3710 |
NN |
denotes |
amino |
T25293 |
3711-3716 |
NNS |
denotes |
acids |
T25291 |
3717-3718 |
CD |
denotes |
1 |
T25294 |
3718-3719 |
SYM |
denotes |
– |
T25295 |
3719-3722 |
CD |
denotes |
400 |
T25296 |
3722-3723 |
-RRB- |
denotes |
) |
T25297 |
3724-3727 |
CC |
denotes |
and |
T25298 |
3728-3729 |
NN |
denotes |
C |
T25300 |
3729-3730 |
HYPH |
denotes |
- |
T25299 |
3730-3738 |
NN |
denotes |
terminus |
T25301 |
3739-3740 |
-LRB- |
denotes |
( |
T25303 |
3740-3745 |
NN |
denotes |
amino |
T25304 |
3746-3751 |
NNS |
denotes |
acids |
T25302 |
3752-3755 |
CD |
denotes |
391 |
T25305 |
3755-3756 |
SYM |
denotes |
– |
T25306 |
3756-3759 |
CD |
denotes |
542 |
T25307 |
3759-3760 |
-RRB- |
denotes |
) |
T25308 |
3761-3763 |
IN |
denotes |
of |
T25309 |
3764-3766 |
NN |
denotes |
mr |
T25311 |
3766-3767 |
HYPH |
denotes |
- |
T25310 |
3767-3768 |
NN |
denotes |
s |
T25312 |
3769-3773 |
IN |
denotes |
into |
T25313 |
3774-3780 |
NN |
denotes |
pGBKT7 |
T25315 |
3781-3784 |
CC |
denotes |
and |
T25316 |
3785-3791 |
NN |
denotes |
pGADT7 |
T25314 |
3792-3799 |
NNS |
denotes |
vectors |
T25317 |
3799-3800 |
. |
denotes |
. |
T25318 |
3800-3885 |
sentence |
denotes |
We assessed interactions by scoring blue color on plates of medium containing X-gal. |
T25319 |
3801-3803 |
PRP |
denotes |
We |
T25320 |
3804-3812 |
VBD |
denotes |
assessed |
T25321 |
3813-3825 |
NNS |
denotes |
interactions |
T25322 |
3826-3828 |
IN |
denotes |
by |
T25323 |
3829-3836 |
VBG |
denotes |
scoring |
T25324 |
3837-3841 |
JJ |
denotes |
blue |
T25325 |
3842-3847 |
NN |
denotes |
color |
T25326 |
3848-3850 |
IN |
denotes |
on |
T25327 |
3851-3857 |
NNS |
denotes |
plates |
T25328 |
3858-3860 |
IN |
denotes |
of |
T25329 |
3861-3867 |
NN |
denotes |
medium |
T25330 |
3868-3878 |
VBG |
denotes |
containing |
T25331 |
3879-3880 |
NN |
denotes |
X |
T25333 |
3880-3881 |
HYPH |
denotes |
- |
T25332 |
3881-3884 |
NN |
denotes |
gal |
T25334 |
3884-3885 |
. |
denotes |
. |
T26198 |
3887-3906 |
NN |
denotes |
Immunoprecipitation |
T26199 |
3907-3912 |
NN |
denotes |
assay |
T26200 |
3912-4238 |
sentence |
denotes |
For immunoprecipitation assay, 4× hemagglutinin (HA) or 3× Flag tagged cDNA fragment encoding full-length mr-s (full-HA and Flag-mrs), a cDNA fragment encoding amino acids 1–400 (ΔSAM-HA and Flag-ΔSAM), and a cDNA fragment encoding amino acids 400–542 (Flag-SAM) were subcloned into the pcDNA3 (Invitrogen) expression vector. |
T26201 |
3913-3916 |
IN |
denotes |
For |
T26203 |
3917-3936 |
NN |
denotes |
immunoprecipitation |
T26204 |
3937-3942 |
NN |
denotes |
assay |
T26205 |
3942-3944 |
, |
denotes |
, |
T26206 |
3944-3945 |
CD |
denotes |
4 |
T26208 |
3945-3946 |
SYM |
denotes |
× |
T26207 |
3947-3960 |
NN |
denotes |
hemagglutinin |
T26210 |
3961-3962 |
-LRB- |
denotes |
( |
T26211 |
3962-3964 |
NN |
denotes |
HA |
T26212 |
3964-3965 |
-RRB- |
denotes |
) |
T26213 |
3966-3968 |
CC |
denotes |
or |
T26214 |
3969-3970 |
CD |
denotes |
3 |
T26216 |
3970-3971 |
SYM |
denotes |
× |
T26215 |
3972-3976 |
NN |
denotes |
Flag |
T26209 |
3977-3983 |
VBN |
denotes |
tagged |
T26218 |
3984-3988 |
NN |
denotes |
cDNA |
T26217 |
3989-3997 |
NN |
denotes |
fragment |
T26219 |
3998-4006 |
VBG |
denotes |
encoding |
T26220 |
4007-4011 |
JJ |
denotes |
full |
T26222 |
4011-4012 |
HYPH |
denotes |
- |
T26221 |
4012-4018 |
NN |
denotes |
length |
T26224 |
4019-4021 |
NN |
denotes |
mr |
T26225 |
4021-4022 |
HYPH |
denotes |
- |
T26223 |
4022-4023 |
NN |
denotes |
s |
T26226 |
4024-4025 |
-LRB- |
denotes |
( |
T26228 |
4025-4029 |
JJ |
denotes |
full |
T26229 |
4029-4030 |
HYPH |
denotes |
- |
T26227 |
4030-4032 |
NN |
denotes |
HA |
T26230 |
4033-4036 |
CC |
denotes |
and |
T26231 |
4037-4041 |
NN |
denotes |
Flag |
T26233 |
4041-4042 |
HYPH |
denotes |
- |
T26232 |
4042-4045 |
NN |
denotes |
mrs |
T26234 |
4045-4046 |
-RRB- |
denotes |
) |
T26235 |
4046-4048 |
, |
denotes |
, |
T26236 |
4048-4049 |
DT |
denotes |
a |
T26238 |
4050-4054 |
NN |
denotes |
cDNA |
T26237 |
4055-4063 |
NN |
denotes |
fragment |
T26239 |
4064-4072 |
VBG |
denotes |
encoding |
T26240 |
4073-4078 |
NN |
denotes |
amino |
T26242 |
4079-4084 |
NNS |
denotes |
acids |
T26241 |
4085-4086 |
CD |
denotes |
1 |
T26243 |
4086-4087 |
SYM |
denotes |
– |
T26244 |
4087-4090 |
CD |
denotes |
400 |
T26245 |
4091-4092 |
-LRB- |
denotes |
( |
T26247 |
4092-4096 |
NN |
denotes |
ΔSAM |
T26248 |
4096-4097 |
HYPH |
denotes |
- |
T26246 |
4097-4099 |
NN |
denotes |
HA |
T26249 |
4100-4103 |
CC |
denotes |
and |
T26250 |
4104-4108 |
NN |
denotes |
Flag |
T26252 |
4108-4109 |
HYPH |
denotes |
- |
T26251 |
4109-4113 |
NN |
denotes |
ΔSAM |
T26253 |
4113-4114 |
-RRB- |
denotes |
) |
T26254 |
4114-4116 |
, |
denotes |
, |
T26255 |
4116-4119 |
CC |
denotes |
and |
T26256 |
4120-4121 |
DT |
denotes |
a |
T26258 |
4122-4126 |
NN |
denotes |
cDNA |
T26257 |
4127-4135 |
NN |
denotes |
fragment |
T26259 |
4136-4144 |
VBG |
denotes |
encoding |
T26260 |
4145-4150 |
NN |
denotes |
amino |
T26262 |
4151-4156 |
NNS |
denotes |
acids |
T26261 |
4157-4160 |
CD |
denotes |
400 |
T26263 |
4160-4161 |
SYM |
denotes |
– |
T26264 |
4161-4164 |
CD |
denotes |
542 |
T26265 |
4165-4166 |
-LRB- |
denotes |
( |
T26267 |
4166-4170 |
NN |
denotes |
Flag |
T26268 |
4170-4171 |
HYPH |
denotes |
- |
T26266 |
4171-4174 |
NN |
denotes |
SAM |
T26269 |
4174-4175 |
-RRB- |
denotes |
) |
T26270 |
4176-4180 |
VBD |
denotes |
were |
T26202 |
4181-4190 |
VBN |
denotes |
subcloned |
T26271 |
4191-4195 |
IN |
denotes |
into |
T26272 |
4196-4199 |
DT |
denotes |
the |
T26274 |
4200-4206 |
NN |
denotes |
pcDNA3 |
T26275 |
4207-4208 |
-LRB- |
denotes |
( |
T26276 |
4208-4218 |
NNP |
denotes |
Invitrogen |
T26277 |
4218-4219 |
-RRB- |
denotes |
) |
T26278 |
4220-4230 |
NN |
denotes |
expression |
T26273 |
4231-4237 |
NN |
denotes |
vector |
T26279 |
4237-4238 |
. |
denotes |
. |
T26280 |
4238-4323 |
sentence |
denotes |
We also constructed two site-directed mutants, Flag-W404A and Flag-G453A, using PCR. |
T26281 |
4239-4241 |
PRP |
denotes |
We |
T26283 |
4242-4246 |
RB |
denotes |
also |
T26282 |
4247-4258 |
VBD |
denotes |
constructed |
T26284 |
4259-4262 |
CD |
denotes |
two |
T26286 |
4263-4267 |
NN |
denotes |
site |
T26288 |
4267-4268 |
HYPH |
denotes |
- |
T26287 |
4268-4276 |
VBN |
denotes |
directed |
T26285 |
4277-4284 |
NNS |
denotes |
mutants |
T26289 |
4284-4286 |
, |
denotes |
, |
T26290 |
4286-4290 |
NN |
denotes |
Flag |
T26292 |
4290-4291 |
HYPH |
denotes |
- |
T26291 |
4291-4296 |
NN |
denotes |
W404A |
T26293 |
4297-4300 |
CC |
denotes |
and |
T26294 |
4301-4305 |
NN |
denotes |
Flag |
T26296 |
4305-4306 |
HYPH |
denotes |
- |
T26295 |
4306-4311 |
NN |
denotes |
G453A |
T26297 |
4311-4313 |
, |
denotes |
, |
T26298 |
4313-4318 |
VBG |
denotes |
using |
T26299 |
4319-4322 |
NN |
denotes |
PCR |
T26300 |
4322-4323 |
. |
denotes |
. |
T26301 |
4323-4383 |
sentence |
denotes |
Each of these mutations was also introduced into Flag-mr-s. |
T26302 |
4324-4328 |
DT |
denotes |
Each |
T26304 |
4329-4331 |
IN |
denotes |
of |
T26305 |
4332-4337 |
DT |
denotes |
these |
T26306 |
4338-4347 |
NNS |
denotes |
mutations |
T26307 |
4348-4351 |
VBD |
denotes |
was |
T26308 |
4352-4356 |
RB |
denotes |
also |
T26303 |
4357-4367 |
VBN |
denotes |
introduced |
T26309 |
4368-4372 |
IN |
denotes |
into |
T26310 |
4373-4377 |
NN |
denotes |
Flag |
T26311 |
4377-4378 |
HYPH |
denotes |
- |
T26312 |
4378-4380 |
NN |
denotes |
mr |
T26314 |
4380-4381 |
HYPH |
denotes |
- |
T26313 |
4381-4382 |
NN |
denotes |
s |
T26315 |
4382-4383 |
. |
denotes |
. |
T26316 |
4383-4480 |
sentence |
denotes |
We transfected HEK293T cells with 5 μg of plasmid DNA per 6 cm dish by calcium phosphate method. |
T26317 |
4384-4386 |
PRP |
denotes |
We |
T26318 |
4387-4398 |
VBD |
denotes |
transfected |
T26319 |
4399-4406 |
NN |
denotes |
HEK293T |
T26320 |
4407-4412 |
NNS |
denotes |
cells |
T26321 |
4413-4417 |
IN |
denotes |
with |
T26322 |
4418-4419 |
CD |
denotes |
5 |
T26323 |
4420-4422 |
NN |
denotes |
μg |
T26324 |
4423-4425 |
IN |
denotes |
of |
T26325 |
4426-4433 |
NN |
denotes |
plasmid |
T26326 |
4434-4437 |
NN |
denotes |
DNA |
T26327 |
4438-4441 |
IN |
denotes |
per |
T26328 |
4442-4443 |
CD |
denotes |
6 |
T26329 |
4444-4446 |
NN |
denotes |
cm |
T26330 |
4447-4451 |
NN |
denotes |
dish |
T26331 |
4452-4454 |
IN |
denotes |
by |
T26332 |
4455-4462 |
NN |
denotes |
calcium |
T26333 |
4463-4472 |
NN |
denotes |
phosphate |
T26334 |
4473-4479 |
NN |
denotes |
method |
T26335 |
4479-4480 |
. |
denotes |
. |
T26336 |
4480-4771 |
sentence |
denotes |
Approximately 48 hr after transfection, cells were harvested in immunoprecipitation buffer (50 mM Tris-HCl [pH 7.5], 1 mM EDTA, 2 mM MgCl2, 150 mM NaCl, 1 mM phenylmethylsulfonyl fluoride [Wako], 1% Nonidet P-40, 10% glycerol) in the presence of protease inhibitor cocktail tablets (Roche). |
T26337 |
4481-4494 |
RB |
denotes |
Approximately |
T26338 |
4495-4497 |
CD |
denotes |
48 |
T26339 |
4498-4500 |
NN |
denotes |
hr |
T26340 |
4501-4506 |
IN |
denotes |
after |
T26342 |
4507-4519 |
NN |
denotes |
transfection |
T26343 |
4519-4521 |
, |
denotes |
, |
T26344 |
4521-4526 |
NNS |
denotes |
cells |
T26345 |
4527-4531 |
VBD |
denotes |
were |
T26341 |
4532-4541 |
VBN |
denotes |
harvested |
T26346 |
4542-4544 |
IN |
denotes |
in |
T26347 |
4545-4564 |
NN |
denotes |
immunoprecipitation |
T26348 |
4565-4571 |
NN |
denotes |
buffer |
T26349 |
4572-4573 |
-LRB- |
denotes |
( |
T26351 |
4573-4575 |
CD |
denotes |
50 |
T26352 |
4576-4578 |
NN |
denotes |
mM |
T26353 |
4579-4583 |
NN |
denotes |
Tris |
T26354 |
4583-4584 |
HYPH |
denotes |
- |
T26350 |
4584-4587 |
NN |
denotes |
HCl |
T26355 |
4588-4589 |
-LRB- |
denotes |
[ |
T26356 |
4589-4591 |
NN |
denotes |
pH |
T26357 |
4592-4595 |
CD |
denotes |
7.5 |
T26358 |
4595-4596 |
-RRB- |
denotes |
] |
T26359 |
4596-4598 |
, |
denotes |
, |
T26360 |
4598-4599 |
CD |
denotes |
1 |
T26361 |
4600-4602 |
NN |
denotes |
mM |
T26362 |
4603-4607 |
NN |
denotes |
EDTA |
T26363 |
4607-4609 |
, |
denotes |
, |
T26364 |
4609-4610 |
CD |
denotes |
2 |
T26365 |
4611-4613 |
NN |
denotes |
mM |
T26366 |
4614-4619 |
NN |
denotes |
MgCl2 |
T26367 |
4619-4621 |
, |
denotes |
, |
T26368 |
4621-4624 |
CD |
denotes |
150 |
T26369 |
4625-4627 |
NN |
denotes |
mM |
T26370 |
4628-4632 |
NN |
denotes |
NaCl |
T26371 |
4632-4634 |
, |
denotes |
, |
T26372 |
4634-4635 |
CD |
denotes |
1 |
T26373 |
4636-4638 |
NN |
denotes |
mM |
T26375 |
4639-4659 |
NN |
denotes |
phenylmethylsulfonyl |
T26374 |
4660-4668 |
NN |
denotes |
fluoride |
T26376 |
4669-4670 |
-LRB- |
denotes |
[ |
T26377 |
4670-4674 |
NN |
denotes |
Wako |
T26378 |
4674-4675 |
-RRB- |
denotes |
] |
T26379 |
4675-4677 |
, |
denotes |
, |
T26380 |
4677-4678 |
CD |
denotes |
1 |
T26381 |
4678-4679 |
NN |
denotes |
% |
T26383 |
4680-4687 |
NN |
denotes |
Nonidet |
T26382 |
4688-4689 |
NN |
denotes |
P |
T26384 |
4689-4690 |
HYPH |
denotes |
- |
T26385 |
4690-4692 |
CD |
denotes |
40 |
T26386 |
4692-4694 |
, |
denotes |
, |
T26387 |
4694-4696 |
CD |
denotes |
10 |
T26388 |
4696-4697 |
NN |
denotes |
% |
T26389 |
4698-4706 |
NN |
denotes |
glycerol |
T26390 |
4706-4707 |
-RRB- |
denotes |
) |
T26391 |
4708-4710 |
IN |
denotes |
in |
T26392 |
4711-4714 |
DT |
denotes |
the |
T26393 |
4715-4723 |
NN |
denotes |
presence |
T26394 |
4724-4726 |
IN |
denotes |
of |
T26395 |
4727-4735 |
NN |
denotes |
protease |
T26396 |
4736-4745 |
NN |
denotes |
inhibitor |
T26398 |
4746-4754 |
NN |
denotes |
cocktail |
T26397 |
4755-4762 |
NNS |
denotes |
tablets |
T26399 |
4763-4764 |
-LRB- |
denotes |
( |
T26400 |
4764-4769 |
NNP |
denotes |
Roche |
T26401 |
4769-4770 |
-RRB- |
denotes |
) |
T26402 |
4770-4771 |
. |
denotes |
. |
T26403 |
4771-4951 |
sentence |
denotes |
For each reaction, 1 mg of cell lysate was mixed with 0.5 μg of anti-Flag antibody (SIGMA, F3165) and 15 μl of protein G-Sepharose (Amersham) on a rotating wheel at 4°C for 2 hrs. |
T26404 |
4772-4775 |
IN |
denotes |
For |
T26406 |
4776-4780 |
DT |
denotes |
each |
T26407 |
4781-4789 |
NN |
denotes |
reaction |
T26408 |
4789-4791 |
, |
denotes |
, |
T26409 |
4791-4792 |
CD |
denotes |
1 |
T26410 |
4793-4795 |
NN |
denotes |
mg |
T26411 |
4796-4798 |
IN |
denotes |
of |
T26412 |
4799-4803 |
NN |
denotes |
cell |
T26413 |
4804-4810 |
NN |
denotes |
lysate |
T26414 |
4811-4814 |
VBD |
denotes |
was |
T26405 |
4815-4820 |
VBN |
denotes |
mixed |
T26415 |
4821-4825 |
IN |
denotes |
with |
T26416 |
4826-4829 |
CD |
denotes |
0.5 |
T26417 |
4830-4832 |
NN |
denotes |
μg |
T26418 |
4833-4835 |
IN |
denotes |
of |
T26419 |
4836-4845 |
JJ |
denotes |
anti-Flag |
T26420 |
4846-4854 |
NN |
denotes |
antibody |
T26421 |
4855-4856 |
-LRB- |
denotes |
( |
T26423 |
4856-4861 |
NNP |
denotes |
SIGMA |
T26424 |
4861-4863 |
, |
denotes |
, |
T26422 |
4863-4868 |
NN |
denotes |
F3165 |
T26425 |
4868-4869 |
-RRB- |
denotes |
) |
T26426 |
4870-4873 |
CC |
denotes |
and |
T26427 |
4874-4876 |
CD |
denotes |
15 |
T26428 |
4877-4879 |
NN |
denotes |
μl |
T26429 |
4880-4882 |
IN |
denotes |
of |
T26430 |
4883-4890 |
NN |
denotes |
protein |
T26432 |
4891-4892 |
NN |
denotes |
G |
T26433 |
4892-4893 |
HYPH |
denotes |
- |
T26431 |
4893-4902 |
NN |
denotes |
Sepharose |
T26434 |
4903-4904 |
-LRB- |
denotes |
( |
T26435 |
4904-4912 |
NNP |
denotes |
Amersham |
T26436 |
4912-4913 |
-RRB- |
denotes |
) |
T26437 |
4914-4916 |
IN |
denotes |
on |
T26438 |
4917-4918 |
DT |
denotes |
a |
T26440 |
4919-4927 |
VBG |
denotes |
rotating |
T26439 |
4928-4933 |
NN |
denotes |
wheel |
T26441 |
4934-4936 |
IN |
denotes |
at |
T26442 |
4937-4938 |
CD |
denotes |
4 |
T26443 |
4938-4940 |
NN |
denotes |
°C |
T26444 |
4941-4944 |
IN |
denotes |
for |
T26445 |
4945-4946 |
CD |
denotes |
2 |
T26446 |
4947-4950 |
NNS |
denotes |
hrs |
T26447 |
4950-4951 |
. |
denotes |
. |
T26448 |
4951-5030 |
sentence |
denotes |
Protein concentration was determined by the BCA protein assay system (Pierce). |
T26449 |
4952-4959 |
NN |
denotes |
Protein |
T26450 |
4960-4973 |
NN |
denotes |
concentration |
T26452 |
4974-4977 |
VBD |
denotes |
was |
T26451 |
4978-4988 |
VBN |
denotes |
determined |
T26453 |
4989-4991 |
IN |
denotes |
by |
T26454 |
4992-4995 |
DT |
denotes |
the |
T26456 |
4996-4999 |
NN |
denotes |
BCA |
T26458 |
5000-5007 |
NN |
denotes |
protein |
T26457 |
5008-5013 |
NN |
denotes |
assay |
T26455 |
5014-5020 |
NN |
denotes |
system |
T26459 |
5021-5022 |
-LRB- |
denotes |
( |
T26460 |
5022-5028 |
NNP |
denotes |
Pierce |
T26461 |
5028-5029 |
-RRB- |
denotes |
) |
T26462 |
5029-5030 |
. |
denotes |
. |
T26463 |
5030-5199 |
sentence |
denotes |
The beads were then washed three times with immunoprecipitation buffer and followed by three times with wash buffer (50 mM Tris-HCl [pH 7.5], 150 mM NaCl, 20 mM MgCl2). |
T26464 |
5031-5034 |
DT |
denotes |
The |
T26465 |
5035-5040 |
NNS |
denotes |
beads |
T26467 |
5041-5045 |
VBD |
denotes |
were |
T26468 |
5046-5050 |
RB |
denotes |
then |
T26466 |
5051-5057 |
VBN |
denotes |
washed |
T26469 |
5058-5063 |
CD |
denotes |
three |
T26470 |
5064-5069 |
NNS |
denotes |
times |
T26471 |
5070-5074 |
IN |
denotes |
with |
T26472 |
5075-5094 |
NN |
denotes |
immunoprecipitation |
T26473 |
5095-5101 |
NN |
denotes |
buffer |
T26474 |
5102-5105 |
CC |
denotes |
and |
T26475 |
5106-5114 |
VBN |
denotes |
followed |
T26476 |
5115-5117 |
IN |
denotes |
by |
T26477 |
5118-5123 |
CD |
denotes |
three |
T26478 |
5124-5129 |
NNS |
denotes |
times |
T26479 |
5130-5134 |
IN |
denotes |
with |
T26480 |
5135-5139 |
NN |
denotes |
wash |
T26481 |
5140-5146 |
NN |
denotes |
buffer |
T26482 |
5147-5148 |
-LRB- |
denotes |
( |
T26484 |
5148-5150 |
CD |
denotes |
50 |
T26485 |
5151-5153 |
NN |
denotes |
mM |
T26486 |
5154-5158 |
NN |
denotes |
Tris |
T26487 |
5158-5159 |
HYPH |
denotes |
- |
T26483 |
5159-5162 |
NN |
denotes |
HCl |
T26488 |
5163-5164 |
-LRB- |
denotes |
[ |
T26489 |
5164-5166 |
NN |
denotes |
pH |
T26490 |
5167-5170 |
CD |
denotes |
7.5 |
T26491 |
5170-5171 |
-RRB- |
denotes |
] |
T26492 |
5171-5173 |
, |
denotes |
, |
T26493 |
5173-5176 |
CD |
denotes |
150 |
T26494 |
5177-5179 |
NN |
denotes |
mM |
T26495 |
5180-5184 |
NN |
denotes |
NaCl |
T26496 |
5184-5186 |
, |
denotes |
, |
T26497 |
5186-5188 |
CD |
denotes |
20 |
T26498 |
5189-5191 |
NN |
denotes |
mM |
T26499 |
5192-5197 |
NN |
denotes |
MgCl2 |
T26500 |
5197-5198 |
-RRB- |
denotes |
) |
T26501 |
5198-5199 |
. |
denotes |
. |
T26502 |
5199-5328 |
sentence |
denotes |
Proteins were then boiled for 5 min in SDS sample buffer (1% SDS, 1 mM Tris [pH 6.8], 40 mM DTT, 4% glycerol, 0.01% pyronine Y). |
T26503 |
5200-5208 |
NNS |
denotes |
Proteins |
T26505 |
5209-5213 |
VBD |
denotes |
were |
T26506 |
5214-5218 |
RB |
denotes |
then |
T26504 |
5219-5225 |
VBN |
denotes |
boiled |
T26507 |
5226-5229 |
IN |
denotes |
for |
T26508 |
5230-5231 |
CD |
denotes |
5 |
T26509 |
5232-5235 |
NN |
denotes |
min |
T26510 |
5236-5238 |
IN |
denotes |
in |
T26511 |
5239-5242 |
NN |
denotes |
SDS |
T26513 |
5243-5249 |
NN |
denotes |
sample |
T26512 |
5250-5256 |
NN |
denotes |
buffer |
T26514 |
5257-5258 |
-LRB- |
denotes |
( |
T26516 |
5258-5259 |
CD |
denotes |
1 |
T26517 |
5259-5260 |
NN |
denotes |
% |
T26515 |
5261-5264 |
NN |
denotes |
SDS |
T26518 |
5264-5266 |
, |
denotes |
, |
T26519 |
5266-5267 |
CD |
denotes |
1 |
T26520 |
5268-5270 |
NN |
denotes |
mM |
T26521 |
5271-5275 |
NN |
denotes |
Tris |
T26522 |
5276-5277 |
-LRB- |
denotes |
[ |
T26523 |
5277-5279 |
NN |
denotes |
pH |
T26524 |
5280-5283 |
CD |
denotes |
6.8 |
T26525 |
5283-5284 |
-RRB- |
denotes |
] |
T26526 |
5284-5286 |
, |
denotes |
, |
T26527 |
5286-5288 |
CD |
denotes |
40 |
T26528 |
5289-5291 |
NN |
denotes |
mM |
T26529 |
5292-5295 |
NN |
denotes |
DTT |
T26530 |
5295-5297 |
, |
denotes |
, |
T26531 |
5297-5298 |
CD |
denotes |
4 |
T26532 |
5298-5299 |
NN |
denotes |
% |
T26533 |
5300-5308 |
NN |
denotes |
glycerol |
T26534 |
5308-5310 |
, |
denotes |
, |
T26535 |
5310-5314 |
CD |
denotes |
0.01 |
T26536 |
5314-5315 |
NN |
denotes |
% |
T26538 |
5316-5324 |
NN |
denotes |
pyronine |
T26537 |
5325-5326 |
NN |
denotes |
Y |
T26539 |
5326-5327 |
-RRB- |
denotes |
) |
T26540 |
5327-5328 |
. |
denotes |
. |
T26541 |
5328-5521 |
sentence |
denotes |
The supernatants were fractionated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to the nitrocellulose membrane (Trans-Blot Transfer Medium, Bio-Rad). |
T26542 |
5329-5332 |
DT |
denotes |
The |
T26543 |
5333-5345 |
NNS |
denotes |
supernatants |
T26545 |
5346-5350 |
VBD |
denotes |
were |
T26544 |
5351-5363 |
VBN |
denotes |
fractionated |
T26546 |
5364-5366 |
IN |
denotes |
by |
T26547 |
5367-5373 |
NN |
denotes |
sodium |
T26549 |
5374-5381 |
NN |
denotes |
dodecyl |
T26548 |
5382-5389 |
NN |
denotes |
sulfate |
T26551 |
5389-5390 |
HYPH |
denotes |
- |
T26552 |
5390-5404 |
NN |
denotes |
polyacrylamide |
T26550 |
5405-5408 |
NN |
denotes |
gel |
T26553 |
5409-5424 |
NN |
denotes |
electrophoresis |
T26554 |
5425-5426 |
-LRB- |
denotes |
( |
T26556 |
5426-5429 |
NN |
denotes |
SDS |
T26557 |
5429-5430 |
HYPH |
denotes |
- |
T26555 |
5430-5434 |
NN |
denotes |
PAGE |
T26558 |
5434-5435 |
-RRB- |
denotes |
) |
T26559 |
5436-5439 |
CC |
denotes |
and |
T26560 |
5440-5451 |
VBN |
denotes |
transferred |
T26561 |
5452-5454 |
IN |
denotes |
to |
T26562 |
5455-5458 |
DT |
denotes |
the |
T26564 |
5459-5473 |
NN |
denotes |
nitrocellulose |
T26563 |
5474-5482 |
NN |
denotes |
membrane |
T26565 |
5483-5484 |
-LRB- |
denotes |
( |
T26567 |
5484-5489 |
NN |
denotes |
Trans |
T26569 |
5489-5490 |
HYPH |
denotes |
- |
T26568 |
5490-5494 |
NN |
denotes |
Blot |
T26570 |
5495-5503 |
NN |
denotes |
Transfer |
T26566 |
5504-5510 |
NN |
denotes |
Medium |
T26571 |
5510-5512 |
, |
denotes |
, |
T26572 |
5512-5515 |
NNP |
denotes |
Bio |
T26574 |
5515-5516 |
HYPH |
denotes |
- |
T26573 |
5516-5519 |
NNP |
denotes |
Rad |
T26575 |
5519-5520 |
-RRB- |
denotes |
) |
T26576 |
5520-5521 |
. |
denotes |
. |
T26577 |
5521-5615 |
sentence |
denotes |
Western blotting was performed with rabbit polyclonal anti-HA antibody (Santa Cruz, #sc-805). |
T26578 |
5522-5529 |
NNP |
denotes |
Western |
T26579 |
5530-5538 |
NN |
denotes |
blotting |
T26581 |
5539-5542 |
VBD |
denotes |
was |
T26580 |
5543-5552 |
VBN |
denotes |
performed |
T26582 |
5553-5557 |
IN |
denotes |
with |
T26583 |
5558-5564 |
NN |
denotes |
rabbit |
T26585 |
5565-5575 |
JJ |
denotes |
polyclonal |
T26586 |
5576-5583 |
JJ |
denotes |
anti-HA |
T26584 |
5584-5592 |
NN |
denotes |
antibody |
T26587 |
5593-5594 |
-LRB- |
denotes |
( |
T26589 |
5594-5599 |
NNP |
denotes |
Santa |
T26588 |
5600-5604 |
NNP |
denotes |
Cruz |
T26590 |
5604-5606 |
, |
denotes |
, |
T26591 |
5606-5607 |
SYM |
denotes |
# |
T26592 |
5607-5609 |
NN |
denotes |
sc |
T26593 |
5609-5610 |
HYPH |
denotes |
- |
T26594 |
5610-5613 |
CD |
denotes |
805 |
T26595 |
5613-5614 |
-RRB- |
denotes |
) |
T26596 |
5614-5615 |
. |
denotes |
. |
T26597 |
5615-5757 |
sentence |
denotes |
Signals were detected with horseradish peroxidase- conjugated goat anti-rabbit IgG and ECL plus Western Blotting Detection System (Amersham). |
T26598 |
5616-5623 |
NNS |
denotes |
Signals |
T26600 |
5624-5628 |
VBD |
denotes |
were |
T26599 |
5629-5637 |
VBN |
denotes |
detected |
T26601 |
5638-5642 |
IN |
denotes |
with |
T26602 |
5643-5654 |
NN |
denotes |
horseradish |
T26603 |
5655-5665 |
NN |
denotes |
peroxidase |
T26605 |
5665-5666 |
HYPH |
denotes |
- |
T26604 |
5667-5677 |
VBN |
denotes |
conjugated |
T26607 |
5678-5682 |
NN |
denotes |
goat |
T26608 |
5683-5694 |
JJ |
denotes |
anti-rabbit |
T26606 |
5695-5698 |
NN |
denotes |
IgG |
T26609 |
5699-5702 |
CC |
denotes |
and |
T26610 |
5703-5706 |
NN |
denotes |
ECL |
T26612 |
5707-5711 |
CC |
denotes |
plus |
T26613 |
5712-5719 |
NNP |
denotes |
Western |
T26614 |
5720-5728 |
NN |
denotes |
Blotting |
T26615 |
5729-5738 |
NN |
denotes |
Detection |
T26611 |
5739-5745 |
NN |
denotes |
System |
T26616 |
5746-5747 |
-LRB- |
denotes |
( |
T26617 |
5747-5755 |
NNP |
denotes |
Amersham |
T26618 |
5755-5756 |
-RRB- |
denotes |
) |
T26619 |
5756-5757 |
. |
denotes |
. |
T27028 |
5759-5770 |
JJ |
denotes |
Subcellular |
T27030 |
5771-5783 |
NN |
denotes |
localization |
T27029 |
5784-5792 |
NN |
denotes |
analysis |
T27031 |
5792-6068 |
sentence |
denotes |
We transfected the plasmid encoding HA-tagged full-length mr-s into HEK293T cells, seeded cells on coverslips coated with collagen 48 hr after transfection, fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS) at room temperature for 20 min, and washed with PBS. |
T27032 |
5793-5795 |
PRP |
denotes |
We |
T27033 |
5796-5807 |
VBD |
denotes |
transfected |
T27034 |
5808-5811 |
DT |
denotes |
the |
T27035 |
5812-5819 |
NN |
denotes |
plasmid |
T27036 |
5820-5828 |
VBG |
denotes |
encoding |
T27037 |
5829-5831 |
NN |
denotes |
HA |
T27039 |
5831-5832 |
HYPH |
denotes |
- |
T27038 |
5832-5838 |
VBN |
denotes |
tagged |
T27041 |
5839-5843 |
JJ |
denotes |
full |
T27043 |
5843-5844 |
HYPH |
denotes |
- |
T27042 |
5844-5850 |
NN |
denotes |
length |
T27044 |
5851-5853 |
NN |
denotes |
mr |
T27045 |
5853-5854 |
HYPH |
denotes |
- |
T27040 |
5854-5855 |
NN |
denotes |
s |
T27046 |
5856-5860 |
IN |
denotes |
into |
T27047 |
5861-5868 |
NN |
denotes |
HEK293T |
T27048 |
5869-5874 |
NNS |
denotes |
cells |
T27049 |
5874-5876 |
, |
denotes |
, |
T27050 |
5876-5882 |
VBD |
denotes |
seeded |
T27051 |
5883-5888 |
NNS |
denotes |
cells |
T27052 |
5889-5891 |
IN |
denotes |
on |
T27053 |
5892-5902 |
NNS |
denotes |
coverslips |
T27054 |
5903-5909 |
VBN |
denotes |
coated |
T27055 |
5910-5914 |
IN |
denotes |
with |
T27056 |
5915-5923 |
NN |
denotes |
collagen |
T27057 |
5924-5926 |
CD |
denotes |
48 |
T27058 |
5927-5929 |
NN |
denotes |
hr |
T27059 |
5930-5935 |
IN |
denotes |
after |
T27060 |
5936-5948 |
NN |
denotes |
transfection |
T27061 |
5948-5950 |
, |
denotes |
, |
T27062 |
5950-5955 |
VBN |
denotes |
fixed |
T27063 |
5956-5960 |
IN |
denotes |
with |
T27064 |
5961-5962 |
CD |
denotes |
4 |
T27065 |
5962-5963 |
NN |
denotes |
% |
T27066 |
5964-5980 |
NN |
denotes |
paraformaldehyde |
T27067 |
5981-5983 |
IN |
denotes |
in |
T27068 |
5984-5993 |
NN |
denotes |
phosphate |
T27070 |
5993-5994 |
HYPH |
denotes |
- |
T27069 |
5994-6002 |
VBN |
denotes |
buffered |
T27071 |
6003-6009 |
NN |
denotes |
saline |
T27072 |
6010-6011 |
-LRB- |
denotes |
( |
T27073 |
6011-6014 |
NN |
denotes |
PBS |
T27074 |
6014-6015 |
-RRB- |
denotes |
) |
T27075 |
6016-6018 |
IN |
denotes |
at |
T27076 |
6019-6023 |
NN |
denotes |
room |
T27077 |
6024-6035 |
NN |
denotes |
temperature |
T27078 |
6036-6039 |
IN |
denotes |
for |
T27079 |
6040-6042 |
CD |
denotes |
20 |
T27080 |
6043-6046 |
NN |
denotes |
min |
T27081 |
6046-6048 |
, |
denotes |
, |
T27082 |
6048-6051 |
CC |
denotes |
and |
T27083 |
6052-6058 |
VBN |
denotes |
washed |
T27084 |
6059-6063 |
IN |
denotes |
with |
T27085 |
6064-6067 |
NN |
denotes |
PBS |
T27086 |
6067-6068 |
. |
denotes |
. |
T27087 |
6068-6263 |
sentence |
denotes |
Then we permeabilized cells in PBS containing 0.1% Triton X-100 for 15 min, washed again with PBS, and incubated in PBS containing 0.1% bovine serum albumin (BSA) for 30 min at room temperature. |
T27088 |
6069-6073 |
RB |
denotes |
Then |
T27090 |
6074-6076 |
PRP |
denotes |
we |
T27089 |
6077-6090 |
VBD |
denotes |
permeabilized |
T27091 |
6091-6096 |
NNS |
denotes |
cells |
T27092 |
6097-6099 |
IN |
denotes |
in |
T27093 |
6100-6103 |
NN |
denotes |
PBS |
T27094 |
6104-6114 |
VBG |
denotes |
containing |
T27095 |
6115-6118 |
CD |
denotes |
0.1 |
T27096 |
6118-6119 |
NN |
denotes |
% |
T27098 |
6120-6126 |
NN |
denotes |
Triton |
T27099 |
6127-6128 |
NN |
denotes |
X |
T27100 |
6128-6129 |
HYPH |
denotes |
- |
T27097 |
6129-6132 |
NN |
denotes |
100 |
T27101 |
6133-6136 |
IN |
denotes |
for |
T27102 |
6137-6139 |
CD |
denotes |
15 |
T27103 |
6140-6143 |
NN |
denotes |
min |
T27104 |
6143-6145 |
, |
denotes |
, |
T27105 |
6145-6151 |
VBD |
denotes |
washed |
T27106 |
6152-6157 |
RB |
denotes |
again |
T27107 |
6158-6162 |
IN |
denotes |
with |
T27108 |
6163-6166 |
NN |
denotes |
PBS |
T27109 |
6166-6168 |
, |
denotes |
, |
T27110 |
6168-6171 |
CC |
denotes |
and |
T27111 |
6172-6181 |
VBD |
denotes |
incubated |
T27112 |
6182-6184 |
IN |
denotes |
in |
T27113 |
6185-6188 |
NN |
denotes |
PBS |
T27114 |
6189-6199 |
VBG |
denotes |
containing |
T27115 |
6200-6203 |
CD |
denotes |
0.1 |
T27116 |
6203-6204 |
NN |
denotes |
% |
T27117 |
6205-6211 |
JJ |
denotes |
bovine |
T27119 |
6212-6217 |
NN |
denotes |
serum |
T27118 |
6218-6225 |
NN |
denotes |
albumin |
T27120 |
6226-6227 |
-LRB- |
denotes |
( |
T27121 |
6227-6230 |
NN |
denotes |
BSA |
T27122 |
6230-6231 |
-RRB- |
denotes |
) |
T27123 |
6232-6235 |
IN |
denotes |
for |
T27124 |
6236-6238 |
CD |
denotes |
30 |
T27125 |
6239-6242 |
NN |
denotes |
min |
T27126 |
6243-6245 |
IN |
denotes |
at |
T27127 |
6246-6250 |
NN |
denotes |
room |
T27128 |
6251-6262 |
NN |
denotes |
temperature |
T27129 |
6262-6263 |
. |
denotes |
. |
T27130 |
6263-6357 |
sentence |
denotes |
We incubated cells with anti-HA antibody overnight at 4°C (1:200 in PBS containing 0.2% BSA). |
T27131 |
6264-6266 |
PRP |
denotes |
We |
T27132 |
6267-6276 |
VBD |
denotes |
incubated |
T27133 |
6277-6282 |
NNS |
denotes |
cells |
T27134 |
6283-6287 |
IN |
denotes |
with |
T27135 |
6288-6295 |
JJ |
denotes |
anti-HA |
T27136 |
6296-6304 |
NN |
denotes |
antibody |
T27137 |
6305-6314 |
RB |
denotes |
overnight |
T27138 |
6315-6317 |
IN |
denotes |
at |
T27139 |
6318-6319 |
CD |
denotes |
4 |
T27140 |
6319-6321 |
NN |
denotes |
°C |
T27141 |
6322-6323 |
-LRB- |
denotes |
( |
T27142 |
6323-6324 |
CD |
denotes |
1 |
T27143 |
6324-6325 |
SYM |
denotes |
: |
T27144 |
6325-6328 |
CD |
denotes |
200 |
T27145 |
6329-6331 |
IN |
denotes |
in |
T27146 |
6332-6335 |
NN |
denotes |
PBS |
T27147 |
6336-6346 |
VBG |
denotes |
containing |
T27148 |
6347-6350 |
CD |
denotes |
0.2 |
T27149 |
6350-6351 |
NN |
denotes |
% |
T27150 |
6352-6355 |
NN |
denotes |
BSA |
T27151 |
6355-6356 |
-RRB- |
denotes |
) |
T27152 |
6356-6357 |
. |
denotes |
. |
T27153 |
6357-6540 |
sentence |
denotes |
The following day, we washed cells three times with PBS and incubated with a Cy3-conjugated goat IgG against rabbit IgG (1:400 in PBS, Jackson ImmunoReseach Laboratories) for 30 min. |
T27154 |
6358-6361 |
DT |
denotes |
The |
T27156 |
6362-6371 |
VBG |
denotes |
following |
T27155 |
6372-6375 |
NN |
denotes |
day |
T27158 |
6375-6377 |
, |
denotes |
, |
T27159 |
6377-6379 |
PRP |
denotes |
we |
T27157 |
6380-6386 |
VBD |
denotes |
washed |
T27160 |
6387-6392 |
NNS |
denotes |
cells |
T27161 |
6393-6398 |
CD |
denotes |
three |
T27162 |
6399-6404 |
NNS |
denotes |
times |
T27163 |
6405-6409 |
IN |
denotes |
with |
T27164 |
6410-6413 |
NN |
denotes |
PBS |
T27165 |
6414-6417 |
CC |
denotes |
and |
T27166 |
6418-6427 |
VBD |
denotes |
incubated |
T27167 |
6428-6432 |
IN |
denotes |
with |
T27168 |
6433-6434 |
DT |
denotes |
a |
T27170 |
6435-6438 |
NN |
denotes |
Cy3 |
T27172 |
6438-6439 |
HYPH |
denotes |
- |
T27171 |
6439-6449 |
VBN |
denotes |
conjugated |
T27173 |
6450-6454 |
NN |
denotes |
goat |
T27169 |
6455-6458 |
NN |
denotes |
IgG |
T27174 |
6459-6466 |
IN |
denotes |
against |
T27175 |
6467-6473 |
NN |
denotes |
rabbit |
T27176 |
6474-6477 |
NN |
denotes |
IgG |
T27177 |
6478-6479 |
-LRB- |
denotes |
( |
T27179 |
6479-6480 |
CD |
denotes |
1 |
T27180 |
6480-6481 |
SYM |
denotes |
: |
T27181 |
6481-6484 |
CD |
denotes |
400 |
T27182 |
6485-6487 |
IN |
denotes |
in |
T27183 |
6488-6491 |
NN |
denotes |
PBS |
T27184 |
6491-6493 |
, |
denotes |
, |
T27185 |
6493-6500 |
NNP |
denotes |
Jackson |
T27186 |
6501-6514 |
NNP |
denotes |
ImmunoReseach |
T27178 |
6515-6527 |
NNP |
denotes |
Laboratories |
T27187 |
6527-6528 |
-RRB- |
denotes |
) |
T27188 |
6529-6532 |
IN |
denotes |
for |
T27189 |
6533-6535 |
CD |
denotes |
30 |
T27190 |
6536-6539 |
NN |
denotes |
min |
T27191 |
6539-6540 |
. |
denotes |
. |
T27192 |
6540-6682 |
sentence |
denotes |
We rinsed cells three times with PBS, followed by observation using a confocal microscope FV300 (Olympus) equipped with a 60× objective lens. |
T27193 |
6541-6543 |
PRP |
denotes |
We |
T27194 |
6544-6550 |
VBD |
denotes |
rinsed |
T27195 |
6551-6556 |
NNS |
denotes |
cells |
T27196 |
6557-6562 |
CD |
denotes |
three |
T27197 |
6563-6568 |
NNS |
denotes |
times |
T27198 |
6569-6573 |
IN |
denotes |
with |
T27199 |
6574-6577 |
NN |
denotes |
PBS |
T27200 |
6577-6579 |
, |
denotes |
, |
T27201 |
6579-6587 |
VBN |
denotes |
followed |
T27202 |
6588-6590 |
IN |
denotes |
by |
T27203 |
6591-6602 |
NN |
denotes |
observation |
T27204 |
6603-6608 |
VBG |
denotes |
using |
T27205 |
6609-6610 |
DT |
denotes |
a |
T27207 |
6611-6619 |
JJ |
denotes |
confocal |
T27208 |
6620-6630 |
NN |
denotes |
microscope |
T27206 |
6631-6636 |
NN |
denotes |
FV300 |
T27209 |
6637-6638 |
-LRB- |
denotes |
( |
T27210 |
6638-6645 |
NNP |
denotes |
Olympus |
T27211 |
6645-6646 |
-RRB- |
denotes |
) |
T27212 |
6647-6655 |
VBN |
denotes |
equipped |
T27213 |
6656-6660 |
IN |
denotes |
with |
T27214 |
6661-6662 |
DT |
denotes |
a |
T27216 |
6663-6665 |
CD |
denotes |
60 |
T27217 |
6665-6666 |
SYM |
denotes |
× |
T27218 |
6667-6676 |
NN |
denotes |
objective |
T27215 |
6677-6681 |
NN |
denotes |
lens |
T27219 |
6681-6682 |
. |
denotes |
. |
T27909 |
6684-6694 |
NN |
denotes |
Luciferase |
T27910 |
6695-6700 |
NN |
denotes |
assay |
T27911 |
6700-6925 |
sentence |
denotes |
For transcriptional analysis of the 1.2-kb promoter region of mr-s, we constructed a reporter plasmid (pro1.2k) by subcloning a 1.2-kb upstream genomic fragment of mr-s gene into a pGL3 luciferase reporter plasmid (Promega). |
T27912 |
6701-6704 |
IN |
denotes |
For |
T27914 |
6705-6720 |
JJ |
denotes |
transcriptional |
T27915 |
6721-6729 |
NN |
denotes |
analysis |
T27916 |
6730-6732 |
IN |
denotes |
of |
T27917 |
6733-6736 |
DT |
denotes |
the |
T27919 |
6737-6740 |
CD |
denotes |
1.2 |
T27921 |
6740-6741 |
HYPH |
denotes |
- |
T27920 |
6741-6743 |
NN |
denotes |
kb |
T27922 |
6744-6752 |
NN |
denotes |
promoter |
T27918 |
6753-6759 |
NN |
denotes |
region |
T27923 |
6760-6762 |
IN |
denotes |
of |
T27924 |
6763-6765 |
NN |
denotes |
mr |
T27926 |
6765-6766 |
HYPH |
denotes |
- |
T27925 |
6766-6767 |
NN |
denotes |
s |
T27927 |
6767-6769 |
, |
denotes |
, |
T27928 |
6769-6771 |
PRP |
denotes |
we |
T27913 |
6772-6783 |
VBD |
denotes |
constructed |
T27929 |
6784-6785 |
DT |
denotes |
a |
T27931 |
6786-6794 |
NN |
denotes |
reporter |
T27930 |
6795-6802 |
NN |
denotes |
plasmid |
T27932 |
6803-6804 |
-LRB- |
denotes |
( |
T27933 |
6804-6811 |
NN |
denotes |
pro1.2k |
T27934 |
6811-6812 |
-RRB- |
denotes |
) |
T27935 |
6813-6815 |
IN |
denotes |
by |
T27936 |
6816-6826 |
VBG |
denotes |
subcloning |
T27937 |
6827-6828 |
DT |
denotes |
a |
T27939 |
6829-6832 |
CD |
denotes |
1.2 |
T27941 |
6832-6833 |
HYPH |
denotes |
- |
T27940 |
6833-6835 |
NN |
denotes |
kb |
T27942 |
6836-6844 |
JJ |
denotes |
upstream |
T27943 |
6845-6852 |
JJ |
denotes |
genomic |
T27938 |
6853-6861 |
NN |
denotes |
fragment |
T27944 |
6862-6864 |
IN |
denotes |
of |
T27945 |
6865-6867 |
NN |
denotes |
mr |
T27947 |
6867-6868 |
HYPH |
denotes |
- |
T27946 |
6868-6869 |
NN |
denotes |
s |
T27948 |
6870-6874 |
NN |
denotes |
gene |
T27949 |
6875-6879 |
IN |
denotes |
into |
T27950 |
6880-6881 |
DT |
denotes |
a |
T27952 |
6882-6886 |
NN |
denotes |
pGL3 |
T27954 |
6887-6897 |
NN |
denotes |
luciferase |
T27953 |
6898-6906 |
NN |
denotes |
reporter |
T27951 |
6907-6914 |
NN |
denotes |
plasmid |
T27955 |
6915-6916 |
-LRB- |
denotes |
( |
T27956 |
6916-6923 |
NNP |
denotes |
Promega |
T27957 |
6923-6924 |
-RRB- |
denotes |
) |
T27958 |
6924-6925 |
. |
denotes |
. |
T27959 |
6925-7087 |
sentence |
denotes |
The expression vectors were constructed by subcloning full-length Crx, Otx2, Nrl genes into a pMIK expression vector (a gift from Dr. K. Maruyama), respectively. |
T27960 |
6926-6929 |
DT |
denotes |
The |
T27962 |
6930-6940 |
NN |
denotes |
expression |
T27961 |
6941-6948 |
NNS |
denotes |
vectors |
T27964 |
6949-6953 |
VBD |
denotes |
were |
T27963 |
6954-6965 |
VBN |
denotes |
constructed |
T27965 |
6966-6968 |
IN |
denotes |
by |
T27966 |
6969-6979 |
VBG |
denotes |
subcloning |
T27967 |
6980-6984 |
JJ |
denotes |
full |
T27969 |
6984-6985 |
HYPH |
denotes |
- |
T27968 |
6985-6991 |
NN |
denotes |
length |
T27971 |
6992-6995 |
NN |
denotes |
Crx |
T27973 |
6995-6997 |
, |
denotes |
, |
T27974 |
6997-7001 |
NN |
denotes |
Otx2 |
T27975 |
7001-7003 |
, |
denotes |
, |
T27972 |
7003-7006 |
NN |
denotes |
Nrl |
T27970 |
7007-7012 |
NNS |
denotes |
genes |
T27976 |
7013-7017 |
IN |
denotes |
into |
T27977 |
7018-7019 |
DT |
denotes |
a |
T27979 |
7020-7024 |
NN |
denotes |
pMIK |
T27980 |
7025-7035 |
NN |
denotes |
expression |
T27978 |
7036-7042 |
NN |
denotes |
vector |
T27981 |
7043-7044 |
-LRB- |
denotes |
( |
T27983 |
7044-7045 |
DT |
denotes |
a |
T27982 |
7046-7050 |
NN |
denotes |
gift |
T27984 |
7051-7055 |
IN |
denotes |
from |
T27985 |
7056-7059 |
NNP |
denotes |
Dr. |
T27987 |
7060-7062 |
NNP |
denotes |
K. |
T27986 |
7063-7071 |
NNP |
denotes |
Maruyama |
T27988 |
7071-7072 |
-RRB- |
denotes |
) |
T27989 |
7072-7074 |
, |
denotes |
, |
T27990 |
7074-7086 |
RB |
denotes |
respectively |
T27991 |
7086-7087 |
. |
denotes |
. |
T27992 |
7087-7204 |
sentence |
denotes |
For the "mut1259" vector, the Crx binding site at the -1259 bp position was mutated by replacing GGATTA with AGATCT. |
T27993 |
7088-7091 |
IN |
denotes |
For |
T27995 |
7092-7095 |
DT |
denotes |
the |
T27997 |
7096-7097 |
`` |
denotes |
" |
T27998 |
7097-7104 |
NN |
denotes |
mut1259 |
T27999 |
7104-7105 |
'' |
denotes |
" |
T27996 |
7106-7112 |
NN |
denotes |
vector |
T28000 |
7112-7114 |
, |
denotes |
, |
T28001 |
7114-7117 |
DT |
denotes |
the |
T28003 |
7118-7121 |
NN |
denotes |
Crx |
T28004 |
7122-7129 |
NN |
denotes |
binding |
T28002 |
7130-7134 |
NN |
denotes |
site |
T28005 |
7135-7137 |
IN |
denotes |
at |
T28006 |
7138-7141 |
DT |
denotes |
the |
T28008 |
7142-7143 |
SYM |
denotes |
- |
T28009 |
7143-7147 |
CD |
denotes |
1259 |
T28010 |
7148-7150 |
NN |
denotes |
bp |
T28007 |
7151-7159 |
NN |
denotes |
position |
T28011 |
7160-7163 |
VBD |
denotes |
was |
T27994 |
7164-7171 |
VBN |
denotes |
mutated |
T28012 |
7172-7174 |
IN |
denotes |
by |
T28013 |
7175-7184 |
VBG |
denotes |
replacing |
T28014 |
7185-7191 |
NN |
denotes |
GGATTA |
T28015 |
7192-7196 |
IN |
denotes |
with |
T28016 |
7197-7203 |
NN |
denotes |
AGATCT |
T28017 |
7203-7204 |
. |
denotes |
. |
T28018 |
7204-7319 |
sentence |
denotes |
For the "mut198" vector, the Crx binding site at the -198 bp position was mutated by replacing TAATCC with GAATTC. |
T28019 |
7205-7208 |
IN |
denotes |
For |
T28021 |
7209-7212 |
DT |
denotes |
the |
T28023 |
7213-7214 |
`` |
denotes |
" |
T28024 |
7214-7220 |
NN |
denotes |
mut198 |
T28025 |
7220-7221 |
'' |
denotes |
" |
T28022 |
7222-7228 |
NN |
denotes |
vector |
T28026 |
7228-7230 |
, |
denotes |
, |
T28027 |
7230-7233 |
DT |
denotes |
the |
T28029 |
7234-7237 |
NN |
denotes |
Crx |
T28030 |
7238-7245 |
NN |
denotes |
binding |
T28028 |
7246-7250 |
NN |
denotes |
site |
T28031 |
7251-7253 |
IN |
denotes |
at |
T28032 |
7254-7257 |
DT |
denotes |
the |
T28034 |
7258-7259 |
SYM |
denotes |
- |
T28035 |
7259-7262 |
CD |
denotes |
198 |
T28036 |
7263-7265 |
NN |
denotes |
bp |
T28033 |
7266-7274 |
NN |
denotes |
position |
T28037 |
7275-7278 |
VBD |
denotes |
was |
T28020 |
7279-7286 |
VBN |
denotes |
mutated |
T28038 |
7287-7289 |
IN |
denotes |
by |
T28039 |
7290-7299 |
VBG |
denotes |
replacing |
T28040 |
7300-7306 |
NN |
denotes |
TAATCC |
T28041 |
7307-7311 |
IN |
denotes |
with |
T28042 |
7312-7318 |
NN |
denotes |
GAATTC |
T28043 |
7318-7319 |
. |
denotes |
. |
T28044 |
7319-7432 |
sentence |
denotes |
For the "mut72" vector, the Crx binding site at the -72 bp position was mutated by replacing GGATTA with GAATTC. |
T28045 |
7320-7323 |
IN |
denotes |
For |
T28047 |
7324-7327 |
DT |
denotes |
the |
T28049 |
7328-7329 |
`` |
denotes |
" |
T28050 |
7329-7334 |
NN |
denotes |
mut72 |
T28051 |
7334-7335 |
'' |
denotes |
" |
T28048 |
7336-7342 |
NN |
denotes |
vector |
T28052 |
7342-7344 |
, |
denotes |
, |
T28053 |
7344-7347 |
DT |
denotes |
the |
T28055 |
7348-7351 |
NN |
denotes |
Crx |
T28056 |
7352-7359 |
NN |
denotes |
binding |
T28054 |
7360-7364 |
NN |
denotes |
site |
T28057 |
7365-7367 |
IN |
denotes |
at |
T28058 |
7368-7371 |
DT |
denotes |
the |
T28060 |
7372-7373 |
SYM |
denotes |
- |
T28061 |
7373-7375 |
CD |
denotes |
72 |
T28062 |
7376-7378 |
NN |
denotes |
bp |
T28059 |
7379-7387 |
NN |
denotes |
position |
T28063 |
7388-7391 |
VBD |
denotes |
was |
T28046 |
7392-7399 |
VBN |
denotes |
mutated |
T28064 |
7400-7402 |
IN |
denotes |
by |
T28065 |
7403-7412 |
VBG |
denotes |
replacing |
T28066 |
7413-7419 |
NN |
denotes |
GGATTA |
T28067 |
7420-7424 |
IN |
denotes |
with |
T28068 |
7425-7431 |
NN |
denotes |
GAATTC |
T28069 |
7431-7432 |
. |
denotes |
. |
T28070 |
7432-7503 |
sentence |
denotes |
For the "mut all" vector, all of three Crx binding sites were mutated. |
T28071 |
7433-7436 |
IN |
denotes |
For |
T28073 |
7437-7440 |
DT |
denotes |
the |
T28075 |
7441-7442 |
`` |
denotes |
" |
T28076 |
7442-7445 |
NN |
denotes |
mut |
T28077 |
7446-7449 |
NN |
denotes |
all |
T28078 |
7449-7450 |
'' |
denotes |
" |
T28074 |
7451-7457 |
NN |
denotes |
vector |
T28079 |
7457-7459 |
, |
denotes |
, |
T28080 |
7459-7462 |
DT |
denotes |
all |
T28081 |
7463-7465 |
IN |
denotes |
of |
T28082 |
7466-7471 |
CD |
denotes |
three |
T28084 |
7472-7475 |
NN |
denotes |
Crx |
T28085 |
7476-7483 |
NN |
denotes |
binding |
T28083 |
7484-7489 |
NNS |
denotes |
sites |
T28086 |
7490-7494 |
VBD |
denotes |
were |
T28072 |
7495-7502 |
VBN |
denotes |
mutated |
T28087 |
7502-7503 |
. |
denotes |
. |
T28088 |
7503-7769 |
sentence |
denotes |
5xGAL4-pGL3 Control reporter plasmid, which contains five copies of the GAL4 DNA recognition sequence positioned immediately upstream of SV40 minimal promoter, was kindly gifted from Dr. T. Noguchi and used for analysis of the transcriptional activity of mr-s [50]. |
T28089 |
7504-7510 |
NN |
denotes |
5xGAL4 |
T28091 |
7510-7511 |
HYPH |
denotes |
- |
T28090 |
7511-7515 |
NN |
denotes |
pGL3 |
T28093 |
7516-7523 |
NN |
denotes |
Control |
T28094 |
7524-7532 |
NN |
denotes |
reporter |
T28092 |
7533-7540 |
NN |
denotes |
plasmid |
T28096 |
7540-7542 |
, |
denotes |
, |
T28097 |
7542-7547 |
WDT |
denotes |
which |
T28098 |
7548-7556 |
VBZ |
denotes |
contains |
T28099 |
7557-7561 |
CD |
denotes |
five |
T28100 |
7562-7568 |
NNS |
denotes |
copies |
T28101 |
7569-7571 |
IN |
denotes |
of |
T28102 |
7572-7575 |
DT |
denotes |
the |
T28104 |
7576-7580 |
NN |
denotes |
GAL4 |
T28105 |
7581-7584 |
NN |
denotes |
DNA |
T28106 |
7585-7596 |
NN |
denotes |
recognition |
T28103 |
7597-7605 |
NN |
denotes |
sequence |
T28107 |
7606-7616 |
VBN |
denotes |
positioned |
T28108 |
7617-7628 |
RB |
denotes |
immediately |
T28109 |
7629-7637 |
IN |
denotes |
upstream |
T28110 |
7638-7640 |
IN |
denotes |
of |
T28111 |
7641-7645 |
NN |
denotes |
SV40 |
T28113 |
7646-7653 |
JJ |
denotes |
minimal |
T28112 |
7654-7662 |
NN |
denotes |
promoter |
T28114 |
7662-7664 |
, |
denotes |
, |
T28115 |
7664-7667 |
VBD |
denotes |
was |
T28116 |
7668-7674 |
RB |
denotes |
kindly |
T28095 |
7675-7681 |
VBN |
denotes |
gifted |
T28117 |
7682-7686 |
IN |
denotes |
from |
T28118 |
7687-7690 |
NNP |
denotes |
Dr. |
T28120 |
7691-7693 |
NNP |
denotes |
T. |
T28119 |
7694-7701 |
NNP |
denotes |
Noguchi |
T28121 |
7702-7705 |
CC |
denotes |
and |
T28122 |
7706-7710 |
VBN |
denotes |
used |
T28123 |
7711-7714 |
IN |
denotes |
for |
T28124 |
7715-7723 |
NN |
denotes |
analysis |
T28125 |
7724-7726 |
IN |
denotes |
of |
T28126 |
7727-7730 |
DT |
denotes |
the |
T28128 |
7731-7746 |
JJ |
denotes |
transcriptional |
T28127 |
7747-7755 |
NN |
denotes |
activity |
T28129 |
7756-7758 |
IN |
denotes |
of |
T28130 |
7759-7761 |
NN |
denotes |
mr |
T28132 |
7761-7762 |
HYPH |
denotes |
- |
T28131 |
7762-7763 |
NN |
denotes |
s |
T28133 |
7764-7765 |
-LRB- |
denotes |
[ |
T28134 |
7765-7767 |
CD |
denotes |
50 |
T28135 |
7767-7768 |
-RRB- |
denotes |
] |
T28136 |
7768-7769 |
. |
denotes |
. |
T28137 |
7769-7905 |
sentence |
denotes |
To generate effector plasmids, various deletion fragments were produced by PCR reaction and subcloned into pGBKT7 vector, respectively. |
T28138 |
7770-7772 |
TO |
denotes |
To |
T28139 |
7773-7781 |
VB |
denotes |
generate |
T28141 |
7782-7790 |
NN |
denotes |
effector |
T28142 |
7791-7799 |
NNS |
denotes |
plasmids |
T28143 |
7799-7801 |
, |
denotes |
, |
T28144 |
7801-7808 |
JJ |
denotes |
various |
T28146 |
7809-7817 |
NN |
denotes |
deletion |
T28145 |
7818-7827 |
NNS |
denotes |
fragments |
T28147 |
7828-7832 |
VBD |
denotes |
were |
T28140 |
7833-7841 |
VBN |
denotes |
produced |
T28148 |
7842-7844 |
IN |
denotes |
by |
T28149 |
7845-7848 |
NN |
denotes |
PCR |
T28150 |
7849-7857 |
NN |
denotes |
reaction |
T28151 |
7858-7861 |
CC |
denotes |
and |
T28152 |
7862-7871 |
VBN |
denotes |
subcloned |
T28153 |
7872-7876 |
IN |
denotes |
into |
T28154 |
7877-7883 |
NN |
denotes |
pGBKT7 |
T28155 |
7884-7890 |
NN |
denotes |
vector |
T28156 |
7890-7892 |
, |
denotes |
, |
T28157 |
7892-7904 |
RB |
denotes |
respectively |
T28158 |
7904-7905 |
. |
denotes |
. |
T28159 |
7905-8019 |
sentence |
denotes |
These fragments were digested with the sequence, which encodes GAL4 DNA binding domain, and inserted into pcDNA3. |
T28160 |
7906-7911 |
DT |
denotes |
These |
T28161 |
7912-7921 |
NNS |
denotes |
fragments |
T28163 |
7922-7926 |
VBD |
denotes |
were |
T28162 |
7927-7935 |
VBN |
denotes |
digested |
T28164 |
7936-7940 |
IN |
denotes |
with |
T28165 |
7941-7944 |
DT |
denotes |
the |
T28166 |
7945-7953 |
NN |
denotes |
sequence |
T28167 |
7953-7955 |
, |
denotes |
, |
T28168 |
7955-7960 |
WDT |
denotes |
which |
T28169 |
7961-7968 |
VBZ |
denotes |
encodes |
T28170 |
7969-7973 |
NN |
denotes |
GAL4 |
T28172 |
7974-7977 |
NN |
denotes |
DNA |
T28173 |
7978-7985 |
NN |
denotes |
binding |
T28171 |
7986-7992 |
NN |
denotes |
domain |
T28174 |
7992-7994 |
, |
denotes |
, |
T28175 |
7994-7997 |
CC |
denotes |
and |
T28176 |
7998-8006 |
VBN |
denotes |
inserted |
T28177 |
8007-8011 |
IN |
denotes |
into |
T28178 |
8012-8018 |
NN |
denotes |
pcDNA3 |
T28179 |
8018-8019 |
. |
denotes |
. |
T28180 |
8019-8172 |
sentence |
denotes |
We transfected 0.1 μg of reporter plasmid DNA and 2 μg of the expression vector DNA per 6 cm dish into HEK293T cells using Fugene6 transfection reagent. |
T28181 |
8020-8022 |
PRP |
denotes |
We |
T28182 |
8023-8034 |
VBD |
denotes |
transfected |
T28183 |
8035-8038 |
CD |
denotes |
0.1 |
T28184 |
8039-8041 |
NN |
denotes |
μg |
T28185 |
8042-8044 |
IN |
denotes |
of |
T28186 |
8045-8053 |
NN |
denotes |
reporter |
T28188 |
8054-8061 |
NN |
denotes |
plasmid |
T28187 |
8062-8065 |
NN |
denotes |
DNA |
T28189 |
8066-8069 |
CC |
denotes |
and |
T28190 |
8070-8071 |
CD |
denotes |
2 |
T28191 |
8072-8074 |
NN |
denotes |
μg |
T28192 |
8075-8077 |
IN |
denotes |
of |
T28193 |
8078-8081 |
DT |
denotes |
the |
T28195 |
8082-8092 |
NN |
denotes |
expression |
T28196 |
8093-8099 |
NN |
denotes |
vector |
T28194 |
8100-8103 |
NN |
denotes |
DNA |
T28197 |
8104-8107 |
IN |
denotes |
per |
T28198 |
8108-8109 |
CD |
denotes |
6 |
T28199 |
8110-8112 |
NN |
denotes |
cm |
T28200 |
8113-8117 |
NN |
denotes |
dish |
T28201 |
8118-8122 |
IN |
denotes |
into |
T28202 |
8123-8130 |
NN |
denotes |
HEK293T |
T28203 |
8131-8136 |
NNS |
denotes |
cells |
T28204 |
8137-8142 |
VBG |
denotes |
using |
T28205 |
8143-8150 |
NN |
denotes |
Fugene6 |
T28207 |
8151-8163 |
NN |
denotes |
transfection |
T28206 |
8164-8171 |
NN |
denotes |
reagent |
T28208 |
8171-8172 |
. |
denotes |
. |
T28209 |
8172-8230 |
sentence |
denotes |
We analyzed luciferase activity 48 hr after transfection. |
T28210 |
8173-8175 |
PRP |
denotes |
We |
T28211 |
8176-8184 |
VBD |
denotes |
analyzed |
T28212 |
8185-8195 |
NN |
denotes |
luciferase |
T28213 |
8196-8204 |
NN |
denotes |
activity |
T28214 |
8205-8207 |
CD |
denotes |
48 |
T28215 |
8208-8210 |
NN |
denotes |
hr |
T28216 |
8211-8216 |
IN |
denotes |
after |
T28217 |
8217-8229 |
NN |
denotes |
transfection |
T28218 |
8229-8230 |
. |
denotes |
. |
R6551 |
T23218 |
T23217 |
prep |
of,Isolation |
R6552 |
T23219 |
T23220 |
compound |
mouse,cDNA |
R6553 |
T23220 |
T23218 |
pobj |
cDNA,of |
R6554 |
T23221 |
T23222 |
compound |
mr,s |
R6555 |
T23222 |
T23220 |
compound |
s,cDNA |
R6556 |
T23223 |
T23222 |
punct |
-,s |
R6557 |
T23225 |
T23226 |
nsubj |
We,used |
R6558 |
T23227 |
T23228 |
det |
the,method |
R6559 |
T23228 |
T23226 |
dobj |
method,used |
R6560 |
T23229 |
T23228 |
compound |
bioinformatics,method |
R6561 |
T23230 |
T23231 |
compound |
Digital,Display |
R6562 |
T23231 |
T23228 |
appos |
Display,method |
R6563 |
T23232 |
T23231 |
compound |
Differential,Display |
R6564 |
T23233 |
T23234 |
punct |
(,NCBI |
R6565 |
T23234 |
T23228 |
parataxis |
NCBI,method |
R6566 |
T23235 |
T23234 |
punct |
", ",NCBI |
R6567 |
T23236 |
T23234 |
npadvmod |
UniGene,NCBI |
R6568 |
T23237 |
T23234 |
punct |
),NCBI |
R6569 |
T23238 |
T23239 |
aux |
to,screen |
R6570 |
T23239 |
T23226 |
advcl |
screen,used |
R6571 |
T23240 |
T23241 |
amod |
novel,genes |
R6572 |
T23241 |
T23239 |
dobj |
genes,screen |
R6573 |
T23242 |
T23241 |
compound |
mouse,genes |
R6574 |
T23243 |
T23241 |
acl |
expressed,genes |
R6575 |
T23244 |
T23243 |
advmod |
preferentially,expressed |
R6576 |
T23245 |
T23243 |
prep |
in,expressed |
R6577 |
T23246 |
T23247 |
det |
the,retina |
R6578 |
T23247 |
T23245 |
pobj |
retina,in |
R6579 |
T23248 |
T23226 |
punct |
.,used |
R6580 |
T23250 |
T23251 |
nsubj |
Some,were |
R6581 |
T23252 |
T23250 |
prep |
of,Some |
R6582 |
T23253 |
T23254 |
det |
the,clusters |
R6583 |
T23254 |
T23252 |
pobj |
clusters,of |
R6584 |
T23255 |
T23250 |
prep |
in,Some |
R6585 |
T23256 |
T23257 |
det |
the,database |
R6586 |
T23257 |
T23255 |
pobj |
database,in |
R6587 |
T23258 |
T23257 |
compound |
UniGene,database |
R6588 |
T23259 |
T23251 |
advmod |
mainly,were |
R6589 |
T23260 |
T23251 |
prep |
from,were |
R6590 |
T23261 |
T23262 |
nmod |
mouse,cDNAs |
R6591 |
T23262 |
T23260 |
pobj |
cDNAs,from |
R6592 |
T23263 |
T23262 |
amod |
retinal,cDNAs |
R6593 |
T23264 |
T23251 |
punct |
.,were |
R6594 |
T23266 |
T23267 |
nummod |
One,clone |
R6595 |
T23267 |
T23268 |
nsubj |
clone,has |
R6596 |
T23269 |
T23267 |
prep |
in,clone |
R6597 |
T23270 |
T23271 |
det |
these,clusters |
R6598 |
T23271 |
T23269 |
pobj |
clusters,in |
R6599 |
T23272 |
T23273 |
punct |
(,Mm. |
R6600 |
T23273 |
T23267 |
parataxis |
Mm.,clone |
R6601 |
T23274 |
T23273 |
punct |
#,Mm. |
R6602 |
T23275 |
T23273 |
nummod |
246385,Mm. |
R6603 |
T23276 |
T23273 |
punct |
),Mm. |
R6604 |
T23277 |
T23278 |
det |
a,homology |
R6605 |
T23278 |
T23268 |
dobj |
homology,has |
R6606 |
T23279 |
T23278 |
amod |
weak,homology |
R6607 |
T23280 |
T23278 |
prep |
with,homology |
R6608 |
T23281 |
T23282 |
det |
the,genes |
R6609 |
T23282 |
T23280 |
pobj |
genes,with |
R6610 |
T23283 |
T23282 |
amod |
polyhomeotic,genes |
R6611 |
T23284 |
T23282 |
compound |
family,genes |
R6612 |
T23285 |
T23268 |
punct |
.,has |
R6613 |
T23287 |
T23288 |
det |
A,fragment |
R6614 |
T23288 |
T23293 |
nsubjpass |
fragment,amplified |
R6615 |
T23289 |
T23290 |
nummod |
735,bp |
R6616 |
T23290 |
T23288 |
compound |
bp,fragment |
R6617 |
T23291 |
T23290 |
punct |
-,bp |
R6618 |
T23292 |
T23288 |
compound |
cDNA,fragment |
R6619 |
T23294 |
T23288 |
prep |
of,fragment |
R6620 |
T23295 |
T23296 |
det |
this,clone |
R6621 |
T23296 |
T23294 |
pobj |
clone,of |
R6622 |
T23297 |
T23288 |
punct |
", ",fragment |
R6623 |
T23298 |
T23288 |
acl |
encoding,fragment |
R6624 |
T23299 |
T23300 |
nmod |
amino,140 |
R6625 |
T23300 |
T23298 |
dobj |
140,encoding |
R6626 |
T23301 |
T23300 |
nmod |
acids,140 |
R6627 |
T23302 |
T23303 |
punct |
–,384 |
R6628 |
T23303 |
T23300 |
prep |
384,140 |
R6629 |
T23304 |
T23293 |
auxpass |
was,amplified |
R6630 |
T23305 |
T23293 |
prep |
by,amplified |
R6631 |
T23306 |
T23307 |
compound |
RT,PCR |
R6632 |
T23307 |
T23305 |
pobj |
PCR,by |
R6633 |
T23308 |
T23307 |
punct |
-,PCR |
R6634 |
T23309 |
T23293 |
prep |
from,amplified |
R6635 |
T23310 |
T23311 |
nmod |
mouse,cDNA |
R6636 |
T23311 |
T23309 |
pobj |
cDNA,from |
R6637 |
T23312 |
T23311 |
nmod |
P0,cDNA |
R6638 |
T23313 |
T23311 |
amod |
retinal,cDNA |
R6639 |
T23314 |
T23293 |
punct |
.,amplified |
R6640 |
T23316 |
T23317 |
det |
This,fragment |
R6641 |
T23317 |
T23318 |
nsubjpass |
fragment,used |
R6642 |
T23319 |
T23318 |
auxpass |
was,used |
R6643 |
T23320 |
T23318 |
prep |
as,used |
R6644 |
T23321 |
T23322 |
det |
the,probe |
R6645 |
T23322 |
T23320 |
pobj |
probe,as |
R6646 |
T23323 |
T23318 |
prep |
for,used |
R6647 |
T23324 |
T23325 |
compound |
library,screening |
R6648 |
T23325 |
T23323 |
pobj |
screening,for |
R6649 |
T23326 |
T23325 |
punct |
", ",screening |
R6650 |
T23327 |
T23328 |
advmod |
in,situ |
R6651 |
T23328 |
T23329 |
amod |
situ,hybridization |
R6652 |
T23329 |
T23325 |
conj |
hybridization,screening |
R6653 |
T23330 |
T23329 |
cc |
and,hybridization |
R6654 |
T23331 |
T23332 |
compound |
Northern,hybridization |
R6655 |
T23332 |
T23329 |
conj |
hybridization,hybridization |
R6656 |
T23333 |
T23318 |
punct |
.,used |
R6657 |
T23335 |
T23336 |
det |
A,library |
R6658 |
T23336 |
T23343 |
nsubjpass |
library,screened |
R6659 |
T23337 |
T23336 |
nmod |
mouse,library |
R6660 |
T23338 |
T23336 |
nmod |
P0,library |
R6661 |
T23339 |
T23340 |
punct |
-,P3 |
R6662 |
T23340 |
T23338 |
prep |
P3,P0 |
R6663 |
T23341 |
T23336 |
amod |
retinal,library |
R6664 |
T23342 |
T23336 |
compound |
cDNA,library |
R6665 |
T23344 |
T23343 |
auxpass |
was,screened |
R6666 |
T23345 |
T23343 |
advcl |
using,screened |
R6667 |
T23346 |
T23347 |
det |
this,fragment |
R6668 |
T23347 |
T23345 |
dobj |
fragment,using |
R6669 |
T23348 |
T23347 |
compound |
mouse,fragment |
R6670 |
T23349 |
T23347 |
compound |
cDNA,fragment |
R6671 |
T23350 |
T23343 |
punct |
.,screened |
R6672 |
T23352 |
T23353 |
amod |
Positive,clones |
R6673 |
T23353 |
T23355 |
nsubjpass |
clones,isolated |
R6674 |
T23354 |
T23353 |
compound |
bacteriophage,clones |
R6675 |
T23356 |
T23355 |
auxpass |
were,isolated |
R6676 |
T23357 |
T23355 |
cc |
and,isolated |
R6677 |
T23358 |
T23359 |
det |
the,fragment |
R6678 |
T23359 |
T23366 |
nsubjpass |
fragment,inserted |
R6679 |
T23360 |
T23361 |
amod |
full,length |
R6680 |
T23361 |
T23359 |
compound |
length,fragment |
R6681 |
T23362 |
T23361 |
punct |
-,length |
R6682 |
T23363 |
T23364 |
compound |
mr,s |
R6683 |
T23364 |
T23359 |
compound |
s,fragment |
R6684 |
T23365 |
T23364 |
punct |
-,s |
R6685 |
T23366 |
T23355 |
conj |
inserted,isolated |
R6686 |
T23367 |
T23366 |
auxpass |
was,inserted |
R6687 |
T23368 |
T23366 |
prep |
into,inserted |
R6688 |
T23369 |
T23368 |
pobj |
pBluescriptII,into |
R6689 |
T23370 |
T23371 |
punct |
(,Stratagene |
R6690 |
T23371 |
T23366 |
parataxis |
Stratagene,inserted |
R6691 |
T23372 |
T23371 |
punct |
),Stratagene |
R6692 |
T23373 |
T23366 |
punct |
.,inserted |
R6693 |
T23375 |
T23376 |
compound |
DNA,sequencing |
R6694 |
T23376 |
T23377 |
nsubjpass |
sequencing,performed |
R6695 |
T23378 |
T23377 |
auxpass |
was,performed |
R6696 |
T23379 |
T23377 |
prep |
on,performed |
R6697 |
T23380 |
T23381 |
det |
both,strands |
R6698 |
T23381 |
T23379 |
pobj |
strands,on |
R6699 |
T23382 |
T23377 |
prep |
by,performed |
R6700 |
T23383 |
T23384 |
det |
the,method |
R6701 |
T23384 |
T23382 |
pobj |
method,by |
R6702 |
T23385 |
T23384 |
compound |
cycle,method |
R6703 |
T23386 |
T23384 |
compound |
sequencing,method |
R6704 |
T23387 |
T23377 |
punct |
.,performed |
R6705 |
T23389 |
T23390 |
det |
The,sequence |
R6706 |
T23390 |
T23392 |
nsubjpass |
sequence,deposited |
R6707 |
T23391 |
T23390 |
compound |
nucleotide,sequence |
R6708 |
T23393 |
T23390 |
prep |
for,sequence |
R6709 |
T23394 |
T23395 |
compound |
mr,s |
R6710 |
T23395 |
T23397 |
compound |
s,gene |
R6711 |
T23396 |
T23395 |
punct |
-,s |
R6712 |
T23397 |
T23393 |
pobj |
gene,for |
R6713 |
T23398 |
T23392 |
aux |
has,deposited |
R6714 |
T23399 |
T23392 |
auxpass |
been,deposited |
R6715 |
T23400 |
T23392 |
prep |
in,deposited |
R6716 |
T23401 |
T23402 |
det |
the,database |
R6717 |
T23402 |
T23400 |
pobj |
database,in |
R6718 |
T23403 |
T23402 |
compound |
GenBank,database |
R6719 |
T23404 |
T23392 |
prep |
under,deposited |
R6720 |
T23405 |
T23406 |
nmod |
GenBank,AY458844 |
R6721 |
T23406 |
T23404 |
pobj |
AY458844,under |
R6722 |
T23407 |
T23406 |
nmod |
Accession,AY458844 |
R6723 |
T23408 |
T23406 |
nmod |
Number,AY458844 |
R6724 |
T23409 |
T23406 |
punct |
#,AY458844 |
R6725 |
T23410 |
T23392 |
punct |
.,deposited |
R6726 |
T23508 |
T23509 |
advmod |
In,situ |
R6727 |
T23509 |
T23510 |
amod |
situ,hybridization |
R6728 |
T23512 |
T23513 |
det |
The,fragment |
R6729 |
T23513 |
T23518 |
nsubjpass |
fragment,used |
R6730 |
T23514 |
T23515 |
nummod |
735,bp |
R6731 |
T23515 |
T23513 |
compound |
bp,fragment |
R6732 |
T23516 |
T23515 |
punct |
-,bp |
R6733 |
T23517 |
T23513 |
compound |
cDNA,fragment |
R6734 |
T23519 |
T23513 |
prep |
of,fragment |
R6735 |
T23520 |
T23521 |
compound |
mr,s |
R6736 |
T23521 |
T23519 |
pobj |
s,of |
R6737 |
T23522 |
T23521 |
punct |
-,s |
R6738 |
T23523 |
T23513 |
acl |
amplified,fragment |
R6739 |
T23524 |
T23523 |
prep |
by,amplified |
R6740 |
T23525 |
T23526 |
compound |
RT,PCR |
R6741 |
T23526 |
T23524 |
pobj |
PCR,by |
R6742 |
T23527 |
T23526 |
punct |
-,PCR |
R6743 |
T23528 |
T23518 |
auxpass |
was,used |
R6744 |
T23529 |
T23518 |
prep |
as,used |
R6745 |
T23530 |
T23531 |
det |
a,probe |
R6746 |
T23531 |
T23529 |
pobj |
probe,as |
R6747 |
T23532 |
T23518 |
prep |
for,used |
R6748 |
T23533 |
T23534 |
advmod |
in,situ |
R6749 |
T23534 |
T23535 |
amod |
situ,hybridization |
R6750 |
T23535 |
T23532 |
pobj |
hybridization,for |
R6751 |
T23536 |
T23518 |
punct |
.,used |
R6752 |
T23538 |
T23539 |
advmod |
In,situ |
R6753 |
T23539 |
T23540 |
amod |
situ,hybridization |
R6754 |
T23540 |
T23541 |
nsubjpass |
hybridization,performed |
R6755 |
T23542 |
T23541 |
auxpass |
was,performed |
R6756 |
T23543 |
T23544 |
mark |
as,described |
R6757 |
T23544 |
T23541 |
advcl |
described,performed |
R6758 |
T23545 |
T23544 |
advmod |
previously,described |
R6759 |
T23546 |
T23547 |
punct |
[,49 |
R6760 |
T23547 |
T23541 |
parataxis |
49,performed |
R6761 |
T23548 |
T23547 |
punct |
],49 |
R6762 |
T23549 |
T23541 |
punct |
.,performed |
R6763 |
T23802 |
T23803 |
compound |
Cell,culture |
R6764 |
T23804 |
T23803 |
cc |
and,culture |
R6765 |
T23805 |
T23803 |
conj |
transfection,culture |
R6766 |
T23807 |
T23808 |
compound |
HEK293T,cells |
R6767 |
T23808 |
T23809 |
nsubjpass |
cells,maintained |
R6768 |
T23810 |
T23809 |
auxpass |
were,maintained |
R6769 |
T23811 |
T23809 |
prep |
at,maintained |
R6770 |
T23812 |
T23813 |
nummod |
37,°C |
R6771 |
T23813 |
T23811 |
pobj |
°C,at |
R6772 |
T23814 |
T23809 |
prep |
in,maintained |
R6773 |
T23815 |
T23816 |
poss |
Dulbecco,medium |
R6774 |
T23816 |
T23814 |
pobj |
medium,in |
R6775 |
T23817 |
T23815 |
case |
's,Dulbecco |
R6776 |
T23818 |
T23816 |
amod |
modified,medium |
R6777 |
T23819 |
T23816 |
poss |
Eagle,medium |
R6778 |
T23820 |
T23819 |
case |
's,Eagle |
R6779 |
T23821 |
T23816 |
punct |
(,medium |
R6780 |
T23822 |
T23816 |
appos |
DMEM,medium |
R6781 |
T23823 |
T23816 |
punct |
),medium |
R6782 |
T23824 |
T23816 |
acl |
supplemented,medium |
R6783 |
T23825 |
T23824 |
prep |
with,supplemented |
R6784 |
T23826 |
T23827 |
nummod |
10,% |
R6785 |
T23827 |
T23828 |
nmod |
%,serum |
R6786 |
T23828 |
T23825 |
pobj |
serum,with |
R6787 |
T23829 |
T23830 |
amod |
fetal,bovine |
R6788 |
T23830 |
T23828 |
amod |
bovine,serum |
R6789 |
T23831 |
T23832 |
punct |
(,Sigma |
R6790 |
T23832 |
T23828 |
parataxis |
Sigma,serum |
R6791 |
T23833 |
T23832 |
punct |
),Sigma |
R6792 |
T23834 |
T23828 |
punct |
", ",serum |
R6793 |
T23835 |
T23836 |
nummod |
100,IU |
R6794 |
T23836 |
T23837 |
nmod |
IU,penicillin |
R6795 |
T23837 |
T23828 |
conj |
penicillin,serum |
R6796 |
T23838 |
T23839 |
punct |
/,ml |
R6797 |
T23839 |
T23836 |
prep |
ml,IU |
R6798 |
T23840 |
T23837 |
cc |
and,penicillin |
R6799 |
T23841 |
T23842 |
nummod |
100,μg |
R6800 |
T23842 |
T23843 |
nmod |
μg,streptomycin |
R6801 |
T23843 |
T23837 |
conj |
streptomycin,penicillin |
R6802 |
T23844 |
T23845 |
punct |
/,ml |
R6803 |
T23845 |
T23842 |
prep |
ml,μg |
R6804 |
T23846 |
T23809 |
punct |
.,maintained |
R6805 |
T23848 |
T23849 |
amod |
Transient,transfection |
R6806 |
T23849 |
T23850 |
nsubjpass |
transfection,carried |
R6807 |
T23851 |
T23849 |
prep |
of,transfection |
R6808 |
T23852 |
T23853 |
compound |
HEK293T,cells |
R6809 |
T23853 |
T23851 |
pobj |
cells,of |
R6810 |
T23854 |
T23850 |
auxpass |
was,carried |
R6811 |
T23855 |
T23850 |
prt |
out,carried |
R6812 |
T23856 |
T23850 |
advcl |
using,carried |
R6813 |
T23857 |
T23858 |
compound |
calcium,phosphate |
R6814 |
T23858 |
T23859 |
compound |
phosphate,method |
R6815 |
T23859 |
T23856 |
dobj |
method,using |
R6816 |
T23860 |
T23859 |
cc |
or,method |
R6817 |
T23861 |
T23862 |
compound |
Fugene6,reagent |
R6818 |
T23862 |
T23859 |
conj |
reagent,method |
R6819 |
T23863 |
T23862 |
compound |
transfection,reagent |
R6820 |
T23864 |
T23865 |
punct |
(,Roche |
R6821 |
T23865 |
T23862 |
parataxis |
Roche,reagent |
R6822 |
T23866 |
T23865 |
punct |
),Roche |
R6823 |
T23867 |
T23850 |
punct |
.,carried |
R6824 |
T23869 |
T23870 |
compound |
Y79,cells |
R6825 |
T23870 |
T23872 |
nsubjpass |
cells,maintained |
R6826 |
T23871 |
T23870 |
compound |
retinoblastoma,cells |
R6827 |
T23873 |
T23872 |
auxpass |
were,maintained |
R6828 |
T23874 |
T23872 |
prep |
in,maintained |
R6829 |
T23875 |
T23876 |
poss |
Iscove,medium |
R6830 |
T23876 |
T23874 |
pobj |
medium,in |
R6831 |
T23877 |
T23875 |
case |
's,Iscove |
R6832 |
T23878 |
T23876 |
amod |
modified,medium |
R6833 |
T23879 |
T23876 |
poss |
Dulbecco,medium |
R6834 |
T23880 |
T23879 |
case |
's,Dulbecco |
R6835 |
T23881 |
T23876 |
prep |
with,medium |
R6836 |
T23882 |
T23883 |
nummod |
4,mM |
R6837 |
T23883 |
T23884 |
compound |
mM,glutamine |
R6838 |
T23884 |
T23881 |
pobj |
glutamine,with |
R6839 |
T23885 |
T23884 |
compound |
L,glutamine |
R6840 |
T23886 |
T23884 |
punct |
-,glutamine |
R6841 |
T23887 |
T23884 |
acl |
adjusted,glutamine |
R6842 |
T23888 |
T23889 |
aux |
to,contain |
R6843 |
T23889 |
T23887 |
advcl |
contain,adjusted |
R6844 |
T23890 |
T23891 |
nummod |
1.5,g |
R6845 |
T23891 |
T23892 |
nmod |
g,bicarbonate |
R6846 |
T23892 |
T23889 |
dobj |
bicarbonate,contain |
R6847 |
T23893 |
T23894 |
punct |
/,L |
R6848 |
T23894 |
T23891 |
prep |
L,g |
R6849 |
T23895 |
T23892 |
compound |
sodium,bicarbonate |
R6850 |
T23896 |
T23892 |
punct |
", ",bicarbonate |
R6851 |
T23897 |
T23898 |
nummod |
20,% |
R6852 |
T23898 |
T23899 |
compound |
%,FBS |
R6853 |
T23899 |
T23892 |
npadvmod |
FBS,bicarbonate |
R6854 |
T23900 |
T23872 |
punct |
.,maintained |
R6855 |
T23902 |
T23903 |
amod |
Transient,transfection |
R6856 |
T23903 |
T23904 |
nsubjpass |
transfection,carried |
R6857 |
T23905 |
T23904 |
auxpass |
was,carried |
R6858 |
T23906 |
T23904 |
prt |
out,carried |
R6859 |
T23907 |
T23904 |
advcl |
using,carried |
R6860 |
T23908 |
T23909 |
compound |
TransIt,LT1 |
R6861 |
T23909 |
T23907 |
dobj |
LT1,using |
R6862 |
T23910 |
T23911 |
punct |
(,Mirus |
R6863 |
T23911 |
T23909 |
parataxis |
Mirus,LT1 |
R6864 |
T23912 |
T23911 |
punct |
),Mirus |
R6865 |
T23913 |
T23904 |
punct |
.,carried |
R6866 |
T24169 |
T24170 |
compound |
Northern,blot |
R6867 |
T24170 |
T24172 |
compound |
blot,analysis |
R6868 |
T24171 |
T24170 |
punct |
-,blot |
R6869 |
T24174 |
T24175 |
nsubjpass |
RNA,extracted |
R6870 |
T24176 |
T24175 |
auxpass |
was,extracted |
R6871 |
T24177 |
T24175 |
prep |
from,extracted |
R6872 |
T24178 |
T24179 |
det |
the,tissues |
R6873 |
T24179 |
T24177 |
pobj |
tissues,from |
R6874 |
T24180 |
T24179 |
prep |
of,tissues |
R6875 |
T24181 |
T24182 |
amod |
adult,mice |
R6876 |
T24182 |
T24180 |
pobj |
mice,of |
R6877 |
T24183 |
T24175 |
advcl |
using,extracted |
R6878 |
T24184 |
T24183 |
dobj |
Trizol,using |
R6879 |
T24185 |
T24186 |
punct |
(,Invitrogen |
R6880 |
T24186 |
T24184 |
parataxis |
Invitrogen,Trizol |
R6881 |
T24187 |
T24186 |
punct |
),Invitrogen |
R6882 |
T24188 |
T24175 |
punct |
.,extracted |
R6883 |
T24190 |
T24191 |
det |
A,μg |
R6884 |
T24191 |
T24193 |
nsubjpass |
μg,electrophoresed |
R6885 |
T24192 |
T24191 |
nummod |
5,μg |
R6886 |
T24194 |
T24191 |
prep |
of,μg |
R6887 |
T24195 |
T24196 |
amod |
total,RNA |
R6888 |
T24196 |
T24194 |
pobj |
RNA,of |
R6889 |
T24197 |
T24193 |
auxpass |
was,electrophoresed |
R6890 |
T24198 |
T24193 |
prep |
in,electrophoresed |
R6891 |
T24199 |
T24200 |
det |
a,gel |
R6892 |
T24200 |
T24198 |
pobj |
gel,in |
R6893 |
T24201 |
T24202 |
nummod |
1.0,% |
R6894 |
T24202 |
T24200 |
compound |
%,gel |
R6895 |
T24203 |
T24204 |
compound |
agarose,formaldehyde |
R6896 |
T24204 |
T24200 |
compound |
formaldehyde,gel |
R6897 |
T24205 |
T24204 |
punct |
-,formaldehyde |
R6898 |
T24206 |
T24193 |
cc |
and,electrophoresed |
R6899 |
T24207 |
T24193 |
conj |
transferred,electrophoresed |
R6900 |
T24208 |
T24207 |
prep |
to,transferred |
R6901 |
T24209 |
T24210 |
det |
a,membrane |
R6902 |
T24210 |
T24208 |
pobj |
membrane,to |
R6903 |
T24211 |
T24210 |
compound |
nylon,membrane |
R6904 |
T24212 |
T24213 |
punct |
(,GT |
R6905 |
T24213 |
T24210 |
parataxis |
GT,membrane |
R6906 |
T24214 |
T24215 |
compound |
Zeta,Probe |
R6907 |
T24215 |
T24213 |
compound |
Probe,GT |
R6908 |
T24216 |
T24215 |
punct |
-,Probe |
R6909 |
T24217 |
T24213 |
punct |
", ",GT |
R6910 |
T24218 |
T24219 |
compound |
Bio,Rad |
R6911 |
T24219 |
T24213 |
npadvmod |
Rad,GT |
R6912 |
T24220 |
T24219 |
punct |
-,Rad |
R6913 |
T24221 |
T24213 |
punct |
),GT |
R6914 |
T24222 |
T24193 |
punct |
.,electrophoresed |
R6915 |
T24224 |
T24225 |
det |
The,fragment |
R6916 |
T24225 |
T24230 |
nsubjpass |
fragment,used |
R6917 |
T24226 |
T24227 |
nummod |
735,bp |
R6918 |
T24227 |
T24225 |
compound |
bp,fragment |
R6919 |
T24228 |
T24227 |
punct |
-,bp |
R6920 |
T24229 |
T24225 |
compound |
cDNA,fragment |
R6921 |
T24231 |
T24225 |
acl |
encoding,fragment |
R6922 |
T24232 |
T24233 |
det |
the,domain |
R6923 |
T24233 |
T24231 |
dobj |
domain,encoding |
R6924 |
T24234 |
T24233 |
compound |
SAM,domain |
R6925 |
T24235 |
T24233 |
prep |
of,domain |
R6926 |
T24236 |
T24237 |
compound |
mr,s |
R6927 |
T24237 |
T24235 |
pobj |
s,of |
R6928 |
T24238 |
T24237 |
punct |
-,s |
R6929 |
T24239 |
T24230 |
auxpass |
was,used |
R6930 |
T24240 |
T24230 |
prep |
as,used |
R6931 |
T24241 |
T24242 |
det |
a,probe |
R6932 |
T24242 |
T24240 |
pobj |
probe,as |
R6933 |
T24243 |
T24230 |
prep |
for,used |
R6934 |
T24244 |
T24243 |
pobj |
hybridization,for |
R6935 |
T24245 |
T24230 |
punct |
.,used |
R6936 |
T24247 |
T24248 |
nsubjpass |
Hybridization,performed |
R6937 |
T24249 |
T24248 |
auxpass |
was,performed |
R6938 |
T24250 |
T24248 |
prep |
according,performed |
R6939 |
T24251 |
T24250 |
prep |
to,according |
R6940 |
T24252 |
T24253 |
det |
the,manufacturer |
R6941 |
T24253 |
T24254 |
poss |
manufacturer,protocol |
R6942 |
T24254 |
T24251 |
pobj |
protocol,to |
R6943 |
T24255 |
T24253 |
case |
's,manufacturer |
R6944 |
T24256 |
T24248 |
punct |
.,performed |
R6945 |
T24258 |
T24259 |
nsubjpass |
Washes,performed |
R6946 |
T24260 |
T24258 |
prep |
with,Washes |
R6947 |
T24261 |
T24262 |
amod |
increasing,stringency |
R6948 |
T24262 |
T24260 |
pobj |
stringency,with |
R6949 |
T24263 |
T24259 |
auxpass |
were,performed |
R6950 |
T24264 |
T24259 |
punct |
", ",performed |
R6951 |
T24265 |
T24266 |
det |
the,last |
R6952 |
T24266 |
T24267 |
nsubj |
last,being |
R6953 |
T24267 |
T24259 |
advcl |
being,performed |
R6954 |
T24268 |
T24267 |
prep |
at,being |
R6955 |
T24269 |
T24270 |
nummod |
50,°C |
R6956 |
T24270 |
T24268 |
pobj |
°C,at |
R6957 |
T24271 |
T24267 |
prep |
in,being |
R6958 |
T24272 |
T24273 |
nummod |
0.1,citrate |
R6959 |
T24273 |
T24271 |
pobj |
citrate,in |
R6960 |
T24274 |
T24272 |
punct |
×,0.1 |
R6961 |
T24275 |
T24273 |
amod |
standard,citrate |
R6962 |
T24276 |
T24273 |
compound |
saline,citrate |
R6963 |
T24277 |
T24278 |
punct |
/,% |
R6964 |
T24278 |
T24273 |
prep |
%,citrate |
R6965 |
T24279 |
T24278 |
nummod |
0.1,% |
R6966 |
T24280 |
T24281 |
compound |
sodium,sulfate |
R6967 |
T24281 |
T24278 |
appos |
sulfate,% |
R6968 |
T24282 |
T24281 |
compound |
dodecyl,sulfate |
R6969 |
T24283 |
T24281 |
punct |
(,sulfate |
R6970 |
T24284 |
T24281 |
appos |
SDS,sulfate |
R6971 |
T24285 |
T24259 |
punct |
),performed |
R6972 |
T24286 |
T24259 |
punct |
.,performed |
R6973 |
T24536 |
T24537 |
compound |
RT,PCR |
R6974 |
T24537 |
T24539 |
compound |
PCR,analysis |
R6975 |
T24538 |
T24537 |
punct |
-,PCR |
R6976 |
T24541 |
T24542 |
amod |
Total,RNA |
R6977 |
T24542 |
T24543 |
nsubjpass |
RNA,isolated |
R6978 |
T24544 |
T24543 |
auxpass |
was,isolated |
R6979 |
T24545 |
T24543 |
prep |
from,isolated |
R6980 |
T24546 |
T24547 |
det |
each,tissue |
R6981 |
T24547 |
T24545 |
pobj |
tissue,from |
R6982 |
T24548 |
T24543 |
advcl |
using,isolated |
R6983 |
T24549 |
T24548 |
dobj |
Trizol,using |
R6984 |
T24550 |
T24543 |
punct |
.,isolated |
R6985 |
T24552 |
T24553 |
det |
A,μg |
R6986 |
T24553 |
T24555 |
nsubjpass |
μg,transcribed |
R6987 |
T24554 |
T24553 |
nummod |
1,μg |
R6988 |
T24556 |
T24553 |
prep |
of,μg |
R6989 |
T24557 |
T24558 |
amod |
total,RNA |
R6990 |
T24558 |
T24556 |
pobj |
RNA,of |
R6991 |
T24559 |
T24555 |
auxpass |
was,transcribed |
R6992 |
T24560 |
T24555 |
amod |
reverse,transcribed |
R6993 |
T24561 |
T24555 |
advcl |
using,transcribed |
R6994 |
T24562 |
T24561 |
dobj |
SuperscriptII,using |
R6995 |
T24563 |
T24564 |
punct |
(,Invitrogen |
R6996 |
T24564 |
T24562 |
parataxis |
Invitrogen,SuperscriptII |
R6997 |
T24565 |
T24564 |
punct |
),Invitrogen |
R6998 |
T24566 |
T24555 |
punct |
.,transcribed |
R6999 |
T24568 |
T24569 |
compound |
RT,PCR |
R7000 |
T24569 |
T24571 |
compound |
PCR,primers |
R7001 |
T24570 |
T24569 |
punct |
-,PCR |
R7002 |
T24571 |
T24572 |
nsubj |
primers,were |
R7003 |
T24573 |
T24571 |
punct |
", ",primers |
R7004 |
T24574 |
T24575 |
dep |
which,span |
R7005 |
T24575 |
T24571 |
relcl |
span,primers |
R7006 |
T24576 |
T24575 |
dobj |
introns,span |
R7007 |
T24577 |
T24571 |
punct |
", ",primers |
R7008 |
T24578 |
T24571 |
prep |
for,primers |
R7009 |
T24579 |
T24578 |
pobj |
detection,for |
R7010 |
T24580 |
T24579 |
prep |
of,detection |
R7011 |
T24581 |
T24582 |
compound |
mr,s |
R7012 |
T24582 |
T24584 |
compound |
s,cDNA |
R7013 |
T24583 |
T24582 |
punct |
-,s |
R7014 |
T24584 |
T24580 |
pobj |
cDNA,of |
R7015 |
T24585 |
T24586 |
nummod |
5,TGTCCAGCCCAGCCAACCCAAGGAGACGACA |
R7016 |
T24586 |
T24572 |
attr |
TGTCCAGCCCAGCCAACCCAAGGAGACGACA,were |
R7017 |
T24587 |
T24585 |
punct |
',5 |
R7018 |
T24588 |
T24586 |
punct |
-,TGTCCAGCCCAGCCAACCCAAGGAGACGACA |
R7019 |
T24589 |
T24586 |
punct |
-,TGTCCAGCCCAGCCAACCCAAGGAGACGACA |
R7020 |
T24590 |
T24586 |
nummod |
3,TGTCCAGCCCAGCCAACCCAAGGAGACGACA |
R7021 |
T24591 |
T24586 |
punct |
',TGTCCAGCCCAGCCAACCCAAGGAGACGACA |
R7022 |
T24592 |
T24586 |
cc |
and,TGTCCAGCCCAGCCAACCCAAGGAGACGACA |
R7023 |
T24593 |
T24594 |
nummod |
5,TGTGGTCTCCTCATCAGTGAAGA |
R7024 |
T24594 |
T24586 |
conj |
TGTGGTCTCCTCATCAGTGAAGA,TGTCCAGCCCAGCCAACCCAAGGAGACGACA |
R7025 |
T24595 |
T24593 |
punct |
',5 |
R7026 |
T24596 |
T24594 |
punct |
-,TGTGGTCTCCTCATCAGTGAAGA |
R7027 |
T24597 |
T24594 |
punct |
-,TGTGGTCTCCTCATCAGTGAAGA |
R7028 |
T24598 |
T24594 |
nummod |
3,TGTGGTCTCCTCATCAGTGAAGA |
R7029 |
T24599 |
T24594 |
punct |
',TGTGGTCTCCTCATCAGTGAAGA |
R7030 |
T24600 |
T24572 |
punct |
.,were |
R7031 |
T24602 |
T24603 |
compound |
Product,size |
R7032 |
T24603 |
T24604 |
nsubj |
size,was |
R7033 |
T24605 |
T24606 |
nummod |
292,bp |
R7034 |
T24606 |
T24604 |
attr |
bp,was |
R7035 |
T24607 |
T24608 |
punct |
(,965 |
R7036 |
T24608 |
T24604 |
parataxis |
965,was |
R7037 |
T24609 |
T24608 |
nmod |
positions,965 |
R7038 |
T24610 |
T24611 |
punct |
–,1256 |
R7039 |
T24611 |
T24608 |
prep |
1256,965 |
R7040 |
T24612 |
T24608 |
prep |
of,965 |
R7041 |
T24613 |
T24614 |
nmod |
Genbank,AY458844 |
R7042 |
T24614 |
T24612 |
pobj |
AY458844,of |
R7043 |
T24615 |
T24614 |
nmod |
Accession,AY458844 |
R7044 |
T24616 |
T24614 |
nmod |
Number,AY458844 |
R7045 |
T24617 |
T24614 |
punct |
#,AY458844 |
R7046 |
T24618 |
T24608 |
punct |
),965 |
R7047 |
T24619 |
T24604 |
punct |
.,was |
R7048 |
T24621 |
T24622 |
compound |
Primer,pairs |
R7049 |
T24622 |
T24623 |
nsubj |
pairs,were |
R7050 |
T24624 |
T24622 |
prep |
for,pairs |
R7051 |
T24625 |
T24626 |
compound |
mouse,G3PDH |
R7052 |
T24626 |
T24624 |
pobj |
G3PDH,for |
R7053 |
T24627 |
T24628 |
nummod |
5,ACCACAGTCCATGCCATCAC |
R7054 |
T24628 |
T24623 |
attr |
ACCACAGTCCATGCCATCAC,were |
R7055 |
T24629 |
T24627 |
punct |
',5 |
R7056 |
T24630 |
T24628 |
punct |
-,ACCACAGTCCATGCCATCAC |
R7057 |
T24631 |
T24628 |
punct |
-,ACCACAGTCCATGCCATCAC |
R7058 |
T24632 |
T24628 |
nummod |
3,ACCACAGTCCATGCCATCAC |
R7059 |
T24633 |
T24628 |
punct |
',ACCACAGTCCATGCCATCAC |
R7060 |
T24634 |
T24628 |
cc |
and,ACCACAGTCCATGCCATCAC |
R7061 |
T24635 |
T24636 |
nummod |
5,TCCACCACCCTGTTGCTGTA |
R7062 |
T24636 |
T24628 |
conj |
TCCACCACCCTGTTGCTGTA,ACCACAGTCCATGCCATCAC |
R7063 |
T24637 |
T24635 |
punct |
',5 |
R7064 |
T24638 |
T24636 |
punct |
-,TCCACCACCCTGTTGCTGTA |
R7065 |
T24639 |
T24636 |
punct |
-,TCCACCACCCTGTTGCTGTA |
R7066 |
T24640 |
T24636 |
nummod |
3,TCCACCACCCTGTTGCTGTA |
R7067 |
T24641 |
T24636 |
punct |
',TCCACCACCCTGTTGCTGTA |
R7068 |
T24642 |
T24643 |
dep |
which,amplified |
R7069 |
T24643 |
T24628 |
relcl |
amplified,ACCACAGTCCATGCCATCAC |
R7070 |
T24644 |
T24645 |
det |
a,product |
R7071 |
T24645 |
T24643 |
dobj |
product,amplified |
R7072 |
T24646 |
T24647 |
nummod |
452,bp |
R7073 |
T24647 |
T24645 |
compound |
bp,product |
R7074 |
T24648 |
T24647 |
punct |
-,bp |
R7075 |
T24649 |
T24650 |
punct |
(,587 |
R7076 |
T24650 |
T24643 |
parataxis |
587,amplified |
R7077 |
T24651 |
T24650 |
nmod |
positions,587 |
R7078 |
T24652 |
T24653 |
punct |
–,1038 |
R7079 |
T24653 |
T24650 |
prep |
1038,587 |
R7080 |
T24654 |
T24650 |
prep |
of,587 |
R7081 |
T24655 |
T24656 |
nmod |
Genbank,BC85275 |
R7082 |
T24656 |
T24654 |
pobj |
BC85275,of |
R7083 |
T24657 |
T24656 |
nmod |
Accession,BC85275 |
R7084 |
T24658 |
T24656 |
nmod |
Number,BC85275 |
R7085 |
T24659 |
T24656 |
punct |
#,BC85275 |
R7086 |
T24660 |
T24650 |
punct |
),587 |
R7087 |
T24661 |
T24623 |
punct |
.,were |
R7088 |
T25116 |
T25117 |
nmod |
Yeast,screening |
R7089 |
T25118 |
T25119 |
nummod |
two,hybrid |
R7090 |
T25119 |
T25117 |
compound |
hybrid,screening |
R7091 |
T25120 |
T25119 |
punct |
-,hybrid |
R7092 |
T25121 |
T25117 |
cc |
and,screening |
R7093 |
T25122 |
T25123 |
compound |
GAL4,assay |
R7094 |
T25123 |
T25117 |
conj |
assay,screening |
R7095 |
T25125 |
T25126 |
nsubj |
We,carried |
R7096 |
T25127 |
T25126 |
prt |
out,carried |
R7097 |
T25128 |
T25129 |
nmod |
yeast,experiments |
R7098 |
T25129 |
T25126 |
dobj |
experiments,carried |
R7099 |
T25130 |
T25131 |
nummod |
two,hybrid |
R7100 |
T25131 |
T25129 |
compound |
hybrid,experiments |
R7101 |
T25132 |
T25131 |
punct |
-,hybrid |
R7102 |
T25133 |
T25126 |
advcl |
using,carried |
R7103 |
T25134 |
T25135 |
det |
the,system |
R7104 |
T25135 |
T25133 |
dobj |
system,using |
R7105 |
T25136 |
T25135 |
nmod |
MATCHMAKER,system |
R7106 |
T25137 |
T25135 |
nmod |
GAL4,system |
R7107 |
T25138 |
T25139 |
nummod |
two,hybrid |
R7108 |
T25139 |
T25135 |
compound |
hybrid,system |
R7109 |
T25140 |
T25139 |
punct |
-,hybrid |
R7110 |
T25141 |
T25135 |
nummod |
3,system |
R7111 |
T25142 |
T25143 |
punct |
(,Bioscience |
R7112 |
T25143 |
T25135 |
parataxis |
Bioscience,system |
R7113 |
T25144 |
T25143 |
compound |
BD,Bioscience |
R7114 |
T25145 |
T25143 |
punct |
),Bioscience |
R7115 |
T25146 |
T25147 |
mark |
as,recommended |
R7116 |
T25147 |
T25126 |
advcl |
recommended,carried |
R7117 |
T25148 |
T25147 |
agent |
by,recommended |
R7118 |
T25149 |
T25150 |
det |
the,manufacturer |
R7119 |
T25150 |
T25148 |
pobj |
manufacturer,by |
R7120 |
T25151 |
T25126 |
punct |
.,carried |
R7121 |
T25153 |
T25154 |
nsubj |
We,cloned |
R7122 |
T25155 |
T25156 |
det |
the,s |
R7123 |
T25156 |
T25154 |
dobj |
s,cloned |
R7124 |
T25157 |
T25158 |
amod |
full,length |
R7125 |
T25158 |
T25156 |
compound |
length,s |
R7126 |
T25159 |
T25158 |
punct |
-,length |
R7127 |
T25160 |
T25156 |
compound |
mr,s |
R7128 |
T25161 |
T25156 |
punct |
-,s |
R7129 |
T25162 |
T25154 |
prep |
into,cloned |
R7130 |
T25163 |
T25164 |
det |
the,vector |
R7131 |
T25164 |
T25162 |
pobj |
vector,into |
R7132 |
T25165 |
T25164 |
compound |
pGBKT7,vector |
R7133 |
T25166 |
T25154 |
cc |
and,cloned |
R7134 |
T25167 |
T25154 |
conj |
used,cloned |
R7135 |
T25168 |
T25167 |
dobj |
it,used |
R7136 |
T25169 |
T25170 |
aux |
to,screen |
R7137 |
T25170 |
T25167 |
advcl |
screen,used |
R7138 |
T25171 |
T25172 |
det |
a,library |
R7139 |
T25172 |
T25170 |
dobj |
library,screen |
R7140 |
T25173 |
T25172 |
prep |
of,library |
R7141 |
T25174 |
T25175 |
nmod |
mouse,cDNAs |
R7142 |
T25175 |
T25173 |
pobj |
cDNAs,of |
R7143 |
T25176 |
T25175 |
nmod |
P0,cDNAs |
R7144 |
T25177 |
T25178 |
punct |
-,P3 |
R7145 |
T25178 |
T25176 |
prep |
P3,P0 |
R7146 |
T25179 |
T25175 |
amod |
retinal,cDNAs |
R7147 |
T25180 |
T25175 |
prep |
in,cDNAs |
R7148 |
T25181 |
T25182 |
det |
the,vector |
R7149 |
T25182 |
T25180 |
pobj |
vector,in |
R7150 |
T25183 |
T25182 |
compound |
pGADT7,vector |
R7151 |
T25184 |
T25154 |
punct |
.,cloned |
R7152 |
T25186 |
T25187 |
nsubj |
Transformants,picked |
R7153 |
T25188 |
T25189 |
dep |
that,conferred |
R7154 |
T25189 |
T25186 |
relcl |
conferred,Transformants |
R7155 |
T25190 |
T25189 |
dobj |
growth,conferred |
R7156 |
T25191 |
T25187 |
aux |
were,picked |
R7157 |
T25192 |
T25187 |
punct |
", ",picked |
R7158 |
T25193 |
T25187 |
conj |
isolated,picked |
R7159 |
T25194 |
T25193 |
cc |
and,isolated |
R7160 |
T25195 |
T25193 |
conj |
re-introduced,isolated |
R7161 |
T25196 |
T25195 |
prep |
with,re-introduced |
R7162 |
T25197 |
T25198 |
det |
the,bait |
R7163 |
T25198 |
T25196 |
pobj |
bait,with |
R7164 |
T25199 |
T25195 |
prep |
into,re-introduced |
R7165 |
T25200 |
T25199 |
pobj |
AH109,into |
R7166 |
T25201 |
T25202 |
aux |
to,confirm |
R7167 |
T25202 |
T25187 |
advcl |
confirm,picked |
R7168 |
T25203 |
T25202 |
dobj |
interaction,confirm |
R7169 |
T25204 |
T25187 |
punct |
.,picked |
R7170 |
T25206 |
T25207 |
compound |
Plasmid,DNA |
R7171 |
T25207 |
T25208 |
nsubjpass |
DNA,isolated |
R7172 |
T25209 |
T25208 |
auxpass |
was,isolated |
R7173 |
T25210 |
T25208 |
prep |
from,isolated |
R7174 |
T25211 |
T25210 |
pobj |
yeast,from |
R7175 |
T25212 |
T25208 |
advcl |
using,isolated |
R7176 |
T25213 |
T25214 |
compound |
RPM,Kit |
R7177 |
T25214 |
T25212 |
dobj |
Kit,using |
R7178 |
T25215 |
T25216 |
compound |
Yeast,Plasmid |
R7179 |
T25216 |
T25217 |
compound |
Plasmid,Isolation |
R7180 |
T25217 |
T25214 |
compound |
Isolation,Kit |
R7181 |
T25218 |
T25219 |
punct |
(,Qbiogene |
R7182 |
T25219 |
T25214 |
parataxis |
Qbiogene,Kit |
R7183 |
T25220 |
T25219 |
punct |
),Qbiogene |
R7184 |
T25221 |
T25208 |
punct |
.,isolated |
R7185 |
T25223 |
T25224 |
prep |
In,picked |
R7186 |
T25225 |
T25223 |
pobj |
order,In |
R7187 |
T25226 |
T25227 |
aux |
to,confirm |
R7188 |
T25227 |
T25225 |
acl |
confirm,order |
R7189 |
T25228 |
T25229 |
det |
the,interactions |
R7190 |
T25229 |
T25227 |
dobj |
interactions,confirm |
R7191 |
T25230 |
T25229 |
compound |
protein,interactions |
R7192 |
T25231 |
T25224 |
punct |
", ",picked |
R7193 |
T25232 |
T25233 |
amod |
single,colonies |
R7194 |
T25233 |
T25224 |
nsubjpass |
colonies,picked |
R7195 |
T25234 |
T25224 |
auxpass |
were,picked |
R7196 |
T25235 |
T25224 |
cc |
and,picked |
R7197 |
T25236 |
T25224 |
conj |
grown,picked |
R7198 |
T25237 |
T25236 |
advmod |
individually,grown |
R7199 |
T25238 |
T25236 |
prep |
in,grown |
R7200 |
T25239 |
T25240 |
amod |
synthetic,media |
R7201 |
T25240 |
T25238 |
pobj |
media,in |
R7202 |
T25241 |
T25240 |
amod |
complete,media |
R7203 |
T25242 |
T25240 |
acl |
lacking,media |
R7204 |
T25243 |
T25244 |
nmod |
leucine,tryptophan |
R7205 |
T25244 |
T25242 |
dobj |
tryptophan,lacking |
R7206 |
T25245 |
T25244 |
punct |
", ",tryptophan |
R7207 |
T25246 |
T25242 |
cc |
and,lacking |
R7208 |
T25247 |
T25242 |
conj |
containing,lacking |
R7209 |
T25248 |
T25249 |
compound |
X,gal |
R7210 |
T25249 |
T25247 |
dobj |
gal,containing |
R7211 |
T25250 |
T25249 |
punct |
-,gal |
R7212 |
T25251 |
T25224 |
punct |
.,picked |
R7213 |
T25253 |
T25254 |
prep |
After,selected |
R7214 |
T25255 |
T25256 |
quantmod |
4,5 |
R7215 |
T25256 |
T25258 |
nummod |
5,days |
R7216 |
T25257 |
T25256 |
punct |
–,5 |
R7217 |
T25258 |
T25253 |
pobj |
days,After |
R7218 |
T25259 |
T25254 |
punct |
", ",selected |
R7219 |
T25260 |
T25261 |
compound |
X,gal |
R7220 |
T25261 |
T25263 |
npadvmod |
gal,positive |
R7221 |
T25262 |
T25261 |
compound |
-,gal |
R7222 |
T25263 |
T25264 |
amod |
positive,clones |
R7223 |
T25264 |
T25254 |
nsubjpass |
clones,selected |
R7224 |
T25265 |
T25254 |
auxpass |
were,selected |
R7225 |
T25266 |
T25254 |
cc |
and,selected |
R7226 |
T25267 |
T25254 |
conj |
analyzed,selected |
R7227 |
T25268 |
T25254 |
punct |
.,selected |
R7228 |
T25270 |
T25271 |
aux |
To,test |
R7229 |
T25271 |
T25272 |
advcl |
test,subcloned |
R7230 |
T25273 |
T25274 |
compound |
self,interaction |
R7231 |
T25274 |
T25271 |
dobj |
interaction,test |
R7232 |
T25275 |
T25274 |
punct |
-,interaction |
R7233 |
T25276 |
T25274 |
prep |
of,interaction |
R7234 |
T25277 |
T25278 |
compound |
mr,s |
R7235 |
T25278 |
T25276 |
pobj |
s,of |
R7236 |
T25279 |
T25278 |
punct |
-,s |
R7237 |
T25280 |
T25272 |
punct |
", ",subcloned |
R7238 |
T25281 |
T25272 |
nsubj |
we,subcloned |
R7239 |
T25282 |
T25283 |
det |
the,length |
R7240 |
T25283 |
T25272 |
dobj |
length,subcloned |
R7241 |
T25284 |
T25283 |
amod |
full,length |
R7242 |
T25285 |
T25283 |
punct |
-,length |
R7243 |
T25286 |
T25283 |
punct |
", ",length |
R7244 |
T25287 |
T25288 |
compound |
N,terminus |
R7245 |
T25288 |
T25283 |
conj |
terminus,length |
R7246 |
T25289 |
T25288 |
punct |
-,terminus |
R7247 |
T25290 |
T25291 |
punct |
(,1 |
R7248 |
T25291 |
T25288 |
parataxis |
1,terminus |
R7249 |
T25292 |
T25291 |
nmod |
amino,1 |
R7250 |
T25293 |
T25291 |
nmod |
acids,1 |
R7251 |
T25294 |
T25295 |
punct |
–,400 |
R7252 |
T25295 |
T25291 |
prep |
400,1 |
R7253 |
T25296 |
T25291 |
punct |
),1 |
R7254 |
T25297 |
T25288 |
cc |
and,terminus |
R7255 |
T25298 |
T25299 |
compound |
C,terminus |
R7256 |
T25299 |
T25288 |
conj |
terminus,terminus |
R7257 |
T25300 |
T25299 |
punct |
-,terminus |
R7258 |
T25301 |
T25302 |
punct |
(,391 |
R7259 |
T25302 |
T25299 |
parataxis |
391,terminus |
R7260 |
T25303 |
T25302 |
nmod |
amino,391 |
R7261 |
T25304 |
T25302 |
nmod |
acids,391 |
R7262 |
T25305 |
T25306 |
punct |
–,542 |
R7263 |
T25306 |
T25302 |
prep |
542,391 |
R7264 |
T25307 |
T25302 |
punct |
),391 |
R7265 |
T25308 |
T25283 |
prep |
of,length |
R7266 |
T25309 |
T25310 |
compound |
mr,s |
R7267 |
T25310 |
T25308 |
pobj |
s,of |
R7268 |
T25311 |
T25310 |
punct |
-,s |
R7269 |
T25312 |
T25272 |
prep |
into,subcloned |
R7270 |
T25313 |
T25314 |
nmod |
pGBKT7,vectors |
R7271 |
T25314 |
T25312 |
pobj |
vectors,into |
R7272 |
T25315 |
T25313 |
cc |
and,pGBKT7 |
R7273 |
T25316 |
T25313 |
conj |
pGADT7,pGBKT7 |
R7274 |
T25317 |
T25272 |
punct |
.,subcloned |
R7275 |
T25319 |
T25320 |
nsubj |
We,assessed |
R7276 |
T25321 |
T25320 |
dobj |
interactions,assessed |
R7277 |
T25322 |
T25320 |
prep |
by,assessed |
R7278 |
T25323 |
T25322 |
pcomp |
scoring,by |
R7279 |
T25324 |
T25325 |
amod |
blue,color |
R7280 |
T25325 |
T25323 |
dobj |
color,scoring |
R7281 |
T25326 |
T25323 |
prep |
on,scoring |
R7282 |
T25327 |
T25326 |
pobj |
plates,on |
R7283 |
T25328 |
T25327 |
prep |
of,plates |
R7284 |
T25329 |
T25328 |
pobj |
medium,of |
R7285 |
T25330 |
T25327 |
acl |
containing,plates |
R7286 |
T25331 |
T25332 |
compound |
X,gal |
R7287 |
T25332 |
T25330 |
dobj |
gal,containing |
R7288 |
T25333 |
T25332 |
punct |
-,gal |
R7289 |
T25334 |
T25320 |
punct |
.,assessed |
R7290 |
T26198 |
T26199 |
compound |
Immunoprecipitation,assay |
R7291 |
T26201 |
T26202 |
prep |
For,subcloned |
R7292 |
T26203 |
T26204 |
compound |
immunoprecipitation,assay |
R7293 |
T26204 |
T26201 |
pobj |
assay,For |
R7294 |
T26205 |
T26202 |
punct |
", ",subcloned |
R7295 |
T26206 |
T26207 |
nummod |
4,hemagglutinin |
R7296 |
T26207 |
T26209 |
npadvmod |
hemagglutinin,tagged |
R7297 |
T26208 |
T26206 |
punct |
×,4 |
R7298 |
T26209 |
T26217 |
amod |
tagged,fragment |
R7299 |
T26210 |
T26207 |
punct |
(,hemagglutinin |
R7300 |
T26211 |
T26207 |
appos |
HA,hemagglutinin |
R7301 |
T26212 |
T26207 |
punct |
),hemagglutinin |
R7302 |
T26213 |
T26207 |
cc |
or,hemagglutinin |
R7303 |
T26214 |
T26215 |
nummod |
3,Flag |
R7304 |
T26215 |
T26207 |
conj |
Flag,hemagglutinin |
R7305 |
T26216 |
T26214 |
punct |
×,3 |
R7306 |
T26217 |
T26202 |
nsubjpass |
fragment,subcloned |
R7307 |
T26218 |
T26217 |
compound |
cDNA,fragment |
R7308 |
T26219 |
T26217 |
acl |
encoding,fragment |
R7309 |
T26220 |
T26221 |
amod |
full,length |
R7310 |
T26221 |
T26223 |
compound |
length,s |
R7311 |
T26222 |
T26221 |
punct |
-,length |
R7312 |
T26223 |
T26219 |
dobj |
s,encoding |
R7313 |
T26224 |
T26223 |
compound |
mr,s |
R7314 |
T26225 |
T26223 |
punct |
-,s |
R7315 |
T26226 |
T26227 |
punct |
(,HA |
R7316 |
T26227 |
T26223 |
parataxis |
HA,s |
R7317 |
T26228 |
T26227 |
amod |
full,HA |
R7318 |
T26229 |
T26227 |
punct |
-,HA |
R7319 |
T26230 |
T26227 |
cc |
and,HA |
R7320 |
T26231 |
T26232 |
compound |
Flag,mrs |
R7321 |
T26232 |
T26227 |
conj |
mrs,HA |
R7322 |
T26233 |
T26232 |
punct |
-,mrs |
R7323 |
T26234 |
T26227 |
punct |
),HA |
R7324 |
T26235 |
T26223 |
punct |
", ",s |
R7325 |
T26236 |
T26237 |
det |
a,fragment |
R7326 |
T26237 |
T26223 |
conj |
fragment,s |
R7327 |
T26238 |
T26237 |
compound |
cDNA,fragment |
R7328 |
T26239 |
T26237 |
acl |
encoding,fragment |
R7329 |
T26240 |
T26241 |
nmod |
amino,1 |
R7330 |
T26241 |
T26239 |
dobj |
1,encoding |
R7331 |
T26242 |
T26241 |
nmod |
acids,1 |
R7332 |
T26243 |
T26244 |
punct |
–,400 |
R7333 |
T26244 |
T26241 |
prep |
400,1 |
R7334 |
T26245 |
T26246 |
punct |
(,HA |
R7335 |
T26246 |
T26237 |
parataxis |
HA,fragment |
R7336 |
T26247 |
T26246 |
compound |
ΔSAM,HA |
R7337 |
T26248 |
T26246 |
punct |
-,HA |
R7338 |
T26249 |
T26246 |
cc |
and,HA |
R7339 |
T26250 |
T26251 |
compound |
Flag,ΔSAM |
R7340 |
T26251 |
T26246 |
conj |
ΔSAM,HA |
R7341 |
T26252 |
T26251 |
punct |
-,ΔSAM |
R7342 |
T26253 |
T26246 |
punct |
),HA |
R7343 |
T26254 |
T26237 |
punct |
", ",fragment |
R7344 |
T26255 |
T26237 |
cc |
and,fragment |
R7345 |
T26256 |
T26257 |
det |
a,fragment |
R7346 |
T26257 |
T26237 |
conj |
fragment,fragment |
R7347 |
T26258 |
T26257 |
compound |
cDNA,fragment |
R7348 |
T26259 |
T26257 |
acl |
encoding,fragment |
R7349 |
T26260 |
T26261 |
nmod |
amino,400 |
R7350 |
T26261 |
T26259 |
dobj |
400,encoding |
R7351 |
T26262 |
T26261 |
nmod |
acids,400 |
R7352 |
T26263 |
T26264 |
punct |
–,542 |
R7353 |
T26264 |
T26261 |
prep |
542,400 |
R7354 |
T26265 |
T26266 |
punct |
(,SAM |
R7355 |
T26266 |
T26257 |
parataxis |
SAM,fragment |
R7356 |
T26267 |
T26266 |
compound |
Flag,SAM |
R7357 |
T26268 |
T26266 |
punct |
-,SAM |
R7358 |
T26269 |
T26266 |
punct |
),SAM |
R7359 |
T26270 |
T26202 |
auxpass |
were,subcloned |
R7360 |
T26271 |
T26202 |
prep |
into,subcloned |
R7361 |
T26272 |
T26273 |
det |
the,vector |
R7362 |
T26273 |
T26271 |
pobj |
vector,into |
R7363 |
T26274 |
T26273 |
nmod |
pcDNA3,vector |
R7364 |
T26275 |
T26276 |
punct |
(,Invitrogen |
R7365 |
T26276 |
T26274 |
parataxis |
Invitrogen,pcDNA3 |
R7366 |
T26277 |
T26276 |
punct |
),Invitrogen |
R7367 |
T26278 |
T26273 |
compound |
expression,vector |
R7368 |
T26279 |
T26202 |
punct |
.,subcloned |
R7369 |
T26281 |
T26282 |
nsubj |
We,constructed |
R7370 |
T26283 |
T26282 |
advmod |
also,constructed |
R7371 |
T26284 |
T26285 |
nummod |
two,mutants |
R7372 |
T26285 |
T26282 |
dobj |
mutants,constructed |
R7373 |
T26286 |
T26287 |
npadvmod |
site,directed |
R7374 |
T26287 |
T26285 |
amod |
directed,mutants |
R7375 |
T26288 |
T26287 |
punct |
-,directed |
R7376 |
T26289 |
T26285 |
punct |
", ",mutants |
R7377 |
T26290 |
T26291 |
compound |
Flag,W404A |
R7378 |
T26291 |
T26285 |
appos |
W404A,mutants |
R7379 |
T26292 |
T26291 |
punct |
-,W404A |
R7380 |
T26293 |
T26291 |
cc |
and,W404A |
R7381 |
T26294 |
T26295 |
compound |
Flag,G453A |
R7382 |
T26295 |
T26291 |
conj |
G453A,W404A |
R7383 |
T26296 |
T26295 |
punct |
-,G453A |
R7384 |
T26297 |
T26282 |
punct |
", ",constructed |
R7385 |
T26298 |
T26282 |
advcl |
using,constructed |
R7386 |
T26299 |
T26298 |
dobj |
PCR,using |
R7387 |
T26300 |
T26282 |
punct |
.,constructed |
R7388 |
T26302 |
T26303 |
nsubjpass |
Each,introduced |
R7389 |
T26304 |
T26302 |
prep |
of,Each |
R7390 |
T26305 |
T26306 |
det |
these,mutations |
R7391 |
T26306 |
T26304 |
pobj |
mutations,of |
R7392 |
T26307 |
T26303 |
auxpass |
was,introduced |
R7393 |
T26308 |
T26303 |
advmod |
also,introduced |
R7394 |
T26309 |
T26303 |
prep |
into,introduced |
R7395 |
T26310 |
T26309 |
pobj |
Flag,into |
R7396 |
T26311 |
T26310 |
punct |
-,Flag |
R7397 |
T26312 |
T26313 |
compound |
mr,s |
R7398 |
T26313 |
T26310 |
appos |
s,Flag |
R7399 |
T26314 |
T26313 |
punct |
-,s |
R7400 |
T26315 |
T26303 |
punct |
.,introduced |
R7401 |
T26317 |
T26318 |
nsubj |
We,transfected |
R7402 |
T26319 |
T26320 |
compound |
HEK293T,cells |
R7403 |
T26320 |
T26318 |
dobj |
cells,transfected |
R7404 |
T26321 |
T26318 |
prep |
with,transfected |
R7405 |
T26322 |
T26323 |
nummod |
5,μg |
R7406 |
T26323 |
T26321 |
pobj |
μg,with |
R7407 |
T26324 |
T26323 |
prep |
of,μg |
R7408 |
T26325 |
T26326 |
compound |
plasmid,DNA |
R7409 |
T26326 |
T26324 |
pobj |
DNA,of |
R7410 |
T26327 |
T26323 |
prep |
per,μg |
R7411 |
T26328 |
T26329 |
nummod |
6,cm |
R7412 |
T26329 |
T26330 |
compound |
cm,dish |
R7413 |
T26330 |
T26327 |
pobj |
dish,per |
R7414 |
T26331 |
T26318 |
prep |
by,transfected |
R7415 |
T26332 |
T26333 |
compound |
calcium,phosphate |
R7416 |
T26333 |
T26334 |
compound |
phosphate,method |
R7417 |
T26334 |
T26331 |
pobj |
method,by |
R7418 |
T26335 |
T26318 |
punct |
.,transfected |
R7419 |
T26337 |
T26338 |
advmod |
Approximately,48 |
R7420 |
T26338 |
T26339 |
nummod |
48,hr |
R7421 |
T26339 |
T26340 |
npadvmod |
hr,after |
R7422 |
T26340 |
T26341 |
prep |
after,harvested |
R7423 |
T26342 |
T26340 |
pobj |
transfection,after |
R7424 |
T26343 |
T26341 |
punct |
", ",harvested |
R7425 |
T26344 |
T26341 |
nsubjpass |
cells,harvested |
R7426 |
T26345 |
T26341 |
auxpass |
were,harvested |
R7427 |
T26346 |
T26341 |
prep |
in,harvested |
R7428 |
T26347 |
T26348 |
compound |
immunoprecipitation,buffer |
R7429 |
T26348 |
T26346 |
pobj |
buffer,in |
R7430 |
T26349 |
T26350 |
punct |
(,HCl |
R7431 |
T26350 |
T26341 |
parataxis |
HCl,harvested |
R7432 |
T26351 |
T26352 |
nummod |
50,mM |
R7433 |
T26352 |
T26350 |
compound |
mM,HCl |
R7434 |
T26353 |
T26350 |
compound |
Tris,HCl |
R7435 |
T26354 |
T26350 |
punct |
-,HCl |
R7436 |
T26355 |
T26356 |
punct |
[,pH |
R7437 |
T26356 |
T26350 |
parataxis |
pH,HCl |
R7438 |
T26357 |
T26356 |
nummod |
7.5,pH |
R7439 |
T26358 |
T26356 |
punct |
],pH |
R7440 |
T26359 |
T26350 |
punct |
", ",HCl |
R7441 |
T26360 |
T26361 |
nummod |
1,mM |
R7442 |
T26361 |
T26362 |
compound |
mM,EDTA |
R7443 |
T26362 |
T26350 |
appos |
EDTA,HCl |
R7444 |
T26363 |
T26350 |
punct |
", ",HCl |
R7445 |
T26364 |
T26365 |
nummod |
2,mM |
R7446 |
T26365 |
T26366 |
compound |
mM,MgCl2 |
R7447 |
T26366 |
T26350 |
appos |
MgCl2,HCl |
R7448 |
T26367 |
T26350 |
punct |
", ",HCl |
R7449 |
T26368 |
T26369 |
nummod |
150,mM |
R7450 |
T26369 |
T26370 |
compound |
mM,NaCl |
R7451 |
T26370 |
T26350 |
appos |
NaCl,HCl |
R7452 |
T26371 |
T26350 |
punct |
", ",HCl |
R7453 |
T26372 |
T26373 |
nummod |
1,mM |
R7454 |
T26373 |
T26374 |
compound |
mM,fluoride |
R7455 |
T26374 |
T26350 |
appos |
fluoride,HCl |
R7456 |
T26375 |
T26374 |
compound |
phenylmethylsulfonyl,fluoride |
R7457 |
T26376 |
T26377 |
punct |
[,Wako |
R7458 |
T26377 |
T26374 |
parataxis |
Wako,fluoride |
R7459 |
T26378 |
T26377 |
punct |
],Wako |
R7460 |
T26379 |
T26350 |
punct |
", ",HCl |
R7461 |
T26380 |
T26381 |
nummod |
1,% |
R7462 |
T26381 |
T26382 |
compound |
%,P |
R7463 |
T26382 |
T26350 |
appos |
P,HCl |
R7464 |
T26383 |
T26382 |
compound |
Nonidet,P |
R7465 |
T26384 |
T26382 |
punct |
-,P |
R7466 |
T26385 |
T26382 |
nummod |
40,P |
R7467 |
T26386 |
T26350 |
punct |
", ",HCl |
R7468 |
T26387 |
T26388 |
nummod |
10,% |
R7469 |
T26388 |
T26389 |
compound |
%,glycerol |
R7470 |
T26389 |
T26350 |
appos |
glycerol,HCl |
R7471 |
T26390 |
T26350 |
punct |
),HCl |
R7472 |
T26391 |
T26341 |
prep |
in,harvested |
R7473 |
T26392 |
T26393 |
det |
the,presence |
R7474 |
T26393 |
T26391 |
pobj |
presence,in |
R7475 |
T26394 |
T26393 |
prep |
of,presence |
R7476 |
T26395 |
T26396 |
compound |
protease,inhibitor |
R7477 |
T26396 |
T26397 |
compound |
inhibitor,tablets |
R7478 |
T26397 |
T26394 |
pobj |
tablets,of |
R7479 |
T26398 |
T26397 |
compound |
cocktail,tablets |
R7480 |
T26399 |
T26400 |
punct |
(,Roche |
R7481 |
T26400 |
T26397 |
parataxis |
Roche,tablets |
R7482 |
T26401 |
T26400 |
punct |
),Roche |
R7483 |
T26402 |
T26341 |
punct |
.,harvested |
R7484 |
T26404 |
T26405 |
prep |
For,mixed |
R7485 |
T26406 |
T26407 |
det |
each,reaction |
R7486 |
T26407 |
T26404 |
pobj |
reaction,For |
R7487 |
T26408 |
T26405 |
punct |
", ",mixed |
R7488 |
T26409 |
T26410 |
nummod |
1,mg |
R7489 |
T26410 |
T26405 |
nsubjpass |
mg,mixed |
R7490 |
T26411 |
T26410 |
prep |
of,mg |
R7491 |
T26412 |
T26413 |
compound |
cell,lysate |
R7492 |
T26413 |
T26411 |
pobj |
lysate,of |
R7493 |
T26414 |
T26405 |
auxpass |
was,mixed |
R7494 |
T26415 |
T26405 |
prep |
with,mixed |
R7495 |
T26416 |
T26417 |
nummod |
0.5,μg |
R7496 |
T26417 |
T26415 |
pobj |
μg,with |
R7497 |
T26418 |
T26417 |
prep |
of,μg |
R7498 |
T26419 |
T26420 |
amod |
anti-Flag,antibody |
R7499 |
T26420 |
T26418 |
pobj |
antibody,of |
R7500 |
T26421 |
T26422 |
punct |
(,F3165 |
R7501 |
T26422 |
T26420 |
parataxis |
F3165,antibody |
R7502 |
T26423 |
T26422 |
nmod |
SIGMA,F3165 |
R7503 |
T26424 |
T26422 |
punct |
", ",F3165 |
R7504 |
T26425 |
T26422 |
punct |
),F3165 |
R7505 |
T26426 |
T26417 |
cc |
and,μg |
R7506 |
T26427 |
T26428 |
nummod |
15,μl |
R7507 |
T26428 |
T26417 |
conj |
μl,μg |
R7508 |
T26429 |
T26428 |
prep |
of,μl |
R7509 |
T26430 |
T26431 |
compound |
protein,Sepharose |
R7510 |
T26431 |
T26429 |
pobj |
Sepharose,of |
R7511 |
T26432 |
T26431 |
compound |
G,Sepharose |
R7512 |
T26433 |
T26431 |
punct |
-,Sepharose |
R7513 |
T26434 |
T26435 |
punct |
(,Amersham |
R7514 |
T26435 |
T26431 |
parataxis |
Amersham,Sepharose |
R7515 |
T26436 |
T26435 |
punct |
),Amersham |
R7516 |
T26437 |
T26405 |
prep |
on,mixed |
R7517 |
T26438 |
T26439 |
det |
a,wheel |
R7518 |
T26439 |
T26437 |
pobj |
wheel,on |
R7519 |
T26440 |
T26439 |
amod |
rotating,wheel |
R7520 |
T26441 |
T26405 |
prep |
at,mixed |
R7521 |
T26442 |
T26443 |
nummod |
4,°C |
R7522 |
T26443 |
T26441 |
pobj |
°C,at |
R7523 |
T26444 |
T26405 |
prep |
for,mixed |
R7524 |
T26445 |
T26446 |
nummod |
2,hrs |
R7525 |
T26446 |
T26444 |
pobj |
hrs,for |
R7526 |
T26447 |
T26405 |
punct |
.,mixed |
R7527 |
T26449 |
T26450 |
compound |
Protein,concentration |
R7528 |
T26450 |
T26451 |
nsubjpass |
concentration,determined |
R7529 |
T26452 |
T26451 |
auxpass |
was,determined |
R7530 |
T26453 |
T26451 |
prep |
by,determined |
R7531 |
T26454 |
T26455 |
det |
the,system |
R7532 |
T26455 |
T26453 |
pobj |
system,by |
R7533 |
T26456 |
T26457 |
compound |
BCA,assay |
R7534 |
T26457 |
T26455 |
compound |
assay,system |
R7535 |
T26458 |
T26457 |
compound |
protein,assay |
R7536 |
T26459 |
T26460 |
punct |
(,Pierce |
R7537 |
T26460 |
T26455 |
parataxis |
Pierce,system |
R7538 |
T26461 |
T26460 |
punct |
),Pierce |
R7539 |
T26462 |
T26451 |
punct |
.,determined |
R7540 |
T26464 |
T26465 |
det |
The,beads |
R7541 |
T26465 |
T26466 |
nsubjpass |
beads,washed |
R7542 |
T26467 |
T26466 |
auxpass |
were,washed |
R7543 |
T26468 |
T26466 |
advmod |
then,washed |
R7544 |
T26469 |
T26470 |
nummod |
three,times |
R7545 |
T26470 |
T26466 |
npadvmod |
times,washed |
R7546 |
T26471 |
T26466 |
prep |
with,washed |
R7547 |
T26472 |
T26473 |
compound |
immunoprecipitation,buffer |
R7548 |
T26473 |
T26471 |
pobj |
buffer,with |
R7549 |
T26474 |
T26466 |
cc |
and,washed |
R7550 |
T26475 |
T26466 |
conj |
followed,washed |
R7551 |
T26476 |
T26475 |
agent |
by,followed |
R7552 |
T26477 |
T26478 |
nummod |
three,times |
R7553 |
T26478 |
T26476 |
pobj |
times,by |
R7554 |
T26479 |
T26478 |
prep |
with,times |
R7555 |
T26480 |
T26481 |
compound |
wash,buffer |
R7556 |
T26481 |
T26479 |
pobj |
buffer,with |
R7557 |
T26482 |
T26483 |
punct |
(,HCl |
R7558 |
T26483 |
T26481 |
parataxis |
HCl,buffer |
R7559 |
T26484 |
T26485 |
nummod |
50,mM |
R7560 |
T26485 |
T26483 |
compound |
mM,HCl |
R7561 |
T26486 |
T26483 |
compound |
Tris,HCl |
R7562 |
T26487 |
T26483 |
punct |
-,HCl |
R7563 |
T26488 |
T26489 |
punct |
[,pH |
R7564 |
T26489 |
T26483 |
parataxis |
pH,HCl |
R7565 |
T26490 |
T26489 |
nummod |
7.5,pH |
R7566 |
T26491 |
T26489 |
punct |
],pH |
R7567 |
T26492 |
T26483 |
punct |
", ",HCl |
R7568 |
T26493 |
T26494 |
nummod |
150,mM |
R7569 |
T26494 |
T26495 |
compound |
mM,NaCl |
R7570 |
T26495 |
T26483 |
appos |
NaCl,HCl |
R7571 |
T26496 |
T26483 |
punct |
", ",HCl |
R7572 |
T26497 |
T26498 |
nummod |
20,mM |
R7573 |
T26498 |
T26499 |
compound |
mM,MgCl2 |
R7574 |
T26499 |
T26483 |
appos |
MgCl2,HCl |
R7575 |
T26500 |
T26483 |
punct |
),HCl |
R7576 |
T26501 |
T26466 |
punct |
.,washed |
R7577 |
T26503 |
T26504 |
nsubjpass |
Proteins,boiled |
R7578 |
T26505 |
T26504 |
auxpass |
were,boiled |
R7579 |
T26506 |
T26504 |
advmod |
then,boiled |
R7580 |
T26507 |
T26504 |
prep |
for,boiled |
R7581 |
T26508 |
T26509 |
nummod |
5,min |
R7582 |
T26509 |
T26507 |
pobj |
min,for |
R7583 |
T26510 |
T26504 |
prep |
in,boiled |
R7584 |
T26511 |
T26512 |
compound |
SDS,buffer |
R7585 |
T26512 |
T26510 |
pobj |
buffer,in |
R7586 |
T26513 |
T26512 |
compound |
sample,buffer |
R7587 |
T26514 |
T26515 |
punct |
(,SDS |
R7588 |
T26515 |
T26512 |
parataxis |
SDS,buffer |
R7589 |
T26516 |
T26517 |
nummod |
1,% |
R7590 |
T26517 |
T26515 |
compound |
%,SDS |
R7591 |
T26518 |
T26515 |
punct |
", ",SDS |
R7592 |
T26519 |
T26520 |
nummod |
1,mM |
R7593 |
T26520 |
T26521 |
compound |
mM,Tris |
R7594 |
T26521 |
T26515 |
appos |
Tris,SDS |
R7595 |
T26522 |
T26523 |
punct |
[,pH |
R7596 |
T26523 |
T26521 |
parataxis |
pH,Tris |
R7597 |
T26524 |
T26523 |
nummod |
6.8,pH |
R7598 |
T26525 |
T26523 |
punct |
],pH |
R7599 |
T26526 |
T26515 |
punct |
", ",SDS |
R7600 |
T26527 |
T26528 |
nummod |
40,mM |
R7601 |
T26528 |
T26529 |
compound |
mM,DTT |
R7602 |
T26529 |
T26515 |
appos |
DTT,SDS |
R7603 |
T26530 |
T26515 |
punct |
", ",SDS |
R7604 |
T26531 |
T26532 |
nummod |
4,% |
R7605 |
T26532 |
T26533 |
compound |
%,glycerol |
R7606 |
T26533 |
T26515 |
appos |
glycerol,SDS |
R7607 |
T26534 |
T26515 |
punct |
", ",SDS |
R7608 |
T26535 |
T26536 |
nummod |
0.01,% |
R7609 |
T26536 |
T26537 |
compound |
%,Y |
R7610 |
T26537 |
T26515 |
appos |
Y,SDS |
R7611 |
T26538 |
T26537 |
compound |
pyronine,Y |
R7612 |
T26539 |
T26515 |
punct |
),SDS |
R7613 |
T26540 |
T26504 |
punct |
.,boiled |
R7614 |
T26542 |
T26543 |
det |
The,supernatants |
R7615 |
T26543 |
T26544 |
nsubjpass |
supernatants,fractionated |
R7616 |
T26545 |
T26544 |
auxpass |
were,fractionated |
R7617 |
T26546 |
T26544 |
prep |
by,fractionated |
R7618 |
T26547 |
T26548 |
nmod |
sodium,sulfate |
R7619 |
T26548 |
T26550 |
nmod |
sulfate,gel |
R7620 |
T26549 |
T26548 |
nmod |
dodecyl,sulfate |
R7621 |
T26550 |
T26553 |
compound |
gel,electrophoresis |
R7622 |
T26551 |
T26548 |
punct |
-,sulfate |
R7623 |
T26552 |
T26548 |
appos |
polyacrylamide,sulfate |
R7624 |
T26553 |
T26546 |
pobj |
electrophoresis,by |
R7625 |
T26554 |
T26555 |
punct |
(,PAGE |
R7626 |
T26555 |
T26553 |
parataxis |
PAGE,electrophoresis |
R7627 |
T26556 |
T26555 |
compound |
SDS,PAGE |
R7628 |
T26557 |
T26555 |
punct |
-,PAGE |
R7629 |
T26558 |
T26555 |
punct |
),PAGE |
R7630 |
T26559 |
T26544 |
cc |
and,fractionated |
R7631 |
T26560 |
T26544 |
conj |
transferred,fractionated |
R7632 |
T26561 |
T26560 |
prep |
to,transferred |
R7633 |
T26562 |
T26563 |
det |
the,membrane |
R7634 |
T26563 |
T26561 |
pobj |
membrane,to |
R7635 |
T26564 |
T26563 |
compound |
nitrocellulose,membrane |
R7636 |
T26565 |
T26566 |
punct |
(,Medium |
R7637 |
T26566 |
T26563 |
parataxis |
Medium,membrane |
R7638 |
T26567 |
T26568 |
compound |
Trans,Blot |
R7639 |
T26568 |
T26566 |
compound |
Blot,Medium |
R7640 |
T26569 |
T26568 |
punct |
-,Blot |
R7641 |
T26570 |
T26566 |
compound |
Transfer,Medium |
R7642 |
T26571 |
T26566 |
punct |
", ",Medium |
R7643 |
T26572 |
T26573 |
compound |
Bio,Rad |
R7644 |
T26573 |
T26566 |
appos |
Rad,Medium |
R7645 |
T26574 |
T26573 |
punct |
-,Rad |
R7646 |
T26575 |
T26566 |
punct |
),Medium |
R7647 |
T26576 |
T26544 |
punct |
.,fractionated |
R7648 |
T26578 |
T26579 |
compound |
Western,blotting |
R7649 |
T26579 |
T26580 |
nsubjpass |
blotting,performed |
R7650 |
T26581 |
T26580 |
auxpass |
was,performed |
R7651 |
T26582 |
T26580 |
prep |
with,performed |
R7652 |
T26583 |
T26584 |
nmod |
rabbit,antibody |
R7653 |
T26584 |
T26582 |
pobj |
antibody,with |
R7654 |
T26585 |
T26584 |
amod |
polyclonal,antibody |
R7655 |
T26586 |
T26584 |
amod |
anti-HA,antibody |
R7656 |
T26587 |
T26588 |
punct |
(,Cruz |
R7657 |
T26588 |
T26584 |
parataxis |
Cruz,antibody |
R7658 |
T26589 |
T26588 |
compound |
Santa,Cruz |
R7659 |
T26590 |
T26588 |
punct |
", ",Cruz |
R7660 |
T26591 |
T26592 |
punct |
#,sc |
R7661 |
T26592 |
T26588 |
appos |
sc,Cruz |
R7662 |
T26593 |
T26592 |
punct |
-,sc |
R7663 |
T26594 |
T26592 |
nummod |
805,sc |
R7664 |
T26595 |
T26588 |
punct |
),Cruz |
R7665 |
T26596 |
T26580 |
punct |
.,performed |
R7666 |
T26598 |
T26599 |
nsubjpass |
Signals,detected |
R7667 |
T26600 |
T26599 |
auxpass |
were,detected |
R7668 |
T26601 |
T26599 |
prep |
with,detected |
R7669 |
T26602 |
T26603 |
compound |
horseradish,peroxidase |
R7670 |
T26603 |
T26604 |
npadvmod |
peroxidase,conjugated |
R7671 |
T26604 |
T26606 |
amod |
conjugated,IgG |
R7672 |
T26605 |
T26604 |
punct |
-,conjugated |
R7673 |
T26606 |
T26601 |
pobj |
IgG,with |
R7674 |
T26607 |
T26606 |
nmod |
goat,IgG |
R7675 |
T26608 |
T26606 |
amod |
anti-rabbit,IgG |
R7676 |
T26609 |
T26606 |
cc |
and,IgG |
R7677 |
T26610 |
T26611 |
nmod |
ECL,System |
R7678 |
T26611 |
T26606 |
conj |
System,IgG |
R7679 |
T26612 |
T26610 |
cc |
plus,ECL |
R7680 |
T26613 |
T26614 |
compound |
Western,Blotting |
R7681 |
T26614 |
T26610 |
conj |
Blotting,ECL |
R7682 |
T26615 |
T26611 |
compound |
Detection,System |
R7683 |
T26616 |
T26617 |
punct |
(,Amersham |
R7684 |
T26617 |
T26611 |
parataxis |
Amersham,System |
R7685 |
T26618 |
T26617 |
punct |
),Amersham |
R7686 |
T26619 |
T26599 |
punct |
.,detected |
R7687 |
T27028 |
T27029 |
amod |
Subcellular,analysis |
R7688 |
T27030 |
T27029 |
compound |
localization,analysis |
R7689 |
T27032 |
T27033 |
nsubj |
We,transfected |
R7690 |
T27034 |
T27035 |
det |
the,plasmid |
R7691 |
T27035 |
T27033 |
dobj |
plasmid,transfected |
R7692 |
T27036 |
T27035 |
acl |
encoding,plasmid |
R7693 |
T27037 |
T27038 |
npadvmod |
HA,tagged |
R7694 |
T27038 |
T27040 |
amod |
tagged,s |
R7695 |
T27039 |
T27038 |
punct |
-,tagged |
R7696 |
T27040 |
T27036 |
dobj |
s,encoding |
R7697 |
T27041 |
T27042 |
amod |
full,length |
R7698 |
T27042 |
T27040 |
compound |
length,s |
R7699 |
T27043 |
T27042 |
punct |
-,length |
R7700 |
T27044 |
T27040 |
compound |
mr,s |
R7701 |
T27045 |
T27040 |
punct |
-,s |
R7702 |
T27046 |
T27033 |
prep |
into,transfected |
R7703 |
T27047 |
T27048 |
compound |
HEK293T,cells |
R7704 |
T27048 |
T27046 |
pobj |
cells,into |
R7705 |
T27049 |
T27033 |
punct |
", ",transfected |
R7706 |
T27050 |
T27033 |
conj |
seeded,transfected |
R7707 |
T27051 |
T27050 |
dobj |
cells,seeded |
R7708 |
T27052 |
T27050 |
prep |
on,seeded |
R7709 |
T27053 |
T27052 |
pobj |
coverslips,on |
R7710 |
T27054 |
T27053 |
acl |
coated,coverslips |
R7711 |
T27055 |
T27054 |
prep |
with,coated |
R7712 |
T27056 |
T27055 |
pobj |
collagen,with |
R7713 |
T27057 |
T27058 |
nummod |
48,hr |
R7714 |
T27058 |
T27059 |
npadvmod |
hr,after |
R7715 |
T27059 |
T27050 |
prep |
after,seeded |
R7716 |
T27060 |
T27059 |
pobj |
transfection,after |
R7717 |
T27061 |
T27050 |
punct |
", ",seeded |
R7718 |
T27062 |
T27050 |
conj |
fixed,seeded |
R7719 |
T27063 |
T27062 |
prep |
with,fixed |
R7720 |
T27064 |
T27065 |
nummod |
4,% |
R7721 |
T27065 |
T27066 |
compound |
%,paraformaldehyde |
R7722 |
T27066 |
T27063 |
pobj |
paraformaldehyde,with |
R7723 |
T27067 |
T27066 |
prep |
in,paraformaldehyde |
R7724 |
T27068 |
T27069 |
npadvmod |
phosphate,buffered |
R7725 |
T27069 |
T27071 |
amod |
buffered,saline |
R7726 |
T27070 |
T27069 |
punct |
-,buffered |
R7727 |
T27071 |
T27067 |
pobj |
saline,in |
R7728 |
T27072 |
T27071 |
punct |
(,saline |
R7729 |
T27073 |
T27071 |
appos |
PBS,saline |
R7730 |
T27074 |
T27062 |
punct |
),fixed |
R7731 |
T27075 |
T27062 |
prep |
at,fixed |
R7732 |
T27076 |
T27077 |
compound |
room,temperature |
R7733 |
T27077 |
T27075 |
pobj |
temperature,at |
R7734 |
T27078 |
T27062 |
prep |
for,fixed |
R7735 |
T27079 |
T27080 |
nummod |
20,min |
R7736 |
T27080 |
T27078 |
pobj |
min,for |
R7737 |
T27081 |
T27062 |
punct |
", ",fixed |
R7738 |
T27082 |
T27062 |
cc |
and,fixed |
R7739 |
T27083 |
T27062 |
conj |
washed,fixed |
R7740 |
T27084 |
T27083 |
prep |
with,washed |
R7741 |
T27085 |
T27084 |
pobj |
PBS,with |
R7742 |
T27086 |
T27033 |
punct |
.,transfected |
R7743 |
T27088 |
T27089 |
advmod |
Then,permeabilized |
R7744 |
T27090 |
T27089 |
nsubj |
we,permeabilized |
R7745 |
T27091 |
T27089 |
dobj |
cells,permeabilized |
R7746 |
T27092 |
T27089 |
prep |
in,permeabilized |
R7747 |
T27093 |
T27092 |
pobj |
PBS,in |
R7748 |
T27094 |
T27093 |
acl |
containing,PBS |
R7749 |
T27095 |
T27096 |
nummod |
0.1,% |
R7750 |
T27096 |
T27097 |
compound |
%,100 |
R7751 |
T27097 |
T27094 |
dobj |
100,containing |
R7752 |
T27098 |
T27097 |
compound |
Triton,100 |
R7753 |
T27099 |
T27097 |
compound |
X,100 |
R7754 |
T27100 |
T27097 |
punct |
-,100 |
R7755 |
T27101 |
T27089 |
prep |
for,permeabilized |
R7756 |
T27102 |
T27103 |
nummod |
15,min |
R7757 |
T27103 |
T27101 |
pobj |
min,for |
R7758 |
T27104 |
T27089 |
punct |
", ",permeabilized |
R7759 |
T27105 |
T27089 |
conj |
washed,permeabilized |
R7760 |
T27106 |
T27105 |
advmod |
again,washed |
R7761 |
T27107 |
T27105 |
prep |
with,washed |
R7762 |
T27108 |
T27107 |
pobj |
PBS,with |
R7763 |
T27109 |
T27105 |
punct |
", ",washed |
R7764 |
T27110 |
T27105 |
cc |
and,washed |
R7765 |
T27111 |
T27105 |
conj |
incubated,washed |
R7766 |
T27112 |
T27111 |
prep |
in,incubated |
R7767 |
T27113 |
T27112 |
pobj |
PBS,in |
R7768 |
T27114 |
T27113 |
acl |
containing,PBS |
R7769 |
T27115 |
T27116 |
nummod |
0.1,% |
R7770 |
T27116 |
T27114 |
dobj |
%,containing |
R7771 |
T27117 |
T27118 |
amod |
bovine,albumin |
R7772 |
T27118 |
T27116 |
appos |
albumin,% |
R7773 |
T27119 |
T27118 |
compound |
serum,albumin |
R7774 |
T27120 |
T27118 |
punct |
(,albumin |
R7775 |
T27121 |
T27118 |
appos |
BSA,albumin |
R7776 |
T27122 |
T27111 |
punct |
),incubated |
R7777 |
T27123 |
T27111 |
prep |
for,incubated |
R7778 |
T27124 |
T27125 |
nummod |
30,min |
R7779 |
T27125 |
T27123 |
pobj |
min,for |
R7780 |
T27126 |
T27111 |
prep |
at,incubated |
R7781 |
T27127 |
T27128 |
compound |
room,temperature |
R7782 |
T27128 |
T27126 |
pobj |
temperature,at |
R7783 |
T27129 |
T27089 |
punct |
.,permeabilized |
R7784 |
T27131 |
T27132 |
nsubj |
We,incubated |
R7785 |
T27133 |
T27132 |
dobj |
cells,incubated |
R7786 |
T27134 |
T27132 |
prep |
with,incubated |
R7787 |
T27135 |
T27136 |
amod |
anti-HA,antibody |
R7788 |
T27136 |
T27134 |
pobj |
antibody,with |
R7789 |
T27137 |
T27132 |
advmod |
overnight,incubated |
R7790 |
T27138 |
T27132 |
prep |
at,incubated |
R7791 |
T27139 |
T27140 |
nummod |
4,°C |
R7792 |
T27140 |
T27138 |
pobj |
°C,at |
R7793 |
T27141 |
T27142 |
punct |
(,1 |
R7794 |
T27142 |
T27132 |
parataxis |
1,incubated |
R7795 |
T27143 |
T27144 |
punct |
:,200 |
R7796 |
T27144 |
T27142 |
prep |
200,1 |
R7797 |
T27145 |
T27142 |
prep |
in,1 |
R7798 |
T27146 |
T27145 |
pobj |
PBS,in |
R7799 |
T27147 |
T27146 |
acl |
containing,PBS |
R7800 |
T27148 |
T27149 |
nummod |
0.2,% |
R7801 |
T27149 |
T27150 |
compound |
%,BSA |
R7802 |
T27150 |
T27147 |
dobj |
BSA,containing |
R7803 |
T27151 |
T27142 |
punct |
),1 |
R7804 |
T27152 |
T27132 |
punct |
.,incubated |
R7805 |
T27154 |
T27155 |
det |
The,day |
R7806 |
T27155 |
T27157 |
npadvmod |
day,washed |
R7807 |
T27156 |
T27155 |
amod |
following,day |
R7808 |
T27158 |
T27157 |
punct |
", ",washed |
R7809 |
T27159 |
T27157 |
nsubj |
we,washed |
R7810 |
T27160 |
T27157 |
dobj |
cells,washed |
R7811 |
T27161 |
T27162 |
nummod |
three,times |
R7812 |
T27162 |
T27157 |
npadvmod |
times,washed |
R7813 |
T27163 |
T27157 |
prep |
with,washed |
R7814 |
T27164 |
T27163 |
pobj |
PBS,with |
R7815 |
T27165 |
T27157 |
cc |
and,washed |
R7816 |
T27166 |
T27157 |
conj |
incubated,washed |
R7817 |
T27167 |
T27166 |
prep |
with,incubated |
R7818 |
T27168 |
T27169 |
det |
a,IgG |
R7819 |
T27169 |
T27167 |
pobj |
IgG,with |
R7820 |
T27170 |
T27171 |
npadvmod |
Cy3,conjugated |
R7821 |
T27171 |
T27169 |
amod |
conjugated,IgG |
R7822 |
T27172 |
T27171 |
punct |
-,conjugated |
R7823 |
T27173 |
T27169 |
compound |
goat,IgG |
R7824 |
T27174 |
T27169 |
prep |
against,IgG |
R7825 |
T27175 |
T27176 |
compound |
rabbit,IgG |
R7826 |
T27176 |
T27174 |
pobj |
IgG,against |
R7827 |
T27177 |
T27178 |
punct |
(,Laboratories |
R7828 |
T27178 |
T27169 |
parataxis |
Laboratories,IgG |
R7829 |
T27179 |
T27178 |
dep |
1,Laboratories |
R7830 |
T27180 |
T27181 |
punct |
:,400 |
R7831 |
T27181 |
T27179 |
prep |
400,1 |
R7832 |
T27182 |
T27179 |
prep |
in,1 |
R7833 |
T27183 |
T27182 |
pobj |
PBS,in |
R7834 |
T27184 |
T27178 |
punct |
", ",Laboratories |
R7835 |
T27185 |
T27178 |
compound |
Jackson,Laboratories |
R7836 |
T27186 |
T27178 |
compound |
ImmunoReseach,Laboratories |
R7837 |
T27187 |
T27178 |
punct |
),Laboratories |
R7838 |
T27188 |
T27166 |
prep |
for,incubated |
R7839 |
T27189 |
T27190 |
nummod |
30,min |
R7840 |
T27190 |
T27188 |
pobj |
min,for |
R7841 |
T27191 |
T27157 |
punct |
.,washed |
R7842 |
T27193 |
T27194 |
nsubj |
We,rinsed |
R7843 |
T27195 |
T27194 |
dobj |
cells,rinsed |
R7844 |
T27196 |
T27197 |
nummod |
three,times |
R7845 |
T27197 |
T27194 |
npadvmod |
times,rinsed |
R7846 |
T27198 |
T27194 |
prep |
with,rinsed |
R7847 |
T27199 |
T27198 |
pobj |
PBS,with |
R7848 |
T27200 |
T27194 |
punct |
", ",rinsed |
R7849 |
T27201 |
T27194 |
advcl |
followed,rinsed |
R7850 |
T27202 |
T27201 |
agent |
by,followed |
R7851 |
T27203 |
T27202 |
pobj |
observation,by |
R7852 |
T27204 |
T27203 |
acl |
using,observation |
R7853 |
T27205 |
T27206 |
det |
a,FV300 |
R7854 |
T27206 |
T27204 |
dobj |
FV300,using |
R7855 |
T27207 |
T27206 |
amod |
confocal,FV300 |
R7856 |
T27208 |
T27206 |
compound |
microscope,FV300 |
R7857 |
T27209 |
T27210 |
punct |
(,Olympus |
R7858 |
T27210 |
T27206 |
parataxis |
Olympus,FV300 |
R7859 |
T27211 |
T27210 |
punct |
),Olympus |
R7860 |
T27212 |
T27206 |
acl |
equipped,FV300 |
R7861 |
T27213 |
T27212 |
prep |
with,equipped |
R7862 |
T27214 |
T27215 |
det |
a,lens |
R7863 |
T27215 |
T27213 |
pobj |
lens,with |
R7864 |
T27216 |
T27215 |
nummod |
60,lens |
R7865 |
T27217 |
T27216 |
punct |
×,60 |
R7866 |
T27218 |
T27215 |
compound |
objective,lens |
R7867 |
T27219 |
T27194 |
punct |
.,rinsed |
R7870 |
T27909 |
T27910 |
compound |
Luciferase,assay |
R7871 |
T27912 |
T27913 |
prep |
For,constructed |
R7872 |
T27914 |
T27915 |
amod |
transcriptional,analysis |
R7873 |
T27915 |
T27912 |
pobj |
analysis,For |
R7874 |
T27916 |
T27915 |
prep |
of,analysis |
R7875 |
T27917 |
T27918 |
det |
the,region |
R7876 |
T27918 |
T27916 |
pobj |
region,of |
R7877 |
T27919 |
T27920 |
nummod |
1.2,kb |
R7878 |
T27920 |
T27918 |
compound |
kb,region |
R7879 |
T27921 |
T27920 |
punct |
-,kb |
R7880 |
T27922 |
T27918 |
compound |
promoter,region |
R7881 |
T27923 |
T27918 |
prep |
of,region |
R7882 |
T27924 |
T27925 |
compound |
mr,s |
R7883 |
T27925 |
T27923 |
pobj |
s,of |
R7884 |
T27926 |
T27925 |
punct |
-,s |
R7885 |
T27927 |
T27913 |
punct |
", ",constructed |
R7886 |
T27928 |
T27913 |
nsubj |
we,constructed |
R7887 |
T27929 |
T27930 |
det |
a,plasmid |
R7888 |
T27930 |
T27913 |
dobj |
plasmid,constructed |
R7889 |
T27931 |
T27930 |
compound |
reporter,plasmid |
R7890 |
T27932 |
T27933 |
punct |
(,pro1.2k |
R7891 |
T27933 |
T27930 |
parataxis |
pro1.2k,plasmid |
R7892 |
T27934 |
T27933 |
punct |
),pro1.2k |
R7893 |
T27935 |
T27913 |
prep |
by,constructed |
R7894 |
T27936 |
T27935 |
pcomp |
subcloning,by |
R7895 |
T27937 |
T27938 |
det |
a,fragment |
R7896 |
T27938 |
T27936 |
dobj |
fragment,subcloning |
R7897 |
T27939 |
T27940 |
nummod |
1.2,kb |
R7898 |
T27940 |
T27938 |
nmod |
kb,fragment |
R7899 |
T27941 |
T27940 |
punct |
-,kb |
R7900 |
T27942 |
T27938 |
amod |
upstream,fragment |
R7901 |
T27943 |
T27938 |
amod |
genomic,fragment |
R7902 |
T27944 |
T27938 |
prep |
of,fragment |
R7903 |
T27945 |
T27946 |
compound |
mr,s |
R7904 |
T27946 |
T27948 |
compound |
s,gene |
R7905 |
T27947 |
T27946 |
punct |
-,s |
R7906 |
T27948 |
T27944 |
pobj |
gene,of |
R7907 |
T27949 |
T27936 |
prep |
into,subcloning |
R7908 |
T27950 |
T27951 |
det |
a,plasmid |
R7909 |
T27951 |
T27949 |
pobj |
plasmid,into |
R7910 |
T27952 |
T27953 |
compound |
pGL3,reporter |
R7911 |
T27953 |
T27951 |
compound |
reporter,plasmid |
R7912 |
T27954 |
T27953 |
compound |
luciferase,reporter |
R7913 |
T27955 |
T27956 |
punct |
(,Promega |
R7914 |
T27956 |
T27951 |
parataxis |
Promega,plasmid |
R7915 |
T27957 |
T27956 |
punct |
),Promega |
R7916 |
T27958 |
T27913 |
punct |
.,constructed |
R7917 |
T27960 |
T27961 |
det |
The,vectors |
R7918 |
T27961 |
T27963 |
nsubjpass |
vectors,constructed |
R7919 |
T27962 |
T27961 |
compound |
expression,vectors |
R7920 |
T27964 |
T27963 |
auxpass |
were,constructed |
R7921 |
T27965 |
T27963 |
prep |
by,constructed |
R7922 |
T27966 |
T27965 |
pcomp |
subcloning,by |
R7923 |
T27967 |
T27968 |
amod |
full,length |
R7924 |
T27968 |
T27970 |
nmod |
length,genes |
R7925 |
T27969 |
T27968 |
punct |
-,length |
R7926 |
T27970 |
T27966 |
dobj |
genes,subcloning |
R7927 |
T27971 |
T27972 |
nmod |
Crx,Nrl |
R7928 |
T27972 |
T27970 |
compound |
Nrl,genes |
R7929 |
T27973 |
T27972 |
punct |
", ",Nrl |
R7930 |
T27974 |
T27972 |
nmod |
Otx2,Nrl |
R7931 |
T27975 |
T27972 |
punct |
", ",Nrl |
R7932 |
T27976 |
T27966 |
prep |
into,subcloning |
R7933 |
T27977 |
T27978 |
det |
a,vector |
R7934 |
T27978 |
T27976 |
pobj |
vector,into |
R7935 |
T27979 |
T27978 |
compound |
pMIK,vector |
R7936 |
T27980 |
T27978 |
compound |
expression,vector |
R7937 |
T27981 |
T27982 |
punct |
(,gift |
R7938 |
T27982 |
T27978 |
parataxis |
gift,vector |
R7939 |
T27983 |
T27982 |
det |
a,gift |
R7940 |
T27984 |
T27982 |
prep |
from,gift |
R7941 |
T27985 |
T27986 |
compound |
Dr.,Maruyama |
R7942 |
T27986 |
T27984 |
pobj |
Maruyama,from |
R7943 |
T27987 |
T27986 |
compound |
K.,Maruyama |
R7944 |
T27988 |
T27982 |
punct |
),gift |
R7945 |
T27989 |
T27966 |
punct |
", ",subcloning |
R7946 |
T27990 |
T27966 |
advmod |
respectively,subcloning |
R7947 |
T27991 |
T27963 |
punct |
.,constructed |
R7948 |
T27993 |
T27994 |
prep |
For,mutated |
R7949 |
T27995 |
T27996 |
det |
the,vector |
R7950 |
T27996 |
T27993 |
pobj |
vector,For |
R7951 |
T27997 |
T27996 |
punct |
"""",vector |
R7952 |
T27998 |
T27996 |
nmod |
mut1259,vector |
R7953 |
T27999 |
T27996 |
punct |
"""",vector |
R7954 |
T28000 |
T27994 |
punct |
", ",mutated |
R7955 |
T28001 |
T28002 |
det |
the,site |
R7956 |
T28002 |
T27994 |
nsubjpass |
site,mutated |
R7957 |
T28003 |
T28004 |
compound |
Crx,binding |
R7958 |
T28004 |
T28002 |
compound |
binding,site |
R7959 |
T28005 |
T28002 |
prep |
at,site |
R7960 |
T28006 |
T28007 |
det |
the,position |
R7961 |
T28007 |
T28005 |
pobj |
position,at |
R7962 |
T28008 |
T28009 |
punct |
-,1259 |
R7963 |
T28009 |
T28010 |
nummod |
1259,bp |
R7964 |
T28010 |
T28007 |
compound |
bp,position |
R7965 |
T28011 |
T27994 |
auxpass |
was,mutated |
R7966 |
T28012 |
T27994 |
prep |
by,mutated |
R7967 |
T28013 |
T28012 |
pcomp |
replacing,by |
R7968 |
T28014 |
T28013 |
dobj |
GGATTA,replacing |
R7969 |
T28015 |
T28013 |
prep |
with,replacing |
R7970 |
T28016 |
T28015 |
pobj |
AGATCT,with |
R7971 |
T28017 |
T27994 |
punct |
.,mutated |
R7972 |
T28019 |
T28020 |
prep |
For,mutated |
R7973 |
T28021 |
T28022 |
det |
the,vector |
R7974 |
T28022 |
T28019 |
pobj |
vector,For |
R7975 |
T28023 |
T28022 |
punct |
"""",vector |
R7976 |
T28024 |
T28022 |
nmod |
mut198,vector |
R7977 |
T28025 |
T28022 |
punct |
"""",vector |
R7978 |
T28026 |
T28020 |
punct |
", ",mutated |
R7979 |
T28027 |
T28028 |
det |
the,site |
R7980 |
T28028 |
T28020 |
nsubjpass |
site,mutated |
R7981 |
T28029 |
T28030 |
compound |
Crx,binding |
R7982 |
T28030 |
T28028 |
compound |
binding,site |
R7983 |
T28031 |
T28028 |
prep |
at,site |
R7984 |
T28032 |
T28033 |
det |
the,position |
R7985 |
T28033 |
T28031 |
pobj |
position,at |
R7986 |
T28034 |
T28035 |
punct |
-,198 |
R7987 |
T28035 |
T28036 |
nummod |
198,bp |
R7988 |
T28036 |
T28033 |
compound |
bp,position |
R7989 |
T28037 |
T28020 |
auxpass |
was,mutated |
R7990 |
T28038 |
T28020 |
prep |
by,mutated |
R7991 |
T28039 |
T28038 |
pcomp |
replacing,by |
R7992 |
T28040 |
T28039 |
dobj |
TAATCC,replacing |
R7993 |
T28041 |
T28039 |
prep |
with,replacing |
R7994 |
T28042 |
T28041 |
pobj |
GAATTC,with |
R7995 |
T28043 |
T28020 |
punct |
.,mutated |
R7996 |
T28045 |
T28046 |
prep |
For,mutated |
R7997 |
T28047 |
T28048 |
det |
the,vector |
R7998 |
T28048 |
T28045 |
pobj |
vector,For |
R7999 |
T28049 |
T28048 |
punct |
"""",vector |
R8000 |
T28050 |
T28048 |
nmod |
mut72,vector |
R8001 |
T28051 |
T28048 |
punct |
"""",vector |
R8002 |
T28052 |
T28046 |
punct |
", ",mutated |
R8003 |
T28053 |
T28054 |
det |
the,site |
R8004 |
T28054 |
T28046 |
nsubjpass |
site,mutated |
R8005 |
T28055 |
T28056 |
compound |
Crx,binding |
R8006 |
T28056 |
T28054 |
compound |
binding,site |
R8007 |
T28057 |
T28054 |
prep |
at,site |
R8008 |
T28058 |
T28059 |
det |
the,position |
R8009 |
T28059 |
T28057 |
pobj |
position,at |
R8010 |
T28060 |
T28061 |
punct |
-,72 |
R8011 |
T28061 |
T28062 |
nummod |
72,bp |
R8012 |
T28062 |
T28059 |
compound |
bp,position |
R8013 |
T28063 |
T28046 |
auxpass |
was,mutated |
R8014 |
T28064 |
T28046 |
prep |
by,mutated |
R8015 |
T28065 |
T28064 |
pcomp |
replacing,by |
R8016 |
T28066 |
T28065 |
dobj |
GGATTA,replacing |
R8017 |
T28067 |
T28065 |
prep |
with,replacing |
R8018 |
T28068 |
T28067 |
pobj |
GAATTC,with |
R8019 |
T28069 |
T28046 |
punct |
.,mutated |
R8020 |
T28071 |
T28072 |
prep |
For,mutated |
R8021 |
T28073 |
T28074 |
det |
the,vector |
R8022 |
T28074 |
T28071 |
pobj |
vector,For |
R8023 |
T28075 |
T28074 |
punct |
"""",vector |
R8024 |
T28076 |
T28077 |
nmod |
mut,all |
R8025 |
T28077 |
T28074 |
nmod |
all,vector |
R8026 |
T28078 |
T28074 |
punct |
"""",vector |
R8027 |
T28079 |
T28072 |
punct |
", ",mutated |
R8028 |
T28080 |
T28072 |
nsubjpass |
all,mutated |
R8029 |
T28081 |
T28080 |
prep |
of,all |
R8030 |
T28082 |
T28083 |
nummod |
three,sites |
R8031 |
T28083 |
T28081 |
pobj |
sites,of |
R8032 |
T28084 |
T28085 |
compound |
Crx,binding |
R8033 |
T28085 |
T28083 |
compound |
binding,sites |
R8034 |
T28086 |
T28072 |
auxpass |
were,mutated |
R8035 |
T28087 |
T28072 |
punct |
.,mutated |
R8036 |
T28089 |
T28090 |
compound |
5xGAL4,pGL3 |
R8037 |
T28090 |
T28092 |
compound |
pGL3,plasmid |
R8038 |
T28091 |
T28090 |
punct |
-,pGL3 |
R8039 |
T28092 |
T28095 |
nsubjpass |
plasmid,gifted |
R8040 |
T28093 |
T28092 |
compound |
Control,plasmid |
R8041 |
T28094 |
T28092 |
compound |
reporter,plasmid |
R8042 |
T28096 |
T28092 |
punct |
", ",plasmid |
R8043 |
T28097 |
T28098 |
dep |
which,contains |
R8044 |
T28098 |
T28092 |
relcl |
contains,plasmid |
R8045 |
T28099 |
T28100 |
nummod |
five,copies |
R8046 |
T28100 |
T28098 |
dobj |
copies,contains |
R8047 |
T28101 |
T28100 |
prep |
of,copies |
R8048 |
T28102 |
T28103 |
det |
the,sequence |
R8049 |
T28103 |
T28101 |
pobj |
sequence,of |
R8050 |
T28104 |
T28103 |
compound |
GAL4,sequence |
R8051 |
T28105 |
T28106 |
compound |
DNA,recognition |
R8052 |
T28106 |
T28103 |
compound |
recognition,sequence |
R8053 |
T28107 |
T28100 |
acl |
positioned,copies |
R8054 |
T28108 |
T28107 |
advmod |
immediately,positioned |
R8055 |
T28109 |
T28108 |
advmod |
upstream,immediately |
R8056 |
T28110 |
T28108 |
prep |
of,immediately |
R8057 |
T28111 |
T28112 |
nmod |
SV40,promoter |
R8058 |
T28112 |
T28110 |
pobj |
promoter,of |
R8059 |
T28113 |
T28112 |
amod |
minimal,promoter |
R8060 |
T28114 |
T28095 |
punct |
", ",gifted |
R8061 |
T28115 |
T28095 |
auxpass |
was,gifted |
R8062 |
T28116 |
T28095 |
advmod |
kindly,gifted |
R8063 |
T28117 |
T28095 |
agent |
from,gifted |
R8064 |
T28118 |
T28119 |
compound |
Dr.,Noguchi |
R8065 |
T28119 |
T28117 |
pobj |
Noguchi,from |
R8066 |
T28120 |
T28119 |
compound |
T.,Noguchi |
R8067 |
T28121 |
T28095 |
cc |
and,gifted |
R8068 |
T28122 |
T28095 |
conj |
used,gifted |
R8069 |
T28123 |
T28122 |
prep |
for,used |
R8070 |
T28124 |
T28123 |
pobj |
analysis,for |
R8071 |
T28125 |
T28124 |
prep |
of,analysis |
R8072 |
T28126 |
T28127 |
det |
the,activity |
R8073 |
T28127 |
T28125 |
pobj |
activity,of |
R8074 |
T28128 |
T28127 |
amod |
transcriptional,activity |
R8075 |
T28129 |
T28127 |
prep |
of,activity |
R8076 |
T28130 |
T28131 |
compound |
mr,s |
R8077 |
T28131 |
T28129 |
pobj |
s,of |
R8078 |
T28132 |
T28131 |
punct |
-,s |
R8079 |
T28133 |
T28134 |
punct |
[,50 |
R8080 |
T28134 |
T28122 |
parataxis |
50,used |
R8081 |
T28135 |
T28134 |
punct |
],50 |
R8082 |
T28136 |
T28095 |
punct |
.,gifted |
R8083 |
T28138 |
T28139 |
aux |
To,generate |
R8084 |
T28139 |
T28140 |
advcl |
generate,produced |
R8085 |
T28141 |
T28142 |
compound |
effector,plasmids |
R8086 |
T28142 |
T28139 |
dobj |
plasmids,generate |
R8087 |
T28143 |
T28140 |
punct |
", ",produced |
R8088 |
T28144 |
T28145 |
amod |
various,fragments |
R8089 |
T28145 |
T28140 |
nsubj |
fragments,produced |
R8090 |
T28146 |
T28145 |
compound |
deletion,fragments |
R8091 |
T28147 |
T28140 |
aux |
were,produced |
R8092 |
T28148 |
T28140 |
prep |
by,produced |
R8093 |
T28149 |
T28150 |
compound |
PCR,reaction |
R8094 |
T28150 |
T28148 |
pobj |
reaction,by |
R8095 |
T28151 |
T28140 |
cc |
and,produced |
R8096 |
T28152 |
T28140 |
conj |
subcloned,produced |
R8097 |
T28153 |
T28152 |
prep |
into,subcloned |
R8098 |
T28154 |
T28155 |
compound |
pGBKT7,vector |
R8099 |
T28155 |
T28153 |
pobj |
vector,into |
R8100 |
T28156 |
T28140 |
punct |
", ",produced |
R8101 |
T28157 |
T28140 |
advmod |
respectively,produced |
R8102 |
T28158 |
T28140 |
punct |
.,produced |
R8103 |
T28160 |
T28161 |
det |
These,fragments |
R8104 |
T28161 |
T28162 |
nsubjpass |
fragments,digested |
R8105 |
T28163 |
T28162 |
auxpass |
were,digested |
R8106 |
T28164 |
T28162 |
prep |
with,digested |
R8107 |
T28165 |
T28166 |
det |
the,sequence |
R8108 |
T28166 |
T28164 |
pobj |
sequence,with |
R8109 |
T28167 |
T28166 |
punct |
", ",sequence |
R8110 |
T28168 |
T28169 |
dep |
which,encodes |
R8111 |
T28169 |
T28166 |
relcl |
encodes,sequence |
R8112 |
T28170 |
T28171 |
compound |
GAL4,domain |
R8113 |
T28171 |
T28169 |
dobj |
domain,encodes |
R8114 |
T28172 |
T28173 |
compound |
DNA,binding |
R8115 |
T28173 |
T28171 |
compound |
binding,domain |
R8116 |
T28174 |
T28162 |
punct |
", ",digested |
R8117 |
T28175 |
T28162 |
cc |
and,digested |
R8118 |
T28176 |
T28162 |
conj |
inserted,digested |
R8119 |
T28177 |
T28176 |
prep |
into,inserted |
R8120 |
T28178 |
T28177 |
pobj |
pcDNA3,into |
R8121 |
T28179 |
T28162 |
punct |
.,digested |
R8122 |
T28181 |
T28182 |
nsubj |
We,transfected |
R8123 |
T28183 |
T28184 |
nummod |
0.1,μg |
R8124 |
T28184 |
T28182 |
dobj |
μg,transfected |
R8125 |
T28185 |
T28184 |
prep |
of,μg |
R8126 |
T28186 |
T28187 |
compound |
reporter,DNA |
R8127 |
T28187 |
T28185 |
pobj |
DNA,of |
R8128 |
T28188 |
T28187 |
compound |
plasmid,DNA |
R8129 |
T28189 |
T28184 |
cc |
and,μg |
R8130 |
T28190 |
T28191 |
nummod |
2,μg |
R8131 |
T28191 |
T28184 |
conj |
μg,μg |
R8132 |
T28192 |
T28191 |
prep |
of,μg |
R8133 |
T28193 |
T28194 |
det |
the,DNA |
R8134 |
T28194 |
T28192 |
pobj |
DNA,of |
R8135 |
T28195 |
T28196 |
compound |
expression,vector |
R8136 |
T28196 |
T28194 |
compound |
vector,DNA |
R8137 |
T28197 |
T28184 |
prep |
per,μg |
R8138 |
T28198 |
T28199 |
nummod |
6,cm |
R8139 |
T28199 |
T28200 |
compound |
cm,dish |
R8140 |
T28200 |
T28197 |
pobj |
dish,per |
R8141 |
T28201 |
T28182 |
prep |
into,transfected |
R8142 |
T28202 |
T28203 |
compound |
HEK293T,cells |
R8143 |
T28203 |
T28201 |
pobj |
cells,into |
R8144 |
T28204 |
T28182 |
advcl |
using,transfected |
R8145 |
T28205 |
T28206 |
compound |
Fugene6,reagent |
R8146 |
T28206 |
T28204 |
dobj |
reagent,using |
R8147 |
T28207 |
T28206 |
compound |
transfection,reagent |
R8148 |
T28208 |
T28182 |
punct |
.,transfected |
R8149 |
T28210 |
T28211 |
nsubj |
We,analyzed |
R8150 |
T28212 |
T28213 |
compound |
luciferase,activity |
R8151 |
T28213 |
T28211 |
dobj |
activity,analyzed |
R8152 |
T28214 |
T28215 |
nummod |
48,hr |
R8153 |
T28215 |
T28216 |
npadvmod |
hr,after |
R8154 |
T28216 |
T28211 |
prep |
after,analyzed |
R8155 |
T28217 |
T28216 |
pobj |
transfection,after |
R8156 |
T28218 |
T28211 |
punct |
.,analyzed |