| Id |
Subject |
Object |
Predicate |
Lexical cue |
| T10414 |
0-10 |
NN |
denotes |
Generation |
| T10415 |
11-13 |
IN |
denotes |
of |
| T10416 |
14-23 |
JJ |
denotes |
anti-ESG1 |
| T10418 |
24-34 |
JJ |
denotes |
polyclonal |
| T10417 |
35-45 |
NNS |
denotes |
antibodies |
| T10419 |
45-222 |
sentence |
denotes |
The coding sequence of Esg1 was amplified by PCR with the pH34-gw-s (5'- AAAAAGCAGGCTGGATGATGGTGACCCTCGTGA-3') and pH34-gw-as (5'- AGAAAGCTGGGTCTGCATCCAGGTCGGAGACA-3') primers. |
| T10420 |
46-49 |
DT |
denotes |
The |
| T10422 |
50-56 |
VBG |
denotes |
coding |
| T10421 |
57-65 |
NN |
denotes |
sequence |
| T10424 |
66-68 |
IN |
denotes |
of |
| T10425 |
69-73 |
NN |
denotes |
Esg1 |
| T10426 |
74-77 |
VBD |
denotes |
was |
| T10423 |
78-87 |
VBN |
denotes |
amplified |
| T10427 |
88-90 |
IN |
denotes |
by |
| T10428 |
91-94 |
NN |
denotes |
PCR |
| T10429 |
95-99 |
IN |
denotes |
with |
| T10430 |
100-103 |
DT |
denotes |
the |
| T10432 |
104-108 |
NN |
denotes |
pH34 |
| T10434 |
108-109 |
HYPH |
denotes |
- |
| T10435 |
109-111 |
NN |
denotes |
gw |
| T10436 |
111-112 |
HYPH |
denotes |
- |
| T10433 |
112-113 |
NN |
denotes |
s |
| T10437 |
114-115 |
-LRB- |
denotes |
( |
| T10439 |
115-116 |
CD |
denotes |
5 |
| T10440 |
116-117 |
SYM |
denotes |
' |
| T10441 |
117-118 |
HYPH |
denotes |
- |
| T10438 |
119-152 |
NN |
denotes |
AAAAAGCAGGCTGGATGATGGTGACCCTCGTGA |
| T10442 |
152-153 |
HYPH |
denotes |
- |
| T10443 |
153-154 |
CD |
denotes |
3 |
| T10444 |
154-155 |
SYM |
denotes |
' |
| T10445 |
155-156 |
-RRB- |
denotes |
) |
| T10446 |
157-160 |
CC |
denotes |
and |
| T10447 |
161-165 |
NN |
denotes |
pH34 |
| T10449 |
165-166 |
HYPH |
denotes |
- |
| T10450 |
166-168 |
NN |
denotes |
gw |
| T10451 |
168-169 |
HYPH |
denotes |
- |
| T10448 |
169-171 |
NN |
denotes |
as |
| T10452 |
172-173 |
-LRB- |
denotes |
( |
| T10454 |
173-174 |
CD |
denotes |
5 |
| T10455 |
174-175 |
SYM |
denotes |
' |
| T10456 |
175-176 |
HYPH |
denotes |
- |
| T10453 |
177-209 |
NN |
denotes |
AGAAAGCTGGGTCTGCATCCAGGTCGGAGACA |
| T10457 |
209-210 |
HYPH |
denotes |
- |
| T10458 |
210-211 |
CD |
denotes |
3 |
| T10459 |
211-212 |
SYM |
denotes |
' |
| T10460 |
212-213 |
-RRB- |
denotes |
) |
| T10431 |
214-221 |
NNS |
denotes |
primers |
| T10461 |
221-222 |
. |
denotes |
. |
| T10462 |
222-315 |
sentence |
denotes |
To construct pDONR-pH34, the resulting PCR product was subcloned into pDONR201 (Invitrogen). |
| T10463 |
223-225 |
TO |
denotes |
To |
| T10464 |
226-235 |
VB |
denotes |
construct |
| T10466 |
236-241 |
NN |
denotes |
pDONR |
| T10468 |
241-242 |
HYPH |
denotes |
- |
| T10467 |
242-246 |
NN |
denotes |
pH34 |
| T10469 |
246-248 |
, |
denotes |
, |
| T10470 |
248-251 |
DT |
denotes |
the |
| T10472 |
252-261 |
VBG |
denotes |
resulting |
| T10473 |
262-265 |
NN |
denotes |
PCR |
| T10471 |
266-273 |
NN |
denotes |
product |
| T10474 |
274-277 |
VBD |
denotes |
was |
| T10465 |
278-287 |
VBN |
denotes |
subcloned |
| T10475 |
288-292 |
IN |
denotes |
into |
| T10476 |
293-301 |
NN |
denotes |
pDONR201 |
| T10477 |
302-303 |
-LRB- |
denotes |
( |
| T10478 |
303-313 |
NNP |
denotes |
Invitrogen |
| T10479 |
313-314 |
-RRB- |
denotes |
) |
| T10480 |
314-315 |
. |
denotes |
. |
| T10481 |
315-388 |
sentence |
denotes |
pDONR-pH34 was interacted with pDEST17 (Invitrogen) by LR recombination. |
| T10482 |
316-321 |
NN |
denotes |
pDONR |
| T10484 |
321-322 |
HYPH |
denotes |
- |
| T10483 |
322-326 |
NN |
denotes |
pH34 |
| T10486 |
327-330 |
VBD |
denotes |
was |
| T10485 |
331-341 |
VBN |
denotes |
interacted |
| T10487 |
342-346 |
IN |
denotes |
with |
| T10488 |
347-354 |
NN |
denotes |
pDEST17 |
| T10489 |
355-356 |
-LRB- |
denotes |
( |
| T10490 |
356-366 |
NNP |
denotes |
Invitrogen |
| T10491 |
366-367 |
-RRB- |
denotes |
) |
| T10492 |
368-370 |
IN |
denotes |
by |
| T10493 |
371-373 |
NN |
denotes |
LR |
| T10494 |
374-387 |
NN |
denotes |
recombination |
| T10495 |
387-388 |
. |
denotes |
. |
| T10496 |
388-574 |
sentence |
denotes |
After introduction of the resulting expression vector pDEST17-pH34 into BL21-AI E. coli (Invitrogen), recombinant protein production was induced according to the manufacture's protocol. |
| T10497 |
389-394 |
IN |
denotes |
After |
| T10499 |
395-407 |
NN |
denotes |
introduction |
| T10500 |
408-410 |
IN |
denotes |
of |
| T10501 |
411-414 |
DT |
denotes |
the |
| T10503 |
415-424 |
VBG |
denotes |
resulting |
| T10504 |
425-435 |
NN |
denotes |
expression |
| T10502 |
436-442 |
NN |
denotes |
vector |
| T10505 |
443-450 |
NN |
denotes |
pDEST17 |
| T10507 |
450-451 |
HYPH |
denotes |
- |
| T10506 |
451-455 |
NN |
denotes |
pH34 |
| T10508 |
456-460 |
IN |
denotes |
into |
| T10509 |
461-465 |
NN |
denotes |
BL21 |
| T10511 |
465-466 |
HYPH |
denotes |
- |
| T10510 |
466-468 |
NN |
denotes |
AI |
| T10512 |
469-471 |
FW |
denotes |
E. |
| T10513 |
472-476 |
FW |
denotes |
coli |
| T10514 |
477-478 |
-LRB- |
denotes |
( |
| T10515 |
478-488 |
NNP |
denotes |
Invitrogen |
| T10516 |
488-489 |
-RRB- |
denotes |
) |
| T10517 |
489-491 |
, |
denotes |
, |
| T10518 |
491-502 |
JJ |
denotes |
recombinant |
| T10519 |
503-510 |
NN |
denotes |
protein |
| T10520 |
511-521 |
NN |
denotes |
production |
| T10521 |
522-525 |
VBD |
denotes |
was |
| T10498 |
526-533 |
VBN |
denotes |
induced |
| T10522 |
534-543 |
VBG |
denotes |
according |
| T10523 |
544-546 |
IN |
denotes |
to |
| T10524 |
547-550 |
DT |
denotes |
the |
| T10525 |
551-562 |
NN |
denotes |
manufacture |
| T10527 |
562-564 |
POS |
denotes |
's |
| T10526 |
565-573 |
NN |
denotes |
protocol |
| T10528 |
573-574 |
. |
denotes |
. |
| T10529 |
574-714 |
sentence |
denotes |
Histidine-tagged ESG1 was purified using Ni-nitrilotriacetic acid agarose (Qiagen) under denaturing conditions in the presence of 8 M urea. |
| T10530 |
575-584 |
NN |
denotes |
Histidine |
| T10532 |
584-585 |
HYPH |
denotes |
- |
| T10531 |
585-591 |
VBN |
denotes |
tagged |
| T10533 |
592-596 |
NN |
denotes |
ESG1 |
| T10535 |
597-600 |
VBD |
denotes |
was |
| T10534 |
601-609 |
VBN |
denotes |
purified |
| T10536 |
610-615 |
VBG |
denotes |
using |
| T10537 |
616-618 |
NN |
denotes |
Ni |
| T10539 |
618-619 |
: |
denotes |
- |
| T10540 |
619-635 |
JJ |
denotes |
nitrilotriacetic |
| T10541 |
636-640 |
NN |
denotes |
acid |
| T10538 |
641-648 |
NN |
denotes |
agarose |
| T10542 |
649-650 |
-LRB- |
denotes |
( |
| T10543 |
650-656 |
NNP |
denotes |
Qiagen |
| T10544 |
656-657 |
-RRB- |
denotes |
) |
| T10545 |
658-663 |
IN |
denotes |
under |
| T10546 |
664-674 |
NN |
denotes |
denaturing |
| T10547 |
675-685 |
NNS |
denotes |
conditions |
| T10548 |
686-688 |
IN |
denotes |
in |
| T10549 |
689-692 |
DT |
denotes |
the |
| T10550 |
693-701 |
NN |
denotes |
presence |
| T10551 |
702-704 |
IN |
denotes |
of |
| T10552 |
705-706 |
CD |
denotes |
8 |
| T10553 |
707-708 |
NN |
denotes |
M |
| T10554 |
709-713 |
NN |
denotes |
urea |
| T10555 |
713-714 |
. |
denotes |
. |
| T10556 |
714-862 |
sentence |
denotes |
After dialysis against 6 M urea, the recombinant proteins were injected into New Zealand White rabbits to generate anti-ESG1 polyclonal antibodies. |
| T10557 |
715-720 |
IN |
denotes |
After |
| T10559 |
721-729 |
NN |
denotes |
dialysis |
| T10560 |
730-737 |
IN |
denotes |
against |
| T10561 |
738-739 |
CD |
denotes |
6 |
| T10562 |
740-741 |
NN |
denotes |
M |
| T10563 |
742-746 |
NN |
denotes |
urea |
| T10564 |
746-748 |
, |
denotes |
, |
| T10565 |
748-751 |
DT |
denotes |
the |
| T10567 |
752-763 |
JJ |
denotes |
recombinant |
| T10566 |
764-772 |
NN |
denotes |
proteins |
| T10568 |
773-777 |
VBD |
denotes |
were |
| T10558 |
778-786 |
VBN |
denotes |
injected |
| T10569 |
787-791 |
IN |
denotes |
into |
| T10570 |
792-795 |
NNP |
denotes |
New |
| T10571 |
796-803 |
NNP |
denotes |
Zealand |
| T10573 |
804-809 |
JJ |
denotes |
White |
| T10572 |
810-817 |
NNS |
denotes |
rabbits |
| T10574 |
818-820 |
TO |
denotes |
to |
| T10575 |
821-829 |
VB |
denotes |
generate |
| T10576 |
830-839 |
JJ |
denotes |
anti-ESG1 |
| T10578 |
840-850 |
JJ |
denotes |
polyclonal |
| T10577 |
851-861 |
NNS |
denotes |
antibodies |
| T10579 |
861-862 |
. |
denotes |
. |
| R2891 |
T10415 |
T10414 |
prep |
of,Generation |
| R2892 |
T10416 |
T10417 |
amod |
anti-ESG1,antibodies |
| R2893 |
T10417 |
T10415 |
pobj |
antibodies,of |
| R2894 |
T10418 |
T10417 |
amod |
polyclonal,antibodies |
| R2895 |
T10420 |
T10421 |
det |
The,sequence |
| R2896 |
T10421 |
T10423 |
nsubjpass |
sequence,amplified |
| R2897 |
T10422 |
T10421 |
amod |
coding,sequence |
| R2898 |
T10424 |
T10421 |
prep |
of,sequence |
| R2899 |
T10425 |
T10424 |
pobj |
Esg1,of |
| R2900 |
T10426 |
T10423 |
auxpass |
was,amplified |
| R2901 |
T10427 |
T10423 |
agent |
by,amplified |
| R2902 |
T10428 |
T10427 |
pobj |
PCR,by |
| R2903 |
T10429 |
T10423 |
prep |
with,amplified |
| R2904 |
T10430 |
T10431 |
det |
the,primers |
| R2905 |
T10431 |
T10429 |
pobj |
primers,with |
| R2906 |
T10432 |
T10433 |
nmod |
pH34,s |
| R2907 |
T10433 |
T10431 |
nmod |
s,primers |
| R2908 |
T10434 |
T10433 |
punct |
-,s |
| R2909 |
T10435 |
T10433 |
nmod |
gw,s |
| R2910 |
T10436 |
T10433 |
punct |
-,s |
| R2911 |
T10437 |
T10438 |
punct |
(,AAAAAGCAGGCTGGATGATGGTGACCCTCGTGA |
| R2912 |
T10438 |
T10433 |
parataxis |
AAAAAGCAGGCTGGATGATGGTGACCCTCGTGA,s |
| R2913 |
T10439 |
T10438 |
nummod |
5,AAAAAGCAGGCTGGATGATGGTGACCCTCGTGA |
| R2914 |
T10440 |
T10439 |
punct |
',5 |
| R2915 |
T10441 |
T10438 |
punct |
-,AAAAAGCAGGCTGGATGATGGTGACCCTCGTGA |
| R2916 |
T10442 |
T10438 |
punct |
-,AAAAAGCAGGCTGGATGATGGTGACCCTCGTGA |
| R2917 |
T10443 |
T10438 |
nummod |
3,AAAAAGCAGGCTGGATGATGGTGACCCTCGTGA |
| R2918 |
T10444 |
T10438 |
punct |
',AAAAAGCAGGCTGGATGATGGTGACCCTCGTGA |
| R2919 |
T10445 |
T10438 |
punct |
),AAAAAGCAGGCTGGATGATGGTGACCCTCGTGA |
| R2920 |
T10446 |
T10433 |
cc |
and,s |
| R2921 |
T10447 |
T10448 |
compound |
pH34,as |
| R2922 |
T10448 |
T10433 |
conj |
as,s |
| R2923 |
T10449 |
T10448 |
punct |
-,as |
| R2924 |
T10450 |
T10448 |
compound |
gw,as |
| R2925 |
T10451 |
T10448 |
punct |
-,as |
| R2926 |
T10452 |
T10453 |
punct |
(,AGAAAGCTGGGTCTGCATCCAGGTCGGAGACA |
| R2927 |
T10453 |
T10448 |
parataxis |
AGAAAGCTGGGTCTGCATCCAGGTCGGAGACA,as |
| R2928 |
T10454 |
T10453 |
nummod |
5,AGAAAGCTGGGTCTGCATCCAGGTCGGAGACA |
| R2929 |
T10455 |
T10454 |
punct |
',5 |
| R2930 |
T10456 |
T10453 |
punct |
-,AGAAAGCTGGGTCTGCATCCAGGTCGGAGACA |
| R2931 |
T10457 |
T10453 |
punct |
-,AGAAAGCTGGGTCTGCATCCAGGTCGGAGACA |
| R2932 |
T10458 |
T10453 |
nummod |
3,AGAAAGCTGGGTCTGCATCCAGGTCGGAGACA |
| R2933 |
T10459 |
T10453 |
punct |
',AGAAAGCTGGGTCTGCATCCAGGTCGGAGACA |
| R2934 |
T10460 |
T10453 |
punct |
),AGAAAGCTGGGTCTGCATCCAGGTCGGAGACA |
| R2935 |
T10461 |
T10423 |
punct |
.,amplified |
| R2936 |
T10463 |
T10464 |
aux |
To,construct |
| R2937 |
T10464 |
T10465 |
advcl |
construct,subcloned |
| R2938 |
T10466 |
T10467 |
compound |
pDONR,pH34 |
| R2939 |
T10467 |
T10464 |
dobj |
pH34,construct |
| R2940 |
T10468 |
T10467 |
punct |
-,pH34 |
| R2941 |
T10469 |
T10465 |
punct |
", ",subcloned |
| R2942 |
T10470 |
T10471 |
det |
the,product |
| R2943 |
T10471 |
T10465 |
nsubjpass |
product,subcloned |
| R2944 |
T10472 |
T10471 |
amod |
resulting,product |
| R2945 |
T10473 |
T10471 |
compound |
PCR,product |
| R2946 |
T10474 |
T10465 |
auxpass |
was,subcloned |
| R2947 |
T10475 |
T10465 |
prep |
into,subcloned |
| R2948 |
T10476 |
T10475 |
pobj |
pDONR201,into |
| R2949 |
T10477 |
T10478 |
punct |
(,Invitrogen |
| R2950 |
T10478 |
T10476 |
parataxis |
Invitrogen,pDONR201 |
| R2951 |
T10479 |
T10478 |
punct |
),Invitrogen |
| R2952 |
T10480 |
T10465 |
punct |
.,subcloned |
| R2953 |
T10482 |
T10483 |
compound |
pDONR,pH34 |
| R2954 |
T10483 |
T10485 |
nsubjpass |
pH34,interacted |
| R2955 |
T10484 |
T10483 |
punct |
-,pH34 |
| R2956 |
T10486 |
T10485 |
auxpass |
was,interacted |
| R2957 |
T10487 |
T10485 |
prep |
with,interacted |
| R2958 |
T10488 |
T10487 |
pobj |
pDEST17,with |
| R2959 |
T10489 |
T10490 |
punct |
(,Invitrogen |
| R2960 |
T10490 |
T10488 |
parataxis |
Invitrogen,pDEST17 |
| R2961 |
T10491 |
T10490 |
punct |
),Invitrogen |
| R2962 |
T10492 |
T10485 |
prep |
by,interacted |
| R2963 |
T10493 |
T10494 |
compound |
LR,recombination |
| R2964 |
T10494 |
T10492 |
pobj |
recombination,by |
| R2965 |
T10495 |
T10485 |
punct |
.,interacted |
| R2966 |
T10497 |
T10498 |
prep |
After,induced |
| R2967 |
T10499 |
T10497 |
pobj |
introduction,After |
| R2968 |
T10500 |
T10499 |
prep |
of,introduction |
| R2969 |
T10501 |
T10502 |
det |
the,vector |
| R2970 |
T10502 |
T10500 |
pobj |
vector,of |
| R2971 |
T10503 |
T10502 |
amod |
resulting,vector |
| R2972 |
T10504 |
T10502 |
compound |
expression,vector |
| R2973 |
T10505 |
T10506 |
compound |
pDEST17,pH34 |
| R2974 |
T10506 |
T10502 |
appos |
pH34,vector |
| R2975 |
T10507 |
T10506 |
punct |
-,pH34 |
| R2976 |
T10508 |
T10499 |
prep |
into,introduction |
| R2977 |
T10509 |
T10510 |
compound |
BL21,AI |
| R2978 |
T10510 |
T10508 |
pobj |
AI,into |
| R2979 |
T10511 |
T10510 |
punct |
-,AI |
| R2980 |
T10512 |
T10510 |
nmod |
E.,AI |
| R2981 |
T10513 |
T10510 |
nmod |
coli,AI |
| R2982 |
T10514 |
T10515 |
punct |
(,Invitrogen |
| R2983 |
T10515 |
T10499 |
parataxis |
Invitrogen,introduction |
| R2984 |
T10516 |
T10515 |
punct |
),Invitrogen |
| R2985 |
T10517 |
T10498 |
punct |
", ",induced |
| R2986 |
T10518 |
T10519 |
amod |
recombinant,protein |
| R2987 |
T10519 |
T10520 |
compound |
protein,production |
| R2988 |
T10520 |
T10498 |
nsubjpass |
production,induced |
| R2989 |
T10521 |
T10498 |
auxpass |
was,induced |
| R2990 |
T10522 |
T10498 |
prep |
according,induced |
| R2991 |
T10523 |
T10522 |
prep |
to,according |
| R2992 |
T10524 |
T10525 |
det |
the,manufacture |
| R2993 |
T10525 |
T10526 |
poss |
manufacture,protocol |
| R2994 |
T10526 |
T10523 |
pobj |
protocol,to |
| R2995 |
T10527 |
T10525 |
case |
's,manufacture |
| R2996 |
T10528 |
T10498 |
punct |
.,induced |
| R2997 |
T10530 |
T10531 |
npadvmod |
Histidine,tagged |
| R2998 |
T10531 |
T10533 |
amod |
tagged,ESG1 |
| R2999 |
T10532 |
T10531 |
punct |
-,tagged |
| R3000 |
T10533 |
T10534 |
nsubjpass |
ESG1,purified |
| R3001 |
T10535 |
T10534 |
auxpass |
was,purified |
| R3002 |
T10536 |
T10534 |
advcl |
using,purified |
| R3003 |
T10537 |
T10538 |
nmod |
Ni,agarose |
| R3004 |
T10538 |
T10536 |
dobj |
agarose,using |
| R3005 |
T10539 |
T10537 |
punct |
-,Ni |
| R3006 |
T10540 |
T10537 |
amod |
nitrilotriacetic,Ni |
| R3007 |
T10541 |
T10538 |
compound |
acid,agarose |
| R3008 |
T10542 |
T10543 |
punct |
(,Qiagen |
| R3009 |
T10543 |
T10538 |
parataxis |
Qiagen,agarose |
| R3010 |
T10544 |
T10543 |
punct |
),Qiagen |
| R3011 |
T10545 |
T10536 |
prep |
under,using |
| R3012 |
T10546 |
T10547 |
compound |
denaturing,conditions |
| R3013 |
T10547 |
T10545 |
pobj |
conditions,under |
| R3014 |
T10548 |
T10536 |
prep |
in,using |
| R3015 |
T10549 |
T10550 |
det |
the,presence |
| R3016 |
T10550 |
T10548 |
pobj |
presence,in |
| R3017 |
T10551 |
T10550 |
prep |
of,presence |
| R3018 |
T10552 |
T10553 |
nummod |
8,M |
| R3019 |
T10553 |
T10554 |
compound |
M,urea |
| R3020 |
T10554 |
T10551 |
pobj |
urea,of |
| R3021 |
T10555 |
T10534 |
punct |
.,purified |
| R3022 |
T10557 |
T10558 |
prep |
After,injected |
| R3023 |
T10559 |
T10557 |
pobj |
dialysis,After |
| R3024 |
T10560 |
T10559 |
prep |
against,dialysis |
| R3025 |
T10561 |
T10562 |
nummod |
6,M |
| R3026 |
T10562 |
T10563 |
compound |
M,urea |
| R3027 |
T10563 |
T10560 |
pobj |
urea,against |
| R3028 |
T10564 |
T10558 |
punct |
", ",injected |
| R3029 |
T10565 |
T10566 |
det |
the,proteins |
| R3030 |
T10566 |
T10558 |
nsubjpass |
proteins,injected |
| R3031 |
T10567 |
T10566 |
amod |
recombinant,proteins |
| R3032 |
T10568 |
T10558 |
auxpass |
were,injected |
| R3033 |
T10569 |
T10558 |
prep |
into,injected |
| R3034 |
T10570 |
T10571 |
nmod |
New,Zealand |
| R3035 |
T10571 |
T10572 |
nmod |
Zealand,rabbits |
| R3036 |
T10572 |
T10569 |
pobj |
rabbits,into |
| R3037 |
T10573 |
T10572 |
amod |
White,rabbits |
| R3038 |
T10574 |
T10575 |
aux |
to,generate |
| R3039 |
T10575 |
T10558 |
advcl |
generate,injected |
| R3040 |
T10576 |
T10577 |
amod |
anti-ESG1,antibodies |
| R3041 |
T10577 |
T10575 |
dobj |
antibodies,generate |
| R3042 |
T10578 |
T10577 |
amod |
polyclonal,antibodies |
| R3043 |
T10579 |
T10558 |
punct |
.,injected |
