| Id |
Subject |
Object |
Predicate |
Lexical cue |
| T11084 |
0-2 |
TO |
denotes |
To |
| T11085 |
3-11 |
VB |
denotes |
generate |
| T11087 |
12-14 |
DT |
denotes |
an |
| T11088 |
15-20 |
NN |
denotes |
shRNA |
| T11089 |
20-22 |
, |
denotes |
, |
| T11090 |
22-24 |
CD |
denotes |
64 |
| T11092 |
24-25 |
HYPH |
denotes |
- |
| T11091 |
25-29 |
NN |
denotes |
base |
| T11094 |
30-36 |
NN |
denotes |
duplex |
| T11095 |
37-40 |
NN |
denotes |
DNA |
| T11093 |
41-52 |
NNS |
denotes |
nucleotides |
| T11096 |
53-57 |
VBD |
denotes |
were |
| T11086 |
58-67 |
VBN |
denotes |
purchased |
| T11097 |
68-72 |
IN |
denotes |
from |
| T11098 |
73-83 |
NNP |
denotes |
Invitrogen |
| T11099 |
83-84 |
. |
denotes |
. |
| T11100 |
84-220 |
sentence |
denotes |
This fragment comprised 19 base residues specific to mouse Sam68 (GATCCCC AAGATGACGAGGAGAATTATTCAAGAGA TAATTCTCCTCGTCATCTT TTTTTGGAAA). |
| T11101 |
85-89 |
DT |
denotes |
This |
| T11102 |
90-98 |
NN |
denotes |
fragment |
| T11103 |
99-108 |
VBD |
denotes |
comprised |
| T11104 |
109-111 |
CD |
denotes |
19 |
| T11106 |
112-116 |
NN |
denotes |
base |
| T11105 |
117-125 |
NNS |
denotes |
residues |
| T11107 |
126-134 |
JJ |
denotes |
specific |
| T11108 |
135-137 |
IN |
denotes |
to |
| T11109 |
138-143 |
NN |
denotes |
mouse |
| T11110 |
144-149 |
NN |
denotes |
Sam68 |
| T11111 |
150-151 |
-LRB- |
denotes |
( |
| T11113 |
151-158 |
NN |
denotes |
GATCCCC |
| T11114 |
159-187 |
NN |
denotes |
AAGATGACGAGGAGAATTATTCAAGAGA |
| T11115 |
188-207 |
NN |
denotes |
TAATTCTCCTCGTCATCTT |
| T11112 |
208-218 |
NN |
denotes |
TTTTTGGAAA |
| T11116 |
218-219 |
-RRB- |
denotes |
) |
| T11117 |
219-220 |
. |
denotes |
. |
| T11118 |
220-314 |
sentence |
denotes |
This fragment was cloned into pSUPER retro (OligoEngine, Seattle, Washington, United States). |
| T11119 |
221-225 |
DT |
denotes |
This |
| T11120 |
226-234 |
NN |
denotes |
fragment |
| T11122 |
235-238 |
VBD |
denotes |
was |
| T11121 |
239-245 |
VBN |
denotes |
cloned |
| T11123 |
246-250 |
IN |
denotes |
into |
| T11124 |
251-257 |
NNP |
denotes |
pSUPER |
| T11125 |
258-263 |
NNP |
denotes |
retro |
| T11126 |
264-265 |
-LRB- |
denotes |
( |
| T11127 |
265-276 |
NNP |
denotes |
OligoEngine |
| T11128 |
276-278 |
, |
denotes |
, |
| T11129 |
278-285 |
NNP |
denotes |
Seattle |
| T11130 |
285-287 |
, |
denotes |
, |
| T11131 |
287-297 |
NNP |
denotes |
Washington |
| T11132 |
297-299 |
, |
denotes |
, |
| T11133 |
299-305 |
NNP |
denotes |
United |
| T11134 |
306-312 |
NNP |
denotes |
States |
| T11135 |
312-313 |
-RRB- |
denotes |
) |
| T11136 |
313-314 |
. |
denotes |
. |
| T11137 |
314-423 |
sentence |
denotes |
Transfections were performed using LipofectAMINE Plus (Invitrogen) with cloned DNA fragment or empty vector. |
| T11138 |
315-328 |
NNS |
denotes |
Transfections |
| T11140 |
329-333 |
VBD |
denotes |
were |
| T11139 |
334-343 |
VBN |
denotes |
performed |
| T11141 |
344-349 |
VBG |
denotes |
using |
| T11142 |
350-363 |
NNP |
denotes |
LipofectAMINE |
| T11143 |
364-368 |
NNP |
denotes |
Plus |
| T11144 |
369-370 |
-LRB- |
denotes |
( |
| T11145 |
370-380 |
NNP |
denotes |
Invitrogen |
| T11146 |
380-381 |
-RRB- |
denotes |
) |
| T11147 |
382-386 |
IN |
denotes |
with |
| T11148 |
387-393 |
VBN |
denotes |
cloned |
| T11150 |
394-397 |
NN |
denotes |
DNA |
| T11149 |
398-406 |
NN |
denotes |
fragment |
| T11151 |
407-409 |
CC |
denotes |
or |
| T11152 |
410-415 |
JJ |
denotes |
empty |
| T11153 |
416-422 |
NN |
denotes |
vector |
| T11154 |
422-423 |
. |
denotes |
. |
| T11155 |
423-578 |
sentence |
denotes |
At 48 h after transfection, populations were selected for 2.5 μg/ml puromycin and the knockdown observed by immunoblotting with anti-Sam68 (AD1) antibody. |
| T11156 |
424-426 |
IN |
denotes |
At |
| T11158 |
427-429 |
CD |
denotes |
48 |
| T11159 |
430-431 |
NN |
denotes |
h |
| T11160 |
432-437 |
IN |
denotes |
after |
| T11161 |
438-450 |
NN |
denotes |
transfection |
| T11162 |
450-452 |
, |
denotes |
, |
| T11163 |
452-463 |
NNS |
denotes |
populations |
| T11164 |
464-468 |
VBD |
denotes |
were |
| T11157 |
469-477 |
VBN |
denotes |
selected |
| T11165 |
478-481 |
IN |
denotes |
for |
| T11166 |
482-485 |
CD |
denotes |
2.5 |
| T11167 |
486-488 |
NN |
denotes |
μg |
| T11169 |
488-489 |
SYM |
denotes |
/ |
| T11170 |
489-491 |
NN |
denotes |
ml |
| T11168 |
492-501 |
NN |
denotes |
puromycin |
| T11171 |
502-505 |
CC |
denotes |
and |
| T11172 |
506-509 |
DT |
denotes |
the |
| T11173 |
510-519 |
NN |
denotes |
knockdown |
| T11174 |
520-528 |
VBN |
denotes |
observed |
| T11175 |
529-531 |
IN |
denotes |
by |
| T11176 |
532-546 |
VBG |
denotes |
immunoblotting |
| T11177 |
547-551 |
IN |
denotes |
with |
| T11178 |
552-562 |
JJ |
denotes |
anti-Sam68 |
| T11180 |
563-564 |
-LRB- |
denotes |
( |
| T11181 |
564-567 |
NN |
denotes |
AD1 |
| T11182 |
567-568 |
-RRB- |
denotes |
) |
| T11179 |
569-577 |
NN |
denotes |
antibody |
| T11183 |
577-578 |
. |
denotes |
. |
| R7151 |
T11084 |
T11085 |
aux |
To,generate |
| R7152 |
T11085 |
T11086 |
advcl |
generate,purchased |
| R7153 |
T11087 |
T11088 |
det |
an,shRNA |
| R7154 |
T11088 |
T11085 |
dobj |
shRNA,generate |
| R7155 |
T11089 |
T11086 |
punct |
", ",purchased |
| R7156 |
T11090 |
T11091 |
nummod |
64,base |
| R7157 |
T11091 |
T11093 |
compound |
base,nucleotides |
| R7158 |
T11092 |
T11091 |
punct |
-,base |
| R7159 |
T11093 |
T11086 |
nsubjpass |
nucleotides,purchased |
| R7160 |
T11094 |
T11093 |
compound |
duplex,nucleotides |
| R7161 |
T11095 |
T11093 |
compound |
DNA,nucleotides |
| R7162 |
T11096 |
T11086 |
auxpass |
were,purchased |
| R7163 |
T11097 |
T11086 |
prep |
from,purchased |
| R7164 |
T11098 |
T11097 |
pobj |
Invitrogen,from |
| R7165 |
T11099 |
T11086 |
punct |
.,purchased |
| R7166 |
T11101 |
T11102 |
det |
This,fragment |
| R7167 |
T11102 |
T11103 |
nsubj |
fragment,comprised |
| R7168 |
T11104 |
T11105 |
nummod |
19,residues |
| R7169 |
T11105 |
T11103 |
dobj |
residues,comprised |
| R7170 |
T11106 |
T11105 |
compound |
base,residues |
| R7171 |
T11107 |
T11105 |
amod |
specific,residues |
| R7172 |
T11108 |
T11107 |
prep |
to,specific |
| R7173 |
T11109 |
T11110 |
compound |
mouse,Sam68 |
| R7174 |
T11110 |
T11108 |
pobj |
Sam68,to |
| R7175 |
T11111 |
T11112 |
punct |
(,TTTTTGGAAA |
| R7176 |
T11112 |
T11103 |
parataxis |
TTTTTGGAAA,comprised |
| R7177 |
T11113 |
T11112 |
compound |
GATCCCC,TTTTTGGAAA |
| R7178 |
T11114 |
T11112 |
compound |
AAGATGACGAGGAGAATTATTCAAGAGA,TTTTTGGAAA |
| R7179 |
T11115 |
T11112 |
compound |
TAATTCTCCTCGTCATCTT,TTTTTGGAAA |
| R7180 |
T11116 |
T11112 |
punct |
),TTTTTGGAAA |
| R7181 |
T11117 |
T11103 |
punct |
.,comprised |
| R7182 |
T11119 |
T11120 |
det |
This,fragment |
| R7183 |
T11120 |
T11121 |
nsubjpass |
fragment,cloned |
| R7184 |
T11122 |
T11121 |
auxpass |
was,cloned |
| R7185 |
T11123 |
T11121 |
prep |
into,cloned |
| R7186 |
T11124 |
T11125 |
compound |
pSUPER,retro |
| R7187 |
T11125 |
T11123 |
pobj |
retro,into |
| R7188 |
T11126 |
T11127 |
punct |
(,OligoEngine |
| R7189 |
T11127 |
T11125 |
parataxis |
OligoEngine,retro |
| R7190 |
T11128 |
T11127 |
punct |
", ",OligoEngine |
| R7191 |
T11129 |
T11127 |
npadvmod |
Seattle,OligoEngine |
| R7192 |
T11130 |
T11127 |
punct |
", ",OligoEngine |
| R7193 |
T11131 |
T11127 |
npadvmod |
Washington,OligoEngine |
| R7194 |
T11132 |
T11127 |
punct |
", ",OligoEngine |
| R7195 |
T11133 |
T11134 |
compound |
United,States |
| R7196 |
T11134 |
T11127 |
npadvmod |
States,OligoEngine |
| R7197 |
T11135 |
T11127 |
punct |
),OligoEngine |
| R7198 |
T11136 |
T11121 |
punct |
.,cloned |
| R7199 |
T11138 |
T11139 |
nsubjpass |
Transfections,performed |
| R7200 |
T11140 |
T11139 |
auxpass |
were,performed |
| R7201 |
T11141 |
T11139 |
advcl |
using,performed |
| R7202 |
T11142 |
T11143 |
compound |
LipofectAMINE,Plus |
| R7203 |
T11143 |
T11141 |
dobj |
Plus,using |
| R7204 |
T11144 |
T11145 |
punct |
(,Invitrogen |
| R7205 |
T11145 |
T11143 |
parataxis |
Invitrogen,Plus |
| R7206 |
T11146 |
T11145 |
punct |
),Invitrogen |
| R7207 |
T11147 |
T11141 |
prep |
with,using |
| R7208 |
T11148 |
T11149 |
amod |
cloned,fragment |
| R7209 |
T11149 |
T11147 |
pobj |
fragment,with |
| R7210 |
T11150 |
T11149 |
compound |
DNA,fragment |
| R7211 |
T11151 |
T11149 |
cc |
or,fragment |
| R7212 |
T11152 |
T11153 |
amod |
empty,vector |
| R7213 |
T11153 |
T11149 |
conj |
vector,fragment |
| R7214 |
T11154 |
T11139 |
punct |
.,performed |
| R7215 |
T11156 |
T11157 |
prep |
At,selected |
| R7216 |
T11158 |
T11159 |
nummod |
48,h |
| R7217 |
T11159 |
T11156 |
pobj |
h,At |
| R7218 |
T11160 |
T11159 |
prep |
after,h |
| R7219 |
T11161 |
T11160 |
pobj |
transfection,after |
| R7220 |
T11162 |
T11157 |
punct |
", ",selected |
| R7221 |
T11163 |
T11157 |
nsubjpass |
populations,selected |
| R7222 |
T11164 |
T11157 |
auxpass |
were,selected |
| R7223 |
T11165 |
T11157 |
prep |
for,selected |
| R7224 |
T11166 |
T11167 |
nummod |
2.5,μg |
| R7225 |
T11167 |
T11168 |
nmod |
μg,puromycin |
| R7226 |
T11168 |
T11165 |
pobj |
puromycin,for |
| R7227 |
T11169 |
T11170 |
punct |
/,ml |
| R7228 |
T11170 |
T11167 |
prep |
ml,μg |
| R7229 |
T11171 |
T11157 |
cc |
and,selected |
| R7230 |
T11172 |
T11173 |
det |
the,knockdown |
| R7231 |
T11173 |
T11174 |
nsubj |
knockdown,observed |
| R7232 |
T11174 |
T11157 |
conj |
observed,selected |
| R7233 |
T11175 |
T11174 |
prep |
by,observed |
| R7234 |
T11176 |
T11175 |
pcomp |
immunoblotting,by |
| R7235 |
T11177 |
T11176 |
prep |
with,immunoblotting |
| R7236 |
T11178 |
T11179 |
nmod |
anti-Sam68,antibody |
| R7237 |
T11179 |
T11177 |
pobj |
antibody,with |
| R7238 |
T11180 |
T11181 |
punct |
(,AD1 |
| R7239 |
T11181 |
T11178 |
parataxis |
AD1,anti-Sam68 |
| R7240 |
T11182 |
T11181 |
punct |
),AD1 |
| R7241 |
T11183 |
T11157 |
punct |
.,selected |
