Id |
Subject |
Object |
Predicate |
Lexical cue |
T1057 |
13-19 |
IN |
denotes |
During |
T1059 |
20-28 |
JJ |
denotes |
skeletal |
T1060 |
29-40 |
NN |
denotes |
development |
T1061 |
40-42 |
, |
denotes |
, |
T1062 |
42-45 |
DT |
denotes |
the |
T1064 |
46-54 |
JJ |
denotes |
anabolic |
T1063 |
55-63 |
NN |
denotes |
activity |
T1065 |
64-66 |
IN |
denotes |
of |
T1066 |
67-78 |
NNS |
denotes |
osteoblasts |
T1067 |
79-80 |
-LRB- |
denotes |
[ |
T1068 |
80-81 |
CD |
denotes |
1 |
T1069 |
81-82 |
-RRB- |
denotes |
] |
T1070 |
83-85 |
VBZ |
denotes |
is |
T1058 |
86-93 |
VBN |
denotes |
favored |
T1071 |
94-98 |
IN |
denotes |
over |
T1072 |
99-102 |
DT |
denotes |
the |
T1074 |
103-112 |
JJ |
denotes |
catabolic |
T1073 |
113-121 |
NN |
denotes |
activity |
T1075 |
122-124 |
IN |
denotes |
of |
T1076 |
125-136 |
NNS |
denotes |
osteoclasts |
T1077 |
137-138 |
-LRB- |
denotes |
[ |
T1078 |
138-139 |
CD |
denotes |
2 |
T1079 |
139-140 |
-RRB- |
denotes |
] |
T1080 |
140-142 |
, |
denotes |
, |
T1081 |
142-147 |
WDT |
denotes |
which |
T1082 |
148-155 |
VBZ |
denotes |
results |
T1083 |
156-158 |
IN |
denotes |
in |
T1084 |
159-160 |
DT |
denotes |
a |
T1086 |
161-164 |
JJ |
denotes |
net |
T1085 |
165-169 |
NN |
denotes |
gain |
T1087 |
170-172 |
IN |
denotes |
in |
T1088 |
173-177 |
NN |
denotes |
bone |
T1089 |
178-182 |
NN |
denotes |
mass |
T1090 |
182-183 |
. |
denotes |
. |
T1091 |
183-319 |
sentence |
denotes |
At skeletal maturity, bone mass is maintained through the balanced activity of osteoblasts and osteoclasts during the remodeling cycle. |
T1092 |
184-186 |
IN |
denotes |
At |
T1094 |
187-195 |
JJ |
denotes |
skeletal |
T1095 |
196-204 |
NN |
denotes |
maturity |
T1096 |
204-206 |
, |
denotes |
, |
T1097 |
206-210 |
NN |
denotes |
bone |
T1098 |
211-215 |
NN |
denotes |
mass |
T1099 |
216-218 |
VBZ |
denotes |
is |
T1093 |
219-229 |
VBN |
denotes |
maintained |
T1100 |
230-237 |
IN |
denotes |
through |
T1101 |
238-241 |
DT |
denotes |
the |
T1103 |
242-250 |
VBN |
denotes |
balanced |
T1102 |
251-259 |
NN |
denotes |
activity |
T1104 |
260-262 |
IN |
denotes |
of |
T1105 |
263-274 |
NNS |
denotes |
osteoblasts |
T1106 |
275-278 |
CC |
denotes |
and |
T1107 |
279-290 |
NNS |
denotes |
osteoclasts |
T1108 |
291-297 |
IN |
denotes |
during |
T1109 |
298-301 |
DT |
denotes |
the |
T1111 |
302-312 |
NN |
denotes |
remodeling |
T1110 |
313-318 |
NN |
denotes |
cycle |
T1112 |
318-319 |
. |
denotes |
. |
T1113 |
319-459 |
sentence |
denotes |
During skeletal aging, there is a shift in the balance that favors osteoclast over osteoblast activity, which results in net bone loss [3]. |
T1114 |
320-326 |
IN |
denotes |
During |
T1116 |
327-335 |
JJ |
denotes |
skeletal |
T1117 |
336-341 |
NN |
denotes |
aging |
T1118 |
341-343 |
, |
denotes |
, |
T1119 |
343-348 |
EX |
denotes |
there |
T1115 |
349-351 |
VBZ |
denotes |
is |
T1120 |
352-353 |
DT |
denotes |
a |
T1121 |
354-359 |
NN |
denotes |
shift |
T1122 |
360-362 |
IN |
denotes |
in |
T1123 |
363-366 |
DT |
denotes |
the |
T1124 |
367-374 |
NN |
denotes |
balance |
T1125 |
375-379 |
WDT |
denotes |
that |
T1126 |
380-386 |
VBZ |
denotes |
favors |
T1127 |
387-397 |
NN |
denotes |
osteoclast |
T1128 |
398-402 |
IN |
denotes |
over |
T1129 |
403-413 |
NN |
denotes |
osteoblast |
T1130 |
414-422 |
NN |
denotes |
activity |
T1131 |
422-424 |
, |
denotes |
, |
T1132 |
424-429 |
WDT |
denotes |
which |
T1133 |
430-437 |
VBZ |
denotes |
results |
T1134 |
438-440 |
IN |
denotes |
in |
T1135 |
441-444 |
JJ |
denotes |
net |
T1137 |
445-449 |
NN |
denotes |
bone |
T1136 |
450-454 |
NN |
denotes |
loss |
T1138 |
455-456 |
-LRB- |
denotes |
[ |
T1139 |
456-457 |
CD |
denotes |
3 |
T1140 |
457-458 |
-RRB- |
denotes |
] |
T1141 |
458-459 |
. |
denotes |
. |
T1142 |
459-761 |
sentence |
denotes |
The amount and rate at which bone is gained during development and lost during aging are determined in large part by genetics [4–6] but also by physical activity and by alterations in the availability and response of bone cells to circulating hormones [7–9] and locally derived growth factors [10,11]. |
T1143 |
460-463 |
DT |
denotes |
The |
T1144 |
464-470 |
NN |
denotes |
amount |
T1146 |
471-474 |
CC |
denotes |
and |
T1147 |
475-479 |
NN |
denotes |
rate |
T1148 |
480-482 |
IN |
denotes |
at |
T1150 |
483-488 |
WDT |
denotes |
which |
T1151 |
489-493 |
NN |
denotes |
bone |
T1152 |
494-496 |
VBZ |
denotes |
is |
T1149 |
497-503 |
VBN |
denotes |
gained |
T1153 |
504-510 |
IN |
denotes |
during |
T1154 |
511-522 |
NN |
denotes |
development |
T1155 |
523-526 |
CC |
denotes |
and |
T1156 |
527-531 |
VBN |
denotes |
lost |
T1157 |
532-538 |
IN |
denotes |
during |
T1158 |
539-544 |
NN |
denotes |
aging |
T1159 |
545-548 |
VBP |
denotes |
are |
T1145 |
549-559 |
VBN |
denotes |
determined |
T1160 |
560-562 |
IN |
denotes |
in |
T1161 |
563-568 |
JJ |
denotes |
large |
T1162 |
569-573 |
NN |
denotes |
part |
T1163 |
574-576 |
IN |
denotes |
by |
T1164 |
577-585 |
NN |
denotes |
genetics |
T1165 |
586-587 |
-LRB- |
denotes |
[ |
T1166 |
587-588 |
CD |
denotes |
4 |
T1167 |
588-589 |
SYM |
denotes |
– |
T1168 |
589-590 |
CD |
denotes |
6 |
T1169 |
590-591 |
-RRB- |
denotes |
] |
T1170 |
592-595 |
CC |
denotes |
but |
T1171 |
596-600 |
RB |
denotes |
also |
T1172 |
601-603 |
IN |
denotes |
by |
T1173 |
604-612 |
JJ |
denotes |
physical |
T1174 |
613-621 |
NN |
denotes |
activity |
T1175 |
622-625 |
CC |
denotes |
and |
T1176 |
626-628 |
IN |
denotes |
by |
T1177 |
629-640 |
NNS |
denotes |
alterations |
T1178 |
641-643 |
IN |
denotes |
in |
T1179 |
644-647 |
DT |
denotes |
the |
T1180 |
648-660 |
NN |
denotes |
availability |
T1181 |
661-664 |
CC |
denotes |
and |
T1182 |
665-673 |
NN |
denotes |
response |
T1183 |
674-676 |
IN |
denotes |
of |
T1184 |
677-681 |
NN |
denotes |
bone |
T1185 |
682-687 |
NNS |
denotes |
cells |
T1186 |
688-690 |
IN |
denotes |
to |
T1187 |
691-702 |
VBG |
denotes |
circulating |
T1188 |
703-711 |
NNS |
denotes |
hormones |
T1189 |
712-713 |
-LRB- |
denotes |
[ |
T1190 |
713-714 |
CD |
denotes |
7 |
T1191 |
714-715 |
SYM |
denotes |
– |
T1192 |
715-716 |
CD |
denotes |
9 |
T1193 |
716-717 |
-RRB- |
denotes |
] |
T1194 |
718-721 |
CC |
denotes |
and |
T1195 |
722-729 |
RB |
denotes |
locally |
T1196 |
730-737 |
VBN |
denotes |
derived |
T1198 |
738-744 |
NN |
denotes |
growth |
T1197 |
745-752 |
NNS |
denotes |
factors |
T1199 |
753-754 |
-LRB- |
denotes |
[ |
T1201 |
754-756 |
CD |
denotes |
10 |
T1202 |
756-757 |
, |
denotes |
, |
T1200 |
757-759 |
CD |
denotes |
11 |
T1203 |
759-760 |
-RRB- |
denotes |
] |
T1204 |
760-761 |
. |
denotes |
. |
T1205 |
761-950 |
sentence |
denotes |
Whereas genetic-based studies have provided novel insights into the pathways that regulate bone development [12–14], relatively little is known about the etiology of age-related bone loss. |
T1206 |
762-769 |
IN |
denotes |
Whereas |
T1208 |
770-777 |
JJ |
denotes |
genetic |
T1210 |
777-778 |
HYPH |
denotes |
- |
T1209 |
778-783 |
VBN |
denotes |
based |
T1211 |
784-791 |
NNS |
denotes |
studies |
T1212 |
792-796 |
VBP |
denotes |
have |
T1207 |
797-805 |
VBN |
denotes |
provided |
T1214 |
806-811 |
JJ |
denotes |
novel |
T1215 |
812-820 |
NNS |
denotes |
insights |
T1216 |
821-825 |
IN |
denotes |
into |
T1217 |
826-829 |
DT |
denotes |
the |
T1218 |
830-838 |
NNS |
denotes |
pathways |
T1219 |
839-843 |
WDT |
denotes |
that |
T1220 |
844-852 |
VBP |
denotes |
regulate |
T1221 |
853-857 |
NN |
denotes |
bone |
T1222 |
858-869 |
NN |
denotes |
development |
T1223 |
870-871 |
-LRB- |
denotes |
[ |
T1224 |
871-873 |
CD |
denotes |
12 |
T1225 |
873-874 |
SYM |
denotes |
– |
T1226 |
874-876 |
CD |
denotes |
14 |
T1227 |
876-877 |
-RRB- |
denotes |
] |
T1228 |
877-879 |
, |
denotes |
, |
T1229 |
879-889 |
RB |
denotes |
relatively |
T1230 |
890-896 |
JJ |
denotes |
little |
T1231 |
897-899 |
VBZ |
denotes |
is |
T1213 |
900-905 |
VBN |
denotes |
known |
T1232 |
906-911 |
IN |
denotes |
about |
T1233 |
912-915 |
DT |
denotes |
the |
T1234 |
916-924 |
NN |
denotes |
etiology |
T1235 |
925-927 |
IN |
denotes |
of |
T1236 |
928-931 |
NN |
denotes |
age |
T1238 |
931-932 |
HYPH |
denotes |
- |
T1237 |
932-939 |
VBN |
denotes |
related |
T1240 |
940-944 |
NN |
denotes |
bone |
T1239 |
945-949 |
NN |
denotes |
loss |
T1241 |
949-950 |
. |
denotes |
. |
T1242 |
950-1108 |
sentence |
denotes |
Increased bone resorption in elderly men and women is associated with a reduction in bone mass and an increase in circulating levels of bone biomarkers [15]. |
T1243 |
951-960 |
VBN |
denotes |
Increased |
T1245 |
961-965 |
NN |
denotes |
bone |
T1244 |
966-976 |
NN |
denotes |
resorption |
T1247 |
977-979 |
IN |
denotes |
in |
T1248 |
980-987 |
JJ |
denotes |
elderly |
T1249 |
988-991 |
NNS |
denotes |
men |
T1250 |
992-995 |
CC |
denotes |
and |
T1251 |
996-1001 |
NNS |
denotes |
women |
T1252 |
1002-1004 |
VBZ |
denotes |
is |
T1246 |
1005-1015 |
VBN |
denotes |
associated |
T1253 |
1016-1020 |
IN |
denotes |
with |
T1254 |
1021-1022 |
DT |
denotes |
a |
T1255 |
1023-1032 |
NN |
denotes |
reduction |
T1256 |
1033-1035 |
IN |
denotes |
in |
T1257 |
1036-1040 |
NN |
denotes |
bone |
T1258 |
1041-1045 |
NN |
denotes |
mass |
T1259 |
1046-1049 |
CC |
denotes |
and |
T1260 |
1050-1052 |
DT |
denotes |
an |
T1261 |
1053-1061 |
NN |
denotes |
increase |
T1262 |
1062-1064 |
IN |
denotes |
in |
T1263 |
1065-1076 |
VBG |
denotes |
circulating |
T1264 |
1077-1083 |
NNS |
denotes |
levels |
T1265 |
1084-1086 |
IN |
denotes |
of |
T1266 |
1087-1091 |
NN |
denotes |
bone |
T1267 |
1092-1102 |
NNS |
denotes |
biomarkers |
T1268 |
1103-1104 |
-LRB- |
denotes |
[ |
T1269 |
1104-1106 |
CD |
denotes |
15 |
T1270 |
1106-1107 |
-RRB- |
denotes |
] |
T1271 |
1107-1108 |
. |
denotes |
. |
T1272 |
1108-1397 |
sentence |
denotes |
These changes have been attributed primarily to nutritional deficits resulting in alterations in the parathyroid hormone–vitamin D axis [16], to gonadal hormone deficiency [17], to leptin levels and the sympathetic nervous system [8,18–20], and to alterations in bone cell apoptosis [21]. |
T1273 |
1109-1114 |
DT |
denotes |
These |
T1274 |
1115-1122 |
NNS |
denotes |
changes |
T1276 |
1123-1127 |
VBP |
denotes |
have |
T1277 |
1128-1132 |
VBN |
denotes |
been |
T1275 |
1133-1143 |
VBN |
denotes |
attributed |
T1278 |
1144-1153 |
RB |
denotes |
primarily |
T1279 |
1154-1156 |
IN |
denotes |
to |
T1280 |
1157-1168 |
JJ |
denotes |
nutritional |
T1281 |
1169-1177 |
NNS |
denotes |
deficits |
T1282 |
1178-1187 |
VBG |
denotes |
resulting |
T1283 |
1188-1190 |
IN |
denotes |
in |
T1284 |
1191-1202 |
NNS |
denotes |
alterations |
T1285 |
1203-1205 |
IN |
denotes |
in |
T1286 |
1206-1209 |
DT |
denotes |
the |
T1288 |
1210-1221 |
NN |
denotes |
parathyroid |
T1289 |
1222-1229 |
NN |
denotes |
hormone |
T1290 |
1229-1230 |
HYPH |
denotes |
– |
T1291 |
1230-1237 |
NN |
denotes |
vitamin |
T1292 |
1238-1239 |
NN |
denotes |
D |
T1287 |
1240-1244 |
NN |
denotes |
axis |
T1293 |
1245-1246 |
-LRB- |
denotes |
[ |
T1294 |
1246-1248 |
CD |
denotes |
16 |
T1295 |
1248-1249 |
-RRB- |
denotes |
] |
T1296 |
1249-1251 |
, |
denotes |
, |
T1297 |
1251-1253 |
IN |
denotes |
to |
T1298 |
1254-1261 |
JJ |
denotes |
gonadal |
T1300 |
1262-1269 |
NN |
denotes |
hormone |
T1299 |
1270-1280 |
NN |
denotes |
deficiency |
T1301 |
1281-1282 |
-LRB- |
denotes |
[ |
T1302 |
1282-1284 |
CD |
denotes |
17 |
T1303 |
1284-1285 |
-RRB- |
denotes |
] |
T1304 |
1285-1287 |
, |
denotes |
, |
T1305 |
1287-1289 |
IN |
denotes |
to |
T1306 |
1290-1296 |
NN |
denotes |
leptin |
T1307 |
1297-1303 |
NNS |
denotes |
levels |
T1308 |
1304-1307 |
CC |
denotes |
and |
T1309 |
1308-1311 |
DT |
denotes |
the |
T1311 |
1312-1323 |
JJ |
denotes |
sympathetic |
T1312 |
1324-1331 |
JJ |
denotes |
nervous |
T1310 |
1332-1338 |
NN |
denotes |
system |
T1313 |
1339-1340 |
-LRB- |
denotes |
[ |
T1314 |
1340-1341 |
CD |
denotes |
8 |
T1315 |
1341-1342 |
, |
denotes |
, |
T1316 |
1342-1344 |
CD |
denotes |
18 |
T1317 |
1344-1345 |
SYM |
denotes |
– |
T1318 |
1345-1347 |
CD |
denotes |
20 |
T1319 |
1347-1348 |
-RRB- |
denotes |
] |
T1320 |
1348-1350 |
, |
denotes |
, |
T1321 |
1350-1353 |
CC |
denotes |
and |
T1322 |
1354-1356 |
IN |
denotes |
to |
T1323 |
1357-1368 |
NNS |
denotes |
alterations |
T1324 |
1369-1371 |
IN |
denotes |
in |
T1325 |
1372-1376 |
NN |
denotes |
bone |
T1326 |
1377-1381 |
NN |
denotes |
cell |
T1327 |
1382-1391 |
NN |
denotes |
apoptosis |
T1328 |
1392-1393 |
-LRB- |
denotes |
[ |
T1329 |
1393-1395 |
CD |
denotes |
21 |
T1330 |
1395-1396 |
-RRB- |
denotes |
] |
T1331 |
1396-1397 |
. |
denotes |
. |
T1332 |
1397-1629 |
sentence |
denotes |
Bone loss in the elderly has also been attributed to alterations in the response of bone marrow stromal cells to their microenvironment that favors differentiation down the adipocyte lineage rather than the osteoblast lineage [22]. |
T1333 |
1398-1402 |
NN |
denotes |
Bone |
T1334 |
1403-1407 |
NN |
denotes |
loss |
T1336 |
1408-1410 |
IN |
denotes |
in |
T1337 |
1411-1414 |
DT |
denotes |
the |
T1338 |
1415-1422 |
JJ |
denotes |
elderly |
T1339 |
1423-1426 |
VBZ |
denotes |
has |
T1340 |
1427-1431 |
RB |
denotes |
also |
T1341 |
1432-1436 |
VBN |
denotes |
been |
T1335 |
1437-1447 |
VBN |
denotes |
attributed |
T1342 |
1448-1450 |
IN |
denotes |
to |
T1343 |
1451-1462 |
NNS |
denotes |
alterations |
T1344 |
1463-1465 |
IN |
denotes |
in |
T1345 |
1466-1469 |
DT |
denotes |
the |
T1346 |
1470-1478 |
NN |
denotes |
response |
T1347 |
1479-1481 |
IN |
denotes |
of |
T1348 |
1482-1486 |
NN |
denotes |
bone |
T1349 |
1487-1493 |
NN |
denotes |
marrow |
T1351 |
1494-1501 |
JJ |
denotes |
stromal |
T1350 |
1502-1507 |
NNS |
denotes |
cells |
T1352 |
1508-1510 |
IN |
denotes |
to |
T1353 |
1511-1516 |
PRP$ |
denotes |
their |
T1354 |
1517-1533 |
NN |
denotes |
microenvironment |
T1355 |
1534-1538 |
WDT |
denotes |
that |
T1356 |
1539-1545 |
VBZ |
denotes |
favors |
T1357 |
1546-1561 |
NN |
denotes |
differentiation |
T1358 |
1562-1566 |
IN |
denotes |
down |
T1359 |
1567-1570 |
DT |
denotes |
the |
T1361 |
1571-1580 |
NN |
denotes |
adipocyte |
T1360 |
1581-1588 |
NN |
denotes |
lineage |
T1362 |
1589-1595 |
RB |
denotes |
rather |
T1363 |
1596-1600 |
IN |
denotes |
than |
T1364 |
1601-1604 |
DT |
denotes |
the |
T1366 |
1605-1615 |
NN |
denotes |
osteoblast |
T1365 |
1616-1623 |
NN |
denotes |
lineage |
T1367 |
1624-1625 |
-LRB- |
denotes |
[ |
T1368 |
1625-1627 |
CD |
denotes |
22 |
T1369 |
1627-1628 |
-RRB- |
denotes |
] |
T1370 |
1628-1629 |
. |
denotes |
. |
T1371 |
1629-1761 |
sentence |
denotes |
Aging has long been associated with an increase in marrow fat, where the generation of adipocytes is favored over osteoblasts [23]. |
T1372 |
1630-1635 |
NN |
denotes |
Aging |
T1374 |
1636-1639 |
VBZ |
denotes |
has |
T1375 |
1640-1644 |
RB |
denotes |
long |
T1376 |
1645-1649 |
VBN |
denotes |
been |
T1373 |
1650-1660 |
VBN |
denotes |
associated |
T1377 |
1661-1665 |
IN |
denotes |
with |
T1378 |
1666-1668 |
DT |
denotes |
an |
T1379 |
1669-1677 |
NN |
denotes |
increase |
T1380 |
1678-1680 |
IN |
denotes |
in |
T1381 |
1681-1687 |
NN |
denotes |
marrow |
T1382 |
1688-1691 |
NN |
denotes |
fat |
T1383 |
1691-1693 |
, |
denotes |
, |
T1384 |
1693-1698 |
WRB |
denotes |
where |
T1386 |
1699-1702 |
DT |
denotes |
the |
T1387 |
1703-1713 |
NN |
denotes |
generation |
T1388 |
1714-1716 |
IN |
denotes |
of |
T1389 |
1717-1727 |
NNS |
denotes |
adipocytes |
T1390 |
1728-1730 |
VBZ |
denotes |
is |
T1385 |
1731-1738 |
VBN |
denotes |
favored |
T1391 |
1739-1743 |
IN |
denotes |
over |
T1392 |
1744-1755 |
NNS |
denotes |
osteoblasts |
T1393 |
1756-1757 |
-LRB- |
denotes |
[ |
T1394 |
1757-1759 |
CD |
denotes |
23 |
T1395 |
1759-1760 |
-RRB- |
denotes |
] |
T1396 |
1760-1761 |
. |
denotes |
. |
T1397 |
1761-1981 |
sentence |
denotes |
Osteoblasts and adipocytes are derived from a common mesenchymal precursor cell present in bone marrow, and the factors that control this age-induced switch toward adipogenic differentiation is not well understood [24]. |
T1398 |
1762-1773 |
NNS |
denotes |
Osteoblasts |
T1400 |
1774-1777 |
CC |
denotes |
and |
T1401 |
1778-1788 |
NNS |
denotes |
adipocytes |
T1402 |
1789-1792 |
VBP |
denotes |
are |
T1399 |
1793-1800 |
VBN |
denotes |
derived |
T1403 |
1801-1805 |
IN |
denotes |
from |
T1404 |
1806-1807 |
DT |
denotes |
a |
T1406 |
1808-1814 |
JJ |
denotes |
common |
T1407 |
1815-1826 |
JJ |
denotes |
mesenchymal |
T1408 |
1827-1836 |
NN |
denotes |
precursor |
T1405 |
1837-1841 |
NN |
denotes |
cell |
T1409 |
1842-1849 |
JJ |
denotes |
present |
T1410 |
1850-1852 |
IN |
denotes |
in |
T1411 |
1853-1857 |
NN |
denotes |
bone |
T1412 |
1858-1864 |
NN |
denotes |
marrow |
T1413 |
1864-1866 |
, |
denotes |
, |
T1414 |
1866-1869 |
CC |
denotes |
and |
T1415 |
1870-1873 |
DT |
denotes |
the |
T1416 |
1874-1881 |
NNS |
denotes |
factors |
T1418 |
1882-1886 |
WDT |
denotes |
that |
T1419 |
1887-1894 |
VBP |
denotes |
control |
T1420 |
1895-1899 |
DT |
denotes |
this |
T1422 |
1900-1903 |
NN |
denotes |
age |
T1424 |
1903-1904 |
HYPH |
denotes |
- |
T1423 |
1904-1911 |
VBN |
denotes |
induced |
T1421 |
1912-1918 |
NN |
denotes |
switch |
T1425 |
1919-1925 |
IN |
denotes |
toward |
T1426 |
1926-1936 |
JJ |
denotes |
adipogenic |
T1427 |
1937-1952 |
NN |
denotes |
differentiation |
T1428 |
1953-1955 |
VBZ |
denotes |
is |
T1429 |
1956-1959 |
RB |
denotes |
not |
T1430 |
1960-1964 |
RB |
denotes |
well |
T1417 |
1965-1975 |
VBN |
denotes |
understood |
T1431 |
1976-1977 |
-LRB- |
denotes |
[ |
T1432 |
1977-1979 |
CD |
denotes |
24 |
T1433 |
1979-1980 |
-RRB- |
denotes |
] |
T1434 |
1980-1981 |
. |
denotes |
. |
T1435 |
1981-2262 |
sentence |
denotes |
While several transcriptional regulatory proteins have been associated with cell fate determination of bone marrow mesenchymal cells, including peroxisome proliferator–activated receptor γ (PPARγ) and KLF5 [25–30], the role of RNA binding proteins in this process remains unknown. |
T1436 |
1982-1987 |
IN |
denotes |
While |
T1438 |
1988-1995 |
JJ |
denotes |
several |
T1440 |
1996-2011 |
JJ |
denotes |
transcriptional |
T1441 |
2012-2022 |
JJ |
denotes |
regulatory |
T1439 |
2023-2031 |
NN |
denotes |
proteins |
T1442 |
2032-2036 |
VBP |
denotes |
have |
T1443 |
2037-2041 |
VBN |
denotes |
been |
T1437 |
2042-2052 |
VBN |
denotes |
associated |
T1445 |
2053-2057 |
IN |
denotes |
with |
T1446 |
2058-2062 |
NN |
denotes |
cell |
T1448 |
2063-2067 |
NN |
denotes |
fate |
T1447 |
2068-2081 |
NN |
denotes |
determination |
T1449 |
2082-2084 |
IN |
denotes |
of |
T1450 |
2085-2089 |
NN |
denotes |
bone |
T1451 |
2090-2096 |
NN |
denotes |
marrow |
T1453 |
2097-2108 |
JJ |
denotes |
mesenchymal |
T1452 |
2109-2114 |
NNS |
denotes |
cells |
T1454 |
2114-2116 |
, |
denotes |
, |
T1455 |
2116-2125 |
VBG |
denotes |
including |
T1456 |
2126-2136 |
NN |
denotes |
peroxisome |
T1458 |
2137-2149 |
NN |
denotes |
proliferator |
T1460 |
2149-2150 |
HYPH |
denotes |
– |
T1459 |
2150-2159 |
VBN |
denotes |
activated |
T1457 |
2160-2168 |
NN |
denotes |
receptor |
T1461 |
2169-2170 |
SYM |
denotes |
γ |
T1462 |
2171-2172 |
-LRB- |
denotes |
( |
T1463 |
2172-2177 |
NN |
denotes |
PPARγ |
T1464 |
2177-2178 |
-RRB- |
denotes |
) |
T1465 |
2179-2182 |
CC |
denotes |
and |
T1466 |
2183-2187 |
NN |
denotes |
KLF5 |
T1467 |
2188-2189 |
-LRB- |
denotes |
[ |
T1468 |
2189-2191 |
CD |
denotes |
25 |
T1469 |
2191-2192 |
SYM |
denotes |
– |
T1470 |
2192-2194 |
CD |
denotes |
30 |
T1471 |
2194-2195 |
-RRB- |
denotes |
] |
T1472 |
2195-2197 |
, |
denotes |
, |
T1473 |
2197-2200 |
DT |
denotes |
the |
T1474 |
2201-2205 |
NN |
denotes |
role |
T1475 |
2206-2208 |
IN |
denotes |
of |
T1476 |
2209-2212 |
NN |
denotes |
RNA |
T1478 |
2213-2220 |
NN |
denotes |
binding |
T1477 |
2221-2229 |
NN |
denotes |
proteins |
T1479 |
2230-2232 |
IN |
denotes |
in |
T1480 |
2233-2237 |
DT |
denotes |
this |
T1481 |
2238-2245 |
NN |
denotes |
process |
T1444 |
2246-2253 |
VBZ |
denotes |
remains |
T1482 |
2254-2261 |
JJ |
denotes |
unknown |
T1483 |
2261-2262 |
. |
denotes |
. |
T1484 |
2262-2348 |
sentence |
denotes |
RNA binding proteins of the KH type are known regulators of cellular differentiation. |
T1485 |
2263-2266 |
NN |
denotes |
RNA |
T1487 |
2267-2274 |
NN |
denotes |
binding |
T1486 |
2275-2283 |
NN |
denotes |
proteins |
T1489 |
2284-2286 |
IN |
denotes |
of |
T1490 |
2287-2290 |
DT |
denotes |
the |
T1492 |
2291-2293 |
NN |
denotes |
KH |
T1491 |
2294-2298 |
NN |
denotes |
type |
T1488 |
2299-2302 |
VBP |
denotes |
are |
T1493 |
2303-2308 |
JJ |
denotes |
known |
T1494 |
2309-2319 |
NNS |
denotes |
regulators |
T1495 |
2320-2322 |
IN |
denotes |
of |
T1496 |
2323-2331 |
JJ |
denotes |
cellular |
T1497 |
2332-2347 |
NN |
denotes |
differentiation |
T1498 |
2347-2348 |
. |
denotes |
. |
T1499 |
2348-2538 |
sentence |
denotes |
For example, expression defects in the KH domain proteins NOVA and FMRP are known to cause paraneoplastic neurologic disorders [31] and the fragile X syndrome, respectively, in humans [32]. |
T1500 |
2349-2352 |
IN |
denotes |
For |
T1502 |
2353-2360 |
NN |
denotes |
example |
T1503 |
2360-2362 |
, |
denotes |
, |
T1504 |
2362-2372 |
NN |
denotes |
expression |
T1505 |
2373-2380 |
NNS |
denotes |
defects |
T1506 |
2381-2383 |
IN |
denotes |
in |
T1507 |
2384-2387 |
DT |
denotes |
the |
T1509 |
2388-2390 |
NN |
denotes |
KH |
T1510 |
2391-2397 |
NN |
denotes |
domain |
T1508 |
2398-2406 |
NN |
denotes |
proteins |
T1511 |
2407-2411 |
NN |
denotes |
NOVA |
T1512 |
2412-2415 |
CC |
denotes |
and |
T1513 |
2416-2420 |
NN |
denotes |
FMRP |
T1514 |
2421-2424 |
VBP |
denotes |
are |
T1501 |
2425-2430 |
VBN |
denotes |
known |
T1515 |
2431-2433 |
TO |
denotes |
to |
T1516 |
2434-2439 |
VB |
denotes |
cause |
T1517 |
2440-2454 |
JJ |
denotes |
paraneoplastic |
T1519 |
2455-2465 |
JJ |
denotes |
neurologic |
T1518 |
2466-2475 |
NNS |
denotes |
disorders |
T1520 |
2476-2477 |
-LRB- |
denotes |
[ |
T1521 |
2477-2479 |
CD |
denotes |
31 |
T1522 |
2479-2480 |
-RRB- |
denotes |
] |
T1523 |
2481-2484 |
CC |
denotes |
and |
T1524 |
2485-2488 |
DT |
denotes |
the |
T1526 |
2489-2496 |
JJ |
denotes |
fragile |
T1527 |
2497-2498 |
NN |
denotes |
X |
T1525 |
2499-2507 |
NN |
denotes |
syndrome |
T1528 |
2507-2509 |
, |
denotes |
, |
T1529 |
2509-2521 |
RB |
denotes |
respectively |
T1530 |
2521-2523 |
, |
denotes |
, |
T1531 |
2523-2525 |
IN |
denotes |
in |
T1532 |
2526-2532 |
NNS |
denotes |
humans |
T1533 |
2533-2534 |
-LRB- |
denotes |
[ |
T1534 |
2534-2536 |
CD |
denotes |
32 |
T1535 |
2536-2537 |
-RRB- |
denotes |
] |
T1536 |
2537-2538 |
. |
denotes |
. |
T1537 |
2538-2673 |
sentence |
denotes |
The phenotype of the quaking viable mice suggests a role for the QUAKING RNA binding protein in oligodendrocytes and myelination [33]. |
T1538 |
2539-2542 |
DT |
denotes |
The |
T1539 |
2543-2552 |
NN |
denotes |
phenotype |
T1541 |
2553-2555 |
IN |
denotes |
of |
T1542 |
2556-2559 |
DT |
denotes |
the |
T1544 |
2560-2567 |
NN |
denotes |
quaking |
T1545 |
2568-2574 |
JJ |
denotes |
viable |
T1543 |
2575-2579 |
NNS |
denotes |
mice |
T1540 |
2580-2588 |
VBZ |
denotes |
suggests |
T1546 |
2589-2590 |
DT |
denotes |
a |
T1547 |
2591-2595 |
NN |
denotes |
role |
T1548 |
2596-2599 |
IN |
denotes |
for |
T1549 |
2600-2603 |
DT |
denotes |
the |
T1551 |
2604-2611 |
NN |
denotes |
QUAKING |
T1552 |
2612-2615 |
NN |
denotes |
RNA |
T1553 |
2616-2623 |
NN |
denotes |
binding |
T1550 |
2624-2631 |
NN |
denotes |
protein |
T1554 |
2632-2634 |
IN |
denotes |
in |
T1555 |
2635-2651 |
NNS |
denotes |
oligodendrocytes |
T1556 |
2652-2655 |
CC |
denotes |
and |
T1557 |
2656-2667 |
NN |
denotes |
myelination |
T1558 |
2668-2669 |
-LRB- |
denotes |
[ |
T1559 |
2669-2671 |
CD |
denotes |
33 |
T1560 |
2671-2672 |
-RRB- |
denotes |
] |
T1561 |
2672-2673 |
. |
denotes |
. |
T1562 |
2673-2872 |
sentence |
denotes |
Indeed, the ectopic expression of the QKI-6/7 isoforms in vivo led to the formation of glial cells rather than neurons from neural progenitor, demonstrating its role in cell fate determination [34]. |
T1563 |
2674-2680 |
RB |
denotes |
Indeed |
T1565 |
2680-2682 |
, |
denotes |
, |
T1566 |
2682-2685 |
DT |
denotes |
the |
T1568 |
2686-2693 |
JJ |
denotes |
ectopic |
T1567 |
2694-2704 |
NN |
denotes |
expression |
T1569 |
2705-2707 |
IN |
denotes |
of |
T1570 |
2708-2711 |
DT |
denotes |
the |
T1572 |
2712-2715 |
NN |
denotes |
QKI |
T1574 |
2715-2716 |
HYPH |
denotes |
- |
T1575 |
2716-2717 |
CD |
denotes |
6 |
T1576 |
2717-2718 |
HYPH |
denotes |
/ |
T1573 |
2718-2719 |
CD |
denotes |
7 |
T1571 |
2720-2728 |
NNS |
denotes |
isoforms |
T1577 |
2729-2731 |
FW |
denotes |
in |
T1578 |
2732-2736 |
FW |
denotes |
vivo |
T1564 |
2737-2740 |
VBD |
denotes |
led |
T1579 |
2741-2743 |
IN |
denotes |
to |
T1580 |
2744-2747 |
DT |
denotes |
the |
T1581 |
2748-2757 |
NN |
denotes |
formation |
T1582 |
2758-2760 |
IN |
denotes |
of |
T1583 |
2761-2766 |
JJ |
denotes |
glial |
T1584 |
2767-2772 |
NNS |
denotes |
cells |
T1585 |
2773-2779 |
RB |
denotes |
rather |
T1586 |
2780-2784 |
IN |
denotes |
than |
T1587 |
2785-2792 |
NNS |
denotes |
neurons |
T1588 |
2793-2797 |
IN |
denotes |
from |
T1589 |
2798-2804 |
JJ |
denotes |
neural |
T1590 |
2805-2815 |
NN |
denotes |
progenitor |
T1591 |
2815-2817 |
, |
denotes |
, |
T1592 |
2817-2830 |
VBG |
denotes |
demonstrating |
T1593 |
2831-2834 |
PRP$ |
denotes |
its |
T1594 |
2835-2839 |
NN |
denotes |
role |
T1595 |
2840-2842 |
IN |
denotes |
in |
T1596 |
2843-2847 |
NN |
denotes |
cell |
T1598 |
2848-2852 |
NN |
denotes |
fate |
T1597 |
2853-2866 |
NN |
denotes |
determination |
T1599 |
2867-2868 |
-LRB- |
denotes |
[ |
T1600 |
2868-2870 |
CD |
denotes |
34 |
T1601 |
2870-2871 |
-RRB- |
denotes |
] |
T1602 |
2871-2872 |
. |
denotes |
. |
T1603 |
2872-3109 |
sentence |
denotes |
The loss of GLD-1 protein in Caenorhabditis elegans prevents the appearance of stem cells [35], and the absence of the KH domain protein HOW in Drosophila prevents muscle differentiation and results in flies with held-out-wings [36,37]. |
T1604 |
2873-2876 |
DT |
denotes |
The |
T1605 |
2877-2881 |
NN |
denotes |
loss |
T1607 |
2882-2884 |
IN |
denotes |
of |
T1608 |
2885-2888 |
NN |
denotes |
GLD |
T1610 |
2888-2889 |
HYPH |
denotes |
- |
T1611 |
2889-2890 |
CD |
denotes |
1 |
T1609 |
2891-2898 |
NN |
denotes |
protein |
T1612 |
2899-2901 |
IN |
denotes |
in |
T1613 |
2902-2916 |
NNP |
denotes |
Caenorhabditis |
T1614 |
2917-2924 |
NNP |
denotes |
elegans |
T1606 |
2925-2933 |
VBZ |
denotes |
prevents |
T1615 |
2934-2937 |
DT |
denotes |
the |
T1616 |
2938-2948 |
NN |
denotes |
appearance |
T1617 |
2949-2951 |
IN |
denotes |
of |
T1618 |
2952-2956 |
NN |
denotes |
stem |
T1619 |
2957-2962 |
NNS |
denotes |
cells |
T1620 |
2963-2964 |
-LRB- |
denotes |
[ |
T1621 |
2964-2966 |
CD |
denotes |
35 |
T1622 |
2966-2967 |
-RRB- |
denotes |
] |
T1623 |
2967-2969 |
, |
denotes |
, |
T1624 |
2969-2972 |
CC |
denotes |
and |
T1625 |
2973-2976 |
DT |
denotes |
the |
T1626 |
2977-2984 |
NN |
denotes |
absence |
T1628 |
2985-2987 |
IN |
denotes |
of |
T1629 |
2988-2991 |
DT |
denotes |
the |
T1631 |
2992-2994 |
NN |
denotes |
KH |
T1632 |
2995-3001 |
NN |
denotes |
domain |
T1630 |
3002-3009 |
NN |
denotes |
protein |
T1633 |
3010-3013 |
NN |
denotes |
HOW |
T1634 |
3014-3016 |
IN |
denotes |
in |
T1635 |
3017-3027 |
NNP |
denotes |
Drosophila |
T1627 |
3028-3036 |
VBZ |
denotes |
prevents |
T1636 |
3037-3043 |
NN |
denotes |
muscle |
T1637 |
3044-3059 |
NN |
denotes |
differentiation |
T1638 |
3060-3063 |
CC |
denotes |
and |
T1639 |
3064-3071 |
VBZ |
denotes |
results |
T1640 |
3072-3074 |
IN |
denotes |
in |
T1641 |
3075-3080 |
NNS |
denotes |
flies |
T1642 |
3081-3085 |
IN |
denotes |
with |
T1643 |
3086-3090 |
VBN |
denotes |
held |
T1645 |
3090-3091 |
HYPH |
denotes |
- |
T1646 |
3091-3094 |
RP |
denotes |
out |
T1647 |
3094-3095 |
HYPH |
denotes |
- |
T1644 |
3095-3100 |
NNS |
denotes |
wings |
T1648 |
3101-3102 |
-LRB- |
denotes |
[ |
T1650 |
3102-3104 |
CD |
denotes |
36 |
T1651 |
3104-3105 |
, |
denotes |
, |
T1649 |
3105-3107 |
CD |
denotes |
37 |
T1652 |
3107-3108 |
-RRB- |
denotes |
] |
T1653 |
3108-3109 |
. |
denotes |
. |
T1654 |
3109-3292 |
sentence |
denotes |
The Src substrate associated in mitosis of 68 kDa (Sam68) is also a member of the family of KH domain RNA binding proteins [38]; however, its physiologic role has remained undefined. |
T1655 |
3110-3113 |
DT |
denotes |
The |
T1657 |
3114-3117 |
NN |
denotes |
Src |
T1656 |
3118-3127 |
NN |
denotes |
substrate |
T1659 |
3128-3138 |
VBN |
denotes |
associated |
T1660 |
3139-3141 |
IN |
denotes |
in |
T1661 |
3142-3149 |
NN |
denotes |
mitosis |
T1662 |
3150-3152 |
IN |
denotes |
of |
T1663 |
3153-3155 |
CD |
denotes |
68 |
T1664 |
3156-3159 |
NN |
denotes |
kDa |
T1665 |
3160-3161 |
-LRB- |
denotes |
( |
T1666 |
3161-3166 |
NN |
denotes |
Sam68 |
T1667 |
3166-3167 |
-RRB- |
denotes |
) |
T1658 |
3168-3170 |
VBZ |
denotes |
is |
T1669 |
3171-3175 |
RB |
denotes |
also |
T1670 |
3176-3177 |
DT |
denotes |
a |
T1671 |
3178-3184 |
NN |
denotes |
member |
T1672 |
3185-3187 |
IN |
denotes |
of |
T1673 |
3188-3191 |
DT |
denotes |
the |
T1674 |
3192-3198 |
NN |
denotes |
family |
T1675 |
3199-3201 |
IN |
denotes |
of |
T1676 |
3202-3204 |
NN |
denotes |
KH |
T1678 |
3205-3211 |
NN |
denotes |
domain |
T1679 |
3212-3215 |
NN |
denotes |
RNA |
T1680 |
3216-3223 |
NN |
denotes |
binding |
T1677 |
3224-3232 |
NN |
denotes |
proteins |
T1681 |
3233-3234 |
-LRB- |
denotes |
[ |
T1682 |
3234-3236 |
CD |
denotes |
38 |
T1683 |
3236-3237 |
-RRB- |
denotes |
] |
T1684 |
3237-3238 |
: |
denotes |
; |
T1685 |
3239-3246 |
RB |
denotes |
however |
T1686 |
3246-3248 |
, |
denotes |
, |
T1687 |
3248-3251 |
PRP$ |
denotes |
its |
T1689 |
3252-3263 |
JJ |
denotes |
physiologic |
T1688 |
3264-3268 |
NN |
denotes |
role |
T1690 |
3269-3272 |
VBZ |
denotes |
has |
T1668 |
3273-3281 |
VBN |
denotes |
remained |
T1691 |
3282-3291 |
JJ |
denotes |
undefined |
T1692 |
3291-3292 |
. |
denotes |
. |
T1693 |
3292-3471 |
sentence |
denotes |
Sam68 was identified as an SH3 and SH2 domain interacting protein for Src family kinases and is also a known substrate of Src kinases [39–42] and of the breast tumor kinase [43]. |
T1694 |
3293-3298 |
NN |
denotes |
Sam68 |
T1696 |
3299-3302 |
VBD |
denotes |
was |
T1695 |
3303-3313 |
VBN |
denotes |
identified |
T1697 |
3314-3316 |
IN |
denotes |
as |
T1698 |
3317-3319 |
DT |
denotes |
an |
T1700 |
3320-3323 |
NN |
denotes |
SH3 |
T1701 |
3324-3327 |
CC |
denotes |
and |
T1702 |
3328-3331 |
NN |
denotes |
SH2 |
T1703 |
3332-3338 |
NN |
denotes |
domain |
T1704 |
3339-3350 |
VBG |
denotes |
interacting |
T1699 |
3351-3358 |
NN |
denotes |
protein |
T1705 |
3359-3362 |
IN |
denotes |
for |
T1706 |
3363-3366 |
NN |
denotes |
Src |
T1708 |
3367-3373 |
NN |
denotes |
family |
T1707 |
3374-3381 |
NNS |
denotes |
kinases |
T1709 |
3382-3385 |
CC |
denotes |
and |
T1710 |
3386-3388 |
VBZ |
denotes |
is |
T1711 |
3389-3393 |
RB |
denotes |
also |
T1712 |
3394-3395 |
DT |
denotes |
a |
T1714 |
3396-3401 |
JJ |
denotes |
known |
T1713 |
3402-3411 |
NN |
denotes |
substrate |
T1715 |
3412-3414 |
IN |
denotes |
of |
T1716 |
3415-3418 |
NN |
denotes |
Src |
T1717 |
3419-3426 |
NNS |
denotes |
kinases |
T1718 |
3427-3428 |
-LRB- |
denotes |
[ |
T1719 |
3428-3430 |
CD |
denotes |
39 |
T1720 |
3430-3431 |
SYM |
denotes |
– |
T1721 |
3431-3433 |
CD |
denotes |
42 |
T1722 |
3433-3434 |
-RRB- |
denotes |
] |
T1723 |
3435-3438 |
CC |
denotes |
and |
T1724 |
3439-3441 |
IN |
denotes |
of |
T1725 |
3442-3445 |
DT |
denotes |
the |
T1727 |
3446-3452 |
NN |
denotes |
breast |
T1728 |
3453-3458 |
NN |
denotes |
tumor |
T1726 |
3459-3465 |
NN |
denotes |
kinase |
T1729 |
3466-3467 |
-LRB- |
denotes |
[ |
T1730 |
3467-3469 |
CD |
denotes |
43 |
T1731 |
3469-3470 |
-RRB- |
denotes |
] |
T1732 |
3470-3471 |
. |
denotes |
. |
T1733 |
3471-3585 |
sentence |
denotes |
Sam68 has been shown to facilitate the export of unspliced HIV RNA [44] and to regulate pre-mRNA processing [45]. |
T1734 |
3472-3477 |
NN |
denotes |
Sam68 |
T1736 |
3478-3481 |
VBZ |
denotes |
has |
T1737 |
3482-3486 |
VBN |
denotes |
been |
T1735 |
3487-3492 |
VBN |
denotes |
shown |
T1738 |
3493-3495 |
TO |
denotes |
to |
T1739 |
3496-3506 |
VB |
denotes |
facilitate |
T1740 |
3507-3510 |
DT |
denotes |
the |
T1741 |
3511-3517 |
NN |
denotes |
export |
T1742 |
3518-3520 |
IN |
denotes |
of |
T1743 |
3521-3530 |
JJ |
denotes |
unspliced |
T1745 |
3531-3534 |
NN |
denotes |
HIV |
T1744 |
3535-3538 |
NN |
denotes |
RNA |
T1746 |
3539-3540 |
-LRB- |
denotes |
[ |
T1747 |
3540-3542 |
CD |
denotes |
44 |
T1748 |
3542-3543 |
-RRB- |
denotes |
] |
T1749 |
3544-3547 |
CC |
denotes |
and |
T1750 |
3548-3550 |
TO |
denotes |
to |
T1751 |
3551-3559 |
VB |
denotes |
regulate |
T1752 |
3560-3568 |
NN |
denotes |
pre-mRNA |
T1753 |
3569-3579 |
NN |
denotes |
processing |
T1754 |
3580-3581 |
-LRB- |
denotes |
[ |
T1755 |
3581-3583 |
CD |
denotes |
45 |
T1756 |
3583-3584 |
-RRB- |
denotes |
] |
T1757 |
3584-3585 |
. |
denotes |
. |
T1758 |
3585-3691 |
sentence |
denotes |
In the present paper, we report the generation of Sam68−/− mice and analysis of their skeletal phenotype. |
T1759 |
3586-3588 |
IN |
denotes |
In |
T1761 |
3589-3592 |
DT |
denotes |
the |
T1763 |
3593-3600 |
JJ |
denotes |
present |
T1762 |
3601-3606 |
NN |
denotes |
paper |
T1764 |
3606-3608 |
, |
denotes |
, |
T1765 |
3608-3610 |
PRP |
denotes |
we |
T1760 |
3611-3617 |
VBP |
denotes |
report |
T1766 |
3618-3621 |
DT |
denotes |
the |
T1767 |
3622-3632 |
NN |
denotes |
generation |
T1768 |
3633-3635 |
IN |
denotes |
of |
T1769 |
3636-3641 |
NN |
denotes |
Sam68 |
T1771 |
3641-3642 |
SYM |
denotes |
− |
T1772 |
3642-3643 |
HYPH |
denotes |
/ |
T1773 |
3643-3644 |
SYM |
denotes |
− |
T1770 |
3645-3649 |
NNS |
denotes |
mice |
T1774 |
3650-3653 |
CC |
denotes |
and |
T1775 |
3654-3662 |
NN |
denotes |
analysis |
T1776 |
3663-3665 |
IN |
denotes |
of |
T1777 |
3666-3671 |
PRP$ |
denotes |
their |
T1779 |
3672-3680 |
JJ |
denotes |
skeletal |
T1778 |
3681-3690 |
NN |
denotes |
phenotype |
T1780 |
3690-3691 |
. |
denotes |
. |
T1781 |
3691-3865 |
sentence |
denotes |
Our data indicate that the absence of Sam68 confers resistance to age-related bone loss in mice such that old Sam68 have a higher bone mass than their wild-type littermates. |
T1782 |
3692-3695 |
PRP$ |
denotes |
Our |
T1783 |
3696-3700 |
NNS |
denotes |
data |
T1784 |
3701-3709 |
VBP |
denotes |
indicate |
T1785 |
3710-3714 |
IN |
denotes |
that |
T1787 |
3715-3718 |
DT |
denotes |
the |
T1788 |
3719-3726 |
NN |
denotes |
absence |
T1789 |
3727-3729 |
IN |
denotes |
of |
T1790 |
3730-3735 |
NN |
denotes |
Sam68 |
T1786 |
3736-3743 |
VBZ |
denotes |
confers |
T1791 |
3744-3754 |
NN |
denotes |
resistance |
T1792 |
3755-3757 |
IN |
denotes |
to |
T1793 |
3758-3761 |
NN |
denotes |
age |
T1795 |
3761-3762 |
HYPH |
denotes |
- |
T1794 |
3762-3769 |
VBN |
denotes |
related |
T1797 |
3770-3774 |
NN |
denotes |
bone |
T1796 |
3775-3779 |
NN |
denotes |
loss |
T1798 |
3780-3782 |
IN |
denotes |
in |
T1799 |
3783-3787 |
NNS |
denotes |
mice |
T1800 |
3788-3792 |
JJ |
denotes |
such |
T1802 |
3793-3797 |
IN |
denotes |
that |
T1803 |
3798-3801 |
JJ |
denotes |
old |
T1804 |
3802-3807 |
NN |
denotes |
Sam68 |
T1801 |
3808-3812 |
VBP |
denotes |
have |
T1805 |
3813-3814 |
DT |
denotes |
a |
T1807 |
3815-3821 |
JJR |
denotes |
higher |
T1808 |
3822-3826 |
NN |
denotes |
bone |
T1806 |
3827-3831 |
NN |
denotes |
mass |
T1809 |
3832-3836 |
IN |
denotes |
than |
T1810 |
3837-3842 |
PRP$ |
denotes |
their |
T1812 |
3843-3847 |
JJ |
denotes |
wild |
T1814 |
3847-3848 |
HYPH |
denotes |
- |
T1813 |
3848-3852 |
NN |
denotes |
type |
T1811 |
3853-3864 |
NNS |
denotes |
littermates |
T1815 |
3864-3865 |
. |
denotes |
. |
T1816 |
3865-4124 |
sentence |
denotes |
We provide evidence that Sam68 regulates the differentiation of bone marrow stromal cells by showing that cells isolated from Sam68−/− animals had enhanced osteogenic activity and decreased adipogenic activity than those harvested from wild-type littermates. |
T1817 |
3866-3868 |
PRP |
denotes |
We |
T1818 |
3869-3876 |
VBP |
denotes |
provide |
T1819 |
3877-3885 |
NN |
denotes |
evidence |
T1820 |
3886-3890 |
IN |
denotes |
that |
T1822 |
3891-3896 |
NN |
denotes |
Sam68 |
T1821 |
3897-3906 |
VBZ |
denotes |
regulates |
T1823 |
3907-3910 |
DT |
denotes |
the |
T1824 |
3911-3926 |
NN |
denotes |
differentiation |
T1825 |
3927-3929 |
IN |
denotes |
of |
T1826 |
3930-3934 |
NN |
denotes |
bone |
T1827 |
3935-3941 |
NN |
denotes |
marrow |
T1829 |
3942-3949 |
JJ |
denotes |
stromal |
T1828 |
3950-3955 |
NNS |
denotes |
cells |
T1830 |
3956-3958 |
IN |
denotes |
by |
T1831 |
3959-3966 |
VBG |
denotes |
showing |
T1832 |
3967-3971 |
IN |
denotes |
that |
T1834 |
3972-3977 |
NNS |
denotes |
cells |
T1835 |
3978-3986 |
VBN |
denotes |
isolated |
T1836 |
3987-3991 |
IN |
denotes |
from |
T1837 |
3992-3997 |
NN |
denotes |
Sam68 |
T1839 |
3997-3998 |
SYM |
denotes |
− |
T1840 |
3998-3999 |
HYPH |
denotes |
/ |
T1841 |
3999-4000 |
SYM |
denotes |
− |
T1838 |
4001-4008 |
NNS |
denotes |
animals |
T1833 |
4009-4012 |
VBD |
denotes |
had |
T1842 |
4013-4021 |
VBN |
denotes |
enhanced |
T1844 |
4022-4032 |
JJ |
denotes |
osteogenic |
T1843 |
4033-4041 |
NN |
denotes |
activity |
T1845 |
4042-4045 |
CC |
denotes |
and |
T1846 |
4046-4055 |
VBN |
denotes |
decreased |
T1848 |
4056-4066 |
JJ |
denotes |
adipogenic |
T1847 |
4067-4075 |
NN |
denotes |
activity |
T1849 |
4076-4080 |
IN |
denotes |
than |
T1850 |
4081-4086 |
DT |
denotes |
those |
T1851 |
4087-4096 |
VBN |
denotes |
harvested |
T1852 |
4097-4101 |
IN |
denotes |
from |
T1853 |
4102-4106 |
JJ |
denotes |
wild |
T1855 |
4106-4107 |
HYPH |
denotes |
- |
T1854 |
4107-4111 |
NN |
denotes |
type |
T1856 |
4112-4123 |
NNS |
denotes |
littermates |
T1857 |
4123-4124 |
. |
denotes |
. |
T1858 |
4124-4333 |
sentence |
denotes |
Furthermore, Sam68−/− mouse embryo fibroblasts (MEFs) were impaired in their capacity to differentiate into adipocytes, consistent with Sam68 being a regulator of bone marrow mesenchymal cell differentiation. |
T1859 |
4125-4136 |
RB |
denotes |
Furthermore |
T1861 |
4136-4138 |
, |
denotes |
, |
T1862 |
4138-4143 |
NN |
denotes |
Sam68 |
T1863 |
4143-4144 |
SYM |
denotes |
− |
T1864 |
4144-4145 |
HYPH |
denotes |
/ |
T1865 |
4145-4146 |
SYM |
denotes |
− |
T1866 |
4147-4152 |
NN |
denotes |
mouse |
T1867 |
4153-4159 |
NN |
denotes |
embryo |
T1868 |
4160-4171 |
NNS |
denotes |
fibroblasts |
T1869 |
4172-4173 |
-LRB- |
denotes |
( |
T1870 |
4173-4177 |
NNS |
denotes |
MEFs |
T1871 |
4177-4178 |
-RRB- |
denotes |
) |
T1872 |
4179-4183 |
VBD |
denotes |
were |
T1860 |
4184-4192 |
VBN |
denotes |
impaired |
T1873 |
4193-4195 |
IN |
denotes |
in |
T1874 |
4196-4201 |
PRP$ |
denotes |
their |
T1875 |
4202-4210 |
NN |
denotes |
capacity |
T1876 |
4211-4213 |
TO |
denotes |
to |
T1877 |
4214-4227 |
VB |
denotes |
differentiate |
T1878 |
4228-4232 |
IN |
denotes |
into |
T1879 |
4233-4243 |
NNS |
denotes |
adipocytes |
T1880 |
4243-4245 |
, |
denotes |
, |
T1881 |
4245-4255 |
JJ |
denotes |
consistent |
T1882 |
4256-4260 |
IN |
denotes |
with |
T1883 |
4261-4266 |
NN |
denotes |
Sam68 |
T1884 |
4267-4272 |
VBG |
denotes |
being |
T1885 |
4273-4274 |
DT |
denotes |
a |
T1886 |
4275-4284 |
NN |
denotes |
regulator |
T1887 |
4285-4287 |
IN |
denotes |
of |
T1888 |
4288-4292 |
NN |
denotes |
bone |
T1889 |
4293-4299 |
NN |
denotes |
marrow |
T1891 |
4300-4311 |
JJ |
denotes |
mesenchymal |
T1892 |
4312-4316 |
NN |
denotes |
cell |
T1890 |
4317-4332 |
NN |
denotes |
differentiation |
T1893 |
4332-4333 |
. |
denotes |
. |
T1894 |
4333-4449 |
sentence |
denotes |
These results also characterize a new animal model to study bone metabolism, regeneration, and repair during aging. |
T1895 |
4334-4339 |
DT |
denotes |
These |
T1896 |
4340-4347 |
NNS |
denotes |
results |
T1898 |
4348-4352 |
RB |
denotes |
also |
T1897 |
4353-4365 |
VBP |
denotes |
characterize |
T1899 |
4366-4367 |
DT |
denotes |
a |
T1901 |
4368-4371 |
JJ |
denotes |
new |
T1902 |
4372-4378 |
NN |
denotes |
animal |
T1900 |
4379-4384 |
NN |
denotes |
model |
T1903 |
4385-4387 |
TO |
denotes |
to |
T1904 |
4388-4393 |
VB |
denotes |
study |
T1905 |
4394-4398 |
NN |
denotes |
bone |
T1906 |
4399-4409 |
NN |
denotes |
metabolism |
T1907 |
4409-4411 |
, |
denotes |
, |
T1908 |
4411-4423 |
NN |
denotes |
regeneration |
T1909 |
4423-4425 |
, |
denotes |
, |
T1910 |
4425-4428 |
CC |
denotes |
and |
T1911 |
4429-4435 |
NN |
denotes |
repair |
T1912 |
4436-4442 |
IN |
denotes |
during |
T1913 |
4443-4448 |
NN |
denotes |
aging |
T1914 |
4448-4449 |
. |
denotes |
. |
T2061 |
4460-4465 |
NN |
denotes |
Sam68 |
T2063 |
4466-4468 |
VBZ |
denotes |
Is |
T2062 |
4469-4478 |
VBN |
denotes |
Expressed |
T2064 |
4479-4481 |
IN |
denotes |
in |
T2065 |
4482-4485 |
DT |
denotes |
the |
T2067 |
4486-4496 |
VBG |
denotes |
Developing |
T2066 |
4497-4505 |
NN |
denotes |
Skeleton |
T2068 |
4506-4508 |
IN |
denotes |
of |
T2069 |
4509-4518 |
JJ |
denotes |
Embryonic |
T2070 |
4519-4523 |
NNS |
denotes |
Mice |
T2071 |
4523-4649 |
sentence |
denotes |
The Sam68 mRNA is known to be widely expressed [38], whereas its pattern of protein expression in vivo remains to be defined. |
T2072 |
4524-4527 |
DT |
denotes |
The |
T2074 |
4528-4533 |
NN |
denotes |
Sam68 |
T2073 |
4534-4538 |
NN |
denotes |
mRNA |
T2076 |
4539-4541 |
VBZ |
denotes |
is |
T2075 |
4542-4547 |
VBN |
denotes |
known |
T2077 |
4548-4550 |
TO |
denotes |
to |
T2079 |
4551-4553 |
VB |
denotes |
be |
T2080 |
4554-4560 |
RB |
denotes |
widely |
T2078 |
4561-4570 |
VBN |
denotes |
expressed |
T2081 |
4571-4572 |
-LRB- |
denotes |
[ |
T2082 |
4572-4574 |
CD |
denotes |
38 |
T2083 |
4574-4575 |
-RRB- |
denotes |
] |
T2084 |
4575-4577 |
, |
denotes |
, |
T2085 |
4577-4584 |
IN |
denotes |
whereas |
T2087 |
4585-4588 |
PRP$ |
denotes |
its |
T2088 |
4589-4596 |
NN |
denotes |
pattern |
T2089 |
4597-4599 |
IN |
denotes |
of |
T2090 |
4600-4607 |
NN |
denotes |
protein |
T2091 |
4608-4618 |
NN |
denotes |
expression |
T2092 |
4619-4621 |
FW |
denotes |
in |
T2093 |
4622-4626 |
FW |
denotes |
vivo |
T2086 |
4627-4634 |
VBZ |
denotes |
remains |
T2094 |
4635-4637 |
TO |
denotes |
to |
T2096 |
4638-4640 |
VB |
denotes |
be |
T2095 |
4641-4648 |
VBN |
denotes |
defined |
T2097 |
4648-4649 |
. |
denotes |
. |
T2098 |
4649-4916 |
sentence |
denotes |
Sections of paraffin-embedded wild-type E14.5 and E16.5 embryonic mice were immunostained with the well-characterized AD1 anti-Sam68 antibody, raised in rabbits against an immunizing peptide that corresponds to amino acids 330 to 348 of the mouse Sam68 protein [46]. |
T2099 |
4650-4658 |
NNS |
denotes |
Sections |
T2101 |
4659-4661 |
IN |
denotes |
of |
T2102 |
4662-4670 |
NN |
denotes |
paraffin |
T2104 |
4670-4671 |
HYPH |
denotes |
- |
T2103 |
4671-4679 |
VBN |
denotes |
embedded |
T2106 |
4680-4684 |
JJ |
denotes |
wild |
T2108 |
4684-4685 |
HYPH |
denotes |
- |
T2107 |
4685-4689 |
NN |
denotes |
type |
T2109 |
4690-4695 |
NN |
denotes |
E14.5 |
T2110 |
4696-4699 |
CC |
denotes |
and |
T2111 |
4700-4705 |
NN |
denotes |
E16.5 |
T2112 |
4706-4715 |
JJ |
denotes |
embryonic |
T2105 |
4716-4720 |
NNS |
denotes |
mice |
T2113 |
4721-4725 |
VBD |
denotes |
were |
T2100 |
4726-4739 |
VBN |
denotes |
immunostained |
T2114 |
4740-4744 |
IN |
denotes |
with |
T2115 |
4745-4748 |
DT |
denotes |
the |
T2117 |
4749-4753 |
RB |
denotes |
well |
T2119 |
4753-4754 |
HYPH |
denotes |
- |
T2118 |
4754-4767 |
VBN |
denotes |
characterized |
T2120 |
4768-4771 |
NN |
denotes |
AD1 |
T2121 |
4772-4782 |
JJ |
denotes |
anti-Sam68 |
T2116 |
4783-4791 |
NN |
denotes |
antibody |
T2122 |
4791-4793 |
, |
denotes |
, |
T2123 |
4793-4799 |
VBN |
denotes |
raised |
T2124 |
4800-4802 |
IN |
denotes |
in |
T2125 |
4803-4810 |
NNS |
denotes |
rabbits |
T2126 |
4811-4818 |
IN |
denotes |
against |
T2127 |
4819-4821 |
DT |
denotes |
an |
T2129 |
4822-4832 |
VBG |
denotes |
immunizing |
T2128 |
4833-4840 |
NN |
denotes |
peptide |
T2130 |
4841-4845 |
WDT |
denotes |
that |
T2131 |
4846-4857 |
VBZ |
denotes |
corresponds |
T2132 |
4858-4860 |
IN |
denotes |
to |
T2133 |
4861-4866 |
NN |
denotes |
amino |
T2135 |
4867-4872 |
NNS |
denotes |
acids |
T2134 |
4873-4876 |
CD |
denotes |
330 |
T2136 |
4877-4879 |
IN |
denotes |
to |
T2137 |
4880-4883 |
CD |
denotes |
348 |
T2138 |
4884-4886 |
IN |
denotes |
of |
T2139 |
4887-4890 |
DT |
denotes |
the |
T2141 |
4891-4896 |
NN |
denotes |
mouse |
T2142 |
4897-4902 |
NN |
denotes |
Sam68 |
T2140 |
4903-4910 |
NN |
denotes |
protein |
T2143 |
4911-4912 |
-LRB- |
denotes |
[ |
T2144 |
4912-4914 |
CD |
denotes |
46 |
T2145 |
4914-4915 |
-RRB- |
denotes |
] |
T2146 |
4915-4916 |
. |
denotes |
. |
T2147 |
4916-5045 |
sentence |
denotes |
Sam68 immunoreactivity was observed in the skeleton and soft tissues of developing wild-type mice at E14.5 and E16.5 (Figure 1). |
T2148 |
4917-4922 |
NN |
denotes |
Sam68 |
T2149 |
4923-4939 |
NN |
denotes |
immunoreactivity |
T2151 |
4940-4943 |
VBD |
denotes |
was |
T2150 |
4944-4952 |
VBN |
denotes |
observed |
T2152 |
4953-4955 |
IN |
denotes |
in |
T2153 |
4956-4959 |
DT |
denotes |
the |
T2154 |
4960-4968 |
NN |
denotes |
skeleton |
T2155 |
4969-4972 |
CC |
denotes |
and |
T2156 |
4973-4977 |
JJ |
denotes |
soft |
T2157 |
4978-4985 |
NNS |
denotes |
tissues |
T2158 |
4986-4988 |
IN |
denotes |
of |
T2159 |
4989-4999 |
VBG |
denotes |
developing |
T2161 |
5000-5004 |
JJ |
denotes |
wild |
T2163 |
5004-5005 |
HYPH |
denotes |
- |
T2162 |
5005-5009 |
NN |
denotes |
type |
T2160 |
5010-5014 |
NNS |
denotes |
mice |
T2164 |
5015-5017 |
IN |
denotes |
at |
T2165 |
5018-5023 |
NN |
denotes |
E14.5 |
T2166 |
5024-5027 |
CC |
denotes |
and |
T2167 |
5028-5033 |
NN |
denotes |
E16.5 |
T2168 |
5034-5035 |
-LRB- |
denotes |
( |
T2169 |
5035-5041 |
NN |
denotes |
Figure |
T2170 |
5042-5043 |
CD |
denotes |
1 |
T2171 |
5043-5044 |
-RRB- |
denotes |
) |
T2172 |
5044-5045 |
. |
denotes |
. |
T2173 |
5045-5417 |
sentence |
denotes |
Intense staining was seen in the nucleus of cells in the developing brain, heart, and small intestine (Figure 1B), as well as in chondrocytes in the nasal septum and the glandular tissue adjacent to the nasal cartilage (Figure 1C, panels A–D), in the vertebra and intervertebral discs (panels E–H) and in the epiphysis (panels I–K) and metaphysis (panel L) of long bones. |
T2174 |
5046-5053 |
JJ |
denotes |
Intense |
T2175 |
5054-5062 |
NN |
denotes |
staining |
T2177 |
5063-5066 |
VBD |
denotes |
was |
T2176 |
5067-5071 |
VBN |
denotes |
seen |
T2178 |
5072-5074 |
IN |
denotes |
in |
T2179 |
5075-5078 |
DT |
denotes |
the |
T2180 |
5079-5086 |
NN |
denotes |
nucleus |
T2181 |
5087-5089 |
IN |
denotes |
of |
T2182 |
5090-5095 |
NNS |
denotes |
cells |
T2183 |
5096-5098 |
IN |
denotes |
in |
T2184 |
5099-5102 |
DT |
denotes |
the |
T2186 |
5103-5113 |
VBG |
denotes |
developing |
T2185 |
5114-5119 |
NN |
denotes |
brain |
T2187 |
5119-5121 |
, |
denotes |
, |
T2188 |
5121-5126 |
NN |
denotes |
heart |
T2189 |
5126-5128 |
, |
denotes |
, |
T2190 |
5128-5131 |
CC |
denotes |
and |
T2191 |
5132-5137 |
JJ |
denotes |
small |
T2192 |
5138-5147 |
NN |
denotes |
intestine |
T2193 |
5148-5149 |
-LRB- |
denotes |
( |
T2195 |
5149-5155 |
NN |
denotes |
Figure |
T2194 |
5156-5158 |
NN |
denotes |
1B |
T2196 |
5158-5159 |
-RRB- |
denotes |
) |
T2197 |
5159-5161 |
, |
denotes |
, |
T2198 |
5161-5163 |
RB |
denotes |
as |
T2200 |
5164-5168 |
RB |
denotes |
well |
T2199 |
5169-5171 |
IN |
denotes |
as |
T2201 |
5172-5174 |
IN |
denotes |
in |
T2202 |
5175-5187 |
NNS |
denotes |
chondrocytes |
T2203 |
5188-5190 |
IN |
denotes |
in |
T2204 |
5191-5194 |
DT |
denotes |
the |
T2206 |
5195-5200 |
JJ |
denotes |
nasal |
T2205 |
5201-5207 |
NN |
denotes |
septum |
T2207 |
5208-5211 |
CC |
denotes |
and |
T2208 |
5212-5215 |
DT |
denotes |
the |
T2210 |
5216-5225 |
JJ |
denotes |
glandular |
T2209 |
5226-5232 |
NN |
denotes |
tissue |
T2211 |
5233-5241 |
JJ |
denotes |
adjacent |
T2212 |
5242-5244 |
IN |
denotes |
to |
T2213 |
5245-5248 |
DT |
denotes |
the |
T2215 |
5249-5254 |
JJ |
denotes |
nasal |
T2214 |
5255-5264 |
NN |
denotes |
cartilage |
T2216 |
5265-5266 |
-LRB- |
denotes |
( |
T2218 |
5266-5272 |
NN |
denotes |
Figure |
T2217 |
5273-5275 |
NN |
denotes |
1C |
T2219 |
5275-5277 |
, |
denotes |
, |
T2220 |
5277-5283 |
NNS |
denotes |
panels |
T2221 |
5284-5285 |
NN |
denotes |
A |
T2222 |
5285-5286 |
SYM |
denotes |
– |
T2223 |
5286-5287 |
NN |
denotes |
D |
T2224 |
5287-5288 |
-RRB- |
denotes |
) |
T2225 |
5288-5290 |
, |
denotes |
, |
T2226 |
5290-5292 |
IN |
denotes |
in |
T2227 |
5293-5296 |
DT |
denotes |
the |
T2228 |
5297-5305 |
NNS |
denotes |
vertebra |
T2229 |
5306-5309 |
CC |
denotes |
and |
T2230 |
5310-5324 |
JJ |
denotes |
intervertebral |
T2231 |
5325-5330 |
NNS |
denotes |
discs |
T2232 |
5331-5332 |
-LRB- |
denotes |
( |
T2234 |
5332-5338 |
NNS |
denotes |
panels |
T2233 |
5339-5340 |
NN |
denotes |
E |
T2235 |
5340-5341 |
SYM |
denotes |
– |
T2236 |
5341-5342 |
NN |
denotes |
H |
T2237 |
5342-5343 |
-RRB- |
denotes |
) |
T2238 |
5344-5347 |
CC |
denotes |
and |
T2239 |
5348-5350 |
IN |
denotes |
in |
T2240 |
5351-5354 |
DT |
denotes |
the |
T2241 |
5355-5364 |
NN |
denotes |
epiphysis |
T2242 |
5365-5366 |
-LRB- |
denotes |
( |
T2244 |
5366-5372 |
NNS |
denotes |
panels |
T2243 |
5373-5374 |
NN |
denotes |
I |
T2245 |
5374-5375 |
SYM |
denotes |
– |
T2246 |
5375-5376 |
NN |
denotes |
K |
T2247 |
5376-5377 |
-RRB- |
denotes |
) |
T2248 |
5378-5381 |
CC |
denotes |
and |
T2249 |
5382-5392 |
NN |
denotes |
metaphysis |
T2250 |
5393-5394 |
-LRB- |
denotes |
( |
T2252 |
5394-5399 |
NN |
denotes |
panel |
T2251 |
5400-5401 |
NN |
denotes |
L |
T2253 |
5401-5402 |
-RRB- |
denotes |
) |
T2254 |
5403-5405 |
IN |
denotes |
of |
T2255 |
5406-5410 |
JJ |
denotes |
long |
T2256 |
5411-5416 |
NNS |
denotes |
bones |
T2257 |
5416-5417 |
. |
denotes |
. |
T2258 |
5417-5600 |
sentence |
denotes |
Nuclear staining was observed in proliferating chondrocytes and hypertrophic chondrocytes (Figure 1C, panel H), in osteoblasts (panel L; Dataset S1), and in osteoclasts (Dataset S1). |
T2259 |
5418-5425 |
JJ |
denotes |
Nuclear |
T2260 |
5426-5434 |
NN |
denotes |
staining |
T2262 |
5435-5438 |
VBD |
denotes |
was |
T2261 |
5439-5447 |
VBN |
denotes |
observed |
T2263 |
5448-5450 |
IN |
denotes |
in |
T2264 |
5451-5464 |
VBG |
denotes |
proliferating |
T2265 |
5465-5477 |
NNS |
denotes |
chondrocytes |
T2266 |
5478-5481 |
CC |
denotes |
and |
T2267 |
5482-5494 |
JJ |
denotes |
hypertrophic |
T2268 |
5495-5507 |
NNS |
denotes |
chondrocytes |
T2269 |
5508-5509 |
-LRB- |
denotes |
( |
T2271 |
5509-5515 |
NN |
denotes |
Figure |
T2270 |
5516-5518 |
NN |
denotes |
1C |
T2272 |
5518-5520 |
, |
denotes |
, |
T2273 |
5520-5525 |
NN |
denotes |
panel |
T2274 |
5526-5527 |
NN |
denotes |
H |
T2275 |
5527-5528 |
-RRB- |
denotes |
) |
T2276 |
5528-5530 |
, |
denotes |
, |
T2277 |
5530-5532 |
IN |
denotes |
in |
T2278 |
5533-5544 |
NNS |
denotes |
osteoblasts |
T2279 |
5545-5546 |
-LRB- |
denotes |
( |
T2281 |
5546-5551 |
NN |
denotes |
panel |
T2280 |
5552-5553 |
NN |
denotes |
L |
T2282 |
5553-5554 |
: |
denotes |
; |
T2283 |
5555-5562 |
NN |
denotes |
Dataset |
T2284 |
5563-5565 |
NN |
denotes |
S1 |
T2285 |
5565-5566 |
-RRB- |
denotes |
) |
T2286 |
5566-5568 |
, |
denotes |
, |
T2287 |
5568-5571 |
CC |
denotes |
and |
T2288 |
5572-5574 |
IN |
denotes |
in |
T2289 |
5575-5586 |
NNS |
denotes |
osteoclasts |
T2290 |
5587-5588 |
-LRB- |
denotes |
( |
T2292 |
5588-5595 |
NN |
denotes |
Dataset |
T2291 |
5596-5598 |
NN |
denotes |
S1 |
T2293 |
5598-5599 |
-RRB- |
denotes |
) |
T2294 |
5599-5600 |
. |
denotes |
. |
T2295 |
5600-5745 |
sentence |
denotes |
No staining was observed with preimmune serum or when the antiserum was preadsorbed with the immunizing peptide (Figure 1C, panels B, F, and J). |
T2296 |
5601-5603 |
DT |
denotes |
No |
T2297 |
5604-5612 |
NN |
denotes |
staining |
T2299 |
5613-5616 |
VBD |
denotes |
was |
T2298 |
5617-5625 |
VBN |
denotes |
observed |
T2300 |
5626-5630 |
IN |
denotes |
with |
T2301 |
5631-5640 |
JJ |
denotes |
preimmune |
T2302 |
5641-5646 |
NN |
denotes |
serum |
T2303 |
5647-5649 |
CC |
denotes |
or |
T2304 |
5650-5654 |
WRB |
denotes |
when |
T2306 |
5655-5658 |
DT |
denotes |
the |
T2307 |
5659-5668 |
NN |
denotes |
antiserum |
T2308 |
5669-5672 |
VBD |
denotes |
was |
T2305 |
5673-5684 |
VBN |
denotes |
preadsorbed |
T2309 |
5685-5689 |
IN |
denotes |
with |
T2310 |
5690-5693 |
DT |
denotes |
the |
T2312 |
5694-5704 |
VBG |
denotes |
immunizing |
T2311 |
5705-5712 |
NN |
denotes |
peptide |
T2313 |
5713-5714 |
-LRB- |
denotes |
( |
T2315 |
5714-5720 |
NN |
denotes |
Figure |
T2314 |
5721-5723 |
NN |
denotes |
1C |
T2316 |
5723-5725 |
, |
denotes |
, |
T2317 |
5725-5731 |
NNS |
denotes |
panels |
T2318 |
5732-5733 |
NN |
denotes |
B |
T2319 |
5733-5735 |
, |
denotes |
, |
T2320 |
5735-5736 |
NN |
denotes |
F |
T2321 |
5736-5738 |
, |
denotes |
, |
T2322 |
5738-5741 |
CC |
denotes |
and |
T2323 |
5742-5743 |
NN |
denotes |
J |
T2324 |
5743-5744 |
-RRB- |
denotes |
) |
T2325 |
5744-5745 |
. |
denotes |
. |
T2326 |
5745-5921 |
sentence |
denotes |
Taken together, these data demonstrate that Sam68 protein is selectively expressed in the developing mouse embryo, with particularly elevated expression in cartilage and bone. |
T2327 |
5746-5751 |
VBN |
denotes |
Taken |
T2329 |
5752-5760 |
RB |
denotes |
together |
T2330 |
5760-5762 |
, |
denotes |
, |
T2331 |
5762-5767 |
DT |
denotes |
these |
T2332 |
5768-5772 |
NNS |
denotes |
data |
T2328 |
5773-5784 |
VBP |
denotes |
demonstrate |
T2333 |
5785-5789 |
IN |
denotes |
that |
T2335 |
5790-5795 |
NN |
denotes |
Sam68 |
T2336 |
5796-5803 |
NN |
denotes |
protein |
T2337 |
5804-5806 |
VBZ |
denotes |
is |
T2338 |
5807-5818 |
RB |
denotes |
selectively |
T2334 |
5819-5828 |
VBN |
denotes |
expressed |
T2339 |
5829-5831 |
IN |
denotes |
in |
T2340 |
5832-5835 |
DT |
denotes |
the |
T2342 |
5836-5846 |
VBG |
denotes |
developing |
T2343 |
5847-5852 |
NN |
denotes |
mouse |
T2341 |
5853-5859 |
NN |
denotes |
embryo |
T2344 |
5859-5861 |
, |
denotes |
, |
T2345 |
5861-5865 |
IN |
denotes |
with |
T2346 |
5866-5878 |
RB |
denotes |
particularly |
T2347 |
5879-5887 |
VBN |
denotes |
elevated |
T2348 |
5888-5898 |
NN |
denotes |
expression |
T2349 |
5899-5901 |
IN |
denotes |
in |
T2350 |
5902-5911 |
NN |
denotes |
cartilage |
T2351 |
5912-5915 |
CC |
denotes |
and |
T2352 |
5916-5920 |
NN |
denotes |
bone |
T2353 |
5920-5921 |
. |
denotes |
. |
T2520 |
7122-7127 |
NN |
denotes |
Sam68 |
T2521 |
7128-7130 |
VBZ |
denotes |
is |
T2522 |
7131-7134 |
RB |
denotes |
Not |
T2523 |
7135-7144 |
JJ |
denotes |
Essential |
T2524 |
7145-7148 |
IN |
denotes |
for |
T2525 |
7149-7154 |
NN |
denotes |
Mouse |
T2526 |
7155-7166 |
NN |
denotes |
Development |
T2527 |
7166-7382 |
sentence |
denotes |
To define the physiologic role of Sam68, we generated Sam68-deficient mice by targeted disruption of exons 4 and 5 of the sam68 gene, which encode the functional region of the KH-type RNA binding domain (Figure 2A). |
T2528 |
7167-7169 |
TO |
denotes |
To |
T2529 |
7170-7176 |
VB |
denotes |
define |
T2531 |
7177-7180 |
DT |
denotes |
the |
T2533 |
7181-7192 |
JJ |
denotes |
physiologic |
T2532 |
7193-7197 |
NN |
denotes |
role |
T2534 |
7198-7200 |
IN |
denotes |
of |
T2535 |
7201-7206 |
NN |
denotes |
Sam68 |
T2536 |
7206-7208 |
, |
denotes |
, |
T2537 |
7208-7210 |
PRP |
denotes |
we |
T2530 |
7211-7220 |
VBD |
denotes |
generated |
T2538 |
7221-7226 |
NN |
denotes |
Sam68 |
T2540 |
7226-7227 |
HYPH |
denotes |
- |
T2539 |
7227-7236 |
JJ |
denotes |
deficient |
T2541 |
7237-7241 |
NNS |
denotes |
mice |
T2542 |
7242-7244 |
IN |
denotes |
by |
T2543 |
7245-7253 |
VBN |
denotes |
targeted |
T2544 |
7254-7264 |
NN |
denotes |
disruption |
T2545 |
7265-7267 |
IN |
denotes |
of |
T2546 |
7268-7273 |
NNS |
denotes |
exons |
T2547 |
7274-7275 |
CD |
denotes |
4 |
T2548 |
7276-7279 |
CC |
denotes |
and |
T2549 |
7280-7281 |
CD |
denotes |
5 |
T2550 |
7282-7284 |
IN |
denotes |
of |
T2551 |
7285-7288 |
DT |
denotes |
the |
T2553 |
7289-7294 |
NN |
denotes |
sam68 |
T2552 |
7295-7299 |
NN |
denotes |
gene |
T2554 |
7299-7301 |
, |
denotes |
, |
T2555 |
7301-7306 |
WDT |
denotes |
which |
T2556 |
7307-7313 |
VBP |
denotes |
encode |
T2557 |
7314-7317 |
DT |
denotes |
the |
T2559 |
7318-7328 |
JJ |
denotes |
functional |
T2558 |
7329-7335 |
NN |
denotes |
region |
T2560 |
7336-7338 |
IN |
denotes |
of |
T2561 |
7339-7342 |
DT |
denotes |
the |
T2563 |
7343-7345 |
NN |
denotes |
KH |
T2565 |
7345-7346 |
HYPH |
denotes |
- |
T2564 |
7346-7350 |
NN |
denotes |
type |
T2566 |
7351-7354 |
NN |
denotes |
RNA |
T2567 |
7355-7362 |
NN |
denotes |
binding |
T2562 |
7363-7369 |
NN |
denotes |
domain |
T2568 |
7370-7371 |
-LRB- |
denotes |
( |
T2570 |
7371-7377 |
NN |
denotes |
Figure |
T2569 |
7378-7380 |
NN |
denotes |
2A |
T2571 |
7380-7381 |
-RRB- |
denotes |
) |
T2572 |
7381-7382 |
. |
denotes |
. |
T2573 |
7382-7516 |
sentence |
denotes |
The integrity of the targeted allele was verified by Southern blot analysis (Figure 2B) and by PCR of genomic DNA (unpublished data). |
T2574 |
7383-7386 |
DT |
denotes |
The |
T2575 |
7387-7396 |
NN |
denotes |
integrity |
T2577 |
7397-7399 |
IN |
denotes |
of |
T2578 |
7400-7403 |
DT |
denotes |
the |
T2580 |
7404-7412 |
VBN |
denotes |
targeted |
T2579 |
7413-7419 |
NN |
denotes |
allele |
T2581 |
7420-7423 |
VBD |
denotes |
was |
T2576 |
7424-7432 |
VBN |
denotes |
verified |
T2582 |
7433-7435 |
IN |
denotes |
by |
T2583 |
7436-7444 |
NNP |
denotes |
Southern |
T2584 |
7445-7449 |
NN |
denotes |
blot |
T2585 |
7450-7458 |
NN |
denotes |
analysis |
T2586 |
7459-7460 |
-LRB- |
denotes |
( |
T2588 |
7460-7466 |
NN |
denotes |
Figure |
T2587 |
7467-7469 |
NN |
denotes |
2B |
T2589 |
7469-7470 |
-RRB- |
denotes |
) |
T2590 |
7471-7474 |
CC |
denotes |
and |
T2591 |
7475-7477 |
IN |
denotes |
by |
T2592 |
7478-7481 |
NN |
denotes |
PCR |
T2593 |
7482-7484 |
IN |
denotes |
of |
T2594 |
7485-7492 |
JJ |
denotes |
genomic |
T2595 |
7493-7496 |
NN |
denotes |
DNA |
T2596 |
7497-7498 |
-LRB- |
denotes |
( |
T2598 |
7498-7509 |
JJ |
denotes |
unpublished |
T2597 |
7510-7514 |
NNS |
denotes |
data |
T2599 |
7514-7515 |
-RRB- |
denotes |
) |
T2600 |
7515-7516 |
. |
denotes |
. |
T2601 |
7516-7816 |
sentence |
denotes |
Sam68 transcripts encoded by exons 1 to 5 were absent as evidenced by RT-PCR (Dataset S2), and Sam68−/− mice were devoid of Sam68 protein, as visualized by immunoblotting with anti-Sam68 AD1 and SC-333 antibodies or control normal rabbit serum or anti-Sam68 AD1 preabsorbed with peptide (Figure 2C). |
T2602 |
7517-7522 |
NN |
denotes |
Sam68 |
T2603 |
7523-7534 |
NNS |
denotes |
transcripts |
T2605 |
7535-7542 |
VBN |
denotes |
encoded |
T2606 |
7543-7545 |
IN |
denotes |
by |
T2607 |
7546-7551 |
NNS |
denotes |
exons |
T2608 |
7552-7553 |
CD |
denotes |
1 |
T2609 |
7554-7556 |
IN |
denotes |
to |
T2610 |
7557-7558 |
CD |
denotes |
5 |
T2604 |
7559-7563 |
VBD |
denotes |
were |
T2611 |
7564-7570 |
JJ |
denotes |
absent |
T2612 |
7571-7573 |
IN |
denotes |
as |
T2613 |
7574-7583 |
VBN |
denotes |
evidenced |
T2614 |
7584-7586 |
IN |
denotes |
by |
T2615 |
7587-7589 |
NN |
denotes |
RT |
T2617 |
7589-7590 |
HYPH |
denotes |
- |
T2616 |
7590-7593 |
NN |
denotes |
PCR |
T2618 |
7594-7595 |
-LRB- |
denotes |
( |
T2620 |
7595-7602 |
NN |
denotes |
Dataset |
T2619 |
7603-7605 |
NN |
denotes |
S2 |
T2621 |
7605-7606 |
-RRB- |
denotes |
) |
T2622 |
7606-7608 |
, |
denotes |
, |
T2623 |
7608-7611 |
CC |
denotes |
and |
T2624 |
7612-7617 |
NN |
denotes |
Sam68 |
T2626 |
7617-7618 |
SYM |
denotes |
− |
T2627 |
7618-7619 |
HYPH |
denotes |
/ |
T2628 |
7619-7620 |
SYM |
denotes |
− |
T2625 |
7621-7625 |
NNS |
denotes |
mice |
T2629 |
7626-7630 |
VBD |
denotes |
were |
T2630 |
7631-7637 |
JJ |
denotes |
devoid |
T2631 |
7638-7640 |
IN |
denotes |
of |
T2632 |
7641-7646 |
NN |
denotes |
Sam68 |
T2633 |
7647-7654 |
NN |
denotes |
protein |
T2634 |
7654-7656 |
, |
denotes |
, |
T2635 |
7656-7658 |
IN |
denotes |
as |
T2636 |
7659-7669 |
VBN |
denotes |
visualized |
T2637 |
7670-7672 |
IN |
denotes |
by |
T2638 |
7673-7687 |
VBG |
denotes |
immunoblotting |
T2639 |
7688-7692 |
IN |
denotes |
with |
T2640 |
7693-7703 |
JJ |
denotes |
anti-Sam68 |
T2641 |
7704-7707 |
NN |
denotes |
AD1 |
T2643 |
7708-7711 |
CC |
denotes |
and |
T2644 |
7712-7714 |
NN |
denotes |
SC |
T2645 |
7714-7715 |
HYPH |
denotes |
- |
T2646 |
7715-7718 |
CD |
denotes |
333 |
T2642 |
7719-7729 |
NNS |
denotes |
antibodies |
T2647 |
7730-7732 |
CC |
denotes |
or |
T2648 |
7733-7740 |
NN |
denotes |
control |
T2650 |
7741-7747 |
JJ |
denotes |
normal |
T2651 |
7748-7754 |
NN |
denotes |
rabbit |
T2649 |
7755-7760 |
NN |
denotes |
serum |
T2652 |
7761-7763 |
CC |
denotes |
or |
T2653 |
7764-7774 |
JJ |
denotes |
anti-Sam68 |
T2654 |
7775-7778 |
NN |
denotes |
AD1 |
T2655 |
7779-7790 |
VBN |
denotes |
preabsorbed |
T2656 |
7791-7795 |
IN |
denotes |
with |
T2657 |
7796-7803 |
NN |
denotes |
peptide |
T2658 |
7804-7805 |
-LRB- |
denotes |
( |
T2660 |
7805-7811 |
NN |
denotes |
Figure |
T2659 |
7812-7814 |
NN |
denotes |
2C |
T2661 |
7814-7815 |
-RRB- |
denotes |
) |
T2662 |
7815-7816 |
. |
denotes |
. |
T2663 |
7816-7924 |
sentence |
denotes |
SC-333 is a rabbit anti-Sam68 antibody that was raised against the C-terminal 20 amino acids of Sam68 [47]. |
T2664 |
7817-7819 |
NN |
denotes |
SC |
T2666 |
7819-7820 |
HYPH |
denotes |
- |
T2667 |
7820-7823 |
CD |
denotes |
333 |
T2665 |
7824-7826 |
VBZ |
denotes |
is |
T2668 |
7827-7828 |
DT |
denotes |
a |
T2670 |
7829-7835 |
NN |
denotes |
rabbit |
T2671 |
7836-7846 |
JJ |
denotes |
anti-Sam68 |
T2669 |
7847-7855 |
NN |
denotes |
antibody |
T2672 |
7856-7860 |
WDT |
denotes |
that |
T2674 |
7861-7864 |
VBD |
denotes |
was |
T2673 |
7865-7871 |
VBN |
denotes |
raised |
T2675 |
7872-7879 |
IN |
denotes |
against |
T2676 |
7880-7883 |
DT |
denotes |
the |
T2678 |
7884-7885 |
NN |
denotes |
C |
T2680 |
7885-7886 |
HYPH |
denotes |
- |
T2679 |
7886-7894 |
JJ |
denotes |
terminal |
T2681 |
7895-7897 |
CD |
denotes |
20 |
T2682 |
7898-7903 |
NN |
denotes |
amino |
T2677 |
7904-7909 |
NNS |
denotes |
acids |
T2683 |
7910-7912 |
IN |
denotes |
of |
T2684 |
7913-7918 |
NN |
denotes |
Sam68 |
T2685 |
7919-7920 |
-LRB- |
denotes |
[ |
T2686 |
7920-7922 |
CD |
denotes |
47 |
T2687 |
7922-7923 |
-RRB- |
denotes |
] |
T2688 |
7923-7924 |
. |
denotes |
. |
T2689 |
7924-7991 |
sentence |
denotes |
These data confirmed the generation of a mouse deficient in Sam68. |
T2690 |
7925-7930 |
DT |
denotes |
These |
T2691 |
7931-7935 |
NNS |
denotes |
data |
T2692 |
7936-7945 |
VBD |
denotes |
confirmed |
T2693 |
7946-7949 |
DT |
denotes |
the |
T2694 |
7950-7960 |
NN |
denotes |
generation |
T2695 |
7961-7963 |
IN |
denotes |
of |
T2696 |
7964-7965 |
DT |
denotes |
a |
T2697 |
7966-7971 |
NN |
denotes |
mouse |
T2698 |
7972-7981 |
JJ |
denotes |
deficient |
T2699 |
7982-7984 |
IN |
denotes |
in |
T2700 |
7985-7990 |
NN |
denotes |
Sam68 |
T2701 |
7990-7991 |
. |
denotes |
. |
T2702 |
7991-8103 |
sentence |
denotes |
The genotypes of offspring from heterozygote intercrosses exhibited a Mendelian segregation at E18.5 (Table 1). |
T2703 |
7992-7995 |
DT |
denotes |
The |
T2704 |
7996-8005 |
NNS |
denotes |
genotypes |
T2706 |
8006-8008 |
IN |
denotes |
of |
T2707 |
8009-8018 |
NN |
denotes |
offspring |
T2708 |
8019-8023 |
IN |
denotes |
from |
T2709 |
8024-8036 |
NN |
denotes |
heterozygote |
T2710 |
8037-8049 |
NNS |
denotes |
intercrosses |
T2705 |
8050-8059 |
VBD |
denotes |
exhibited |
T2711 |
8060-8061 |
DT |
denotes |
a |
T2713 |
8062-8071 |
JJ |
denotes |
Mendelian |
T2712 |
8072-8083 |
NN |
denotes |
segregation |
T2714 |
8084-8086 |
IN |
denotes |
at |
T2715 |
8087-8092 |
NN |
denotes |
E18.5 |
T2716 |
8093-8094 |
-LRB- |
denotes |
( |
T2717 |
8094-8099 |
NN |
denotes |
Table |
T2718 |
8100-8101 |
CD |
denotes |
1 |
T2719 |
8101-8102 |
-RRB- |
denotes |
) |
T2720 |
8102-8103 |
. |
denotes |
. |
T2721 |
8103-8201 |
sentence |
denotes |
Despite the lack of visible deformity, many of the Sam68−/− pups died at birth of unknown causes. |
T2722 |
8104-8111 |
IN |
denotes |
Despite |
T2724 |
8112-8115 |
DT |
denotes |
the |
T2725 |
8116-8120 |
NN |
denotes |
lack |
T2726 |
8121-8123 |
IN |
denotes |
of |
T2727 |
8124-8131 |
JJ |
denotes |
visible |
T2728 |
8132-8141 |
NN |
denotes |
deformity |
T2729 |
8141-8143 |
, |
denotes |
, |
T2730 |
8143-8147 |
JJ |
denotes |
many |
T2731 |
8148-8150 |
IN |
denotes |
of |
T2732 |
8151-8154 |
DT |
denotes |
the |
T2734 |
8155-8160 |
NN |
denotes |
Sam68 |
T2735 |
8160-8161 |
SYM |
denotes |
− |
T2736 |
8161-8162 |
HYPH |
denotes |
/ |
T2737 |
8162-8163 |
SYM |
denotes |
− |
T2733 |
8164-8168 |
NNS |
denotes |
pups |
T2723 |
8169-8173 |
VBD |
denotes |
died |
T2738 |
8174-8176 |
IN |
denotes |
at |
T2739 |
8177-8182 |
NN |
denotes |
birth |
T2740 |
8183-8185 |
IN |
denotes |
of |
T2741 |
8186-8193 |
JJ |
denotes |
unknown |
T2742 |
8194-8200 |
NNS |
denotes |
causes |
T2743 |
8200-8201 |
. |
denotes |
. |
T2744 |
8201-8324 |
sentence |
denotes |
Sam68+/- mice were phenotypically normal and Sam68−/− pups that survived the perinatal period invariably lived to old age. |
T2745 |
8202-8207 |
NN |
denotes |
Sam68 |
T2747 |
8207-8208 |
SYM |
denotes |
+ |
T2748 |
8208-8209 |
HYPH |
denotes |
/ |
T2749 |
8209-8210 |
SYM |
denotes |
- |
T2746 |
8211-8215 |
NNS |
denotes |
mice |
T2750 |
8216-8220 |
VBD |
denotes |
were |
T2751 |
8221-8235 |
RB |
denotes |
phenotypically |
T2752 |
8236-8242 |
JJ |
denotes |
normal |
T2753 |
8243-8246 |
CC |
denotes |
and |
T2754 |
8247-8252 |
NN |
denotes |
Sam68 |
T2756 |
8252-8253 |
SYM |
denotes |
− |
T2757 |
8253-8254 |
HYPH |
denotes |
/ |
T2758 |
8254-8255 |
SYM |
denotes |
− |
T2755 |
8256-8260 |
NNS |
denotes |
pups |
T2760 |
8261-8265 |
WDT |
denotes |
that |
T2761 |
8266-8274 |
VBD |
denotes |
survived |
T2762 |
8275-8278 |
DT |
denotes |
the |
T2764 |
8279-8288 |
JJ |
denotes |
perinatal |
T2763 |
8289-8295 |
NN |
denotes |
period |
T2765 |
8296-8306 |
RB |
denotes |
invariably |
T2759 |
8307-8312 |
VBD |
denotes |
lived |
T2766 |
8313-8315 |
IN |
denotes |
to |
T2767 |
8316-8319 |
JJ |
denotes |
old |
T2768 |
8320-8323 |
NN |
denotes |
age |
T2769 |
8323-8324 |
. |
denotes |
. |
T2770 |
8324-8509 |
sentence |
denotes |
Despite evidence that Sam68 mRNA is widely expressed and phosphorylated in mitosis [41,42], the Sam68−/− mice did not develop tumors and showed no immunologic or other major illnesses. |
T2771 |
8325-8332 |
IN |
denotes |
Despite |
T2773 |
8333-8341 |
NN |
denotes |
evidence |
T2774 |
8342-8346 |
IN |
denotes |
that |
T2776 |
8347-8352 |
NN |
denotes |
Sam68 |
T2777 |
8353-8357 |
NN |
denotes |
mRNA |
T2778 |
8358-8360 |
VBZ |
denotes |
is |
T2779 |
8361-8367 |
RB |
denotes |
widely |
T2775 |
8368-8377 |
VBN |
denotes |
expressed |
T2780 |
8378-8381 |
CC |
denotes |
and |
T2781 |
8382-8396 |
VBN |
denotes |
phosphorylated |
T2782 |
8397-8399 |
IN |
denotes |
in |
T2783 |
8400-8407 |
NN |
denotes |
mitosis |
T2784 |
8408-8409 |
-LRB- |
denotes |
[ |
T2786 |
8409-8411 |
CD |
denotes |
41 |
T2787 |
8411-8412 |
, |
denotes |
, |
T2785 |
8412-8414 |
CD |
denotes |
42 |
T2788 |
8414-8415 |
-RRB- |
denotes |
] |
T2789 |
8415-8417 |
, |
denotes |
, |
T2790 |
8417-8420 |
DT |
denotes |
the |
T2792 |
8421-8426 |
NN |
denotes |
Sam68 |
T2793 |
8426-8427 |
SYM |
denotes |
− |
T2794 |
8427-8428 |
HYPH |
denotes |
/ |
T2795 |
8428-8429 |
SYM |
denotes |
− |
T2791 |
8430-8434 |
NNS |
denotes |
mice |
T2796 |
8435-8438 |
VBD |
denotes |
did |
T2797 |
8439-8442 |
RB |
denotes |
not |
T2772 |
8443-8450 |
VB |
denotes |
develop |
T2798 |
8451-8457 |
NNS |
denotes |
tumors |
T2799 |
8458-8461 |
CC |
denotes |
and |
T2800 |
8462-8468 |
VBD |
denotes |
showed |
T2801 |
8469-8471 |
DT |
denotes |
no |
T2803 |
8472-8483 |
JJ |
denotes |
immunologic |
T2804 |
8484-8486 |
CC |
denotes |
or |
T2805 |
8487-8492 |
JJ |
denotes |
other |
T2806 |
8493-8498 |
JJ |
denotes |
major |
T2802 |
8499-8508 |
NNS |
denotes |
illnesses |
T2807 |
8508-8509 |
. |
denotes |
. |
T2808 |
8509-8648 |
sentence |
denotes |
Sam68−/− mice did, however, have difficulty breeding due to male infertility and the females rarely provided adequate care to their young. |
T2809 |
8510-8515 |
NN |
denotes |
Sam68 |
T2811 |
8515-8516 |
SYM |
denotes |
− |
T2812 |
8516-8517 |
HYPH |
denotes |
/ |
T2813 |
8517-8518 |
SYM |
denotes |
− |
T2810 |
8519-8523 |
NNS |
denotes |
mice |
T2815 |
8524-8527 |
VBD |
denotes |
did |
T2816 |
8527-8529 |
, |
denotes |
, |
T2817 |
8529-8536 |
RB |
denotes |
however |
T2818 |
8536-8538 |
, |
denotes |
, |
T2814 |
8538-8542 |
VB |
denotes |
have |
T2819 |
8543-8553 |
NN |
denotes |
difficulty |
T2820 |
8554-8562 |
VBG |
denotes |
breeding |
T2821 |
8563-8566 |
IN |
denotes |
due |
T2822 |
8567-8569 |
IN |
denotes |
to |
T2823 |
8570-8574 |
JJ |
denotes |
male |
T2824 |
8575-8586 |
NN |
denotes |
infertility |
T2825 |
8587-8590 |
CC |
denotes |
and |
T2826 |
8591-8594 |
DT |
denotes |
the |
T2827 |
8595-8602 |
NNS |
denotes |
females |
T2829 |
8603-8609 |
RB |
denotes |
rarely |
T2828 |
8610-8618 |
VBD |
denotes |
provided |
T2830 |
8619-8627 |
JJ |
denotes |
adequate |
T2831 |
8628-8632 |
NN |
denotes |
care |
T2832 |
8633-8635 |
IN |
denotes |
to |
T2833 |
8636-8641 |
PRP$ |
denotes |
their |
T2834 |
8642-8647 |
JJ |
denotes |
young |
T2835 |
8647-8648 |
. |
denotes |
. |
T3035 |
9877-9882 |
NN |
denotes |
Sam68 |
T3036 |
9883-9893 |
NN |
denotes |
Deficiency |
T3037 |
9894-9902 |
VBZ |
denotes |
Protects |
T3038 |
9903-9907 |
NNS |
denotes |
Mice |
T3039 |
9908-9912 |
IN |
denotes |
from |
T3040 |
9913-9916 |
NN |
denotes |
Age |
T3042 |
9916-9917 |
HYPH |
denotes |
- |
T3041 |
9917-9924 |
VBN |
denotes |
Related |
T3044 |
9925-9929 |
NN |
denotes |
Bone |
T3043 |
9930-9934 |
NN |
denotes |
Loss |
T3045 |
9934-10103 |
sentence |
denotes |
Src null animals are known to have bone metabolism defects [48], and since Sam68 is a substrate of Src, we decided to analyze the Sam68 mice for skeletal abnormalities. |
T3046 |
9935-9938 |
NN |
denotes |
Src |
T3048 |
9939-9943 |
JJ |
denotes |
null |
T3047 |
9944-9951 |
NNS |
denotes |
animals |
T3050 |
9952-9955 |
VBP |
denotes |
are |
T3049 |
9956-9961 |
VBN |
denotes |
known |
T3051 |
9962-9964 |
TO |
denotes |
to |
T3052 |
9965-9969 |
VB |
denotes |
have |
T3053 |
9970-9974 |
NN |
denotes |
bone |
T3054 |
9975-9985 |
NN |
denotes |
metabolism |
T3055 |
9986-9993 |
NNS |
denotes |
defects |
T3056 |
9994-9995 |
-LRB- |
denotes |
[ |
T3057 |
9995-9997 |
CD |
denotes |
48 |
T3058 |
9997-9998 |
-RRB- |
denotes |
] |
T3059 |
9998-10000 |
, |
denotes |
, |
T3060 |
10000-10003 |
CC |
denotes |
and |
T3061 |
10004-10009 |
IN |
denotes |
since |
T3063 |
10010-10015 |
NN |
denotes |
Sam68 |
T3062 |
10016-10018 |
VBZ |
denotes |
is |
T3065 |
10019-10020 |
DT |
denotes |
a |
T3066 |
10021-10030 |
NN |
denotes |
substrate |
T3067 |
10031-10033 |
IN |
denotes |
of |
T3068 |
10034-10037 |
NN |
denotes |
Src |
T3069 |
10037-10039 |
, |
denotes |
, |
T3070 |
10039-10041 |
PRP |
denotes |
we |
T3064 |
10042-10049 |
VBD |
denotes |
decided |
T3071 |
10050-10052 |
TO |
denotes |
to |
T3072 |
10053-10060 |
VB |
denotes |
analyze |
T3073 |
10061-10064 |
DT |
denotes |
the |
T3075 |
10065-10070 |
NN |
denotes |
Sam68 |
T3074 |
10071-10075 |
NNS |
denotes |
mice |
T3076 |
10076-10079 |
IN |
denotes |
for |
T3077 |
10080-10088 |
JJ |
denotes |
skeletal |
T3078 |
10089-10102 |
NNS |
denotes |
abnormalities |
T3079 |
10102-10103 |
. |
denotes |
. |
T3080 |
10103-10209 |
sentence |
denotes |
Cohorts of Sam68+/+ and Sam68−/− mice were euthanized at 4 and 12 months of age for skeletal phenotyping. |
T3081 |
10104-10111 |
NNS |
denotes |
Cohorts |
T3083 |
10112-10114 |
IN |
denotes |
of |
T3084 |
10115-10120 |
NN |
denotes |
Sam68 |
T3086 |
10120-10121 |
SYM |
denotes |
+ |
T3087 |
10121-10122 |
HYPH |
denotes |
/ |
T3088 |
10122-10123 |
SYM |
denotes |
+ |
T3089 |
10124-10127 |
CC |
denotes |
and |
T3090 |
10128-10133 |
NN |
denotes |
Sam68 |
T3091 |
10133-10134 |
SYM |
denotes |
− |
T3092 |
10134-10135 |
HYPH |
denotes |
/ |
T3093 |
10135-10136 |
SYM |
denotes |
− |
T3085 |
10137-10141 |
NNS |
denotes |
mice |
T3094 |
10142-10146 |
VBD |
denotes |
were |
T3082 |
10147-10157 |
VBN |
denotes |
euthanized |
T3095 |
10158-10160 |
IN |
denotes |
at |
T3096 |
10161-10162 |
CD |
denotes |
4 |
T3098 |
10163-10166 |
CC |
denotes |
and |
T3099 |
10167-10169 |
CD |
denotes |
12 |
T3097 |
10170-10176 |
NNS |
denotes |
months |
T3100 |
10177-10179 |
IN |
denotes |
of |
T3101 |
10180-10183 |
NN |
denotes |
age |
T3102 |
10184-10187 |
IN |
denotes |
for |
T3103 |
10188-10196 |
JJ |
denotes |
skeletal |
T3104 |
10197-10208 |
NN |
denotes |
phenotyping |
T3105 |
10208-10209 |
. |
denotes |
. |
T3106 |
10209-10371 |
sentence |
denotes |
To minimize differences in the bone phenotype that might arise secondary to gender or weight differences, we selected age-matched female mice for these analyses. |
T3107 |
10210-10212 |
TO |
denotes |
To |
T3108 |
10213-10221 |
VB |
denotes |
minimize |
T3110 |
10222-10233 |
NNS |
denotes |
differences |
T3111 |
10234-10236 |
IN |
denotes |
in |
T3112 |
10237-10240 |
DT |
denotes |
the |
T3114 |
10241-10245 |
NN |
denotes |
bone |
T3113 |
10246-10255 |
NN |
denotes |
phenotype |
T3115 |
10256-10260 |
WDT |
denotes |
that |
T3117 |
10261-10266 |
MD |
denotes |
might |
T3116 |
10267-10272 |
VB |
denotes |
arise |
T3118 |
10273-10282 |
JJ |
denotes |
secondary |
T3119 |
10283-10285 |
IN |
denotes |
to |
T3120 |
10286-10292 |
NN |
denotes |
gender |
T3122 |
10293-10295 |
CC |
denotes |
or |
T3123 |
10296-10302 |
NN |
denotes |
weight |
T3121 |
10303-10314 |
NNS |
denotes |
differences |
T3124 |
10314-10316 |
, |
denotes |
, |
T3125 |
10316-10318 |
PRP |
denotes |
we |
T3109 |
10319-10327 |
VBD |
denotes |
selected |
T3126 |
10328-10331 |
NN |
denotes |
age |
T3128 |
10331-10332 |
HYPH |
denotes |
- |
T3127 |
10332-10339 |
VBN |
denotes |
matched |
T3130 |
10340-10346 |
JJ |
denotes |
female |
T3129 |
10347-10351 |
NNS |
denotes |
mice |
T3131 |
10352-10355 |
IN |
denotes |
for |
T3132 |
10356-10361 |
DT |
denotes |
these |
T3133 |
10362-10370 |
NNS |
denotes |
analyses |
T3134 |
10370-10371 |
. |
denotes |
. |
T3135 |
10371-10619 |
sentence |
denotes |
The female mice demonstrated similar increases in body weight, although 4-month-old Sam68−/− mice weighed less than Sam68+/+ mice, and similar changes in bone lengths in the axial and appendicular skeleton between 4 and 12 months of age (Table 2). |
T3136 |
10372-10375 |
DT |
denotes |
The |
T3138 |
10376-10382 |
JJ |
denotes |
female |
T3137 |
10383-10387 |
NNS |
denotes |
mice |
T3139 |
10388-10400 |
VBD |
denotes |
demonstrated |
T3140 |
10401-10408 |
JJ |
denotes |
similar |
T3141 |
10409-10418 |
NNS |
denotes |
increases |
T3142 |
10419-10421 |
IN |
denotes |
in |
T3143 |
10422-10426 |
NN |
denotes |
body |
T3144 |
10427-10433 |
NN |
denotes |
weight |
T3145 |
10433-10435 |
, |
denotes |
, |
T3147 |
10435-10443 |
IN |
denotes |
although |
T3148 |
10444-10445 |
CD |
denotes |
4 |
T3150 |
10445-10446 |
HYPH |
denotes |
- |
T3149 |
10446-10451 |
NN |
denotes |
month |
T3152 |
10451-10452 |
HYPH |
denotes |
- |
T3151 |
10452-10455 |
JJ |
denotes |
old |
T3154 |
10456-10461 |
NN |
denotes |
Sam68 |
T3155 |
10461-10462 |
SYM |
denotes |
− |
T3156 |
10462-10463 |
HYPH |
denotes |
/ |
T3157 |
10463-10464 |
SYM |
denotes |
− |
T3153 |
10465-10469 |
NNS |
denotes |
mice |
T3146 |
10470-10477 |
VBD |
denotes |
weighed |
T3158 |
10478-10482 |
JJR |
denotes |
less |
T3159 |
10483-10487 |
IN |
denotes |
than |
T3160 |
10488-10493 |
NN |
denotes |
Sam68 |
T3162 |
10493-10494 |
SYM |
denotes |
+ |
T3163 |
10494-10495 |
HYPH |
denotes |
/ |
T3164 |
10495-10496 |
SYM |
denotes |
+ |
T3161 |
10497-10501 |
NNS |
denotes |
mice |
T3165 |
10501-10503 |
, |
denotes |
, |
T3166 |
10503-10506 |
CC |
denotes |
and |
T3167 |
10507-10514 |
JJ |
denotes |
similar |
T3168 |
10515-10522 |
NNS |
denotes |
changes |
T3169 |
10523-10525 |
IN |
denotes |
in |
T3170 |
10526-10530 |
NN |
denotes |
bone |
T3171 |
10531-10538 |
NNS |
denotes |
lengths |
T3172 |
10539-10541 |
IN |
denotes |
in |
T3173 |
10542-10545 |
DT |
denotes |
the |
T3175 |
10546-10551 |
JJ |
denotes |
axial |
T3176 |
10552-10555 |
CC |
denotes |
and |
T3177 |
10556-10568 |
JJ |
denotes |
appendicular |
T3174 |
10569-10577 |
NN |
denotes |
skeleton |
T3178 |
10578-10585 |
IN |
denotes |
between |
T3179 |
10586-10587 |
CD |
denotes |
4 |
T3181 |
10588-10591 |
CC |
denotes |
and |
T3182 |
10592-10594 |
CD |
denotes |
12 |
T3180 |
10595-10601 |
NNS |
denotes |
months |
T3183 |
10602-10604 |
IN |
denotes |
of |
T3184 |
10605-10608 |
NN |
denotes |
age |
T3185 |
10609-10610 |
-LRB- |
denotes |
( |
T3186 |
10610-10615 |
NN |
denotes |
Table |
T3187 |
10616-10617 |
CD |
denotes |
2 |
T3188 |
10617-10618 |
-RRB- |
denotes |
) |
T3189 |
10618-10619 |
. |
denotes |
. |
T3190 |
10619-10990 |
sentence |
denotes |
Faxitron radiography (Faxitron X-ray Corporation, Wheeling, Illinois, United States) (Figure 3A) and micro–computed tomography (CT) (Figure 3B) revealed significant cortical thinning (arrow) and a reduction in metaphyseal bone (asterisk) in the distal femora of 12-month-old Sam68+/+ mice compared with 4-month-old mice of either genotype and 12-month-old Sam68−/− mice. |
T3191 |
10620-10628 |
NNP |
denotes |
Faxitron |
T3192 |
10629-10640 |
NN |
denotes |
radiography |
T3194 |
10641-10642 |
-LRB- |
denotes |
( |
T3196 |
10642-10650 |
NNP |
denotes |
Faxitron |
T3197 |
10651-10652 |
NN |
denotes |
X |
T3199 |
10652-10653 |
HYPH |
denotes |
- |
T3198 |
10653-10656 |
NN |
denotes |
ray |
T3195 |
10657-10668 |
NNP |
denotes |
Corporation |
T3200 |
10668-10670 |
, |
denotes |
, |
T3201 |
10670-10678 |
NNP |
denotes |
Wheeling |
T3202 |
10678-10680 |
, |
denotes |
, |
T3203 |
10680-10688 |
NNP |
denotes |
Illinois |
T3204 |
10688-10690 |
, |
denotes |
, |
T3205 |
10690-10696 |
NNP |
denotes |
United |
T3206 |
10697-10703 |
NNP |
denotes |
States |
T3207 |
10703-10704 |
-RRB- |
denotes |
) |
T3208 |
10705-10706 |
-LRB- |
denotes |
( |
T3210 |
10706-10712 |
NN |
denotes |
Figure |
T3209 |
10713-10715 |
NN |
denotes |
3A |
T3211 |
10715-10716 |
-RRB- |
denotes |
) |
T3212 |
10717-10720 |
CC |
denotes |
and |
T3213 |
10721-10735 |
VBN |
denotes |
micro–computed |
T3214 |
10736-10746 |
NN |
denotes |
tomography |
T3215 |
10747-10748 |
-LRB- |
denotes |
( |
T3216 |
10748-10750 |
NN |
denotes |
CT |
T3217 |
10750-10751 |
-RRB- |
denotes |
) |
T3218 |
10752-10753 |
-LRB- |
denotes |
( |
T3220 |
10753-10759 |
NN |
denotes |
Figure |
T3219 |
10760-10762 |
NN |
denotes |
3B |
T3221 |
10762-10763 |
-RRB- |
denotes |
) |
T3193 |
10764-10772 |
VBD |
denotes |
revealed |
T3222 |
10773-10784 |
JJ |
denotes |
significant |
T3224 |
10785-10793 |
JJ |
denotes |
cortical |
T3223 |
10794-10802 |
NN |
denotes |
thinning |
T3225 |
10803-10804 |
-LRB- |
denotes |
( |
T3226 |
10804-10809 |
NN |
denotes |
arrow |
T3227 |
10809-10810 |
-RRB- |
denotes |
) |
T3228 |
10811-10814 |
CC |
denotes |
and |
T3229 |
10815-10816 |
DT |
denotes |
a |
T3230 |
10817-10826 |
NN |
denotes |
reduction |
T3231 |
10827-10829 |
IN |
denotes |
in |
T3232 |
10830-10841 |
JJ |
denotes |
metaphyseal |
T3233 |
10842-10846 |
NN |
denotes |
bone |
T3234 |
10847-10848 |
-LRB- |
denotes |
( |
T3235 |
10848-10856 |
NN |
denotes |
asterisk |
T3236 |
10856-10857 |
-RRB- |
denotes |
) |
T3237 |
10858-10860 |
IN |
denotes |
in |
T3238 |
10861-10864 |
DT |
denotes |
the |
T3240 |
10865-10871 |
JJ |
denotes |
distal |
T3239 |
10872-10878 |
NNS |
denotes |
femora |
T3241 |
10879-10881 |
IN |
denotes |
of |
T3242 |
10882-10884 |
CD |
denotes |
12 |
T3244 |
10884-10885 |
HYPH |
denotes |
- |
T3243 |
10885-10890 |
NN |
denotes |
month |
T3246 |
10890-10891 |
HYPH |
denotes |
- |
T3245 |
10891-10894 |
JJ |
denotes |
old |
T3248 |
10895-10900 |
NN |
denotes |
Sam68 |
T3249 |
10900-10901 |
SYM |
denotes |
+ |
T3250 |
10901-10902 |
HYPH |
denotes |
/ |
T3251 |
10902-10903 |
SYM |
denotes |
+ |
T3247 |
10904-10908 |
NNS |
denotes |
mice |
T3252 |
10909-10917 |
VBN |
denotes |
compared |
T3253 |
10918-10922 |
IN |
denotes |
with |
T3254 |
10923-10924 |
CD |
denotes |
4 |
T3256 |
10924-10925 |
HYPH |
denotes |
- |
T3255 |
10925-10930 |
NN |
denotes |
month |
T3258 |
10930-10931 |
HYPH |
denotes |
- |
T3257 |
10931-10934 |
JJ |
denotes |
old |
T3259 |
10935-10939 |
NNS |
denotes |
mice |
T3260 |
10940-10942 |
IN |
denotes |
of |
T3261 |
10943-10949 |
CC |
denotes |
either |
T3262 |
10950-10958 |
NN |
denotes |
genotype |
T3263 |
10959-10962 |
CC |
denotes |
and |
T3264 |
10963-10965 |
CD |
denotes |
12 |
T3266 |
10965-10966 |
HYPH |
denotes |
- |
T3265 |
10966-10971 |
NN |
denotes |
month |
T3268 |
10971-10972 |
HYPH |
denotes |
- |
T3267 |
10972-10975 |
JJ |
denotes |
old |
T3270 |
10976-10981 |
NN |
denotes |
Sam68 |
T3271 |
10981-10982 |
SYM |
denotes |
− |
T3272 |
10982-10983 |
HYPH |
denotes |
/ |
T3273 |
10983-10984 |
SYM |
denotes |
− |
T3269 |
10985-10989 |
NNS |
denotes |
mice |
T3274 |
10989-10990 |
. |
denotes |
. |
T3275 |
10990-11177 |
sentence |
denotes |
Similar reductions in trabecular bone were shown by Faxitron and micro-CT in the fifth lumbar vertebrae of the 12-month-old Sam68+/+ mice but not in the Sam68−/− mice (unpublished data). |
T3276 |
10991-10998 |
JJ |
denotes |
Similar |
T3277 |
10999-11009 |
NNS |
denotes |
reductions |
T3279 |
11010-11012 |
IN |
denotes |
in |
T3280 |
11013-11023 |
JJ |
denotes |
trabecular |
T3281 |
11024-11028 |
NN |
denotes |
bone |
T3282 |
11029-11033 |
VBD |
denotes |
were |
T3278 |
11034-11039 |
VBN |
denotes |
shown |
T3283 |
11040-11042 |
IN |
denotes |
by |
T3284 |
11043-11051 |
NNP |
denotes |
Faxitron |
T3285 |
11052-11055 |
CC |
denotes |
and |
T3286 |
11056-11064 |
NN |
denotes |
micro-CT |
T3287 |
11065-11067 |
IN |
denotes |
in |
T3288 |
11068-11071 |
DT |
denotes |
the |
T3290 |
11072-11077 |
JJ |
denotes |
fifth |
T3291 |
11078-11084 |
NN |
denotes |
lumbar |
T3289 |
11085-11094 |
NNS |
denotes |
vertebrae |
T3292 |
11095-11097 |
IN |
denotes |
of |
T3293 |
11098-11101 |
DT |
denotes |
the |
T3295 |
11102-11104 |
CD |
denotes |
12 |
T3297 |
11104-11105 |
HYPH |
denotes |
- |
T3296 |
11105-11110 |
NN |
denotes |
month |
T3299 |
11110-11111 |
HYPH |
denotes |
- |
T3298 |
11111-11114 |
JJ |
denotes |
old |
T3300 |
11115-11120 |
NN |
denotes |
Sam68 |
T3301 |
11120-11121 |
SYM |
denotes |
+ |
T3302 |
11121-11122 |
HYPH |
denotes |
/ |
T3303 |
11122-11123 |
SYM |
denotes |
+ |
T3294 |
11124-11128 |
NNS |
denotes |
mice |
T3304 |
11129-11132 |
CC |
denotes |
but |
T3305 |
11133-11136 |
RB |
denotes |
not |
T3306 |
11137-11139 |
IN |
denotes |
in |
T3307 |
11140-11143 |
DT |
denotes |
the |
T3309 |
11144-11149 |
NN |
denotes |
Sam68 |
T3310 |
11149-11150 |
SYM |
denotes |
− |
T3311 |
11150-11151 |
HYPH |
denotes |
/ |
T3312 |
11151-11152 |
SYM |
denotes |
− |
T3308 |
11153-11157 |
NNS |
denotes |
mice |
T3313 |
11158-11159 |
-LRB- |
denotes |
( |
T3315 |
11159-11170 |
JJ |
denotes |
unpublished |
T3314 |
11171-11175 |
NNS |
denotes |
data |
T3316 |
11175-11176 |
-RRB- |
denotes |
) |
T3317 |
11176-11177 |
. |
denotes |
. |
T3318 |
11177-11460 |
sentence |
denotes |
Total body bone mineral content (BMC), quantified with a Lunar PIXImus mouse densitometer (GE-Lunar, Madison, Wisconsin, United States), increased in both Sam68+/+ and Sam68−/− mice between 4 months and 12 months of age, but only reached significance in the Sam68−/− mice (Table 2). |
T3319 |
11178-11183 |
JJ |
denotes |
Total |
T3321 |
11184-11188 |
NN |
denotes |
body |
T3322 |
11189-11193 |
NN |
denotes |
bone |
T3323 |
11194-11201 |
NN |
denotes |
mineral |
T3320 |
11202-11209 |
NN |
denotes |
content |
T3325 |
11210-11211 |
-LRB- |
denotes |
( |
T3326 |
11211-11214 |
NN |
denotes |
BMC |
T3327 |
11214-11215 |
-RRB- |
denotes |
) |
T3328 |
11215-11217 |
, |
denotes |
, |
T3329 |
11217-11227 |
VBN |
denotes |
quantified |
T3330 |
11228-11232 |
IN |
denotes |
with |
T3331 |
11233-11234 |
DT |
denotes |
a |
T3333 |
11235-11240 |
JJ |
denotes |
Lunar |
T3334 |
11241-11248 |
NNP |
denotes |
PIXImus |
T3335 |
11249-11254 |
NN |
denotes |
mouse |
T3332 |
11255-11267 |
NN |
denotes |
densitometer |
T3336 |
11268-11269 |
-LRB- |
denotes |
( |
T3338 |
11269-11271 |
NNP |
denotes |
GE |
T3339 |
11271-11272 |
HYPH |
denotes |
- |
T3337 |
11272-11277 |
NNP |
denotes |
Lunar |
T3340 |
11277-11279 |
, |
denotes |
, |
T3341 |
11279-11286 |
NNP |
denotes |
Madison |
T3342 |
11286-11288 |
, |
denotes |
, |
T3343 |
11288-11297 |
NNP |
denotes |
Wisconsin |
T3344 |
11297-11299 |
, |
denotes |
, |
T3345 |
11299-11305 |
NNP |
denotes |
United |
T3346 |
11306-11312 |
NNP |
denotes |
States |
T3347 |
11312-11313 |
-RRB- |
denotes |
) |
T3348 |
11313-11315 |
, |
denotes |
, |
T3324 |
11315-11324 |
VBD |
denotes |
increased |
T3349 |
11325-11327 |
IN |
denotes |
in |
T3350 |
11328-11332 |
CC |
denotes |
both |
T3351 |
11333-11338 |
NN |
denotes |
Sam68 |
T3353 |
11338-11339 |
SYM |
denotes |
+ |
T3354 |
11339-11340 |
HYPH |
denotes |
/ |
T3355 |
11340-11341 |
SYM |
denotes |
+ |
T3356 |
11342-11345 |
CC |
denotes |
and |
T3357 |
11346-11351 |
NN |
denotes |
Sam68 |
T3358 |
11351-11352 |
SYM |
denotes |
− |
T3359 |
11352-11353 |
HYPH |
denotes |
/ |
T3360 |
11353-11354 |
SYM |
denotes |
− |
T3352 |
11355-11359 |
NNS |
denotes |
mice |
T3361 |
11360-11367 |
IN |
denotes |
between |
T3362 |
11368-11369 |
CD |
denotes |
4 |
T3363 |
11370-11376 |
NNS |
denotes |
months |
T3364 |
11377-11380 |
CC |
denotes |
and |
T3365 |
11381-11383 |
CD |
denotes |
12 |
T3366 |
11384-11390 |
NNS |
denotes |
months |
T3367 |
11391-11393 |
IN |
denotes |
of |
T3368 |
11394-11397 |
NN |
denotes |
age |
T3369 |
11397-11399 |
, |
denotes |
, |
T3370 |
11399-11402 |
CC |
denotes |
but |
T3371 |
11403-11407 |
RB |
denotes |
only |
T3372 |
11408-11415 |
VBD |
denotes |
reached |
T3373 |
11416-11428 |
NN |
denotes |
significance |
T3374 |
11429-11431 |
IN |
denotes |
in |
T3375 |
11432-11435 |
DT |
denotes |
the |
T3377 |
11436-11441 |
NN |
denotes |
Sam68 |
T3378 |
11441-11442 |
SYM |
denotes |
− |
T3379 |
11442-11443 |
HYPH |
denotes |
/ |
T3380 |
11443-11444 |
SYM |
denotes |
− |
T3376 |
11445-11449 |
NNS |
denotes |
mice |
T3381 |
11450-11451 |
-LRB- |
denotes |
( |
T3382 |
11451-11456 |
NN |
denotes |
Table |
T3383 |
11457-11458 |
CD |
denotes |
2 |
T3384 |
11458-11459 |
-RRB- |
denotes |
) |
T3385 |
11459-11460 |
. |
denotes |
. |
T3386 |
11460-11554 |
sentence |
denotes |
Similarly, a greater increase in BMC was seen in the femur and vertebra in the Sam68−/− mice. |
T3387 |
11461-11470 |
RB |
denotes |
Similarly |
T3389 |
11470-11472 |
, |
denotes |
, |
T3390 |
11472-11473 |
DT |
denotes |
a |
T3392 |
11474-11481 |
JJR |
denotes |
greater |
T3391 |
11482-11490 |
NN |
denotes |
increase |
T3393 |
11491-11493 |
IN |
denotes |
in |
T3394 |
11494-11497 |
NN |
denotes |
BMC |
T3395 |
11498-11501 |
VBD |
denotes |
was |
T3388 |
11502-11506 |
VBN |
denotes |
seen |
T3396 |
11507-11509 |
IN |
denotes |
in |
T3397 |
11510-11513 |
DT |
denotes |
the |
T3398 |
11514-11519 |
NN |
denotes |
femur |
T3399 |
11520-11523 |
CC |
denotes |
and |
T3400 |
11524-11532 |
NN |
denotes |
vertebra |
T3401 |
11533-11535 |
IN |
denotes |
in |
T3402 |
11536-11539 |
DT |
denotes |
the |
T3404 |
11540-11545 |
NN |
denotes |
Sam68 |
T3405 |
11545-11546 |
SYM |
denotes |
− |
T3406 |
11546-11547 |
HYPH |
denotes |
/ |
T3407 |
11547-11548 |
SYM |
denotes |
− |
T3403 |
11549-11553 |
NNS |
denotes |
mice |
T3408 |
11553-11554 |
. |
denotes |
. |
T3409 |
11554-11760 |
sentence |
denotes |
Bone mineral density (BMD) remained constant or decreased in the wild type mice but increased significantly in the total body and in the femoral and vertebral regions of interest in the Sam68−/− (Table 2). |
T3410 |
11555-11559 |
NN |
denotes |
Bone |
T3411 |
11560-11567 |
NN |
denotes |
mineral |
T3412 |
11568-11575 |
NN |
denotes |
density |
T3414 |
11576-11577 |
-LRB- |
denotes |
( |
T3415 |
11577-11580 |
NN |
denotes |
BMD |
T3416 |
11580-11581 |
-RRB- |
denotes |
) |
T3413 |
11582-11590 |
VBD |
denotes |
remained |
T3417 |
11591-11599 |
JJ |
denotes |
constant |
T3418 |
11600-11602 |
CC |
denotes |
or |
T3419 |
11603-11612 |
VBN |
denotes |
decreased |
T3420 |
11613-11615 |
IN |
denotes |
in |
T3421 |
11616-11619 |
DT |
denotes |
the |
T3423 |
11620-11624 |
JJ |
denotes |
wild |
T3424 |
11625-11629 |
NN |
denotes |
type |
T3422 |
11630-11634 |
NNS |
denotes |
mice |
T3425 |
11635-11638 |
CC |
denotes |
but |
T3426 |
11639-11648 |
VBD |
denotes |
increased |
T3427 |
11649-11662 |
RB |
denotes |
significantly |
T3428 |
11663-11665 |
IN |
denotes |
in |
T3429 |
11666-11669 |
DT |
denotes |
the |
T3431 |
11670-11675 |
JJ |
denotes |
total |
T3430 |
11676-11680 |
NN |
denotes |
body |
T3432 |
11681-11684 |
CC |
denotes |
and |
T3433 |
11685-11687 |
IN |
denotes |
in |
T3434 |
11688-11691 |
DT |
denotes |
the |
T3436 |
11692-11699 |
JJ |
denotes |
femoral |
T3437 |
11700-11703 |
CC |
denotes |
and |
T3438 |
11704-11713 |
JJ |
denotes |
vertebral |
T3435 |
11714-11721 |
NNS |
denotes |
regions |
T3439 |
11722-11724 |
IN |
denotes |
of |
T3440 |
11725-11733 |
NN |
denotes |
interest |
T3441 |
11734-11736 |
IN |
denotes |
in |
T3442 |
11737-11740 |
DT |
denotes |
the |
T3443 |
11741-11746 |
NN |
denotes |
Sam68 |
T3444 |
11746-11747 |
SYM |
denotes |
− |
T3445 |
11747-11748 |
HYPH |
denotes |
/ |
T3446 |
11748-11749 |
SYM |
denotes |
− |
T3447 |
11750-11751 |
-LRB- |
denotes |
( |
T3448 |
11751-11756 |
NN |
denotes |
Table |
T3449 |
11757-11758 |
CD |
denotes |
2 |
T3450 |
11758-11759 |
-RRB- |
denotes |
) |
T3451 |
11759-11760 |
. |
denotes |
. |
T3452 |
11760-11899 |
sentence |
denotes |
These data showed that Sam68−/− mice continued to thrive and accrue bone in the axial and appendicular skeleton for longer than 12 months. |
T3453 |
11761-11766 |
DT |
denotes |
These |
T3454 |
11767-11771 |
NNS |
denotes |
data |
T3455 |
11772-11778 |
VBD |
denotes |
showed |
T3456 |
11779-11783 |
IN |
denotes |
that |
T3458 |
11784-11789 |
NN |
denotes |
Sam68 |
T3460 |
11789-11790 |
SYM |
denotes |
− |
T3461 |
11790-11791 |
HYPH |
denotes |
/ |
T3462 |
11791-11792 |
SYM |
denotes |
− |
T3459 |
11793-11797 |
NNS |
denotes |
mice |
T3457 |
11798-11807 |
VBD |
denotes |
continued |
T3463 |
11808-11810 |
TO |
denotes |
to |
T3464 |
11811-11817 |
VB |
denotes |
thrive |
T3465 |
11818-11821 |
CC |
denotes |
and |
T3466 |
11822-11828 |
VB |
denotes |
accrue |
T3467 |
11829-11833 |
NN |
denotes |
bone |
T3468 |
11834-11836 |
IN |
denotes |
in |
T3469 |
11837-11840 |
DT |
denotes |
the |
T3471 |
11841-11846 |
JJ |
denotes |
axial |
T3472 |
11847-11850 |
CC |
denotes |
and |
T3473 |
11851-11863 |
JJ |
denotes |
appendicular |
T3470 |
11864-11872 |
NN |
denotes |
skeleton |
T3474 |
11873-11876 |
IN |
denotes |
for |
T3475 |
11877-11883 |
JJR |
denotes |
longer |
T3477 |
11884-11888 |
IN |
denotes |
than |
T3476 |
11889-11891 |
CD |
denotes |
12 |
T3478 |
11892-11898 |
NNS |
denotes |
months |
T3479 |
11898-11899 |
. |
denotes |
. |
T3480 |
11899-12045 |
sentence |
denotes |
This was in contrast to the situation in age-matched, littermate controls in which a significant amount of bone was lost over the same timeframe. |
T3481 |
11900-11904 |
DT |
denotes |
This |
T3482 |
11905-11908 |
VBD |
denotes |
was |
T3483 |
11909-11911 |
IN |
denotes |
in |
T3484 |
11912-11920 |
NN |
denotes |
contrast |
T3485 |
11921-11923 |
IN |
denotes |
to |
T3486 |
11924-11927 |
DT |
denotes |
the |
T3487 |
11928-11937 |
NN |
denotes |
situation |
T3488 |
11938-11940 |
IN |
denotes |
in |
T3489 |
11941-11944 |
NN |
denotes |
age |
T3491 |
11944-11945 |
HYPH |
denotes |
- |
T3490 |
11945-11952 |
VBN |
denotes |
matched |
T3493 |
11952-11954 |
, |
denotes |
, |
T3494 |
11954-11964 |
NN |
denotes |
littermate |
T3492 |
11965-11973 |
NNS |
denotes |
controls |
T3495 |
11974-11976 |
IN |
denotes |
in |
T3497 |
11977-11982 |
WDT |
denotes |
which |
T3498 |
11983-11984 |
DT |
denotes |
a |
T3500 |
11985-11996 |
JJ |
denotes |
significant |
T3499 |
11997-12003 |
NN |
denotes |
amount |
T3501 |
12004-12006 |
IN |
denotes |
of |
T3502 |
12007-12011 |
NN |
denotes |
bone |
T3503 |
12012-12015 |
VBD |
denotes |
was |
T3496 |
12016-12020 |
VBN |
denotes |
lost |
T3504 |
12021-12025 |
IN |
denotes |
over |
T3505 |
12026-12029 |
DT |
denotes |
the |
T3507 |
12030-12034 |
JJ |
denotes |
same |
T3506 |
12035-12044 |
NN |
denotes |
timeframe |
T3508 |
12044-12045 |
. |
denotes |
. |
T3587 |
13332-13337 |
CD |
denotes |
Three |
T3589 |
13337-13338 |
HYPH |
denotes |
- |
T3588 |
13338-13349 |
JJ |
denotes |
Dimensional |
T3590 |
13350-13362 |
NN |
denotes |
Architecture |
T3592 |
13363-13365 |
IN |
denotes |
of |
T3593 |
13366-13370 |
NN |
denotes |
Bone |
T3594 |
13371-13373 |
VBZ |
denotes |
Is |
T3591 |
13374-13383 |
VBN |
denotes |
Preserved |
T3595 |
13384-13386 |
IN |
denotes |
in |
T3596 |
13387-13391 |
VBN |
denotes |
Aged |
T3598 |
13392-13397 |
NN |
denotes |
Sam68 |
T3599 |
13397-13398 |
SYM |
denotes |
− |
T3600 |
13398-13399 |
HYPH |
denotes |
/ |
T3601 |
13399-13400 |
SYM |
denotes |
− |
T3597 |
13401-13405 |
NNS |
denotes |
Mice |
T3602 |
13405-13627 |
sentence |
denotes |
Bone loss and compromised architecture are characteristic features of the skeletons of aged C57BL/6 mice and resemble the clinical features of age-related bone loss in humans that can predispose an individual to fracture. |
T3603 |
13406-13410 |
NN |
denotes |
Bone |
T3604 |
13411-13415 |
NN |
denotes |
loss |
T3606 |
13416-13419 |
CC |
denotes |
and |
T3607 |
13420-13431 |
VBN |
denotes |
compromised |
T3608 |
13432-13444 |
NN |
denotes |
architecture |
T3605 |
13445-13448 |
VBP |
denotes |
are |
T3609 |
13449-13463 |
JJ |
denotes |
characteristic |
T3610 |
13464-13472 |
NNS |
denotes |
features |
T3611 |
13473-13475 |
IN |
denotes |
of |
T3612 |
13476-13479 |
DT |
denotes |
the |
T3613 |
13480-13489 |
NNS |
denotes |
skeletons |
T3614 |
13490-13492 |
IN |
denotes |
of |
T3615 |
13493-13497 |
JJ |
denotes |
aged |
T3617 |
13498-13503 |
NN |
denotes |
C57BL |
T3618 |
13503-13504 |
HYPH |
denotes |
/ |
T3619 |
13504-13505 |
CD |
denotes |
6 |
T3616 |
13506-13510 |
NNS |
denotes |
mice |
T3620 |
13511-13514 |
CC |
denotes |
and |
T3621 |
13515-13523 |
VBP |
denotes |
resemble |
T3622 |
13524-13527 |
DT |
denotes |
the |
T3624 |
13528-13536 |
JJ |
denotes |
clinical |
T3623 |
13537-13545 |
NNS |
denotes |
features |
T3625 |
13546-13548 |
IN |
denotes |
of |
T3626 |
13549-13552 |
NN |
denotes |
age |
T3628 |
13552-13553 |
HYPH |
denotes |
- |
T3627 |
13553-13560 |
VBN |
denotes |
related |
T3630 |
13561-13565 |
NN |
denotes |
bone |
T3629 |
13566-13570 |
NN |
denotes |
loss |
T3631 |
13571-13573 |
IN |
denotes |
in |
T3632 |
13574-13580 |
NNS |
denotes |
humans |
T3633 |
13581-13585 |
WDT |
denotes |
that |
T3635 |
13586-13589 |
MD |
denotes |
can |
T3634 |
13590-13600 |
VB |
denotes |
predispose |
T3636 |
13601-13603 |
DT |
denotes |
an |
T3637 |
13604-13614 |
NN |
denotes |
individual |
T3638 |
13615-13617 |
IN |
denotes |
to |
T3639 |
13618-13626 |
NN |
denotes |
fracture |
T3640 |
13626-13627 |
. |
denotes |
. |
T3641 |
13627-13933 |
sentence |
denotes |
Quantification of the micro-CT data shown in Figure 3B confirmed the reduction in bone volume compared with tissue volume (BV/TV; Figure 4A, left) in the 12-month-old Sam68+/+ mice (hatched bars) compared with 4-month-old mice of both genotypes (solid bars) and 12-month-old Sam68−/− mice (stippled bars). |
T3642 |
13628-13642 |
NN |
denotes |
Quantification |
T3644 |
13643-13645 |
IN |
denotes |
of |
T3645 |
13646-13649 |
DT |
denotes |
the |
T3647 |
13650-13658 |
NN |
denotes |
micro-CT |
T3646 |
13659-13663 |
NNS |
denotes |
data |
T3648 |
13664-13669 |
VBN |
denotes |
shown |
T3649 |
13670-13672 |
IN |
denotes |
in |
T3650 |
13673-13679 |
NN |
denotes |
Figure |
T3651 |
13680-13682 |
NN |
denotes |
3B |
T3643 |
13683-13692 |
VBD |
denotes |
confirmed |
T3652 |
13693-13696 |
DT |
denotes |
the |
T3653 |
13697-13706 |
NN |
denotes |
reduction |
T3654 |
13707-13709 |
IN |
denotes |
in |
T3655 |
13710-13714 |
NN |
denotes |
bone |
T3656 |
13715-13721 |
NN |
denotes |
volume |
T3657 |
13722-13730 |
VBN |
denotes |
compared |
T3658 |
13731-13735 |
IN |
denotes |
with |
T3659 |
13736-13742 |
NN |
denotes |
tissue |
T3660 |
13743-13749 |
NN |
denotes |
volume |
T3661 |
13750-13751 |
-LRB- |
denotes |
( |
T3663 |
13751-13753 |
NN |
denotes |
BV |
T3665 |
13753-13754 |
HYPH |
denotes |
/ |
T3664 |
13754-13756 |
NN |
denotes |
TV |
T3666 |
13756-13757 |
: |
denotes |
; |
T3667 |
13758-13764 |
NN |
denotes |
Figure |
T3662 |
13765-13767 |
NN |
denotes |
4A |
T3668 |
13767-13769 |
, |
denotes |
, |
T3669 |
13769-13773 |
JJ |
denotes |
left |
T3670 |
13773-13774 |
-RRB- |
denotes |
) |
T3671 |
13775-13777 |
IN |
denotes |
in |
T3672 |
13778-13781 |
DT |
denotes |
the |
T3674 |
13782-13784 |
CD |
denotes |
12 |
T3676 |
13784-13785 |
HYPH |
denotes |
- |
T3675 |
13785-13790 |
NN |
denotes |
month |
T3678 |
13790-13791 |
HYPH |
denotes |
- |
T3677 |
13791-13794 |
JJ |
denotes |
old |
T3679 |
13795-13800 |
NN |
denotes |
Sam68 |
T3680 |
13800-13801 |
SYM |
denotes |
+ |
T3681 |
13801-13802 |
HYPH |
denotes |
/ |
T3682 |
13802-13803 |
SYM |
denotes |
+ |
T3673 |
13804-13808 |
NNS |
denotes |
mice |
T3683 |
13809-13810 |
-LRB- |
denotes |
( |
T3685 |
13810-13817 |
VBN |
denotes |
hatched |
T3684 |
13818-13822 |
NNS |
denotes |
bars |
T3686 |
13822-13823 |
-RRB- |
denotes |
) |
T3687 |
13824-13832 |
VBN |
denotes |
compared |
T3688 |
13833-13837 |
IN |
denotes |
with |
T3689 |
13838-13839 |
CD |
denotes |
4 |
T3691 |
13839-13840 |
HYPH |
denotes |
- |
T3690 |
13840-13845 |
NN |
denotes |
month |
T3693 |
13845-13846 |
HYPH |
denotes |
- |
T3692 |
13846-13849 |
JJ |
denotes |
old |
T3694 |
13850-13854 |
NNS |
denotes |
mice |
T3695 |
13855-13857 |
IN |
denotes |
of |
T3696 |
13858-13862 |
DT |
denotes |
both |
T3697 |
13863-13872 |
NNS |
denotes |
genotypes |
T3698 |
13873-13874 |
-LRB- |
denotes |
( |
T3700 |
13874-13879 |
JJ |
denotes |
solid |
T3699 |
13880-13884 |
NNS |
denotes |
bars |
T3701 |
13884-13885 |
-RRB- |
denotes |
) |
T3702 |
13886-13889 |
CC |
denotes |
and |
T3703 |
13890-13892 |
CD |
denotes |
12 |
T3705 |
13892-13893 |
HYPH |
denotes |
- |
T3704 |
13893-13898 |
NN |
denotes |
month |
T3707 |
13898-13899 |
HYPH |
denotes |
- |
T3706 |
13899-13902 |
JJ |
denotes |
old |
T3709 |
13903-13908 |
NN |
denotes |
Sam68 |
T3710 |
13908-13909 |
SYM |
denotes |
− |
T3711 |
13909-13910 |
HYPH |
denotes |
/ |
T3712 |
13910-13911 |
SYM |
denotes |
− |
T3708 |
13912-13916 |
NNS |
denotes |
mice |
T3713 |
13917-13918 |
-LRB- |
denotes |
( |
T3715 |
13918-13926 |
VBN |
denotes |
stippled |
T3714 |
13927-13931 |
NNS |
denotes |
bars |
T3716 |
13931-13932 |
-RRB- |
denotes |
) |
T3717 |
13932-13933 |
. |
denotes |
. |
T3718 |
13933-14130 |
sentence |
denotes |
This was associated with a significant increase (p < 0.01; denoted by the asterisks) in the structure model index, which measures the ratio of plate-like to rod-like structures (Figure 4A, right). |
T3719 |
13934-13938 |
DT |
denotes |
This |
T3721 |
13939-13942 |
VBD |
denotes |
was |
T3720 |
13943-13953 |
VBN |
denotes |
associated |
T3722 |
13954-13958 |
IN |
denotes |
with |
T3723 |
13959-13960 |
DT |
denotes |
a |
T3725 |
13961-13972 |
JJ |
denotes |
significant |
T3724 |
13973-13981 |
NN |
denotes |
increase |
T3726 |
13982-13983 |
-LRB- |
denotes |
( |
T3728 |
13983-13984 |
NN |
denotes |
p |
T3730 |
13985-13986 |
SYM |
denotes |
< |
T3729 |
13987-13991 |
CD |
denotes |
0.01 |
T3731 |
13991-13992 |
: |
denotes |
; |
T3727 |
13993-14000 |
VBN |
denotes |
denoted |
T3732 |
14001-14003 |
IN |
denotes |
by |
T3733 |
14004-14007 |
DT |
denotes |
the |
T3734 |
14008-14017 |
NNS |
denotes |
asterisks |
T3735 |
14017-14018 |
-RRB- |
denotes |
) |
T3736 |
14019-14021 |
IN |
denotes |
in |
T3737 |
14022-14025 |
DT |
denotes |
the |
T3739 |
14026-14035 |
NN |
denotes |
structure |
T3740 |
14036-14041 |
NN |
denotes |
model |
T3738 |
14042-14047 |
NN |
denotes |
index |
T3741 |
14047-14049 |
, |
denotes |
, |
T3742 |
14049-14054 |
WDT |
denotes |
which |
T3743 |
14055-14063 |
VBZ |
denotes |
measures |
T3744 |
14064-14067 |
DT |
denotes |
the |
T3745 |
14068-14073 |
NN |
denotes |
ratio |
T3746 |
14074-14076 |
IN |
denotes |
of |
T3747 |
14077-14082 |
NN |
denotes |
plate |
T3749 |
14082-14083 |
HYPH |
denotes |
- |
T3748 |
14083-14087 |
JJ |
denotes |
like |
T3750 |
14088-14090 |
IN |
denotes |
to |
T3751 |
14091-14094 |
NN |
denotes |
rod |
T3753 |
14094-14095 |
HYPH |
denotes |
- |
T3752 |
14095-14099 |
JJ |
denotes |
like |
T3754 |
14100-14110 |
NNS |
denotes |
structures |
T3755 |
14111-14112 |
-LRB- |
denotes |
( |
T3757 |
14112-14118 |
NN |
denotes |
Figure |
T3756 |
14119-14121 |
NN |
denotes |
4A |
T3758 |
14121-14123 |
, |
denotes |
, |
T3759 |
14123-14128 |
NN |
denotes |
right |
T3760 |
14128-14129 |
-RRB- |
denotes |
) |
T3761 |
14129-14130 |
. |
denotes |
. |
T3762 |
14130-14365 |
sentence |
denotes |
A quantifiable increase in the mean trabecular separation (Tb.Sp) (unpublished data) in 12-month-old Sam68+/+ mice was due to an increase in the percentage of spaces falling in the range of 350 to 700 μm (Figure 4B, red hatched line). |
T3763 |
14131-14132 |
DT |
denotes |
A |
T3765 |
14133-14145 |
JJ |
denotes |
quantifiable |
T3764 |
14146-14154 |
NN |
denotes |
increase |
T3767 |
14155-14157 |
IN |
denotes |
in |
T3768 |
14158-14161 |
DT |
denotes |
the |
T3770 |
14162-14166 |
NN |
denotes |
mean |
T3771 |
14167-14177 |
JJ |
denotes |
trabecular |
T3769 |
14178-14188 |
NN |
denotes |
separation |
T3772 |
14189-14190 |
-LRB- |
denotes |
( |
T3773 |
14190-14195 |
NN |
denotes |
Tb.Sp |
T3774 |
14195-14196 |
-RRB- |
denotes |
) |
T3775 |
14197-14198 |
-LRB- |
denotes |
( |
T3777 |
14198-14209 |
JJ |
denotes |
unpublished |
T3776 |
14210-14214 |
NNS |
denotes |
data |
T3778 |
14214-14215 |
-RRB- |
denotes |
) |
T3779 |
14216-14218 |
IN |
denotes |
in |
T3780 |
14219-14221 |
CD |
denotes |
12 |
T3782 |
14221-14222 |
HYPH |
denotes |
- |
T3781 |
14222-14227 |
NN |
denotes |
month |
T3784 |
14227-14228 |
HYPH |
denotes |
- |
T3783 |
14228-14231 |
JJ |
denotes |
old |
T3786 |
14232-14237 |
NN |
denotes |
Sam68 |
T3787 |
14237-14238 |
SYM |
denotes |
+ |
T3788 |
14238-14239 |
HYPH |
denotes |
/ |
T3789 |
14239-14240 |
SYM |
denotes |
+ |
T3785 |
14241-14245 |
NNS |
denotes |
mice |
T3766 |
14246-14249 |
VBD |
denotes |
was |
T3790 |
14250-14253 |
IN |
denotes |
due |
T3791 |
14254-14256 |
IN |
denotes |
to |
T3792 |
14257-14259 |
DT |
denotes |
an |
T3793 |
14260-14268 |
NN |
denotes |
increase |
T3794 |
14269-14271 |
IN |
denotes |
in |
T3795 |
14272-14275 |
DT |
denotes |
the |
T3796 |
14276-14286 |
NN |
denotes |
percentage |
T3797 |
14287-14289 |
IN |
denotes |
of |
T3798 |
14290-14296 |
NNS |
denotes |
spaces |
T3799 |
14297-14304 |
VBG |
denotes |
falling |
T3800 |
14305-14307 |
IN |
denotes |
in |
T3801 |
14308-14311 |
DT |
denotes |
the |
T3802 |
14312-14317 |
NN |
denotes |
range |
T3803 |
14318-14320 |
IN |
denotes |
of |
T3804 |
14321-14324 |
CD |
denotes |
350 |
T3806 |
14325-14327 |
IN |
denotes |
to |
T3805 |
14328-14331 |
CD |
denotes |
700 |
T3807 |
14332-14334 |
NN |
denotes |
μm |
T3808 |
14335-14336 |
-LRB- |
denotes |
( |
T3810 |
14336-14342 |
NN |
denotes |
Figure |
T3809 |
14343-14345 |
NN |
denotes |
4B |
T3811 |
14345-14347 |
, |
denotes |
, |
T3812 |
14347-14350 |
JJ |
denotes |
red |
T3814 |
14351-14358 |
VBN |
denotes |
hatched |
T3813 |
14359-14363 |
NN |
denotes |
line |
T3815 |
14363-14364 |
-RRB- |
denotes |
) |
T3816 |
14364-14365 |
. |
denotes |
. |
T3817 |
14365-14459 |
sentence |
denotes |
Trabecular thickness remained constant among the different groups of mice (unpublished data). |
T3818 |
14366-14376 |
JJ |
denotes |
Trabecular |
T3819 |
14377-14386 |
NN |
denotes |
thickness |
T3820 |
14387-14395 |
VBD |
denotes |
remained |
T3821 |
14396-14404 |
JJ |
denotes |
constant |
T3822 |
14405-14410 |
IN |
denotes |
among |
T3823 |
14411-14414 |
DT |
denotes |
the |
T3825 |
14415-14424 |
JJ |
denotes |
different |
T3824 |
14425-14431 |
NNS |
denotes |
groups |
T3826 |
14432-14434 |
IN |
denotes |
of |
T3827 |
14435-14439 |
NNS |
denotes |
mice |
T3828 |
14440-14441 |
-LRB- |
denotes |
( |
T3830 |
14441-14452 |
JJ |
denotes |
unpublished |
T3829 |
14453-14457 |
NNS |
denotes |
data |
T3831 |
14457-14458 |
-RRB- |
denotes |
) |
T3832 |
14458-14459 |
. |
denotes |
. |
T3833 |
14459-14647 |
sentence |
denotes |
In effect, this meant that there were fewer trabeculae, rather than equivalent numbers of thin trabeculae, in the 12-month-old Sam68+/+ mice compared with any of the other groups of mice. |
T3834 |
14460-14462 |
IN |
denotes |
In |
T3836 |
14463-14469 |
NN |
denotes |
effect |
T3837 |
14469-14471 |
, |
denotes |
, |
T3838 |
14471-14475 |
DT |
denotes |
this |
T3835 |
14476-14481 |
VBD |
denotes |
meant |
T3839 |
14482-14486 |
IN |
denotes |
that |
T3841 |
14487-14492 |
EX |
denotes |
there |
T3840 |
14493-14497 |
VBD |
denotes |
were |
T3842 |
14498-14503 |
JJR |
denotes |
fewer |
T3843 |
14504-14514 |
NNS |
denotes |
trabeculae |
T3844 |
14514-14516 |
, |
denotes |
, |
T3845 |
14516-14522 |
RB |
denotes |
rather |
T3846 |
14523-14527 |
IN |
denotes |
than |
T3847 |
14528-14538 |
JJ |
denotes |
equivalent |
T3848 |
14539-14546 |
NNS |
denotes |
numbers |
T3849 |
14547-14549 |
IN |
denotes |
of |
T3850 |
14550-14554 |
JJ |
denotes |
thin |
T3851 |
14555-14565 |
NNS |
denotes |
trabeculae |
T3852 |
14565-14567 |
, |
denotes |
, |
T3853 |
14567-14569 |
IN |
denotes |
in |
T3854 |
14570-14573 |
DT |
denotes |
the |
T3856 |
14574-14576 |
CD |
denotes |
12 |
T3858 |
14576-14577 |
HYPH |
denotes |
- |
T3857 |
14577-14582 |
NN |
denotes |
month |
T3860 |
14582-14583 |
HYPH |
denotes |
- |
T3859 |
14583-14586 |
JJ |
denotes |
old |
T3861 |
14587-14592 |
NN |
denotes |
Sam68 |
T3862 |
14592-14593 |
SYM |
denotes |
+ |
T3863 |
14593-14594 |
HYPH |
denotes |
/ |
T3864 |
14594-14595 |
SYM |
denotes |
+ |
T3855 |
14596-14600 |
NNS |
denotes |
mice |
T3865 |
14601-14609 |
VBN |
denotes |
compared |
T3866 |
14610-14614 |
IN |
denotes |
with |
T3867 |
14615-14618 |
DT |
denotes |
any |
T3868 |
14619-14621 |
IN |
denotes |
of |
T3869 |
14622-14625 |
DT |
denotes |
the |
T3871 |
14626-14631 |
JJ |
denotes |
other |
T3870 |
14632-14638 |
NNS |
denotes |
groups |
T3872 |
14639-14641 |
IN |
denotes |
of |
T3873 |
14642-14646 |
NNS |
denotes |
mice |
T3874 |
14646-14647 |
. |
denotes |
. |
T4163 |
15537-15541 |
NN |
denotes |
Bone |
T4164 |
15542-15552 |
NN |
denotes |
Remodeling |
T4166 |
15553-15555 |
VBZ |
denotes |
Is |
T4165 |
15556-15565 |
VBN |
denotes |
Preserved |
T4167 |
15566-15568 |
IN |
denotes |
in |
T4168 |
15569-15573 |
VBN |
denotes |
Aged |
T4170 |
15574-15579 |
NN |
denotes |
Sam68 |
T4171 |
15579-15580 |
SYM |
denotes |
− |
T4172 |
15580-15581 |
HYPH |
denotes |
/ |
T4173 |
15581-15582 |
SYM |
denotes |
− |
T4169 |
15583-15587 |
NNS |
denotes |
Mice |
T4174 |
15587-15804 |
sentence |
denotes |
To further define the mechanisms involved in the preservation of bone mass in aged Sam68−/− mice, we prepared sections from plastic-embedded femora and tibia to evaluate osteoblast and osteoclast activity (Figure 5). |
T4175 |
15588-15590 |
TO |
denotes |
To |
T4177 |
15591-15598 |
RB |
denotes |
further |
T4176 |
15599-15605 |
VB |
denotes |
define |
T4179 |
15606-15609 |
DT |
denotes |
the |
T4180 |
15610-15620 |
NNS |
denotes |
mechanisms |
T4181 |
15621-15629 |
VBN |
denotes |
involved |
T4182 |
15630-15632 |
IN |
denotes |
in |
T4183 |
15633-15636 |
DT |
denotes |
the |
T4184 |
15637-15649 |
NN |
denotes |
preservation |
T4185 |
15650-15652 |
IN |
denotes |
of |
T4186 |
15653-15657 |
NN |
denotes |
bone |
T4187 |
15658-15662 |
NN |
denotes |
mass |
T4188 |
15663-15665 |
IN |
denotes |
in |
T4189 |
15666-15670 |
JJ |
denotes |
aged |
T4191 |
15671-15676 |
NN |
denotes |
Sam68 |
T4192 |
15676-15677 |
SYM |
denotes |
− |
T4193 |
15677-15678 |
HYPH |
denotes |
/ |
T4194 |
15678-15679 |
SYM |
denotes |
− |
T4190 |
15680-15684 |
NNS |
denotes |
mice |
T4195 |
15684-15686 |
, |
denotes |
, |
T4196 |
15686-15688 |
PRP |
denotes |
we |
T4178 |
15689-15697 |
VBD |
denotes |
prepared |
T4197 |
15698-15706 |
NNS |
denotes |
sections |
T4198 |
15707-15711 |
IN |
denotes |
from |
T4199 |
15712-15719 |
NN |
denotes |
plastic |
T4201 |
15719-15720 |
HYPH |
denotes |
- |
T4200 |
15720-15728 |
VBN |
denotes |
embedded |
T4202 |
15729-15735 |
NNS |
denotes |
femora |
T4203 |
15736-15739 |
CC |
denotes |
and |
T4204 |
15740-15745 |
NN |
denotes |
tibia |
T4205 |
15746-15748 |
TO |
denotes |
to |
T4206 |
15749-15757 |
VB |
denotes |
evaluate |
T4207 |
15758-15768 |
NN |
denotes |
osteoblast |
T4209 |
15769-15772 |
CC |
denotes |
and |
T4210 |
15773-15783 |
NN |
denotes |
osteoclast |
T4208 |
15784-15792 |
NN |
denotes |
activity |
T4211 |
15793-15794 |
-LRB- |
denotes |
( |
T4212 |
15794-15800 |
NN |
denotes |
Figure |
T4213 |
15801-15802 |
CD |
denotes |
5 |
T4214 |
15802-15803 |
-RRB- |
denotes |
) |
T4215 |
15803-15804 |
. |
denotes |
. |
T4216 |
15804-16056 |
sentence |
denotes |
In situ enzyme histochemical staining for alkaline phosphatase (ALP; brown stain) activity was used as a biomarker for osteoblasts and tartrate-resistant ALP (tartrate-resistant acid phosphatase [TRAP]; red stain) activity as a marker for osteoclasts. |
T4217 |
15805-15807 |
FW |
denotes |
In |
T4218 |
15808-15812 |
FW |
denotes |
situ |
T4220 |
15813-15819 |
NN |
denotes |
enzyme |
T4221 |
15820-15833 |
JJ |
denotes |
histochemical |
T4219 |
15834-15842 |
NN |
denotes |
staining |
T4223 |
15843-15846 |
IN |
denotes |
for |
T4224 |
15847-15855 |
NN |
denotes |
alkaline |
T4225 |
15856-15867 |
NN |
denotes |
phosphatase |
T4227 |
15868-15869 |
-LRB- |
denotes |
( |
T4228 |
15869-15872 |
NN |
denotes |
ALP |
T4229 |
15872-15873 |
: |
denotes |
; |
T4231 |
15874-15879 |
JJ |
denotes |
brown |
T4230 |
15880-15885 |
NN |
denotes |
stain |
T4232 |
15885-15886 |
-RRB- |
denotes |
) |
T4226 |
15887-15895 |
NN |
denotes |
activity |
T4233 |
15896-15899 |
VBD |
denotes |
was |
T4222 |
15900-15904 |
VBN |
denotes |
used |
T4234 |
15905-15907 |
IN |
denotes |
as |
T4235 |
15908-15909 |
DT |
denotes |
a |
T4236 |
15910-15919 |
NN |
denotes |
biomarker |
T4237 |
15920-15923 |
IN |
denotes |
for |
T4238 |
15924-15935 |
NNS |
denotes |
osteoblasts |
T4239 |
15936-15939 |
CC |
denotes |
and |
T4240 |
15940-15948 |
NN |
denotes |
tartrate |
T4242 |
15948-15949 |
HYPH |
denotes |
- |
T4241 |
15949-15958 |
JJ |
denotes |
resistant |
T4244 |
15959-15962 |
NN |
denotes |
ALP |
T4245 |
15963-15964 |
-LRB- |
denotes |
( |
T4247 |
15964-15972 |
NN |
denotes |
tartrate |
T4249 |
15972-15973 |
HYPH |
denotes |
- |
T4248 |
15973-15982 |
JJ |
denotes |
resistant |
T4251 |
15983-15987 |
NN |
denotes |
acid |
T4250 |
15988-15999 |
NN |
denotes |
phosphatase |
T4252 |
16000-16001 |
-LRB- |
denotes |
[ |
T4253 |
16001-16005 |
NN |
denotes |
TRAP |
T4254 |
16005-16006 |
-RRB- |
denotes |
] |
T4255 |
16006-16007 |
: |
denotes |
; |
T4256 |
16008-16011 |
JJ |
denotes |
red |
T4246 |
16012-16017 |
NN |
denotes |
stain |
T4257 |
16017-16018 |
-RRB- |
denotes |
) |
T4243 |
16019-16027 |
NN |
denotes |
activity |
T4258 |
16028-16030 |
IN |
denotes |
as |
T4259 |
16031-16032 |
DT |
denotes |
a |
T4260 |
16033-16039 |
NN |
denotes |
marker |
T4261 |
16040-16043 |
IN |
denotes |
for |
T4262 |
16044-16055 |
NNS |
denotes |
osteoclasts |
T4263 |
16055-16056 |
. |
denotes |
. |
T4264 |
16056-16176 |
sentence |
denotes |
Little difference was seen between Sam68+/+ (Figure 5A and 5B) and Sam68−/− (Figure 5C and 5D) mice at 4 months of age. |
T4265 |
16057-16063 |
JJ |
denotes |
Little |
T4266 |
16064-16074 |
NN |
denotes |
difference |
T4268 |
16075-16078 |
VBD |
denotes |
was |
T4267 |
16079-16083 |
VBN |
denotes |
seen |
T4269 |
16084-16091 |
IN |
denotes |
between |
T4270 |
16092-16097 |
NN |
denotes |
Sam68 |
T4272 |
16097-16098 |
SYM |
denotes |
+ |
T4273 |
16098-16099 |
HYPH |
denotes |
/ |
T4274 |
16099-16100 |
SYM |
denotes |
+ |
T4275 |
16101-16102 |
-LRB- |
denotes |
( |
T4277 |
16102-16108 |
NN |
denotes |
Figure |
T4276 |
16109-16111 |
NN |
denotes |
5A |
T4278 |
16112-16115 |
CC |
denotes |
and |
T4279 |
16116-16118 |
NN |
denotes |
5B |
T4280 |
16118-16119 |
-RRB- |
denotes |
) |
T4281 |
16120-16123 |
CC |
denotes |
and |
T4282 |
16124-16129 |
NN |
denotes |
Sam68 |
T4283 |
16129-16130 |
SYM |
denotes |
− |
T4284 |
16130-16131 |
HYPH |
denotes |
/ |
T4285 |
16131-16132 |
SYM |
denotes |
− |
T4286 |
16133-16134 |
-LRB- |
denotes |
( |
T4288 |
16134-16140 |
NN |
denotes |
Figure |
T4287 |
16141-16143 |
NN |
denotes |
5C |
T4289 |
16144-16147 |
CC |
denotes |
and |
T4290 |
16148-16150 |
NN |
denotes |
5D |
T4291 |
16150-16151 |
-RRB- |
denotes |
) |
T4271 |
16152-16156 |
NNS |
denotes |
mice |
T4292 |
16157-16159 |
IN |
denotes |
at |
T4293 |
16160-16161 |
CD |
denotes |
4 |
T4294 |
16162-16168 |
NNS |
denotes |
months |
T4295 |
16169-16171 |
IN |
denotes |
of |
T4296 |
16172-16175 |
NN |
denotes |
age |
T4297 |
16175-16176 |
. |
denotes |
. |
T4298 |
16176-16344 |
sentence |
denotes |
ALP- and TRAP-positive cells were reduced in the 12-month-old Sam68+/+ mice (Figure 5E and 5F) and remained unchanged in 12-month-old Sam68−/− mice (Figure 5G and 5H). |
T4299 |
16177-16180 |
NN |
denotes |
ALP |
T4301 |
16180-16181 |
HYPH |
denotes |
- |
T4302 |
16182-16185 |
CC |
denotes |
and |
T4303 |
16186-16190 |
NN |
denotes |
TRAP |
T4304 |
16190-16191 |
HYPH |
denotes |
- |
T4300 |
16191-16199 |
JJ |
denotes |
positive |
T4305 |
16200-16205 |
NNS |
denotes |
cells |
T4307 |
16206-16210 |
VBD |
denotes |
were |
T4306 |
16211-16218 |
VBN |
denotes |
reduced |
T4308 |
16219-16221 |
IN |
denotes |
in |
T4309 |
16222-16225 |
DT |
denotes |
the |
T4311 |
16226-16228 |
CD |
denotes |
12 |
T4313 |
16228-16229 |
HYPH |
denotes |
- |
T4312 |
16229-16234 |
NN |
denotes |
month |
T4315 |
16234-16235 |
HYPH |
denotes |
- |
T4314 |
16235-16238 |
JJ |
denotes |
old |
T4316 |
16239-16244 |
NN |
denotes |
Sam68 |
T4317 |
16244-16245 |
SYM |
denotes |
+ |
T4318 |
16245-16246 |
HYPH |
denotes |
/ |
T4319 |
16246-16247 |
SYM |
denotes |
+ |
T4310 |
16248-16252 |
NNS |
denotes |
mice |
T4320 |
16253-16254 |
-LRB- |
denotes |
( |
T4322 |
16254-16260 |
NN |
denotes |
Figure |
T4321 |
16261-16263 |
NN |
denotes |
5E |
T4323 |
16264-16267 |
CC |
denotes |
and |
T4324 |
16268-16270 |
NN |
denotes |
5F |
T4325 |
16270-16271 |
-RRB- |
denotes |
) |
T4326 |
16272-16275 |
CC |
denotes |
and |
T4327 |
16276-16284 |
VBD |
denotes |
remained |
T4328 |
16285-16294 |
JJ |
denotes |
unchanged |
T4329 |
16295-16297 |
IN |
denotes |
in |
T4330 |
16298-16300 |
CD |
denotes |
12 |
T4332 |
16300-16301 |
HYPH |
denotes |
- |
T4331 |
16301-16306 |
NN |
denotes |
month |
T4334 |
16306-16307 |
HYPH |
denotes |
- |
T4333 |
16307-16310 |
JJ |
denotes |
old |
T4336 |
16311-16316 |
NN |
denotes |
Sam68 |
T4337 |
16316-16317 |
SYM |
denotes |
− |
T4338 |
16317-16318 |
HYPH |
denotes |
/ |
T4339 |
16318-16319 |
SYM |
denotes |
− |
T4335 |
16320-16324 |
NNS |
denotes |
mice |
T4340 |
16325-16326 |
-LRB- |
denotes |
( |
T4342 |
16326-16332 |
NN |
denotes |
Figure |
T4341 |
16333-16335 |
NN |
denotes |
5G |
T4343 |
16336-16339 |
CC |
denotes |
and |
T4344 |
16340-16342 |
NN |
denotes |
5H |
T4345 |
16342-16343 |
-RRB- |
denotes |
) |
T4346 |
16343-16344 |
. |
denotes |
. |
T4347 |
16344-16582 |
sentence |
denotes |
The reduction in both osteoblast and osteoclast activity in the 12-month-old Sam68+/+ mice argued against bone being lost primarily due to a relative increase in osteoclast over osteoblast activity, as seen in high turnover disease [49]. |
T4348 |
16345-16348 |
DT |
denotes |
The |
T4349 |
16349-16358 |
NN |
denotes |
reduction |
T4351 |
16359-16361 |
IN |
denotes |
in |
T4352 |
16362-16366 |
CC |
denotes |
both |
T4353 |
16367-16377 |
NN |
denotes |
osteoblast |
T4355 |
16378-16381 |
CC |
denotes |
and |
T4356 |
16382-16392 |
NN |
denotes |
osteoclast |
T4354 |
16393-16401 |
NN |
denotes |
activity |
T4357 |
16402-16404 |
IN |
denotes |
in |
T4358 |
16405-16408 |
DT |
denotes |
the |
T4360 |
16409-16411 |
CD |
denotes |
12 |
T4362 |
16411-16412 |
HYPH |
denotes |
- |
T4361 |
16412-16417 |
NN |
denotes |
month |
T4364 |
16417-16418 |
HYPH |
denotes |
- |
T4363 |
16418-16421 |
JJ |
denotes |
old |
T4365 |
16422-16427 |
NN |
denotes |
Sam68 |
T4366 |
16427-16428 |
SYM |
denotes |
+ |
T4367 |
16428-16429 |
HYPH |
denotes |
/ |
T4368 |
16429-16430 |
SYM |
denotes |
+ |
T4359 |
16431-16435 |
NNS |
denotes |
mice |
T4350 |
16436-16442 |
VBD |
denotes |
argued |
T4369 |
16443-16450 |
IN |
denotes |
against |
T4370 |
16451-16455 |
NN |
denotes |
bone |
T4372 |
16456-16461 |
VBG |
denotes |
being |
T4371 |
16462-16466 |
VBN |
denotes |
lost |
T4373 |
16467-16476 |
RB |
denotes |
primarily |
T4374 |
16477-16480 |
IN |
denotes |
due |
T4375 |
16481-16483 |
IN |
denotes |
to |
T4376 |
16484-16485 |
DT |
denotes |
a |
T4378 |
16486-16494 |
JJ |
denotes |
relative |
T4377 |
16495-16503 |
NN |
denotes |
increase |
T4379 |
16504-16506 |
IN |
denotes |
in |
T4380 |
16507-16517 |
NN |
denotes |
osteoclast |
T4381 |
16518-16522 |
IN |
denotes |
over |
T4382 |
16523-16533 |
NN |
denotes |
osteoblast |
T4383 |
16534-16542 |
NN |
denotes |
activity |
T4384 |
16542-16544 |
, |
denotes |
, |
T4385 |
16544-16546 |
IN |
denotes |
as |
T4386 |
16547-16551 |
VBN |
denotes |
seen |
T4387 |
16552-16554 |
IN |
denotes |
in |
T4388 |
16555-16559 |
JJ |
denotes |
high |
T4389 |
16560-16568 |
NN |
denotes |
turnover |
T4390 |
16569-16576 |
NN |
denotes |
disease |
T4391 |
16577-16578 |
-LRB- |
denotes |
[ |
T4392 |
16578-16580 |
CD |
denotes |
49 |
T4393 |
16580-16581 |
-RRB- |
denotes |
] |
T4394 |
16581-16582 |
. |
denotes |
. |
T4395 |
16582-17336 |
sentence |
denotes |
Figure 5 Histologic Analysis of Undecalcified Bone from Sam68+/+ and Sam68−/− Mice
Sections of tibia fixed in 4% paraformaldehyde and embedded in plastic were stained for ALP (A–C, E–G) activity to identify osteoblasts or for TRAP (B–D, F–H) activity to identify osteoclasts. Staining patterns were similar in 4-month-old Sam68+/+ (A and B), 4-month-old Sam68−/− (C and D), and 12-month-old Sam68−/− (G and H) mice compared with 12-month-old Sam68+/+ mice (E and F). Magnification at source, left panels ×10 and right panels ×40. Micrographs are representative of those taken from five to seven sections in each group of animals. Histomorphometric analyses [50] of the long bones (Table 3) corroborated the radiologic evidence of age-related bone loss. |
T4396 |
17214-17231 |
JJ |
denotes |
Histomorphometric |
T4397 |
17232-17240 |
NNS |
denotes |
analyses |
T4399 |
17241-17242 |
-LRB- |
denotes |
[ |
T4400 |
17242-17244 |
CD |
denotes |
50 |
T4401 |
17244-17245 |
-RRB- |
denotes |
] |
T4402 |
17246-17248 |
IN |
denotes |
of |
T4403 |
17249-17252 |
DT |
denotes |
the |
T4405 |
17253-17257 |
JJ |
denotes |
long |
T4404 |
17258-17263 |
NNS |
denotes |
bones |
T4406 |
17264-17265 |
-LRB- |
denotes |
( |
T4407 |
17265-17270 |
NN |
denotes |
Table |
T4408 |
17271-17272 |
CD |
denotes |
3 |
T4409 |
17272-17273 |
-RRB- |
denotes |
) |
T4398 |
17274-17286 |
VBD |
denotes |
corroborated |
T4410 |
17287-17290 |
DT |
denotes |
the |
T4412 |
17291-17301 |
JJ |
denotes |
radiologic |
T4411 |
17302-17310 |
NN |
denotes |
evidence |
T4413 |
17311-17313 |
IN |
denotes |
of |
T4414 |
17314-17317 |
NN |
denotes |
age |
T4416 |
17317-17318 |
HYPH |
denotes |
- |
T4415 |
17318-17325 |
VBN |
denotes |
related |
T4418 |
17326-17330 |
NN |
denotes |
bone |
T4417 |
17331-17335 |
NN |
denotes |
loss |
T4419 |
17335-17336 |
. |
denotes |
. |
T4420 |
17336-17523 |
sentence |
denotes |
Bone volume (BV/TV), newly formed osteoid (OV/TV), and mineral apposition rate (MAR) were all significantly reduced in 12-month-old Sam68+/+ mice compared with 4-month-old Sam68+/+ mice. |
T4421 |
17337-17341 |
NN |
denotes |
Bone |
T4422 |
17342-17348 |
NN |
denotes |
volume |
T4424 |
17349-17350 |
-LRB- |
denotes |
( |
T4425 |
17350-17352 |
NN |
denotes |
BV |
T4427 |
17352-17353 |
HYPH |
denotes |
/ |
T4426 |
17353-17355 |
NN |
denotes |
TV |
T4428 |
17355-17356 |
-RRB- |
denotes |
) |
T4429 |
17356-17358 |
, |
denotes |
, |
T4430 |
17358-17363 |
RB |
denotes |
newly |
T4431 |
17364-17370 |
VBN |
denotes |
formed |
T4432 |
17371-17378 |
JJ |
denotes |
osteoid |
T4433 |
17379-17380 |
-LRB- |
denotes |
( |
T4434 |
17380-17382 |
NN |
denotes |
OV |
T4436 |
17382-17383 |
HYPH |
denotes |
/ |
T4435 |
17383-17385 |
NN |
denotes |
TV |
T4437 |
17385-17386 |
-RRB- |
denotes |
) |
T4438 |
17386-17388 |
, |
denotes |
, |
T4439 |
17388-17391 |
CC |
denotes |
and |
T4440 |
17392-17399 |
NN |
denotes |
mineral |
T4442 |
17400-17410 |
NN |
denotes |
apposition |
T4441 |
17411-17415 |
NN |
denotes |
rate |
T4443 |
17416-17417 |
-LRB- |
denotes |
( |
T4444 |
17417-17420 |
NN |
denotes |
MAR |
T4445 |
17420-17421 |
-RRB- |
denotes |
) |
T4446 |
17422-17426 |
VBD |
denotes |
were |
T4447 |
17427-17430 |
DT |
denotes |
all |
T4448 |
17431-17444 |
RB |
denotes |
significantly |
T4423 |
17445-17452 |
VBN |
denotes |
reduced |
T4449 |
17453-17455 |
IN |
denotes |
in |
T4450 |
17456-17458 |
CD |
denotes |
12 |
T4452 |
17458-17459 |
HYPH |
denotes |
- |
T4451 |
17459-17464 |
NN |
denotes |
month |
T4454 |
17464-17465 |
HYPH |
denotes |
- |
T4453 |
17465-17468 |
JJ |
denotes |
old |
T4456 |
17469-17474 |
NN |
denotes |
Sam68 |
T4457 |
17474-17475 |
SYM |
denotes |
+ |
T4458 |
17475-17476 |
HYPH |
denotes |
/ |
T4459 |
17476-17477 |
SYM |
denotes |
+ |
T4455 |
17478-17482 |
NNS |
denotes |
mice |
T4460 |
17483-17491 |
VBN |
denotes |
compared |
T4461 |
17492-17496 |
IN |
denotes |
with |
T4462 |
17497-17498 |
CD |
denotes |
4 |
T4464 |
17498-17499 |
HYPH |
denotes |
- |
T4463 |
17499-17504 |
NN |
denotes |
month |
T4466 |
17504-17505 |
HYPH |
denotes |
- |
T4465 |
17505-17508 |
JJ |
denotes |
old |
T4468 |
17509-17514 |
NN |
denotes |
Sam68 |
T4469 |
17514-17515 |
SYM |
denotes |
+ |
T4470 |
17515-17516 |
HYPH |
denotes |
/ |
T4471 |
17516-17517 |
SYM |
denotes |
+ |
T4467 |
17518-17522 |
NNS |
denotes |
mice |
T4472 |
17522-17523 |
. |
denotes |
. |
T4473 |
17523-17706 |
sentence |
denotes |
These reductions were associated with a significant increase in marrow fat (FV/TV) and decreased numbers of osteoblasts (nOB/TV) and osteoclasts (nOC/TV) per tissue volume (Table 3). |
T4474 |
17524-17529 |
DT |
denotes |
These |
T4475 |
17530-17540 |
NNS |
denotes |
reductions |
T4477 |
17541-17545 |
VBD |
denotes |
were |
T4476 |
17546-17556 |
VBN |
denotes |
associated |
T4478 |
17557-17561 |
IN |
denotes |
with |
T4479 |
17562-17563 |
DT |
denotes |
a |
T4481 |
17564-17575 |
JJ |
denotes |
significant |
T4480 |
17576-17584 |
NN |
denotes |
increase |
T4482 |
17585-17587 |
IN |
denotes |
in |
T4483 |
17588-17594 |
NN |
denotes |
marrow |
T4484 |
17595-17598 |
NN |
denotes |
fat |
T4485 |
17599-17600 |
-LRB- |
denotes |
( |
T4487 |
17600-17602 |
NN |
denotes |
FV |
T4488 |
17602-17603 |
HYPH |
denotes |
/ |
T4486 |
17603-17605 |
NN |
denotes |
TV |
T4489 |
17605-17606 |
-RRB- |
denotes |
) |
T4490 |
17607-17610 |
CC |
denotes |
and |
T4491 |
17611-17620 |
VBN |
denotes |
decreased |
T4492 |
17621-17628 |
NNS |
denotes |
numbers |
T4493 |
17629-17631 |
IN |
denotes |
of |
T4494 |
17632-17643 |
NNS |
denotes |
osteoblasts |
T4495 |
17644-17645 |
-LRB- |
denotes |
( |
T4497 |
17645-17648 |
NN |
denotes |
nOB |
T4498 |
17648-17649 |
HYPH |
denotes |
/ |
T4496 |
17649-17651 |
NN |
denotes |
TV |
T4499 |
17651-17652 |
-RRB- |
denotes |
) |
T4500 |
17653-17656 |
CC |
denotes |
and |
T4501 |
17657-17668 |
NNS |
denotes |
osteoclasts |
T4502 |
17669-17670 |
-LRB- |
denotes |
( |
T4504 |
17670-17673 |
NN |
denotes |
nOC |
T4505 |
17673-17674 |
HYPH |
denotes |
/ |
T4503 |
17674-17676 |
NN |
denotes |
TV |
T4506 |
17676-17677 |
-RRB- |
denotes |
) |
T4507 |
17678-17681 |
IN |
denotes |
per |
T4508 |
17682-17688 |
NN |
denotes |
tissue |
T4509 |
17689-17695 |
NN |
denotes |
volume |
T4510 |
17696-17697 |
-LRB- |
denotes |
( |
T4511 |
17697-17702 |
NN |
denotes |
Table |
T4512 |
17703-17704 |
CD |
denotes |
3 |
T4513 |
17704-17705 |
-RRB- |
denotes |
) |
T4514 |
17705-17706 |
. |
denotes |
. |
T4515 |
17706-17905 |
sentence |
denotes |
These results were in contrast to those of the 12-month-old Sam68−/− mice in which all histomorphometric parameters, including marrow fat, resembled those of young mice of either genotype (Table 3). |
T4516 |
17707-17712 |
DT |
denotes |
These |
T4517 |
17713-17720 |
NNS |
denotes |
results |
T4518 |
17721-17725 |
VBD |
denotes |
were |
T4519 |
17726-17728 |
IN |
denotes |
in |
T4520 |
17729-17737 |
NN |
denotes |
contrast |
T4521 |
17738-17740 |
IN |
denotes |
to |
T4522 |
17741-17746 |
DT |
denotes |
those |
T4523 |
17747-17749 |
IN |
denotes |
of |
T4524 |
17750-17753 |
DT |
denotes |
the |
T4526 |
17754-17756 |
CD |
denotes |
12 |
T4528 |
17756-17757 |
HYPH |
denotes |
- |
T4527 |
17757-17762 |
NN |
denotes |
month |
T4530 |
17762-17763 |
HYPH |
denotes |
- |
T4529 |
17763-17766 |
JJ |
denotes |
old |
T4531 |
17767-17772 |
NN |
denotes |
Sam68 |
T4532 |
17772-17773 |
SYM |
denotes |
− |
T4533 |
17773-17774 |
HYPH |
denotes |
/ |
T4534 |
17774-17775 |
SYM |
denotes |
− |
T4525 |
17776-17780 |
NNS |
denotes |
mice |
T4535 |
17781-17783 |
IN |
denotes |
in |
T4537 |
17784-17789 |
WDT |
denotes |
which |
T4538 |
17790-17793 |
DT |
denotes |
all |
T4540 |
17794-17811 |
JJ |
denotes |
histomorphometric |
T4539 |
17812-17822 |
NNS |
denotes |
parameters |
T4541 |
17822-17824 |
, |
denotes |
, |
T4542 |
17824-17833 |
VBG |
denotes |
including |
T4543 |
17834-17840 |
NN |
denotes |
marrow |
T4544 |
17841-17844 |
NN |
denotes |
fat |
T4545 |
17844-17846 |
, |
denotes |
, |
T4536 |
17846-17855 |
VBD |
denotes |
resembled |
T4546 |
17856-17861 |
DT |
denotes |
those |
T4547 |
17862-17864 |
IN |
denotes |
of |
T4548 |
17865-17870 |
JJ |
denotes |
young |
T4549 |
17871-17875 |
NNS |
denotes |
mice |
T4550 |
17876-17878 |
IN |
denotes |
of |
T4551 |
17879-17885 |
CC |
denotes |
either |
T4552 |
17886-17894 |
NN |
denotes |
genotype |
T4553 |
17895-17896 |
-LRB- |
denotes |
( |
T4554 |
17896-17901 |
NN |
denotes |
Table |
T4555 |
17902-17903 |
CD |
denotes |
3 |
T4556 |
17903-17904 |
-RRB- |
denotes |
) |
T4557 |
17904-17905 |
. |
denotes |
. |
T4558 |
17905-18112 |
sentence |
denotes |
When cells were expressed as a function of the bone perimeter (nOB/BP, nOC/BP), there were no statistical differences and the ratio of osteoblasts to osteoclasts was similar in all groups of mice (Table 3). |
T4559 |
17906-17910 |
WRB |
denotes |
When |
T4561 |
17911-17916 |
NNS |
denotes |
cells |
T4562 |
17917-17921 |
VBD |
denotes |
were |
T4560 |
17922-17931 |
VBN |
denotes |
expressed |
T4564 |
17932-17934 |
IN |
denotes |
as |
T4565 |
17935-17936 |
DT |
denotes |
a |
T4566 |
17937-17945 |
NN |
denotes |
function |
T4567 |
17946-17948 |
IN |
denotes |
of |
T4568 |
17949-17952 |
DT |
denotes |
the |
T4570 |
17953-17957 |
NN |
denotes |
bone |
T4569 |
17958-17967 |
NN |
denotes |
perimeter |
T4571 |
17968-17969 |
-LRB- |
denotes |
( |
T4573 |
17969-17972 |
NN |
denotes |
nOB |
T4574 |
17972-17973 |
HYPH |
denotes |
/ |
T4572 |
17973-17975 |
NN |
denotes |
BP |
T4575 |
17975-17977 |
, |
denotes |
, |
T4576 |
17977-17980 |
NN |
denotes |
nOC |
T4578 |
17980-17981 |
HYPH |
denotes |
/ |
T4577 |
17981-17983 |
NN |
denotes |
BP |
T4579 |
17983-17984 |
-RRB- |
denotes |
) |
T4580 |
17984-17986 |
, |
denotes |
, |
T4581 |
17986-17991 |
EX |
denotes |
there |
T4563 |
17992-17996 |
VBD |
denotes |
were |
T4582 |
17997-17999 |
DT |
denotes |
no |
T4584 |
18000-18011 |
JJ |
denotes |
statistical |
T4583 |
18012-18023 |
NNS |
denotes |
differences |
T4585 |
18024-18027 |
CC |
denotes |
and |
T4586 |
18028-18031 |
DT |
denotes |
the |
T4587 |
18032-18037 |
NN |
denotes |
ratio |
T4589 |
18038-18040 |
IN |
denotes |
of |
T4590 |
18041-18052 |
NNS |
denotes |
osteoblasts |
T4591 |
18053-18055 |
IN |
denotes |
to |
T4592 |
18056-18067 |
NNS |
denotes |
osteoclasts |
T4588 |
18068-18071 |
VBD |
denotes |
was |
T4593 |
18072-18079 |
JJ |
denotes |
similar |
T4594 |
18080-18082 |
IN |
denotes |
in |
T4595 |
18083-18086 |
DT |
denotes |
all |
T4596 |
18087-18093 |
NNS |
denotes |
groups |
T4597 |
18094-18096 |
IN |
denotes |
of |
T4598 |
18097-18101 |
NNS |
denotes |
mice |
T4599 |
18102-18103 |
-LRB- |
denotes |
( |
T4600 |
18103-18108 |
NN |
denotes |
Table |
T4601 |
18109-18110 |
CD |
denotes |
3 |
T4602 |
18110-18111 |
-RRB- |
denotes |
) |
T4603 |
18111-18112 |
. |
denotes |
. |
T4604 |
18112-18406 |
sentence |
denotes |
Table 3 Histomorphometric Analysis of Long Bones from 4- and 12-Month-Old Mice Circulating levels of serum C-telopeptide (sCTX; Roche Diagnostics, Mannheim, Germany) and ALP showed little difference among the groups, except for a small decrease in 12-month-old Sam68−/− mice and (Dataset S3). |
T4605 |
18193-18204 |
VBG |
denotes |
Circulating |
T4606 |
18205-18211 |
NNS |
denotes |
levels |
T4608 |
18212-18214 |
IN |
denotes |
of |
T4609 |
18215-18220 |
NN |
denotes |
serum |
T4611 |
18221-18222 |
NN |
denotes |
C |
T4612 |
18222-18223 |
HYPH |
denotes |
- |
T4610 |
18223-18234 |
NN |
denotes |
telopeptide |
T4613 |
18235-18236 |
-LRB- |
denotes |
( |
T4615 |
18236-18240 |
NN |
denotes |
sCTX |
T4616 |
18240-18241 |
: |
denotes |
; |
T4617 |
18242-18247 |
NNP |
denotes |
Roche |
T4614 |
18248-18259 |
NNP |
denotes |
Diagnostics |
T4618 |
18259-18261 |
, |
denotes |
, |
T4619 |
18261-18269 |
NNP |
denotes |
Mannheim |
T4620 |
18269-18271 |
, |
denotes |
, |
T4621 |
18271-18278 |
NNP |
denotes |
Germany |
T4622 |
18278-18279 |
-RRB- |
denotes |
) |
T4623 |
18280-18283 |
CC |
denotes |
and |
T4624 |
18284-18287 |
NN |
denotes |
ALP |
T4607 |
18288-18294 |
VBD |
denotes |
showed |
T4625 |
18295-18301 |
JJ |
denotes |
little |
T4626 |
18302-18312 |
NN |
denotes |
difference |
T4627 |
18313-18318 |
IN |
denotes |
among |
T4628 |
18319-18322 |
DT |
denotes |
the |
T4629 |
18323-18329 |
NNS |
denotes |
groups |
T4630 |
18329-18331 |
, |
denotes |
, |
T4631 |
18331-18337 |
IN |
denotes |
except |
T4632 |
18338-18341 |
IN |
denotes |
for |
T4633 |
18342-18343 |
DT |
denotes |
a |
T4635 |
18344-18349 |
JJ |
denotes |
small |
T4634 |
18350-18358 |
NN |
denotes |
decrease |
T4636 |
18359-18361 |
IN |
denotes |
in |
T4637 |
18362-18364 |
CD |
denotes |
12 |
T4639 |
18364-18365 |
HYPH |
denotes |
- |
T4638 |
18365-18370 |
NN |
denotes |
month |
T4641 |
18370-18371 |
HYPH |
denotes |
- |
T4640 |
18371-18374 |
JJ |
denotes |
old |
T4643 |
18375-18380 |
NN |
denotes |
Sam68 |
T4644 |
18380-18381 |
SYM |
denotes |
− |
T4645 |
18381-18382 |
HYPH |
denotes |
/ |
T4646 |
18382-18383 |
SYM |
denotes |
− |
T4642 |
18384-18388 |
NNS |
denotes |
mice |
T4647 |
18389-18392 |
CC |
denotes |
and |
T4648 |
18393-18394 |
-LRB- |
denotes |
( |
T4650 |
18394-18401 |
NN |
denotes |
Dataset |
T4649 |
18402-18404 |
NN |
denotes |
S3 |
T4651 |
18404-18405 |
-RRB- |
denotes |
) |
T4652 |
18405-18406 |
. |
denotes |
. |
T4653 |
18406-18562 |
sentence |
denotes |
Serum estrogen was significantly decreased in all 12-month-old mice regardless of genotype with a reciprocal increase in interleukin-6 levels (Dataset S3). |
T4654 |
18407-18412 |
NN |
denotes |
Serum |
T4655 |
18413-18421 |
NN |
denotes |
estrogen |
T4657 |
18422-18425 |
VBD |
denotes |
was |
T4658 |
18426-18439 |
RB |
denotes |
significantly |
T4656 |
18440-18449 |
VBN |
denotes |
decreased |
T4659 |
18450-18452 |
IN |
denotes |
in |
T4660 |
18453-18456 |
DT |
denotes |
all |
T4662 |
18457-18459 |
CD |
denotes |
12 |
T4664 |
18459-18460 |
HYPH |
denotes |
- |
T4663 |
18460-18465 |
NN |
denotes |
month |
T4666 |
18465-18466 |
HYPH |
denotes |
- |
T4665 |
18466-18469 |
JJ |
denotes |
old |
T4661 |
18470-18474 |
NNS |
denotes |
mice |
T4667 |
18475-18485 |
RB |
denotes |
regardless |
T4668 |
18486-18488 |
IN |
denotes |
of |
T4669 |
18489-18497 |
NN |
denotes |
genotype |
T4670 |
18498-18502 |
IN |
denotes |
with |
T4671 |
18503-18504 |
DT |
denotes |
a |
T4673 |
18505-18515 |
JJ |
denotes |
reciprocal |
T4672 |
18516-18524 |
NN |
denotes |
increase |
T4674 |
18525-18527 |
IN |
denotes |
in |
T4675 |
18528-18539 |
NN |
denotes |
interleukin |
T4677 |
18539-18540 |
HYPH |
denotes |
- |
T4678 |
18540-18541 |
CD |
denotes |
6 |
T4676 |
18542-18548 |
NNS |
denotes |
levels |
T4679 |
18549-18550 |
-LRB- |
denotes |
( |
T4681 |
18550-18557 |
NN |
denotes |
Dataset |
T4680 |
18558-18560 |
NN |
denotes |
S3 |
T4682 |
18560-18561 |
-RRB- |
denotes |
) |
T4683 |
18561-18562 |
. |
denotes |
. |
T4684 |
18562-18685 |
sentence |
denotes |
Given the involvement of leptin in regulating body and bone mass, serum leptin was measured in Sam68+/+ and Sam68−/− mice. |
T4685 |
18563-18568 |
VBN |
denotes |
Given |
T4687 |
18569-18572 |
DT |
denotes |
the |
T4688 |
18573-18584 |
NN |
denotes |
involvement |
T4689 |
18585-18587 |
IN |
denotes |
of |
T4690 |
18588-18594 |
NN |
denotes |
leptin |
T4691 |
18595-18597 |
IN |
denotes |
in |
T4692 |
18598-18608 |
VBG |
denotes |
regulating |
T4693 |
18609-18613 |
NN |
denotes |
body |
T4695 |
18614-18617 |
CC |
denotes |
and |
T4696 |
18618-18622 |
NN |
denotes |
bone |
T4694 |
18623-18627 |
NN |
denotes |
mass |
T4697 |
18627-18629 |
, |
denotes |
, |
T4698 |
18629-18634 |
NN |
denotes |
serum |
T4699 |
18635-18641 |
NN |
denotes |
leptin |
T4700 |
18642-18645 |
VBD |
denotes |
was |
T4686 |
18646-18654 |
VBN |
denotes |
measured |
T4701 |
18655-18657 |
IN |
denotes |
in |
T4702 |
18658-18663 |
NN |
denotes |
Sam68 |
T4704 |
18663-18664 |
SYM |
denotes |
+ |
T4705 |
18664-18665 |
HYPH |
denotes |
/ |
T4706 |
18665-18666 |
SYM |
denotes |
+ |
T4707 |
18667-18670 |
CC |
denotes |
and |
T4708 |
18671-18676 |
NN |
denotes |
Sam68 |
T4709 |
18676-18677 |
SYM |
denotes |
− |
T4710 |
18677-18678 |
HYPH |
denotes |
/ |
T4711 |
18678-18679 |
SYM |
denotes |
− |
T4703 |
18680-18684 |
NNS |
denotes |
mice |
T4712 |
18684-18685 |
. |
denotes |
. |
T4713 |
18685-18818 |
sentence |
denotes |
Twelve-month-old Sam68−/− mice had significantly lower levels than young and old Sam68+/+ mice and young Sam68−/− mice (Dataset S3). |
T4714 |
18686-18692 |
CD |
denotes |
Twelve |
T4716 |
18692-18693 |
HYPH |
denotes |
- |
T4715 |
18693-18698 |
NN |
denotes |
month |
T4718 |
18698-18699 |
HYPH |
denotes |
- |
T4717 |
18699-18702 |
JJ |
denotes |
old |
T4720 |
18703-18708 |
NN |
denotes |
Sam68 |
T4721 |
18708-18709 |
SYM |
denotes |
− |
T4722 |
18709-18710 |
HYPH |
denotes |
/ |
T4723 |
18710-18711 |
SYM |
denotes |
− |
T4719 |
18712-18716 |
NNS |
denotes |
mice |
T4724 |
18717-18720 |
VBD |
denotes |
had |
T4725 |
18721-18734 |
RB |
denotes |
significantly |
T4726 |
18735-18740 |
JJR |
denotes |
lower |
T4727 |
18741-18747 |
NNS |
denotes |
levels |
T4728 |
18748-18752 |
IN |
denotes |
than |
T4729 |
18753-18758 |
JJ |
denotes |
young |
T4731 |
18759-18762 |
CC |
denotes |
and |
T4732 |
18763-18766 |
JJ |
denotes |
old |
T4733 |
18767-18772 |
NN |
denotes |
Sam68 |
T4734 |
18772-18773 |
SYM |
denotes |
+ |
T4735 |
18773-18774 |
HYPH |
denotes |
/ |
T4736 |
18774-18775 |
SYM |
denotes |
+ |
T4730 |
18776-18780 |
NNS |
denotes |
mice |
T4737 |
18781-18784 |
CC |
denotes |
and |
T4738 |
18785-18790 |
JJ |
denotes |
young |
T4740 |
18791-18796 |
NN |
denotes |
Sam68 |
T4741 |
18796-18797 |
SYM |
denotes |
− |
T4742 |
18797-18798 |
HYPH |
denotes |
/ |
T4743 |
18798-18799 |
SYM |
denotes |
− |
T4739 |
18800-18804 |
NNS |
denotes |
mice |
T4744 |
18805-18806 |
-LRB- |
denotes |
( |
T4746 |
18806-18813 |
NN |
denotes |
Dataset |
T4745 |
18814-18816 |
NN |
denotes |
S3 |
T4747 |
18816-18817 |
-RRB- |
denotes |
) |
T4748 |
18817-18818 |
. |
denotes |
. |
T4749 |
18818-19040 |
sentence |
denotes |
Taken together, these observations suggested that preservation of bone mass in the Sam68−/− mice was not due primarily to altered estrogen status but could have been influenced by differences in circulating leptin levels. |
T4750 |
18819-18824 |
VBN |
denotes |
Taken |
T4752 |
18825-18833 |
RB |
denotes |
together |
T4753 |
18833-18835 |
, |
denotes |
, |
T4754 |
18835-18840 |
DT |
denotes |
these |
T4755 |
18841-18853 |
NNS |
denotes |
observations |
T4751 |
18854-18863 |
VBD |
denotes |
suggested |
T4756 |
18864-18868 |
IN |
denotes |
that |
T4758 |
18869-18881 |
NN |
denotes |
preservation |
T4759 |
18882-18884 |
IN |
denotes |
of |
T4760 |
18885-18889 |
NN |
denotes |
bone |
T4761 |
18890-18894 |
NN |
denotes |
mass |
T4762 |
18895-18897 |
IN |
denotes |
in |
T4763 |
18898-18901 |
DT |
denotes |
the |
T4765 |
18902-18907 |
NN |
denotes |
Sam68 |
T4766 |
18907-18908 |
SYM |
denotes |
− |
T4767 |
18908-18909 |
HYPH |
denotes |
/ |
T4768 |
18909-18910 |
SYM |
denotes |
− |
T4764 |
18911-18915 |
NNS |
denotes |
mice |
T4757 |
18916-18919 |
VBD |
denotes |
was |
T4769 |
18920-18923 |
RB |
denotes |
not |
T4770 |
18924-18927 |
IN |
denotes |
due |
T4771 |
18928-18937 |
RB |
denotes |
primarily |
T4772 |
18938-18940 |
IN |
denotes |
to |
T4773 |
18941-18948 |
VBN |
denotes |
altered |
T4775 |
18949-18957 |
NN |
denotes |
estrogen |
T4774 |
18958-18964 |
NN |
denotes |
status |
T4776 |
18965-18968 |
CC |
denotes |
but |
T4777 |
18969-18974 |
MD |
denotes |
could |
T4779 |
18975-18979 |
VB |
denotes |
have |
T4780 |
18980-18984 |
VBN |
denotes |
been |
T4778 |
18985-18995 |
VBN |
denotes |
influenced |
T4781 |
18996-18998 |
IN |
denotes |
by |
T4782 |
18999-19010 |
NNS |
denotes |
differences |
T4783 |
19011-19013 |
IN |
denotes |
in |
T4784 |
19014-19025 |
VBG |
denotes |
circulating |
T4786 |
19026-19032 |
NN |
denotes |
leptin |
T4785 |
19033-19039 |
NNS |
denotes |
levels |
T4787 |
19039-19040 |
. |
denotes |
. |
T4956 |
19042-19052 |
NN |
denotes |
Osteoblast |
T4958 |
19052-19054 |
, |
denotes |
, |
T4959 |
19054-19057 |
CC |
denotes |
but |
T4960 |
19058-19061 |
RB |
denotes |
Not |
T4961 |
19062-19072 |
NN |
denotes |
Osteoclast |
T4962 |
19072-19074 |
, |
denotes |
, |
T4957 |
19074-19082 |
NN |
denotes |
Activity |
T4964 |
19083-19085 |
VBZ |
denotes |
Is |
T4963 |
19086-19093 |
VBN |
denotes |
Altered |
T4965 |
19094-19096 |
IN |
denotes |
in |
T4966 |
19097-19102 |
NN |
denotes |
Sam68 |
T4968 |
19102-19103 |
SYM |
denotes |
− |
T4969 |
19103-19104 |
HYPH |
denotes |
/ |
T4970 |
19104-19105 |
SYM |
denotes |
− |
T4967 |
19106-19110 |
NNS |
denotes |
Mice |
T4971 |
19111-19113 |
FW |
denotes |
Ex |
T4972 |
19114-19118 |
FW |
denotes |
Vivo |
T4973 |
19118-19297 |
sentence |
denotes |
Maintenance of bone mass during the adult remodeling cycle is dependent on the coupling of osteoblast to osteoclast activity, such that there is no net gain or loss of bone [49]. |
T4974 |
19119-19130 |
NN |
denotes |
Maintenance |
T4976 |
19131-19133 |
IN |
denotes |
of |
T4977 |
19134-19138 |
NN |
denotes |
bone |
T4978 |
19139-19143 |
NN |
denotes |
mass |
T4979 |
19144-19150 |
IN |
denotes |
during |
T4980 |
19151-19154 |
DT |
denotes |
the |
T4982 |
19155-19160 |
JJ |
denotes |
adult |
T4983 |
19161-19171 |
NN |
denotes |
remodeling |
T4981 |
19172-19177 |
NN |
denotes |
cycle |
T4975 |
19178-19180 |
VBZ |
denotes |
is |
T4984 |
19181-19190 |
JJ |
denotes |
dependent |
T4985 |
19191-19193 |
IN |
denotes |
on |
T4986 |
19194-19197 |
DT |
denotes |
the |
T4987 |
19198-19206 |
NN |
denotes |
coupling |
T4988 |
19207-19209 |
IN |
denotes |
of |
T4989 |
19210-19220 |
NN |
denotes |
osteoblast |
T4990 |
19221-19223 |
IN |
denotes |
to |
T4991 |
19224-19234 |
NN |
denotes |
osteoclast |
T4992 |
19235-19243 |
NN |
denotes |
activity |
T4993 |
19243-19245 |
, |
denotes |
, |
T4994 |
19245-19249 |
JJ |
denotes |
such |
T4996 |
19250-19254 |
IN |
denotes |
that |
T4997 |
19255-19260 |
EX |
denotes |
there |
T4995 |
19261-19263 |
VBZ |
denotes |
is |
T4998 |
19264-19266 |
DT |
denotes |
no |
T5000 |
19267-19270 |
JJ |
denotes |
net |
T4999 |
19271-19275 |
NN |
denotes |
gain |
T5001 |
19276-19278 |
CC |
denotes |
or |
T5002 |
19279-19283 |
NN |
denotes |
loss |
T5003 |
19284-19286 |
IN |
denotes |
of |
T5004 |
19287-19291 |
NN |
denotes |
bone |
T5005 |
19292-19293 |
-LRB- |
denotes |
[ |
T5006 |
19293-19295 |
CD |
denotes |
49 |
T5007 |
19295-19296 |
-RRB- |
denotes |
] |
T5008 |
19296-19297 |
. |
denotes |
. |
T5009 |
19297-19498 |
sentence |
denotes |
To further explore the age-related advantage of Sam68−/− mice with respect to bone preservation, we examined the functional activity of Sam68−/− osteoblasts and osteoclasts ex vivo (Figure 6A and 6B). |
T5010 |
19298-19300 |
TO |
denotes |
To |
T5012 |
19301-19308 |
RB |
denotes |
further |
T5011 |
19309-19316 |
VB |
denotes |
explore |
T5014 |
19317-19320 |
DT |
denotes |
the |
T5016 |
19321-19324 |
NN |
denotes |
age |
T5018 |
19324-19325 |
HYPH |
denotes |
- |
T5017 |
19325-19332 |
VBN |
denotes |
related |
T5015 |
19333-19342 |
NN |
denotes |
advantage |
T5019 |
19343-19345 |
IN |
denotes |
of |
T5020 |
19346-19351 |
NN |
denotes |
Sam68 |
T5022 |
19351-19352 |
SYM |
denotes |
− |
T5023 |
19352-19353 |
HYPH |
denotes |
/ |
T5024 |
19353-19354 |
SYM |
denotes |
− |
T5021 |
19355-19359 |
NNS |
denotes |
mice |
T5025 |
19360-19364 |
IN |
denotes |
with |
T5026 |
19365-19372 |
NN |
denotes |
respect |
T5027 |
19373-19375 |
IN |
denotes |
to |
T5028 |
19376-19380 |
NN |
denotes |
bone |
T5029 |
19381-19393 |
NN |
denotes |
preservation |
T5030 |
19393-19395 |
, |
denotes |
, |
T5031 |
19395-19397 |
PRP |
denotes |
we |
T5013 |
19398-19406 |
VBD |
denotes |
examined |
T5032 |
19407-19410 |
DT |
denotes |
the |
T5034 |
19411-19421 |
JJ |
denotes |
functional |
T5033 |
19422-19430 |
NN |
denotes |
activity |
T5035 |
19431-19433 |
IN |
denotes |
of |
T5036 |
19434-19439 |
NN |
denotes |
Sam68 |
T5037 |
19439-19440 |
SYM |
denotes |
− |
T5038 |
19440-19441 |
HYPH |
denotes |
/ |
T5039 |
19441-19442 |
SYM |
denotes |
− |
T5040 |
19443-19454 |
NNS |
denotes |
osteoblasts |
T5041 |
19455-19458 |
CC |
denotes |
and |
T5042 |
19459-19470 |
NNS |
denotes |
osteoclasts |
T5043 |
19471-19473 |
FW |
denotes |
ex |
T5044 |
19474-19478 |
FW |
denotes |
vivo |
T5045 |
19479-19480 |
-LRB- |
denotes |
( |
T5047 |
19480-19486 |
NN |
denotes |
Figure |
T5046 |
19487-19489 |
NN |
denotes |
6A |
T5048 |
19490-19493 |
CC |
denotes |
and |
T5049 |
19494-19496 |
NN |
denotes |
6B |
T5050 |
19496-19497 |
-RRB- |
denotes |
) |
T5051 |
19497-19498 |
. |
denotes |
. |
T5052 |
19498-19921 |
sentence |
denotes |
Cultures of bone marrow stromal cells harvested from 4-week-old Sam68−/− mice and maintained for 18 days in osteoblast differentiation medium demonstrated more intense staining for ALP at 6 days (unpublished data) and 18 days (Figure 6A), and more mineralized nodules at 18 days, than the Sam68+/+ mice, even though similar amounts of fibroblast colony-forming units (CFU-F) were observed (Figure 6A and unpublished data). |
T5053 |
19499-19507 |
NNS |
denotes |
Cultures |
T5055 |
19508-19510 |
IN |
denotes |
of |
T5056 |
19511-19515 |
NN |
denotes |
bone |
T5057 |
19516-19522 |
NN |
denotes |
marrow |
T5059 |
19523-19530 |
JJ |
denotes |
stromal |
T5058 |
19531-19536 |
NNS |
denotes |
cells |
T5060 |
19537-19546 |
VBN |
denotes |
harvested |
T5061 |
19547-19551 |
IN |
denotes |
from |
T5062 |
19552-19553 |
CD |
denotes |
4 |
T5064 |
19553-19554 |
HYPH |
denotes |
- |
T5063 |
19554-19558 |
NN |
denotes |
week |
T5066 |
19558-19559 |
HYPH |
denotes |
- |
T5065 |
19559-19562 |
JJ |
denotes |
old |
T5068 |
19563-19568 |
NN |
denotes |
Sam68 |
T5069 |
19568-19569 |
SYM |
denotes |
− |
T5070 |
19569-19570 |
HYPH |
denotes |
/ |
T5071 |
19570-19571 |
SYM |
denotes |
− |
T5067 |
19572-19576 |
NNS |
denotes |
mice |
T5072 |
19577-19580 |
CC |
denotes |
and |
T5073 |
19581-19591 |
VBN |
denotes |
maintained |
T5074 |
19592-19595 |
IN |
denotes |
for |
T5075 |
19596-19598 |
CD |
denotes |
18 |
T5076 |
19599-19603 |
NNS |
denotes |
days |
T5077 |
19604-19606 |
IN |
denotes |
in |
T5078 |
19607-19617 |
NN |
denotes |
osteoblast |
T5079 |
19618-19633 |
NN |
denotes |
differentiation |
T5080 |
19634-19640 |
NN |
denotes |
medium |
T5054 |
19641-19653 |
VBD |
denotes |
demonstrated |
T5081 |
19654-19658 |
RBR |
denotes |
more |
T5082 |
19659-19666 |
JJ |
denotes |
intense |
T5083 |
19667-19675 |
NN |
denotes |
staining |
T5084 |
19676-19679 |
IN |
denotes |
for |
T5085 |
19680-19683 |
NN |
denotes |
ALP |
T5086 |
19684-19686 |
IN |
denotes |
at |
T5087 |
19687-19688 |
CD |
denotes |
6 |
T5088 |
19689-19693 |
NNS |
denotes |
days |
T5089 |
19694-19695 |
-LRB- |
denotes |
( |
T5091 |
19695-19706 |
JJ |
denotes |
unpublished |
T5090 |
19707-19711 |
NNS |
denotes |
data |
T5092 |
19711-19712 |
-RRB- |
denotes |
) |
T5093 |
19713-19716 |
CC |
denotes |
and |
T5094 |
19717-19719 |
CD |
denotes |
18 |
T5095 |
19720-19724 |
NNS |
denotes |
days |
T5096 |
19725-19726 |
-LRB- |
denotes |
( |
T5098 |
19726-19732 |
NN |
denotes |
Figure |
T5097 |
19733-19735 |
NN |
denotes |
6A |
T5099 |
19735-19736 |
NN |
denotes |
) |
T5100 |
19736-19738 |
NN |
denotes |
, |
T5101 |
19738-19741 |
CC |
denotes |
and |
T5102 |
19742-19746 |
JJR |
denotes |
more |
T5104 |
19747-19758 |
VBN |
denotes |
mineralized |
T5103 |
19759-19766 |
NNS |
denotes |
nodules |
T5105 |
19767-19769 |
IN |
denotes |
at |
T5106 |
19770-19772 |
CD |
denotes |
18 |
T5107 |
19773-19777 |
NNS |
denotes |
days |
T5108 |
19777-19779 |
NN |
denotes |
, |
T5109 |
19779-19783 |
IN |
denotes |
than |
T5110 |
19784-19787 |
DT |
denotes |
the |
T5112 |
19788-19793 |
NN |
denotes |
Sam68 |
T5113 |
19793-19794 |
SYM |
denotes |
+ |
T5114 |
19794-19795 |
HYPH |
denotes |
/ |
T5115 |
19795-19796 |
SYM |
denotes |
+ |
T5111 |
19797-19801 |
NNS |
denotes |
mice |
T5116 |
19801-19803 |
NN |
denotes |
, |
T5117 |
19803-19807 |
RB |
denotes |
even |
T5119 |
19808-19814 |
IN |
denotes |
though |
T5120 |
19815-19822 |
JJ |
denotes |
similar |
T5121 |
19823-19830 |
NNS |
denotes |
amounts |
T5122 |
19831-19833 |
IN |
denotes |
of |
T5123 |
19834-19844 |
NN |
denotes |
fibroblast |
T5125 |
19845-19851 |
NN |
denotes |
colony |
T5127 |
19851-19852 |
HYPH |
denotes |
- |
T5126 |
19852-19859 |
VBG |
denotes |
forming |
T5124 |
19860-19865 |
NNS |
denotes |
units |
T5128 |
19866-19867 |
-LRB- |
denotes |
( |
T5129 |
19867-19870 |
NN |
denotes |
CFU |
T5131 |
19870-19871 |
HYPH |
denotes |
- |
T5130 |
19871-19872 |
NN |
denotes |
F |
T5132 |
19872-19873 |
-RRB- |
denotes |
) |
T5133 |
19874-19878 |
VBD |
denotes |
were |
T5118 |
19879-19887 |
VBN |
denotes |
observed |
T5134 |
19888-19889 |
-LRB- |
denotes |
( |
T5136 |
19889-19895 |
NN |
denotes |
Figure |
T5135 |
19896-19898 |
NN |
denotes |
6A |
T5137 |
19899-19902 |
CC |
denotes |
and |
T5138 |
19903-19914 |
JJ |
denotes |
unpublished |
T5139 |
19915-19919 |
NNS |
denotes |
data |
T5140 |
19919-19920 |
-RRB- |
denotes |
) |
T5141 |
19920-19921 |
. |
denotes |
. |
T5142 |
19921-20172 |
sentence |
denotes |
RT-PCR analysis of molecular markers of osteoblast differentiation (Dataset S2) revealed similar increases over time in RNA from Sam68+/+ and Sam68−/− mice, although type I collagen appeared to be up-regulated at both timepoints in the Sam68−/− mice. |
T5143 |
19922-19924 |
NN |
denotes |
RT |
T5145 |
19924-19925 |
HYPH |
denotes |
- |
T5144 |
19925-19928 |
NN |
denotes |
PCR |
T5146 |
19929-19937 |
NN |
denotes |
analysis |
T5148 |
19938-19940 |
IN |
denotes |
of |
T5149 |
19941-19950 |
JJ |
denotes |
molecular |
T5150 |
19951-19958 |
NNS |
denotes |
markers |
T5151 |
19959-19961 |
IN |
denotes |
of |
T5152 |
19962-19972 |
NN |
denotes |
osteoblast |
T5153 |
19973-19988 |
NN |
denotes |
differentiation |
T5154 |
19989-19990 |
-LRB- |
denotes |
( |
T5156 |
19990-19997 |
NN |
denotes |
Dataset |
T5155 |
19998-20000 |
NN |
denotes |
S2 |
T5157 |
20000-20001 |
-RRB- |
denotes |
) |
T5147 |
20002-20010 |
VBD |
denotes |
revealed |
T5158 |
20011-20018 |
JJ |
denotes |
similar |
T5159 |
20019-20028 |
NNS |
denotes |
increases |
T5160 |
20029-20033 |
IN |
denotes |
over |
T5161 |
20034-20038 |
NN |
denotes |
time |
T5162 |
20039-20041 |
IN |
denotes |
in |
T5163 |
20042-20045 |
NN |
denotes |
RNA |
T5164 |
20046-20050 |
IN |
denotes |
from |
T5165 |
20051-20056 |
NN |
denotes |
Sam68 |
T5167 |
20056-20057 |
SYM |
denotes |
+ |
T5168 |
20057-20058 |
HYPH |
denotes |
/ |
T5169 |
20058-20059 |
SYM |
denotes |
+ |
T5170 |
20060-20063 |
CC |
denotes |
and |
T5171 |
20064-20069 |
NN |
denotes |
Sam68 |
T5172 |
20069-20070 |
SYM |
denotes |
− |
T5173 |
20070-20071 |
HYPH |
denotes |
/ |
T5174 |
20071-20072 |
SYM |
denotes |
− |
T5166 |
20073-20077 |
NNS |
denotes |
mice |
T5175 |
20077-20079 |
, |
denotes |
, |
T5176 |
20079-20087 |
IN |
denotes |
although |
T5178 |
20088-20092 |
NN |
denotes |
type |
T5180 |
20093-20094 |
CD |
denotes |
I |
T5179 |
20095-20103 |
NN |
denotes |
collagen |
T5177 |
20104-20112 |
VBD |
denotes |
appeared |
T5181 |
20113-20115 |
TO |
denotes |
to |
T5183 |
20116-20118 |
VB |
denotes |
be |
T5184 |
20119-20121 |
RB |
denotes |
up |
T5185 |
20121-20122 |
HYPH |
denotes |
- |
T5182 |
20122-20131 |
VBN |
denotes |
regulated |
T5186 |
20132-20134 |
IN |
denotes |
at |
T5187 |
20135-20139 |
DT |
denotes |
both |
T5188 |
20140-20150 |
NNS |
denotes |
timepoints |
T5189 |
20151-20153 |
IN |
denotes |
in |
T5190 |
20154-20157 |
DT |
denotes |
the |
T5192 |
20158-20163 |
NN |
denotes |
Sam68 |
T5193 |
20163-20164 |
SYM |
denotes |
− |
T5194 |
20164-20165 |
HYPH |
denotes |
/ |
T5195 |
20165-20166 |
SYM |
denotes |
− |
T5191 |
20167-20171 |
NNS |
denotes |
mice |
T5196 |
20171-20172 |
. |
denotes |
. |
T5197 |
20172-20452 |
sentence |
denotes |
Short-term cultures of mature osteoclasts released from the crushed long bones of Sam68+/+ and Sam68−/− mice stained equally well for TRAP and excavated approximately equal numbers of pits of equal size in dentin slices, as visualized by scanning electron microscopy (Figure 6B). |
T5198 |
20173-20178 |
JJ |
denotes |
Short |
T5200 |
20178-20179 |
HYPH |
denotes |
- |
T5199 |
20179-20183 |
NN |
denotes |
term |
T5201 |
20184-20192 |
NNS |
denotes |
cultures |
T5203 |
20193-20195 |
IN |
denotes |
of |
T5204 |
20196-20202 |
JJ |
denotes |
mature |
T5205 |
20203-20214 |
NNS |
denotes |
osteoclasts |
T5206 |
20215-20223 |
VBN |
denotes |
released |
T5207 |
20224-20228 |
IN |
denotes |
from |
T5208 |
20229-20232 |
DT |
denotes |
the |
T5210 |
20233-20240 |
JJ |
denotes |
crushed |
T5211 |
20241-20245 |
JJ |
denotes |
long |
T5209 |
20246-20251 |
NNS |
denotes |
bones |
T5212 |
20252-20254 |
IN |
denotes |
of |
T5213 |
20255-20260 |
NN |
denotes |
Sam68 |
T5215 |
20260-20261 |
SYM |
denotes |
+ |
T5216 |
20261-20262 |
HYPH |
denotes |
/ |
T5217 |
20262-20263 |
SYM |
denotes |
+ |
T5218 |
20264-20267 |
CC |
denotes |
and |
T5219 |
20268-20273 |
NN |
denotes |
Sam68 |
T5220 |
20273-20274 |
SYM |
denotes |
− |
T5221 |
20274-20275 |
HYPH |
denotes |
/ |
T5222 |
20275-20276 |
SYM |
denotes |
− |
T5214 |
20277-20281 |
NNS |
denotes |
mice |
T5202 |
20282-20289 |
VBD |
denotes |
stained |
T5223 |
20290-20297 |
RB |
denotes |
equally |
T5224 |
20298-20302 |
RB |
denotes |
well |
T5225 |
20303-20306 |
IN |
denotes |
for |
T5226 |
20307-20311 |
NN |
denotes |
TRAP |
T5227 |
20312-20315 |
CC |
denotes |
and |
T5228 |
20316-20325 |
VBD |
denotes |
excavated |
T5229 |
20326-20339 |
RB |
denotes |
approximately |
T5230 |
20340-20345 |
JJ |
denotes |
equal |
T5231 |
20346-20353 |
NNS |
denotes |
numbers |
T5232 |
20354-20356 |
IN |
denotes |
of |
T5233 |
20357-20361 |
NNS |
denotes |
pits |
T5234 |
20362-20364 |
IN |
denotes |
of |
T5235 |
20365-20370 |
JJ |
denotes |
equal |
T5236 |
20371-20375 |
NN |
denotes |
size |
T5237 |
20376-20378 |
IN |
denotes |
in |
T5238 |
20379-20385 |
NN |
denotes |
dentin |
T5239 |
20386-20392 |
NNS |
denotes |
slices |
T5240 |
20392-20394 |
, |
denotes |
, |
T5241 |
20394-20396 |
IN |
denotes |
as |
T5242 |
20397-20407 |
VBN |
denotes |
visualized |
T5243 |
20408-20410 |
IN |
denotes |
by |
T5244 |
20411-20419 |
VBG |
denotes |
scanning |
T5245 |
20420-20428 |
NN |
denotes |
electron |
T5246 |
20429-20439 |
NN |
denotes |
microscopy |
T5247 |
20440-20441 |
-LRB- |
denotes |
( |
T5249 |
20441-20447 |
NN |
denotes |
Figure |
T5248 |
20448-20450 |
NN |
denotes |
6B |
T5250 |
20450-20451 |
-RRB- |
denotes |
) |
T5251 |
20451-20452 |
. |
denotes |
. |
T5252 |
20452-20579 |
sentence |
denotes |
These findings suggest that the osteoclasts may not be the primary defect in Sam68−/− mice, as they are in Src null mice [48]. |
T5253 |
20453-20458 |
DT |
denotes |
These |
T5254 |
20459-20467 |
NNS |
denotes |
findings |
T5255 |
20468-20475 |
VBP |
denotes |
suggest |
T5256 |
20476-20480 |
IN |
denotes |
that |
T5258 |
20481-20484 |
DT |
denotes |
the |
T5259 |
20485-20496 |
NNS |
denotes |
osteoclasts |
T5260 |
20497-20500 |
MD |
denotes |
may |
T5261 |
20501-20504 |
RB |
denotes |
not |
T5257 |
20505-20507 |
VB |
denotes |
be |
T5262 |
20508-20511 |
DT |
denotes |
the |
T5264 |
20512-20519 |
JJ |
denotes |
primary |
T5263 |
20520-20526 |
NN |
denotes |
defect |
T5265 |
20527-20529 |
IN |
denotes |
in |
T5266 |
20530-20535 |
NN |
denotes |
Sam68 |
T5268 |
20535-20536 |
SYM |
denotes |
− |
T5269 |
20536-20537 |
HYPH |
denotes |
/ |
T5270 |
20537-20538 |
SYM |
denotes |
− |
T5267 |
20539-20543 |
NNS |
denotes |
mice |
T5271 |
20543-20545 |
, |
denotes |
, |
T5272 |
20545-20547 |
IN |
denotes |
as |
T5274 |
20548-20552 |
PRP |
denotes |
they |
T5273 |
20553-20556 |
VBP |
denotes |
are |
T5275 |
20557-20559 |
IN |
denotes |
in |
T5276 |
20560-20563 |
NN |
denotes |
Src |
T5278 |
20564-20568 |
JJ |
denotes |
null |
T5277 |
20569-20573 |
NNS |
denotes |
mice |
T5279 |
20574-20575 |
-LRB- |
denotes |
[ |
T5280 |
20575-20577 |
CD |
denotes |
48 |
T5281 |
20577-20578 |
-RRB- |
denotes |
] |
T5282 |
20578-20579 |
. |
denotes |
. |
T5689 |
21645-21648 |
DT |
denotes |
The |
T5690 |
21649-21656 |
NN |
denotes |
Absence |
T5692 |
21657-21659 |
IN |
denotes |
of |
T5693 |
21660-21665 |
NN |
denotes |
Sam68 |
T5691 |
21666-21674 |
VBZ |
denotes |
Prevents |
T5694 |
21675-21684 |
NN |
denotes |
Adipocyte |
T5695 |
21685-21700 |
NN |
denotes |
Differentiation |
T5696 |
21701-21704 |
CC |
denotes |
and |
T5697 |
21705-21713 |
VBZ |
denotes |
Promotes |
T5698 |
21714-21724 |
NN |
denotes |
Osteoblast |
T5699 |
21725-21740 |
NN |
denotes |
Differentiation |
T5700 |
21740-21951 |
sentence |
denotes |
It is well recognized that bone marrow stromal cells give rise to both osteoblasts and adipocytes and that age-related bone loss is accompanied by an increase in differentiation down the adipocyte lineage [22]. |
T5701 |
21741-21743 |
PRP |
denotes |
It |
T5703 |
21744-21746 |
VBZ |
denotes |
is |
T5704 |
21747-21751 |
RB |
denotes |
well |
T5702 |
21752-21762 |
VBN |
denotes |
recognized |
T5705 |
21763-21767 |
IN |
denotes |
that |
T5707 |
21768-21772 |
NN |
denotes |
bone |
T5708 |
21773-21779 |
NN |
denotes |
marrow |
T5710 |
21780-21787 |
JJ |
denotes |
stromal |
T5709 |
21788-21793 |
NNS |
denotes |
cells |
T5706 |
21794-21798 |
VBP |
denotes |
give |
T5711 |
21799-21803 |
NN |
denotes |
rise |
T5712 |
21804-21806 |
IN |
denotes |
to |
T5713 |
21807-21811 |
DT |
denotes |
both |
T5714 |
21812-21823 |
NNS |
denotes |
osteoblasts |
T5715 |
21824-21827 |
CC |
denotes |
and |
T5716 |
21828-21838 |
NNS |
denotes |
adipocytes |
T5717 |
21839-21842 |
CC |
denotes |
and |
T5718 |
21843-21847 |
IN |
denotes |
that |
T5720 |
21848-21851 |
NN |
denotes |
age |
T5722 |
21851-21852 |
HYPH |
denotes |
- |
T5721 |
21852-21859 |
VBN |
denotes |
related |
T5724 |
21860-21864 |
NN |
denotes |
bone |
T5723 |
21865-21869 |
NN |
denotes |
loss |
T5725 |
21870-21872 |
VBZ |
denotes |
is |
T5719 |
21873-21884 |
VBN |
denotes |
accompanied |
T5726 |
21885-21887 |
IN |
denotes |
by |
T5727 |
21888-21890 |
DT |
denotes |
an |
T5728 |
21891-21899 |
NN |
denotes |
increase |
T5729 |
21900-21902 |
IN |
denotes |
in |
T5730 |
21903-21918 |
NN |
denotes |
differentiation |
T5731 |
21919-21923 |
IN |
denotes |
down |
T5732 |
21924-21927 |
DT |
denotes |
the |
T5734 |
21928-21937 |
NN |
denotes |
adipocyte |
T5733 |
21938-21945 |
NN |
denotes |
lineage |
T5735 |
21946-21947 |
-LRB- |
denotes |
[ |
T5736 |
21947-21949 |
CD |
denotes |
22 |
T5737 |
21949-21950 |
-RRB- |
denotes |
] |
T5738 |
21950-21951 |
. |
denotes |
. |
T5739 |
21951-22095 |
sentence |
denotes |
Therefore, the loss of Sam68 could influence the bone marrow stromal cells to differentiate along the osteogenic versus the adipogenic pathway. |
T5740 |
21952-21961 |
RB |
denotes |
Therefore |
T5742 |
21961-21963 |
, |
denotes |
, |
T5743 |
21963-21966 |
DT |
denotes |
the |
T5744 |
21967-21971 |
NN |
denotes |
loss |
T5745 |
21972-21974 |
IN |
denotes |
of |
T5746 |
21975-21980 |
NN |
denotes |
Sam68 |
T5747 |
21981-21986 |
MD |
denotes |
could |
T5741 |
21987-21996 |
VB |
denotes |
influence |
T5748 |
21997-22000 |
DT |
denotes |
the |
T5750 |
22001-22005 |
NN |
denotes |
bone |
T5751 |
22006-22012 |
NN |
denotes |
marrow |
T5752 |
22013-22020 |
JJ |
denotes |
stromal |
T5749 |
22021-22026 |
NNS |
denotes |
cells |
T5753 |
22027-22029 |
TO |
denotes |
to |
T5754 |
22030-22043 |
VB |
denotes |
differentiate |
T5755 |
22044-22049 |
IN |
denotes |
along |
T5756 |
22050-22053 |
DT |
denotes |
the |
T5757 |
22054-22064 |
JJ |
denotes |
osteogenic |
T5758 |
22065-22071 |
CC |
denotes |
versus |
T5759 |
22072-22075 |
DT |
denotes |
the |
T5760 |
22076-22086 |
JJ |
denotes |
adipogenic |
T5761 |
22087-22094 |
NN |
denotes |
pathway |
T5762 |
22094-22095 |
. |
denotes |
. |
T5763 |
22095-22329 |
sentence |
denotes |
Alternatively, the loss of Sam68 could indirectly regulate bone mass as a general disturbance of neuroendocrine control as was shown when leptin and the sympathetic nervous system axis were shown to negatively regulate bone mass [8]. |
T5764 |
22096-22109 |
RB |
denotes |
Alternatively |
T5766 |
22109-22111 |
, |
denotes |
, |
T5767 |
22111-22114 |
DT |
denotes |
the |
T5768 |
22115-22119 |
NN |
denotes |
loss |
T5769 |
22120-22122 |
IN |
denotes |
of |
T5770 |
22123-22128 |
NN |
denotes |
Sam68 |
T5771 |
22129-22134 |
MD |
denotes |
could |
T5772 |
22135-22145 |
RB |
denotes |
indirectly |
T5765 |
22146-22154 |
VB |
denotes |
regulate |
T5773 |
22155-22159 |
NN |
denotes |
bone |
T5774 |
22160-22164 |
NN |
denotes |
mass |
T5775 |
22165-22167 |
IN |
denotes |
as |
T5776 |
22168-22169 |
DT |
denotes |
a |
T5778 |
22170-22177 |
JJ |
denotes |
general |
T5777 |
22178-22189 |
NN |
denotes |
disturbance |
T5779 |
22190-22192 |
IN |
denotes |
of |
T5780 |
22193-22207 |
JJ |
denotes |
neuroendocrine |
T5781 |
22208-22215 |
NN |
denotes |
control |
T5782 |
22216-22218 |
IN |
denotes |
as |
T5784 |
22219-22222 |
VBD |
denotes |
was |
T5783 |
22223-22228 |
VBN |
denotes |
shown |
T5785 |
22229-22233 |
WRB |
denotes |
when |
T5787 |
22234-22240 |
NN |
denotes |
leptin |
T5788 |
22241-22244 |
CC |
denotes |
and |
T5789 |
22245-22248 |
DT |
denotes |
the |
T5791 |
22249-22260 |
JJ |
denotes |
sympathetic |
T5792 |
22261-22268 |
JJ |
denotes |
nervous |
T5793 |
22269-22275 |
NN |
denotes |
system |
T5790 |
22276-22280 |
NN |
denotes |
axis |
T5794 |
22281-22285 |
VBD |
denotes |
were |
T5786 |
22286-22291 |
VBN |
denotes |
shown |
T5795 |
22292-22294 |
TO |
denotes |
to |
T5797 |
22295-22305 |
RB |
denotes |
negatively |
T5796 |
22306-22314 |
VB |
denotes |
regulate |
T5798 |
22315-22319 |
NN |
denotes |
bone |
T5799 |
22320-22324 |
NN |
denotes |
mass |
T5800 |
22325-22326 |
-LRB- |
denotes |
[ |
T5801 |
22326-22327 |
CD |
denotes |
8 |
T5802 |
22327-22328 |
-RRB- |
denotes |
] |
T5803 |
22328-22329 |
. |
denotes |
. |
T5804 |
22329-22479 |
sentence |
denotes |
To confirm a role for Sam68 in the regulation of adipocyte differentiation, we isolated primary MEFs from 14.5-day-old Sam68+/+ and Sam68−/− embryos. |
T5805 |
22330-22332 |
TO |
denotes |
To |
T5806 |
22333-22340 |
VB |
denotes |
confirm |
T5808 |
22341-22342 |
DT |
denotes |
a |
T5809 |
22343-22347 |
NN |
denotes |
role |
T5810 |
22348-22351 |
IN |
denotes |
for |
T5811 |
22352-22357 |
NN |
denotes |
Sam68 |
T5812 |
22358-22360 |
IN |
denotes |
in |
T5813 |
22361-22364 |
DT |
denotes |
the |
T5814 |
22365-22375 |
NN |
denotes |
regulation |
T5815 |
22376-22378 |
IN |
denotes |
of |
T5816 |
22379-22388 |
NN |
denotes |
adipocyte |
T5817 |
22389-22404 |
NN |
denotes |
differentiation |
T5818 |
22404-22406 |
, |
denotes |
, |
T5819 |
22406-22408 |
PRP |
denotes |
we |
T5807 |
22409-22417 |
VBD |
denotes |
isolated |
T5820 |
22418-22425 |
JJ |
denotes |
primary |
T5821 |
22426-22430 |
NNS |
denotes |
MEFs |
T5822 |
22431-22435 |
IN |
denotes |
from |
T5823 |
22436-22440 |
CD |
denotes |
14.5 |
T5825 |
22440-22441 |
HYPH |
denotes |
- |
T5824 |
22441-22444 |
NN |
denotes |
day |
T5827 |
22444-22445 |
HYPH |
denotes |
- |
T5826 |
22445-22448 |
JJ |
denotes |
old |
T5829 |
22449-22454 |
NN |
denotes |
Sam68 |
T5830 |
22454-22455 |
SYM |
denotes |
+ |
T5831 |
22455-22456 |
HYPH |
denotes |
/ |
T5832 |
22456-22457 |
SYM |
denotes |
+ |
T5833 |
22458-22461 |
CC |
denotes |
and |
T5834 |
22462-22467 |
NN |
denotes |
Sam68 |
T5835 |
22467-22468 |
SYM |
denotes |
− |
T5836 |
22468-22469 |
HYPH |
denotes |
/ |
T5837 |
22469-22470 |
SYM |
denotes |
− |
T5828 |
22471-22478 |
NNS |
denotes |
embryos |
T5838 |
22478-22479 |
. |
denotes |
. |
T5839 |
22479-22621 |
sentence |
denotes |
The primary Sam68−/− MEFs were differentiated into adipocytes in vitro in culture medium containing 5 μM pioglitazone to induce adipogenesis. |
T5840 |
22480-22483 |
DT |
denotes |
The |
T5842 |
22484-22491 |
JJ |
denotes |
primary |
T5843 |
22492-22497 |
NN |
denotes |
Sam68 |
T5844 |
22497-22498 |
SYM |
denotes |
− |
T5845 |
22498-22499 |
HYPH |
denotes |
/ |
T5846 |
22499-22500 |
SYM |
denotes |
− |
T5841 |
22501-22505 |
NNS |
denotes |
MEFs |
T5848 |
22506-22510 |
VBD |
denotes |
were |
T5847 |
22511-22525 |
VBN |
denotes |
differentiated |
T5849 |
22526-22530 |
IN |
denotes |
into |
T5850 |
22531-22541 |
NNS |
denotes |
adipocytes |
T5851 |
22542-22544 |
FW |
denotes |
in |
T5852 |
22545-22550 |
FW |
denotes |
vitro |
T5853 |
22551-22553 |
IN |
denotes |
in |
T5854 |
22554-22561 |
NN |
denotes |
culture |
T5855 |
22562-22568 |
NN |
denotes |
medium |
T5856 |
22569-22579 |
VBG |
denotes |
containing |
T5857 |
22580-22581 |
CD |
denotes |
5 |
T5858 |
22582-22584 |
NN |
denotes |
μM |
T5859 |
22585-22597 |
NN |
denotes |
pioglitazone |
T5860 |
22598-22600 |
TO |
denotes |
to |
T5861 |
22601-22607 |
VB |
denotes |
induce |
T5862 |
22608-22620 |
NN |
denotes |
adipogenesis |
T5863 |
22620-22621 |
. |
denotes |
. |
T5864 |
22621-22704 |
sentence |
denotes |
Cells at days 0, 4, 6, and 12 were stained with Oil red O to monitor adipogenesis. |
T5865 |
22622-22627 |
NNS |
denotes |
Cells |
T5867 |
22628-22630 |
IN |
denotes |
at |
T5868 |
22631-22635 |
NNS |
denotes |
days |
T5869 |
22636-22637 |
CD |
denotes |
0 |
T5870 |
22637-22639 |
, |
denotes |
, |
T5871 |
22639-22640 |
CD |
denotes |
4 |
T5872 |
22640-22642 |
, |
denotes |
, |
T5873 |
22642-22643 |
CD |
denotes |
6 |
T5874 |
22643-22645 |
, |
denotes |
, |
T5875 |
22645-22648 |
CC |
denotes |
and |
T5876 |
22649-22651 |
CD |
denotes |
12 |
T5877 |
22652-22656 |
VBD |
denotes |
were |
T5866 |
22657-22664 |
VBN |
denotes |
stained |
T5878 |
22665-22669 |
IN |
denotes |
with |
T5879 |
22670-22673 |
NN |
denotes |
Oil |
T5881 |
22674-22677 |
NN |
denotes |
red |
T5880 |
22678-22679 |
NN |
denotes |
O |
T5882 |
22680-22682 |
TO |
denotes |
to |
T5883 |
22683-22690 |
VB |
denotes |
monitor |
T5884 |
22691-22703 |
NN |
denotes |
adipogenesis |
T5885 |
22703-22704 |
. |
denotes |
. |
T5886 |
22704-22890 |
sentence |
denotes |
Adipogenesis was more pronounced in the wild-type MEFs cultures than in the Sam68−/− MEFs, consistent with the positive role of endogenous Sam68 in adipocyte differentiation (Figure 7). |
T5887 |
22705-22717 |
NN |
denotes |
Adipogenesis |
T5888 |
22718-22721 |
VBD |
denotes |
was |
T5889 |
22722-22726 |
RBR |
denotes |
more |
T5890 |
22727-22737 |
JJ |
denotes |
pronounced |
T5891 |
22738-22740 |
IN |
denotes |
in |
T5892 |
22741-22744 |
DT |
denotes |
the |
T5894 |
22745-22749 |
JJ |
denotes |
wild |
T5896 |
22749-22750 |
HYPH |
denotes |
- |
T5895 |
22750-22754 |
NN |
denotes |
type |
T5897 |
22755-22759 |
NNS |
denotes |
MEFs |
T5893 |
22760-22768 |
NNS |
denotes |
cultures |
T5898 |
22769-22773 |
IN |
denotes |
than |
T5899 |
22774-22776 |
IN |
denotes |
in |
T5900 |
22777-22780 |
DT |
denotes |
the |
T5902 |
22781-22786 |
NN |
denotes |
Sam68 |
T5903 |
22786-22787 |
SYM |
denotes |
− |
T5904 |
22787-22788 |
HYPH |
denotes |
/ |
T5905 |
22788-22789 |
SYM |
denotes |
− |
T5901 |
22790-22794 |
NNS |
denotes |
MEFs |
T5906 |
22794-22796 |
, |
denotes |
, |
T5907 |
22796-22806 |
JJ |
denotes |
consistent |
T5908 |
22807-22811 |
IN |
denotes |
with |
T5909 |
22812-22815 |
DT |
denotes |
the |
T5911 |
22816-22824 |
JJ |
denotes |
positive |
T5910 |
22825-22829 |
NN |
denotes |
role |
T5912 |
22830-22832 |
IN |
denotes |
of |
T5913 |
22833-22843 |
JJ |
denotes |
endogenous |
T5914 |
22844-22849 |
NN |
denotes |
Sam68 |
T5915 |
22850-22852 |
IN |
denotes |
in |
T5916 |
22853-22862 |
NN |
denotes |
adipocyte |
T5917 |
22863-22878 |
NN |
denotes |
differentiation |
T5918 |
22879-22880 |
-LRB- |
denotes |
( |
T5919 |
22880-22886 |
NN |
denotes |
Figure |
T5920 |
22887-22888 |
CD |
denotes |
7 |
T5921 |
22888-22889 |
-RRB- |
denotes |
) |
T5922 |
22889-22890 |
. |
denotes |
. |
T5923 |
22890-23111 |
sentence |
denotes |
The expression of key transcription factors including the PPARγ and KLF5 was impaired in Sam68−/− differentiated MEFs compared with Sam68+/+ MEFs, consistent with impaired adipogenesis in the absence of Sam68 (Figure 7). |
T5924 |
22891-22894 |
DT |
denotes |
The |
T5925 |
22895-22905 |
NN |
denotes |
expression |
T5927 |
22906-22908 |
IN |
denotes |
of |
T5928 |
22909-22912 |
JJ |
denotes |
key |
T5930 |
22913-22926 |
NN |
denotes |
transcription |
T5929 |
22927-22934 |
NNS |
denotes |
factors |
T5931 |
22935-22944 |
VBG |
denotes |
including |
T5932 |
22945-22948 |
DT |
denotes |
the |
T5933 |
22949-22954 |
NN |
denotes |
PPARγ |
T5934 |
22955-22958 |
CC |
denotes |
and |
T5935 |
22959-22963 |
NN |
denotes |
KLF5 |
T5936 |
22964-22967 |
VBD |
denotes |
was |
T5926 |
22968-22976 |
VBN |
denotes |
impaired |
T5937 |
22977-22979 |
IN |
denotes |
in |
T5938 |
22980-22985 |
NN |
denotes |
Sam68 |
T5940 |
22985-22986 |
SYM |
denotes |
− |
T5941 |
22986-22987 |
HYPH |
denotes |
/ |
T5942 |
22987-22988 |
SYM |
denotes |
− |
T5943 |
22989-23003 |
VBN |
denotes |
differentiated |
T5939 |
23004-23008 |
NNS |
denotes |
MEFs |
T5944 |
23009-23017 |
VBN |
denotes |
compared |
T5945 |
23018-23022 |
IN |
denotes |
with |
T5946 |
23023-23028 |
NN |
denotes |
Sam68 |
T5948 |
23028-23029 |
SYM |
denotes |
+ |
T5949 |
23029-23030 |
HYPH |
denotes |
/ |
T5950 |
23030-23031 |
SYM |
denotes |
+ |
T5947 |
23032-23036 |
NNS |
denotes |
MEFs |
T5951 |
23036-23038 |
, |
denotes |
, |
T5952 |
23038-23048 |
JJ |
denotes |
consistent |
T5953 |
23049-23053 |
IN |
denotes |
with |
T5954 |
23054-23062 |
VBN |
denotes |
impaired |
T5955 |
23063-23075 |
NN |
denotes |
adipogenesis |
T5956 |
23076-23078 |
IN |
denotes |
in |
T5957 |
23079-23082 |
DT |
denotes |
the |
T5958 |
23083-23090 |
NN |
denotes |
absence |
T5959 |
23091-23093 |
IN |
denotes |
of |
T5960 |
23094-23099 |
NN |
denotes |
Sam68 |
T5961 |
23100-23101 |
-LRB- |
denotes |
( |
T5962 |
23101-23107 |
NN |
denotes |
Figure |
T5963 |
23108-23109 |
CD |
denotes |
7 |
T5964 |
23109-23110 |
-RRB- |
denotes |
) |
T5965 |
23110-23111 |
. |
denotes |
. |
T5966 |
23111-23319 |
sentence |
denotes |
These data, together with data confirming a lean phenotype in Sam68−/− mice (N. Torabi and S. Richard, unpublished data), support the hypothesis that Sam68 modulates the differentiation of mesenchymal cells. |
T5967 |
23112-23117 |
DT |
denotes |
These |
T5968 |
23118-23122 |
NNS |
denotes |
data |
T5970 |
23122-23124 |
, |
denotes |
, |
T5971 |
23124-23132 |
RB |
denotes |
together |
T5972 |
23133-23137 |
IN |
denotes |
with |
T5973 |
23138-23142 |
NNS |
denotes |
data |
T5974 |
23143-23153 |
VBG |
denotes |
confirming |
T5975 |
23154-23155 |
DT |
denotes |
a |
T5977 |
23156-23160 |
JJ |
denotes |
lean |
T5976 |
23161-23170 |
NN |
denotes |
phenotype |
T5978 |
23171-23173 |
IN |
denotes |
in |
T5979 |
23174-23179 |
NN |
denotes |
Sam68 |
T5981 |
23179-23180 |
SYM |
denotes |
− |
T5982 |
23180-23181 |
HYPH |
denotes |
/ |
T5983 |
23181-23182 |
SYM |
denotes |
− |
T5980 |
23183-23187 |
NNS |
denotes |
mice |
T5984 |
23188-23189 |
-LRB- |
denotes |
( |
T5985 |
23189-23191 |
NNP |
denotes |
N. |
T5986 |
23192-23198 |
NNP |
denotes |
Torabi |
T5987 |
23199-23202 |
CC |
denotes |
and |
T5988 |
23203-23205 |
NNP |
denotes |
S. |
T5989 |
23206-23213 |
NNP |
denotes |
Richard |
T5990 |
23213-23215 |
, |
denotes |
, |
T5991 |
23215-23226 |
JJ |
denotes |
unpublished |
T5992 |
23227-23231 |
NNS |
denotes |
data |
T5993 |
23231-23232 |
-RRB- |
denotes |
) |
T5994 |
23232-23234 |
, |
denotes |
, |
T5969 |
23234-23241 |
VBP |
denotes |
support |
T5995 |
23242-23245 |
DT |
denotes |
the |
T5996 |
23246-23256 |
NN |
denotes |
hypothesis |
T5997 |
23257-23261 |
IN |
denotes |
that |
T5999 |
23262-23267 |
NN |
denotes |
Sam68 |
T5998 |
23268-23277 |
VBZ |
denotes |
modulates |
T6000 |
23278-23281 |
DT |
denotes |
the |
T6001 |
23282-23297 |
NN |
denotes |
differentiation |
T6002 |
23298-23300 |
IN |
denotes |
of |
T6003 |
23301-23312 |
JJ |
denotes |
mesenchymal |
T6004 |
23313-23318 |
NNS |
denotes |
cells |
T6005 |
23318-23319 |
. |
denotes |
. |
T6006 |
23319-24385 |
sentence |
denotes |
Figure 7 Ex Vivo Adipogenesis Analysis of Sam68−/− Mouse Embryonic Fibroblasts
MEFs were isolated from mouse embryos at embryonic day 14.5. Equal number of MEFs from Sam68+/+ and Sam68−/− was plated on glass cover slips in 24 well-plates. Adipocyte differentiation was carried out at indicated times by the addition of complete media containing the pioglitazone.
(A) Cultures were fixed in 4% paraformaldehyde and stained with Oil Red O to detect the fat droplets stored in adipocytes and photographed (top). The cell images were magnified ×10 and ×20 as indicated.
(B) RT-PCR was carried out on total cellular RNA isolated after differentiation of the MEFs for day 0, 2, 4, 6, and 12. The DNA fragments were visualized on agarose gels stained with ethidium bromide. The expression of adipogenic markers C/EBPβ, C/EBPδ, PPARα, and KLF5 was examined as well as the expression of controls including Sam68, β-actin, and GAPDH. To further examine this phenotype in a cell autonomous system, we chose the embryonic mesenchymal multipotential progenitor cells C3H10T1/2. |
T6007 |
24245-24247 |
TO |
denotes |
To |
T6009 |
24248-24255 |
RB |
denotes |
further |
T6008 |
24256-24263 |
VB |
denotes |
examine |
T6011 |
24264-24268 |
DT |
denotes |
this |
T6012 |
24269-24278 |
NN |
denotes |
phenotype |
T6013 |
24279-24281 |
IN |
denotes |
in |
T6014 |
24282-24283 |
DT |
denotes |
a |
T6016 |
24284-24288 |
NN |
denotes |
cell |
T6017 |
24289-24299 |
JJ |
denotes |
autonomous |
T6015 |
24300-24306 |
NN |
denotes |
system |
T6018 |
24306-24308 |
, |
denotes |
, |
T6019 |
24308-24310 |
PRP |
denotes |
we |
T6010 |
24311-24316 |
VBD |
denotes |
chose |
T6020 |
24317-24320 |
DT |
denotes |
the |
T6022 |
24321-24330 |
JJ |
denotes |
embryonic |
T6023 |
24331-24342 |
JJ |
denotes |
mesenchymal |
T6024 |
24343-24357 |
JJ |
denotes |
multipotential |
T6025 |
24358-24368 |
NN |
denotes |
progenitor |
T6021 |
24369-24374 |
NNS |
denotes |
cells |
T6026 |
24375-24382 |
NN |
denotes |
C3H10T1 |
T6027 |
24382-24383 |
HYPH |
denotes |
/ |
T6028 |
24383-24384 |
CD |
denotes |
2 |
T6029 |
24384-24385 |
. |
denotes |
. |
T6030 |
24385-24544 |
sentence |
denotes |
The addition of BMP-2 induced osteoblast differentiation, as evidenced by an approximately 400-fold increase in expression of the osteocalcin (OCN) gene [51]. |
T6031 |
24386-24389 |
DT |
denotes |
The |
T6032 |
24390-24398 |
NN |
denotes |
addition |
T6034 |
24399-24401 |
IN |
denotes |
of |
T6035 |
24402-24405 |
NN |
denotes |
BMP |
T6036 |
24405-24406 |
HYPH |
denotes |
- |
T6037 |
24406-24407 |
CD |
denotes |
2 |
T6033 |
24408-24415 |
VBD |
denotes |
induced |
T6038 |
24416-24426 |
NN |
denotes |
osteoblast |
T6039 |
24427-24442 |
NN |
denotes |
differentiation |
T6040 |
24442-24444 |
, |
denotes |
, |
T6041 |
24444-24446 |
IN |
denotes |
as |
T6042 |
24447-24456 |
VBN |
denotes |
evidenced |
T6043 |
24457-24459 |
IN |
denotes |
by |
T6044 |
24460-24462 |
DT |
denotes |
an |
T6046 |
24463-24476 |
RB |
denotes |
approximately |
T6047 |
24477-24485 |
JJ |
denotes |
400-fold |
T6045 |
24486-24494 |
NN |
denotes |
increase |
T6048 |
24495-24497 |
IN |
denotes |
in |
T6049 |
24498-24508 |
NN |
denotes |
expression |
T6050 |
24509-24511 |
IN |
denotes |
of |
T6051 |
24512-24515 |
DT |
denotes |
the |
T6053 |
24516-24527 |
NN |
denotes |
osteocalcin |
T6054 |
24528-24529 |
-LRB- |
denotes |
( |
T6055 |
24529-24532 |
NN |
denotes |
OCN |
T6056 |
24532-24533 |
-RRB- |
denotes |
) |
T6052 |
24534-24538 |
NN |
denotes |
gene |
T6057 |
24539-24540 |
-LRB- |
denotes |
[ |
T6058 |
24540-24542 |
CD |
denotes |
51 |
T6059 |
24542-24543 |
-RRB- |
denotes |
] |
T6060 |
24543-24544 |
. |
denotes |
. |
T6061 |
24544-24726 |
sentence |
denotes |
Populations of C3H10T1/2 cells stably transfected with either pSuper-retro (control) and pSuper-retro harboring a short hairpin against Sam68 (Sam68sh) were selected with puromycin. |
T6062 |
24545-24556 |
NNS |
denotes |
Populations |
T6064 |
24557-24559 |
IN |
denotes |
of |
T6065 |
24560-24567 |
NN |
denotes |
C3H10T1 |
T6067 |
24567-24568 |
HYPH |
denotes |
/ |
T6068 |
24568-24569 |
CD |
denotes |
2 |
T6066 |
24570-24575 |
NNS |
denotes |
cells |
T6069 |
24576-24582 |
RB |
denotes |
stably |
T6070 |
24583-24594 |
VBN |
denotes |
transfected |
T6071 |
24595-24599 |
IN |
denotes |
with |
T6072 |
24600-24606 |
CC |
denotes |
either |
T6074 |
24607-24613 |
NN |
denotes |
pSuper |
T6075 |
24613-24614 |
HYPH |
denotes |
- |
T6073 |
24614-24619 |
NN |
denotes |
retro |
T6076 |
24620-24621 |
-LRB- |
denotes |
( |
T6077 |
24621-24628 |
NN |
denotes |
control |
T6078 |
24628-24629 |
-RRB- |
denotes |
) |
T6079 |
24630-24633 |
CC |
denotes |
and |
T6080 |
24634-24640 |
NN |
denotes |
pSuper |
T6082 |
24640-24641 |
HYPH |
denotes |
- |
T6081 |
24641-24646 |
NN |
denotes |
retro |
T6083 |
24647-24656 |
VBG |
denotes |
harboring |
T6084 |
24657-24658 |
DT |
denotes |
a |
T6086 |
24659-24664 |
JJ |
denotes |
short |
T6085 |
24665-24672 |
NN |
denotes |
hairpin |
T6087 |
24673-24680 |
IN |
denotes |
against |
T6088 |
24681-24686 |
NN |
denotes |
Sam68 |
T6089 |
24687-24688 |
-LRB- |
denotes |
( |
T6090 |
24688-24695 |
NN |
denotes |
Sam68sh |
T6091 |
24695-24696 |
-RRB- |
denotes |
) |
T6092 |
24697-24701 |
VBD |
denotes |
were |
T6063 |
24702-24710 |
VBN |
denotes |
selected |
T6093 |
24711-24715 |
IN |
denotes |
with |
T6094 |
24716-24725 |
NN |
denotes |
puromycin |
T6095 |
24725-24726 |
. |
denotes |
. |
T6096 |
24726-24867 |
sentence |
denotes |
The expression of Sam68 was reduced by approximately 80% as evidenced by immunoblot analyses using β-actin as a loading control (Figure 8A). |
T6097 |
24727-24730 |
DT |
denotes |
The |
T6098 |
24731-24741 |
NN |
denotes |
expression |
T6100 |
24742-24744 |
IN |
denotes |
of |
T6101 |
24745-24750 |
NN |
denotes |
Sam68 |
T6102 |
24751-24754 |
VBD |
denotes |
was |
T6099 |
24755-24762 |
VBN |
denotes |
reduced |
T6103 |
24763-24765 |
IN |
denotes |
by |
T6104 |
24766-24779 |
RB |
denotes |
approximately |
T6105 |
24780-24782 |
CD |
denotes |
80 |
T6106 |
24782-24783 |
NN |
denotes |
% |
T6107 |
24784-24786 |
IN |
denotes |
as |
T6108 |
24787-24796 |
VBN |
denotes |
evidenced |
T6109 |
24797-24799 |
IN |
denotes |
by |
T6110 |
24800-24810 |
NN |
denotes |
immunoblot |
T6111 |
24811-24819 |
NNS |
denotes |
analyses |
T6112 |
24820-24825 |
VBG |
denotes |
using |
T6113 |
24826-24827 |
NN |
denotes |
β |
T6115 |
24827-24828 |
HYPH |
denotes |
- |
T6114 |
24828-24833 |
NN |
denotes |
actin |
T6116 |
24834-24836 |
IN |
denotes |
as |
T6117 |
24837-24838 |
DT |
denotes |
a |
T6119 |
24839-24846 |
NN |
denotes |
loading |
T6118 |
24847-24854 |
NN |
denotes |
control |
T6120 |
24855-24856 |
-LRB- |
denotes |
( |
T6122 |
24856-24862 |
NN |
denotes |
Figure |
T6121 |
24863-24865 |
NN |
denotes |
8A |
T6123 |
24865-24866 |
-RRB- |
denotes |
) |
T6124 |
24866-24867 |
. |
denotes |
. |
T6125 |
24867-25012 |
sentence |
denotes |
Osteoblast differentiation was induced in cultures expressing pSuper-retro or pSuper-retro Sam68sh by addition of BMP-2 to the culture medium. . |
T6126 |
24868-24878 |
NN |
denotes |
Osteoblast |
T6127 |
24879-24894 |
NN |
denotes |
differentiation |
T6129 |
24895-24898 |
VBD |
denotes |
was |
T6128 |
24899-24906 |
VBN |
denotes |
induced |
T6130 |
24907-24909 |
IN |
denotes |
in |
T6131 |
24910-24918 |
NNS |
denotes |
cultures |
T6132 |
24919-24929 |
VBG |
denotes |
expressing |
T6133 |
24930-24936 |
NN |
denotes |
pSuper |
T6135 |
24936-24937 |
HYPH |
denotes |
- |
T6134 |
24937-24942 |
NN |
denotes |
retro |
T6136 |
24943-24945 |
CC |
denotes |
or |
T6137 |
24946-24952 |
NN |
denotes |
pSuper |
T6139 |
24952-24953 |
HYPH |
denotes |
- |
T6138 |
24953-24958 |
NN |
denotes |
retro |
T6140 |
24959-24966 |
NN |
denotes |
Sam68sh |
T6141 |
24967-24969 |
IN |
denotes |
by |
T6142 |
24970-24978 |
NN |
denotes |
addition |
T6143 |
24979-24981 |
IN |
denotes |
of |
T6144 |
24982-24985 |
NN |
denotes |
BMP |
T6145 |
24985-24986 |
HYPH |
denotes |
- |
T6146 |
24986-24987 |
CD |
denotes |
2 |
T6147 |
24988-24990 |
IN |
denotes |
to |
T6148 |
24991-24994 |
DT |
denotes |
the |
T6150 |
24995-25002 |
NN |
denotes |
culture |
T6149 |
25003-25009 |
NN |
denotes |
medium |
T6151 |
25009-25010 |
. |
denotes |
. |
T6152 |
25011-25012 |
. |
denotes |
. |
T6153 |
25012-25253 |
sentence |
denotes |
The expression of OCN and β-actin mRNAs was examined by semiquantitative RT-PCR and the Sam68sh-expressing cells displayed a more pronounced osteoblast phenotype compared with control cells, as assessed by the expression of OCN (Figure 8B). |
T6154 |
25013-25016 |
DT |
denotes |
The |
T6155 |
25017-25027 |
NN |
denotes |
expression |
T6157 |
25028-25030 |
IN |
denotes |
of |
T6158 |
25031-25034 |
NN |
denotes |
OCN |
T6159 |
25035-25038 |
CC |
denotes |
and |
T6160 |
25039-25040 |
NN |
denotes |
β |
T6162 |
25040-25041 |
HYPH |
denotes |
- |
T6161 |
25041-25046 |
NN |
denotes |
actin |
T6163 |
25047-25052 |
NNS |
denotes |
mRNAs |
T6164 |
25053-25056 |
VBD |
denotes |
was |
T6156 |
25057-25065 |
VBN |
denotes |
examined |
T6165 |
25066-25068 |
IN |
denotes |
by |
T6166 |
25069-25085 |
JJ |
denotes |
semiquantitative |
T6168 |
25086-25088 |
NN |
denotes |
RT |
T6169 |
25088-25089 |
HYPH |
denotes |
- |
T6167 |
25089-25092 |
NN |
denotes |
PCR |
T6170 |
25093-25096 |
CC |
denotes |
and |
T6171 |
25097-25100 |
DT |
denotes |
the |
T6173 |
25101-25108 |
NN |
denotes |
Sam68sh |
T6175 |
25108-25109 |
HYPH |
denotes |
- |
T6174 |
25109-25119 |
VBG |
denotes |
expressing |
T6172 |
25120-25125 |
NNS |
denotes |
cells |
T6176 |
25126-25135 |
VBD |
denotes |
displayed |
T6177 |
25136-25137 |
DT |
denotes |
a |
T6179 |
25138-25142 |
RBR |
denotes |
more |
T6180 |
25143-25153 |
JJ |
denotes |
pronounced |
T6181 |
25154-25164 |
NN |
denotes |
osteoblast |
T6178 |
25165-25174 |
NN |
denotes |
phenotype |
T6182 |
25175-25183 |
VBN |
denotes |
compared |
T6183 |
25184-25188 |
IN |
denotes |
with |
T6184 |
25189-25196 |
NN |
denotes |
control |
T6185 |
25197-25202 |
NNS |
denotes |
cells |
T6186 |
25202-25204 |
, |
denotes |
, |
T6187 |
25204-25206 |
IN |
denotes |
as |
T6188 |
25207-25215 |
VBN |
denotes |
assessed |
T6189 |
25216-25218 |
IN |
denotes |
by |
T6190 |
25219-25222 |
DT |
denotes |
the |
T6191 |
25223-25233 |
NN |
denotes |
expression |
T6192 |
25234-25236 |
IN |
denotes |
of |
T6193 |
25237-25240 |
NN |
denotes |
OCN |
T6194 |
25241-25242 |
-LRB- |
denotes |
( |
T6196 |
25242-25248 |
NN |
denotes |
Figure |
T6195 |
25249-25251 |
NN |
denotes |
8B |
T6197 |
25251-25252 |
-RRB- |
denotes |
) |
T6198 |
25252-25253 |
. |
denotes |
. |
T6199 |
25253-26386 |
sentence |
denotes |
Figure 8 Enhanced Osteogenic Differentiation of the C3HT101/2 Embryonic Cell Line Depleted of Endogenous Sam68
(A) C3HT101/2 cells transfected with an empty vector (pSuper-retro) or a vector containing an shRNA (Sam68 shRNA) were selected with puromycin, and knockdown populations depleted of Sam68 were identified. The reduction in Sam68 protein was analyzed by immunoblotting with anti-Sam68 (AD1) antibody and anti–β-actin antibodies as loading controls.
(B) Osteogenic differentiation was carried out with conditioned medium containing BMP-2 for the indicated times. To assess the level of osteogenic differentiation in these cells, expression of late osteoblast marker, osteocalcin (OCN), was analyzed by RT-PCR and compared with β-actin and GAPDH controls. The DNA fragments were visualized by agarose gel stained with ethidium bromide. Given the apparent enhancement of mineralized nodule formation by Sam68−/− bone marrow stromal cells ex vivo and the phenotype observed with short hairpin RNA (shRNA)-treated C3H10T1/2, we stained sections of bone from 4- and 12-month-old mice for evidence of changes in marrow adiposity. |
T6200 |
26098-26103 |
VBN |
denotes |
Given |
T6202 |
26104-26107 |
DT |
denotes |
the |
T6204 |
26108-26116 |
JJ |
denotes |
apparent |
T6203 |
26117-26128 |
NN |
denotes |
enhancement |
T6205 |
26129-26131 |
IN |
denotes |
of |
T6206 |
26132-26143 |
VBN |
denotes |
mineralized |
T6207 |
26144-26150 |
NN |
denotes |
nodule |
T6208 |
26151-26160 |
NN |
denotes |
formation |
T6209 |
26161-26163 |
IN |
denotes |
by |
T6210 |
26164-26169 |
NN |
denotes |
Sam68 |
T6212 |
26169-26170 |
SYM |
denotes |
− |
T6213 |
26170-26171 |
HYPH |
denotes |
/ |
T6214 |
26171-26172 |
SYM |
denotes |
− |
T6215 |
26173-26177 |
NN |
denotes |
bone |
T6216 |
26178-26184 |
NN |
denotes |
marrow |
T6217 |
26185-26192 |
JJ |
denotes |
stromal |
T6211 |
26193-26198 |
NNS |
denotes |
cells |
T6218 |
26199-26201 |
FW |
denotes |
ex |
T6219 |
26202-26206 |
FW |
denotes |
vivo |
T6220 |
26207-26210 |
CC |
denotes |
and |
T6221 |
26211-26214 |
DT |
denotes |
the |
T6222 |
26215-26224 |
NN |
denotes |
phenotype |
T6223 |
26225-26233 |
VBN |
denotes |
observed |
T6224 |
26234-26238 |
IN |
denotes |
with |
T6225 |
26239-26244 |
JJ |
denotes |
short |
T6227 |
26245-26252 |
NN |
denotes |
hairpin |
T6226 |
26253-26256 |
NN |
denotes |
RNA |
T6229 |
26257-26258 |
-LRB- |
denotes |
( |
T6230 |
26258-26263 |
NN |
denotes |
shRNA |
T6231 |
26263-26264 |
-RRB- |
denotes |
) |
T6232 |
26264-26265 |
HYPH |
denotes |
- |
T6228 |
26265-26272 |
VBN |
denotes |
treated |
T6233 |
26273-26280 |
NN |
denotes |
C3H10T1 |
T6234 |
26280-26281 |
HYPH |
denotes |
/ |
T6235 |
26281-26282 |
CD |
denotes |
2 |
T6236 |
26282-26284 |
, |
denotes |
, |
T6237 |
26284-26286 |
PRP |
denotes |
we |
T6201 |
26287-26294 |
VBD |
denotes |
stained |
T6238 |
26295-26303 |
NNS |
denotes |
sections |
T6239 |
26304-26306 |
IN |
denotes |
of |
T6240 |
26307-26311 |
NN |
denotes |
bone |
T6241 |
26312-26316 |
IN |
denotes |
from |
T6242 |
26317-26318 |
CD |
denotes |
4 |
T6244 |
26318-26319 |
HYPH |
denotes |
- |
T6245 |
26320-26323 |
CC |
denotes |
and |
T6246 |
26324-26326 |
CD |
denotes |
12 |
T6247 |
26326-26327 |
HYPH |
denotes |
- |
T6243 |
26327-26332 |
NN |
denotes |
month |
T6249 |
26332-26333 |
HYPH |
denotes |
- |
T6248 |
26333-26336 |
JJ |
denotes |
old |
T6250 |
26337-26341 |
NNS |
denotes |
mice |
T6251 |
26342-26345 |
IN |
denotes |
for |
T6252 |
26346-26354 |
NN |
denotes |
evidence |
T6253 |
26355-26357 |
IN |
denotes |
of |
T6254 |
26358-26365 |
NNS |
denotes |
changes |
T6255 |
26366-26368 |
IN |
denotes |
in |
T6256 |
26369-26375 |
NN |
denotes |
marrow |
T6257 |
26376-26385 |
NN |
denotes |
adiposity |
T6258 |
26385-26386 |
. |
denotes |
. |
T6259 |
26386-26704 |
sentence |
denotes |
Figure 9 shows sections of undecalcified bone from 4- and 12-month-old Sam68+/+ and Sam68−/− mice stained with von Kossa and toluidine blue to show mineralized tissue (Figure 9A, black) and marrow adipocytes (Figure 9B, white) and left unstained to show fluorochrome labeling of the mineralization fronts (Figure 9C). |
T6260 |
26387-26393 |
NN |
denotes |
Figure |
T6262 |
26394-26395 |
CD |
denotes |
9 |
T6261 |
26396-26401 |
VBZ |
denotes |
shows |
T6263 |
26402-26410 |
NNS |
denotes |
sections |
T6264 |
26411-26413 |
IN |
denotes |
of |
T6265 |
26414-26427 |
JJ |
denotes |
undecalcified |
T6266 |
26428-26432 |
NN |
denotes |
bone |
T6267 |
26433-26437 |
IN |
denotes |
from |
T6268 |
26438-26439 |
CD |
denotes |
4 |
T6270 |
26439-26440 |
HYPH |
denotes |
- |
T6271 |
26441-26444 |
CC |
denotes |
and |
T6272 |
26445-26447 |
CD |
denotes |
12 |
T6273 |
26447-26448 |
HYPH |
denotes |
- |
T6269 |
26448-26453 |
NN |
denotes |
month |
T6275 |
26453-26454 |
HYPH |
denotes |
- |
T6274 |
26454-26457 |
JJ |
denotes |
old |
T6277 |
26458-26463 |
NN |
denotes |
Sam68 |
T6278 |
26463-26464 |
SYM |
denotes |
+ |
T6279 |
26464-26465 |
HYPH |
denotes |
/ |
T6280 |
26465-26466 |
SYM |
denotes |
+ |
T6281 |
26467-26470 |
CC |
denotes |
and |
T6282 |
26471-26476 |
NN |
denotes |
Sam68 |
T6283 |
26476-26477 |
SYM |
denotes |
− |
T6284 |
26477-26478 |
HYPH |
denotes |
/ |
T6285 |
26478-26479 |
SYM |
denotes |
− |
T6276 |
26480-26484 |
NNS |
denotes |
mice |
T6286 |
26485-26492 |
VBN |
denotes |
stained |
T6287 |
26493-26497 |
IN |
denotes |
with |
T6288 |
26498-26501 |
NNP |
denotes |
von |
T6289 |
26502-26507 |
NNP |
denotes |
Kossa |
T6290 |
26508-26511 |
CC |
denotes |
and |
T6291 |
26512-26521 |
NN |
denotes |
toluidine |
T6292 |
26522-26526 |
JJ |
denotes |
blue |
T6293 |
26527-26529 |
TO |
denotes |
to |
T6294 |
26530-26534 |
VB |
denotes |
show |
T6295 |
26535-26546 |
VBN |
denotes |
mineralized |
T6296 |
26547-26553 |
NN |
denotes |
tissue |
T6297 |
26554-26555 |
-LRB- |
denotes |
( |
T6299 |
26555-26561 |
NN |
denotes |
Figure |
T6298 |
26562-26564 |
NN |
denotes |
9A |
T6300 |
26564-26566 |
, |
denotes |
, |
T6301 |
26566-26571 |
JJ |
denotes |
black |
T6302 |
26571-26572 |
-RRB- |
denotes |
) |
T6303 |
26573-26576 |
CC |
denotes |
and |
T6304 |
26577-26583 |
NN |
denotes |
marrow |
T6305 |
26584-26594 |
NNS |
denotes |
adipocytes |
T6306 |
26595-26596 |
-LRB- |
denotes |
( |
T6308 |
26596-26602 |
NN |
denotes |
Figure |
T6307 |
26603-26605 |
NN |
denotes |
9B |
T6309 |
26605-26607 |
, |
denotes |
, |
T6310 |
26607-26612 |
JJ |
denotes |
white |
T6311 |
26612-26613 |
-RRB- |
denotes |
) |
T6312 |
26614-26617 |
CC |
denotes |
and |
T6313 |
26618-26622 |
VBD |
denotes |
left |
T6314 |
26623-26632 |
JJ |
denotes |
unstained |
T6315 |
26633-26635 |
TO |
denotes |
to |
T6316 |
26636-26640 |
VB |
denotes |
show |
T6317 |
26641-26653 |
NN |
denotes |
fluorochrome |
T6318 |
26654-26662 |
NN |
denotes |
labeling |
T6319 |
26663-26665 |
IN |
denotes |
of |
T6320 |
26666-26669 |
DT |
denotes |
the |
T6322 |
26670-26684 |
NN |
denotes |
mineralization |
T6321 |
26685-26691 |
NNS |
denotes |
fronts |
T6323 |
26692-26693 |
-LRB- |
denotes |
( |
T6325 |
26693-26699 |
NN |
denotes |
Figure |
T6324 |
26700-26702 |
NN |
denotes |
9C |
T6326 |
26702-26703 |
-RRB- |
denotes |
) |
T6327 |
26703-26704 |
. |
denotes |
. |
T6328 |
26704-26957 |
sentence |
denotes |
Twelve-month-old Sam68+/+ mice showed a noticeable decrease in trabecular bone (Figure 9A), which was associated with a significant increase in marrow adiposity (Figure 9B) and with the two fluorochrome labels superimposed upon one another (Figure 9C). |
T6329 |
26705-26711 |
CD |
denotes |
Twelve |
T6331 |
26711-26712 |
HYPH |
denotes |
- |
T6330 |
26712-26717 |
NN |
denotes |
month |
T6333 |
26717-26718 |
HYPH |
denotes |
- |
T6332 |
26718-26721 |
JJ |
denotes |
old |
T6335 |
26722-26727 |
NN |
denotes |
Sam68 |
T6336 |
26727-26728 |
SYM |
denotes |
+ |
T6337 |
26728-26729 |
HYPH |
denotes |
/ |
T6338 |
26729-26730 |
SYM |
denotes |
+ |
T6334 |
26731-26735 |
NNS |
denotes |
mice |
T6339 |
26736-26742 |
VBD |
denotes |
showed |
T6340 |
26743-26744 |
DT |
denotes |
a |
T6342 |
26745-26755 |
JJ |
denotes |
noticeable |
T6341 |
26756-26764 |
NN |
denotes |
decrease |
T6343 |
26765-26767 |
IN |
denotes |
in |
T6344 |
26768-26778 |
JJ |
denotes |
trabecular |
T6345 |
26779-26783 |
NN |
denotes |
bone |
T6346 |
26784-26785 |
-LRB- |
denotes |
( |
T6348 |
26785-26791 |
NN |
denotes |
Figure |
T6347 |
26792-26794 |
NN |
denotes |
9A |
T6349 |
26794-26795 |
-RRB- |
denotes |
) |
T6350 |
26795-26797 |
, |
denotes |
, |
T6351 |
26797-26802 |
WDT |
denotes |
which |
T6353 |
26803-26806 |
VBD |
denotes |
was |
T6352 |
26807-26817 |
VBN |
denotes |
associated |
T6354 |
26818-26822 |
IN |
denotes |
with |
T6355 |
26823-26824 |
DT |
denotes |
a |
T6357 |
26825-26836 |
JJ |
denotes |
significant |
T6356 |
26837-26845 |
NN |
denotes |
increase |
T6358 |
26846-26848 |
IN |
denotes |
in |
T6359 |
26849-26855 |
NN |
denotes |
marrow |
T6360 |
26856-26865 |
NN |
denotes |
adiposity |
T6361 |
26866-26867 |
-LRB- |
denotes |
( |
T6363 |
26867-26873 |
NN |
denotes |
Figure |
T6362 |
26874-26876 |
NN |
denotes |
9B |
T6364 |
26876-26877 |
-RRB- |
denotes |
) |
T6365 |
26878-26881 |
CC |
denotes |
and |
T6366 |
26882-26886 |
IN |
denotes |
with |
T6367 |
26887-26890 |
DT |
denotes |
the |
T6369 |
26891-26894 |
CD |
denotes |
two |
T6370 |
26895-26907 |
NN |
denotes |
fluorochrome |
T6368 |
26908-26914 |
NNS |
denotes |
labels |
T6371 |
26915-26927 |
VBN |
denotes |
superimposed |
T6372 |
26928-26932 |
IN |
denotes |
upon |
T6373 |
26933-26936 |
CD |
denotes |
one |
T6374 |
26937-26944 |
DT |
denotes |
another |
T6375 |
26945-26946 |
-LRB- |
denotes |
( |
T6377 |
26946-26952 |
NN |
denotes |
Figure |
T6376 |
26953-26955 |
NN |
denotes |
9C |
T6378 |
26955-26956 |
-RRB- |
denotes |
) |
T6379 |
26956-26957 |
. |
denotes |
. |
T6380 |
26957-27080 |
sentence |
denotes |
In contrast, the bones of 12-month-old Sam68−/− mice appeared similar to those of the 4-month-old mice of either genotype. |
T6381 |
26958-26960 |
IN |
denotes |
In |
T6383 |
26961-26969 |
NN |
denotes |
contrast |
T6384 |
26969-26971 |
, |
denotes |
, |
T6385 |
26971-26974 |
DT |
denotes |
the |
T6386 |
26975-26980 |
NNS |
denotes |
bones |
T6387 |
26981-26983 |
IN |
denotes |
of |
T6388 |
26984-26986 |
CD |
denotes |
12 |
T6390 |
26986-26987 |
HYPH |
denotes |
- |
T6389 |
26987-26992 |
NN |
denotes |
month |
T6392 |
26992-26993 |
HYPH |
denotes |
- |
T6391 |
26993-26996 |
JJ |
denotes |
old |
T6394 |
26997-27002 |
NN |
denotes |
Sam68 |
T6395 |
27002-27003 |
SYM |
denotes |
− |
T6396 |
27003-27004 |
HYPH |
denotes |
/ |
T6397 |
27004-27005 |
SYM |
denotes |
− |
T6393 |
27006-27010 |
NNS |
denotes |
mice |
T6382 |
27011-27019 |
VBD |
denotes |
appeared |
T6398 |
27020-27027 |
JJ |
denotes |
similar |
T6399 |
27028-27030 |
IN |
denotes |
to |
T6400 |
27031-27036 |
DT |
denotes |
those |
T6401 |
27037-27039 |
IN |
denotes |
of |
T6402 |
27040-27043 |
DT |
denotes |
the |
T6404 |
27044-27045 |
CD |
denotes |
4 |
T6406 |
27045-27046 |
HYPH |
denotes |
- |
T6405 |
27046-27051 |
NN |
denotes |
month |
T6408 |
27051-27052 |
HYPH |
denotes |
- |
T6407 |
27052-27055 |
JJ |
denotes |
old |
T6403 |
27056-27060 |
NNS |
denotes |
mice |
T6409 |
27061-27063 |
IN |
denotes |
of |
T6410 |
27064-27070 |
DT |
denotes |
either |
T6411 |
27071-27079 |
NN |
denotes |
genotype |
T6412 |
27079-27080 |
. |
denotes |
. |
T6413 |
27080-27268 |
sentence |
denotes |
These data demonstrate that Sam68 regulates the differentiation of bone marrow mesenchymal cells to promote adipocyte differentiation and inhibit osteoblast differentiation in aging bone. |
T6414 |
27081-27086 |
DT |
denotes |
These |
T6415 |
27087-27091 |
NNS |
denotes |
data |
T6416 |
27092-27103 |
VBP |
denotes |
demonstrate |
T6417 |
27104-27108 |
IN |
denotes |
that |
T6419 |
27109-27114 |
NN |
denotes |
Sam68 |
T6418 |
27115-27124 |
VBZ |
denotes |
regulates |
T6420 |
27125-27128 |
DT |
denotes |
the |
T6421 |
27129-27144 |
NN |
denotes |
differentiation |
T6422 |
27145-27147 |
IN |
denotes |
of |
T6423 |
27148-27152 |
NN |
denotes |
bone |
T6424 |
27153-27159 |
NN |
denotes |
marrow |
T6426 |
27160-27171 |
JJ |
denotes |
mesenchymal |
T6425 |
27172-27177 |
NNS |
denotes |
cells |
T6427 |
27178-27180 |
TO |
denotes |
to |
T6428 |
27181-27188 |
VB |
denotes |
promote |
T6429 |
27189-27198 |
NN |
denotes |
adipocyte |
T6430 |
27199-27214 |
NN |
denotes |
differentiation |
T6431 |
27215-27218 |
CC |
denotes |
and |
T6432 |
27219-27226 |
VB |
denotes |
inhibit |
T6433 |
27227-27237 |
NN |
denotes |
osteoblast |
T6434 |
27238-27253 |
NN |
denotes |
differentiation |
T6435 |
27254-27256 |
IN |
denotes |
in |
T6436 |
27257-27262 |
VBG |
denotes |
aging |
T6437 |
27263-27267 |
NN |
denotes |
bone |
T6438 |
27267-27268 |
. |
denotes |
. |
T7333 |
27953-27956 |
DT |
denotes |
The |
T7335 |
27957-27964 |
JJ |
denotes |
present |
T7334 |
27965-27970 |
NN |
denotes |
study |
T7336 |
27971-27979 |
VBZ |
denotes |
provides |
T7337 |
27980-27988 |
NN |
denotes |
evidence |
T7338 |
27989-27993 |
IN |
denotes |
that |
T7340 |
27994-27995 |
DT |
denotes |
a |
T7342 |
27996-28007 |
JJ |
denotes |
physiologic |
T7341 |
28008-28012 |
NN |
denotes |
role |
T7343 |
28013-28015 |
IN |
denotes |
of |
T7344 |
28016-28021 |
NN |
denotes |
Sam68 |
T7339 |
28022-28024 |
VBZ |
denotes |
is |
T7345 |
28025-28027 |
TO |
denotes |
to |
T7346 |
28028-28036 |
VB |
denotes |
modulate |
T7347 |
28037-28041 |
NN |
denotes |
bone |
T7348 |
28042-28048 |
NN |
denotes |
marrow |
T7350 |
28049-28060 |
JJ |
denotes |
mesenchymal |
T7351 |
28061-28065 |
NN |
denotes |
stem |
T7349 |
28066-28071 |
NNS |
denotes |
cells |
T7352 |
28071-28072 |
. |
denotes |
. |
T7353 |
28072-28180 |
sentence |
denotes |
Young Sam68−/− mice developed normally and contained similar bone mass compared with wild-type littermates. |
T7354 |
28073-28078 |
JJ |
denotes |
Young |
T7356 |
28079-28084 |
NN |
denotes |
Sam68 |
T7357 |
28084-28085 |
SYM |
denotes |
− |
T7358 |
28085-28086 |
HYPH |
denotes |
/ |
T7359 |
28086-28087 |
SYM |
denotes |
− |
T7355 |
28088-28092 |
NNS |
denotes |
mice |
T7360 |
28093-28102 |
VBD |
denotes |
developed |
T7361 |
28103-28111 |
RB |
denotes |
normally |
T7362 |
28112-28115 |
CC |
denotes |
and |
T7363 |
28116-28125 |
VBD |
denotes |
contained |
T7364 |
28126-28133 |
JJ |
denotes |
similar |
T7366 |
28134-28138 |
NN |
denotes |
bone |
T7365 |
28139-28143 |
NN |
denotes |
mass |
T7367 |
28144-28152 |
VBN |
denotes |
compared |
T7368 |
28153-28157 |
IN |
denotes |
with |
T7369 |
28158-28162 |
JJ |
denotes |
wild |
T7371 |
28162-28163 |
HYPH |
denotes |
- |
T7370 |
28163-28167 |
NN |
denotes |
type |
T7372 |
28168-28179 |
NNS |
denotes |
littermates |
T7373 |
28179-28180 |
. |
denotes |
. |
T7374 |
28180-28284 |
sentence |
denotes |
Aged (12 months) Sam68−/− mice displayed a high bone mass phenotype compared with Sam68+/+ littermates. |
T7375 |
28181-28185 |
VBN |
denotes |
Aged |
T7377 |
28186-28187 |
-LRB- |
denotes |
( |
T7379 |
28187-28189 |
CD |
denotes |
12 |
T7378 |
28190-28196 |
NNS |
denotes |
months |
T7380 |
28196-28197 |
-RRB- |
denotes |
) |
T7381 |
28198-28203 |
NN |
denotes |
Sam68 |
T7382 |
28203-28204 |
SYM |
denotes |
− |
T7383 |
28204-28205 |
HYPH |
denotes |
/ |
T7384 |
28205-28206 |
SYM |
denotes |
− |
T7376 |
28207-28211 |
NNS |
denotes |
mice |
T7385 |
28212-28221 |
VBD |
denotes |
displayed |
T7386 |
28222-28223 |
DT |
denotes |
a |
T7388 |
28224-28228 |
JJ |
denotes |
high |
T7390 |
28229-28233 |
NN |
denotes |
bone |
T7389 |
28234-28238 |
NN |
denotes |
mass |
T7387 |
28239-28248 |
NN |
denotes |
phenotype |
T7391 |
28249-28257 |
VBN |
denotes |
compared |
T7392 |
28258-28262 |
IN |
denotes |
with |
T7393 |
28263-28268 |
NN |
denotes |
Sam68 |
T7395 |
28268-28269 |
SYM |
denotes |
+ |
T7396 |
28269-28270 |
HYPH |
denotes |
/ |
T7397 |
28270-28271 |
SYM |
denotes |
+ |
T7394 |
28272-28283 |
NNS |
denotes |
littermates |
T7398 |
28283-28284 |
. |
denotes |
. |
T7399 |
28284-28441 |
sentence |
denotes |
The wild-type littermates underwent age-related bone loss that occurs naturally in mammals, while the Sam68−/− animals preserved their bone mass with aging. |
T7400 |
28285-28288 |
DT |
denotes |
The |
T7402 |
28289-28293 |
JJ |
denotes |
wild |
T7404 |
28293-28294 |
HYPH |
denotes |
- |
T7403 |
28294-28298 |
NN |
denotes |
type |
T7401 |
28299-28310 |
NNS |
denotes |
littermates |
T7405 |
28311-28320 |
VBD |
denotes |
underwent |
T7406 |
28321-28324 |
NN |
denotes |
age |
T7408 |
28324-28325 |
HYPH |
denotes |
- |
T7407 |
28325-28332 |
VBN |
denotes |
related |
T7410 |
28333-28337 |
NN |
denotes |
bone |
T7409 |
28338-28342 |
NN |
denotes |
loss |
T7411 |
28343-28347 |
WDT |
denotes |
that |
T7412 |
28348-28354 |
VBZ |
denotes |
occurs |
T7413 |
28355-28364 |
RB |
denotes |
naturally |
T7414 |
28365-28367 |
IN |
denotes |
in |
T7415 |
28368-28375 |
NNS |
denotes |
mammals |
T7416 |
28375-28377 |
, |
denotes |
, |
T7417 |
28377-28382 |
IN |
denotes |
while |
T7419 |
28383-28386 |
DT |
denotes |
the |
T7421 |
28387-28392 |
NN |
denotes |
Sam68 |
T7422 |
28392-28393 |
SYM |
denotes |
− |
T7423 |
28393-28394 |
HYPH |
denotes |
/ |
T7424 |
28394-28395 |
SYM |
denotes |
− |
T7420 |
28396-28403 |
NNS |
denotes |
animals |
T7418 |
28404-28413 |
VBD |
denotes |
preserved |
T7425 |
28414-28419 |
PRP$ |
denotes |
their |
T7427 |
28420-28424 |
NN |
denotes |
bone |
T7426 |
28425-28429 |
NN |
denotes |
mass |
T7428 |
28430-28434 |
IN |
denotes |
with |
T7429 |
28435-28440 |
NN |
denotes |
aging |
T7430 |
28440-28441 |
. |
denotes |
. |
T7431 |
28441-28666 |
sentence |
denotes |
The differentiation of bone marrow stem cells isolated from Sam68−/− mice and embryonic mesenchymal multipotential progenitor cells C3H10T1/2 treated with Sam68 shRNA resulted in a more pronounced osteoblast differentiation. |
T7432 |
28442-28445 |
DT |
denotes |
The |
T7433 |
28446-28461 |
NN |
denotes |
differentiation |
T7435 |
28462-28464 |
IN |
denotes |
of |
T7436 |
28465-28469 |
NN |
denotes |
bone |
T7437 |
28470-28476 |
NN |
denotes |
marrow |
T7439 |
28477-28481 |
NN |
denotes |
stem |
T7438 |
28482-28487 |
NNS |
denotes |
cells |
T7440 |
28488-28496 |
VBN |
denotes |
isolated |
T7441 |
28497-28501 |
IN |
denotes |
from |
T7442 |
28502-28507 |
NN |
denotes |
Sam68 |
T7444 |
28507-28508 |
SYM |
denotes |
− |
T7445 |
28508-28509 |
HYPH |
denotes |
/ |
T7446 |
28509-28510 |
SYM |
denotes |
− |
T7443 |
28511-28515 |
NNS |
denotes |
mice |
T7447 |
28516-28519 |
CC |
denotes |
and |
T7448 |
28520-28529 |
JJ |
denotes |
embryonic |
T7450 |
28530-28541 |
JJ |
denotes |
mesenchymal |
T7451 |
28542-28556 |
JJ |
denotes |
multipotential |
T7452 |
28557-28567 |
NN |
denotes |
progenitor |
T7449 |
28568-28573 |
NNS |
denotes |
cells |
T7453 |
28574-28581 |
NN |
denotes |
C3H10T1 |
T7454 |
28581-28582 |
HYPH |
denotes |
/ |
T7455 |
28582-28583 |
CD |
denotes |
2 |
T7456 |
28584-28591 |
VBN |
denotes |
treated |
T7457 |
28592-28596 |
IN |
denotes |
with |
T7458 |
28597-28602 |
NN |
denotes |
Sam68 |
T7459 |
28603-28608 |
NN |
denotes |
shRNA |
T7434 |
28609-28617 |
VBD |
denotes |
resulted |
T7460 |
28618-28620 |
IN |
denotes |
in |
T7461 |
28621-28622 |
DT |
denotes |
a |
T7463 |
28623-28627 |
RBR |
denotes |
more |
T7464 |
28628-28638 |
JJ |
denotes |
pronounced |
T7465 |
28639-28649 |
NN |
denotes |
osteoblast |
T7462 |
28650-28665 |
NN |
denotes |
differentiation |
T7466 |
28665-28666 |
. |
denotes |
. |
T7467 |
28666-28753 |
sentence |
denotes |
These findings demonstrate that the loss of Sam68 enhances osteoblast differentiation. |
T7468 |
28667-28672 |
DT |
denotes |
These |
T7469 |
28673-28681 |
NNS |
denotes |
findings |
T7470 |
28682-28693 |
VBP |
denotes |
demonstrate |
T7471 |
28694-28698 |
IN |
denotes |
that |
T7473 |
28699-28702 |
DT |
denotes |
the |
T7474 |
28703-28707 |
NN |
denotes |
loss |
T7475 |
28708-28710 |
IN |
denotes |
of |
T7476 |
28711-28716 |
NN |
denotes |
Sam68 |
T7472 |
28717-28725 |
VBZ |
denotes |
enhances |
T7477 |
28726-28736 |
NN |
denotes |
osteoblast |
T7478 |
28737-28752 |
NN |
denotes |
differentiation |
T7479 |
28752-28753 |
. |
denotes |
. |
T7480 |
28753-28917 |
sentence |
denotes |
The converse was also true, as MEFs isolated from Sam68−/− animals were impaired in their ability to undergo adipocyte differentiation compared with Sam68+/+ MEFs. |
T7481 |
28754-28757 |
DT |
denotes |
The |
T7482 |
28758-28766 |
NN |
denotes |
converse |
T7483 |
28767-28770 |
VBD |
denotes |
was |
T7484 |
28771-28775 |
RB |
denotes |
also |
T7485 |
28776-28780 |
JJ |
denotes |
true |
T7486 |
28780-28782 |
, |
denotes |
, |
T7487 |
28782-28784 |
IN |
denotes |
as |
T7489 |
28785-28789 |
NNS |
denotes |
MEFs |
T7490 |
28790-28798 |
VBN |
denotes |
isolated |
T7491 |
28799-28803 |
IN |
denotes |
from |
T7492 |
28804-28809 |
NN |
denotes |
Sam68 |
T7494 |
28809-28810 |
SYM |
denotes |
− |
T7495 |
28810-28811 |
HYPH |
denotes |
/ |
T7496 |
28811-28812 |
SYM |
denotes |
− |
T7493 |
28813-28820 |
NNS |
denotes |
animals |
T7497 |
28821-28825 |
VBD |
denotes |
were |
T7488 |
28826-28834 |
VBN |
denotes |
impaired |
T7498 |
28835-28837 |
IN |
denotes |
in |
T7499 |
28838-28843 |
PRP$ |
denotes |
their |
T7500 |
28844-28851 |
NN |
denotes |
ability |
T7501 |
28852-28854 |
TO |
denotes |
to |
T7502 |
28855-28862 |
VB |
denotes |
undergo |
T7503 |
28863-28872 |
NN |
denotes |
adipocyte |
T7504 |
28873-28888 |
NN |
denotes |
differentiation |
T7505 |
28889-28897 |
VBN |
denotes |
compared |
T7506 |
28898-28902 |
IN |
denotes |
with |
T7507 |
28903-28908 |
NN |
denotes |
Sam68 |
T7509 |
28908-28909 |
SYM |
denotes |
+ |
T7510 |
28909-28910 |
HYPH |
denotes |
/ |
T7511 |
28910-28911 |
SYM |
denotes |
+ |
T7508 |
28912-28916 |
NNS |
denotes |
MEFs |
T7512 |
28916-28917 |
. |
denotes |
. |
T7513 |
28917-29083 |
sentence |
denotes |
These findings suggest that a physiologic role for Sam68 is to regulate the balance between adipogenic and osteogenic differentiation of the bone marrow mesenchymal. |
T7514 |
28918-28923 |
DT |
denotes |
These |
T7515 |
28924-28932 |
NNS |
denotes |
findings |
T7516 |
28933-28940 |
VBP |
denotes |
suggest |
T7517 |
28941-28945 |
IN |
denotes |
that |
T7519 |
28946-28947 |
DT |
denotes |
a |
T7521 |
28948-28959 |
JJ |
denotes |
physiologic |
T7520 |
28960-28964 |
NN |
denotes |
role |
T7522 |
28965-28968 |
IN |
denotes |
for |
T7523 |
28969-28974 |
NN |
denotes |
Sam68 |
T7518 |
28975-28977 |
VBZ |
denotes |
is |
T7524 |
28978-28980 |
TO |
denotes |
to |
T7525 |
28981-28989 |
VB |
denotes |
regulate |
T7526 |
28990-28993 |
DT |
denotes |
the |
T7527 |
28994-29001 |
NN |
denotes |
balance |
T7528 |
29002-29009 |
IN |
denotes |
between |
T7529 |
29010-29020 |
JJ |
denotes |
adipogenic |
T7531 |
29021-29024 |
CC |
denotes |
and |
T7532 |
29025-29035 |
JJ |
denotes |
osteogenic |
T7530 |
29036-29051 |
NN |
denotes |
differentiation |
T7533 |
29052-29054 |
IN |
denotes |
of |
T7534 |
29055-29058 |
DT |
denotes |
the |
T7536 |
29059-29063 |
NN |
denotes |
bone |
T7535 |
29064-29070 |
NN |
denotes |
marrow |
T7537 |
29071-29082 |
JJ |
denotes |
mesenchymal |
T7538 |
29082-29083 |
. |
denotes |
. |
T7539 |
29083-29254 |
sentence |
denotes |
Sam68 protein expression was observed throughout the developing mouse embryo, in keeping with previous reports that identified the Sam68 mRNA to be widely expressed [38]. |
T7540 |
29084-29089 |
NN |
denotes |
Sam68 |
T7542 |
29090-29097 |
NN |
denotes |
protein |
T7541 |
29098-29108 |
NN |
denotes |
expression |
T7544 |
29109-29112 |
VBD |
denotes |
was |
T7543 |
29113-29121 |
VBN |
denotes |
observed |
T7545 |
29122-29132 |
IN |
denotes |
throughout |
T7546 |
29133-29136 |
DT |
denotes |
the |
T7548 |
29137-29147 |
VBG |
denotes |
developing |
T7549 |
29148-29153 |
NN |
denotes |
mouse |
T7547 |
29154-29160 |
NN |
denotes |
embryo |
T7550 |
29160-29162 |
, |
denotes |
, |
T7551 |
29162-29164 |
IN |
denotes |
in |
T7552 |
29165-29172 |
VBG |
denotes |
keeping |
T7553 |
29173-29177 |
IN |
denotes |
with |
T7554 |
29178-29186 |
JJ |
denotes |
previous |
T7555 |
29187-29194 |
NNS |
denotes |
reports |
T7556 |
29195-29199 |
WDT |
denotes |
that |
T7557 |
29200-29210 |
VBD |
denotes |
identified |
T7558 |
29211-29214 |
DT |
denotes |
the |
T7560 |
29215-29220 |
NN |
denotes |
Sam68 |
T7559 |
29221-29225 |
NN |
denotes |
mRNA |
T7562 |
29226-29228 |
TO |
denotes |
to |
T7563 |
29229-29231 |
VB |
denotes |
be |
T7564 |
29232-29238 |
RB |
denotes |
widely |
T7561 |
29239-29248 |
VBN |
denotes |
expressed |
T7565 |
29249-29250 |
-LRB- |
denotes |
[ |
T7566 |
29250-29252 |
CD |
denotes |
38 |
T7567 |
29252-29253 |
-RRB- |
denotes |
] |
T7568 |
29253-29254 |
. |
denotes |
. |
T7569 |
29254-29407 |
sentence |
denotes |
We observe Sam68 staining in the brain, heart, and intestine (see Figure 1) as well as liver, skin, and kidney (unpublished data) of late-stage embryos. |
T7570 |
29255-29257 |
PRP |
denotes |
We |
T7571 |
29258-29265 |
VBP |
denotes |
observe |
T7572 |
29266-29271 |
NN |
denotes |
Sam68 |
T7573 |
29272-29280 |
NN |
denotes |
staining |
T7574 |
29281-29283 |
IN |
denotes |
in |
T7575 |
29284-29287 |
DT |
denotes |
the |
T7576 |
29288-29293 |
NN |
denotes |
brain |
T7577 |
29293-29295 |
, |
denotes |
, |
T7578 |
29295-29300 |
NN |
denotes |
heart |
T7579 |
29300-29302 |
, |
denotes |
, |
T7580 |
29302-29305 |
CC |
denotes |
and |
T7581 |
29306-29315 |
NN |
denotes |
intestine |
T7582 |
29316-29317 |
-LRB- |
denotes |
( |
T7583 |
29317-29320 |
VB |
denotes |
see |
T7584 |
29321-29327 |
NN |
denotes |
Figure |
T7585 |
29328-29329 |
CD |
denotes |
1 |
T7586 |
29329-29330 |
-RRB- |
denotes |
) |
T7587 |
29331-29333 |
RB |
denotes |
as |
T7589 |
29334-29338 |
RB |
denotes |
well |
T7588 |
29339-29341 |
IN |
denotes |
as |
T7590 |
29342-29347 |
NN |
denotes |
liver |
T7591 |
29347-29349 |
, |
denotes |
, |
T7592 |
29349-29353 |
NN |
denotes |
skin |
T7593 |
29353-29355 |
, |
denotes |
, |
T7594 |
29355-29358 |
CC |
denotes |
and |
T7595 |
29359-29365 |
NN |
denotes |
kidney |
T7596 |
29366-29367 |
-LRB- |
denotes |
( |
T7598 |
29367-29378 |
JJ |
denotes |
unpublished |
T7597 |
29379-29383 |
NNS |
denotes |
data |
T7599 |
29383-29384 |
-RRB- |
denotes |
) |
T7600 |
29385-29387 |
IN |
denotes |
of |
T7601 |
29388-29392 |
JJ |
denotes |
late |
T7603 |
29392-29393 |
HYPH |
denotes |
- |
T7602 |
29393-29398 |
NN |
denotes |
stage |
T7604 |
29399-29406 |
NNS |
denotes |
embryos |
T7605 |
29406-29407 |
. |
denotes |
. |
T7606 |
29407-29571 |
sentence |
denotes |
This expression pattern is consistent with previous work that has observed Sam68 in neurons [52] and as a substrate of the intestinal SIK/breast tumor kinase [43]. |
T7607 |
29408-29412 |
DT |
denotes |
This |
T7609 |
29413-29423 |
NN |
denotes |
expression |
T7608 |
29424-29431 |
NN |
denotes |
pattern |
T7610 |
29432-29434 |
VBZ |
denotes |
is |
T7611 |
29435-29445 |
JJ |
denotes |
consistent |
T7612 |
29446-29450 |
IN |
denotes |
with |
T7613 |
29451-29459 |
JJ |
denotes |
previous |
T7614 |
29460-29464 |
NN |
denotes |
work |
T7615 |
29465-29469 |
WDT |
denotes |
that |
T7617 |
29470-29473 |
VBZ |
denotes |
has |
T7616 |
29474-29482 |
VBN |
denotes |
observed |
T7618 |
29483-29488 |
NN |
denotes |
Sam68 |
T7619 |
29489-29491 |
IN |
denotes |
in |
T7620 |
29492-29499 |
NNS |
denotes |
neurons |
T7621 |
29500-29501 |
-LRB- |
denotes |
[ |
T7622 |
29501-29503 |
CD |
denotes |
52 |
T7623 |
29503-29504 |
-RRB- |
denotes |
] |
T7624 |
29505-29508 |
CC |
denotes |
and |
T7625 |
29509-29511 |
IN |
denotes |
as |
T7626 |
29512-29513 |
DT |
denotes |
a |
T7627 |
29514-29523 |
NN |
denotes |
substrate |
T7628 |
29524-29526 |
IN |
denotes |
of |
T7629 |
29527-29530 |
DT |
denotes |
the |
T7631 |
29531-29541 |
JJ |
denotes |
intestinal |
T7632 |
29542-29545 |
NN |
denotes |
SIK |
T7633 |
29545-29546 |
HYPH |
denotes |
/ |
T7634 |
29546-29552 |
NN |
denotes |
breast |
T7635 |
29553-29558 |
NN |
denotes |
tumor |
T7630 |
29559-29565 |
NN |
denotes |
kinase |
T7636 |
29566-29567 |
-LRB- |
denotes |
[ |
T7637 |
29567-29569 |
CD |
denotes |
43 |
T7638 |
29569-29570 |
-RRB- |
denotes |
] |
T7639 |
29570-29571 |
. |
denotes |
. |
T7640 |
29571-29697 |
sentence |
denotes |
The expression of Sam68 was not altered in aging bone marrow stromal cells or in senescencing WI-38 cells (unpublished data). |
T7641 |
29572-29575 |
DT |
denotes |
The |
T7642 |
29576-29586 |
NN |
denotes |
expression |
T7644 |
29587-29589 |
IN |
denotes |
of |
T7645 |
29590-29595 |
NN |
denotes |
Sam68 |
T7646 |
29596-29599 |
VBD |
denotes |
was |
T7647 |
29600-29603 |
RB |
denotes |
not |
T7643 |
29604-29611 |
VBN |
denotes |
altered |
T7648 |
29612-29614 |
IN |
denotes |
in |
T7649 |
29615-29620 |
VBG |
denotes |
aging |
T7651 |
29621-29625 |
NN |
denotes |
bone |
T7652 |
29626-29632 |
NN |
denotes |
marrow |
T7653 |
29633-29640 |
JJ |
denotes |
stromal |
T7650 |
29641-29646 |
NNS |
denotes |
cells |
T7654 |
29647-29649 |
CC |
denotes |
or |
T7655 |
29650-29652 |
IN |
denotes |
in |
T7656 |
29653-29665 |
VBG |
denotes |
senescencing |
T7658 |
29666-29668 |
NN |
denotes |
WI |
T7659 |
29668-29669 |
HYPH |
denotes |
- |
T7660 |
29669-29671 |
CD |
denotes |
38 |
T7657 |
29672-29677 |
NNS |
denotes |
cells |
T7661 |
29678-29679 |
-LRB- |
denotes |
( |
T7663 |
29679-29690 |
JJ |
denotes |
unpublished |
T7662 |
29691-29695 |
NNS |
denotes |
data |
T7664 |
29695-29696 |
-RRB- |
denotes |
) |
T7665 |
29696-29697 |
. |
denotes |
. |
T7666 |
29697-29863 |
sentence |
denotes |
The presence of Sam68 in chondrocytes, osteoblasts and osteoclasts in developing cartilage and bone predicted a pivotal role for the protein in skeletal development. |
T7667 |
29698-29701 |
DT |
denotes |
The |
T7668 |
29702-29710 |
NN |
denotes |
presence |
T7670 |
29711-29713 |
IN |
denotes |
of |
T7671 |
29714-29719 |
NN |
denotes |
Sam68 |
T7672 |
29720-29722 |
IN |
denotes |
in |
T7673 |
29723-29735 |
NNS |
denotes |
chondrocytes |
T7674 |
29735-29737 |
, |
denotes |
, |
T7675 |
29737-29748 |
NNS |
denotes |
osteoblasts |
T7676 |
29749-29752 |
CC |
denotes |
and |
T7677 |
29753-29764 |
NNS |
denotes |
osteoclasts |
T7678 |
29765-29767 |
IN |
denotes |
in |
T7679 |
29768-29778 |
VBG |
denotes |
developing |
T7680 |
29779-29788 |
NN |
denotes |
cartilage |
T7681 |
29789-29792 |
CC |
denotes |
and |
T7682 |
29793-29797 |
NN |
denotes |
bone |
T7669 |
29798-29807 |
VBD |
denotes |
predicted |
T7683 |
29808-29809 |
DT |
denotes |
a |
T7685 |
29810-29817 |
JJ |
denotes |
pivotal |
T7684 |
29818-29822 |
NN |
denotes |
role |
T7686 |
29823-29826 |
IN |
denotes |
for |
T7687 |
29827-29830 |
DT |
denotes |
the |
T7688 |
29831-29838 |
NN |
denotes |
protein |
T7689 |
29839-29841 |
IN |
denotes |
in |
T7690 |
29842-29850 |
JJ |
denotes |
skeletal |
T7691 |
29851-29862 |
NN |
denotes |
development |
T7692 |
29862-29863 |
. |
denotes |
. |
T7693 |
29863-30075 |
sentence |
denotes |
The Sam68−/− mice were generated using a traditional targeting approach where the functional KH domain was deleted and approximately one third of the Sam68−/− mice survived to adulthood with no apparent defects. |
T7694 |
29864-29867 |
DT |
denotes |
The |
T7696 |
29868-29873 |
NN |
denotes |
Sam68 |
T7697 |
29873-29874 |
SYM |
denotes |
− |
T7698 |
29874-29875 |
HYPH |
denotes |
/ |
T7699 |
29875-29876 |
SYM |
denotes |
− |
T7695 |
29877-29881 |
NNS |
denotes |
mice |
T7701 |
29882-29886 |
VBD |
denotes |
were |
T7700 |
29887-29896 |
VBN |
denotes |
generated |
T7702 |
29897-29902 |
VBG |
denotes |
using |
T7703 |
29903-29904 |
DT |
denotes |
a |
T7705 |
29905-29916 |
JJ |
denotes |
traditional |
T7706 |
29917-29926 |
NN |
denotes |
targeting |
T7704 |
29927-29935 |
NN |
denotes |
approach |
T7707 |
29936-29941 |
WRB |
denotes |
where |
T7709 |
29942-29945 |
DT |
denotes |
the |
T7711 |
29946-29956 |
JJ |
denotes |
functional |
T7712 |
29957-29959 |
NN |
denotes |
KH |
T7710 |
29960-29966 |
NN |
denotes |
domain |
T7713 |
29967-29970 |
VBD |
denotes |
was |
T7708 |
29971-29978 |
VBN |
denotes |
deleted |
T7714 |
29979-29982 |
CC |
denotes |
and |
T7715 |
29983-29996 |
RB |
denotes |
approximately |
T7716 |
29997-30000 |
CD |
denotes |
one |
T7718 |
30001-30006 |
JJ |
denotes |
third |
T7719 |
30007-30009 |
IN |
denotes |
of |
T7720 |
30010-30013 |
DT |
denotes |
the |
T7722 |
30014-30019 |
NN |
denotes |
Sam68 |
T7723 |
30019-30020 |
SYM |
denotes |
− |
T7724 |
30020-30021 |
HYPH |
denotes |
/ |
T7725 |
30021-30022 |
SYM |
denotes |
− |
T7721 |
30023-30027 |
NNS |
denotes |
mice |
T7717 |
30028-30036 |
VBD |
denotes |
survived |
T7726 |
30037-30039 |
IN |
denotes |
to |
T7727 |
30040-30049 |
NN |
denotes |
adulthood |
T7728 |
30050-30054 |
IN |
denotes |
with |
T7729 |
30055-30057 |
DT |
denotes |
no |
T7731 |
30058-30066 |
JJ |
denotes |
apparent |
T7730 |
30067-30074 |
NNS |
denotes |
defects |
T7732 |
30074-30075 |
. |
denotes |
. |
T7733 |
30075-30234 |
sentence |
denotes |
One explanation for this phenomenon is that Sam68 function is sub-served by one or more of its family members during development such as SLM-1 and SLM-2 [47]. |
T7734 |
30076-30079 |
CD |
denotes |
One |
T7735 |
30080-30091 |
NN |
denotes |
explanation |
T7737 |
30092-30095 |
IN |
denotes |
for |
T7738 |
30096-30100 |
DT |
denotes |
this |
T7739 |
30101-30111 |
NN |
denotes |
phenomenon |
T7736 |
30112-30114 |
VBZ |
denotes |
is |
T7740 |
30115-30119 |
IN |
denotes |
that |
T7742 |
30120-30125 |
NN |
denotes |
Sam68 |
T7743 |
30126-30134 |
NN |
denotes |
function |
T7744 |
30135-30137 |
VBZ |
denotes |
is |
T7741 |
30138-30148 |
VBN |
denotes |
sub-served |
T7745 |
30149-30151 |
IN |
denotes |
by |
T7746 |
30152-30155 |
CD |
denotes |
one |
T7747 |
30156-30158 |
CC |
denotes |
or |
T7748 |
30159-30163 |
JJR |
denotes |
more |
T7749 |
30164-30166 |
IN |
denotes |
of |
T7750 |
30167-30170 |
PRP$ |
denotes |
its |
T7752 |
30171-30177 |
NN |
denotes |
family |
T7751 |
30178-30185 |
NNS |
denotes |
members |
T7753 |
30186-30192 |
IN |
denotes |
during |
T7754 |
30193-30204 |
NN |
denotes |
development |
T7755 |
30205-30209 |
JJ |
denotes |
such |
T7756 |
30210-30212 |
IN |
denotes |
as |
T7757 |
30213-30216 |
NN |
denotes |
SLM |
T7758 |
30216-30217 |
HYPH |
denotes |
- |
T7759 |
30217-30218 |
CD |
denotes |
1 |
T7760 |
30219-30222 |
CC |
denotes |
and |
T7761 |
30223-30226 |
NN |
denotes |
SLM |
T7762 |
30226-30227 |
HYPH |
denotes |
- |
T7763 |
30227-30228 |
CD |
denotes |
2 |
T7764 |
30229-30230 |
-LRB- |
denotes |
[ |
T7765 |
30230-30232 |
CD |
denotes |
47 |
T7766 |
30232-30233 |
-RRB- |
denotes |
] |
T7767 |
30233-30234 |
. |
denotes |
. |
T7768 |
30234-30301 |
sentence |
denotes |
Alternatively, Sam68 is not required during embryonic development. |
T7769 |
30235-30248 |
RB |
denotes |
Alternatively |
T7771 |
30248-30250 |
, |
denotes |
, |
T7772 |
30250-30255 |
NN |
denotes |
Sam68 |
T7773 |
30256-30258 |
VBZ |
denotes |
is |
T7774 |
30259-30262 |
RB |
denotes |
not |
T7770 |
30263-30271 |
VBN |
denotes |
required |
T7775 |
30272-30278 |
IN |
denotes |
during |
T7776 |
30279-30288 |
JJ |
denotes |
embryonic |
T7777 |
30289-30300 |
NN |
denotes |
development |
T7778 |
30300-30301 |
. |
denotes |
. |
T7779 |
30301-30404 |
sentence |
denotes |
However, two thirds of the Sam68−/−, but not the Sam68+/- pups, were killed by their Sam68+/- mothers. |
T7780 |
30302-30309 |
RB |
denotes |
However |
T7782 |
30309-30311 |
, |
denotes |
, |
T7783 |
30311-30314 |
CD |
denotes |
two |
T7784 |
30315-30321 |
NNS |
denotes |
thirds |
T7785 |
30322-30324 |
IN |
denotes |
of |
T7786 |
30325-30328 |
DT |
denotes |
the |
T7787 |
30329-30334 |
NN |
denotes |
Sam68 |
T7788 |
30334-30335 |
SYM |
denotes |
− |
T7789 |
30335-30336 |
HYPH |
denotes |
/ |
T7790 |
30336-30337 |
SYM |
denotes |
− |
T7791 |
30337-30339 |
, |
denotes |
, |
T7792 |
30339-30342 |
CC |
denotes |
but |
T7793 |
30343-30346 |
RB |
denotes |
not |
T7794 |
30347-30350 |
DT |
denotes |
the |
T7795 |
30351-30356 |
NN |
denotes |
Sam68 |
T7797 |
30356-30357 |
SYM |
denotes |
+ |
T7798 |
30357-30358 |
HYPH |
denotes |
/ |
T7799 |
30358-30359 |
SYM |
denotes |
- |
T7796 |
30360-30364 |
NNS |
denotes |
pups |
T7800 |
30364-30366 |
, |
denotes |
, |
T7801 |
30366-30370 |
VBD |
denotes |
were |
T7781 |
30371-30377 |
VBN |
denotes |
killed |
T7802 |
30378-30380 |
IN |
denotes |
by |
T7803 |
30381-30386 |
PRP$ |
denotes |
their |
T7805 |
30387-30392 |
NN |
denotes |
Sam68 |
T7806 |
30392-30393 |
SYM |
denotes |
+ |
T7807 |
30393-30394 |
HYPH |
denotes |
/ |
T7808 |
30394-30395 |
SYM |
denotes |
- |
T7804 |
30396-30403 |
NNS |
denotes |
mothers |
T7809 |
30403-30404 |
. |
denotes |
. |
T7810 |
30404-30506 |
sentence |
denotes |
These findings suggest that the mothers are able to detect a subtle defect/difference that we cannot. |
T7811 |
30405-30410 |
DT |
denotes |
These |
T7812 |
30411-30419 |
NNS |
denotes |
findings |
T7813 |
30420-30427 |
VBP |
denotes |
suggest |
T7814 |
30428-30432 |
IN |
denotes |
that |
T7816 |
30433-30436 |
DT |
denotes |
the |
T7817 |
30437-30444 |
NNS |
denotes |
mothers |
T7815 |
30445-30448 |
VBP |
denotes |
are |
T7818 |
30449-30453 |
JJ |
denotes |
able |
T7819 |
30454-30456 |
TO |
denotes |
to |
T7820 |
30457-30463 |
VB |
denotes |
detect |
T7821 |
30464-30465 |
DT |
denotes |
a |
T7823 |
30466-30472 |
JJ |
denotes |
subtle |
T7824 |
30473-30479 |
NN |
denotes |
defect |
T7825 |
30479-30480 |
HYPH |
denotes |
/ |
T7822 |
30480-30490 |
NN |
denotes |
difference |
T7826 |
30491-30495 |
WDT |
denotes |
that |
T7828 |
30496-30498 |
PRP |
denotes |
we |
T7827 |
30499-30502 |
MD |
denotes |
can |
T7829 |
30502-30505 |
RB |
denotes |
not |
T7830 |
30505-30506 |
. |
denotes |
. |
T7831 |
30506-30578 |
sentence |
denotes |
Adult Sam68−/− mice live a normal life span of approximately two years. |
T7832 |
30507-30512 |
JJ |
denotes |
Adult |
T7834 |
30513-30518 |
NN |
denotes |
Sam68 |
T7835 |
30518-30519 |
SYM |
denotes |
− |
T7836 |
30519-30520 |
HYPH |
denotes |
/ |
T7837 |
30520-30521 |
SYM |
denotes |
− |
T7833 |
30522-30526 |
NNS |
denotes |
mice |
T7838 |
30527-30531 |
VBP |
denotes |
live |
T7839 |
30532-30533 |
DT |
denotes |
a |
T7841 |
30534-30540 |
JJ |
denotes |
normal |
T7842 |
30541-30545 |
NN |
denotes |
life |
T7840 |
30546-30550 |
NN |
denotes |
span |
T7843 |
30551-30553 |
IN |
denotes |
of |
T7844 |
30554-30567 |
RB |
denotes |
approximately |
T7845 |
30568-30571 |
CD |
denotes |
two |
T7846 |
30572-30577 |
NNS |
denotes |
years |
T7847 |
30577-30578 |
. |
denotes |
. |
T7848 |
30578-30758 |
sentence |
denotes |
The Sam68−/− males were sterile and the Sam68−/− females provided inadequate care to their young, but the pups were not scattered and neglected as observed with FosB−/− mice [53]. |
T7849 |
30579-30582 |
DT |
denotes |
The |
T7851 |
30583-30588 |
NN |
denotes |
Sam68 |
T7852 |
30588-30589 |
SYM |
denotes |
− |
T7853 |
30589-30590 |
HYPH |
denotes |
/ |
T7854 |
30590-30591 |
SYM |
denotes |
− |
T7850 |
30592-30597 |
NNS |
denotes |
males |
T7855 |
30598-30602 |
VBD |
denotes |
were |
T7856 |
30603-30610 |
JJ |
denotes |
sterile |
T7857 |
30611-30614 |
CC |
denotes |
and |
T7858 |
30615-30618 |
DT |
denotes |
the |
T7860 |
30619-30624 |
NN |
denotes |
Sam68 |
T7861 |
30624-30625 |
SYM |
denotes |
− |
T7862 |
30625-30626 |
HYPH |
denotes |
/ |
T7863 |
30626-30627 |
SYM |
denotes |
− |
T7859 |
30628-30635 |
NNS |
denotes |
females |
T7864 |
30636-30644 |
VBD |
denotes |
provided |
T7865 |
30645-30655 |
JJ |
denotes |
inadequate |
T7866 |
30656-30660 |
NN |
denotes |
care |
T7867 |
30661-30663 |
IN |
denotes |
to |
T7868 |
30664-30669 |
PRP$ |
denotes |
their |
T7869 |
30670-30675 |
JJ |
denotes |
young |
T7870 |
30675-30677 |
, |
denotes |
, |
T7871 |
30677-30680 |
CC |
denotes |
but |
T7872 |
30681-30684 |
DT |
denotes |
the |
T7873 |
30685-30689 |
NNS |
denotes |
pups |
T7875 |
30690-30694 |
VBD |
denotes |
were |
T7876 |
30695-30698 |
RB |
denotes |
not |
T7874 |
30699-30708 |
VBN |
denotes |
scattered |
T7877 |
30709-30712 |
CC |
denotes |
and |
T7878 |
30713-30722 |
VBN |
denotes |
neglected |
T7879 |
30723-30725 |
IN |
denotes |
as |
T7880 |
30726-30734 |
VBN |
denotes |
observed |
T7881 |
30735-30739 |
IN |
denotes |
with |
T7882 |
30740-30744 |
NN |
denotes |
FosB |
T7884 |
30744-30745 |
SYM |
denotes |
− |
T7885 |
30745-30746 |
HYPH |
denotes |
/ |
T7886 |
30746-30747 |
SYM |
denotes |
− |
T7883 |
30748-30752 |
NNS |
denotes |
mice |
T7887 |
30753-30754 |
-LRB- |
denotes |
[ |
T7888 |
30754-30756 |
CD |
denotes |
53 |
T7889 |
30756-30757 |
-RRB- |
denotes |
] |
T7890 |
30757-30758 |
. |
denotes |
. |
T7891 |
30758-30895 |
sentence |
denotes |
Serum levels of estrogen decreased in aging Sam68−/− females as expected; however, the leptin levels decreased in aged Sam68−/− females. |
T7892 |
30759-30764 |
NN |
denotes |
Serum |
T7893 |
30765-30771 |
NNS |
denotes |
levels |
T7895 |
30772-30774 |
IN |
denotes |
of |
T7896 |
30775-30783 |
NN |
denotes |
estrogen |
T7894 |
30784-30793 |
VBD |
denotes |
decreased |
T7898 |
30794-30796 |
IN |
denotes |
in |
T7899 |
30797-30802 |
VBG |
denotes |
aging |
T7901 |
30803-30808 |
NN |
denotes |
Sam68 |
T7902 |
30808-30809 |
SYM |
denotes |
− |
T7903 |
30809-30810 |
HYPH |
denotes |
/ |
T7904 |
30810-30811 |
SYM |
denotes |
− |
T7900 |
30812-30819 |
NNS |
denotes |
females |
T7905 |
30820-30822 |
IN |
denotes |
as |
T7906 |
30823-30831 |
VBN |
denotes |
expected |
T7907 |
30831-30832 |
: |
denotes |
; |
T7908 |
30833-30840 |
RB |
denotes |
however |
T7909 |
30840-30842 |
, |
denotes |
, |
T7910 |
30842-30845 |
DT |
denotes |
the |
T7912 |
30846-30852 |
NN |
denotes |
leptin |
T7911 |
30853-30859 |
NNS |
denotes |
levels |
T7897 |
30860-30869 |
VBD |
denotes |
decreased |
T7913 |
30870-30872 |
IN |
denotes |
in |
T7914 |
30873-30877 |
JJ |
denotes |
aged |
T7916 |
30878-30883 |
NN |
denotes |
Sam68 |
T7917 |
30883-30884 |
SYM |
denotes |
− |
T7918 |
30884-30885 |
HYPH |
denotes |
/ |
T7919 |
30885-30886 |
SYM |
denotes |
− |
T7915 |
30887-30894 |
NNS |
denotes |
females |
T7920 |
30894-30895 |
. |
denotes |
. |
T7921 |
30895-31006 |
sentence |
denotes |
The aged Sam68−/− females were not obese and actually weighed less than the littermate controls (see Table 2). |
T7922 |
30896-30899 |
DT |
denotes |
The |
T7924 |
30900-30904 |
JJ |
denotes |
aged |
T7925 |
30905-30910 |
NN |
denotes |
Sam68 |
T7926 |
30910-30911 |
SYM |
denotes |
− |
T7927 |
30911-30912 |
HYPH |
denotes |
/ |
T7928 |
30912-30913 |
SYM |
denotes |
− |
T7923 |
30914-30921 |
NNS |
denotes |
females |
T7929 |
30922-30926 |
VBD |
denotes |
were |
T7930 |
30927-30930 |
RB |
denotes |
not |
T7931 |
30931-30936 |
JJ |
denotes |
obese |
T7932 |
30937-30940 |
CC |
denotes |
and |
T7933 |
30941-30949 |
RB |
denotes |
actually |
T7934 |
30950-30957 |
VBD |
denotes |
weighed |
T7935 |
30958-30962 |
JJR |
denotes |
less |
T7936 |
30963-30967 |
IN |
denotes |
than |
T7937 |
30968-30971 |
DT |
denotes |
the |
T7939 |
30972-30982 |
NN |
denotes |
littermate |
T7938 |
30983-30991 |
NNS |
denotes |
controls |
T7940 |
30992-30993 |
-LRB- |
denotes |
( |
T7941 |
30993-30996 |
VB |
denotes |
see |
T7942 |
30997-31002 |
NN |
denotes |
Table |
T7943 |
31003-31004 |
CD |
denotes |
2 |
T7944 |
31004-31005 |
-RRB- |
denotes |
) |
T7945 |
31005-31006 |
. |
denotes |
. |
T7946 |
31006-31246 |
sentence |
denotes |
Moreover, their appetite was not altered with aging (N. Torabi and S. Richard, unpublished data), suggesting that the observed leptin reduction was not recreating ob/ob-like phenotypes related to weight, appetite and female sterility [54]. |
T7947 |
31007-31015 |
RB |
denotes |
Moreover |
T7949 |
31015-31017 |
, |
denotes |
, |
T7950 |
31017-31022 |
PRP$ |
denotes |
their |
T7951 |
31023-31031 |
NN |
denotes |
appetite |
T7952 |
31032-31035 |
VBD |
denotes |
was |
T7953 |
31036-31039 |
RB |
denotes |
not |
T7948 |
31040-31047 |
VBN |
denotes |
altered |
T7954 |
31048-31052 |
IN |
denotes |
with |
T7955 |
31053-31058 |
NN |
denotes |
aging |
T7956 |
31059-31060 |
-LRB- |
denotes |
( |
T7957 |
31060-31062 |
NNP |
denotes |
N. |
T7958 |
31063-31069 |
NNP |
denotes |
Torabi |
T7959 |
31070-31073 |
CC |
denotes |
and |
T7960 |
31074-31076 |
NNP |
denotes |
S. |
T7961 |
31077-31084 |
NNP |
denotes |
Richard |
T7962 |
31084-31086 |
, |
denotes |
, |
T7963 |
31086-31097 |
JJ |
denotes |
unpublished |
T7964 |
31098-31102 |
NNS |
denotes |
data |
T7965 |
31102-31103 |
-RRB- |
denotes |
) |
T7966 |
31103-31105 |
, |
denotes |
, |
T7967 |
31105-31115 |
VBG |
denotes |
suggesting |
T7968 |
31116-31120 |
IN |
denotes |
that |
T7970 |
31121-31124 |
DT |
denotes |
the |
T7972 |
31125-31133 |
VBN |
denotes |
observed |
T7973 |
31134-31140 |
NN |
denotes |
leptin |
T7971 |
31141-31150 |
NN |
denotes |
reduction |
T7974 |
31151-31154 |
VBD |
denotes |
was |
T7975 |
31155-31158 |
RB |
denotes |
not |
T7969 |
31159-31169 |
VBG |
denotes |
recreating |
T7976 |
31170-31172 |
NN |
denotes |
ob |
T7978 |
31172-31173 |
HYPH |
denotes |
/ |
T7979 |
31173-31175 |
NN |
denotes |
ob |
T7980 |
31175-31176 |
HYPH |
denotes |
- |
T7977 |
31176-31180 |
JJ |
denotes |
like |
T7981 |
31181-31191 |
NNS |
denotes |
phenotypes |
T7982 |
31192-31199 |
VBN |
denotes |
related |
T7983 |
31200-31202 |
IN |
denotes |
to |
T7984 |
31203-31209 |
NN |
denotes |
weight |
T7985 |
31209-31211 |
, |
denotes |
, |
T7986 |
31211-31219 |
NN |
denotes |
appetite |
T7987 |
31220-31223 |
CC |
denotes |
and |
T7988 |
31224-31230 |
JJ |
denotes |
female |
T7989 |
31231-31240 |
NN |
denotes |
sterility |
T7990 |
31241-31242 |
-LRB- |
denotes |
[ |
T7991 |
31242-31244 |
CD |
denotes |
54 |
T7992 |
31244-31245 |
-RRB- |
denotes |
] |
T7993 |
31245-31246 |
. |
denotes |
. |
T7994 |
31246-31371 |
sentence |
denotes |
The skeletal phenotyping of cohorts of Sam68+/+ and Sam68−/− mice showed that bone mass was preserved in aged Sam68−/− mice. |
T7995 |
31247-31250 |
DT |
denotes |
The |
T7997 |
31251-31259 |
JJ |
denotes |
skeletal |
T7996 |
31260-31271 |
NN |
denotes |
phenotyping |
T7999 |
31272-31274 |
IN |
denotes |
of |
T8000 |
31275-31282 |
NNS |
denotes |
cohorts |
T8001 |
31283-31285 |
IN |
denotes |
of |
T8002 |
31286-31291 |
NN |
denotes |
Sam68 |
T8004 |
31291-31292 |
SYM |
denotes |
+ |
T8005 |
31292-31293 |
HYPH |
denotes |
/ |
T8006 |
31293-31294 |
SYM |
denotes |
+ |
T8007 |
31295-31298 |
CC |
denotes |
and |
T8008 |
31299-31304 |
NN |
denotes |
Sam68 |
T8009 |
31304-31305 |
SYM |
denotes |
− |
T8010 |
31305-31306 |
HYPH |
denotes |
/ |
T8011 |
31306-31307 |
SYM |
denotes |
− |
T8003 |
31308-31312 |
NNS |
denotes |
mice |
T7998 |
31313-31319 |
VBD |
denotes |
showed |
T8012 |
31320-31324 |
IN |
denotes |
that |
T8014 |
31325-31329 |
NN |
denotes |
bone |
T8015 |
31330-31334 |
NN |
denotes |
mass |
T8016 |
31335-31338 |
VBD |
denotes |
was |
T8013 |
31339-31348 |
VBN |
denotes |
preserved |
T8017 |
31349-31351 |
IN |
denotes |
in |
T8018 |
31352-31356 |
JJ |
denotes |
aged |
T8020 |
31357-31362 |
NN |
denotes |
Sam68 |
T8021 |
31362-31363 |
SYM |
denotes |
− |
T8022 |
31363-31364 |
HYPH |
denotes |
/ |
T8023 |
31364-31365 |
SYM |
denotes |
− |
T8019 |
31366-31370 |
NNS |
denotes |
mice |
T8024 |
31370-31371 |
. |
denotes |
. |
T8025 |
31371-31504 |
sentence |
denotes |
Traditional histology and histomorphometry suggested that the mechanism involved preservation of osteoblast and osteoclast activity. |
T8026 |
31372-31383 |
JJ |
denotes |
Traditional |
T8027 |
31384-31393 |
NN |
denotes |
histology |
T8029 |
31394-31397 |
CC |
denotes |
and |
T8030 |
31398-31414 |
NN |
denotes |
histomorphometry |
T8028 |
31415-31424 |
VBD |
denotes |
suggested |
T8031 |
31425-31429 |
IN |
denotes |
that |
T8033 |
31430-31433 |
DT |
denotes |
the |
T8034 |
31434-31443 |
NN |
denotes |
mechanism |
T8032 |
31444-31452 |
VBD |
denotes |
involved |
T8035 |
31453-31465 |
NN |
denotes |
preservation |
T8036 |
31466-31468 |
IN |
denotes |
of |
T8037 |
31469-31479 |
NN |
denotes |
osteoblast |
T8039 |
31480-31483 |
CC |
denotes |
and |
T8040 |
31484-31494 |
NN |
denotes |
osteoclast |
T8038 |
31495-31503 |
NN |
denotes |
activity |
T8041 |
31503-31504 |
DT |
denotes |
. |
T8042 |
31504-31662 |
sentence |
denotes |
The documented role of the Sam68 regulatory protein, Src, in osteopetrosis led us to investigate the morphology and activity of Sam68−/− osteoclasts ex vivo. |
T8043 |
31505-31508 |
DT |
denotes |
The |
T8045 |
31509-31519 |
VBN |
denotes |
documented |
T8044 |
31520-31524 |
NN |
denotes |
role |
T8047 |
31525-31527 |
IN |
denotes |
of |
T8048 |
31528-31531 |
DT |
denotes |
the |
T8050 |
31532-31537 |
NN |
denotes |
Sam68 |
T8051 |
31538-31548 |
JJ |
denotes |
regulatory |
T8049 |
31549-31556 |
NN |
denotes |
protein |
T8052 |
31556-31558 |
, |
denotes |
, |
T8053 |
31558-31561 |
NN |
denotes |
Src |
T8054 |
31561-31563 |
, |
denotes |
, |
T8055 |
31563-31565 |
IN |
denotes |
in |
T8056 |
31566-31579 |
NN |
denotes |
osteopetrosis |
T8046 |
31580-31583 |
VBD |
denotes |
led |
T8057 |
31584-31586 |
PRP |
denotes |
us |
T8058 |
31587-31589 |
TO |
denotes |
to |
T8059 |
31590-31601 |
VB |
denotes |
investigate |
T8060 |
31602-31605 |
DT |
denotes |
the |
T8061 |
31606-31616 |
NN |
denotes |
morphology |
T8062 |
31617-31620 |
CC |
denotes |
and |
T8063 |
31621-31629 |
NN |
denotes |
activity |
T8064 |
31630-31632 |
IN |
denotes |
of |
T8065 |
31633-31638 |
NN |
denotes |
Sam68 |
T8067 |
31638-31639 |
SYM |
denotes |
− |
T8068 |
31639-31640 |
HYPH |
denotes |
/ |
T8069 |
31640-31641 |
SYM |
denotes |
− |
T8066 |
31642-31653 |
NNS |
denotes |
osteoclasts |
T8070 |
31654-31656 |
FW |
denotes |
ex |
T8071 |
31657-31661 |
FW |
denotes |
vivo |
T8072 |
31661-31662 |
. |
denotes |
. |
T8073 |
31662-31880 |
sentence |
denotes |
The Src tyrosine kinase was shown to play a role in bone remodeling when Src−/− mice died at 6 months of age with an osteopetrotic phenotype [48] and the defect was attributed to defective osteoclast function [55−59]. |
T8074 |
31663-31666 |
DT |
denotes |
The |
T8076 |
31667-31670 |
NN |
denotes |
Src |
T8077 |
31671-31679 |
NN |
denotes |
tyrosine |
T8075 |
31680-31686 |
NN |
denotes |
kinase |
T8079 |
31687-31690 |
VBD |
denotes |
was |
T8078 |
31691-31696 |
VBN |
denotes |
shown |
T8080 |
31697-31699 |
TO |
denotes |
to |
T8081 |
31700-31704 |
VB |
denotes |
play |
T8082 |
31705-31706 |
DT |
denotes |
a |
T8083 |
31707-31711 |
NN |
denotes |
role |
T8084 |
31712-31714 |
IN |
denotes |
in |
T8085 |
31715-31719 |
NN |
denotes |
bone |
T8086 |
31720-31730 |
NN |
denotes |
remodeling |
T8087 |
31731-31735 |
WRB |
denotes |
when |
T8089 |
31736-31739 |
NN |
denotes |
Src |
T8091 |
31739-31740 |
SYM |
denotes |
− |
T8092 |
31740-31741 |
HYPH |
denotes |
/ |
T8093 |
31741-31742 |
SYM |
denotes |
− |
T8090 |
31743-31747 |
NNS |
denotes |
mice |
T8088 |
31748-31752 |
VBD |
denotes |
died |
T8094 |
31753-31755 |
IN |
denotes |
at |
T8095 |
31756-31757 |
CD |
denotes |
6 |
T8096 |
31758-31764 |
NNS |
denotes |
months |
T8097 |
31765-31767 |
IN |
denotes |
of |
T8098 |
31768-31771 |
NN |
denotes |
age |
T8099 |
31772-31776 |
IN |
denotes |
with |
T8100 |
31777-31779 |
DT |
denotes |
an |
T8102 |
31780-31793 |
JJ |
denotes |
osteopetrotic |
T8101 |
31794-31803 |
NN |
denotes |
phenotype |
T8103 |
31804-31805 |
-LRB- |
denotes |
[ |
T8104 |
31805-31807 |
CD |
denotes |
48 |
T8105 |
31807-31808 |
-RRB- |
denotes |
] |
T8106 |
31809-31812 |
CC |
denotes |
and |
T8107 |
31813-31816 |
DT |
denotes |
the |
T8108 |
31817-31823 |
NN |
denotes |
defect |
T8110 |
31824-31827 |
VBD |
denotes |
was |
T8109 |
31828-31838 |
VBN |
denotes |
attributed |
T8111 |
31839-31841 |
IN |
denotes |
to |
T8112 |
31842-31851 |
JJ |
denotes |
defective |
T8114 |
31852-31862 |
NN |
denotes |
osteoclast |
T8113 |
31863-31871 |
NN |
denotes |
function |
T8115 |
31872-31873 |
-LRB- |
denotes |
[ |
T8116 |
31873-31875 |
CD |
denotes |
55 |
T8117 |
31875-31876 |
SYM |
denotes |
− |
T8118 |
31876-31878 |
CD |
denotes |
59 |
T8119 |
31878-31879 |
-RRB- |
denotes |
] |
T8120 |
31879-31880 |
. |
denotes |
. |
T8121 |
31880-32027 |
sentence |
denotes |
We therefore cultured mature osteoclasts harvested from Sam68+/+ and Sam68−/− mice ex vivo on dentin slices to quantify their resorptive capacity. |
T8122 |
31881-31883 |
PRP |
denotes |
We |
T8124 |
31884-31893 |
RB |
denotes |
therefore |
T8123 |
31894-31902 |
VBD |
denotes |
cultured |
T8125 |
31903-31909 |
JJ |
denotes |
mature |
T8126 |
31910-31921 |
NNS |
denotes |
osteoclasts |
T8127 |
31922-31931 |
VBN |
denotes |
harvested |
T8128 |
31932-31936 |
IN |
denotes |
from |
T8129 |
31937-31942 |
NN |
denotes |
Sam68 |
T8131 |
31942-31943 |
SYM |
denotes |
+ |
T8132 |
31943-31944 |
HYPH |
denotes |
/ |
T8133 |
31944-31945 |
SYM |
denotes |
+ |
T8134 |
31946-31949 |
CC |
denotes |
and |
T8135 |
31950-31955 |
NN |
denotes |
Sam68 |
T8136 |
31955-31956 |
SYM |
denotes |
− |
T8137 |
31956-31957 |
HYPH |
denotes |
/ |
T8138 |
31957-31958 |
SYM |
denotes |
− |
T8130 |
31959-31963 |
NNS |
denotes |
mice |
T8139 |
31964-31966 |
FW |
denotes |
ex |
T8140 |
31967-31971 |
FW |
denotes |
vivo |
T8141 |
31972-31974 |
IN |
denotes |
on |
T8142 |
31975-31981 |
NN |
denotes |
dentin |
T8143 |
31982-31988 |
NNS |
denotes |
slices |
T8144 |
31989-31991 |
TO |
denotes |
to |
T8145 |
31992-32000 |
VB |
denotes |
quantify |
T8146 |
32001-32006 |
PRP$ |
denotes |
their |
T8148 |
32007-32017 |
JJ |
denotes |
resorptive |
T8147 |
32018-32026 |
NN |
denotes |
capacity |
T8149 |
32026-32027 |
. |
denotes |
. |
T8150 |
32027-32243 |
sentence |
denotes |
The fact that Sam68−/− osteoclasts looked and acted like Sam68+/+ osteoclasts ex vivo and in vivo made it unlikely that this was the primary source of the difference in bone metabolism in 12-month-old Sam68−/− mice. |
T8151 |
32028-32031 |
DT |
denotes |
The |
T8152 |
32032-32036 |
NN |
denotes |
fact |
T8154 |
32037-32041 |
IN |
denotes |
that |
T8156 |
32042-32047 |
NN |
denotes |
Sam68 |
T8158 |
32047-32048 |
SYM |
denotes |
− |
T8159 |
32048-32049 |
HYPH |
denotes |
/ |
T8160 |
32049-32050 |
SYM |
denotes |
− |
T8157 |
32051-32062 |
NNS |
denotes |
osteoclasts |
T8155 |
32063-32069 |
VBD |
denotes |
looked |
T8161 |
32070-32073 |
CC |
denotes |
and |
T8162 |
32074-32079 |
VBD |
denotes |
acted |
T8163 |
32080-32084 |
IN |
denotes |
like |
T8164 |
32085-32090 |
NN |
denotes |
Sam68 |
T8166 |
32090-32091 |
SYM |
denotes |
+ |
T8167 |
32091-32092 |
HYPH |
denotes |
/ |
T8168 |
32092-32093 |
SYM |
denotes |
+ |
T8165 |
32094-32105 |
NNS |
denotes |
osteoclasts |
T8169 |
32106-32108 |
FW |
denotes |
ex |
T8170 |
32109-32113 |
FW |
denotes |
vivo |
T8171 |
32114-32117 |
CC |
denotes |
and |
T8172 |
32118-32120 |
FW |
denotes |
in |
T8173 |
32121-32125 |
FW |
denotes |
vivo |
T8153 |
32126-32130 |
VBD |
denotes |
made |
T8174 |
32131-32133 |
PRP |
denotes |
it |
T8175 |
32134-32142 |
JJ |
denotes |
unlikely |
T8176 |
32143-32147 |
IN |
denotes |
that |
T8178 |
32148-32152 |
DT |
denotes |
this |
T8177 |
32153-32156 |
VBD |
denotes |
was |
T8179 |
32157-32160 |
DT |
denotes |
the |
T8181 |
32161-32168 |
JJ |
denotes |
primary |
T8180 |
32169-32175 |
NN |
denotes |
source |
T8182 |
32176-32178 |
IN |
denotes |
of |
T8183 |
32179-32182 |
DT |
denotes |
the |
T8184 |
32183-32193 |
NN |
denotes |
difference |
T8185 |
32194-32196 |
IN |
denotes |
in |
T8186 |
32197-32201 |
NN |
denotes |
bone |
T8187 |
32202-32212 |
NN |
denotes |
metabolism |
T8188 |
32213-32215 |
IN |
denotes |
in |
T8189 |
32216-32218 |
CD |
denotes |
12 |
T8191 |
32218-32219 |
HYPH |
denotes |
- |
T8190 |
32219-32224 |
NN |
denotes |
month |
T8193 |
32224-32225 |
HYPH |
denotes |
- |
T8192 |
32225-32228 |
JJ |
denotes |
old |
T8195 |
32229-32234 |
NN |
denotes |
Sam68 |
T8196 |
32234-32235 |
SYM |
denotes |
− |
T8197 |
32235-32236 |
HYPH |
denotes |
/ |
T8198 |
32236-32237 |
SYM |
denotes |
− |
T8194 |
32238-32242 |
NNS |
denotes |
mice |
T8199 |
32242-32243 |
. |
denotes |
. |
T8200 |
32243-32407 |
sentence |
denotes |
The fact that the CTX levels were lower in young and old Sam68−/− mice suggested that there is reduced bone resorption compared with wild-type littermate controls. |
T8201 |
32244-32247 |
DT |
denotes |
The |
T8202 |
32248-32252 |
NN |
denotes |
fact |
T8204 |
32253-32257 |
IN |
denotes |
that |
T8206 |
32258-32261 |
DT |
denotes |
the |
T8208 |
32262-32265 |
NN |
denotes |
CTX |
T8207 |
32266-32272 |
NNS |
denotes |
levels |
T8205 |
32273-32277 |
VBD |
denotes |
were |
T8209 |
32278-32283 |
JJR |
denotes |
lower |
T8210 |
32284-32286 |
IN |
denotes |
in |
T8211 |
32287-32292 |
JJ |
denotes |
young |
T8213 |
32293-32296 |
CC |
denotes |
and |
T8214 |
32297-32300 |
JJ |
denotes |
old |
T8215 |
32301-32306 |
NN |
denotes |
Sam68 |
T8216 |
32306-32307 |
SYM |
denotes |
− |
T8217 |
32307-32308 |
HYPH |
denotes |
/ |
T8218 |
32308-32309 |
SYM |
denotes |
− |
T8212 |
32310-32314 |
NNS |
denotes |
mice |
T8203 |
32315-32324 |
VBD |
denotes |
suggested |
T8219 |
32325-32329 |
IN |
denotes |
that |
T8221 |
32330-32335 |
EX |
denotes |
there |
T8220 |
32336-32338 |
VBZ |
denotes |
is |
T8222 |
32339-32346 |
VBN |
denotes |
reduced |
T8224 |
32347-32351 |
NN |
denotes |
bone |
T8223 |
32352-32362 |
NN |
denotes |
resorption |
T8225 |
32363-32371 |
VBN |
denotes |
compared |
T8226 |
32372-32376 |
IN |
denotes |
with |
T8227 |
32377-32381 |
JJ |
denotes |
wild |
T8229 |
32381-32382 |
HYPH |
denotes |
- |
T8228 |
32382-32386 |
NN |
denotes |
type |
T8231 |
32387-32397 |
NN |
denotes |
littermate |
T8230 |
32398-32406 |
NNS |
denotes |
controls |
T8232 |
32406-32407 |
. |
denotes |
. |
T8233 |
32407-32527 |
sentence |
denotes |
However, this reduction in bone resorption occurred with normal osteoclast activity, as assessed by in vitro culturing. |
T8234 |
32408-32415 |
RB |
denotes |
However |
T8236 |
32415-32417 |
, |
denotes |
, |
T8237 |
32417-32421 |
DT |
denotes |
this |
T8238 |
32422-32431 |
NN |
denotes |
reduction |
T8239 |
32432-32434 |
IN |
denotes |
in |
T8240 |
32435-32439 |
NN |
denotes |
bone |
T8241 |
32440-32450 |
NN |
denotes |
resorption |
T8235 |
32451-32459 |
VBD |
denotes |
occurred |
T8242 |
32460-32464 |
IN |
denotes |
with |
T8243 |
32465-32471 |
JJ |
denotes |
normal |
T8245 |
32472-32482 |
NN |
denotes |
osteoclast |
T8244 |
32483-32491 |
NN |
denotes |
activity |
T8246 |
32491-32493 |
, |
denotes |
, |
T8247 |
32493-32495 |
IN |
denotes |
as |
T8248 |
32496-32504 |
VBN |
denotes |
assessed |
T8249 |
32505-32507 |
IN |
denotes |
by |
T8250 |
32508-32510 |
FW |
denotes |
in |
T8251 |
32511-32516 |
FW |
denotes |
vitro |
T8252 |
32517-32526 |
NN |
denotes |
culturing |
T8253 |
32526-32527 |
. |
denotes |
. |
T8254 |
32527-32620 |
sentence |
denotes |
These observations are consistent with the Sam68−/− mice having a youth-like bone phenotype. |
T8255 |
32528-32533 |
DT |
denotes |
These |
T8256 |
32534-32546 |
NNS |
denotes |
observations |
T8257 |
32547-32550 |
VBP |
denotes |
are |
T8258 |
32551-32561 |
JJ |
denotes |
consistent |
T8259 |
32562-32566 |
IN |
denotes |
with |
T8260 |
32567-32570 |
DT |
denotes |
the |
T8262 |
32571-32576 |
NN |
denotes |
Sam68 |
T8263 |
32576-32577 |
SYM |
denotes |
− |
T8264 |
32577-32578 |
HYPH |
denotes |
/ |
T8265 |
32578-32579 |
SYM |
denotes |
− |
T8261 |
32580-32584 |
NNS |
denotes |
mice |
T8266 |
32585-32591 |
VBG |
denotes |
having |
T8267 |
32592-32593 |
DT |
denotes |
a |
T8269 |
32594-32599 |
NN |
denotes |
youth |
T8271 |
32599-32600 |
HYPH |
denotes |
- |
T8270 |
32600-32604 |
JJ |
denotes |
like |
T8272 |
32605-32609 |
NN |
denotes |
bone |
T8268 |
32610-32619 |
NN |
denotes |
phenotype |
T8273 |
32619-32620 |
. |
denotes |
. |
T8274 |
32620-32825 |
sentence |
denotes |
However, it is still possible, that a mild impairment in Sam68−/− mice osteoclast function may manifest itself later in life in overall accumulation of bone and this will require further detailed studies. |
T8275 |
32621-32628 |
RB |
denotes |
However |
T8277 |
32628-32630 |
, |
denotes |
, |
T8278 |
32630-32632 |
PRP |
denotes |
it |
T8276 |
32633-32635 |
VBZ |
denotes |
is |
T8279 |
32636-32641 |
RB |
denotes |
still |
T8280 |
32642-32650 |
JJ |
denotes |
possible |
T8281 |
32650-32652 |
, |
denotes |
, |
T8282 |
32652-32656 |
IN |
denotes |
that |
T8284 |
32657-32658 |
DT |
denotes |
a |
T8286 |
32659-32663 |
JJ |
denotes |
mild |
T8285 |
32664-32674 |
NN |
denotes |
impairment |
T8287 |
32675-32677 |
IN |
denotes |
in |
T8288 |
32678-32683 |
NN |
denotes |
Sam68 |
T8290 |
32683-32684 |
SYM |
denotes |
− |
T8291 |
32684-32685 |
HYPH |
denotes |
/ |
T8292 |
32685-32686 |
SYM |
denotes |
− |
T8289 |
32687-32691 |
NNS |
denotes |
mice |
T8294 |
32692-32702 |
NN |
denotes |
osteoclast |
T8293 |
32703-32711 |
NN |
denotes |
function |
T8295 |
32712-32715 |
MD |
denotes |
may |
T8283 |
32716-32724 |
VB |
denotes |
manifest |
T8296 |
32725-32731 |
PRP |
denotes |
itself |
T8297 |
32732-32737 |
RB |
denotes |
later |
T8298 |
32738-32740 |
IN |
denotes |
in |
T8299 |
32741-32745 |
NN |
denotes |
life |
T8300 |
32746-32748 |
IN |
denotes |
in |
T8301 |
32749-32756 |
JJ |
denotes |
overall |
T8302 |
32757-32769 |
NN |
denotes |
accumulation |
T8303 |
32770-32772 |
IN |
denotes |
of |
T8304 |
32773-32777 |
NN |
denotes |
bone |
T8305 |
32778-32781 |
CC |
denotes |
and |
T8306 |
32782-32786 |
DT |
denotes |
this |
T8308 |
32787-32791 |
MD |
denotes |
will |
T8307 |
32792-32799 |
VB |
denotes |
require |
T8309 |
32800-32807 |
JJ |
denotes |
further |
T8311 |
32808-32816 |
JJ |
denotes |
detailed |
T8310 |
32817-32824 |
NNS |
denotes |
studies |
T8312 |
32824-32825 |
. |
denotes |
. |
T8313 |
32825-33048 |
sentence |
denotes |
Ex vivo differentiation of primary bone marrow stromal cells, harvested from Sam68+/+ and Sam68−/− mice, down the osteoblast lineage revealed an osteogenic advantage in the cultures of cells derived from the Sam68−/− mice. |
T8314 |
32826-32828 |
FW |
denotes |
Ex |
T8315 |
32829-32833 |
FW |
denotes |
vivo |
T8316 |
32834-32849 |
NN |
denotes |
differentiation |
T8318 |
32850-32852 |
IN |
denotes |
of |
T8319 |
32853-32860 |
JJ |
denotes |
primary |
T8321 |
32861-32865 |
NN |
denotes |
bone |
T8322 |
32866-32872 |
NN |
denotes |
marrow |
T8323 |
32873-32880 |
JJ |
denotes |
stromal |
T8320 |
32881-32886 |
NNS |
denotes |
cells |
T8324 |
32886-32888 |
, |
denotes |
, |
T8325 |
32888-32897 |
VBN |
denotes |
harvested |
T8326 |
32898-32902 |
IN |
denotes |
from |
T8327 |
32903-32908 |
NN |
denotes |
Sam68 |
T8329 |
32908-32909 |
SYM |
denotes |
+ |
T8330 |
32909-32910 |
HYPH |
denotes |
/ |
T8331 |
32910-32911 |
SYM |
denotes |
+ |
T8332 |
32912-32915 |
CC |
denotes |
and |
T8333 |
32916-32921 |
NN |
denotes |
Sam68 |
T8334 |
32921-32922 |
SYM |
denotes |
− |
T8335 |
32922-32923 |
HYPH |
denotes |
/ |
T8336 |
32923-32924 |
SYM |
denotes |
− |
T8328 |
32925-32929 |
NNS |
denotes |
mice |
T8337 |
32929-32931 |
, |
denotes |
, |
T8338 |
32931-32935 |
IN |
denotes |
down |
T8339 |
32936-32939 |
DT |
denotes |
the |
T8341 |
32940-32950 |
NN |
denotes |
osteoblast |
T8340 |
32951-32958 |
NN |
denotes |
lineage |
T8317 |
32959-32967 |
VBD |
denotes |
revealed |
T8342 |
32968-32970 |
DT |
denotes |
an |
T8344 |
32971-32981 |
JJ |
denotes |
osteogenic |
T8343 |
32982-32991 |
NN |
denotes |
advantage |
T8345 |
32992-32994 |
IN |
denotes |
in |
T8346 |
32995-32998 |
DT |
denotes |
the |
T8347 |
32999-33007 |
NNS |
denotes |
cultures |
T8348 |
33008-33010 |
IN |
denotes |
of |
T8349 |
33011-33016 |
NNS |
denotes |
cells |
T8350 |
33017-33024 |
VBN |
denotes |
derived |
T8351 |
33025-33029 |
IN |
denotes |
from |
T8352 |
33030-33033 |
DT |
denotes |
the |
T8354 |
33034-33039 |
NN |
denotes |
Sam68 |
T8355 |
33039-33040 |
SYM |
denotes |
− |
T8356 |
33040-33041 |
HYPH |
denotes |
/ |
T8357 |
33041-33042 |
SYM |
denotes |
− |
T8353 |
33043-33047 |
NNS |
denotes |
mice |
T8358 |
33047-33048 |
. |
denotes |
. |
T8359 |
33048-33183 |
sentence |
denotes |
It will be important to demonstrate that a similar effect is observed using primary bone marrow stromal cells from aged Sam68−/− mice. |
T8360 |
33049-33051 |
PRP |
denotes |
It |
T8362 |
33052-33056 |
MD |
denotes |
will |
T8361 |
33057-33059 |
VB |
denotes |
be |
T8363 |
33060-33069 |
JJ |
denotes |
important |
T8364 |
33070-33072 |
TO |
denotes |
to |
T8365 |
33073-33084 |
VB |
denotes |
demonstrate |
T8366 |
33085-33089 |
IN |
denotes |
that |
T8368 |
33090-33091 |
DT |
denotes |
a |
T8370 |
33092-33099 |
JJ |
denotes |
similar |
T8369 |
33100-33106 |
NN |
denotes |
effect |
T8371 |
33107-33109 |
VBZ |
denotes |
is |
T8367 |
33110-33118 |
VBN |
denotes |
observed |
T8372 |
33119-33124 |
VBG |
denotes |
using |
T8373 |
33125-33132 |
JJ |
denotes |
primary |
T8375 |
33133-33137 |
NN |
denotes |
bone |
T8376 |
33138-33144 |
NN |
denotes |
marrow |
T8377 |
33145-33152 |
JJ |
denotes |
stromal |
T8374 |
33153-33158 |
NNS |
denotes |
cells |
T8378 |
33159-33163 |
IN |
denotes |
from |
T8379 |
33164-33168 |
JJ |
denotes |
aged |
T8381 |
33169-33174 |
NN |
denotes |
Sam68 |
T8382 |
33174-33175 |
SYM |
denotes |
− |
T8383 |
33175-33176 |
HYPH |
denotes |
/ |
T8384 |
33176-33177 |
SYM |
denotes |
− |
T8380 |
33178-33182 |
NNS |
denotes |
mice |
T8385 |
33182-33183 |
. |
denotes |
. |
T8386 |
33183-33357 |
sentence |
denotes |
Similar findings were observed when embryonic mesenchymal multipotential progenitor cells C3H10T1/2 treated with Sam68 shRNA, were differentiated into osteoblasts with BMP2. |
T8387 |
33184-33191 |
JJ |
denotes |
Similar |
T8388 |
33192-33200 |
NNS |
denotes |
findings |
T8390 |
33201-33205 |
VBD |
denotes |
were |
T8389 |
33206-33214 |
VBN |
denotes |
observed |
T8391 |
33215-33219 |
WRB |
denotes |
when |
T8393 |
33220-33229 |
JJ |
denotes |
embryonic |
T8395 |
33230-33241 |
JJ |
denotes |
mesenchymal |
T8396 |
33242-33256 |
JJ |
denotes |
multipotential |
T8397 |
33257-33267 |
NN |
denotes |
progenitor |
T8394 |
33268-33273 |
NNS |
denotes |
cells |
T8398 |
33274-33281 |
NN |
denotes |
C3H10T1 |
T8399 |
33281-33282 |
HYPH |
denotes |
/ |
T8400 |
33282-33283 |
CD |
denotes |
2 |
T8401 |
33284-33291 |
VBN |
denotes |
treated |
T8402 |
33292-33296 |
IN |
denotes |
with |
T8403 |
33297-33302 |
NN |
denotes |
Sam68 |
T8404 |
33303-33308 |
NN |
denotes |
shRNA |
T8405 |
33308-33310 |
, |
denotes |
, |
T8406 |
33310-33314 |
VBD |
denotes |
were |
T8392 |
33315-33329 |
VBN |
denotes |
differentiated |
T8407 |
33330-33334 |
IN |
denotes |
into |
T8408 |
33335-33346 |
NNS |
denotes |
osteoblasts |
T8409 |
33347-33351 |
IN |
denotes |
with |
T8410 |
33352-33356 |
NN |
denotes |
BMP2 |
T8411 |
33356-33357 |
. |
denotes |
. |
T8412 |
33357-33587 |
sentence |
denotes |
Our findings that aged Sam68−/− mice do not develop fatty bone marrow and that MEFs derived from Sam68 −/− mice have impaired adipocyte differentiation, indicate that Sam68 regulates both adipocyte and osteoblast differentiation. |
T8413 |
33358-33361 |
PRP$ |
denotes |
Our |
T8414 |
33362-33370 |
NNS |
denotes |
findings |
T8416 |
33371-33375 |
IN |
denotes |
that |
T8418 |
33376-33380 |
JJ |
denotes |
aged |
T8420 |
33381-33386 |
NN |
denotes |
Sam68 |
T8421 |
33386-33387 |
SYM |
denotes |
− |
T8422 |
33387-33388 |
HYPH |
denotes |
/ |
T8423 |
33388-33389 |
SYM |
denotes |
− |
T8419 |
33390-33394 |
NNS |
denotes |
mice |
T8424 |
33395-33397 |
VBP |
denotes |
do |
T8425 |
33398-33401 |
RB |
denotes |
not |
T8417 |
33402-33409 |
VB |
denotes |
develop |
T8426 |
33410-33415 |
JJ |
denotes |
fatty |
T8428 |
33416-33420 |
NN |
denotes |
bone |
T8427 |
33421-33427 |
NN |
denotes |
marrow |
T8429 |
33428-33431 |
CC |
denotes |
and |
T8430 |
33432-33436 |
IN |
denotes |
that |
T8432 |
33437-33441 |
NNS |
denotes |
MEFs |
T8433 |
33442-33449 |
VBN |
denotes |
derived |
T8434 |
33450-33454 |
IN |
denotes |
from |
T8435 |
33455-33460 |
NN |
denotes |
Sam68 |
T8437 |
33461-33462 |
SYM |
denotes |
− |
T8438 |
33462-33463 |
HYPH |
denotes |
/ |
T8439 |
33463-33464 |
SYM |
denotes |
− |
T8436 |
33465-33469 |
NNS |
denotes |
mice |
T8431 |
33470-33474 |
VBP |
denotes |
have |
T8440 |
33475-33483 |
VBN |
denotes |
impaired |
T8442 |
33484-33493 |
NN |
denotes |
adipocyte |
T8441 |
33494-33509 |
NN |
denotes |
differentiation |
T8443 |
33509-33511 |
, |
denotes |
, |
T8415 |
33511-33519 |
VBP |
denotes |
indicate |
T8444 |
33520-33524 |
IN |
denotes |
that |
T8446 |
33525-33530 |
NN |
denotes |
Sam68 |
T8445 |
33531-33540 |
VBZ |
denotes |
regulates |
T8447 |
33541-33545 |
CC |
denotes |
both |
T8448 |
33546-33555 |
NN |
denotes |
adipocyte |
T8450 |
33556-33559 |
CC |
denotes |
and |
T8451 |
33560-33570 |
NN |
denotes |
osteoblast |
T8449 |
33571-33586 |
NN |
denotes |
differentiation |
T8452 |
33586-33587 |
. |
denotes |
. |
T8453 |
33587-33797 |
sentence |
denotes |
These findings identify Sam68 as the first RNA binding protein to regulate mesenchymal cell differentiation and the challenge will be to identify the specific RNA targets that it regulates during this process. |
T8454 |
33588-33593 |
DT |
denotes |
These |
T8455 |
33594-33602 |
NNS |
denotes |
findings |
T8456 |
33603-33611 |
VBP |
denotes |
identify |
T8457 |
33612-33617 |
NN |
denotes |
Sam68 |
T8458 |
33618-33620 |
IN |
denotes |
as |
T8459 |
33621-33624 |
DT |
denotes |
the |
T8461 |
33625-33630 |
JJ |
denotes |
first |
T8462 |
33631-33634 |
NN |
denotes |
RNA |
T8463 |
33635-33642 |
VBG |
denotes |
binding |
T8460 |
33643-33650 |
NN |
denotes |
protein |
T8464 |
33651-33653 |
TO |
denotes |
to |
T8465 |
33654-33662 |
VB |
denotes |
regulate |
T8466 |
33663-33674 |
JJ |
denotes |
mesenchymal |
T8468 |
33675-33679 |
NN |
denotes |
cell |
T8467 |
33680-33695 |
NN |
denotes |
differentiation |
T8469 |
33696-33699 |
CC |
denotes |
and |
T8470 |
33700-33703 |
DT |
denotes |
the |
T8471 |
33704-33713 |
NN |
denotes |
challenge |
T8473 |
33714-33718 |
MD |
denotes |
will |
T8472 |
33719-33721 |
VB |
denotes |
be |
T8474 |
33722-33724 |
TO |
denotes |
to |
T8475 |
33725-33733 |
VB |
denotes |
identify |
T8476 |
33734-33737 |
DT |
denotes |
the |
T8478 |
33738-33746 |
JJ |
denotes |
specific |
T8479 |
33747-33750 |
NN |
denotes |
RNA |
T8477 |
33751-33758 |
NNS |
denotes |
targets |
T8480 |
33759-33763 |
WDT |
denotes |
that |
T8482 |
33764-33766 |
PRP |
denotes |
it |
T8481 |
33767-33776 |
VBZ |
denotes |
regulates |
T8483 |
33777-33783 |
IN |
denotes |
during |
T8484 |
33784-33788 |
DT |
denotes |
this |
T8485 |
33789-33796 |
NN |
denotes |
process |
T8486 |
33796-33797 |
. |
denotes |
. |
T8487 |
33797-33983 |
sentence |
denotes |
The fact that osteoblast function is altered in Src−/− mice [60,61] raises the possibility that preservation of bone mass in the Sam68−/− mice could be linked with and regulated by Src. |
T8488 |
33798-33801 |
DT |
denotes |
The |
T8489 |
33802-33806 |
NN |
denotes |
fact |
T8491 |
33807-33811 |
IN |
denotes |
that |
T8493 |
33812-33822 |
NN |
denotes |
osteoblast |
T8494 |
33823-33831 |
NN |
denotes |
function |
T8495 |
33832-33834 |
VBZ |
denotes |
is |
T8492 |
33835-33842 |
VBN |
denotes |
altered |
T8496 |
33843-33845 |
IN |
denotes |
in |
T8497 |
33846-33849 |
NN |
denotes |
Src |
T8499 |
33849-33850 |
SYM |
denotes |
− |
T8500 |
33850-33851 |
HYPH |
denotes |
/ |
T8501 |
33851-33852 |
SYM |
denotes |
− |
T8498 |
33853-33857 |
NNS |
denotes |
mice |
T8502 |
33858-33859 |
-LRB- |
denotes |
[ |
T8504 |
33859-33861 |
CD |
denotes |
60 |
T8505 |
33861-33862 |
, |
denotes |
, |
T8503 |
33862-33864 |
CD |
denotes |
61 |
T8506 |
33864-33865 |
-RRB- |
denotes |
] |
T8490 |
33866-33872 |
VBZ |
denotes |
raises |
T8507 |
33873-33876 |
DT |
denotes |
the |
T8508 |
33877-33888 |
NN |
denotes |
possibility |
T8509 |
33889-33893 |
IN |
denotes |
that |
T8511 |
33894-33906 |
NN |
denotes |
preservation |
T8512 |
33907-33909 |
IN |
denotes |
of |
T8513 |
33910-33914 |
NN |
denotes |
bone |
T8514 |
33915-33919 |
NN |
denotes |
mass |
T8515 |
33920-33922 |
IN |
denotes |
in |
T8516 |
33923-33926 |
DT |
denotes |
the |
T8518 |
33927-33932 |
NN |
denotes |
Sam68 |
T8519 |
33932-33933 |
SYM |
denotes |
− |
T8520 |
33933-33934 |
HYPH |
denotes |
/ |
T8521 |
33934-33935 |
SYM |
denotes |
− |
T8517 |
33936-33940 |
NNS |
denotes |
mice |
T8522 |
33941-33946 |
MD |
denotes |
could |
T8523 |
33947-33949 |
VB |
denotes |
be |
T8510 |
33950-33956 |
VBN |
denotes |
linked |
T8524 |
33957-33961 |
IN |
denotes |
with |
T8525 |
33962-33965 |
CC |
denotes |
and |
T8526 |
33966-33975 |
VBN |
denotes |
regulated |
T8527 |
33976-33978 |
IN |
denotes |
by |
T8528 |
33979-33982 |
NN |
denotes |
Src |
T8529 |
33982-33983 |
. |
denotes |
. |
T8530 |
33983-34257 |
sentence |
denotes |
The pathway by which leptin regulates bone resorption was identified to involve the sympathetic nervous system relaying to the osteoblasts via the β-adrenergic pathway leading to the release of growth factors including RANKL that causes the osteoclasts to thrive [8,18–20]. |
T8531 |
33984-33987 |
DT |
denotes |
The |
T8532 |
33988-33995 |
NN |
denotes |
pathway |
T8534 |
33996-33998 |
IN |
denotes |
by |
T8536 |
33999-34004 |
WDT |
denotes |
which |
T8537 |
34005-34011 |
NN |
denotes |
leptin |
T8535 |
34012-34021 |
VBZ |
denotes |
regulates |
T8538 |
34022-34026 |
NN |
denotes |
bone |
T8539 |
34027-34037 |
NN |
denotes |
resorption |
T8540 |
34038-34041 |
VBD |
denotes |
was |
T8533 |
34042-34052 |
VBN |
denotes |
identified |
T8541 |
34053-34055 |
TO |
denotes |
to |
T8542 |
34056-34063 |
VB |
denotes |
involve |
T8543 |
34064-34067 |
DT |
denotes |
the |
T8545 |
34068-34079 |
JJ |
denotes |
sympathetic |
T8546 |
34080-34087 |
JJ |
denotes |
nervous |
T8544 |
34088-34094 |
NN |
denotes |
system |
T8547 |
34095-34103 |
VBG |
denotes |
relaying |
T8548 |
34104-34106 |
IN |
denotes |
to |
T8549 |
34107-34110 |
DT |
denotes |
the |
T8550 |
34111-34122 |
NNS |
denotes |
osteoblasts |
T8551 |
34123-34126 |
IN |
denotes |
via |
T8552 |
34127-34130 |
DT |
denotes |
the |
T8554 |
34131-34132 |
NN |
denotes |
β |
T8556 |
34132-34133 |
HYPH |
denotes |
- |
T8555 |
34133-34143 |
JJ |
denotes |
adrenergic |
T8553 |
34144-34151 |
NN |
denotes |
pathway |
T8557 |
34152-34159 |
VBG |
denotes |
leading |
T8558 |
34160-34162 |
IN |
denotes |
to |
T8559 |
34163-34166 |
DT |
denotes |
the |
T8560 |
34167-34174 |
NN |
denotes |
release |
T8561 |
34175-34177 |
IN |
denotes |
of |
T8562 |
34178-34184 |
NN |
denotes |
growth |
T8563 |
34185-34192 |
NNS |
denotes |
factors |
T8564 |
34193-34202 |
VBG |
denotes |
including |
T8565 |
34203-34208 |
NN |
denotes |
RANKL |
T8566 |
34209-34213 |
WDT |
denotes |
that |
T8567 |
34214-34220 |
VBZ |
denotes |
causes |
T8568 |
34221-34224 |
DT |
denotes |
the |
T8569 |
34225-34236 |
NNS |
denotes |
osteoclasts |
T8571 |
34237-34239 |
TO |
denotes |
to |
T8570 |
34240-34246 |
VB |
denotes |
thrive |
T8572 |
34247-34248 |
-LRB- |
denotes |
[ |
T8573 |
34248-34249 |
CD |
denotes |
8 |
T8574 |
34249-34250 |
, |
denotes |
, |
T8575 |
34250-34252 |
CD |
denotes |
18 |
T8576 |
34252-34253 |
SYM |
denotes |
– |
T8577 |
34253-34255 |
CD |
denotes |
20 |
T8578 |
34255-34256 |
-RRB- |
denotes |
] |
T8579 |
34256-34257 |
. |
denotes |
. |
T8580 |
34257-34401 |
sentence |
denotes |
The lowering of leptin levels in aged Sam68−/− mice is consistent with these mice having a high bone mass compared with their aged littermates. |
T8581 |
34258-34261 |
DT |
denotes |
The |
T8582 |
34262-34270 |
NN |
denotes |
lowering |
T8584 |
34271-34273 |
IN |
denotes |
of |
T8585 |
34274-34280 |
NN |
denotes |
leptin |
T8586 |
34281-34287 |
NNS |
denotes |
levels |
T8587 |
34288-34290 |
IN |
denotes |
in |
T8588 |
34291-34295 |
JJ |
denotes |
aged |
T8590 |
34296-34301 |
NN |
denotes |
Sam68 |
T8591 |
34301-34302 |
SYM |
denotes |
− |
T8592 |
34302-34303 |
HYPH |
denotes |
/ |
T8593 |
34303-34304 |
SYM |
denotes |
− |
T8589 |
34305-34309 |
NNS |
denotes |
mice |
T8583 |
34310-34312 |
VBZ |
denotes |
is |
T8594 |
34313-34323 |
JJ |
denotes |
consistent |
T8595 |
34324-34328 |
IN |
denotes |
with |
T8596 |
34329-34334 |
DT |
denotes |
these |
T8597 |
34335-34339 |
NNS |
denotes |
mice |
T8598 |
34340-34346 |
VBG |
denotes |
having |
T8599 |
34347-34348 |
DT |
denotes |
a |
T8601 |
34349-34353 |
JJ |
denotes |
high |
T8602 |
34354-34358 |
NN |
denotes |
bone |
T8600 |
34359-34363 |
NN |
denotes |
mass |
T8603 |
34364-34372 |
VBN |
denotes |
compared |
T8604 |
34373-34377 |
IN |
denotes |
with |
T8605 |
34378-34383 |
PRP$ |
denotes |
their |
T8607 |
34384-34388 |
JJ |
denotes |
aged |
T8606 |
34389-34400 |
NNS |
denotes |
littermates |
T8608 |
34400-34401 |
. |
denotes |
. |
T8609 |
34401-34591 |
sentence |
denotes |
These data would suggest that the leptin-sympathetic pathway is unaltered in Sam68−/− mice and that the lowering of leptin may explain the lower levels of CTX in the serum of Sam68−/− mice. |
T8610 |
34402-34407 |
DT |
denotes |
These |
T8611 |
34408-34412 |
NNS |
denotes |
data |
T8613 |
34413-34418 |
MD |
denotes |
would |
T8612 |
34419-34426 |
VB |
denotes |
suggest |
T8614 |
34427-34431 |
IN |
denotes |
that |
T8616 |
34432-34435 |
DT |
denotes |
the |
T8618 |
34436-34442 |
NN |
denotes |
leptin |
T8620 |
34442-34443 |
HYPH |
denotes |
- |
T8619 |
34443-34454 |
JJ |
denotes |
sympathetic |
T8617 |
34455-34462 |
NN |
denotes |
pathway |
T8615 |
34463-34465 |
VBZ |
denotes |
is |
T8621 |
34466-34475 |
JJ |
denotes |
unaltered |
T8622 |
34476-34478 |
IN |
denotes |
in |
T8623 |
34479-34484 |
NN |
denotes |
Sam68 |
T8625 |
34484-34485 |
SYM |
denotes |
− |
T8626 |
34485-34486 |
HYPH |
denotes |
/ |
T8627 |
34486-34487 |
SYM |
denotes |
− |
T8624 |
34488-34492 |
NNS |
denotes |
mice |
T8628 |
34493-34496 |
CC |
denotes |
and |
T8629 |
34497-34501 |
IN |
denotes |
that |
T8631 |
34502-34505 |
DT |
denotes |
the |
T8632 |
34506-34514 |
NN |
denotes |
lowering |
T8633 |
34515-34517 |
IN |
denotes |
of |
T8634 |
34518-34524 |
NN |
denotes |
leptin |
T8635 |
34525-34528 |
MD |
denotes |
may |
T8630 |
34529-34536 |
VB |
denotes |
explain |
T8636 |
34537-34540 |
DT |
denotes |
the |
T8638 |
34541-34546 |
JJR |
denotes |
lower |
T8637 |
34547-34553 |
NNS |
denotes |
levels |
T8639 |
34554-34556 |
IN |
denotes |
of |
T8640 |
34557-34560 |
NN |
denotes |
CTX |
T8641 |
34561-34563 |
IN |
denotes |
in |
T8642 |
34564-34567 |
DT |
denotes |
the |
T8643 |
34568-34573 |
NN |
denotes |
serum |
T8644 |
34574-34576 |
IN |
denotes |
of |
T8645 |
34577-34582 |
NN |
denotes |
Sam68 |
T8647 |
34582-34583 |
SYM |
denotes |
− |
T8648 |
34583-34584 |
HYPH |
denotes |
/ |
T8649 |
34584-34585 |
SYM |
denotes |
− |
T8646 |
34586-34590 |
NNS |
denotes |
mice |
T8650 |
34590-34591 |
. |
denotes |
. |
T8651 |
34591-34895 |
sentence |
denotes |
These findings suggest that Sam68 may be regulating bone metabolism at two different levels: (1) the absence of Sam68 results in lower leptin levels that may reduce bone resorption via the sympathetic nervous system and (2) the absence of Sam68 favors osteoblast, rather than adipocyte, differentiation. |
T8652 |
34592-34597 |
DT |
denotes |
These |
T8653 |
34598-34606 |
NNS |
denotes |
findings |
T8654 |
34607-34614 |
VBP |
denotes |
suggest |
T8656 |
34615-34619 |
IN |
denotes |
that |
T8658 |
34620-34625 |
NN |
denotes |
Sam68 |
T8659 |
34626-34629 |
MD |
denotes |
may |
T8660 |
34630-34632 |
VB |
denotes |
be |
T8657 |
34633-34643 |
VBG |
denotes |
regulating |
T8661 |
34644-34648 |
NN |
denotes |
bone |
T8662 |
34649-34659 |
NN |
denotes |
metabolism |
T8663 |
34660-34662 |
IN |
denotes |
at |
T8664 |
34663-34666 |
CD |
denotes |
two |
T8666 |
34667-34676 |
JJ |
denotes |
different |
T8665 |
34677-34683 |
NNS |
denotes |
levels |
T8667 |
34683-34685 |
: |
denotes |
: |
T8668 |
34685-34686 |
-LRB- |
denotes |
( |
T8669 |
34686-34687 |
LS |
denotes |
1 |
T8670 |
34687-34688 |
-RRB- |
denotes |
) |
T8671 |
34689-34692 |
DT |
denotes |
the |
T8672 |
34693-34700 |
NN |
denotes |
absence |
T8673 |
34701-34703 |
IN |
denotes |
of |
T8674 |
34704-34709 |
NN |
denotes |
Sam68 |
T8655 |
34710-34717 |
VBZ |
denotes |
results |
T8675 |
34718-34720 |
IN |
denotes |
in |
T8676 |
34721-34726 |
JJR |
denotes |
lower |
T8678 |
34727-34733 |
NN |
denotes |
leptin |
T8677 |
34734-34740 |
NNS |
denotes |
levels |
T8679 |
34741-34745 |
WDT |
denotes |
that |
T8681 |
34746-34749 |
MD |
denotes |
may |
T8680 |
34750-34756 |
VB |
denotes |
reduce |
T8682 |
34757-34761 |
NN |
denotes |
bone |
T8683 |
34762-34772 |
NN |
denotes |
resorption |
T8684 |
34773-34776 |
IN |
denotes |
via |
T8685 |
34777-34780 |
DT |
denotes |
the |
T8687 |
34781-34792 |
JJ |
denotes |
sympathetic |
T8688 |
34793-34800 |
JJ |
denotes |
nervous |
T8686 |
34801-34807 |
NN |
denotes |
system |
T8689 |
34808-34811 |
CC |
denotes |
and |
T8690 |
34812-34813 |
-LRB- |
denotes |
( |
T8691 |
34813-34814 |
LS |
denotes |
2 |
T8693 |
34814-34815 |
-RRB- |
denotes |
) |
T8694 |
34816-34819 |
DT |
denotes |
the |
T8695 |
34820-34827 |
NN |
denotes |
absence |
T8696 |
34828-34830 |
IN |
denotes |
of |
T8697 |
34831-34836 |
NN |
denotes |
Sam68 |
T8692 |
34837-34843 |
VBZ |
denotes |
favors |
T8698 |
34844-34854 |
NN |
denotes |
osteoblast |
T8700 |
34854-34856 |
, |
denotes |
, |
T8701 |
34856-34862 |
RB |
denotes |
rather |
T8702 |
34863-34867 |
IN |
denotes |
than |
T8703 |
34868-34877 |
NN |
denotes |
adipocyte |
T8704 |
34877-34879 |
, |
denotes |
, |
T8699 |
34879-34894 |
NN |
denotes |
differentiation |
T8705 |
34894-34895 |
. |
denotes |
. |
T8706 |
34895-35029 |
sentence |
denotes |
In conclusion, our data define a physiologic role for Sam68 in bone metabolism and bone marrow mesenchymal stem cell differentiation. |
T8707 |
34896-34898 |
IN |
denotes |
In |
T8709 |
34899-34909 |
NN |
denotes |
conclusion |
T8710 |
34909-34911 |
, |
denotes |
, |
T8711 |
34911-34914 |
PRP$ |
denotes |
our |
T8712 |
34915-34919 |
NNS |
denotes |
data |
T8708 |
34920-34926 |
VBP |
denotes |
define |
T8713 |
34927-34928 |
DT |
denotes |
a |
T8715 |
34929-34940 |
JJ |
denotes |
physiologic |
T8714 |
34941-34945 |
NN |
denotes |
role |
T8716 |
34946-34949 |
IN |
denotes |
for |
T8717 |
34950-34955 |
NN |
denotes |
Sam68 |
T8718 |
34956-34958 |
IN |
denotes |
in |
T8719 |
34959-34963 |
NN |
denotes |
bone |
T8720 |
34964-34974 |
NN |
denotes |
metabolism |
T8721 |
34975-34978 |
CC |
denotes |
and |
T8722 |
34979-34983 |
NN |
denotes |
bone |
T8723 |
34984-34990 |
NN |
denotes |
marrow |
T8725 |
34991-35002 |
JJ |
denotes |
mesenchymal |
T8727 |
35003-35007 |
NN |
denotes |
stem |
T8726 |
35008-35012 |
NN |
denotes |
cell |
T8724 |
35013-35028 |
NN |
denotes |
differentiation |
T8728 |
35028-35029 |
. |
denotes |
. |
T8729 |
35029-35142 |
sentence |
denotes |
The bone phenotype observed in Sam68−/− mice imply that inhibitors of Sam68 could prevent age-related bone loss. |
T8730 |
35030-35033 |
DT |
denotes |
The |
T8732 |
35034-35038 |
NN |
denotes |
bone |
T8731 |
35039-35048 |
NN |
denotes |
phenotype |
T8734 |
35049-35057 |
VBN |
denotes |
observed |
T8735 |
35058-35060 |
IN |
denotes |
in |
T8736 |
35061-35066 |
NN |
denotes |
Sam68 |
T8738 |
35066-35067 |
SYM |
denotes |
− |
T8739 |
35067-35068 |
HYPH |
denotes |
/ |
T8740 |
35068-35069 |
SYM |
denotes |
− |
T8737 |
35070-35074 |
NNS |
denotes |
mice |
T8733 |
35075-35080 |
VBP |
denotes |
imply |
T8741 |
35081-35085 |
IN |
denotes |
that |
T8743 |
35086-35096 |
NNS |
denotes |
inhibitors |
T8744 |
35097-35099 |
IN |
denotes |
of |
T8745 |
35100-35105 |
NN |
denotes |
Sam68 |
T8746 |
35106-35111 |
MD |
denotes |
could |
T8742 |
35112-35119 |
VB |
denotes |
prevent |
T8747 |
35120-35123 |
NN |
denotes |
age |
T8749 |
35123-35124 |
HYPH |
denotes |
- |
T8748 |
35124-35131 |
VBN |
denotes |
related |
T8751 |
35132-35136 |
NN |
denotes |
bone |
T8750 |
35137-35141 |
NN |
denotes |
loss |
T8752 |
35141-35142 |
. |
denotes |
. |
T8753 |
35142-35328 |
sentence |
denotes |
Furthermore, the results also suggest that Sam68 expression levels, hypomorphism, and mutations in humans may influence susceptibility to marrow adipocyte accumulation and osteoporosis. |
T8754 |
35143-35154 |
RB |
denotes |
Furthermore |
T8756 |
35154-35156 |
, |
denotes |
, |
T8757 |
35156-35159 |
DT |
denotes |
the |
T8758 |
35160-35167 |
NNS |
denotes |
results |
T8759 |
35168-35172 |
RB |
denotes |
also |
T8755 |
35173-35180 |
VBP |
denotes |
suggest |
T8760 |
35181-35185 |
IN |
denotes |
that |
T8762 |
35186-35191 |
NN |
denotes |
Sam68 |
T8764 |
35192-35202 |
NN |
denotes |
expression |
T8763 |
35203-35209 |
NNS |
denotes |
levels |
T8765 |
35209-35211 |
, |
denotes |
, |
T8766 |
35211-35223 |
NN |
denotes |
hypomorphism |
T8767 |
35223-35225 |
, |
denotes |
, |
T8768 |
35225-35228 |
CC |
denotes |
and |
T8769 |
35229-35238 |
NNS |
denotes |
mutations |
T8770 |
35239-35241 |
IN |
denotes |
in |
T8771 |
35242-35248 |
NNS |
denotes |
humans |
T8772 |
35249-35252 |
MD |
denotes |
may |
T8761 |
35253-35262 |
VB |
denotes |
influence |
T8773 |
35263-35277 |
NN |
denotes |
susceptibility |
T8774 |
35278-35280 |
IN |
denotes |
to |
T8775 |
35281-35287 |
NN |
denotes |
marrow |
T8776 |
35288-35297 |
NN |
denotes |
adipocyte |
T8777 |
35298-35310 |
NN |
denotes |
accumulation |
T8778 |
35311-35314 |
CC |
denotes |
and |
T8779 |
35315-35327 |
NN |
denotes |
osteoporosis |
T8780 |
35327-35328 |
. |
denotes |
. |
T8781 |
35328-35400 |
sentence |
denotes |
Our findings also identify a new animal model to study aging bone loss. |
T8782 |
35329-35332 |
PRP$ |
denotes |
Our |
T8783 |
35333-35341 |
NNS |
denotes |
findings |
T8785 |
35342-35346 |
RB |
denotes |
also |
T8784 |
35347-35355 |
VBP |
denotes |
identify |
T8786 |
35356-35357 |
DT |
denotes |
a |
T8788 |
35358-35361 |
JJ |
denotes |
new |
T8789 |
35362-35368 |
NN |
denotes |
animal |
T8787 |
35369-35374 |
NN |
denotes |
model |
T8790 |
35375-35377 |
TO |
denotes |
to |
T8791 |
35378-35383 |
VB |
denotes |
study |
T8792 |
35384-35389 |
VBG |
denotes |
aging |
T8794 |
35390-35394 |
NN |
denotes |
bone |
T8793 |
35395-35399 |
NN |
denotes |
loss |
T8795 |
35399-35400 |
. |
denotes |
. |
T8863 |
35425-35435 |
JJ |
denotes |
Histologic |
T8865 |
35435-35437 |
, |
denotes |
, |
T8866 |
35437-35456 |
JJ |
denotes |
immunohistochemical |
T8867 |
35456-35458 |
, |
denotes |
, |
T8868 |
35458-35461 |
CC |
denotes |
and |
T8869 |
35462-35479 |
JJ |
denotes |
histomorphometric |
T8864 |
35480-35488 |
NNS |
denotes |
analyses |
T8870 |
35488-35489 |
. |
denotes |
. |
T8871 |
35489-35562 |
sentence |
denotes |
All analyses were performed essentially as described previously [62,63]. |
T8872 |
35490-35493 |
DT |
denotes |
All |
T8873 |
35494-35502 |
NNS |
denotes |
analyses |
T8875 |
35503-35507 |
VBD |
denotes |
were |
T8874 |
35508-35517 |
VBN |
denotes |
performed |
T8876 |
35518-35529 |
RB |
denotes |
essentially |
T8878 |
35530-35532 |
IN |
denotes |
as |
T8877 |
35533-35542 |
VBN |
denotes |
described |
T8879 |
35543-35553 |
RB |
denotes |
previously |
T8880 |
35554-35555 |
-LRB- |
denotes |
[ |
T8882 |
35555-35557 |
CD |
denotes |
62 |
T8883 |
35557-35558 |
, |
denotes |
, |
T8881 |
35558-35560 |
CD |
denotes |
63 |
T8884 |
35560-35561 |
-RRB- |
denotes |
] |
T8885 |
35561-35562 |
. |
denotes |
. |
T8886 |
35562-35757 |
sentence |
denotes |
Briefly, embryonic mice were removed from timed pregnant dams at E14.5 and E16.5 and fixed intact for 36 h in 4% paraformaldehyde, rinsed thoroughly in PBS, and processed for paraffin embedding. |
T8887 |
35563-35570 |
RB |
denotes |
Briefly |
T8889 |
35570-35572 |
, |
denotes |
, |
T8890 |
35572-35581 |
JJ |
denotes |
embryonic |
T8891 |
35582-35586 |
NNS |
denotes |
mice |
T8892 |
35587-35591 |
VBD |
denotes |
were |
T8888 |
35592-35599 |
VBN |
denotes |
removed |
T8893 |
35600-35604 |
IN |
denotes |
from |
T8894 |
35605-35610 |
VBN |
denotes |
timed |
T8896 |
35611-35619 |
JJ |
denotes |
pregnant |
T8895 |
35620-35624 |
NNS |
denotes |
dams |
T8897 |
35625-35627 |
IN |
denotes |
at |
T8898 |
35628-35633 |
NN |
denotes |
E14.5 |
T8899 |
35634-35637 |
CC |
denotes |
and |
T8900 |
35638-35643 |
NN |
denotes |
E16.5 |
T8901 |
35644-35647 |
CC |
denotes |
and |
T8902 |
35648-35653 |
VBN |
denotes |
fixed |
T8903 |
35654-35660 |
JJ |
denotes |
intact |
T8904 |
35661-35664 |
IN |
denotes |
for |
T8905 |
35665-35667 |
CD |
denotes |
36 |
T8906 |
35668-35669 |
NN |
denotes |
h |
T8907 |
35670-35672 |
IN |
denotes |
in |
T8908 |
35673-35674 |
CD |
denotes |
4 |
T8909 |
35674-35675 |
NN |
denotes |
% |
T8910 |
35676-35692 |
NN |
denotes |
paraformaldehyde |
T8911 |
35692-35694 |
, |
denotes |
, |
T8912 |
35694-35700 |
VBN |
denotes |
rinsed |
T8913 |
35701-35711 |
RB |
denotes |
thoroughly |
T8914 |
35712-35714 |
IN |
denotes |
in |
T8915 |
35715-35718 |
NN |
denotes |
PBS |
T8916 |
35718-35720 |
, |
denotes |
, |
T8917 |
35720-35723 |
CC |
denotes |
and |
T8918 |
35724-35733 |
VBN |
denotes |
processed |
T8919 |
35734-35737 |
IN |
denotes |
for |
T8920 |
35738-35746 |
NN |
denotes |
paraffin |
T8921 |
35747-35756 |
NN |
denotes |
embedding |
T8922 |
35756-35757 |
. |
denotes |
. |
T8923 |
35757-36012 |
sentence |
denotes |
Serial 4-μm sections were cut on a modified Leica RM 2155 rotary microtome (Leica Microsystems, Richmond Hill, Ontario, Canada), stained with a 1:600 dilution of the AD1 anti-Sam68 antibody [46] and counterstained with either methyl green or hematoxylin. |
T8924 |
35758-35764 |
JJ |
denotes |
Serial |
T8926 |
35765-35766 |
CD |
denotes |
4 |
T8928 |
35766-35767 |
HYPH |
denotes |
- |
T8927 |
35767-35769 |
NN |
denotes |
μm |
T8925 |
35770-35778 |
NNS |
denotes |
sections |
T8930 |
35779-35783 |
VBD |
denotes |
were |
T8929 |
35784-35787 |
VBN |
denotes |
cut |
T8931 |
35788-35790 |
IN |
denotes |
on |
T8932 |
35791-35792 |
DT |
denotes |
a |
T8934 |
35793-35801 |
VBN |
denotes |
modified |
T8935 |
35802-35807 |
NNP |
denotes |
Leica |
T8936 |
35808-35810 |
NNP |
denotes |
RM |
T8937 |
35811-35815 |
CD |
denotes |
2155 |
T8938 |
35816-35822 |
JJ |
denotes |
rotary |
T8933 |
35823-35832 |
NN |
denotes |
microtome |
T8939 |
35833-35834 |
-LRB- |
denotes |
( |
T8941 |
35834-35839 |
NNP |
denotes |
Leica |
T8940 |
35840-35852 |
NNP |
denotes |
Microsystems |
T8942 |
35852-35854 |
, |
denotes |
, |
T8943 |
35854-35862 |
NNP |
denotes |
Richmond |
T8944 |
35863-35867 |
NNP |
denotes |
Hill |
T8945 |
35867-35869 |
, |
denotes |
, |
T8946 |
35869-35876 |
NNP |
denotes |
Ontario |
T8947 |
35876-35878 |
, |
denotes |
, |
T8948 |
35878-35884 |
NNP |
denotes |
Canada |
T8949 |
35884-35885 |
-RRB- |
denotes |
) |
T8950 |
35885-35887 |
, |
denotes |
, |
T8951 |
35887-35894 |
VBN |
denotes |
stained |
T8952 |
35895-35899 |
IN |
denotes |
with |
T8953 |
35900-35901 |
DT |
denotes |
a |
T8955 |
35902-35903 |
CD |
denotes |
1 |
T8956 |
35903-35904 |
SYM |
denotes |
: |
T8957 |
35904-35907 |
CD |
denotes |
600 |
T8954 |
35908-35916 |
NN |
denotes |
dilution |
T8958 |
35917-35919 |
IN |
denotes |
of |
T8959 |
35920-35923 |
DT |
denotes |
the |
T8961 |
35924-35927 |
NN |
denotes |
AD1 |
T8962 |
35928-35938 |
JJ |
denotes |
anti-Sam68 |
T8960 |
35939-35947 |
NN |
denotes |
antibody |
T8963 |
35948-35949 |
-LRB- |
denotes |
[ |
T8964 |
35949-35951 |
CD |
denotes |
46 |
T8965 |
35951-35952 |
-RRB- |
denotes |
] |
T8966 |
35953-35956 |
CC |
denotes |
and |
T8967 |
35957-35971 |
VBN |
denotes |
counterstained |
T8968 |
35972-35976 |
IN |
denotes |
with |
T8969 |
35977-35983 |
CC |
denotes |
either |
T8971 |
35984-35990 |
NN |
denotes |
methyl |
T8970 |
35991-35996 |
NN |
denotes |
green |
T8972 |
35997-35999 |
CC |
denotes |
or |
T8973 |
36000-36011 |
NN |
denotes |
hematoxylin |
T8974 |
36011-36012 |
. |
denotes |
. |
T8975 |
36012-36189 |
sentence |
denotes |
Adult mice were given an intraperitoneal injection of 30 mg/kg calcein at 7 days and 30 mg/kg tetracycline at 2 days prior to sacrifice to label actively mineralizing surfaces. |
T8976 |
36013-36018 |
JJ |
denotes |
Adult |
T8977 |
36019-36023 |
NNS |
denotes |
mice |
T8979 |
36024-36028 |
VBD |
denotes |
were |
T8978 |
36029-36034 |
VBN |
denotes |
given |
T8980 |
36035-36037 |
DT |
denotes |
an |
T8982 |
36038-36053 |
JJ |
denotes |
intraperitoneal |
T8981 |
36054-36063 |
NN |
denotes |
injection |
T8983 |
36064-36066 |
IN |
denotes |
of |
T8984 |
36067-36069 |
CD |
denotes |
30 |
T8985 |
36070-36072 |
NN |
denotes |
mg |
T8987 |
36072-36073 |
SYM |
denotes |
/ |
T8988 |
36073-36075 |
NN |
denotes |
kg |
T8986 |
36076-36083 |
NN |
denotes |
calcein |
T8989 |
36084-36086 |
IN |
denotes |
at |
T8990 |
36087-36088 |
CD |
denotes |
7 |
T8991 |
36089-36093 |
NNS |
denotes |
days |
T8992 |
36094-36097 |
CC |
denotes |
and |
T8993 |
36098-36100 |
CD |
denotes |
30 |
T8994 |
36101-36103 |
NN |
denotes |
mg |
T8996 |
36103-36104 |
SYM |
denotes |
/ |
T8997 |
36104-36106 |
NN |
denotes |
kg |
T8995 |
36107-36119 |
NN |
denotes |
tetracycline |
T8998 |
36120-36122 |
IN |
denotes |
at |
T8999 |
36123-36124 |
CD |
denotes |
2 |
T9000 |
36125-36129 |
NNS |
denotes |
days |
T9001 |
36130-36135 |
JJ |
denotes |
prior |
T9002 |
36136-36138 |
IN |
denotes |
to |
T9003 |
36139-36148 |
NN |
denotes |
sacrifice |
T9004 |
36149-36151 |
TO |
denotes |
to |
T9005 |
36152-36157 |
VB |
denotes |
label |
T9006 |
36158-36166 |
RB |
denotes |
actively |
T9007 |
36167-36179 |
VBG |
denotes |
mineralizing |
T9008 |
36180-36188 |
NNS |
denotes |
surfaces |
T9009 |
36188-36189 |
. |
denotes |
. |
T9010 |
36189-36386 |
sentence |
denotes |
After overnight fixation in 4% paraformaldehyde and rinsing in PBS, the left femur and tibia were embedded in polymethylmethacrylate (MMA) or a mixture of 50% MMA and 50% glycolmethacrylate (GMA). |
T9011 |
36190-36195 |
IN |
denotes |
After |
T9013 |
36196-36205 |
RB |
denotes |
overnight |
T9014 |
36206-36214 |
NN |
denotes |
fixation |
T9015 |
36215-36217 |
IN |
denotes |
in |
T9016 |
36218-36219 |
CD |
denotes |
4 |
T9017 |
36219-36220 |
NN |
denotes |
% |
T9018 |
36221-36237 |
NN |
denotes |
paraformaldehyde |
T9019 |
36238-36241 |
CC |
denotes |
and |
T9020 |
36242-36249 |
VBG |
denotes |
rinsing |
T9021 |
36250-36252 |
IN |
denotes |
in |
T9022 |
36253-36256 |
NN |
denotes |
PBS |
T9023 |
36256-36258 |
, |
denotes |
, |
T9024 |
36258-36261 |
DT |
denotes |
the |
T9026 |
36262-36266 |
JJ |
denotes |
left |
T9025 |
36267-36272 |
NN |
denotes |
femur |
T9027 |
36273-36276 |
CC |
denotes |
and |
T9028 |
36277-36282 |
NN |
denotes |
tibia |
T9029 |
36283-36287 |
VBD |
denotes |
were |
T9012 |
36288-36296 |
VBN |
denotes |
embedded |
T9030 |
36297-36299 |
IN |
denotes |
in |
T9031 |
36300-36322 |
NN |
denotes |
polymethylmethacrylate |
T9032 |
36323-36324 |
-LRB- |
denotes |
( |
T9033 |
36324-36327 |
NN |
denotes |
MMA |
T9034 |
36327-36328 |
-RRB- |
denotes |
) |
T9035 |
36329-36331 |
CC |
denotes |
or |
T9036 |
36332-36333 |
DT |
denotes |
a |
T9037 |
36334-36341 |
NN |
denotes |
mixture |
T9038 |
36342-36344 |
IN |
denotes |
of |
T9039 |
36345-36347 |
CD |
denotes |
50 |
T9040 |
36347-36348 |
NN |
denotes |
% |
T9041 |
36349-36352 |
NN |
denotes |
MMA |
T9042 |
36353-36356 |
CC |
denotes |
and |
T9043 |
36357-36359 |
CD |
denotes |
50 |
T9044 |
36359-36360 |
NN |
denotes |
% |
T9045 |
36361-36379 |
NN |
denotes |
glycolmethacrylate |
T9046 |
36380-36381 |
-LRB- |
denotes |
( |
T9047 |
36381-36384 |
NN |
denotes |
GMA |
T9048 |
36384-36385 |
-RRB- |
denotes |
) |
T9049 |
36385-36386 |
. |
denotes |
. |
T9050 |
36386-36600 |
sentence |
denotes |
Serial 4- to 6-μm sections of MMA-embedded tissues were left unstained or stained with von Kossa and toluidine blue or with toluidine blue alone, while 4-μm MMA-GMA sections were stained for TRAP and ALP activity. |
T9051 |
36387-36393 |
JJ |
denotes |
Serial |
T9053 |
36394-36395 |
CD |
denotes |
4 |
T9055 |
36395-36396 |
HYPH |
denotes |
- |
T9056 |
36397-36399 |
IN |
denotes |
to |
T9054 |
36400-36401 |
CD |
denotes |
6 |
T9058 |
36401-36402 |
HYPH |
denotes |
- |
T9057 |
36402-36404 |
NN |
denotes |
μm |
T9052 |
36405-36413 |
NNS |
denotes |
sections |
T9060 |
36414-36416 |
IN |
denotes |
of |
T9061 |
36417-36420 |
NN |
denotes |
MMA |
T9063 |
36420-36421 |
HYPH |
denotes |
- |
T9062 |
36421-36429 |
VBN |
denotes |
embedded |
T9064 |
36430-36437 |
NNS |
denotes |
tissues |
T9065 |
36438-36442 |
VBD |
denotes |
were |
T9059 |
36443-36447 |
VBN |
denotes |
left |
T9066 |
36448-36457 |
JJ |
denotes |
unstained |
T9067 |
36458-36460 |
CC |
denotes |
or |
T9068 |
36461-36468 |
VBN |
denotes |
stained |
T9069 |
36469-36473 |
IN |
denotes |
with |
T9070 |
36474-36477 |
NNP |
denotes |
von |
T9071 |
36478-36483 |
NNP |
denotes |
Kossa |
T9072 |
36484-36487 |
CC |
denotes |
and |
T9073 |
36488-36497 |
NN |
denotes |
toluidine |
T9074 |
36498-36502 |
NN |
denotes |
blue |
T9075 |
36503-36505 |
CC |
denotes |
or |
T9076 |
36506-36510 |
IN |
denotes |
with |
T9077 |
36511-36520 |
NN |
denotes |
toluidine |
T9078 |
36521-36525 |
NN |
denotes |
blue |
T9079 |
36526-36531 |
RB |
denotes |
alone |
T9080 |
36531-36533 |
, |
denotes |
, |
T9081 |
36533-36538 |
IN |
denotes |
while |
T9083 |
36539-36540 |
CD |
denotes |
4 |
T9085 |
36540-36541 |
HYPH |
denotes |
- |
T9084 |
36541-36543 |
NN |
denotes |
μm |
T9087 |
36544-36547 |
NN |
denotes |
MMA |
T9089 |
36547-36548 |
HYPH |
denotes |
- |
T9088 |
36548-36551 |
NN |
denotes |
GMA |
T9086 |
36552-36560 |
NNS |
denotes |
sections |
T9090 |
36561-36565 |
VBD |
denotes |
were |
T9082 |
36566-36573 |
VBN |
denotes |
stained |
T9091 |
36574-36577 |
IN |
denotes |
for |
T9092 |
36578-36582 |
NN |
denotes |
TRAP |
T9094 |
36583-36586 |
CC |
denotes |
and |
T9095 |
36587-36590 |
NN |
denotes |
ALP |
T9093 |
36591-36599 |
NN |
denotes |
activity |
T9096 |
36599-36600 |
. |
denotes |
. |
T9097 |
36600-36919 |
sentence |
denotes |
Images were captured using a Leica DMR microscope (Leica Microsystems) equipped with a Retiga 1300 camera (Qimaging, Burnaby, British Columbia, Canada) and the primary histomorphometric data obtained using Bioquant Nova Prime image analysis software (Bioquant Image Analysis Corp, Nashville, Tennessee, United States). |
T9098 |
36601-36607 |
NNS |
denotes |
Images |
T9100 |
36608-36612 |
VBD |
denotes |
were |
T9099 |
36613-36621 |
VBN |
denotes |
captured |
T9101 |
36622-36627 |
VBG |
denotes |
using |
T9102 |
36628-36629 |
DT |
denotes |
a |
T9104 |
36630-36635 |
NNP |
denotes |
Leica |
T9105 |
36636-36639 |
NN |
denotes |
DMR |
T9103 |
36640-36650 |
NN |
denotes |
microscope |
T9106 |
36651-36652 |
-LRB- |
denotes |
( |
T9108 |
36652-36657 |
NNP |
denotes |
Leica |
T9107 |
36658-36670 |
NNP |
denotes |
Microsystems |
T9109 |
36670-36671 |
-RRB- |
denotes |
) |
T9110 |
36672-36680 |
VBN |
denotes |
equipped |
T9111 |
36681-36685 |
IN |
denotes |
with |
T9112 |
36686-36687 |
DT |
denotes |
a |
T9114 |
36688-36694 |
NNP |
denotes |
Retiga |
T9115 |
36695-36699 |
CD |
denotes |
1300 |
T9113 |
36700-36706 |
NN |
denotes |
camera |
T9116 |
36707-36708 |
-LRB- |
denotes |
( |
T9117 |
36708-36716 |
NNP |
denotes |
Qimaging |
T9118 |
36716-36718 |
, |
denotes |
, |
T9119 |
36718-36725 |
NNP |
denotes |
Burnaby |
T9120 |
36725-36727 |
, |
denotes |
, |
T9121 |
36727-36734 |
NNP |
denotes |
British |
T9122 |
36735-36743 |
NNP |
denotes |
Columbia |
T9123 |
36743-36745 |
, |
denotes |
, |
T9124 |
36745-36751 |
NNP |
denotes |
Canada |
T9125 |
36751-36752 |
-RRB- |
denotes |
) |
T9126 |
36753-36756 |
CC |
denotes |
and |
T9127 |
36757-36760 |
DT |
denotes |
the |
T9129 |
36761-36768 |
JJ |
denotes |
primary |
T9130 |
36769-36786 |
JJ |
denotes |
histomorphometric |
T9128 |
36787-36791 |
NNS |
denotes |
data |
T9131 |
36792-36800 |
VBN |
denotes |
obtained |
T9132 |
36801-36806 |
VBG |
denotes |
using |
T9133 |
36807-36815 |
NNP |
denotes |
Bioquant |
T9135 |
36816-36820 |
NNP |
denotes |
Nova |
T9134 |
36821-36826 |
NNP |
denotes |
Prime |
T9137 |
36827-36832 |
NN |
denotes |
image |
T9138 |
36833-36841 |
NN |
denotes |
analysis |
T9136 |
36842-36850 |
NN |
denotes |
software |
T9139 |
36851-36852 |
-LRB- |
denotes |
( |
T9141 |
36852-36860 |
NNP |
denotes |
Bioquant |
T9142 |
36861-36866 |
NNP |
denotes |
Image |
T9143 |
36867-36875 |
NNP |
denotes |
Analysis |
T9140 |
36876-36880 |
NNP |
denotes |
Corp |
T9144 |
36880-36882 |
, |
denotes |
, |
T9145 |
36882-36891 |
NNP |
denotes |
Nashville |
T9146 |
36891-36893 |
, |
denotes |
, |
T9147 |
36893-36902 |
NNP |
denotes |
Tennessee |
T9148 |
36902-36904 |
, |
denotes |
, |
T9149 |
36904-36910 |
NNP |
denotes |
United |
T9150 |
36911-36917 |
NNP |
denotes |
States |
T9151 |
36917-36918 |
-RRB- |
denotes |
) |
T9152 |
36918-36919 |
. |
denotes |
. |
T9153 |
36919-37039 |
sentence |
denotes |
Nomenclature and abbreviations conform to those recommended by the American Society for Bone and Mineral Research [50]. |
T9154 |
36920-36932 |
NN |
denotes |
Nomenclature |
T9156 |
36933-36936 |
CC |
denotes |
and |
T9157 |
36937-36950 |
NNS |
denotes |
abbreviations |
T9155 |
36951-36958 |
VBP |
denotes |
conform |
T9158 |
36959-36961 |
IN |
denotes |
to |
T9159 |
36962-36967 |
DT |
denotes |
those |
T9160 |
36968-36979 |
VBN |
denotes |
recommended |
T9161 |
36980-36982 |
IN |
denotes |
by |
T9162 |
36983-36986 |
DT |
denotes |
the |
T9164 |
36987-36995 |
NNP |
denotes |
American |
T9163 |
36996-37003 |
NNP |
denotes |
Society |
T9165 |
37004-37007 |
IN |
denotes |
for |
T9166 |
37008-37012 |
NNP |
denotes |
Bone |
T9168 |
37013-37016 |
CC |
denotes |
and |
T9169 |
37017-37024 |
NNP |
denotes |
Mineral |
T9167 |
37025-37033 |
NNP |
denotes |
Research |
T9170 |
37034-37035 |
-LRB- |
denotes |
[ |
T9171 |
37035-37037 |
CD |
denotes |
50 |
T9172 |
37037-37038 |
-RRB- |
denotes |
] |
T9173 |
37038-37039 |
. |
denotes |
. |
T9293 |
37041-37051 |
NN |
denotes |
Generation |
T9294 |
37052-37054 |
IN |
denotes |
of |
T9295 |
37055-37059 |
NNS |
denotes |
mice |
T9296 |
37060-37064 |
IN |
denotes |
with |
T9297 |
37065-37073 |
VBN |
denotes |
targeted |
T9298 |
37074-37084 |
NN |
denotes |
disruption |
T9299 |
37085-37087 |
IN |
denotes |
of |
T9300 |
37088-37091 |
DT |
denotes |
the |
T9302 |
37092-37097 |
NN |
denotes |
sam68 |
T9301 |
37098-37102 |
NN |
denotes |
gene |
T9303 |
37102-37103 |
. |
denotes |
. |
T9304 |
37103-37244 |
sentence |
denotes |
A λ bacteriophage clone encompassing Sam68 exons 3 to 9 was isolated from a 129/SvJ genomic library using full-length Sam68 cDNA as a probe. |
T9305 |
37104-37105 |
DT |
denotes |
A |
T9307 |
37106-37107 |
NN |
denotes |
λ |
T9308 |
37108-37121 |
NN |
denotes |
bacteriophage |
T9306 |
37122-37127 |
NN |
denotes |
clone |
T9310 |
37128-37140 |
VBG |
denotes |
encompassing |
T9311 |
37141-37146 |
NN |
denotes |
Sam68 |
T9313 |
37147-37152 |
NNS |
denotes |
exons |
T9312 |
37153-37154 |
CD |
denotes |
3 |
T9314 |
37155-37157 |
IN |
denotes |
to |
T9315 |
37158-37159 |
CD |
denotes |
9 |
T9316 |
37160-37163 |
VBD |
denotes |
was |
T9309 |
37164-37172 |
VBN |
denotes |
isolated |
T9317 |
37173-37177 |
IN |
denotes |
from |
T9318 |
37178-37179 |
DT |
denotes |
a |
T9320 |
37180-37183 |
CD |
denotes |
129 |
T9322 |
37183-37184 |
HYPH |
denotes |
/ |
T9321 |
37184-37187 |
NN |
denotes |
SvJ |
T9323 |
37188-37195 |
JJ |
denotes |
genomic |
T9319 |
37196-37203 |
NN |
denotes |
library |
T9324 |
37204-37209 |
VBG |
denotes |
using |
T9325 |
37210-37214 |
JJ |
denotes |
full |
T9327 |
37214-37215 |
HYPH |
denotes |
- |
T9326 |
37215-37221 |
NN |
denotes |
length |
T9329 |
37222-37227 |
NN |
denotes |
Sam68 |
T9328 |
37228-37232 |
NN |
denotes |
cDNA |
T9330 |
37233-37235 |
IN |
denotes |
as |
T9331 |
37236-37237 |
DT |
denotes |
a |
T9332 |
37238-37243 |
NN |
denotes |
probe |
T9333 |
37243-37244 |
. |
denotes |
. |
T9334 |
37244-37454 |
sentence |
denotes |
XbaI-digested Sam68 genomic DNA fragments of 4 kb (encompassing exon 4 and part of exon 5) and 3kb (spanning part of exon 5 and exon 6) were subcloned in Bluescript SK resulting in pBS4 and pBS3, respectively. |
T9335 |
37245-37249 |
NN |
denotes |
XbaI |
T9337 |
37249-37250 |
HYPH |
denotes |
- |
T9336 |
37250-37258 |
VBN |
denotes |
digested |
T9339 |
37259-37264 |
NN |
denotes |
Sam68 |
T9340 |
37265-37272 |
JJ |
denotes |
genomic |
T9341 |
37273-37276 |
NN |
denotes |
DNA |
T9338 |
37277-37286 |
NNS |
denotes |
fragments |
T9343 |
37287-37289 |
IN |
denotes |
of |
T9344 |
37290-37291 |
CD |
denotes |
4 |
T9345 |
37292-37294 |
NN |
denotes |
kb |
T9346 |
37295-37296 |
-LRB- |
denotes |
( |
T9347 |
37296-37308 |
VBG |
denotes |
encompassing |
T9348 |
37309-37313 |
NN |
denotes |
exon |
T9349 |
37314-37315 |
CD |
denotes |
4 |
T9350 |
37316-37319 |
CC |
denotes |
and |
T9351 |
37320-37324 |
NN |
denotes |
part |
T9352 |
37325-37327 |
IN |
denotes |
of |
T9353 |
37328-37332 |
NN |
denotes |
exon |
T9354 |
37333-37334 |
CD |
denotes |
5 |
T9355 |
37334-37335 |
-RRB- |
denotes |
) |
T9356 |
37336-37339 |
CC |
denotes |
and |
T9357 |
37340-37343 |
NN |
denotes |
3kb |
T9358 |
37344-37345 |
-LRB- |
denotes |
( |
T9359 |
37345-37353 |
VBG |
denotes |
spanning |
T9360 |
37354-37358 |
NN |
denotes |
part |
T9361 |
37359-37361 |
IN |
denotes |
of |
T9362 |
37362-37366 |
NN |
denotes |
exon |
T9363 |
37367-37368 |
CD |
denotes |
5 |
T9364 |
37369-37372 |
CC |
denotes |
and |
T9365 |
37373-37377 |
NN |
denotes |
exon |
T9366 |
37378-37379 |
CD |
denotes |
6 |
T9367 |
37379-37380 |
-RRB- |
denotes |
) |
T9368 |
37381-37385 |
VBD |
denotes |
were |
T9342 |
37386-37395 |
VBN |
denotes |
subcloned |
T9369 |
37396-37398 |
IN |
denotes |
in |
T9370 |
37399-37409 |
NN |
denotes |
Bluescript |
T9371 |
37410-37412 |
NN |
denotes |
SK |
T9372 |
37413-37422 |
VBG |
denotes |
resulting |
T9373 |
37423-37425 |
IN |
denotes |
in |
T9374 |
37426-37430 |
NN |
denotes |
pBS4 |
T9375 |
37431-37434 |
CC |
denotes |
and |
T9376 |
37435-37439 |
NN |
denotes |
pBS3 |
T9377 |
37439-37441 |
, |
denotes |
, |
T9378 |
37441-37453 |
RB |
denotes |
respectively |
T9379 |
37453-37454 |
. |
denotes |
. |
T9380 |
37454-37601 |
sentence |
denotes |
A DNA fragment was amplified from pBS4 with the following oligonucleotides (5′-AAT GTC TAG AAA CAA CTC ATA TAC AGA C-3′) and the universal primer. |
T9381 |
37455-37456 |
DT |
denotes |
A |
T9383 |
37457-37460 |
NN |
denotes |
DNA |
T9382 |
37461-37469 |
NN |
denotes |
fragment |
T9385 |
37470-37473 |
VBD |
denotes |
was |
T9384 |
37474-37483 |
VBN |
denotes |
amplified |
T9386 |
37484-37488 |
IN |
denotes |
from |
T9387 |
37489-37493 |
NN |
denotes |
pBS4 |
T9388 |
37494-37498 |
IN |
denotes |
with |
T9389 |
37499-37502 |
DT |
denotes |
the |
T9391 |
37503-37512 |
JJ |
denotes |
following |
T9390 |
37513-37529 |
NNS |
denotes |
oligonucleotides |
T9392 |
37530-37531 |
-LRB- |
denotes |
( |
T9393 |
37531-37532 |
CD |
denotes |
5 |
T9394 |
37532-37533 |
SYM |
denotes |
′ |
T9395 |
37533-37534 |
HYPH |
denotes |
- |
T9396 |
37534-37537 |
NN |
denotes |
AAT |
T9398 |
37538-37541 |
NN |
denotes |
GTC |
T9399 |
37542-37545 |
NN |
denotes |
TAG |
T9400 |
37546-37549 |
NN |
denotes |
AAA |
T9401 |
37550-37553 |
NN |
denotes |
CAA |
T9402 |
37554-37557 |
NN |
denotes |
CTC |
T9403 |
37558-37561 |
NN |
denotes |
ATA |
T9404 |
37562-37565 |
NN |
denotes |
TAC |
T9405 |
37566-37569 |
NN |
denotes |
AGA |
T9397 |
37570-37571 |
NN |
denotes |
C |
T9406 |
37571-37572 |
HYPH |
denotes |
- |
T9407 |
37572-37573 |
CD |
denotes |
3 |
T9408 |
37573-37574 |
SYM |
denotes |
′ |
T9409 |
37574-37575 |
-RRB- |
denotes |
) |
T9410 |
37576-37579 |
CC |
denotes |
and |
T9411 |
37580-37583 |
DT |
denotes |
the |
T9413 |
37584-37593 |
JJ |
denotes |
universal |
T9412 |
37594-37600 |
NN |
denotes |
primer |
T9414 |
37600-37601 |
. |
denotes |
. |
T9415 |
37601-37752 |
sentence |
denotes |
The XbaI-digested 1-kb DNA fragment was subcloned in the XbaI site of pPNT (a gift from Andrew Karaplis, McGill University, Montréal, Quebec, Canada). |
T9416 |
37602-37605 |
DT |
denotes |
The |
T9418 |
37606-37610 |
NN |
denotes |
XbaI |
T9420 |
37610-37611 |
HYPH |
denotes |
- |
T9419 |
37611-37619 |
VBN |
denotes |
digested |
T9421 |
37620-37621 |
CD |
denotes |
1 |
T9423 |
37621-37622 |
HYPH |
denotes |
- |
T9422 |
37622-37624 |
NN |
denotes |
kb |
T9424 |
37625-37628 |
NN |
denotes |
DNA |
T9417 |
37629-37637 |
NN |
denotes |
fragment |
T9426 |
37638-37641 |
VBD |
denotes |
was |
T9425 |
37642-37651 |
VBN |
denotes |
subcloned |
T9427 |
37652-37654 |
IN |
denotes |
in |
T9428 |
37655-37658 |
DT |
denotes |
the |
T9430 |
37659-37663 |
NN |
denotes |
XbaI |
T9429 |
37664-37668 |
NN |
denotes |
site |
T9431 |
37669-37671 |
IN |
denotes |
of |
T9432 |
37672-37676 |
NN |
denotes |
pPNT |
T9433 |
37677-37678 |
-LRB- |
denotes |
( |
T9435 |
37678-37679 |
DT |
denotes |
a |
T9434 |
37680-37684 |
NN |
denotes |
gift |
T9436 |
37685-37689 |
IN |
denotes |
from |
T9437 |
37690-37696 |
NNP |
denotes |
Andrew |
T9438 |
37697-37705 |
NNP |
denotes |
Karaplis |
T9439 |
37705-37707 |
, |
denotes |
, |
T9440 |
37707-37713 |
NNP |
denotes |
McGill |
T9441 |
37714-37724 |
NNP |
denotes |
University |
T9442 |
37724-37726 |
, |
denotes |
, |
T9443 |
37726-37734 |
NNP |
denotes |
Montréal |
T9444 |
37734-37736 |
, |
denotes |
, |
T9445 |
37736-37742 |
NNP |
denotes |
Quebec |
T9446 |
37742-37744 |
, |
denotes |
, |
T9447 |
37744-37750 |
NNP |
denotes |
Canada |
T9448 |
37750-37751 |
-RRB- |
denotes |
) |
T9449 |
37751-37752 |
. |
denotes |
. |
T9450 |
37752-37966 |
sentence |
denotes |
The 3-kb fragment from pBS3 was amplified by PCR with (5′-GGG ATG CGG CCG CTC TAG AAT TGT CCT ACT TGA ACG G-3') and (5′-CGG TGG CGG CCG CTG TCG ACC TGA GTA ACA TTT CTT A-3′) and subcloned in the NotI site of pPNT. |
T9451 |
37753-37756 |
DT |
denotes |
The |
T9453 |
37757-37758 |
CD |
denotes |
3 |
T9455 |
37758-37759 |
HYPH |
denotes |
- |
T9454 |
37759-37761 |
NN |
denotes |
kb |
T9452 |
37762-37770 |
NN |
denotes |
fragment |
T9457 |
37771-37775 |
IN |
denotes |
from |
T9458 |
37776-37780 |
NN |
denotes |
pBS3 |
T9459 |
37781-37784 |
VBD |
denotes |
was |
T9456 |
37785-37794 |
VBN |
denotes |
amplified |
T9460 |
37795-37797 |
IN |
denotes |
by |
T9461 |
37798-37801 |
NN |
denotes |
PCR |
T9462 |
37802-37806 |
IN |
denotes |
with |
T9463 |
37807-37808 |
-LRB- |
denotes |
( |
T9464 |
37808-37809 |
CD |
denotes |
5 |
T9465 |
37809-37810 |
SYM |
denotes |
′ |
T9466 |
37810-37811 |
HYPH |
denotes |
- |
T9467 |
37811-37814 |
NN |
denotes |
GGG |
T9469 |
37815-37818 |
NN |
denotes |
ATG |
T9470 |
37819-37822 |
NN |
denotes |
CGG |
T9471 |
37823-37826 |
NN |
denotes |
CCG |
T9472 |
37827-37830 |
NN |
denotes |
CTC |
T9473 |
37831-37834 |
NN |
denotes |
TAG |
T9474 |
37835-37838 |
NN |
denotes |
AAT |
T9475 |
37839-37842 |
NN |
denotes |
TGT |
T9476 |
37843-37846 |
NN |
denotes |
CCT |
T9477 |
37847-37850 |
NN |
denotes |
ACT |
T9478 |
37851-37854 |
NN |
denotes |
TGA |
T9479 |
37855-37858 |
NN |
denotes |
ACG |
T9468 |
37859-37860 |
NN |
denotes |
G |
T9480 |
37860-37861 |
HYPH |
denotes |
- |
T9481 |
37861-37862 |
CD |
denotes |
3 |
T9482 |
37862-37863 |
SYM |
denotes |
' |
T9483 |
37863-37864 |
-RRB- |
denotes |
) |
T9484 |
37865-37868 |
CC |
denotes |
and |
T9485 |
37869-37870 |
-LRB- |
denotes |
( |
T9486 |
37870-37871 |
CD |
denotes |
5 |
T9487 |
37871-37872 |
SYM |
denotes |
′ |
T9488 |
37872-37873 |
HYPH |
denotes |
- |
T9489 |
37873-37876 |
NN |
denotes |
CGG |
T9491 |
37877-37880 |
NN |
denotes |
TGG |
T9492 |
37881-37884 |
NN |
denotes |
CGG |
T9493 |
37885-37888 |
NN |
denotes |
CCG |
T9494 |
37889-37892 |
NN |
denotes |
CTG |
T9495 |
37893-37896 |
NN |
denotes |
TCG |
T9496 |
37897-37900 |
NN |
denotes |
ACC |
T9497 |
37901-37904 |
NN |
denotes |
TGA |
T9498 |
37905-37908 |
NN |
denotes |
GTA |
T9499 |
37909-37912 |
NN |
denotes |
ACA |
T9500 |
37913-37916 |
NN |
denotes |
TTT |
T9501 |
37917-37920 |
NN |
denotes |
CTT |
T9490 |
37921-37922 |
NN |
denotes |
A |
T9502 |
37922-37923 |
HYPH |
denotes |
- |
T9503 |
37923-37924 |
CD |
denotes |
3 |
T9504 |
37924-37925 |
SYM |
denotes |
′ |
T9505 |
37925-37926 |
-RRB- |
denotes |
) |
T9506 |
37927-37930 |
CC |
denotes |
and |
T9507 |
37931-37940 |
VBN |
denotes |
subcloned |
T9508 |
37941-37943 |
IN |
denotes |
in |
T9509 |
37944-37947 |
DT |
denotes |
the |
T9511 |
37948-37952 |
NN |
denotes |
NotI |
T9510 |
37953-37957 |
NN |
denotes |
site |
T9512 |
37958-37960 |
IN |
denotes |
of |
T9513 |
37961-37965 |
NN |
denotes |
pPNT |
T9514 |
37965-37966 |
. |
denotes |
. |
T9515 |
37966-38074 |
sentence |
denotes |
The targeting vector pPNT-Sam68 replaces exon 4 and part of exon 5 with a neomycin-resistant gene cassette. |
T9516 |
37967-37970 |
DT |
denotes |
The |
T9518 |
37971-37980 |
NN |
denotes |
targeting |
T9517 |
37981-37987 |
NN |
denotes |
vector |
T9520 |
37988-37992 |
NN |
denotes |
pPNT |
T9522 |
37992-37993 |
HYPH |
denotes |
- |
T9521 |
37993-37998 |
NN |
denotes |
Sam68 |
T9519 |
37999-38007 |
VBZ |
denotes |
replaces |
T9523 |
38008-38012 |
NN |
denotes |
exon |
T9524 |
38013-38014 |
CD |
denotes |
4 |
T9525 |
38015-38018 |
CC |
denotes |
and |
T9526 |
38019-38023 |
NN |
denotes |
part |
T9527 |
38024-38026 |
IN |
denotes |
of |
T9528 |
38027-38031 |
NN |
denotes |
exon |
T9529 |
38032-38033 |
CD |
denotes |
5 |
T9530 |
38034-38038 |
IN |
denotes |
with |
T9531 |
38039-38040 |
DT |
denotes |
a |
T9533 |
38041-38049 |
NN |
denotes |
neomycin |
T9535 |
38049-38050 |
HYPH |
denotes |
- |
T9534 |
38050-38059 |
JJ |
denotes |
resistant |
T9536 |
38060-38064 |
NN |
denotes |
gene |
T9532 |
38065-38073 |
NN |
denotes |
cassette |
T9537 |
38073-38074 |
. |
denotes |
. |
T9538 |
38074-38231 |
sentence |
denotes |
An SalI site was introduced at the 3′ end of the 3-kb DNA fragment and was used to linearize the plasmid for electroporation into embryonic stem (ES) cells. |
T9539 |
38075-38077 |
DT |
denotes |
An |
T9541 |
38078-38082 |
NN |
denotes |
SalI |
T9540 |
38083-38087 |
NN |
denotes |
site |
T9543 |
38088-38091 |
VBD |
denotes |
was |
T9542 |
38092-38102 |
VBN |
denotes |
introduced |
T9544 |
38103-38105 |
IN |
denotes |
at |
T9545 |
38106-38109 |
DT |
denotes |
the |
T9547 |
38110-38111 |
CD |
denotes |
3 |
T9548 |
38111-38112 |
SYM |
denotes |
′ |
T9546 |
38113-38116 |
NN |
denotes |
end |
T9549 |
38117-38119 |
IN |
denotes |
of |
T9550 |
38120-38123 |
DT |
denotes |
the |
T9552 |
38124-38125 |
CD |
denotes |
3 |
T9554 |
38125-38126 |
HYPH |
denotes |
- |
T9553 |
38126-38128 |
NN |
denotes |
kb |
T9555 |
38129-38132 |
NN |
denotes |
DNA |
T9551 |
38133-38141 |
NN |
denotes |
fragment |
T9556 |
38142-38145 |
CC |
denotes |
and |
T9557 |
38146-38149 |
VBD |
denotes |
was |
T9558 |
38150-38154 |
VBN |
denotes |
used |
T9559 |
38155-38157 |
TO |
denotes |
to |
T9560 |
38158-38167 |
VB |
denotes |
linearize |
T9561 |
38168-38171 |
DT |
denotes |
the |
T9562 |
38172-38179 |
NN |
denotes |
plasmid |
T9563 |
38180-38183 |
IN |
denotes |
for |
T9564 |
38184-38199 |
NN |
denotes |
electroporation |
T9565 |
38200-38204 |
IN |
denotes |
into |
T9566 |
38205-38214 |
JJ |
denotes |
embryonic |
T9567 |
38215-38219 |
NN |
denotes |
stem |
T9569 |
38220-38221 |
-LRB- |
denotes |
( |
T9570 |
38221-38223 |
NN |
denotes |
ES |
T9571 |
38223-38224 |
-RRB- |
denotes |
) |
T9568 |
38225-38230 |
NNS |
denotes |
cells |
T9572 |
38230-38231 |
. |
denotes |
. |
T9573 |
38231-38384 |
sentence |
denotes |
Approximately 1,000 ES colonies were screened and two clones were identified that contained the Sam68 mutant allele, as determined by Southern blotting. |
T9574 |
38232-38245 |
RB |
denotes |
Approximately |
T9575 |
38246-38251 |
CD |
denotes |
1,000 |
T9577 |
38252-38254 |
NN |
denotes |
ES |
T9576 |
38255-38263 |
NNS |
denotes |
colonies |
T9579 |
38264-38268 |
VBD |
denotes |
were |
T9578 |
38269-38277 |
VBN |
denotes |
screened |
T9580 |
38278-38281 |
CC |
denotes |
and |
T9581 |
38282-38285 |
CD |
denotes |
two |
T9582 |
38286-38292 |
NNS |
denotes |
clones |
T9584 |
38293-38297 |
VBD |
denotes |
were |
T9583 |
38298-38308 |
VBN |
denotes |
identified |
T9585 |
38309-38313 |
WDT |
denotes |
that |
T9586 |
38314-38323 |
VBD |
denotes |
contained |
T9587 |
38324-38327 |
DT |
denotes |
the |
T9588 |
38328-38333 |
NN |
denotes |
Sam68 |
T9590 |
38334-38340 |
NN |
denotes |
mutant |
T9589 |
38341-38347 |
NN |
denotes |
allele |
T9591 |
38347-38349 |
, |
denotes |
, |
T9592 |
38349-38351 |
IN |
denotes |
as |
T9593 |
38352-38362 |
VBN |
denotes |
determined |
T9594 |
38363-38365 |
IN |
denotes |
by |
T9595 |
38366-38374 |
NNP |
denotes |
Southern |
T9596 |
38375-38383 |
NN |
denotes |
blotting |
T9597 |
38383-38384 |
. |
denotes |
. |
T9598 |
38384-38577 |
sentence |
denotes |
Targeted ES cells were injected into 3.5-day-old BALB/c blastocysts and were transferred into CD-1 foster mothers, and animals classified as chimeras by coat color were mated with BALB/c mice. |
T9599 |
38385-38393 |
VBN |
denotes |
Targeted |
T9601 |
38394-38396 |
NN |
denotes |
ES |
T9600 |
38397-38402 |
NNS |
denotes |
cells |
T9603 |
38403-38407 |
VBD |
denotes |
were |
T9602 |
38408-38416 |
VBN |
denotes |
injected |
T9604 |
38417-38421 |
IN |
denotes |
into |
T9605 |
38422-38425 |
CD |
denotes |
3.5 |
T9607 |
38425-38426 |
HYPH |
denotes |
- |
T9606 |
38426-38429 |
NN |
denotes |
day |
T9609 |
38429-38430 |
HYPH |
denotes |
- |
T9608 |
38430-38433 |
JJ |
denotes |
old |
T9611 |
38434-38438 |
NN |
denotes |
BALB |
T9613 |
38438-38439 |
HYPH |
denotes |
/ |
T9612 |
38439-38440 |
NN |
denotes |
c |
T9610 |
38441-38452 |
NNS |
denotes |
blastocysts |
T9614 |
38453-38456 |
CC |
denotes |
and |
T9615 |
38457-38461 |
VBD |
denotes |
were |
T9616 |
38462-38473 |
VBN |
denotes |
transferred |
T9617 |
38474-38478 |
IN |
denotes |
into |
T9618 |
38479-38481 |
NN |
denotes |
CD |
T9620 |
38481-38482 |
HYPH |
denotes |
- |
T9621 |
38482-38483 |
CD |
denotes |
1 |
T9622 |
38484-38490 |
NN |
denotes |
foster |
T9619 |
38491-38498 |
NNS |
denotes |
mothers |
T9623 |
38498-38500 |
, |
denotes |
, |
T9624 |
38500-38503 |
CC |
denotes |
and |
T9625 |
38504-38511 |
NNS |
denotes |
animals |
T9627 |
38512-38522 |
VBN |
denotes |
classified |
T9628 |
38523-38525 |
IN |
denotes |
as |
T9629 |
38526-38534 |
NNS |
denotes |
chimeras |
T9630 |
38535-38537 |
IN |
denotes |
by |
T9631 |
38538-38542 |
NN |
denotes |
coat |
T9632 |
38543-38548 |
NN |
denotes |
color |
T9633 |
38549-38553 |
VBD |
denotes |
were |
T9626 |
38554-38559 |
VBN |
denotes |
mated |
T9634 |
38560-38564 |
IN |
denotes |
with |
T9635 |
38565-38569 |
NN |
denotes |
BALB |
T9637 |
38569-38570 |
HYPH |
denotes |
/ |
T9636 |
38570-38571 |
NN |
denotes |
c |
T9638 |
38572-38576 |
NNS |
denotes |
mice |
T9639 |
38576-38577 |
. |
denotes |
. |
T9640 |
38577-38665 |
sentence |
denotes |
Germ line transmission was achieved and the mice were maintained in C57BL/6 background. |
T9641 |
38578-38582 |
NN |
denotes |
Germ |
T9642 |
38583-38587 |
NN |
denotes |
line |
T9643 |
38588-38600 |
NN |
denotes |
transmission |
T9645 |
38601-38604 |
VBD |
denotes |
was |
T9644 |
38605-38613 |
VBN |
denotes |
achieved |
T9646 |
38614-38617 |
CC |
denotes |
and |
T9647 |
38618-38621 |
DT |
denotes |
the |
T9648 |
38622-38626 |
NNS |
denotes |
mice |
T9650 |
38627-38631 |
VBD |
denotes |
were |
T9649 |
38632-38642 |
VBN |
denotes |
maintained |
T9651 |
38643-38645 |
IN |
denotes |
in |
T9652 |
38646-38651 |
NN |
denotes |
C57BL |
T9654 |
38651-38652 |
HYPH |
denotes |
/ |
T9655 |
38652-38653 |
CD |
denotes |
6 |
T9653 |
38654-38664 |
NN |
denotes |
background |
T9656 |
38664-38665 |
. |
denotes |
. |
T9657 |
38665-38871 |
sentence |
denotes |
The mice used for this study represent mice that were backcrossed in C57BL/6 between three and eight generations; in addition, we maintained the mice in the 129/SvJ strain and observed a similar phenotype. |
T9658 |
38666-38669 |
DT |
denotes |
The |
T9659 |
38670-38674 |
NNS |
denotes |
mice |
T9661 |
38675-38679 |
VBN |
denotes |
used |
T9662 |
38680-38683 |
IN |
denotes |
for |
T9663 |
38684-38688 |
DT |
denotes |
this |
T9664 |
38689-38694 |
NN |
denotes |
study |
T9660 |
38695-38704 |
VBP |
denotes |
represent |
T9666 |
38705-38709 |
NNS |
denotes |
mice |
T9667 |
38710-38714 |
WDT |
denotes |
that |
T9669 |
38715-38719 |
VBD |
denotes |
were |
T9668 |
38720-38731 |
VBN |
denotes |
backcrossed |
T9670 |
38732-38734 |
IN |
denotes |
in |
T9671 |
38735-38740 |
NN |
denotes |
C57BL |
T9672 |
38740-38741 |
HYPH |
denotes |
/ |
T9673 |
38741-38742 |
CD |
denotes |
6 |
T9674 |
38743-38750 |
IN |
denotes |
between |
T9675 |
38751-38756 |
CD |
denotes |
three |
T9677 |
38757-38760 |
CC |
denotes |
and |
T9678 |
38761-38766 |
CD |
denotes |
eight |
T9676 |
38767-38778 |
NNS |
denotes |
generations |
T9679 |
38778-38779 |
: |
denotes |
; |
T9680 |
38780-38782 |
IN |
denotes |
in |
T9681 |
38783-38791 |
NN |
denotes |
addition |
T9682 |
38791-38793 |
, |
denotes |
, |
T9683 |
38793-38795 |
PRP |
denotes |
we |
T9665 |
38796-38806 |
VBD |
denotes |
maintained |
T9684 |
38807-38810 |
DT |
denotes |
the |
T9685 |
38811-38815 |
NNS |
denotes |
mice |
T9686 |
38816-38818 |
IN |
denotes |
in |
T9687 |
38819-38822 |
DT |
denotes |
the |
T9689 |
38823-38826 |
CD |
denotes |
129 |
T9691 |
38826-38827 |
HYPH |
denotes |
/ |
T9690 |
38827-38830 |
NN |
denotes |
SvJ |
T9688 |
38831-38837 |
NN |
denotes |
strain |
T9692 |
38838-38841 |
CC |
denotes |
and |
T9693 |
38842-38850 |
VBD |
denotes |
observed |
T9694 |
38851-38852 |
DT |
denotes |
a |
T9696 |
38853-38860 |
JJ |
denotes |
similar |
T9695 |
38861-38870 |
NN |
denotes |
phenotype |
T9697 |
38870-38871 |
. |
denotes |
. |
T9732 |
38873-38883 |
NN |
denotes |
Genotyping |
T9733 |
38884-38887 |
CC |
denotes |
and |
T9734 |
38888-38898 |
NN |
denotes |
immunoblot |
T9735 |
38899-38907 |
NNS |
denotes |
analyses |
T9736 |
38907-38908 |
. |
denotes |
. |
T9737 |
38908-39047 |
sentence |
denotes |
All mouse procedures were performed in accordance with McGill University guidelines, which are set by the Canadian Council on Animal Care. |
T9738 |
38909-38912 |
DT |
denotes |
All |
T9740 |
38913-38918 |
NN |
denotes |
mouse |
T9739 |
38919-38929 |
NNS |
denotes |
procedures |
T9742 |
38930-38934 |
VBD |
denotes |
were |
T9741 |
38935-38944 |
VBN |
denotes |
performed |
T9743 |
38945-38947 |
IN |
denotes |
in |
T9744 |
38948-38958 |
NN |
denotes |
accordance |
T9745 |
38959-38963 |
IN |
denotes |
with |
T9746 |
38964-38970 |
NNP |
denotes |
McGill |
T9747 |
38971-38981 |
NNP |
denotes |
University |
T9748 |
38982-38992 |
NNS |
denotes |
guidelines |
T9749 |
38992-38994 |
, |
denotes |
, |
T9750 |
38994-38999 |
WDT |
denotes |
which |
T9752 |
39000-39003 |
VBP |
denotes |
are |
T9751 |
39004-39007 |
VBN |
denotes |
set |
T9753 |
39008-39010 |
IN |
denotes |
by |
T9754 |
39011-39014 |
DT |
denotes |
the |
T9756 |
39015-39023 |
NNP |
denotes |
Canadian |
T9755 |
39024-39031 |
NNP |
denotes |
Council |
T9757 |
39032-39034 |
IN |
denotes |
on |
T9758 |
39035-39041 |
NNP |
denotes |
Animal |
T9759 |
39042-39046 |
NNP |
denotes |
Care |
T9760 |
39046-39047 |
. |
denotes |
. |
T9761 |
39047-39151 |
sentence |
denotes |
Genomic DNA was isolated from tail biopsies and analyzed by Southern blotting and genomic PCR analysis. |
T9762 |
39048-39055 |
JJ |
denotes |
Genomic |
T9763 |
39056-39059 |
NN |
denotes |
DNA |
T9765 |
39060-39063 |
VBD |
denotes |
was |
T9764 |
39064-39072 |
VBN |
denotes |
isolated |
T9766 |
39073-39077 |
IN |
denotes |
from |
T9767 |
39078-39082 |
NN |
denotes |
tail |
T9768 |
39083-39091 |
NNS |
denotes |
biopsies |
T9769 |
39092-39095 |
CC |
denotes |
and |
T9770 |
39096-39104 |
VBN |
denotes |
analyzed |
T9771 |
39105-39107 |
IN |
denotes |
by |
T9772 |
39108-39116 |
NNP |
denotes |
Southern |
T9773 |
39117-39125 |
NN |
denotes |
blotting |
T9774 |
39126-39129 |
CC |
denotes |
and |
T9775 |
39130-39137 |
JJ |
denotes |
genomic |
T9777 |
39138-39141 |
NN |
denotes |
PCR |
T9776 |
39142-39150 |
NN |
denotes |
analysis |
T9778 |
39150-39151 |
. |
denotes |
. |
T9779 |
39151-39353 |
sentence |
denotes |
The DNA fragment utilized as the probe for the Southern blotting analysis was amplified with the following two oligonucleotides (5′-AAG CCT TTA CTG GTT GTG T-3′) and (5′-CTT GAA ACG CAC CGT AGG CT-3′). |
T9780 |
39152-39155 |
DT |
denotes |
The |
T9782 |
39156-39159 |
NN |
denotes |
DNA |
T9781 |
39160-39168 |
NN |
denotes |
fragment |
T9784 |
39169-39177 |
VBN |
denotes |
utilized |
T9785 |
39178-39180 |
IN |
denotes |
as |
T9786 |
39181-39184 |
DT |
denotes |
the |
T9787 |
39185-39190 |
NN |
denotes |
probe |
T9788 |
39191-39194 |
IN |
denotes |
for |
T9789 |
39195-39198 |
DT |
denotes |
the |
T9791 |
39199-39207 |
NNP |
denotes |
Southern |
T9792 |
39208-39216 |
NN |
denotes |
blotting |
T9790 |
39217-39225 |
NN |
denotes |
analysis |
T9793 |
39226-39229 |
VBD |
denotes |
was |
T9783 |
39230-39239 |
VBN |
denotes |
amplified |
T9794 |
39240-39244 |
IN |
denotes |
with |
T9795 |
39245-39248 |
DT |
denotes |
the |
T9797 |
39249-39258 |
VBG |
denotes |
following |
T9798 |
39259-39262 |
CD |
denotes |
two |
T9796 |
39263-39279 |
NNS |
denotes |
oligonucleotides |
T9799 |
39280-39281 |
-LRB- |
denotes |
( |
T9800 |
39281-39282 |
CD |
denotes |
5 |
T9801 |
39282-39283 |
SYM |
denotes |
′ |
T9802 |
39283-39284 |
HYPH |
denotes |
- |
T9803 |
39284-39287 |
NN |
denotes |
AAG |
T9805 |
39288-39291 |
NN |
denotes |
CCT |
T9806 |
39292-39295 |
NN |
denotes |
TTA |
T9807 |
39296-39299 |
NN |
denotes |
CTG |
T9808 |
39300-39303 |
NN |
denotes |
GTT |
T9809 |
39304-39307 |
NN |
denotes |
GTG |
T9804 |
39308-39309 |
NN |
denotes |
T |
T9810 |
39309-39310 |
HYPH |
denotes |
- |
T9811 |
39310-39311 |
CD |
denotes |
3 |
T9812 |
39311-39312 |
SYM |
denotes |
′ |
T9813 |
39312-39313 |
-RRB- |
denotes |
) |
T9814 |
39314-39317 |
CC |
denotes |
and |
T9815 |
39318-39319 |
-LRB- |
denotes |
( |
T9816 |
39319-39320 |
CD |
denotes |
5 |
T9817 |
39320-39321 |
SYM |
denotes |
′ |
T9818 |
39321-39322 |
HYPH |
denotes |
- |
T9819 |
39322-39325 |
NN |
denotes |
CTT |
T9821 |
39326-39329 |
NN |
denotes |
GAA |
T9822 |
39330-39333 |
NN |
denotes |
ACG |
T9823 |
39334-39337 |
NN |
denotes |
CAC |
T9824 |
39338-39341 |
NN |
denotes |
CGT |
T9825 |
39342-39345 |
NN |
denotes |
AGG |
T9820 |
39346-39348 |
NN |
denotes |
CT |
T9826 |
39348-39349 |
HYPH |
denotes |
- |
T9827 |
39349-39350 |
CD |
denotes |
3 |
T9828 |
39350-39351 |
SYM |
denotes |
′ |
T9829 |
39351-39352 |
-RRB- |
denotes |
) |
T9830 |
39352-39353 |
. |
denotes |
. |
T9831 |
39353-39527 |
sentence |
denotes |
The wild-type sam68 allele was identified by genomic PCR using the following oligonucleotides 5′-AAA TCC TAA CCC TCC TCA GTC AG-3′ and 5′-GAT ATG ATG GAT GAT ATC TGT CAG-3′. |
T9832 |
39354-39357 |
DT |
denotes |
The |
T9834 |
39358-39362 |
JJ |
denotes |
wild |
T9836 |
39362-39363 |
HYPH |
denotes |
- |
T9835 |
39363-39367 |
NN |
denotes |
type |
T9837 |
39368-39373 |
NN |
denotes |
sam68 |
T9833 |
39374-39380 |
NN |
denotes |
allele |
T9839 |
39381-39384 |
VBD |
denotes |
was |
T9838 |
39385-39395 |
VBN |
denotes |
identified |
T9840 |
39396-39398 |
IN |
denotes |
by |
T9841 |
39399-39406 |
JJ |
denotes |
genomic |
T9842 |
39407-39410 |
NN |
denotes |
PCR |
T9843 |
39411-39416 |
VBG |
denotes |
using |
T9844 |
39417-39420 |
DT |
denotes |
the |
T9846 |
39421-39430 |
VBG |
denotes |
following |
T9845 |
39431-39447 |
NNS |
denotes |
oligonucleotides |
T9847 |
39448-39449 |
CD |
denotes |
5 |
T9848 |
39449-39450 |
SYM |
denotes |
′ |
T9849 |
39450-39451 |
HYPH |
denotes |
- |
T9850 |
39451-39454 |
NN |
denotes |
AAA |
T9852 |
39455-39458 |
NN |
denotes |
TCC |
T9853 |
39459-39462 |
NN |
denotes |
TAA |
T9854 |
39463-39466 |
NN |
denotes |
CCC |
T9855 |
39467-39470 |
NN |
denotes |
TCC |
T9856 |
39471-39474 |
NN |
denotes |
TCA |
T9857 |
39475-39478 |
NN |
denotes |
GTC |
T9851 |
39479-39481 |
NN |
denotes |
AG |
T9858 |
39481-39482 |
HYPH |
denotes |
- |
T9859 |
39482-39483 |
CD |
denotes |
3 |
T9860 |
39483-39484 |
SYM |
denotes |
′ |
T9861 |
39485-39488 |
CC |
denotes |
and |
T9862 |
39489-39490 |
CD |
denotes |
5 |
T9863 |
39490-39491 |
SYM |
denotes |
′ |
T9864 |
39491-39492 |
HYPH |
denotes |
- |
T9865 |
39492-39495 |
NN |
denotes |
GAT |
T9867 |
39496-39499 |
NN |
denotes |
ATG |
T9868 |
39500-39503 |
NN |
denotes |
ATG |
T9869 |
39504-39507 |
NN |
denotes |
GAT |
T9870 |
39508-39511 |
NN |
denotes |
GAT |
T9871 |
39512-39515 |
NN |
denotes |
ATC |
T9872 |
39516-39519 |
NN |
denotes |
TGT |
T9866 |
39520-39523 |
NN |
denotes |
CAG |
T9873 |
39523-39524 |
HYPH |
denotes |
- |
T9874 |
39524-39525 |
CD |
denotes |
3 |
T9875 |
39525-39526 |
SYM |
denotes |
′ |
T9876 |
39526-39527 |
. |
denotes |
. |
T9877 |
39527-39695 |
sentence |
denotes |
The sam68-targeted allele was identified by genomic PCR using the following oligonucleotides 5′-CTT GGG TGG AGA GGC TAT TCG-3′ and 5′-GTC GGG CAT GCG CGC CTT GAG C-3′. |
T9878 |
39528-39531 |
DT |
denotes |
The |
T9880 |
39532-39537 |
NN |
denotes |
sam68 |
T9882 |
39537-39538 |
HYPH |
denotes |
- |
T9881 |
39538-39546 |
VBN |
denotes |
targeted |
T9879 |
39547-39553 |
NN |
denotes |
allele |
T9884 |
39554-39557 |
VBD |
denotes |
was |
T9883 |
39558-39568 |
VBN |
denotes |
identified |
T9885 |
39569-39571 |
IN |
denotes |
by |
T9886 |
39572-39579 |
JJ |
denotes |
genomic |
T9887 |
39580-39583 |
NN |
denotes |
PCR |
T9888 |
39584-39589 |
VBG |
denotes |
using |
T9889 |
39590-39593 |
DT |
denotes |
the |
T9891 |
39594-39603 |
VBG |
denotes |
following |
T9890 |
39604-39620 |
NNS |
denotes |
oligonucleotides |
T9892 |
39621-39622 |
CD |
denotes |
5 |
T9893 |
39622-39623 |
SYM |
denotes |
′ |
T9894 |
39623-39624 |
HYPH |
denotes |
- |
T9895 |
39624-39627 |
NN |
denotes |
CTT |
T9897 |
39628-39631 |
NN |
denotes |
GGG |
T9898 |
39632-39635 |
NN |
denotes |
TGG |
T9899 |
39636-39639 |
NN |
denotes |
AGA |
T9900 |
39640-39643 |
NN |
denotes |
GGC |
T9901 |
39644-39647 |
NN |
denotes |
TAT |
T9896 |
39648-39651 |
NN |
denotes |
TCG |
T9902 |
39651-39652 |
HYPH |
denotes |
- |
T9903 |
39652-39653 |
CD |
denotes |
3 |
T9904 |
39653-39654 |
SYM |
denotes |
′ |
T9905 |
39655-39658 |
CC |
denotes |
and |
T9906 |
39659-39660 |
CD |
denotes |
5 |
T9907 |
39660-39661 |
SYM |
denotes |
′ |
T9908 |
39661-39662 |
HYPH |
denotes |
- |
T9909 |
39662-39665 |
NN |
denotes |
GTC |
T9911 |
39666-39669 |
NN |
denotes |
GGG |
T9912 |
39670-39673 |
NN |
denotes |
CAT |
T9913 |
39674-39677 |
NN |
denotes |
GCG |
T9914 |
39678-39681 |
NN |
denotes |
CGC |
T9915 |
39682-39685 |
NN |
denotes |
CTT |
T9916 |
39686-39689 |
NN |
denotes |
GAG |
T9910 |
39690-39691 |
NN |
denotes |
C |
T9917 |
39691-39692 |
HYPH |
denotes |
- |
T9918 |
39692-39693 |
CD |
denotes |
3 |
T9919 |
39693-39694 |
SYM |
denotes |
′ |
T9920 |
39694-39695 |
. |
denotes |
. |
T9978 |
39697-39706 |
NN |
denotes |
Radiology |
T9979 |
39707-39710 |
CC |
denotes |
and |
T9980 |
39711-39716 |
NN |
denotes |
serum |
T9981 |
39717-39729 |
NN |
denotes |
biochemistry |
T9982 |
39730-39732 |
IN |
denotes |
on |
T9983 |
39733-39738 |
NN |
denotes |
Sam68 |
T9985 |
39738-39739 |
SYM |
denotes |
+ |
T9986 |
39739-39740 |
HYPH |
denotes |
/ |
T9987 |
39740-39741 |
SYM |
denotes |
+ |
T9988 |
39742-39745 |
CC |
denotes |
and |
T9989 |
39746-39751 |
NN |
denotes |
Sam68 |
T9990 |
39751-39752 |
SYM |
denotes |
− |
T9991 |
39752-39753 |
HYPH |
denotes |
/ |
T9992 |
39753-39754 |
SYM |
denotes |
− |
T9984 |
39755-39759 |
NNS |
denotes |
mice |
T9993 |
39759-39760 |
. |
denotes |
. |
T9994 |
39760-39848 |
sentence |
denotes |
Radiography, BMD, and micro-CT were performed essentially as described previously [63]. |
T9995 |
39761-39772 |
NN |
denotes |
Radiography |
T9997 |
39772-39774 |
, |
denotes |
, |
T9998 |
39774-39777 |
NN |
denotes |
BMD |
T9999 |
39777-39779 |
, |
denotes |
, |
T10000 |
39779-39782 |
CC |
denotes |
and |
T10001 |
39783-39791 |
NN |
denotes |
micro-CT |
T10002 |
39792-39796 |
VBD |
denotes |
were |
T9996 |
39797-39806 |
VBN |
denotes |
performed |
T10003 |
39807-39818 |
RB |
denotes |
essentially |
T10005 |
39819-39821 |
IN |
denotes |
as |
T10004 |
39822-39831 |
VBN |
denotes |
described |
T10006 |
39832-39842 |
RB |
denotes |
previously |
T10007 |
39843-39844 |
-LRB- |
denotes |
[ |
T10008 |
39844-39846 |
CD |
denotes |
63 |
T10009 |
39846-39847 |
-RRB- |
denotes |
] |
T10010 |
39847-39848 |
. |
denotes |
. |
T10011 |
39848-40055 |
sentence |
denotes |
Mice were administered a lethal dose of anesthetic at the indicated times, exsanguinated, and imaged using a Faxitron MX20 equipped with an FPX-2 Imaging system (Dalsa Medoptics, Waterloo, Ontario, Canada). |
T10012 |
39849-39853 |
NNS |
denotes |
Mice |
T10014 |
39854-39858 |
VBD |
denotes |
were |
T10013 |
39859-39871 |
VBN |
denotes |
administered |
T10015 |
39872-39873 |
DT |
denotes |
a |
T10017 |
39874-39880 |
JJ |
denotes |
lethal |
T10016 |
39881-39885 |
NN |
denotes |
dose |
T10018 |
39886-39888 |
IN |
denotes |
of |
T10019 |
39889-39899 |
JJ |
denotes |
anesthetic |
T10020 |
39900-39902 |
IN |
denotes |
at |
T10021 |
39903-39906 |
DT |
denotes |
the |
T10023 |
39907-39916 |
VBN |
denotes |
indicated |
T10022 |
39917-39922 |
NNS |
denotes |
times |
T10024 |
39922-39924 |
, |
denotes |
, |
T10025 |
39924-39937 |
VBN |
denotes |
exsanguinated |
T10026 |
39937-39939 |
, |
denotes |
, |
T10027 |
39939-39942 |
CC |
denotes |
and |
T10028 |
39943-39949 |
VBN |
denotes |
imaged |
T10029 |
39950-39955 |
VBG |
denotes |
using |
T10030 |
39956-39957 |
DT |
denotes |
a |
T10032 |
39958-39966 |
NNP |
denotes |
Faxitron |
T10031 |
39967-39971 |
NNP |
denotes |
MX20 |
T10033 |
39972-39980 |
VBN |
denotes |
equipped |
T10034 |
39981-39985 |
IN |
denotes |
with |
T10035 |
39986-39988 |
DT |
denotes |
an |
T10037 |
39989-39992 |
NN |
denotes |
FPX |
T10038 |
39992-39993 |
HYPH |
denotes |
- |
T10039 |
39993-39994 |
CD |
denotes |
2 |
T10040 |
39995-40002 |
NN |
denotes |
Imaging |
T10036 |
40003-40009 |
NN |
denotes |
system |
T10041 |
40010-40011 |
-LRB- |
denotes |
( |
T10043 |
40011-40016 |
NNP |
denotes |
Dalsa |
T10042 |
40017-40026 |
NNP |
denotes |
Medoptics |
T10044 |
40026-40028 |
, |
denotes |
, |
T10045 |
40028-40036 |
NNP |
denotes |
Waterloo |
T10046 |
40036-40038 |
, |
denotes |
, |
T10047 |
40038-40045 |
NNP |
denotes |
Ontario |
T10048 |
40045-40047 |
, |
denotes |
, |
T10049 |
40047-40053 |
NNP |
denotes |
Canada |
T10050 |
40053-40054 |
-RRB- |
denotes |
) |
T10051 |
40054-40055 |
. |
denotes |
. |
T10052 |
40055-40167 |
sentence |
denotes |
Body fat, BMC, and BMD were evaluated using a Lunar PixiMUS 1.46 (GE-Lunar, Madison, Wisconsin, United States). |
T10053 |
40056-40060 |
NN |
denotes |
Body |
T10054 |
40061-40064 |
NN |
denotes |
fat |
T10056 |
40064-40066 |
, |
denotes |
, |
T10057 |
40066-40069 |
NN |
denotes |
BMC |
T10058 |
40069-40071 |
, |
denotes |
, |
T10059 |
40071-40074 |
CC |
denotes |
and |
T10060 |
40075-40078 |
NN |
denotes |
BMD |
T10061 |
40079-40083 |
VBD |
denotes |
were |
T10055 |
40084-40093 |
VBN |
denotes |
evaluated |
T10062 |
40094-40099 |
VBG |
denotes |
using |
T10063 |
40100-40101 |
DT |
denotes |
a |
T10065 |
40102-40107 |
NNP |
denotes |
Lunar |
T10064 |
40108-40115 |
NNP |
denotes |
PixiMUS |
T10066 |
40116-40120 |
CD |
denotes |
1.46 |
T10067 |
40121-40122 |
-LRB- |
denotes |
( |
T10069 |
40122-40124 |
NNP |
denotes |
GE |
T10070 |
40124-40125 |
HYPH |
denotes |
- |
T10068 |
40125-40130 |
NNP |
denotes |
Lunar |
T10071 |
40130-40132 |
, |
denotes |
, |
T10072 |
40132-40139 |
NNP |
denotes |
Madison |
T10073 |
40139-40141 |
, |
denotes |
, |
T10074 |
40141-40150 |
NNP |
denotes |
Wisconsin |
T10075 |
40150-40152 |
, |
denotes |
, |
T10076 |
40152-40158 |
NNP |
denotes |
United |
T10077 |
40159-40165 |
NNP |
denotes |
States |
T10078 |
40165-40166 |
-RRB- |
denotes |
) |
T10079 |
40166-40167 |
. |
denotes |
. |
T10080 |
40167-40308 |
sentence |
denotes |
Morphometric parameters were determined on anesthetized mice at the time of sacrifice by direct measurement or from the Faxitron radiograph. |
T10081 |
40168-40180 |
JJ |
denotes |
Morphometric |
T10082 |
40181-40191 |
NNS |
denotes |
parameters |
T10084 |
40192-40196 |
VBD |
denotes |
were |
T10083 |
40197-40207 |
VBN |
denotes |
determined |
T10085 |
40208-40210 |
IN |
denotes |
on |
T10086 |
40211-40223 |
VBN |
denotes |
anesthetized |
T10087 |
40224-40228 |
NNS |
denotes |
mice |
T10088 |
40229-40231 |
IN |
denotes |
at |
T10089 |
40232-40235 |
DT |
denotes |
the |
T10090 |
40236-40240 |
NN |
denotes |
time |
T10091 |
40241-40243 |
IN |
denotes |
of |
T10092 |
40244-40253 |
NN |
denotes |
sacrifice |
T10093 |
40254-40256 |
IN |
denotes |
by |
T10094 |
40257-40263 |
JJ |
denotes |
direct |
T10095 |
40264-40275 |
NN |
denotes |
measurement |
T10096 |
40276-40278 |
CC |
denotes |
or |
T10097 |
40279-40283 |
IN |
denotes |
from |
T10098 |
40284-40287 |
DT |
denotes |
the |
T10100 |
40288-40296 |
NNP |
denotes |
Faxitron |
T10099 |
40297-40307 |
NN |
denotes |
radiograph |
T10101 |
40307-40308 |
. |
denotes |
. |
T10102 |
40308-40453 |
sentence |
denotes |
Micro-CT was performed on the left femur and fourth lumbar vertebra after removal of soft tissues and overnight fixation in 4% paraformaldehyde. |
T10103 |
40309-40317 |
NN |
denotes |
Micro-CT |
T10105 |
40318-40321 |
VBD |
denotes |
was |
T10104 |
40322-40331 |
VBN |
denotes |
performed |
T10106 |
40332-40334 |
IN |
denotes |
on |
T10107 |
40335-40338 |
DT |
denotes |
the |
T10109 |
40339-40343 |
JJ |
denotes |
left |
T10108 |
40344-40349 |
NN |
denotes |
femur |
T10110 |
40350-40353 |
CC |
denotes |
and |
T10111 |
40354-40360 |
JJ |
denotes |
fourth |
T10113 |
40361-40367 |
NN |
denotes |
lumbar |
T10112 |
40368-40376 |
NN |
denotes |
vertebra |
T10114 |
40377-40382 |
IN |
denotes |
after |
T10115 |
40383-40390 |
NN |
denotes |
removal |
T10116 |
40391-40393 |
IN |
denotes |
of |
T10117 |
40394-40398 |
JJ |
denotes |
soft |
T10118 |
40399-40406 |
NNS |
denotes |
tissues |
T10119 |
40407-40410 |
CC |
denotes |
and |
T10120 |
40411-40420 |
JJ |
denotes |
overnight |
T10121 |
40421-40429 |
NN |
denotes |
fixation |
T10122 |
40430-40432 |
IN |
denotes |
in |
T10123 |
40433-40434 |
CD |
denotes |
4 |
T10124 |
40434-40435 |
NN |
denotes |
% |
T10125 |
40436-40452 |
NN |
denotes |
paraformaldehyde |
T10126 |
40452-40453 |
. |
denotes |
. |
T10127 |
40453-40556 |
sentence |
denotes |
The distal metaphysis was scanned with a Skyscan 1072 micro-CT instrument (Skyscan, Antwerp, Belgium). |
T10128 |
40454-40457 |
DT |
denotes |
The |
T10130 |
40458-40464 |
JJ |
denotes |
distal |
T10129 |
40465-40475 |
NN |
denotes |
metaphysis |
T10132 |
40476-40479 |
VBD |
denotes |
was |
T10131 |
40480-40487 |
VBN |
denotes |
scanned |
T10133 |
40488-40492 |
IN |
denotes |
with |
T10134 |
40493-40494 |
DT |
denotes |
a |
T10136 |
40495-40502 |
NNP |
denotes |
Skyscan |
T10137 |
40503-40507 |
CD |
denotes |
1072 |
T10138 |
40508-40516 |
NN |
denotes |
micro-CT |
T10135 |
40517-40527 |
NN |
denotes |
instrument |
T10139 |
40528-40529 |
-LRB- |
denotes |
( |
T10140 |
40529-40536 |
NNP |
denotes |
Skyscan |
T10141 |
40536-40538 |
, |
denotes |
, |
T10142 |
40538-40545 |
NNP |
denotes |
Antwerp |
T10143 |
40545-40547 |
, |
denotes |
, |
T10144 |
40547-40554 |
NNP |
denotes |
Belgium |
T10145 |
40554-40555 |
-RRB- |
denotes |
) |
T10146 |
40555-40556 |
. |
denotes |
. |
T10147 |
40556-40646 |
sentence |
denotes |
Image acquisition was performed at 100 kV and 98 μA, with a 0.9° rotation between frames. |
T10148 |
40557-40562 |
NN |
denotes |
Image |
T10149 |
40563-40574 |
NN |
denotes |
acquisition |
T10151 |
40575-40578 |
VBD |
denotes |
was |
T10150 |
40579-40588 |
VBN |
denotes |
performed |
T10152 |
40589-40591 |
IN |
denotes |
at |
T10153 |
40592-40595 |
CD |
denotes |
100 |
T10154 |
40596-40598 |
NN |
denotes |
kV |
T10155 |
40599-40602 |
CC |
denotes |
and |
T10156 |
40603-40605 |
CD |
denotes |
98 |
T10157 |
40606-40608 |
NN |
denotes |
μA |
T10158 |
40608-40610 |
, |
denotes |
, |
T10159 |
40610-40614 |
IN |
denotes |
with |
T10160 |
40615-40616 |
DT |
denotes |
a |
T10162 |
40617-40620 |
CD |
denotes |
0.9 |
T10163 |
40620-40621 |
NN |
denotes |
° |
T10161 |
40622-40630 |
NN |
denotes |
rotation |
T10164 |
40631-40638 |
IN |
denotes |
between |
T10165 |
40639-40645 |
NNS |
denotes |
frames |
T10166 |
40645-40646 |
. |
denotes |
. |
T10167 |
40646-40816 |
sentence |
denotes |
The two-dimensional images were used to generate three-dimensional reconstructions to obtain quantitative data with the 3D Creator software supplied with the instrument. |
T10168 |
40647-40650 |
DT |
denotes |
The |
T10170 |
40651-40654 |
CD |
denotes |
two |
T10172 |
40654-40655 |
HYPH |
denotes |
- |
T10171 |
40655-40666 |
JJ |
denotes |
dimensional |
T10169 |
40667-40673 |
NNS |
denotes |
images |
T10174 |
40674-40678 |
VBD |
denotes |
were |
T10173 |
40679-40683 |
VBN |
denotes |
used |
T10175 |
40684-40686 |
TO |
denotes |
to |
T10176 |
40687-40695 |
VB |
denotes |
generate |
T10177 |
40696-40701 |
CD |
denotes |
three |
T10179 |
40701-40702 |
HYPH |
denotes |
- |
T10178 |
40702-40713 |
JJ |
denotes |
dimensional |
T10180 |
40714-40729 |
NNS |
denotes |
reconstructions |
T10181 |
40730-40732 |
TO |
denotes |
to |
T10182 |
40733-40739 |
VB |
denotes |
obtain |
T10183 |
40740-40752 |
JJ |
denotes |
quantitative |
T10184 |
40753-40757 |
NNS |
denotes |
data |
T10185 |
40758-40762 |
IN |
denotes |
with |
T10186 |
40763-40766 |
DT |
denotes |
the |
T10188 |
40767-40769 |
JJ |
denotes |
3D |
T10189 |
40770-40777 |
NN |
denotes |
Creator |
T10187 |
40778-40786 |
NN |
denotes |
software |
T10190 |
40787-40795 |
VBN |
denotes |
supplied |
T10191 |
40796-40800 |
IN |
denotes |
with |
T10192 |
40801-40804 |
DT |
denotes |
the |
T10193 |
40805-40815 |
NN |
denotes |
instrument |
T10194 |
40815-40816 |
. |
denotes |
. |
T10195 |
40816-40981 |
sentence |
denotes |
Serum biochemistry (ALP, Ca, PO4, Mg) was determined at the Rodent Diagnostics Lab (McGill University, Montréal, Quebec, Canada) using routine automated techniques. |
T10196 |
40817-40822 |
NN |
denotes |
Serum |
T10197 |
40823-40835 |
NN |
denotes |
biochemistry |
T10199 |
40836-40837 |
-LRB- |
denotes |
( |
T10201 |
40837-40840 |
NN |
denotes |
ALP |
T10202 |
40840-40842 |
, |
denotes |
, |
T10203 |
40842-40844 |
NN |
denotes |
Ca |
T10204 |
40844-40846 |
, |
denotes |
, |
T10205 |
40846-40849 |
NN |
denotes |
PO4 |
T10206 |
40849-40851 |
, |
denotes |
, |
T10200 |
40851-40853 |
NN |
denotes |
Mg |
T10207 |
40853-40854 |
-RRB- |
denotes |
) |
T10208 |
40855-40858 |
VBD |
denotes |
was |
T10198 |
40859-40869 |
VBN |
denotes |
determined |
T10209 |
40870-40872 |
IN |
denotes |
at |
T10210 |
40873-40876 |
DT |
denotes |
the |
T10212 |
40877-40883 |
NNP |
denotes |
Rodent |
T10213 |
40884-40895 |
NNP |
denotes |
Diagnostics |
T10211 |
40896-40899 |
NNP |
denotes |
Lab |
T10214 |
40900-40901 |
-LRB- |
denotes |
( |
T10216 |
40901-40907 |
NNP |
denotes |
McGill |
T10215 |
40908-40918 |
NNP |
denotes |
University |
T10217 |
40918-40920 |
, |
denotes |
, |
T10218 |
40920-40928 |
NNP |
denotes |
Montréal |
T10219 |
40928-40930 |
, |
denotes |
, |
T10220 |
40930-40936 |
NNP |
denotes |
Quebec |
T10221 |
40936-40938 |
, |
denotes |
, |
T10222 |
40938-40944 |
NNP |
denotes |
Canada |
T10223 |
40944-40945 |
-RRB- |
denotes |
) |
T10224 |
40946-40951 |
VBG |
denotes |
using |
T10225 |
40952-40959 |
JJ |
denotes |
routine |
T10227 |
40960-40969 |
VBN |
denotes |
automated |
T10226 |
40970-40980 |
NNS |
denotes |
techniques |
T10228 |
40980-40981 |
. |
denotes |
. |
T10229 |
40981-41233 |
sentence |
denotes |
Commercial assays were used to determine serum levels of CTX (RatLaps ELISA, Nordic Bioscience), 17β estradiol (IBL Immuno-Biological, Hamburg, Germany), leptin (R & D Systems, Minneapolis, Minnesota, United States), and interleukin-6 (R & D Systems). |
T10230 |
40982-40992 |
JJ |
denotes |
Commercial |
T10231 |
40993-40999 |
NNS |
denotes |
assays |
T10233 |
41000-41004 |
VBD |
denotes |
were |
T10232 |
41005-41009 |
VBN |
denotes |
used |
T10234 |
41010-41012 |
TO |
denotes |
to |
T10235 |
41013-41022 |
VB |
denotes |
determine |
T10236 |
41023-41028 |
NN |
denotes |
serum |
T10237 |
41029-41035 |
NNS |
denotes |
levels |
T10238 |
41036-41038 |
IN |
denotes |
of |
T10239 |
41039-41042 |
NN |
denotes |
CTX |
T10240 |
41043-41044 |
-LRB- |
denotes |
( |
T10242 |
41044-41051 |
NNP |
denotes |
RatLaps |
T10241 |
41052-41057 |
NNP |
denotes |
ELISA |
T10243 |
41057-41059 |
, |
denotes |
, |
T10244 |
41059-41065 |
NNP |
denotes |
Nordic |
T10245 |
41066-41076 |
NNP |
denotes |
Bioscience |
T10246 |
41076-41077 |
-RRB- |
denotes |
) |
T10247 |
41077-41079 |
, |
denotes |
, |
T10248 |
41079-41082 |
CD |
denotes |
17β |
T10249 |
41083-41092 |
NN |
denotes |
estradiol |
T10250 |
41093-41094 |
-LRB- |
denotes |
( |
T10252 |
41094-41097 |
NNP |
denotes |
IBL |
T10251 |
41098-41115 |
NNP |
denotes |
Immuno-Biological |
T10253 |
41115-41117 |
, |
denotes |
, |
T10254 |
41117-41124 |
NNP |
denotes |
Hamburg |
T10255 |
41124-41126 |
, |
denotes |
, |
T10256 |
41126-41133 |
NNP |
denotes |
Germany |
T10257 |
41133-41134 |
-RRB- |
denotes |
) |
T10258 |
41134-41136 |
, |
denotes |
, |
T10259 |
41136-41142 |
NN |
denotes |
leptin |
T10260 |
41143-41144 |
-LRB- |
denotes |
( |
T10262 |
41144-41145 |
NNP |
denotes |
R |
T10263 |
41146-41147 |
CC |
denotes |
& |
T10264 |
41148-41149 |
NNP |
denotes |
D |
T10261 |
41150-41157 |
NNP |
denotes |
Systems |
T10265 |
41157-41159 |
, |
denotes |
, |
T10266 |
41159-41170 |
NNP |
denotes |
Minneapolis |
T10267 |
41170-41172 |
, |
denotes |
, |
T10268 |
41172-41181 |
NNP |
denotes |
Minnesota |
T10269 |
41181-41183 |
, |
denotes |
, |
T10270 |
41183-41189 |
NNP |
denotes |
United |
T10271 |
41190-41196 |
NNP |
denotes |
States |
T10272 |
41196-41197 |
-RRB- |
denotes |
) |
T10273 |
41197-41199 |
, |
denotes |
, |
T10274 |
41199-41202 |
CC |
denotes |
and |
T10275 |
41203-41214 |
NN |
denotes |
interleukin |
T10276 |
41214-41215 |
HYPH |
denotes |
- |
T10277 |
41215-41216 |
CD |
denotes |
6 |
T10278 |
41217-41218 |
-LRB- |
denotes |
( |
T10280 |
41218-41219 |
NNP |
denotes |
R |
T10281 |
41220-41221 |
CC |
denotes |
& |
T10282 |
41222-41223 |
NNP |
denotes |
D |
T10279 |
41224-41231 |
NNP |
denotes |
Systems |
T10283 |
41231-41232 |
-RRB- |
denotes |
) |
T10284 |
41232-41233 |
. |
denotes |
. |
T10388 |
41235-41237 |
FW |
denotes |
Ex |
T10389 |
41238-41242 |
FW |
denotes |
vivo |
T10390 |
41243-41253 |
NN |
denotes |
assessment |
T10391 |
41254-41256 |
IN |
denotes |
of |
T10392 |
41257-41267 |
NN |
denotes |
osteoblast |
T10394 |
41268-41271 |
CC |
denotes |
and |
T10395 |
41272-41282 |
NN |
denotes |
osteoclast |
T10393 |
41283-41291 |
NN |
denotes |
activity |
T10396 |
41291-41292 |
. |
denotes |
. |
T10397 |
41292-41499 |
sentence |
denotes |
Bone marrow was flushed from the tibia and femora of juvenile 4-week-old Sam68+/+ and Sam68−/− mice to obtain stromal cells that were maintained in differentiation medium for 6 or 18 days as described [63]. |
T10398 |
41293-41297 |
NN |
denotes |
Bone |
T10399 |
41298-41304 |
NN |
denotes |
marrow |
T10401 |
41305-41308 |
VBD |
denotes |
was |
T10400 |
41309-41316 |
VBN |
denotes |
flushed |
T10402 |
41317-41321 |
IN |
denotes |
from |
T10403 |
41322-41325 |
DT |
denotes |
the |
T10404 |
41326-41331 |
NN |
denotes |
tibia |
T10405 |
41332-41335 |
CC |
denotes |
and |
T10406 |
41336-41342 |
NNS |
denotes |
femora |
T10407 |
41343-41345 |
IN |
denotes |
of |
T10408 |
41346-41354 |
JJ |
denotes |
juvenile |
T10410 |
41355-41356 |
CD |
denotes |
4 |
T10412 |
41356-41357 |
HYPH |
denotes |
- |
T10411 |
41357-41361 |
NN |
denotes |
week |
T10414 |
41361-41362 |
HYPH |
denotes |
- |
T10413 |
41362-41365 |
JJ |
denotes |
old |
T10415 |
41366-41371 |
NN |
denotes |
Sam68 |
T10416 |
41371-41372 |
SYM |
denotes |
+ |
T10417 |
41372-41373 |
HYPH |
denotes |
/ |
T10418 |
41373-41374 |
SYM |
denotes |
+ |
T10419 |
41375-41378 |
CC |
denotes |
and |
T10420 |
41379-41384 |
NN |
denotes |
Sam68 |
T10421 |
41384-41385 |
SYM |
denotes |
− |
T10422 |
41385-41386 |
HYPH |
denotes |
/ |
T10423 |
41386-41387 |
SYM |
denotes |
− |
T10409 |
41388-41392 |
NNS |
denotes |
mice |
T10424 |
41393-41395 |
TO |
denotes |
to |
T10425 |
41396-41402 |
VB |
denotes |
obtain |
T10426 |
41403-41410 |
JJ |
denotes |
stromal |
T10427 |
41411-41416 |
NNS |
denotes |
cells |
T10428 |
41417-41421 |
WDT |
denotes |
that |
T10430 |
41422-41426 |
VBD |
denotes |
were |
T10429 |
41427-41437 |
VBN |
denotes |
maintained |
T10431 |
41438-41440 |
IN |
denotes |
in |
T10432 |
41441-41456 |
NN |
denotes |
differentiation |
T10433 |
41457-41463 |
NN |
denotes |
medium |
T10434 |
41464-41467 |
IN |
denotes |
for |
T10435 |
41468-41469 |
CD |
denotes |
6 |
T10437 |
41470-41472 |
CC |
denotes |
or |
T10438 |
41473-41475 |
CD |
denotes |
18 |
T10436 |
41476-41480 |
NNS |
denotes |
days |
T10439 |
41481-41483 |
IN |
denotes |
as |
T10440 |
41484-41493 |
VBN |
denotes |
described |
T10441 |
41494-41495 |
-LRB- |
denotes |
[ |
T10442 |
41495-41497 |
CD |
denotes |
63 |
T10443 |
41497-41498 |
-RRB- |
denotes |
] |
T10444 |
41498-41499 |
. |
denotes |
. |
T10445 |
41499-41602 |
sentence |
denotes |
Cultures were stained in situ for ALP activity and with von Kossa stain to detect mineralized nodules. |
T10446 |
41500-41508 |
NNS |
denotes |
Cultures |
T10448 |
41509-41513 |
VBD |
denotes |
were |
T10447 |
41514-41521 |
VBN |
denotes |
stained |
T10449 |
41522-41524 |
FW |
denotes |
in |
T10450 |
41525-41529 |
FW |
denotes |
situ |
T10451 |
41530-41533 |
IN |
denotes |
for |
T10452 |
41534-41537 |
NN |
denotes |
ALP |
T10453 |
41538-41546 |
NN |
denotes |
activity |
T10454 |
41547-41550 |
CC |
denotes |
and |
T10455 |
41551-41555 |
IN |
denotes |
with |
T10456 |
41556-41559 |
NNP |
denotes |
von |
T10457 |
41560-41565 |
NNP |
denotes |
Kossa |
T10458 |
41566-41571 |
NN |
denotes |
stain |
T10459 |
41572-41574 |
TO |
denotes |
to |
T10460 |
41575-41581 |
VB |
denotes |
detect |
T10461 |
41582-41593 |
VBN |
denotes |
mineralized |
T10462 |
41594-41601 |
NNS |
denotes |
nodules |
T10463 |
41601-41602 |
. |
denotes |
. |
T10464 |
41602-41747 |
sentence |
denotes |
Total RNA was harvested from parallel cultures for RT-PCR analysis of osteoblast-related gene expression over time as described previously [63]. |
T10465 |
41603-41608 |
JJ |
denotes |
Total |
T10466 |
41609-41612 |
NN |
denotes |
RNA |
T10468 |
41613-41616 |
VBD |
denotes |
was |
T10467 |
41617-41626 |
VBN |
denotes |
harvested |
T10469 |
41627-41631 |
IN |
denotes |
from |
T10470 |
41632-41640 |
JJ |
denotes |
parallel |
T10471 |
41641-41649 |
NNS |
denotes |
cultures |
T10472 |
41650-41653 |
IN |
denotes |
for |
T10473 |
41654-41656 |
NN |
denotes |
RT |
T10475 |
41656-41657 |
HYPH |
denotes |
- |
T10474 |
41657-41660 |
NN |
denotes |
PCR |
T10476 |
41661-41669 |
NN |
denotes |
analysis |
T10477 |
41670-41672 |
IN |
denotes |
of |
T10478 |
41673-41683 |
NN |
denotes |
osteoblast |
T10480 |
41683-41684 |
HYPH |
denotes |
- |
T10479 |
41684-41691 |
VBN |
denotes |
related |
T10482 |
41692-41696 |
NN |
denotes |
gene |
T10481 |
41697-41707 |
NN |
denotes |
expression |
T10483 |
41708-41712 |
IN |
denotes |
over |
T10484 |
41713-41717 |
NN |
denotes |
time |
T10485 |
41718-41720 |
IN |
denotes |
as |
T10486 |
41721-41730 |
VBN |
denotes |
described |
T10487 |
41731-41741 |
RB |
denotes |
previously |
T10488 |
41742-41743 |
-LRB- |
denotes |
[ |
T10489 |
41743-41745 |
CD |
denotes |
63 |
T10490 |
41745-41746 |
-RRB- |
denotes |
] |
T10491 |
41746-41747 |
. |
denotes |
. |
T10492 |
41747-41893 |
sentence |
denotes |
Osteoclasts were isolated from the crushed long bones of juvenile Sam68+/+ and Sam68−/− mice and used for quantitative studies as described [64]. |
T10493 |
41748-41759 |
NNS |
denotes |
Osteoclasts |
T10495 |
41760-41764 |
VBD |
denotes |
were |
T10494 |
41765-41773 |
VBN |
denotes |
isolated |
T10496 |
41774-41778 |
IN |
denotes |
from |
T10497 |
41779-41782 |
DT |
denotes |
the |
T10499 |
41783-41790 |
VBN |
denotes |
crushed |
T10500 |
41791-41795 |
JJ |
denotes |
long |
T10498 |
41796-41801 |
NNS |
denotes |
bones |
T10501 |
41802-41804 |
IN |
denotes |
of |
T10502 |
41805-41813 |
JJ |
denotes |
juvenile |
T10504 |
41814-41819 |
NN |
denotes |
Sam68 |
T10505 |
41819-41820 |
SYM |
denotes |
+ |
T10506 |
41820-41821 |
HYPH |
denotes |
/ |
T10507 |
41821-41822 |
SYM |
denotes |
+ |
T10508 |
41823-41826 |
CC |
denotes |
and |
T10509 |
41827-41832 |
NN |
denotes |
Sam68 |
T10510 |
41832-41833 |
SYM |
denotes |
− |
T10511 |
41833-41834 |
HYPH |
denotes |
/ |
T10512 |
41834-41835 |
SYM |
denotes |
− |
T10503 |
41836-41840 |
NNS |
denotes |
mice |
T10513 |
41841-41844 |
CC |
denotes |
and |
T10514 |
41845-41849 |
VBN |
denotes |
used |
T10515 |
41850-41853 |
IN |
denotes |
for |
T10516 |
41854-41866 |
JJ |
denotes |
quantitative |
T10517 |
41867-41874 |
NNS |
denotes |
studies |
T10518 |
41875-41877 |
IN |
denotes |
as |
T10519 |
41878-41887 |
VBN |
denotes |
described |
T10520 |
41888-41889 |
-LRB- |
denotes |
[ |
T10521 |
41889-41891 |
CD |
denotes |
64 |
T10522 |
41891-41892 |
-RRB- |
denotes |
] |
T10523 |
41892-41893 |
. |
denotes |
. |
T10524 |
41893-42046 |
sentence |
denotes |
Briefly, cells were plated on glass coverslips or on dentin slices in 24-well cluster plates for assessment of cell number and pit number, respectively. |
T10525 |
41894-41901 |
RB |
denotes |
Briefly |
T10527 |
41901-41903 |
, |
denotes |
, |
T10528 |
41903-41908 |
NNS |
denotes |
cells |
T10529 |
41909-41913 |
VBD |
denotes |
were |
T10526 |
41914-41920 |
VBN |
denotes |
plated |
T10530 |
41921-41923 |
IN |
denotes |
on |
T10531 |
41924-41929 |
NN |
denotes |
glass |
T10532 |
41930-41940 |
NNS |
denotes |
coverslips |
T10533 |
41941-41943 |
CC |
denotes |
or |
T10534 |
41944-41946 |
IN |
denotes |
on |
T10535 |
41947-41953 |
NN |
denotes |
dentin |
T10536 |
41954-41960 |
NNS |
denotes |
slices |
T10537 |
41961-41963 |
IN |
denotes |
in |
T10538 |
41964-41966 |
CD |
denotes |
24 |
T10540 |
41966-41967 |
HYPH |
denotes |
- |
T10539 |
41967-41971 |
NN |
denotes |
well |
T10542 |
41972-41979 |
NN |
denotes |
cluster |
T10541 |
41980-41986 |
NNS |
denotes |
plates |
T10543 |
41987-41990 |
IN |
denotes |
for |
T10544 |
41991-42001 |
NN |
denotes |
assessment |
T10545 |
42002-42004 |
IN |
denotes |
of |
T10546 |
42005-42009 |
NN |
denotes |
cell |
T10547 |
42010-42016 |
NN |
denotes |
number |
T10548 |
42017-42020 |
CC |
denotes |
and |
T10549 |
42021-42024 |
NN |
denotes |
pit |
T10550 |
42025-42031 |
NN |
denotes |
number |
T10551 |
42031-42033 |
, |
denotes |
, |
T10552 |
42033-42045 |
RB |
denotes |
respectively |
T10553 |
42045-42046 |
. |
denotes |
. |
T10554 |
42046-42136 |
sentence |
denotes |
Cover slips were immersed in 4% paraformaldehyde and stained for TRAP activity after 2 h. |
T10555 |
42047-42052 |
NN |
denotes |
Cover |
T10556 |
42053-42058 |
NNS |
denotes |
slips |
T10558 |
42059-42063 |
VBD |
denotes |
were |
T10557 |
42064-42072 |
VBN |
denotes |
immersed |
T10559 |
42073-42075 |
IN |
denotes |
in |
T10560 |
42076-42077 |
CD |
denotes |
4 |
T10561 |
42077-42078 |
NN |
denotes |
% |
T10562 |
42079-42095 |
NN |
denotes |
paraformaldehyde |
T10563 |
42096-42099 |
CC |
denotes |
and |
T10564 |
42100-42107 |
VBN |
denotes |
stained |
T10565 |
42108-42111 |
IN |
denotes |
for |
T10566 |
42112-42116 |
NN |
denotes |
TRAP |
T10567 |
42117-42125 |
NN |
denotes |
activity |
T10568 |
42126-42131 |
IN |
denotes |
after |
T10569 |
42132-42133 |
CD |
denotes |
2 |
T10570 |
42134-42135 |
NN |
denotes |
h |
T10571 |
42135-42136 |
. |
denotes |
. |
T10572 |
42136-42359 |
sentence |
denotes |
Dentin slices were left for 28 h before removing the cells with 1 M ammonium hydroxide and air drying before coating with sputter Au-Pd and examination with scanning electron microscopy (McGill Electron Microscopy Centre). |
T10573 |
42137-42143 |
NN |
denotes |
Dentin |
T10574 |
42144-42150 |
NNS |
denotes |
slices |
T10576 |
42151-42155 |
VBD |
denotes |
were |
T10575 |
42156-42160 |
VBN |
denotes |
left |
T10577 |
42161-42164 |
IN |
denotes |
for |
T10578 |
42165-42167 |
CD |
denotes |
28 |
T10579 |
42168-42169 |
NN |
denotes |
h |
T10580 |
42170-42176 |
IN |
denotes |
before |
T10581 |
42177-42185 |
VBG |
denotes |
removing |
T10582 |
42186-42189 |
DT |
denotes |
the |
T10583 |
42190-42195 |
NNS |
denotes |
cells |
T10584 |
42196-42200 |
IN |
denotes |
with |
T10585 |
42201-42202 |
CD |
denotes |
1 |
T10586 |
42203-42204 |
NN |
denotes |
M |
T10588 |
42205-42213 |
NN |
denotes |
ammonium |
T10587 |
42214-42223 |
NN |
denotes |
hydroxide |
T10589 |
42224-42227 |
CC |
denotes |
and |
T10590 |
42228-42231 |
NN |
denotes |
air |
T10591 |
42232-42238 |
VBG |
denotes |
drying |
T10592 |
42239-42245 |
IN |
denotes |
before |
T10593 |
42246-42253 |
VBG |
denotes |
coating |
T10594 |
42254-42258 |
IN |
denotes |
with |
T10595 |
42259-42266 |
NN |
denotes |
sputter |
T10597 |
42267-42269 |
NN |
denotes |
Au |
T10598 |
42269-42270 |
HYPH |
denotes |
- |
T10596 |
42270-42272 |
NN |
denotes |
Pd |
T10599 |
42273-42276 |
CC |
denotes |
and |
T10600 |
42277-42288 |
NN |
denotes |
examination |
T10601 |
42289-42293 |
IN |
denotes |
with |
T10602 |
42294-42302 |
VBG |
denotes |
scanning |
T10604 |
42303-42311 |
NN |
denotes |
electron |
T10603 |
42312-42322 |
NN |
denotes |
microscopy |
T10605 |
42323-42324 |
-LRB- |
denotes |
( |
T10607 |
42324-42330 |
NNP |
denotes |
McGill |
T10608 |
42331-42339 |
NNP |
denotes |
Electron |
T10609 |
42340-42350 |
NNP |
denotes |
Microscopy |
T10606 |
42351-42357 |
NNP |
denotes |
Centre |
T10610 |
42357-42358 |
-RRB- |
denotes |
) |
T10611 |
42358-42359 |
. |
denotes |
. |
T10612 |
42359-42462 |
sentence |
denotes |
Light microscope images were captured using a Leica DMR microscope equipped with a Retiga 1300 camera. |
T10613 |
42360-42365 |
NN |
denotes |
Light |
T10614 |
42366-42376 |
NN |
denotes |
microscope |
T10615 |
42377-42383 |
NNS |
denotes |
images |
T10617 |
42384-42388 |
VBD |
denotes |
were |
T10616 |
42389-42397 |
VBN |
denotes |
captured |
T10618 |
42398-42403 |
VBG |
denotes |
using |
T10619 |
42404-42405 |
DT |
denotes |
a |
T10621 |
42406-42411 |
NNP |
denotes |
Leica |
T10622 |
42412-42415 |
NNP |
denotes |
DMR |
T10620 |
42416-42426 |
NN |
denotes |
microscope |
T10623 |
42427-42435 |
VBN |
denotes |
equipped |
T10624 |
42436-42440 |
IN |
denotes |
with |
T10625 |
42441-42442 |
DT |
denotes |
a |
T10627 |
42443-42449 |
NNP |
denotes |
Retiga |
T10628 |
42450-42454 |
CD |
denotes |
1300 |
T10626 |
42455-42461 |
NN |
denotes |
camera |
T10629 |
42461-42462 |
. |
denotes |
. |
T10630 |
42462-42602 |
sentence |
denotes |
Quantitative analyses were performed using Adobe Photoshop and the data presented as the mean ± SD of two or three independent experiments. |
T10631 |
42463-42475 |
JJ |
denotes |
Quantitative |
T10632 |
42476-42484 |
NNS |
denotes |
analyses |
T10634 |
42485-42489 |
VBD |
denotes |
were |
T10633 |
42490-42499 |
VBN |
denotes |
performed |
T10635 |
42500-42505 |
VBG |
denotes |
using |
T10636 |
42506-42511 |
NNP |
denotes |
Adobe |
T10637 |
42512-42521 |
NNP |
denotes |
Photoshop |
T10638 |
42522-42525 |
CC |
denotes |
and |
T10639 |
42526-42529 |
DT |
denotes |
the |
T10640 |
42530-42534 |
NNS |
denotes |
data |
T10641 |
42535-42544 |
VBN |
denotes |
presented |
T10642 |
42545-42547 |
IN |
denotes |
as |
T10643 |
42548-42551 |
DT |
denotes |
the |
T10645 |
42552-42556 |
NN |
denotes |
mean |
T10646 |
42557-42558 |
SYM |
denotes |
± |
T10644 |
42559-42561 |
NN |
denotes |
SD |
T10647 |
42562-42564 |
IN |
denotes |
of |
T10648 |
42565-42568 |
CD |
denotes |
two |
T10650 |
42569-42571 |
CC |
denotes |
or |
T10651 |
42572-42577 |
CD |
denotes |
three |
T10652 |
42578-42589 |
JJ |
denotes |
independent |
T10649 |
42590-42601 |
NNS |
denotes |
experiments |
T10653 |
42601-42602 |
. |
denotes |
. |
T10654 |
42602-42664 |
sentence |
denotes |
Statistical comparisons were made using the Student's t test. |
T10655 |
42603-42614 |
JJ |
denotes |
Statistical |
T10656 |
42615-42626 |
NNS |
denotes |
comparisons |
T10658 |
42627-42631 |
VBD |
denotes |
were |
T10657 |
42632-42636 |
VBN |
denotes |
made |
T10659 |
42637-42642 |
VBG |
denotes |
using |
T10660 |
42643-42646 |
DT |
denotes |
the |
T10661 |
42647-42654 |
NNP |
denotes |
Student |
T10663 |
42654-42656 |
POS |
denotes |
's |
T10664 |
42657-42658 |
NN |
denotes |
t |
T10662 |
42659-42663 |
NN |
denotes |
test |
T10665 |
42663-42664 |
. |
denotes |
. |
T10693 |
42666-42677 |
NN |
denotes |
Preparation |
T10694 |
42678-42680 |
IN |
denotes |
of |
T10695 |
42681-42686 |
NN |
denotes |
mouse |
T10697 |
42687-42696 |
JJ |
denotes |
embryonic |
T10696 |
42697-42707 |
NN |
denotes |
fibroblast |
T10698 |
42708-42711 |
CC |
denotes |
and |
T10699 |
42712-42721 |
NN |
denotes |
induction |
T10700 |
42722-42724 |
IN |
denotes |
of |
T10701 |
42725-42734 |
NN |
denotes |
adipocyte |
T10702 |
42735-42750 |
NN |
denotes |
differentiation |
T10703 |
42750-42751 |
. |
denotes |
. |
T10704 |
42751-42797 |
sentence |
denotes |
MEFs were prepared from 14.5-day-old embryos. |
T10705 |
42752-42756 |
NNS |
denotes |
MEFs |
T10707 |
42757-42761 |
VBD |
denotes |
were |
T10706 |
42762-42770 |
VBN |
denotes |
prepared |
T10708 |
42771-42775 |
IN |
denotes |
from |
T10709 |
42776-42780 |
CD |
denotes |
14.5 |
T10711 |
42780-42781 |
HYPH |
denotes |
- |
T10710 |
42781-42784 |
NN |
denotes |
day |
T10713 |
42784-42785 |
HYPH |
denotes |
- |
T10712 |
42785-42788 |
JJ |
denotes |
old |
T10714 |
42789-42796 |
NNS |
denotes |
embryos |
T10715 |
42796-42797 |
. |
denotes |
. |
T10716 |
42797-42972 |
sentence |
denotes |
Only early-passage MEFs were used for the experimental studies, and induction of adipocyte differentiation was carried out according to the methods previously described [30]. |
T10717 |
42798-42802 |
RB |
denotes |
Only |
T10719 |
42803-42808 |
JJ |
denotes |
early |
T10721 |
42808-42809 |
HYPH |
denotes |
- |
T10720 |
42809-42816 |
NN |
denotes |
passage |
T10718 |
42817-42821 |
NNS |
denotes |
MEFs |
T10723 |
42822-42826 |
VBD |
denotes |
were |
T10722 |
42827-42831 |
VBN |
denotes |
used |
T10724 |
42832-42835 |
IN |
denotes |
for |
T10725 |
42836-42839 |
DT |
denotes |
the |
T10727 |
42840-42852 |
JJ |
denotes |
experimental |
T10726 |
42853-42860 |
NNS |
denotes |
studies |
T10728 |
42860-42862 |
, |
denotes |
, |
T10729 |
42862-42865 |
CC |
denotes |
and |
T10730 |
42866-42875 |
NN |
denotes |
induction |
T10732 |
42876-42878 |
IN |
denotes |
of |
T10733 |
42879-42888 |
NN |
denotes |
adipocyte |
T10734 |
42889-42904 |
NN |
denotes |
differentiation |
T10735 |
42905-42908 |
VBD |
denotes |
was |
T10731 |
42909-42916 |
VBN |
denotes |
carried |
T10736 |
42917-42920 |
RP |
denotes |
out |
T10737 |
42921-42930 |
VBG |
denotes |
according |
T10738 |
42931-42933 |
IN |
denotes |
to |
T10739 |
42934-42937 |
DT |
denotes |
the |
T10740 |
42938-42945 |
NNS |
denotes |
methods |
T10741 |
42946-42956 |
RB |
denotes |
previously |
T10742 |
42957-42966 |
VBN |
denotes |
described |
T10743 |
42967-42968 |
-LRB- |
denotes |
[ |
T10744 |
42968-42970 |
CD |
denotes |
30 |
T10745 |
42970-42971 |
-RRB- |
denotes |
] |
T10746 |
42971-42972 |
. |
denotes |
. |
T10747 |
42972-43034 |
sentence |
denotes |
Cultured cells were stained with Oil Red O as described [29]. |
T10748 |
42973-42981 |
VBN |
denotes |
Cultured |
T10749 |
42982-42987 |
NNS |
denotes |
cells |
T10751 |
42988-42992 |
VBD |
denotes |
were |
T10750 |
42993-43000 |
VBN |
denotes |
stained |
T10752 |
43001-43005 |
IN |
denotes |
with |
T10753 |
43006-43009 |
NN |
denotes |
Oil |
T10755 |
43010-43013 |
NN |
denotes |
Red |
T10754 |
43014-43015 |
NN |
denotes |
O |
T10756 |
43016-43018 |
IN |
denotes |
as |
T10757 |
43019-43028 |
VBN |
denotes |
described |
T10758 |
43029-43030 |
-LRB- |
denotes |
[ |
T10759 |
43030-43032 |
CD |
denotes |
29 |
T10760 |
43032-43033 |
-RRB- |
denotes |
] |
T10761 |
43033-43034 |
. |
denotes |
. |
T10818 |
43036-43039 |
NN |
denotes |
RNA |
T10819 |
43040-43051 |
NN |
denotes |
preparation |
T10820 |
43052-43055 |
CC |
denotes |
and |
T10821 |
43056-43058 |
NN |
denotes |
RT |
T10823 |
43058-43059 |
HYPH |
denotes |
- |
T10822 |
43059-43062 |
NN |
denotes |
PCR |
T10824 |
43063-43065 |
TO |
denotes |
to |
T10825 |
43066-43072 |
VB |
denotes |
assess |
T10826 |
43073-43085 |
NN |
denotes |
adipogenesis |
T10827 |
43086-43088 |
IN |
denotes |
in |
T10828 |
43089-43094 |
NN |
denotes |
Sam68 |
T10830 |
43094-43095 |
SYM |
denotes |
− |
T10831 |
43095-43096 |
HYPH |
denotes |
/ |
T10832 |
43096-43097 |
SYM |
denotes |
− |
T10829 |
43098-43102 |
NNS |
denotes |
MEFs |
T10833 |
43102-43103 |
. |
denotes |
. |
T10834 |
43103-43245 |
sentence |
denotes |
Total cellular RNA was prepared by TRIzol reagent according to the manufacturer's protocol (Invitrogen, Carlsbad, California, United States). |
T10835 |
43104-43109 |
JJ |
denotes |
Total |
T10837 |
43110-43118 |
JJ |
denotes |
cellular |
T10836 |
43119-43122 |
NN |
denotes |
RNA |
T10839 |
43123-43126 |
VBD |
denotes |
was |
T10838 |
43127-43135 |
VBN |
denotes |
prepared |
T10840 |
43136-43138 |
IN |
denotes |
by |
T10841 |
43139-43145 |
NN |
denotes |
TRIzol |
T10842 |
43146-43153 |
NN |
denotes |
reagent |
T10843 |
43154-43163 |
VBG |
denotes |
according |
T10844 |
43164-43166 |
IN |
denotes |
to |
T10845 |
43167-43170 |
DT |
denotes |
the |
T10846 |
43171-43183 |
NN |
denotes |
manufacturer |
T10848 |
43183-43185 |
POS |
denotes |
's |
T10847 |
43186-43194 |
NN |
denotes |
protocol |
T10849 |
43195-43196 |
-LRB- |
denotes |
( |
T10850 |
43196-43206 |
NNP |
denotes |
Invitrogen |
T10851 |
43206-43208 |
, |
denotes |
, |
T10852 |
43208-43216 |
NNP |
denotes |
Carlsbad |
T10853 |
43216-43218 |
, |
denotes |
, |
T10854 |
43218-43228 |
NNP |
denotes |
California |
T10855 |
43228-43230 |
, |
denotes |
, |
T10856 |
43230-43236 |
NNP |
denotes |
United |
T10857 |
43237-43243 |
NNP |
denotes |
States |
T10858 |
43243-43244 |
-RRB- |
denotes |
) |
T10859 |
43244-43245 |
. |
denotes |
. |
T10860 |
43245-43327 |
sentence |
denotes |
Total RNA (1 μg) was reverse-transcribed, and cDNA samples were subjected to PCR. |
T10861 |
43246-43251 |
JJ |
denotes |
Total |
T10862 |
43252-43255 |
NN |
denotes |
RNA |
T10864 |
43256-43257 |
-LRB- |
denotes |
( |
T10866 |
43257-43258 |
CD |
denotes |
1 |
T10865 |
43259-43261 |
NN |
denotes |
μg |
T10867 |
43261-43262 |
-RRB- |
denotes |
) |
T10868 |
43263-43266 |
VBD |
denotes |
was |
T10869 |
43267-43274 |
RB |
denotes |
reverse |
T10870 |
43274-43275 |
HYPH |
denotes |
- |
T10863 |
43275-43286 |
VBN |
denotes |
transcribed |
T10871 |
43286-43288 |
, |
denotes |
, |
T10872 |
43288-43291 |
CC |
denotes |
and |
T10873 |
43292-43296 |
NN |
denotes |
cDNA |
T10874 |
43297-43304 |
NNS |
denotes |
samples |
T10876 |
43305-43309 |
VBD |
denotes |
were |
T10875 |
43310-43319 |
VBN |
denotes |
subjected |
T10877 |
43320-43322 |
IN |
denotes |
to |
T10878 |
43323-43326 |
NN |
denotes |
PCR |
T10879 |
43326-43327 |
. |
denotes |
. |
T10880 |
43327-43388 |
sentence |
denotes |
RT-PCR was normalized by the transcriptional level of GAPDH. |
T10881 |
43328-43330 |
NN |
denotes |
RT |
T10883 |
43330-43331 |
HYPH |
denotes |
- |
T10882 |
43331-43334 |
NN |
denotes |
PCR |
T10885 |
43335-43338 |
VBD |
denotes |
was |
T10884 |
43339-43349 |
VBN |
denotes |
normalized |
T10886 |
43350-43352 |
IN |
denotes |
by |
T10887 |
43353-43356 |
DT |
denotes |
the |
T10889 |
43357-43372 |
JJ |
denotes |
transcriptional |
T10888 |
43373-43378 |
NN |
denotes |
level |
T10890 |
43379-43381 |
IN |
denotes |
of |
T10891 |
43382-43387 |
NN |
denotes |
GAPDH |
T10892 |
43387-43388 |
. |
denotes |
. |
T10893 |
43388-43789 |
sentence |
denotes |
The following 5′ and 3′ primers were used to evaluate adipogenic differentiation: KLF5: 5'-AGA CAA GCT GAG ATG CTG C-3′, 5′-GGC AAA CCT CCA GTC GC-3′; PPARγ: 5′-GTG CGA TCA AAG TAG AAC CTG C-3′, 5′-CCT ATC ATA AAT AAG CTT CAA TCG-3′; β-Actin: 5′-TAG GCG GAC TGT TAC TGA GC-3′, 5′-AGC CTT CAT ACA TCA AGT TGG-3′; and Sam68: 5′- GTG GAG ACC CCA AAT ATG CCC A-3′ and 5′-AAA CTG CTC CTG ACA GAT ATC A-3′. |
T10894 |
43389-43392 |
DT |
denotes |
The |
T10896 |
43393-43402 |
VBG |
denotes |
following |
T10897 |
43403-43404 |
CD |
denotes |
5 |
T10898 |
43404-43405 |
SYM |
denotes |
′ |
T10899 |
43406-43409 |
CC |
denotes |
and |
T10900 |
43410-43411 |
CD |
denotes |
3 |
T10901 |
43411-43412 |
SYM |
denotes |
′ |
T10895 |
43413-43420 |
NNS |
denotes |
primers |
T10903 |
43421-43425 |
VBD |
denotes |
were |
T10902 |
43426-43430 |
VBN |
denotes |
used |
T10904 |
43431-43433 |
TO |
denotes |
to |
T10905 |
43434-43442 |
VB |
denotes |
evaluate |
T10906 |
43443-43453 |
JJ |
denotes |
adipogenic |
T10907 |
43454-43469 |
NN |
denotes |
differentiation |
T10908 |
43469-43471 |
: |
denotes |
: |
T10909 |
43471-43475 |
NN |
denotes |
KLF5 |
T10910 |
43475-43477 |
: |
denotes |
: |
T10911 |
43477-43478 |
CD |
denotes |
5 |
T10912 |
43478-43479 |
SYM |
denotes |
' |
T10913 |
43479-43480 |
HYPH |
denotes |
- |
T10914 |
43480-43483 |
NN |
denotes |
AGA |
T10916 |
43484-43487 |
NN |
denotes |
CAA |
T10917 |
43488-43491 |
NN |
denotes |
GCT |
T10918 |
43492-43495 |
NN |
denotes |
GAG |
T10919 |
43496-43499 |
NN |
denotes |
ATG |
T10920 |
43500-43503 |
NN |
denotes |
CTG |
T10915 |
43504-43505 |
NN |
denotes |
C |
T10921 |
43505-43506 |
HYPH |
denotes |
- |
T10922 |
43506-43507 |
CD |
denotes |
3 |
T10923 |
43507-43508 |
SYM |
denotes |
′ |
T10924 |
43508-43510 |
, |
denotes |
, |
T10925 |
43510-43511 |
CD |
denotes |
5 |
T10926 |
43511-43512 |
SYM |
denotes |
′ |
T10927 |
43512-43513 |
HYPH |
denotes |
- |
T10928 |
43513-43516 |
NN |
denotes |
GGC |
T10930 |
43517-43520 |
NN |
denotes |
AAA |
T10931 |
43521-43524 |
NN |
denotes |
CCT |
T10932 |
43525-43528 |
NN |
denotes |
CCA |
T10933 |
43529-43532 |
NN |
denotes |
GTC |
T10929 |
43533-43535 |
NN |
denotes |
GC |
T10934 |
43535-43536 |
HYPH |
denotes |
- |
T10935 |
43536-43537 |
CD |
denotes |
3 |
T10936 |
43537-43538 |
SYM |
denotes |
′ |
T10937 |
43538-43539 |
: |
denotes |
; |
T10938 |
43540-43545 |
NN |
denotes |
PPARγ |
T10939 |
43545-43547 |
: |
denotes |
: |
T10940 |
43547-43548 |
CD |
denotes |
5 |
T10941 |
43548-43549 |
SYM |
denotes |
′ |
T10942 |
43549-43550 |
HYPH |
denotes |
- |
T10943 |
43550-43553 |
NN |
denotes |
GTG |
T10945 |
43554-43557 |
NN |
denotes |
CGA |
T10946 |
43558-43561 |
NN |
denotes |
TCA |
T10947 |
43562-43565 |
NN |
denotes |
AAG |
T10948 |
43566-43569 |
NN |
denotes |
TAG |
T10949 |
43570-43573 |
NN |
denotes |
AAC |
T10950 |
43574-43577 |
NN |
denotes |
CTG |
T10944 |
43578-43579 |
NN |
denotes |
C |
T10951 |
43579-43580 |
HYPH |
denotes |
- |
T10952 |
43580-43581 |
CD |
denotes |
3 |
T10953 |
43581-43582 |
SYM |
denotes |
′ |
T10954 |
43582-43584 |
, |
denotes |
, |
T10955 |
43584-43585 |
CD |
denotes |
5 |
T10956 |
43585-43586 |
SYM |
denotes |
′ |
T10957 |
43586-43587 |
HYPH |
denotes |
- |
T10958 |
43587-43590 |
NN |
denotes |
CCT |
T10960 |
43591-43594 |
NN |
denotes |
ATC |
T10961 |
43595-43598 |
NN |
denotes |
ATA |
T10962 |
43599-43602 |
NN |
denotes |
AAT |
T10963 |
43603-43606 |
NN |
denotes |
AAG |
T10964 |
43607-43610 |
NN |
denotes |
CTT |
T10965 |
43611-43614 |
NN |
denotes |
CAA |
T10959 |
43615-43618 |
NN |
denotes |
TCG |
T10966 |
43618-43619 |
HYPH |
denotes |
- |
T10967 |
43619-43620 |
CD |
denotes |
3 |
T10968 |
43620-43621 |
SYM |
denotes |
′ |
T10969 |
43621-43622 |
: |
denotes |
; |
T10970 |
43623-43624 |
NN |
denotes |
β |
T10972 |
43624-43625 |
HYPH |
denotes |
- |
T10971 |
43625-43630 |
NN |
denotes |
Actin |
T10973 |
43630-43632 |
: |
denotes |
: |
T10974 |
43632-43633 |
CD |
denotes |
5 |
T10975 |
43633-43634 |
SYM |
denotes |
′ |
T10976 |
43634-43635 |
HYPH |
denotes |
- |
T10977 |
43635-43638 |
NN |
denotes |
TAG |
T10979 |
43639-43642 |
NN |
denotes |
GCG |
T10980 |
43643-43646 |
NN |
denotes |
GAC |
T10981 |
43647-43650 |
NN |
denotes |
TGT |
T10982 |
43651-43654 |
NN |
denotes |
TAC |
T10983 |
43655-43658 |
NN |
denotes |
TGA |
T10978 |
43659-43661 |
NN |
denotes |
GC |
T10984 |
43661-43662 |
HYPH |
denotes |
- |
T10985 |
43662-43663 |
CD |
denotes |
3 |
T10986 |
43663-43664 |
SYM |
denotes |
′ |
T10987 |
43664-43666 |
, |
denotes |
, |
T10988 |
43666-43667 |
CD |
denotes |
5 |
T10989 |
43667-43668 |
SYM |
denotes |
′ |
T10990 |
43668-43669 |
HYPH |
denotes |
- |
T10991 |
43669-43672 |
NN |
denotes |
AGC |
T10993 |
43673-43676 |
NN |
denotes |
CTT |
T10994 |
43677-43680 |
NN |
denotes |
CAT |
T10995 |
43681-43684 |
NN |
denotes |
ACA |
T10996 |
43685-43688 |
NN |
denotes |
TCA |
T10997 |
43689-43692 |
NN |
denotes |
AGT |
T10992 |
43693-43696 |
NN |
denotes |
TGG |
T10998 |
43696-43697 |
HYPH |
denotes |
- |
T10999 |
43697-43698 |
CD |
denotes |
3 |
T11000 |
43698-43699 |
SYM |
denotes |
′ |
T11001 |
43699-43700 |
: |
denotes |
; |
T11002 |
43701-43704 |
CC |
denotes |
and |
T11003 |
43705-43710 |
NN |
denotes |
Sam68 |
T11004 |
43710-43712 |
: |
denotes |
: |
T11005 |
43712-43713 |
CD |
denotes |
5 |
T11006 |
43713-43714 |
SYM |
denotes |
′ |
T11007 |
43714-43715 |
HYPH |
denotes |
- |
T11008 |
43716-43719 |
NN |
denotes |
GTG |
T11010 |
43720-43723 |
NN |
denotes |
GAG |
T11011 |
43724-43727 |
NN |
denotes |
ACC |
T11012 |
43728-43731 |
NN |
denotes |
CCA |
T11013 |
43732-43735 |
NN |
denotes |
AAT |
T11014 |
43736-43739 |
NN |
denotes |
ATG |
T11015 |
43740-43743 |
NN |
denotes |
CCC |
T11009 |
43744-43745 |
NN |
denotes |
A |
T11016 |
43745-43746 |
HYPH |
denotes |
- |
T11017 |
43746-43747 |
CD |
denotes |
3 |
T11018 |
43747-43748 |
SYM |
denotes |
′ |
T11019 |
43749-43752 |
CC |
denotes |
and |
T11020 |
43753-43754 |
CD |
denotes |
5 |
T11021 |
43754-43755 |
SYM |
denotes |
′ |
T11022 |
43755-43756 |
HYPH |
denotes |
- |
T11023 |
43756-43759 |
NN |
denotes |
AAA |
T11025 |
43760-43763 |
NN |
denotes |
CTG |
T11026 |
43764-43767 |
NN |
denotes |
CTC |
T11027 |
43768-43771 |
NN |
denotes |
CTG |
T11028 |
43772-43775 |
NN |
denotes |
ACA |
T11029 |
43776-43779 |
NN |
denotes |
GAT |
T11030 |
43780-43783 |
NN |
denotes |
ATC |
T11024 |
43784-43785 |
NN |
denotes |
A |
T11031 |
43785-43786 |
HYPH |
denotes |
- |
T11032 |
43786-43787 |
CD |
denotes |
3 |
T11033 |
43787-43788 |
SYM |
denotes |
′ |
T11034 |
43788-43789 |
. |
denotes |
. |
T11076 |
43791-43796 |
NN |
denotes |
Sam68 |
T11078 |
43797-43801 |
RB |
denotes |
down |
T11079 |
43801-43802 |
HYPH |
denotes |
- |
T11077 |
43802-43812 |
NN |
denotes |
regulation |
T11080 |
43813-43818 |
VBG |
denotes |
using |
T11081 |
43819-43826 |
NN |
denotes |
Sam68sh |
T11082 |
43826-43827 |
. |
denotes |
. |
T11083 |
43827-43912 |
sentence |
denotes |
To generate an shRNA, 64-base duplex DNA nucleotides were purchased from Invitrogen. |
T11084 |
43828-43830 |
TO |
denotes |
To |
T11085 |
43831-43839 |
VB |
denotes |
generate |
T11087 |
43840-43842 |
DT |
denotes |
an |
T11088 |
43843-43848 |
NN |
denotes |
shRNA |
T11089 |
43848-43850 |
, |
denotes |
, |
T11090 |
43850-43852 |
CD |
denotes |
64 |
T11092 |
43852-43853 |
HYPH |
denotes |
- |
T11091 |
43853-43857 |
NN |
denotes |
base |
T11094 |
43858-43864 |
NN |
denotes |
duplex |
T11095 |
43865-43868 |
NN |
denotes |
DNA |
T11093 |
43869-43880 |
NNS |
denotes |
nucleotides |
T11096 |
43881-43885 |
VBD |
denotes |
were |
T11086 |
43886-43895 |
VBN |
denotes |
purchased |
T11097 |
43896-43900 |
IN |
denotes |
from |
T11098 |
43901-43911 |
NNP |
denotes |
Invitrogen |
T11099 |
43911-43912 |
. |
denotes |
. |
T11100 |
43912-44048 |
sentence |
denotes |
This fragment comprised 19 base residues specific to mouse Sam68 (GATCCCC AAGATGACGAGGAGAATTATTCAAGAGA TAATTCTCCTCGTCATCTT TTTTTGGAAA). |
T11101 |
43913-43917 |
DT |
denotes |
This |
T11102 |
43918-43926 |
NN |
denotes |
fragment |
T11103 |
43927-43936 |
VBD |
denotes |
comprised |
T11104 |
43937-43939 |
CD |
denotes |
19 |
T11106 |
43940-43944 |
NN |
denotes |
base |
T11105 |
43945-43953 |
NNS |
denotes |
residues |
T11107 |
43954-43962 |
JJ |
denotes |
specific |
T11108 |
43963-43965 |
IN |
denotes |
to |
T11109 |
43966-43971 |
NN |
denotes |
mouse |
T11110 |
43972-43977 |
NN |
denotes |
Sam68 |
T11111 |
43978-43979 |
-LRB- |
denotes |
( |
T11113 |
43979-43986 |
NN |
denotes |
GATCCCC |
T11114 |
43987-44015 |
NN |
denotes |
AAGATGACGAGGAGAATTATTCAAGAGA |
T11115 |
44016-44035 |
NN |
denotes |
TAATTCTCCTCGTCATCTT |
T11112 |
44036-44046 |
NN |
denotes |
TTTTTGGAAA |
T11116 |
44046-44047 |
-RRB- |
denotes |
) |
T11117 |
44047-44048 |
. |
denotes |
. |
T11118 |
44048-44142 |
sentence |
denotes |
This fragment was cloned into pSUPER retro (OligoEngine, Seattle, Washington, United States). |
T11119 |
44049-44053 |
DT |
denotes |
This |
T11120 |
44054-44062 |
NN |
denotes |
fragment |
T11122 |
44063-44066 |
VBD |
denotes |
was |
T11121 |
44067-44073 |
VBN |
denotes |
cloned |
T11123 |
44074-44078 |
IN |
denotes |
into |
T11124 |
44079-44085 |
NNP |
denotes |
pSUPER |
T11125 |
44086-44091 |
NNP |
denotes |
retro |
T11126 |
44092-44093 |
-LRB- |
denotes |
( |
T11127 |
44093-44104 |
NNP |
denotes |
OligoEngine |
T11128 |
44104-44106 |
, |
denotes |
, |
T11129 |
44106-44113 |
NNP |
denotes |
Seattle |
T11130 |
44113-44115 |
, |
denotes |
, |
T11131 |
44115-44125 |
NNP |
denotes |
Washington |
T11132 |
44125-44127 |
, |
denotes |
, |
T11133 |
44127-44133 |
NNP |
denotes |
United |
T11134 |
44134-44140 |
NNP |
denotes |
States |
T11135 |
44140-44141 |
-RRB- |
denotes |
) |
T11136 |
44141-44142 |
. |
denotes |
. |
T11137 |
44142-44251 |
sentence |
denotes |
Transfections were performed using LipofectAMINE Plus (Invitrogen) with cloned DNA fragment or empty vector. |
T11138 |
44143-44156 |
NNS |
denotes |
Transfections |
T11140 |
44157-44161 |
VBD |
denotes |
were |
T11139 |
44162-44171 |
VBN |
denotes |
performed |
T11141 |
44172-44177 |
VBG |
denotes |
using |
T11142 |
44178-44191 |
NNP |
denotes |
LipofectAMINE |
T11143 |
44192-44196 |
NNP |
denotes |
Plus |
T11144 |
44197-44198 |
-LRB- |
denotes |
( |
T11145 |
44198-44208 |
NNP |
denotes |
Invitrogen |
T11146 |
44208-44209 |
-RRB- |
denotes |
) |
T11147 |
44210-44214 |
IN |
denotes |
with |
T11148 |
44215-44221 |
VBN |
denotes |
cloned |
T11150 |
44222-44225 |
NN |
denotes |
DNA |
T11149 |
44226-44234 |
NN |
denotes |
fragment |
T11151 |
44235-44237 |
CC |
denotes |
or |
T11152 |
44238-44243 |
JJ |
denotes |
empty |
T11153 |
44244-44250 |
NN |
denotes |
vector |
T11154 |
44250-44251 |
. |
denotes |
. |
T11155 |
44251-44406 |
sentence |
denotes |
At 48 h after transfection, populations were selected for 2.5 μg/ml puromycin and the knockdown observed by immunoblotting with anti-Sam68 (AD1) antibody. |
T11156 |
44252-44254 |
IN |
denotes |
At |
T11158 |
44255-44257 |
CD |
denotes |
48 |
T11159 |
44258-44259 |
NN |
denotes |
h |
T11160 |
44260-44265 |
IN |
denotes |
after |
T11161 |
44266-44278 |
NN |
denotes |
transfection |
T11162 |
44278-44280 |
, |
denotes |
, |
T11163 |
44280-44291 |
NNS |
denotes |
populations |
T11164 |
44292-44296 |
VBD |
denotes |
were |
T11157 |
44297-44305 |
VBN |
denotes |
selected |
T11165 |
44306-44309 |
IN |
denotes |
for |
T11166 |
44310-44313 |
CD |
denotes |
2.5 |
T11167 |
44314-44316 |
NN |
denotes |
μg |
T11169 |
44316-44317 |
SYM |
denotes |
/ |
T11170 |
44317-44319 |
NN |
denotes |
ml |
T11168 |
44320-44329 |
NN |
denotes |
puromycin |
T11171 |
44330-44333 |
CC |
denotes |
and |
T11172 |
44334-44337 |
DT |
denotes |
the |
T11173 |
44338-44347 |
NN |
denotes |
knockdown |
T11174 |
44348-44356 |
VBN |
denotes |
observed |
T11175 |
44357-44359 |
IN |
denotes |
by |
T11176 |
44360-44374 |
VBG |
denotes |
immunoblotting |
T11177 |
44375-44379 |
IN |
denotes |
with |
T11178 |
44380-44390 |
JJ |
denotes |
anti-Sam68 |
T11180 |
44391-44392 |
-LRB- |
denotes |
( |
T11181 |
44392-44395 |
NN |
denotes |
AD1 |
T11182 |
44395-44396 |
-RRB- |
denotes |
) |
T11179 |
44397-44405 |
NN |
denotes |
antibody |
T11183 |
44405-44406 |
. |
denotes |
. |
T11232 |
44408-44418 |
JJ |
denotes |
Osteogenic |
T11234 |
44419-44434 |
NN |
denotes |
differentiation |
T11233 |
44435-44443 |
NN |
denotes |
analysis |
T11235 |
44444-44446 |
IN |
denotes |
of |
T11236 |
44447-44454 |
NN |
denotes |
C3HT101 |
T11238 |
44454-44455 |
HYPH |
denotes |
/ |
T11239 |
44455-44456 |
CD |
denotes |
2 |
T11237 |
44457-44462 |
NNS |
denotes |
cells |
T11240 |
44462-44463 |
. |
denotes |
. |
T11241 |
44463-44592 |
sentence |
denotes |
For osteogenic differentiation, C3HT101/2 (ATCC) cells were incubated in 48-well tissue culture plates at 1.25 × 104 cells/cm2 . |
T11242 |
44464-44467 |
IN |
denotes |
For |
T11244 |
44468-44478 |
JJ |
denotes |
osteogenic |
T11245 |
44479-44494 |
NN |
denotes |
differentiation |
T11246 |
44494-44496 |
, |
denotes |
, |
T11247 |
44496-44503 |
NN |
denotes |
C3HT101 |
T11249 |
44503-44504 |
HYPH |
denotes |
/ |
T11250 |
44504-44505 |
CD |
denotes |
2 |
T11251 |
44506-44507 |
-LRB- |
denotes |
( |
T11252 |
44507-44511 |
NN |
denotes |
ATCC |
T11253 |
44511-44512 |
-RRB- |
denotes |
) |
T11248 |
44513-44518 |
NNS |
denotes |
cells |
T11254 |
44519-44523 |
VBD |
denotes |
were |
T11243 |
44524-44533 |
VBN |
denotes |
incubated |
T11255 |
44534-44536 |
IN |
denotes |
in |
T11256 |
44537-44539 |
CD |
denotes |
48 |
T11258 |
44539-44540 |
HYPH |
denotes |
- |
T11257 |
44540-44544 |
NN |
denotes |
well |
T11260 |
44545-44551 |
NN |
denotes |
tissue |
T11261 |
44552-44559 |
NN |
denotes |
culture |
T11259 |
44560-44566 |
NNS |
denotes |
plates |
T11262 |
44567-44569 |
IN |
denotes |
at |
T11263 |
44570-44574 |
CD |
denotes |
1.25 |
T11265 |
44575-44576 |
SYM |
denotes |
× |
T11264 |
44577-44580 |
CD |
denotes |
104 |
T11266 |
44581-44586 |
NNS |
denotes |
cells |
T11267 |
44586-44587 |
SYM |
denotes |
/ |
T11268 |
44587-44590 |
NN |
denotes |
cm2 |
T11269 |
44591-44592 |
. |
denotes |
. |
T11270 |
44592-44733 |
sentence |
denotes |
After 24-h incubation, the culture media were changed to fresh media containing 300 ng/ml BMP-2 (Sigma, St. Louis, Missouri, United States). |
T11271 |
44593-44598 |
IN |
denotes |
After |
T11273 |
44599-44601 |
CD |
denotes |
24 |
T11275 |
44601-44602 |
HYPH |
denotes |
- |
T11274 |
44602-44603 |
NN |
denotes |
h |
T11276 |
44604-44614 |
NN |
denotes |
incubation |
T11277 |
44614-44616 |
, |
denotes |
, |
T11278 |
44616-44619 |
DT |
denotes |
the |
T11280 |
44620-44627 |
NN |
denotes |
culture |
T11279 |
44628-44633 |
NNS |
denotes |
media |
T11281 |
44634-44638 |
VBD |
denotes |
were |
T11272 |
44639-44646 |
VBN |
denotes |
changed |
T11282 |
44647-44649 |
IN |
denotes |
to |
T11283 |
44650-44655 |
JJ |
denotes |
fresh |
T11284 |
44656-44661 |
NNS |
denotes |
media |
T11285 |
44662-44672 |
VBG |
denotes |
containing |
T11286 |
44673-44676 |
CD |
denotes |
300 |
T11287 |
44677-44679 |
NN |
denotes |
ng |
T11289 |
44679-44680 |
SYM |
denotes |
/ |
T11290 |
44680-44682 |
NN |
denotes |
ml |
T11288 |
44683-44686 |
NN |
denotes |
BMP |
T11291 |
44686-44687 |
HYPH |
denotes |
- |
T11292 |
44687-44688 |
CD |
denotes |
2 |
T11293 |
44689-44690 |
-LRB- |
denotes |
( |
T11294 |
44690-44695 |
NNP |
denotes |
Sigma |
T11295 |
44695-44697 |
, |
denotes |
, |
T11296 |
44697-44700 |
NNP |
denotes |
St. |
T11297 |
44701-44706 |
NNP |
denotes |
Louis |
T11298 |
44706-44708 |
, |
denotes |
, |
T11299 |
44708-44716 |
NNP |
denotes |
Missouri |
T11300 |
44716-44718 |
, |
denotes |
, |
T11301 |
44718-44724 |
NNP |
denotes |
United |
T11302 |
44725-44731 |
NNP |
denotes |
States |
T11303 |
44731-44732 |
-RRB- |
denotes |
) |
T11304 |
44732-44733 |
. |
denotes |
. |
T11305 |
44733-44904 |
sentence |
denotes |
Total cellular RNA was prepared as described above, and osteocalcin, β-actin, and GAPDH gene expression at indicated times after BMP-2 treatment was quantified by RT-PCR. |
T11306 |
44734-44739 |
JJ |
denotes |
Total |
T11308 |
44740-44748 |
JJ |
denotes |
cellular |
T11307 |
44749-44752 |
NN |
denotes |
RNA |
T11310 |
44753-44756 |
VBD |
denotes |
was |
T11309 |
44757-44765 |
VBN |
denotes |
prepared |
T11311 |
44766-44768 |
IN |
denotes |
as |
T11312 |
44769-44778 |
VBN |
denotes |
described |
T11313 |
44779-44784 |
RB |
denotes |
above |
T11314 |
44784-44786 |
, |
denotes |
, |
T11315 |
44786-44789 |
CC |
denotes |
and |
T11316 |
44790-44801 |
NN |
denotes |
osteocalcin |
T11318 |
44801-44803 |
, |
denotes |
, |
T11319 |
44803-44804 |
NN |
denotes |
β |
T11321 |
44804-44805 |
HYPH |
denotes |
- |
T11320 |
44805-44810 |
NN |
denotes |
actin |
T11322 |
44810-44812 |
, |
denotes |
, |
T11323 |
44812-44815 |
CC |
denotes |
and |
T11324 |
44816-44821 |
NN |
denotes |
GAPDH |
T11325 |
44822-44826 |
NN |
denotes |
gene |
T11317 |
44827-44837 |
NN |
denotes |
expression |
T11327 |
44838-44840 |
IN |
denotes |
at |
T11328 |
44841-44850 |
VBN |
denotes |
indicated |
T11329 |
44851-44856 |
NNS |
denotes |
times |
T11330 |
44857-44862 |
IN |
denotes |
after |
T11331 |
44863-44866 |
NN |
denotes |
BMP |
T11333 |
44866-44867 |
HYPH |
denotes |
- |
T11334 |
44867-44868 |
CD |
denotes |
2 |
T11332 |
44869-44878 |
NN |
denotes |
treatment |
T11335 |
44879-44882 |
VBD |
denotes |
was |
T11326 |
44883-44893 |
VBN |
denotes |
quantified |
T11336 |
44894-44896 |
IN |
denotes |
by |
T11337 |
44897-44899 |
NN |
denotes |
RT |
T11339 |
44899-44900 |
HYPH |
denotes |
- |
T11338 |
44900-44903 |
NN |
denotes |
PCR |
T11340 |
44903-44904 |
. |
denotes |
. |
R1000 |
T1712 |
T1713 |
det |
a,substrate |
R1001 |
T1765 |
T1760 |
nsubj |
we,report |
R1002 |
T1766 |
T1767 |
det |
the,generation |
R1003 |
T1767 |
T1760 |
dobj |
generation,report |
R1004 |
T1768 |
T1767 |
prep |
of,generation |
R1005 |
T1713 |
T1710 |
attr |
substrate,is |
R1006 |
T1769 |
T1770 |
nmod |
Sam68,mice |
R1007 |
T1770 |
T1768 |
pobj |
mice,of |
R1008 |
T1714 |
T1713 |
amod |
known,substrate |
R1009 |
T1771 |
T1769 |
punct |
−,Sam68 |
R1010 |
T1772 |
T1769 |
punct |
/,Sam68 |
R1011 |
T1773 |
T1769 |
punct |
−,Sam68 |
R1012 |
T1774 |
T1767 |
cc |
and,generation |
R1013 |
T1775 |
T1767 |
conj |
analysis,generation |
R1014 |
T1776 |
T1775 |
prep |
of,analysis |
R1015 |
T1777 |
T1778 |
poss |
their,phenotype |
R1016 |
T1715 |
T1713 |
prep |
of,substrate |
R1017 |
T1778 |
T1776 |
pobj |
phenotype,of |
R1018 |
T1779 |
T1778 |
amod |
skeletal,phenotype |
R1019 |
T1780 |
T1760 |
punct |
.,report |
R1020 |
T1716 |
T1717 |
compound |
Src,kinases |
R1021 |
T1782 |
T1783 |
poss |
Our,data |
R1022 |
T1717 |
T1715 |
pobj |
kinases,of |
R1023 |
T1783 |
T1784 |
nsubj |
data,indicate |
R1024 |
T1785 |
T1786 |
mark |
that,confers |
R1025 |
T1718 |
T1719 |
punct |
[,39 |
R1026 |
T1786 |
T1784 |
ccomp |
confers,indicate |
R1027 |
T1787 |
T1788 |
det |
the,absence |
R1028 |
T1719 |
T1717 |
parataxis |
39,kinases |
R1029 |
T1788 |
T1786 |
nsubj |
absence,confers |
R1030 |
T1789 |
T1788 |
prep |
of,absence |
R1031 |
T1790 |
T1789 |
pobj |
Sam68,of |
R1032 |
T1720 |
T1721 |
punct |
–,42 |
R1033 |
T1791 |
T1786 |
dobj |
resistance,confers |
R1034 |
T1792 |
T1791 |
prep |
to,resistance |
R1035 |
T1793 |
T1794 |
npadvmod |
age,related |
R1036 |
T1826 |
T1827 |
nmod |
bone,marrow |
R1037 |
T1794 |
T1796 |
amod |
related,loss |
R1038 |
T1795 |
T1794 |
punct |
-,related |
R1039 |
T1796 |
T1792 |
pobj |
loss,to |
R1040 |
T1797 |
T1796 |
compound |
bone,loss |
R1041 |
T1798 |
T1786 |
prep |
in,confers |
R1042 |
T1799 |
T1798 |
pobj |
mice,in |
R1043 |
T1827 |
T1828 |
nmod |
marrow,cells |
R1044 |
T1800 |
T1801 |
amod |
such,have |
R1045 |
T1801 |
T1786 |
advcl |
have,confers |
R1046 |
T1802 |
T1801 |
mark |
that,have |
R1047 |
T1828 |
T1825 |
pobj |
cells,of |
R1048 |
T1803 |
T1804 |
amod |
old,Sam68 |
R1049 |
T1804 |
T1801 |
nsubj |
Sam68,have |
R1050 |
T1805 |
T1806 |
det |
a,mass |
R1051 |
T1829 |
T1828 |
amod |
stromal,cells |
R1052 |
T1806 |
T1801 |
dobj |
mass,have |
R1053 |
T1807 |
T1806 |
amod |
higher,mass |
R1054 |
T1808 |
T1806 |
compound |
bone,mass |
R1055 |
T1830 |
T1818 |
prep |
by,provide |
R1056 |
T1809 |
T1806 |
prep |
than,mass |
R1057 |
T1810 |
T1811 |
poss |
their,littermates |
R1058 |
T1811 |
T1809 |
pobj |
littermates,than |
R1059 |
T1831 |
T1830 |
pcomp |
showing,by |
R1060 |
T1812 |
T1813 |
amod |
wild,type |
R1061 |
T1813 |
T1811 |
compound |
type,littermates |
R1062 |
T1814 |
T1813 |
punct |
-,type |
R1063 |
T1815 |
T1784 |
punct |
.,indicate |
R1064 |
T1817 |
T1818 |
nsubj |
We,provide |
R1065 |
T1832 |
T1833 |
mark |
that,had |
R1066 |
T1819 |
T1818 |
dobj |
evidence,provide |
R1067 |
T1820 |
T1821 |
mark |
that,regulates |
R1068 |
T1833 |
T1831 |
ccomp |
had,showing |
R1069 |
T1821 |
T1819 |
acl |
regulates,evidence |
R1070 |
T1822 |
T1821 |
nsubj |
Sam68,regulates |
R1071 |
T1823 |
T1824 |
det |
the,differentiation |
R1072 |
T1834 |
T1833 |
nsubj |
cells,had |
R1073 |
T1824 |
T1821 |
dobj |
differentiation,regulates |
R1074 |
T1825 |
T1824 |
prep |
of,differentiation |
R1075 |
T1835 |
T1834 |
acl |
isolated,cells |
R1076 |
T1836 |
T1835 |
prep |
from,isolated |
R1077 |
T1837 |
T1838 |
nmod |
Sam68,animals |
R1078 |
T1838 |
T1836 |
pobj |
animals,from |
R1079 |
T1839 |
T1837 |
punct |
−,Sam68 |
R1080 |
T1840 |
T1837 |
punct |
/,Sam68 |
R1081 |
T1841 |
T1837 |
punct |
−,Sam68 |
R1082 |
T1842 |
T1843 |
amod |
enhanced,activity |
R1083 |
T1843 |
T1833 |
dobj |
activity,had |
R1084 |
T1844 |
T1843 |
amod |
osteogenic,activity |
R1085 |
T1845 |
T1843 |
cc |
and,activity |
R1086 |
T1846 |
T1847 |
amod |
decreased,activity |
R1087 |
T1847 |
T1843 |
conj |
activity,activity |
R1088 |
T1848 |
T1847 |
amod |
adipogenic,activity |
R1089 |
T1849 |
T1843 |
prep |
than,activity |
R1090 |
T1850 |
T1849 |
pobj |
those,than |
R1091 |
T1851 |
T1850 |
acl |
harvested,those |
R1092 |
T1852 |
T1851 |
prep |
from,harvested |
R1093 |
T1853 |
T1854 |
amod |
wild,type |
R1094 |
T1854 |
T1856 |
compound |
type,littermates |
R1095 |
T1855 |
T1854 |
punct |
-,type |
R1096 |
T1856 |
T1852 |
pobj |
littermates,from |
R1097 |
T1857 |
T1818 |
punct |
.,provide |
R1098 |
T1859 |
T1860 |
advmod |
Furthermore,impaired |
R1099 |
T1861 |
T1860 |
punct |
", ",impaired |
R1100 |
T1862 |
T1860 |
nsubjpass |
Sam68,impaired |
R1101 |
T1863 |
T1862 |
punct |
−,Sam68 |
R1102 |
T1864 |
T1862 |
punct |
/,Sam68 |
R1103 |
T1865 |
T1862 |
punct |
−,Sam68 |
R1104 |
T1866 |
T1867 |
compound |
mouse,embryo |
R1105 |
T1867 |
T1868 |
compound |
embryo,fibroblasts |
R1106 |
T1868 |
T1862 |
appos |
fibroblasts,Sam68 |
R1107 |
T1869 |
T1868 |
punct |
(,fibroblasts |
R1108 |
T1870 |
T1868 |
appos |
MEFs,fibroblasts |
R1109 |
T1871 |
T1862 |
punct |
),Sam68 |
R1110 |
T1872 |
T1860 |
auxpass |
were,impaired |
R1111 |
T1873 |
T1860 |
prep |
in,impaired |
R1112 |
T1874 |
T1875 |
poss |
their,capacity |
R1113 |
T1875 |
T1873 |
pobj |
capacity,in |
R1114 |
T1876 |
T1877 |
aux |
to,differentiate |
R1115 |
T1877 |
T1875 |
acl |
differentiate,capacity |
R1116 |
T1878 |
T1877 |
prep |
into,differentiate |
R1117 |
T1879 |
T1878 |
pobj |
adipocytes,into |
R1118 |
T1880 |
T1860 |
punct |
", ",impaired |
R1119 |
T1881 |
T1860 |
advcl |
consistent,impaired |
R1120 |
T1882 |
T1881 |
prep |
with,consistent |
R1121 |
T1883 |
T1884 |
nsubj |
Sam68,being |
R1122 |
T1884 |
T1882 |
pcomp |
being,with |
R1123 |
T1885 |
T1886 |
det |
a,regulator |
R1124 |
T1886 |
T1884 |
attr |
regulator,being |
R1125 |
T1887 |
T1886 |
prep |
of,regulator |
R1126 |
T1888 |
T1889 |
nmod |
bone,marrow |
R1127 |
T1889 |
T1890 |
nmod |
marrow,differentiation |
R1128 |
T1890 |
T1887 |
pobj |
differentiation,of |
R1129 |
T1891 |
T1890 |
amod |
mesenchymal,differentiation |
R1130 |
T1892 |
T1890 |
compound |
cell,differentiation |
R1131 |
T1893 |
T1860 |
punct |
.,impaired |
R1132 |
T1895 |
T1896 |
det |
These,results |
R1133 |
T1896 |
T1897 |
nsubj |
results,characterize |
R1134 |
T1898 |
T1897 |
advmod |
also,characterize |
R1135 |
T1899 |
T1900 |
det |
a,model |
R1136 |
T1900 |
T1897 |
dobj |
model,characterize |
R1137 |
T1901 |
T1900 |
amod |
new,model |
R1138 |
T1902 |
T1900 |
compound |
animal,model |
R1139 |
T1903 |
T1904 |
aux |
to,study |
R1140 |
T1904 |
T1900 |
advcl |
study,model |
R1141 |
T1905 |
T1906 |
compound |
bone,metabolism |
R1142 |
T1906 |
T1904 |
dobj |
metabolism,study |
R1143 |
T1907 |
T1906 |
punct |
", ",metabolism |
R1144 |
T1908 |
T1906 |
conj |
regeneration,metabolism |
R1145 |
T1909 |
T1908 |
punct |
", ",regeneration |
R1146 |
T1910 |
T1908 |
cc |
and,regeneration |
R1147 |
T1911 |
T1908 |
conj |
repair,regeneration |
R1148 |
T1912 |
T1904 |
prep |
during,study |
R1149 |
T1913 |
T1912 |
pobj |
aging,during |
R1150 |
T1914 |
T1897 |
punct |
.,characterize |
R1155 |
T2061 |
T2062 |
nsubjpass |
Sam68,Expressed |
R1156 |
T2063 |
T2062 |
auxpass |
Is,Expressed |
R1157 |
T2064 |
T2062 |
prep |
in,Expressed |
R1158 |
T2065 |
T2066 |
det |
the,Skeleton |
R1159 |
T2066 |
T2064 |
pobj |
Skeleton,in |
R1160 |
T2067 |
T2066 |
amod |
Developing,Skeleton |
R1161 |
T2068 |
T2066 |
prep |
of,Skeleton |
R1162 |
T2069 |
T2070 |
amod |
Embryonic,Mice |
R1163 |
T2070 |
T2068 |
pobj |
Mice,of |
R1164 |
T2072 |
T2073 |
det |
The,mRNA |
R1165 |
T2073 |
T2075 |
nsubjpass |
mRNA,known |
R1166 |
T2074 |
T2073 |
compound |
Sam68,mRNA |
R1167 |
T2076 |
T2075 |
auxpass |
is,known |
R1168 |
T2077 |
T2078 |
aux |
to,expressed |
R1169 |
T2078 |
T2075 |
xcomp |
expressed,known |
R1170 |
T2079 |
T2078 |
auxpass |
be,expressed |
R1171 |
T2080 |
T2078 |
advmod |
widely,expressed |
R1172 |
T2081 |
T2082 |
punct |
[,38 |
R1173 |
T2082 |
T2078 |
parataxis |
38,expressed |
R1174 |
T2083 |
T2082 |
punct |
],38 |
R1175 |
T2084 |
T2078 |
punct |
", ",expressed |
R1176 |
T2085 |
T2086 |
mark |
whereas,remains |
R1177 |
T2086 |
T2078 |
advcl |
remains,expressed |
R1178 |
T2087 |
T2088 |
poss |
its,pattern |
R1179 |
T2088 |
T2086 |
nsubj |
pattern,remains |
R1180 |
T2089 |
T2088 |
prep |
of,pattern |
R1181 |
T2090 |
T2091 |
compound |
protein,expression |
R1182 |
T2091 |
T2089 |
pobj |
expression,of |
R1183 |
T2092 |
T2093 |
advmod |
in,vivo |
R1184 |
T2093 |
T2088 |
advmod |
vivo,pattern |
R1185 |
T2094 |
T2095 |
aux |
to,defined |
R1186 |
T2095 |
T2086 |
xcomp |
defined,remains |
R1187 |
T2096 |
T2095 |
auxpass |
be,defined |
R1188 |
T2097 |
T2075 |
punct |
.,known |
R1189 |
T2099 |
T2100 |
nsubjpass |
Sections,immunostained |
R1190 |
T2101 |
T2099 |
prep |
of,Sections |
R1191 |
T2102 |
T2103 |
npadvmod |
paraffin,embedded |
R1192 |
T2103 |
T2105 |
amod |
embedded,mice |
R1193 |
T2104 |
T2103 |
punct |
-,embedded |
R1194 |
T2105 |
T2101 |
pobj |
mice,of |
R1195 |
T2106 |
T2107 |
amod |
wild,type |
R1196 |
T2107 |
T2105 |
nmod |
type,mice |
R1197 |
T2108 |
T2107 |
punct |
-,type |
R1198 |
T2109 |
T2105 |
nmod |
E14.5,mice |
R1199 |
T2110 |
T2109 |
cc |
and,E14.5 |
R1200 |
T2111 |
T2109 |
conj |
E16.5,E14.5 |
R1201 |
T2112 |
T2105 |
amod |
embryonic,mice |
R1202 |
T2113 |
T2100 |
auxpass |
were,immunostained |
R1203 |
T2114 |
T2100 |
prep |
with,immunostained |
R1204 |
T2115 |
T2116 |
det |
the,antibody |
R1205 |
T2116 |
T2114 |
pobj |
antibody,with |
R1206 |
T2117 |
T2118 |
advmod |
well,characterized |
R1207 |
T2118 |
T2116 |
amod |
characterized,antibody |
R1208 |
T2119 |
T2118 |
punct |
-,characterized |
R1209 |
T2120 |
T2116 |
nmod |
AD1,antibody |
R1210 |
T2121 |
T2116 |
amod |
anti-Sam68,antibody |
R1211 |
T2122 |
T2116 |
punct |
", ",antibody |
R1212 |
T2123 |
T2116 |
acl |
raised,antibody |
R1213 |
T2124 |
T2123 |
prep |
in,raised |
R1214 |
T2125 |
T2124 |
pobj |
rabbits,in |
R1215 |
T2126 |
T2116 |
prep |
against,antibody |
R1216 |
T2127 |
T2128 |
det |
an,peptide |
R1217 |
T2128 |
T2126 |
pobj |
peptide,against |
R1218 |
T2129 |
T2128 |
amod |
immunizing,peptide |
R1219 |
T2130 |
T2131 |
dep |
that,corresponds |
R1220 |
T2131 |
T2128 |
relcl |
corresponds,peptide |
R1221 |
T2132 |
T2131 |
prep |
to,corresponds |
R1222 |
T2133 |
T2134 |
nmod |
amino,330 |
R1223 |
T2134 |
T2132 |
pobj |
330,to |
R1224 |
T2135 |
T2134 |
nmod |
acids,330 |
R1225 |
T2136 |
T2134 |
prep |
to,330 |
R1226 |
T2137 |
T2136 |
pobj |
348,to |
R1227 |
T2138 |
T2134 |
prep |
of,330 |
R1228 |
T2139 |
T2140 |
det |
the,protein |
R1229 |
T2140 |
T2138 |
pobj |
protein,of |
R1230 |
T2141 |
T2140 |
compound |
mouse,protein |
R1231 |
T2142 |
T2140 |
compound |
Sam68,protein |
R1232 |
T2143 |
T2144 |
punct |
[,46 |
R1233 |
T2144 |
T2100 |
parataxis |
46,immunostained |
R1234 |
T2145 |
T2144 |
punct |
],46 |
R1235 |
T2146 |
T2100 |
punct |
.,immunostained |
R1236 |
T2148 |
T2149 |
compound |
Sam68,immunoreactivity |
R1237 |
T2149 |
T2150 |
nsubjpass |
immunoreactivity,observed |
R1238 |
T2151 |
T2150 |
auxpass |
was,observed |
R1239 |
T2152 |
T2150 |
prep |
in,observed |
R1240 |
T2153 |
T2154 |
det |
the,skeleton |
R1241 |
T2154 |
T2152 |
pobj |
skeleton,in |
R1242 |
T2155 |
T2154 |
cc |
and,skeleton |
R1243 |
T2156 |
T2157 |
amod |
soft,tissues |
R1244 |
T2157 |
T2154 |
conj |
tissues,skeleton |
R1245 |
T2158 |
T2154 |
prep |
of,skeleton |
R1246 |
T2159 |
T2160 |
amod |
developing,mice |
R1247 |
T2160 |
T2158 |
pobj |
mice,of |
R1248 |
T2161 |
T2162 |
amod |
wild,type |
R1249 |
T2162 |
T2160 |
compound |
type,mice |
R1250 |
T2163 |
T2162 |
punct |
-,type |
R1251 |
T2164 |
T2150 |
prep |
at,observed |
R1252 |
T2165 |
T2164 |
pobj |
E14.5,at |
R1253 |
T2166 |
T2165 |
cc |
and,E14.5 |
R1254 |
T2167 |
T2165 |
conj |
E16.5,E14.5 |
R1255 |
T2168 |
T2169 |
punct |
(,Figure |
R1256 |
T2169 |
T2150 |
parataxis |
Figure,observed |
R1257 |
T2170 |
T2169 |
nummod |
1,Figure |
R1258 |
T2171 |
T2169 |
punct |
),Figure |
R1259 |
T2172 |
T2150 |
punct |
.,observed |
R1260 |
T2174 |
T2175 |
amod |
Intense,staining |
R1261 |
T2175 |
T2176 |
nsubjpass |
staining,seen |
R1262 |
T2177 |
T2176 |
auxpass |
was,seen |
R1263 |
T2178 |
T2176 |
prep |
in,seen |
R1264 |
T2179 |
T2180 |
det |
the,nucleus |
R1265 |
T2180 |
T2178 |
pobj |
nucleus,in |
R1266 |
T2181 |
T2180 |
prep |
of,nucleus |
R1267 |
T2182 |
T2181 |
pobj |
cells,of |
R1268 |
T2183 |
T2176 |
prep |
in,seen |
R1269 |
T2184 |
T2185 |
det |
the,brain |
R1270 |
T2185 |
T2183 |
pobj |
brain,in |
R1271 |
T2186 |
T2185 |
amod |
developing,brain |
R1272 |
T2187 |
T2185 |
punct |
", ",brain |
R1273 |
T2188 |
T2185 |
conj |
heart,brain |
R1274 |
T2189 |
T2188 |
punct |
", ",heart |
R1275 |
T2190 |
T2188 |
cc |
and,heart |
R1276 |
T2191 |
T2192 |
amod |
small,intestine |
R1277 |
T2192 |
T2188 |
conj |
intestine,heart |
R1278 |
T2193 |
T2194 |
punct |
(,1B |
R1279 |
T2194 |
T2185 |
parataxis |
1B,brain |
R1280 |
T2195 |
T2194 |
compound |
Figure,1B |
R1281 |
T2196 |
T2194 |
punct |
),1B |
R1282 |
T2197 |
T2183 |
punct |
", ",in |
R1283 |
T2198 |
T2199 |
advmod |
as,as |
R1284 |
T2199 |
T2183 |
cc |
as,in |
R1285 |
T2200 |
T2199 |
advmod |
well,as |
R1286 |
T2201 |
T2183 |
conj |
in,in |
R1287 |
T2202 |
T2201 |
pobj |
chondrocytes,in |
R1288 |
T2203 |
T2202 |
prep |
in,chondrocytes |
R1289 |
T2204 |
T2205 |
det |
the,septum |
R1290 |
T2205 |
T2203 |
pobj |
septum,in |
R1291 |
T2206 |
T2205 |
amod |
nasal,septum |
R1292 |
T2207 |
T2205 |
cc |
and,septum |
R1293 |
T2208 |
T2209 |
det |
the,tissue |
R1294 |
T2209 |
T2205 |
conj |
tissue,septum |
R1295 |
T2210 |
T2209 |
amod |
glandular,tissue |
R1296 |
T2211 |
T2209 |
amod |
adjacent,tissue |
R1297 |
T2212 |
T2211 |
prep |
to,adjacent |
R1298 |
T2213 |
T2214 |
det |
the,cartilage |
R1299 |
T2214 |
T2212 |
pobj |
cartilage,to |
R1300 |
T2215 |
T2214 |
amod |
nasal,cartilage |
R1301 |
T2216 |
T2217 |
punct |
(,1C |
R1302 |
T2217 |
T2202 |
parataxis |
1C,chondrocytes |
R1303 |
T2218 |
T2217 |
compound |
Figure,1C |
R1304 |
T2219 |
T2217 |
punct |
", ",1C |
R1305 |
T2220 |
T2221 |
compound |
panels,A |
R1306 |
T2221 |
T2217 |
appos |
A,1C |
R1307 |
T2222 |
T2223 |
punct |
–,D |
R1308 |
T2223 |
T2221 |
prep |
D,A |
R1309 |
T2224 |
T2217 |
punct |
),1C |
R1310 |
T2225 |
T2201 |
punct |
", ",in |
R1311 |
T2226 |
T2201 |
prep |
in,in |
R1312 |
T2227 |
T2228 |
det |
the,vertebra |
R1313 |
T2228 |
T2226 |
pobj |
vertebra,in |
R1314 |
T2229 |
T2228 |
cc |
and,vertebra |
R1315 |
T2230 |
T2231 |
amod |
intervertebral,discs |
R1316 |
T2231 |
T2228 |
conj |
discs,vertebra |
R1317 |
T2232 |
T2233 |
punct |
(,E |
R1318 |
T2233 |
T2228 |
parataxis |
E,vertebra |
R1319 |
T2234 |
T2233 |
compound |
panels,E |
R1320 |
T2235 |
T2236 |
punct |
–,H |
R1321 |
T2236 |
T2233 |
prep |
H,E |
R1322 |
T2237 |
T2233 |
punct |
),E |
R1323 |
T2238 |
T2226 |
cc |
and,in |
R1324 |
T2239 |
T2226 |
conj |
in,in |
R1325 |
T2240 |
T2241 |
det |
the,epiphysis |
R1326 |
T2241 |
T2239 |
pobj |
epiphysis,in |
R1327 |
T2242 |
T2243 |
punct |
(,I |
R1328 |
T2243 |
T2241 |
parataxis |
I,epiphysis |
R1329 |
T2244 |
T2243 |
compound |
panels,I |
R1330 |
T2245 |
T2246 |
punct |
–,K |
R1331 |
T2246 |
T2243 |
prep |
K,I |
R1332 |
T2247 |
T2243 |
punct |
),I |
R1333 |
T2248 |
T2241 |
cc |
and,epiphysis |
R1334 |
T2249 |
T2241 |
conj |
metaphysis,epiphysis |
R1335 |
T2250 |
T2251 |
punct |
(,L |
R1336 |
T2251 |
T2249 |
parataxis |
L,metaphysis |
R1337 |
T2252 |
T2251 |
compound |
panel,L |
R1338 |
T2253 |
T2251 |
punct |
),L |
R1339 |
T2254 |
T2241 |
prep |
of,epiphysis |
R1340 |
T2255 |
T2256 |
amod |
long,bones |
R1341 |
T2256 |
T2254 |
pobj |
bones,of |
R1342 |
T2257 |
T2176 |
punct |
.,seen |
R1343 |
T2259 |
T2260 |
amod |
Nuclear,staining |
R1344 |
T2260 |
T2261 |
nsubjpass |
staining,observed |
R1345 |
T2262 |
T2261 |
auxpass |
was,observed |
R1346 |
T2263 |
T2261 |
prep |
in,observed |
R1347 |
T2264 |
T2265 |
amod |
proliferating,chondrocytes |
R1348 |
T2265 |
T2263 |
pobj |
chondrocytes,in |
R1349 |
T2266 |
T2265 |
cc |
and,chondrocytes |
R1350 |
T2267 |
T2268 |
amod |
hypertrophic,chondrocytes |
R1351 |
T2268 |
T2265 |
conj |
chondrocytes,chondrocytes |
R1352 |
T2269 |
T2270 |
punct |
(,1C |
R1353 |
T2270 |
T2268 |
parataxis |
1C,chondrocytes |
R1354 |
T2271 |
T2270 |
compound |
Figure,1C |
R1355 |
T2272 |
T2270 |
punct |
", ",1C |
R1356 |
T2273 |
T2274 |
compound |
panel,H |
R1357 |
T2274 |
T2270 |
appos |
H,1C |
R1358 |
T2275 |
T2270 |
punct |
),1C |
R1359 |
T2276 |
T2263 |
punct |
", ",in |
R1360 |
T2277 |
T2263 |
conj |
in,in |
R1361 |
T2278 |
T2277 |
pobj |
osteoblasts,in |
R1362 |
T2279 |
T2280 |
punct |
(,L |
R1363 |
T2280 |
T2278 |
parataxis |
L,osteoblasts |
R1364 |
T2281 |
T2280 |
compound |
panel,L |
R1365 |
T2282 |
T2280 |
punct |
;,L |
R1366 |
T2283 |
T2284 |
compound |
Dataset,S1 |
R1367 |
T2284 |
T2280 |
appos |
S1,L |
R1368 |
T2285 |
T2280 |
punct |
),L |
R1369 |
T2286 |
T2277 |
punct |
", ",in |
R1370 |
T2287 |
T2277 |
cc |
and,in |
R1371 |
T2288 |
T2277 |
conj |
in,in |
R1372 |
T2289 |
T2288 |
pobj |
osteoclasts,in |
R1373 |
T2290 |
T2291 |
punct |
(,S1 |
R1374 |
T2291 |
T2289 |
parataxis |
S1,osteoclasts |
R1375 |
T2292 |
T2291 |
compound |
Dataset,S1 |
R1376 |
T2293 |
T2291 |
punct |
),S1 |
R1377 |
T2294 |
T2261 |
punct |
.,observed |
R1378 |
T2296 |
T2297 |
det |
No,staining |
R1379 |
T2297 |
T2298 |
nsubjpass |
staining,observed |
R1380 |
T2299 |
T2298 |
auxpass |
was,observed |
R1381 |
T2300 |
T2298 |
prep |
with,observed |
R1382 |
T2301 |
T2302 |
amod |
preimmune,serum |
R1383 |
T2302 |
T2300 |
pobj |
serum,with |
R1384 |
T2303 |
T2300 |
cc |
or,with |
R1385 |
T2304 |
T2305 |
advmod |
when,preadsorbed |
R1386 |
T2305 |
T2300 |
conj |
preadsorbed,with |
R1387 |
T2306 |
T2307 |
det |
the,antiserum |
R1388 |
T2307 |
T2305 |
nsubjpass |
antiserum,preadsorbed |
R1389 |
T2308 |
T2305 |
auxpass |
was,preadsorbed |
R1390 |
T2309 |
T2305 |
prep |
with,preadsorbed |
R1391 |
T2310 |
T2311 |
det |
the,peptide |
R1392 |
T2311 |
T2309 |
pobj |
peptide,with |
R1393 |
T2312 |
T2311 |
amod |
immunizing,peptide |
R1394 |
T2313 |
T2314 |
punct |
(,1C |
R1395 |
T2314 |
T2305 |
parataxis |
1C,preadsorbed |
R1396 |
T2315 |
T2314 |
compound |
Figure,1C |
R1397 |
T2316 |
T2314 |
punct |
", ",1C |
R1398 |
T2317 |
T2318 |
compound |
panels,B |
R1399 |
T2318 |
T2314 |
appos |
B,1C |
R1400 |
T2319 |
T2318 |
punct |
", ",B |
R1401 |
T2320 |
T2318 |
conj |
F,B |
R1402 |
T2321 |
T2320 |
punct |
", ",F |
R1403 |
T2322 |
T2320 |
cc |
and,F |
R1404 |
T2323 |
T2320 |
conj |
J,F |
R1405 |
T2324 |
T2314 |
punct |
),1C |
R1406 |
T2325 |
T2298 |
punct |
.,observed |
R1407 |
T2327 |
T2328 |
advcl |
Taken,demonstrate |
R1408 |
T2329 |
T2327 |
advmod |
together,Taken |
R1409 |
T2330 |
T2328 |
punct |
", ",demonstrate |
R1410 |
T2331 |
T2332 |
det |
these,data |
R1411 |
T2332 |
T2328 |
nsubj |
data,demonstrate |
R1412 |
T2333 |
T2334 |
mark |
that,expressed |
R1413 |
T2334 |
T2328 |
ccomp |
expressed,demonstrate |
R1414 |
T2335 |
T2336 |
compound |
Sam68,protein |
R1415 |
T2336 |
T2334 |
nsubjpass |
protein,expressed |
R1416 |
T2337 |
T2334 |
auxpass |
is,expressed |
R1417 |
T2338 |
T2334 |
advmod |
selectively,expressed |
R1418 |
T2339 |
T2334 |
prep |
in,expressed |
R1419 |
T2340 |
T2341 |
det |
the,embryo |
R1420 |
T2341 |
T2339 |
pobj |
embryo,in |
R1421 |
T2342 |
T2341 |
amod |
developing,embryo |
R1422 |
T2343 |
T2341 |
compound |
mouse,embryo |
R1423 |
T2344 |
T2334 |
punct |
", ",expressed |
R1424 |
T2345 |
T2334 |
prep |
with,expressed |
R1425 |
T2346 |
T2347 |
advmod |
particularly,elevated |
R1426 |
T2347 |
T2348 |
amod |
elevated,expression |
R1427 |
T2348 |
T2345 |
pobj |
expression,with |
R1428 |
T2349 |
T2348 |
prep |
in,expression |
R1429 |
T2350 |
T2349 |
pobj |
cartilage,in |
R1430 |
T2351 |
T2350 |
cc |
and,cartilage |
R1431 |
T2352 |
T2350 |
conj |
bone,cartilage |
R1432 |
T2353 |
T2328 |
punct |
.,demonstrate |
R1433 |
T2520 |
T2521 |
nsubj |
Sam68,is |
R1434 |
T2522 |
T2521 |
neg |
Not,is |
R1435 |
T2523 |
T2521 |
acomp |
Essential,is |
R1436 |
T2524 |
T2523 |
prep |
for,Essential |
R1437 |
T2525 |
T2526 |
compound |
Mouse,Development |
R1438 |
T2526 |
T2524 |
pobj |
Development,for |
R1439 |
T2528 |
T2529 |
aux |
To,define |
R1440 |
T2529 |
T2530 |
advcl |
define,generated |
R1441 |
T2531 |
T2532 |
det |
the,role |
R1442 |
T2532 |
T2529 |
dobj |
role,define |
R1443 |
T2533 |
T2532 |
amod |
physiologic,role |
R1444 |
T2534 |
T2532 |
prep |
of,role |
R1445 |
T2535 |
T2534 |
pobj |
Sam68,of |
R1446 |
T2536 |
T2530 |
punct |
", ",generated |
R1447 |
T2537 |
T2530 |
nsubj |
we,generated |
R1448 |
T2538 |
T2539 |
npadvmod |
Sam68,deficient |
R1449 |
T2539 |
T2541 |
amod |
deficient,mice |
R1450 |
T2540 |
T2539 |
punct |
-,deficient |
R1451 |
T2541 |
T2530 |
dobj |
mice,generated |
R1452 |
T2542 |
T2530 |
prep |
by,generated |
R1453 |
T2543 |
T2544 |
amod |
targeted,disruption |
R1454 |
T2544 |
T2542 |
pobj |
disruption,by |
R1455 |
T2545 |
T2544 |
prep |
of,disruption |
R1456 |
T2546 |
T2547 |
nmod |
exons,4 |
R1457 |
T2547 |
T2545 |
pobj |
4,of |
R1458 |
T2548 |
T2547 |
cc |
and,4 |
R1459 |
T2549 |
T2547 |
conj |
5,4 |
R1460 |
T2550 |
T2547 |
prep |
of,4 |
R1461 |
T2551 |
T2552 |
det |
the,gene |
R1462 |
T2552 |
T2550 |
pobj |
gene,of |
R1463 |
T2553 |
T2552 |
compound |
sam68,gene |
R1464 |
T2554 |
T2547 |
punct |
", ",4 |
R1465 |
T2555 |
T2556 |
dep |
which,encode |
R1466 |
T2556 |
T2547 |
relcl |
encode,4 |
R1467 |
T2557 |
T2558 |
det |
the,region |
R1468 |
T2558 |
T2556 |
dobj |
region,encode |
R1469 |
T2559 |
T2558 |
amod |
functional,region |
R1470 |
T2560 |
T2558 |
prep |
of,region |
R1471 |
T2561 |
T2562 |
det |
the,domain |
R1472 |
T2562 |
T2560 |
pobj |
domain,of |
R1473 |
T2563 |
T2564 |
compound |
KH,type |
R1474 |
T2564 |
T2562 |
compound |
type,domain |
R1475 |
T2565 |
T2564 |
punct |
-,type |
R1476 |
T2566 |
T2567 |
compound |
RNA,binding |
R1477 |
T2567 |
T2562 |
compound |
binding,domain |
R1478 |
T2568 |
T2569 |
punct |
(,2A |
R1479 |
T2569 |
T2530 |
parataxis |
2A,generated |
R1480 |
T2570 |
T2569 |
compound |
Figure,2A |
R1481 |
T2571 |
T2569 |
punct |
),2A |
R1482 |
T2572 |
T2530 |
punct |
.,generated |
R1483 |
T2574 |
T2575 |
det |
The,integrity |
R1484 |
T2575 |
T2576 |
nsubjpass |
integrity,verified |
R1485 |
T2577 |
T2575 |
prep |
of,integrity |
R1486 |
T2578 |
T2579 |
det |
the,allele |
R1487 |
T2579 |
T2577 |
pobj |
allele,of |
R1488 |
T2580 |
T2579 |
amod |
targeted,allele |
R1489 |
T2581 |
T2576 |
auxpass |
was,verified |
R1490 |
T2582 |
T2576 |
prep |
by,verified |
R1491 |
T2583 |
T2584 |
compound |
Southern,blot |
R1492 |
T2584 |
T2585 |
compound |
blot,analysis |
R1493 |
T2585 |
T2582 |
pobj |
analysis,by |
R1494 |
T2586 |
T2587 |
punct |
(,2B |
R1495 |
T2587 |
T2585 |
parataxis |
2B,analysis |
R1496 |
T2588 |
T2587 |
compound |
Figure,2B |
R1497 |
T2589 |
T2587 |
punct |
),2B |
R1498 |
T2590 |
T2582 |
cc |
and,by |
R1499 |
T2591 |
T2582 |
conj |
by,by |
R1500 |
T2592 |
T2591 |
pobj |
PCR,by |
R1501 |
T2593 |
T2592 |
prep |
of,PCR |
R1502 |
T2594 |
T2595 |
amod |
genomic,DNA |
R1503 |
T2595 |
T2593 |
pobj |
DNA,of |
R1504 |
T2596 |
T2597 |
punct |
(,data |
R1505 |
T2597 |
T2592 |
meta |
data,PCR |
R1506 |
T2598 |
T2597 |
amod |
unpublished,data |
R1507 |
T2599 |
T2597 |
punct |
),data |
R1508 |
T2600 |
T2576 |
punct |
.,verified |
R1509 |
T2602 |
T2603 |
compound |
Sam68,transcripts |
R1510 |
T2603 |
T2604 |
nsubj |
transcripts,were |
R1511 |
T2605 |
T2603 |
acl |
encoded,transcripts |
R1512 |
T2606 |
T2605 |
agent |
by,encoded |
R1513 |
T2607 |
T2608 |
nmod |
exons,1 |
R1514 |
T2608 |
T2606 |
pobj |
1,by |
R1515 |
T2609 |
T2608 |
prep |
to,1 |
R1516 |
T2610 |
T2609 |
pobj |
5,to |
R1517 |
T2611 |
T2604 |
acomp |
absent,were |
R1518 |
T2612 |
T2613 |
mark |
as,evidenced |
R1519 |
T2613 |
T2604 |
advcl |
evidenced,were |
R1520 |
T2614 |
T2613 |
prep |
by,evidenced |
R1521 |
T2615 |
T2616 |
compound |
RT,PCR |
R1522 |
T2616 |
T2614 |
pobj |
PCR,by |
R1523 |
T2617 |
T2616 |
punct |
-,PCR |
R1524 |
T2618 |
T2619 |
punct |
(,S2 |
R1525 |
T2619 |
T2613 |
parataxis |
S2,evidenced |
R1526 |
T2620 |
T2619 |
compound |
Dataset,S2 |
R1527 |
T2621 |
T2619 |
punct |
),S2 |
R1528 |
T2622 |
T2604 |
punct |
", ",were |
R1529 |
T2623 |
T2604 |
cc |
and,were |
R1530 |
T2624 |
T2625 |
nmod |
Sam68,mice |
R1531 |
T2625 |
T2629 |
nsubj |
mice,were |
R1532 |
T2626 |
T2624 |
punct |
−,Sam68 |
R1533 |
T2627 |
T2624 |
punct |
/,Sam68 |
R1534 |
T2628 |
T2624 |
punct |
−,Sam68 |
R1535 |
T2629 |
T2604 |
conj |
were,were |
R1536 |
T2630 |
T2629 |
acomp |
devoid,were |
R1537 |
T2631 |
T2630 |
prep |
of,devoid |
R1538 |
T2632 |
T2633 |
compound |
Sam68,protein |
R1539 |
T2633 |
T2631 |
pobj |
protein,of |
R1540 |
T2634 |
T2629 |
punct |
", ",were |
R1541 |
T2635 |
T2636 |
mark |
as,visualized |
R1542 |
T2636 |
T2629 |
advcl |
visualized,were |
R1543 |
T2637 |
T2636 |
prep |
by,visualized |
R1544 |
T2638 |
T2637 |
pcomp |
immunoblotting,by |
R1545 |
T2639 |
T2638 |
prep |
with,immunoblotting |
R1546 |
T2640 |
T2641 |
amod |
anti-Sam68,AD1 |
R1547 |
T2641 |
T2642 |
nmod |
AD1,antibodies |
R1548 |
T2642 |
T2639 |
pobj |
antibodies,with |
R1549 |
T2643 |
T2641 |
cc |
and,AD1 |
R1550 |
T2644 |
T2641 |
conj |
SC,AD1 |
R1551 |
T2645 |
T2644 |
punct |
-,SC |
R1552 |
T2646 |
T2644 |
nummod |
333,SC |
R1553 |
T2647 |
T2642 |
cc |
or,antibodies |
R1554 |
T2648 |
T2649 |
nmod |
control,serum |
R1555 |
T2649 |
T2642 |
conj |
serum,antibodies |
R1556 |
T2650 |
T2649 |
amod |
normal,serum |
R1557 |
T2651 |
T2649 |
compound |
rabbit,serum |
R1558 |
T2652 |
T2649 |
cc |
or,serum |
R1559 |
T2653 |
T2654 |
amod |
anti-Sam68,AD1 |
R1560 |
T2654 |
T2649 |
conj |
AD1,serum |
R1561 |
T2655 |
T2654 |
acl |
preabsorbed,AD1 |
R1562 |
T2656 |
T2655 |
prep |
with,preabsorbed |
R1563 |
T2657 |
T2656 |
pobj |
peptide,with |
R1564 |
T2658 |
T2659 |
punct |
(,2C |
R1565 |
T2659 |
T2629 |
parataxis |
2C,were |
R1566 |
T2660 |
T2659 |
compound |
Figure,2C |
R1567 |
T2661 |
T2659 |
punct |
),2C |
R1568 |
T2662 |
T2629 |
punct |
.,were |
R1569 |
T2664 |
T2665 |
nsubj |
SC,is |
R1570 |
T2666 |
T2664 |
punct |
-,SC |
R1571 |
T2667 |
T2664 |
nummod |
333,SC |
R1572 |
T2668 |
T2669 |
det |
a,antibody |
R1573 |
T2669 |
T2665 |
attr |
antibody,is |
R1574 |
T2670 |
T2669 |
nmod |
rabbit,antibody |
R1575 |
T2671 |
T2669 |
amod |
anti-Sam68,antibody |
R1576 |
T2672 |
T2673 |
dep |
that,raised |
R1577 |
T2673 |
T2669 |
relcl |
raised,antibody |
R1578 |
T2674 |
T2673 |
auxpass |
was,raised |
R1579 |
T2675 |
T2673 |
prep |
against,raised |
R1580 |
T2676 |
T2677 |
det |
the,acids |
R1581 |
T2677 |
T2675 |
pobj |
acids,against |
R1582 |
T2678 |
T2679 |
npadvmod |
C,terminal |
R1583 |
T2679 |
T2677 |
amod |
terminal,acids |
R1584 |
T2680 |
T2679 |
punct |
-,terminal |
R1585 |
T2681 |
T2677 |
nummod |
20,acids |
R1586 |
T2682 |
T2677 |
compound |
amino,acids |
R1587 |
T2683 |
T2677 |
prep |
of,acids |
R1588 |
T2684 |
T2683 |
pobj |
Sam68,of |
R1589 |
T2685 |
T2686 |
punct |
[,47 |
R1590 |
T2686 |
T2665 |
parataxis |
47,is |
R1591 |
T2687 |
T2686 |
punct |
],47 |
R1592 |
T2688 |
T2665 |
punct |
.,is |
R1593 |
T2690 |
T2691 |
det |
These,data |
R1594 |
T2691 |
T2692 |
nsubj |
data,confirmed |
R1595 |
T2693 |
T2694 |
det |
the,generation |
R1596 |
T2694 |
T2692 |
dobj |
generation,confirmed |
R1597 |
T2695 |
T2694 |
prep |
of,generation |
R1598 |
T2696 |
T2697 |
det |
a,mouse |
R1599 |
T2697 |
T2695 |
pobj |
mouse,of |
R1600 |
T2698 |
T2697 |
amod |
deficient,mouse |
R1601 |
T2699 |
T2698 |
prep |
in,deficient |
R1602 |
T2700 |
T2699 |
pobj |
Sam68,in |
R1603 |
T2701 |
T2692 |
punct |
.,confirmed |
R1604 |
T2703 |
T2704 |
det |
The,genotypes |
R1605 |
T2704 |
T2705 |
nsubj |
genotypes,exhibited |
R1606 |
T2706 |
T2704 |
prep |
of,genotypes |
R1607 |
T2707 |
T2706 |
pobj |
offspring,of |
R1608 |
T2708 |
T2707 |
prep |
from,offspring |
R1609 |
T2709 |
T2710 |
compound |
heterozygote,intercrosses |
R1610 |
T2710 |
T2708 |
pobj |
intercrosses,from |
R1611 |
T2711 |
T2712 |
det |
a,segregation |
R1612 |
T2712 |
T2705 |
dobj |
segregation,exhibited |
R1613 |
T2713 |
T2712 |
amod |
Mendelian,segregation |
R1614 |
T2714 |
T2705 |
prep |
at,exhibited |
R1615 |
T2715 |
T2714 |
pobj |
E18.5,at |
R1616 |
T2716 |
T2717 |
punct |
(,Table |
R1617 |
T2717 |
T2705 |
parataxis |
Table,exhibited |
R1618 |
T2718 |
T2717 |
nummod |
1,Table |
R1619 |
T2719 |
T2717 |
punct |
),Table |
R1620 |
T2720 |
T2705 |
punct |
.,exhibited |
R1621 |
T2722 |
T2723 |
prep |
Despite,died |
R1622 |
T2724 |
T2725 |
det |
the,lack |
R1623 |
T2725 |
T2722 |
pobj |
lack,Despite |
R1624 |
T2726 |
T2725 |
prep |
of,lack |
R1625 |
T2727 |
T2728 |
amod |
visible,deformity |
R1626 |
T2728 |
T2726 |
pobj |
deformity,of |
R1627 |
T2729 |
T2723 |
punct |
", ",died |
R1628 |
T2730 |
T2723 |
nsubj |
many,died |
R1629 |
T2731 |
T2730 |
prep |
of,many |
R1630 |
T2732 |
T2733 |
det |
the,pups |
R1631 |
T2733 |
T2731 |
pobj |
pups,of |
R1632 |
T2734 |
T2733 |
nmod |
Sam68,pups |
R1633 |
T2735 |
T2734 |
punct |
−,Sam68 |
R1634 |
T2736 |
T2734 |
punct |
/,Sam68 |
R1635 |
T2737 |
T2734 |
punct |
−,Sam68 |
R1636 |
T2738 |
T2723 |
prep |
at,died |
R1637 |
T2739 |
T2738 |
pobj |
birth,at |
R1638 |
T2740 |
T2723 |
prep |
of,died |
R1639 |
T2741 |
T2742 |
amod |
unknown,causes |
R1640 |
T2742 |
T2740 |
pobj |
causes,of |
R1641 |
T2743 |
T2723 |
punct |
.,died |
R1642 |
T2745 |
T2746 |
nmod |
Sam68,mice |
R1643 |
T2746 |
T2750 |
nsubj |
mice,were |
R1644 |
T2747 |
T2745 |
punct |
+,Sam68 |
R1645 |
T2748 |
T2745 |
punct |
/,Sam68 |
R1646 |
T2749 |
T2745 |
punct |
-,Sam68 |
R1647 |
T2751 |
T2752 |
advmod |
phenotypically,normal |
R1648 |
T2752 |
T2750 |
acomp |
normal,were |
R1649 |
T2753 |
T2750 |
cc |
and,were |
R1650 |
T2754 |
T2755 |
nmod |
Sam68,pups |
R1651 |
T2755 |
T2759 |
nsubj |
pups,lived |
R1652 |
T2756 |
T2754 |
punct |
−,Sam68 |
R1653 |
T2757 |
T2754 |
punct |
/,Sam68 |
R1654 |
T2758 |
T2754 |
punct |
−,Sam68 |
R1655 |
T2759 |
T2750 |
conj |
lived,were |
R1656 |
T2760 |
T2761 |
dep |
that,survived |
R1657 |
T2761 |
T2755 |
relcl |
survived,pups |
R1658 |
T2762 |
T2763 |
det |
the,period |
R1659 |
T2763 |
T2761 |
dobj |
period,survived |
R1660 |
T2764 |
T2763 |
amod |
perinatal,period |
R1661 |
T2765 |
T2759 |
advmod |
invariably,lived |
R1662 |
T2766 |
T2759 |
prep |
to,lived |
R1663 |
T2767 |
T2768 |
amod |
old,age |
R1664 |
T2768 |
T2766 |
pobj |
age,to |
R1665 |
T2769 |
T2759 |
punct |
.,lived |
R1666 |
T2771 |
T2772 |
prep |
Despite,develop |
R1667 |
T2773 |
T2771 |
pobj |
evidence,Despite |
R1668 |
T2774 |
T2775 |
mark |
that,expressed |
R1669 |
T2775 |
T2773 |
acl |
expressed,evidence |
R1670 |
T2776 |
T2777 |
compound |
Sam68,mRNA |
R1671 |
T2777 |
T2775 |
nsubjpass |
mRNA,expressed |
R1672 |
T2778 |
T2775 |
auxpass |
is,expressed |
R1673 |
T2779 |
T2775 |
advmod |
widely,expressed |
R1674 |
T2780 |
T2775 |
cc |
and,expressed |
R1675 |
T2781 |
T2775 |
conj |
phosphorylated,expressed |
R1676 |
T2782 |
T2781 |
prep |
in,phosphorylated |
R1677 |
T2783 |
T2782 |
pobj |
mitosis,in |
R1678 |
T2784 |
T2785 |
punct |
[,42 |
R1679 |
T2785 |
T2775 |
parataxis |
42,expressed |
R1680 |
T2786 |
T2785 |
nummod |
41,42 |
R1681 |
T2787 |
T2785 |
punct |
",",42 |
R1682 |
T2788 |
T2785 |
punct |
],42 |
R1683 |
T2789 |
T2772 |
punct |
", ",develop |
R1684 |
T2790 |
T2791 |
det |
the,mice |
R1685 |
T2791 |
T2772 |
nsubj |
mice,develop |
R1686 |
T2792 |
T2791 |
nmod |
Sam68,mice |
R1687 |
T2793 |
T2792 |
punct |
−,Sam68 |
R1688 |
T2794 |
T2792 |
punct |
/,Sam68 |
R1689 |
T2795 |
T2792 |
punct |
−,Sam68 |
R1690 |
T2796 |
T2772 |
aux |
did,develop |
R1691 |
T2797 |
T2772 |
neg |
not,develop |
R1692 |
T2798 |
T2772 |
dobj |
tumors,develop |
R1693 |
T2799 |
T2772 |
cc |
and,develop |
R1694 |
T2800 |
T2772 |
conj |
showed,develop |
R1695 |
T2801 |
T2802 |
det |
no,illnesses |
R1696 |
T2802 |
T2800 |
dobj |
illnesses,showed |
R1697 |
T2803 |
T2802 |
amod |
immunologic,illnesses |
R1698 |
T2804 |
T2803 |
cc |
or,immunologic |
R1699 |
T2805 |
T2806 |
amod |
other,major |
R1700 |
T2806 |
T2803 |
conj |
major,immunologic |
R1701 |
T2807 |
T2772 |
punct |
.,develop |
R1702 |
T2809 |
T2810 |
nmod |
Sam68,mice |
R1703 |
T2810 |
T2814 |
nsubj |
mice,have |
R1704 |
T2811 |
T2809 |
punct |
−,Sam68 |
R1705 |
T2812 |
T2809 |
punct |
/,Sam68 |
R1706 |
T2813 |
T2809 |
punct |
−,Sam68 |
R1707 |
T2815 |
T2814 |
aux |
did,have |
R1708 |
T2816 |
T2814 |
punct |
", ",have |
R1709 |
T2817 |
T2814 |
advmod |
however,have |
R1710 |
T2818 |
T2814 |
punct |
", ",have |
R1711 |
T2819 |
T2814 |
dobj |
difficulty,have |
R1712 |
T2820 |
T2819 |
acl |
breeding,difficulty |
R1713 |
T2821 |
T2814 |
prep |
due,have |
R1714 |
T2822 |
T2821 |
pcomp |
to,due |
R1715 |
T2823 |
T2824 |
amod |
male,infertility |
R1716 |
T2824 |
T2821 |
pobj |
infertility,due |
R1717 |
T2825 |
T2814 |
cc |
and,have |
R1718 |
T2826 |
T2827 |
det |
the,females |
R1719 |
T2827 |
T2828 |
nsubj |
females,provided |
R1720 |
T2828 |
T2814 |
conj |
provided,have |
R1721 |
T2829 |
T2828 |
advmod |
rarely,provided |
R1722 |
T2830 |
T2831 |
amod |
adequate,care |
R1723 |
T2831 |
T2828 |
dobj |
care,provided |
R1724 |
T2832 |
T2828 |
dative |
to,provided |
R1725 |
T2833 |
T2834 |
poss |
their,young |
R1726 |
T2834 |
T2832 |
pobj |
young,to |
R1727 |
T2835 |
T2828 |
punct |
.,provided |
R1732 |
T3035 |
T3036 |
compound |
Sam68,Deficiency |
R1733 |
T3036 |
T3037 |
nsubj |
Deficiency,Protects |
R1734 |
T3038 |
T3037 |
dobj |
Mice,Protects |
R1735 |
T3039 |
T3037 |
prep |
from,Protects |
R1736 |
T3040 |
T3041 |
npadvmod |
Age,Related |
R1737 |
T3041 |
T3043 |
amod |
Related,Loss |
R1738 |
T3042 |
T3041 |
punct |
-,Related |
R1739 |
T3043 |
T3039 |
pobj |
Loss,from |
R1740 |
T3044 |
T3043 |
compound |
Bone,Loss |
R1741 |
T3046 |
T3047 |
nmod |
Src,animals |
R1742 |
T3047 |
T3049 |
nsubjpass |
animals,known |
R1743 |
T3048 |
T3047 |
amod |
null,animals |
R1744 |
T3050 |
T3049 |
auxpass |
are,known |
R1745 |
T3051 |
T3052 |
aux |
to,have |
R1746 |
T3052 |
T3049 |
xcomp |
have,known |
R1747 |
T3053 |
T3054 |
compound |
bone,metabolism |
R1748 |
T3054 |
T3055 |
compound |
metabolism,defects |
R1749 |
T3055 |
T3052 |
dobj |
defects,have |
R1750 |
T3056 |
T3057 |
punct |
[,48 |
R1751 |
T3057 |
T3049 |
parataxis |
48,known |
R1752 |
T3058 |
T3057 |
punct |
],48 |
R1753 |
T3059 |
T3049 |
punct |
", ",known |
R1754 |
T3060 |
T3049 |
cc |
and,known |
R1755 |
T3061 |
T3062 |
mark |
since,is |
R1756 |
T3062 |
T3064 |
advcl |
is,decided |
R1757 |
T3063 |
T3062 |
nsubj |
Sam68,is |
R1758 |
T3064 |
T3049 |
conj |
decided,known |
R1759 |
T3065 |
T3066 |
det |
a,substrate |
R1760 |
T3066 |
T3062 |
attr |
substrate,is |
R1761 |
T3067 |
T3066 |
prep |
of,substrate |
R1762 |
T3068 |
T3067 |
pobj |
Src,of |
R1763 |
T3069 |
T3064 |
punct |
", ",decided |
R1764 |
T3070 |
T3064 |
nsubj |
we,decided |
R1765 |
T3071 |
T3072 |
aux |
to,analyze |
R1766 |
T3072 |
T3064 |
xcomp |
analyze,decided |
R1767 |
T3073 |
T3074 |
det |
the,mice |
R1768 |
T3074 |
T3072 |
dobj |
mice,analyze |
R1769 |
T3075 |
T3074 |
compound |
Sam68,mice |
R1770 |
T3076 |
T3072 |
prep |
for,analyze |
R1771 |
T3077 |
T3078 |
amod |
skeletal,abnormalities |
R1772 |
T3078 |
T3076 |
pobj |
abnormalities,for |
R1773 |
T3079 |
T3064 |
punct |
.,decided |
R1774 |
T3081 |
T3082 |
nsubjpass |
Cohorts,euthanized |
R1775 |
T3083 |
T3081 |
prep |
of,Cohorts |
R1776 |
T3084 |
T3085 |
nmod |
Sam68,mice |
R1777 |
T3085 |
T3083 |
pobj |
mice,of |
R1778 |
T3086 |
T3084 |
punct |
+,Sam68 |
R1779 |
T3087 |
T3084 |
punct |
/,Sam68 |
R1780 |
T3088 |
T3084 |
punct |
+,Sam68 |
R1781 |
T3089 |
T3084 |
cc |
and,Sam68 |
R1782 |
T3090 |
T3084 |
conj |
Sam68,Sam68 |
R1783 |
T3091 |
T3090 |
punct |
−,Sam68 |
R1784 |
T3092 |
T3090 |
punct |
/,Sam68 |
R1785 |
T3093 |
T3090 |
punct |
−,Sam68 |
R1786 |
T3094 |
T3082 |
auxpass |
were,euthanized |
R1787 |
T3095 |
T3082 |
prep |
at,euthanized |
R1788 |
T3096 |
T3097 |
nummod |
4,months |
R1789 |
T3097 |
T3095 |
pobj |
months,at |
R1790 |
T3098 |
T3096 |
cc |
and,4 |
R1791 |
T3099 |
T3096 |
conj |
12,4 |
R1792 |
T3100 |
T3097 |
prep |
of,months |
R1793 |
T3101 |
T3100 |
pobj |
age,of |
R1794 |
T3102 |
T3082 |
prep |
for,euthanized |
R1795 |
T3103 |
T3104 |
amod |
skeletal,phenotyping |
R1796 |
T3104 |
T3102 |
pobj |
phenotyping,for |
R1797 |
T3105 |
T3082 |
punct |
.,euthanized |
R1798 |
T3107 |
T3108 |
aux |
To,minimize |
R1799 |
T3108 |
T3109 |
advcl |
minimize,selected |
R1800 |
T3110 |
T3108 |
dobj |
differences,minimize |
R1801 |
T3111 |
T3110 |
prep |
in,differences |
R1802 |
T3112 |
T3113 |
det |
the,phenotype |
R1803 |
T3113 |
T3111 |
pobj |
phenotype,in |
R1804 |
T3114 |
T3113 |
compound |
bone,phenotype |
R1805 |
T3115 |
T3116 |
dep |
that,arise |
R1806 |
T3116 |
T3110 |
relcl |
arise,differences |
R1807 |
T3117 |
T3116 |
aux |
might,arise |
R1808 |
T3118 |
T3116 |
advcl |
secondary,arise |
R1809 |
T3119 |
T3118 |
prep |
to,secondary |
R1810 |
T3120 |
T3121 |
nmod |
gender,differences |
R1811 |
T3121 |
T3119 |
pobj |
differences,to |
R1812 |
T3122 |
T3120 |
cc |
or,gender |
R1813 |
T3123 |
T3120 |
conj |
weight,gender |
R1814 |
T3124 |
T3109 |
punct |
", ",selected |
R1815 |
T3125 |
T3109 |
nsubj |
we,selected |
R1816 |
T3126 |
T3127 |
npadvmod |
age,matched |
R1817 |
T3127 |
T3129 |
amod |
matched,mice |
R1818 |
T3128 |
T3127 |
punct |
-,matched |
R1819 |
T3129 |
T3109 |
dobj |
mice,selected |
R1820 |
T3130 |
T3129 |
amod |
female,mice |
R1821 |
T3131 |
T3109 |
prep |
for,selected |
R1822 |
T3132 |
T3133 |
det |
these,analyses |
R1823 |
T3133 |
T3131 |
pobj |
analyses,for |
R1824 |
T3134 |
T3109 |
punct |
.,selected |
R1825 |
T3136 |
T3137 |
det |
The,mice |
R1826 |
T3137 |
T3139 |
nsubj |
mice,demonstrated |
R1827 |
T3138 |
T3137 |
amod |
female,mice |
R1828 |
T3140 |
T3141 |
amod |
similar,increases |
R1829 |
T3141 |
T3139 |
dobj |
increases,demonstrated |
R1830 |
T3142 |
T3141 |
prep |
in,increases |
R1831 |
T3143 |
T3144 |
compound |
body,weight |
R1832 |
T3144 |
T3142 |
pobj |
weight,in |
R1833 |
T3145 |
T3146 |
punct |
", ",weighed |
R1834 |
T3146 |
T3141 |
parataxis |
weighed,increases |
R1835 |
T3147 |
T3146 |
mark |
although,weighed |
R1836 |
T3148 |
T3149 |
nummod |
4,month |
R1837 |
T3149 |
T3151 |
npadvmod |
month,old |
R1838 |
T3150 |
T3149 |
punct |
-,month |
R1839 |
T3151 |
T3153 |
amod |
old,mice |
R1840 |
T3152 |
T3151 |
punct |
-,old |
R1841 |
T3153 |
T3146 |
nsubj |
mice,weighed |
R1842 |
T3154 |
T3153 |
nmod |
Sam68,mice |
R1843 |
T3155 |
T3154 |
punct |
−,Sam68 |
R1844 |
T3156 |
T3154 |
punct |
/,Sam68 |
R1845 |
T3157 |
T3154 |
punct |
−,Sam68 |
R1846 |
T3158 |
T3159 |
amod |
less,than |
R1847 |
T3159 |
T3146 |
prep |
than,weighed |
R1848 |
T3160 |
T3161 |
nmod |
Sam68,mice |
R1849 |
T3161 |
T3159 |
pobj |
mice,than |
R1850 |
T3162 |
T3160 |
punct |
+,Sam68 |
R1851 |
T3163 |
T3160 |
punct |
/,Sam68 |
R1852 |
T3164 |
T3160 |
punct |
+,Sam68 |
R1853 |
T3165 |
T3141 |
punct |
", ",increases |
R1854 |
T3166 |
T3141 |
cc |
and,increases |
R1855 |
T3167 |
T3168 |
amod |
similar,changes |
R1856 |
T3168 |
T3141 |
conj |
changes,increases |
R1857 |
T3169 |
T3168 |
prep |
in,changes |
R1858 |
T3170 |
T3171 |
compound |
bone,lengths |
R1859 |
T3171 |
T3169 |
pobj |
lengths,in |
R1860 |
T3172 |
T3168 |
prep |
in,changes |
R1861 |
T3173 |
T3174 |
det |
the,skeleton |
R1862 |
T3174 |
T3172 |
pobj |
skeleton,in |
R1863 |
T3175 |
T3174 |
amod |
axial,skeleton |
R1864 |
T3176 |
T3175 |
cc |
and,axial |
R1865 |
T3177 |
T3175 |
conj |
appendicular,axial |
R1866 |
T3178 |
T3168 |
prep |
between,changes |
R1867 |
T3179 |
T3180 |
nummod |
4,months |
R1868 |
T3180 |
T3178 |
pobj |
months,between |
R1869 |
T3181 |
T3179 |
cc |
and,4 |
R1870 |
T3182 |
T3179 |
conj |
12,4 |
R1871 |
T3183 |
T3180 |
prep |
of,months |
R1872 |
T3184 |
T3183 |
pobj |
age,of |
R1873 |
T3185 |
T3186 |
punct |
(,Table |
R1874 |
T3186 |
T3139 |
parataxis |
Table,demonstrated |
R1875 |
T3187 |
T3186 |
nummod |
2,Table |
R1876 |
T3188 |
T3186 |
punct |
),Table |
R1877 |
T3189 |
T3139 |
punct |
.,demonstrated |
R1878 |
T3191 |
T3192 |
compound |
Faxitron,radiography |
R1879 |
T3192 |
T3193 |
nsubj |
radiography,revealed |
R1880 |
T3194 |
T3195 |
punct |
(,Corporation |
R1881 |
T3195 |
T3192 |
parataxis |
Corporation,radiography |
R1882 |
T3196 |
T3195 |
compound |
Faxitron,Corporation |
R1883 |
T3197 |
T3198 |
compound |
X,ray |
R1884 |
T3198 |
T3195 |
compound |
ray,Corporation |
R1885 |
T3199 |
T3198 |
punct |
-,ray |
R1886 |
T3200 |
T3195 |
punct |
", ",Corporation |
R1887 |
T3201 |
T3195 |
npadvmod |
Wheeling,Corporation |
R1888 |
T3202 |
T3195 |
punct |
", ",Corporation |
R1889 |
T3203 |
T3195 |
npadvmod |
Illinois,Corporation |
R1890 |
T3204 |
T3195 |
punct |
", ",Corporation |
R1891 |
T3205 |
T3206 |
compound |
United,States |
R1892 |
T3206 |
T3195 |
npadvmod |
States,Corporation |
R1893 |
T3207 |
T3195 |
punct |
),Corporation |
R1894 |
T3208 |
T3209 |
punct |
(,3A |
R1895 |
T3209 |
T3192 |
parataxis |
3A,radiography |
R1896 |
T3210 |
T3209 |
compound |
Figure,3A |
R1897 |
T3211 |
T3209 |
punct |
),3A |
R1898 |
T3212 |
T3192 |
cc |
and,radiography |
R1899 |
T3213 |
T3214 |
amod |
micro–computed,tomography |
R1900 |
T3214 |
T3192 |
conj |
tomography,radiography |
R1901 |
T3215 |
T3216 |
punct |
(,CT |
R1902 |
T3216 |
T3214 |
parataxis |
CT,tomography |
R1903 |
T3217 |
T3216 |
punct |
),CT |
R1904 |
T3218 |
T3219 |
punct |
(,3B |
R1905 |
T3219 |
T3214 |
parataxis |
3B,tomography |
R1906 |
T3220 |
T3219 |
compound |
Figure,3B |
R1907 |
T3221 |
T3219 |
punct |
),3B |
R1908 |
T3222 |
T3223 |
amod |
significant,thinning |
R1909 |
T3223 |
T3193 |
dobj |
thinning,revealed |
R1910 |
T3224 |
T3223 |
amod |
cortical,thinning |
R1911 |
T3225 |
T3226 |
punct |
(,arrow |
R1912 |
T3226 |
T3223 |
parataxis |
arrow,thinning |
R1913 |
T3227 |
T3226 |
punct |
),arrow |
R1914 |
T3228 |
T3223 |
cc |
and,thinning |
R1915 |
T3229 |
T3230 |
det |
a,reduction |
R1916 |
T3230 |
T3223 |
conj |
reduction,thinning |
R1917 |
T3231 |
T3230 |
prep |
in,reduction |
R1918 |
T3232 |
T3233 |
amod |
metaphyseal,bone |
R1919 |
T3233 |
T3231 |
pobj |
bone,in |
R1920 |
T3234 |
T3235 |
punct |
(,asterisk |
R1921 |
T3235 |
T3230 |
parataxis |
asterisk,reduction |
R1922 |
T3236 |
T3235 |
punct |
),asterisk |
R1923 |
T3237 |
T3223 |
prep |
in,thinning |
R1924 |
T3238 |
T3239 |
det |
the,femora |
R1925 |
T3239 |
T3237 |
pobj |
femora,in |
R1926 |
T3240 |
T3239 |
amod |
distal,femora |
R1927 |
T3241 |
T3239 |
prep |
of,femora |
R1928 |
T3242 |
T3243 |
nummod |
12,month |
R1929 |
T3243 |
T3245 |
npadvmod |
month,old |
R1930 |
T3244 |
T3243 |
punct |
-,month |
R1931 |
T3245 |
T3247 |
amod |
old,mice |
R1932 |
T3246 |
T3245 |
punct |
-,old |
R1933 |
T3247 |
T3241 |
pobj |
mice,of |
R1934 |
T3248 |
T3247 |
nmod |
Sam68,mice |
R1935 |
T3249 |
T3248 |
punct |
+,Sam68 |
R1936 |
T3250 |
T3248 |
punct |
/,Sam68 |
R1937 |
T3251 |
T3248 |
punct |
+,Sam68 |
R1938 |
T3252 |
T3223 |
prep |
compared,thinning |
R1939 |
T3253 |
T3252 |
prep |
with,compared |
R1940 |
T3254 |
T3255 |
nummod |
4,month |
R1941 |
T3255 |
T3257 |
npadvmod |
month,old |
R1942 |
T3256 |
T3255 |
punct |
-,month |
R1943 |
T3257 |
T3259 |
amod |
old,mice |
R1944 |
T3258 |
T3257 |
punct |
-,old |
R1945 |
T3259 |
T3253 |
pobj |
mice,with |
R1946 |
T3260 |
T3259 |
prep |
of,mice |
R1947 |
T3261 |
T3262 |
preconj |
either,genotype |
R1948 |
T3262 |
T3260 |
pobj |
genotype,of |
R1949 |
T3263 |
T3259 |
cc |
and,mice |
R1950 |
T3264 |
T3265 |
nummod |
12,month |
R1951 |
T3265 |
T3267 |
npadvmod |
month,old |
R1952 |
T3266 |
T3265 |
punct |
-,month |
R1953 |
T3267 |
T3269 |
amod |
old,mice |
R1954 |
T3268 |
T3267 |
punct |
-,old |
R1955 |
T3269 |
T3259 |
conj |
mice,mice |
R1956 |
T3270 |
T3269 |
nmod |
Sam68,mice |
R1957 |
T3271 |
T3270 |
punct |
−,Sam68 |
R1958 |
T3272 |
T3270 |
punct |
/,Sam68 |
R1959 |
T3273 |
T3270 |
punct |
−,Sam68 |
R1960 |
T3274 |
T3193 |
punct |
.,revealed |
R1961 |
T3276 |
T3277 |
amod |
Similar,reductions |
R1962 |
T3277 |
T3278 |
nsubjpass |
reductions,shown |
R1963 |
T3279 |
T3277 |
prep |
in,reductions |
R1964 |
T3280 |
T3281 |
amod |
trabecular,bone |
R1965 |
T3281 |
T3279 |
pobj |
bone,in |
R1966 |
T3282 |
T3278 |
auxpass |
were,shown |
R1967 |
T3283 |
T3278 |
prep |
by,shown |
R1968 |
T3284 |
T3283 |
pobj |
Faxitron,by |
R1969 |
T3285 |
T3284 |
cc |
and,Faxitron |
R1970 |
T3286 |
T3284 |
conj |
micro-CT,Faxitron |
R1971 |
T3287 |
T3278 |
prep |
in,shown |
R1972 |
T3288 |
T3289 |
det |
the,vertebrae |
R1973 |
T3289 |
T3287 |
pobj |
vertebrae,in |
R1974 |
T3290 |
T3289 |
amod |
fifth,vertebrae |
R1975 |
T3291 |
T3289 |
compound |
lumbar,vertebrae |
R1976 |
T3292 |
T3289 |
prep |
of,vertebrae |
R1977 |
T3293 |
T3294 |
det |
the,mice |
R1978 |
T3294 |
T3292 |
pobj |
mice,of |
R1979 |
T3295 |
T3296 |
nummod |
12,month |
R1980 |
T3296 |
T3298 |
npadvmod |
month,old |
R1981 |
T3297 |
T3296 |
punct |
-,month |
R1982 |
T3298 |
T3294 |
amod |
old,mice |
R1983 |
T3299 |
T3298 |
punct |
-,old |
R1984 |
T3300 |
T3294 |
nmod |
Sam68,mice |
R1985 |
T3301 |
T3300 |
punct |
+,Sam68 |
R1986 |
T3302 |
T3300 |
punct |
/,Sam68 |
R1987 |
T3303 |
T3300 |
punct |
+,Sam68 |
R1988 |
T3304 |
T3287 |
cc |
but,in |
R1989 |
T3305 |
T3304 |
neg |
not,but |
R1990 |
T3306 |
T3287 |
conj |
in,in |
R1991 |
T3307 |
T3308 |
det |
the,mice |
R1992 |
T3308 |
T3306 |
pobj |
mice,in |
R1993 |
T3309 |
T3308 |
nmod |
Sam68,mice |
R1994 |
T3310 |
T3309 |
punct |
−,Sam68 |
R1995 |
T3311 |
T3309 |
punct |
/,Sam68 |
R1996 |
T3312 |
T3309 |
punct |
−,Sam68 |
R1997 |
T3313 |
T3314 |
punct |
(,data |
R1998 |
T3314 |
T3278 |
meta |
data,shown |
R1999 |
T3315 |
T3314 |
amod |
unpublished,data |
R2000 |
T3316 |
T3314 |
punct |
),data |
R2001 |
T3317 |
T3278 |
punct |
.,shown |
R2002 |
T3319 |
T3320 |
amod |
Total,content |
R2003 |
T3320 |
T3324 |
nsubj |
content,increased |
R2004 |
T3321 |
T3320 |
compound |
body,content |
R2005 |
T3322 |
T3320 |
compound |
bone,content |
R2006 |
T3323 |
T3320 |
compound |
mineral,content |
R2007 |
T3325 |
T3320 |
punct |
(,content |
R2008 |
T3326 |
T3320 |
appos |
BMC,content |
R2009 |
T3327 |
T3320 |
punct |
),content |
R2010 |
T3328 |
T3320 |
punct |
", ",content |
R2011 |
T3329 |
T3320 |
acl |
quantified,content |
R2012 |
T3330 |
T3329 |
prep |
with,quantified |
R2013 |
T3331 |
T3332 |
det |
a,densitometer |
R2014 |
T3332 |
T3330 |
pobj |
densitometer,with |
R2015 |
T3333 |
T3334 |
amod |
Lunar,PIXImus |
R2016 |
T3334 |
T3332 |
compound |
PIXImus,densitometer |
R2017 |
T3335 |
T3332 |
compound |
mouse,densitometer |
R2018 |
T3336 |
T3337 |
punct |
(,Lunar |
R2019 |
T3337 |
T3332 |
parataxis |
Lunar,densitometer |
R2020 |
T3338 |
T3337 |
compound |
GE,Lunar |
R2021 |
T3339 |
T3337 |
punct |
-,Lunar |
R2022 |
T3340 |
T3337 |
punct |
", ",Lunar |
R2023 |
T3341 |
T3337 |
npadvmod |
Madison,Lunar |
R2024 |
T3342 |
T3337 |
punct |
", ",Lunar |
R2025 |
T3343 |
T3337 |
npadvmod |
Wisconsin,Lunar |
R2026 |
T3344 |
T3337 |
punct |
", ",Lunar |
R2027 |
T3345 |
T3346 |
compound |
United,States |
R2028 |
T3346 |
T3337 |
npadvmod |
States,Lunar |
R2029 |
T3347 |
T3337 |
punct |
),Lunar |
R2030 |
T3348 |
T3324 |
punct |
", ",increased |
R2031 |
T3349 |
T3324 |
prep |
in,increased |
R2032 |
T3350 |
T3351 |
preconj |
both,Sam68 |
R2033 |
T3351 |
T3352 |
nmod |
Sam68,mice |
R2034 |
T3352 |
T3349 |
pobj |
mice,in |
R2035 |
T3353 |
T3351 |
punct |
+,Sam68 |
R2036 |
T3354 |
T3351 |
punct |
/,Sam68 |
R2037 |
T3355 |
T3351 |
punct |
+,Sam68 |
R2038 |
T3356 |
T3351 |
cc |
and,Sam68 |
R2039 |
T3357 |
T3351 |
conj |
Sam68,Sam68 |
R2040 |
T3358 |
T3357 |
punct |
−,Sam68 |
R2041 |
T3359 |
T3357 |
punct |
/,Sam68 |
R2042 |
T3360 |
T3357 |
punct |
−,Sam68 |
R2043 |
T3361 |
T3352 |
prep |
between,mice |
R2044 |
T3362 |
T3363 |
nummod |
4,months |
R2045 |
T3363 |
T3361 |
pobj |
months,between |
R2046 |
T3364 |
T3363 |
cc |
and,months |
R2047 |
T3365 |
T3366 |
nummod |
12,months |
R2048 |
T3366 |
T3363 |
conj |
months,months |
R2049 |
T3367 |
T3363 |
prep |
of,months |
R2050 |
T3368 |
T3367 |
pobj |
age,of |
R2051 |
T3369 |
T3324 |
punct |
", ",increased |
R2052 |
T3370 |
T3324 |
cc |
but,increased |
R2053 |
T3371 |
T3372 |
advmod |
only,reached |
R2054 |
T3372 |
T3324 |
conj |
reached,increased |
R2055 |
T3373 |
T3372 |
dobj |
significance,reached |
R2056 |
T3374 |
T3372 |
prep |
in,reached |
R2057 |
T3375 |
T3376 |
det |
the,mice |
R2058 |
T3376 |
T3374 |
pobj |
mice,in |
R2059 |
T3377 |
T3376 |
nmod |
Sam68,mice |
R2060 |
T3378 |
T3377 |
punct |
−,Sam68 |
R2061 |
T3379 |
T3377 |
punct |
/,Sam68 |
R2062 |
T3380 |
T3377 |
punct |
−,Sam68 |
R2063 |
T3381 |
T3382 |
punct |
(,Table |
R2064 |
T3382 |
T3372 |
parataxis |
Table,reached |
R2065 |
T3383 |
T3382 |
nummod |
2,Table |
R2066 |
T3384 |
T3382 |
punct |
),Table |
R2067 |
T3385 |
T3324 |
punct |
.,increased |
R2068 |
T3387 |
T3388 |
advmod |
Similarly,seen |
R2069 |
T3389 |
T3388 |
punct |
", ",seen |
R2070 |
T3390 |
T3391 |
det |
a,increase |
R2071 |
T3391 |
T3388 |
nsubjpass |
increase,seen |
R2072 |
T3392 |
T3391 |
amod |
greater,increase |
R2073 |
T3393 |
T3391 |
prep |
in,increase |
R2074 |
T3394 |
T3393 |
pobj |
BMC,in |
R2075 |
T3395 |
T3388 |
auxpass |
was,seen |
R2076 |
T3396 |
T3388 |
prep |
in,seen |
R2077 |
T3397 |
T3398 |
det |
the,femur |
R2078 |
T3398 |
T3396 |
pobj |
femur,in |
R2079 |
T3399 |
T3398 |
cc |
and,femur |
R2080 |
T3400 |
T3398 |
conj |
vertebra,femur |
R2081 |
T3401 |
T3398 |
prep |
in,femur |
R2082 |
T3402 |
T3403 |
det |
the,mice |
R2083 |
T3403 |
T3401 |
pobj |
mice,in |
R2084 |
T3404 |
T3403 |
nmod |
Sam68,mice |
R2085 |
T3405 |
T3404 |
punct |
−,Sam68 |
R2086 |
T3406 |
T3404 |
punct |
/,Sam68 |
R2087 |
T3407 |
T3404 |
punct |
−,Sam68 |
R2088 |
T3408 |
T3388 |
punct |
.,seen |
R2089 |
T3410 |
T3411 |
compound |
Bone,mineral |
R2090 |
T3411 |
T3412 |
compound |
mineral,density |
R2091 |
T3412 |
T3413 |
nsubj |
density,remained |
R2092 |
T3414 |
T3412 |
punct |
(,density |
R2093 |
T3415 |
T3412 |
appos |
BMD,density |
R2094 |
T3416 |
T3413 |
punct |
),remained |
R2095 |
T3417 |
T3413 |
acomp |
constant,remained |
R2096 |
T3418 |
T3413 |
cc |
or,remained |
R2097 |
T3419 |
T3413 |
conj |
decreased,remained |
R2098 |
T3420 |
T3413 |
prep |
in,remained |
R2099 |
T3421 |
T3422 |
det |
the,mice |
R2100 |
T3422 |
T3420 |
pobj |
mice,in |
R2101 |
T3423 |
T3424 |
amod |
wild,type |
R2102 |
T3424 |
T3422 |
compound |
type,mice |
R2103 |
T3425 |
T3413 |
cc |
but,remained |
R2104 |
T3426 |
T3413 |
conj |
increased,remained |
R2105 |
T3427 |
T3426 |
advmod |
significantly,increased |
R2106 |
T3428 |
T3426 |
prep |
in,increased |
R2107 |
T3429 |
T3430 |
det |
the,body |
R2108 |
T3430 |
T3428 |
pobj |
body,in |
R2109 |
T3431 |
T3430 |
amod |
total,body |
R2110 |
T3432 |
T3428 |
cc |
and,in |
R2111 |
T3433 |
T3428 |
conj |
in,in |
R2112 |
T3434 |
T3435 |
det |
the,regions |
R2113 |
T3435 |
T3433 |
pobj |
regions,in |
R2114 |
T3436 |
T3435 |
amod |
femoral,regions |
R2115 |
T3437 |
T3436 |
cc |
and,femoral |
R2116 |
T3438 |
T3436 |
conj |
vertebral,femoral |
R2117 |
T3439 |
T3435 |
prep |
of,regions |
R2118 |
T3440 |
T3439 |
pobj |
interest,of |
R2119 |
T3441 |
T3426 |
prep |
in,increased |
R2120 |
T3442 |
T3443 |
det |
the,Sam68 |
R2121 |
T3443 |
T3441 |
pobj |
Sam68,in |
R2122 |
T3444 |
T3443 |
punct |
−,Sam68 |
R2123 |
T3445 |
T3443 |
punct |
/,Sam68 |
R2124 |
T3446 |
T3443 |
punct |
−,Sam68 |
R2125 |
T3447 |
T3448 |
punct |
(,Table |
R2126 |
T3448 |
T3426 |
parataxis |
Table,increased |
R2127 |
T3449 |
T3448 |
nummod |
2,Table |
R2128 |
T3450 |
T3448 |
punct |
),Table |
R2129 |
T3451 |
T3413 |
punct |
.,remained |
R2130 |
T3453 |
T3454 |
det |
These,data |
R2131 |
T3454 |
T3455 |
nsubj |
data,showed |
R2132 |
T3456 |
T3457 |
mark |
that,continued |
R2133 |
T3457 |
T3455 |
ccomp |
continued,showed |
R2134 |
T3458 |
T3459 |
nmod |
Sam68,mice |
R2135 |
T3459 |
T3457 |
nsubj |
mice,continued |
R2136 |
T3460 |
T3458 |
punct |
−,Sam68 |
R2137 |
T3461 |
T3458 |
punct |
/,Sam68 |
R2138 |
T3462 |
T3458 |
punct |
−,Sam68 |
R2139 |
T3463 |
T3464 |
aux |
to,thrive |
R2140 |
T3464 |
T3457 |
xcomp |
thrive,continued |
R2141 |
T3465 |
T3464 |
cc |
and,thrive |
R2142 |
T3466 |
T3464 |
conj |
accrue,thrive |
R2143 |
T3467 |
T3466 |
dobj |
bone,accrue |
R2144 |
T3468 |
T3466 |
prep |
in,accrue |
R2145 |
T3469 |
T3470 |
det |
the,skeleton |
R2146 |
T3470 |
T3468 |
pobj |
skeleton,in |
R2147 |
T3471 |
T3470 |
amod |
axial,skeleton |
R2148 |
T3472 |
T3471 |
cc |
and,axial |
R2149 |
T3473 |
T3471 |
conj |
appendicular,axial |
R2150 |
T3474 |
T3464 |
prep |
for,thrive |
R2151 |
T3475 |
T3476 |
amod |
longer,12 |
R2152 |
T3476 |
T3478 |
nummod |
12,months |
R2153 |
T3477 |
T3476 |
quantmod |
than,12 |
R2154 |
T3478 |
T3474 |
pobj |
months,for |
R2155 |
T3479 |
T3455 |
punct |
.,showed |
R2156 |
T3481 |
T3482 |
nsubj |
This,was |
R2157 |
T3483 |
T3482 |
prep |
in,was |
R2158 |
T3484 |
T3483 |
pobj |
contrast,in |
R2159 |
T3485 |
T3484 |
prep |
to,contrast |
R2160 |
T3486 |
T3487 |
det |
the,situation |
R2161 |
T3487 |
T3485 |
pobj |
situation,to |
R2162 |
T3488 |
T3487 |
prep |
in,situation |
R2163 |
T3489 |
T3490 |
npadvmod |
age,matched |
R2164 |
T3490 |
T3492 |
amod |
matched,controls |
R2165 |
T3491 |
T3490 |
punct |
-,matched |
R2166 |
T3492 |
T3488 |
pobj |
controls,in |
R2167 |
T3493 |
T3492 |
punct |
", ",controls |
R2168 |
T3494 |
T3492 |
compound |
littermate,controls |
R2169 |
T3495 |
T3496 |
prep |
in,lost |
R2170 |
T3496 |
T3487 |
relcl |
lost,situation |
R2171 |
T3497 |
T3495 |
pobj |
which,in |
R2172 |
T3498 |
T3499 |
det |
a,amount |
R2173 |
T3499 |
T3496 |
nsubjpass |
amount,lost |
R2174 |
T3500 |
T3499 |
amod |
significant,amount |
R2175 |
T3501 |
T3499 |
prep |
of,amount |
R2176 |
T3502 |
T3501 |
pobj |
bone,of |
R2177 |
T3503 |
T3496 |
auxpass |
was,lost |
R2178 |
T3504 |
T3496 |
prep |
over,lost |
R2179 |
T3505 |
T3506 |
det |
the,timeframe |
R2180 |
T3506 |
T3504 |
pobj |
timeframe,over |
R2181 |
T3507 |
T3506 |
amod |
same,timeframe |
R2182 |
T3508 |
T3482 |
punct |
.,was |
R2183 |
T3587 |
T3588 |
advmod |
Three,Dimensional |
R2184 |
T3588 |
T3590 |
amod |
Dimensional,Architecture |
R2185 |
T3589 |
T3588 |
punct |
-,Dimensional |
R2186 |
T3590 |
T3591 |
nsubjpass |
Architecture,Preserved |
R2187 |
T3592 |
T3590 |
prep |
of,Architecture |
R2188 |
T3593 |
T3592 |
pobj |
Bone,of |
R2189 |
T3594 |
T3591 |
auxpass |
Is,Preserved |
R2190 |
T3595 |
T3591 |
prep |
in,Preserved |
R2191 |
T3596 |
T3597 |
amod |
Aged,Mice |
R2192 |
T3597 |
T3595 |
pobj |
Mice,in |
R2193 |
T3598 |
T3597 |
nmod |
Sam68,Mice |
R2194 |
T3599 |
T3598 |
punct |
−,Sam68 |
R2195 |
T3600 |
T3598 |
punct |
/,Sam68 |
R2196 |
T3601 |
T3598 |
punct |
−,Sam68 |
R2197 |
T3603 |
T3604 |
compound |
Bone,loss |
R2198 |
T3604 |
T3605 |
nsubj |
loss,are |
R2199 |
T3606 |
T3604 |
cc |
and,loss |
R2200 |
T3607 |
T3608 |
amod |
compromised,architecture |
R2201 |
T3608 |
T3604 |
conj |
architecture,loss |
R2202 |
T3609 |
T3610 |
amod |
characteristic,features |
R2203 |
T3610 |
T3605 |
attr |
features,are |
R2204 |
T3611 |
T3610 |
prep |
of,features |
R2205 |
T3612 |
T3613 |
det |
the,skeletons |
R2206 |
T3613 |
T3611 |
pobj |
skeletons,of |
R2207 |
T3614 |
T3613 |
prep |
of,skeletons |
R2208 |
T3615 |
T3616 |
amod |
aged,mice |
R2209 |
T3616 |
T3614 |
pobj |
mice,of |
R2210 |
T3617 |
T3616 |
nmod |
C57BL,mice |
R2211 |
T3618 |
T3617 |
punct |
/,C57BL |
R2212 |
T3619 |
T3617 |
nummod |
6,C57BL |
R2213 |
T3620 |
T3605 |
cc |
and,are |
R2214 |
T3621 |
T3605 |
conj |
resemble,are |
R2215 |
T3622 |
T3623 |
det |
the,features |
R2216 |
T3623 |
T3621 |
dobj |
features,resemble |
R2217 |
T3624 |
T3623 |
amod |
clinical,features |
R2218 |
T3625 |
T3623 |
prep |
of,features |
R2219 |
T3626 |
T3627 |
npadvmod |
age,related |
R2220 |
T3627 |
T3629 |
amod |
related,loss |
R2221 |
T3628 |
T3627 |
punct |
-,related |
R2222 |
T3629 |
T3625 |
pobj |
loss,of |
R2223 |
T3630 |
T3629 |
compound |
bone,loss |
R2224 |
T3631 |
T3629 |
prep |
in,loss |
R2225 |
T3632 |
T3631 |
pobj |
humans,in |
R2226 |
T3633 |
T3634 |
dep |
that,predispose |
R2227 |
T3634 |
T3623 |
relcl |
predispose,features |
R2228 |
T3635 |
T3634 |
aux |
can,predispose |
R2229 |
T3636 |
T3637 |
det |
an,individual |
R2230 |
T3637 |
T3634 |
dobj |
individual,predispose |
R2231 |
T3638 |
T3634 |
prep |
to,predispose |
R2232 |
T3639 |
T3638 |
pobj |
fracture,to |
R2233 |
T3640 |
T3605 |
punct |
.,are |
R2234 |
T3642 |
T3643 |
nsubj |
Quantification,confirmed |
R2235 |
T3644 |
T3642 |
prep |
of,Quantification |
R2236 |
T3645 |
T3646 |
det |
the,data |
R2237 |
T3646 |
T3644 |
pobj |
data,of |
R2238 |
T3647 |
T3646 |
compound |
micro-CT,data |
R2239 |
T3648 |
T3646 |
acl |
shown,data |
R2240 |
T3649 |
T3648 |
prep |
in,shown |
R2241 |
T3650 |
T3651 |
compound |
Figure,3B |
R2242 |
T3651 |
T3649 |
pobj |
3B,in |
R2243 |
T3652 |
T3653 |
det |
the,reduction |
R2244 |
T3653 |
T3643 |
dobj |
reduction,confirmed |
R2245 |
T3654 |
T3653 |
prep |
in,reduction |
R2246 |
T3655 |
T3656 |
compound |
bone,volume |
R2247 |
T3656 |
T3654 |
pobj |
volume,in |
R2248 |
T3657 |
T3653 |
prep |
compared,reduction |
R2249 |
T3658 |
T3657 |
prep |
with,compared |
R2250 |
T3659 |
T3660 |
compound |
tissue,volume |
R2251 |
T3660 |
T3658 |
pobj |
volume,with |
R2252 |
T3661 |
T3662 |
punct |
(,4A |
R2253 |
T3662 |
T3660 |
parataxis |
4A,volume |
R2254 |
T3663 |
T3664 |
compound |
BV,TV |
R2255 |
T3664 |
T3662 |
dep |
TV,4A |
R2256 |
T3665 |
T3664 |
punct |
/,TV |
R2257 |
T3666 |
T3662 |
punct |
;,4A |
R2258 |
T3667 |
T3662 |
compound |
Figure,4A |
R2259 |
T3668 |
T3662 |
punct |
", ",4A |
R2260 |
T3669 |
T3662 |
amod |
left,4A |
R2261 |
T3670 |
T3662 |
punct |
),4A |
R2262 |
T3671 |
T3660 |
prep |
in,volume |
R2263 |
T3672 |
T3673 |
det |
the,mice |
R2264 |
T3673 |
T3671 |
pobj |
mice,in |
R2265 |
T3674 |
T3675 |
nummod |
12,month |
R2266 |
T3675 |
T3677 |
npadvmod |
month,old |
R2267 |
T3676 |
T3675 |
punct |
-,month |
R2268 |
T3677 |
T3673 |
amod |
old,mice |
R2269 |
T3678 |
T3677 |
punct |
-,old |
R2270 |
T3679 |
T3673 |
nmod |
Sam68,mice |
R2271 |
T3680 |
T3679 |
punct |
+,Sam68 |
R2272 |
T3681 |
T3679 |
punct |
/,Sam68 |
R2273 |
T3682 |
T3679 |
punct |
+,Sam68 |
R2274 |
T3683 |
T3684 |
punct |
(,bars |
R2275 |
T3684 |
T3673 |
parataxis |
bars,mice |
R2276 |
T3685 |
T3684 |
amod |
hatched,bars |
R2277 |
T3686 |
T3684 |
punct |
),bars |
R2278 |
T3687 |
T3660 |
prep |
compared,volume |
R2279 |
T3688 |
T3687 |
prep |
with,compared |
R2280 |
T3689 |
T3690 |
nummod |
4,month |
R2281 |
T3690 |
T3692 |
npadvmod |
month,old |
R2282 |
T3691 |
T3690 |
punct |
-,month |
R2283 |
T3692 |
T3694 |
amod |
old,mice |
R2284 |
T3693 |
T3692 |
punct |
-,old |
R2285 |
T3694 |
T3688 |
pobj |
mice,with |
R2286 |
T3695 |
T3694 |
prep |
of,mice |
R2287 |
T3696 |
T3697 |
det |
both,genotypes |
R2288 |
T3697 |
T3695 |
pobj |
genotypes,of |
R2289 |
T3698 |
T3699 |
punct |
(,bars |
R2290 |
T3699 |
T3694 |
parataxis |
bars,mice |
R2291 |
T3700 |
T3699 |
amod |
solid,bars |
R2292 |
T3701 |
T3699 |
punct |
),bars |
R2293 |
T3702 |
T3694 |
cc |
and,mice |
R2294 |
T3703 |
T3704 |
nummod |
12,month |
R2295 |
T3704 |
T3706 |
npadvmod |
month,old |
R2296 |
T3705 |
T3704 |
punct |
-,month |
R2297 |
T3706 |
T3708 |
amod |
old,mice |
R2298 |
T3707 |
T3706 |
punct |
-,old |
R2299 |
T3708 |
T3694 |
conj |
mice,mice |
R2300 |
T3709 |
T3708 |
nmod |
Sam68,mice |
R2301 |
T3710 |
T3709 |
punct |
−,Sam68 |
R2302 |
T3711 |
T3709 |
punct |
/,Sam68 |
R2303 |
T3712 |
T3709 |
punct |
−,Sam68 |
R2304 |
T3713 |
T3714 |
punct |
(,bars |
R2305 |
T3714 |
T3708 |
parataxis |
bars,mice |
R2306 |
T3715 |
T3714 |
amod |
stippled,bars |
R2307 |
T3716 |
T3714 |
punct |
),bars |
R2308 |
T3717 |
T3643 |
punct |
.,confirmed |
R2309 |
T3719 |
T3720 |
nsubjpass |
This,associated |
R2310 |
T3721 |
T3720 |
auxpass |
was,associated |
R2311 |
T3722 |
T3720 |
prep |
with,associated |
R2312 |
T3723 |
T3724 |
det |
a,increase |
R2313 |
T3724 |
T3722 |
pobj |
increase,with |
R2314 |
T3725 |
T3724 |
amod |
significant,increase |
R2315 |
T3726 |
T3727 |
punct |
(,denoted |
R2316 |
T3727 |
T3724 |
parataxis |
denoted,increase |
R2317 |
T3728 |
T3729 |
nsubj |
p,0.01 |
R2318 |
T3729 |
T3727 |
ccomp |
0.01,denoted |
R2319 |
T3730 |
T3729 |
punct |
<,0.01 |
R2320 |
T3731 |
T3727 |
punct |
;,denoted |
R2321 |
T3732 |
T3727 |
agent |
by,denoted |
R2322 |
T3733 |
T3734 |
det |
the,asterisks |
R2323 |
T3734 |
T3732 |
pobj |
asterisks,by |
R2324 |
T3735 |
T3727 |
punct |
),denoted |
R2325 |
T3736 |
T3724 |
prep |
in,increase |
R2326 |
T3737 |
T3738 |
det |
the,index |
R2327 |
T3738 |
T3736 |
pobj |
index,in |
R2328 |
T3739 |
T3738 |
compound |
structure,index |
R2329 |
T3740 |
T3738 |
compound |
model,index |
R2330 |
T3741 |
T3738 |
punct |
", ",index |
R2331 |
T3742 |
T3743 |
dep |
which,measures |
R2332 |
T3743 |
T3738 |
relcl |
measures,index |
R2333 |
T3744 |
T3745 |
det |
the,ratio |
R2334 |
T3745 |
T3743 |
dobj |
ratio,measures |
R2335 |
T3746 |
T3745 |
prep |
of,ratio |
R2336 |
T3747 |
T3748 |
npadvmod |
plate,like |
R2337 |
T3748 |
T3746 |
pobj |
like,of |
R2338 |
T3749 |
T3748 |
punct |
-,like |
R2339 |
T3750 |
T3748 |
prep |
to,like |
R2340 |
T3751 |
T3752 |
npadvmod |
rod,like |
R2341 |
T3752 |
T3750 |
pobj |
like,to |
R2342 |
T3753 |
T3752 |
punct |
-,like |
R2343 |
T3754 |
T3748 |
appos |
structures,like |
R2344 |
T3755 |
T3756 |
punct |
(,4A |
R2345 |
T3756 |
T3743 |
parataxis |
4A,measures |
R2346 |
T3757 |
T3756 |
compound |
Figure,4A |
R2347 |
T3758 |
T3756 |
punct |
", ",4A |
R2348 |
T3759 |
T3756 |
appos |
right,4A |
R2349 |
T3760 |
T3756 |
punct |
),4A |
R2350 |
T3761 |
T3720 |
punct |
.,associated |
R2351 |
T3763 |
T3764 |
det |
A,increase |
R2352 |
T3764 |
T3766 |
nsubj |
increase,was |
R2353 |
T3765 |
T3764 |
amod |
quantifiable,increase |
R2354 |
T3767 |
T3764 |
prep |
in,increase |
R2355 |
T3768 |
T3769 |
det |
the,separation |
R2356 |
T3769 |
T3767 |
pobj |
separation,in |
R2357 |
T3770 |
T3769 |
nmod |
mean,separation |
R2358 |
T3771 |
T3769 |
amod |
trabecular,separation |
R2359 |
T3772 |
T3769 |
punct |
(,separation |
R2360 |
T3773 |
T3769 |
appos |
Tb.Sp,separation |
R2361 |
T3774 |
T3769 |
punct |
),separation |
R2362 |
T3775 |
T3776 |
punct |
(,data |
R2363 |
T3776 |
T3769 |
parataxis |
data,separation |
R2364 |
T3777 |
T3776 |
amod |
unpublished,data |
R2365 |
T3778 |
T3776 |
punct |
),data |
R2366 |
T3779 |
T3764 |
prep |
in,increase |
R2367 |
T3780 |
T3781 |
nummod |
12,month |
R2368 |
T3781 |
T3783 |
npadvmod |
month,old |
R2369 |
T3782 |
T3781 |
punct |
-,month |
R2370 |
T3783 |
T3785 |
amod |
old,mice |
R2371 |
T3784 |
T3783 |
punct |
-,old |
R2372 |
T3785 |
T3779 |
pobj |
mice,in |
R2373 |
T3786 |
T3785 |
nmod |
Sam68,mice |
R2374 |
T3787 |
T3786 |
punct |
+,Sam68 |
R2375 |
T3788 |
T3786 |
punct |
/,Sam68 |
R2376 |
T3789 |
T3786 |
punct |
+,Sam68 |
R2377 |
T3790 |
T3766 |
prep |
due,was |
R2378 |
T3791 |
T3790 |
pcomp |
to,due |
R2379 |
T3792 |
T3793 |
det |
an,increase |
R2380 |
T3793 |
T3790 |
pobj |
increase,due |
R2381 |
T3794 |
T3793 |
prep |
in,increase |
R2382 |
T3795 |
T3796 |
det |
the,percentage |
R2383 |
T3796 |
T3794 |
pobj |
percentage,in |
R2384 |
T3797 |
T3796 |
prep |
of,percentage |
R2385 |
T3798 |
T3797 |
pobj |
spaces,of |
R2386 |
T3799 |
T3798 |
acl |
falling,spaces |
R2387 |
T3800 |
T3799 |
prep |
in,falling |
R2388 |
T3801 |
T3802 |
det |
the,range |
R2389 |
T3802 |
T3800 |
pobj |
range,in |
R2390 |
T3803 |
T3802 |
prep |
of,range |
R2391 |
T3804 |
T3805 |
quantmod |
350,700 |
R2392 |
T3805 |
T3807 |
nummod |
700,μm |
R2393 |
T3806 |
T3805 |
quantmod |
to,700 |
R2394 |
T3807 |
T3803 |
pobj |
μm,of |
R2395 |
T3808 |
T3809 |
punct |
(,4B |
R2396 |
T3809 |
T3766 |
parataxis |
4B,was |
R2397 |
T3810 |
T3809 |
compound |
Figure,4B |
R2398 |
T3811 |
T3809 |
punct |
", ",4B |
R2399 |
T3812 |
T3813 |
amod |
red,line |
R2400 |
T3813 |
T3809 |
appos |
line,4B |
R2401 |
T3814 |
T3813 |
amod |
hatched,line |
R2402 |
T3815 |
T3809 |
punct |
),4B |
R2403 |
T3816 |
T3766 |
punct |
.,was |
R2404 |
T3818 |
T3819 |
amod |
Trabecular,thickness |
R2405 |
T3819 |
T3820 |
nsubj |
thickness,remained |
R2406 |
T3821 |
T3820 |
acomp |
constant,remained |
R2407 |
T3822 |
T3820 |
prep |
among,remained |
R2408 |
T3823 |
T3824 |
det |
the,groups |
R2409 |
T3824 |
T3822 |
pobj |
groups,among |
R2410 |
T3825 |
T3824 |
amod |
different,groups |
R2411 |
T3826 |
T3824 |
prep |
of,groups |
R2412 |
T3827 |
T3826 |
pobj |
mice,of |
R2413 |
T3828 |
T3829 |
punct |
(,data |
R2414 |
T3829 |
T3820 |
meta |
data,remained |
R2415 |
T3830 |
T3829 |
amod |
unpublished,data |
R2416 |
T3831 |
T3829 |
punct |
),data |
R2417 |
T3832 |
T3820 |
punct |
.,remained |
R2418 |
T3834 |
T3835 |
prep |
In,meant |
R2419 |
T3836 |
T3834 |
pobj |
effect,In |
R2420 |
T3837 |
T3835 |
punct |
", ",meant |
R2421 |
T3838 |
T3835 |
nsubj |
this,meant |
R2422 |
T3839 |
T3840 |
mark |
that,were |
R2423 |
T3840 |
T3835 |
ccomp |
were,meant |
R2424 |
T3841 |
T3840 |
expl |
there,were |
R2425 |
T3842 |
T3843 |
amod |
fewer,trabeculae |
R2426 |
T3843 |
T3840 |
attr |
trabeculae,were |
R2427 |
T3844 |
T3843 |
punct |
", ",trabeculae |
R2428 |
T3845 |
T3846 |
advmod |
rather,than |
R2429 |
T3846 |
T3843 |
cc |
than,trabeculae |
R2430 |
T3847 |
T3848 |
amod |
equivalent,numbers |
R2431 |
T3848 |
T3843 |
conj |
numbers,trabeculae |
R2432 |
T3849 |
T3848 |
prep |
of,numbers |
R2433 |
T3850 |
T3851 |
amod |
thin,trabeculae |
R2434 |
T3851 |
T3849 |
pobj |
trabeculae,of |
R2435 |
T3852 |
T3843 |
punct |
", ",trabeculae |
R2436 |
T3853 |
T3843 |
prep |
in,trabeculae |
R2437 |
T3854 |
T3855 |
det |
the,mice |
R2438 |
T3855 |
T3853 |
pobj |
mice,in |
R2439 |
T3856 |
T3857 |
nummod |
12,month |
R2440 |
T3857 |
T3859 |
npadvmod |
month,old |
R2441 |
T3858 |
T3857 |
punct |
-,month |
R2442 |
T3859 |
T3855 |
amod |
old,mice |
R2443 |
T3860 |
T3859 |
punct |
-,old |
R2444 |
T3861 |
T3855 |
nmod |
Sam68,mice |
R2445 |
T3862 |
T3861 |
punct |
+,Sam68 |
R2446 |
T3863 |
T3861 |
punct |
/,Sam68 |
R2447 |
T3864 |
T3861 |
punct |
+,Sam68 |
R2448 |
T3865 |
T3843 |
prep |
compared,trabeculae |
R2449 |
T3866 |
T3865 |
prep |
with,compared |
R2450 |
T3867 |
T3866 |
pobj |
any,with |
R2451 |
T3868 |
T3867 |
prep |
of,any |
R2452 |
T3869 |
T3870 |
det |
the,groups |
R2453 |
T3870 |
T3868 |
pobj |
groups,of |
R2454 |
T3871 |
T3870 |
amod |
other,groups |
R2455 |
T3872 |
T3870 |
prep |
of,groups |
R2456 |
T3873 |
T3872 |
pobj |
mice,of |
R2457 |
T3874 |
T3835 |
punct |
.,meant |
R2458 |
T4163 |
T4164 |
compound |
Bone,Remodeling |
R2459 |
T4164 |
T4165 |
nsubjpass |
Remodeling,Preserved |
R2460 |
T4166 |
T4165 |
auxpass |
Is,Preserved |
R2461 |
T4167 |
T4165 |
prep |
in,Preserved |
R2462 |
T4168 |
T4169 |
amod |
Aged,Mice |
R2463 |
T4169 |
T4167 |
pobj |
Mice,in |
R2464 |
T4170 |
T4169 |
nmod |
Sam68,Mice |
R2465 |
T4171 |
T4170 |
punct |
−,Sam68 |
R2466 |
T4172 |
T4170 |
punct |
/,Sam68 |
R2467 |
T4173 |
T4170 |
punct |
−,Sam68 |
R2468 |
T4175 |
T4176 |
aux |
To,define |
R2469 |
T4176 |
T4178 |
advcl |
define,prepared |
R2470 |
T4177 |
T4176 |
advmod |
further,define |
R2471 |
T4179 |
T4180 |
det |
the,mechanisms |
R2472 |
T4180 |
T4176 |
dobj |
mechanisms,define |
R2473 |
T4181 |
T4180 |
acl |
involved,mechanisms |
R2474 |
T4182 |
T4181 |
prep |
in,involved |
R2475 |
T4183 |
T4184 |
det |
the,preservation |
R2476 |
T4184 |
T4182 |
pobj |
preservation,in |
R2477 |
T4185 |
T4184 |
prep |
of,preservation |
R2478 |
T4186 |
T4187 |
compound |
bone,mass |
R2479 |
T4187 |
T4185 |
pobj |
mass,of |
R2480 |
T4188 |
T4184 |
prep |
in,preservation |
R2481 |
T4189 |
T4190 |
amod |
aged,mice |
R2482 |
T4190 |
T4188 |
pobj |
mice,in |
R2483 |
T4191 |
T4190 |
nmod |
Sam68,mice |
R2484 |
T4192 |
T4191 |
punct |
−,Sam68 |
R2485 |
T4193 |
T4191 |
punct |
/,Sam68 |
R2486 |
T4194 |
T4191 |
punct |
−,Sam68 |
R2487 |
T4195 |
T4178 |
punct |
", ",prepared |
R2488 |
T4196 |
T4178 |
nsubj |
we,prepared |
R2489 |
T4197 |
T4178 |
dobj |
sections,prepared |
R2490 |
T4198 |
T4178 |
prep |
from,prepared |
R2491 |
T4199 |
T4200 |
npadvmod |
plastic,embedded |
R2492 |
T4200 |
T4202 |
amod |
embedded,femora |
R2493 |
T4201 |
T4200 |
punct |
-,embedded |
R2494 |
T4202 |
T4198 |
pobj |
femora,from |
R2495 |
T4203 |
T4202 |
cc |
and,femora |
R2496 |
T4204 |
T4202 |
conj |
tibia,femora |
R2497 |
T4205 |
T4206 |
aux |
to,evaluate |
R2498 |
T4206 |
T4178 |
advcl |
evaluate,prepared |
R2499 |
T4207 |
T4208 |
nmod |
osteoblast,activity |
R2500 |
T4208 |
T4206 |
dobj |
activity,evaluate |
R2501 |
T4209 |
T4207 |
cc |
and,osteoblast |
R2502 |
T4210 |
T4207 |
conj |
osteoclast,osteoblast |
R2503 |
T4211 |
T4212 |
punct |
(,Figure |
R2504 |
T4212 |
T4178 |
parataxis |
Figure,prepared |
R2505 |
T4213 |
T4212 |
nummod |
5,Figure |
R2506 |
T4214 |
T4212 |
punct |
),Figure |
R2507 |
T4215 |
T4178 |
punct |
.,prepared |
R2508 |
T4217 |
T4218 |
advmod |
In,situ |
R2509 |
T4218 |
T4219 |
amod |
situ,staining |
R2510 |
T4219 |
T4222 |
nsubjpass |
staining,used |
R2511 |
T4220 |
T4219 |
nmod |
enzyme,staining |
R2512 |
T4221 |
T4219 |
amod |
histochemical,staining |
R2513 |
T4223 |
T4219 |
prep |
for,staining |
R2514 |
T4224 |
T4225 |
nmod |
alkaline,phosphatase |
R2515 |
T4225 |
T4226 |
nmod |
phosphatase,activity |
R2516 |
T4226 |
T4223 |
pobj |
activity,for |
R2517 |
T4227 |
T4225 |
punct |
(,phosphatase |
R2518 |
T4228 |
T4225 |
appos |
ALP,phosphatase |
R2519 |
T4229 |
T4230 |
punct |
;,stain |
R2520 |
T4230 |
T4228 |
parataxis |
stain,ALP |
R2521 |
T4231 |
T4230 |
amod |
brown,stain |
R2522 |
T4232 |
T4230 |
punct |
),stain |
R2523 |
T4233 |
T4222 |
auxpass |
was,used |
R2524 |
T4234 |
T4222 |
prep |
as,used |
R2525 |
T4235 |
T4236 |
det |
a,biomarker |
R2526 |
T4236 |
T4234 |
pobj |
biomarker,as |
R2527 |
T4237 |
T4236 |
prep |
for,biomarker |
R2528 |
T4238 |
T4237 |
pobj |
osteoblasts,for |
R2529 |
T4239 |
T4238 |
cc |
and,osteoblasts |
R2530 |
T4240 |
T4241 |
npadvmod |
tartrate,resistant |
R2531 |
T4241 |
T4243 |
amod |
resistant,activity |
R2532 |
T4242 |
T4241 |
punct |
-,resistant |
R2533 |
T4243 |
T4238 |
conj |
activity,osteoblasts |
R2534 |
T4244 |
T4243 |
nmod |
ALP,activity |
R2535 |
T4245 |
T4246 |
punct |
(,stain |
R2536 |
T4246 |
T4243 |
parataxis |
stain,activity |
R2537 |
T4247 |
T4248 |
npadvmod |
tartrate,resistant |
R2538 |
T4248 |
T4250 |
amod |
resistant,phosphatase |
R2539 |
T4249 |
T4248 |
punct |
-,resistant |
R2540 |
T4250 |
T4246 |
dep |
phosphatase,stain |
R2541 |
T4251 |
T4250 |
compound |
acid,phosphatase |
R2542 |
T4252 |
T4250 |
punct |
[,phosphatase |
R2543 |
T4253 |
T4250 |
appos |
TRAP,phosphatase |
R2544 |
T4254 |
T4246 |
punct |
],stain |
R2545 |
T4255 |
T4246 |
punct |
;,stain |
R2546 |
T4256 |
T4246 |
amod |
red,stain |
R2547 |
T4257 |
T4246 |
punct |
),stain |
R2548 |
T4258 |
T4222 |
prep |
as,used |
R2549 |
T4259 |
T4260 |
det |
a,marker |
R2550 |
T4260 |
T4258 |
pobj |
marker,as |
R2551 |
T4261 |
T4260 |
prep |
for,marker |
R2552 |
T4262 |
T4261 |
pobj |
osteoclasts,for |
R2553 |
T4263 |
T4222 |
punct |
.,used |
R2554 |
T4265 |
T4266 |
amod |
Little,difference |
R2555 |
T4266 |
T4267 |
nsubjpass |
difference,seen |
R2556 |
T4268 |
T4267 |
auxpass |
was,seen |
R2557 |
T4269 |
T4267 |
prep |
between,seen |
R2558 |
T4270 |
T4271 |
nmod |
Sam68,mice |
R2559 |
T4271 |
T4269 |
pobj |
mice,between |
R2560 |
T4272 |
T4270 |
punct |
+,Sam68 |
R2561 |
T4273 |
T4270 |
punct |
/,Sam68 |
R2562 |
T4274 |
T4270 |
punct |
+,Sam68 |
R2563 |
T4275 |
T4276 |
punct |
(,5A |
R2564 |
T4276 |
T4270 |
parataxis |
5A,Sam68 |
R2565 |
T4277 |
T4276 |
compound |
Figure,5A |
R2566 |
T4278 |
T4276 |
cc |
and,5A |
R2567 |
T4279 |
T4276 |
conj |
5B,5A |
R2568 |
T4280 |
T4276 |
punct |
),5A |
R2569 |
T4281 |
T4270 |
cc |
and,Sam68 |
R2570 |
T4282 |
T4270 |
conj |
Sam68,Sam68 |
R2571 |
T4283 |
T4282 |
punct |
−,Sam68 |
R2572 |
T4284 |
T4282 |
punct |
/,Sam68 |
R2573 |
T4285 |
T4282 |
punct |
−,Sam68 |
R2574 |
T4286 |
T4287 |
punct |
(,5C |
R2575 |
T4287 |
T4282 |
parataxis |
5C,Sam68 |
R2576 |
T4288 |
T4287 |
compound |
Figure,5C |
R2577 |
T4289 |
T4287 |
cc |
and,5C |
R2578 |
T4290 |
T4287 |
conj |
5D,5C |
R2579 |
T4291 |
T4287 |
punct |
),5C |
R2580 |
T4292 |
T4267 |
prep |
at,seen |
R2581 |
T4293 |
T4294 |
nummod |
4,months |
R2582 |
T4294 |
T4292 |
pobj |
months,at |
R2583 |
T4295 |
T4294 |
prep |
of,months |
R2584 |
T4296 |
T4295 |
pobj |
age,of |
R2585 |
T4297 |
T4267 |
punct |
.,seen |
R2586 |
T4299 |
T4300 |
npadvmod |
ALP,positive |
R2587 |
T4300 |
T4305 |
amod |
positive,cells |
R2588 |
T4301 |
T4299 |
punct |
-,ALP |
R2589 |
T4302 |
T4299 |
cc |
and,ALP |
R2590 |
T4303 |
T4299 |
conj |
TRAP,ALP |
R2591 |
T4304 |
T4300 |
punct |
-,positive |
R2592 |
T4305 |
T4306 |
nsubjpass |
cells,reduced |
R2593 |
T4307 |
T4306 |
auxpass |
were,reduced |
R2594 |
T4308 |
T4306 |
prep |
in,reduced |
R2595 |
T4309 |
T4310 |
det |
the,mice |
R2596 |
T4310 |
T4308 |
pobj |
mice,in |
R2597 |
T4311 |
T4312 |
nummod |
12,month |
R2598 |
T4312 |
T4314 |
npadvmod |
month,old |
R2599 |
T4313 |
T4312 |
punct |
-,month |
R2600 |
T4314 |
T4310 |
amod |
old,mice |
R2601 |
T4315 |
T4314 |
punct |
-,old |
R2602 |
T4316 |
T4310 |
nmod |
Sam68,mice |
R2603 |
T4317 |
T4316 |
punct |
+,Sam68 |
R2604 |
T4318 |
T4316 |
punct |
/,Sam68 |
R2605 |
T4319 |
T4316 |
punct |
+,Sam68 |
R2606 |
T4320 |
T4321 |
punct |
(,5E |
R2607 |
T4321 |
T4306 |
parataxis |
5E,reduced |
R2608 |
T4322 |
T4321 |
compound |
Figure,5E |
R2609 |
T4323 |
T4321 |
cc |
and,5E |
R2610 |
T4324 |
T4321 |
conj |
5F,5E |
R2611 |
T4325 |
T4321 |
punct |
),5E |
R2612 |
T4326 |
T4306 |
cc |
and,reduced |
R2613 |
T4327 |
T4306 |
conj |
remained,reduced |
R2614 |
T4328 |
T4327 |
acomp |
unchanged,remained |
R2615 |
T4329 |
T4327 |
prep |
in,remained |
R2616 |
T4330 |
T4331 |
nummod |
12,month |
R2617 |
T4331 |
T4333 |
npadvmod |
month,old |
R2618 |
T4332 |
T4331 |
punct |
-,month |
R2619 |
T4333 |
T4335 |
amod |
old,mice |
R2620 |
T4334 |
T4333 |
punct |
-,old |
R2621 |
T4335 |
T4329 |
pobj |
mice,in |
R2622 |
T4336 |
T4335 |
nmod |
Sam68,mice |
R2623 |
T4337 |
T4336 |
punct |
−,Sam68 |
R2624 |
T4338 |
T4336 |
punct |
/,Sam68 |
R2625 |
T4339 |
T4336 |
punct |
−,Sam68 |
R2626 |
T4340 |
T4341 |
punct |
(,5G |
R2627 |
T4341 |
T4327 |
parataxis |
5G,remained |
R2628 |
T4342 |
T4341 |
compound |
Figure,5G |
R2629 |
T4343 |
T4341 |
cc |
and,5G |
R2630 |
T4344 |
T4341 |
conj |
5H,5G |
R2631 |
T4345 |
T4341 |
punct |
),5G |
R2632 |
T4346 |
T4306 |
punct |
.,reduced |
R2633 |
T4348 |
T4349 |
det |
The,reduction |
R2634 |
T4349 |
T4350 |
nsubj |
reduction,argued |
R2635 |
T4351 |
T4349 |
prep |
in,reduction |
R2636 |
T4352 |
T4353 |
preconj |
both,osteoblast |
R2637 |
T4353 |
T4354 |
nmod |
osteoblast,activity |
R2638 |
T4354 |
T4351 |
pobj |
activity,in |
R2639 |
T4355 |
T4353 |
cc |
and,osteoblast |
R2640 |
T4356 |
T4353 |
conj |
osteoclast,osteoblast |
R2641 |
T4357 |
T4349 |
prep |
in,reduction |
R2642 |
T4358 |
T4359 |
det |
the,mice |
R2643 |
T4359 |
T4357 |
pobj |
mice,in |
R2644 |
T4360 |
T4361 |
nummod |
12,month |
R2645 |
T4361 |
T4363 |
npadvmod |
month,old |
R2646 |
T4362 |
T4361 |
punct |
-,month |
R2647 |
T4363 |
T4359 |
amod |
old,mice |
R2648 |
T4364 |
T4363 |
punct |
-,old |
R2649 |
T4365 |
T4359 |
nmod |
Sam68,mice |
R2650 |
T4366 |
T4365 |
punct |
+,Sam68 |
R2651 |
T4367 |
T4365 |
punct |
/,Sam68 |
R2652 |
T4368 |
T4365 |
punct |
+,Sam68 |
R2653 |
T4369 |
T4350 |
prep |
against,argued |
R2654 |
T4370 |
T4371 |
nsubjpass |
bone,lost |
R2655 |
T4371 |
T4369 |
pcomp |
lost,against |
R2656 |
T4372 |
T4371 |
auxpass |
being,lost |
R2657 |
T4373 |
T4374 |
advmod |
primarily,due |
R2658 |
T4374 |
T4371 |
prep |
due,lost |
R2659 |
T4375 |
T4374 |
pcomp |
to,due |
R2660 |
T4376 |
T4377 |
det |
a,increase |
R2661 |
T4377 |
T4374 |
pobj |
increase,due |
R2662 |
T4378 |
T4377 |
amod |
relative,increase |
R2663 |
T4379 |
T4377 |
prep |
in,increase |
R2664 |
T4380 |
T4379 |
pobj |
osteoclast,in |
R2665 |
T4381 |
T4380 |
prep |
over,osteoclast |
R2666 |
T4382 |
T4381 |
pobj |
osteoblast,over |
R2667 |
T4383 |
T4380 |
appos |
activity,osteoclast |
R2668 |
T4384 |
T4371 |
punct |
", ",lost |
R2669 |
T4385 |
T4386 |
mark |
as,seen |
R2670 |
T4386 |
T4371 |
advcl |
seen,lost |
R2671 |
T4387 |
T4386 |
prep |
in,seen |
R2672 |
T4388 |
T4389 |
amod |
high,turnover |
R2673 |
T4389 |
T4390 |
compound |
turnover,disease |
R2674 |
T4390 |
T4387 |
pobj |
disease,in |
R2675 |
T4391 |
T4392 |
punct |
[,49 |
R2676 |
T4392 |
T4350 |
parataxis |
49,argued |
R2677 |
T4393 |
T4392 |
punct |
],49 |
R2678 |
T4394 |
T4350 |
punct |
.,argued |
R2679 |
T4396 |
T4397 |
amod |
Histomorphometric,analyses |
R2680 |
T4397 |
T4398 |
nsubj |
analyses,corroborated |
R2681 |
T4399 |
T4400 |
punct |
[,50 |
R2682 |
T4400 |
T4397 |
parataxis |
50,analyses |
R2683 |
T4401 |
T4400 |
punct |
],50 |
R2684 |
T4402 |
T4397 |
prep |
of,analyses |
R2685 |
T4403 |
T4404 |
det |
the,bones |
R2686 |
T4404 |
T4402 |
pobj |
bones,of |
R2687 |
T4405 |
T4404 |
amod |
long,bones |
R2688 |
T4406 |
T4407 |
punct |
(,Table |
R2689 |
T4407 |
T4397 |
parataxis |
Table,analyses |
R2690 |
T4408 |
T4407 |
nummod |
3,Table |
R2691 |
T4409 |
T4407 |
punct |
),Table |
R2692 |
T4410 |
T4411 |
det |
the,evidence |
R2693 |
T4411 |
T4398 |
dobj |
evidence,corroborated |
R2694 |
T4412 |
T4411 |
amod |
radiologic,evidence |
R2695 |
T4413 |
T4411 |
prep |
of,evidence |
R2696 |
T4414 |
T4415 |
npadvmod |
age,related |
R2697 |
T4415 |
T4417 |
amod |
related,loss |
R2698 |
T4416 |
T4415 |
punct |
-,related |
R2699 |
T4417 |
T4413 |
pobj |
loss,of |
R2700 |
T4418 |
T4417 |
compound |
bone,loss |
R2701 |
T4419 |
T4398 |
punct |
.,corroborated |
R2702 |
T4421 |
T4422 |
compound |
Bone,volume |
R2703 |
T4422 |
T4423 |
nsubjpass |
volume,reduced |
R2704 |
T4424 |
T4422 |
punct |
(,volume |
R2705 |
T4425 |
T4426 |
compound |
BV,TV |
R2706 |
T4426 |
T4422 |
appos |
TV,volume |
R2707 |
T4427 |
T4426 |
punct |
/,TV |
R2708 |
T4428 |
T4422 |
punct |
),volume |
R2709 |
T4429 |
T4422 |
punct |
", ",volume |
R2710 |
T4430 |
T4431 |
advmod |
newly,formed |
R2711 |
T4431 |
T4432 |
amod |
formed,osteoid |
R2712 |
T4432 |
T4422 |
conj |
osteoid,volume |
R2713 |
T4433 |
T4432 |
punct |
(,osteoid |
R2714 |
T4434 |
T4435 |
compound |
OV,TV |
R2715 |
T4435 |
T4432 |
appos |
TV,osteoid |
R2716 |
T4436 |
T4435 |
punct |
/,TV |
R2717 |
T4437 |
T4432 |
punct |
),osteoid |
R2718 |
T4438 |
T4432 |
punct |
", ",osteoid |
R2719 |
T4439 |
T4432 |
cc |
and,osteoid |
R2720 |
T4440 |
T4441 |
compound |
mineral,rate |
R2721 |
T4441 |
T4432 |
conj |
rate,osteoid |
R2722 |
T4442 |
T4441 |
compound |
apposition,rate |
R2723 |
T4443 |
T4441 |
punct |
(,rate |
R2724 |
T4444 |
T4441 |
appos |
MAR,rate |
R2725 |
T4445 |
T4423 |
punct |
),reduced |
R2726 |
T4446 |
T4423 |
auxpass |
were,reduced |
R2727 |
T4447 |
T4423 |
dep |
all,reduced |
R2728 |
T4448 |
T4423 |
advmod |
significantly,reduced |
R2729 |
T4449 |
T4423 |
prep |
in,reduced |
R2730 |
T4450 |
T4451 |
nummod |
12,month |
R2731 |
T4451 |
T4453 |
npadvmod |
month,old |
R2732 |
T4452 |
T4451 |
punct |
-,month |
R2733 |
T4453 |
T4455 |
amod |
old,mice |
R2734 |
T4454 |
T4453 |
punct |
-,old |
R2735 |
T4455 |
T4449 |
pobj |
mice,in |
R2736 |
T4456 |
T4455 |
nmod |
Sam68,mice |
R2737 |
T4457 |
T4456 |
punct |
+,Sam68 |
R2738 |
T4458 |
T4456 |
punct |
/,Sam68 |
R2739 |
T4459 |
T4456 |
punct |
+,Sam68 |
R2740 |
T4460 |
T4423 |
prep |
compared,reduced |
R2741 |
T4461 |
T4460 |
prep |
with,compared |
R2742 |
T4462 |
T4463 |
nummod |
4,month |
R2743 |
T4463 |
T4465 |
npadvmod |
month,old |
R2744 |
T4464 |
T4463 |
punct |
-,month |
R2745 |
T4465 |
T4467 |
amod |
old,mice |
R2746 |
T4466 |
T4465 |
punct |
-,old |
R2747 |
T4467 |
T4461 |
pobj |
mice,with |
R2748 |
T4468 |
T4467 |
nmod |
Sam68,mice |
R2749 |
T4469 |
T4468 |
punct |
+,Sam68 |
R2750 |
T4470 |
T4468 |
punct |
/,Sam68 |
R2751 |
T4471 |
T4468 |
punct |
+,Sam68 |
R2752 |
T4472 |
T4423 |
punct |
.,reduced |
R2753 |
T4474 |
T4475 |
det |
These,reductions |
R2754 |
T4475 |
T4476 |
nsubjpass |
reductions,associated |
R2755 |
T4477 |
T4476 |
auxpass |
were,associated |
R2756 |
T4478 |
T4476 |
prep |
with,associated |
R2757 |
T4479 |
T4480 |
det |
a,increase |
R2758 |
T4480 |
T4478 |
pobj |
increase,with |
R2759 |
T4481 |
T4480 |
amod |
significant,increase |
R2760 |
T4482 |
T4480 |
prep |
in,increase |
R2761 |
T4483 |
T4484 |
compound |
marrow,fat |
R2762 |
T4484 |
T4482 |
pobj |
fat,in |
R2763 |
T4485 |
T4486 |
punct |
(,TV |
R2764 |
T4486 |
T4480 |
parataxis |
TV,increase |
R2765 |
T4487 |
T4486 |
compound |
FV,TV |
R2766 |
T4488 |
T4486 |
punct |
/,TV |
R2767 |
T4489 |
T4486 |
punct |
),TV |
R2768 |
T4490 |
T4480 |
cc |
and,increase |
R2769 |
T4491 |
T4492 |
amod |
decreased,numbers |
R2770 |
T4492 |
T4480 |
conj |
numbers,increase |
R2771 |
T4493 |
T4492 |
prep |
of,numbers |
R2772 |
T4494 |
T4493 |
pobj |
osteoblasts,of |
R2773 |
T4495 |
T4496 |
punct |
(,TV |
R2774 |
T4496 |
T4494 |
parataxis |
TV,osteoblasts |
R2775 |
T4497 |
T4496 |
compound |
nOB,TV |
R2776 |
T4498 |
T4496 |
punct |
/,TV |
R2777 |
T4499 |
T4496 |
punct |
),TV |
R2778 |
T4500 |
T4494 |
cc |
and,osteoblasts |
R2779 |
T4501 |
T4494 |
conj |
osteoclasts,osteoblasts |
R2780 |
T4502 |
T4503 |
punct |
(,TV |
R2781 |
T4503 |
T4501 |
parataxis |
TV,osteoclasts |
R2782 |
T4504 |
T4503 |
compound |
nOC,TV |
R2783 |
T4505 |
T4503 |
punct |
/,TV |
R2784 |
T4506 |
T4503 |
punct |
),TV |
R2785 |
T4507 |
T4492 |
prep |
per,numbers |
R2786 |
T4508 |
T4509 |
compound |
tissue,volume |
R2787 |
T4509 |
T4507 |
pobj |
volume,per |
R2788 |
T4510 |
T4511 |
punct |
(,Table |
R2789 |
T4511 |
T4476 |
parataxis |
Table,associated |
R2790 |
T4512 |
T4511 |
nummod |
3,Table |
R2791 |
T4513 |
T4511 |
punct |
),Table |
R2792 |
T4514 |
T4476 |
punct |
.,associated |
R2793 |
T4516 |
T4517 |
det |
These,results |
R2794 |
T4517 |
T4518 |
nsubj |
results,were |
R2795 |
T4519 |
T4518 |
prep |
in,were |
R2796 |
T4520 |
T4519 |
pobj |
contrast,in |
R2797 |
T4521 |
T4520 |
prep |
to,contrast |
R2798 |
T4522 |
T4521 |
pobj |
those,to |
R2799 |
T4523 |
T4522 |
prep |
of,those |
R2800 |
T4524 |
T4525 |
det |
the,mice |
R2801 |
T4525 |
T4523 |
pobj |
mice,of |
R2802 |
T4526 |
T4527 |
nummod |
12,month |
R2803 |
T4527 |
T4529 |
npadvmod |
month,old |
R2804 |
T4528 |
T4527 |
punct |
-,month |
R2805 |
T4529 |
T4525 |
amod |
old,mice |
R2806 |
T4530 |
T4529 |
punct |
-,old |
R2807 |
T4531 |
T4525 |
nmod |
Sam68,mice |
R2808 |
T4532 |
T4531 |
punct |
−,Sam68 |
R2809 |
T4533 |
T4531 |
punct |
/,Sam68 |
R2810 |
T4534 |
T4531 |
punct |
−,Sam68 |
R2811 |
T4535 |
T4536 |
prep |
in,resembled |
R2812 |
T4536 |
T4522 |
relcl |
resembled,those |
R2813 |
T4537 |
T4535 |
pobj |
which,in |
R2814 |
T4538 |
T4539 |
det |
all,parameters |
R2815 |
T4539 |
T4536 |
nsubj |
parameters,resembled |
R2816 |
T4540 |
T4539 |
amod |
histomorphometric,parameters |
R2817 |
T4541 |
T4539 |
punct |
", ",parameters |
R2818 |
T4542 |
T4539 |
prep |
including,parameters |
R2819 |
T4543 |
T4544 |
compound |
marrow,fat |
R2820 |
T4544 |
T4542 |
pobj |
fat,including |
R2821 |
T4545 |
T4536 |
punct |
", ",resembled |
R2822 |
T4546 |
T4536 |
dobj |
those,resembled |
R2823 |
T4547 |
T4546 |
prep |
of,those |
R2824 |
T4548 |
T4549 |
amod |
young,mice |
R2825 |
T4549 |
T4547 |
pobj |
mice,of |
R2826 |
T4550 |
T4549 |
prep |
of,mice |
R2827 |
T4551 |
T4552 |
preconj |
either,genotype |
R2828 |
T4552 |
T4550 |
pobj |
genotype,of |
R2829 |
T4553 |
T4554 |
punct |
(,Table |
R2830 |
T4554 |
T4536 |
parataxis |
Table,resembled |
R2831 |
T4555 |
T4554 |
nummod |
3,Table |
R2832 |
T4556 |
T4554 |
punct |
),Table |
R2833 |
T4557 |
T4518 |
punct |
.,were |
R2834 |
T4559 |
T4560 |
advmod |
When,expressed |
R2835 |
T4560 |
T4563 |
advcl |
expressed,were |
R2836 |
T4561 |
T4560 |
nsubjpass |
cells,expressed |
R2837 |
T4562 |
T4560 |
auxpass |
were,expressed |
R2838 |
T4564 |
T4560 |
prep |
as,expressed |
R2839 |
T4565 |
T4566 |
det |
a,function |
R2840 |
T4566 |
T4564 |
pobj |
function,as |
R2841 |
T4567 |
T4566 |
prep |
of,function |
R2842 |
T4568 |
T4569 |
det |
the,perimeter |
R2843 |
T4569 |
T4567 |
pobj |
perimeter,of |
R2844 |
T4570 |
T4569 |
compound |
bone,perimeter |
R2845 |
T4571 |
T4572 |
punct |
(,BP |
R2846 |
T4572 |
T4560 |
parataxis |
BP,expressed |
R2847 |
T4573 |
T4572 |
compound |
nOB,BP |
R2848 |
T4574 |
T4572 |
punct |
/,BP |
R2849 |
T4575 |
T4572 |
punct |
", ",BP |
R2850 |
T4576 |
T4577 |
compound |
nOC,BP |
R2851 |
T4577 |
T4572 |
appos |
BP,BP |
R2852 |
T4578 |
T4577 |
punct |
/,BP |
R2853 |
T4579 |
T4572 |
punct |
),BP |
R2854 |
T4580 |
T4563 |
punct |
", ",were |
R2855 |
T4581 |
T4563 |
expl |
there,were |
R2856 |
T4582 |
T4583 |
det |
no,differences |
R2857 |
T4583 |
T4563 |
attr |
differences,were |
R2858 |
T4584 |
T4583 |
amod |
statistical,differences |
R2859 |
T4585 |
T4563 |
cc |
and,were |
R2860 |
T4586 |
T4587 |
det |
the,ratio |
R2861 |
T4587 |
T4588 |
nsubj |
ratio,was |
R2862 |
T4588 |
T4563 |
conj |
was,were |
R2863 |
T4589 |
T4587 |
prep |
of,ratio |
R2864 |
T4590 |
T4589 |
pobj |
osteoblasts,of |
R2865 |
T4591 |
T4590 |
prep |
to,osteoblasts |
R2866 |
T4592 |
T4591 |
pobj |
osteoclasts,to |
R2867 |
T4593 |
T4588 |
acomp |
similar,was |
R2868 |
T4594 |
T4588 |
prep |
in,was |
R2869 |
T4595 |
T4596 |
det |
all,groups |
R2870 |
T4596 |
T4594 |
pobj |
groups,in |
R2871 |
T4597 |
T4596 |
prep |
of,groups |
R2872 |
T4598 |
T4597 |
pobj |
mice,of |
R2873 |
T4599 |
T4600 |
punct |
(,Table |
R2874 |
T4600 |
T4588 |
parataxis |
Table,was |
R2875 |
T4601 |
T4600 |
nummod |
3,Table |
R2876 |
T4602 |
T4600 |
punct |
),Table |
R2877 |
T4603 |
T4563 |
punct |
.,were |
R2878 |
T4605 |
T4606 |
amod |
Circulating,levels |
R2879 |
T4606 |
T4607 |
nsubj |
levels,showed |
R2880 |
T4608 |
T4606 |
prep |
of,levels |
R2881 |
T4609 |
T4610 |
compound |
serum,telopeptide |
R2882 |
T4610 |
T4608 |
pobj |
telopeptide,of |
R2883 |
T4611 |
T4610 |
compound |
C,telopeptide |
R2884 |
T4612 |
T4610 |
punct |
-,telopeptide |
R2885 |
T4613 |
T4614 |
punct |
(,Diagnostics |
R2886 |
T4614 |
T4610 |
parataxis |
Diagnostics,telopeptide |
R2887 |
T4615 |
T4614 |
dep |
sCTX,Diagnostics |
R2888 |
T4616 |
T4614 |
punct |
;,Diagnostics |
R2889 |
T4617 |
T4614 |
compound |
Roche,Diagnostics |
R2890 |
T4618 |
T4614 |
punct |
", ",Diagnostics |
R2891 |
T4619 |
T4614 |
npadvmod |
Mannheim,Diagnostics |
R2892 |
T4620 |
T4614 |
punct |
", ",Diagnostics |
R2893 |
T4621 |
T4614 |
npadvmod |
Germany,Diagnostics |
R2894 |
T4622 |
T4614 |
punct |
),Diagnostics |
R2895 |
T4623 |
T4610 |
cc |
and,telopeptide |
R2896 |
T4624 |
T4610 |
conj |
ALP,telopeptide |
R2897 |
T4625 |
T4626 |
amod |
little,difference |
R2898 |
T4626 |
T4607 |
dobj |
difference,showed |
R2899 |
T4627 |
T4607 |
prep |
among,showed |
R2900 |
T4628 |
T4629 |
det |
the,groups |
R2901 |
T4629 |
T4627 |
pobj |
groups,among |
R2902 |
T4630 |
T4607 |
punct |
", ",showed |
R2903 |
T4631 |
T4607 |
prep |
except,showed |
R2904 |
T4632 |
T4631 |
prep |
for,except |
R2905 |
T4633 |
T4634 |
det |
a,decrease |
R2906 |
T4634 |
T4632 |
pobj |
decrease,for |
R2907 |
T4635 |
T4634 |
amod |
small,decrease |
R2908 |
T4636 |
T4634 |
prep |
in,decrease |
R2909 |
T4637 |
T4638 |
nummod |
12,month |
R2910 |
T4638 |
T4640 |
npadvmod |
month,old |
R2911 |
T4639 |
T4638 |
punct |
-,month |
R2912 |
T4640 |
T4642 |
amod |
old,mice |
R2913 |
T4641 |
T4640 |
punct |
-,old |
R2914 |
T4642 |
T4636 |
pobj |
mice,in |
R2915 |
T4643 |
T4642 |
nmod |
Sam68,mice |
R2916 |
T4644 |
T4643 |
punct |
−,Sam68 |
R2917 |
T4645 |
T4643 |
punct |
/,Sam68 |
R2918 |
T4646 |
T4643 |
punct |
−,Sam68 |
R2919 |
T4647 |
T4642 |
cc |
and,mice |
R2920 |
T4648 |
T4649 |
punct |
(,S3 |
R2921 |
T4649 |
T4642 |
conj |
S3,mice |
R2922 |
T4650 |
T4649 |
compound |
Dataset,S3 |
R2923 |
T4651 |
T4607 |
punct |
),showed |
R2924 |
T4652 |
T4607 |
punct |
.,showed |
R2925 |
T4654 |
T4655 |
compound |
Serum,estrogen |
R2926 |
T4655 |
T4656 |
nsubjpass |
estrogen,decreased |
R2927 |
T4657 |
T4656 |
auxpass |
was,decreased |
R2928 |
T4658 |
T4656 |
advmod |
significantly,decreased |
R2929 |
T4659 |
T4656 |
prep |
in,decreased |
R2930 |
T4660 |
T4661 |
det |
all,mice |
R2931 |
T4661 |
T4659 |
pobj |
mice,in |
R2932 |
T4662 |
T4663 |
nummod |
12,month |
R2933 |
T4663 |
T4665 |
npadvmod |
month,old |
R2934 |
T4664 |
T4663 |
punct |
-,month |
R2935 |
T4665 |
T4661 |
amod |
old,mice |
R2936 |
T4666 |
T4665 |
punct |
-,old |
R2937 |
T4667 |
T4656 |
advmod |
regardless,decreased |
R2938 |
T4668 |
T4667 |
prep |
of,regardless |
R2939 |
T4669 |
T4668 |
pobj |
genotype,of |
R2940 |
T4670 |
T4656 |
prep |
with,decreased |
R2941 |
T4671 |
T4672 |
det |
a,increase |
R2942 |
T4672 |
T4670 |
pobj |
increase,with |
R2943 |
T4673 |
T4672 |
amod |
reciprocal,increase |
R2944 |
T4674 |
T4672 |
prep |
in,increase |
R2945 |
T4675 |
T4676 |
nmod |
interleukin,levels |
R2946 |
T4676 |
T4674 |
pobj |
levels,in |
R2947 |
T4677 |
T4675 |
punct |
-,interleukin |
R2948 |
T4678 |
T4675 |
nummod |
6,interleukin |
R2949 |
T4679 |
T4680 |
punct |
(,S3 |
R2950 |
T4680 |
T4656 |
parataxis |
S3,decreased |
R2951 |
T4681 |
T4680 |
compound |
Dataset,S3 |
R2952 |
T4682 |
T4680 |
punct |
),S3 |
R2953 |
T4683 |
T4656 |
punct |
.,decreased |
R2954 |
T4685 |
T4686 |
prep |
Given,measured |
R2955 |
T4687 |
T4688 |
det |
the,involvement |
R2956 |
T4688 |
T4685 |
pobj |
involvement,Given |
R2957 |
T4689 |
T4688 |
prep |
of,involvement |
R2958 |
T4690 |
T4689 |
pobj |
leptin,of |
R2959 |
T4691 |
T4688 |
prep |
in,involvement |
R2960 |
T4692 |
T4691 |
pcomp |
regulating,in |
R2961 |
T4693 |
T4694 |
nmod |
body,mass |
R2962 |
T4694 |
T4692 |
dobj |
mass,regulating |
R2963 |
T4695 |
T4693 |
cc |
and,body |
R2964 |
T4696 |
T4693 |
conj |
bone,body |
R2965 |
T4697 |
T4686 |
punct |
", ",measured |
R2966 |
T4698 |
T4699 |
compound |
serum,leptin |
R2967 |
T4699 |
T4686 |
nsubjpass |
leptin,measured |
R2968 |
T4700 |
T4686 |
auxpass |
was,measured |
R2969 |
T4701 |
T4686 |
prep |
in,measured |
R2970 |
T4702 |
T4703 |
nmod |
Sam68,mice |
R2971 |
T4703 |
T4701 |
pobj |
mice,in |
R2972 |
T4704 |
T4702 |
punct |
+,Sam68 |
R2973 |
T4705 |
T4702 |
punct |
/,Sam68 |
R2974 |
T4706 |
T4702 |
punct |
+,Sam68 |
R2975 |
T4707 |
T4702 |
cc |
and,Sam68 |
R2976 |
T4708 |
T4702 |
conj |
Sam68,Sam68 |
R2977 |
T4709 |
T4708 |
punct |
−,Sam68 |
R2978 |
T4710 |
T4708 |
punct |
/,Sam68 |
R2979 |
T4711 |
T4708 |
punct |
−,Sam68 |
R2980 |
T4712 |
T4686 |
punct |
.,measured |
R2981 |
T4714 |
T4715 |
nummod |
Twelve,month |
R2982 |
T4715 |
T4717 |
npadvmod |
month,old |
R2983 |
T4716 |
T4715 |
punct |
-,month |
R2984 |
T4717 |
T4719 |
amod |
old,mice |
R2985 |
T4718 |
T4717 |
punct |
-,old |
R2986 |
T4719 |
T4724 |
nsubj |
mice,had |
R2987 |
T4720 |
T4719 |
nmod |
Sam68,mice |
R2988 |
T4721 |
T4720 |
punct |
−,Sam68 |
R2989 |
T4722 |
T4720 |
punct |
/,Sam68 |
R2990 |
T4723 |
T4720 |
punct |
−,Sam68 |
R2991 |
T4725 |
T4726 |
advmod |
significantly,lower |
R2992 |
T4726 |
T4727 |
amod |
lower,levels |
R2993 |
T4727 |
T4724 |
dobj |
levels,had |
R2994 |
T4728 |
T4727 |
prep |
than,levels |
R2995 |
T4729 |
T4730 |
amod |
young,mice |
R2996 |
T4730 |
T4728 |
pobj |
mice,than |
R2997 |
T4731 |
T4729 |
cc |
and,young |
R2998 |
T4732 |
T4729 |
conj |
old,young |
R2999 |
T4733 |
T4730 |
nmod |
Sam68,mice |
R3000 |
T4734 |
T4733 |
punct |
+,Sam68 |
R3001 |
T4735 |
T4733 |
punct |
/,Sam68 |
R3002 |
T4736 |
T4733 |
punct |
+,Sam68 |
R3003 |
T4737 |
T4730 |
cc |
and,mice |
R3004 |
T4738 |
T4739 |
amod |
young,mice |
R3005 |
T4739 |
T4730 |
conj |
mice,mice |
R3006 |
T4740 |
T4739 |
nmod |
Sam68,mice |
R3007 |
T4741 |
T4740 |
punct |
−,Sam68 |
R3008 |
T4742 |
T4740 |
punct |
/,Sam68 |
R3009 |
T4743 |
T4740 |
punct |
−,Sam68 |
R3010 |
T4744 |
T4745 |
punct |
(,S3 |
R3011 |
T4745 |
T4724 |
parataxis |
S3,had |
R3012 |
T4746 |
T4745 |
compound |
Dataset,S3 |
R3013 |
T4747 |
T4745 |
punct |
),S3 |
R3014 |
T4748 |
T4724 |
punct |
.,had |
R3015 |
T4750 |
T4751 |
advcl |
Taken,suggested |
R3016 |
T4752 |
T4750 |
advmod |
together,Taken |
R3017 |
T4753 |
T4751 |
punct |
", ",suggested |
R3018 |
T4754 |
T4755 |
det |
these,observations |
R3019 |
T4755 |
T4751 |
nsubj |
observations,suggested |
R3020 |
T4756 |
T4757 |
mark |
that,was |
R3021 |
T4757 |
T4751 |
ccomp |
was,suggested |
R3022 |
T4758 |
T4757 |
nsubj |
preservation,was |
R3023 |
T4759 |
T4758 |
prep |
of,preservation |
R3024 |
T4760 |
T4761 |
compound |
bone,mass |
R3025 |
T4761 |
T4759 |
pobj |
mass,of |
R3026 |
T4762 |
T4758 |
prep |
in,preservation |
R3027 |
T4763 |
T4764 |
det |
the,mice |
R3028 |
T4764 |
T4762 |
pobj |
mice,in |
R3029 |
T4765 |
T4764 |
nmod |
Sam68,mice |
R3030 |
T4766 |
T4765 |
punct |
−,Sam68 |
R3031 |
T4767 |
T4765 |
punct |
/,Sam68 |
R3032 |
T4768 |
T4765 |
punct |
−,Sam68 |
R3033 |
T4769 |
T4757 |
neg |
not,was |
R3034 |
T4770 |
T4757 |
prep |
due,was |
R3035 |
T4771 |
T4770 |
advmod |
primarily,due |
R3036 |
T4772 |
T4770 |
pcomp |
to,due |
R3037 |
T4773 |
T4774 |
amod |
altered,status |
R3038 |
T4774 |
T4770 |
pobj |
status,due |
R3039 |
T4775 |
T4774 |
compound |
estrogen,status |
R3040 |
T4776 |
T4757 |
cc |
but,was |
R3041 |
T4777 |
T4778 |
aux |
could,influenced |
R3042 |
T4778 |
T4757 |
conj |
influenced,was |
R3043 |
T4779 |
T4778 |
aux |
have,influenced |
R3044 |
T4780 |
T4778 |
auxpass |
been,influenced |
R3045 |
T4781 |
T4778 |
agent |
by,influenced |
R3046 |
T4782 |
T4781 |
pobj |
differences,by |
R3047 |
T4783 |
T4782 |
prep |
in,differences |
R3048 |
T4784 |
T4785 |
amod |
circulating,levels |
R3049 |
T4785 |
T4783 |
pobj |
levels,in |
R3050 |
T4786 |
T4785 |
compound |
leptin,levels |
R3051 |
T4787 |
T4751 |
punct |
.,suggested |
R3052 |
T4956 |
T4957 |
nmod |
Osteoblast,Activity |
R3053 |
T4957 |
T4963 |
nsubjpass |
Activity,Altered |
R3054 |
T4958 |
T4956 |
punct |
", ",Osteoblast |
R3055 |
T4959 |
T4956 |
cc |
but,Osteoblast |
R3056 |
T4960 |
T4959 |
neg |
Not,but |
R3057 |
T4961 |
T4956 |
conj |
Osteoclast,Osteoblast |
R3058 |
T4962 |
T4957 |
punct |
", ",Activity |
R3059 |
T4964 |
T4963 |
auxpass |
Is,Altered |
R3060 |
T4965 |
T4963 |
prep |
in,Altered |
R3061 |
T4966 |
T4967 |
nmod |
Sam68,Mice |
R3062 |
T4967 |
T4965 |
pobj |
Mice,in |
R3063 |
T4968 |
T4966 |
punct |
−,Sam68 |
R3064 |
T4969 |
T4966 |
punct |
/,Sam68 |
R3065 |
T4970 |
T4966 |
punct |
−,Sam68 |
R3066 |
T4971 |
T4972 |
advmod |
Ex,Vivo |
R3067 |
T4972 |
T4963 |
advmod |
Vivo,Altered |
R3068 |
T4974 |
T4975 |
nsubj |
Maintenance,is |
R3069 |
T4976 |
T4974 |
prep |
of,Maintenance |
R3070 |
T4977 |
T4978 |
compound |
bone,mass |
R3071 |
T4978 |
T4976 |
pobj |
mass,of |
R3072 |
T4979 |
T4974 |
prep |
during,Maintenance |
R3073 |
T4980 |
T4981 |
det |
the,cycle |
R3074 |
T4981 |
T4979 |
pobj |
cycle,during |
R3075 |
T4982 |
T4981 |
amod |
adult,cycle |
R3076 |
T4983 |
T4981 |
compound |
remodeling,cycle |
R3077 |
T4984 |
T4975 |
acomp |
dependent,is |
R3078 |
T4985 |
T4984 |
prep |
on,dependent |
R3079 |
T4986 |
T4987 |
det |
the,coupling |
R3080 |
T4987 |
T4985 |
pobj |
coupling,on |
R3081 |
T4988 |
T4987 |
prep |
of,coupling |
R3082 |
T4989 |
T4988 |
pobj |
osteoblast,of |
R3083 |
T4990 |
T4987 |
prep |
to,coupling |
R3084 |
T4991 |
T4990 |
pobj |
osteoclast,to |
R3085 |
T4992 |
T4987 |
appos |
activity,coupling |
R3086 |
T4993 |
T4975 |
punct |
", ",is |
R3087 |
T4994 |
T4995 |
amod |
such,is |
R3088 |
T4995 |
T4975 |
advcl |
is,is |
R3089 |
T4996 |
T4995 |
mark |
that,is |
R3090 |
T4997 |
T4995 |
expl |
there,is |
R3091 |
T4998 |
T4999 |
det |
no,gain |
R3092 |
T4999 |
T4995 |
attr |
gain,is |
R3093 |
T5000 |
T4999 |
amod |
net,gain |
R3094 |
T5001 |
T4999 |
cc |
or,gain |
R3095 |
T5002 |
T4999 |
conj |
loss,gain |
R3096 |
T5003 |
T4999 |
prep |
of,gain |
R3097 |
T5004 |
T5003 |
pobj |
bone,of |
R3098 |
T5005 |
T5006 |
punct |
[,49 |
R3099 |
T5006 |
T4975 |
parataxis |
49,is |
R3100 |
T5007 |
T5006 |
punct |
],49 |
R3101 |
T5008 |
T4975 |
punct |
.,is |
R3102 |
T5010 |
T5011 |
aux |
To,explore |
R3103 |
T5011 |
T5013 |
advcl |
explore,examined |
R3104 |
T5012 |
T5011 |
advmod |
further,explore |
R3105 |
T5014 |
T5015 |
det |
the,advantage |
R3106 |
T5015 |
T5011 |
dobj |
advantage,explore |
R3107 |
T5016 |
T5017 |
npadvmod |
age,related |
R3108 |
T5017 |
T5015 |
amod |
related,advantage |
R3109 |
T5018 |
T5017 |
punct |
-,related |
R3110 |
T5019 |
T5015 |
prep |
of,advantage |
R3111 |
T5020 |
T5021 |
nmod |
Sam68,mice |
R3112 |
T5021 |
T5019 |
pobj |
mice,of |
R3113 |
T5022 |
T5020 |
punct |
−,Sam68 |
R3114 |
T5023 |
T5020 |
punct |
/,Sam68 |
R3115 |
T5024 |
T5020 |
punct |
−,Sam68 |
R3116 |
T5025 |
T5011 |
prep |
with,explore |
R3117 |
T5026 |
T5025 |
pobj |
respect,with |
R3118 |
T5027 |
T5026 |
prep |
to,respect |
R3119 |
T5028 |
T5029 |
compound |
bone,preservation |
R3120 |
T5029 |
T5027 |
pobj |
preservation,to |
R3121 |
T5030 |
T5013 |
punct |
", ",examined |
R3122 |
T5031 |
T5013 |
nsubj |
we,examined |
R3123 |
T5032 |
T5033 |
det |
the,activity |
R3124 |
T5033 |
T5013 |
dobj |
activity,examined |
R3125 |
T5034 |
T5033 |
amod |
functional,activity |
R3126 |
T5035 |
T5033 |
prep |
of,activity |
R3127 |
T5036 |
T5035 |
pobj |
Sam68,of |
R3128 |
T5037 |
T5036 |
punct |
−,Sam68 |
R3129 |
T5038 |
T5036 |
punct |
/,Sam68 |
R3130 |
T5039 |
T5036 |
punct |
−,Sam68 |
R3131 |
T5040 |
T5036 |
appos |
osteoblasts,Sam68 |
R3132 |
T5041 |
T5040 |
cc |
and,osteoblasts |
R3133 |
T5042 |
T5040 |
conj |
osteoclasts,osteoblasts |
R3134 |
T5043 |
T5044 |
advmod |
ex,vivo |
R3135 |
T5044 |
T5013 |
advmod |
vivo,examined |
R3136 |
T5045 |
T5046 |
punct |
(,6A |
R3137 |
T5046 |
T5013 |
parataxis |
6A,examined |
R3138 |
T5047 |
T5046 |
compound |
Figure,6A |
R3139 |
T5048 |
T5046 |
cc |
and,6A |
R3140 |
T5049 |
T5046 |
conj |
6B,6A |
R3141 |
T5050 |
T5046 |
punct |
),6A |
R3142 |
T5051 |
T5013 |
punct |
.,examined |
R3143 |
T5053 |
T5054 |
nsubj |
Cultures,demonstrated |
R3144 |
T5055 |
T5053 |
prep |
of,Cultures |
R3145 |
T5056 |
T5057 |
nmod |
bone,marrow |
R3146 |
T5057 |
T5058 |
nmod |
marrow,cells |
R3147 |
T5058 |
T5055 |
pobj |
cells,of |
R3148 |
T5059 |
T5058 |
amod |
stromal,cells |
R3149 |
T5060 |
T5053 |
acl |
harvested,Cultures |
R3150 |
T5061 |
T5060 |
prep |
from,harvested |
R3151 |
T5062 |
T5063 |
nummod |
4,week |
R3152 |
T5063 |
T5065 |
npadvmod |
week,old |
R3153 |
T5064 |
T5063 |
punct |
-,week |
R3154 |
T5065 |
T5067 |
amod |
old,mice |
R3155 |
T5066 |
T5065 |
punct |
-,old |
R3156 |
T5067 |
T5061 |
pobj |
mice,from |
R3157 |
T5068 |
T5067 |
nmod |
Sam68,mice |
R3158 |
T5069 |
T5068 |
punct |
−,Sam68 |
R3159 |
T5070 |
T5068 |
punct |
/,Sam68 |
R3160 |
T5071 |
T5068 |
punct |
−,Sam68 |
R3161 |
T5072 |
T5060 |
cc |
and,harvested |
R3162 |
T5073 |
T5060 |
conj |
maintained,harvested |
R3163 |
T5074 |
T5073 |
prep |
for,maintained |
R3164 |
T5075 |
T5076 |
nummod |
18,days |
R3165 |
T5076 |
T5074 |
pobj |
days,for |
R3166 |
T5077 |
T5073 |
prep |
in,maintained |
R3167 |
T5078 |
T5079 |
compound |
osteoblast,differentiation |
R3168 |
T5079 |
T5080 |
compound |
differentiation,medium |
R3169 |
T5080 |
T5077 |
pobj |
medium,in |
R3170 |
T5081 |
T5082 |
advmod |
more,intense |
R3171 |
T5082 |
T5083 |
amod |
intense,staining |
R3172 |
T5083 |
T5054 |
dobj |
staining,demonstrated |
R3173 |
T5084 |
T5083 |
prep |
for,staining |
R3174 |
T5085 |
T5084 |
pobj |
ALP,for |
R3175 |
T5086 |
T5054 |
prep |
at,demonstrated |
R3176 |
T5087 |
T5088 |
nummod |
6,days |
R3177 |
T5088 |
T5086 |
pobj |
days,at |
R3178 |
T5089 |
T5090 |
punct |
(,data |
R3179 |
T5090 |
T5088 |
meta |
data,days |
R3180 |
T5091 |
T5090 |
amod |
unpublished,data |
R3181 |
T5092 |
T5090 |
punct |
),data |
R3182 |
T5093 |
T5088 |
cc |
and,days |
R3183 |
T5094 |
T5095 |
nummod |
18,days |
R3184 |
T5095 |
T5088 |
conj |
days,days |
R3185 |
T5096 |
T5097 |
punct |
(,6A |
R3186 |
T5097 |
T5095 |
parataxis |
6A,days |
R3187 |
T5098 |
T5097 |
compound |
Figure,6A |
R3188 |
T5099 |
T5097 |
dep |
),6A |
R3189 |
T5100 |
T5054 |
dep |
", ",demonstrated |
R3190 |
T5101 |
T5054 |
cc |
and,demonstrated |
R3191 |
T5102 |
T5103 |
amod |
more,nodules |
R3192 |
T5103 |
T5054 |
conj |
nodules,demonstrated |
R3193 |
T5104 |
T5103 |
amod |
mineralized,nodules |
R3194 |
T5105 |
T5103 |
prep |
at,nodules |
R3195 |
T5106 |
T5107 |
nummod |
18,days |
R3196 |
T5107 |
T5105 |
pobj |
days,at |
R3197 |
T5108 |
T5054 |
dep |
", ",demonstrated |
R3198 |
T5109 |
T5054 |
prep |
than,demonstrated |
R3199 |
T5110 |
T5111 |
det |
the,mice |
R3200 |
T5111 |
T5109 |
pobj |
mice,than |
R3201 |
T5112 |
T5111 |
nmod |
Sam68,mice |
R3202 |
T5113 |
T5112 |
punct |
+,Sam68 |
R3203 |
T5114 |
T5112 |
punct |
/,Sam68 |
R3204 |
T5115 |
T5112 |
punct |
+,Sam68 |
R3205 |
T5116 |
T5054 |
dep |
", ",demonstrated |
R3206 |
T5117 |
T5118 |
advmod |
even,observed |
R3207 |
T5118 |
T5054 |
advcl |
observed,demonstrated |
R3208 |
T5119 |
T5118 |
mark |
though,observed |
R3209 |
T5120 |
T5121 |
amod |
similar,amounts |
R3210 |
T5121 |
T5118 |
nsubjpass |
amounts,observed |
R3211 |
T5122 |
T5121 |
prep |
of,amounts |
R3212 |
T5123 |
T5124 |
nmod |
fibroblast,units |
R3213 |
T5124 |
T5122 |
pobj |
units,of |
R3214 |
T5125 |
T5126 |
npadvmod |
colony,forming |
R3215 |
T5126 |
T5124 |
amod |
forming,units |
R3216 |
T5127 |
T5126 |
punct |
-,forming |
R3217 |
T5128 |
T5124 |
punct |
(,units |
R3218 |
T5129 |
T5130 |
compound |
CFU,F |
R3219 |
T5130 |
T5124 |
appos |
F,units |
R3220 |
T5131 |
T5130 |
punct |
-,F |
R3221 |
T5132 |
T5118 |
punct |
),observed |
R3222 |
T5133 |
T5118 |
auxpass |
were,observed |
R3223 |
T5134 |
T5135 |
punct |
(,6A |
R3224 |
T5135 |
T5118 |
parataxis |
6A,observed |
R3225 |
T5136 |
T5135 |
compound |
Figure,6A |
R3226 |
T5137 |
T5135 |
cc |
and,6A |
R3227 |
T5138 |
T5139 |
amod |
unpublished,data |
R3228 |
T5139 |
T5135 |
conj |
data,6A |
R3229 |
T5140 |
T5135 |
punct |
),6A |
R3230 |
T5141 |
T5054 |
punct |
.,demonstrated |
R3231 |
T5143 |
T5144 |
compound |
RT,PCR |
R3232 |
T5144 |
T5146 |
compound |
PCR,analysis |
R3233 |
T5145 |
T5144 |
punct |
-,PCR |
R3234 |
T5146 |
T5147 |
nsubj |
analysis,revealed |
R3235 |
T5148 |
T5146 |
prep |
of,analysis |
R3236 |
T5149 |
T5150 |
amod |
molecular,markers |
R3237 |
T5150 |
T5148 |
pobj |
markers,of |
R3238 |
T5151 |
T5150 |
prep |
of,markers |
R3239 |
T5152 |
T5153 |
compound |
osteoblast,differentiation |
R3240 |
T5153 |
T5151 |
pobj |
differentiation,of |
R3241 |
T5154 |
T5155 |
punct |
(,S2 |
R3242 |
T5155 |
T5146 |
parataxis |
S2,analysis |
R3243 |
T5156 |
T5155 |
compound |
Dataset,S2 |
R3244 |
T5157 |
T5155 |
punct |
),S2 |
R3245 |
T5158 |
T5159 |
amod |
similar,increases |
R3246 |
T5159 |
T5147 |
dobj |
increases,revealed |
R3247 |
T5160 |
T5147 |
prep |
over,revealed |
R3248 |
T5161 |
T5160 |
pobj |
time,over |
R3249 |
T5162 |
T5147 |
prep |
in,revealed |
R3250 |
T5163 |
T5162 |
pobj |
RNA,in |
R3251 |
T5164 |
T5163 |
prep |
from,RNA |
R3252 |
T5165 |
T5166 |
nmod |
Sam68,mice |
R3253 |
T5166 |
T5164 |
pobj |
mice,from |
R3254 |
T5167 |
T5165 |
punct |
+,Sam68 |
R3255 |
T5168 |
T5165 |
punct |
/,Sam68 |
R3256 |
T5169 |
T5165 |
punct |
+,Sam68 |
R3257 |
T5170 |
T5165 |
cc |
and,Sam68 |
R3258 |
T5171 |
T5165 |
conj |
Sam68,Sam68 |
R3259 |
T5172 |
T5171 |
punct |
−,Sam68 |
R3260 |
T5173 |
T5171 |
punct |
/,Sam68 |
R3261 |
T5174 |
T5171 |
punct |
−,Sam68 |
R3262 |
T5175 |
T5147 |
punct |
", ",revealed |
R3263 |
T5176 |
T5177 |
mark |
although,appeared |
R3264 |
T5177 |
T5147 |
advcl |
appeared,revealed |
R3265 |
T5178 |
T5179 |
nmod |
type,collagen |
R3266 |
T5179 |
T5177 |
nsubj |
collagen,appeared |
R3267 |
T5180 |
T5178 |
nummod |
I,type |
R3268 |
T5181 |
T5182 |
aux |
to,regulated |
R3269 |
T5182 |
T5177 |
xcomp |
regulated,appeared |
R3270 |
T5183 |
T5182 |
auxpass |
be,regulated |
R3271 |
T5184 |
T5182 |
advmod |
up,regulated |
R3272 |
T5185 |
T5182 |
punct |
-,regulated |
R3273 |
T5186 |
T5182 |
prep |
at,regulated |
R3274 |
T5187 |
T5188 |
det |
both,timepoints |
R3275 |
T5188 |
T5186 |
pobj |
timepoints,at |
R3276 |
T5189 |
T5182 |
prep |
in,regulated |
R3277 |
T5190 |
T5191 |
det |
the,mice |
R3278 |
T5191 |
T5189 |
pobj |
mice,in |
R3279 |
T5192 |
T5191 |
nmod |
Sam68,mice |
R3280 |
T5193 |
T5192 |
punct |
−,Sam68 |
R3281 |
T5194 |
T5192 |
punct |
/,Sam68 |
R3282 |
T5195 |
T5192 |
punct |
−,Sam68 |
R3283 |
T5196 |
T5147 |
punct |
.,revealed |
R3284 |
T5198 |
T5199 |
amod |
Short,term |
R3285 |
T5199 |
T5201 |
compound |
term,cultures |
R3286 |
T5200 |
T5199 |
punct |
-,term |
R3287 |
T5201 |
T5202 |
nsubj |
cultures,stained |
R3288 |
T5203 |
T5201 |
prep |
of,cultures |
R3289 |
T5204 |
T5205 |
amod |
mature,osteoclasts |
R3290 |
T5205 |
T5203 |
pobj |
osteoclasts,of |
R3291 |
T5206 |
T5205 |
acl |
released,osteoclasts |
R3292 |
T5207 |
T5206 |
prep |
from,released |
R3293 |
T5208 |
T5209 |
det |
the,bones |
R3294 |
T5209 |
T5207 |
pobj |
bones,from |
R3295 |
T5210 |
T5209 |
amod |
crushed,bones |
R3296 |
T5211 |
T5209 |
amod |
long,bones |
R3297 |
T5212 |
T5209 |
prep |
of,bones |
R3298 |
T5213 |
T5214 |
nmod |
Sam68,mice |
R3299 |
T5214 |
T5212 |
pobj |
mice,of |
R3300 |
T5215 |
T5213 |
punct |
+,Sam68 |
R3301 |
T5216 |
T5213 |
punct |
/,Sam68 |
R3302 |
T5217 |
T5213 |
punct |
+,Sam68 |
R3303 |
T5218 |
T5213 |
cc |
and,Sam68 |
R3304 |
T5219 |
T5213 |
conj |
Sam68,Sam68 |
R3305 |
T5220 |
T5219 |
punct |
−,Sam68 |
R3306 |
T5221 |
T5219 |
punct |
/,Sam68 |
R3307 |
T5222 |
T5219 |
punct |
−,Sam68 |
R3308 |
T5223 |
T5224 |
advmod |
equally,well |
R3309 |
T5224 |
T5202 |
advmod |
well,stained |
R3310 |
T5225 |
T5202 |
prep |
for,stained |
R3311 |
T5226 |
T5225 |
pobj |
TRAP,for |
R3312 |
T5227 |
T5202 |
cc |
and,stained |
R3313 |
T5228 |
T5202 |
conj |
excavated,stained |
R3314 |
T5229 |
T5230 |
advmod |
approximately,equal |
R3315 |
T5230 |
T5231 |
amod |
equal,numbers |
R3316 |
T5231 |
T5228 |
dobj |
numbers,excavated |
R3317 |
T5232 |
T5231 |
prep |
of,numbers |
R3318 |
T5233 |
T5232 |
pobj |
pits,of |
R3319 |
T5234 |
T5233 |
prep |
of,pits |
R3320 |
T5235 |
T5236 |
amod |
equal,size |
R3321 |
T5236 |
T5234 |
pobj |
size,of |
R3322 |
T5237 |
T5228 |
prep |
in,excavated |
R3323 |
T5238 |
T5239 |
compound |
dentin,slices |
R3324 |
T5239 |
T5237 |
pobj |
slices,in |
R3325 |
T5240 |
T5228 |
punct |
", ",excavated |
R3326 |
T5241 |
T5242 |
mark |
as,visualized |
R3327 |
T5242 |
T5228 |
advcl |
visualized,excavated |
R3328 |
T5243 |
T5242 |
prep |
by,visualized |
R3329 |
T5244 |
T5243 |
pcomp |
scanning,by |
R3330 |
T5245 |
T5246 |
compound |
electron,microscopy |
R3331 |
T5246 |
T5244 |
dobj |
microscopy,scanning |
R3332 |
T5247 |
T5248 |
punct |
(,6B |
R3333 |
T5248 |
T5228 |
parataxis |
6B,excavated |
R3334 |
T5249 |
T5248 |
compound |
Figure,6B |
R3335 |
T5250 |
T5248 |
punct |
),6B |
R3336 |
T5251 |
T5202 |
punct |
.,stained |
R3337 |
T5253 |
T5254 |
det |
These,findings |
R3338 |
T5254 |
T5255 |
nsubj |
findings,suggest |
R3339 |
T5256 |
T5257 |
mark |
that,be |
R3340 |
T5257 |
T5255 |
ccomp |
be,suggest |
R3341 |
T5258 |
T5259 |
det |
the,osteoclasts |
R3342 |
T5259 |
T5257 |
nsubj |
osteoclasts,be |
R3343 |
T5260 |
T5257 |
aux |
may,be |
R3344 |
T5261 |
T5257 |
neg |
not,be |
R3345 |
T5262 |
T5263 |
det |
the,defect |
R3346 |
T5263 |
T5257 |
attr |
defect,be |
R3347 |
T5264 |
T5263 |
amod |
primary,defect |
R3348 |
T5265 |
T5263 |
prep |
in,defect |
R3349 |
T5266 |
T5267 |
nmod |
Sam68,mice |
R3350 |
T5267 |
T5265 |
pobj |
mice,in |
R3351 |
T5268 |
T5266 |
punct |
−,Sam68 |
R3352 |
T5269 |
T5266 |
punct |
/,Sam68 |
R3353 |
T5270 |
T5266 |
punct |
−,Sam68 |
R3354 |
T5271 |
T5257 |
punct |
", ",be |
R3355 |
T5272 |
T5273 |
mark |
as,are |
R3356 |
T5273 |
T5257 |
advcl |
are,be |
R3357 |
T5274 |
T5273 |
nsubj |
they,are |
R3358 |
T5275 |
T5273 |
prep |
in,are |
R3359 |
T5276 |
T5277 |
nmod |
Src,mice |
R3360 |
T5277 |
T5275 |
pobj |
mice,in |
R3361 |
T5278 |
T5277 |
amod |
null,mice |
R3362 |
T5279 |
T5280 |
punct |
[,48 |
R3363 |
T5280 |
T5273 |
parataxis |
48,are |
R3364 |
T5281 |
T5280 |
punct |
],48 |
R3365 |
T5282 |
T5255 |
punct |
.,suggest |
R3377 |
T5689 |
T5690 |
det |
The,Absence |
R3378 |
T5690 |
T5691 |
nsubj |
Absence,Prevents |
R3379 |
T5692 |
T5690 |
prep |
of,Absence |
R3380 |
T5693 |
T5692 |
pobj |
Sam68,of |
R3381 |
T5694 |
T5695 |
compound |
Adipocyte,Differentiation |
R3382 |
T5695 |
T5691 |
dobj |
Differentiation,Prevents |
R3383 |
T5696 |
T5691 |
cc |
and,Prevents |
R3384 |
T5697 |
T5691 |
conj |
Promotes,Prevents |
R3385 |
T5698 |
T5699 |
compound |
Osteoblast,Differentiation |
R3386 |
T5699 |
T5697 |
dobj |
Differentiation,Promotes |
R3387 |
T5701 |
T5702 |
nsubjpass |
It,recognized |
R3388 |
T5703 |
T5702 |
auxpass |
is,recognized |
R3389 |
T5704 |
T5702 |
advmod |
well,recognized |
R3390 |
T5705 |
T5706 |
mark |
that,give |
R3391 |
T5706 |
T5702 |
advcl |
give,recognized |
R3392 |
T5707 |
T5708 |
nmod |
bone,marrow |
R3393 |
T5708 |
T5709 |
nmod |
marrow,cells |
R3394 |
T5709 |
T5706 |
nsubj |
cells,give |
R3395 |
T5710 |
T5709 |
amod |
stromal,cells |
R3396 |
T5711 |
T5706 |
dobj |
rise,give |
R3397 |
T5712 |
T5706 |
prep |
to,give |
R3398 |
T5713 |
T5714 |
det |
both,osteoblasts |
R3399 |
T5714 |
T5712 |
pobj |
osteoblasts,to |
R340 |
T1057 |
T1058 |
prep |
During,favored |
R3400 |
T5715 |
T5714 |
cc |
and,osteoblasts |
R3401 |
T5716 |
T5714 |
conj |
adipocytes,osteoblasts |
R3402 |
T5717 |
T5706 |
cc |
and,give |
R3403 |
T5718 |
T5719 |
mark |
that,accompanied |
R3404 |
T5719 |
T5706 |
conj |
accompanied,give |
R3405 |
T5720 |
T5721 |
npadvmod |
age,related |
R3406 |
T5721 |
T5723 |
amod |
related,loss |
R3407 |
T5722 |
T5721 |
punct |
-,related |
R3408 |
T5723 |
T5719 |
nsubjpass |
loss,accompanied |
R3409 |
T5724 |
T5723 |
compound |
bone,loss |
R341 |
T1059 |
T1060 |
amod |
skeletal,development |
R3410 |
T5725 |
T5719 |
auxpass |
is,accompanied |
R3411 |
T5726 |
T5719 |
agent |
by,accompanied |
R3412 |
T5727 |
T5728 |
det |
an,increase |
R3413 |
T5728 |
T5726 |
pobj |
increase,by |
R3414 |
T5729 |
T5728 |
prep |
in,increase |
R3415 |
T5730 |
T5729 |
pobj |
differentiation,in |
R3416 |
T5731 |
T5719 |
prep |
down,accompanied |
R3417 |
T5732 |
T5733 |
det |
the,lineage |
R3418 |
T5733 |
T5731 |
pobj |
lineage,down |
R3419 |
T5734 |
T5733 |
compound |
adipocyte,lineage |
R342 |
T1060 |
T1057 |
pobj |
development,During |
R3420 |
T5735 |
T5736 |
punct |
[,22 |
R3421 |
T5736 |
T5719 |
parataxis |
22,accompanied |
R3422 |
T5737 |
T5736 |
punct |
],22 |
R3423 |
T5738 |
T5702 |
punct |
.,recognized |
R3424 |
T5740 |
T5741 |
advmod |
Therefore,influence |
R3425 |
T5742 |
T5741 |
punct |
", ",influence |
R3426 |
T5743 |
T5744 |
det |
the,loss |
R3427 |
T5744 |
T5741 |
nsubj |
loss,influence |
R3428 |
T5745 |
T5744 |
prep |
of,loss |
R3429 |
T5746 |
T5745 |
pobj |
Sam68,of |
R343 |
T1061 |
T1058 |
punct |
", ",favored |
R3430 |
T5747 |
T5741 |
aux |
could,influence |
R3431 |
T5748 |
T5749 |
det |
the,cells |
R3432 |
T5749 |
T5741 |
dobj |
cells,influence |
R3433 |
T5750 |
T5751 |
nmod |
bone,marrow |
R3434 |
T5751 |
T5749 |
nmod |
marrow,cells |
R3435 |
T5752 |
T5749 |
amod |
stromal,cells |
R3436 |
T5753 |
T5754 |
aux |
to,differentiate |
R3437 |
T5754 |
T5741 |
advcl |
differentiate,influence |
R3438 |
T5755 |
T5754 |
prep |
along,differentiate |
R3439 |
T5756 |
T5757 |
det |
the,osteogenic |
R344 |
T1062 |
T1063 |
det |
the,activity |
R3440 |
T5757 |
T5755 |
pobj |
osteogenic,along |
R3441 |
T5758 |
T5757 |
cc |
versus,osteogenic |
R3442 |
T5759 |
T5760 |
det |
the,adipogenic |
R3443 |
T5760 |
T5761 |
nmod |
adipogenic,pathway |
R3444 |
T5761 |
T5757 |
conj |
pathway,osteogenic |
R3445 |
T5762 |
T5741 |
punct |
.,influence |
R3446 |
T5764 |
T5765 |
advmod |
Alternatively,regulate |
R3447 |
T5766 |
T5765 |
punct |
", ",regulate |
R3448 |
T5767 |
T5768 |
det |
the,loss |
R3449 |
T5768 |
T5765 |
nsubj |
loss,regulate |
R345 |
T1063 |
T1058 |
nsubjpass |
activity,favored |
R3450 |
T5769 |
T5768 |
prep |
of,loss |
R3451 |
T5770 |
T5769 |
pobj |
Sam68,of |
R3452 |
T5771 |
T5765 |
aux |
could,regulate |
R3453 |
T5772 |
T5765 |
advmod |
indirectly,regulate |
R3454 |
T5773 |
T5774 |
compound |
bone,mass |
R3455 |
T5774 |
T5765 |
dobj |
mass,regulate |
R3456 |
T5775 |
T5765 |
prep |
as,regulate |
R3457 |
T5776 |
T5777 |
det |
a,disturbance |
R3458 |
T5777 |
T5775 |
pobj |
disturbance,as |
R3459 |
T5778 |
T5777 |
amod |
general,disturbance |
R346 |
T1064 |
T1063 |
amod |
anabolic,activity |
R3460 |
T5779 |
T5777 |
prep |
of,disturbance |
R3461 |
T5780 |
T5781 |
amod |
neuroendocrine,control |
R3462 |
T5781 |
T5779 |
pobj |
control,of |
R3463 |
T5782 |
T5783 |
mark |
as,shown |
R3464 |
T5783 |
T5765 |
advcl |
shown,regulate |
R3465 |
T5784 |
T5783 |
auxpass |
was,shown |
R3466 |
T5785 |
T5786 |
advmod |
when,shown |
R3467 |
T5786 |
T5783 |
advcl |
shown,shown |
R3468 |
T5787 |
T5786 |
nsubjpass |
leptin,shown |
R3469 |
T5788 |
T5787 |
cc |
and,leptin |
R347 |
T1065 |
T1063 |
prep |
of,activity |
R3470 |
T5789 |
T5790 |
det |
the,axis |
R3471 |
T5790 |
T5787 |
conj |
axis,leptin |
R3472 |
T5791 |
T5790 |
amod |
sympathetic,axis |
R3473 |
T5792 |
T5793 |
amod |
nervous,system |
R3474 |
T5793 |
T5790 |
compound |
system,axis |
R3475 |
T5794 |
T5786 |
auxpass |
were,shown |
R3476 |
T5795 |
T5796 |
aux |
to,regulate |
R3477 |
T5796 |
T5786 |
xcomp |
regulate,shown |
R3478 |
T5797 |
T5796 |
advmod |
negatively,regulate |
R3479 |
T5798 |
T5799 |
compound |
bone,mass |
R348 |
T1066 |
T1065 |
pobj |
osteoblasts,of |
R3480 |
T5799 |
T5796 |
dobj |
mass,regulate |
R3481 |
T5800 |
T5801 |
punct |
[,8 |
R3482 |
T5801 |
T5765 |
parataxis |
8,regulate |
R3483 |
T5802 |
T5801 |
punct |
],8 |
R3484 |
T5803 |
T5765 |
punct |
.,regulate |
R3485 |
T5805 |
T5806 |
aux |
To,confirm |
R3486 |
T5806 |
T5807 |
advcl |
confirm,isolated |
R3487 |
T5808 |
T5809 |
det |
a,role |
R3488 |
T5809 |
T5806 |
dobj |
role,confirm |
R3489 |
T5810 |
T5809 |
prep |
for,role |
R349 |
T1067 |
T1068 |
punct |
[,1 |
R3490 |
T5811 |
T5810 |
pobj |
Sam68,for |
R3491 |
T5812 |
T5809 |
prep |
in,role |
R3492 |
T5813 |
T5814 |
det |
the,regulation |
R3493 |
T5814 |
T5812 |
pobj |
regulation,in |
R3494 |
T5815 |
T5814 |
prep |
of,regulation |
R3495 |
T5816 |
T5817 |
compound |
adipocyte,differentiation |
R3496 |
T5817 |
T5815 |
pobj |
differentiation,of |
R3497 |
T5818 |
T5807 |
punct |
", ",isolated |
R3498 |
T5819 |
T5807 |
nsubj |
we,isolated |
R3499 |
T5820 |
T5821 |
amod |
primary,MEFs |
R350 |
T1068 |
T1063 |
parataxis |
1,activity |
R3500 |
T5821 |
T5807 |
dobj |
MEFs,isolated |
R3501 |
T5822 |
T5821 |
prep |
from,MEFs |
R3502 |
T5823 |
T5824 |
nummod |
14.5,day |
R3503 |
T5824 |
T5826 |
npadvmod |
day,old |
R3504 |
T5825 |
T5824 |
punct |
-,day |
R3505 |
T5826 |
T5828 |
amod |
old,embryos |
R3506 |
T5827 |
T5826 |
punct |
-,old |
R3507 |
T5828 |
T5822 |
pobj |
embryos,from |
R3508 |
T5829 |
T5828 |
nmod |
Sam68,embryos |
R3509 |
T5830 |
T5829 |
punct |
+,Sam68 |
R351 |
T1069 |
T1068 |
punct |
],1 |
R3510 |
T5831 |
T5829 |
punct |
/,Sam68 |
R3511 |
T5832 |
T5829 |
punct |
+,Sam68 |
R3512 |
T5833 |
T5829 |
cc |
and,Sam68 |
R3513 |
T5834 |
T5829 |
conj |
Sam68,Sam68 |
R3514 |
T5835 |
T5834 |
punct |
−,Sam68 |
R3515 |
T5836 |
T5834 |
punct |
/,Sam68 |
R3516 |
T5837 |
T5834 |
punct |
−,Sam68 |
R3517 |
T5838 |
T5807 |
punct |
.,isolated |
R3518 |
T5840 |
T5841 |
det |
The,MEFs |
R3519 |
T5841 |
T5847 |
nsubjpass |
MEFs,differentiated |
R352 |
T1070 |
T1058 |
auxpass |
is,favored |
R3520 |
T5842 |
T5841 |
amod |
primary,MEFs |
R3521 |
T5843 |
T5841 |
nmod |
Sam68,MEFs |
R3522 |
T5844 |
T5843 |
punct |
−,Sam68 |
R3523 |
T5845 |
T5843 |
punct |
/,Sam68 |
R3524 |
T5846 |
T5843 |
punct |
−,Sam68 |
R3525 |
T5848 |
T5847 |
auxpass |
were,differentiated |
R3526 |
T5849 |
T5847 |
prep |
into,differentiated |
R3527 |
T5850 |
T5849 |
pobj |
adipocytes,into |
R3528 |
T5851 |
T5852 |
advmod |
in,vitro |
R3529 |
T5852 |
T5847 |
advmod |
vitro,differentiated |
R353 |
T1071 |
T1058 |
prep |
over,favored |
R3530 |
T5853 |
T5847 |
prep |
in,differentiated |
R3531 |
T5854 |
T5855 |
compound |
culture,medium |
R3532 |
T5855 |
T5853 |
pobj |
medium,in |
R3533 |
T5856 |
T5855 |
acl |
containing,medium |
R3534 |
T5857 |
T5858 |
nummod |
5,μM |
R3535 |
T5858 |
T5859 |
compound |
μM,pioglitazone |
R3536 |
T5859 |
T5856 |
dobj |
pioglitazone,containing |
R3537 |
T5860 |
T5861 |
aux |
to,induce |
R3538 |
T5861 |
T5847 |
advcl |
induce,differentiated |
R3539 |
T5862 |
T5861 |
dobj |
adipogenesis,induce |
R354 |
T1072 |
T1073 |
det |
the,activity |
R3540 |
T5863 |
T5847 |
punct |
.,differentiated |
R3541 |
T5865 |
T5866 |
nsubjpass |
Cells,stained |
R3542 |
T5867 |
T5865 |
prep |
at,Cells |
R3543 |
T5868 |
T5869 |
nmod |
days,0 |
R3544 |
T5869 |
T5867 |
pobj |
0,at |
R3545 |
T5870 |
T5869 |
punct |
", ",0 |
R3546 |
T5871 |
T5869 |
conj |
4,0 |
R3547 |
T5872 |
T5871 |
punct |
", ",4 |
R3548 |
T5873 |
T5871 |
conj |
6,4 |
R3549 |
T5874 |
T5873 |
punct |
", ",6 |
R355 |
T1073 |
T1071 |
pobj |
activity,over |
R3550 |
T5875 |
T5873 |
cc |
and,6 |
R3551 |
T5876 |
T5873 |
conj |
12,6 |
R3552 |
T5877 |
T5866 |
auxpass |
were,stained |
R3553 |
T5878 |
T5866 |
prep |
with,stained |
R3554 |
T5879 |
T5880 |
compound |
Oil,O |
R3555 |
T5880 |
T5878 |
pobj |
O,with |
R3556 |
T5881 |
T5880 |
compound |
red,O |
R3557 |
T5882 |
T5883 |
aux |
to,monitor |
R3558 |
T5883 |
T5866 |
advcl |
monitor,stained |
R3559 |
T5884 |
T5883 |
dobj |
adipogenesis,monitor |
R356 |
T1074 |
T1073 |
amod |
catabolic,activity |
R3560 |
T5885 |
T5866 |
punct |
.,stained |
R3561 |
T5887 |
T5888 |
nsubj |
Adipogenesis,was |
R3562 |
T5889 |
T5890 |
advmod |
more,pronounced |
R3563 |
T5890 |
T5888 |
acomp |
pronounced,was |
R3564 |
T5891 |
T5888 |
prep |
in,was |
R3565 |
T5892 |
T5893 |
det |
the,cultures |
R3566 |
T5893 |
T5891 |
pobj |
cultures,in |
R3567 |
T5894 |
T5895 |
amod |
wild,type |
R3568 |
T5895 |
T5893 |
compound |
type,cultures |
R3569 |
T5896 |
T5895 |
punct |
-,type |
R357 |
T1075 |
T1073 |
prep |
of,activity |
R3570 |
T5897 |
T5893 |
compound |
MEFs,cultures |
R3571 |
T5898 |
T5888 |
prep |
than,was |
R3572 |
T5899 |
T5898 |
prep |
in,than |
R3573 |
T5900 |
T5901 |
det |
the,MEFs |
R3574 |
T5901 |
T5899 |
pobj |
MEFs,in |
R3575 |
T5902 |
T5901 |
nmod |
Sam68,MEFs |
R3576 |
T5903 |
T5902 |
punct |
−,Sam68 |
R3577 |
T5904 |
T5902 |
punct |
/,Sam68 |
R3578 |
T5905 |
T5902 |
punct |
−,Sam68 |
R3579 |
T5906 |
T5888 |
punct |
", ",was |
R358 |
T1076 |
T1075 |
pobj |
osteoclasts,of |
R3580 |
T5907 |
T5888 |
advcl |
consistent,was |
R3581 |
T5908 |
T5907 |
prep |
with,consistent |
R3582 |
T5909 |
T5910 |
det |
the,role |
R3583 |
T5910 |
T5908 |
pobj |
role,with |
R3584 |
T5911 |
T5910 |
amod |
positive,role |
R3585 |
T5912 |
T5910 |
prep |
of,role |
R3586 |
T5913 |
T5914 |
amod |
endogenous,Sam68 |
R3587 |
T5914 |
T5912 |
pobj |
Sam68,of |
R3588 |
T5915 |
T5910 |
prep |
in,role |
R3589 |
T5916 |
T5917 |
compound |
adipocyte,differentiation |
R359 |
T1077 |
T1078 |
punct |
[,2 |
R3590 |
T5917 |
T5915 |
pobj |
differentiation,in |
R3591 |
T5918 |
T5919 |
punct |
(,Figure |
R3592 |
T5919 |
T5888 |
parataxis |
Figure,was |
R3593 |
T5920 |
T5919 |
nummod |
7,Figure |
R3594 |
T5921 |
T5919 |
punct |
),Figure |
R3595 |
T5922 |
T5888 |
punct |
.,was |
R3596 |
T5924 |
T5925 |
det |
The,expression |
R3597 |
T5925 |
T5926 |
nsubjpass |
expression,impaired |
R3598 |
T5927 |
T5925 |
prep |
of,expression |
R3599 |
T5928 |
T5929 |
amod |
key,factors |
R360 |
T1078 |
T1073 |
appos |
2,activity |
R3600 |
T5929 |
T5927 |
pobj |
factors,of |
R3601 |
T5930 |
T5929 |
compound |
transcription,factors |
R3602 |
T5931 |
T5929 |
prep |
including,factors |
R3603 |
T5932 |
T5933 |
det |
the,PPARγ |
R3604 |
T5933 |
T5931 |
pobj |
PPARγ,including |
R3605 |
T5934 |
T5933 |
cc |
and,PPARγ |
R3606 |
T5935 |
T5933 |
conj |
KLF5,PPARγ |
R3607 |
T5936 |
T5926 |
auxpass |
was,impaired |
R3608 |
T5937 |
T5926 |
prep |
in,impaired |
R3609 |
T5938 |
T5939 |
nmod |
Sam68,MEFs |
R361 |
T1079 |
T1078 |
punct |
],2 |
R3610 |
T5939 |
T5937 |
pobj |
MEFs,in |
R3611 |
T5940 |
T5938 |
punct |
−,Sam68 |
R3612 |
T5941 |
T5938 |
punct |
/,Sam68 |
R3613 |
T5942 |
T5938 |
punct |
−,Sam68 |
R3614 |
T5943 |
T5939 |
amod |
differentiated,MEFs |
R3615 |
T5944 |
T5926 |
prep |
compared,impaired |
R3616 |
T5945 |
T5944 |
prep |
with,compared |
R3617 |
T5946 |
T5947 |
nmod |
Sam68,MEFs |
R3618 |
T5947 |
T5945 |
pobj |
MEFs,with |
R3619 |
T5948 |
T5946 |
punct |
+,Sam68 |
R362 |
T1080 |
T1073 |
punct |
", ",activity |
R3620 |
T5949 |
T5946 |
punct |
/,Sam68 |
R3621 |
T5950 |
T5946 |
punct |
+,Sam68 |
R3622 |
T5951 |
T5926 |
punct |
", ",impaired |
R3623 |
T5952 |
T5926 |
advcl |
consistent,impaired |
R3624 |
T5953 |
T5952 |
prep |
with,consistent |
R3625 |
T5954 |
T5955 |
amod |
impaired,adipogenesis |
R3626 |
T5955 |
T5953 |
pobj |
adipogenesis,with |
R3627 |
T5956 |
T5955 |
prep |
in,adipogenesis |
R3628 |
T5957 |
T5958 |
det |
the,absence |
R3629 |
T5958 |
T5956 |
pobj |
absence,in |
R363 |
T1081 |
T1082 |
dep |
which,results |
R3630 |
T5959 |
T5958 |
prep |
of,absence |
R3631 |
T5960 |
T5959 |
pobj |
Sam68,of |
R3632 |
T5961 |
T5962 |
punct |
(,Figure |
R3633 |
T5962 |
T5926 |
parataxis |
Figure,impaired |
R3634 |
T5963 |
T5962 |
nummod |
7,Figure |
R3635 |
T5964 |
T5962 |
punct |
),Figure |
R3636 |
T5965 |
T5926 |
punct |
.,impaired |
R3637 |
T5967 |
T5968 |
det |
These,data |
R3638 |
T5968 |
T5969 |
nsubj |
data,support |
R3639 |
T5970 |
T5968 |
punct |
", ",data |
R364 |
T1082 |
T1073 |
relcl |
results,activity |
R3640 |
T5971 |
T5968 |
advmod |
together,data |
R3641 |
T5972 |
T5971 |
prep |
with,together |
R3642 |
T5973 |
T5972 |
pobj |
data,with |
R3643 |
T5974 |
T5973 |
acl |
confirming,data |
R3644 |
T5975 |
T5976 |
det |
a,phenotype |
R3645 |
T5976 |
T5974 |
dobj |
phenotype,confirming |
R3646 |
T5977 |
T5976 |
amod |
lean,phenotype |
R3647 |
T5978 |
T5976 |
prep |
in,phenotype |
R3648 |
T5979 |
T5980 |
nmod |
Sam68,mice |
R3649 |
T5980 |
T5978 |
pobj |
mice,in |
R365 |
T1083 |
T1082 |
prep |
in,results |
R3650 |
T5981 |
T5979 |
punct |
−,Sam68 |
R3651 |
T5982 |
T5979 |
punct |
/,Sam68 |
R3652 |
T5983 |
T5979 |
punct |
−,Sam68 |
R3653 |
T5984 |
T5985 |
punct |
(,N. |
R3654 |
T5985 |
T5968 |
meta |
N.,data |
R3655 |
T5986 |
T5985 |
nmod |
Torabi,N. |
R3656 |
T5987 |
T5985 |
cc |
and,N. |
R3657 |
T5988 |
T5985 |
conj |
S.,N. |
R3658 |
T5989 |
T5988 |
nmod |
Richard,S. |
R3659 |
T5990 |
T5988 |
punct |
", ",S. |
R366 |
T1084 |
T1085 |
det |
a,gain |
R3660 |
T5991 |
T5992 |
amod |
unpublished,data |
R3661 |
T5992 |
T5988 |
conj |
data,S. |
R3662 |
T5993 |
T5992 |
punct |
),data |
R3663 |
T5994 |
T5969 |
punct |
", ",support |
R3664 |
T5995 |
T5996 |
det |
the,hypothesis |
R3665 |
T5996 |
T5969 |
dobj |
hypothesis,support |
R3666 |
T5997 |
T5998 |
mark |
that,modulates |
R3667 |
T5998 |
T5996 |
acl |
modulates,hypothesis |
R3668 |
T5999 |
T5998 |
nsubj |
Sam68,modulates |
R3669 |
T6000 |
T6001 |
det |
the,differentiation |
R367 |
T1085 |
T1083 |
pobj |
gain,in |
R3670 |
T6001 |
T5998 |
dobj |
differentiation,modulates |
R3671 |
T6002 |
T6001 |
prep |
of,differentiation |
R3672 |
T6003 |
T6004 |
amod |
mesenchymal,cells |
R3673 |
T6004 |
T6002 |
pobj |
cells,of |
R3674 |
T6005 |
T5969 |
punct |
.,support |
R3675 |
T6007 |
T6008 |
aux |
To,examine |
R3676 |
T6008 |
T6010 |
advcl |
examine,chose |
R3677 |
T6009 |
T6008 |
advmod |
further,examine |
R3678 |
T6011 |
T6012 |
det |
this,phenotype |
R3679 |
T6012 |
T6008 |
dobj |
phenotype,examine |
R368 |
T1086 |
T1085 |
amod |
net,gain |
R3680 |
T6013 |
T6008 |
prep |
in,examine |
R3681 |
T6014 |
T6015 |
det |
a,system |
R3682 |
T6015 |
T6013 |
pobj |
system,in |
R3683 |
T6016 |
T6017 |
npadvmod |
cell,autonomous |
R3684 |
T6017 |
T6015 |
amod |
autonomous,system |
R3685 |
T6018 |
T6010 |
punct |
", ",chose |
R3686 |
T6019 |
T6010 |
nsubj |
we,chose |
R3687 |
T6020 |
T6021 |
det |
the,cells |
R3688 |
T6021 |
T6010 |
dobj |
cells,chose |
R3689 |
T6022 |
T6021 |
amod |
embryonic,cells |
R369 |
T1087 |
T1085 |
prep |
in,gain |
R3690 |
T6023 |
T6021 |
amod |
mesenchymal,cells |
R3691 |
T6024 |
T6021 |
amod |
multipotential,cells |
R3692 |
T6025 |
T6021 |
compound |
progenitor,cells |
R3693 |
T6026 |
T6021 |
appos |
C3H10T1,cells |
R3694 |
T6027 |
T6026 |
punct |
/,C3H10T1 |
R3695 |
T6028 |
T6026 |
nummod |
2,C3H10T1 |
R3696 |
T6029 |
T6010 |
punct |
.,chose |
R3697 |
T6031 |
T6032 |
det |
The,addition |
R3698 |
T6032 |
T6033 |
nsubj |
addition,induced |
R3699 |
T6034 |
T6032 |
prep |
of,addition |
R370 |
T1088 |
T1089 |
compound |
bone,mass |
R3700 |
T6035 |
T6034 |
pobj |
BMP,of |
R3701 |
T6036 |
T6035 |
punct |
-,BMP |
R3702 |
T6037 |
T6035 |
nummod |
2,BMP |
R3703 |
T6038 |
T6039 |
compound |
osteoblast,differentiation |
R3704 |
T6039 |
T6033 |
dobj |
differentiation,induced |
R3705 |
T6040 |
T6033 |
punct |
", ",induced |
R3706 |
T6041 |
T6042 |
mark |
as,evidenced |
R3707 |
T6042 |
T6033 |
advcl |
evidenced,induced |
R3708 |
T6043 |
T6042 |
agent |
by,evidenced |
R3709 |
T6044 |
T6045 |
det |
an,increase |
R371 |
T1089 |
T1087 |
pobj |
mass,in |
R3710 |
T6045 |
T6043 |
pobj |
increase,by |
R3711 |
T6046 |
T6047 |
advmod |
approximately,400-fold |
R3712 |
T6047 |
T6045 |
nmod |
400-fold,increase |
R3713 |
T6048 |
T6045 |
prep |
in,increase |
R3714 |
T6049 |
T6048 |
pobj |
expression,in |
R3715 |
T6050 |
T6049 |
prep |
of,expression |
R3716 |
T6051 |
T6052 |
det |
the,gene |
R3717 |
T6052 |
T6050 |
pobj |
gene,of |
R3718 |
T6053 |
T6052 |
nmod |
osteocalcin,gene |
R3719 |
T6054 |
T6053 |
punct |
(,osteocalcin |
R372 |
T1090 |
T1058 |
punct |
.,favored |
R3720 |
T6055 |
T6053 |
appos |
OCN,osteocalcin |
R3721 |
T6056 |
T6052 |
punct |
),gene |
R3722 |
T6057 |
T6058 |
punct |
[,51 |
R3723 |
T6058 |
T6033 |
parataxis |
51,induced |
R3724 |
T6059 |
T6058 |
punct |
],51 |
R3725 |
T6060 |
T6033 |
punct |
.,induced |
R3726 |
T6062 |
T6063 |
nsubjpass |
Populations,selected |
R3727 |
T6064 |
T6062 |
prep |
of,Populations |
R3728 |
T6065 |
T6066 |
nmod |
C3H10T1,cells |
R3729 |
T6066 |
T6064 |
pobj |
cells,of |
R373 |
T1092 |
T1093 |
prep |
At,maintained |
R3730 |
T6067 |
T6065 |
punct |
/,C3H10T1 |
R3731 |
T6068 |
T6065 |
nummod |
2,C3H10T1 |
R3732 |
T6069 |
T6070 |
advmod |
stably,transfected |
R3733 |
T6070 |
T6062 |
acl |
transfected,Populations |
R3734 |
T6071 |
T6070 |
prep |
with,transfected |
R3735 |
T6072 |
T6073 |
preconj |
either,retro |
R3736 |
T6073 |
T6071 |
pobj |
retro,with |
R3737 |
T6074 |
T6073 |
compound |
pSuper,retro |
R3738 |
T6075 |
T6073 |
punct |
-,retro |
R3739 |
T6076 |
T6077 |
punct |
(,control |
R374 |
T1094 |
T1095 |
amod |
skeletal,maturity |
R3740 |
T6077 |
T6073 |
parataxis |
control,retro |
R3741 |
T6078 |
T6077 |
punct |
),control |
R3742 |
T6079 |
T6073 |
cc |
and,retro |
R3743 |
T6080 |
T6081 |
compound |
pSuper,retro |
R3744 |
T6081 |
T6073 |
conj |
retro,retro |
R3745 |
T6082 |
T6081 |
punct |
-,retro |
R3746 |
T6083 |
T6081 |
acl |
harboring,retro |
R3747 |
T6084 |
T6085 |
det |
a,hairpin |
R3748 |
T6085 |
T6083 |
dobj |
hairpin,harboring |
R3749 |
T6086 |
T6085 |
amod |
short,hairpin |
R375 |
T1095 |
T1092 |
pobj |
maturity,At |
R3750 |
T6087 |
T6085 |
prep |
against,hairpin |
R3751 |
T6088 |
T6087 |
pobj |
Sam68,against |
R3752 |
T6089 |
T6085 |
punct |
(,hairpin |
R3753 |
T6090 |
T6085 |
appos |
Sam68sh,hairpin |
R3754 |
T6091 |
T6063 |
punct |
),selected |
R3755 |
T6092 |
T6063 |
auxpass |
were,selected |
R3756 |
T6093 |
T6063 |
prep |
with,selected |
R3757 |
T6094 |
T6093 |
pobj |
puromycin,with |
R3758 |
T6095 |
T6063 |
punct |
.,selected |
R3759 |
T6097 |
T6098 |
det |
The,expression |
R376 |
T1096 |
T1093 |
punct |
", ",maintained |
R3760 |
T6098 |
T6099 |
nsubjpass |
expression,reduced |
R3761 |
T6100 |
T6098 |
prep |
of,expression |
R3762 |
T6101 |
T6100 |
pobj |
Sam68,of |
R3763 |
T6102 |
T6099 |
auxpass |
was,reduced |
R3764 |
T6103 |
T6099 |
prep |
by,reduced |
R3765 |
T6104 |
T6105 |
advmod |
approximately,80 |
R3766 |
T6105 |
T6106 |
nummod |
80,% |
R3767 |
T6106 |
T6103 |
pobj |
%,by |
R3768 |
T6107 |
T6108 |
mark |
as,evidenced |
R3769 |
T6108 |
T6099 |
advcl |
evidenced,reduced |
R377 |
T1097 |
T1098 |
compound |
bone,mass |
R3770 |
T6109 |
T6108 |
agent |
by,evidenced |
R3771 |
T6110 |
T6111 |
compound |
immunoblot,analyses |
R3772 |
T6111 |
T6109 |
pobj |
analyses,by |
R3773 |
T6112 |
T6111 |
acl |
using,analyses |
R3774 |
T6113 |
T6114 |
compound |
β,actin |
R3775 |
T6114 |
T6112 |
dobj |
actin,using |
R3776 |
T6115 |
T6114 |
punct |
-,actin |
R3777 |
T6116 |
T6112 |
prep |
as,using |
R3778 |
T6117 |
T6118 |
det |
a,control |
R3779 |
T6118 |
T6116 |
pobj |
control,as |
R378 |
T1098 |
T1093 |
nsubjpass |
mass,maintained |
R3780 |
T6119 |
T6118 |
compound |
loading,control |
R3781 |
T6120 |
T6121 |
punct |
(,8A |
R3782 |
T6121 |
T6099 |
parataxis |
8A,reduced |
R3783 |
T6122 |
T6121 |
compound |
Figure,8A |
R3784 |
T6123 |
T6121 |
punct |
),8A |
R3785 |
T6124 |
T6099 |
punct |
.,reduced |
R3786 |
T6126 |
T6127 |
compound |
Osteoblast,differentiation |
R3787 |
T6127 |
T6128 |
nsubjpass |
differentiation,induced |
R3788 |
T6129 |
T6128 |
auxpass |
was,induced |
R3789 |
T6130 |
T6128 |
prep |
in,induced |
R379 |
T1099 |
T1093 |
auxpass |
is,maintained |
R3790 |
T6131 |
T6130 |
pobj |
cultures,in |
R3791 |
T6132 |
T6131 |
acl |
expressing,cultures |
R3792 |
T6133 |
T6134 |
compound |
pSuper,retro |
R3793 |
T6134 |
T6132 |
dobj |
retro,expressing |
R3794 |
T6135 |
T6134 |
punct |
-,retro |
R3795 |
T6136 |
T6134 |
cc |
or,retro |
R3796 |
T6137 |
T6138 |
compound |
pSuper,retro |
R3797 |
T6138 |
T6140 |
compound |
retro,Sam68sh |
R3798 |
T6139 |
T6138 |
punct |
-,retro |
R3799 |
T6140 |
T6134 |
conj |
Sam68sh,retro |
R380 |
T1100 |
T1093 |
prep |
through,maintained |
R3800 |
T6141 |
T6128 |
prep |
by,induced |
R3801 |
T6142 |
T6141 |
pobj |
addition,by |
R3802 |
T6143 |
T6142 |
prep |
of,addition |
R3803 |
T6144 |
T6143 |
pobj |
BMP,of |
R3804 |
T6145 |
T6144 |
punct |
-,BMP |
R3805 |
T6146 |
T6144 |
nummod |
2,BMP |
R3806 |
T6147 |
T6142 |
prep |
to,addition |
R3807 |
T6148 |
T6149 |
det |
the,medium |
R3808 |
T6149 |
T6147 |
pobj |
medium,to |
R3809 |
T6150 |
T6149 |
compound |
culture,medium |
R381 |
T1101 |
T1102 |
det |
the,activity |
R3810 |
T6151 |
T6128 |
punct |
.,induced |
R3811 |
T6152 |
T6128 |
punct |
.,induced |
R3812 |
T6154 |
T6155 |
det |
The,expression |
R3813 |
T6155 |
T6156 |
nsubjpass |
expression,examined |
R3814 |
T6157 |
T6155 |
prep |
of,expression |
R3815 |
T6158 |
T6157 |
pobj |
OCN,of |
R3816 |
T6159 |
T6158 |
cc |
and,OCN |
R3817 |
T6160 |
T6161 |
compound |
β,actin |
R3818 |
T6161 |
T6163 |
compound |
actin,mRNAs |
R3819 |
T6162 |
T6161 |
punct |
-,actin |
R382 |
T1102 |
T1100 |
pobj |
activity,through |
R3820 |
T6163 |
T6158 |
conj |
mRNAs,OCN |
R3821 |
T6164 |
T6156 |
auxpass |
was,examined |
R3822 |
T6165 |
T6156 |
prep |
by,examined |
R3823 |
T6166 |
T6167 |
amod |
semiquantitative,PCR |
R3824 |
T6167 |
T6165 |
pobj |
PCR,by |
R3825 |
T6168 |
T6167 |
compound |
RT,PCR |
R3826 |
T6169 |
T6167 |
punct |
-,PCR |
R3827 |
T6170 |
T6156 |
cc |
and,examined |
R3828 |
T6171 |
T6172 |
det |
the,cells |
R3829 |
T6172 |
T6176 |
nsubj |
cells,displayed |
R383 |
T1103 |
T1102 |
amod |
balanced,activity |
R3830 |
T6173 |
T6174 |
npadvmod |
Sam68sh,expressing |
R3831 |
T6174 |
T6172 |
amod |
expressing,cells |
R3832 |
T6175 |
T6174 |
punct |
-,expressing |
R3833 |
T6176 |
T6156 |
conj |
displayed,examined |
R3834 |
T6177 |
T6178 |
det |
a,phenotype |
R3835 |
T6178 |
T6176 |
dobj |
phenotype,displayed |
R3836 |
T6179 |
T6180 |
advmod |
more,pronounced |
R3837 |
T6180 |
T6178 |
amod |
pronounced,phenotype |
R3838 |
T6181 |
T6178 |
compound |
osteoblast,phenotype |
R3839 |
T6182 |
T6178 |
prep |
compared,phenotype |
R384 |
T1104 |
T1102 |
prep |
of,activity |
R3840 |
T6183 |
T6182 |
prep |
with,compared |
R3841 |
T6184 |
T6185 |
compound |
control,cells |
R3842 |
T6185 |
T6183 |
pobj |
cells,with |
R3843 |
T6186 |
T6176 |
punct |
", ",displayed |
R3844 |
T6187 |
T6188 |
mark |
as,assessed |
R3845 |
T6188 |
T6176 |
advcl |
assessed,displayed |
R3846 |
T6189 |
T6188 |
prep |
by,assessed |
R3847 |
T6190 |
T6191 |
det |
the,expression |
R3848 |
T6191 |
T6189 |
pobj |
expression,by |
R3849 |
T6192 |
T6191 |
prep |
of,expression |
R385 |
T1105 |
T1104 |
pobj |
osteoblasts,of |
R3850 |
T6193 |
T6192 |
pobj |
OCN,of |
R3851 |
T6194 |
T6195 |
punct |
(,8B |
R3852 |
T6195 |
T6176 |
parataxis |
8B,displayed |
R3853 |
T6196 |
T6195 |
compound |
Figure,8B |
R3854 |
T6197 |
T6195 |
punct |
),8B |
R3855 |
T6198 |
T6176 |
punct |
.,displayed |
R3856 |
T6200 |
T6201 |
prep |
Given,stained |
R3857 |
T6202 |
T6203 |
det |
the,enhancement |
R3858 |
T6203 |
T6200 |
pobj |
enhancement,Given |
R3859 |
T6204 |
T6203 |
amod |
apparent,enhancement |
R386 |
T1106 |
T1105 |
cc |
and,osteoblasts |
R3860 |
T6205 |
T6203 |
prep |
of,enhancement |
R3861 |
T6206 |
T6207 |
amod |
mineralized,nodule |
R3862 |
T6207 |
T6208 |
compound |
nodule,formation |
R3863 |
T6208 |
T6205 |
pobj |
formation,of |
R3864 |
T6209 |
T6203 |
prep |
by,enhancement |
R3865 |
T6210 |
T6211 |
nmod |
Sam68,cells |
R3866 |
T6211 |
T6209 |
pobj |
cells,by |
R3867 |
T6212 |
T6210 |
punct |
−,Sam68 |
R3868 |
T6213 |
T6210 |
punct |
/,Sam68 |
R3869 |
T6214 |
T6210 |
punct |
−,Sam68 |
R387 |
T1107 |
T1105 |
conj |
osteoclasts,osteoblasts |
R3870 |
T6215 |
T6216 |
nmod |
bone,marrow |
R3871 |
T6216 |
T6211 |
nmod |
marrow,cells |
R3872 |
T6217 |
T6211 |
amod |
stromal,cells |
R3873 |
T6218 |
T6219 |
advmod |
ex,vivo |
R3874 |
T6219 |
T6203 |
advmod |
vivo,enhancement |
R3875 |
T6220 |
T6203 |
cc |
and,enhancement |
R3876 |
T6221 |
T6222 |
det |
the,phenotype |
R3877 |
T6222 |
T6203 |
conj |
phenotype,enhancement |
R3878 |
T6223 |
T6222 |
acl |
observed,phenotype |
R3879 |
T6224 |
T6223 |
prep |
with,observed |
R388 |
T1108 |
T1093 |
prep |
during,maintained |
R3880 |
T6225 |
T6226 |
amod |
short,RNA |
R3881 |
T6226 |
T6228 |
npadvmod |
RNA,treated |
R3882 |
T6227 |
T6226 |
compound |
hairpin,RNA |
R3883 |
T6228 |
T6233 |
amod |
treated,C3H10T1 |
R3884 |
T6229 |
T6226 |
punct |
(,RNA |
R3885 |
T6230 |
T6226 |
appos |
shRNA,RNA |
R3886 |
T6231 |
T6228 |
punct |
),treated |
R3887 |
T6232 |
T6228 |
punct |
-,treated |
R3888 |
T6233 |
T6224 |
pobj |
C3H10T1,with |
R3889 |
T6234 |
T6233 |
punct |
/,C3H10T1 |
R389 |
T1109 |
T1110 |
det |
the,cycle |
R3890 |
T6235 |
T6233 |
nummod |
2,C3H10T1 |
R3891 |
T6236 |
T6201 |
punct |
", ",stained |
R3892 |
T6237 |
T6201 |
nsubj |
we,stained |
R3893 |
T6238 |
T6201 |
dobj |
sections,stained |
R3894 |
T6239 |
T6238 |
prep |
of,sections |
R3895 |
T6240 |
T6239 |
pobj |
bone,of |
R3896 |
T6241 |
T6238 |
prep |
from,sections |
R3897 |
T6242 |
T6243 |
nummod |
4,month |
R3898 |
T6243 |
T6248 |
npadvmod |
month,old |
R3899 |
T6244 |
T6242 |
punct |
-,4 |
R390 |
T1110 |
T1108 |
pobj |
cycle,during |
R3900 |
T6245 |
T6242 |
cc |
and,4 |
R3901 |
T6246 |
T6242 |
conj |
12,4 |
R3902 |
T6247 |
T6243 |
punct |
-,month |
R3903 |
T6248 |
T6250 |
amod |
old,mice |
R3904 |
T6249 |
T6248 |
punct |
-,old |
R3905 |
T6250 |
T6241 |
pobj |
mice,from |
R3906 |
T6251 |
T6201 |
prep |
for,stained |
R3907 |
T6252 |
T6251 |
pobj |
evidence,for |
R3908 |
T6253 |
T6252 |
prep |
of,evidence |
R3909 |
T6254 |
T6253 |
pobj |
changes,of |
R391 |
T1111 |
T1110 |
compound |
remodeling,cycle |
R3910 |
T6255 |
T6254 |
prep |
in,changes |
R3911 |
T6256 |
T6257 |
compound |
marrow,adiposity |
R3912 |
T6257 |
T6255 |
pobj |
adiposity,in |
R3913 |
T6258 |
T6201 |
punct |
.,stained |
R3914 |
T6260 |
T6261 |
nsubj |
Figure,shows |
R3915 |
T6262 |
T6260 |
nummod |
9,Figure |
R3916 |
T6263 |
T6261 |
dobj |
sections,shows |
R3917 |
T6264 |
T6263 |
prep |
of,sections |
R3918 |
T6265 |
T6266 |
amod |
undecalcified,bone |
R3919 |
T6266 |
T6264 |
pobj |
bone,of |
R392 |
T1112 |
T1093 |
punct |
.,maintained |
R3920 |
T6267 |
T6266 |
prep |
from,bone |
R3921 |
T6268 |
T6269 |
nummod |
4,month |
R3922 |
T6269 |
T6274 |
npadvmod |
month,old |
R3923 |
T6270 |
T6268 |
punct |
-,4 |
R3924 |
T6271 |
T6268 |
cc |
and,4 |
R3925 |
T6272 |
T6268 |
conj |
12,4 |
R3926 |
T6273 |
T6269 |
punct |
-,month |
R3927 |
T6274 |
T6276 |
amod |
old,mice |
R3928 |
T6275 |
T6274 |
punct |
-,old |
R3929 |
T6276 |
T6267 |
pobj |
mice,from |
R393 |
T1114 |
T1115 |
prep |
During,is |
R3930 |
T6277 |
T6276 |
nmod |
Sam68,mice |
R3931 |
T6278 |
T6277 |
punct |
+,Sam68 |
R3932 |
T6279 |
T6277 |
punct |
/,Sam68 |
R3933 |
T6280 |
T6277 |
punct |
+,Sam68 |
R3934 |
T6281 |
T6277 |
cc |
and,Sam68 |
R3935 |
T6282 |
T6277 |
conj |
Sam68,Sam68 |
R3936 |
T6283 |
T6282 |
punct |
−,Sam68 |
R3937 |
T6284 |
T6282 |
punct |
/,Sam68 |
R3938 |
T6285 |
T6282 |
punct |
−,Sam68 |
R3939 |
T6286 |
T6276 |
acl |
stained,mice |
R394 |
T1116 |
T1117 |
amod |
skeletal,aging |
R3940 |
T6287 |
T6286 |
prep |
with,stained |
R3941 |
T6288 |
T6289 |
compound |
von,Kossa |
R3942 |
T6289 |
T6287 |
pobj |
Kossa,with |
R3943 |
T6290 |
T6289 |
cc |
and,Kossa |
R3944 |
T6291 |
T6289 |
conj |
toluidine,Kossa |
R3945 |
T6292 |
T6291 |
amod |
blue,toluidine |
R3946 |
T6293 |
T6294 |
aux |
to,show |
R3947 |
T6294 |
T6286 |
advcl |
show,stained |
R3948 |
T6295 |
T6296 |
amod |
mineralized,tissue |
R3949 |
T6296 |
T6294 |
dobj |
tissue,show |
R395 |
T1117 |
T1114 |
pobj |
aging,During |
R3950 |
T6297 |
T6298 |
punct |
(,9A |
R3951 |
T6298 |
T6296 |
parataxis |
9A,tissue |
R3952 |
T6299 |
T6298 |
compound |
Figure,9A |
R3953 |
T6300 |
T6298 |
punct |
", ",9A |
R3954 |
T6301 |
T6298 |
amod |
black,9A |
R3955 |
T6302 |
T6298 |
punct |
),9A |
R3956 |
T6303 |
T6296 |
cc |
and,tissue |
R3957 |
T6304 |
T6305 |
compound |
marrow,adipocytes |
R3958 |
T6305 |
T6296 |
conj |
adipocytes,tissue |
R3959 |
T6306 |
T6307 |
punct |
(,9B |
R396 |
T1118 |
T1115 |
punct |
", ",is |
R3960 |
T6307 |
T6305 |
parataxis |
9B,adipocytes |
R3961 |
T6308 |
T6307 |
compound |
Figure,9B |
R3962 |
T6309 |
T6307 |
punct |
", ",9B |
R3963 |
T6310 |
T6307 |
amod |
white,9B |
R3964 |
T6311 |
T6307 |
punct |
),9B |
R3965 |
T6312 |
T6286 |
cc |
and,stained |
R3966 |
T6313 |
T6286 |
conj |
left,stained |
R3967 |
T6314 |
T6313 |
oprd |
unstained,left |
R3968 |
T6315 |
T6316 |
aux |
to,show |
R3969 |
T6316 |
T6313 |
advcl |
show,left |
R397 |
T1119 |
T1115 |
expl |
there,is |
R3970 |
T6317 |
T6318 |
compound |
fluorochrome,labeling |
R3971 |
T6318 |
T6316 |
dobj |
labeling,show |
R3972 |
T6319 |
T6318 |
prep |
of,labeling |
R3973 |
T6320 |
T6321 |
det |
the,fronts |
R3974 |
T6321 |
T6319 |
pobj |
fronts,of |
R3975 |
T6322 |
T6321 |
compound |
mineralization,fronts |
R3976 |
T6323 |
T6324 |
punct |
(,9C |
R3977 |
T6324 |
T6316 |
parataxis |
9C,show |
R3978 |
T6325 |
T6324 |
compound |
Figure,9C |
R3979 |
T6326 |
T6324 |
punct |
),9C |
R398 |
T1120 |
T1121 |
det |
a,shift |
R3980 |
T6327 |
T6261 |
punct |
.,shows |
R3981 |
T6329 |
T6330 |
nummod |
Twelve,month |
R3982 |
T6330 |
T6332 |
npadvmod |
month,old |
R3983 |
T6331 |
T6330 |
punct |
-,month |
R3984 |
T6332 |
T6334 |
amod |
old,mice |
R3985 |
T6333 |
T6332 |
punct |
-,old |
R3986 |
T6334 |
T6339 |
nsubj |
mice,showed |
R3987 |
T6335 |
T6334 |
nmod |
Sam68,mice |
R3988 |
T6336 |
T6335 |
punct |
+,Sam68 |
R3989 |
T6337 |
T6335 |
punct |
/,Sam68 |
R399 |
T1121 |
T1115 |
attr |
shift,is |
R3990 |
T6338 |
T6335 |
punct |
+,Sam68 |
R3991 |
T6340 |
T6341 |
det |
a,decrease |
R3992 |
T6341 |
T6339 |
dobj |
decrease,showed |
R3993 |
T6342 |
T6341 |
amod |
noticeable,decrease |
R3994 |
T6343 |
T6341 |
prep |
in,decrease |
R3995 |
T6344 |
T6345 |
amod |
trabecular,bone |
R3996 |
T6345 |
T6343 |
pobj |
bone,in |
R3997 |
T6346 |
T6347 |
punct |
(,9A |
R3998 |
T6347 |
T6345 |
parataxis |
9A,bone |
R3999 |
T6348 |
T6347 |
compound |
Figure,9A |
R400 |
T1122 |
T1121 |
prep |
in,shift |
R4000 |
T6349 |
T6347 |
punct |
),9A |
R4001 |
T6350 |
T6341 |
punct |
", ",decrease |
R4002 |
T6351 |
T6352 |
dep |
which,associated |
R4003 |
T6352 |
T6341 |
relcl |
associated,decrease |
R4004 |
T6353 |
T6352 |
auxpass |
was,associated |
R4005 |
T6354 |
T6352 |
prep |
with,associated |
R4006 |
T6355 |
T6356 |
det |
a,increase |
R4007 |
T6356 |
T6354 |
pobj |
increase,with |
R4008 |
T6357 |
T6356 |
amod |
significant,increase |
R4009 |
T6358 |
T6356 |
prep |
in,increase |
R401 |
T1123 |
T1124 |
det |
the,balance |
R4010 |
T6359 |
T6360 |
compound |
marrow,adiposity |
R4011 |
T6360 |
T6358 |
pobj |
adiposity,in |
R4012 |
T6361 |
T6362 |
punct |
(,9B |
R4013 |
T6362 |
T6356 |
parataxis |
9B,increase |
R4014 |
T6363 |
T6362 |
compound |
Figure,9B |
R4015 |
T6364 |
T6362 |
punct |
),9B |
R4016 |
T6365 |
T6354 |
cc |
and,with |
R4017 |
T6366 |
T6354 |
conj |
with,with |
R4018 |
T6367 |
T6368 |
det |
the,labels |
R4019 |
T6368 |
T6366 |
pobj |
labels,with |
R402 |
T1124 |
T1122 |
pobj |
balance,in |
R4020 |
T6369 |
T6368 |
nummod |
two,labels |
R4021 |
T6370 |
T6368 |
compound |
fluorochrome,labels |
R4022 |
T6371 |
T6368 |
acl |
superimposed,labels |
R4023 |
T6372 |
T6371 |
prep |
upon,superimposed |
R4024 |
T6373 |
T6372 |
pobj |
one,upon |
R4025 |
T6374 |
T6373 |
det |
another,one |
R4026 |
T6375 |
T6376 |
punct |
(,9C |
R4027 |
T6376 |
T6368 |
parataxis |
9C,labels |
R4028 |
T6377 |
T6376 |
compound |
Figure,9C |
R4029 |
T6378 |
T6376 |
punct |
),9C |
R403 |
T1125 |
T1126 |
dep |
that,favors |
R4030 |
T6379 |
T6339 |
punct |
.,showed |
R4031 |
T6381 |
T6382 |
prep |
In,appeared |
R4032 |
T6383 |
T6381 |
pobj |
contrast,In |
R4033 |
T6384 |
T6382 |
punct |
", ",appeared |
R4034 |
T6385 |
T6386 |
det |
the,bones |
R4035 |
T6386 |
T6382 |
nsubj |
bones,appeared |
R4036 |
T6387 |
T6386 |
prep |
of,bones |
R4037 |
T6388 |
T6389 |
nummod |
12,month |
R4038 |
T6389 |
T6391 |
npadvmod |
month,old |
R4039 |
T6390 |
T6389 |
punct |
-,month |
R404 |
T1126 |
T1121 |
relcl |
favors,shift |
R4040 |
T6391 |
T6393 |
amod |
old,mice |
R4041 |
T6392 |
T6391 |
punct |
-,old |
R4042 |
T6393 |
T6387 |
pobj |
mice,of |
R4043 |
T6394 |
T6393 |
nmod |
Sam68,mice |
R4044 |
T6395 |
T6394 |
punct |
−,Sam68 |
R4045 |
T6396 |
T6394 |
punct |
/,Sam68 |
R4046 |
T6397 |
T6394 |
punct |
−,Sam68 |
R4047 |
T6398 |
T6382 |
oprd |
similar,appeared |
R4048 |
T6399 |
T6398 |
prep |
to,similar |
R4049 |
T6400 |
T6399 |
pobj |
those,to |
R405 |
T1127 |
T1126 |
dative |
osteoclast,favors |
R4050 |
T6401 |
T6400 |
prep |
of,those |
R4051 |
T6402 |
T6403 |
det |
the,mice |
R4052 |
T6403 |
T6401 |
pobj |
mice,of |
R4053 |
T6404 |
T6405 |
nummod |
4,month |
R4054 |
T6405 |
T6407 |
npadvmod |
month,old |
R4055 |
T6406 |
T6405 |
punct |
-,month |
R4056 |
T6407 |
T6403 |
amod |
old,mice |
R4057 |
T6408 |
T6407 |
punct |
-,old |
R4058 |
T6409 |
T6403 |
prep |
of,mice |
R4059 |
T6410 |
T6411 |
det |
either,genotype |
R406 |
T1128 |
T1126 |
prep |
over,favors |
R4060 |
T6411 |
T6409 |
pobj |
genotype,of |
R4061 |
T6412 |
T6382 |
punct |
.,appeared |
R4062 |
T6414 |
T6415 |
det |
These,data |
R4063 |
T6415 |
T6416 |
nsubj |
data,demonstrate |
R4064 |
T6417 |
T6418 |
mark |
that,regulates |
R4065 |
T6418 |
T6416 |
ccomp |
regulates,demonstrate |
R4066 |
T6419 |
T6418 |
nsubj |
Sam68,regulates |
R4067 |
T6420 |
T6421 |
det |
the,differentiation |
R4068 |
T6421 |
T6418 |
dobj |
differentiation,regulates |
R4069 |
T6422 |
T6421 |
prep |
of,differentiation |
R407 |
T1129 |
T1128 |
pobj |
osteoblast,over |
R4070 |
T6423 |
T6424 |
nmod |
bone,marrow |
R4071 |
T6424 |
T6425 |
nmod |
marrow,cells |
R4072 |
T6425 |
T6422 |
pobj |
cells,of |
R4073 |
T6426 |
T6425 |
amod |
mesenchymal,cells |
R4074 |
T6427 |
T6428 |
aux |
to,promote |
R4075 |
T6428 |
T6418 |
advcl |
promote,regulates |
R4076 |
T6429 |
T6430 |
compound |
adipocyte,differentiation |
R4077 |
T6430 |
T6428 |
dobj |
differentiation,promote |
R4078 |
T6431 |
T6428 |
cc |
and,promote |
R4079 |
T6432 |
T6428 |
conj |
inhibit,promote |
R408 |
T1130 |
T1126 |
dobj |
activity,favors |
R4080 |
T6433 |
T6434 |
compound |
osteoblast,differentiation |
R4081 |
T6434 |
T6432 |
dobj |
differentiation,inhibit |
R4082 |
T6435 |
T6428 |
prep |
in,promote |
R4083 |
T6436 |
T6437 |
amod |
aging,bone |
R4084 |
T6437 |
T6435 |
pobj |
bone,in |
R4085 |
T6438 |
T6416 |
punct |
.,demonstrate |
R409 |
T1131 |
T1126 |
punct |
", ",favors |
R410 |
T1132 |
T1133 |
dep |
which,results |
R4104 |
T7333 |
T7334 |
det |
The,study |
R4105 |
T7334 |
T7336 |
nsubj |
study,provides |
R4106 |
T7335 |
T7334 |
amod |
present,study |
R4107 |
T7337 |
T7336 |
dobj |
evidence,provides |
R4108 |
T7338 |
T7339 |
mark |
that,is |
R4109 |
T7339 |
T7337 |
acl |
is,evidence |
R411 |
T1133 |
T1126 |
ccomp |
results,favors |
R4110 |
T7340 |
T7341 |
det |
a,role |
R4111 |
T7341 |
T7339 |
nsubj |
role,is |
R4112 |
T7342 |
T7341 |
amod |
physiologic,role |
R4113 |
T7343 |
T7341 |
prep |
of,role |
R4114 |
T7344 |
T7343 |
pobj |
Sam68,of |
R4115 |
T7345 |
T7346 |
aux |
to,modulate |
R4116 |
T7346 |
T7339 |
xcomp |
modulate,is |
R4117 |
T7347 |
T7348 |
nmod |
bone,marrow |
R4118 |
T7348 |
T7349 |
nmod |
marrow,cells |
R4119 |
T7349 |
T7346 |
dobj |
cells,modulate |
R412 |
T1134 |
T1133 |
prep |
in,results |
R4120 |
T7350 |
T7349 |
amod |
mesenchymal,cells |
R4121 |
T7351 |
T7349 |
compound |
stem,cells |
R4122 |
T7352 |
T7336 |
punct |
.,provides |
R4123 |
T7354 |
T7355 |
amod |
Young,mice |
R4124 |
T7355 |
T7360 |
nsubj |
mice,developed |
R4125 |
T7356 |
T7355 |
nmod |
Sam68,mice |
R4126 |
T7357 |
T7356 |
punct |
−,Sam68 |
R4127 |
T7358 |
T7356 |
punct |
/,Sam68 |
R4128 |
T7359 |
T7356 |
punct |
−,Sam68 |
R4129 |
T7361 |
T7360 |
advmod |
normally,developed |
R413 |
T1135 |
T1136 |
amod |
net,loss |
R4130 |
T7362 |
T7360 |
cc |
and,developed |
R4131 |
T7363 |
T7360 |
conj |
contained,developed |
R4132 |
T7364 |
T7365 |
amod |
similar,mass |
R4133 |
T7365 |
T7363 |
dobj |
mass,contained |
R4134 |
T7366 |
T7365 |
compound |
bone,mass |
R4135 |
T7367 |
T7363 |
prep |
compared,contained |
R4136 |
T7368 |
T7367 |
prep |
with,compared |
R4137 |
T7369 |
T7370 |
amod |
wild,type |
R4138 |
T7370 |
T7372 |
compound |
type,littermates |
R4139 |
T7371 |
T7370 |
punct |
-,type |
R414 |
T1136 |
T1134 |
pobj |
loss,in |
R4140 |
T7372 |
T7368 |
pobj |
littermates,with |
R4141 |
T7373 |
T7360 |
punct |
.,developed |
R4142 |
T7375 |
T7376 |
amod |
Aged,mice |
R4143 |
T7376 |
T7385 |
nsubj |
mice,displayed |
R4144 |
T7377 |
T7378 |
punct |
(,months |
R4145 |
T7378 |
T7375 |
parataxis |
months,Aged |
R4146 |
T7379 |
T7378 |
nummod |
12,months |
R4147 |
T7380 |
T7378 |
punct |
),months |
R4148 |
T7381 |
T7376 |
nmod |
Sam68,mice |
R4149 |
T7382 |
T7381 |
punct |
−,Sam68 |
R415 |
T1137 |
T1136 |
compound |
bone,loss |
R4150 |
T7383 |
T7381 |
punct |
/,Sam68 |
R4151 |
T7384 |
T7381 |
punct |
−,Sam68 |
R4152 |
T7386 |
T7387 |
det |
a,phenotype |
R4153 |
T7387 |
T7385 |
dobj |
phenotype,displayed |
R4154 |
T7388 |
T7389 |
amod |
high,mass |
R4155 |
T7389 |
T7387 |
compound |
mass,phenotype |
R4156 |
T7390 |
T7389 |
compound |
bone,mass |
R4157 |
T7391 |
T7385 |
prep |
compared,displayed |
R4158 |
T7392 |
T7391 |
prep |
with,compared |
R4159 |
T7393 |
T7394 |
nmod |
Sam68,littermates |
R416 |
T1138 |
T1139 |
punct |
[,3 |
R4160 |
T7394 |
T7392 |
pobj |
littermates,with |
R4161 |
T7395 |
T7393 |
punct |
+,Sam68 |
R4162 |
T7396 |
T7393 |
punct |
/,Sam68 |
R4163 |
T7397 |
T7393 |
punct |
+,Sam68 |
R4164 |
T7398 |
T7385 |
punct |
.,displayed |
R4165 |
T7400 |
T7401 |
det |
The,littermates |
R4166 |
T7401 |
T7405 |
nsubj |
littermates,underwent |
R4167 |
T7402 |
T7403 |
amod |
wild,type |
R4168 |
T7403 |
T7401 |
compound |
type,littermates |
R4169 |
T7404 |
T7403 |
punct |
-,type |
R417 |
T1139 |
T1115 |
parataxis |
3,is |
R4170 |
T7406 |
T7407 |
npadvmod |
age,related |
R4171 |
T7407 |
T7409 |
amod |
related,loss |
R4172 |
T7408 |
T7407 |
punct |
-,related |
R4173 |
T7409 |
T7405 |
dobj |
loss,underwent |
R4174 |
T7410 |
T7409 |
compound |
bone,loss |
R4175 |
T7411 |
T7412 |
dep |
that,occurs |
R4176 |
T7412 |
T7409 |
relcl |
occurs,loss |
R4177 |
T7413 |
T7412 |
advmod |
naturally,occurs |
R4178 |
T7414 |
T7412 |
prep |
in,occurs |
R4179 |
T7415 |
T7414 |
pobj |
mammals,in |
R418 |
T1140 |
T1139 |
punct |
],3 |
R4180 |
T7416 |
T7405 |
punct |
", ",underwent |
R4181 |
T7417 |
T7418 |
mark |
while,preserved |
R4182 |
T7418 |
T7405 |
advcl |
preserved,underwent |
R4183 |
T7419 |
T7420 |
det |
the,animals |
R4184 |
T7420 |
T7418 |
nsubj |
animals,preserved |
R4185 |
T7421 |
T7420 |
nmod |
Sam68,animals |
R4186 |
T7422 |
T7421 |
punct |
−,Sam68 |
R4187 |
T7423 |
T7421 |
punct |
/,Sam68 |
R4188 |
T7424 |
T7421 |
punct |
−,Sam68 |
R4189 |
T7425 |
T7426 |
poss |
their,mass |
R419 |
T1141 |
T1115 |
punct |
.,is |
R4190 |
T7426 |
T7418 |
dobj |
mass,preserved |
R4191 |
T7427 |
T7426 |
compound |
bone,mass |
R4192 |
T7428 |
T7418 |
prep |
with,preserved |
R4193 |
T7429 |
T7428 |
pobj |
aging,with |
R4194 |
T7430 |
T7405 |
punct |
.,underwent |
R4195 |
T7432 |
T7433 |
det |
The,differentiation |
R4196 |
T7433 |
T7434 |
nsubj |
differentiation,resulted |
R4197 |
T7435 |
T7433 |
prep |
of,differentiation |
R4198 |
T7436 |
T7437 |
compound |
bone,marrow |
R4199 |
T7437 |
T7438 |
compound |
marrow,cells |
R420 |
T1143 |
T1144 |
det |
The,amount |
R4200 |
T7438 |
T7435 |
pobj |
cells,of |
R4201 |
T7439 |
T7438 |
compound |
stem,cells |
R4202 |
T7440 |
T7438 |
acl |
isolated,cells |
R4203 |
T7441 |
T7440 |
prep |
from,isolated |
R4204 |
T7442 |
T7443 |
nmod |
Sam68,mice |
R4205 |
T7443 |
T7441 |
pobj |
mice,from |
R4206 |
T7444 |
T7442 |
punct |
−,Sam68 |
R4207 |
T7445 |
T7442 |
punct |
/,Sam68 |
R4208 |
T7446 |
T7442 |
punct |
−,Sam68 |
R4209 |
T7447 |
T7438 |
cc |
and,cells |
R421 |
T1144 |
T1145 |
nsubjpass |
amount,determined |
R4210 |
T7448 |
T7449 |
amod |
embryonic,cells |
R4211 |
T7449 |
T7438 |
conj |
cells,cells |
R4212 |
T7450 |
T7449 |
amod |
mesenchymal,cells |
R4213 |
T7451 |
T7449 |
amod |
multipotential,cells |
R4214 |
T7452 |
T7449 |
compound |
progenitor,cells |
R4215 |
T7453 |
T7449 |
appos |
C3H10T1,cells |
R4216 |
T7454 |
T7453 |
punct |
/,C3H10T1 |
R4217 |
T7455 |
T7453 |
nummod |
2,C3H10T1 |
R4218 |
T7456 |
T7449 |
acl |
treated,cells |
R4219 |
T7457 |
T7456 |
prep |
with,treated |
R422 |
T1146 |
T1144 |
cc |
and,amount |
R4220 |
T7458 |
T7459 |
compound |
Sam68,shRNA |
R4221 |
T7459 |
T7457 |
pobj |
shRNA,with |
R4222 |
T7460 |
T7434 |
prep |
in,resulted |
R4223 |
T7461 |
T7462 |
det |
a,differentiation |
R4224 |
T7462 |
T7460 |
pobj |
differentiation,in |
R4225 |
T7463 |
T7464 |
advmod |
more,pronounced |
R4226 |
T7464 |
T7462 |
amod |
pronounced,differentiation |
R4227 |
T7465 |
T7462 |
compound |
osteoblast,differentiation |
R4228 |
T7466 |
T7434 |
punct |
.,resulted |
R4229 |
T7468 |
T7469 |
det |
These,findings |
R423 |
T1147 |
T1144 |
conj |
rate,amount |
R4230 |
T7469 |
T7470 |
nsubj |
findings,demonstrate |
R4231 |
T7471 |
T7472 |
mark |
that,enhances |
R4232 |
T7472 |
T7470 |
ccomp |
enhances,demonstrate |
R4233 |
T7473 |
T7474 |
det |
the,loss |
R4234 |
T7474 |
T7472 |
nsubj |
loss,enhances |
R4235 |
T7475 |
T7474 |
prep |
of,loss |
R4236 |
T7476 |
T7475 |
pobj |
Sam68,of |
R4237 |
T7477 |
T7478 |
compound |
osteoblast,differentiation |
R4238 |
T7478 |
T7472 |
dobj |
differentiation,enhances |
R4239 |
T7479 |
T7470 |
punct |
.,demonstrate |
R424 |
T1148 |
T1149 |
prep |
at,gained |
R4240 |
T7481 |
T7482 |
det |
The,converse |
R4241 |
T7482 |
T7483 |
nsubj |
converse,was |
R4242 |
T7484 |
T7483 |
advmod |
also,was |
R4243 |
T7485 |
T7483 |
acomp |
true,was |
R4244 |
T7486 |
T7483 |
punct |
", ",was |
R4245 |
T7487 |
T7488 |
mark |
as,impaired |
R4246 |
T7488 |
T7483 |
advcl |
impaired,was |
R4247 |
T7489 |
T7488 |
nsubjpass |
MEFs,impaired |
R4248 |
T7490 |
T7489 |
acl |
isolated,MEFs |
R4249 |
T7491 |
T7490 |
prep |
from,isolated |
R425 |
T1149 |
T1147 |
relcl |
gained,rate |
R4250 |
T7492 |
T7493 |
nmod |
Sam68,animals |
R4251 |
T7493 |
T7491 |
pobj |
animals,from |
R4252 |
T7494 |
T7492 |
punct |
−,Sam68 |
R4253 |
T7495 |
T7492 |
punct |
/,Sam68 |
R4254 |
T7496 |
T7492 |
punct |
−,Sam68 |
R4255 |
T7497 |
T7488 |
auxpass |
were,impaired |
R4256 |
T7498 |
T7488 |
prep |
in,impaired |
R4257 |
T7499 |
T7500 |
poss |
their,ability |
R4258 |
T7500 |
T7498 |
pobj |
ability,in |
R4259 |
T7501 |
T7502 |
aux |
to,undergo |
R426 |
T1150 |
T1148 |
pobj |
which,at |
R4260 |
T7502 |
T7500 |
acl |
undergo,ability |
R4261 |
T7503 |
T7504 |
compound |
adipocyte,differentiation |
R4262 |
T7504 |
T7502 |
dobj |
differentiation,undergo |
R4263 |
T7505 |
T7488 |
prep |
compared,impaired |
R4264 |
T7506 |
T7505 |
prep |
with,compared |
R4265 |
T7507 |
T7508 |
nmod |
Sam68,MEFs |
R4266 |
T7508 |
T7506 |
pobj |
MEFs,with |
R4267 |
T7509 |
T7507 |
punct |
+,Sam68 |
R4268 |
T7510 |
T7507 |
punct |
/,Sam68 |
R4269 |
T7511 |
T7507 |
punct |
+,Sam68 |
R427 |
T1151 |
T1149 |
nsubjpass |
bone,gained |
R4270 |
T7512 |
T7483 |
punct |
.,was |
R4271 |
T7514 |
T7515 |
det |
These,findings |
R4272 |
T7515 |
T7516 |
nsubj |
findings,suggest |
R4273 |
T7517 |
T7518 |
mark |
that,is |
R4274 |
T7518 |
T7516 |
ccomp |
is,suggest |
R4275 |
T7519 |
T7520 |
det |
a,role |
R4276 |
T7520 |
T7518 |
nsubj |
role,is |
R4277 |
T7521 |
T7520 |
amod |
physiologic,role |
R4278 |
T7522 |
T7520 |
prep |
for,role |
R4279 |
T7523 |
T7522 |
pobj |
Sam68,for |
R428 |
T1152 |
T1149 |
auxpass |
is,gained |
R4280 |
T7524 |
T7525 |
aux |
to,regulate |
R4281 |
T7525 |
T7518 |
xcomp |
regulate,is |
R4282 |
T7526 |
T7527 |
det |
the,balance |
R4283 |
T7527 |
T7525 |
dobj |
balance,regulate |
R4284 |
T7528 |
T7527 |
prep |
between,balance |
R4285 |
T7529 |
T7530 |
amod |
adipogenic,differentiation |
R4286 |
T7530 |
T7528 |
pobj |
differentiation,between |
R4287 |
T7531 |
T7529 |
cc |
and,adipogenic |
R4288 |
T7532 |
T7529 |
conj |
osteogenic,adipogenic |
R4289 |
T7533 |
T7530 |
prep |
of,differentiation |
R429 |
T1153 |
T1149 |
prep |
during,gained |
R4290 |
T7534 |
T7535 |
det |
the,marrow |
R4291 |
T7535 |
T7533 |
pobj |
marrow,of |
R4292 |
T7536 |
T7535 |
compound |
bone,marrow |
R4293 |
T7537 |
T7535 |
amod |
mesenchymal,marrow |
R4294 |
T7538 |
T7516 |
punct |
.,suggest |
R4295 |
T7540 |
T7541 |
compound |
Sam68,expression |
R4296 |
T7541 |
T7543 |
nsubjpass |
expression,observed |
R4297 |
T7542 |
T7541 |
compound |
protein,expression |
R4298 |
T7544 |
T7543 |
auxpass |
was,observed |
R4299 |
T7545 |
T7543 |
prep |
throughout,observed |
R430 |
T1154 |
T1153 |
pobj |
development,during |
R4300 |
T7546 |
T7547 |
det |
the,embryo |
R4301 |
T7547 |
T7545 |
pobj |
embryo,throughout |
R4302 |
T7548 |
T7547 |
amod |
developing,embryo |
R4303 |
T7549 |
T7547 |
compound |
mouse,embryo |
R4304 |
T7550 |
T7543 |
punct |
", ",observed |
R4305 |
T7551 |
T7543 |
prep |
in,observed |
R4306 |
T7552 |
T7551 |
pobj |
keeping,in |
R4307 |
T7553 |
T7552 |
prep |
with,keeping |
R4308 |
T7554 |
T7555 |
amod |
previous,reports |
R4309 |
T7555 |
T7553 |
pobj |
reports,with |
R431 |
T1155 |
T1149 |
cc |
and,gained |
R4310 |
T7556 |
T7557 |
dep |
that,identified |
R4311 |
T7557 |
T7555 |
relcl |
identified,reports |
R4312 |
T7558 |
T7559 |
det |
the,mRNA |
R4313 |
T7559 |
T7561 |
nsubjpass |
mRNA,expressed |
R4314 |
T7560 |
T7559 |
compound |
Sam68,mRNA |
R4315 |
T7561 |
T7557 |
ccomp |
expressed,identified |
R4316 |
T7562 |
T7561 |
aux |
to,expressed |
R4317 |
T7563 |
T7561 |
auxpass |
be,expressed |
R4318 |
T7564 |
T7561 |
advmod |
widely,expressed |
R4319 |
T7565 |
T7566 |
punct |
[,38 |
R432 |
T1156 |
T1149 |
conj |
lost,gained |
R4320 |
T7566 |
T7543 |
parataxis |
38,observed |
R4321 |
T7567 |
T7566 |
punct |
],38 |
R4322 |
T7568 |
T7543 |
punct |
.,observed |
R4323 |
T7570 |
T7571 |
nsubj |
We,observe |
R4324 |
T7572 |
T7573 |
compound |
Sam68,staining |
R4325 |
T7573 |
T7571 |
dobj |
staining,observe |
R4326 |
T7574 |
T7571 |
prep |
in,observe |
R4327 |
T7575 |
T7576 |
det |
the,brain |
R4328 |
T7576 |
T7574 |
pobj |
brain,in |
R4329 |
T7577 |
T7576 |
punct |
", ",brain |
R433 |
T1157 |
T1156 |
prep |
during,lost |
R4330 |
T7578 |
T7576 |
conj |
heart,brain |
R4331 |
T7579 |
T7578 |
punct |
", ",heart |
R4332 |
T7580 |
T7578 |
cc |
and,heart |
R4333 |
T7581 |
T7578 |
conj |
intestine,heart |
R4334 |
T7582 |
T7583 |
punct |
(,see |
R4335 |
T7583 |
T7581 |
parataxis |
see,intestine |
R4336 |
T7584 |
T7583 |
dobj |
Figure,see |
R4337 |
T7585 |
T7584 |
nummod |
1,Figure |
R4338 |
T7586 |
T7583 |
punct |
),see |
R4339 |
T7587 |
T7588 |
advmod |
as,as |
R434 |
T1158 |
T1157 |
pobj |
aging,during |
R4340 |
T7588 |
T7576 |
cc |
as,brain |
R4341 |
T7589 |
T7588 |
advmod |
well,as |
R4342 |
T7590 |
T7576 |
conj |
liver,brain |
R4343 |
T7591 |
T7590 |
punct |
", ",liver |
R4344 |
T7592 |
T7590 |
conj |
skin,liver |
R4345 |
T7593 |
T7592 |
punct |
", ",skin |
R4346 |
T7594 |
T7592 |
cc |
and,skin |
R4347 |
T7595 |
T7592 |
conj |
kidney,skin |
R4348 |
T7596 |
T7597 |
punct |
(,data |
R4349 |
T7597 |
T7595 |
meta |
data,kidney |
R435 |
T1159 |
T1145 |
auxpass |
are,determined |
R4350 |
T7598 |
T7597 |
amod |
unpublished,data |
R4351 |
T7599 |
T7597 |
punct |
),data |
R4352 |
T7600 |
T7576 |
prep |
of,brain |
R4353 |
T7601 |
T7602 |
amod |
late,stage |
R4354 |
T7602 |
T7604 |
compound |
stage,embryos |
R4355 |
T7603 |
T7602 |
punct |
-,stage |
R4356 |
T7604 |
T7600 |
pobj |
embryos,of |
R4357 |
T7605 |
T7571 |
punct |
.,observe |
R4358 |
T7607 |
T7608 |
det |
This,pattern |
R4359 |
T7608 |
T7610 |
nsubj |
pattern,is |
R436 |
T1160 |
T1145 |
prep |
in,determined |
R4360 |
T7609 |
T7608 |
compound |
expression,pattern |
R4361 |
T7611 |
T7610 |
acomp |
consistent,is |
R4362 |
T7612 |
T7611 |
prep |
with,consistent |
R4363 |
T7613 |
T7614 |
amod |
previous,work |
R4364 |
T7614 |
T7612 |
pobj |
work,with |
R4365 |
T7615 |
T7616 |
dep |
that,observed |
R4366 |
T7616 |
T7614 |
relcl |
observed,work |
R4367 |
T7617 |
T7616 |
aux |
has,observed |
R4368 |
T7618 |
T7616 |
dobj |
Sam68,observed |
R4369 |
T7619 |
T7618 |
prep |
in,Sam68 |
R437 |
T1161 |
T1162 |
amod |
large,part |
R4370 |
T7620 |
T7619 |
pobj |
neurons,in |
R4371 |
T7621 |
T7622 |
punct |
[,52 |
R4372 |
T7622 |
T7619 |
parataxis |
52,in |
R4373 |
T7623 |
T7622 |
punct |
],52 |
R4374 |
T7624 |
T7619 |
cc |
and,in |
R4375 |
T7625 |
T7619 |
conj |
as,in |
R4376 |
T7626 |
T7627 |
det |
a,substrate |
R4377 |
T7627 |
T7625 |
pobj |
substrate,as |
R4378 |
T7628 |
T7627 |
prep |
of,substrate |
R4379 |
T7629 |
T7630 |
det |
the,kinase |
R438 |
T1162 |
T1160 |
pobj |
part,in |
R4380 |
T7630 |
T7628 |
pobj |
kinase,of |
R4381 |
T7631 |
T7632 |
amod |
intestinal,SIK |
R4382 |
T7632 |
T7630 |
nmod |
SIK,kinase |
R4383 |
T7633 |
T7632 |
punct |
/,SIK |
R4384 |
T7634 |
T7635 |
compound |
breast,tumor |
R4385 |
T7635 |
T7632 |
appos |
tumor,SIK |
R4386 |
T7636 |
T7637 |
punct |
[,43 |
R4387 |
T7637 |
T7627 |
parataxis |
43,substrate |
R4388 |
T7638 |
T7637 |
punct |
],43 |
R4389 |
T7639 |
T7610 |
punct |
.,is |
R439 |
T1163 |
T1145 |
prep |
by,determined |
R4390 |
T7641 |
T7642 |
det |
The,expression |
R4391 |
T7642 |
T7643 |
nsubjpass |
expression,altered |
R4392 |
T7644 |
T7642 |
prep |
of,expression |
R4393 |
T7645 |
T7644 |
pobj |
Sam68,of |
R4394 |
T7646 |
T7643 |
auxpass |
was,altered |
R4395 |
T7647 |
T7643 |
neg |
not,altered |
R4396 |
T7648 |
T7643 |
prep |
in,altered |
R4397 |
T7649 |
T7650 |
amod |
aging,cells |
R4398 |
T7650 |
T7648 |
pobj |
cells,in |
R4399 |
T7651 |
T7652 |
nmod |
bone,marrow |
R440 |
T1164 |
T1163 |
pobj |
genetics,by |
R4400 |
T7652 |
T7650 |
nmod |
marrow,cells |
R4401 |
T7653 |
T7650 |
amod |
stromal,cells |
R4402 |
T7654 |
T7648 |
cc |
or,in |
R4403 |
T7655 |
T7648 |
conj |
in,in |
R4404 |
T7656 |
T7657 |
amod |
senescencing,cells |
R4405 |
T7657 |
T7655 |
pobj |
cells,in |
R4406 |
T7658 |
T7657 |
nmod |
WI,cells |
R4407 |
T7659 |
T7658 |
punct |
-,WI |
R4408 |
T7660 |
T7658 |
nummod |
38,WI |
R4409 |
T7661 |
T7662 |
punct |
(,data |
R441 |
T1165 |
T1166 |
punct |
[,4 |
R4410 |
T7662 |
T7643 |
meta |
data,altered |
R4411 |
T7663 |
T7662 |
amod |
unpublished,data |
R4412 |
T7664 |
T7662 |
punct |
),data |
R4413 |
T7665 |
T7643 |
punct |
.,altered |
R4414 |
T7667 |
T7668 |
det |
The,presence |
R4415 |
T7668 |
T7669 |
nsubj |
presence,predicted |
R4416 |
T7670 |
T7668 |
prep |
of,presence |
R4417 |
T7671 |
T7670 |
pobj |
Sam68,of |
R4418 |
T7672 |
T7668 |
prep |
in,presence |
R4419 |
T7673 |
T7672 |
pobj |
chondrocytes,in |
R442 |
T1166 |
T1164 |
parataxis |
4,genetics |
R4420 |
T7674 |
T7673 |
punct |
", ",chondrocytes |
R4421 |
T7675 |
T7673 |
conj |
osteoblasts,chondrocytes |
R4422 |
T7676 |
T7675 |
cc |
and,osteoblasts |
R4423 |
T7677 |
T7675 |
conj |
osteoclasts,osteoblasts |
R4424 |
T7678 |
T7673 |
prep |
in,chondrocytes |
R4425 |
T7679 |
T7680 |
amod |
developing,cartilage |
R4426 |
T7680 |
T7678 |
pobj |
cartilage,in |
R4427 |
T7681 |
T7680 |
cc |
and,cartilage |
R4428 |
T7682 |
T7680 |
conj |
bone,cartilage |
R4429 |
T7683 |
T7684 |
det |
a,role |
R443 |
T1167 |
T1168 |
punct |
–,6 |
R4430 |
T7684 |
T7669 |
dobj |
role,predicted |
R4431 |
T7685 |
T7684 |
amod |
pivotal,role |
R4432 |
T7686 |
T7684 |
prep |
for,role |
R4433 |
T7687 |
T7688 |
det |
the,protein |
R4434 |
T7688 |
T7686 |
pobj |
protein,for |
R4435 |
T7689 |
T7684 |
prep |
in,role |
R4436 |
T7690 |
T7691 |
amod |
skeletal,development |
R4437 |
T7691 |
T7689 |
pobj |
development,in |
R4438 |
T7692 |
T7669 |
punct |
.,predicted |
R4439 |
T7694 |
T7695 |
det |
The,mice |
R444 |
T1168 |
T1166 |
prep |
6,4 |
R4440 |
T7695 |
T7700 |
nsubjpass |
mice,generated |
R4441 |
T7696 |
T7695 |
nmod |
Sam68,mice |
R4442 |
T7697 |
T7696 |
punct |
−,Sam68 |
R4443 |
T7698 |
T7696 |
punct |
/,Sam68 |
R4444 |
T7699 |
T7696 |
punct |
−,Sam68 |
R4445 |
T7701 |
T7700 |
auxpass |
were,generated |
R4446 |
T7702 |
T7700 |
advcl |
using,generated |
R4447 |
T7703 |
T7704 |
det |
a,approach |
R4448 |
T7704 |
T7702 |
dobj |
approach,using |
R4449 |
T7705 |
T7704 |
amod |
traditional,approach |
R445 |
T1169 |
T1166 |
punct |
],4 |
R4450 |
T7706 |
T7704 |
compound |
targeting,approach |
R4451 |
T7707 |
T7708 |
advmod |
where,deleted |
R4452 |
T7708 |
T7704 |
relcl |
deleted,approach |
R4453 |
T7709 |
T7710 |
det |
the,domain |
R4454 |
T7710 |
T7708 |
nsubjpass |
domain,deleted |
R4455 |
T7711 |
T7710 |
amod |
functional,domain |
R4456 |
T7712 |
T7710 |
compound |
KH,domain |
R4457 |
T7713 |
T7708 |
auxpass |
was,deleted |
R4458 |
T7714 |
T7700 |
cc |
and,generated |
R4459 |
T7715 |
T7716 |
advmod |
approximately,one |
R446 |
T1170 |
T1163 |
cc |
but,by |
R4460 |
T7716 |
T7717 |
nsubj |
one,survived |
R4461 |
T7717 |
T7700 |
conj |
survived,generated |
R4462 |
T7718 |
T7716 |
amod |
third,one |
R4463 |
T7719 |
T7716 |
prep |
of,one |
R4464 |
T7720 |
T7721 |
det |
the,mice |
R4465 |
T7721 |
T7719 |
pobj |
mice,of |
R4466 |
T7722 |
T7721 |
nmod |
Sam68,mice |
R4467 |
T7723 |
T7722 |
punct |
−,Sam68 |
R4468 |
T7724 |
T7722 |
punct |
/,Sam68 |
R4469 |
T7725 |
T7722 |
punct |
−,Sam68 |
R447 |
T1171 |
T1170 |
advmod |
also,but |
R4470 |
T7726 |
T7717 |
prep |
to,survived |
R4471 |
T7727 |
T7726 |
pobj |
adulthood,to |
R4472 |
T7728 |
T7717 |
prep |
with,survived |
R4473 |
T7729 |
T7730 |
det |
no,defects |
R4474 |
T7730 |
T7728 |
pobj |
defects,with |
R4475 |
T7731 |
T7730 |
amod |
apparent,defects |
R4476 |
T7732 |
T7717 |
punct |
.,survived |
R4477 |
T7734 |
T7735 |
nummod |
One,explanation |
R4478 |
T7735 |
T7736 |
nsubj |
explanation,is |
R4479 |
T7737 |
T7735 |
prep |
for,explanation |
R448 |
T1172 |
T1163 |
conj |
by,by |
R4480 |
T7738 |
T7739 |
det |
this,phenomenon |
R4481 |
T7739 |
T7737 |
pobj |
phenomenon,for |
R4482 |
T7740 |
T7741 |
mark |
that,sub-served |
R4483 |
T7741 |
T7736 |
ccomp |
sub-served,is |
R4484 |
T7742 |
T7743 |
compound |
Sam68,function |
R4485 |
T7743 |
T7741 |
nsubjpass |
function,sub-served |
R4486 |
T7744 |
T7741 |
auxpass |
is,sub-served |
R4487 |
T7745 |
T7741 |
agent |
by,sub-served |
R4488 |
T7746 |
T7745 |
pobj |
one,by |
R4489 |
T7747 |
T7746 |
cc |
or,one |
R449 |
T1173 |
T1174 |
amod |
physical,activity |
R4490 |
T7748 |
T7746 |
conj |
more,one |
R4491 |
T7749 |
T7746 |
prep |
of,one |
R4492 |
T7750 |
T7751 |
poss |
its,members |
R4493 |
T7751 |
T7749 |
pobj |
members,of |
R4494 |
T7752 |
T7751 |
compound |
family,members |
R4495 |
T7753 |
T7741 |
prep |
during,sub-served |
R4496 |
T7754 |
T7753 |
pobj |
development,during |
R4497 |
T7755 |
T7756 |
amod |
such,as |
R4498 |
T7756 |
T7741 |
prep |
as,sub-served |
R4499 |
T7757 |
T7756 |
pobj |
SLM,as |
R450 |
T1174 |
T1172 |
pobj |
activity,by |
R4500 |
T7758 |
T7757 |
punct |
-,SLM |
R4501 |
T7759 |
T7757 |
nummod |
1,SLM |
R4502 |
T7760 |
T7757 |
cc |
and,SLM |
R4503 |
T7761 |
T7757 |
conj |
SLM,SLM |
R4504 |
T7762 |
T7761 |
punct |
-,SLM |
R4505 |
T7763 |
T7761 |
nummod |
2,SLM |
R4506 |
T7764 |
T7765 |
punct |
[,47 |
R4507 |
T7765 |
T7736 |
parataxis |
47,is |
R4508 |
T7766 |
T7765 |
punct |
],47 |
R4509 |
T7767 |
T7736 |
punct |
.,is |
R451 |
T1175 |
T1172 |
cc |
and,by |
R4510 |
T7769 |
T7770 |
advmod |
Alternatively,required |
R4511 |
T7771 |
T7770 |
punct |
", ",required |
R4512 |
T7772 |
T7770 |
nsubjpass |
Sam68,required |
R4513 |
T7773 |
T7770 |
auxpass |
is,required |
R4514 |
T7774 |
T7770 |
neg |
not,required |
R4515 |
T7775 |
T7770 |
prep |
during,required |
R4516 |
T7776 |
T7777 |
amod |
embryonic,development |
R4517 |
T7777 |
T7775 |
pobj |
development,during |
R4518 |
T7778 |
T7770 |
punct |
.,required |
R4519 |
T7780 |
T7781 |
advmod |
However,killed |
R452 |
T1176 |
T1172 |
conj |
by,by |
R4520 |
T7782 |
T7781 |
punct |
", ",killed |
R4521 |
T7783 |
T7784 |
nummod |
two,thirds |
R4522 |
T7784 |
T7781 |
nsubjpass |
thirds,killed |
R4523 |
T7785 |
T7784 |
prep |
of,thirds |
R4524 |
T7786 |
T7787 |
det |
the,Sam68 |
R4525 |
T7787 |
T7785 |
pobj |
Sam68,of |
R4526 |
T7788 |
T7787 |
punct |
−,Sam68 |
R4527 |
T7789 |
T7787 |
punct |
/,Sam68 |
R4528 |
T7790 |
T7787 |
punct |
−,Sam68 |
R4529 |
T7791 |
T7787 |
punct |
", ",Sam68 |
R453 |
T1177 |
T1176 |
pobj |
alterations,by |
R4530 |
T7792 |
T7787 |
cc |
but,Sam68 |
R4531 |
T7793 |
T7792 |
neg |
not,but |
R4532 |
T7794 |
T7795 |
det |
the,Sam68 |
R4533 |
T7795 |
T7796 |
nmod |
Sam68,pups |
R4534 |
T7796 |
T7787 |
conj |
pups,Sam68 |
R4535 |
T7797 |
T7795 |
punct |
+,Sam68 |
R4536 |
T7798 |
T7795 |
punct |
/,Sam68 |
R4537 |
T7799 |
T7795 |
punct |
-,Sam68 |
R4538 |
T7800 |
T7781 |
punct |
", ",killed |
R4539 |
T7801 |
T7781 |
auxpass |
were,killed |
R454 |
T1178 |
T1177 |
prep |
in,alterations |
R4540 |
T7802 |
T7781 |
agent |
by,killed |
R4541 |
T7803 |
T7804 |
poss |
their,mothers |
R4542 |
T7804 |
T7802 |
pobj |
mothers,by |
R4543 |
T7805 |
T7804 |
nmod |
Sam68,mothers |
R4544 |
T7806 |
T7805 |
punct |
+,Sam68 |
R4545 |
T7807 |
T7805 |
punct |
/,Sam68 |
R4546 |
T7808 |
T7805 |
punct |
-,Sam68 |
R4547 |
T7809 |
T7781 |
punct |
.,killed |
R4548 |
T7811 |
T7812 |
det |
These,findings |
R4549 |
T7812 |
T7813 |
nsubj |
findings,suggest |
R455 |
T1179 |
T1180 |
det |
the,availability |
R4550 |
T7814 |
T7815 |
mark |
that,are |
R4551 |
T7815 |
T7813 |
ccomp |
are,suggest |
R4552 |
T7816 |
T7817 |
det |
the,mothers |
R4553 |
T7817 |
T7815 |
nsubj |
mothers,are |
R4554 |
T7818 |
T7815 |
acomp |
able,are |
R4555 |
T7819 |
T7820 |
aux |
to,detect |
R4556 |
T7820 |
T7818 |
xcomp |
detect,able |
R4557 |
T7821 |
T7822 |
det |
a,difference |
R4558 |
T7822 |
T7820 |
dobj |
difference,detect |
R4559 |
T7823 |
T7822 |
amod |
subtle,difference |
R456 |
T1180 |
T1178 |
pobj |
availability,in |
R4560 |
T7824 |
T7822 |
compound |
defect,difference |
R4561 |
T7825 |
T7822 |
punct |
/,difference |
R4562 |
T7826 |
T7827 |
dep |
that,can |
R4563 |
T7827 |
T7822 |
relcl |
can,difference |
R4564 |
T7828 |
T7827 |
nsubj |
we,can |
R4565 |
T7829 |
T7827 |
neg |
not,can |
R4566 |
T7830 |
T7813 |
punct |
.,suggest |
R4567 |
T7832 |
T7833 |
amod |
Adult,mice |
R4568 |
T7833 |
T7838 |
nsubj |
mice,live |
R4569 |
T7834 |
T7833 |
nmod |
Sam68,mice |
R457 |
T1181 |
T1180 |
cc |
and,availability |
R4570 |
T7835 |
T7834 |
punct |
−,Sam68 |
R4571 |
T7836 |
T7834 |
punct |
/,Sam68 |
R4572 |
T7837 |
T7834 |
punct |
−,Sam68 |
R4573 |
T7839 |
T7840 |
det |
a,span |
R4574 |
T7840 |
T7838 |
dobj |
span,live |
R4575 |
T7841 |
T7840 |
amod |
normal,span |
R4576 |
T7842 |
T7840 |
compound |
life,span |
R4577 |
T7843 |
T7840 |
prep |
of,span |
R4578 |
T7844 |
T7845 |
advmod |
approximately,two |
R4579 |
T7845 |
T7846 |
nummod |
two,years |
R458 |
T1182 |
T1180 |
conj |
response,availability |
R4580 |
T7846 |
T7843 |
pobj |
years,of |
R4581 |
T7847 |
T7838 |
punct |
.,live |
R4582 |
T7849 |
T7850 |
det |
The,males |
R4583 |
T7850 |
T7855 |
nsubj |
males,were |
R4584 |
T7851 |
T7850 |
nmod |
Sam68,males |
R4585 |
T7852 |
T7851 |
punct |
−,Sam68 |
R4586 |
T7853 |
T7851 |
punct |
/,Sam68 |
R4587 |
T7854 |
T7851 |
punct |
−,Sam68 |
R4588 |
T7856 |
T7855 |
acomp |
sterile,were |
R4589 |
T7857 |
T7855 |
cc |
and,were |
R459 |
T1183 |
T1180 |
prep |
of,availability |
R4590 |
T7858 |
T7859 |
det |
the,females |
R4591 |
T7859 |
T7864 |
nsubj |
females,provided |
R4592 |
T7860 |
T7859 |
nmod |
Sam68,females |
R4593 |
T7861 |
T7860 |
punct |
−,Sam68 |
R4594 |
T7862 |
T7860 |
punct |
/,Sam68 |
R4595 |
T7863 |
T7860 |
punct |
−,Sam68 |
R4596 |
T7864 |
T7855 |
conj |
provided,were |
R4597 |
T7865 |
T7866 |
amod |
inadequate,care |
R4598 |
T7866 |
T7864 |
dobj |
care,provided |
R4599 |
T7867 |
T7864 |
dative |
to,provided |
R460 |
T1184 |
T1185 |
compound |
bone,cells |
R4600 |
T7868 |
T7869 |
poss |
their,young |
R4601 |
T7869 |
T7867 |
pobj |
young,to |
R4602 |
T7870 |
T7855 |
punct |
", ",were |
R4603 |
T7871 |
T7855 |
cc |
but,were |
R4604 |
T7872 |
T7873 |
det |
the,pups |
R4605 |
T7873 |
T7874 |
nsubjpass |
pups,scattered |
R4606 |
T7874 |
T7855 |
conj |
scattered,were |
R4607 |
T7875 |
T7874 |
auxpass |
were,scattered |
R4608 |
T7876 |
T7874 |
neg |
not,scattered |
R4609 |
T7877 |
T7874 |
cc |
and,scattered |
R461 |
T1185 |
T1183 |
pobj |
cells,of |
R4610 |
T7878 |
T7874 |
conj |
neglected,scattered |
R4611 |
T7879 |
T7880 |
mark |
as,observed |
R4612 |
T7880 |
T7878 |
advcl |
observed,neglected |
R4613 |
T7881 |
T7880 |
prep |
with,observed |
R4614 |
T7882 |
T7883 |
nmod |
FosB,mice |
R4615 |
T7883 |
T7881 |
pobj |
mice,with |
R4616 |
T7884 |
T7882 |
punct |
−,FosB |
R4617 |
T7885 |
T7882 |
punct |
/,FosB |
R4618 |
T7886 |
T7882 |
punct |
−,FosB |
R4619 |
T7887 |
T7888 |
punct |
[,53 |
R462 |
T1186 |
T1180 |
prep |
to,availability |
R4620 |
T7888 |
T7878 |
parataxis |
53,neglected |
R4621 |
T7889 |
T7888 |
punct |
],53 |
R4622 |
T7890 |
T7874 |
punct |
.,scattered |
R4623 |
T7892 |
T7893 |
compound |
Serum,levels |
R4624 |
T7893 |
T7894 |
nsubj |
levels,decreased |
R4625 |
T7894 |
T7897 |
ccomp |
decreased,decreased |
R4626 |
T7895 |
T7893 |
prep |
of,levels |
R4627 |
T7896 |
T7895 |
pobj |
estrogen,of |
R4628 |
T7898 |
T7894 |
prep |
in,decreased |
R4629 |
T7899 |
T7900 |
amod |
aging,females |
R463 |
T1187 |
T1188 |
amod |
circulating,hormones |
R4630 |
T7900 |
T7898 |
pobj |
females,in |
R4631 |
T7901 |
T7900 |
nmod |
Sam68,females |
R4632 |
T7902 |
T7901 |
punct |
−,Sam68 |
R4633 |
T7903 |
T7901 |
punct |
/,Sam68 |
R4634 |
T7904 |
T7901 |
punct |
−,Sam68 |
R4635 |
T7905 |
T7906 |
mark |
as,expected |
R4636 |
T7906 |
T7894 |
advcl |
expected,decreased |
R4637 |
T7907 |
T7897 |
punct |
;,decreased |
R4638 |
T7908 |
T7897 |
advmod |
however,decreased |
R4639 |
T7909 |
T7897 |
punct |
", ",decreased |
R464 |
T1188 |
T1186 |
pobj |
hormones,to |
R4640 |
T7910 |
T7911 |
det |
the,levels |
R4641 |
T7911 |
T7897 |
nsubj |
levels,decreased |
R4642 |
T7912 |
T7911 |
compound |
leptin,levels |
R4643 |
T7913 |
T7897 |
prep |
in,decreased |
R4644 |
T7914 |
T7915 |
amod |
aged,females |
R4645 |
T7915 |
T7913 |
pobj |
females,in |
R4646 |
T7916 |
T7915 |
nmod |
Sam68,females |
R4647 |
T7917 |
T7916 |
punct |
−,Sam68 |
R4648 |
T7918 |
T7916 |
punct |
/,Sam68 |
R4649 |
T7919 |
T7916 |
punct |
−,Sam68 |
R465 |
T1189 |
T1190 |
punct |
[,7 |
R4650 |
T7920 |
T7897 |
punct |
.,decreased |
R4651 |
T7922 |
T7923 |
det |
The,females |
R4652 |
T7923 |
T7929 |
nsubj |
females,were |
R4653 |
T7924 |
T7923 |
amod |
aged,females |
R4654 |
T7925 |
T7923 |
nmod |
Sam68,females |
R4655 |
T7926 |
T7925 |
punct |
−,Sam68 |
R4656 |
T7927 |
T7925 |
punct |
/,Sam68 |
R4657 |
T7928 |
T7925 |
punct |
−,Sam68 |
R4658 |
T7930 |
T7929 |
neg |
not,were |
R4659 |
T7931 |
T7929 |
acomp |
obese,were |
R466 |
T1190 |
T1188 |
parataxis |
7,hormones |
R4660 |
T7932 |
T7929 |
cc |
and,were |
R4661 |
T7933 |
T7934 |
advmod |
actually,weighed |
R4662 |
T7934 |
T7929 |
conj |
weighed,were |
R4663 |
T7935 |
T7934 |
dobj |
less,weighed |
R4664 |
T7936 |
T7935 |
prep |
than,less |
R4665 |
T7937 |
T7938 |
det |
the,controls |
R4666 |
T7938 |
T7936 |
pobj |
controls,than |
R4667 |
T7939 |
T7938 |
compound |
littermate,controls |
R4668 |
T7940 |
T7941 |
punct |
(,see |
R4669 |
T7941 |
T7934 |
parataxis |
see,weighed |
R467 |
T1191 |
T1192 |
punct |
–,9 |
R4670 |
T7942 |
T7941 |
dobj |
Table,see |
R4671 |
T7943 |
T7942 |
nummod |
2,Table |
R4672 |
T7944 |
T7941 |
punct |
),see |
R4673 |
T7945 |
T7929 |
punct |
.,were |
R4674 |
T7947 |
T7948 |
advmod |
Moreover,altered |
R4675 |
T7949 |
T7948 |
punct |
", ",altered |
R4676 |
T7950 |
T7951 |
poss |
their,appetite |
R4677 |
T7951 |
T7948 |
nsubjpass |
appetite,altered |
R4678 |
T7952 |
T7948 |
auxpass |
was,altered |
R4679 |
T7953 |
T7948 |
neg |
not,altered |
R468 |
T1192 |
T1190 |
prep |
9,7 |
R4680 |
T7954 |
T7948 |
prep |
with,altered |
R4681 |
T7955 |
T7954 |
pobj |
aging,with |
R4682 |
T7956 |
T7957 |
punct |
(,N. |
R4683 |
T7957 |
T7948 |
meta |
N.,altered |
R4684 |
T7958 |
T7957 |
nmod |
Torabi,N. |
R4685 |
T7959 |
T7957 |
cc |
and,N. |
R4686 |
T7960 |
T7957 |
conj |
S.,N. |
R4687 |
T7961 |
T7960 |
nmod |
Richard,S. |
R4688 |
T7962 |
T7960 |
punct |
", ",S. |
R4689 |
T7963 |
T7964 |
amod |
unpublished,data |
R469 |
T1193 |
T1190 |
punct |
],7 |
R4690 |
T7964 |
T7960 |
conj |
data,S. |
R4691 |
T7965 |
T7964 |
punct |
),data |
R4692 |
T7966 |
T7948 |
punct |
", ",altered |
R4693 |
T7967 |
T7948 |
advcl |
suggesting,altered |
R4694 |
T7968 |
T7969 |
mark |
that,recreating |
R4695 |
T7969 |
T7967 |
ccomp |
recreating,suggesting |
R4696 |
T7970 |
T7971 |
det |
the,reduction |
R4697 |
T7971 |
T7969 |
nsubj |
reduction,recreating |
R4698 |
T7972 |
T7971 |
amod |
observed,reduction |
R4699 |
T7973 |
T7971 |
compound |
leptin,reduction |
R470 |
T1194 |
T1188 |
cc |
and,hormones |
R4700 |
T7974 |
T7969 |
aux |
was,recreating |
R4701 |
T7975 |
T7969 |
neg |
not,recreating |
R4702 |
T7976 |
T7977 |
dep |
ob,like |
R4703 |
T7977 |
T7981 |
amod |
like,phenotypes |
R4704 |
T7978 |
T7977 |
punct |
/,like |
R4705 |
T7979 |
T7977 |
npadvmod |
ob,like |
R4706 |
T7980 |
T7977 |
punct |
-,like |
R4707 |
T7981 |
T7969 |
dobj |
phenotypes,recreating |
R4708 |
T7982 |
T7981 |
acl |
related,phenotypes |
R4709 |
T7983 |
T7982 |
prep |
to,related |
R471 |
T1195 |
T1196 |
advmod |
locally,derived |
R4710 |
T7984 |
T7983 |
pobj |
weight,to |
R4711 |
T7985 |
T7984 |
punct |
", ",weight |
R4712 |
T7986 |
T7984 |
conj |
appetite,weight |
R4713 |
T7987 |
T7986 |
cc |
and,appetite |
R4714 |
T7988 |
T7989 |
amod |
female,sterility |
R4715 |
T7989 |
T7986 |
conj |
sterility,appetite |
R4716 |
T7990 |
T7991 |
punct |
[,54 |
R4717 |
T7991 |
T7948 |
parataxis |
54,altered |
R4718 |
T7992 |
T7991 |
punct |
],54 |
R4719 |
T7993 |
T7948 |
punct |
.,altered |
R472 |
T1196 |
T1197 |
amod |
derived,factors |
R4720 |
T7995 |
T7996 |
det |
The,phenotyping |
R4721 |
T7996 |
T7998 |
nsubj |
phenotyping,showed |
R4722 |
T7997 |
T7996 |
amod |
skeletal,phenotyping |
R4723 |
T7999 |
T7996 |
prep |
of,phenotyping |
R4724 |
T8000 |
T7999 |
pobj |
cohorts,of |
R4725 |
T8001 |
T8000 |
prep |
of,cohorts |
R4726 |
T8002 |
T8003 |
nmod |
Sam68,mice |
R4727 |
T8003 |
T8001 |
pobj |
mice,of |
R4728 |
T8004 |
T8002 |
punct |
+,Sam68 |
R4729 |
T8005 |
T8002 |
punct |
/,Sam68 |
R473 |
T1197 |
T1188 |
conj |
factors,hormones |
R4730 |
T8006 |
T8002 |
punct |
+,Sam68 |
R4731 |
T8007 |
T8002 |
cc |
and,Sam68 |
R4732 |
T8008 |
T8002 |
conj |
Sam68,Sam68 |
R4733 |
T8009 |
T8008 |
punct |
−,Sam68 |
R4734 |
T8010 |
T8008 |
punct |
/,Sam68 |
R4735 |
T8011 |
T8008 |
punct |
−,Sam68 |
R4736 |
T8012 |
T8013 |
mark |
that,preserved |
R4737 |
T8013 |
T7998 |
ccomp |
preserved,showed |
R4738 |
T8014 |
T8015 |
compound |
bone,mass |
R4739 |
T8015 |
T8013 |
nsubjpass |
mass,preserved |
R474 |
T1198 |
T1197 |
compound |
growth,factors |
R4740 |
T8016 |
T8013 |
auxpass |
was,preserved |
R4741 |
T8017 |
T8013 |
prep |
in,preserved |
R4742 |
T8018 |
T8019 |
amod |
aged,mice |
R4743 |
T8019 |
T8017 |
pobj |
mice,in |
R4744 |
T8020 |
T8019 |
nmod |
Sam68,mice |
R4745 |
T8021 |
T8020 |
punct |
−,Sam68 |
R4746 |
T8022 |
T8020 |
punct |
/,Sam68 |
R4747 |
T8023 |
T8020 |
punct |
−,Sam68 |
R4748 |
T8024 |
T7998 |
punct |
.,showed |
R4749 |
T8026 |
T8027 |
amod |
Traditional,histology |
R475 |
T1199 |
T1200 |
punct |
[,11 |
R4750 |
T8027 |
T8028 |
nsubj |
histology,suggested |
R4751 |
T8029 |
T8027 |
cc |
and,histology |
R4752 |
T8030 |
T8027 |
conj |
histomorphometry,histology |
R4753 |
T8031 |
T8032 |
mark |
that,involved |
R4754 |
T8032 |
T8028 |
ccomp |
involved,suggested |
R4755 |
T8033 |
T8034 |
det |
the,mechanism |
R4756 |
T8034 |
T8032 |
nsubj |
mechanism,involved |
R4757 |
T8035 |
T8032 |
dobj |
preservation,involved |
R4758 |
T8036 |
T8035 |
prep |
of,preservation |
R4759 |
T8037 |
T8038 |
nmod |
osteoblast,activity |
R476 |
T1200 |
T1197 |
parataxis |
11,factors |
R4760 |
T8038 |
T8036 |
pobj |
activity,of |
R4761 |
T8039 |
T8037 |
cc |
and,osteoblast |
R4762 |
T8040 |
T8037 |
conj |
osteoclast,osteoblast |
R4763 |
T8041 |
T8028 |
dep |
.,suggested |
R4764 |
T8043 |
T8044 |
det |
The,role |
R4765 |
T8044 |
T8046 |
nsubj |
role,led |
R4766 |
T8045 |
T8044 |
amod |
documented,role |
R4767 |
T8047 |
T8044 |
prep |
of,role |
R4768 |
T8048 |
T8049 |
det |
the,protein |
R4769 |
T8049 |
T8047 |
pobj |
protein,of |
R477 |
T1201 |
T1200 |
nummod |
10,11 |
R4770 |
T8050 |
T8049 |
nmod |
Sam68,protein |
R4771 |
T8051 |
T8049 |
amod |
regulatory,protein |
R4772 |
T8052 |
T8049 |
punct |
", ",protein |
R4773 |
T8053 |
T8049 |
appos |
Src,protein |
R4774 |
T8054 |
T8044 |
punct |
", ",role |
R4775 |
T8055 |
T8044 |
prep |
in,role |
R4776 |
T8056 |
T8055 |
pobj |
osteopetrosis,in |
R4777 |
T8057 |
T8046 |
dobj |
us,led |
R4778 |
T8058 |
T8059 |
aux |
to,investigate |
R4779 |
T8059 |
T8046 |
xcomp |
investigate,led |
R478 |
T1202 |
T1200 |
punct |
",",11 |
R4780 |
T8060 |
T8061 |
det |
the,morphology |
R4781 |
T8061 |
T8059 |
dobj |
morphology,investigate |
R4782 |
T8062 |
T8061 |
cc |
and,morphology |
R4783 |
T8063 |
T8061 |
conj |
activity,morphology |
R4784 |
T8064 |
T8061 |
prep |
of,morphology |
R4785 |
T8065 |
T8066 |
nmod |
Sam68,osteoclasts |
R4786 |
T8066 |
T8064 |
pobj |
osteoclasts,of |
R4787 |
T8067 |
T8065 |
punct |
−,Sam68 |
R4788 |
T8068 |
T8065 |
punct |
/,Sam68 |
R4789 |
T8069 |
T8065 |
punct |
−,Sam68 |
R479 |
T1203 |
T1200 |
punct |
],11 |
R4790 |
T8070 |
T8071 |
advmod |
ex,vivo |
R4791 |
T8071 |
T8059 |
advmod |
vivo,investigate |
R4792 |
T8072 |
T8046 |
punct |
.,led |
R4793 |
T8074 |
T8075 |
det |
The,kinase |
R4794 |
T8075 |
T8078 |
nsubjpass |
kinase,shown |
R4795 |
T8076 |
T8075 |
compound |
Src,kinase |
R4796 |
T8077 |
T8075 |
compound |
tyrosine,kinase |
R4797 |
T8079 |
T8078 |
auxpass |
was,shown |
R4798 |
T8080 |
T8081 |
aux |
to,play |
R4799 |
T8081 |
T8078 |
xcomp |
play,shown |
R480 |
T1204 |
T1145 |
punct |
.,determined |
R4800 |
T8082 |
T8083 |
det |
a,role |
R4801 |
T8083 |
T8081 |
dobj |
role,play |
R4802 |
T8084 |
T8081 |
prep |
in,play |
R4803 |
T8085 |
T8086 |
compound |
bone,remodeling |
R4804 |
T8086 |
T8084 |
pobj |
remodeling,in |
R4805 |
T8087 |
T8088 |
advmod |
when,died |
R4806 |
T8088 |
T8081 |
advcl |
died,play |
R4807 |
T8089 |
T8090 |
nmod |
Src,mice |
R4808 |
T8090 |
T8088 |
nsubj |
mice,died |
R4809 |
T8091 |
T8089 |
punct |
−,Src |
R481 |
T1206 |
T1207 |
mark |
Whereas,provided |
R4810 |
T8092 |
T8089 |
punct |
/,Src |
R4811 |
T8093 |
T8089 |
punct |
−,Src |
R4812 |
T8094 |
T8088 |
prep |
at,died |
R4813 |
T8095 |
T8096 |
nummod |
6,months |
R4814 |
T8096 |
T8094 |
pobj |
months,at |
R4815 |
T8097 |
T8096 |
prep |
of,months |
R4816 |
T8098 |
T8097 |
pobj |
age,of |
R4817 |
T8099 |
T8088 |
prep |
with,died |
R4818 |
T8100 |
T8101 |
det |
an,phenotype |
R4819 |
T8101 |
T8099 |
pobj |
phenotype,with |
R482 |
T1207 |
T1213 |
advcl |
provided,known |
R4820 |
T8102 |
T8101 |
amod |
osteopetrotic,phenotype |
R4821 |
T8103 |
T8104 |
punct |
[,48 |
R4822 |
T8104 |
T8088 |
parataxis |
48,died |
R4823 |
T8105 |
T8104 |
punct |
],48 |
R4824 |
T8106 |
T8088 |
cc |
and,died |
R4825 |
T8107 |
T8108 |
det |
the,defect |
R4826 |
T8108 |
T8109 |
nsubjpass |
defect,attributed |
R4827 |
T8109 |
T8088 |
conj |
attributed,died |
R4828 |
T8110 |
T8109 |
auxpass |
was,attributed |
R4829 |
T8111 |
T8109 |
prep |
to,attributed |
R483 |
T1208 |
T1209 |
amod |
genetic,based |
R4830 |
T8112 |
T8113 |
amod |
defective,function |
R4831 |
T8113 |
T8111 |
pobj |
function,to |
R4832 |
T8114 |
T8113 |
compound |
osteoclast,function |
R4833 |
T8115 |
T8116 |
punct |
[,55 |
R4834 |
T8116 |
T8109 |
parataxis |
55,attributed |
R4835 |
T8117 |
T8118 |
punct |
−,59 |
R4836 |
T8118 |
T8116 |
prep |
59,55 |
R4837 |
T8119 |
T8116 |
punct |
],55 |
R4838 |
T8120 |
T8078 |
punct |
.,shown |
R4839 |
T8122 |
T8123 |
nsubj |
We,cultured |
R484 |
T1209 |
T1211 |
amod |
based,studies |
R4840 |
T8124 |
T8123 |
advmod |
therefore,cultured |
R4841 |
T8125 |
T8126 |
amod |
mature,osteoclasts |
R4842 |
T8126 |
T8123 |
dobj |
osteoclasts,cultured |
R4843 |
T8127 |
T8126 |
acl |
harvested,osteoclasts |
R4844 |
T8128 |
T8127 |
prep |
from,harvested |
R4845 |
T8129 |
T8130 |
nmod |
Sam68,mice |
R4846 |
T8130 |
T8128 |
pobj |
mice,from |
R4847 |
T8131 |
T8129 |
punct |
+,Sam68 |
R4848 |
T8132 |
T8129 |
punct |
/,Sam68 |
R4849 |
T8133 |
T8129 |
punct |
+,Sam68 |
R485 |
T1210 |
T1209 |
punct |
-,based |
R4850 |
T8134 |
T8129 |
cc |
and,Sam68 |
R4851 |
T8135 |
T8129 |
conj |
Sam68,Sam68 |
R4852 |
T8136 |
T8135 |
punct |
−,Sam68 |
R4853 |
T8137 |
T8135 |
punct |
/,Sam68 |
R4854 |
T8138 |
T8135 |
punct |
−,Sam68 |
R4855 |
T8139 |
T8140 |
advmod |
ex,vivo |
R4856 |
T8140 |
T8123 |
advmod |
vivo,cultured |
R4857 |
T8141 |
T8123 |
prep |
on,cultured |
R4858 |
T8142 |
T8143 |
compound |
dentin,slices |
R4859 |
T8143 |
T8141 |
pobj |
slices,on |
R486 |
T1211 |
T1207 |
nsubj |
studies,provided |
R4860 |
T8144 |
T8145 |
aux |
to,quantify |
R4861 |
T8145 |
T8123 |
advcl |
quantify,cultured |
R4862 |
T8146 |
T8147 |
poss |
their,capacity |
R4863 |
T8147 |
T8145 |
dobj |
capacity,quantify |
R4864 |
T8148 |
T8147 |
amod |
resorptive,capacity |
R4865 |
T8149 |
T8123 |
punct |
.,cultured |
R4866 |
T8151 |
T8152 |
det |
The,fact |
R4867 |
T8152 |
T8153 |
nsubj |
fact,made |
R4868 |
T8154 |
T8155 |
mark |
that,looked |
R4869 |
T8155 |
T8152 |
acl |
looked,fact |
R487 |
T1212 |
T1207 |
aux |
have,provided |
R4870 |
T8156 |
T8157 |
nmod |
Sam68,osteoclasts |
R4871 |
T8157 |
T8155 |
nsubj |
osteoclasts,looked |
R4872 |
T8158 |
T8156 |
punct |
−,Sam68 |
R4873 |
T8159 |
T8156 |
punct |
/,Sam68 |
R4874 |
T8160 |
T8156 |
punct |
−,Sam68 |
R4875 |
T8161 |
T8155 |
cc |
and,looked |
R4876 |
T8162 |
T8155 |
conj |
acted,looked |
R4877 |
T8163 |
T8162 |
prep |
like,acted |
R4878 |
T8164 |
T8165 |
nmod |
Sam68,osteoclasts |
R4879 |
T8165 |
T8163 |
pobj |
osteoclasts,like |
R488 |
T1214 |
T1215 |
amod |
novel,insights |
R4880 |
T8166 |
T8164 |
punct |
+,Sam68 |
R4881 |
T8167 |
T8164 |
punct |
/,Sam68 |
R4882 |
T8168 |
T8164 |
punct |
+,Sam68 |
R4883 |
T8169 |
T8170 |
advmod |
ex,vivo |
R4884 |
T8170 |
T8162 |
advmod |
vivo,acted |
R4885 |
T8171 |
T8170 |
cc |
and,vivo |
R4886 |
T8172 |
T8173 |
advmod |
in,vivo |
R4887 |
T8173 |
T8170 |
conj |
vivo,vivo |
R4888 |
T8174 |
T8175 |
nsubj |
it,unlikely |
R4889 |
T8175 |
T8153 |
ccomp |
unlikely,made |
R489 |
T1215 |
T1207 |
dobj |
insights,provided |
R4890 |
T8176 |
T8177 |
mark |
that,was |
R4891 |
T8177 |
T8175 |
advcl |
was,unlikely |
R4892 |
T8178 |
T8177 |
nsubj |
this,was |
R4893 |
T8179 |
T8180 |
det |
the,source |
R4894 |
T8180 |
T8177 |
attr |
source,was |
R4895 |
T8181 |
T8180 |
amod |
primary,source |
R4896 |
T8182 |
T8180 |
prep |
of,source |
R4897 |
T8183 |
T8184 |
det |
the,difference |
R4898 |
T8184 |
T8182 |
pobj |
difference,of |
R4899 |
T8185 |
T8184 |
prep |
in,difference |
R490 |
T1216 |
T1215 |
prep |
into,insights |
R4900 |
T8186 |
T8187 |
compound |
bone,metabolism |
R4901 |
T8187 |
T8185 |
pobj |
metabolism,in |
R4902 |
T8188 |
T8177 |
prep |
in,was |
R4903 |
T8189 |
T8190 |
nummod |
12,month |
R4904 |
T8190 |
T8192 |
npadvmod |
month,old |
R4905 |
T8191 |
T8190 |
punct |
-,month |
R4906 |
T8192 |
T8194 |
amod |
old,mice |
R4907 |
T8193 |
T8192 |
punct |
-,old |
R4908 |
T8194 |
T8188 |
pobj |
mice,in |
R4909 |
T8195 |
T8194 |
nmod |
Sam68,mice |
R491 |
T1217 |
T1218 |
det |
the,pathways |
R4910 |
T8196 |
T8195 |
punct |
−,Sam68 |
R4911 |
T8197 |
T8195 |
punct |
/,Sam68 |
R4912 |
T8198 |
T8195 |
punct |
−,Sam68 |
R4913 |
T8199 |
T8153 |
punct |
.,made |
R4914 |
T8201 |
T8202 |
det |
The,fact |
R4915 |
T8202 |
T8203 |
nsubj |
fact,suggested |
R4916 |
T8204 |
T8205 |
mark |
that,were |
R4917 |
T8205 |
T8202 |
acl |
were,fact |
R4918 |
T8206 |
T8207 |
det |
the,levels |
R4919 |
T8207 |
T8205 |
nsubj |
levels,were |
R492 |
T1218 |
T1216 |
pobj |
pathways,into |
R4920 |
T8208 |
T8207 |
compound |
CTX,levels |
R4921 |
T8209 |
T8205 |
acomp |
lower,were |
R4922 |
T8210 |
T8205 |
prep |
in,were |
R4923 |
T8211 |
T8212 |
amod |
young,mice |
R4924 |
T8212 |
T8210 |
pobj |
mice,in |
R4925 |
T8213 |
T8211 |
cc |
and,young |
R4926 |
T8214 |
T8211 |
conj |
old,young |
R4927 |
T8215 |
T8212 |
nmod |
Sam68,mice |
R4928 |
T8216 |
T8215 |
punct |
−,Sam68 |
R4929 |
T8217 |
T8215 |
punct |
/,Sam68 |
R493 |
T1219 |
T1220 |
dep |
that,regulate |
R4930 |
T8218 |
T8215 |
punct |
−,Sam68 |
R4931 |
T8219 |
T8220 |
mark |
that,is |
R4932 |
T8220 |
T8203 |
ccomp |
is,suggested |
R4933 |
T8221 |
T8220 |
expl |
there,is |
R4934 |
T8222 |
T8223 |
amod |
reduced,resorption |
R4935 |
T8223 |
T8220 |
attr |
resorption,is |
R4936 |
T8224 |
T8223 |
compound |
bone,resorption |
R4937 |
T8225 |
T8223 |
prep |
compared,resorption |
R4938 |
T8226 |
T8225 |
prep |
with,compared |
R4939 |
T8227 |
T8228 |
amod |
wild,type |
R494 |
T1220 |
T1218 |
relcl |
regulate,pathways |
R4940 |
T8228 |
T8230 |
compound |
type,controls |
R4941 |
T8229 |
T8228 |
punct |
-,type |
R4942 |
T8230 |
T8226 |
pobj |
controls,with |
R4943 |
T8231 |
T8230 |
compound |
littermate,controls |
R4944 |
T8232 |
T8203 |
punct |
.,suggested |
R4945 |
T8234 |
T8235 |
advmod |
However,occurred |
R4946 |
T8236 |
T8235 |
punct |
", ",occurred |
R4947 |
T8237 |
T8238 |
det |
this,reduction |
R4948 |
T8238 |
T8235 |
nsubj |
reduction,occurred |
R4949 |
T8239 |
T8238 |
prep |
in,reduction |
R495 |
T1221 |
T1222 |
compound |
bone,development |
R4950 |
T8240 |
T8241 |
compound |
bone,resorption |
R4951 |
T8241 |
T8239 |
pobj |
resorption,in |
R4952 |
T8242 |
T8235 |
prep |
with,occurred |
R4953 |
T8243 |
T8244 |
amod |
normal,activity |
R4954 |
T8244 |
T8242 |
pobj |
activity,with |
R4955 |
T8245 |
T8244 |
compound |
osteoclast,activity |
R4956 |
T8246 |
T8235 |
punct |
", ",occurred |
R4957 |
T8247 |
T8248 |
mark |
as,assessed |
R4958 |
T8248 |
T8235 |
advcl |
assessed,occurred |
R4959 |
T8249 |
T8248 |
prep |
by,assessed |
R496 |
T1222 |
T1220 |
dobj |
development,regulate |
R4960 |
T8250 |
T8251 |
advmod |
in,vitro |
R4961 |
T8251 |
T8252 |
amod |
vitro,culturing |
R4962 |
T8252 |
T8249 |
pobj |
culturing,by |
R4963 |
T8253 |
T8235 |
punct |
.,occurred |
R4964 |
T8255 |
T8256 |
det |
These,observations |
R4965 |
T8256 |
T8257 |
nsubj |
observations,are |
R4966 |
T8258 |
T8257 |
acomp |
consistent,are |
R4967 |
T8259 |
T8258 |
prep |
with,consistent |
R4968 |
T8260 |
T8261 |
det |
the,mice |
R4969 |
T8261 |
T8266 |
nsubj |
mice,having |
R497 |
T1223 |
T1224 |
punct |
[,12 |
R4970 |
T8262 |
T8261 |
nmod |
Sam68,mice |
R4971 |
T8263 |
T8262 |
punct |
−,Sam68 |
R4972 |
T8264 |
T8262 |
punct |
/,Sam68 |
R4973 |
T8265 |
T8262 |
punct |
−,Sam68 |
R4974 |
T8266 |
T8259 |
pcomp |
having,with |
R4975 |
T8267 |
T8268 |
det |
a,phenotype |
R4976 |
T8268 |
T8266 |
dobj |
phenotype,having |
R4977 |
T8269 |
T8270 |
npadvmod |
youth,like |
R4978 |
T8270 |
T8268 |
amod |
like,phenotype |
R4979 |
T8271 |
T8270 |
punct |
-,like |
R498 |
T1224 |
T1220 |
parataxis |
12,regulate |
R4980 |
T8272 |
T8268 |
compound |
bone,phenotype |
R4981 |
T8273 |
T8257 |
punct |
.,are |
R4982 |
T8275 |
T8276 |
advmod |
However,is |
R4983 |
T8277 |
T8276 |
punct |
", ",is |
R4984 |
T8278 |
T8276 |
nsubj |
it,is |
R4985 |
T8279 |
T8276 |
advmod |
still,is |
R4986 |
T8280 |
T8276 |
acomp |
possible,is |
R4987 |
T8281 |
T8276 |
punct |
", ",is |
R4988 |
T8282 |
T8283 |
mark |
that,manifest |
R4989 |
T8283 |
T8276 |
ccomp |
manifest,is |
R499 |
T1225 |
T1226 |
punct |
–,14 |
R4990 |
T8284 |
T8285 |
det |
a,impairment |
R4991 |
T8285 |
T8283 |
nsubj |
impairment,manifest |
R4992 |
T8286 |
T8285 |
amod |
mild,impairment |
R4993 |
T8287 |
T8285 |
prep |
in,impairment |
R4994 |
T8288 |
T8289 |
nmod |
Sam68,mice |
R4995 |
T8289 |
T8293 |
compound |
mice,function |
R4996 |
T8290 |
T8288 |
punct |
−,Sam68 |
R4997 |
T8291 |
T8288 |
punct |
/,Sam68 |
R4998 |
T8292 |
T8288 |
punct |
−,Sam68 |
R4999 |
T8293 |
T8287 |
pobj |
function,in |
R500 |
T1226 |
T1224 |
prep |
14,12 |
R5000 |
T8294 |
T8293 |
compound |
osteoclast,function |
R5001 |
T8295 |
T8283 |
aux |
may,manifest |
R5002 |
T8296 |
T8283 |
dobj |
itself,manifest |
R5003 |
T8297 |
T8283 |
advmod |
later,manifest |
R5004 |
T8298 |
T8297 |
prep |
in,later |
R5005 |
T8299 |
T8298 |
pobj |
life,in |
R5006 |
T8300 |
T8283 |
prep |
in,manifest |
R5007 |
T8301 |
T8302 |
amod |
overall,accumulation |
R5008 |
T8302 |
T8300 |
pobj |
accumulation,in |
R5009 |
T8303 |
T8302 |
prep |
of,accumulation |
R501 |
T1227 |
T1224 |
punct |
],12 |
R5010 |
T8304 |
T8303 |
pobj |
bone,of |
R5011 |
T8305 |
T8276 |
cc |
and,is |
R5012 |
T8306 |
T8307 |
nsubj |
this,require |
R5013 |
T8307 |
T8276 |
conj |
require,is |
R5014 |
T8308 |
T8307 |
aux |
will,require |
R5015 |
T8309 |
T8310 |
amod |
further,studies |
R5016 |
T8310 |
T8307 |
dobj |
studies,require |
R5017 |
T8311 |
T8310 |
amod |
detailed,studies |
R5018 |
T8312 |
T8276 |
punct |
.,is |
R5019 |
T8314 |
T8315 |
advmod |
Ex,vivo |
R502 |
T1228 |
T1213 |
punct |
", ",known |
R5020 |
T8315 |
T8316 |
amod |
vivo,differentiation |
R5021 |
T8316 |
T8317 |
nsubj |
differentiation,revealed |
R5022 |
T8318 |
T8316 |
prep |
of,differentiation |
R5023 |
T8319 |
T8320 |
amod |
primary,cells |
R5024 |
T8320 |
T8318 |
pobj |
cells,of |
R5025 |
T8321 |
T8322 |
nmod |
bone,marrow |
R5026 |
T8322 |
T8320 |
nmod |
marrow,cells |
R5027 |
T8323 |
T8320 |
amod |
stromal,cells |
R5028 |
T8324 |
T8320 |
punct |
", ",cells |
R5029 |
T8325 |
T8320 |
acl |
harvested,cells |
R503 |
T1229 |
T1230 |
advmod |
relatively,little |
R5030 |
T8326 |
T8325 |
prep |
from,harvested |
R5031 |
T8327 |
T8328 |
nmod |
Sam68,mice |
R5032 |
T8328 |
T8326 |
pobj |
mice,from |
R5033 |
T8329 |
T8327 |
punct |
+,Sam68 |
R5034 |
T8330 |
T8327 |
punct |
/,Sam68 |
R5035 |
T8331 |
T8327 |
punct |
+,Sam68 |
R5036 |
T8332 |
T8327 |
cc |
and,Sam68 |
R5037 |
T8333 |
T8327 |
conj |
Sam68,Sam68 |
R5038 |
T8334 |
T8333 |
punct |
−,Sam68 |
R5039 |
T8335 |
T8333 |
punct |
/,Sam68 |
R504 |
T1230 |
T1213 |
nsubjpass |
little,known |
R5040 |
T8336 |
T8333 |
punct |
−,Sam68 |
R5041 |
T8337 |
T8317 |
punct |
", ",revealed |
R5042 |
T8338 |
T8317 |
prep |
down,revealed |
R5043 |
T8339 |
T8340 |
det |
the,lineage |
R5044 |
T8340 |
T8338 |
pobj |
lineage,down |
R5045 |
T8341 |
T8340 |
compound |
osteoblast,lineage |
R5046 |
T8342 |
T8343 |
det |
an,advantage |
R5047 |
T8343 |
T8317 |
dobj |
advantage,revealed |
R5048 |
T8344 |
T8343 |
amod |
osteogenic,advantage |
R5049 |
T8345 |
T8317 |
prep |
in,revealed |
R505 |
T1231 |
T1213 |
auxpass |
is,known |
R5050 |
T8346 |
T8347 |
det |
the,cultures |
R5051 |
T8347 |
T8345 |
pobj |
cultures,in |
R5052 |
T8348 |
T8347 |
prep |
of,cultures |
R5053 |
T8349 |
T8348 |
pobj |
cells,of |
R5054 |
T8350 |
T8349 |
acl |
derived,cells |
R5055 |
T8351 |
T8350 |
prep |
from,derived |
R5056 |
T8352 |
T8353 |
det |
the,mice |
R5057 |
T8353 |
T8351 |
pobj |
mice,from |
R5058 |
T8354 |
T8353 |
nmod |
Sam68,mice |
R5059 |
T8355 |
T8354 |
punct |
−,Sam68 |
R506 |
T1232 |
T1213 |
prep |
about,known |
R5060 |
T8356 |
T8354 |
punct |
/,Sam68 |
R5061 |
T8357 |
T8354 |
punct |
−,Sam68 |
R5062 |
T8358 |
T8317 |
punct |
.,revealed |
R5063 |
T8360 |
T8361 |
nsubj |
It,be |
R5064 |
T8362 |
T8361 |
aux |
will,be |
R5065 |
T8363 |
T8361 |
acomp |
important,be |
R5066 |
T8364 |
T8365 |
aux |
to,demonstrate |
R5067 |
T8365 |
T8361 |
xcomp |
demonstrate,be |
R5068 |
T8366 |
T8367 |
mark |
that,observed |
R5069 |
T8367 |
T8365 |
ccomp |
observed,demonstrate |
R507 |
T1233 |
T1234 |
det |
the,etiology |
R5070 |
T8368 |
T8369 |
det |
a,effect |
R5071 |
T8369 |
T8367 |
nsubjpass |
effect,observed |
R5072 |
T8370 |
T8369 |
amod |
similar,effect |
R5073 |
T8407 |
T8392 |
prep |
into,differentiated |
R5074 |
T8371 |
T8367 |
auxpass |
is,observed |
R5075 |
T8408 |
T8407 |
pobj |
osteoblasts,into |
R5076 |
T8372 |
T8367 |
advcl |
using,observed |
R5077 |
T8409 |
T8392 |
prep |
with,differentiated |
R5078 |
T8410 |
T8409 |
pobj |
BMP2,with |
R5079 |
T8411 |
T8389 |
punct |
.,observed |
R508 |
T1234 |
T1232 |
pobj |
etiology,about |
R5080 |
T8413 |
T8414 |
poss |
Our,findings |
R5081 |
T8373 |
T8374 |
amod |
primary,cells |
R5082 |
T8414 |
T8415 |
nsubj |
findings,indicate |
R5083 |
T8416 |
T8417 |
mark |
that,develop |
R5084 |
T8374 |
T8372 |
dobj |
cells,using |
R5085 |
T8417 |
T8414 |
advcl |
develop,findings |
R5086 |
T8418 |
T8419 |
amod |
aged,mice |
R5087 |
T8375 |
T8376 |
nmod |
bone,marrow |
R5088 |
T8419 |
T8417 |
nsubj |
mice,develop |
R5089 |
T8420 |
T8419 |
nmod |
Sam68,mice |
R509 |
T1235 |
T1234 |
prep |
of,etiology |
R5090 |
T8421 |
T8420 |
punct |
−,Sam68 |
R5091 |
T8376 |
T8374 |
nmod |
marrow,cells |
R5092 |
T8422 |
T8420 |
punct |
/,Sam68 |
R5093 |
T8423 |
T8420 |
punct |
−,Sam68 |
R5094 |
T8377 |
T8374 |
amod |
stromal,cells |
R5095 |
T8424 |
T8417 |
aux |
do,develop |
R5096 |
T8425 |
T8417 |
neg |
not,develop |
R5097 |
T8426 |
T8427 |
amod |
fatty,marrow |
R5098 |
T8378 |
T8374 |
prep |
from,cells |
R5099 |
T8427 |
T8417 |
dobj |
marrow,develop |
R510 |
T1236 |
T1237 |
npadvmod |
age,related |
R5100 |
T8428 |
T8427 |
compound |
bone,marrow |
R5101 |
T8379 |
T8380 |
amod |
aged,mice |
R5102 |
T8429 |
T8417 |
cc |
and,develop |
R5103 |
T8430 |
T8431 |
mark |
that,have |
R5104 |
T8431 |
T8417 |
conj |
have,develop |
R5105 |
T8380 |
T8378 |
pobj |
mice,from |
R5106 |
T8432 |
T8431 |
nsubj |
MEFs,have |
R5107 |
T8433 |
T8432 |
acl |
derived,MEFs |
R5108 |
T8434 |
T8433 |
prep |
from,derived |
R5109 |
T8381 |
T8380 |
nmod |
Sam68,mice |
R511 |
T1237 |
T1239 |
amod |
related,loss |
R5110 |
T8435 |
T8436 |
nmod |
Sam68,mice |
R5111 |
T8436 |
T8434 |
pobj |
mice,from |
R5112 |
T8382 |
T8381 |
punct |
−,Sam68 |
R5113 |
T8437 |
T8435 |
punct |
−,Sam68 |
R5114 |
T8438 |
T8435 |
punct |
/,Sam68 |
R5115 |
T8383 |
T8381 |
punct |
/,Sam68 |
R5116 |
T8439 |
T8435 |
punct |
−,Sam68 |
R5117 |
T8440 |
T8441 |
amod |
impaired,differentiation |
R5118 |
T8441 |
T8431 |
dobj |
differentiation,have |
R5119 |
T8442 |
T8441 |
compound |
adipocyte,differentiation |
R512 |
T1238 |
T1237 |
punct |
-,related |
R5120 |
T8384 |
T8381 |
punct |
−,Sam68 |
R5121 |
T8443 |
T8415 |
punct |
", ",indicate |
R5122 |
T8444 |
T8445 |
mark |
that,regulates |
R5123 |
T8445 |
T8415 |
ccomp |
regulates,indicate |
R5124 |
T8385 |
T8361 |
punct |
.,be |
R5125 |
T8446 |
T8445 |
nsubj |
Sam68,regulates |
R5126 |
T8447 |
T8448 |
preconj |
both,adipocyte |
R5127 |
T8448 |
T8449 |
nmod |
adipocyte,differentiation |
R5128 |
T8387 |
T8388 |
amod |
Similar,findings |
R5129 |
T8449 |
T8445 |
dobj |
differentiation,regulates |
R513 |
T1239 |
T1235 |
pobj |
loss,of |
R5130 |
T8450 |
T8448 |
cc |
and,adipocyte |
R5131 |
T8451 |
T8448 |
conj |
osteoblast,adipocyte |
R5132 |
T8452 |
T8415 |
punct |
.,indicate |
R5133 |
T8454 |
T8455 |
det |
These,findings |
R5134 |
T8455 |
T8456 |
nsubj |
findings,identify |
R5135 |
T8388 |
T8389 |
nsubjpass |
findings,observed |
R5136 |
T8390 |
T8389 |
auxpass |
were,observed |
R5137 |
T8457 |
T8456 |
dobj |
Sam68,identify |
R5138 |
T8458 |
T8456 |
prep |
as,identify |
R5139 |
T8391 |
T8392 |
advmod |
when,differentiated |
R514 |
T1240 |
T1239 |
compound |
bone,loss |
R5140 |
T8459 |
T8460 |
det |
the,protein |
R5141 |
T8460 |
T8458 |
pobj |
protein,as |
R5142 |
T8392 |
T8389 |
advcl |
differentiated,observed |
R5143 |
T8461 |
T8460 |
amod |
first,protein |
R5144 |
T8462 |
T8463 |
npadvmod |
RNA,binding |
R5145 |
T8463 |
T8460 |
amod |
binding,protein |
R5146 |
T8393 |
T8394 |
amod |
embryonic,cells |
R5147 |
T8464 |
T8465 |
aux |
to,regulate |
R5148 |
T8465 |
T8460 |
advcl |
regulate,protein |
R5149 |
T8394 |
T8392 |
nsubjpass |
cells,differentiated |
R515 |
T1241 |
T1213 |
punct |
.,known |
R5150 |
T8466 |
T8467 |
amod |
mesenchymal,differentiation |
R5151 |
T8467 |
T8465 |
dobj |
differentiation,regulate |
R5152 |
T8468 |
T8467 |
compound |
cell,differentiation |
R5153 |
T8395 |
T8394 |
amod |
mesenchymal,cells |
R5154 |
T8469 |
T8456 |
cc |
and,identify |
R5155 |
T8470 |
T8471 |
det |
the,challenge |
R5156 |
T8471 |
T8472 |
nsubj |
challenge,be |
R5157 |
T8396 |
T8394 |
amod |
multipotential,cells |
R5158 |
T8472 |
T8456 |
conj |
be,identify |
R5159 |
T8473 |
T8472 |
aux |
will,be |
R516 |
T1243 |
T1244 |
amod |
Increased,resorption |
R5160 |
T8474 |
T8475 |
aux |
to,identify |
R5161 |
T8397 |
T8394 |
compound |
progenitor,cells |
R5162 |
T8475 |
T8472 |
xcomp |
identify,be |
R5163 |
T8476 |
T8477 |
det |
the,targets |
R5164 |
T8477 |
T8475 |
dobj |
targets,identify |
R5165 |
T8398 |
T8394 |
appos |
C3H10T1,cells |
R5166 |
T8478 |
T8477 |
amod |
specific,targets |
R5167 |
T8479 |
T8477 |
compound |
RNA,targets |
R5168 |
T8399 |
T8398 |
punct |
/,C3H10T1 |
R5169 |
T8480 |
T8481 |
dep |
that,regulates |
R517 |
T1244 |
T1246 |
nsubjpass |
resorption,associated |
R5170 |
T8400 |
T8398 |
nummod |
2,C3H10T1 |
R5171 |
T8481 |
T8477 |
relcl |
regulates,targets |
R5172 |
T8482 |
T8481 |
nsubj |
it,regulates |
R5173 |
T8483 |
T8481 |
prep |
during,regulates |
R5174 |
T8401 |
T8394 |
acl |
treated,cells |
R5175 |
T8484 |
T8485 |
det |
this,process |
R5176 |
T8485 |
T8483 |
pobj |
process,during |
R5177 |
T8486 |
T8472 |
punct |
.,be |
R5178 |
T8402 |
T8401 |
prep |
with,treated |
R5179 |
T8488 |
T8489 |
det |
The,fact |
R518 |
T1245 |
T1244 |
compound |
bone,resorption |
R5180 |
T8489 |
T8490 |
nsubj |
fact,raises |
R5181 |
T8403 |
T8404 |
compound |
Sam68,shRNA |
R5182 |
T8491 |
T8492 |
mark |
that,altered |
R5183 |
T8492 |
T8489 |
acl |
altered,fact |
R5184 |
T8404 |
T8402 |
pobj |
shRNA,with |
R5185 |
T8405 |
T8392 |
punct |
", ",differentiated |
R5186 |
T8493 |
T8494 |
compound |
osteoblast,function |
R5187 |
T8406 |
T8392 |
auxpass |
were,differentiated |
R5188 |
T8494 |
T8492 |
nsubjpass |
function,altered |
R5189 |
T8495 |
T8492 |
auxpass |
is,altered |
R519 |
T1247 |
T1244 |
prep |
in,resorption |
R5190 |
T8496 |
T8492 |
prep |
in,altered |
R5191 |
T8513 |
T8514 |
compound |
bone,mass |
R5192 |
T8497 |
T8498 |
nmod |
Src,mice |
R5193 |
T8498 |
T8496 |
pobj |
mice,in |
R5194 |
T8499 |
T8497 |
punct |
−,Src |
R5195 |
T8514 |
T8512 |
pobj |
mass,of |
R5196 |
T8500 |
T8497 |
punct |
/,Src |
R5197 |
T8501 |
T8497 |
punct |
−,Src |
R5198 |
T8502 |
T8503 |
punct |
[,61 |
R5199 |
T8515 |
T8511 |
prep |
in,preservation |
R520 |
T1248 |
T1249 |
amod |
elderly,men |
R5200 |
T8503 |
T8492 |
parataxis |
61,altered |
R5201 |
T8504 |
T8503 |
nummod |
60,61 |
R5202 |
T8505 |
T8503 |
punct |
",",61 |
R5203 |
T8516 |
T8517 |
det |
the,mice |
R5204 |
T8506 |
T8503 |
punct |
],61 |
R5205 |
T8507 |
T8508 |
det |
the,possibility |
R5206 |
T8508 |
T8490 |
dobj |
possibility,raises |
R5207 |
T8517 |
T8515 |
pobj |
mice,in |
R5208 |
T8509 |
T8510 |
mark |
that,linked |
R5209 |
T8510 |
T8508 |
acl |
linked,possibility |
R521 |
T1249 |
T1247 |
pobj |
men,in |
R5210 |
T8511 |
T8510 |
nsubjpass |
preservation,linked |
R5211 |
T8518 |
T8517 |
nmod |
Sam68,mice |
R5212 |
T8512 |
T8511 |
prep |
of,preservation |
R5213 |
T8519 |
T8518 |
punct |
−,Sam68 |
R5214 |
T8520 |
T8518 |
punct |
/,Sam68 |
R5215 |
T8521 |
T8518 |
punct |
−,Sam68 |
R5216 |
T8522 |
T8510 |
aux |
could,linked |
R5217 |
T8523 |
T8510 |
auxpass |
be,linked |
R5218 |
T8524 |
T8510 |
prep |
with,linked |
R5219 |
T8619 |
T8617 |
amod |
sympathetic,pathway |
R522 |
T1250 |
T1249 |
cc |
and,men |
R5220 |
T8525 |
T8510 |
cc |
and,linked |
R5221 |
T8620 |
T8619 |
punct |
-,sympathetic |
R5222 |
T8621 |
T8615 |
acomp |
unaltered,is |
R5223 |
T8622 |
T8615 |
prep |
in,is |
R5224 |
T8526 |
T8510 |
conj |
regulated,linked |
R5225 |
T8623 |
T8624 |
nmod |
Sam68,mice |
R5226 |
T8527 |
T8526 |
agent |
by,regulated |
R5227 |
T8624 |
T8622 |
pobj |
mice,in |
R5228 |
T8528 |
T8526 |
dobj |
Src,regulated |
R5229 |
T8625 |
T8623 |
punct |
−,Sam68 |
R523 |
T1251 |
T1249 |
conj |
women,men |
R5230 |
T8626 |
T8623 |
punct |
/,Sam68 |
R5231 |
T8529 |
T8490 |
punct |
.,raises |
R5232 |
T8627 |
T8623 |
punct |
−,Sam68 |
R5233 |
T8531 |
T8532 |
det |
The,pathway |
R5234 |
T8628 |
T8615 |
cc |
and,is |
R5235 |
T8629 |
T8630 |
mark |
that,explain |
R5236 |
T8630 |
T8615 |
conj |
explain,is |
R5237 |
T8631 |
T8632 |
det |
the,lowering |
R5238 |
T8632 |
T8630 |
nsubj |
lowering,explain |
R5239 |
T8633 |
T8632 |
prep |
of,lowering |
R524 |
T1252 |
T1246 |
auxpass |
is,associated |
R5240 |
T8634 |
T8633 |
pobj |
leptin,of |
R5241 |
T8532 |
T8533 |
nsubjpass |
pathway,identified |
R5242 |
T8635 |
T8630 |
aux |
may,explain |
R5243 |
T8636 |
T8637 |
det |
the,levels |
R5244 |
T8637 |
T8630 |
dobj |
levels,explain |
R5245 |
T8534 |
T8535 |
prep |
by,regulates |
R5246 |
T8638 |
T8637 |
amod |
lower,levels |
R5247 |
T8639 |
T8637 |
prep |
of,levels |
R5248 |
T8640 |
T8639 |
pobj |
CTX,of |
R5249 |
T8535 |
T8532 |
relcl |
regulates,pathway |
R525 |
T1253 |
T1246 |
prep |
with,associated |
R5250 |
T8641 |
T8637 |
prep |
in,levels |
R5251 |
T8642 |
T8643 |
det |
the,serum |
R5252 |
T8643 |
T8641 |
pobj |
serum,in |
R5253 |
T8536 |
T8534 |
pobj |
which,by |
R5254 |
T8644 |
T8643 |
prep |
of,serum |
R5255 |
T8645 |
T8646 |
nmod |
Sam68,mice |
R5256 |
T8646 |
T8644 |
pobj |
mice,of |
R5257 |
T8537 |
T8535 |
nsubj |
leptin,regulates |
R5258 |
T8647 |
T8645 |
punct |
−,Sam68 |
R5259 |
T8648 |
T8645 |
punct |
/,Sam68 |
R526 |
T1254 |
T1255 |
det |
a,reduction |
R5260 |
T8649 |
T8645 |
punct |
−,Sam68 |
R5261 |
T8538 |
T8539 |
compound |
bone,resorption |
R5262 |
T8650 |
T8612 |
punct |
.,suggest |
R5263 |
T8652 |
T8653 |
det |
These,findings |
R5264 |
T8539 |
T8535 |
dobj |
resorption,regulates |
R5265 |
T8653 |
T8654 |
nsubj |
findings,suggest |
R5266 |
T8654 |
T8655 |
ccomp |
suggest,results |
R5267 |
T8540 |
T8533 |
auxpass |
was,identified |
R5268 |
T8656 |
T8657 |
mark |
that,regulating |
R5269 |
T8657 |
T8654 |
ccomp |
regulating,suggest |
R527 |
T1255 |
T1253 |
pobj |
reduction,with |
R5270 |
T8541 |
T8542 |
aux |
to,involve |
R5271 |
T8658 |
T8657 |
nsubj |
Sam68,regulating |
R5272 |
T8659 |
T8657 |
aux |
may,regulating |
R5273 |
T8542 |
T8533 |
xcomp |
involve,identified |
R5274 |
T8660 |
T8657 |
aux |
be,regulating |
R5275 |
T8661 |
T8662 |
compound |
bone,metabolism |
R5276 |
T8662 |
T8657 |
dobj |
metabolism,regulating |
R5277 |
T8543 |
T8544 |
det |
the,system |
R5278 |
T8663 |
T8657 |
prep |
at,regulating |
R5279 |
T8664 |
T8665 |
nummod |
two,levels |
R528 |
T1256 |
T1255 |
prep |
in,reduction |
R5280 |
T8665 |
T8663 |
pobj |
levels,at |
R5281 |
T8544 |
T8542 |
dobj |
system,involve |
R5282 |
T8666 |
T8665 |
amod |
different,levels |
R5283 |
T8667 |
T8655 |
punct |
: ,results |
R5284 |
T8668 |
T8669 |
punct |
(,1 |
R5285 |
T8545 |
T8544 |
amod |
sympathetic,system |
R5286 |
T8669 |
T8655 |
meta |
1,results |
R5287 |
T8670 |
T8669 |
punct |
),1 |
R5288 |
T8671 |
T8672 |
det |
the,absence |
R5289 |
T8672 |
T8655 |
nsubj |
absence,results |
R529 |
T1257 |
T1258 |
compound |
bone,mass |
R5290 |
T8673 |
T8672 |
prep |
of,absence |
R5291 |
T8674 |
T8673 |
pobj |
Sam68,of |
R5292 |
T8546 |
T8544 |
amod |
nervous,system |
R5293 |
T8675 |
T8655 |
prep |
in,results |
R5294 |
T8676 |
T8677 |
amod |
lower,levels |
R5295 |
T8677 |
T8675 |
pobj |
levels,in |
R5296 |
T8547 |
T8544 |
acl |
relaying,system |
R5297 |
T8678 |
T8677 |
compound |
leptin,levels |
R5298 |
T8679 |
T8680 |
dep |
that,reduce |
R5299 |
T8680 |
T8677 |
relcl |
reduce,levels |
R530 |
T1258 |
T1256 |
pobj |
mass,in |
R5300 |
T8548 |
T8547 |
prep |
to,relaying |
R5301 |
T8681 |
T8680 |
aux |
may,reduce |
R5302 |
T8682 |
T8683 |
compound |
bone,resorption |
R5303 |
T8683 |
T8680 |
dobj |
resorption,reduce |
R5304 |
T8549 |
T8550 |
det |
the,osteoblasts |
R5305 |
T8684 |
T8680 |
prep |
via,reduce |
R5306 |
T8685 |
T8686 |
det |
the,system |
R5307 |
T8686 |
T8684 |
pobj |
system,via |
R5308 |
T8550 |
T8548 |
pobj |
osteoblasts,to |
R5309 |
T8687 |
T8686 |
amod |
sympathetic,system |
R531 |
T1259 |
T1255 |
cc |
and,reduction |
R5310 |
T8688 |
T8686 |
amod |
nervous,system |
R5311 |
T8689 |
T8655 |
cc |
and,results |
R5312 |
T8551 |
T8547 |
prep |
via,relaying |
R5313 |
T8690 |
T8691 |
punct |
(,2 |
R5314 |
T8691 |
T8692 |
meta |
2,favors |
R5315 |
T8692 |
T8655 |
conj |
favors,results |
R5316 |
T8552 |
T8553 |
det |
the,pathway |
R5317 |
T8693 |
T8691 |
punct |
),2 |
R5318 |
T8694 |
T8695 |
det |
the,absence |
R5319 |
T8695 |
T8692 |
nsubj |
absence,favors |
R532 |
T1260 |
T1261 |
det |
an,increase |
R5320 |
T8553 |
T8551 |
pobj |
pathway,via |
R5321 |
T8696 |
T8695 |
prep |
of,absence |
R5322 |
T8697 |
T8696 |
pobj |
Sam68,of |
R5323 |
T8698 |
T8699 |
nmod |
osteoblast,differentiation |
R5324 |
T8554 |
T8555 |
npadvmod |
β,adrenergic |
R5325 |
T8699 |
T8692 |
dobj |
differentiation,favors |
R5326 |
T8700 |
T8698 |
punct |
", ",osteoblast |
R5327 |
T8701 |
T8702 |
advmod |
rather,than |
R5328 |
T8555 |
T8553 |
amod |
adrenergic,pathway |
R5329 |
T8702 |
T8698 |
cc |
than,osteoblast |
R533 |
T1261 |
T1255 |
conj |
increase,reduction |
R5330 |
T8703 |
T8698 |
conj |
adipocyte,osteoblast |
R5331 |
T8556 |
T8555 |
punct |
-,adrenergic |
R5332 |
T8704 |
T8699 |
punct |
", ",differentiation |
R5333 |
T8705 |
T8655 |
punct |
.,results |
R5334 |
T8557 |
T8547 |
advcl |
leading,relaying |
R5335 |
T8707 |
T8708 |
prep |
In,define |
R5336 |
T8558 |
T8557 |
prep |
to,leading |
R5337 |
T8709 |
T8707 |
pobj |
conclusion,In |
R5338 |
T8710 |
T8708 |
punct |
", ",define |
R5339 |
T8711 |
T8712 |
poss |
our,data |
R534 |
T1262 |
T1261 |
prep |
in,increase |
R5340 |
T8559 |
T8560 |
det |
the,release |
R5341 |
T8560 |
T8558 |
pobj |
release,to |
R5342 |
T8712 |
T8708 |
nsubj |
data,define |
R5343 |
T8713 |
T8714 |
det |
a,role |
R5344 |
T8714 |
T8708 |
dobj |
role,define |
R5345 |
T8561 |
T8560 |
prep |
of,release |
R5346 |
T8715 |
T8714 |
amod |
physiologic,role |
R5347 |
T8716 |
T8714 |
prep |
for,role |
R5348 |
T8562 |
T8563 |
compound |
growth,factors |
R5349 |
T8717 |
T8716 |
pobj |
Sam68,for |
R535 |
T1263 |
T1264 |
amod |
circulating,levels |
R5350 |
T8718 |
T8714 |
prep |
in,role |
R5351 |
T8563 |
T8561 |
pobj |
factors,of |
R5352 |
T8564 |
T8563 |
prep |
including,factors |
R5353 |
T8719 |
T8720 |
compound |
bone,metabolism |
R5354 |
T8565 |
T8564 |
pobj |
RANKL,including |
R5355 |
T8720 |
T8718 |
pobj |
metabolism,in |
R5356 |
T8566 |
T8567 |
dep |
that,causes |
R5357 |
T8721 |
T8720 |
cc |
and,metabolism |
R5358 |
T8722 |
T8723 |
nmod |
bone,marrow |
R5359 |
T8567 |
T8563 |
relcl |
causes,factors |
R536 |
T1264 |
T1262 |
pobj |
levels,in |
R5360 |
T8723 |
T8724 |
nmod |
marrow,differentiation |
R5361 |
T8724 |
T8720 |
conj |
differentiation,metabolism |
R5362 |
T8568 |
T8569 |
det |
the,osteoclasts |
R5363 |
T8569 |
T8570 |
nsubj |
osteoclasts,thrive |
R5364 |
T8725 |
T8726 |
amod |
mesenchymal,cell |
R5365 |
T8570 |
T8567 |
ccomp |
thrive,causes |
R5366 |
T8726 |
T8724 |
compound |
cell,differentiation |
R5367 |
T8727 |
T8726 |
compound |
stem,cell |
R5368 |
T8571 |
T8570 |
aux |
to,thrive |
R5369 |
T8728 |
T8708 |
punct |
.,define |
R537 |
T1265 |
T1264 |
prep |
of,levels |
R5370 |
T8730 |
T8731 |
det |
The,phenotype |
R5371 |
T8572 |
T8573 |
punct |
[,8 |
R5372 |
T8731 |
T8733 |
nsubj |
phenotype,imply |
R5373 |
T8732 |
T8731 |
compound |
bone,phenotype |
R5374 |
T8573 |
T8533 |
parataxis |
8,identified |
R5375 |
T8734 |
T8731 |
acl |
observed,phenotype |
R5376 |
T8735 |
T8734 |
prep |
in,observed |
R5377 |
T8574 |
T8573 |
punct |
",",8 |
R5378 |
T8736 |
T8737 |
nmod |
Sam68,mice |
R5379 |
T8737 |
T8735 |
pobj |
mice,in |
R538 |
T1266 |
T1267 |
compound |
bone,biomarkers |
R5380 |
T8738 |
T8736 |
punct |
−,Sam68 |
R5381 |
T8575 |
T8573 |
appos |
18,8 |
R5382 |
T8739 |
T8736 |
punct |
/,Sam68 |
R5383 |
T8740 |
T8736 |
punct |
−,Sam68 |
R5384 |
T8576 |
T8577 |
punct |
–,20 |
R5385 |
T8741 |
T8742 |
mark |
that,prevent |
R5386 |
T8742 |
T8733 |
ccomp |
prevent,imply |
R5387 |
T8743 |
T8742 |
nsubj |
inhibitors,prevent |
R5388 |
T8577 |
T8575 |
prep |
20,18 |
R5389 |
T8744 |
T8743 |
prep |
of,inhibitors |
R539 |
T1267 |
T1265 |
pobj |
biomarkers,of |
R5390 |
T8745 |
T8744 |
pobj |
Sam68,of |
R5391 |
T8746 |
T8742 |
aux |
could,prevent |
R5392 |
T8747 |
T8748 |
npadvmod |
age,related |
R5393 |
T8748 |
T8750 |
amod |
related,loss |
R5394 |
T8749 |
T8748 |
punct |
-,related |
R5395 |
T8578 |
T8573 |
punct |
],8 |
R5396 |
T8750 |
T8742 |
dobj |
loss,prevent |
R5397 |
T8751 |
T8750 |
compound |
bone,loss |
R5398 |
T8579 |
T8533 |
punct |
.,identified |
R5399 |
T8752 |
T8733 |
punct |
.,imply |
R540 |
T1268 |
T1269 |
punct |
[,15 |
R5400 |
T8754 |
T8755 |
advmod |
Furthermore,suggest |
R5401 |
T8581 |
T8582 |
det |
The,lowering |
R5402 |
T8756 |
T8755 |
punct |
", ",suggest |
R5403 |
T8757 |
T8758 |
det |
the,results |
R5404 |
T8758 |
T8755 |
nsubj |
results,suggest |
R5405 |
T8582 |
T8583 |
nsubj |
lowering,is |
R5406 |
T8759 |
T8755 |
advmod |
also,suggest |
R5407 |
T8760 |
T8761 |
mark |
that,influence |
R5408 |
T8761 |
T8755 |
ccomp |
influence,suggest |
R5409 |
T8584 |
T8582 |
prep |
of,lowering |
R541 |
T1269 |
T1246 |
parataxis |
15,associated |
R5410 |
T8762 |
T8763 |
compound |
Sam68,levels |
R5411 |
T8763 |
T8761 |
nsubj |
levels,influence |
R5412 |
T8764 |
T8763 |
compound |
expression,levels |
R5413 |
T8765 |
T8763 |
punct |
", ",levels |
R5414 |
T8585 |
T8586 |
compound |
leptin,levels |
R5415 |
T8766 |
T8763 |
conj |
hypomorphism,levels |
R5416 |
T8767 |
T8766 |
punct |
", ",hypomorphism |
R5417 |
T8768 |
T8766 |
cc |
and,hypomorphism |
R5418 |
T8586 |
T8584 |
pobj |
levels,of |
R5419 |
T8769 |
T8766 |
conj |
mutations,hypomorphism |
R542 |
T1270 |
T1269 |
punct |
],15 |
R5420 |
T8770 |
T8763 |
prep |
in,levels |
R5421 |
T8771 |
T8770 |
pobj |
humans,in |
R5422 |
T8587 |
T8582 |
prep |
in,lowering |
R5423 |
T8772 |
T8761 |
aux |
may,influence |
R5424 |
T8773 |
T8761 |
dobj |
susceptibility,influence |
R5425 |
T8774 |
T8773 |
prep |
to,susceptibility |
R5426 |
T8588 |
T8589 |
amod |
aged,mice |
R5427 |
T8775 |
T8776 |
compound |
marrow,adipocyte |
R5428 |
T8776 |
T8777 |
compound |
adipocyte,accumulation |
R5429 |
T8777 |
T8774 |
pobj |
accumulation,to |
R543 |
T1271 |
T1246 |
punct |
.,associated |
R5430 |
T8589 |
T8587 |
pobj |
mice,in |
R5431 |
T8778 |
T8777 |
cc |
and,accumulation |
R5432 |
T8779 |
T8777 |
conj |
osteoporosis,accumulation |
R5433 |
T8780 |
T8755 |
punct |
.,suggest |
R5434 |
T8590 |
T8589 |
nmod |
Sam68,mice |
R5435 |
T8782 |
T8783 |
poss |
Our,findings |
R5436 |
T8783 |
T8784 |
nsubj |
findings,identify |
R5437 |
T8591 |
T8590 |
punct |
−,Sam68 |
R5438 |
T8785 |
T8784 |
advmod |
also,identify |
R5439 |
T8786 |
T8787 |
det |
a,model |
R544 |
T1273 |
T1274 |
det |
These,changes |
R5440 |
T8592 |
T8590 |
punct |
/,Sam68 |
R5441 |
T8787 |
T8784 |
dobj |
model,identify |
R5442 |
T8788 |
T8787 |
amod |
new,model |
R5443 |
T8789 |
T8787 |
compound |
animal,model |
R5444 |
T8790 |
T8791 |
aux |
to,study |
R5445 |
T8791 |
T8787 |
advcl |
study,model |
R5446 |
T8792 |
T8793 |
amod |
aging,loss |
R5447 |
T8593 |
T8590 |
punct |
−,Sam68 |
R5448 |
T8793 |
T8791 |
dobj |
loss,study |
R5449 |
T8794 |
T8793 |
compound |
bone,loss |
R545 |
T1274 |
T1275 |
nsubjpass |
changes,attributed |
R5450 |
T8594 |
T8583 |
acomp |
consistent,is |
R5451 |
T8795 |
T8784 |
punct |
.,identify |
R5452 |
T8595 |
T8594 |
prep |
with,consistent |
R5453 |
T8596 |
T8597 |
det |
these,mice |
R5454 |
T8597 |
T8598 |
nsubj |
mice,having |
R5455 |
T8598 |
T8595 |
pcomp |
having,with |
R5456 |
T8599 |
T8600 |
det |
a,mass |
R5457 |
T8600 |
T8598 |
dobj |
mass,having |
R5458 |
T8601 |
T8600 |
amod |
high,mass |
R5459 |
T8602 |
T8600 |
compound |
bone,mass |
R546 |
T1276 |
T1275 |
aux |
have,attributed |
R5460 |
T8603 |
T8598 |
prep |
compared,having |
R5461 |
T8604 |
T8603 |
prep |
with,compared |
R5462 |
T8605 |
T8606 |
poss |
their,littermates |
R5463 |
T8606 |
T8604 |
pobj |
littermates,with |
R5464 |
T8607 |
T8606 |
amod |
aged,littermates |
R5465 |
T8608 |
T8583 |
punct |
.,is |
R5466 |
T8610 |
T8611 |
det |
These,data |
R5467 |
T8611 |
T8612 |
nsubj |
data,suggest |
R5468 |
T8613 |
T8612 |
aux |
would,suggest |
R5469 |
T8614 |
T8615 |
mark |
that,is |
R547 |
T1277 |
T1275 |
auxpass |
been,attributed |
R5470 |
T8615 |
T8612 |
advcl |
is,suggest |
R5471 |
T8616 |
T8617 |
det |
the,pathway |
R5472 |
T8617 |
T8615 |
nsubj |
pathway,is |
R5473 |
T8618 |
T8619 |
npadvmod |
leptin,sympathetic |
R5474 |
T8863 |
T8864 |
amod |
Histologic,analyses |
R5475 |
T8865 |
T8863 |
punct |
", ",Histologic |
R5476 |
T8866 |
T8863 |
conj |
immunohistochemical,Histologic |
R5477 |
T8867 |
T8866 |
punct |
", ",immunohistochemical |
R5478 |
T8868 |
T8866 |
cc |
and,immunohistochemical |
R5479 |
T8869 |
T8866 |
conj |
histomorphometric,immunohistochemical |
R548 |
T1278 |
T1275 |
advmod |
primarily,attributed |
R5480 |
T8870 |
T8864 |
punct |
.,analyses |
R5481 |
T8872 |
T8873 |
det |
All,analyses |
R5482 |
T8873 |
T8874 |
nsubjpass |
analyses,performed |
R5483 |
T8875 |
T8874 |
auxpass |
were,performed |
R5484 |
T8876 |
T8877 |
advmod |
essentially,described |
R5485 |
T8877 |
T8874 |
advcl |
described,performed |
R5486 |
T8878 |
T8877 |
mark |
as,described |
R5487 |
T8879 |
T8877 |
advmod |
previously,described |
R5488 |
T8880 |
T8881 |
punct |
[,63 |
R5489 |
T8881 |
T8874 |
parataxis |
63,performed |
R549 |
T1279 |
T1275 |
prep |
to,attributed |
R5490 |
T8882 |
T8881 |
nummod |
62,63 |
R5491 |
T8883 |
T8881 |
punct |
",",63 |
R5492 |
T8884 |
T8881 |
punct |
],63 |
R5493 |
T8885 |
T8874 |
punct |
.,performed |
R5494 |
T8887 |
T8888 |
advmod |
Briefly,removed |
R5495 |
T8889 |
T8888 |
punct |
", ",removed |
R5496 |
T8890 |
T8891 |
amod |
embryonic,mice |
R5497 |
T8891 |
T8888 |
nsubjpass |
mice,removed |
R5498 |
T8892 |
T8888 |
auxpass |
were,removed |
R5499 |
T8893 |
T8888 |
prep |
from,removed |
R550 |
T1280 |
T1281 |
amod |
nutritional,deficits |
R5500 |
T8894 |
T8895 |
amod |
timed,dams |
R5501 |
T8895 |
T8893 |
pobj |
dams,from |
R5502 |
T8896 |
T8895 |
amod |
pregnant,dams |
R5503 |
T8897 |
T8888 |
prep |
at,removed |
R5504 |
T8898 |
T8897 |
pobj |
E14.5,at |
R5505 |
T8899 |
T8898 |
cc |
and,E14.5 |
R5506 |
T8900 |
T8898 |
conj |
E16.5,E14.5 |
R5507 |
T8901 |
T8888 |
cc |
and,removed |
R5508 |
T8902 |
T8888 |
conj |
fixed,removed |
R5509 |
T8903 |
T8902 |
advcl |
intact,fixed |
R551 |
T1281 |
T1279 |
pobj |
deficits,to |
R5510 |
T8904 |
T8902 |
prep |
for,fixed |
R5511 |
T8905 |
T8906 |
nummod |
36,h |
R5512 |
T8906 |
T8904 |
pobj |
h,for |
R5513 |
T8907 |
T8902 |
prep |
in,fixed |
R5514 |
T8908 |
T8909 |
nummod |
4,% |
R5515 |
T8909 |
T8910 |
compound |
%,paraformaldehyde |
R5516 |
T8910 |
T8907 |
pobj |
paraformaldehyde,in |
R5517 |
T8911 |
T8902 |
punct |
", ",fixed |
R5518 |
T8912 |
T8902 |
conj |
rinsed,fixed |
R5519 |
T8913 |
T8912 |
advmod |
thoroughly,rinsed |
R552 |
T1282 |
T1281 |
acl |
resulting,deficits |
R5520 |
T8914 |
T8912 |
prep |
in,rinsed |
R5521 |
T8915 |
T8914 |
pobj |
PBS,in |
R5522 |
T8916 |
T8912 |
punct |
", ",rinsed |
R5523 |
T8917 |
T8912 |
cc |
and,rinsed |
R5524 |
T8918 |
T8912 |
conj |
processed,rinsed |
R5525 |
T8919 |
T8918 |
prep |
for,processed |
R5526 |
T8920 |
T8921 |
compound |
paraffin,embedding |
R5527 |
T8921 |
T8919 |
pobj |
embedding,for |
R5528 |
T8922 |
T8888 |
punct |
.,removed |
R5529 |
T8924 |
T8925 |
amod |
Serial,sections |
R553 |
T1283 |
T1282 |
prep |
in,resulting |
R5530 |
T8925 |
T8929 |
nsubjpass |
sections,cut |
R5531 |
T8926 |
T8927 |
nummod |
4,μm |
R5532 |
T8927 |
T8925 |
compound |
μm,sections |
R5533 |
T8928 |
T8927 |
punct |
-,μm |
R5534 |
T8930 |
T8929 |
auxpass |
were,cut |
R5535 |
T8931 |
T8929 |
prep |
on,cut |
R5536 |
T8932 |
T8933 |
det |
a,microtome |
R5537 |
T8933 |
T8931 |
pobj |
microtome,on |
R5538 |
T8934 |
T8933 |
amod |
modified,microtome |
R5539 |
T8935 |
T8936 |
nmod |
Leica,RM |
R554 |
T1284 |
T1283 |
pobj |
alterations,in |
R5540 |
T8936 |
T8933 |
nmod |
RM,microtome |
R5541 |
T8937 |
T8936 |
nummod |
2155,RM |
R5542 |
T8938 |
T8933 |
amod |
rotary,microtome |
R5543 |
T8939 |
T8940 |
punct |
(,Microsystems |
R5544 |
T8940 |
T8933 |
parataxis |
Microsystems,microtome |
R5545 |
T8941 |
T8940 |
compound |
Leica,Microsystems |
R5546 |
T8942 |
T8940 |
punct |
", ",Microsystems |
R5547 |
T8943 |
T8944 |
compound |
Richmond,Hill |
R5548 |
T8944 |
T8940 |
npadvmod |
Hill,Microsystems |
R5549 |
T8945 |
T8940 |
punct |
", ",Microsystems |
R555 |
T1285 |
T1284 |
prep |
in,alterations |
R5550 |
T8946 |
T8940 |
npadvmod |
Ontario,Microsystems |
R5551 |
T8947 |
T8940 |
punct |
", ",Microsystems |
R5552 |
T8948 |
T8940 |
npadvmod |
Canada,Microsystems |
R5553 |
T8949 |
T8940 |
punct |
),Microsystems |
R5554 |
T8950 |
T8929 |
punct |
", ",cut |
R5555 |
T8951 |
T8929 |
conj |
stained,cut |
R5556 |
T8952 |
T8951 |
prep |
with,stained |
R5557 |
T8953 |
T8954 |
det |
a,dilution |
R5558 |
T8954 |
T8952 |
pobj |
dilution,with |
R5559 |
T8955 |
T8954 |
nummod |
1,dilution |
R556 |
T1286 |
T1287 |
det |
the,axis |
R5560 |
T8956 |
T8957 |
punct |
:,600 |
R5561 |
T8957 |
T8955 |
prep |
600,1 |
R5562 |
T8958 |
T8954 |
prep |
of,dilution |
R5563 |
T8959 |
T8960 |
det |
the,antibody |
R5564 |
T8960 |
T8958 |
pobj |
antibody,of |
R5565 |
T8961 |
T8960 |
nmod |
AD1,antibody |
R5566 |
T8962 |
T8960 |
amod |
anti-Sam68,antibody |
R5567 |
T8963 |
T8964 |
punct |
[,46 |
R5568 |
T8964 |
T8951 |
parataxis |
46,stained |
R5569 |
T8965 |
T8964 |
punct |
],46 |
R557 |
T1287 |
T1285 |
pobj |
axis,in |
R5570 |
T8966 |
T8951 |
cc |
and,stained |
R5571 |
T8967 |
T8951 |
conj |
counterstained,stained |
R5572 |
T8968 |
T8967 |
prep |
with,counterstained |
R5573 |
T8969 |
T8970 |
preconj |
either,green |
R5574 |
T8970 |
T8968 |
pobj |
green,with |
R5575 |
T8971 |
T8970 |
compound |
methyl,green |
R5576 |
T8972 |
T8970 |
cc |
or,green |
R5577 |
T8973 |
T8970 |
conj |
hematoxylin,green |
R5578 |
T8974 |
T8929 |
punct |
.,cut |
R5579 |
T8976 |
T8977 |
amod |
Adult,mice |
R558 |
T1288 |
T1289 |
nmod |
parathyroid,hormone |
R5580 |
T8977 |
T8978 |
nsubj |
mice,given |
R5581 |
T8979 |
T8978 |
aux |
were,given |
R5582 |
T8980 |
T8981 |
det |
an,injection |
R5583 |
T8981 |
T8978 |
dobj |
injection,given |
R5584 |
T8982 |
T8981 |
amod |
intraperitoneal,injection |
R5585 |
T8983 |
T8981 |
prep |
of,injection |
R5586 |
T8984 |
T8985 |
nummod |
30,mg |
R5587 |
T8985 |
T8986 |
nmod |
mg,calcein |
R5588 |
T8986 |
T8983 |
pobj |
calcein,of |
R5589 |
T8987 |
T8988 |
punct |
/,kg |
R559 |
T1289 |
T1287 |
nmod |
hormone,axis |
R5590 |
T8988 |
T8985 |
prep |
kg,mg |
R5591 |
T8989 |
T8978 |
prep |
at,given |
R5592 |
T8990 |
T8991 |
nummod |
7,days |
R5593 |
T8991 |
T8989 |
pobj |
days,at |
R5594 |
T8992 |
T8978 |
cc |
and,given |
R5595 |
T8993 |
T8994 |
nummod |
30,mg |
R5596 |
T8994 |
T8995 |
nmod |
mg,tetracycline |
R5597 |
T8995 |
T8978 |
conj |
tetracycline,given |
R5598 |
T8996 |
T8997 |
punct |
/,kg |
R5599 |
T8997 |
T8994 |
prep |
kg,mg |
R560 |
T1290 |
T1289 |
punct |
–,hormone |
R5600 |
T8998 |
T8995 |
prep |
at,tetracycline |
R5601 |
T8999 |
T9000 |
nummod |
2,days |
R5602 |
T9000 |
T8998 |
pobj |
days,at |
R5603 |
T9001 |
T9002 |
amod |
prior,to |
R5604 |
T9002 |
T9000 |
prep |
to,days |
R5605 |
T9003 |
T9002 |
pobj |
sacrifice,to |
R5606 |
T9004 |
T9005 |
aux |
to,label |
R5607 |
T9005 |
T8978 |
advcl |
label,given |
R5608 |
T9006 |
T9007 |
advmod |
actively,mineralizing |
R5609 |
T9007 |
T9008 |
amod |
mineralizing,surfaces |
R561 |
T1291 |
T1292 |
compound |
vitamin,D |
R5610 |
T9008 |
T9005 |
dobj |
surfaces,label |
R5611 |
T9009 |
T8978 |
punct |
.,given |
R5612 |
T9011 |
T9012 |
prep |
After,embedded |
R5613 |
T9013 |
T9014 |
advmod |
overnight,fixation |
R5614 |
T9014 |
T9011 |
pobj |
fixation,After |
R5615 |
T9015 |
T9014 |
prep |
in,fixation |
R5616 |
T9016 |
T9017 |
nummod |
4,% |
R5617 |
T9017 |
T9018 |
compound |
%,paraformaldehyde |
R5618 |
T9018 |
T9015 |
pobj |
paraformaldehyde,in |
R5619 |
T9019 |
T9014 |
cc |
and,fixation |
R562 |
T1292 |
T1289 |
appos |
D,hormone |
R5620 |
T9020 |
T9014 |
conj |
rinsing,fixation |
R5621 |
T9021 |
T9020 |
prep |
in,rinsing |
R5622 |
T9022 |
T9021 |
pobj |
PBS,in |
R5623 |
T9023 |
T9012 |
punct |
", ",embedded |
R5624 |
T9024 |
T9025 |
det |
the,femur |
R5625 |
T9025 |
T9012 |
nsubjpass |
femur,embedded |
R5626 |
T9026 |
T9025 |
amod |
left,femur |
R5627 |
T9027 |
T9025 |
cc |
and,femur |
R5628 |
T9028 |
T9025 |
conj |
tibia,femur |
R5629 |
T9029 |
T9012 |
auxpass |
were,embedded |
R563 |
T1293 |
T1294 |
punct |
[,16 |
R5630 |
T9030 |
T9012 |
prep |
in,embedded |
R5631 |
T9031 |
T9030 |
pobj |
polymethylmethacrylate,in |
R5632 |
T9032 |
T9031 |
punct |
(,polymethylmethacrylate |
R5633 |
T9033 |
T9031 |
appos |
MMA,polymethylmethacrylate |
R5634 |
T9034 |
T9031 |
punct |
),polymethylmethacrylate |
R5635 |
T9035 |
T9031 |
cc |
or,polymethylmethacrylate |
R5636 |
T9036 |
T9037 |
det |
a,mixture |
R5637 |
T9037 |
T9031 |
conj |
mixture,polymethylmethacrylate |
R5638 |
T9038 |
T9037 |
prep |
of,mixture |
R5639 |
T9039 |
T9040 |
nummod |
50,% |
R564 |
T1294 |
T1281 |
parataxis |
16,deficits |
R5640 |
T9040 |
T9041 |
compound |
%,MMA |
R5641 |
T9041 |
T9038 |
pobj |
MMA,of |
R5642 |
T9042 |
T9041 |
cc |
and,MMA |
R5643 |
T9043 |
T9044 |
nummod |
50,% |
R5644 |
T9044 |
T9041 |
conj |
%,MMA |
R5645 |
T9045 |
T9044 |
appos |
glycolmethacrylate,% |
R5646 |
T9046 |
T9045 |
punct |
(,glycolmethacrylate |
R5647 |
T9047 |
T9045 |
appos |
GMA,glycolmethacrylate |
R5648 |
T9048 |
T9037 |
punct |
),mixture |
R5649 |
T9049 |
T9012 |
punct |
.,embedded |
R565 |
T1295 |
T1294 |
punct |
],16 |
R5650 |
T9051 |
T9052 |
amod |
Serial,sections |
R5651 |
T9052 |
T9059 |
nsubjpass |
sections,left |
R5652 |
T9053 |
T9054 |
quantmod |
4,6 |
R5653 |
T9054 |
T9057 |
nummod |
6,μm |
R5654 |
T9055 |
T9054 |
punct |
-,6 |
R5655 |
T9056 |
T9054 |
quantmod |
to,6 |
R5656 |
T9057 |
T9052 |
compound |
μm,sections |
R5657 |
T9058 |
T9057 |
punct |
-,μm |
R5658 |
T9060 |
T9052 |
prep |
of,sections |
R5659 |
T9061 |
T9062 |
npadvmod |
MMA,embedded |
R566 |
T1296 |
T1279 |
punct |
", ",to |
R5660 |
T9062 |
T9064 |
amod |
embedded,tissues |
R5661 |
T9063 |
T9062 |
punct |
-,embedded |
R5662 |
T9064 |
T9060 |
pobj |
tissues,of |
R5663 |
T9065 |
T9059 |
auxpass |
were,left |
R5664 |
T9066 |
T9059 |
oprd |
unstained,left |
R5665 |
T9067 |
T9059 |
cc |
or,left |
R5666 |
T9068 |
T9059 |
conj |
stained,left |
R5667 |
T9069 |
T9068 |
prep |
with,stained |
R5668 |
T9070 |
T9071 |
compound |
von,Kossa |
R5669 |
T9071 |
T9069 |
pobj |
Kossa,with |
R567 |
T1297 |
T1279 |
conj |
to,to |
R5670 |
T9072 |
T9071 |
cc |
and,Kossa |
R5671 |
T9073 |
T9074 |
compound |
toluidine,blue |
R5672 |
T9074 |
T9071 |
conj |
blue,Kossa |
R5673 |
T9075 |
T9069 |
cc |
or,with |
R5674 |
T9076 |
T9069 |
conj |
with,with |
R5675 |
T9077 |
T9078 |
compound |
toluidine,blue |
R5676 |
T9078 |
T9076 |
pobj |
blue,with |
R5677 |
T9079 |
T9078 |
advmod |
alone,blue |
R5678 |
T9080 |
T9059 |
punct |
", ",left |
R5679 |
T9081 |
T9082 |
mark |
while,stained |
R568 |
T1298 |
T1299 |
amod |
gonadal,deficiency |
R5680 |
T9082 |
T9059 |
advcl |
stained,left |
R5681 |
T9083 |
T9084 |
nummod |
4,μm |
R5682 |
T9084 |
T9086 |
compound |
μm,sections |
R5683 |
T9085 |
T9084 |
punct |
-,μm |
R5684 |
T9086 |
T9082 |
nsubjpass |
sections,stained |
R5685 |
T9087 |
T9088 |
compound |
MMA,GMA |
R5686 |
T9088 |
T9086 |
compound |
GMA,sections |
R5687 |
T9089 |
T9088 |
punct |
-,GMA |
R5688 |
T9090 |
T9082 |
auxpass |
were,stained |
R5689 |
T9091 |
T9082 |
prep |
for,stained |
R569 |
T1299 |
T1297 |
pobj |
deficiency,to |
R5690 |
T9092 |
T9093 |
nmod |
TRAP,activity |
R5691 |
T9093 |
T9091 |
pobj |
activity,for |
R5692 |
T9094 |
T9092 |
cc |
and,TRAP |
R5693 |
T9095 |
T9092 |
conj |
ALP,TRAP |
R5694 |
T9096 |
T9059 |
punct |
.,left |
R5695 |
T9098 |
T9099 |
nsubjpass |
Images,captured |
R5696 |
T9100 |
T9099 |
auxpass |
were,captured |
R5697 |
T9101 |
T9099 |
advcl |
using,captured |
R5698 |
T9102 |
T9103 |
det |
a,microscope |
R5699 |
T9103 |
T9101 |
dobj |
microscope,using |
R570 |
T1300 |
T1299 |
compound |
hormone,deficiency |
R5700 |
T9104 |
T9105 |
compound |
Leica,DMR |
R5701 |
T9105 |
T9103 |
compound |
DMR,microscope |
R5702 |
T9106 |
T9107 |
punct |
(,Microsystems |
R5703 |
T9107 |
T9103 |
parataxis |
Microsystems,microscope |
R5704 |
T9108 |
T9107 |
compound |
Leica,Microsystems |
R5705 |
T9109 |
T9107 |
punct |
),Microsystems |
R5706 |
T9110 |
T9103 |
acl |
equipped,microscope |
R5707 |
T9111 |
T9110 |
prep |
with,equipped |
R5708 |
T9112 |
T9113 |
det |
a,camera |
R5709 |
T9113 |
T9111 |
pobj |
camera,with |
R571 |
T1301 |
T1302 |
punct |
[,17 |
R5710 |
T9114 |
T9113 |
nmod |
Retiga,camera |
R5711 |
T9115 |
T9114 |
nummod |
1300,Retiga |
R5712 |
T9116 |
T9117 |
punct |
(,Qimaging |
R5713 |
T9117 |
T9113 |
parataxis |
Qimaging,camera |
R5714 |
T9118 |
T9117 |
punct |
", ",Qimaging |
R5715 |
T9119 |
T9117 |
npadvmod |
Burnaby,Qimaging |
R5716 |
T9120 |
T9117 |
punct |
", ",Qimaging |
R5717 |
T9121 |
T9122 |
compound |
British,Columbia |
R5718 |
T9122 |
T9117 |
npadvmod |
Columbia,Qimaging |
R5719 |
T9123 |
T9117 |
punct |
", ",Qimaging |
R572 |
T1302 |
T1299 |
parataxis |
17,deficiency |
R5720 |
T9124 |
T9117 |
npadvmod |
Canada,Qimaging |
R5721 |
T9125 |
T9117 |
punct |
),Qimaging |
R5722 |
T9126 |
T9099 |
cc |
and,captured |
R5723 |
T9127 |
T9128 |
det |
the,data |
R5724 |
T9128 |
T9131 |
nsubj |
data,obtained |
R5725 |
T9129 |
T9128 |
amod |
primary,data |
R5726 |
T9130 |
T9128 |
amod |
histomorphometric,data |
R5727 |
T9131 |
T9099 |
conj |
obtained,captured |
R5728 |
T9132 |
T9131 |
advcl |
using,obtained |
R5729 |
T9133 |
T9134 |
compound |
Bioquant,Prime |
R573 |
T1303 |
T1302 |
punct |
],17 |
R5730 |
T9134 |
T9136 |
compound |
Prime,software |
R5731 |
T9135 |
T9134 |
compound |
Nova,Prime |
R5732 |
T9136 |
T9132 |
dobj |
software,using |
R5733 |
T9137 |
T9138 |
compound |
image,analysis |
R5734 |
T9138 |
T9136 |
compound |
analysis,software |
R5735 |
T9139 |
T9140 |
punct |
(,Corp |
R5736 |
T9140 |
T9136 |
parataxis |
Corp,software |
R5737 |
T9141 |
T9140 |
compound |
Bioquant,Corp |
R5738 |
T9142 |
T9143 |
compound |
Image,Analysis |
R5739 |
T9143 |
T9140 |
compound |
Analysis,Corp |
R574 |
T1304 |
T1297 |
punct |
", ",to |
R5740 |
T9144 |
T9140 |
punct |
", ",Corp |
R5741 |
T9145 |
T9140 |
npadvmod |
Nashville,Corp |
R5742 |
T9146 |
T9140 |
punct |
", ",Corp |
R5743 |
T9147 |
T9140 |
npadvmod |
Tennessee,Corp |
R5744 |
T9148 |
T9140 |
punct |
", ",Corp |
R5745 |
T9149 |
T9150 |
compound |
United,States |
R5746 |
T9150 |
T9140 |
npadvmod |
States,Corp |
R5747 |
T9151 |
T9140 |
punct |
),Corp |
R5748 |
T9152 |
T9131 |
punct |
.,obtained |
R5749 |
T9154 |
T9155 |
nsubj |
Nomenclature,conform |
R575 |
T1305 |
T1297 |
conj |
to,to |
R5750 |
T9156 |
T9154 |
cc |
and,Nomenclature |
R5751 |
T9157 |
T9154 |
conj |
abbreviations,Nomenclature |
R5752 |
T9158 |
T9155 |
prep |
to,conform |
R5753 |
T9159 |
T9158 |
pobj |
those,to |
R5754 |
T9160 |
T9159 |
acl |
recommended,those |
R5755 |
T9161 |
T9160 |
agent |
by,recommended |
R5756 |
T9162 |
T9163 |
det |
the,Society |
R5757 |
T9163 |
T9161 |
pobj |
Society,by |
R5758 |
T9164 |
T9163 |
compound |
American,Society |
R5759 |
T9165 |
T9163 |
prep |
for,Society |
R576 |
T1306 |
T1307 |
compound |
leptin,levels |
R5760 |
T9166 |
T9167 |
nmod |
Bone,Research |
R5761 |
T9167 |
T9165 |
pobj |
Research,for |
R5762 |
T9168 |
T9166 |
cc |
and,Bone |
R5763 |
T9169 |
T9166 |
conj |
Mineral,Bone |
R5764 |
T9170 |
T9171 |
punct |
[,50 |
R5765 |
T9171 |
T9155 |
parataxis |
50,conform |
R5766 |
T9172 |
T9171 |
punct |
],50 |
R5767 |
T9173 |
T9155 |
punct |
.,conform |
R577 |
T1307 |
T1305 |
pobj |
levels,to |
R5772 |
T9294 |
T9293 |
prep |
of,Generation |
R5773 |
T9295 |
T9294 |
pobj |
mice,of |
R5774 |
T9296 |
T9295 |
prep |
with,mice |
R5775 |
T9297 |
T9298 |
amod |
targeted,disruption |
R5776 |
T9298 |
T9296 |
pobj |
disruption,with |
R5777 |
T9299 |
T9298 |
prep |
of,disruption |
R5778 |
T9300 |
T9301 |
det |
the,gene |
R5779 |
T9301 |
T9299 |
pobj |
gene,of |
R578 |
T1308 |
T1307 |
cc |
and,levels |
R5780 |
T9302 |
T9301 |
compound |
sam68,gene |
R5781 |
T9303 |
T9293 |
punct |
.,Generation |
R5782 |
T9305 |
T9306 |
det |
A,clone |
R5783 |
T9306 |
T9309 |
nsubjpass |
clone,isolated |
R5784 |
T9307 |
T9306 |
compound |
λ,clone |
R5785 |
T9308 |
T9306 |
compound |
bacteriophage,clone |
R5786 |
T9310 |
T9306 |
acl |
encompassing,clone |
R5787 |
T9311 |
T9312 |
nmod |
Sam68,3 |
R5788 |
T9312 |
T9310 |
dobj |
3,encompassing |
R5789 |
T9313 |
T9312 |
nmod |
exons,3 |
R579 |
T1309 |
T1310 |
det |
the,system |
R5790 |
T9314 |
T9312 |
prep |
to,3 |
R5791 |
T9315 |
T9314 |
pobj |
9,to |
R5792 |
T9316 |
T9309 |
auxpass |
was,isolated |
R5793 |
T9317 |
T9309 |
prep |
from,isolated |
R5794 |
T9318 |
T9319 |
det |
a,library |
R5795 |
T9319 |
T9317 |
pobj |
library,from |
R5796 |
T9320 |
T9321 |
nummod |
129,SvJ |
R5797 |
T9321 |
T9319 |
nmod |
SvJ,library |
R5798 |
T9322 |
T9321 |
punct |
/,SvJ |
R5799 |
T9323 |
T9319 |
amod |
genomic,library |
R580 |
T1310 |
T1307 |
conj |
system,levels |
R5800 |
T9324 |
T9309 |
advcl |
using,isolated |
R5801 |
T9325 |
T9326 |
amod |
full,length |
R5802 |
T9326 |
T9328 |
compound |
length,cDNA |
R5803 |
T9327 |
T9326 |
punct |
-,length |
R5804 |
T9328 |
T9324 |
dobj |
cDNA,using |
R5805 |
T9329 |
T9328 |
compound |
Sam68,cDNA |
R5806 |
T9330 |
T9324 |
prep |
as,using |
R5807 |
T9331 |
T9332 |
det |
a,probe |
R5808 |
T9332 |
T9330 |
pobj |
probe,as |
R5809 |
T9333 |
T9309 |
punct |
.,isolated |
R581 |
T1311 |
T1310 |
amod |
sympathetic,system |
R5810 |
T9335 |
T9336 |
npadvmod |
XbaI,digested |
R5811 |
T9336 |
T9338 |
amod |
digested,fragments |
R5812 |
T9337 |
T9336 |
punct |
-,digested |
R5813 |
T9338 |
T9342 |
nsubjpass |
fragments,subcloned |
R5814 |
T9339 |
T9338 |
nmod |
Sam68,fragments |
R5815 |
T9340 |
T9338 |
amod |
genomic,fragments |
R5816 |
T9341 |
T9338 |
compound |
DNA,fragments |
R5817 |
T9343 |
T9338 |
prep |
of,fragments |
R5818 |
T9344 |
T9345 |
nummod |
4,kb |
R5819 |
T9345 |
T9343 |
pobj |
kb,of |
R582 |
T1312 |
T1310 |
amod |
nervous,system |
R5820 |
T9346 |
T9347 |
punct |
(,encompassing |
R5821 |
T9347 |
T9345 |
parataxis |
encompassing,kb |
R5822 |
T9348 |
T9347 |
dobj |
exon,encompassing |
R5823 |
T9349 |
T9348 |
nummod |
4,exon |
R5824 |
T9350 |
T9348 |
cc |
and,exon |
R5825 |
T9351 |
T9348 |
conj |
part,exon |
R5826 |
T9352 |
T9351 |
prep |
of,part |
R5827 |
T9353 |
T9352 |
pobj |
exon,of |
R5828 |
T9354 |
T9353 |
nummod |
5,exon |
R5829 |
T9355 |
T9347 |
punct |
),encompassing |
R583 |
T1313 |
T1314 |
punct |
[,8 |
R5830 |
T9356 |
T9345 |
cc |
and,kb |
R5831 |
T9357 |
T9345 |
conj |
3kb,kb |
R5832 |
T9358 |
T9359 |
punct |
(,spanning |
R5833 |
T9359 |
T9357 |
parataxis |
spanning,3kb |
R5834 |
T9360 |
T9359 |
dobj |
part,spanning |
R5835 |
T9361 |
T9360 |
prep |
of,part |
R5836 |
T9362 |
T9361 |
pobj |
exon,of |
R5837 |
T9363 |
T9362 |
nummod |
5,exon |
R5838 |
T9364 |
T9360 |
cc |
and,part |
R5839 |
T9365 |
T9360 |
conj |
exon,part |
R584 |
T1314 |
T1310 |
parataxis |
8,system |
R5840 |
T9366 |
T9365 |
nummod |
6,exon |
R5841 |
T9367 |
T9359 |
punct |
),spanning |
R5842 |
T9368 |
T9342 |
auxpass |
were,subcloned |
R5843 |
T9369 |
T9342 |
prep |
in,subcloned |
R5844 |
T9370 |
T9371 |
compound |
Bluescript,SK |
R5845 |
T9371 |
T9369 |
pobj |
SK,in |
R5846 |
T9372 |
T9342 |
advcl |
resulting,subcloned |
R5847 |
T9373 |
T9372 |
prep |
in,resulting |
R5848 |
T9374 |
T9373 |
pobj |
pBS4,in |
R5849 |
T9375 |
T9374 |
cc |
and,pBS4 |
R585 |
T1315 |
T1314 |
punct |
",",8 |
R5850 |
T9376 |
T9374 |
conj |
pBS3,pBS4 |
R5851 |
T9377 |
T9372 |
punct |
", ",resulting |
R5852 |
T9378 |
T9372 |
advmod |
respectively,resulting |
R5853 |
T9379 |
T9342 |
punct |
.,subcloned |
R5854 |
T9381 |
T9382 |
det |
A,fragment |
R5855 |
T9382 |
T9384 |
nsubjpass |
fragment,amplified |
R5856 |
T9383 |
T9382 |
compound |
DNA,fragment |
R5857 |
T9385 |
T9384 |
auxpass |
was,amplified |
R5858 |
T9386 |
T9384 |
prep |
from,amplified |
R5859 |
T9387 |
T9386 |
pobj |
pBS4,from |
R586 |
T1316 |
T1314 |
appos |
18,8 |
R5860 |
T9388 |
T9384 |
prep |
with,amplified |
R5861 |
T9389 |
T9390 |
det |
the,oligonucleotides |
R5862 |
T9390 |
T9388 |
pobj |
oligonucleotides,with |
R5863 |
T9391 |
T9390 |
amod |
following,oligonucleotides |
R5864 |
T9392 |
T9393 |
punct |
(,5 |
R5865 |
T9393 |
T9390 |
parataxis |
5,oligonucleotides |
R5866 |
T9394 |
T9393 |
punct |
′,5 |
R5867 |
T9395 |
T9393 |
punct |
-,5 |
R5868 |
T9396 |
T9397 |
compound |
AAT,C |
R5869 |
T9397 |
T9393 |
appos |
C,5 |
R587 |
T1317 |
T1318 |
punct |
–,20 |
R5870 |
T9398 |
T9397 |
compound |
GTC,C |
R5871 |
T9399 |
T9397 |
compound |
TAG,C |
R5872 |
T9400 |
T9397 |
compound |
AAA,C |
R5873 |
T9401 |
T9397 |
compound |
CAA,C |
R5874 |
T9402 |
T9397 |
compound |
CTC,C |
R5875 |
T9403 |
T9397 |
compound |
ATA,C |
R5876 |
T9404 |
T9397 |
compound |
TAC,C |
R5877 |
T9405 |
T9397 |
compound |
AGA,C |
R5878 |
T9406 |
T9393 |
punct |
-,5 |
R5879 |
T9407 |
T9393 |
nummod |
3,5 |
R588 |
T1318 |
T1316 |
prep |
20,18 |
R5880 |
T9408 |
T9393 |
punct |
′,5 |
R5881 |
T9409 |
T9393 |
punct |
),5 |
R5882 |
T9410 |
T9390 |
cc |
and,oligonucleotides |
R5883 |
T9411 |
T9412 |
det |
the,primer |
R5884 |
T9412 |
T9390 |
conj |
primer,oligonucleotides |
R5885 |
T9413 |
T9412 |
amod |
universal,primer |
R5886 |
T9414 |
T9384 |
punct |
.,amplified |
R5887 |
T9416 |
T9417 |
det |
The,fragment |
R5888 |
T9417 |
T9425 |
nsubjpass |
fragment,subcloned |
R5889 |
T9418 |
T9419 |
npadvmod |
XbaI,digested |
R589 |
T1319 |
T1314 |
punct |
],8 |
R5890 |
T9419 |
T9417 |
amod |
digested,fragment |
R5891 |
T9420 |
T9419 |
punct |
-,digested |
R5892 |
T9421 |
T9422 |
nummod |
1,kb |
R5893 |
T9422 |
T9417 |
compound |
kb,fragment |
R5894 |
T9423 |
T9422 |
punct |
-,kb |
R5895 |
T9424 |
T9417 |
compound |
DNA,fragment |
R5896 |
T9426 |
T9425 |
auxpass |
was,subcloned |
R5897 |
T9427 |
T9425 |
prep |
in,subcloned |
R5898 |
T9428 |
T9429 |
det |
the,site |
R5899 |
T9429 |
T9427 |
pobj |
site,in |
R590 |
T1320 |
T1305 |
punct |
", ",to |
R5900 |
T9430 |
T9429 |
compound |
XbaI,site |
R5901 |
T9431 |
T9429 |
prep |
of,site |
R5902 |
T9432 |
T9431 |
pobj |
pPNT,of |
R5903 |
T9433 |
T9434 |
punct |
(,gift |
R5904 |
T9434 |
T9432 |
parataxis |
gift,pPNT |
R5905 |
T9435 |
T9434 |
det |
a,gift |
R5906 |
T9436 |
T9434 |
prep |
from,gift |
R5907 |
T9437 |
T9438 |
compound |
Andrew,Karaplis |
R5908 |
T9438 |
T9436 |
pobj |
Karaplis,from |
R5909 |
T9439 |
T9438 |
punct |
", ",Karaplis |
R591 |
T1321 |
T1305 |
cc |
and,to |
R5910 |
T9440 |
T9441 |
compound |
McGill,University |
R5911 |
T9441 |
T9438 |
npadvmod |
University,Karaplis |
R5912 |
T9442 |
T9438 |
punct |
", ",Karaplis |
R5913 |
T9443 |
T9438 |
npadvmod |
Montréal,Karaplis |
R5914 |
T9444 |
T9438 |
punct |
", ",Karaplis |
R5915 |
T9445 |
T9438 |
npadvmod |
Quebec,Karaplis |
R5916 |
T9446 |
T9438 |
punct |
", ",Karaplis |
R5917 |
T9447 |
T9438 |
npadvmod |
Canada,Karaplis |
R5918 |
T9448 |
T9434 |
punct |
),gift |
R5919 |
T9449 |
T9425 |
punct |
.,subcloned |
R592 |
T1322 |
T1305 |
conj |
to,to |
R5920 |
T9451 |
T9452 |
det |
The,fragment |
R5921 |
T9452 |
T9456 |
nsubjpass |
fragment,amplified |
R5922 |
T9453 |
T9454 |
nummod |
3,kb |
R5923 |
T9454 |
T9452 |
compound |
kb,fragment |
R5924 |
T9455 |
T9454 |
punct |
-,kb |
R5925 |
T9457 |
T9452 |
prep |
from,fragment |
R5926 |
T9458 |
T9457 |
pobj |
pBS3,from |
R5927 |
T9459 |
T9456 |
auxpass |
was,amplified |
R5928 |
T9460 |
T9456 |
prep |
by,amplified |
R5929 |
T9461 |
T9460 |
pobj |
PCR,by |
R593 |
T1323 |
T1322 |
pobj |
alterations,to |
R5930 |
T9462 |
T9461 |
prep |
with,PCR |
R5931 |
T9463 |
T9462 |
punct |
(,with |
R5932 |
T9464 |
T9462 |
pobj |
5,with |
R5933 |
T9465 |
T9464 |
punct |
′,5 |
R5934 |
T9466 |
T9464 |
punct |
-,5 |
R5935 |
T9467 |
T9468 |
compound |
GGG,G |
R5936 |
T9468 |
T9464 |
appos |
G,5 |
R5937 |
T9469 |
T9468 |
compound |
ATG,G |
R5938 |
T9470 |
T9468 |
compound |
CGG,G |
R5939 |
T9471 |
T9468 |
compound |
CCG,G |
R594 |
T1324 |
T1323 |
prep |
in,alterations |
R5940 |
T9472 |
T9468 |
compound |
CTC,G |
R5941 |
T9473 |
T9468 |
compound |
TAG,G |
R5942 |
T9474 |
T9468 |
compound |
AAT,G |
R5943 |
T9475 |
T9468 |
compound |
TGT,G |
R5944 |
T9476 |
T9468 |
compound |
CCT,G |
R5945 |
T9477 |
T9468 |
compound |
ACT,G |
R5946 |
T9478 |
T9468 |
compound |
TGA,G |
R5947 |
T9479 |
T9468 |
compound |
ACG,G |
R5948 |
T9480 |
T9464 |
punct |
-,5 |
R5949 |
T9481 |
T9464 |
nummod |
3,5 |
R595 |
T1325 |
T1326 |
compound |
bone,cell |
R5950 |
T9482 |
T9464 |
punct |
',5 |
R5951 |
T9483 |
T9464 |
punct |
),5 |
R5952 |
T9484 |
T9464 |
cc |
and,5 |
R5953 |
T9485 |
T9486 |
punct |
(,5 |
R5954 |
T9486 |
T9464 |
conj |
5,5 |
R5955 |
T9487 |
T9486 |
punct |
′,5 |
R5956 |
T9488 |
T9486 |
punct |
-,5 |
R5957 |
T9489 |
T9490 |
compound |
CGG,A |
R5958 |
T9490 |
T9486 |
appos |
A,5 |
R5959 |
T9491 |
T9490 |
compound |
TGG,A |
R596 |
T1326 |
T1327 |
compound |
cell,apoptosis |
R5960 |
T9492 |
T9490 |
compound |
CGG,A |
R5961 |
T9493 |
T9490 |
compound |
CCG,A |
R5962 |
T9494 |
T9490 |
compound |
CTG,A |
R5963 |
T9495 |
T9490 |
compound |
TCG,A |
R5964 |
T9496 |
T9490 |
compound |
ACC,A |
R5965 |
T9497 |
T9490 |
compound |
TGA,A |
R5966 |
T9498 |
T9490 |
compound |
GTA,A |
R5967 |
T9499 |
T9490 |
compound |
ACA,A |
R5968 |
T9500 |
T9490 |
compound |
TTT,A |
R5969 |
T9501 |
T9490 |
compound |
CTT,A |
R597 |
T1327 |
T1324 |
pobj |
apoptosis,in |
R5970 |
T9502 |
T9486 |
punct |
-,5 |
R5971 |
T9503 |
T9486 |
nummod |
3,5 |
R5972 |
T9504 |
T9486 |
punct |
′,5 |
R5973 |
T9505 |
T9456 |
punct |
),amplified |
R5974 |
T9506 |
T9456 |
cc |
and,amplified |
R5975 |
T9507 |
T9456 |
conj |
subcloned,amplified |
R5976 |
T9508 |
T9507 |
prep |
in,subcloned |
R5977 |
T9509 |
T9510 |
det |
the,site |
R5978 |
T9510 |
T9508 |
pobj |
site,in |
R5979 |
T9511 |
T9510 |
compound |
NotI,site |
R598 |
T1328 |
T1329 |
punct |
[,21 |
R5980 |
T9512 |
T9510 |
prep |
of,site |
R5981 |
T9513 |
T9512 |
pobj |
pPNT,of |
R5982 |
T9514 |
T9456 |
punct |
.,amplified |
R5983 |
T9516 |
T9517 |
det |
The,vector |
R5984 |
T9517 |
T9519 |
nsubj |
vector,replaces |
R5985 |
T9518 |
T9517 |
compound |
targeting,vector |
R5986 |
T9520 |
T9521 |
compound |
pPNT,Sam68 |
R5987 |
T9521 |
T9517 |
appos |
Sam68,vector |
R5988 |
T9522 |
T9521 |
punct |
-,Sam68 |
R5989 |
T9523 |
T9519 |
dobj |
exon,replaces |
R599 |
T1329 |
T1323 |
parataxis |
21,alterations |
R5990 |
T9524 |
T9523 |
nummod |
4,exon |
R5991 |
T9525 |
T9523 |
cc |
and,exon |
R5992 |
T9526 |
T9523 |
conj |
part,exon |
R5993 |
T9527 |
T9526 |
prep |
of,part |
R5994 |
T9528 |
T9527 |
pobj |
exon,of |
R5995 |
T9529 |
T9528 |
nummod |
5,exon |
R5996 |
T9530 |
T9519 |
prep |
with,replaces |
R5997 |
T9531 |
T9532 |
det |
a,cassette |
R5998 |
T9532 |
T9530 |
pobj |
cassette,with |
R5999 |
T9533 |
T9534 |
npadvmod |
neomycin,resistant |
R600 |
T1330 |
T1329 |
punct |
],21 |
R6000 |
T9534 |
T9532 |
amod |
resistant,cassette |
R6001 |
T9535 |
T9534 |
punct |
-,resistant |
R6002 |
T9536 |
T9532 |
compound |
gene,cassette |
R6003 |
T9537 |
T9519 |
punct |
.,replaces |
R6004 |
T9539 |
T9540 |
det |
An,site |
R6005 |
T9540 |
T9542 |
nsubjpass |
site,introduced |
R6006 |
T9541 |
T9540 |
compound |
SalI,site |
R6007 |
T9543 |
T9542 |
auxpass |
was,introduced |
R6008 |
T9544 |
T9542 |
prep |
at,introduced |
R6009 |
T9545 |
T9546 |
det |
the,end |
R601 |
T1331 |
T1275 |
punct |
.,attributed |
R6010 |
T9546 |
T9544 |
pobj |
end,at |
R6011 |
T9547 |
T9546 |
nummod |
3,end |
R6012 |
T9548 |
T9547 |
punct |
′,3 |
R6013 |
T9549 |
T9546 |
prep |
of,end |
R6014 |
T9550 |
T9551 |
det |
the,fragment |
R6015 |
T9551 |
T9549 |
pobj |
fragment,of |
R6016 |
T9552 |
T9553 |
nummod |
3,kb |
R6017 |
T9553 |
T9551 |
compound |
kb,fragment |
R6018 |
T9554 |
T9553 |
punct |
-,kb |
R6019 |
T9555 |
T9551 |
compound |
DNA,fragment |
R602 |
T1333 |
T1334 |
compound |
Bone,loss |
R6020 |
T9556 |
T9542 |
cc |
and,introduced |
R6021 |
T9557 |
T9558 |
auxpass |
was,used |
R6022 |
T9558 |
T9542 |
conj |
used,introduced |
R6023 |
T9559 |
T9560 |
aux |
to,linearize |
R6024 |
T9560 |
T9558 |
advcl |
linearize,used |
R6025 |
T9561 |
T9562 |
det |
the,plasmid |
R6026 |
T9562 |
T9560 |
dobj |
plasmid,linearize |
R6027 |
T9563 |
T9560 |
prep |
for,linearize |
R6028 |
T9564 |
T9563 |
pobj |
electroporation,for |
R6029 |
T9565 |
T9564 |
prep |
into,electroporation |
R603 |
T1334 |
T1335 |
nsubjpass |
loss,attributed |
R6030 |
T9566 |
T9567 |
amod |
embryonic,stem |
R6031 |
T9567 |
T9568 |
nmod |
stem,cells |
R6032 |
T9568 |
T9565 |
pobj |
cells,into |
R6033 |
T9569 |
T9567 |
punct |
(,stem |
R6034 |
T9570 |
T9567 |
appos |
ES,stem |
R6035 |
T9571 |
T9568 |
punct |
),cells |
R6036 |
T9572 |
T9542 |
punct |
.,introduced |
R6037 |
T9574 |
T9575 |
advmod |
Approximately,"1,000" |
R6038 |
T9575 |
T9576 |
nummod |
"1,000",colonies |
R6039 |
T9576 |
T9578 |
nsubjpass |
colonies,screened |
R604 |
T1336 |
T1334 |
prep |
in,loss |
R6040 |
T9577 |
T9576 |
compound |
ES,colonies |
R6041 |
T9579 |
T9578 |
auxpass |
were,screened |
R6042 |
T9580 |
T9578 |
cc |
and,screened |
R6043 |
T9581 |
T9582 |
nummod |
two,clones |
R6044 |
T9582 |
T9583 |
nsubjpass |
clones,identified |
R6045 |
T9583 |
T9578 |
conj |
identified,screened |
R6046 |
T9584 |
T9583 |
auxpass |
were,identified |
R6047 |
T9585 |
T9586 |
dep |
that,contained |
R6048 |
T9586 |
T9583 |
ccomp |
contained,identified |
R6049 |
T9587 |
T9588 |
det |
the,Sam68 |
R605 |
T1337 |
T1338 |
det |
the,elderly |
R6050 |
T9588 |
T9589 |
compound |
Sam68,allele |
R6051 |
T9589 |
T9586 |
dobj |
allele,contained |
R6052 |
T9590 |
T9589 |
compound |
mutant,allele |
R6053 |
T9591 |
T9583 |
punct |
", ",identified |
R6054 |
T9592 |
T9593 |
mark |
as,determined |
R6055 |
T9593 |
T9583 |
advcl |
determined,identified |
R6056 |
T9594 |
T9593 |
prep |
by,determined |
R6057 |
T9595 |
T9596 |
compound |
Southern,blotting |
R6058 |
T9596 |
T9594 |
pobj |
blotting,by |
R6059 |
T9597 |
T9583 |
punct |
.,identified |
R606 |
T1338 |
T1336 |
pobj |
elderly,in |
R6060 |
T9599 |
T9600 |
amod |
Targeted,cells |
R6061 |
T9600 |
T9602 |
nsubjpass |
cells,injected |
R6062 |
T9601 |
T9600 |
compound |
ES,cells |
R6063 |
T9603 |
T9602 |
auxpass |
were,injected |
R6064 |
T9604 |
T9602 |
prep |
into,injected |
R6065 |
T9605 |
T9606 |
nummod |
3.5,day |
R6066 |
T9606 |
T9608 |
npadvmod |
day,old |
R6067 |
T9607 |
T9606 |
punct |
-,day |
R6068 |
T9608 |
T9610 |
amod |
old,blastocysts |
R6069 |
T9609 |
T9608 |
punct |
-,old |
R607 |
T1339 |
T1335 |
aux |
has,attributed |
R6070 |
T9610 |
T9604 |
pobj |
blastocysts,into |
R6071 |
T9611 |
T9612 |
compound |
BALB,c |
R6072 |
T9612 |
T9610 |
compound |
c,blastocysts |
R6073 |
T9613 |
T9612 |
punct |
/,c |
R6074 |
T9614 |
T9602 |
cc |
and,injected |
R6075 |
T9615 |
T9616 |
auxpass |
were,transferred |
R6076 |
T9616 |
T9602 |
conj |
transferred,injected |
R6077 |
T9617 |
T9616 |
prep |
into,transferred |
R6078 |
T9618 |
T9619 |
nmod |
CD,mothers |
R6079 |
T9619 |
T9617 |
pobj |
mothers,into |
R608 |
T1340 |
T1335 |
advmod |
also,attributed |
R6080 |
T9620 |
T9618 |
punct |
-,CD |
R6081 |
T9621 |
T9618 |
nummod |
1,CD |
R6082 |
T9622 |
T9619 |
compound |
foster,mothers |
R6083 |
T9623 |
T9602 |
punct |
", ",injected |
R6084 |
T9624 |
T9602 |
cc |
and,injected |
R6085 |
T9625 |
T9626 |
nsubjpass |
animals,mated |
R6086 |
T9626 |
T9602 |
conj |
mated,injected |
R6087 |
T9627 |
T9625 |
acl |
classified,animals |
R6088 |
T9628 |
T9627 |
prep |
as,classified |
R6089 |
T9629 |
T9628 |
pobj |
chimeras,as |
R609 |
T1341 |
T1335 |
auxpass |
been,attributed |
R6090 |
T9630 |
T9627 |
prep |
by,classified |
R6091 |
T9631 |
T9632 |
compound |
coat,color |
R6092 |
T9632 |
T9630 |
pobj |
color,by |
R6093 |
T9633 |
T9626 |
auxpass |
were,mated |
R6094 |
T9634 |
T9626 |
prep |
with,mated |
R6095 |
T9635 |
T9636 |
compound |
BALB,c |
R6096 |
T9636 |
T9638 |
compound |
c,mice |
R6097 |
T9637 |
T9636 |
punct |
/,c |
R6098 |
T9638 |
T9634 |
pobj |
mice,with |
R6099 |
T9639 |
T9626 |
punct |
.,mated |
R610 |
T1342 |
T1335 |
prep |
to,attributed |
R6100 |
T9641 |
T9642 |
compound |
Germ,line |
R6101 |
T9642 |
T9643 |
compound |
line,transmission |
R6102 |
T9643 |
T9644 |
nsubjpass |
transmission,achieved |
R6103 |
T9645 |
T9644 |
auxpass |
was,achieved |
R6104 |
T9646 |
T9644 |
cc |
and,achieved |
R6105 |
T9647 |
T9648 |
det |
the,mice |
R6106 |
T9648 |
T9649 |
nsubjpass |
mice,maintained |
R6107 |
T9649 |
T9644 |
conj |
maintained,achieved |
R6108 |
T9650 |
T9649 |
auxpass |
were,maintained |
R6109 |
T9651 |
T9649 |
prep |
in,maintained |
R611 |
T1343 |
T1342 |
pobj |
alterations,to |
R6110 |
T9652 |
T9653 |
nmod |
C57BL,background |
R6111 |
T9653 |
T9651 |
pobj |
background,in |
R6112 |
T9654 |
T9652 |
punct |
/,C57BL |
R6113 |
T9655 |
T9652 |
nummod |
6,C57BL |
R6114 |
T9656 |
T9649 |
punct |
.,maintained |
R6115 |
T9658 |
T9659 |
det |
The,mice |
R6116 |
T9659 |
T9660 |
nsubj |
mice,represent |
R6117 |
T9660 |
T9665 |
ccomp |
represent,maintained |
R6118 |
T9661 |
T9659 |
acl |
used,mice |
R6119 |
T9662 |
T9661 |
prep |
for,used |
R612 |
T1344 |
T1343 |
prep |
in,alterations |
R6120 |
T9663 |
T9664 |
det |
this,study |
R6121 |
T9664 |
T9662 |
pobj |
study,for |
R6122 |
T9666 |
T9660 |
dobj |
mice,represent |
R6123 |
T9667 |
T9668 |
dep |
that,backcrossed |
R6124 |
T9668 |
T9666 |
relcl |
backcrossed,mice |
R6125 |
T9669 |
T9668 |
auxpass |
were,backcrossed |
R6126 |
T9670 |
T9668 |
prep |
in,backcrossed |
R6127 |
T9671 |
T9670 |
pobj |
C57BL,in |
R6128 |
T9672 |
T9671 |
punct |
/,C57BL |
R6129 |
T9673 |
T9671 |
nummod |
6,C57BL |
R613 |
T1345 |
T1346 |
det |
the,response |
R6130 |
T9674 |
T9675 |
quantmod |
between,three |
R6131 |
T9675 |
T9676 |
nummod |
three,generations |
R6132 |
T9676 |
T9668 |
npadvmod |
generations,backcrossed |
R6133 |
T9677 |
T9675 |
cc |
and,three |
R6134 |
T9678 |
T9675 |
conj |
eight,three |
R6135 |
T9679 |
T9665 |
punct |
;,maintained |
R6136 |
T9680 |
T9665 |
prep |
in,maintained |
R6137 |
T9681 |
T9680 |
pobj |
addition,in |
R6138 |
T9682 |
T9665 |
punct |
", ",maintained |
R6139 |
T9683 |
T9665 |
nsubj |
we,maintained |
R614 |
T1346 |
T1344 |
pobj |
response,in |
R6140 |
T9684 |
T9685 |
det |
the,mice |
R6141 |
T9685 |
T9665 |
dobj |
mice,maintained |
R6142 |
T9686 |
T9685 |
prep |
in,mice |
R6143 |
T9687 |
T9688 |
det |
the,strain |
R6144 |
T9688 |
T9686 |
pobj |
strain,in |
R6145 |
T9689 |
T9690 |
nummod |
129,SvJ |
R6146 |
T9690 |
T9688 |
compound |
SvJ,strain |
R6147 |
T9691 |
T9690 |
punct |
/,SvJ |
R6148 |
T9692 |
T9665 |
cc |
and,maintained |
R6149 |
T9693 |
T9665 |
conj |
observed,maintained |
R615 |
T1347 |
T1346 |
prep |
of,response |
R6150 |
T9694 |
T9695 |
det |
a,phenotype |
R6151 |
T9695 |
T9693 |
dobj |
phenotype,observed |
R6152 |
T9696 |
T9695 |
amod |
similar,phenotype |
R6153 |
T9697 |
T9665 |
punct |
.,maintained |
R6154 |
T9733 |
T9732 |
cc |
and,Genotyping |
R6155 |
T9734 |
T9735 |
compound |
immunoblot,analyses |
R6156 |
T9735 |
T9732 |
conj |
analyses,Genotyping |
R6157 |
T9736 |
T9735 |
punct |
.,analyses |
R6158 |
T9738 |
T9739 |
det |
All,procedures |
R6159 |
T9739 |
T9741 |
nsubjpass |
procedures,performed |
R616 |
T1348 |
T1349 |
nmod |
bone,marrow |
R6160 |
T9740 |
T9739 |
compound |
mouse,procedures |
R6161 |
T9742 |
T9741 |
auxpass |
were,performed |
R6162 |
T9743 |
T9741 |
prep |
in,performed |
R6163 |
T9744 |
T9743 |
pobj |
accordance,in |
R6164 |
T9745 |
T9744 |
prep |
with,accordance |
R6165 |
T9746 |
T9747 |
compound |
McGill,University |
R6166 |
T9747 |
T9748 |
compound |
University,guidelines |
R6167 |
T9748 |
T9745 |
pobj |
guidelines,with |
R6168 |
T9749 |
T9748 |
punct |
", ",guidelines |
R6169 |
T9750 |
T9751 |
dep |
which,set |
R617 |
T1349 |
T1350 |
nmod |
marrow,cells |
R6170 |
T9751 |
T9748 |
relcl |
set,guidelines |
R6171 |
T9752 |
T9751 |
auxpass |
are,set |
R6172 |
T9753 |
T9751 |
agent |
by,set |
R6173 |
T9754 |
T9755 |
det |
the,Council |
R6174 |
T9755 |
T9753 |
pobj |
Council,by |
R6175 |
T9756 |
T9755 |
compound |
Canadian,Council |
R6176 |
T9757 |
T9755 |
prep |
on,Council |
R6177 |
T9758 |
T9759 |
compound |
Animal,Care |
R6178 |
T9759 |
T9757 |
pobj |
Care,on |
R6179 |
T9760 |
T9741 |
punct |
.,performed |
R618 |
T1350 |
T1347 |
pobj |
cells,of |
R6180 |
T9762 |
T9763 |
amod |
Genomic,DNA |
R6181 |
T9763 |
T9764 |
nsubjpass |
DNA,isolated |
R6182 |
T9765 |
T9764 |
auxpass |
was,isolated |
R6183 |
T9766 |
T9764 |
prep |
from,isolated |
R6184 |
T9767 |
T9768 |
compound |
tail,biopsies |
R6185 |
T9768 |
T9766 |
pobj |
biopsies,from |
R6186 |
T9769 |
T9764 |
cc |
and,isolated |
R6187 |
T9770 |
T9764 |
conj |
analyzed,isolated |
R6188 |
T9771 |
T9770 |
prep |
by,analyzed |
R6189 |
T9772 |
T9773 |
compound |
Southern,blotting |
R619 |
T1351 |
T1350 |
amod |
stromal,cells |
R6190 |
T9773 |
T9771 |
pobj |
blotting,by |
R6191 |
T9774 |
T9773 |
cc |
and,blotting |
R6192 |
T9775 |
T9776 |
amod |
genomic,analysis |
R6193 |
T9776 |
T9773 |
conj |
analysis,blotting |
R6194 |
T9777 |
T9776 |
compound |
PCR,analysis |
R6195 |
T9778 |
T9764 |
punct |
.,isolated |
R6196 |
T9780 |
T9781 |
det |
The,fragment |
R6197 |
T9781 |
T9783 |
nsubjpass |
fragment,amplified |
R6198 |
T9782 |
T9781 |
compound |
DNA,fragment |
R6199 |
T9784 |
T9781 |
acl |
utilized,fragment |
R620 |
T1352 |
T1346 |
prep |
to,response |
R6200 |
T9785 |
T9784 |
prep |
as,utilized |
R6201 |
T9786 |
T9787 |
det |
the,probe |
R6202 |
T9787 |
T9785 |
pobj |
probe,as |
R6203 |
T9788 |
T9787 |
prep |
for,probe |
R6204 |
T9789 |
T9790 |
det |
the,analysis |
R6205 |
T9790 |
T9788 |
pobj |
analysis,for |
R6206 |
T9791 |
T9792 |
compound |
Southern,blotting |
R6207 |
T9792 |
T9790 |
compound |
blotting,analysis |
R6208 |
T9793 |
T9783 |
auxpass |
was,amplified |
R6209 |
T9794 |
T9783 |
prep |
with,amplified |
R621 |
T1353 |
T1354 |
poss |
their,microenvironment |
R6210 |
T9795 |
T9796 |
det |
the,oligonucleotides |
R6211 |
T9796 |
T9794 |
pobj |
oligonucleotides,with |
R6212 |
T9797 |
T9796 |
amod |
following,oligonucleotides |
R6213 |
T9798 |
T9796 |
nummod |
two,oligonucleotides |
R6214 |
T9799 |
T9796 |
punct |
(,oligonucleotides |
R6215 |
T9800 |
T9796 |
appos |
5,oligonucleotides |
R6216 |
T9801 |
T9800 |
punct |
′,5 |
R6217 |
T9802 |
T9800 |
punct |
-,5 |
R6218 |
T9803 |
T9804 |
compound |
AAG,T |
R6219 |
T9804 |
T9800 |
appos |
T,5 |
R622 |
T1354 |
T1352 |
pobj |
microenvironment,to |
R6220 |
T9805 |
T9804 |
compound |
CCT,T |
R6221 |
T9806 |
T9804 |
compound |
TTA,T |
R6222 |
T9807 |
T9804 |
compound |
CTG,T |
R6223 |
T9808 |
T9804 |
compound |
GTT,T |
R6224 |
T9809 |
T9804 |
compound |
GTG,T |
R6225 |
T9810 |
T9800 |
punct |
-,5 |
R6226 |
T9811 |
T9800 |
nummod |
3,5 |
R6227 |
T9812 |
T9800 |
punct |
′,5 |
R6228 |
T9813 |
T9800 |
punct |
),5 |
R6229 |
T9814 |
T9800 |
cc |
and,5 |
R623 |
T1355 |
T1356 |
dep |
that,favors |
R6230 |
T9815 |
T9816 |
punct |
(,5 |
R6231 |
T9816 |
T9800 |
conj |
5,5 |
R6232 |
T9817 |
T9816 |
punct |
′,5 |
R6233 |
T9818 |
T9816 |
punct |
-,5 |
R6234 |
T9819 |
T9820 |
compound |
CTT,CT |
R6235 |
T9820 |
T9816 |
appos |
CT,5 |
R6236 |
T9821 |
T9820 |
compound |
GAA,CT |
R6237 |
T9822 |
T9820 |
compound |
ACG,CT |
R6238 |
T9823 |
T9820 |
compound |
CAC,CT |
R6239 |
T9824 |
T9820 |
compound |
CGT,CT |
R624 |
T1356 |
T1346 |
relcl |
favors,response |
R6240 |
T9825 |
T9820 |
compound |
AGG,CT |
R6241 |
T9826 |
T9816 |
punct |
-,5 |
R6242 |
T9827 |
T9816 |
nummod |
3,5 |
R6243 |
T9828 |
T9816 |
punct |
′,5 |
R6244 |
T9829 |
T9783 |
punct |
),amplified |
R6245 |
T9830 |
T9783 |
punct |
.,amplified |
R6246 |
T9832 |
T9833 |
det |
The,allele |
R6247 |
T9833 |
T9838 |
nsubjpass |
allele,identified |
R6248 |
T9834 |
T9835 |
amod |
wild,type |
R6249 |
T9835 |
T9833 |
compound |
type,allele |
R625 |
T1357 |
T1356 |
dobj |
differentiation,favors |
R6250 |
T9836 |
T9835 |
punct |
-,type |
R6251 |
T9837 |
T9833 |
compound |
sam68,allele |
R6252 |
T9839 |
T9838 |
auxpass |
was,identified |
R6253 |
T9840 |
T9838 |
prep |
by,identified |
R6254 |
T9841 |
T9842 |
amod |
genomic,PCR |
R6255 |
T9842 |
T9840 |
pobj |
PCR,by |
R6256 |
T9843 |
T9838 |
advcl |
using,identified |
R6257 |
T9844 |
T9845 |
det |
the,oligonucleotides |
R6258 |
T9845 |
T9843 |
dobj |
oligonucleotides,using |
R6259 |
T9846 |
T9845 |
amod |
following,oligonucleotides |
R626 |
T1358 |
T1357 |
prep |
down,differentiation |
R6260 |
T9847 |
T9845 |
appos |
5,oligonucleotides |
R6261 |
T9848 |
T9847 |
punct |
′,5 |
R6262 |
T9849 |
T9847 |
punct |
-,5 |
R6263 |
T9850 |
T9851 |
compound |
AAA,AG |
R6264 |
T9851 |
T9847 |
appos |
AG,5 |
R6265 |
T9852 |
T9851 |
compound |
TCC,AG |
R6266 |
T9853 |
T9851 |
compound |
TAA,AG |
R6267 |
T9854 |
T9851 |
compound |
CCC,AG |
R6268 |
T9855 |
T9851 |
compound |
TCC,AG |
R6269 |
T9856 |
T9851 |
compound |
TCA,AG |
R627 |
T1359 |
T1360 |
det |
the,lineage |
R6270 |
T9857 |
T9851 |
compound |
GTC,AG |
R6271 |
T9858 |
T9847 |
punct |
-,5 |
R6272 |
T9859 |
T9847 |
nummod |
3,5 |
R6273 |
T9860 |
T9847 |
punct |
′,5 |
R6274 |
T9861 |
T9847 |
cc |
and,5 |
R6275 |
T9862 |
T9847 |
conj |
5,5 |
R6276 |
T9863 |
T9862 |
punct |
′,5 |
R6277 |
T9864 |
T9862 |
punct |
-,5 |
R6278 |
T9865 |
T9866 |
compound |
GAT,CAG |
R6279 |
T9866 |
T9862 |
appos |
CAG,5 |
R628 |
T1360 |
T1358 |
pobj |
lineage,down |
R6280 |
T9867 |
T9866 |
compound |
ATG,CAG |
R6281 |
T9868 |
T9866 |
compound |
ATG,CAG |
R6282 |
T9869 |
T9866 |
compound |
GAT,CAG |
R6283 |
T9870 |
T9866 |
compound |
GAT,CAG |
R6284 |
T9871 |
T9866 |
compound |
ATC,CAG |
R6285 |
T9872 |
T9866 |
compound |
TGT,CAG |
R6286 |
T9873 |
T9862 |
punct |
-,5 |
R6287 |
T9874 |
T9862 |
nummod |
3,5 |
R6288 |
T9875 |
T9862 |
punct |
′,5 |
R6289 |
T9876 |
T9838 |
punct |
.,identified |
R629 |
T1361 |
T1360 |
compound |
adipocyte,lineage |
R6290 |
T9878 |
T9879 |
det |
The,allele |
R6291 |
T9879 |
T9883 |
nsubjpass |
allele,identified |
R6292 |
T9880 |
T9881 |
npadvmod |
sam68,targeted |
R6293 |
T9881 |
T9879 |
amod |
targeted,allele |
R6294 |
T9882 |
T9881 |
punct |
-,targeted |
R6295 |
T9884 |
T9883 |
auxpass |
was,identified |
R6296 |
T9885 |
T9883 |
prep |
by,identified |
R6297 |
T9886 |
T9887 |
amod |
genomic,PCR |
R6298 |
T9887 |
T9885 |
pobj |
PCR,by |
R6299 |
T9888 |
T9883 |
advcl |
using,identified |
R630 |
T1362 |
T1363 |
advmod |
rather,than |
R6300 |
T9889 |
T9890 |
det |
the,oligonucleotides |
R6301 |
T9890 |
T9888 |
dobj |
oligonucleotides,using |
R6302 |
T9891 |
T9890 |
amod |
following,oligonucleotides |
R6303 |
T9892 |
T9890 |
appos |
5,oligonucleotides |
R6304 |
T9893 |
T9892 |
punct |
′,5 |
R6305 |
T9894 |
T9892 |
punct |
-,5 |
R6306 |
T9895 |
T9896 |
compound |
CTT,TCG |
R6307 |
T9896 |
T9892 |
appos |
TCG,5 |
R6308 |
T9897 |
T9896 |
compound |
GGG,TCG |
R6309 |
T9898 |
T9896 |
compound |
TGG,TCG |
R631 |
T1363 |
T1360 |
cc |
than,lineage |
R6310 |
T9899 |
T9896 |
compound |
AGA,TCG |
R6311 |
T9900 |
T9896 |
compound |
GGC,TCG |
R6312 |
T9901 |
T9896 |
compound |
TAT,TCG |
R6313 |
T9902 |
T9892 |
punct |
-,5 |
R6314 |
T9903 |
T9892 |
nummod |
3,5 |
R6315 |
T9904 |
T9892 |
punct |
′,5 |
R6316 |
T9905 |
T9892 |
cc |
and,5 |
R6317 |
T9906 |
T9892 |
conj |
5,5 |
R6318 |
T9907 |
T9906 |
punct |
′,5 |
R6319 |
T9908 |
T9906 |
punct |
-,5 |
R632 |
T1364 |
T1365 |
det |
the,lineage |
R6320 |
T9909 |
T9910 |
compound |
GTC,C |
R6321 |
T9910 |
T9906 |
appos |
C,5 |
R6322 |
T9911 |
T9910 |
compound |
GGG,C |
R6323 |
T9912 |
T9910 |
compound |
CAT,C |
R6324 |
T9913 |
T9910 |
compound |
GCG,C |
R6325 |
T9914 |
T9910 |
compound |
CGC,C |
R6326 |
T9915 |
T9910 |
compound |
CTT,C |
R6327 |
T9916 |
T9910 |
compound |
GAG,C |
R6328 |
T9917 |
T9906 |
punct |
-,5 |
R6329 |
T9918 |
T9906 |
nummod |
3,5 |
R633 |
T1365 |
T1360 |
conj |
lineage,lineage |
R6330 |
T9919 |
T9906 |
punct |
′,5 |
R6331 |
T9920 |
T9883 |
punct |
.,identified |
R6332 |
T9979 |
T9978 |
cc |
and,Radiology |
R6333 |
T9980 |
T9981 |
compound |
serum,biochemistry |
R6334 |
T9981 |
T9978 |
conj |
biochemistry,Radiology |
R6335 |
T9982 |
T9978 |
prep |
on,Radiology |
R6336 |
T9983 |
T9984 |
nmod |
Sam68,mice |
R6337 |
T9984 |
T9982 |
pobj |
mice,on |
R6338 |
T9985 |
T9983 |
punct |
+,Sam68 |
R6339 |
T9986 |
T9983 |
punct |
/,Sam68 |
R634 |
T1366 |
T1365 |
compound |
osteoblast,lineage |
R6340 |
T9987 |
T9983 |
punct |
+,Sam68 |
R6341 |
T9988 |
T9983 |
cc |
and,Sam68 |
R6342 |
T9989 |
T9983 |
conj |
Sam68,Sam68 |
R6343 |
T9990 |
T9989 |
punct |
−,Sam68 |
R6344 |
T9991 |
T9989 |
punct |
/,Sam68 |
R6345 |
T9992 |
T9989 |
punct |
−,Sam68 |
R6346 |
T9993 |
T9978 |
punct |
.,Radiology |
R6347 |
T9995 |
T9996 |
nsubjpass |
Radiography,performed |
R6348 |
T9997 |
T9995 |
punct |
", ",Radiography |
R6349 |
T9998 |
T9995 |
conj |
BMD,Radiography |
R635 |
T1367 |
T1368 |
punct |
[,22 |
R6350 |
T9999 |
T9998 |
punct |
", ",BMD |
R6351 |
T10000 |
T9998 |
cc |
and,BMD |
R6352 |
T10001 |
T9998 |
conj |
micro-CT,BMD |
R6353 |
T10002 |
T9996 |
auxpass |
were,performed |
R6354 |
T10003 |
T10004 |
advmod |
essentially,described |
R6355 |
T10004 |
T9996 |
advcl |
described,performed |
R6356 |
T10005 |
T10004 |
mark |
as,described |
R6357 |
T10006 |
T10004 |
advmod |
previously,described |
R6358 |
T10007 |
T10008 |
punct |
[,63 |
R6359 |
T10008 |
T9996 |
parataxis |
63,performed |
R636 |
T1368 |
T1335 |
parataxis |
22,attributed |
R6360 |
T10009 |
T10008 |
punct |
],63 |
R6361 |
T10010 |
T9996 |
punct |
.,performed |
R6362 |
T10012 |
T10013 |
nsubjpass |
Mice,administered |
R6363 |
T10014 |
T10013 |
auxpass |
were,administered |
R6364 |
T10015 |
T10016 |
det |
a,dose |
R6365 |
T10016 |
T10013 |
dobj |
dose,administered |
R6366 |
T10017 |
T10016 |
amod |
lethal,dose |
R6367 |
T10018 |
T10016 |
prep |
of,dose |
R6368 |
T10019 |
T10018 |
pobj |
anesthetic,of |
R6369 |
T10020 |
T10013 |
prep |
at,administered |
R637 |
T1369 |
T1368 |
punct |
],22 |
R6370 |
T10021 |
T10022 |
det |
the,times |
R6371 |
T10022 |
T10020 |
pobj |
times,at |
R6372 |
T10023 |
T10022 |
amod |
indicated,times |
R6373 |
T10024 |
T10013 |
punct |
", ",administered |
R6374 |
T10025 |
T10013 |
conj |
exsanguinated,administered |
R6375 |
T10026 |
T10025 |
punct |
", ",exsanguinated |
R6376 |
T10027 |
T10025 |
cc |
and,exsanguinated |
R6377 |
T10028 |
T10025 |
conj |
imaged,exsanguinated |
R6378 |
T10029 |
T10028 |
advcl |
using,imaged |
R6379 |
T10030 |
T10031 |
det |
a,MX20 |
R638 |
T1370 |
T1335 |
punct |
.,attributed |
R6380 |
T10031 |
T10029 |
dobj |
MX20,using |
R6381 |
T10032 |
T10031 |
compound |
Faxitron,MX20 |
R6382 |
T10033 |
T10031 |
acl |
equipped,MX20 |
R6383 |
T10034 |
T10033 |
prep |
with,equipped |
R6384 |
T10035 |
T10036 |
det |
an,system |
R6385 |
T10036 |
T10034 |
pobj |
system,with |
R6386 |
T10037 |
T10036 |
nmod |
FPX,system |
R6387 |
T10038 |
T10037 |
punct |
-,FPX |
R6388 |
T10039 |
T10037 |
nummod |
2,FPX |
R6389 |
T10040 |
T10036 |
compound |
Imaging,system |
R639 |
T1372 |
T1373 |
nsubjpass |
Aging,associated |
R6390 |
T10041 |
T10042 |
punct |
(,Medoptics |
R6391 |
T10042 |
T10031 |
parataxis |
Medoptics,MX20 |
R6392 |
T10043 |
T10042 |
compound |
Dalsa,Medoptics |
R6393 |
T10044 |
T10042 |
punct |
", ",Medoptics |
R6394 |
T10045 |
T10042 |
npadvmod |
Waterloo,Medoptics |
R6395 |
T10046 |
T10042 |
punct |
", ",Medoptics |
R6396 |
T10047 |
T10042 |
npadvmod |
Ontario,Medoptics |
R6397 |
T10048 |
T10042 |
punct |
", ",Medoptics |
R6398 |
T10049 |
T10042 |
npadvmod |
Canada,Medoptics |
R6399 |
T10050 |
T10042 |
punct |
),Medoptics |
R640 |
T1374 |
T1373 |
aux |
has,associated |
R6400 |
T10051 |
T10013 |
punct |
.,administered |
R6401 |
T10053 |
T10054 |
compound |
Body,fat |
R6402 |
T10054 |
T10055 |
nsubjpass |
fat,evaluated |
R6403 |
T10056 |
T10054 |
punct |
", ",fat |
R6404 |
T10057 |
T10054 |
conj |
BMC,fat |
R6405 |
T10058 |
T10057 |
punct |
", ",BMC |
R6406 |
T10059 |
T10057 |
cc |
and,BMC |
R6407 |
T10060 |
T10057 |
conj |
BMD,BMC |
R6408 |
T10061 |
T10055 |
auxpass |
were,evaluated |
R6409 |
T10062 |
T10055 |
advcl |
using,evaluated |
R641 |
T1375 |
T1373 |
advmod |
long,associated |
R6410 |
T10063 |
T10064 |
det |
a,PixiMUS |
R6411 |
T10064 |
T10062 |
dobj |
PixiMUS,using |
R6412 |
T10065 |
T10064 |
compound |
Lunar,PixiMUS |
R6413 |
T10066 |
T10064 |
nummod |
1.46,PixiMUS |
R6414 |
T10067 |
T10068 |
punct |
(,Lunar |
R6415 |
T10068 |
T10064 |
parataxis |
Lunar,PixiMUS |
R6416 |
T10069 |
T10068 |
compound |
GE,Lunar |
R6417 |
T10070 |
T10068 |
punct |
-,Lunar |
R6418 |
T10071 |
T10068 |
punct |
", ",Lunar |
R6419 |
T10072 |
T10068 |
npadvmod |
Madison,Lunar |
R642 |
T1376 |
T1373 |
auxpass |
been,associated |
R6420 |
T10073 |
T10068 |
punct |
", ",Lunar |
R6421 |
T10074 |
T10068 |
npadvmod |
Wisconsin,Lunar |
R6422 |
T10075 |
T10068 |
punct |
", ",Lunar |
R6423 |
T10076 |
T10077 |
compound |
United,States |
R6424 |
T10077 |
T10068 |
npadvmod |
States,Lunar |
R6425 |
T10078 |
T10068 |
punct |
),Lunar |
R6426 |
T10079 |
T10055 |
punct |
.,evaluated |
R6427 |
T10081 |
T10082 |
amod |
Morphometric,parameters |
R6428 |
T10082 |
T10083 |
nsubjpass |
parameters,determined |
R6429 |
T10084 |
T10083 |
auxpass |
were,determined |
R643 |
T1377 |
T1373 |
prep |
with,associated |
R6430 |
T10085 |
T10083 |
prep |
on,determined |
R6431 |
T10086 |
T10087 |
amod |
anesthetized,mice |
R6432 |
T10087 |
T10085 |
pobj |
mice,on |
R6433 |
T10088 |
T10083 |
prep |
at,determined |
R6434 |
T10089 |
T10090 |
det |
the,time |
R6435 |
T10090 |
T10088 |
pobj |
time,at |
R6436 |
T10091 |
T10090 |
prep |
of,time |
R6437 |
T10092 |
T10091 |
pobj |
sacrifice,of |
R6438 |
T10093 |
T10083 |
prep |
by,determined |
R6439 |
T10094 |
T10095 |
amod |
direct,measurement |
R644 |
T1378 |
T1379 |
det |
an,increase |
R6440 |
T10095 |
T10093 |
pobj |
measurement,by |
R6441 |
T10096 |
T10093 |
cc |
or,by |
R6442 |
T10097 |
T10093 |
conj |
from,by |
R6443 |
T10098 |
T10099 |
det |
the,radiograph |
R6444 |
T10099 |
T10097 |
pobj |
radiograph,from |
R6445 |
T10100 |
T10099 |
compound |
Faxitron,radiograph |
R6446 |
T10101 |
T10083 |
punct |
.,determined |
R6447 |
T10103 |
T10104 |
nsubjpass |
Micro-CT,performed |
R6448 |
T10105 |
T10104 |
auxpass |
was,performed |
R6449 |
T10106 |
T10104 |
prep |
on,performed |
R645 |
T1379 |
T1377 |
pobj |
increase,with |
R6450 |
T10107 |
T10108 |
det |
the,femur |
R6451 |
T10108 |
T10106 |
pobj |
femur,on |
R6452 |
T10109 |
T10108 |
amod |
left,femur |
R6453 |
T10110 |
T10108 |
cc |
and,femur |
R6454 |
T10111 |
T10112 |
amod |
fourth,vertebra |
R6455 |
T10112 |
T10108 |
conj |
vertebra,femur |
R6456 |
T10113 |
T10112 |
compound |
lumbar,vertebra |
R6457 |
T10114 |
T10104 |
prep |
after,performed |
R6458 |
T10115 |
T10114 |
pobj |
removal,after |
R6459 |
T10116 |
T10115 |
prep |
of,removal |
R646 |
T1380 |
T1379 |
prep |
in,increase |
R6460 |
T10117 |
T10118 |
amod |
soft,tissues |
R6461 |
T10118 |
T10116 |
pobj |
tissues,of |
R6462 |
T10119 |
T10115 |
cc |
and,removal |
R6463 |
T10120 |
T10121 |
amod |
overnight,fixation |
R6464 |
T10121 |
T10115 |
conj |
fixation,removal |
R6465 |
T10122 |
T10121 |
prep |
in,fixation |
R6466 |
T10123 |
T10124 |
nummod |
4,% |
R6467 |
T10124 |
T10125 |
compound |
%,paraformaldehyde |
R6468 |
T10125 |
T10122 |
pobj |
paraformaldehyde,in |
R6469 |
T10126 |
T10104 |
punct |
.,performed |
R647 |
T1381 |
T1382 |
compound |
marrow,fat |
R6470 |
T10128 |
T10129 |
det |
The,metaphysis |
R6471 |
T10129 |
T10131 |
nsubjpass |
metaphysis,scanned |
R6472 |
T10130 |
T10129 |
amod |
distal,metaphysis |
R6473 |
T10132 |
T10131 |
auxpass |
was,scanned |
R6474 |
T10133 |
T10131 |
prep |
with,scanned |
R6475 |
T10134 |
T10135 |
det |
a,instrument |
R6476 |
T10135 |
T10133 |
pobj |
instrument,with |
R6477 |
T10136 |
T10135 |
nmod |
Skyscan,instrument |
R6478 |
T10137 |
T10136 |
nummod |
1072,Skyscan |
R6479 |
T10138 |
T10135 |
compound |
micro-CT,instrument |
R648 |
T1382 |
T1380 |
pobj |
fat,in |
R6480 |
T10139 |
T10140 |
punct |
(,Skyscan |
R6481 |
T10140 |
T10135 |
parataxis |
Skyscan,instrument |
R6482 |
T10141 |
T10140 |
punct |
", ",Skyscan |
R6483 |
T10142 |
T10140 |
npadvmod |
Antwerp,Skyscan |
R6484 |
T10143 |
T10140 |
punct |
", ",Skyscan |
R6485 |
T10144 |
T10140 |
npadvmod |
Belgium,Skyscan |
R6486 |
T10145 |
T10140 |
punct |
),Skyscan |
R6487 |
T10146 |
T10131 |
punct |
.,scanned |
R6488 |
T10148 |
T10149 |
compound |
Image,acquisition |
R6489 |
T10149 |
T10150 |
nsubjpass |
acquisition,performed |
R649 |
T1383 |
T1382 |
punct |
", ",fat |
R6490 |
T10151 |
T10150 |
auxpass |
was,performed |
R6491 |
T10152 |
T10150 |
prep |
at,performed |
R6492 |
T10153 |
T10154 |
nummod |
100,kV |
R6493 |
T10154 |
T10152 |
pobj |
kV,at |
R6494 |
T10155 |
T10154 |
cc |
and,kV |
R6495 |
T10156 |
T10157 |
nummod |
98,μA |
R6496 |
T10157 |
T10154 |
conj |
μA,kV |
R6497 |
T10158 |
T10150 |
punct |
", ",performed |
R6498 |
T10159 |
T10150 |
prep |
with,performed |
R6499 |
T10160 |
T10161 |
det |
a,rotation |
R650 |
T1384 |
T1385 |
advmod |
where,favored |
R6500 |
T10161 |
T10159 |
pobj |
rotation,with |
R6501 |
T10162 |
T10163 |
nummod |
0.9,° |
R6502 |
T10163 |
T10161 |
compound |
°,rotation |
R6503 |
T10164 |
T10161 |
prep |
between,rotation |
R6504 |
T10165 |
T10164 |
pobj |
frames,between |
R6505 |
T10166 |
T10150 |
punct |
.,performed |
R6506 |
T10168 |
T10169 |
det |
The,images |
R6507 |
T10169 |
T10173 |
nsubjpass |
images,used |
R6508 |
T10170 |
T10171 |
advmod |
two,dimensional |
R6509 |
T10171 |
T10169 |
amod |
dimensional,images |
R651 |
T1385 |
T1382 |
relcl |
favored,fat |
R6510 |
T10172 |
T10171 |
punct |
-,dimensional |
R6511 |
T10174 |
T10173 |
auxpass |
were,used |
R6512 |
T10175 |
T10176 |
aux |
to,generate |
R6513 |
T10176 |
T10173 |
advcl |
generate,used |
R6514 |
T10177 |
T10178 |
advmod |
three,dimensional |
R6515 |
T10178 |
T10180 |
amod |
dimensional,reconstructions |
R6516 |
T10179 |
T10178 |
punct |
-,dimensional |
R6517 |
T10180 |
T10176 |
dobj |
reconstructions,generate |
R6518 |
T10181 |
T10182 |
aux |
to,obtain |
R6519 |
T10182 |
T10176 |
advcl |
obtain,generate |
R652 |
T1386 |
T1387 |
det |
the,generation |
R6520 |
T10183 |
T10184 |
amod |
quantitative,data |
R6521 |
T10184 |
T10182 |
dobj |
data,obtain |
R6522 |
T10185 |
T10182 |
prep |
with,obtain |
R6523 |
T10186 |
T10187 |
det |
the,software |
R6524 |
T10187 |
T10185 |
pobj |
software,with |
R6525 |
T10188 |
T10189 |
amod |
3D,Creator |
R6526 |
T10189 |
T10187 |
compound |
Creator,software |
R6527 |
T10190 |
T10187 |
acl |
supplied,software |
R6528 |
T10191 |
T10190 |
prep |
with,supplied |
R6529 |
T10192 |
T10193 |
det |
the,instrument |
R653 |
T1387 |
T1385 |
nsubjpass |
generation,favored |
R6530 |
T10193 |
T10191 |
pobj |
instrument,with |
R6531 |
T10194 |
T10173 |
punct |
.,used |
R6532 |
T10196 |
T10197 |
compound |
Serum,biochemistry |
R6533 |
T10197 |
T10198 |
nsubjpass |
biochemistry,determined |
R6534 |
T10199 |
T10200 |
punct |
(,Mg |
R6535 |
T10200 |
T10197 |
parataxis |
Mg,biochemistry |
R6536 |
T10201 |
T10200 |
nmod |
ALP,Mg |
R6537 |
T10202 |
T10200 |
punct |
", ",Mg |
R6538 |
T10203 |
T10200 |
nmod |
Ca,Mg |
R6539 |
T10204 |
T10200 |
punct |
", ",Mg |
R654 |
T1388 |
T1387 |
prep |
of,generation |
R6540 |
T10205 |
T10200 |
nmod |
PO4,Mg |
R6541 |
T10206 |
T10200 |
punct |
", ",Mg |
R6542 |
T10207 |
T10200 |
punct |
),Mg |
R6543 |
T10208 |
T10198 |
auxpass |
was,determined |
R6544 |
T10209 |
T10198 |
prep |
at,determined |
R6545 |
T10210 |
T10211 |
det |
the,Lab |
R6546 |
T10211 |
T10209 |
pobj |
Lab,at |
R6547 |
T10212 |
T10211 |
compound |
Rodent,Lab |
R6548 |
T10213 |
T10211 |
compound |
Diagnostics,Lab |
R6549 |
T10214 |
T10215 |
punct |
(,University |
R655 |
T1389 |
T1388 |
pobj |
adipocytes,of |
R6550 |
T10215 |
T10211 |
parataxis |
University,Lab |
R6551 |
T10216 |
T10215 |
compound |
McGill,University |
R6552 |
T10217 |
T10215 |
punct |
", ",University |
R6553 |
T10218 |
T10215 |
npadvmod |
Montréal,University |
R6554 |
T10219 |
T10215 |
punct |
", ",University |
R6555 |
T10220 |
T10215 |
npadvmod |
Quebec,University |
R6556 |
T10221 |
T10215 |
punct |
", ",University |
R6557 |
T10222 |
T10215 |
npadvmod |
Canada,University |
R6558 |
T10223 |
T10215 |
punct |
),University |
R6559 |
T10224 |
T10198 |
advcl |
using,determined |
R656 |
T1390 |
T1385 |
auxpass |
is,favored |
R6560 |
T10225 |
T10226 |
amod |
routine,techniques |
R6561 |
T10226 |
T10224 |
dobj |
techniques,using |
R6562 |
T10227 |
T10226 |
amod |
automated,techniques |
R6563 |
T10228 |
T10198 |
punct |
.,determined |
R6564 |
T10230 |
T10231 |
amod |
Commercial,assays |
R6565 |
T10231 |
T10232 |
nsubjpass |
assays,used |
R6566 |
T10233 |
T10232 |
auxpass |
were,used |
R6567 |
T10234 |
T10235 |
aux |
to,determine |
R6568 |
T10235 |
T10232 |
advcl |
determine,used |
R6569 |
T10236 |
T10237 |
compound |
serum,levels |
R657 |
T1391 |
T1385 |
prep |
over,favored |
R6570 |
T10237 |
T10235 |
dobj |
levels,determine |
R6571 |
T10238 |
T10237 |
prep |
of,levels |
R6572 |
T10239 |
T10238 |
pobj |
CTX,of |
R6573 |
T10240 |
T10241 |
punct |
(,ELISA |
R6574 |
T10241 |
T10239 |
parataxis |
ELISA,CTX |
R6575 |
T10242 |
T10241 |
compound |
RatLaps,ELISA |
R6576 |
T10243 |
T10241 |
punct |
", ",ELISA |
R6577 |
T10244 |
T10245 |
compound |
Nordic,Bioscience |
R6578 |
T10245 |
T10241 |
appos |
Bioscience,ELISA |
R6579 |
T10246 |
T10241 |
punct |
),ELISA |
R658 |
T1392 |
T1391 |
pobj |
osteoblasts,over |
R6580 |
T10247 |
T10232 |
punct |
", ",used |
R6581 |
T10248 |
T10249 |
nummod |
17β,estradiol |
R6582 |
T10249 |
T10232 |
dep |
estradiol,used |
R6583 |
T10250 |
T10251 |
punct |
(,Immuno-Biological |
R6584 |
T10251 |
T10249 |
parataxis |
Immuno-Biological,estradiol |
R6585 |
T10252 |
T10251 |
compound |
IBL,Immuno-Biological |
R6586 |
T10253 |
T10251 |
punct |
", ",Immuno-Biological |
R6587 |
T10254 |
T10251 |
npadvmod |
Hamburg,Immuno-Biological |
R6588 |
T10255 |
T10251 |
punct |
", ",Immuno-Biological |
R6589 |
T10256 |
T10251 |
npadvmod |
Germany,Immuno-Biological |
R659 |
T1393 |
T1394 |
punct |
[,23 |
R6590 |
T10257 |
T10251 |
punct |
),Immuno-Biological |
R6591 |
T10258 |
T10249 |
punct |
", ",estradiol |
R6592 |
T10259 |
T10249 |
conj |
leptin,estradiol |
R6593 |
T10260 |
T10261 |
punct |
(,Systems |
R6594 |
T10261 |
T10259 |
parataxis |
Systems,leptin |
R6595 |
T10262 |
T10261 |
nmod |
R,Systems |
R6596 |
T10263 |
T10262 |
cc |
&,R |
R6597 |
T10264 |
T10262 |
conj |
D,R |
R6598 |
T10265 |
T10261 |
punct |
", ",Systems |
R6599 |
T10266 |
T10261 |
npadvmod |
Minneapolis,Systems |
R660 |
T1394 |
T1373 |
parataxis |
23,associated |
R6600 |
T10267 |
T10261 |
punct |
", ",Systems |
R6601 |
T10268 |
T10261 |
npadvmod |
Minnesota,Systems |
R6602 |
T10269 |
T10261 |
punct |
", ",Systems |
R6603 |
T10270 |
T10271 |
compound |
United,States |
R6604 |
T10271 |
T10261 |
npadvmod |
States,Systems |
R6605 |
T10272 |
T10261 |
punct |
),Systems |
R6606 |
T10273 |
T10259 |
punct |
", ",leptin |
R6607 |
T10274 |
T10259 |
cc |
and,leptin |
R6608 |
T10275 |
T10259 |
conj |
interleukin,leptin |
R6609 |
T10276 |
T10275 |
punct |
-,interleukin |
R661 |
T1395 |
T1394 |
punct |
],23 |
R6610 |
T10277 |
T10275 |
nummod |
6,interleukin |
R6611 |
T10278 |
T10279 |
punct |
(,Systems |
R6612 |
T10279 |
T10275 |
parataxis |
Systems,interleukin |
R6613 |
T10280 |
T10279 |
nmod |
R,Systems |
R6614 |
T10281 |
T10280 |
cc |
&,R |
R6615 |
T10282 |
T10280 |
conj |
D,R |
R6616 |
T10283 |
T10279 |
punct |
),Systems |
R6617 |
T10284 |
T10232 |
punct |
.,used |
R6618 |
T10388 |
T10389 |
advmod |
Ex,vivo |
R6619 |
T10389 |
T10390 |
amod |
vivo,assessment |
R662 |
T1396 |
T1373 |
punct |
.,associated |
R6620 |
T10391 |
T10390 |
prep |
of,assessment |
R6621 |
T10392 |
T10393 |
nmod |
osteoblast,activity |
R6622 |
T10393 |
T10391 |
pobj |
activity,of |
R6623 |
T10394 |
T10392 |
cc |
and,osteoblast |
R6624 |
T10395 |
T10392 |
conj |
osteoclast,osteoblast |
R6625 |
T10396 |
T10390 |
punct |
.,assessment |
R6626 |
T10398 |
T10399 |
compound |
Bone,marrow |
R6627 |
T10399 |
T10400 |
nsubjpass |
marrow,flushed |
R6628 |
T10401 |
T10400 |
auxpass |
was,flushed |
R6629 |
T10402 |
T10400 |
prep |
from,flushed |
R663 |
T1398 |
T1399 |
nsubjpass |
Osteoblasts,derived |
R6630 |
T10403 |
T10404 |
det |
the,tibia |
R6631 |
T10404 |
T10402 |
pobj |
tibia,from |
R6632 |
T10405 |
T10404 |
cc |
and,tibia |
R6633 |
T10406 |
T10404 |
conj |
femora,tibia |
R6634 |
T10407 |
T10404 |
prep |
of,tibia |
R6635 |
T10408 |
T10409 |
amod |
juvenile,mice |
R6636 |
T10409 |
T10407 |
pobj |
mice,of |
R6637 |
T10410 |
T10411 |
nummod |
4,week |
R6638 |
T10411 |
T10413 |
npadvmod |
week,old |
R6639 |
T10412 |
T10411 |
punct |
-,week |
R664 |
T1400 |
T1398 |
cc |
and,Osteoblasts |
R6640 |
T10413 |
T10409 |
amod |
old,mice |
R6641 |
T10414 |
T10413 |
punct |
-,old |
R6642 |
T10415 |
T10409 |
nmod |
Sam68,mice |
R6643 |
T10416 |
T10415 |
punct |
+,Sam68 |
R6644 |
T10417 |
T10415 |
punct |
/,Sam68 |
R6645 |
T10418 |
T10415 |
punct |
+,Sam68 |
R6646 |
T10419 |
T10415 |
cc |
and,Sam68 |
R6647 |
T10420 |
T10415 |
conj |
Sam68,Sam68 |
R6648 |
T10421 |
T10420 |
punct |
−,Sam68 |
R6649 |
T10422 |
T10420 |
punct |
/,Sam68 |
R665 |
T1401 |
T1398 |
conj |
adipocytes,Osteoblasts |
R6650 |
T10423 |
T10420 |
punct |
−,Sam68 |
R6651 |
T10424 |
T10425 |
aux |
to,obtain |
R6652 |
T10425 |
T10400 |
advcl |
obtain,flushed |
R6653 |
T10426 |
T10427 |
amod |
stromal,cells |
R6654 |
T10427 |
T10425 |
dobj |
cells,obtain |
R6655 |
T10428 |
T10429 |
dep |
that,maintained |
R6656 |
T10429 |
T10427 |
relcl |
maintained,cells |
R6657 |
T10430 |
T10429 |
auxpass |
were,maintained |
R6658 |
T10431 |
T10429 |
prep |
in,maintained |
R6659 |
T10432 |
T10433 |
compound |
differentiation,medium |
R666 |
T1402 |
T1399 |
auxpass |
are,derived |
R6660 |
T10433 |
T10431 |
pobj |
medium,in |
R6661 |
T10434 |
T10400 |
prep |
for,flushed |
R6662 |
T10435 |
T10436 |
nummod |
6,days |
R6663 |
T10436 |
T10434 |
pobj |
days,for |
R6664 |
T10437 |
T10435 |
cc |
or,6 |
R6665 |
T10438 |
T10435 |
conj |
18,6 |
R6666 |
T10439 |
T10440 |
mark |
as,described |
R6667 |
T10440 |
T10400 |
advcl |
described,flushed |
R6668 |
T10441 |
T10442 |
punct |
[,63 |
R6669 |
T10442 |
T10400 |
parataxis |
63,flushed |
R667 |
T1403 |
T1399 |
prep |
from,derived |
R6670 |
T10443 |
T10442 |
punct |
],63 |
R6671 |
T10444 |
T10400 |
punct |
.,flushed |
R6672 |
T10446 |
T10447 |
nsubjpass |
Cultures,stained |
R6673 |
T10448 |
T10447 |
auxpass |
were,stained |
R6674 |
T10449 |
T10450 |
advmod |
in,situ |
R6675 |
T10450 |
T10447 |
advmod |
situ,stained |
R6676 |
T10451 |
T10447 |
prep |
for,stained |
R6677 |
T10452 |
T10453 |
compound |
ALP,activity |
R6678 |
T10453 |
T10451 |
pobj |
activity,for |
R6679 |
T10454 |
T10451 |
cc |
and,for |
R668 |
T1404 |
T1405 |
det |
a,cell |
R6680 |
T10455 |
T10451 |
conj |
with,for |
R6681 |
T10456 |
T10457 |
compound |
von,Kossa |
R6682 |
T10457 |
T10458 |
compound |
Kossa,stain |
R6683 |
T10458 |
T10455 |
pobj |
stain,with |
R6684 |
T10459 |
T10460 |
aux |
to,detect |
R6685 |
T10460 |
T10447 |
advcl |
detect,stained |
R6686 |
T10461 |
T10462 |
amod |
mineralized,nodules |
R6687 |
T10462 |
T10460 |
dobj |
nodules,detect |
R6688 |
T10463 |
T10447 |
punct |
.,stained |
R6689 |
T10465 |
T10466 |
amod |
Total,RNA |
R669 |
T1405 |
T1403 |
pobj |
cell,from |
R6690 |
T10466 |
T10467 |
nsubjpass |
RNA,harvested |
R6691 |
T10468 |
T10467 |
auxpass |
was,harvested |
R6692 |
T10469 |
T10467 |
prep |
from,harvested |
R6693 |
T10470 |
T10471 |
amod |
parallel,cultures |
R6694 |
T10471 |
T10469 |
pobj |
cultures,from |
R6695 |
T10472 |
T10467 |
prep |
for,harvested |
R6696 |
T10473 |
T10474 |
compound |
RT,PCR |
R6697 |
T10474 |
T10476 |
compound |
PCR,analysis |
R6698 |
T10475 |
T10474 |
punct |
-,PCR |
R6699 |
T10476 |
T10472 |
pobj |
analysis,for |
R670 |
T1406 |
T1405 |
amod |
common,cell |
R6700 |
T10477 |
T10476 |
prep |
of,analysis |
R6701 |
T10478 |
T10479 |
npadvmod |
osteoblast,related |
R6702 |
T10479 |
T10481 |
amod |
related,expression |
R6703 |
T10480 |
T10479 |
punct |
-,related |
R6704 |
T10481 |
T10477 |
pobj |
expression,of |
R6705 |
T10482 |
T10481 |
compound |
gene,expression |
R6706 |
T10483 |
T10467 |
prep |
over,harvested |
R6707 |
T10484 |
T10483 |
pobj |
time,over |
R6708 |
T10485 |
T10486 |
mark |
as,described |
R6709 |
T10486 |
T10467 |
advcl |
described,harvested |
R671 |
T1407 |
T1405 |
amod |
mesenchymal,cell |
R6710 |
T10487 |
T10486 |
advmod |
previously,described |
R6711 |
T10488 |
T10489 |
punct |
[,63 |
R6712 |
T10489 |
T10467 |
parataxis |
63,harvested |
R6713 |
T10490 |
T10489 |
punct |
],63 |
R6714 |
T10491 |
T10467 |
punct |
.,harvested |
R6715 |
T10493 |
T10494 |
nsubj |
Osteoclasts,isolated |
R6716 |
T10495 |
T10494 |
aux |
were,isolated |
R6717 |
T10496 |
T10494 |
prep |
from,isolated |
R6718 |
T10497 |
T10498 |
det |
the,bones |
R6719 |
T10498 |
T10496 |
pobj |
bones,from |
R672 |
T1408 |
T1405 |
compound |
precursor,cell |
R6720 |
T10499 |
T10498 |
amod |
crushed,bones |
R6721 |
T10500 |
T10498 |
amod |
long,bones |
R6722 |
T10501 |
T10498 |
prep |
of,bones |
R6723 |
T10502 |
T10503 |
amod |
juvenile,mice |
R6724 |
T10503 |
T10501 |
pobj |
mice,of |
R6725 |
T10504 |
T10503 |
nmod |
Sam68,mice |
R6726 |
T10505 |
T10504 |
punct |
+,Sam68 |
R6727 |
T10506 |
T10504 |
punct |
/,Sam68 |
R6728 |
T10507 |
T10504 |
punct |
+,Sam68 |
R6729 |
T10508 |
T10504 |
cc |
and,Sam68 |
R673 |
T1409 |
T1405 |
relcl |
present,cell |
R6730 |
T10509 |
T10504 |
conj |
Sam68,Sam68 |
R6731 |
T10510 |
T10509 |
punct |
−,Sam68 |
R6732 |
T10511 |
T10509 |
punct |
/,Sam68 |
R6733 |
T10512 |
T10509 |
punct |
−,Sam68 |
R6734 |
T10513 |
T10494 |
cc |
and,isolated |
R6735 |
T10514 |
T10494 |
conj |
used,isolated |
R6736 |
T10515 |
T10514 |
prep |
for,used |
R6737 |
T10516 |
T10517 |
amod |
quantitative,studies |
R6738 |
T10517 |
T10515 |
pobj |
studies,for |
R6739 |
T10518 |
T10519 |
mark |
as,described |
R674 |
T1410 |
T1409 |
prep |
in,present |
R6740 |
T10519 |
T10494 |
advcl |
described,isolated |
R6741 |
T10520 |
T10521 |
punct |
[,64 |
R6742 |
T10521 |
T10494 |
parataxis |
64,isolated |
R6743 |
T10522 |
T10521 |
punct |
],64 |
R6744 |
T10523 |
T10494 |
punct |
.,isolated |
R6745 |
T10525 |
T10526 |
advmod |
Briefly,plated |
R6746 |
T10527 |
T10526 |
punct |
", ",plated |
R6747 |
T10528 |
T10526 |
nsubjpass |
cells,plated |
R6748 |
T10529 |
T10526 |
auxpass |
were,plated |
R6749 |
T10530 |
T10526 |
prep |
on,plated |
R675 |
T1411 |
T1412 |
compound |
bone,marrow |
R6750 |
T10531 |
T10532 |
compound |
glass,coverslips |
R6751 |
T10532 |
T10530 |
pobj |
coverslips,on |
R6752 |
T10533 |
T10530 |
cc |
or,on |
R6753 |
T10534 |
T10530 |
conj |
on,on |
R6754 |
T10535 |
T10536 |
compound |
dentin,slices |
R6755 |
T10536 |
T10534 |
pobj |
slices,on |
R6756 |
T10537 |
T10526 |
prep |
in,plated |
R6757 |
T10538 |
T10539 |
nummod |
24,well |
R6758 |
T10539 |
T10541 |
compound |
well,plates |
R6759 |
T10540 |
T10539 |
punct |
-,well |
R676 |
T1412 |
T1410 |
pobj |
marrow,in |
R6760 |
T10541 |
T10537 |
pobj |
plates,in |
R6761 |
T10542 |
T10541 |
compound |
cluster,plates |
R6762 |
T10543 |
T10526 |
prep |
for,plated |
R6763 |
T10544 |
T10543 |
pobj |
assessment,for |
R6764 |
T10545 |
T10544 |
prep |
of,assessment |
R6765 |
T10546 |
T10547 |
compound |
cell,number |
R6766 |
T10547 |
T10545 |
pobj |
number,of |
R6767 |
T10548 |
T10547 |
cc |
and,number |
R6768 |
T10549 |
T10550 |
compound |
pit,number |
R6769 |
T10550 |
T10547 |
conj |
number,number |
R677 |
T1413 |
T1399 |
punct |
", ",derived |
R6770 |
T10551 |
T10526 |
punct |
", ",plated |
R6771 |
T10552 |
T10526 |
advmod |
respectively,plated |
R6772 |
T10553 |
T10526 |
punct |
.,plated |
R6773 |
T10555 |
T10556 |
compound |
Cover,slips |
R6774 |
T10556 |
T10557 |
nsubjpass |
slips,immersed |
R6775 |
T10558 |
T10557 |
auxpass |
were,immersed |
R6776 |
T10559 |
T10557 |
prep |
in,immersed |
R6777 |
T10560 |
T10561 |
nummod |
4,% |
R6778 |
T10561 |
T10562 |
compound |
%,paraformaldehyde |
R6779 |
T10562 |
T10559 |
pobj |
paraformaldehyde,in |
R678 |
T1414 |
T1399 |
cc |
and,derived |
R6780 |
T10563 |
T10557 |
cc |
and,immersed |
R6781 |
T10564 |
T10557 |
conj |
stained,immersed |
R6782 |
T10565 |
T10564 |
prep |
for,stained |
R6783 |
T10566 |
T10567 |
compound |
TRAP,activity |
R6784 |
T10567 |
T10565 |
pobj |
activity,for |
R6785 |
T10568 |
T10564 |
prep |
after,stained |
R6786 |
T10569 |
T10570 |
nummod |
2,h |
R6787 |
T10570 |
T10568 |
pobj |
h,after |
R6788 |
T10571 |
T10557 |
punct |
.,immersed |
R6789 |
T10573 |
T10574 |
compound |
Dentin,slices |
R679 |
T1415 |
T1416 |
det |
the,factors |
R6790 |
T10574 |
T10575 |
nsubjpass |
slices,left |
R6791 |
T10576 |
T10575 |
auxpass |
were,left |
R6792 |
T10577 |
T10575 |
prep |
for,left |
R6793 |
T10578 |
T10579 |
nummod |
28,h |
R6794 |
T10579 |
T10577 |
pobj |
h,for |
R6795 |
T10580 |
T10575 |
prep |
before,left |
R6796 |
T10581 |
T10580 |
pcomp |
removing,before |
R6797 |
T10582 |
T10583 |
det |
the,cells |
R6798 |
T10583 |
T10581 |
dobj |
cells,removing |
R6799 |
T10584 |
T10581 |
prep |
with,removing |
R680 |
T1416 |
T1417 |
nsubjpass |
factors,understood |
R6800 |
T10585 |
T10586 |
nummod |
1,M |
R6801 |
T10586 |
T10587 |
compound |
M,hydroxide |
R6802 |
T10587 |
T10584 |
pobj |
hydroxide,with |
R6803 |
T10588 |
T10587 |
compound |
ammonium,hydroxide |
R6804 |
T10589 |
T10581 |
cc |
and,removing |
R6805 |
T10590 |
T10591 |
dep |
air,drying |
R6806 |
T10591 |
T10581 |
conj |
drying,removing |
R6807 |
T10592 |
T10591 |
prep |
before,drying |
R6808 |
T10593 |
T10592 |
pobj |
coating,before |
R6809 |
T10594 |
T10593 |
prep |
with,coating |
R681 |
T1417 |
T1399 |
conj |
understood,derived |
R6810 |
T10595 |
T10596 |
compound |
sputter,Pd |
R6811 |
T10596 |
T10594 |
pobj |
Pd,with |
R6812 |
T10597 |
T10596 |
compound |
Au,Pd |
R6813 |
T10598 |
T10596 |
punct |
-,Pd |
R6814 |
T10599 |
T10593 |
cc |
and,coating |
R6815 |
T10600 |
T10593 |
conj |
examination,coating |
R6816 |
T10601 |
T10600 |
prep |
with,examination |
R6817 |
T10602 |
T10603 |
amod |
scanning,microscopy |
R6818 |
T10603 |
T10601 |
pobj |
microscopy,with |
R6819 |
T10604 |
T10603 |
compound |
electron,microscopy |
R682 |
T1418 |
T1419 |
dep |
that,control |
R6820 |
T10605 |
T10606 |
punct |
(,Centre |
R6821 |
T10606 |
T10603 |
parataxis |
Centre,microscopy |
R6822 |
T10607 |
T10606 |
compound |
McGill,Centre |
R6823 |
T10608 |
T10609 |
compound |
Electron,Microscopy |
R6824 |
T10609 |
T10606 |
compound |
Microscopy,Centre |
R6825 |
T10610 |
T10606 |
punct |
),Centre |
R6826 |
T10611 |
T10575 |
punct |
.,left |
R6827 |
T10613 |
T10614 |
compound |
Light,microscope |
R6828 |
T10614 |
T10615 |
compound |
microscope,images |
R6829 |
T10615 |
T10616 |
nsubjpass |
images,captured |
R683 |
T1419 |
T1416 |
relcl |
control,factors |
R6830 |
T10617 |
T10616 |
auxpass |
were,captured |
R6831 |
T10618 |
T10616 |
advcl |
using,captured |
R6832 |
T10619 |
T10620 |
det |
a,microscope |
R6833 |
T10620 |
T10618 |
dobj |
microscope,using |
R6834 |
T10621 |
T10622 |
compound |
Leica,DMR |
R6835 |
T10622 |
T10620 |
compound |
DMR,microscope |
R6836 |
T10623 |
T10620 |
acl |
equipped,microscope |
R6837 |
T10624 |
T10623 |
prep |
with,equipped |
R6838 |
T10625 |
T10626 |
det |
a,camera |
R6839 |
T10626 |
T10624 |
pobj |
camera,with |
R684 |
T1420 |
T1421 |
det |
this,switch |
R6840 |
T10627 |
T10626 |
nmod |
Retiga,camera |
R6841 |
T10628 |
T10627 |
nummod |
1300,Retiga |
R6842 |
T10629 |
T10616 |
punct |
.,captured |
R6843 |
T10631 |
T10632 |
amod |
Quantitative,analyses |
R6844 |
T10632 |
T10633 |
nsubjpass |
analyses,performed |
R6845 |
T10634 |
T10633 |
auxpass |
were,performed |
R6846 |
T10635 |
T10633 |
advcl |
using,performed |
R6847 |
T10636 |
T10637 |
compound |
Adobe,Photoshop |
R6848 |
T10637 |
T10635 |
dobj |
Photoshop,using |
R6849 |
T10638 |
T10637 |
cc |
and,Photoshop |
R685 |
T1421 |
T1419 |
dobj |
switch,control |
R6850 |
T10639 |
T10640 |
det |
the,data |
R6851 |
T10640 |
T10637 |
conj |
data,Photoshop |
R6852 |
T10641 |
T10640 |
acl |
presented,data |
R6853 |
T10642 |
T10641 |
prep |
as,presented |
R6854 |
T10643 |
T10644 |
det |
the,SD |
R6855 |
T10644 |
T10642 |
pobj |
SD,as |
R6856 |
T10645 |
T10644 |
nmod |
mean,SD |
R6857 |
T10646 |
T10644 |
punct |
±,SD |
R6858 |
T10647 |
T10644 |
prep |
of,SD |
R6859 |
T10648 |
T10649 |
nummod |
two,experiments |
R686 |
T1422 |
T1423 |
npadvmod |
age,induced |
R6860 |
T10649 |
T10647 |
pobj |
experiments,of |
R6861 |
T10650 |
T10648 |
cc |
or,two |
R6862 |
T10651 |
T10648 |
conj |
three,two |
R6863 |
T10652 |
T10649 |
amod |
independent,experiments |
R6864 |
T10653 |
T10633 |
punct |
.,performed |
R6865 |
T10655 |
T10656 |
amod |
Statistical,comparisons |
R6866 |
T10656 |
T10657 |
nsubjpass |
comparisons,made |
R6867 |
T10658 |
T10657 |
auxpass |
were,made |
R6868 |
T10659 |
T10657 |
advcl |
using,made |
R6869 |
T10660 |
T10661 |
det |
the,Student |
R687 |
T1423 |
T1421 |
amod |
induced,switch |
R6870 |
T10661 |
T10662 |
poss |
Student,test |
R6871 |
T10662 |
T10659 |
dobj |
test,using |
R6872 |
T10663 |
T10661 |
case |
's,Student |
R6873 |
T10664 |
T10662 |
compound |
t,test |
R6874 |
T10665 |
T10657 |
punct |
.,made |
R6875 |
T10694 |
T10693 |
prep |
of,Preparation |
R6876 |
T10695 |
T10696 |
nmod |
mouse,fibroblast |
R6877 |
T10696 |
T10694 |
pobj |
fibroblast,of |
R6878 |
T10697 |
T10696 |
amod |
embryonic,fibroblast |
R6879 |
T10698 |
T10693 |
cc |
and,Preparation |
R688 |
T1424 |
T1423 |
punct |
-,induced |
R6880 |
T10699 |
T10693 |
conj |
induction,Preparation |
R6881 |
T10700 |
T10699 |
prep |
of,induction |
R6882 |
T10701 |
T10702 |
compound |
adipocyte,differentiation |
R6883 |
T10702 |
T10700 |
pobj |
differentiation,of |
R6884 |
T10703 |
T10699 |
punct |
.,induction |
R6885 |
T10705 |
T10706 |
nsubjpass |
MEFs,prepared |
R6886 |
T10707 |
T10706 |
auxpass |
were,prepared |
R6887 |
T10708 |
T10706 |
prep |
from,prepared |
R6888 |
T10709 |
T10710 |
nummod |
14.5,day |
R6889 |
T10710 |
T10712 |
npadvmod |
day,old |
R689 |
T1425 |
T1421 |
prep |
toward,switch |
R6890 |
T10711 |
T10710 |
punct |
-,day |
R6891 |
T10712 |
T10714 |
amod |
old,embryos |
R6892 |
T10713 |
T10712 |
punct |
-,old |
R6893 |
T10714 |
T10708 |
pobj |
embryos,from |
R6894 |
T10715 |
T10706 |
punct |
.,prepared |
R6895 |
T10717 |
T10718 |
advmod |
Only,MEFs |
R6896 |
T10718 |
T10722 |
nsubjpass |
MEFs,used |
R6897 |
T10719 |
T10720 |
amod |
early,passage |
R6898 |
T10720 |
T10718 |
compound |
passage,MEFs |
R6899 |
T10721 |
T10720 |
punct |
-,passage |
R690 |
T1426 |
T1427 |
amod |
adipogenic,differentiation |
R6900 |
T10723 |
T10722 |
auxpass |
were,used |
R6901 |
T10724 |
T10722 |
prep |
for,used |
R6902 |
T10725 |
T10726 |
det |
the,studies |
R6903 |
T10726 |
T10724 |
pobj |
studies,for |
R6904 |
T10727 |
T10726 |
amod |
experimental,studies |
R6905 |
T10728 |
T10722 |
punct |
", ",used |
R6906 |
T10729 |
T10722 |
cc |
and,used |
R6907 |
T10730 |
T10731 |
nsubjpass |
induction,carried |
R6908 |
T10731 |
T10722 |
conj |
carried,used |
R6909 |
T10732 |
T10730 |
prep |
of,induction |
R691 |
T1427 |
T1425 |
pobj |
differentiation,toward |
R6910 |
T10733 |
T10734 |
compound |
adipocyte,differentiation |
R6911 |
T10734 |
T10732 |
pobj |
differentiation,of |
R6912 |
T10735 |
T10731 |
auxpass |
was,carried |
R6913 |
T10736 |
T10731 |
prt |
out,carried |
R6914 |
T10737 |
T10731 |
prep |
according,carried |
R6915 |
T10738 |
T10737 |
prep |
to,according |
R6916 |
T10739 |
T10740 |
det |
the,methods |
R6917 |
T10740 |
T10738 |
pobj |
methods,to |
R6918 |
T10741 |
T10742 |
advmod |
previously,described |
R6919 |
T10742 |
T10740 |
acl |
described,methods |
R692 |
T1428 |
T1417 |
auxpass |
is,understood |
R6920 |
T10743 |
T10744 |
punct |
[,30 |
R6921 |
T10744 |
T10731 |
parataxis |
30,carried |
R6922 |
T10745 |
T10744 |
punct |
],30 |
R6923 |
T10746 |
T10731 |
punct |
.,carried |
R6924 |
T10748 |
T10749 |
amod |
Cultured,cells |
R6925 |
T10749 |
T10750 |
nsubjpass |
cells,stained |
R6926 |
T10751 |
T10750 |
auxpass |
were,stained |
R6927 |
T10752 |
T10750 |
prep |
with,stained |
R6928 |
T10753 |
T10754 |
compound |
Oil,O |
R6929 |
T10754 |
T10752 |
pobj |
O,with |
R693 |
T1429 |
T1417 |
neg |
not,understood |
R6930 |
T10755 |
T10754 |
compound |
Red,O |
R6931 |
T10756 |
T10757 |
mark |
as,described |
R6932 |
T10757 |
T10750 |
advcl |
described,stained |
R6933 |
T10758 |
T10759 |
punct |
[,29 |
R6934 |
T10759 |
T10750 |
parataxis |
29,stained |
R6935 |
T10760 |
T10759 |
punct |
],29 |
R6936 |
T10761 |
T10750 |
punct |
.,stained |
R6937 |
T10818 |
T10819 |
compound |
RNA,preparation |
R6938 |
T10820 |
T10819 |
cc |
and,preparation |
R6939 |
T10821 |
T10822 |
compound |
RT,PCR |
R694 |
T1430 |
T1417 |
advmod |
well,understood |
R6940 |
T10822 |
T10819 |
conj |
PCR,preparation |
R6941 |
T10823 |
T10822 |
punct |
-,PCR |
R6942 |
T10824 |
T10825 |
aux |
to,assess |
R6943 |
T10825 |
T10819 |
advcl |
assess,preparation |
R6944 |
T10826 |
T10825 |
dobj |
adipogenesis,assess |
R6945 |
T10827 |
T10825 |
prep |
in,assess |
R6946 |
T10828 |
T10829 |
nmod |
Sam68,MEFs |
R6947 |
T10829 |
T10827 |
pobj |
MEFs,in |
R6948 |
T10830 |
T10828 |
punct |
−,Sam68 |
R6949 |
T10831 |
T10828 |
punct |
/,Sam68 |
R695 |
T1431 |
T1432 |
punct |
[,24 |
R6950 |
T10832 |
T10828 |
punct |
−,Sam68 |
R6951 |
T10833 |
T10819 |
punct |
.,preparation |
R6952 |
T10835 |
T10836 |
amod |
Total,RNA |
R6953 |
T10836 |
T10838 |
nsubjpass |
RNA,prepared |
R6954 |
T10837 |
T10836 |
amod |
cellular,RNA |
R6955 |
T10839 |
T10838 |
auxpass |
was,prepared |
R6956 |
T10840 |
T10838 |
prep |
by,prepared |
R6957 |
T10841 |
T10842 |
compound |
TRIzol,reagent |
R6958 |
T10842 |
T10840 |
pobj |
reagent,by |
R6959 |
T10843 |
T10838 |
prep |
according,prepared |
R696 |
T1432 |
T1417 |
parataxis |
24,understood |
R6960 |
T10844 |
T10843 |
prep |
to,according |
R6961 |
T10845 |
T10846 |
det |
the,manufacturer |
R6962 |
T10846 |
T10847 |
poss |
manufacturer,protocol |
R6963 |
T10847 |
T10844 |
pobj |
protocol,to |
R6964 |
T10848 |
T10846 |
case |
's,manufacturer |
R6965 |
T10849 |
T10850 |
punct |
(,Invitrogen |
R6966 |
T10850 |
T10847 |
parataxis |
Invitrogen,protocol |
R6967 |
T10851 |
T10850 |
punct |
", ",Invitrogen |
R6968 |
T10852 |
T10850 |
npadvmod |
Carlsbad,Invitrogen |
R6969 |
T10853 |
T10850 |
punct |
", ",Invitrogen |
R697 |
T1433 |
T1432 |
punct |
],24 |
R6970 |
T10854 |
T10850 |
npadvmod |
California,Invitrogen |
R6971 |
T10855 |
T10850 |
punct |
", ",Invitrogen |
R6972 |
T10856 |
T10857 |
compound |
United,States |
R6973 |
T10857 |
T10850 |
npadvmod |
States,Invitrogen |
R6974 |
T10858 |
T10850 |
punct |
),Invitrogen |
R6975 |
T10859 |
T10838 |
punct |
.,prepared |
R6976 |
T10861 |
T10862 |
amod |
Total,RNA |
R6977 |
T10862 |
T10863 |
nsubjpass |
RNA,transcribed |
R6978 |
T10864 |
T10865 |
punct |
(,μg |
R6979 |
T10865 |
T10862 |
parataxis |
μg,RNA |
R698 |
T1434 |
T1417 |
punct |
.,understood |
R6980 |
T10866 |
T10865 |
nummod |
1,μg |
R6981 |
T10867 |
T10865 |
punct |
),μg |
R6982 |
T10868 |
T10863 |
auxpass |
was,transcribed |
R6983 |
T10869 |
T10863 |
advmod |
reverse,transcribed |
R6984 |
T10870 |
T10863 |
punct |
-,transcribed |
R6985 |
T10871 |
T10863 |
punct |
", ",transcribed |
R6986 |
T10872 |
T10863 |
cc |
and,transcribed |
R6987 |
T10873 |
T10874 |
compound |
cDNA,samples |
R6988 |
T10874 |
T10875 |
nsubjpass |
samples,subjected |
R6989 |
T10875 |
T10863 |
conj |
subjected,transcribed |
R699 |
T1436 |
T1437 |
mark |
While,associated |
R6990 |
T10876 |
T10875 |
auxpass |
were,subjected |
R6991 |
T10877 |
T10875 |
prep |
to,subjected |
R6992 |
T10878 |
T10877 |
pobj |
PCR,to |
R6993 |
T10879 |
T10875 |
punct |
.,subjected |
R6994 |
T10881 |
T10882 |
compound |
RT,PCR |
R6995 |
T10882 |
T10884 |
nsubjpass |
PCR,normalized |
R6996 |
T10883 |
T10882 |
punct |
-,PCR |
R6997 |
T10885 |
T10884 |
auxpass |
was,normalized |
R6998 |
T10886 |
T10884 |
agent |
by,normalized |
R6999 |
T10887 |
T10888 |
det |
the,level |
R700 |
T1437 |
T1444 |
advcl |
associated,remains |
R7000 |
T10888 |
T10886 |
pobj |
level,by |
R7001 |
T10889 |
T10888 |
amod |
transcriptional,level |
R7002 |
T10890 |
T10888 |
prep |
of,level |
R7003 |
T10891 |
T10890 |
pobj |
GAPDH,of |
R7004 |
T10892 |
T10884 |
punct |
.,normalized |
R7005 |
T10894 |
T10895 |
det |
The,primers |
R7006 |
T10895 |
T10902 |
nsubjpass |
primers,used |
R7007 |
T10896 |
T10895 |
amod |
following,primers |
R7008 |
T10897 |
T10895 |
nummod |
5,primers |
R7009 |
T10898 |
T10897 |
punct |
′,5 |
R701 |
T1438 |
T1439 |
amod |
several,proteins |
R7010 |
T10899 |
T10897 |
cc |
and,5 |
R7011 |
T10900 |
T10897 |
conj |
3,5 |
R7012 |
T10901 |
T10900 |
punct |
′,3 |
R7013 |
T10903 |
T10902 |
auxpass |
were,used |
R7014 |
T10904 |
T10905 |
aux |
to,evaluate |
R7015 |
T10905 |
T10902 |
advcl |
evaluate,used |
R7016 |
T10906 |
T10907 |
amod |
adipogenic,differentiation |
R7017 |
T10907 |
T10905 |
dobj |
differentiation,evaluate |
R7018 |
T10908 |
T10902 |
punct |
: ,used |
R7019 |
T10909 |
T10902 |
dep |
KLF5,used |
R702 |
T1439 |
T1437 |
nsubjpass |
proteins,associated |
R7020 |
T10910 |
T10909 |
punct |
: ,KLF5 |
R7021 |
T10911 |
T10909 |
appos |
5,KLF5 |
R7022 |
T10912 |
T10911 |
punct |
',5 |
R7023 |
T10913 |
T10911 |
punct |
-,5 |
R7024 |
T10914 |
T10915 |
compound |
AGA,C |
R7025 |
T10915 |
T10911 |
appos |
C,5 |
R7026 |
T10916 |
T10915 |
compound |
CAA,C |
R7027 |
T10917 |
T10915 |
compound |
GCT,C |
R7028 |
T10918 |
T10915 |
compound |
GAG,C |
R7029 |
T10919 |
T10915 |
compound |
ATG,C |
R703 |
T1440 |
T1439 |
amod |
transcriptional,proteins |
R7030 |
T10920 |
T10915 |
compound |
CTG,C |
R7031 |
T10921 |
T10911 |
punct |
-,5 |
R7032 |
T10922 |
T10911 |
nummod |
3,5 |
R7033 |
T10923 |
T10911 |
punct |
′,5 |
R7034 |
T10924 |
T10911 |
punct |
", ",5 |
R7035 |
T10925 |
T10911 |
appos |
5,5 |
R7036 |
T10926 |
T10925 |
punct |
′,5 |
R7037 |
T10927 |
T10925 |
punct |
-,5 |
R7038 |
T10928 |
T10929 |
compound |
GGC,GC |
R7039 |
T10929 |
T10925 |
appos |
GC,5 |
R704 |
T1441 |
T1439 |
amod |
regulatory,proteins |
R7040 |
T10930 |
T10929 |
compound |
AAA,GC |
R7041 |
T10931 |
T10929 |
compound |
CCT,GC |
R7042 |
T10932 |
T10929 |
compound |
CCA,GC |
R7043 |
T10933 |
T10929 |
compound |
GTC,GC |
R7044 |
T10934 |
T10925 |
punct |
-,5 |
R7045 |
T10935 |
T10925 |
nummod |
3,5 |
R7046 |
T10936 |
T10925 |
punct |
′,5 |
R7047 |
T10937 |
T10909 |
punct |
;,KLF5 |
R7048 |
T10938 |
T10909 |
conj |
PPARγ,KLF5 |
R7049 |
T10939 |
T10938 |
punct |
: ,PPARγ |
R705 |
T1442 |
T1437 |
aux |
have,associated |
R7050 |
T10940 |
T10938 |
appos |
5,PPARγ |
R7051 |
T10941 |
T10940 |
punct |
′,5 |
R7052 |
T10942 |
T10940 |
punct |
-,5 |
R7053 |
T10943 |
T10944 |
compound |
GTG,C |
R7054 |
T10944 |
T10940 |
appos |
C,5 |
R7055 |
T10945 |
T10944 |
compound |
CGA,C |
R7056 |
T10946 |
T10944 |
compound |
TCA,C |
R7057 |
T10947 |
T10944 |
compound |
AAG,C |
R7058 |
T10948 |
T10944 |
compound |
TAG,C |
R7059 |
T10949 |
T10944 |
compound |
AAC,C |
R706 |
T1443 |
T1437 |
auxpass |
been,associated |
R7060 |
T10950 |
T10944 |
compound |
CTG,C |
R7061 |
T10951 |
T10940 |
punct |
-,5 |
R7062 |
T10952 |
T10940 |
nummod |
3,5 |
R7063 |
T10953 |
T10940 |
punct |
′,5 |
R7064 |
T10954 |
T10940 |
punct |
", ",5 |
R7065 |
T10955 |
T10940 |
appos |
5,5 |
R7066 |
T10956 |
T10955 |
punct |
′,5 |
R7067 |
T10957 |
T10955 |
punct |
-,5 |
R7068 |
T10958 |
T10959 |
compound |
CCT,TCG |
R7069 |
T10959 |
T10955 |
appos |
TCG,5 |
R707 |
T1445 |
T1437 |
prep |
with,associated |
R7070 |
T10960 |
T10959 |
compound |
ATC,TCG |
R7071 |
T10961 |
T10959 |
compound |
ATA,TCG |
R7072 |
T10962 |
T10959 |
compound |
AAT,TCG |
R7073 |
T10963 |
T10959 |
compound |
AAG,TCG |
R7074 |
T10964 |
T10959 |
compound |
CTT,TCG |
R7075 |
T10965 |
T10959 |
compound |
CAA,TCG |
R7076 |
T10966 |
T10955 |
punct |
-,5 |
R7077 |
T10967 |
T10955 |
nummod |
3,5 |
R7078 |
T10968 |
T10955 |
punct |
′,5 |
R7079 |
T10969 |
T10938 |
punct |
;,PPARγ |
R708 |
T1446 |
T1447 |
compound |
cell,determination |
R7080 |
T10970 |
T10971 |
compound |
β,Actin |
R7081 |
T10971 |
T10938 |
conj |
Actin,PPARγ |
R7082 |
T10972 |
T10971 |
punct |
-,Actin |
R7083 |
T10973 |
T10971 |
punct |
: ,Actin |
R7084 |
T10974 |
T10971 |
appos |
5,Actin |
R7085 |
T10975 |
T10974 |
punct |
′,5 |
R7086 |
T10976 |
T10974 |
punct |
-,5 |
R7087 |
T10977 |
T10978 |
compound |
TAG,GC |
R7088 |
T10978 |
T10974 |
appos |
GC,5 |
R7089 |
T10979 |
T10978 |
compound |
GCG,GC |
R709 |
T1447 |
T1445 |
pobj |
determination,with |
R7090 |
T10980 |
T10978 |
compound |
GAC,GC |
R7091 |
T10981 |
T10978 |
compound |
TGT,GC |
R7092 |
T10982 |
T10978 |
compound |
TAC,GC |
R7093 |
T10983 |
T10978 |
compound |
TGA,GC |
R7094 |
T10984 |
T10974 |
punct |
-,5 |
R7095 |
T10985 |
T10974 |
nummod |
3,5 |
R7096 |
T10986 |
T10974 |
punct |
′,5 |
R7097 |
T10987 |
T10974 |
punct |
", ",5 |
R7098 |
T10988 |
T10974 |
appos |
5,5 |
R7099 |
T10989 |
T10988 |
punct |
′,5 |
R710 |
T1448 |
T1447 |
compound |
fate,determination |
R7100 |
T10990 |
T10988 |
punct |
-,5 |
R7101 |
T10991 |
T10992 |
compound |
AGC,TGG |
R7102 |
T10992 |
T10988 |
appos |
TGG,5 |
R7103 |
T10993 |
T10992 |
compound |
CTT,TGG |
R7104 |
T10994 |
T10992 |
compound |
CAT,TGG |
R7105 |
T10995 |
T10992 |
compound |
ACA,TGG |
R7106 |
T10996 |
T10992 |
compound |
TCA,TGG |
R7107 |
T10997 |
T10992 |
compound |
AGT,TGG |
R7108 |
T10998 |
T10988 |
punct |
-,5 |
R7109 |
T10999 |
T10988 |
nummod |
3,5 |
R711 |
T1449 |
T1447 |
prep |
of,determination |
R7110 |
T11000 |
T10988 |
punct |
′,5 |
R7111 |
T11001 |
T10971 |
punct |
;,Actin |
R7112 |
T11002 |
T10971 |
cc |
and,Actin |
R7113 |
T11003 |
T10971 |
conj |
Sam68,Actin |
R7114 |
T11004 |
T11003 |
punct |
: ,Sam68 |
R7115 |
T11005 |
T11003 |
appos |
5,Sam68 |
R7116 |
T11006 |
T11005 |
punct |
′,5 |
R7117 |
T11007 |
T11005 |
punct |
-,5 |
R7118 |
T11008 |
T11009 |
compound |
GTG,A |
R7119 |
T11009 |
T11005 |
appos |
A,5 |
R712 |
T1450 |
T1451 |
nmod |
bone,marrow |
R7120 |
T11010 |
T11009 |
compound |
GAG,A |
R7121 |
T11011 |
T11009 |
compound |
ACC,A |
R7122 |
T11012 |
T11009 |
compound |
CCA,A |
R7123 |
T11013 |
T11009 |
compound |
AAT,A |
R7124 |
T11014 |
T11009 |
compound |
ATG,A |
R7125 |
T11015 |
T11009 |
compound |
CCC,A |
R7126 |
T11016 |
T11005 |
punct |
-,5 |
R7127 |
T11017 |
T11005 |
nummod |
3,5 |
R7128 |
T11018 |
T11005 |
punct |
′,5 |
R7129 |
T11019 |
T11005 |
cc |
and,5 |
R713 |
T1451 |
T1452 |
nmod |
marrow,cells |
R7130 |
T11020 |
T11005 |
conj |
5,5 |
R7131 |
T11021 |
T11020 |
punct |
′,5 |
R7132 |
T11022 |
T11020 |
punct |
-,5 |
R7133 |
T11023 |
T11024 |
compound |
AAA,A |
R7134 |
T11024 |
T11020 |
appos |
A,5 |
R7135 |
T11025 |
T11024 |
compound |
CTG,A |
R7136 |
T11026 |
T11024 |
compound |
CTC,A |
R7137 |
T11027 |
T11024 |
compound |
CTG,A |
R7138 |
T11028 |
T11024 |
compound |
ACA,A |
R7139 |
T11029 |
T11024 |
compound |
GAT,A |
R714 |
T1452 |
T1449 |
pobj |
cells,of |
R7140 |
T11030 |
T11024 |
compound |
ATC,A |
R7141 |
T11031 |
T11020 |
punct |
-,5 |
R7142 |
T11032 |
T11020 |
nummod |
3,5 |
R7143 |
T11033 |
T11020 |
punct |
′,5 |
R7144 |
T11034 |
T10902 |
punct |
.,used |
R7145 |
T11076 |
T11077 |
nmod |
Sam68,regulation |
R7146 |
T11078 |
T11077 |
advmod |
down,regulation |
R7147 |
T11079 |
T11077 |
punct |
-,regulation |
R7148 |
T11080 |
T11077 |
acl |
using,regulation |
R7149 |
T11081 |
T11080 |
dobj |
Sam68sh,using |
R715 |
T1453 |
T1452 |
amod |
mesenchymal,cells |
R7150 |
T11082 |
T11077 |
punct |
.,regulation |
R7151 |
T11084 |
T11085 |
aux |
To,generate |
R7152 |
T11085 |
T11086 |
advcl |
generate,purchased |
R7153 |
T11087 |
T11088 |
det |
an,shRNA |
R7154 |
T11088 |
T11085 |
dobj |
shRNA,generate |
R7155 |
T11089 |
T11086 |
punct |
", ",purchased |
R7156 |
T11090 |
T11091 |
nummod |
64,base |
R7157 |
T11091 |
T11093 |
compound |
base,nucleotides |
R7158 |
T11092 |
T11091 |
punct |
-,base |
R7159 |
T11093 |
T11086 |
nsubjpass |
nucleotides,purchased |
R716 |
T1454 |
T1452 |
punct |
", ",cells |
R7160 |
T11094 |
T11093 |
compound |
duplex,nucleotides |
R7161 |
T11095 |
T11093 |
compound |
DNA,nucleotides |
R7162 |
T11096 |
T11086 |
auxpass |
were,purchased |
R7163 |
T11097 |
T11086 |
prep |
from,purchased |
R7164 |
T11098 |
T11097 |
pobj |
Invitrogen,from |
R7165 |
T11099 |
T11086 |
punct |
.,purchased |
R7166 |
T11101 |
T11102 |
det |
This,fragment |
R7167 |
T11102 |
T11103 |
nsubj |
fragment,comprised |
R7168 |
T11104 |
T11105 |
nummod |
19,residues |
R7169 |
T11105 |
T11103 |
dobj |
residues,comprised |
R717 |
T1455 |
T1452 |
prep |
including,cells |
R7170 |
T11106 |
T11105 |
compound |
base,residues |
R7171 |
T11107 |
T11105 |
amod |
specific,residues |
R7172 |
T11108 |
T11107 |
prep |
to,specific |
R7173 |
T11109 |
T11110 |
compound |
mouse,Sam68 |
R7174 |
T11110 |
T11108 |
pobj |
Sam68,to |
R7175 |
T11111 |
T11112 |
punct |
(,TTTTTGGAAA |
R7176 |
T11112 |
T11103 |
parataxis |
TTTTTGGAAA,comprised |
R7177 |
T11113 |
T11112 |
compound |
GATCCCC,TTTTTGGAAA |
R7178 |
T11114 |
T11112 |
compound |
AAGATGACGAGGAGAATTATTCAAGAGA,TTTTTGGAAA |
R7179 |
T11115 |
T11112 |
compound |
TAATTCTCCTCGTCATCTT,TTTTTGGAAA |
R718 |
T1456 |
T1457 |
nmod |
peroxisome,receptor |
R7180 |
T11116 |
T11112 |
punct |
),TTTTTGGAAA |
R7181 |
T11117 |
T11103 |
punct |
.,comprised |
R7182 |
T11119 |
T11120 |
det |
This,fragment |
R7183 |
T11120 |
T11121 |
nsubjpass |
fragment,cloned |
R7184 |
T11122 |
T11121 |
auxpass |
was,cloned |
R7185 |
T11123 |
T11121 |
prep |
into,cloned |
R7186 |
T11124 |
T11125 |
compound |
pSUPER,retro |
R7187 |
T11125 |
T11123 |
pobj |
retro,into |
R7188 |
T11126 |
T11127 |
punct |
(,OligoEngine |
R7189 |
T11127 |
T11125 |
parataxis |
OligoEngine,retro |
R719 |
T1457 |
T1455 |
pobj |
receptor,including |
R7190 |
T11128 |
T11127 |
punct |
", ",OligoEngine |
R7191 |
T11129 |
T11127 |
npadvmod |
Seattle,OligoEngine |
R7192 |
T11130 |
T11127 |
punct |
", ",OligoEngine |
R7193 |
T11131 |
T11127 |
npadvmod |
Washington,OligoEngine |
R7194 |
T11132 |
T11127 |
punct |
", ",OligoEngine |
R7195 |
T11133 |
T11134 |
compound |
United,States |
R7196 |
T11134 |
T11127 |
npadvmod |
States,OligoEngine |
R7197 |
T11135 |
T11127 |
punct |
),OligoEngine |
R7198 |
T11136 |
T11121 |
punct |
.,cloned |
R7199 |
T11138 |
T11139 |
nsubjpass |
Transfections,performed |
R720 |
T1458 |
T1459 |
npadvmod |
proliferator,activated |
R7200 |
T11140 |
T11139 |
auxpass |
were,performed |
R7201 |
T11141 |
T11139 |
advcl |
using,performed |
R7202 |
T11142 |
T11143 |
compound |
LipofectAMINE,Plus |
R7203 |
T11143 |
T11141 |
dobj |
Plus,using |
R7204 |
T11144 |
T11145 |
punct |
(,Invitrogen |
R7205 |
T11145 |
T11143 |
parataxis |
Invitrogen,Plus |
R7206 |
T11146 |
T11145 |
punct |
),Invitrogen |
R7207 |
T11147 |
T11141 |
prep |
with,using |
R7208 |
T11148 |
T11149 |
amod |
cloned,fragment |
R7209 |
T11149 |
T11147 |
pobj |
fragment,with |
R721 |
T1459 |
T1457 |
amod |
activated,receptor |
R7210 |
T11150 |
T11149 |
compound |
DNA,fragment |
R7211 |
T11151 |
T11149 |
cc |
or,fragment |
R7212 |
T11152 |
T11153 |
amod |
empty,vector |
R7213 |
T11153 |
T11149 |
conj |
vector,fragment |
R7214 |
T11154 |
T11139 |
punct |
.,performed |
R7215 |
T11156 |
T11157 |
prep |
At,selected |
R7216 |
T11158 |
T11159 |
nummod |
48,h |
R7217 |
T11159 |
T11156 |
pobj |
h,At |
R7218 |
T11160 |
T11159 |
prep |
after,h |
R7219 |
T11161 |
T11160 |
pobj |
transfection,after |
R722 |
T1460 |
T1459 |
punct |
–,activated |
R7220 |
T11162 |
T11157 |
punct |
", ",selected |
R7221 |
T11163 |
T11157 |
nsubjpass |
populations,selected |
R7222 |
T11164 |
T11157 |
auxpass |
were,selected |
R7223 |
T11165 |
T11157 |
prep |
for,selected |
R7224 |
T11166 |
T11167 |
nummod |
2.5,μg |
R7225 |
T11167 |
T11168 |
nmod |
μg,puromycin |
R7226 |
T11168 |
T11165 |
pobj |
puromycin,for |
R7227 |
T11169 |
T11170 |
punct |
/,ml |
R7228 |
T11170 |
T11167 |
prep |
ml,μg |
R7229 |
T11171 |
T11157 |
cc |
and,selected |
R723 |
T1461 |
T1457 |
punct |
γ,receptor |
R7230 |
T11172 |
T11173 |
det |
the,knockdown |
R7231 |
T11173 |
T11174 |
nsubj |
knockdown,observed |
R7232 |
T11174 |
T11157 |
conj |
observed,selected |
R7233 |
T11175 |
T11174 |
prep |
by,observed |
R7234 |
T11176 |
T11175 |
pcomp |
immunoblotting,by |
R7235 |
T11177 |
T11176 |
prep |
with,immunoblotting |
R7236 |
T11178 |
T11179 |
nmod |
anti-Sam68,antibody |
R7237 |
T11179 |
T11177 |
pobj |
antibody,with |
R7238 |
T11180 |
T11181 |
punct |
(,AD1 |
R7239 |
T11181 |
T11178 |
parataxis |
AD1,anti-Sam68 |
R724 |
T1462 |
T1457 |
punct |
(,receptor |
R7240 |
T11182 |
T11181 |
punct |
),AD1 |
R7241 |
T11183 |
T11157 |
punct |
.,selected |
R7242 |
T11232 |
T11233 |
amod |
Osteogenic,analysis |
R7243 |
T11234 |
T11233 |
compound |
differentiation,analysis |
R7244 |
T11235 |
T11233 |
prep |
of,analysis |
R7245 |
T11236 |
T11237 |
nmod |
C3HT101,cells |
R7246 |
T11237 |
T11235 |
pobj |
cells,of |
R7247 |
T11238 |
T11236 |
punct |
/,C3HT101 |
R7248 |
T11239 |
T11236 |
nummod |
2,C3HT101 |
R7249 |
T11240 |
T11233 |
punct |
.,analysis |
R725 |
T1463 |
T1457 |
appos |
PPARγ,receptor |
R7250 |
T11242 |
T11243 |
prep |
For,incubated |
R7251 |
T11244 |
T11245 |
amod |
osteogenic,differentiation |
R7252 |
T11245 |
T11242 |
pobj |
differentiation,For |
R7253 |
T11246 |
T11243 |
punct |
", ",incubated |
R7254 |
T11247 |
T11248 |
nmod |
C3HT101,cells |
R7255 |
T11248 |
T11243 |
nsubjpass |
cells,incubated |
R7256 |
T11249 |
T11247 |
punct |
/,C3HT101 |
R7257 |
T11250 |
T11247 |
nummod |
2,C3HT101 |
R7258 |
T11251 |
T11252 |
punct |
(,ATCC |
R7259 |
T11252 |
T11247 |
parataxis |
ATCC,C3HT101 |
R726 |
T1464 |
T1457 |
punct |
),receptor |
R7260 |
T11253 |
T11252 |
punct |
),ATCC |
R7261 |
T11254 |
T11243 |
auxpass |
were,incubated |
R7262 |
T11255 |
T11243 |
prep |
in,incubated |
R7263 |
T11256 |
T11257 |
nummod |
48,well |
R7264 |
T11257 |
T11259 |
compound |
well,plates |
R7265 |
T11258 |
T11257 |
punct |
-,well |
R7266 |
T11259 |
T11255 |
pobj |
plates,in |
R7267 |
T11260 |
T11259 |
compound |
tissue,plates |
R7268 |
T11261 |
T11259 |
compound |
culture,plates |
R7269 |
T11262 |
T11243 |
prep |
at,incubated |
R727 |
T1465 |
T1457 |
cc |
and,receptor |
R7270 |
T11263 |
T11264 |
quantmod |
1.25,104 |
R7271 |
T11264 |
T11266 |
nummod |
104,cells |
R7272 |
T11265 |
T11264 |
punct |
×,104 |
R7273 |
T11266 |
T11262 |
pobj |
cells,at |
R7274 |
T11267 |
T11268 |
punct |
/,cm2 |
R7275 |
T11268 |
T11266 |
prep |
cm2,cells |
R7276 |
T11269 |
T11243 |
punct |
.,incubated |
R7277 |
T11271 |
T11272 |
prep |
After,changed |
R7278 |
T11273 |
T11274 |
nummod |
24,h |
R7279 |
T11274 |
T11276 |
compound |
h,incubation |
R728 |
T1466 |
T1457 |
conj |
KLF5,receptor |
R7280 |
T11275 |
T11274 |
punct |
-,h |
R7281 |
T11276 |
T11271 |
pobj |
incubation,After |
R7282 |
T11277 |
T11272 |
punct |
", ",changed |
R7283 |
T11278 |
T11279 |
det |
the,media |
R7284 |
T11279 |
T11272 |
nsubjpass |
media,changed |
R7285 |
T11280 |
T11279 |
compound |
culture,media |
R7286 |
T11281 |
T11272 |
auxpass |
were,changed |
R7287 |
T11282 |
T11272 |
prep |
to,changed |
R7288 |
T11283 |
T11284 |
amod |
fresh,media |
R7289 |
T11284 |
T11282 |
pobj |
media,to |
R729 |
T1467 |
T1468 |
punct |
[,25 |
R7290 |
T11285 |
T11284 |
acl |
containing,media |
R7291 |
T11286 |
T11287 |
nummod |
300,ng |
R7292 |
T11287 |
T11288 |
nmod |
ng,BMP |
R7293 |
T11288 |
T11285 |
dobj |
BMP,containing |
R7294 |
T11289 |
T11290 |
punct |
/,ml |
R7295 |
T11290 |
T11287 |
prep |
ml,ng |
R7296 |
T11291 |
T11288 |
punct |
-,BMP |
R7297 |
T11292 |
T11288 |
nummod |
2,BMP |
R7298 |
T11293 |
T11294 |
punct |
(,Sigma |
R7299 |
T11294 |
T11288 |
parataxis |
Sigma,BMP |
R730 |
T1468 |
T1437 |
parataxis |
25,associated |
R7300 |
T11295 |
T11294 |
punct |
", ",Sigma |
R7301 |
T11296 |
T11297 |
compound |
St.,Louis |
R7302 |
T11297 |
T11294 |
npadvmod |
Louis,Sigma |
R7303 |
T11298 |
T11294 |
punct |
", ",Sigma |
R7304 |
T11299 |
T11294 |
npadvmod |
Missouri,Sigma |
R7305 |
T11300 |
T11294 |
punct |
", ",Sigma |
R7306 |
T11301 |
T11302 |
compound |
United,States |
R7307 |
T11302 |
T11294 |
npadvmod |
States,Sigma |
R7308 |
T11303 |
T11294 |
punct |
),Sigma |
R7309 |
T11304 |
T11272 |
punct |
.,changed |
R731 |
T1469 |
T1470 |
punct |
–,30 |
R7310 |
T11306 |
T11307 |
amod |
Total,RNA |
R7311 |
T11307 |
T11309 |
nsubjpass |
RNA,prepared |
R7312 |
T11308 |
T11307 |
amod |
cellular,RNA |
R7313 |
T11310 |
T11309 |
auxpass |
was,prepared |
R7314 |
T11311 |
T11312 |
mark |
as,described |
R7315 |
T11312 |
T11309 |
advcl |
described,prepared |
R7316 |
T11313 |
T11312 |
advmod |
above,described |
R7317 |
T11314 |
T11309 |
punct |
", ",prepared |
R7318 |
T11315 |
T11309 |
cc |
and,prepared |
R7319 |
T11316 |
T11317 |
nmod |
osteocalcin,expression |
R732 |
T1470 |
T1468 |
prep |
30,25 |
R7320 |
T11317 |
T11326 |
nsubjpass |
expression,quantified |
R7321 |
T11318 |
T11316 |
punct |
", ",osteocalcin |
R7322 |
T11319 |
T11320 |
compound |
β,actin |
R7323 |
T11320 |
T11316 |
conj |
actin,osteocalcin |
R7324 |
T11321 |
T11320 |
punct |
-,actin |
R7325 |
T11322 |
T11320 |
punct |
", ",actin |
R7326 |
T11323 |
T11320 |
cc |
and,actin |
R7327 |
T11324 |
T11320 |
conj |
GAPDH,actin |
R7328 |
T11325 |
T11317 |
compound |
gene,expression |
R7329 |
T11326 |
T11309 |
conj |
quantified,prepared |
R733 |
T1471 |
T1468 |
punct |
],25 |
R7330 |
T11327 |
T11317 |
prep |
at,expression |
R7331 |
T11328 |
T11329 |
amod |
indicated,times |
R7332 |
T11329 |
T11327 |
pobj |
times,at |
R7333 |
T11330 |
T11329 |
prep |
after,times |
R7334 |
T11331 |
T11332 |
nmod |
BMP,treatment |
R7335 |
T11332 |
T11330 |
pobj |
treatment,after |
R7336 |
T11333 |
T11331 |
punct |
-,BMP |
R7337 |
T11334 |
T11331 |
nummod |
2,BMP |
R7338 |
T11335 |
T11326 |
auxpass |
was,quantified |
R7339 |
T11336 |
T11326 |
prep |
by,quantified |
R734 |
T1472 |
T1444 |
punct |
", ",remains |
R7340 |
T11337 |
T11338 |
compound |
RT,PCR |
R7341 |
T11338 |
T11336 |
pobj |
PCR,by |
R7342 |
T11339 |
T11338 |
punct |
-,PCR |
R7343 |
T11340 |
T11326 |
punct |
.,quantified |
R735 |
T1473 |
T1474 |
det |
the,role |
R736 |
T1474 |
T1444 |
nsubj |
role,remains |
R737 |
T1475 |
T1474 |
prep |
of,role |
R738 |
T1476 |
T1477 |
compound |
RNA,proteins |
R739 |
T1477 |
T1475 |
pobj |
proteins,of |
R740 |
T1478 |
T1477 |
compound |
binding,proteins |
R741 |
T1479 |
T1474 |
prep |
in,role |
R742 |
T1480 |
T1481 |
det |
this,process |
R743 |
T1481 |
T1479 |
pobj |
process,in |
R744 |
T1482 |
T1444 |
acomp |
unknown,remains |
R745 |
T1483 |
T1444 |
punct |
.,remains |
R746 |
T1485 |
T1486 |
compound |
RNA,proteins |
R747 |
T1486 |
T1488 |
nsubj |
proteins,are |
R748 |
T1487 |
T1486 |
compound |
binding,proteins |
R749 |
T1489 |
T1486 |
prep |
of,proteins |
R750 |
T1490 |
T1491 |
det |
the,type |
R751 |
T1491 |
T1489 |
pobj |
type,of |
R752 |
T1492 |
T1491 |
compound |
KH,type |
R753 |
T1493 |
T1494 |
amod |
known,regulators |
R754 |
T1494 |
T1488 |
attr |
regulators,are |
R755 |
T1495 |
T1494 |
prep |
of,regulators |
R756 |
T1496 |
T1497 |
amod |
cellular,differentiation |
R757 |
T1497 |
T1495 |
pobj |
differentiation,of |
R758 |
T1498 |
T1488 |
punct |
.,are |
R759 |
T1500 |
T1501 |
prep |
For,known |
R760 |
T1502 |
T1500 |
pobj |
example,For |
R761 |
T1503 |
T1501 |
punct |
", ",known |
R762 |
T1504 |
T1505 |
compound |
expression,defects |
R763 |
T1505 |
T1501 |
nsubjpass |
defects,known |
R764 |
T1506 |
T1505 |
prep |
in,defects |
R765 |
T1507 |
T1508 |
det |
the,proteins |
R766 |
T1508 |
T1506 |
pobj |
proteins,in |
R767 |
T1509 |
T1510 |
compound |
KH,domain |
R768 |
T1510 |
T1508 |
compound |
domain,proteins |
R769 |
T1511 |
T1508 |
appos |
NOVA,proteins |
R770 |
T1512 |
T1511 |
cc |
and,NOVA |
R771 |
T1513 |
T1511 |
conj |
FMRP,NOVA |
R772 |
T1514 |
T1501 |
auxpass |
are,known |
R773 |
T1515 |
T1516 |
aux |
to,cause |
R774 |
T1516 |
T1501 |
xcomp |
cause,known |
R775 |
T1517 |
T1518 |
amod |
paraneoplastic,disorders |
R776 |
T1518 |
T1516 |
dobj |
disorders,cause |
R777 |
T1519 |
T1518 |
amod |
neurologic,disorders |
R778 |
T1520 |
T1521 |
punct |
[,31 |
R779 |
T1521 |
T1518 |
parataxis |
31,disorders |
R780 |
T1522 |
T1521 |
punct |
],31 |
R781 |
T1523 |
T1518 |
cc |
and,disorders |
R782 |
T1524 |
T1525 |
det |
the,syndrome |
R783 |
T1525 |
T1518 |
conj |
syndrome,disorders |
R784 |
T1526 |
T1527 |
amod |
fragile,X |
R785 |
T1527 |
T1525 |
compound |
X,syndrome |
R786 |
T1528 |
T1516 |
punct |
", ",cause |
R787 |
T1529 |
T1516 |
advmod |
respectively,cause |
R788 |
T1530 |
T1516 |
punct |
", ",cause |
R789 |
T1531 |
T1516 |
prep |
in,cause |
R790 |
T1532 |
T1531 |
pobj |
humans,in |
R791 |
T1533 |
T1534 |
punct |
[,32 |
R792 |
T1534 |
T1516 |
parataxis |
32,cause |
R793 |
T1535 |
T1534 |
punct |
],32 |
R794 |
T1536 |
T1501 |
punct |
.,known |
R795 |
T1538 |
T1539 |
det |
The,phenotype |
R796 |
T1539 |
T1540 |
nsubj |
phenotype,suggests |
R797 |
T1541 |
T1539 |
prep |
of,phenotype |
R798 |
T1542 |
T1543 |
det |
the,mice |
R799 |
T1543 |
T1541 |
pobj |
mice,of |
R800 |
T1544 |
T1543 |
nmod |
quaking,mice |
R801 |
T1545 |
T1543 |
amod |
viable,mice |
R802 |
T1546 |
T1547 |
det |
a,role |
R803 |
T1547 |
T1540 |
dobj |
role,suggests |
R804 |
T1548 |
T1547 |
prep |
for,role |
R805 |
T1549 |
T1550 |
det |
the,protein |
R806 |
T1550 |
T1548 |
pobj |
protein,for |
R807 |
T1551 |
T1550 |
compound |
QUAKING,protein |
R808 |
T1552 |
T1553 |
compound |
RNA,binding |
R809 |
T1553 |
T1550 |
compound |
binding,protein |
R810 |
T1554 |
T1547 |
prep |
in,role |
R811 |
T1555 |
T1554 |
pobj |
oligodendrocytes,in |
R812 |
T1556 |
T1555 |
cc |
and,oligodendrocytes |
R813 |
T1557 |
T1555 |
conj |
myelination,oligodendrocytes |
R814 |
T1558 |
T1559 |
punct |
[,33 |
R815 |
T1559 |
T1540 |
parataxis |
33,suggests |
R816 |
T1560 |
T1559 |
punct |
],33 |
R817 |
T1561 |
T1540 |
punct |
.,suggests |
R818 |
T1563 |
T1564 |
advmod |
Indeed,led |
R819 |
T1565 |
T1564 |
punct |
", ",led |
R820 |
T1566 |
T1567 |
det |
the,expression |
R821 |
T1567 |
T1564 |
nsubj |
expression,led |
R822 |
T1568 |
T1567 |
amod |
ectopic,expression |
R823 |
T1569 |
T1567 |
prep |
of,expression |
R824 |
T1570 |
T1571 |
det |
the,isoforms |
R825 |
T1571 |
T1569 |
pobj |
isoforms,of |
R826 |
T1572 |
T1573 |
nmod |
QKI,7 |
R827 |
T1573 |
T1571 |
nummod |
7,isoforms |
R828 |
T1574 |
T1573 |
punct |
-,7 |
R829 |
T1575 |
T1573 |
nummod |
6,7 |
R830 |
T1576 |
T1573 |
punct |
/,7 |
R831 |
T1577 |
T1578 |
advmod |
in,vivo |
R832 |
T1578 |
T1564 |
advmod |
vivo,led |
R833 |
T1579 |
T1564 |
prep |
to,led |
R834 |
T1580 |
T1581 |
det |
the,formation |
R835 |
T1581 |
T1579 |
pobj |
formation,to |
R836 |
T1582 |
T1581 |
prep |
of,formation |
R837 |
T1583 |
T1584 |
amod |
glial,cells |
R838 |
T1584 |
T1582 |
pobj |
cells,of |
R839 |
T1585 |
T1586 |
advmod |
rather,than |
R840 |
T1586 |
T1584 |
cc |
than,cells |
R841 |
T1587 |
T1584 |
conj |
neurons,cells |
R842 |
T1588 |
T1581 |
prep |
from,formation |
R843 |
T1589 |
T1590 |
amod |
neural,progenitor |
R844 |
T1590 |
T1588 |
pobj |
progenitor,from |
R845 |
T1591 |
T1564 |
punct |
", ",led |
R846 |
T1592 |
T1564 |
advcl |
demonstrating,led |
R847 |
T1593 |
T1594 |
poss |
its,role |
R848 |
T1594 |
T1592 |
dobj |
role,demonstrating |
R849 |
T1595 |
T1594 |
prep |
in,role |
R850 |
T1596 |
T1597 |
compound |
cell,determination |
R851 |
T1597 |
T1595 |
pobj |
determination,in |
R852 |
T1598 |
T1597 |
compound |
fate,determination |
R853 |
T1599 |
T1600 |
punct |
[,34 |
R854 |
T1600 |
T1564 |
parataxis |
34,led |
R855 |
T1601 |
T1600 |
punct |
],34 |
R856 |
T1602 |
T1564 |
punct |
.,led |
R857 |
T1604 |
T1605 |
det |
The,loss |
R858 |
T1605 |
T1606 |
nsubj |
loss,prevents |
R859 |
T1607 |
T1605 |
prep |
of,loss |
R860 |
T1608 |
T1609 |
nmod |
GLD,protein |
R861 |
T1609 |
T1607 |
pobj |
protein,of |
R862 |
T1610 |
T1608 |
punct |
-,GLD |
R863 |
T1611 |
T1608 |
nummod |
1,GLD |
R864 |
T1612 |
T1605 |
prep |
in,loss |
R865 |
T1613 |
T1614 |
compound |
Caenorhabditis,elegans |
R866 |
T1614 |
T1612 |
pobj |
elegans,in |
R867 |
T1615 |
T1616 |
det |
the,appearance |
R868 |
T1616 |
T1606 |
dobj |
appearance,prevents |
R869 |
T1617 |
T1616 |
prep |
of,appearance |
R870 |
T1618 |
T1619 |
compound |
stem,cells |
R871 |
T1619 |
T1617 |
pobj |
cells,of |
R872 |
T1620 |
T1621 |
punct |
[,35 |
R873 |
T1621 |
T1606 |
parataxis |
35,prevents |
R874 |
T1622 |
T1621 |
punct |
],35 |
R875 |
T1623 |
T1606 |
punct |
", ",prevents |
R876 |
T1624 |
T1606 |
cc |
and,prevents |
R877 |
T1625 |
T1626 |
det |
the,absence |
R878 |
T1626 |
T1627 |
nsubj |
absence,prevents |
R879 |
T1627 |
T1606 |
conj |
prevents,prevents |
R880 |
T1628 |
T1626 |
prep |
of,absence |
R881 |
T1629 |
T1630 |
det |
the,protein |
R882 |
T1630 |
T1628 |
pobj |
protein,of |
R883 |
T1631 |
T1630 |
compound |
KH,protein |
R884 |
T1632 |
T1630 |
compound |
domain,protein |
R885 |
T1633 |
T1630 |
appos |
HOW,protein |
R886 |
T1634 |
T1626 |
prep |
in,absence |
R887 |
T1635 |
T1634 |
pobj |
Drosophila,in |
R888 |
T1636 |
T1637 |
compound |
muscle,differentiation |
R889 |
T1637 |
T1627 |
dobj |
differentiation,prevents |
R890 |
T1638 |
T1627 |
cc |
and,prevents |
R891 |
T1639 |
T1627 |
conj |
results,prevents |
R892 |
T1640 |
T1639 |
prep |
in,results |
R893 |
T1641 |
T1640 |
pobj |
flies,in |
R894 |
T1642 |
T1641 |
prep |
with,flies |
R895 |
T1643 |
T1644 |
amod |
held,wings |
R896 |
T1644 |
T1642 |
pobj |
wings,with |
R897 |
T1645 |
T1643 |
punct |
-,held |
R898 |
T1646 |
T1643 |
prt |
out,held |
R899 |
T1647 |
T1644 |
punct |
-,wings |
R900 |
T1648 |
T1649 |
punct |
[,37 |
R901 |
T1649 |
T1639 |
parataxis |
37,results |
R902 |
T1650 |
T1649 |
nummod |
36,37 |
R903 |
T1651 |
T1649 |
punct |
",",37 |
R904 |
T1652 |
T1649 |
punct |
],37 |
R905 |
T1653 |
T1627 |
punct |
.,prevents |
R906 |
T1655 |
T1656 |
det |
The,substrate |
R907 |
T1656 |
T1658 |
nsubj |
substrate,is |
R908 |
T1657 |
T1656 |
compound |
Src,substrate |
R909 |
T1658 |
T1668 |
ccomp |
is,remained |
R910 |
T1659 |
T1656 |
acl |
associated,substrate |
R911 |
T1660 |
T1659 |
prep |
in,associated |
R912 |
T1661 |
T1660 |
pobj |
mitosis,in |
R913 |
T1662 |
T1661 |
prep |
of,mitosis |
R914 |
T1663 |
T1664 |
nummod |
68,kDa |
R915 |
T1664 |
T1662 |
pobj |
kDa,of |
R916 |
T1665 |
T1666 |
punct |
(,Sam68 |
R917 |
T1666 |
T1659 |
parataxis |
Sam68,associated |
R918 |
T1667 |
T1666 |
punct |
),Sam68 |
R919 |
T1669 |
T1658 |
advmod |
also,is |
R920 |
T1670 |
T1671 |
det |
a,member |
R921 |
T1671 |
T1658 |
attr |
member,is |
R922 |
T1672 |
T1671 |
prep |
of,member |
R923 |
T1673 |
T1674 |
det |
the,family |
R924 |
T1674 |
T1672 |
pobj |
family,of |
R925 |
T1675 |
T1674 |
prep |
of,family |
R926 |
T1676 |
T1677 |
compound |
KH,proteins |
R927 |
T1677 |
T1675 |
pobj |
proteins,of |
R928 |
T1678 |
T1677 |
compound |
domain,proteins |
R929 |
T1679 |
T1680 |
compound |
RNA,binding |
R930 |
T1680 |
T1677 |
compound |
binding,proteins |
R931 |
T1681 |
T1682 |
punct |
[,38 |
R932 |
T1682 |
T1658 |
parataxis |
38,is |
R933 |
T1683 |
T1682 |
punct |
],38 |
R934 |
T1684 |
T1668 |
punct |
;,remained |
R935 |
T1685 |
T1668 |
advmod |
however,remained |
R936 |
T1686 |
T1668 |
punct |
", ",remained |
R937 |
T1687 |
T1688 |
poss |
its,role |
R938 |
T1688 |
T1668 |
nsubj |
role,remained |
R939 |
T1689 |
T1688 |
amod |
physiologic,role |
R940 |
T1690 |
T1668 |
aux |
has,remained |
R941 |
T1691 |
T1668 |
acomp |
undefined,remained |
R942 |
T1692 |
T1668 |
punct |
.,remained |
R943 |
T1721 |
T1719 |
prep |
42,39 |
R944 |
T1694 |
T1695 |
nsubjpass |
Sam68,identified |
R945 |
T1722 |
T1719 |
punct |
],39 |
R946 |
T1723 |
T1715 |
cc |
and,of |
R947 |
T1724 |
T1715 |
conj |
of,of |
R948 |
T1725 |
T1726 |
det |
the,kinase |
R949 |
T1696 |
T1695 |
auxpass |
was,identified |
R950 |
T1726 |
T1724 |
pobj |
kinase,of |
R951 |
T1727 |
T1728 |
compound |
breast,tumor |
R952 |
T1728 |
T1726 |
compound |
tumor,kinase |
R953 |
T1729 |
T1730 |
punct |
[,43 |
R954 |
T1697 |
T1695 |
prep |
as,identified |
R955 |
T1730 |
T1726 |
parataxis |
43,kinase |
R956 |
T1731 |
T1730 |
punct |
],43 |
R957 |
T1698 |
T1699 |
det |
an,protein |
R958 |
T1732 |
T1695 |
punct |
.,identified |
R959 |
T1734 |
T1735 |
nsubjpass |
Sam68,shown |
R960 |
T1736 |
T1735 |
aux |
has,shown |
R961 |
T1737 |
T1735 |
auxpass |
been,shown |
R962 |
T1699 |
T1697 |
pobj |
protein,as |
R963 |
T1738 |
T1739 |
aux |
to,facilitate |
R964 |
T1700 |
T1699 |
nmod |
SH3,protein |
R965 |
T1739 |
T1735 |
xcomp |
facilitate,shown |
R966 |
T1701 |
T1700 |
cc |
and,SH3 |
R967 |
T1702 |
T1700 |
conj |
SH2,SH3 |
R968 |
T1740 |
T1741 |
det |
the,export |
R969 |
T1703 |
T1699 |
nmod |
domain,protein |
R970 |
T1741 |
T1739 |
dobj |
export,facilitate |
R971 |
T1704 |
T1699 |
amod |
interacting,protein |
R972 |
T1742 |
T1741 |
prep |
of,export |
R973 |
T1743 |
T1744 |
amod |
unspliced,RNA |
R974 |
T1744 |
T1742 |
pobj |
RNA,of |
R975 |
T1705 |
T1695 |
prep |
for,identified |
R976 |
T1745 |
T1744 |
compound |
HIV,RNA |
R977 |
T1746 |
T1747 |
punct |
[,44 |
R978 |
T1747 |
T1739 |
parataxis |
44,facilitate |
R979 |
T1706 |
T1707 |
compound |
Src,kinases |
R980 |
T1748 |
T1747 |
punct |
],44 |
R981 |
T1749 |
T1739 |
cc |
and,facilitate |
R982 |
T1750 |
T1751 |
aux |
to,regulate |
R983 |
T1707 |
T1705 |
pobj |
kinases,for |
R984 |
T1751 |
T1739 |
conj |
regulate,facilitate |
R985 |
T1752 |
T1753 |
compound |
pre-mRNA,processing |
R986 |
T1708 |
T1707 |
compound |
family,kinases |
R987 |
T1753 |
T1751 |
dobj |
processing,regulate |
R988 |
T1754 |
T1755 |
punct |
[,45 |
R989 |
T1755 |
T1751 |
parataxis |
45,regulate |
R990 |
T1709 |
T1695 |
cc |
and,identified |
R991 |
T1756 |
T1755 |
punct |
],45 |
R992 |
T1757 |
T1735 |
punct |
.,shown |
R993 |
T1759 |
T1760 |
prep |
In,report |
R994 |
T1710 |
T1695 |
conj |
is,identified |
R995 |
T1761 |
T1762 |
det |
the,paper |
R996 |
T1711 |
T1710 |
advmod |
also,is |
R997 |
T1762 |
T1759 |
pobj |
paper,In |
R998 |
T1763 |
T1762 |
amod |
present,paper |
R999 |
T1764 |
T1760 |
punct |
", ",report |