PMC:1189073 / 31718-40803 JSON TXT 5 Projects

Annnotations TAB TSV DIC JSON TextAE

Id	Subject	Object	Predicate	Lexical cue
T15507	23-33	NN	denotes	Generation
T15508	34-36	IN	denotes	of
T15509	37-40	NN	denotes	ENU
T15510	41-45	NNS	denotes	mice
T15511	46-49	CC	denotes	and
T15512	50-57	NN	denotes	housing
T15513	57-58	.	denotes	.
T15514	58-121	sentence	denotes	ENU mutagenized C57BL/6 mice were generated as described [19].
T15515	59-62	NN	denotes	ENU
T15517	63-74	VBN	denotes	mutagenized
T15518	75-80	NN	denotes	C57BL
T15519	80-81	HYPH	denotes	/
T15520	81-82	CD	denotes	6
T15516	83-87	NNS	denotes	mice
T15522	88-92	VBD	denotes	were
T15521	93-102	VBN	denotes	generated
T15523	103-105	IN	denotes	as
T15524	106-115	VBN	denotes	described
T15525	116-117	-LRB-	denotes	[
T15526	117-119	CD	denotes	19
T15527	119-120	-RRB-	denotes	]
T15528	120-121	.	denotes	.
T15529	121-337	sentence	denotes	Mice were maintained by backcrossing affected animals to C57BL/6 and housed in the Genomics Institute of the Novartis Research Foundation Specific Pathogen Free animal facility (La Jolla, California, United States).
T15530	122-126	NNS	denotes	Mice
T15532	127-131	VBD	denotes	were
T15531	132-142	VBN	denotes	maintained
T15533	143-145	IN	denotes	by
T15534	146-158	VBG	denotes	backcrossing
T15535	159-167	VBN	denotes	affected
T15536	168-175	NNS	denotes	animals
T15537	176-178	IN	denotes	to
T15538	179-184	NN	denotes	C57BL
T15539	184-185	HYPH	denotes	/
T15540	185-186	CD	denotes	6
T15541	187-190	CC	denotes	and
T15542	191-197	VBN	denotes	housed
T15543	198-200	IN	denotes	in
T15544	201-204	DT	denotes	the
T15546	205-213	NNP	denotes	Genomics
T15545	214-223	NNP	denotes	Institute
T15547	224-226	IN	denotes	of
T15548	227-230	DT	denotes	the
T15550	231-239	NNP	denotes	Novartis
T15552	240-248	NNP	denotes	Research
T15551	249-259	NNP	denotes	Foundation
T15553	260-268	NNP	denotes	Specific
T15554	269-277	NNP	denotes	Pathogen
T15555	278-282	NNP	denotes	Free
T15556	283-289	NNP	denotes	animal
T15549	290-298	NNP	denotes	facility
T15557	299-300	-LRB-	denotes	(
T15559	300-302	NNP	denotes	La
T15558	303-308	NNP	denotes	Jolla
T15560	308-310	,	denotes	,
T15561	310-320	NNP	denotes	California
T15562	320-322	,	denotes	,
T15563	322-328	NNP	denotes	United
T15564	329-335	NNP	denotes	States
T15565	335-336	-RRB-	denotes	)
T15566	336-337	.	denotes	.
T15567	337-473	sentence	denotes	All procedures were approved by the Genomics Institute of the Novartis Research Foundation Institutional Animal Care and Use Committee.
T15568	338-341	DT	denotes	All
T15569	342-352	NNS	denotes	procedures
T15571	353-357	VBD	denotes	were
T15570	358-366	VBN	denotes	approved
T15572	367-369	IN	denotes	by
T15573	370-373	DT	denotes	the
T15575	374-382	NNP	denotes	Genomics
T15574	383-392	NNP	denotes	Institute
T15576	393-395	IN	denotes	of
T15577	396-399	DT	denotes	the
T15579	400-408	NNP	denotes	Novartis
T15581	409-417	NNP	denotes	Research
T15580	418-428	NNP	denotes	Foundation
T15582	429-442	NNP	denotes	Institutional
T15583	443-449	NNP	denotes	Animal
T15584	450-454	NNP	denotes	Care
T15585	455-458	CC	denotes	and
T15586	459-462	NNP	denotes	Use
T15578	463-472	NNP	denotes	Committee
T15587	472-473	.	denotes	.
T15900	475-485	NNS	denotes	Constructs
T15901	485-486	.	denotes	.
T15902	486-688	sentence	denotes	The complete coding sequence of mouse AQP2 from an IMAGE clone was digested from the pCMV⋅SPORT6 plasmid with EcoRI and NotI and ligated into pcDNA3.1 (Invitrogen, Carlsbad, California, United States).
T15903	487-490	DT	denotes	The
T15905	491-499	JJ	denotes	complete
T15906	500-506	NN	denotes	coding
T15904	507-515	NN	denotes	sequence
T15908	516-518	IN	denotes	of
T15909	519-524	NN	denotes	mouse
T15910	525-529	NN	denotes	AQP2
T15911	530-534	IN	denotes	from
T15912	535-537	DT	denotes	an
T15914	538-543	NN	denotes	IMAGE
T15913	544-549	NN	denotes	clone
T15915	550-553	VBD	denotes	was
T15907	554-562	VBN	denotes	digested
T15916	563-567	IN	denotes	from
T15917	568-571	DT	denotes	the
T15919	572-583	NN	denotes	pCMV⋅SPORT6
T15918	584-591	NN	denotes	plasmid
T15920	592-596	IN	denotes	with
T15921	597-602	NN	denotes	EcoRI
T15922	603-606	CC	denotes	and
T15923	607-611	NN	denotes	NotI
T15924	612-615	CC	denotes	and
T15925	616-623	VBN	denotes	ligated
T15926	624-628	IN	denotes	into
T15927	629-637	NN	denotes	pcDNA3.1
T15928	638-639	-LRB-	denotes	(
T15929	639-649	NNP	denotes	Invitrogen
T15930	649-651	,	denotes	,
T15931	651-659	NNP	denotes	Carlsbad
T15932	659-661	,	denotes	,
T15933	661-671	NNP	denotes	California
T15934	671-673	,	denotes	,
T15935	673-679	NNP	denotes	United
T15936	680-686	NNP	denotes	States
T15937	686-687	-RRB-	denotes	)
T15938	687-688	.	denotes	.
T15939	688-942	sentence	denotes	The F204V mutation was introduced by site-directed mutagenesis (Stratagene, La Jolla, California, United States), using the sense oligonucleotide 5′-GATGATCACTGGGTCGTCTGGATCGGACCCC-3′, and antisense oligonucleotide 5′-GGGGTCCGATCCAGACGACCCAGTGATCATC-3′.
T15940	689-692	DT	denotes	The
T15942	693-698	NN	denotes	F204V
T15941	699-707	NN	denotes	mutation
T15944	708-711	VBD	denotes	was
T15943	712-722	VBN	denotes	introduced
T15945	723-725	IN	denotes	by
T15946	726-730	NN	denotes	site
T15948	730-731	HYPH	denotes	-
T15947	731-739	JJ	denotes	directed
T15949	740-751	NN	denotes	mutagenesis
T15950	752-753	-LRB-	denotes	(
T15951	753-763	NNP	denotes	Stratagene
T15952	763-765	,	denotes	,
T15953	765-767	NNP	denotes	La
T15954	768-773	NNP	denotes	Jolla
T15955	773-775	,	denotes	,
T15956	775-785	NNP	denotes	California
T15957	785-787	,	denotes	,
T15958	787-793	NNP	denotes	United
T15959	794-800	NNP	denotes	States
T15960	800-801	-RRB-	denotes	)
T15961	801-803	,	denotes	,
T15962	803-808	VBG	denotes	using
T15963	809-812	DT	denotes	the
T15965	813-818	NN	denotes	sense
T15964	819-834	NN	denotes	oligonucleotide
T15966	835-836	CD	denotes	5
T15968	836-837	SYM	denotes	′
T15969	837-838	HYPH	denotes	-
T15967	838-869	NN	denotes	GATGATCACTGGGTCGTCTGGATCGGACCCC
T15970	869-870	HYPH	denotes	-
T15971	870-871	CD	denotes	3
T15972	871-872	SYM	denotes	′
T15973	872-874	,	denotes	,
T15974	874-877	CC	denotes	and
T15975	878-887	JJ	denotes	antisense
T15976	888-903	NN	denotes	oligonucleotide
T15977	904-905	CD	denotes	5
T15979	905-906	SYM	denotes	′
T15980	906-907	HYPH	denotes	-
T15978	907-938	NN	denotes	GGGGTCCGATCCAGACGACCCAGTGATCATC
T15981	938-939	HYPH	denotes	-
T15982	939-940	CD	denotes	3
T15983	940-941	SYM	denotes	′
T15984	941-942	.	denotes	.
T15985	942-1131	sentence	denotes	To generate GFP fusions of AQP2, the pCMV⋅SPORT6 AQP2 construct was used in a PCR reaction with the primers Sp6 and 5′-GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG-3′ to remove the stop codon of AQP2.
T15986	943-945	TO	denotes	To
T15987	946-954	VB	denotes	generate
T15989	955-958	NN	denotes	GFP
T15990	959-966	NNS	denotes	fusions
T15991	967-969	IN	denotes	of
T15992	970-974	NN	denotes	AQP2
T15993	974-976	,	denotes	,
T15994	976-979	DT	denotes	the
T15996	980-991	NN	denotes	pCMV⋅SPORT6
T15997	992-996	NN	denotes	AQP2
T15995	997-1006	NN	denotes	construct
T15998	1007-1010	VBD	denotes	was
T15988	1011-1015	VBN	denotes	used
T15999	1016-1018	IN	denotes	in
T16000	1019-1020	DT	denotes	a
T16002	1021-1024	NN	denotes	PCR
T16001	1025-1033	NN	denotes	reaction
T16003	1034-1038	IN	denotes	with
T16004	1039-1042	DT	denotes	the
T16006	1043-1050	NNS	denotes	primers
T16005	1051-1054	NN	denotes	Sp6
T16007	1055-1058	CC	denotes	and
T16008	1059-1060	CD	denotes	5
T16010	1060-1061	SYM	denotes	′
T16011	1061-1062	HYPH	denotes	-
T16009	1062-1094	NN	denotes	GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG
T16012	1094-1095	HYPH	denotes	-
T16013	1095-1096	CD	denotes	3
T16014	1096-1097	SYM	denotes	′
T16015	1098-1100	TO	denotes	to
T16016	1101-1107	VB	denotes	remove
T16017	1108-1111	DT	denotes	the
T16019	1112-1116	NN	denotes	stop
T16018	1117-1122	NN	denotes	codon
T16020	1123-1125	IN	denotes	of
T16021	1126-1130	NN	denotes	AQP2
T16022	1130-1131	.	denotes	.
T16023	1131-1258	sentence	denotes	The product was digested with KpnI and BamHI and ligated into pEGFP-N2 (BD Biosciences, San Diego, California, United States).
T16024	1132-1135	DT	denotes	The
T16025	1136-1143	NN	denotes	product
T16027	1144-1147	VBD	denotes	was
T16026	1148-1156	VBN	denotes	digested
T16028	1157-1161	IN	denotes	with
T16029	1162-1166	NN	denotes	KpnI
T16030	1167-1170	CC	denotes	and
T16031	1171-1176	NN	denotes	BamHI
T16032	1177-1180	CC	denotes	and
T16033	1181-1188	VBN	denotes	ligated
T16034	1189-1193	IN	denotes	into
T16035	1194-1199	NN	denotes	pEGFP
T16037	1199-1200	HYPH	denotes	-
T16036	1200-1202	NN	denotes	N2
T16038	1203-1204	-LRB-	denotes	(
T16040	1204-1206	NN	denotes	BD
T16039	1207-1218	NNP	denotes	Biosciences
T16041	1218-1220	,	denotes	,
T16042	1220-1223	NNP	denotes	San
T16043	1224-1229	NNP	denotes	Diego
T16044	1229-1231	,	denotes	,
T16045	1231-1241	NNP	denotes	California
T16046	1241-1243	,	denotes	,
T16047	1243-1249	NNP	denotes	United
T16048	1250-1256	NNP	denotes	States
T16049	1256-1257	-RRB-	denotes	)
T16050	1257-1258	.	denotes	.
T16051	1258-1335	sentence	denotes	The F204V mutation was introduced using the same mutagenic oligonucleotides.
T16052	1259-1262	DT	denotes	The
T16054	1263-1268	NN	denotes	F204V
T16053	1269-1277	NN	denotes	mutation
T16056	1278-1281	VBD	denotes	was
T16055	1282-1292	VBN	denotes	introduced
T16057	1293-1298	VBG	denotes	using
T16058	1299-1302	DT	denotes	the
T16060	1303-1307	JJ	denotes	same
T16061	1308-1317	JJ	denotes	mutagenic
T16059	1318-1334	NNS	denotes	oligonucleotides
T16062	1334-1335	.	denotes	.
T16399	1337-1341	NN	denotes	Cell
T16400	1342-1349	NN	denotes	culture
T16401	1350-1353	CC	denotes	and
T16402	1354-1364	NN	denotes	generation
T16403	1365-1367	IN	denotes	of
T16404	1368-1374	JJ	denotes	stable
T16406	1375-1379	NN	denotes	cell
T16405	1380-1385	NNS	denotes	lines
T16407	1385-1386	.	denotes	.
T16408	1386-1638	sentence	denotes	MDCK cells (CCL-34; ATCC, Manassas, Virginia, United States) were cultured in DMEM (Sigma-Aldrich, St. Louis, Missouri, United States) supplemented with 10% FBS (Sigma-Aldrich), 100 U/ml of penicillin, and 100 μg/ml of streptomycin at 37 °C in 5% CO2.
T16409	1387-1391	NN	denotes	MDCK
T16410	1392-1397	NNS	denotes	cells
T16412	1398-1399	-LRB-	denotes	(
T16414	1399-1402	NN	denotes	CCL
T16415	1402-1403	HYPH	denotes	-
T16416	1403-1405	CD	denotes	34
T16417	1405-1406	:	denotes	;
T16413	1407-1411	NN	denotes	ATCC
T16418	1411-1413	,	denotes	,
T16419	1413-1421	NNP	denotes	Manassas
T16420	1421-1423	,	denotes	,
T16421	1423-1431	NNP	denotes	Virginia
T16422	1431-1433	,	denotes	,
T16423	1433-1439	NNP	denotes	United
T16424	1440-1446	NNP	denotes	States
T16425	1446-1447	-RRB-	denotes	)
T16426	1448-1452	VBD	denotes	were
T16411	1453-1461	VBN	denotes	cultured
T16427	1462-1464	IN	denotes	in
T16428	1465-1469	NN	denotes	DMEM
T16429	1470-1471	-LRB-	denotes	(
T16431	1471-1476	NNP	denotes	Sigma
T16432	1476-1477	HYPH	denotes	-
T16430	1477-1484	NNP	denotes	Aldrich
T16433	1484-1486	,	denotes	,
T16434	1486-1489	NNP	denotes	St.
T16435	1490-1495	NNP	denotes	Louis
T16436	1495-1497	,	denotes	,
T16437	1497-1505	NNP	denotes	Missouri
T16438	1505-1507	,	denotes	,
T16439	1507-1513	NNP	denotes	United
T16440	1514-1520	NNP	denotes	States
T16441	1520-1521	-RRB-	denotes	)
T16442	1522-1534	VBN	denotes	supplemented
T16443	1535-1539	IN	denotes	with
T16444	1540-1542	CD	denotes	10
T16445	1542-1543	NN	denotes	%
T16446	1544-1547	NN	denotes	FBS
T16447	1548-1549	-LRB-	denotes	(
T16449	1549-1554	NNP	denotes	Sigma
T16450	1554-1555	HYPH	denotes	-
T16448	1555-1562	NNP	denotes	Aldrich
T16451	1562-1563	-RRB-	denotes	)
T16452	1563-1565	,	denotes	,
T16453	1565-1568	CD	denotes	100
T16454	1569-1570	NN	denotes	U
T16455	1570-1571	SYM	denotes	/
T16456	1571-1573	NN	denotes	ml
T16457	1574-1576	IN	denotes	of
T16458	1577-1587	NN	denotes	penicillin
T16459	1587-1589	,	denotes	,
T16460	1589-1592	CC	denotes	and
T16461	1593-1596	CD	denotes	100
T16462	1597-1599	NN	denotes	μg
T16463	1599-1600	SYM	denotes	/
T16464	1600-1602	NN	denotes	ml
T16465	1603-1605	IN	denotes	of
T16466	1606-1618	NN	denotes	streptomycin
T16467	1619-1621	IN	denotes	at
T16468	1622-1624	CD	denotes	37
T16469	1625-1627	NN	denotes	°C
T16470	1628-1630	IN	denotes	in
T16471	1631-1632	CD	denotes	5
T16472	1632-1633	NN	denotes	%
T16473	1634-1637	NN	denotes	CO2
T16474	1637-1638	.	denotes	.
T16475	1638-1878	sentence	denotes	To generate stable MDCK cell lines, cells were transfected using Lipofectamine 2000 (Invitrogen) and the pcDNA3.1 expression constructs (containing wild-type AQP2, AQP2-F204V, or no insert) and selected with 900 μg/ml G418 (Sigma-Aldrich).
T16476	1639-1641	TO	denotes	To
T16477	1642-1650	VB	denotes	generate
T16479	1651-1657	JJ	denotes	stable
T16481	1658-1662	NN	denotes	MDCK
T16482	1663-1667	NN	denotes	cell
T16480	1668-1673	NNS	denotes	lines
T16483	1673-1675	,	denotes	,
T16484	1675-1680	NNS	denotes	cells
T16485	1681-1685	VBD	denotes	were
T16478	1686-1697	VBN	denotes	transfected
T16486	1698-1703	VBG	denotes	using
T16487	1704-1717	NN	denotes	Lipofectamine
T16488	1718-1722	CD	denotes	2000
T16489	1723-1724	-LRB-	denotes	(
T16490	1724-1734	NNP	denotes	Invitrogen
T16491	1734-1735	-RRB-	denotes	)
T16492	1736-1739	CC	denotes	and
T16493	1740-1743	DT	denotes	the
T16495	1744-1752	NN	denotes	pcDNA3.1
T16496	1753-1763	NN	denotes	expression
T16494	1764-1774	NNS	denotes	constructs
T16497	1775-1776	-LRB-	denotes	(
T16498	1776-1786	VBG	denotes	containing
T16499	1787-1791	JJ	denotes	wild
T16501	1791-1792	HYPH	denotes	-
T16500	1792-1796	NN	denotes	type
T16502	1797-1801	NN	denotes	AQP2
T16503	1801-1803	,	denotes	,
T16504	1803-1807	NN	denotes	AQP2
T16506	1807-1808	HYPH	denotes	-
T16505	1808-1813	NN	denotes	F204V
T16507	1813-1815	,	denotes	,
T16508	1815-1817	CC	denotes	or
T16509	1818-1820	DT	denotes	no
T16510	1821-1827	NN	denotes	insert
T16511	1827-1828	-RRB-	denotes	)
T16512	1829-1832	CC	denotes	and
T16513	1833-1841	VBN	denotes	selected
T16514	1842-1846	IN	denotes	with
T16515	1847-1850	CD	denotes	900
T16516	1851-1853	NN	denotes	μg
T16518	1853-1854	SYM	denotes	/
T16519	1854-1856	NN	denotes	ml
T16517	1857-1861	NN	denotes	G418
T16520	1862-1863	-LRB-	denotes	(
T16522	1863-1868	NNP	denotes	Sigma
T16523	1868-1869	HYPH	denotes	-
T16521	1869-1876	NNP	denotes	Aldrich
T16524	1876-1877	-RRB-	denotes	)
T16525	1877-1878	.	denotes	.
T16526	1878-1924	sentence	denotes	Individual colonies were expanded 14 d later.
T16527	1879-1889	JJ	denotes	Individual
T16528	1890-1898	NNS	denotes	colonies
T16530	1899-1903	VBD	denotes	were
T16529	1904-1912	VBN	denotes	expanded
T16531	1913-1915	CD	denotes	14
T16532	1916-1917	NN	denotes	d
T16533	1918-1923	RB	denotes	later
T16534	1923-1924	.	denotes	.
T16535	1924-2014	sentence	denotes	For the duration of these experiments, the antibiotic was continually added to the media.
T16536	1925-1928	IN	denotes	For
T16538	1929-1932	DT	denotes	the
T16539	1933-1941	NN	denotes	duration
T16540	1942-1944	IN	denotes	of
T16541	1945-1950	DT	denotes	these
T16542	1951-1962	NNS	denotes	experiments
T16543	1962-1964	,	denotes	,
T16544	1964-1967	DT	denotes	the
T16545	1968-1978	NN	denotes	antibiotic
T16546	1979-1982	VBD	denotes	was
T16547	1983-1994	RB	denotes	continually
T16537	1995-2000	VBN	denotes	added
T16548	2001-2003	IN	denotes	to
T16549	2004-2007	DT	denotes	the
T16550	2008-2013	NNS	denotes	media
T16551	2013-2014	.	denotes	.
T16552	2014-2125	sentence	denotes	Transient GFP transfections were carried out in subconfluent stable cells lines also using Lipofectamine 2000.
T16553	2015-2024	JJ	denotes	Transient
T16555	2025-2028	NN	denotes	GFP
T16554	2029-2042	NNS	denotes	transfections
T16557	2043-2047	VBD	denotes	were
T16556	2048-2055	VBN	denotes	carried
T16558	2056-2059	RP	denotes	out
T16559	2060-2062	IN	denotes	in
T16560	2063-2075	JJ	denotes	subconfluent
T16562	2076-2082	JJ	denotes	stable
T16563	2083-2088	NNS	denotes	cells
T16561	2089-2094	NNS	denotes	lines
T16564	2095-2099	RB	denotes	also
T16565	2100-2105	VBG	denotes	using
T16566	2106-2119	NN	denotes	Lipofectamine
T16567	2120-2124	CD	denotes	2000
T16568	2124-2125	.	denotes	.
T16676	2127-2137	NN	denotes	Sequencing
T16677	2138-2140	IN	denotes	of
T16678	2141-2145	NN	denotes	Aqp2
T16679	2146-2149	CC	denotes	and
T16680	2150-2160	NN	denotes	genotyping
T16681	2161-2163	IN	denotes	of
T16682	2164-2168	NNS	denotes	mice
T16683	2168-2169	.	denotes	.
T16684	2169-2240	sentence	denotes	All exons of Aqp2 were amplified from mouse genomic DNA and sequenced.
T16685	2170-2173	DT	denotes	All
T16686	2174-2179	NNS	denotes	exons
T16688	2180-2182	IN	denotes	of
T16689	2183-2187	NN	denotes	Aqp2
T16690	2188-2192	VBD	denotes	were
T16687	2193-2202	VBN	denotes	amplified
T16691	2203-2207	IN	denotes	from
T16692	2208-2213	NN	denotes	mouse
T16694	2214-2221	JJ	denotes	genomic
T16693	2222-2225	NN	denotes	DNA
T16695	2226-2229	CC	denotes	and
T16696	2230-2239	VBN	denotes	sequenced
T16697	2239-2240	.	denotes	.
T16698	2240-2354	sentence	denotes	For genotyping, exon 4 was amplified using the primers 5′-TCAGAACTTGCCCACTAGCC-3′ and 5′-TGTAGAGGAGGGAACCGATG-3′.
T16699	2241-2244	IN	denotes	For
T16701	2245-2255	NN	denotes	genotyping
T16702	2255-2257	,	denotes	,
T16703	2257-2261	NN	denotes	exon
T16704	2262-2263	CD	denotes	4
T16705	2264-2267	VBD	denotes	was
T16700	2268-2277	VBN	denotes	amplified
T16706	2278-2283	VBG	denotes	using
T16707	2284-2287	DT	denotes	the
T16708	2288-2295	NNS	denotes	primers
T16709	2296-2297	CD	denotes	5
T16711	2297-2298	SYM	denotes	′
T16712	2298-2299	HYPH	denotes	-
T16710	2299-2319	NN	denotes	TCAGAACTTGCCCACTAGCC
T16713	2319-2320	HYPH	denotes	-
T16714	2320-2321	CD	denotes	3
T16715	2321-2322	SYM	denotes	′
T16716	2323-2326	CC	denotes	and
T16717	2327-2328	CD	denotes	5
T16719	2328-2329	SYM	denotes	′
T16720	2329-2330	HYPH	denotes	-
T16718	2330-2350	NN	denotes	TGTAGAGGAGGGAACCGATG
T16721	2350-2351	HYPH	denotes	-
T16722	2351-2352	CD	denotes	3
T16723	2352-2353	SYM	denotes	′
T16724	2353-2354	.	denotes	.
T16959	2356-2361	NN	denotes	Urine
T16960	2362-2374	NNS	denotes	measurements
T16961	2374-2375	.	denotes	.
T16962	2375-2559	sentence	denotes	Total urine output was measured by separately housing adult mice in Nalgene Metabolic Cages (Minimitter, Bend, Oregon, United States) for 2–3 d and collecting urine every 24 h period.
T16963	2376-2381	JJ	denotes	Total
T16965	2382-2387	NN	denotes	urine
T16964	2388-2394	NN	denotes	output
T16967	2395-2398	VBD	denotes	was
T16966	2399-2407	VBN	denotes	measured
T16968	2408-2410	IN	denotes	by
T16969	2411-2421	RB	denotes	separately
T16970	2422-2429	VBG	denotes	housing
T16971	2430-2435	JJ	denotes	adult
T16972	2436-2440	NNS	denotes	mice
T16973	2441-2443	IN	denotes	in
T16974	2444-2451	NNP	denotes	Nalgene
T16976	2452-2461	JJ	denotes	Metabolic
T16975	2462-2467	NNS	denotes	Cages
T16977	2468-2469	-LRB-	denotes	(
T16978	2469-2479	NNP	denotes	Minimitter
T16979	2479-2481	,	denotes	,
T16980	2481-2485	NNP	denotes	Bend
T16981	2485-2487	,	denotes	,
T16982	2487-2493	NNP	denotes	Oregon
T16983	2493-2495	,	denotes	,
T16984	2495-2501	NNP	denotes	United
T16985	2502-2508	NNP	denotes	States
T16986	2508-2509	-RRB-	denotes	)
T16987	2510-2513	IN	denotes	for
T16988	2514-2515	CD	denotes	2
T16990	2515-2516	SYM	denotes	–
T16989	2516-2517	CD	denotes	3
T16991	2518-2519	NN	denotes	d
T16992	2520-2523	CC	denotes	and
T16993	2524-2534	VBG	denotes	collecting
T16994	2535-2540	NN	denotes	urine
T16995	2541-2546	DT	denotes	every
T16997	2547-2549	CD	denotes	24
T16998	2550-2551	NN	denotes	h
T16996	2552-2558	NN	denotes	period
T16999	2558-2559	.	denotes	.
T17000	2559-2686	sentence	denotes	Urine osmolalities were determined using an Osmometer (Osmette 5004; Precision Systems, Natick, Massachusetts, United States).
T17001	2560-2565	NN	denotes	Urine
T17002	2566-2578	NNS	denotes	osmolalities
T17004	2579-2583	VBD	denotes	were
T17003	2584-2594	VBN	denotes	determined
T17005	2595-2600	VBG	denotes	using
T17006	2601-2603	DT	denotes	an
T17007	2604-2613	NN	denotes	Osmometer
T17008	2614-2615	-LRB-	denotes	(
T17010	2615-2622	NNP	denotes	Osmette
T17011	2623-2627	CD	denotes	5004
T17012	2627-2628	:	denotes	;
T17013	2629-2638	NNP	denotes	Precision
T17009	2639-2646	NNP	denotes	Systems
T17014	2646-2648	,	denotes	,
T17015	2648-2654	NNP	denotes	Natick
T17016	2654-2656	,	denotes	,
T17017	2656-2669	NNP	denotes	Massachusetts
T17018	2669-2671	,	denotes	,
T17019	2671-2677	NNP	denotes	United
T17020	2678-2684	NNP	denotes	States
T17021	2684-2685	-RRB-	denotes	)
T17022	2685-2686	.	denotes	.
T17023	2686-2786	sentence	denotes	Urine concentrating experiments were carried out by intraperitoneal injection of dDAVP (0.4 μg/kg).
T17024	2687-2692	NN	denotes	Urine
T17025	2693-2706	VBG	denotes	concentrating
T17026	2707-2718	NNS	denotes	experiments
T17028	2719-2723	VBD	denotes	were
T17027	2724-2731	VBN	denotes	carried
T17029	2732-2735	RP	denotes	out
T17030	2736-2738	IN	denotes	by
T17031	2739-2754	JJ	denotes	intraperitoneal
T17032	2755-2764	NN	denotes	injection
T17033	2765-2767	IN	denotes	of
T17034	2768-2773	NN	denotes	dDAVP
T17035	2774-2775	-LRB-	denotes	(
T17037	2775-2778	CD	denotes	0.4
T17036	2779-2781	NN	denotes	μg
T17038	2781-2782	SYM	denotes	/
T17039	2782-2784	NN	denotes	kg
T17040	2784-2785	-RRB-	denotes	)
T17041	2785-2786	.	denotes	.
T17042	2786-2859	sentence	denotes	Mice were injected twice with dDAVP, once at time 0 and again at 30 min.
T17043	2787-2791	NNS	denotes	Mice
T17045	2792-2796	VBD	denotes	were
T17044	2797-2805	VBN	denotes	injected
T17046	2806-2811	RB	denotes	twice
T17047	2812-2816	IN	denotes	with
T17048	2817-2822	NN	denotes	dDAVP
T17049	2822-2824	,	denotes	,
T17050	2824-2828	RB	denotes	once
T17051	2829-2831	IN	denotes	at
T17052	2832-2836	NN	denotes	time
T17053	2837-2838	CD	denotes	0
T17054	2839-2842	CC	denotes	and
T17055	2843-2848	RB	denotes	again
T17056	2849-2851	IN	denotes	at
T17057	2852-2854	CD	denotes	30
T17058	2855-2858	NN	denotes	min
T17059	2858-2859	.	denotes	.
T17060	2859-2949	sentence	denotes	Urine was collected at the start of the experiment and 30 min after the second injection.
T17061	2860-2865	NN	denotes	Urine
T17063	2866-2869	VBD	denotes	was
T17062	2870-2879	VBN	denotes	collected
T17064	2880-2882	IN	denotes	at
T17065	2883-2886	DT	denotes	the
T17066	2887-2892	NN	denotes	start
T17067	2893-2895	IN	denotes	of
T17068	2896-2899	DT	denotes	the
T17069	2900-2910	NN	denotes	experiment
T17070	2911-2914	CC	denotes	and
T17071	2915-2917	CD	denotes	30
T17072	2918-2921	NN	denotes	min
T17073	2922-2927	IN	denotes	after
T17074	2928-2931	DT	denotes	the
T17076	2932-2938	JJ	denotes	second
T17075	2939-2948	NN	denotes	injection
T17077	2948-2949	.	denotes	.
T17265	2951-2957	NN	denotes	Kidney
T17266	2958-2966	NN	denotes	membrane
T17267	2967-2978	NN	denotes	preparation
T17268	2978-2979	.	denotes	.
T17269	2979-3160	sentence	denotes	Whole mouse kidneys were homogenized in 10 mM Tris (pH 7.4), 350 mM sucrose, and 5 mM EDTA containing protease inhibitors (Sigma-Aldrich, #P-8340) in a Potter-Elvehjem homogenizer.
T17270	2980-2985	JJ	denotes	Whole
T17272	2986-2991	NN	denotes	mouse
T17271	2992-2999	NNS	denotes	kidneys
T17274	3000-3004	VBD	denotes	were
T17273	3005-3016	VBN	denotes	homogenized
T17275	3017-3019	IN	denotes	in
T17276	3020-3022	CD	denotes	10
T17277	3023-3025	NN	denotes	mM
T17278	3026-3030	NN	denotes	Tris
T17279	3031-3032	-LRB-	denotes	(
T17280	3032-3034	NN	denotes	pH
T17281	3035-3038	CD	denotes	7.4
T17282	3038-3039	-RRB-	denotes	)
T17283	3039-3041	,	denotes	,
T17284	3041-3044	CD	denotes	350
T17285	3045-3047	NN	denotes	mM
T17286	3048-3055	NN	denotes	sucrose
T17287	3055-3057	,	denotes	,
T17288	3057-3060	CC	denotes	and
T17289	3061-3062	CD	denotes	5
T17290	3063-3065	NN	denotes	mM
T17291	3066-3070	NN	denotes	EDTA
T17292	3071-3081	VBG	denotes	containing
T17293	3082-3090	NN	denotes	protease
T17294	3091-3101	NNS	denotes	inhibitors
T17295	3102-3103	-LRB-	denotes	(
T17297	3103-3108	NNP	denotes	Sigma
T17299	3108-3109	HYPH	denotes	-
T17298	3109-3116	NNP	denotes	Aldrich
T17300	3116-3118	,	denotes	,
T17301	3118-3119	SYM	denotes	#
T17296	3119-3120	NN	denotes	P
T17302	3120-3121	HYPH	denotes	-
T17303	3121-3125	CD	denotes	8340
T17304	3125-3126	-RRB-	denotes	)
T17305	3127-3129	IN	denotes	in
T17306	3130-3131	DT	denotes	a
T17308	3132-3138	NNP	denotes	Potter
T17310	3138-3139	HYPH	denotes	-
T17309	3139-3147	NNP	denotes	Elvehjem
T17307	3148-3159	NN	denotes	homogenizer
T17311	3159-3160	.	denotes	.
T17312	3160-3300	sentence	denotes	The homogenate was centrifuged at 2,000 g for 10 min and the supernatant was subjected to ultracentrifugation at 100,000 g for 1 h at 4 °C.
T17313	3161-3164	DT	denotes	The
T17314	3165-3175	NN	denotes	homogenate
T17316	3176-3179	VBD	denotes	was
T17315	3180-3191	VBN	denotes	centrifuged
T17317	3192-3194	IN	denotes	at
T17318	3195-3200	CD	denotes	2,000
T17319	3201-3202	NN	denotes	g
T17320	3203-3206	IN	denotes	for
T17321	3207-3209	CD	denotes	10
T17322	3210-3213	NN	denotes	min
T17323	3214-3217	CC	denotes	and
T17324	3218-3221	DT	denotes	the
T17325	3222-3233	NN	denotes	supernatant
T17327	3234-3237	VBD	denotes	was
T17326	3238-3247	VBN	denotes	subjected
T17328	3248-3250	IN	denotes	to
T17329	3251-3270	NN	denotes	ultracentrifugation
T17330	3271-3273	IN	denotes	at
T17331	3274-3281	CD	denotes	100,000
T17332	3282-3283	NN	denotes	g
T17333	3284-3287	IN	denotes	for
T17334	3288-3289	CD	denotes	1
T17335	3290-3291	NN	denotes	h
T17336	3292-3294	IN	denotes	at
T17337	3295-3296	CD	denotes	4
T17338	3297-3299	NN	denotes	°C
T17339	3299-3300	.	denotes	.
T17340	3300-3416	sentence	denotes	Pelleted membranes were resuspended in the same buffer, and protein concentration was determined by Bradford assay.
T17341	3301-3309	VBN	denotes	Pelleted
T17342	3310-3319	NNS	denotes	membranes
T17344	3320-3324	VBD	denotes	were
T17343	3325-3336	VBN	denotes	resuspended
T17345	3337-3339	IN	denotes	in
T17346	3340-3343	DT	denotes	the
T17348	3344-3348	JJ	denotes	same
T17347	3349-3355	NN	denotes	buffer
T17349	3355-3357	,	denotes	,
T17350	3357-3360	CC	denotes	and
T17351	3361-3368	NN	denotes	protein
T17352	3369-3382	NN	denotes	concentration
T17354	3383-3386	VBD	denotes	was
T17353	3387-3397	VBN	denotes	determined
T17355	3398-3400	IN	denotes	by
T17356	3401-3409	NNP	denotes	Bradford
T17357	3410-3415	NN	denotes	assay
T17358	3415-3416	.	denotes	.
T17614	3418-3432	NN	denotes	Immunoblotting
T17615	3432-3433	.	denotes	.
T17616	3433-3559	sentence	denotes	Kidney membrane fractions (60 μg) were resolved on a 12% SDS-polyacrylamide gel and transferred to a nitrocellulose membrane.
T17617	3434-3440	NN	denotes	Kidney
T17618	3441-3449	NN	denotes	membrane
T17619	3450-3459	NNS	denotes	fractions
T17621	3460-3461	-LRB-	denotes	(
T17623	3461-3463	CD	denotes	60
T17622	3464-3466	NN	denotes	μg
T17624	3466-3467	-RRB-	denotes	)
T17625	3468-3472	VBD	denotes	were
T17620	3473-3481	VBN	denotes	resolved
T17626	3482-3484	IN	denotes	on
T17627	3485-3486	DT	denotes	a
T17629	3487-3489	CD	denotes	12
T17630	3489-3490	NN	denotes	%
T17631	3491-3494	NN	denotes	SDS
T17633	3494-3495	HYPH	denotes	-
T17632	3495-3509	NN	denotes	polyacrylamide
T17628	3510-3513	NN	denotes	gel
T17634	3514-3517	CC	denotes	and
T17635	3518-3529	VBN	denotes	transferred
T17636	3530-3532	IN	denotes	to
T17637	3533-3534	DT	denotes	a
T17639	3535-3549	NN	denotes	nitrocellulose
T17638	3550-3558	NN	denotes	membrane
T17640	3558-3559	.	denotes	.
T17641	3559-3805	sentence	denotes	Membranes were blocked in 5% nonfat milk in Tris-buffered saline with 0.05% Tween 20 (TBST), followed by an overnight incubation (at 4 °C) with AQP2 polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, California, United States; #sc-9882).
T17642	3560-3569	NNS	denotes	Membranes
T17644	3570-3574	VBD	denotes	were
T17643	3575-3582	VBN	denotes	blocked
T17645	3583-3585	IN	denotes	in
T17646	3586-3587	CD	denotes	5
T17647	3587-3588	NN	denotes	%
T17649	3589-3595	JJ	denotes	nonfat
T17648	3596-3600	NN	denotes	milk
T17650	3601-3603	IN	denotes	in
T17651	3604-3608	NN	denotes	Tris
T17653	3608-3609	HYPH	denotes	-
T17652	3609-3617	VBN	denotes	buffered
T17654	3618-3624	NN	denotes	saline
T17655	3625-3629	IN	denotes	with
T17656	3630-3634	CD	denotes	0.05
T17657	3634-3635	NN	denotes	%
T17658	3636-3641	NN	denotes	Tween
T17659	3642-3644	CD	denotes	20
T17660	3645-3646	-LRB-	denotes	(
T17661	3646-3650	NN	denotes	TBST
T17662	3650-3651	-RRB-	denotes	)
T17663	3651-3653	,	denotes	,
T17664	3653-3661	VBN	denotes	followed
T17665	3662-3664	IN	denotes	by
T17666	3665-3667	DT	denotes	an
T17668	3668-3677	JJ	denotes	overnight
T17667	3678-3688	NN	denotes	incubation
T17669	3689-3690	-LRB-	denotes	(
T17670	3690-3692	IN	denotes	at
T17671	3693-3694	CD	denotes	4
T17672	3695-3697	NN	denotes	°C
T17673	3697-3698	-RRB-	denotes	)
T17674	3699-3703	IN	denotes	with
T17675	3704-3708	NN	denotes	AQP2
T17677	3709-3719	JJ	denotes	polyclonal
T17676	3720-3728	NN	denotes	antibody
T17678	3729-3730	-LRB-	denotes	(
T17680	3730-3735	NNP	denotes	Santa
T17681	3736-3740	NNP	denotes	Cruz
T17682	3741-3754	NNP	denotes	Biotechnology
T17683	3754-3756	,	denotes	,
T17684	3756-3761	NNP	denotes	Santa
T17685	3762-3766	NNP	denotes	Cruz
T17686	3766-3768	,	denotes	,
T17687	3768-3778	NNP	denotes	California
T17688	3778-3780	,	denotes	,
T17689	3780-3786	NNP	denotes	United
T17690	3787-3793	NNP	denotes	States
T17691	3793-3794	:	denotes	;
T17692	3795-3796	SYM	denotes	#
T17679	3796-3798	NN	denotes	sc
T17693	3798-3799	HYPH	denotes	-
T17694	3799-3803	CD	denotes	9882
T17695	3803-3804	-RRB-	denotes	)
T17696	3804-3805	.	denotes	.
T17697	3805-3897	sentence	denotes	Membranes were washed in TBST then incubated with HRP-conjugated donkey anti-goat antibody.
T17698	3806-3815	NNS	denotes	Membranes
T17700	3816-3820	VBD	denotes	were
T17699	3821-3827	VBN	denotes	washed
T17701	3828-3830	IN	denotes	in
T17702	3831-3835	NN	denotes	TBST
T17703	3836-3840	RB	denotes	then
T17704	3841-3850	VBN	denotes	incubated
T17705	3851-3855	IN	denotes	with
T17706	3856-3859	NN	denotes	HRP
T17708	3859-3860	HYPH	denotes	-
T17707	3860-3870	VBN	denotes	conjugated
T17710	3871-3877	NN	denotes	donkey
T17711	3878-3887	JJ	denotes	anti-goat
T17709	3888-3896	NN	denotes	antibody
T17712	3896-3897	.	denotes	.
T17713	3897-4036	sentence	denotes	Membranes were washed further in TBST and bands were visualized using ECL reagent (Amersham Biosciences, Little Chalfont, United Kingdom).
T17714	3898-3907	NNS	denotes	Membranes
T17716	3908-3912	VBD	denotes	were
T17715	3913-3919	VBN	denotes	washed
T17717	3920-3927	RB	denotes	further
T17718	3928-3930	IN	denotes	in
T17719	3931-3935	NN	denotes	TBST
T17720	3936-3939	CC	denotes	and
T17721	3940-3945	NNS	denotes	bands
T17723	3946-3950	VBD	denotes	were
T17722	3951-3961	VBN	denotes	visualized
T17724	3962-3967	VBG	denotes	using
T17725	3968-3971	NN	denotes	ECL
T17726	3972-3979	NN	denotes	reagent
T17727	3980-3981	-LRB-	denotes	(
T17729	3981-3989	NNP	denotes	Amersham
T17728	3990-4001	NNP	denotes	Biosciences
T17730	4001-4003	,	denotes	,
T17731	4003-4009	NNP	denotes	Little
T17732	4010-4018	NNP	denotes	Chalfont
T17733	4018-4020	,	denotes	,
T17734	4020-4026	NNP	denotes	United
T17735	4027-4034	NNP	denotes	Kingdom
T17736	4034-4035	-RRB-	denotes	)
T17737	4035-4036	.	denotes	.
T17905	4038-4053	NN	denotes	Endoglycosidase
T17906	4054-4063	NN	denotes	digestion
T17907	4063-4064	.	denotes	.
T17908	4064-4220	sentence	denotes	Kidney membranes (60 μg) were incubated in 50 mM sodium phosphate (pH 5.5), 0.1% SDS, and 50 mM β-mercaptoethanol, heated to 100 °C for 5 min, then cooled.
T17909	4065-4071	NN	denotes	Kidney
T17910	4072-4081	NNS	denotes	membranes
T17912	4082-4083	-LRB-	denotes	(
T17914	4083-4085	CD	denotes	60
T17913	4086-4088	NN	denotes	μg
T17915	4088-4089	-RRB-	denotes	)
T17916	4090-4094	VBD	denotes	were
T17911	4095-4104	VBN	denotes	incubated
T17917	4105-4107	IN	denotes	in
T17918	4108-4110	CD	denotes	50
T17919	4111-4113	NN	denotes	mM
T17921	4114-4120	NN	denotes	sodium
T17920	4121-4130	NN	denotes	phosphate
T17922	4131-4132	-LRB-	denotes	(
T17923	4132-4134	NN	denotes	pH
T17924	4135-4138	CD	denotes	5.5
T17925	4138-4139	-RRB-	denotes	)
T17926	4139-4141	,	denotes	,
T17927	4141-4144	CD	denotes	0.1
T17928	4144-4145	NN	denotes	%
T17929	4146-4149	NN	denotes	SDS
T17930	4149-4151	,	denotes	,
T17931	4151-4154	CC	denotes	and
T17932	4155-4157	CD	denotes	50
T17933	4158-4160	NN	denotes	mM
T17935	4161-4162	NN	denotes	β
T17936	4162-4163	HYPH	denotes	-
T17934	4163-4178	NN	denotes	mercaptoethanol
T17937	4178-4180	,	denotes	,
T17938	4180-4186	VBN	denotes	heated
T17939	4187-4189	IN	denotes	to
T17940	4190-4193	CD	denotes	100
T17941	4194-4196	NN	denotes	°C
T17942	4197-4200	IN	denotes	for
T17943	4201-4202	CD	denotes	5
T17944	4203-4206	NN	denotes	min
T17945	4206-4208	,	denotes	,
T17946	4208-4212	RB	denotes	then
T17947	4213-4219	VBN	denotes	cooled
T17948	4219-4220	.	denotes	.
T17949	4220-4308	sentence	denotes	Endoglycosidase H (0.01 units; Sigma-Aldrich) was added and incubated at 37 °C for 2 h.
T17950	4221-4236	NN	denotes	Endoglycosidase
T17951	4237-4238	NN	denotes	H
T17953	4239-4240	-LRB-	denotes	(
T17955	4240-4244	CD	denotes	0.01
T17956	4245-4250	NNS	denotes	units
T17957	4250-4251	:	denotes	;
T17958	4252-4257	NNP	denotes	Sigma
T17959	4257-4258	HYPH	denotes	-
T17954	4258-4265	NNP	denotes	Aldrich
T17960	4265-4266	-RRB-	denotes	)
T17961	4267-4270	VBD	denotes	was
T17952	4271-4276	VBN	denotes	added
T17962	4277-4280	CC	denotes	and
T17963	4281-4290	VBN	denotes	incubated
T17964	4291-4293	IN	denotes	at
T17965	4294-4296	CD	denotes	37
T17966	4297-4299	NN	denotes	°C
T17967	4300-4303	IN	denotes	for
T17968	4304-4305	CD	denotes	2
T17969	4306-4307	NN	denotes	h
T17970	4307-4308	.	denotes	.
T17971	4308-4375	sentence	denotes	The reaction was stopped by boiling the samples in Laemmli buffer.
T17972	4309-4312	DT	denotes	The
T17973	4313-4321	NN	denotes	reaction
T17975	4322-4325	VBD	denotes	was
T17974	4326-4333	VBN	denotes	stopped
T17976	4334-4336	IN	denotes	by
T17977	4337-4344	VBG	denotes	boiling
T17978	4345-4348	DT	denotes	the
T17979	4349-4356	NNS	denotes	samples
T17980	4357-4359	IN	denotes	in
T17981	4360-4367	NNP	denotes	Laemmli
T17982	4368-4374	NN	denotes	buffer
T17983	4374-4375	.	denotes	.
T17984	4375-4430	sentence	denotes	Total reactants were immunoblotted as described above.
T17985	4376-4381	JJ	denotes	Total
T17986	4382-4391	NNS	denotes	reactants
T17988	4392-4396	VBD	denotes	were
T17987	4397-4410	VBN	denotes	immunoblotted
T17989	4411-4413	IN	denotes	as
T17990	4414-4423	VBN	denotes	described
T17991	4424-4429	RB	denotes	above
T17992	4429-4430	.	denotes	.
T18783	4432-4453	NN	denotes	Coimmunoprecipitation
T18784	4454-4457	CC	denotes	and
T18785	4458-4471	NN	denotes	biotinylation
T18786	4472-4474	IN	denotes	in
T18787	4475-4479	NN	denotes	MDCK
T18788	4480-4485	NNS	denotes	cells
T18789	4485-4486	.	denotes	.
T18790	4486-4633	sentence	denotes	MDCK cells stably expressing wild-type AQP2 (grown on 10-cm plates) were transfected with pEGFP-wild-type AQP2, pEGFP-AQP2-F204V, or vector alone.
T18791	4487-4491	NN	denotes	MDCK
T18792	4492-4497	NNS	denotes	cells
T18794	4498-4504	RB	denotes	stably
T18795	4505-4515	VBG	denotes	expressing
T18796	4516-4520	JJ	denotes	wild
T18798	4520-4521	HYPH	denotes	-
T18797	4521-4525	NN	denotes	type
T18799	4526-4530	NN	denotes	AQP2
T18800	4531-4532	-LRB-	denotes	(
T18801	4532-4537	VBN	denotes	grown
T18802	4538-4540	IN	denotes	on
T18803	4541-4543	CD	denotes	10
T18805	4543-4544	HYPH	denotes	-
T18804	4544-4546	NN	denotes	cm
T18806	4547-4553	NNS	denotes	plates
T18807	4553-4554	-RRB-	denotes	)
T18808	4555-4559	VBD	denotes	were
T18793	4560-4571	VBN	denotes	transfected
T18809	4572-4576	IN	denotes	with
T18810	4577-4582	NN	denotes	pEGFP
T18812	4582-4583	HYPH	denotes	-
T18813	4583-4587	JJ	denotes	wild
T18814	4587-4588	HYPH	denotes	-
T18811	4588-4592	NN	denotes	type
T18815	4593-4597	NN	denotes	AQP2
T18816	4597-4599	,	denotes	,
T18817	4599-4604	NN	denotes	pEGFP
T18819	4604-4605	HYPH	denotes	-
T18820	4605-4609	NN	denotes	AQP2
T18821	4609-4610	HYPH	denotes	-
T18818	4610-4615	NN	denotes	F204V
T18822	4615-4617	,	denotes	,
T18823	4617-4619	CC	denotes	or
T18824	4620-4626	NN	denotes	vector
T18825	4627-4632	RB	denotes	alone
T18826	4632-4633	.	denotes	.
T18827	4633-4726	sentence	denotes	The cells were homogenized in 10 mM Tris (pH 7.4), 1 mM EDTA, and 250 mM sucrose 40 h later.
T18828	4634-4637	DT	denotes	The
T18829	4638-4643	NNS	denotes	cells
T18831	4644-4648	VBD	denotes	were
T18830	4649-4660	VBN	denotes	homogenized
T18832	4661-4663	IN	denotes	in
T18833	4664-4666	CD	denotes	10
T18834	4667-4669	NN	denotes	mM
T18835	4670-4674	NN	denotes	Tris
T18836	4675-4676	-LRB-	denotes	(
T18837	4676-4678	NN	denotes	pH
T18838	4679-4682	CD	denotes	7.4
T18839	4682-4683	-RRB-	denotes	)
T18840	4683-4685	,	denotes	,
T18841	4685-4686	CD	denotes	1
T18842	4687-4689	NN	denotes	mM
T18843	4690-4694	NN	denotes	EDTA
T18844	4694-4696	,	denotes	,
T18845	4696-4699	CC	denotes	and
T18846	4700-4703	CD	denotes	250
T18847	4704-4706	NN	denotes	mM
T18848	4707-4714	NN	denotes	sucrose
T18849	4715-4717	CD	denotes	40
T18850	4718-4719	NN	denotes	h
T18851	4720-4725	RB	denotes	later
T18852	4725-4726	.	denotes	.
T18853	4726-4793	sentence	denotes	The clarified supernatant was centrifuged at 200,000 g for 30 min.
T18854	4727-4730	DT	denotes	The
T18856	4731-4740	VBN	denotes	clarified
T18855	4741-4752	NN	denotes	supernatant
T18858	4753-4756	VBD	denotes	was
T18857	4757-4768	VBN	denotes	centrifuged
T18859	4769-4771	IN	denotes	at
T18860	4772-4779	CD	denotes	200,000
T18861	4780-4781	NN	denotes	g
T18862	4782-4785	IN	denotes	for
T18863	4786-4788	CD	denotes	30
T18864	4789-4792	NN	denotes	min
T18865	4792-4793	.	denotes	.
T18866	4793-4918	sentence	denotes	Pelleted membranes were resuspended in the same buffer but containing 4% sodium deoxycholate and incubated at 37 °C for 1 h.
T18867	4794-4802	VBN	denotes	Pelleted
T18868	4803-4812	NNS	denotes	membranes
T18870	4813-4817	VBD	denotes	were
T18871	4818-4829	VBN	denotes	resuspended
T18872	4830-4832	IN	denotes	in
T18873	4833-4836	DT	denotes	the
T18875	4837-4841	JJ	denotes	same
T18874	4842-4848	NN	denotes	buffer
T18876	4849-4852	IN	denotes	but
T18877	4853-4863	VBG	denotes	containing
T18878	4864-4865	CD	denotes	4
T18879	4865-4866	NN	denotes	%
T18881	4867-4873	NN	denotes	sodium
T18880	4874-4886	NN	denotes	deoxycholate
T18882	4887-4890	CC	denotes	and
T18869	4891-4900	VBN	denotes	incubated
T18883	4901-4903	IN	denotes	at
T18884	4904-4906	CD	denotes	37
T18885	4907-4909	NN	denotes	°C
T18886	4910-4913	IN	denotes	for
T18887	4914-4915	CD	denotes	1
T18888	4916-4917	NN	denotes	h
T18889	4917-4918	.	denotes	.
T18890	4918-5016	sentence	denotes	From the dissolved membranes, a 30 μl sample was removed and used as the total membrane fraction.
T18891	4919-4923	IN	denotes	From
T18893	4924-4927	DT	denotes	the
T18895	4928-4937	VBN	denotes	dissolved
T18894	4938-4947	NNS	denotes	membranes
T18896	4947-4949	,	denotes	,
T18897	4949-4950	DT	denotes	a
T18899	4951-4953	CD	denotes	30
T18900	4954-4956	NN	denotes	μl
T18898	4957-4963	NN	denotes	sample
T18901	4964-4967	VBD	denotes	was
T18892	4968-4975	VBN	denotes	removed
T18902	4976-4979	CC	denotes	and
T18903	4980-4984	VBN	denotes	used
T18904	4985-4987	IN	denotes	as
T18905	4988-4991	DT	denotes	the
T18907	4992-4997	JJ	denotes	total
T18908	4998-5006	NN	denotes	membrane
T18906	5007-5015	NN	denotes	fraction
T18909	5015-5016	.	denotes	.
T18910	5016-5185	sentence	denotes	The remaining membranes were diluted with 600 μl of the homogenization buffer, and incubated with 1 μl of GFP antisera (Invitrogen, #46–0092) and protein A/G sepharose.
T18911	5017-5020	DT	denotes	The
T18913	5021-5030	VBG	denotes	remaining
T18912	5031-5040	NNS	denotes	membranes
T18915	5041-5045	VBD	denotes	were
T18914	5046-5053	VBN	denotes	diluted
T18916	5054-5058	IN	denotes	with
T18917	5059-5062	CD	denotes	600
T18918	5063-5065	NN	denotes	μl
T18919	5066-5068	IN	denotes	of
T18920	5069-5072	DT	denotes	the
T18922	5073-5087	NN	denotes	homogenization
T18921	5088-5094	NN	denotes	buffer
T18923	5094-5096	,	denotes	,
T18924	5096-5099	CC	denotes	and
T18925	5100-5109	VBN	denotes	incubated
T18926	5110-5114	IN	denotes	with
T18927	5115-5116	CD	denotes	1
T18928	5117-5119	NN	denotes	μl
T18929	5120-5122	IN	denotes	of
T18930	5123-5126	NN	denotes	GFP
T18931	5127-5135	NNS	denotes	antisera
T18932	5136-5137	-LRB-	denotes	(
T18934	5137-5147	NNP	denotes	Invitrogen
T18935	5147-5149	,	denotes	,
T18936	5149-5150	SYM	denotes	#
T18937	5150-5152	CD	denotes	46
T18938	5152-5153	HYPH	denotes	–
T18933	5153-5157	CD	denotes	0092
T18939	5157-5158	-RRB-	denotes	)
T18940	5159-5162	CC	denotes	and
T18941	5163-5170	NN	denotes	protein
T18943	5171-5172	NN	denotes	A
T18945	5172-5173	HYPH	denotes	/
T18944	5173-5174	NN	denotes	G
T18942	5175-5184	NN	denotes	sepharose
T18946	5184-5185	.	denotes	.
T18947	5185-5317	sentence	denotes	Following overnight incubation, the precipitated proteins were washed in RIPA buffer and finally boiled in 50 μl of Laemmli buffer.
T18948	5186-5195	VBG	denotes	Following
T18950	5196-5205	JJ	denotes	overnight
T18951	5206-5216	NN	denotes	incubation
T18952	5216-5218	,	denotes	,
T18953	5218-5221	DT	denotes	the
T18955	5222-5234	VBN	denotes	precipitated
T18954	5235-5243	NN	denotes	proteins
T18956	5244-5248	VBD	denotes	were
T18949	5249-5255	VBN	denotes	washed
T18957	5256-5258	IN	denotes	in
T18958	5259-5263	NN	denotes	RIPA
T18959	5264-5270	NN	denotes	buffer
T18960	5271-5274	CC	denotes	and
T18961	5275-5282	RB	denotes	finally
T18962	5283-5289	VBN	denotes	boiled
T18963	5290-5292	IN	denotes	in
T18964	5293-5295	CD	denotes	50
T18965	5296-5298	NN	denotes	μl
T18966	5299-5301	IN	denotes	of
T18967	5302-5309	NNP	denotes	Laemmli
T18968	5310-5316	NN	denotes	buffer
T18969	5316-5317	.	denotes	.
T18970	5317-5400	sentence	denotes	Half of the total membrane and the IP fractions were processed for immunoblotting.
T18971	5318-5322	NN	denotes	Half
T18973	5323-5325	IN	denotes	of
T18974	5326-5329	DT	denotes	the
T18976	5330-5335	JJ	denotes	total
T18975	5336-5344	NN	denotes	membrane
T18977	5345-5348	CC	denotes	and
T18978	5349-5352	DT	denotes	the
T18980	5353-5355	NN	denotes	IP
T18979	5356-5365	NNS	denotes	fractions
T18981	5366-5370	VBD	denotes	were
T18972	5371-5380	VBN	denotes	processed
T18982	5381-5384	IN	denotes	for
T18983	5385-5399	NN	denotes	immunoblotting
T18984	5399-5400	.	denotes	.
T18985	5400-5462	sentence	denotes	Cell surface biotinylation was performed in a similar manner.
T18986	5401-5405	NN	denotes	Cell
T18988	5406-5413	NN	denotes	surface
T18987	5414-5427	NN	denotes	biotinylation
T18990	5428-5431	VBD	denotes	was
T18989	5432-5441	VBN	denotes	performed
T18991	5442-5444	IN	denotes	in
T18992	5445-5446	DT	denotes	a
T18994	5447-5454	JJ	denotes	similar
T18993	5455-5461	NN	denotes	manner
T18995	5461-5462	.	denotes	.
T18996	5462-5595	sentence	denotes	However, pEGFP-AQP2-F204V, was transfected into MDCK cells stably expressing wild-type AQP2 and cells made stable with vector alone.
T18997	5463-5470	RB	denotes	However
T18999	5470-5472	,	denotes	,
T19000	5472-5477	NN	denotes	pEGFP
T19002	5477-5478	HYPH	denotes	-
T19003	5478-5482	NN	denotes	AQP2
T19004	5482-5483	HYPH	denotes	-
T19001	5483-5488	NN	denotes	F204V
T19005	5488-5490	,	denotes	,
T19006	5490-5493	VBD	denotes	was
T18998	5494-5505	VBN	denotes	transfected
T19007	5506-5510	IN	denotes	into
T19008	5511-5515	NN	denotes	MDCK
T19009	5516-5521	NNS	denotes	cells
T19010	5522-5528	RB	denotes	stably
T19011	5529-5539	VBG	denotes	expressing
T19012	5540-5544	JJ	denotes	wild
T19014	5544-5545	HYPH	denotes	-
T19013	5545-5549	NN	denotes	type
T19015	5550-5554	NN	denotes	AQP2
T19016	5555-5558	CC	denotes	and
T19017	5559-5564	NNS	denotes	cells
T19018	5565-5569	VBN	denotes	made
T19019	5570-5576	JJ	denotes	stable
T19020	5577-5581	IN	denotes	with
T19021	5582-5588	NN	denotes	vector
T19022	5589-5594	RB	denotes	alone
T19023	5594-5595	.	denotes	.
T19024	5595-5832	sentence	denotes	Twenty-four hours post-transfection, cells were stimulated with forskolin, trypsinized, resuspended in 1 ml of PBS (2.5 × 106 cells/ml), and incubated with 0.5 mg of NHS-PEO4-biotin (Pierce Biotechnology) for 30 min at room temperature.
T19025	5596-5602	CD	denotes	Twenty
T19027	5602-5603	HYPH	denotes	-
T19026	5603-5607	CD	denotes	four
T19028	5608-5613	NNS	denotes	hours
T19029	5614-5631	RB	denotes	post-transfection
T19031	5631-5633	,	denotes	,
T19032	5633-5638	NNS	denotes	cells
T19033	5639-5643	VBD	denotes	were
T19030	5644-5654	VBN	denotes	stimulated
T19034	5655-5659	IN	denotes	with
T19035	5660-5669	NN	denotes	forskolin
T19036	5669-5671	,	denotes	,
T19037	5671-5682	VBN	denotes	trypsinized
T19038	5682-5684	,	denotes	,
T19039	5684-5695	VBN	denotes	resuspended
T19040	5696-5698	IN	denotes	in
T19041	5699-5700	CD	denotes	1
T19042	5701-5703	NN	denotes	ml
T19043	5704-5706	IN	denotes	of
T19044	5707-5710	NN	denotes	PBS
T19045	5711-5712	-LRB-	denotes	(
T19047	5712-5715	CD	denotes	2.5
T19049	5716-5717	SYM	denotes	×
T19048	5718-5721	CD	denotes	106
T19046	5722-5727	NNS	denotes	cells
T19050	5727-5728	SYM	denotes	/
T19051	5728-5730	NNS	denotes	ml
T19052	5730-5731	-RRB-	denotes	)
T19053	5731-5733	,	denotes	,
T19054	5733-5736	CC	denotes	and
T19055	5737-5746	VBN	denotes	incubated
T19056	5747-5751	IN	denotes	with
T19057	5752-5755	CD	denotes	0.5
T19058	5756-5758	NN	denotes	mg
T19059	5759-5761	IN	denotes	of
T19060	5762-5765	NN	denotes	NHS
T19062	5765-5766	HYPH	denotes	-
T19063	5766-5770	NN	denotes	PEO4
T19064	5770-5771	HYPH	denotes	-
T19061	5771-5777	NN	denotes	biotin
T19065	5778-5779	-LRB-	denotes	(
T19067	5779-5785	NNP	denotes	Pierce
T19066	5786-5799	NNP	denotes	Biotechnology
T19068	5799-5800	-RRB-	denotes	)
T19069	5801-5804	IN	denotes	for
T19070	5805-5807	CD	denotes	30
T19071	5808-5811	NN	denotes	min
T19072	5812-5814	IN	denotes	at
T19073	5815-5819	NN	denotes	room
T19074	5820-5831	NN	denotes	temperature
T19075	5831-5832	.	denotes	.
T19076	5832-5972	sentence	denotes	Cells were washed once in 10 mM Tris (pH 8) and three times in PBS, after which membranes were purified and solubilized as described above.
T19077	5833-5838	NNS	denotes	Cells
T19079	5839-5843	VBD	denotes	were
T19078	5844-5850	VBN	denotes	washed
T19080	5851-5855	RB	denotes	once
T19081	5856-5858	IN	denotes	in
T19082	5859-5861	CD	denotes	10
T19083	5862-5864	NN	denotes	mM
T19084	5865-5869	NN	denotes	Tris
T19085	5870-5871	-LRB-	denotes	(
T19086	5871-5873	NN	denotes	pH
T19087	5874-5875	CD	denotes	8
T19088	5875-5876	-RRB-	denotes	)
T19089	5877-5880	CC	denotes	and
T19090	5881-5886	CD	denotes	three
T19091	5887-5892	NNS	denotes	times
T19092	5893-5895	IN	denotes	in
T19093	5896-5899	NN	denotes	PBS
T19094	5899-5901	,	denotes	,
T19095	5901-5906	IN	denotes	after
T19097	5907-5912	WDT	denotes	which
T19098	5913-5922	NNS	denotes	membranes
T19099	5923-5927	VBD	denotes	were
T19096	5928-5936	VBN	denotes	purified
T19100	5937-5940	CC	denotes	and
T19101	5941-5952	VBN	denotes	solubilized
T19102	5953-5955	IN	denotes	as
T19103	5956-5965	VBN	denotes	described
T19104	5966-5971	RB	denotes	above
T19105	5971-5972	.	denotes	.
T19106	5972-6088	sentence	denotes	Solubilized membranes were incubated with 20 μl of immobilized streptavidin (Pierce Biotechnology) for 2 h at 4 °C.
T19107	5973-5984	VBN	denotes	Solubilized
T19108	5985-5994	NNS	denotes	membranes
T19110	5995-5999	VBD	denotes	were
T19109	6000-6009	VBN	denotes	incubated
T19111	6010-6014	IN	denotes	with
T19112	6015-6017	CD	denotes	20
T19113	6018-6020	NN	denotes	μl
T19114	6021-6023	IN	denotes	of
T19115	6024-6035	VBN	denotes	immobilized
T19116	6036-6048	NN	denotes	streptavidin
T19117	6049-6050	-LRB-	denotes	(
T19119	6050-6056	NNP	denotes	Pierce
T19118	6057-6070	NNP	denotes	Biotechnology
T19120	6070-6071	-RRB-	denotes	)
T19121	6072-6075	IN	denotes	for
T19122	6076-6077	CD	denotes	2
T19123	6078-6079	NN	denotes	h
T19124	6080-6082	IN	denotes	at
T19125	6083-6084	CD	denotes	4
T19126	6085-6087	NN	denotes	°C
T19127	6087-6088	.	denotes	.
T19128	6088-6188	sentence	denotes	Finally the precipitated proteins were washed in RIPA buffer and boiled in 50 μl of Laemmli buffer.
T19129	6089-6096	RB	denotes	Finally
T19131	6097-6100	DT	denotes	the
T19133	6101-6113	VBN	denotes	precipitated
T19132	6114-6122	NN	denotes	proteins
T19134	6123-6127	VBD	denotes	were
T19130	6128-6134	VBN	denotes	washed
T19135	6135-6137	IN	denotes	in
T19136	6138-6142	NN	denotes	RIPA
T19137	6143-6149	NN	denotes	buffer
T19138	6150-6153	CC	denotes	and
T19139	6154-6160	VBN	denotes	boiled
T19140	6161-6163	IN	denotes	in
T19141	6164-6166	CD	denotes	50
T19142	6167-6169	NN	denotes	μl
T19143	6170-6172	IN	denotes	of
T19144	6173-6180	NNP	denotes	Laemmli
T19145	6181-6187	NN	denotes	buffer
T19146	6187-6188	.	denotes	.
T19147	6188-6281	sentence	denotes	Total cells and the biotinylated precipitates were immunoblotting using an antibody to AQP2.
T19148	6189-6194	JJ	denotes	Total
T19149	6195-6200	NNS	denotes	cells
T19151	6201-6204	CC	denotes	and
T19152	6205-6208	DT	denotes	the
T19154	6209-6221	VBN	denotes	biotinylated
T19153	6222-6234	NNS	denotes	precipitates
T19155	6235-6239	VBD	denotes	were
T19150	6240-6254	VBG	denotes	immunoblotting
T19156	6255-6260	VBG	denotes	using
T19157	6261-6263	DT	denotes	an
T19158	6264-6272	NN	denotes	antibody
T19159	6273-6275	IN	denotes	to
T19160	6276-6280	NN	denotes	AQP2
T19161	6280-6281	.	denotes	.
T19603	6283-6289	NN	denotes	Kidney
T19604	6290-6310	NN	denotes	immunohistochemistry
T19605	6310-6311	.	denotes	.
T19606	6311-6387	sentence	denotes	Whole mouse kidneys were fixed in 10% phosphate-buffered formalin for 24 h.
T19607	6312-6317	JJ	denotes	Whole
T19609	6318-6323	NN	denotes	mouse
T19608	6324-6331	NNS	denotes	kidneys
T19611	6332-6336	VBD	denotes	were
T19610	6337-6342	VBN	denotes	fixed
T19612	6343-6345	IN	denotes	in
T19613	6346-6348	CD	denotes	10
T19614	6348-6349	NN	denotes	%
T19616	6350-6359	NN	denotes	phosphate
T19618	6359-6360	HYPH	denotes	-
T19617	6360-6368	VBN	denotes	buffered
T19615	6369-6377	NN	denotes	formalin
T19619	6378-6381	IN	denotes	for
T19620	6382-6384	CD	denotes	24
T19621	6385-6386	NN	denotes	h
T19622	6386-6387	.	denotes	.
T19623	6387-6455	sentence	denotes	Kidneys were embedded in paraffin, and 5-μm sections were prepared.
T19624	6388-6395	NNS	denotes	Kidneys
T19626	6396-6400	VBD	denotes	were
T19625	6401-6409	VBN	denotes	embedded
T19627	6410-6412	IN	denotes	in
T19628	6413-6421	NN	denotes	paraffin
T19629	6421-6423	,	denotes	,
T19630	6423-6426	CC	denotes	and
T19631	6427-6428	CD	denotes	5
T19633	6428-6429	HYPH	denotes	-
T19632	6429-6431	NN	denotes	μm
T19634	6432-6440	NNS	denotes	sections
T19636	6441-6445	VBD	denotes	were
T19635	6446-6454	VBN	denotes	prepared
T19637	6454-6455	.	denotes	.
T19638	6455-6607	sentence	denotes	Following antigen retrieval using 10 mM sodium citrate (pH 8) for 10 min at 98 °C, sections were sequentially probed, first for AQP3 and then for AQP2.
T19639	6456-6465	VBG	denotes	Following
T19641	6466-6473	NN	denotes	antigen
T19642	6474-6483	NN	denotes	retrieval
T19643	6484-6489	VBG	denotes	using
T19644	6490-6492	CD	denotes	10
T19645	6493-6495	NN	denotes	mM
T19647	6496-6502	NN	denotes	sodium
T19646	6503-6510	NN	denotes	citrate
T19648	6511-6512	-LRB-	denotes	(
T19649	6512-6514	NN	denotes	pH
T19650	6515-6516	CD	denotes	8
T19651	6516-6517	-RRB-	denotes	)
T19652	6518-6521	IN	denotes	for
T19653	6522-6524	CD	denotes	10
T19654	6525-6528	NN	denotes	min
T19655	6529-6531	IN	denotes	at
T19656	6532-6534	CD	denotes	98
T19657	6535-6537	NN	denotes	°C
T19658	6537-6539	,	denotes	,
T19659	6539-6547	NNS	denotes	sections
T19660	6548-6552	VBD	denotes	were
T19661	6553-6565	RB	denotes	sequentially
T19640	6566-6572	VBN	denotes	probed
T19662	6572-6574	,	denotes	,
T19663	6574-6579	RB	denotes	first
T19664	6580-6583	IN	denotes	for
T19665	6584-6588	NN	denotes	AQP3
T19666	6589-6592	CC	denotes	and
T19667	6593-6597	RB	denotes	then
T19668	6598-6601	IN	denotes	for
T19669	6602-6606	NN	denotes	AQP2
T19670	6606-6607	.	denotes	.
T19671	6607-6731	sentence	denotes	Sections were incubated in 5% donkey serum and then in goat anti-AQP3 antibody (1:100; Santa Cruz Biotechnology; #sc-9885).
T19672	6608-6616	NNS	denotes	Sections
T19674	6617-6621	VBD	denotes	were
T19673	6622-6631	VBN	denotes	incubated
T19675	6632-6634	IN	denotes	in
T19676	6635-6636	CD	denotes	5
T19677	6636-6637	NN	denotes	%
T19679	6638-6644	NN	denotes	donkey
T19678	6645-6650	NN	denotes	serum
T19680	6651-6654	CC	denotes	and
T19681	6655-6659	RB	denotes	then
T19682	6660-6662	IN	denotes	in
T19683	6663-6667	NN	denotes	goat
T19685	6668-6677	JJ	denotes	anti-AQP3
T19684	6678-6686	NN	denotes	antibody
T19686	6687-6688	-LRB-	denotes	(
T19688	6688-6689	CD	denotes	1
T19689	6689-6690	SYM	denotes	:
T19690	6690-6693	CD	denotes	100
T19691	6693-6694	:	denotes	;
T19692	6695-6700	NNP	denotes	Santa
T19693	6701-6705	NNP	denotes	Cruz
T19694	6706-6719	NNP	denotes	Biotechnology
T19695	6719-6720	:	denotes	;
T19696	6721-6722	SYM	denotes	#
T19687	6722-6724	NN	denotes	sc
T19697	6724-6725	HYPH	denotes	-
T19698	6725-6729	CD	denotes	9885
T19699	6729-6730	-RRB-	denotes	)
T19700	6730-6731	.	denotes	.
T19701	6731-6881	sentence	denotes	Slides were washed with PBS and incubated with AlexaFluor 488-conjugated donkey anti-goat antibody (Molecular Probes, Eugene, Oregon, United States).
T19702	6732-6738	NNS	denotes	Slides
T19704	6739-6743	VBD	denotes	were
T19703	6744-6750	VBN	denotes	washed
T19705	6751-6755	IN	denotes	with
T19706	6756-6759	NN	denotes	PBS
T19707	6760-6763	CC	denotes	and
T19708	6764-6773	VBN	denotes	incubated
T19709	6774-6778	IN	denotes	with
T19710	6779-6789	NNP	denotes	AlexaFluor
T19712	6790-6793	CD	denotes	488
T19713	6793-6794	HYPH	denotes	-
T19711	6794-6804	VBN	denotes	conjugated
T19715	6805-6811	NN	denotes	donkey
T19716	6812-6821	JJ	denotes	anti-goat
T19714	6822-6830	NN	denotes	antibody
T19717	6831-6832	-LRB-	denotes	(
T19719	6832-6841	NNP	denotes	Molecular
T19718	6842-6848	NNP	denotes	Probes
T19720	6848-6850	,	denotes	,
T19721	6850-6856	NNP	denotes	Eugene
T19722	6856-6858	,	denotes	,
T19723	6858-6864	NNP	denotes	Oregon
T19724	6864-6866	,	denotes	,
T19725	6866-6872	NNP	denotes	United
T19726	6873-6879	NNP	denotes	States
T19727	6879-6880	-RRB-	denotes	)
T19728	6880-6881	.	denotes	.
T19729	6881-7147	sentence	denotes	The slides were subsequently blocked in 5% chicken serum, incubated with a rabbit anti-AQP2 antibody (1:250; USB, Cleveland, Ohio, United States; #A3000–06), which was detected with a AlexaFluor 594-conjugated chicken anti-rabbit antibody (1:500; Molecular Probes).
T19730	6882-6885	DT	denotes	The
T19731	6886-6892	NNS	denotes	slides
T19733	6893-6897	VBD	denotes	were
T19734	6898-6910	RB	denotes	subsequently
T19735	6911-6918	VBN	denotes	blocked
T19736	6919-6921	IN	denotes	in
T19737	6922-6923	CD	denotes	5
T19738	6923-6924	NN	denotes	%
T19740	6925-6932	NN	denotes	chicken
T19739	6933-6938	NN	denotes	serum
T19741	6938-6940	,	denotes	,
T19732	6940-6949	VBN	denotes	incubated
T19742	6950-6954	IN	denotes	with
T19743	6955-6956	DT	denotes	a
T19745	6957-6963	NN	denotes	rabbit
T19746	6964-6973	JJ	denotes	anti-AQP2
T19744	6974-6982	NN	denotes	antibody
T19747	6983-6984	-LRB-	denotes	(
T19749	6984-6985	CD	denotes	1
T19750	6985-6986	SYM	denotes	:
T19751	6986-6989	CD	denotes	250
T19752	6989-6990	:	denotes	;
T19753	6991-6994	NNP	denotes	USB
T19754	6994-6996	,	denotes	,
T19755	6996-7005	NNP	denotes	Cleveland
T19756	7005-7007	,	denotes	,
T19757	7007-7011	NNP	denotes	Ohio
T19758	7011-7013	,	denotes	,
T19759	7013-7019	NNP	denotes	United
T19760	7020-7026	NNP	denotes	States
T19761	7026-7027	:	denotes	;
T19762	7028-7029	SYM	denotes	#
T19748	7029-7034	NN	denotes	A3000
T19763	7034-7035	HYPH	denotes	–
T19764	7035-7037	CD	denotes	06
T19765	7037-7038	-RRB-	denotes	)
T19766	7038-7040	,	denotes	,
T19767	7040-7045	WDT	denotes	which
T19769	7046-7049	VBD	denotes	was
T19768	7050-7058	VBN	denotes	detected
T19770	7059-7063	IN	denotes	with
T19771	7064-7065	DT	denotes	a
T19773	7066-7076	NNP	denotes	AlexaFluor
T19775	7077-7080	CD	denotes	594
T19776	7080-7081	HYPH	denotes	-
T19774	7081-7091	VBN	denotes	conjugated
T19777	7092-7099	NN	denotes	chicken
T19778	7100-7111	JJ	denotes	anti-rabbit
T19772	7112-7120	NN	denotes	antibody
T19779	7121-7122	-LRB-	denotes	(
T19781	7122-7123	CD	denotes	1
T19782	7123-7124	SYM	denotes	:
T19783	7124-7127	CD	denotes	500
T19784	7127-7128	:	denotes	;
T19785	7129-7138	NNP	denotes	Molecular
T19780	7139-7145	NNP	denotes	Probes
T19786	7145-7146	-RRB-	denotes	)
T19787	7146-7147	.	denotes	.
T19788	7147-7264	sentence	denotes	The sections were stained with DAPI and mounted in Vectashield (Vector Labs, Burlingame, California, United States).
T19789	7148-7151	DT	denotes	The
T19790	7152-7160	NNS	denotes	sections
T19792	7161-7165	VBD	denotes	were
T19791	7166-7173	VBN	denotes	stained
T19793	7174-7178	IN	denotes	with
T19794	7179-7183	NN	denotes	DAPI
T19795	7184-7187	CC	denotes	and
T19796	7188-7195	VBD	denotes	mounted
T19797	7196-7198	IN	denotes	in
T19798	7199-7210	NNP	denotes	Vectashield
T19799	7211-7212	-LRB-	denotes	(
T19801	7212-7218	NNP	denotes	Vector
T19800	7219-7223	NNP	denotes	Labs
T19802	7223-7225	,	denotes	,
T19803	7225-7235	NNP	denotes	Burlingame
T19804	7235-7237	,	denotes	,
T19805	7237-7247	NNP	denotes	California
T19806	7247-7249	,	denotes	,
T19807	7249-7255	NNP	denotes	United
T19808	7256-7262	NNP	denotes	States
T19809	7262-7263	-RRB-	denotes	)
T19810	7263-7264	.	denotes	.
T20424	7266-7285	NN	denotes	Immunocytochemistry
T20425	7286-7288	IN	denotes	on
T20426	7289-7293	NN	denotes	MDCK
T20427	7294-7299	NNS	denotes	cells
T20428	7299-7300	.	denotes	.
T20429	7300-7511	sentence	denotes	MDCK stable cell lines expressing vector alone, wild-type AQP2, or AQP2-F204V (and in some cases transiently expressing a GFP construct) were grown on fibronectin-coated coverslips until tight junctions formed.
T20430	7301-7305	NN	denotes	MDCK
T20432	7306-7312	JJ	denotes	stable
T20433	7313-7317	NN	denotes	cell
T20431	7318-7323	NNS	denotes	lines
T20435	7324-7334	VBG	denotes	expressing
T20436	7335-7341	NN	denotes	vector
T20437	7342-7347	JJ	denotes	alone
T20438	7347-7349	,	denotes	,
T20439	7349-7353	JJ	denotes	wild
T20441	7353-7354	HYPH	denotes	-
T20440	7354-7358	NN	denotes	type
T20442	7359-7363	NN	denotes	AQP2
T20443	7363-7365	,	denotes	,
T20444	7365-7367	CC	denotes	or
T20445	7368-7372	NN	denotes	AQP2
T20447	7372-7373	HYPH	denotes	-
T20446	7373-7378	NN	denotes	F204V
T20448	7379-7380	-LRB-	denotes	(
T20449	7380-7383	CC	denotes	and
T20450	7384-7386	IN	denotes	in
T20452	7387-7391	DT	denotes	some
T20453	7392-7397	NNS	denotes	cases
T20454	7398-7409	RB	denotes	transiently
T20451	7410-7420	VBG	denotes	expressing
T20455	7421-7422	DT	denotes	a
T20457	7423-7426	NN	denotes	GFP
T20456	7427-7436	NN	denotes	construct
T20458	7436-7437	-RRB-	denotes	)
T20459	7438-7442	VBD	denotes	were
T20434	7443-7448	VBN	denotes	grown
T20460	7449-7451	IN	denotes	on
T20461	7452-7463	NN	denotes	fibronectin
T20463	7463-7464	HYPH	denotes	-
T20462	7464-7470	VBN	denotes	coated
T20464	7471-7481	NNS	denotes	coverslips
T20465	7482-7487	IN	denotes	until
T20467	7488-7493	JJ	denotes	tight
T20468	7494-7503	NNS	denotes	junctions
T20466	7504-7510	VBD	denotes	formed
T20469	7510-7511	.	denotes	.
T20470	7511-7608	sentence	denotes	Cells were treated with or without 150 μM forskolin for 90 min, and fixed in methanol at −20 °C.
T20471	7512-7517	NNS	denotes	Cells
T20473	7518-7522	VBD	denotes	were
T20472	7523-7530	VBN	denotes	treated
T20474	7531-7535	IN	denotes	with
T20475	7536-7538	CC	denotes	or
T20476	7539-7546	IN	denotes	without
T20477	7547-7550	CD	denotes	150
T20478	7551-7553	NN	denotes	μM
T20479	7554-7563	NN	denotes	forskolin
T20480	7564-7567	IN	denotes	for
T20481	7568-7570	CD	denotes	90
T20482	7571-7574	NN	denotes	min
T20483	7574-7576	,	denotes	,
T20484	7576-7579	CC	denotes	and
T20485	7580-7585	VBN	denotes	fixed
T20486	7586-7588	IN	denotes	in
T20487	7589-7597	NN	denotes	methanol
T20488	7598-7600	IN	denotes	at
T20489	7601-7602	SYM	denotes	−
T20490	7602-7604	CD	denotes	20
T20491	7605-7607	NN	denotes	°C
T20492	7607-7608	.	denotes	.
T20493	7608-7774	sentence	denotes	Subsequently, cells were washed and permeabilized in 0.2% Triton X-100 for 5 min, and sequentially probed for AQP2 and organelle markers for either the PM or the ER.
T20494	7609-7621	RB	denotes	Subsequently
T20496	7621-7623	,	denotes	,
T20497	7623-7628	NNS	denotes	cells
T20498	7629-7633	VBD	denotes	were
T20495	7634-7640	VBN	denotes	washed
T20499	7641-7644	CC	denotes	and
T20500	7645-7658	VBN	denotes	permeabilized
T20501	7659-7661	IN	denotes	in
T20502	7662-7665	CD	denotes	0.2
T20503	7665-7666	NN	denotes	%
T20505	7667-7673	NN	denotes	Triton
T20504	7674-7675	NN	denotes	X
T20506	7675-7676	HYPH	denotes	-
T20507	7676-7679	CD	denotes	100
T20508	7680-7683	IN	denotes	for
T20509	7684-7685	CD	denotes	5
T20510	7686-7689	NN	denotes	min
T20511	7689-7691	,	denotes	,
T20512	7691-7694	CC	denotes	and
T20513	7695-7707	RB	denotes	sequentially
T20514	7708-7714	VBN	denotes	probed
T20515	7715-7718	IN	denotes	for
T20516	7719-7723	NN	denotes	AQP2
T20517	7724-7727	CC	denotes	and
T20518	7728-7737	NN	denotes	organelle
T20519	7738-7745	NNS	denotes	markers
T20520	7746-7749	IN	denotes	for
T20521	7750-7756	CC	denotes	either
T20523	7757-7760	DT	denotes	the
T20522	7761-7763	NN	denotes	PM
T20524	7764-7766	CC	denotes	or
T20525	7767-7770	DT	denotes	the
T20526	7771-7773	NN	denotes	ER
T20527	7773-7774	.	denotes	.
T20528	7774-7944	sentence	denotes	AQP2 was detected using goat anti-AQP2 (1:100; Santa Cruz Biotechnology; #sc-9882) and a 1:200 dilution of AlexaFluor 488-conjugated donkey anti-goat secondary antibody.
T20529	7775-7779	NN	denotes	AQP2
T20531	7780-7783	VBD	denotes	was
T20530	7784-7792	VBN	denotes	detected
T20532	7793-7798	VBG	denotes	using
T20533	7799-7803	NN	denotes	goat
T20534	7804-7813	JJ	denotes	anti-AQP2
T20535	7814-7815	-LRB-	denotes	(
T20537	7815-7816	CD	denotes	1
T20538	7816-7817	SYM	denotes	:
T20539	7817-7820	CD	denotes	100
T20540	7820-7821	:	denotes	;
T20541	7822-7827	NNP	denotes	Santa
T20542	7828-7832	NNP	denotes	Cruz
T20543	7833-7846	NNP	denotes	Biotechnology
T20544	7846-7847	:	denotes	;
T20545	7848-7849	SYM	denotes	#
T20536	7849-7851	NN	denotes	sc
T20546	7851-7852	HYPH	denotes	-
T20547	7852-7856	CD	denotes	9882
T20548	7856-7857	-RRB-	denotes	)
T20549	7858-7861	CC	denotes	and
T20550	7862-7863	DT	denotes	a
T20552	7864-7865	CD	denotes	1
T20554	7865-7866	SYM	denotes	:
T20553	7866-7869	CD	denotes	200
T20551	7870-7878	NN	denotes	dilution
T20555	7879-7881	IN	denotes	of
T20556	7882-7892	NNP	denotes	AlexaFluor
T20558	7893-7896	CD	denotes	488
T20559	7896-7897	HYPH	denotes	-
T20557	7897-7907	VBN	denotes	conjugated
T20561	7908-7914	NN	denotes	donkey
T20562	7915-7924	JJ	denotes	anti-goat
T20563	7925-7934	JJ	denotes	secondary
T20560	7935-7943	NN	denotes	antibody
T20564	7943-7944	.	denotes	.
T20565	7944-8352	sentence	denotes	The PM and ER were probed using mouse anti-Na+/K+-ATPase (Upstate, Waltham, Massachusetts, United States) or rabbit anti-calnexin (Stressgen Biotechnology, Victoria, British Columbia, Canada) antibodies and the secondary antibodies, Cy3-conjugated goat anti-mouse (1:200; Jackson ImmunoResearch, West Grove, Pennsylvania, United States) or AlexaFluor 594-conjugated chicken anti-rabbit (1:200) respectively.
T20566	7945-7948	DT	denotes	The
T20567	7949-7951	NN	denotes	PM
T20569	7952-7955	CC	denotes	and
T20570	7956-7958	NN	denotes	ER
T20571	7959-7963	VBD	denotes	were
T20568	7964-7970	VBN	denotes	probed
T20572	7971-7976	VBG	denotes	using
T20573	7977-7982	NN	denotes	mouse
T20575	7983-7991	JJ	denotes	anti-Na+
T20576	7991-7992	HYPH	denotes	/
T20577	7992-7994	NN	denotes	K+
T20578	7994-7995	HYPH	denotes	-
T20574	7995-8001	NN	denotes	ATPase
T20580	8002-8003	-LRB-	denotes	(
T20581	8003-8010	NNP	denotes	Upstate
T20582	8010-8012	,	denotes	,
T20583	8012-8019	NNP	denotes	Waltham
T20584	8019-8021	,	denotes	,
T20585	8021-8034	NNP	denotes	Massachusetts
T20586	8034-8036	,	denotes	,
T20587	8036-8042	NNP	denotes	United
T20588	8043-8049	NNP	denotes	States
T20589	8049-8050	-RRB-	denotes	)
T20590	8051-8053	CC	denotes	or
T20591	8054-8060	NN	denotes	rabbit
T20592	8061-8074	JJ	denotes	anti-calnexin
T20593	8075-8076	-LRB-	denotes	(
T20595	8076-8085	NNP	denotes	Stressgen
T20594	8086-8099	NNP	denotes	Biotechnology
T20596	8099-8101	,	denotes	,
T20597	8101-8109	NNP	denotes	Victoria
T20598	8109-8111	,	denotes	,
T20599	8111-8118	NNP	denotes	British
T20600	8119-8127	NNP	denotes	Columbia
T20601	8127-8129	,	denotes	,
T20602	8129-8135	NNP	denotes	Canada
T20603	8135-8136	-RRB-	denotes	)
T20579	8137-8147	NNS	denotes	antibodies
T20604	8148-8151	CC	denotes	and
T20605	8152-8155	DT	denotes	the
T20607	8156-8165	JJ	denotes	secondary
T20606	8166-8176	NNS	denotes	antibodies
T20608	8176-8178	,	denotes	,
T20609	8178-8181	NN	denotes	Cy3
T20611	8181-8182	HYPH	denotes	-
T20610	8182-8192	VBN	denotes	conjugated
T20612	8193-8197	NN	denotes	goat
T20613	8198-8208	JJ	denotes	anti-mouse
T20614	8209-8210	-LRB-	denotes	(
T20616	8210-8211	CD	denotes	1
T20617	8211-8212	SYM	denotes	:
T20618	8212-8215	CD	denotes	200
T20619	8215-8216	:	denotes	;
T20620	8217-8224	NNP	denotes	Jackson
T20615	8225-8239	NNP	denotes	ImmunoResearch
T20621	8239-8241	,	denotes	,
T20622	8241-8245	NNP	denotes	West
T20623	8246-8251	NNP	denotes	Grove
T20624	8251-8253	,	denotes	,
T20625	8253-8265	NNP	denotes	Pennsylvania
T20626	8265-8267	,	denotes	,
T20627	8267-8273	NNP	denotes	United
T20628	8274-8280	NNP	denotes	States
T20629	8280-8281	-RRB-	denotes	)
T20630	8282-8284	CC	denotes	or
T20631	8285-8295	NNP	denotes	AlexaFluor
T20633	8296-8299	CD	denotes	594
T20634	8299-8300	HYPH	denotes	-
T20632	8300-8310	VBN	denotes	conjugated
T20635	8311-8318	NN	denotes	chicken
T20636	8319-8330	JJ	denotes	anti-rabbit
T20637	8331-8332	-LRB-	denotes	(
T20638	8332-8333	CD	denotes	1
T20639	8333-8334	SYM	denotes	:
T20640	8334-8337	CD	denotes	200
T20641	8337-8338	-RRB-	denotes	)
T20642	8339-8351	RB	denotes	respectively
T20643	8351-8352	.	denotes	.
T20644	8352-8432	sentence	denotes	Cells were washed in PBS, counterstained with DAPI, and mounted in Vectashield.
T20645	8353-8358	NNS	denotes	Cells
T20647	8359-8363	VBD	denotes	were
T20646	8364-8370	VBN	denotes	washed
T20648	8371-8373	IN	denotes	in
T20649	8374-8377	NN	denotes	PBS
T20650	8377-8379	,	denotes	,
T20651	8379-8393	VBN	denotes	counterstained
T20652	8394-8398	IN	denotes	with
T20653	8399-8403	NN	denotes	DAPI
T20654	8403-8405	,	denotes	,
T20655	8405-8408	CC	denotes	and
T20656	8409-8416	VBN	denotes	mounted
T20657	8417-8419	IN	denotes	in
T20658	8420-8431	NNP	denotes	Vectashield
T20659	8431-8432	.	denotes	.
T20660	8432-8650	sentence	denotes	In experiments in which GFP fusions were used, AQP2 was probed using the antibody combination used for kidney immunohistochemistry in order to detect the AQP2 at 594 nm, to distinguish between the GFP fusion proteins.
T20661	8433-8435	IN	denotes	In
T20663	8436-8447	NNS	denotes	experiments
T20664	8448-8450	IN	denotes	in
T20666	8451-8456	WDT	denotes	which
T20667	8457-8460	NN	denotes	GFP
T20668	8461-8468	NNS	denotes	fusions
T20669	8469-8473	VBD	denotes	were
T20665	8474-8478	VBN	denotes	used
T20670	8478-8480	,	denotes	,
T20671	8480-8484	NN	denotes	AQP2
T20672	8485-8488	VBD	denotes	was
T20662	8489-8495	VBN	denotes	probed
T20673	8496-8501	VBG	denotes	using
T20674	8502-8505	DT	denotes	the
T20676	8506-8514	NN	denotes	antibody
T20675	8515-8526	NN	denotes	combination
T20677	8527-8531	VBN	denotes	used
T20678	8532-8535	IN	denotes	for
T20679	8536-8542	NN	denotes	kidney
T20680	8543-8563	NN	denotes	immunohistochemistry
T20681	8564-8566	IN	denotes	in
T20682	8567-8572	NN	denotes	order
T20683	8573-8575	TO	denotes	to
T20684	8576-8582	VB	denotes	detect
T20685	8583-8586	DT	denotes	the
T20686	8587-8591	NN	denotes	AQP2
T20687	8592-8594	IN	denotes	at
T20688	8595-8598	CD	denotes	594
T20689	8599-8601	NN	denotes	nm
T20690	8601-8603	,	denotes	,
T20691	8603-8605	TO	denotes	to
T20692	8606-8617	VB	denotes	distinguish
T20693	8618-8625	IN	denotes	between
T20694	8626-8629	DT	denotes	the
T20696	8630-8633	NN	denotes	GFP
T20697	8634-8640	NN	denotes	fusion
T20695	8641-8649	NN	denotes	proteins
T20698	8649-8650	.	denotes	.
T20832	8652-8660	JJ	denotes	Confocal
T20833	8661-8671	NN	denotes	microscopy
T20834	8671-8672	.	denotes	.
T20835	8672-8820	sentence	denotes	Optical z-section images were collected on a BioRad (Hercules, California, United States) Rainbow Radiance 2100 Laser Scanning Confocal Microscope.
T20836	8673-8680	JJ	denotes	Optical
T20838	8681-8682	NN	denotes	z
T20840	8682-8683	HYPH	denotes	-
T20839	8683-8690	NN	denotes	section
T20837	8691-8697	NNS	denotes	images
T20842	8698-8702	VBD	denotes	were
T20841	8703-8712	VBN	denotes	collected
T20843	8713-8715	IN	denotes	on
T20844	8716-8717	DT	denotes	a
T20846	8718-8724	NNP	denotes	BioRad
T20847	8725-8726	-LRB-	denotes	(
T20848	8726-8734	NNP	denotes	Hercules
T20849	8734-8736	,	denotes	,
T20850	8736-8746	NNP	denotes	California
T20851	8746-8748	,	denotes	,
T20852	8748-8754	NNP	denotes	United
T20853	8755-8761	NNP	denotes	States
T20854	8761-8762	-RRB-	denotes	)
T20855	8763-8770	NNP	denotes	Rainbow
T20856	8771-8779	NNP	denotes	Radiance
T20857	8780-8784	CD	denotes	2100
T20858	8785-8790	NN	denotes	Laser
T20859	8791-8799	NN	denotes	Scanning
T20860	8800-8808	NN	denotes	Confocal
T20845	8809-8819	NN	denotes	Microscope
T20861	8819-8820	.	denotes	.
T20862	8820-9005	sentence	denotes	Image stacks were flattened, or sectioned along the z-axis, then further processed using BioRad Laser Sharp 2000 software and Image J software (v. 1.32; National Institutes of Health).
T20863	8821-8826	NN	denotes	Image
T20864	8827-8833	NNS	denotes	stacks
T20866	8834-8838	VBD	denotes	were
T20865	8839-8848	VBN	denotes	flattened
T20867	8848-8850	,	denotes	,
T20868	8850-8852	CC	denotes	or
T20869	8853-8862	VBN	denotes	sectioned
T20870	8863-8868	IN	denotes	along
T20871	8869-8872	DT	denotes	the
T20873	8873-8874	NN	denotes	z
T20874	8874-8875	HYPH	denotes	-
T20872	8875-8879	NN	denotes	axis
T20875	8879-8881	,	denotes	,
T20876	8881-8885	RB	denotes	then
T20878	8886-8893	RB	denotes	further
T20877	8894-8903	VBN	denotes	processed
T20879	8904-8909	VBG	denotes	using
T20880	8910-8916	NNP	denotes	BioRad
T20882	8917-8922	NNP	denotes	Laser
T20883	8923-8928	NNP	denotes	Sharp
T20884	8929-8933	CD	denotes	2000
T20881	8934-8942	NN	denotes	software
T20885	8943-8946	CC	denotes	and
T20886	8947-8952	NNP	denotes	Image
T20887	8953-8954	NNP	denotes	J
T20888	8955-8963	NN	denotes	software
T20889	8964-8965	-LRB-	denotes	(
T20891	8965-8967	NN	denotes	v.
T20892	8968-8972	CD	denotes	1.32
T20893	8972-8973	:	denotes	;
T20894	8974-8982	NNP	denotes	National
T20890	8983-8993	NNPS	denotes	Institutes
T20895	8994-8996	IN	denotes	of
T20896	8997-9003	NNP	denotes	Health
T20897	9003-9004	-RRB-	denotes	)
T20898	9004-9005	.	denotes	.
T20899	9005-9085	sentence	denotes	Colocalization was performed using the overlay coefficient of Image J software.
T20900	9006-9020	NN	denotes	Colocalization
T20902	9021-9024	VBD	denotes	was
T20901	9025-9034	VBN	denotes	performed
T20903	9035-9040	VBG	denotes	using
T20904	9041-9044	DT	denotes	the
T20906	9045-9052	JJ	denotes	overlay
T20905	9053-9064	NN	denotes	coefficient
T20907	9065-9067	IN	denotes	of
T20908	9068-9073	NNP	denotes	Image
T20909	9074-9075	NNP	denotes	J
T20910	9076-9084	NN	denotes	software
T20911	9084-9085	.	denotes	.
R4474	T15508	T15507	prep	of,Generation
R4475	T15509	T15510	compound	ENU,mice
R4476	T15510	T15508	pobj	mice,of
R4477	T15511	T15507	cc	and,Generation
R4478	T15512	T15507	conj	housing,Generation
R4479	T15513	T15512	punct	.,housing
R4480	T15515	T15516	nmod	ENU,mice
R4481	T15516	T15521	nsubjpass	mice,generated
R4482	T15517	T15516	amod	mutagenized,mice
R4483	T15518	T15516	nmod	C57BL,mice
R4484	T15519	T15518	punct	/,C57BL
R4485	T15520	T15518	nummod	6,C57BL
R4486	T15522	T15521	auxpass	were,generated
R4487	T15523	T15524	mark	as,described
R4488	T15524	T15521	advcl	described,generated
R4489	T15525	T15526	punct	[,19
R4490	T15526	T15521	parataxis	19,generated
R4491	T15527	T15526	punct	],19
R4492	T15528	T15521	punct	.,generated
R4493	T15530	T15531	nsubjpass	Mice,maintained
R4494	T15532	T15531	auxpass	were,maintained
R4495	T15533	T15531	prep	by,maintained
R4496	T15534	T15533	pcomp	backcrossing,by
R4497	T15535	T15536	amod	affected,animals
R4498	T15536	T15534	dobj	animals,backcrossing
R4499	T15537	T15534	prep	to,backcrossing
R4500	T15538	T15537	pobj	C57BL,to
R4501	T15539	T15538	punct	/,C57BL
R4502	T15540	T15538	nummod	6,C57BL
R4503	T15541	T15531	cc	and,maintained
R4504	T15542	T15531	conj	housed,maintained
R4505	T15543	T15542	prep	in,housed
R4506	T15544	T15545	det	the,Institute
R4507	T15545	T15543	pobj	Institute,in
R4508	T15546	T15545	compound	Genomics,Institute
R4509	T15547	T15545	prep	of,Institute
R4510	T15548	T15549	det	the,facility
R4511	T15549	T15547	pobj	facility,of
R4512	T15550	T15551	compound	Novartis,Foundation
R4513	T15551	T15549	compound	Foundation,facility
R4514	T15552	T15551	compound	Research,Foundation
R4515	T15553	T15554	compound	Specific,Pathogen
R4516	T15554	T15555	compound	Pathogen,Free
R4517	T15555	T15549	compound	Free,facility
R4518	T15556	T15549	compound	animal,facility
R4519	T15557	T15558	punct	(,Jolla
R4520	T15558	T15549	parataxis	Jolla,facility
R4521	T15559	T15558	compound	La,Jolla
R4522	T15560	T15558	punct	", ",Jolla
R4523	T15561	T15558	npadvmod	California,Jolla
R4524	T15562	T15558	punct	", ",Jolla
R4525	T15563	T15564	compound	United,States
R4526	T15564	T15558	npadvmod	States,Jolla
R4527	T15565	T15558	punct	),Jolla
R4528	T15566	T15531	punct	.,maintained
R4529	T15568	T15569	det	All,procedures
R4530	T15569	T15570	nsubjpass	procedures,approved
R4531	T15571	T15570	auxpass	were,approved
R4532	T15572	T15570	agent	by,approved
R4533	T15573	T15574	det	the,Institute
R4534	T15574	T15572	pobj	Institute,by
R4535	T15575	T15574	compound	Genomics,Institute
R4536	T15576	T15574	prep	of,Institute
R4537	T15577	T15578	det	the,Committee
R4538	T15578	T15576	pobj	Committee,of
R4539	T15579	T15580	nmod	Novartis,Foundation
R4540	T15580	T15578	nmod	Foundation,Committee
R4541	T15581	T15580	nmod	Research,Foundation
R4542	T15582	T15583	nmod	Institutional,Animal
R4543	T15583	T15578	nmod	Animal,Committee
R4544	T15584	T15583	appos	Care,Animal
R4545	T15585	T15584	cc	and,Care
R4546	T15586	T15584	conj	Use,Care
R4547	T15587	T15570	punct	.,approved
R4548	T15901	T15900	punct	.,Constructs
R4549	T15903	T15904	det	The,sequence
R4550	T15904	T15907	nsubjpass	sequence,digested
R4551	T15905	T15904	amod	complete,sequence
R4552	T15906	T15904	compound	coding,sequence
R4553	T15908	T15904	prep	of,sequence
R4554	T15909	T15910	compound	mouse,AQP2
R4555	T15910	T15908	pobj	AQP2,of
R4556	T15911	T15904	prep	from,sequence
R4557	T15912	T15913	det	an,clone
R4558	T15913	T15911	pobj	clone,from
R4559	T15914	T15913	compound	IMAGE,clone
R4560	T15915	T15907	auxpass	was,digested
R4561	T15916	T15907	prep	from,digested
R4562	T15917	T15918	det	the,plasmid
R4563	T15918	T15916	pobj	plasmid,from
R4564	T15919	T15918	compound	pCMV⋅SPORT6,plasmid
R4565	T15920	T15907	prep	with,digested
R4566	T15921	T15920	pobj	EcoRI,with
R4567	T15922	T15921	cc	and,EcoRI
R4568	T15923	T15921	conj	NotI,EcoRI
R4569	T15924	T15907	cc	and,digested
R4570	T15925	T15907	conj	ligated,digested
R4571	T15926	T15925	prep	into,ligated
R4572	T15927	T15926	pobj	pcDNA3.1,into
R4573	T15928	T15929	punct	(,Invitrogen
R4574	T15929	T15927	parataxis	Invitrogen,pcDNA3.1
R4575	T15930	T15929	punct	", ",Invitrogen
R4576	T15931	T15929	npadvmod	Carlsbad,Invitrogen
R4577	T15932	T15929	punct	", ",Invitrogen
R4578	T15933	T15929	npadvmod	California,Invitrogen
R4579	T15934	T15929	punct	", ",Invitrogen
R4580	T15935	T15936	compound	United,States
R4581	T15936	T15929	npadvmod	States,Invitrogen
R4582	T15937	T15929	punct	),Invitrogen
R4583	T15938	T15907	punct	.,digested
R4584	T15940	T15941	det	The,mutation
R4585	T15941	T15943	nsubjpass	mutation,introduced
R4586	T15942	T15941	compound	F204V,mutation
R4587	T15944	T15943	auxpass	was,introduced
R4588	T15945	T15943	prep	by,introduced
R4589	T15946	T15947	npadvmod	site,directed
R4590	T15947	T15949	amod	directed,mutagenesis
R4591	T15948	T15947	punct	-,directed
R4592	T15949	T15945	pobj	mutagenesis,by
R4593	T15950	T15951	punct	(,Stratagene
R4594	T15951	T15949	parataxis	Stratagene,mutagenesis
R4595	T15952	T15951	punct	", ",Stratagene
R4596	T15953	T15954	compound	La,Jolla
R4597	T15954	T15951	npadvmod	Jolla,Stratagene
R4598	T15955	T15951	punct	", ",Stratagene
R4599	T15956	T15951	npadvmod	California,Stratagene
R4600	T15957	T15951	punct	", ",Stratagene
R4601	T15958	T15959	compound	United,States
R4602	T15959	T15951	npadvmod	States,Stratagene
R4603	T15960	T15951	punct	),Stratagene
R4604	T15961	T15943	punct	", ",introduced
R4605	T15962	T15943	advcl	using,introduced
R4606	T15963	T15964	det	the,oligonucleotide
R4607	T15964	T15962	dobj	oligonucleotide,using
R4608	T15965	T15964	compound	sense,oligonucleotide
R4609	T15966	T15967	nummod	5,GATGATCACTGGGTCGTCTGGATCGGACCCC
R4610	T15967	T15964	appos	GATGATCACTGGGTCGTCTGGATCGGACCCC,oligonucleotide
R4611	T15968	T15966	punct	′,5
R4612	T15969	T15967	punct	-,GATGATCACTGGGTCGTCTGGATCGGACCCC
R4613	T15970	T15967	punct	-,GATGATCACTGGGTCGTCTGGATCGGACCCC
R4614	T15971	T15967	nummod	3,GATGATCACTGGGTCGTCTGGATCGGACCCC
R4615	T15972	T15967	punct	′,GATGATCACTGGGTCGTCTGGATCGGACCCC
R4616	T15973	T15964	punct	", ",oligonucleotide
R4617	T15974	T15964	cc	and,oligonucleotide
R4618	T15975	T15976	amod	antisense,oligonucleotide
R4619	T15976	T15964	conj	oligonucleotide,oligonucleotide
R4620	T15977	T15978	nummod	5,GGGGTCCGATCCAGACGACCCAGTGATCATC
R4621	T15978	T15976	appos	GGGGTCCGATCCAGACGACCCAGTGATCATC,oligonucleotide
R4622	T15979	T15977	punct	′,5
R4623	T15980	T15978	punct	-,GGGGTCCGATCCAGACGACCCAGTGATCATC
R4624	T15981	T15978	punct	-,GGGGTCCGATCCAGACGACCCAGTGATCATC
R4625	T15982	T15978	nummod	3,GGGGTCCGATCCAGACGACCCAGTGATCATC
R4626	T15983	T15978	punct	′,GGGGTCCGATCCAGACGACCCAGTGATCATC
R4627	T15984	T15943	punct	.,introduced
R4628	T15986	T15987	aux	To,generate
R4629	T15987	T15988	advcl	generate,used
R4630	T15989	T15990	compound	GFP,fusions
R4631	T15990	T15987	dobj	fusions,generate
R4632	T15991	T15990	prep	of,fusions
R4633	T15992	T15991	pobj	AQP2,of
R4634	T15993	T15988	punct	", ",used
R4635	T15994	T15995	det	the,construct
R4636	T15995	T15988	nsubjpass	construct,used
R4637	T15996	T15995	compound	pCMV⋅SPORT6,construct
R4638	T15997	T15995	compound	AQP2,construct
R4639	T15998	T15988	auxpass	was,used
R4640	T15999	T15988	prep	in,used
R4641	T16000	T16001	det	a,reaction
R4642	T16001	T15999	pobj	reaction,in
R4643	T16002	T16001	compound	PCR,reaction
R4644	T16003	T16001	prep	with,reaction
R4645	T16004	T16005	det	the,Sp6
R4646	T16005	T16003	pobj	Sp6,with
R4647	T16006	T16005	compound	primers,Sp6
R4648	T16007	T16005	cc	and,Sp6
R4649	T16008	T16009	nummod	5,GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG
R4650	T16009	T16005	conj	GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG,Sp6
R4651	T16010	T16008	punct	′,5
R4652	T16011	T16009	punct	-,GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG
R4653	T16012	T16009	punct	-,GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG
R4654	T16013	T16009	nummod	3,GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG
R4655	T16014	T16009	punct	′,GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG
R4656	T16015	T16016	aux	to,remove
R4657	T16016	T15988	advcl	remove,used
R4658	T16017	T16018	det	the,codon
R4659	T16018	T16016	dobj	codon,remove
R4660	T16019	T16018	compound	stop,codon
R4661	T16020	T16018	prep	of,codon
R4662	T16021	T16020	pobj	AQP2,of
R4663	T16022	T15988	punct	.,used
R4664	T16024	T16025	det	The,product
R4665	T16025	T16026	nsubjpass	product,digested
R4666	T16027	T16026	auxpass	was,digested
R4667	T16028	T16026	prep	with,digested
R4668	T16029	T16028	pobj	KpnI,with
R4669	T16030	T16029	cc	and,KpnI
R4670	T16031	T16029	conj	BamHI,KpnI
R4671	T16032	T16026	cc	and,digested
R4672	T16033	T16026	conj	ligated,digested
R4673	T16034	T16033	prep	into,ligated
R4674	T16035	T16036	compound	pEGFP,N2
R4675	T16036	T16034	pobj	N2,into
R4676	T16037	T16036	punct	-,N2
R4677	T16038	T16039	punct	(,Biosciences
R4678	T16039	T16036	parataxis	Biosciences,N2
R4679	T16040	T16039	compound	BD,Biosciences
R4680	T16041	T16039	punct	", ",Biosciences
R4681	T16042	T16043	compound	San,Diego
R4682	T16043	T16039	npadvmod	Diego,Biosciences
R4683	T16044	T16039	punct	", ",Biosciences
R4684	T16045	T16039	npadvmod	California,Biosciences
R4685	T16046	T16039	punct	", ",Biosciences
R4686	T16047	T16048	compound	United,States
R4687	T16048	T16039	npadvmod	States,Biosciences
R4688	T16049	T16039	punct	),Biosciences
R4689	T16050	T16026	punct	.,digested
R4690	T16052	T16053	det	The,mutation
R4691	T16053	T16055	nsubjpass	mutation,introduced
R4692	T16054	T16053	compound	F204V,mutation
R4693	T16056	T16055	auxpass	was,introduced
R4694	T16057	T16055	advcl	using,introduced
R4695	T16058	T16059	det	the,oligonucleotides
R4696	T16059	T16057	dobj	oligonucleotides,using
R4697	T16060	T16059	amod	same,oligonucleotides
R4698	T16061	T16059	amod	mutagenic,oligonucleotides
R4699	T16062	T16055	punct	.,introduced
R4700	T16399	T16400	compound	Cell,culture
R4701	T16401	T16400	cc	and,culture
R4702	T16402	T16400	conj	generation,culture
R4703	T16403	T16400	prep	of,culture
R4704	T16404	T16405	amod	stable,lines
R4705	T16405	T16403	pobj	lines,of
R4706	T16406	T16405	compound	cell,lines
R4707	T16407	T16400	punct	.,culture
R4708	T16409	T16410	compound	MDCK,cells
R4709	T16410	T16411	nsubjpass	cells,cultured
R4710	T16412	T16413	punct	(,ATCC
R4711	T16413	T16410	parataxis	ATCC,cells
R4712	T16414	T16413	dep	CCL,ATCC
R4713	T16415	T16414	punct	-,CCL
R4714	T16416	T16414	nummod	34,CCL
R4715	T16417	T16413	punct	;,ATCC
R4716	T16418	T16413	punct	", ",ATCC
R4717	T16419	T16413	npadvmod	Manassas,ATCC
R4718	T16420	T16413	punct	", ",ATCC
R4719	T16421	T16413	npadvmod	Virginia,ATCC
R4720	T16422	T16413	punct	", ",ATCC
R4721	T16423	T16424	compound	United,States
R4722	T16424	T16413	npadvmod	States,ATCC
R4723	T16425	T16413	punct	),ATCC
R4724	T16426	T16411	auxpass	were,cultured
R4725	T16427	T16411	prep	in,cultured
R4726	T16428	T16427	pobj	DMEM,in
R4727	T16429	T16430	punct	(,Aldrich
R4728	T16430	T16428	parataxis	Aldrich,DMEM
R4729	T16431	T16430	compound	Sigma,Aldrich
R4730	T16432	T16430	punct	-,Aldrich
R4731	T16433	T16430	punct	", ",Aldrich
R4732	T16434	T16435	compound	St.,Louis
R4733	T16435	T16430	npadvmod	Louis,Aldrich
R4734	T16436	T16430	punct	", ",Aldrich
R4735	T16437	T16430	npadvmod	Missouri,Aldrich
R4736	T16438	T16430	punct	", ",Aldrich
R4737	T16439	T16440	compound	United,States
R4738	T16440	T16430	npadvmod	States,Aldrich
R4739	T16441	T16430	punct	),Aldrich
R4740	T16442	T16411	dep	supplemented,cultured
R4741	T16443	T16442	prep	with,supplemented
R4742	T16444	T16445	nummod	10,%
R4743	T16445	T16446	compound	%,FBS
R4744	T16446	T16443	pobj	FBS,with
R4745	T16447	T16448	punct	(,Aldrich
R4746	T16448	T16446	parataxis	Aldrich,FBS
R4747	T16449	T16448	compound	Sigma,Aldrich
R4748	T16450	T16448	punct	-,Aldrich
R4749	T16451	T16448	punct	),Aldrich
R4750	T16452	T16446	punct	", ",FBS
R4751	T16453	T16454	nummod	100,U
R4752	T16454	T16446	conj	U,FBS
R4753	T16455	T16456	punct	/,ml
R4754	T16456	T16454	prep	ml,U
R4755	T16457	T16454	prep	of,U
R4756	T16458	T16457	pobj	penicillin,of
R4757	T16459	T16454	punct	", ",U
R4758	T16460	T16454	cc	and,U
R4759	T16461	T16462	nummod	100,μg
R4760	T16462	T16454	conj	μg,U
R4761	T16463	T16464	punct	/,ml
R4762	T16464	T16462	prep	ml,μg
R4763	T16465	T16462	prep	of,μg
R4764	T16466	T16465	pobj	streptomycin,of
R4765	T16467	T16446	prep	at,FBS
R4766	T16468	T16469	nummod	37,°C
R4767	T16469	T16467	pobj	°C,at
R4768	T16470	T16446	prep	in,FBS
R4769	T16471	T16472	nummod	5,%
R4770	T16472	T16473	compound	%,CO2
R4771	T16473	T16470	pobj	CO2,in
R4772	T16474	T16411	punct	.,cultured
R4773	T16476	T16477	aux	To,generate
R4774	T16477	T16478	advcl	generate,transfected
R4775	T16479	T16480	amod	stable,lines
R4776	T16480	T16477	dobj	lines,generate
R4777	T16481	T16480	compound	MDCK,lines
R4778	T16482	T16480	compound	cell,lines
R4779	T16483	T16478	punct	", ",transfected
R4780	T16484	T16478	nsubjpass	cells,transfected
R4781	T16485	T16478	auxpass	were,transfected
R4782	T16486	T16478	advcl	using,transfected
R4783	T16487	T16486	dobj	Lipofectamine,using
R4784	T16488	T16487	nummod	2000,Lipofectamine
R4785	T16489	T16490	punct	(,Invitrogen
R4786	T16490	T16487	parataxis	Invitrogen,Lipofectamine
R4787	T16491	T16490	punct	),Invitrogen
R4788	T16492	T16487	cc	and,Lipofectamine
R4789	T16493	T16494	det	the,constructs
R4790	T16494	T16487	conj	constructs,Lipofectamine
R4791	T16495	T16494	compound	pcDNA3.1,constructs
R4792	T16496	T16494	compound	expression,constructs
R4793	T16497	T16494	punct	(,constructs
R4794	T16498	T16494	acl	containing,constructs
R4795	T16499	T16500	amod	wild,type
R4796	T16500	T16502	compound	type,AQP2
R4797	T16501	T16500	punct	-,type
R4798	T16502	T16498	dobj	AQP2,containing
R4799	T16503	T16502	punct	", ",AQP2
R4800	T16504	T16505	compound	AQP2,F204V
R4801	T16505	T16502	conj	F204V,AQP2
R4802	T16506	T16505	punct	-,F204V
R4803	T16507	T16505	punct	", ",F204V
R4804	T16508	T16505	cc	or,F204V
R4805	T16509	T16510	det	no,insert
R4806	T16510	T16505	conj	insert,F204V
R4807	T16511	T16494	punct	),constructs
R4808	T16512	T16478	cc	and,transfected
R4809	T16513	T16478	conj	selected,transfected
R4810	T16514	T16513	prep	with,selected
R4811	T16515	T16516	nummod	900,μg
R4812	T16516	T16517	nmod	μg,G418
R4813	T16517	T16514	pobj	G418,with
R4814	T16518	T16519	punct	/,ml
R4815	T16519	T16516	prep	ml,μg
R4816	T16520	T16521	punct	(,Aldrich
R4817	T16521	T16517	parataxis	Aldrich,G418
R4818	T16522	T16521	compound	Sigma,Aldrich
R4819	T16523	T16521	punct	-,Aldrich
R4820	T16524	T16521	punct	),Aldrich
R4821	T16525	T16478	punct	.,transfected
R4822	T16527	T16528	amod	Individual,colonies
R4823	T16528	T16529	nsubjpass	colonies,expanded
R4824	T16530	T16529	auxpass	were,expanded
R4825	T16531	T16532	nummod	14,d
R4826	T16532	T16533	npadvmod	d,later
R4827	T16533	T16529	advmod	later,expanded
R4828	T16534	T16529	punct	.,expanded
R4829	T16536	T16537	prep	For,added
R4830	T16538	T16539	det	the,duration
R4831	T16539	T16536	pobj	duration,For
R4832	T16540	T16539	prep	of,duration
R4833	T16541	T16542	det	these,experiments
R4834	T16542	T16540	pobj	experiments,of
R4835	T16543	T16537	punct	", ",added
R4836	T16544	T16545	det	the,antibiotic
R4837	T16545	T16537	nsubjpass	antibiotic,added
R4838	T16546	T16537	auxpass	was,added
R4839	T16547	T16537	advmod	continually,added
R4840	T16548	T16537	prep	to,added
R4841	T16549	T16550	det	the,media
R4842	T16550	T16548	pobj	media,to
R4843	T16551	T16537	punct	.,added
R4844	T16553	T16554	amod	Transient,transfections
R4845	T16554	T16556	nsubjpass	transfections,carried
R4846	T16555	T16554	compound	GFP,transfections
R4847	T16557	T16556	auxpass	were,carried
R4848	T16558	T16556	prt	out,carried
R4849	T16559	T16556	prep	in,carried
R4850	T16560	T16561	amod	subconfluent,lines
R4851	T16561	T16559	pobj	lines,in
R4852	T16562	T16561	amod	stable,lines
R4853	T16563	T16561	compound	cells,lines
R4854	T16564	T16556	advmod	also,carried
R4855	T16565	T16556	advcl	using,carried
R4856	T16566	T16565	dobj	Lipofectamine,using
R4857	T16567	T16566	nummod	2000,Lipofectamine
R4858	T16568	T16556	punct	.,carried
R4859	T16677	T16676	prep	of,Sequencing
R4860	T16678	T16677	pobj	Aqp2,of
R4861	T16679	T16676	cc	and,Sequencing
R4862	T16680	T16676	conj	genotyping,Sequencing
R4863	T16681	T16680	prep	of,genotyping
R4864	T16682	T16681	pobj	mice,of
R4865	T16683	T16680	punct	.,genotyping
R4866	T16685	T16686	det	All,exons
R4867	T16686	T16687	nsubjpass	exons,amplified
R4868	T16688	T16686	prep	of,exons
R4869	T16689	T16688	pobj	Aqp2,of
R4870	T16690	T16687	auxpass	were,amplified
R4871	T16691	T16687	prep	from,amplified
R4872	T16692	T16693	nmod	mouse,DNA
R4873	T16693	T16691	pobj	DNA,from
R4874	T16694	T16693	amod	genomic,DNA
R4875	T16695	T16687	cc	and,amplified
R4876	T16696	T16687	conj	sequenced,amplified
R4877	T16697	T16687	punct	.,amplified
R4878	T16699	T16700	prep	For,amplified
R4879	T16701	T16699	pobj	genotyping,For
R4880	T16702	T16700	punct	", ",amplified
R4881	T16703	T16700	nsubjpass	exon,amplified
R4882	T16704	T16703	nummod	4,exon
R4883	T16705	T16700	auxpass	was,amplified
R4884	T16706	T16700	advcl	using,amplified
R4885	T16707	T16708	det	the,primers
R4886	T16708	T16706	dobj	primers,using
R4887	T16709	T16710	nummod	5,TCAGAACTTGCCCACTAGCC
R4888	T16710	T16708	appos	TCAGAACTTGCCCACTAGCC,primers
R4889	T16711	T16709	punct	′,5
R4890	T16712	T16710	punct	-,TCAGAACTTGCCCACTAGCC
R4891	T16713	T16710	punct	-,TCAGAACTTGCCCACTAGCC
R4892	T16714	T16710	nummod	3,TCAGAACTTGCCCACTAGCC
R4893	T16715	T16710	punct	′,TCAGAACTTGCCCACTAGCC
R4894	T16716	T16710	cc	and,TCAGAACTTGCCCACTAGCC
R4895	T16717	T16718	nummod	5,TGTAGAGGAGGGAACCGATG
R4896	T16718	T16710	conj	TGTAGAGGAGGGAACCGATG,TCAGAACTTGCCCACTAGCC
R4897	T16719	T16717	punct	′,5
R4898	T16720	T16718	punct	-,TGTAGAGGAGGGAACCGATG
R4899	T16721	T16718	punct	-,TGTAGAGGAGGGAACCGATG
R4900	T16722	T16718	nummod	3,TGTAGAGGAGGGAACCGATG
R4901	T16723	T16718	punct	′,TGTAGAGGAGGGAACCGATG
R4902	T16724	T16700	punct	.,amplified
R4903	T16959	T16960	compound	Urine,measurements
R4904	T16961	T16960	punct	.,measurements
R4905	T16963	T16964	amod	Total,output
R4906	T16964	T16966	nsubjpass	output,measured
R4907	T16965	T16964	compound	urine,output
R4908	T16967	T16966	auxpass	was,measured
R4909	T16968	T16966	prep	by,measured
R4910	T16969	T16970	advmod	separately,housing
R4911	T16970	T16968	pcomp	housing,by
R4912	T16971	T16972	amod	adult,mice
R4913	T16972	T16970	dobj	mice,housing
R4914	T16973	T16970	prep	in,housing
R4915	T16974	T16975	nmod	Nalgene,Cages
R4916	T16975	T16973	pobj	Cages,in
R4917	T16976	T16975	amod	Metabolic,Cages
R4918	T16977	T16978	punct	(,Minimitter
R4919	T16978	T16975	parataxis	Minimitter,Cages
R4920	T16979	T16978	punct	", ",Minimitter
R4921	T16980	T16978	npadvmod	Bend,Minimitter
R4922	T16981	T16978	punct	", ",Minimitter
R4923	T16982	T16978	npadvmod	Oregon,Minimitter
R4924	T16983	T16978	punct	", ",Minimitter
R4925	T16984	T16985	compound	United,States
R4926	T16985	T16978	npadvmod	States,Minimitter
R4927	T16986	T16978	punct	),Minimitter
R4928	T16987	T16970	prep	for,housing
R4929	T16988	T16989	quantmod	2,3
R4930	T16989	T16991	nummod	3,d
R4931	T16990	T16989	punct	–,3
R4932	T16991	T16987	pobj	d,for
R4933	T16992	T16970	cc	and,housing
R4934	T16993	T16970	conj	collecting,housing
R4935	T16994	T16993	dobj	urine,collecting
R4936	T16995	T16996	det	every,period
R4937	T16996	T16993	npadvmod	period,collecting
R4938	T16997	T16998	nummod	24,h
R4939	T16998	T16996	compound	h,period
R4940	T16999	T16966	punct	.,measured
R4941	T17001	T17002	compound	Urine,osmolalities
R4942	T17002	T17003	nsubjpass	osmolalities,determined
R4943	T17004	T17003	auxpass	were,determined
R4944	T17005	T17003	advcl	using,determined
R4945	T17006	T17007	det	an,Osmometer
R4946	T17007	T17005	dobj	Osmometer,using
R4947	T17008	T17009	punct	(,Systems
R4948	T17009	T17007	parataxis	Systems,Osmometer
R4949	T17010	T17009	dep	Osmette,Systems
R4950	T17011	T17010	nummod	5004,Osmette
R4951	T17012	T17009	punct	;,Systems
R4952	T17013	T17009	compound	Precision,Systems
R4953	T17014	T17009	punct	", ",Systems
R4954	T17015	T17009	npadvmod	Natick,Systems
R4955	T17016	T17009	punct	", ",Systems
R4956	T17017	T17009	npadvmod	Massachusetts,Systems
R4957	T17018	T17009	punct	", ",Systems
R4958	T17019	T17020	compound	United,States
R4959	T17020	T17009	npadvmod	States,Systems
R4960	T17021	T17009	punct	),Systems
R4961	T17022	T17003	punct	.,determined
R4962	T17024	T17025	npadvmod	Urine,concentrating
R4963	T17025	T17026	amod	concentrating,experiments
R4964	T17026	T17027	nsubjpass	experiments,carried
R4965	T17028	T17027	auxpass	were,carried
R4966	T17029	T17027	prt	out,carried
R4967	T17030	T17027	prep	by,carried
R4968	T17031	T17032	amod	intraperitoneal,injection
R4969	T17032	T17030	pobj	injection,by
R4970	T17033	T17032	prep	of,injection
R4971	T17034	T17033	pobj	dDAVP,of
R4972	T17035	T17036	punct	(,μg
R4973	T17036	T17034	parataxis	μg,dDAVP
R4974	T17037	T17036	nummod	0.4,μg
R4975	T17038	T17039	punct	/,kg
R4976	T17039	T17036	prep	kg,μg
R4977	T17040	T17036	punct	),μg
R4978	T17041	T17027	punct	.,carried
R4979	T17043	T17044	nsubjpass	Mice,injected
R4980	T17045	T17044	auxpass	were,injected
R4981	T17046	T17044	advmod	twice,injected
R4982	T17047	T17044	prep	with,injected
R4983	T17048	T17047	pobj	dDAVP,with
R4984	T17049	T17044	punct	", ",injected
R4985	T17050	T17051	advmod	once,at
R4986	T17051	T17044	prep	at,injected
R4987	T17052	T17051	pobj	time,at
R4988	T17053	T17052	nummod	0,time
R4989	T17054	T17051	cc	and,at
R4990	T17055	T17056	advmod	again,at
R4991	T17056	T17051	conj	at,at
R4992	T17057	T17058	nummod	30,min
R4993	T17058	T17056	pobj	min,at
R4994	T17059	T17044	punct	.,injected
R4995	T17061	T17062	nsubjpass	Urine,collected
R4996	T17063	T17062	auxpass	was,collected
R4997	T17064	T17062	prep	at,collected
R4998	T17065	T17066	det	the,start
R4999	T17066	T17064	pobj	start,at
R5000	T17067	T17066	prep	of,start
R5001	T17068	T17069	det	the,experiment
R5002	T17069	T17067	pobj	experiment,of
R5003	T17070	T17064	cc	and,at
R5004	T17071	T17072	nummod	30,min
R5005	T17072	T17073	npadvmod	min,after
R5006	T17073	T17064	conj	after,at
R5007	T17074	T17075	det	the,injection
R5008	T17075	T17073	pobj	injection,after
R5009	T17076	T17075	amod	second,injection
R5010	T17077	T17062	punct	.,collected
R5011	T17265	T17266	compound	Kidney,membrane
R5012	T17266	T17267	compound	membrane,preparation
R5013	T17268	T17267	punct	.,preparation
R5014	T17270	T17271	amod	Whole,kidneys
R5015	T17271	T17273	nsubjpass	kidneys,homogenized
R5016	T17272	T17271	compound	mouse,kidneys
R5017	T17274	T17273	auxpass	were,homogenized
R5018	T17275	T17273	prep	in,homogenized
R5019	T17276	T17277	nummod	10,mM
R5020	T17277	T17278	compound	mM,Tris
R5021	T17278	T17275	pobj	Tris,in
R5022	T17279	T17278	punct	(,Tris
R5023	T17280	T17278	npadvmod	pH,Tris
R5024	T17281	T17280	nummod	7.4,pH
R5025	T17282	T17278	punct	),Tris
R5026	T17283	T17278	punct	", ",Tris
R5027	T17284	T17285	nummod	350,mM
R5028	T17285	T17286	compound	mM,sucrose
R5029	T17286	T17278	conj	sucrose,Tris
R5030	T17287	T17286	punct	", ",sucrose
R5031	T17288	T17286	cc	and,sucrose
R5032	T17289	T17290	nummod	5,mM
R5033	T17290	T17291	compound	mM,EDTA
R5034	T17291	T17286	conj	EDTA,sucrose
R5035	T17292	T17291	acl	containing,EDTA
R5036	T17293	T17294	compound	protease,inhibitors
R5037	T17294	T17292	dobj	inhibitors,containing
R5038	T17295	T17296	punct	(,P
R5039	T17296	T17294	parataxis	P,inhibitors
R5040	T17297	T17298	compound	Sigma,Aldrich
R5041	T17298	T17296	dep	Aldrich,P
R5042	T17299	T17298	punct	-,Aldrich
R5043	T17300	T17296	punct	", ",P
R5044	T17301	T17296	punct	#,P
R5045	T17302	T17296	punct	-,P
R5046	T17303	T17296	nummod	8340,P
R5047	T17304	T17296	punct	),P
R5048	T17305	T17273	prep	in,homogenized
R5049	T17306	T17307	det	a,homogenizer
R5050	T17307	T17305	pobj	homogenizer,in
R5051	T17308	T17309	compound	Potter,Elvehjem
R5052	T17309	T17307	compound	Elvehjem,homogenizer
R5053	T17310	T17309	punct	-,Elvehjem
R5054	T17311	T17273	punct	.,homogenized
R5055	T17313	T17314	det	The,homogenate
R5056	T17314	T17315	nsubjpass	homogenate,centrifuged
R5057	T17316	T17315	auxpass	was,centrifuged
R5058	T17317	T17315	prep	at,centrifuged
R5059	T17318	T17319	nummod	"2,000",g
R5060	T17319	T17317	pobj	g,at
R5061	T17320	T17315	prep	for,centrifuged
R5062	T17321	T17322	nummod	10,min
R5063	T17322	T17320	pobj	min,for
R5064	T17323	T17315	cc	and,centrifuged
R5065	T17324	T17325	det	the,supernatant
R5066	T17325	T17326	nsubjpass	supernatant,subjected
R5067	T17326	T17315	conj	subjected,centrifuged
R5068	T17327	T17326	auxpass	was,subjected
R5069	T17328	T17326	prep	to,subjected
R5070	T17329	T17328	pobj	ultracentrifugation,to
R5071	T17330	T17329	prep	at,ultracentrifugation
R5072	T17331	T17332	nummod	"100,000",g
R5073	T17332	T17330	pobj	g,at
R5074	T17333	T17326	prep	for,subjected
R5075	T17334	T17335	nummod	1,h
R5076	T17335	T17333	pobj	h,for
R5077	T17336	T17326	prep	at,subjected
R5078	T17337	T17338	nummod	4,°C
R5079	T17338	T17336	pobj	°C,at
R5080	T17339	T17326	punct	.,subjected
R5081	T17341	T17342	amod	Pelleted,membranes
R5082	T17342	T17343	nsubjpass	membranes,resuspended
R5083	T17344	T17343	auxpass	were,resuspended
R5084	T17345	T17343	prep	in,resuspended
R5085	T17346	T17347	det	the,buffer
R5086	T17347	T17345	pobj	buffer,in
R5087	T17348	T17347	amod	same,buffer
R5088	T17349	T17343	punct	", ",resuspended
R5089	T17350	T17343	cc	and,resuspended
R5090	T17351	T17352	compound	protein,concentration
R5091	T17352	T17353	nsubjpass	concentration,determined
R5092	T17353	T17343	conj	determined,resuspended
R5093	T17354	T17353	auxpass	was,determined
R5094	T17355	T17353	prep	by,determined
R5095	T17356	T17357	compound	Bradford,assay
R5096	T17357	T17355	pobj	assay,by
R5097	T17358	T17353	punct	.,determined
R5098	T17615	T17614	punct	.,Immunoblotting
R5099	T17617	T17618	compound	Kidney,membrane
R5100	T17618	T17619	compound	membrane,fractions
R5101	T17619	T17620	nsubjpass	fractions,resolved
R5102	T17621	T17622	punct	(,μg
R5103	T17622	T17619	parataxis	μg,fractions
R5104	T17623	T17622	nummod	60,μg
R5105	T17624	T17622	punct	),μg
R5106	T17625	T17620	auxpass	were,resolved
R5107	T17626	T17620	prep	on,resolved
R5108	T17627	T17628	det	a,gel
R5109	T17628	T17626	pobj	gel,on
R5110	T17629	T17630	nummod	12,%
R5111	T17630	T17628	compound	%,gel
R5112	T17631	T17632	compound	SDS,polyacrylamide
R5113	T17632	T17628	compound	polyacrylamide,gel
R5114	T17633	T17632	punct	-,polyacrylamide
R5115	T17634	T17620	cc	and,resolved
R5116	T17635	T17620	conj	transferred,resolved
R5117	T17636	T17635	prep	to,transferred
R5118	T17637	T17638	det	a,membrane
R5119	T17638	T17636	pobj	membrane,to
R5120	T17639	T17638	compound	nitrocellulose,membrane
R5121	T17640	T17620	punct	.,resolved
R5122	T17642	T17643	nsubjpass	Membranes,blocked
R5123	T17644	T17643	auxpass	were,blocked
R5124	T17645	T17643	prep	in,blocked
R5125	T17646	T17647	nummod	5,%
R5126	T17647	T17648	nmod	%,milk
R5127	T17648	T17645	pobj	milk,in
R5128	T17649	T17648	amod	nonfat,milk
R5129	T17650	T17648	prep	in,milk
R5130	T17651	T17652	npadvmod	Tris,buffered
R5131	T17652	T17654	amod	buffered,saline
R5132	T17653	T17652	punct	-,buffered
R5133	T17654	T17650	pobj	saline,in
R5134	T17655	T17654	prep	with,saline
R5135	T17656	T17657	nummod	0.05,%
R5136	T17657	T17658	compound	%,Tween
R5137	T17658	T17655	pobj	Tween,with
R5138	T17659	T17658	nummod	20,Tween
R5139	T17660	T17661	punct	(,TBST
R5140	T17661	T17658	parataxis	TBST,Tween
R5141	T17662	T17661	punct	),TBST
R5142	T17663	T17643	punct	", ",blocked
R5143	T17664	T17643	advcl	followed,blocked
R5144	T17665	T17664	agent	by,followed
R5145	T17666	T17667	det	an,incubation
R5146	T17667	T17665	pobj	incubation,by
R5147	T17668	T17667	amod	overnight,incubation
R5148	T17669	T17667	punct	(,incubation
R5149	T17670	T17667	prep	at,incubation
R5150	T17671	T17672	nummod	4,°C
R5151	T17672	T17670	pobj	°C,at
R5152	T17673	T17667	punct	),incubation
R5153	T17674	T17667	prep	with,incubation
R5154	T17675	T17676	nmod	AQP2,antibody
R5155	T17676	T17674	pobj	antibody,with
R5156	T17677	T17676	amod	polyclonal,antibody
R5157	T17678	T17679	punct	(,sc
R5158	T17679	T17676	parataxis	sc,antibody
R5159	T17680	T17681	compound	Santa,Cruz
R5160	T17681	T17682	compound	Cruz,Biotechnology
R5161	T17682	T17679	dep	Biotechnology,sc
R5162	T17683	T17682	punct	", ",Biotechnology
R5163	T17684	T17685	compound	Santa,Cruz
R5164	T17685	T17682	npadvmod	Cruz,Biotechnology
R5165	T17686	T17682	punct	", ",Biotechnology
R5166	T17687	T17682	npadvmod	California,Biotechnology
R5167	T17688	T17682	punct	", ",Biotechnology
R5168	T17689	T17690	compound	United,States
R5169	T17690	T17682	npadvmod	States,Biotechnology
R5170	T17691	T17679	punct	;,sc
R5171	T17692	T17679	punct	#,sc
R5172	T17693	T17679	punct	-,sc
R5173	T17694	T17679	nummod	9882,sc
R5174	T17695	T17679	punct	),sc
R5175	T17696	T17643	punct	.,blocked
R5176	T17698	T17699	nsubjpass	Membranes,washed
R5177	T17700	T17699	auxpass	were,washed
R5178	T17701	T17699	prep	in,washed
R5179	T17702	T17701	pobj	TBST,in
R5180	T17703	T17704	advmod	then,incubated
R5181	T17704	T17699	dep	incubated,washed
R5182	T17705	T17704	prep	with,incubated
R5183	T17706	T17707	npadvmod	HRP,conjugated
R5184	T17707	T17709	amod	conjugated,antibody
R5185	T17708	T17707	punct	-,conjugated
R5186	T17709	T17705	pobj	antibody,with
R5187	T17710	T17709	nmod	donkey,antibody
R5188	T17711	T17709	amod	anti-goat,antibody
R5189	T17712	T17699	punct	.,washed
R5190	T17714	T17715	nsubjpass	Membranes,washed
R5191	T17716	T17715	auxpass	were,washed
R5192	T17717	T17715	advmod	further,washed
R5193	T17718	T17715	prep	in,washed
R5194	T17719	T17718	pobj	TBST,in
R5195	T17720	T17715	cc	and,washed
R5196	T17721	T17722	nsubjpass	bands,visualized
R5197	T17722	T17715	conj	visualized,washed
R5198	T17723	T17722	auxpass	were,visualized
R5199	T17724	T17722	advcl	using,visualized
R5200	T17725	T17726	compound	ECL,reagent
R5201	T17726	T17724	dobj	reagent,using
R5202	T17727	T17728	punct	(,Biosciences
R5203	T17728	T17726	parataxis	Biosciences,reagent
R5204	T17729	T17728	compound	Amersham,Biosciences
R5205	T17730	T17728	punct	", ",Biosciences
R5206	T17731	T17732	compound	Little,Chalfont
R5207	T17732	T17728	npadvmod	Chalfont,Biosciences
R5208	T17733	T17728	punct	", ",Biosciences
R5209	T17734	T17735	compound	United,Kingdom
R5210	T17735	T17728	npadvmod	Kingdom,Biosciences
R5211	T17736	T17728	punct	),Biosciences
R5212	T17737	T17722	punct	.,visualized
R5213	T17905	T17906	compound	Endoglycosidase,digestion
R5214	T17907	T17906	punct	.,digestion
R5215	T17909	T17910	compound	Kidney,membranes
R5216	T17910	T17911	nsubjpass	membranes,incubated
R5217	T17912	T17913	punct	(,μg
R5218	T17913	T17910	parataxis	μg,membranes
R5219	T17914	T17913	nummod	60,μg
R5220	T17915	T17913	punct	),μg
R5221	T17916	T17911	auxpass	were,incubated
R5222	T17917	T17911	prep	in,incubated
R5223	T17918	T17919	nummod	50,mM
R5224	T17919	T17920	compound	mM,phosphate
R5225	T17920	T17917	pobj	phosphate,in
R5226	T17921	T17920	compound	sodium,phosphate
R5227	T17922	T17920	punct	(,phosphate
R5228	T17923	T17920	npadvmod	pH,phosphate
R5229	T17924	T17923	nummod	5.5,pH
R5230	T17925	T17920	punct	),phosphate
R5231	T17926	T17920	punct	", ",phosphate
R5232	T17927	T17928	nummod	0.1,%
R5233	T17928	T17929	compound	%,SDS
R5234	T17929	T17920	appos	SDS,phosphate
R5235	T17930	T17929	punct	", ",SDS
R5236	T17931	T17929	cc	and,SDS
R5237	T17932	T17933	nummod	50,mM
R5238	T17933	T17934	compound	mM,mercaptoethanol
R5239	T17934	T17929	conj	mercaptoethanol,SDS
R5240	T17935	T17934	compound	β,mercaptoethanol
R5241	T17936	T17934	punct	-,mercaptoethanol
R5242	T17937	T17911	punct	", ",incubated
R5243	T17938	T17911	dep	heated,incubated
R5244	T17939	T17938	prep	to,heated
R5245	T17940	T17941	nummod	100,°C
R5246	T17941	T17939	pobj	°C,to
R5247	T17942	T17938	prep	for,heated
R5248	T17943	T17944	nummod	5,min
R5249	T17944	T17942	pobj	min,for
R5250	T17945	T17911	punct	", ",incubated
R5251	T17946	T17947	advmod	then,cooled
R5252	T17947	T17911	dep	cooled,incubated
R5253	T17948	T17911	punct	.,incubated
R5254	T17950	T17951	compound	Endoglycosidase,H
R5255	T17951	T17952	nsubjpass	H,added
R5256	T17953	T17954	punct	(,Aldrich
R5257	T17954	T17951	parataxis	Aldrich,H
R5258	T17955	T17956	nummod	0.01,units
R5259	T17956	T17954	dep	units,Aldrich
R5260	T17957	T17954	punct	;,Aldrich
R5261	T17958	T17954	compound	Sigma,Aldrich
R5262	T17959	T17954	punct	-,Aldrich
R5263	T17960	T17954	punct	),Aldrich
R5264	T17961	T17952	auxpass	was,added
R5265	T17962	T17952	cc	and,added
R5266	T17963	T17952	conj	incubated,added
R5267	T17964	T17963	prep	at,incubated
R5268	T17965	T17966	nummod	37,°C
R5269	T17966	T17964	pobj	°C,at
R5270	T17967	T17963	prep	for,incubated
R5271	T17968	T17969	nummod	2,h
R5272	T17969	T17967	pobj	h,for
R5273	T17970	T17952	punct	.,added
R5274	T17972	T17973	det	The,reaction
R5275	T17973	T17974	nsubjpass	reaction,stopped
R5276	T17975	T17974	auxpass	was,stopped
R5277	T17976	T17974	prep	by,stopped
R5278	T17977	T17976	pcomp	boiling,by
R5279	T17978	T17979	det	the,samples
R5280	T17979	T17977	dobj	samples,boiling
R5281	T17980	T17977	prep	in,boiling
R5282	T17981	T17982	compound	Laemmli,buffer
R5283	T17982	T17980	pobj	buffer,in
R5284	T17983	T17974	punct	.,stopped
R5285	T17985	T17986	amod	Total,reactants
R5286	T17986	T17987	nsubjpass	reactants,immunoblotted
R5287	T17988	T17987	auxpass	were,immunoblotted
R5288	T17989	T17990	mark	as,described
R5289	T17990	T17987	advcl	described,immunoblotted
R5290	T17991	T17990	advmod	above,described
R5291	T17992	T17987	punct	.,immunoblotted
R5292	T18784	T18783	cc	and,Coimmunoprecipitation
R5293	T18785	T18783	conj	biotinylation,Coimmunoprecipitation
R5294	T18786	T18783	prep	in,Coimmunoprecipitation
R5295	T18787	T18788	compound	MDCK,cells
R5296	T18788	T18786	pobj	cells,in
R5297	T18789	T18783	punct	.,Coimmunoprecipitation
R5298	T18791	T18792	compound	MDCK,cells
R5299	T18792	T18793	nsubjpass	cells,transfected
R5300	T18794	T18795	advmod	stably,expressing
R5301	T18795	T18792	acl	expressing,cells
R5302	T18796	T18797	amod	wild,type
R5303	T18797	T18799	compound	type,AQP2
R5304	T18798	T18797	punct	-,type
R5305	T18799	T18795	dobj	AQP2,expressing
R5306	T18800	T18799	punct	(,AQP2
R5307	T18801	T18799	acl	grown,AQP2
R5308	T18802	T18801	prep	on,grown
R5309	T18803	T18804	nummod	10,cm
R5310	T18804	T18806	compound	cm,plates
R5311	T18805	T18804	punct	-,cm
R5312	T18806	T18802	pobj	plates,on
R5313	T18807	T18795	punct	),expressing
R5314	T18808	T18793	auxpass	were,transfected
R5315	T18809	T18793	prep	with,transfected
R5316	T18810	T18811	nmod	pEGFP,type
R5317	T18811	T18815	compound	type,AQP2
R5318	T18812	T18811	punct	-,type
R5319	T18813	T18811	amod	wild,type
R5320	T18814	T18811	punct	-,type
R5321	T18815	T18809	pobj	AQP2,with
R5322	T18816	T18815	punct	", ",AQP2
R5323	T18817	T18818	compound	pEGFP,F204V
R5324	T18818	T18815	conj	F204V,AQP2
R5325	T18819	T18818	punct	-,F204V
R5326	T18820	T18818	compound	AQP2,F204V
R5327	T18821	T18818	punct	-,F204V
R5328	T18822	T18818	punct	", ",F204V
R5329	T18823	T18818	cc	or,F204V
R5330	T18824	T18818	conj	vector,F204V
R5331	T18825	T18824	advmod	alone,vector
R5332	T18826	T18793	punct	.,transfected
R5333	T18828	T18829	det	The,cells
R5334	T18829	T18830	nsubjpass	cells,homogenized
R5335	T18831	T18830	auxpass	were,homogenized
R5336	T18832	T18830	prep	in,homogenized
R5337	T18833	T18834	nummod	10,mM
R5338	T18834	T18835	compound	mM,Tris
R5339	T18835	T18832	pobj	Tris,in
R5340	T18836	T18835	punct	(,Tris
R5341	T18837	T18835	npadvmod	pH,Tris
R5342	T18838	T18837	nummod	7.4,pH
R5343	T18839	T18835	punct	),Tris
R5344	T18840	T18835	punct	", ",Tris
R5345	T18841	T18842	nummod	1,mM
R5346	T18842	T18843	compound	mM,EDTA
R5347	T18843	T18835	conj	EDTA,Tris
R5348	T18844	T18843	punct	", ",EDTA
R5349	T18845	T18843	cc	and,EDTA
R5350	T18846	T18847	nummod	250,mM
R5351	T18847	T18848	compound	mM,sucrose
R5352	T18848	T18843	conj	sucrose,EDTA
R5353	T18849	T18850	nummod	40,h
R5354	T18850	T18851	npadvmod	h,later
R5355	T18851	T18830	advmod	later,homogenized
R5356	T18852	T18830	punct	.,homogenized
R5357	T18854	T18855	det	The,supernatant
R5358	T18855	T18857	nsubjpass	supernatant,centrifuged
R5359	T18856	T18855	amod	clarified,supernatant
R5360	T18858	T18857	auxpass	was,centrifuged
R5361	T18859	T18857	prep	at,centrifuged
R5362	T18860	T18861	nummod	"200,000",g
R5363	T18861	T18859	pobj	g,at
R5364	T18862	T18857	prep	for,centrifuged
R5365	T18863	T18864	nummod	30,min
R5366	T18864	T18862	pobj	min,for
R5367	T18865	T18857	punct	.,centrifuged
R5368	T18867	T18868	amod	Pelleted,membranes
R5369	T18868	T18869	nsubjpass	membranes,incubated
R5370	T18870	T18869	auxpass	were,incubated
R5371	T18871	T18869	aux	resuspended,incubated
R5372	T18872	T18869	prep	in,incubated
R5373	T18873	T18874	det	the,buffer
R5374	T18874	T18872	pobj	buffer,in
R5375	T18875	T18874	amod	same,buffer
R5376	T18876	T18874	prep	but,buffer
R5377	T18877	T18876	pcomp	containing,but
R5378	T18878	T18879	nummod	4,%
R5379	T18879	T18880	compound	%,deoxycholate
R5380	T18880	T18877	dobj	deoxycholate,containing
R5381	T18881	T18880	compound	sodium,deoxycholate
R5382	T18882	T18869	cc	and,incubated
R5383	T18883	T18869	prep	at,incubated
R5384	T18884	T18885	nummod	37,°C
R5385	T18885	T18883	pobj	°C,at
R5386	T18886	T18869	prep	for,incubated
R5387	T18887	T18888	nummod	1,h
R5388	T18888	T18886	pobj	h,for
R5389	T18889	T18869	punct	.,incubated
R5390	T18891	T18892	prep	From,removed
R5391	T18893	T18894	det	the,membranes
R5392	T18894	T18891	pobj	membranes,From
R5393	T18895	T18894	amod	dissolved,membranes
R5394	T18896	T18892	punct	", ",removed
R5395	T18897	T18898	det	a,sample
R5396	T18898	T18892	nsubjpass	sample,removed
R5397	T18899	T18900	nummod	30,μl
R5398	T18900	T18898	compound	μl,sample
R5399	T18901	T18892	auxpass	was,removed
R5400	T18902	T18892	cc	and,removed
R5401	T18903	T18892	conj	used,removed
R5402	T18904	T18903	prep	as,used
R5403	T18905	T18906	det	the,fraction
R5404	T18906	T18904	pobj	fraction,as
R5405	T18907	T18906	amod	total,fraction
R5406	T18908	T18906	compound	membrane,fraction
R5407	T18909	T18892	punct	.,removed
R5408	T18911	T18912	det	The,membranes
R5409	T18912	T18914	nsubjpass	membranes,diluted
R5410	T18913	T18912	amod	remaining,membranes
R5411	T18915	T18914	auxpass	were,diluted
R5412	T18916	T18914	prep	with,diluted
R5413	T18917	T18918	nummod	600,μl
R5414	T18918	T18916	pobj	μl,with
R5415	T18919	T18918	prep	of,μl
R5416	T18920	T18921	det	the,buffer
R5417	T18921	T18919	pobj	buffer,of
R5418	T18922	T18921	compound	homogenization,buffer
R5419	T18923	T18914	punct	", ",diluted
R5420	T18924	T18914	cc	and,diluted
R5421	T18925	T18914	conj	incubated,diluted
R5422	T18926	T18925	prep	with,incubated
R5423	T18927	T18928	nummod	1,μl
R5424	T18928	T18926	pobj	μl,with
R5425	T18929	T18928	prep	of,μl
R5426	T18930	T18931	compound	GFP,antisera
R5427	T18931	T18929	pobj	antisera,of
R5428	T18932	T18933	punct	(,0092
R5429	T18933	T18931	parataxis	0092,antisera
R5430	T18934	T18933	dep	Invitrogen,0092
R5431	T18935	T18933	punct	", ",0092
R5432	T18936	T18933	punct	#,0092
R5433	T18937	T18933	nummod	46,0092
R5434	T18938	T18933	punct	–,0092
R5435	T18939	T18933	punct	),0092
R5436	T18940	T18931	cc	and,antisera
R5437	T18941	T18942	compound	protein,sepharose
R5438	T18942	T18931	conj	sepharose,antisera
R5439	T18943	T18944	compound	A,G
R5440	T18944	T18942	compound	G,sepharose
R5441	T18945	T18944	punct	/,G
R5442	T18946	T18914	punct	.,diluted
R5443	T18948	T18949	prep	Following,washed
R5444	T18950	T18951	amod	overnight,incubation
R5445	T18951	T18948	pobj	incubation,Following
R5446	T18952	T18949	punct	", ",washed
R5447	T18953	T18954	det	the,proteins
R5448	T18954	T18949	nsubjpass	proteins,washed
R5449	T18955	T18954	amod	precipitated,proteins
R5450	T18956	T18949	auxpass	were,washed
R5451	T18957	T18949	prep	in,washed
R5452	T18958	T18959	compound	RIPA,buffer
R5453	T18959	T18957	pobj	buffer,in
R5454	T18960	T18949	cc	and,washed
R5455	T18961	T18962	advmod	finally,boiled
R5456	T18962	T18949	conj	boiled,washed
R5457	T18963	T18962	prep	in,boiled
R5458	T18964	T18965	nummod	50,μl
R5459	T18965	T18963	pobj	μl,in
R5460	T18966	T18965	prep	of,μl
R5461	T18967	T18968	compound	Laemmli,buffer
R5462	T18968	T18966	pobj	buffer,of
R5463	T18969	T18949	punct	.,washed
R5464	T18971	T18972	nsubjpass	Half,processed
R5465	T18973	T18971	prep	of,Half
R5466	T18974	T18975	det	the,membrane
R5467	T18975	T18973	pobj	membrane,of
R5468	T18976	T18975	amod	total,membrane
R5469	T18977	T18975	cc	and,membrane
R5470	T18978	T18979	det	the,fractions
R5471	T18979	T18975	conj	fractions,membrane
R5472	T18980	T18979	compound	IP,fractions
R5473	T18981	T18972	auxpass	were,processed
R5474	T18982	T18972	prep	for,processed
R5475	T18983	T18982	pobj	immunoblotting,for
R5476	T18984	T18972	punct	.,processed
R5477	T18986	T18987	compound	Cell,biotinylation
R5478	T18987	T18989	nsubjpass	biotinylation,performed
R5479	T18988	T18987	compound	surface,biotinylation
R5480	T18990	T18989	auxpass	was,performed
R5481	T18991	T18989	prep	in,performed
R5482	T18992	T18993	det	a,manner
R5483	T18993	T18991	pobj	manner,in
R5484	T18994	T18993	amod	similar,manner
R5485	T18995	T18989	punct	.,performed
R5486	T18997	T18998	advmod	However,transfected
R5487	T18999	T18998	punct	", ",transfected
R5488	T19000	T19001	compound	pEGFP,F204V
R5489	T19001	T18998	nsubjpass	F204V,transfected
R5490	T19002	T19001	punct	-,F204V
R5491	T19003	T19001	compound	AQP2,F204V
R5492	T19004	T19001	punct	-,F204V
R5493	T19005	T18998	punct	", ",transfected
R5494	T19006	T18998	auxpass	was,transfected
R5495	T19007	T18998	prep	into,transfected
R5496	T19008	T19009	compound	MDCK,cells
R5497	T19009	T19007	pobj	cells,into
R5498	T19010	T19011	advmod	stably,expressing
R5499	T19011	T19009	acl	expressing,cells
R5500	T19012	T19013	amod	wild,type
R5501	T19013	T19015	compound	type,AQP2
R5502	T19014	T19013	punct	-,type
R5503	T19015	T19011	dobj	AQP2,expressing
R5504	T19016	T19009	cc	and,cells
R5505	T19017	T19009	conj	cells,cells
R5506	T19018	T19017	acl	made,cells
R5507	T19019	T19018	oprd	stable,made
R5508	T19020	T19018	prep	with,made
R5509	T19021	T19020	pobj	vector,with
R5510	T19022	T19021	advmod	alone,vector
R5511	T19023	T18998	punct	.,transfected
R5512	T19025	T19026	compound	Twenty,four
R5513	T19026	T19028	nummod	four,hours
R5514	T19027	T19026	punct	-,four
R5515	T19028	T19029	npadvmod	hours,post-transfection
R5516	T19029	T19030	advmod	post-transfection,stimulated
R5517	T19031	T19030	punct	", ",stimulated
R5518	T19032	T19030	nsubjpass	cells,stimulated
R5519	T19033	T19030	auxpass	were,stimulated
R5520	T19034	T19030	prep	with,stimulated
R5521	T19035	T19034	pobj	forskolin,with
R5522	T19036	T19030	punct	", ",stimulated
R5523	T19037	T19030	conj	trypsinized,stimulated
R5524	T19038	T19037	punct	", ",trypsinized
R5525	T19039	T19037	conj	resuspended,trypsinized
R5526	T19040	T19039	prep	in,resuspended
R5527	T19041	T19042	nummod	1,ml
R5528	T19042	T19040	pobj	ml,in
R5529	T19043	T19042	prep	of,ml
R5530	T19044	T19043	pobj	PBS,of
R5531	T19045	T19046	punct	(,cells
R5532	T19046	T19042	parataxis	cells,ml
R5533	T19047	T19048	quantmod	2.5,106
R5534	T19048	T19046	nummod	106,cells
R5535	T19049	T19048	punct	×,106
R5536	T19050	T19051	punct	/,ml
R5537	T19051	T19046	prep	ml,cells
R5538	T19052	T19046	punct	),cells
R5539	T19053	T19039	punct	", ",resuspended
R5540	T19054	T19039	cc	and,resuspended
R5541	T19055	T19039	conj	incubated,resuspended
R5542	T19056	T19055	prep	with,incubated
R5543	T19057	T19058	nummod	0.5,mg
R5544	T19058	T19056	pobj	mg,with
R5545	T19059	T19058	prep	of,mg
R5546	T19060	T19061	compound	NHS,biotin
R5547	T19061	T19059	pobj	biotin,of
R5548	T19062	T19061	punct	-,biotin
R5549	T19063	T19061	compound	PEO4,biotin
R5550	T19064	T19061	punct	-,biotin
R5551	T19065	T19066	punct	(,Biotechnology
R5552	T19066	T19061	parataxis	Biotechnology,biotin
R5553	T19067	T19066	compound	Pierce,Biotechnology
R5554	T19068	T19066	punct	),Biotechnology
R5555	T19069	T19055	prep	for,incubated
R5556	T19070	T19071	nummod	30,min
R5557	T19071	T19069	pobj	min,for
R5558	T19072	T19055	prep	at,incubated
R5559	T19073	T19074	compound	room,temperature
R5560	T19074	T19072	pobj	temperature,at
R5561	T19075	T19030	punct	.,stimulated
R5562	T19077	T19078	nsubj	Cells,washed
R5563	T19079	T19078	aux	were,washed
R5564	T19080	T19078	advmod	once,washed
R5565	T19081	T19078	prep	in,washed
R5566	T19082	T19083	nummod	10,mM
R5567	T19083	T19084	compound	mM,Tris
R5568	T19084	T19081	pobj	Tris,in
R5569	T19085	T19086	punct	(,pH
R5570	T19086	T19084	parataxis	pH,Tris
R5571	T19087	T19086	nummod	8,pH
R5572	T19088	T19086	punct	),pH
R5573	T19089	T19078	cc	and,washed
R5574	T19090	T19091	nummod	three,times
R5575	T19091	T19092	npadvmod	times,in
R5576	T19092	T19078	conj	in,washed
R5577	T19093	T19092	pobj	PBS,in
R5578	T19094	T19078	punct	", ",washed
R5579	T19095	T19096	prep	after,purified
R5580	T19096	T19078	advcl	purified,washed
R5581	T19097	T19095	pobj	which,after
R5582	T19098	T19096	nsubjpass	membranes,purified
R5583	T19099	T19096	auxpass	were,purified
R5584	T19100	T19096	cc	and,purified
R5585	T19101	T19096	conj	solubilized,purified
R5586	T19102	T19103	mark	as,described
R5587	T19103	T19101	advcl	described,solubilized
R5588	T19104	T19103	advmod	above,described
R5589	T19105	T19078	punct	.,washed
R5590	T19107	T19108	amod	Solubilized,membranes
R5591	T19108	T19109	nsubjpass	membranes,incubated
R5592	T19110	T19109	auxpass	were,incubated
R5593	T19111	T19109	prep	with,incubated
R5594	T19112	T19113	nummod	20,μl
R5595	T19113	T19111	pobj	μl,with
R5596	T19114	T19113	prep	of,μl
R5597	T19115	T19116	amod	immobilized,streptavidin
R5598	T19116	T19114	pobj	streptavidin,of
R5599	T19117	T19118	punct	(,Biotechnology
R5600	T19118	T19116	parataxis	Biotechnology,streptavidin
R5601	T19119	T19118	compound	Pierce,Biotechnology
R5602	T19120	T19118	punct	),Biotechnology
R5603	T19121	T19109	prep	for,incubated
R5604	T19122	T19123	nummod	2,h
R5605	T19123	T19121	pobj	h,for
R5606	T19124	T19109	prep	at,incubated
R5607	T19125	T19126	nummod	4,°C
R5608	T19126	T19124	pobj	°C,at
R5609	T19127	T19109	punct	.,incubated
R5610	T19129	T19130	advmod	Finally,washed
R5611	T19131	T19132	det	the,proteins
R5612	T19132	T19130	nsubjpass	proteins,washed
R5613	T19133	T19132	amod	precipitated,proteins
R5614	T19134	T19130	auxpass	were,washed
R5615	T19135	T19130	prep	in,washed
R5616	T19136	T19137	compound	RIPA,buffer
R5617	T19137	T19135	pobj	buffer,in
R5618	T19138	T19130	cc	and,washed
R5619	T19139	T19130	conj	boiled,washed
R5620	T19140	T19139	prep	in,boiled
R5621	T19141	T19142	nummod	50,μl
R5622	T19142	T19140	pobj	μl,in
R5623	T19143	T19142	prep	of,μl
R5624	T19144	T19145	compound	Laemmli,buffer
R5625	T19145	T19143	pobj	buffer,of
R5626	T19146	T19130	punct	.,washed
R5627	T19148	T19149	amod	Total,cells
R5628	T19149	T19150	nsubj	cells,immunoblotting
R5629	T19151	T19149	cc	and,cells
R5630	T19152	T19153	det	the,precipitates
R5631	T19153	T19149	conj	precipitates,cells
R5632	T19154	T19153	amod	biotinylated,precipitates
R5633	T19155	T19150	aux	were,immunoblotting
R5634	T19156	T19150	advcl	using,immunoblotting
R5635	T19157	T19158	det	an,antibody
R5636	T19158	T19156	dobj	antibody,using
R5637	T19159	T19158	prep	to,antibody
R5638	T19160	T19159	pobj	AQP2,to
R5639	T19161	T19150	punct	.,immunoblotting
R5640	T19603	T19604	compound	Kidney,immunohistochemistry
R5641	T19605	T19604	punct	.,immunohistochemistry
R5642	T19607	T19608	amod	Whole,kidneys
R5643	T19608	T19610	nsubjpass	kidneys,fixed
R5644	T19609	T19608	compound	mouse,kidneys
R5645	T19611	T19610	auxpass	were,fixed
R5646	T19612	T19610	prep	in,fixed
R5647	T19613	T19614	nummod	10,%
R5648	T19614	T19615	nmod	%,formalin
R5649	T19615	T19612	pobj	formalin,in
R5650	T19616	T19617	npadvmod	phosphate,buffered
R5651	T19617	T19615	amod	buffered,formalin
R5652	T19618	T19617	punct	-,buffered
R5653	T19619	T19610	prep	for,fixed
R5654	T19620	T19621	nummod	24,h
R5655	T19621	T19619	pobj	h,for
R5656	T19622	T19610	punct	.,fixed
R5657	T19624	T19625	nsubjpass	Kidneys,embedded
R5658	T19626	T19625	auxpass	were,embedded
R5659	T19627	T19625	prep	in,embedded
R5660	T19628	T19627	pobj	paraffin,in
R5661	T19629	T19625	punct	", ",embedded
R5662	T19630	T19625	cc	and,embedded
R5663	T19631	T19632	nummod	5,μm
R5664	T19632	T19634	compound	μm,sections
R5665	T19633	T19632	punct	-,μm
R5666	T19634	T19635	nsubjpass	sections,prepared
R5667	T19635	T19625	conj	prepared,embedded
R5668	T19636	T19635	auxpass	were,prepared
R5669	T19637	T19635	punct	.,prepared
R5670	T19639	T19640	prep	Following,probed
R5671	T19641	T19642	compound	antigen,retrieval
R5672	T19642	T19639	pobj	retrieval,Following
R5673	T19643	T19642	acl	using,retrieval
R5674	T19644	T19645	nummod	10,mM
R5675	T19645	T19646	compound	mM,citrate
R5676	T19646	T19643	dobj	citrate,using
R5677	T19647	T19646	compound	sodium,citrate
R5678	T19648	T19646	punct	(,citrate
R5679	T19649	T19646	npadvmod	pH,citrate
R5680	T19650	T19649	nummod	8,pH
R5681	T19651	T19646	punct	),citrate
R5682	T19652	T19643	prep	for,using
R5683	T19653	T19654	nummod	10,min
R5684	T19654	T19652	pobj	min,for
R5685	T19655	T19643	prep	at,using
R5686	T19656	T19657	nummod	98,°C
R5687	T19657	T19655	pobj	°C,at
R5688	T19658	T19640	punct	", ",probed
R5689	T19659	T19640	nsubjpass	sections,probed
R5690	T19660	T19640	auxpass	were,probed
R5691	T19661	T19640	advmod	sequentially,probed
R5692	T19662	T19640	punct	", ",probed
R5693	T19663	T19664	advmod	first,for
R5694	T19664	T19640	prep	for,probed
R5695	T19665	T19664	pobj	AQP3,for
R5696	T19666	T19664	cc	and,for
R5697	T19667	T19668	advmod	then,for
R5698	T19668	T19664	conj	for,for
R5699	T19669	T19668	pobj	AQP2,for
R5700	T19670	T19640	punct	.,probed
R5701	T19672	T19673	nsubjpass	Sections,incubated
R5702	T19674	T19673	auxpass	were,incubated
R5703	T19675	T19673	prep	in,incubated
R5704	T19676	T19677	nummod	5,%
R5705	T19677	T19678	compound	%,serum
R5706	T19678	T19675	pobj	serum,in
R5707	T19679	T19678	compound	donkey,serum
R5708	T19680	T19673	cc	and,incubated
R5709	T19681	T19682	advmod	then,in
R5710	T19682	T19673	conj	in,incubated
R5711	T19683	T19684	nmod	goat,antibody
R5712	T19684	T19682	pobj	antibody,in
R5713	T19685	T19684	amod	anti-AQP3,antibody
R5714	T19686	T19687	punct	(,sc
R5715	T19687	T19684	parataxis	sc,antibody
R5716	T19688	T19687	dep	1,sc
R5717	T19689	T19690	punct	:,100
R5718	T19690	T19688	prep	100,1
R5719	T19691	T19687	punct	;,sc
R5720	T19692	T19693	compound	Santa,Cruz
R5721	T19693	T19694	compound	Cruz,Biotechnology
R5722	T19694	T19687	dep	Biotechnology,sc
R5723	T19695	T19687	punct	;,sc
R5724	T19696	T19687	punct	#,sc
R5725	T19697	T19687	punct	-,sc
R5726	T19698	T19687	nummod	9885,sc
R5727	T19699	T19687	punct	),sc
R5728	T19700	T19673	punct	.,incubated
R5729	T19702	T19703	nsubjpass	Slides,washed
R5730	T19704	T19703	auxpass	were,washed
R5731	T19705	T19703	prep	with,washed
R5732	T19706	T19705	pobj	PBS,with
R5733	T19707	T19703	cc	and,washed
R5734	T19708	T19703	conj	incubated,washed
R5735	T19709	T19708	prep	with,incubated
R5736	T19710	T19711	npadvmod	AlexaFluor,conjugated
R5737	T19711	T19714	amod	conjugated,antibody
R5738	T19712	T19710	nummod	488,AlexaFluor
R5739	T19713	T19711	punct	-,conjugated
R5740	T19714	T19709	pobj	antibody,with
R5741	T19715	T19714	nmod	donkey,antibody
R5742	T19716	T19714	amod	anti-goat,antibody
R5743	T19717	T19718	punct	(,Probes
R5744	T19718	T19714	parataxis	Probes,antibody
R5745	T19719	T19718	compound	Molecular,Probes
R5746	T19720	T19718	punct	", ",Probes
R5747	T19721	T19718	npadvmod	Eugene,Probes
R5748	T19722	T19718	punct	", ",Probes
R5749	T19723	T19718	npadvmod	Oregon,Probes
R5750	T19724	T19718	punct	", ",Probes
R5751	T19725	T19726	compound	United,States
R5752	T19726	T19718	npadvmod	States,Probes
R5753	T19727	T19718	punct	),Probes
R5754	T19728	T19703	punct	.,washed
R5755	T19730	T19731	det	The,slides
R5756	T19731	T19732	nsubjpass	slides,incubated
R5757	T19733	T19732	auxpass	were,incubated
R5758	T19734	T19732	advmod	subsequently,incubated
R5759	T19735	T19732	aux	blocked,incubated
R5760	T19736	T19732	prep	in,incubated
R5761	T19737	T19738	nummod	5,%
R5762	T19738	T19739	compound	%,serum
R5763	T19739	T19736	pobj	serum,in
R5764	T19740	T19739	compound	chicken,serum
R5765	T19741	T19732	punct	", ",incubated
R5766	T19742	T19732	prep	with,incubated
R5767	T19743	T19744	det	a,antibody
R5768	T19744	T19742	pobj	antibody,with
R5769	T19745	T19744	nmod	rabbit,antibody
R5770	T19746	T19744	amod	anti-AQP2,antibody
R5771	T19747	T19748	punct	(,A3000
R5772	T19748	T19744	parataxis	A3000,antibody
R5773	T19749	T19748	dep	1,A3000
R5774	T19750	T19751	punct	:,250
R5775	T19751	T19749	prep	250,1
R5776	T19752	T19748	punct	;,A3000
R5777	T19753	T19748	dep	USB,A3000
R5778	T19754	T19753	punct	", ",USB
R5779	T19755	T19753	npadvmod	Cleveland,USB
R5780	T19756	T19753	punct	", ",USB
R5781	T19757	T19753	npadvmod	Ohio,USB
R5782	T19758	T19753	punct	", ",USB
R5783	T19759	T19760	compound	United,States
R5784	T19760	T19753	npadvmod	States,USB
R5785	T19761	T19748	punct	;,A3000
R5786	T19762	T19748	punct	#,A3000
R5787	T19763	T19748	punct	–,A3000
R5788	T19764	T19748	nummod	06,A3000
R5789	T19765	T19748	punct	),A3000
R5790	T19766	T19744	punct	", ",antibody
R5791	T19767	T19768	dep	which,detected
R5792	T19768	T19744	relcl	detected,antibody
R5793	T19769	T19768	auxpass	was,detected
R5794	T19770	T19768	prep	with,detected
R5795	T19771	T19772	det	a,antibody
R5796	T19772	T19770	pobj	antibody,with
R5797	T19773	T19774	npadvmod	AlexaFluor,conjugated
R5798	T19774	T19772	amod	conjugated,antibody
R5799	T19775	T19773	nummod	594,AlexaFluor
R5800	T19776	T19774	punct	-,conjugated
R5801	T19777	T19772	nmod	chicken,antibody
R5802	T19778	T19772	amod	anti-rabbit,antibody
R5803	T19779	T19780	punct	(,Probes
R5804	T19780	T19772	parataxis	Probes,antibody
R5805	T19781	T19780	dep	1,Probes
R5806	T19782	T19783	punct	:,500
R5807	T19783	T19781	prep	500,1
R5808	T19784	T19780	punct	;,Probes
R5809	T19785	T19780	compound	Molecular,Probes
R5810	T19786	T19780	punct	),Probes
R5811	T19787	T19732	punct	.,incubated
R5812	T19789	T19790	det	The,sections
R5813	T19790	T19791	nsubjpass	sections,stained
R5814	T19792	T19791	auxpass	were,stained
R5815	T19793	T19791	prep	with,stained
R5816	T19794	T19793	pobj	DAPI,with
R5817	T19795	T19791	cc	and,stained
R5818	T19796	T19791	conj	mounted,stained
R5819	T19797	T19796	prep	in,mounted
R5820	T19798	T19797	pobj	Vectashield,in
R5821	T19799	T19800	punct	(,Labs
R5822	T19800	T19796	parataxis	Labs,mounted
R5823	T19801	T19800	compound	Vector,Labs
R5824	T19802	T19800	punct	", ",Labs
R5825	T19803	T19800	npadvmod	Burlingame,Labs
R5826	T19804	T19800	punct	", ",Labs
R5827	T19805	T19800	npadvmod	California,Labs
R5828	T19806	T19800	punct	", ",Labs
R5829	T19807	T19808	compound	United,States
R5830	T19808	T19800	npadvmod	States,Labs
R5831	T19809	T19800	punct	),Labs
R5832	T19810	T19791	punct	.,stained
R5833	T20425	T20424	prep	on,Immunocytochemistry
R5834	T20426	T20427	compound	MDCK,cells
R5835	T20427	T20425	pobj	cells,on
R5836	T20428	T20424	punct	.,Immunocytochemistry
R5837	T20430	T20431	nmod	MDCK,lines
R5838	T20431	T20434	nsubjpass	lines,grown
R5839	T20432	T20431	amod	stable,lines
R5840	T20433	T20431	compound	cell,lines
R5841	T20435	T20431	acl	expressing,lines
R5842	T20436	T20435	dobj	vector,expressing
R5843	T20437	T20436	amod	alone,vector
R5844	T20438	T20436	punct	", ",vector
R5845	T20439	T20440	amod	wild,type
R5846	T20440	T20442	compound	type,AQP2
R5847	T20441	T20440	punct	-,type
R5848	T20442	T20436	conj	AQP2,vector
R5849	T20443	T20442	punct	", ",AQP2
R5850	T20444	T20442	cc	or,AQP2
R5851	T20445	T20446	compound	AQP2,F204V
R5852	T20446	T20442	conj	F204V,AQP2
R5853	T20447	T20446	punct	-,F204V
R5854	T20448	T20435	punct	(,expressing
R5855	T20449	T20435	cc	and,expressing
R5856	T20450	T20451	prep	in,expressing
R5857	T20451	T20435	conj	expressing,expressing
R5858	T20452	T20453	det	some,cases
R5859	T20453	T20450	pobj	cases,in
R5860	T20454	T20451	advmod	transiently,expressing
R5861	T20455	T20456	det	a,construct
R5862	T20456	T20451	dobj	construct,expressing
R5863	T20457	T20456	compound	GFP,construct
R5864	T20458	T20451	punct	),expressing
R5865	T20459	T20434	auxpass	were,grown
R5866	T20460	T20434	prep	on,grown
R5867	T20461	T20462	npadvmod	fibronectin,coated
R5868	T20462	T20464	amod	coated,coverslips
R5869	T20463	T20462	punct	-,coated
R5870	T20464	T20460	pobj	coverslips,on
R5871	T20465	T20466	mark	until,formed
R5872	T20466	T20434	advcl	formed,grown
R5873	T20467	T20468	amod	tight,junctions
R5874	T20468	T20466	nsubj	junctions,formed
R5875	T20469	T20434	punct	.,grown
R5876	T20471	T20472	nsubjpass	Cells,treated
R5877	T20473	T20472	auxpass	were,treated
R5878	T20474	T20472	prep	with,treated
R5879	T20475	T20474	cc	or,with
R5880	T20476	T20474	conj	without,with
R5881	T20477	T20478	nummod	150,μM
R5882	T20478	T20479	compound	μM,forskolin
R5883	T20479	T20476	pobj	forskolin,without
R5884	T20480	T20472	prep	for,treated
R5885	T20481	T20482	nummod	90,min
R5886	T20482	T20480	pobj	min,for
R5887	T20483	T20472	punct	", ",treated
R5888	T20484	T20472	cc	and,treated
R5889	T20485	T20472	conj	fixed,treated
R5890	T20486	T20485	prep	in,fixed
R5891	T20487	T20486	pobj	methanol,in
R5892	T20488	T20485	prep	at,fixed
R5893	T20489	T20490	punct	−,20
R5894	T20490	T20491	nummod	20,°C
R5895	T20491	T20488	pobj	°C,at
R5896	T20492	T20472	punct	.,treated
R5897	T20494	T20495	advmod	Subsequently,washed
R5898	T20496	T20495	punct	", ",washed
R5899	T20497	T20495	nsubj	cells,washed
R5900	T20498	T20495	aux	were,washed
R5901	T20499	T20495	cc	and,washed
R5902	T20500	T20495	conj	permeabilized,washed
R5903	T20501	T20500	prep	in,permeabilized
R5904	T20502	T20503	nummod	0.2,%
R5905	T20503	T20504	compound	%,X
R5906	T20504	T20501	pobj	X,in
R5907	T20505	T20504	compound	Triton,X
R5908	T20506	T20504	punct	-,X
R5909	T20507	T20504	nummod	100,X
R5910	T20508	T20500	prep	for,permeabilized
R5911	T20509	T20510	nummod	5,min
R5912	T20510	T20508	pobj	min,for
R5913	T20511	T20495	punct	", ",washed
R5914	T20512	T20495	cc	and,washed
R5915	T20513	T20514	advmod	sequentially,probed
R5916	T20514	T20495	conj	probed,washed
R5917	T20515	T20514	prep	for,probed
R5918	T20516	T20515	pobj	AQP2,for
R5919	T20517	T20516	cc	and,AQP2
R5920	T20518	T20519	compound	organelle,markers
R5921	T20519	T20516	conj	markers,AQP2
R5922	T20520	T20519	prep	for,markers
R5923	T20521	T20522	preconj	either,PM
R5924	T20522	T20520	pobj	PM,for
R5925	T20523	T20522	det	the,PM
R5926	T20524	T20522	cc	or,PM
R5927	T20525	T20526	det	the,ER
R5928	T20526	T20522	conj	ER,PM
R5929	T20527	T20495	punct	.,washed
R5930	T20529	T20530	nsubjpass	AQP2,detected
R5931	T20531	T20530	auxpass	was,detected
R5932	T20532	T20530	advcl	using,detected
R5933	T20533	T20532	dobj	goat,using
R5934	T20534	T20533	amod	anti-AQP2,goat
R5935	T20535	T20536	punct	(,sc
R5936	T20536	T20533	parataxis	sc,goat
R5937	T20537	T20536	dep	1,sc
R5938	T20538	T20539	punct	:,100
R5939	T20539	T20537	prep	100,1
R5940	T20540	T20536	punct	;,sc
R5941	T20541	T20542	compound	Santa,Cruz
R5942	T20542	T20543	compound	Cruz,Biotechnology
R5943	T20543	T20536	dep	Biotechnology,sc
R5944	T20544	T20536	punct	;,sc
R5945	T20545	T20536	punct	#,sc
R5946	T20546	T20536	punct	-,sc
R5947	T20547	T20536	nummod	9882,sc
R5948	T20548	T20536	punct	),sc
R5949	T20549	T20533	cc	and,goat
R5950	T20550	T20551	det	a,dilution
R5951	T20551	T20533	conj	dilution,goat
R5952	T20552	T20553	quantmod	1,200
R5953	T20553	T20551	nummod	200,dilution
R5954	T20554	T20553	punct	:,200
R5955	T20555	T20551	prep	of,dilution
R5956	T20556	T20557	npadvmod	AlexaFluor,conjugated
R5957	T20557	T20560	amod	conjugated,antibody
R5958	T20558	T20556	nummod	488,AlexaFluor
R5959	T20559	T20557	punct	-,conjugated
R5960	T20560	T20555	pobj	antibody,of
R5961	T20561	T20560	nmod	donkey,antibody
R5962	T20562	T20560	amod	anti-goat,antibody
R5963	T20563	T20560	amod	secondary,antibody
R5964	T20564	T20530	punct	.,detected
R5965	T20566	T20567	det	The,PM
R5966	T20567	T20568	nsubjpass	PM,probed
R5967	T20569	T20567	cc	and,PM
R5968	T20570	T20567	conj	ER,PM
R5969	T20571	T20568	auxpass	were,probed
R5970	T20572	T20568	advcl	using,probed
R5971	T20573	T20574	nmod	mouse,ATPase
R5972	T20574	T20579	nmod	ATPase,antibodies
R5973	T20575	T20574	amod	anti-Na+,ATPase
R5974	T20576	T20574	punct	/,ATPase
R5975	T20577	T20574	nmod	K+,ATPase
R5976	T20578	T20574	punct	-,ATPase
R5977	T20579	T20572	dobj	antibodies,using
R5978	T20580	T20581	punct	(,Upstate
R5979	T20581	T20574	parataxis	Upstate,ATPase
R5980	T20582	T20581	punct	", ",Upstate
R5981	T20583	T20581	npadvmod	Waltham,Upstate
R5982	T20584	T20581	punct	", ",Upstate
R5983	T20585	T20581	npadvmod	Massachusetts,Upstate
R5984	T20586	T20581	punct	", ",Upstate
R5985	T20587	T20588	compound	United,States
R5986	T20588	T20581	npadvmod	States,Upstate
R5987	T20589	T20581	punct	),Upstate
R5988	T20590	T20574	cc	or,ATPase
R5989	T20591	T20592	npadvmod	rabbit,anti-calnexin
R5990	T20592	T20574	conj	anti-calnexin,ATPase
R5991	T20593	T20594	punct	(,Biotechnology
R5992	T20594	T20592	parataxis	Biotechnology,anti-calnexin
R5993	T20595	T20594	compound	Stressgen,Biotechnology
R5994	T20596	T20594	punct	", ",Biotechnology
R5995	T20597	T20594	npadvmod	Victoria,Biotechnology
R5996	T20598	T20594	punct	", ",Biotechnology
R5997	T20599	T20600	compound	British,Columbia
R5998	T20600	T20594	npadvmod	Columbia,Biotechnology
R5999	T20601	T20594	punct	", ",Biotechnology
R6000	T20602	T20594	npadvmod	Canada,Biotechnology
R6001	T20603	T20594	punct	),Biotechnology
R6002	T20604	T20579	cc	and,antibodies
R6003	T20605	T20606	det	the,antibodies
R6004	T20606	T20579	conj	antibodies,antibodies
R6005	T20607	T20606	amod	secondary,antibodies
R6006	T20608	T20606	punct	", ",antibodies
R6007	T20609	T20610	npadvmod	Cy3,conjugated
R6008	T20610	T20612	amod	conjugated,goat
R6009	T20611	T20610	punct	-,conjugated
R6010	T20612	T20606	appos	goat,antibodies
R6011	T20613	T20612	amod	anti-mouse,goat
R6012	T20614	T20615	punct	(,ImmunoResearch
R6013	T20615	T20612	parataxis	ImmunoResearch,goat
R6014	T20616	T20615	dep	1,ImmunoResearch
R6015	T20617	T20618	punct	:,200
R6016	T20618	T20616	prep	200,1
R6017	T20619	T20615	punct	;,ImmunoResearch
R6018	T20620	T20615	compound	Jackson,ImmunoResearch
R6019	T20621	T20615	punct	", ",ImmunoResearch
R6020	T20622	T20623	compound	West,Grove
R6021	T20623	T20615	npadvmod	Grove,ImmunoResearch
R6022	T20624	T20615	punct	", ",ImmunoResearch
R6023	T20625	T20615	npadvmod	Pennsylvania,ImmunoResearch
R6024	T20626	T20615	punct	", ",ImmunoResearch
R6025	T20627	T20628	compound	United,States
R6026	T20628	T20615	npadvmod	States,ImmunoResearch
R6027	T20629	T20615	punct	),ImmunoResearch
R6028	T20630	T20606	cc	or,antibodies
R6029	T20631	T20632	npadvmod	AlexaFluor,conjugated
R6030	T20632	T20635	amod	conjugated,chicken
R6031	T20633	T20631	nummod	594,AlexaFluor
R6032	T20634	T20632	punct	-,conjugated
R6033	T20635	T20606	conj	chicken,antibodies
R6034	T20636	T20635	amod	anti-rabbit,chicken
R6035	T20637	T20638	punct	(,1
R6036	T20638	T20635	parataxis	1,chicken
R6037	T20639	T20640	punct	:,200
R6038	T20640	T20638	prep	200,1
R6039	T20641	T20638	punct	),1
R6040	T20642	T20572	advmod	respectively,using
R6041	T20643	T20568	punct	.,probed
R6042	T20645	T20646	nsubjpass	Cells,washed
R6043	T20647	T20646	auxpass	were,washed
R6044	T20648	T20646	prep	in,washed
R6045	T20649	T20648	pobj	PBS,in
R6046	T20650	T20646	punct	", ",washed
R6047	T20651	T20646	conj	counterstained,washed
R6048	T20652	T20651	prep	with,counterstained
R6049	T20653	T20652	pobj	DAPI,with
R6050	T20654	T20651	punct	", ",counterstained
R6051	T20655	T20651	cc	and,counterstained
R6052	T20656	T20651	conj	mounted,counterstained
R6053	T20657	T20656	prep	in,mounted
R6054	T20658	T20657	pobj	Vectashield,in
R6055	T20659	T20646	punct	.,washed
R6056	T20661	T20662	prep	In,probed
R6057	T20663	T20661	pobj	experiments,In
R6058	T20664	T20665	prep	in,used
R6059	T20665	T20663	relcl	used,experiments
R6060	T20666	T20664	pobj	which,in
R6061	T20667	T20668	compound	GFP,fusions
R6062	T20668	T20665	nsubjpass	fusions,used
R6063	T20669	T20665	auxpass	were,used
R6064	T20670	T20662	punct	", ",probed
R6065	T20671	T20662	nsubjpass	AQP2,probed
R6066	T20672	T20662	auxpass	was,probed
R6067	T20673	T20662	advcl	using,probed
R6068	T20674	T20675	det	the,combination
R6069	T20675	T20673	dobj	combination,using
R6070	T20676	T20675	compound	antibody,combination
R6071	T20677	T20675	acl	used,combination
R6072	T20678	T20677	prep	for,used
R6073	T20679	T20680	compound	kidney,immunohistochemistry
R6074	T20680	T20678	pobj	immunohistochemistry,for
R6075	T20681	T20662	prep	in,probed
R6076	T20682	T20681	pobj	order,in
R6077	T20683	T20684	aux	to,detect
R6078	T20684	T20682	acl	detect,order
R6079	T20685	T20686	det	the,AQP2
R6080	T20686	T20684	dobj	AQP2,detect
R6081	T20687	T20684	prep	at,detect
R6082	T20688	T20689	nummod	594,nm
R6083	T20689	T20687	pobj	nm,at
R6084	T20690	T20684	punct	", ",detect
R6085	T20691	T20692	aux	to,distinguish
R6086	T20692	T20684	advcl	distinguish,detect
R6087	T20693	T20692	prep	between,distinguish
R6088	T20694	T20695	det	the,proteins
R6089	T20695	T20693	pobj	proteins,between
R6090	T20696	T20695	compound	GFP,proteins
R6091	T20697	T20695	compound	fusion,proteins
R6092	T20698	T20662	punct	.,probed
R6093	T20832	T20833	amod	Confocal,microscopy
R6094	T20834	T20833	punct	.,microscopy
R6095	T20836	T20837	amod	Optical,images
R6096	T20837	T20841	nsubjpass	images,collected
R6097	T20838	T20839	compound	z,section
R6098	T20839	T20837	compound	section,images
R6099	T20840	T20839	punct	-,section
R6100	T20842	T20841	auxpass	were,collected
R6101	T20843	T20841	prep	on,collected
R6102	T20844	T20845	det	a,Microscope
R6103	T20845	T20843	pobj	Microscope,on
R6104	T20846	T20845	nmod	BioRad,Microscope
R6105	T20847	T20848	punct	(,Hercules
R6106	T20848	T20846	parataxis	Hercules,BioRad
R6107	T20849	T20848	punct	", ",Hercules
R6108	T20850	T20848	npadvmod	California,Hercules
R6109	T20851	T20848	punct	", ",Hercules
R6110	T20852	T20853	compound	United,States
R6111	T20853	T20848	npadvmod	States,Hercules
R6112	T20854	T20848	punct	),Hercules
R6113	T20855	T20856	nmod	Rainbow,Radiance
R6114	T20856	T20845	nmod	Radiance,Microscope
R6115	T20857	T20856	nummod	2100,Radiance
R6116	T20858	T20859	compound	Laser,Scanning
R6117	T20859	T20845	compound	Scanning,Microscope
R6118	T20860	T20845	compound	Confocal,Microscope
R6119	T20861	T20841	punct	.,collected
R6120	T20863	T20864	compound	Image,stacks
R6121	T20864	T20865	nsubjpass	stacks,flattened
R6122	T20866	T20865	auxpass	were,flattened
R6123	T20867	T20865	punct	", ",flattened
R6124	T20868	T20865	cc	or,flattened
R6125	T20869	T20865	conj	sectioned,flattened
R6126	T20870	T20869	prep	along,sectioned
R6127	T20871	T20872	det	the,axis
R6128	T20872	T20870	pobj	axis,along
R6129	T20873	T20872	compound	z,axis
R6130	T20874	T20872	punct	-,axis
R6131	T20875	T20865	punct	", ",flattened
R6132	T20876	T20877	advmod	then,processed
R6133	T20877	T20865	dep	processed,flattened
R6134	T20878	T20877	advmod	further,processed
R6135	T20879	T20877	advcl	using,processed
R6136	T20880	T20881	nmod	BioRad,software
R6137	T20881	T20879	dobj	software,using
R6138	T20882	T20883	nmod	Laser,Sharp
R6139	T20883	T20881	nmod	Sharp,software
R6140	T20884	T20883	nummod	2000,Sharp
R6141	T20885	T20881	cc	and,software
R6142	T20886	T20887	compound	Image,J
R6143	T20887	T20888	compound	J,software
R6144	T20888	T20881	conj	software,software
R6145	T20889	T20890	punct	(,Institutes
R6146	T20890	T20888	parataxis	Institutes,software
R6147	T20891	T20890	dep	v.,Institutes
R6148	T20892	T20891	nummod	1.32,v.
R6149	T20893	T20890	punct	;,Institutes
R6150	T20894	T20890	compound	National,Institutes
R6151	T20895	T20890	prep	of,Institutes
R6152	T20896	T20895	pobj	Health,of
R6153	T20897	T20890	punct	),Institutes
R6154	T20898	T20865	punct	.,flattened
R6155	T20900	T20901	nsubjpass	Colocalization,performed
R6156	T20902	T20901	auxpass	was,performed
R6157	T20903	T20901	advcl	using,performed
R6158	T20904	T20905	det	the,coefficient
R6159	T20905	T20903	dobj	coefficient,using
R6160	T20906	T20905	amod	overlay,coefficient
R6161	T20907	T20905	prep	of,coefficient
R6162	T20908	T20909	compound	Image,J
R6163	T20909	T20910	compound	J,software
R6164	T20910	T20907	pobj	software,of
R6165	T20911	T20901	punct	.,performed

PMC:1189073 / 31718-40803 JSONTXT 5 Projects

Annnotations TAB TSV DIC JSON TextAE

PMC:1189073 / 31718-40803 JSON TXT 5 Projects