| Id |
Subject |
Object |
Predicate |
Lexical cue |
| T593 |
0-8 |
NN |
denotes |
Diabetes |
| T595 |
0-57 |
sentence |
denotes |
Diabetes Insipidus in Mice with a Mutation in Aquaporin-2 |
| T594 |
9-18 |
NN |
denotes |
Insipidus |
| T596 |
19-21 |
IN |
denotes |
in |
| T597 |
22-26 |
NNS |
denotes |
Mice |
| T598 |
27-31 |
IN |
denotes |
with |
| T599 |
32-33 |
DT |
denotes |
a |
| T600 |
34-42 |
NN |
denotes |
Mutation |
| T601 |
43-45 |
IN |
denotes |
in |
| T602 |
46-55 |
NN |
denotes |
Aquaporin |
| T603 |
55-56 |
HYPH |
denotes |
- |
| T604 |
56-57 |
CD |
denotes |
2 |
| T607 |
57-240 |
sentence |
denotes |
Aquaporin-2 Mutant Mice
Abstract
Congenital nephrogenic diabetes insipidus (NDI) is a disease characterized by failure of the kidney to concentrate urine in response to vasopressin. |
| T608 |
92-102 |
JJ |
denotes |
Congenital |
| T610 |
103-114 |
JJ |
denotes |
nephrogenic |
| T611 |
115-123 |
NN |
denotes |
diabetes |
| T609 |
124-133 |
NN |
denotes |
insipidus |
| T613 |
134-135 |
-LRB- |
denotes |
( |
| T614 |
135-138 |
NN |
denotes |
NDI |
| T615 |
138-139 |
-RRB- |
denotes |
) |
| T612 |
140-142 |
VBZ |
denotes |
is |
| T616 |
143-144 |
DT |
denotes |
a |
| T617 |
145-152 |
NN |
denotes |
disease |
| T618 |
153-166 |
VBN |
denotes |
characterized |
| T619 |
167-169 |
IN |
denotes |
by |
| T620 |
170-177 |
NN |
denotes |
failure |
| T621 |
178-180 |
IN |
denotes |
of |
| T622 |
181-184 |
DT |
denotes |
the |
| T623 |
185-191 |
NN |
denotes |
kidney |
| T624 |
192-194 |
TO |
denotes |
to |
| T625 |
195-206 |
VB |
denotes |
concentrate |
| T626 |
207-212 |
NN |
denotes |
urine |
| T627 |
213-215 |
IN |
denotes |
in |
| T628 |
216-224 |
NN |
denotes |
response |
| T629 |
225-227 |
IN |
denotes |
to |
| T630 |
228-239 |
NN |
denotes |
vasopressin |
| T631 |
239-240 |
. |
denotes |
. |
| T632 |
240-438 |
sentence |
denotes |
Human kindreds with nephrogenic diabetes insipidus have been found to harbor mutations in the vasopressin receptor 2 (Avpr2) gene or the vasopressin-sensitive water channel aquaporin-2 (Aqp2) gene. |
| T633 |
241-246 |
JJ |
denotes |
Human |
| T634 |
247-255 |
NNS |
denotes |
kindreds |
| T636 |
256-260 |
IN |
denotes |
with |
| T637 |
261-272 |
JJ |
denotes |
nephrogenic |
| T639 |
273-281 |
NN |
denotes |
diabetes |
| T638 |
282-291 |
NN |
denotes |
insipidus |
| T640 |
292-296 |
VBP |
denotes |
have |
| T641 |
297-301 |
VBN |
denotes |
been |
| T635 |
302-307 |
VBN |
denotes |
found |
| T642 |
308-310 |
TO |
denotes |
to |
| T643 |
311-317 |
VB |
denotes |
harbor |
| T644 |
318-327 |
NNS |
denotes |
mutations |
| T645 |
328-330 |
IN |
denotes |
in |
| T646 |
331-334 |
DT |
denotes |
the |
| T648 |
335-346 |
NN |
denotes |
vasopressin |
| T649 |
347-355 |
NN |
denotes |
receptor |
| T650 |
356-357 |
CD |
denotes |
2 |
| T651 |
358-359 |
-LRB- |
denotes |
( |
| T652 |
359-364 |
NN |
denotes |
Avpr2 |
| T653 |
364-365 |
-RRB- |
denotes |
) |
| T647 |
366-370 |
NN |
denotes |
gene |
| T654 |
371-373 |
CC |
denotes |
or |
| T655 |
374-377 |
DT |
denotes |
the |
| T657 |
378-389 |
NN |
denotes |
vasopressin |
| T659 |
389-390 |
HYPH |
denotes |
- |
| T658 |
390-399 |
JJ |
denotes |
sensitive |
| T660 |
400-405 |
NN |
denotes |
water |
| T661 |
406-413 |
NN |
denotes |
channel |
| T662 |
414-423 |
NN |
denotes |
aquaporin |
| T663 |
423-424 |
HYPH |
denotes |
- |
| T664 |
424-425 |
CD |
denotes |
2 |
| T665 |
426-427 |
-LRB- |
denotes |
( |
| T666 |
427-431 |
NN |
denotes |
Aqp2 |
| T667 |
431-432 |
-RRB- |
denotes |
) |
| T656 |
433-437 |
NN |
denotes |
gene |
| T668 |
437-438 |
. |
denotes |
. |
| T669 |
438-529 |
sentence |
denotes |
Development of a treatment is rendered difficult due to the lack of a viable animal model. |
| T670 |
439-450 |
NN |
denotes |
Development |
| T672 |
451-453 |
IN |
denotes |
of |
| T673 |
454-455 |
DT |
denotes |
a |
| T674 |
456-465 |
NN |
denotes |
treatment |
| T675 |
466-468 |
VBZ |
denotes |
is |
| T671 |
469-477 |
VBN |
denotes |
rendered |
| T676 |
478-487 |
JJ |
denotes |
difficult |
| T677 |
488-491 |
IN |
denotes |
due |
| T678 |
492-494 |
IN |
denotes |
to |
| T679 |
495-498 |
DT |
denotes |
the |
| T680 |
499-503 |
NN |
denotes |
lack |
| T681 |
504-506 |
IN |
denotes |
of |
| T682 |
507-508 |
DT |
denotes |
a |
| T684 |
509-515 |
JJ |
denotes |
viable |
| T685 |
516-522 |
NN |
denotes |
animal |
| T683 |
523-528 |
NN |
denotes |
model |
| T686 |
528-529 |
. |
denotes |
. |
| T687 |
529-717 |
sentence |
denotes |
Through forward genetic screening of ethylnitrosourea-mutagenized mice, we report the identification and characterization of a mouse model of NDI, with an F204V mutation in the Aqp2 gene. |
| T688 |
530-537 |
IN |
denotes |
Through |
| T690 |
538-545 |
JJ |
denotes |
forward |
| T692 |
546-553 |
JJ |
denotes |
genetic |
| T691 |
554-563 |
NN |
denotes |
screening |
| T693 |
564-566 |
IN |
denotes |
of |
| T694 |
567-583 |
NN |
denotes |
ethylnitrosourea |
| T696 |
583-584 |
HYPH |
denotes |
- |
| T695 |
584-595 |
VBN |
denotes |
mutagenized |
| T697 |
596-600 |
NNS |
denotes |
mice |
| T698 |
600-602 |
, |
denotes |
, |
| T699 |
602-604 |
PRP |
denotes |
we |
| T689 |
605-611 |
VBP |
denotes |
report |
| T700 |
612-615 |
DT |
denotes |
the |
| T701 |
616-630 |
NN |
denotes |
identification |
| T702 |
631-634 |
CC |
denotes |
and |
| T703 |
635-651 |
NN |
denotes |
characterization |
| T704 |
652-654 |
IN |
denotes |
of |
| T705 |
655-656 |
DT |
denotes |
a |
| T707 |
657-662 |
NN |
denotes |
mouse |
| T706 |
663-668 |
NN |
denotes |
model |
| T708 |
669-671 |
IN |
denotes |
of |
| T709 |
672-675 |
NN |
denotes |
NDI |
| T710 |
675-677 |
, |
denotes |
, |
| T711 |
677-681 |
IN |
denotes |
with |
| T712 |
682-684 |
DT |
denotes |
an |
| T714 |
685-690 |
NN |
denotes |
F204V |
| T713 |
691-699 |
NN |
denotes |
mutation |
| T715 |
700-702 |
IN |
denotes |
in |
| T716 |
703-706 |
DT |
denotes |
the |
| T718 |
707-711 |
NN |
denotes |
Aqp2 |
| T717 |
712-716 |
NN |
denotes |
gene |
| T719 |
716-717 |
. |
denotes |
. |
| T720 |
717-847 |
sentence |
denotes |
Unlike previously attempted murine models of NDI, our mice survive to adulthood and more exactly recapitulate the human disorder. |
| T721 |
718-724 |
IN |
denotes |
Unlike |
| T723 |
725-735 |
RB |
denotes |
previously |
| T724 |
736-745 |
VBN |
denotes |
attempted |
| T726 |
746-752 |
JJ |
denotes |
murine |
| T725 |
753-759 |
NNS |
denotes |
models |
| T727 |
760-762 |
IN |
denotes |
of |
| T728 |
763-766 |
NN |
denotes |
NDI |
| T729 |
766-768 |
, |
denotes |
, |
| T730 |
768-771 |
PRP$ |
denotes |
our |
| T731 |
772-776 |
NNS |
denotes |
mice |
| T722 |
777-784 |
VBP |
denotes |
survive |
| T732 |
785-787 |
IN |
denotes |
to |
| T733 |
788-797 |
NN |
denotes |
adulthood |
| T734 |
798-801 |
CC |
denotes |
and |
| T735 |
802-806 |
RBR |
denotes |
more |
| T736 |
807-814 |
RB |
denotes |
exactly |
| T737 |
815-827 |
VBP |
denotes |
recapitulate |
| T738 |
828-831 |
DT |
denotes |
the |
| T740 |
832-837 |
JJ |
denotes |
human |
| T739 |
838-846 |
NN |
denotes |
disorder |
| T741 |
846-847 |
. |
denotes |
. |
| T742 |
847-990 |
sentence |
denotes |
Previous in vitro experiments using renal cell lines suggest recessive Aqp2 mutations result in improper trafficking of the mutant water pore. |
| T743 |
848-856 |
JJ |
denotes |
Previous |
| T745 |
857-859 |
FW |
denotes |
in |
| T746 |
860-865 |
FW |
denotes |
vitro |
| T744 |
866-877 |
NNS |
denotes |
experiments |
| T748 |
878-883 |
VBG |
denotes |
using |
| T749 |
884-889 |
JJ |
denotes |
renal |
| T751 |
890-894 |
NN |
denotes |
cell |
| T750 |
895-900 |
NNS |
denotes |
lines |
| T747 |
901-908 |
VBP |
denotes |
suggest |
| T752 |
909-918 |
JJ |
denotes |
recessive |
| T754 |
919-923 |
NN |
denotes |
Aqp2 |
| T753 |
924-933 |
NNS |
denotes |
mutations |
| T755 |
934-940 |
VBP |
denotes |
result |
| T756 |
941-943 |
IN |
denotes |
in |
| T757 |
944-952 |
JJ |
denotes |
improper |
| T758 |
953-964 |
NN |
denotes |
trafficking |
| T759 |
965-967 |
IN |
denotes |
of |
| T760 |
968-971 |
DT |
denotes |
the |
| T762 |
972-978 |
JJ |
denotes |
mutant |
| T763 |
979-984 |
NN |
denotes |
water |
| T761 |
985-989 |
NN |
denotes |
pore |
| T764 |
989-990 |
. |
denotes |
. |
| T765 |
990-1164 |
sentence |
denotes |
Using these animals, we have directly proven this hypothesis of improper AQP2 translocation as the molecular defect in nephrogenic diabetes insipidus in the intact organism. |
| T766 |
991-996 |
VBG |
denotes |
Using |
| T768 |
997-1002 |
DT |
denotes |
these |
| T769 |
1003-1010 |
NNS |
denotes |
animals |
| T770 |
1010-1012 |
, |
denotes |
, |
| T771 |
1012-1014 |
PRP |
denotes |
we |
| T772 |
1015-1019 |
VBP |
denotes |
have |
| T773 |
1020-1028 |
RB |
denotes |
directly |
| T767 |
1029-1035 |
VBN |
denotes |
proven |
| T774 |
1036-1040 |
DT |
denotes |
this |
| T775 |
1041-1051 |
NN |
denotes |
hypothesis |
| T776 |
1052-1054 |
IN |
denotes |
of |
| T777 |
1055-1063 |
JJ |
denotes |
improper |
| T779 |
1064-1068 |
NN |
denotes |
AQP2 |
| T778 |
1069-1082 |
NN |
denotes |
translocation |
| T780 |
1083-1085 |
IN |
denotes |
as |
| T781 |
1086-1089 |
DT |
denotes |
the |
| T783 |
1090-1099 |
JJ |
denotes |
molecular |
| T782 |
1100-1106 |
NN |
denotes |
defect |
| T784 |
1107-1109 |
IN |
denotes |
in |
| T785 |
1110-1121 |
JJ |
denotes |
nephrogenic |
| T787 |
1122-1130 |
NN |
denotes |
diabetes |
| T786 |
1131-1140 |
NN |
denotes |
insipidus |
| T788 |
1141-1143 |
IN |
denotes |
in |
| T789 |
1144-1147 |
DT |
denotes |
the |
| T791 |
1148-1154 |
JJ |
denotes |
intact |
| T790 |
1155-1163 |
NN |
denotes |
organism |
| T792 |
1163-1164 |
. |
denotes |
. |
| T793 |
1164-1362 |
sentence |
denotes |
Additionally, using a renal cell line we show that the mutated protein, AQP2-F204V, is retained in the endoplasmic reticulum and that this abnormal localization can be rescued by wild-type protein. |
| T794 |
1165-1177 |
RB |
denotes |
Additionally |
| T796 |
1177-1179 |
, |
denotes |
, |
| T797 |
1179-1184 |
VBG |
denotes |
using |
| T798 |
1185-1186 |
DT |
denotes |
a |
| T800 |
1187-1192 |
JJ |
denotes |
renal |
| T801 |
1193-1197 |
NN |
denotes |
cell |
| T799 |
1198-1202 |
NN |
denotes |
line |
| T802 |
1203-1205 |
PRP |
denotes |
we |
| T795 |
1206-1210 |
VBP |
denotes |
show |
| T803 |
1211-1215 |
IN |
denotes |
that |
| T805 |
1216-1219 |
DT |
denotes |
the |
| T807 |
1220-1227 |
VBN |
denotes |
mutated |
| T806 |
1228-1235 |
NN |
denotes |
protein |
| T808 |
1235-1237 |
, |
denotes |
, |
| T809 |
1237-1241 |
NN |
denotes |
AQP2 |
| T811 |
1241-1242 |
HYPH |
denotes |
- |
| T810 |
1242-1247 |
NN |
denotes |
F204V |
| T812 |
1247-1249 |
, |
denotes |
, |
| T813 |
1249-1251 |
VBZ |
denotes |
is |
| T804 |
1252-1260 |
VBN |
denotes |
retained |
| T814 |
1261-1263 |
IN |
denotes |
in |
| T815 |
1264-1267 |
DT |
denotes |
the |
| T817 |
1268-1279 |
JJ |
denotes |
endoplasmic |
| T816 |
1280-1289 |
NN |
denotes |
reticulum |
| T818 |
1290-1293 |
CC |
denotes |
and |
| T819 |
1294-1298 |
IN |
denotes |
that |
| T821 |
1299-1303 |
DT |
denotes |
this |
| T823 |
1304-1312 |
JJ |
denotes |
abnormal |
| T822 |
1313-1325 |
NN |
denotes |
localization |
| T824 |
1326-1329 |
MD |
denotes |
can |
| T825 |
1330-1332 |
VB |
denotes |
be |
| T820 |
1333-1340 |
VBN |
denotes |
rescued |
| T826 |
1341-1343 |
IN |
denotes |
by |
| T827 |
1344-1348 |
JJ |
denotes |
wild |
| T829 |
1348-1349 |
HYPH |
denotes |
- |
| T828 |
1349-1353 |
NN |
denotes |
type |
| T830 |
1354-1361 |
NN |
denotes |
protein |
| T831 |
1361-1362 |
. |
denotes |
. |
| T832 |
1362-1490 |
sentence |
denotes |
This novel mouse model allows for further mechanistic studies as well as testing of pharmacological and gene therapies for NDI. |
| T833 |
1363-1367 |
DT |
denotes |
This |
| T835 |
1368-1373 |
JJ |
denotes |
novel |
| T836 |
1374-1379 |
NN |
denotes |
mouse |
| T834 |
1380-1385 |
NN |
denotes |
model |
| T837 |
1386-1392 |
VBZ |
denotes |
allows |
| T838 |
1393-1396 |
IN |
denotes |
for |
| T839 |
1397-1404 |
JJ |
denotes |
further |
| T841 |
1405-1416 |
JJ |
denotes |
mechanistic |
| T840 |
1417-1424 |
NNS |
denotes |
studies |
| T842 |
1425-1427 |
RB |
denotes |
as |
| T844 |
1428-1432 |
RB |
denotes |
well |
| T843 |
1433-1435 |
IN |
denotes |
as |
| T845 |
1436-1443 |
NN |
denotes |
testing |
| T846 |
1444-1446 |
IN |
denotes |
of |
| T847 |
1447-1462 |
JJ |
denotes |
pharmacological |
| T849 |
1463-1466 |
CC |
denotes |
and |
| T850 |
1467-1471 |
NN |
denotes |
gene |
| T848 |
1472-1481 |
NNS |
denotes |
therapies |
| T851 |
1482-1485 |
IN |
denotes |
for |
| T852 |
1486-1489 |
NN |
denotes |
NDI |
| T853 |
1489-1490 |
. |
denotes |
. |
| T2464 |
3091-3102 |
JJ |
denotes |
Nephrogenic |
| T2466 |
3103-3111 |
NN |
denotes |
diabetes |
| T2465 |
3112-3121 |
NN |
denotes |
insipidus |
| T2468 |
3122-3123 |
-LRB- |
denotes |
( |
| T2469 |
3123-3126 |
NN |
denotes |
NDI |
| T2470 |
3126-3127 |
-RRB- |
denotes |
) |
| T2467 |
3128-3130 |
VBZ |
denotes |
is |
| T2471 |
3131-3132 |
DT |
denotes |
a |
| T2472 |
3133-3140 |
NN |
denotes |
disease |
| T2473 |
3141-3154 |
VBN |
denotes |
characterized |
| T2474 |
3155-3157 |
IN |
denotes |
by |
| T2475 |
3158-3167 |
JJ |
denotes |
excessive |
| T2476 |
3168-3177 |
NN |
denotes |
urination |
| T2477 |
3178-3181 |
CC |
denotes |
and |
| T2478 |
3182-3188 |
RB |
denotes |
thirst |
| T2479 |
3188-3190 |
, |
denotes |
, |
| T2480 |
3190-3197 |
IN |
denotes |
despite |
| T2481 |
3198-3204 |
JJ |
denotes |
normal |
| T2482 |
3205-3215 |
NN |
denotes |
production |
| T2483 |
3216-3218 |
IN |
denotes |
of |
| T2484 |
3219-3222 |
DT |
denotes |
the |
| T2486 |
3223-3235 |
JJ |
denotes |
antidiuretic |
| T2485 |
3236-3243 |
NN |
denotes |
hormone |
| T2487 |
3244-3252 |
NN |
denotes |
arginine |
| T2488 |
3253-3264 |
NN |
denotes |
vasopressin |
| T2489 |
3265-3266 |
-LRB- |
denotes |
( |
| T2490 |
3266-3269 |
NN |
denotes |
AVP |
| T2491 |
3269-3270 |
-RRB- |
denotes |
) |
| T2492 |
3271-3272 |
-LRB- |
denotes |
[ |
| T2493 |
3272-3273 |
CD |
denotes |
1 |
| T2494 |
3273-3274 |
-RRB- |
denotes |
] |
| T2495 |
3274-3275 |
. |
denotes |
. |
| T2496 |
3275-3418 |
sentence |
denotes |
The inherited forms are either X-linked as a consequence of mutation of the Avpr2 gene [2], or autosomal due to mutation of the Aqp2 gene [3]. |
| T2497 |
3276-3279 |
DT |
denotes |
The |
| T2499 |
3280-3289 |
VBN |
denotes |
inherited |
| T2498 |
3290-3295 |
NNS |
denotes |
forms |
| T2500 |
3296-3299 |
VBP |
denotes |
are |
| T2501 |
3300-3306 |
RB |
denotes |
either |
| T2503 |
3307-3308 |
NN |
denotes |
X |
| T2504 |
3308-3309 |
HYPH |
denotes |
- |
| T2502 |
3309-3315 |
VBN |
denotes |
linked |
| T2505 |
3316-3318 |
IN |
denotes |
as |
| T2506 |
3319-3320 |
DT |
denotes |
a |
| T2507 |
3321-3332 |
NN |
denotes |
consequence |
| T2508 |
3333-3335 |
IN |
denotes |
of |
| T2509 |
3336-3344 |
NN |
denotes |
mutation |
| T2510 |
3345-3347 |
IN |
denotes |
of |
| T2511 |
3348-3351 |
DT |
denotes |
the |
| T2513 |
3352-3357 |
NN |
denotes |
Avpr2 |
| T2512 |
3358-3362 |
NN |
denotes |
gene |
| T2514 |
3363-3364 |
-LRB- |
denotes |
[ |
| T2515 |
3364-3365 |
CD |
denotes |
2 |
| T2516 |
3365-3366 |
-RRB- |
denotes |
] |
| T2517 |
3366-3368 |
, |
denotes |
, |
| T2518 |
3368-3370 |
CC |
denotes |
or |
| T2519 |
3371-3380 |
JJ |
denotes |
autosomal |
| T2520 |
3381-3384 |
JJ |
denotes |
due |
| T2521 |
3385-3387 |
IN |
denotes |
to |
| T2522 |
3388-3396 |
NN |
denotes |
mutation |
| T2523 |
3397-3399 |
IN |
denotes |
of |
| T2524 |
3400-3403 |
DT |
denotes |
the |
| T2526 |
3404-3408 |
NN |
denotes |
Aqp2 |
| T2525 |
3409-3413 |
NN |
denotes |
gene |
| T2527 |
3414-3415 |
-LRB- |
denotes |
[ |
| T2528 |
3415-3416 |
CD |
denotes |
3 |
| T2529 |
3416-3417 |
-RRB- |
denotes |
] |
| T2530 |
3417-3418 |
. |
denotes |
. |
| T2531 |
3418-3582 |
sentence |
denotes |
Aquaporin-2 (AQP2) is a pore-forming protein belonging to a family of water channels [4], and it is expressed in collecting-duct principal cells in the kidney [5]. |
| T2532 |
3419-3428 |
NN |
denotes |
Aquaporin |
| T2534 |
3428-3429 |
HYPH |
denotes |
- |
| T2535 |
3429-3430 |
CD |
denotes |
2 |
| T2536 |
3431-3432 |
-LRB- |
denotes |
( |
| T2537 |
3432-3436 |
NN |
denotes |
AQP2 |
| T2538 |
3436-3437 |
-RRB- |
denotes |
) |
| T2533 |
3438-3440 |
VBZ |
denotes |
is |
| T2539 |
3441-3442 |
DT |
denotes |
a |
| T2541 |
3443-3447 |
NN |
denotes |
pore |
| T2543 |
3447-3448 |
HYPH |
denotes |
- |
| T2542 |
3448-3455 |
VBG |
denotes |
forming |
| T2540 |
3456-3463 |
NN |
denotes |
protein |
| T2544 |
3464-3473 |
VBG |
denotes |
belonging |
| T2545 |
3474-3476 |
IN |
denotes |
to |
| T2546 |
3477-3478 |
DT |
denotes |
a |
| T2547 |
3479-3485 |
NN |
denotes |
family |
| T2548 |
3486-3488 |
IN |
denotes |
of |
| T2549 |
3489-3494 |
NN |
denotes |
water |
| T2550 |
3495-3503 |
NNS |
denotes |
channels |
| T2551 |
3504-3505 |
-LRB- |
denotes |
[ |
| T2552 |
3505-3506 |
CD |
denotes |
4 |
| T2553 |
3506-3507 |
-RRB- |
denotes |
] |
| T2554 |
3507-3509 |
, |
denotes |
, |
| T2555 |
3509-3512 |
CC |
denotes |
and |
| T2556 |
3513-3515 |
PRP |
denotes |
it |
| T2558 |
3516-3518 |
VBZ |
denotes |
is |
| T2557 |
3519-3528 |
VBN |
denotes |
expressed |
| T2559 |
3529-3531 |
IN |
denotes |
in |
| T2560 |
3532-3542 |
VBG |
denotes |
collecting |
| T2562 |
3542-3543 |
HYPH |
denotes |
- |
| T2561 |
3543-3547 |
NN |
denotes |
duct |
| T2564 |
3548-3557 |
JJ |
denotes |
principal |
| T2563 |
3558-3563 |
NNS |
denotes |
cells |
| T2565 |
3564-3566 |
IN |
denotes |
in |
| T2566 |
3567-3570 |
DT |
denotes |
the |
| T2567 |
3571-3577 |
NN |
denotes |
kidney |
| T2568 |
3578-3579 |
-LRB- |
denotes |
[ |
| T2569 |
3579-3580 |
CD |
denotes |
5 |
| T2570 |
3580-3581 |
-RRB- |
denotes |
] |
| T2571 |
3581-3582 |
. |
denotes |
. |
| T2572 |
3582-3791 |
sentence |
denotes |
Generally these proteins permit the passage of water through the plasma membrane (PM) of cells, several of which carry out this role specifically in the process of water reabsorption from urine in the kidney. |
| T2573 |
3583-3592 |
RB |
denotes |
Generally |
| T2575 |
3593-3598 |
DT |
denotes |
these |
| T2576 |
3599-3607 |
NN |
denotes |
proteins |
| T2574 |
3608-3614 |
VBP |
denotes |
permit |
| T2577 |
3615-3618 |
DT |
denotes |
the |
| T2578 |
3619-3626 |
NN |
denotes |
passage |
| T2579 |
3627-3629 |
IN |
denotes |
of |
| T2580 |
3630-3635 |
NN |
denotes |
water |
| T2581 |
3636-3643 |
IN |
denotes |
through |
| T2582 |
3644-3647 |
DT |
denotes |
the |
| T2584 |
3648-3654 |
NN |
denotes |
plasma |
| T2583 |
3655-3663 |
NN |
denotes |
membrane |
| T2585 |
3664-3665 |
-LRB- |
denotes |
( |
| T2586 |
3665-3667 |
NN |
denotes |
PM |
| T2587 |
3667-3668 |
-RRB- |
denotes |
) |
| T2588 |
3669-3671 |
IN |
denotes |
of |
| T2589 |
3672-3677 |
NNS |
denotes |
cells |
| T2590 |
3677-3679 |
, |
denotes |
, |
| T2591 |
3679-3686 |
JJ |
denotes |
several |
| T2593 |
3687-3689 |
IN |
denotes |
of |
| T2594 |
3690-3695 |
WDT |
denotes |
which |
| T2592 |
3696-3701 |
VBP |
denotes |
carry |
| T2595 |
3702-3705 |
RP |
denotes |
out |
| T2596 |
3706-3710 |
DT |
denotes |
this |
| T2597 |
3711-3715 |
NN |
denotes |
role |
| T2598 |
3716-3728 |
RB |
denotes |
specifically |
| T2599 |
3729-3731 |
IN |
denotes |
in |
| T2600 |
3732-3735 |
DT |
denotes |
the |
| T2601 |
3736-3743 |
NN |
denotes |
process |
| T2602 |
3744-3746 |
IN |
denotes |
of |
| T2603 |
3747-3752 |
NN |
denotes |
water |
| T2604 |
3753-3765 |
NN |
denotes |
reabsorption |
| T2605 |
3766-3770 |
IN |
denotes |
from |
| T2606 |
3771-3776 |
NN |
denotes |
urine |
| T2607 |
3777-3779 |
IN |
denotes |
in |
| T2608 |
3780-3783 |
DT |
denotes |
the |
| T2609 |
3784-3790 |
NN |
denotes |
kidney |
| T2610 |
3790-3791 |
. |
denotes |
. |
| T2611 |
3791-3933 |
sentence |
denotes |
It has been established that aquaporins, although functional as a monomer, tetramerize before their insertion into the plasma membrane [4,6]. |
| T2612 |
3792-3794 |
PRP |
denotes |
It |
| T2614 |
3795-3798 |
VBZ |
denotes |
has |
| T2615 |
3799-3803 |
VBN |
denotes |
been |
| T2613 |
3804-3815 |
VBN |
denotes |
established |
| T2616 |
3816-3820 |
IN |
denotes |
that |
| T2618 |
3821-3831 |
NNS |
denotes |
aquaporins |
| T2619 |
3831-3833 |
, |
denotes |
, |
| T2620 |
3833-3841 |
IN |
denotes |
although |
| T2621 |
3842-3852 |
JJ |
denotes |
functional |
| T2622 |
3853-3855 |
IN |
denotes |
as |
| T2623 |
3856-3857 |
DT |
denotes |
a |
| T2624 |
3858-3865 |
NN |
denotes |
monomer |
| T2625 |
3865-3867 |
, |
denotes |
, |
| T2617 |
3867-3878 |
VBP |
denotes |
tetramerize |
| T2626 |
3879-3885 |
IN |
denotes |
before |
| T2627 |
3886-3891 |
PRP$ |
denotes |
their |
| T2628 |
3892-3901 |
NN |
denotes |
insertion |
| T2629 |
3902-3906 |
IN |
denotes |
into |
| T2630 |
3907-3910 |
DT |
denotes |
the |
| T2632 |
3911-3917 |
NN |
denotes |
plasma |
| T2631 |
3918-3926 |
NN |
denotes |
membrane |
| T2633 |
3927-3928 |
-LRB- |
denotes |
[ |
| T2635 |
3928-3929 |
CD |
denotes |
4 |
| T2636 |
3929-3930 |
, |
denotes |
, |
| T2634 |
3930-3931 |
CD |
denotes |
6 |
| T2637 |
3931-3932 |
-RRB- |
denotes |
] |
| T2638 |
3932-3933 |
. |
denotes |
. |
| T2639 |
3933-4197 |
sentence |
denotes |
Furthermore these proteins can also be differentially targeted to distinct regions of the PM; for example, AQP2 is routed to the apical membrane of cells surrounding the collecting duct, whereas other aquaporins (AQP3 or 4) are inserted into the basolateral face. |
| T2640 |
3934-3945 |
RB |
denotes |
Furthermore |
| T2642 |
3946-3951 |
DT |
denotes |
these |
| T2643 |
3952-3960 |
NN |
denotes |
proteins |
| T2644 |
3961-3964 |
MD |
denotes |
can |
| T2645 |
3965-3969 |
RB |
denotes |
also |
| T2646 |
3970-3972 |
VB |
denotes |
be |
| T2647 |
3973-3987 |
RB |
denotes |
differentially |
| T2641 |
3988-3996 |
VBN |
denotes |
targeted |
| T2649 |
3997-3999 |
IN |
denotes |
to |
| T2650 |
4000-4008 |
JJ |
denotes |
distinct |
| T2651 |
4009-4016 |
NNS |
denotes |
regions |
| T2652 |
4017-4019 |
IN |
denotes |
of |
| T2653 |
4020-4023 |
DT |
denotes |
the |
| T2654 |
4024-4026 |
NN |
denotes |
PM |
| T2655 |
4026-4027 |
: |
denotes |
; |
| T2656 |
4028-4031 |
IN |
denotes |
for |
| T2657 |
4032-4039 |
NN |
denotes |
example |
| T2658 |
4039-4041 |
, |
denotes |
, |
| T2659 |
4041-4045 |
NN |
denotes |
AQP2 |
| T2660 |
4046-4048 |
VBZ |
denotes |
is |
| T2648 |
4049-4055 |
VBN |
denotes |
routed |
| T2661 |
4056-4058 |
IN |
denotes |
to |
| T2662 |
4059-4062 |
DT |
denotes |
the |
| T2664 |
4063-4069 |
JJ |
denotes |
apical |
| T2663 |
4070-4078 |
NN |
denotes |
membrane |
| T2665 |
4079-4081 |
IN |
denotes |
of |
| T2666 |
4082-4087 |
NNS |
denotes |
cells |
| T2667 |
4088-4099 |
VBG |
denotes |
surrounding |
| T2668 |
4100-4103 |
DT |
denotes |
the |
| T2670 |
4104-4114 |
VBG |
denotes |
collecting |
| T2669 |
4115-4119 |
NN |
denotes |
duct |
| T2671 |
4119-4121 |
, |
denotes |
, |
| T2672 |
4121-4128 |
IN |
denotes |
whereas |
| T2674 |
4129-4134 |
JJ |
denotes |
other |
| T2675 |
4135-4145 |
NNS |
denotes |
aquaporins |
| T2676 |
4146-4147 |
-LRB- |
denotes |
( |
| T2677 |
4147-4151 |
NN |
denotes |
AQP3 |
| T2678 |
4152-4154 |
CC |
denotes |
or |
| T2679 |
4155-4156 |
CD |
denotes |
4 |
| T2680 |
4156-4157 |
-RRB- |
denotes |
) |
| T2681 |
4158-4161 |
VBP |
denotes |
are |
| T2673 |
4162-4170 |
VBN |
denotes |
inserted |
| T2682 |
4171-4175 |
IN |
denotes |
into |
| T2683 |
4176-4179 |
DT |
denotes |
the |
| T2685 |
4180-4191 |
JJ |
denotes |
basolateral |
| T2684 |
4192-4196 |
NN |
denotes |
face |
| T2686 |
4196-4197 |
. |
denotes |
. |
| T2687 |
4197-4292 |
sentence |
denotes |
Unlike all other family members, AQP2 is not constitutively inserted into the plasma membrane. |
| T2688 |
4198-4204 |
IN |
denotes |
Unlike |
| T2690 |
4205-4208 |
DT |
denotes |
all |
| T2692 |
4209-4214 |
JJ |
denotes |
other |
| T2693 |
4215-4221 |
NN |
denotes |
family |
| T2691 |
4222-4229 |
NNS |
denotes |
members |
| T2694 |
4229-4231 |
, |
denotes |
, |
| T2695 |
4231-4235 |
NN |
denotes |
AQP2 |
| T2696 |
4236-4238 |
VBZ |
denotes |
is |
| T2697 |
4239-4242 |
RB |
denotes |
not |
| T2698 |
4243-4257 |
RB |
denotes |
constitutively |
| T2689 |
4258-4266 |
VBN |
denotes |
inserted |
| T2699 |
4267-4271 |
IN |
denotes |
into |
| T2700 |
4272-4275 |
DT |
denotes |
the |
| T2702 |
4276-4282 |
NN |
denotes |
plasma |
| T2701 |
4283-4291 |
NN |
denotes |
membrane |
| T2703 |
4291-4292 |
. |
denotes |
. |
| T2704 |
4292-4504 |
sentence |
denotes |
Under basal conditions, the protein resides in subapical intracellular vesicles; however, under conditions requiring water retention AQP2 translocates to the apical membrane, permitting water reabsorption [7,8]. |
| T2705 |
4293-4298 |
IN |
denotes |
Under |
| T2707 |
4299-4304 |
JJ |
denotes |
basal |
| T2708 |
4305-4315 |
NNS |
denotes |
conditions |
| T2709 |
4315-4317 |
, |
denotes |
, |
| T2710 |
4317-4320 |
DT |
denotes |
the |
| T2711 |
4321-4328 |
NN |
denotes |
protein |
| T2706 |
4329-4336 |
VBZ |
denotes |
resides |
| T2713 |
4337-4339 |
IN |
denotes |
in |
| T2714 |
4340-4349 |
JJ |
denotes |
subapical |
| T2716 |
4350-4363 |
JJ |
denotes |
intracellular |
| T2715 |
4364-4372 |
NNS |
denotes |
vesicles |
| T2717 |
4372-4373 |
: |
denotes |
; |
| T2718 |
4374-4381 |
RB |
denotes |
however |
| T2719 |
4381-4383 |
, |
denotes |
, |
| T2720 |
4383-4388 |
IN |
denotes |
under |
| T2721 |
4389-4399 |
NNS |
denotes |
conditions |
| T2722 |
4400-4409 |
VBG |
denotes |
requiring |
| T2723 |
4410-4415 |
NN |
denotes |
water |
| T2724 |
4416-4425 |
NN |
denotes |
retention |
| T2725 |
4426-4430 |
NN |
denotes |
AQP2 |
| T2712 |
4431-4443 |
VBZ |
denotes |
translocates |
| T2726 |
4444-4446 |
IN |
denotes |
to |
| T2727 |
4447-4450 |
DT |
denotes |
the |
| T2729 |
4451-4457 |
JJ |
denotes |
apical |
| T2728 |
4458-4466 |
NN |
denotes |
membrane |
| T2730 |
4466-4468 |
, |
denotes |
, |
| T2731 |
4468-4478 |
VBG |
denotes |
permitting |
| T2732 |
4479-4484 |
NN |
denotes |
water |
| T2733 |
4485-4497 |
NN |
denotes |
reabsorption |
| T2734 |
4498-4499 |
-LRB- |
denotes |
[ |
| T2736 |
4499-4500 |
CD |
denotes |
7 |
| T2737 |
4500-4501 |
, |
denotes |
, |
| T2735 |
4501-4502 |
CD |
denotes |
8 |
| T2738 |
4502-4503 |
-RRB- |
denotes |
] |
| T2739 |
4503-4504 |
. |
denotes |
. |
| T2740 |
4504-4803 |
sentence |
denotes |
For this process to occur, AVP binds its receptor, AVPR2, on the basolateral face of the collecting duct cells, leading to a rise in intracellular cAMP, ultimately resulting in phosphorylation of AQP2 at serine 256 by cAMP-dependent protein kinase [9] and its redistribution to the plasma membrane. |
| T2741 |
4505-4508 |
IN |
denotes |
For |
| T2743 |
4509-4513 |
DT |
denotes |
this |
| T2744 |
4514-4521 |
NN |
denotes |
process |
| T2745 |
4522-4524 |
TO |
denotes |
to |
| T2742 |
4525-4530 |
VB |
denotes |
occur |
| T2747 |
4530-4532 |
, |
denotes |
, |
| T2748 |
4532-4535 |
NN |
denotes |
AVP |
| T2746 |
4536-4541 |
VBZ |
denotes |
binds |
| T2749 |
4542-4545 |
PRP$ |
denotes |
its |
| T2750 |
4546-4554 |
NN |
denotes |
receptor |
| T2751 |
4554-4556 |
, |
denotes |
, |
| T2752 |
4556-4561 |
NN |
denotes |
AVPR2 |
| T2753 |
4561-4563 |
, |
denotes |
, |
| T2754 |
4563-4565 |
IN |
denotes |
on |
| T2755 |
4566-4569 |
DT |
denotes |
the |
| T2757 |
4570-4581 |
JJ |
denotes |
basolateral |
| T2756 |
4582-4586 |
NN |
denotes |
face |
| T2758 |
4587-4589 |
IN |
denotes |
of |
| T2759 |
4590-4593 |
DT |
denotes |
the |
| T2761 |
4594-4604 |
VBG |
denotes |
collecting |
| T2762 |
4605-4609 |
NN |
denotes |
duct |
| T2760 |
4610-4615 |
NNS |
denotes |
cells |
| T2763 |
4615-4617 |
, |
denotes |
, |
| T2764 |
4617-4624 |
VBG |
denotes |
leading |
| T2765 |
4625-4627 |
IN |
denotes |
to |
| T2766 |
4628-4629 |
DT |
denotes |
a |
| T2767 |
4630-4634 |
NN |
denotes |
rise |
| T2768 |
4635-4637 |
IN |
denotes |
in |
| T2769 |
4638-4651 |
JJ |
denotes |
intracellular |
| T2770 |
4652-4656 |
NN |
denotes |
cAMP |
| T2771 |
4656-4658 |
, |
denotes |
, |
| T2772 |
4658-4668 |
RB |
denotes |
ultimately |
| T2773 |
4669-4678 |
VBG |
denotes |
resulting |
| T2774 |
4679-4681 |
IN |
denotes |
in |
| T2775 |
4682-4697 |
NN |
denotes |
phosphorylation |
| T2776 |
4698-4700 |
IN |
denotes |
of |
| T2777 |
4701-4705 |
NN |
denotes |
AQP2 |
| T2778 |
4706-4708 |
IN |
denotes |
at |
| T2779 |
4709-4715 |
NN |
denotes |
serine |
| T2780 |
4716-4719 |
CD |
denotes |
256 |
| T2781 |
4720-4722 |
IN |
denotes |
by |
| T2782 |
4723-4727 |
NN |
denotes |
cAMP |
| T2784 |
4727-4728 |
HYPH |
denotes |
- |
| T2783 |
4728-4737 |
JJ |
denotes |
dependent |
| T2786 |
4738-4745 |
NN |
denotes |
protein |
| T2785 |
4746-4752 |
NN |
denotes |
kinase |
| T2787 |
4753-4754 |
-LRB- |
denotes |
[ |
| T2788 |
4754-4755 |
CD |
denotes |
9 |
| T2789 |
4755-4756 |
-RRB- |
denotes |
] |
| T2790 |
4757-4760 |
CC |
denotes |
and |
| T2791 |
4761-4764 |
PRP$ |
denotes |
its |
| T2792 |
4765-4779 |
NN |
denotes |
redistribution |
| T2793 |
4780-4782 |
IN |
denotes |
to |
| T2794 |
4783-4786 |
DT |
denotes |
the |
| T2796 |
4787-4793 |
NN |
denotes |
plasma |
| T2795 |
4794-4802 |
NN |
denotes |
membrane |
| T2797 |
4802-4803 |
. |
denotes |
. |
| T2798 |
4803-4953 |
sentence |
denotes |
The importance of AQP2 redistribution has been highlighted by functional characterization of Aqp2 mutations resulting in severe NDI in humans [3,10]. |
| T2799 |
4804-4807 |
DT |
denotes |
The |
| T2800 |
4808-4818 |
NN |
denotes |
importance |
| T2802 |
4819-4821 |
IN |
denotes |
of |
| T2803 |
4822-4826 |
NN |
denotes |
AQP2 |
| T2804 |
4827-4841 |
NN |
denotes |
redistribution |
| T2805 |
4842-4845 |
VBZ |
denotes |
has |
| T2806 |
4846-4850 |
VBN |
denotes |
been |
| T2801 |
4851-4862 |
VBN |
denotes |
highlighted |
| T2807 |
4863-4865 |
IN |
denotes |
by |
| T2808 |
4866-4876 |
JJ |
denotes |
functional |
| T2809 |
4877-4893 |
NN |
denotes |
characterization |
| T2810 |
4894-4896 |
IN |
denotes |
of |
| T2811 |
4897-4901 |
NN |
denotes |
Aqp2 |
| T2812 |
4902-4911 |
NNS |
denotes |
mutations |
| T2813 |
4912-4921 |
VBG |
denotes |
resulting |
| T2814 |
4922-4924 |
IN |
denotes |
in |
| T2815 |
4925-4931 |
JJ |
denotes |
severe |
| T2816 |
4932-4935 |
NN |
denotes |
NDI |
| T2817 |
4936-4938 |
IN |
denotes |
in |
| T2818 |
4939-4945 |
NNS |
denotes |
humans |
| T2819 |
4946-4947 |
-LRB- |
denotes |
[ |
| T2821 |
4947-4948 |
CD |
denotes |
3 |
| T2822 |
4948-4949 |
, |
denotes |
, |
| T2820 |
4949-4951 |
CD |
denotes |
10 |
| T2823 |
4951-4952 |
-RRB- |
denotes |
] |
| T2824 |
4952-4953 |
. |
denotes |
. |
| T2825 |
4953-5136 |
sentence |
denotes |
Recessive Aqp2 mutations are generally thought to produce an abnormally localized and, in most instances, misfolded water pore that responds abnormally to an increase in cAMP [6,11]. |
| T2826 |
4954-4963 |
JJ |
denotes |
Recessive |
| T2828 |
4964-4968 |
NN |
denotes |
Aqp2 |
| T2827 |
4969-4978 |
NNS |
denotes |
mutations |
| T2830 |
4979-4982 |
VBP |
denotes |
are |
| T2831 |
4983-4992 |
RB |
denotes |
generally |
| T2829 |
4993-5000 |
VBN |
denotes |
thought |
| T2832 |
5001-5003 |
TO |
denotes |
to |
| T2833 |
5004-5011 |
VB |
denotes |
produce |
| T2834 |
5012-5014 |
DT |
denotes |
an |
| T2836 |
5015-5025 |
RB |
denotes |
abnormally |
| T2837 |
5026-5035 |
VBN |
denotes |
localized |
| T2838 |
5036-5039 |
CC |
denotes |
and |
| T2839 |
5039-5041 |
, |
denotes |
, |
| T2841 |
5041-5043 |
IN |
denotes |
in |
| T2842 |
5044-5048 |
JJS |
denotes |
most |
| T2843 |
5049-5058 |
NNS |
denotes |
instances |
| T2844 |
5058-5060 |
, |
denotes |
, |
| T2840 |
5060-5069 |
VBN |
denotes |
misfolded |
| T2845 |
5070-5075 |
NN |
denotes |
water |
| T2835 |
5076-5080 |
NN |
denotes |
pore |
| T2846 |
5081-5085 |
WDT |
denotes |
that |
| T2847 |
5086-5094 |
VBZ |
denotes |
responds |
| T2848 |
5095-5105 |
RB |
denotes |
abnormally |
| T2849 |
5106-5108 |
IN |
denotes |
to |
| T2850 |
5109-5111 |
DT |
denotes |
an |
| T2851 |
5112-5120 |
NN |
denotes |
increase |
| T2852 |
5121-5123 |
IN |
denotes |
in |
| T2853 |
5124-5128 |
NN |
denotes |
cAMP |
| T2854 |
5129-5130 |
-LRB- |
denotes |
[ |
| T2856 |
5130-5131 |
CD |
denotes |
6 |
| T2857 |
5131-5132 |
, |
denotes |
, |
| T2855 |
5132-5134 |
CD |
denotes |
11 |
| T2858 |
5134-5135 |
-RRB- |
denotes |
] |
| T2859 |
5135-5136 |
. |
denotes |
. |
| T2860 |
5136-5288 |
sentence |
denotes |
Furthermore, dominant mutations have been described and found to misroute both the mutant and the wild-type protein to the basolateral membrane [6,12]. |
| T2861 |
5137-5148 |
RB |
denotes |
Furthermore |
| T2863 |
5148-5150 |
, |
denotes |
, |
| T2864 |
5150-5158 |
JJ |
denotes |
dominant |
| T2865 |
5159-5168 |
NNS |
denotes |
mutations |
| T2866 |
5169-5173 |
VBP |
denotes |
have |
| T2867 |
5174-5178 |
VBN |
denotes |
been |
| T2862 |
5179-5188 |
VBN |
denotes |
described |
| T2868 |
5189-5192 |
CC |
denotes |
and |
| T2869 |
5193-5198 |
VBN |
denotes |
found |
| T2870 |
5199-5201 |
TO |
denotes |
to |
| T2871 |
5202-5210 |
VB |
denotes |
misroute |
| T2872 |
5211-5215 |
CC |
denotes |
both |
| T2874 |
5216-5219 |
DT |
denotes |
the |
| T2873 |
5220-5226 |
NN |
denotes |
mutant |
| T2875 |
5227-5230 |
CC |
denotes |
and |
| T2876 |
5231-5234 |
DT |
denotes |
the |
| T2878 |
5235-5239 |
JJ |
denotes |
wild |
| T2879 |
5239-5240 |
HYPH |
denotes |
- |
| T2877 |
5240-5244 |
NN |
denotes |
type |
| T2880 |
5245-5252 |
NN |
denotes |
protein |
| T2881 |
5253-5255 |
IN |
denotes |
to |
| T2882 |
5256-5259 |
DT |
denotes |
the |
| T2884 |
5260-5271 |
JJ |
denotes |
basolateral |
| T2883 |
5272-5280 |
NN |
denotes |
membrane |
| T2885 |
5281-5282 |
-LRB- |
denotes |
[ |
| T2887 |
5282-5283 |
CD |
denotes |
6 |
| T2888 |
5283-5284 |
, |
denotes |
, |
| T2886 |
5284-5286 |
CD |
denotes |
12 |
| T2889 |
5286-5287 |
-RRB- |
denotes |
] |
| T2890 |
5287-5288 |
. |
denotes |
. |
| T2891 |
5288-5360 |
sentence |
denotes |
Several mouse models of diabetes insipidus have been generated [13–17]. |
| T2892 |
5289-5296 |
JJ |
denotes |
Several |
| T2894 |
5297-5302 |
NN |
denotes |
mouse |
| T2893 |
5303-5309 |
NNS |
denotes |
models |
| T2896 |
5310-5312 |
IN |
denotes |
of |
| T2897 |
5313-5321 |
NN |
denotes |
diabetes |
| T2898 |
5322-5331 |
NN |
denotes |
insipidus |
| T2899 |
5332-5336 |
VBP |
denotes |
have |
| T2900 |
5337-5341 |
VBN |
denotes |
been |
| T2895 |
5342-5351 |
VBN |
denotes |
generated |
| T2901 |
5352-5353 |
-LRB- |
denotes |
[ |
| T2902 |
5353-5355 |
CD |
denotes |
13 |
| T2903 |
5355-5356 |
SYM |
denotes |
– |
| T2904 |
5356-5358 |
CD |
denotes |
17 |
| T2905 |
5358-5359 |
-RRB- |
denotes |
] |
| T2906 |
5359-5360 |
. |
denotes |
. |
| T2907 |
5360-5468 |
sentence |
denotes |
In an attempt to recapitulate human NDI, mice have been generated with mutations in Aqp2 and Avpr2 [15,18]. |
| T2908 |
5361-5363 |
IN |
denotes |
In |
| T2910 |
5364-5366 |
DT |
denotes |
an |
| T2911 |
5367-5374 |
NN |
denotes |
attempt |
| T2912 |
5375-5377 |
TO |
denotes |
to |
| T2913 |
5378-5390 |
VB |
denotes |
recapitulate |
| T2914 |
5391-5396 |
JJ |
denotes |
human |
| T2915 |
5397-5400 |
NN |
denotes |
NDI |
| T2916 |
5400-5402 |
, |
denotes |
, |
| T2917 |
5402-5406 |
NNS |
denotes |
mice |
| T2918 |
5407-5411 |
VBP |
denotes |
have |
| T2919 |
5412-5416 |
VBN |
denotes |
been |
| T2909 |
5417-5426 |
VBN |
denotes |
generated |
| T2920 |
5427-5431 |
IN |
denotes |
with |
| T2921 |
5432-5441 |
NNS |
denotes |
mutations |
| T2922 |
5442-5444 |
IN |
denotes |
in |
| T2923 |
5445-5449 |
NN |
denotes |
Aqp2 |
| T2924 |
5450-5453 |
CC |
denotes |
and |
| T2925 |
5454-5459 |
NN |
denotes |
Avpr2 |
| T2926 |
5460-5461 |
-LRB- |
denotes |
[ |
| T2928 |
5461-5463 |
CD |
denotes |
15 |
| T2929 |
5463-5464 |
, |
denotes |
, |
| T2927 |
5464-5466 |
CD |
denotes |
18 |
| T2930 |
5466-5467 |
-RRB- |
denotes |
] |
| T2931 |
5467-5468 |
. |
denotes |
. |
| T2932 |
5468-5553 |
sentence |
denotes |
Yang and colleagues created a mouse with a T126M knock-in mutation in the Aqp2 gene. |
| T2933 |
5469-5473 |
NNP |
denotes |
Yang |
| T2935 |
5474-5477 |
CC |
denotes |
and |
| T2936 |
5478-5488 |
NNS |
denotes |
colleagues |
| T2934 |
5489-5496 |
VBD |
denotes |
created |
| T2937 |
5497-5498 |
DT |
denotes |
a |
| T2938 |
5499-5504 |
NN |
denotes |
mouse |
| T2939 |
5505-5509 |
IN |
denotes |
with |
| T2940 |
5510-5511 |
DT |
denotes |
a |
| T2942 |
5512-5517 |
NN |
denotes |
T126M |
| T2943 |
5518-5523 |
VB |
denotes |
knock |
| T2944 |
5523-5524 |
HYPH |
denotes |
- |
| T2945 |
5524-5526 |
RP |
denotes |
in |
| T2941 |
5527-5535 |
NN |
denotes |
mutation |
| T2946 |
5536-5538 |
IN |
denotes |
in |
| T2947 |
5539-5542 |
DT |
denotes |
the |
| T2949 |
5543-5547 |
NN |
denotes |
Aqp2 |
| T2948 |
5548-5552 |
NN |
denotes |
gene |
| T2950 |
5552-5553 |
. |
denotes |
. |
| T2951 |
5553-5619 |
sentence |
denotes |
Unexpectedly, homozygous mutant mice died within 6 d after birth. |
| T2952 |
5554-5566 |
RB |
denotes |
Unexpectedly |
| T2954 |
5566-5568 |
, |
denotes |
, |
| T2955 |
5568-5578 |
JJ |
denotes |
homozygous |
| T2957 |
5579-5585 |
NN |
denotes |
mutant |
| T2956 |
5586-5590 |
NNS |
denotes |
mice |
| T2953 |
5591-5595 |
VBD |
denotes |
died |
| T2958 |
5596-5602 |
IN |
denotes |
within |
| T2959 |
5603-5604 |
CD |
denotes |
6 |
| T2960 |
5605-5606 |
NNS |
denotes |
d |
| T2961 |
5607-5612 |
IN |
denotes |
after |
| T2962 |
5613-5618 |
NN |
denotes |
birth |
| T2963 |
5618-5619 |
. |
denotes |
. |
| T2964 |
5619-5704 |
sentence |
denotes |
Interestingly, AVPR2-deficient male pups also die within the first week after birth. |
| T2965 |
5620-5633 |
RB |
denotes |
Interestingly |
| T2967 |
5633-5635 |
, |
denotes |
, |
| T2968 |
5635-5640 |
NN |
denotes |
AVPR2 |
| T2970 |
5640-5641 |
HYPH |
denotes |
- |
| T2969 |
5641-5650 |
JJ |
denotes |
deficient |
| T2972 |
5651-5655 |
JJ |
denotes |
male |
| T2971 |
5656-5660 |
NNS |
denotes |
pups |
| T2973 |
5661-5665 |
RB |
denotes |
also |
| T2966 |
5666-5669 |
VBP |
denotes |
die |
| T2974 |
5670-5676 |
IN |
denotes |
within |
| T2975 |
5677-5680 |
DT |
denotes |
the |
| T2977 |
5681-5686 |
JJ |
denotes |
first |
| T2976 |
5687-5691 |
NN |
denotes |
week |
| T2978 |
5692-5697 |
IN |
denotes |
after |
| T2979 |
5698-5703 |
NN |
denotes |
birth |
| T2980 |
5703-5704 |
. |
denotes |
. |
| T2981 |
5704-5858 |
sentence |
denotes |
Together these models suggest that the mouse may be a highly sensitive organism with regard to water homeostasis, and is unable to survive with polyuria. |
| T2982 |
5705-5713 |
RB |
denotes |
Together |
| T2984 |
5714-5719 |
DT |
denotes |
these |
| T2985 |
5720-5726 |
NNS |
denotes |
models |
| T2983 |
5727-5734 |
VBP |
denotes |
suggest |
| T2986 |
5735-5739 |
IN |
denotes |
that |
| T2988 |
5740-5743 |
DT |
denotes |
the |
| T2989 |
5744-5749 |
NN |
denotes |
mouse |
| T2990 |
5750-5753 |
MD |
denotes |
may |
| T2987 |
5754-5756 |
VB |
denotes |
be |
| T2991 |
5757-5758 |
DT |
denotes |
a |
| T2993 |
5759-5765 |
RB |
denotes |
highly |
| T2994 |
5766-5775 |
JJ |
denotes |
sensitive |
| T2992 |
5776-5784 |
NN |
denotes |
organism |
| T2995 |
5785-5789 |
IN |
denotes |
with |
| T2996 |
5790-5796 |
NN |
denotes |
regard |
| T2997 |
5797-5799 |
IN |
denotes |
to |
| T2998 |
5800-5805 |
NN |
denotes |
water |
| T2999 |
5806-5817 |
NN |
denotes |
homeostasis |
| T3000 |
5817-5819 |
, |
denotes |
, |
| T3001 |
5819-5822 |
CC |
denotes |
and |
| T3002 |
5823-5825 |
VBZ |
denotes |
is |
| T3003 |
5826-5832 |
JJ |
denotes |
unable |
| T3004 |
5833-5835 |
TO |
denotes |
to |
| T3005 |
5836-5843 |
VB |
denotes |
survive |
| T3006 |
5844-5848 |
IN |
denotes |
with |
| T3007 |
5849-5857 |
NN |
denotes |
polyuria |
| T3008 |
5857-5858 |
. |
denotes |
. |
| T3009 |
5858-5933 |
sentence |
denotes |
In a forward genetic screen, a mouse with an Aqp2 mutation was identified. |
| T3010 |
5859-5861 |
IN |
denotes |
In |
| T3012 |
5862-5863 |
DT |
denotes |
a |
| T3014 |
5864-5871 |
RB |
denotes |
forward |
| T3015 |
5872-5879 |
JJ |
denotes |
genetic |
| T3013 |
5880-5886 |
NN |
denotes |
screen |
| T3016 |
5886-5888 |
, |
denotes |
, |
| T3017 |
5888-5889 |
DT |
denotes |
a |
| T3018 |
5890-5895 |
NN |
denotes |
mouse |
| T3019 |
5896-5900 |
IN |
denotes |
with |
| T3020 |
5901-5903 |
DT |
denotes |
an |
| T3022 |
5904-5908 |
NN |
denotes |
Aqp2 |
| T3021 |
5909-5917 |
NN |
denotes |
mutation |
| T3023 |
5918-5921 |
VBD |
denotes |
was |
| T3011 |
5922-5932 |
VBN |
denotes |
identified |
| T3024 |
5932-5933 |
. |
denotes |
. |
| T3025 |
5933-6026 |
sentence |
denotes |
The purpose of this study was to characterize this murine model of recessive nephrogenic DI. |
| T3026 |
5934-5937 |
DT |
denotes |
The |
| T3027 |
5938-5945 |
NN |
denotes |
purpose |
| T3029 |
5946-5948 |
IN |
denotes |
of |
| T3030 |
5949-5953 |
DT |
denotes |
this |
| T3031 |
5954-5959 |
NN |
denotes |
study |
| T3028 |
5960-5963 |
VBD |
denotes |
was |
| T3032 |
5964-5966 |
TO |
denotes |
to |
| T3033 |
5967-5979 |
VB |
denotes |
characterize |
| T3034 |
5980-5984 |
DT |
denotes |
this |
| T3036 |
5985-5991 |
JJ |
denotes |
murine |
| T3035 |
5992-5997 |
NN |
denotes |
model |
| T3037 |
5998-6000 |
IN |
denotes |
of |
| T3038 |
6001-6010 |
JJ |
denotes |
recessive |
| T3040 |
6011-6022 |
JJ |
denotes |
nephrogenic |
| T3039 |
6023-6025 |
NN |
denotes |
DI |
| T3041 |
6025-6026 |
. |
denotes |
. |
| T3042 |
6026-6081 |
sentence |
denotes |
We now report a novel F204V mutation in the Aqp2 gene. |
| T3043 |
6027-6029 |
PRP |
denotes |
We |
| T3045 |
6030-6033 |
RB |
denotes |
now |
| T3044 |
6034-6040 |
VBP |
denotes |
report |
| T3046 |
6041-6042 |
DT |
denotes |
a |
| T3048 |
6043-6048 |
JJ |
denotes |
novel |
| T3049 |
6049-6054 |
NN |
denotes |
F204V |
| T3047 |
6055-6063 |
NN |
denotes |
mutation |
| T3050 |
6064-6066 |
IN |
denotes |
in |
| T3051 |
6067-6070 |
DT |
denotes |
the |
| T3053 |
6071-6075 |
NN |
denotes |
Aqp2 |
| T3052 |
6076-6080 |
NN |
denotes |
gene |
| T3054 |
6080-6081 |
. |
denotes |
. |
| T3055 |
6081-6189 |
sentence |
denotes |
This allele of Aqp2 was found to cause the first mouse model of NDI to survive past the first week of life. |
| T3056 |
6082-6086 |
DT |
denotes |
This |
| T3057 |
6087-6093 |
NN |
denotes |
allele |
| T3059 |
6094-6096 |
IN |
denotes |
of |
| T3060 |
6097-6101 |
NN |
denotes |
Aqp2 |
| T3061 |
6102-6105 |
VBD |
denotes |
was |
| T3058 |
6106-6111 |
VBN |
denotes |
found |
| T3062 |
6112-6114 |
TO |
denotes |
to |
| T3063 |
6115-6120 |
VB |
denotes |
cause |
| T3064 |
6121-6124 |
DT |
denotes |
the |
| T3066 |
6125-6130 |
JJ |
denotes |
first |
| T3067 |
6131-6136 |
NN |
denotes |
mouse |
| T3065 |
6137-6142 |
NN |
denotes |
model |
| T3069 |
6143-6145 |
IN |
denotes |
of |
| T3070 |
6146-6149 |
NN |
denotes |
NDI |
| T3071 |
6150-6152 |
TO |
denotes |
to |
| T3068 |
6153-6160 |
VB |
denotes |
survive |
| T3072 |
6161-6165 |
IN |
denotes |
past |
| T3073 |
6166-6169 |
DT |
denotes |
the |
| T3075 |
6170-6175 |
JJ |
denotes |
first |
| T3074 |
6176-6180 |
NN |
denotes |
week |
| T3076 |
6181-6183 |
IN |
denotes |
of |
| T3077 |
6184-6188 |
NN |
denotes |
life |
| T3078 |
6188-6189 |
. |
denotes |
. |
| T3079 |
6189-6390 |
sentence |
denotes |
Molecular analyses concluded that mutant AQP2 adopts a different subcellular localization in renal collecting-duct cells, and was resistant to translocation induced by desmopressin, an agonist of AVP. |
| T3080 |
6190-6199 |
JJ |
denotes |
Molecular |
| T3081 |
6200-6208 |
NNS |
denotes |
analyses |
| T3082 |
6209-6218 |
VBD |
denotes |
concluded |
| T3083 |
6219-6223 |
IN |
denotes |
that |
| T3085 |
6224-6230 |
NN |
denotes |
mutant |
| T3086 |
6231-6235 |
NN |
denotes |
AQP2 |
| T3084 |
6236-6242 |
VBZ |
denotes |
adopts |
| T3087 |
6243-6244 |
DT |
denotes |
a |
| T3089 |
6245-6254 |
JJ |
denotes |
different |
| T3090 |
6255-6266 |
JJ |
denotes |
subcellular |
| T3088 |
6267-6279 |
NN |
denotes |
localization |
| T3091 |
6280-6282 |
IN |
denotes |
in |
| T3092 |
6283-6288 |
JJ |
denotes |
renal |
| T3094 |
6289-6299 |
VBG |
denotes |
collecting |
| T3096 |
6299-6300 |
HYPH |
denotes |
- |
| T3095 |
6300-6304 |
NN |
denotes |
duct |
| T3093 |
6305-6310 |
NNS |
denotes |
cells |
| T3097 |
6310-6312 |
, |
denotes |
, |
| T3098 |
6312-6315 |
CC |
denotes |
and |
| T3099 |
6316-6319 |
VBD |
denotes |
was |
| T3100 |
6320-6329 |
JJ |
denotes |
resistant |
| T3101 |
6330-6332 |
IN |
denotes |
to |
| T3102 |
6333-6346 |
NN |
denotes |
translocation |
| T3103 |
6347-6354 |
VBN |
denotes |
induced |
| T3104 |
6355-6357 |
IN |
denotes |
by |
| T3105 |
6358-6370 |
NN |
denotes |
desmopressin |
| T3106 |
6370-6372 |
, |
denotes |
, |
| T3107 |
6372-6374 |
DT |
denotes |
an |
| T3108 |
6375-6382 |
NN |
denotes |
agonist |
| T3109 |
6383-6385 |
IN |
denotes |
of |
| T3110 |
6386-6389 |
NN |
denotes |
AVP |
| T3111 |
6389-6390 |
. |
denotes |
. |
| T3112 |
6390-6572 |
sentence |
denotes |
In vitro studies using the Madin-Darby canine kidney (MDCK) cell line demonstrated an endoplasmic reticulum pattern for the mutant protein, and apparent resistance to translocation. |
| T3113 |
6391-6393 |
FW |
denotes |
In |
| T3114 |
6394-6399 |
FW |
denotes |
vitro |
| T3115 |
6400-6407 |
NNS |
denotes |
studies |
| T3117 |
6408-6413 |
VBG |
denotes |
using |
| T3118 |
6414-6417 |
DT |
denotes |
the |
| T3120 |
6418-6423 |
NN |
denotes |
Madin |
| T3122 |
6423-6424 |
HYPH |
denotes |
- |
| T3121 |
6424-6429 |
NN |
denotes |
Darby |
| T3124 |
6430-6436 |
JJ |
denotes |
canine |
| T3123 |
6437-6443 |
NN |
denotes |
kidney |
| T3125 |
6444-6445 |
-LRB- |
denotes |
( |
| T3126 |
6445-6449 |
NN |
denotes |
MDCK |
| T3127 |
6449-6450 |
-RRB- |
denotes |
) |
| T3128 |
6451-6455 |
NN |
denotes |
cell |
| T3119 |
6456-6460 |
NN |
denotes |
line |
| T3116 |
6461-6473 |
VBD |
denotes |
demonstrated |
| T3129 |
6474-6476 |
DT |
denotes |
an |
| T3131 |
6477-6488 |
JJ |
denotes |
endoplasmic |
| T3132 |
6489-6498 |
NN |
denotes |
reticulum |
| T3130 |
6499-6506 |
NN |
denotes |
pattern |
| T3133 |
6507-6510 |
IN |
denotes |
for |
| T3134 |
6511-6514 |
DT |
denotes |
the |
| T3136 |
6515-6521 |
NN |
denotes |
mutant |
| T3135 |
6522-6529 |
NN |
denotes |
protein |
| T3137 |
6529-6531 |
, |
denotes |
, |
| T3138 |
6531-6534 |
CC |
denotes |
and |
| T3139 |
6535-6543 |
JJ |
denotes |
apparent |
| T3140 |
6544-6554 |
NN |
denotes |
resistance |
| T3141 |
6555-6557 |
IN |
denotes |
to |
| T3142 |
6558-6571 |
NN |
denotes |
translocation |
| T3143 |
6571-6572 |
. |
denotes |
. |
| T3144 |
6572-6695 |
sentence |
denotes |
These data conclusively prove that autosomal recessive NDI is a consequence of improper AQP2 routing in the intact mammal. |
| T3145 |
6573-6578 |
DT |
denotes |
These |
| T3146 |
6579-6583 |
NNS |
denotes |
data |
| T3148 |
6584-6596 |
RB |
denotes |
conclusively |
| T3147 |
6597-6602 |
VBP |
denotes |
prove |
| T3149 |
6603-6607 |
IN |
denotes |
that |
| T3151 |
6608-6617 |
JJ |
denotes |
autosomal |
| T3153 |
6618-6627 |
JJ |
denotes |
recessive |
| T3152 |
6628-6631 |
NN |
denotes |
NDI |
| T3150 |
6632-6634 |
VBZ |
denotes |
is |
| T3154 |
6635-6636 |
DT |
denotes |
a |
| T3155 |
6637-6648 |
NN |
denotes |
consequence |
| T3156 |
6649-6651 |
IN |
denotes |
of |
| T3157 |
6652-6660 |
JJ |
denotes |
improper |
| T3159 |
6661-6665 |
NN |
denotes |
AQP2 |
| T3158 |
6666-6673 |
NN |
denotes |
routing |
| T3160 |
6674-6676 |
IN |
denotes |
in |
| T3161 |
6677-6680 |
DT |
denotes |
the |
| T3163 |
6681-6687 |
JJ |
denotes |
intact |
| T3162 |
6688-6694 |
NN |
denotes |
mammal |
| T3164 |
6694-6695 |
. |
denotes |
. |
| T8951 |
6705-6707 |
IN |
denotes |
In |
| T8953 |
6708-6709 |
DT |
denotes |
a |
| T8955 |
6710-6717 |
JJ |
denotes |
forward |
| T8956 |
6718-6725 |
JJ |
denotes |
genetic |
| T8954 |
6726-6732 |
NN |
denotes |
screen |
| T8957 |
6733-6737 |
WDT |
denotes |
that |
| T8958 |
6738-6742 |
VBD |
denotes |
used |
| T8959 |
6743-6759 |
NN |
denotes |
ethylnitrosourea |
| T8960 |
6760-6761 |
-LRB- |
denotes |
( |
| T8961 |
6761-6764 |
NN |
denotes |
ENU |
| T8962 |
6764-6765 |
-RRB- |
denotes |
) |
| T8963 |
6766-6768 |
TO |
denotes |
to |
| T8964 |
6769-6775 |
VB |
denotes |
induce |
| T8965 |
6776-6785 |
NNS |
denotes |
mutations |
| T8966 |
6786-6788 |
IN |
denotes |
in |
| T8967 |
6789-6790 |
DT |
denotes |
a |
| T8969 |
6791-6798 |
NN |
denotes |
founder |
| T8968 |
6799-6805 |
NN |
denotes |
animal |
| T8970 |
6806-6811 |
WP$ |
denotes |
whose |
| T8971 |
6812-6821 |
NN |
denotes |
offspring |
| T8973 |
6822-6826 |
VBD |
denotes |
were |
| T8974 |
6827-6831 |
RB |
denotes |
then |
| T8972 |
6832-6840 |
VBN |
denotes |
screened |
| T8975 |
6841-6844 |
IN |
denotes |
for |
| T8976 |
6845-6853 |
JJ |
denotes |
abnormal |
| T8978 |
6854-6859 |
JJ |
denotes |
whole |
| T8979 |
6860-6864 |
NN |
denotes |
body |
| T8977 |
6865-6875 |
NN |
denotes |
metabolism |
| T8980 |
6876-6877 |
-LRB- |
denotes |
[ |
| T8982 |
6877-6879 |
CD |
denotes |
19 |
| T8983 |
6879-6880 |
, |
denotes |
, |
| T8981 |
6880-6882 |
CD |
denotes |
20 |
| T8984 |
6882-6883 |
-RRB- |
denotes |
] |
| T8985 |
6883-6885 |
, |
denotes |
, |
| T8986 |
6885-6887 |
PRP |
denotes |
we |
| T8952 |
6888-6893 |
VBD |
denotes |
found |
| T8987 |
6894-6895 |
DT |
denotes |
a |
| T8988 |
6896-6902 |
NN |
denotes |
family |
| T8989 |
6903-6905 |
IN |
denotes |
of |
| T8990 |
6906-6910 |
NNS |
denotes |
mice |
| T8991 |
6911-6915 |
WDT |
denotes |
that |
| T8992 |
6916-6924 |
VBD |
denotes |
urinated |
| T8993 |
6925-6928 |
CC |
denotes |
and |
| T8994 |
6929-6934 |
VBD |
denotes |
drank |
| T8995 |
6935-6946 |
RB |
denotes |
excessively |
| T8996 |
6946-6947 |
. |
denotes |
. |
| T8997 |
6947-7076 |
sentence |
denotes |
Serum and urine analysis showed that plasma glucose levels were normal and there was no glucose in the urine (unpublished data). |
| T8998 |
6948-6953 |
NN |
denotes |
Serum |
| T9000 |
6954-6957 |
CC |
denotes |
and |
| T9001 |
6958-6963 |
NN |
denotes |
urine |
| T8999 |
6964-6972 |
NN |
denotes |
analysis |
| T9002 |
6973-6979 |
VBD |
denotes |
showed |
| T9003 |
6980-6984 |
IN |
denotes |
that |
| T9005 |
6985-6991 |
NN |
denotes |
plasma |
| T9007 |
6992-6999 |
NN |
denotes |
glucose |
| T9006 |
7000-7006 |
NNS |
denotes |
levels |
| T9004 |
7007-7011 |
VBD |
denotes |
were |
| T9008 |
7012-7018 |
JJ |
denotes |
normal |
| T9009 |
7019-7022 |
CC |
denotes |
and |
| T9010 |
7023-7028 |
EX |
denotes |
there |
| T9011 |
7029-7032 |
VBD |
denotes |
was |
| T9012 |
7033-7035 |
DT |
denotes |
no |
| T9013 |
7036-7043 |
NN |
denotes |
glucose |
| T9014 |
7044-7046 |
IN |
denotes |
in |
| T9015 |
7047-7050 |
DT |
denotes |
the |
| T9016 |
7051-7056 |
NN |
denotes |
urine |
| T9017 |
7057-7058 |
-LRB- |
denotes |
( |
| T9019 |
7058-7069 |
JJ |
denotes |
unpublished |
| T9018 |
7070-7074 |
NNS |
denotes |
data |
| T9020 |
7074-7075 |
-RRB- |
denotes |
) |
| T9021 |
7075-7076 |
. |
denotes |
. |
| T9022 |
7076-7126 |
sentence |
denotes |
Hence, this was an example of diabetes insipidus. |
| T9023 |
7077-7082 |
RB |
denotes |
Hence |
| T9025 |
7082-7084 |
, |
denotes |
, |
| T9026 |
7084-7088 |
DT |
denotes |
this |
| T9024 |
7089-7092 |
VBD |
denotes |
was |
| T9027 |
7093-7095 |
DT |
denotes |
an |
| T9028 |
7096-7103 |
NN |
denotes |
example |
| T9029 |
7104-7106 |
IN |
denotes |
of |
| T9030 |
7107-7115 |
NN |
denotes |
diabetes |
| T9031 |
7116-7125 |
NN |
denotes |
insipidus |
| T9032 |
7125-7126 |
. |
denotes |
. |
| T9033 |
7126-7238 |
sentence |
denotes |
The disorder in these mice segregated in a monogenic, autosomal recessive manner, making Aqp2 a candidate gene. |
| T9034 |
7127-7130 |
DT |
denotes |
The |
| T9035 |
7131-7139 |
NN |
denotes |
disorder |
| T9037 |
7140-7142 |
IN |
denotes |
in |
| T9038 |
7143-7148 |
DT |
denotes |
these |
| T9039 |
7149-7153 |
NNS |
denotes |
mice |
| T9036 |
7154-7164 |
VBD |
denotes |
segregated |
| T9040 |
7165-7167 |
IN |
denotes |
in |
| T9041 |
7168-7169 |
DT |
denotes |
a |
| T9043 |
7170-7179 |
JJ |
denotes |
monogenic |
| T9044 |
7179-7181 |
, |
denotes |
, |
| T9045 |
7181-7190 |
JJ |
denotes |
autosomal |
| T9046 |
7191-7200 |
JJ |
denotes |
recessive |
| T9042 |
7201-7207 |
NN |
denotes |
manner |
| T9047 |
7207-7209 |
, |
denotes |
, |
| T9048 |
7209-7215 |
VBG |
denotes |
making |
| T9049 |
7216-7220 |
NN |
denotes |
Aqp2 |
| T9051 |
7221-7222 |
DT |
denotes |
a |
| T9052 |
7223-7232 |
NN |
denotes |
candidate |
| T9050 |
7233-7237 |
NN |
denotes |
gene |
| T9053 |
7237-7238 |
. |
denotes |
. |
| T9054 |
7238-7467 |
sentence |
denotes |
Sequencing of Aqp2 coding region of affected mice identified a thymine to guanine (T to G) transversion (Figure 1A), which is predicted to lead to a valine for phenylalanine substitution at amino acid 204 of the protein (F204V). |
| T9055 |
7239-7249 |
NN |
denotes |
Sequencing |
| T9057 |
7250-7252 |
IN |
denotes |
of |
| T9058 |
7253-7257 |
NN |
denotes |
Aqp2 |
| T9060 |
7258-7264 |
NN |
denotes |
coding |
| T9059 |
7265-7271 |
NN |
denotes |
region |
| T9061 |
7272-7274 |
IN |
denotes |
of |
| T9062 |
7275-7283 |
VBN |
denotes |
affected |
| T9063 |
7284-7288 |
NNS |
denotes |
mice |
| T9056 |
7289-7299 |
VBD |
denotes |
identified |
| T9064 |
7300-7301 |
DT |
denotes |
a |
| T9066 |
7302-7309 |
NN |
denotes |
thymine |
| T9067 |
7310-7312 |
IN |
denotes |
to |
| T9068 |
7313-7320 |
NN |
denotes |
guanine |
| T9069 |
7321-7322 |
-LRB- |
denotes |
( |
| T9070 |
7322-7323 |
NN |
denotes |
T |
| T9071 |
7324-7326 |
IN |
denotes |
to |
| T9072 |
7327-7328 |
NN |
denotes |
G |
| T9073 |
7328-7329 |
-RRB- |
denotes |
) |
| T9065 |
7330-7342 |
NN |
denotes |
transversion |
| T9074 |
7343-7344 |
-LRB- |
denotes |
( |
| T9075 |
7344-7350 |
NN |
denotes |
Figure |
| T9076 |
7351-7353 |
CD |
denotes |
1A |
| T9077 |
7353-7354 |
-RRB- |
denotes |
) |
| T9078 |
7354-7356 |
, |
denotes |
, |
| T9079 |
7356-7361 |
WDT |
denotes |
which |
| T9081 |
7362-7364 |
VBZ |
denotes |
is |
| T9080 |
7365-7374 |
VBN |
denotes |
predicted |
| T9082 |
7375-7377 |
TO |
denotes |
to |
| T9083 |
7378-7382 |
VB |
denotes |
lead |
| T9084 |
7383-7385 |
IN |
denotes |
to |
| T9085 |
7386-7387 |
DT |
denotes |
a |
| T9087 |
7388-7394 |
NN |
denotes |
valine |
| T9088 |
7395-7398 |
IN |
denotes |
for |
| T9089 |
7399-7412 |
NN |
denotes |
phenylalanine |
| T9086 |
7413-7425 |
NN |
denotes |
substitution |
| T9090 |
7426-7428 |
IN |
denotes |
at |
| T9091 |
7429-7434 |
NN |
denotes |
amino |
| T9092 |
7435-7439 |
NN |
denotes |
acid |
| T9093 |
7440-7443 |
CD |
denotes |
204 |
| T9094 |
7444-7446 |
IN |
denotes |
of |
| T9095 |
7447-7450 |
DT |
denotes |
the |
| T9096 |
7451-7458 |
NN |
denotes |
protein |
| T9097 |
7459-7460 |
-LRB- |
denotes |
( |
| T9098 |
7460-7465 |
NN |
denotes |
F204V |
| T9099 |
7465-7466 |
-RRB- |
denotes |
) |
| T9100 |
7466-7467 |
. |
denotes |
. |
| T9101 |
7467-8657 |
sentence |
denotes |
Figure 1 Analysis of Aqp2 Sequence and Phenotype in Mutant Mice
(A) Chromatographic traces of Aqp2 F204V mutation. The box shows the mutated codon, TTC (Phe) to GTC (Val) at position 204.
WT, wild type; Mut, mutant.
(B) Amino acid conservation of mouse AQP2 (residues 194–214). The boxed residue indicates phenylalanine at position 204.
hAQP2, human AQP2; mAQP1, mouse AQP1; mAQP2, mouse AQP2; rAQP2, rat AQP2; xAQP2, Xenopus AQP2.
(C) Urine production (ml) and water consumption (ml) of 58 F2 mice over a 24-h period (both sexes, aged 10–22 wk). Mutant mice (black squares) exhibit overt polyuria and polydipsia compared to littermate wild-type (white triangles) and heterozygous (grey circles) mice.
(D) Urine osmolality and concentrating ability in Aqp2 mutant and their littermates (10–22 wk, both sexes), before (white bars) and after (black bars) dDAVP treatment. Wild type (WT; n = 12); heterozygote (Het; n = 20); mutant (Mut; n = 9). Data represent averages ± standard error of the mean, **p < 0.01; ***p < 0.001. AQP2 is a six-transmembrane water channel, and F204 lies near the extracellular face of the sixth membrane spanning domain, a region rich in hydrophobic amino acids. |
| T9102 |
8492-8496 |
NN |
denotes |
AQP2 |
| T9103 |
8497-8499 |
VBZ |
denotes |
is |
| T9104 |
8500-8501 |
DT |
denotes |
a |
| T9106 |
8502-8505 |
CD |
denotes |
six |
| T9108 |
8505-8506 |
HYPH |
denotes |
- |
| T9107 |
8506-8519 |
NN |
denotes |
transmembrane |
| T9109 |
8520-8525 |
NN |
denotes |
water |
| T9105 |
8526-8533 |
NN |
denotes |
channel |
| T9110 |
8533-8535 |
, |
denotes |
, |
| T9111 |
8535-8538 |
CC |
denotes |
and |
| T9112 |
8539-8543 |
NN |
denotes |
F204 |
| T9113 |
8544-8548 |
VBZ |
denotes |
lies |
| T9114 |
8549-8553 |
IN |
denotes |
near |
| T9115 |
8554-8557 |
DT |
denotes |
the |
| T9117 |
8558-8571 |
JJ |
denotes |
extracellular |
| T9116 |
8572-8576 |
NN |
denotes |
face |
| T9118 |
8577-8579 |
IN |
denotes |
of |
| T9119 |
8580-8583 |
DT |
denotes |
the |
| T9121 |
8584-8589 |
JJ |
denotes |
sixth |
| T9122 |
8590-8598 |
NN |
denotes |
membrane |
| T9123 |
8599-8607 |
VBG |
denotes |
spanning |
| T9120 |
8608-8614 |
NN |
denotes |
domain |
| T9124 |
8614-8616 |
, |
denotes |
, |
| T9125 |
8616-8617 |
DT |
denotes |
a |
| T9126 |
8618-8624 |
NN |
denotes |
region |
| T9127 |
8625-8629 |
JJ |
denotes |
rich |
| T9128 |
8630-8632 |
IN |
denotes |
in |
| T9129 |
8633-8644 |
JJ |
denotes |
hydrophobic |
| T9131 |
8645-8650 |
NN |
denotes |
amino |
| T9130 |
8651-8656 |
NNS |
denotes |
acids |
| T9132 |
8656-8657 |
. |
denotes |
. |
| T9133 |
8657-8742 |
sentence |
denotes |
This and the other membrane-spanning domains are conserved among vertebrate species. |
| T9134 |
8658-8662 |
DT |
denotes |
This |
| T9136 |
8663-8666 |
CC |
denotes |
and |
| T9137 |
8667-8670 |
DT |
denotes |
the |
| T9138 |
8671-8676 |
JJ |
denotes |
other |
| T9140 |
8677-8685 |
NN |
denotes |
membrane |
| T9142 |
8685-8686 |
HYPH |
denotes |
- |
| T9141 |
8686-8694 |
VBG |
denotes |
spanning |
| T9139 |
8695-8702 |
NNS |
denotes |
domains |
| T9143 |
8703-8706 |
VBP |
denotes |
are |
| T9135 |
8707-8716 |
VBN |
denotes |
conserved |
| T9144 |
8717-8722 |
IN |
denotes |
among |
| T9145 |
8723-8733 |
JJ |
denotes |
vertebrate |
| T9146 |
8734-8741 |
NNS |
denotes |
species |
| T9147 |
8741-8742 |
. |
denotes |
. |
| T9148 |
8742-8907 |
sentence |
denotes |
The phenylalanine at position 204 is particularly well conserved (Figure 1B), not only among vertebrate AQP2 proteins, but also among others members of this family. |
| T9149 |
8743-8746 |
DT |
denotes |
The |
| T9150 |
8747-8760 |
NN |
denotes |
phenylalanine |
| T9152 |
8761-8763 |
IN |
denotes |
at |
| T9153 |
8764-8772 |
NN |
denotes |
position |
| T9154 |
8773-8776 |
CD |
denotes |
204 |
| T9151 |
8777-8779 |
VBZ |
denotes |
is |
| T9155 |
8780-8792 |
RB |
denotes |
particularly |
| T9157 |
8793-8797 |
RB |
denotes |
well |
| T9156 |
8798-8807 |
VBN |
denotes |
conserved |
| T9158 |
8808-8809 |
-LRB- |
denotes |
( |
| T9159 |
8809-8815 |
NN |
denotes |
Figure |
| T9160 |
8816-8818 |
CD |
denotes |
1B |
| T9161 |
8818-8819 |
-RRB- |
denotes |
) |
| T9162 |
8819-8821 |
, |
denotes |
, |
| T9163 |
8821-8824 |
RB |
denotes |
not |
| T9165 |
8825-8829 |
RB |
denotes |
only |
| T9164 |
8830-8835 |
IN |
denotes |
among |
| T9166 |
8836-8846 |
JJ |
denotes |
vertebrate |
| T9168 |
8847-8851 |
NN |
denotes |
AQP2 |
| T9167 |
8852-8860 |
NN |
denotes |
proteins |
| T9169 |
8860-8862 |
, |
denotes |
, |
| T9170 |
8862-8865 |
CC |
denotes |
but |
| T9171 |
8866-8870 |
RB |
denotes |
also |
| T9172 |
8871-8876 |
IN |
denotes |
among |
| T9173 |
8877-8883 |
NNS |
denotes |
others |
| T9174 |
8884-8891 |
NNS |
denotes |
members |
| T9175 |
8892-8894 |
IN |
denotes |
of |
| T9176 |
8895-8899 |
DT |
denotes |
this |
| T9177 |
8900-8906 |
NN |
denotes |
family |
| T9178 |
8906-8907 |
. |
denotes |
. |
| T9179 |
8907-9114 |
sentence |
denotes |
Aqp2F204V/F204V mice have dramatically increased urine production, in some cases producing an amount of urine in 24 h that exceeds their body weight, compared to their heterozygous or wild-type littermates. |
| T9180 |
8908-8917 |
NN |
denotes |
Aqp2F204V |
| T9182 |
8917-8918 |
HYPH |
denotes |
/ |
| T9181 |
8918-8923 |
NN |
denotes |
F204V |
| T9183 |
8924-8928 |
NNS |
denotes |
mice |
| T9184 |
8929-8933 |
VBP |
denotes |
have |
| T9185 |
8934-8946 |
RB |
denotes |
dramatically |
| T9186 |
8947-8956 |
VBN |
denotes |
increased |
| T9188 |
8957-8962 |
NN |
denotes |
urine |
| T9187 |
8963-8973 |
NN |
denotes |
production |
| T9189 |
8973-8975 |
, |
denotes |
, |
| T9190 |
8975-8977 |
IN |
denotes |
in |
| T9192 |
8978-8982 |
DT |
denotes |
some |
| T9193 |
8983-8988 |
NNS |
denotes |
cases |
| T9191 |
8989-8998 |
VBG |
denotes |
producing |
| T9194 |
8999-9001 |
DT |
denotes |
an |
| T9195 |
9002-9008 |
NN |
denotes |
amount |
| T9196 |
9009-9011 |
IN |
denotes |
of |
| T9197 |
9012-9017 |
NN |
denotes |
urine |
| T9198 |
9018-9020 |
IN |
denotes |
in |
| T9199 |
9021-9023 |
CD |
denotes |
24 |
| T9200 |
9024-9025 |
NN |
denotes |
h |
| T9201 |
9026-9030 |
WDT |
denotes |
that |
| T9202 |
9031-9038 |
VBZ |
denotes |
exceeds |
| T9203 |
9039-9044 |
PRP$ |
denotes |
their |
| T9205 |
9045-9049 |
NN |
denotes |
body |
| T9204 |
9050-9056 |
NN |
denotes |
weight |
| T9206 |
9056-9058 |
, |
denotes |
, |
| T9207 |
9058-9066 |
VBN |
denotes |
compared |
| T9208 |
9067-9069 |
IN |
denotes |
to |
| T9209 |
9070-9075 |
PRP$ |
denotes |
their |
| T9211 |
9076-9088 |
JJ |
denotes |
heterozygous |
| T9212 |
9089-9091 |
CC |
denotes |
or |
| T9213 |
9092-9096 |
JJ |
denotes |
wild |
| T9215 |
9096-9097 |
HYPH |
denotes |
- |
| T9214 |
9097-9101 |
NN |
denotes |
type |
| T9210 |
9102-9113 |
NNS |
denotes |
littermates |
| T9216 |
9113-9114 |
. |
denotes |
. |
| T9217 |
9114-9218 |
sentence |
denotes |
Such loss of water would rapidly lead to dehydration were it not compensated by increased water intake. |
| T9218 |
9115-9119 |
JJ |
denotes |
Such |
| T9219 |
9120-9124 |
NN |
denotes |
loss |
| T9221 |
9125-9127 |
IN |
denotes |
of |
| T9222 |
9128-9133 |
NN |
denotes |
water |
| T9223 |
9134-9139 |
MD |
denotes |
would |
| T9224 |
9140-9147 |
RB |
denotes |
rapidly |
| T9220 |
9148-9152 |
VB |
denotes |
lead |
| T9225 |
9153-9155 |
IN |
denotes |
to |
| T9226 |
9156-9167 |
NN |
denotes |
dehydration |
| T9227 |
9168-9172 |
VBD |
denotes |
were |
| T9229 |
9173-9175 |
PRP |
denotes |
it |
| T9230 |
9176-9179 |
RB |
denotes |
not |
| T9228 |
9180-9191 |
VBN |
denotes |
compensated |
| T9231 |
9192-9194 |
IN |
denotes |
by |
| T9232 |
9195-9204 |
VBN |
denotes |
increased |
| T9234 |
9205-9210 |
NN |
denotes |
water |
| T9233 |
9211-9217 |
NN |
denotes |
intake |
| T9235 |
9217-9218 |
. |
denotes |
. |
| T9236 |
9218-9353 |
sentence |
denotes |
Indeed, mutant mice also dramatically increase their water intake (Figure 1C) compared to their heterozygous or wild-type littermates. |
| T9237 |
9219-9225 |
RB |
denotes |
Indeed |
| T9239 |
9225-9227 |
, |
denotes |
, |
| T9240 |
9227-9233 |
NN |
denotes |
mutant |
| T9241 |
9234-9238 |
NNS |
denotes |
mice |
| T9242 |
9239-9243 |
RB |
denotes |
also |
| T9243 |
9244-9256 |
RB |
denotes |
dramatically |
| T9238 |
9257-9265 |
VB |
denotes |
increase |
| T9244 |
9266-9271 |
PRP$ |
denotes |
their |
| T9246 |
9272-9277 |
NN |
denotes |
water |
| T9245 |
9278-9284 |
NN |
denotes |
intake |
| T9247 |
9285-9286 |
-LRB- |
denotes |
( |
| T9248 |
9286-9292 |
NN |
denotes |
Figure |
| T9249 |
9293-9295 |
CD |
denotes |
1C |
| T9250 |
9295-9296 |
-RRB- |
denotes |
) |
| T9251 |
9297-9305 |
VBN |
denotes |
compared |
| T9252 |
9306-9308 |
IN |
denotes |
to |
| T9253 |
9309-9314 |
PRP$ |
denotes |
their |
| T9255 |
9315-9327 |
JJ |
denotes |
heterozygous |
| T9256 |
9328-9330 |
CC |
denotes |
or |
| T9257 |
9331-9335 |
JJ |
denotes |
wild |
| T9259 |
9335-9336 |
HYPH |
denotes |
- |
| T9258 |
9336-9340 |
NN |
denotes |
type |
| T9254 |
9341-9352 |
NNS |
denotes |
littermates |
| T9260 |
9352-9353 |
. |
denotes |
. |
| T9261 |
9353-9504 |
sentence |
denotes |
This phenotype—increased urinary output and water intake—showed complete concordance with homozygosity of the F204V mutation in the 58 animals tested. |
| T9262 |
9354-9358 |
DT |
denotes |
This |
| T9263 |
9359-9368 |
NN |
denotes |
phenotype |
| T9265 |
9368-9369 |
, |
denotes |
— |
| T9266 |
9369-9378 |
VBN |
denotes |
increased |
| T9268 |
9379-9386 |
JJ |
denotes |
urinary |
| T9267 |
9387-9393 |
NN |
denotes |
output |
| T9269 |
9394-9397 |
CC |
denotes |
and |
| T9270 |
9398-9403 |
NN |
denotes |
water |
| T9271 |
9404-9410 |
NN |
denotes |
intake |
| T9272 |
9410-9411 |
, |
denotes |
— |
| T9264 |
9411-9417 |
VBD |
denotes |
showed |
| T9273 |
9418-9426 |
JJ |
denotes |
complete |
| T9274 |
9427-9438 |
NN |
denotes |
concordance |
| T9275 |
9439-9443 |
IN |
denotes |
with |
| T9276 |
9444-9456 |
NN |
denotes |
homozygosity |
| T9277 |
9457-9459 |
IN |
denotes |
of |
| T9278 |
9460-9463 |
DT |
denotes |
the |
| T9280 |
9464-9469 |
NN |
denotes |
F204V |
| T9279 |
9470-9478 |
NN |
denotes |
mutation |
| T9281 |
9479-9481 |
IN |
denotes |
in |
| T9282 |
9482-9485 |
DT |
denotes |
the |
| T9284 |
9486-9488 |
CD |
denotes |
58 |
| T9283 |
9489-9496 |
NNS |
denotes |
animals |
| T9285 |
9497-9503 |
VBN |
denotes |
tested |
| T9286 |
9503-9504 |
. |
denotes |
. |
| T9287 |
9504-9594 |
sentence |
denotes |
Diabetes insipidus can be defined as an inability to concentrate urine where appropriate. |
| T9288 |
9505-9513 |
NN |
denotes |
Diabetes |
| T9289 |
9514-9523 |
NN |
denotes |
insipidus |
| T9291 |
9524-9527 |
MD |
denotes |
can |
| T9292 |
9528-9530 |
VB |
denotes |
be |
| T9290 |
9531-9538 |
VBN |
denotes |
defined |
| T9293 |
9539-9541 |
IN |
denotes |
as |
| T9294 |
9542-9544 |
DT |
denotes |
an |
| T9295 |
9545-9554 |
NN |
denotes |
inability |
| T9296 |
9555-9557 |
TO |
denotes |
to |
| T9297 |
9558-9569 |
VB |
denotes |
concentrate |
| T9298 |
9570-9575 |
NN |
denotes |
urine |
| T9299 |
9576-9581 |
WRB |
denotes |
where |
| T9300 |
9582-9593 |
JJ |
denotes |
appropriate |
| T9301 |
9593-9594 |
. |
denotes |
. |
| T9302 |
9594-9705 |
sentence |
denotes |
Compared to wild-type or heterozygous littermates, Aqp2F204V/F204V mice produce very dilute urine (Figure 1D). |
| T9303 |
9595-9603 |
VBN |
denotes |
Compared |
| T9305 |
9604-9606 |
IN |
denotes |
to |
| T9306 |
9607-9611 |
JJ |
denotes |
wild |
| T9308 |
9611-9612 |
HYPH |
denotes |
- |
| T9307 |
9612-9616 |
NN |
denotes |
type |
| T9310 |
9617-9619 |
CC |
denotes |
or |
| T9311 |
9620-9632 |
JJ |
denotes |
heterozygous |
| T9309 |
9633-9644 |
NNS |
denotes |
littermates |
| T9312 |
9644-9646 |
, |
denotes |
, |
| T9313 |
9646-9655 |
NN |
denotes |
Aqp2F204V |
| T9315 |
9655-9656 |
HYPH |
denotes |
/ |
| T9314 |
9656-9661 |
NN |
denotes |
F204V |
| T9316 |
9662-9666 |
NNS |
denotes |
mice |
| T9304 |
9667-9674 |
VBP |
denotes |
produce |
| T9317 |
9675-9679 |
RB |
denotes |
very |
| T9318 |
9680-9686 |
JJ |
denotes |
dilute |
| T9319 |
9687-9692 |
NN |
denotes |
urine |
| T9320 |
9693-9694 |
-LRB- |
denotes |
( |
| T9321 |
9694-9700 |
NN |
denotes |
Figure |
| T9322 |
9701-9703 |
CD |
denotes |
1D |
| T9323 |
9703-9704 |
-RRB- |
denotes |
) |
| T9324 |
9704-9705 |
. |
denotes |
. |
| T9325 |
9705-9825 |
sentence |
denotes |
Basal urine concentration in mutant mice is about 161 mOsm, compared to about 1,293 mOsm in wild-type mice (p < 0.001). |
| T9326 |
9706-9711 |
JJ |
denotes |
Basal |
| T9328 |
9712-9717 |
NN |
denotes |
urine |
| T9327 |
9718-9731 |
NN |
denotes |
concentration |
| T9330 |
9732-9734 |
IN |
denotes |
in |
| T9331 |
9735-9741 |
NN |
denotes |
mutant |
| T9332 |
9742-9746 |
NNS |
denotes |
mice |
| T9329 |
9747-9749 |
VBZ |
denotes |
is |
| T9333 |
9750-9755 |
RB |
denotes |
about |
| T9334 |
9756-9759 |
CD |
denotes |
161 |
| T9335 |
9760-9764 |
NN |
denotes |
mOsm |
| T9336 |
9764-9766 |
, |
denotes |
, |
| T9337 |
9766-9774 |
VBN |
denotes |
compared |
| T9338 |
9775-9777 |
IN |
denotes |
to |
| T9339 |
9778-9783 |
IN |
denotes |
about |
| T9340 |
9784-9789 |
CD |
denotes |
1,293 |
| T9341 |
9790-9794 |
NN |
denotes |
mOsm |
| T9342 |
9795-9797 |
IN |
denotes |
in |
| T9343 |
9798-9802 |
JJ |
denotes |
wild |
| T9345 |
9802-9803 |
HYPH |
denotes |
- |
| T9344 |
9803-9807 |
NN |
denotes |
type |
| T9346 |
9808-9812 |
NNS |
denotes |
mice |
| T9347 |
9813-9814 |
-LRB- |
denotes |
( |
| T9349 |
9814-9815 |
NN |
denotes |
p |
| T9350 |
9816-9817 |
SYM |
denotes |
< |
| T9348 |
9818-9823 |
CD |
denotes |
0.001 |
| T9351 |
9823-9824 |
-RRB- |
denotes |
) |
| T9352 |
9824-9825 |
. |
denotes |
. |
| T9353 |
9825-9968 |
sentence |
denotes |
Normally, urine concentration is under the control of the hypothalamus, which, in response to hypovolemia or hypernatremia [21], secretes AVP. |
| T9354 |
9826-9834 |
RB |
denotes |
Normally |
| T9356 |
9834-9836 |
, |
denotes |
, |
| T9357 |
9836-9841 |
NN |
denotes |
urine |
| T9358 |
9842-9855 |
NN |
denotes |
concentration |
| T9355 |
9856-9858 |
VBZ |
denotes |
is |
| T9359 |
9859-9864 |
IN |
denotes |
under |
| T9360 |
9865-9868 |
DT |
denotes |
the |
| T9361 |
9869-9876 |
NN |
denotes |
control |
| T9362 |
9877-9879 |
IN |
denotes |
of |
| T9363 |
9880-9883 |
DT |
denotes |
the |
| T9364 |
9884-9896 |
NN |
denotes |
hypothalamus |
| T9365 |
9896-9898 |
, |
denotes |
, |
| T9366 |
9898-9903 |
WDT |
denotes |
which |
| T9368 |
9903-9905 |
, |
denotes |
, |
| T9369 |
9905-9907 |
IN |
denotes |
in |
| T9370 |
9908-9916 |
NN |
denotes |
response |
| T9371 |
9917-9919 |
IN |
denotes |
to |
| T9372 |
9920-9931 |
NN |
denotes |
hypovolemia |
| T9373 |
9932-9934 |
CC |
denotes |
or |
| T9374 |
9935-9948 |
NN |
denotes |
hypernatremia |
| T9375 |
9949-9950 |
-LRB- |
denotes |
[ |
| T9376 |
9950-9952 |
CD |
denotes |
21 |
| T9377 |
9952-9953 |
-RRB- |
denotes |
] |
| T9378 |
9953-9955 |
, |
denotes |
, |
| T9367 |
9955-9963 |
VBZ |
denotes |
secretes |
| T9379 |
9964-9967 |
NN |
denotes |
AVP |
| T9380 |
9967-9968 |
. |
denotes |
. |
| T9381 |
9968-10094 |
sentence |
denotes |
The synthetic AVP analog, 1-deamino-8-D-arginine vasopressin (dDAVP; also called desmopressin), is a potent agonist of AVPR2. |
| T9382 |
9969-9972 |
DT |
denotes |
The |
| T9384 |
9973-9982 |
JJ |
denotes |
synthetic |
| T9385 |
9983-9986 |
NN |
denotes |
AVP |
| T9383 |
9987-9993 |
NN |
denotes |
analog |
| T9387 |
9993-9995 |
, |
denotes |
, |
| T9388 |
9995-9996 |
CD |
denotes |
1 |
| T9390 |
9996-9997 |
HYPH |
denotes |
- |
| T9389 |
9997-10004 |
NN |
denotes |
deamino |
| T9392 |
10004-10005 |
HYPH |
denotes |
- |
| T9393 |
10005-10006 |
CD |
denotes |
8 |
| T9394 |
10006-10007 |
HYPH |
denotes |
- |
| T9395 |
10007-10008 |
NN |
denotes |
D |
| T9396 |
10008-10009 |
HYPH |
denotes |
- |
| T9391 |
10009-10017 |
NN |
denotes |
arginine |
| T9397 |
10018-10029 |
NN |
denotes |
vasopressin |
| T9398 |
10030-10031 |
-LRB- |
denotes |
( |
| T9399 |
10031-10036 |
NN |
denotes |
dDAVP |
| T9400 |
10036-10037 |
: |
denotes |
; |
| T9401 |
10038-10042 |
RB |
denotes |
also |
| T9402 |
10043-10049 |
VBN |
denotes |
called |
| T9403 |
10050-10062 |
NN |
denotes |
desmopressin |
| T9404 |
10062-10063 |
-RRB- |
denotes |
) |
| T9405 |
10063-10065 |
, |
denotes |
, |
| T9386 |
10065-10067 |
VBZ |
denotes |
is |
| T9406 |
10068-10069 |
DT |
denotes |
a |
| T9408 |
10070-10076 |
JJ |
denotes |
potent |
| T9407 |
10077-10084 |
NN |
denotes |
agonist |
| T9409 |
10085-10087 |
IN |
denotes |
of |
| T9410 |
10088-10093 |
NN |
denotes |
AVPR2 |
| T9411 |
10093-10094 |
. |
denotes |
. |
| T9412 |
10094-10238 |
sentence |
denotes |
When administered to wild-type mice, dDAVP leads to a dramatic increase in urine concentration, from 1,293 to 5,885 mOsm (4.6-fold; Figure 1D). |
| T9413 |
10095-10099 |
WRB |
denotes |
When |
| T9414 |
10100-10112 |
VBN |
denotes |
administered |
| T9416 |
10113-10115 |
IN |
denotes |
to |
| T9417 |
10116-10120 |
JJ |
denotes |
wild |
| T9419 |
10120-10121 |
HYPH |
denotes |
- |
| T9418 |
10121-10125 |
NN |
denotes |
type |
| T9420 |
10126-10130 |
NNS |
denotes |
mice |
| T9421 |
10130-10132 |
, |
denotes |
, |
| T9422 |
10132-10137 |
NN |
denotes |
dDAVP |
| T9415 |
10138-10143 |
VBZ |
denotes |
leads |
| T9423 |
10144-10146 |
IN |
denotes |
to |
| T9424 |
10147-10148 |
DT |
denotes |
a |
| T9426 |
10149-10157 |
JJ |
denotes |
dramatic |
| T9425 |
10158-10166 |
NN |
denotes |
increase |
| T9427 |
10167-10169 |
IN |
denotes |
in |
| T9428 |
10170-10175 |
NN |
denotes |
urine |
| T9429 |
10176-10189 |
NN |
denotes |
concentration |
| T9430 |
10189-10191 |
, |
denotes |
, |
| T9431 |
10191-10195 |
IN |
denotes |
from |
| T9432 |
10196-10201 |
CD |
denotes |
1,293 |
| T9433 |
10202-10204 |
IN |
denotes |
to |
| T9434 |
10205-10210 |
CD |
denotes |
5,885 |
| T9435 |
10211-10215 |
NN |
denotes |
mOsm |
| T9436 |
10216-10217 |
-LRB- |
denotes |
( |
| T9438 |
10217-10225 |
RB |
denotes |
4.6-fold |
| T9439 |
10225-10226 |
: |
denotes |
; |
| T9437 |
10227-10233 |
NN |
denotes |
Figure |
| T9440 |
10234-10236 |
CD |
denotes |
1D |
| T9441 |
10236-10237 |
-RRB- |
denotes |
) |
| T9442 |
10237-10238 |
. |
denotes |
. |
| T9443 |
10238-10510 |
sentence |
denotes |
With similar treatment, mutant mice concentrate their urine to a lesser but still significant extent, from 161 to 470 mOsm (2.9-fold), indicating that these animals are not only unable to concentrate their urine properly but are also defective in their response to dDAVP. |
| T9444 |
10239-10243 |
IN |
denotes |
With |
| T9446 |
10244-10251 |
JJ |
denotes |
similar |
| T9447 |
10252-10261 |
NN |
denotes |
treatment |
| T9448 |
10261-10263 |
, |
denotes |
, |
| T9449 |
10263-10269 |
NN |
denotes |
mutant |
| T9450 |
10270-10274 |
NNS |
denotes |
mice |
| T9445 |
10275-10286 |
VBP |
denotes |
concentrate |
| T9451 |
10287-10292 |
PRP$ |
denotes |
their |
| T9452 |
10293-10298 |
NN |
denotes |
urine |
| T9453 |
10299-10301 |
IN |
denotes |
to |
| T9454 |
10302-10303 |
DT |
denotes |
a |
| T9456 |
10304-10310 |
JJR |
denotes |
lesser |
| T9457 |
10311-10314 |
CC |
denotes |
but |
| T9458 |
10315-10320 |
RB |
denotes |
still |
| T9459 |
10321-10332 |
JJ |
denotes |
significant |
| T9455 |
10333-10339 |
NN |
denotes |
extent |
| T9460 |
10339-10341 |
, |
denotes |
, |
| T9461 |
10341-10345 |
IN |
denotes |
from |
| T9462 |
10346-10349 |
CD |
denotes |
161 |
| T9463 |
10350-10352 |
IN |
denotes |
to |
| T9464 |
10353-10356 |
CD |
denotes |
470 |
| T9465 |
10357-10361 |
NN |
denotes |
mOsm |
| T9466 |
10362-10363 |
-LRB- |
denotes |
( |
| T9467 |
10363-10371 |
RB |
denotes |
2.9-fold |
| T9468 |
10371-10372 |
-RRB- |
denotes |
) |
| T9469 |
10372-10374 |
, |
denotes |
, |
| T9470 |
10374-10384 |
VBG |
denotes |
indicating |
| T9471 |
10385-10389 |
IN |
denotes |
that |
| T9473 |
10390-10395 |
DT |
denotes |
these |
| T9474 |
10396-10403 |
NNS |
denotes |
animals |
| T9472 |
10404-10407 |
VBP |
denotes |
are |
| T9475 |
10408-10411 |
RB |
denotes |
not |
| T9476 |
10412-10416 |
RB |
denotes |
only |
| T9477 |
10417-10423 |
JJ |
denotes |
unable |
| T9478 |
10424-10426 |
TO |
denotes |
to |
| T9479 |
10427-10438 |
VB |
denotes |
concentrate |
| T9480 |
10439-10444 |
PRP$ |
denotes |
their |
| T9481 |
10445-10450 |
NN |
denotes |
urine |
| T9482 |
10451-10459 |
RB |
denotes |
properly |
| T9483 |
10460-10463 |
CC |
denotes |
but |
| T9484 |
10464-10467 |
VBP |
denotes |
are |
| T9485 |
10468-10472 |
RB |
denotes |
also |
| T9486 |
10473-10482 |
JJ |
denotes |
defective |
| T9487 |
10483-10485 |
IN |
denotes |
in |
| T9488 |
10486-10491 |
PRP$ |
denotes |
their |
| T9489 |
10492-10500 |
NN |
denotes |
response |
| T9490 |
10501-10503 |
IN |
denotes |
to |
| T9491 |
10504-10509 |
NN |
denotes |
dDAVP |
| T9492 |
10509-10510 |
. |
denotes |
. |
| T9493 |
10510-10709 |
sentence |
denotes |
The smaller response to dDAVP indicates some residual activity of the mutant AQP2 channel, which must be sufficient to allow survival of the individual, in contrast to the T126M knock-in mouse [18]. |
| T9494 |
10511-10514 |
DT |
denotes |
The |
| T9496 |
10515-10522 |
JJR |
denotes |
smaller |
| T9495 |
10523-10531 |
NN |
denotes |
response |
| T9498 |
10532-10534 |
IN |
denotes |
to |
| T9499 |
10535-10540 |
NN |
denotes |
dDAVP |
| T9497 |
10541-10550 |
VBZ |
denotes |
indicates |
| T9500 |
10551-10555 |
DT |
denotes |
some |
| T9502 |
10556-10564 |
JJ |
denotes |
residual |
| T9501 |
10565-10573 |
NN |
denotes |
activity |
| T9503 |
10574-10576 |
IN |
denotes |
of |
| T9504 |
10577-10580 |
DT |
denotes |
the |
| T9506 |
10581-10587 |
NN |
denotes |
mutant |
| T9507 |
10588-10592 |
NN |
denotes |
AQP2 |
| T9505 |
10593-10600 |
NN |
denotes |
channel |
| T9508 |
10600-10602 |
, |
denotes |
, |
| T9509 |
10602-10607 |
WDT |
denotes |
which |
| T9511 |
10608-10612 |
MD |
denotes |
must |
| T9510 |
10613-10615 |
VB |
denotes |
be |
| T9512 |
10616-10626 |
JJ |
denotes |
sufficient |
| T9513 |
10627-10629 |
TO |
denotes |
to |
| T9514 |
10630-10635 |
VB |
denotes |
allow |
| T9515 |
10636-10644 |
NN |
denotes |
survival |
| T9516 |
10645-10647 |
IN |
denotes |
of |
| T9517 |
10648-10651 |
DT |
denotes |
the |
| T9518 |
10652-10662 |
NN |
denotes |
individual |
| T9519 |
10662-10664 |
, |
denotes |
, |
| T9520 |
10664-10666 |
IN |
denotes |
in |
| T9521 |
10667-10675 |
NN |
denotes |
contrast |
| T9522 |
10676-10678 |
IN |
denotes |
to |
| T9523 |
10679-10682 |
DT |
denotes |
the |
| T9525 |
10683-10688 |
NN |
denotes |
T126M |
| T9526 |
10689-10694 |
VB |
denotes |
knock |
| T9527 |
10694-10695 |
HYPH |
denotes |
- |
| T9528 |
10695-10697 |
RP |
denotes |
in |
| T9524 |
10698-10703 |
NN |
denotes |
mouse |
| T9529 |
10704-10705 |
-LRB- |
denotes |
[ |
| T9530 |
10705-10707 |
CD |
denotes |
18 |
| T9531 |
10707-10708 |
-RRB- |
denotes |
] |
| T9532 |
10708-10709 |
. |
denotes |
. |
| T9533 |
10709-10967 |
sentence |
denotes |
Multiple heterozygous matings yielded 101 animals, which appeared at a ratio of 26:49:26, near the expected Mendelian wild type, heterozygote, and mutant frequencies, respectively, indicating that there is no reduced viability associated with this mutation. |
| T9534 |
10710-10718 |
JJ |
denotes |
Multiple |
| T9536 |
10719-10731 |
JJ |
denotes |
heterozygous |
| T9535 |
10732-10739 |
NNS |
denotes |
matings |
| T9537 |
10740-10747 |
VBD |
denotes |
yielded |
| T9538 |
10748-10751 |
CD |
denotes |
101 |
| T9539 |
10752-10759 |
NNS |
denotes |
animals |
| T9540 |
10759-10761 |
, |
denotes |
, |
| T9541 |
10761-10766 |
WDT |
denotes |
which |
| T9542 |
10767-10775 |
VBD |
denotes |
appeared |
| T9543 |
10776-10778 |
IN |
denotes |
at |
| T9544 |
10779-10780 |
DT |
denotes |
a |
| T9545 |
10781-10786 |
NN |
denotes |
ratio |
| T9546 |
10787-10789 |
IN |
denotes |
of |
| T9547 |
10790-10792 |
CD |
denotes |
26 |
| T9548 |
10792-10793 |
SYM |
denotes |
: |
| T9549 |
10793-10795 |
CD |
denotes |
49 |
| T9550 |
10795-10796 |
SYM |
denotes |
: |
| T9551 |
10796-10798 |
CD |
denotes |
26 |
| T9552 |
10798-10800 |
, |
denotes |
, |
| T9553 |
10800-10804 |
IN |
denotes |
near |
| T9554 |
10805-10808 |
DT |
denotes |
the |
| T9556 |
10809-10817 |
VBN |
denotes |
expected |
| T9557 |
10818-10827 |
JJ |
denotes |
Mendelian |
| T9559 |
10828-10832 |
JJ |
denotes |
wild |
| T9558 |
10833-10837 |
NN |
denotes |
type |
| T9560 |
10837-10839 |
, |
denotes |
, |
| T9561 |
10839-10851 |
NN |
denotes |
heterozygote |
| T9562 |
10851-10853 |
, |
denotes |
, |
| T9563 |
10853-10856 |
CC |
denotes |
and |
| T9564 |
10857-10863 |
NN |
denotes |
mutant |
| T9555 |
10864-10875 |
NNS |
denotes |
frequencies |
| T9565 |
10875-10877 |
, |
denotes |
, |
| T9566 |
10877-10889 |
RB |
denotes |
respectively |
| T9567 |
10889-10891 |
, |
denotes |
, |
| T9568 |
10891-10901 |
VBG |
denotes |
indicating |
| T9569 |
10902-10906 |
IN |
denotes |
that |
| T9571 |
10907-10912 |
EX |
denotes |
there |
| T9570 |
10913-10915 |
VBZ |
denotes |
is |
| T9572 |
10916-10918 |
DT |
denotes |
no |
| T9574 |
10919-10926 |
VBN |
denotes |
reduced |
| T9573 |
10927-10936 |
NN |
denotes |
viability |
| T9575 |
10937-10947 |
VBN |
denotes |
associated |
| T9576 |
10948-10952 |
IN |
denotes |
with |
| T9577 |
10953-10957 |
DT |
denotes |
this |
| T9578 |
10958-10966 |
NN |
denotes |
mutation |
| T9579 |
10966-10967 |
. |
denotes |
. |
| T9580 |
10967-11150 |
sentence |
denotes |
Other than the increased urine production and water intake, there was no overt phenotype in mutant mice, save distended kidneys, which appeared variably in adult animals (Figure 2A). |
| T9581 |
10968-10973 |
JJ |
denotes |
Other |
| T9583 |
10974-10978 |
IN |
denotes |
than |
| T9584 |
10979-10982 |
DT |
denotes |
the |
| T9586 |
10983-10992 |
VBN |
denotes |
increased |
| T9587 |
10993-10998 |
NN |
denotes |
urine |
| T9585 |
10999-11009 |
NN |
denotes |
production |
| T9588 |
11010-11013 |
CC |
denotes |
and |
| T9589 |
11014-11019 |
NN |
denotes |
water |
| T9590 |
11020-11026 |
NN |
denotes |
intake |
| T9591 |
11026-11028 |
, |
denotes |
, |
| T9592 |
11028-11033 |
EX |
denotes |
there |
| T9582 |
11034-11037 |
VBD |
denotes |
was |
| T9593 |
11038-11040 |
DT |
denotes |
no |
| T9595 |
11041-11046 |
JJ |
denotes |
overt |
| T9594 |
11047-11056 |
NN |
denotes |
phenotype |
| T9596 |
11057-11059 |
IN |
denotes |
in |
| T9597 |
11060-11066 |
NN |
denotes |
mutant |
| T9598 |
11067-11071 |
NNS |
denotes |
mice |
| T9599 |
11071-11073 |
, |
denotes |
, |
| T9600 |
11073-11077 |
IN |
denotes |
save |
| T9601 |
11078-11087 |
JJ |
denotes |
distended |
| T9602 |
11088-11095 |
NNS |
denotes |
kidneys |
| T9603 |
11095-11097 |
, |
denotes |
, |
| T9604 |
11097-11102 |
WDT |
denotes |
which |
| T9605 |
11103-11111 |
VBD |
denotes |
appeared |
| T9606 |
11112-11120 |
RB |
denotes |
variably |
| T9607 |
11121-11123 |
IN |
denotes |
in |
| T9608 |
11124-11129 |
JJ |
denotes |
adult |
| T9609 |
11130-11137 |
NNS |
denotes |
animals |
| T9610 |
11138-11139 |
-LRB- |
denotes |
( |
| T9611 |
11139-11145 |
NN |
denotes |
Figure |
| T9612 |
11146-11148 |
CD |
denotes |
2A |
| T9613 |
11148-11149 |
-RRB- |
denotes |
) |
| T9614 |
11149-11150 |
. |
denotes |
. |
| T9615 |
11150-11230 |
sentence |
denotes |
Although not specifically measured, mutant mice seem to have a normal lifespan. |
| T9616 |
11151-11159 |
IN |
denotes |
Although |
| T9618 |
11160-11163 |
RB |
denotes |
not |
| T9619 |
11164-11176 |
RB |
denotes |
specifically |
| T9617 |
11177-11185 |
VBN |
denotes |
measured |
| T9621 |
11185-11187 |
, |
denotes |
, |
| T9622 |
11187-11193 |
NN |
denotes |
mutant |
| T9623 |
11194-11198 |
NNS |
denotes |
mice |
| T9620 |
11199-11203 |
VBP |
denotes |
seem |
| T9624 |
11204-11206 |
TO |
denotes |
to |
| T9625 |
11207-11211 |
VB |
denotes |
have |
| T9626 |
11212-11213 |
DT |
denotes |
a |
| T9628 |
11214-11220 |
JJ |
denotes |
normal |
| T9627 |
11221-11229 |
NN |
denotes |
lifespan |
| T9629 |
11229-11230 |
. |
denotes |
. |
| T9630 |
11230-11314 |
sentence |
denotes |
The one animal that was followed lived to 18 mo, typical for animals in our colony. |
| T9631 |
11231-11234 |
DT |
denotes |
The |
| T9633 |
11235-11238 |
CD |
denotes |
one |
| T9632 |
11239-11245 |
NN |
denotes |
animal |
| T9635 |
11246-11250 |
WDT |
denotes |
that |
| T9637 |
11251-11254 |
VBD |
denotes |
was |
| T9636 |
11255-11263 |
VBN |
denotes |
followed |
| T9634 |
11264-11269 |
VBN |
denotes |
lived |
| T9638 |
11270-11272 |
IN |
denotes |
to |
| T9639 |
11273-11275 |
CD |
denotes |
18 |
| T9640 |
11276-11278 |
NNS |
denotes |
mo |
| T9641 |
11278-11280 |
, |
denotes |
, |
| T9642 |
11280-11287 |
JJ |
denotes |
typical |
| T9643 |
11288-11291 |
IN |
denotes |
for |
| T9644 |
11292-11299 |
NNS |
denotes |
animals |
| T9645 |
11300-11302 |
IN |
denotes |
in |
| T9646 |
11303-11306 |
PRP$ |
denotes |
our |
| T9647 |
11307-11313 |
NN |
denotes |
colony |
| T9648 |
11313-11314 |
. |
denotes |
. |
| T9649 |
11314-12312 |
sentence |
denotes |
Figure 2 Anatomy and Histology of Mouse Kidneys
(A) Gross anatomy of an affected mouse (8-mo-old male). This shows the enlargement and cystic dilatation of the renal pelvis. There is thinning of the overlying renal parenchyma imparting a translucent appearance to portions of the kidney and collecting system. The bladder is also dilated.
(B) Left kidney from mutant mouse (right) shown in (A) compared to a kidney from an age-sex matched unaffected littermate (left).
(C) Hematoxylin and eosin stained section of ureter from a mutant mouse, showing normal histology despite bloating of the kidney.
(D) Hematoxylin and eosin stained histologic section of a kidney from a 4-wk-old female mutant mouse. The mutant kidney shows marked dilatation of the renal pelvis with blunting of the papilla. There is preservation of the cortex and medulla. Aqp2F204V/F204V mice suffer from severe hydronephrosis (Figure 2A and 2B), presumably as a consequence of an inability to cope with the extreme polyuria. |
| T9650 |
12159-12168 |
NN |
denotes |
Aqp2F204V |
| T9652 |
12168-12169 |
HYPH |
denotes |
/ |
| T9651 |
12169-12174 |
NN |
denotes |
F204V |
| T9653 |
12175-12179 |
NNS |
denotes |
mice |
| T9654 |
12180-12186 |
VBP |
denotes |
suffer |
| T9655 |
12187-12191 |
IN |
denotes |
from |
| T9656 |
12192-12198 |
JJ |
denotes |
severe |
| T9657 |
12199-12213 |
NN |
denotes |
hydronephrosis |
| T9658 |
12214-12215 |
-LRB- |
denotes |
( |
| T9660 |
12215-12221 |
NN |
denotes |
Figure |
| T9659 |
12222-12224 |
CD |
denotes |
2A |
| T9661 |
12225-12228 |
CC |
denotes |
and |
| T9662 |
12229-12231 |
CD |
denotes |
2B |
| T9663 |
12231-12232 |
-RRB- |
denotes |
) |
| T9664 |
12232-12234 |
, |
denotes |
, |
| T9665 |
12234-12244 |
RB |
denotes |
presumably |
| T9666 |
12245-12247 |
IN |
denotes |
as |
| T9667 |
12248-12249 |
DT |
denotes |
a |
| T9668 |
12250-12261 |
NN |
denotes |
consequence |
| T9669 |
12262-12264 |
IN |
denotes |
of |
| T9670 |
12265-12267 |
DT |
denotes |
an |
| T9671 |
12268-12277 |
NN |
denotes |
inability |
| T9672 |
12278-12280 |
TO |
denotes |
to |
| T9673 |
12281-12285 |
VB |
denotes |
cope |
| T9674 |
12286-12290 |
IN |
denotes |
with |
| T9675 |
12291-12294 |
DT |
denotes |
the |
| T9677 |
12295-12302 |
JJ |
denotes |
extreme |
| T9676 |
12303-12311 |
NN |
denotes |
polyuria |
| T9678 |
12311-12312 |
. |
denotes |
. |
| T9679 |
12312-12454 |
sentence |
denotes |
We found distended kidneys in all Aqp2F204V/F204V mice; however, the degree of inflation was variable in affected mice and worsened with age. |
| T9680 |
12313-12315 |
PRP |
denotes |
We |
| T9681 |
12316-12321 |
VBD |
denotes |
found |
| T9683 |
12322-12331 |
JJ |
denotes |
distended |
| T9684 |
12332-12339 |
NNS |
denotes |
kidneys |
| T9685 |
12340-12342 |
IN |
denotes |
in |
| T9686 |
12343-12346 |
DT |
denotes |
all |
| T9688 |
12347-12356 |
NN |
denotes |
Aqp2F204V |
| T9690 |
12356-12357 |
HYPH |
denotes |
/ |
| T9689 |
12357-12362 |
NN |
denotes |
F204V |
| T9687 |
12363-12367 |
NNS |
denotes |
mice |
| T9691 |
12367-12368 |
: |
denotes |
; |
| T9692 |
12369-12376 |
RB |
denotes |
however |
| T9693 |
12376-12378 |
, |
denotes |
, |
| T9694 |
12378-12381 |
DT |
denotes |
the |
| T9695 |
12382-12388 |
NN |
denotes |
degree |
| T9696 |
12389-12391 |
IN |
denotes |
of |
| T9697 |
12392-12401 |
NN |
denotes |
inflation |
| T9682 |
12402-12405 |
VBD |
denotes |
was |
| T9698 |
12406-12414 |
JJ |
denotes |
variable |
| T9699 |
12415-12417 |
IN |
denotes |
in |
| T9700 |
12418-12426 |
VBN |
denotes |
affected |
| T9701 |
12427-12431 |
NNS |
denotes |
mice |
| T9702 |
12432-12435 |
CC |
denotes |
and |
| T9703 |
12436-12444 |
VBD |
denotes |
worsened |
| T9704 |
12445-12449 |
IN |
denotes |
with |
| T9705 |
12450-12453 |
NN |
denotes |
age |
| T9706 |
12453-12454 |
. |
denotes |
. |
| T9707 |
12454-12567 |
sentence |
denotes |
Severe hydronephrosis has previously been observed in double Aqp1/Aqp3 knock-out mice [17], and appears at 6 wk. |
| T9708 |
12455-12461 |
JJ |
denotes |
Severe |
| T9709 |
12462-12476 |
NN |
denotes |
hydronephrosis |
| T9711 |
12477-12480 |
VBZ |
denotes |
has |
| T9712 |
12481-12491 |
RB |
denotes |
previously |
| T9713 |
12492-12496 |
VBN |
denotes |
been |
| T9710 |
12497-12505 |
VBN |
denotes |
observed |
| T9714 |
12506-12508 |
IN |
denotes |
in |
| T9715 |
12509-12515 |
JJ |
denotes |
double |
| T9717 |
12516-12520 |
NN |
denotes |
Aqp1 |
| T9719 |
12520-12521 |
HYPH |
denotes |
/ |
| T9718 |
12521-12525 |
NN |
denotes |
Aqp3 |
| T9716 |
12526-12531 |
VB |
denotes |
knock |
| T9721 |
12531-12532 |
HYPH |
denotes |
- |
| T9722 |
12532-12535 |
RP |
denotes |
out |
| T9720 |
12536-12540 |
NNS |
denotes |
mice |
| T9723 |
12541-12542 |
-LRB- |
denotes |
[ |
| T9724 |
12542-12544 |
CD |
denotes |
17 |
| T9725 |
12544-12545 |
-RRB- |
denotes |
] |
| T9726 |
12545-12547 |
, |
denotes |
, |
| T9727 |
12547-12550 |
CC |
denotes |
and |
| T9728 |
12551-12558 |
VBZ |
denotes |
appears |
| T9729 |
12559-12561 |
IN |
denotes |
at |
| T9730 |
12562-12563 |
CD |
denotes |
6 |
| T9731 |
12564-12566 |
NNS |
denotes |
wk |
| T9732 |
12566-12567 |
. |
denotes |
. |
| T9733 |
12567-12622 |
sentence |
denotes |
Even at 4 wk, Aqp2F204V/F204V mice had hydronephrosis. |
| T9734 |
12568-12572 |
RB |
denotes |
Even |
| T9735 |
12573-12575 |
IN |
denotes |
at |
| T9737 |
12576-12577 |
CD |
denotes |
4 |
| T9738 |
12578-12580 |
NNS |
denotes |
wk |
| T9739 |
12580-12582 |
, |
denotes |
, |
| T9740 |
12582-12591 |
NN |
denotes |
Aqp2F204V |
| T9742 |
12591-12592 |
HYPH |
denotes |
/ |
| T9741 |
12592-12597 |
NN |
denotes |
F204V |
| T9743 |
12598-12602 |
NNS |
denotes |
mice |
| T9736 |
12603-12606 |
VBD |
denotes |
had |
| T9744 |
12607-12621 |
NN |
denotes |
hydronephrosis |
| T9745 |
12621-12622 |
. |
denotes |
. |
| T9746 |
12622-12775 |
sentence |
denotes |
Histologic sections from Aqp2F204V/F204V mice demonstrated marked dilatation of the renal pelvis yet normal morphology of the ureter (Figure 2C and 2D). |
| T9747 |
12623-12633 |
JJ |
denotes |
Histologic |
| T9748 |
12634-12642 |
NNS |
denotes |
sections |
| T9750 |
12643-12647 |
IN |
denotes |
from |
| T9751 |
12648-12657 |
NN |
denotes |
Aqp2F204V |
| T9753 |
12657-12658 |
HYPH |
denotes |
/ |
| T9752 |
12658-12663 |
NN |
denotes |
F204V |
| T9754 |
12664-12668 |
NNS |
denotes |
mice |
| T9749 |
12669-12681 |
VBD |
denotes |
demonstrated |
| T9755 |
12682-12688 |
JJ |
denotes |
marked |
| T9756 |
12689-12699 |
NN |
denotes |
dilatation |
| T9757 |
12700-12702 |
IN |
denotes |
of |
| T9758 |
12703-12706 |
DT |
denotes |
the |
| T9760 |
12707-12712 |
JJ |
denotes |
renal |
| T9759 |
12713-12719 |
NN |
denotes |
pelvis |
| T9761 |
12720-12723 |
CC |
denotes |
yet |
| T9762 |
12724-12730 |
JJ |
denotes |
normal |
| T9763 |
12731-12741 |
NN |
denotes |
morphology |
| T9764 |
12742-12744 |
IN |
denotes |
of |
| T9765 |
12745-12748 |
DT |
denotes |
the |
| T9766 |
12749-12755 |
NN |
denotes |
ureter |
| T9767 |
12756-12757 |
-LRB- |
denotes |
( |
| T9769 |
12757-12763 |
NN |
denotes |
Figure |
| T9768 |
12764-12766 |
CD |
denotes |
2C |
| T9770 |
12767-12770 |
CC |
denotes |
and |
| T9771 |
12771-12773 |
CD |
denotes |
2D |
| T9772 |
12773-12774 |
-RRB- |
denotes |
) |
| T9773 |
12774-12775 |
. |
denotes |
. |
| T9774 |
12775-12852 |
sentence |
denotes |
In particular, the muscularis propria was neither hypertrophied nor thinned. |
| T9775 |
12776-12778 |
IN |
denotes |
In |
| T9777 |
12779-12789 |
JJ |
denotes |
particular |
| T9778 |
12789-12791 |
, |
denotes |
, |
| T9779 |
12791-12794 |
DT |
denotes |
the |
| T9781 |
12795-12805 |
NN |
denotes |
muscularis |
| T9780 |
12806-12813 |
NN |
denotes |
propria |
| T9776 |
12814-12817 |
VBD |
denotes |
was |
| T9782 |
12818-12825 |
CC |
denotes |
neither |
| T9783 |
12826-12839 |
JJ |
denotes |
hypertrophied |
| T9784 |
12840-12843 |
CC |
denotes |
nor |
| T9785 |
12844-12851 |
JJ |
denotes |
thinned |
| T9786 |
12851-12852 |
. |
denotes |
. |
| T9787 |
12852-12971 |
sentence |
denotes |
There was the normal festooned appearance of the urothelium, and this transitional epithelium was of normal thickness. |
| T9788 |
12853-12858 |
EX |
denotes |
There |
| T9789 |
12859-12862 |
VBD |
denotes |
was |
| T9790 |
12863-12866 |
DT |
denotes |
the |
| T9792 |
12867-12873 |
JJ |
denotes |
normal |
| T9793 |
12874-12883 |
VBN |
denotes |
festooned |
| T9791 |
12884-12894 |
NN |
denotes |
appearance |
| T9794 |
12895-12897 |
IN |
denotes |
of |
| T9795 |
12898-12901 |
DT |
denotes |
the |
| T9796 |
12902-12912 |
NN |
denotes |
urothelium |
| T9797 |
12912-12914 |
, |
denotes |
, |
| T9798 |
12914-12917 |
CC |
denotes |
and |
| T9799 |
12918-12922 |
DT |
denotes |
this |
| T9801 |
12923-12935 |
JJ |
denotes |
transitional |
| T9800 |
12936-12946 |
NN |
denotes |
epithelium |
| T9802 |
12947-12950 |
VBD |
denotes |
was |
| T9803 |
12951-12953 |
IN |
denotes |
of |
| T9804 |
12954-12960 |
JJ |
denotes |
normal |
| T9805 |
12961-12970 |
NN |
denotes |
thickness |
| T9806 |
12970-12971 |
. |
denotes |
. |
| T9807 |
12971-13052 |
sentence |
denotes |
There was thinning of the kidney as measured from renal capsule to renal pelvis. |
| T9808 |
12972-12977 |
EX |
denotes |
There |
| T9809 |
12978-12981 |
VBD |
denotes |
was |
| T9810 |
12982-12990 |
NN |
denotes |
thinning |
| T9811 |
12991-12993 |
IN |
denotes |
of |
| T9812 |
12994-12997 |
DT |
denotes |
the |
| T9813 |
12998-13004 |
NN |
denotes |
kidney |
| T9814 |
13005-13007 |
IN |
denotes |
as |
| T9815 |
13008-13016 |
VBN |
denotes |
measured |
| T9816 |
13017-13021 |
IN |
denotes |
from |
| T9817 |
13022-13027 |
JJ |
denotes |
renal |
| T9818 |
13028-13035 |
NN |
denotes |
capsule |
| T9819 |
13036-13038 |
IN |
denotes |
to |
| T9820 |
13039-13044 |
JJ |
denotes |
renal |
| T9821 |
13045-13051 |
NN |
denotes |
pelvis |
| T9822 |
13051-13052 |
. |
denotes |
. |
| T9823 |
13052-13162 |
sentence |
denotes |
However, the morphologic features of the glomeruli and proximal/distal tubules were unremarkable (Figure 2D). |
| T9824 |
13053-13060 |
RB |
denotes |
However |
| T9826 |
13060-13062 |
, |
denotes |
, |
| T9827 |
13062-13065 |
DT |
denotes |
the |
| T9829 |
13066-13077 |
JJ |
denotes |
morphologic |
| T9828 |
13078-13086 |
NNS |
denotes |
features |
| T9830 |
13087-13089 |
IN |
denotes |
of |
| T9831 |
13090-13093 |
DT |
denotes |
the |
| T9832 |
13094-13103 |
NNS |
denotes |
glomeruli |
| T9833 |
13104-13107 |
CC |
denotes |
and |
| T9834 |
13108-13116 |
JJ |
denotes |
proximal |
| T9836 |
13116-13117 |
HYPH |
denotes |
/ |
| T9835 |
13117-13123 |
JJ |
denotes |
distal |
| T9837 |
13124-13131 |
NNS |
denotes |
tubules |
| T9825 |
13132-13136 |
VBD |
denotes |
were |
| T9838 |
13137-13149 |
JJ |
denotes |
unremarkable |
| T9839 |
13150-13151 |
-LRB- |
denotes |
( |
| T9840 |
13151-13157 |
NN |
denotes |
Figure |
| T9841 |
13158-13160 |
CD |
denotes |
2D |
| T9842 |
13160-13161 |
-RRB- |
denotes |
) |
| T9843 |
13161-13162 |
. |
denotes |
. |
| T9844 |
13162-13311 |
sentence |
denotes |
As shown previously [18,22], immunoblotting revealed three different forms of AQP2, due to different degrees and forms of glycosylation (Figure 3A). |
| T9845 |
13163-13165 |
IN |
denotes |
As |
| T9846 |
13166-13171 |
VBN |
denotes |
shown |
| T9848 |
13172-13182 |
RB |
denotes |
previously |
| T9849 |
13183-13184 |
-LRB- |
denotes |
[ |
| T9851 |
13184-13186 |
CD |
denotes |
18 |
| T9852 |
13186-13187 |
, |
denotes |
, |
| T9850 |
13187-13189 |
CD |
denotes |
22 |
| T9853 |
13189-13190 |
-RRB- |
denotes |
] |
| T9854 |
13190-13192 |
, |
denotes |
, |
| T9855 |
13192-13206 |
NN |
denotes |
immunoblotting |
| T9847 |
13207-13215 |
VBD |
denotes |
revealed |
| T9856 |
13216-13221 |
CD |
denotes |
three |
| T9858 |
13222-13231 |
JJ |
denotes |
different |
| T9857 |
13232-13237 |
NNS |
denotes |
forms |
| T9859 |
13238-13240 |
IN |
denotes |
of |
| T9860 |
13241-13245 |
NN |
denotes |
AQP2 |
| T9861 |
13245-13247 |
, |
denotes |
, |
| T9862 |
13247-13250 |
IN |
denotes |
due |
| T9863 |
13251-13253 |
IN |
denotes |
to |
| T9864 |
13254-13263 |
JJ |
denotes |
different |
| T9865 |
13264-13271 |
NNS |
denotes |
degrees |
| T9866 |
13272-13275 |
CC |
denotes |
and |
| T9867 |
13276-13281 |
NNS |
denotes |
forms |
| T9868 |
13282-13284 |
IN |
denotes |
of |
| T9869 |
13285-13298 |
NN |
denotes |
glycosylation |
| T9870 |
13299-13300 |
-LRB- |
denotes |
( |
| T9871 |
13300-13306 |
NN |
denotes |
Figure |
| T9872 |
13307-13309 |
CD |
denotes |
3A |
| T9873 |
13309-13310 |
-RRB- |
denotes |
) |
| T9874 |
13310-13311 |
. |
denotes |
. |
| T9875 |
13311-13475 |
sentence |
denotes |
Previous reports have demonstrated that nonglycosylated protein appears as a 29 kDa band, while complex glycosylated protein runs as a smear between 35 and 45 kDa. |
| T9876 |
13312-13320 |
JJ |
denotes |
Previous |
| T9877 |
13321-13328 |
NNS |
denotes |
reports |
| T9879 |
13329-13333 |
VBP |
denotes |
have |
| T9878 |
13334-13346 |
VBN |
denotes |
demonstrated |
| T9880 |
13347-13351 |
IN |
denotes |
that |
| T9882 |
13352-13367 |
JJ |
denotes |
nonglycosylated |
| T9883 |
13368-13375 |
NN |
denotes |
protein |
| T9881 |
13376-13383 |
VBZ |
denotes |
appears |
| T9884 |
13384-13386 |
IN |
denotes |
as |
| T9885 |
13387-13388 |
DT |
denotes |
a |
| T9887 |
13389-13391 |
CD |
denotes |
29 |
| T9888 |
13392-13395 |
NN |
denotes |
kDa |
| T9886 |
13396-13400 |
NN |
denotes |
band |
| T9889 |
13400-13402 |
, |
denotes |
, |
| T9890 |
13402-13407 |
IN |
denotes |
while |
| T9892 |
13408-13415 |
JJ |
denotes |
complex |
| T9894 |
13416-13428 |
VBN |
denotes |
glycosylated |
| T9893 |
13429-13436 |
NN |
denotes |
protein |
| T9891 |
13437-13441 |
VBZ |
denotes |
runs |
| T9895 |
13442-13444 |
IN |
denotes |
as |
| T9896 |
13445-13446 |
DT |
denotes |
a |
| T9897 |
13447-13452 |
NN |
denotes |
smear |
| T9898 |
13453-13460 |
IN |
denotes |
between |
| T9899 |
13461-13463 |
CD |
denotes |
35 |
| T9901 |
13464-13467 |
CC |
denotes |
and |
| T9902 |
13468-13470 |
CD |
denotes |
45 |
| T9900 |
13471-13474 |
NN |
denotes |
kDa |
| T9903 |
13474-13475 |
. |
denotes |
. |
| T9904 |
13475-13627 |
sentence |
denotes |
A short-lived intermediate form of 31 kDa representing core, high-mannose glycosylation of AQP2 is apparent from pulse-chase labeling experiments [22]. |
| T9905 |
13476-13477 |
DT |
denotes |
A |
| T9907 |
13478-13483 |
JJ |
denotes |
short |
| T9909 |
13483-13484 |
HYPH |
denotes |
- |
| T9908 |
13484-13489 |
JJ |
denotes |
lived |
| T9910 |
13490-13502 |
JJ |
denotes |
intermediate |
| T9906 |
13503-13507 |
NN |
denotes |
form |
| T9912 |
13508-13510 |
IN |
denotes |
of |
| T9913 |
13511-13513 |
CD |
denotes |
31 |
| T9914 |
13514-13517 |
NN |
denotes |
kDa |
| T9915 |
13518-13530 |
VBG |
denotes |
representing |
| T9916 |
13531-13535 |
NN |
denotes |
core |
| T9918 |
13535-13537 |
, |
denotes |
, |
| T9919 |
13537-13541 |
JJ |
denotes |
high |
| T9921 |
13541-13542 |
HYPH |
denotes |
- |
| T9920 |
13542-13549 |
NN |
denotes |
mannose |
| T9917 |
13550-13563 |
NN |
denotes |
glycosylation |
| T9922 |
13564-13566 |
IN |
denotes |
of |
| T9923 |
13567-13571 |
NN |
denotes |
AQP2 |
| T9911 |
13572-13574 |
VBZ |
denotes |
is |
| T9924 |
13575-13583 |
JJ |
denotes |
apparent |
| T9925 |
13584-13588 |
IN |
denotes |
from |
| T9926 |
13589-13594 |
NN |
denotes |
pulse |
| T9928 |
13594-13595 |
HYPH |
denotes |
- |
| T9927 |
13595-13600 |
NN |
denotes |
chase |
| T9929 |
13601-13609 |
NN |
denotes |
labeling |
| T9930 |
13610-13621 |
NNS |
denotes |
experiments |
| T9931 |
13622-13623 |
-LRB- |
denotes |
[ |
| T9932 |
13623-13625 |
CD |
denotes |
22 |
| T9933 |
13625-13626 |
-RRB- |
denotes |
] |
| T9934 |
13626-13627 |
. |
denotes |
. |
| T9935 |
13627-13874 |
sentence |
denotes |
Compared to that from the kidneys of wild-type animals, AQP2 from mutant animals was reduced in both the high molecular weight, diffuse form and the lowest molecular weight form, but enriched in the intermediate molecular weight form (Figure 3A). |
| T9936 |
13628-13636 |
VBN |
denotes |
Compared |
| T9938 |
13637-13639 |
IN |
denotes |
to |
| T9939 |
13640-13644 |
DT |
denotes |
that |
| T9940 |
13645-13649 |
IN |
denotes |
from |
| T9941 |
13650-13653 |
DT |
denotes |
the |
| T9942 |
13654-13661 |
NNS |
denotes |
kidneys |
| T9943 |
13662-13664 |
IN |
denotes |
of |
| T9944 |
13665-13669 |
JJ |
denotes |
wild |
| T9946 |
13669-13670 |
HYPH |
denotes |
- |
| T9945 |
13670-13674 |
NN |
denotes |
type |
| T9947 |
13675-13682 |
NNS |
denotes |
animals |
| T9948 |
13682-13684 |
, |
denotes |
, |
| T9949 |
13684-13688 |
NN |
denotes |
AQP2 |
| T9950 |
13689-13693 |
IN |
denotes |
from |
| T9951 |
13694-13700 |
NN |
denotes |
mutant |
| T9952 |
13701-13708 |
NNS |
denotes |
animals |
| T9953 |
13709-13712 |
VBD |
denotes |
was |
| T9937 |
13713-13720 |
VBN |
denotes |
reduced |
| T9954 |
13721-13723 |
IN |
denotes |
in |
| T9955 |
13724-13728 |
CC |
denotes |
both |
| T9957 |
13729-13732 |
DT |
denotes |
the |
| T9958 |
13733-13737 |
JJ |
denotes |
high |
| T9960 |
13738-13747 |
JJ |
denotes |
molecular |
| T9959 |
13748-13754 |
NN |
denotes |
weight |
| T9961 |
13754-13756 |
, |
denotes |
, |
| T9962 |
13756-13763 |
JJ |
denotes |
diffuse |
| T9956 |
13764-13768 |
NN |
denotes |
form |
| T9963 |
13769-13772 |
CC |
denotes |
and |
| T9964 |
13773-13776 |
DT |
denotes |
the |
| T9966 |
13777-13783 |
JJS |
denotes |
lowest |
| T9968 |
13784-13793 |
JJ |
denotes |
molecular |
| T9967 |
13794-13800 |
NN |
denotes |
weight |
| T9965 |
13801-13805 |
NN |
denotes |
form |
| T9969 |
13805-13807 |
, |
denotes |
, |
| T9970 |
13807-13810 |
CC |
denotes |
but |
| T9971 |
13811-13819 |
VBN |
denotes |
enriched |
| T9972 |
13820-13822 |
IN |
denotes |
in |
| T9973 |
13823-13826 |
DT |
denotes |
the |
| T9975 |
13827-13839 |
JJ |
denotes |
intermediate |
| T9977 |
13840-13849 |
JJ |
denotes |
molecular |
| T9976 |
13850-13856 |
NN |
denotes |
weight |
| T9974 |
13857-13861 |
NN |
denotes |
form |
| T9978 |
13862-13863 |
-LRB- |
denotes |
( |
| T9979 |
13863-13869 |
NN |
denotes |
Figure |
| T9980 |
13870-13872 |
CD |
denotes |
3A |
| T9981 |
13872-13873 |
-RRB- |
denotes |
) |
| T9982 |
13873-13874 |
. |
denotes |
. |
| T9983 |
13874-13943 |
sentence |
denotes |
Heterozygous animals showed intermediate amounts of all three forms. |
| T9984 |
13875-13887 |
JJ |
denotes |
Heterozygous |
| T9985 |
13888-13895 |
NNS |
denotes |
animals |
| T9986 |
13896-13902 |
VBD |
denotes |
showed |
| T9987 |
13903-13915 |
JJ |
denotes |
intermediate |
| T9988 |
13916-13923 |
NNS |
denotes |
amounts |
| T9989 |
13924-13926 |
IN |
denotes |
of |
| T9990 |
13927-13930 |
DT |
denotes |
all |
| T9992 |
13931-13936 |
CD |
denotes |
three |
| T9991 |
13937-13942 |
NNS |
denotes |
forms |
| T9993 |
13942-13943 |
. |
denotes |
. |
| T9994 |
13943-14112 |
sentence |
denotes |
The nature of these glycosylated forms was revealed by digestion with endoglycosidase H, which specifically cleaves mannose-rich carbohydrate from the protein backbone. |
| T9995 |
13944-13947 |
DT |
denotes |
The |
| T9996 |
13948-13954 |
NN |
denotes |
nature |
| T9998 |
13955-13957 |
IN |
denotes |
of |
| T9999 |
13958-13963 |
DT |
denotes |
these |
| T10001 |
13964-13976 |
VBN |
denotes |
glycosylated |
| T10000 |
13977-13982 |
NNS |
denotes |
forms |
| T10002 |
13983-13986 |
VBD |
denotes |
was |
| T9997 |
13987-13995 |
VBN |
denotes |
revealed |
| T10003 |
13996-13998 |
IN |
denotes |
by |
| T10004 |
13999-14008 |
NN |
denotes |
digestion |
| T10005 |
14009-14013 |
IN |
denotes |
with |
| T10006 |
14014-14029 |
NN |
denotes |
endoglycosidase |
| T10007 |
14030-14031 |
NN |
denotes |
H |
| T10008 |
14031-14033 |
, |
denotes |
, |
| T10009 |
14033-14038 |
WDT |
denotes |
which |
| T10011 |
14039-14051 |
RB |
denotes |
specifically |
| T10010 |
14052-14059 |
VBZ |
denotes |
cleaves |
| T10012 |
14060-14067 |
NN |
denotes |
mannose |
| T10014 |
14067-14068 |
HYPH |
denotes |
- |
| T10013 |
14068-14072 |
JJ |
denotes |
rich |
| T10015 |
14073-14085 |
NN |
denotes |
carbohydrate |
| T10016 |
14086-14090 |
IN |
denotes |
from |
| T10017 |
14091-14094 |
DT |
denotes |
the |
| T10019 |
14095-14102 |
NN |
denotes |
protein |
| T10018 |
14103-14111 |
NN |
denotes |
backbone |
| T10020 |
14111-14112 |
. |
denotes |
. |
| T10021 |
14112-14275 |
sentence |
denotes |
Treatment of endogenous AQP2 from kidneys of wild-type, heterozygous, and mutant animals specifically affected the intermediate molecular weight form (Figure 3B). |
| T10022 |
14113-14122 |
NN |
denotes |
Treatment |
| T10024 |
14123-14125 |
IN |
denotes |
of |
| T10025 |
14126-14136 |
JJ |
denotes |
endogenous |
| T10026 |
14137-14141 |
NN |
denotes |
AQP2 |
| T10027 |
14142-14146 |
IN |
denotes |
from |
| T10028 |
14147-14154 |
NNS |
denotes |
kidneys |
| T10029 |
14155-14157 |
IN |
denotes |
of |
| T10030 |
14158-14162 |
JJ |
denotes |
wild |
| T10032 |
14162-14163 |
HYPH |
denotes |
- |
| T10031 |
14163-14167 |
NN |
denotes |
type |
| T10034 |
14167-14169 |
, |
denotes |
, |
| T10035 |
14169-14181 |
JJ |
denotes |
heterozygous |
| T10036 |
14181-14183 |
, |
denotes |
, |
| T10037 |
14183-14186 |
CC |
denotes |
and |
| T10038 |
14187-14193 |
JJ |
denotes |
mutant |
| T10033 |
14194-14201 |
NNS |
denotes |
animals |
| T10039 |
14202-14214 |
RB |
denotes |
specifically |
| T10023 |
14215-14223 |
VBD |
denotes |
affected |
| T10040 |
14224-14227 |
DT |
denotes |
the |
| T10042 |
14228-14240 |
JJ |
denotes |
intermediate |
| T10044 |
14241-14250 |
JJ |
denotes |
molecular |
| T10043 |
14251-14257 |
NN |
denotes |
weight |
| T10041 |
14258-14262 |
NN |
denotes |
form |
| T10045 |
14263-14264 |
-LRB- |
denotes |
( |
| T10046 |
14264-14270 |
NN |
denotes |
Figure |
| T10047 |
14271-14273 |
CD |
denotes |
3B |
| T10048 |
14273-14274 |
-RRB- |
denotes |
) |
| T10049 |
14274-14275 |
. |
denotes |
. |
| T10050 |
14275-14484 |
sentence |
denotes |
The presence of some mature glycosylated proteins (35–45 kDa) in Aqp2F204V/F204V mice presumably permits their survival compared to Aqp2T126M/T126M mice, and is consistent with a diminished response to dDAVP. |
| T10051 |
14276-14279 |
DT |
denotes |
The |
| T10052 |
14280-14288 |
NN |
denotes |
presence |
| T10054 |
14289-14291 |
IN |
denotes |
of |
| T10055 |
14292-14296 |
DT |
denotes |
some |
| T10057 |
14297-14303 |
JJ |
denotes |
mature |
| T10058 |
14304-14316 |
VBN |
denotes |
glycosylated |
| T10056 |
14317-14325 |
NN |
denotes |
proteins |
| T10059 |
14326-14327 |
-LRB- |
denotes |
( |
| T10061 |
14327-14329 |
CD |
denotes |
35 |
| T10063 |
14329-14330 |
SYM |
denotes |
– |
| T10062 |
14330-14332 |
CD |
denotes |
45 |
| T10060 |
14333-14336 |
NN |
denotes |
kDa |
| T10064 |
14336-14337 |
-RRB- |
denotes |
) |
| T10065 |
14338-14340 |
IN |
denotes |
in |
| T10066 |
14341-14350 |
NN |
denotes |
Aqp2F204V |
| T10068 |
14350-14351 |
HYPH |
denotes |
/ |
| T10067 |
14351-14356 |
NN |
denotes |
F204V |
| T10069 |
14357-14361 |
NNS |
denotes |
mice |
| T10070 |
14362-14372 |
RB |
denotes |
presumably |
| T10053 |
14373-14380 |
VBZ |
denotes |
permits |
| T10071 |
14381-14386 |
PRP$ |
denotes |
their |
| T10072 |
14387-14395 |
NN |
denotes |
survival |
| T10073 |
14396-14404 |
VBN |
denotes |
compared |
| T10074 |
14405-14407 |
IN |
denotes |
to |
| T10075 |
14408-14417 |
NN |
denotes |
Aqp2T126M |
| T10077 |
14417-14418 |
HYPH |
denotes |
/ |
| T10076 |
14418-14423 |
NN |
denotes |
T126M |
| T10078 |
14424-14428 |
NNS |
denotes |
mice |
| T10079 |
14428-14430 |
, |
denotes |
, |
| T10080 |
14430-14433 |
CC |
denotes |
and |
| T10081 |
14434-14436 |
VBZ |
denotes |
is |
| T10082 |
14437-14447 |
JJ |
denotes |
consistent |
| T10083 |
14448-14452 |
IN |
denotes |
with |
| T10084 |
14453-14454 |
DT |
denotes |
a |
| T10086 |
14455-14465 |
JJ |
denotes |
diminished |
| T10085 |
14466-14474 |
NN |
denotes |
response |
| T10087 |
14475-14477 |
IN |
denotes |
to |
| T10088 |
14478-14483 |
NN |
denotes |
dDAVP |
| T10089 |
14483-14484 |
. |
denotes |
. |
| T10090 |
14484-15138 |
sentence |
denotes |
Figure 3 Immunoblot Analyses of AQP2 from Mouse Kidneys
(A) Western blot analyses of total kidney membranes from littermate mice. An intermediate form of AQP2 at 31 kDa was identified in kidney membranes from a mutant mouse (Mut) and partially in a heterozygous mouse (Het).
(B) Total kidney membranes were subjected to endoglycosidase H treatment (Endo H) prior to Western blotting. High-mannose (h.m.) glycosylated proteins that have not exited the ER are sensitive to endoglycosidase H digestion. In humans, recessive alleles of Aqp2 are postulated to cause NDI because they do not properly translocate to the apical cell surface in response to AVP. |
| T10091 |
14986-14988 |
IN |
denotes |
In |
| T10093 |
14989-14995 |
NNS |
denotes |
humans |
| T10094 |
14995-14997 |
, |
denotes |
, |
| T10095 |
14997-15006 |
JJ |
denotes |
recessive |
| T10096 |
15007-15014 |
NNS |
denotes |
alleles |
| T10097 |
15015-15017 |
IN |
denotes |
of |
| T10098 |
15018-15022 |
NN |
denotes |
Aqp2 |
| T10099 |
15023-15026 |
VBP |
denotes |
are |
| T10092 |
15027-15037 |
VBN |
denotes |
postulated |
| T10100 |
15038-15040 |
TO |
denotes |
to |
| T10101 |
15041-15046 |
VB |
denotes |
cause |
| T10102 |
15047-15050 |
NN |
denotes |
NDI |
| T10103 |
15051-15058 |
IN |
denotes |
because |
| T10105 |
15059-15063 |
PRP |
denotes |
they |
| T10106 |
15064-15066 |
VBP |
denotes |
do |
| T10107 |
15067-15070 |
RB |
denotes |
not |
| T10108 |
15071-15079 |
RB |
denotes |
properly |
| T10104 |
15080-15091 |
VB |
denotes |
translocate |
| T10109 |
15092-15094 |
IN |
denotes |
to |
| T10110 |
15095-15098 |
DT |
denotes |
the |
| T10112 |
15099-15105 |
JJ |
denotes |
apical |
| T10113 |
15106-15110 |
NN |
denotes |
cell |
| T10111 |
15111-15118 |
NN |
denotes |
surface |
| T10114 |
15119-15121 |
IN |
denotes |
in |
| T10115 |
15122-15130 |
NN |
denotes |
response |
| T10116 |
15131-15133 |
IN |
denotes |
to |
| T10117 |
15134-15137 |
NN |
denotes |
AVP |
| T10118 |
15137-15138 |
. |
denotes |
. |
| T10119 |
15138-15296 |
sentence |
denotes |
This postulate comes solely from in vitro studies in which mutant Aqp2 cDNAs corresponding to human disease mutations are transfected into kidney cell lines. |
| T10120 |
15139-15143 |
DT |
denotes |
This |
| T10121 |
15144-15153 |
NN |
denotes |
postulate |
| T10122 |
15154-15159 |
VBZ |
denotes |
comes |
| T10123 |
15160-15166 |
RB |
denotes |
solely |
| T10124 |
15167-15171 |
IN |
denotes |
from |
| T10125 |
15172-15174 |
FW |
denotes |
in |
| T10126 |
15175-15180 |
FW |
denotes |
vitro |
| T10127 |
15181-15188 |
NNS |
denotes |
studies |
| T10128 |
15189-15191 |
IN |
denotes |
in |
| T10130 |
15192-15197 |
WDT |
denotes |
which |
| T10131 |
15198-15204 |
NN |
denotes |
mutant |
| T10133 |
15205-15209 |
NN |
denotes |
Aqp2 |
| T10132 |
15210-15215 |
NNS |
denotes |
cDNAs |
| T10134 |
15216-15229 |
VBG |
denotes |
corresponding |
| T10135 |
15230-15232 |
IN |
denotes |
to |
| T10136 |
15233-15238 |
JJ |
denotes |
human |
| T10138 |
15239-15246 |
NN |
denotes |
disease |
| T10137 |
15247-15256 |
NNS |
denotes |
mutations |
| T10139 |
15257-15260 |
VBP |
denotes |
are |
| T10129 |
15261-15272 |
VBN |
denotes |
transfected |
| T10140 |
15273-15277 |
IN |
denotes |
into |
| T10141 |
15278-15284 |
NN |
denotes |
kidney |
| T10143 |
15285-15289 |
NN |
denotes |
cell |
| T10142 |
15290-15295 |
NNS |
denotes |
lines |
| T10144 |
15295-15296 |
. |
denotes |
. |
| T10145 |
15296-15415 |
sentence |
denotes |
In general, such recessive alleles, when visualized immunocytochemically, fail to localize to AVP-responsive vesicles. |
| T10146 |
15297-15299 |
IN |
denotes |
In |
| T10148 |
15300-15307 |
JJ |
denotes |
general |
| T10149 |
15307-15309 |
, |
denotes |
, |
| T10150 |
15309-15313 |
JJ |
denotes |
such |
| T10152 |
15314-15323 |
JJ |
denotes |
recessive |
| T10151 |
15324-15331 |
NNS |
denotes |
alleles |
| T10153 |
15331-15333 |
, |
denotes |
, |
| T10154 |
15333-15337 |
WRB |
denotes |
when |
| T10155 |
15338-15348 |
VBN |
denotes |
visualized |
| T10156 |
15349-15369 |
RB |
denotes |
immunocytochemically |
| T10157 |
15369-15371 |
, |
denotes |
, |
| T10147 |
15371-15375 |
VBP |
denotes |
fail |
| T10158 |
15376-15378 |
TO |
denotes |
to |
| T10159 |
15379-15387 |
VB |
denotes |
localize |
| T10160 |
15388-15390 |
IN |
denotes |
to |
| T10161 |
15391-15394 |
NN |
denotes |
AVP |
| T10163 |
15394-15395 |
HYPH |
denotes |
- |
| T10162 |
15395-15405 |
JJ |
denotes |
responsive |
| T10164 |
15406-15414 |
NNS |
denotes |
vesicles |
| T10165 |
15414-15415 |
. |
denotes |
. |
| T10166 |
15415-15475 |
sentence |
denotes |
Rather, they get trapped in the endoplasmic reticulum (ER). |
| T10167 |
15416-15422 |
RB |
denotes |
Rather |
| T10169 |
15422-15424 |
, |
denotes |
, |
| T10170 |
15424-15428 |
PRP |
denotes |
they |
| T10171 |
15429-15432 |
VBP |
denotes |
get |
| T10168 |
15433-15440 |
VBN |
denotes |
trapped |
| T10172 |
15441-15443 |
IN |
denotes |
in |
| T10173 |
15444-15447 |
DT |
denotes |
the |
| T10175 |
15448-15459 |
JJ |
denotes |
endoplasmic |
| T10174 |
15460-15469 |
NN |
denotes |
reticulum |
| T10176 |
15470-15471 |
-LRB- |
denotes |
( |
| T10177 |
15471-15473 |
NN |
denotes |
ER |
| T10178 |
15473-15474 |
-RRB- |
denotes |
) |
| T10179 |
15474-15475 |
. |
denotes |
. |
| T10180 |
15475-15572 |
sentence |
denotes |
Our mouse model of NDI affords the first opportunity to test this hypothesis in a mature animal. |
| T10181 |
15476-15479 |
PRP$ |
denotes |
Our |
| T10183 |
15480-15485 |
NN |
denotes |
mouse |
| T10182 |
15486-15491 |
NN |
denotes |
model |
| T10185 |
15492-15494 |
IN |
denotes |
of |
| T10186 |
15495-15498 |
NN |
denotes |
NDI |
| T10184 |
15499-15506 |
VBZ |
denotes |
affords |
| T10187 |
15507-15510 |
DT |
denotes |
the |
| T10189 |
15511-15516 |
JJ |
denotes |
first |
| T10188 |
15517-15528 |
NN |
denotes |
opportunity |
| T10190 |
15529-15531 |
TO |
denotes |
to |
| T10191 |
15532-15536 |
VB |
denotes |
test |
| T10192 |
15537-15541 |
DT |
denotes |
this |
| T10193 |
15542-15552 |
NN |
denotes |
hypothesis |
| T10194 |
15553-15555 |
IN |
denotes |
in |
| T10195 |
15556-15557 |
DT |
denotes |
a |
| T10197 |
15558-15564 |
JJ |
denotes |
mature |
| T10196 |
15565-15571 |
NN |
denotes |
animal |
| T10198 |
15571-15572 |
. |
denotes |
. |
| T10199 |
15572-15742 |
sentence |
denotes |
As shown in Figure 4A (top row of photomicrographs), AQP2 (stained red) normally localized to the subapical region of collecting duct cells in kidneys of wild-type mice. |
| T10200 |
15573-15575 |
IN |
denotes |
As |
| T10201 |
15576-15581 |
VBN |
denotes |
shown |
| T10203 |
15582-15584 |
IN |
denotes |
in |
| T10204 |
15585-15591 |
NN |
denotes |
Figure |
| T10205 |
15592-15594 |
CD |
denotes |
4A |
| T10206 |
15595-15596 |
-LRB- |
denotes |
( |
| T10208 |
15596-15599 |
JJ |
denotes |
top |
| T10207 |
15600-15603 |
NN |
denotes |
row |
| T10209 |
15604-15606 |
IN |
denotes |
of |
| T10210 |
15607-15623 |
NNS |
denotes |
photomicrographs |
| T10211 |
15623-15624 |
-RRB- |
denotes |
) |
| T10212 |
15624-15626 |
, |
denotes |
, |
| T10213 |
15626-15630 |
NN |
denotes |
AQP2 |
| T10214 |
15631-15632 |
-LRB- |
denotes |
( |
| T10215 |
15632-15639 |
VBN |
denotes |
stained |
| T10216 |
15640-15643 |
JJ |
denotes |
red |
| T10217 |
15643-15644 |
-RRB- |
denotes |
) |
| T10218 |
15645-15653 |
RB |
denotes |
normally |
| T10202 |
15654-15663 |
VBD |
denotes |
localized |
| T10219 |
15664-15666 |
IN |
denotes |
to |
| T10220 |
15667-15670 |
DT |
denotes |
the |
| T10222 |
15671-15680 |
JJ |
denotes |
subapical |
| T10221 |
15681-15687 |
NN |
denotes |
region |
| T10223 |
15688-15690 |
IN |
denotes |
of |
| T10224 |
15691-15701 |
VBG |
denotes |
collecting |
| T10225 |
15702-15706 |
NN |
denotes |
duct |
| T10226 |
15707-15712 |
NNS |
denotes |
cells |
| T10227 |
15713-15715 |
IN |
denotes |
in |
| T10228 |
15716-15723 |
NNS |
denotes |
kidneys |
| T10229 |
15724-15726 |
IN |
denotes |
of |
| T10230 |
15727-15731 |
JJ |
denotes |
wild |
| T10232 |
15731-15732 |
HYPH |
denotes |
- |
| T10231 |
15732-15736 |
NN |
denotes |
type |
| T10233 |
15737-15741 |
NNS |
denotes |
mice |
| T10234 |
15741-15742 |
. |
denotes |
. |
| T10235 |
15742-15842 |
sentence |
denotes |
Upon stimulation with dDAVP, AQP2 translocated to or near the cell surface (Figure 4A, second row). |
| T10236 |
15743-15747 |
IN |
denotes |
Upon |
| T10238 |
15748-15759 |
NN |
denotes |
stimulation |
| T10239 |
15760-15764 |
IN |
denotes |
with |
| T10240 |
15765-15770 |
NN |
denotes |
dDAVP |
| T10241 |
15770-15772 |
, |
denotes |
, |
| T10242 |
15772-15776 |
NN |
denotes |
AQP2 |
| T10237 |
15777-15789 |
VBD |
denotes |
translocated |
| T10243 |
15790-15792 |
IN |
denotes |
to |
| T10244 |
15793-15795 |
CC |
denotes |
or |
| T10245 |
15796-15800 |
IN |
denotes |
near |
| T10246 |
15801-15804 |
DT |
denotes |
the |
| T10248 |
15805-15809 |
NN |
denotes |
cell |
| T10247 |
15810-15817 |
NN |
denotes |
surface |
| T10249 |
15818-15819 |
-LRB- |
denotes |
( |
| T10251 |
15819-15825 |
NN |
denotes |
Figure |
| T10252 |
15826-15828 |
CD |
denotes |
4A |
| T10253 |
15828-15830 |
, |
denotes |
, |
| T10254 |
15830-15836 |
JJ |
denotes |
second |
| T10250 |
15837-15840 |
NN |
denotes |
row |
| T10255 |
15840-15841 |
-RRB- |
denotes |
) |
| T10256 |
15841-15842 |
. |
denotes |
. |
| T10257 |
15842-16058 |
sentence |
denotes |
In kidneys taken from mutant animals, however, AQP2 was distributed randomly throughout the cell in the basal state (Figure 4A, third row), while AQP3 (green) appropriately localized to the basolateral surface [23]. |
| T10258 |
15843-15845 |
IN |
denotes |
In |
| T10260 |
15846-15853 |
NNS |
denotes |
kidneys |
| T10261 |
15854-15859 |
VBN |
denotes |
taken |
| T10262 |
15860-15864 |
IN |
denotes |
from |
| T10263 |
15865-15871 |
NN |
denotes |
mutant |
| T10264 |
15872-15879 |
NNS |
denotes |
animals |
| T10265 |
15879-15881 |
, |
denotes |
, |
| T10266 |
15881-15888 |
RB |
denotes |
however |
| T10267 |
15888-15890 |
, |
denotes |
, |
| T10268 |
15890-15894 |
NN |
denotes |
AQP2 |
| T10269 |
15895-15898 |
VBD |
denotes |
was |
| T10259 |
15899-15910 |
VBN |
denotes |
distributed |
| T10270 |
15911-15919 |
RB |
denotes |
randomly |
| T10271 |
15920-15930 |
IN |
denotes |
throughout |
| T10272 |
15931-15934 |
DT |
denotes |
the |
| T10273 |
15935-15939 |
NN |
denotes |
cell |
| T10274 |
15940-15942 |
IN |
denotes |
in |
| T10275 |
15943-15946 |
DT |
denotes |
the |
| T10277 |
15947-15952 |
JJ |
denotes |
basal |
| T10276 |
15953-15958 |
NN |
denotes |
state |
| T10278 |
15959-15960 |
-LRB- |
denotes |
( |
| T10280 |
15960-15966 |
NN |
denotes |
Figure |
| T10281 |
15967-15969 |
CD |
denotes |
4A |
| T10282 |
15969-15971 |
, |
denotes |
, |
| T10283 |
15971-15976 |
JJ |
denotes |
third |
| T10279 |
15977-15980 |
NN |
denotes |
row |
| T10284 |
15980-15981 |
-RRB- |
denotes |
) |
| T10285 |
15981-15983 |
, |
denotes |
, |
| T10286 |
15983-15988 |
IN |
denotes |
while |
| T10288 |
15989-15993 |
NN |
denotes |
AQP3 |
| T10289 |
15994-15995 |
-LRB- |
denotes |
( |
| T10290 |
15995-16000 |
NN |
denotes |
green |
| T10291 |
16000-16001 |
-RRB- |
denotes |
) |
| T10292 |
16002-16015 |
RB |
denotes |
appropriately |
| T10287 |
16016-16025 |
VBD |
denotes |
localized |
| T10293 |
16026-16028 |
IN |
denotes |
to |
| T10294 |
16029-16032 |
DT |
denotes |
the |
| T10296 |
16033-16044 |
JJ |
denotes |
basolateral |
| T10295 |
16045-16052 |
NN |
denotes |
surface |
| T10297 |
16053-16054 |
-LRB- |
denotes |
[ |
| T10298 |
16054-16056 |
CD |
denotes |
23 |
| T10299 |
16056-16057 |
-RRB- |
denotes |
] |
| T10300 |
16057-16058 |
. |
denotes |
. |
| T10301 |
16058-16173 |
sentence |
denotes |
Furthermore, upon dDAVP stimulation, AQP2-F204V failed to translocate to the cell surface (Figure 4A, bottom row). |
| T10302 |
16059-16070 |
RB |
denotes |
Furthermore |
| T10304 |
16070-16072 |
, |
denotes |
, |
| T10305 |
16072-16076 |
IN |
denotes |
upon |
| T10306 |
16077-16082 |
NN |
denotes |
dDAVP |
| T10307 |
16083-16094 |
NN |
denotes |
stimulation |
| T10308 |
16094-16096 |
, |
denotes |
, |
| T10309 |
16096-16100 |
NN |
denotes |
AQP2 |
| T10311 |
16100-16101 |
HYPH |
denotes |
- |
| T10310 |
16101-16106 |
NN |
denotes |
F204V |
| T10303 |
16107-16113 |
VBD |
denotes |
failed |
| T10312 |
16114-16116 |
TO |
denotes |
to |
| T10313 |
16117-16128 |
VB |
denotes |
translocate |
| T10314 |
16129-16131 |
IN |
denotes |
to |
| T10315 |
16132-16135 |
DT |
denotes |
the |
| T10317 |
16136-16140 |
NN |
denotes |
cell |
| T10316 |
16141-16148 |
NN |
denotes |
surface |
| T10318 |
16149-16150 |
-LRB- |
denotes |
( |
| T10320 |
16150-16156 |
NN |
denotes |
Figure |
| T10321 |
16157-16159 |
CD |
denotes |
4A |
| T10322 |
16159-16161 |
, |
denotes |
, |
| T10323 |
16161-16167 |
JJ |
denotes |
bottom |
| T10319 |
16168-16171 |
NN |
denotes |
row |
| T10324 |
16171-16172 |
-RRB- |
denotes |
) |
| T10325 |
16172-16173 |
. |
denotes |
. |
| T10326 |
16173-16359 |
sentence |
denotes |
To confirm these findings, the staining was repeated in kidneys taken from two further mice for each class, wild-type or mutant, with or without dDAVP treatment, with identical results. |
| T10327 |
16174-16176 |
TO |
denotes |
To |
| T10328 |
16177-16184 |
VB |
denotes |
confirm |
| T10330 |
16185-16190 |
DT |
denotes |
these |
| T10331 |
16191-16199 |
NNS |
denotes |
findings |
| T10332 |
16199-16201 |
, |
denotes |
, |
| T10333 |
16201-16204 |
DT |
denotes |
the |
| T10334 |
16205-16213 |
NN |
denotes |
staining |
| T10335 |
16214-16217 |
VBD |
denotes |
was |
| T10329 |
16218-16226 |
VBN |
denotes |
repeated |
| T10336 |
16227-16229 |
IN |
denotes |
in |
| T10337 |
16230-16237 |
NNS |
denotes |
kidneys |
| T10338 |
16238-16243 |
VBN |
denotes |
taken |
| T10339 |
16244-16248 |
IN |
denotes |
from |
| T10340 |
16249-16252 |
CD |
denotes |
two |
| T10342 |
16253-16260 |
JJ |
denotes |
further |
| T10341 |
16261-16265 |
NNS |
denotes |
mice |
| T10343 |
16266-16269 |
IN |
denotes |
for |
| T10344 |
16270-16274 |
DT |
denotes |
each |
| T10345 |
16275-16280 |
NN |
denotes |
class |
| T10346 |
16280-16282 |
, |
denotes |
, |
| T10347 |
16282-16286 |
JJ |
denotes |
wild |
| T10349 |
16286-16287 |
HYPH |
denotes |
- |
| T10348 |
16287-16291 |
NN |
denotes |
type |
| T10350 |
16292-16294 |
CC |
denotes |
or |
| T10351 |
16295-16301 |
NN |
denotes |
mutant |
| T10352 |
16301-16303 |
, |
denotes |
, |
| T10353 |
16303-16307 |
IN |
denotes |
with |
| T10354 |
16308-16310 |
CC |
denotes |
or |
| T10355 |
16311-16318 |
IN |
denotes |
without |
| T10356 |
16319-16324 |
NN |
denotes |
dDAVP |
| T10357 |
16325-16334 |
NN |
denotes |
treatment |
| T10358 |
16334-16336 |
, |
denotes |
, |
| T10359 |
16336-16340 |
IN |
denotes |
with |
| T10360 |
16341-16350 |
JJ |
denotes |
identical |
| T10361 |
16351-16358 |
NNS |
denotes |
results |
| T10362 |
16358-16359 |
. |
denotes |
. |
| T10363 |
16359-18139 |
sentence |
denotes |
Figure 4 AQP2 Subcellular Localization and Translocation in Mouse Kidney Collecting Ducts and MDCK Cell Lines
(A) Immunohistochemistry on collecting ducts in kidney sections from an AQP2-F204V mutant (Mut) mouse and an age-sex matched wild-type (WT) littermate. Mice were injected intraperitoneally with PBS (NT) or dDAVP before sacrificing and fixation of the kidneys. Kidneys sections were immunostained for AQP2 (red) and the basolateral marker AQP3 (green). The images were merged and an area of the cytoplasm was magnified (zoom). Note that mutant AQP2 is not properly localized to the subapical compartment, nor does it respond to dDAVP.
(B) MDCK cell lines, stably transfected with constructs encoding mouse WT or AQP2-F204V, were treated with and without 150 μM forskolin for 90 min, after which cells were fixed, permeabilized, and subjected to immunocytochemistry. AQP2 is shown in green, and the basolateral marker Na+/K+-ATPase is shown in red, alongside the nuclear stain DAPI. The z-profile images were reconstructed from multiple z-sections, along the dotted line. Mutant AQP2 fails to localize to the cell surface upon forskolin stimulation. Rather, the perinuclear staining is consistent with an ER localization of mutant AQP2.
(C) The MDCK cell line expressing AQP2-F204V was grown on fibronectin-coated coverslips until tight junctions formed, at which point the cells were treated with 150 μM forskolin for 90 min. Cells were fixed, permeabilized, and sequentially immunoblotted for AQP2 (green) and calnexin (red), an ER marker. The merged image shows that AQP2-F204V colocalizes with the endoplasmic reticulum marker. Scale bar refers to 10 μm. To investigate the mechanism of defective translocation of AQP2-F204V, we turned to transfection of MDCK cells. |
| T10364 |
18028-18030 |
TO |
denotes |
To |
| T10365 |
18031-18042 |
VB |
denotes |
investigate |
| T10367 |
18043-18046 |
DT |
denotes |
the |
| T10368 |
18047-18056 |
NN |
denotes |
mechanism |
| T10369 |
18057-18059 |
IN |
denotes |
of |
| T10370 |
18060-18069 |
JJ |
denotes |
defective |
| T10371 |
18070-18083 |
NN |
denotes |
translocation |
| T10372 |
18084-18086 |
IN |
denotes |
of |
| T10373 |
18087-18091 |
NN |
denotes |
AQP2 |
| T10375 |
18091-18092 |
HYPH |
denotes |
- |
| T10374 |
18092-18097 |
NN |
denotes |
F204V |
| T10376 |
18097-18099 |
, |
denotes |
, |
| T10377 |
18099-18101 |
PRP |
denotes |
we |
| T10366 |
18102-18108 |
VBD |
denotes |
turned |
| T10378 |
18109-18111 |
IN |
denotes |
to |
| T10379 |
18112-18124 |
NN |
denotes |
transfection |
| T10380 |
18125-18127 |
IN |
denotes |
of |
| T10381 |
18128-18132 |
NN |
denotes |
MDCK |
| T10382 |
18133-18138 |
NNS |
denotes |
cells |
| T10383 |
18138-18139 |
. |
denotes |
. |
| T10384 |
18139-18222 |
sentence |
denotes |
Stable cell lines expressing mouse wild-type AQP2 and AQP2-F204V were established. |
| T10385 |
18140-18146 |
JJ |
denotes |
Stable |
| T10387 |
18147-18151 |
NN |
denotes |
cell |
| T10386 |
18152-18157 |
NNS |
denotes |
lines |
| T10389 |
18158-18168 |
VBG |
denotes |
expressing |
| T10390 |
18169-18174 |
NN |
denotes |
mouse |
| T10392 |
18175-18179 |
JJ |
denotes |
wild |
| T10394 |
18179-18180 |
HYPH |
denotes |
- |
| T10393 |
18180-18184 |
NN |
denotes |
type |
| T10391 |
18185-18189 |
NN |
denotes |
AQP2 |
| T10395 |
18190-18193 |
CC |
denotes |
and |
| T10396 |
18194-18198 |
NN |
denotes |
AQP2 |
| T10398 |
18198-18199 |
HYPH |
denotes |
- |
| T10397 |
18199-18204 |
NN |
denotes |
F204V |
| T10399 |
18205-18209 |
VBD |
denotes |
were |
| T10388 |
18210-18221 |
VBN |
denotes |
established |
| T10400 |
18221-18222 |
. |
denotes |
. |
| T10401 |
18222-18378 |
sentence |
denotes |
Immunoblots of protein extracts from stable cell lines showed that MDCK cells recapitulate the glycosylation defect seen in mutant mice (unpublished data). |
| T10402 |
18223-18234 |
NNS |
denotes |
Immunoblots |
| T10404 |
18235-18237 |
IN |
denotes |
of |
| T10405 |
18238-18245 |
NN |
denotes |
protein |
| T10406 |
18246-18254 |
NNS |
denotes |
extracts |
| T10407 |
18255-18259 |
IN |
denotes |
from |
| T10408 |
18260-18266 |
JJ |
denotes |
stable |
| T10410 |
18267-18271 |
NN |
denotes |
cell |
| T10409 |
18272-18277 |
NNS |
denotes |
lines |
| T10403 |
18278-18284 |
VBD |
denotes |
showed |
| T10411 |
18285-18289 |
IN |
denotes |
that |
| T10413 |
18290-18294 |
NN |
denotes |
MDCK |
| T10414 |
18295-18300 |
NNS |
denotes |
cells |
| T10412 |
18301-18313 |
VBP |
denotes |
recapitulate |
| T10415 |
18314-18317 |
DT |
denotes |
the |
| T10417 |
18318-18331 |
NN |
denotes |
glycosylation |
| T10416 |
18332-18338 |
NN |
denotes |
defect |
| T10418 |
18339-18343 |
VBN |
denotes |
seen |
| T10419 |
18344-18346 |
IN |
denotes |
in |
| T10420 |
18347-18353 |
NN |
denotes |
mutant |
| T10421 |
18354-18358 |
NNS |
denotes |
mice |
| T10422 |
18359-18360 |
-LRB- |
denotes |
( |
| T10424 |
18360-18371 |
JJ |
denotes |
unpublished |
| T10423 |
18372-18376 |
NNS |
denotes |
data |
| T10425 |
18376-18377 |
-RRB- |
denotes |
) |
| T10426 |
18377-18378 |
. |
denotes |
. |
| T10427 |
18378-18444 |
sentence |
denotes |
The wild-type protein was again present in three different forms. |
| T10428 |
18379-18382 |
DT |
denotes |
The |
| T10430 |
18383-18387 |
JJ |
denotes |
wild |
| T10432 |
18387-18388 |
HYPH |
denotes |
- |
| T10431 |
18388-18392 |
NN |
denotes |
type |
| T10429 |
18393-18400 |
NN |
denotes |
protein |
| T10433 |
18401-18404 |
VBD |
denotes |
was |
| T10434 |
18405-18410 |
RB |
denotes |
again |
| T10435 |
18411-18418 |
JJ |
denotes |
present |
| T10436 |
18419-18421 |
IN |
denotes |
in |
| T10437 |
18422-18427 |
CD |
denotes |
three |
| T10439 |
18428-18437 |
JJ |
denotes |
different |
| T10438 |
18438-18443 |
NNS |
denotes |
forms |
| T10440 |
18443-18444 |
. |
denotes |
. |
| T10441 |
18444-18554 |
sentence |
denotes |
Cells expressing AQP2-F204V lacked the 35–45 kDa form and were enriched in the core-glycosylated 31 kDa form. |
| T10442 |
18445-18450 |
NNS |
denotes |
Cells |
| T10444 |
18451-18461 |
VBG |
denotes |
expressing |
| T10445 |
18462-18466 |
NN |
denotes |
AQP2 |
| T10447 |
18466-18467 |
HYPH |
denotes |
- |
| T10446 |
18467-18472 |
NN |
denotes |
F204V |
| T10443 |
18473-18479 |
VBD |
denotes |
lacked |
| T10448 |
18480-18483 |
DT |
denotes |
the |
| T10450 |
18484-18486 |
CD |
denotes |
35 |
| T10452 |
18486-18487 |
SYM |
denotes |
– |
| T10451 |
18487-18489 |
CD |
denotes |
45 |
| T10453 |
18490-18493 |
NN |
denotes |
kDa |
| T10449 |
18494-18498 |
NN |
denotes |
form |
| T10454 |
18499-18502 |
CC |
denotes |
and |
| T10455 |
18503-18507 |
VBD |
denotes |
were |
| T10456 |
18508-18516 |
VBN |
denotes |
enriched |
| T10457 |
18517-18519 |
IN |
denotes |
in |
| T10458 |
18520-18523 |
DT |
denotes |
the |
| T10460 |
18524-18528 |
NN |
denotes |
core |
| T10462 |
18528-18529 |
HYPH |
denotes |
- |
| T10461 |
18529-18541 |
VBN |
denotes |
glycosylated |
| T10463 |
18542-18544 |
CD |
denotes |
31 |
| T10464 |
18545-18548 |
NN |
denotes |
kDa |
| T10459 |
18549-18553 |
NN |
denotes |
form |
| T10465 |
18553-18554 |
. |
denotes |
. |
| T10466 |
18554-18792 |
sentence |
denotes |
In transfected, unstimulated MDCK cells, wild-type AQP2 (stained green) appeared in a punctate pattern distributed throughout the subapical region (Figure 4B, left column photomicrographs), consistent with vesicular compartmentalization. |
| T10467 |
18555-18557 |
IN |
denotes |
In |
| T10469 |
18558-18569 |
VBN |
denotes |
transfected |
| T10471 |
18569-18571 |
, |
denotes |
, |
| T10472 |
18571-18583 |
JJ |
denotes |
unstimulated |
| T10473 |
18584-18588 |
NN |
denotes |
MDCK |
| T10470 |
18589-18594 |
NNS |
denotes |
cells |
| T10474 |
18594-18596 |
, |
denotes |
, |
| T10475 |
18596-18600 |
JJ |
denotes |
wild |
| T10477 |
18600-18601 |
HYPH |
denotes |
- |
| T10476 |
18601-18605 |
NN |
denotes |
type |
| T10478 |
18606-18610 |
NN |
denotes |
AQP2 |
| T10479 |
18611-18612 |
-LRB- |
denotes |
( |
| T10480 |
18612-18619 |
VBN |
denotes |
stained |
| T10481 |
18620-18625 |
JJ |
denotes |
green |
| T10482 |
18625-18626 |
-RRB- |
denotes |
) |
| T10468 |
18627-18635 |
VBD |
denotes |
appeared |
| T10483 |
18636-18638 |
IN |
denotes |
in |
| T10484 |
18639-18640 |
DT |
denotes |
a |
| T10486 |
18641-18649 |
NN |
denotes |
punctate |
| T10485 |
18650-18657 |
NN |
denotes |
pattern |
| T10487 |
18658-18669 |
VBN |
denotes |
distributed |
| T10488 |
18670-18680 |
IN |
denotes |
throughout |
| T10489 |
18681-18684 |
DT |
denotes |
the |
| T10491 |
18685-18694 |
JJ |
denotes |
subapical |
| T10490 |
18695-18701 |
NN |
denotes |
region |
| T10492 |
18702-18703 |
-LRB- |
denotes |
( |
| T10494 |
18703-18709 |
NN |
denotes |
Figure |
| T10495 |
18710-18712 |
CD |
denotes |
4B |
| T10496 |
18712-18714 |
, |
denotes |
, |
| T10497 |
18714-18718 |
JJ |
denotes |
left |
| T10498 |
18719-18725 |
NN |
denotes |
column |
| T10493 |
18726-18742 |
NNS |
denotes |
photomicrographs |
| T10499 |
18742-18743 |
-RRB- |
denotes |
) |
| T10500 |
18743-18745 |
, |
denotes |
, |
| T10501 |
18745-18755 |
JJ |
denotes |
consistent |
| T10502 |
18756-18760 |
IN |
denotes |
with |
| T10503 |
18761-18770 |
JJ |
denotes |
vesicular |
| T10504 |
18771-18791 |
NN |
denotes |
compartmentalization |
| T10505 |
18791-18792 |
. |
denotes |
. |
| T10506 |
18792-18897 |
sentence |
denotes |
AQP2-F204V, on the other hand, appeared in a punctate but perinuclear pattern (Figure 4B, third column). |
| T10507 |
18793-18797 |
NN |
denotes |
AQP2 |
| T10509 |
18797-18798 |
HYPH |
denotes |
- |
| T10508 |
18798-18803 |
NN |
denotes |
F204V |
| T10511 |
18803-18805 |
, |
denotes |
, |
| T10512 |
18805-18807 |
IN |
denotes |
on |
| T10513 |
18808-18811 |
DT |
denotes |
the |
| T10515 |
18812-18817 |
JJ |
denotes |
other |
| T10514 |
18818-18822 |
NN |
denotes |
hand |
| T10516 |
18822-18824 |
, |
denotes |
, |
| T10510 |
18824-18832 |
VBD |
denotes |
appeared |
| T10517 |
18833-18835 |
IN |
denotes |
in |
| T10518 |
18836-18837 |
DT |
denotes |
a |
| T10520 |
18838-18846 |
NN |
denotes |
punctate |
| T10522 |
18847-18850 |
CC |
denotes |
but |
| T10521 |
18851-18862 |
JJ |
denotes |
perinuclear |
| T10519 |
18863-18870 |
NN |
denotes |
pattern |
| T10523 |
18871-18872 |
-LRB- |
denotes |
( |
| T10525 |
18872-18878 |
NN |
denotes |
Figure |
| T10526 |
18879-18881 |
CD |
denotes |
4B |
| T10527 |
18881-18883 |
, |
denotes |
, |
| T10528 |
18883-18888 |
JJ |
denotes |
third |
| T10524 |
18889-18895 |
NN |
denotes |
column |
| T10529 |
18895-18896 |
-RRB- |
denotes |
) |
| T10530 |
18896-18897 |
. |
denotes |
. |
| T10531 |
18897-19075 |
sentence |
denotes |
Upon stimulation with forskolin, a cAMP-dependent protein kinase activator, wild-type AQP2 translocated to the apical surface of polarized MDCK cells (Figure 4B, second column). |
| T10532 |
18898-18902 |
IN |
denotes |
Upon |
| T10534 |
18903-18914 |
NN |
denotes |
stimulation |
| T10535 |
18915-18919 |
IN |
denotes |
with |
| T10536 |
18920-18929 |
NN |
denotes |
forskolin |
| T10537 |
18929-18931 |
, |
denotes |
, |
| T10538 |
18931-18932 |
DT |
denotes |
a |
| T10540 |
18933-18937 |
NN |
denotes |
cAMP |
| T10542 |
18937-18938 |
HYPH |
denotes |
- |
| T10541 |
18938-18947 |
JJ |
denotes |
dependent |
| T10543 |
18948-18955 |
NN |
denotes |
protein |
| T10544 |
18956-18962 |
NN |
denotes |
kinase |
| T10539 |
18963-18972 |
NN |
denotes |
activator |
| T10545 |
18972-18974 |
, |
denotes |
, |
| T10546 |
18974-18978 |
JJ |
denotes |
wild |
| T10548 |
18978-18979 |
HYPH |
denotes |
- |
| T10547 |
18979-18983 |
NN |
denotes |
type |
| T10549 |
18984-18988 |
NN |
denotes |
AQP2 |
| T10533 |
18989-19001 |
VBD |
denotes |
translocated |
| T10550 |
19002-19004 |
IN |
denotes |
to |
| T10551 |
19005-19008 |
DT |
denotes |
the |
| T10553 |
19009-19015 |
JJ |
denotes |
apical |
| T10552 |
19016-19023 |
NN |
denotes |
surface |
| T10554 |
19024-19026 |
IN |
denotes |
of |
| T10555 |
19027-19036 |
VBN |
denotes |
polarized |
| T10557 |
19037-19041 |
NN |
denotes |
MDCK |
| T10556 |
19042-19047 |
NNS |
denotes |
cells |
| T10558 |
19048-19049 |
-LRB- |
denotes |
( |
| T10560 |
19049-19055 |
NN |
denotes |
Figure |
| T10561 |
19056-19058 |
CD |
denotes |
4B |
| T10562 |
19058-19060 |
, |
denotes |
, |
| T10563 |
19060-19066 |
JJ |
denotes |
second |
| T10559 |
19067-19073 |
NN |
denotes |
column |
| T10564 |
19073-19074 |
-RRB- |
denotes |
) |
| T10565 |
19074-19075 |
. |
denotes |
. |
| T10566 |
19075-19248 |
sentence |
denotes |
Along the z-axis, the perinuclear distribution of AQP2-F204V was clearly seen, and this distribution is not altered by forskolin (Figure 4B, bottom row, two right columns). |
| T10567 |
19076-19081 |
IN |
denotes |
Along |
| T10569 |
19082-19085 |
DT |
denotes |
the |
| T10571 |
19086-19087 |
NN |
denotes |
z |
| T10572 |
19087-19088 |
HYPH |
denotes |
- |
| T10570 |
19088-19092 |
NN |
denotes |
axis |
| T10573 |
19092-19094 |
, |
denotes |
, |
| T10574 |
19094-19097 |
DT |
denotes |
the |
| T10576 |
19098-19109 |
JJ |
denotes |
perinuclear |
| T10575 |
19110-19122 |
NN |
denotes |
distribution |
| T10577 |
19123-19125 |
IN |
denotes |
of |
| T10578 |
19126-19130 |
NN |
denotes |
AQP2 |
| T10580 |
19130-19131 |
HYPH |
denotes |
- |
| T10579 |
19131-19136 |
NN |
denotes |
F204V |
| T10581 |
19137-19140 |
VBD |
denotes |
was |
| T10582 |
19141-19148 |
RB |
denotes |
clearly |
| T10568 |
19149-19153 |
VBN |
denotes |
seen |
| T10583 |
19153-19155 |
, |
denotes |
, |
| T10584 |
19155-19158 |
CC |
denotes |
and |
| T10585 |
19159-19163 |
DT |
denotes |
this |
| T10586 |
19164-19176 |
NN |
denotes |
distribution |
| T10588 |
19177-19179 |
VBZ |
denotes |
is |
| T10589 |
19180-19183 |
RB |
denotes |
not |
| T10587 |
19184-19191 |
VBN |
denotes |
altered |
| T10590 |
19192-19194 |
IN |
denotes |
by |
| T10591 |
19195-19204 |
NN |
denotes |
forskolin |
| T10592 |
19205-19206 |
-LRB- |
denotes |
( |
| T10594 |
19206-19212 |
NN |
denotes |
Figure |
| T10595 |
19213-19215 |
CD |
denotes |
4B |
| T10596 |
19215-19217 |
, |
denotes |
, |
| T10597 |
19217-19223 |
JJ |
denotes |
bottom |
| T10598 |
19224-19227 |
NN |
denotes |
row |
| T10599 |
19227-19229 |
, |
denotes |
, |
| T10600 |
19229-19232 |
CD |
denotes |
two |
| T10601 |
19233-19238 |
JJ |
denotes |
right |
| T10593 |
19239-19246 |
NNS |
denotes |
columns |
| T10602 |
19246-19247 |
-RRB- |
denotes |
) |
| T10603 |
19247-19248 |
. |
denotes |
. |
| T10604 |
19248-19338 |
sentence |
denotes |
The perinuclear distribution of AQP2-F204V is consistent with an ER compartmentalization. |
| T10605 |
19249-19252 |
DT |
denotes |
The |
| T10607 |
19253-19264 |
JJ |
denotes |
perinuclear |
| T10606 |
19265-19277 |
NN |
denotes |
distribution |
| T10609 |
19278-19280 |
IN |
denotes |
of |
| T10610 |
19281-19285 |
NN |
denotes |
AQP2 |
| T10612 |
19285-19286 |
HYPH |
denotes |
- |
| T10611 |
19286-19291 |
NN |
denotes |
F204V |
| T10608 |
19292-19294 |
VBZ |
denotes |
is |
| T10613 |
19295-19305 |
JJ |
denotes |
consistent |
| T10614 |
19306-19310 |
IN |
denotes |
with |
| T10615 |
19311-19313 |
DT |
denotes |
an |
| T10617 |
19314-19316 |
NN |
denotes |
ER |
| T10616 |
19317-19337 |
NN |
denotes |
compartmentalization |
| T10618 |
19337-19338 |
. |
denotes |
. |
| T10619 |
19338-19495 |
sentence |
denotes |
To test the idea that AQP2-F204V localizes to the ER, we co-stained cells transfected with Aqp2F204V (cDNA) for AQP2 and an ER marker, calnexin (Figure 4C). |
| T10620 |
19339-19341 |
TO |
denotes |
To |
| T10621 |
19342-19346 |
VB |
denotes |
test |
| T10623 |
19347-19350 |
DT |
denotes |
the |
| T10624 |
19351-19355 |
NN |
denotes |
idea |
| T10625 |
19356-19360 |
IN |
denotes |
that |
| T10627 |
19361-19365 |
NN |
denotes |
AQP2 |
| T10629 |
19365-19366 |
HYPH |
denotes |
- |
| T10628 |
19366-19371 |
NN |
denotes |
F204V |
| T10626 |
19372-19381 |
VBZ |
denotes |
localizes |
| T10630 |
19382-19384 |
IN |
denotes |
to |
| T10631 |
19385-19388 |
DT |
denotes |
the |
| T10632 |
19389-19391 |
NN |
denotes |
ER |
| T10633 |
19391-19393 |
, |
denotes |
, |
| T10634 |
19393-19395 |
PRP |
denotes |
we |
| T10622 |
19396-19406 |
VBD |
denotes |
co-stained |
| T10635 |
19407-19412 |
NNS |
denotes |
cells |
| T10636 |
19413-19424 |
VBN |
denotes |
transfected |
| T10637 |
19425-19429 |
IN |
denotes |
with |
| T10638 |
19430-19439 |
NN |
denotes |
Aqp2F204V |
| T10639 |
19440-19441 |
-LRB- |
denotes |
( |
| T10640 |
19441-19445 |
NN |
denotes |
cDNA |
| T10641 |
19445-19446 |
-RRB- |
denotes |
) |
| T10642 |
19447-19450 |
IN |
denotes |
for |
| T10643 |
19451-19455 |
NN |
denotes |
AQP2 |
| T10644 |
19456-19459 |
CC |
denotes |
and |
| T10645 |
19460-19462 |
DT |
denotes |
an |
| T10647 |
19463-19465 |
NN |
denotes |
ER |
| T10646 |
19466-19472 |
NN |
denotes |
marker |
| T10648 |
19472-19474 |
, |
denotes |
, |
| T10649 |
19474-19482 |
NN |
denotes |
calnexin |
| T10650 |
19483-19484 |
-LRB- |
denotes |
( |
| T10651 |
19484-19490 |
NN |
denotes |
Figure |
| T10652 |
19491-19493 |
CD |
denotes |
4C |
| T10653 |
19493-19494 |
-RRB- |
denotes |
) |
| T10654 |
19494-19495 |
. |
denotes |
. |
| T10655 |
19495-19638 |
sentence |
denotes |
Colocalization of calnexin with AQP2 was investigated directly, and it was found that 80% of all AQP2-F204V protein colocalized with calnexin. |
| T10656 |
19496-19510 |
NN |
denotes |
Colocalization |
| T10658 |
19511-19513 |
IN |
denotes |
of |
| T10659 |
19514-19522 |
NN |
denotes |
calnexin |
| T10660 |
19523-19527 |
IN |
denotes |
with |
| T10661 |
19528-19532 |
NN |
denotes |
AQP2 |
| T10662 |
19533-19536 |
VBD |
denotes |
was |
| T10657 |
19537-19549 |
VBN |
denotes |
investigated |
| T10663 |
19550-19558 |
RB |
denotes |
directly |
| T10664 |
19558-19560 |
, |
denotes |
, |
| T10665 |
19560-19563 |
CC |
denotes |
and |
| T10666 |
19564-19566 |
PRP |
denotes |
it |
| T10668 |
19567-19570 |
VBD |
denotes |
was |
| T10667 |
19571-19576 |
VBN |
denotes |
found |
| T10669 |
19577-19581 |
IN |
denotes |
that |
| T10671 |
19582-19584 |
CD |
denotes |
80 |
| T10672 |
19584-19585 |
NN |
denotes |
% |
| T10673 |
19586-19588 |
IN |
denotes |
of |
| T10674 |
19589-19592 |
DT |
denotes |
all |
| T10676 |
19593-19597 |
NN |
denotes |
AQP2 |
| T10678 |
19597-19598 |
HYPH |
denotes |
- |
| T10677 |
19598-19603 |
NN |
denotes |
F204V |
| T10675 |
19604-19611 |
NN |
denotes |
protein |
| T10670 |
19612-19623 |
VBD |
denotes |
colocalized |
| T10679 |
19624-19628 |
IN |
denotes |
with |
| T10680 |
19629-19637 |
NN |
denotes |
calnexin |
| T10681 |
19637-19638 |
. |
denotes |
. |
| T10682 |
19638-19764 |
sentence |
denotes |
The remaining 20% appeared at the periphery of the ER, representing AQP2-F204V that had potentially progressed beyond the ER. |
| T10683 |
19639-19642 |
DT |
denotes |
The |
| T10685 |
19643-19652 |
VBG |
denotes |
remaining |
| T10686 |
19653-19655 |
CD |
denotes |
20 |
| T10684 |
19655-19656 |
NN |
denotes |
% |
| T10687 |
19657-19665 |
VBD |
denotes |
appeared |
| T10688 |
19666-19668 |
IN |
denotes |
at |
| T10689 |
19669-19672 |
DT |
denotes |
the |
| T10690 |
19673-19682 |
NN |
denotes |
periphery |
| T10691 |
19683-19685 |
IN |
denotes |
of |
| T10692 |
19686-19689 |
DT |
denotes |
the |
| T10693 |
19690-19692 |
NN |
denotes |
ER |
| T10694 |
19692-19694 |
, |
denotes |
, |
| T10695 |
19694-19706 |
VBG |
denotes |
representing |
| T10696 |
19707-19711 |
NN |
denotes |
AQP2 |
| T10698 |
19711-19712 |
HYPH |
denotes |
- |
| T10697 |
19712-19717 |
NN |
denotes |
F204V |
| T10699 |
19718-19722 |
WDT |
denotes |
that |
| T10701 |
19723-19726 |
VBD |
denotes |
had |
| T10702 |
19727-19738 |
RB |
denotes |
potentially |
| T10700 |
19739-19749 |
VBN |
denotes |
progressed |
| T10703 |
19750-19756 |
IN |
denotes |
beyond |
| T10704 |
19757-19760 |
DT |
denotes |
the |
| T10705 |
19761-19763 |
NN |
denotes |
ER |
| T10706 |
19763-19764 |
. |
denotes |
. |
| T10707 |
19764-19901 |
sentence |
denotes |
This “ER escape” was consistent with the small proportion of mature, complex glycosylated, AQP2-F204V in mutant kidneys (see Figure 3A). |
| T10708 |
19765-19769 |
DT |
denotes |
This |
| T10710 |
19770-19771 |
`` |
denotes |
“ |
| T10711 |
19771-19773 |
NN |
denotes |
ER |
| T10709 |
19774-19780 |
NN |
denotes |
escape |
| T10713 |
19780-19781 |
'' |
denotes |
” |
| T10712 |
19782-19785 |
VBD |
denotes |
was |
| T10714 |
19786-19796 |
JJ |
denotes |
consistent |
| T10715 |
19797-19801 |
IN |
denotes |
with |
| T10716 |
19802-19805 |
DT |
denotes |
the |
| T10718 |
19806-19811 |
JJ |
denotes |
small |
| T10717 |
19812-19822 |
NN |
denotes |
proportion |
| T10719 |
19823-19825 |
IN |
denotes |
of |
| T10720 |
19826-19832 |
JJ |
denotes |
mature |
| T10722 |
19832-19834 |
, |
denotes |
, |
| T10723 |
19834-19841 |
JJ |
denotes |
complex |
| T10724 |
19842-19854 |
VBN |
denotes |
glycosylated |
| T10725 |
19854-19856 |
, |
denotes |
, |
| T10726 |
19856-19860 |
NN |
denotes |
AQP2 |
| T10727 |
19860-19861 |
HYPH |
denotes |
- |
| T10721 |
19861-19866 |
NN |
denotes |
F204V |
| T10728 |
19867-19869 |
IN |
denotes |
in |
| T10729 |
19870-19876 |
NN |
denotes |
mutant |
| T10730 |
19877-19884 |
NNS |
denotes |
kidneys |
| T10731 |
19885-19886 |
-LRB- |
denotes |
( |
| T10732 |
19886-19889 |
VB |
denotes |
see |
| T10733 |
19890-19896 |
NN |
denotes |
Figure |
| T10734 |
19897-19899 |
CD |
denotes |
3A |
| T10735 |
19899-19900 |
-RRB- |
denotes |
) |
| T10736 |
19900-19901 |
. |
denotes |
. |
| T10737 |
19901-20037 |
sentence |
denotes |
Animals heterozygous for the Aqp2F204V mutation were not affected in their urine production or urine osmolality (see Figure 1C and 1D). |
| T10738 |
19902-19909 |
NNS |
denotes |
Animals |
| T10740 |
19910-19922 |
JJ |
denotes |
heterozygous |
| T10741 |
19923-19926 |
IN |
denotes |
for |
| T10742 |
19927-19930 |
DT |
denotes |
the |
| T10744 |
19931-19940 |
NN |
denotes |
Aqp2F204V |
| T10743 |
19941-19949 |
NN |
denotes |
mutation |
| T10745 |
19950-19954 |
VBD |
denotes |
were |
| T10746 |
19955-19958 |
RB |
denotes |
not |
| T10739 |
19959-19967 |
VBN |
denotes |
affected |
| T10747 |
19968-19970 |
IN |
denotes |
in |
| T10748 |
19971-19976 |
PRP$ |
denotes |
their |
| T10750 |
19977-19982 |
NN |
denotes |
urine |
| T10749 |
19983-19993 |
NN |
denotes |
production |
| T10751 |
19994-19996 |
CC |
denotes |
or |
| T10752 |
19997-20002 |
NN |
denotes |
urine |
| T10753 |
20003-20013 |
NN |
denotes |
osmolality |
| T10754 |
20014-20015 |
-LRB- |
denotes |
( |
| T10755 |
20015-20018 |
VB |
denotes |
see |
| T10756 |
20019-20025 |
NN |
denotes |
Figure |
| T10757 |
20026-20028 |
CD |
denotes |
1C |
| T10758 |
20029-20032 |
CC |
denotes |
and |
| T10759 |
20033-20035 |
CD |
denotes |
1D |
| T10760 |
20035-20036 |
-RRB- |
denotes |
) |
| T10761 |
20036-20037 |
. |
denotes |
. |
| T10762 |
20037-20208 |
sentence |
denotes |
It has also been shown that a recessive NDI allele, AQP2-R187C, does not interact with wild-type protein in oocytes [24], nor does it homo-oligomerize in MDCK cells [22]. |
| T10763 |
20038-20040 |
PRP |
denotes |
It |
| T10765 |
20041-20044 |
VBZ |
denotes |
has |
| T10766 |
20045-20049 |
RB |
denotes |
also |
| T10767 |
20050-20054 |
VBN |
denotes |
been |
| T10764 |
20055-20060 |
VBN |
denotes |
shown |
| T10768 |
20061-20065 |
IN |
denotes |
that |
| T10770 |
20066-20067 |
DT |
denotes |
a |
| T10772 |
20068-20077 |
JJ |
denotes |
recessive |
| T10773 |
20078-20081 |
NN |
denotes |
NDI |
| T10771 |
20082-20088 |
NN |
denotes |
allele |
| T10774 |
20088-20090 |
, |
denotes |
, |
| T10775 |
20090-20094 |
NN |
denotes |
AQP2 |
| T10777 |
20094-20095 |
HYPH |
denotes |
- |
| T10776 |
20095-20100 |
NN |
denotes |
R187C |
| T10778 |
20100-20102 |
, |
denotes |
, |
| T10779 |
20102-20106 |
VBZ |
denotes |
does |
| T10780 |
20107-20110 |
RB |
denotes |
not |
| T10769 |
20111-20119 |
VB |
denotes |
interact |
| T10781 |
20120-20124 |
IN |
denotes |
with |
| T10782 |
20125-20129 |
JJ |
denotes |
wild |
| T10784 |
20129-20130 |
HYPH |
denotes |
- |
| T10783 |
20130-20134 |
NN |
denotes |
type |
| T10785 |
20135-20142 |
NN |
denotes |
protein |
| T10786 |
20143-20145 |
IN |
denotes |
in |
| T10787 |
20146-20153 |
NNS |
denotes |
oocytes |
| T10788 |
20154-20155 |
-LRB- |
denotes |
[ |
| T10789 |
20155-20157 |
CD |
denotes |
24 |
| T10790 |
20157-20158 |
-RRB- |
denotes |
] |
| T10791 |
20158-20160 |
, |
denotes |
, |
| T10792 |
20160-20163 |
CC |
denotes |
nor |
| T10793 |
20164-20168 |
VBZ |
denotes |
does |
| T10795 |
20169-20171 |
PRP |
denotes |
it |
| T10794 |
20172-20188 |
VB |
denotes |
homo-oligomerize |
| T10796 |
20189-20191 |
IN |
denotes |
in |
| T10797 |
20192-20196 |
NN |
denotes |
MDCK |
| T10798 |
20197-20202 |
NNS |
denotes |
cells |
| T10799 |
20203-20204 |
-LRB- |
denotes |
[ |
| T10800 |
20204-20206 |
CD |
denotes |
22 |
| T10801 |
20206-20207 |
-RRB- |
denotes |
] |
| T10802 |
20207-20208 |
. |
denotes |
. |
| T10803 |
20208-20316 |
sentence |
denotes |
Therefore, kidneys from heterozygous animals were examined for evidence of two populations of AQP2 protein. |
| T10804 |
20209-20218 |
RB |
denotes |
Therefore |
| T10806 |
20218-20220 |
, |
denotes |
, |
| T10807 |
20220-20227 |
NNS |
denotes |
kidneys |
| T10808 |
20228-20232 |
IN |
denotes |
from |
| T10809 |
20233-20245 |
JJ |
denotes |
heterozygous |
| T10810 |
20246-20253 |
NNS |
denotes |
animals |
| T10811 |
20254-20258 |
VBD |
denotes |
were |
| T10805 |
20259-20267 |
VBN |
denotes |
examined |
| T10812 |
20268-20271 |
IN |
denotes |
for |
| T10813 |
20272-20280 |
NN |
denotes |
evidence |
| T10814 |
20281-20283 |
IN |
denotes |
of |
| T10815 |
20284-20287 |
CD |
denotes |
two |
| T10816 |
20288-20299 |
NNS |
denotes |
populations |
| T10817 |
20300-20302 |
IN |
denotes |
of |
| T10818 |
20303-20307 |
NN |
denotes |
AQP2 |
| T10819 |
20308-20315 |
NN |
denotes |
protein |
| T10820 |
20315-20316 |
. |
denotes |
. |
| T10821 |
20316-20472 |
sentence |
denotes |
Surprisingly, immunohistochemical staining of kidney collecting ducts from Aqp2F204V/+ mice revealed a pattern remarkably similar to wild type (Figure 5A). |
| T10822 |
20317-20329 |
RB |
denotes |
Surprisingly |
| T10824 |
20329-20331 |
, |
denotes |
, |
| T10825 |
20331-20350 |
JJ |
denotes |
immunohistochemical |
| T10826 |
20351-20359 |
NN |
denotes |
staining |
| T10827 |
20360-20362 |
IN |
denotes |
of |
| T10828 |
20363-20369 |
NN |
denotes |
kidney |
| T10830 |
20370-20380 |
VBG |
denotes |
collecting |
| T10829 |
20381-20386 |
NNS |
denotes |
ducts |
| T10831 |
20387-20391 |
IN |
denotes |
from |
| T10832 |
20392-20401 |
NN |
denotes |
Aqp2F204V |
| T10834 |
20401-20402 |
HYPH |
denotes |
/ |
| T10835 |
20402-20403 |
SYM |
denotes |
+ |
| T10833 |
20404-20408 |
NNS |
denotes |
mice |
| T10823 |
20409-20417 |
VBD |
denotes |
revealed |
| T10836 |
20418-20419 |
DT |
denotes |
a |
| T10837 |
20420-20427 |
NN |
denotes |
pattern |
| T10838 |
20428-20438 |
RB |
denotes |
remarkably |
| T10839 |
20439-20446 |
JJ |
denotes |
similar |
| T10840 |
20447-20449 |
IN |
denotes |
to |
| T10841 |
20450-20454 |
JJ |
denotes |
wild |
| T10842 |
20455-20459 |
NN |
denotes |
type |
| T10843 |
20460-20461 |
-LRB- |
denotes |
( |
| T10844 |
20461-20467 |
NN |
denotes |
Figure |
| T10845 |
20468-20470 |
CD |
denotes |
5A |
| T10846 |
20470-20471 |
-RRB- |
denotes |
) |
| T10847 |
20471-20472 |
. |
denotes |
. |
| T10848 |
20472-20552 |
sentence |
denotes |
AQP2 translocated completely to the apical cell surface upon dDAVP stimulation. |
| T10849 |
20473-20477 |
NN |
denotes |
AQP2 |
| T10850 |
20478-20490 |
VBD |
denotes |
translocated |
| T10851 |
20491-20501 |
RB |
denotes |
completely |
| T10852 |
20502-20504 |
IN |
denotes |
to |
| T10853 |
20505-20508 |
DT |
denotes |
the |
| T10855 |
20509-20515 |
JJ |
denotes |
apical |
| T10856 |
20516-20520 |
NN |
denotes |
cell |
| T10854 |
20521-20528 |
NN |
denotes |
surface |
| T10857 |
20529-20533 |
IN |
denotes |
upon |
| T10858 |
20534-20539 |
NN |
denotes |
dDAVP |
| T10859 |
20540-20551 |
NN |
denotes |
stimulation |
| T10860 |
20551-20552 |
. |
denotes |
. |
| T10861 |
20552-20711 |
sentence |
denotes |
This wild-type staining pattern may simply reflect the fact that decreasing the amount of mutant protein by half makes it undetectable by immunocytochemistry. |
| T10862 |
20553-20557 |
DT |
denotes |
This |
| T10864 |
20558-20562 |
JJ |
denotes |
wild |
| T10866 |
20562-20563 |
HYPH |
denotes |
- |
| T10865 |
20563-20567 |
NN |
denotes |
type |
| T10867 |
20568-20576 |
NN |
denotes |
staining |
| T10863 |
20577-20584 |
NN |
denotes |
pattern |
| T10869 |
20585-20588 |
MD |
denotes |
may |
| T10870 |
20589-20595 |
RB |
denotes |
simply |
| T10868 |
20596-20603 |
VB |
denotes |
reflect |
| T10871 |
20604-20607 |
DT |
denotes |
the |
| T10872 |
20608-20612 |
NN |
denotes |
fact |
| T10873 |
20613-20617 |
IN |
denotes |
that |
| T10875 |
20618-20628 |
VBG |
denotes |
decreasing |
| T10876 |
20629-20632 |
DT |
denotes |
the |
| T10877 |
20633-20639 |
NN |
denotes |
amount |
| T10878 |
20640-20642 |
IN |
denotes |
of |
| T10879 |
20643-20649 |
NN |
denotes |
mutant |
| T10880 |
20650-20657 |
NN |
denotes |
protein |
| T10881 |
20658-20660 |
IN |
denotes |
by |
| T10882 |
20661-20665 |
NN |
denotes |
half |
| T10874 |
20666-20671 |
VBZ |
denotes |
makes |
| T10883 |
20672-20674 |
PRP |
denotes |
it |
| T10884 |
20675-20687 |
JJ |
denotes |
undetectable |
| T10885 |
20688-20690 |
IN |
denotes |
by |
| T10886 |
20691-20710 |
NN |
denotes |
immunocytochemistry |
| T10887 |
20710-20711 |
. |
denotes |
. |
| T10888 |
20711-20810 |
sentence |
denotes |
Alternatively, the presence of wild-type protein may alter the localization of the mutant protein. |
| T10889 |
20712-20725 |
RB |
denotes |
Alternatively |
| T10891 |
20725-20727 |
, |
denotes |
, |
| T10892 |
20727-20730 |
DT |
denotes |
the |
| T10893 |
20731-20739 |
NN |
denotes |
presence |
| T10894 |
20740-20742 |
IN |
denotes |
of |
| T10895 |
20743-20747 |
JJ |
denotes |
wild |
| T10897 |
20747-20748 |
HYPH |
denotes |
- |
| T10896 |
20748-20752 |
NN |
denotes |
type |
| T10898 |
20753-20760 |
NN |
denotes |
protein |
| T10899 |
20761-20764 |
MD |
denotes |
may |
| T10890 |
20765-20770 |
VB |
denotes |
alter |
| T10900 |
20771-20774 |
DT |
denotes |
the |
| T10901 |
20775-20787 |
NN |
denotes |
localization |
| T10902 |
20788-20790 |
IN |
denotes |
of |
| T10903 |
20791-20794 |
DT |
denotes |
the |
| T10905 |
20795-20801 |
NN |
denotes |
mutant |
| T10904 |
20802-20809 |
NN |
denotes |
protein |
| T10906 |
20809-20810 |
. |
denotes |
. |
| T10907 |
20810-20980 |
sentence |
denotes |
Indeed, Hendriks et al. proposed a “piggy-back” mechanism to explain the transport of nonglycosylated subunits of AQP2 to the cell surface by glycosylated subunits [22]. |
| T10908 |
20811-20817 |
RB |
denotes |
Indeed |
| T10910 |
20817-20819 |
, |
denotes |
, |
| T10911 |
20819-20827 |
NNP |
denotes |
Hendriks |
| T10912 |
20828-20830 |
FW |
denotes |
et |
| T10913 |
20831-20834 |
FW |
denotes |
al. |
| T10909 |
20835-20843 |
VBD |
denotes |
proposed |
| T10914 |
20844-20845 |
DT |
denotes |
a |
| T10916 |
20846-20847 |
`` |
denotes |
“ |
| T10917 |
20847-20852 |
NN |
denotes |
piggy |
| T10919 |
20852-20853 |
HYPH |
denotes |
- |
| T10918 |
20853-20857 |
NN |
denotes |
back |
| T10920 |
20857-20858 |
'' |
denotes |
” |
| T10915 |
20859-20868 |
NN |
denotes |
mechanism |
| T10921 |
20869-20871 |
TO |
denotes |
to |
| T10922 |
20872-20879 |
VB |
denotes |
explain |
| T10923 |
20880-20883 |
DT |
denotes |
the |
| T10924 |
20884-20893 |
NN |
denotes |
transport |
| T10925 |
20894-20896 |
IN |
denotes |
of |
| T10926 |
20897-20912 |
JJ |
denotes |
nonglycosylated |
| T10927 |
20913-20921 |
NNS |
denotes |
subunits |
| T10928 |
20922-20924 |
IN |
denotes |
of |
| T10929 |
20925-20929 |
NN |
denotes |
AQP2 |
| T10930 |
20930-20932 |
IN |
denotes |
to |
| T10931 |
20933-20936 |
DT |
denotes |
the |
| T10933 |
20937-20941 |
NN |
denotes |
cell |
| T10932 |
20942-20949 |
NN |
denotes |
surface |
| T10934 |
20950-20952 |
IN |
denotes |
by |
| T10935 |
20953-20965 |
VBN |
denotes |
glycosylated |
| T10936 |
20966-20974 |
NNS |
denotes |
subunits |
| T10937 |
20975-20976 |
-LRB- |
denotes |
[ |
| T10938 |
20976-20978 |
CD |
denotes |
22 |
| T10939 |
20978-20979 |
-RRB- |
denotes |
] |
| T10940 |
20979-20980 |
. |
denotes |
. |
| T10941 |
20980-21145 |
sentence |
denotes |
It has also been shown that wild-type AQP2 protein can rescue a translocation-defective mutant protein, AQP2-P262L, when the two are coexpressed in MDCK cells [25]. |
| T10942 |
20981-20983 |
PRP |
denotes |
It |
| T10944 |
20984-20987 |
VBZ |
denotes |
has |
| T10945 |
20988-20992 |
RB |
denotes |
also |
| T10946 |
20993-20997 |
VBN |
denotes |
been |
| T10943 |
20998-21003 |
VBN |
denotes |
shown |
| T10947 |
21004-21008 |
IN |
denotes |
that |
| T10949 |
21009-21013 |
JJ |
denotes |
wild |
| T10951 |
21013-21014 |
HYPH |
denotes |
- |
| T10950 |
21014-21018 |
NN |
denotes |
type |
| T10953 |
21019-21023 |
NN |
denotes |
AQP2 |
| T10952 |
21024-21031 |
NN |
denotes |
protein |
| T10954 |
21032-21035 |
MD |
denotes |
can |
| T10948 |
21036-21042 |
VB |
denotes |
rescue |
| T10955 |
21043-21044 |
DT |
denotes |
a |
| T10957 |
21045-21058 |
NN |
denotes |
translocation |
| T10959 |
21058-21059 |
HYPH |
denotes |
- |
| T10958 |
21059-21068 |
JJ |
denotes |
defective |
| T10960 |
21069-21075 |
NN |
denotes |
mutant |
| T10956 |
21076-21083 |
NN |
denotes |
protein |
| T10961 |
21083-21085 |
, |
denotes |
, |
| T10962 |
21085-21089 |
NN |
denotes |
AQP2 |
| T10964 |
21089-21090 |
HYPH |
denotes |
- |
| T10963 |
21090-21095 |
NN |
denotes |
P262L |
| T10965 |
21095-21097 |
, |
denotes |
, |
| T10966 |
21097-21101 |
WRB |
denotes |
when |
| T10968 |
21102-21105 |
DT |
denotes |
the |
| T10969 |
21106-21109 |
CD |
denotes |
two |
| T10970 |
21110-21113 |
VBP |
denotes |
are |
| T10967 |
21114-21125 |
VBN |
denotes |
coexpressed |
| T10971 |
21126-21128 |
IN |
denotes |
in |
| T10972 |
21129-21133 |
NN |
denotes |
MDCK |
| T10973 |
21134-21139 |
NNS |
denotes |
cells |
| T10974 |
21140-21141 |
-LRB- |
denotes |
[ |
| T10975 |
21141-21143 |
CD |
denotes |
25 |
| T10976 |
21143-21144 |
-RRB- |
denotes |
] |
| T10977 |
21144-21145 |
. |
denotes |
. |
| T10978 |
21145-22908 |
sentence |
denotes |
Figure 5 AQP2-F204V Rescue in Heterozygous Mouse Collecting Ducts and in Cotransfected MDCK Cells
(A) In heterozygous animals, AQP2 localizes and responds to dDAVP normally. Immunohistochemistry was carried out on kidney sections from an Aqp2F204V/+ mouse, after injection with dDAVP. Kidney sections were sequentially immunostained for AQP2 (red) and the basolateral marker AQP3 (green).
(B) Mutant and wild-type AQP2 physically interact. MDCK cells stably expressing wild-type AQP2 were transiently transfected with GFP tagged wild-type AQP2, AQP2-F204V, or GFP alone. Solubilized membranes were immunoprecipitated with a GFP antibody. Total membranes and immunoprecipitates (GFP-IP) were Western blotted using an antibody against AQP2 (arrow) or AQP2-GFP fusions (arrowhead).
(C) Wild-type AQP2 rescues the localization defect of mutant AQP2. GFP fusions of either wild-type AQP2 (WT-GFP, top photomicrographs) or F204V AQP2 (F204V-GFP, bottom photomicrographs) were expressed in polarized MDCK stable cell lines expressing vector alone (vector, left photomicrographs) or AQP2-WT (right photomicrographs). Cells were stimulated with forskolin, processed for immunocytochemistry, and used to generate z-sectional images.
(D) Mutant AQP2 is present at the cell surface in cells coexpressing wild-type AQP2 (AQP2-WT). GFP fused to AQP2-F204V was expressed in MDCK cells expressing wild-type AQP2 or vector alone. Cells were stimulated with forskolin, and cell surface biotinylated proteins were precipitated then analyzed for the presence of wild-type AQP2 (arrow) and AQP2-F204V (arrowhead) by Western blot. In the collecting ducts from Aqp2F204V/+ mice, the wild type may rescue the mutant protein as suggested by the subcellular distribution of AQP2 protein. |
| T10979 |
22756-22758 |
IN |
denotes |
In |
| T10981 |
22759-22762 |
DT |
denotes |
the |
| T10983 |
22763-22773 |
VBG |
denotes |
collecting |
| T10982 |
22774-22779 |
NNS |
denotes |
ducts |
| T10984 |
22780-22784 |
IN |
denotes |
from |
| T10985 |
22785-22794 |
NN |
denotes |
Aqp2F204V |
| T10987 |
22794-22795 |
HYPH |
denotes |
/ |
| T10988 |
22795-22796 |
SYM |
denotes |
+ |
| T10986 |
22797-22801 |
NNS |
denotes |
mice |
| T10989 |
22801-22803 |
, |
denotes |
, |
| T10990 |
22803-22806 |
DT |
denotes |
the |
| T10992 |
22807-22811 |
JJ |
denotes |
wild |
| T10991 |
22812-22816 |
NN |
denotes |
type |
| T10993 |
22817-22820 |
MD |
denotes |
may |
| T10980 |
22821-22827 |
VB |
denotes |
rescue |
| T10994 |
22828-22831 |
DT |
denotes |
the |
| T10996 |
22832-22838 |
NN |
denotes |
mutant |
| T10995 |
22839-22846 |
NN |
denotes |
protein |
| T10997 |
22847-22849 |
IN |
denotes |
as |
| T10998 |
22850-22859 |
VBN |
denotes |
suggested |
| T10999 |
22860-22862 |
IN |
denotes |
by |
| T11000 |
22863-22866 |
DT |
denotes |
the |
| T11002 |
22867-22878 |
JJ |
denotes |
subcellular |
| T11001 |
22879-22891 |
NN |
denotes |
distribution |
| T11003 |
22892-22894 |
IN |
denotes |
of |
| T11004 |
22895-22899 |
NN |
denotes |
AQP2 |
| T11005 |
22900-22907 |
NN |
denotes |
protein |
| T11006 |
22907-22908 |
. |
denotes |
. |
| T11007 |
22908-23039 |
sentence |
denotes |
To test this idea, we first looked for an interaction between mutant and wild-type proteins in transfected MDCK cells (Figure 5B). |
| T11008 |
22909-22911 |
TO |
denotes |
To |
| T11009 |
22912-22916 |
VB |
denotes |
test |
| T11011 |
22917-22921 |
DT |
denotes |
this |
| T11012 |
22922-22926 |
NN |
denotes |
idea |
| T11013 |
22926-22928 |
, |
denotes |
, |
| T11014 |
22928-22930 |
PRP |
denotes |
we |
| T11015 |
22931-22936 |
RB |
denotes |
first |
| T11010 |
22937-22943 |
VBD |
denotes |
looked |
| T11016 |
22944-22947 |
IN |
denotes |
for |
| T11017 |
22948-22950 |
DT |
denotes |
an |
| T11018 |
22951-22962 |
NN |
denotes |
interaction |
| T11019 |
22963-22970 |
IN |
denotes |
between |
| T11020 |
22971-22977 |
NN |
denotes |
mutant |
| T11022 |
22978-22981 |
CC |
denotes |
and |
| T11023 |
22982-22986 |
JJ |
denotes |
wild |
| T11025 |
22986-22987 |
HYPH |
denotes |
- |
| T11024 |
22987-22991 |
NN |
denotes |
type |
| T11021 |
22992-23000 |
NN |
denotes |
proteins |
| T11026 |
23001-23003 |
IN |
denotes |
in |
| T11027 |
23004-23015 |
VBN |
denotes |
transfected |
| T11029 |
23016-23020 |
NN |
denotes |
MDCK |
| T11028 |
23021-23026 |
NNS |
denotes |
cells |
| T11030 |
23027-23028 |
-LRB- |
denotes |
( |
| T11031 |
23028-23034 |
NN |
denotes |
Figure |
| T11032 |
23035-23037 |
CD |
denotes |
5B |
| T11033 |
23037-23038 |
-RRB- |
denotes |
) |
| T11034 |
23038-23039 |
. |
denotes |
. |
| T11035 |
23039-23205 |
sentence |
denotes |
MDCK cells stably expressing wild-type AQP2 were transiently transfected with GFP expression constructs encoding GFP-tagged wild-type AQP2, AQP2-F204V, or GFP alone. |
| T11036 |
23040-23044 |
NN |
denotes |
MDCK |
| T11037 |
23045-23050 |
NNS |
denotes |
cells |
| T11039 |
23051-23057 |
RB |
denotes |
stably |
| T11040 |
23058-23068 |
VBG |
denotes |
expressing |
| T11041 |
23069-23073 |
JJ |
denotes |
wild |
| T11043 |
23073-23074 |
HYPH |
denotes |
- |
| T11042 |
23074-23078 |
NN |
denotes |
type |
| T11044 |
23079-23083 |
NN |
denotes |
AQP2 |
| T11045 |
23084-23088 |
VBD |
denotes |
were |
| T11046 |
23089-23100 |
RB |
denotes |
transiently |
| T11038 |
23101-23112 |
VBN |
denotes |
transfected |
| T11047 |
23113-23117 |
IN |
denotes |
with |
| T11048 |
23118-23121 |
NN |
denotes |
GFP |
| T11050 |
23122-23132 |
NN |
denotes |
expression |
| T11049 |
23133-23143 |
NNS |
denotes |
constructs |
| T11051 |
23144-23152 |
VBG |
denotes |
encoding |
| T11052 |
23153-23156 |
NN |
denotes |
GFP |
| T11054 |
23156-23157 |
HYPH |
denotes |
- |
| T11053 |
23157-23163 |
VBN |
denotes |
tagged |
| T11056 |
23164-23168 |
JJ |
denotes |
wild |
| T11058 |
23168-23169 |
HYPH |
denotes |
- |
| T11057 |
23169-23173 |
NN |
denotes |
type |
| T11055 |
23174-23178 |
NN |
denotes |
AQP2 |
| T11059 |
23178-23180 |
, |
denotes |
, |
| T11060 |
23180-23184 |
NN |
denotes |
AQP2 |
| T11062 |
23184-23185 |
HYPH |
denotes |
- |
| T11061 |
23185-23190 |
NN |
denotes |
F204V |
| T11063 |
23190-23192 |
, |
denotes |
, |
| T11064 |
23192-23194 |
CC |
denotes |
or |
| T11065 |
23195-23198 |
NN |
denotes |
GFP |
| T11066 |
23199-23204 |
RB |
denotes |
alone |
| T11067 |
23204-23205 |
. |
denotes |
. |
| T11068 |
23205-23455 |
sentence |
denotes |
Antibodies against GFP coimmunoprecipitated wild-type AQP2 when AQP2-GFP or AQP2-F204V-GFP was transiently transfected, but not when GFP by itself was transiently transfected into MDCK cells stably expressing wild-type AQP2 (Figure 5B, upper blots). |
| T11069 |
23206-23216 |
NNS |
denotes |
Antibodies |
| T11071 |
23217-23224 |
IN |
denotes |
against |
| T11072 |
23225-23228 |
NN |
denotes |
GFP |
| T11070 |
23229-23249 |
VBD |
denotes |
coimmunoprecipitated |
| T11073 |
23250-23254 |
JJ |
denotes |
wild |
| T11075 |
23254-23255 |
HYPH |
denotes |
- |
| T11074 |
23255-23259 |
NN |
denotes |
type |
| T11076 |
23260-23264 |
NN |
denotes |
AQP2 |
| T11077 |
23265-23269 |
WRB |
denotes |
when |
| T11079 |
23270-23274 |
NN |
denotes |
AQP2 |
| T11081 |
23274-23275 |
HYPH |
denotes |
- |
| T11080 |
23275-23278 |
NN |
denotes |
GFP |
| T11082 |
23279-23281 |
CC |
denotes |
or |
| T11083 |
23282-23286 |
NN |
denotes |
AQP2 |
| T11085 |
23286-23287 |
HYPH |
denotes |
- |
| T11086 |
23287-23292 |
NN |
denotes |
F204V |
| T11087 |
23292-23293 |
HYPH |
denotes |
- |
| T11084 |
23293-23296 |
NN |
denotes |
GFP |
| T11088 |
23297-23300 |
VBD |
denotes |
was |
| T11089 |
23301-23312 |
RB |
denotes |
transiently |
| T11078 |
23313-23324 |
VBN |
denotes |
transfected |
| T11090 |
23324-23326 |
, |
denotes |
, |
| T11091 |
23326-23329 |
CC |
denotes |
but |
| T11092 |
23330-23333 |
RB |
denotes |
not |
| T11093 |
23334-23338 |
WRB |
denotes |
when |
| T11095 |
23339-23342 |
NN |
denotes |
GFP |
| T11096 |
23343-23345 |
IN |
denotes |
by |
| T11097 |
23346-23352 |
PRP |
denotes |
itself |
| T11098 |
23353-23356 |
VBD |
denotes |
was |
| T11099 |
23357-23368 |
RB |
denotes |
transiently |
| T11094 |
23369-23380 |
VBN |
denotes |
transfected |
| T11100 |
23381-23385 |
IN |
denotes |
into |
| T11101 |
23386-23390 |
NN |
denotes |
MDCK |
| T11102 |
23391-23396 |
NNS |
denotes |
cells |
| T11103 |
23397-23403 |
RB |
denotes |
stably |
| T11104 |
23404-23414 |
VBG |
denotes |
expressing |
| T11105 |
23415-23419 |
JJ |
denotes |
wild |
| T11107 |
23419-23420 |
HYPH |
denotes |
- |
| T11106 |
23420-23424 |
NN |
denotes |
type |
| T11108 |
23425-23429 |
NN |
denotes |
AQP2 |
| T11109 |
23430-23431 |
-LRB- |
denotes |
( |
| T11111 |
23431-23437 |
NN |
denotes |
Figure |
| T11112 |
23438-23440 |
CD |
denotes |
5B |
| T11113 |
23440-23442 |
, |
denotes |
, |
| T11114 |
23442-23447 |
JJ |
denotes |
upper |
| T11110 |
23448-23453 |
NNS |
denotes |
blots |
| T11115 |
23453-23454 |
-RRB- |
denotes |
) |
| T11116 |
23454-23455 |
. |
denotes |
. |
| T11117 |
23455-23585 |
sentence |
denotes |
Western blot of total membranes showed that wild-type AQP2 is equivalently expressed in all three cases (Figure 5B, lower blots). |
| T11118 |
23456-23463 |
NNP |
denotes |
Western |
| T11119 |
23464-23468 |
NN |
denotes |
blot |
| T11121 |
23469-23471 |
IN |
denotes |
of |
| T11122 |
23472-23477 |
JJ |
denotes |
total |
| T11123 |
23478-23487 |
NNS |
denotes |
membranes |
| T11120 |
23488-23494 |
VBD |
denotes |
showed |
| T11124 |
23495-23499 |
IN |
denotes |
that |
| T11126 |
23500-23504 |
JJ |
denotes |
wild |
| T11128 |
23504-23505 |
HYPH |
denotes |
- |
| T11127 |
23505-23509 |
NN |
denotes |
type |
| T11129 |
23510-23514 |
NN |
denotes |
AQP2 |
| T11130 |
23515-23517 |
VBZ |
denotes |
is |
| T11131 |
23518-23530 |
RB |
denotes |
equivalently |
| T11125 |
23531-23540 |
VBN |
denotes |
expressed |
| T11132 |
23541-23543 |
IN |
denotes |
in |
| T11133 |
23544-23547 |
DT |
denotes |
all |
| T11135 |
23548-23553 |
CD |
denotes |
three |
| T11134 |
23554-23559 |
NNS |
denotes |
cases |
| T11136 |
23560-23561 |
-LRB- |
denotes |
( |
| T11138 |
23561-23567 |
NN |
denotes |
Figure |
| T11139 |
23568-23570 |
CD |
denotes |
5B |
| T11140 |
23570-23572 |
, |
denotes |
, |
| T11141 |
23572-23577 |
JJ |
denotes |
lower |
| T11137 |
23578-23583 |
NNS |
denotes |
blots |
| T11142 |
23583-23584 |
-RRB- |
denotes |
) |
| T11143 |
23584-23585 |
. |
denotes |
. |
| T11144 |
23585-23731 |
sentence |
denotes |
If wild-type and mutant proteins are indeed interacting in the cell, is this interaction sufficient to rescue the localization of mutant protein? |
| T11145 |
23586-23588 |
IN |
denotes |
If |
| T11147 |
23589-23593 |
JJ |
denotes |
wild |
| T11149 |
23593-23594 |
HYPH |
denotes |
- |
| T11148 |
23594-23598 |
NN |
denotes |
type |
| T11151 |
23599-23602 |
CC |
denotes |
and |
| T11152 |
23603-23609 |
NN |
denotes |
mutant |
| T11150 |
23610-23618 |
NN |
denotes |
proteins |
| T11153 |
23619-23622 |
VBP |
denotes |
are |
| T11154 |
23623-23629 |
RB |
denotes |
indeed |
| T11146 |
23630-23641 |
VBG |
denotes |
interacting |
| T11156 |
23642-23644 |
IN |
denotes |
in |
| T11157 |
23645-23648 |
DT |
denotes |
the |
| T11158 |
23649-23653 |
NN |
denotes |
cell |
| T11159 |
23653-23655 |
, |
denotes |
, |
| T11155 |
23655-23657 |
VBZ |
denotes |
is |
| T11160 |
23658-23662 |
DT |
denotes |
this |
| T11161 |
23663-23674 |
NN |
denotes |
interaction |
| T11162 |
23675-23685 |
JJ |
denotes |
sufficient |
| T11163 |
23686-23688 |
TO |
denotes |
to |
| T11164 |
23689-23695 |
VB |
denotes |
rescue |
| T11165 |
23696-23699 |
DT |
denotes |
the |
| T11166 |
23700-23712 |
NN |
denotes |
localization |
| T11167 |
23713-23715 |
IN |
denotes |
of |
| T11168 |
23716-23722 |
NN |
denotes |
mutant |
| T11169 |
23723-23730 |
NN |
denotes |
protein |
| T11170 |
23730-23731 |
. |
denotes |
? |
| T11171 |
23731-23854 |
sentence |
denotes |
To answer this question, we used MDCK cells stably transfected with wild-type AQP2 expressing vector or with empty vector. |
| T11172 |
23732-23734 |
TO |
denotes |
To |
| T11173 |
23735-23741 |
VB |
denotes |
answer |
| T11175 |
23742-23746 |
DT |
denotes |
this |
| T11176 |
23747-23755 |
NN |
denotes |
question |
| T11177 |
23755-23757 |
, |
denotes |
, |
| T11178 |
23757-23759 |
PRP |
denotes |
we |
| T11174 |
23760-23764 |
VBD |
denotes |
used |
| T11179 |
23765-23769 |
NN |
denotes |
MDCK |
| T11180 |
23770-23775 |
NNS |
denotes |
cells |
| T11181 |
23776-23782 |
RB |
denotes |
stably |
| T11182 |
23783-23794 |
VBN |
denotes |
transfected |
| T11183 |
23795-23799 |
IN |
denotes |
with |
| T11184 |
23800-23804 |
JJ |
denotes |
wild |
| T11186 |
23804-23805 |
HYPH |
denotes |
- |
| T11185 |
23805-23809 |
NN |
denotes |
type |
| T11187 |
23810-23814 |
NN |
denotes |
AQP2 |
| T11188 |
23815-23825 |
VBG |
denotes |
expressing |
| T11189 |
23826-23832 |
NN |
denotes |
vector |
| T11190 |
23833-23835 |
CC |
denotes |
or |
| T11191 |
23836-23840 |
IN |
denotes |
with |
| T11192 |
23841-23846 |
JJ |
denotes |
empty |
| T11193 |
23847-23853 |
NN |
denotes |
vector |
| T11194 |
23853-23854 |
. |
denotes |
. |
| T11195 |
23854-23948 |
sentence |
denotes |
On top of these, we transiently transfected AQP2-GFP or AQP2-F204V-GFP expression constructs. |
| T11196 |
23855-23857 |
IN |
denotes |
On |
| T11198 |
23858-23861 |
NN |
denotes |
top |
| T11199 |
23862-23864 |
IN |
denotes |
of |
| T11200 |
23865-23870 |
DT |
denotes |
these |
| T11201 |
23870-23872 |
, |
denotes |
, |
| T11202 |
23872-23874 |
PRP |
denotes |
we |
| T11203 |
23875-23886 |
RB |
denotes |
transiently |
| T11197 |
23887-23898 |
VBD |
denotes |
transfected |
| T11204 |
23899-23903 |
NN |
denotes |
AQP2 |
| T11206 |
23903-23904 |
HYPH |
denotes |
- |
| T11205 |
23904-23907 |
NN |
denotes |
GFP |
| T11208 |
23908-23910 |
CC |
denotes |
or |
| T11209 |
23911-23915 |
NN |
denotes |
AQP2 |
| T11211 |
23915-23916 |
HYPH |
denotes |
- |
| T11212 |
23916-23921 |
NN |
denotes |
F204V |
| T11213 |
23921-23922 |
HYPH |
denotes |
- |
| T11210 |
23922-23925 |
NN |
denotes |
GFP |
| T11214 |
23926-23936 |
NN |
denotes |
expression |
| T11207 |
23937-23947 |
NNS |
denotes |
constructs |
| T11215 |
23947-23948 |
. |
denotes |
. |
| T11216 |
23948-24164 |
sentence |
denotes |
AQP2-GFP localized to the apical surface upon forskolin stimulation whether it was transiently transfected into vector-only cells (Figure 5C, upper left images) or into wild-type AQP2 cells (Figure 5C, upper right). |
| T11217 |
23949-23953 |
NN |
denotes |
AQP2 |
| T11219 |
23953-23954 |
HYPH |
denotes |
- |
| T11218 |
23954-23957 |
NN |
denotes |
GFP |
| T11220 |
23958-23967 |
VBD |
denotes |
localized |
| T11221 |
23968-23970 |
IN |
denotes |
to |
| T11222 |
23971-23974 |
DT |
denotes |
the |
| T11224 |
23975-23981 |
JJ |
denotes |
apical |
| T11223 |
23982-23989 |
NN |
denotes |
surface |
| T11225 |
23990-23994 |
IN |
denotes |
upon |
| T11226 |
23995-24004 |
NN |
denotes |
forskolin |
| T11227 |
24005-24016 |
NN |
denotes |
stimulation |
| T11228 |
24017-24024 |
IN |
denotes |
whether |
| T11230 |
24025-24027 |
PRP |
denotes |
it |
| T11231 |
24028-24031 |
VBD |
denotes |
was |
| T11232 |
24032-24043 |
RB |
denotes |
transiently |
| T11229 |
24044-24055 |
VBN |
denotes |
transfected |
| T11233 |
24056-24060 |
IN |
denotes |
into |
| T11234 |
24061-24067 |
NN |
denotes |
vector |
| T11236 |
24067-24068 |
HYPH |
denotes |
- |
| T11235 |
24068-24072 |
JJ |
denotes |
only |
| T11237 |
24073-24078 |
NNS |
denotes |
cells |
| T11238 |
24079-24080 |
-LRB- |
denotes |
( |
| T11240 |
24080-24086 |
NN |
denotes |
Figure |
| T11241 |
24087-24089 |
CD |
denotes |
5C |
| T11242 |
24089-24091 |
, |
denotes |
, |
| T11243 |
24091-24096 |
JJ |
denotes |
upper |
| T11244 |
24097-24101 |
JJ |
denotes |
left |
| T11239 |
24102-24108 |
NNS |
denotes |
images |
| T11245 |
24108-24109 |
-RRB- |
denotes |
) |
| T11246 |
24110-24112 |
CC |
denotes |
or |
| T11247 |
24113-24117 |
IN |
denotes |
into |
| T11248 |
24118-24122 |
JJ |
denotes |
wild |
| T11250 |
24122-24123 |
HYPH |
denotes |
- |
| T11249 |
24123-24127 |
NN |
denotes |
type |
| T11252 |
24128-24132 |
NN |
denotes |
AQP2 |
| T11251 |
24133-24138 |
NNS |
denotes |
cells |
| T11253 |
24139-24140 |
-LRB- |
denotes |
( |
| T11254 |
24140-24146 |
NN |
denotes |
Figure |
| T11255 |
24147-24149 |
CD |
denotes |
5C |
| T11256 |
24149-24151 |
, |
denotes |
, |
| T11257 |
24151-24156 |
JJ |
denotes |
upper |
| T11258 |
24157-24162 |
JJ |
denotes |
right |
| T11259 |
24162-24163 |
-RRB- |
denotes |
) |
| T11260 |
24163-24164 |
. |
denotes |
. |
| T11261 |
24164-24320 |
sentence |
denotes |
AQP2-F204V-GFP, when expressed by transient transfection into vector only cells, showed a diffuse cytoplasmic distribution pattern (Figure 5C, lower left). |
| T11262 |
24165-24169 |
NN |
denotes |
AQP2 |
| T11264 |
24169-24170 |
HYPH |
denotes |
- |
| T11265 |
24170-24175 |
NN |
denotes |
F204V |
| T11266 |
24175-24176 |
HYPH |
denotes |
- |
| T11263 |
24176-24179 |
NN |
denotes |
GFP |
| T11268 |
24179-24181 |
, |
denotes |
, |
| T11269 |
24181-24185 |
WRB |
denotes |
when |
| T11270 |
24186-24195 |
VBN |
denotes |
expressed |
| T11271 |
24196-24198 |
IN |
denotes |
by |
| T11272 |
24199-24208 |
JJ |
denotes |
transient |
| T11273 |
24209-24221 |
NN |
denotes |
transfection |
| T11274 |
24222-24226 |
IN |
denotes |
into |
| T11275 |
24227-24233 |
NN |
denotes |
vector |
| T11276 |
24234-24238 |
JJ |
denotes |
only |
| T11277 |
24239-24244 |
NNS |
denotes |
cells |
| T11278 |
24244-24246 |
, |
denotes |
, |
| T11267 |
24246-24252 |
VBD |
denotes |
showed |
| T11279 |
24253-24254 |
DT |
denotes |
a |
| T11281 |
24255-24262 |
JJ |
denotes |
diffuse |
| T11282 |
24263-24274 |
JJ |
denotes |
cytoplasmic |
| T11283 |
24275-24287 |
NN |
denotes |
distribution |
| T11280 |
24288-24295 |
NN |
denotes |
pattern |
| T11284 |
24296-24297 |
-LRB- |
denotes |
( |
| T11286 |
24297-24303 |
NN |
denotes |
Figure |
| T11287 |
24304-24306 |
CD |
denotes |
5C |
| T11288 |
24306-24308 |
, |
denotes |
, |
| T11289 |
24308-24313 |
JJ |
denotes |
lower |
| T11285 |
24314-24318 |
JJ |
denotes |
left |
| T11290 |
24318-24319 |
-RRB- |
denotes |
) |
| T11291 |
24319-24320 |
. |
denotes |
. |
| T11292 |
24320-24476 |
sentence |
denotes |
When expressed in wild-type AQP2 cells, however, AQP2-F204V-GFP localized to the apical surface to varying degrees (Figure 5C, lower right images [i–iii]). |
| T11293 |
24321-24325 |
WRB |
denotes |
When |
| T11294 |
24326-24335 |
VBN |
denotes |
expressed |
| T11296 |
24336-24338 |
IN |
denotes |
in |
| T11297 |
24339-24343 |
JJ |
denotes |
wild |
| T11299 |
24343-24344 |
HYPH |
denotes |
- |
| T11298 |
24344-24348 |
NN |
denotes |
type |
| T11301 |
24349-24353 |
NN |
denotes |
AQP2 |
| T11300 |
24354-24359 |
NNS |
denotes |
cells |
| T11302 |
24359-24361 |
, |
denotes |
, |
| T11303 |
24361-24368 |
RB |
denotes |
however |
| T11304 |
24368-24370 |
, |
denotes |
, |
| T11305 |
24370-24374 |
NN |
denotes |
AQP2 |
| T11307 |
24374-24375 |
HYPH |
denotes |
- |
| T11308 |
24375-24380 |
NN |
denotes |
F204V |
| T11309 |
24380-24381 |
HYPH |
denotes |
- |
| T11306 |
24381-24384 |
NN |
denotes |
GFP |
| T11295 |
24385-24394 |
VBD |
denotes |
localized |
| T11310 |
24395-24397 |
IN |
denotes |
to |
| T11311 |
24398-24401 |
DT |
denotes |
the |
| T11313 |
24402-24408 |
JJ |
denotes |
apical |
| T11312 |
24409-24416 |
NN |
denotes |
surface |
| T11314 |
24417-24419 |
IN |
denotes |
to |
| T11315 |
24420-24427 |
VBG |
denotes |
varying |
| T11316 |
24428-24435 |
NNS |
denotes |
degrees |
| T11317 |
24436-24437 |
-LRB- |
denotes |
( |
| T11319 |
24437-24443 |
NN |
denotes |
Figure |
| T11320 |
24444-24446 |
CD |
denotes |
5C |
| T11321 |
24446-24448 |
, |
denotes |
, |
| T11322 |
24448-24453 |
JJ |
denotes |
lower |
| T11323 |
24454-24459 |
JJ |
denotes |
right |
| T11318 |
24460-24466 |
NNS |
denotes |
images |
| T11324 |
24467-24468 |
-LRB- |
denotes |
[ |
| T11325 |
24468-24469 |
CD |
denotes |
i |
| T11326 |
24469-24470 |
SYM |
denotes |
– |
| T11327 |
24470-24473 |
CD |
denotes |
iii |
| T11328 |
24473-24474 |
-RRB- |
denotes |
] |
| T11329 |
24474-24475 |
-RRB- |
denotes |
) |
| T11330 |
24475-24476 |
. |
denotes |
. |
| T11331 |
24476-24558 |
sentence |
denotes |
The lower right images of Figure 5C shows three cells from a single transfection. |
| T11332 |
24477-24480 |
DT |
denotes |
The |
| T11334 |
24481-24486 |
JJ |
denotes |
lower |
| T11335 |
24487-24492 |
JJ |
denotes |
right |
| T11333 |
24493-24499 |
NNS |
denotes |
images |
| T11337 |
24500-24502 |
IN |
denotes |
of |
| T11338 |
24503-24509 |
NN |
denotes |
Figure |
| T11339 |
24510-24512 |
CD |
denotes |
5C |
| T11336 |
24513-24518 |
VBZ |
denotes |
shows |
| T11340 |
24519-24524 |
CD |
denotes |
three |
| T11341 |
24525-24530 |
NNS |
denotes |
cells |
| T11342 |
24531-24535 |
IN |
denotes |
from |
| T11343 |
24536-24537 |
DT |
denotes |
a |
| T11345 |
24538-24544 |
JJ |
denotes |
single |
| T11344 |
24545-24557 |
NN |
denotes |
transfection |
| T11346 |
24557-24558 |
. |
denotes |
. |
| T11347 |
24558-24706 |
sentence |
denotes |
The first is a nontransfected cell that shows the localization of the stably expressing wild-type AQP2, which is apical upon forskolin stimulation. |
| T11348 |
24559-24562 |
DT |
denotes |
The |
| T11349 |
24563-24568 |
JJ |
denotes |
first |
| T11350 |
24569-24571 |
VBZ |
denotes |
is |
| T11351 |
24572-24573 |
DT |
denotes |
a |
| T11353 |
24574-24588 |
JJ |
denotes |
nontransfected |
| T11352 |
24589-24593 |
NN |
denotes |
cell |
| T11354 |
24594-24598 |
WDT |
denotes |
that |
| T11355 |
24599-24604 |
VBZ |
denotes |
shows |
| T11356 |
24605-24608 |
DT |
denotes |
the |
| T11357 |
24609-24621 |
NN |
denotes |
localization |
| T11358 |
24622-24624 |
IN |
denotes |
of |
| T11359 |
24625-24628 |
DT |
denotes |
the |
| T11361 |
24629-24635 |
RB |
denotes |
stably |
| T11362 |
24636-24646 |
VBG |
denotes |
expressing |
| T11363 |
24647-24651 |
JJ |
denotes |
wild |
| T11365 |
24651-24652 |
HYPH |
denotes |
- |
| T11364 |
24652-24656 |
NN |
denotes |
type |
| T11360 |
24657-24661 |
NN |
denotes |
AQP2 |
| T11366 |
24661-24663 |
, |
denotes |
, |
| T11367 |
24663-24668 |
WDT |
denotes |
which |
| T11368 |
24669-24671 |
VBZ |
denotes |
is |
| T11369 |
24672-24678 |
JJ |
denotes |
apical |
| T11370 |
24679-24683 |
IN |
denotes |
upon |
| T11371 |
24684-24693 |
NN |
denotes |
forskolin |
| T11372 |
24694-24705 |
NN |
denotes |
stimulation |
| T11373 |
24705-24706 |
. |
denotes |
. |
| T11374 |
24706-24803 |
sentence |
denotes |
The next two show expression of both the stable wild-type AQP2 and the transient AQP2-F204V-GFP. |
| T11375 |
24707-24710 |
DT |
denotes |
The |
| T11377 |
24711-24715 |
JJ |
denotes |
next |
| T11376 |
24716-24719 |
CD |
denotes |
two |
| T11378 |
24720-24724 |
VBP |
denotes |
show |
| T11379 |
24725-24735 |
NN |
denotes |
expression |
| T11380 |
24736-24738 |
IN |
denotes |
of |
| T11381 |
24739-24743 |
CC |
denotes |
both |
| T11383 |
24744-24747 |
DT |
denotes |
the |
| T11384 |
24748-24754 |
JJ |
denotes |
stable |
| T11385 |
24755-24759 |
JJ |
denotes |
wild |
| T11387 |
24759-24760 |
HYPH |
denotes |
- |
| T11386 |
24760-24764 |
NN |
denotes |
type |
| T11382 |
24765-24769 |
NN |
denotes |
AQP2 |
| T11388 |
24770-24773 |
CC |
denotes |
and |
| T11389 |
24774-24777 |
DT |
denotes |
the |
| T11391 |
24778-24787 |
JJ |
denotes |
transient |
| T11392 |
24788-24792 |
NN |
denotes |
AQP2 |
| T11393 |
24792-24793 |
HYPH |
denotes |
- |
| T11394 |
24793-24798 |
NN |
denotes |
F204V |
| T11395 |
24798-24799 |
HYPH |
denotes |
- |
| T11390 |
24799-24802 |
NN |
denotes |
GFP |
| T11396 |
24802-24803 |
. |
denotes |
. |
| T11397 |
24803-24936 |
sentence |
denotes |
In cell (ii), localization of wild-type AQP2 was indistinguishable from AQP2-F204V-GFP; both were apical upon forskolin stimulation. |
| T11398 |
24804-24806 |
IN |
denotes |
In |
| T11400 |
24807-24811 |
NN |
denotes |
cell |
| T11401 |
24812-24813 |
-LRB- |
denotes |
( |
| T11402 |
24813-24815 |
CD |
denotes |
ii |
| T11403 |
24815-24816 |
-RRB- |
denotes |
) |
| T11404 |
24816-24818 |
, |
denotes |
, |
| T11405 |
24818-24830 |
NN |
denotes |
localization |
| T11406 |
24831-24833 |
IN |
denotes |
of |
| T11407 |
24834-24838 |
JJ |
denotes |
wild |
| T11409 |
24838-24839 |
HYPH |
denotes |
- |
| T11408 |
24839-24843 |
NN |
denotes |
type |
| T11410 |
24844-24848 |
NN |
denotes |
AQP2 |
| T11399 |
24849-24852 |
VBD |
denotes |
was |
| T11412 |
24853-24870 |
JJ |
denotes |
indistinguishable |
| T11413 |
24871-24875 |
IN |
denotes |
from |
| T11414 |
24876-24880 |
NN |
denotes |
AQP2 |
| T11416 |
24880-24881 |
HYPH |
denotes |
- |
| T11417 |
24881-24886 |
NN |
denotes |
F204V |
| T11418 |
24886-24887 |
HYPH |
denotes |
- |
| T11415 |
24887-24890 |
NN |
denotes |
GFP |
| T11419 |
24890-24891 |
: |
denotes |
; |
| T11420 |
24892-24896 |
DT |
denotes |
both |
| T11411 |
24897-24901 |
VBD |
denotes |
were |
| T11421 |
24902-24908 |
JJ |
denotes |
apical |
| T11422 |
24909-24913 |
IN |
denotes |
upon |
| T11423 |
24914-24923 |
NN |
denotes |
forskolin |
| T11424 |
24924-24935 |
NN |
denotes |
stimulation |
| T11425 |
24935-24936 |
. |
denotes |
. |
| T11426 |
24936-25041 |
sentence |
denotes |
Although the effect was subtle in cell (iii), AQP2-F204V-GFP was partly localized to the apical surface. |
| T11427 |
24937-24945 |
IN |
denotes |
Although |
| T11429 |
24946-24949 |
DT |
denotes |
the |
| T11430 |
24950-24956 |
NN |
denotes |
effect |
| T11428 |
24957-24960 |
VBD |
denotes |
was |
| T11432 |
24961-24967 |
JJ |
denotes |
subtle |
| T11433 |
24968-24970 |
IN |
denotes |
in |
| T11434 |
24971-24975 |
NN |
denotes |
cell |
| T11435 |
24976-24977 |
-LRB- |
denotes |
( |
| T11436 |
24977-24980 |
CD |
denotes |
iii |
| T11437 |
24980-24981 |
-RRB- |
denotes |
) |
| T11438 |
24981-24983 |
, |
denotes |
, |
| T11439 |
24983-24987 |
NN |
denotes |
AQP2 |
| T11441 |
24987-24988 |
HYPH |
denotes |
- |
| T11442 |
24988-24993 |
NN |
denotes |
F204V |
| T11443 |
24993-24994 |
HYPH |
denotes |
- |
| T11440 |
24994-24997 |
NN |
denotes |
GFP |
| T11444 |
24998-25001 |
VBD |
denotes |
was |
| T11445 |
25002-25008 |
RB |
denotes |
partly |
| T11431 |
25009-25018 |
VBN |
denotes |
localized |
| T11446 |
25019-25021 |
IN |
denotes |
to |
| T11447 |
25022-25025 |
DT |
denotes |
the |
| T11449 |
25026-25032 |
JJ |
denotes |
apical |
| T11448 |
25033-25040 |
NN |
denotes |
surface |
| T11450 |
25040-25041 |
. |
denotes |
. |
| T11451 |
25041-25151 |
sentence |
denotes |
Generally, the localization of AQP2-F204V-GFP was clearly more apical when wild-type AQP2 was also expressed. |
| T11452 |
25042-25051 |
RB |
denotes |
Generally |
| T11454 |
25051-25053 |
, |
denotes |
, |
| T11455 |
25053-25056 |
DT |
denotes |
the |
| T11456 |
25057-25069 |
NN |
denotes |
localization |
| T11457 |
25070-25072 |
IN |
denotes |
of |
| T11458 |
25073-25077 |
NN |
denotes |
AQP2 |
| T11460 |
25077-25078 |
HYPH |
denotes |
- |
| T11461 |
25078-25083 |
NN |
denotes |
F204V |
| T11462 |
25083-25084 |
HYPH |
denotes |
- |
| T11459 |
25084-25087 |
NN |
denotes |
GFP |
| T11453 |
25088-25091 |
VBD |
denotes |
was |
| T11463 |
25092-25099 |
RB |
denotes |
clearly |
| T11464 |
25100-25104 |
RBR |
denotes |
more |
| T11465 |
25105-25111 |
JJ |
denotes |
apical |
| T11466 |
25112-25116 |
WRB |
denotes |
when |
| T11468 |
25117-25121 |
JJ |
denotes |
wild |
| T11470 |
25121-25122 |
HYPH |
denotes |
- |
| T11469 |
25122-25126 |
NN |
denotes |
type |
| T11471 |
25127-25131 |
NN |
denotes |
AQP2 |
| T11472 |
25132-25135 |
VBD |
denotes |
was |
| T11473 |
25136-25140 |
RB |
denotes |
also |
| T11467 |
25141-25150 |
VBN |
denotes |
expressed |
| T11474 |
25150-25151 |
. |
denotes |
. |
| T11475 |
25151-25384 |
sentence |
denotes |
To confirm these results biochemically, we transfected the same cell lines (wild-type AQP2 or vector) with F204V-GFP, biotinylated surface proteins after forskolin stimulation, and precipitated the biotinylated proteins (Figure 5D). |
| T11476 |
25152-25154 |
TO |
denotes |
To |
| T11477 |
25155-25162 |
VB |
denotes |
confirm |
| T11479 |
25163-25168 |
DT |
denotes |
these |
| T11480 |
25169-25176 |
NNS |
denotes |
results |
| T11481 |
25177-25190 |
RB |
denotes |
biochemically |
| T11482 |
25190-25192 |
, |
denotes |
, |
| T11483 |
25192-25194 |
PRP |
denotes |
we |
| T11478 |
25195-25206 |
VBD |
denotes |
transfected |
| T11484 |
25207-25210 |
DT |
denotes |
the |
| T11486 |
25211-25215 |
JJ |
denotes |
same |
| T11487 |
25216-25220 |
NN |
denotes |
cell |
| T11485 |
25221-25226 |
NNS |
denotes |
lines |
| T11488 |
25227-25228 |
-LRB- |
denotes |
( |
| T11489 |
25228-25232 |
JJ |
denotes |
wild |
| T11491 |
25232-25233 |
HYPH |
denotes |
- |
| T11490 |
25233-25237 |
NN |
denotes |
type |
| T11492 |
25238-25242 |
NN |
denotes |
AQP2 |
| T11493 |
25243-25245 |
CC |
denotes |
or |
| T11494 |
25246-25252 |
NN |
denotes |
vector |
| T11495 |
25252-25253 |
-RRB- |
denotes |
) |
| T11496 |
25254-25258 |
IN |
denotes |
with |
| T11497 |
25259-25264 |
NN |
denotes |
F204V |
| T11499 |
25264-25265 |
HYPH |
denotes |
- |
| T11498 |
25265-25268 |
NN |
denotes |
GFP |
| T11500 |
25268-25270 |
, |
denotes |
, |
| T11501 |
25270-25282 |
VBD |
denotes |
biotinylated |
| T11502 |
25283-25290 |
NN |
denotes |
surface |
| T11503 |
25291-25299 |
NN |
denotes |
proteins |
| T11504 |
25300-25305 |
IN |
denotes |
after |
| T11505 |
25306-25315 |
NN |
denotes |
forskolin |
| T11506 |
25316-25327 |
NN |
denotes |
stimulation |
| T11507 |
25327-25329 |
, |
denotes |
, |
| T11508 |
25329-25332 |
CC |
denotes |
and |
| T11509 |
25333-25345 |
VBD |
denotes |
precipitated |
| T11510 |
25346-25349 |
DT |
denotes |
the |
| T11512 |
25350-25362 |
VBN |
denotes |
biotinylated |
| T11511 |
25363-25371 |
NN |
denotes |
proteins |
| T11513 |
25372-25373 |
-LRB- |
denotes |
( |
| T11514 |
25373-25379 |
NN |
denotes |
Figure |
| T11515 |
25380-25382 |
CD |
denotes |
5D |
| T11516 |
25382-25383 |
-RRB- |
denotes |
) |
| T11517 |
25383-25384 |
. |
denotes |
. |
| T11518 |
25384-25577 |
sentence |
denotes |
AQP2-F204V-GFP is expressed approximately equally in both cell lines (Figure 5D, total cells), but is biotinylated only when wild-type AQP2 is also expressed (Figure 5D, surface biotinylated). |
| T11519 |
25385-25389 |
NN |
denotes |
AQP2 |
| T11521 |
25389-25390 |
HYPH |
denotes |
- |
| T11522 |
25390-25395 |
NN |
denotes |
F204V |
| T11523 |
25395-25396 |
HYPH |
denotes |
- |
| T11520 |
25396-25399 |
NN |
denotes |
GFP |
| T11525 |
25400-25402 |
VBZ |
denotes |
is |
| T11524 |
25403-25412 |
VBN |
denotes |
expressed |
| T11526 |
25413-25426 |
RB |
denotes |
approximately |
| T11527 |
25427-25434 |
RB |
denotes |
equally |
| T11528 |
25435-25437 |
IN |
denotes |
in |
| T11529 |
25438-25442 |
DT |
denotes |
both |
| T11531 |
25443-25447 |
NN |
denotes |
cell |
| T11530 |
25448-25453 |
NNS |
denotes |
lines |
| T11532 |
25454-25455 |
-LRB- |
denotes |
( |
| T11534 |
25455-25461 |
NN |
denotes |
Figure |
| T11535 |
25462-25464 |
CD |
denotes |
5D |
| T11536 |
25464-25466 |
, |
denotes |
, |
| T11537 |
25466-25471 |
JJ |
denotes |
total |
| T11533 |
25472-25477 |
NNS |
denotes |
cells |
| T11538 |
25477-25478 |
-RRB- |
denotes |
) |
| T11539 |
25478-25480 |
, |
denotes |
, |
| T11540 |
25480-25483 |
CC |
denotes |
but |
| T11541 |
25484-25486 |
VBZ |
denotes |
is |
| T11542 |
25487-25499 |
VBN |
denotes |
biotinylated |
| T11543 |
25500-25504 |
RB |
denotes |
only |
| T11545 |
25505-25509 |
WRB |
denotes |
when |
| T11546 |
25510-25514 |
JJ |
denotes |
wild |
| T11548 |
25514-25515 |
HYPH |
denotes |
- |
| T11547 |
25515-25519 |
NN |
denotes |
type |
| T11549 |
25520-25524 |
NN |
denotes |
AQP2 |
| T11550 |
25525-25527 |
VBZ |
denotes |
is |
| T11551 |
25528-25532 |
RB |
denotes |
also |
| T11544 |
25533-25542 |
VBN |
denotes |
expressed |
| T11552 |
25543-25544 |
-LRB- |
denotes |
( |
| T11553 |
25544-25550 |
NN |
denotes |
Figure |
| T11554 |
25551-25553 |
CD |
denotes |
5D |
| T11555 |
25553-25555 |
, |
denotes |
, |
| T11556 |
25555-25562 |
NN |
denotes |
surface |
| T11557 |
25563-25575 |
VBN |
denotes |
biotinylated |
| T11558 |
25575-25576 |
-RRB- |
denotes |
) |
| T11559 |
25576-25577 |
. |
denotes |
. |
| T11560 |
25577-25762 |
sentence |
denotes |
Since only cell surface proteins are accessible to biotin, these results indicate that AQP2-F204V is transported to the cell surface when wild-type AQP2 is present, but not on its own. |
| T11561 |
25578-25583 |
IN |
denotes |
Since |
| T11563 |
25584-25588 |
RB |
denotes |
only |
| T11565 |
25589-25593 |
NN |
denotes |
cell |
| T11566 |
25594-25601 |
NN |
denotes |
surface |
| T11564 |
25602-25610 |
NN |
denotes |
proteins |
| T11562 |
25611-25614 |
VBP |
denotes |
are |
| T11568 |
25615-25625 |
JJ |
denotes |
accessible |
| T11569 |
25626-25628 |
IN |
denotes |
to |
| T11570 |
25629-25635 |
NN |
denotes |
biotin |
| T11571 |
25635-25637 |
, |
denotes |
, |
| T11572 |
25637-25642 |
DT |
denotes |
these |
| T11573 |
25643-25650 |
NNS |
denotes |
results |
| T11567 |
25651-25659 |
VBP |
denotes |
indicate |
| T11574 |
25660-25664 |
IN |
denotes |
that |
| T11576 |
25665-25669 |
NN |
denotes |
AQP2 |
| T11578 |
25669-25670 |
HYPH |
denotes |
- |
| T11577 |
25670-25675 |
NN |
denotes |
F204V |
| T11579 |
25676-25678 |
VBZ |
denotes |
is |
| T11575 |
25679-25690 |
VBN |
denotes |
transported |
| T11580 |
25691-25693 |
IN |
denotes |
to |
| T11581 |
25694-25697 |
DT |
denotes |
the |
| T11583 |
25698-25702 |
NN |
denotes |
cell |
| T11582 |
25703-25710 |
NN |
denotes |
surface |
| T11584 |
25711-25715 |
WRB |
denotes |
when |
| T11586 |
25716-25720 |
JJ |
denotes |
wild |
| T11588 |
25720-25721 |
HYPH |
denotes |
- |
| T11587 |
25721-25725 |
NN |
denotes |
type |
| T11589 |
25726-25730 |
NN |
denotes |
AQP2 |
| T11585 |
25731-25733 |
VBZ |
denotes |
is |
| T11590 |
25734-25741 |
JJ |
denotes |
present |
| T11591 |
25741-25743 |
, |
denotes |
, |
| T11592 |
25743-25746 |
CC |
denotes |
but |
| T11593 |
25747-25750 |
RB |
denotes |
not |
| T11594 |
25751-25753 |
IN |
denotes |
on |
| T11595 |
25754-25757 |
PRP$ |
denotes |
its |
| T11596 |
25758-25761 |
JJ |
denotes |
own |
| T11597 |
25761-25762 |
. |
denotes |
. |
| T14172 |
25775-25783 |
NN |
denotes |
Aqp2F204 |
| T14174 |
25783-25784 |
HYPH |
denotes |
/ |
| T14173 |
25784-25789 |
NN |
denotes |
F204V |
| T14175 |
25790-25794 |
NNS |
denotes |
mice |
| T14176 |
25795-25798 |
VBP |
denotes |
are |
| T14177 |
25799-25805 |
JJ |
denotes |
viable |
| T14178 |
25806-25809 |
CC |
denotes |
and |
| T14179 |
25810-25814 |
VBP |
denotes |
grow |
| T14180 |
25815-25818 |
CC |
denotes |
and |
| T14181 |
25819-25828 |
VBP |
denotes |
reproduce |
| T14182 |
25829-25837 |
RB |
denotes |
normally |
| T14183 |
25837-25838 |
. |
denotes |
. |
| T14184 |
25838-26037 |
sentence |
denotes |
They are, however, severely defective in their ability to concentrate urine, leading to increased urine output and water intake, thus making them the first mouse model of NDI to survive to maturity. |
| T14185 |
25839-25843 |
PRP |
denotes |
They |
| T14186 |
25844-25847 |
VBP |
denotes |
are |
| T14187 |
25847-25849 |
, |
denotes |
, |
| T14188 |
25849-25856 |
RB |
denotes |
however |
| T14189 |
25856-25858 |
, |
denotes |
, |
| T14190 |
25858-25866 |
RB |
denotes |
severely |
| T14191 |
25867-25876 |
JJ |
denotes |
defective |
| T14192 |
25877-25879 |
IN |
denotes |
in |
| T14193 |
25880-25885 |
PRP$ |
denotes |
their |
| T14194 |
25886-25893 |
NN |
denotes |
ability |
| T14195 |
25894-25896 |
TO |
denotes |
to |
| T14196 |
25897-25908 |
VB |
denotes |
concentrate |
| T14197 |
25909-25914 |
NN |
denotes |
urine |
| T14198 |
25914-25916 |
, |
denotes |
, |
| T14199 |
25916-25923 |
VBG |
denotes |
leading |
| T14200 |
25924-25926 |
IN |
denotes |
to |
| T14201 |
25927-25936 |
VBN |
denotes |
increased |
| T14203 |
25937-25942 |
NN |
denotes |
urine |
| T14202 |
25943-25949 |
NN |
denotes |
output |
| T14204 |
25950-25953 |
CC |
denotes |
and |
| T14205 |
25954-25959 |
NN |
denotes |
water |
| T14206 |
25960-25966 |
NN |
denotes |
intake |
| T14207 |
25966-25968 |
, |
denotes |
, |
| T14208 |
25968-25972 |
RB |
denotes |
thus |
| T14209 |
25973-25979 |
VBG |
denotes |
making |
| T14210 |
25980-25984 |
PRP |
denotes |
them |
| T14212 |
25985-25988 |
DT |
denotes |
the |
| T14213 |
25989-25994 |
JJ |
denotes |
first |
| T14214 |
25995-26000 |
NN |
denotes |
mouse |
| T14211 |
26001-26006 |
NN |
denotes |
model |
| T14215 |
26007-26009 |
IN |
denotes |
of |
| T14216 |
26010-26013 |
NN |
denotes |
NDI |
| T14217 |
26014-26016 |
TO |
denotes |
to |
| T14218 |
26017-26024 |
VB |
denotes |
survive |
| T14219 |
26025-26027 |
IN |
denotes |
to |
| T14220 |
26028-26036 |
NN |
denotes |
maturity |
| T14221 |
26036-26037 |
. |
denotes |
. |
| T14222 |
26037-26093 |
sentence |
denotes |
In humans, NDI is caused by mutations in Avpr2 or Aqp2. |
| T14223 |
26038-26040 |
IN |
denotes |
In |
| T14225 |
26041-26047 |
NNS |
denotes |
humans |
| T14226 |
26047-26049 |
, |
denotes |
, |
| T14227 |
26049-26052 |
NN |
denotes |
NDI |
| T14228 |
26053-26055 |
VBZ |
denotes |
is |
| T14224 |
26056-26062 |
VBN |
denotes |
caused |
| T14229 |
26063-26065 |
IN |
denotes |
by |
| T14230 |
26066-26075 |
NNS |
denotes |
mutations |
| T14231 |
26076-26078 |
IN |
denotes |
in |
| T14232 |
26079-26084 |
NN |
denotes |
Avpr2 |
| T14233 |
26085-26087 |
CC |
denotes |
or |
| T14234 |
26088-26092 |
NN |
denotes |
Aqp2 |
| T14235 |
26092-26093 |
. |
denotes |
. |
| T14236 |
26093-26288 |
sentence |
denotes |
Knockout of the X-linked Avpr2 gene in mice [15] gave an NDI-like phenotype in male, hemizygous neonates, but the phenotype could not be assessed in adults as the mice died within 1 wk of birth. |
| T14237 |
26094-26102 |
NN |
denotes |
Knockout |
| T14239 |
26103-26105 |
IN |
denotes |
of |
| T14240 |
26106-26109 |
DT |
denotes |
the |
| T14242 |
26110-26111 |
NN |
denotes |
X |
| T14244 |
26111-26112 |
HYPH |
denotes |
- |
| T14243 |
26112-26118 |
VBN |
denotes |
linked |
| T14245 |
26119-26124 |
NN |
denotes |
Avpr2 |
| T14241 |
26125-26129 |
NN |
denotes |
gene |
| T14246 |
26130-26132 |
IN |
denotes |
in |
| T14247 |
26133-26137 |
NNS |
denotes |
mice |
| T14248 |
26138-26139 |
-LRB- |
denotes |
[ |
| T14249 |
26139-26141 |
CD |
denotes |
15 |
| T14250 |
26141-26142 |
-RRB- |
denotes |
] |
| T14238 |
26143-26147 |
VBD |
denotes |
gave |
| T14251 |
26148-26150 |
DT |
denotes |
an |
| T14253 |
26151-26154 |
NN |
denotes |
NDI |
| T14255 |
26154-26155 |
HYPH |
denotes |
- |
| T14254 |
26155-26159 |
JJ |
denotes |
like |
| T14252 |
26160-26169 |
NN |
denotes |
phenotype |
| T14256 |
26170-26172 |
IN |
denotes |
in |
| T14257 |
26173-26177 |
JJ |
denotes |
male |
| T14259 |
26177-26179 |
, |
denotes |
, |
| T14260 |
26179-26189 |
JJ |
denotes |
hemizygous |
| T14258 |
26190-26198 |
NNS |
denotes |
neonates |
| T14261 |
26198-26200 |
, |
denotes |
, |
| T14262 |
26200-26203 |
CC |
denotes |
but |
| T14263 |
26204-26207 |
DT |
denotes |
the |
| T14264 |
26208-26217 |
NN |
denotes |
phenotype |
| T14266 |
26218-26223 |
MD |
denotes |
could |
| T14267 |
26224-26227 |
RB |
denotes |
not |
| T14268 |
26228-26230 |
VB |
denotes |
be |
| T14265 |
26231-26239 |
VBN |
denotes |
assessed |
| T14269 |
26240-26242 |
IN |
denotes |
in |
| T14270 |
26243-26249 |
NNS |
denotes |
adults |
| T14271 |
26250-26252 |
IN |
denotes |
as |
| T14273 |
26253-26256 |
DT |
denotes |
the |
| T14274 |
26257-26261 |
NNS |
denotes |
mice |
| T14272 |
26262-26266 |
VBD |
denotes |
died |
| T14275 |
26267-26273 |
IN |
denotes |
within |
| T14276 |
26274-26275 |
CD |
denotes |
1 |
| T14277 |
26276-26278 |
NN |
denotes |
wk |
| T14278 |
26279-26281 |
IN |
denotes |
of |
| T14279 |
26282-26287 |
NN |
denotes |
birth |
| T14280 |
26287-26288 |
. |
denotes |
. |
| T14281 |
26288-26423 |
sentence |
denotes |
The adult heterozygous females showed a mild tendency toward increased urinary output and water intake and decreased urine osmolality. |
| T14282 |
26289-26292 |
DT |
denotes |
The |
| T14284 |
26293-26298 |
JJ |
denotes |
adult |
| T14285 |
26299-26311 |
JJ |
denotes |
heterozygous |
| T14283 |
26312-26319 |
NNS |
denotes |
females |
| T14286 |
26320-26326 |
VBD |
denotes |
showed |
| T14287 |
26327-26328 |
DT |
denotes |
a |
| T14289 |
26329-26333 |
JJ |
denotes |
mild |
| T14288 |
26334-26342 |
NN |
denotes |
tendency |
| T14290 |
26343-26349 |
IN |
denotes |
toward |
| T14291 |
26350-26359 |
VBN |
denotes |
increased |
| T14293 |
26360-26367 |
JJ |
denotes |
urinary |
| T14292 |
26368-26374 |
NN |
denotes |
output |
| T14294 |
26375-26378 |
CC |
denotes |
and |
| T14295 |
26379-26384 |
NN |
denotes |
water |
| T14296 |
26385-26391 |
NN |
denotes |
intake |
| T14297 |
26392-26395 |
CC |
denotes |
and |
| T14298 |
26396-26405 |
VBN |
denotes |
decreased |
| T14300 |
26406-26411 |
NN |
denotes |
urine |
| T14299 |
26412-26422 |
NN |
denotes |
osmolality |
| T14301 |
26422-26423 |
. |
denotes |
. |
| T14302 |
26423-26478 |
sentence |
denotes |
Knockout of the mouse Aqp2 gene has not been reported. |
| T14303 |
26424-26432 |
NN |
denotes |
Knockout |
| T14305 |
26433-26435 |
IN |
denotes |
of |
| T14306 |
26436-26439 |
DT |
denotes |
the |
| T14308 |
26440-26445 |
NN |
denotes |
mouse |
| T14309 |
26446-26450 |
NN |
denotes |
Aqp2 |
| T14307 |
26451-26455 |
NN |
denotes |
gene |
| T14310 |
26456-26459 |
VBZ |
denotes |
has |
| T14311 |
26460-26463 |
RB |
denotes |
not |
| T14312 |
26464-26468 |
VBN |
denotes |
been |
| T14304 |
26469-26477 |
VBN |
denotes |
reported |
| T14313 |
26477-26478 |
. |
denotes |
. |
| T14314 |
26478-26563 |
sentence |
denotes |
A knock-in of a human disease-causing mutation (T126M), however, has been made [18]. |
| T14315 |
26479-26480 |
DT |
denotes |
A |
| T14317 |
26481-26486 |
NN |
denotes |
knock |
| T14318 |
26486-26487 |
HYPH |
denotes |
- |
| T14316 |
26487-26489 |
NN |
denotes |
in |
| T14320 |
26490-26492 |
IN |
denotes |
of |
| T14321 |
26493-26494 |
DT |
denotes |
a |
| T14323 |
26495-26500 |
JJ |
denotes |
human |
| T14324 |
26501-26508 |
NN |
denotes |
disease |
| T14326 |
26508-26509 |
HYPH |
denotes |
- |
| T14325 |
26509-26516 |
VBG |
denotes |
causing |
| T14322 |
26517-26525 |
NN |
denotes |
mutation |
| T14327 |
26526-26527 |
-LRB- |
denotes |
( |
| T14328 |
26527-26532 |
NN |
denotes |
T126M |
| T14329 |
26532-26533 |
-RRB- |
denotes |
) |
| T14330 |
26533-26535 |
, |
denotes |
, |
| T14331 |
26535-26542 |
RB |
denotes |
however |
| T14332 |
26542-26544 |
, |
denotes |
, |
| T14333 |
26544-26547 |
VBZ |
denotes |
has |
| T14334 |
26548-26552 |
VBN |
denotes |
been |
| T14319 |
26553-26557 |
VBN |
denotes |
made |
| T14335 |
26558-26559 |
-LRB- |
denotes |
[ |
| T14336 |
26559-26561 |
CD |
denotes |
18 |
| T14337 |
26561-26562 |
-RRB- |
denotes |
] |
| T14338 |
26562-26563 |
. |
denotes |
. |
| T14339 |
26563-26672 |
sentence |
denotes |
These mice have a severe urine-concentrating defect resulting in dehydration and death within 1 wk of birth. |
| T14340 |
26564-26569 |
DT |
denotes |
These |
| T14341 |
26570-26574 |
NNS |
denotes |
mice |
| T14342 |
26575-26579 |
VBP |
denotes |
have |
| T14343 |
26580-26581 |
DT |
denotes |
a |
| T14345 |
26582-26588 |
JJ |
denotes |
severe |
| T14346 |
26589-26594 |
NN |
denotes |
urine |
| T14348 |
26594-26595 |
HYPH |
denotes |
- |
| T14347 |
26595-26608 |
VBG |
denotes |
concentrating |
| T14344 |
26609-26615 |
NN |
denotes |
defect |
| T14349 |
26616-26625 |
VBG |
denotes |
resulting |
| T14350 |
26626-26628 |
IN |
denotes |
in |
| T14351 |
26629-26640 |
NN |
denotes |
dehydration |
| T14352 |
26641-26644 |
CC |
denotes |
and |
| T14353 |
26645-26650 |
NN |
denotes |
death |
| T14354 |
26651-26657 |
IN |
denotes |
within |
| T14355 |
26658-26659 |
CD |
denotes |
1 |
| T14356 |
26660-26662 |
NN |
denotes |
wk |
| T14357 |
26663-26665 |
IN |
denotes |
of |
| T14358 |
26666-26671 |
NN |
denotes |
birth |
| T14359 |
26671-26672 |
. |
denotes |
. |
| T14360 |
26672-26748 |
sentence |
denotes |
Curiously, AQP2-T126M does localize properly in at least a subset of cells. |
| T14361 |
26673-26682 |
RB |
denotes |
Curiously |
| T14363 |
26682-26684 |
, |
denotes |
, |
| T14364 |
26684-26688 |
NN |
denotes |
AQP2 |
| T14366 |
26688-26689 |
HYPH |
denotes |
- |
| T14365 |
26689-26694 |
NN |
denotes |
T126M |
| T14367 |
26695-26699 |
VBZ |
denotes |
does |
| T14362 |
26700-26708 |
VB |
denotes |
localize |
| T14368 |
26709-26717 |
RB |
denotes |
properly |
| T14369 |
26718-26720 |
IN |
denotes |
in |
| T14370 |
26721-26723 |
RB |
denotes |
at |
| T14371 |
26724-26729 |
RBS |
denotes |
least |
| T14373 |
26730-26731 |
DT |
denotes |
a |
| T14372 |
26732-26738 |
NN |
denotes |
subset |
| T14374 |
26739-26741 |
IN |
denotes |
of |
| T14375 |
26742-26747 |
NNS |
denotes |
cells |
| T14376 |
26747-26748 |
. |
denotes |
. |
| T14377 |
26748-26873 |
sentence |
denotes |
The grossly abnormal collecting duct morphology makes it impossible to pinpoint the molecular defect in these knock-in mice. |
| T14378 |
26749-26752 |
DT |
denotes |
The |
| T14380 |
26753-26760 |
RB |
denotes |
grossly |
| T14381 |
26761-26769 |
JJ |
denotes |
abnormal |
| T14382 |
26770-26780 |
VBG |
denotes |
collecting |
| T14383 |
26781-26785 |
NN |
denotes |
duct |
| T14379 |
26786-26796 |
NN |
denotes |
morphology |
| T14384 |
26797-26802 |
VBZ |
denotes |
makes |
| T14385 |
26803-26805 |
PRP |
denotes |
it |
| T14386 |
26806-26816 |
JJ |
denotes |
impossible |
| T14387 |
26817-26819 |
TO |
denotes |
to |
| T14388 |
26820-26828 |
VB |
denotes |
pinpoint |
| T14389 |
26829-26832 |
DT |
denotes |
the |
| T14391 |
26833-26842 |
JJ |
denotes |
molecular |
| T14390 |
26843-26849 |
NN |
denotes |
defect |
| T14392 |
26850-26852 |
IN |
denotes |
in |
| T14393 |
26853-26858 |
DT |
denotes |
these |
| T14395 |
26859-26864 |
VB |
denotes |
knock |
| T14396 |
26864-26865 |
HYPH |
denotes |
- |
| T14397 |
26865-26867 |
RP |
denotes |
in |
| T14394 |
26868-26872 |
NNS |
denotes |
mice |
| T14398 |
26872-26873 |
. |
denotes |
. |
| T14399 |
26873-26943 |
sentence |
denotes |
The T126M knock-in clearly shows that Aqp2 is an essential gene [18]. |
| T14400 |
26874-26877 |
DT |
denotes |
The |
| T14402 |
26878-26883 |
NN |
denotes |
T126M |
| T14403 |
26884-26889 |
NN |
denotes |
knock |
| T14404 |
26889-26890 |
HYPH |
denotes |
- |
| T14401 |
26890-26892 |
NN |
denotes |
in |
| T14406 |
26893-26900 |
RB |
denotes |
clearly |
| T14405 |
26901-26906 |
VBZ |
denotes |
shows |
| T14407 |
26907-26911 |
IN |
denotes |
that |
| T14409 |
26912-26916 |
NN |
denotes |
Aqp2 |
| T14408 |
26917-26919 |
VBZ |
denotes |
is |
| T14410 |
26920-26922 |
DT |
denotes |
an |
| T14412 |
26923-26932 |
JJ |
denotes |
essential |
| T14411 |
26933-26937 |
NN |
denotes |
gene |
| T14413 |
26938-26939 |
-LRB- |
denotes |
[ |
| T14414 |
26939-26941 |
CD |
denotes |
18 |
| T14415 |
26941-26942 |
-RRB- |
denotes |
] |
| T14416 |
26942-26943 |
. |
denotes |
. |
| T14417 |
26943-27121 |
sentence |
denotes |
The fact that our mice survive shows either that AQP2-F204V possesses some residual water transporting ability or that there are AVP-independent pathways for water reabsorption. |
| T14418 |
26944-26947 |
DT |
denotes |
The |
| T14419 |
26948-26952 |
NN |
denotes |
fact |
| T14421 |
26953-26957 |
IN |
denotes |
that |
| T14423 |
26958-26961 |
PRP$ |
denotes |
our |
| T14424 |
26962-26966 |
NNS |
denotes |
mice |
| T14422 |
26967-26974 |
VBP |
denotes |
survive |
| T14420 |
26975-26980 |
VBZ |
denotes |
shows |
| T14425 |
26981-26987 |
CC |
denotes |
either |
| T14427 |
26988-26992 |
IN |
denotes |
that |
| T14428 |
26993-26997 |
NN |
denotes |
AQP2 |
| T14430 |
26997-26998 |
HYPH |
denotes |
- |
| T14429 |
26998-27003 |
NN |
denotes |
F204V |
| T14426 |
27004-27013 |
VBZ |
denotes |
possesses |
| T14431 |
27014-27018 |
DT |
denotes |
some |
| T14433 |
27019-27027 |
JJ |
denotes |
residual |
| T14434 |
27028-27033 |
NN |
denotes |
water |
| T14435 |
27034-27046 |
VBG |
denotes |
transporting |
| T14432 |
27047-27054 |
NN |
denotes |
ability |
| T14436 |
27055-27057 |
CC |
denotes |
or |
| T14437 |
27058-27062 |
IN |
denotes |
that |
| T14439 |
27063-27068 |
EX |
denotes |
there |
| T14438 |
27069-27072 |
VBP |
denotes |
are |
| T14440 |
27073-27076 |
NN |
denotes |
AVP |
| T14442 |
27076-27077 |
HYPH |
denotes |
- |
| T14441 |
27077-27088 |
JJ |
denotes |
independent |
| T14443 |
27089-27097 |
NNS |
denotes |
pathways |
| T14444 |
27098-27101 |
IN |
denotes |
for |
| T14445 |
27102-27107 |
NN |
denotes |
water |
| T14446 |
27108-27120 |
NN |
denotes |
reabsorption |
| T14447 |
27120-27121 |
. |
denotes |
. |
| T14448 |
27121-27279 |
sentence |
denotes |
Residual activity of AQP2-F204V is likely, as mutant animals show some small response to dDAVP, although dDAVP-stimulated urine osmolality remains quite low. |
| T14449 |
27122-27130 |
JJ |
denotes |
Residual |
| T14450 |
27131-27139 |
NN |
denotes |
activity |
| T14452 |
27140-27142 |
IN |
denotes |
of |
| T14453 |
27143-27147 |
NN |
denotes |
AQP2 |
| T14455 |
27147-27148 |
HYPH |
denotes |
- |
| T14454 |
27148-27153 |
NN |
denotes |
F204V |
| T14451 |
27154-27156 |
VBZ |
denotes |
is |
| T14456 |
27157-27163 |
JJ |
denotes |
likely |
| T14457 |
27163-27165 |
, |
denotes |
, |
| T14458 |
27165-27167 |
IN |
denotes |
as |
| T14460 |
27168-27174 |
NN |
denotes |
mutant |
| T14461 |
27175-27182 |
NNS |
denotes |
animals |
| T14459 |
27183-27187 |
VBP |
denotes |
show |
| T14462 |
27188-27192 |
DT |
denotes |
some |
| T14464 |
27193-27198 |
JJ |
denotes |
small |
| T14463 |
27199-27207 |
NN |
denotes |
response |
| T14465 |
27208-27210 |
IN |
denotes |
to |
| T14466 |
27211-27216 |
NN |
denotes |
dDAVP |
| T14467 |
27216-27218 |
, |
denotes |
, |
| T14468 |
27218-27226 |
IN |
denotes |
although |
| T14470 |
27227-27232 |
NN |
denotes |
dDAVP |
| T14472 |
27232-27233 |
HYPH |
denotes |
- |
| T14471 |
27233-27243 |
VBN |
denotes |
stimulated |
| T14474 |
27244-27249 |
NN |
denotes |
urine |
| T14473 |
27250-27260 |
NN |
denotes |
osmolality |
| T14469 |
27261-27268 |
VBZ |
denotes |
remains |
| T14475 |
27269-27274 |
RB |
denotes |
quite |
| T14476 |
27275-27278 |
JJ |
denotes |
low |
| T14477 |
27278-27279 |
. |
denotes |
. |
| T14478 |
27279-27443 |
sentence |
denotes |
Immunostaining of kidney shows that AQP2-F204V does not efficiently transport water, because it fails to localize to the apical cell surface after dDAVP treatment. |
| T14479 |
27280-27294 |
NN |
denotes |
Immunostaining |
| T14481 |
27295-27297 |
IN |
denotes |
of |
| T14482 |
27298-27304 |
NN |
denotes |
kidney |
| T14480 |
27305-27310 |
VBZ |
denotes |
shows |
| T14483 |
27311-27315 |
IN |
denotes |
that |
| T14485 |
27316-27320 |
NN |
denotes |
AQP2 |
| T14487 |
27320-27321 |
HYPH |
denotes |
- |
| T14486 |
27321-27326 |
NN |
denotes |
F204V |
| T14488 |
27327-27331 |
VBZ |
denotes |
does |
| T14489 |
27332-27335 |
RB |
denotes |
not |
| T14490 |
27336-27347 |
RB |
denotes |
efficiently |
| T14484 |
27348-27357 |
VB |
denotes |
transport |
| T14491 |
27358-27363 |
NN |
denotes |
water |
| T14492 |
27363-27365 |
, |
denotes |
, |
| T14493 |
27365-27372 |
IN |
denotes |
because |
| T14495 |
27373-27375 |
PRP |
denotes |
it |
| T14494 |
27376-27381 |
VBZ |
denotes |
fails |
| T14496 |
27382-27384 |
TO |
denotes |
to |
| T14497 |
27385-27393 |
VB |
denotes |
localize |
| T14498 |
27394-27396 |
IN |
denotes |
to |
| T14499 |
27397-27400 |
DT |
denotes |
the |
| T14501 |
27401-27407 |
JJ |
denotes |
apical |
| T14502 |
27408-27412 |
NN |
denotes |
cell |
| T14500 |
27413-27420 |
NN |
denotes |
surface |
| T14503 |
27421-27426 |
IN |
denotes |
after |
| T14504 |
27427-27432 |
NN |
denotes |
dDAVP |
| T14505 |
27433-27442 |
NN |
denotes |
treatment |
| T14506 |
27442-27443 |
. |
denotes |
. |
| T14507 |
27443-27578 |
sentence |
denotes |
Some residual activity of AQP2 would imply that some small, undetectable portion of the mutant protein is getting to the cell surface. |
| T14508 |
27444-27448 |
DT |
denotes |
Some |
| T14510 |
27449-27457 |
JJ |
denotes |
residual |
| T14509 |
27458-27466 |
NN |
denotes |
activity |
| T14512 |
27467-27469 |
IN |
denotes |
of |
| T14513 |
27470-27474 |
NN |
denotes |
AQP2 |
| T14514 |
27475-27480 |
MD |
denotes |
would |
| T14511 |
27481-27486 |
VB |
denotes |
imply |
| T14515 |
27487-27491 |
IN |
denotes |
that |
| T14517 |
27492-27496 |
DT |
denotes |
some |
| T14519 |
27497-27502 |
JJ |
denotes |
small |
| T14520 |
27502-27504 |
, |
denotes |
, |
| T14521 |
27504-27516 |
JJ |
denotes |
undetectable |
| T14518 |
27517-27524 |
NN |
denotes |
portion |
| T14522 |
27525-27527 |
IN |
denotes |
of |
| T14523 |
27528-27531 |
DT |
denotes |
the |
| T14525 |
27532-27538 |
NN |
denotes |
mutant |
| T14524 |
27539-27546 |
NN |
denotes |
protein |
| T14526 |
27547-27549 |
VBZ |
denotes |
is |
| T14516 |
27550-27557 |
VBG |
denotes |
getting |
| T14527 |
27558-27560 |
IN |
denotes |
to |
| T14528 |
27561-27564 |
DT |
denotes |
the |
| T14530 |
27565-27569 |
NN |
denotes |
cell |
| T14529 |
27570-27577 |
NN |
denotes |
surface |
| T14531 |
27577-27578 |
. |
denotes |
. |
| T14532 |
27578-27741 |
sentence |
denotes |
The surface biotinylation experiment (Figure 5D) suggests that no mutant protein gets to the surface, but this does not necessarily reflect the situation in vivo. |
| T14533 |
27579-27582 |
DT |
denotes |
The |
| T14535 |
27583-27590 |
NN |
denotes |
surface |
| T14536 |
27591-27604 |
NN |
denotes |
biotinylation |
| T14534 |
27605-27615 |
NN |
denotes |
experiment |
| T14538 |
27616-27617 |
-LRB- |
denotes |
( |
| T14539 |
27617-27623 |
NN |
denotes |
Figure |
| T14540 |
27624-27626 |
CD |
denotes |
5D |
| T14541 |
27626-27627 |
-RRB- |
denotes |
) |
| T14537 |
27628-27636 |
VBZ |
denotes |
suggests |
| T14542 |
27637-27641 |
IN |
denotes |
that |
| T14544 |
27642-27644 |
DT |
denotes |
no |
| T14546 |
27645-27651 |
NN |
denotes |
mutant |
| T14545 |
27652-27659 |
NN |
denotes |
protein |
| T14543 |
27660-27664 |
VBZ |
denotes |
gets |
| T14547 |
27665-27667 |
IN |
denotes |
to |
| T14548 |
27668-27671 |
DT |
denotes |
the |
| T14549 |
27672-27679 |
NN |
denotes |
surface |
| T14550 |
27679-27681 |
, |
denotes |
, |
| T14551 |
27681-27684 |
CC |
denotes |
but |
| T14552 |
27685-27689 |
DT |
denotes |
this |
| T14554 |
27690-27694 |
VBZ |
denotes |
does |
| T14555 |
27695-27698 |
RB |
denotes |
not |
| T14556 |
27699-27710 |
RB |
denotes |
necessarily |
| T14553 |
27711-27718 |
VB |
denotes |
reflect |
| T14557 |
27719-27722 |
DT |
denotes |
the |
| T14558 |
27723-27732 |
NN |
denotes |
situation |
| T14559 |
27733-27735 |
FW |
denotes |
in |
| T14560 |
27736-27740 |
FW |
denotes |
vivo |
| T14561 |
27740-27741 |
. |
denotes |
. |
| T14562 |
27741-27933 |
sentence |
denotes |
While this small fraction of protein may not be detectable by immunofluorescence, Western blotting shows that some mutant protein does progress beyond the ER (35–45 kDa species in Figure 3A). |
| T14563 |
27742-27747 |
IN |
denotes |
While |
| T14565 |
27748-27752 |
DT |
denotes |
this |
| T14567 |
27753-27758 |
JJ |
denotes |
small |
| T14566 |
27759-27767 |
NN |
denotes |
fraction |
| T14568 |
27768-27770 |
IN |
denotes |
of |
| T14569 |
27771-27778 |
NN |
denotes |
protein |
| T14570 |
27779-27782 |
MD |
denotes |
may |
| T14571 |
27783-27786 |
RB |
denotes |
not |
| T14564 |
27787-27789 |
VB |
denotes |
be |
| T14573 |
27790-27800 |
JJ |
denotes |
detectable |
| T14574 |
27801-27803 |
IN |
denotes |
by |
| T14575 |
27804-27822 |
NN |
denotes |
immunofluorescence |
| T14576 |
27822-27824 |
, |
denotes |
, |
| T14577 |
27824-27831 |
NNP |
denotes |
Western |
| T14578 |
27832-27840 |
NN |
denotes |
blotting |
| T14572 |
27841-27846 |
VBZ |
denotes |
shows |
| T14579 |
27847-27851 |
IN |
denotes |
that |
| T14581 |
27852-27856 |
DT |
denotes |
some |
| T14583 |
27857-27863 |
NN |
denotes |
mutant |
| T14582 |
27864-27871 |
NN |
denotes |
protein |
| T14584 |
27872-27876 |
VBZ |
denotes |
does |
| T14580 |
27877-27885 |
VB |
denotes |
progress |
| T14585 |
27886-27892 |
IN |
denotes |
beyond |
| T14586 |
27893-27896 |
DT |
denotes |
the |
| T14587 |
27897-27899 |
NN |
denotes |
ER |
| T14588 |
27900-27901 |
-LRB- |
denotes |
( |
| T14590 |
27901-27903 |
CD |
denotes |
35 |
| T14592 |
27903-27904 |
SYM |
denotes |
– |
| T14591 |
27904-27906 |
CD |
denotes |
45 |
| T14593 |
27907-27910 |
NN |
denotes |
kDa |
| T14589 |
27911-27918 |
NNS |
denotes |
species |
| T14594 |
27919-27921 |
IN |
denotes |
in |
| T14595 |
27922-27928 |
NN |
denotes |
Figure |
| T14596 |
27929-27931 |
CD |
denotes |
3A |
| T14597 |
27931-27932 |
-RRB- |
denotes |
) |
| T14598 |
27932-27933 |
. |
denotes |
. |
| T14599 |
27933-28122 |
sentence |
denotes |
Compared to wild-type, mutant protein is enriched in the high-mannose, core-glycosylated form (31 kDa) and deficient in nonglycosylated (29 kDa) and complex glycosylated (35–45 kDa) forms. |
| T14600 |
27934-27942 |
VBN |
denotes |
Compared |
| T14602 |
27943-27945 |
IN |
denotes |
to |
| T14603 |
27946-27950 |
JJ |
denotes |
wild |
| T14605 |
27950-27951 |
HYPH |
denotes |
- |
| T14604 |
27951-27955 |
NN |
denotes |
type |
| T14606 |
27955-27957 |
, |
denotes |
, |
| T14607 |
27957-27963 |
NN |
denotes |
mutant |
| T14608 |
27964-27971 |
NN |
denotes |
protein |
| T14601 |
27972-27974 |
VBZ |
denotes |
is |
| T14609 |
27975-27983 |
VBN |
denotes |
enriched |
| T14610 |
27984-27986 |
IN |
denotes |
in |
| T14611 |
27987-27990 |
DT |
denotes |
the |
| T14613 |
27991-27995 |
JJ |
denotes |
high |
| T14615 |
27995-27996 |
HYPH |
denotes |
- |
| T14614 |
27996-28003 |
NN |
denotes |
mannose |
| T14616 |
28003-28005 |
, |
denotes |
, |
| T14617 |
28005-28009 |
NN |
denotes |
core |
| T14619 |
28009-28010 |
HYPH |
denotes |
- |
| T14618 |
28010-28022 |
VBN |
denotes |
glycosylated |
| T14612 |
28023-28027 |
NN |
denotes |
form |
| T14620 |
28028-28029 |
-LRB- |
denotes |
( |
| T14622 |
28029-28031 |
CD |
denotes |
31 |
| T14621 |
28032-28035 |
NN |
denotes |
kDa |
| T14623 |
28035-28036 |
-RRB- |
denotes |
) |
| T14624 |
28037-28040 |
CC |
denotes |
and |
| T14625 |
28041-28050 |
JJ |
denotes |
deficient |
| T14626 |
28051-28053 |
IN |
denotes |
in |
| T14627 |
28054-28069 |
JJ |
denotes |
nonglycosylated |
| T14629 |
28070-28071 |
-LRB- |
denotes |
( |
| T14631 |
28071-28073 |
CD |
denotes |
29 |
| T14630 |
28074-28077 |
NN |
denotes |
kDa |
| T14632 |
28077-28078 |
-RRB- |
denotes |
) |
| T14633 |
28079-28082 |
CC |
denotes |
and |
| T14634 |
28083-28090 |
JJ |
denotes |
complex |
| T14635 |
28091-28103 |
JJ |
denotes |
glycosylated |
| T14636 |
28104-28105 |
-LRB- |
denotes |
( |
| T14638 |
28105-28107 |
CD |
denotes |
35 |
| T14640 |
28107-28108 |
SYM |
denotes |
– |
| T14639 |
28108-28110 |
CD |
denotes |
45 |
| T14637 |
28111-28114 |
NN |
denotes |
kDa |
| T14641 |
28114-28115 |
-RRB- |
denotes |
) |
| T14628 |
28116-28121 |
NNS |
denotes |
forms |
| T14642 |
28121-28122 |
. |
denotes |
. |
| T14643 |
28122-28301 |
sentence |
denotes |
The presence of a reduced but detectable amount of protein in the 35–45 kDa range indicates that mutant protein is transported out of the ER, but with greatly reduced efficiency. |
| T14644 |
28123-28126 |
DT |
denotes |
The |
| T14645 |
28127-28135 |
NN |
denotes |
presence |
| T14647 |
28136-28138 |
IN |
denotes |
of |
| T14648 |
28139-28140 |
DT |
denotes |
a |
| T14650 |
28141-28148 |
VBN |
denotes |
reduced |
| T14651 |
28149-28152 |
CC |
denotes |
but |
| T14652 |
28153-28163 |
JJ |
denotes |
detectable |
| T14649 |
28164-28170 |
NN |
denotes |
amount |
| T14653 |
28171-28173 |
IN |
denotes |
of |
| T14654 |
28174-28181 |
NN |
denotes |
protein |
| T14655 |
28182-28184 |
IN |
denotes |
in |
| T14656 |
28185-28188 |
DT |
denotes |
the |
| T14658 |
28189-28191 |
CD |
denotes |
35 |
| T14660 |
28191-28192 |
SYM |
denotes |
– |
| T14659 |
28192-28194 |
CD |
denotes |
45 |
| T14661 |
28195-28198 |
NN |
denotes |
kDa |
| T14657 |
28199-28204 |
NN |
denotes |
range |
| T14646 |
28205-28214 |
VBZ |
denotes |
indicates |
| T14662 |
28215-28219 |
IN |
denotes |
that |
| T14664 |
28220-28226 |
NN |
denotes |
mutant |
| T14665 |
28227-28234 |
NN |
denotes |
protein |
| T14666 |
28235-28237 |
VBZ |
denotes |
is |
| T14663 |
28238-28249 |
VBN |
denotes |
transported |
| T14667 |
28250-28253 |
IN |
denotes |
out |
| T14668 |
28254-28256 |
IN |
denotes |
of |
| T14669 |
28257-28260 |
DT |
denotes |
the |
| T14670 |
28261-28263 |
NN |
denotes |
ER |
| T14671 |
28263-28265 |
, |
denotes |
, |
| T14672 |
28265-28268 |
CC |
denotes |
but |
| T14673 |
28269-28273 |
IN |
denotes |
with |
| T14674 |
28274-28281 |
RB |
denotes |
greatly |
| T14675 |
28282-28289 |
VBN |
denotes |
reduced |
| T14676 |
28290-28300 |
NN |
denotes |
efficiency |
| T14677 |
28300-28301 |
. |
denotes |
. |
| T14678 |
28301-28486 |
sentence |
denotes |
Colocalization of AQP2-F204V with the ER protein calnexin in transfected MDCK cells shows that, while most of the mutant protein is trapped in the ER, some does progress beyond the ER. |
| T14679 |
28302-28316 |
NN |
denotes |
Colocalization |
| T14681 |
28317-28319 |
IN |
denotes |
of |
| T14682 |
28320-28324 |
NN |
denotes |
AQP2 |
| T14684 |
28324-28325 |
HYPH |
denotes |
- |
| T14683 |
28325-28330 |
NN |
denotes |
F204V |
| T14685 |
28331-28335 |
IN |
denotes |
with |
| T14686 |
28336-28339 |
DT |
denotes |
the |
| T14688 |
28340-28342 |
NN |
denotes |
ER |
| T14687 |
28343-28350 |
NN |
denotes |
protein |
| T14689 |
28351-28359 |
NN |
denotes |
calnexin |
| T14690 |
28360-28362 |
IN |
denotes |
in |
| T14691 |
28363-28374 |
VBN |
denotes |
transfected |
| T14693 |
28375-28379 |
NN |
denotes |
MDCK |
| T14692 |
28380-28385 |
NNS |
denotes |
cells |
| T14680 |
28386-28391 |
VBZ |
denotes |
shows |
| T14694 |
28392-28396 |
IN |
denotes |
that |
| T14696 |
28396-28398 |
, |
denotes |
, |
| T14697 |
28398-28403 |
IN |
denotes |
while |
| T14699 |
28404-28408 |
JJS |
denotes |
most |
| T14700 |
28409-28411 |
IN |
denotes |
of |
| T14701 |
28412-28415 |
DT |
denotes |
the |
| T14703 |
28416-28422 |
NN |
denotes |
mutant |
| T14702 |
28423-28430 |
NN |
denotes |
protein |
| T14704 |
28431-28433 |
VBZ |
denotes |
is |
| T14698 |
28434-28441 |
VBN |
denotes |
trapped |
| T14705 |
28442-28444 |
IN |
denotes |
in |
| T14706 |
28445-28448 |
DT |
denotes |
the |
| T14707 |
28449-28451 |
NN |
denotes |
ER |
| T14708 |
28451-28453 |
, |
denotes |
, |
| T14709 |
28453-28457 |
DT |
denotes |
some |
| T14710 |
28458-28462 |
VBZ |
denotes |
does |
| T14695 |
28463-28471 |
VB |
denotes |
progress |
| T14711 |
28472-28478 |
IN |
denotes |
beyond |
| T14712 |
28479-28482 |
DT |
denotes |
the |
| T14713 |
28483-28485 |
NN |
denotes |
ER |
| T14714 |
28485-28486 |
. |
denotes |
. |
| T14715 |
28486-28804 |
sentence |
denotes |
Diminished response to dDAVP, diminished abundance of mature glycosylated protein in mutant animals, and the transport of a fraction of mutant protein beyond the ER in MDCK cells are all consistent with the notion that AQP2-F204V misfolding is limited and that it may retain some residual water transporting activity. |
| T14716 |
28487-28497 |
VBN |
denotes |
Diminished |
| T14717 |
28498-28506 |
NN |
denotes |
response |
| T14719 |
28507-28509 |
IN |
denotes |
to |
| T14720 |
28510-28515 |
NN |
denotes |
dDAVP |
| T14721 |
28515-28517 |
, |
denotes |
, |
| T14722 |
28517-28527 |
VBN |
denotes |
diminished |
| T14723 |
28528-28537 |
NN |
denotes |
abundance |
| T14724 |
28538-28540 |
IN |
denotes |
of |
| T14725 |
28541-28547 |
JJ |
denotes |
mature |
| T14727 |
28548-28560 |
VBN |
denotes |
glycosylated |
| T14726 |
28561-28568 |
NN |
denotes |
protein |
| T14728 |
28569-28571 |
IN |
denotes |
in |
| T14729 |
28572-28578 |
NN |
denotes |
mutant |
| T14730 |
28579-28586 |
NNS |
denotes |
animals |
| T14731 |
28586-28588 |
, |
denotes |
, |
| T14732 |
28588-28591 |
CC |
denotes |
and |
| T14733 |
28592-28595 |
DT |
denotes |
the |
| T14734 |
28596-28605 |
NN |
denotes |
transport |
| T14735 |
28606-28608 |
IN |
denotes |
of |
| T14736 |
28609-28610 |
DT |
denotes |
a |
| T14737 |
28611-28619 |
NN |
denotes |
fraction |
| T14738 |
28620-28622 |
IN |
denotes |
of |
| T14739 |
28623-28629 |
NN |
denotes |
mutant |
| T14740 |
28630-28637 |
NN |
denotes |
protein |
| T14741 |
28638-28644 |
IN |
denotes |
beyond |
| T14742 |
28645-28648 |
DT |
denotes |
the |
| T14743 |
28649-28651 |
NN |
denotes |
ER |
| T14744 |
28652-28654 |
IN |
denotes |
in |
| T14745 |
28655-28659 |
NN |
denotes |
MDCK |
| T14746 |
28660-28665 |
NNS |
denotes |
cells |
| T14718 |
28666-28669 |
VBP |
denotes |
are |
| T14747 |
28670-28673 |
RB |
denotes |
all |
| T14748 |
28674-28684 |
JJ |
denotes |
consistent |
| T14749 |
28685-28689 |
IN |
denotes |
with |
| T14750 |
28690-28693 |
DT |
denotes |
the |
| T14751 |
28694-28700 |
NN |
denotes |
notion |
| T14752 |
28701-28705 |
IN |
denotes |
that |
| T14754 |
28706-28710 |
NN |
denotes |
AQP2 |
| T14756 |
28710-28711 |
HYPH |
denotes |
- |
| T14755 |
28711-28716 |
NN |
denotes |
F204V |
| T14757 |
28717-28727 |
NN |
denotes |
misfolding |
| T14753 |
28728-28730 |
VBZ |
denotes |
is |
| T14758 |
28731-28738 |
JJ |
denotes |
limited |
| T14759 |
28739-28742 |
CC |
denotes |
and |
| T14760 |
28743-28747 |
IN |
denotes |
that |
| T14762 |
28748-28750 |
PRP |
denotes |
it |
| T14763 |
28751-28754 |
MD |
denotes |
may |
| T14761 |
28755-28761 |
VB |
denotes |
retain |
| T14764 |
28762-28766 |
DT |
denotes |
some |
| T14766 |
28767-28775 |
JJ |
denotes |
residual |
| T14767 |
28776-28781 |
NN |
denotes |
water |
| T14768 |
28782-28794 |
VBG |
denotes |
transporting |
| T14765 |
28795-28803 |
NN |
denotes |
activity |
| T14769 |
28803-28804 |
. |
denotes |
. |
| T14770 |
28804-28899 |
sentence |
denotes |
Evidently this residual activity is sufficient for the viability and growth of mutant animals. |
| T14771 |
28805-28814 |
RB |
denotes |
Evidently |
| T14773 |
28815-28819 |
DT |
denotes |
this |
| T14775 |
28820-28828 |
JJ |
denotes |
residual |
| T14774 |
28829-28837 |
NN |
denotes |
activity |
| T14772 |
28838-28840 |
VBZ |
denotes |
is |
| T14776 |
28841-28851 |
JJ |
denotes |
sufficient |
| T14777 |
28852-28855 |
IN |
denotes |
for |
| T14778 |
28856-28859 |
DT |
denotes |
the |
| T14779 |
28860-28869 |
NN |
denotes |
viability |
| T14780 |
28870-28873 |
CC |
denotes |
and |
| T14781 |
28874-28880 |
NN |
denotes |
growth |
| T14782 |
28881-28883 |
IN |
denotes |
of |
| T14783 |
28884-28890 |
NN |
denotes |
mutant |
| T14784 |
28891-28898 |
NNS |
denotes |
animals |
| T14785 |
28898-28899 |
. |
denotes |
. |
| T14786 |
28899-29021 |
sentence |
denotes |
Reduced efficiency in exiting the ER may explain why AQP2-F204V is enriched in the 31 kDa high-mannose glycosylated form. |
| T14787 |
28900-28907 |
VBN |
denotes |
Reduced |
| T14788 |
28908-28918 |
NN |
denotes |
efficiency |
| T14790 |
28919-28921 |
IN |
denotes |
in |
| T14791 |
28922-28929 |
VBG |
denotes |
exiting |
| T14792 |
28930-28933 |
DT |
denotes |
the |
| T14793 |
28934-28936 |
NN |
denotes |
ER |
| T14794 |
28937-28940 |
MD |
denotes |
may |
| T14789 |
28941-28948 |
VB |
denotes |
explain |
| T14795 |
28949-28952 |
WRB |
denotes |
why |
| T14797 |
28953-28957 |
NN |
denotes |
AQP2 |
| T14799 |
28957-28958 |
HYPH |
denotes |
- |
| T14798 |
28958-28963 |
NN |
denotes |
F204V |
| T14800 |
28964-28966 |
VBZ |
denotes |
is |
| T14796 |
28967-28975 |
VBN |
denotes |
enriched |
| T14801 |
28976-28978 |
IN |
denotes |
in |
| T14802 |
28979-28982 |
DT |
denotes |
the |
| T14804 |
28983-28985 |
CD |
denotes |
31 |
| T14805 |
28986-28989 |
NN |
denotes |
kDa |
| T14806 |
28990-28994 |
JJ |
denotes |
high |
| T14808 |
28994-28995 |
HYPH |
denotes |
- |
| T14807 |
28995-29002 |
NN |
denotes |
mannose |
| T14809 |
29003-29015 |
VBN |
denotes |
glycosylated |
| T14803 |
29016-29020 |
NN |
denotes |
form |
| T14810 |
29020-29021 |
. |
denotes |
. |
| T14811 |
29021-29144 |
sentence |
denotes |
The high-mannose core oligosaccharide is added in the ER and is later modified and elaborated in the Golgi apparatus [26]. |
| T14812 |
29022-29025 |
DT |
denotes |
The |
| T14814 |
29026-29030 |
JJ |
denotes |
high |
| T14816 |
29030-29031 |
HYPH |
denotes |
- |
| T14815 |
29031-29038 |
NN |
denotes |
mannose |
| T14817 |
29039-29043 |
NN |
denotes |
core |
| T14813 |
29044-29059 |
NN |
denotes |
oligosaccharide |
| T14819 |
29060-29062 |
VBZ |
denotes |
is |
| T14818 |
29063-29068 |
VBN |
denotes |
added |
| T14820 |
29069-29071 |
IN |
denotes |
in |
| T14821 |
29072-29075 |
DT |
denotes |
the |
| T14822 |
29076-29078 |
NN |
denotes |
ER |
| T14823 |
29079-29082 |
CC |
denotes |
and |
| T14824 |
29083-29085 |
VBZ |
denotes |
is |
| T14826 |
29086-29091 |
RB |
denotes |
later |
| T14825 |
29092-29100 |
VBN |
denotes |
modified |
| T14827 |
29101-29104 |
CC |
denotes |
and |
| T14828 |
29105-29115 |
VBN |
denotes |
elaborated |
| T14829 |
29116-29118 |
IN |
denotes |
in |
| T14830 |
29119-29122 |
DT |
denotes |
the |
| T14832 |
29123-29128 |
NN |
denotes |
Golgi |
| T14831 |
29129-29138 |
NN |
denotes |
apparatus |
| T14833 |
29139-29140 |
-LRB- |
denotes |
[ |
| T14834 |
29140-29142 |
CD |
denotes |
26 |
| T14835 |
29142-29143 |
-RRB- |
denotes |
] |
| T14836 |
29143-29144 |
. |
denotes |
. |
| T14837 |
29144-29305 |
sentence |
denotes |
The increase in the high-mannose glycosylated form of AQP2-F204V may simply reflect its prolonged presence in the ER and exposure to oligosaccharyl transferase. |
| T14838 |
29145-29148 |
DT |
denotes |
The |
| T14839 |
29149-29157 |
NN |
denotes |
increase |
| T14841 |
29158-29160 |
IN |
denotes |
in |
| T14842 |
29161-29164 |
DT |
denotes |
the |
| T14844 |
29165-29169 |
JJ |
denotes |
high |
| T14846 |
29169-29170 |
HYPH |
denotes |
- |
| T14845 |
29170-29177 |
NN |
denotes |
mannose |
| T14847 |
29178-29190 |
VBN |
denotes |
glycosylated |
| T14843 |
29191-29195 |
NN |
denotes |
form |
| T14848 |
29196-29198 |
IN |
denotes |
of |
| T14849 |
29199-29203 |
NN |
denotes |
AQP2 |
| T14851 |
29203-29204 |
HYPH |
denotes |
- |
| T14850 |
29204-29209 |
NN |
denotes |
F204V |
| T14852 |
29210-29213 |
MD |
denotes |
may |
| T14853 |
29214-29220 |
RB |
denotes |
simply |
| T14840 |
29221-29228 |
VB |
denotes |
reflect |
| T14854 |
29229-29232 |
PRP$ |
denotes |
its |
| T14856 |
29233-29242 |
JJ |
denotes |
prolonged |
| T14855 |
29243-29251 |
NN |
denotes |
presence |
| T14857 |
29252-29254 |
IN |
denotes |
in |
| T14858 |
29255-29258 |
DT |
denotes |
the |
| T14859 |
29259-29261 |
NN |
denotes |
ER |
| T14860 |
29262-29265 |
CC |
denotes |
and |
| T14861 |
29266-29274 |
NN |
denotes |
exposure |
| T14862 |
29275-29277 |
IN |
denotes |
to |
| T14863 |
29278-29292 |
NN |
denotes |
oligosaccharyl |
| T14864 |
29293-29304 |
NN |
denotes |
transferase |
| T14865 |
29304-29305 |
. |
denotes |
. |
| T14866 |
29305-29475 |
sentence |
denotes |
While improper localization of AQP2 explains the phenotype of homozygous mutant mice, the complete lack of a phenotype in heterozygous mice is more difficult to explain. |
| T14867 |
29306-29311 |
IN |
denotes |
While |
| T14869 |
29312-29320 |
JJ |
denotes |
improper |
| T14870 |
29321-29333 |
NN |
denotes |
localization |
| T14871 |
29334-29336 |
IN |
denotes |
of |
| T14872 |
29337-29341 |
NN |
denotes |
AQP2 |
| T14868 |
29342-29350 |
VBZ |
denotes |
explains |
| T14874 |
29351-29354 |
DT |
denotes |
the |
| T14875 |
29355-29364 |
NN |
denotes |
phenotype |
| T14876 |
29365-29367 |
IN |
denotes |
of |
| T14877 |
29368-29378 |
JJ |
denotes |
homozygous |
| T14879 |
29379-29385 |
NN |
denotes |
mutant |
| T14878 |
29386-29390 |
NNS |
denotes |
mice |
| T14880 |
29390-29392 |
, |
denotes |
, |
| T14881 |
29392-29395 |
DT |
denotes |
the |
| T14883 |
29396-29404 |
JJ |
denotes |
complete |
| T14882 |
29405-29409 |
NN |
denotes |
lack |
| T14884 |
29410-29412 |
IN |
denotes |
of |
| T14885 |
29413-29414 |
DT |
denotes |
a |
| T14886 |
29415-29424 |
NN |
denotes |
phenotype |
| T14887 |
29425-29427 |
IN |
denotes |
in |
| T14888 |
29428-29440 |
JJ |
denotes |
heterozygous |
| T14889 |
29441-29445 |
NNS |
denotes |
mice |
| T14873 |
29446-29448 |
VBZ |
denotes |
is |
| T14890 |
29449-29453 |
RBR |
denotes |
more |
| T14891 |
29454-29463 |
JJ |
denotes |
difficult |
| T14892 |
29464-29466 |
TO |
denotes |
to |
| T14893 |
29467-29474 |
VB |
denotes |
explain |
| T14894 |
29474-29475 |
. |
denotes |
. |
| T14895 |
29475-29632 |
sentence |
denotes |
Physiologically, heterozygous mice have no symptoms (see Figure 1C), and they are indistinguishable from wild type on immunostaining of kidneys (Figure 5A). |
| T14896 |
29476-29491 |
RB |
denotes |
Physiologically |
| T14898 |
29491-29493 |
, |
denotes |
, |
| T14899 |
29493-29505 |
JJ |
denotes |
heterozygous |
| T14900 |
29506-29510 |
NNS |
denotes |
mice |
| T14897 |
29511-29515 |
VBP |
denotes |
have |
| T14901 |
29516-29518 |
DT |
denotes |
no |
| T14902 |
29519-29527 |
NNS |
denotes |
symptoms |
| T14903 |
29528-29529 |
-LRB- |
denotes |
( |
| T14904 |
29529-29532 |
VB |
denotes |
see |
| T14905 |
29533-29539 |
NN |
denotes |
Figure |
| T14906 |
29540-29542 |
CD |
denotes |
1C |
| T14907 |
29542-29543 |
-RRB- |
denotes |
) |
| T14908 |
29543-29545 |
, |
denotes |
, |
| T14909 |
29545-29548 |
CC |
denotes |
and |
| T14910 |
29549-29553 |
PRP |
denotes |
they |
| T14911 |
29554-29557 |
VBP |
denotes |
are |
| T14912 |
29558-29575 |
JJ |
denotes |
indistinguishable |
| T14913 |
29576-29580 |
IN |
denotes |
from |
| T14914 |
29581-29585 |
JJ |
denotes |
wild |
| T14915 |
29586-29590 |
NN |
denotes |
type |
| T14916 |
29591-29593 |
IN |
denotes |
on |
| T14917 |
29594-29608 |
NN |
denotes |
immunostaining |
| T14918 |
29609-29611 |
IN |
denotes |
of |
| T14919 |
29612-29619 |
NNS |
denotes |
kidneys |
| T14920 |
29620-29621 |
-LRB- |
denotes |
( |
| T14921 |
29621-29627 |
NN |
denotes |
Figure |
| T14922 |
29628-29630 |
CD |
denotes |
5A |
| T14923 |
29630-29631 |
-RRB- |
denotes |
) |
| T14924 |
29631-29632 |
. |
denotes |
. |
| T14925 |
29632-29794 |
sentence |
denotes |
The presence of 50% of the normal amount of wild-type protein may explain the lack of symptoms, but it cannot explain the lack of any ER-retained mutant protein. |
| T14926 |
29633-29636 |
DT |
denotes |
The |
| T14927 |
29637-29645 |
NN |
denotes |
presence |
| T14929 |
29646-29648 |
IN |
denotes |
of |
| T14930 |
29649-29651 |
CD |
denotes |
50 |
| T14931 |
29651-29652 |
NN |
denotes |
% |
| T14932 |
29653-29655 |
IN |
denotes |
of |
| T14933 |
29656-29659 |
DT |
denotes |
the |
| T14935 |
29660-29666 |
JJ |
denotes |
normal |
| T14934 |
29667-29673 |
NN |
denotes |
amount |
| T14936 |
29674-29676 |
IN |
denotes |
of |
| T14937 |
29677-29681 |
JJ |
denotes |
wild |
| T14939 |
29681-29682 |
HYPH |
denotes |
- |
| T14938 |
29682-29686 |
NN |
denotes |
type |
| T14940 |
29687-29694 |
NN |
denotes |
protein |
| T14941 |
29695-29698 |
MD |
denotes |
may |
| T14928 |
29699-29706 |
VB |
denotes |
explain |
| T14942 |
29707-29710 |
DT |
denotes |
the |
| T14943 |
29711-29715 |
NN |
denotes |
lack |
| T14944 |
29716-29718 |
IN |
denotes |
of |
| T14945 |
29719-29727 |
NNS |
denotes |
symptoms |
| T14946 |
29727-29729 |
, |
denotes |
, |
| T14947 |
29729-29732 |
CC |
denotes |
but |
| T14948 |
29733-29735 |
PRP |
denotes |
it |
| T14950 |
29736-29739 |
MD |
denotes |
can |
| T14951 |
29739-29742 |
RB |
denotes |
not |
| T14949 |
29743-29750 |
VB |
denotes |
explain |
| T14952 |
29751-29754 |
DT |
denotes |
the |
| T14953 |
29755-29759 |
NN |
denotes |
lack |
| T14954 |
29760-29762 |
IN |
denotes |
of |
| T14955 |
29763-29766 |
DT |
denotes |
any |
| T14957 |
29767-29769 |
NN |
denotes |
ER |
| T14959 |
29769-29770 |
HYPH |
denotes |
- |
| T14958 |
29770-29778 |
VBN |
denotes |
retained |
| T14960 |
29779-29785 |
NN |
denotes |
mutant |
| T14956 |
29786-29793 |
NN |
denotes |
protein |
| T14961 |
29793-29794 |
. |
denotes |
. |
| T14962 |
29794-29919 |
sentence |
denotes |
Rather, the phenotype of the Aqp2F204V/+ animals suggests that the mutant protein is being rescued by the wild-type protein. |
| T14963 |
29795-29801 |
RB |
denotes |
Rather |
| T14965 |
29801-29803 |
, |
denotes |
, |
| T14966 |
29803-29806 |
DT |
denotes |
the |
| T14967 |
29807-29816 |
NN |
denotes |
phenotype |
| T14968 |
29817-29819 |
IN |
denotes |
of |
| T14969 |
29820-29823 |
DT |
denotes |
the |
| T14971 |
29824-29833 |
NN |
denotes |
Aqp2F204V |
| T14972 |
29833-29834 |
HYPH |
denotes |
/ |
| T14973 |
29834-29835 |
SYM |
denotes |
+ |
| T14970 |
29836-29843 |
NNS |
denotes |
animals |
| T14964 |
29844-29852 |
VBZ |
denotes |
suggests |
| T14974 |
29853-29857 |
IN |
denotes |
that |
| T14976 |
29858-29861 |
DT |
denotes |
the |
| T14978 |
29862-29868 |
NN |
denotes |
mutant |
| T14977 |
29869-29876 |
NN |
denotes |
protein |
| T14979 |
29877-29879 |
VBZ |
denotes |
is |
| T14980 |
29880-29885 |
VBG |
denotes |
being |
| T14975 |
29886-29893 |
VBN |
denotes |
rescued |
| T14981 |
29894-29896 |
IN |
denotes |
by |
| T14982 |
29897-29900 |
DT |
denotes |
the |
| T14984 |
29901-29905 |
JJ |
denotes |
wild |
| T14986 |
29905-29906 |
HYPH |
denotes |
- |
| T14985 |
29906-29910 |
NN |
denotes |
type |
| T14983 |
29911-29918 |
NN |
denotes |
protein |
| T14987 |
29918-29919 |
. |
denotes |
. |
| T14988 |
29919-30149 |
sentence |
denotes |
Indeed, de Mattia et al. (26) have demonstrated that one recessive allele of Aqp2, P262L, does not properly translocate when expressed by itself in MDCK cells, but that in the presence of wild-type protein, it localizes normally. |
| T14989 |
29920-29926 |
RB |
denotes |
Indeed |
| T14991 |
29926-29928 |
, |
denotes |
, |
| T14992 |
29928-29930 |
NNP |
denotes |
de |
| T14993 |
29931-29937 |
NNP |
denotes |
Mattia |
| T14994 |
29938-29940 |
FW |
denotes |
et |
| T14995 |
29941-29944 |
FW |
denotes |
al. |
| T14996 |
29945-29946 |
-LRB- |
denotes |
( |
| T14997 |
29946-29948 |
CD |
denotes |
26 |
| T14998 |
29948-29949 |
-RRB- |
denotes |
) |
| T14999 |
29950-29954 |
VBP |
denotes |
have |
| T14990 |
29955-29967 |
VBN |
denotes |
demonstrated |
| T15000 |
29968-29972 |
IN |
denotes |
that |
| T15002 |
29973-29976 |
CD |
denotes |
one |
| T15004 |
29977-29986 |
JJ |
denotes |
recessive |
| T15003 |
29987-29993 |
NN |
denotes |
allele |
| T15005 |
29994-29996 |
IN |
denotes |
of |
| T15006 |
29997-30001 |
NN |
denotes |
Aqp2 |
| T15007 |
30001-30003 |
, |
denotes |
, |
| T15008 |
30003-30008 |
NN |
denotes |
P262L |
| T15009 |
30008-30010 |
, |
denotes |
, |
| T15010 |
30010-30014 |
VBZ |
denotes |
does |
| T15011 |
30015-30018 |
RB |
denotes |
not |
| T15012 |
30019-30027 |
RB |
denotes |
properly |
| T15001 |
30028-30039 |
VB |
denotes |
translocate |
| T15013 |
30040-30044 |
WRB |
denotes |
when |
| T15014 |
30045-30054 |
VBN |
denotes |
expressed |
| T15015 |
30055-30057 |
IN |
denotes |
by |
| T15016 |
30058-30064 |
PRP |
denotes |
itself |
| T15017 |
30065-30067 |
IN |
denotes |
in |
| T15018 |
30068-30072 |
NN |
denotes |
MDCK |
| T15019 |
30073-30078 |
NNS |
denotes |
cells |
| T15020 |
30078-30080 |
, |
denotes |
, |
| T15021 |
30080-30083 |
CC |
denotes |
but |
| T15022 |
30084-30088 |
IN |
denotes |
that |
| T15024 |
30089-30091 |
IN |
denotes |
in |
| T15025 |
30092-30095 |
DT |
denotes |
the |
| T15026 |
30096-30104 |
NN |
denotes |
presence |
| T15027 |
30105-30107 |
IN |
denotes |
of |
| T15028 |
30108-30112 |
JJ |
denotes |
wild |
| T15030 |
30112-30113 |
HYPH |
denotes |
- |
| T15029 |
30113-30117 |
NN |
denotes |
type |
| T15031 |
30118-30125 |
NN |
denotes |
protein |
| T15032 |
30125-30127 |
, |
denotes |
, |
| T15033 |
30127-30129 |
PRP |
denotes |
it |
| T15023 |
30130-30139 |
VBZ |
denotes |
localizes |
| T15034 |
30140-30148 |
RB |
denotes |
normally |
| T15035 |
30148-30149 |
. |
denotes |
. |
| T15036 |
30149-30214 |
sentence |
denotes |
The same mechanism seems to apply in vivo with Aqp2F204V/+ mice. |
| T15037 |
30150-30153 |
DT |
denotes |
The |
| T15039 |
30154-30158 |
JJ |
denotes |
same |
| T15038 |
30159-30168 |
NN |
denotes |
mechanism |
| T15040 |
30169-30174 |
VBZ |
denotes |
seems |
| T15041 |
30175-30177 |
TO |
denotes |
to |
| T15042 |
30178-30183 |
VB |
denotes |
apply |
| T15043 |
30184-30186 |
FW |
denotes |
in |
| T15044 |
30187-30191 |
FW |
denotes |
vivo |
| T15045 |
30192-30196 |
IN |
denotes |
with |
| T15046 |
30197-30206 |
NN |
denotes |
Aqp2F204V |
| T15048 |
30206-30207 |
HYPH |
denotes |
/ |
| T15049 |
30207-30208 |
SYM |
denotes |
+ |
| T15047 |
30209-30213 |
NNS |
denotes |
mice |
| T15050 |
30213-30214 |
. |
denotes |
. |
| T15051 |
30214-30413 |
sentence |
denotes |
In support of this, AQP2-F204V can interact with wild-type AQP2 (Figure 5B), and when coexpressed with wild-type protein, AQP2-F204V can reach the cell surface (Figure 5C bottom right panel and 5D). |
| T15052 |
30215-30217 |
IN |
denotes |
In |
| T15054 |
30218-30225 |
NN |
denotes |
support |
| T15055 |
30226-30228 |
IN |
denotes |
of |
| T15056 |
30229-30233 |
DT |
denotes |
this |
| T15057 |
30233-30235 |
, |
denotes |
, |
| T15058 |
30235-30239 |
NN |
denotes |
AQP2 |
| T15060 |
30239-30240 |
HYPH |
denotes |
- |
| T15059 |
30240-30245 |
NN |
denotes |
F204V |
| T15061 |
30246-30249 |
MD |
denotes |
can |
| T15053 |
30250-30258 |
VB |
denotes |
interact |
| T15062 |
30259-30263 |
IN |
denotes |
with |
| T15063 |
30264-30268 |
JJ |
denotes |
wild |
| T15065 |
30268-30269 |
HYPH |
denotes |
- |
| T15064 |
30269-30273 |
NN |
denotes |
type |
| T15066 |
30274-30278 |
NN |
denotes |
AQP2 |
| T15067 |
30279-30280 |
-LRB- |
denotes |
( |
| T15068 |
30280-30286 |
NN |
denotes |
Figure |
| T15069 |
30287-30289 |
CD |
denotes |
5B |
| T15070 |
30289-30290 |
-RRB- |
denotes |
) |
| T15071 |
30290-30292 |
, |
denotes |
, |
| T15072 |
30292-30295 |
CC |
denotes |
and |
| T15073 |
30296-30300 |
WRB |
denotes |
when |
| T15074 |
30301-30312 |
VBN |
denotes |
coexpressed |
| T15076 |
30313-30317 |
IN |
denotes |
with |
| T15077 |
30318-30322 |
JJ |
denotes |
wild |
| T15079 |
30322-30323 |
HYPH |
denotes |
- |
| T15078 |
30323-30327 |
NN |
denotes |
type |
| T15080 |
30328-30335 |
NN |
denotes |
protein |
| T15081 |
30335-30337 |
, |
denotes |
, |
| T15082 |
30337-30341 |
NN |
denotes |
AQP2 |
| T15084 |
30341-30342 |
HYPH |
denotes |
- |
| T15083 |
30342-30347 |
NN |
denotes |
F204V |
| T15085 |
30348-30351 |
MD |
denotes |
can |
| T15075 |
30352-30357 |
VB |
denotes |
reach |
| T15086 |
30358-30361 |
DT |
denotes |
the |
| T15088 |
30362-30366 |
NN |
denotes |
cell |
| T15087 |
30367-30374 |
NN |
denotes |
surface |
| T15089 |
30375-30376 |
-LRB- |
denotes |
( |
| T15091 |
30376-30382 |
NN |
denotes |
Figure |
| T15092 |
30383-30385 |
CD |
denotes |
5C |
| T15093 |
30386-30392 |
NN |
denotes |
bottom |
| T15094 |
30393-30398 |
JJ |
denotes |
right |
| T15090 |
30399-30404 |
NN |
denotes |
panel |
| T15095 |
30405-30408 |
CC |
denotes |
and |
| T15096 |
30409-30411 |
CD |
denotes |
5D |
| T15097 |
30411-30412 |
-RRB- |
denotes |
) |
| T15098 |
30412-30413 |
. |
denotes |
. |
| T15099 |
30413-30715 |
sentence |
denotes |
Although it has been demonstrated that a recessive allele (encoding AQP2-R187C) of NDI fails to interact with wild-type AQP2 [6], here we show that AQP2-F204V does interact with the wild-type protein, presumably as part of heterotetramers, and represents a rescuable allele, both in vitro and in vivo. |
| T15100 |
30414-30422 |
IN |
denotes |
Although |
| T15102 |
30423-30425 |
PRP |
denotes |
it |
| T15103 |
30426-30429 |
VBZ |
denotes |
has |
| T15104 |
30430-30434 |
VBN |
denotes |
been |
| T15101 |
30435-30447 |
VBN |
denotes |
demonstrated |
| T15106 |
30448-30452 |
IN |
denotes |
that |
| T15108 |
30453-30454 |
DT |
denotes |
a |
| T15110 |
30455-30464 |
JJ |
denotes |
recessive |
| T15109 |
30465-30471 |
NN |
denotes |
allele |
| T15111 |
30472-30473 |
-LRB- |
denotes |
( |
| T15112 |
30473-30481 |
VBG |
denotes |
encoding |
| T15113 |
30482-30486 |
NN |
denotes |
AQP2 |
| T15115 |
30486-30487 |
HYPH |
denotes |
- |
| T15114 |
30487-30492 |
NN |
denotes |
R187C |
| T15116 |
30492-30493 |
-RRB- |
denotes |
) |
| T15117 |
30494-30496 |
IN |
denotes |
of |
| T15118 |
30497-30500 |
NN |
denotes |
NDI |
| T15107 |
30501-30506 |
VBZ |
denotes |
fails |
| T15119 |
30507-30509 |
TO |
denotes |
to |
| T15120 |
30510-30518 |
VB |
denotes |
interact |
| T15121 |
30519-30523 |
IN |
denotes |
with |
| T15122 |
30524-30528 |
JJ |
denotes |
wild |
| T15124 |
30528-30529 |
HYPH |
denotes |
- |
| T15123 |
30529-30533 |
NN |
denotes |
type |
| T15125 |
30534-30538 |
NN |
denotes |
AQP2 |
| T15126 |
30539-30540 |
-LRB- |
denotes |
[ |
| T15127 |
30540-30541 |
CD |
denotes |
6 |
| T15128 |
30541-30542 |
-RRB- |
denotes |
] |
| T15129 |
30542-30544 |
, |
denotes |
, |
| T15130 |
30544-30548 |
RB |
denotes |
here |
| T15131 |
30549-30551 |
PRP |
denotes |
we |
| T15105 |
30552-30556 |
VBP |
denotes |
show |
| T15132 |
30557-30561 |
IN |
denotes |
that |
| T15134 |
30562-30566 |
NN |
denotes |
AQP2 |
| T15136 |
30566-30567 |
HYPH |
denotes |
- |
| T15135 |
30567-30572 |
NN |
denotes |
F204V |
| T15137 |
30573-30577 |
VBZ |
denotes |
does |
| T15133 |
30578-30586 |
VB |
denotes |
interact |
| T15138 |
30587-30591 |
IN |
denotes |
with |
| T15139 |
30592-30595 |
DT |
denotes |
the |
| T15141 |
30596-30600 |
JJ |
denotes |
wild |
| T15143 |
30600-30601 |
HYPH |
denotes |
- |
| T15142 |
30601-30605 |
NN |
denotes |
type |
| T15140 |
30606-30613 |
NN |
denotes |
protein |
| T15144 |
30613-30615 |
, |
denotes |
, |
| T15145 |
30615-30625 |
RB |
denotes |
presumably |
| T15146 |
30626-30628 |
IN |
denotes |
as |
| T15147 |
30629-30633 |
NN |
denotes |
part |
| T15148 |
30634-30636 |
IN |
denotes |
of |
| T15149 |
30637-30652 |
NNS |
denotes |
heterotetramers |
| T15150 |
30652-30654 |
, |
denotes |
, |
| T15151 |
30654-30657 |
CC |
denotes |
and |
| T15152 |
30658-30668 |
VBZ |
denotes |
represents |
| T15153 |
30669-30670 |
DT |
denotes |
a |
| T15155 |
30671-30680 |
JJ |
denotes |
rescuable |
| T15154 |
30681-30687 |
NN |
denotes |
allele |
| T15156 |
30687-30689 |
, |
denotes |
, |
| T15157 |
30689-30693 |
CC |
denotes |
both |
| T15159 |
30694-30696 |
FW |
denotes |
in |
| T15158 |
30697-30702 |
FW |
denotes |
vitro |
| T15160 |
30703-30706 |
CC |
denotes |
and |
| T15161 |
30707-30709 |
FW |
denotes |
in |
| T15162 |
30710-30714 |
FW |
denotes |
vivo |
| T15163 |
30714-30715 |
. |
denotes |
. |
| T15164 |
30715-30949 |
sentence |
denotes |
Immunostaining the kidneys of homozygous Aqp2F204V/F204V mice shows that the mutant-expressing collecting duct cells can not mediate water reabsorption, because it fails to insert into the apical plasma membrane in response to dDAVP. |
| T15165 |
30716-30730 |
VBG |
denotes |
Immunostaining |
| T15167 |
30731-30734 |
DT |
denotes |
the |
| T15168 |
30735-30742 |
NNS |
denotes |
kidneys |
| T15169 |
30743-30745 |
IN |
denotes |
of |
| T15170 |
30746-30756 |
JJ |
denotes |
homozygous |
| T15172 |
30757-30766 |
NN |
denotes |
Aqp2F204V |
| T15174 |
30766-30767 |
HYPH |
denotes |
/ |
| T15173 |
30767-30772 |
NN |
denotes |
F204V |
| T15171 |
30773-30777 |
NNS |
denotes |
mice |
| T15166 |
30778-30783 |
VBZ |
denotes |
shows |
| T15175 |
30784-30788 |
IN |
denotes |
that |
| T15177 |
30789-30792 |
DT |
denotes |
the |
| T15179 |
30793-30799 |
NN |
denotes |
mutant |
| T15181 |
30799-30800 |
HYPH |
denotes |
- |
| T15180 |
30800-30810 |
VBG |
denotes |
expressing |
| T15182 |
30811-30821 |
VBG |
denotes |
collecting |
| T15183 |
30822-30826 |
NN |
denotes |
duct |
| T15178 |
30827-30832 |
NNS |
denotes |
cells |
| T15184 |
30833-30836 |
MD |
denotes |
can |
| T15185 |
30837-30840 |
RB |
denotes |
not |
| T15176 |
30841-30848 |
VB |
denotes |
mediate |
| T15186 |
30849-30854 |
NN |
denotes |
water |
| T15187 |
30855-30867 |
NN |
denotes |
reabsorption |
| T15188 |
30867-30869 |
, |
denotes |
, |
| T15189 |
30869-30876 |
IN |
denotes |
because |
| T15191 |
30877-30879 |
PRP |
denotes |
it |
| T15190 |
30880-30885 |
VBZ |
denotes |
fails |
| T15192 |
30886-30888 |
TO |
denotes |
to |
| T15193 |
30889-30895 |
VB |
denotes |
insert |
| T15194 |
30896-30900 |
IN |
denotes |
into |
| T15195 |
30901-30904 |
DT |
denotes |
the |
| T15197 |
30905-30911 |
JJ |
denotes |
apical |
| T15198 |
30912-30918 |
NN |
denotes |
plasma |
| T15196 |
30919-30927 |
NN |
denotes |
membrane |
| T15199 |
30928-30930 |
IN |
denotes |
in |
| T15200 |
30931-30939 |
NN |
denotes |
response |
| T15201 |
30940-30942 |
IN |
denotes |
to |
| T15202 |
30943-30948 |
NN |
denotes |
dDAVP |
| T15203 |
30948-30949 |
. |
denotes |
. |
| T15204 |
30949-31076 |
sentence |
denotes |
This is this first in vivo proof of a long-standing hypothesis that comes from in vitro studies with recessive Aqp2 mutations. |
| T15205 |
30950-30954 |
DT |
denotes |
This |
| T15206 |
30955-30957 |
VBZ |
denotes |
is |
| T15207 |
30958-30962 |
DT |
denotes |
this |
| T15209 |
30963-30968 |
JJ |
denotes |
first |
| T15210 |
30969-30971 |
FW |
denotes |
in |
| T15211 |
30972-30976 |
FW |
denotes |
vivo |
| T15208 |
30977-30982 |
NN |
denotes |
proof |
| T15212 |
30983-30985 |
IN |
denotes |
of |
| T15213 |
30986-30987 |
DT |
denotes |
a |
| T15215 |
30988-30992 |
JJ |
denotes |
long |
| T15217 |
30992-30993 |
HYPH |
denotes |
- |
| T15216 |
30993-31001 |
VBG |
denotes |
standing |
| T15214 |
31002-31012 |
NN |
denotes |
hypothesis |
| T15218 |
31013-31017 |
WDT |
denotes |
that |
| T15219 |
31018-31023 |
VBZ |
denotes |
comes |
| T15220 |
31024-31028 |
IN |
denotes |
from |
| T15221 |
31029-31031 |
FW |
denotes |
in |
| T15222 |
31032-31037 |
FW |
denotes |
vitro |
| T15223 |
31038-31045 |
NNS |
denotes |
studies |
| T15224 |
31046-31050 |
IN |
denotes |
with |
| T15225 |
31051-31060 |
JJ |
denotes |
recessive |
| T15227 |
31061-31065 |
NN |
denotes |
Aqp2 |
| T15226 |
31066-31075 |
NNS |
denotes |
mutations |
| T15228 |
31075-31076 |
. |
denotes |
. |
| T15229 |
31076-31295 |
sentence |
denotes |
Transfection into MDCK cells of any of several Aqp2 mutations corresponding to recessive human alleles shows abnormal subcellular localization [25], [27] and failure to appropriately translocate to the plasma membrane. |
| T15230 |
31077-31089 |
NN |
denotes |
Transfection |
| T15232 |
31090-31094 |
IN |
denotes |
into |
| T15233 |
31095-31099 |
NN |
denotes |
MDCK |
| T15234 |
31100-31105 |
NNS |
denotes |
cells |
| T15235 |
31106-31108 |
IN |
denotes |
of |
| T15236 |
31109-31112 |
DT |
denotes |
any |
| T15237 |
31113-31115 |
IN |
denotes |
of |
| T15238 |
31116-31123 |
JJ |
denotes |
several |
| T15240 |
31124-31128 |
NN |
denotes |
Aqp2 |
| T15239 |
31129-31138 |
NNS |
denotes |
mutations |
| T15241 |
31139-31152 |
VBG |
denotes |
corresponding |
| T15242 |
31153-31155 |
IN |
denotes |
to |
| T15243 |
31156-31165 |
JJ |
denotes |
recessive |
| T15245 |
31166-31171 |
JJ |
denotes |
human |
| T15244 |
31172-31179 |
NNS |
denotes |
alleles |
| T15231 |
31180-31185 |
VBZ |
denotes |
shows |
| T15246 |
31186-31194 |
JJ |
denotes |
abnormal |
| T15248 |
31195-31206 |
JJ |
denotes |
subcellular |
| T15247 |
31207-31219 |
NN |
denotes |
localization |
| T15249 |
31220-31221 |
-LRB- |
denotes |
[ |
| T15250 |
31221-31223 |
CD |
denotes |
25 |
| T15251 |
31223-31224 |
-RRB- |
denotes |
] |
| T15252 |
31224-31226 |
, |
denotes |
, |
| T15253 |
31226-31227 |
-LRB- |
denotes |
[ |
| T15254 |
31227-31229 |
CD |
denotes |
27 |
| T15255 |
31229-31230 |
-RRB- |
denotes |
] |
| T15256 |
31231-31234 |
CC |
denotes |
and |
| T15257 |
31235-31242 |
NN |
denotes |
failure |
| T15258 |
31243-31245 |
TO |
denotes |
to |
| T15260 |
31246-31259 |
RB |
denotes |
appropriately |
| T15259 |
31260-31271 |
VB |
denotes |
translocate |
| T15261 |
31272-31274 |
IN |
denotes |
to |
| T15262 |
31275-31278 |
DT |
denotes |
the |
| T15264 |
31279-31285 |
NN |
denotes |
plasma |
| T15263 |
31286-31294 |
NN |
denotes |
membrane |
| T15265 |
31294-31295 |
. |
denotes |
. |
| T15266 |
31295-31442 |
sentence |
denotes |
Thus, misfolding, retention in the ER, and failure to translocate in response to dDAVP were proposed as the mechanism for autosomal recessive NDI. |
| T15267 |
31296-31300 |
RB |
denotes |
Thus |
| T15269 |
31300-31302 |
, |
denotes |
, |
| T15270 |
31302-31312 |
NN |
denotes |
misfolding |
| T15271 |
31312-31314 |
, |
denotes |
, |
| T15272 |
31314-31323 |
NN |
denotes |
retention |
| T15273 |
31324-31326 |
IN |
denotes |
in |
| T15274 |
31327-31330 |
DT |
denotes |
the |
| T15275 |
31331-31333 |
NN |
denotes |
ER |
| T15276 |
31333-31335 |
, |
denotes |
, |
| T15277 |
31335-31338 |
CC |
denotes |
and |
| T15278 |
31339-31346 |
NN |
denotes |
failure |
| T15279 |
31347-31349 |
TO |
denotes |
to |
| T15280 |
31350-31361 |
VB |
denotes |
translocate |
| T15281 |
31362-31364 |
IN |
denotes |
in |
| T15282 |
31365-31373 |
NN |
denotes |
response |
| T15283 |
31374-31376 |
IN |
denotes |
to |
| T15284 |
31377-31382 |
NN |
denotes |
dDAVP |
| T15285 |
31383-31387 |
VBD |
denotes |
were |
| T15268 |
31388-31396 |
VBN |
denotes |
proposed |
| T15286 |
31397-31399 |
IN |
denotes |
as |
| T15287 |
31400-31403 |
DT |
denotes |
the |
| T15288 |
31404-31413 |
NN |
denotes |
mechanism |
| T15289 |
31414-31417 |
IN |
denotes |
for |
| T15290 |
31418-31427 |
JJ |
denotes |
autosomal |
| T15292 |
31428-31437 |
JJ |
denotes |
recessive |
| T15291 |
31438-31441 |
NN |
denotes |
NDI |
| T15293 |
31441-31442 |
. |
denotes |
. |
| T15294 |
31442-31530 |
sentence |
denotes |
Here we not only prove this hypothesis but also establish a useful model for human NDI. |
| T15295 |
31443-31447 |
RB |
denotes |
Here |
| T15297 |
31448-31450 |
PRP |
denotes |
we |
| T15298 |
31451-31454 |
RB |
denotes |
not |
| T15299 |
31455-31459 |
RB |
denotes |
only |
| T15296 |
31460-31465 |
VB |
denotes |
prove |
| T15300 |
31466-31470 |
DT |
denotes |
this |
| T15301 |
31471-31481 |
NN |
denotes |
hypothesis |
| T15302 |
31482-31485 |
CC |
denotes |
but |
| T15303 |
31486-31490 |
RB |
denotes |
also |
| T15304 |
31491-31500 |
VB |
denotes |
establish |
| T15305 |
31501-31502 |
DT |
denotes |
a |
| T15307 |
31503-31509 |
JJ |
denotes |
useful |
| T15306 |
31510-31515 |
NN |
denotes |
model |
| T15308 |
31516-31519 |
IN |
denotes |
for |
| T15309 |
31520-31525 |
JJ |
denotes |
human |
| T15310 |
31526-31529 |
NN |
denotes |
NDI |
| T15311 |
31529-31530 |
. |
denotes |
. |
| T15312 |
31530-31716 |
sentence |
denotes |
This mouse model of NDI based on an Aqp2 allele that can be rescued provides the opportunity to test therapies, including gene therapy, that may promote proper subcellular localization. |
| T15313 |
31531-31535 |
DT |
denotes |
This |
| T15315 |
31536-31541 |
NN |
denotes |
mouse |
| T15314 |
31542-31547 |
NN |
denotes |
model |
| T15317 |
31548-31550 |
IN |
denotes |
of |
| T15318 |
31551-31554 |
NN |
denotes |
NDI |
| T15319 |
31555-31560 |
VBN |
denotes |
based |
| T15320 |
31561-31563 |
IN |
denotes |
on |
| T15321 |
31564-31566 |
DT |
denotes |
an |
| T15323 |
31567-31571 |
NN |
denotes |
Aqp2 |
| T15322 |
31572-31578 |
NN |
denotes |
allele |
| T15324 |
31579-31583 |
WDT |
denotes |
that |
| T15326 |
31584-31587 |
MD |
denotes |
can |
| T15327 |
31588-31590 |
VB |
denotes |
be |
| T15325 |
31591-31598 |
VBN |
denotes |
rescued |
| T15316 |
31599-31607 |
VBZ |
denotes |
provides |
| T15328 |
31608-31611 |
DT |
denotes |
the |
| T15329 |
31612-31623 |
NN |
denotes |
opportunity |
| T15330 |
31624-31626 |
TO |
denotes |
to |
| T15331 |
31627-31631 |
VB |
denotes |
test |
| T15332 |
31632-31641 |
NNS |
denotes |
therapies |
| T15333 |
31641-31643 |
, |
denotes |
, |
| T15334 |
31643-31652 |
VBG |
denotes |
including |
| T15335 |
31653-31657 |
NN |
denotes |
gene |
| T15336 |
31658-31665 |
NN |
denotes |
therapy |
| T15337 |
31665-31667 |
, |
denotes |
, |
| T15338 |
31667-31671 |
WDT |
denotes |
that |
| T15340 |
31672-31675 |
MD |
denotes |
may |
| T15339 |
31676-31683 |
VB |
denotes |
promote |
| T15341 |
31684-31690 |
JJ |
denotes |
proper |
| T15343 |
31691-31702 |
JJ |
denotes |
subcellular |
| T15342 |
31703-31715 |
NN |
denotes |
localization |
| T15344 |
31715-31716 |
. |
denotes |
. |
| T15507 |
31741-31751 |
NN |
denotes |
Generation |
| T15508 |
31752-31754 |
IN |
denotes |
of |
| T15509 |
31755-31758 |
NN |
denotes |
ENU |
| T15510 |
31759-31763 |
NNS |
denotes |
mice |
| T15511 |
31764-31767 |
CC |
denotes |
and |
| T15512 |
31768-31775 |
NN |
denotes |
housing |
| T15513 |
31775-31776 |
. |
denotes |
. |
| T15514 |
31776-31839 |
sentence |
denotes |
ENU mutagenized C57BL/6 mice were generated as described [19]. |
| T15515 |
31777-31780 |
NN |
denotes |
ENU |
| T15517 |
31781-31792 |
VBN |
denotes |
mutagenized |
| T15518 |
31793-31798 |
NN |
denotes |
C57BL |
| T15519 |
31798-31799 |
HYPH |
denotes |
/ |
| T15520 |
31799-31800 |
CD |
denotes |
6 |
| T15516 |
31801-31805 |
NNS |
denotes |
mice |
| T15522 |
31806-31810 |
VBD |
denotes |
were |
| T15521 |
31811-31820 |
VBN |
denotes |
generated |
| T15523 |
31821-31823 |
IN |
denotes |
as |
| T15524 |
31824-31833 |
VBN |
denotes |
described |
| T15525 |
31834-31835 |
-LRB- |
denotes |
[ |
| T15526 |
31835-31837 |
CD |
denotes |
19 |
| T15527 |
31837-31838 |
-RRB- |
denotes |
] |
| T15528 |
31838-31839 |
. |
denotes |
. |
| T15529 |
31839-32055 |
sentence |
denotes |
Mice were maintained by backcrossing affected animals to C57BL/6 and housed in the Genomics Institute of the Novartis Research Foundation Specific Pathogen Free animal facility (La Jolla, California, United States). |
| T15530 |
31840-31844 |
NNS |
denotes |
Mice |
| T15532 |
31845-31849 |
VBD |
denotes |
were |
| T15531 |
31850-31860 |
VBN |
denotes |
maintained |
| T15533 |
31861-31863 |
IN |
denotes |
by |
| T15534 |
31864-31876 |
VBG |
denotes |
backcrossing |
| T15535 |
31877-31885 |
VBN |
denotes |
affected |
| T15536 |
31886-31893 |
NNS |
denotes |
animals |
| T15537 |
31894-31896 |
IN |
denotes |
to |
| T15538 |
31897-31902 |
NN |
denotes |
C57BL |
| T15539 |
31902-31903 |
HYPH |
denotes |
/ |
| T15540 |
31903-31904 |
CD |
denotes |
6 |
| T15541 |
31905-31908 |
CC |
denotes |
and |
| T15542 |
31909-31915 |
VBN |
denotes |
housed |
| T15543 |
31916-31918 |
IN |
denotes |
in |
| T15544 |
31919-31922 |
DT |
denotes |
the |
| T15546 |
31923-31931 |
NNP |
denotes |
Genomics |
| T15545 |
31932-31941 |
NNP |
denotes |
Institute |
| T15547 |
31942-31944 |
IN |
denotes |
of |
| T15548 |
31945-31948 |
DT |
denotes |
the |
| T15550 |
31949-31957 |
NNP |
denotes |
Novartis |
| T15552 |
31958-31966 |
NNP |
denotes |
Research |
| T15551 |
31967-31977 |
NNP |
denotes |
Foundation |
| T15553 |
31978-31986 |
NNP |
denotes |
Specific |
| T15554 |
31987-31995 |
NNP |
denotes |
Pathogen |
| T15555 |
31996-32000 |
NNP |
denotes |
Free |
| T15556 |
32001-32007 |
NNP |
denotes |
animal |
| T15549 |
32008-32016 |
NNP |
denotes |
facility |
| T15557 |
32017-32018 |
-LRB- |
denotes |
( |
| T15559 |
32018-32020 |
NNP |
denotes |
La |
| T15558 |
32021-32026 |
NNP |
denotes |
Jolla |
| T15560 |
32026-32028 |
, |
denotes |
, |
| T15561 |
32028-32038 |
NNP |
denotes |
California |
| T15562 |
32038-32040 |
, |
denotes |
, |
| T15563 |
32040-32046 |
NNP |
denotes |
United |
| T15564 |
32047-32053 |
NNP |
denotes |
States |
| T15565 |
32053-32054 |
-RRB- |
denotes |
) |
| T15566 |
32054-32055 |
. |
denotes |
. |
| T15567 |
32055-32191 |
sentence |
denotes |
All procedures were approved by the Genomics Institute of the Novartis Research Foundation Institutional Animal Care and Use Committee. |
| T15568 |
32056-32059 |
DT |
denotes |
All |
| T15569 |
32060-32070 |
NNS |
denotes |
procedures |
| T15571 |
32071-32075 |
VBD |
denotes |
were |
| T15570 |
32076-32084 |
VBN |
denotes |
approved |
| T15572 |
32085-32087 |
IN |
denotes |
by |
| T15573 |
32088-32091 |
DT |
denotes |
the |
| T15575 |
32092-32100 |
NNP |
denotes |
Genomics |
| T15574 |
32101-32110 |
NNP |
denotes |
Institute |
| T15576 |
32111-32113 |
IN |
denotes |
of |
| T15577 |
32114-32117 |
DT |
denotes |
the |
| T15579 |
32118-32126 |
NNP |
denotes |
Novartis |
| T15581 |
32127-32135 |
NNP |
denotes |
Research |
| T15580 |
32136-32146 |
NNP |
denotes |
Foundation |
| T15582 |
32147-32160 |
NNP |
denotes |
Institutional |
| T15583 |
32161-32167 |
NNP |
denotes |
Animal |
| T15584 |
32168-32172 |
NNP |
denotes |
Care |
| T15585 |
32173-32176 |
CC |
denotes |
and |
| T15586 |
32177-32180 |
NNP |
denotes |
Use |
| T15578 |
32181-32190 |
NNP |
denotes |
Committee |
| T15587 |
32190-32191 |
. |
denotes |
. |
| T15900 |
32193-32203 |
NNS |
denotes |
Constructs |
| T15901 |
32203-32204 |
. |
denotes |
. |
| T15902 |
32204-32406 |
sentence |
denotes |
The complete coding sequence of mouse AQP2 from an IMAGE clone was digested from the pCMV⋅SPORT6 plasmid with EcoRI and NotI and ligated into pcDNA3.1 (Invitrogen, Carlsbad, California, United States). |
| T15903 |
32205-32208 |
DT |
denotes |
The |
| T15905 |
32209-32217 |
JJ |
denotes |
complete |
| T15906 |
32218-32224 |
NN |
denotes |
coding |
| T15904 |
32225-32233 |
NN |
denotes |
sequence |
| T15908 |
32234-32236 |
IN |
denotes |
of |
| T15909 |
32237-32242 |
NN |
denotes |
mouse |
| T15910 |
32243-32247 |
NN |
denotes |
AQP2 |
| T15911 |
32248-32252 |
IN |
denotes |
from |
| T15912 |
32253-32255 |
DT |
denotes |
an |
| T15914 |
32256-32261 |
NN |
denotes |
IMAGE |
| T15913 |
32262-32267 |
NN |
denotes |
clone |
| T15915 |
32268-32271 |
VBD |
denotes |
was |
| T15907 |
32272-32280 |
VBN |
denotes |
digested |
| T15916 |
32281-32285 |
IN |
denotes |
from |
| T15917 |
32286-32289 |
DT |
denotes |
the |
| T15919 |
32290-32301 |
NN |
denotes |
pCMV⋅SPORT6 |
| T15918 |
32302-32309 |
NN |
denotes |
plasmid |
| T15920 |
32310-32314 |
IN |
denotes |
with |
| T15921 |
32315-32320 |
NN |
denotes |
EcoRI |
| T15922 |
32321-32324 |
CC |
denotes |
and |
| T15923 |
32325-32329 |
NN |
denotes |
NotI |
| T15924 |
32330-32333 |
CC |
denotes |
and |
| T15925 |
32334-32341 |
VBN |
denotes |
ligated |
| T15926 |
32342-32346 |
IN |
denotes |
into |
| T15927 |
32347-32355 |
NN |
denotes |
pcDNA3.1 |
| T15928 |
32356-32357 |
-LRB- |
denotes |
( |
| T15929 |
32357-32367 |
NNP |
denotes |
Invitrogen |
| T15930 |
32367-32369 |
, |
denotes |
, |
| T15931 |
32369-32377 |
NNP |
denotes |
Carlsbad |
| T15932 |
32377-32379 |
, |
denotes |
, |
| T15933 |
32379-32389 |
NNP |
denotes |
California |
| T15934 |
32389-32391 |
, |
denotes |
, |
| T15935 |
32391-32397 |
NNP |
denotes |
United |
| T15936 |
32398-32404 |
NNP |
denotes |
States |
| T15937 |
32404-32405 |
-RRB- |
denotes |
) |
| T15938 |
32405-32406 |
. |
denotes |
. |
| T15939 |
32406-32660 |
sentence |
denotes |
The F204V mutation was introduced by site-directed mutagenesis (Stratagene, La Jolla, California, United States), using the sense oligonucleotide 5′-GATGATCACTGGGTCGTCTGGATCGGACCCC-3′, and antisense oligonucleotide 5′-GGGGTCCGATCCAGACGACCCAGTGATCATC-3′. |
| T15940 |
32407-32410 |
DT |
denotes |
The |
| T15942 |
32411-32416 |
NN |
denotes |
F204V |
| T15941 |
32417-32425 |
NN |
denotes |
mutation |
| T15944 |
32426-32429 |
VBD |
denotes |
was |
| T15943 |
32430-32440 |
VBN |
denotes |
introduced |
| T15945 |
32441-32443 |
IN |
denotes |
by |
| T15946 |
32444-32448 |
NN |
denotes |
site |
| T15948 |
32448-32449 |
HYPH |
denotes |
- |
| T15947 |
32449-32457 |
JJ |
denotes |
directed |
| T15949 |
32458-32469 |
NN |
denotes |
mutagenesis |
| T15950 |
32470-32471 |
-LRB- |
denotes |
( |
| T15951 |
32471-32481 |
NNP |
denotes |
Stratagene |
| T15952 |
32481-32483 |
, |
denotes |
, |
| T15953 |
32483-32485 |
NNP |
denotes |
La |
| T15954 |
32486-32491 |
NNP |
denotes |
Jolla |
| T15955 |
32491-32493 |
, |
denotes |
, |
| T15956 |
32493-32503 |
NNP |
denotes |
California |
| T15957 |
32503-32505 |
, |
denotes |
, |
| T15958 |
32505-32511 |
NNP |
denotes |
United |
| T15959 |
32512-32518 |
NNP |
denotes |
States |
| T15960 |
32518-32519 |
-RRB- |
denotes |
) |
| T15961 |
32519-32521 |
, |
denotes |
, |
| T15962 |
32521-32526 |
VBG |
denotes |
using |
| T15963 |
32527-32530 |
DT |
denotes |
the |
| T15965 |
32531-32536 |
NN |
denotes |
sense |
| T15964 |
32537-32552 |
NN |
denotes |
oligonucleotide |
| T15966 |
32553-32554 |
CD |
denotes |
5 |
| T15968 |
32554-32555 |
SYM |
denotes |
′ |
| T15969 |
32555-32556 |
HYPH |
denotes |
- |
| T15967 |
32556-32587 |
NN |
denotes |
GATGATCACTGGGTCGTCTGGATCGGACCCC |
| T15970 |
32587-32588 |
HYPH |
denotes |
- |
| T15971 |
32588-32589 |
CD |
denotes |
3 |
| T15972 |
32589-32590 |
SYM |
denotes |
′ |
| T15973 |
32590-32592 |
, |
denotes |
, |
| T15974 |
32592-32595 |
CC |
denotes |
and |
| T15975 |
32596-32605 |
JJ |
denotes |
antisense |
| T15976 |
32606-32621 |
NN |
denotes |
oligonucleotide |
| T15977 |
32622-32623 |
CD |
denotes |
5 |
| T15979 |
32623-32624 |
SYM |
denotes |
′ |
| T15980 |
32624-32625 |
HYPH |
denotes |
- |
| T15978 |
32625-32656 |
NN |
denotes |
GGGGTCCGATCCAGACGACCCAGTGATCATC |
| T15981 |
32656-32657 |
HYPH |
denotes |
- |
| T15982 |
32657-32658 |
CD |
denotes |
3 |
| T15983 |
32658-32659 |
SYM |
denotes |
′ |
| T15984 |
32659-32660 |
. |
denotes |
. |
| T15985 |
32660-32849 |
sentence |
denotes |
To generate GFP fusions of AQP2, the pCMV⋅SPORT6 AQP2 construct was used in a PCR reaction with the primers Sp6 and 5′-GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG-3′ to remove the stop codon of AQP2. |
| T15986 |
32661-32663 |
TO |
denotes |
To |
| T15987 |
32664-32672 |
VB |
denotes |
generate |
| T15989 |
32673-32676 |
NN |
denotes |
GFP |
| T15990 |
32677-32684 |
NNS |
denotes |
fusions |
| T15991 |
32685-32687 |
IN |
denotes |
of |
| T15992 |
32688-32692 |
NN |
denotes |
AQP2 |
| T15993 |
32692-32694 |
, |
denotes |
, |
| T15994 |
32694-32697 |
DT |
denotes |
the |
| T15996 |
32698-32709 |
NN |
denotes |
pCMV⋅SPORT6 |
| T15997 |
32710-32714 |
NN |
denotes |
AQP2 |
| T15995 |
32715-32724 |
NN |
denotes |
construct |
| T15998 |
32725-32728 |
VBD |
denotes |
was |
| T15988 |
32729-32733 |
VBN |
denotes |
used |
| T15999 |
32734-32736 |
IN |
denotes |
in |
| T16000 |
32737-32738 |
DT |
denotes |
a |
| T16002 |
32739-32742 |
NN |
denotes |
PCR |
| T16001 |
32743-32751 |
NN |
denotes |
reaction |
| T16003 |
32752-32756 |
IN |
denotes |
with |
| T16004 |
32757-32760 |
DT |
denotes |
the |
| T16006 |
32761-32768 |
NNS |
denotes |
primers |
| T16005 |
32769-32772 |
NN |
denotes |
Sp6 |
| T16007 |
32773-32776 |
CC |
denotes |
and |
| T16008 |
32777-32778 |
CD |
denotes |
5 |
| T16010 |
32778-32779 |
SYM |
denotes |
′ |
| T16011 |
32779-32780 |
HYPH |
denotes |
- |
| T16009 |
32780-32812 |
NN |
denotes |
GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG |
| T16012 |
32812-32813 |
HYPH |
denotes |
- |
| T16013 |
32813-32814 |
CD |
denotes |
3 |
| T16014 |
32814-32815 |
SYM |
denotes |
′ |
| T16015 |
32816-32818 |
TO |
denotes |
to |
| T16016 |
32819-32825 |
VB |
denotes |
remove |
| T16017 |
32826-32829 |
DT |
denotes |
the |
| T16019 |
32830-32834 |
NN |
denotes |
stop |
| T16018 |
32835-32840 |
NN |
denotes |
codon |
| T16020 |
32841-32843 |
IN |
denotes |
of |
| T16021 |
32844-32848 |
NN |
denotes |
AQP2 |
| T16022 |
32848-32849 |
. |
denotes |
. |
| T16023 |
32849-32976 |
sentence |
denotes |
The product was digested with KpnI and BamHI and ligated into pEGFP-N2 (BD Biosciences, San Diego, California, United States). |
| T16024 |
32850-32853 |
DT |
denotes |
The |
| T16025 |
32854-32861 |
NN |
denotes |
product |
| T16027 |
32862-32865 |
VBD |
denotes |
was |
| T16026 |
32866-32874 |
VBN |
denotes |
digested |
| T16028 |
32875-32879 |
IN |
denotes |
with |
| T16029 |
32880-32884 |
NN |
denotes |
KpnI |
| T16030 |
32885-32888 |
CC |
denotes |
and |
| T16031 |
32889-32894 |
NN |
denotes |
BamHI |
| T16032 |
32895-32898 |
CC |
denotes |
and |
| T16033 |
32899-32906 |
VBN |
denotes |
ligated |
| T16034 |
32907-32911 |
IN |
denotes |
into |
| T16035 |
32912-32917 |
NN |
denotes |
pEGFP |
| T16037 |
32917-32918 |
HYPH |
denotes |
- |
| T16036 |
32918-32920 |
NN |
denotes |
N2 |
| T16038 |
32921-32922 |
-LRB- |
denotes |
( |
| T16040 |
32922-32924 |
NN |
denotes |
BD |
| T16039 |
32925-32936 |
NNP |
denotes |
Biosciences |
| T16041 |
32936-32938 |
, |
denotes |
, |
| T16042 |
32938-32941 |
NNP |
denotes |
San |
| T16043 |
32942-32947 |
NNP |
denotes |
Diego |
| T16044 |
32947-32949 |
, |
denotes |
, |
| T16045 |
32949-32959 |
NNP |
denotes |
California |
| T16046 |
32959-32961 |
, |
denotes |
, |
| T16047 |
32961-32967 |
NNP |
denotes |
United |
| T16048 |
32968-32974 |
NNP |
denotes |
States |
| T16049 |
32974-32975 |
-RRB- |
denotes |
) |
| T16050 |
32975-32976 |
. |
denotes |
. |
| T16051 |
32976-33053 |
sentence |
denotes |
The F204V mutation was introduced using the same mutagenic oligonucleotides. |
| T16052 |
32977-32980 |
DT |
denotes |
The |
| T16054 |
32981-32986 |
NN |
denotes |
F204V |
| T16053 |
32987-32995 |
NN |
denotes |
mutation |
| T16056 |
32996-32999 |
VBD |
denotes |
was |
| T16055 |
33000-33010 |
VBN |
denotes |
introduced |
| T16057 |
33011-33016 |
VBG |
denotes |
using |
| T16058 |
33017-33020 |
DT |
denotes |
the |
| T16060 |
33021-33025 |
JJ |
denotes |
same |
| T16061 |
33026-33035 |
JJ |
denotes |
mutagenic |
| T16059 |
33036-33052 |
NNS |
denotes |
oligonucleotides |
| T16062 |
33052-33053 |
. |
denotes |
. |
| T16399 |
33055-33059 |
NN |
denotes |
Cell |
| T16400 |
33060-33067 |
NN |
denotes |
culture |
| T16401 |
33068-33071 |
CC |
denotes |
and |
| T16402 |
33072-33082 |
NN |
denotes |
generation |
| T16403 |
33083-33085 |
IN |
denotes |
of |
| T16404 |
33086-33092 |
JJ |
denotes |
stable |
| T16406 |
33093-33097 |
NN |
denotes |
cell |
| T16405 |
33098-33103 |
NNS |
denotes |
lines |
| T16407 |
33103-33104 |
. |
denotes |
. |
| T16408 |
33104-33356 |
sentence |
denotes |
MDCK cells (CCL-34; ATCC, Manassas, Virginia, United States) were cultured in DMEM (Sigma-Aldrich, St. Louis, Missouri, United States) supplemented with 10% FBS (Sigma-Aldrich), 100 U/ml of penicillin, and 100 μg/ml of streptomycin at 37 °C in 5% CO2. |
| T16409 |
33105-33109 |
NN |
denotes |
MDCK |
| T16410 |
33110-33115 |
NNS |
denotes |
cells |
| T16412 |
33116-33117 |
-LRB- |
denotes |
( |
| T16414 |
33117-33120 |
NN |
denotes |
CCL |
| T16415 |
33120-33121 |
HYPH |
denotes |
- |
| T16416 |
33121-33123 |
CD |
denotes |
34 |
| T16417 |
33123-33124 |
: |
denotes |
; |
| T16413 |
33125-33129 |
NN |
denotes |
ATCC |
| T16418 |
33129-33131 |
, |
denotes |
, |
| T16419 |
33131-33139 |
NNP |
denotes |
Manassas |
| T16420 |
33139-33141 |
, |
denotes |
, |
| T16421 |
33141-33149 |
NNP |
denotes |
Virginia |
| T16422 |
33149-33151 |
, |
denotes |
, |
| T16423 |
33151-33157 |
NNP |
denotes |
United |
| T16424 |
33158-33164 |
NNP |
denotes |
States |
| T16425 |
33164-33165 |
-RRB- |
denotes |
) |
| T16426 |
33166-33170 |
VBD |
denotes |
were |
| T16411 |
33171-33179 |
VBN |
denotes |
cultured |
| T16427 |
33180-33182 |
IN |
denotes |
in |
| T16428 |
33183-33187 |
NN |
denotes |
DMEM |
| T16429 |
33188-33189 |
-LRB- |
denotes |
( |
| T16431 |
33189-33194 |
NNP |
denotes |
Sigma |
| T16432 |
33194-33195 |
HYPH |
denotes |
- |
| T16430 |
33195-33202 |
NNP |
denotes |
Aldrich |
| T16433 |
33202-33204 |
, |
denotes |
, |
| T16434 |
33204-33207 |
NNP |
denotes |
St. |
| T16435 |
33208-33213 |
NNP |
denotes |
Louis |
| T16436 |
33213-33215 |
, |
denotes |
, |
| T16437 |
33215-33223 |
NNP |
denotes |
Missouri |
| T16438 |
33223-33225 |
, |
denotes |
, |
| T16439 |
33225-33231 |
NNP |
denotes |
United |
| T16440 |
33232-33238 |
NNP |
denotes |
States |
| T16441 |
33238-33239 |
-RRB- |
denotes |
) |
| T16442 |
33240-33252 |
VBN |
denotes |
supplemented |
| T16443 |
33253-33257 |
IN |
denotes |
with |
| T16444 |
33258-33260 |
CD |
denotes |
10 |
| T16445 |
33260-33261 |
NN |
denotes |
% |
| T16446 |
33262-33265 |
NN |
denotes |
FBS |
| T16447 |
33266-33267 |
-LRB- |
denotes |
( |
| T16449 |
33267-33272 |
NNP |
denotes |
Sigma |
| T16450 |
33272-33273 |
HYPH |
denotes |
- |
| T16448 |
33273-33280 |
NNP |
denotes |
Aldrich |
| T16451 |
33280-33281 |
-RRB- |
denotes |
) |
| T16452 |
33281-33283 |
, |
denotes |
, |
| T16453 |
33283-33286 |
CD |
denotes |
100 |
| T16454 |
33287-33288 |
NN |
denotes |
U |
| T16455 |
33288-33289 |
SYM |
denotes |
/ |
| T16456 |
33289-33291 |
NN |
denotes |
ml |
| T16457 |
33292-33294 |
IN |
denotes |
of |
| T16458 |
33295-33305 |
NN |
denotes |
penicillin |
| T16459 |
33305-33307 |
, |
denotes |
, |
| T16460 |
33307-33310 |
CC |
denotes |
and |
| T16461 |
33311-33314 |
CD |
denotes |
100 |
| T16462 |
33315-33317 |
NN |
denotes |
μg |
| T16463 |
33317-33318 |
SYM |
denotes |
/ |
| T16464 |
33318-33320 |
NN |
denotes |
ml |
| T16465 |
33321-33323 |
IN |
denotes |
of |
| T16466 |
33324-33336 |
NN |
denotes |
streptomycin |
| T16467 |
33337-33339 |
IN |
denotes |
at |
| T16468 |
33340-33342 |
CD |
denotes |
37 |
| T16469 |
33343-33345 |
NN |
denotes |
°C |
| T16470 |
33346-33348 |
IN |
denotes |
in |
| T16471 |
33349-33350 |
CD |
denotes |
5 |
| T16472 |
33350-33351 |
NN |
denotes |
% |
| T16473 |
33352-33355 |
NN |
denotes |
CO2 |
| T16474 |
33355-33356 |
. |
denotes |
. |
| T16475 |
33356-33596 |
sentence |
denotes |
To generate stable MDCK cell lines, cells were transfected using Lipofectamine 2000 (Invitrogen) and the pcDNA3.1 expression constructs (containing wild-type AQP2, AQP2-F204V, or no insert) and selected with 900 μg/ml G418 (Sigma-Aldrich). |
| T16476 |
33357-33359 |
TO |
denotes |
To |
| T16477 |
33360-33368 |
VB |
denotes |
generate |
| T16479 |
33369-33375 |
JJ |
denotes |
stable |
| T16481 |
33376-33380 |
NN |
denotes |
MDCK |
| T16482 |
33381-33385 |
NN |
denotes |
cell |
| T16480 |
33386-33391 |
NNS |
denotes |
lines |
| T16483 |
33391-33393 |
, |
denotes |
, |
| T16484 |
33393-33398 |
NNS |
denotes |
cells |
| T16485 |
33399-33403 |
VBD |
denotes |
were |
| T16478 |
33404-33415 |
VBN |
denotes |
transfected |
| T16486 |
33416-33421 |
VBG |
denotes |
using |
| T16487 |
33422-33435 |
NN |
denotes |
Lipofectamine |
| T16488 |
33436-33440 |
CD |
denotes |
2000 |
| T16489 |
33441-33442 |
-LRB- |
denotes |
( |
| T16490 |
33442-33452 |
NNP |
denotes |
Invitrogen |
| T16491 |
33452-33453 |
-RRB- |
denotes |
) |
| T16492 |
33454-33457 |
CC |
denotes |
and |
| T16493 |
33458-33461 |
DT |
denotes |
the |
| T16495 |
33462-33470 |
NN |
denotes |
pcDNA3.1 |
| T16496 |
33471-33481 |
NN |
denotes |
expression |
| T16494 |
33482-33492 |
NNS |
denotes |
constructs |
| T16497 |
33493-33494 |
-LRB- |
denotes |
( |
| T16498 |
33494-33504 |
VBG |
denotes |
containing |
| T16499 |
33505-33509 |
JJ |
denotes |
wild |
| T16501 |
33509-33510 |
HYPH |
denotes |
- |
| T16500 |
33510-33514 |
NN |
denotes |
type |
| T16502 |
33515-33519 |
NN |
denotes |
AQP2 |
| T16503 |
33519-33521 |
, |
denotes |
, |
| T16504 |
33521-33525 |
NN |
denotes |
AQP2 |
| T16506 |
33525-33526 |
HYPH |
denotes |
- |
| T16505 |
33526-33531 |
NN |
denotes |
F204V |
| T16507 |
33531-33533 |
, |
denotes |
, |
| T16508 |
33533-33535 |
CC |
denotes |
or |
| T16509 |
33536-33538 |
DT |
denotes |
no |
| T16510 |
33539-33545 |
NN |
denotes |
insert |
| T16511 |
33545-33546 |
-RRB- |
denotes |
) |
| T16512 |
33547-33550 |
CC |
denotes |
and |
| T16513 |
33551-33559 |
VBN |
denotes |
selected |
| T16514 |
33560-33564 |
IN |
denotes |
with |
| T16515 |
33565-33568 |
CD |
denotes |
900 |
| T16516 |
33569-33571 |
NN |
denotes |
μg |
| T16518 |
33571-33572 |
SYM |
denotes |
/ |
| T16519 |
33572-33574 |
NN |
denotes |
ml |
| T16517 |
33575-33579 |
NN |
denotes |
G418 |
| T16520 |
33580-33581 |
-LRB- |
denotes |
( |
| T16522 |
33581-33586 |
NNP |
denotes |
Sigma |
| T16523 |
33586-33587 |
HYPH |
denotes |
- |
| T16521 |
33587-33594 |
NNP |
denotes |
Aldrich |
| T16524 |
33594-33595 |
-RRB- |
denotes |
) |
| T16525 |
33595-33596 |
. |
denotes |
. |
| T16526 |
33596-33642 |
sentence |
denotes |
Individual colonies were expanded 14 d later. |
| T16527 |
33597-33607 |
JJ |
denotes |
Individual |
| T16528 |
33608-33616 |
NNS |
denotes |
colonies |
| T16530 |
33617-33621 |
VBD |
denotes |
were |
| T16529 |
33622-33630 |
VBN |
denotes |
expanded |
| T16531 |
33631-33633 |
CD |
denotes |
14 |
| T16532 |
33634-33635 |
NN |
denotes |
d |
| T16533 |
33636-33641 |
RB |
denotes |
later |
| T16534 |
33641-33642 |
. |
denotes |
. |
| T16535 |
33642-33732 |
sentence |
denotes |
For the duration of these experiments, the antibiotic was continually added to the media. |
| T16536 |
33643-33646 |
IN |
denotes |
For |
| T16538 |
33647-33650 |
DT |
denotes |
the |
| T16539 |
33651-33659 |
NN |
denotes |
duration |
| T16540 |
33660-33662 |
IN |
denotes |
of |
| T16541 |
33663-33668 |
DT |
denotes |
these |
| T16542 |
33669-33680 |
NNS |
denotes |
experiments |
| T16543 |
33680-33682 |
, |
denotes |
, |
| T16544 |
33682-33685 |
DT |
denotes |
the |
| T16545 |
33686-33696 |
NN |
denotes |
antibiotic |
| T16546 |
33697-33700 |
VBD |
denotes |
was |
| T16547 |
33701-33712 |
RB |
denotes |
continually |
| T16537 |
33713-33718 |
VBN |
denotes |
added |
| T16548 |
33719-33721 |
IN |
denotes |
to |
| T16549 |
33722-33725 |
DT |
denotes |
the |
| T16550 |
33726-33731 |
NNS |
denotes |
media |
| T16551 |
33731-33732 |
. |
denotes |
. |
| T16552 |
33732-33843 |
sentence |
denotes |
Transient GFP transfections were carried out in subconfluent stable cells lines also using Lipofectamine 2000. |
| T16553 |
33733-33742 |
JJ |
denotes |
Transient |
| T16555 |
33743-33746 |
NN |
denotes |
GFP |
| T16554 |
33747-33760 |
NNS |
denotes |
transfections |
| T16557 |
33761-33765 |
VBD |
denotes |
were |
| T16556 |
33766-33773 |
VBN |
denotes |
carried |
| T16558 |
33774-33777 |
RP |
denotes |
out |
| T16559 |
33778-33780 |
IN |
denotes |
in |
| T16560 |
33781-33793 |
JJ |
denotes |
subconfluent |
| T16562 |
33794-33800 |
JJ |
denotes |
stable |
| T16563 |
33801-33806 |
NNS |
denotes |
cells |
| T16561 |
33807-33812 |
NNS |
denotes |
lines |
| T16564 |
33813-33817 |
RB |
denotes |
also |
| T16565 |
33818-33823 |
VBG |
denotes |
using |
| T16566 |
33824-33837 |
NN |
denotes |
Lipofectamine |
| T16567 |
33838-33842 |
CD |
denotes |
2000 |
| T16568 |
33842-33843 |
. |
denotes |
. |
| T16676 |
33845-33855 |
NN |
denotes |
Sequencing |
| T16677 |
33856-33858 |
IN |
denotes |
of |
| T16678 |
33859-33863 |
NN |
denotes |
Aqp2 |
| T16679 |
33864-33867 |
CC |
denotes |
and |
| T16680 |
33868-33878 |
NN |
denotes |
genotyping |
| T16681 |
33879-33881 |
IN |
denotes |
of |
| T16682 |
33882-33886 |
NNS |
denotes |
mice |
| T16683 |
33886-33887 |
. |
denotes |
. |
| T16684 |
33887-33958 |
sentence |
denotes |
All exons of Aqp2 were amplified from mouse genomic DNA and sequenced. |
| T16685 |
33888-33891 |
DT |
denotes |
All |
| T16686 |
33892-33897 |
NNS |
denotes |
exons |
| T16688 |
33898-33900 |
IN |
denotes |
of |
| T16689 |
33901-33905 |
NN |
denotes |
Aqp2 |
| T16690 |
33906-33910 |
VBD |
denotes |
were |
| T16687 |
33911-33920 |
VBN |
denotes |
amplified |
| T16691 |
33921-33925 |
IN |
denotes |
from |
| T16692 |
33926-33931 |
NN |
denotes |
mouse |
| T16694 |
33932-33939 |
JJ |
denotes |
genomic |
| T16693 |
33940-33943 |
NN |
denotes |
DNA |
| T16695 |
33944-33947 |
CC |
denotes |
and |
| T16696 |
33948-33957 |
VBN |
denotes |
sequenced |
| T16697 |
33957-33958 |
. |
denotes |
. |
| T16698 |
33958-34072 |
sentence |
denotes |
For genotyping, exon 4 was amplified using the primers 5′-TCAGAACTTGCCCACTAGCC-3′ and 5′-TGTAGAGGAGGGAACCGATG-3′. |
| T16699 |
33959-33962 |
IN |
denotes |
For |
| T16701 |
33963-33973 |
NN |
denotes |
genotyping |
| T16702 |
33973-33975 |
, |
denotes |
, |
| T16703 |
33975-33979 |
NN |
denotes |
exon |
| T16704 |
33980-33981 |
CD |
denotes |
4 |
| T16705 |
33982-33985 |
VBD |
denotes |
was |
| T16700 |
33986-33995 |
VBN |
denotes |
amplified |
| T16706 |
33996-34001 |
VBG |
denotes |
using |
| T16707 |
34002-34005 |
DT |
denotes |
the |
| T16708 |
34006-34013 |
NNS |
denotes |
primers |
| T16709 |
34014-34015 |
CD |
denotes |
5 |
| T16711 |
34015-34016 |
SYM |
denotes |
′ |
| T16712 |
34016-34017 |
HYPH |
denotes |
- |
| T16710 |
34017-34037 |
NN |
denotes |
TCAGAACTTGCCCACTAGCC |
| T16713 |
34037-34038 |
HYPH |
denotes |
- |
| T16714 |
34038-34039 |
CD |
denotes |
3 |
| T16715 |
34039-34040 |
SYM |
denotes |
′ |
| T16716 |
34041-34044 |
CC |
denotes |
and |
| T16717 |
34045-34046 |
CD |
denotes |
5 |
| T16719 |
34046-34047 |
SYM |
denotes |
′ |
| T16720 |
34047-34048 |
HYPH |
denotes |
- |
| T16718 |
34048-34068 |
NN |
denotes |
TGTAGAGGAGGGAACCGATG |
| T16721 |
34068-34069 |
HYPH |
denotes |
- |
| T16722 |
34069-34070 |
CD |
denotes |
3 |
| T16723 |
34070-34071 |
SYM |
denotes |
′ |
| T16724 |
34071-34072 |
. |
denotes |
. |
| T16959 |
34074-34079 |
NN |
denotes |
Urine |
| T16960 |
34080-34092 |
NNS |
denotes |
measurements |
| T16961 |
34092-34093 |
. |
denotes |
. |
| T16962 |
34093-34277 |
sentence |
denotes |
Total urine output was measured by separately housing adult mice in Nalgene Metabolic Cages (Minimitter, Bend, Oregon, United States) for 2–3 d and collecting urine every 24 h period. |
| T16963 |
34094-34099 |
JJ |
denotes |
Total |
| T16965 |
34100-34105 |
NN |
denotes |
urine |
| T16964 |
34106-34112 |
NN |
denotes |
output |
| T16967 |
34113-34116 |
VBD |
denotes |
was |
| T16966 |
34117-34125 |
VBN |
denotes |
measured |
| T16968 |
34126-34128 |
IN |
denotes |
by |
| T16969 |
34129-34139 |
RB |
denotes |
separately |
| T16970 |
34140-34147 |
VBG |
denotes |
housing |
| T16971 |
34148-34153 |
JJ |
denotes |
adult |
| T16972 |
34154-34158 |
NNS |
denotes |
mice |
| T16973 |
34159-34161 |
IN |
denotes |
in |
| T16974 |
34162-34169 |
NNP |
denotes |
Nalgene |
| T16976 |
34170-34179 |
JJ |
denotes |
Metabolic |
| T16975 |
34180-34185 |
NNS |
denotes |
Cages |
| T16977 |
34186-34187 |
-LRB- |
denotes |
( |
| T16978 |
34187-34197 |
NNP |
denotes |
Minimitter |
| T16979 |
34197-34199 |
, |
denotes |
, |
| T16980 |
34199-34203 |
NNP |
denotes |
Bend |
| T16981 |
34203-34205 |
, |
denotes |
, |
| T16982 |
34205-34211 |
NNP |
denotes |
Oregon |
| T16983 |
34211-34213 |
, |
denotes |
, |
| T16984 |
34213-34219 |
NNP |
denotes |
United |
| T16985 |
34220-34226 |
NNP |
denotes |
States |
| T16986 |
34226-34227 |
-RRB- |
denotes |
) |
| T16987 |
34228-34231 |
IN |
denotes |
for |
| T16988 |
34232-34233 |
CD |
denotes |
2 |
| T16990 |
34233-34234 |
SYM |
denotes |
– |
| T16989 |
34234-34235 |
CD |
denotes |
3 |
| T16991 |
34236-34237 |
NN |
denotes |
d |
| T16992 |
34238-34241 |
CC |
denotes |
and |
| T16993 |
34242-34252 |
VBG |
denotes |
collecting |
| T16994 |
34253-34258 |
NN |
denotes |
urine |
| T16995 |
34259-34264 |
DT |
denotes |
every |
| T16997 |
34265-34267 |
CD |
denotes |
24 |
| T16998 |
34268-34269 |
NN |
denotes |
h |
| T16996 |
34270-34276 |
NN |
denotes |
period |
| T16999 |
34276-34277 |
. |
denotes |
. |
| T17000 |
34277-34404 |
sentence |
denotes |
Urine osmolalities were determined using an Osmometer (Osmette 5004; Precision Systems, Natick, Massachusetts, United States). |
| T17001 |
34278-34283 |
NN |
denotes |
Urine |
| T17002 |
34284-34296 |
NNS |
denotes |
osmolalities |
| T17004 |
34297-34301 |
VBD |
denotes |
were |
| T17003 |
34302-34312 |
VBN |
denotes |
determined |
| T17005 |
34313-34318 |
VBG |
denotes |
using |
| T17006 |
34319-34321 |
DT |
denotes |
an |
| T17007 |
34322-34331 |
NN |
denotes |
Osmometer |
| T17008 |
34332-34333 |
-LRB- |
denotes |
( |
| T17010 |
34333-34340 |
NNP |
denotes |
Osmette |
| T17011 |
34341-34345 |
CD |
denotes |
5004 |
| T17012 |
34345-34346 |
: |
denotes |
; |
| T17013 |
34347-34356 |
NNP |
denotes |
Precision |
| T17009 |
34357-34364 |
NNP |
denotes |
Systems |
| T17014 |
34364-34366 |
, |
denotes |
, |
| T17015 |
34366-34372 |
NNP |
denotes |
Natick |
| T17016 |
34372-34374 |
, |
denotes |
, |
| T17017 |
34374-34387 |
NNP |
denotes |
Massachusetts |
| T17018 |
34387-34389 |
, |
denotes |
, |
| T17019 |
34389-34395 |
NNP |
denotes |
United |
| T17020 |
34396-34402 |
NNP |
denotes |
States |
| T17021 |
34402-34403 |
-RRB- |
denotes |
) |
| T17022 |
34403-34404 |
. |
denotes |
. |
| T17023 |
34404-34504 |
sentence |
denotes |
Urine concentrating experiments were carried out by intraperitoneal injection of dDAVP (0.4 μg/kg). |
| T17024 |
34405-34410 |
NN |
denotes |
Urine |
| T17025 |
34411-34424 |
VBG |
denotes |
concentrating |
| T17026 |
34425-34436 |
NNS |
denotes |
experiments |
| T17028 |
34437-34441 |
VBD |
denotes |
were |
| T17027 |
34442-34449 |
VBN |
denotes |
carried |
| T17029 |
34450-34453 |
RP |
denotes |
out |
| T17030 |
34454-34456 |
IN |
denotes |
by |
| T17031 |
34457-34472 |
JJ |
denotes |
intraperitoneal |
| T17032 |
34473-34482 |
NN |
denotes |
injection |
| T17033 |
34483-34485 |
IN |
denotes |
of |
| T17034 |
34486-34491 |
NN |
denotes |
dDAVP |
| T17035 |
34492-34493 |
-LRB- |
denotes |
( |
| T17037 |
34493-34496 |
CD |
denotes |
0.4 |
| T17036 |
34497-34499 |
NN |
denotes |
μg |
| T17038 |
34499-34500 |
SYM |
denotes |
/ |
| T17039 |
34500-34502 |
NN |
denotes |
kg |
| T17040 |
34502-34503 |
-RRB- |
denotes |
) |
| T17041 |
34503-34504 |
. |
denotes |
. |
| T17042 |
34504-34577 |
sentence |
denotes |
Mice were injected twice with dDAVP, once at time 0 and again at 30 min. |
| T17043 |
34505-34509 |
NNS |
denotes |
Mice |
| T17045 |
34510-34514 |
VBD |
denotes |
were |
| T17044 |
34515-34523 |
VBN |
denotes |
injected |
| T17046 |
34524-34529 |
RB |
denotes |
twice |
| T17047 |
34530-34534 |
IN |
denotes |
with |
| T17048 |
34535-34540 |
NN |
denotes |
dDAVP |
| T17049 |
34540-34542 |
, |
denotes |
, |
| T17050 |
34542-34546 |
RB |
denotes |
once |
| T17051 |
34547-34549 |
IN |
denotes |
at |
| T17052 |
34550-34554 |
NN |
denotes |
time |
| T17053 |
34555-34556 |
CD |
denotes |
0 |
| T17054 |
34557-34560 |
CC |
denotes |
and |
| T17055 |
34561-34566 |
RB |
denotes |
again |
| T17056 |
34567-34569 |
IN |
denotes |
at |
| T17057 |
34570-34572 |
CD |
denotes |
30 |
| T17058 |
34573-34576 |
NN |
denotes |
min |
| T17059 |
34576-34577 |
. |
denotes |
. |
| T17060 |
34577-34667 |
sentence |
denotes |
Urine was collected at the start of the experiment and 30 min after the second injection. |
| T17061 |
34578-34583 |
NN |
denotes |
Urine |
| T17063 |
34584-34587 |
VBD |
denotes |
was |
| T17062 |
34588-34597 |
VBN |
denotes |
collected |
| T17064 |
34598-34600 |
IN |
denotes |
at |
| T17065 |
34601-34604 |
DT |
denotes |
the |
| T17066 |
34605-34610 |
NN |
denotes |
start |
| T17067 |
34611-34613 |
IN |
denotes |
of |
| T17068 |
34614-34617 |
DT |
denotes |
the |
| T17069 |
34618-34628 |
NN |
denotes |
experiment |
| T17070 |
34629-34632 |
CC |
denotes |
and |
| T17071 |
34633-34635 |
CD |
denotes |
30 |
| T17072 |
34636-34639 |
NN |
denotes |
min |
| T17073 |
34640-34645 |
IN |
denotes |
after |
| T17074 |
34646-34649 |
DT |
denotes |
the |
| T17076 |
34650-34656 |
JJ |
denotes |
second |
| T17075 |
34657-34666 |
NN |
denotes |
injection |
| T17077 |
34666-34667 |
. |
denotes |
. |
| T17265 |
34669-34675 |
NN |
denotes |
Kidney |
| T17266 |
34676-34684 |
NN |
denotes |
membrane |
| T17267 |
34685-34696 |
NN |
denotes |
preparation |
| T17268 |
34696-34697 |
. |
denotes |
. |
| T17269 |
34697-34878 |
sentence |
denotes |
Whole mouse kidneys were homogenized in 10 mM Tris (pH 7.4), 350 mM sucrose, and 5 mM EDTA containing protease inhibitors (Sigma-Aldrich, #P-8340) in a Potter-Elvehjem homogenizer. |
| T17270 |
34698-34703 |
JJ |
denotes |
Whole |
| T17272 |
34704-34709 |
NN |
denotes |
mouse |
| T17271 |
34710-34717 |
NNS |
denotes |
kidneys |
| T17274 |
34718-34722 |
VBD |
denotes |
were |
| T17273 |
34723-34734 |
VBN |
denotes |
homogenized |
| T17275 |
34735-34737 |
IN |
denotes |
in |
| T17276 |
34738-34740 |
CD |
denotes |
10 |
| T17277 |
34741-34743 |
NN |
denotes |
mM |
| T17278 |
34744-34748 |
NN |
denotes |
Tris |
| T17279 |
34749-34750 |
-LRB- |
denotes |
( |
| T17280 |
34750-34752 |
NN |
denotes |
pH |
| T17281 |
34753-34756 |
CD |
denotes |
7.4 |
| T17282 |
34756-34757 |
-RRB- |
denotes |
) |
| T17283 |
34757-34759 |
, |
denotes |
, |
| T17284 |
34759-34762 |
CD |
denotes |
350 |
| T17285 |
34763-34765 |
NN |
denotes |
mM |
| T17286 |
34766-34773 |
NN |
denotes |
sucrose |
| T17287 |
34773-34775 |
, |
denotes |
, |
| T17288 |
34775-34778 |
CC |
denotes |
and |
| T17289 |
34779-34780 |
CD |
denotes |
5 |
| T17290 |
34781-34783 |
NN |
denotes |
mM |
| T17291 |
34784-34788 |
NN |
denotes |
EDTA |
| T17292 |
34789-34799 |
VBG |
denotes |
containing |
| T17293 |
34800-34808 |
NN |
denotes |
protease |
| T17294 |
34809-34819 |
NNS |
denotes |
inhibitors |
| T17295 |
34820-34821 |
-LRB- |
denotes |
( |
| T17297 |
34821-34826 |
NNP |
denotes |
Sigma |
| T17299 |
34826-34827 |
HYPH |
denotes |
- |
| T17298 |
34827-34834 |
NNP |
denotes |
Aldrich |
| T17300 |
34834-34836 |
, |
denotes |
, |
| T17301 |
34836-34837 |
SYM |
denotes |
# |
| T17296 |
34837-34838 |
NN |
denotes |
P |
| T17302 |
34838-34839 |
HYPH |
denotes |
- |
| T17303 |
34839-34843 |
CD |
denotes |
8340 |
| T17304 |
34843-34844 |
-RRB- |
denotes |
) |
| T17305 |
34845-34847 |
IN |
denotes |
in |
| T17306 |
34848-34849 |
DT |
denotes |
a |
| T17308 |
34850-34856 |
NNP |
denotes |
Potter |
| T17310 |
34856-34857 |
HYPH |
denotes |
- |
| T17309 |
34857-34865 |
NNP |
denotes |
Elvehjem |
| T17307 |
34866-34877 |
NN |
denotes |
homogenizer |
| T17311 |
34877-34878 |
. |
denotes |
. |
| T17312 |
34878-35018 |
sentence |
denotes |
The homogenate was centrifuged at 2,000 g for 10 min and the supernatant was subjected to ultracentrifugation at 100,000 g for 1 h at 4 °C. |
| T17313 |
34879-34882 |
DT |
denotes |
The |
| T17314 |
34883-34893 |
NN |
denotes |
homogenate |
| T17316 |
34894-34897 |
VBD |
denotes |
was |
| T17315 |
34898-34909 |
VBN |
denotes |
centrifuged |
| T17317 |
34910-34912 |
IN |
denotes |
at |
| T17318 |
34913-34918 |
CD |
denotes |
2,000 |
| T17319 |
34919-34920 |
NN |
denotes |
g |
| T17320 |
34921-34924 |
IN |
denotes |
for |
| T17321 |
34925-34927 |
CD |
denotes |
10 |
| T17322 |
34928-34931 |
NN |
denotes |
min |
| T17323 |
34932-34935 |
CC |
denotes |
and |
| T17324 |
34936-34939 |
DT |
denotes |
the |
| T17325 |
34940-34951 |
NN |
denotes |
supernatant |
| T17327 |
34952-34955 |
VBD |
denotes |
was |
| T17326 |
34956-34965 |
VBN |
denotes |
subjected |
| T17328 |
34966-34968 |
IN |
denotes |
to |
| T17329 |
34969-34988 |
NN |
denotes |
ultracentrifugation |
| T17330 |
34989-34991 |
IN |
denotes |
at |
| T17331 |
34992-34999 |
CD |
denotes |
100,000 |
| T17332 |
35000-35001 |
NN |
denotes |
g |
| T17333 |
35002-35005 |
IN |
denotes |
for |
| T17334 |
35006-35007 |
CD |
denotes |
1 |
| T17335 |
35008-35009 |
NN |
denotes |
h |
| T17336 |
35010-35012 |
IN |
denotes |
at |
| T17337 |
35013-35014 |
CD |
denotes |
4 |
| T17338 |
35015-35017 |
NN |
denotes |
°C |
| T17339 |
35017-35018 |
. |
denotes |
. |
| T17340 |
35018-35134 |
sentence |
denotes |
Pelleted membranes were resuspended in the same buffer, and protein concentration was determined by Bradford assay. |
| T17341 |
35019-35027 |
VBN |
denotes |
Pelleted |
| T17342 |
35028-35037 |
NNS |
denotes |
membranes |
| T17344 |
35038-35042 |
VBD |
denotes |
were |
| T17343 |
35043-35054 |
VBN |
denotes |
resuspended |
| T17345 |
35055-35057 |
IN |
denotes |
in |
| T17346 |
35058-35061 |
DT |
denotes |
the |
| T17348 |
35062-35066 |
JJ |
denotes |
same |
| T17347 |
35067-35073 |
NN |
denotes |
buffer |
| T17349 |
35073-35075 |
, |
denotes |
, |
| T17350 |
35075-35078 |
CC |
denotes |
and |
| T17351 |
35079-35086 |
NN |
denotes |
protein |
| T17352 |
35087-35100 |
NN |
denotes |
concentration |
| T17354 |
35101-35104 |
VBD |
denotes |
was |
| T17353 |
35105-35115 |
VBN |
denotes |
determined |
| T17355 |
35116-35118 |
IN |
denotes |
by |
| T17356 |
35119-35127 |
NNP |
denotes |
Bradford |
| T17357 |
35128-35133 |
NN |
denotes |
assay |
| T17358 |
35133-35134 |
. |
denotes |
. |
| T17614 |
35136-35150 |
NN |
denotes |
Immunoblotting |
| T17615 |
35150-35151 |
. |
denotes |
. |
| T17616 |
35151-35277 |
sentence |
denotes |
Kidney membrane fractions (60 μg) were resolved on a 12% SDS-polyacrylamide gel and transferred to a nitrocellulose membrane. |
| T17617 |
35152-35158 |
NN |
denotes |
Kidney |
| T17618 |
35159-35167 |
NN |
denotes |
membrane |
| T17619 |
35168-35177 |
NNS |
denotes |
fractions |
| T17621 |
35178-35179 |
-LRB- |
denotes |
( |
| T17623 |
35179-35181 |
CD |
denotes |
60 |
| T17622 |
35182-35184 |
NN |
denotes |
μg |
| T17624 |
35184-35185 |
-RRB- |
denotes |
) |
| T17625 |
35186-35190 |
VBD |
denotes |
were |
| T17620 |
35191-35199 |
VBN |
denotes |
resolved |
| T17626 |
35200-35202 |
IN |
denotes |
on |
| T17627 |
35203-35204 |
DT |
denotes |
a |
| T17629 |
35205-35207 |
CD |
denotes |
12 |
| T17630 |
35207-35208 |
NN |
denotes |
% |
| T17631 |
35209-35212 |
NN |
denotes |
SDS |
| T17633 |
35212-35213 |
HYPH |
denotes |
- |
| T17632 |
35213-35227 |
NN |
denotes |
polyacrylamide |
| T17628 |
35228-35231 |
NN |
denotes |
gel |
| T17634 |
35232-35235 |
CC |
denotes |
and |
| T17635 |
35236-35247 |
VBN |
denotes |
transferred |
| T17636 |
35248-35250 |
IN |
denotes |
to |
| T17637 |
35251-35252 |
DT |
denotes |
a |
| T17639 |
35253-35267 |
NN |
denotes |
nitrocellulose |
| T17638 |
35268-35276 |
NN |
denotes |
membrane |
| T17640 |
35276-35277 |
. |
denotes |
. |
| T17641 |
35277-35523 |
sentence |
denotes |
Membranes were blocked in 5% nonfat milk in Tris-buffered saline with 0.05% Tween 20 (TBST), followed by an overnight incubation (at 4 °C) with AQP2 polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, California, United States; #sc-9882). |
| T17642 |
35278-35287 |
NNS |
denotes |
Membranes |
| T17644 |
35288-35292 |
VBD |
denotes |
were |
| T17643 |
35293-35300 |
VBN |
denotes |
blocked |
| T17645 |
35301-35303 |
IN |
denotes |
in |
| T17646 |
35304-35305 |
CD |
denotes |
5 |
| T17647 |
35305-35306 |
NN |
denotes |
% |
| T17649 |
35307-35313 |
JJ |
denotes |
nonfat |
| T17648 |
35314-35318 |
NN |
denotes |
milk |
| T17650 |
35319-35321 |
IN |
denotes |
in |
| T17651 |
35322-35326 |
NN |
denotes |
Tris |
| T17653 |
35326-35327 |
HYPH |
denotes |
- |
| T17652 |
35327-35335 |
VBN |
denotes |
buffered |
| T17654 |
35336-35342 |
NN |
denotes |
saline |
| T17655 |
35343-35347 |
IN |
denotes |
with |
| T17656 |
35348-35352 |
CD |
denotes |
0.05 |
| T17657 |
35352-35353 |
NN |
denotes |
% |
| T17658 |
35354-35359 |
NN |
denotes |
Tween |
| T17659 |
35360-35362 |
CD |
denotes |
20 |
| T17660 |
35363-35364 |
-LRB- |
denotes |
( |
| T17661 |
35364-35368 |
NN |
denotes |
TBST |
| T17662 |
35368-35369 |
-RRB- |
denotes |
) |
| T17663 |
35369-35371 |
, |
denotes |
, |
| T17664 |
35371-35379 |
VBN |
denotes |
followed |
| T17665 |
35380-35382 |
IN |
denotes |
by |
| T17666 |
35383-35385 |
DT |
denotes |
an |
| T17668 |
35386-35395 |
JJ |
denotes |
overnight |
| T17667 |
35396-35406 |
NN |
denotes |
incubation |
| T17669 |
35407-35408 |
-LRB- |
denotes |
( |
| T17670 |
35408-35410 |
IN |
denotes |
at |
| T17671 |
35411-35412 |
CD |
denotes |
4 |
| T17672 |
35413-35415 |
NN |
denotes |
°C |
| T17673 |
35415-35416 |
-RRB- |
denotes |
) |
| T17674 |
35417-35421 |
IN |
denotes |
with |
| T17675 |
35422-35426 |
NN |
denotes |
AQP2 |
| T17677 |
35427-35437 |
JJ |
denotes |
polyclonal |
| T17676 |
35438-35446 |
NN |
denotes |
antibody |
| T17678 |
35447-35448 |
-LRB- |
denotes |
( |
| T17680 |
35448-35453 |
NNP |
denotes |
Santa |
| T17681 |
35454-35458 |
NNP |
denotes |
Cruz |
| T17682 |
35459-35472 |
NNP |
denotes |
Biotechnology |
| T17683 |
35472-35474 |
, |
denotes |
, |
| T17684 |
35474-35479 |
NNP |
denotes |
Santa |
| T17685 |
35480-35484 |
NNP |
denotes |
Cruz |
| T17686 |
35484-35486 |
, |
denotes |
, |
| T17687 |
35486-35496 |
NNP |
denotes |
California |
| T17688 |
35496-35498 |
, |
denotes |
, |
| T17689 |
35498-35504 |
NNP |
denotes |
United |
| T17690 |
35505-35511 |
NNP |
denotes |
States |
| T17691 |
35511-35512 |
: |
denotes |
; |
| T17692 |
35513-35514 |
SYM |
denotes |
# |
| T17679 |
35514-35516 |
NN |
denotes |
sc |
| T17693 |
35516-35517 |
HYPH |
denotes |
- |
| T17694 |
35517-35521 |
CD |
denotes |
9882 |
| T17695 |
35521-35522 |
-RRB- |
denotes |
) |
| T17696 |
35522-35523 |
. |
denotes |
. |
| T17697 |
35523-35615 |
sentence |
denotes |
Membranes were washed in TBST then incubated with HRP-conjugated donkey anti-goat antibody. |
| T17698 |
35524-35533 |
NNS |
denotes |
Membranes |
| T17700 |
35534-35538 |
VBD |
denotes |
were |
| T17699 |
35539-35545 |
VBN |
denotes |
washed |
| T17701 |
35546-35548 |
IN |
denotes |
in |
| T17702 |
35549-35553 |
NN |
denotes |
TBST |
| T17703 |
35554-35558 |
RB |
denotes |
then |
| T17704 |
35559-35568 |
VBN |
denotes |
incubated |
| T17705 |
35569-35573 |
IN |
denotes |
with |
| T17706 |
35574-35577 |
NN |
denotes |
HRP |
| T17708 |
35577-35578 |
HYPH |
denotes |
- |
| T17707 |
35578-35588 |
VBN |
denotes |
conjugated |
| T17710 |
35589-35595 |
NN |
denotes |
donkey |
| T17711 |
35596-35605 |
JJ |
denotes |
anti-goat |
| T17709 |
35606-35614 |
NN |
denotes |
antibody |
| T17712 |
35614-35615 |
. |
denotes |
. |
| T17713 |
35615-35754 |
sentence |
denotes |
Membranes were washed further in TBST and bands were visualized using ECL reagent (Amersham Biosciences, Little Chalfont, United Kingdom). |
| T17714 |
35616-35625 |
NNS |
denotes |
Membranes |
| T17716 |
35626-35630 |
VBD |
denotes |
were |
| T17715 |
35631-35637 |
VBN |
denotes |
washed |
| T17717 |
35638-35645 |
RB |
denotes |
further |
| T17718 |
35646-35648 |
IN |
denotes |
in |
| T17719 |
35649-35653 |
NN |
denotes |
TBST |
| T17720 |
35654-35657 |
CC |
denotes |
and |
| T17721 |
35658-35663 |
NNS |
denotes |
bands |
| T17723 |
35664-35668 |
VBD |
denotes |
were |
| T17722 |
35669-35679 |
VBN |
denotes |
visualized |
| T17724 |
35680-35685 |
VBG |
denotes |
using |
| T17725 |
35686-35689 |
NN |
denotes |
ECL |
| T17726 |
35690-35697 |
NN |
denotes |
reagent |
| T17727 |
35698-35699 |
-LRB- |
denotes |
( |
| T17729 |
35699-35707 |
NNP |
denotes |
Amersham |
| T17728 |
35708-35719 |
NNP |
denotes |
Biosciences |
| T17730 |
35719-35721 |
, |
denotes |
, |
| T17731 |
35721-35727 |
NNP |
denotes |
Little |
| T17732 |
35728-35736 |
NNP |
denotes |
Chalfont |
| T17733 |
35736-35738 |
, |
denotes |
, |
| T17734 |
35738-35744 |
NNP |
denotes |
United |
| T17735 |
35745-35752 |
NNP |
denotes |
Kingdom |
| T17736 |
35752-35753 |
-RRB- |
denotes |
) |
| T17737 |
35753-35754 |
. |
denotes |
. |
| T17905 |
35756-35771 |
NN |
denotes |
Endoglycosidase |
| T17906 |
35772-35781 |
NN |
denotes |
digestion |
| T17907 |
35781-35782 |
. |
denotes |
. |
| T17908 |
35782-35938 |
sentence |
denotes |
Kidney membranes (60 μg) were incubated in 50 mM sodium phosphate (pH 5.5), 0.1% SDS, and 50 mM β-mercaptoethanol, heated to 100 °C for 5 min, then cooled. |
| T17909 |
35783-35789 |
NN |
denotes |
Kidney |
| T17910 |
35790-35799 |
NNS |
denotes |
membranes |
| T17912 |
35800-35801 |
-LRB- |
denotes |
( |
| T17914 |
35801-35803 |
CD |
denotes |
60 |
| T17913 |
35804-35806 |
NN |
denotes |
μg |
| T17915 |
35806-35807 |
-RRB- |
denotes |
) |
| T17916 |
35808-35812 |
VBD |
denotes |
were |
| T17911 |
35813-35822 |
VBN |
denotes |
incubated |
| T17917 |
35823-35825 |
IN |
denotes |
in |
| T17918 |
35826-35828 |
CD |
denotes |
50 |
| T17919 |
35829-35831 |
NN |
denotes |
mM |
| T17921 |
35832-35838 |
NN |
denotes |
sodium |
| T17920 |
35839-35848 |
NN |
denotes |
phosphate |
| T17922 |
35849-35850 |
-LRB- |
denotes |
( |
| T17923 |
35850-35852 |
NN |
denotes |
pH |
| T17924 |
35853-35856 |
CD |
denotes |
5.5 |
| T17925 |
35856-35857 |
-RRB- |
denotes |
) |
| T17926 |
35857-35859 |
, |
denotes |
, |
| T17927 |
35859-35862 |
CD |
denotes |
0.1 |
| T17928 |
35862-35863 |
NN |
denotes |
% |
| T17929 |
35864-35867 |
NN |
denotes |
SDS |
| T17930 |
35867-35869 |
, |
denotes |
, |
| T17931 |
35869-35872 |
CC |
denotes |
and |
| T17932 |
35873-35875 |
CD |
denotes |
50 |
| T17933 |
35876-35878 |
NN |
denotes |
mM |
| T17935 |
35879-35880 |
NN |
denotes |
β |
| T17936 |
35880-35881 |
HYPH |
denotes |
- |
| T17934 |
35881-35896 |
NN |
denotes |
mercaptoethanol |
| T17937 |
35896-35898 |
, |
denotes |
, |
| T17938 |
35898-35904 |
VBN |
denotes |
heated |
| T17939 |
35905-35907 |
IN |
denotes |
to |
| T17940 |
35908-35911 |
CD |
denotes |
100 |
| T17941 |
35912-35914 |
NN |
denotes |
°C |
| T17942 |
35915-35918 |
IN |
denotes |
for |
| T17943 |
35919-35920 |
CD |
denotes |
5 |
| T17944 |
35921-35924 |
NN |
denotes |
min |
| T17945 |
35924-35926 |
, |
denotes |
, |
| T17946 |
35926-35930 |
RB |
denotes |
then |
| T17947 |
35931-35937 |
VBN |
denotes |
cooled |
| T17948 |
35937-35938 |
. |
denotes |
. |
| T17949 |
35938-36026 |
sentence |
denotes |
Endoglycosidase H (0.01 units; Sigma-Aldrich) was added and incubated at 37 °C for 2 h. |
| T17950 |
35939-35954 |
NN |
denotes |
Endoglycosidase |
| T17951 |
35955-35956 |
NN |
denotes |
H |
| T17953 |
35957-35958 |
-LRB- |
denotes |
( |
| T17955 |
35958-35962 |
CD |
denotes |
0.01 |
| T17956 |
35963-35968 |
NNS |
denotes |
units |
| T17957 |
35968-35969 |
: |
denotes |
; |
| T17958 |
35970-35975 |
NNP |
denotes |
Sigma |
| T17959 |
35975-35976 |
HYPH |
denotes |
- |
| T17954 |
35976-35983 |
NNP |
denotes |
Aldrich |
| T17960 |
35983-35984 |
-RRB- |
denotes |
) |
| T17961 |
35985-35988 |
VBD |
denotes |
was |
| T17952 |
35989-35994 |
VBN |
denotes |
added |
| T17962 |
35995-35998 |
CC |
denotes |
and |
| T17963 |
35999-36008 |
VBN |
denotes |
incubated |
| T17964 |
36009-36011 |
IN |
denotes |
at |
| T17965 |
36012-36014 |
CD |
denotes |
37 |
| T17966 |
36015-36017 |
NN |
denotes |
°C |
| T17967 |
36018-36021 |
IN |
denotes |
for |
| T17968 |
36022-36023 |
CD |
denotes |
2 |
| T17969 |
36024-36025 |
NN |
denotes |
h |
| T17970 |
36025-36026 |
. |
denotes |
. |
| T17971 |
36026-36093 |
sentence |
denotes |
The reaction was stopped by boiling the samples in Laemmli buffer. |
| T17972 |
36027-36030 |
DT |
denotes |
The |
| T17973 |
36031-36039 |
NN |
denotes |
reaction |
| T17975 |
36040-36043 |
VBD |
denotes |
was |
| T17974 |
36044-36051 |
VBN |
denotes |
stopped |
| T17976 |
36052-36054 |
IN |
denotes |
by |
| T17977 |
36055-36062 |
VBG |
denotes |
boiling |
| T17978 |
36063-36066 |
DT |
denotes |
the |
| T17979 |
36067-36074 |
NNS |
denotes |
samples |
| T17980 |
36075-36077 |
IN |
denotes |
in |
| T17981 |
36078-36085 |
NNP |
denotes |
Laemmli |
| T17982 |
36086-36092 |
NN |
denotes |
buffer |
| T17983 |
36092-36093 |
. |
denotes |
. |
| T17984 |
36093-36148 |
sentence |
denotes |
Total reactants were immunoblotted as described above. |
| T17985 |
36094-36099 |
JJ |
denotes |
Total |
| T17986 |
36100-36109 |
NNS |
denotes |
reactants |
| T17988 |
36110-36114 |
VBD |
denotes |
were |
| T17987 |
36115-36128 |
VBN |
denotes |
immunoblotted |
| T17989 |
36129-36131 |
IN |
denotes |
as |
| T17990 |
36132-36141 |
VBN |
denotes |
described |
| T17991 |
36142-36147 |
RB |
denotes |
above |
| T17992 |
36147-36148 |
. |
denotes |
. |
| T18783 |
36150-36171 |
NN |
denotes |
Coimmunoprecipitation |
| T18784 |
36172-36175 |
CC |
denotes |
and |
| T18785 |
36176-36189 |
NN |
denotes |
biotinylation |
| T18786 |
36190-36192 |
IN |
denotes |
in |
| T18787 |
36193-36197 |
NN |
denotes |
MDCK |
| T18788 |
36198-36203 |
NNS |
denotes |
cells |
| T18789 |
36203-36204 |
. |
denotes |
. |
| T18790 |
36204-36351 |
sentence |
denotes |
MDCK cells stably expressing wild-type AQP2 (grown on 10-cm plates) were transfected with pEGFP-wild-type AQP2, pEGFP-AQP2-F204V, or vector alone. |
| T18791 |
36205-36209 |
NN |
denotes |
MDCK |
| T18792 |
36210-36215 |
NNS |
denotes |
cells |
| T18794 |
36216-36222 |
RB |
denotes |
stably |
| T18795 |
36223-36233 |
VBG |
denotes |
expressing |
| T18796 |
36234-36238 |
JJ |
denotes |
wild |
| T18798 |
36238-36239 |
HYPH |
denotes |
- |
| T18797 |
36239-36243 |
NN |
denotes |
type |
| T18799 |
36244-36248 |
NN |
denotes |
AQP2 |
| T18800 |
36249-36250 |
-LRB- |
denotes |
( |
| T18801 |
36250-36255 |
VBN |
denotes |
grown |
| T18802 |
36256-36258 |
IN |
denotes |
on |
| T18803 |
36259-36261 |
CD |
denotes |
10 |
| T18805 |
36261-36262 |
HYPH |
denotes |
- |
| T18804 |
36262-36264 |
NN |
denotes |
cm |
| T18806 |
36265-36271 |
NNS |
denotes |
plates |
| T18807 |
36271-36272 |
-RRB- |
denotes |
) |
| T18808 |
36273-36277 |
VBD |
denotes |
were |
| T18793 |
36278-36289 |
VBN |
denotes |
transfected |
| T18809 |
36290-36294 |
IN |
denotes |
with |
| T18810 |
36295-36300 |
NN |
denotes |
pEGFP |
| T18812 |
36300-36301 |
HYPH |
denotes |
- |
| T18813 |
36301-36305 |
JJ |
denotes |
wild |
| T18814 |
36305-36306 |
HYPH |
denotes |
- |
| T18811 |
36306-36310 |
NN |
denotes |
type |
| T18815 |
36311-36315 |
NN |
denotes |
AQP2 |
| T18816 |
36315-36317 |
, |
denotes |
, |
| T18817 |
36317-36322 |
NN |
denotes |
pEGFP |
| T18819 |
36322-36323 |
HYPH |
denotes |
- |
| T18820 |
36323-36327 |
NN |
denotes |
AQP2 |
| T18821 |
36327-36328 |
HYPH |
denotes |
- |
| T18818 |
36328-36333 |
NN |
denotes |
F204V |
| T18822 |
36333-36335 |
, |
denotes |
, |
| T18823 |
36335-36337 |
CC |
denotes |
or |
| T18824 |
36338-36344 |
NN |
denotes |
vector |
| T18825 |
36345-36350 |
RB |
denotes |
alone |
| T18826 |
36350-36351 |
. |
denotes |
. |
| T18827 |
36351-36444 |
sentence |
denotes |
The cells were homogenized in 10 mM Tris (pH 7.4), 1 mM EDTA, and 250 mM sucrose 40 h later. |
| T18828 |
36352-36355 |
DT |
denotes |
The |
| T18829 |
36356-36361 |
NNS |
denotes |
cells |
| T18831 |
36362-36366 |
VBD |
denotes |
were |
| T18830 |
36367-36378 |
VBN |
denotes |
homogenized |
| T18832 |
36379-36381 |
IN |
denotes |
in |
| T18833 |
36382-36384 |
CD |
denotes |
10 |
| T18834 |
36385-36387 |
NN |
denotes |
mM |
| T18835 |
36388-36392 |
NN |
denotes |
Tris |
| T18836 |
36393-36394 |
-LRB- |
denotes |
( |
| T18837 |
36394-36396 |
NN |
denotes |
pH |
| T18838 |
36397-36400 |
CD |
denotes |
7.4 |
| T18839 |
36400-36401 |
-RRB- |
denotes |
) |
| T18840 |
36401-36403 |
, |
denotes |
, |
| T18841 |
36403-36404 |
CD |
denotes |
1 |
| T18842 |
36405-36407 |
NN |
denotes |
mM |
| T18843 |
36408-36412 |
NN |
denotes |
EDTA |
| T18844 |
36412-36414 |
, |
denotes |
, |
| T18845 |
36414-36417 |
CC |
denotes |
and |
| T18846 |
36418-36421 |
CD |
denotes |
250 |
| T18847 |
36422-36424 |
NN |
denotes |
mM |
| T18848 |
36425-36432 |
NN |
denotes |
sucrose |
| T18849 |
36433-36435 |
CD |
denotes |
40 |
| T18850 |
36436-36437 |
NN |
denotes |
h |
| T18851 |
36438-36443 |
RB |
denotes |
later |
| T18852 |
36443-36444 |
. |
denotes |
. |
| T18853 |
36444-36511 |
sentence |
denotes |
The clarified supernatant was centrifuged at 200,000 g for 30 min. |
| T18854 |
36445-36448 |
DT |
denotes |
The |
| T18856 |
36449-36458 |
VBN |
denotes |
clarified |
| T18855 |
36459-36470 |
NN |
denotes |
supernatant |
| T18858 |
36471-36474 |
VBD |
denotes |
was |
| T18857 |
36475-36486 |
VBN |
denotes |
centrifuged |
| T18859 |
36487-36489 |
IN |
denotes |
at |
| T18860 |
36490-36497 |
CD |
denotes |
200,000 |
| T18861 |
36498-36499 |
NN |
denotes |
g |
| T18862 |
36500-36503 |
IN |
denotes |
for |
| T18863 |
36504-36506 |
CD |
denotes |
30 |
| T18864 |
36507-36510 |
NN |
denotes |
min |
| T18865 |
36510-36511 |
. |
denotes |
. |
| T18866 |
36511-36636 |
sentence |
denotes |
Pelleted membranes were resuspended in the same buffer but containing 4% sodium deoxycholate and incubated at 37 °C for 1 h. |
| T18867 |
36512-36520 |
VBN |
denotes |
Pelleted |
| T18868 |
36521-36530 |
NNS |
denotes |
membranes |
| T18870 |
36531-36535 |
VBD |
denotes |
were |
| T18871 |
36536-36547 |
VBN |
denotes |
resuspended |
| T18872 |
36548-36550 |
IN |
denotes |
in |
| T18873 |
36551-36554 |
DT |
denotes |
the |
| T18875 |
36555-36559 |
JJ |
denotes |
same |
| T18874 |
36560-36566 |
NN |
denotes |
buffer |
| T18876 |
36567-36570 |
IN |
denotes |
but |
| T18877 |
36571-36581 |
VBG |
denotes |
containing |
| T18878 |
36582-36583 |
CD |
denotes |
4 |
| T18879 |
36583-36584 |
NN |
denotes |
% |
| T18881 |
36585-36591 |
NN |
denotes |
sodium |
| T18880 |
36592-36604 |
NN |
denotes |
deoxycholate |
| T18882 |
36605-36608 |
CC |
denotes |
and |
| T18869 |
36609-36618 |
VBN |
denotes |
incubated |
| T18883 |
36619-36621 |
IN |
denotes |
at |
| T18884 |
36622-36624 |
CD |
denotes |
37 |
| T18885 |
36625-36627 |
NN |
denotes |
°C |
| T18886 |
36628-36631 |
IN |
denotes |
for |
| T18887 |
36632-36633 |
CD |
denotes |
1 |
| T18888 |
36634-36635 |
NN |
denotes |
h |
| T18889 |
36635-36636 |
. |
denotes |
. |
| T18890 |
36636-36734 |
sentence |
denotes |
From the dissolved membranes, a 30 μl sample was removed and used as the total membrane fraction. |
| T18891 |
36637-36641 |
IN |
denotes |
From |
| T18893 |
36642-36645 |
DT |
denotes |
the |
| T18895 |
36646-36655 |
VBN |
denotes |
dissolved |
| T18894 |
36656-36665 |
NNS |
denotes |
membranes |
| T18896 |
36665-36667 |
, |
denotes |
, |
| T18897 |
36667-36668 |
DT |
denotes |
a |
| T18899 |
36669-36671 |
CD |
denotes |
30 |
| T18900 |
36672-36674 |
NN |
denotes |
μl |
| T18898 |
36675-36681 |
NN |
denotes |
sample |
| T18901 |
36682-36685 |
VBD |
denotes |
was |
| T18892 |
36686-36693 |
VBN |
denotes |
removed |
| T18902 |
36694-36697 |
CC |
denotes |
and |
| T18903 |
36698-36702 |
VBN |
denotes |
used |
| T18904 |
36703-36705 |
IN |
denotes |
as |
| T18905 |
36706-36709 |
DT |
denotes |
the |
| T18907 |
36710-36715 |
JJ |
denotes |
total |
| T18908 |
36716-36724 |
NN |
denotes |
membrane |
| T18906 |
36725-36733 |
NN |
denotes |
fraction |
| T18909 |
36733-36734 |
. |
denotes |
. |
| T18910 |
36734-36903 |
sentence |
denotes |
The remaining membranes were diluted with 600 μl of the homogenization buffer, and incubated with 1 μl of GFP antisera (Invitrogen, #46–0092) and protein A/G sepharose. |
| T18911 |
36735-36738 |
DT |
denotes |
The |
| T18913 |
36739-36748 |
VBG |
denotes |
remaining |
| T18912 |
36749-36758 |
NNS |
denotes |
membranes |
| T18915 |
36759-36763 |
VBD |
denotes |
were |
| T18914 |
36764-36771 |
VBN |
denotes |
diluted |
| T18916 |
36772-36776 |
IN |
denotes |
with |
| T18917 |
36777-36780 |
CD |
denotes |
600 |
| T18918 |
36781-36783 |
NN |
denotes |
μl |
| T18919 |
36784-36786 |
IN |
denotes |
of |
| T18920 |
36787-36790 |
DT |
denotes |
the |
| T18922 |
36791-36805 |
NN |
denotes |
homogenization |
| T18921 |
36806-36812 |
NN |
denotes |
buffer |
| T18923 |
36812-36814 |
, |
denotes |
, |
| T18924 |
36814-36817 |
CC |
denotes |
and |
| T18925 |
36818-36827 |
VBN |
denotes |
incubated |
| T18926 |
36828-36832 |
IN |
denotes |
with |
| T18927 |
36833-36834 |
CD |
denotes |
1 |
| T18928 |
36835-36837 |
NN |
denotes |
μl |
| T18929 |
36838-36840 |
IN |
denotes |
of |
| T18930 |
36841-36844 |
NN |
denotes |
GFP |
| T18931 |
36845-36853 |
NNS |
denotes |
antisera |
| T18932 |
36854-36855 |
-LRB- |
denotes |
( |
| T18934 |
36855-36865 |
NNP |
denotes |
Invitrogen |
| T18935 |
36865-36867 |
, |
denotes |
, |
| T18936 |
36867-36868 |
SYM |
denotes |
# |
| T18937 |
36868-36870 |
CD |
denotes |
46 |
| T18938 |
36870-36871 |
HYPH |
denotes |
– |
| T18933 |
36871-36875 |
CD |
denotes |
0092 |
| T18939 |
36875-36876 |
-RRB- |
denotes |
) |
| T18940 |
36877-36880 |
CC |
denotes |
and |
| T18941 |
36881-36888 |
NN |
denotes |
protein |
| T18943 |
36889-36890 |
NN |
denotes |
A |
| T18945 |
36890-36891 |
HYPH |
denotes |
/ |
| T18944 |
36891-36892 |
NN |
denotes |
G |
| T18942 |
36893-36902 |
NN |
denotes |
sepharose |
| T18946 |
36902-36903 |
. |
denotes |
. |
| T18947 |
36903-37035 |
sentence |
denotes |
Following overnight incubation, the precipitated proteins were washed in RIPA buffer and finally boiled in 50 μl of Laemmli buffer. |
| T18948 |
36904-36913 |
VBG |
denotes |
Following |
| T18950 |
36914-36923 |
JJ |
denotes |
overnight |
| T18951 |
36924-36934 |
NN |
denotes |
incubation |
| T18952 |
36934-36936 |
, |
denotes |
, |
| T18953 |
36936-36939 |
DT |
denotes |
the |
| T18955 |
36940-36952 |
VBN |
denotes |
precipitated |
| T18954 |
36953-36961 |
NN |
denotes |
proteins |
| T18956 |
36962-36966 |
VBD |
denotes |
were |
| T18949 |
36967-36973 |
VBN |
denotes |
washed |
| T18957 |
36974-36976 |
IN |
denotes |
in |
| T18958 |
36977-36981 |
NN |
denotes |
RIPA |
| T18959 |
36982-36988 |
NN |
denotes |
buffer |
| T18960 |
36989-36992 |
CC |
denotes |
and |
| T18961 |
36993-37000 |
RB |
denotes |
finally |
| T18962 |
37001-37007 |
VBN |
denotes |
boiled |
| T18963 |
37008-37010 |
IN |
denotes |
in |
| T18964 |
37011-37013 |
CD |
denotes |
50 |
| T18965 |
37014-37016 |
NN |
denotes |
μl |
| T18966 |
37017-37019 |
IN |
denotes |
of |
| T18967 |
37020-37027 |
NNP |
denotes |
Laemmli |
| T18968 |
37028-37034 |
NN |
denotes |
buffer |
| T18969 |
37034-37035 |
. |
denotes |
. |
| T18970 |
37035-37118 |
sentence |
denotes |
Half of the total membrane and the IP fractions were processed for immunoblotting. |
| T18971 |
37036-37040 |
NN |
denotes |
Half |
| T18973 |
37041-37043 |
IN |
denotes |
of |
| T18974 |
37044-37047 |
DT |
denotes |
the |
| T18976 |
37048-37053 |
JJ |
denotes |
total |
| T18975 |
37054-37062 |
NN |
denotes |
membrane |
| T18977 |
37063-37066 |
CC |
denotes |
and |
| T18978 |
37067-37070 |
DT |
denotes |
the |
| T18980 |
37071-37073 |
NN |
denotes |
IP |
| T18979 |
37074-37083 |
NNS |
denotes |
fractions |
| T18981 |
37084-37088 |
VBD |
denotes |
were |
| T18972 |
37089-37098 |
VBN |
denotes |
processed |
| T18982 |
37099-37102 |
IN |
denotes |
for |
| T18983 |
37103-37117 |
NN |
denotes |
immunoblotting |
| T18984 |
37117-37118 |
. |
denotes |
. |
| T18985 |
37118-37180 |
sentence |
denotes |
Cell surface biotinylation was performed in a similar manner. |
| T18986 |
37119-37123 |
NN |
denotes |
Cell |
| T18988 |
37124-37131 |
NN |
denotes |
surface |
| T18987 |
37132-37145 |
NN |
denotes |
biotinylation |
| T18990 |
37146-37149 |
VBD |
denotes |
was |
| T18989 |
37150-37159 |
VBN |
denotes |
performed |
| T18991 |
37160-37162 |
IN |
denotes |
in |
| T18992 |
37163-37164 |
DT |
denotes |
a |
| T18994 |
37165-37172 |
JJ |
denotes |
similar |
| T18993 |
37173-37179 |
NN |
denotes |
manner |
| T18995 |
37179-37180 |
. |
denotes |
. |
| T18996 |
37180-37313 |
sentence |
denotes |
However, pEGFP-AQP2-F204V, was transfected into MDCK cells stably expressing wild-type AQP2 and cells made stable with vector alone. |
| T18997 |
37181-37188 |
RB |
denotes |
However |
| T18999 |
37188-37190 |
, |
denotes |
, |
| T19000 |
37190-37195 |
NN |
denotes |
pEGFP |
| T19002 |
37195-37196 |
HYPH |
denotes |
- |
| T19003 |
37196-37200 |
NN |
denotes |
AQP2 |
| T19004 |
37200-37201 |
HYPH |
denotes |
- |
| T19001 |
37201-37206 |
NN |
denotes |
F204V |
| T19005 |
37206-37208 |
, |
denotes |
, |
| T19006 |
37208-37211 |
VBD |
denotes |
was |
| T18998 |
37212-37223 |
VBN |
denotes |
transfected |
| T19007 |
37224-37228 |
IN |
denotes |
into |
| T19008 |
37229-37233 |
NN |
denotes |
MDCK |
| T19009 |
37234-37239 |
NNS |
denotes |
cells |
| T19010 |
37240-37246 |
RB |
denotes |
stably |
| T19011 |
37247-37257 |
VBG |
denotes |
expressing |
| T19012 |
37258-37262 |
JJ |
denotes |
wild |
| T19014 |
37262-37263 |
HYPH |
denotes |
- |
| T19013 |
37263-37267 |
NN |
denotes |
type |
| T19015 |
37268-37272 |
NN |
denotes |
AQP2 |
| T19016 |
37273-37276 |
CC |
denotes |
and |
| T19017 |
37277-37282 |
NNS |
denotes |
cells |
| T19018 |
37283-37287 |
VBN |
denotes |
made |
| T19019 |
37288-37294 |
JJ |
denotes |
stable |
| T19020 |
37295-37299 |
IN |
denotes |
with |
| T19021 |
37300-37306 |
NN |
denotes |
vector |
| T19022 |
37307-37312 |
RB |
denotes |
alone |
| T19023 |
37312-37313 |
. |
denotes |
. |
| T19024 |
37313-37550 |
sentence |
denotes |
Twenty-four hours post-transfection, cells were stimulated with forskolin, trypsinized, resuspended in 1 ml of PBS (2.5 × 106 cells/ml), and incubated with 0.5 mg of NHS-PEO4-biotin (Pierce Biotechnology) for 30 min at room temperature. |
| T19025 |
37314-37320 |
CD |
denotes |
Twenty |
| T19027 |
37320-37321 |
HYPH |
denotes |
- |
| T19026 |
37321-37325 |
CD |
denotes |
four |
| T19028 |
37326-37331 |
NNS |
denotes |
hours |
| T19029 |
37332-37349 |
RB |
denotes |
post-transfection |
| T19031 |
37349-37351 |
, |
denotes |
, |
| T19032 |
37351-37356 |
NNS |
denotes |
cells |
| T19033 |
37357-37361 |
VBD |
denotes |
were |
| T19030 |
37362-37372 |
VBN |
denotes |
stimulated |
| T19034 |
37373-37377 |
IN |
denotes |
with |
| T19035 |
37378-37387 |
NN |
denotes |
forskolin |
| T19036 |
37387-37389 |
, |
denotes |
, |
| T19037 |
37389-37400 |
VBN |
denotes |
trypsinized |
| T19038 |
37400-37402 |
, |
denotes |
, |
| T19039 |
37402-37413 |
VBN |
denotes |
resuspended |
| T19040 |
37414-37416 |
IN |
denotes |
in |
| T19041 |
37417-37418 |
CD |
denotes |
1 |
| T19042 |
37419-37421 |
NN |
denotes |
ml |
| T19043 |
37422-37424 |
IN |
denotes |
of |
| T19044 |
37425-37428 |
NN |
denotes |
PBS |
| T19045 |
37429-37430 |
-LRB- |
denotes |
( |
| T19047 |
37430-37433 |
CD |
denotes |
2.5 |
| T19049 |
37434-37435 |
SYM |
denotes |
× |
| T19048 |
37436-37439 |
CD |
denotes |
106 |
| T19046 |
37440-37445 |
NNS |
denotes |
cells |
| T19050 |
37445-37446 |
SYM |
denotes |
/ |
| T19051 |
37446-37448 |
NNS |
denotes |
ml |
| T19052 |
37448-37449 |
-RRB- |
denotes |
) |
| T19053 |
37449-37451 |
, |
denotes |
, |
| T19054 |
37451-37454 |
CC |
denotes |
and |
| T19055 |
37455-37464 |
VBN |
denotes |
incubated |
| T19056 |
37465-37469 |
IN |
denotes |
with |
| T19057 |
37470-37473 |
CD |
denotes |
0.5 |
| T19058 |
37474-37476 |
NN |
denotes |
mg |
| T19059 |
37477-37479 |
IN |
denotes |
of |
| T19060 |
37480-37483 |
NN |
denotes |
NHS |
| T19062 |
37483-37484 |
HYPH |
denotes |
- |
| T19063 |
37484-37488 |
NN |
denotes |
PEO4 |
| T19064 |
37488-37489 |
HYPH |
denotes |
- |
| T19061 |
37489-37495 |
NN |
denotes |
biotin |
| T19065 |
37496-37497 |
-LRB- |
denotes |
( |
| T19067 |
37497-37503 |
NNP |
denotes |
Pierce |
| T19066 |
37504-37517 |
NNP |
denotes |
Biotechnology |
| T19068 |
37517-37518 |
-RRB- |
denotes |
) |
| T19069 |
37519-37522 |
IN |
denotes |
for |
| T19070 |
37523-37525 |
CD |
denotes |
30 |
| T19071 |
37526-37529 |
NN |
denotes |
min |
| T19072 |
37530-37532 |
IN |
denotes |
at |
| T19073 |
37533-37537 |
NN |
denotes |
room |
| T19074 |
37538-37549 |
NN |
denotes |
temperature |
| T19075 |
37549-37550 |
. |
denotes |
. |
| T19076 |
37550-37690 |
sentence |
denotes |
Cells were washed once in 10 mM Tris (pH 8) and three times in PBS, after which membranes were purified and solubilized as described above. |
| T19077 |
37551-37556 |
NNS |
denotes |
Cells |
| T19079 |
37557-37561 |
VBD |
denotes |
were |
| T19078 |
37562-37568 |
VBN |
denotes |
washed |
| T19080 |
37569-37573 |
RB |
denotes |
once |
| T19081 |
37574-37576 |
IN |
denotes |
in |
| T19082 |
37577-37579 |
CD |
denotes |
10 |
| T19083 |
37580-37582 |
NN |
denotes |
mM |
| T19084 |
37583-37587 |
NN |
denotes |
Tris |
| T19085 |
37588-37589 |
-LRB- |
denotes |
( |
| T19086 |
37589-37591 |
NN |
denotes |
pH |
| T19087 |
37592-37593 |
CD |
denotes |
8 |
| T19088 |
37593-37594 |
-RRB- |
denotes |
) |
| T19089 |
37595-37598 |
CC |
denotes |
and |
| T19090 |
37599-37604 |
CD |
denotes |
three |
| T19091 |
37605-37610 |
NNS |
denotes |
times |
| T19092 |
37611-37613 |
IN |
denotes |
in |
| T19093 |
37614-37617 |
NN |
denotes |
PBS |
| T19094 |
37617-37619 |
, |
denotes |
, |
| T19095 |
37619-37624 |
IN |
denotes |
after |
| T19097 |
37625-37630 |
WDT |
denotes |
which |
| T19098 |
37631-37640 |
NNS |
denotes |
membranes |
| T19099 |
37641-37645 |
VBD |
denotes |
were |
| T19096 |
37646-37654 |
VBN |
denotes |
purified |
| T19100 |
37655-37658 |
CC |
denotes |
and |
| T19101 |
37659-37670 |
VBN |
denotes |
solubilized |
| T19102 |
37671-37673 |
IN |
denotes |
as |
| T19103 |
37674-37683 |
VBN |
denotes |
described |
| T19104 |
37684-37689 |
RB |
denotes |
above |
| T19105 |
37689-37690 |
. |
denotes |
. |
| T19106 |
37690-37806 |
sentence |
denotes |
Solubilized membranes were incubated with 20 μl of immobilized streptavidin (Pierce Biotechnology) for 2 h at 4 °C. |
| T19107 |
37691-37702 |
VBN |
denotes |
Solubilized |
| T19108 |
37703-37712 |
NNS |
denotes |
membranes |
| T19110 |
37713-37717 |
VBD |
denotes |
were |
| T19109 |
37718-37727 |
VBN |
denotes |
incubated |
| T19111 |
37728-37732 |
IN |
denotes |
with |
| T19112 |
37733-37735 |
CD |
denotes |
20 |
| T19113 |
37736-37738 |
NN |
denotes |
μl |
| T19114 |
37739-37741 |
IN |
denotes |
of |
| T19115 |
37742-37753 |
VBN |
denotes |
immobilized |
| T19116 |
37754-37766 |
NN |
denotes |
streptavidin |
| T19117 |
37767-37768 |
-LRB- |
denotes |
( |
| T19119 |
37768-37774 |
NNP |
denotes |
Pierce |
| T19118 |
37775-37788 |
NNP |
denotes |
Biotechnology |
| T19120 |
37788-37789 |
-RRB- |
denotes |
) |
| T19121 |
37790-37793 |
IN |
denotes |
for |
| T19122 |
37794-37795 |
CD |
denotes |
2 |
| T19123 |
37796-37797 |
NN |
denotes |
h |
| T19124 |
37798-37800 |
IN |
denotes |
at |
| T19125 |
37801-37802 |
CD |
denotes |
4 |
| T19126 |
37803-37805 |
NN |
denotes |
°C |
| T19127 |
37805-37806 |
. |
denotes |
. |
| T19128 |
37806-37906 |
sentence |
denotes |
Finally the precipitated proteins were washed in RIPA buffer and boiled in 50 μl of Laemmli buffer. |
| T19129 |
37807-37814 |
RB |
denotes |
Finally |
| T19131 |
37815-37818 |
DT |
denotes |
the |
| T19133 |
37819-37831 |
VBN |
denotes |
precipitated |
| T19132 |
37832-37840 |
NN |
denotes |
proteins |
| T19134 |
37841-37845 |
VBD |
denotes |
were |
| T19130 |
37846-37852 |
VBN |
denotes |
washed |
| T19135 |
37853-37855 |
IN |
denotes |
in |
| T19136 |
37856-37860 |
NN |
denotes |
RIPA |
| T19137 |
37861-37867 |
NN |
denotes |
buffer |
| T19138 |
37868-37871 |
CC |
denotes |
and |
| T19139 |
37872-37878 |
VBN |
denotes |
boiled |
| T19140 |
37879-37881 |
IN |
denotes |
in |
| T19141 |
37882-37884 |
CD |
denotes |
50 |
| T19142 |
37885-37887 |
NN |
denotes |
μl |
| T19143 |
37888-37890 |
IN |
denotes |
of |
| T19144 |
37891-37898 |
NNP |
denotes |
Laemmli |
| T19145 |
37899-37905 |
NN |
denotes |
buffer |
| T19146 |
37905-37906 |
. |
denotes |
. |
| T19147 |
37906-37999 |
sentence |
denotes |
Total cells and the biotinylated precipitates were immunoblotting using an antibody to AQP2. |
| T19148 |
37907-37912 |
JJ |
denotes |
Total |
| T19149 |
37913-37918 |
NNS |
denotes |
cells |
| T19151 |
37919-37922 |
CC |
denotes |
and |
| T19152 |
37923-37926 |
DT |
denotes |
the |
| T19154 |
37927-37939 |
VBN |
denotes |
biotinylated |
| T19153 |
37940-37952 |
NNS |
denotes |
precipitates |
| T19155 |
37953-37957 |
VBD |
denotes |
were |
| T19150 |
37958-37972 |
VBG |
denotes |
immunoblotting |
| T19156 |
37973-37978 |
VBG |
denotes |
using |
| T19157 |
37979-37981 |
DT |
denotes |
an |
| T19158 |
37982-37990 |
NN |
denotes |
antibody |
| T19159 |
37991-37993 |
IN |
denotes |
to |
| T19160 |
37994-37998 |
NN |
denotes |
AQP2 |
| T19161 |
37998-37999 |
. |
denotes |
. |
| T19603 |
38001-38007 |
NN |
denotes |
Kidney |
| T19604 |
38008-38028 |
NN |
denotes |
immunohistochemistry |
| T19605 |
38028-38029 |
. |
denotes |
. |
| T19606 |
38029-38105 |
sentence |
denotes |
Whole mouse kidneys were fixed in 10% phosphate-buffered formalin for 24 h. |
| T19607 |
38030-38035 |
JJ |
denotes |
Whole |
| T19609 |
38036-38041 |
NN |
denotes |
mouse |
| T19608 |
38042-38049 |
NNS |
denotes |
kidneys |
| T19611 |
38050-38054 |
VBD |
denotes |
were |
| T19610 |
38055-38060 |
VBN |
denotes |
fixed |
| T19612 |
38061-38063 |
IN |
denotes |
in |
| T19613 |
38064-38066 |
CD |
denotes |
10 |
| T19614 |
38066-38067 |
NN |
denotes |
% |
| T19616 |
38068-38077 |
NN |
denotes |
phosphate |
| T19618 |
38077-38078 |
HYPH |
denotes |
- |
| T19617 |
38078-38086 |
VBN |
denotes |
buffered |
| T19615 |
38087-38095 |
NN |
denotes |
formalin |
| T19619 |
38096-38099 |
IN |
denotes |
for |
| T19620 |
38100-38102 |
CD |
denotes |
24 |
| T19621 |
38103-38104 |
NN |
denotes |
h |
| T19622 |
38104-38105 |
. |
denotes |
. |
| T19623 |
38105-38173 |
sentence |
denotes |
Kidneys were embedded in paraffin, and 5-μm sections were prepared. |
| T19624 |
38106-38113 |
NNS |
denotes |
Kidneys |
| T19626 |
38114-38118 |
VBD |
denotes |
were |
| T19625 |
38119-38127 |
VBN |
denotes |
embedded |
| T19627 |
38128-38130 |
IN |
denotes |
in |
| T19628 |
38131-38139 |
NN |
denotes |
paraffin |
| T19629 |
38139-38141 |
, |
denotes |
, |
| T19630 |
38141-38144 |
CC |
denotes |
and |
| T19631 |
38145-38146 |
CD |
denotes |
5 |
| T19633 |
38146-38147 |
HYPH |
denotes |
- |
| T19632 |
38147-38149 |
NN |
denotes |
μm |
| T19634 |
38150-38158 |
NNS |
denotes |
sections |
| T19636 |
38159-38163 |
VBD |
denotes |
were |
| T19635 |
38164-38172 |
VBN |
denotes |
prepared |
| T19637 |
38172-38173 |
. |
denotes |
. |
| T19638 |
38173-38325 |
sentence |
denotes |
Following antigen retrieval using 10 mM sodium citrate (pH 8) for 10 min at 98 °C, sections were sequentially probed, first for AQP3 and then for AQP2. |
| T19639 |
38174-38183 |
VBG |
denotes |
Following |
| T19641 |
38184-38191 |
NN |
denotes |
antigen |
| T19642 |
38192-38201 |
NN |
denotes |
retrieval |
| T19643 |
38202-38207 |
VBG |
denotes |
using |
| T19644 |
38208-38210 |
CD |
denotes |
10 |
| T19645 |
38211-38213 |
NN |
denotes |
mM |
| T19647 |
38214-38220 |
NN |
denotes |
sodium |
| T19646 |
38221-38228 |
NN |
denotes |
citrate |
| T19648 |
38229-38230 |
-LRB- |
denotes |
( |
| T19649 |
38230-38232 |
NN |
denotes |
pH |
| T19650 |
38233-38234 |
CD |
denotes |
8 |
| T19651 |
38234-38235 |
-RRB- |
denotes |
) |
| T19652 |
38236-38239 |
IN |
denotes |
for |
| T19653 |
38240-38242 |
CD |
denotes |
10 |
| T19654 |
38243-38246 |
NN |
denotes |
min |
| T19655 |
38247-38249 |
IN |
denotes |
at |
| T19656 |
38250-38252 |
CD |
denotes |
98 |
| T19657 |
38253-38255 |
NN |
denotes |
°C |
| T19658 |
38255-38257 |
, |
denotes |
, |
| T19659 |
38257-38265 |
NNS |
denotes |
sections |
| T19660 |
38266-38270 |
VBD |
denotes |
were |
| T19661 |
38271-38283 |
RB |
denotes |
sequentially |
| T19640 |
38284-38290 |
VBN |
denotes |
probed |
| T19662 |
38290-38292 |
, |
denotes |
, |
| T19663 |
38292-38297 |
RB |
denotes |
first |
| T19664 |
38298-38301 |
IN |
denotes |
for |
| T19665 |
38302-38306 |
NN |
denotes |
AQP3 |
| T19666 |
38307-38310 |
CC |
denotes |
and |
| T19667 |
38311-38315 |
RB |
denotes |
then |
| T19668 |
38316-38319 |
IN |
denotes |
for |
| T19669 |
38320-38324 |
NN |
denotes |
AQP2 |
| T19670 |
38324-38325 |
. |
denotes |
. |
| T19671 |
38325-38449 |
sentence |
denotes |
Sections were incubated in 5% donkey serum and then in goat anti-AQP3 antibody (1:100; Santa Cruz Biotechnology; #sc-9885). |
| T19672 |
38326-38334 |
NNS |
denotes |
Sections |
| T19674 |
38335-38339 |
VBD |
denotes |
were |
| T19673 |
38340-38349 |
VBN |
denotes |
incubated |
| T19675 |
38350-38352 |
IN |
denotes |
in |
| T19676 |
38353-38354 |
CD |
denotes |
5 |
| T19677 |
38354-38355 |
NN |
denotes |
% |
| T19679 |
38356-38362 |
NN |
denotes |
donkey |
| T19678 |
38363-38368 |
NN |
denotes |
serum |
| T19680 |
38369-38372 |
CC |
denotes |
and |
| T19681 |
38373-38377 |
RB |
denotes |
then |
| T19682 |
38378-38380 |
IN |
denotes |
in |
| T19683 |
38381-38385 |
NN |
denotes |
goat |
| T19685 |
38386-38395 |
JJ |
denotes |
anti-AQP3 |
| T19684 |
38396-38404 |
NN |
denotes |
antibody |
| T19686 |
38405-38406 |
-LRB- |
denotes |
( |
| T19688 |
38406-38407 |
CD |
denotes |
1 |
| T19689 |
38407-38408 |
SYM |
denotes |
: |
| T19690 |
38408-38411 |
CD |
denotes |
100 |
| T19691 |
38411-38412 |
: |
denotes |
; |
| T19692 |
38413-38418 |
NNP |
denotes |
Santa |
| T19693 |
38419-38423 |
NNP |
denotes |
Cruz |
| T19694 |
38424-38437 |
NNP |
denotes |
Biotechnology |
| T19695 |
38437-38438 |
: |
denotes |
; |
| T19696 |
38439-38440 |
SYM |
denotes |
# |
| T19687 |
38440-38442 |
NN |
denotes |
sc |
| T19697 |
38442-38443 |
HYPH |
denotes |
- |
| T19698 |
38443-38447 |
CD |
denotes |
9885 |
| T19699 |
38447-38448 |
-RRB- |
denotes |
) |
| T19700 |
38448-38449 |
. |
denotes |
. |
| T19701 |
38449-38599 |
sentence |
denotes |
Slides were washed with PBS and incubated with AlexaFluor 488-conjugated donkey anti-goat antibody (Molecular Probes, Eugene, Oregon, United States). |
| T19702 |
38450-38456 |
NNS |
denotes |
Slides |
| T19704 |
38457-38461 |
VBD |
denotes |
were |
| T19703 |
38462-38468 |
VBN |
denotes |
washed |
| T19705 |
38469-38473 |
IN |
denotes |
with |
| T19706 |
38474-38477 |
NN |
denotes |
PBS |
| T19707 |
38478-38481 |
CC |
denotes |
and |
| T19708 |
38482-38491 |
VBN |
denotes |
incubated |
| T19709 |
38492-38496 |
IN |
denotes |
with |
| T19710 |
38497-38507 |
NNP |
denotes |
AlexaFluor |
| T19712 |
38508-38511 |
CD |
denotes |
488 |
| T19713 |
38511-38512 |
HYPH |
denotes |
- |
| T19711 |
38512-38522 |
VBN |
denotes |
conjugated |
| T19715 |
38523-38529 |
NN |
denotes |
donkey |
| T19716 |
38530-38539 |
JJ |
denotes |
anti-goat |
| T19714 |
38540-38548 |
NN |
denotes |
antibody |
| T19717 |
38549-38550 |
-LRB- |
denotes |
( |
| T19719 |
38550-38559 |
NNP |
denotes |
Molecular |
| T19718 |
38560-38566 |
NNP |
denotes |
Probes |
| T19720 |
38566-38568 |
, |
denotes |
, |
| T19721 |
38568-38574 |
NNP |
denotes |
Eugene |
| T19722 |
38574-38576 |
, |
denotes |
, |
| T19723 |
38576-38582 |
NNP |
denotes |
Oregon |
| T19724 |
38582-38584 |
, |
denotes |
, |
| T19725 |
38584-38590 |
NNP |
denotes |
United |
| T19726 |
38591-38597 |
NNP |
denotes |
States |
| T19727 |
38597-38598 |
-RRB- |
denotes |
) |
| T19728 |
38598-38599 |
. |
denotes |
. |
| T19729 |
38599-38865 |
sentence |
denotes |
The slides were subsequently blocked in 5% chicken serum, incubated with a rabbit anti-AQP2 antibody (1:250; USB, Cleveland, Ohio, United States; #A3000–06), which was detected with a AlexaFluor 594-conjugated chicken anti-rabbit antibody (1:500; Molecular Probes). |
| T19730 |
38600-38603 |
DT |
denotes |
The |
| T19731 |
38604-38610 |
NNS |
denotes |
slides |
| T19733 |
38611-38615 |
VBD |
denotes |
were |
| T19734 |
38616-38628 |
RB |
denotes |
subsequently |
| T19735 |
38629-38636 |
VBN |
denotes |
blocked |
| T19736 |
38637-38639 |
IN |
denotes |
in |
| T19737 |
38640-38641 |
CD |
denotes |
5 |
| T19738 |
38641-38642 |
NN |
denotes |
% |
| T19740 |
38643-38650 |
NN |
denotes |
chicken |
| T19739 |
38651-38656 |
NN |
denotes |
serum |
| T19741 |
38656-38658 |
, |
denotes |
, |
| T19732 |
38658-38667 |
VBN |
denotes |
incubated |
| T19742 |
38668-38672 |
IN |
denotes |
with |
| T19743 |
38673-38674 |
DT |
denotes |
a |
| T19745 |
38675-38681 |
NN |
denotes |
rabbit |
| T19746 |
38682-38691 |
JJ |
denotes |
anti-AQP2 |
| T19744 |
38692-38700 |
NN |
denotes |
antibody |
| T19747 |
38701-38702 |
-LRB- |
denotes |
( |
| T19749 |
38702-38703 |
CD |
denotes |
1 |
| T19750 |
38703-38704 |
SYM |
denotes |
: |
| T19751 |
38704-38707 |
CD |
denotes |
250 |
| T19752 |
38707-38708 |
: |
denotes |
; |
| T19753 |
38709-38712 |
NNP |
denotes |
USB |
| T19754 |
38712-38714 |
, |
denotes |
, |
| T19755 |
38714-38723 |
NNP |
denotes |
Cleveland |
| T19756 |
38723-38725 |
, |
denotes |
, |
| T19757 |
38725-38729 |
NNP |
denotes |
Ohio |
| T19758 |
38729-38731 |
, |
denotes |
, |
| T19759 |
38731-38737 |
NNP |
denotes |
United |
| T19760 |
38738-38744 |
NNP |
denotes |
States |
| T19761 |
38744-38745 |
: |
denotes |
; |
| T19762 |
38746-38747 |
SYM |
denotes |
# |
| T19748 |
38747-38752 |
NN |
denotes |
A3000 |
| T19763 |
38752-38753 |
HYPH |
denotes |
– |
| T19764 |
38753-38755 |
CD |
denotes |
06 |
| T19765 |
38755-38756 |
-RRB- |
denotes |
) |
| T19766 |
38756-38758 |
, |
denotes |
, |
| T19767 |
38758-38763 |
WDT |
denotes |
which |
| T19769 |
38764-38767 |
VBD |
denotes |
was |
| T19768 |
38768-38776 |
VBN |
denotes |
detected |
| T19770 |
38777-38781 |
IN |
denotes |
with |
| T19771 |
38782-38783 |
DT |
denotes |
a |
| T19773 |
38784-38794 |
NNP |
denotes |
AlexaFluor |
| T19775 |
38795-38798 |
CD |
denotes |
594 |
| T19776 |
38798-38799 |
HYPH |
denotes |
- |
| T19774 |
38799-38809 |
VBN |
denotes |
conjugated |
| T19777 |
38810-38817 |
NN |
denotes |
chicken |
| T19778 |
38818-38829 |
JJ |
denotes |
anti-rabbit |
| T19772 |
38830-38838 |
NN |
denotes |
antibody |
| T19779 |
38839-38840 |
-LRB- |
denotes |
( |
| T19781 |
38840-38841 |
CD |
denotes |
1 |
| T19782 |
38841-38842 |
SYM |
denotes |
: |
| T19783 |
38842-38845 |
CD |
denotes |
500 |
| T19784 |
38845-38846 |
: |
denotes |
; |
| T19785 |
38847-38856 |
NNP |
denotes |
Molecular |
| T19780 |
38857-38863 |
NNP |
denotes |
Probes |
| T19786 |
38863-38864 |
-RRB- |
denotes |
) |
| T19787 |
38864-38865 |
. |
denotes |
. |
| T19788 |
38865-38982 |
sentence |
denotes |
The sections were stained with DAPI and mounted in Vectashield (Vector Labs, Burlingame, California, United States). |
| T19789 |
38866-38869 |
DT |
denotes |
The |
| T19790 |
38870-38878 |
NNS |
denotes |
sections |
| T19792 |
38879-38883 |
VBD |
denotes |
were |
| T19791 |
38884-38891 |
VBN |
denotes |
stained |
| T19793 |
38892-38896 |
IN |
denotes |
with |
| T19794 |
38897-38901 |
NN |
denotes |
DAPI |
| T19795 |
38902-38905 |
CC |
denotes |
and |
| T19796 |
38906-38913 |
VBD |
denotes |
mounted |
| T19797 |
38914-38916 |
IN |
denotes |
in |
| T19798 |
38917-38928 |
NNP |
denotes |
Vectashield |
| T19799 |
38929-38930 |
-LRB- |
denotes |
( |
| T19801 |
38930-38936 |
NNP |
denotes |
Vector |
| T19800 |
38937-38941 |
NNP |
denotes |
Labs |
| T19802 |
38941-38943 |
, |
denotes |
, |
| T19803 |
38943-38953 |
NNP |
denotes |
Burlingame |
| T19804 |
38953-38955 |
, |
denotes |
, |
| T19805 |
38955-38965 |
NNP |
denotes |
California |
| T19806 |
38965-38967 |
, |
denotes |
, |
| T19807 |
38967-38973 |
NNP |
denotes |
United |
| T19808 |
38974-38980 |
NNP |
denotes |
States |
| T19809 |
38980-38981 |
-RRB- |
denotes |
) |
| T19810 |
38981-38982 |
. |
denotes |
. |
| T20424 |
38984-39003 |
NN |
denotes |
Immunocytochemistry |
| T20425 |
39004-39006 |
IN |
denotes |
on |
| T20426 |
39007-39011 |
NN |
denotes |
MDCK |
| T20427 |
39012-39017 |
NNS |
denotes |
cells |
| T20428 |
39017-39018 |
. |
denotes |
. |
| T20429 |
39018-39229 |
sentence |
denotes |
MDCK stable cell lines expressing vector alone, wild-type AQP2, or AQP2-F204V (and in some cases transiently expressing a GFP construct) were grown on fibronectin-coated coverslips until tight junctions formed. |
| T20430 |
39019-39023 |
NN |
denotes |
MDCK |
| T20432 |
39024-39030 |
JJ |
denotes |
stable |
| T20433 |
39031-39035 |
NN |
denotes |
cell |
| T20431 |
39036-39041 |
NNS |
denotes |
lines |
| T20435 |
39042-39052 |
VBG |
denotes |
expressing |
| T20436 |
39053-39059 |
NN |
denotes |
vector |
| T20437 |
39060-39065 |
JJ |
denotes |
alone |
| T20438 |
39065-39067 |
, |
denotes |
, |
| T20439 |
39067-39071 |
JJ |
denotes |
wild |
| T20441 |
39071-39072 |
HYPH |
denotes |
- |
| T20440 |
39072-39076 |
NN |
denotes |
type |
| T20442 |
39077-39081 |
NN |
denotes |
AQP2 |
| T20443 |
39081-39083 |
, |
denotes |
, |
| T20444 |
39083-39085 |
CC |
denotes |
or |
| T20445 |
39086-39090 |
NN |
denotes |
AQP2 |
| T20447 |
39090-39091 |
HYPH |
denotes |
- |
| T20446 |
39091-39096 |
NN |
denotes |
F204V |
| T20448 |
39097-39098 |
-LRB- |
denotes |
( |
| T20449 |
39098-39101 |
CC |
denotes |
and |
| T20450 |
39102-39104 |
IN |
denotes |
in |
| T20452 |
39105-39109 |
DT |
denotes |
some |
| T20453 |
39110-39115 |
NNS |
denotes |
cases |
| T20454 |
39116-39127 |
RB |
denotes |
transiently |
| T20451 |
39128-39138 |
VBG |
denotes |
expressing |
| T20455 |
39139-39140 |
DT |
denotes |
a |
| T20457 |
39141-39144 |
NN |
denotes |
GFP |
| T20456 |
39145-39154 |
NN |
denotes |
construct |
| T20458 |
39154-39155 |
-RRB- |
denotes |
) |
| T20459 |
39156-39160 |
VBD |
denotes |
were |
| T20434 |
39161-39166 |
VBN |
denotes |
grown |
| T20460 |
39167-39169 |
IN |
denotes |
on |
| T20461 |
39170-39181 |
NN |
denotes |
fibronectin |
| T20463 |
39181-39182 |
HYPH |
denotes |
- |
| T20462 |
39182-39188 |
VBN |
denotes |
coated |
| T20464 |
39189-39199 |
NNS |
denotes |
coverslips |
| T20465 |
39200-39205 |
IN |
denotes |
until |
| T20467 |
39206-39211 |
JJ |
denotes |
tight |
| T20468 |
39212-39221 |
NNS |
denotes |
junctions |
| T20466 |
39222-39228 |
VBD |
denotes |
formed |
| T20469 |
39228-39229 |
. |
denotes |
. |
| T20470 |
39229-39326 |
sentence |
denotes |
Cells were treated with or without 150 μM forskolin for 90 min, and fixed in methanol at −20 °C. |
| T20471 |
39230-39235 |
NNS |
denotes |
Cells |
| T20473 |
39236-39240 |
VBD |
denotes |
were |
| T20472 |
39241-39248 |
VBN |
denotes |
treated |
| T20474 |
39249-39253 |
IN |
denotes |
with |
| T20475 |
39254-39256 |
CC |
denotes |
or |
| T20476 |
39257-39264 |
IN |
denotes |
without |
| T20477 |
39265-39268 |
CD |
denotes |
150 |
| T20478 |
39269-39271 |
NN |
denotes |
μM |
| T20479 |
39272-39281 |
NN |
denotes |
forskolin |
| T20480 |
39282-39285 |
IN |
denotes |
for |
| T20481 |
39286-39288 |
CD |
denotes |
90 |
| T20482 |
39289-39292 |
NN |
denotes |
min |
| T20483 |
39292-39294 |
, |
denotes |
, |
| T20484 |
39294-39297 |
CC |
denotes |
and |
| T20485 |
39298-39303 |
VBN |
denotes |
fixed |
| T20486 |
39304-39306 |
IN |
denotes |
in |
| T20487 |
39307-39315 |
NN |
denotes |
methanol |
| T20488 |
39316-39318 |
IN |
denotes |
at |
| T20489 |
39319-39320 |
SYM |
denotes |
− |
| T20490 |
39320-39322 |
CD |
denotes |
20 |
| T20491 |
39323-39325 |
NN |
denotes |
°C |
| T20492 |
39325-39326 |
. |
denotes |
. |
| T20493 |
39326-39492 |
sentence |
denotes |
Subsequently, cells were washed and permeabilized in 0.2% Triton X-100 for 5 min, and sequentially probed for AQP2 and organelle markers for either the PM or the ER. |
| T20494 |
39327-39339 |
RB |
denotes |
Subsequently |
| T20496 |
39339-39341 |
, |
denotes |
, |
| T20497 |
39341-39346 |
NNS |
denotes |
cells |
| T20498 |
39347-39351 |
VBD |
denotes |
were |
| T20495 |
39352-39358 |
VBN |
denotes |
washed |
| T20499 |
39359-39362 |
CC |
denotes |
and |
| T20500 |
39363-39376 |
VBN |
denotes |
permeabilized |
| T20501 |
39377-39379 |
IN |
denotes |
in |
| T20502 |
39380-39383 |
CD |
denotes |
0.2 |
| T20503 |
39383-39384 |
NN |
denotes |
% |
| T20505 |
39385-39391 |
NN |
denotes |
Triton |
| T20504 |
39392-39393 |
NN |
denotes |
X |
| T20506 |
39393-39394 |
HYPH |
denotes |
- |
| T20507 |
39394-39397 |
CD |
denotes |
100 |
| T20508 |
39398-39401 |
IN |
denotes |
for |
| T20509 |
39402-39403 |
CD |
denotes |
5 |
| T20510 |
39404-39407 |
NN |
denotes |
min |
| T20511 |
39407-39409 |
, |
denotes |
, |
| T20512 |
39409-39412 |
CC |
denotes |
and |
| T20513 |
39413-39425 |
RB |
denotes |
sequentially |
| T20514 |
39426-39432 |
VBN |
denotes |
probed |
| T20515 |
39433-39436 |
IN |
denotes |
for |
| T20516 |
39437-39441 |
NN |
denotes |
AQP2 |
| T20517 |
39442-39445 |
CC |
denotes |
and |
| T20518 |
39446-39455 |
NN |
denotes |
organelle |
| T20519 |
39456-39463 |
NNS |
denotes |
markers |
| T20520 |
39464-39467 |
IN |
denotes |
for |
| T20521 |
39468-39474 |
CC |
denotes |
either |
| T20523 |
39475-39478 |
DT |
denotes |
the |
| T20522 |
39479-39481 |
NN |
denotes |
PM |
| T20524 |
39482-39484 |
CC |
denotes |
or |
| T20525 |
39485-39488 |
DT |
denotes |
the |
| T20526 |
39489-39491 |
NN |
denotes |
ER |
| T20527 |
39491-39492 |
. |
denotes |
. |
| T20528 |
39492-39662 |
sentence |
denotes |
AQP2 was detected using goat anti-AQP2 (1:100; Santa Cruz Biotechnology; #sc-9882) and a 1:200 dilution of AlexaFluor 488-conjugated donkey anti-goat secondary antibody. |
| T20529 |
39493-39497 |
NN |
denotes |
AQP2 |
| T20531 |
39498-39501 |
VBD |
denotes |
was |
| T20530 |
39502-39510 |
VBN |
denotes |
detected |
| T20532 |
39511-39516 |
VBG |
denotes |
using |
| T20533 |
39517-39521 |
NN |
denotes |
goat |
| T20534 |
39522-39531 |
JJ |
denotes |
anti-AQP2 |
| T20535 |
39532-39533 |
-LRB- |
denotes |
( |
| T20537 |
39533-39534 |
CD |
denotes |
1 |
| T20538 |
39534-39535 |
SYM |
denotes |
: |
| T20539 |
39535-39538 |
CD |
denotes |
100 |
| T20540 |
39538-39539 |
: |
denotes |
; |
| T20541 |
39540-39545 |
NNP |
denotes |
Santa |
| T20542 |
39546-39550 |
NNP |
denotes |
Cruz |
| T20543 |
39551-39564 |
NNP |
denotes |
Biotechnology |
| T20544 |
39564-39565 |
: |
denotes |
; |
| T20545 |
39566-39567 |
SYM |
denotes |
# |
| T20536 |
39567-39569 |
NN |
denotes |
sc |
| T20546 |
39569-39570 |
HYPH |
denotes |
- |
| T20547 |
39570-39574 |
CD |
denotes |
9882 |
| T20548 |
39574-39575 |
-RRB- |
denotes |
) |
| T20549 |
39576-39579 |
CC |
denotes |
and |
| T20550 |
39580-39581 |
DT |
denotes |
a |
| T20552 |
39582-39583 |
CD |
denotes |
1 |
| T20554 |
39583-39584 |
SYM |
denotes |
: |
| T20553 |
39584-39587 |
CD |
denotes |
200 |
| T20551 |
39588-39596 |
NN |
denotes |
dilution |
| T20555 |
39597-39599 |
IN |
denotes |
of |
| T20556 |
39600-39610 |
NNP |
denotes |
AlexaFluor |
| T20558 |
39611-39614 |
CD |
denotes |
488 |
| T20559 |
39614-39615 |
HYPH |
denotes |
- |
| T20557 |
39615-39625 |
VBN |
denotes |
conjugated |
| T20561 |
39626-39632 |
NN |
denotes |
donkey |
| T20562 |
39633-39642 |
JJ |
denotes |
anti-goat |
| T20563 |
39643-39652 |
JJ |
denotes |
secondary |
| T20560 |
39653-39661 |
NN |
denotes |
antibody |
| T20564 |
39661-39662 |
. |
denotes |
. |
| T20565 |
39662-40070 |
sentence |
denotes |
The PM and ER were probed using mouse anti-Na+/K+-ATPase (Upstate, Waltham, Massachusetts, United States) or rabbit anti-calnexin (Stressgen Biotechnology, Victoria, British Columbia, Canada) antibodies and the secondary antibodies, Cy3-conjugated goat anti-mouse (1:200; Jackson ImmunoResearch, West Grove, Pennsylvania, United States) or AlexaFluor 594-conjugated chicken anti-rabbit (1:200) respectively. |
| T20566 |
39663-39666 |
DT |
denotes |
The |
| T20567 |
39667-39669 |
NN |
denotes |
PM |
| T20569 |
39670-39673 |
CC |
denotes |
and |
| T20570 |
39674-39676 |
NN |
denotes |
ER |
| T20571 |
39677-39681 |
VBD |
denotes |
were |
| T20568 |
39682-39688 |
VBN |
denotes |
probed |
| T20572 |
39689-39694 |
VBG |
denotes |
using |
| T20573 |
39695-39700 |
NN |
denotes |
mouse |
| T20575 |
39701-39709 |
JJ |
denotes |
anti-Na+ |
| T20576 |
39709-39710 |
HYPH |
denotes |
/ |
| T20577 |
39710-39712 |
NN |
denotes |
K+ |
| T20578 |
39712-39713 |
HYPH |
denotes |
- |
| T20574 |
39713-39719 |
NN |
denotes |
ATPase |
| T20580 |
39720-39721 |
-LRB- |
denotes |
( |
| T20581 |
39721-39728 |
NNP |
denotes |
Upstate |
| T20582 |
39728-39730 |
, |
denotes |
, |
| T20583 |
39730-39737 |
NNP |
denotes |
Waltham |
| T20584 |
39737-39739 |
, |
denotes |
, |
| T20585 |
39739-39752 |
NNP |
denotes |
Massachusetts |
| T20586 |
39752-39754 |
, |
denotes |
, |
| T20587 |
39754-39760 |
NNP |
denotes |
United |
| T20588 |
39761-39767 |
NNP |
denotes |
States |
| T20589 |
39767-39768 |
-RRB- |
denotes |
) |
| T20590 |
39769-39771 |
CC |
denotes |
or |
| T20591 |
39772-39778 |
NN |
denotes |
rabbit |
| T20592 |
39779-39792 |
JJ |
denotes |
anti-calnexin |
| T20593 |
39793-39794 |
-LRB- |
denotes |
( |
| T20595 |
39794-39803 |
NNP |
denotes |
Stressgen |
| T20594 |
39804-39817 |
NNP |
denotes |
Biotechnology |
| T20596 |
39817-39819 |
, |
denotes |
, |
| T20597 |
39819-39827 |
NNP |
denotes |
Victoria |
| T20598 |
39827-39829 |
, |
denotes |
, |
| T20599 |
39829-39836 |
NNP |
denotes |
British |
| T20600 |
39837-39845 |
NNP |
denotes |
Columbia |
| T20601 |
39845-39847 |
, |
denotes |
, |
| T20602 |
39847-39853 |
NNP |
denotes |
Canada |
| T20603 |
39853-39854 |
-RRB- |
denotes |
) |
| T20579 |
39855-39865 |
NNS |
denotes |
antibodies |
| T20604 |
39866-39869 |
CC |
denotes |
and |
| T20605 |
39870-39873 |
DT |
denotes |
the |
| T20607 |
39874-39883 |
JJ |
denotes |
secondary |
| T20606 |
39884-39894 |
NNS |
denotes |
antibodies |
| T20608 |
39894-39896 |
, |
denotes |
, |
| T20609 |
39896-39899 |
NN |
denotes |
Cy3 |
| T20611 |
39899-39900 |
HYPH |
denotes |
- |
| T20610 |
39900-39910 |
VBN |
denotes |
conjugated |
| T20612 |
39911-39915 |
NN |
denotes |
goat |
| T20613 |
39916-39926 |
JJ |
denotes |
anti-mouse |
| T20614 |
39927-39928 |
-LRB- |
denotes |
( |
| T20616 |
39928-39929 |
CD |
denotes |
1 |
| T20617 |
39929-39930 |
SYM |
denotes |
: |
| T20618 |
39930-39933 |
CD |
denotes |
200 |
| T20619 |
39933-39934 |
: |
denotes |
; |
| T20620 |
39935-39942 |
NNP |
denotes |
Jackson |
| T20615 |
39943-39957 |
NNP |
denotes |
ImmunoResearch |
| T20621 |
39957-39959 |
, |
denotes |
, |
| T20622 |
39959-39963 |
NNP |
denotes |
West |
| T20623 |
39964-39969 |
NNP |
denotes |
Grove |
| T20624 |
39969-39971 |
, |
denotes |
, |
| T20625 |
39971-39983 |
NNP |
denotes |
Pennsylvania |
| T20626 |
39983-39985 |
, |
denotes |
, |
| T20627 |
39985-39991 |
NNP |
denotes |
United |
| T20628 |
39992-39998 |
NNP |
denotes |
States |
| T20629 |
39998-39999 |
-RRB- |
denotes |
) |
| T20630 |
40000-40002 |
CC |
denotes |
or |
| T20631 |
40003-40013 |
NNP |
denotes |
AlexaFluor |
| T20633 |
40014-40017 |
CD |
denotes |
594 |
| T20634 |
40017-40018 |
HYPH |
denotes |
- |
| T20632 |
40018-40028 |
VBN |
denotes |
conjugated |
| T20635 |
40029-40036 |
NN |
denotes |
chicken |
| T20636 |
40037-40048 |
JJ |
denotes |
anti-rabbit |
| T20637 |
40049-40050 |
-LRB- |
denotes |
( |
| T20638 |
40050-40051 |
CD |
denotes |
1 |
| T20639 |
40051-40052 |
SYM |
denotes |
: |
| T20640 |
40052-40055 |
CD |
denotes |
200 |
| T20641 |
40055-40056 |
-RRB- |
denotes |
) |
| T20642 |
40057-40069 |
RB |
denotes |
respectively |
| T20643 |
40069-40070 |
. |
denotes |
. |
| T20644 |
40070-40150 |
sentence |
denotes |
Cells were washed in PBS, counterstained with DAPI, and mounted in Vectashield. |
| T20645 |
40071-40076 |
NNS |
denotes |
Cells |
| T20647 |
40077-40081 |
VBD |
denotes |
were |
| T20646 |
40082-40088 |
VBN |
denotes |
washed |
| T20648 |
40089-40091 |
IN |
denotes |
in |
| T20649 |
40092-40095 |
NN |
denotes |
PBS |
| T20650 |
40095-40097 |
, |
denotes |
, |
| T20651 |
40097-40111 |
VBN |
denotes |
counterstained |
| T20652 |
40112-40116 |
IN |
denotes |
with |
| T20653 |
40117-40121 |
NN |
denotes |
DAPI |
| T20654 |
40121-40123 |
, |
denotes |
, |
| T20655 |
40123-40126 |
CC |
denotes |
and |
| T20656 |
40127-40134 |
VBN |
denotes |
mounted |
| T20657 |
40135-40137 |
IN |
denotes |
in |
| T20658 |
40138-40149 |
NNP |
denotes |
Vectashield |
| T20659 |
40149-40150 |
. |
denotes |
. |
| T20660 |
40150-40368 |
sentence |
denotes |
In experiments in which GFP fusions were used, AQP2 was probed using the antibody combination used for kidney immunohistochemistry in order to detect the AQP2 at 594 nm, to distinguish between the GFP fusion proteins. |
| T20661 |
40151-40153 |
IN |
denotes |
In |
| T20663 |
40154-40165 |
NNS |
denotes |
experiments |
| T20664 |
40166-40168 |
IN |
denotes |
in |
| T20666 |
40169-40174 |
WDT |
denotes |
which |
| T20667 |
40175-40178 |
NN |
denotes |
GFP |
| T20668 |
40179-40186 |
NNS |
denotes |
fusions |
| T20669 |
40187-40191 |
VBD |
denotes |
were |
| T20665 |
40192-40196 |
VBN |
denotes |
used |
| T20670 |
40196-40198 |
, |
denotes |
, |
| T20671 |
40198-40202 |
NN |
denotes |
AQP2 |
| T20672 |
40203-40206 |
VBD |
denotes |
was |
| T20662 |
40207-40213 |
VBN |
denotes |
probed |
| T20673 |
40214-40219 |
VBG |
denotes |
using |
| T20674 |
40220-40223 |
DT |
denotes |
the |
| T20676 |
40224-40232 |
NN |
denotes |
antibody |
| T20675 |
40233-40244 |
NN |
denotes |
combination |
| T20677 |
40245-40249 |
VBN |
denotes |
used |
| T20678 |
40250-40253 |
IN |
denotes |
for |
| T20679 |
40254-40260 |
NN |
denotes |
kidney |
| T20680 |
40261-40281 |
NN |
denotes |
immunohistochemistry |
| T20681 |
40282-40284 |
IN |
denotes |
in |
| T20682 |
40285-40290 |
NN |
denotes |
order |
| T20683 |
40291-40293 |
TO |
denotes |
to |
| T20684 |
40294-40300 |
VB |
denotes |
detect |
| T20685 |
40301-40304 |
DT |
denotes |
the |
| T20686 |
40305-40309 |
NN |
denotes |
AQP2 |
| T20687 |
40310-40312 |
IN |
denotes |
at |
| T20688 |
40313-40316 |
CD |
denotes |
594 |
| T20689 |
40317-40319 |
NN |
denotes |
nm |
| T20690 |
40319-40321 |
, |
denotes |
, |
| T20691 |
40321-40323 |
TO |
denotes |
to |
| T20692 |
40324-40335 |
VB |
denotes |
distinguish |
| T20693 |
40336-40343 |
IN |
denotes |
between |
| T20694 |
40344-40347 |
DT |
denotes |
the |
| T20696 |
40348-40351 |
NN |
denotes |
GFP |
| T20697 |
40352-40358 |
NN |
denotes |
fusion |
| T20695 |
40359-40367 |
NN |
denotes |
proteins |
| T20698 |
40367-40368 |
. |
denotes |
. |
| T20832 |
40370-40378 |
JJ |
denotes |
Confocal |
| T20833 |
40379-40389 |
NN |
denotes |
microscopy |
| T20834 |
40389-40390 |
. |
denotes |
. |
| T20835 |
40390-40538 |
sentence |
denotes |
Optical z-section images were collected on a BioRad (Hercules, California, United States) Rainbow Radiance 2100 Laser Scanning Confocal Microscope. |
| T20836 |
40391-40398 |
JJ |
denotes |
Optical |
| T20838 |
40399-40400 |
NN |
denotes |
z |
| T20840 |
40400-40401 |
HYPH |
denotes |
- |
| T20839 |
40401-40408 |
NN |
denotes |
section |
| T20837 |
40409-40415 |
NNS |
denotes |
images |
| T20842 |
40416-40420 |
VBD |
denotes |
were |
| T20841 |
40421-40430 |
VBN |
denotes |
collected |
| T20843 |
40431-40433 |
IN |
denotes |
on |
| T20844 |
40434-40435 |
DT |
denotes |
a |
| T20846 |
40436-40442 |
NNP |
denotes |
BioRad |
| T20847 |
40443-40444 |
-LRB- |
denotes |
( |
| T20848 |
40444-40452 |
NNP |
denotes |
Hercules |
| T20849 |
40452-40454 |
, |
denotes |
, |
| T20850 |
40454-40464 |
NNP |
denotes |
California |
| T20851 |
40464-40466 |
, |
denotes |
, |
| T20852 |
40466-40472 |
NNP |
denotes |
United |
| T20853 |
40473-40479 |
NNP |
denotes |
States |
| T20854 |
40479-40480 |
-RRB- |
denotes |
) |
| T20855 |
40481-40488 |
NNP |
denotes |
Rainbow |
| T20856 |
40489-40497 |
NNP |
denotes |
Radiance |
| T20857 |
40498-40502 |
CD |
denotes |
2100 |
| T20858 |
40503-40508 |
NN |
denotes |
Laser |
| T20859 |
40509-40517 |
NN |
denotes |
Scanning |
| T20860 |
40518-40526 |
NN |
denotes |
Confocal |
| T20845 |
40527-40537 |
NN |
denotes |
Microscope |
| T20861 |
40537-40538 |
. |
denotes |
. |
| T20862 |
40538-40723 |
sentence |
denotes |
Image stacks were flattened, or sectioned along the z-axis, then further processed using BioRad Laser Sharp 2000 software and Image J software (v. 1.32; National Institutes of Health). |
| T20863 |
40539-40544 |
NN |
denotes |
Image |
| T20864 |
40545-40551 |
NNS |
denotes |
stacks |
| T20866 |
40552-40556 |
VBD |
denotes |
were |
| T20865 |
40557-40566 |
VBN |
denotes |
flattened |
| T20867 |
40566-40568 |
, |
denotes |
, |
| T20868 |
40568-40570 |
CC |
denotes |
or |
| T20869 |
40571-40580 |
VBN |
denotes |
sectioned |
| T20870 |
40581-40586 |
IN |
denotes |
along |
| T20871 |
40587-40590 |
DT |
denotes |
the |
| T20873 |
40591-40592 |
NN |
denotes |
z |
| T20874 |
40592-40593 |
HYPH |
denotes |
- |
| T20872 |
40593-40597 |
NN |
denotes |
axis |
| T20875 |
40597-40599 |
, |
denotes |
, |
| T20876 |
40599-40603 |
RB |
denotes |
then |
| T20878 |
40604-40611 |
RB |
denotes |
further |
| T20877 |
40612-40621 |
VBN |
denotes |
processed |
| T20879 |
40622-40627 |
VBG |
denotes |
using |
| T20880 |
40628-40634 |
NNP |
denotes |
BioRad |
| T20882 |
40635-40640 |
NNP |
denotes |
Laser |
| T20883 |
40641-40646 |
NNP |
denotes |
Sharp |
| T20884 |
40647-40651 |
CD |
denotes |
2000 |
| T20881 |
40652-40660 |
NN |
denotes |
software |
| T20885 |
40661-40664 |
CC |
denotes |
and |
| T20886 |
40665-40670 |
NNP |
denotes |
Image |
| T20887 |
40671-40672 |
NNP |
denotes |
J |
| T20888 |
40673-40681 |
NN |
denotes |
software |
| T20889 |
40682-40683 |
-LRB- |
denotes |
( |
| T20891 |
40683-40685 |
NN |
denotes |
v. |
| T20892 |
40686-40690 |
CD |
denotes |
1.32 |
| T20893 |
40690-40691 |
: |
denotes |
; |
| T20894 |
40692-40700 |
NNP |
denotes |
National |
| T20890 |
40701-40711 |
NNPS |
denotes |
Institutes |
| T20895 |
40712-40714 |
IN |
denotes |
of |
| T20896 |
40715-40721 |
NNP |
denotes |
Health |
| T20897 |
40721-40722 |
-RRB- |
denotes |
) |
| T20898 |
40722-40723 |
. |
denotes |
. |
| T20899 |
40723-40803 |
sentence |
denotes |
Colocalization was performed using the overlay coefficient of Image J software. |
| T20900 |
40724-40738 |
NN |
denotes |
Colocalization |
| T20902 |
40739-40742 |
VBD |
denotes |
was |
| T20901 |
40743-40752 |
VBN |
denotes |
performed |
| T20903 |
40753-40758 |
VBG |
denotes |
using |
| T20904 |
40759-40762 |
DT |
denotes |
the |
| T20906 |
40763-40770 |
JJ |
denotes |
overlay |
| T20905 |
40771-40782 |
NN |
denotes |
coefficient |
| T20907 |
40783-40785 |
IN |
denotes |
of |
| T20908 |
40786-40791 |
NNP |
denotes |
Image |
| T20909 |
40792-40793 |
NNP |
denotes |
J |
| T20910 |
40794-40802 |
NN |
denotes |
software |
| T20911 |
40802-40803 |
. |
denotes |
. |
| R1 |
T593 |
T594 |
compound |
Diabetes,Insipidus |
| R10 |
T604 |
T602 |
nummod |
2,Aquaporin |
| R100 |
T704 |
T701 |
prep |
of,identification |
| R1000 |
T9121 |
T9120 |
amod |
sixth,domain |
| R1001 |
T9005 |
T9006 |
compound |
plasma,levels |
| R1002 |
T9122 |
T9123 |
npadvmod |
membrane,spanning |
| R1003 |
T9123 |
T9120 |
amod |
spanning,domain |
| R1004 |
T9124 |
T9120 |
punct |
", ",domain |
| R1005 |
T9125 |
T9126 |
det |
a,region |
| R1006 |
T9006 |
T9004 |
nsubj |
levels,were |
| R1007 |
T9126 |
T9120 |
appos |
region,domain |
| R1008 |
T9127 |
T9126 |
amod |
rich,region |
| R1009 |
T9128 |
T9127 |
prep |
in,rich |
| R101 |
T705 |
T706 |
det |
a,model |
| R1010 |
T9129 |
T9130 |
amod |
hydrophobic,acids |
| R1011 |
T9130 |
T9128 |
pobj |
acids,in |
| R1012 |
T9131 |
T9130 |
compound |
amino,acids |
| R1013 |
T9007 |
T9006 |
compound |
glucose,levels |
| R1014 |
T9132 |
T9113 |
punct |
.,lies |
| R1015 |
T9134 |
T9135 |
nsubjpass |
This,conserved |
| R1016 |
T9008 |
T9004 |
acomp |
normal,were |
| R1017 |
T9136 |
T9134 |
cc |
and,This |
| R1018 |
T9137 |
T9138 |
det |
the,other |
| R1019 |
T9009 |
T9004 |
cc |
and,were |
| R102 |
T706 |
T704 |
pobj |
model,of |
| R1020 |
T9138 |
T9139 |
nmod |
other,domains |
| R1021 |
T9139 |
T9134 |
conj |
domains,This |
| R1022 |
T9140 |
T9141 |
npadvmod |
membrane,spanning |
| R1023 |
T9010 |
T9011 |
expl |
there,was |
| R1024 |
T9141 |
T9139 |
amod |
spanning,domains |
| R1025 |
T9142 |
T9141 |
punct |
-,spanning |
| R1026 |
T9011 |
T9004 |
conj |
was,were |
| R1027 |
T9143 |
T9135 |
auxpass |
are,conserved |
| R1028 |
T9144 |
T9135 |
prep |
among,conserved |
| R1029 |
T9145 |
T9146 |
amod |
vertebrate,species |
| R103 |
T707 |
T706 |
compound |
mouse,model |
| R1030 |
T9012 |
T9013 |
det |
no,glucose |
| R1031 |
T9146 |
T9144 |
pobj |
species,among |
| R1032 |
T9147 |
T9135 |
punct |
.,conserved |
| R1033 |
T9013 |
T9011 |
attr |
glucose,was |
| R1034 |
T9149 |
T9150 |
det |
The,phenylalanine |
| R1035 |
T9150 |
T9151 |
nsubj |
phenylalanine,is |
| R1036 |
T9014 |
T9011 |
prep |
in,was |
| R1037 |
T9152 |
T9150 |
prep |
at,phenylalanine |
| R1038 |
T9015 |
T9016 |
det |
the,urine |
| R1039 |
T9016 |
T9014 |
pobj |
urine,in |
| R104 |
T708 |
T706 |
prep |
of,model |
| R1040 |
T9153 |
T9152 |
pobj |
position,at |
| R1041 |
T9154 |
T9153 |
nummod |
204,position |
| R1042 |
T9017 |
T9018 |
punct |
(,data |
| R1043 |
T9155 |
T9156 |
advmod |
particularly,conserved |
| R1044 |
T9156 |
T9151 |
acomp |
conserved,is |
| R1045 |
T9018 |
T9002 |
meta |
data,showed |
| R1046 |
T9157 |
T9156 |
advmod |
well,conserved |
| R1047 |
T9158 |
T9159 |
punct |
(,Figure |
| R1048 |
T9159 |
T9156 |
parataxis |
Figure,conserved |
| R1049 |
T9019 |
T9018 |
amod |
unpublished,data |
| R105 |
T709 |
T708 |
pobj |
NDI,of |
| R1050 |
T9160 |
T9159 |
nummod |
1B,Figure |
| R1051 |
T9161 |
T9159 |
punct |
),Figure |
| R1052 |
T9020 |
T9018 |
punct |
),data |
| R1053 |
T9162 |
T9151 |
punct |
", ",is |
| R1054 |
T9163 |
T9164 |
preconj |
not,among |
| R1055 |
T9164 |
T9151 |
prep |
among,is |
| R1056 |
T9021 |
T9002 |
punct |
.,showed |
| R1057 |
T9165 |
T9163 |
advmod |
only,not |
| R1058 |
T9166 |
T9167 |
amod |
vertebrate,proteins |
| R1059 |
T9023 |
T9024 |
advmod |
Hence,was |
| R106 |
T710 |
T706 |
punct |
", ",model |
| R1060 |
T9167 |
T9164 |
pobj |
proteins,among |
| R1061 |
T9168 |
T9167 |
compound |
AQP2,proteins |
| R1062 |
T9169 |
T9164 |
punct |
", ",among |
| R1063 |
T9170 |
T9164 |
cc |
but,among |
| R1064 |
T9171 |
T9170 |
advmod |
also,but |
| R1065 |
T9172 |
T9164 |
conj |
among,among |
| R1066 |
T9173 |
T9174 |
compound |
others,members |
| R1067 |
T9025 |
T9024 |
punct |
", ",was |
| R1068 |
T9174 |
T9172 |
pobj |
members,among |
| R1069 |
T9175 |
T9174 |
prep |
of,members |
| R107 |
T711 |
T706 |
prep |
with,model |
| R1070 |
T9176 |
T9177 |
det |
this,family |
| R1071 |
T9177 |
T9175 |
pobj |
family,of |
| R1072 |
T9178 |
T9151 |
punct |
.,is |
| R1073 |
T9026 |
T9024 |
nsubj |
this,was |
| R1074 |
T9180 |
T9181 |
compound |
Aqp2F204V,F204V |
| R1075 |
T9181 |
T9183 |
compound |
F204V,mice |
| R1076 |
T9027 |
T9028 |
det |
an,example |
| R1077 |
T9182 |
T9181 |
punct |
/,F204V |
| R1078 |
T9183 |
T9184 |
nsubj |
mice,have |
| R1079 |
T9028 |
T9024 |
attr |
example,was |
| R108 |
T712 |
T713 |
det |
an,mutation |
| R1080 |
T9185 |
T9186 |
advmod |
dramatically,increased |
| R1081 |
T9186 |
T9187 |
amod |
increased,production |
| R1082 |
T9029 |
T9028 |
prep |
of,example |
| R1083 |
T9187 |
T9184 |
dobj |
production,have |
| R1084 |
T9188 |
T9187 |
compound |
urine,production |
| R1085 |
T9189 |
T9184 |
punct |
", ",have |
| R1086 |
T9030 |
T9031 |
compound |
diabetes,insipidus |
| R1087 |
T9190 |
T9191 |
prep |
in,producing |
| R1088 |
T9191 |
T9184 |
advcl |
producing,have |
| R1089 |
T9031 |
T9029 |
pobj |
insipidus,of |
| R109 |
T713 |
T711 |
pobj |
mutation,with |
| R1090 |
T9032 |
T9024 |
punct |
.,was |
| R1091 |
T9034 |
T9035 |
det |
The,disorder |
| R1092 |
T9192 |
T9193 |
det |
some,cases |
| R1093 |
T9193 |
T9190 |
pobj |
cases,in |
| R1094 |
T9194 |
T9195 |
det |
an,amount |
| R1095 |
T9035 |
T9036 |
nsubj |
disorder,segregated |
| R1096 |
T9195 |
T9191 |
dobj |
amount,producing |
| R1097 |
T9196 |
T9195 |
prep |
of,amount |
| R1098 |
T9197 |
T9196 |
pobj |
urine,of |
| R1099 |
T9037 |
T9035 |
prep |
in,disorder |
| R11 |
T608 |
T609 |
amod |
Congenital,insipidus |
| R110 |
T714 |
T713 |
compound |
F204V,mutation |
| R1100 |
T9198 |
T9191 |
prep |
in,producing |
| R1101 |
T9199 |
T9200 |
nummod |
24,h |
| R1102 |
T9200 |
T9198 |
pobj |
h,in |
| R1103 |
T9201 |
T9202 |
dep |
that,exceeds |
| R1104 |
T9038 |
T9039 |
det |
these,mice |
| R1105 |
T9202 |
T9191 |
ccomp |
exceeds,producing |
| R1106 |
T9203 |
T9204 |
poss |
their,weight |
| R1107 |
T9204 |
T9202 |
dobj |
weight,exceeds |
| R1108 |
T9039 |
T9037 |
pobj |
mice,in |
| R1109 |
T9205 |
T9204 |
compound |
body,weight |
| R111 |
T715 |
T713 |
prep |
in,mutation |
| R1110 |
T9206 |
T9191 |
punct |
", ",producing |
| R1111 |
T9040 |
T9036 |
prep |
in,segregated |
| R1112 |
T9207 |
T9191 |
prep |
compared,producing |
| R1113 |
T9208 |
T9207 |
prep |
to,compared |
| R1114 |
T9209 |
T9210 |
poss |
their,littermates |
| R1115 |
T9210 |
T9208 |
pobj |
littermates,to |
| R1116 |
T9211 |
T9210 |
amod |
heterozygous,littermates |
| R1117 |
T9212 |
T9211 |
cc |
or,heterozygous |
| R1118 |
T9041 |
T9042 |
det |
a,manner |
| R1119 |
T9213 |
T9214 |
amod |
wild,type |
| R112 |
T716 |
T717 |
det |
the,gene |
| R1120 |
T9214 |
T9211 |
conj |
type,heterozygous |
| R1121 |
T9215 |
T9214 |
punct |
-,type |
| R1122 |
T9042 |
T9040 |
pobj |
manner,in |
| R1123 |
T9216 |
T9184 |
punct |
.,have |
| R1124 |
T9043 |
T9042 |
amod |
monogenic,manner |
| R1125 |
T9218 |
T9219 |
amod |
Such,loss |
| R1126 |
T9219 |
T9220 |
nsubj |
loss,lead |
| R1127 |
T9044 |
T9042 |
punct |
", ",manner |
| R1128 |
T9221 |
T9219 |
prep |
of,loss |
| R1129 |
T9222 |
T9221 |
pobj |
water,of |
| R113 |
T717 |
T715 |
pobj |
gene,in |
| R1130 |
T9223 |
T9220 |
aux |
would,lead |
| R1131 |
T9224 |
T9220 |
advmod |
rapidly,lead |
| R1132 |
T9045 |
T9046 |
amod |
autosomal,recessive |
| R1133 |
T9225 |
T9220 |
prep |
to,lead |
| R1134 |
T9226 |
T9225 |
pobj |
dehydration,to |
| R1135 |
T9227 |
T9228 |
auxpass |
were,compensated |
| R1136 |
T9046 |
T9042 |
amod |
recessive,manner |
| R1137 |
T9228 |
T9220 |
advcl |
compensated,lead |
| R1138 |
T9229 |
T9228 |
nsubjpass |
it,compensated |
| R1139 |
T9047 |
T9036 |
punct |
", ",segregated |
| R114 |
T718 |
T717 |
compound |
Aqp2,gene |
| R1140 |
T9230 |
T9228 |
neg |
not,compensated |
| R1141 |
T9231 |
T9228 |
agent |
by,compensated |
| R1142 |
T9232 |
T9233 |
amod |
increased,intake |
| R1143 |
T9048 |
T9036 |
advcl |
making,segregated |
| R1144 |
T9233 |
T9231 |
pobj |
intake,by |
| R1145 |
T9234 |
T9233 |
compound |
water,intake |
| R1146 |
T9235 |
T9220 |
punct |
.,lead |
| R1147 |
T9049 |
T9050 |
nsubj |
Aqp2,gene |
| R1148 |
T9237 |
T9238 |
advmod |
Indeed,increase |
| R1149 |
T9050 |
T9048 |
ccomp |
gene,making |
| R115 |
T719 |
T689 |
punct |
.,report |
| R1150 |
T9239 |
T9238 |
punct |
", ",increase |
| R1151 |
T9051 |
T9050 |
det |
a,gene |
| R1152 |
T9240 |
T9241 |
compound |
mutant,mice |
| R1153 |
T9052 |
T9050 |
compound |
candidate,gene |
| R1154 |
T9241 |
T9238 |
nsubj |
mice,increase |
| R1155 |
T9242 |
T9238 |
advmod |
also,increase |
| R1156 |
T9053 |
T9036 |
punct |
.,segregated |
| R1157 |
T9243 |
T9238 |
advmod |
dramatically,increase |
| R1158 |
T9244 |
T9245 |
poss |
their,intake |
| R1159 |
T9245 |
T9238 |
dobj |
intake,increase |
| R116 |
T721 |
T722 |
prep |
Unlike,survive |
| R1160 |
T9055 |
T9056 |
nsubj |
Sequencing,identified |
| R1161 |
T9246 |
T9245 |
compound |
water,intake |
| R1162 |
T9247 |
T9248 |
punct |
(,Figure |
| R1163 |
T9248 |
T9238 |
parataxis |
Figure,increase |
| R1164 |
T9249 |
T9248 |
nummod |
1C,Figure |
| R1165 |
T9057 |
T9055 |
prep |
of,Sequencing |
| R1166 |
T9250 |
T9248 |
punct |
),Figure |
| R1167 |
T9251 |
T9238 |
prep |
compared,increase |
| R1168 |
T9252 |
T9251 |
prep |
to,compared |
| R1169 |
T9253 |
T9254 |
poss |
their,littermates |
| R117 |
T723 |
T724 |
advmod |
previously,attempted |
| R1170 |
T9254 |
T9252 |
pobj |
littermates,to |
| R1171 |
T9058 |
T9059 |
compound |
Aqp2,region |
| R1172 |
T9255 |
T9254 |
amod |
heterozygous,littermates |
| R1173 |
T9256 |
T9255 |
cc |
or,heterozygous |
| R1174 |
T9257 |
T9258 |
amod |
wild,type |
| R1175 |
T9059 |
T9057 |
pobj |
region,of |
| R1176 |
T9258 |
T9255 |
conj |
type,heterozygous |
| R1177 |
T9259 |
T9258 |
punct |
-,type |
| R1178 |
T9260 |
T9238 |
punct |
.,increase |
| R1179 |
T9060 |
T9059 |
compound |
coding,region |
| R118 |
T724 |
T725 |
amod |
attempted,models |
| R1180 |
T9262 |
T9263 |
det |
This,phenotype |
| R1181 |
T9061 |
T9059 |
prep |
of,region |
| R1182 |
T9263 |
T9264 |
nsubj |
phenotype,showed |
| R1183 |
T9265 |
T9263 |
punct |
—,phenotype |
| R1184 |
T9062 |
T9063 |
amod |
affected,mice |
| R1185 |
T9266 |
T9267 |
amod |
increased,output |
| R1186 |
T9267 |
T9263 |
appos |
output,phenotype |
| R1187 |
T9268 |
T9267 |
amod |
urinary,output |
| R1188 |
T9063 |
T9061 |
pobj |
mice,of |
| R1189 |
T9269 |
T9267 |
cc |
and,output |
| R119 |
T725 |
T721 |
pobj |
models,Unlike |
| R1190 |
T9270 |
T9271 |
compound |
water,intake |
| R1191 |
T9271 |
T9267 |
conj |
intake,output |
| R1192 |
T9064 |
T9065 |
det |
a,transversion |
| R1193 |
T9272 |
T9264 |
punct |
—,showed |
| R1194 |
T9273 |
T9274 |
amod |
complete,concordance |
| R1195 |
T9274 |
T9264 |
dobj |
concordance,showed |
| R1196 |
T9065 |
T9056 |
dobj |
transversion,identified |
| R1197 |
T9275 |
T9274 |
prep |
with,concordance |
| R1198 |
T9276 |
T9275 |
pobj |
homozygosity,with |
| R1199 |
T9277 |
T9276 |
prep |
of,homozygosity |
| R12 |
T609 |
T612 |
nsubj |
insipidus,is |
| R120 |
T726 |
T725 |
amod |
murine,models |
| R1200 |
T9066 |
T9065 |
nmod |
thymine,transversion |
| R1201 |
T9278 |
T9279 |
det |
the,mutation |
| R1202 |
T9279 |
T9277 |
pobj |
mutation,of |
| R1203 |
T9280 |
T9279 |
compound |
F204V,mutation |
| R1204 |
T9067 |
T9066 |
prep |
to,thymine |
| R1205 |
T9281 |
T9264 |
prep |
in,showed |
| R1206 |
T9282 |
T9283 |
det |
the,animals |
| R1207 |
T9283 |
T9281 |
pobj |
animals,in |
| R1208 |
T9068 |
T9067 |
pobj |
guanine,to |
| R1209 |
T9284 |
T9283 |
nummod |
58,animals |
| R121 |
T727 |
T725 |
prep |
of,models |
| R1210 |
T9285 |
T9283 |
acl |
tested,animals |
| R1211 |
T9286 |
T9264 |
punct |
.,showed |
| R1212 |
T9069 |
T9066 |
punct |
(,thymine |
| R1213 |
T9288 |
T9289 |
compound |
Diabetes,insipidus |
| R1214 |
T9289 |
T9290 |
nsubjpass |
insipidus,defined |
| R1215 |
T9070 |
T9066 |
appos |
T,thymine |
| R1216 |
T9291 |
T9290 |
aux |
can,defined |
| R1217 |
T9292 |
T9290 |
auxpass |
be,defined |
| R1218 |
T9293 |
T9290 |
prep |
as,defined |
| R1219 |
T9294 |
T9295 |
det |
an,inability |
| R122 |
T728 |
T727 |
pobj |
NDI,of |
| R1220 |
T9295 |
T9293 |
pobj |
inability,as |
| R1221 |
T9071 |
T9070 |
prep |
to,T |
| R1222 |
T9296 |
T9297 |
aux |
to,concentrate |
| R1223 |
T9297 |
T9295 |
acl |
concentrate,inability |
| R1224 |
T9072 |
T9071 |
pobj |
G,to |
| R1225 |
T9073 |
T9065 |
punct |
),transversion |
| R1226 |
T9074 |
T9075 |
punct |
(,Figure |
| R1227 |
T9298 |
T9297 |
dobj |
urine,concentrate |
| R1228 |
T9299 |
T9300 |
advmod |
where,appropriate |
| R1229 |
T9075 |
T9065 |
parataxis |
Figure,transversion |
| R123 |
T729 |
T722 |
punct |
", ",survive |
| R1230 |
T9300 |
T9297 |
advcl |
appropriate,concentrate |
| R1231 |
T9301 |
T9290 |
punct |
.,defined |
| R1232 |
T9076 |
T9075 |
nummod |
1A,Figure |
| R1233 |
T9303 |
T9304 |
prep |
Compared,produce |
| R1234 |
T9305 |
T9303 |
prep |
to,Compared |
| R1235 |
T9077 |
T9075 |
punct |
),Figure |
| R1236 |
T9306 |
T9307 |
amod |
wild,type |
| R1237 |
T9307 |
T9309 |
nmod |
type,littermates |
| R1238 |
T9308 |
T9307 |
punct |
-,type |
| R1239 |
T9078 |
T9065 |
punct |
", ",transversion |
| R124 |
T730 |
T731 |
poss |
our,mice |
| R1240 |
T9309 |
T9305 |
pobj |
littermates,to |
| R1241 |
T9310 |
T9307 |
cc |
or,type |
| R1242 |
T9311 |
T9307 |
conj |
heterozygous,type |
| R1243 |
T9079 |
T9080 |
dep |
which,predicted |
| R1244 |
T9312 |
T9304 |
punct |
", ",produce |
| R1245 |
T9313 |
T9314 |
compound |
Aqp2F204V,F204V |
| R1246 |
T9314 |
T9316 |
compound |
F204V,mice |
| R1247 |
T9080 |
T9065 |
relcl |
predicted,transversion |
| R1248 |
T9315 |
T9314 |
punct |
/,F204V |
| R1249 |
T9316 |
T9304 |
nsubj |
mice,produce |
| R125 |
T731 |
T722 |
nsubj |
mice,survive |
| R1250 |
T9317 |
T9318 |
advmod |
very,dilute |
| R1251 |
T9318 |
T9319 |
amod |
dilute,urine |
| R1252 |
T9081 |
T9080 |
auxpass |
is,predicted |
| R1253 |
T9319 |
T9304 |
dobj |
urine,produce |
| R1254 |
T9320 |
T9321 |
punct |
(,Figure |
| R1255 |
T9321 |
T9304 |
parataxis |
Figure,produce |
| R1256 |
T9082 |
T9083 |
aux |
to,lead |
| R1257 |
T9322 |
T9321 |
nummod |
1D,Figure |
| R1258 |
T9323 |
T9321 |
punct |
),Figure |
| R1259 |
T9083 |
T9080 |
xcomp |
lead,predicted |
| R126 |
T732 |
T722 |
prep |
to,survive |
| R1260 |
T9324 |
T9304 |
punct |
.,produce |
| R1261 |
T9326 |
T9327 |
amod |
Basal,concentration |
| R1262 |
T9084 |
T9083 |
prep |
to,lead |
| R1263 |
T9085 |
T9086 |
det |
a,substitution |
| R1264 |
T9327 |
T9329 |
nsubj |
concentration,is |
| R1265 |
T9403 |
T9402 |
oprd |
desmopressin,called |
| R1266 |
T9328 |
T9327 |
compound |
urine,concentration |
| R1267 |
T9330 |
T9327 |
prep |
in,concentration |
| R1268 |
T9331 |
T9332 |
compound |
mutant,mice |
| R1269 |
T9332 |
T9330 |
pobj |
mice,in |
| R127 |
T733 |
T732 |
pobj |
adulthood,to |
| R1270 |
T9333 |
T9334 |
advmod |
about,161 |
| R1271 |
T9404 |
T9383 |
punct |
),analog |
| R1272 |
T9334 |
T9335 |
nummod |
161,mOsm |
| R1273 |
T9335 |
T9329 |
attr |
mOsm,is |
| R1274 |
T9405 |
T9386 |
punct |
", ",is |
| R1275 |
T9336 |
T9335 |
punct |
", ",mOsm |
| R1276 |
T9337 |
T9335 |
prep |
compared,mOsm |
| R1277 |
T9338 |
T9337 |
prep |
to,compared |
| R1278 |
T9406 |
T9407 |
det |
a,agonist |
| R1279 |
T9339 |
T9340 |
quantmod |
about,"1,293" |
| R128 |
T734 |
T722 |
cc |
and,survive |
| R1280 |
T9340 |
T9341 |
nummod |
"1,293",mOsm |
| R1281 |
T9341 |
T9338 |
pobj |
mOsm,to |
| R1282 |
T9407 |
T9386 |
attr |
agonist,is |
| R1283 |
T9342 |
T9341 |
prep |
in,mOsm |
| R1284 |
T9343 |
T9344 |
amod |
wild,type |
| R1285 |
T9344 |
T9346 |
compound |
type,mice |
| R1286 |
T9408 |
T9407 |
amod |
potent,agonist |
| R1287 |
T9345 |
T9344 |
punct |
-,type |
| R1288 |
T9346 |
T9342 |
pobj |
mice,in |
| R1289 |
T9409 |
T9407 |
prep |
of,agonist |
| R129 |
T735 |
T736 |
advmod |
more,exactly |
| R1290 |
T9347 |
T9348 |
punct |
(,0.001 |
| R1291 |
T9348 |
T9329 |
parataxis |
0.001,is |
| R1292 |
T9349 |
T9348 |
nsubj |
p,0.001 |
| R1293 |
T9410 |
T9409 |
pobj |
AVPR2,of |
| R1294 |
T9350 |
T9348 |
punct |
<,0.001 |
| R1295 |
T9351 |
T9348 |
punct |
),0.001 |
| R1296 |
T9352 |
T9329 |
punct |
.,is |
| R1297 |
T9411 |
T9386 |
punct |
.,is |
| R1298 |
T9354 |
T9355 |
advmod |
Normally,is |
| R1299 |
T9413 |
T9414 |
advmod |
When,administered |
| R13 |
T610 |
T609 |
amod |
nephrogenic,insipidus |
| R130 |
T736 |
T737 |
advmod |
exactly,recapitulate |
| R1300 |
T9356 |
T9355 |
punct |
", ",is |
| R1301 |
T9357 |
T9358 |
compound |
urine,concentration |
| R1302 |
T9358 |
T9355 |
nsubj |
concentration,is |
| R1303 |
T9359 |
T9355 |
prep |
under,is |
| R1304 |
T9360 |
T9361 |
det |
the,control |
| R1305 |
T9361 |
T9359 |
pobj |
control,under |
| R1306 |
T9414 |
T9415 |
advcl |
administered,leads |
| R1307 |
T9362 |
T9361 |
prep |
of,control |
| R1308 |
T9363 |
T9364 |
det |
the,hypothalamus |
| R1309 |
T9364 |
T9362 |
pobj |
hypothalamus,of |
| R131 |
T737 |
T722 |
conj |
recapitulate,survive |
| R1310 |
T9365 |
T9364 |
punct |
", ",hypothalamus |
| R1311 |
T9416 |
T9414 |
prep |
to,administered |
| R1312 |
T9366 |
T9367 |
dep |
which,secretes |
| R1313 |
T9367 |
T9364 |
relcl |
secretes,hypothalamus |
| R1314 |
T9368 |
T9367 |
punct |
", ",secretes |
| R1315 |
T9369 |
T9367 |
prep |
in,secretes |
| R1316 |
T9417 |
T9418 |
amod |
wild,type |
| R1317 |
T9370 |
T9369 |
pobj |
response,in |
| R1318 |
T9371 |
T9370 |
prep |
to,response |
| R1319 |
T9372 |
T9371 |
pobj |
hypovolemia,to |
| R132 |
T738 |
T739 |
det |
the,disorder |
| R1320 |
T9373 |
T9372 |
cc |
or,hypovolemia |
| R1321 |
T9374 |
T9372 |
conj |
hypernatremia,hypovolemia |
| R1322 |
T9375 |
T9376 |
punct |
[,21 |
| R1323 |
T9418 |
T9420 |
compound |
type,mice |
| R1324 |
T9376 |
T9370 |
parataxis |
21,response |
| R1325 |
T9377 |
T9376 |
punct |
],21 |
| R1326 |
T9378 |
T9367 |
punct |
", ",secretes |
| R1327 |
T9379 |
T9367 |
dobj |
AVP,secretes |
| R1328 |
T9419 |
T9418 |
punct |
-,type |
| R1329 |
T9380 |
T9355 |
punct |
.,is |
| R133 |
T739 |
T737 |
dobj |
disorder,recapitulate |
| R1330 |
T9382 |
T9383 |
det |
The,analog |
| R1331 |
T9420 |
T9416 |
pobj |
mice,to |
| R1332 |
T9383 |
T9386 |
nsubj |
analog,is |
| R1333 |
T9384 |
T9383 |
amod |
synthetic,analog |
| R1334 |
T9421 |
T9415 |
punct |
", ",leads |
| R1335 |
T9385 |
T9383 |
compound |
AVP,analog |
| R1336 |
T9387 |
T9383 |
punct |
", ",analog |
| R1337 |
T9422 |
T9415 |
nsubj |
dDAVP,leads |
| R1338 |
T9388 |
T9389 |
nummod |
1,deamino |
| R1339 |
T9389 |
T9391 |
nmod |
deamino,arginine |
| R134 |
T740 |
T739 |
amod |
human,disorder |
| R1340 |
T9390 |
T9389 |
punct |
-,deamino |
| R1341 |
T9423 |
T9415 |
prep |
to,leads |
| R1342 |
T9424 |
T9425 |
det |
a,increase |
| R1343 |
T9391 |
T9397 |
compound |
arginine,vasopressin |
| R1344 |
T9425 |
T9423 |
pobj |
increase,to |
| R1345 |
T9392 |
T9391 |
punct |
-,arginine |
| R1346 |
T9393 |
T9391 |
nummod |
8,arginine |
| R1347 |
T9426 |
T9425 |
amod |
dramatic,increase |
| R1348 |
T9394 |
T9391 |
punct |
-,arginine |
| R1349 |
T9395 |
T9391 |
compound |
D,arginine |
| R135 |
T741 |
T722 |
punct |
.,survive |
| R1350 |
T9396 |
T9391 |
punct |
-,arginine |
| R1351 |
T9427 |
T9425 |
prep |
in,increase |
| R1352 |
T9397 |
T9383 |
appos |
vasopressin,analog |
| R1353 |
T9398 |
T9397 |
punct |
(,vasopressin |
| R1354 |
T9399 |
T9397 |
appos |
dDAVP,vasopressin |
| R1355 |
T9428 |
T9429 |
compound |
urine,concentration |
| R1356 |
T9400 |
T9397 |
punct |
;,vasopressin |
| R1357 |
T9401 |
T9402 |
advmod |
also,called |
| R1358 |
T9402 |
T9397 |
acl |
called,vasopressin |
| R1359 |
T9429 |
T9427 |
pobj |
concentration,in |
| R136 |
T743 |
T744 |
amod |
Previous,experiments |
| R1360 |
T9430 |
T9425 |
punct |
", ",increase |
| R1361 |
T9431 |
T9425 |
prep |
from,increase |
| R1362 |
T9432 |
T9431 |
pobj |
"1,293",from |
| R1363 |
T9509 |
T9510 |
dep |
which,be |
| R1364 |
T9510 |
T9505 |
relcl |
be,channel |
| R1365 |
T9433 |
T9431 |
prep |
to,from |
| R1366 |
T9511 |
T9510 |
aux |
must,be |
| R1367 |
T9512 |
T9510 |
acomp |
sufficient,be |
| R1368 |
T9513 |
T9514 |
aux |
to,allow |
| R1369 |
T9434 |
T9433 |
pobj |
"5,885",to |
| R137 |
T744 |
T747 |
nsubj |
experiments,suggest |
| R1370 |
T9514 |
T9512 |
xcomp |
allow,sufficient |
| R1371 |
T9515 |
T9514 |
dobj |
survival,allow |
| R1372 |
T9516 |
T9515 |
prep |
of,survival |
| R1373 |
T9517 |
T9518 |
det |
the,individual |
| R1374 |
T9518 |
T9516 |
pobj |
individual,of |
| R1375 |
T9519 |
T9497 |
punct |
", ",indicates |
| R1376 |
T9435 |
T9431 |
pobj |
mOsm,from |
| R1377 |
T9520 |
T9497 |
prep |
in,indicates |
| R1378 |
T9521 |
T9520 |
pobj |
contrast,in |
| R1379 |
T9522 |
T9521 |
prep |
to,contrast |
| R138 |
T745 |
T746 |
advmod |
in,vitro |
| R1380 |
T9436 |
T9437 |
punct |
(,Figure |
| R1381 |
T9523 |
T9524 |
det |
the,mouse |
| R1382 |
T9524 |
T9522 |
pobj |
mouse,to |
| R1383 |
T9437 |
T9415 |
parataxis |
Figure,leads |
| R1384 |
T9525 |
T9524 |
nmod |
T126M,mouse |
| R1385 |
T9526 |
T9524 |
amod |
knock,mouse |
| R1386 |
T9527 |
T9526 |
punct |
-,knock |
| R1387 |
T9528 |
T9526 |
prt |
in,knock |
| R1388 |
T9438 |
T9437 |
advmod |
4.6-fold,Figure |
| R1389 |
T9529 |
T9530 |
punct |
[,18 |
| R139 |
T746 |
T744 |
amod |
vitro,experiments |
| R1390 |
T9530 |
T9497 |
parataxis |
18,indicates |
| R1391 |
T9531 |
T9530 |
punct |
],18 |
| R1392 |
T9439 |
T9437 |
punct |
;,Figure |
| R1393 |
T9532 |
T9497 |
punct |
.,indicates |
| R1394 |
T9534 |
T9535 |
amod |
Multiple,matings |
| R1395 |
T9440 |
T9437 |
nummod |
1D,Figure |
| R1396 |
T9535 |
T9537 |
nsubj |
matings,yielded |
| R1397 |
T9536 |
T9535 |
amod |
heterozygous,matings |
| R1398 |
T9441 |
T9437 |
punct |
),Figure |
| R1399 |
T9538 |
T9539 |
nummod |
101,animals |
| R14 |
T611 |
T609 |
compound |
diabetes,insipidus |
| R140 |
T748 |
T744 |
acl |
using,experiments |
| R1400 |
T9539 |
T9537 |
dobj |
animals,yielded |
| R1401 |
T9442 |
T9415 |
punct |
.,leads |
| R1402 |
T9540 |
T9539 |
punct |
", ",animals |
| R1403 |
T9541 |
T9542 |
dep |
which,appeared |
| R1404 |
T9542 |
T9539 |
relcl |
appeared,animals |
| R1405 |
T9543 |
T9542 |
prep |
at,appeared |
| R1406 |
T9444 |
T9445 |
prep |
With,concentrate |
| R1407 |
T9544 |
T9545 |
det |
a,ratio |
| R1408 |
T9545 |
T9543 |
pobj |
ratio,at |
| R1409 |
T9546 |
T9545 |
prep |
of,ratio |
| R141 |
T749 |
T750 |
amod |
renal,lines |
| R1410 |
T9547 |
T9546 |
pobj |
26,of |
| R1411 |
T9446 |
T9447 |
amod |
similar,treatment |
| R1412 |
T9548 |
T9549 |
punct |
:,49 |
| R1413 |
T9549 |
T9547 |
prep |
49,26 |
| R1414 |
T9550 |
T9551 |
punct |
:,26 |
| R1415 |
T9447 |
T9444 |
pobj |
treatment,With |
| R1416 |
T9551 |
T9547 |
prep |
26,26 |
| R1417 |
T9552 |
T9542 |
punct |
", ",appeared |
| R1418 |
T9553 |
T9542 |
prep |
near,appeared |
| R1419 |
T9448 |
T9445 |
punct |
", ",concentrate |
| R142 |
T750 |
T748 |
dobj |
lines,using |
| R1420 |
T9554 |
T9555 |
det |
the,frequencies |
| R1421 |
T9555 |
T9553 |
pobj |
frequencies,near |
| R1422 |
T9556 |
T9555 |
amod |
expected,frequencies |
| R1423 |
T9557 |
T9558 |
amod |
Mendelian,type |
| R1424 |
T9558 |
T9555 |
nmod |
type,frequencies |
| R1425 |
T9559 |
T9558 |
amod |
wild,type |
| R1426 |
T9449 |
T9450 |
compound |
mutant,mice |
| R1427 |
T9560 |
T9558 |
punct |
", ",type |
| R1428 |
T9561 |
T9558 |
conj |
heterozygote,type |
| R1429 |
T9562 |
T9561 |
punct |
", ",heterozygote |
| R143 |
T751 |
T750 |
compound |
cell,lines |
| R1430 |
T9450 |
T9445 |
nsubj |
mice,concentrate |
| R1431 |
T9563 |
T9561 |
cc |
and,heterozygote |
| R1432 |
T9564 |
T9561 |
conj |
mutant,heterozygote |
| R1433 |
T9565 |
T9542 |
punct |
", ",appeared |
| R1434 |
T9451 |
T9452 |
poss |
their,urine |
| R1435 |
T9566 |
T9542 |
advmod |
respectively,appeared |
| R1436 |
T9567 |
T9537 |
punct |
", ",yielded |
| R1437 |
T9452 |
T9445 |
dobj |
urine,concentrate |
| R1438 |
T9568 |
T9537 |
advcl |
indicating,yielded |
| R1439 |
T9569 |
T9570 |
mark |
that,is |
| R144 |
T752 |
T753 |
amod |
recessive,mutations |
| R1440 |
T9570 |
T9568 |
ccomp |
is,indicating |
| R1441 |
T9571 |
T9570 |
expl |
there,is |
| R1442 |
T9453 |
T9445 |
prep |
to,concentrate |
| R1443 |
T9572 |
T9573 |
det |
no,viability |
| R1444 |
T9573 |
T9570 |
attr |
viability,is |
| R1445 |
T9454 |
T9455 |
det |
a,extent |
| R1446 |
T9574 |
T9573 |
amod |
reduced,viability |
| R1447 |
T9575 |
T9573 |
acl |
associated,viability |
| R1448 |
T9576 |
T9575 |
prep |
with,associated |
| R1449 |
T9455 |
T9453 |
pobj |
extent,to |
| R145 |
T753 |
T755 |
nsubj |
mutations,result |
| R1450 |
T9577 |
T9578 |
det |
this,mutation |
| R1451 |
T9578 |
T9576 |
pobj |
mutation,with |
| R1452 |
T9579 |
T9537 |
punct |
.,yielded |
| R1453 |
T9456 |
T9455 |
amod |
lesser,extent |
| R1454 |
T9581 |
T9582 |
amod |
Other,was |
| R1455 |
T9457 |
T9456 |
cc |
but,lesser |
| R1456 |
T9583 |
T9581 |
prep |
than,Other |
| R1457 |
T9458 |
T9459 |
advmod |
still,significant |
| R1458 |
T9459 |
T9456 |
conj |
significant,lesser |
| R1459 |
T9584 |
T9585 |
det |
the,production |
| R146 |
T754 |
T753 |
compound |
Aqp2,mutations |
| R1460 |
T9585 |
T9583 |
pobj |
production,than |
| R1461 |
T9586 |
T9585 |
amod |
increased,production |
| R1462 |
T9460 |
T9445 |
punct |
", ",concentrate |
| R1463 |
T9587 |
T9585 |
compound |
urine,production |
| R1464 |
T9588 |
T9585 |
cc |
and,production |
| R1465 |
T9589 |
T9590 |
compound |
water,intake |
| R1466 |
T9461 |
T9445 |
prep |
from,concentrate |
| R1467 |
T9590 |
T9585 |
conj |
intake,production |
| R1468 |
T9591 |
T9582 |
punct |
", ",was |
| R1469 |
T9592 |
T9582 |
expl |
there,was |
| R147 |
T755 |
T747 |
advcl |
result,suggest |
| R1470 |
T9462 |
T9461 |
pobj |
161,from |
| R1471 |
T9593 |
T9594 |
det |
no,phenotype |
| R1472 |
T9594 |
T9582 |
attr |
phenotype,was |
| R1473 |
T9463 |
T9461 |
prep |
to,from |
| R1474 |
T9595 |
T9594 |
amod |
overt,phenotype |
| R1475 |
T9596 |
T9594 |
prep |
in,phenotype |
| R1476 |
T9597 |
T9598 |
compound |
mutant,mice |
| R1477 |
T9598 |
T9596 |
pobj |
mice,in |
| R1478 |
T9599 |
T9594 |
punct |
", ",phenotype |
| R1479 |
T9600 |
T9594 |
prep |
save,phenotype |
| R148 |
T756 |
T755 |
prep |
in,result |
| R1480 |
T9464 |
T9463 |
pobj |
470,to |
| R1481 |
T9601 |
T9602 |
amod |
distended,kidneys |
| R1482 |
T9602 |
T9600 |
pobj |
kidneys,save |
| R1483 |
T9603 |
T9602 |
punct |
", ",kidneys |
| R1484 |
T9465 |
T9461 |
pobj |
mOsm,from |
| R1485 |
T9604 |
T9605 |
dep |
which,appeared |
| R1486 |
T9605 |
T9602 |
relcl |
appeared,kidneys |
| R1487 |
T9606 |
T9605 |
advmod |
variably,appeared |
| R1488 |
T9466 |
T9467 |
punct |
(,2.9-fold |
| R1489 |
T9607 |
T9605 |
prep |
in,appeared |
| R149 |
T757 |
T758 |
amod |
improper,trafficking |
| R1490 |
T9608 |
T9609 |
amod |
adult,animals |
| R1491 |
T9609 |
T9607 |
pobj |
animals,in |
| R1492 |
T9467 |
T9461 |
parataxis |
2.9-fold,from |
| R1493 |
T9610 |
T9611 |
punct |
(,Figure |
| R1494 |
T9611 |
T9582 |
parataxis |
Figure,was |
| R1495 |
T9612 |
T9611 |
nummod |
2A,Figure |
| R1496 |
T9468 |
T9467 |
punct |
),2.9-fold |
| R1497 |
T9613 |
T9611 |
punct |
),Figure |
| R1498 |
T9614 |
T9582 |
punct |
.,was |
| R1499 |
T9469 |
T9445 |
punct |
", ",concentrate |
| R15 |
T613 |
T609 |
punct |
(,insipidus |
| R150 |
T758 |
T756 |
pobj |
trafficking,in |
| R1500 |
T9470 |
T9445 |
advcl |
indicating,concentrate |
| R1501 |
T9471 |
T9472 |
mark |
that,are |
| R1502 |
T9616 |
T9617 |
mark |
Although,measured |
| R1503 |
T9472 |
T9470 |
ccomp |
are,indicating |
| R1504 |
T9617 |
T9620 |
advcl |
measured,seem |
| R1505 |
T9618 |
T9617 |
neg |
not,measured |
| R1506 |
T9619 |
T9617 |
advmod |
specifically,measured |
| R1507 |
T9473 |
T9474 |
det |
these,animals |
| R1508 |
T9621 |
T9620 |
punct |
", ",seem |
| R1509 |
T9622 |
T9623 |
compound |
mutant,mice |
| R151 |
T759 |
T758 |
prep |
of,trafficking |
| R1510 |
T9474 |
T9472 |
nsubj |
animals,are |
| R1511 |
T9623 |
T9620 |
nsubj |
mice,seem |
| R1512 |
T9624 |
T9625 |
aux |
to,have |
| R1513 |
T9625 |
T9620 |
xcomp |
have,seem |
| R1514 |
T9475 |
T9472 |
preconj |
not,are |
| R1515 |
T9626 |
T9627 |
det |
a,lifespan |
| R1516 |
T9627 |
T9625 |
dobj |
lifespan,have |
| R1517 |
T9628 |
T9627 |
amod |
normal,lifespan |
| R1518 |
T9476 |
T9475 |
advmod |
only,not |
| R1519 |
T9629 |
T9620 |
punct |
.,seem |
| R152 |
T760 |
T761 |
det |
the,pore |
| R1520 |
T9477 |
T9472 |
conj |
unable,are |
| R1521 |
T9631 |
T9632 |
det |
The,animal |
| R1522 |
T9632 |
T9634 |
nsubj |
animal,lived |
| R1523 |
T9633 |
T9632 |
nummod |
one,animal |
| R1524 |
T9478 |
T9479 |
aux |
to,concentrate |
| R1525 |
T9635 |
T9636 |
dep |
that,followed |
| R1526 |
T9636 |
T9632 |
relcl |
followed,animal |
| R1527 |
T9637 |
T9636 |
auxpass |
was,followed |
| R1528 |
T9638 |
T9634 |
prep |
to,lived |
| R1529 |
T9639 |
T9640 |
nummod |
18,mo |
| R153 |
T761 |
T759 |
pobj |
pore,of |
| R1530 |
T9479 |
T9477 |
xcomp |
concentrate,unable |
| R1531 |
T9640 |
T9638 |
pobj |
mo,to |
| R1532 |
T9641 |
T9634 |
punct |
", ",lived |
| R1533 |
T9642 |
T9634 |
advcl |
typical,lived |
| R1534 |
T9480 |
T9481 |
poss |
their,urine |
| R1535 |
T9643 |
T9642 |
prep |
for,typical |
| R1536 |
T9644 |
T9643 |
pobj |
animals,for |
| R1537 |
T9645 |
T9644 |
prep |
in,animals |
| R1538 |
T9481 |
T9479 |
dobj |
urine,concentrate |
| R1539 |
T9646 |
T9647 |
poss |
our,colony |
| R154 |
T762 |
T761 |
amod |
mutant,pore |
| R1540 |
T9647 |
T9645 |
pobj |
colony,in |
| R1541 |
T9648 |
T9634 |
punct |
.,lived |
| R1542 |
T9482 |
T9479 |
advmod |
properly,concentrate |
| R1543 |
T9650 |
T9651 |
compound |
Aqp2F204V,F204V |
| R1544 |
T9651 |
T9653 |
compound |
F204V,mice |
| R1545 |
T9483 |
T9472 |
cc |
but,are |
| R1546 |
T9652 |
T9651 |
punct |
/,F204V |
| R1547 |
T9653 |
T9654 |
nsubj |
mice,suffer |
| R1548 |
T9484 |
T9472 |
conj |
are,are |
| R1549 |
T9655 |
T9654 |
prep |
from,suffer |
| R155 |
T763 |
T761 |
compound |
water,pore |
| R1550 |
T9656 |
T9657 |
amod |
severe,hydronephrosis |
| R1551 |
T9485 |
T9484 |
advmod |
also,are |
| R1552 |
T9657 |
T9655 |
pobj |
hydronephrosis,from |
| R1553 |
T9658 |
T9659 |
punct |
(,2A |
| R1554 |
T9486 |
T9484 |
acomp |
defective,are |
| R1555 |
T9659 |
T9654 |
parataxis |
2A,suffer |
| R1556 |
T9660 |
T9659 |
nmod |
Figure,2A |
| R1557 |
T9661 |
T9659 |
cc |
and,2A |
| R1558 |
T9487 |
T9484 |
prep |
in,are |
| R1559 |
T9662 |
T9659 |
conj |
2B,2A |
| R156 |
T764 |
T747 |
punct |
.,suggest |
| R1560 |
T9663 |
T9659 |
punct |
),2A |
| R1561 |
T9664 |
T9654 |
punct |
", ",suffer |
| R1562 |
T9488 |
T9489 |
poss |
their,response |
| R1563 |
T9665 |
T9666 |
advmod |
presumably,as |
| R1564 |
T9666 |
T9654 |
prep |
as,suffer |
| R1565 |
T9667 |
T9668 |
det |
a,consequence |
| R1566 |
T9489 |
T9487 |
pobj |
response,in |
| R1567 |
T9668 |
T9666 |
pobj |
consequence,as |
| R1568 |
T9669 |
T9668 |
prep |
of,consequence |
| R1569 |
T9490 |
T9489 |
prep |
to,response |
| R157 |
T766 |
T767 |
advcl |
Using,proven |
| R1570 |
T9491 |
T9490 |
pobj |
dDAVP,to |
| R1571 |
T9670 |
T9671 |
det |
an,inability |
| R1572 |
T9492 |
T9445 |
punct |
.,concentrate |
| R1573 |
T9671 |
T9669 |
pobj |
inability,of |
| R1574 |
T9672 |
T9673 |
aux |
to,cope |
| R1575 |
T9673 |
T9671 |
acl |
cope,inability |
| R1576 |
T9494 |
T9495 |
det |
The,response |
| R1577 |
T9674 |
T9673 |
prep |
with,cope |
| R1578 |
T9675 |
T9676 |
det |
the,polyuria |
| R1579 |
T9676 |
T9674 |
pobj |
polyuria,with |
| R158 |
T768 |
T769 |
det |
these,animals |
| R1580 |
T9677 |
T9676 |
amod |
extreme,polyuria |
| R1581 |
T9678 |
T9654 |
punct |
.,suffer |
| R1582 |
T9495 |
T9497 |
nsubj |
response,indicates |
| R1583 |
T9680 |
T9681 |
nsubj |
We,found |
| R1584 |
T9681 |
T9682 |
ccomp |
found,was |
| R1585 |
T9496 |
T9495 |
amod |
smaller,response |
| R1586 |
T9683 |
T9684 |
amod |
distended,kidneys |
| R1587 |
T9684 |
T9681 |
dobj |
kidneys,found |
| R1588 |
T9685 |
T9681 |
prep |
in,found |
| R1589 |
T9498 |
T9495 |
prep |
to,response |
| R159 |
T769 |
T766 |
dobj |
animals,Using |
| R1590 |
T9686 |
T9687 |
det |
all,mice |
| R1591 |
T9687 |
T9685 |
pobj |
mice,in |
| R1592 |
T9688 |
T9689 |
compound |
Aqp2F204V,F204V |
| R1593 |
T9689 |
T9687 |
compound |
F204V,mice |
| R1594 |
T9499 |
T9498 |
pobj |
dDAVP,to |
| R1595 |
T9690 |
T9689 |
punct |
/,F204V |
| R1596 |
T9691 |
T9682 |
punct |
;,was |
| R1597 |
T9692 |
T9682 |
advmod |
however,was |
| R1598 |
T9500 |
T9501 |
det |
some,activity |
| R1599 |
T9693 |
T9682 |
punct |
", ",was |
| R16 |
T614 |
T609 |
appos |
NDI,insipidus |
| R160 |
T770 |
T767 |
punct |
", ",proven |
| R1600 |
T9694 |
T9695 |
det |
the,degree |
| R1601 |
T9695 |
T9682 |
nsubj |
degree,was |
| R1602 |
T9501 |
T9497 |
dobj |
activity,indicates |
| R1603 |
T9696 |
T9695 |
prep |
of,degree |
| R1604 |
T9697 |
T9696 |
pobj |
inflation,of |
| R1605 |
T9502 |
T9501 |
amod |
residual,activity |
| R1606 |
T9698 |
T9682 |
acomp |
variable,was |
| R1607 |
T9699 |
T9682 |
prep |
in,was |
| R1608 |
T9700 |
T9701 |
amod |
affected,mice |
| R1609 |
T9503 |
T9501 |
prep |
of,activity |
| R161 |
T771 |
T767 |
nsubj |
we,proven |
| R1610 |
T9701 |
T9699 |
pobj |
mice,in |
| R1611 |
T9702 |
T9682 |
cc |
and,was |
| R1612 |
T9703 |
T9682 |
conj |
worsened,was |
| R1613 |
T9704 |
T9703 |
prep |
with,worsened |
| R1614 |
T9504 |
T9505 |
det |
the,channel |
| R1615 |
T9705 |
T9704 |
pobj |
age,with |
| R1616 |
T9706 |
T9682 |
punct |
.,was |
| R1617 |
T9505 |
T9503 |
pobj |
channel,of |
| R1618 |
T9708 |
T9709 |
amod |
Severe,hydronephrosis |
| R1619 |
T9709 |
T9710 |
nsubjpass |
hydronephrosis,observed |
| R162 |
T772 |
T767 |
aux |
have,proven |
| R1620 |
T9506 |
T9505 |
compound |
mutant,channel |
| R1621 |
T9711 |
T9710 |
aux |
has,observed |
| R1622 |
T9712 |
T9710 |
advmod |
previously,observed |
| R1623 |
T9507 |
T9505 |
compound |
AQP2,channel |
| R1624 |
T9713 |
T9710 |
auxpass |
been,observed |
| R1625 |
T9714 |
T9710 |
prep |
in,observed |
| R1626 |
T9715 |
T9716 |
amod |
double,knock |
| R1627 |
T9508 |
T9505 |
punct |
", ",channel |
| R1628 |
T9716 |
T9720 |
amod |
knock,mice |
| R1629 |
T9717 |
T9718 |
compound |
Aqp1,Aqp3 |
| R163 |
T773 |
T767 |
advmod |
directly,proven |
| R1630 |
T9718 |
T9716 |
npadvmod |
Aqp3,knock |
| R1631 |
T9719 |
T9718 |
punct |
/,Aqp3 |
| R1632 |
T9720 |
T9714 |
pobj |
mice,in |
| R1633 |
T9827 |
T9828 |
det |
the,features |
| R1634 |
T9721 |
T9716 |
punct |
-,knock |
| R1635 |
T9828 |
T9825 |
nsubj |
features,were |
| R1636 |
T9722 |
T9716 |
prt |
out,knock |
| R1637 |
T9723 |
T9724 |
punct |
[,17 |
| R1638 |
T9829 |
T9828 |
amod |
morphologic,features |
| R1639 |
T9724 |
T9710 |
parataxis |
17,observed |
| R164 |
T774 |
T775 |
det |
this,hypothesis |
| R1640 |
T9725 |
T9724 |
punct |
],17 |
| R1641 |
T9726 |
T9710 |
punct |
", ",observed |
| R1642 |
T9830 |
T9828 |
prep |
of,features |
| R1643 |
T9727 |
T9710 |
cc |
and,observed |
| R1644 |
T9728 |
T9710 |
conj |
appears,observed |
| R1645 |
T9729 |
T9728 |
prep |
at,appears |
| R1646 |
T9831 |
T9832 |
det |
the,glomeruli |
| R1647 |
T9730 |
T9731 |
nummod |
6,wk |
| R1648 |
T9731 |
T9729 |
pobj |
wk,at |
| R1649 |
T9732 |
T9710 |
punct |
.,observed |
| R165 |
T775 |
T767 |
dobj |
hypothesis,proven |
| R1650 |
T9832 |
T9830 |
pobj |
glomeruli,of |
| R1651 |
T9734 |
T9735 |
advmod |
Even,at |
| R1652 |
T9833 |
T9832 |
cc |
and,glomeruli |
| R1653 |
T9735 |
T9736 |
prep |
at,had |
| R1654 |
T9737 |
T9738 |
nummod |
4,wk |
| R1655 |
T9834 |
T9835 |
amod |
proximal,distal |
| R1656 |
T9738 |
T9735 |
pobj |
wk,at |
| R1657 |
T9739 |
T9736 |
punct |
", ",had |
| R1658 |
T9835 |
T9837 |
amod |
distal,tubules |
| R1659 |
T9740 |
T9741 |
compound |
Aqp2F204V,F204V |
| R166 |
T776 |
T775 |
prep |
of,hypothesis |
| R1660 |
T9741 |
T9743 |
compound |
F204V,mice |
| R1661 |
T9742 |
T9741 |
punct |
/,F204V |
| R1662 |
T9743 |
T9736 |
nsubj |
mice,had |
| R1663 |
T9836 |
T9835 |
punct |
/,distal |
| R1664 |
T9744 |
T9736 |
dobj |
hydronephrosis,had |
| R1665 |
T9745 |
T9736 |
punct |
.,had |
| R1666 |
T9837 |
T9832 |
conj |
tubules,glomeruli |
| R1667 |
T9747 |
T9748 |
amod |
Histologic,sections |
| R1668 |
T9748 |
T9749 |
nsubj |
sections,demonstrated |
| R1669 |
T9838 |
T9825 |
acomp |
unremarkable,were |
| R167 |
T777 |
T778 |
amod |
improper,translocation |
| R1670 |
T9750 |
T9748 |
prep |
from,sections |
| R1671 |
T9751 |
T9752 |
compound |
Aqp2F204V,F204V |
| R1672 |
T9839 |
T9840 |
punct |
(,Figure |
| R1673 |
T9752 |
T9754 |
compound |
F204V,mice |
| R1674 |
T9753 |
T9752 |
punct |
/,F204V |
| R1675 |
T9754 |
T9750 |
pobj |
mice,from |
| R1676 |
T9840 |
T9825 |
parataxis |
Figure,were |
| R1677 |
T9755 |
T9756 |
amod |
marked,dilatation |
| R1678 |
T9756 |
T9749 |
dobj |
dilatation,demonstrated |
| R1679 |
T9841 |
T9840 |
nummod |
2D,Figure |
| R168 |
T778 |
T776 |
pobj |
translocation,of |
| R1680 |
T9757 |
T9756 |
prep |
of,dilatation |
| R1681 |
T9758 |
T9759 |
det |
the,pelvis |
| R1682 |
T9842 |
T9840 |
punct |
),Figure |
| R1683 |
T9759 |
T9757 |
pobj |
pelvis,of |
| R1684 |
T9760 |
T9759 |
amod |
renal,pelvis |
| R1685 |
T9761 |
T9756 |
cc |
yet,dilatation |
| R1686 |
T9762 |
T9763 |
amod |
normal,morphology |
| R1687 |
T9843 |
T9825 |
punct |
.,were |
| R1688 |
T9763 |
T9756 |
conj |
morphology,dilatation |
| R1689 |
T9764 |
T9763 |
prep |
of,morphology |
| R169 |
T779 |
T778 |
compound |
AQP2,translocation |
| R1690 |
T9765 |
T9766 |
det |
the,ureter |
| R1691 |
T9845 |
T9846 |
mark |
As,shown |
| R1692 |
T9766 |
T9764 |
pobj |
ureter,of |
| R1693 |
T9767 |
T9768 |
punct |
(,2C |
| R1694 |
T9768 |
T9749 |
parataxis |
2C,demonstrated |
| R1695 |
T9846 |
T9847 |
advcl |
shown,revealed |
| R1696 |
T9769 |
T9768 |
nmod |
Figure,2C |
| R1697 |
T9770 |
T9768 |
cc |
and,2C |
| R1698 |
T9771 |
T9768 |
conj |
2D,2C |
| R1699 |
T9848 |
T9846 |
advmod |
previously,shown |
| R17 |
T615 |
T609 |
punct |
),insipidus |
| R170 |
T780 |
T778 |
prep |
as,translocation |
| R1700 |
T9772 |
T9768 |
punct |
),2C |
| R1701 |
T9773 |
T9749 |
punct |
.,demonstrated |
| R1702 |
T9849 |
T9850 |
punct |
[,22 |
| R1703 |
T9775 |
T9776 |
prep |
In,was |
| R1704 |
T9777 |
T9775 |
amod |
particular,In |
| R1705 |
T9778 |
T9776 |
punct |
", ",was |
| R1706 |
T9779 |
T9780 |
det |
the,propria |
| R1707 |
T9850 |
T9846 |
parataxis |
22,shown |
| R1708 |
T9780 |
T9776 |
nsubj |
propria,was |
| R1709 |
T9781 |
T9780 |
compound |
muscularis,propria |
| R171 |
T781 |
T782 |
det |
the,defect |
| R1710 |
T9782 |
T9783 |
preconj |
neither,hypertrophied |
| R1711 |
T9851 |
T9850 |
nummod |
18,22 |
| R1712 |
T9852 |
T9850 |
punct |
",",22 |
| R1713 |
T9783 |
T9776 |
acomp |
hypertrophied,was |
| R1714 |
T9853 |
T9850 |
punct |
],22 |
| R1715 |
T9784 |
T9783 |
cc |
nor,hypertrophied |
| R1716 |
T9785 |
T9783 |
conj |
thinned,hypertrophied |
| R1717 |
T9854 |
T9847 |
punct |
", ",revealed |
| R1718 |
T9786 |
T9776 |
punct |
.,was |
| R1719 |
T9855 |
T9847 |
nsubj |
immunoblotting,revealed |
| R172 |
T782 |
T780 |
pobj |
defect,as |
| R1720 |
T9788 |
T9789 |
expl |
There,was |
| R1721 |
T9790 |
T9791 |
det |
the,appearance |
| R1722 |
T9856 |
T9857 |
nummod |
three,forms |
| R1723 |
T9791 |
T9789 |
attr |
appearance,was |
| R1724 |
T9792 |
T9791 |
amod |
normal,appearance |
| R1725 |
T9857 |
T9847 |
dobj |
forms,revealed |
| R1726 |
T9793 |
T9791 |
amod |
festooned,appearance |
| R1727 |
T9794 |
T9791 |
prep |
of,appearance |
| R1728 |
T9795 |
T9796 |
det |
the,urothelium |
| R1729 |
T9796 |
T9794 |
pobj |
urothelium,of |
| R173 |
T783 |
T782 |
amod |
molecular,defect |
| R1730 |
T9858 |
T9857 |
amod |
different,forms |
| R1731 |
T9797 |
T9789 |
punct |
", ",was |
| R1732 |
T9798 |
T9789 |
cc |
and,was |
| R1733 |
T9859 |
T9857 |
prep |
of,forms |
| R1734 |
T9799 |
T9800 |
det |
this,epithelium |
| R1735 |
T9800 |
T9802 |
nsubj |
epithelium,was |
| R1736 |
T9801 |
T9800 |
amod |
transitional,epithelium |
| R1737 |
T9802 |
T9789 |
conj |
was,was |
| R1738 |
T9803 |
T9802 |
prep |
of,was |
| R1739 |
T9804 |
T9805 |
amod |
normal,thickness |
| R174 |
T784 |
T782 |
prep |
in,defect |
| R1740 |
T9860 |
T9859 |
pobj |
AQP2,of |
| R1741 |
T9805 |
T9803 |
pobj |
thickness,of |
| R1742 |
T9806 |
T9802 |
punct |
.,was |
| R1743 |
T9861 |
T9847 |
punct |
", ",revealed |
| R1744 |
T9808 |
T9809 |
expl |
There,was |
| R1745 |
T9810 |
T9809 |
attr |
thinning,was |
| R1746 |
T9862 |
T9847 |
prep |
due,revealed |
| R1747 |
T9811 |
T9810 |
prep |
of,thinning |
| R1748 |
T9812 |
T9813 |
det |
the,kidney |
| R1749 |
T9813 |
T9811 |
pobj |
kidney,of |
| R175 |
T785 |
T786 |
amod |
nephrogenic,insipidus |
| R1750 |
T9863 |
T9862 |
pcomp |
to,due |
| R1751 |
T9814 |
T9815 |
mark |
as,measured |
| R1752 |
T9815 |
T9809 |
advcl |
measured,was |
| R1753 |
T9816 |
T9815 |
prep |
from,measured |
| R1754 |
T9864 |
T9865 |
amod |
different,degrees |
| R1755 |
T9817 |
T9818 |
amod |
renal,capsule |
| R1756 |
T9818 |
T9816 |
pobj |
capsule,from |
| R1757 |
T9819 |
T9816 |
prep |
to,from |
| R1758 |
T9865 |
T9862 |
pobj |
degrees,due |
| R1759 |
T9820 |
T9821 |
amod |
renal,pelvis |
| R176 |
T786 |
T784 |
pobj |
insipidus,in |
| R1760 |
T9821 |
T9819 |
pobj |
pelvis,to |
| R1761 |
T9866 |
T9865 |
cc |
and,degrees |
| R1762 |
T9822 |
T9809 |
punct |
.,was |
| R1763 |
T9824 |
T9825 |
advmod |
However,were |
| R1764 |
T9867 |
T9865 |
conj |
forms,degrees |
| R1765 |
T9826 |
T9825 |
punct |
", ",were |
| R1766 |
T9868 |
T9865 |
prep |
of,degrees |
| R1767 |
T9869 |
T9868 |
pobj |
glycosylation,of |
| R1768 |
T9870 |
T9871 |
punct |
(,Figure |
| R1769 |
T9871 |
T9847 |
parataxis |
Figure,revealed |
| R177 |
T787 |
T786 |
compound |
diabetes,insipidus |
| R1770 |
T9872 |
T9871 |
nummod |
3A,Figure |
| R1771 |
T9933 |
T9932 |
punct |
],22 |
| R1772 |
T9873 |
T9871 |
punct |
),Figure |
| R1773 |
T9934 |
T9911 |
punct |
.,is |
| R1774 |
T9874 |
T9847 |
punct |
.,revealed |
| R1775 |
T9936 |
T9937 |
prep |
Compared,reduced |
| R1776 |
T9876 |
T9877 |
amod |
Previous,reports |
| R1777 |
T9938 |
T9936 |
prep |
to,Compared |
| R1778 |
T9939 |
T9938 |
pobj |
that,to |
| R1779 |
T9940 |
T9939 |
prep |
from,that |
| R178 |
T788 |
T782 |
prep |
in,defect |
| R1780 |
T9941 |
T9942 |
det |
the,kidneys |
| R1781 |
T9877 |
T9878 |
nsubj |
reports,demonstrated |
| R1782 |
T9942 |
T9940 |
pobj |
kidneys,from |
| R1783 |
T9943 |
T9942 |
prep |
of,kidneys |
| R1784 |
T9879 |
T9878 |
aux |
have,demonstrated |
| R1785 |
T9944 |
T9945 |
amod |
wild,type |
| R1786 |
T9945 |
T9947 |
compound |
type,animals |
| R1787 |
T9946 |
T9945 |
punct |
-,type |
| R1788 |
T9947 |
T9943 |
pobj |
animals,of |
| R1789 |
T9948 |
T9937 |
punct |
", ",reduced |
| R179 |
T789 |
T790 |
det |
the,organism |
| R1790 |
T9949 |
T9937 |
nsubjpass |
AQP2,reduced |
| R1791 |
T9880 |
T9881 |
mark |
that,appears |
| R1792 |
T9950 |
T9949 |
prep |
from,AQP2 |
| R1793 |
T9951 |
T9952 |
compound |
mutant,animals |
| R1794 |
T9952 |
T9950 |
pobj |
animals,from |
| R1795 |
T9881 |
T9878 |
ccomp |
appears,demonstrated |
| R1796 |
T9953 |
T9937 |
auxpass |
was,reduced |
| R1797 |
T9954 |
T9937 |
prep |
in,reduced |
| R1798 |
T9955 |
T9956 |
preconj |
both,form |
| R1799 |
T9882 |
T9883 |
amod |
nonglycosylated,protein |
| R18 |
T616 |
T617 |
det |
a,disease |
| R180 |
T790 |
T788 |
pobj |
organism,in |
| R1800 |
T9956 |
T9954 |
pobj |
form,in |
| R1801 |
T9957 |
T9956 |
det |
the,form |
| R1802 |
T9883 |
T9881 |
nsubj |
protein,appears |
| R1803 |
T9958 |
T9959 |
amod |
high,weight |
| R1804 |
T9959 |
T9956 |
nmod |
weight,form |
| R1805 |
T9960 |
T9959 |
amod |
molecular,weight |
| R1806 |
T9884 |
T9881 |
prep |
as,appears |
| R1807 |
T9961 |
T9956 |
punct |
", ",form |
| R1808 |
T9962 |
T9956 |
amod |
diffuse,form |
| R1809 |
T9963 |
T9956 |
cc |
and,form |
| R181 |
T791 |
T790 |
amod |
intact,organism |
| R1810 |
T9885 |
T9886 |
det |
a,band |
| R1811 |
T9964 |
T9965 |
det |
the,form |
| R1812 |
T9965 |
T9956 |
conj |
form,form |
| R1813 |
T9966 |
T9967 |
amod |
lowest,weight |
| R1814 |
T9886 |
T9884 |
pobj |
band,as |
| R1815 |
T9967 |
T9965 |
compound |
weight,form |
| R1816 |
T9968 |
T9967 |
amod |
molecular,weight |
| R1817 |
T9969 |
T9937 |
punct |
", ",reduced |
| R1818 |
T9887 |
T9888 |
nummod |
29,kDa |
| R1819 |
T9970 |
T9937 |
cc |
but,reduced |
| R182 |
T792 |
T767 |
punct |
.,proven |
| R1820 |
T9971 |
T9937 |
conj |
enriched,reduced |
| R1821 |
T9888 |
T9886 |
compound |
kDa,band |
| R1822 |
T9972 |
T9971 |
prep |
in,enriched |
| R1823 |
T9973 |
T9974 |
det |
the,form |
| R1824 |
T9974 |
T9972 |
pobj |
form,in |
| R1825 |
T9889 |
T9881 |
punct |
", ",appears |
| R1826 |
T9975 |
T9976 |
amod |
intermediate,weight |
| R1827 |
T9976 |
T9974 |
compound |
weight,form |
| R1828 |
T9977 |
T9976 |
amod |
molecular,weight |
| R1829 |
T9890 |
T9891 |
mark |
while,runs |
| R183 |
T794 |
T795 |
advmod |
Additionally,show |
| R1830 |
T9978 |
T9979 |
punct |
(,Figure |
| R1831 |
T9979 |
T9971 |
parataxis |
Figure,enriched |
| R1832 |
T9980 |
T9979 |
nummod |
3A,Figure |
| R1833 |
T9891 |
T9881 |
advcl |
runs,appears |
| R1834 |
T9981 |
T9979 |
punct |
),Figure |
| R1835 |
T9982 |
T9937 |
punct |
.,reduced |
| R1836 |
T9892 |
T9893 |
amod |
complex,protein |
| R1837 |
T9984 |
T9985 |
amod |
Heterozygous,animals |
| R1838 |
T9985 |
T9986 |
nsubj |
animals,showed |
| R1839 |
T9987 |
T9988 |
amod |
intermediate,amounts |
| R184 |
T796 |
T795 |
punct |
", ",show |
| R1840 |
T9988 |
T9986 |
dobj |
amounts,showed |
| R1841 |
T9893 |
T9891 |
nsubj |
protein,runs |
| R1842 |
T9989 |
T9988 |
prep |
of,amounts |
| R1843 |
T9990 |
T9991 |
det |
all,forms |
| R1844 |
T9991 |
T9989 |
pobj |
forms,of |
| R1845 |
T9894 |
T9893 |
amod |
glycosylated,protein |
| R1846 |
T9992 |
T9991 |
nummod |
three,forms |
| R1847 |
T9993 |
T9986 |
punct |
.,showed |
| R1848 |
T9895 |
T9891 |
prep |
as,runs |
| R1849 |
T9995 |
T9996 |
det |
The,nature |
| R185 |
T797 |
T795 |
advcl |
using,show |
| R1850 |
T9996 |
T9997 |
nsubjpass |
nature,revealed |
| R1851 |
T9896 |
T9897 |
det |
a,smear |
| R1852 |
T9998 |
T9996 |
prep |
of,nature |
| R1853 |
T9999 |
T10000 |
det |
these,forms |
| R1854 |
T9897 |
T9895 |
pobj |
smear,as |
| R1855 |
T10000 |
T9998 |
pobj |
forms,of |
| R1856 |
T10001 |
T10000 |
amod |
glycosylated,forms |
| R1857 |
T9898 |
T9897 |
prep |
between,smear |
| R1858 |
T10002 |
T9997 |
auxpass |
was,revealed |
| R1859 |
T10003 |
T9997 |
prep |
by,revealed |
| R186 |
T798 |
T799 |
det |
a,line |
| R1860 |
T10004 |
T10003 |
pobj |
digestion,by |
| R1861 |
T9899 |
T9900 |
nummod |
35,kDa |
| R1862 |
T10005 |
T10004 |
prep |
with,digestion |
| R1863 |
T10006 |
T10007 |
compound |
endoglycosidase,H |
| R1864 |
T10007 |
T10005 |
pobj |
H,with |
| R1865 |
T9900 |
T9898 |
pobj |
kDa,between |
| R1866 |
T10008 |
T10007 |
punct |
", ",H |
| R1867 |
T10009 |
T10010 |
dep |
which,cleaves |
| R1868 |
T9901 |
T9899 |
cc |
and,35 |
| R1869 |
T10010 |
T10007 |
relcl |
cleaves,H |
| R187 |
T799 |
T797 |
dobj |
line,using |
| R1870 |
T10011 |
T10010 |
advmod |
specifically,cleaves |
| R1871 |
T10012 |
T10013 |
npadvmod |
mannose,rich |
| R1872 |
T9902 |
T9899 |
conj |
45,35 |
| R1873 |
T10013 |
T10015 |
amod |
rich,carbohydrate |
| R1874 |
T10014 |
T10013 |
punct |
-,rich |
| R1875 |
T10015 |
T10010 |
dobj |
carbohydrate,cleaves |
| R1876 |
T9903 |
T9878 |
punct |
.,demonstrated |
| R1877 |
T10016 |
T10010 |
prep |
from,cleaves |
| R1878 |
T10017 |
T10018 |
det |
the,backbone |
| R1879 |
T10018 |
T10016 |
pobj |
backbone,from |
| R188 |
T800 |
T799 |
amod |
renal,line |
| R1880 |
T9905 |
T9906 |
det |
A,form |
| R1881 |
T10019 |
T10018 |
compound |
protein,backbone |
| R1882 |
T9906 |
T9911 |
nsubj |
form,is |
| R1883 |
T10020 |
T9997 |
punct |
.,revealed |
| R1884 |
T9907 |
T9908 |
amod |
short,lived |
| R1885 |
T10022 |
T10023 |
nsubj |
Treatment,affected |
| R1886 |
T9908 |
T9906 |
amod |
lived,form |
| R1887 |
T10024 |
T10022 |
prep |
of,Treatment |
| R1888 |
T10025 |
T10026 |
amod |
endogenous,AQP2 |
| R1889 |
T10026 |
T10024 |
pobj |
AQP2,of |
| R189 |
T801 |
T799 |
compound |
cell,line |
| R1890 |
T9909 |
T9908 |
punct |
-,lived |
| R1891 |
T10027 |
T10026 |
prep |
from,AQP2 |
| R1892 |
T10028 |
T10027 |
pobj |
kidneys,from |
| R1893 |
T10029 |
T10028 |
prep |
of,kidneys |
| R1894 |
T10030 |
T10031 |
amod |
wild,type |
| R1895 |
T10031 |
T10033 |
nmod |
type,animals |
| R1896 |
T9910 |
T9906 |
amod |
intermediate,form |
| R1897 |
T10032 |
T10031 |
punct |
-,type |
| R1898 |
T10033 |
T10029 |
pobj |
animals,of |
| R1899 |
T9912 |
T9906 |
prep |
of,form |
| R19 |
T617 |
T612 |
attr |
disease,is |
| R190 |
T802 |
T795 |
nsubj |
we,show |
| R1900 |
T10034 |
T10031 |
punct |
", ",type |
| R1901 |
T10035 |
T10031 |
conj |
heterozygous,type |
| R1902 |
T10036 |
T10035 |
punct |
", ",heterozygous |
| R1903 |
T10037 |
T10035 |
cc |
and,heterozygous |
| R1904 |
T9913 |
T9914 |
nummod |
31,kDa |
| R1905 |
T10038 |
T10035 |
conj |
mutant,heterozygous |
| R1906 |
T9914 |
T9912 |
pobj |
kDa,of |
| R1907 |
T9915 |
T9906 |
acl |
representing,form |
| R1908 |
T9916 |
T9917 |
nmod |
core,glycosylation |
| R1909 |
T10039 |
T10023 |
advmod |
specifically,affected |
| R191 |
T803 |
T804 |
mark |
that,retained |
| R1910 |
T10040 |
T10041 |
det |
the,form |
| R1911 |
T9917 |
T9915 |
dobj |
glycosylation,representing |
| R1912 |
T10041 |
T10023 |
dobj |
form,affected |
| R1913 |
T10042 |
T10043 |
amod |
intermediate,weight |
| R1914 |
T10043 |
T10041 |
compound |
weight,form |
| R1915 |
T9918 |
T9917 |
punct |
", ",glycosylation |
| R1916 |
T10044 |
T10043 |
amod |
molecular,weight |
| R1917 |
T10045 |
T10046 |
punct |
(,Figure |
| R1918 |
T9919 |
T9920 |
amod |
high,mannose |
| R1919 |
T10046 |
T10023 |
parataxis |
Figure,affected |
| R192 |
T804 |
T795 |
advcl |
retained,show |
| R1920 |
T10047 |
T10046 |
nummod |
3B,Figure |
| R1921 |
T10048 |
T10046 |
punct |
),Figure |
| R1922 |
T9920 |
T9917 |
compound |
mannose,glycosylation |
| R1923 |
T10049 |
T10023 |
punct |
.,affected |
| R1924 |
T10051 |
T10052 |
det |
The,presence |
| R1925 |
T9921 |
T9920 |
punct |
-,mannose |
| R1926 |
T10052 |
T10053 |
nsubj |
presence,permits |
| R1927 |
T9922 |
T9917 |
prep |
of,glycosylation |
| R1928 |
T10054 |
T10052 |
prep |
of,presence |
| R1929 |
T10055 |
T10056 |
det |
some,proteins |
| R193 |
T805 |
T806 |
det |
the,protein |
| R1930 |
T10056 |
T10054 |
pobj |
proteins,of |
| R1931 |
T9923 |
T9922 |
pobj |
AQP2,of |
| R1932 |
T10057 |
T10056 |
amod |
mature,proteins |
| R1933 |
T10058 |
T10056 |
amod |
glycosylated,proteins |
| R1934 |
T10059 |
T10060 |
punct |
(,kDa |
| R1935 |
T9924 |
T9911 |
acomp |
apparent,is |
| R1936 |
T10060 |
T10056 |
parataxis |
kDa,proteins |
| R1937 |
T10061 |
T10062 |
quantmod |
35,45 |
| R1938 |
T10062 |
T10060 |
nummod |
45,kDa |
| R1939 |
T9925 |
T9924 |
prep |
from,apparent |
| R194 |
T806 |
T804 |
nsubjpass |
protein,retained |
| R1940 |
T10063 |
T10062 |
punct |
–,45 |
| R1941 |
T10064 |
T10060 |
punct |
),kDa |
| R1942 |
T9926 |
T9927 |
compound |
pulse,chase |
| R1943 |
T10065 |
T10056 |
prep |
in,proteins |
| R1944 |
T10066 |
T10067 |
compound |
Aqp2F204V,F204V |
| R1945 |
T10067 |
T10069 |
compound |
F204V,mice |
| R1946 |
T10068 |
T10067 |
punct |
/,F204V |
| R1947 |
T10069 |
T10065 |
pobj |
mice,in |
| R1948 |
T10070 |
T10053 |
advmod |
presumably,permits |
| R1949 |
T9927 |
T9929 |
compound |
chase,labeling |
| R195 |
T807 |
T806 |
amod |
mutated,protein |
| R1950 |
T10071 |
T10072 |
poss |
their,survival |
| R1951 |
T10072 |
T10053 |
dobj |
survival,permits |
| R1952 |
T10073 |
T10072 |
prep |
compared,survival |
| R1953 |
T9928 |
T9927 |
punct |
-,chase |
| R1954 |
T10074 |
T10073 |
prep |
to,compared |
| R1955 |
T10075 |
T10076 |
compound |
Aqp2T126M,T126M |
| R1956 |
T10076 |
T10078 |
compound |
T126M,mice |
| R1957 |
T9929 |
T9930 |
compound |
labeling,experiments |
| R1958 |
T10077 |
T10076 |
punct |
/,T126M |
| R1959 |
T10078 |
T10074 |
pobj |
mice,to |
| R196 |
T808 |
T806 |
punct |
", ",protein |
| R1960 |
T10079 |
T10053 |
punct |
", ",permits |
| R1961 |
T9930 |
T9925 |
pobj |
experiments,from |
| R1962 |
T10080 |
T10053 |
cc |
and,permits |
| R1963 |
T10081 |
T10053 |
conj |
is,permits |
| R1964 |
T10082 |
T10081 |
acomp |
consistent,is |
| R1965 |
T9931 |
T9932 |
punct |
[,22 |
| R1966 |
T10083 |
T10082 |
prep |
with,consistent |
| R1967 |
T10084 |
T10085 |
det |
a,response |
| R1968 |
T9932 |
T9911 |
parataxis |
22,is |
| R1969 |
T10085 |
T10083 |
pobj |
response,with |
| R197 |
T809 |
T810 |
compound |
AQP2,F204V |
| R1970 |
T10086 |
T10085 |
amod |
diminished,response |
| R1971 |
T10087 |
T10085 |
prep |
to,response |
| R1972 |
T10088 |
T10087 |
pobj |
dDAVP,to |
| R1973 |
T10146 |
T10147 |
prep |
In,fail |
| R1974 |
T10089 |
T10053 |
punct |
.,permits |
| R1975 |
T10091 |
T10092 |
prep |
In,postulated |
| R1976 |
T10093 |
T10091 |
pobj |
humans,In |
| R1977 |
T10148 |
T10146 |
amod |
general,In |
| R1978 |
T10094 |
T10092 |
punct |
", ",postulated |
| R1979 |
T10095 |
T10096 |
amod |
recessive,alleles |
| R198 |
T810 |
T806 |
appos |
F204V,protein |
| R1980 |
T10096 |
T10092 |
nsubjpass |
alleles,postulated |
| R1981 |
T10097 |
T10096 |
prep |
of,alleles |
| R1982 |
T10149 |
T10147 |
punct |
", ",fail |
| R1983 |
T10098 |
T10097 |
pobj |
Aqp2,of |
| R1984 |
T10099 |
T10092 |
auxpass |
are,postulated |
| R1985 |
T10100 |
T10101 |
aux |
to,cause |
| R1986 |
T10150 |
T10151 |
amod |
such,alleles |
| R1987 |
T10101 |
T10092 |
xcomp |
cause,postulated |
| R1988 |
T10102 |
T10101 |
dobj |
NDI,cause |
| R1989 |
T10103 |
T10104 |
mark |
because,translocate |
| R199 |
T811 |
T810 |
punct |
-,F204V |
| R1990 |
T10151 |
T10147 |
nsubj |
alleles,fail |
| R1991 |
T10152 |
T10151 |
amod |
recessive,alleles |
| R1992 |
T10104 |
T10101 |
advcl |
translocate,cause |
| R1993 |
T10105 |
T10104 |
nsubj |
they,translocate |
| R1994 |
T10153 |
T10147 |
punct |
", ",fail |
| R1995 |
T10106 |
T10104 |
aux |
do,translocate |
| R1996 |
T10107 |
T10104 |
neg |
not,translocate |
| R1997 |
T10108 |
T10104 |
advmod |
properly,translocate |
| R1998 |
T10109 |
T10104 |
prep |
to,translocate |
| R1999 |
T10110 |
T10111 |
det |
the,surface |
| R2 |
T596 |
T594 |
prep |
in,Insipidus |
| R20 |
T618 |
T617 |
acl |
characterized,disease |
| R200 |
T812 |
T804 |
punct |
", ",retained |
| R2000 |
T10154 |
T10155 |
advmod |
when,visualized |
| R2001 |
T10111 |
T10109 |
pobj |
surface,to |
| R2002 |
T10112 |
T10111 |
amod |
apical,surface |
| R2003 |
T10113 |
T10111 |
compound |
cell,surface |
| R2004 |
T10114 |
T10104 |
prep |
in,translocate |
| R2005 |
T10155 |
T10147 |
advcl |
visualized,fail |
| R2006 |
T10115 |
T10114 |
pobj |
response,in |
| R2007 |
T10116 |
T10115 |
prep |
to,response |
| R2008 |
T10156 |
T10155 |
advmod |
immunocytochemically,visualized |
| R2009 |
T10117 |
T10116 |
pobj |
AVP,to |
| R201 |
T813 |
T804 |
auxpass |
is,retained |
| R2010 |
T10118 |
T10092 |
punct |
.,postulated |
| R2011 |
T10157 |
T10147 |
punct |
", ",fail |
| R2012 |
T10120 |
T10121 |
det |
This,postulate |
| R2013 |
T10121 |
T10122 |
nsubj |
postulate,comes |
| R2014 |
T10158 |
T10159 |
aux |
to,localize |
| R2015 |
T10123 |
T10124 |
advmod |
solely,from |
| R2016 |
T10124 |
T10122 |
prep |
from,comes |
| R2017 |
T10159 |
T10147 |
xcomp |
localize,fail |
| R2018 |
T10125 |
T10126 |
advmod |
in,vitro |
| R2019 |
T10126 |
T10127 |
amod |
vitro,studies |
| R202 |
T814 |
T804 |
prep |
in,retained |
| R2020 |
T10127 |
T10124 |
pobj |
studies,from |
| R2021 |
T10160 |
T10159 |
prep |
to,localize |
| R2022 |
T10128 |
T10129 |
prep |
in,transfected |
| R2023 |
T10129 |
T10127 |
relcl |
transfected,studies |
| R2024 |
T10130 |
T10128 |
pobj |
which,in |
| R2025 |
T10161 |
T10162 |
npadvmod |
AVP,responsive |
| R2026 |
T10131 |
T10132 |
compound |
mutant,cDNAs |
| R2027 |
T10132 |
T10129 |
nsubjpass |
cDNAs,transfected |
| R2028 |
T10133 |
T10132 |
compound |
Aqp2,cDNAs |
| R2029 |
T10162 |
T10164 |
amod |
responsive,vesicles |
| R203 |
T815 |
T816 |
det |
the,reticulum |
| R2030 |
T10134 |
T10132 |
acl |
corresponding,cDNAs |
| R2031 |
T10135 |
T10134 |
prep |
to,corresponding |
| R2032 |
T10136 |
T10137 |
amod |
human,mutations |
| R2033 |
T10163 |
T10162 |
punct |
-,responsive |
| R2034 |
T10137 |
T10135 |
pobj |
mutations,to |
| R2035 |
T10138 |
T10137 |
compound |
disease,mutations |
| R2036 |
T10164 |
T10160 |
pobj |
vesicles,to |
| R2037 |
T10139 |
T10129 |
auxpass |
are,transfected |
| R2038 |
T10140 |
T10129 |
prep |
into,transfected |
| R2039 |
T10141 |
T10142 |
compound |
kidney,lines |
| R204 |
T816 |
T814 |
pobj |
reticulum,in |
| R2040 |
T10165 |
T10147 |
punct |
.,fail |
| R2041 |
T10142 |
T10140 |
pobj |
lines,into |
| R2042 |
T10143 |
T10142 |
compound |
cell,lines |
| R2043 |
T10144 |
T10122 |
punct |
.,comes |
| R2044 |
T10167 |
T10168 |
advmod |
Rather,trapped |
| R2045 |
T10169 |
T10168 |
punct |
", ",trapped |
| R2046 |
T10170 |
T10168 |
nsubjpass |
they,trapped |
| R2047 |
T10171 |
T10168 |
auxpass |
get,trapped |
| R2048 |
T10172 |
T10168 |
prep |
in,trapped |
| R2049 |
T10250 |
T10237 |
parataxis |
row,translocated |
| R205 |
T817 |
T816 |
amod |
endoplasmic,reticulum |
| R2050 |
T10251 |
T10250 |
dep |
Figure,row |
| R2051 |
T10173 |
T10174 |
det |
the,reticulum |
| R2052 |
T10252 |
T10251 |
nummod |
4A,Figure |
| R2053 |
T10253 |
T10250 |
punct |
", ",row |
| R2054 |
T10174 |
T10172 |
pobj |
reticulum,in |
| R2055 |
T10254 |
T10250 |
amod |
second,row |
| R2056 |
T10255 |
T10250 |
punct |
),row |
| R2057 |
T10256 |
T10237 |
punct |
.,translocated |
| R2058 |
T10175 |
T10174 |
amod |
endoplasmic,reticulum |
| R2059 |
T10258 |
T10259 |
prep |
In,distributed |
| R206 |
T818 |
T804 |
cc |
and,retained |
| R2060 |
T10176 |
T10174 |
punct |
(,reticulum |
| R2061 |
T10260 |
T10258 |
pobj |
kidneys,In |
| R2062 |
T10261 |
T10260 |
acl |
taken,kidneys |
| R2063 |
T10177 |
T10174 |
appos |
ER,reticulum |
| R2064 |
T10262 |
T10261 |
prep |
from,taken |
| R2065 |
T10263 |
T10264 |
compound |
mutant,animals |
| R2066 |
T10264 |
T10262 |
pobj |
animals,from |
| R2067 |
T10178 |
T10168 |
punct |
),trapped |
| R2068 |
T10265 |
T10259 |
punct |
", ",distributed |
| R2069 |
T10266 |
T10259 |
advmod |
however,distributed |
| R207 |
T819 |
T820 |
mark |
that,rescued |
| R2070 |
T10267 |
T10259 |
punct |
", ",distributed |
| R2071 |
T10179 |
T10168 |
punct |
.,trapped |
| R2072 |
T10268 |
T10259 |
nsubjpass |
AQP2,distributed |
| R2073 |
T10269 |
T10259 |
auxpass |
was,distributed |
| R2074 |
T10270 |
T10259 |
advmod |
randomly,distributed |
| R2075 |
T10271 |
T10259 |
prep |
throughout,distributed |
| R2076 |
T10181 |
T10182 |
poss |
Our,model |
| R2077 |
T10272 |
T10273 |
det |
the,cell |
| R2078 |
T10273 |
T10271 |
pobj |
cell,throughout |
| R2079 |
T10274 |
T10259 |
prep |
in,distributed |
| R208 |
T820 |
T804 |
conj |
rescued,retained |
| R2080 |
T10275 |
T10276 |
det |
the,state |
| R2081 |
T10182 |
T10184 |
nsubj |
model,affords |
| R2082 |
T10276 |
T10274 |
pobj |
state,in |
| R2083 |
T10277 |
T10276 |
amod |
basal,state |
| R2084 |
T10278 |
T10279 |
punct |
(,row |
| R2085 |
T10183 |
T10182 |
compound |
mouse,model |
| R2086 |
T10185 |
T10182 |
prep |
of,model |
| R2087 |
T10279 |
T10259 |
parataxis |
row,distributed |
| R2088 |
T10186 |
T10185 |
pobj |
NDI,of |
| R2089 |
T10280 |
T10279 |
dep |
Figure,row |
| R209 |
T821 |
T822 |
det |
this,localization |
| R2090 |
T10281 |
T10280 |
nummod |
4A,Figure |
| R2091 |
T10187 |
T10188 |
det |
the,opportunity |
| R2092 |
T10282 |
T10279 |
punct |
", ",row |
| R2093 |
T10283 |
T10279 |
amod |
third,row |
| R2094 |
T10284 |
T10279 |
punct |
),row |
| R2095 |
T10188 |
T10184 |
dobj |
opportunity,affords |
| R2096 |
T10285 |
T10259 |
punct |
", ",distributed |
| R2097 |
T10286 |
T10287 |
mark |
while,localized |
| R2098 |
T10189 |
T10188 |
amod |
first,opportunity |
| R2099 |
T10287 |
T10259 |
advcl |
localized,distributed |
| R21 |
T619 |
T618 |
agent |
by,characterized |
| R210 |
T822 |
T820 |
nsubjpass |
localization,rescued |
| R2100 |
T10288 |
T10287 |
nsubj |
AQP3,localized |
| R2101 |
T10289 |
T10290 |
punct |
(,green |
| R2102 |
T10290 |
T10288 |
parataxis |
green,AQP3 |
| R2103 |
T10291 |
T10290 |
punct |
),green |
| R2104 |
T10190 |
T10191 |
aux |
to,test |
| R2105 |
T10292 |
T10287 |
advmod |
appropriately,localized |
| R2106 |
T10293 |
T10287 |
prep |
to,localized |
| R2107 |
T10294 |
T10295 |
det |
the,surface |
| R2108 |
T10191 |
T10188 |
acl |
test,opportunity |
| R2109 |
T10295 |
T10293 |
pobj |
surface,to |
| R211 |
T823 |
T822 |
amod |
abnormal,localization |
| R2110 |
T10296 |
T10295 |
amod |
basolateral,surface |
| R2111 |
T10297 |
T10298 |
punct |
[,23 |
| R2112 |
T10192 |
T10193 |
det |
this,hypothesis |
| R2113 |
T10298 |
T10287 |
parataxis |
23,localized |
| R2114 |
T10299 |
T10298 |
punct |
],23 |
| R2115 |
T10300 |
T10259 |
punct |
.,distributed |
| R2116 |
T10193 |
T10191 |
dobj |
hypothesis,test |
| R2117 |
T10302 |
T10303 |
advmod |
Furthermore,failed |
| R2118 |
T10194 |
T10191 |
prep |
in,test |
| R2119 |
T10304 |
T10303 |
punct |
", ",failed |
| R212 |
T824 |
T820 |
aux |
can,rescued |
| R2120 |
T10305 |
T10303 |
prep |
upon,failed |
| R2121 |
T10306 |
T10307 |
compound |
dDAVP,stimulation |
| R2122 |
T10195 |
T10196 |
det |
a,animal |
| R2123 |
T10307 |
T10305 |
pobj |
stimulation,upon |
| R2124 |
T10308 |
T10303 |
punct |
", ",failed |
| R2125 |
T10309 |
T10310 |
compound |
AQP2,F204V |
| R2126 |
T10196 |
T10194 |
pobj |
animal,in |
| R2127 |
T10310 |
T10303 |
nsubj |
F204V,failed |
| R2128 |
T10311 |
T10310 |
punct |
-,F204V |
| R2129 |
T10312 |
T10313 |
aux |
to,translocate |
| R213 |
T825 |
T820 |
auxpass |
be,rescued |
| R2130 |
T10197 |
T10196 |
amod |
mature,animal |
| R2131 |
T10313 |
T10303 |
xcomp |
translocate,failed |
| R2132 |
T10314 |
T10313 |
prep |
to,translocate |
| R2133 |
T10198 |
T10184 |
punct |
.,affords |
| R2134 |
T10315 |
T10316 |
det |
the,surface |
| R2135 |
T10316 |
T10314 |
pobj |
surface,to |
| R2136 |
T10317 |
T10316 |
compound |
cell,surface |
| R2137 |
T10200 |
T10201 |
mark |
As,shown |
| R2138 |
T10318 |
T10319 |
punct |
(,row |
| R2139 |
T10319 |
T10303 |
parataxis |
row,failed |
| R214 |
T826 |
T820 |
agent |
by,rescued |
| R2140 |
T10320 |
T10319 |
dep |
Figure,row |
| R2141 |
T10321 |
T10320 |
nummod |
4A,Figure |
| R2142 |
T10322 |
T10319 |
punct |
", ",row |
| R2143 |
T10201 |
T10202 |
advcl |
shown,localized |
| R2144 |
T10323 |
T10319 |
amod |
bottom,row |
| R2145 |
T10324 |
T10319 |
punct |
),row |
| R2146 |
T10203 |
T10201 |
prep |
in,shown |
| R2147 |
T10325 |
T10303 |
punct |
.,failed |
| R2148 |
T10327 |
T10328 |
aux |
To,confirm |
| R2149 |
T10328 |
T10329 |
advcl |
confirm,repeated |
| R215 |
T827 |
T828 |
amod |
wild,type |
| R2150 |
T10204 |
T10203 |
pobj |
Figure,in |
| R2151 |
T10330 |
T10331 |
det |
these,findings |
| R2152 |
T10331 |
T10328 |
dobj |
findings,confirm |
| R2153 |
T10332 |
T10329 |
punct |
", ",repeated |
| R2154 |
T10333 |
T10334 |
det |
the,staining |
| R2155 |
T10334 |
T10329 |
nsubjpass |
staining,repeated |
| R2156 |
T10205 |
T10204 |
nummod |
4A,Figure |
| R2157 |
T10335 |
T10329 |
auxpass |
was,repeated |
| R2158 |
T10336 |
T10329 |
prep |
in,repeated |
| R2159 |
T10337 |
T10336 |
pobj |
kidneys,in |
| R216 |
T828 |
T830 |
compound |
type,protein |
| R2160 |
T10206 |
T10207 |
punct |
(,row |
| R2161 |
T10338 |
T10337 |
acl |
taken,kidneys |
| R2162 |
T10339 |
T10338 |
prep |
from,taken |
| R2163 |
T10340 |
T10341 |
nummod |
two,mice |
| R2164 |
T10341 |
T10339 |
pobj |
mice,from |
| R2165 |
T10207 |
T10204 |
parataxis |
row,Figure |
| R2166 |
T10342 |
T10341 |
amod |
further,mice |
| R2167 |
T10343 |
T10338 |
prep |
for,taken |
| R2168 |
T10208 |
T10207 |
amod |
top,row |
| R2169 |
T10344 |
T10345 |
det |
each,class |
| R217 |
T829 |
T828 |
punct |
-,type |
| R2170 |
T10345 |
T10343 |
pobj |
class,for |
| R2171 |
T10209 |
T10207 |
prep |
of,row |
| R2172 |
T10346 |
T10345 |
punct |
", ",class |
| R2173 |
T10347 |
T10348 |
amod |
wild,type |
| R2174 |
T10348 |
T10345 |
appos |
type,class |
| R2175 |
T10210 |
T10209 |
pobj |
photomicrographs,of |
| R2176 |
T10349 |
T10348 |
punct |
-,type |
| R2177 |
T10350 |
T10348 |
cc |
or,type |
| R2178 |
T10351 |
T10348 |
conj |
mutant,type |
| R2179 |
T10211 |
T10207 |
punct |
),row |
| R218 |
T830 |
T826 |
pobj |
protein,by |
| R2180 |
T10352 |
T10329 |
punct |
", ",repeated |
| R2181 |
T10353 |
T10329 |
prep |
with,repeated |
| R2182 |
T10354 |
T10353 |
cc |
or,with |
| R2183 |
T10212 |
T10202 |
punct |
", ",localized |
| R2184 |
T10355 |
T10353 |
conj |
without,with |
| R2185 |
T10213 |
T10202 |
nsubj |
AQP2,localized |
| R2186 |
T10214 |
T10213 |
punct |
(,AQP2 |
| R2187 |
T10215 |
T10213 |
acl |
stained,AQP2 |
| R2188 |
T10356 |
T10357 |
compound |
dDAVP,treatment |
| R2189 |
T10357 |
T10355 |
pobj |
treatment,without |
| R219 |
T831 |
T795 |
punct |
.,show |
| R2190 |
T10216 |
T10215 |
oprd |
red,stained |
| R2191 |
T10358 |
T10329 |
punct |
", ",repeated |
| R2192 |
T10359 |
T10329 |
prep |
with,repeated |
| R2193 |
T10217 |
T10213 |
punct |
),AQP2 |
| R2194 |
T10360 |
T10361 |
amod |
identical,results |
| R2195 |
T10361 |
T10359 |
pobj |
results,with |
| R2196 |
T10362 |
T10329 |
punct |
.,repeated |
| R2197 |
T10218 |
T10202 |
advmod |
normally,localized |
| R2198 |
T10364 |
T10365 |
aux |
To,investigate |
| R2199 |
T10365 |
T10366 |
advcl |
investigate,turned |
| R22 |
T620 |
T619 |
pobj |
failure,by |
| R220 |
T833 |
T834 |
det |
This,model |
| R2200 |
T10219 |
T10202 |
prep |
to,localized |
| R2201 |
T10367 |
T10368 |
det |
the,mechanism |
| R2202 |
T10220 |
T10221 |
det |
the,region |
| R2203 |
T10368 |
T10365 |
dobj |
mechanism,investigate |
| R2204 |
T10221 |
T10219 |
pobj |
region,to |
| R2205 |
T10369 |
T10368 |
prep |
of,mechanism |
| R2206 |
T10370 |
T10371 |
amod |
defective,translocation |
| R2207 |
T10222 |
T10221 |
amod |
subapical,region |
| R2208 |
T10371 |
T10369 |
pobj |
translocation,of |
| R2209 |
T10372 |
T10371 |
prep |
of,translocation |
| R221 |
T834 |
T837 |
nsubj |
model,allows |
| R2210 |
T10223 |
T10221 |
prep |
of,region |
| R2211 |
T10373 |
T10374 |
compound |
AQP2,F204V |
| R2212 |
T10374 |
T10372 |
pobj |
F204V,of |
| R2213 |
T10375 |
T10374 |
punct |
-,F204V |
| R2214 |
T10224 |
T10225 |
amod |
collecting,duct |
| R2215 |
T10376 |
T10366 |
punct |
", ",turned |
| R2216 |
T10377 |
T10366 |
nsubj |
we,turned |
| R2217 |
T10225 |
T10226 |
compound |
duct,cells |
| R2218 |
T10378 |
T10366 |
prep |
to,turned |
| R2219 |
T10379 |
T10378 |
pobj |
transfection,to |
| R222 |
T835 |
T834 |
amod |
novel,model |
| R2220 |
T10226 |
T10223 |
pobj |
cells,of |
| R2221 |
T10380 |
T10379 |
prep |
of,transfection |
| R2222 |
T10381 |
T10382 |
compound |
MDCK,cells |
| R2223 |
T10382 |
T10380 |
pobj |
cells,of |
| R2224 |
T10227 |
T10221 |
prep |
in,region |
| R2225 |
T10383 |
T10366 |
punct |
.,turned |
| R2226 |
T10228 |
T10227 |
pobj |
kidneys,in |
| R2227 |
T10385 |
T10386 |
amod |
Stable,lines |
| R2228 |
T10386 |
T10388 |
nsubjpass |
lines,established |
| R2229 |
T10387 |
T10386 |
compound |
cell,lines |
| R223 |
T836 |
T834 |
compound |
mouse,model |
| R2230 |
T10229 |
T10228 |
prep |
of,kidneys |
| R2231 |
T10389 |
T10386 |
acl |
expressing,lines |
| R2232 |
T10390 |
T10391 |
nmod |
mouse,AQP2 |
| R2233 |
T10230 |
T10231 |
amod |
wild,type |
| R2234 |
T10391 |
T10389 |
dobj |
AQP2,expressing |
| R2235 |
T10392 |
T10393 |
amod |
wild,type |
| R2236 |
T10393 |
T10391 |
compound |
type,AQP2 |
| R2237 |
T10231 |
T10233 |
compound |
type,mice |
| R2238 |
T10394 |
T10393 |
punct |
-,type |
| R2239 |
T10395 |
T10391 |
cc |
and,AQP2 |
| R224 |
T838 |
T837 |
prep |
for,allows |
| R2240 |
T10232 |
T10231 |
punct |
-,type |
| R2241 |
T10396 |
T10397 |
compound |
AQP2,F204V |
| R2242 |
T10397 |
T10391 |
conj |
F204V,AQP2 |
| R2243 |
T10398 |
T10397 |
punct |
-,F204V |
| R2244 |
T10233 |
T10229 |
pobj |
mice,of |
| R2245 |
T10399 |
T10388 |
auxpass |
were,established |
| R2246 |
T10400 |
T10388 |
punct |
.,established |
| R2247 |
T10234 |
T10202 |
punct |
.,localized |
| R2248 |
T10402 |
T10403 |
nsubj |
Immunoblots,showed |
| R2249 |
T10236 |
T10237 |
prep |
Upon,translocated |
| R225 |
T839 |
T840 |
amod |
further,studies |
| R2250 |
T10404 |
T10402 |
prep |
of,Immunoblots |
| R2251 |
T10405 |
T10406 |
compound |
protein,extracts |
| R2252 |
T10406 |
T10404 |
pobj |
extracts,of |
| R2253 |
T10407 |
T10406 |
prep |
from,extracts |
| R2254 |
T10408 |
T10409 |
amod |
stable,lines |
| R2255 |
T10409 |
T10407 |
pobj |
lines,from |
| R2256 |
T10410 |
T10409 |
compound |
cell,lines |
| R2257 |
T10238 |
T10236 |
pobj |
stimulation,Upon |
| R2258 |
T10411 |
T10412 |
mark |
that,recapitulate |
| R2259 |
T10412 |
T10403 |
ccomp |
recapitulate,showed |
| R226 |
T840 |
T838 |
pobj |
studies,for |
| R2260 |
T10413 |
T10414 |
compound |
MDCK,cells |
| R2261 |
T10414 |
T10412 |
nsubj |
cells,recapitulate |
| R2262 |
T10415 |
T10416 |
det |
the,defect |
| R2263 |
T10239 |
T10238 |
prep |
with,stimulation |
| R2264 |
T10416 |
T10412 |
dobj |
defect,recapitulate |
| R2265 |
T10417 |
T10416 |
compound |
glycosylation,defect |
| R2266 |
T10240 |
T10239 |
pobj |
dDAVP,with |
| R2267 |
T10418 |
T10416 |
acl |
seen,defect |
| R2268 |
T10419 |
T10418 |
prep |
in,seen |
| R2269 |
T10420 |
T10421 |
compound |
mutant,mice |
| R227 |
T841 |
T840 |
amod |
mechanistic,studies |
| R2270 |
T10241 |
T10237 |
punct |
", ",translocated |
| R2271 |
T10421 |
T10419 |
pobj |
mice,in |
| R2272 |
T10422 |
T10423 |
punct |
(,data |
| R2273 |
T10423 |
T10403 |
meta |
data,showed |
| R2274 |
T10424 |
T10423 |
amod |
unpublished,data |
| R2275 |
T10242 |
T10237 |
nsubj |
AQP2,translocated |
| R2276 |
T10425 |
T10423 |
punct |
),data |
| R2277 |
T10426 |
T10403 |
punct |
.,showed |
| R2278 |
T10243 |
T10237 |
prep |
to,translocated |
| R2279 |
T10428 |
T10429 |
det |
The,protein |
| R228 |
T842 |
T843 |
advmod |
as,as |
| R2280 |
T10429 |
T10433 |
nsubj |
protein,was |
| R2281 |
T10244 |
T10243 |
cc |
or,to |
| R2282 |
T10430 |
T10431 |
amod |
wild,type |
| R2283 |
T10431 |
T10429 |
compound |
type,protein |
| R2284 |
T10432 |
T10431 |
punct |
-,type |
| R2285 |
T10245 |
T10243 |
conj |
near,to |
| R2286 |
T10434 |
T10433 |
advmod |
again,was |
| R2287 |
T10246 |
T10247 |
det |
the,surface |
| R2288 |
T10435 |
T10433 |
acomp |
present,was |
| R2289 |
T10436 |
T10433 |
prep |
in,was |
| R229 |
T843 |
T840 |
cc |
as,studies |
| R2290 |
T10437 |
T10438 |
nummod |
three,forms |
| R2291 |
T10247 |
T10245 |
pobj |
surface,near |
| R2292 |
T10438 |
T10436 |
pobj |
forms,in |
| R2293 |
T10439 |
T10438 |
amod |
different,forms |
| R2294 |
T10248 |
T10247 |
compound |
cell,surface |
| R2295 |
T10440 |
T10433 |
punct |
.,was |
| R2296 |
T10442 |
T10443 |
nsubj |
Cells,lacked |
| R2297 |
T10249 |
T10250 |
punct |
(,row |
| R2298 |
T10444 |
T10442 |
acl |
expressing,Cells |
| R2299 |
T10445 |
T10446 |
compound |
AQP2,F204V |
| R23 |
T621 |
T620 |
prep |
of,failure |
| R230 |
T844 |
T843 |
advmod |
well,as |
| R2300 |
T10462 |
T10461 |
punct |
-,glycosylated |
| R2301 |
T10446 |
T10444 |
dobj |
F204V,expressing |
| R2302 |
T10447 |
T10446 |
punct |
-,F204V |
| R2303 |
T10448 |
T10449 |
det |
the,form |
| R2304 |
T10449 |
T10443 |
dobj |
form,lacked |
| R2305 |
T10463 |
T10464 |
nummod |
31,kDa |
| R2306 |
T10450 |
T10451 |
quantmod |
35,45 |
| R2307 |
T10451 |
T10453 |
nummod |
45,kDa |
| R2308 |
T10452 |
T10451 |
punct |
–,45 |
| R2309 |
T10453 |
T10449 |
compound |
kDa,form |
| R231 |
T845 |
T840 |
conj |
testing,studies |
| R2310 |
T10454 |
T10443 |
cc |
and,lacked |
| R2311 |
T10455 |
T10456 |
auxpass |
were,enriched |
| R2312 |
T10464 |
T10459 |
compound |
kDa,form |
| R2313 |
T10456 |
T10443 |
conj |
enriched,lacked |
| R2314 |
T10457 |
T10456 |
prep |
in,enriched |
| R2315 |
T10465 |
T10443 |
punct |
.,lacked |
| R2316 |
T10458 |
T10459 |
det |
the,form |
| R2317 |
T10467 |
T10468 |
prep |
In,appeared |
| R2318 |
T10459 |
T10457 |
pobj |
form,in |
| R2319 |
T10460 |
T10461 |
npadvmod |
core,glycosylated |
| R232 |
T846 |
T845 |
prep |
of,testing |
| R2320 |
T10461 |
T10459 |
amod |
glycosylated,form |
| R2321 |
T10469 |
T10470 |
amod |
transfected,cells |
| R2322 |
T10470 |
T10467 |
pobj |
cells,In |
| R2323 |
T10471 |
T10470 |
punct |
", ",cells |
| R2324 |
T10567 |
T10568 |
prep |
Along,seen |
| R2325 |
T10472 |
T10470 |
amod |
unstimulated,cells |
| R2326 |
T10569 |
T10570 |
det |
the,axis |
| R2327 |
T10570 |
T10567 |
pobj |
axis,Along |
| R2328 |
T10473 |
T10470 |
compound |
MDCK,cells |
| R2329 |
T10571 |
T10570 |
compound |
z,axis |
| R233 |
T847 |
T848 |
amod |
pharmacological,therapies |
| R2330 |
T10572 |
T10570 |
punct |
-,axis |
| R2331 |
T10573 |
T10568 |
punct |
", ",seen |
| R2332 |
T10474 |
T10468 |
punct |
", ",appeared |
| R2333 |
T10574 |
T10575 |
det |
the,distribution |
| R2334 |
T10475 |
T10476 |
amod |
wild,type |
| R2335 |
T10476 |
T10478 |
compound |
type,AQP2 |
| R2336 |
T10575 |
T10568 |
nsubjpass |
distribution,seen |
| R2337 |
T10576 |
T10575 |
amod |
perinuclear,distribution |
| R2338 |
T10477 |
T10476 |
punct |
-,type |
| R2339 |
T10577 |
T10575 |
prep |
of,distribution |
| R234 |
T848 |
T846 |
pobj |
therapies,of |
| R2340 |
T10578 |
T10579 |
compound |
AQP2,F204V |
| R2341 |
T10478 |
T10468 |
nsubj |
AQP2,appeared |
| R2342 |
T10579 |
T10577 |
pobj |
F204V,of |
| R2343 |
T10580 |
T10579 |
punct |
-,F204V |
| R2344 |
T10581 |
T10568 |
auxpass |
was,seen |
| R2345 |
T10582 |
T10568 |
advmod |
clearly,seen |
| R2346 |
T10479 |
T10478 |
punct |
(,AQP2 |
| R2347 |
T10583 |
T10568 |
punct |
", ",seen |
| R2348 |
T10584 |
T10568 |
cc |
and,seen |
| R2349 |
T10585 |
T10586 |
det |
this,distribution |
| R235 |
T849 |
T847 |
cc |
and,pharmacological |
| R2350 |
T10480 |
T10478 |
acl |
stained,AQP2 |
| R2351 |
T10586 |
T10587 |
nsubjpass |
distribution,altered |
| R2352 |
T10587 |
T10568 |
conj |
altered,seen |
| R2353 |
T10588 |
T10587 |
auxpass |
is,altered |
| R2354 |
T10481 |
T10480 |
oprd |
green,stained |
| R2355 |
T10589 |
T10587 |
neg |
not,altered |
| R2356 |
T10590 |
T10587 |
agent |
by,altered |
| R2357 |
T10482 |
T10478 |
punct |
),AQP2 |
| R2358 |
T10591 |
T10590 |
pobj |
forskolin,by |
| R2359 |
T10592 |
T10593 |
punct |
(,columns |
| R236 |
T850 |
T847 |
conj |
gene,pharmacological |
| R2360 |
T10593 |
T10587 |
parataxis |
columns,altered |
| R2361 |
T10594 |
T10593 |
dep |
Figure,columns |
| R2362 |
T10595 |
T10594 |
nummod |
4B,Figure |
| R2363 |
T10596 |
T10593 |
punct |
", ",columns |
| R2364 |
T10483 |
T10468 |
prep |
in,appeared |
| R2365 |
T10597 |
T10598 |
amod |
bottom,row |
| R2366 |
T10598 |
T10593 |
dep |
row,columns |
| R2367 |
T10599 |
T10593 |
punct |
", ",columns |
| R2368 |
T10484 |
T10485 |
det |
a,pattern |
| R2369 |
T10600 |
T10593 |
nummod |
two,columns |
| R237 |
T851 |
T845 |
prep |
for,testing |
| R2370 |
T10601 |
T10593 |
amod |
right,columns |
| R2371 |
T10602 |
T10593 |
punct |
),columns |
| R2372 |
T10485 |
T10483 |
pobj |
pattern,in |
| R2373 |
T10603 |
T10587 |
punct |
.,altered |
| R2374 |
T10486 |
T10485 |
compound |
punctate,pattern |
| R2375 |
T10605 |
T10606 |
det |
The,distribution |
| R2376 |
T10606 |
T10608 |
nsubj |
distribution,is |
| R2377 |
T10607 |
T10606 |
amod |
perinuclear,distribution |
| R2378 |
T10487 |
T10485 |
acl |
distributed,pattern |
| R2379 |
T10609 |
T10606 |
prep |
of,distribution |
| R238 |
T852 |
T851 |
pobj |
NDI,for |
| R2380 |
T10610 |
T10611 |
compound |
AQP2,F204V |
| R2381 |
T10488 |
T10487 |
prep |
throughout,distributed |
| R2382 |
T10611 |
T10609 |
pobj |
F204V,of |
| R2383 |
T10612 |
T10611 |
punct |
-,F204V |
| R2384 |
T10489 |
T10490 |
det |
the,region |
| R2385 |
T10613 |
T10608 |
acomp |
consistent,is |
| R2386 |
T10614 |
T10613 |
prep |
with,consistent |
| R2387 |
T10615 |
T10616 |
det |
an,compartmentalization |
| R2388 |
T10616 |
T10614 |
pobj |
compartmentalization,with |
| R2389 |
T10490 |
T10488 |
pobj |
region,throughout |
| R239 |
T853 |
T837 |
punct |
.,allows |
| R2390 |
T10617 |
T10616 |
compound |
ER,compartmentalization |
| R2391 |
T10618 |
T10608 |
punct |
.,is |
| R2392 |
T10491 |
T10490 |
amod |
subapical,region |
| R2393 |
T10620 |
T10621 |
aux |
To,test |
| R2394 |
T10621 |
T10622 |
advcl |
test,co-stained |
| R2395 |
T10492 |
T10493 |
punct |
(,photomicrographs |
| R2396 |
T10623 |
T10624 |
det |
the,idea |
| R2397 |
T10493 |
T10468 |
parataxis |
photomicrographs,appeared |
| R2398 |
T10624 |
T10621 |
dobj |
idea,test |
| R2399 |
T10625 |
T10626 |
mark |
that,localizes |
| R24 |
T622 |
T623 |
det |
the,kidney |
| R2400 |
T10626 |
T10624 |
acl |
localizes,idea |
| R2401 |
T10494 |
T10493 |
dep |
Figure,photomicrographs |
| R2402 |
T10627 |
T10628 |
compound |
AQP2,F204V |
| R2403 |
T10628 |
T10626 |
nsubj |
F204V,localizes |
| R2404 |
T10629 |
T10628 |
punct |
-,F204V |
| R2405 |
T10495 |
T10494 |
nummod |
4B,Figure |
| R2406 |
T10630 |
T10626 |
prep |
to,localizes |
| R2407 |
T10631 |
T10632 |
det |
the,ER |
| R2408 |
T10496 |
T10493 |
punct |
", ",photomicrographs |
| R2409 |
T10497 |
T10498 |
amod |
left,column |
| R2410 |
T10632 |
T10630 |
pobj |
ER,to |
| R2411 |
T10633 |
T10622 |
punct |
", ",co-stained |
| R2412 |
T10634 |
T10622 |
nsubj |
we,co-stained |
| R2413 |
T10635 |
T10622 |
dobj |
cells,co-stained |
| R2414 |
T10636 |
T10635 |
acl |
transfected,cells |
| R2415 |
T10498 |
T10493 |
compound |
column,photomicrographs |
| R2416 |
T10637 |
T10636 |
prep |
with,transfected |
| R2417 |
T10638 |
T10637 |
pobj |
Aqp2F204V,with |
| R2418 |
T10499 |
T10493 |
punct |
),photomicrographs |
| R2419 |
T10639 |
T10640 |
punct |
(,cDNA |
| R2420 |
T10640 |
T10638 |
parataxis |
cDNA,Aqp2F204V |
| R2421 |
T10500 |
T10468 |
punct |
", ",appeared |
| R2422 |
T10641 |
T10640 |
punct |
),cDNA |
| R2423 |
T10642 |
T10622 |
prep |
for,co-stained |
| R2424 |
T10643 |
T10642 |
pobj |
AQP2,for |
| R2425 |
T10501 |
T10468 |
advcl |
consistent,appeared |
| R2426 |
T10644 |
T10643 |
cc |
and,AQP2 |
| R2427 |
T10645 |
T10646 |
det |
an,marker |
| R2428 |
T10646 |
T10643 |
conj |
marker,AQP2 |
| R2429 |
T10502 |
T10501 |
prep |
with,consistent |
| R2430 |
T10647 |
T10646 |
compound |
ER,marker |
| R2431 |
T10648 |
T10646 |
punct |
", ",marker |
| R2432 |
T10649 |
T10646 |
appos |
calnexin,marker |
| R2433 |
T10503 |
T10504 |
amod |
vesicular,compartmentalization |
| R2434 |
T10650 |
T10651 |
punct |
(,Figure |
| R2435 |
T10651 |
T10622 |
parataxis |
Figure,co-stained |
| R2436 |
T10652 |
T10651 |
nummod |
4C,Figure |
| R2437 |
T10504 |
T10502 |
pobj |
compartmentalization,with |
| R2438 |
T10653 |
T10651 |
punct |
),Figure |
| R2439 |
T10654 |
T10622 |
punct |
.,co-stained |
| R2440 |
T10505 |
T10468 |
punct |
.,appeared |
| R2441 |
T10656 |
T10657 |
nsubjpass |
Colocalization,investigated |
| R2442 |
T10658 |
T10656 |
prep |
of,Colocalization |
| R2443 |
T10507 |
T10508 |
compound |
AQP2,F204V |
| R2444 |
T10659 |
T10658 |
pobj |
calnexin,of |
| R2445 |
T10660 |
T10656 |
prep |
with,Colocalization |
| R2446 |
T10661 |
T10660 |
pobj |
AQP2,with |
| R2447 |
T10662 |
T10657 |
auxpass |
was,investigated |
| R2448 |
T10508 |
T10510 |
nsubj |
F204V,appeared |
| R2449 |
T10663 |
T10657 |
advmod |
directly,investigated |
| R2450 |
T10664 |
T10657 |
punct |
", ",investigated |
| R2451 |
T10665 |
T10657 |
cc |
and,investigated |
| R2452 |
T10509 |
T10508 |
punct |
-,F204V |
| R2453 |
T10666 |
T10667 |
nsubjpass |
it,found |
| R2454 |
T10667 |
T10657 |
conj |
found,investigated |
| R2455 |
T10668 |
T10667 |
auxpass |
was,found |
| R2456 |
T10511 |
T10510 |
punct |
", ",appeared |
| R2457 |
T10669 |
T10670 |
mark |
that,colocalized |
| R2458 |
T10670 |
T10667 |
ccomp |
colocalized,found |
| R2459 |
T10671 |
T10672 |
nummod |
80,% |
| R2460 |
T10672 |
T10670 |
nsubj |
%,colocalized |
| R2461 |
T10512 |
T10510 |
prep |
on,appeared |
| R2462 |
T10513 |
T10514 |
det |
the,hand |
| R2463 |
T10673 |
T10672 |
prep |
of,% |
| R2464 |
T10514 |
T10512 |
pobj |
hand,on |
| R2465 |
T10674 |
T10675 |
det |
all,protein |
| R2466 |
T10675 |
T10673 |
pobj |
protein,of |
| R2467 |
T10676 |
T10677 |
compound |
AQP2,F204V |
| R2468 |
T10515 |
T10514 |
amod |
other,hand |
| R2469 |
T10677 |
T10675 |
compound |
F204V,protein |
| R2470 |
T10678 |
T10677 |
punct |
-,F204V |
| R2471 |
T10679 |
T10670 |
prep |
with,colocalized |
| R2472 |
T10516 |
T10510 |
punct |
", ",appeared |
| R2473 |
T10680 |
T10679 |
pobj |
calnexin,with |
| R2474 |
T10681 |
T10667 |
punct |
.,found |
| R2475 |
T10517 |
T10510 |
prep |
in,appeared |
| R2476 |
T10683 |
T10684 |
det |
The,% |
| R2477 |
T10684 |
T10687 |
nsubj |
%,appeared |
| R2478 |
T10518 |
T10519 |
det |
a,pattern |
| R2479 |
T10685 |
T10684 |
amod |
remaining,% |
| R2480 |
T10686 |
T10684 |
nummod |
20,% |
| R2481 |
T10519 |
T10517 |
pobj |
pattern,in |
| R2482 |
T10688 |
T10687 |
prep |
at,appeared |
| R2483 |
T10689 |
T10690 |
det |
the,periphery |
| R2484 |
T10520 |
T10521 |
npadvmod |
punctate,perinuclear |
| R2485 |
T10690 |
T10688 |
pobj |
periphery,at |
| R2486 |
T10691 |
T10690 |
prep |
of,periphery |
| R2487 |
T10692 |
T10693 |
det |
the,ER |
| R2488 |
T10521 |
T10519 |
amod |
perinuclear,pattern |
| R2489 |
T10693 |
T10691 |
pobj |
ER,of |
| R2490 |
T10694 |
T10687 |
punct |
", ",appeared |
| R2491 |
T10695 |
T10687 |
advcl |
representing,appeared |
| R2492 |
T10522 |
T10521 |
cc |
but,perinuclear |
| R2493 |
T10696 |
T10697 |
compound |
AQP2,F204V |
| R2494 |
T10697 |
T10695 |
dobj |
F204V,representing |
| R2495 |
T10698 |
T10697 |
punct |
-,F204V |
| R2496 |
T10523 |
T10524 |
punct |
(,column |
| R2497 |
T10699 |
T10700 |
dep |
that,progressed |
| R2498 |
T10700 |
T10697 |
relcl |
progressed,F204V |
| R2499 |
T10524 |
T10510 |
parataxis |
column,appeared |
| R25 |
T623 |
T621 |
pobj |
kidney,of |
| R2500 |
T10701 |
T10700 |
aux |
had,progressed |
| R2501 |
T10702 |
T10700 |
advmod |
potentially,progressed |
| R2502 |
T10703 |
T10700 |
prep |
beyond,progressed |
| R2503 |
T10525 |
T10524 |
dep |
Figure,column |
| R2504 |
T10704 |
T10705 |
det |
the,ER |
| R2505 |
T10705 |
T10703 |
pobj |
ER,beyond |
| R2506 |
T10706 |
T10687 |
punct |
.,appeared |
| R2507 |
T10526 |
T10525 |
nummod |
4B,Figure |
| R2508 |
T10708 |
T10709 |
det |
This,escape |
| R2509 |
T10709 |
T10712 |
nsubj |
escape,was |
| R2510 |
T10527 |
T10524 |
punct |
", ",column |
| R2511 |
T10710 |
T10709 |
punct |
“,escape |
| R2512 |
T10711 |
T10709 |
compound |
ER,escape |
| R2513 |
T10528 |
T10524 |
amod |
third,column |
| R2514 |
T10713 |
T10709 |
punct |
”,escape |
| R2515 |
T10714 |
T10712 |
acomp |
consistent,was |
| R2516 |
T10715 |
T10714 |
prep |
with,consistent |
| R2517 |
T10716 |
T10717 |
det |
the,proportion |
| R2518 |
T10717 |
T10715 |
pobj |
proportion,with |
| R2519 |
T10529 |
T10524 |
punct |
),column |
| R2520 |
T10718 |
T10717 |
amod |
small,proportion |
| R2521 |
T10530 |
T10510 |
punct |
.,appeared |
| R2522 |
T10719 |
T10717 |
prep |
of,proportion |
| R2523 |
T10720 |
T10721 |
amod |
mature,F204V |
| R2524 |
T10721 |
T10719 |
pobj |
F204V,of |
| R2525 |
T10532 |
T10533 |
prep |
Upon,translocated |
| R2526 |
T10722 |
T10721 |
punct |
", ",F204V |
| R2527 |
T10723 |
T10724 |
amod |
complex,glycosylated |
| R2528 |
T10724 |
T10721 |
amod |
glycosylated,F204V |
| R2529 |
T10725 |
T10721 |
punct |
", ",F204V |
| R2530 |
T10534 |
T10532 |
pobj |
stimulation,Upon |
| R2531 |
T10726 |
T10721 |
compound |
AQP2,F204V |
| R2532 |
T10727 |
T10721 |
punct |
-,F204V |
| R2533 |
T10728 |
T10717 |
prep |
in,proportion |
| R2534 |
T10535 |
T10534 |
prep |
with,stimulation |
| R2535 |
T10729 |
T10730 |
compound |
mutant,kidneys |
| R2536 |
T10730 |
T10728 |
pobj |
kidneys,in |
| R2537 |
T10731 |
T10732 |
punct |
(,see |
| R2538 |
T10536 |
T10535 |
pobj |
forskolin,with |
| R2539 |
T10732 |
T10712 |
parataxis |
see,was |
| R254 |
T2464 |
T2465 |
amod |
Nephrogenic,insipidus |
| R2540 |
T10733 |
T10732 |
dobj |
Figure,see |
| R2541 |
T10537 |
T10533 |
punct |
", ",translocated |
| R2542 |
T10734 |
T10733 |
nummod |
3A,Figure |
| R2543 |
T10735 |
T10732 |
punct |
),see |
| R2544 |
T10736 |
T10712 |
punct |
.,was |
| R2545 |
T10538 |
T10539 |
det |
a,activator |
| R2546 |
T10738 |
T10739 |
nsubjpass |
Animals,affected |
| R2547 |
T10539 |
T10533 |
nsubj |
activator,translocated |
| R2548 |
T10740 |
T10738 |
amod |
heterozygous,Animals |
| R2549 |
T10741 |
T10740 |
prep |
for,heterozygous |
| R255 |
T2465 |
T2467 |
nsubj |
insipidus,is |
| R2550 |
T10742 |
T10743 |
det |
the,mutation |
| R2551 |
T10540 |
T10541 |
npadvmod |
cAMP,dependent |
| R2552 |
T10743 |
T10741 |
pobj |
mutation,for |
| R2553 |
T10744 |
T10743 |
compound |
Aqp2F204V,mutation |
| R2554 |
T10745 |
T10739 |
auxpass |
were,affected |
| R2555 |
T10541 |
T10539 |
amod |
dependent,activator |
| R2556 |
T10746 |
T10739 |
neg |
not,affected |
| R2557 |
T10747 |
T10739 |
prep |
in,affected |
| R2558 |
T10748 |
T10749 |
poss |
their,production |
| R2559 |
T10542 |
T10541 |
punct |
-,dependent |
| R256 |
T2466 |
T2465 |
compound |
diabetes,insipidus |
| R2560 |
T10749 |
T10747 |
pobj |
production,in |
| R2561 |
T10750 |
T10749 |
compound |
urine,production |
| R2562 |
T10751 |
T10749 |
cc |
or,production |
| R2563 |
T10543 |
T10544 |
compound |
protein,kinase |
| R2564 |
T10752 |
T10753 |
compound |
urine,osmolality |
| R2565 |
T10753 |
T10749 |
conj |
osmolality,production |
| R2566 |
T10754 |
T10755 |
punct |
(,see |
| R2567 |
T10755 |
T10739 |
parataxis |
see,affected |
| R2568 |
T10756 |
T10757 |
nmod |
Figure,1C |
| R2569 |
T10757 |
T10755 |
dobj |
1C,see |
| R257 |
T2468 |
T2465 |
punct |
(,insipidus |
| R2570 |
T10544 |
T10539 |
compound |
kinase,activator |
| R2571 |
T10758 |
T10757 |
cc |
and,1C |
| R2572 |
T10759 |
T10757 |
conj |
1D,1C |
| R2573 |
T10760 |
T10755 |
punct |
),see |
| R2574 |
T10545 |
T10539 |
punct |
", ",activator |
| R2575 |
T10761 |
T10739 |
punct |
.,affected |
| R2576 |
T10763 |
T10764 |
nsubjpass |
It,shown |
| R2577 |
T10546 |
T10547 |
amod |
wild,type |
| R2578 |
T10765 |
T10764 |
aux |
has,shown |
| R2579 |
T10766 |
T10764 |
advmod |
also,shown |
| R258 |
T2469 |
T2465 |
appos |
NDI,insipidus |
| R2580 |
T10547 |
T10549 |
compound |
type,AQP2 |
| R2581 |
T10767 |
T10764 |
auxpass |
been,shown |
| R2582 |
T10768 |
T10769 |
mark |
that,interact |
| R2583 |
T10769 |
T10764 |
ccomp |
interact,shown |
| R2584 |
T10548 |
T10547 |
punct |
-,type |
| R2585 |
T10770 |
T10771 |
det |
a,allele |
| R2586 |
T10771 |
T10769 |
nsubj |
allele,interact |
| R2587 |
T10772 |
T10771 |
amod |
recessive,allele |
| R2588 |
T10549 |
T10539 |
appos |
AQP2,activator |
| R2589 |
T10773 |
T10771 |
compound |
NDI,allele |
| R259 |
T2470 |
T2467 |
punct |
),is |
| R2590 |
T10774 |
T10771 |
punct |
", ",allele |
| R2591 |
T10775 |
T10776 |
compound |
AQP2,R187C |
| R2592 |
T10550 |
T10533 |
prep |
to,translocated |
| R2593 |
T10776 |
T10771 |
appos |
R187C,allele |
| R2594 |
T10777 |
T10776 |
punct |
-,R187C |
| R2595 |
T10778 |
T10769 |
punct |
", ",interact |
| R2596 |
T10551 |
T10552 |
det |
the,surface |
| R2597 |
T10552 |
T10550 |
pobj |
surface,to |
| R2598 |
T10553 |
T10552 |
amod |
apical,surface |
| R2599 |
T10779 |
T10769 |
aux |
does,interact |
| R26 |
T624 |
T625 |
aux |
to,concentrate |
| R260 |
T2471 |
T2472 |
det |
a,disease |
| R2600 |
T10554 |
T10552 |
prep |
of,surface |
| R2601 |
T10780 |
T10769 |
neg |
not,interact |
| R2602 |
T10781 |
T10769 |
prep |
with,interact |
| R2603 |
T10782 |
T10783 |
amod |
wild,type |
| R2604 |
T10555 |
T10556 |
amod |
polarized,cells |
| R2605 |
T10783 |
T10785 |
compound |
type,protein |
| R2606 |
T10784 |
T10783 |
punct |
-,type |
| R2607 |
T10556 |
T10554 |
pobj |
cells,of |
| R2608 |
T10785 |
T10781 |
pobj |
protein,with |
| R2609 |
T10786 |
T10769 |
prep |
in,interact |
| R261 |
T2472 |
T2467 |
attr |
disease,is |
| R2610 |
T10787 |
T10786 |
pobj |
oocytes,in |
| R2611 |
T10557 |
T10556 |
compound |
MDCK,cells |
| R2612 |
T10788 |
T10789 |
punct |
[,24 |
| R2613 |
T10789 |
T10769 |
parataxis |
24,interact |
| R2614 |
T10790 |
T10789 |
punct |
],24 |
| R2615 |
T10558 |
T10559 |
punct |
(,column |
| R2616 |
T10791 |
T10769 |
punct |
", ",interact |
| R2617 |
T10792 |
T10769 |
cc |
nor,interact |
| R2618 |
T10793 |
T10794 |
aux |
does,homo-oligomerize |
| R2619 |
T10794 |
T10769 |
conj |
homo-oligomerize,interact |
| R262 |
T2473 |
T2472 |
acl |
characterized,disease |
| R2620 |
T10795 |
T10794 |
nsubj |
it,homo-oligomerize |
| R2621 |
T10796 |
T10794 |
prep |
in,homo-oligomerize |
| R2622 |
T10559 |
T10533 |
parataxis |
column,translocated |
| R2623 |
T10797 |
T10798 |
compound |
MDCK,cells |
| R2624 |
T10798 |
T10796 |
pobj |
cells,in |
| R2625 |
T10799 |
T10800 |
punct |
[,22 |
| R2626 |
T10560 |
T10559 |
dep |
Figure,column |
| R2627 |
T10800 |
T10764 |
parataxis |
22,shown |
| R2628 |
T10801 |
T10800 |
punct |
],22 |
| R2629 |
T10802 |
T10764 |
punct |
.,shown |
| R263 |
T2474 |
T2473 |
agent |
by,characterized |
| R2630 |
T10561 |
T10560 |
nummod |
4B,Figure |
| R2631 |
T10804 |
T10805 |
advmod |
Therefore,examined |
| R2632 |
T10562 |
T10559 |
punct |
", ",column |
| R2633 |
T10563 |
T10559 |
amod |
second,column |
| R2634 |
T10806 |
T10805 |
punct |
", ",examined |
| R2635 |
T10564 |
T10559 |
punct |
),column |
| R2636 |
T10807 |
T10805 |
nsubjpass |
kidneys,examined |
| R2637 |
T10808 |
T10807 |
prep |
from,kidneys |
| R2638 |
T10565 |
T10533 |
punct |
.,translocated |
| R2639 |
T10809 |
T10810 |
amod |
heterozygous,animals |
| R264 |
T2475 |
T2476 |
amod |
excessive,urination |
| R2640 |
T10810 |
T10808 |
pobj |
animals,from |
| R2641 |
T10811 |
T10805 |
auxpass |
were,examined |
| R2642 |
T10885 |
T10884 |
prep |
by,undetectable |
| R2643 |
T10812 |
T10805 |
prep |
for,examined |
| R2644 |
T10813 |
T10812 |
pobj |
evidence,for |
| R2645 |
T10814 |
T10813 |
prep |
of,evidence |
| R2646 |
T10815 |
T10816 |
nummod |
two,populations |
| R2647 |
T10886 |
T10885 |
pobj |
immunocytochemistry,by |
| R2648 |
T10816 |
T10814 |
pobj |
populations,of |
| R2649 |
T10817 |
T10816 |
prep |
of,populations |
| R265 |
T2476 |
T2474 |
pobj |
urination,by |
| R2650 |
T10818 |
T10819 |
compound |
AQP2,protein |
| R2651 |
T10887 |
T10868 |
punct |
.,reflect |
| R2652 |
T10819 |
T10817 |
pobj |
protein,of |
| R2653 |
T10820 |
T10805 |
punct |
.,examined |
| R2654 |
T10889 |
T10890 |
advmod |
Alternatively,alter |
| R2655 |
T10822 |
T10823 |
advmod |
Surprisingly,revealed |
| R2656 |
T10824 |
T10823 |
punct |
", ",revealed |
| R2657 |
T10891 |
T10890 |
punct |
", ",alter |
| R2658 |
T10825 |
T10826 |
amod |
immunohistochemical,staining |
| R2659 |
T10826 |
T10823 |
nsubj |
staining,revealed |
| R266 |
T2477 |
T2476 |
cc |
and,urination |
| R2660 |
T10827 |
T10826 |
prep |
of,staining |
| R2661 |
T10828 |
T10829 |
nmod |
kidney,ducts |
| R2662 |
T10892 |
T10893 |
det |
the,presence |
| R2663 |
T10829 |
T10827 |
pobj |
ducts,of |
| R2664 |
T10830 |
T10829 |
amod |
collecting,ducts |
| R2665 |
T10831 |
T10829 |
prep |
from,ducts |
| R2666 |
T10893 |
T10890 |
nsubj |
presence,alter |
| R2667 |
T10832 |
T10833 |
nmod |
Aqp2F204V,mice |
| R2668 |
T10833 |
T10831 |
pobj |
mice,from |
| R2669 |
T10834 |
T10832 |
punct |
/,Aqp2F204V |
| R267 |
T2478 |
T2476 |
conj |
thirst,urination |
| R2670 |
T10835 |
T10832 |
punct |
+,Aqp2F204V |
| R2671 |
T10836 |
T10837 |
det |
a,pattern |
| R2672 |
T10837 |
T10823 |
dobj |
pattern,revealed |
| R2673 |
T10894 |
T10893 |
prep |
of,presence |
| R2674 |
T10838 |
T10839 |
advmod |
remarkably,similar |
| R2675 |
T10839 |
T10837 |
amod |
similar,pattern |
| R2676 |
T10840 |
T10839 |
prep |
to,similar |
| R2677 |
T10895 |
T10896 |
amod |
wild,type |
| R2678 |
T10841 |
T10842 |
amod |
wild,type |
| R2679 |
T10842 |
T10840 |
pobj |
type,to |
| R268 |
T2479 |
T2473 |
punct |
", ",characterized |
| R2680 |
T10843 |
T10844 |
punct |
(,Figure |
| R2681 |
T10844 |
T10823 |
parataxis |
Figure,revealed |
| R2682 |
T10845 |
T10844 |
nummod |
5A,Figure |
| R2683 |
T10846 |
T10844 |
punct |
),Figure |
| R2684 |
T10847 |
T10823 |
punct |
.,revealed |
| R2685 |
T10896 |
T10898 |
compound |
type,protein |
| R2686 |
T10849 |
T10850 |
nsubj |
AQP2,translocated |
| R2687 |
T10897 |
T10896 |
punct |
-,type |
| R2688 |
T10851 |
T10850 |
advmod |
completely,translocated |
| R2689 |
T10852 |
T10850 |
prep |
to,translocated |
| R269 |
T2480 |
T2473 |
prep |
despite,characterized |
| R2690 |
T10898 |
T10894 |
pobj |
protein,of |
| R2691 |
T10853 |
T10854 |
det |
the,surface |
| R2692 |
T10854 |
T10852 |
pobj |
surface,to |
| R2693 |
T10855 |
T10854 |
amod |
apical,surface |
| R2694 |
T10856 |
T10854 |
compound |
cell,surface |
| R2695 |
T10899 |
T10890 |
aux |
may,alter |
| R2696 |
T10857 |
T10850 |
prep |
upon,translocated |
| R2697 |
T10858 |
T10859 |
compound |
dDAVP,stimulation |
| R2698 |
T10859 |
T10857 |
pobj |
stimulation,upon |
| R2699 |
T10900 |
T10901 |
det |
the,localization |
| R27 |
T625 |
T620 |
acl |
concentrate,failure |
| R270 |
T2481 |
T2482 |
amod |
normal,production |
| R2700 |
T10860 |
T10850 |
punct |
.,translocated |
| R2701 |
T10901 |
T10890 |
dobj |
localization,alter |
| R2702 |
T10862 |
T10863 |
det |
This,pattern |
| R2703 |
T10863 |
T10868 |
nsubj |
pattern,reflect |
| R2704 |
T10864 |
T10865 |
amod |
wild,type |
| R2705 |
T10902 |
T10901 |
prep |
of,localization |
| R2706 |
T10865 |
T10863 |
compound |
type,pattern |
| R2707 |
T10866 |
T10865 |
punct |
-,type |
| R2708 |
T10867 |
T10863 |
compound |
staining,pattern |
| R2709 |
T10903 |
T10904 |
det |
the,protein |
| R271 |
T2482 |
T2480 |
pobj |
production,despite |
| R2710 |
T10869 |
T10868 |
aux |
may,reflect |
| R2711 |
T10904 |
T10902 |
pobj |
protein,of |
| R2712 |
T10870 |
T10868 |
advmod |
simply,reflect |
| R2713 |
T10871 |
T10872 |
det |
the,fact |
| R2714 |
T10872 |
T10868 |
dobj |
fact,reflect |
| R2715 |
T10873 |
T10874 |
mark |
that,makes |
| R2716 |
T10905 |
T10904 |
compound |
mutant,protein |
| R2717 |
T10874 |
T10872 |
acl |
makes,fact |
| R2718 |
T10875 |
T10874 |
csubj |
decreasing,makes |
| R2719 |
T10876 |
T10877 |
det |
the,amount |
| R272 |
T2483 |
T2482 |
prep |
of,production |
| R2720 |
T10906 |
T10890 |
punct |
.,alter |
| R2721 |
T10877 |
T10875 |
dobj |
amount,decreasing |
| R2722 |
T10878 |
T10877 |
prep |
of,amount |
| R2723 |
T10879 |
T10880 |
compound |
mutant,protein |
| R2724 |
T10880 |
T10878 |
pobj |
protein,of |
| R2725 |
T10881 |
T10875 |
prep |
by,decreasing |
| R2726 |
T10882 |
T10881 |
pobj |
half,by |
| R2727 |
T10908 |
T10909 |
advmod |
Indeed,proposed |
| R2728 |
T10883 |
T10884 |
nsubj |
it,undetectable |
| R2729 |
T10884 |
T10874 |
ccomp |
undetectable,makes |
| R273 |
T2484 |
T2485 |
det |
the,hormone |
| R2730 |
T10910 |
T10909 |
punct |
", ",proposed |
| R2731 |
T10911 |
T10909 |
nsubj |
Hendriks,proposed |
| R2732 |
T10912 |
T10913 |
advmod |
et,al. |
| R2733 |
T10913 |
T10911 |
advmod |
al.,Hendriks |
| R2734 |
T10991 |
T10980 |
nsubj |
type,rescue |
| R2735 |
T10914 |
T10915 |
det |
a,mechanism |
| R2736 |
T10992 |
T10991 |
amod |
wild,type |
| R2737 |
T10915 |
T10909 |
dobj |
mechanism,proposed |
| R2738 |
T10993 |
T10980 |
aux |
may,rescue |
| R2739 |
T10994 |
T10995 |
det |
the,protein |
| R274 |
T2485 |
T2483 |
pobj |
hormone,of |
| R2740 |
T10916 |
T10915 |
punct |
“,mechanism |
| R2741 |
T10995 |
T10980 |
dobj |
protein,rescue |
| R2742 |
T10996 |
T10995 |
compound |
mutant,protein |
| R2743 |
T10997 |
T10998 |
mark |
as,suggested |
| R2744 |
T10917 |
T10918 |
nmod |
piggy,back |
| R2745 |
T10998 |
T10980 |
advcl |
suggested,rescue |
| R2746 |
T10999 |
T10998 |
agent |
by,suggested |
| R2747 |
T10918 |
T10915 |
nmod |
back,mechanism |
| R2748 |
T11000 |
T11001 |
det |
the,distribution |
| R2749 |
T11001 |
T10999 |
pobj |
distribution,by |
| R275 |
T2486 |
T2485 |
amod |
antidiuretic,hormone |
| R2750 |
T11002 |
T11001 |
amod |
subcellular,distribution |
| R2751 |
T11003 |
T11001 |
prep |
of,distribution |
| R2752 |
T10919 |
T10918 |
punct |
-,back |
| R2753 |
T11004 |
T11005 |
compound |
AQP2,protein |
| R2754 |
T11005 |
T11003 |
pobj |
protein,of |
| R2755 |
T10920 |
T10915 |
punct |
”,mechanism |
| R2756 |
T11006 |
T10980 |
punct |
.,rescue |
| R2757 |
T11008 |
T11009 |
aux |
To,test |
| R2758 |
T10921 |
T10922 |
aux |
to,explain |
| R2759 |
T11009 |
T11010 |
advcl |
test,looked |
| R276 |
T2487 |
T2488 |
compound |
arginine,vasopressin |
| R2760 |
T10922 |
T10909 |
advcl |
explain,proposed |
| R2761 |
T11011 |
T11012 |
det |
this,idea |
| R2762 |
T11012 |
T11009 |
dobj |
idea,test |
| R2763 |
T11013 |
T11010 |
punct |
", ",looked |
| R2764 |
T11014 |
T11010 |
nsubj |
we,looked |
| R2765 |
T10923 |
T10924 |
det |
the,transport |
| R2766 |
T11015 |
T11010 |
advmod |
first,looked |
| R2767 |
T11016 |
T11010 |
prep |
for,looked |
| R2768 |
T10924 |
T10922 |
dobj |
transport,explain |
| R2769 |
T11017 |
T11018 |
det |
an,interaction |
| R277 |
T2488 |
T2485 |
appos |
vasopressin,hormone |
| R2770 |
T11018 |
T11016 |
pobj |
interaction,for |
| R2771 |
T11019 |
T11018 |
prep |
between,interaction |
| R2772 |
T10925 |
T10924 |
prep |
of,transport |
| R2773 |
T11020 |
T11021 |
nmod |
mutant,proteins |
| R2774 |
T11021 |
T11019 |
pobj |
proteins,between |
| R2775 |
T11022 |
T11020 |
cc |
and,mutant |
| R2776 |
T11023 |
T11024 |
amod |
wild,type |
| R2777 |
T11024 |
T11020 |
conj |
type,mutant |
| R2778 |
T10926 |
T10927 |
amod |
nonglycosylated,subunits |
| R2779 |
T11025 |
T11024 |
punct |
-,type |
| R278 |
T2489 |
T2488 |
punct |
(,vasopressin |
| R2780 |
T11026 |
T11010 |
prep |
in,looked |
| R2781 |
T11027 |
T11028 |
amod |
transfected,cells |
| R2782 |
T10927 |
T10925 |
pobj |
subunits,of |
| R2783 |
T11028 |
T11026 |
pobj |
cells,in |
| R2784 |
T11029 |
T11028 |
compound |
MDCK,cells |
| R2785 |
T11030 |
T11031 |
punct |
(,Figure |
| R2786 |
T10928 |
T10927 |
prep |
of,subunits |
| R2787 |
T11031 |
T11010 |
parataxis |
Figure,looked |
| R2788 |
T11032 |
T11031 |
nummod |
5B,Figure |
| R2789 |
T11033 |
T11031 |
punct |
),Figure |
| R279 |
T2490 |
T2488 |
appos |
AVP,vasopressin |
| R2790 |
T11034 |
T11010 |
punct |
.,looked |
| R2791 |
T10929 |
T10928 |
pobj |
AQP2,of |
| R2792 |
T11036 |
T11037 |
compound |
MDCK,cells |
| R2793 |
T10930 |
T10924 |
prep |
to,transport |
| R2794 |
T11037 |
T11038 |
nsubjpass |
cells,transfected |
| R2795 |
T11039 |
T11040 |
advmod |
stably,expressing |
| R2796 |
T10931 |
T10932 |
det |
the,surface |
| R2797 |
T11040 |
T11037 |
acl |
expressing,cells |
| R2798 |
T11041 |
T11042 |
amod |
wild,type |
| R2799 |
T10932 |
T10930 |
pobj |
surface,to |
| R28 |
T626 |
T625 |
dobj |
urine,concentrate |
| R280 |
T2491 |
T2467 |
punct |
),is |
| R2800 |
T11042 |
T11044 |
compound |
type,AQP2 |
| R2801 |
T11043 |
T11042 |
punct |
-,type |
| R2802 |
T11044 |
T11040 |
dobj |
AQP2,expressing |
| R2803 |
T10933 |
T10932 |
compound |
cell,surface |
| R2804 |
T11045 |
T11038 |
auxpass |
were,transfected |
| R2805 |
T11046 |
T11038 |
advmod |
transiently,transfected |
| R2806 |
T11047 |
T11038 |
prep |
with,transfected |
| R2807 |
T10934 |
T10924 |
prep |
by,transport |
| R2808 |
T11048 |
T11049 |
compound |
GFP,constructs |
| R2809 |
T11049 |
T11047 |
pobj |
constructs,with |
| R281 |
T2492 |
T2493 |
punct |
[,1 |
| R2810 |
T11050 |
T11049 |
compound |
expression,constructs |
| R2811 |
T10935 |
T10936 |
amod |
glycosylated,subunits |
| R2812 |
T11051 |
T11049 |
acl |
encoding,constructs |
| R2813 |
T11052 |
T11053 |
npadvmod |
GFP,tagged |
| R2814 |
T10936 |
T10934 |
pobj |
subunits,by |
| R2815 |
T11053 |
T11055 |
amod |
tagged,AQP2 |
| R2816 |
T11054 |
T11053 |
punct |
-,tagged |
| R2817 |
T11055 |
T11051 |
dobj |
AQP2,encoding |
| R2818 |
T10937 |
T10938 |
punct |
[,22 |
| R2819 |
T11056 |
T11057 |
amod |
wild,type |
| R282 |
T2493 |
T2467 |
parataxis |
1,is |
| R2820 |
T11057 |
T11055 |
compound |
type,AQP2 |
| R2821 |
T11058 |
T11057 |
punct |
-,type |
| R2822 |
T10938 |
T10922 |
parataxis |
22,explain |
| R2823 |
T11059 |
T11055 |
punct |
", ",AQP2 |
| R2824 |
T11060 |
T11061 |
compound |
AQP2,F204V |
| R2825 |
T11061 |
T11055 |
conj |
F204V,AQP2 |
| R2826 |
T11062 |
T11061 |
punct |
-,F204V |
| R2827 |
T11063 |
T11061 |
punct |
", ",F204V |
| R2828 |
T11064 |
T11061 |
cc |
or,F204V |
| R2829 |
T10939 |
T10938 |
punct |
],22 |
| R283 |
T2494 |
T2493 |
punct |
],1 |
| R2830 |
T11065 |
T11061 |
conj |
GFP,F204V |
| R2831 |
T11066 |
T11065 |
advmod |
alone,GFP |
| R2832 |
T10940 |
T10909 |
punct |
.,proposed |
| R2833 |
T10942 |
T10943 |
nsubjpass |
It,shown |
| R2834 |
T11067 |
T11038 |
punct |
.,transfected |
| R2835 |
T10944 |
T10943 |
aux |
has,shown |
| R2836 |
T11069 |
T11070 |
nsubj |
Antibodies,coimmunoprecipitated |
| R2837 |
T11071 |
T11069 |
prep |
against,Antibodies |
| R2838 |
T11072 |
T11071 |
pobj |
GFP,against |
| R2839 |
T10945 |
T10943 |
advmod |
also,shown |
| R284 |
T2495 |
T2467 |
punct |
.,is |
| R2840 |
T11073 |
T11074 |
amod |
wild,type |
| R2841 |
T11074 |
T11076 |
compound |
type,AQP2 |
| R2842 |
T10946 |
T10943 |
auxpass |
been,shown |
| R2843 |
T11075 |
T11074 |
punct |
-,type |
| R2844 |
T11076 |
T11070 |
dobj |
AQP2,coimmunoprecipitated |
| R2845 |
T11077 |
T11078 |
advmod |
when,transfected |
| R2846 |
T10947 |
T10948 |
mark |
that,rescue |
| R2847 |
T11078 |
T11070 |
advcl |
transfected,coimmunoprecipitated |
| R2848 |
T11079 |
T11080 |
compound |
AQP2,GFP |
| R2849 |
T10948 |
T10943 |
ccomp |
rescue,shown |
| R285 |
T2497 |
T2498 |
det |
The,forms |
| R2850 |
T11080 |
T11078 |
nsubjpass |
GFP,transfected |
| R2851 |
T11081 |
T11080 |
punct |
-,GFP |
| R2852 |
T11082 |
T11080 |
cc |
or,GFP |
| R2853 |
T10949 |
T10950 |
amod |
wild,type |
| R2854 |
T11083 |
T11084 |
compound |
AQP2,GFP |
| R2855 |
T11084 |
T11080 |
conj |
GFP,GFP |
| R2856 |
T11085 |
T11084 |
punct |
-,GFP |
| R2857 |
T10950 |
T10952 |
compound |
type,protein |
| R2858 |
T11086 |
T11084 |
compound |
F204V,GFP |
| R2859 |
T11087 |
T11084 |
punct |
-,GFP |
| R286 |
T2498 |
T2500 |
nsubj |
forms,are |
| R2860 |
T10951 |
T10950 |
punct |
-,type |
| R2861 |
T11088 |
T11078 |
auxpass |
was,transfected |
| R2862 |
T11089 |
T11078 |
advmod |
transiently,transfected |
| R2863 |
T11090 |
T11078 |
punct |
", ",transfected |
| R2864 |
T10952 |
T10948 |
nsubj |
protein,rescue |
| R2865 |
T11091 |
T11078 |
cc |
but,transfected |
| R2866 |
T11092 |
T11091 |
neg |
not,but |
| R2867 |
T11093 |
T11094 |
advmod |
when,transfected |
| R2868 |
T10953 |
T10952 |
compound |
AQP2,protein |
| R2869 |
T11094 |
T11078 |
conj |
transfected,transfected |
| R287 |
T2499 |
T2498 |
amod |
inherited,forms |
| R2870 |
T11095 |
T11094 |
nsubjpass |
GFP,transfected |
| R2871 |
T10954 |
T10948 |
aux |
can,rescue |
| R2872 |
T11096 |
T11095 |
prep |
by,GFP |
| R2873 |
T10955 |
T10956 |
det |
a,protein |
| R2874 |
T10956 |
T10948 |
dobj |
protein,rescue |
| R2875 |
T10957 |
T10958 |
npadvmod |
translocation,defective |
| R2876 |
T11097 |
T11096 |
pobj |
itself,by |
| R2877 |
T11098 |
T11094 |
auxpass |
was,transfected |
| R2878 |
T11099 |
T11094 |
advmod |
transiently,transfected |
| R2879 |
T11100 |
T11094 |
prep |
into,transfected |
| R288 |
T2501 |
T2502 |
advmod |
either,linked |
| R2880 |
T11101 |
T11102 |
compound |
MDCK,cells |
| R2881 |
T10958 |
T10956 |
amod |
defective,protein |
| R2882 |
T11102 |
T11100 |
pobj |
cells,into |
| R2883 |
T11103 |
T11104 |
advmod |
stably,expressing |
| R2884 |
T11104 |
T11102 |
acl |
expressing,cells |
| R2885 |
T10959 |
T10958 |
punct |
-,defective |
| R2886 |
T11105 |
T11106 |
amod |
wild,type |
| R2887 |
T11106 |
T11108 |
compound |
type,AQP2 |
| R2888 |
T11107 |
T11106 |
punct |
-,type |
| R2889 |
T10960 |
T10956 |
compound |
mutant,protein |
| R289 |
T2502 |
T2500 |
acomp |
linked,are |
| R2890 |
T11108 |
T11104 |
dobj |
AQP2,expressing |
| R2891 |
T11109 |
T11110 |
punct |
(,blots |
| R2892 |
T10961 |
T10956 |
punct |
", ",protein |
| R2893 |
T11110 |
T11070 |
parataxis |
blots,coimmunoprecipitated |
| R2894 |
T11111 |
T11110 |
dep |
Figure,blots |
| R2895 |
T11112 |
T11111 |
nummod |
5B,Figure |
| R2896 |
T10962 |
T10963 |
compound |
AQP2,P262L |
| R2897 |
T11113 |
T11110 |
punct |
", ",blots |
| R2898 |
T11114 |
T11110 |
amod |
upper,blots |
| R2899 |
T11115 |
T11110 |
punct |
),blots |
| R29 |
T627 |
T625 |
prep |
in,concentrate |
| R290 |
T2503 |
T2502 |
npadvmod |
X,linked |
| R2900 |
T10963 |
T10956 |
appos |
P262L,protein |
| R2901 |
T11116 |
T11070 |
punct |
.,coimmunoprecipitated |
| R2902 |
T10964 |
T10963 |
punct |
-,P262L |
| R2903 |
T11118 |
T11119 |
compound |
Western,blot |
| R2904 |
T11119 |
T11120 |
nsubj |
blot,showed |
| R2905 |
T10965 |
T10948 |
punct |
", ",rescue |
| R2906 |
T11121 |
T11119 |
prep |
of,blot |
| R2907 |
T11122 |
T11123 |
amod |
total,membranes |
| R2908 |
T11123 |
T11121 |
pobj |
membranes,of |
| R2909 |
T10966 |
T10967 |
advmod |
when,coexpressed |
| R291 |
T2504 |
T2502 |
punct |
-,linked |
| R2910 |
T11124 |
T11125 |
mark |
that,expressed |
| R2911 |
T11125 |
T11120 |
ccomp |
expressed,showed |
| R2912 |
T11126 |
T11127 |
amod |
wild,type |
| R2913 |
T10967 |
T10948 |
advcl |
coexpressed,rescue |
| R2914 |
T11127 |
T11129 |
compound |
type,AQP2 |
| R2915 |
T11128 |
T11127 |
punct |
-,type |
| R2916 |
T11129 |
T11125 |
nsubjpass |
AQP2,expressed |
| R2917 |
T10968 |
T10969 |
det |
the,two |
| R2918 |
T11130 |
T11125 |
auxpass |
is,expressed |
| R2919 |
T11131 |
T11125 |
advmod |
equivalently,expressed |
| R292 |
T2505 |
T2502 |
prep |
as,linked |
| R2920 |
T10969 |
T10967 |
nsubjpass |
two,coexpressed |
| R2921 |
T11132 |
T11125 |
prep |
in,expressed |
| R2922 |
T11133 |
T11134 |
det |
all,cases |
| R2923 |
T11134 |
T11132 |
pobj |
cases,in |
| R2924 |
T11135 |
T11134 |
nummod |
three,cases |
| R2925 |
T10970 |
T10967 |
auxpass |
are,coexpressed |
| R2926 |
T11136 |
T11137 |
punct |
(,blots |
| R2927 |
T11137 |
T11120 |
parataxis |
blots,showed |
| R2928 |
T11138 |
T11137 |
dep |
Figure,blots |
| R2929 |
T11139 |
T11138 |
nummod |
5B,Figure |
| R293 |
T2506 |
T2507 |
det |
a,consequence |
| R2930 |
T11140 |
T11137 |
punct |
", ",blots |
| R2931 |
T11141 |
T11137 |
amod |
lower,blots |
| R2932 |
T10971 |
T10967 |
prep |
in,coexpressed |
| R2933 |
T11142 |
T11137 |
punct |
),blots |
| R2934 |
T11143 |
T11120 |
punct |
.,showed |
| R2935 |
T11145 |
T11146 |
mark |
If,interacting |
| R2936 |
T10972 |
T10973 |
compound |
MDCK,cells |
| R2937 |
T10973 |
T10971 |
pobj |
cells,in |
| R2938 |
T11146 |
T11155 |
advcl |
interacting,is |
| R2939 |
T10974 |
T10975 |
punct |
[,25 |
| R294 |
T2507 |
T2505 |
pobj |
consequence,as |
| R2940 |
T11147 |
T11148 |
amod |
wild,type |
| R2941 |
T11148 |
T11150 |
nmod |
type,proteins |
| R2942 |
T11149 |
T11148 |
punct |
-,type |
| R2943 |
T11150 |
T11146 |
nsubj |
proteins,interacting |
| R2944 |
T10975 |
T10943 |
parataxis |
25,shown |
| R2945 |
T11151 |
T11148 |
cc |
and,type |
| R2946 |
T11152 |
T11148 |
conj |
mutant,type |
| R2947 |
T11153 |
T11146 |
aux |
are,interacting |
| R2948 |
T10976 |
T10975 |
punct |
],25 |
| R2949 |
T11154 |
T11146 |
advmod |
indeed,interacting |
| R295 |
T2508 |
T2507 |
prep |
of,consequence |
| R2950 |
T11156 |
T11146 |
prep |
in,interacting |
| R2951 |
T10977 |
T10943 |
punct |
.,shown |
| R2952 |
T11157 |
T11158 |
det |
the,cell |
| R2953 |
T11158 |
T11156 |
pobj |
cell,in |
| R2954 |
T11159 |
T11155 |
punct |
", ",is |
| R2955 |
T10979 |
T10980 |
prep |
In,rescue |
| R2956 |
T11160 |
T11161 |
det |
this,interaction |
| R2957 |
T11161 |
T11155 |
nsubj |
interaction,is |
| R2958 |
T11162 |
T11155 |
acomp |
sufficient,is |
| R2959 |
T11163 |
T11164 |
aux |
to,rescue |
| R296 |
T2509 |
T2508 |
pobj |
mutation,of |
| R2960 |
T10981 |
T10982 |
det |
the,ducts |
| R2961 |
T11164 |
T11162 |
xcomp |
rescue,sufficient |
| R2962 |
T11165 |
T11166 |
det |
the,localization |
| R2963 |
T11166 |
T11164 |
dobj |
localization,rescue |
| R2964 |
T10982 |
T10979 |
pobj |
ducts,In |
| R2965 |
T11167 |
T11166 |
prep |
of,localization |
| R2966 |
T11168 |
T11169 |
compound |
mutant,protein |
| R2967 |
T11169 |
T11167 |
pobj |
protein,of |
| R2968 |
T11170 |
T11155 |
punct |
?,is |
| R2969 |
T10983 |
T10982 |
amod |
collecting,ducts |
| R297 |
T2510 |
T2509 |
prep |
of,mutation |
| R2970 |
T11172 |
T11173 |
aux |
To,answer |
| R2971 |
T11173 |
T11174 |
advcl |
answer,used |
| R2972 |
T10984 |
T10982 |
prep |
from,ducts |
| R2973 |
T11175 |
T11176 |
det |
this,question |
| R2974 |
T11176 |
T11173 |
dobj |
question,answer |
| R2975 |
T10985 |
T10986 |
nmod |
Aqp2F204V,mice |
| R2976 |
T11177 |
T11174 |
punct |
", ",used |
| R2977 |
T11178 |
T11174 |
nsubj |
we,used |
| R2978 |
T10986 |
T10984 |
pobj |
mice,from |
| R2979 |
T11179 |
T11180 |
compound |
MDCK,cells |
| R298 |
T2511 |
T2512 |
det |
the,gene |
| R2980 |
T11180 |
T11174 |
dobj |
cells,used |
| R2981 |
T11181 |
T11182 |
advmod |
stably,transfected |
| R2982 |
T11182 |
T11180 |
acl |
transfected,cells |
| R2983 |
T11183 |
T11182 |
prep |
with,transfected |
| R2984 |
T11184 |
T11185 |
amod |
wild,type |
| R2985 |
T10987 |
T10985 |
punct |
/,Aqp2F204V |
| R2986 |
T11185 |
T11187 |
compound |
type,AQP2 |
| R2987 |
T11186 |
T11185 |
punct |
-,type |
| R2988 |
T11187 |
T11183 |
pobj |
AQP2,with |
| R2989 |
T10988 |
T10985 |
punct |
+,Aqp2F204V |
| R299 |
T2512 |
T2510 |
pobj |
gene,of |
| R2990 |
T11188 |
T11187 |
acl |
expressing,AQP2 |
| R2991 |
T11189 |
T11188 |
dobj |
vector,expressing |
| R2992 |
T11190 |
T11188 |
cc |
or,expressing |
| R2993 |
T10989 |
T10980 |
punct |
", ",rescue |
| R2994 |
T11191 |
T11188 |
conj |
with,expressing |
| R2995 |
T11192 |
T11193 |
amod |
empty,vector |
| R2996 |
T11193 |
T11191 |
pobj |
vector,with |
| R2997 |
T10990 |
T10991 |
det |
the,type |
| R2998 |
T11194 |
T11174 |
punct |
.,used |
| R2999 |
T11196 |
T11197 |
prep |
On,transfected |
| R3 |
T597 |
T596 |
pobj |
Mice,in |
| R30 |
T628 |
T627 |
pobj |
response,in |
| R300 |
T2513 |
T2512 |
compound |
Avpr2,gene |
| R3000 |
T11203 |
T11197 |
advmod |
transiently,transfected |
| R3001 |
T11198 |
T11196 |
pobj |
top,On |
| R3002 |
T11199 |
T11198 |
prep |
of,top |
| R3003 |
T11200 |
T11199 |
pobj |
these,of |
| R3004 |
T11201 |
T11197 |
punct |
", ",transfected |
| R3005 |
T11204 |
T11205 |
nmod |
AQP2,GFP |
| R3006 |
T11202 |
T11197 |
nsubj |
we,transfected |
| R3007 |
T11205 |
T11207 |
nmod |
GFP,constructs |
| R3008 |
T11206 |
T11205 |
punct |
-,GFP |
| R3009 |
T11207 |
T11197 |
dobj |
constructs,transfected |
| R301 |
T2514 |
T2515 |
punct |
[,2 |
| R3010 |
T11208 |
T11205 |
cc |
or,GFP |
| R3011 |
T11308 |
T11306 |
compound |
F204V,GFP |
| R3012 |
T11309 |
T11306 |
punct |
-,GFP |
| R3013 |
T11209 |
T11210 |
compound |
AQP2,GFP |
| R3014 |
T11310 |
T11295 |
prep |
to,localized |
| R3015 |
T11311 |
T11312 |
det |
the,surface |
| R3016 |
T11312 |
T11310 |
pobj |
surface,to |
| R3017 |
T11210 |
T11205 |
conj |
GFP,GFP |
| R3018 |
T11313 |
T11312 |
amod |
apical,surface |
| R3019 |
T11314 |
T11295 |
prep |
to,localized |
| R302 |
T2515 |
T2502 |
parataxis |
2,linked |
| R3020 |
T11211 |
T11210 |
punct |
-,GFP |
| R3021 |
T11315 |
T11316 |
amod |
varying,degrees |
| R3022 |
T11316 |
T11314 |
pobj |
degrees,to |
| R3023 |
T11317 |
T11318 |
punct |
(,images |
| R3024 |
T11212 |
T11210 |
compound |
F204V,GFP |
| R3025 |
T11318 |
T11295 |
parataxis |
images,localized |
| R3026 |
T11319 |
T11318 |
dep |
Figure,images |
| R3027 |
T11320 |
T11319 |
nummod |
5C,Figure |
| R3028 |
T11213 |
T11210 |
punct |
-,GFP |
| R3029 |
T11321 |
T11318 |
punct |
", ",images |
| R303 |
T2516 |
T2515 |
punct |
],2 |
| R3030 |
T11322 |
T11318 |
amod |
lower,images |
| R3031 |
T11214 |
T11207 |
compound |
expression,constructs |
| R3032 |
T11323 |
T11318 |
amod |
right,images |
| R3033 |
T11324 |
T11325 |
punct |
[,i |
| R3034 |
T11325 |
T11318 |
parataxis |
i,images |
| R3035 |
T11215 |
T11197 |
punct |
.,transfected |
| R3036 |
T11326 |
T11327 |
punct |
–,iii |
| R3037 |
T11327 |
T11325 |
prep |
iii,i |
| R3038 |
T11217 |
T11218 |
compound |
AQP2,GFP |
| R3039 |
T11328 |
T11325 |
punct |
],i |
| R304 |
T2517 |
T2502 |
punct |
", ",linked |
| R3040 |
T11329 |
T11318 |
punct |
),images |
| R3041 |
T11330 |
T11295 |
punct |
.,localized |
| R3042 |
T11218 |
T11220 |
nsubj |
GFP,localized |
| R3043 |
T11332 |
T11333 |
det |
The,images |
| R3044 |
T11333 |
T11336 |
nsubj |
images,shows |
| R3045 |
T11219 |
T11218 |
punct |
-,GFP |
| R3046 |
T11334 |
T11335 |
amod |
lower,right |
| R3047 |
T11335 |
T11333 |
amod |
right,images |
| R3048 |
T11221 |
T11220 |
prep |
to,localized |
| R3049 |
T11337 |
T11333 |
prep |
of,images |
| R305 |
T2518 |
T2502 |
cc |
or,linked |
| R3050 |
T11338 |
T11337 |
pobj |
Figure,of |
| R3051 |
T11339 |
T11338 |
nummod |
5C,Figure |
| R3052 |
T11222 |
T11223 |
det |
the,surface |
| R3053 |
T11340 |
T11341 |
nummod |
three,cells |
| R3054 |
T11341 |
T11336 |
dobj |
cells,shows |
| R3055 |
T11342 |
T11341 |
prep |
from,cells |
| R3056 |
T11223 |
T11221 |
pobj |
surface,to |
| R3057 |
T11343 |
T11344 |
det |
a,transfection |
| R3058 |
T11344 |
T11342 |
pobj |
transfection,from |
| R3059 |
T11345 |
T11344 |
amod |
single,transfection |
| R306 |
T2519 |
T2502 |
conj |
autosomal,linked |
| R3060 |
T11224 |
T11223 |
amod |
apical,surface |
| R3061 |
T11346 |
T11336 |
punct |
.,shows |
| R3062 |
T11348 |
T11349 |
det |
The,first |
| R3063 |
T11225 |
T11220 |
prep |
upon,localized |
| R3064 |
T11349 |
T11350 |
nsubj |
first,is |
| R3065 |
T11226 |
T11227 |
compound |
forskolin,stimulation |
| R3066 |
T11351 |
T11352 |
det |
a,cell |
| R3067 |
T11352 |
T11350 |
attr |
cell,is |
| R3068 |
T11353 |
T11352 |
amod |
nontransfected,cell |
| R3069 |
T11227 |
T11225 |
pobj |
stimulation,upon |
| R307 |
T2520 |
T2521 |
amod |
due,to |
| R3070 |
T11354 |
T11355 |
dep |
that,shows |
| R3071 |
T11355 |
T11352 |
relcl |
shows,cell |
| R3072 |
T11356 |
T11357 |
det |
the,localization |
| R3073 |
T11228 |
T11229 |
mark |
whether,transfected |
| R3074 |
T11357 |
T11355 |
dobj |
localization,shows |
| R3075 |
T11358 |
T11357 |
prep |
of,localization |
| R3076 |
T11359 |
T11360 |
det |
the,AQP2 |
| R3077 |
T11229 |
T11220 |
advcl |
transfected,localized |
| R3078 |
T11360 |
T11358 |
pobj |
AQP2,of |
| R3079 |
T11230 |
T11229 |
nsubjpass |
it,transfected |
| R308 |
T2521 |
T2519 |
prep |
to,autosomal |
| R3080 |
T11361 |
T11362 |
advmod |
stably,expressing |
| R3081 |
T11231 |
T11229 |
auxpass |
was,transfected |
| R3082 |
T11362 |
T11360 |
amod |
expressing,AQP2 |
| R3083 |
T11363 |
T11364 |
amod |
wild,type |
| R3084 |
T11232 |
T11229 |
advmod |
transiently,transfected |
| R3085 |
T11364 |
T11360 |
compound |
type,AQP2 |
| R3086 |
T11365 |
T11364 |
punct |
-,type |
| R3087 |
T11366 |
T11360 |
punct |
", ",AQP2 |
| R3088 |
T11367 |
T11368 |
dep |
which,is |
| R3089 |
T11368 |
T11360 |
relcl |
is,AQP2 |
| R309 |
T2522 |
T2521 |
pobj |
mutation,to |
| R3090 |
T11233 |
T11229 |
prep |
into,transfected |
| R3091 |
T11369 |
T11368 |
acomp |
apical,is |
| R3092 |
T11370 |
T11368 |
prep |
upon,is |
| R3093 |
T11371 |
T11372 |
compound |
forskolin,stimulation |
| R3094 |
T11234 |
T11235 |
npadvmod |
vector,only |
| R3095 |
T11372 |
T11370 |
pobj |
stimulation,upon |
| R3096 |
T11373 |
T11350 |
punct |
.,is |
| R3097 |
T11235 |
T11237 |
amod |
only,cells |
| R3098 |
T11375 |
T11376 |
det |
The,two |
| R3099 |
T11376 |
T11378 |
nsubj |
two,show |
| R31 |
T629 |
T628 |
prep |
to,response |
| R310 |
T2523 |
T2522 |
prep |
of,mutation |
| R3100 |
T11377 |
T11376 |
amod |
next,two |
| R3101 |
T11236 |
T11235 |
punct |
-,only |
| R3102 |
T11379 |
T11378 |
dobj |
expression,show |
| R3103 |
T11380 |
T11379 |
prep |
of,expression |
| R3104 |
T11237 |
T11233 |
pobj |
cells,into |
| R3105 |
T11381 |
T11382 |
preconj |
both,AQP2 |
| R3106 |
T11382 |
T11380 |
pobj |
AQP2,of |
| R3107 |
T11238 |
T11239 |
punct |
(,images |
| R3108 |
T11383 |
T11382 |
det |
the,AQP2 |
| R3109 |
T11384 |
T11382 |
amod |
stable,AQP2 |
| R311 |
T2524 |
T2525 |
det |
the,gene |
| R3110 |
T11385 |
T11386 |
amod |
wild,type |
| R3111 |
T11239 |
T11237 |
parataxis |
images,cells |
| R3112 |
T11386 |
T11382 |
compound |
type,AQP2 |
| R3113 |
T11387 |
T11386 |
punct |
-,type |
| R3114 |
T11388 |
T11382 |
cc |
and,AQP2 |
| R3115 |
T11240 |
T11239 |
dep |
Figure,images |
| R3116 |
T11389 |
T11390 |
det |
the,GFP |
| R3117 |
T11390 |
T11382 |
conj |
GFP,AQP2 |
| R3118 |
T11391 |
T11390 |
amod |
transient,GFP |
| R3119 |
T11241 |
T11240 |
nummod |
5C,Figure |
| R312 |
T2525 |
T2523 |
pobj |
gene,of |
| R3120 |
T11392 |
T11390 |
compound |
AQP2,GFP |
| R3121 |
T11393 |
T11390 |
punct |
-,GFP |
| R3122 |
T11394 |
T11390 |
compound |
F204V,GFP |
| R3123 |
T11242 |
T11239 |
punct |
", ",images |
| R3124 |
T11395 |
T11390 |
punct |
-,GFP |
| R3125 |
T11396 |
T11378 |
punct |
.,show |
| R3126 |
T11243 |
T11239 |
amod |
upper,images |
| R3127 |
T11398 |
T11399 |
prep |
In,was |
| R3128 |
T11399 |
T11411 |
ccomp |
was,were |
| R3129 |
T11244 |
T11239 |
amod |
left,images |
| R313 |
T2526 |
T2525 |
compound |
Aqp2,gene |
| R3130 |
T11400 |
T11398 |
pobj |
cell,In |
| R3131 |
T11401 |
T11400 |
punct |
(,cell |
| R3132 |
T11402 |
T11400 |
nummod |
ii,cell |
| R3133 |
T11403 |
T11400 |
punct |
),cell |
| R3134 |
T11245 |
T11239 |
punct |
),images |
| R3135 |
T11404 |
T11399 |
punct |
", ",was |
| R3136 |
T11405 |
T11399 |
nsubj |
localization,was |
| R3137 |
T11406 |
T11405 |
prep |
of,localization |
| R3138 |
T11407 |
T11408 |
amod |
wild,type |
| R3139 |
T11408 |
T11410 |
compound |
type,AQP2 |
| R314 |
T2527 |
T2528 |
punct |
[,3 |
| R3140 |
T11409 |
T11408 |
punct |
-,type |
| R3141 |
T11246 |
T11233 |
cc |
or,into |
| R3142 |
T11410 |
T11406 |
pobj |
AQP2,of |
| R3143 |
T11412 |
T11399 |
acomp |
indistinguishable,was |
| R3144 |
T11247 |
T11233 |
conj |
into,into |
| R3145 |
T11248 |
T11249 |
amod |
wild,type |
| R3146 |
T11249 |
T11251 |
compound |
type,cells |
| R3147 |
T11413 |
T11412 |
prep |
from,indistinguishable |
| R3148 |
T11414 |
T11415 |
compound |
AQP2,GFP |
| R3149 |
T11250 |
T11249 |
punct |
-,type |
| R315 |
T2528 |
T2519 |
parataxis |
3,autosomal |
| R3150 |
T11251 |
T11247 |
pobj |
cells,into |
| R3151 |
T11415 |
T11413 |
pobj |
GFP,from |
| R3152 |
T11416 |
T11415 |
punct |
-,GFP |
| R3153 |
T11252 |
T11251 |
compound |
AQP2,cells |
| R3154 |
T11417 |
T11415 |
compound |
F204V,GFP |
| R3155 |
T11418 |
T11415 |
punct |
-,GFP |
| R3156 |
T11419 |
T11411 |
punct |
;,were |
| R3157 |
T11253 |
T11254 |
punct |
(,Figure |
| R3158 |
T11420 |
T11411 |
nsubj |
both,were |
| R3159 |
T11421 |
T11411 |
acomp |
apical,were |
| R316 |
T2529 |
T2528 |
punct |
],3 |
| R3160 |
T11254 |
T11251 |
parataxis |
Figure,cells |
| R3161 |
T11422 |
T11411 |
prep |
upon,were |
| R3162 |
T11423 |
T11424 |
compound |
forskolin,stimulation |
| R3163 |
T11255 |
T11254 |
nummod |
5C,Figure |
| R3164 |
T11424 |
T11422 |
pobj |
stimulation,upon |
| R3165 |
T11425 |
T11411 |
punct |
.,were |
| R3166 |
T11256 |
T11254 |
punct |
", ",Figure |
| R3167 |
T11427 |
T11428 |
mark |
Although,was |
| R3168 |
T11428 |
T11431 |
advcl |
was,localized |
| R3169 |
T11257 |
T11258 |
amod |
upper,right |
| R317 |
T2530 |
T2500 |
punct |
.,are |
| R3170 |
T11429 |
T11430 |
det |
the,effect |
| R3171 |
T11430 |
T11428 |
nsubj |
effect,was |
| R3172 |
T11258 |
T11254 |
amod |
right,Figure |
| R3173 |
T11432 |
T11428 |
acomp |
subtle,was |
| R3174 |
T11433 |
T11428 |
prep |
in,was |
| R3175 |
T11259 |
T11254 |
punct |
),Figure |
| R3176 |
T11434 |
T11433 |
pobj |
cell,in |
| R3177 |
T11435 |
T11434 |
punct |
(,cell |
| R3178 |
T11436 |
T11434 |
nummod |
iii,cell |
| R3179 |
T11260 |
T11220 |
punct |
.,localized |
| R318 |
T2532 |
T2533 |
nsubj |
Aquaporin,is |
| R3180 |
T11437 |
T11434 |
punct |
),cell |
| R3181 |
T11438 |
T11431 |
punct |
", ",localized |
| R3182 |
T11439 |
T11440 |
compound |
AQP2,GFP |
| R3183 |
T11262 |
T11263 |
compound |
AQP2,GFP |
| R3184 |
T11440 |
T11431 |
nsubjpass |
GFP,localized |
| R3185 |
T11441 |
T11440 |
punct |
-,GFP |
| R3186 |
T11442 |
T11440 |
compound |
F204V,GFP |
| R3187 |
T11443 |
T11440 |
punct |
-,GFP |
| R3188 |
T11444 |
T11431 |
auxpass |
was,localized |
| R3189 |
T11445 |
T11431 |
advmod |
partly,localized |
| R319 |
T2534 |
T2532 |
punct |
-,Aquaporin |
| R3190 |
T11446 |
T11431 |
prep |
to,localized |
| R3191 |
T11263 |
T11267 |
nsubj |
GFP,showed |
| R3192 |
T11447 |
T11448 |
det |
the,surface |
| R3193 |
T11448 |
T11446 |
pobj |
surface,to |
| R3194 |
T11449 |
T11448 |
amod |
apical,surface |
| R3195 |
T11264 |
T11263 |
punct |
-,GFP |
| R3196 |
T11450 |
T11431 |
punct |
.,localized |
| R3197 |
T11452 |
T11453 |
advmod |
Generally,was |
| R3198 |
T11265 |
T11263 |
compound |
F204V,GFP |
| R3199 |
T11454 |
T11453 |
punct |
", ",was |
| R32 |
T630 |
T629 |
pobj |
vasopressin,to |
| R320 |
T2535 |
T2532 |
nummod |
2,Aquaporin |
| R3200 |
T11266 |
T11263 |
punct |
-,GFP |
| R3201 |
T11455 |
T11456 |
det |
the,localization |
| R3202 |
T11456 |
T11453 |
nsubj |
localization,was |
| R3203 |
T11457 |
T11456 |
prep |
of,localization |
| R3204 |
T11268 |
T11267 |
punct |
", ",showed |
| R3205 |
T11458 |
T11459 |
compound |
AQP2,GFP |
| R3206 |
T11459 |
T11457 |
pobj |
GFP,of |
| R3207 |
T11460 |
T11459 |
punct |
-,GFP |
| R3208 |
T11461 |
T11459 |
compound |
F204V,GFP |
| R3209 |
T11269 |
T11270 |
advmod |
when,expressed |
| R321 |
T2536 |
T2532 |
punct |
(,Aquaporin |
| R3210 |
T11462 |
T11459 |
punct |
-,GFP |
| R3211 |
T11463 |
T11453 |
advmod |
clearly,was |
| R3212 |
T11464 |
T11465 |
advmod |
more,apical |
| R3213 |
T11270 |
T11267 |
advcl |
expressed,showed |
| R3214 |
T11465 |
T11453 |
acomp |
apical,was |
| R3215 |
T11466 |
T11467 |
advmod |
when,expressed |
| R3216 |
T11467 |
T11453 |
advcl |
expressed,was |
| R3217 |
T11271 |
T11270 |
prep |
by,expressed |
| R3218 |
T11468 |
T11469 |
amod |
wild,type |
| R3219 |
T11469 |
T11471 |
compound |
type,AQP2 |
| R322 |
T2537 |
T2532 |
appos |
AQP2,Aquaporin |
| R3220 |
T11470 |
T11469 |
punct |
-,type |
| R3221 |
T11272 |
T11273 |
amod |
transient,transfection |
| R3222 |
T11471 |
T11467 |
nsubjpass |
AQP2,expressed |
| R3223 |
T11472 |
T11467 |
auxpass |
was,expressed |
| R3224 |
T11473 |
T11467 |
advmod |
also,expressed |
| R3225 |
T11273 |
T11271 |
pobj |
transfection,by |
| R3226 |
T11474 |
T11453 |
punct |
.,was |
| R3227 |
T11274 |
T11270 |
prep |
into,expressed |
| R3228 |
T11476 |
T11477 |
aux |
To,confirm |
| R3229 |
T11477 |
T11478 |
advcl |
confirm,transfected |
| R323 |
T2538 |
T2533 |
punct |
),is |
| R3230 |
T11275 |
T11276 |
npadvmod |
vector,only |
| R3231 |
T11479 |
T11480 |
det |
these,results |
| R3232 |
T11480 |
T11477 |
dobj |
results,confirm |
| R3233 |
T11276 |
T11277 |
amod |
only,cells |
| R3234 |
T11481 |
T11477 |
advmod |
biochemically,confirm |
| R3235 |
T11482 |
T11478 |
punct |
", ",transfected |
| R3236 |
T11483 |
T11478 |
nsubj |
we,transfected |
| R3237 |
T11277 |
T11274 |
pobj |
cells,into |
| R3238 |
T11484 |
T11485 |
det |
the,lines |
| R3239 |
T11485 |
T11478 |
dobj |
lines,transfected |
| R324 |
T2539 |
T2540 |
det |
a,protein |
| R3240 |
T11486 |
T11485 |
amod |
same,lines |
| R3241 |
T11487 |
T11485 |
compound |
cell,lines |
| R3242 |
T11488 |
T11485 |
punct |
(,lines |
| R3243 |
T11278 |
T11267 |
punct |
", ",showed |
| R3244 |
T11489 |
T11490 |
amod |
wild,type |
| R3245 |
T11490 |
T11492 |
compound |
type,AQP2 |
| R3246 |
T11491 |
T11490 |
punct |
-,type |
| R3247 |
T11279 |
T11280 |
det |
a,pattern |
| R3248 |
T11492 |
T11485 |
appos |
AQP2,lines |
| R3249 |
T11493 |
T11492 |
cc |
or,AQP2 |
| R325 |
T2540 |
T2533 |
attr |
protein,is |
| R3250 |
T11494 |
T11492 |
conj |
vector,AQP2 |
| R3251 |
T11280 |
T11267 |
dobj |
pattern,showed |
| R3252 |
T11495 |
T11485 |
punct |
),lines |
| R3253 |
T11496 |
T11478 |
prep |
with,transfected |
| R3254 |
T11497 |
T11498 |
compound |
F204V,GFP |
| R3255 |
T11281 |
T11280 |
amod |
diffuse,pattern |
| R3256 |
T11498 |
T11496 |
pobj |
GFP,with |
| R3257 |
T11499 |
T11498 |
punct |
-,GFP |
| R3258 |
T11500 |
T11478 |
punct |
", ",transfected |
| R3259 |
T11282 |
T11280 |
amod |
cytoplasmic,pattern |
| R326 |
T2541 |
T2542 |
npadvmod |
pore,forming |
| R3260 |
T11501 |
T11478 |
conj |
biotinylated,transfected |
| R3261 |
T11283 |
T11280 |
compound |
distribution,pattern |
| R3262 |
T11502 |
T11503 |
compound |
surface,proteins |
| R3263 |
T11284 |
T11285 |
punct |
(,left |
| R3264 |
T11503 |
T11501 |
dobj |
proteins,biotinylated |
| R3265 |
T11504 |
T11501 |
prep |
after,biotinylated |
| R3266 |
T11505 |
T11506 |
compound |
forskolin,stimulation |
| R3267 |
T11285 |
T11267 |
parataxis |
left,showed |
| R3268 |
T11506 |
T11504 |
pobj |
stimulation,after |
| R3269 |
T11507 |
T11501 |
punct |
", ",biotinylated |
| R327 |
T2542 |
T2540 |
amod |
forming,protein |
| R3270 |
T11286 |
T11285 |
dep |
Figure,left |
| R3271 |
T11508 |
T11501 |
cc |
and,biotinylated |
| R3272 |
T11509 |
T11501 |
conj |
precipitated,biotinylated |
| R3273 |
T11510 |
T11511 |
det |
the,proteins |
| R3274 |
T11287 |
T11286 |
nummod |
5C,Figure |
| R3275 |
T11511 |
T11509 |
dobj |
proteins,precipitated |
| R3276 |
T11512 |
T11511 |
amod |
biotinylated,proteins |
| R3277 |
T11288 |
T11285 |
punct |
", ",left |
| R3278 |
T11513 |
T11514 |
punct |
(,Figure |
| R3279 |
T11514 |
T11509 |
parataxis |
Figure,precipitated |
| R328 |
T2543 |
T2542 |
punct |
-,forming |
| R3280 |
T11515 |
T11514 |
nummod |
5D,Figure |
| R3281 |
T11289 |
T11285 |
amod |
lower,left |
| R3282 |
T11516 |
T11514 |
punct |
),Figure |
| R3283 |
T11517 |
T11478 |
punct |
.,transfected |
| R3284 |
T11290 |
T11285 |
punct |
),left |
| R3285 |
T11291 |
T11267 |
punct |
.,showed |
| R3286 |
T11293 |
T11294 |
advmod |
When,expressed |
| R3287 |
T11519 |
T11520 |
compound |
AQP2,GFP |
| R3288 |
T11520 |
T11524 |
nsubjpass |
GFP,expressed |
| R3289 |
T11294 |
T11295 |
advcl |
expressed,localized |
| R329 |
T2544 |
T2540 |
acl |
belonging,protein |
| R3290 |
T11521 |
T11520 |
punct |
-,GFP |
| R3291 |
T11522 |
T11520 |
compound |
F204V,GFP |
| R3292 |
T11523 |
T11520 |
punct |
-,GFP |
| R3293 |
T11525 |
T11524 |
auxpass |
is,expressed |
| R3294 |
T11296 |
T11294 |
prep |
in,expressed |
| R3295 |
T11526 |
T11527 |
advmod |
approximately,equally |
| R3296 |
T11527 |
T11524 |
advmod |
equally,expressed |
| R3297 |
T11528 |
T11524 |
prep |
in,expressed |
| R3298 |
T11529 |
T11530 |
det |
both,lines |
| R3299 |
T11530 |
T11528 |
pobj |
lines,in |
| R33 |
T631 |
T612 |
punct |
.,is |
| R330 |
T2545 |
T2544 |
prep |
to,belonging |
| R3300 |
T11297 |
T11298 |
amod |
wild,type |
| R3301 |
T11531 |
T11530 |
compound |
cell,lines |
| R3302 |
T11532 |
T11533 |
punct |
(,cells |
| R3303 |
T11533 |
T11524 |
parataxis |
cells,expressed |
| R3304 |
T11298 |
T11300 |
compound |
type,cells |
| R3305 |
T11534 |
T11533 |
dep |
Figure,cells |
| R3306 |
T11535 |
T11534 |
nummod |
5D,Figure |
| R3307 |
T11536 |
T11533 |
punct |
", ",cells |
| R3308 |
T11299 |
T11298 |
punct |
-,type |
| R3309 |
T11537 |
T11533 |
amod |
total,cells |
| R331 |
T2546 |
T2547 |
det |
a,family |
| R3310 |
T11538 |
T11533 |
punct |
),cells |
| R3311 |
T11300 |
T11296 |
pobj |
cells,in |
| R3312 |
T11539 |
T11524 |
punct |
", ",expressed |
| R3313 |
T11540 |
T11524 |
cc |
but,expressed |
| R3314 |
T11541 |
T11542 |
auxpass |
is,biotinylated |
| R3315 |
T11301 |
T11300 |
compound |
AQP2,cells |
| R3316 |
T11542 |
T11524 |
conj |
biotinylated,expressed |
| R3317 |
T11543 |
T11544 |
advmod |
only,expressed |
| R3318 |
T11544 |
T11542 |
ccomp |
expressed,biotinylated |
| R3319 |
T11302 |
T11295 |
punct |
", ",localized |
| R332 |
T2547 |
T2545 |
pobj |
family,to |
| R3320 |
T11545 |
T11544 |
advmod |
when,expressed |
| R3321 |
T11546 |
T11547 |
amod |
wild,type |
| R3322 |
T11547 |
T11549 |
compound |
type,AQP2 |
| R3323 |
T11303 |
T11295 |
advmod |
however,localized |
| R3324 |
T11548 |
T11547 |
punct |
-,type |
| R3325 |
T11549 |
T11544 |
nsubjpass |
AQP2,expressed |
| R3326 |
T11550 |
T11544 |
auxpass |
is,expressed |
| R3327 |
T11304 |
T11295 |
punct |
", ",localized |
| R3328 |
T11551 |
T11544 |
advmod |
also,expressed |
| R3329 |
T11552 |
T11553 |
punct |
(,Figure |
| R333 |
T2548 |
T2547 |
prep |
of,family |
| R3330 |
T11553 |
T11542 |
parataxis |
Figure,biotinylated |
| R3331 |
T11305 |
T11306 |
compound |
AQP2,GFP |
| R3332 |
T11554 |
T11553 |
nummod |
5D,Figure |
| R3333 |
T11555 |
T11553 |
punct |
", ",Figure |
| R3334 |
T11556 |
T11557 |
npadvmod |
surface,biotinylated |
| R3335 |
T11306 |
T11295 |
nsubj |
GFP,localized |
| R3336 |
T11557 |
T11553 |
amod |
biotinylated,Figure |
| R3337 |
T11558 |
T11553 |
punct |
),Figure |
| R3338 |
T11559 |
T11524 |
punct |
.,expressed |
| R3339 |
T11307 |
T11306 |
punct |
-,GFP |
| R334 |
T2549 |
T2550 |
compound |
water,channels |
| R3340 |
T11561 |
T11562 |
mark |
Since,are |
| R3341 |
T11562 |
T11567 |
advcl |
are,indicate |
| R3342 |
T11563 |
T11564 |
advmod |
only,proteins |
| R3343 |
T11564 |
T11562 |
nsubj |
proteins,are |
| R3344 |
T11565 |
T11566 |
compound |
cell,surface |
| R3345 |
T11566 |
T11564 |
compound |
surface,proteins |
| R3346 |
T11568 |
T11562 |
acomp |
accessible,are |
| R3347 |
T11569 |
T11568 |
prep |
to,accessible |
| R3348 |
T11570 |
T11569 |
pobj |
biotin,to |
| R3349 |
T11571 |
T11567 |
punct |
", ",indicate |
| R335 |
T2550 |
T2548 |
pobj |
channels,of |
| R3350 |
T11572 |
T11573 |
det |
these,results |
| R3351 |
T11573 |
T11567 |
nsubj |
results,indicate |
| R3352 |
T11574 |
T11575 |
mark |
that,transported |
| R3353 |
T11575 |
T11567 |
ccomp |
transported,indicate |
| R3354 |
T11576 |
T11577 |
compound |
AQP2,F204V |
| R3355 |
T11577 |
T11575 |
nsubjpass |
F204V,transported |
| R3356 |
T11578 |
T11577 |
punct |
-,F204V |
| R3357 |
T11579 |
T11575 |
auxpass |
is,transported |
| R3358 |
T11580 |
T11575 |
prep |
to,transported |
| R3359 |
T11581 |
T11582 |
det |
the,surface |
| R336 |
T2551 |
T2552 |
punct |
[,4 |
| R3360 |
T11582 |
T11580 |
pobj |
surface,to |
| R3361 |
T11583 |
T11582 |
compound |
cell,surface |
| R3362 |
T11584 |
T11585 |
advmod |
when,is |
| R3363 |
T11585 |
T11575 |
advcl |
is,transported |
| R3364 |
T11586 |
T11587 |
amod |
wild,type |
| R3365 |
T11587 |
T11589 |
compound |
type,AQP2 |
| R3366 |
T11588 |
T11587 |
punct |
-,type |
| R3367 |
T11589 |
T11585 |
nsubj |
AQP2,is |
| R3368 |
T11590 |
T11585 |
acomp |
present,is |
| R3369 |
T11591 |
T11585 |
punct |
", ",is |
| R337 |
T2552 |
T2533 |
parataxis |
4,is |
| R3370 |
T11592 |
T11585 |
cc |
but,is |
| R3371 |
T11593 |
T11592 |
neg |
not,but |
| R3372 |
T11594 |
T11585 |
conj |
on,is |
| R3373 |
T11595 |
T11596 |
poss |
its,own |
| R3374 |
T11596 |
T11594 |
pobj |
own,on |
| R3375 |
T11597 |
T11567 |
punct |
.,indicate |
| R3378 |
T14172 |
T14173 |
compound |
Aqp2F204,F204V |
| R3379 |
T14173 |
T14175 |
compound |
F204V,mice |
| R338 |
T2553 |
T2552 |
punct |
],4 |
| R3380 |
T14174 |
T14173 |
punct |
/,F204V |
| R3381 |
T14175 |
T14176 |
nsubj |
mice,are |
| R3382 |
T14177 |
T14176 |
acomp |
viable,are |
| R3383 |
T14178 |
T14176 |
cc |
and,are |
| R3384 |
T14179 |
T14176 |
conj |
grow,are |
| R3385 |
T14180 |
T14179 |
cc |
and,grow |
| R3386 |
T14181 |
T14179 |
conj |
reproduce,grow |
| R3387 |
T14182 |
T14181 |
advmod |
normally,reproduce |
| R3388 |
T14183 |
T14176 |
punct |
.,are |
| R3389 |
T14185 |
T14186 |
nsubj |
They,are |
| R339 |
T2554 |
T2533 |
punct |
", ",is |
| R3390 |
T14187 |
T14186 |
punct |
", ",are |
| R3391 |
T14188 |
T14186 |
advmod |
however,are |
| R3392 |
T14189 |
T14186 |
punct |
", ",are |
| R3393 |
T14190 |
T14191 |
advmod |
severely,defective |
| R3394 |
T14191 |
T14186 |
acomp |
defective,are |
| R3395 |
T14192 |
T14191 |
prep |
in,defective |
| R3396 |
T14193 |
T14194 |
poss |
their,ability |
| R3397 |
T14194 |
T14192 |
pobj |
ability,in |
| R3398 |
T14195 |
T14196 |
aux |
to,concentrate |
| R3399 |
T14196 |
T14194 |
acl |
concentrate,ability |
| R34 |
T633 |
T634 |
amod |
Human,kindreds |
| R340 |
T2555 |
T2533 |
cc |
and,is |
| R3400 |
T14197 |
T14196 |
dobj |
urine,concentrate |
| R3401 |
T14198 |
T14186 |
punct |
", ",are |
| R3402 |
T14199 |
T14186 |
advcl |
leading,are |
| R3403 |
T14200 |
T14199 |
prep |
to,leading |
| R3404 |
T14201 |
T14202 |
amod |
increased,output |
| R3405 |
T14202 |
T14200 |
pobj |
output,to |
| R3406 |
T14203 |
T14202 |
compound |
urine,output |
| R3407 |
T14204 |
T14202 |
cc |
and,output |
| R3408 |
T14205 |
T14206 |
compound |
water,intake |
| R3409 |
T14206 |
T14202 |
conj |
intake,output |
| R341 |
T2556 |
T2557 |
nsubjpass |
it,expressed |
| R3410 |
T14207 |
T14186 |
punct |
", ",are |
| R3411 |
T14208 |
T14209 |
advmod |
thus,making |
| R3412 |
T14209 |
T14186 |
advcl |
making,are |
| R3413 |
T14210 |
T14211 |
nsubj |
them,model |
| R3414 |
T14211 |
T14209 |
ccomp |
model,making |
| R3415 |
T14212 |
T14211 |
det |
the,model |
| R3416 |
T14213 |
T14211 |
amod |
first,model |
| R3417 |
T14214 |
T14211 |
compound |
mouse,model |
| R3418 |
T14215 |
T14211 |
prep |
of,model |
| R3419 |
T14216 |
T14215 |
pobj |
NDI,of |
| R342 |
T2557 |
T2533 |
conj |
expressed,is |
| R3420 |
T14217 |
T14218 |
aux |
to,survive |
| R3421 |
T14218 |
T14211 |
advcl |
survive,model |
| R3422 |
T14219 |
T14218 |
prep |
to,survive |
| R3423 |
T14220 |
T14219 |
pobj |
maturity,to |
| R3424 |
T14221 |
T14186 |
punct |
.,are |
| R3425 |
T14223 |
T14224 |
prep |
In,caused |
| R3426 |
T14225 |
T14223 |
pobj |
humans,In |
| R3427 |
T14226 |
T14224 |
punct |
", ",caused |
| R3428 |
T14227 |
T14224 |
nsubjpass |
NDI,caused |
| R3429 |
T14228 |
T14224 |
auxpass |
is,caused |
| R343 |
T2558 |
T2557 |
auxpass |
is,expressed |
| R3430 |
T14229 |
T14224 |
agent |
by,caused |
| R3431 |
T14230 |
T14229 |
pobj |
mutations,by |
| R3432 |
T14231 |
T14230 |
prep |
in,mutations |
| R3433 |
T14232 |
T14231 |
pobj |
Avpr2,in |
| R3434 |
T14233 |
T14232 |
cc |
or,Avpr2 |
| R3435 |
T14234 |
T14232 |
conj |
Aqp2,Avpr2 |
| R3436 |
T14235 |
T14224 |
punct |
.,caused |
| R3437 |
T14237 |
T14238 |
nsubj |
Knockout,gave |
| R3438 |
T14239 |
T14237 |
prep |
of,Knockout |
| R3439 |
T14240 |
T14241 |
det |
the,gene |
| R344 |
T2559 |
T2557 |
prep |
in,expressed |
| R3440 |
T14241 |
T14239 |
pobj |
gene,of |
| R3441 |
T14242 |
T14243 |
npadvmod |
X,linked |
| R3442 |
T14243 |
T14241 |
amod |
linked,gene |
| R3443 |
T14244 |
T14243 |
punct |
-,linked |
| R3444 |
T14245 |
T14241 |
compound |
Avpr2,gene |
| R3445 |
T14246 |
T14237 |
prep |
in,Knockout |
| R3446 |
T14247 |
T14246 |
pobj |
mice,in |
| R3447 |
T14248 |
T14249 |
punct |
[,15 |
| R3448 |
T14249 |
T14237 |
parataxis |
15,Knockout |
| R3449 |
T14250 |
T14249 |
punct |
],15 |
| R345 |
T2560 |
T2561 |
amod |
collecting,duct |
| R3450 |
T14251 |
T14252 |
det |
an,phenotype |
| R3451 |
T14252 |
T14238 |
dobj |
phenotype,gave |
| R3452 |
T14253 |
T14254 |
npadvmod |
NDI,like |
| R3453 |
T14254 |
T14252 |
amod |
like,phenotype |
| R3454 |
T14255 |
T14254 |
punct |
-,like |
| R3455 |
T14256 |
T14238 |
prep |
in,gave |
| R3456 |
T14257 |
T14258 |
amod |
male,neonates |
| R3457 |
T14258 |
T14256 |
pobj |
neonates,in |
| R3458 |
T14259 |
T14258 |
punct |
", ",neonates |
| R3459 |
T14260 |
T14258 |
amod |
hemizygous,neonates |
| R346 |
T2561 |
T2563 |
nmod |
duct,cells |
| R3460 |
T14261 |
T14238 |
punct |
", ",gave |
| R3461 |
T14262 |
T14238 |
cc |
but,gave |
| R3462 |
T14263 |
T14264 |
det |
the,phenotype |
| R3463 |
T14264 |
T14265 |
nsubjpass |
phenotype,assessed |
| R3464 |
T14265 |
T14238 |
conj |
assessed,gave |
| R3465 |
T14266 |
T14265 |
aux |
could,assessed |
| R3466 |
T14267 |
T14265 |
neg |
not,assessed |
| R3467 |
T14268 |
T14265 |
auxpass |
be,assessed |
| R3468 |
T14269 |
T14265 |
prep |
in,assessed |
| R3469 |
T14270 |
T14269 |
pobj |
adults,in |
| R347 |
T2562 |
T2561 |
punct |
-,duct |
| R3470 |
T14271 |
T14272 |
mark |
as,died |
| R3471 |
T14272 |
T14265 |
advcl |
died,assessed |
| R3472 |
T14273 |
T14274 |
det |
the,mice |
| R3473 |
T14274 |
T14272 |
nsubj |
mice,died |
| R3474 |
T14275 |
T14272 |
prep |
within,died |
| R3475 |
T14276 |
T14277 |
nummod |
1,wk |
| R3476 |
T14277 |
T14275 |
pobj |
wk,within |
| R3477 |
T14278 |
T14277 |
prep |
of,wk |
| R3478 |
T14279 |
T14278 |
pobj |
birth,of |
| R3479 |
T14280 |
T14265 |
punct |
.,assessed |
| R348 |
T2563 |
T2559 |
pobj |
cells,in |
| R3480 |
T14282 |
T14283 |
det |
The,females |
| R3481 |
T14283 |
T14286 |
nsubj |
females,showed |
| R3482 |
T14284 |
T14283 |
amod |
adult,females |
| R3483 |
T14285 |
T14283 |
amod |
heterozygous,females |
| R3484 |
T14287 |
T14288 |
det |
a,tendency |
| R3485 |
T14288 |
T14286 |
dobj |
tendency,showed |
| R3486 |
T14289 |
T14288 |
amod |
mild,tendency |
| R3487 |
T14290 |
T14288 |
prep |
toward,tendency |
| R3488 |
T14291 |
T14292 |
amod |
increased,output |
| R3489 |
T14292 |
T14290 |
pobj |
output,toward |
| R349 |
T2564 |
T2563 |
amod |
principal,cells |
| R3490 |
T14293 |
T14292 |
amod |
urinary,output |
| R3491 |
T14294 |
T14292 |
cc |
and,output |
| R3492 |
T14295 |
T14296 |
compound |
water,intake |
| R3493 |
T14296 |
T14292 |
conj |
intake,output |
| R3494 |
T14297 |
T14292 |
cc |
and,output |
| R3495 |
T14298 |
T14299 |
amod |
decreased,osmolality |
| R3496 |
T14299 |
T14292 |
conj |
osmolality,output |
| R3497 |
T14300 |
T14299 |
compound |
urine,osmolality |
| R3498 |
T14301 |
T14286 |
punct |
.,showed |
| R3499 |
T14303 |
T14304 |
nsubjpass |
Knockout,reported |
| R35 |
T634 |
T635 |
nsubjpass |
kindreds,found |
| R350 |
T2565 |
T2557 |
prep |
in,expressed |
| R3500 |
T14305 |
T14303 |
prep |
of,Knockout |
| R3501 |
T14306 |
T14307 |
det |
the,gene |
| R3502 |
T14307 |
T14305 |
pobj |
gene,of |
| R3503 |
T14308 |
T14307 |
compound |
mouse,gene |
| R3504 |
T14309 |
T14307 |
compound |
Aqp2,gene |
| R3505 |
T14310 |
T14304 |
aux |
has,reported |
| R3506 |
T14311 |
T14304 |
neg |
not,reported |
| R3507 |
T14312 |
T14304 |
auxpass |
been,reported |
| R3508 |
T14313 |
T14304 |
punct |
.,reported |
| R3509 |
T14315 |
T14316 |
det |
A,in |
| R351 |
T2566 |
T2567 |
det |
the,kidney |
| R3510 |
T14316 |
T14319 |
nsubjpass |
in,made |
| R3511 |
T14317 |
T14316 |
compound |
knock,in |
| R3512 |
T14318 |
T14316 |
punct |
-,in |
| R3513 |
T14320 |
T14316 |
prep |
of,in |
| R3514 |
T14321 |
T14322 |
det |
a,mutation |
| R3515 |
T14322 |
T14320 |
pobj |
mutation,of |
| R3516 |
T14323 |
T14322 |
amod |
human,mutation |
| R3517 |
T14324 |
T14325 |
npadvmod |
disease,causing |
| R3518 |
T14325 |
T14322 |
amod |
causing,mutation |
| R3519 |
T14326 |
T14325 |
punct |
-,causing |
| R352 |
T2567 |
T2565 |
pobj |
kidney,in |
| R3520 |
T14327 |
T14322 |
punct |
(,mutation |
| R3521 |
T14328 |
T14322 |
appos |
T126M,mutation |
| R3522 |
T14329 |
T14322 |
punct |
),mutation |
| R3523 |
T14330 |
T14319 |
punct |
", ",made |
| R3524 |
T14331 |
T14319 |
advmod |
however,made |
| R3525 |
T14332 |
T14319 |
punct |
", ",made |
| R3526 |
T14333 |
T14319 |
aux |
has,made |
| R3527 |
T14334 |
T14319 |
auxpass |
been,made |
| R3528 |
T14335 |
T14336 |
punct |
[,18 |
| R3529 |
T14336 |
T14319 |
parataxis |
18,made |
| R353 |
T2568 |
T2569 |
punct |
[,5 |
| R3530 |
T14337 |
T14336 |
punct |
],18 |
| R3531 |
T14338 |
T14319 |
punct |
.,made |
| R3532 |
T14340 |
T14341 |
det |
These,mice |
| R3533 |
T14341 |
T14342 |
nsubj |
mice,have |
| R3534 |
T14343 |
T14344 |
det |
a,defect |
| R3535 |
T14344 |
T14342 |
dobj |
defect,have |
| R3536 |
T14345 |
T14344 |
amod |
severe,defect |
| R3537 |
T14346 |
T14347 |
npadvmod |
urine,concentrating |
| R3538 |
T14347 |
T14344 |
amod |
concentrating,defect |
| R3539 |
T14348 |
T14347 |
punct |
-,concentrating |
| R354 |
T2569 |
T2557 |
parataxis |
5,expressed |
| R3540 |
T14349 |
T14344 |
acl |
resulting,defect |
| R3541 |
T14350 |
T14349 |
prep |
in,resulting |
| R3542 |
T14351 |
T14350 |
pobj |
dehydration,in |
| R3543 |
T14352 |
T14351 |
cc |
and,dehydration |
| R3544 |
T14353 |
T14351 |
conj |
death,dehydration |
| R3545 |
T14354 |
T14349 |
prep |
within,resulting |
| R3546 |
T14355 |
T14356 |
nummod |
1,wk |
| R3547 |
T14356 |
T14354 |
pobj |
wk,within |
| R3548 |
T14357 |
T14356 |
prep |
of,wk |
| R3549 |
T14358 |
T14357 |
pobj |
birth,of |
| R355 |
T2570 |
T2569 |
punct |
],5 |
| R3550 |
T14359 |
T14342 |
punct |
.,have |
| R3551 |
T14361 |
T14362 |
advmod |
Curiously,localize |
| R3552 |
T14363 |
T14362 |
punct |
", ",localize |
| R3553 |
T14364 |
T14365 |
compound |
AQP2,T126M |
| R3554 |
T14365 |
T14362 |
nsubj |
T126M,localize |
| R3555 |
T14366 |
T14365 |
punct |
-,T126M |
| R3556 |
T14367 |
T14362 |
aux |
does,localize |
| R3557 |
T14368 |
T14362 |
advmod |
properly,localize |
| R3558 |
T14369 |
T14362 |
prep |
in,localize |
| R3559 |
T14370 |
T14371 |
advmod |
at,least |
| R356 |
T2571 |
T2557 |
punct |
.,expressed |
| R3560 |
T14371 |
T14372 |
advmod |
least,subset |
| R3561 |
T14372 |
T14369 |
pobj |
subset,in |
| R3562 |
T14373 |
T14372 |
det |
a,subset |
| R3563 |
T14374 |
T14372 |
prep |
of,subset |
| R3564 |
T14375 |
T14374 |
pobj |
cells,of |
| R3565 |
T14376 |
T14362 |
punct |
.,localize |
| R3566 |
T14378 |
T14379 |
det |
The,morphology |
| R3567 |
T14379 |
T14384 |
nsubj |
morphology,makes |
| R3568 |
T14380 |
T14381 |
advmod |
grossly,abnormal |
| R3569 |
T14381 |
T14379 |
amod |
abnormal,morphology |
| R357 |
T2573 |
T2574 |
advmod |
Generally,permit |
| R3570 |
T14382 |
T14383 |
amod |
collecting,duct |
| R3571 |
T14383 |
T14379 |
compound |
duct,morphology |
| R3572 |
T14385 |
T14386 |
nsubj |
it,impossible |
| R3573 |
T14386 |
T14384 |
ccomp |
impossible,makes |
| R3574 |
T14387 |
T14388 |
aux |
to,pinpoint |
| R3575 |
T14388 |
T14386 |
advcl |
pinpoint,impossible |
| R3576 |
T14389 |
T14390 |
det |
the,defect |
| R3577 |
T14390 |
T14388 |
dobj |
defect,pinpoint |
| R3578 |
T14391 |
T14390 |
amod |
molecular,defect |
| R3579 |
T14392 |
T14388 |
prep |
in,pinpoint |
| R358 |
T2575 |
T2576 |
det |
these,proteins |
| R3580 |
T14393 |
T14394 |
det |
these,mice |
| R3581 |
T14394 |
T14392 |
pobj |
mice,in |
| R3582 |
T14395 |
T14394 |
amod |
knock,mice |
| R3583 |
T14396 |
T14395 |
punct |
-,knock |
| R3584 |
T14397 |
T14395 |
prt |
in,knock |
| R3585 |
T14398 |
T14384 |
punct |
.,makes |
| R3586 |
T14400 |
T14401 |
det |
The,in |
| R3587 |
T14401 |
T14405 |
nsubj |
in,shows |
| R3588 |
T14402 |
T14401 |
compound |
T126M,in |
| R3589 |
T14403 |
T14401 |
compound |
knock,in |
| R359 |
T2576 |
T2574 |
nsubj |
proteins,permit |
| R3590 |
T14404 |
T14401 |
punct |
-,in |
| R3591 |
T14406 |
T14405 |
advmod |
clearly,shows |
| R3592 |
T14407 |
T14408 |
mark |
that,is |
| R3593 |
T14408 |
T14405 |
ccomp |
is,shows |
| R3594 |
T14409 |
T14408 |
nsubj |
Aqp2,is |
| R3595 |
T14410 |
T14411 |
det |
an,gene |
| R3596 |
T14411 |
T14408 |
attr |
gene,is |
| R3597 |
T14412 |
T14411 |
amod |
essential,gene |
| R3598 |
T14413 |
T14414 |
punct |
[,18 |
| R3599 |
T14414 |
T14405 |
parataxis |
18,shows |
| R36 |
T636 |
T634 |
prep |
with,kindreds |
| R360 |
T2577 |
T2578 |
det |
the,passage |
| R3600 |
T14415 |
T14414 |
punct |
],18 |
| R3601 |
T14416 |
T14405 |
punct |
.,shows |
| R3602 |
T14418 |
T14419 |
det |
The,fact |
| R3603 |
T14419 |
T14420 |
nsubj |
fact,shows |
| R3604 |
T14421 |
T14422 |
mark |
that,survive |
| R3605 |
T14422 |
T14419 |
acl |
survive,fact |
| R3606 |
T14423 |
T14424 |
poss |
our,mice |
| R3607 |
T14424 |
T14422 |
nsubj |
mice,survive |
| R3608 |
T14425 |
T14426 |
preconj |
either,possesses |
| R3609 |
T14426 |
T14420 |
advcl |
possesses,shows |
| R361 |
T2578 |
T2574 |
dobj |
passage,permit |
| R3610 |
T14427 |
T14426 |
mark |
that,possesses |
| R3611 |
T14428 |
T14429 |
compound |
AQP2,F204V |
| R3612 |
T14429 |
T14426 |
nsubj |
F204V,possesses |
| R3613 |
T14430 |
T14429 |
punct |
-,F204V |
| R3614 |
T14431 |
T14432 |
det |
some,ability |
| R3615 |
T14432 |
T14426 |
dobj |
ability,possesses |
| R3616 |
T14433 |
T14432 |
amod |
residual,ability |
| R3617 |
T14434 |
T14435 |
npadvmod |
water,transporting |
| R3618 |
T14435 |
T14432 |
amod |
transporting,ability |
| R3619 |
T14436 |
T14426 |
cc |
or,possesses |
| R362 |
T2579 |
T2578 |
prep |
of,passage |
| R3620 |
T14437 |
T14438 |
mark |
that,are |
| R3621 |
T14438 |
T14426 |
conj |
are,possesses |
| R3622 |
T14439 |
T14438 |
expl |
there,are |
| R3623 |
T14440 |
T14441 |
npadvmod |
AVP,independent |
| R3624 |
T14441 |
T14443 |
amod |
independent,pathways |
| R3625 |
T14442 |
T14441 |
punct |
-,independent |
| R3626 |
T14443 |
T14438 |
attr |
pathways,are |
| R3627 |
T14444 |
T14443 |
prep |
for,pathways |
| R3628 |
T14445 |
T14446 |
compound |
water,reabsorption |
| R3629 |
T14446 |
T14444 |
pobj |
reabsorption,for |
| R363 |
T2580 |
T2579 |
pobj |
water,of |
| R3630 |
T14447 |
T14420 |
punct |
.,shows |
| R3631 |
T14449 |
T14450 |
amod |
Residual,activity |
| R3632 |
T14450 |
T14451 |
nsubj |
activity,is |
| R3633 |
T14452 |
T14450 |
prep |
of,activity |
| R3634 |
T14453 |
T14454 |
compound |
AQP2,F204V |
| R3635 |
T14454 |
T14452 |
pobj |
F204V,of |
| R3636 |
T14455 |
T14454 |
punct |
-,F204V |
| R3637 |
T14456 |
T14451 |
acomp |
likely,is |
| R3638 |
T14457 |
T14451 |
punct |
", ",is |
| R3639 |
T14458 |
T14459 |
mark |
as,show |
| R364 |
T2581 |
T2578 |
prep |
through,passage |
| R3640 |
T14459 |
T14451 |
advcl |
show,is |
| R3641 |
T14460 |
T14461 |
compound |
mutant,animals |
| R3642 |
T14461 |
T14459 |
nsubj |
animals,show |
| R3643 |
T14462 |
T14463 |
det |
some,response |
| R3644 |
T14463 |
T14459 |
dobj |
response,show |
| R3645 |
T14464 |
T14463 |
amod |
small,response |
| R3646 |
T14465 |
T14463 |
prep |
to,response |
| R3647 |
T14466 |
T14465 |
pobj |
dDAVP,to |
| R3648 |
T14467 |
T14459 |
punct |
", ",show |
| R3649 |
T14468 |
T14469 |
mark |
although,remains |
| R365 |
T2582 |
T2583 |
det |
the,membrane |
| R3650 |
T14469 |
T14459 |
advcl |
remains,show |
| R3651 |
T14470 |
T14471 |
npadvmod |
dDAVP,stimulated |
| R3652 |
T14471 |
T14473 |
amod |
stimulated,osmolality |
| R3653 |
T14472 |
T14471 |
punct |
-,stimulated |
| R3654 |
T14473 |
T14469 |
nsubj |
osmolality,remains |
| R3655 |
T14474 |
T14473 |
compound |
urine,osmolality |
| R3656 |
T14475 |
T14476 |
advmod |
quite,low |
| R3657 |
T14476 |
T14469 |
acomp |
low,remains |
| R3658 |
T14477 |
T14451 |
punct |
.,is |
| R3659 |
T14479 |
T14480 |
nsubj |
Immunostaining,shows |
| R366 |
T2583 |
T2581 |
pobj |
membrane,through |
| R3660 |
T14481 |
T14479 |
prep |
of,Immunostaining |
| R3661 |
T14482 |
T14481 |
pobj |
kidney,of |
| R3662 |
T14483 |
T14484 |
mark |
that,transport |
| R3663 |
T14484 |
T14480 |
ccomp |
transport,shows |
| R3664 |
T14485 |
T14486 |
compound |
AQP2,F204V |
| R3665 |
T14486 |
T14484 |
nsubj |
F204V,transport |
| R3666 |
T14487 |
T14486 |
punct |
-,F204V |
| R3667 |
T14488 |
T14484 |
aux |
does,transport |
| R3668 |
T14489 |
T14484 |
neg |
not,transport |
| R3669 |
T14490 |
T14484 |
advmod |
efficiently,transport |
| R367 |
T2584 |
T2583 |
compound |
plasma,membrane |
| R3670 |
T14491 |
T14484 |
dobj |
water,transport |
| R3671 |
T14492 |
T14484 |
punct |
", ",transport |
| R3672 |
T14493 |
T14494 |
mark |
because,fails |
| R3673 |
T14494 |
T14484 |
advcl |
fails,transport |
| R3674 |
T14495 |
T14494 |
nsubj |
it,fails |
| R3675 |
T14496 |
T14497 |
aux |
to,localize |
| R3676 |
T14497 |
T14494 |
xcomp |
localize,fails |
| R3677 |
T14498 |
T14497 |
prep |
to,localize |
| R3678 |
T14499 |
T14500 |
det |
the,surface |
| R3679 |
T14500 |
T14498 |
pobj |
surface,to |
| R368 |
T2585 |
T2583 |
punct |
(,membrane |
| R3680 |
T14501 |
T14500 |
amod |
apical,surface |
| R3681 |
T14502 |
T14500 |
compound |
cell,surface |
| R3682 |
T14503 |
T14497 |
prep |
after,localize |
| R3683 |
T14504 |
T14505 |
compound |
dDAVP,treatment |
| R3684 |
T14505 |
T14503 |
pobj |
treatment,after |
| R3685 |
T14506 |
T14480 |
punct |
.,shows |
| R3686 |
T14508 |
T14509 |
det |
Some,activity |
| R3687 |
T14509 |
T14511 |
nsubj |
activity,imply |
| R3688 |
T14510 |
T14509 |
amod |
residual,activity |
| R3689 |
T14512 |
T14509 |
prep |
of,activity |
| R369 |
T2586 |
T2583 |
appos |
PM,membrane |
| R3690 |
T14513 |
T14512 |
pobj |
AQP2,of |
| R3691 |
T14514 |
T14511 |
aux |
would,imply |
| R3692 |
T14515 |
T14516 |
mark |
that,getting |
| R3693 |
T14516 |
T14511 |
ccomp |
getting,imply |
| R3694 |
T14517 |
T14518 |
det |
some,portion |
| R3695 |
T14518 |
T14516 |
nsubj |
portion,getting |
| R3696 |
T14519 |
T14518 |
amod |
small,portion |
| R3697 |
T14520 |
T14518 |
punct |
", ",portion |
| R3698 |
T14521 |
T14518 |
amod |
undetectable,portion |
| R3699 |
T14522 |
T14518 |
prep |
of,portion |
| R37 |
T637 |
T638 |
amod |
nephrogenic,insipidus |
| R370 |
T2587 |
T2583 |
punct |
),membrane |
| R3700 |
T14523 |
T14524 |
det |
the,protein |
| R3701 |
T14524 |
T14522 |
pobj |
protein,of |
| R3702 |
T14525 |
T14524 |
compound |
mutant,protein |
| R3703 |
T14526 |
T14516 |
aux |
is,getting |
| R3704 |
T14527 |
T14516 |
prep |
to,getting |
| R3705 |
T14528 |
T14529 |
det |
the,surface |
| R3706 |
T14529 |
T14527 |
pobj |
surface,to |
| R3707 |
T14530 |
T14529 |
compound |
cell,surface |
| R3708 |
T14531 |
T14511 |
punct |
.,imply |
| R3709 |
T14533 |
T14534 |
det |
The,experiment |
| R371 |
T2588 |
T2583 |
prep |
of,membrane |
| R3710 |
T14534 |
T14537 |
nsubj |
experiment,suggests |
| R3711 |
T14535 |
T14534 |
compound |
surface,experiment |
| R3712 |
T14536 |
T14534 |
compound |
biotinylation,experiment |
| R3713 |
T14538 |
T14539 |
punct |
(,Figure |
| R3714 |
T14539 |
T14534 |
parataxis |
Figure,experiment |
| R3715 |
T14540 |
T14539 |
nummod |
5D,Figure |
| R3716 |
T14541 |
T14539 |
punct |
),Figure |
| R3717 |
T14542 |
T14543 |
mark |
that,gets |
| R3718 |
T14543 |
T14537 |
ccomp |
gets,suggests |
| R3719 |
T14544 |
T14545 |
det |
no,protein |
| R372 |
T2589 |
T2588 |
pobj |
cells,of |
| R3720 |
T14545 |
T14543 |
nsubj |
protein,gets |
| R3721 |
T14546 |
T14545 |
compound |
mutant,protein |
| R3722 |
T14547 |
T14543 |
prep |
to,gets |
| R3723 |
T14548 |
T14549 |
det |
the,surface |
| R3724 |
T14549 |
T14547 |
pobj |
surface,to |
| R3725 |
T14550 |
T14537 |
punct |
", ",suggests |
| R3726 |
T14551 |
T14537 |
cc |
but,suggests |
| R3727 |
T14552 |
T14553 |
nsubj |
this,reflect |
| R3728 |
T14553 |
T14537 |
conj |
reflect,suggests |
| R3729 |
T14554 |
T14553 |
aux |
does,reflect |
| R373 |
T2590 |
T2589 |
punct |
", ",cells |
| R3730 |
T14555 |
T14553 |
neg |
not,reflect |
| R3731 |
T14556 |
T14553 |
advmod |
necessarily,reflect |
| R3732 |
T14557 |
T14558 |
det |
the,situation |
| R3733 |
T14558 |
T14553 |
dobj |
situation,reflect |
| R3734 |
T14559 |
T14560 |
advmod |
in,vivo |
| R3735 |
T14560 |
T14558 |
advmod |
vivo,situation |
| R3736 |
T14561 |
T14553 |
punct |
.,reflect |
| R3737 |
T14563 |
T14564 |
mark |
While,be |
| R3738 |
T14564 |
T14572 |
advcl |
be,shows |
| R3739 |
T14565 |
T14566 |
det |
this,fraction |
| R374 |
T2591 |
T2592 |
dep |
several,carry |
| R3740 |
T14566 |
T14564 |
nsubj |
fraction,be |
| R3741 |
T14567 |
T14566 |
amod |
small,fraction |
| R3742 |
T14568 |
T14566 |
prep |
of,fraction |
| R3743 |
T14569 |
T14568 |
pobj |
protein,of |
| R3744 |
T14570 |
T14564 |
aux |
may,be |
| R3745 |
T14571 |
T14564 |
neg |
not,be |
| R3746 |
T14573 |
T14564 |
acomp |
detectable,be |
| R3747 |
T14574 |
T14564 |
prep |
by,be |
| R3748 |
T14575 |
T14574 |
pobj |
immunofluorescence,by |
| R3749 |
T14576 |
T14572 |
punct |
", ",shows |
| R375 |
T2592 |
T2589 |
relcl |
carry,cells |
| R3750 |
T14577 |
T14578 |
compound |
Western,blotting |
| R3751 |
T14578 |
T14572 |
nsubj |
blotting,shows |
| R3752 |
T14579 |
T14580 |
mark |
that,progress |
| R3753 |
T14580 |
T14572 |
ccomp |
progress,shows |
| R3754 |
T14581 |
T14582 |
det |
some,protein |
| R3755 |
T14582 |
T14580 |
nsubj |
protein,progress |
| R3756 |
T14583 |
T14582 |
compound |
mutant,protein |
| R3757 |
T14584 |
T14580 |
aux |
does,progress |
| R3758 |
T14585 |
T14580 |
prep |
beyond,progress |
| R3759 |
T14586 |
T14587 |
det |
the,ER |
| R376 |
T2593 |
T2591 |
prep |
of,several |
| R3760 |
T14587 |
T14585 |
pobj |
ER,beyond |
| R3761 |
T14588 |
T14589 |
punct |
(,species |
| R3762 |
T14589 |
T14572 |
parataxis |
species,shows |
| R3763 |
T14590 |
T14591 |
quantmod |
35,45 |
| R3764 |
T14591 |
T14593 |
nummod |
45,kDa |
| R3765 |
T14592 |
T14591 |
punct |
–,45 |
| R3766 |
T14593 |
T14589 |
compound |
kDa,species |
| R3767 |
T14594 |
T14589 |
prep |
in,species |
| R3768 |
T14595 |
T14594 |
pobj |
Figure,in |
| R3769 |
T14596 |
T14595 |
nummod |
3A,Figure |
| R377 |
T2594 |
T2593 |
pobj |
which,of |
| R3770 |
T14597 |
T14589 |
punct |
),species |
| R3771 |
T14598 |
T14572 |
punct |
.,shows |
| R3772 |
T14600 |
T14601 |
prep |
Compared,is |
| R3773 |
T14602 |
T14600 |
prep |
to,Compared |
| R3774 |
T14603 |
T14604 |
amod |
wild,type |
| R3775 |
T14604 |
T14602 |
pobj |
type,to |
| R3776 |
T14605 |
T14604 |
punct |
-,type |
| R3777 |
T14606 |
T14601 |
punct |
", ",is |
| R3778 |
T14607 |
T14608 |
compound |
mutant,protein |
| R3779 |
T14608 |
T14601 |
nsubj |
protein,is |
| R378 |
T2595 |
T2592 |
prt |
out,carry |
| R3780 |
T14609 |
T14601 |
acomp |
enriched,is |
| R3781 |
T14610 |
T14609 |
prep |
in,enriched |
| R3782 |
T14611 |
T14612 |
det |
the,form |
| R3783 |
T14612 |
T14610 |
pobj |
form,in |
| R3784 |
T14613 |
T14614 |
amod |
high,mannose |
| R3785 |
T14614 |
T14612 |
nmod |
mannose,form |
| R3786 |
T14615 |
T14614 |
punct |
-,mannose |
| R3787 |
T14616 |
T14612 |
punct |
", ",form |
| R3788 |
T14617 |
T14618 |
npadvmod |
core,glycosylated |
| R3789 |
T14618 |
T14612 |
amod |
glycosylated,form |
| R379 |
T2596 |
T2597 |
det |
this,role |
| R3790 |
T14619 |
T14618 |
punct |
-,glycosylated |
| R3791 |
T14620 |
T14621 |
punct |
(,kDa |
| R3792 |
T14621 |
T14612 |
parataxis |
kDa,form |
| R3793 |
T14622 |
T14621 |
nummod |
31,kDa |
| R3794 |
T14623 |
T14621 |
punct |
),kDa |
| R3795 |
T14624 |
T14609 |
cc |
and,enriched |
| R3796 |
T14625 |
T14609 |
conj |
deficient,enriched |
| R3797 |
T14626 |
T14625 |
prep |
in,deficient |
| R3798 |
T14627 |
T14628 |
amod |
nonglycosylated,forms |
| R3799 |
T14628 |
T14626 |
pobj |
forms,in |
| R38 |
T638 |
T636 |
pobj |
insipidus,with |
| R380 |
T2597 |
T2592 |
dobj |
role,carry |
| R3800 |
T14629 |
T14630 |
punct |
(,kDa |
| R3801 |
T14630 |
T14627 |
parataxis |
kDa,nonglycosylated |
| R3802 |
T14631 |
T14630 |
nummod |
29,kDa |
| R3803 |
T14632 |
T14630 |
punct |
),kDa |
| R3804 |
T14633 |
T14627 |
cc |
and,nonglycosylated |
| R3805 |
T14634 |
T14635 |
amod |
complex,glycosylated |
| R3806 |
T14635 |
T14627 |
conj |
glycosylated,nonglycosylated |
| R3807 |
T14636 |
T14637 |
punct |
(,kDa |
| R3808 |
T14637 |
T14635 |
parataxis |
kDa,glycosylated |
| R3809 |
T14638 |
T14639 |
quantmod |
35,45 |
| R381 |
T2598 |
T2599 |
advmod |
specifically,in |
| R3810 |
T14639 |
T14637 |
nummod |
45,kDa |
| R3811 |
T14640 |
T14639 |
punct |
–,45 |
| R3812 |
T14641 |
T14637 |
punct |
),kDa |
| R3813 |
T14642 |
T14601 |
punct |
.,is |
| R3814 |
T14644 |
T14645 |
det |
The,presence |
| R3815 |
T14645 |
T14646 |
nsubj |
presence,indicates |
| R3816 |
T14647 |
T14645 |
prep |
of,presence |
| R3817 |
T14648 |
T14649 |
det |
a,amount |
| R3818 |
T14649 |
T14647 |
pobj |
amount,of |
| R3819 |
T14650 |
T14649 |
amod |
reduced,amount |
| R382 |
T2599 |
T2592 |
prep |
in,carry |
| R3820 |
T14651 |
T14650 |
cc |
but,reduced |
| R3821 |
T14652 |
T14650 |
conj |
detectable,reduced |
| R3822 |
T14653 |
T14649 |
prep |
of,amount |
| R3823 |
T14654 |
T14653 |
pobj |
protein,of |
| R3824 |
T14655 |
T14654 |
prep |
in,protein |
| R3825 |
T14656 |
T14657 |
det |
the,range |
| R3826 |
T14657 |
T14655 |
pobj |
range,in |
| R3827 |
T14658 |
T14659 |
quantmod |
35,45 |
| R3828 |
T14659 |
T14661 |
nummod |
45,kDa |
| R3829 |
T14660 |
T14659 |
punct |
–,45 |
| R383 |
T2600 |
T2601 |
det |
the,process |
| R3830 |
T14661 |
T14657 |
compound |
kDa,range |
| R3831 |
T14662 |
T14663 |
mark |
that,transported |
| R3832 |
T14663 |
T14646 |
ccomp |
transported,indicates |
| R3833 |
T14664 |
T14665 |
compound |
mutant,protein |
| R3834 |
T14665 |
T14663 |
nsubjpass |
protein,transported |
| R3835 |
T14666 |
T14663 |
auxpass |
is,transported |
| R3836 |
T14667 |
T14663 |
prep |
out,transported |
| R3837 |
T14668 |
T14667 |
prep |
of,out |
| R3838 |
T14669 |
T14670 |
det |
the,ER |
| R3839 |
T14670 |
T14668 |
pobj |
ER,of |
| R384 |
T2601 |
T2599 |
pobj |
process,in |
| R3840 |
T14671 |
T14663 |
punct |
", ",transported |
| R3841 |
T14672 |
T14673 |
cc |
but,with |
| R3842 |
T14673 |
T14663 |
prep |
with,transported |
| R3843 |
T14674 |
T14675 |
advmod |
greatly,reduced |
| R3844 |
T14675 |
T14676 |
amod |
reduced,efficiency |
| R3845 |
T14676 |
T14673 |
pobj |
efficiency,with |
| R3846 |
T14677 |
T14646 |
punct |
.,indicates |
| R3847 |
T14679 |
T14680 |
nsubj |
Colocalization,shows |
| R3848 |
T14681 |
T14679 |
prep |
of,Colocalization |
| R3849 |
T14682 |
T14683 |
compound |
AQP2,F204V |
| R385 |
T2602 |
T2601 |
prep |
of,process |
| R3850 |
T14683 |
T14681 |
pobj |
F204V,of |
| R3851 |
T14684 |
T14683 |
punct |
-,F204V |
| R3852 |
T14685 |
T14679 |
prep |
with,Colocalization |
| R3853 |
T14686 |
T14687 |
det |
the,protein |
| R3854 |
T14687 |
T14685 |
pobj |
protein,with |
| R3855 |
T14688 |
T14687 |
compound |
ER,protein |
| R3856 |
T14689 |
T14687 |
appos |
calnexin,protein |
| R3857 |
T14690 |
T14679 |
prep |
in,Colocalization |
| R3858 |
T14691 |
T14692 |
amod |
transfected,cells |
| R3859 |
T14692 |
T14690 |
pobj |
cells,in |
| R386 |
T2603 |
T2604 |
compound |
water,reabsorption |
| R3860 |
T14693 |
T14692 |
compound |
MDCK,cells |
| R3861 |
T14694 |
T14695 |
mark |
that,progress |
| R3862 |
T14695 |
T14680 |
ccomp |
progress,shows |
| R3863 |
T14696 |
T14695 |
punct |
", ",progress |
| R3864 |
T14697 |
T14698 |
mark |
while,trapped |
| R3865 |
T14698 |
T14695 |
advcl |
trapped,progress |
| R3866 |
T14738 |
T14737 |
prep |
of,fraction |
| R3867 |
T14699 |
T14698 |
nsubjpass |
most,trapped |
| R3868 |
T14739 |
T14740 |
compound |
mutant,protein |
| R3869 |
T14700 |
T14699 |
prep |
of,most |
| R387 |
T2604 |
T2602 |
pobj |
reabsorption,of |
| R3870 |
T14740 |
T14738 |
pobj |
protein,of |
| R3871 |
T14741 |
T14734 |
prep |
beyond,transport |
| R3872 |
T14701 |
T14702 |
det |
the,protein |
| R3873 |
T14742 |
T14743 |
det |
the,ER |
| R3874 |
T14743 |
T14741 |
pobj |
ER,beyond |
| R3875 |
T14744 |
T14734 |
prep |
in,transport |
| R3876 |
T14702 |
T14700 |
pobj |
protein,of |
| R3877 |
T14745 |
T14746 |
compound |
MDCK,cells |
| R3878 |
T14746 |
T14744 |
pobj |
cells,in |
| R3879 |
T14747 |
T14718 |
advmod |
all,are |
| R388 |
T2605 |
T2604 |
prep |
from,reabsorption |
| R3880 |
T14703 |
T14702 |
compound |
mutant,protein |
| R3881 |
T14748 |
T14718 |
acomp |
consistent,are |
| R3882 |
T14749 |
T14748 |
prep |
with,consistent |
| R3883 |
T14750 |
T14751 |
det |
the,notion |
| R3884 |
T14704 |
T14698 |
auxpass |
is,trapped |
| R3885 |
T14751 |
T14749 |
pobj |
notion,with |
| R3886 |
T14752 |
T14753 |
mark |
that,is |
| R3887 |
T14753 |
T14751 |
advcl |
is,notion |
| R3888 |
T14705 |
T14698 |
prep |
in,trapped |
| R3889 |
T14754 |
T14755 |
compound |
AQP2,F204V |
| R389 |
T2606 |
T2605 |
pobj |
urine,from |
| R3890 |
T14755 |
T14757 |
compound |
F204V,misfolding |
| R3891 |
T14756 |
T14755 |
punct |
-,F204V |
| R3892 |
T14706 |
T14707 |
det |
the,ER |
| R3893 |
T14757 |
T14753 |
nsubj |
misfolding,is |
| R3894 |
T14758 |
T14753 |
acomp |
limited,is |
| R3895 |
T14759 |
T14753 |
cc |
and,is |
| R3896 |
T14760 |
T14761 |
mark |
that,retain |
| R3897 |
T14761 |
T14753 |
conj |
retain,is |
| R3898 |
T14762 |
T14761 |
nsubj |
it,retain |
| R3899 |
T14707 |
T14705 |
pobj |
ER,in |
| R39 |
T639 |
T638 |
compound |
diabetes,insipidus |
| R390 |
T2607 |
T2604 |
prep |
in,reabsorption |
| R3900 |
T14763 |
T14761 |
aux |
may,retain |
| R3901 |
T14764 |
T14765 |
det |
some,activity |
| R3902 |
T14765 |
T14761 |
dobj |
activity,retain |
| R3903 |
T14708 |
T14695 |
punct |
", ",progress |
| R3904 |
T14766 |
T14765 |
amod |
residual,activity |
| R3905 |
T14767 |
T14768 |
npadvmod |
water,transporting |
| R3906 |
T14709 |
T14695 |
nsubj |
some,progress |
| R3907 |
T14768 |
T14765 |
amod |
transporting,activity |
| R3908 |
T14769 |
T14718 |
punct |
.,are |
| R3909 |
T14771 |
T14772 |
advmod |
Evidently,is |
| R391 |
T2608 |
T2609 |
det |
the,kidney |
| R3910 |
T14710 |
T14695 |
aux |
does,progress |
| R3911 |
T14773 |
T14774 |
det |
this,activity |
| R3912 |
T14774 |
T14772 |
nsubj |
activity,is |
| R3913 |
T14711 |
T14695 |
prep |
beyond,progress |
| R3914 |
T14775 |
T14774 |
amod |
residual,activity |
| R3915 |
T14712 |
T14713 |
det |
the,ER |
| R3916 |
T14776 |
T14772 |
acomp |
sufficient,is |
| R3917 |
T14777 |
T14776 |
prep |
for,sufficient |
| R3918 |
T14713 |
T14711 |
pobj |
ER,beyond |
| R3919 |
T14778 |
T14779 |
det |
the,viability |
| R392 |
T2609 |
T2607 |
pobj |
kidney,in |
| R3920 |
T14779 |
T14777 |
pobj |
viability,for |
| R3921 |
T14780 |
T14779 |
cc |
and,viability |
| R3922 |
T14714 |
T14680 |
punct |
.,shows |
| R3923 |
T14781 |
T14779 |
conj |
growth,viability |
| R3924 |
T14782 |
T14779 |
prep |
of,viability |
| R3925 |
T14783 |
T14784 |
compound |
mutant,animals |
| R3926 |
T14716 |
T14717 |
amod |
Diminished,response |
| R3927 |
T14784 |
T14782 |
pobj |
animals,of |
| R3928 |
T14785 |
T14772 |
punct |
.,is |
| R3929 |
T14787 |
T14788 |
amod |
Reduced,efficiency |
| R393 |
T2610 |
T2574 |
punct |
.,permit |
| R3930 |
T14717 |
T14718 |
nsubj |
response,are |
| R3931 |
T14788 |
T14789 |
nsubj |
efficiency,explain |
| R3932 |
T14790 |
T14788 |
prep |
in,efficiency |
| R3933 |
T14719 |
T14717 |
prep |
to,response |
| R3934 |
T14791 |
T14790 |
pcomp |
exiting,in |
| R3935 |
T14792 |
T14793 |
det |
the,ER |
| R3936 |
T14793 |
T14791 |
dobj |
ER,exiting |
| R3937 |
T14794 |
T14789 |
aux |
may,explain |
| R3938 |
T14720 |
T14719 |
pobj |
dDAVP,to |
| R3939 |
T14795 |
T14796 |
advmod |
why,enriched |
| R394 |
T2612 |
T2613 |
nsubjpass |
It,established |
| R3940 |
T14796 |
T14789 |
ccomp |
enriched,explain |
| R3941 |
T14797 |
T14798 |
compound |
AQP2,F204V |
| R3942 |
T14721 |
T14717 |
punct |
", ",response |
| R3943 |
T14798 |
T14796 |
nsubjpass |
F204V,enriched |
| R3944 |
T14799 |
T14798 |
punct |
-,F204V |
| R3945 |
T14800 |
T14796 |
auxpass |
is,enriched |
| R3946 |
T14801 |
T14796 |
prep |
in,enriched |
| R3947 |
T14802 |
T14803 |
det |
the,form |
| R3948 |
T14803 |
T14801 |
pobj |
form,in |
| R3949 |
T14722 |
T14723 |
amod |
diminished,abundance |
| R395 |
T2614 |
T2613 |
aux |
has,established |
| R3950 |
T14804 |
T14805 |
nummod |
31,kDa |
| R3951 |
T14805 |
T14803 |
nmod |
kDa,form |
| R3952 |
T14806 |
T14807 |
amod |
high,mannose |
| R3953 |
T14807 |
T14803 |
nmod |
mannose,form |
| R3954 |
T14723 |
T14717 |
conj |
abundance,response |
| R3955 |
T14808 |
T14807 |
punct |
-,mannose |
| R3956 |
T14809 |
T14803 |
amod |
glycosylated,form |
| R3957 |
T14810 |
T14789 |
punct |
.,explain |
| R3958 |
T14724 |
T14723 |
prep |
of,abundance |
| R3959 |
T14725 |
T14726 |
amod |
mature,protein |
| R396 |
T2615 |
T2613 |
auxpass |
been,established |
| R3960 |
T14812 |
T14813 |
det |
The,oligosaccharide |
| R3961 |
T14813 |
T14818 |
nsubjpass |
oligosaccharide,added |
| R3962 |
T14814 |
T14815 |
amod |
high,mannose |
| R3963 |
T14815 |
T14813 |
compound |
mannose,oligosaccharide |
| R3964 |
T14816 |
T14815 |
punct |
-,mannose |
| R3965 |
T14726 |
T14724 |
pobj |
protein,of |
| R3966 |
T14817 |
T14813 |
compound |
core,oligosaccharide |
| R3967 |
T14727 |
T14726 |
amod |
glycosylated,protein |
| R3968 |
T14819 |
T14818 |
auxpass |
is,added |
| R3969 |
T14820 |
T14818 |
prep |
in,added |
| R397 |
T2616 |
T2617 |
mark |
that,tetramerize |
| R3970 |
T14821 |
T14822 |
det |
the,ER |
| R3971 |
T14728 |
T14723 |
prep |
in,abundance |
| R3972 |
T14822 |
T14820 |
pobj |
ER,in |
| R3973 |
T14823 |
T14818 |
cc |
and,added |
| R3974 |
T14824 |
T14825 |
auxpass |
is,modified |
| R3975 |
T14729 |
T14730 |
compound |
mutant,animals |
| R3976 |
T14825 |
T14818 |
conj |
modified,added |
| R3977 |
T14826 |
T14825 |
advmod |
later,modified |
| R3978 |
T14730 |
T14728 |
pobj |
animals,in |
| R3979 |
T14827 |
T14825 |
cc |
and,modified |
| R398 |
T2617 |
T2613 |
ccomp |
tetramerize,established |
| R3980 |
T14828 |
T14825 |
conj |
elaborated,modified |
| R3981 |
T14829 |
T14828 |
prep |
in,elaborated |
| R3982 |
T14731 |
T14723 |
punct |
", ",abundance |
| R3983 |
T14830 |
T14831 |
det |
the,apparatus |
| R3984 |
T14831 |
T14829 |
pobj |
apparatus,in |
| R3985 |
T14732 |
T14723 |
cc |
and,abundance |
| R3986 |
T14832 |
T14831 |
compound |
Golgi,apparatus |
| R3987 |
T14833 |
T14834 |
punct |
[,26 |
| R3988 |
T14834 |
T14825 |
parataxis |
26,modified |
| R3989 |
T14733 |
T14734 |
det |
the,transport |
| R399 |
T2618 |
T2617 |
nsubj |
aquaporins,tetramerize |
| R3990 |
T14835 |
T14834 |
punct |
],26 |
| R3991 |
T14836 |
T14818 |
punct |
.,added |
| R3992 |
T14734 |
T14723 |
conj |
transport,abundance |
| R3993 |
T14838 |
T14839 |
det |
The,increase |
| R3994 |
T14839 |
T14840 |
nsubj |
increase,reflect |
| R3995 |
T14735 |
T14734 |
prep |
of,transport |
| R3996 |
T14841 |
T14839 |
prep |
in,increase |
| R3997 |
T14842 |
T14843 |
det |
the,form |
| R3998 |
T14843 |
T14841 |
pobj |
form,in |
| R3999 |
T14736 |
T14737 |
det |
a,fraction |
| R4 |
T598 |
T597 |
prep |
with,Mice |
| R40 |
T640 |
T635 |
aux |
have,found |
| R400 |
T2619 |
T2617 |
punct |
", ",tetramerize |
| R4000 |
T14737 |
T14735 |
pobj |
fraction,of |
| R4001 |
T14950 |
T14949 |
aux |
can,explain |
| R4002 |
T14844 |
T14845 |
amod |
high,mannose |
| R4003 |
T14845 |
T14843 |
nmod |
mannose,form |
| R4004 |
T14846 |
T14845 |
punct |
-,mannose |
| R4005 |
T14847 |
T14843 |
amod |
glycosylated,form |
| R4006 |
T14951 |
T14949 |
neg |
not,explain |
| R4007 |
T14848 |
T14843 |
prep |
of,form |
| R4008 |
T14849 |
T14850 |
compound |
AQP2,F204V |
| R4009 |
T14850 |
T14848 |
pobj |
F204V,of |
| R401 |
T2620 |
T2621 |
mark |
although,functional |
| R4010 |
T14952 |
T14953 |
det |
the,lack |
| R4011 |
T14851 |
T14850 |
punct |
-,F204V |
| R4012 |
T14852 |
T14840 |
aux |
may,reflect |
| R4013 |
T14853 |
T14840 |
advmod |
simply,reflect |
| R4014 |
T14953 |
T14949 |
dobj |
lack,explain |
| R4015 |
T14854 |
T14855 |
poss |
its,presence |
| R4016 |
T14954 |
T14953 |
prep |
of,lack |
| R4017 |
T14855 |
T14840 |
dobj |
presence,reflect |
| R4018 |
T14856 |
T14855 |
amod |
prolonged,presence |
| R4019 |
T14857 |
T14855 |
prep |
in,presence |
| R402 |
T2621 |
T2617 |
advcl |
functional,tetramerize |
| R4020 |
T14858 |
T14859 |
det |
the,ER |
| R4021 |
T14955 |
T14956 |
det |
any,protein |
| R4022 |
T14859 |
T14857 |
pobj |
ER,in |
| R4023 |
T14860 |
T14855 |
cc |
and,presence |
| R4024 |
T14861 |
T14855 |
conj |
exposure,presence |
| R4025 |
T14956 |
T14954 |
pobj |
protein,of |
| R4026 |
T14957 |
T14958 |
npadvmod |
ER,retained |
| R4027 |
T14862 |
T14861 |
prep |
to,exposure |
| R4028 |
T14863 |
T14864 |
compound |
oligosaccharyl,transferase |
| R4029 |
T14864 |
T14862 |
pobj |
transferase,to |
| R403 |
T2622 |
T2621 |
prep |
as,functional |
| R4030 |
T14958 |
T14956 |
amod |
retained,protein |
| R4031 |
T14865 |
T14840 |
punct |
.,reflect |
| R4032 |
T14867 |
T14868 |
mark |
While,explains |
| R4033 |
T14959 |
T14958 |
punct |
-,retained |
| R4034 |
T14868 |
T14873 |
advcl |
explains,is |
| R4035 |
T14960 |
T14956 |
compound |
mutant,protein |
| R4036 |
T14869 |
T14870 |
amod |
improper,localization |
| R4037 |
T14870 |
T14868 |
nsubj |
localization,explains |
| R4038 |
T14871 |
T14870 |
prep |
of,localization |
| R4039 |
T14961 |
T14949 |
punct |
.,explain |
| R404 |
T2623 |
T2624 |
det |
a,monomer |
| R4040 |
T14872 |
T14871 |
pobj |
AQP2,of |
| R4041 |
T14963 |
T14964 |
advmod |
Rather,suggests |
| R4042 |
T14874 |
T14875 |
det |
the,phenotype |
| R4043 |
T14875 |
T14868 |
dobj |
phenotype,explains |
| R4044 |
T14876 |
T14875 |
prep |
of,phenotype |
| R4045 |
T14877 |
T14878 |
amod |
homozygous,mice |
| R4046 |
T14878 |
T14876 |
pobj |
mice,of |
| R4047 |
T14965 |
T14964 |
punct |
", ",suggests |
| R4048 |
T14879 |
T14878 |
compound |
mutant,mice |
| R4049 |
T14880 |
T14873 |
punct |
", ",is |
| R405 |
T2624 |
T2622 |
pobj |
monomer,as |
| R4050 |
T14881 |
T14882 |
det |
the,lack |
| R4051 |
T14882 |
T14873 |
nsubj |
lack,is |
| R4052 |
T14883 |
T14882 |
amod |
complete,lack |
| R4053 |
T14884 |
T14882 |
prep |
of,lack |
| R4054 |
T14885 |
T14886 |
det |
a,phenotype |
| R4055 |
T14886 |
T14884 |
pobj |
phenotype,of |
| R4056 |
T14966 |
T14967 |
det |
the,phenotype |
| R4057 |
T14887 |
T14882 |
prep |
in,lack |
| R4058 |
T14888 |
T14889 |
amod |
heterozygous,mice |
| R4059 |
T14889 |
T14887 |
pobj |
mice,in |
| R406 |
T2625 |
T2617 |
punct |
", ",tetramerize |
| R4060 |
T14967 |
T14964 |
nsubj |
phenotype,suggests |
| R4061 |
T14890 |
T14891 |
advmod |
more,difficult |
| R4062 |
T14891 |
T14873 |
acomp |
difficult,is |
| R4063 |
T14892 |
T14893 |
aux |
to,explain |
| R4064 |
T14968 |
T14967 |
prep |
of,phenotype |
| R4065 |
T14893 |
T14891 |
advcl |
explain,difficult |
| R4066 |
T14894 |
T14873 |
punct |
.,is |
| R4067 |
T14969 |
T14970 |
det |
the,animals |
| R4068 |
T14896 |
T14897 |
advmod |
Physiologically,have |
| R4069 |
T14970 |
T14968 |
pobj |
animals,of |
| R407 |
T2626 |
T2617 |
prep |
before,tetramerize |
| R4070 |
T14898 |
T14897 |
punct |
", ",have |
| R4071 |
T14899 |
T14900 |
amod |
heterozygous,mice |
| R4072 |
T14900 |
T14897 |
nsubj |
mice,have |
| R4073 |
T14971 |
T14970 |
nmod |
Aqp2F204V,animals |
| R4074 |
T14901 |
T14902 |
det |
no,symptoms |
| R4075 |
T14902 |
T14897 |
dobj |
symptoms,have |
| R4076 |
T14903 |
T14904 |
punct |
(,see |
| R4077 |
T14972 |
T14971 |
punct |
/,Aqp2F204V |
| R4078 |
T14904 |
T14897 |
parataxis |
see,have |
| R4079 |
T14905 |
T14904 |
dobj |
Figure,see |
| R408 |
T2627 |
T2628 |
poss |
their,insertion |
| R4080 |
T14973 |
T14971 |
punct |
+,Aqp2F204V |
| R4081 |
T14906 |
T14905 |
nummod |
1C,Figure |
| R4082 |
T14907 |
T14904 |
punct |
),see |
| R4083 |
T14908 |
T14897 |
punct |
", ",have |
| R4084 |
T14909 |
T14897 |
cc |
and,have |
| R4085 |
T14974 |
T14975 |
mark |
that,rescued |
| R4086 |
T14910 |
T14911 |
nsubj |
they,are |
| R4087 |
T14911 |
T14897 |
conj |
are,have |
| R4088 |
T14975 |
T14964 |
ccomp |
rescued,suggests |
| R4089 |
T14912 |
T14911 |
acomp |
indistinguishable,are |
| R409 |
T2628 |
T2626 |
pobj |
insertion,before |
| R4090 |
T14913 |
T14912 |
prep |
from,indistinguishable |
| R4091 |
T14914 |
T14915 |
amod |
wild,type |
| R4092 |
T14976 |
T14977 |
det |
the,protein |
| R4093 |
T14915 |
T14913 |
pobj |
type,from |
| R4094 |
T14916 |
T14911 |
prep |
on,are |
| R4095 |
T14917 |
T14916 |
pobj |
immunostaining,on |
| R4096 |
T14977 |
T14975 |
nsubjpass |
protein,rescued |
| R4097 |
T14918 |
T14917 |
prep |
of,immunostaining |
| R4098 |
T14919 |
T14918 |
pobj |
kidneys,of |
| R4099 |
T14920 |
T14921 |
punct |
(,Figure |
| R41 |
T641 |
T635 |
auxpass |
been,found |
| R410 |
T2629 |
T2628 |
prep |
into,insertion |
| R4100 |
T14978 |
T14977 |
compound |
mutant,protein |
| R4101 |
T14921 |
T14911 |
parataxis |
Figure,are |
| R4102 |
T14922 |
T14921 |
nummod |
5A,Figure |
| R4103 |
T14923 |
T14921 |
punct |
),Figure |
| R4104 |
T14924 |
T14911 |
punct |
.,are |
| R4105 |
T14979 |
T14975 |
aux |
is,rescued |
| R4106 |
T14926 |
T14927 |
det |
The,presence |
| R4107 |
T14927 |
T14928 |
nsubj |
presence,explain |
| R4108 |
T14980 |
T14975 |
auxpass |
being,rescued |
| R4109 |
T14929 |
T14927 |
prep |
of,presence |
| R411 |
T2630 |
T2631 |
det |
the,membrane |
| R4110 |
T14930 |
T14931 |
nummod |
50,% |
| R4111 |
T14931 |
T14929 |
pobj |
%,of |
| R4112 |
T14981 |
T14975 |
agent |
by,rescued |
| R4113 |
T14932 |
T14931 |
prep |
of,% |
| R4114 |
T14933 |
T14934 |
det |
the,amount |
| R4115 |
T14934 |
T14932 |
pobj |
amount,of |
| R4116 |
T14982 |
T14983 |
det |
the,protein |
| R4117 |
T14935 |
T14934 |
amod |
normal,amount |
| R4118 |
T14936 |
T14934 |
prep |
of,amount |
| R4119 |
T14937 |
T14938 |
amod |
wild,type |
| R412 |
T2631 |
T2629 |
pobj |
membrane,into |
| R4120 |
T14938 |
T14940 |
compound |
type,protein |
| R4121 |
T14983 |
T14981 |
pobj |
protein,by |
| R4122 |
T14939 |
T14938 |
punct |
-,type |
| R4123 |
T14940 |
T14936 |
pobj |
protein,of |
| R4124 |
T14984 |
T14985 |
amod |
wild,type |
| R4125 |
T14941 |
T14928 |
aux |
may,explain |
| R4126 |
T14942 |
T14943 |
det |
the,lack |
| R4127 |
T14943 |
T14928 |
dobj |
lack,explain |
| R4128 |
T14944 |
T14943 |
prep |
of,lack |
| R4129 |
T14985 |
T14983 |
compound |
type,protein |
| R413 |
T2632 |
T2631 |
compound |
plasma,membrane |
| R4130 |
T14945 |
T14944 |
pobj |
symptoms,of |
| R4131 |
T14946 |
T14928 |
punct |
", ",explain |
| R4132 |
T14947 |
T14928 |
cc |
but,explain |
| R4133 |
T14986 |
T14985 |
punct |
-,type |
| R4134 |
T14948 |
T14949 |
nsubj |
it,explain |
| R4135 |
T14987 |
T14964 |
punct |
.,suggests |
| R4136 |
T14949 |
T14928 |
conj |
explain,explain |
| R4137 |
T14989 |
T14990 |
advmod |
Indeed,demonstrated |
| R4138 |
T14991 |
T14990 |
punct |
", ",demonstrated |
| R4139 |
T14992 |
T14993 |
compound |
de,Mattia |
| R414 |
T2633 |
T2634 |
punct |
[,6 |
| R4140 |
T14993 |
T14990 |
nsubj |
Mattia,demonstrated |
| R4141 |
T14994 |
T14995 |
advmod |
et,al. |
| R4142 |
T15056 |
T15055 |
pobj |
this,of |
| R4143 |
T15057 |
T15053 |
punct |
", ",interact |
| R4144 |
T14995 |
T14993 |
advmod |
al.,Mattia |
| R4145 |
T15058 |
T15059 |
compound |
AQP2,F204V |
| R4146 |
T15059 |
T15053 |
nsubj |
F204V,interact |
| R4147 |
T15060 |
T15059 |
punct |
-,F204V |
| R4148 |
T14996 |
T14997 |
punct |
(,26 |
| R4149 |
T15061 |
T15053 |
aux |
can,interact |
| R415 |
T2634 |
T2613 |
parataxis |
6,established |
| R4150 |
T15062 |
T15053 |
prep |
with,interact |
| R4151 |
T14997 |
T14993 |
parataxis |
26,Mattia |
| R4152 |
T15063 |
T15064 |
amod |
wild,type |
| R4153 |
T15064 |
T15066 |
compound |
type,AQP2 |
| R4154 |
T15065 |
T15064 |
punct |
-,type |
| R4155 |
T15066 |
T15062 |
pobj |
AQP2,with |
| R4156 |
T15067 |
T15068 |
punct |
(,Figure |
| R4157 |
T15068 |
T15053 |
parataxis |
Figure,interact |
| R4158 |
T14998 |
T14997 |
punct |
),26 |
| R4159 |
T15069 |
T15068 |
nummod |
5B,Figure |
| R416 |
T2635 |
T2634 |
nummod |
4,6 |
| R4160 |
T15070 |
T15068 |
punct |
),Figure |
| R4161 |
T15071 |
T15053 |
punct |
", ",interact |
| R4162 |
T15072 |
T15053 |
cc |
and,interact |
| R4163 |
T14999 |
T14990 |
aux |
have,demonstrated |
| R4164 |
T15073 |
T15074 |
advmod |
when,coexpressed |
| R4165 |
T15074 |
T15075 |
advcl |
coexpressed,reach |
| R4166 |
T15000 |
T15001 |
mark |
that,translocate |
| R4167 |
T15075 |
T15053 |
conj |
reach,interact |
| R4168 |
T15076 |
T15074 |
prep |
with,coexpressed |
| R4169 |
T15077 |
T15078 |
amod |
wild,type |
| R417 |
T2636 |
T2634 |
punct |
",",6 |
| R4170 |
T15001 |
T14990 |
advcl |
translocate,demonstrated |
| R4171 |
T15078 |
T15080 |
compound |
type,protein |
| R4172 |
T15079 |
T15078 |
punct |
-,type |
| R4173 |
T15080 |
T15076 |
pobj |
protein,with |
| R4174 |
T15002 |
T15003 |
nummod |
one,allele |
| R4175 |
T15081 |
T15075 |
punct |
", ",reach |
| R4176 |
T15082 |
T15083 |
compound |
AQP2,F204V |
| R4177 |
T15083 |
T15075 |
nsubj |
F204V,reach |
| R4178 |
T15003 |
T15001 |
nsubj |
allele,translocate |
| R4179 |
T15084 |
T15083 |
punct |
-,F204V |
| R418 |
T2637 |
T2634 |
punct |
],6 |
| R4180 |
T15085 |
T15075 |
aux |
can,reach |
| R4181 |
T15086 |
T15087 |
det |
the,surface |
| R4182 |
T15004 |
T15003 |
amod |
recessive,allele |
| R4183 |
T15087 |
T15075 |
dobj |
surface,reach |
| R4184 |
T15088 |
T15087 |
compound |
cell,surface |
| R4185 |
T15089 |
T15090 |
punct |
(,panel |
| R4186 |
T15005 |
T15003 |
prep |
of,allele |
| R4187 |
T15090 |
T15075 |
parataxis |
panel,reach |
| R4188 |
T15091 |
T15090 |
nmod |
Figure,panel |
| R4189 |
T15092 |
T15091 |
nummod |
5C,Figure |
| R419 |
T2638 |
T2613 |
punct |
.,established |
| R4190 |
T15093 |
T15094 |
npadvmod |
bottom,right |
| R4191 |
T15006 |
T15005 |
pobj |
Aqp2,of |
| R4192 |
T15094 |
T15090 |
amod |
right,panel |
| R4193 |
T15095 |
T15090 |
cc |
and,panel |
| R4194 |
T15096 |
T15090 |
conj |
5D,panel |
| R4195 |
T15007 |
T15003 |
punct |
", ",allele |
| R4196 |
T15097 |
T15090 |
punct |
),panel |
| R4197 |
T15098 |
T15053 |
punct |
.,interact |
| R4198 |
T15008 |
T15003 |
appos |
P262L,allele |
| R4199 |
T15100 |
T15101 |
mark |
Although,demonstrated |
| R42 |
T642 |
T643 |
aux |
to,harbor |
| R420 |
T2640 |
T2641 |
advmod |
Furthermore,targeted |
| R4200 |
T15101 |
T15105 |
advcl |
demonstrated,show |
| R4201 |
T15009 |
T15001 |
punct |
", ",translocate |
| R4202 |
T15102 |
T15101 |
nsubjpass |
it,demonstrated |
| R4203 |
T15103 |
T15101 |
aux |
has,demonstrated |
| R4204 |
T15104 |
T15101 |
auxpass |
been,demonstrated |
| R4205 |
T15010 |
T15001 |
aux |
does,translocate |
| R4206 |
T15106 |
T15107 |
mark |
that,fails |
| R4207 |
T15107 |
T15101 |
ccomp |
fails,demonstrated |
| R4208 |
T15108 |
T15109 |
det |
a,allele |
| R4209 |
T15109 |
T15107 |
nsubj |
allele,fails |
| R421 |
T2641 |
T2648 |
ccomp |
targeted,routed |
| R4210 |
T15110 |
T15109 |
amod |
recessive,allele |
| R4211 |
T15011 |
T15001 |
neg |
not,translocate |
| R4212 |
T15111 |
T15109 |
punct |
(,allele |
| R4213 |
T15112 |
T15109 |
acl |
encoding,allele |
| R4214 |
T15113 |
T15114 |
compound |
AQP2,R187C |
| R4215 |
T15012 |
T15001 |
advmod |
properly,translocate |
| R4216 |
T15114 |
T15112 |
dobj |
R187C,encoding |
| R4217 |
T15115 |
T15114 |
punct |
-,R187C |
| R4218 |
T15116 |
T15109 |
punct |
),allele |
| R4219 |
T15013 |
T15014 |
advmod |
when,expressed |
| R422 |
T2642 |
T2643 |
det |
these,proteins |
| R4220 |
T15117 |
T15109 |
prep |
of,allele |
| R4221 |
T15118 |
T15117 |
pobj |
NDI,of |
| R4222 |
T15014 |
T15001 |
advcl |
expressed,translocate |
| R4223 |
T15119 |
T15120 |
aux |
to,interact |
| R4224 |
T15015 |
T15014 |
prep |
by,expressed |
| R4225 |
T15120 |
T15107 |
xcomp |
interact,fails |
| R4226 |
T15121 |
T15120 |
prep |
with,interact |
| R4227 |
T15122 |
T15123 |
amod |
wild,type |
| R4228 |
T15016 |
T15015 |
pobj |
itself,by |
| R4229 |
T15123 |
T15125 |
compound |
type,AQP2 |
| R423 |
T2643 |
T2641 |
nsubjpass |
proteins,targeted |
| R4230 |
T15124 |
T15123 |
punct |
-,type |
| R4231 |
T15125 |
T15121 |
pobj |
AQP2,with |
| R4232 |
T15017 |
T15014 |
prep |
in,expressed |
| R4233 |
T15126 |
T15127 |
punct |
[,6 |
| R4234 |
T15127 |
T15101 |
parataxis |
6,demonstrated |
| R4235 |
T15018 |
T15019 |
compound |
MDCK,cells |
| R4236 |
T15128 |
T15127 |
punct |
],6 |
| R4237 |
T15129 |
T15105 |
punct |
", ",show |
| R4238 |
T15019 |
T15017 |
pobj |
cells,in |
| R4239 |
T15130 |
T15105 |
advmod |
here,show |
| R424 |
T2644 |
T2641 |
aux |
can,targeted |
| R4240 |
T15131 |
T15105 |
nsubj |
we,show |
| R4241 |
T15132 |
T15133 |
mark |
that,interact |
| R4242 |
T15133 |
T15105 |
ccomp |
interact,show |
| R4243 |
T15020 |
T15001 |
punct |
", ",translocate |
| R4244 |
T15134 |
T15135 |
compound |
AQP2,F204V |
| R4245 |
T15135 |
T15133 |
nsubj |
F204V,interact |
| R4246 |
T15021 |
T15001 |
cc |
but,translocate |
| R4247 |
T15136 |
T15135 |
punct |
-,F204V |
| R4248 |
T15137 |
T15133 |
aux |
does,interact |
| R4249 |
T15138 |
T15133 |
prep |
with,interact |
| R425 |
T2645 |
T2641 |
advmod |
also,targeted |
| R4250 |
T15022 |
T15023 |
mark |
that,localizes |
| R4251 |
T15139 |
T15140 |
det |
the,protein |
| R4252 |
T15140 |
T15138 |
pobj |
protein,with |
| R4253 |
T15141 |
T15142 |
amod |
wild,type |
| R4254 |
T15023 |
T15001 |
conj |
localizes,translocate |
| R4255 |
T15142 |
T15140 |
compound |
type,protein |
| R4256 |
T15143 |
T15142 |
punct |
-,type |
| R4257 |
T15144 |
T15133 |
punct |
", ",interact |
| R4258 |
T15145 |
T15146 |
advmod |
presumably,as |
| R4259 |
T15146 |
T15133 |
prep |
as,interact |
| R426 |
T2646 |
T2641 |
auxpass |
be,targeted |
| R4260 |
T15147 |
T15146 |
pobj |
part,as |
| R4261 |
T15024 |
T15023 |
prep |
in,localizes |
| R4262 |
T15148 |
T15147 |
prep |
of,part |
| R4263 |
T15149 |
T15148 |
pobj |
heterotetramers,of |
| R4264 |
T15025 |
T15026 |
det |
the,presence |
| R4265 |
T15150 |
T15133 |
punct |
", ",interact |
| R4266 |
T15151 |
T15133 |
cc |
and,interact |
| R4267 |
T15152 |
T15133 |
conj |
represents,interact |
| R4268 |
T15153 |
T15154 |
det |
a,allele |
| R4269 |
T15026 |
T15024 |
pobj |
presence,in |
| R427 |
T2647 |
T2641 |
advmod |
differentially,targeted |
| R4270 |
T15154 |
T15152 |
dobj |
allele,represents |
| R4271 |
T15155 |
T15154 |
amod |
rescuable,allele |
| R4272 |
T15156 |
T15152 |
punct |
", ",represents |
| R4273 |
T15027 |
T15026 |
prep |
of,presence |
| R4274 |
T15157 |
T15158 |
preconj |
both,vitro |
| R4275 |
T15158 |
T15152 |
advmod |
vitro,represents |
| R4276 |
T15028 |
T15029 |
amod |
wild,type |
| R4277 |
T15159 |
T15158 |
advmod |
in,vitro |
| R4278 |
T15160 |
T15158 |
cc |
and,vitro |
| R4279 |
T15029 |
T15031 |
compound |
type,protein |
| R428 |
T2649 |
T2641 |
prep |
to,targeted |
| R4280 |
T15030 |
T15029 |
punct |
-,type |
| R4281 |
T15031 |
T15027 |
pobj |
protein,of |
| R4282 |
T15161 |
T15162 |
advmod |
in,vivo |
| R4283 |
T15162 |
T15158 |
conj |
vivo,vitro |
| R4284 |
T15032 |
T15023 |
punct |
", ",localizes |
| R4285 |
T15163 |
T15105 |
punct |
.,show |
| R4286 |
T15165 |
T15166 |
csubj |
Immunostaining,shows |
| R4287 |
T15033 |
T15023 |
nsubj |
it,localizes |
| R4288 |
T15034 |
T15023 |
advmod |
normally,localizes |
| R4289 |
T15167 |
T15168 |
det |
the,kidneys |
| R429 |
T2650 |
T2651 |
amod |
distinct,regions |
| R4290 |
T15168 |
T15165 |
dobj |
kidneys,Immunostaining |
| R4291 |
T15169 |
T15168 |
prep |
of,kidneys |
| R4292 |
T15170 |
T15171 |
amod |
homozygous,mice |
| R4293 |
T15035 |
T14990 |
punct |
.,demonstrated |
| R4294 |
T15171 |
T15169 |
pobj |
mice,of |
| R4295 |
T15172 |
T15173 |
compound |
Aqp2F204V,F204V |
| R4296 |
T15173 |
T15171 |
compound |
F204V,mice |
| R4297 |
T15037 |
T15038 |
det |
The,mechanism |
| R4298 |
T15174 |
T15173 |
punct |
/,F204V |
| R4299 |
T15175 |
T15176 |
mark |
that,mediate |
| R43 |
T643 |
T635 |
xcomp |
harbor,found |
| R430 |
T2651 |
T2649 |
pobj |
regions,to |
| R4300 |
T15176 |
T15166 |
ccomp |
mediate,shows |
| R4301 |
T15177 |
T15178 |
det |
the,cells |
| R4302 |
T15038 |
T15040 |
nsubj |
mechanism,seems |
| R4303 |
T15178 |
T15176 |
nsubj |
cells,mediate |
| R4304 |
T15179 |
T15180 |
npadvmod |
mutant,expressing |
| R4305 |
T15039 |
T15038 |
amod |
same,mechanism |
| R4306 |
T15180 |
T15178 |
amod |
expressing,cells |
| R4307 |
T15181 |
T15180 |
punct |
-,expressing |
| R4308 |
T15182 |
T15183 |
amod |
collecting,duct |
| R4309 |
T15183 |
T15178 |
compound |
duct,cells |
| R431 |
T2652 |
T2651 |
prep |
of,regions |
| R4310 |
T15184 |
T15176 |
aux |
can,mediate |
| R4311 |
T15185 |
T15176 |
neg |
not,mediate |
| R4312 |
T15186 |
T15187 |
compound |
water,reabsorption |
| R4313 |
T15041 |
T15042 |
aux |
to,apply |
| R4314 |
T15187 |
T15176 |
dobj |
reabsorption,mediate |
| R4315 |
T15188 |
T15176 |
punct |
", ",mediate |
| R4316 |
T15189 |
T15190 |
mark |
because,fails |
| R4317 |
T15190 |
T15176 |
advcl |
fails,mediate |
| R4318 |
T15191 |
T15190 |
nsubj |
it,fails |
| R4319 |
T15042 |
T15040 |
xcomp |
apply,seems |
| R432 |
T2653 |
T2654 |
det |
the,PM |
| R4320 |
T15192 |
T15193 |
aux |
to,insert |
| R4321 |
T15193 |
T15190 |
xcomp |
insert,fails |
| R4322 |
T15043 |
T15044 |
advmod |
in,vivo |
| R4323 |
T15194 |
T15193 |
prep |
into,insert |
| R4324 |
T15195 |
T15196 |
det |
the,membrane |
| R4325 |
T15196 |
T15194 |
pobj |
membrane,into |
| R4326 |
T15044 |
T15042 |
advmod |
vivo,apply |
| R4327 |
T15197 |
T15196 |
amod |
apical,membrane |
| R4328 |
T15198 |
T15196 |
compound |
plasma,membrane |
| R4329 |
T15199 |
T15193 |
prep |
in,insert |
| R433 |
T2654 |
T2652 |
pobj |
PM,of |
| R4330 |
T15045 |
T15042 |
prep |
with,apply |
| R4331 |
T15200 |
T15199 |
pobj |
response,in |
| R4332 |
T15046 |
T15047 |
nmod |
Aqp2F204V,mice |
| R4333 |
T15047 |
T15045 |
pobj |
mice,with |
| R4334 |
T15048 |
T15046 |
punct |
/,Aqp2F204V |
| R4335 |
T15201 |
T15200 |
prep |
to,response |
| R4336 |
T15049 |
T15046 |
punct |
+,Aqp2F204V |
| R4337 |
T15050 |
T15040 |
punct |
.,seems |
| R4338 |
T15202 |
T15201 |
pobj |
dDAVP,to |
| R4339 |
T15203 |
T15166 |
punct |
.,shows |
| R434 |
T2655 |
T2648 |
punct |
;,routed |
| R4340 |
T15052 |
T15053 |
prep |
In,interact |
| R4341 |
T15205 |
T15206 |
nsubj |
This,is |
| R4342 |
T15054 |
T15052 |
pobj |
support,In |
| R4343 |
T15207 |
T15208 |
det |
this,proof |
| R4344 |
T15208 |
T15206 |
attr |
proof,is |
| R4345 |
T15209 |
T15208 |
amod |
first,proof |
| R4346 |
T15055 |
T15054 |
prep |
of,support |
| R4347 |
T15210 |
T15211 |
advmod |
in,vivo |
| R4348 |
T15211 |
T15208 |
amod |
vivo,proof |
| R4349 |
T15212 |
T15208 |
prep |
of,proof |
| R435 |
T2656 |
T2648 |
prep |
for,routed |
| R4350 |
T15267 |
T15268 |
advmod |
Thus,proposed |
| R4351 |
T15213 |
T15214 |
det |
a,hypothesis |
| R4352 |
T15214 |
T15212 |
pobj |
hypothesis,of |
| R4353 |
T15215 |
T15216 |
amod |
long,standing |
| R4354 |
T15216 |
T15214 |
amod |
standing,hypothesis |
| R4355 |
T15217 |
T15216 |
punct |
-,standing |
| R4356 |
T15269 |
T15268 |
punct |
", ",proposed |
| R4357 |
T15218 |
T15219 |
dep |
that,comes |
| R4358 |
T15219 |
T15214 |
relcl |
comes,hypothesis |
| R4359 |
T15220 |
T15219 |
prep |
from,comes |
| R436 |
T2657 |
T2656 |
pobj |
example,for |
| R4360 |
T15221 |
T15222 |
advmod |
in,vitro |
| R4361 |
T15222 |
T15223 |
amod |
vitro,studies |
| R4362 |
T15223 |
T15220 |
pobj |
studies,from |
| R4363 |
T15224 |
T15223 |
prep |
with,studies |
| R4364 |
T15270 |
T15268 |
nsubjpass |
misfolding,proposed |
| R4365 |
T15225 |
T15226 |
amod |
recessive,mutations |
| R4366 |
T15226 |
T15224 |
pobj |
mutations,with |
| R4367 |
T15227 |
T15226 |
compound |
Aqp2,mutations |
| R4368 |
T15228 |
T15206 |
punct |
.,is |
| R4369 |
T15271 |
T15270 |
punct |
", ",misfolding |
| R437 |
T2658 |
T2648 |
punct |
", ",routed |
| R4370 |
T15230 |
T15231 |
nsubj |
Transfection,shows |
| R4371 |
T15272 |
T15270 |
conj |
retention,misfolding |
| R4372 |
T15232 |
T15230 |
prep |
into,Transfection |
| R4373 |
T15233 |
T15234 |
compound |
MDCK,cells |
| R4374 |
T15273 |
T15272 |
prep |
in,retention |
| R4375 |
T15234 |
T15232 |
pobj |
cells,into |
| R4376 |
T15235 |
T15230 |
prep |
of,Transfection |
| R4377 |
T15236 |
T15235 |
pobj |
any,of |
| R4378 |
T15274 |
T15275 |
det |
the,ER |
| R4379 |
T15237 |
T15236 |
prep |
of,any |
| R438 |
T2659 |
T2648 |
nsubjpass |
AQP2,routed |
| R4380 |
T15238 |
T15239 |
amod |
several,mutations |
| R4381 |
T15239 |
T15237 |
pobj |
mutations,of |
| R4382 |
T15275 |
T15273 |
pobj |
ER,in |
| R4383 |
T15240 |
T15239 |
compound |
Aqp2,mutations |
| R4384 |
T15241 |
T15239 |
acl |
corresponding,mutations |
| R4385 |
T15276 |
T15272 |
punct |
", ",retention |
| R4386 |
T15242 |
T15241 |
prep |
to,corresponding |
| R4387 |
T15243 |
T15244 |
amod |
recessive,alleles |
| R4388 |
T15244 |
T15242 |
pobj |
alleles,to |
| R4389 |
T15245 |
T15244 |
amod |
human,alleles |
| R439 |
T2660 |
T2648 |
auxpass |
is,routed |
| R4390 |
T15277 |
T15272 |
cc |
and,retention |
| R4391 |
T15246 |
T15247 |
amod |
abnormal,localization |
| R4392 |
T15247 |
T15231 |
dobj |
localization,shows |
| R4393 |
T15278 |
T15272 |
conj |
failure,retention |
| R4394 |
T15248 |
T15247 |
amod |
subcellular,localization |
| R4395 |
T15249 |
T15250 |
punct |
[,25 |
| R4396 |
T15279 |
T15280 |
aux |
to,translocate |
| R4397 |
T15250 |
T15247 |
parataxis |
25,localization |
| R4398 |
T15251 |
T15250 |
punct |
],25 |
| R4399 |
T15252 |
T15247 |
punct |
", ",localization |
| R44 |
T644 |
T643 |
dobj |
mutations,harbor |
| R440 |
T2661 |
T2648 |
prep |
to,routed |
| R4400 |
T15280 |
T15278 |
acl |
translocate,failure |
| R4401 |
T15253 |
T15254 |
punct |
[,27 |
| R4402 |
T15254 |
T15247 |
parataxis |
27,localization |
| R4403 |
T15255 |
T15254 |
punct |
],27 |
| R4404 |
T15281 |
T15280 |
prep |
in,translocate |
| R4405 |
T15256 |
T15247 |
cc |
and,localization |
| R4406 |
T15257 |
T15247 |
conj |
failure,localization |
| R4407 |
T15258 |
T15259 |
aux |
to,translocate |
| R4408 |
T15282 |
T15281 |
pobj |
response,in |
| R4409 |
T15259 |
T15257 |
acl |
translocate,failure |
| R441 |
T2662 |
T2663 |
det |
the,membrane |
| R4410 |
T15260 |
T15259 |
advmod |
appropriately,translocate |
| R4411 |
T15261 |
T15259 |
prep |
to,translocate |
| R4412 |
T15283 |
T15282 |
prep |
to,response |
| R4413 |
T15262 |
T15263 |
det |
the,membrane |
| R4414 |
T15263 |
T15261 |
pobj |
membrane,to |
| R4415 |
T15264 |
T15263 |
compound |
plasma,membrane |
| R4416 |
T15265 |
T15231 |
punct |
.,shows |
| R4417 |
T15284 |
T15283 |
pobj |
dDAVP,to |
| R4418 |
T15285 |
T15268 |
auxpass |
were,proposed |
| R4419 |
T15286 |
T15268 |
prep |
as,proposed |
| R442 |
T2663 |
T2661 |
pobj |
membrane,to |
| R4420 |
T15287 |
T15288 |
det |
the,mechanism |
| R4421 |
T15288 |
T15286 |
pobj |
mechanism,as |
| R4422 |
T15289 |
T15288 |
prep |
for,mechanism |
| R4423 |
T15290 |
T15291 |
amod |
autosomal,NDI |
| R4424 |
T15291 |
T15289 |
pobj |
NDI,for |
| R4425 |
T15292 |
T15291 |
amod |
recessive,NDI |
| R4426 |
T15293 |
T15268 |
punct |
.,proposed |
| R4427 |
T15295 |
T15296 |
advmod |
Here,prove |
| R4428 |
T15297 |
T15296 |
nsubj |
we,prove |
| R4429 |
T15298 |
T15296 |
preconj |
not,prove |
| R443 |
T2664 |
T2663 |
amod |
apical,membrane |
| R4430 |
T15299 |
T15298 |
advmod |
only,not |
| R4431 |
T15300 |
T15301 |
det |
this,hypothesis |
| R4432 |
T15301 |
T15296 |
dobj |
hypothesis,prove |
| R4433 |
T15302 |
T15296 |
cc |
but,prove |
| R4434 |
T15303 |
T15302 |
advmod |
also,but |
| R4435 |
T15304 |
T15296 |
conj |
establish,prove |
| R4436 |
T15305 |
T15306 |
det |
a,model |
| R4437 |
T15306 |
T15304 |
dobj |
model,establish |
| R4438 |
T15307 |
T15306 |
amod |
useful,model |
| R4439 |
T15308 |
T15306 |
prep |
for,model |
| R444 |
T2665 |
T2663 |
prep |
of,membrane |
| R4440 |
T15309 |
T15310 |
amod |
human,NDI |
| R4441 |
T15310 |
T15308 |
pobj |
NDI,for |
| R4442 |
T15311 |
T15296 |
punct |
.,prove |
| R4443 |
T15313 |
T15314 |
det |
This,model |
| R4444 |
T15314 |
T15316 |
nsubj |
model,provides |
| R4445 |
T15315 |
T15314 |
compound |
mouse,model |
| R4446 |
T15317 |
T15314 |
prep |
of,model |
| R4447 |
T15318 |
T15317 |
pobj |
NDI,of |
| R4448 |
T15319 |
T15314 |
prep |
based,model |
| R4449 |
T15320 |
T15319 |
prep |
on,based |
| R445 |
T2666 |
T2665 |
pobj |
cells,of |
| R4450 |
T15321 |
T15322 |
det |
an,allele |
| R4451 |
T15322 |
T15320 |
pobj |
allele,on |
| R4452 |
T15323 |
T15322 |
compound |
Aqp2,allele |
| R4453 |
T15324 |
T15325 |
dep |
that,rescued |
| R4454 |
T15325 |
T15322 |
relcl |
rescued,allele |
| R4455 |
T15326 |
T15325 |
aux |
can,rescued |
| R4456 |
T15327 |
T15325 |
auxpass |
be,rescued |
| R4457 |
T15328 |
T15329 |
det |
the,opportunity |
| R4458 |
T15329 |
T15316 |
dobj |
opportunity,provides |
| R4459 |
T15330 |
T15331 |
aux |
to,test |
| R446 |
T2667 |
T2666 |
acl |
surrounding,cells |
| R4460 |
T15331 |
T15329 |
acl |
test,opportunity |
| R4461 |
T15332 |
T15331 |
dobj |
therapies,test |
| R4462 |
T15333 |
T15332 |
punct |
", ",therapies |
| R4463 |
T15334 |
T15332 |
prep |
including,therapies |
| R4464 |
T15335 |
T15336 |
compound |
gene,therapy |
| R4465 |
T15336 |
T15334 |
pobj |
therapy,including |
| R4466 |
T15337 |
T15332 |
punct |
", ",therapies |
| R4467 |
T15338 |
T15339 |
dep |
that,promote |
| R4468 |
T15339 |
T15332 |
relcl |
promote,therapies |
| R4469 |
T15340 |
T15339 |
aux |
may,promote |
| R447 |
T2668 |
T2669 |
det |
the,duct |
| R4470 |
T15341 |
T15342 |
amod |
proper,localization |
| R4471 |
T15342 |
T15339 |
dobj |
localization,promote |
| R4472 |
T15343 |
T15342 |
amod |
subcellular,localization |
| R4473 |
T15344 |
T15316 |
punct |
.,provides |
| R4474 |
T15508 |
T15507 |
prep |
of,Generation |
| R4475 |
T15509 |
T15510 |
compound |
ENU,mice |
| R4476 |
T15510 |
T15508 |
pobj |
mice,of |
| R4477 |
T15511 |
T15507 |
cc |
and,Generation |
| R4478 |
T15512 |
T15507 |
conj |
housing,Generation |
| R4479 |
T15513 |
T15512 |
punct |
.,housing |
| R448 |
T2669 |
T2667 |
dobj |
duct,surrounding |
| R4480 |
T15515 |
T15516 |
nmod |
ENU,mice |
| R4481 |
T15516 |
T15521 |
nsubjpass |
mice,generated |
| R4482 |
T15517 |
T15516 |
amod |
mutagenized,mice |
| R4483 |
T15518 |
T15516 |
nmod |
C57BL,mice |
| R4484 |
T15519 |
T15518 |
punct |
/,C57BL |
| R4485 |
T15520 |
T15518 |
nummod |
6,C57BL |
| R4486 |
T15522 |
T15521 |
auxpass |
were,generated |
| R4487 |
T15523 |
T15524 |
mark |
as,described |
| R4488 |
T15524 |
T15521 |
advcl |
described,generated |
| R4489 |
T15525 |
T15526 |
punct |
[,19 |
| R449 |
T2670 |
T2669 |
amod |
collecting,duct |
| R4490 |
T15526 |
T15521 |
parataxis |
19,generated |
| R4491 |
T15527 |
T15526 |
punct |
],19 |
| R4492 |
T15528 |
T15521 |
punct |
.,generated |
| R4493 |
T15530 |
T15531 |
nsubjpass |
Mice,maintained |
| R4494 |
T15532 |
T15531 |
auxpass |
were,maintained |
| R4495 |
T15533 |
T15531 |
prep |
by,maintained |
| R4496 |
T15534 |
T15533 |
pcomp |
backcrossing,by |
| R4497 |
T15535 |
T15536 |
amod |
affected,animals |
| R4498 |
T15536 |
T15534 |
dobj |
animals,backcrossing |
| R4499 |
T15537 |
T15534 |
prep |
to,backcrossing |
| R45 |
T645 |
T643 |
prep |
in,harbor |
| R450 |
T2671 |
T2648 |
punct |
", ",routed |
| R4500 |
T15538 |
T15537 |
pobj |
C57BL,to |
| R4501 |
T15539 |
T15538 |
punct |
/,C57BL |
| R4502 |
T15540 |
T15538 |
nummod |
6,C57BL |
| R4503 |
T15541 |
T15531 |
cc |
and,maintained |
| R4504 |
T15542 |
T15531 |
conj |
housed,maintained |
| R4505 |
T15543 |
T15542 |
prep |
in,housed |
| R4506 |
T15544 |
T15545 |
det |
the,Institute |
| R4507 |
T15545 |
T15543 |
pobj |
Institute,in |
| R4508 |
T15546 |
T15545 |
compound |
Genomics,Institute |
| R4509 |
T15547 |
T15545 |
prep |
of,Institute |
| R451 |
T2672 |
T2673 |
mark |
whereas,inserted |
| R4510 |
T15548 |
T15549 |
det |
the,facility |
| R4511 |
T15549 |
T15547 |
pobj |
facility,of |
| R4512 |
T15550 |
T15551 |
compound |
Novartis,Foundation |
| R4513 |
T15551 |
T15549 |
compound |
Foundation,facility |
| R4514 |
T15552 |
T15551 |
compound |
Research,Foundation |
| R4515 |
T15553 |
T15554 |
compound |
Specific,Pathogen |
| R4516 |
T15554 |
T15555 |
compound |
Pathogen,Free |
| R4517 |
T15555 |
T15549 |
compound |
Free,facility |
| R4518 |
T15556 |
T15549 |
compound |
animal,facility |
| R4519 |
T15557 |
T15558 |
punct |
(,Jolla |
| R452 |
T2673 |
T2648 |
advcl |
inserted,routed |
| R4520 |
T15558 |
T15549 |
parataxis |
Jolla,facility |
| R4521 |
T15559 |
T15558 |
compound |
La,Jolla |
| R4522 |
T15560 |
T15558 |
punct |
", ",Jolla |
| R4523 |
T15561 |
T15558 |
npadvmod |
California,Jolla |
| R4524 |
T15562 |
T15558 |
punct |
", ",Jolla |
| R4525 |
T15563 |
T15564 |
compound |
United,States |
| R4526 |
T15564 |
T15558 |
npadvmod |
States,Jolla |
| R4527 |
T15565 |
T15558 |
punct |
),Jolla |
| R4528 |
T15566 |
T15531 |
punct |
.,maintained |
| R4529 |
T15568 |
T15569 |
det |
All,procedures |
| R453 |
T2674 |
T2675 |
amod |
other,aquaporins |
| R4530 |
T15569 |
T15570 |
nsubjpass |
procedures,approved |
| R4531 |
T15571 |
T15570 |
auxpass |
were,approved |
| R4532 |
T15572 |
T15570 |
agent |
by,approved |
| R4533 |
T15573 |
T15574 |
det |
the,Institute |
| R4534 |
T15574 |
T15572 |
pobj |
Institute,by |
| R4535 |
T15575 |
T15574 |
compound |
Genomics,Institute |
| R4536 |
T15576 |
T15574 |
prep |
of,Institute |
| R4537 |
T15577 |
T15578 |
det |
the,Committee |
| R4538 |
T15578 |
T15576 |
pobj |
Committee,of |
| R4539 |
T15579 |
T15580 |
nmod |
Novartis,Foundation |
| R454 |
T2675 |
T2673 |
nsubjpass |
aquaporins,inserted |
| R4540 |
T15580 |
T15578 |
nmod |
Foundation,Committee |
| R4541 |
T15581 |
T15580 |
nmod |
Research,Foundation |
| R4542 |
T15582 |
T15583 |
nmod |
Institutional,Animal |
| R4543 |
T15583 |
T15578 |
nmod |
Animal,Committee |
| R4544 |
T15584 |
T15583 |
appos |
Care,Animal |
| R4545 |
T15585 |
T15584 |
cc |
and,Care |
| R4546 |
T15586 |
T15584 |
conj |
Use,Care |
| R4547 |
T15587 |
T15570 |
punct |
.,approved |
| R4548 |
T15901 |
T15900 |
punct |
.,Constructs |
| R4549 |
T15903 |
T15904 |
det |
The,sequence |
| R455 |
T2676 |
T2675 |
punct |
(,aquaporins |
| R4550 |
T15904 |
T15907 |
nsubjpass |
sequence,digested |
| R4551 |
T15905 |
T15904 |
amod |
complete,sequence |
| R4552 |
T15906 |
T15904 |
compound |
coding,sequence |
| R4553 |
T15908 |
T15904 |
prep |
of,sequence |
| R4554 |
T15909 |
T15910 |
compound |
mouse,AQP2 |
| R4555 |
T15910 |
T15908 |
pobj |
AQP2,of |
| R4556 |
T15911 |
T15904 |
prep |
from,sequence |
| R4557 |
T15912 |
T15913 |
det |
an,clone |
| R4558 |
T15913 |
T15911 |
pobj |
clone,from |
| R4559 |
T15914 |
T15913 |
compound |
IMAGE,clone |
| R456 |
T2677 |
T2675 |
appos |
AQP3,aquaporins |
| R4560 |
T15915 |
T15907 |
auxpass |
was,digested |
| R4561 |
T15916 |
T15907 |
prep |
from,digested |
| R4562 |
T15917 |
T15918 |
det |
the,plasmid |
| R4563 |
T15918 |
T15916 |
pobj |
plasmid,from |
| R4564 |
T15919 |
T15918 |
compound |
pCMV⋅SPORT6,plasmid |
| R4565 |
T15920 |
T15907 |
prep |
with,digested |
| R4566 |
T15921 |
T15920 |
pobj |
EcoRI,with |
| R4567 |
T15922 |
T15921 |
cc |
and,EcoRI |
| R4568 |
T15923 |
T15921 |
conj |
NotI,EcoRI |
| R4569 |
T15924 |
T15907 |
cc |
and,digested |
| R457 |
T2678 |
T2677 |
cc |
or,AQP3 |
| R4570 |
T15925 |
T15907 |
conj |
ligated,digested |
| R4571 |
T15926 |
T15925 |
prep |
into,ligated |
| R4572 |
T15927 |
T15926 |
pobj |
pcDNA3.1,into |
| R4573 |
T15928 |
T15929 |
punct |
(,Invitrogen |
| R4574 |
T15929 |
T15927 |
parataxis |
Invitrogen,pcDNA3.1 |
| R4575 |
T15930 |
T15929 |
punct |
", ",Invitrogen |
| R4576 |
T15931 |
T15929 |
npadvmod |
Carlsbad,Invitrogen |
| R4577 |
T15932 |
T15929 |
punct |
", ",Invitrogen |
| R4578 |
T15933 |
T15929 |
npadvmod |
California,Invitrogen |
| R4579 |
T15934 |
T15929 |
punct |
", ",Invitrogen |
| R458 |
T2679 |
T2677 |
conj |
4,AQP3 |
| R4580 |
T15935 |
T15936 |
compound |
United,States |
| R4581 |
T15936 |
T15929 |
npadvmod |
States,Invitrogen |
| R4582 |
T15937 |
T15929 |
punct |
),Invitrogen |
| R4583 |
T15938 |
T15907 |
punct |
.,digested |
| R4584 |
T15940 |
T15941 |
det |
The,mutation |
| R4585 |
T15941 |
T15943 |
nsubjpass |
mutation,introduced |
| R4586 |
T15942 |
T15941 |
compound |
F204V,mutation |
| R4587 |
T15944 |
T15943 |
auxpass |
was,introduced |
| R4588 |
T15945 |
T15943 |
prep |
by,introduced |
| R4589 |
T15946 |
T15947 |
npadvmod |
site,directed |
| R459 |
T2680 |
T2673 |
punct |
),inserted |
| R4590 |
T15947 |
T15949 |
amod |
directed,mutagenesis |
| R4591 |
T15948 |
T15947 |
punct |
-,directed |
| R4592 |
T15949 |
T15945 |
pobj |
mutagenesis,by |
| R4593 |
T15950 |
T15951 |
punct |
(,Stratagene |
| R4594 |
T15951 |
T15949 |
parataxis |
Stratagene,mutagenesis |
| R4595 |
T15952 |
T15951 |
punct |
", ",Stratagene |
| R4596 |
T15953 |
T15954 |
compound |
La,Jolla |
| R4597 |
T15954 |
T15951 |
npadvmod |
Jolla,Stratagene |
| R4598 |
T15955 |
T15951 |
punct |
", ",Stratagene |
| R4599 |
T15956 |
T15951 |
npadvmod |
California,Stratagene |
| R46 |
T646 |
T647 |
det |
the,gene |
| R460 |
T2681 |
T2673 |
auxpass |
are,inserted |
| R4600 |
T15957 |
T15951 |
punct |
", ",Stratagene |
| R4601 |
T15958 |
T15959 |
compound |
United,States |
| R4602 |
T15959 |
T15951 |
npadvmod |
States,Stratagene |
| R4603 |
T15960 |
T15951 |
punct |
),Stratagene |
| R4604 |
T15961 |
T15943 |
punct |
", ",introduced |
| R4605 |
T15962 |
T15943 |
advcl |
using,introduced |
| R4606 |
T15963 |
T15964 |
det |
the,oligonucleotide |
| R4607 |
T15964 |
T15962 |
dobj |
oligonucleotide,using |
| R4608 |
T15965 |
T15964 |
compound |
sense,oligonucleotide |
| R4609 |
T15966 |
T15967 |
nummod |
5,GATGATCACTGGGTCGTCTGGATCGGACCCC |
| R461 |
T2682 |
T2673 |
prep |
into,inserted |
| R4610 |
T15967 |
T15964 |
appos |
GATGATCACTGGGTCGTCTGGATCGGACCCC,oligonucleotide |
| R4611 |
T15968 |
T15966 |
punct |
′,5 |
| R4612 |
T15969 |
T15967 |
punct |
-,GATGATCACTGGGTCGTCTGGATCGGACCCC |
| R4613 |
T15970 |
T15967 |
punct |
-,GATGATCACTGGGTCGTCTGGATCGGACCCC |
| R4614 |
T15971 |
T15967 |
nummod |
3,GATGATCACTGGGTCGTCTGGATCGGACCCC |
| R4615 |
T15972 |
T15967 |
punct |
′,GATGATCACTGGGTCGTCTGGATCGGACCCC |
| R4616 |
T15973 |
T15964 |
punct |
", ",oligonucleotide |
| R4617 |
T15974 |
T15964 |
cc |
and,oligonucleotide |
| R4618 |
T15975 |
T15976 |
amod |
antisense,oligonucleotide |
| R4619 |
T15976 |
T15964 |
conj |
oligonucleotide,oligonucleotide |
| R462 |
T2683 |
T2684 |
det |
the,face |
| R4620 |
T15977 |
T15978 |
nummod |
5,GGGGTCCGATCCAGACGACCCAGTGATCATC |
| R4621 |
T15978 |
T15976 |
appos |
GGGGTCCGATCCAGACGACCCAGTGATCATC,oligonucleotide |
| R4622 |
T15979 |
T15977 |
punct |
′,5 |
| R4623 |
T15980 |
T15978 |
punct |
-,GGGGTCCGATCCAGACGACCCAGTGATCATC |
| R4624 |
T15981 |
T15978 |
punct |
-,GGGGTCCGATCCAGACGACCCAGTGATCATC |
| R4625 |
T15982 |
T15978 |
nummod |
3,GGGGTCCGATCCAGACGACCCAGTGATCATC |
| R4626 |
T15983 |
T15978 |
punct |
′,GGGGTCCGATCCAGACGACCCAGTGATCATC |
| R4627 |
T15984 |
T15943 |
punct |
.,introduced |
| R4628 |
T15986 |
T15987 |
aux |
To,generate |
| R4629 |
T15987 |
T15988 |
advcl |
generate,used |
| R463 |
T2684 |
T2682 |
pobj |
face,into |
| R4630 |
T15989 |
T15990 |
compound |
GFP,fusions |
| R4631 |
T15990 |
T15987 |
dobj |
fusions,generate |
| R4632 |
T15991 |
T15990 |
prep |
of,fusions |
| R4633 |
T15992 |
T15991 |
pobj |
AQP2,of |
| R4634 |
T15993 |
T15988 |
punct |
", ",used |
| R4635 |
T15994 |
T15995 |
det |
the,construct |
| R4636 |
T15995 |
T15988 |
nsubjpass |
construct,used |
| R4637 |
T15996 |
T15995 |
compound |
pCMV⋅SPORT6,construct |
| R4638 |
T15997 |
T15995 |
compound |
AQP2,construct |
| R4639 |
T15998 |
T15988 |
auxpass |
was,used |
| R464 |
T2685 |
T2684 |
amod |
basolateral,face |
| R4640 |
T15999 |
T15988 |
prep |
in,used |
| R4641 |
T16000 |
T16001 |
det |
a,reaction |
| R4642 |
T16001 |
T15999 |
pobj |
reaction,in |
| R4643 |
T16002 |
T16001 |
compound |
PCR,reaction |
| R4644 |
T16003 |
T16001 |
prep |
with,reaction |
| R4645 |
T16004 |
T16005 |
det |
the,Sp6 |
| R4646 |
T16005 |
T16003 |
pobj |
Sp6,with |
| R4647 |
T16006 |
T16005 |
compound |
primers,Sp6 |
| R4648 |
T16007 |
T16005 |
cc |
and,Sp6 |
| R4649 |
T16008 |
T16009 |
nummod |
5,GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG |
| R465 |
T2686 |
T2648 |
punct |
.,routed |
| R4650 |
T16009 |
T16005 |
conj |
GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG,Sp6 |
| R4651 |
T16010 |
T16008 |
punct |
′,5 |
| R4652 |
T16011 |
T16009 |
punct |
-,GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG |
| R4653 |
T16012 |
T16009 |
punct |
-,GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG |
| R4654 |
T16013 |
T16009 |
nummod |
3,GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG |
| R4655 |
T16014 |
T16009 |
punct |
′,GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG |
| R4656 |
T16015 |
T16016 |
aux |
to,remove |
| R4657 |
T16016 |
T15988 |
advcl |
remove,used |
| R4658 |
T16017 |
T16018 |
det |
the,codon |
| R4659 |
T16018 |
T16016 |
dobj |
codon,remove |
| R466 |
T2688 |
T2689 |
prep |
Unlike,inserted |
| R4660 |
T16019 |
T16018 |
compound |
stop,codon |
| R4661 |
T16020 |
T16018 |
prep |
of,codon |
| R4662 |
T16021 |
T16020 |
pobj |
AQP2,of |
| R4663 |
T16022 |
T15988 |
punct |
.,used |
| R4664 |
T16024 |
T16025 |
det |
The,product |
| R4665 |
T16025 |
T16026 |
nsubjpass |
product,digested |
| R4666 |
T16027 |
T16026 |
auxpass |
was,digested |
| R4667 |
T16028 |
T16026 |
prep |
with,digested |
| R4668 |
T16029 |
T16028 |
pobj |
KpnI,with |
| R4669 |
T16030 |
T16029 |
cc |
and,KpnI |
| R467 |
T2690 |
T2691 |
det |
all,members |
| R4670 |
T16031 |
T16029 |
conj |
BamHI,KpnI |
| R4671 |
T16032 |
T16026 |
cc |
and,digested |
| R4672 |
T16033 |
T16026 |
conj |
ligated,digested |
| R4673 |
T16034 |
T16033 |
prep |
into,ligated |
| R4674 |
T16035 |
T16036 |
compound |
pEGFP,N2 |
| R4675 |
T16036 |
T16034 |
pobj |
N2,into |
| R4676 |
T16037 |
T16036 |
punct |
-,N2 |
| R4677 |
T16038 |
T16039 |
punct |
(,Biosciences |
| R4678 |
T16039 |
T16036 |
parataxis |
Biosciences,N2 |
| R4679 |
T16040 |
T16039 |
compound |
BD,Biosciences |
| R468 |
T2691 |
T2688 |
pobj |
members,Unlike |
| R4680 |
T16041 |
T16039 |
punct |
", ",Biosciences |
| R4681 |
T16042 |
T16043 |
compound |
San,Diego |
| R4682 |
T16043 |
T16039 |
npadvmod |
Diego,Biosciences |
| R4683 |
T16044 |
T16039 |
punct |
", ",Biosciences |
| R4684 |
T16045 |
T16039 |
npadvmod |
California,Biosciences |
| R4685 |
T16046 |
T16039 |
punct |
", ",Biosciences |
| R4686 |
T16047 |
T16048 |
compound |
United,States |
| R4687 |
T16048 |
T16039 |
npadvmod |
States,Biosciences |
| R4688 |
T16049 |
T16039 |
punct |
),Biosciences |
| R4689 |
T16050 |
T16026 |
punct |
.,digested |
| R469 |
T2692 |
T2691 |
amod |
other,members |
| R4690 |
T16052 |
T16053 |
det |
The,mutation |
| R4691 |
T16053 |
T16055 |
nsubjpass |
mutation,introduced |
| R4692 |
T16054 |
T16053 |
compound |
F204V,mutation |
| R4693 |
T16056 |
T16055 |
auxpass |
was,introduced |
| R4694 |
T16057 |
T16055 |
advcl |
using,introduced |
| R4695 |
T16058 |
T16059 |
det |
the,oligonucleotides |
| R4696 |
T16059 |
T16057 |
dobj |
oligonucleotides,using |
| R4697 |
T16060 |
T16059 |
amod |
same,oligonucleotides |
| R4698 |
T16061 |
T16059 |
amod |
mutagenic,oligonucleotides |
| R4699 |
T16062 |
T16055 |
punct |
.,introduced |
| R47 |
T647 |
T645 |
pobj |
gene,in |
| R470 |
T2693 |
T2691 |
compound |
family,members |
| R4700 |
T16399 |
T16400 |
compound |
Cell,culture |
| R4701 |
T16401 |
T16400 |
cc |
and,culture |
| R4702 |
T16402 |
T16400 |
conj |
generation,culture |
| R4703 |
T16403 |
T16400 |
prep |
of,culture |
| R4704 |
T16404 |
T16405 |
amod |
stable,lines |
| R4705 |
T16405 |
T16403 |
pobj |
lines,of |
| R4706 |
T16406 |
T16405 |
compound |
cell,lines |
| R4707 |
T16407 |
T16400 |
punct |
.,culture |
| R4708 |
T16409 |
T16410 |
compound |
MDCK,cells |
| R4709 |
T16410 |
T16411 |
nsubjpass |
cells,cultured |
| R471 |
T2694 |
T2689 |
punct |
", ",inserted |
| R4710 |
T16412 |
T16413 |
punct |
(,ATCC |
| R4711 |
T16413 |
T16410 |
parataxis |
ATCC,cells |
| R4712 |
T16414 |
T16413 |
dep |
CCL,ATCC |
| R4713 |
T16415 |
T16414 |
punct |
-,CCL |
| R4714 |
T16416 |
T16414 |
nummod |
34,CCL |
| R4715 |
T16417 |
T16413 |
punct |
;,ATCC |
| R4716 |
T16418 |
T16413 |
punct |
", ",ATCC |
| R4717 |
T16419 |
T16413 |
npadvmod |
Manassas,ATCC |
| R4718 |
T16420 |
T16413 |
punct |
", ",ATCC |
| R4719 |
T16421 |
T16413 |
npadvmod |
Virginia,ATCC |
| R472 |
T2695 |
T2689 |
nsubjpass |
AQP2,inserted |
| R4720 |
T16422 |
T16413 |
punct |
", ",ATCC |
| R4721 |
T16423 |
T16424 |
compound |
United,States |
| R4722 |
T16424 |
T16413 |
npadvmod |
States,ATCC |
| R4723 |
T16425 |
T16413 |
punct |
),ATCC |
| R4724 |
T16426 |
T16411 |
auxpass |
were,cultured |
| R4725 |
T16427 |
T16411 |
prep |
in,cultured |
| R4726 |
T16428 |
T16427 |
pobj |
DMEM,in |
| R4727 |
T16429 |
T16430 |
punct |
(,Aldrich |
| R4728 |
T16430 |
T16428 |
parataxis |
Aldrich,DMEM |
| R4729 |
T16431 |
T16430 |
compound |
Sigma,Aldrich |
| R473 |
T2696 |
T2689 |
auxpass |
is,inserted |
| R4730 |
T16432 |
T16430 |
punct |
-,Aldrich |
| R4731 |
T16433 |
T16430 |
punct |
", ",Aldrich |
| R4732 |
T16434 |
T16435 |
compound |
St.,Louis |
| R4733 |
T16435 |
T16430 |
npadvmod |
Louis,Aldrich |
| R4734 |
T16436 |
T16430 |
punct |
", ",Aldrich |
| R4735 |
T16437 |
T16430 |
npadvmod |
Missouri,Aldrich |
| R4736 |
T16438 |
T16430 |
punct |
", ",Aldrich |
| R4737 |
T16439 |
T16440 |
compound |
United,States |
| R4738 |
T16440 |
T16430 |
npadvmod |
States,Aldrich |
| R4739 |
T16441 |
T16430 |
punct |
),Aldrich |
| R474 |
T2697 |
T2689 |
neg |
not,inserted |
| R4740 |
T16442 |
T16411 |
dep |
supplemented,cultured |
| R4741 |
T16443 |
T16442 |
prep |
with,supplemented |
| R4742 |
T16444 |
T16445 |
nummod |
10,% |
| R4743 |
T16445 |
T16446 |
compound |
%,FBS |
| R4744 |
T16446 |
T16443 |
pobj |
FBS,with |
| R4745 |
T16447 |
T16448 |
punct |
(,Aldrich |
| R4746 |
T16448 |
T16446 |
parataxis |
Aldrich,FBS |
| R4747 |
T16449 |
T16448 |
compound |
Sigma,Aldrich |
| R4748 |
T16450 |
T16448 |
punct |
-,Aldrich |
| R4749 |
T16451 |
T16448 |
punct |
),Aldrich |
| R475 |
T2698 |
T2689 |
advmod |
constitutively,inserted |
| R4750 |
T16452 |
T16446 |
punct |
", ",FBS |
| R4751 |
T16453 |
T16454 |
nummod |
100,U |
| R4752 |
T16454 |
T16446 |
conj |
U,FBS |
| R4753 |
T16455 |
T16456 |
punct |
/,ml |
| R4754 |
T16456 |
T16454 |
prep |
ml,U |
| R4755 |
T16457 |
T16454 |
prep |
of,U |
| R4756 |
T16458 |
T16457 |
pobj |
penicillin,of |
| R4757 |
T16459 |
T16454 |
punct |
", ",U |
| R4758 |
T16460 |
T16454 |
cc |
and,U |
| R4759 |
T16461 |
T16462 |
nummod |
100,μg |
| R476 |
T2699 |
T2689 |
prep |
into,inserted |
| R4760 |
T16462 |
T16454 |
conj |
μg,U |
| R4761 |
T16463 |
T16464 |
punct |
/,ml |
| R4762 |
T16464 |
T16462 |
prep |
ml,μg |
| R4763 |
T16465 |
T16462 |
prep |
of,μg |
| R4764 |
T16466 |
T16465 |
pobj |
streptomycin,of |
| R4765 |
T16467 |
T16446 |
prep |
at,FBS |
| R4766 |
T16468 |
T16469 |
nummod |
37,°C |
| R4767 |
T16469 |
T16467 |
pobj |
°C,at |
| R4768 |
T16470 |
T16446 |
prep |
in,FBS |
| R4769 |
T16471 |
T16472 |
nummod |
5,% |
| R477 |
T2700 |
T2701 |
det |
the,membrane |
| R4770 |
T16472 |
T16473 |
compound |
%,CO2 |
| R4771 |
T16473 |
T16470 |
pobj |
CO2,in |
| R4772 |
T16474 |
T16411 |
punct |
.,cultured |
| R4773 |
T16476 |
T16477 |
aux |
To,generate |
| R4774 |
T16477 |
T16478 |
advcl |
generate,transfected |
| R4775 |
T16479 |
T16480 |
amod |
stable,lines |
| R4776 |
T16480 |
T16477 |
dobj |
lines,generate |
| R4777 |
T16481 |
T16480 |
compound |
MDCK,lines |
| R4778 |
T16482 |
T16480 |
compound |
cell,lines |
| R4779 |
T16483 |
T16478 |
punct |
", ",transfected |
| R478 |
T2701 |
T2699 |
pobj |
membrane,into |
| R4780 |
T16484 |
T16478 |
nsubjpass |
cells,transfected |
| R4781 |
T16485 |
T16478 |
auxpass |
were,transfected |
| R4782 |
T16486 |
T16478 |
advcl |
using,transfected |
| R4783 |
T16487 |
T16486 |
dobj |
Lipofectamine,using |
| R4784 |
T16488 |
T16487 |
nummod |
2000,Lipofectamine |
| R4785 |
T16489 |
T16490 |
punct |
(,Invitrogen |
| R4786 |
T16490 |
T16487 |
parataxis |
Invitrogen,Lipofectamine |
| R4787 |
T16491 |
T16490 |
punct |
),Invitrogen |
| R4788 |
T16492 |
T16487 |
cc |
and,Lipofectamine |
| R4789 |
T16493 |
T16494 |
det |
the,constructs |
| R479 |
T2702 |
T2701 |
compound |
plasma,membrane |
| R4790 |
T16494 |
T16487 |
conj |
constructs,Lipofectamine |
| R4791 |
T16495 |
T16494 |
compound |
pcDNA3.1,constructs |
| R4792 |
T16496 |
T16494 |
compound |
expression,constructs |
| R4793 |
T16497 |
T16494 |
punct |
(,constructs |
| R4794 |
T16498 |
T16494 |
acl |
containing,constructs |
| R4795 |
T16499 |
T16500 |
amod |
wild,type |
| R4796 |
T16500 |
T16502 |
compound |
type,AQP2 |
| R4797 |
T16501 |
T16500 |
punct |
-,type |
| R4798 |
T16502 |
T16498 |
dobj |
AQP2,containing |
| R4799 |
T16503 |
T16502 |
punct |
", ",AQP2 |
| R48 |
T648 |
T649 |
nmod |
vasopressin,receptor |
| R480 |
T2703 |
T2689 |
punct |
.,inserted |
| R4800 |
T16504 |
T16505 |
compound |
AQP2,F204V |
| R4801 |
T16505 |
T16502 |
conj |
F204V,AQP2 |
| R4802 |
T16506 |
T16505 |
punct |
-,F204V |
| R4803 |
T16507 |
T16505 |
punct |
", ",F204V |
| R4804 |
T16508 |
T16505 |
cc |
or,F204V |
| R4805 |
T16509 |
T16510 |
det |
no,insert |
| R4806 |
T16510 |
T16505 |
conj |
insert,F204V |
| R4807 |
T16511 |
T16494 |
punct |
),constructs |
| R4808 |
T16512 |
T16478 |
cc |
and,transfected |
| R4809 |
T16513 |
T16478 |
conj |
selected,transfected |
| R481 |
T2705 |
T2706 |
prep |
Under,resides |
| R4810 |
T16514 |
T16513 |
prep |
with,selected |
| R4811 |
T16515 |
T16516 |
nummod |
900,μg |
| R4812 |
T16516 |
T16517 |
nmod |
μg,G418 |
| R4813 |
T16517 |
T16514 |
pobj |
G418,with |
| R4814 |
T16518 |
T16519 |
punct |
/,ml |
| R4815 |
T16519 |
T16516 |
prep |
ml,μg |
| R4816 |
T16520 |
T16521 |
punct |
(,Aldrich |
| R4817 |
T16521 |
T16517 |
parataxis |
Aldrich,G418 |
| R4818 |
T16522 |
T16521 |
compound |
Sigma,Aldrich |
| R4819 |
T16523 |
T16521 |
punct |
-,Aldrich |
| R482 |
T2706 |
T2712 |
ccomp |
resides,translocates |
| R4820 |
T16524 |
T16521 |
punct |
),Aldrich |
| R4821 |
T16525 |
T16478 |
punct |
.,transfected |
| R4822 |
T16527 |
T16528 |
amod |
Individual,colonies |
| R4823 |
T16528 |
T16529 |
nsubjpass |
colonies,expanded |
| R4824 |
T16530 |
T16529 |
auxpass |
were,expanded |
| R4825 |
T16531 |
T16532 |
nummod |
14,d |
| R4826 |
T16532 |
T16533 |
npadvmod |
d,later |
| R4827 |
T16533 |
T16529 |
advmod |
later,expanded |
| R4828 |
T16534 |
T16529 |
punct |
.,expanded |
| R4829 |
T16536 |
T16537 |
prep |
For,added |
| R483 |
T2707 |
T2708 |
amod |
basal,conditions |
| R4830 |
T16538 |
T16539 |
det |
the,duration |
| R4831 |
T16539 |
T16536 |
pobj |
duration,For |
| R4832 |
T16540 |
T16539 |
prep |
of,duration |
| R4833 |
T16541 |
T16542 |
det |
these,experiments |
| R4834 |
T16542 |
T16540 |
pobj |
experiments,of |
| R4835 |
T16543 |
T16537 |
punct |
", ",added |
| R4836 |
T16544 |
T16545 |
det |
the,antibiotic |
| R4837 |
T16545 |
T16537 |
nsubjpass |
antibiotic,added |
| R4838 |
T16546 |
T16537 |
auxpass |
was,added |
| R4839 |
T16547 |
T16537 |
advmod |
continually,added |
| R484 |
T2708 |
T2705 |
pobj |
conditions,Under |
| R4840 |
T16548 |
T16537 |
prep |
to,added |
| R4841 |
T16549 |
T16550 |
det |
the,media |
| R4842 |
T16550 |
T16548 |
pobj |
media,to |
| R4843 |
T16551 |
T16537 |
punct |
.,added |
| R4844 |
T16553 |
T16554 |
amod |
Transient,transfections |
| R4845 |
T16554 |
T16556 |
nsubjpass |
transfections,carried |
| R4846 |
T16555 |
T16554 |
compound |
GFP,transfections |
| R4847 |
T16557 |
T16556 |
auxpass |
were,carried |
| R4848 |
T16558 |
T16556 |
prt |
out,carried |
| R4849 |
T16559 |
T16556 |
prep |
in,carried |
| R485 |
T2709 |
T2706 |
punct |
", ",resides |
| R4850 |
T16560 |
T16561 |
amod |
subconfluent,lines |
| R4851 |
T16561 |
T16559 |
pobj |
lines,in |
| R4852 |
T16562 |
T16561 |
amod |
stable,lines |
| R4853 |
T16563 |
T16561 |
compound |
cells,lines |
| R4854 |
T16564 |
T16556 |
advmod |
also,carried |
| R4855 |
T16565 |
T16556 |
advcl |
using,carried |
| R4856 |
T16566 |
T16565 |
dobj |
Lipofectamine,using |
| R4857 |
T16567 |
T16566 |
nummod |
2000,Lipofectamine |
| R4858 |
T16568 |
T16556 |
punct |
.,carried |
| R4859 |
T16677 |
T16676 |
prep |
of,Sequencing |
| R486 |
T2710 |
T2711 |
det |
the,protein |
| R4860 |
T16678 |
T16677 |
pobj |
Aqp2,of |
| R4861 |
T16679 |
T16676 |
cc |
and,Sequencing |
| R4862 |
T16680 |
T16676 |
conj |
genotyping,Sequencing |
| R4863 |
T16681 |
T16680 |
prep |
of,genotyping |
| R4864 |
T16682 |
T16681 |
pobj |
mice,of |
| R4865 |
T16683 |
T16680 |
punct |
.,genotyping |
| R4866 |
T16685 |
T16686 |
det |
All,exons |
| R4867 |
T16686 |
T16687 |
nsubjpass |
exons,amplified |
| R4868 |
T16688 |
T16686 |
prep |
of,exons |
| R4869 |
T16689 |
T16688 |
pobj |
Aqp2,of |
| R487 |
T2711 |
T2706 |
nsubj |
protein,resides |
| R4870 |
T16690 |
T16687 |
auxpass |
were,amplified |
| R4871 |
T16691 |
T16687 |
prep |
from,amplified |
| R4872 |
T16692 |
T16693 |
nmod |
mouse,DNA |
| R4873 |
T16693 |
T16691 |
pobj |
DNA,from |
| R4874 |
T16694 |
T16693 |
amod |
genomic,DNA |
| R4875 |
T16695 |
T16687 |
cc |
and,amplified |
| R4876 |
T16696 |
T16687 |
conj |
sequenced,amplified |
| R4877 |
T16697 |
T16687 |
punct |
.,amplified |
| R4878 |
T16699 |
T16700 |
prep |
For,amplified |
| R4879 |
T16701 |
T16699 |
pobj |
genotyping,For |
| R488 |
T2713 |
T2706 |
prep |
in,resides |
| R4880 |
T16702 |
T16700 |
punct |
", ",amplified |
| R4881 |
T16703 |
T16700 |
nsubjpass |
exon,amplified |
| R4882 |
T16704 |
T16703 |
nummod |
4,exon |
| R4883 |
T16705 |
T16700 |
auxpass |
was,amplified |
| R4884 |
T16706 |
T16700 |
advcl |
using,amplified |
| R4885 |
T16707 |
T16708 |
det |
the,primers |
| R4886 |
T16708 |
T16706 |
dobj |
primers,using |
| R4887 |
T16709 |
T16710 |
nummod |
5,TCAGAACTTGCCCACTAGCC |
| R4888 |
T16710 |
T16708 |
appos |
TCAGAACTTGCCCACTAGCC,primers |
| R4889 |
T16711 |
T16709 |
punct |
′,5 |
| R489 |
T2714 |
T2715 |
amod |
subapical,vesicles |
| R4890 |
T16712 |
T16710 |
punct |
-,TCAGAACTTGCCCACTAGCC |
| R4891 |
T16713 |
T16710 |
punct |
-,TCAGAACTTGCCCACTAGCC |
| R4892 |
T16714 |
T16710 |
nummod |
3,TCAGAACTTGCCCACTAGCC |
| R4893 |
T16715 |
T16710 |
punct |
′,TCAGAACTTGCCCACTAGCC |
| R4894 |
T16716 |
T16710 |
cc |
and,TCAGAACTTGCCCACTAGCC |
| R4895 |
T16717 |
T16718 |
nummod |
5,TGTAGAGGAGGGAACCGATG |
| R4896 |
T16718 |
T16710 |
conj |
TGTAGAGGAGGGAACCGATG,TCAGAACTTGCCCACTAGCC |
| R4897 |
T16719 |
T16717 |
punct |
′,5 |
| R4898 |
T16720 |
T16718 |
punct |
-,TGTAGAGGAGGGAACCGATG |
| R4899 |
T16721 |
T16718 |
punct |
-,TGTAGAGGAGGGAACCGATG |
| R49 |
T649 |
T647 |
nmod |
receptor,gene |
| R490 |
T2715 |
T2713 |
pobj |
vesicles,in |
| R4900 |
T16722 |
T16718 |
nummod |
3,TGTAGAGGAGGGAACCGATG |
| R4901 |
T16723 |
T16718 |
punct |
′,TGTAGAGGAGGGAACCGATG |
| R4902 |
T16724 |
T16700 |
punct |
.,amplified |
| R4903 |
T16959 |
T16960 |
compound |
Urine,measurements |
| R4904 |
T16961 |
T16960 |
punct |
.,measurements |
| R4905 |
T16963 |
T16964 |
amod |
Total,output |
| R4906 |
T16964 |
T16966 |
nsubjpass |
output,measured |
| R4907 |
T16965 |
T16964 |
compound |
urine,output |
| R4908 |
T16967 |
T16966 |
auxpass |
was,measured |
| R4909 |
T16968 |
T16966 |
prep |
by,measured |
| R491 |
T2716 |
T2715 |
amod |
intracellular,vesicles |
| R4910 |
T16969 |
T16970 |
advmod |
separately,housing |
| R4911 |
T16970 |
T16968 |
pcomp |
housing,by |
| R4912 |
T16971 |
T16972 |
amod |
adult,mice |
| R4913 |
T16972 |
T16970 |
dobj |
mice,housing |
| R4914 |
T16973 |
T16970 |
prep |
in,housing |
| R4915 |
T16974 |
T16975 |
nmod |
Nalgene,Cages |
| R4916 |
T16975 |
T16973 |
pobj |
Cages,in |
| R4917 |
T16976 |
T16975 |
amod |
Metabolic,Cages |
| R4918 |
T16977 |
T16978 |
punct |
(,Minimitter |
| R4919 |
T16978 |
T16975 |
parataxis |
Minimitter,Cages |
| R492 |
T2717 |
T2712 |
punct |
;,translocates |
| R4920 |
T16979 |
T16978 |
punct |
", ",Minimitter |
| R4921 |
T16980 |
T16978 |
npadvmod |
Bend,Minimitter |
| R4922 |
T16981 |
T16978 |
punct |
", ",Minimitter |
| R4923 |
T16982 |
T16978 |
npadvmod |
Oregon,Minimitter |
| R4924 |
T16983 |
T16978 |
punct |
", ",Minimitter |
| R4925 |
T16984 |
T16985 |
compound |
United,States |
| R4926 |
T16985 |
T16978 |
npadvmod |
States,Minimitter |
| R4927 |
T16986 |
T16978 |
punct |
),Minimitter |
| R4928 |
T16987 |
T16970 |
prep |
for,housing |
| R4929 |
T16988 |
T16989 |
quantmod |
2,3 |
| R493 |
T2718 |
T2712 |
advmod |
however,translocates |
| R4930 |
T16989 |
T16991 |
nummod |
3,d |
| R4931 |
T16990 |
T16989 |
punct |
–,3 |
| R4932 |
T16991 |
T16987 |
pobj |
d,for |
| R4933 |
T16992 |
T16970 |
cc |
and,housing |
| R4934 |
T16993 |
T16970 |
conj |
collecting,housing |
| R4935 |
T16994 |
T16993 |
dobj |
urine,collecting |
| R4936 |
T16995 |
T16996 |
det |
every,period |
| R4937 |
T16996 |
T16993 |
npadvmod |
period,collecting |
| R4938 |
T16997 |
T16998 |
nummod |
24,h |
| R4939 |
T16998 |
T16996 |
compound |
h,period |
| R494 |
T2719 |
T2712 |
punct |
", ",translocates |
| R4940 |
T16999 |
T16966 |
punct |
.,measured |
| R4941 |
T17001 |
T17002 |
compound |
Urine,osmolalities |
| R4942 |
T17002 |
T17003 |
nsubjpass |
osmolalities,determined |
| R4943 |
T17004 |
T17003 |
auxpass |
were,determined |
| R4944 |
T17005 |
T17003 |
advcl |
using,determined |
| R4945 |
T17006 |
T17007 |
det |
an,Osmometer |
| R4946 |
T17007 |
T17005 |
dobj |
Osmometer,using |
| R4947 |
T17008 |
T17009 |
punct |
(,Systems |
| R4948 |
T17009 |
T17007 |
parataxis |
Systems,Osmometer |
| R4949 |
T17010 |
T17009 |
dep |
Osmette,Systems |
| R495 |
T2720 |
T2712 |
prep |
under,translocates |
| R4950 |
T17011 |
T17010 |
nummod |
5004,Osmette |
| R4951 |
T17012 |
T17009 |
punct |
;,Systems |
| R4952 |
T17013 |
T17009 |
compound |
Precision,Systems |
| R4953 |
T17014 |
T17009 |
punct |
", ",Systems |
| R4954 |
T17015 |
T17009 |
npadvmod |
Natick,Systems |
| R4955 |
T17016 |
T17009 |
punct |
", ",Systems |
| R4956 |
T17017 |
T17009 |
npadvmod |
Massachusetts,Systems |
| R4957 |
T17018 |
T17009 |
punct |
", ",Systems |
| R4958 |
T17019 |
T17020 |
compound |
United,States |
| R4959 |
T17020 |
T17009 |
npadvmod |
States,Systems |
| R496 |
T2721 |
T2720 |
pobj |
conditions,under |
| R4960 |
T17021 |
T17009 |
punct |
),Systems |
| R4961 |
T17022 |
T17003 |
punct |
.,determined |
| R4962 |
T17024 |
T17025 |
npadvmod |
Urine,concentrating |
| R4963 |
T17025 |
T17026 |
amod |
concentrating,experiments |
| R4964 |
T17026 |
T17027 |
nsubjpass |
experiments,carried |
| R4965 |
T17028 |
T17027 |
auxpass |
were,carried |
| R4966 |
T17029 |
T17027 |
prt |
out,carried |
| R4967 |
T17030 |
T17027 |
prep |
by,carried |
| R4968 |
T17031 |
T17032 |
amod |
intraperitoneal,injection |
| R4969 |
T17032 |
T17030 |
pobj |
injection,by |
| R497 |
T2722 |
T2721 |
acl |
requiring,conditions |
| R4970 |
T17033 |
T17032 |
prep |
of,injection |
| R4971 |
T17034 |
T17033 |
pobj |
dDAVP,of |
| R4972 |
T17035 |
T17036 |
punct |
(,μg |
| R4973 |
T17036 |
T17034 |
parataxis |
μg,dDAVP |
| R4974 |
T17037 |
T17036 |
nummod |
0.4,μg |
| R4975 |
T17038 |
T17039 |
punct |
/,kg |
| R4976 |
T17039 |
T17036 |
prep |
kg,μg |
| R4977 |
T17040 |
T17036 |
punct |
),μg |
| R4978 |
T17041 |
T17027 |
punct |
.,carried |
| R4979 |
T17043 |
T17044 |
nsubjpass |
Mice,injected |
| R498 |
T2723 |
T2724 |
compound |
water,retention |
| R4980 |
T17045 |
T17044 |
auxpass |
were,injected |
| R4981 |
T17046 |
T17044 |
advmod |
twice,injected |
| R4982 |
T17047 |
T17044 |
prep |
with,injected |
| R4983 |
T17048 |
T17047 |
pobj |
dDAVP,with |
| R4984 |
T17049 |
T17044 |
punct |
", ",injected |
| R4985 |
T17050 |
T17051 |
advmod |
once,at |
| R4986 |
T17051 |
T17044 |
prep |
at,injected |
| R4987 |
T17052 |
T17051 |
pobj |
time,at |
| R4988 |
T17053 |
T17052 |
nummod |
0,time |
| R4989 |
T17054 |
T17051 |
cc |
and,at |
| R499 |
T2724 |
T2722 |
dobj |
retention,requiring |
| R4990 |
T17055 |
T17056 |
advmod |
again,at |
| R4991 |
T17056 |
T17051 |
conj |
at,at |
| R4992 |
T17057 |
T17058 |
nummod |
30,min |
| R4993 |
T17058 |
T17056 |
pobj |
min,at |
| R4994 |
T17059 |
T17044 |
punct |
.,injected |
| R4995 |
T17061 |
T17062 |
nsubjpass |
Urine,collected |
| R4996 |
T17063 |
T17062 |
auxpass |
was,collected |
| R4997 |
T17064 |
T17062 |
prep |
at,collected |
| R4998 |
T17065 |
T17066 |
det |
the,start |
| R4999 |
T17066 |
T17064 |
pobj |
start,at |
| R5 |
T599 |
T600 |
det |
a,Mutation |
| R50 |
T650 |
T649 |
nummod |
2,receptor |
| R500 |
T2725 |
T2712 |
nsubj |
AQP2,translocates |
| R5000 |
T17067 |
T17066 |
prep |
of,start |
| R5001 |
T17068 |
T17069 |
det |
the,experiment |
| R5002 |
T17069 |
T17067 |
pobj |
experiment,of |
| R5003 |
T17070 |
T17064 |
cc |
and,at |
| R5004 |
T17071 |
T17072 |
nummod |
30,min |
| R5005 |
T17072 |
T17073 |
npadvmod |
min,after |
| R5006 |
T17073 |
T17064 |
conj |
after,at |
| R5007 |
T17074 |
T17075 |
det |
the,injection |
| R5008 |
T17075 |
T17073 |
pobj |
injection,after |
| R5009 |
T17076 |
T17075 |
amod |
second,injection |
| R501 |
T2726 |
T2712 |
prep |
to,translocates |
| R5010 |
T17077 |
T17062 |
punct |
.,collected |
| R5011 |
T17265 |
T17266 |
compound |
Kidney,membrane |
| R5012 |
T17266 |
T17267 |
compound |
membrane,preparation |
| R5013 |
T17268 |
T17267 |
punct |
.,preparation |
| R5014 |
T17270 |
T17271 |
amod |
Whole,kidneys |
| R5015 |
T17271 |
T17273 |
nsubjpass |
kidneys,homogenized |
| R5016 |
T17272 |
T17271 |
compound |
mouse,kidneys |
| R5017 |
T17274 |
T17273 |
auxpass |
were,homogenized |
| R5018 |
T17275 |
T17273 |
prep |
in,homogenized |
| R5019 |
T17276 |
T17277 |
nummod |
10,mM |
| R502 |
T2727 |
T2728 |
det |
the,membrane |
| R5020 |
T17277 |
T17278 |
compound |
mM,Tris |
| R5021 |
T17278 |
T17275 |
pobj |
Tris,in |
| R5022 |
T17279 |
T17278 |
punct |
(,Tris |
| R5023 |
T17280 |
T17278 |
npadvmod |
pH,Tris |
| R5024 |
T17281 |
T17280 |
nummod |
7.4,pH |
| R5025 |
T17282 |
T17278 |
punct |
),Tris |
| R5026 |
T17283 |
T17278 |
punct |
", ",Tris |
| R5027 |
T17284 |
T17285 |
nummod |
350,mM |
| R5028 |
T17285 |
T17286 |
compound |
mM,sucrose |
| R5029 |
T17286 |
T17278 |
conj |
sucrose,Tris |
| R503 |
T2728 |
T2726 |
pobj |
membrane,to |
| R5030 |
T17287 |
T17286 |
punct |
", ",sucrose |
| R5031 |
T17288 |
T17286 |
cc |
and,sucrose |
| R5032 |
T17289 |
T17290 |
nummod |
5,mM |
| R5033 |
T17290 |
T17291 |
compound |
mM,EDTA |
| R5034 |
T17291 |
T17286 |
conj |
EDTA,sucrose |
| R5035 |
T17292 |
T17291 |
acl |
containing,EDTA |
| R5036 |
T17293 |
T17294 |
compound |
protease,inhibitors |
| R5037 |
T17294 |
T17292 |
dobj |
inhibitors,containing |
| R5038 |
T17295 |
T17296 |
punct |
(,P |
| R5039 |
T17296 |
T17294 |
parataxis |
P,inhibitors |
| R504 |
T2729 |
T2728 |
amod |
apical,membrane |
| R5040 |
T17297 |
T17298 |
compound |
Sigma,Aldrich |
| R5041 |
T17298 |
T17296 |
dep |
Aldrich,P |
| R5042 |
T17299 |
T17298 |
punct |
-,Aldrich |
| R5043 |
T17300 |
T17296 |
punct |
", ",P |
| R5044 |
T17301 |
T17296 |
punct |
#,P |
| R5045 |
T17302 |
T17296 |
punct |
-,P |
| R5046 |
T17303 |
T17296 |
nummod |
8340,P |
| R5047 |
T17304 |
T17296 |
punct |
),P |
| R5048 |
T17305 |
T17273 |
prep |
in,homogenized |
| R5049 |
T17306 |
T17307 |
det |
a,homogenizer |
| R505 |
T2730 |
T2712 |
punct |
", ",translocates |
| R5050 |
T17307 |
T17305 |
pobj |
homogenizer,in |
| R5051 |
T17308 |
T17309 |
compound |
Potter,Elvehjem |
| R5052 |
T17309 |
T17307 |
compound |
Elvehjem,homogenizer |
| R5053 |
T17310 |
T17309 |
punct |
-,Elvehjem |
| R5054 |
T17311 |
T17273 |
punct |
.,homogenized |
| R5055 |
T17313 |
T17314 |
det |
The,homogenate |
| R5056 |
T17314 |
T17315 |
nsubjpass |
homogenate,centrifuged |
| R5057 |
T17316 |
T17315 |
auxpass |
was,centrifuged |
| R5058 |
T17317 |
T17315 |
prep |
at,centrifuged |
| R5059 |
T17318 |
T17319 |
nummod |
"2,000",g |
| R506 |
T2731 |
T2712 |
advcl |
permitting,translocates |
| R5060 |
T17319 |
T17317 |
pobj |
g,at |
| R5061 |
T17320 |
T17315 |
prep |
for,centrifuged |
| R5062 |
T17321 |
T17322 |
nummod |
10,min |
| R5063 |
T17322 |
T17320 |
pobj |
min,for |
| R5064 |
T17323 |
T17315 |
cc |
and,centrifuged |
| R5065 |
T17324 |
T17325 |
det |
the,supernatant |
| R5066 |
T17325 |
T17326 |
nsubjpass |
supernatant,subjected |
| R5067 |
T17326 |
T17315 |
conj |
subjected,centrifuged |
| R5068 |
T17327 |
T17326 |
auxpass |
was,subjected |
| R5069 |
T17328 |
T17326 |
prep |
to,subjected |
| R507 |
T2732 |
T2733 |
compound |
water,reabsorption |
| R5070 |
T17329 |
T17328 |
pobj |
ultracentrifugation,to |
| R5071 |
T17330 |
T17329 |
prep |
at,ultracentrifugation |
| R5072 |
T17331 |
T17332 |
nummod |
"100,000",g |
| R5073 |
T17332 |
T17330 |
pobj |
g,at |
| R5074 |
T17333 |
T17326 |
prep |
for,subjected |
| R5075 |
T17334 |
T17335 |
nummod |
1,h |
| R5076 |
T17335 |
T17333 |
pobj |
h,for |
| R5077 |
T17336 |
T17326 |
prep |
at,subjected |
| R5078 |
T17337 |
T17338 |
nummod |
4,°C |
| R5079 |
T17338 |
T17336 |
pobj |
°C,at |
| R508 |
T2733 |
T2731 |
dobj |
reabsorption,permitting |
| R5080 |
T17339 |
T17326 |
punct |
.,subjected |
| R5081 |
T17341 |
T17342 |
amod |
Pelleted,membranes |
| R5082 |
T17342 |
T17343 |
nsubjpass |
membranes,resuspended |
| R5083 |
T17344 |
T17343 |
auxpass |
were,resuspended |
| R5084 |
T17345 |
T17343 |
prep |
in,resuspended |
| R5085 |
T17346 |
T17347 |
det |
the,buffer |
| R5086 |
T17347 |
T17345 |
pobj |
buffer,in |
| R5087 |
T17348 |
T17347 |
amod |
same,buffer |
| R5088 |
T17349 |
T17343 |
punct |
", ",resuspended |
| R5089 |
T17350 |
T17343 |
cc |
and,resuspended |
| R509 |
T2734 |
T2735 |
punct |
[,8 |
| R5090 |
T17351 |
T17352 |
compound |
protein,concentration |
| R5091 |
T17352 |
T17353 |
nsubjpass |
concentration,determined |
| R5092 |
T17353 |
T17343 |
conj |
determined,resuspended |
| R5093 |
T17354 |
T17353 |
auxpass |
was,determined |
| R5094 |
T17355 |
T17353 |
prep |
by,determined |
| R5095 |
T17356 |
T17357 |
compound |
Bradford,assay |
| R5096 |
T17357 |
T17355 |
pobj |
assay,by |
| R5097 |
T17358 |
T17353 |
punct |
.,determined |
| R5098 |
T17615 |
T17614 |
punct |
.,Immunoblotting |
| R5099 |
T17617 |
T17618 |
compound |
Kidney,membrane |
| R51 |
T651 |
T649 |
punct |
(,receptor |
| R510 |
T2735 |
T2712 |
parataxis |
8,translocates |
| R5100 |
T17618 |
T17619 |
compound |
membrane,fractions |
| R5101 |
T17619 |
T17620 |
nsubjpass |
fractions,resolved |
| R5102 |
T17621 |
T17622 |
punct |
(,μg |
| R5103 |
T17622 |
T17619 |
parataxis |
μg,fractions |
| R5104 |
T17623 |
T17622 |
nummod |
60,μg |
| R5105 |
T17624 |
T17622 |
punct |
),μg |
| R5106 |
T17625 |
T17620 |
auxpass |
were,resolved |
| R5107 |
T17626 |
T17620 |
prep |
on,resolved |
| R5108 |
T17627 |
T17628 |
det |
a,gel |
| R5109 |
T17628 |
T17626 |
pobj |
gel,on |
| R511 |
T2736 |
T2735 |
nummod |
7,8 |
| R5110 |
T17629 |
T17630 |
nummod |
12,% |
| R5111 |
T17630 |
T17628 |
compound |
%,gel |
| R5112 |
T17631 |
T17632 |
compound |
SDS,polyacrylamide |
| R5113 |
T17632 |
T17628 |
compound |
polyacrylamide,gel |
| R5114 |
T17633 |
T17632 |
punct |
-,polyacrylamide |
| R5115 |
T17634 |
T17620 |
cc |
and,resolved |
| R5116 |
T17635 |
T17620 |
conj |
transferred,resolved |
| R5117 |
T17636 |
T17635 |
prep |
to,transferred |
| R5118 |
T17637 |
T17638 |
det |
a,membrane |
| R5119 |
T17638 |
T17636 |
pobj |
membrane,to |
| R512 |
T2737 |
T2735 |
punct |
",",8 |
| R5120 |
T17639 |
T17638 |
compound |
nitrocellulose,membrane |
| R5121 |
T17640 |
T17620 |
punct |
.,resolved |
| R5122 |
T17642 |
T17643 |
nsubjpass |
Membranes,blocked |
| R5123 |
T17644 |
T17643 |
auxpass |
were,blocked |
| R5124 |
T17645 |
T17643 |
prep |
in,blocked |
| R5125 |
T17646 |
T17647 |
nummod |
5,% |
| R5126 |
T17647 |
T17648 |
nmod |
%,milk |
| R5127 |
T17648 |
T17645 |
pobj |
milk,in |
| R5128 |
T17649 |
T17648 |
amod |
nonfat,milk |
| R5129 |
T17650 |
T17648 |
prep |
in,milk |
| R513 |
T2738 |
T2735 |
punct |
],8 |
| R5130 |
T17651 |
T17652 |
npadvmod |
Tris,buffered |
| R5131 |
T17652 |
T17654 |
amod |
buffered,saline |
| R5132 |
T17653 |
T17652 |
punct |
-,buffered |
| R5133 |
T17654 |
T17650 |
pobj |
saline,in |
| R5134 |
T17655 |
T17654 |
prep |
with,saline |
| R5135 |
T17656 |
T17657 |
nummod |
0.05,% |
| R5136 |
T17657 |
T17658 |
compound |
%,Tween |
| R5137 |
T17658 |
T17655 |
pobj |
Tween,with |
| R5138 |
T17659 |
T17658 |
nummod |
20,Tween |
| R5139 |
T17660 |
T17661 |
punct |
(,TBST |
| R514 |
T2739 |
T2712 |
punct |
.,translocates |
| R5140 |
T17661 |
T17658 |
parataxis |
TBST,Tween |
| R5141 |
T17662 |
T17661 |
punct |
),TBST |
| R5142 |
T17663 |
T17643 |
punct |
", ",blocked |
| R5143 |
T17664 |
T17643 |
advcl |
followed,blocked |
| R5144 |
T17665 |
T17664 |
agent |
by,followed |
| R5145 |
T17666 |
T17667 |
det |
an,incubation |
| R5146 |
T17667 |
T17665 |
pobj |
incubation,by |
| R5147 |
T17668 |
T17667 |
amod |
overnight,incubation |
| R5148 |
T17669 |
T17667 |
punct |
(,incubation |
| R5149 |
T17670 |
T17667 |
prep |
at,incubation |
| R515 |
T2741 |
T2742 |
mark |
For,occur |
| R5150 |
T17671 |
T17672 |
nummod |
4,°C |
| R5151 |
T17672 |
T17670 |
pobj |
°C,at |
| R5152 |
T17673 |
T17667 |
punct |
),incubation |
| R5153 |
T17674 |
T17667 |
prep |
with,incubation |
| R5154 |
T17675 |
T17676 |
nmod |
AQP2,antibody |
| R5155 |
T17676 |
T17674 |
pobj |
antibody,with |
| R5156 |
T17677 |
T17676 |
amod |
polyclonal,antibody |
| R5157 |
T17678 |
T17679 |
punct |
(,sc |
| R5158 |
T17679 |
T17676 |
parataxis |
sc,antibody |
| R5159 |
T17680 |
T17681 |
compound |
Santa,Cruz |
| R516 |
T2742 |
T2746 |
advcl |
occur,binds |
| R5160 |
T17681 |
T17682 |
compound |
Cruz,Biotechnology |
| R5161 |
T17682 |
T17679 |
dep |
Biotechnology,sc |
| R5162 |
T17683 |
T17682 |
punct |
", ",Biotechnology |
| R5163 |
T17684 |
T17685 |
compound |
Santa,Cruz |
| R5164 |
T17685 |
T17682 |
npadvmod |
Cruz,Biotechnology |
| R5165 |
T17686 |
T17682 |
punct |
", ",Biotechnology |
| R5166 |
T17687 |
T17682 |
npadvmod |
California,Biotechnology |
| R5167 |
T17688 |
T17682 |
punct |
", ",Biotechnology |
| R5168 |
T17689 |
T17690 |
compound |
United,States |
| R5169 |
T17690 |
T17682 |
npadvmod |
States,Biotechnology |
| R517 |
T2743 |
T2744 |
det |
this,process |
| R5170 |
T17691 |
T17679 |
punct |
;,sc |
| R5171 |
T17692 |
T17679 |
punct |
#,sc |
| R5172 |
T17693 |
T17679 |
punct |
-,sc |
| R5173 |
T17694 |
T17679 |
nummod |
9882,sc |
| R5174 |
T17695 |
T17679 |
punct |
),sc |
| R5175 |
T17696 |
T17643 |
punct |
.,blocked |
| R5176 |
T17698 |
T17699 |
nsubjpass |
Membranes,washed |
| R5177 |
T17700 |
T17699 |
auxpass |
were,washed |
| R5178 |
T17701 |
T17699 |
prep |
in,washed |
| R5179 |
T17702 |
T17701 |
pobj |
TBST,in |
| R518 |
T2744 |
T2742 |
nsubj |
process,occur |
| R5180 |
T17703 |
T17704 |
advmod |
then,incubated |
| R5181 |
T17704 |
T17699 |
dep |
incubated,washed |
| R5182 |
T17705 |
T17704 |
prep |
with,incubated |
| R5183 |
T17706 |
T17707 |
npadvmod |
HRP,conjugated |
| R5184 |
T17707 |
T17709 |
amod |
conjugated,antibody |
| R5185 |
T17708 |
T17707 |
punct |
-,conjugated |
| R5186 |
T17709 |
T17705 |
pobj |
antibody,with |
| R5187 |
T17710 |
T17709 |
nmod |
donkey,antibody |
| R5188 |
T17711 |
T17709 |
amod |
anti-goat,antibody |
| R5189 |
T17712 |
T17699 |
punct |
.,washed |
| R519 |
T2745 |
T2742 |
aux |
to,occur |
| R5190 |
T17714 |
T17715 |
nsubjpass |
Membranes,washed |
| R5191 |
T17716 |
T17715 |
auxpass |
were,washed |
| R5192 |
T17717 |
T17715 |
advmod |
further,washed |
| R5193 |
T17718 |
T17715 |
prep |
in,washed |
| R5194 |
T17719 |
T17718 |
pobj |
TBST,in |
| R5195 |
T17720 |
T17715 |
cc |
and,washed |
| R5196 |
T17721 |
T17722 |
nsubjpass |
bands,visualized |
| R5197 |
T17722 |
T17715 |
conj |
visualized,washed |
| R5198 |
T17723 |
T17722 |
auxpass |
were,visualized |
| R5199 |
T17724 |
T17722 |
advcl |
using,visualized |
| R52 |
T652 |
T649 |
appos |
Avpr2,receptor |
| R520 |
T2747 |
T2746 |
punct |
", ",binds |
| R5200 |
T17725 |
T17726 |
compound |
ECL,reagent |
| R5201 |
T17726 |
T17724 |
dobj |
reagent,using |
| R5202 |
T17727 |
T17728 |
punct |
(,Biosciences |
| R5203 |
T17728 |
T17726 |
parataxis |
Biosciences,reagent |
| R5204 |
T17729 |
T17728 |
compound |
Amersham,Biosciences |
| R5205 |
T17730 |
T17728 |
punct |
", ",Biosciences |
| R5206 |
T17731 |
T17732 |
compound |
Little,Chalfont |
| R5207 |
T17732 |
T17728 |
npadvmod |
Chalfont,Biosciences |
| R5208 |
T17733 |
T17728 |
punct |
", ",Biosciences |
| R5209 |
T17734 |
T17735 |
compound |
United,Kingdom |
| R521 |
T2748 |
T2746 |
nsubj |
AVP,binds |
| R5210 |
T17735 |
T17728 |
npadvmod |
Kingdom,Biosciences |
| R5211 |
T17736 |
T17728 |
punct |
),Biosciences |
| R5212 |
T17737 |
T17722 |
punct |
.,visualized |
| R5213 |
T17905 |
T17906 |
compound |
Endoglycosidase,digestion |
| R5214 |
T17907 |
T17906 |
punct |
.,digestion |
| R5215 |
T17909 |
T17910 |
compound |
Kidney,membranes |
| R5216 |
T17910 |
T17911 |
nsubjpass |
membranes,incubated |
| R5217 |
T17912 |
T17913 |
punct |
(,μg |
| R5218 |
T17913 |
T17910 |
parataxis |
μg,membranes |
| R5219 |
T17914 |
T17913 |
nummod |
60,μg |
| R522 |
T2749 |
T2750 |
poss |
its,receptor |
| R5220 |
T17915 |
T17913 |
punct |
),μg |
| R5221 |
T17916 |
T17911 |
auxpass |
were,incubated |
| R5222 |
T17917 |
T17911 |
prep |
in,incubated |
| R5223 |
T17918 |
T17919 |
nummod |
50,mM |
| R5224 |
T17919 |
T17920 |
compound |
mM,phosphate |
| R5225 |
T17920 |
T17917 |
pobj |
phosphate,in |
| R5226 |
T17921 |
T17920 |
compound |
sodium,phosphate |
| R5227 |
T17922 |
T17920 |
punct |
(,phosphate |
| R5228 |
T17923 |
T17920 |
npadvmod |
pH,phosphate |
| R5229 |
T17924 |
T17923 |
nummod |
5.5,pH |
| R523 |
T2750 |
T2746 |
dobj |
receptor,binds |
| R5230 |
T17925 |
T17920 |
punct |
),phosphate |
| R5231 |
T17926 |
T17920 |
punct |
", ",phosphate |
| R5232 |
T17927 |
T17928 |
nummod |
0.1,% |
| R5233 |
T17928 |
T17929 |
compound |
%,SDS |
| R5234 |
T17929 |
T17920 |
appos |
SDS,phosphate |
| R5235 |
T17930 |
T17929 |
punct |
", ",SDS |
| R5236 |
T17931 |
T17929 |
cc |
and,SDS |
| R5237 |
T17932 |
T17933 |
nummod |
50,mM |
| R5238 |
T17933 |
T17934 |
compound |
mM,mercaptoethanol |
| R5239 |
T17934 |
T17929 |
conj |
mercaptoethanol,SDS |
| R524 |
T2751 |
T2750 |
punct |
", ",receptor |
| R5240 |
T17935 |
T17934 |
compound |
β,mercaptoethanol |
| R5241 |
T17936 |
T17934 |
punct |
-,mercaptoethanol |
| R5242 |
T17937 |
T17911 |
punct |
", ",incubated |
| R5243 |
T17938 |
T17911 |
dep |
heated,incubated |
| R5244 |
T17939 |
T17938 |
prep |
to,heated |
| R5245 |
T17940 |
T17941 |
nummod |
100,°C |
| R5246 |
T17941 |
T17939 |
pobj |
°C,to |
| R5247 |
T17942 |
T17938 |
prep |
for,heated |
| R5248 |
T17943 |
T17944 |
nummod |
5,min |
| R5249 |
T17944 |
T17942 |
pobj |
min,for |
| R525 |
T2752 |
T2750 |
appos |
AVPR2,receptor |
| R5250 |
T17945 |
T17911 |
punct |
", ",incubated |
| R5251 |
T17946 |
T17947 |
advmod |
then,cooled |
| R5252 |
T17947 |
T17911 |
dep |
cooled,incubated |
| R5253 |
T17948 |
T17911 |
punct |
.,incubated |
| R5254 |
T17950 |
T17951 |
compound |
Endoglycosidase,H |
| R5255 |
T17951 |
T17952 |
nsubjpass |
H,added |
| R5256 |
T17953 |
T17954 |
punct |
(,Aldrich |
| R5257 |
T17954 |
T17951 |
parataxis |
Aldrich,H |
| R5258 |
T17955 |
T17956 |
nummod |
0.01,units |
| R5259 |
T17956 |
T17954 |
dep |
units,Aldrich |
| R526 |
T2753 |
T2746 |
punct |
", ",binds |
| R5260 |
T17957 |
T17954 |
punct |
;,Aldrich |
| R5261 |
T17958 |
T17954 |
compound |
Sigma,Aldrich |
| R5262 |
T17959 |
T17954 |
punct |
-,Aldrich |
| R5263 |
T17960 |
T17954 |
punct |
),Aldrich |
| R5264 |
T17961 |
T17952 |
auxpass |
was,added |
| R5265 |
T17962 |
T17952 |
cc |
and,added |
| R5266 |
T17963 |
T17952 |
conj |
incubated,added |
| R5267 |
T17964 |
T17963 |
prep |
at,incubated |
| R5268 |
T17965 |
T17966 |
nummod |
37,°C |
| R5269 |
T17966 |
T17964 |
pobj |
°C,at |
| R527 |
T2754 |
T2746 |
prep |
on,binds |
| R5270 |
T17967 |
T17963 |
prep |
for,incubated |
| R5271 |
T17968 |
T17969 |
nummod |
2,h |
| R5272 |
T17969 |
T17967 |
pobj |
h,for |
| R5273 |
T17970 |
T17952 |
punct |
.,added |
| R5274 |
T17972 |
T17973 |
det |
The,reaction |
| R5275 |
T17973 |
T17974 |
nsubjpass |
reaction,stopped |
| R5276 |
T17975 |
T17974 |
auxpass |
was,stopped |
| R5277 |
T17976 |
T17974 |
prep |
by,stopped |
| R5278 |
T17977 |
T17976 |
pcomp |
boiling,by |
| R5279 |
T17978 |
T17979 |
det |
the,samples |
| R528 |
T2755 |
T2756 |
det |
the,face |
| R5280 |
T17979 |
T17977 |
dobj |
samples,boiling |
| R5281 |
T17980 |
T17977 |
prep |
in,boiling |
| R5282 |
T17981 |
T17982 |
compound |
Laemmli,buffer |
| R5283 |
T17982 |
T17980 |
pobj |
buffer,in |
| R5284 |
T17983 |
T17974 |
punct |
.,stopped |
| R5285 |
T17985 |
T17986 |
amod |
Total,reactants |
| R5286 |
T17986 |
T17987 |
nsubjpass |
reactants,immunoblotted |
| R5287 |
T17988 |
T17987 |
auxpass |
were,immunoblotted |
| R5288 |
T17989 |
T17990 |
mark |
as,described |
| R5289 |
T17990 |
T17987 |
advcl |
described,immunoblotted |
| R529 |
T2756 |
T2754 |
pobj |
face,on |
| R5290 |
T17991 |
T17990 |
advmod |
above,described |
| R5291 |
T17992 |
T17987 |
punct |
.,immunoblotted |
| R5292 |
T18784 |
T18783 |
cc |
and,Coimmunoprecipitation |
| R5293 |
T18785 |
T18783 |
conj |
biotinylation,Coimmunoprecipitation |
| R5294 |
T18786 |
T18783 |
prep |
in,Coimmunoprecipitation |
| R5295 |
T18787 |
T18788 |
compound |
MDCK,cells |
| R5296 |
T18788 |
T18786 |
pobj |
cells,in |
| R5297 |
T18789 |
T18783 |
punct |
.,Coimmunoprecipitation |
| R5298 |
T18791 |
T18792 |
compound |
MDCK,cells |
| R5299 |
T18792 |
T18793 |
nsubjpass |
cells,transfected |
| R53 |
T653 |
T647 |
punct |
),gene |
| R530 |
T2757 |
T2756 |
amod |
basolateral,face |
| R5300 |
T18794 |
T18795 |
advmod |
stably,expressing |
| R5301 |
T18795 |
T18792 |
acl |
expressing,cells |
| R5302 |
T18796 |
T18797 |
amod |
wild,type |
| R5303 |
T18797 |
T18799 |
compound |
type,AQP2 |
| R5304 |
T18798 |
T18797 |
punct |
-,type |
| R5305 |
T18799 |
T18795 |
dobj |
AQP2,expressing |
| R5306 |
T18800 |
T18799 |
punct |
(,AQP2 |
| R5307 |
T18801 |
T18799 |
acl |
grown,AQP2 |
| R5308 |
T18802 |
T18801 |
prep |
on,grown |
| R5309 |
T18803 |
T18804 |
nummod |
10,cm |
| R531 |
T2758 |
T2756 |
prep |
of,face |
| R5310 |
T18804 |
T18806 |
compound |
cm,plates |
| R5311 |
T18805 |
T18804 |
punct |
-,cm |
| R5312 |
T18806 |
T18802 |
pobj |
plates,on |
| R5313 |
T18807 |
T18795 |
punct |
),expressing |
| R5314 |
T18808 |
T18793 |
auxpass |
were,transfected |
| R5315 |
T18809 |
T18793 |
prep |
with,transfected |
| R5316 |
T18810 |
T18811 |
nmod |
pEGFP,type |
| R5317 |
T18811 |
T18815 |
compound |
type,AQP2 |
| R5318 |
T18812 |
T18811 |
punct |
-,type |
| R5319 |
T18813 |
T18811 |
amod |
wild,type |
| R532 |
T2759 |
T2760 |
det |
the,cells |
| R5320 |
T18814 |
T18811 |
punct |
-,type |
| R5321 |
T18815 |
T18809 |
pobj |
AQP2,with |
| R5322 |
T18816 |
T18815 |
punct |
", ",AQP2 |
| R5323 |
T18817 |
T18818 |
compound |
pEGFP,F204V |
| R5324 |
T18818 |
T18815 |
conj |
F204V,AQP2 |
| R5325 |
T18819 |
T18818 |
punct |
-,F204V |
| R5326 |
T18820 |
T18818 |
compound |
AQP2,F204V |
| R5327 |
T18821 |
T18818 |
punct |
-,F204V |
| R5328 |
T18822 |
T18818 |
punct |
", ",F204V |
| R5329 |
T18823 |
T18818 |
cc |
or,F204V |
| R533 |
T2760 |
T2758 |
pobj |
cells,of |
| R5330 |
T18824 |
T18818 |
conj |
vector,F204V |
| R5331 |
T18825 |
T18824 |
advmod |
alone,vector |
| R5332 |
T18826 |
T18793 |
punct |
.,transfected |
| R5333 |
T18828 |
T18829 |
det |
The,cells |
| R5334 |
T18829 |
T18830 |
nsubjpass |
cells,homogenized |
| R5335 |
T18831 |
T18830 |
auxpass |
were,homogenized |
| R5336 |
T18832 |
T18830 |
prep |
in,homogenized |
| R5337 |
T18833 |
T18834 |
nummod |
10,mM |
| R5338 |
T18834 |
T18835 |
compound |
mM,Tris |
| R5339 |
T18835 |
T18832 |
pobj |
Tris,in |
| R534 |
T2761 |
T2762 |
amod |
collecting,duct |
| R5340 |
T18836 |
T18835 |
punct |
(,Tris |
| R5341 |
T18837 |
T18835 |
npadvmod |
pH,Tris |
| R5342 |
T18838 |
T18837 |
nummod |
7.4,pH |
| R5343 |
T18839 |
T18835 |
punct |
),Tris |
| R5344 |
T18840 |
T18835 |
punct |
", ",Tris |
| R5345 |
T18841 |
T18842 |
nummod |
1,mM |
| R5346 |
T18842 |
T18843 |
compound |
mM,EDTA |
| R5347 |
T18843 |
T18835 |
conj |
EDTA,Tris |
| R5348 |
T18844 |
T18843 |
punct |
", ",EDTA |
| R5349 |
T18845 |
T18843 |
cc |
and,EDTA |
| R535 |
T2762 |
T2760 |
compound |
duct,cells |
| R5350 |
T18846 |
T18847 |
nummod |
250,mM |
| R5351 |
T18847 |
T18848 |
compound |
mM,sucrose |
| R5352 |
T18848 |
T18843 |
conj |
sucrose,EDTA |
| R5353 |
T18849 |
T18850 |
nummod |
40,h |
| R5354 |
T18850 |
T18851 |
npadvmod |
h,later |
| R5355 |
T18851 |
T18830 |
advmod |
later,homogenized |
| R5356 |
T18852 |
T18830 |
punct |
.,homogenized |
| R5357 |
T18854 |
T18855 |
det |
The,supernatant |
| R5358 |
T18855 |
T18857 |
nsubjpass |
supernatant,centrifuged |
| R5359 |
T18856 |
T18855 |
amod |
clarified,supernatant |
| R536 |
T2763 |
T2746 |
punct |
", ",binds |
| R5360 |
T18858 |
T18857 |
auxpass |
was,centrifuged |
| R5361 |
T18859 |
T18857 |
prep |
at,centrifuged |
| R5362 |
T18860 |
T18861 |
nummod |
"200,000",g |
| R5363 |
T18861 |
T18859 |
pobj |
g,at |
| R5364 |
T18862 |
T18857 |
prep |
for,centrifuged |
| R5365 |
T18863 |
T18864 |
nummod |
30,min |
| R5366 |
T18864 |
T18862 |
pobj |
min,for |
| R5367 |
T18865 |
T18857 |
punct |
.,centrifuged |
| R5368 |
T18867 |
T18868 |
amod |
Pelleted,membranes |
| R5369 |
T18868 |
T18869 |
nsubjpass |
membranes,incubated |
| R537 |
T2764 |
T2746 |
advcl |
leading,binds |
| R5370 |
T18870 |
T18869 |
auxpass |
were,incubated |
| R5371 |
T18871 |
T18869 |
aux |
resuspended,incubated |
| R5372 |
T18872 |
T18869 |
prep |
in,incubated |
| R5373 |
T18873 |
T18874 |
det |
the,buffer |
| R5374 |
T18874 |
T18872 |
pobj |
buffer,in |
| R5375 |
T18875 |
T18874 |
amod |
same,buffer |
| R5376 |
T18876 |
T18874 |
prep |
but,buffer |
| R5377 |
T18877 |
T18876 |
pcomp |
containing,but |
| R5378 |
T18878 |
T18879 |
nummod |
4,% |
| R5379 |
T18879 |
T18880 |
compound |
%,deoxycholate |
| R538 |
T2765 |
T2764 |
prep |
to,leading |
| R5380 |
T18880 |
T18877 |
dobj |
deoxycholate,containing |
| R5381 |
T18881 |
T18880 |
compound |
sodium,deoxycholate |
| R5382 |
T18882 |
T18869 |
cc |
and,incubated |
| R5383 |
T18883 |
T18869 |
prep |
at,incubated |
| R5384 |
T18884 |
T18885 |
nummod |
37,°C |
| R5385 |
T18885 |
T18883 |
pobj |
°C,at |
| R5386 |
T18886 |
T18869 |
prep |
for,incubated |
| R5387 |
T18887 |
T18888 |
nummod |
1,h |
| R5388 |
T18888 |
T18886 |
pobj |
h,for |
| R5389 |
T18889 |
T18869 |
punct |
.,incubated |
| R539 |
T2766 |
T2767 |
det |
a,rise |
| R5390 |
T18891 |
T18892 |
prep |
From,removed |
| R5391 |
T18893 |
T18894 |
det |
the,membranes |
| R5392 |
T18894 |
T18891 |
pobj |
membranes,From |
| R5393 |
T18895 |
T18894 |
amod |
dissolved,membranes |
| R5394 |
T18896 |
T18892 |
punct |
", ",removed |
| R5395 |
T18897 |
T18898 |
det |
a,sample |
| R5396 |
T18898 |
T18892 |
nsubjpass |
sample,removed |
| R5397 |
T18899 |
T18900 |
nummod |
30,μl |
| R5398 |
T18900 |
T18898 |
compound |
μl,sample |
| R5399 |
T18901 |
T18892 |
auxpass |
was,removed |
| R54 |
T654 |
T647 |
cc |
or,gene |
| R540 |
T2767 |
T2765 |
pobj |
rise,to |
| R5400 |
T18902 |
T18892 |
cc |
and,removed |
| R5401 |
T18903 |
T18892 |
conj |
used,removed |
| R5402 |
T18904 |
T18903 |
prep |
as,used |
| R5403 |
T18905 |
T18906 |
det |
the,fraction |
| R5404 |
T18906 |
T18904 |
pobj |
fraction,as |
| R5405 |
T18907 |
T18906 |
amod |
total,fraction |
| R5406 |
T18908 |
T18906 |
compound |
membrane,fraction |
| R5407 |
T18909 |
T18892 |
punct |
.,removed |
| R5408 |
T18911 |
T18912 |
det |
The,membranes |
| R5409 |
T18912 |
T18914 |
nsubjpass |
membranes,diluted |
| R541 |
T2768 |
T2767 |
prep |
in,rise |
| R5410 |
T18913 |
T18912 |
amod |
remaining,membranes |
| R5411 |
T18915 |
T18914 |
auxpass |
were,diluted |
| R5412 |
T18916 |
T18914 |
prep |
with,diluted |
| R5413 |
T18917 |
T18918 |
nummod |
600,μl |
| R5414 |
T18918 |
T18916 |
pobj |
μl,with |
| R5415 |
T18919 |
T18918 |
prep |
of,μl |
| R5416 |
T18920 |
T18921 |
det |
the,buffer |
| R5417 |
T18921 |
T18919 |
pobj |
buffer,of |
| R5418 |
T18922 |
T18921 |
compound |
homogenization,buffer |
| R5419 |
T18923 |
T18914 |
punct |
", ",diluted |
| R542 |
T2769 |
T2770 |
amod |
intracellular,cAMP |
| R5420 |
T18924 |
T18914 |
cc |
and,diluted |
| R5421 |
T18925 |
T18914 |
conj |
incubated,diluted |
| R5422 |
T18926 |
T18925 |
prep |
with,incubated |
| R5423 |
T18927 |
T18928 |
nummod |
1,μl |
| R5424 |
T18928 |
T18926 |
pobj |
μl,with |
| R5425 |
T18929 |
T18928 |
prep |
of,μl |
| R5426 |
T18930 |
T18931 |
compound |
GFP,antisera |
| R5427 |
T18931 |
T18929 |
pobj |
antisera,of |
| R5428 |
T18932 |
T18933 |
punct |
(,0092 |
| R5429 |
T18933 |
T18931 |
parataxis |
0092,antisera |
| R543 |
T2770 |
T2768 |
pobj |
cAMP,in |
| R5430 |
T18934 |
T18933 |
dep |
Invitrogen,0092 |
| R5431 |
T18935 |
T18933 |
punct |
", ",0092 |
| R5432 |
T18936 |
T18933 |
punct |
#,0092 |
| R5433 |
T18937 |
T18933 |
nummod |
46,0092 |
| R5434 |
T18938 |
T18933 |
punct |
–,0092 |
| R5435 |
T18939 |
T18933 |
punct |
),0092 |
| R5436 |
T18940 |
T18931 |
cc |
and,antisera |
| R5437 |
T18941 |
T18942 |
compound |
protein,sepharose |
| R5438 |
T18942 |
T18931 |
conj |
sepharose,antisera |
| R5439 |
T18943 |
T18944 |
compound |
A,G |
| R544 |
T2771 |
T2764 |
punct |
", ",leading |
| R5440 |
T18944 |
T18942 |
compound |
G,sepharose |
| R5441 |
T18945 |
T18944 |
punct |
/,G |
| R5442 |
T18946 |
T18914 |
punct |
.,diluted |
| R5443 |
T18948 |
T18949 |
prep |
Following,washed |
| R5444 |
T18950 |
T18951 |
amod |
overnight,incubation |
| R5445 |
T18951 |
T18948 |
pobj |
incubation,Following |
| R5446 |
T18952 |
T18949 |
punct |
", ",washed |
| R5447 |
T18953 |
T18954 |
det |
the,proteins |
| R5448 |
T18954 |
T18949 |
nsubjpass |
proteins,washed |
| R5449 |
T18955 |
T18954 |
amod |
precipitated,proteins |
| R545 |
T2772 |
T2773 |
advmod |
ultimately,resulting |
| R5450 |
T18956 |
T18949 |
auxpass |
were,washed |
| R5451 |
T18957 |
T18949 |
prep |
in,washed |
| R5452 |
T18958 |
T18959 |
compound |
RIPA,buffer |
| R5453 |
T18959 |
T18957 |
pobj |
buffer,in |
| R5454 |
T18960 |
T18949 |
cc |
and,washed |
| R5455 |
T18961 |
T18962 |
advmod |
finally,boiled |
| R5456 |
T18962 |
T18949 |
conj |
boiled,washed |
| R5457 |
T18963 |
T18962 |
prep |
in,boiled |
| R5458 |
T18964 |
T18965 |
nummod |
50,μl |
| R5459 |
T18965 |
T18963 |
pobj |
μl,in |
| R546 |
T2773 |
T2764 |
advcl |
resulting,leading |
| R5460 |
T18966 |
T18965 |
prep |
of,μl |
| R5461 |
T18967 |
T18968 |
compound |
Laemmli,buffer |
| R5462 |
T18968 |
T18966 |
pobj |
buffer,of |
| R5463 |
T18969 |
T18949 |
punct |
.,washed |
| R5464 |
T18971 |
T18972 |
nsubjpass |
Half,processed |
| R5465 |
T18973 |
T18971 |
prep |
of,Half |
| R5466 |
T18974 |
T18975 |
det |
the,membrane |
| R5467 |
T18975 |
T18973 |
pobj |
membrane,of |
| R5468 |
T18976 |
T18975 |
amod |
total,membrane |
| R5469 |
T18977 |
T18975 |
cc |
and,membrane |
| R547 |
T2774 |
T2773 |
prep |
in,resulting |
| R5470 |
T18978 |
T18979 |
det |
the,fractions |
| R5471 |
T18979 |
T18975 |
conj |
fractions,membrane |
| R5472 |
T18980 |
T18979 |
compound |
IP,fractions |
| R5473 |
T18981 |
T18972 |
auxpass |
were,processed |
| R5474 |
T18982 |
T18972 |
prep |
for,processed |
| R5475 |
T18983 |
T18982 |
pobj |
immunoblotting,for |
| R5476 |
T18984 |
T18972 |
punct |
.,processed |
| R5477 |
T18986 |
T18987 |
compound |
Cell,biotinylation |
| R5478 |
T18987 |
T18989 |
nsubjpass |
biotinylation,performed |
| R5479 |
T18988 |
T18987 |
compound |
surface,biotinylation |
| R548 |
T2775 |
T2774 |
pobj |
phosphorylation,in |
| R5480 |
T18990 |
T18989 |
auxpass |
was,performed |
| R5481 |
T18991 |
T18989 |
prep |
in,performed |
| R5482 |
T18992 |
T18993 |
det |
a,manner |
| R5483 |
T18993 |
T18991 |
pobj |
manner,in |
| R5484 |
T18994 |
T18993 |
amod |
similar,manner |
| R5485 |
T18995 |
T18989 |
punct |
.,performed |
| R5486 |
T18997 |
T18998 |
advmod |
However,transfected |
| R5487 |
T18999 |
T18998 |
punct |
", ",transfected |
| R5488 |
T19000 |
T19001 |
compound |
pEGFP,F204V |
| R5489 |
T19001 |
T18998 |
nsubjpass |
F204V,transfected |
| R549 |
T2776 |
T2775 |
prep |
of,phosphorylation |
| R5490 |
T19002 |
T19001 |
punct |
-,F204V |
| R5491 |
T19003 |
T19001 |
compound |
AQP2,F204V |
| R5492 |
T19004 |
T19001 |
punct |
-,F204V |
| R5493 |
T19005 |
T18998 |
punct |
", ",transfected |
| R5494 |
T19006 |
T18998 |
auxpass |
was,transfected |
| R5495 |
T19007 |
T18998 |
prep |
into,transfected |
| R5496 |
T19008 |
T19009 |
compound |
MDCK,cells |
| R5497 |
T19009 |
T19007 |
pobj |
cells,into |
| R5498 |
T19010 |
T19011 |
advmod |
stably,expressing |
| R5499 |
T19011 |
T19009 |
acl |
expressing,cells |
| R55 |
T655 |
T656 |
det |
the,gene |
| R550 |
T2777 |
T2776 |
pobj |
AQP2,of |
| R5500 |
T19012 |
T19013 |
amod |
wild,type |
| R5501 |
T19013 |
T19015 |
compound |
type,AQP2 |
| R5502 |
T19014 |
T19013 |
punct |
-,type |
| R5503 |
T19015 |
T19011 |
dobj |
AQP2,expressing |
| R5504 |
T19016 |
T19009 |
cc |
and,cells |
| R5505 |
T19017 |
T19009 |
conj |
cells,cells |
| R5506 |
T19018 |
T19017 |
acl |
made,cells |
| R5507 |
T19019 |
T19018 |
oprd |
stable,made |
| R5508 |
T19020 |
T19018 |
prep |
with,made |
| R5509 |
T19021 |
T19020 |
pobj |
vector,with |
| R551 |
T2778 |
T2775 |
prep |
at,phosphorylation |
| R5510 |
T19022 |
T19021 |
advmod |
alone,vector |
| R5511 |
T19023 |
T18998 |
punct |
.,transfected |
| R5512 |
T19025 |
T19026 |
compound |
Twenty,four |
| R5513 |
T19026 |
T19028 |
nummod |
four,hours |
| R5514 |
T19027 |
T19026 |
punct |
-,four |
| R5515 |
T19028 |
T19029 |
npadvmod |
hours,post-transfection |
| R5516 |
T19029 |
T19030 |
advmod |
post-transfection,stimulated |
| R5517 |
T19031 |
T19030 |
punct |
", ",stimulated |
| R5518 |
T19032 |
T19030 |
nsubjpass |
cells,stimulated |
| R5519 |
T19033 |
T19030 |
auxpass |
were,stimulated |
| R552 |
T2779 |
T2778 |
pobj |
serine,at |
| R5520 |
T19034 |
T19030 |
prep |
with,stimulated |
| R5521 |
T19035 |
T19034 |
pobj |
forskolin,with |
| R5522 |
T19036 |
T19030 |
punct |
", ",stimulated |
| R5523 |
T19037 |
T19030 |
conj |
trypsinized,stimulated |
| R5524 |
T19038 |
T19037 |
punct |
", ",trypsinized |
| R5525 |
T19039 |
T19037 |
conj |
resuspended,trypsinized |
| R5526 |
T19040 |
T19039 |
prep |
in,resuspended |
| R5527 |
T19041 |
T19042 |
nummod |
1,ml |
| R5528 |
T19042 |
T19040 |
pobj |
ml,in |
| R5529 |
T19043 |
T19042 |
prep |
of,ml |
| R553 |
T2780 |
T2779 |
nummod |
256,serine |
| R5530 |
T19044 |
T19043 |
pobj |
PBS,of |
| R5531 |
T19045 |
T19046 |
punct |
(,cells |
| R5532 |
T19046 |
T19042 |
parataxis |
cells,ml |
| R5533 |
T19047 |
T19048 |
quantmod |
2.5,106 |
| R5534 |
T19048 |
T19046 |
nummod |
106,cells |
| R5535 |
T19049 |
T19048 |
punct |
×,106 |
| R5536 |
T19050 |
T19051 |
punct |
/,ml |
| R5537 |
T19051 |
T19046 |
prep |
ml,cells |
| R5538 |
T19052 |
T19046 |
punct |
),cells |
| R5539 |
T19053 |
T19039 |
punct |
", ",resuspended |
| R554 |
T2781 |
T2775 |
prep |
by,phosphorylation |
| R5540 |
T19054 |
T19039 |
cc |
and,resuspended |
| R5541 |
T19055 |
T19039 |
conj |
incubated,resuspended |
| R5542 |
T19056 |
T19055 |
prep |
with,incubated |
| R5543 |
T19057 |
T19058 |
nummod |
0.5,mg |
| R5544 |
T19058 |
T19056 |
pobj |
mg,with |
| R5545 |
T19059 |
T19058 |
prep |
of,mg |
| R5546 |
T19060 |
T19061 |
compound |
NHS,biotin |
| R5547 |
T19061 |
T19059 |
pobj |
biotin,of |
| R5548 |
T19062 |
T19061 |
punct |
-,biotin |
| R5549 |
T19063 |
T19061 |
compound |
PEO4,biotin |
| R555 |
T2782 |
T2783 |
npadvmod |
cAMP,dependent |
| R5550 |
T19064 |
T19061 |
punct |
-,biotin |
| R5551 |
T19065 |
T19066 |
punct |
(,Biotechnology |
| R5552 |
T19066 |
T19061 |
parataxis |
Biotechnology,biotin |
| R5553 |
T19067 |
T19066 |
compound |
Pierce,Biotechnology |
| R5554 |
T19068 |
T19066 |
punct |
),Biotechnology |
| R5555 |
T19069 |
T19055 |
prep |
for,incubated |
| R5556 |
T19070 |
T19071 |
nummod |
30,min |
| R5557 |
T19071 |
T19069 |
pobj |
min,for |
| R5558 |
T19072 |
T19055 |
prep |
at,incubated |
| R5559 |
T19073 |
T19074 |
compound |
room,temperature |
| R556 |
T2783 |
T2785 |
amod |
dependent,kinase |
| R5560 |
T19074 |
T19072 |
pobj |
temperature,at |
| R5561 |
T19075 |
T19030 |
punct |
.,stimulated |
| R5562 |
T19077 |
T19078 |
nsubj |
Cells,washed |
| R5563 |
T19079 |
T19078 |
aux |
were,washed |
| R5564 |
T19080 |
T19078 |
advmod |
once,washed |
| R5565 |
T19081 |
T19078 |
prep |
in,washed |
| R5566 |
T19082 |
T19083 |
nummod |
10,mM |
| R5567 |
T19083 |
T19084 |
compound |
mM,Tris |
| R5568 |
T19084 |
T19081 |
pobj |
Tris,in |
| R5569 |
T19085 |
T19086 |
punct |
(,pH |
| R557 |
T2784 |
T2783 |
punct |
-,dependent |
| R5570 |
T19086 |
T19084 |
parataxis |
pH,Tris |
| R5571 |
T19087 |
T19086 |
nummod |
8,pH |
| R5572 |
T19088 |
T19086 |
punct |
),pH |
| R5573 |
T19089 |
T19078 |
cc |
and,washed |
| R5574 |
T19090 |
T19091 |
nummod |
three,times |
| R5575 |
T19091 |
T19092 |
npadvmod |
times,in |
| R5576 |
T19092 |
T19078 |
conj |
in,washed |
| R5577 |
T19093 |
T19092 |
pobj |
PBS,in |
| R5578 |
T19094 |
T19078 |
punct |
", ",washed |
| R5579 |
T19095 |
T19096 |
prep |
after,purified |
| R558 |
T2785 |
T2781 |
pobj |
kinase,by |
| R5580 |
T19096 |
T19078 |
advcl |
purified,washed |
| R5581 |
T19097 |
T19095 |
pobj |
which,after |
| R5582 |
T19098 |
T19096 |
nsubjpass |
membranes,purified |
| R5583 |
T19099 |
T19096 |
auxpass |
were,purified |
| R5584 |
T19100 |
T19096 |
cc |
and,purified |
| R5585 |
T19101 |
T19096 |
conj |
solubilized,purified |
| R5586 |
T19102 |
T19103 |
mark |
as,described |
| R5587 |
T19103 |
T19101 |
advcl |
described,solubilized |
| R5588 |
T19104 |
T19103 |
advmod |
above,described |
| R5589 |
T19105 |
T19078 |
punct |
.,washed |
| R559 |
T2786 |
T2785 |
compound |
protein,kinase |
| R5590 |
T19107 |
T19108 |
amod |
Solubilized,membranes |
| R5591 |
T19108 |
T19109 |
nsubjpass |
membranes,incubated |
| R5592 |
T19110 |
T19109 |
auxpass |
were,incubated |
| R5593 |
T19111 |
T19109 |
prep |
with,incubated |
| R5594 |
T19112 |
T19113 |
nummod |
20,μl |
| R5595 |
T19113 |
T19111 |
pobj |
μl,with |
| R5596 |
T19114 |
T19113 |
prep |
of,μl |
| R5597 |
T19115 |
T19116 |
amod |
immobilized,streptavidin |
| R5598 |
T19116 |
T19114 |
pobj |
streptavidin,of |
| R5599 |
T19117 |
T19118 |
punct |
(,Biotechnology |
| R56 |
T656 |
T647 |
conj |
gene,gene |
| R560 |
T2787 |
T2788 |
punct |
[,9 |
| R5600 |
T19118 |
T19116 |
parataxis |
Biotechnology,streptavidin |
| R5601 |
T19119 |
T19118 |
compound |
Pierce,Biotechnology |
| R5602 |
T19120 |
T19118 |
punct |
),Biotechnology |
| R5603 |
T19121 |
T19109 |
prep |
for,incubated |
| R5604 |
T19122 |
T19123 |
nummod |
2,h |
| R5605 |
T19123 |
T19121 |
pobj |
h,for |
| R5606 |
T19124 |
T19109 |
prep |
at,incubated |
| R5607 |
T19125 |
T19126 |
nummod |
4,°C |
| R5608 |
T19126 |
T19124 |
pobj |
°C,at |
| R5609 |
T19127 |
T19109 |
punct |
.,incubated |
| R561 |
T2788 |
T2775 |
parataxis |
9,phosphorylation |
| R5610 |
T19129 |
T19130 |
advmod |
Finally,washed |
| R5611 |
T19131 |
T19132 |
det |
the,proteins |
| R5612 |
T19132 |
T19130 |
nsubjpass |
proteins,washed |
| R5613 |
T19133 |
T19132 |
amod |
precipitated,proteins |
| R5614 |
T19134 |
T19130 |
auxpass |
were,washed |
| R5615 |
T19135 |
T19130 |
prep |
in,washed |
| R5616 |
T19136 |
T19137 |
compound |
RIPA,buffer |
| R5617 |
T19137 |
T19135 |
pobj |
buffer,in |
| R5618 |
T19138 |
T19130 |
cc |
and,washed |
| R5619 |
T19139 |
T19130 |
conj |
boiled,washed |
| R562 |
T2789 |
T2788 |
punct |
],9 |
| R5620 |
T19140 |
T19139 |
prep |
in,boiled |
| R5621 |
T19141 |
T19142 |
nummod |
50,μl |
| R5622 |
T19142 |
T19140 |
pobj |
μl,in |
| R5623 |
T19143 |
T19142 |
prep |
of,μl |
| R5624 |
T19144 |
T19145 |
compound |
Laemmli,buffer |
| R5625 |
T19145 |
T19143 |
pobj |
buffer,of |
| R5626 |
T19146 |
T19130 |
punct |
.,washed |
| R5627 |
T19148 |
T19149 |
amod |
Total,cells |
| R5628 |
T19149 |
T19150 |
nsubj |
cells,immunoblotting |
| R5629 |
T19151 |
T19149 |
cc |
and,cells |
| R563 |
T2790 |
T2775 |
cc |
and,phosphorylation |
| R5630 |
T19152 |
T19153 |
det |
the,precipitates |
| R5631 |
T19153 |
T19149 |
conj |
precipitates,cells |
| R5632 |
T19154 |
T19153 |
amod |
biotinylated,precipitates |
| R5633 |
T19155 |
T19150 |
aux |
were,immunoblotting |
| R5634 |
T19156 |
T19150 |
advcl |
using,immunoblotting |
| R5635 |
T19157 |
T19158 |
det |
an,antibody |
| R5636 |
T19158 |
T19156 |
dobj |
antibody,using |
| R5637 |
T19159 |
T19158 |
prep |
to,antibody |
| R5638 |
T19160 |
T19159 |
pobj |
AQP2,to |
| R5639 |
T19161 |
T19150 |
punct |
.,immunoblotting |
| R564 |
T2791 |
T2792 |
poss |
its,redistribution |
| R5640 |
T19603 |
T19604 |
compound |
Kidney,immunohistochemistry |
| R5641 |
T19605 |
T19604 |
punct |
.,immunohistochemistry |
| R5642 |
T19607 |
T19608 |
amod |
Whole,kidneys |
| R5643 |
T19608 |
T19610 |
nsubjpass |
kidneys,fixed |
| R5644 |
T19609 |
T19608 |
compound |
mouse,kidneys |
| R5645 |
T19611 |
T19610 |
auxpass |
were,fixed |
| R5646 |
T19612 |
T19610 |
prep |
in,fixed |
| R5647 |
T19613 |
T19614 |
nummod |
10,% |
| R5648 |
T19614 |
T19615 |
nmod |
%,formalin |
| R5649 |
T19615 |
T19612 |
pobj |
formalin,in |
| R565 |
T2792 |
T2775 |
conj |
redistribution,phosphorylation |
| R5650 |
T19616 |
T19617 |
npadvmod |
phosphate,buffered |
| R5651 |
T19617 |
T19615 |
amod |
buffered,formalin |
| R5652 |
T19618 |
T19617 |
punct |
-,buffered |
| R5653 |
T19619 |
T19610 |
prep |
for,fixed |
| R5654 |
T19620 |
T19621 |
nummod |
24,h |
| R5655 |
T19621 |
T19619 |
pobj |
h,for |
| R5656 |
T19622 |
T19610 |
punct |
.,fixed |
| R5657 |
T19624 |
T19625 |
nsubjpass |
Kidneys,embedded |
| R5658 |
T19626 |
T19625 |
auxpass |
were,embedded |
| R5659 |
T19627 |
T19625 |
prep |
in,embedded |
| R566 |
T2793 |
T2792 |
prep |
to,redistribution |
| R5660 |
T19628 |
T19627 |
pobj |
paraffin,in |
| R5661 |
T19629 |
T19625 |
punct |
", ",embedded |
| R5662 |
T19630 |
T19625 |
cc |
and,embedded |
| R5663 |
T19631 |
T19632 |
nummod |
5,μm |
| R5664 |
T19632 |
T19634 |
compound |
μm,sections |
| R5665 |
T19633 |
T19632 |
punct |
-,μm |
| R5666 |
T19634 |
T19635 |
nsubjpass |
sections,prepared |
| R5667 |
T19635 |
T19625 |
conj |
prepared,embedded |
| R5668 |
T19636 |
T19635 |
auxpass |
were,prepared |
| R5669 |
T19637 |
T19635 |
punct |
.,prepared |
| R567 |
T2794 |
T2795 |
det |
the,membrane |
| R5670 |
T19639 |
T19640 |
prep |
Following,probed |
| R5671 |
T19641 |
T19642 |
compound |
antigen,retrieval |
| R5672 |
T19642 |
T19639 |
pobj |
retrieval,Following |
| R5673 |
T19643 |
T19642 |
acl |
using,retrieval |
| R5674 |
T19644 |
T19645 |
nummod |
10,mM |
| R5675 |
T19645 |
T19646 |
compound |
mM,citrate |
| R5676 |
T19646 |
T19643 |
dobj |
citrate,using |
| R5677 |
T19647 |
T19646 |
compound |
sodium,citrate |
| R5678 |
T19648 |
T19646 |
punct |
(,citrate |
| R5679 |
T19649 |
T19646 |
npadvmod |
pH,citrate |
| R568 |
T2795 |
T2793 |
pobj |
membrane,to |
| R5680 |
T19650 |
T19649 |
nummod |
8,pH |
| R5681 |
T19651 |
T19646 |
punct |
),citrate |
| R5682 |
T19652 |
T19643 |
prep |
for,using |
| R5683 |
T19653 |
T19654 |
nummod |
10,min |
| R5684 |
T19654 |
T19652 |
pobj |
min,for |
| R5685 |
T19655 |
T19643 |
prep |
at,using |
| R5686 |
T19656 |
T19657 |
nummod |
98,°C |
| R5687 |
T19657 |
T19655 |
pobj |
°C,at |
| R5688 |
T19658 |
T19640 |
punct |
", ",probed |
| R5689 |
T19659 |
T19640 |
nsubjpass |
sections,probed |
| R569 |
T2796 |
T2795 |
compound |
plasma,membrane |
| R5690 |
T19660 |
T19640 |
auxpass |
were,probed |
| R5691 |
T19661 |
T19640 |
advmod |
sequentially,probed |
| R5692 |
T19662 |
T19640 |
punct |
", ",probed |
| R5693 |
T19663 |
T19664 |
advmod |
first,for |
| R5694 |
T19664 |
T19640 |
prep |
for,probed |
| R5695 |
T19665 |
T19664 |
pobj |
AQP3,for |
| R5696 |
T19666 |
T19664 |
cc |
and,for |
| R5697 |
T19667 |
T19668 |
advmod |
then,for |
| R5698 |
T19668 |
T19664 |
conj |
for,for |
| R5699 |
T19669 |
T19668 |
pobj |
AQP2,for |
| R57 |
T657 |
T658 |
npadvmod |
vasopressin,sensitive |
| R570 |
T2797 |
T2746 |
punct |
.,binds |
| R5700 |
T19670 |
T19640 |
punct |
.,probed |
| R5701 |
T19672 |
T19673 |
nsubjpass |
Sections,incubated |
| R5702 |
T19674 |
T19673 |
auxpass |
were,incubated |
| R5703 |
T19675 |
T19673 |
prep |
in,incubated |
| R5704 |
T19676 |
T19677 |
nummod |
5,% |
| R5705 |
T19677 |
T19678 |
compound |
%,serum |
| R5706 |
T19678 |
T19675 |
pobj |
serum,in |
| R5707 |
T19679 |
T19678 |
compound |
donkey,serum |
| R5708 |
T19680 |
T19673 |
cc |
and,incubated |
| R5709 |
T19681 |
T19682 |
advmod |
then,in |
| R571 |
T2799 |
T2800 |
det |
The,importance |
| R5710 |
T19682 |
T19673 |
conj |
in,incubated |
| R5711 |
T19683 |
T19684 |
nmod |
goat,antibody |
| R5712 |
T19684 |
T19682 |
pobj |
antibody,in |
| R5713 |
T19685 |
T19684 |
amod |
anti-AQP3,antibody |
| R5714 |
T19686 |
T19687 |
punct |
(,sc |
| R5715 |
T19687 |
T19684 |
parataxis |
sc,antibody |
| R5716 |
T19688 |
T19687 |
dep |
1,sc |
| R5717 |
T19689 |
T19690 |
punct |
:,100 |
| R5718 |
T19690 |
T19688 |
prep |
100,1 |
| R5719 |
T19691 |
T19687 |
punct |
;,sc |
| R572 |
T2800 |
T2801 |
nsubjpass |
importance,highlighted |
| R5720 |
T19692 |
T19693 |
compound |
Santa,Cruz |
| R5721 |
T19693 |
T19694 |
compound |
Cruz,Biotechnology |
| R5722 |
T19694 |
T19687 |
dep |
Biotechnology,sc |
| R5723 |
T19695 |
T19687 |
punct |
;,sc |
| R5724 |
T19696 |
T19687 |
punct |
#,sc |
| R5725 |
T19697 |
T19687 |
punct |
-,sc |
| R5726 |
T19698 |
T19687 |
nummod |
9885,sc |
| R5727 |
T19699 |
T19687 |
punct |
),sc |
| R5728 |
T19700 |
T19673 |
punct |
.,incubated |
| R5729 |
T19702 |
T19703 |
nsubjpass |
Slides,washed |
| R573 |
T2802 |
T2800 |
prep |
of,importance |
| R5730 |
T19704 |
T19703 |
auxpass |
were,washed |
| R5731 |
T19705 |
T19703 |
prep |
with,washed |
| R5732 |
T19706 |
T19705 |
pobj |
PBS,with |
| R5733 |
T19707 |
T19703 |
cc |
and,washed |
| R5734 |
T19708 |
T19703 |
conj |
incubated,washed |
| R5735 |
T19709 |
T19708 |
prep |
with,incubated |
| R5736 |
T19710 |
T19711 |
npadvmod |
AlexaFluor,conjugated |
| R5737 |
T19711 |
T19714 |
amod |
conjugated,antibody |
| R5738 |
T19712 |
T19710 |
nummod |
488,AlexaFluor |
| R5739 |
T19713 |
T19711 |
punct |
-,conjugated |
| R574 |
T2803 |
T2804 |
compound |
AQP2,redistribution |
| R5740 |
T19714 |
T19709 |
pobj |
antibody,with |
| R5741 |
T19715 |
T19714 |
nmod |
donkey,antibody |
| R5742 |
T19716 |
T19714 |
amod |
anti-goat,antibody |
| R5743 |
T19717 |
T19718 |
punct |
(,Probes |
| R5744 |
T19718 |
T19714 |
parataxis |
Probes,antibody |
| R5745 |
T19719 |
T19718 |
compound |
Molecular,Probes |
| R5746 |
T19720 |
T19718 |
punct |
", ",Probes |
| R5747 |
T19721 |
T19718 |
npadvmod |
Eugene,Probes |
| R5748 |
T19722 |
T19718 |
punct |
", ",Probes |
| R5749 |
T19723 |
T19718 |
npadvmod |
Oregon,Probes |
| R575 |
T2804 |
T2802 |
pobj |
redistribution,of |
| R5750 |
T19724 |
T19718 |
punct |
", ",Probes |
| R5751 |
T19725 |
T19726 |
compound |
United,States |
| R5752 |
T19726 |
T19718 |
npadvmod |
States,Probes |
| R5753 |
T19727 |
T19718 |
punct |
),Probes |
| R5754 |
T19728 |
T19703 |
punct |
.,washed |
| R5755 |
T19730 |
T19731 |
det |
The,slides |
| R5756 |
T19731 |
T19732 |
nsubjpass |
slides,incubated |
| R5757 |
T19733 |
T19732 |
auxpass |
were,incubated |
| R5758 |
T19734 |
T19732 |
advmod |
subsequently,incubated |
| R5759 |
T19735 |
T19732 |
aux |
blocked,incubated |
| R576 |
T2805 |
T2801 |
aux |
has,highlighted |
| R5760 |
T19736 |
T19732 |
prep |
in,incubated |
| R5761 |
T19737 |
T19738 |
nummod |
5,% |
| R5762 |
T19738 |
T19739 |
compound |
%,serum |
| R5763 |
T19739 |
T19736 |
pobj |
serum,in |
| R5764 |
T19740 |
T19739 |
compound |
chicken,serum |
| R5765 |
T19741 |
T19732 |
punct |
", ",incubated |
| R5766 |
T19742 |
T19732 |
prep |
with,incubated |
| R5767 |
T19743 |
T19744 |
det |
a,antibody |
| R5768 |
T19744 |
T19742 |
pobj |
antibody,with |
| R5769 |
T19745 |
T19744 |
nmod |
rabbit,antibody |
| R577 |
T2806 |
T2801 |
auxpass |
been,highlighted |
| R5770 |
T19746 |
T19744 |
amod |
anti-AQP2,antibody |
| R5771 |
T19747 |
T19748 |
punct |
(,A3000 |
| R5772 |
T19748 |
T19744 |
parataxis |
A3000,antibody |
| R5773 |
T19749 |
T19748 |
dep |
1,A3000 |
| R5774 |
T19750 |
T19751 |
punct |
:,250 |
| R5775 |
T19751 |
T19749 |
prep |
250,1 |
| R5776 |
T19752 |
T19748 |
punct |
;,A3000 |
| R5777 |
T19753 |
T19748 |
dep |
USB,A3000 |
| R5778 |
T19754 |
T19753 |
punct |
", ",USB |
| R5779 |
T19755 |
T19753 |
npadvmod |
Cleveland,USB |
| R578 |
T2807 |
T2801 |
agent |
by,highlighted |
| R5780 |
T19756 |
T19753 |
punct |
", ",USB |
| R5781 |
T19757 |
T19753 |
npadvmod |
Ohio,USB |
| R5782 |
T19758 |
T19753 |
punct |
", ",USB |
| R5783 |
T19759 |
T19760 |
compound |
United,States |
| R5784 |
T19760 |
T19753 |
npadvmod |
States,USB |
| R5785 |
T19761 |
T19748 |
punct |
;,A3000 |
| R5786 |
T19762 |
T19748 |
punct |
#,A3000 |
| R5787 |
T19763 |
T19748 |
punct |
–,A3000 |
| R5788 |
T19764 |
T19748 |
nummod |
06,A3000 |
| R5789 |
T19765 |
T19748 |
punct |
),A3000 |
| R579 |
T2808 |
T2809 |
amod |
functional,characterization |
| R5790 |
T19766 |
T19744 |
punct |
", ",antibody |
| R5791 |
T19767 |
T19768 |
dep |
which,detected |
| R5792 |
T19768 |
T19744 |
relcl |
detected,antibody |
| R5793 |
T19769 |
T19768 |
auxpass |
was,detected |
| R5794 |
T19770 |
T19768 |
prep |
with,detected |
| R5795 |
T19771 |
T19772 |
det |
a,antibody |
| R5796 |
T19772 |
T19770 |
pobj |
antibody,with |
| R5797 |
T19773 |
T19774 |
npadvmod |
AlexaFluor,conjugated |
| R5798 |
T19774 |
T19772 |
amod |
conjugated,antibody |
| R5799 |
T19775 |
T19773 |
nummod |
594,AlexaFluor |
| R58 |
T658 |
T656 |
amod |
sensitive,gene |
| R580 |
T2809 |
T2807 |
pobj |
characterization,by |
| R5800 |
T19776 |
T19774 |
punct |
-,conjugated |
| R5801 |
T19777 |
T19772 |
nmod |
chicken,antibody |
| R5802 |
T19778 |
T19772 |
amod |
anti-rabbit,antibody |
| R5803 |
T19779 |
T19780 |
punct |
(,Probes |
| R5804 |
T19780 |
T19772 |
parataxis |
Probes,antibody |
| R5805 |
T19781 |
T19780 |
dep |
1,Probes |
| R5806 |
T19782 |
T19783 |
punct |
:,500 |
| R5807 |
T19783 |
T19781 |
prep |
500,1 |
| R5808 |
T19784 |
T19780 |
punct |
;,Probes |
| R5809 |
T19785 |
T19780 |
compound |
Molecular,Probes |
| R581 |
T2810 |
T2809 |
prep |
of,characterization |
| R5810 |
T19786 |
T19780 |
punct |
),Probes |
| R5811 |
T19787 |
T19732 |
punct |
.,incubated |
| R5812 |
T19789 |
T19790 |
det |
The,sections |
| R5813 |
T19790 |
T19791 |
nsubjpass |
sections,stained |
| R5814 |
T19792 |
T19791 |
auxpass |
were,stained |
| R5815 |
T19793 |
T19791 |
prep |
with,stained |
| R5816 |
T19794 |
T19793 |
pobj |
DAPI,with |
| R5817 |
T19795 |
T19791 |
cc |
and,stained |
| R5818 |
T19796 |
T19791 |
conj |
mounted,stained |
| R5819 |
T19797 |
T19796 |
prep |
in,mounted |
| R582 |
T2811 |
T2812 |
compound |
Aqp2,mutations |
| R5820 |
T19798 |
T19797 |
pobj |
Vectashield,in |
| R5821 |
T19799 |
T19800 |
punct |
(,Labs |
| R5822 |
T19800 |
T19796 |
parataxis |
Labs,mounted |
| R5823 |
T19801 |
T19800 |
compound |
Vector,Labs |
| R5824 |
T19802 |
T19800 |
punct |
", ",Labs |
| R5825 |
T19803 |
T19800 |
npadvmod |
Burlingame,Labs |
| R5826 |
T19804 |
T19800 |
punct |
", ",Labs |
| R5827 |
T19805 |
T19800 |
npadvmod |
California,Labs |
| R5828 |
T19806 |
T19800 |
punct |
", ",Labs |
| R5829 |
T19807 |
T19808 |
compound |
United,States |
| R583 |
T2812 |
T2810 |
pobj |
mutations,of |
| R5830 |
T19808 |
T19800 |
npadvmod |
States,Labs |
| R5831 |
T19809 |
T19800 |
punct |
),Labs |
| R5832 |
T19810 |
T19791 |
punct |
.,stained |
| R5833 |
T20425 |
T20424 |
prep |
on,Immunocytochemistry |
| R5834 |
T20426 |
T20427 |
compound |
MDCK,cells |
| R5835 |
T20427 |
T20425 |
pobj |
cells,on |
| R5836 |
T20428 |
T20424 |
punct |
.,Immunocytochemistry |
| R5837 |
T20430 |
T20431 |
nmod |
MDCK,lines |
| R5838 |
T20431 |
T20434 |
nsubjpass |
lines,grown |
| R5839 |
T20432 |
T20431 |
amod |
stable,lines |
| R584 |
T2813 |
T2801 |
advcl |
resulting,highlighted |
| R5840 |
T20433 |
T20431 |
compound |
cell,lines |
| R5841 |
T20435 |
T20431 |
acl |
expressing,lines |
| R5842 |
T20436 |
T20435 |
dobj |
vector,expressing |
| R5843 |
T20437 |
T20436 |
amod |
alone,vector |
| R5844 |
T20438 |
T20436 |
punct |
", ",vector |
| R5845 |
T20439 |
T20440 |
amod |
wild,type |
| R5846 |
T20440 |
T20442 |
compound |
type,AQP2 |
| R5847 |
T20441 |
T20440 |
punct |
-,type |
| R5848 |
T20442 |
T20436 |
conj |
AQP2,vector |
| R5849 |
T20443 |
T20442 |
punct |
", ",AQP2 |
| R585 |
T2814 |
T2813 |
prep |
in,resulting |
| R5850 |
T20444 |
T20442 |
cc |
or,AQP2 |
| R5851 |
T20445 |
T20446 |
compound |
AQP2,F204V |
| R5852 |
T20446 |
T20442 |
conj |
F204V,AQP2 |
| R5853 |
T20447 |
T20446 |
punct |
-,F204V |
| R5854 |
T20448 |
T20435 |
punct |
(,expressing |
| R5855 |
T20449 |
T20435 |
cc |
and,expressing |
| R5856 |
T20450 |
T20451 |
prep |
in,expressing |
| R5857 |
T20451 |
T20435 |
conj |
expressing,expressing |
| R5858 |
T20452 |
T20453 |
det |
some,cases |
| R5859 |
T20453 |
T20450 |
pobj |
cases,in |
| R586 |
T2815 |
T2816 |
amod |
severe,NDI |
| R5860 |
T20454 |
T20451 |
advmod |
transiently,expressing |
| R5861 |
T20455 |
T20456 |
det |
a,construct |
| R5862 |
T20456 |
T20451 |
dobj |
construct,expressing |
| R5863 |
T20457 |
T20456 |
compound |
GFP,construct |
| R5864 |
T20458 |
T20451 |
punct |
),expressing |
| R5865 |
T20459 |
T20434 |
auxpass |
were,grown |
| R5866 |
T20460 |
T20434 |
prep |
on,grown |
| R5867 |
T20461 |
T20462 |
npadvmod |
fibronectin,coated |
| R5868 |
T20462 |
T20464 |
amod |
coated,coverslips |
| R5869 |
T20463 |
T20462 |
punct |
-,coated |
| R587 |
T2816 |
T2814 |
pobj |
NDI,in |
| R5870 |
T20464 |
T20460 |
pobj |
coverslips,on |
| R5871 |
T20465 |
T20466 |
mark |
until,formed |
| R5872 |
T20466 |
T20434 |
advcl |
formed,grown |
| R5873 |
T20467 |
T20468 |
amod |
tight,junctions |
| R5874 |
T20468 |
T20466 |
nsubj |
junctions,formed |
| R5875 |
T20469 |
T20434 |
punct |
.,grown |
| R5876 |
T20471 |
T20472 |
nsubjpass |
Cells,treated |
| R5877 |
T20473 |
T20472 |
auxpass |
were,treated |
| R5878 |
T20474 |
T20472 |
prep |
with,treated |
| R5879 |
T20475 |
T20474 |
cc |
or,with |
| R588 |
T2817 |
T2813 |
prep |
in,resulting |
| R5880 |
T20476 |
T20474 |
conj |
without,with |
| R5881 |
T20477 |
T20478 |
nummod |
150,μM |
| R5882 |
T20478 |
T20479 |
compound |
μM,forskolin |
| R5883 |
T20479 |
T20476 |
pobj |
forskolin,without |
| R5884 |
T20480 |
T20472 |
prep |
for,treated |
| R5885 |
T20481 |
T20482 |
nummod |
90,min |
| R5886 |
T20482 |
T20480 |
pobj |
min,for |
| R5887 |
T20483 |
T20472 |
punct |
", ",treated |
| R5888 |
T20484 |
T20472 |
cc |
and,treated |
| R5889 |
T20485 |
T20472 |
conj |
fixed,treated |
| R589 |
T2818 |
T2817 |
pobj |
humans,in |
| R5890 |
T20486 |
T20485 |
prep |
in,fixed |
| R5891 |
T20487 |
T20486 |
pobj |
methanol,in |
| R5892 |
T20488 |
T20485 |
prep |
at,fixed |
| R5893 |
T20489 |
T20490 |
punct |
−,20 |
| R5894 |
T20490 |
T20491 |
nummod |
20,°C |
| R5895 |
T20491 |
T20488 |
pobj |
°C,at |
| R5896 |
T20492 |
T20472 |
punct |
.,treated |
| R5897 |
T20494 |
T20495 |
advmod |
Subsequently,washed |
| R5898 |
T20496 |
T20495 |
punct |
", ",washed |
| R5899 |
T20497 |
T20495 |
nsubj |
cells,washed |
| R59 |
T659 |
T658 |
punct |
-,sensitive |
| R590 |
T2819 |
T2820 |
punct |
[,10 |
| R5900 |
T20498 |
T20495 |
aux |
were,washed |
| R5901 |
T20499 |
T20495 |
cc |
and,washed |
| R5902 |
T20500 |
T20495 |
conj |
permeabilized,washed |
| R5903 |
T20501 |
T20500 |
prep |
in,permeabilized |
| R5904 |
T20502 |
T20503 |
nummod |
0.2,% |
| R5905 |
T20503 |
T20504 |
compound |
%,X |
| R5906 |
T20504 |
T20501 |
pobj |
X,in |
| R5907 |
T20505 |
T20504 |
compound |
Triton,X |
| R5908 |
T20506 |
T20504 |
punct |
-,X |
| R5909 |
T20507 |
T20504 |
nummod |
100,X |
| R591 |
T2820 |
T2801 |
parataxis |
10,highlighted |
| R5910 |
T20508 |
T20500 |
prep |
for,permeabilized |
| R5911 |
T20509 |
T20510 |
nummod |
5,min |
| R5912 |
T20510 |
T20508 |
pobj |
min,for |
| R5913 |
T20511 |
T20495 |
punct |
", ",washed |
| R5914 |
T20512 |
T20495 |
cc |
and,washed |
| R5915 |
T20513 |
T20514 |
advmod |
sequentially,probed |
| R5916 |
T20514 |
T20495 |
conj |
probed,washed |
| R5917 |
T20515 |
T20514 |
prep |
for,probed |
| R5918 |
T20516 |
T20515 |
pobj |
AQP2,for |
| R5919 |
T20517 |
T20516 |
cc |
and,AQP2 |
| R592 |
T2821 |
T2820 |
nummod |
3,10 |
| R5920 |
T20518 |
T20519 |
compound |
organelle,markers |
| R5921 |
T20519 |
T20516 |
conj |
markers,AQP2 |
| R5922 |
T20520 |
T20519 |
prep |
for,markers |
| R5923 |
T20521 |
T20522 |
preconj |
either,PM |
| R5924 |
T20522 |
T20520 |
pobj |
PM,for |
| R5925 |
T20523 |
T20522 |
det |
the,PM |
| R5926 |
T20524 |
T20522 |
cc |
or,PM |
| R5927 |
T20525 |
T20526 |
det |
the,ER |
| R5928 |
T20526 |
T20522 |
conj |
ER,PM |
| R5929 |
T20527 |
T20495 |
punct |
.,washed |
| R593 |
T2822 |
T2820 |
punct |
",",10 |
| R5930 |
T20529 |
T20530 |
nsubjpass |
AQP2,detected |
| R5931 |
T20531 |
T20530 |
auxpass |
was,detected |
| R5932 |
T20532 |
T20530 |
advcl |
using,detected |
| R5933 |
T20533 |
T20532 |
dobj |
goat,using |
| R5934 |
T20534 |
T20533 |
amod |
anti-AQP2,goat |
| R5935 |
T20535 |
T20536 |
punct |
(,sc |
| R5936 |
T20536 |
T20533 |
parataxis |
sc,goat |
| R5937 |
T20537 |
T20536 |
dep |
1,sc |
| R5938 |
T20538 |
T20539 |
punct |
:,100 |
| R5939 |
T20539 |
T20537 |
prep |
100,1 |
| R594 |
T2823 |
T2820 |
punct |
],10 |
| R5940 |
T20540 |
T20536 |
punct |
;,sc |
| R5941 |
T20541 |
T20542 |
compound |
Santa,Cruz |
| R5942 |
T20542 |
T20543 |
compound |
Cruz,Biotechnology |
| R5943 |
T20543 |
T20536 |
dep |
Biotechnology,sc |
| R5944 |
T20544 |
T20536 |
punct |
;,sc |
| R5945 |
T20545 |
T20536 |
punct |
#,sc |
| R5946 |
T20546 |
T20536 |
punct |
-,sc |
| R5947 |
T20547 |
T20536 |
nummod |
9882,sc |
| R5948 |
T20548 |
T20536 |
punct |
),sc |
| R5949 |
T20549 |
T20533 |
cc |
and,goat |
| R595 |
T2824 |
T2801 |
punct |
.,highlighted |
| R5950 |
T20550 |
T20551 |
det |
a,dilution |
| R5951 |
T20551 |
T20533 |
conj |
dilution,goat |
| R5952 |
T20552 |
T20553 |
quantmod |
1,200 |
| R5953 |
T20553 |
T20551 |
nummod |
200,dilution |
| R5954 |
T20554 |
T20553 |
punct |
:,200 |
| R5955 |
T20555 |
T20551 |
prep |
of,dilution |
| R5956 |
T20556 |
T20557 |
npadvmod |
AlexaFluor,conjugated |
| R5957 |
T20557 |
T20560 |
amod |
conjugated,antibody |
| R5958 |
T20558 |
T20556 |
nummod |
488,AlexaFluor |
| R5959 |
T20559 |
T20557 |
punct |
-,conjugated |
| R596 |
T2826 |
T2827 |
amod |
Recessive,mutations |
| R5960 |
T20560 |
T20555 |
pobj |
antibody,of |
| R5961 |
T20561 |
T20560 |
nmod |
donkey,antibody |
| R5962 |
T20562 |
T20560 |
amod |
anti-goat,antibody |
| R5963 |
T20563 |
T20560 |
amod |
secondary,antibody |
| R5964 |
T20564 |
T20530 |
punct |
.,detected |
| R5965 |
T20566 |
T20567 |
det |
The,PM |
| R5966 |
T20567 |
T20568 |
nsubjpass |
PM,probed |
| R5967 |
T20569 |
T20567 |
cc |
and,PM |
| R5968 |
T20570 |
T20567 |
conj |
ER,PM |
| R5969 |
T20571 |
T20568 |
auxpass |
were,probed |
| R597 |
T2827 |
T2829 |
nsubjpass |
mutations,thought |
| R5970 |
T20572 |
T20568 |
advcl |
using,probed |
| R5971 |
T20573 |
T20574 |
nmod |
mouse,ATPase |
| R5972 |
T20574 |
T20579 |
nmod |
ATPase,antibodies |
| R5973 |
T20575 |
T20574 |
amod |
anti-Na+,ATPase |
| R5974 |
T20576 |
T20574 |
punct |
/,ATPase |
| R5975 |
T20577 |
T20574 |
nmod |
K+,ATPase |
| R5976 |
T20578 |
T20574 |
punct |
-,ATPase |
| R5977 |
T20579 |
T20572 |
dobj |
antibodies,using |
| R5978 |
T20580 |
T20581 |
punct |
(,Upstate |
| R5979 |
T20581 |
T20574 |
parataxis |
Upstate,ATPase |
| R598 |
T2828 |
T2827 |
compound |
Aqp2,mutations |
| R5980 |
T20582 |
T20581 |
punct |
", ",Upstate |
| R5981 |
T20583 |
T20581 |
npadvmod |
Waltham,Upstate |
| R5982 |
T20584 |
T20581 |
punct |
", ",Upstate |
| R5983 |
T20585 |
T20581 |
npadvmod |
Massachusetts,Upstate |
| R5984 |
T20586 |
T20581 |
punct |
", ",Upstate |
| R5985 |
T20587 |
T20588 |
compound |
United,States |
| R5986 |
T20588 |
T20581 |
npadvmod |
States,Upstate |
| R5987 |
T20589 |
T20581 |
punct |
),Upstate |
| R5988 |
T20590 |
T20574 |
cc |
or,ATPase |
| R5989 |
T20591 |
T20592 |
npadvmod |
rabbit,anti-calnexin |
| R599 |
T2830 |
T2829 |
auxpass |
are,thought |
| R5990 |
T20592 |
T20574 |
conj |
anti-calnexin,ATPase |
| R5991 |
T20593 |
T20594 |
punct |
(,Biotechnology |
| R5992 |
T20594 |
T20592 |
parataxis |
Biotechnology,anti-calnexin |
| R5993 |
T20595 |
T20594 |
compound |
Stressgen,Biotechnology |
| R5994 |
T20596 |
T20594 |
punct |
", ",Biotechnology |
| R5995 |
T20597 |
T20594 |
npadvmod |
Victoria,Biotechnology |
| R5996 |
T20598 |
T20594 |
punct |
", ",Biotechnology |
| R5997 |
T20599 |
T20600 |
compound |
British,Columbia |
| R5998 |
T20600 |
T20594 |
npadvmod |
Columbia,Biotechnology |
| R5999 |
T20601 |
T20594 |
punct |
", ",Biotechnology |
| R6 |
T600 |
T598 |
pobj |
Mutation,with |
| R60 |
T660 |
T661 |
nmod |
water,channel |
| R600 |
T2831 |
T2829 |
advmod |
generally,thought |
| R6000 |
T20602 |
T20594 |
npadvmod |
Canada,Biotechnology |
| R6001 |
T20603 |
T20594 |
punct |
),Biotechnology |
| R6002 |
T20604 |
T20579 |
cc |
and,antibodies |
| R6003 |
T20605 |
T20606 |
det |
the,antibodies |
| R6004 |
T20606 |
T20579 |
conj |
antibodies,antibodies |
| R6005 |
T20607 |
T20606 |
amod |
secondary,antibodies |
| R6006 |
T20608 |
T20606 |
punct |
", ",antibodies |
| R6007 |
T20609 |
T20610 |
npadvmod |
Cy3,conjugated |
| R6008 |
T20610 |
T20612 |
amod |
conjugated,goat |
| R6009 |
T20611 |
T20610 |
punct |
-,conjugated |
| R601 |
T2832 |
T2833 |
aux |
to,produce |
| R6010 |
T20612 |
T20606 |
appos |
goat,antibodies |
| R6011 |
T20613 |
T20612 |
amod |
anti-mouse,goat |
| R6012 |
T20614 |
T20615 |
punct |
(,ImmunoResearch |
| R6013 |
T20615 |
T20612 |
parataxis |
ImmunoResearch,goat |
| R6014 |
T20616 |
T20615 |
dep |
1,ImmunoResearch |
| R6015 |
T20617 |
T20618 |
punct |
:,200 |
| R6016 |
T20618 |
T20616 |
prep |
200,1 |
| R6017 |
T20619 |
T20615 |
punct |
;,ImmunoResearch |
| R6018 |
T20620 |
T20615 |
compound |
Jackson,ImmunoResearch |
| R6019 |
T20621 |
T20615 |
punct |
", ",ImmunoResearch |
| R602 |
T2833 |
T2829 |
xcomp |
produce,thought |
| R6020 |
T20622 |
T20623 |
compound |
West,Grove |
| R6021 |
T20623 |
T20615 |
npadvmod |
Grove,ImmunoResearch |
| R6022 |
T20624 |
T20615 |
punct |
", ",ImmunoResearch |
| R6023 |
T20625 |
T20615 |
npadvmod |
Pennsylvania,ImmunoResearch |
| R6024 |
T20626 |
T20615 |
punct |
", ",ImmunoResearch |
| R6025 |
T20627 |
T20628 |
compound |
United,States |
| R6026 |
T20628 |
T20615 |
npadvmod |
States,ImmunoResearch |
| R6027 |
T20629 |
T20615 |
punct |
),ImmunoResearch |
| R6028 |
T20630 |
T20606 |
cc |
or,antibodies |
| R6029 |
T20631 |
T20632 |
npadvmod |
AlexaFluor,conjugated |
| R603 |
T2834 |
T2835 |
det |
an,pore |
| R6030 |
T20632 |
T20635 |
amod |
conjugated,chicken |
| R6031 |
T20633 |
T20631 |
nummod |
594,AlexaFluor |
| R6032 |
T20634 |
T20632 |
punct |
-,conjugated |
| R6033 |
T20635 |
T20606 |
conj |
chicken,antibodies |
| R6034 |
T20636 |
T20635 |
amod |
anti-rabbit,chicken |
| R6035 |
T20637 |
T20638 |
punct |
(,1 |
| R6036 |
T20638 |
T20635 |
parataxis |
1,chicken |
| R6037 |
T20639 |
T20640 |
punct |
:,200 |
| R6038 |
T20640 |
T20638 |
prep |
200,1 |
| R6039 |
T20641 |
T20638 |
punct |
),1 |
| R604 |
T2835 |
T2833 |
dobj |
pore,produce |
| R6040 |
T20642 |
T20572 |
advmod |
respectively,using |
| R6041 |
T20643 |
T20568 |
punct |
.,probed |
| R6042 |
T20645 |
T20646 |
nsubjpass |
Cells,washed |
| R6043 |
T20647 |
T20646 |
auxpass |
were,washed |
| R6044 |
T20648 |
T20646 |
prep |
in,washed |
| R6045 |
T20649 |
T20648 |
pobj |
PBS,in |
| R6046 |
T20650 |
T20646 |
punct |
", ",washed |
| R6047 |
T20651 |
T20646 |
conj |
counterstained,washed |
| R6048 |
T20652 |
T20651 |
prep |
with,counterstained |
| R6049 |
T20653 |
T20652 |
pobj |
DAPI,with |
| R605 |
T2836 |
T2837 |
advmod |
abnormally,localized |
| R6050 |
T20654 |
T20651 |
punct |
", ",counterstained |
| R6051 |
T20655 |
T20651 |
cc |
and,counterstained |
| R6052 |
T20656 |
T20651 |
conj |
mounted,counterstained |
| R6053 |
T20657 |
T20656 |
prep |
in,mounted |
| R6054 |
T20658 |
T20657 |
pobj |
Vectashield,in |
| R6055 |
T20659 |
T20646 |
punct |
.,washed |
| R6056 |
T20661 |
T20662 |
prep |
In,probed |
| R6057 |
T20663 |
T20661 |
pobj |
experiments,In |
| R6058 |
T20664 |
T20665 |
prep |
in,used |
| R6059 |
T20665 |
T20663 |
relcl |
used,experiments |
| R606 |
T2837 |
T2835 |
amod |
localized,pore |
| R6060 |
T20666 |
T20664 |
pobj |
which,in |
| R6061 |
T20667 |
T20668 |
compound |
GFP,fusions |
| R6062 |
T20668 |
T20665 |
nsubjpass |
fusions,used |
| R6063 |
T20669 |
T20665 |
auxpass |
were,used |
| R6064 |
T20670 |
T20662 |
punct |
", ",probed |
| R6065 |
T20671 |
T20662 |
nsubjpass |
AQP2,probed |
| R6066 |
T20672 |
T20662 |
auxpass |
was,probed |
| R6067 |
T20673 |
T20662 |
advcl |
using,probed |
| R6068 |
T20674 |
T20675 |
det |
the,combination |
| R6069 |
T20675 |
T20673 |
dobj |
combination,using |
| R607 |
T2838 |
T2837 |
cc |
and,localized |
| R6070 |
T20676 |
T20675 |
compound |
antibody,combination |
| R6071 |
T20677 |
T20675 |
acl |
used,combination |
| R6072 |
T20678 |
T20677 |
prep |
for,used |
| R6073 |
T20679 |
T20680 |
compound |
kidney,immunohistochemistry |
| R6074 |
T20680 |
T20678 |
pobj |
immunohistochemistry,for |
| R6075 |
T20681 |
T20662 |
prep |
in,probed |
| R6076 |
T20682 |
T20681 |
pobj |
order,in |
| R6077 |
T20683 |
T20684 |
aux |
to,detect |
| R6078 |
T20684 |
T20682 |
acl |
detect,order |
| R6079 |
T20685 |
T20686 |
det |
the,AQP2 |
| R608 |
T2839 |
T2840 |
punct |
", ",misfolded |
| R6080 |
T20686 |
T20684 |
dobj |
AQP2,detect |
| R6081 |
T20687 |
T20684 |
prep |
at,detect |
| R6082 |
T20688 |
T20689 |
nummod |
594,nm |
| R6083 |
T20689 |
T20687 |
pobj |
nm,at |
| R6084 |
T20690 |
T20684 |
punct |
", ",detect |
| R6085 |
T20691 |
T20692 |
aux |
to,distinguish |
| R6086 |
T20692 |
T20684 |
advcl |
distinguish,detect |
| R6087 |
T20693 |
T20692 |
prep |
between,distinguish |
| R6088 |
T20694 |
T20695 |
det |
the,proteins |
| R6089 |
T20695 |
T20693 |
pobj |
proteins,between |
| R609 |
T2840 |
T2837 |
conj |
misfolded,localized |
| R6090 |
T20696 |
T20695 |
compound |
GFP,proteins |
| R6091 |
T20697 |
T20695 |
compound |
fusion,proteins |
| R6092 |
T20698 |
T20662 |
punct |
.,probed |
| R6093 |
T20832 |
T20833 |
amod |
Confocal,microscopy |
| R6094 |
T20834 |
T20833 |
punct |
.,microscopy |
| R6095 |
T20836 |
T20837 |
amod |
Optical,images |
| R6096 |
T20837 |
T20841 |
nsubjpass |
images,collected |
| R6097 |
T20838 |
T20839 |
compound |
z,section |
| R6098 |
T20839 |
T20837 |
compound |
section,images |
| R6099 |
T20840 |
T20839 |
punct |
-,section |
| R61 |
T661 |
T656 |
nmod |
channel,gene |
| R610 |
T2841 |
T2840 |
prep |
in,misfolded |
| R6100 |
T20842 |
T20841 |
auxpass |
were,collected |
| R6101 |
T20843 |
T20841 |
prep |
on,collected |
| R6102 |
T20844 |
T20845 |
det |
a,Microscope |
| R6103 |
T20845 |
T20843 |
pobj |
Microscope,on |
| R6104 |
T20846 |
T20845 |
nmod |
BioRad,Microscope |
| R6105 |
T20847 |
T20848 |
punct |
(,Hercules |
| R6106 |
T20848 |
T20846 |
parataxis |
Hercules,BioRad |
| R6107 |
T20849 |
T20848 |
punct |
", ",Hercules |
| R6108 |
T20850 |
T20848 |
npadvmod |
California,Hercules |
| R6109 |
T20851 |
T20848 |
punct |
", ",Hercules |
| R611 |
T2842 |
T2843 |
amod |
most,instances |
| R6110 |
T20852 |
T20853 |
compound |
United,States |
| R6111 |
T20853 |
T20848 |
npadvmod |
States,Hercules |
| R6112 |
T20854 |
T20848 |
punct |
),Hercules |
| R6113 |
T20855 |
T20856 |
nmod |
Rainbow,Radiance |
| R6114 |
T20856 |
T20845 |
nmod |
Radiance,Microscope |
| R6115 |
T20857 |
T20856 |
nummod |
2100,Radiance |
| R6116 |
T20858 |
T20859 |
compound |
Laser,Scanning |
| R6117 |
T20859 |
T20845 |
compound |
Scanning,Microscope |
| R6118 |
T20860 |
T20845 |
compound |
Confocal,Microscope |
| R6119 |
T20861 |
T20841 |
punct |
.,collected |
| R612 |
T2843 |
T2841 |
pobj |
instances,in |
| R6120 |
T20863 |
T20864 |
compound |
Image,stacks |
| R6121 |
T20864 |
T20865 |
nsubjpass |
stacks,flattened |
| R6122 |
T20866 |
T20865 |
auxpass |
were,flattened |
| R6123 |
T20867 |
T20865 |
punct |
", ",flattened |
| R6124 |
T20868 |
T20865 |
cc |
or,flattened |
| R6125 |
T20869 |
T20865 |
conj |
sectioned,flattened |
| R6126 |
T20870 |
T20869 |
prep |
along,sectioned |
| R6127 |
T20871 |
T20872 |
det |
the,axis |
| R6128 |
T20872 |
T20870 |
pobj |
axis,along |
| R6129 |
T20873 |
T20872 |
compound |
z,axis |
| R613 |
T2844 |
T2840 |
punct |
", ",misfolded |
| R6130 |
T20874 |
T20872 |
punct |
-,axis |
| R6131 |
T20875 |
T20865 |
punct |
", ",flattened |
| R6132 |
T20876 |
T20877 |
advmod |
then,processed |
| R6133 |
T20877 |
T20865 |
dep |
processed,flattened |
| R6134 |
T20878 |
T20877 |
advmod |
further,processed |
| R6135 |
T20879 |
T20877 |
advcl |
using,processed |
| R6136 |
T20880 |
T20881 |
nmod |
BioRad,software |
| R6137 |
T20881 |
T20879 |
dobj |
software,using |
| R6138 |
T20882 |
T20883 |
nmod |
Laser,Sharp |
| R6139 |
T20883 |
T20881 |
nmod |
Sharp,software |
| R614 |
T2845 |
T2835 |
compound |
water,pore |
| R6140 |
T20884 |
T20883 |
nummod |
2000,Sharp |
| R6141 |
T20885 |
T20881 |
cc |
and,software |
| R6142 |
T20886 |
T20887 |
compound |
Image,J |
| R6143 |
T20887 |
T20888 |
compound |
J,software |
| R6144 |
T20888 |
T20881 |
conj |
software,software |
| R6145 |
T20889 |
T20890 |
punct |
(,Institutes |
| R6146 |
T20890 |
T20888 |
parataxis |
Institutes,software |
| R6147 |
T20891 |
T20890 |
dep |
v.,Institutes |
| R6148 |
T20892 |
T20891 |
nummod |
1.32,v. |
| R6149 |
T20893 |
T20890 |
punct |
;,Institutes |
| R615 |
T2846 |
T2847 |
dep |
that,responds |
| R6150 |
T20894 |
T20890 |
compound |
National,Institutes |
| R6151 |
T20895 |
T20890 |
prep |
of,Institutes |
| R6152 |
T20896 |
T20895 |
pobj |
Health,of |
| R6153 |
T20897 |
T20890 |
punct |
),Institutes |
| R6154 |
T20898 |
T20865 |
punct |
.,flattened |
| R6155 |
T20900 |
T20901 |
nsubjpass |
Colocalization,performed |
| R6156 |
T20902 |
T20901 |
auxpass |
was,performed |
| R6157 |
T20903 |
T20901 |
advcl |
using,performed |
| R6158 |
T20904 |
T20905 |
det |
the,coefficient |
| R6159 |
T20905 |
T20903 |
dobj |
coefficient,using |
| R616 |
T2847 |
T2835 |
relcl |
responds,pore |
| R6160 |
T20906 |
T20905 |
amod |
overlay,coefficient |
| R6161 |
T20907 |
T20905 |
prep |
of,coefficient |
| R6162 |
T20908 |
T20909 |
compound |
Image,J |
| R6163 |
T20909 |
T20910 |
compound |
J,software |
| R6164 |
T20910 |
T20907 |
pobj |
software,of |
| R6165 |
T20911 |
T20901 |
punct |
.,performed |
| R617 |
T2848 |
T2847 |
advmod |
abnormally,responds |
| R618 |
T2849 |
T2847 |
prep |
to,responds |
| R619 |
T2850 |
T2851 |
det |
an,increase |
| R62 |
T662 |
T656 |
nmod |
aquaporin,gene |
| R620 |
T2851 |
T2849 |
pobj |
increase,to |
| R621 |
T2852 |
T2851 |
prep |
in,increase |
| R622 |
T2853 |
T2852 |
pobj |
cAMP,in |
| R623 |
T2854 |
T2855 |
punct |
[,11 |
| R624 |
T2855 |
T2829 |
parataxis |
11,thought |
| R625 |
T2856 |
T2855 |
nummod |
6,11 |
| R626 |
T2857 |
T2855 |
punct |
",",11 |
| R627 |
T2858 |
T2855 |
punct |
],11 |
| R628 |
T2859 |
T2829 |
punct |
.,thought |
| R629 |
T2861 |
T2862 |
advmod |
Furthermore,described |
| R63 |
T663 |
T662 |
punct |
-,aquaporin |
| R630 |
T2863 |
T2862 |
punct |
", ",described |
| R631 |
T2864 |
T2865 |
amod |
dominant,mutations |
| R632 |
T2865 |
T2862 |
nsubjpass |
mutations,described |
| R633 |
T2866 |
T2862 |
aux |
have,described |
| R634 |
T2867 |
T2862 |
auxpass |
been,described |
| R635 |
T2868 |
T2862 |
cc |
and,described |
| R636 |
T2869 |
T2862 |
conj |
found,described |
| R637 |
T2870 |
T2871 |
aux |
to,misroute |
| R638 |
T2871 |
T2869 |
xcomp |
misroute,found |
| R639 |
T2872 |
T2873 |
preconj |
both,mutant |
| R64 |
T664 |
T662 |
nummod |
2,aquaporin |
| R640 |
T2873 |
T2871 |
dobj |
mutant,misroute |
| R641 |
T2874 |
T2873 |
det |
the,mutant |
| R642 |
T2875 |
T2873 |
cc |
and,mutant |
| R643 |
T2876 |
T2877 |
det |
the,type |
| R644 |
T2877 |
T2880 |
compound |
type,protein |
| R645 |
T2878 |
T2877 |
amod |
wild,type |
| R646 |
T2879 |
T2877 |
punct |
-,type |
| R647 |
T2880 |
T2873 |
conj |
protein,mutant |
| R648 |
T2881 |
T2871 |
prep |
to,misroute |
| R649 |
T2882 |
T2883 |
det |
the,membrane |
| R65 |
T665 |
T662 |
punct |
(,aquaporin |
| R650 |
T2883 |
T2881 |
pobj |
membrane,to |
| R651 |
T2884 |
T2883 |
amod |
basolateral,membrane |
| R652 |
T2885 |
T2886 |
punct |
[,12 |
| R653 |
T2886 |
T2869 |
parataxis |
12,found |
| R654 |
T2887 |
T2886 |
nummod |
6,12 |
| R655 |
T2888 |
T2886 |
punct |
",",12 |
| R656 |
T2889 |
T2886 |
punct |
],12 |
| R657 |
T2890 |
T2862 |
punct |
.,described |
| R658 |
T2892 |
T2893 |
amod |
Several,models |
| R659 |
T2893 |
T2895 |
nsubjpass |
models,generated |
| R66 |
T666 |
T662 |
appos |
Aqp2,aquaporin |
| R660 |
T2894 |
T2893 |
compound |
mouse,models |
| R661 |
T2896 |
T2893 |
prep |
of,models |
| R662 |
T2897 |
T2898 |
compound |
diabetes,insipidus |
| R663 |
T2898 |
T2896 |
pobj |
insipidus,of |
| R664 |
T2899 |
T2895 |
aux |
have,generated |
| R665 |
T2900 |
T2895 |
auxpass |
been,generated |
| R666 |
T2901 |
T2902 |
punct |
[,13 |
| R667 |
T2902 |
T2895 |
parataxis |
13,generated |
| R668 |
T2903 |
T2904 |
punct |
–,17 |
| R669 |
T2904 |
T2902 |
prep |
17,13 |
| R67 |
T667 |
T656 |
punct |
),gene |
| R670 |
T2905 |
T2902 |
punct |
],13 |
| R671 |
T2906 |
T2895 |
punct |
.,generated |
| R672 |
T2908 |
T2909 |
prep |
In,generated |
| R673 |
T2910 |
T2911 |
det |
an,attempt |
| R674 |
T2911 |
T2908 |
pobj |
attempt,In |
| R675 |
T2912 |
T2913 |
aux |
to,recapitulate |
| R676 |
T2913 |
T2911 |
acl |
recapitulate,attempt |
| R677 |
T2914 |
T2915 |
amod |
human,NDI |
| R678 |
T2915 |
T2913 |
dobj |
NDI,recapitulate |
| R679 |
T2916 |
T2909 |
punct |
", ",generated |
| R68 |
T668 |
T635 |
punct |
.,found |
| R680 |
T2917 |
T2909 |
nsubjpass |
mice,generated |
| R681 |
T2918 |
T2909 |
aux |
have,generated |
| R682 |
T2919 |
T2909 |
auxpass |
been,generated |
| R683 |
T2920 |
T2909 |
prep |
with,generated |
| R684 |
T2921 |
T2920 |
pobj |
mutations,with |
| R685 |
T2922 |
T2921 |
prep |
in,mutations |
| R686 |
T2923 |
T2922 |
pobj |
Aqp2,in |
| R687 |
T2924 |
T2923 |
cc |
and,Aqp2 |
| R688 |
T2925 |
T2923 |
conj |
Avpr2,Aqp2 |
| R689 |
T2926 |
T2927 |
punct |
[,18 |
| R69 |
T670 |
T671 |
nsubjpass |
Development,rendered |
| R690 |
T2927 |
T2909 |
parataxis |
18,generated |
| R691 |
T2928 |
T2927 |
nummod |
15,18 |
| R692 |
T2929 |
T2927 |
punct |
",",18 |
| R693 |
T2930 |
T2927 |
punct |
],18 |
| R694 |
T2931 |
T2909 |
punct |
.,generated |
| R695 |
T2933 |
T2934 |
nsubj |
Yang,created |
| R696 |
T2935 |
T2933 |
cc |
and,Yang |
| R697 |
T2936 |
T2933 |
conj |
colleagues,Yang |
| R698 |
T2937 |
T2938 |
det |
a,mouse |
| R699 |
T2938 |
T2934 |
dobj |
mouse,created |
| R7 |
T601 |
T600 |
prep |
in,Mutation |
| R70 |
T672 |
T670 |
prep |
of,Development |
| R700 |
T2939 |
T2938 |
prep |
with,mouse |
| R701 |
T2940 |
T2941 |
det |
a,mutation |
| R702 |
T2941 |
T2939 |
pobj |
mutation,with |
| R703 |
T2942 |
T2941 |
nmod |
T126M,mutation |
| R704 |
T2943 |
T2941 |
amod |
knock,mutation |
| R705 |
T2944 |
T2943 |
punct |
-,knock |
| R706 |
T2945 |
T2943 |
prt |
in,knock |
| R707 |
T2946 |
T2941 |
prep |
in,mutation |
| R708 |
T2947 |
T2948 |
det |
the,gene |
| R709 |
T2948 |
T2946 |
pobj |
gene,in |
| R71 |
T673 |
T674 |
det |
a,treatment |
| R710 |
T2949 |
T2948 |
compound |
Aqp2,gene |
| R711 |
T2950 |
T2934 |
punct |
.,created |
| R712 |
T2952 |
T2953 |
advmod |
Unexpectedly,died |
| R713 |
T2954 |
T2953 |
punct |
", ",died |
| R714 |
T2955 |
T2956 |
amod |
homozygous,mice |
| R715 |
T2956 |
T2953 |
nsubj |
mice,died |
| R716 |
T2957 |
T2956 |
compound |
mutant,mice |
| R717 |
T2958 |
T2953 |
prep |
within,died |
| R718 |
T2959 |
T2960 |
nummod |
6,d |
| R719 |
T2960 |
T2958 |
pobj |
d,within |
| R72 |
T674 |
T672 |
pobj |
treatment,of |
| R720 |
T2961 |
T2960 |
prep |
after,d |
| R721 |
T2962 |
T2961 |
pobj |
birth,after |
| R722 |
T2963 |
T2953 |
punct |
.,died |
| R723 |
T2965 |
T2966 |
advmod |
Interestingly,die |
| R724 |
T2967 |
T2966 |
punct |
", ",die |
| R725 |
T2968 |
T2969 |
npadvmod |
AVPR2,deficient |
| R726 |
T2969 |
T2971 |
amod |
deficient,pups |
| R727 |
T2970 |
T2969 |
punct |
-,deficient |
| R728 |
T2971 |
T2966 |
nsubj |
pups,die |
| R729 |
T2972 |
T2971 |
amod |
male,pups |
| R73 |
T675 |
T671 |
auxpass |
is,rendered |
| R730 |
T2973 |
T2966 |
advmod |
also,die |
| R731 |
T2974 |
T2966 |
prep |
within,die |
| R732 |
T2975 |
T2976 |
det |
the,week |
| R733 |
T2976 |
T2974 |
pobj |
week,within |
| R734 |
T2977 |
T2976 |
amod |
first,week |
| R735 |
T2978 |
T2976 |
prep |
after,week |
| R736 |
T2979 |
T2978 |
pobj |
birth,after |
| R737 |
T2980 |
T2966 |
punct |
.,die |
| R738 |
T2982 |
T2983 |
advmod |
Together,suggest |
| R739 |
T2984 |
T2985 |
det |
these,models |
| R74 |
T676 |
T671 |
oprd |
difficult,rendered |
| R740 |
T2985 |
T2983 |
nsubj |
models,suggest |
| R741 |
T2986 |
T2987 |
mark |
that,be |
| R742 |
T2987 |
T2983 |
ccomp |
be,suggest |
| R743 |
T2988 |
T2989 |
det |
the,mouse |
| R744 |
T2989 |
T2987 |
nsubj |
mouse,be |
| R745 |
T3096 |
T3095 |
punct |
-,duct |
| R746 |
T2990 |
T2987 |
aux |
may,be |
| R747 |
T3097 |
T3084 |
punct |
", ",adopts |
| R748 |
T2991 |
T2992 |
det |
a,organism |
| R749 |
T2992 |
T2987 |
attr |
organism,be |
| R75 |
T677 |
T671 |
prep |
due,rendered |
| R750 |
T3098 |
T3084 |
cc |
and,adopts |
| R751 |
T2993 |
T2994 |
advmod |
highly,sensitive |
| R752 |
T2994 |
T2992 |
amod |
sensitive,organism |
| R753 |
T3099 |
T3084 |
conj |
was,adopts |
| R754 |
T2995 |
T2987 |
prep |
with,be |
| R755 |
T2996 |
T2995 |
pobj |
regard,with |
| R756 |
T3100 |
T3099 |
acomp |
resistant,was |
| R757 |
T2997 |
T2996 |
prep |
to,regard |
| R758 |
T2998 |
T2999 |
compound |
water,homeostasis |
| R759 |
T2999 |
T2997 |
pobj |
homeostasis,to |
| R76 |
T678 |
T677 |
pcomp |
to,due |
| R760 |
T3000 |
T2987 |
punct |
", ",be |
| R761 |
T3001 |
T2987 |
cc |
and,be |
| R762 |
T3101 |
T3100 |
prep |
to,resistant |
| R763 |
T3002 |
T2987 |
conj |
is,be |
| R764 |
T3003 |
T3002 |
acomp |
unable,is |
| R765 |
T3004 |
T3005 |
aux |
to,survive |
| R766 |
T3102 |
T3101 |
pobj |
translocation,to |
| R767 |
T3005 |
T3003 |
xcomp |
survive,unable |
| R768 |
T3006 |
T3005 |
prep |
with,survive |
| R769 |
T3007 |
T3006 |
pobj |
polyuria,with |
| R77 |
T679 |
T680 |
det |
the,lack |
| R770 |
T3103 |
T3102 |
acl |
induced,translocation |
| R771 |
T3008 |
T2983 |
punct |
.,suggest |
| R772 |
T3010 |
T3011 |
prep |
In,identified |
| R773 |
T3104 |
T3103 |
agent |
by,induced |
| R774 |
T3012 |
T3013 |
det |
a,screen |
| R775 |
T3105 |
T3104 |
pobj |
desmopressin,by |
| R776 |
T3013 |
T3010 |
pobj |
screen,In |
| R777 |
T3014 |
T3015 |
advmod |
forward,genetic |
| R778 |
T3015 |
T3013 |
amod |
genetic,screen |
| R779 |
T3016 |
T3011 |
punct |
", ",identified |
| R78 |
T680 |
T677 |
pobj |
lack,due |
| R780 |
T3106 |
T3105 |
punct |
", ",desmopressin |
| R781 |
T3017 |
T3018 |
det |
a,mouse |
| R782 |
T3018 |
T3011 |
nsubjpass |
mouse,identified |
| R783 |
T3107 |
T3108 |
det |
an,agonist |
| R784 |
T3019 |
T3018 |
prep |
with,mouse |
| R785 |
T3020 |
T3021 |
det |
an,mutation |
| R786 |
T3021 |
T3019 |
pobj |
mutation,with |
| R787 |
T3108 |
T3105 |
appos |
agonist,desmopressin |
| R788 |
T3109 |
T3108 |
prep |
of,agonist |
| R789 |
T3022 |
T3021 |
compound |
Aqp2,mutation |
| R79 |
T681 |
T680 |
prep |
of,lack |
| R790 |
T3023 |
T3011 |
auxpass |
was,identified |
| R791 |
T3024 |
T3011 |
punct |
.,identified |
| R792 |
T3026 |
T3027 |
det |
The,purpose |
| R793 |
T3110 |
T3109 |
pobj |
AVP,of |
| R794 |
T3027 |
T3028 |
nsubj |
purpose,was |
| R795 |
T3029 |
T3027 |
prep |
of,purpose |
| R796 |
T3030 |
T3031 |
det |
this,study |
| R797 |
T3111 |
T3082 |
punct |
.,concluded |
| R798 |
T3031 |
T3029 |
pobj |
study,of |
| R799 |
T3032 |
T3033 |
aux |
to,characterize |
| R8 |
T602 |
T601 |
pobj |
Aquaporin,in |
| R80 |
T682 |
T683 |
det |
a,model |
| R800 |
T3033 |
T3028 |
xcomp |
characterize,was |
| R801 |
T3113 |
T3114 |
advmod |
In,vitro |
| R802 |
T3034 |
T3035 |
det |
this,model |
| R803 |
T3035 |
T3033 |
dobj |
model,characterize |
| R804 |
T3036 |
T3035 |
amod |
murine,model |
| R805 |
T3037 |
T3035 |
prep |
of,model |
| R806 |
T3114 |
T3115 |
amod |
vitro,studies |
| R807 |
T3038 |
T3039 |
amod |
recessive,DI |
| R808 |
T3039 |
T3037 |
pobj |
DI,of |
| R809 |
T3115 |
T3116 |
nsubj |
studies,demonstrated |
| R81 |
T683 |
T681 |
pobj |
model,of |
| R810 |
T3040 |
T3039 |
amod |
nephrogenic,DI |
| R811 |
T3041 |
T3028 |
punct |
.,was |
| R812 |
T3043 |
T3044 |
nsubj |
We,report |
| R813 |
T3045 |
T3044 |
advmod |
now,report |
| R814 |
T3117 |
T3115 |
acl |
using,studies |
| R815 |
T3046 |
T3047 |
det |
a,mutation |
| R816 |
T3047 |
T3044 |
dobj |
mutation,report |
| R817 |
T3048 |
T3047 |
amod |
novel,mutation |
| R818 |
T3049 |
T3047 |
compound |
F204V,mutation |
| R819 |
T3118 |
T3119 |
det |
the,line |
| R82 |
T684 |
T683 |
amod |
viable,model |
| R820 |
T3050 |
T3047 |
prep |
in,mutation |
| R821 |
T3051 |
T3052 |
det |
the,gene |
| R822 |
T3052 |
T3050 |
pobj |
gene,in |
| R823 |
T3119 |
T3117 |
dobj |
line,using |
| R824 |
T3053 |
T3052 |
compound |
Aqp2,gene |
| R825 |
T3054 |
T3044 |
punct |
.,report |
| R826 |
T3120 |
T3121 |
nmod |
Madin,Darby |
| R827 |
T3056 |
T3057 |
det |
This,allele |
| R828 |
T3057 |
T3058 |
nsubjpass |
allele,found |
| R829 |
T3121 |
T3123 |
nmod |
Darby,kidney |
| R83 |
T685 |
T683 |
compound |
animal,model |
| R830 |
T3059 |
T3057 |
prep |
of,allele |
| R831 |
T3060 |
T3059 |
pobj |
Aqp2,of |
| R832 |
T3122 |
T3121 |
punct |
-,Darby |
| R833 |
T3061 |
T3058 |
auxpass |
was,found |
| R834 |
T3062 |
T3063 |
aux |
to,cause |
| R835 |
T3063 |
T3058 |
xcomp |
cause,found |
| R836 |
T3123 |
T3119 |
nmod |
kidney,line |
| R837 |
T3064 |
T3065 |
det |
the,model |
| R838 |
T3065 |
T3068 |
nsubj |
model,survive |
| R839 |
T3124 |
T3123 |
amod |
canine,kidney |
| R84 |
T686 |
T671 |
punct |
.,rendered |
| R840 |
T3066 |
T3065 |
amod |
first,model |
| R841 |
T3067 |
T3065 |
compound |
mouse,model |
| R842 |
T3125 |
T3123 |
punct |
(,kidney |
| R843 |
T3068 |
T3063 |
ccomp |
survive,cause |
| R844 |
T3069 |
T3065 |
prep |
of,model |
| R845 |
T3070 |
T3069 |
pobj |
NDI,of |
| R846 |
T3126 |
T3123 |
appos |
MDCK,kidney |
| R847 |
T3071 |
T3068 |
aux |
to,survive |
| R848 |
T3072 |
T3068 |
prep |
past,survive |
| R849 |
T3073 |
T3074 |
det |
the,week |
| R85 |
T688 |
T689 |
prep |
Through,report |
| R850 |
T3127 |
T3119 |
punct |
),line |
| R851 |
T3074 |
T3072 |
pobj |
week,past |
| R852 |
T3075 |
T3074 |
amod |
first,week |
| R853 |
T3076 |
T3074 |
prep |
of,week |
| R854 |
T3128 |
T3119 |
compound |
cell,line |
| R855 |
T3129 |
T3130 |
det |
an,pattern |
| R856 |
T3130 |
T3116 |
dobj |
pattern,demonstrated |
| R857 |
T3077 |
T3076 |
pobj |
life,of |
| R858 |
T3078 |
T3058 |
punct |
.,found |
| R859 |
T3131 |
T3130 |
amod |
endoplasmic,pattern |
| R86 |
T690 |
T691 |
amod |
forward,screening |
| R860 |
T3080 |
T3081 |
amod |
Molecular,analyses |
| R861 |
T3132 |
T3130 |
compound |
reticulum,pattern |
| R862 |
T3081 |
T3082 |
nsubj |
analyses,concluded |
| R863 |
T3083 |
T3084 |
mark |
that,adopts |
| R864 |
T3084 |
T3082 |
ccomp |
adopts,concluded |
| R865 |
T3085 |
T3086 |
compound |
mutant,AQP2 |
| R866 |
T3086 |
T3084 |
nsubj |
AQP2,adopts |
| R867 |
T3133 |
T3130 |
prep |
for,pattern |
| R868 |
T3087 |
T3088 |
det |
a,localization |
| R869 |
T3088 |
T3084 |
dobj |
localization,adopts |
| R87 |
T691 |
T688 |
pobj |
screening,Through |
| R870 |
T3089 |
T3088 |
amod |
different,localization |
| R871 |
T3134 |
T3135 |
det |
the,protein |
| R872 |
T3090 |
T3088 |
amod |
subcellular,localization |
| R873 |
T3091 |
T3084 |
prep |
in,adopts |
| R874 |
T3092 |
T3093 |
amod |
renal,cells |
| R875 |
T3135 |
T3133 |
pobj |
protein,for |
| R876 |
T3093 |
T3091 |
pobj |
cells,in |
| R877 |
T3094 |
T3095 |
amod |
collecting,duct |
| R878 |
T3136 |
T3135 |
compound |
mutant,protein |
| R879 |
T3095 |
T3093 |
compound |
duct,cells |
| R88 |
T692 |
T691 |
amod |
genetic,screening |
| R880 |
T3137 |
T3130 |
punct |
", ",pattern |
| R881 |
T3138 |
T3130 |
cc |
and,pattern |
| R882 |
T3139 |
T3140 |
amod |
apparent,resistance |
| R883 |
T3140 |
T3130 |
conj |
resistance,pattern |
| R884 |
T3141 |
T3140 |
prep |
to,resistance |
| R885 |
T3142 |
T3141 |
pobj |
translocation,to |
| R886 |
T3143 |
T3116 |
punct |
.,demonstrated |
| R887 |
T3145 |
T3146 |
det |
These,data |
| R888 |
T3146 |
T3147 |
nsubj |
data,prove |
| R889 |
T3148 |
T3147 |
advmod |
conclusively,prove |
| R89 |
T693 |
T691 |
prep |
of,screening |
| R890 |
T3149 |
T3150 |
mark |
that,is |
| R891 |
T3150 |
T3147 |
ccomp |
is,prove |
| R892 |
T3151 |
T3152 |
amod |
autosomal,NDI |
| R893 |
T3152 |
T3150 |
nsubj |
NDI,is |
| R894 |
T3153 |
T3152 |
amod |
recessive,NDI |
| R895 |
T3154 |
T3155 |
det |
a,consequence |
| R896 |
T3155 |
T3150 |
attr |
consequence,is |
| R897 |
T3156 |
T3155 |
prep |
of,consequence |
| R898 |
T3157 |
T3158 |
amod |
improper,routing |
| R899 |
T3158 |
T3156 |
pobj |
routing,of |
| R9 |
T603 |
T602 |
punct |
-,Aquaporin |
| R90 |
T694 |
T695 |
npadvmod |
ethylnitrosourea,mutagenized |
| R900 |
T3159 |
T3158 |
compound |
AQP2,routing |
| R901 |
T3160 |
T3158 |
prep |
in,routing |
| R902 |
T3161 |
T3162 |
det |
the,mammal |
| R903 |
T3162 |
T3160 |
pobj |
mammal,in |
| R904 |
T3163 |
T3162 |
amod |
intact,mammal |
| R905 |
T3164 |
T3147 |
punct |
.,prove |
| R91 |
T695 |
T697 |
amod |
mutagenized,mice |
| R916 |
T8980 |
T8981 |
punct |
[,20 |
| R917 |
T8951 |
T8952 |
prep |
In,found |
| R918 |
T8953 |
T8954 |
det |
a,screen |
| R919 |
T8954 |
T8951 |
pobj |
screen,In |
| R92 |
T696 |
T695 |
punct |
-,mutagenized |
| R920 |
T8955 |
T8956 |
amod |
forward,genetic |
| R921 |
T8956 |
T8954 |
amod |
genetic,screen |
| R922 |
T8957 |
T8958 |
dep |
that,used |
| R923 |
T8958 |
T8954 |
relcl |
used,screen |
| R924 |
T8959 |
T8958 |
dobj |
ethylnitrosourea,used |
| R925 |
T8960 |
T8959 |
punct |
(,ethylnitrosourea |
| R926 |
T8961 |
T8959 |
appos |
ENU,ethylnitrosourea |
| R927 |
T8981 |
T8958 |
parataxis |
20,used |
| R928 |
T8962 |
T8958 |
punct |
),used |
| R929 |
T8963 |
T8964 |
aux |
to,induce |
| R93 |
T697 |
T693 |
pobj |
mice,of |
| R930 |
T8964 |
T8958 |
advcl |
induce,used |
| R931 |
T8982 |
T8981 |
nummod |
19,20 |
| R932 |
T8965 |
T8964 |
dobj |
mutations,induce |
| R933 |
T8966 |
T8964 |
prep |
in,induce |
| R934 |
T8967 |
T8968 |
det |
a,animal |
| R935 |
T8983 |
T8981 |
punct |
",",20 |
| R936 |
T8968 |
T8966 |
pobj |
animal,in |
| R937 |
T8969 |
T8968 |
compound |
founder,animal |
| R938 |
T8970 |
T8971 |
poss |
whose,offspring |
| R939 |
T8984 |
T8981 |
punct |
],20 |
| R94 |
T698 |
T689 |
punct |
", ",report |
| R940 |
T8971 |
T8972 |
dep |
offspring,screened |
| R941 |
T8972 |
T8968 |
relcl |
screened,animal |
| R942 |
T8973 |
T8972 |
auxpass |
were,screened |
| R943 |
T8985 |
T8952 |
punct |
", ",found |
| R944 |
T8974 |
T8972 |
advmod |
then,screened |
| R945 |
T8986 |
T8952 |
nsubj |
we,found |
| R946 |
T8975 |
T8972 |
prep |
for,screened |
| R947 |
T8976 |
T8977 |
amod |
abnormal,metabolism |
| R948 |
T8987 |
T8988 |
det |
a,family |
| R949 |
T8977 |
T8975 |
pobj |
metabolism,for |
| R95 |
T699 |
T689 |
nsubj |
we,report |
| R950 |
T8978 |
T8979 |
amod |
whole,body |
| R951 |
T8988 |
T8952 |
dobj |
family,found |
| R952 |
T8979 |
T8977 |
compound |
body,metabolism |
| R953 |
T8989 |
T8988 |
prep |
of,family |
| R954 |
T8990 |
T8989 |
pobj |
mice,of |
| R955 |
T8991 |
T8992 |
dep |
that,urinated |
| R956 |
T9086 |
T9084 |
pobj |
substitution,to |
| R957 |
T9087 |
T9086 |
nmod |
valine,substitution |
| R958 |
T9088 |
T9087 |
prep |
for,valine |
| R959 |
T9089 |
T9088 |
pobj |
phenylalanine,for |
| R96 |
T700 |
T701 |
det |
the,identification |
| R960 |
T9090 |
T9086 |
prep |
at,substitution |
| R961 |
T8992 |
T8988 |
relcl |
urinated,family |
| R962 |
T9091 |
T9092 |
compound |
amino,acid |
| R963 |
T9092 |
T9090 |
pobj |
acid,at |
| R964 |
T9093 |
T9092 |
nummod |
204,acid |
| R965 |
T9094 |
T9092 |
prep |
of,acid |
| R966 |
T8993 |
T8992 |
cc |
and,urinated |
| R967 |
T9095 |
T9096 |
det |
the,protein |
| R968 |
T9096 |
T9094 |
pobj |
protein,of |
| R969 |
T9097 |
T9092 |
punct |
(,acid |
| R97 |
T701 |
T689 |
dobj |
identification,report |
| R970 |
T8994 |
T8992 |
conj |
drank,urinated |
| R971 |
T9098 |
T9092 |
appos |
F204V,acid |
| R972 |
T9099 |
T9092 |
punct |
),acid |
| R973 |
T9100 |
T9056 |
punct |
.,identified |
| R974 |
T8995 |
T8994 |
advmod |
excessively,drank |
| R975 |
T8996 |
T8952 |
punct |
.,found |
| R976 |
T9102 |
T9103 |
nsubj |
AQP2,is |
| R977 |
T9104 |
T9105 |
det |
a,channel |
| R978 |
T8998 |
T8999 |
nmod |
Serum,analysis |
| R979 |
T9105 |
T9103 |
attr |
channel,is |
| R98 |
T702 |
T701 |
cc |
and,identification |
| R980 |
T9106 |
T9107 |
nummod |
six,transmembrane |
| R981 |
T9107 |
T9105 |
compound |
transmembrane,channel |
| R982 |
T9108 |
T9107 |
punct |
-,transmembrane |
| R983 |
T8999 |
T9002 |
nsubj |
analysis,showed |
| R984 |
T9109 |
T9105 |
compound |
water,channel |
| R985 |
T9110 |
T9103 |
punct |
", ",is |
| R986 |
T9000 |
T8998 |
cc |
and,Serum |
| R987 |
T9111 |
T9103 |
cc |
and,is |
| R988 |
T9112 |
T9113 |
nsubj |
F204,lies |
| R989 |
T9113 |
T9103 |
conj |
lies,is |
| R99 |
T703 |
T701 |
conj |
characterization,identification |
| R990 |
T9001 |
T8998 |
conj |
urine,Serum |
| R991 |
T9114 |
T9113 |
prep |
near,lies |
| R992 |
T9115 |
T9116 |
det |
the,face |
| R993 |
T9003 |
T9004 |
mark |
that,were |
| R994 |
T9116 |
T9114 |
pobj |
face,near |
| R995 |
T9117 |
T9116 |
amod |
extracellular,face |
| R996 |
T9118 |
T9116 |
prep |
of,face |
| R997 |
T9119 |
T9120 |
det |
the,domain |
| R998 |
T9120 |
T9118 |
pobj |
domain,of |
| R999 |
T9004 |
T9002 |
ccomp |
were,showed |