Id |
Subject |
Object |
Predicate |
Lexical cue |
T5985 |
0-5 |
JJ |
denotes |
Adult |
T5987 |
6-11 |
NN |
denotes |
C57BL |
T5988 |
11-12 |
HYPH |
denotes |
/ |
T5989 |
12-13 |
CD |
denotes |
6 |
T5990 |
14-18 |
JJ |
denotes |
male |
T5986 |
19-23 |
NNS |
denotes |
mice |
T5992 |
24-28 |
VBD |
denotes |
were |
T5991 |
29-33 |
VBN |
denotes |
used |
T5993 |
34-36 |
IN |
denotes |
in |
T5994 |
37-41 |
DT |
denotes |
this |
T5995 |
42-47 |
NN |
denotes |
study |
T5996 |
47-48 |
. |
denotes |
. |
T5997 |
48-451 |
sentence |
denotes |
Total RNAs purified from the cerebellum, spinal cord, sciatic nerve, DRG and cultured Schwann cells using TRIzol (Invitrogen Corp.) and RNeasy kit (Qiagen GmbH) were analysed by RT-PCR using SuperScript II and random primer (Invitrogen Corp.), and PCR amplification (40 cycles; 94°C-30 s, 60°C-30 s and 68°C-5 min) with Expand Hi-Fidelity DNA polymerase (Roche Diagnostics) and ADAM22-specific primers. |
T5998 |
49-54 |
JJ |
denotes |
Total |
T5999 |
55-59 |
NNS |
denotes |
RNAs |
T6001 |
60-68 |
VBN |
denotes |
purified |
T6002 |
69-73 |
IN |
denotes |
from |
T6003 |
74-77 |
DT |
denotes |
the |
T6004 |
78-88 |
NN |
denotes |
cerebellum |
T6005 |
88-90 |
, |
denotes |
, |
T6006 |
90-96 |
JJ |
denotes |
spinal |
T6007 |
97-101 |
NN |
denotes |
cord |
T6008 |
101-103 |
, |
denotes |
, |
T6009 |
103-110 |
JJ |
denotes |
sciatic |
T6010 |
111-116 |
NN |
denotes |
nerve |
T6011 |
116-118 |
, |
denotes |
, |
T6012 |
118-121 |
NN |
denotes |
DRG |
T6013 |
122-125 |
CC |
denotes |
and |
T6014 |
126-134 |
VBN |
denotes |
cultured |
T6016 |
135-142 |
NNP |
denotes |
Schwann |
T6015 |
143-148 |
NNS |
denotes |
cells |
T6017 |
149-154 |
VBG |
denotes |
using |
T6018 |
155-161 |
NN |
denotes |
TRIzol |
T6019 |
162-163 |
-LRB- |
denotes |
( |
T6021 |
163-173 |
NNP |
denotes |
Invitrogen |
T6020 |
174-179 |
NNP |
denotes |
Corp. |
T6022 |
179-180 |
-RRB- |
denotes |
) |
T6023 |
181-184 |
CC |
denotes |
and |
T6024 |
185-191 |
NN |
denotes |
RNeasy |
T6025 |
192-195 |
NN |
denotes |
kit |
T6026 |
196-197 |
-LRB- |
denotes |
( |
T6028 |
197-203 |
NNP |
denotes |
Qiagen |
T6027 |
204-208 |
NNP |
denotes |
GmbH |
T6029 |
208-209 |
-RRB- |
denotes |
) |
T6030 |
210-214 |
VBD |
denotes |
were |
T6000 |
215-223 |
VBN |
denotes |
analysed |
T6031 |
224-226 |
IN |
denotes |
by |
T6032 |
227-229 |
NN |
denotes |
RT |
T6034 |
229-230 |
HYPH |
denotes |
- |
T6033 |
230-233 |
NN |
denotes |
PCR |
T6035 |
234-239 |
VBG |
denotes |
using |
T6036 |
240-251 |
NNP |
denotes |
SuperScript |
T6037 |
252-254 |
CD |
denotes |
II |
T6038 |
255-258 |
CC |
denotes |
and |
T6039 |
259-265 |
JJ |
denotes |
random |
T6040 |
266-272 |
NN |
denotes |
primer |
T6041 |
273-274 |
-LRB- |
denotes |
( |
T6043 |
274-284 |
NNP |
denotes |
Invitrogen |
T6042 |
285-290 |
NNP |
denotes |
Corp. |
T6044 |
290-291 |
-RRB- |
denotes |
) |
T6045 |
291-293 |
, |
denotes |
, |
T6046 |
293-296 |
CC |
denotes |
and |
T6047 |
297-300 |
NN |
denotes |
PCR |
T6048 |
301-314 |
NN |
denotes |
amplification |
T6049 |
315-316 |
-LRB- |
denotes |
( |
T6051 |
316-318 |
CD |
denotes |
40 |
T6052 |
319-325 |
NNS |
denotes |
cycles |
T6053 |
325-326 |
: |
denotes |
; |
T6054 |
327-329 |
CD |
denotes |
94 |
T6050 |
329-331 |
NN |
denotes |
°C |
T6055 |
331-332 |
HYPH |
denotes |
- |
T6056 |
332-334 |
CD |
denotes |
30 |
T6057 |
335-336 |
NN |
denotes |
s |
T6058 |
336-338 |
, |
denotes |
, |
T6059 |
338-340 |
CD |
denotes |
60 |
T6060 |
340-342 |
NN |
denotes |
°C |
T6061 |
342-343 |
HYPH |
denotes |
- |
T6062 |
343-345 |
CD |
denotes |
30 |
T6063 |
346-347 |
NN |
denotes |
s |
T6064 |
348-351 |
CC |
denotes |
and |
T6065 |
352-354 |
CD |
denotes |
68 |
T6066 |
354-356 |
NN |
denotes |
°C |
T6067 |
356-357 |
HYPH |
denotes |
- |
T6068 |
357-358 |
CD |
denotes |
5 |
T6069 |
359-362 |
NN |
denotes |
min |
T6070 |
362-363 |
-RRB- |
denotes |
) |
T6071 |
364-368 |
IN |
denotes |
with |
T6072 |
369-375 |
NNP |
denotes |
Expand |
T6074 |
376-378 |
NNP |
denotes |
Hi |
T6076 |
378-379 |
HYPH |
denotes |
- |
T6075 |
379-387 |
NNP |
denotes |
Fidelity |
T6077 |
388-391 |
NN |
denotes |
DNA |
T6073 |
392-402 |
NN |
denotes |
polymerase |
T6078 |
403-404 |
-LRB- |
denotes |
( |
T6080 |
404-409 |
NNP |
denotes |
Roche |
T6079 |
410-421 |
NNP |
denotes |
Diagnostics |
T6081 |
421-422 |
-RRB- |
denotes |
) |
T6082 |
423-426 |
CC |
denotes |
and |
T6083 |
427-433 |
NN |
denotes |
ADAM22 |
T6085 |
433-434 |
HYPH |
denotes |
- |
T6084 |
434-442 |
JJ |
denotes |
specific |
T6086 |
443-450 |
NNS |
denotes |
primers |
T6087 |
450-451 |
. |
denotes |
. |
T6088 |
451-630 |
sentence |
denotes |
To detect splicing variants in the cytoplasmic domain, a forward primer was placed just upstream of the transmembrane domain and a reverse primer was set on the terminating exon. |
T6089 |
452-454 |
TO |
denotes |
To |
T6090 |
455-461 |
VB |
denotes |
detect |
T6092 |
462-470 |
NN |
denotes |
splicing |
T6093 |
471-479 |
NNS |
denotes |
variants |
T6094 |
480-482 |
IN |
denotes |
in |
T6095 |
483-486 |
DT |
denotes |
the |
T6097 |
487-498 |
JJ |
denotes |
cytoplasmic |
T6096 |
499-505 |
NN |
denotes |
domain |
T6098 |
505-507 |
, |
denotes |
, |
T6099 |
507-508 |
DT |
denotes |
a |
T6101 |
509-516 |
JJ |
denotes |
forward |
T6100 |
517-523 |
NN |
denotes |
primer |
T6102 |
524-527 |
VBD |
denotes |
was |
T6091 |
528-534 |
VBN |
denotes |
placed |
T6103 |
535-539 |
RB |
denotes |
just |
T6104 |
540-548 |
RB |
denotes |
upstream |
T6105 |
549-551 |
IN |
denotes |
of |
T6106 |
552-555 |
DT |
denotes |
the |
T6108 |
556-569 |
JJ |
denotes |
transmembrane |
T6107 |
570-576 |
NN |
denotes |
domain |
T6109 |
577-580 |
CC |
denotes |
and |
T6110 |
581-582 |
DT |
denotes |
a |
T6112 |
583-590 |
JJ |
denotes |
reverse |
T6111 |
591-597 |
NN |
denotes |
primer |
T6114 |
598-601 |
VBD |
denotes |
was |
T6113 |
602-605 |
VBN |
denotes |
set |
T6115 |
606-608 |
IN |
denotes |
on |
T6116 |
609-612 |
DT |
denotes |
the |
T6118 |
613-624 |
VBG |
denotes |
terminating |
T6117 |
625-629 |
NN |
denotes |
exon |
T6119 |
629-630 |
. |
denotes |
. |
T6120 |
630-678 |
sentence |
denotes |
The primers used in this study were as follows. |
T6121 |
631-634 |
DT |
denotes |
The |
T6122 |
635-642 |
NNS |
denotes |
primers |
T6124 |
643-647 |
VBN |
denotes |
used |
T6125 |
648-650 |
IN |
denotes |
in |
T6126 |
651-655 |
DT |
denotes |
this |
T6127 |
656-661 |
NN |
denotes |
study |
T6123 |
662-666 |
VBD |
denotes |
were |
T6128 |
667-669 |
IN |
denotes |
as |
T6129 |
670-677 |
VBZ |
denotes |
follows |
T6130 |
677-678 |
. |
denotes |
. |
T6131 |
678-775 |
sentence |
denotes |
ISH04-forward: 5'-AACAGGCACTGGACAGGGGCTGAC-3' and ISH04-reverse: 5'-AATGGATGTCTCCCATAGCCTGGC-3'. |
T6132 |
679-684 |
NN |
denotes |
ISH04 |
T6133 |
684-685 |
HYPH |
denotes |
- |
T6134 |
685-692 |
JJ |
denotes |
forward |
T6135 |
692-694 |
: |
denotes |
: |
T6136 |
694-695 |
CD |
denotes |
5 |
T6138 |
695-696 |
SYM |
denotes |
' |
T6139 |
696-697 |
HYPH |
denotes |
- |
T6137 |
697-721 |
NN |
denotes |
AACAGGCACTGGACAGGGGCTGAC |
T6140 |
721-722 |
HYPH |
denotes |
- |
T6141 |
722-723 |
CD |
denotes |
3 |
T6142 |
723-724 |
SYM |
denotes |
' |
T6143 |
725-728 |
CC |
denotes |
and |
T6144 |
729-734 |
NN |
denotes |
ISH04 |
T6145 |
734-735 |
HYPH |
denotes |
- |
T6146 |
735-742 |
JJ |
denotes |
reverse |
T6147 |
742-744 |
: |
denotes |
: |
T6148 |
744-745 |
CD |
denotes |
5 |
T6150 |
745-746 |
SYM |
denotes |
' |
T6151 |
746-747 |
HYPH |
denotes |
- |
T6149 |
747-771 |
NN |
denotes |
AATGGATGTCTCCCATAGCCTGGC |
T6152 |
771-772 |
HYPH |
denotes |
- |
T6153 |
772-773 |
CD |
denotes |
3 |
T6154 |
773-774 |
SYM |
denotes |
' |
T6155 |
774-775 |
. |
denotes |
. |
R3758 |
T5985 |
T5986 |
amod |
Adult,mice |
R3759 |
T5986 |
T5991 |
nsubjpass |
mice,used |
R3760 |
T5987 |
T5986 |
nmod |
C57BL,mice |
R3761 |
T5988 |
T5987 |
punct |
/,C57BL |
R3762 |
T5989 |
T5987 |
nummod |
6,C57BL |
R3763 |
T5990 |
T5986 |
amod |
male,mice |
R3764 |
T5992 |
T5991 |
auxpass |
were,used |
R3765 |
T5993 |
T5991 |
prep |
in,used |
R3766 |
T5994 |
T5995 |
det |
this,study |
R3767 |
T5995 |
T5993 |
pobj |
study,in |
R3768 |
T5996 |
T5991 |
punct |
.,used |
R3769 |
T5998 |
T5999 |
amod |
Total,RNAs |
R3770 |
T5999 |
T6000 |
nsubjpass |
RNAs,analysed |
R3771 |
T6001 |
T5999 |
acl |
purified,RNAs |
R3772 |
T6002 |
T6001 |
prep |
from,purified |
R3773 |
T6003 |
T6004 |
det |
the,cerebellum |
R3774 |
T6004 |
T6002 |
pobj |
cerebellum,from |
R3775 |
T6005 |
T6004 |
punct |
", ",cerebellum |
R3776 |
T6006 |
T6007 |
amod |
spinal,cord |
R3777 |
T6007 |
T6004 |
conj |
cord,cerebellum |
R3778 |
T6008 |
T6007 |
punct |
", ",cord |
R3779 |
T6009 |
T6010 |
amod |
sciatic,nerve |
R3780 |
T6010 |
T6007 |
conj |
nerve,cord |
R3781 |
T6011 |
T6010 |
punct |
", ",nerve |
R3782 |
T6012 |
T6010 |
conj |
DRG,nerve |
R3783 |
T6013 |
T6012 |
cc |
and,DRG |
R3784 |
T6014 |
T6015 |
amod |
cultured,cells |
R3785 |
T6015 |
T6012 |
conj |
cells,DRG |
R3786 |
T6016 |
T6015 |
compound |
Schwann,cells |
R3787 |
T6017 |
T6001 |
advcl |
using,purified |
R3788 |
T6018 |
T6017 |
dobj |
TRIzol,using |
R3789 |
T6019 |
T6020 |
punct |
(,Corp. |
R3790 |
T6020 |
T6018 |
parataxis |
Corp.,TRIzol |
R3791 |
T6021 |
T6020 |
compound |
Invitrogen,Corp. |
R3792 |
T6022 |
T6020 |
punct |
),Corp. |
R3793 |
T6023 |
T6018 |
cc |
and,TRIzol |
R3794 |
T6024 |
T6025 |
compound |
RNeasy,kit |
R3795 |
T6025 |
T6018 |
conj |
kit,TRIzol |
R3796 |
T6026 |
T6027 |
punct |
(,GmbH |
R3797 |
T6027 |
T6025 |
parataxis |
GmbH,kit |
R3798 |
T6028 |
T6027 |
compound |
Qiagen,GmbH |
R3799 |
T6029 |
T6027 |
punct |
),GmbH |
R3800 |
T6030 |
T6000 |
auxpass |
were,analysed |
R3801 |
T6031 |
T6000 |
prep |
by,analysed |
R3802 |
T6032 |
T6033 |
compound |
RT,PCR |
R3803 |
T6033 |
T6031 |
pobj |
PCR,by |
R3804 |
T6034 |
T6033 |
punct |
-,PCR |
R3805 |
T6035 |
T6000 |
advcl |
using,analysed |
R3806 |
T6036 |
T6035 |
dobj |
SuperScript,using |
R3807 |
T6037 |
T6036 |
nummod |
II,SuperScript |
R3808 |
T6038 |
T6036 |
cc |
and,SuperScript |
R3809 |
T6039 |
T6040 |
amod |
random,primer |
R3810 |
T6040 |
T6036 |
conj |
primer,SuperScript |
R3811 |
T6041 |
T6042 |
punct |
(,Corp. |
R3812 |
T6042 |
T6040 |
parataxis |
Corp.,primer |
R3813 |
T6043 |
T6042 |
compound |
Invitrogen,Corp. |
R3814 |
T6044 |
T6042 |
punct |
),Corp. |
R3815 |
T6045 |
T6036 |
punct |
", ",SuperScript |
R3816 |
T6046 |
T6036 |
cc |
and,SuperScript |
R3817 |
T6047 |
T6048 |
compound |
PCR,amplification |
R3818 |
T6048 |
T6036 |
conj |
amplification,SuperScript |
R3819 |
T6049 |
T6050 |
punct |
(,°C |
R3820 |
T6050 |
T6048 |
parataxis |
°C,amplification |
R3821 |
T6051 |
T6052 |
nummod |
40,cycles |
R3822 |
T6052 |
T6050 |
dep |
cycles,°C |
R3823 |
T6053 |
T6050 |
punct |
;,°C |
R3824 |
T6054 |
T6050 |
nummod |
94,°C |
R3825 |
T6055 |
T6050 |
punct |
-,°C |
R3826 |
T6056 |
T6057 |
nummod |
30,s |
R3827 |
T6057 |
T6050 |
npadvmod |
s,°C |
R3828 |
T6058 |
T6050 |
punct |
", ",°C |
R3829 |
T6059 |
T6060 |
nummod |
60,°C |
R3830 |
T6060 |
T6050 |
conj |
°C,°C |
R3831 |
T6061 |
T6060 |
punct |
-,°C |
R3832 |
T6062 |
T6063 |
nummod |
30,s |
R3833 |
T6063 |
T6060 |
npadvmod |
s,°C |
R3834 |
T6064 |
T6060 |
cc |
and,°C |
R3835 |
T6065 |
T6066 |
nummod |
68,°C |
R3836 |
T6066 |
T6060 |
conj |
°C,°C |
R3837 |
T6067 |
T6066 |
punct |
-,°C |
R3838 |
T6068 |
T6069 |
nummod |
5,min |
R3839 |
T6069 |
T6066 |
npadvmod |
min,°C |
R3840 |
T6070 |
T6050 |
punct |
),°C |
R3841 |
T6071 |
T6048 |
prep |
with,amplification |
R3842 |
T6072 |
T6073 |
compound |
Expand,polymerase |
R3843 |
T6073 |
T6071 |
pobj |
polymerase,with |
R3844 |
T6074 |
T6075 |
compound |
Hi,Fidelity |
R3845 |
T6075 |
T6073 |
compound |
Fidelity,polymerase |
R3846 |
T6076 |
T6075 |
punct |
-,Fidelity |
R3847 |
T6077 |
T6073 |
compound |
DNA,polymerase |
R3848 |
T6078 |
T6079 |
punct |
(,Diagnostics |
R3849 |
T6079 |
T6073 |
parataxis |
Diagnostics,polymerase |
R3850 |
T6080 |
T6079 |
compound |
Roche,Diagnostics |
R3851 |
T6081 |
T6079 |
punct |
),Diagnostics |
R3852 |
T6082 |
T6073 |
cc |
and,polymerase |
R3853 |
T6083 |
T6084 |
npadvmod |
ADAM22,specific |
R3854 |
T6084 |
T6086 |
amod |
specific,primers |
R3855 |
T6085 |
T6084 |
punct |
-,specific |
R3856 |
T6086 |
T6073 |
conj |
primers,polymerase |
R3857 |
T6087 |
T6000 |
punct |
.,analysed |
R3858 |
T6089 |
T6090 |
aux |
To,detect |
R3859 |
T6090 |
T6091 |
advcl |
detect,placed |
R3860 |
T6092 |
T6093 |
compound |
splicing,variants |
R3861 |
T6093 |
T6090 |
dobj |
variants,detect |
R3862 |
T6094 |
T6090 |
prep |
in,detect |
R3863 |
T6095 |
T6096 |
det |
the,domain |
R3864 |
T6096 |
T6094 |
pobj |
domain,in |
R3865 |
T6097 |
T6096 |
amod |
cytoplasmic,domain |
R3866 |
T6098 |
T6091 |
punct |
", ",placed |
R3867 |
T6099 |
T6100 |
det |
a,primer |
R3868 |
T6100 |
T6091 |
nsubjpass |
primer,placed |
R3869 |
T6101 |
T6100 |
amod |
forward,primer |
R3870 |
T6102 |
T6091 |
auxpass |
was,placed |
R3871 |
T6103 |
T6104 |
advmod |
just,upstream |
R3872 |
T6104 |
T6091 |
advmod |
upstream,placed |
R3873 |
T6105 |
T6104 |
prep |
of,upstream |
R3874 |
T6106 |
T6107 |
det |
the,domain |
R3875 |
T6107 |
T6105 |
pobj |
domain,of |
R3876 |
T6108 |
T6107 |
amod |
transmembrane,domain |
R3877 |
T6109 |
T6091 |
cc |
and,placed |
R3878 |
T6110 |
T6111 |
det |
a,primer |
R3879 |
T6111 |
T6113 |
nsubjpass |
primer,set |
R3880 |
T6112 |
T6111 |
amod |
reverse,primer |
R3881 |
T6113 |
T6091 |
conj |
set,placed |
R3882 |
T6114 |
T6113 |
auxpass |
was,set |
R3883 |
T6115 |
T6113 |
prep |
on,set |
R3884 |
T6116 |
T6117 |
det |
the,exon |
R3885 |
T6117 |
T6115 |
pobj |
exon,on |
R3886 |
T6118 |
T6117 |
amod |
terminating,exon |
R3887 |
T6119 |
T6091 |
punct |
.,placed |
R3888 |
T6121 |
T6122 |
det |
The,primers |
R3889 |
T6122 |
T6123 |
nsubj |
primers,were |
R3890 |
T6124 |
T6122 |
acl |
used,primers |
R3891 |
T6125 |
T6124 |
prep |
in,used |
R3892 |
T6126 |
T6127 |
det |
this,study |
R3893 |
T6127 |
T6125 |
pobj |
study,in |
R3894 |
T6128 |
T6129 |
mark |
as,follows |
R3895 |
T6129 |
T6123 |
advcl |
follows,were |
R3896 |
T6130 |
T6123 |
punct |
.,were |
R3897 |
T6133 |
T6132 |
punct |
-,ISH04 |
R3898 |
T6134 |
T6132 |
amod |
forward,ISH04 |
R3899 |
T6135 |
T6132 |
punct |
: ,ISH04 |
R3900 |
T6136 |
T6137 |
nummod |
5,AACAGGCACTGGACAGGGGCTGAC |
R3901 |
T6137 |
T6132 |
appos |
AACAGGCACTGGACAGGGGCTGAC,ISH04 |
R3902 |
T6138 |
T6136 |
punct |
',5 |
R3903 |
T6139 |
T6137 |
punct |
-,AACAGGCACTGGACAGGGGCTGAC |
R3904 |
T6140 |
T6137 |
punct |
-,AACAGGCACTGGACAGGGGCTGAC |
R3905 |
T6141 |
T6137 |
nummod |
3,AACAGGCACTGGACAGGGGCTGAC |
R3906 |
T6142 |
T6137 |
punct |
',AACAGGCACTGGACAGGGGCTGAC |
R3907 |
T6143 |
T6132 |
cc |
and,ISH04 |
R3908 |
T6144 |
T6132 |
conj |
ISH04,ISH04 |
R3909 |
T6145 |
T6144 |
punct |
-,ISH04 |
R3910 |
T6146 |
T6144 |
amod |
reverse,ISH04 |
R3911 |
T6147 |
T6144 |
punct |
: ,ISH04 |
R3912 |
T6148 |
T6149 |
nummod |
5,AATGGATGTCTCCCATAGCCTGGC |
R3913 |
T6149 |
T6144 |
appos |
AATGGATGTCTCCCATAGCCTGGC,ISH04 |
R3914 |
T6150 |
T6148 |
punct |
',5 |
R3915 |
T6151 |
T6149 |
punct |
-,AATGGATGTCTCCCATAGCCTGGC |
R3916 |
T6152 |
T6149 |
punct |
-,AATGGATGTCTCCCATAGCCTGGC |
R3917 |
T6153 |
T6149 |
nummod |
3,AATGGATGTCTCCCATAGCCTGGC |
R3918 |
T6154 |
T6149 |
punct |
',AATGGATGTCTCCCATAGCCTGGC |
R3919 |
T6155 |
T6144 |
punct |
.,ISH04 |