craft-sa-dev Home  

PMC:1064854 / 57609-59189 JSONTXT 6 Projects

Annnotations TAB TSV DIC JSON TextAE

Id Subject Object Predicate Lexical cue
T34077 0-1 DT denotes A
T34079 2-5 NN denotes BAC
T34080 6-13 JJ denotes genomic
T34078 14-19 NN denotes clone
T34082 20-30 VBG denotes containing
T34083 31-34 DT denotes the
T34085 35-41 JJ denotes murine
T34086 42-45 NN denotes PGC
T34088 45-46 HYPH denotes -
T34087 46-48 NN denotes 1α
T34084 49-53 NN denotes gene
T34089 53-55 , denotes ,
T34090 55-63 VBN denotes isolated
T34091 64-68 IN denotes from
T34092 69-71 DT denotes an
T34094 72-77 NN denotes Sv129
T34095 78-85 JJ denotes genomic
T34093 86-93 NN denotes library
T34096 93-95 , denotes ,
T34097 95-98 VBD denotes was
T34081 99-107 VBN denotes obtained
T34098 108-112 IN denotes from
T34099 113-119 NNP denotes Incyte
T34100 120-128 NNP denotes Genomics
T34101 129-130 -LRB- denotes (
T34103 130-134 NNP denotes Palo
T34102 135-139 NNP denotes Alto
T34104 139-141 , denotes ,
T34105 141-151 NNP denotes California
T34106 151-153 , denotes ,
T34107 153-159 NNP denotes United
T34108 160-166 NNP denotes States
T34109 166-167 -RRB- denotes )
T34110 167-168 . denotes .
T34111 168-236 sentence denotes A 3-kb region spanning exon 3 was amplified from the genomic clone.
T34112 169-170 DT denotes A
T34114 171-172 CD denotes 3
T34116 172-173 HYPH denotes -
T34115 173-175 NN denotes kb
T34113 176-182 NN denotes region
T34118 183-191 VBG denotes spanning
T34119 192-196 NN denotes exon
T34120 197-198 CD denotes 3
T34121 199-202 VBD denotes was
T34117 203-212 VBN denotes amplified
T34122 213-217 IN denotes from
T34123 218-221 DT denotes the
T34125 222-229 JJ denotes genomic
T34124 230-235 NN denotes clone
T34126 235-236 . denotes .
T34127 236-420 sentence denotes A 5′ primer was designed to amplify a fragment with the 5′ end beginning 732 bp upstream of exon 3 just upstream of an endogenous Kpn1 restriction site (5′- AGTTTCCTTAGCAACTTCATA-3′).
T34128 237-238 DT denotes A
T34130 239-240 CD denotes 5
T34131 240-241 SYM denotes ′
T34129 242-248 NN denotes primer
T34133 249-252 VBD denotes was
T34132 253-261 VBN denotes designed
T34134 262-264 TO denotes to
T34135 265-272 VB denotes amplify
T34136 273-274 DT denotes a
T34137 275-283 NN denotes fragment
T34138 284-288 IN denotes with
T34139 289-292 DT denotes the
T34141 293-294 CD denotes 5
T34142 294-295 SYM denotes ′
T34140 296-299 NN denotes end
T34143 300-309 VBG denotes beginning
T34144 310-313 CD denotes 732
T34145 314-316 NN denotes bp
T34146 317-325 RB denotes upstream
T34147 326-328 IN denotes of
T34148 329-333 NN denotes exon
T34149 334-335 CD denotes 3
T34150 336-340 RB denotes just
T34151 341-349 RB denotes upstream
T34152 350-352 IN denotes of
T34153 353-355 DT denotes an
T34155 356-366 JJ denotes endogenous
T34156 367-371 NN denotes Kpn1
T34157 372-383 NN denotes restriction
T34154 384-388 NN denotes site
T34158 389-390 -LRB- denotes (
T34160 390-391 CD denotes 5
T34161 391-392 SYM denotes ′
T34162 392-393 HYPH denotes -
T34159 394-415 NN denotes AGTTTCCTTAGCAACTTCATA
T34163 415-416 HYPH denotes -
T34164 416-417 CD denotes 3
T34165 417-418 SYM denotes ′
T34166 418-419 -RRB- denotes )
T34167 419-420 . denotes .
T34168 420-543 sentence denotes The 3′ primer contained a BamH1 site engineered by mutating the bases shown in lowercase (5′- AAGGATTTTAgGATcc CAGTAC-3′).
T34169 421-424 DT denotes The
T34171 425-426 CD denotes 3
T34172 426-427 SYM denotes ′
T34170 428-434 NN denotes primer
T34173 435-444 VBD denotes contained
T34174 445-446 DT denotes a
T34176 447-452 NN denotes BamH1
T34175 453-457 NN denotes site
T34177 458-468 VBN denotes engineered
T34178 469-471 IN denotes by
T34179 472-480 VBG denotes mutating
T34180 481-484 DT denotes the
T34181 485-490 NNS denotes bases
T34182 491-496 VBN denotes shown
T34183 497-499 IN denotes in
T34184 500-509 NN denotes lowercase
T34185 510-511 -LRB- denotes (
T34187 511-512 CD denotes 5
T34188 512-513 SYM denotes ′
T34189 513-514 HYPH denotes -
T34186 515-538 NN denotes AAGGATTTTAgGATcc CAGTAC
T34190 538-539 HYPH denotes -
T34191 539-540 CD denotes 3
T34192 540-541 SYM denotes ′
T34193 541-542 -RRB- denotes )
T34194 542-543 . denotes .
T34195 543-597 sentence denotes A second fragment downstream of exon 5 was amplified.
T34196 544-545 DT denotes A
T34198 546-552 JJ denotes second
T34197 553-561 NN denotes fragment
T34200 562-572 RB denotes downstream
T34201 573-575 IN denotes of
T34202 576-580 NN denotes exon
T34203 581-582 CD denotes 5
T34204 583-586 VBD denotes was
T34199 587-596 VBN denotes amplified
T34205 596-597 . denotes .
T34206 597-766 sentence denotes In this latter amplicon, Not1 and Xho1 sites were engineered into the 5′ and 3′ primers, respectively (5′- TGGAGTgc GGCCGCTGGGA-3′ and 5′- AAAGAGTCTCgAg AATAGTTTCT-3′).
T34207 598-600 IN denotes In
T34209 601-605 DT denotes this
T34211 606-612 JJ denotes latter
T34210 613-621 NN denotes amplicon
T34212 621-623 , denotes ,
T34213 623-627 NN denotes Not1
T34215 628-631 CC denotes and
T34216 632-636 NN denotes Xho1
T34214 637-642 NNS denotes sites
T34217 643-647 VBD denotes were
T34208 648-658 VBN denotes engineered
T34218 659-663 IN denotes into
T34219 664-667 DT denotes the
T34220 668-669 CD denotes 5
T34222 669-670 SYM denotes ′
T34223 671-674 CC denotes and
T34224 675-676 CD denotes 3
T34225 676-677 SYM denotes ′
T34221 678-685 NNS denotes primers
T34226 685-687 , denotes ,
T34227 687-699 RB denotes respectively
T34228 700-701 -LRB- denotes (
T34230 701-702 CD denotes 5
T34231 702-703 SYM denotes ′
T34232 703-704 HYPH denotes -
T34229 705-725 NN denotes TGGAGTgc GGCCGCTGGGA
T34233 725-726 HYPH denotes -
T34234 726-727 CD denotes 3
T34235 727-728 SYM denotes ′
T34236 729-732 CC denotes and
T34237 733-734 CD denotes 5
T34239 734-735 SYM denotes ′
T34240 735-736 HYPH denotes -
T34238 737-761 NN denotes AAAGAGTCTCgAg AATAGTTTCT
T34241 761-762 HYPH denotes -
T34242 762-763 CD denotes 3
T34243 763-764 SYM denotes ′
T34244 764-765 -RRB- denotes )
T34245 765-766 . denotes .
T34246 766-834 sentence denotes The fragments were cloned into p1339-PGK-Neomycin targeting vector.
T34247 767-770 DT denotes The
T34248 771-780 NNS denotes fragments
T34250 781-785 VBD denotes were
T34249 786-792 VBN denotes cloned
T34251 793-797 IN denotes into
T34252 798-803 NN denotes p1339
T34254 803-804 HYPH denotes -
T34255 804-807 NN denotes PGK
T34256 807-808 HYPH denotes -
T34253 808-816 NN denotes Neomycin
T34258 817-826 NN denotes targeting
T34257 827-833 NN denotes vector
T34259 833-834 . denotes .
T34260 834-948 sentence denotes The construct was linearized with Xho1 and electroporated into RW4 ES cells (Sv129 derived) using G418 selection.
T34261 835-838 DT denotes The
T34262 839-848 NN denotes construct
T34264 849-852 VBD denotes was
T34263 853-863 VBN denotes linearized
T34265 864-868 IN denotes with
T34266 869-873 NN denotes Xho1
T34267 874-877 CC denotes and
T34268 878-892 VBN denotes electroporated
T34269 893-897 IN denotes into
T34270 898-901 NN denotes RW4
T34272 902-904 NN denotes ES
T34271 905-910 NNS denotes cells
T34273 911-912 -LRB- denotes (
T34274 912-917 NN denotes Sv129
T34275 918-925 VBN denotes derived
T34276 925-926 -RRB- denotes )
T34277 927-932 VBG denotes using
T34278 933-937 NN denotes G418
T34279 938-947 NN denotes selection
T34280 947-948 . denotes .
T34281 948-1087 sentence denotes The electroporation was performed by the Siteman Cancer Center ES Cell Core at Washington University (St. Louis, Missouri, United States).
T34282 949-952 DT denotes The
T34283 953-968 NN denotes electroporation
T34285 969-972 VBD denotes was
T34284 973-982 VBN denotes performed
T34286 983-985 IN denotes by
T34287 986-989 DT denotes the
T34289 990-997 NNP denotes Siteman
T34291 998-1004 NNP denotes Cancer
T34290 1005-1011 NNP denotes Center
T34292 1012-1014 NNP denotes ES
T34293 1015-1019 NNP denotes Cell
T34288 1020-1024 NNP denotes Core
T34294 1025-1027 IN denotes at
T34295 1028-1038 NNP denotes Washington
T34296 1039-1049 NNP denotes University
T34297 1050-1051 -LRB- denotes (
T34299 1051-1054 NNP denotes St.
T34298 1055-1060 NNP denotes Louis
T34300 1060-1062 , denotes ,
T34301 1062-1070 NNP denotes Missouri
T34302 1070-1072 , denotes ,
T34303 1072-1078 NNP denotes United
T34304 1079-1085 NNP denotes States
T34305 1085-1086 -RRB- denotes )
T34306 1086-1087 . denotes .
T34307 1087-1174 sentence denotes The clones were screened by Southern blot using an Xba1 digest (see Figure 1A and 1B).
T34308 1088-1091 DT denotes The
T34309 1092-1098 NNS denotes clones
T34311 1099-1103 VBD denotes were
T34310 1104-1112 VBN denotes screened
T34312 1113-1115 IN denotes by
T34313 1116-1124 NNP denotes Southern
T34314 1125-1129 NN denotes blot
T34315 1130-1135 VBG denotes using
T34316 1136-1138 DT denotes an
T34318 1139-1143 NN denotes Xba1
T34317 1144-1150 NN denotes digest
T34319 1151-1152 -LRB- denotes (
T34320 1152-1155 VB denotes see
T34321 1156-1162 NN denotes Figure
T34322 1163-1165 NN denotes 1A
T34323 1166-1169 CC denotes and
T34324 1170-1172 NN denotes 1B
T34325 1172-1173 -RRB- denotes )
T34326 1173-1174 . denotes .
T34327 1174-1310 sentence denotes One clone out of approximately 400 screened was positive for the homologous recombination on the 3′ end and an insertion on the 5′ end.
T34328 1175-1178 CD denotes One
T34329 1179-1184 NN denotes clone
T34331 1185-1188 IN denotes out
T34332 1189-1191 IN denotes of
T34333 1192-1205 RB denotes approximately
T34334 1206-1209 CD denotes 400
T34335 1210-1218 VBN denotes screened
T34330 1219-1222 VBD denotes was
T34336 1223-1231 JJ denotes positive
T34337 1232-1235 IN denotes for
T34338 1236-1239 DT denotes the
T34340 1240-1250 JJ denotes homologous
T34339 1251-1264 NN denotes recombination
T34341 1265-1267 IN denotes on
T34342 1268-1271 DT denotes the
T34344 1272-1273 CD denotes 3
T34345 1273-1274 SYM denotes ′
T34343 1275-1278 NN denotes end
T34346 1279-1282 CC denotes and
T34347 1283-1285 DT denotes an
T34348 1286-1295 NN denotes insertion
T34349 1296-1298 IN denotes on
T34350 1299-1302 DT denotes the
T34352 1303-1304 CD denotes 5
T34353 1304-1305 SYM denotes ′
T34351 1306-1309 NN denotes end
T34354 1309-1310 . denotes .
T34355 1310-1362 sentence denotes This clone was injected into a C57BL6/J blastocyst.
T34356 1311-1315 DT denotes This
T34357 1316-1321 NN denotes clone
T34359 1322-1325 VBD denotes was
T34358 1326-1334 VBN denotes injected
T34360 1335-1339 IN denotes into
T34361 1340-1341 DT denotes a
T34363 1342-1348 NN denotes C57BL6
T34365 1348-1349 HYPH denotes /
T34364 1349-1350 NN denotes J
T34362 1351-1361 NN denotes blastocyst
T34366 1361-1362 . denotes .
T34367 1362-1489 sentence denotes Chimeras were mated to C57BL6/J mice and germline transmission was confirmed by Southern blotting of tail DNA (see Figure 1B).
T34368 1363-1371 NNS denotes Chimeras
T34370 1372-1376 VBD denotes were
T34369 1377-1382 VBN denotes mated
T34371 1383-1385 IN denotes to
T34372 1386-1392 NN denotes C57BL6
T34374 1392-1393 HYPH denotes /
T34373 1393-1394 NN denotes J
T34375 1395-1399 NNS denotes mice
T34376 1400-1403 CC denotes and
T34377 1404-1412 NN denotes germline
T34378 1413-1425 NN denotes transmission
T34380 1426-1429 VBD denotes was
T34379 1430-1439 VBN denotes confirmed
T34381 1440-1442 IN denotes by
T34382 1443-1451 NNP denotes Southern
T34383 1452-1460 NN denotes blotting
T34384 1461-1463 IN denotes of
T34385 1464-1468 NN denotes tail
T34386 1469-1472 NN denotes DNA
T34387 1473-1474 -LRB- denotes (
T34388 1474-1477 VB denotes see
T34389 1478-1484 NN denotes Figure
T34390 1485-1487 NN denotes 1B
T34391 1487-1488 -RRB- denotes )
T34392 1488-1489 . denotes .
T34393 1489-1580 sentence denotes All experiments were performed using sex- and age-matched or littermate controls as noted.
T34394 1490-1493 DT denotes All
T34395 1494-1505 NNS denotes experiments
T34397 1506-1510 VBD denotes were
T34396 1511-1520 VBN denotes performed
T34398 1521-1526 VBG denotes using
T34399 1527-1530 NN denotes sex
T34401 1530-1531 HYPH denotes -
T34402 1532-1535 CC denotes and
T34403 1536-1539 NN denotes age
T34404 1539-1540 HYPH denotes -
T34400 1540-1547 VBN denotes matched
T34406 1548-1550 CC denotes or
T34407 1551-1561 NN denotes littermate
T34405 1562-1570 NNS denotes controls
T34408 1571-1573 IN denotes as
T34409 1574-1579 VBN denotes noted
T34410 1579-1580 . denotes .
R8694 T34077 T34078 det A,clone
R8695 T34078 T34081 nsubjpass clone,obtained
R8696 T34079 T34078 nmod BAC,clone
R8697 T34080 T34078 amod genomic,clone
R8698 T34082 T34078 acl containing,clone
R8699 T34083 T34084 det the,gene
R8700 T34084 T34082 dobj gene,containing
R8701 T34085 T34084 amod murine,gene
R8702 T34086 T34087 compound PGC,1α
R8703 T34087 T34084 compound 1α,gene
R8704 T34088 T34087 punct -,1α
R8705 T34089 T34084 punct ", ",gene
R8706 T34090 T34084 acl isolated,gene
R8707 T34091 T34090 prep from,isolated
R8708 T34092 T34093 det an,library
R8709 T34093 T34091 pobj library,from
R8710 T34094 T34093 nmod Sv129,library
R8711 T34095 T34093 amod genomic,library
R8712 T34096 T34081 punct ", ",obtained
R8713 T34097 T34081 auxpass was,obtained
R8714 T34098 T34081 prep from,obtained
R8715 T34099 T34100 compound Incyte,Genomics
R8716 T34100 T34098 pobj Genomics,from
R8717 T34101 T34102 punct (,Alto
R8718 T34102 T34100 parataxis Alto,Genomics
R8719 T34103 T34102 compound Palo,Alto
R8720 T34104 T34102 punct ", ",Alto
R8721 T34105 T34102 npadvmod California,Alto
R8722 T34106 T34102 punct ", ",Alto
R8723 T34107 T34108 compound United,States
R8724 T34108 T34102 npadvmod States,Alto
R8725 T34109 T34102 punct ),Alto
R8726 T34110 T34081 punct .,obtained
R8727 T34112 T34113 det A,region
R8728 T34113 T34117 nsubjpass region,amplified
R8729 T34114 T34115 nummod 3,kb
R8730 T34115 T34113 compound kb,region
R8731 T34116 T34115 punct -,kb
R8732 T34118 T34113 acl spanning,region
R8733 T34119 T34118 dobj exon,spanning
R8734 T34120 T34119 nummod 3,exon
R8735 T34121 T34117 auxpass was,amplified
R8736 T34122 T34117 prep from,amplified
R8737 T34123 T34124 det the,clone
R8738 T34124 T34122 pobj clone,from
R8739 T34125 T34124 amod genomic,clone
R8740 T34126 T34117 punct .,amplified
R8741 T34128 T34129 det A,primer
R8742 T34129 T34132 nsubjpass primer,designed
R8743 T34130 T34129 nummod 5,primer
R8744 T34131 T34130 punct ′,5
R8745 T34133 T34132 auxpass was,designed
R8746 T34134 T34135 aux to,amplify
R8747 T34135 T34132 advcl amplify,designed
R8748 T34136 T34137 det a,fragment
R8749 T34137 T34135 dobj fragment,amplify
R8750 T34138 T34137 prep with,fragment
R8751 T34139 T34140 det the,end
R8752 T34140 T34143 nsubj end,beginning
R8753 T34141 T34140 nummod 5,end
R8754 T34142 T34141 punct ′,5
R8755 T34143 T34138 pcomp beginning,with
R8756 T34144 T34145 nummod 732,bp
R8757 T34145 T34146 npadvmod bp,upstream
R8758 T34146 T34143 advmod upstream,beginning
R8759 T34147 T34146 prep of,upstream
R8760 T34148 T34147 pobj exon,of
R8761 T34149 T34148 nummod 3,exon
R8762 T34150 T34151 advmod just,upstream
R8763 T34151 T34143 advmod upstream,beginning
R8764 T34152 T34151 prep of,upstream
R8765 T34153 T34154 det an,site
R8766 T34154 T34152 pobj site,of
R8767 T34155 T34154 amod endogenous,site
R8768 T34156 T34154 compound Kpn1,site
R8769 T34157 T34154 compound restriction,site
R8770 T34158 T34159 punct (,AGTTTCCTTAGCAACTTCATA
R8771 T34159 T34154 parataxis AGTTTCCTTAGCAACTTCATA,site
R8772 T34160 T34159 nummod 5,AGTTTCCTTAGCAACTTCATA
R8773 T34161 T34160 punct ′,5
R8774 T34162 T34159 punct -,AGTTTCCTTAGCAACTTCATA
R8775 T34163 T34159 punct -,AGTTTCCTTAGCAACTTCATA
R8776 T34164 T34159 nummod 3,AGTTTCCTTAGCAACTTCATA
R8777 T34165 T34159 punct ′,AGTTTCCTTAGCAACTTCATA
R8778 T34166 T34159 punct ),AGTTTCCTTAGCAACTTCATA
R8779 T34167 T34132 punct .,designed
R8780 T34169 T34170 det The,primer
R8781 T34170 T34173 nsubj primer,contained
R8782 T34171 T34170 nummod 3,primer
R8783 T34172 T34171 punct ′,3
R8784 T34174 T34175 det a,site
R8785 T34175 T34173 dobj site,contained
R8786 T34176 T34175 compound BamH1,site
R8787 T34177 T34175 acl engineered,site
R8788 T34178 T34177 prep by,engineered
R8789 T34179 T34178 pcomp mutating,by
R8790 T34180 T34181 det the,bases
R8791 T34181 T34179 dobj bases,mutating
R8792 T34182 T34181 acl shown,bases
R8793 T34183 T34182 prep in,shown
R8794 T34184 T34183 pobj lowercase,in
R8795 T34185 T34186 punct (,AAGGATTTTAgGATcc CAGTAC
R8796 T34186 T34175 parataxis AAGGATTTTAgGATcc CAGTAC,site
R8797 T34187 T34186 nummod 5,AAGGATTTTAgGATcc CAGTAC
R8798 T34188 T34187 punct ′,5
R8799 T34189 T34186 punct -,AAGGATTTTAgGATcc CAGTAC
R8800 T34190 T34186 punct -,AAGGATTTTAgGATcc CAGTAC
R8801 T34191 T34186 nummod 3,AAGGATTTTAgGATcc CAGTAC
R8802 T34192 T34186 punct ′,AAGGATTTTAgGATcc CAGTAC
R8803 T34193 T34186 punct ),AAGGATTTTAgGATcc CAGTAC
R8804 T34194 T34173 punct .,contained
R8805 T34196 T34197 det A,fragment
R8806 T34197 T34199 nsubjpass fragment,amplified
R8807 T34198 T34197 amod second,fragment
R8808 T34200 T34197 advmod downstream,fragment
R8809 T34201 T34200 prep of,downstream
R8810 T34202 T34201 pobj exon,of
R8811 T34203 T34202 nummod 5,exon
R8812 T34204 T34199 auxpass was,amplified
R8813 T34205 T34199 punct .,amplified
R8814 T34207 T34208 prep In,engineered
R8815 T34209 T34210 det this,amplicon
R8816 T34210 T34207 pobj amplicon,In
R8817 T34211 T34210 amod latter,amplicon
R8818 T34212 T34208 punct ", ",engineered
R8819 T34213 T34214 nmod Not1,sites
R8820 T34214 T34208 nsubjpass sites,engineered
R8821 T34215 T34213 cc and,Not1
R8822 T34216 T34213 conj Xho1,Not1
R8823 T34217 T34208 auxpass were,engineered
R8824 T34218 T34208 prep into,engineered
R8825 T34219 T34220 det the,5
R8826 T34220 T34221 nummod 5,primers
R8827 T34221 T34218 pobj primers,into
R8828 T34222 T34220 punct ′,5
R8829 T34223 T34220 cc and,5
R8830 T34224 T34220 conj 3,5
R8831 T34225 T34224 punct ′,3
R8832 T34226 T34208 punct ", ",engineered
R8833 T34227 T34208 advmod respectively,engineered
R8834 T34228 T34229 punct (,TGGAGTgc GGCCGCTGGGA
R8835 T34229 T34208 parataxis TGGAGTgc GGCCGCTGGGA,engineered
R8836 T34230 T34229 nummod 5,TGGAGTgc GGCCGCTGGGA
R8837 T34231 T34230 punct ′,5
R8838 T34232 T34229 punct -,TGGAGTgc GGCCGCTGGGA
R8839 T34233 T34229 punct -,TGGAGTgc GGCCGCTGGGA
R8840 T34234 T34229 nummod 3,TGGAGTgc GGCCGCTGGGA
R8841 T34235 T34229 punct ′,TGGAGTgc GGCCGCTGGGA
R8842 T34236 T34229 cc and,TGGAGTgc GGCCGCTGGGA
R8843 T34237 T34238 nummod 5,AAAGAGTCTCgAg AATAGTTTCT
R8844 T34238 T34229 conj AAAGAGTCTCgAg AATAGTTTCT,TGGAGTgc GGCCGCTGGGA
R8845 T34239 T34237 punct ′,5
R8846 T34240 T34238 punct -,AAAGAGTCTCgAg AATAGTTTCT
R8847 T34241 T34238 punct -,AAAGAGTCTCgAg AATAGTTTCT
R8848 T34242 T34238 nummod 3,AAAGAGTCTCgAg AATAGTTTCT
R8849 T34243 T34238 punct ′,AAAGAGTCTCgAg AATAGTTTCT
R8850 T34244 T34229 punct ),TGGAGTgc GGCCGCTGGGA
R8851 T34245 T34208 punct .,engineered
R8852 T34247 T34248 det The,fragments
R8853 T34248 T34249 nsubjpass fragments,cloned
R8854 T34250 T34249 auxpass were,cloned
R8855 T34251 T34249 prep into,cloned
R8856 T34252 T34253 compound p1339,Neomycin
R8857 T34253 T34257 compound Neomycin,vector
R8858 T34254 T34253 punct -,Neomycin
R8859 T34255 T34253 compound PGK,Neomycin
R8860 T34256 T34253 punct -,Neomycin
R8861 T34257 T34251 pobj vector,into
R8862 T34258 T34257 compound targeting,vector
R8863 T34259 T34249 punct .,cloned
R8864 T34261 T34262 det The,construct
R8865 T34262 T34263 nsubjpass construct,linearized
R8866 T34264 T34263 auxpass was,linearized
R8867 T34265 T34263 prep with,linearized
R8868 T34266 T34265 pobj Xho1,with
R8869 T34267 T34263 cc and,linearized
R8870 T34268 T34263 conj electroporated,linearized
R8871 T34269 T34268 prep into,electroporated
R8872 T34270 T34271 compound RW4,cells
R8873 T34271 T34269 pobj cells,into
R8874 T34272 T34271 compound ES,cells
R8875 T34273 T34271 punct (,cells
R8876 T34274 T34275 npadvmod Sv129,derived
R8877 T34275 T34271 amod derived,cells
R8878 T34276 T34268 punct ),electroporated
R8879 T34277 T34268 advcl using,electroporated
R8880 T34278 T34279 compound G418,selection
R8881 T34279 T34277 dobj selection,using
R8882 T34280 T34263 punct .,linearized
R8883 T34282 T34283 det The,electroporation
R8884 T34283 T34284 nsubjpass electroporation,performed
R8885 T34285 T34284 auxpass was,performed
R8886 T34286 T34284 agent by,performed
R8887 T34287 T34288 det the,Core
R8888 T34288 T34286 pobj Core,by
R8889 T34289 T34290 compound Siteman,Center
R8890 T34290 T34288 compound Center,Core
R8891 T34291 T34290 compound Cancer,Center
R8892 T34292 T34293 compound ES,Cell
R8893 T34293 T34288 compound Cell,Core
R8894 T34294 T34288 prep at,Core
R8895 T34295 T34296 compound Washington,University
R8896 T34296 T34294 pobj University,at
R8897 T34297 T34298 punct (,Louis
R8898 T34298 T34296 parataxis Louis,University
R8899 T34299 T34298 compound St.,Louis
R8900 T34300 T34298 punct ", ",Louis
R8901 T34301 T34298 npadvmod Missouri,Louis
R8902 T34302 T34298 punct ", ",Louis
R8903 T34303 T34304 compound United,States
R8904 T34304 T34298 npadvmod States,Louis
R8905 T34305 T34298 punct ),Louis
R8906 T34306 T34284 punct .,performed
R8907 T34308 T34309 det The,clones
R8908 T34309 T34310 nsubjpass clones,screened
R8909 T34311 T34310 auxpass were,screened
R8910 T34312 T34310 prep by,screened
R8911 T34313 T34314 compound Southern,blot
R8912 T34314 T34312 pobj blot,by
R8913 T34315 T34310 advcl using,screened
R8914 T34316 T34317 det an,digest
R8915 T34317 T34315 dobj digest,using
R8916 T34318 T34317 compound Xba1,digest
R8917 T34319 T34320 punct (,see
R8918 T34320 T34310 parataxis see,screened
R8919 T34321 T34322 compound Figure,1A
R8920 T34322 T34320 dobj 1A,see
R8921 T34323 T34322 cc and,1A
R8922 T34324 T34322 conj 1B,1A
R8923 T34325 T34320 punct ),see
R8924 T34326 T34310 punct .,screened
R8925 T34328 T34329 nummod One,clone
R8926 T34329 T34330 nsubj clone,was
R8927 T34331 T34329 prep out,clone
R8928 T34332 T34331 prep of,out
R8929 T34333 T34334 advmod approximately,400
R8930 T34334 T34332 pobj 400,of
R8931 T34335 T34334 acl screened,400
R8932 T34336 T34330 acomp positive,was
R8933 T34337 T34336 prep for,positive
R8934 T34338 T34339 det the,recombination
R8935 T34339 T34337 pobj recombination,for
R8936 T34340 T34339 amod homologous,recombination
R8937 T34341 T34339 prep on,recombination
R8938 T34342 T34343 det the,end
R8939 T34343 T34341 pobj end,on
R8940 T34344 T34343 nummod 3,end
R8941 T34345 T34344 punct ′,3
R8942 T34346 T34339 cc and,recombination
R8943 T34347 T34348 det an,insertion
R8944 T34348 T34339 conj insertion,recombination
R8945 T34349 T34348 prep on,insertion
R8946 T34350 T34351 det the,end
R8947 T34351 T34349 pobj end,on
R8948 T34352 T34351 nummod 5,end
R8949 T34353 T34352 punct ′,5
R8950 T34354 T34330 punct .,was
R8951 T34356 T34357 det This,clone
R8952 T34357 T34358 nsubjpass clone,injected
R8953 T34359 T34358 auxpass was,injected
R8954 T34360 T34358 prep into,injected
R8955 T34361 T34362 det a,blastocyst
R8956 T34362 T34360 pobj blastocyst,into
R8957 T34363 T34364 compound C57BL6,J
R8958 T34364 T34362 compound J,blastocyst
R8959 T34365 T34364 punct /,J
R8960 T34366 T34358 punct .,injected
R8961 T34368 T34369 nsubjpass Chimeras,mated
R8962 T34370 T34369 auxpass were,mated
R8963 T34371 T34369 prep to,mated
R8964 T34372 T34373 compound C57BL6,J
R8965 T34373 T34375 compound J,mice
R8966 T34374 T34373 punct /,J
R8967 T34375 T34371 pobj mice,to
R8968 T34376 T34369 cc and,mated
R8969 T34377 T34378 compound germline,transmission
R8970 T34378 T34379 nsubjpass transmission,confirmed
R8971 T34379 T34369 conj confirmed,mated
R8972 T34380 T34379 auxpass was,confirmed
R8973 T34381 T34379 prep by,confirmed
R8974 T34382 T34383 compound Southern,blotting
R8975 T34383 T34381 pobj blotting,by
R8976 T34384 T34383 prep of,blotting
R8977 T34385 T34386 compound tail,DNA
R8978 T34386 T34384 pobj DNA,of
R8979 T34387 T34388 punct (,see
R8980 T34388 T34379 parataxis see,confirmed
R8981 T34389 T34390 compound Figure,1B
R8982 T34390 T34388 dobj 1B,see
R8983 T34391 T34388 punct ),see
R8984 T34392 T34379 punct .,confirmed
R8985 T34394 T34395 det All,experiments
R8986 T34395 T34396 nsubjpass experiments,performed
R8987 T34397 T34396 auxpass were,performed
R8988 T34398 T34396 advcl using,performed
R8989 T34399 T34400 npadvmod sex,matched
R8990 T34400 T34405 amod matched,controls
R8991 T34401 T34399 punct -,sex
R8992 T34402 T34399 cc and,sex
R8993 T34403 T34399 conj age,sex
R8994 T34404 T34400 punct -,matched
R8995 T34405 T34398 dobj controls,using
R8996 T34406 T34400 cc or,matched
R8997 T34407 T34400 conj littermate,matched
R8998 T34408 T34409 mark as,noted
R8999 T34409 T34396 advcl noted,performed
R9000 T34410 T34396 punct .,performed