bionlp-st-ge-2016-test-ihmc

PMC:3585731 JSON TXT 30 Projects

Annnotations TAB TSV DIC JSON TextAE

Id	Subject	Object	Predicate	Lexical cue	Negation	Speculation
T728	0-3	Protein	denotes	Akt
T744	14-17	Protein	denotes	TNF
T753	43-47	Protein	denotes	RIP1
T741	43-54	Protein	denotes	RIP1 Kinase
T765	43-84	Positive_regulation	denotes	RIP1 Kinase Activation during Necroptosis
T748	415-487	Protein	denotes	by the necroptosis mediator receptor interacting protein-1 (RIP1) kinase
T736	443-480	Protein	denotes	receptor interacting protein-1 (RIP1)
T746	475-479	Protein	denotes	RIP1
T743	502-505	Protein	denotes	Akt
T742	502-512	Protein	denotes	Akt kinase
T734	588-592	Protein	denotes	TNFα
T764	588-603	Gene_expression	denotes	TNFα production
T758	605-707	Phosphorylation	denotes	During necroptosis, Akt is activated in a RIP1 dependent fashion through its phosphorylation on Thr308
T757	605-707	Positive_regulation	denotes	During necroptosis, Akt is activated in a RIP1 dependent fashion through its phosphorylation on Thr308
T729	625-628	Protein	denotes	Akt
T745	647-661	Protein	denotes	RIP1 dependent
T737	698-707	Entity	denotes	on Thr308
T760	709-811	Regulation	denotes	In L929 cells, this activation requires independent signaling inputs from both growth factors and RIP1
T732	807-811	Protein	denotes	RIP1
T733	813-816	Protein	denotes	Akt
T735	870-899	Protein	denotes	mammalian Target of Rapamycin
T730	900-918	Entity	denotes	complex 1 (mTORC1)
T738	911-917	Entity	denotes	mTORC1
T750	920-923	Protein	denotes	Akt
T751	959-965	Entity	denotes	mTORC1
T763	959-1028	Binding	denotes	mTORC1, links RIP1 to JNK activation and autocrine production of TNFα
T752	973-977	Protein	denotes	RIP1
T740	981-984	Protein	denotes	JNK
T762	981-995	Positive_regulation	denotes	JNK activation
T761	1000-1028	Gene_expression	denotes	autocrine production of TNFα
T756	1021-1028	Protein	denotes	of TNFα
T731	1033-1058	Entity	denotes	other cell types, such as
T739	1033-1081	Entity	denotes	other cell types, such as mouse lung fibroblasts
T755	1086-1098	Entity	denotes	macrophages,
T749	1099-1102	Protein	denotes	Akt
T759	1126-1164	Gene_expression	denotes	necroptosis-associated TNFα production
T747	1149-1153	Protein	denotes	TNFα
T754	1290-1303	Protein	denotes	of Akt kinase
T727	1293-1296	Protein	denotes	Akt
T2758	1601-1708	Entity	denotes	retinal ischemia-reperfusion injury, acute pancreatitis, brain trauma, retinal detachment, and Huntington’s
T2805	1768-1786	Binding	denotes	linked necroptosis
T2779	2079-2088	Entity	denotes	A complex
T2745	2115-2122	Entity	denotes	Ser/Thr
T2742	2115-2122	Entity	denotes	Ser/Thr
T2776	2115-2146	Protein	denotes	Ser/Thr kinases, RIP1 and RIP3,
T2783	2119-2122	Entity	denotes	Thr
T2729	2132-2136	Protein	denotes	RIP1
T2732	2141-2145	Protein	denotes	RIP3
T2762	2308-2345	Entity	denotes	by the pan-caspase inhibitor zVAD.fmk
T2737	2308-2345	Protein	denotes	by the pan-caspase inhibitor zVAD.fmk
T2756	2327-2336	Entity	denotes	inhibitor
T2780	2349-2378	Entity	denotes	mouse fibrosarcoma L929 cells
T2744	2349-2378	Entity	denotes	mouse fibrosarcoma L929 cells
T2736	2429-2474	Protein	denotes	432 genes that may regulate this process [10]
T2740	2757-2761	Protein	denotes	RIP1
T2775	2766-2770	Protein	denotes	RIP3
T2739	2869-2872	Protein	denotes	JNK
T2785	2869-2879	Protein	denotes	JNK kinase
T2799	2869-2890	Positive_regulation	denotes	JNK kinase activation
T2730	2964-2968	Protein	denotes	RIP1
T2760	2964-2975	Protein	denotes	RIP1 kinase
T2767	2990-3060	Protein	denotes	the transcription factor c-Jun, a key cellular target of JNK activity,
T2782	2994-3014	Protein	denotes	transcription factor
T2753	3047-3050	Protein	denotes	JNK
T2755	3102-3105	Protein	denotes	RNA
T2796	3119-3150	Positive_regulation	denotes	Activation of JNK in L929 cells
T2795	3119-3254	Binding	denotes	Activation of JNK in L929 cells has been linked to autocrine TNFα synthesis, activation of oxidative stress and induction of autophagy,
T2750	3130-3136	Protein	denotes	of JNK
T2733	3167-3254	Protein	denotes	to autocrine TNFα synthesis, activation of oxidative stress and induction of autophagy,
T7185	3308-3312	Protein	denotes	RIP1
T2771	3308-3312	Protein	denotes	RIP1
T7201	3308-10171	Protein	denotes	RIP1 kinase dependent activation of JNK and TNFα production has recently been described to be independent of its role in necroptosis [15]. Curiously, Akt kinase, a key pro-survival molecule and a well-established inhibitor of apoptotic cell death, has also recently been linked to necroptosis in L929 cells [16], where insulin-dependent activation of Akt was suggested to promote necroptosis by suppressing autophagy. This conclusion was unexpected, since several reports from different groups, including ours, have established that autophagy promotes, rather than suppresses, zVAD.fmk-induced necroptosis in L929 cells [11], [14], [17]. This raised the possibility that Akt controls more general mechanisms that contribute to the execution of necroptosis. Furthermore, the key question of whether insulin-dependent Akt activity solely provides an environment conducive for necroptosis or if Akt activation is an intrinsic component of necroptosis signaling that is linked to RIP1 kinase has not been explored. In this study, we expanded these observations to delineate the specific contributions and molecular ordering of the Akt and JNK pathways downstream from RIP1 kinase during necroptosis. Our data reveal that Akt is activated through RIP1 kinase-dependent Thr308 phosphorylation during necroptosis in multiple cell types. Furthermore, we found that downstream Akt signaling through mTORC1 and S6 contributes to the activation of necroptosis and TNFα production. We found that the Akt pathway serves as a critical link between RIP1 kinase and JNK activation in L929 cells. Further data suggested that in multiple other cell types including FADD deficient Jurkat cells, RAW and J774.1 macrophage cell lines, and mouse lung fibroblasts Akt provides a key link to TNFα production, but is dispensible for cell death per se. Overall, our results reveal a specific and novel role for the Akt pathway in regulated necrosis and necrosis-associated inflammatory signaling. Results Basic Fibroblast Growth Factor Promotes Necroptosis in L929 Cells It has been established that mouse fibrosarcoma L929 cells undergo necroptotic cell death following stimulation with TNFα [10], [17]. In addition, inhibition of caspase-8 activity alone, either through siRNA knockdown or by using the pan-caspase inhibitor, zVAD.fmk, is sufficient to trigger necroptosis in these cells [10], [14]. Interestingly, while necroptosis was initially identified as a back-up form of cell death triggered by pro-apoptotic stimuli in the presence of apoptosis inhibitors [17], recent analysis of physiological cell death during mouse development has suggested that the loss of apoptotic regulators, such as caspase-8 and FADD [18], [19], [20], leads to robust induction of necroptosis and death of E10.5 embryos even though apoptosis is not normally induced in wild type embryos. These data are reminiscent of the observations in L929 cells where the loss of caspase activity in healthy cells is sufficient to trigger necroptosis and prompted us to explore the extrinsic or intrinsic cellular factors that promote necroptosis once caspase-8 activity, which cleaves and inactivates RIP1 kinase and the RIP1 deubiquitinase CYLD [21], [22], is removed in L929 cells. Consistent with a previous report [16], we found that serum starvation of L929 cells prevented necroptosis in response to zVAD.fmk (Fig. 1A). The addition of growth factors, such as bFGF, restored zVAD.fmk induced death under serum free conditions (Fig. 1B). Interestingly, this does not reflect a generic requirement for growth factor signaling, as only some growth factors (bFGF and IGF-1, but not EGF and PDGF) promoted death (Fig. 1B). Furthermore, growth factor-dependent necroptosis required the inhibition of caspase activity, as bFGF alone did not induce cell death (Fig. 1C). In contrast, TNFα triggered necroptosis equally efficiently in the absence of serum (Fig. 1A), suggesting that either growth factors and zVAD.fmk or TNFα are required for necroptotic death in L929 cells. 10.1371/journal.pone.0056576.g001 Figure 1 bFGF and IGF-1 promote necroptosis in concert with zVAD.fmk. (A) L929 cells were treated with TNFα or zVAD.fmk under normal serum (10% FBS) or serum free conditions. Cell viability was determined after 24 hr using the CellTiter-Glo Viability assay. The concentrations of all necroptosis-inducing agents are listed in the Materials and Methods section or indicated in the figures. (B) Cells were treated with zVAD.fmk, the indicated growth factors, and Nec-1 under serum free conditions for 24 hrs followed by measurement of cell viability. (C) Cells under serum free conditions were treated with FGF, zVAD.fmk, or both for 24 hrs followed by viability assay. (D) Cell death was induced by zVAD.fmk or TNFα under full serum condition in the presence of 2 µM PD173074 and 20 µM PD166866. In all graphs, average±SD was plotted. Previously we described the development of 7-Cl-O-Nec-1 (Nec-1) as a potent and selective inhibitor of RIP1 kinase and necroptosis (Fig. S1A) [23], [24]. Recently, its selectivity has been further validated against a panel of more than 400 human kinases [15]. This inhibitor efficiently blocked growth factor/zVAD.fmk-induced necroptosis under serum free conditions in L929 cells and both zVAD.fmk and TNFα-induced necroptosis under full serum conditions (Fig. 1B, S1B). To further validate the role of RIP1, we used an inactive analog, 7-Cl-O-Nec-1i (Nec-1i) (Fig. S1A), which contains an extra N-methyl group that leads to almost complete loss of RIP1 kinase inhibitory activity in vitro [23]. Nec-1i was unable to protect L929 cell death under serum condtions treated with zVAD.fmk or TNFα (Fig. S1B) or serum free conditions treated with bFGF/zVAD.fmk (Fig. S1C). This confirms that RIP1 kinase is responsible for necroptosis in L929 cells under both serum and serum free conditions. We next examined whether bFGF contributes to zVAD.fmk-induced necroptosis under normal serum conditions (10% FBS). We used two bFGF receptor tyrosine kinase inhibitors (PD173074 and PD166866), and determined that inhibition of bFGF signaling strongly inhibited zVAD.fmk-induced necroptosis under normal serum conditions (Fig. 1D). In contrast, neither bFGF receptor inhibitor was able to attenuate TNFα-induced necroptosis (Fig. 1D), consistent with growth factors being dispensable for this pathway (Fig. 1A). Overall, these data suggest that the induction of necroptosis by zVAD.fmk is promoted by bFGF under both serum and serum free conditions. The induction of necroptosis, however, is not a simple consequence of growth factor signaling since not all growth factors allowed death to occur. Instead, specific signaling events mediated by particular growth factors appear to contribute to necroptotic death. RIP1 Kinase-dependent Activation of Akt Contributes to Necroptosis
T2791	3313-3329	Protein	denotes	kinase dependent
T2734	3344-3347	Protein	denotes	JNK
T2746	3352-3356	Protein	denotes	TNFα
T2800	3352-3367	Gene_expression	denotes	TNFα production
T2770	3458-3461	Protein	denotes	Akt
T2728	3458-3469	Protein	denotes	Akt kinase,
T2757	3489-3497	Entity	denotes	molecule
T2747	3521-3555	Entity	denotes	inhibitor of apoptotic cell death,
T2790	3627-3644	Protein	denotes	insulin-dependent
T2807	3627-3662	Positive_regulation	denotes	insulin-dependent activation of Akt
T2798	3627-3662	Regulation	denotes	insulin-dependent activation of Akt
T2788	3656-3662	Protein	denotes	of Akt
T2772	3885-3901	Entity	denotes	zVAD.fmk-induced
T2748	3979-3982	Protein	denotes	Akt
T2763	4106-4123	Protein	denotes	insulin-dependent
T2806	4106-4136	Regulation	denotes	insulin-dependent Akt activity
T2754	4124-4127	Protein	denotes	Akt
T2777	4200-4203	Protein	denotes	Akt
T2801	4200-4214	Positive_regulation	denotes	Akt activation
T2741	4281-4295	Protein	denotes	to RIP1 kinase
T2759	4284-4288	Protein	denotes	RIP1
T2781	4435-4438	Protein	denotes	Akt
T2731	4443-4446	Protein	denotes	JNK
T2792	4472-4476	Protein	denotes	RIP1
T2786	4472-4483	Protein	denotes	RIP1 kinase
T2803	4520-4636	Positive_regulation	denotes	that Akt is activated through RIP1 kinase-dependent Thr308 phosphorylation during necroptosis in multiple cell types
T2735	4525-4528	Protein	denotes	Akt
T15670	4550-4554	Protein	denotes	RIP1
T2793	4550-4554	Protein	denotes	RIP1
T15674	4550-4571	Protein	denotes	RIP1 kinase-dependent
T2804	4550-4636	Regulation	denotes	RIP1 kinase-dependent Thr308 phosphorylation during necroptosis in multiple cell types
T15756	4550-30854	Phosphorylation	denotes	RIP1 kinase-dependent Thr308 phosphorylation during necroptosis in multiple cell types. Furthermore, we found that downstream Akt signaling through mTORC1 and S6 contributes to the activation of necroptosis and TNFα production. We found that the Akt pathway serves as a critical link between RIP1 kinase and JNK activation in L929 cells. Further data suggested that in multiple other cell types including FADD deficient Jurkat cells, RAW and J774.1 macrophage cell lines, and mouse lung fibroblasts Akt provides a key link to TNFα production, but is dispensible for cell death per se. Overall, our results reveal a specific and novel role for the Akt pathway in regulated necrosis and necrosis-associated inflammatory signaling. Results Basic Fibroblast Growth Factor Promotes Necroptosis in L929 Cells It has been established that mouse fibrosarcoma L929 cells undergo necroptotic cell death following stimulation with TNFα [10], [17]. In addition, inhibition of caspase-8 activity alone, either through siRNA knockdown or by using the pan-caspase inhibitor, zVAD.fmk, is sufficient to trigger necroptosis in these cells [10], [14]. Interestingly, while necroptosis was initially identified as a back-up form of cell death triggered by pro-apoptotic stimuli in the presence of apoptosis inhibitors [17], recent analysis of physiological cell death during mouse development has suggested that the loss of apoptotic regulators, such as caspase-8 and FADD [18], [19], [20], leads to robust induction of necroptosis and death of E10.5 embryos even though apoptosis is not normally induced in wild type embryos. These data are reminiscent of the observations in L929 cells where the loss of caspase activity in healthy cells is sufficient to trigger necroptosis and prompted us to explore the extrinsic or intrinsic cellular factors that promote necroptosis once caspase-8 activity, which cleaves and inactivates RIP1 kinase and the RIP1 deubiquitinase CYLD [21], [22], is removed in L929 cells. Consistent with a previous report [16], we found that serum starvation of L929 cells prevented necroptosis in response to zVAD.fmk (Fig. 1A). The addition of growth factors, such as bFGF, restored zVAD.fmk induced death under serum free conditions (Fig. 1B). Interestingly, this does not reflect a generic requirement for growth factor signaling, as only some growth factors (bFGF and IGF-1, but not EGF and PDGF) promoted death (Fig. 1B). Furthermore, growth factor-dependent necroptosis required the inhibition of caspase activity, as bFGF alone did not induce cell death (Fig. 1C). In contrast, TNFα triggered necroptosis equally efficiently in the absence of serum (Fig. 1A), suggesting that either growth factors and zVAD.fmk or TNFα are required for necroptotic death in L929 cells. 10.1371/journal.pone.0056576.g001 Figure 1 bFGF and IGF-1 promote necroptosis in concert with zVAD.fmk. (A) L929 cells were treated with TNFα or zVAD.fmk under normal serum (10% FBS) or serum free conditions. Cell viability was determined after 24 hr using the CellTiter-Glo Viability assay. The concentrations of all necroptosis-inducing agents are listed in the Materials and Methods section or indicated in the figures. (B) Cells were treated with zVAD.fmk, the indicated growth factors, and Nec-1 under serum free conditions for 24 hrs followed by measurement of cell viability. (C) Cells under serum free conditions were treated with FGF, zVAD.fmk, or both for 24 hrs followed by viability assay. (D) Cell death was induced by zVAD.fmk or TNFα under full serum condition in the presence of 2 µM PD173074 and 20 µM PD166866. In all graphs, average±SD was plotted. Previously we described the development of 7-Cl-O-Nec-1 (Nec-1) as a potent and selective inhibitor of RIP1 kinase and necroptosis (Fig. S1A) [23], [24]. Recently, its selectivity has been further validated against a panel of more than 400 human kinases [15]. This inhibitor efficiently blocked growth factor/zVAD.fmk-induced necroptosis under serum free conditions in L929 cells and both zVAD.fmk and TNFα-induced necroptosis under full serum conditions (Fig. 1B, S1B). To further validate the role of RIP1, we used an inactive analog, 7-Cl-O-Nec-1i (Nec-1i) (Fig. S1A), which contains an extra N-methyl group that leads to almost complete loss of RIP1 kinase inhibitory activity in vitro [23]. Nec-1i was unable to protect L929 cell death under serum condtions treated with zVAD.fmk or TNFα (Fig. S1B) or serum free conditions treated with bFGF/zVAD.fmk (Fig. S1C). This confirms that RIP1 kinase is responsible for necroptosis in L929 cells under both serum and serum free conditions. We next examined whether bFGF contributes to zVAD.fmk-induced necroptosis under normal serum conditions (10% FBS). We used two bFGF receptor tyrosine kinase inhibitors (PD173074 and PD166866), and determined that inhibition of bFGF signaling strongly inhibited zVAD.fmk-induced necroptosis under normal serum conditions (Fig. 1D). In contrast, neither bFGF receptor inhibitor was able to attenuate TNFα-induced necroptosis (Fig. 1D), consistent with growth factors being dispensable for this pathway (Fig. 1A). Overall, these data suggest that the induction of necroptosis by zVAD.fmk is promoted by bFGF under both serum and serum free conditions. The induction of necroptosis, however, is not a simple consequence of growth factor signaling since not all growth factors allowed death to occur. Instead, specific signaling events mediated by particular growth factors appear to contribute to necroptotic death. RIP1 Kinase-dependent Activation of Akt Contributes to Necroptosis Given our observation that growth factors are important for zVAD.fmk induced death, we examined the contribution of several pathways, including MAPK pathways and Akt, which are known to be activated following growth factor receptor activation (Fig. 2A). Inhibition of Akt (Akt inhibitor VIII) strongly protected the cells from growth factor-sensitive necroptosis induced by zVAD.fmk [16] as well as cell death triggered by bFGF or IGF-1/zVAD.fmk under serum free conditions (Fig. 2B). Inhibition of Akt also protected the cells from growth-factor insensitive death by caused by TNFα (Fig. 2A). Consistent with previous reports, the JNK inhibitor SP600125 protected the cells from both zVAD.fmk and TNFα induced death (Fig. 2A,B and Fig. S2A) [12], [14]. In contrast, inhibition of two other MAPKs, p38 and ERK, previously reported not to be activated during necroptosis [14], did not protect from either zVAD.fmk or TNFα induced death (Fig. 2A). 10.1371/journal.pone.0056576.g002 Figure 2 Akt contributes to necroptosis induced by zVAD.fmk and TNFα. (A,B) Necroptosis was induced by zVAD.fmk or TNFα (full serum, A) or growth factors/zVAD.fmk (serum free, B) in the presence of inhibitors of Akt (Akt inhibitor VIII), JNK (SP600125), p38 (PD169316), and Erk (UO126). Cell viability was determined after 24 hrs. (C) L929 cells transfected with Akt1, Akt2, and Akt3 siRNAs for 72 hrs were treated with zVAD.fmk or TNFα for 9 hrs. Cell viability and Akt expression levels were determined after 24 hrs. In all graphs, average±SD was plotted. Next, we used two approaches to further validate the role of Akt in necroptotic cell death. First, two additional Akt inhibitors, a highly specific, allosteric kinase inhibitor MK-2206 [25] and triciribine (TCN) [26], which blocks membrane translocation of Akt, both attenuated cell death (Fig. S2B). Secondly, simultaneous knockdown of Akt isoforms Akt1 and Akt2 using siRNAs protected cells from necroptosis induced by both zVAD.fmk and TNFα (Fig. 2C). No expression of Akt3 was seen in L929 cells (Fig. S2C) and, consistently, Akt3 siRNA had no additional effect on necroptosis. Our results confirmed that Akt plays a key role in necroptosis induced by multiple stimuli in L929 cells. To understand the activation of Akt and JNK under necroptotic conditions, we examined the changes in Akt and JNK phosphorylation at 9 hrs post zVAD.fmk and TNFα stimulation. This time point was chosen because it reflects the early stage of cell death in our system (Fig. S3A, B). Following stimulation with either zVAD.fmk or TNFα we observed a robust increase in Akt phosphorylation at a known major activation site, Thr308 (Fig. 3A). Interestingly, we did not observe concomitant phosphorylation changes in the second major activation site of Akt, Ser473. We also observed an increase in the phosphorylation of both the p46 and p54 isoforms of JNK and its major substrate c-Jun (Fig. 3A). These data indicate that both Akt and JNK are activated under necroptotic conditions. 10.1371/journal.pone.0056576.g003 Figure 3 RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis. (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr, followed by western blotting with indicated antibodies. (B,C) L929 cells were treated with zVAD.fmk (B) or bFGF/zVAD.fmk (serum free conditions, C) and samples were collected at the indicated time points for western blot. (D) Nec-1 was added to the cells stimulated with bFGF or bFGF/zVAD (serum free conditions) for 15 min or 9 hr followed by western blot with the indicated antibodies. The RIP1 kinase inhibitor, Nec-1, completely prevented the increase in Thr308 Akt phosphorylation, while Nec-1i did not (Fig. 3A, Fig. S1D). Similarly, Nec-1 prevented the induction of JNK phosphorylation in response to zVAD.fmk and substantially reduced this change after TNFα addition. We observed some changes in total protein levels of JNK and c-Jun following necroptotic stimulation. Some of these changes, e.g. zVAD.fmk-induced increase in c-Jun, were also attenuated by Nec-1. Importantly, Nec-1 did not alter the basal phosphorylation levels of either Akt or JNK (Fig. 3A). This established that Akt Thr308 and JNK phosphorylation during necroptosis is RIP1 dependent. Interestingly, we discovered that the phosphorylation of Akt Thr308, JNK and Jun are late events following zVAD.fmk stimulation (Fig. 3B) that coincide with the onset of necroptosis at 6 hr post-stimulation (Fig. S3A). To better understand the contributions of growth factors and RIP1 kinase to necroptotic regulation of Akt, we next analyzed the time course of these phosphorylation changes under serum free conditions. We found that the addition of bFGF alone or in combination with zVAD.fmk led to a substantial rapid and transient increase in both Thr308 and Ser473 phosphorylation of Akt as well as JNK and c-Jun at 15 minutes, reflecting the expected response to growth factor stimulation (Fig. 3C). Significantly, the combination of bFGF/zVAD.fmk, but not bFGF alone, also caused a robust, second, delayed increase in the phosphorylation of Thr308, but not Ser473, of Akt as well as a delayed increase in the phosphorylation of JNK and Jun. Furthermore, Nec-1 had no significant effect on the early increase in both Akt and JNK/c-Jun phosphorylation triggered by both bFGF and bFGF/zVAD, while Nec-1, but not its inactive analog Nec-1i (Fig. S1E), efficiently blocked the bFGF/zVAD increase at 6–9 hr (Fig. 3D), suggesting that only the delayed activation of Akt and JNK is specific for necroptosis and dependent on RIP1 kinase activity. Similarly, IGF/zVAD, which also promoted cell death under serum free conditions, produced a delayed increase in Thr308 phosphorylation on Akt, while IGF alone caused solely an early, transient increase in phosphorylation (Fig. S3C). We confirmed the kinetics of the Akt Thr308 and Ser473 phosphorylation changes using a quantitative ELISA assay, which also showed a robust delayed necroptosis-specific RIP1-dependent increase in Akt Thr308 phosphorylation (Fig. S3D, E). Taken together, these results indicate that the observed delayed increases in Akt and JNK phosphorylation, preceding the onset of cell death, represent specific consequences of necroptotic signaling downstream from RIP1 kinase. TNFα Induces Delayed Akt Thr308 Phosphorylation and Necroptosis Independent of Growth Factor Stimulation Consistent with TNFα inducing necroptosis independently of growth factors (Fig. 1A), FGFR inhibitors did not attenuate TNFα-induced changes in Akt or JNK phosphorylation, while efficiently preventing these changes in response to zVAD.fmk (Fig. S4A). Furthermore, addition of TNFα led to comparable late activation of Akt p308 signal under both normal and serum free conditions (Fig. S4B, C), indicating that TNFα signaling to Akt Thr308 is growth factor-independent. In contrast, activation of JNK by TNFα followed different kinetics from zVAD.fmk-induced changes. TNFα treatment caused an early and robust increase in the phosphorylation of JNK and c-Jun. Nec-1 did not affect this early increase, however, it reduced levels of pJNK/Jun at the late, 9 hr time point (Fig. S4B, C). This again separated early RIP1-independent changes, which likely reflect the ability of additional upstream kinases, such as Ask1 to activate JNK [27], from the late RIP1 kinase-dependent necroptotic signaling. Late Increase in Akt Thr308 Phosphorylation Contributes to the Induction of Necroptotic Cell Death We next investigated if the delayed RIP1 kinase-dependent increase in Akt Thr308 phosphorylation functionally contributes to the execution of necroptotic cell death. Firstly, PDGF/zVAD.fmk, which cannot induce necroptosis (Fig. 2A), triggered only the initial, rapid Akt and JNK phosphorylation changes and not the delayed activation (Fig. 4A), indicating that late, rather than early Akt phosphorylation correlates with necroptosis. Secondly, we saw that the ability of the Akt inhibitor to protect cells from necroptosis rapidly declined after 6 hrs of stimulation with zVAD.fmk, TNFα or bFGF/zVAD.fmk and no protection was observed when the inhibitor was added at 9 hrs (Fig. 4B,C). This time frame coincides with the timing of the secondary Akt Thr308 phosphorylation. Finally, we terminated the bFGF signal one hour after addition of bFGF by the addition of PD173074. This allowed us to retain early Akt activation, but to suppress the secondary increase (Fig. 4D). Both pre-addition and delayed addition of PD173074 fully prevented necroptosis (Fig. 4E). Overall, these data, while correlative, indicate that early Akt activation is insufficient to promote necroptosis and are strongly supportive of an important role for the delayed activation of Akt in the induction of necroptotic cell death. 10.1371/journal.pone.0056576.g004 Figure 4 Late Thr308 phosphorylation of Akt contributes to necroptosis. (A) L929 cells were treated with zVAD.fmk and bFGF or PDGF, with or without Nec-1, for the indicated periods of time. (B,C) L929 cells were stimulated by zVAD.fmk or TNFα (B) or bFGF/zVAD.fmk under serum free conditions (C). Akt inh. VIII was added 15 min before necroptotic stimulation (Pre) or at indicated times after stimulation. Viability was measured 24 hr after activation of necroptosis. (D) L929 cells were stimulated with bFGF/zVAD under serum free conditions. PD173074 was added 15 min before or 1 hr after FGF/zVAD. Samples for western blot were collected at 15 min and 9 hr time points. (E) Cells were pretreated with PD173074 or it was added 1 hr after bFGF/zVAD.fmk, followed by viability assessment at 24 hr. In all graphs, average±SD was plotted. The Akt Signaling Pathway Contributes to the Regulation of Necroptosis We next determined whether the necroptosis-associated increase in Thr308 phosphorylation results in an increase in Akt kinase activity. Under necroptotic conditions, we observed an increase in the phosphorylation of multiple known Akt substrates (Forkhead box class O (FoxO) proteins, GSK-3 kinases and mouse double minute 2 (MDM2)) as well as downstream molecules (p70 ribosomal protein S6 Kinase (p70S6K), S6) (Fig. 5A). In some cases (FoxO1, FoxO4, MDM2), a robust increase was observed. In other cases (FoxO3a, GSK-3α/β, p70S6K and its substrate S6), the changes were less pronounced (Fig. 5A). The timing of the phosphorylation changes paralleled the increase in Akt phosphorylation (Fig. 5B, S5A, B). In the case of pFoxO1 we occasionally observed a shift in migration rather than an increase in band intensity (e.g. comparing Fig. 5A and B), suggesting that phosphorylation events in addition to Thr24 take place during necroptosis. Notably, in all cases the necroptosis-associated increases in Akt substrates were abrogated by Nec-1 (Fig. 5A, Fig. S5A, B). Overall, these data suggested that a significant part of the “canonical” Akt signaling network is activated at the onset of necroptotic cell death in a RIP1 dependent fashion. 10.1371/journal.pone.0056576.g005 Figure 5 mTORC1 contributes to the regulation of necroptosis. (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr and harvested for western blot. (B) Cell under serum free condition were treated with bFGF or bFGF/zVAD.fmk for the indicated amounts of time, followed by western blotting using the indicated antibodies. (C) Necroptosis was induced by zVAD.fmk or TNFα in L929 cell in the presence of inhibitors of Akt(Akt inh. VIII) and mTOR (rapamycin, Torin-1 and PI-103). (D) L929 cells with mTOR siRNA knockdown were harvested for western blot or treated with zVAD.fmk or TNFα for 24 hrs. Cell viability was determined 24 hr after activation of necroptosis. In all graphs, average±SD was plotted. Akt kinase is considered to be a pro-survival protein that inhibits apoptosis through the control of multiple effectors including mTORC1, GSK-3 and others [28]. An important question is whether these same molecules reverse their pro-survival roles during necroptosis. We found that inhibition of mTORC1 by rapamycin, an inhibitor of the mTOR co-factor Raptor [29], protected cells from necroptosis (Fig. 5C). Similarly, the direct mTOR kinase inhibitor Torin1 [30] and the dual PI3K/mTOR inhibitor PI-103 [31] also efficiently inhibited necroptosis (Fig. 5C). Knockdown of mTOR using siRNA further validated the small-molecule inhibitor data indicating a role for mTOR in necroptosis by protecting cells from both zVAD.fmk and TNFα induced death (Fig. 5D). mTORC1 regulates translation through activation of p70S6 kinase and, subsequently, ribosomal protein S6 [32]. Notably, a genome-wide siRNA screen [10] suggested an important role for protein translation in necroptosis. Consistently, we found that the small molecule inhibitor of p70S6K PF-4708671 [33] attenuated necroptosis at the concentrations required to block S6 phosphorylation (Fig. S5C, D). Partial siRNA knockdown of S6 protein attenuated necroptosis as well (Fig. S5E), suggesting that translational control by p70S6K/S6 may play a role in necroptosis. Overall, while the full repertoire of Akt targets during necroptosis remains to be fully explored, our data provide evidence that the activity of an anti-apoptotic branch of Akt signaling can promote necroptosis. RIP1 kinase, Akt, mTORC1 and JNK control the upregulation of TNFα accompanying necroptosis. Hitomi et al. [10] have recently reported that the induction of necroptosis by zVAD.fmk in L929 cells is associated with increased synthesis of TNFα, which potentiates cell death. Therefore, we examined whether Akt and its effectors contribute to TNFα synthesis. Consistent with a RIP1-dependent increase in TNFα protein (Fig. S6A, B), we found that TNFα mRNA levels increased during necroptosis in L929 cells in a RIP1 (Fig. S6C. Under serum free conditions, bFGF alone triggered some induction of TNFα mRNA, while its combination with zVAD.fmk (but not zVAD.fmk alone) caused a pronounced further increase (Fig. 6A). Conversely, PDGF caused a modest upregulation of TNFα mRNA, which was not further increased in the presence of zVAD.fmk (Fig. 6A), demonstrating that activation of necroptosis is specifically accompanied by a marked increase in autocrine TNFα synthesis. 10.1371/journal.pone.0056576.g006 Figure 6 Akt and mTORC1 control autocrine TNFα synthesis and JNK activation during necroptosis. (A) Cells were treated under serum free conditions with bFGF or PDGF with or without zVAD.fmk for 9 hr, followed by qRT-PCR analysis of mTNFα. Data was normalized to mouse 18S RNA. (B) Necroptosis was induced by zVAD.fmk or TNFα in cells treated with Nec-1, rapamycin (rapa), or Akt inh. VIII inh. followed by qRT-PCR analysis of TNFα mRNA levels. (C-F) L929 cells with siRNA knockdown of Akt isoforms (C,E) or mTOR (D,F) were stimulated with zVAD.fmk or TNFα for 9 hr, followed by qRT-PCR analysis of mTNFα (C,D) or western blot (E,F). In all graphs, average±SD was plotted. Further analysis suggested that both Akt and mTORC1 contribute to the upregulation of TNFα mRNA during necroptosis as both small-molecule inhibition and siRNA knockdown of Akt and mTOR reduced TNFα mRNA levels in necroptotic cells (Fig. 6B,C,D). Notably, RIP1 and Akt inhibitors had no effect on the levels of TNFα mRNA in control cells or in the cells stimulated with bFGF alone (Fig. 6A,B, Fig. S6C), suggesting that these kinases specifically mediate necroptosis-dependent increase in TNFα synthesis. Akt and mTORC1 Control the Activation of JNK during Necroptosis JNK is a well-established regulator of TNFα synthesis in a variety of systems [13], [14], [15], [34]. Therefore, the ability of Akt and mTORC1 inhibitors to block the increase in TNFα mRNA lead us to examine their role in the activation of JNK during necroptosis. Knockdown of Akt isoforms Akt1 and Akt2 or inhibition of Akt prominently suppressed the necroptosis dependent increase in JNK and c-Jun phosphorylation (Fig. 6E, S6D,E) suggesting that Akt may provide a link between RIP1 and JNK activation. Importantly, inhibition of Akt only inhibited the delayed, but not the early, increase in bFGF/zVAD.fmk induced JNK and c-Jun phosphorylation (Fig. S6F). Knockdown of mTOR, rapamycin and the p70S6K inhibitor PF-4708671 also attenuated the necroptosis-associated increase in JNK and c-Jun phosphorylation (Fig. 6F, S6E,G, Fig. S5D). Overall, these data suggested that the Akt-mTORC1-S6K axis, acting downstream from RIP1 kinase, is required for the increase in JNK activity during necroptosis in L929 cells. PI3-kinase and PDK1 Mediate the Increase in Akt Thr308 Phosphorylation Under Necroptotic Conditions Typical regulation of Akt by growth factors involves its recruitment to the plasma membrane, which is mediated by the binding of the pleckstrin homology (PH) domain of Akt to the product of PI3K, phosphatidylinositol-3,4,5-triphosphate (PIP3). In the membrane, Akt is phosphorylated on Thr308 and Ser473 by 3-phosphoinositide dependent protein kinase-1 (PDK1) and mTORC2 (or DNA-PK), respectively [35]. Since our results showed that only Thr308 Akt phosphorylation is increased during necroptosis, we next examined whether it is still dependent on PI3K and PDK1. Inhibition of PI3K and PDK1 using the specific inhibitors LY249002 and BX912 [36] resulted in the efficient inhibition of cell death and Akt Thr308 phosphorylation (Fig. S7A–D). Likewise, siRNA knockdown of PDK1 protected cells from death and inhibited Akt Thr308 phosphorylation (Fig. S7E,F) Therefore, PI3K and PDK1 activity is still required for non-canonical Akt activation during necroptosis. Expression of Constitutively Active Akt, Rescues Necroptosis Under Serum Free Conditions We used L929 cells stably expressing constitutively active wild type Akt1 (Myr-Akt) or the catalytically inactive mutant K179M in order to further understand the contribution of growth factors and RIP1 kinase to Akt activation during necroptosis. Constitutively active Akt1 (Myr-Akt) was generated as previously described [37] by the addition of a myristoylation signal which provides constitutive localization to the plasma membrane and by the deletion of the auto-inhibitory PH domain (Fig. 7A) resulting in an Akt that is active under serum free. It is important to note that the cells expressing Myr-Akt were viable, grew in a manner indistinguishable from the empty vector control cells, and were not triggered to induce necroptosis by serum starvation (Fig. 7B). This indicates that active Akt alone is not sufficient to induce necroptotic cell death. Under serum free conditions Myr-Akt, but not the K179M mutant, fully restored zVAD.fmk-induced necroptosis (Fig. 7A,B). Nec-1 prevented both Myr-Akt dependent cell death and the necroptosis-specific delayed increase in Akt Thr308 phosphorylation (Fig. 7B,C). Myr-Akt also allowed other zVAD.fmk-dependent events, including activation of JNK and c-Jun phosphorylation (Fig. 7C) and upregulation of TNFα mRNA (Fig. 7D) to occur under serum free conditions, confirming an important role for Akt at the apex of necroptotic signaling. These data demonstrated that the presence of active and membrane localized Akt is sufficient to uncouple Akt activation during necroptosis from growth factor signaling. RIP1 kinase was still able to regulate Akt activation during necroptosis, suggesting that growth factors and RIP1 kinase provide two independent inputs required for Akt changes during necroptosis. 10.1371/journal.pone.0056576.g007 Figure 7 Over expression of constitutively active Akt restores necroptosis under serum free conditions. (A,B) L929 cells were stably infected with empty MSCV retrovirus or viruses encoding Myr-Akt or the catalytically inactive Myr-Akt K179M. Necroptosis was induced by the addition of zVAD.fmk under serum free conditions (A) or serum or serum free conditions with Nec-1 (B). Viability assays were performed after 24 hr. (C) Myr-Akt and Myr-Akt K179M cells were treated with zVAD.fmk and/or Nec-1 under serum free conditions for 9 hr, followed by western blot using the indicated antibodies. Endogenous Akt (∼) and Myr-Akt (*) bands are indicated. (D) L929 cells, stably infected with Myr-Akt and Myr-Akt K179KM, were stimulated with zVAD.fmk for 9 hr under serum free conditions. TNFα mRNA levels were determined by qRT-PCR and normalized using mouse 18S RNA. (E-G) L929 cells expressing Myr-Akt and Ala and Asp mutants of Thr308 and Ser473 were treated with zVAD.fmk under serum free conditions, followed by viability assay at 24 hr (E), western blot at 9 hr (F), or evaluation of TNFα mRNA levels by qRT-PCR at 9 hrs (G). In all graphs, average±SD was plotted. RIP1 kinase-dependent Thr308 phosphorylation of Myr-Akt during necroptosis
T15753	4550-30854	Regulation	denotes	RIP1 kinase-dependent Thr308 phosphorylation during necroptosis in multiple cell types. Furthermore, we found that downstream Akt signaling through mTORC1 and S6 contributes to the activation of necroptosis and TNFα production. We found that the Akt pathway serves as a critical link between RIP1 kinase and JNK activation in L929 cells. Further data suggested that in multiple other cell types including FADD deficient Jurkat cells, RAW and J774.1 macrophage cell lines, and mouse lung fibroblasts Akt provides a key link to TNFα production, but is dispensible for cell death per se. Overall, our results reveal a specific and novel role for the Akt pathway in regulated necrosis and necrosis-associated inflammatory signaling. Results Basic Fibroblast Growth Factor Promotes Necroptosis in L929 Cells It has been established that mouse fibrosarcoma L929 cells undergo necroptotic cell death following stimulation with TNFα [10], [17]. In addition, inhibition of caspase-8 activity alone, either through siRNA knockdown or by using the pan-caspase inhibitor, zVAD.fmk, is sufficient to trigger necroptosis in these cells [10], [14]. Interestingly, while necroptosis was initially identified as a back-up form of cell death triggered by pro-apoptotic stimuli in the presence of apoptosis inhibitors [17], recent analysis of physiological cell death during mouse development has suggested that the loss of apoptotic regulators, such as caspase-8 and FADD [18], [19], [20], leads to robust induction of necroptosis and death of E10.5 embryos even though apoptosis is not normally induced in wild type embryos. These data are reminiscent of the observations in L929 cells where the loss of caspase activity in healthy cells is sufficient to trigger necroptosis and prompted us to explore the extrinsic or intrinsic cellular factors that promote necroptosis once caspase-8 activity, which cleaves and inactivates RIP1 kinase and the RIP1 deubiquitinase CYLD [21], [22], is removed in L929 cells. Consistent with a previous report [16], we found that serum starvation of L929 cells prevented necroptosis in response to zVAD.fmk (Fig. 1A). The addition of growth factors, such as bFGF, restored zVAD.fmk induced death under serum free conditions (Fig. 1B). Interestingly, this does not reflect a generic requirement for growth factor signaling, as only some growth factors (bFGF and IGF-1, but not EGF and PDGF) promoted death (Fig. 1B). Furthermore, growth factor-dependent necroptosis required the inhibition of caspase activity, as bFGF alone did not induce cell death (Fig. 1C). In contrast, TNFα triggered necroptosis equally efficiently in the absence of serum (Fig. 1A), suggesting that either growth factors and zVAD.fmk or TNFα are required for necroptotic death in L929 cells. 10.1371/journal.pone.0056576.g001 Figure 1 bFGF and IGF-1 promote necroptosis in concert with zVAD.fmk. (A) L929 cells were treated with TNFα or zVAD.fmk under normal serum (10% FBS) or serum free conditions. Cell viability was determined after 24 hr using the CellTiter-Glo Viability assay. The concentrations of all necroptosis-inducing agents are listed in the Materials and Methods section or indicated in the figures. (B) Cells were treated with zVAD.fmk, the indicated growth factors, and Nec-1 under serum free conditions for 24 hrs followed by measurement of cell viability. (C) Cells under serum free conditions were treated with FGF, zVAD.fmk, or both for 24 hrs followed by viability assay. (D) Cell death was induced by zVAD.fmk or TNFα under full serum condition in the presence of 2 µM PD173074 and 20 µM PD166866. In all graphs, average±SD was plotted. Previously we described the development of 7-Cl-O-Nec-1 (Nec-1) as a potent and selective inhibitor of RIP1 kinase and necroptosis (Fig. S1A) [23], [24]. Recently, its selectivity has been further validated against a panel of more than 400 human kinases [15]. This inhibitor efficiently blocked growth factor/zVAD.fmk-induced necroptosis under serum free conditions in L929 cells and both zVAD.fmk and TNFα-induced necroptosis under full serum conditions (Fig. 1B, S1B). To further validate the role of RIP1, we used an inactive analog, 7-Cl-O-Nec-1i (Nec-1i) (Fig. S1A), which contains an extra N-methyl group that leads to almost complete loss of RIP1 kinase inhibitory activity in vitro [23]. Nec-1i was unable to protect L929 cell death under serum condtions treated with zVAD.fmk or TNFα (Fig. S1B) or serum free conditions treated with bFGF/zVAD.fmk (Fig. S1C). This confirms that RIP1 kinase is responsible for necroptosis in L929 cells under both serum and serum free conditions. We next examined whether bFGF contributes to zVAD.fmk-induced necroptosis under normal serum conditions (10% FBS). We used two bFGF receptor tyrosine kinase inhibitors (PD173074 and PD166866), and determined that inhibition of bFGF signaling strongly inhibited zVAD.fmk-induced necroptosis under normal serum conditions (Fig. 1D). In contrast, neither bFGF receptor inhibitor was able to attenuate TNFα-induced necroptosis (Fig. 1D), consistent with growth factors being dispensable for this pathway (Fig. 1A). Overall, these data suggest that the induction of necroptosis by zVAD.fmk is promoted by bFGF under both serum and serum free conditions. The induction of necroptosis, however, is not a simple consequence of growth factor signaling since not all growth factors allowed death to occur. Instead, specific signaling events mediated by particular growth factors appear to contribute to necroptotic death. RIP1 Kinase-dependent Activation of Akt Contributes to Necroptosis Given our observation that growth factors are important for zVAD.fmk induced death, we examined the contribution of several pathways, including MAPK pathways and Akt, which are known to be activated following growth factor receptor activation (Fig. 2A). Inhibition of Akt (Akt inhibitor VIII) strongly protected the cells from growth factor-sensitive necroptosis induced by zVAD.fmk [16] as well as cell death triggered by bFGF or IGF-1/zVAD.fmk under serum free conditions (Fig. 2B). Inhibition of Akt also protected the cells from growth-factor insensitive death by caused by TNFα (Fig. 2A). Consistent with previous reports, the JNK inhibitor SP600125 protected the cells from both zVAD.fmk and TNFα induced death (Fig. 2A,B and Fig. S2A) [12], [14]. In contrast, inhibition of two other MAPKs, p38 and ERK, previously reported not to be activated during necroptosis [14], did not protect from either zVAD.fmk or TNFα induced death (Fig. 2A). 10.1371/journal.pone.0056576.g002 Figure 2 Akt contributes to necroptosis induced by zVAD.fmk and TNFα. (A,B) Necroptosis was induced by zVAD.fmk or TNFα (full serum, A) or growth factors/zVAD.fmk (serum free, B) in the presence of inhibitors of Akt (Akt inhibitor VIII), JNK (SP600125), p38 (PD169316), and Erk (UO126). Cell viability was determined after 24 hrs. (C) L929 cells transfected with Akt1, Akt2, and Akt3 siRNAs for 72 hrs were treated with zVAD.fmk or TNFα for 9 hrs. Cell viability and Akt expression levels were determined after 24 hrs. In all graphs, average±SD was plotted. Next, we used two approaches to further validate the role of Akt in necroptotic cell death. First, two additional Akt inhibitors, a highly specific, allosteric kinase inhibitor MK-2206 [25] and triciribine (TCN) [26], which blocks membrane translocation of Akt, both attenuated cell death (Fig. S2B). Secondly, simultaneous knockdown of Akt isoforms Akt1 and Akt2 using siRNAs protected cells from necroptosis induced by both zVAD.fmk and TNFα (Fig. 2C). No expression of Akt3 was seen in L929 cells (Fig. S2C) and, consistently, Akt3 siRNA had no additional effect on necroptosis. Our results confirmed that Akt plays a key role in necroptosis induced by multiple stimuli in L929 cells. To understand the activation of Akt and JNK under necroptotic conditions, we examined the changes in Akt and JNK phosphorylation at 9 hrs post zVAD.fmk and TNFα stimulation. This time point was chosen because it reflects the early stage of cell death in our system (Fig. S3A, B). Following stimulation with either zVAD.fmk or TNFα we observed a robust increase in Akt phosphorylation at a known major activation site, Thr308 (Fig. 3A). Interestingly, we did not observe concomitant phosphorylation changes in the second major activation site of Akt, Ser473. We also observed an increase in the phosphorylation of both the p46 and p54 isoforms of JNK and its major substrate c-Jun (Fig. 3A). These data indicate that both Akt and JNK are activated under necroptotic conditions. 10.1371/journal.pone.0056576.g003 Figure 3 RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis. (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr, followed by western blotting with indicated antibodies. (B,C) L929 cells were treated with zVAD.fmk (B) or bFGF/zVAD.fmk (serum free conditions, C) and samples were collected at the indicated time points for western blot. (D) Nec-1 was added to the cells stimulated with bFGF or bFGF/zVAD (serum free conditions) for 15 min or 9 hr followed by western blot with the indicated antibodies. The RIP1 kinase inhibitor, Nec-1, completely prevented the increase in Thr308 Akt phosphorylation, while Nec-1i did not (Fig. 3A, Fig. S1D). Similarly, Nec-1 prevented the induction of JNK phosphorylation in response to zVAD.fmk and substantially reduced this change after TNFα addition. We observed some changes in total protein levels of JNK and c-Jun following necroptotic stimulation. Some of these changes, e.g. zVAD.fmk-induced increase in c-Jun, were also attenuated by Nec-1. Importantly, Nec-1 did not alter the basal phosphorylation levels of either Akt or JNK (Fig. 3A). This established that Akt Thr308 and JNK phosphorylation during necroptosis is RIP1 dependent. Interestingly, we discovered that the phosphorylation of Akt Thr308, JNK and Jun are late events following zVAD.fmk stimulation (Fig. 3B) that coincide with the onset of necroptosis at 6 hr post-stimulation (Fig. S3A). To better understand the contributions of growth factors and RIP1 kinase to necroptotic regulation of Akt, we next analyzed the time course of these phosphorylation changes under serum free conditions. We found that the addition of bFGF alone or in combination with zVAD.fmk led to a substantial rapid and transient increase in both Thr308 and Ser473 phosphorylation of Akt as well as JNK and c-Jun at 15 minutes, reflecting the expected response to growth factor stimulation (Fig. 3C). Significantly, the combination of bFGF/zVAD.fmk, but not bFGF alone, also caused a robust, second, delayed increase in the phosphorylation of Thr308, but not Ser473, of Akt as well as a delayed increase in the phosphorylation of JNK and Jun. Furthermore, Nec-1 had no significant effect on the early increase in both Akt and JNK/c-Jun phosphorylation triggered by both bFGF and bFGF/zVAD, while Nec-1, but not its inactive analog Nec-1i (Fig. S1E), efficiently blocked the bFGF/zVAD increase at 6–9 hr (Fig. 3D), suggesting that only the delayed activation of Akt and JNK is specific for necroptosis and dependent on RIP1 kinase activity. Similarly, IGF/zVAD, which also promoted cell death under serum free conditions, produced a delayed increase in Thr308 phosphorylation on Akt, while IGF alone caused solely an early, transient increase in phosphorylation (Fig. S3C). We confirmed the kinetics of the Akt Thr308 and Ser473 phosphorylation changes using a quantitative ELISA assay, which also showed a robust delayed necroptosis-specific RIP1-dependent increase in Akt Thr308 phosphorylation (Fig. S3D, E). Taken together, these results indicate that the observed delayed increases in Akt and JNK phosphorylation, preceding the onset of cell death, represent specific consequences of necroptotic signaling downstream from RIP1 kinase. TNFα Induces Delayed Akt Thr308 Phosphorylation and Necroptosis Independent of Growth Factor Stimulation Consistent with TNFα inducing necroptosis independently of growth factors (Fig. 1A), FGFR inhibitors did not attenuate TNFα-induced changes in Akt or JNK phosphorylation, while efficiently preventing these changes in response to zVAD.fmk (Fig. S4A). Furthermore, addition of TNFα led to comparable late activation of Akt p308 signal under both normal and serum free conditions (Fig. S4B, C), indicating that TNFα signaling to Akt Thr308 is growth factor-independent. In contrast, activation of JNK by TNFα followed different kinetics from zVAD.fmk-induced changes. TNFα treatment caused an early and robust increase in the phosphorylation of JNK and c-Jun. Nec-1 did not affect this early increase, however, it reduced levels of pJNK/Jun at the late, 9 hr time point (Fig. S4B, C). This again separated early RIP1-independent changes, which likely reflect the ability of additional upstream kinases, such as Ask1 to activate JNK [27], from the late RIP1 kinase-dependent necroptotic signaling. Late Increase in Akt Thr308 Phosphorylation Contributes to the Induction of Necroptotic Cell Death We next investigated if the delayed RIP1 kinase-dependent increase in Akt Thr308 phosphorylation functionally contributes to the execution of necroptotic cell death. Firstly, PDGF/zVAD.fmk, which cannot induce necroptosis (Fig. 2A), triggered only the initial, rapid Akt and JNK phosphorylation changes and not the delayed activation (Fig. 4A), indicating that late, rather than early Akt phosphorylation correlates with necroptosis. Secondly, we saw that the ability of the Akt inhibitor to protect cells from necroptosis rapidly declined after 6 hrs of stimulation with zVAD.fmk, TNFα or bFGF/zVAD.fmk and no protection was observed when the inhibitor was added at 9 hrs (Fig. 4B,C). This time frame coincides with the timing of the secondary Akt Thr308 phosphorylation. Finally, we terminated the bFGF signal one hour after addition of bFGF by the addition of PD173074. This allowed us to retain early Akt activation, but to suppress the secondary increase (Fig. 4D). Both pre-addition and delayed addition of PD173074 fully prevented necroptosis (Fig. 4E). Overall, these data, while correlative, indicate that early Akt activation is insufficient to promote necroptosis and are strongly supportive of an important role for the delayed activation of Akt in the induction of necroptotic cell death. 10.1371/journal.pone.0056576.g004 Figure 4 Late Thr308 phosphorylation of Akt contributes to necroptosis. (A) L929 cells were treated with zVAD.fmk and bFGF or PDGF, with or without Nec-1, for the indicated periods of time. (B,C) L929 cells were stimulated by zVAD.fmk or TNFα (B) or bFGF/zVAD.fmk under serum free conditions (C). Akt inh. VIII was added 15 min before necroptotic stimulation (Pre) or at indicated times after stimulation. Viability was measured 24 hr after activation of necroptosis. (D) L929 cells were stimulated with bFGF/zVAD under serum free conditions. PD173074 was added 15 min before or 1 hr after FGF/zVAD. Samples for western blot were collected at 15 min and 9 hr time points. (E) Cells were pretreated with PD173074 or it was added 1 hr after bFGF/zVAD.fmk, followed by viability assessment at 24 hr. In all graphs, average±SD was plotted. The Akt Signaling Pathway Contributes to the Regulation of Necroptosis We next determined whether the necroptosis-associated increase in Thr308 phosphorylation results in an increase in Akt kinase activity. Under necroptotic conditions, we observed an increase in the phosphorylation of multiple known Akt substrates (Forkhead box class O (FoxO) proteins, GSK-3 kinases and mouse double minute 2 (MDM2)) as well as downstream molecules (p70 ribosomal protein S6 Kinase (p70S6K), S6) (Fig. 5A). In some cases (FoxO1, FoxO4, MDM2), a robust increase was observed. In other cases (FoxO3a, GSK-3α/β, p70S6K and its substrate S6), the changes were less pronounced (Fig. 5A). The timing of the phosphorylation changes paralleled the increase in Akt phosphorylation (Fig. 5B, S5A, B). In the case of pFoxO1 we occasionally observed a shift in migration rather than an increase in band intensity (e.g. comparing Fig. 5A and B), suggesting that phosphorylation events in addition to Thr24 take place during necroptosis. Notably, in all cases the necroptosis-associated increases in Akt substrates were abrogated by Nec-1 (Fig. 5A, Fig. S5A, B). Overall, these data suggested that a significant part of the “canonical” Akt signaling network is activated at the onset of necroptotic cell death in a RIP1 dependent fashion. 10.1371/journal.pone.0056576.g005 Figure 5 mTORC1 contributes to the regulation of necroptosis. (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr and harvested for western blot. (B) Cell under serum free condition were treated with bFGF or bFGF/zVAD.fmk for the indicated amounts of time, followed by western blotting using the indicated antibodies. (C) Necroptosis was induced by zVAD.fmk or TNFα in L929 cell in the presence of inhibitors of Akt(Akt inh. VIII) and mTOR (rapamycin, Torin-1 and PI-103). (D) L929 cells with mTOR siRNA knockdown were harvested for western blot or treated with zVAD.fmk or TNFα for 24 hrs. Cell viability was determined 24 hr after activation of necroptosis. In all graphs, average±SD was plotted. Akt kinase is considered to be a pro-survival protein that inhibits apoptosis through the control of multiple effectors including mTORC1, GSK-3 and others [28]. An important question is whether these same molecules reverse their pro-survival roles during necroptosis. We found that inhibition of mTORC1 by rapamycin, an inhibitor of the mTOR co-factor Raptor [29], protected cells from necroptosis (Fig. 5C). Similarly, the direct mTOR kinase inhibitor Torin1 [30] and the dual PI3K/mTOR inhibitor PI-103 [31] also efficiently inhibited necroptosis (Fig. 5C). Knockdown of mTOR using siRNA further validated the small-molecule inhibitor data indicating a role for mTOR in necroptosis by protecting cells from both zVAD.fmk and TNFα induced death (Fig. 5D). mTORC1 regulates translation through activation of p70S6 kinase and, subsequently, ribosomal protein S6 [32]. Notably, a genome-wide siRNA screen [10] suggested an important role for protein translation in necroptosis. Consistently, we found that the small molecule inhibitor of p70S6K PF-4708671 [33] attenuated necroptosis at the concentrations required to block S6 phosphorylation (Fig. S5C, D). Partial siRNA knockdown of S6 protein attenuated necroptosis as well (Fig. S5E), suggesting that translational control by p70S6K/S6 may play a role in necroptosis. Overall, while the full repertoire of Akt targets during necroptosis remains to be fully explored, our data provide evidence that the activity of an anti-apoptotic branch of Akt signaling can promote necroptosis. RIP1 kinase, Akt, mTORC1 and JNK control the upregulation of TNFα accompanying necroptosis. Hitomi et al. [10] have recently reported that the induction of necroptosis by zVAD.fmk in L929 cells is associated with increased synthesis of TNFα, which potentiates cell death. Therefore, we examined whether Akt and its effectors contribute to TNFα synthesis. Consistent with a RIP1-dependent increase in TNFα protein (Fig. S6A, B), we found that TNFα mRNA levels increased during necroptosis in L929 cells in a RIP1 (Fig. S6C. Under serum free conditions, bFGF alone triggered some induction of TNFα mRNA, while its combination with zVAD.fmk (but not zVAD.fmk alone) caused a pronounced further increase (Fig. 6A). Conversely, PDGF caused a modest upregulation of TNFα mRNA, which was not further increased in the presence of zVAD.fmk (Fig. 6A), demonstrating that activation of necroptosis is specifically accompanied by a marked increase in autocrine TNFα synthesis. 10.1371/journal.pone.0056576.g006 Figure 6 Akt and mTORC1 control autocrine TNFα synthesis and JNK activation during necroptosis. (A) Cells were treated under serum free conditions with bFGF or PDGF with or without zVAD.fmk for 9 hr, followed by qRT-PCR analysis of mTNFα. Data was normalized to mouse 18S RNA. (B) Necroptosis was induced by zVAD.fmk or TNFα in cells treated with Nec-1, rapamycin (rapa), or Akt inh. VIII inh. followed by qRT-PCR analysis of TNFα mRNA levels. (C-F) L929 cells with siRNA knockdown of Akt isoforms (C,E) or mTOR (D,F) were stimulated with zVAD.fmk or TNFα for 9 hr, followed by qRT-PCR analysis of mTNFα (C,D) or western blot (E,F). In all graphs, average±SD was plotted. Further analysis suggested that both Akt and mTORC1 contribute to the upregulation of TNFα mRNA during necroptosis as both small-molecule inhibition and siRNA knockdown of Akt and mTOR reduced TNFα mRNA levels in necroptotic cells (Fig. 6B,C,D). Notably, RIP1 and Akt inhibitors had no effect on the levels of TNFα mRNA in control cells or in the cells stimulated with bFGF alone (Fig. 6A,B, Fig. S6C), suggesting that these kinases specifically mediate necroptosis-dependent increase in TNFα synthesis. Akt and mTORC1 Control the Activation of JNK during Necroptosis JNK is a well-established regulator of TNFα synthesis in a variety of systems [13], [14], [15], [34]. Therefore, the ability of Akt and mTORC1 inhibitors to block the increase in TNFα mRNA lead us to examine their role in the activation of JNK during necroptosis. Knockdown of Akt isoforms Akt1 and Akt2 or inhibition of Akt prominently suppressed the necroptosis dependent increase in JNK and c-Jun phosphorylation (Fig. 6E, S6D,E) suggesting that Akt may provide a link between RIP1 and JNK activation. Importantly, inhibition of Akt only inhibited the delayed, but not the early, increase in bFGF/zVAD.fmk induced JNK and c-Jun phosphorylation (Fig. S6F). Knockdown of mTOR, rapamycin and the p70S6K inhibitor PF-4708671 also attenuated the necroptosis-associated increase in JNK and c-Jun phosphorylation (Fig. 6F, S6E,G, Fig. S5D). Overall, these data suggested that the Akt-mTORC1-S6K axis, acting downstream from RIP1 kinase, is required for the increase in JNK activity during necroptosis in L929 cells. PI3-kinase and PDK1 Mediate the Increase in Akt Thr308 Phosphorylation Under Necroptotic Conditions Typical regulation of Akt by growth factors involves its recruitment to the plasma membrane, which is mediated by the binding of the pleckstrin homology (PH) domain of Akt to the product of PI3K, phosphatidylinositol-3,4,5-triphosphate (PIP3). In the membrane, Akt is phosphorylated on Thr308 and Ser473 by 3-phosphoinositide dependent protein kinase-1 (PDK1) and mTORC2 (or DNA-PK), respectively [35]. Since our results showed that only Thr308 Akt phosphorylation is increased during necroptosis, we next examined whether it is still dependent on PI3K and PDK1. Inhibition of PI3K and PDK1 using the specific inhibitors LY249002 and BX912 [36] resulted in the efficient inhibition of cell death and Akt Thr308 phosphorylation (Fig. S7A–D). Likewise, siRNA knockdown of PDK1 protected cells from death and inhibited Akt Thr308 phosphorylation (Fig. S7E,F) Therefore, PI3K and PDK1 activity is still required for non-canonical Akt activation during necroptosis. Expression of Constitutively Active Akt, Rescues Necroptosis Under Serum Free Conditions We used L929 cells stably expressing constitutively active wild type Akt1 (Myr-Akt) or the catalytically inactive mutant K179M in order to further understand the contribution of growth factors and RIP1 kinase to Akt activation during necroptosis. Constitutively active Akt1 (Myr-Akt) was generated as previously described [37] by the addition of a myristoylation signal which provides constitutive localization to the plasma membrane and by the deletion of the auto-inhibitory PH domain (Fig. 7A) resulting in an Akt that is active under serum free. It is important to note that the cells expressing Myr-Akt were viable, grew in a manner indistinguishable from the empty vector control cells, and were not triggered to induce necroptosis by serum starvation (Fig. 7B). This indicates that active Akt alone is not sufficient to induce necroptotic cell death. Under serum free conditions Myr-Akt, but not the K179M mutant, fully restored zVAD.fmk-induced necroptosis (Fig. 7A,B). Nec-1 prevented both Myr-Akt dependent cell death and the necroptosis-specific delayed increase in Akt Thr308 phosphorylation (Fig. 7B,C). Myr-Akt also allowed other zVAD.fmk-dependent events, including activation of JNK and c-Jun phosphorylation (Fig. 7C) and upregulation of TNFα mRNA (Fig. 7D) to occur under serum free conditions, confirming an important role for Akt at the apex of necroptotic signaling. These data demonstrated that the presence of active and membrane localized Akt is sufficient to uncouple Akt activation during necroptosis from growth factor signaling. RIP1 kinase was still able to regulate Akt activation during necroptosis, suggesting that growth factors and RIP1 kinase provide two independent inputs required for Akt changes during necroptosis. 10.1371/journal.pone.0056576.g007 Figure 7 Over expression of constitutively active Akt restores necroptosis under serum free conditions. (A,B) L929 cells were stably infected with empty MSCV retrovirus or viruses encoding Myr-Akt or the catalytically inactive Myr-Akt K179M. Necroptosis was induced by the addition of zVAD.fmk under serum free conditions (A) or serum or serum free conditions with Nec-1 (B). Viability assays were performed after 24 hr. (C) Myr-Akt and Myr-Akt K179M cells were treated with zVAD.fmk and/or Nec-1 under serum free conditions for 9 hr, followed by western blot using the indicated antibodies. Endogenous Akt (∼) and Myr-Akt (*) bands are indicated. (D) L929 cells, stably infected with Myr-Akt and Myr-Akt K179KM, were stimulated with zVAD.fmk for 9 hr under serum free conditions. TNFα mRNA levels were determined by qRT-PCR and normalized using mouse 18S RNA. (E-G) L929 cells expressing Myr-Akt and Ala and Asp mutants of Thr308 and Ser473 were treated with zVAD.fmk under serum free conditions, followed by viability assay at 24 hr (E), western blot at 9 hr (F), or evaluation of TNFα mRNA levels by qRT-PCR at 9 hrs (G). In all graphs, average±SD was plotted. RIP1 kinase-dependent Thr308 phosphorylation of Myr-Akt during necroptosis
T15763	4550-30891	Positive_regulation	denotes	RIP1 kinase-dependent Thr308 phosphorylation during necroptosis in multiple cell types. Furthermore, we found that downstream Akt signaling through mTORC1 and S6 contributes to the activation of necroptosis and TNFα production. We found that the Akt pathway serves as a critical link between RIP1 kinase and JNK activation in L929 cells. Further data suggested that in multiple other cell types including FADD deficient Jurkat cells, RAW and J774.1 macrophage cell lines, and mouse lung fibroblasts Akt provides a key link to TNFα production, but is dispensible for cell death per se. Overall, our results reveal a specific and novel role for the Akt pathway in regulated necrosis and necrosis-associated inflammatory signaling. Results Basic Fibroblast Growth Factor Promotes Necroptosis in L929 Cells It has been established that mouse fibrosarcoma L929 cells undergo necroptotic cell death following stimulation with TNFα [10], [17]. In addition, inhibition of caspase-8 activity alone, either through siRNA knockdown or by using the pan-caspase inhibitor, zVAD.fmk, is sufficient to trigger necroptosis in these cells [10], [14]. Interestingly, while necroptosis was initially identified as a back-up form of cell death triggered by pro-apoptotic stimuli in the presence of apoptosis inhibitors [17], recent analysis of physiological cell death during mouse development has suggested that the loss of apoptotic regulators, such as caspase-8 and FADD [18], [19], [20], leads to robust induction of necroptosis and death of E10.5 embryos even though apoptosis is not normally induced in wild type embryos. These data are reminiscent of the observations in L929 cells where the loss of caspase activity in healthy cells is sufficient to trigger necroptosis and prompted us to explore the extrinsic or intrinsic cellular factors that promote necroptosis once caspase-8 activity, which cleaves and inactivates RIP1 kinase and the RIP1 deubiquitinase CYLD [21], [22], is removed in L929 cells. Consistent with a previous report [16], we found that serum starvation of L929 cells prevented necroptosis in response to zVAD.fmk (Fig. 1A). The addition of growth factors, such as bFGF, restored zVAD.fmk induced death under serum free conditions (Fig. 1B). Interestingly, this does not reflect a generic requirement for growth factor signaling, as only some growth factors (bFGF and IGF-1, but not EGF and PDGF) promoted death (Fig. 1B). Furthermore, growth factor-dependent necroptosis required the inhibition of caspase activity, as bFGF alone did not induce cell death (Fig. 1C). In contrast, TNFα triggered necroptosis equally efficiently in the absence of serum (Fig. 1A), suggesting that either growth factors and zVAD.fmk or TNFα are required for necroptotic death in L929 cells. 10.1371/journal.pone.0056576.g001 Figure 1 bFGF and IGF-1 promote necroptosis in concert with zVAD.fmk. (A) L929 cells were treated with TNFα or zVAD.fmk under normal serum (10% FBS) or serum free conditions. Cell viability was determined after 24 hr using the CellTiter-Glo Viability assay. The concentrations of all necroptosis-inducing agents are listed in the Materials and Methods section or indicated in the figures. (B) Cells were treated with zVAD.fmk, the indicated growth factors, and Nec-1 under serum free conditions for 24 hrs followed by measurement of cell viability. (C) Cells under serum free conditions were treated with FGF, zVAD.fmk, or both for 24 hrs followed by viability assay. (D) Cell death was induced by zVAD.fmk or TNFα under full serum condition in the presence of 2 µM PD173074 and 20 µM PD166866. In all graphs, average±SD was plotted. Previously we described the development of 7-Cl-O-Nec-1 (Nec-1) as a potent and selective inhibitor of RIP1 kinase and necroptosis (Fig. S1A) [23], [24]. Recently, its selectivity has been further validated against a panel of more than 400 human kinases [15]. This inhibitor efficiently blocked growth factor/zVAD.fmk-induced necroptosis under serum free conditions in L929 cells and both zVAD.fmk and TNFα-induced necroptosis under full serum conditions (Fig. 1B, S1B). To further validate the role of RIP1, we used an inactive analog, 7-Cl-O-Nec-1i (Nec-1i) (Fig. S1A), which contains an extra N-methyl group that leads to almost complete loss of RIP1 kinase inhibitory activity in vitro [23]. Nec-1i was unable to protect L929 cell death under serum condtions treated with zVAD.fmk or TNFα (Fig. S1B) or serum free conditions treated with bFGF/zVAD.fmk (Fig. S1C). This confirms that RIP1 kinase is responsible for necroptosis in L929 cells under both serum and serum free conditions. We next examined whether bFGF contributes to zVAD.fmk-induced necroptosis under normal serum conditions (10% FBS). We used two bFGF receptor tyrosine kinase inhibitors (PD173074 and PD166866), and determined that inhibition of bFGF signaling strongly inhibited zVAD.fmk-induced necroptosis under normal serum conditions (Fig. 1D). In contrast, neither bFGF receptor inhibitor was able to attenuate TNFα-induced necroptosis (Fig. 1D), consistent with growth factors being dispensable for this pathway (Fig. 1A). Overall, these data suggest that the induction of necroptosis by zVAD.fmk is promoted by bFGF under both serum and serum free conditions. The induction of necroptosis, however, is not a simple consequence of growth factor signaling since not all growth factors allowed death to occur. Instead, specific signaling events mediated by particular growth factors appear to contribute to necroptotic death. RIP1 Kinase-dependent Activation of Akt Contributes to Necroptosis Given our observation that growth factors are important for zVAD.fmk induced death, we examined the contribution of several pathways, including MAPK pathways and Akt, which are known to be activated following growth factor receptor activation (Fig. 2A). Inhibition of Akt (Akt inhibitor VIII) strongly protected the cells from growth factor-sensitive necroptosis induced by zVAD.fmk [16] as well as cell death triggered by bFGF or IGF-1/zVAD.fmk under serum free conditions (Fig. 2B). Inhibition of Akt also protected the cells from growth-factor insensitive death by caused by TNFα (Fig. 2A). Consistent with previous reports, the JNK inhibitor SP600125 protected the cells from both zVAD.fmk and TNFα induced death (Fig. 2A,B and Fig. S2A) [12], [14]. In contrast, inhibition of two other MAPKs, p38 and ERK, previously reported not to be activated during necroptosis [14], did not protect from either zVAD.fmk or TNFα induced death (Fig. 2A). 10.1371/journal.pone.0056576.g002 Figure 2 Akt contributes to necroptosis induced by zVAD.fmk and TNFα. (A,B) Necroptosis was induced by zVAD.fmk or TNFα (full serum, A) or growth factors/zVAD.fmk (serum free, B) in the presence of inhibitors of Akt (Akt inhibitor VIII), JNK (SP600125), p38 (PD169316), and Erk (UO126). Cell viability was determined after 24 hrs. (C) L929 cells transfected with Akt1, Akt2, and Akt3 siRNAs for 72 hrs were treated with zVAD.fmk or TNFα for 9 hrs. Cell viability and Akt expression levels were determined after 24 hrs. In all graphs, average±SD was plotted. Next, we used two approaches to further validate the role of Akt in necroptotic cell death. First, two additional Akt inhibitors, a highly specific, allosteric kinase inhibitor MK-2206 [25] and triciribine (TCN) [26], which blocks membrane translocation of Akt, both attenuated cell death (Fig. S2B). Secondly, simultaneous knockdown of Akt isoforms Akt1 and Akt2 using siRNAs protected cells from necroptosis induced by both zVAD.fmk and TNFα (Fig. 2C). No expression of Akt3 was seen in L929 cells (Fig. S2C) and, consistently, Akt3 siRNA had no additional effect on necroptosis. Our results confirmed that Akt plays a key role in necroptosis induced by multiple stimuli in L929 cells. To understand the activation of Akt and JNK under necroptotic conditions, we examined the changes in Akt and JNK phosphorylation at 9 hrs post zVAD.fmk and TNFα stimulation. This time point was chosen because it reflects the early stage of cell death in our system (Fig. S3A, B). Following stimulation with either zVAD.fmk or TNFα we observed a robust increase in Akt phosphorylation at a known major activation site, Thr308 (Fig. 3A). Interestingly, we did not observe concomitant phosphorylation changes in the second major activation site of Akt, Ser473. We also observed an increase in the phosphorylation of both the p46 and p54 isoforms of JNK and its major substrate c-Jun (Fig. 3A). These data indicate that both Akt and JNK are activated under necroptotic conditions. 10.1371/journal.pone.0056576.g003 Figure 3 RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis. (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr, followed by western blotting with indicated antibodies. (B,C) L929 cells were treated with zVAD.fmk (B) or bFGF/zVAD.fmk (serum free conditions, C) and samples were collected at the indicated time points for western blot. (D) Nec-1 was added to the cells stimulated with bFGF or bFGF/zVAD (serum free conditions) for 15 min or 9 hr followed by western blot with the indicated antibodies. The RIP1 kinase inhibitor, Nec-1, completely prevented the increase in Thr308 Akt phosphorylation, while Nec-1i did not (Fig. 3A, Fig. S1D). Similarly, Nec-1 prevented the induction of JNK phosphorylation in response to zVAD.fmk and substantially reduced this change after TNFα addition. We observed some changes in total protein levels of JNK and c-Jun following necroptotic stimulation. Some of these changes, e.g. zVAD.fmk-induced increase in c-Jun, were also attenuated by Nec-1. Importantly, Nec-1 did not alter the basal phosphorylation levels of either Akt or JNK (Fig. 3A). This established that Akt Thr308 and JNK phosphorylation during necroptosis is RIP1 dependent. Interestingly, we discovered that the phosphorylation of Akt Thr308, JNK and Jun are late events following zVAD.fmk stimulation (Fig. 3B) that coincide with the onset of necroptosis at 6 hr post-stimulation (Fig. S3A). To better understand the contributions of growth factors and RIP1 kinase to necroptotic regulation of Akt, we next analyzed the time course of these phosphorylation changes under serum free conditions. We found that the addition of bFGF alone or in combination with zVAD.fmk led to a substantial rapid and transient increase in both Thr308 and Ser473 phosphorylation of Akt as well as JNK and c-Jun at 15 minutes, reflecting the expected response to growth factor stimulation (Fig. 3C). Significantly, the combination of bFGF/zVAD.fmk, but not bFGF alone, also caused a robust, second, delayed increase in the phosphorylation of Thr308, but not Ser473, of Akt as well as a delayed increase in the phosphorylation of JNK and Jun. Furthermore, Nec-1 had no significant effect on the early increase in both Akt and JNK/c-Jun phosphorylation triggered by both bFGF and bFGF/zVAD, while Nec-1, but not its inactive analog Nec-1i (Fig. S1E), efficiently blocked the bFGF/zVAD increase at 6–9 hr (Fig. 3D), suggesting that only the delayed activation of Akt and JNK is specific for necroptosis and dependent on RIP1 kinase activity. Similarly, IGF/zVAD, which also promoted cell death under serum free conditions, produced a delayed increase in Thr308 phosphorylation on Akt, while IGF alone caused solely an early, transient increase in phosphorylation (Fig. S3C). We confirmed the kinetics of the Akt Thr308 and Ser473 phosphorylation changes using a quantitative ELISA assay, which also showed a robust delayed necroptosis-specific RIP1-dependent increase in Akt Thr308 phosphorylation (Fig. S3D, E). Taken together, these results indicate that the observed delayed increases in Akt and JNK phosphorylation, preceding the onset of cell death, represent specific consequences of necroptotic signaling downstream from RIP1 kinase. TNFα Induces Delayed Akt Thr308 Phosphorylation and Necroptosis Independent of Growth Factor Stimulation Consistent with TNFα inducing necroptosis independently of growth factors (Fig. 1A), FGFR inhibitors did not attenuate TNFα-induced changes in Akt or JNK phosphorylation, while efficiently preventing these changes in response to zVAD.fmk (Fig. S4A). Furthermore, addition of TNFα led to comparable late activation of Akt p308 signal under both normal and serum free conditions (Fig. S4B, C), indicating that TNFα signaling to Akt Thr308 is growth factor-independent. In contrast, activation of JNK by TNFα followed different kinetics from zVAD.fmk-induced changes. TNFα treatment caused an early and robust increase in the phosphorylation of JNK and c-Jun. Nec-1 did not affect this early increase, however, it reduced levels of pJNK/Jun at the late, 9 hr time point (Fig. S4B, C). This again separated early RIP1-independent changes, which likely reflect the ability of additional upstream kinases, such as Ask1 to activate JNK [27], from the late RIP1 kinase-dependent necroptotic signaling. Late Increase in Akt Thr308 Phosphorylation Contributes to the Induction of Necroptotic Cell Death We next investigated if the delayed RIP1 kinase-dependent increase in Akt Thr308 phosphorylation functionally contributes to the execution of necroptotic cell death. Firstly, PDGF/zVAD.fmk, which cannot induce necroptosis (Fig. 2A), triggered only the initial, rapid Akt and JNK phosphorylation changes and not the delayed activation (Fig. 4A), indicating that late, rather than early Akt phosphorylation correlates with necroptosis. Secondly, we saw that the ability of the Akt inhibitor to protect cells from necroptosis rapidly declined after 6 hrs of stimulation with zVAD.fmk, TNFα or bFGF/zVAD.fmk and no protection was observed when the inhibitor was added at 9 hrs (Fig. 4B,C). This time frame coincides with the timing of the secondary Akt Thr308 phosphorylation. Finally, we terminated the bFGF signal one hour after addition of bFGF by the addition of PD173074. This allowed us to retain early Akt activation, but to suppress the secondary increase (Fig. 4D). Both pre-addition and delayed addition of PD173074 fully prevented necroptosis (Fig. 4E). Overall, these data, while correlative, indicate that early Akt activation is insufficient to promote necroptosis and are strongly supportive of an important role for the delayed activation of Akt in the induction of necroptotic cell death. 10.1371/journal.pone.0056576.g004 Figure 4 Late Thr308 phosphorylation of Akt contributes to necroptosis. (A) L929 cells were treated with zVAD.fmk and bFGF or PDGF, with or without Nec-1, for the indicated periods of time. (B,C) L929 cells were stimulated by zVAD.fmk or TNFα (B) or bFGF/zVAD.fmk under serum free conditions (C). Akt inh. VIII was added 15 min before necroptotic stimulation (Pre) or at indicated times after stimulation. Viability was measured 24 hr after activation of necroptosis. (D) L929 cells were stimulated with bFGF/zVAD under serum free conditions. PD173074 was added 15 min before or 1 hr after FGF/zVAD. Samples for western blot were collected at 15 min and 9 hr time points. (E) Cells were pretreated with PD173074 or it was added 1 hr after bFGF/zVAD.fmk, followed by viability assessment at 24 hr. In all graphs, average±SD was plotted. The Akt Signaling Pathway Contributes to the Regulation of Necroptosis We next determined whether the necroptosis-associated increase in Thr308 phosphorylation results in an increase in Akt kinase activity. Under necroptotic conditions, we observed an increase in the phosphorylation of multiple known Akt substrates (Forkhead box class O (FoxO) proteins, GSK-3 kinases and mouse double minute 2 (MDM2)) as well as downstream molecules (p70 ribosomal protein S6 Kinase (p70S6K), S6) (Fig. 5A). In some cases (FoxO1, FoxO4, MDM2), a robust increase was observed. In other cases (FoxO3a, GSK-3α/β, p70S6K and its substrate S6), the changes were less pronounced (Fig. 5A). The timing of the phosphorylation changes paralleled the increase in Akt phosphorylation (Fig. 5B, S5A, B). In the case of pFoxO1 we occasionally observed a shift in migration rather than an increase in band intensity (e.g. comparing Fig. 5A and B), suggesting that phosphorylation events in addition to Thr24 take place during necroptosis. Notably, in all cases the necroptosis-associated increases in Akt substrates were abrogated by Nec-1 (Fig. 5A, Fig. S5A, B). Overall, these data suggested that a significant part of the “canonical” Akt signaling network is activated at the onset of necroptotic cell death in a RIP1 dependent fashion. 10.1371/journal.pone.0056576.g005 Figure 5 mTORC1 contributes to the regulation of necroptosis. (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr and harvested for western blot. (B) Cell under serum free condition were treated with bFGF or bFGF/zVAD.fmk for the indicated amounts of time, followed by western blotting using the indicated antibodies. (C) Necroptosis was induced by zVAD.fmk or TNFα in L929 cell in the presence of inhibitors of Akt(Akt inh. VIII) and mTOR (rapamycin, Torin-1 and PI-103). (D) L929 cells with mTOR siRNA knockdown were harvested for western blot or treated with zVAD.fmk or TNFα for 24 hrs. Cell viability was determined 24 hr after activation of necroptosis. In all graphs, average±SD was plotted. Akt kinase is considered to be a pro-survival protein that inhibits apoptosis through the control of multiple effectors including mTORC1, GSK-3 and others [28]. An important question is whether these same molecules reverse their pro-survival roles during necroptosis. We found that inhibition of mTORC1 by rapamycin, an inhibitor of the mTOR co-factor Raptor [29], protected cells from necroptosis (Fig. 5C). Similarly, the direct mTOR kinase inhibitor Torin1 [30] and the dual PI3K/mTOR inhibitor PI-103 [31] also efficiently inhibited necroptosis (Fig. 5C). Knockdown of mTOR using siRNA further validated the small-molecule inhibitor data indicating a role for mTOR in necroptosis by protecting cells from both zVAD.fmk and TNFα induced death (Fig. 5D). mTORC1 regulates translation through activation of p70S6 kinase and, subsequently, ribosomal protein S6 [32]. Notably, a genome-wide siRNA screen [10] suggested an important role for protein translation in necroptosis. Consistently, we found that the small molecule inhibitor of p70S6K PF-4708671 [33] attenuated necroptosis at the concentrations required to block S6 phosphorylation (Fig. S5C, D). Partial siRNA knockdown of S6 protein attenuated necroptosis as well (Fig. S5E), suggesting that translational control by p70S6K/S6 may play a role in necroptosis. Overall, while the full repertoire of Akt targets during necroptosis remains to be fully explored, our data provide evidence that the activity of an anti-apoptotic branch of Akt signaling can promote necroptosis. RIP1 kinase, Akt, mTORC1 and JNK control the upregulation of TNFα accompanying necroptosis. Hitomi et al. [10] have recently reported that the induction of necroptosis by zVAD.fmk in L929 cells is associated with increased synthesis of TNFα, which potentiates cell death. Therefore, we examined whether Akt and its effectors contribute to TNFα synthesis. Consistent with a RIP1-dependent increase in TNFα protein (Fig. S6A, B), we found that TNFα mRNA levels increased during necroptosis in L929 cells in a RIP1 (Fig. S6C. Under serum free conditions, bFGF alone triggered some induction of TNFα mRNA, while its combination with zVAD.fmk (but not zVAD.fmk alone) caused a pronounced further increase (Fig. 6A). Conversely, PDGF caused a modest upregulation of TNFα mRNA, which was not further increased in the presence of zVAD.fmk (Fig. 6A), demonstrating that activation of necroptosis is specifically accompanied by a marked increase in autocrine TNFα synthesis. 10.1371/journal.pone.0056576.g006 Figure 6 Akt and mTORC1 control autocrine TNFα synthesis and JNK activation during necroptosis. (A) Cells were treated under serum free conditions with bFGF or PDGF with or without zVAD.fmk for 9 hr, followed by qRT-PCR analysis of mTNFα. Data was normalized to mouse 18S RNA. (B) Necroptosis was induced by zVAD.fmk or TNFα in cells treated with Nec-1, rapamycin (rapa), or Akt inh. VIII inh. followed by qRT-PCR analysis of TNFα mRNA levels. (C-F) L929 cells with siRNA knockdown of Akt isoforms (C,E) or mTOR (D,F) were stimulated with zVAD.fmk or TNFα for 9 hr, followed by qRT-PCR analysis of mTNFα (C,D) or western blot (E,F). In all graphs, average±SD was plotted. Further analysis suggested that both Akt and mTORC1 contribute to the upregulation of TNFα mRNA during necroptosis as both small-molecule inhibition and siRNA knockdown of Akt and mTOR reduced TNFα mRNA levels in necroptotic cells (Fig. 6B,C,D). Notably, RIP1 and Akt inhibitors had no effect on the levels of TNFα mRNA in control cells or in the cells stimulated with bFGF alone (Fig. 6A,B, Fig. S6C), suggesting that these kinases specifically mediate necroptosis-dependent increase in TNFα synthesis. Akt and mTORC1 Control the Activation of JNK during Necroptosis JNK is a well-established regulator of TNFα synthesis in a variety of systems [13], [14], [15], [34]. Therefore, the ability of Akt and mTORC1 inhibitors to block the increase in TNFα mRNA lead us to examine their role in the activation of JNK during necroptosis. Knockdown of Akt isoforms Akt1 and Akt2 or inhibition of Akt prominently suppressed the necroptosis dependent increase in JNK and c-Jun phosphorylation (Fig. 6E, S6D,E) suggesting that Akt may provide a link between RIP1 and JNK activation. Importantly, inhibition of Akt only inhibited the delayed, but not the early, increase in bFGF/zVAD.fmk induced JNK and c-Jun phosphorylation (Fig. S6F). Knockdown of mTOR, rapamycin and the p70S6K inhibitor PF-4708671 also attenuated the necroptosis-associated increase in JNK and c-Jun phosphorylation (Fig. 6F, S6E,G, Fig. S5D). Overall, these data suggested that the Akt-mTORC1-S6K axis, acting downstream from RIP1 kinase, is required for the increase in JNK activity during necroptosis in L929 cells. PI3-kinase and PDK1 Mediate the Increase in Akt Thr308 Phosphorylation Under Necroptotic Conditions Typical regulation of Akt by growth factors involves its recruitment to the plasma membrane, which is mediated by the binding of the pleckstrin homology (PH) domain of Akt to the product of PI3K, phosphatidylinositol-3,4,5-triphosphate (PIP3). In the membrane, Akt is phosphorylated on Thr308 and Ser473 by 3-phosphoinositide dependent protein kinase-1 (PDK1) and mTORC2 (or DNA-PK), respectively [35]. Since our results showed that only Thr308 Akt phosphorylation is increased during necroptosis, we next examined whether it is still dependent on PI3K and PDK1. Inhibition of PI3K and PDK1 using the specific inhibitors LY249002 and BX912 [36] resulted in the efficient inhibition of cell death and Akt Thr308 phosphorylation (Fig. S7A–D). Likewise, siRNA knockdown of PDK1 protected cells from death and inhibited Akt Thr308 phosphorylation (Fig. S7E,F) Therefore, PI3K and PDK1 activity is still required for non-canonical Akt activation during necroptosis. Expression of Constitutively Active Akt, Rescues Necroptosis Under Serum Free Conditions We used L929 cells stably expressing constitutively active wild type Akt1 (Myr-Akt) or the catalytically inactive mutant K179M in order to further understand the contribution of growth factors and RIP1 kinase to Akt activation during necroptosis. Constitutively active Akt1 (Myr-Akt) was generated as previously described [37] by the addition of a myristoylation signal which provides constitutive localization to the plasma membrane and by the deletion of the auto-inhibitory PH domain (Fig. 7A) resulting in an Akt that is active under serum free. It is important to note that the cells expressing Myr-Akt were viable, grew in a manner indistinguishable from the empty vector control cells, and were not triggered to induce necroptosis by serum starvation (Fig. 7B). This indicates that active Akt alone is not sufficient to induce necroptotic cell death. Under serum free conditions Myr-Akt, but not the K179M mutant, fully restored zVAD.fmk-induced necroptosis (Fig. 7A,B). Nec-1 prevented both Myr-Akt dependent cell death and the necroptosis-specific delayed increase in Akt Thr308 phosphorylation (Fig. 7B,C). Myr-Akt also allowed other zVAD.fmk-dependent events, including activation of JNK and c-Jun phosphorylation (Fig. 7C) and upregulation of TNFα mRNA (Fig. 7D) to occur under serum free conditions, confirming an important role for Akt at the apex of necroptotic signaling. These data demonstrated that the presence of active and membrane localized Akt is sufficient to uncouple Akt activation during necroptosis from growth factor signaling. RIP1 kinase was still able to regulate Akt activation during necroptosis, suggesting that growth factors and RIP1 kinase provide two independent inputs required for Akt changes during necroptosis. 10.1371/journal.pone.0056576.g007 Figure 7 Over expression of constitutively active Akt restores necroptosis under serum free conditions. (A,B) L929 cells were stably infected with empty MSCV retrovirus or viruses encoding Myr-Akt or the catalytically inactive Myr-Akt K179M. Necroptosis was induced by the addition of zVAD.fmk under serum free conditions (A) or serum or serum free conditions with Nec-1 (B). Viability assays were performed after 24 hr. (C) Myr-Akt and Myr-Akt K179M cells were treated with zVAD.fmk and/or Nec-1 under serum free conditions for 9 hr, followed by western blot using the indicated antibodies. Endogenous Akt (∼) and Myr-Akt (*) bands are indicated. (D) L929 cells, stably infected with Myr-Akt and Myr-Akt K179KM, were stimulated with zVAD.fmk for 9 hr under serum free conditions. TNFα mRNA levels were determined by qRT-PCR and normalized using mouse 18S RNA. (E-G) L929 cells expressing Myr-Akt and Ala and Asp mutants of Thr308 and Ser473 were treated with zVAD.fmk under serum free conditions, followed by viability assay at 24 hr (E), western blot at 9 hr (F), or evaluation of TNFα mRNA levels by qRT-PCR at 9 hrs (G). In all graphs, average±SD was plotted. RIP1 kinase-dependent Thr308 phosphorylation of Myr-Akt during necroptosis increased Myr-Akt activity as it did
T2773	4555-4571	Protein	denotes	kinase-dependent
T15647	4572-4578	Entity	denotes	Thr308
T2765	4572-4578	Entity	denotes	Thr308
T2764	4617-4636	Entity	denotes	multiple cell types
T2794	4651-4689	Positive_regulation	denotes	we found that downstream Akt signaling
T2787	4676-4679	Protein	denotes	Akt
T2778	4699-4704	Entity	denotes	TORC1
T2738	4709-4711	Protein	denotes	S6
T2769	4761-4765	Protein	denotes	TNFα
T2802	4761-4776	Gene_expression	denotes	TNFα production
T2749	4792-4807	Protein	denotes	the Akt pathway
T2743	4842-4846	Protein	denotes	RIP1
T2727	4842-4853	Protein	denotes	RIP1 kinase
T2752	4858-4861	Protein	denotes	JNK
T2808	4858-4886	Positive_regulation	denotes	JNK activation in L929 cells
T2784	4919-4983	Entity	denotes	multiple other cell types including FADD deficient Jurkat cells,
T2774	4955-4959	Protein	denotes	FADD
T2768	4955-4982	Entity	denotes	FADD deficient Jurkat cells
T2751	5026-5048	Entity	denotes	mouse lung fibroblasts
T2789	5049-5052	Protein	denotes	Akt
T2766	5076-5080	Protein	denotes	TNFα
T2797	5076-5091	Gene_expression	denotes	TNFα production
T2761	5193-5208	Protein	denotes	the Akt pathway
T4918	5289-5319	Protein	denotes	Basic Fibroblast Growth Factor
T4984	5289-5320	Localization	denotes	Basic Fibroblast Growth Factor
T4976	5295-5305	Entity	denotes	Fibroblast
T4974	5472-5487	Protein	denotes	TNFα [10], [17]
T4985	5492-5534	Negative_regulation	denotes	addition, inhibition of caspase-8 activity
T4951	5516-5525	Protein	denotes	caspase-8
T4933	5585-5611	Protein	denotes	the pan-caspase inhibitor,
T4964	5585-5611	Entity	denotes	the pan-caspase inhibitor,
T4934	5612-5621	Entity	denotes	zVAD.fmk,
T4978	5662-5684	Entity	denotes	these cells [10], [14]
T4958	5827-5855	Entity	denotes	of apoptosis inhibitors [17]
T4950	5987-5996	Protein	denotes	caspase-8
T4961	6001-6016	Protein	denotes	FADD [18], [19]
T4915	6239-6246	Protein	denotes	caspase
T4924	6259-6272	Entity	denotes	healthy cells
T4954	6411-6420	Protein	denotes	caspase-8
T4991	6431-6500	Negative_regulation	denotes	which cleaves and inactivates RIP1 kinase and the RIP1 deubiquitinase
T4990	6431-6500	Negative_regulation	denotes	which cleaves and inactivates RIP1 kinase and the RIP1 deubiquitinase
T4963	6461-6465	Protein	denotes	RIP1
T4931	6461-6472	Protein	denotes	RIP1 kinase
T4967	6477-6500	Protein	denotes	the RIP1 deubiquitinase
T4968	6501-6517	Protein	denotes	CYLD [21], [22],
T4986	6501-6542	Negative_regulation	denotes	CYLD [21], [22], is removed in L929 cells
T4932	6666-6674	Entity	denotes	zVAD.fmk
T4981	6699-6749	Entity	denotes	of growth factors, such as bFGF, restored zVAD.fmk
T4945	6726-6731	Protein	denotes	bFGF,
T4952	6866-6879	Protein	denotes	growth factor
T4983	6866-6889	Positive_regulation	denotes	growth factor signaling
T4928	6920-6924	Protein	denotes	bFGF
T4973	6929-6934	Protein	denotes	IGF-1
T4941	6944-6947	Protein	denotes	EGF
T4965	6997-7020	Protein	denotes	growth factor-dependent
T4992	7042-7077	Negative_regulation	denotes	the inhibition of caspase activity,
T4977	7060-7067	Protein	denotes	caspase
T4966	7081-7085	Protein	denotes	bFGF
T4923	7142-7146	Protein	denotes	TNFα
T4917	7266-7274	Entity	denotes	zVAD.fmk
T4938	7278-7282	Protein	denotes	TNFα
T28893	7377-7381	Protein	denotes	bFGF
T28890	7386-7391	Protein	denotes	IGF-1
T28888	7428-7436	Entity	denotes	zVAD.fmk
T28905	7471-7475	Protein	denotes	TNFα
T28898	7479-7487	Entity	denotes	zVAD.fmk
T28896	7508-7515	Protein	denotes	10% FBS
T28902	7591-7624	Protein	denotes	the CellTiter-Glo Viability assay
T28891	7595-7599	Entity	denotes	Cell
T28906	7763-7768	Entity	denotes	Cells
T28900	7787-7796	Entity	denotes	zVAD.fmk,
T28903	7831-7836	Protein	denotes	Nec-1
T28892	7869-7917	Protein	denotes	24 hrs followed by measurement of cell viability
T28894	7900-7917	Entity	denotes	of cell viability
T28887	7923-7956	Entity	denotes	Cells under serum free conditions
T28889	7975-7978	Entity	denotes	FGF
T28904	7980-7988	Entity	denotes	zVAD.fmk
T28899	8002-8008	Protein	denotes	24 hrs
T28897	8068-8076	Entity	denotes	zVAD.fmk
T28895	8080-8084	Protein	denotes	TNFα
T28901	8133-8144	Entity	denotes	µM PD173074
T4960	8261-8266	Protein	denotes	Nec-1
T4946	8273-8356	Entity	denotes	potent and selective inhibitor of RIP1 kinase and necroptosis (Fig. S1A) [23], [24]
T4936	8307-8311	Protein	denotes	RIP1
T4943	8307-8318	Protein	denotes	RIP1 kinase
T4937	8430-8462	Protein	denotes	more than 400 human kinases [15]
T4982	8464-8478	Entity	denotes	This inhibitor
T4975	8593-8601	Entity	denotes	zVAD.fmk
T4957	8606-8618	Protein	denotes	TNFα-induced
T4920	8660-8663	Protein	denotes	Fig
T4962	8704-8711	Protein	denotes	of RIP1
T4921	8791-8884	Entity	denotes	an extra N-methyl group that leads to almost complete loss of RIP1 kinase inhibitory activity
T4980	8853-8857	Protein	denotes	RIP1
T4925	8853-8875	Protein	denotes	RIP1 kinase inhibitory
T4929	8929-8933	Entity	denotes	L929
T4916	8980-8988	Entity	denotes	zVAD.fmk
T4949	8992-8996	Protein	denotes	TNFα
T4935	9046-9050	Protein	denotes	bFGF
T4955	9051-9059	Entity	denotes	zVAD.fmk
T4942	9091-9095	Protein	denotes	RIP1
T4972	9091-9102	Protein	denotes	RIP1 kinase
T4948	9217-9221	Protein	denotes	bFGF
T4930	9237-9253	Entity	denotes	zVAD.fmk-induced
T4927	9297-9304	Protein	denotes	10% FBS
T4989	9307-9433	Negative_regulation	denotes	We used two bFGF receptor tyrosine kinase inhibitors (PD173074 and PD166866), and determined that inhibition of bFGF signaling
T4953	9315-9384	Protein	denotes	two bFGF receptor tyrosine kinase inhibitors (PD173074 and PD166866),
T4947	9315-9384	Entity	denotes	two bFGF receptor tyrosine kinase inhibitors (PD173074 and PD166866),
T4939	9319-9323	Protein	denotes	bFGF
T4987	9416-9433	Positive_regulation	denotes	of bFGF signaling
T4922	9419-9423	Protein	denotes	bFGF
T4970	9453-9461	Entity	denotes	zVAD.fmk
T4956	9513-9516	Protein	denotes	Fig
T4959	9544-9548	Protein	denotes	bFGF
T4979	9549-9557	Protein	denotes	receptor
T4944	9549-9567	Entity	denotes	receptor inhibitor
T4919	9590-9602	Protein	denotes	TNFα-induced
T4971	9616-9619	Protein	denotes	Fig
T4969	9765-9776	Entity	denotes	by zVAD.fmk
T4940	9789-9796	Protein	denotes	by bFGF
T4988	9908-9934	Positive_regulation	denotes	of growth factor signaling
T4926	9911-9924	Protein	denotes	growth factor
T7294	10127-10144	Positive_regulation	denotes	Activation of Akt
T7204	10138-10144	Protein	denotes	of Akt
T7169	10178-10240	Entity	denotes	our observation that growth factors are important for zVAD.fmk
T7238	10316-10329	Protein	denotes	MAPK pathways
T7194	10334-10337	Protein	denotes	Akt
T7302	10361-10414	Positive_regulation	denotes	activated following growth factor receptor activation
T7265	10395-10403	Protein	denotes	receptor
T7225	10416-10419	Protein	denotes	Fig
T7293	10426-10464	Negative_regulation	denotes	Inhibition of Akt (Akt inhibitor VIII)
T7268	10437-10443	Protein	denotes	of Akt
T7262	10445-10463	Entity	denotes	Akt inhibitor VIII
T7264	10484-10559	Entity	denotes	the cells from growth factor-sensitive necroptosis induced by zVAD.fmk [16]
T7207	10499-10522	Protein	denotes	growth factor-sensitive
T7182	10543-10559	Entity	denotes	by zVAD.fmk [16]
T7234	10595-10599	Protein	denotes	bFGF
T7274	10647-10650	Protein	denotes	Fig
T7291	10657-10674	Negative_regulation	denotes	Inhibition of Akt
T7271	10668-10674	Protein	denotes	of Akt
T7203	10690-10699	Entity	denotes	the cells
T7239	10705-10730	Protein	denotes	growth-factor insensitive
T7221	10747-10764	Protein	denotes	by TNFα (Fig. 2A)
T7183	10800-10807	Protein	denotes	the JNK
T7155	10808-10817	Entity	denotes	inhibitor
T7226	10808-10826	Entity	denotes	inhibitor SP600125
T7151	10837-10846	Entity	denotes	the cells
T7260	10857-10865	Entity	denotes	zVAD.fmk
T7275	10870-10874	Protein	denotes	TNFα
T7259	10904-10907	Protein	denotes	Fig
T7282	10939-10968	Negative_regulation	denotes	inhibition of two other MAPKs
T7224	10950-10968	Protein	denotes	of two other MAPKs
T7250	10970-10973	Protein	denotes	p38
T7187	10978-11046	Protein	denotes	ERK, previously reported not to be activated during necroptosis [14]
T7191	11076-11084	Entity	denotes	zVAD.fmk
T7272	11088-11092	Protein	denotes	TNFα
T29360	11162-11165	Protein	denotes	Akt
T29358	11204-11212	Entity	denotes	zVAD.fmk
T29346	11217-11221	Protein	denotes	TNFα
T29350	11256-11264	Entity	denotes	zVAD.fmk
T29362	11268-11272	Protein	denotes	TNFα
T29368	11307-11315	Entity	denotes	zVAD.fmk
T29353	11351-11394	Entity	denotes	inhibitors of Akt (Akt inhibitor VIII), JNK
T29361	11365-11390	Protein	denotes	Akt (Akt inhibitor VIII),
T29365	11365-11394	Protein	denotes	Akt (Akt inhibitor VIII), JNK
T29356	11370-11388	Entity	denotes	Akt inhibitor VIII
T29359	11407-11410	Protein	denotes	p38
T29345	11427-11430	Protein	denotes	Erk
T29357	11476-11482	Protein	denotes	24 hrs
T29348	11488-11492	Entity	denotes	L929
T29367	11488-11554	Entity	denotes	L929 cells transfected with Akt1, Akt2, and Akt3 siRNAs for 72 hrs
T29351	11516-11520	Protein	denotes	Akt1
T29364	11522-11526	Protein	denotes	Akt2
T29349	11532-11543	Protein	denotes	Akt3 siRNAs
T29363	11548-11554	Protein	denotes	72 hrs
T29352	11573-11581	Entity	denotes	zVAD.fmk
T29347	11585-11599	Protein	denotes	TNFα for 9 hrs
T29369	11594-11599	Protein	denotes	9 hrs
T29366	11601-11615	Entity	denotes	Cell viability
T29355	11620-11623	Protein	denotes	Akt
T29370	11620-11641	Gene_expression	denotes	Akt expression levels
T29354	11664-11670	Protein	denotes	24 hrs
T7177	11769-11775	Protein	denotes	of Akt
T7180	11810-11839	Entity	denotes	two additional Akt inhibitors
T7273	11825-11828	Protein	denotes	Akt
T7252	11850-11900	Entity	denotes	specific, allosteric kinase inhibitor MK-2206 [25]
T7161	11850-11900	Protein	denotes	specific, allosteric kinase inhibitor MK-2206 [25]
T7200	11878-11887	Entity	denotes	inhibitor
T7186	11905-11922	Entity	denotes	triciribine (TCN)
T7220	11918-11921	Entity	denotes	TCN
T7289	11929-11972	Negative_regulation	denotes	which blocks membrane translocation of Akt,
T7184	11942-11950	Entity	denotes	membrane
T7202	11965-11971	Protein	denotes	of Akt
T7150	12048-12051	Protein	denotes	Akt
T7233	12048-12065	Protein	denotes	Akt isoforms Akt1
T7256	12070-12087	Protein	denotes	Akt2 using siRNAs
T7217	12098-12103	Entity	denotes	cells
T7158	12137-12145	Entity	denotes	zVAD.fmk
T7249	12150-12154	Protein	denotes	TNFα
T7215	12156-12159	Protein	denotes	Fig
T7279	12166-12221	Gene_expression	denotes	No expression of Akt3 was seen in L929 cells (Fig. S2C)
T7176	12180-12187	Protein	denotes	of Akt3
T7195	12241-12251	Protein	denotes	Akt3 siRNA
T7228	12320-12323	Protein	denotes	Akt
T7306	12413-12442	Positive_regulation	denotes	the activation of Akt and JNK
T7305	12413-12442	Positive_regulation	denotes	the activation of Akt and JNK
T7190	12431-12434	Protein	denotes	Akt
T7162	12439-12442	Protein	denotes	JNK
T7247	12500-12503	Protein	denotes	Akt
T7165	12508-12511	Protein	denotes	JNK
T7287	12508-12527	Phosphorylation	denotes	JNK phosphorylation
T7153	12531-12536	Protein	denotes	9 hrs
T7214	12542-12550	Entity	denotes	zVAD.fmk
T7276	12555-12559	Protein	denotes	TNFα
T7281	12555-12571	Positive_regulation	denotes	TNFα stimulation
T7166	12670-12674	Protein	denotes	S3A,
T7299	12679-12782	Positive_regulation	denotes	Following stimulation with either zVAD.fmk or TNFα we observed a robust increase in Akt phosphorylation
T7198	12713-12721	Entity	denotes	zVAD.fmk
T7211	12725-12729	Protein	denotes	TNFα
T7286	12760-12782	Phosphorylation	denotes	in Akt phosphorylation
T7240	12763-12766	Protein	denotes	Akt
T7251	12811-12815	Entity	denotes	site
T7197	12817-12823	Entity	denotes	Thr308
T7245	12941-12955	Entity	denotes	of Akt, Ser473
T7179	12944-12948	Protein	denotes	Akt,
T7196	13021-13024	Protein	denotes	p46
T7178	13029-13032	Protein	denotes	p54
T7181	13045-13048	Protein	denotes	JNK
T7193	13057-13072	Entity	denotes	major substrate
T7237	13073-13078	Protein	denotes	c-Jun
T7160	13080-13083	Protein	denotes	Fig
T7298	13090-13174	Positive_regulation	denotes	These data indicate that both Akt and JNK are activated under necroptotic conditions
T7297	13090-13174	Positive_regulation	denotes	These data indicate that both Akt and JNK are activated under necroptotic conditions
T7241	13120-13123	Protein	denotes	Akt
T7218	13128-13131	Protein	denotes	JNK
T29707	13220-13224	Protein	denotes	RIP1
T29720	13220-13291	Phosphorylation	denotes	RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis
T29719	13220-13291	Phosphorylation	denotes	RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis
T29718	13220-13291	Regulation	denotes	RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis
T29717	13220-13291	Regulation	denotes	RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis
T29709	13225-13241	Protein	denotes	kinase-dependent
T29706	13261-13264	Protein	denotes	Akt
T29705	13269-13272	Protein	denotes	JNK
T29708	13326-13334	Entity	denotes	zVAD.fmk
T29714	13338-13381	Protein	denotes	TNFα for 9 hr, followed by western blotting
T29711	13397-13407	Entity	denotes	antibodies
T29712	13444-13456	Entity	denotes	zVAD.fmk (B)
T29704	13460-13464	Protein	denotes	bFGF
T29710	13465-13473	Entity	denotes	zVAD.fmk
T29716	13579-13584	Protein	denotes	Nec-1
T29702	13595-13636	Entity	denotes	to the cells stimulated with bFGF or bFGF
T29713	13624-13628	Protein	denotes	bFGF
T29715	13632-13636	Protein	denotes	bFGF
T29703	13729-13739	Entity	denotes	antibodies
T7210	13741-13767	Protein	denotes	The RIP1 kinase inhibitor,
T7199	13741-13767	Entity	denotes	The RIP1 kinase inhibitor,
T7159	13741-13767	Protein	denotes	The RIP1 kinase inhibitor,
T7253	13768-13773	Protein	denotes	Nec-1
T7307	13768-13839	Negative_regulation	denotes	Nec-1, completely prevented the increase in Thr308 Akt phosphorylation,
T7301	13796-13839	Positive_regulation	denotes	the increase in Thr308 Akt phosphorylation,
T7303	13809-13838	Phosphorylation	denotes	in Thr308 Akt phosphorylation
T7175	13812-13818	Entity	denotes	Thr308
T7156	13812-13822	Protein	denotes	Thr308 Akt
T7267	13893-13898	Protein	denotes	Nec-1
T7292	13923-13945	Phosphorylation	denotes	of JNK phosphorylation
T7216	13926-13929	Protein	denotes	JNK
T7170	13961-13969	Entity	denotes	zVAD.fmk
T7223	14014-14018	Protein	denotes	TNFα
T7173	14081-14084	Protein	denotes	JNK
T7232	14089-14128	Protein	denotes	c-Jun following necroptotic stimulation
T7255	14158-14174	Entity	denotes	zVAD.fmk-induced
T7263	14184-14193	Protein	denotes	in c-Jun,
T7257	14215-14223	Protein	denotes	by Nec-1
T7154	14238-14243	Protein	denotes	Nec-1
T7213	14301-14304	Protein	denotes	Akt
T7269	14308-14321	Protein	denotes	JNK (Fig. 3A)
T7209	14345-14379	Protein	denotes	Akt Thr308 and JNK phosphorylation
T7258	14349-14355	Entity	denotes	Thr308
T7219	14360-14363	Protein	denotes	JNK
T7296	14360-14379	Phosphorylation	denotes	JNK phosphorylation
T7231	14402-14416	Protein	denotes	RIP1 dependent
T7308	14452-14507	Phosphorylation	denotes	the phosphorylation of Akt Thr308, JNK and Jun are late
T7147	14472-14486	Entity	denotes	of Akt Thr308,
T7189	14475-14478	Protein	denotes	Akt
T7235	14487-14490	Protein	denotes	JNK
T7157	14495-14498	Protein	denotes	Jun
T7152	14525-14533	Entity	denotes	zVAD.fmk
T7261	14698-14702	Protein	denotes	RIP1
T7148	14698-14709	Protein	denotes	RIP1 kinase
T7304	14713-14742	Regulation	denotes	necroptotic regulation of Akt
T7254	14736-14742	Protein	denotes	of Akt
T7244	14866-14873	Protein	denotes	of bFGF
T7208	14903-14911	Entity	denotes	zVAD.fmk
T7248	14970-14976	Entity	denotes	Thr308
T7229	14981-14987	Entity	denotes	Ser473
T7188	15007-15010	Protein	denotes	Akt
T7230	15022-15025	Protein	denotes	JNK
T7172	15030-15050	Protein	denotes	c-Jun at 15 minutes,
T7285	15658-15695	Positive_regulation	denotes	the delayed activation of Akt and JNK
T7284	15658-15695	Positive_regulation	denotes	the delayed activation of Akt and JNK
T7278	15658-15695	Negative_regulation	denotes	the delayed activation of Akt and JNK
T7277	15658-15695	Negative_regulation	denotes	the delayed activation of Akt and JNK
T7227	15684-15687	Protein	denotes	Akt
T7174	15692-15695	Protein	denotes	JNK
T7246	15728-15761	Protein	denotes	dependent on RIP1 kinase activity
T7192	15741-15745	Protein	denotes	RIP1
T7290	15853-15905	Negative_regulation	denotes	a delayed increase in Thr308 phosphorylation on Akt,
T7280	15853-15905	Positive_regulation	denotes	a delayed increase in Thr308 phosphorylation on Akt,
T7270	15875-15881	Entity	denotes	Thr308
T7212	15901-15905	Protein	denotes	Akt,
T7171	15906-15915	Protein	denotes	while IGF
T7222	16022-16039	Entity	denotes	of the Akt Thr308
T7266	16029-16032	Protein	denotes	Akt
T7242	16044-16050	Entity	denotes	Ser473
T7300	16109-16218	Positive_regulation	denotes	which also showed a robust delayed necroptosis-specific RIP1-dependent increase in Akt Thr308 phosphorylation
T7295	16127-16218	Regulation	denotes	a robust delayed necroptosis-specific RIP1-dependent increase in Akt Thr308 phosphorylation
T7283	16127-16218	Negative_regulation	denotes	a robust delayed necroptosis-specific RIP1-dependent increase in Akt Thr308 phosphorylation
T7164	16165-16179	Protein	denotes	RIP1-dependent
T7288	16189-16218	Phosphorylation	denotes	in Akt Thr308 phosphorylation
T7205	16192-16195	Protein	denotes	Akt
T7236	16192-16202	Entity	denotes	Akt Thr308
T7206	16220-16223	Protein	denotes	Fig
T7149	16312-16315	Protein	denotes	Akt
T7243	16320-16323	Protein	denotes	JNK
T7309	16320-16340	Phosphorylation	denotes	JNK phosphorylation,
T7163	16361-16368	Entity	denotes	of cell
T7167	16449-16453	Protein	denotes	RIP1
T7168	16449-16460	Protein	denotes	RIP1 kinase
T8045	16463-16467	Protein	denotes	TNFα
T8075	16476-16510	Phosphorylation	denotes	Delayed Akt Thr308 Phosphorylation
T8064	16476-16510	Negative_regulation	denotes	Delayed Akt Thr308 Phosphorylation
T8042	16476-16510	Protein	denotes	Delayed Akt Thr308 Phosphorylation
T8032	16488-16494	Entity	denotes	Thr308
T8071	16539-16567	Positive_regulation	denotes	of Growth Factor Stimulation
T8061	16542-16555	Protein	denotes	Growth Factor
T8046	16584-16587	Protein	denotes	TNF
T8033	16653-16668	Entity	denotes	FGFR inhibitors
T8073	16653-16737	Negative_regulation	denotes	FGFR inhibitors did not attenuate TNFα-induced changes in Akt or JNK phosphorylation	true
T8050	16687-16699	Protein	denotes	TNFα-induced
T8029	16711-16714	Protein	denotes	Akt
T8053	16718-16721	Protein	denotes	JNK
T8068	16718-16737	Phosphorylation	denotes	JNK phosphorylation
T8037	16797-16816	Entity	denotes	zVAD.fmk (Fig. S4A)
T8035	16840-16847	Protein	denotes	of TNFα
T8067	16871-16888	Positive_regulation	denotes	activation of Akt
T8049	16882-16888	Protein	denotes	of Akt
T8055	16889-16893	Entity	denotes	p308
T8041	16946-16949	Protein	denotes	Fig
T8036	16976-16980	Protein	denotes	TNFα
T8065	16976-16990	Positive_regulation	denotes	TNFα signaling
T8076	16976-17033	Regulation	denotes	TNFα signaling to Akt Thr308 is growth factor-independent	true
T8056	16994-16997	Protein	denotes	Akt
T8031	16994-17004	Entity	denotes	Akt Thr308
T8062	17008-17033	Protein	denotes	growth factor-independent
T8069	17048-17073	Positive_regulation	denotes	activation of JNK by TNFα
T8047	17059-17065	Protein	denotes	of JNK
T8059	17066-17073	Protein	denotes	by TNFα
T8043	17107-17115	Entity	denotes	zVAD.fmk
T8057	17133-17137	Protein	denotes	TNFα
T8077	17133-17154	Regulation	denotes	TNFα treatment caused
T8063	17168-17213	Positive_regulation	denotes	robust increase in the phosphorylation of JNK
T8066	17184-17213	Phosphorylation	denotes	in the phosphorylation of JNK
T8038	17207-17213	Protein	denotes	of JNK
T8034	17225-17230	Protein	denotes	Nec-1
T8048	17297-17305	Entity	denotes	pJNK/Jun
T8040	17298-17305	Protein	denotes	JNK/Jun
T8039	17298-17305	Protein	denotes	JNK/Jun
T8030	17302-17305	Protein	denotes	Jun
T8060	17377-17393	Protein	denotes	RIP1-independent
T8058	17436-17496	Protein	denotes	of additional upstream kinases, such as Ask1 to activate JNK
T8054	17459-17475	Protein	denotes	kinases, such as
T8070	17481-17496	Positive_regulation	denotes	to activate JNK
T8052	17493-17496	Protein	denotes	JNK
T8051	17517-17521	Protein	denotes	RIP1
T8074	17517-17560	Positive_regulation	denotes	RIP1 kinase-dependent necroptotic signaling
T8072	17517-17560	Regulation	denotes	RIP1 kinase-dependent necroptotic signaling
T8044	17522-17538	Protein	denotes	kinase-dependent
T8827	17577-17606	Phosphorylation	denotes	in Akt Thr308 Phosphorylation
T8793	17580-17583	Protein	denotes	Akt
T8798	17580-17590	Entity	denotes	Akt Thr308
T8830	17686-17758	Regulation	denotes	the delayed RIP1 kinase-dependent increase in Akt Thr308 phosphorylation
T8825	17686-17758	Positive_regulation	denotes	the delayed RIP1 kinase-dependent increase in Akt Thr308 phosphorylation
T8822	17686-17758	Negative_regulation	denotes	the delayed RIP1 kinase-dependent increase in Akt Thr308 phosphorylation
T8818	17698-17702	Protein	denotes	RIP1
T8794	17698-17719	Protein	denotes	RIP1 kinase-dependent
T8831	17729-17758	Phosphorylation	denotes	in Akt Thr308 phosphorylation
T8802	17732-17735	Protein	denotes	Akt
T8797	17732-17742	Entity	denotes	Akt Thr308
T8799	17910-17932	Protein	denotes	the initial, rapid Akt
T8796	17937-17940	Protein	denotes	JNK
T8823	17937-17964	Phosphorylation	denotes	JNK phosphorylation changes
T8824	17973-18005	Negative_regulation	denotes	the delayed activation (Fig. 4A)
T8815	18047-18094	Protein	denotes	Akt phosphorylation correlates with necroptosis
T8807	18130-18150	Entity	denotes	of the Akt inhibitor
T8795	18137-18140	Protein	denotes	Akt
T8808	18162-18167	Entity	denotes	cells
T8821	18208-18228	Protein	denotes	6 hrs of stimulation
T8820	18234-18242	Entity	denotes	zVAD.fmk
T8817	18244-18248	Protein	denotes	TNFα
T8806	18252-18256	Protein	denotes	bFGF
T8800	18257-18265	Entity	denotes	zVAD.fmk
T8812	18302-18315	Entity	denotes	the inhibitor
T8803	18329-18334	Protein	denotes	9 hrs
T8801	18336-18339	Protein	denotes	Fig
T8810	18393-18417	Entity	denotes	the secondary Akt Thr308
T8828	18393-18433	Phosphorylation	denotes	the secondary Akt Thr308 phosphorylation
T8814	18407-18410	Protein	denotes	Akt
T8804	18458-18466	Protein	denotes	the bFGF
T8811	18498-18505	Protein	denotes	of bFGF
T8819	18522-18533	Entity	denotes	of PD173074
T8805	18567-18570	Protein	denotes	Akt
T8832	18567-18581	Positive_regulation	denotes	Akt activation
T8834	18587-18631	Negative_regulation	denotes	to suppress the secondary increase (Fig. 4D)
T8835	18633-18683	Negative_regulation	denotes	Both pre-addition and delayed addition of PD173074
T8813	18672-18683	Entity	denotes	of PD173074
T8816	18783-18786	Protein	denotes	Akt
T8826	18783-18797	Positive_regulation	denotes	Akt activation
T8833	18890-18962	Negative_regulation	denotes	the delayed activation of Akt in the induction of necroptotic cell death
T8829	18890-18962	Positive_regulation	denotes	the delayed activation of Akt in the induction of necroptotic cell death
T8809	18913-18919	Protein	denotes	of Akt
T30192	19013-19069	Entity	denotes	Thr308 phosphorylation of Akt contributes to necroptosis
T30203	19020-19042	Phosphorylation	denotes	phosphorylation of Akt
T30199	19036-19042	Protein	denotes	of Akt
T30190	19104-19112	Entity	denotes	zVAD.fmk
T30189	19104-19121	Entity	denotes	zVAD.fmk and bFGF
T30187	19125-19129	Entity	denotes	PDGF
T30201	19147-19152	Protein	denotes	Nec-1
T30195	19225-19233	Entity	denotes	zVAD.fmk
T30194	19237-19245	Protein	denotes	TNFα (B)
T30200	19249-19253	Protein	denotes	bFGF
T30198	19254-19262	Entity	denotes	zVAD.fmk
T30196	19296-19299	Protein	denotes	Akt
T30197	19296-19303	Entity	denotes	Akt inh
T30191	19305-19309	Protein	denotes	VIII
T30202	19542-19550	Entity	denotes	PD173074
T30193	19675-19680	Entity	denotes	Cells
T30188	19702-19710	Entity	denotes	PD173074
T10833	19840-19843	Protein	denotes	Akt
T10932	19934-19995	Positive_regulation	denotes	the necroptosis-associated increase in Thr308 phosphorylation
T10836	19973-19979	Entity	denotes	Thr308
T10939	20004-20041	Positive_regulation	denotes	in an increase in Akt kinase activity
T10881	20022-20025	Protein	denotes	Akt
T10915	20022-20032	Protein	denotes	Akt kinase
T10928	20043-20152	Positive_regulation	denotes	Under necroptotic conditions, we observed an increase in the phosphorylation of multiple known Akt substrates
T10813	20138-20141	Protein	denotes	Akt
T10852	20176-20180	Entity	denotes	FoxO
T10883	20182-20239	Protein	denotes	proteins, GSK-3 kinases and mouse double minute 2 (MDM2))
T10910	20192-20197	Protein	denotes	GSK-3
T10860	20192-20205	Protein	denotes	GSK-3 kinases
T10805	20210-20238	Protein	denotes	mouse double minute 2 (MDM2)
T10844	20233-20237	Protein	denotes	MDM2
T10847	20251-20318	Entity	denotes	downstream molecules (p70 ribosomal protein S6 Kinase (p70S6K), S6)
T10827	20273-20314	Protein	denotes	p70 ribosomal protein S6 Kinase (p70S6K),
T10921	20273-20317	Protein	denotes	p70 ribosomal protein S6 Kinase (p70S6K), S6
T10808	20306-20312	Protein	denotes	p70S6K
T10863	20345-20358	Protein	denotes	FoxO1, FoxO4,
T10895	20345-20363	Protein	denotes	FoxO1, FoxO4, MDM2
T10911	20352-20357	Protein	denotes	FoxO4
T10879	20414-20420	Protein	denotes	FoxO3a
T10893	20422-20430	Protein	denotes	GSK-3α/β
T10810	20422-20430	Protein	denotes	GSK-3α/β
T10797	20429-20430	Protein	denotes	β
T10871	20432-20438	Protein	denotes	p70S6K
T10865	20443-20459	Protein	denotes	its substrate S6
T10814	20443-20459	Entity	denotes	its substrate S6
T10899	20575-20578	Protein	denotes	Akt
T10926	20575-20604	Phosphorylation	denotes	Akt phosphorylation (Fig. 5B,
T10896	20629-20635	Protein	denotes	pFoxO1
T10884	20740-20743	Protein	denotes	Fig
T10840	20810-20815	Entity	denotes	Thr24
T10892	20909-20912	Protein	denotes	Akt
T10902	20909-20923	Entity	denotes	Akt substrates
T10907	20939-20957	Protein	denotes	by Nec-1 (Fig. 5A,
T10812	20958-20961	Protein	denotes	Fig
T10838	21045-21048	Protein	denotes	Akt
T10886	21124-21128	Protein	denotes	RIP1
T30618	21193-21198	Entity	denotes	TORC1
T30611	21278-21286	Entity	denotes	zVAD.fmk
T30617	21290-21303	Protein	denotes	TNFα for 9 hr
T30616	21340-21371	Entity	denotes	Cell under serum free condition
T30629	21390-21394	Protein	denotes	bFGF
T30623	21398-21402	Protein	denotes	bFGF
T30613	21403-21411	Entity	denotes	zVAD.fmk
T30627	21496-21506	Entity	denotes	antibodies
T30625	21539-21547	Entity	denotes	zVAD.fmk
T30610	21551-21555	Protein	denotes	TNFα
T30608	21588-21598	Entity	denotes	inhibitors
T30621	21602-21605	Protein	denotes	Akt
T30609	21606-21609	Protein	denotes	Akt
T30606	21606-21613	Entity	denotes	Akt inh
T30612	21615-21619	Protein	denotes	VIII
T30619	21625-21661	Protein	denotes	mTOR (rapamycin, Torin-1 and PI-103)
T30624	21631-21640	Entity	denotes	rapamycin
T30614	21642-21649	Entity	denotes	Torin-1
T30620	21654-21660	Entity	denotes	PI-103
T30605	21667-21671	Entity	denotes	L929
T30615	21667-21703	Entity	denotes	L929 cells with mTOR siRNA knockdown
T30622	21683-21687	Protein	denotes	mTOR
T30628	21752-21760	Entity	denotes	zVAD.fmk
T30626	21764-21779	Protein	denotes	TNFα for 24 hrs
T30607	21773-21779	Protein	denotes	24 hrs
T10834	21889-21892	Protein	denotes	Akt
T10861	21889-21899	Protein	denotes	Akt kinase
T10839	21920-22048	Protein	denotes	a pro-survival protein that inhibits apoptosis through the control of multiple effectors including mTORC1, GSK-3 and others [28]
T10876	22019-22025	Entity	denotes	mTORC1
T10822	22027-22032	Protein	denotes	GSK-3
T10811	22083-22103	Entity	denotes	these same molecules
T10909	22182-22191	Entity	denotes	of mTORC1
T10817	22192-22205	Entity	denotes	by rapamycin,
T10906	22209-22296	Entity	denotes	inhibitor of the mTOR co-factor Raptor [29], protected cells from necroptosis (Fig. 5C)
T10845	22222-22296	Entity	denotes	the mTOR co-factor Raptor [29], protected cells from necroptosis (Fig. 5C)
T10866	22226-22230	Protein	denotes	mTOR
T10870	22241-22252	Protein	denotes	Raptor [29]
T10835	22309-22331	Protein	denotes	the direct mTOR kinase
T10855	22320-22324	Protein	denotes	mTOR
T10856	22332-22341	Entity	denotes	inhibitor
T10841	22332-22353	Entity	denotes	inhibitor Torin1 [30]
T10867	22358-22398	Protein	denotes	the dual PI3K/mTOR inhibitor PI-103 [31]
T10802	22358-22398	Entity	denotes	the dual PI3K/mTOR inhibitor PI-103 [31]
T10830	22377-22386	Entity	denotes	inhibitor
T10816	22459-22475	Entity	denotes	of mTOR using si
T10848	22462-22466	Protein	denotes	mTOR
T10920	22475-22478	Protein	denotes	RNA
T10821	22516-22525	Entity	denotes	inhibitor
T10882	22553-22557	Protein	denotes	mTOR
T10831	22587-22592	Entity	denotes	cells
T10796	22603-22611	Entity	denotes	zVAD.fmk
T10820	22616-22620	Protein	denotes	TNFα
T10857	22636-22639	Protein	denotes	Fig
T10875	22647-22652	Entity	denotes	TORC1
T10924	22647-22709	Regulation	denotes	TORC1 regulates translation through activation of p70S6 kinase
T10929	22683-22709	Positive_regulation	denotes	activation of p70S6 kinase
T10905	22694-22709	Protein	denotes	of p70S6 kinase
T10917	22729-22754	Protein	denotes	ribosomal protein S6 [32]
T10903	22829-22836	Protein	denotes	protein
T10937	22829-22863	Translation	denotes	protein translation in necroptosis
T10853	22893-22947	Entity	denotes	the small molecule inhibitor of p70S6K PF-4708671 [33]
T10794	22893-22947	Entity	denotes	the small molecule inhibitor of p70S6K PF-4708671 [33]
T10919	22925-22931	Protein	denotes	p70S6K
T10837	22925-22942	Entity	denotes	p70S6K PF-4708671
T10935	23005-23029	Negative_regulation	denotes	block S6 phosphorylation
T10823	23011-23013	Protein	denotes	S6
T10931	23011-23029	Phosphorylation	denotes	S6 phosphorylation
T10874	23031-23034	Protein	denotes	Fig
T10916	23069-23124	Protein	denotes	of S6 protein attenuated necroptosis as well (Fig. S5E)
T10815	23075-23082	Protein	denotes	protein
T10888	23167-23176	Protein	denotes	p70S6K/S6
T10798	23167-23176	Protein	denotes	p70S6K/S6
T10878	23174-23176	Protein	denotes	S6
T10829	23247-23250	Protein	denotes	Akt
T10927	23380-23396	Positive_regulation	denotes	of Akt signaling
T10804	23383-23386	Protein	denotes	Akt
T10894	23422-23426	Protein	denotes	RIP1
T10868	23422-23433	Protein	denotes	RIP1 kinase
T10908	23435-23439	Protein	denotes	Akt,
T10803	23435-23446	Entity	denotes	Akt, mTORC1
T10795	23451-23454	Protein	denotes	JNK
T10933	23463-23512	Positive_regulation	denotes	the upregulation of TNFα accompanying necroptosis
T10826	23480-23512	Protein	denotes	of TNFα accompanying necroptosis
T10904	23590-23601	Entity	denotes	by zVAD.fmk
T10825	23658-23692	Protein	denotes	TNFα, which potentiates cell death
T10807	23725-23728	Protein	denotes	Akt
T10862	23761-23775	Protein	denotes	TNFα synthesis
T10930	23788-23834	Regulation	denotes	with a RIP1-dependent increase in TNFα protein
T10850	23795-23809	Protein	denotes	RIP1-dependent
T10887	23819-23834	Protein	denotes	in TNFα protein
T10901	23822-23826	Protein	denotes	TNFα
T10889	23859-23923	Protein	denotes	that TNFα mRNA levels increased during necroptosis in L929 cells
T10828	23869-23873	Protein	denotes	mRNA
T10824	23929-23933	Protein	denotes	RIP1
T10880	23935-23938	Protein	denotes	Fig
T10914	23974-23978	Protein	denotes	bFGF
T10923	23995-24022	Gene_expression	denotes	some induction of TNFα mRNA
T10922	23995-24022	Positive_regulation	denotes	some induction of TNFα mRNA
T10859	24010-24022	Protein	denotes	of TNFα mRNA
T10854	24013-24017	Protein	denotes	TNFα
T10897	24051-24059	Entity	denotes	zVAD.fmk
T10918	24069-24077	Entity	denotes	zVAD.fmk
T10925	24157-24192	Positive_regulation	denotes	a modest upregulation of TNFα mRNA,
T10818	24179-24192	Protein	denotes	of TNFα mRNA,
T10898	24182-24186	Protein	denotes	TNFα
T10877	24244-24263	Entity	denotes	zVAD.fmk (Fig. 6A),
T10799	24358-24385	Protein	denotes	in autocrine TNFα synthesis
T31129	24431-24434	Protein	denotes	Akt
T31120	24439-24445	Entity	denotes	mTORC1
T31143	24454-24478	Protein	denotes	autocrine TNFα synthesis
T31121	24483-24486	Protein	denotes	JNK
T31152	24483-24516	Positive_regulation	denotes	JNK activation during necroptosis
T31150	24522-24527	Entity	denotes	Cells
T31140	24574-24578	Protein	denotes	bFGF
T31135	24582-24586	Entity	denotes	PDGF
T31148	24603-24611	Entity	denotes	zVAD.fmk
T31144	24638-24641	Protein	denotes	PCR
T31142	24651-24659	Protein	denotes	of mTNFα
T31147	24681-24697	Protein	denotes	to mouse 18S RNA
T31123	24690-24693	Protein	denotes	18S
T31125	24730-24738	Entity	denotes	zVAD.fmk
T31131	24742-24746	Protein	denotes	TNFα
T31128	24750-24793	Entity	denotes	cells treated with Nec-1, rapamycin (rapa),
T31137	24769-24793	Protein	denotes	Nec-1, rapamycin (rapa),
T31134	24776-24792	Entity	denotes	rapamycin (rapa)
T31127	24787-24791	Protein	denotes	rapa
T31122	24797-24800	Protein	denotes	Akt
T31145	24797-24804	Entity	denotes	Akt inh
T31149	24806-24810	Protein	denotes	VIII
T31136	24806-24814	Entity	denotes	VIII inh
T31119	24828-24835	Protein	denotes	qRT-PCR
T31133	24845-24864	Protein	denotes	of TNFα mRNA levels
T31118	24848-24852	Protein	denotes	TNFα
T31132	24888-24890	Entity	denotes	si
T31138	24890-24893	Protein	denotes	RNA
T31151	24907-24910	Protein	denotes	Akt
T31141	24929-24937	Protein	denotes	mTOR (D,
T31139	24929-24938	Entity	denotes	mTOR (D,F
T31146	24961-24969	Entity	denotes	zVAD.fmk
T31126	24973-24977	Protein	denotes	TNFα
T31130	25004-25007	Protein	denotes	PCR
T31124	25017-25025	Protein	denotes	of mTNFα
T10846	25131-25134	Protein	denotes	Akt
T10793	25140-25145	Entity	denotes	TORC1
T10934	25160-25208	Positive_regulation	denotes	the upregulation of TNFα mRNA during necroptosis
T10842	25177-25189	Protein	denotes	of TNFα mRNA
T10858	25180-25184	Protein	denotes	TNFα
T10806	25217-25231	Entity	denotes	small-molecule
T10912	25266-25269	Protein	denotes	Akt
T10872	25274-25278	Protein	denotes	mTOR
T10832	25287-25291	Protein	denotes	TNFα
T10851	25287-25303	Protein	denotes	TNFα mRNA levels
T10819	25307-25324	Entity	denotes	necroptotic cells
T10843	25326-25329	Protein	denotes	Fig
T10864	25349-25353	Protein	denotes	RIP1
T10849	25358-25361	Protein	denotes	Akt
T10809	25358-25372	Entity	denotes	Akt inhibitors
T10801	25401-25413	Protein	denotes	of TNFα mRNA
T10873	25404-25408	Protein	denotes	TNFα
T10891	25417-25430	Entity	denotes	control cells
T10869	25437-25457	Entity	denotes	the cells stimulated
T10890	25463-25467	Protein	denotes	bFGF
T10913	25475-25478	Protein	denotes	Fig
T10800	25486-25489	Protein	denotes	Fig
T10938	25508-25596	Regulation	denotes	that these kinases specifically mediate necroptosis-dependent increase in TNFα synthesis
T10885	25513-25526	Protein	denotes	these kinases
T10936	25548-25596	Regulation	denotes	necroptosis-dependent increase in TNFα synthesis
T10900	25579-25596	Protein	denotes	in TNFα synthesis
T12658	25599-25602	Protein	denotes	Akt
T12657	25607-25613	Entity	denotes	mTORC1
T12661	25622-25662	Positive_regulation	denotes	the Activation of JNK during Necroptosis
T12641	25637-25643	Protein	denotes	of JNK
T12630	25663-25666	Protein	denotes	JNK
T12633	25702-25716	Protein	denotes	TNFα synthesis
T12645	25788-25794	Protein	denotes	of Akt
T12637	25806-25816	Entity	denotes	inhibitors
T12666	25820-25851	Negative_regulation	denotes	block the increase in TNFα mRNA
T12626	25839-25851	Protein	denotes	in TNFα mRNA
T12631	25842-25846	Protein	denotes	TNFα
T12668	25885-25925	Positive_regulation	denotes	the activation of JNK during necroptosis
T12648	25900-25906	Protein	denotes	of JNK
T12635	25937-25943	Protein	denotes	of Akt
T12653	25953-25957	Protein	denotes	Akt1
T12652	25962-25966	Protein	denotes	Akt2
T12670	25970-25987	Negative_regulation	denotes	inhibition of Akt
T12640	25981-25987	Protein	denotes	of Akt
T12647	26049-26052	Protein	denotes	JNK
T12628	26057-26062	Protein	denotes	c-Jun
T12663	26057-26078	Phosphorylation	denotes	c-Jun phosphorylation
T12655	26112-26115	Protein	denotes	Akt
T12660	26143-26147	Protein	denotes	RIP1
T12642	26152-26155	Protein	denotes	JNK
T12669	26152-26166	Positive_regulation	denotes	JNK activation
T12667	26181-26198	Negative_regulation	denotes	inhibition of Akt
T12625	26192-26198	Protein	denotes	of Akt
T12638	26258-26262	Protein	denotes	bFGF
T12639	26263-26271	Entity	denotes	zVAD.fmk
T12654	26280-26283	Protein	denotes	JNK
T12632	26288-26293	Protein	denotes	c-Jun
T12664	26288-26309	Phosphorylation	denotes	c-Jun phosphorylation
T12643	26335-26339	Protein	denotes	mTOR
T12629	26341-26350	Entity	denotes	rapamycin
T12651	26355-26386	Entity	denotes	the p70S6K inhibitor PF-4708671
T12636	26355-26386	Entity	denotes	the p70S6K inhibitor PF-4708671
T12659	26359-26365	Protein	denotes	p70S6K
T12646	26442-26445	Protein	denotes	JNK
T12627	26450-26455	Protein	denotes	c-Jun
T12662	26450-26471	Phosphorylation	denotes	c-Jun phosphorylation
T12656	26473-26476	Protein	denotes	Fig
T12644	26486-26492	Protein	denotes	G, Fig
T12649	26583-26587	Protein	denotes	RIP1
T12650	26583-26595	Protein	denotes	RIP1 kinase,
T12665	26612-26673	Positive_regulation	denotes	the increase in JNK activity during necroptosis in L929 cells
T12634	26628-26631	Protein	denotes	JNK
T13372	26676-26686	Protein	denotes	PI3-kinase
T13397	26676-26752	Regulation	denotes	PI3-kinase and PDK1 Mediate the Increase in Akt Thr308 Phosphorylation Under
T13396	26676-26752	Regulation	denotes	PI3-kinase and PDK1 Mediate the Increase in Akt Thr308 Phosphorylation Under
T13391	26691-26695	Protein	denotes	PDK1
T13383	26717-26752	Entity	denotes	in Akt Thr308 Phosphorylation Under
T13366	26720-26723	Protein	denotes	Akt
T13368	26795-26801	Protein	denotes	of Akt
T13381	26909-26919	Protein	denotes	pleckstrin
T13384	26930-26932	Protein	denotes	PH
T13386	26934-26971	Entity	denotes	domain of Akt to the product of PI3K,
T13377	26944-26947	Protein	denotes	Akt
T13365	26963-26971	Protein	denotes	of PI3K,
T13364	27013-27017	Entity	denotes	PIP3
T13362	27023-27035	Entity	denotes	the membrane
T13373	27037-27040	Protein	denotes	Akt
T13398	27037-27135	Phosphorylation	denotes	Akt is phosphorylated on Thr308 and Ser473 by 3-phosphoinositide dependent protein kinase-1 (PDK1)
T13361	27062-27068	Entity	denotes	Thr308
T13385	27073-27079	Entity	denotes	Ser473
T13379	27080-27135	Protein	denotes	by 3-phosphoinositide dependent protein kinase-1 (PDK1)
T13369	27130-27134	Protein	denotes	PDK1
T13393	27214-27220	Entity	denotes	Thr308
T13370	27214-27224	Protein	denotes	Thr308 Akt
T13399	27214-27240	Phosphorylation	denotes	Thr308 Akt phosphorylation
T13367	27324-27328	Protein	denotes	PI3K
T13378	27333-27337	Protein	denotes	PDK1
T13403	27339-27366	Negative_regulation	denotes	Inhibition of PI3K and PDK1
T13402	27339-27366	Negative_regulation	denotes	Inhibition of PI3K and PDK1
T13382	27353-27357	Protein	denotes	PI3K
T13392	27362-27366	Protein	denotes	PDK1
T13376	27476-27479	Protein	denotes	Akt
T13388	27476-27486	Entity	denotes	Akt Thr308
T13400	27476-27502	Phosphorylation	denotes	Akt Thr308 phosphorylation
T13371	27504-27507	Protein	denotes	Fig
T13389	27527-27529	Entity	denotes	si
T13359	27529-27532	Protein	denotes	RNA
T13363	27543-27618	Entity	denotes	of PDK1 protected cells from death and inhibited Akt Thr308 phosphorylation
T13380	27546-27550	Protein	denotes	PDK1
T13395	27582-27618	Phosphorylation	denotes	inhibited Akt Thr308 phosphorylation
T13394	27582-27618	Negative_regulation	denotes	inhibited Akt Thr308 phosphorylation
T13374	27592-27595	Protein	denotes	Akt
T13390	27592-27602	Entity	denotes	Akt Thr308
T13375	27620-27623	Protein	denotes	Fig
T13387	27652-27656	Protein	denotes	PDK1
T13401	27688-27735	Positive_regulation	denotes	non-canonical Akt activation during necroptosis
T13360	27702-27705	Protein	denotes	Akt
T15681	27879-27910	Protein	denotes	active wild type Akt1 (Myr-Akt)
T15633	27902-27909	Protein	denotes	Myr-Akt
T15653	27932-27953	Protein	denotes	inactive mutant K179M
T15624	28024-28028	Protein	denotes	RIP1
T15637	28024-28035	Protein	denotes	RIP1 kinase
T15702	28039-28042	Protein	denotes	Akt
T15757	28039-28053	Positive_regulation	denotes	Akt activation
T15748	28074-28124	Gene_expression	denotes	Constitutively active Akt1 (Myr-Akt) was generated
T15634	28089-28110	Protein	denotes	active Akt1 (Myr-Akt)
T15616	28102-28109	Protein	denotes	Myr-Akt
T15767	28157-28189	Positive_regulation	denotes	the addition of a myristoylation
T15743	28241-28260	Entity	denotes	the plasma membrane
T15693	28268-28306	Protein	denotes	the deletion of the auto-inhibitory PH
T15722	28307-28323	Entity	denotes	domain (Fig. 7A)
T15613	28340-28375	Protein	denotes	Akt that is active under serum free
T15759	28406-28434	Gene_expression	denotes	the cells expressing Myr-Akt
T15730	28406-28434	Entity	denotes	the cells expressing Myr-Akt
T15672	28427-28434	Protein	denotes	Myr-Akt
T15659	28488-28518	Entity	denotes	the empty vector control cells
T15729	28611-28626	Protein	denotes	that active Akt
T15667	28713-28747	Entity	denotes	Myr-Akt, but not the K179M mutant,
T15715	28713-28747	Entity	denotes	Myr-Akt, but not the K179M mutant,
T15717	28717-28720	Protein	denotes	Akt
T15704	28730-28746	Protein	denotes	the K179M mutant
T15657	28763-28779	Entity	denotes	zVAD.fmk-induced
T15682	28826-28843	Protein	denotes	Myr-Akt dependent
T15752	28901-28930	Phosphorylation	denotes	in Akt Thr308 phosphorylation
T15643	28904-28907	Protein	denotes	Akt
T15640	28904-28914	Entity	denotes	Akt Thr308
T15627	28932-28935	Protein	denotes	Fig
T15740	28944-28951	Protein	denotes	Myr-Akt
T15745	28965-29035	Positive_regulation	denotes	other zVAD.fmk-dependent events, including activation of JNK and c-Jun
T15744	28965-29035	Positive_regulation	denotes	other zVAD.fmk-dependent events, including activation of JNK and c-Jun
T15699	28971-28989	Entity	denotes	zVAD.fmk-dependent
T15660	29022-29025	Protein	denotes	JNK
T15668	29030-29035	Protein	denotes	c-Jun
T15651	29053-29056	Protein	denotes	Fig
T15766	29066-29091	Positive_regulation	denotes	upregulation of TNFα mRNA
T15697	29079-29091	Protein	denotes	of TNFα mRNA
T15683	29082-29086	Protein	denotes	TNFα
T15724	29093-29096	Protein	denotes	Fig
T15619	29173-29176	Protein	denotes	Akt
T15655	29180-29213	Entity	denotes	the apex of necroptotic signaling
T15712	29257-29293	Protein	denotes	of active and membrane localized Akt
T15735	29271-29289	Entity	denotes	membrane localized
T15725	29320-29323	Protein	denotes	Akt
T15765	29320-29334	Positive_regulation	denotes	Akt activation
T15694	29359-29372	Protein	denotes	growth factor
T15749	29359-29382	Positive_regulation	denotes	growth factor signaling
T15690	29384-29388	Protein	denotes	RIP1
T15641	29384-29395	Protein	denotes	RIP1 kinase
T15746	29411-29456	Regulation	denotes	to regulate Akt activation during necroptosis
T15606	29423-29426	Protein	denotes	Akt
T15758	29423-29437	Positive_regulation	denotes	Akt activation
T15710	29493-29497	Protein	denotes	RIP1
T15721	29493-29504	Protein	denotes	RIP1 kinase
T15649	29549-29552	Protein	denotes	Akt
T31749	29805-29812	Entity	denotes	Myr-Akt
T31747	29805-29812	Protein	denotes	Myr-Akt
T31764	29834-29856	Protein	denotes	inactive Myr-Akt K179M
T31754	29834-29856	Entity	denotes	inactive Myr-Akt K179M
T31763	29898-29909	Entity	denotes	of zVAD.fmk
T31743	29981-29990	Protein	denotes	Nec-1 (B)
T31778	30041-30048	Entity	denotes	Myr-Akt
T31739	30041-30048	Protein	denotes	Myr-Akt
T31776	30053-30072	Entity	denotes	Myr-Akt K179M cells
T31774	30053-30072	Protein	denotes	Myr-Akt K179M cells
T31767	30053-30072	Entity	denotes	Myr-Akt K179M cells
T31755	30091-30099	Entity	denotes	zVAD.fmk
T31765	30107-30149	Protein	denotes	Nec-1 under serum free conditions for 9 hr
T31751	30196-30206	Entity	denotes	antibodies
T31769	30208-30226	Protein	denotes	Endogenous Akt (∼)
T31760	30231-30238	Protein	denotes	Myr-Akt
T31748	30231-30238	Entity	denotes	Myr-Akt
T31761	30301-30308	Protein	denotes	Myr-Akt
T31746	30301-30308	Entity	denotes	Myr-Akt
T31780	30313-30328	Entity	denotes	Myr-Akt K179KM,
T31759	30313-30328	Entity	denotes	Myr-Akt K179KM,
T31750	30313-30328	Protein	denotes	Myr-Akt K179KM,
T31741	30350-30367	Entity	denotes	zVAD.fmk for 9 hr
T31770	30397-30401	Protein	denotes	TNFα
T31758	30397-30413	Protein	denotes	TNFα mRNA levels
T31775	30462-30475	Protein	denotes	mouse 18S RNA
T31773	30468-30471	Protein	denotes	18S
T31757	30478-30481	Entity	denotes	E-G
T31762	30483-30487	Entity	denotes	L929
T31756	30483-30557	Entity	denotes	L929 cells expressing Myr-Akt and Ala and Asp mutants of Thr308 and Ser473
T31772	30505-30512	Entity	denotes	Myr-Akt
T31742	30505-30512	Protein	denotes	Myr-Akt
T31740	30517-30520	Entity	denotes	Ala
T31745	30525-30528	Protein	denotes	Asp
T31753	30540-30546	Entity	denotes	Thr308
T31766	30551-30557	Entity	denotes	Ser473
T31752	30576-30584	Entity	denotes	zVAD.fmk
T31768	30678-30679	Entity	denotes	F
T31779	30696-30726	Protein	denotes	of TNFα mRNA levels by qRT-PCR
T31777	30699-30703	Protein	denotes	TNFα
T31744	30719-30726	Protein	denotes	qRT-PCR
T31771	30730-30739	Protein	denotes	9 hrs (G)
T15708	30825-30835	Protein	denotes	of Myr-Akt
T15612	30865-30872	Protein	denotes	Myr-Akt
T15685	30908-30911	Protein	denotes	Akt
T15677	30967-30970	Protein	denotes	Akt
T15684	30967-30981	Entity	denotes	Akt substrates
T15764	31001-31053	Gene_expression	denotes	the expression of Myr-Akt, but not the K179M mutant,
T15610	31016-31026	Protein	denotes	of Myr-Akt
T15644	31036-31052	Protein	denotes	the K179M mutant
T15632	31070-31085	Entity	denotes	these molecules
T15609	31090-31093	Protein	denotes	Akt
T15630	31090-31104	Entity	denotes	Akt substrates
T15707	31141-31152	Entity	denotes	of zVAD.fmk
T15761	31200-31239	Positive_regulation	denotes	the increased basal activity of Myr-Akt
T15614	31229-31239	Protein	denotes	of Myr-Akt
T15675	31241-31296	Entity	denotes	Some substrates, including p70S6K, S6, GSK-3 and FoxO4,
T15714	31268-31274	Protein	denotes	p70S6K
T15741	31276-31278	Protein	denotes	S6
T15663	31280-31285	Protein	denotes	GSK-3
T15698	31290-31295	Protein	denotes	FoxO4
T15666	31343-31354	Entity	denotes	of zVAD.fmk
T15751	31375-31408	Phosphorylation	denotes	phosphorylation of FoxO1 and MDM2
T15750	31375-31408	Phosphorylation	denotes	phosphorylation of FoxO1 and MDM2
T15755	31375-31465	Positive_regulation	denotes	phosphorylation of FoxO1 and MDM2 was significantly increased in the presence of zVAD.fmk,
T15754	31375-31465	Positive_regulation	denotes	phosphorylation of FoxO1 and MDM2 was significantly increased in the presence of zVAD.fmk,
T15656	31394-31399	Protein	denotes	FoxO1
T15718	31404-31408	Protein	denotes	MDM2
T15638	31453-31464	Entity	denotes	of zVAD.fmk
T15771	31482-31527	Phosphorylation	denotes	necroptotic Thr308 phosphorylation of Myr-Akt
T15706	31494-31500	Entity	denotes	Thr308
T15631	31517-31527	Protein	denotes	of Myr-Akt
T15703	31589-31605	Entity	denotes	zVAD.fmk-induced
T15618	31625-31657	Protein	denotes	cell death, JNK activation, TNFα
T15747	31625-31668	Gene_expression	denotes	cell death, JNK activation, TNFα production
T15620	31637-31640	Protein	denotes	JNK
T15760	31637-31651	Positive_regulation	denotes	JNK activation
T15648	31707-31714	Protein	denotes	Myr-Akt
T15701	31764-31767	Protein	denotes	Akt
T15662	31810-31846	Entity	denotes	that membrane localization of Akt is
T15692	31837-31843	Protein	denotes	of Akt
T15686	31857-31861	Protein	denotes	Full
T15688	31869-31872	Protein	denotes	Akt
T15671	31898-31911	Entity	denotes	the PH domain
T15719	31902-31904	Protein	denotes	PH
T15720	31920-31923	Entity	denotes	Myr
T15642	31986-31992	Entity	denotes	Thr308
T15628	32019-32027	Entity	denotes	zVAD.fmk
T15713	32066-32069	Protein	denotes	Fig
T15669	32129-32135	Entity	denotes	Thr308
T15625	32199-32205	Protein	denotes	of Akt
T15676	32233-32236	Entity	denotes	Ala
T15652	32250-32256	Entity	denotes	Thr308
T15673	32261-32267	Entity	denotes	Ser473
T15608	32312-32318	Protein	denotes	of Akt
T15691	32320-32337	Protein	denotes	while Asp mutants
T15654	32388-32391	Entity	denotes	Ala
T15734	32396-32421	Protein	denotes	Asp mutants at both sites
T15709	32456-32472	Protein	denotes	both Asp mutants
T15711	32503-32520	Protein	denotes	to wild type Akt,
T15696	32532-32543	Entity	denotes	Ala mutants
T15621	32637-32643	Entity	denotes	Thr308
T15695	32648-32654	Entity	denotes	Ser473
T15762	32711-32738	Positive_regulation	denotes	promote necroptotic changes
T15716	32767-32784	Protein	denotes	the S473D mutant,
T15733	32813-32819	Entity	denotes	Thr308
T15639	32890-32901	Protein	denotes	while S473A
T15617	32963-32968	Protein	denotes	S473A
T15727	33016-33022	Entity	denotes	Thr308
T15680	33056-33063	Entity	denotes	the Ala
T15623	33072-33080	Entity	denotes	473 site
T15678	33114-33128	Entity	denotes	a docking site
T15626	33133-33137	Protein	denotes	PDK1
T15629	33155-33166	Entity	denotes	Thr308 [39]
T15664	33185-33188	Entity	denotes	Ala
T15728	33193-33214	Protein	denotes	Asp mutants of Thr308
T15700	33208-33214	Entity	denotes	Thr308
T15769	33271-33303	Phosphorylation	denotes	phosphorylation of JNK and c-Jun
T15768	33271-33303	Phosphorylation	denotes	phosphorylation of JNK and c-Jun
T15689	33290-33293	Protein	denotes	JNK
T15687	33298-33303	Protein	denotes	c-Jun
T15636	33309-33313	Protein	denotes	TNFα
T15742	33309-33318	Protein	denotes	TNFα mRNA
T15665	33339-33388	Protein	denotes	T308D, in spite of being an active Akt construct,
T15739	33374-33377	Protein	denotes	Akt
T15736	33402-33434	Entity	denotes	perfect mimic of phosphorylation
T15723	33456-33469	Protein	denotes	of the kinase
T15737	33542-33555	Entity	denotes	of substrates
T15738	33559-33568	Entity	denotes	the cells
T15622	33583-33588	Protein	denotes	T308D
T15607	33639-33772	Entity	denotes	several substrates that were phosphorylated by the Myr-Akt construct in the presence of zVAD including FoxO1, Foxo4, MDM2, and p70S6K
T15646	33690-33697	Protein	denotes	Myr-Akt
T15611	33742-33747	Protein	denotes	FoxO1
T15645	33749-33754	Protein	denotes	Foxo4
T15679	33756-33760	Protein	denotes	MDM2
T15705	33766-33772	Protein	denotes	p70S6K
T15658	33774-33777	Protein	denotes	Fig
T15635	33849-33855	Entity	denotes	Thr308
T15731	33931-33934	Protein	denotes	Akt
T15650	33931-33941	Protein	denotes	Akt kinase
T15732	33952-33955	Protein	denotes	Akt
T15615	33973-33983	Entity	denotes	substrates
T15726	34012-34026	Protein	denotes	TNFα synthesis
T15661	34028-34031	Protein	denotes	JNK
T15770	34028-34042	Positive_regulation	denotes	JNK activation
T18066	34069-34072	Protein	denotes	Akt
T18100	34069-34117	Regulation	denotes	Akt Controls TNFα Production in Other Cell Types
T18064	34082-34086	Protein	denotes	TNFα
T18098	34082-34117	Gene_expression	denotes	TNFα Production in Other Cell Types
T18099	34101-34117	Localization	denotes	Other Cell Types
T18056	34101-34117	Protein	denotes	Other Cell Types
T18051	34107-34111	Entity	denotes	Cell
T18103	34146-34180	Regulation	denotes	of RIP1 kinase-dependent signaling
T18095	34146-34180	Positive_regulation	denotes	of RIP1 kinase-dependent signaling
T18035	34149-34153	Protein	denotes	RIP1
T18038	34154-34170	Protein	denotes	kinase-dependent
T18062	34184-34201	Protein	denotes	Akt in L929 cells
T18061	34233-34301	Entity	denotes	to other cell types that are known to undergo necroptotic cell death
T18082	34303-34306	Protein	denotes	Fas
T18096	34303-34350	Binding	denotes	Fas-associated protein with death domain (FADD)
T18039	34318-34325	Protein	denotes	protein
T18055	34326-34350	Entity	denotes	with death domain (FADD)
T18084	34345-34349	Protein	denotes	FADD
T18086	34350-34381	Entity	denotes	-deficient Jurkat T lymphocytes
T18080	34390-34400	Entity	denotes	macrophage
T18049	34509-34513	Protein	denotes	TNFα
T18070	34517-34525	Entity	denotes	zVAD.fmk
T18106	34569-34641	Regulation	denotes	a RIP1 kinase dependent increase in the phosphorylation of Thr308 on Akt
T18104	34569-34641	Positive_regulation	denotes	a RIP1 kinase dependent increase in the phosphorylation of Thr308 on Akt
T18057	34571-34575	Protein	denotes	RIP1
T18069	34576-34592	Protein	denotes	kinase dependent
T18052	34625-34634	Entity	denotes	of Thr308
T18044	34638-34641	Protein	denotes	Akt
T18058	34687-34703	Entity	denotes	these cell types
T18063	34718-34722	Protein	denotes	TNFα
T18092	34753-34777	Entity	denotes	each of these cell types
T18079	34758-34777	Entity	denotes	of these cell types
T18093	34831-34835	Protein	denotes	RIP1
T18077	34840-34843	Protein	denotes	Akt
T18088	34840-34854	Entity	denotes	Akt inhibitors
T18105	34879-34896	Negative_regulation	denotes	inhibition of Akt
T18090	34890-34896	Protein	denotes	of Akt
T18042	34913-34924	Entity	denotes	these cells
T18073	35004-35008	Protein	denotes	TNFα
T18040	35102-35108	Protein	denotes	of Akt
T18067	35128-35142	Protein	denotes	by RIP1 kinase
T18087	35131-35135	Protein	denotes	RIP1
T18083	35146-35165	Entity	denotes	multiple cell types
T32265	35283-35331	Gene_expression	denotes	autocrine TNFα production in multiple cell types
T32263	35293-35297	Protein	denotes	TNFα
T32236	35312-35331	Entity	denotes	multiple cell types
T32259	35333-35337	Protein	denotes	FADD
T32264	35333-35360	Entity	denotes	FADD deficient Jurkat cells
T32245	35379-35414	Protein	denotes	TNFα followed by measurement of (A)
T32235	35415-35430	Protein	denotes	human TNFα mRNA
T32253	35421-35425	Protein	denotes	TNFα
T32241	35441-35448	Protein	denotes	qRT-PCR
T32251	35470-35483	Protein	denotes	human 18S RNA
T32252	35476-35479	Protein	denotes	18S
T32261	35558-35566	Entity	denotes	zVAD.fmk
T32247	35628-35658	Protein	denotes	of TNFα mRNA levels by qRT-PCR
T32244	35631-35635	Protein	denotes	TNFα
T32239	35651-35658	Protein	denotes	qRT-PCR
T32257	35665-35666	Entity	denotes	F
T32242	35694-35697	Protein	denotes	Akt
T32238	35709-35736	Entity	denotes	lung fibroblasts expressing
T32250	35737-35744	Entity	denotes	Myr-Akt
T32262	35737-35744	Protein	denotes	Myr-Akt
T32248	35772-35780	Entity	denotes	zVAD.fmk
T32240	35785-35844	Protein	denotes	TNFα followed by measurement of TNFα mRNA levels by qRT-PCR
T32232	35814-35833	Protein	denotes	of TNFα mRNA levels
T32256	35822-35826	Protein	denotes	mRNA
T32234	35837-35844	Protein	denotes	qRT-PCR
T32233	35855-35856	Entity	denotes	H
T32260	35869-35920	Entity	denotes	fibroblasts expressing only endogenous Akt1 or Akt2
T32267	35869-35920	Gene_expression	denotes	fibroblasts expressing only endogenous Akt1 or Akt2
T32266	35869-35920	Gene_expression	denotes	fibroblasts expressing only endogenous Akt1 or Akt2
T32258	35892-35912	Protein	denotes	only endogenous Akt1
T32255	35916-35920	Protein	denotes	Akt2
T32249	35939-35947	Entity	denotes	zVAD.fmk
T32246	35952-36011	Protein	denotes	TNFα followed by measurement of TNFα mRNA levels by qRT-PCR
T32254	35981-36000	Protein	denotes	of TNFα mRNA levels
T32243	35984-35988	Protein	denotes	TNFα
T32237	36004-36011	Protein	denotes	qRT-PCR
T18074	36055-36061	Protein	denotes	of Akt
T18048	36080-36102	Entity	denotes	mouse lung fibroblasts
T18050	36104-36186	Entity	denotes	Lung fibroblasts selected to survive after deletion of all three Akt isoforms [40]
T18071	36169-36172	Protein	denotes	Akt
T18037	36243-36247	Protein	denotes	TNFα
T18094	36252-36260	Entity	denotes	zVAD.fmk
T18078	36290-36310	Protein	denotes	active Akt (Myr-Akt)
T18089	36302-36309	Entity	denotes	Myr-Akt
T18059	36302-36309	Protein	denotes	Myr-Akt
T18041	36314-36325	Entity	denotes	these cells
T18053	36335-36339	Protein	denotes	TNFα
T18091	36335-36344	Protein	denotes	TNFα mRNA
T18101	36335-36355	Gene_expression	denotes	TNFα mRNA production
T18034	36371-36375	Protein	denotes	TNFα
T18032	36380-36388	Entity	denotes	zVAD.fmk
T18045	36390-36393	Protein	denotes	Fig
T18036	36435-36438	Protein	denotes	Fig
T18047	36474-36477	Protein	denotes	Akt
T18108	36499-36545	Gene_expression	denotes	fibroblasts expressing endogenous Akt1 or Akt2
T18107	36499-36545	Gene_expression	denotes	fibroblasts expressing endogenous Akt1 or Akt2
T18075	36499-36545	Entity	denotes	fibroblasts expressing endogenous Akt1 or Akt2
T18043	36522-36537	Protein	denotes	endogenous Akt1
T18060	36541-36545	Protein	denotes	Akt2
T18054	36569-36575	Entity	denotes	Thr308
T18033	36591-36595	Protein	denotes	TNFα
T18076	36600-36608	Entity	denotes	zVAD.fmk
T18072	36610-36613	Protein	denotes	Fig
T18081	36638-36669	Protein	denotes	robust RIP1-dependent TNFα mRNA
T18102	36638-36682	Positive_regulation	denotes	robust RIP1-dependent TNFα mRNA upregulation
T18031	36645-36659	Protein	denotes	RIP1-dependent
T18046	36660-36664	Protein	denotes	TNFα
T18085	36770-36778	Protein	denotes	that Akt
T18065	36800-36829	Protein	denotes	for autocrine TNFα synthesis,
T18068	36926-36938	Protein	denotes	Akt-mediated
T18097	36926-36990	Regulation	denotes	Akt-mediated inflammatory signaling under necroptotic conditions
T19845	37024-37028	Protein	denotes	RIP1
T19840	37030-37033	Protein	denotes	Akt
T19792	37038-37051	Protein	denotes	JNK Dependent
T19815	37065-37087	Entity	denotes	Necroptotic L929 Cells
T19857	37077-37081	Entity	denotes	L929
T19826	37118-37122	Protein	denotes	RIP1
T19812	37123-37139	Protein	denotes	kinase-dependent
T19788	37165-37194	Entity	denotes	mouse fibrosarcoma L929 cells
T19777	37165-37194	Entity	denotes	mouse fibrosarcoma L929 cells
T19830	37237-37271	Entity	denotes	the pan-caspase inhibitor zVAD.fmk
T19823	37237-37271	Protein	denotes	the pan-caspase inhibitor zVAD.fmk
T19863	37253-37262	Entity	denotes	inhibitor
T19865	37310-37313	Protein	denotes	Akt
T19838	37310-37320	Protein	denotes	Akt kinase
T19852	37374-37378	Protein	denotes	RIP1
T19822	37374-37386	Protein	denotes	RIP1 kinase,
T19794	37446-37455	Entity	denotes	on Thr308
T19804	37465-37471	Entity	denotes	Ser473
T19888	37506-37551	Phosphorylation	denotes	necroptosis-associated phosphorylation of Akt
T19786	37545-37551	Protein	denotes	of Akt
T19834	37645-37664	Entity	denotes	the plasma membrane
T19877	37678-37684	Protein	denotes	of Akt
T19841	37717-37734	Entity	denotes	membrane-targeted
T19839	37735-37738	Protein	denotes	Akt
T19868	37750-37757	Protein	denotes	Myr-Akt
T19881	37823-37844	Gene_expression	denotes	expression of Myr-Akt
T19861	37834-37844	Protein	denotes	of Myr-Akt
T19801	37913-37917	Protein	denotes	RIP1
T19785	37918-37934	Protein	denotes	kinase-dependent
T19835	37957-37963	Entity	denotes	Thr308
T19897	37957-37986	Phosphorylation	denotes	Thr308 phosphorylation of Akt
T19784	37980-37986	Protein	denotes	of Akt
T19781	38002-38009	Protein	denotes	caspase
T19886	38002-38020	Negative_regulation	denotes	caspase inhibition
T32557	38138-38142	Protein	denotes	RIP1
T32554	38144-38147	Protein	denotes	Akt
T32552	38152-38155	Protein	denotes	JNK
T32568	38152-38175	Positive_regulation	denotes	JNK dependent signaling
T32565	38179-38201	Entity	denotes	necroptotic L929 cells
T32563	38191-38195	Entity	denotes	L929
T32560	38203-38206	Protein	denotes	Akt
T32571	38203-38251	Phosphorylation	denotes	Akt phosphorylation at Thr308 during necroptosis
T32570	38203-38308	Regulation	denotes	Akt phosphorylation at Thr308 during necroptosis requires inputs from both growth factors and RIP1 kinase
T32559	38226-38232	Entity	denotes	Thr308
T32556	38297-38301	Protein	denotes	RIP1
T32553	38297-38308	Protein	denotes	RIP1 kinase
T32567	38326-38330	Protein	denotes	Akt,
T32555	38326-38345	Protein	denotes	Akt, JNK activation
T32561	38352-38369	Protein	denotes	to TNFα synthesis
T32569	38371-38407	Positive_regulation	denotes	Activation of Akt during necroptosis
T32564	38382-38388	Protein	denotes	of Akt
T32572	38419-38484	Phosphorylation	denotes	the phosphorylation of several known Akt substrates, such as mTOR
T32566	38439-38484	Protein	denotes	of several known Akt substrates, such as mTOR
T32562	38442-38479	Entity	denotes	several known Akt substrates, such as
T32558	38456-38459	Protein	denotes	Akt
T19793	38562-38565	Protein	denotes	Akt
T19846	38562-38577	Entity	denotes	Akt inhibitors,
T19800	38591-38594	Protein	denotes	Akt
T19827	38624-38638	Protein	denotes	of Akt mutants
T19898	38655-38684	Positive_regulation	denotes	necroptotic activation of Akt
T19774	38678-38684	Protein	denotes	of Akt
T19829	38777-38790	Protein	denotes	Akt-dependent
T19890	38860-38914	Phosphorylation	denotes	selective necroptotic phosphorylation of Thr308 of Akt
T19831	38898-38914	Entity	denotes	of Thr308 of Akt
T19776	38911-38914	Protein	denotes	Akt
T19849	38971-38990	Entity	denotes	of known substrates
T19795	38995-38998	Protein	denotes	Akt
T19858	38999-39024	Entity	denotes	effector pathways such as
T19802	39025-39043	Entity	denotes	the mTORC1 pathway
T19799	39115-39123	Protein	denotes	that Akt
T19851	39170-39174	Protein	denotes	RIP1
T19811	39170-39211	Protein	denotes	RIP1 kinase to known downstream signaling
T19783	39236-39258	Entity	denotes	necroptotic L929 cells
T19789	39248-39252	Entity	denotes	L929
T19810	39268-39271	Protein	denotes	JNK
T19884	39268-39282	Positive_regulation	denotes	JNK activation
T19874	39287-39311	Protein	denotes	autocrine TNFα synthesis
T19843	39348-39363	Entity	denotes	L929 cells [15]
T19889	39401-39465	Phosphorylation	denotes	we examined Akt phosphorylation after inhibition of a downstream
T19860	39413-39416	Protein	denotes	Akt
T19875	39466-39492	Protein	denotes	kinase in the pathway, JNK
T19796	39476-39492	Protein	denotes	the pathway, JNK
T19820	39512-39526	Entity	denotes	that SP600125,
T19893	39527-39594	Negative_regulation	denotes	which protected L929 cells from death and inhibited TNFα production
T19787	39579-39583	Protein	denotes	TNFα
T19892	39579-39594	Gene_expression	denotes	TNFα production
T19871	39596-39599	Protein	denotes	Fig
T19825	39683-39686	Protein	denotes	Akt
T19870	39695-39701	Entity	denotes	Ser473
T19814	39706-39712	Entity	denotes	Thr308
T19901	39789-39860	Negative_regulation	denotes	inhibitor that may inhibit the p110δ subunit of PI3K [41] and PDK1 [42]		true
T19900	39789-39860	Negative_regulation	denotes	inhibitor that may inhibit the p110δ subunit of PI3K [41] and PDK1 [42]		true
T19878	39789-39860	Entity	denotes	inhibitor that may inhibit the p110δ subunit of PI3K [41] and PDK1 [42]
T19790	39816-39846	Protein	denotes	the p110δ subunit of PI3K [41]
T19782	39837-39841	Protein	denotes	PI3K
T19854	39851-39860	Protein	denotes	PDK1 [42]
T19883	39909-39942	Phosphorylation	denotes	basal Akt phosphorylation levels,
T19844	39915-39918	Protein	denotes	Akt
T19856	39962-39973	Entity	denotes	of SP600125
T19779	40021-40027	Protein	denotes	of JNK
T19876	40044-40099	Entity	denotes	a more specific JNK inhibitor, JNK inhibitor VIII [43],
T19816	40060-40063	Protein	denotes	JNK
T19808	40075-40078	Protein	denotes	JNK
T19855	40075-40098	Entity	denotes	JNK inhibitor VIII [43]
T19813	40075-40098	Protein	denotes	JNK inhibitor VIII [43]
T19828	40119-40123	Protein	denotes	JNK1
T19819	40128-40132	Protein	denotes	JNK2
T19805	40134-40145	Protein	denotes	Fig. S10B–G
T19866	40197-40203	Protein	denotes	JNK1/2
T19842	40197-40203	Protein	denotes	JNK1/2
T19867	40202-40203	Protein	denotes	2
T19896	40212-40234	Phosphorylation	denotes	phosphorylation of Akt
T19821	40228-40234	Protein	denotes	of Akt
T19859	40238-40244	Entity	denotes	Thr308
T19894	40262-40299	Phosphorylation	denotes	the phosphorylation of c-Jun at Ser63
T19837	40282-40290	Protein	denotes	of c-Jun
T19847	40294-40299	Entity	denotes	Ser63
T19850	40384-40388	Protein	denotes	TNFα
T19880	40384-40399	Gene_expression	denotes	TNFα production
T19832	40415-40418	Protein	denotes	Fig
T19873	40427-40431	Entity	denotes	F,G)
T19775	40488-40491	Protein	denotes	Fig
T19818	40532-40545	Entity	denotes	this molecule
T19824	40559-40562	Protein	denotes	JNK
T19887	40559-40573	Negative_regulation	denotes	JNK inhibition
T19862	40629-40693	Protein	denotes	Jun in necroptosis and autocrine TNFα synthesis [13], [14], [15]
T19833	40652-40693	Protein	denotes	autocrine TNFα synthesis [13], [14], [15]
T19848	40735-40740	Protein	denotes	c-Jun
T19817	40795-40801	Entity	denotes	Thr308
T19899	40872-40918	Regulation	denotes	autocrine TNFα production, dependent on c-Jun,
T19891	40872-40918	Gene_expression	denotes	autocrine TNFα production, dependent on c-Jun,
T19864	40882-40886	Protein	denotes	TNFα
T19791	40909-40917	Protein	denotes	on c-Jun
T19895	40966-40995	Positive_regulation	denotes	the delayed activation of Akt
T19882	40966-40995	Negative_regulation	denotes	the delayed activation of Akt
T19806	40989-40995	Protein	denotes	of Akt
T19778	41063-41077	Protein	denotes	in the protein
T19869	41087-41092	Protein	denotes	c-Jun
T19807	41128-41136	Entity	denotes	zVAD.fmk
T19798	41140-41144	Protein	denotes	TNFα
T19803	41161-41164	Protein	denotes	Akt
T19853	41169-41183	Protein	denotes	mTOR-dependent
T19879	41262-41272	Protein	denotes	that c-Jun
T19797	41308-41311	Protein	denotes	JNK
T19885	41407-41431	Phosphorylation	denotes	phosphorylation of c-Jun
T19872	41423-41431	Protein	denotes	of c-Jun
T19809	41435-41441	Entity	denotes	a site
T19780	41453-41458	Entity	denotes	Ser63
T19836	41560-41568	Entity	denotes	SP600125
T23552	41655-41658	Protein	denotes	Akt
T23517	41655-41665	Protein	denotes	Akt kinase
T23597	41669-41734	Protein	denotes	specifically engaged in the signaling downstream from RIP1 kinase
T23598	41723-41727	Protein	denotes	RIP1
T23634	41770-41833	Positive_regulation	denotes	promoting a selective increase in Akt phosphorylation on Thr308
T23632	41780-41833	Positive_regulation	denotes	a selective increase in Akt phosphorylation on Thr308
T23488	41804-41807	Protein	denotes	Akt
T23539	41824-41833	Entity	denotes	on Thr308
T23478	41867-41871	Protein	denotes	RIP1
T23568	41867-41878	Protein	denotes	RIP1 kinase
T23494	41968-41971	Protein	denotes	JNK
T23637	41968-41982	Positive_regulation	denotes	JNK activation
T23534	41984-42008	Protein	denotes	autocrine TNFα synthesis
T23625	42058-42080	Phosphorylation	denotes	phosphorylation of Akt
T23541	42074-42080	Protein	denotes	of Akt
T23521	42174-42193	Entity	denotes	the plasma membrane
T23503	42207-42213	Protein	denotes	of Akt
T23532	42244-42276	Protein	denotes	active membrane-targeted Myr-Akt
T23611	42251-42268	Entity	denotes	membrane-targeted
T23643	42323-42344	Gene_expression	denotes	expression of Myr-Akt
T23522	42334-42344	Protein	denotes	of Myr-Akt
T23512	42423-42426	Protein	denotes	JNK
T23479	42431-42435	Protein	denotes	TNFα
T23560	42457-42461	Protein	denotes	RIP1
T23557	42457-42478	Protein	denotes	RIP1 kinase-dependent
T23551	42501-42507	Entity	denotes	Thr308
T23642	42501-42531	Phosphorylation	denotes	Thr308 phosphorylation of Akt,
T23535	42524-42530	Protein	denotes	of Akt
T23639	42585-42629	Phosphorylation	denotes	Necroptotic phosphorylation of Thr308 of Akt
T23486	42613-42629	Entity	denotes	of Thr308 of Akt
T23476	42626-42629	Protein	denotes	Akt
T23602	42686-42705	Entity	denotes	of known substrates
T23601	42745-42769	Entity	denotes	the Akt effector pathway
T23586	42749-42752	Protein	denotes	Akt
T23579	42784-42790	Entity	denotes	mTORC1
T23564	42976-42979	Protein	denotes	Akt
T23633	43032-43089	Regulation	denotes	the RIP1-dependent increase in Akt Thr308 phosphorylation
T23626	43032-43089	Positive_regulation	denotes	the RIP1-dependent increase in Akt Thr308 phosphorylation
T23573	43036-43050	Protein	denotes	RIP1-dependent
T23645	43060-43089	Phosphorylation	denotes	in Akt Thr308 phosphorylation
T23506	43063-43066	Protein	denotes	Akt
T23544	43063-43073	Entity	denotes	Akt Thr308
T23577	43110-43169	Protein	denotes	that RIP1 kinase inhibits a phosphatase that targets Thr308
T23526	43110-43169	Protein	denotes	that RIP1 kinase inhibits a phosphatase that targets Thr308
T23628	43110-43169	Negative_regulation	denotes	that RIP1 kinase inhibits a phosphatase that targets Thr308
T23555	43120-43126	Protein	denotes	kinase
T23513	43163-43169	Entity	denotes	Thr308
T23587	43197-43274	Protein	denotes	the only enzyme established to specifically dephosphorylate this residue [45]
T23650	43197-43274	Gene_expression	denotes	the only enzyme established to specifically dephosphorylate this residue [45]
T23501	43257-43274	Entity	denotes	this residue [45]
T23547	43315-43325	Entity	denotes	of the PP2
T23473	43327-43351	Entity	denotes	inhibitor, okadaic acid,
T23529	43338-43350	Entity	denotes	okadaic acid
T23491	43355-43361	Entity	denotes	Thr308
T23537	43463-43472	Entity	denotes	in Thr308
T23514	43486-43490	Protein	denotes	RIP1
T23590	43486-43540	Protein	denotes	RIP1 kinase targeting PDK1, Akt or scaffolding factors
T23520	43508-43512	Protein	denotes	PDK1
T23594	43514-43517	Protein	denotes	Akt
T23508	43552-43569	Protein	denotes	these two kinases
T23641	43580-43693	Phosphorylation	denotes	Interestingly, we observed phosphorylation of Akt by recombinant RIP1 kinase in vitro on Thr146, 195/197, and 435
T23576	43623-43629	Protein	denotes	of Akt
T23543	43630-43656	Protein	denotes	by recombinant RIP1 kinase
T23495	43645-43649	Protein	denotes	RIP1
T23474	43669-43685	Entity	denotes	Thr146, 195/197,
T23490	43698-43704	Entity	denotes	Ser381
T23582	43698-43713	Entity	denotes	Ser381 residues
T23497	43737-43769	Entity	denotes	these residues to Ala in Myr-Akt
T23605	43755-43769	Entity	denotes	Ala in Myr-Akt
T23493	43762-43769	Protein	denotes	Myr-Akt
T23496	43880-43897	Entity	denotes	of these residues
T23482	43901-43915	Protein	denotes	endogenous Akt
T23500	44005-44013	Protein	denotes	antibody
T23619	44029-44035	Entity	denotes	Thr435
T23578	44029-44043	Entity	denotes	Thr435 peptide
T23621	44084-44090	Protein	denotes	of Akt
T23546	44094-44098	Protein	denotes	RIP1
T23481	44199-44271	Entity	denotes	the key substrates of Akt that promote necrotic death and TNFα synthesis
T23507	44221-44224	Protein	denotes	Akt
T23505	44257-44271	Protein	denotes	TNFα synthesis
T23566	44321-44324	Protein	denotes	Akt
T23572	44321-44342	Entity	denotes	Akt effector pathways
T23571	44356-44384	Entity	denotes	TORC1 in necroptotic control
T23565	44445-44451	Entity	denotes	mTORC1
T23504	44507-44532	Entity	denotes	additional Akt substrates
T23502	44518-44521	Protein	denotes	Akt
T23561	44603-44631	Entity	denotes	of additional Akt substrates
T23485	44617-44620	Protein	denotes	Akt
T23647	44729-44753	Binding	denotes	connecting mTORC1 to JNK
T23533	44740-44746	Entity	denotes	mTORC1
T23519	44747-44753	Protein	denotes	to JNK
T23652	44816-44853	Regulation	denotes	of mTORC1-dependent regulation of JNK
T23542	44847-44853	Protein	denotes	of JNK
T23531	44870-44884	Protein	denotes	ER stress [46]
T23644	44958-44979	Positive_regulation	denotes	the activation of JNK
T23518	44973-44979	Protein	denotes	of JNK
T23492	44983-44987	Protein	denotes	TNFα
T23615	45089-45095	Entity	denotes	mTORC1
T23635	45111-45134	Translation	denotes	the translation of TNFα
T23609	45127-45134	Protein	denotes	of TNFα
T23580	45179-45182	Protein	denotes	JNK
T23623	45200-45226	Entity	denotes	key inhibitor of apoptosis
T23640	45417-45452	Regulation	denotes	necrosis-specific regulation of Akt
T23498	45446-45452	Protein	denotes	of Akt
T23585	45456-45460	Protein	denotes	RIP1
T23606	45456-45467	Protein	denotes	RIP1 kinase
T23489	45540-45543	Protein	denotes	Akt
T23569	45613-45616	Protein	denotes	Akt
T23617	45635-45641	Entity	denotes	mTORC1
T23595	45660-45665	Protein	denotes	GSK-3
T23559	45667-45674	Protein	denotes	FoxO1/4
T23613	45667-45674	Protein	denotes	FoxO1/4
T23515	45673-45674	Protein	denotes	4
T23575	45680-45684	Protein	denotes	MDM2
T23629	45722-45754	Positive_regulation	denotes	to assume that activation of Akt
T23530	45748-45754	Protein	denotes	of Akt
T23614	45939-45954	Protein	denotes	the Akt pathway
T23648	45971-46065	Positive_regulation	denotes	promote cell fates alternative to apoptosis, ranging from survival to non-apoptotic cell death
T23527	45979-46065	Entity	denotes	cell fates alternative to apoptosis, ranging from survival to non-apoptotic cell death
T23649	45979-46065	Localization	denotes	cell fates alternative to apoptosis, ranging from survival to non-apoptotic cell death
T23608	45979-46065	Protein	denotes	cell fates alternative to apoptosis, ranging from survival to non-apoptotic cell death
T23516	46139-46154	Protein	denotes	Akt-independent
T23525	46185-46189	Protein	denotes	RIP1
T23612	46185-46197	Protein	denotes	RIP1 kinase,
T23536	46375-46381	Protein	denotes	by Akt
T23511	46396-46399	Protein	denotes	Akt
T23630	46396-46410	Positive_regulation	denotes	Akt activation
T23651	46456-46479	Positive_regulation	denotes	activation of mTOR [48]
T23550	46467-46479	Protein	denotes	of mTOR [48]
T23558	46699-46710	Entity	denotes	by zVAD.fmk
T23545	46851-46860	Protein	denotes	TNFα [49]
T23588	46909-46915	Protein	denotes	by Akt
T23589	46919-46937	Protein	denotes	mTOR in our system
T23620	46976-46983	Protein	denotes	by TNFα
T23556	47018-47071	Entity	denotes	reconcile with the positive role of these proteins in
T23604	47033-47071	Protein	denotes	the positive role of these proteins in
T23599	47203-47218	Entity	denotes	mammalian cells
T23487	47294-47305	Protein	denotes	Akt pathway
T23510	47343-47347	Protein	denotes	RIP1
T23591	47343-47354	Protein	denotes	RIP1 kinase
T23646	47343-47364	Positive_regulation	denotes	RIP1 kinase signaling
T23596	47368-47371	Protein	denotes	Akt
T23618	47438-47457	Entity	denotes	multiple cell types
T23499	47525-47543	Entity	denotes	cell type specific
T23584	47569-47591	Entity	denotes	mouse lung fibroblasts
T23524	47593-47620	Entity	denotes	FADD-deficient Jurkat cells
T23592	47626-47638	Entity	denotes	macrophages,
T23603	47639-47642	Protein	denotes	Akt
T23636	47639-47738	Positive_regulation	denotes	Akt signaling contributed more prominently to an increase in TNFα synthesis, rather than cell death
T23549	47697-47714	Protein	denotes	in TNFα synthesis
T23616	47743-47776	Entity	denotes	se, unlike its role in L929 cells
T23528	47861-47865	Protein	denotes	RIP1
T23638	47893-47925	Regulation	denotes	mediating the production of TNFα
T23631	47903-47925	Gene_expression	denotes	the production of TNFα
T23600	47918-47925	Protein	denotes	of TNFα
T23553	48045-48051	Protein	denotes	of Akt
T23610	48512-48579	Entity	denotes	of plasma membrane integrity characteristic for necrotic cell death
T23570	48522-48530	Entity	denotes	membrane
T23554	48684-48701	Protein	denotes	of TNFα synthesis
T23574	48702-48721	Protein	denotes	by RIP1/Akt kinases
T23484	48705-48713	Protein	denotes	RIP1/Akt
T23622	48705-48713	Protein	denotes	RIP1/Akt
T23607	48710-48713	Protein	denotes	Akt
T23548	48949-49018	Protein	denotes	RIP1/RIP3 kinase activities by FADD and caspase-8 in epithelial cells
T23475	48959-48965	Protein	denotes	kinase
T23540	48980-48984	Protein	denotes	FADD
T23562	48989-49018	Protein	denotes	caspase-8 in epithelial cells
T23653	48989-49019	Localization	denotes	caspase-8 in epithelial cells
T23523	49002-49018	Entity	denotes	epithelial cells
T23480	49069-49073	Protein	denotes	TNFα
T23563	49145-49149	Protein	denotes	mice
T23654	49208-49260	Gene_expression	denotes	This increased production of TNFα during necroptosis
T23627	49208-49260	Positive_regulation	denotes	This increased production of TNFα during necroptosis
T23477	49234-49241	Protein	denotes	of TNFα
T23567	49582-49586	Protein	denotes	RIP1
T23509	49591-49595	Protein	denotes	RIP3
T23593	49638-49649	Protein	denotes	TNF-induced
T23538	49669-49683	Protein	denotes	of RIP1 kinase
T23483	49672-49676	Protein	denotes	RIP1
T23583	49762-49789	Protein	denotes	efficient and specific RIP1
T23581	49790-49807	Entity	denotes	kinase inhibitors
T23624	49790-49807	Protein	denotes	kinase inhibitors
T25560	49893-49901	Entity	denotes	Reagents
T25565	49989-50011	Entity	denotes	The following reagents
T25563	50717-50758	Protein	denotes	Pan-caspase inhibitor zVAD.fmk (20–30 µM)
T25562	50717-50758	Entity	denotes	Pan-caspase inhibitor zVAD.fmk (20–30 µM)
T25569	50717-50784	Binding	denotes	Pan-caspase inhibitor zVAD.fmk (20–30 µM) was purchased from Bachem
T25568	50729-50738	Entity	denotes	inhibitor
T25567	50796-50806	Protein	denotes	mouse TNFα
T25564	50819-50829	Protein	denotes	human bFGF
T25566	50842-50845	Protein	denotes	EGF
T25561	50858-50865	Entity	denotes	PDGF-BB
T25557	50882-50887	Protein	denotes	IGF-1
T25558	50909-50913	Entity	denotes	Cell
T25559	50937-50955	Entity	denotes	All other reagents
T25556	50966-50971	Protein	denotes	Sigma
T25665	50974-50977	Entity	denotes	DNA
T25661	50986-51020	Entity	denotes	of Myr-Akt1, containing c-terminal
T25660	50986-51020	Entity	denotes	of Myr-Akt1, containing c-terminal
T25662	50989-50992	Entity	denotes	Myr
T25666	50993-50997	Protein	denotes	Akt1
T25663	51021-51054	Protein	denotes	FLAG tag, has been described [52]
T25668	51056-51069	Protein	denotes	Myr-Akt1-FLAG
T25667	51084-51090	Protein	denotes	by PCR
T25669	51114-51119	Entity	denotes	BglII
T25670	51124-51129	Entity	denotes	EcoRI
T25664	51198-51209	Protein	denotes	of Myr-Akt1
T25746	51251-51261	Entity	denotes	Antibodies
T26173	52211-52221	Protein	denotes	Mouse TNFα
T26174	52270-52305	Protein	denotes	5′-GCTACGACGTGGGCTACAG-3′;mouse 18S
T26170	52386-52396	Protein	denotes	human TNFα
T26175	52437-52447	Protein	denotes	human TNFα
T26171	52487-52496	Protein	denotes	human 18S
T26172	52506-52544	Protein	denotes	5′- CAGCCACCCGAGATTGAGCA -3, human 18S
T26466	52594-52598	Entity	denotes	L929
T26468	52603-52630	Entity	denotes	FADD-deficient Jurkat cells
T26473	52656-52672	Entity	denotes	Lung fibroblasts
T26469	52742-52762	Entity	denotes	J774A.1 (ATCC) cells
T26467	52767-52788	Entity	denotes	RAW264.7 (ATCC) cells
T26461	52903-52908	Entity	denotes	Cells
T26462	52975-52978	Protein	denotes	FBS
T26460	52984-53030	Entity	denotes	1% antibiotic-antimycotic mixture (Invitrogen)
T26465	53047-53057	Entity	denotes	fibroblast
T26463	53099-53110	Entity	denotes	L-glutamine
T26472	53112-53137	Entity	denotes	non-essential amino acids
T26471	53143-53158	Entity	denotes	sodium pyruvate
T26470	53160-53172	Entity	denotes	Jurkat cells
T26464	53247-53272	Entity	denotes	1% antibiotic-antimycotic
T26685	53275-53301	Entity	denotes	Cell Viability Experiments
T26690	53449-53463	Entity	denotes	Cell viability
T26689	53485-53529	Entity	denotes	CellTiter-Glo Cell Viability Assay (Promega)
T26686	53596-53626	Entity	denotes	of the control untreated cells
T26687	53663-53671	Entity	denotes	of cells
T26688	53775-53780	Entity	denotes	cells
T26684	53844-53888	Entity	denotes	non-specific toxicity of the small molecules
T26691	53869-53888	Entity	denotes	the small molecules
T26924	53945-54001	Protein	denotes	Mouse ribosomal S6 protein (L-040893-00 and L-045791-00)
T26927	53961-53963	Entity	denotes	S6
T26928	54003-54027	Protein	denotes	mouse Akt1 (L-040709-00)
T26925	54278-54307	Entity	denotes	RNAiMAX reagent (Invitrogen),
T26922	54278-54307	Protein	denotes	RNAiMAX reagent (Invitrogen),
T26926	54366-54371	Entity	denotes	cells
T26920	54390-54398	Entity	denotes	zVAD.fmk
T26923	54402-54437	Protein	denotes	TNFα for 9 hr (RNA or Western blot)
T26921	54448-54462	Entity	denotes	cell viability
T27365	54479-54569	Binding	denotes	For Western blot, 4×105 adherent cells (1×106 Jurkat cells) were seeded into 35 mm2 dishes
T27359	54497-54538	Entity	denotes	4×105 adherent cells (1×106 Jurkat cells)
T27345	54519-54537	Entity	denotes	1×106 Jurkat cells
T27358	54587-54592	Entity	denotes	cells
T27342	54614-54628	Entity	denotes	30 µM zVAD.fmk
T27349	54632-54651	Protein	denotes	10 ng/ml mouse TNFα
T27363	54697-54702	Entity	denotes	cells
T27348	54773-54810	Protein	denotes	20 µM zVAD.fmk or 10 ng/ml mouse TNFα
T27353	54779-54787	Entity	denotes	zVAD.fmk
T27356	54812-54817	Entity	denotes	Cells
T27366	54812-54842	Binding	denotes	Cells were harvested in 1×RIPA
T27354	54851-54855	Entity	denotes	Cell
T27352	54949-54961	Entity	denotes	cell lysates
T27344	55003-55025	Entity	denotes	Protein concentrations
T27364	55061-55086	Entity	denotes	nm Assay Reagent (Pierce)
T27339	55102-55113	Protein	denotes	of proteins
T27347	55218-55231	Entity	denotes	SDS-PAGE gels
T27341	55252-55256	Entity	denotes	PVDF
T27361	55252-55265	Entity	denotes	PVDF membrane
T27340	55289-55318	Protein	denotes	5% bovine serum albumin (BSA)
T27346	55314-55317	Protein	denotes	BSA
T27343	55366-55384	Entity	denotes	Primary antibodies
T27360	55432-55452	Entity	denotes	Secondary antibodies
T27351	55529-55532	Protein	denotes	ECL
T27362	55529-55541	Entity	denotes	ECL reagents
T27350	55591-55600	Entity	denotes	membranes
T27357	55649-55651	Entity	denotes	GM
T27355	55683-55697	Entity	denotes	new antibodies
T27693	55700-55707	Protein	denotes	qRT-PCR
T27689	55708-55713	Entity	denotes	Cells
T27692	55759-55768	Protein	denotes	Total RNA
T27690	55829-55832	Protein	denotes	RNA
T27691	55961-55975	Protein	denotes	qPCR reactions
T27877	56076-56104	Regulation	denotes	Stable Infection of Myr-Akt1
T27871	56093-56104	Protein	denotes	of Myr-Akt1
T27874	56136-56163	Entity	denotes	HEK293FT cells (Invitrogen)
T27876	56186-56203	Entity	denotes	2 µg of viral DNA
T27870	56191-56203	Entity	denotes	of viral DNA
T27868	56276-56279	Protein	denotes	Gen
T27872	56276-56319	Entity	denotes	GenJet transfection reagent (Signagen Labs)
T27869	56434-56451	Entity	denotes	8 µg/ml polybrene
T27873	56453-56458	Entity	denotes	Cells
T27875	56491-56509	Entity	denotes	10 µg/ml puromycin
T28061	56527-56573	Entity	denotes	ELISAOne assays (TGRBio, Hindmarsh, Australia)
T28062	56544-56547	Protein	denotes	TGR
T28069	56660-56732	Entity	denotes	Cell lysates were prepared in RIPA buffer as described for Western blots
T28059	56828-56883	Entity	denotes	Primary antibodies to phopsho-Thr308 and phopsho-Ser473
T28060	56850-56864	Entity	denotes	phopsho-Thr308
T28067	56869-56883	Entity	denotes	phopsho-Ser473
T28064	56946-56962	Entity	denotes	Primary antibody
T28065	56966-56973	Protein	denotes	pan-Akt
T28068	57006-57013	Entity	denotes	Signals
T28063	57018-57036	Entity	denotes	phospho-antibodies
T28066	57062-57076	Protein	denotes	pan-Akt values
T28269	57079-57083	Protein	denotes	TNFα
T28268	57090-57111	Protein	denotes	Mouse TNFα Quantikine
T28270	57196-57208	Entity	denotes	Cell lysates
T28267	57228-57275	Entity	denotes	3×106 cells plated and treated in a 10 cm2 dish
T28271	57262-57275	Protein	denotes	a 10 cm2 dish
T28403	57278-57303	Protein	denotes	In vitro Akt Kinase Assay
T28407	57287-57290	Protein	denotes	Akt
T28402	57304-57307	Protein	denotes	Akt
T28398	57304-57314	Protein	denotes	Akt kinase
T28408	57347-57350	Protein	denotes	Akt
T28400	57351-57357	Protein	denotes	kinase
T28401	57390-57415	Entity	denotes	Cell Signaling Technology
T28406	57427-57434	Protein	denotes	Myr-Akt
T28405	57490-57492	Entity	denotes	M2
T28399	57509-57514	Protein	denotes	Sigma
T28409	57582-57599	Protein	denotes	protein substrate
T28397	57582-57599	Entity	denotes	protein substrate
T28404	57617-57642	Protein	denotes	of the GSK fusion protein
R10210	T15606	T15758	themeOf	Akt,Akt activation
R10211	T15610	T15764	themeOf	of Myr-Akt,"the expression of Myr-Akt, but not the K179M mutant,"
R10212	T15612	T15763	themeOf	Myr-Akt,"RIP1 kinase-dependent Thr308 phosphorylation during necroptosis in multiple cell types. Furthermore, we found that downstream Akt signaling through mTORC1 and S6 contributes to the activation of necroptosis and TNFα production. We found that the Akt pathway serves as a critical link between RIP1 kinase and JNK activation in L929 cells. Further data suggested that in multiple other cell types including FADD deficient Jurkat cells, RAW and J774.1 macrophage cell lines, and mouse lung fibroblasts Akt provides a key link to TNFα production, but is dispensible for cell death per se. Overall, our results reveal a specific and novel role for the Akt pathway in regulated necrosis and necrosis-associated inflammatory signaling. Results Basic Fibroblast Growth Factor Promotes Necroptosis in L929 Cells It has been established that mouse fibrosarcoma L929 cells undergo necroptotic cell death following stimulation with TNFα [10], [17]. In addition, inhibition of caspase-8 activity alone, either through siRNA knockdown or by using the pan-caspase inhibitor, zVAD.fmk, is sufficient to trigger necroptosis in these cells [10], [14]. Interestingly, while necroptosis was initially identified as a back-up form of cell death triggered by pro-apoptotic stimuli in the presence of apoptosis inhibitors [17], recent analysis of physiological cell death during mouse development has suggested that the loss of apoptotic regulators, such as caspase-8 and FADD [18], [19], [20], leads to robust induction of necroptosis and death of E10.5 embryos even though apoptosis is not normally induced in wild type embryos. These data are reminiscent of the observations in L929 cells where the loss of caspase activity in healthy cells is sufficient to trigger necroptosis and prompted us to explore the extrinsic or intrinsic cellular factors that promote necroptosis once caspase-8 activity, which cleaves and inactivates RIP1 kinase and the RIP1 deubiquitinase CYLD [21], [22], is removed in L929 cells. Consistent with a previous report [16], we found that serum starvation of L929 cells prevented necroptosis in response to zVAD.fmk (Fig. 1A). The addition of growth factors, such as bFGF, restored zVAD.fmk induced death under serum free conditions (Fig. 1B). Interestingly, this does not reflect a generic requirement for growth factor signaling, as only some growth factors (bFGF and IGF-1, but not EGF and PDGF) promoted death (Fig. 1B). Furthermore, growth factor-dependent necroptosis required the inhibition of caspase activity, as bFGF alone did not induce cell death (Fig. 1C). In contrast, TNFα triggered necroptosis equally efficiently in the absence of serum (Fig. 1A), suggesting that either growth factors and zVAD.fmk or TNFα are required for necroptotic death in L929 cells. 10.1371/journal.pone.0056576.g001 Figure 1 bFGF and IGF-1 promote necroptosis in concert with zVAD.fmk. (A) L929 cells were treated with TNFα or zVAD.fmk under normal serum (10% FBS) or serum free conditions. Cell viability was determined after 24 hr using the CellTiter-Glo Viability assay. The concentrations of all necroptosis-inducing agents are listed in the Materials and Methods section or indicated in the figures. (B) Cells were treated with zVAD.fmk, the indicated growth factors, and Nec-1 under serum free conditions for 24 hrs followed by measurement of cell viability. (C) Cells under serum free conditions were treated with FGF, zVAD.fmk, or both for 24 hrs followed by viability assay. (D) Cell death was induced by zVAD.fmk or TNFα under full serum condition in the presence of 2 µM PD173074 and 20 µM PD166866. In all graphs, average±SD was plotted. Previously we described the development of 7-Cl-O-Nec-1 (Nec-1) as a potent and selective inhibitor of RIP1 kinase and necroptosis (Fig. S1A) [23], [24]. Recently, its selectivity has been further validated against a panel of more than 400 human kinases [15]. This inhibitor efficiently blocked growth factor/zVAD.fmk-induced necroptosis under serum free conditions in L929 cells and both zVAD.fmk and TNFα-induced necroptosis under full serum conditions (Fig. 1B, S1B). To further validate the role of RIP1, we used an inactive analog, 7-Cl-O-Nec-1i (Nec-1i) (Fig. S1A), which contains an extra N-methyl group that leads to almost complete loss of RIP1 kinase inhibitory activity in vitro [23]. Nec-1i was unable to protect L929 cell death under serum condtions treated with zVAD.fmk or TNFα (Fig. S1B) or serum free conditions treated with bFGF/zVAD.fmk (Fig. S1C). This confirms that RIP1 kinase is responsible for necroptosis in L929 cells under both serum and serum free conditions. We next examined whether bFGF contributes to zVAD.fmk-induced necroptosis under normal serum conditions (10% FBS). We used two bFGF receptor tyrosine kinase inhibitors (PD173074 and PD166866), and determined that inhibition of bFGF signaling strongly inhibited zVAD.fmk-induced necroptosis under normal serum conditions (Fig. 1D). In contrast, neither bFGF receptor inhibitor was able to attenuate TNFα-induced necroptosis (Fig. 1D), consistent with growth factors being dispensable for this pathway (Fig. 1A). Overall, these data suggest that the induction of necroptosis by zVAD.fmk is promoted by bFGF under both serum and serum free conditions. The induction of necroptosis, however, is not a simple consequence of growth factor signaling since not all growth factors allowed death to occur. Instead, specific signaling events mediated by particular growth factors appear to contribute to necroptotic death. RIP1 Kinase-dependent Activation of Akt Contributes to Necroptosis Given our observation that growth factors are important for zVAD.fmk induced death, we examined the contribution of several pathways, including MAPK pathways and Akt, which are known to be activated following growth factor receptor activation (Fig. 2A). Inhibition of Akt (Akt inhibitor VIII) strongly protected the cells from growth factor-sensitive necroptosis induced by zVAD.fmk [16] as well as cell death triggered by bFGF or IGF-1/zVAD.fmk under serum free conditions (Fig. 2B). Inhibition of Akt also protected the cells from growth-factor insensitive death by caused by TNFα (Fig. 2A). Consistent with previous reports, the JNK inhibitor SP600125 protected the cells from both zVAD.fmk and TNFα induced death (Fig. 2A,B and Fig. S2A) [12], [14]. In contrast, inhibition of two other MAPKs, p38 and ERK, previously reported not to be activated during necroptosis [14], did not protect from either zVAD.fmk or TNFα induced death (Fig. 2A). 10.1371/journal.pone.0056576.g002 Figure 2 Akt contributes to necroptosis induced by zVAD.fmk and TNFα. (A,B) Necroptosis was induced by zVAD.fmk or TNFα (full serum, A) or growth factors/zVAD.fmk (serum free, B) in the presence of inhibitors of Akt (Akt inhibitor VIII), JNK (SP600125), p38 (PD169316), and Erk (UO126). Cell viability was determined after 24 hrs. (C) L929 cells transfected with Akt1, Akt2, and Akt3 siRNAs for 72 hrs were treated with zVAD.fmk or TNFα for 9 hrs. Cell viability and Akt expression levels were determined after 24 hrs. In all graphs, average±SD was plotted. Next, we used two approaches to further validate the role of Akt in necroptotic cell death. First, two additional Akt inhibitors, a highly specific, allosteric kinase inhibitor MK-2206 [25] and triciribine (TCN) [26], which blocks membrane translocation of Akt, both attenuated cell death (Fig. S2B). Secondly, simultaneous knockdown of Akt isoforms Akt1 and Akt2 using siRNAs protected cells from necroptosis induced by both zVAD.fmk and TNFα (Fig. 2C). No expression of Akt3 was seen in L929 cells (Fig. S2C) and, consistently, Akt3 siRNA had no additional effect on necroptosis. Our results confirmed that Akt plays a key role in necroptosis induced by multiple stimuli in L929 cells. To understand the activation of Akt and JNK under necroptotic conditions, we examined the changes in Akt and JNK phosphorylation at 9 hrs post zVAD.fmk and TNFα stimulation. This time point was chosen because it reflects the early stage of cell death in our system (Fig. S3A, B). Following stimulation with either zVAD.fmk or TNFα we observed a robust increase in Akt phosphorylation at a known major activation site, Thr308 (Fig. 3A). Interestingly, we did not observe concomitant phosphorylation changes in the second major activation site of Akt, Ser473. We also observed an increase in the phosphorylation of both the p46 and p54 isoforms of JNK and its major substrate c-Jun (Fig. 3A). These data indicate that both Akt and JNK are activated under necroptotic conditions. 10.1371/journal.pone.0056576.g003 Figure 3 RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis. (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr, followed by western blotting with indicated antibodies. (B,C) L929 cells were treated with zVAD.fmk (B) or bFGF/zVAD.fmk (serum free conditions, C) and samples were collected at the indicated time points for western blot. (D) Nec-1 was added to the cells stimulated with bFGF or bFGF/zVAD (serum free conditions) for 15 min or 9 hr followed by western blot with the indicated antibodies. The RIP1 kinase inhibitor, Nec-1, completely prevented the increase in Thr308 Akt phosphorylation, while Nec-1i did not (Fig. 3A, Fig. S1D). Similarly, Nec-1 prevented the induction of JNK phosphorylation in response to zVAD.fmk and substantially reduced this change after TNFα addition. We observed some changes in total protein levels of JNK and c-Jun following necroptotic stimulation. Some of these changes, e.g. zVAD.fmk-induced increase in c-Jun, were also attenuated by Nec-1. Importantly, Nec-1 did not alter the basal phosphorylation levels of either Akt or JNK (Fig. 3A). This established that Akt Thr308 and JNK phosphorylation during necroptosis is RIP1 dependent. Interestingly, we discovered that the phosphorylation of Akt Thr308, JNK and Jun are late events following zVAD.fmk stimulation (Fig. 3B) that coincide with the onset of necroptosis at 6 hr post-stimulation (Fig. S3A). To better understand the contributions of growth factors and RIP1 kinase to necroptotic regulation of Akt, we next analyzed the time course of these phosphorylation changes under serum free conditions. We found that the addition of bFGF alone or in combination with zVAD.fmk led to a substantial rapid and transient increase in both Thr308 and Ser473 phosphorylation of Akt as well as JNK and c-Jun at 15 minutes, reflecting the expected response to growth factor stimulation (Fig. 3C). Significantly, the combination of bFGF/zVAD.fmk, but not bFGF alone, also caused a robust, second, delayed increase in the phosphorylation of Thr308, but not Ser473, of Akt as well as a delayed increase in the phosphorylation of JNK and Jun. Furthermore, Nec-1 had no significant effect on the early increase in both Akt and JNK/c-Jun phosphorylation triggered by both bFGF and bFGF/zVAD, while Nec-1, but not its inactive analog Nec-1i (Fig. S1E), efficiently blocked the bFGF/zVAD increase at 6–9 hr (Fig. 3D), suggesting that only the delayed activation of Akt and JNK is specific for necroptosis and dependent on RIP1 kinase activity. Similarly, IGF/zVAD, which also promoted cell death under serum free conditions, produced a delayed increase in Thr308 phosphorylation on Akt, while IGF alone caused solely an early, transient increase in phosphorylation (Fig. S3C). We confirmed the kinetics of the Akt Thr308 and Ser473 phosphorylation changes using a quantitative ELISA assay, which also showed a robust delayed necroptosis-specific RIP1-dependent increase in Akt Thr308 phosphorylation (Fig. S3D, E). Taken together, these results indicate that the observed delayed increases in Akt and JNK phosphorylation, preceding the onset of cell death, represent specific consequences of necroptotic signaling downstream from RIP1 kinase. TNFα Induces Delayed Akt Thr308 Phosphorylation and Necroptosis Independent of Growth Factor Stimulation Consistent with TNFα inducing necroptosis independently of growth factors (Fig. 1A), FGFR inhibitors did not attenuate TNFα-induced changes in Akt or JNK phosphorylation, while efficiently preventing these changes in response to zVAD.fmk (Fig. S4A). Furthermore, addition of TNFα led to comparable late activation of Akt p308 signal under both normal and serum free conditions (Fig. S4B, C), indicating that TNFα signaling to Akt Thr308 is growth factor-independent. In contrast, activation of JNK by TNFα followed different kinetics from zVAD.fmk-induced changes. TNFα treatment caused an early and robust increase in the phosphorylation of JNK and c-Jun. Nec-1 did not affect this early increase, however, it reduced levels of pJNK/Jun at the late, 9 hr time point (Fig. S4B, C). This again separated early RIP1-independent changes, which likely reflect the ability of additional upstream kinases, such as Ask1 to activate JNK [27], from the late RIP1 kinase-dependent necroptotic signaling. Late Increase in Akt Thr308 Phosphorylation Contributes to the Induction of Necroptotic Cell Death We next investigated if the delayed RIP1 kinase-dependent increase in Akt Thr308 phosphorylation functionally contributes to the execution of necroptotic cell death. Firstly, PDGF/zVAD.fmk, which cannot induce necroptosis (Fig. 2A), triggered only the initial, rapid Akt and JNK phosphorylation changes and not the delayed activation (Fig. 4A), indicating that late, rather than early Akt phosphorylation correlates with necroptosis. Secondly, we saw that the ability of the Akt inhibitor to protect cells from necroptosis rapidly declined after 6 hrs of stimulation with zVAD.fmk, TNFα or bFGF/zVAD.fmk and no protection was observed when the inhibitor was added at 9 hrs (Fig. 4B,C). This time frame coincides with the timing of the secondary Akt Thr308 phosphorylation. Finally, we terminated the bFGF signal one hour after addition of bFGF by the addition of PD173074. This allowed us to retain early Akt activation, but to suppress the secondary increase (Fig. 4D). Both pre-addition and delayed addition of PD173074 fully prevented necroptosis (Fig. 4E). Overall, these data, while correlative, indicate that early Akt activation is insufficient to promote necroptosis and are strongly supportive of an important role for the delayed activation of Akt in the induction of necroptotic cell death. 10.1371/journal.pone.0056576.g004 Figure 4 Late Thr308 phosphorylation of Akt contributes to necroptosis. (A) L929 cells were treated with zVAD.fmk and bFGF or PDGF, with or without Nec-1, for the indicated periods of time. (B,C) L929 cells were stimulated by zVAD.fmk or TNFα (B) or bFGF/zVAD.fmk under serum free conditions (C). Akt inh. VIII was added 15 min before necroptotic stimulation (Pre) or at indicated times after stimulation. Viability was measured 24 hr after activation of necroptosis. (D) L929 cells were stimulated with bFGF/zVAD under serum free conditions. PD173074 was added 15 min before or 1 hr after FGF/zVAD. Samples for western blot were collected at 15 min and 9 hr time points. (E) Cells were pretreated with PD173074 or it was added 1 hr after bFGF/zVAD.fmk, followed by viability assessment at 24 hr. In all graphs, average±SD was plotted. The Akt Signaling Pathway Contributes to the Regulation of Necroptosis We next determined whether the necroptosis-associated increase in Thr308 phosphorylation results in an increase in Akt kinase activity. Under necroptotic conditions, we observed an increase in the phosphorylation of multiple known Akt substrates (Forkhead box class O (FoxO) proteins, GSK-3 kinases and mouse double minute 2 (MDM2)) as well as downstream molecules (p70 ribosomal protein S6 Kinase (p70S6K), S6) (Fig. 5A). In some cases (FoxO1, FoxO4, MDM2), a robust increase was observed. In other cases (FoxO3a, GSK-3α/β, p70S6K and its substrate S6), the changes were less pronounced (Fig. 5A). The timing of the phosphorylation changes paralleled the increase in Akt phosphorylation (Fig. 5B, S5A, B). In the case of pFoxO1 we occasionally observed a shift in migration rather than an increase in band intensity (e.g. comparing Fig. 5A and B), suggesting that phosphorylation events in addition to Thr24 take place during necroptosis. Notably, in all cases the necroptosis-associated increases in Akt substrates were abrogated by Nec-1 (Fig. 5A, Fig. S5A, B). Overall, these data suggested that a significant part of the “canonical” Akt signaling network is activated at the onset of necroptotic cell death in a RIP1 dependent fashion. 10.1371/journal.pone.0056576.g005 Figure 5 mTORC1 contributes to the regulation of necroptosis. (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr and harvested for western blot. (B) Cell under serum free condition were treated with bFGF or bFGF/zVAD.fmk for the indicated amounts of time, followed by western blotting using the indicated antibodies. (C) Necroptosis was induced by zVAD.fmk or TNFα in L929 cell in the presence of inhibitors of Akt(Akt inh. VIII) and mTOR (rapamycin, Torin-1 and PI-103). (D) L929 cells with mTOR siRNA knockdown were harvested for western blot or treated with zVAD.fmk or TNFα for 24 hrs. Cell viability was determined 24 hr after activation of necroptosis. In all graphs, average±SD was plotted. Akt kinase is considered to be a pro-survival protein that inhibits apoptosis through the control of multiple effectors including mTORC1, GSK-3 and others [28]. An important question is whether these same molecules reverse their pro-survival roles during necroptosis. We found that inhibition of mTORC1 by rapamycin, an inhibitor of the mTOR co-factor Raptor [29], protected cells from necroptosis (Fig. 5C). Similarly, the direct mTOR kinase inhibitor Torin1 [30] and the dual PI3K/mTOR inhibitor PI-103 [31] also efficiently inhibited necroptosis (Fig. 5C). Knockdown of mTOR using siRNA further validated the small-molecule inhibitor data indicating a role for mTOR in necroptosis by protecting cells from both zVAD.fmk and TNFα induced death (Fig. 5D). mTORC1 regulates translation through activation of p70S6 kinase and, subsequently, ribosomal protein S6 [32]. Notably, a genome-wide siRNA screen [10] suggested an important role for protein translation in necroptosis. Consistently, we found that the small molecule inhibitor of p70S6K PF-4708671 [33] attenuated necroptosis at the concentrations required to block S6 phosphorylation (Fig. S5C, D). Partial siRNA knockdown of S6 protein attenuated necroptosis as well (Fig. S5E), suggesting that translational control by p70S6K/S6 may play a role in necroptosis. Overall, while the full repertoire of Akt targets during necroptosis remains to be fully explored, our data provide evidence that the activity of an anti-apoptotic branch of Akt signaling can promote necroptosis. RIP1 kinase, Akt, mTORC1 and JNK control the upregulation of TNFα accompanying necroptosis. Hitomi et al. [10] have recently reported that the induction of necroptosis by zVAD.fmk in L929 cells is associated with increased synthesis of TNFα, which potentiates cell death. Therefore, we examined whether Akt and its effectors contribute to TNFα synthesis. Consistent with a RIP1-dependent increase in TNFα protein (Fig. S6A, B), we found that TNFα mRNA levels increased during necroptosis in L929 cells in a RIP1 (Fig. S6C. Under serum free conditions, bFGF alone triggered some induction of TNFα mRNA, while its combination with zVAD.fmk (but not zVAD.fmk alone) caused a pronounced further increase (Fig. 6A). Conversely, PDGF caused a modest upregulation of TNFα mRNA, which was not further increased in the presence of zVAD.fmk (Fig. 6A), demonstrating that activation of necroptosis is specifically accompanied by a marked increase in autocrine TNFα synthesis. 10.1371/journal.pone.0056576.g006 Figure 6 Akt and mTORC1 control autocrine TNFα synthesis and JNK activation during necroptosis. (A) Cells were treated under serum free conditions with bFGF or PDGF with or without zVAD.fmk for 9 hr, followed by qRT-PCR analysis of mTNFα. Data was normalized to mouse 18S RNA. (B) Necroptosis was induced by zVAD.fmk or TNFα in cells treated with Nec-1, rapamycin (rapa), or Akt inh. VIII inh. followed by qRT-PCR analysis of TNFα mRNA levels. (C-F) L929 cells with siRNA knockdown of Akt isoforms (C,E) or mTOR (D,F) were stimulated with zVAD.fmk or TNFα for 9 hr, followed by qRT-PCR analysis of mTNFα (C,D) or western blot (E,F). In all graphs, average±SD was plotted. Further analysis suggested that both Akt and mTORC1 contribute to the upregulation of TNFα mRNA during necroptosis as both small-molecule inhibition and siRNA knockdown of Akt and mTOR reduced TNFα mRNA levels in necroptotic cells (Fig. 6B,C,D). Notably, RIP1 and Akt inhibitors had no effect on the levels of TNFα mRNA in control cells or in the cells stimulated with bFGF alone (Fig. 6A,B, Fig. S6C), suggesting that these kinases specifically mediate necroptosis-dependent increase in TNFα synthesis. Akt and mTORC1 Control the Activation of JNK during Necroptosis JNK is a well-established regulator of TNFα synthesis in a variety of systems [13], [14], [15], [34]. Therefore, the ability of Akt and mTORC1 inhibitors to block the increase in TNFα mRNA lead us to examine their role in the activation of JNK during necroptosis. Knockdown of Akt isoforms Akt1 and Akt2 or inhibition of Akt prominently suppressed the necroptosis dependent increase in JNK and c-Jun phosphorylation (Fig. 6E, S6D,E) suggesting that Akt may provide a link between RIP1 and JNK activation. Importantly, inhibition of Akt only inhibited the delayed, but not the early, increase in bFGF/zVAD.fmk induced JNK and c-Jun phosphorylation (Fig. S6F). Knockdown of mTOR, rapamycin and the p70S6K inhibitor PF-4708671 also attenuated the necroptosis-associated increase in JNK and c-Jun phosphorylation (Fig. 6F, S6E,G, Fig. S5D). Overall, these data suggested that the Akt-mTORC1-S6K axis, acting downstream from RIP1 kinase, is required for the increase in JNK activity during necroptosis in L929 cells. PI3-kinase and PDK1 Mediate the Increase in Akt Thr308 Phosphorylation Under Necroptotic Conditions Typical regulation of Akt by growth factors involves its recruitment to the plasma membrane, which is mediated by the binding of the pleckstrin homology (PH) domain of Akt to the product of PI3K, phosphatidylinositol-3,4,5-triphosphate (PIP3). In the membrane, Akt is phosphorylated on Thr308 and Ser473 by 3-phosphoinositide dependent protein kinase-1 (PDK1) and mTORC2 (or DNA-PK), respectively [35]. Since our results showed that only Thr308 Akt phosphorylation is increased during necroptosis, we next examined whether it is still dependent on PI3K and PDK1. Inhibition of PI3K and PDK1 using the specific inhibitors LY249002 and BX912 [36] resulted in the efficient inhibition of cell death and Akt Thr308 phosphorylation (Fig. S7A–D). Likewise, siRNA knockdown of PDK1 protected cells from death and inhibited Akt Thr308 phosphorylation (Fig. S7E,F) Therefore, PI3K and PDK1 activity is still required for non-canonical Akt activation during necroptosis. Expression of Constitutively Active Akt, Rescues Necroptosis Under Serum Free Conditions We used L929 cells stably expressing constitutively active wild type Akt1 (Myr-Akt) or the catalytically inactive mutant K179M in order to further understand the contribution of growth factors and RIP1 kinase to Akt activation during necroptosis. Constitutively active Akt1 (Myr-Akt) was generated as previously described [37] by the addition of a myristoylation signal which provides constitutive localization to the plasma membrane and by the deletion of the auto-inhibitory PH domain (Fig. 7A) resulting in an Akt that is active under serum free. It is important to note that the cells expressing Myr-Akt were viable, grew in a manner indistinguishable from the empty vector control cells, and were not triggered to induce necroptosis by serum starvation (Fig. 7B). This indicates that active Akt alone is not sufficient to induce necroptotic cell death. Under serum free conditions Myr-Akt, but not the K179M mutant, fully restored zVAD.fmk-induced necroptosis (Fig. 7A,B). Nec-1 prevented both Myr-Akt dependent cell death and the necroptosis-specific delayed increase in Akt Thr308 phosphorylation (Fig. 7B,C). Myr-Akt also allowed other zVAD.fmk-dependent events, including activation of JNK and c-Jun phosphorylation (Fig. 7C) and upregulation of TNFα mRNA (Fig. 7D) to occur under serum free conditions, confirming an important role for Akt at the apex of necroptotic signaling. These data demonstrated that the presence of active and membrane localized Akt is sufficient to uncouple Akt activation during necroptosis from growth factor signaling. RIP1 kinase was still able to regulate Akt activation during necroptosis, suggesting that growth factors and RIP1 kinase provide two independent inputs required for Akt changes during necroptosis. 10.1371/journal.pone.0056576.g007 Figure 7 Over expression of constitutively active Akt restores necroptosis under serum free conditions. (A,B) L929 cells were stably infected with empty MSCV retrovirus or viruses encoding Myr-Akt or the catalytically inactive Myr-Akt K179M. Necroptosis was induced by the addition of zVAD.fmk under serum free conditions (A) or serum or serum free conditions with Nec-1 (B). Viability assays were performed after 24 hr. (C) Myr-Akt and Myr-Akt K179M cells were treated with zVAD.fmk and/or Nec-1 under serum free conditions for 9 hr, followed by western blot using the indicated antibodies. Endogenous Akt (∼) and Myr-Akt (*) bands are indicated. (D) L929 cells, stably infected with Myr-Akt and Myr-Akt K179KM, were stimulated with zVAD.fmk for 9 hr under serum free conditions. TNFα mRNA levels were determined by qRT-PCR and normalized using mouse 18S RNA. (E-G) L929 cells expressing Myr-Akt and Ala and Asp mutants of Thr308 and Ser473 were treated with zVAD.fmk under serum free conditions, followed by viability assay at 24 hr (E), western blot at 9 hr (F), or evaluation of TNFα mRNA levels by qRT-PCR at 9 hrs (G). In all graphs, average±SD was plotted. RIP1 kinase-dependent Thr308 phosphorylation of Myr-Akt during necroptosis increased Myr-Akt activity as it did"
R10213	T15614	T15761	themeOf	of Myr-Akt,the increased basal activity of Myr-Akt
R10214	T15618	T15747	themeOf	"cell death, JNK activation, TNFα","cell death, JNK activation, TNFα production"
R10215	T15620	T15760	themeOf	JNK,JNK activation
R10216	T15631	T15771	themeOf	of Myr-Akt,necroptotic Thr308 phosphorylation of Myr-Akt
R10217	T15634	T15748	themeOf	active Akt1 (Myr-Akt),Constitutively active Akt1 (Myr-Akt) was generated
R10218	T15640	T15643	partOf	Akt Thr308,Akt
R10219	T15640	T15752	siteOf	Akt Thr308,in Akt Thr308 phosphorylation
R10220	T15643	T15752	themeOf	Akt,in Akt Thr308 phosphorylation
R10221	T15647	T15708	partOf	Thr308,of Myr-Akt
R10222	T15647	T15756	siteOf	Thr308,"RIP1 kinase-dependent Thr308 phosphorylation during necroptosis in multiple cell types. Furthermore, we found that downstream Akt signaling through mTORC1 and S6 contributes to the activation of necroptosis and TNFα production. We found that the Akt pathway serves as a critical link between RIP1 kinase and JNK activation in L929 cells. Further data suggested that in multiple other cell types including FADD deficient Jurkat cells, RAW and J774.1 macrophage cell lines, and mouse lung fibroblasts Akt provides a key link to TNFα production, but is dispensible for cell death per se. Overall, our results reveal a specific and novel role for the Akt pathway in regulated necrosis and necrosis-associated inflammatory signaling. Results Basic Fibroblast Growth Factor Promotes Necroptosis in L929 Cells It has been established that mouse fibrosarcoma L929 cells undergo necroptotic cell death following stimulation with TNFα [10], [17]. In addition, inhibition of caspase-8 activity alone, either through siRNA knockdown or by using the pan-caspase inhibitor, zVAD.fmk, is sufficient to trigger necroptosis in these cells [10], [14]. Interestingly, while necroptosis was initially identified as a back-up form of cell death triggered by pro-apoptotic stimuli in the presence of apoptosis inhibitors [17], recent analysis of physiological cell death during mouse development has suggested that the loss of apoptotic regulators, such as caspase-8 and FADD [18], [19], [20], leads to robust induction of necroptosis and death of E10.5 embryos even though apoptosis is not normally induced in wild type embryos. These data are reminiscent of the observations in L929 cells where the loss of caspase activity in healthy cells is sufficient to trigger necroptosis and prompted us to explore the extrinsic or intrinsic cellular factors that promote necroptosis once caspase-8 activity, which cleaves and inactivates RIP1 kinase and the RIP1 deubiquitinase CYLD [21], [22], is removed in L929 cells. Consistent with a previous report [16], we found that serum starvation of L929 cells prevented necroptosis in response to zVAD.fmk (Fig. 1A). The addition of growth factors, such as bFGF, restored zVAD.fmk induced death under serum free conditions (Fig. 1B). Interestingly, this does not reflect a generic requirement for growth factor signaling, as only some growth factors (bFGF and IGF-1, but not EGF and PDGF) promoted death (Fig. 1B). Furthermore, growth factor-dependent necroptosis required the inhibition of caspase activity, as bFGF alone did not induce cell death (Fig. 1C). In contrast, TNFα triggered necroptosis equally efficiently in the absence of serum (Fig. 1A), suggesting that either growth factors and zVAD.fmk or TNFα are required for necroptotic death in L929 cells. 10.1371/journal.pone.0056576.g001 Figure 1 bFGF and IGF-1 promote necroptosis in concert with zVAD.fmk. (A) L929 cells were treated with TNFα or zVAD.fmk under normal serum (10% FBS) or serum free conditions. Cell viability was determined after 24 hr using the CellTiter-Glo Viability assay. The concentrations of all necroptosis-inducing agents are listed in the Materials and Methods section or indicated in the figures. (B) Cells were treated with zVAD.fmk, the indicated growth factors, and Nec-1 under serum free conditions for 24 hrs followed by measurement of cell viability. (C) Cells under serum free conditions were treated with FGF, zVAD.fmk, or both for 24 hrs followed by viability assay. (D) Cell death was induced by zVAD.fmk or TNFα under full serum condition in the presence of 2 µM PD173074 and 20 µM PD166866. In all graphs, average±SD was plotted. Previously we described the development of 7-Cl-O-Nec-1 (Nec-1) as a potent and selective inhibitor of RIP1 kinase and necroptosis (Fig. S1A) [23], [24]. Recently, its selectivity has been further validated against a panel of more than 400 human kinases [15]. This inhibitor efficiently blocked growth factor/zVAD.fmk-induced necroptosis under serum free conditions in L929 cells and both zVAD.fmk and TNFα-induced necroptosis under full serum conditions (Fig. 1B, S1B). To further validate the role of RIP1, we used an inactive analog, 7-Cl-O-Nec-1i (Nec-1i) (Fig. S1A), which contains an extra N-methyl group that leads to almost complete loss of RIP1 kinase inhibitory activity in vitro [23]. Nec-1i was unable to protect L929 cell death under serum condtions treated with zVAD.fmk or TNFα (Fig. S1B) or serum free conditions treated with bFGF/zVAD.fmk (Fig. S1C). This confirms that RIP1 kinase is responsible for necroptosis in L929 cells under both serum and serum free conditions. We next examined whether bFGF contributes to zVAD.fmk-induced necroptosis under normal serum conditions (10% FBS). We used two bFGF receptor tyrosine kinase inhibitors (PD173074 and PD166866), and determined that inhibition of bFGF signaling strongly inhibited zVAD.fmk-induced necroptosis under normal serum conditions (Fig. 1D). In contrast, neither bFGF receptor inhibitor was able to attenuate TNFα-induced necroptosis (Fig. 1D), consistent with growth factors being dispensable for this pathway (Fig. 1A). Overall, these data suggest that the induction of necroptosis by zVAD.fmk is promoted by bFGF under both serum and serum free conditions. The induction of necroptosis, however, is not a simple consequence of growth factor signaling since not all growth factors allowed death to occur. Instead, specific signaling events mediated by particular growth factors appear to contribute to necroptotic death. RIP1 Kinase-dependent Activation of Akt Contributes to Necroptosis Given our observation that growth factors are important for zVAD.fmk induced death, we examined the contribution of several pathways, including MAPK pathways and Akt, which are known to be activated following growth factor receptor activation (Fig. 2A). Inhibition of Akt (Akt inhibitor VIII) strongly protected the cells from growth factor-sensitive necroptosis induced by zVAD.fmk [16] as well as cell death triggered by bFGF or IGF-1/zVAD.fmk under serum free conditions (Fig. 2B). Inhibition of Akt also protected the cells from growth-factor insensitive death by caused by TNFα (Fig. 2A). Consistent with previous reports, the JNK inhibitor SP600125 protected the cells from both zVAD.fmk and TNFα induced death (Fig. 2A,B and Fig. S2A) [12], [14]. In contrast, inhibition of two other MAPKs, p38 and ERK, previously reported not to be activated during necroptosis [14], did not protect from either zVAD.fmk or TNFα induced death (Fig. 2A). 10.1371/journal.pone.0056576.g002 Figure 2 Akt contributes to necroptosis induced by zVAD.fmk and TNFα. (A,B) Necroptosis was induced by zVAD.fmk or TNFα (full serum, A) or growth factors/zVAD.fmk (serum free, B) in the presence of inhibitors of Akt (Akt inhibitor VIII), JNK (SP600125), p38 (PD169316), and Erk (UO126). Cell viability was determined after 24 hrs. (C) L929 cells transfected with Akt1, Akt2, and Akt3 siRNAs for 72 hrs were treated with zVAD.fmk or TNFα for 9 hrs. Cell viability and Akt expression levels were determined after 24 hrs. In all graphs, average±SD was plotted. Next, we used two approaches to further validate the role of Akt in necroptotic cell death. First, two additional Akt inhibitors, a highly specific, allosteric kinase inhibitor MK-2206 [25] and triciribine (TCN) [26], which blocks membrane translocation of Akt, both attenuated cell death (Fig. S2B). Secondly, simultaneous knockdown of Akt isoforms Akt1 and Akt2 using siRNAs protected cells from necroptosis induced by both zVAD.fmk and TNFα (Fig. 2C). No expression of Akt3 was seen in L929 cells (Fig. S2C) and, consistently, Akt3 siRNA had no additional effect on necroptosis. Our results confirmed that Akt plays a key role in necroptosis induced by multiple stimuli in L929 cells. To understand the activation of Akt and JNK under necroptotic conditions, we examined the changes in Akt and JNK phosphorylation at 9 hrs post zVAD.fmk and TNFα stimulation. This time point was chosen because it reflects the early stage of cell death in our system (Fig. S3A, B). Following stimulation with either zVAD.fmk or TNFα we observed a robust increase in Akt phosphorylation at a known major activation site, Thr308 (Fig. 3A). Interestingly, we did not observe concomitant phosphorylation changes in the second major activation site of Akt, Ser473. We also observed an increase in the phosphorylation of both the p46 and p54 isoforms of JNK and its major substrate c-Jun (Fig. 3A). These data indicate that both Akt and JNK are activated under necroptotic conditions. 10.1371/journal.pone.0056576.g003 Figure 3 RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis. (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr, followed by western blotting with indicated antibodies. (B,C) L929 cells were treated with zVAD.fmk (B) or bFGF/zVAD.fmk (serum free conditions, C) and samples were collected at the indicated time points for western blot. (D) Nec-1 was added to the cells stimulated with bFGF or bFGF/zVAD (serum free conditions) for 15 min or 9 hr followed by western blot with the indicated antibodies. The RIP1 kinase inhibitor, Nec-1, completely prevented the increase in Thr308 Akt phosphorylation, while Nec-1i did not (Fig. 3A, Fig. S1D). Similarly, Nec-1 prevented the induction of JNK phosphorylation in response to zVAD.fmk and substantially reduced this change after TNFα addition. We observed some changes in total protein levels of JNK and c-Jun following necroptotic stimulation. Some of these changes, e.g. zVAD.fmk-induced increase in c-Jun, were also attenuated by Nec-1. Importantly, Nec-1 did not alter the basal phosphorylation levels of either Akt or JNK (Fig. 3A). This established that Akt Thr308 and JNK phosphorylation during necroptosis is RIP1 dependent. Interestingly, we discovered that the phosphorylation of Akt Thr308, JNK and Jun are late events following zVAD.fmk stimulation (Fig. 3B) that coincide with the onset of necroptosis at 6 hr post-stimulation (Fig. S3A). To better understand the contributions of growth factors and RIP1 kinase to necroptotic regulation of Akt, we next analyzed the time course of these phosphorylation changes under serum free conditions. We found that the addition of bFGF alone or in combination with zVAD.fmk led to a substantial rapid and transient increase in both Thr308 and Ser473 phosphorylation of Akt as well as JNK and c-Jun at 15 minutes, reflecting the expected response to growth factor stimulation (Fig. 3C). Significantly, the combination of bFGF/zVAD.fmk, but not bFGF alone, also caused a robust, second, delayed increase in the phosphorylation of Thr308, but not Ser473, of Akt as well as a delayed increase in the phosphorylation of JNK and Jun. Furthermore, Nec-1 had no significant effect on the early increase in both Akt and JNK/c-Jun phosphorylation triggered by both bFGF and bFGF/zVAD, while Nec-1, but not its inactive analog Nec-1i (Fig. S1E), efficiently blocked the bFGF/zVAD increase at 6–9 hr (Fig. 3D), suggesting that only the delayed activation of Akt and JNK is specific for necroptosis and dependent on RIP1 kinase activity. Similarly, IGF/zVAD, which also promoted cell death under serum free conditions, produced a delayed increase in Thr308 phosphorylation on Akt, while IGF alone caused solely an early, transient increase in phosphorylation (Fig. S3C). We confirmed the kinetics of the Akt Thr308 and Ser473 phosphorylation changes using a quantitative ELISA assay, which also showed a robust delayed necroptosis-specific RIP1-dependent increase in Akt Thr308 phosphorylation (Fig. S3D, E). Taken together, these results indicate that the observed delayed increases in Akt and JNK phosphorylation, preceding the onset of cell death, represent specific consequences of necroptotic signaling downstream from RIP1 kinase. TNFα Induces Delayed Akt Thr308 Phosphorylation and Necroptosis Independent of Growth Factor Stimulation Consistent with TNFα inducing necroptosis independently of growth factors (Fig. 1A), FGFR inhibitors did not attenuate TNFα-induced changes in Akt or JNK phosphorylation, while efficiently preventing these changes in response to zVAD.fmk (Fig. S4A). Furthermore, addition of TNFα led to comparable late activation of Akt p308 signal under both normal and serum free conditions (Fig. S4B, C), indicating that TNFα signaling to Akt Thr308 is growth factor-independent. In contrast, activation of JNK by TNFα followed different kinetics from zVAD.fmk-induced changes. TNFα treatment caused an early and robust increase in the phosphorylation of JNK and c-Jun. Nec-1 did not affect this early increase, however, it reduced levels of pJNK/Jun at the late, 9 hr time point (Fig. S4B, C). This again separated early RIP1-independent changes, which likely reflect the ability of additional upstream kinases, such as Ask1 to activate JNK [27], from the late RIP1 kinase-dependent necroptotic signaling. Late Increase in Akt Thr308 Phosphorylation Contributes to the Induction of Necroptotic Cell Death We next investigated if the delayed RIP1 kinase-dependent increase in Akt Thr308 phosphorylation functionally contributes to the execution of necroptotic cell death. Firstly, PDGF/zVAD.fmk, which cannot induce necroptosis (Fig. 2A), triggered only the initial, rapid Akt and JNK phosphorylation changes and not the delayed activation (Fig. 4A), indicating that late, rather than early Akt phosphorylation correlates with necroptosis. Secondly, we saw that the ability of the Akt inhibitor to protect cells from necroptosis rapidly declined after 6 hrs of stimulation with zVAD.fmk, TNFα or bFGF/zVAD.fmk and no protection was observed when the inhibitor was added at 9 hrs (Fig. 4B,C). This time frame coincides with the timing of the secondary Akt Thr308 phosphorylation. Finally, we terminated the bFGF signal one hour after addition of bFGF by the addition of PD173074. This allowed us to retain early Akt activation, but to suppress the secondary increase (Fig. 4D). Both pre-addition and delayed addition of PD173074 fully prevented necroptosis (Fig. 4E). Overall, these data, while correlative, indicate that early Akt activation is insufficient to promote necroptosis and are strongly supportive of an important role for the delayed activation of Akt in the induction of necroptotic cell death. 10.1371/journal.pone.0056576.g004 Figure 4 Late Thr308 phosphorylation of Akt contributes to necroptosis. (A) L929 cells were treated with zVAD.fmk and bFGF or PDGF, with or without Nec-1, for the indicated periods of time. (B,C) L929 cells were stimulated by zVAD.fmk or TNFα (B) or bFGF/zVAD.fmk under serum free conditions (C). Akt inh. VIII was added 15 min before necroptotic stimulation (Pre) or at indicated times after stimulation. Viability was measured 24 hr after activation of necroptosis. (D) L929 cells were stimulated with bFGF/zVAD under serum free conditions. PD173074 was added 15 min before or 1 hr after FGF/zVAD. Samples for western blot were collected at 15 min and 9 hr time points. (E) Cells were pretreated with PD173074 or it was added 1 hr after bFGF/zVAD.fmk, followed by viability assessment at 24 hr. In all graphs, average±SD was plotted. The Akt Signaling Pathway Contributes to the Regulation of Necroptosis We next determined whether the necroptosis-associated increase in Thr308 phosphorylation results in an increase in Akt kinase activity. Under necroptotic conditions, we observed an increase in the phosphorylation of multiple known Akt substrates (Forkhead box class O (FoxO) proteins, GSK-3 kinases and mouse double minute 2 (MDM2)) as well as downstream molecules (p70 ribosomal protein S6 Kinase (p70S6K), S6) (Fig. 5A). In some cases (FoxO1, FoxO4, MDM2), a robust increase was observed. In other cases (FoxO3a, GSK-3α/β, p70S6K and its substrate S6), the changes were less pronounced (Fig. 5A). The timing of the phosphorylation changes paralleled the increase in Akt phosphorylation (Fig. 5B, S5A, B). In the case of pFoxO1 we occasionally observed a shift in migration rather than an increase in band intensity (e.g. comparing Fig. 5A and B), suggesting that phosphorylation events in addition to Thr24 take place during necroptosis. Notably, in all cases the necroptosis-associated increases in Akt substrates were abrogated by Nec-1 (Fig. 5A, Fig. S5A, B). Overall, these data suggested that a significant part of the “canonical” Akt signaling network is activated at the onset of necroptotic cell death in a RIP1 dependent fashion. 10.1371/journal.pone.0056576.g005 Figure 5 mTORC1 contributes to the regulation of necroptosis. (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr and harvested for western blot. (B) Cell under serum free condition were treated with bFGF or bFGF/zVAD.fmk for the indicated amounts of time, followed by western blotting using the indicated antibodies. (C) Necroptosis was induced by zVAD.fmk or TNFα in L929 cell in the presence of inhibitors of Akt(Akt inh. VIII) and mTOR (rapamycin, Torin-1 and PI-103). (D) L929 cells with mTOR siRNA knockdown were harvested for western blot or treated with zVAD.fmk or TNFα for 24 hrs. Cell viability was determined 24 hr after activation of necroptosis. In all graphs, average±SD was plotted. Akt kinase is considered to be a pro-survival protein that inhibits apoptosis through the control of multiple effectors including mTORC1, GSK-3 and others [28]. An important question is whether these same molecules reverse their pro-survival roles during necroptosis. We found that inhibition of mTORC1 by rapamycin, an inhibitor of the mTOR co-factor Raptor [29], protected cells from necroptosis (Fig. 5C). Similarly, the direct mTOR kinase inhibitor Torin1 [30] and the dual PI3K/mTOR inhibitor PI-103 [31] also efficiently inhibited necroptosis (Fig. 5C). Knockdown of mTOR using siRNA further validated the small-molecule inhibitor data indicating a role for mTOR in necroptosis by protecting cells from both zVAD.fmk and TNFα induced death (Fig. 5D). mTORC1 regulates translation through activation of p70S6 kinase and, subsequently, ribosomal protein S6 [32]. Notably, a genome-wide siRNA screen [10] suggested an important role for protein translation in necroptosis. Consistently, we found that the small molecule inhibitor of p70S6K PF-4708671 [33] attenuated necroptosis at the concentrations required to block S6 phosphorylation (Fig. S5C, D). Partial siRNA knockdown of S6 protein attenuated necroptosis as well (Fig. S5E), suggesting that translational control by p70S6K/S6 may play a role in necroptosis. Overall, while the full repertoire of Akt targets during necroptosis remains to be fully explored, our data provide evidence that the activity of an anti-apoptotic branch of Akt signaling can promote necroptosis. RIP1 kinase, Akt, mTORC1 and JNK control the upregulation of TNFα accompanying necroptosis. Hitomi et al. [10] have recently reported that the induction of necroptosis by zVAD.fmk in L929 cells is associated with increased synthesis of TNFα, which potentiates cell death. Therefore, we examined whether Akt and its effectors contribute to TNFα synthesis. Consistent with a RIP1-dependent increase in TNFα protein (Fig. S6A, B), we found that TNFα mRNA levels increased during necroptosis in L929 cells in a RIP1 (Fig. S6C. Under serum free conditions, bFGF alone triggered some induction of TNFα mRNA, while its combination with zVAD.fmk (but not zVAD.fmk alone) caused a pronounced further increase (Fig. 6A). Conversely, PDGF caused a modest upregulation of TNFα mRNA, which was not further increased in the presence of zVAD.fmk (Fig. 6A), demonstrating that activation of necroptosis is specifically accompanied by a marked increase in autocrine TNFα synthesis. 10.1371/journal.pone.0056576.g006 Figure 6 Akt and mTORC1 control autocrine TNFα synthesis and JNK activation during necroptosis. (A) Cells were treated under serum free conditions with bFGF or PDGF with or without zVAD.fmk for 9 hr, followed by qRT-PCR analysis of mTNFα. Data was normalized to mouse 18S RNA. (B) Necroptosis was induced by zVAD.fmk or TNFα in cells treated with Nec-1, rapamycin (rapa), or Akt inh. VIII inh. followed by qRT-PCR analysis of TNFα mRNA levels. (C-F) L929 cells with siRNA knockdown of Akt isoforms (C,E) or mTOR (D,F) were stimulated with zVAD.fmk or TNFα for 9 hr, followed by qRT-PCR analysis of mTNFα (C,D) or western blot (E,F). In all graphs, average±SD was plotted. Further analysis suggested that both Akt and mTORC1 contribute to the upregulation of TNFα mRNA during necroptosis as both small-molecule inhibition and siRNA knockdown of Akt and mTOR reduced TNFα mRNA levels in necroptotic cells (Fig. 6B,C,D). Notably, RIP1 and Akt inhibitors had no effect on the levels of TNFα mRNA in control cells or in the cells stimulated with bFGF alone (Fig. 6A,B, Fig. S6C), suggesting that these kinases specifically mediate necroptosis-dependent increase in TNFα synthesis. Akt and mTORC1 Control the Activation of JNK during Necroptosis JNK is a well-established regulator of TNFα synthesis in a variety of systems [13], [14], [15], [34]. Therefore, the ability of Akt and mTORC1 inhibitors to block the increase in TNFα mRNA lead us to examine their role in the activation of JNK during necroptosis. Knockdown of Akt isoforms Akt1 and Akt2 or inhibition of Akt prominently suppressed the necroptosis dependent increase in JNK and c-Jun phosphorylation (Fig. 6E, S6D,E) suggesting that Akt may provide a link between RIP1 and JNK activation. Importantly, inhibition of Akt only inhibited the delayed, but not the early, increase in bFGF/zVAD.fmk induced JNK and c-Jun phosphorylation (Fig. S6F). Knockdown of mTOR, rapamycin and the p70S6K inhibitor PF-4708671 also attenuated the necroptosis-associated increase in JNK and c-Jun phosphorylation (Fig. 6F, S6E,G, Fig. S5D). Overall, these data suggested that the Akt-mTORC1-S6K axis, acting downstream from RIP1 kinase, is required for the increase in JNK activity during necroptosis in L929 cells. PI3-kinase and PDK1 Mediate the Increase in Akt Thr308 Phosphorylation Under Necroptotic Conditions Typical regulation of Akt by growth factors involves its recruitment to the plasma membrane, which is mediated by the binding of the pleckstrin homology (PH) domain of Akt to the product of PI3K, phosphatidylinositol-3,4,5-triphosphate (PIP3). In the membrane, Akt is phosphorylated on Thr308 and Ser473 by 3-phosphoinositide dependent protein kinase-1 (PDK1) and mTORC2 (or DNA-PK), respectively [35]. Since our results showed that only Thr308 Akt phosphorylation is increased during necroptosis, we next examined whether it is still dependent on PI3K and PDK1. Inhibition of PI3K and PDK1 using the specific inhibitors LY249002 and BX912 [36] resulted in the efficient inhibition of cell death and Akt Thr308 phosphorylation (Fig. S7A–D). Likewise, siRNA knockdown of PDK1 protected cells from death and inhibited Akt Thr308 phosphorylation (Fig. S7E,F) Therefore, PI3K and PDK1 activity is still required for non-canonical Akt activation during necroptosis. Expression of Constitutively Active Akt, Rescues Necroptosis Under Serum Free Conditions We used L929 cells stably expressing constitutively active wild type Akt1 (Myr-Akt) or the catalytically inactive mutant K179M in order to further understand the contribution of growth factors and RIP1 kinase to Akt activation during necroptosis. Constitutively active Akt1 (Myr-Akt) was generated as previously described [37] by the addition of a myristoylation signal which provides constitutive localization to the plasma membrane and by the deletion of the auto-inhibitory PH domain (Fig. 7A) resulting in an Akt that is active under serum free. It is important to note that the cells expressing Myr-Akt were viable, grew in a manner indistinguishable from the empty vector control cells, and were not triggered to induce necroptosis by serum starvation (Fig. 7B). This indicates that active Akt alone is not sufficient to induce necroptotic cell death. Under serum free conditions Myr-Akt, but not the K179M mutant, fully restored zVAD.fmk-induced necroptosis (Fig. 7A,B). Nec-1 prevented both Myr-Akt dependent cell death and the necroptosis-specific delayed increase in Akt Thr308 phosphorylation (Fig. 7B,C). Myr-Akt also allowed other zVAD.fmk-dependent events, including activation of JNK and c-Jun phosphorylation (Fig. 7C) and upregulation of TNFα mRNA (Fig. 7D) to occur under serum free conditions, confirming an important role for Akt at the apex of necroptotic signaling. These data demonstrated that the presence of active and membrane localized Akt is sufficient to uncouple Akt activation during necroptosis from growth factor signaling. RIP1 kinase was still able to regulate Akt activation during necroptosis, suggesting that growth factors and RIP1 kinase provide two independent inputs required for Akt changes during necroptosis. 10.1371/journal.pone.0056576.g007 Figure 7 Over expression of constitutively active Akt restores necroptosis under serum free conditions. (A,B) L929 cells were stably infected with empty MSCV retrovirus or viruses encoding Myr-Akt or the catalytically inactive Myr-Akt K179M. Necroptosis was induced by the addition of zVAD.fmk under serum free conditions (A) or serum or serum free conditions with Nec-1 (B). Viability assays were performed after 24 hr. (C) Myr-Akt and Myr-Akt K179M cells were treated with zVAD.fmk and/or Nec-1 under serum free conditions for 9 hr, followed by western blot using the indicated antibodies. Endogenous Akt (∼) and Myr-Akt (*) bands are indicated. (D) L929 cells, stably infected with Myr-Akt and Myr-Akt K179KM, were stimulated with zVAD.fmk for 9 hr under serum free conditions. TNFα mRNA levels were determined by qRT-PCR and normalized using mouse 18S RNA. (E-G) L929 cells expressing Myr-Akt and Ala and Asp mutants of Thr308 and Ser473 were treated with zVAD.fmk under serum free conditions, followed by viability assay at 24 hr (E), western blot at 9 hr (F), or evaluation of TNFα mRNA levels by qRT-PCR at 9 hrs (G). In all graphs, average±SD was plotted. RIP1 kinase-dependent Thr308 phosphorylation of Myr-Akt during necroptosis"
R10223	T15656	T15751	themeOf	FoxO1,phosphorylation of FoxO1 and MDM2
R10224	T15660	T15744	themeOf	JNK,"other zVAD.fmk-dependent events, including activation of JNK and c-Jun"
R10225	T15661	T15770	themeOf	JNK,JNK activation
R10226	T15668	T15745	themeOf	c-Jun,"other zVAD.fmk-dependent events, including activation of JNK and c-Jun"
R10227	T15672	T15759	themeOf	Myr-Akt,the cells expressing Myr-Akt
R10228	T15674	T15753	causeOf	RIP1 kinase-dependent,"RIP1 kinase-dependent Thr308 phosphorylation during necroptosis in multiple cell types. Furthermore, we found that downstream Akt signaling through mTORC1 and S6 contributes to the activation of necroptosis and TNFα production. We found that the Akt pathway serves as a critical link between RIP1 kinase and JNK activation in L929 cells. Further data suggested that in multiple other cell types including FADD deficient Jurkat cells, RAW and J774.1 macrophage cell lines, and mouse lung fibroblasts Akt provides a key link to TNFα production, but is dispensible for cell death per se. Overall, our results reveal a specific and novel role for the Akt pathway in regulated necrosis and necrosis-associated inflammatory signaling. Results Basic Fibroblast Growth Factor Promotes Necroptosis in L929 Cells It has been established that mouse fibrosarcoma L929 cells undergo necroptotic cell death following stimulation with TNFα [10], [17]. In addition, inhibition of caspase-8 activity alone, either through siRNA knockdown or by using the pan-caspase inhibitor, zVAD.fmk, is sufficient to trigger necroptosis in these cells [10], [14]. Interestingly, while necroptosis was initially identified as a back-up form of cell death triggered by pro-apoptotic stimuli in the presence of apoptosis inhibitors [17], recent analysis of physiological cell death during mouse development has suggested that the loss of apoptotic regulators, such as caspase-8 and FADD [18], [19], [20], leads to robust induction of necroptosis and death of E10.5 embryos even though apoptosis is not normally induced in wild type embryos. These data are reminiscent of the observations in L929 cells where the loss of caspase activity in healthy cells is sufficient to trigger necroptosis and prompted us to explore the extrinsic or intrinsic cellular factors that promote necroptosis once caspase-8 activity, which cleaves and inactivates RIP1 kinase and the RIP1 deubiquitinase CYLD [21], [22], is removed in L929 cells. Consistent with a previous report [16], we found that serum starvation of L929 cells prevented necroptosis in response to zVAD.fmk (Fig. 1A). The addition of growth factors, such as bFGF, restored zVAD.fmk induced death under serum free conditions (Fig. 1B). Interestingly, this does not reflect a generic requirement for growth factor signaling, as only some growth factors (bFGF and IGF-1, but not EGF and PDGF) promoted death (Fig. 1B). Furthermore, growth factor-dependent necroptosis required the inhibition of caspase activity, as bFGF alone did not induce cell death (Fig. 1C). In contrast, TNFα triggered necroptosis equally efficiently in the absence of serum (Fig. 1A), suggesting that either growth factors and zVAD.fmk or TNFα are required for necroptotic death in L929 cells. 10.1371/journal.pone.0056576.g001 Figure 1 bFGF and IGF-1 promote necroptosis in concert with zVAD.fmk. (A) L929 cells were treated with TNFα or zVAD.fmk under normal serum (10% FBS) or serum free conditions. Cell viability was determined after 24 hr using the CellTiter-Glo Viability assay. The concentrations of all necroptosis-inducing agents are listed in the Materials and Methods section or indicated in the figures. (B) Cells were treated with zVAD.fmk, the indicated growth factors, and Nec-1 under serum free conditions for 24 hrs followed by measurement of cell viability. (C) Cells under serum free conditions were treated with FGF, zVAD.fmk, or both for 24 hrs followed by viability assay. (D) Cell death was induced by zVAD.fmk or TNFα under full serum condition in the presence of 2 µM PD173074 and 20 µM PD166866. In all graphs, average±SD was plotted. Previously we described the development of 7-Cl-O-Nec-1 (Nec-1) as a potent and selective inhibitor of RIP1 kinase and necroptosis (Fig. S1A) [23], [24]. Recently, its selectivity has been further validated against a panel of more than 400 human kinases [15]. This inhibitor efficiently blocked growth factor/zVAD.fmk-induced necroptosis under serum free conditions in L929 cells and both zVAD.fmk and TNFα-induced necroptosis under full serum conditions (Fig. 1B, S1B). To further validate the role of RIP1, we used an inactive analog, 7-Cl-O-Nec-1i (Nec-1i) (Fig. S1A), which contains an extra N-methyl group that leads to almost complete loss of RIP1 kinase inhibitory activity in vitro [23]. Nec-1i was unable to protect L929 cell death under serum condtions treated with zVAD.fmk or TNFα (Fig. S1B) or serum free conditions treated with bFGF/zVAD.fmk (Fig. S1C). This confirms that RIP1 kinase is responsible for necroptosis in L929 cells under both serum and serum free conditions. We next examined whether bFGF contributes to zVAD.fmk-induced necroptosis under normal serum conditions (10% FBS). We used two bFGF receptor tyrosine kinase inhibitors (PD173074 and PD166866), and determined that inhibition of bFGF signaling strongly inhibited zVAD.fmk-induced necroptosis under normal serum conditions (Fig. 1D). In contrast, neither bFGF receptor inhibitor was able to attenuate TNFα-induced necroptosis (Fig. 1D), consistent with growth factors being dispensable for this pathway (Fig. 1A). Overall, these data suggest that the induction of necroptosis by zVAD.fmk is promoted by bFGF under both serum and serum free conditions. The induction of necroptosis, however, is not a simple consequence of growth factor signaling since not all growth factors allowed death to occur. Instead, specific signaling events mediated by particular growth factors appear to contribute to necroptotic death. RIP1 Kinase-dependent Activation of Akt Contributes to Necroptosis Given our observation that growth factors are important for zVAD.fmk induced death, we examined the contribution of several pathways, including MAPK pathways and Akt, which are known to be activated following growth factor receptor activation (Fig. 2A). Inhibition of Akt (Akt inhibitor VIII) strongly protected the cells from growth factor-sensitive necroptosis induced by zVAD.fmk [16] as well as cell death triggered by bFGF or IGF-1/zVAD.fmk under serum free conditions (Fig. 2B). Inhibition of Akt also protected the cells from growth-factor insensitive death by caused by TNFα (Fig. 2A). Consistent with previous reports, the JNK inhibitor SP600125 protected the cells from both zVAD.fmk and TNFα induced death (Fig. 2A,B and Fig. S2A) [12], [14]. In contrast, inhibition of two other MAPKs, p38 and ERK, previously reported not to be activated during necroptosis [14], did not protect from either zVAD.fmk or TNFα induced death (Fig. 2A). 10.1371/journal.pone.0056576.g002 Figure 2 Akt contributes to necroptosis induced by zVAD.fmk and TNFα. (A,B) Necroptosis was induced by zVAD.fmk or TNFα (full serum, A) or growth factors/zVAD.fmk (serum free, B) in the presence of inhibitors of Akt (Akt inhibitor VIII), JNK (SP600125), p38 (PD169316), and Erk (UO126). Cell viability was determined after 24 hrs. (C) L929 cells transfected with Akt1, Akt2, and Akt3 siRNAs for 72 hrs were treated with zVAD.fmk or TNFα for 9 hrs. Cell viability and Akt expression levels were determined after 24 hrs. In all graphs, average±SD was plotted. Next, we used two approaches to further validate the role of Akt in necroptotic cell death. First, two additional Akt inhibitors, a highly specific, allosteric kinase inhibitor MK-2206 [25] and triciribine (TCN) [26], which blocks membrane translocation of Akt, both attenuated cell death (Fig. S2B). Secondly, simultaneous knockdown of Akt isoforms Akt1 and Akt2 using siRNAs protected cells from necroptosis induced by both zVAD.fmk and TNFα (Fig. 2C). No expression of Akt3 was seen in L929 cells (Fig. S2C) and, consistently, Akt3 siRNA had no additional effect on necroptosis. Our results confirmed that Akt plays a key role in necroptosis induced by multiple stimuli in L929 cells. To understand the activation of Akt and JNK under necroptotic conditions, we examined the changes in Akt and JNK phosphorylation at 9 hrs post zVAD.fmk and TNFα stimulation. This time point was chosen because it reflects the early stage of cell death in our system (Fig. S3A, B). Following stimulation with either zVAD.fmk or TNFα we observed a robust increase in Akt phosphorylation at a known major activation site, Thr308 (Fig. 3A). Interestingly, we did not observe concomitant phosphorylation changes in the second major activation site of Akt, Ser473. We also observed an increase in the phosphorylation of both the p46 and p54 isoforms of JNK and its major substrate c-Jun (Fig. 3A). These data indicate that both Akt and JNK are activated under necroptotic conditions. 10.1371/journal.pone.0056576.g003 Figure 3 RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis. (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr, followed by western blotting with indicated antibodies. (B,C) L929 cells were treated with zVAD.fmk (B) or bFGF/zVAD.fmk (serum free conditions, C) and samples were collected at the indicated time points for western blot. (D) Nec-1 was added to the cells stimulated with bFGF or bFGF/zVAD (serum free conditions) for 15 min or 9 hr followed by western blot with the indicated antibodies. The RIP1 kinase inhibitor, Nec-1, completely prevented the increase in Thr308 Akt phosphorylation, while Nec-1i did not (Fig. 3A, Fig. S1D). Similarly, Nec-1 prevented the induction of JNK phosphorylation in response to zVAD.fmk and substantially reduced this change after TNFα addition. We observed some changes in total protein levels of JNK and c-Jun following necroptotic stimulation. Some of these changes, e.g. zVAD.fmk-induced increase in c-Jun, were also attenuated by Nec-1. Importantly, Nec-1 did not alter the basal phosphorylation levels of either Akt or JNK (Fig. 3A). This established that Akt Thr308 and JNK phosphorylation during necroptosis is RIP1 dependent. Interestingly, we discovered that the phosphorylation of Akt Thr308, JNK and Jun are late events following zVAD.fmk stimulation (Fig. 3B) that coincide with the onset of necroptosis at 6 hr post-stimulation (Fig. S3A). To better understand the contributions of growth factors and RIP1 kinase to necroptotic regulation of Akt, we next analyzed the time course of these phosphorylation changes under serum free conditions. We found that the addition of bFGF alone or in combination with zVAD.fmk led to a substantial rapid and transient increase in both Thr308 and Ser473 phosphorylation of Akt as well as JNK and c-Jun at 15 minutes, reflecting the expected response to growth factor stimulation (Fig. 3C). Significantly, the combination of bFGF/zVAD.fmk, but not bFGF alone, also caused a robust, second, delayed increase in the phosphorylation of Thr308, but not Ser473, of Akt as well as a delayed increase in the phosphorylation of JNK and Jun. Furthermore, Nec-1 had no significant effect on the early increase in both Akt and JNK/c-Jun phosphorylation triggered by both bFGF and bFGF/zVAD, while Nec-1, but not its inactive analog Nec-1i (Fig. S1E), efficiently blocked the bFGF/zVAD increase at 6–9 hr (Fig. 3D), suggesting that only the delayed activation of Akt and JNK is specific for necroptosis and dependent on RIP1 kinase activity. Similarly, IGF/zVAD, which also promoted cell death under serum free conditions, produced a delayed increase in Thr308 phosphorylation on Akt, while IGF alone caused solely an early, transient increase in phosphorylation (Fig. S3C). We confirmed the kinetics of the Akt Thr308 and Ser473 phosphorylation changes using a quantitative ELISA assay, which also showed a robust delayed necroptosis-specific RIP1-dependent increase in Akt Thr308 phosphorylation (Fig. S3D, E). Taken together, these results indicate that the observed delayed increases in Akt and JNK phosphorylation, preceding the onset of cell death, represent specific consequences of necroptotic signaling downstream from RIP1 kinase. TNFα Induces Delayed Akt Thr308 Phosphorylation and Necroptosis Independent of Growth Factor Stimulation Consistent with TNFα inducing necroptosis independently of growth factors (Fig. 1A), FGFR inhibitors did not attenuate TNFα-induced changes in Akt or JNK phosphorylation, while efficiently preventing these changes in response to zVAD.fmk (Fig. S4A). Furthermore, addition of TNFα led to comparable late activation of Akt p308 signal under both normal and serum free conditions (Fig. S4B, C), indicating that TNFα signaling to Akt Thr308 is growth factor-independent. In contrast, activation of JNK by TNFα followed different kinetics from zVAD.fmk-induced changes. TNFα treatment caused an early and robust increase in the phosphorylation of JNK and c-Jun. Nec-1 did not affect this early increase, however, it reduced levels of pJNK/Jun at the late, 9 hr time point (Fig. S4B, C). This again separated early RIP1-independent changes, which likely reflect the ability of additional upstream kinases, such as Ask1 to activate JNK [27], from the late RIP1 kinase-dependent necroptotic signaling. Late Increase in Akt Thr308 Phosphorylation Contributes to the Induction of Necroptotic Cell Death We next investigated if the delayed RIP1 kinase-dependent increase in Akt Thr308 phosphorylation functionally contributes to the execution of necroptotic cell death. Firstly, PDGF/zVAD.fmk, which cannot induce necroptosis (Fig. 2A), triggered only the initial, rapid Akt and JNK phosphorylation changes and not the delayed activation (Fig. 4A), indicating that late, rather than early Akt phosphorylation correlates with necroptosis. Secondly, we saw that the ability of the Akt inhibitor to protect cells from necroptosis rapidly declined after 6 hrs of stimulation with zVAD.fmk, TNFα or bFGF/zVAD.fmk and no protection was observed when the inhibitor was added at 9 hrs (Fig. 4B,C). This time frame coincides with the timing of the secondary Akt Thr308 phosphorylation. Finally, we terminated the bFGF signal one hour after addition of bFGF by the addition of PD173074. This allowed us to retain early Akt activation, but to suppress the secondary increase (Fig. 4D). Both pre-addition and delayed addition of PD173074 fully prevented necroptosis (Fig. 4E). Overall, these data, while correlative, indicate that early Akt activation is insufficient to promote necroptosis and are strongly supportive of an important role for the delayed activation of Akt in the induction of necroptotic cell death. 10.1371/journal.pone.0056576.g004 Figure 4 Late Thr308 phosphorylation of Akt contributes to necroptosis. (A) L929 cells were treated with zVAD.fmk and bFGF or PDGF, with or without Nec-1, for the indicated periods of time. (B,C) L929 cells were stimulated by zVAD.fmk or TNFα (B) or bFGF/zVAD.fmk under serum free conditions (C). Akt inh. VIII was added 15 min before necroptotic stimulation (Pre) or at indicated times after stimulation. Viability was measured 24 hr after activation of necroptosis. (D) L929 cells were stimulated with bFGF/zVAD under serum free conditions. PD173074 was added 15 min before or 1 hr after FGF/zVAD. Samples for western blot were collected at 15 min and 9 hr time points. (E) Cells were pretreated with PD173074 or it was added 1 hr after bFGF/zVAD.fmk, followed by viability assessment at 24 hr. In all graphs, average±SD was plotted. The Akt Signaling Pathway Contributes to the Regulation of Necroptosis We next determined whether the necroptosis-associated increase in Thr308 phosphorylation results in an increase in Akt kinase activity. Under necroptotic conditions, we observed an increase in the phosphorylation of multiple known Akt substrates (Forkhead box class O (FoxO) proteins, GSK-3 kinases and mouse double minute 2 (MDM2)) as well as downstream molecules (p70 ribosomal protein S6 Kinase (p70S6K), S6) (Fig. 5A). In some cases (FoxO1, FoxO4, MDM2), a robust increase was observed. In other cases (FoxO3a, GSK-3α/β, p70S6K and its substrate S6), the changes were less pronounced (Fig. 5A). The timing of the phosphorylation changes paralleled the increase in Akt phosphorylation (Fig. 5B, S5A, B). In the case of pFoxO1 we occasionally observed a shift in migration rather than an increase in band intensity (e.g. comparing Fig. 5A and B), suggesting that phosphorylation events in addition to Thr24 take place during necroptosis. Notably, in all cases the necroptosis-associated increases in Akt substrates were abrogated by Nec-1 (Fig. 5A, Fig. S5A, B). Overall, these data suggested that a significant part of the “canonical” Akt signaling network is activated at the onset of necroptotic cell death in a RIP1 dependent fashion. 10.1371/journal.pone.0056576.g005 Figure 5 mTORC1 contributes to the regulation of necroptosis. (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr and harvested for western blot. (B) Cell under serum free condition were treated with bFGF or bFGF/zVAD.fmk for the indicated amounts of time, followed by western blotting using the indicated antibodies. (C) Necroptosis was induced by zVAD.fmk or TNFα in L929 cell in the presence of inhibitors of Akt(Akt inh. VIII) and mTOR (rapamycin, Torin-1 and PI-103). (D) L929 cells with mTOR siRNA knockdown were harvested for western blot or treated with zVAD.fmk or TNFα for 24 hrs. Cell viability was determined 24 hr after activation of necroptosis. In all graphs, average±SD was plotted. Akt kinase is considered to be a pro-survival protein that inhibits apoptosis through the control of multiple effectors including mTORC1, GSK-3 and others [28]. An important question is whether these same molecules reverse their pro-survival roles during necroptosis. We found that inhibition of mTORC1 by rapamycin, an inhibitor of the mTOR co-factor Raptor [29], protected cells from necroptosis (Fig. 5C). Similarly, the direct mTOR kinase inhibitor Torin1 [30] and the dual PI3K/mTOR inhibitor PI-103 [31] also efficiently inhibited necroptosis (Fig. 5C). Knockdown of mTOR using siRNA further validated the small-molecule inhibitor data indicating a role for mTOR in necroptosis by protecting cells from both zVAD.fmk and TNFα induced death (Fig. 5D). mTORC1 regulates translation through activation of p70S6 kinase and, subsequently, ribosomal protein S6 [32]. Notably, a genome-wide siRNA screen [10] suggested an important role for protein translation in necroptosis. Consistently, we found that the small molecule inhibitor of p70S6K PF-4708671 [33] attenuated necroptosis at the concentrations required to block S6 phosphorylation (Fig. S5C, D). Partial siRNA knockdown of S6 protein attenuated necroptosis as well (Fig. S5E), suggesting that translational control by p70S6K/S6 may play a role in necroptosis. Overall, while the full repertoire of Akt targets during necroptosis remains to be fully explored, our data provide evidence that the activity of an anti-apoptotic branch of Akt signaling can promote necroptosis. RIP1 kinase, Akt, mTORC1 and JNK control the upregulation of TNFα accompanying necroptosis. Hitomi et al. [10] have recently reported that the induction of necroptosis by zVAD.fmk in L929 cells is associated with increased synthesis of TNFα, which potentiates cell death. Therefore, we examined whether Akt and its effectors contribute to TNFα synthesis. Consistent with a RIP1-dependent increase in TNFα protein (Fig. S6A, B), we found that TNFα mRNA levels increased during necroptosis in L929 cells in a RIP1 (Fig. S6C. Under serum free conditions, bFGF alone triggered some induction of TNFα mRNA, while its combination with zVAD.fmk (but not zVAD.fmk alone) caused a pronounced further increase (Fig. 6A). Conversely, PDGF caused a modest upregulation of TNFα mRNA, which was not further increased in the presence of zVAD.fmk (Fig. 6A), demonstrating that activation of necroptosis is specifically accompanied by a marked increase in autocrine TNFα synthesis. 10.1371/journal.pone.0056576.g006 Figure 6 Akt and mTORC1 control autocrine TNFα synthesis and JNK activation during necroptosis. (A) Cells were treated under serum free conditions with bFGF or PDGF with or without zVAD.fmk for 9 hr, followed by qRT-PCR analysis of mTNFα. Data was normalized to mouse 18S RNA. (B) Necroptosis was induced by zVAD.fmk or TNFα in cells treated with Nec-1, rapamycin (rapa), or Akt inh. VIII inh. followed by qRT-PCR analysis of TNFα mRNA levels. (C-F) L929 cells with siRNA knockdown of Akt isoforms (C,E) or mTOR (D,F) were stimulated with zVAD.fmk or TNFα for 9 hr, followed by qRT-PCR analysis of mTNFα (C,D) or western blot (E,F). In all graphs, average±SD was plotted. Further analysis suggested that both Akt and mTORC1 contribute to the upregulation of TNFα mRNA during necroptosis as both small-molecule inhibition and siRNA knockdown of Akt and mTOR reduced TNFα mRNA levels in necroptotic cells (Fig. 6B,C,D). Notably, RIP1 and Akt inhibitors had no effect on the levels of TNFα mRNA in control cells or in the cells stimulated with bFGF alone (Fig. 6A,B, Fig. S6C), suggesting that these kinases specifically mediate necroptosis-dependent increase in TNFα synthesis. Akt and mTORC1 Control the Activation of JNK during Necroptosis JNK is a well-established regulator of TNFα synthesis in a variety of systems [13], [14], [15], [34]. Therefore, the ability of Akt and mTORC1 inhibitors to block the increase in TNFα mRNA lead us to examine their role in the activation of JNK during necroptosis. Knockdown of Akt isoforms Akt1 and Akt2 or inhibition of Akt prominently suppressed the necroptosis dependent increase in JNK and c-Jun phosphorylation (Fig. 6E, S6D,E) suggesting that Akt may provide a link between RIP1 and JNK activation. Importantly, inhibition of Akt only inhibited the delayed, but not the early, increase in bFGF/zVAD.fmk induced JNK and c-Jun phosphorylation (Fig. S6F). Knockdown of mTOR, rapamycin and the p70S6K inhibitor PF-4708671 also attenuated the necroptosis-associated increase in JNK and c-Jun phosphorylation (Fig. 6F, S6E,G, Fig. S5D). Overall, these data suggested that the Akt-mTORC1-S6K axis, acting downstream from RIP1 kinase, is required for the increase in JNK activity during necroptosis in L929 cells. PI3-kinase and PDK1 Mediate the Increase in Akt Thr308 Phosphorylation Under Necroptotic Conditions Typical regulation of Akt by growth factors involves its recruitment to the plasma membrane, which is mediated by the binding of the pleckstrin homology (PH) domain of Akt to the product of PI3K, phosphatidylinositol-3,4,5-triphosphate (PIP3). In the membrane, Akt is phosphorylated on Thr308 and Ser473 by 3-phosphoinositide dependent protein kinase-1 (PDK1) and mTORC2 (or DNA-PK), respectively [35]. Since our results showed that only Thr308 Akt phosphorylation is increased during necroptosis, we next examined whether it is still dependent on PI3K and PDK1. Inhibition of PI3K and PDK1 using the specific inhibitors LY249002 and BX912 [36] resulted in the efficient inhibition of cell death and Akt Thr308 phosphorylation (Fig. S7A–D). Likewise, siRNA knockdown of PDK1 protected cells from death and inhibited Akt Thr308 phosphorylation (Fig. S7E,F) Therefore, PI3K and PDK1 activity is still required for non-canonical Akt activation during necroptosis. Expression of Constitutively Active Akt, Rescues Necroptosis Under Serum Free Conditions We used L929 cells stably expressing constitutively active wild type Akt1 (Myr-Akt) or the catalytically inactive mutant K179M in order to further understand the contribution of growth factors and RIP1 kinase to Akt activation during necroptosis. Constitutively active Akt1 (Myr-Akt) was generated as previously described [37] by the addition of a myristoylation signal which provides constitutive localization to the plasma membrane and by the deletion of the auto-inhibitory PH domain (Fig. 7A) resulting in an Akt that is active under serum free. It is important to note that the cells expressing Myr-Akt were viable, grew in a manner indistinguishable from the empty vector control cells, and were not triggered to induce necroptosis by serum starvation (Fig. 7B). This indicates that active Akt alone is not sufficient to induce necroptotic cell death. Under serum free conditions Myr-Akt, but not the K179M mutant, fully restored zVAD.fmk-induced necroptosis (Fig. 7A,B). Nec-1 prevented both Myr-Akt dependent cell death and the necroptosis-specific delayed increase in Akt Thr308 phosphorylation (Fig. 7B,C). Myr-Akt also allowed other zVAD.fmk-dependent events, including activation of JNK and c-Jun phosphorylation (Fig. 7C) and upregulation of TNFα mRNA (Fig. 7D) to occur under serum free conditions, confirming an important role for Akt at the apex of necroptotic signaling. These data demonstrated that the presence of active and membrane localized Akt is sufficient to uncouple Akt activation during necroptosis from growth factor signaling. RIP1 kinase was still able to regulate Akt activation during necroptosis, suggesting that growth factors and RIP1 kinase provide two independent inputs required for Akt changes during necroptosis. 10.1371/journal.pone.0056576.g007 Figure 7 Over expression of constitutively active Akt restores necroptosis under serum free conditions. (A,B) L929 cells were stably infected with empty MSCV retrovirus or viruses encoding Myr-Akt or the catalytically inactive Myr-Akt K179M. Necroptosis was induced by the addition of zVAD.fmk under serum free conditions (A) or serum or serum free conditions with Nec-1 (B). Viability assays were performed after 24 hr. (C) Myr-Akt and Myr-Akt K179M cells were treated with zVAD.fmk and/or Nec-1 under serum free conditions for 9 hr, followed by western blot using the indicated antibodies. Endogenous Akt (∼) and Myr-Akt (*) bands are indicated. (D) L929 cells, stably infected with Myr-Akt and Myr-Akt K179KM, were stimulated with zVAD.fmk for 9 hr under serum free conditions. TNFα mRNA levels were determined by qRT-PCR and normalized using mouse 18S RNA. (E-G) L929 cells expressing Myr-Akt and Ala and Asp mutants of Thr308 and Ser473 were treated with zVAD.fmk under serum free conditions, followed by viability assay at 24 hr (E), western blot at 9 hr (F), or evaluation of TNFα mRNA levels by qRT-PCR at 9 hrs (G). In all graphs, average±SD was plotted. RIP1 kinase-dependent Thr308 phosphorylation of Myr-Akt during necroptosis"
R10229	T15687	T15768	themeOf	c-Jun,phosphorylation of JNK and c-Jun
R10230	T15689	T15769	themeOf	JNK,phosphorylation of JNK and c-Jun
R10231	T15694	T15749	causeOf	growth factor,growth factor signaling
R10232	T15697	T15766	themeOf	of TNFα mRNA,upregulation of TNFα mRNA
R10233	T15702	T15757	themeOf	Akt,Akt activation
R10234	T15706	T15631	partOf	Thr308,of Myr-Akt
R10235	T15706	T15771	siteOf	Thr308,necroptotic Thr308 phosphorylation of Myr-Akt
R10236	T15708	T15756	themeOf	of Myr-Akt,"RIP1 kinase-dependent Thr308 phosphorylation during necroptosis in multiple cell types. Furthermore, we found that downstream Akt signaling through mTORC1 and S6 contributes to the activation of necroptosis and TNFα production. We found that the Akt pathway serves as a critical link between RIP1 kinase and JNK activation in L929 cells. Further data suggested that in multiple other cell types including FADD deficient Jurkat cells, RAW and J774.1 macrophage cell lines, and mouse lung fibroblasts Akt provides a key link to TNFα production, but is dispensible for cell death per se. Overall, our results reveal a specific and novel role for the Akt pathway in regulated necrosis and necrosis-associated inflammatory signaling. Results Basic Fibroblast Growth Factor Promotes Necroptosis in L929 Cells It has been established that mouse fibrosarcoma L929 cells undergo necroptotic cell death following stimulation with TNFα [10], [17]. In addition, inhibition of caspase-8 activity alone, either through siRNA knockdown or by using the pan-caspase inhibitor, zVAD.fmk, is sufficient to trigger necroptosis in these cells [10], [14]. Interestingly, while necroptosis was initially identified as a back-up form of cell death triggered by pro-apoptotic stimuli in the presence of apoptosis inhibitors [17], recent analysis of physiological cell death during mouse development has suggested that the loss of apoptotic regulators, such as caspase-8 and FADD [18], [19], [20], leads to robust induction of necroptosis and death of E10.5 embryos even though apoptosis is not normally induced in wild type embryos. These data are reminiscent of the observations in L929 cells where the loss of caspase activity in healthy cells is sufficient to trigger necroptosis and prompted us to explore the extrinsic or intrinsic cellular factors that promote necroptosis once caspase-8 activity, which cleaves and inactivates RIP1 kinase and the RIP1 deubiquitinase CYLD [21], [22], is removed in L929 cells. Consistent with a previous report [16], we found that serum starvation of L929 cells prevented necroptosis in response to zVAD.fmk (Fig. 1A). The addition of growth factors, such as bFGF, restored zVAD.fmk induced death under serum free conditions (Fig. 1B). Interestingly, this does not reflect a generic requirement for growth factor signaling, as only some growth factors (bFGF and IGF-1, but not EGF and PDGF) promoted death (Fig. 1B). Furthermore, growth factor-dependent necroptosis required the inhibition of caspase activity, as bFGF alone did not induce cell death (Fig. 1C). In contrast, TNFα triggered necroptosis equally efficiently in the absence of serum (Fig. 1A), suggesting that either growth factors and zVAD.fmk or TNFα are required for necroptotic death in L929 cells. 10.1371/journal.pone.0056576.g001 Figure 1 bFGF and IGF-1 promote necroptosis in concert with zVAD.fmk. (A) L929 cells were treated with TNFα or zVAD.fmk under normal serum (10% FBS) or serum free conditions. Cell viability was determined after 24 hr using the CellTiter-Glo Viability assay. The concentrations of all necroptosis-inducing agents are listed in the Materials and Methods section or indicated in the figures. (B) Cells were treated with zVAD.fmk, the indicated growth factors, and Nec-1 under serum free conditions for 24 hrs followed by measurement of cell viability. (C) Cells under serum free conditions were treated with FGF, zVAD.fmk, or both for 24 hrs followed by viability assay. (D) Cell death was induced by zVAD.fmk or TNFα under full serum condition in the presence of 2 µM PD173074 and 20 µM PD166866. In all graphs, average±SD was plotted. Previously we described the development of 7-Cl-O-Nec-1 (Nec-1) as a potent and selective inhibitor of RIP1 kinase and necroptosis (Fig. S1A) [23], [24]. Recently, its selectivity has been further validated against a panel of more than 400 human kinases [15]. This inhibitor efficiently blocked growth factor/zVAD.fmk-induced necroptosis under serum free conditions in L929 cells and both zVAD.fmk and TNFα-induced necroptosis under full serum conditions (Fig. 1B, S1B). To further validate the role of RIP1, we used an inactive analog, 7-Cl-O-Nec-1i (Nec-1i) (Fig. S1A), which contains an extra N-methyl group that leads to almost complete loss of RIP1 kinase inhibitory activity in vitro [23]. Nec-1i was unable to protect L929 cell death under serum condtions treated with zVAD.fmk or TNFα (Fig. S1B) or serum free conditions treated with bFGF/zVAD.fmk (Fig. S1C). This confirms that RIP1 kinase is responsible for necroptosis in L929 cells under both serum and serum free conditions. We next examined whether bFGF contributes to zVAD.fmk-induced necroptosis under normal serum conditions (10% FBS). We used two bFGF receptor tyrosine kinase inhibitors (PD173074 and PD166866), and determined that inhibition of bFGF signaling strongly inhibited zVAD.fmk-induced necroptosis under normal serum conditions (Fig. 1D). In contrast, neither bFGF receptor inhibitor was able to attenuate TNFα-induced necroptosis (Fig. 1D), consistent with growth factors being dispensable for this pathway (Fig. 1A). Overall, these data suggest that the induction of necroptosis by zVAD.fmk is promoted by bFGF under both serum and serum free conditions. The induction of necroptosis, however, is not a simple consequence of growth factor signaling since not all growth factors allowed death to occur. Instead, specific signaling events mediated by particular growth factors appear to contribute to necroptotic death. RIP1 Kinase-dependent Activation of Akt Contributes to Necroptosis Given our observation that growth factors are important for zVAD.fmk induced death, we examined the contribution of several pathways, including MAPK pathways and Akt, which are known to be activated following growth factor receptor activation (Fig. 2A). Inhibition of Akt (Akt inhibitor VIII) strongly protected the cells from growth factor-sensitive necroptosis induced by zVAD.fmk [16] as well as cell death triggered by bFGF or IGF-1/zVAD.fmk under serum free conditions (Fig. 2B). Inhibition of Akt also protected the cells from growth-factor insensitive death by caused by TNFα (Fig. 2A). Consistent with previous reports, the JNK inhibitor SP600125 protected the cells from both zVAD.fmk and TNFα induced death (Fig. 2A,B and Fig. S2A) [12], [14]. In contrast, inhibition of two other MAPKs, p38 and ERK, previously reported not to be activated during necroptosis [14], did not protect from either zVAD.fmk or TNFα induced death (Fig. 2A). 10.1371/journal.pone.0056576.g002 Figure 2 Akt contributes to necroptosis induced by zVAD.fmk and TNFα. (A,B) Necroptosis was induced by zVAD.fmk or TNFα (full serum, A) or growth factors/zVAD.fmk (serum free, B) in the presence of inhibitors of Akt (Akt inhibitor VIII), JNK (SP600125), p38 (PD169316), and Erk (UO126). Cell viability was determined after 24 hrs. (C) L929 cells transfected with Akt1, Akt2, and Akt3 siRNAs for 72 hrs were treated with zVAD.fmk or TNFα for 9 hrs. Cell viability and Akt expression levels were determined after 24 hrs. In all graphs, average±SD was plotted. Next, we used two approaches to further validate the role of Akt in necroptotic cell death. First, two additional Akt inhibitors, a highly specific, allosteric kinase inhibitor MK-2206 [25] and triciribine (TCN) [26], which blocks membrane translocation of Akt, both attenuated cell death (Fig. S2B). Secondly, simultaneous knockdown of Akt isoforms Akt1 and Akt2 using siRNAs protected cells from necroptosis induced by both zVAD.fmk and TNFα (Fig. 2C). No expression of Akt3 was seen in L929 cells (Fig. S2C) and, consistently, Akt3 siRNA had no additional effect on necroptosis. Our results confirmed that Akt plays a key role in necroptosis induced by multiple stimuli in L929 cells. To understand the activation of Akt and JNK under necroptotic conditions, we examined the changes in Akt and JNK phosphorylation at 9 hrs post zVAD.fmk and TNFα stimulation. This time point was chosen because it reflects the early stage of cell death in our system (Fig. S3A, B). Following stimulation with either zVAD.fmk or TNFα we observed a robust increase in Akt phosphorylation at a known major activation site, Thr308 (Fig. 3A). Interestingly, we did not observe concomitant phosphorylation changes in the second major activation site of Akt, Ser473. We also observed an increase in the phosphorylation of both the p46 and p54 isoforms of JNK and its major substrate c-Jun (Fig. 3A). These data indicate that both Akt and JNK are activated under necroptotic conditions. 10.1371/journal.pone.0056576.g003 Figure 3 RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis. (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr, followed by western blotting with indicated antibodies. (B,C) L929 cells were treated with zVAD.fmk (B) or bFGF/zVAD.fmk (serum free conditions, C) and samples were collected at the indicated time points for western blot. (D) Nec-1 was added to the cells stimulated with bFGF or bFGF/zVAD (serum free conditions) for 15 min or 9 hr followed by western blot with the indicated antibodies. The RIP1 kinase inhibitor, Nec-1, completely prevented the increase in Thr308 Akt phosphorylation, while Nec-1i did not (Fig. 3A, Fig. S1D). Similarly, Nec-1 prevented the induction of JNK phosphorylation in response to zVAD.fmk and substantially reduced this change after TNFα addition. We observed some changes in total protein levels of JNK and c-Jun following necroptotic stimulation. Some of these changes, e.g. zVAD.fmk-induced increase in c-Jun, were also attenuated by Nec-1. Importantly, Nec-1 did not alter the basal phosphorylation levels of either Akt or JNK (Fig. 3A). This established that Akt Thr308 and JNK phosphorylation during necroptosis is RIP1 dependent. Interestingly, we discovered that the phosphorylation of Akt Thr308, JNK and Jun are late events following zVAD.fmk stimulation (Fig. 3B) that coincide with the onset of necroptosis at 6 hr post-stimulation (Fig. S3A). To better understand the contributions of growth factors and RIP1 kinase to necroptotic regulation of Akt, we next analyzed the time course of these phosphorylation changes under serum free conditions. We found that the addition of bFGF alone or in combination with zVAD.fmk led to a substantial rapid and transient increase in both Thr308 and Ser473 phosphorylation of Akt as well as JNK and c-Jun at 15 minutes, reflecting the expected response to growth factor stimulation (Fig. 3C). Significantly, the combination of bFGF/zVAD.fmk, but not bFGF alone, also caused a robust, second, delayed increase in the phosphorylation of Thr308, but not Ser473, of Akt as well as a delayed increase in the phosphorylation of JNK and Jun. Furthermore, Nec-1 had no significant effect on the early increase in both Akt and JNK/c-Jun phosphorylation triggered by both bFGF and bFGF/zVAD, while Nec-1, but not its inactive analog Nec-1i (Fig. S1E), efficiently blocked the bFGF/zVAD increase at 6–9 hr (Fig. 3D), suggesting that only the delayed activation of Akt and JNK is specific for necroptosis and dependent on RIP1 kinase activity. Similarly, IGF/zVAD, which also promoted cell death under serum free conditions, produced a delayed increase in Thr308 phosphorylation on Akt, while IGF alone caused solely an early, transient increase in phosphorylation (Fig. S3C). We confirmed the kinetics of the Akt Thr308 and Ser473 phosphorylation changes using a quantitative ELISA assay, which also showed a robust delayed necroptosis-specific RIP1-dependent increase in Akt Thr308 phosphorylation (Fig. S3D, E). Taken together, these results indicate that the observed delayed increases in Akt and JNK phosphorylation, preceding the onset of cell death, represent specific consequences of necroptotic signaling downstream from RIP1 kinase. TNFα Induces Delayed Akt Thr308 Phosphorylation and Necroptosis Independent of Growth Factor Stimulation Consistent with TNFα inducing necroptosis independently of growth factors (Fig. 1A), FGFR inhibitors did not attenuate TNFα-induced changes in Akt or JNK phosphorylation, while efficiently preventing these changes in response to zVAD.fmk (Fig. S4A). Furthermore, addition of TNFα led to comparable late activation of Akt p308 signal under both normal and serum free conditions (Fig. S4B, C), indicating that TNFα signaling to Akt Thr308 is growth factor-independent. In contrast, activation of JNK by TNFα followed different kinetics from zVAD.fmk-induced changes. TNFα treatment caused an early and robust increase in the phosphorylation of JNK and c-Jun. Nec-1 did not affect this early increase, however, it reduced levels of pJNK/Jun at the late, 9 hr time point (Fig. S4B, C). This again separated early RIP1-independent changes, which likely reflect the ability of additional upstream kinases, such as Ask1 to activate JNK [27], from the late RIP1 kinase-dependent necroptotic signaling. Late Increase in Akt Thr308 Phosphorylation Contributes to the Induction of Necroptotic Cell Death We next investigated if the delayed RIP1 kinase-dependent increase in Akt Thr308 phosphorylation functionally contributes to the execution of necroptotic cell death. Firstly, PDGF/zVAD.fmk, which cannot induce necroptosis (Fig. 2A), triggered only the initial, rapid Akt and JNK phosphorylation changes and not the delayed activation (Fig. 4A), indicating that late, rather than early Akt phosphorylation correlates with necroptosis. Secondly, we saw that the ability of the Akt inhibitor to protect cells from necroptosis rapidly declined after 6 hrs of stimulation with zVAD.fmk, TNFα or bFGF/zVAD.fmk and no protection was observed when the inhibitor was added at 9 hrs (Fig. 4B,C). This time frame coincides with the timing of the secondary Akt Thr308 phosphorylation. Finally, we terminated the bFGF signal one hour after addition of bFGF by the addition of PD173074. This allowed us to retain early Akt activation, but to suppress the secondary increase (Fig. 4D). Both pre-addition and delayed addition of PD173074 fully prevented necroptosis (Fig. 4E). Overall, these data, while correlative, indicate that early Akt activation is insufficient to promote necroptosis and are strongly supportive of an important role for the delayed activation of Akt in the induction of necroptotic cell death. 10.1371/journal.pone.0056576.g004 Figure 4 Late Thr308 phosphorylation of Akt contributes to necroptosis. (A) L929 cells were treated with zVAD.fmk and bFGF or PDGF, with or without Nec-1, for the indicated periods of time. (B,C) L929 cells were stimulated by zVAD.fmk or TNFα (B) or bFGF/zVAD.fmk under serum free conditions (C). Akt inh. VIII was added 15 min before necroptotic stimulation (Pre) or at indicated times after stimulation. Viability was measured 24 hr after activation of necroptosis. (D) L929 cells were stimulated with bFGF/zVAD under serum free conditions. PD173074 was added 15 min before or 1 hr after FGF/zVAD. Samples for western blot were collected at 15 min and 9 hr time points. (E) Cells were pretreated with PD173074 or it was added 1 hr after bFGF/zVAD.fmk, followed by viability assessment at 24 hr. In all graphs, average±SD was plotted. The Akt Signaling Pathway Contributes to the Regulation of Necroptosis We next determined whether the necroptosis-associated increase in Thr308 phosphorylation results in an increase in Akt kinase activity. Under necroptotic conditions, we observed an increase in the phosphorylation of multiple known Akt substrates (Forkhead box class O (FoxO) proteins, GSK-3 kinases and mouse double minute 2 (MDM2)) as well as downstream molecules (p70 ribosomal protein S6 Kinase (p70S6K), S6) (Fig. 5A). In some cases (FoxO1, FoxO4, MDM2), a robust increase was observed. In other cases (FoxO3a, GSK-3α/β, p70S6K and its substrate S6), the changes were less pronounced (Fig. 5A). The timing of the phosphorylation changes paralleled the increase in Akt phosphorylation (Fig. 5B, S5A, B). In the case of pFoxO1 we occasionally observed a shift in migration rather than an increase in band intensity (e.g. comparing Fig. 5A and B), suggesting that phosphorylation events in addition to Thr24 take place during necroptosis. Notably, in all cases the necroptosis-associated increases in Akt substrates were abrogated by Nec-1 (Fig. 5A, Fig. S5A, B). Overall, these data suggested that a significant part of the “canonical” Akt signaling network is activated at the onset of necroptotic cell death in a RIP1 dependent fashion. 10.1371/journal.pone.0056576.g005 Figure 5 mTORC1 contributes to the regulation of necroptosis. (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr and harvested for western blot. (B) Cell under serum free condition were treated with bFGF or bFGF/zVAD.fmk for the indicated amounts of time, followed by western blotting using the indicated antibodies. (C) Necroptosis was induced by zVAD.fmk or TNFα in L929 cell in the presence of inhibitors of Akt(Akt inh. VIII) and mTOR (rapamycin, Torin-1 and PI-103). (D) L929 cells with mTOR siRNA knockdown were harvested for western blot or treated with zVAD.fmk or TNFα for 24 hrs. Cell viability was determined 24 hr after activation of necroptosis. In all graphs, average±SD was plotted. Akt kinase is considered to be a pro-survival protein that inhibits apoptosis through the control of multiple effectors including mTORC1, GSK-3 and others [28]. An important question is whether these same molecules reverse their pro-survival roles during necroptosis. We found that inhibition of mTORC1 by rapamycin, an inhibitor of the mTOR co-factor Raptor [29], protected cells from necroptosis (Fig. 5C). Similarly, the direct mTOR kinase inhibitor Torin1 [30] and the dual PI3K/mTOR inhibitor PI-103 [31] also efficiently inhibited necroptosis (Fig. 5C). Knockdown of mTOR using siRNA further validated the small-molecule inhibitor data indicating a role for mTOR in necroptosis by protecting cells from both zVAD.fmk and TNFα induced death (Fig. 5D). mTORC1 regulates translation through activation of p70S6 kinase and, subsequently, ribosomal protein S6 [32]. Notably, a genome-wide siRNA screen [10] suggested an important role for protein translation in necroptosis. Consistently, we found that the small molecule inhibitor of p70S6K PF-4708671 [33] attenuated necroptosis at the concentrations required to block S6 phosphorylation (Fig. S5C, D). Partial siRNA knockdown of S6 protein attenuated necroptosis as well (Fig. S5E), suggesting that translational control by p70S6K/S6 may play a role in necroptosis. Overall, while the full repertoire of Akt targets during necroptosis remains to be fully explored, our data provide evidence that the activity of an anti-apoptotic branch of Akt signaling can promote necroptosis. RIP1 kinase, Akt, mTORC1 and JNK control the upregulation of TNFα accompanying necroptosis. Hitomi et al. [10] have recently reported that the induction of necroptosis by zVAD.fmk in L929 cells is associated with increased synthesis of TNFα, which potentiates cell death. Therefore, we examined whether Akt and its effectors contribute to TNFα synthesis. Consistent with a RIP1-dependent increase in TNFα protein (Fig. S6A, B), we found that TNFα mRNA levels increased during necroptosis in L929 cells in a RIP1 (Fig. S6C. Under serum free conditions, bFGF alone triggered some induction of TNFα mRNA, while its combination with zVAD.fmk (but not zVAD.fmk alone) caused a pronounced further increase (Fig. 6A). Conversely, PDGF caused a modest upregulation of TNFα mRNA, which was not further increased in the presence of zVAD.fmk (Fig. 6A), demonstrating that activation of necroptosis is specifically accompanied by a marked increase in autocrine TNFα synthesis. 10.1371/journal.pone.0056576.g006 Figure 6 Akt and mTORC1 control autocrine TNFα synthesis and JNK activation during necroptosis. (A) Cells were treated under serum free conditions with bFGF or PDGF with or without zVAD.fmk for 9 hr, followed by qRT-PCR analysis of mTNFα. Data was normalized to mouse 18S RNA. (B) Necroptosis was induced by zVAD.fmk or TNFα in cells treated with Nec-1, rapamycin (rapa), or Akt inh. VIII inh. followed by qRT-PCR analysis of TNFα mRNA levels. (C-F) L929 cells with siRNA knockdown of Akt isoforms (C,E) or mTOR (D,F) were stimulated with zVAD.fmk or TNFα for 9 hr, followed by qRT-PCR analysis of mTNFα (C,D) or western blot (E,F). In all graphs, average±SD was plotted. Further analysis suggested that both Akt and mTORC1 contribute to the upregulation of TNFα mRNA during necroptosis as both small-molecule inhibition and siRNA knockdown of Akt and mTOR reduced TNFα mRNA levels in necroptotic cells (Fig. 6B,C,D). Notably, RIP1 and Akt inhibitors had no effect on the levels of TNFα mRNA in control cells or in the cells stimulated with bFGF alone (Fig. 6A,B, Fig. S6C), suggesting that these kinases specifically mediate necroptosis-dependent increase in TNFα synthesis. Akt and mTORC1 Control the Activation of JNK during Necroptosis JNK is a well-established regulator of TNFα synthesis in a variety of systems [13], [14], [15], [34]. Therefore, the ability of Akt and mTORC1 inhibitors to block the increase in TNFα mRNA lead us to examine their role in the activation of JNK during necroptosis. Knockdown of Akt isoforms Akt1 and Akt2 or inhibition of Akt prominently suppressed the necroptosis dependent increase in JNK and c-Jun phosphorylation (Fig. 6E, S6D,E) suggesting that Akt may provide a link between RIP1 and JNK activation. Importantly, inhibition of Akt only inhibited the delayed, but not the early, increase in bFGF/zVAD.fmk induced JNK and c-Jun phosphorylation (Fig. S6F). Knockdown of mTOR, rapamycin and the p70S6K inhibitor PF-4708671 also attenuated the necroptosis-associated increase in JNK and c-Jun phosphorylation (Fig. 6F, S6E,G, Fig. S5D). Overall, these data suggested that the Akt-mTORC1-S6K axis, acting downstream from RIP1 kinase, is required for the increase in JNK activity during necroptosis in L929 cells. PI3-kinase and PDK1 Mediate the Increase in Akt Thr308 Phosphorylation Under Necroptotic Conditions Typical regulation of Akt by growth factors involves its recruitment to the plasma membrane, which is mediated by the binding of the pleckstrin homology (PH) domain of Akt to the product of PI3K, phosphatidylinositol-3,4,5-triphosphate (PIP3). In the membrane, Akt is phosphorylated on Thr308 and Ser473 by 3-phosphoinositide dependent protein kinase-1 (PDK1) and mTORC2 (or DNA-PK), respectively [35]. Since our results showed that only Thr308 Akt phosphorylation is increased during necroptosis, we next examined whether it is still dependent on PI3K and PDK1. Inhibition of PI3K and PDK1 using the specific inhibitors LY249002 and BX912 [36] resulted in the efficient inhibition of cell death and Akt Thr308 phosphorylation (Fig. S7A–D). Likewise, siRNA knockdown of PDK1 protected cells from death and inhibited Akt Thr308 phosphorylation (Fig. S7E,F) Therefore, PI3K and PDK1 activity is still required for non-canonical Akt activation during necroptosis. Expression of Constitutively Active Akt, Rescues Necroptosis Under Serum Free Conditions We used L929 cells stably expressing constitutively active wild type Akt1 (Myr-Akt) or the catalytically inactive mutant K179M in order to further understand the contribution of growth factors and RIP1 kinase to Akt activation during necroptosis. Constitutively active Akt1 (Myr-Akt) was generated as previously described [37] by the addition of a myristoylation signal which provides constitutive localization to the plasma membrane and by the deletion of the auto-inhibitory PH domain (Fig. 7A) resulting in an Akt that is active under serum free. It is important to note that the cells expressing Myr-Akt were viable, grew in a manner indistinguishable from the empty vector control cells, and were not triggered to induce necroptosis by serum starvation (Fig. 7B). This indicates that active Akt alone is not sufficient to induce necroptotic cell death. Under serum free conditions Myr-Akt, but not the K179M mutant, fully restored zVAD.fmk-induced necroptosis (Fig. 7A,B). Nec-1 prevented both Myr-Akt dependent cell death and the necroptosis-specific delayed increase in Akt Thr308 phosphorylation (Fig. 7B,C). Myr-Akt also allowed other zVAD.fmk-dependent events, including activation of JNK and c-Jun phosphorylation (Fig. 7C) and upregulation of TNFα mRNA (Fig. 7D) to occur under serum free conditions, confirming an important role for Akt at the apex of necroptotic signaling. These data demonstrated that the presence of active and membrane localized Akt is sufficient to uncouple Akt activation during necroptosis from growth factor signaling. RIP1 kinase was still able to regulate Akt activation during necroptosis, suggesting that growth factors and RIP1 kinase provide two independent inputs required for Akt changes during necroptosis. 10.1371/journal.pone.0056576.g007 Figure 7 Over expression of constitutively active Akt restores necroptosis under serum free conditions. (A,B) L929 cells were stably infected with empty MSCV retrovirus or viruses encoding Myr-Akt or the catalytically inactive Myr-Akt K179M. Necroptosis was induced by the addition of zVAD.fmk under serum free conditions (A) or serum or serum free conditions with Nec-1 (B). Viability assays were performed after 24 hr. (C) Myr-Akt and Myr-Akt K179M cells were treated with zVAD.fmk and/or Nec-1 under serum free conditions for 9 hr, followed by western blot using the indicated antibodies. Endogenous Akt (∼) and Myr-Akt (*) bands are indicated. (D) L929 cells, stably infected with Myr-Akt and Myr-Akt K179KM, were stimulated with zVAD.fmk for 9 hr under serum free conditions. TNFα mRNA levels were determined by qRT-PCR and normalized using mouse 18S RNA. (E-G) L929 cells expressing Myr-Akt and Ala and Asp mutants of Thr308 and Ser473 were treated with zVAD.fmk under serum free conditions, followed by viability assay at 24 hr (E), western blot at 9 hr (F), or evaluation of TNFα mRNA levels by qRT-PCR at 9 hrs (G). In all graphs, average±SD was plotted. RIP1 kinase-dependent Thr308 phosphorylation of Myr-Akt during necroptosis"
R10237	T15718	T15750	themeOf	MDM2,phosphorylation of FoxO1 and MDM2
R10238	T15725	T15765	themeOf	Akt,Akt activation
R10239	T15750	T15754	themeOf	phosphorylation of FoxO1 and MDM2,"phosphorylation of FoxO1 and MDM2 was significantly increased in the presence of zVAD.fmk,"
R10240	T15751	T15755	themeOf	phosphorylation of FoxO1 and MDM2,"phosphorylation of FoxO1 and MDM2 was significantly increased in the presence of zVAD.fmk,"
R10241	T15756	T15753	themeOf	"RIP1 kinase-dependent Thr308 phosphorylation during necroptosis in multiple cell types. Furthermore, we found that downstream Akt signaling through mTORC1 and S6 contributes to the activation of necroptosis and TNFα production. We found that the Akt pathway serves as a critical link between RIP1 kinase and JNK activation in L929 cells. Further data suggested that in multiple other cell types including FADD deficient Jurkat cells, RAW and J774.1 macrophage cell lines, and mouse lung fibroblasts Akt provides a key link to TNFα production, but is dispensible for cell death per se. Overall, our results reveal a specific and novel role for the Akt pathway in regulated necrosis and necrosis-associated inflammatory signaling. Results Basic Fibroblast Growth Factor Promotes Necroptosis in L929 Cells It has been established that mouse fibrosarcoma L929 cells undergo necroptotic cell death following stimulation with TNFα [10], [17]. In addition, inhibition of caspase-8 activity alone, either through siRNA knockdown or by using the pan-caspase inhibitor, zVAD.fmk, is sufficient to trigger necroptosis in these cells [10], [14]. Interestingly, while necroptosis was initially identified as a back-up form of cell death triggered by pro-apoptotic stimuli in the presence of apoptosis inhibitors [17], recent analysis of physiological cell death during mouse development has suggested that the loss of apoptotic regulators, such as caspase-8 and FADD [18], [19], [20], leads to robust induction of necroptosis and death of E10.5 embryos even though apoptosis is not normally induced in wild type embryos. These data are reminiscent of the observations in L929 cells where the loss of caspase activity in healthy cells is sufficient to trigger necroptosis and prompted us to explore the extrinsic or intrinsic cellular factors that promote necroptosis once caspase-8 activity, which cleaves and inactivates RIP1 kinase and the RIP1 deubiquitinase CYLD [21], [22], is removed in L929 cells. Consistent with a previous report [16], we found that serum starvation of L929 cells prevented necroptosis in response to zVAD.fmk (Fig. 1A). The addition of growth factors, such as bFGF, restored zVAD.fmk induced death under serum free conditions (Fig. 1B). Interestingly, this does not reflect a generic requirement for growth factor signaling, as only some growth factors (bFGF and IGF-1, but not EGF and PDGF) promoted death (Fig. 1B). Furthermore, growth factor-dependent necroptosis required the inhibition of caspase activity, as bFGF alone did not induce cell death (Fig. 1C). In contrast, TNFα triggered necroptosis equally efficiently in the absence of serum (Fig. 1A), suggesting that either growth factors and zVAD.fmk or TNFα are required for necroptotic death in L929 cells. 10.1371/journal.pone.0056576.g001 Figure 1 bFGF and IGF-1 promote necroptosis in concert with zVAD.fmk. (A) L929 cells were treated with TNFα or zVAD.fmk under normal serum (10% FBS) or serum free conditions. Cell viability was determined after 24 hr using the CellTiter-Glo Viability assay. The concentrations of all necroptosis-inducing agents are listed in the Materials and Methods section or indicated in the figures. (B) Cells were treated with zVAD.fmk, the indicated growth factors, and Nec-1 under serum free conditions for 24 hrs followed by measurement of cell viability. (C) Cells under serum free conditions were treated with FGF, zVAD.fmk, or both for 24 hrs followed by viability assay. (D) Cell death was induced by zVAD.fmk or TNFα under full serum condition in the presence of 2 µM PD173074 and 20 µM PD166866. In all graphs, average±SD was plotted. Previously we described the development of 7-Cl-O-Nec-1 (Nec-1) as a potent and selective inhibitor of RIP1 kinase and necroptosis (Fig. S1A) [23], [24]. Recently, its selectivity has been further validated against a panel of more than 400 human kinases [15]. This inhibitor efficiently blocked growth factor/zVAD.fmk-induced necroptosis under serum free conditions in L929 cells and both zVAD.fmk and TNFα-induced necroptosis under full serum conditions (Fig. 1B, S1B). To further validate the role of RIP1, we used an inactive analog, 7-Cl-O-Nec-1i (Nec-1i) (Fig. S1A), which contains an extra N-methyl group that leads to almost complete loss of RIP1 kinase inhibitory activity in vitro [23]. Nec-1i was unable to protect L929 cell death under serum condtions treated with zVAD.fmk or TNFα (Fig. S1B) or serum free conditions treated with bFGF/zVAD.fmk (Fig. S1C). This confirms that RIP1 kinase is responsible for necroptosis in L929 cells under both serum and serum free conditions. We next examined whether bFGF contributes to zVAD.fmk-induced necroptosis under normal serum conditions (10% FBS). We used two bFGF receptor tyrosine kinase inhibitors (PD173074 and PD166866), and determined that inhibition of bFGF signaling strongly inhibited zVAD.fmk-induced necroptosis under normal serum conditions (Fig. 1D). In contrast, neither bFGF receptor inhibitor was able to attenuate TNFα-induced necroptosis (Fig. 1D), consistent with growth factors being dispensable for this pathway (Fig. 1A). Overall, these data suggest that the induction of necroptosis by zVAD.fmk is promoted by bFGF under both serum and serum free conditions. The induction of necroptosis, however, is not a simple consequence of growth factor signaling since not all growth factors allowed death to occur. Instead, specific signaling events mediated by particular growth factors appear to contribute to necroptotic death. RIP1 Kinase-dependent Activation of Akt Contributes to Necroptosis Given our observation that growth factors are important for zVAD.fmk induced death, we examined the contribution of several pathways, including MAPK pathways and Akt, which are known to be activated following growth factor receptor activation (Fig. 2A). Inhibition of Akt (Akt inhibitor VIII) strongly protected the cells from growth factor-sensitive necroptosis induced by zVAD.fmk [16] as well as cell death triggered by bFGF or IGF-1/zVAD.fmk under serum free conditions (Fig. 2B). Inhibition of Akt also protected the cells from growth-factor insensitive death by caused by TNFα (Fig. 2A). Consistent with previous reports, the JNK inhibitor SP600125 protected the cells from both zVAD.fmk and TNFα induced death (Fig. 2A,B and Fig. S2A) [12], [14]. In contrast, inhibition of two other MAPKs, p38 and ERK, previously reported not to be activated during necroptosis [14], did not protect from either zVAD.fmk or TNFα induced death (Fig. 2A). 10.1371/journal.pone.0056576.g002 Figure 2 Akt contributes to necroptosis induced by zVAD.fmk and TNFα. (A,B) Necroptosis was induced by zVAD.fmk or TNFα (full serum, A) or growth factors/zVAD.fmk (serum free, B) in the presence of inhibitors of Akt (Akt inhibitor VIII), JNK (SP600125), p38 (PD169316), and Erk (UO126). Cell viability was determined after 24 hrs. (C) L929 cells transfected with Akt1, Akt2, and Akt3 siRNAs for 72 hrs were treated with zVAD.fmk or TNFα for 9 hrs. Cell viability and Akt expression levels were determined after 24 hrs. In all graphs, average±SD was plotted. Next, we used two approaches to further validate the role of Akt in necroptotic cell death. First, two additional Akt inhibitors, a highly specific, allosteric kinase inhibitor MK-2206 [25] and triciribine (TCN) [26], which blocks membrane translocation of Akt, both attenuated cell death (Fig. S2B). Secondly, simultaneous knockdown of Akt isoforms Akt1 and Akt2 using siRNAs protected cells from necroptosis induced by both zVAD.fmk and TNFα (Fig. 2C). No expression of Akt3 was seen in L929 cells (Fig. S2C) and, consistently, Akt3 siRNA had no additional effect on necroptosis. Our results confirmed that Akt plays a key role in necroptosis induced by multiple stimuli in L929 cells. To understand the activation of Akt and JNK under necroptotic conditions, we examined the changes in Akt and JNK phosphorylation at 9 hrs post zVAD.fmk and TNFα stimulation. This time point was chosen because it reflects the early stage of cell death in our system (Fig. S3A, B). Following stimulation with either zVAD.fmk or TNFα we observed a robust increase in Akt phosphorylation at a known major activation site, Thr308 (Fig. 3A). Interestingly, we did not observe concomitant phosphorylation changes in the second major activation site of Akt, Ser473. We also observed an increase in the phosphorylation of both the p46 and p54 isoforms of JNK and its major substrate c-Jun (Fig. 3A). These data indicate that both Akt and JNK are activated under necroptotic conditions. 10.1371/journal.pone.0056576.g003 Figure 3 RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis. (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr, followed by western blotting with indicated antibodies. (B,C) L929 cells were treated with zVAD.fmk (B) or bFGF/zVAD.fmk (serum free conditions, C) and samples were collected at the indicated time points for western blot. (D) Nec-1 was added to the cells stimulated with bFGF or bFGF/zVAD (serum free conditions) for 15 min or 9 hr followed by western blot with the indicated antibodies. The RIP1 kinase inhibitor, Nec-1, completely prevented the increase in Thr308 Akt phosphorylation, while Nec-1i did not (Fig. 3A, Fig. S1D). Similarly, Nec-1 prevented the induction of JNK phosphorylation in response to zVAD.fmk and substantially reduced this change after TNFα addition. We observed some changes in total protein levels of JNK and c-Jun following necroptotic stimulation. Some of these changes, e.g. zVAD.fmk-induced increase in c-Jun, were also attenuated by Nec-1. Importantly, Nec-1 did not alter the basal phosphorylation levels of either Akt or JNK (Fig. 3A). This established that Akt Thr308 and JNK phosphorylation during necroptosis is RIP1 dependent. Interestingly, we discovered that the phosphorylation of Akt Thr308, JNK and Jun are late events following zVAD.fmk stimulation (Fig. 3B) that coincide with the onset of necroptosis at 6 hr post-stimulation (Fig. S3A). To better understand the contributions of growth factors and RIP1 kinase to necroptotic regulation of Akt, we next analyzed the time course of these phosphorylation changes under serum free conditions. We found that the addition of bFGF alone or in combination with zVAD.fmk led to a substantial rapid and transient increase in both Thr308 and Ser473 phosphorylation of Akt as well as JNK and c-Jun at 15 minutes, reflecting the expected response to growth factor stimulation (Fig. 3C). Significantly, the combination of bFGF/zVAD.fmk, but not bFGF alone, also caused a robust, second, delayed increase in the phosphorylation of Thr308, but not Ser473, of Akt as well as a delayed increase in the phosphorylation of JNK and Jun. Furthermore, Nec-1 had no significant effect on the early increase in both Akt and JNK/c-Jun phosphorylation triggered by both bFGF and bFGF/zVAD, while Nec-1, but not its inactive analog Nec-1i (Fig. S1E), efficiently blocked the bFGF/zVAD increase at 6–9 hr (Fig. 3D), suggesting that only the delayed activation of Akt and JNK is specific for necroptosis and dependent on RIP1 kinase activity. Similarly, IGF/zVAD, which also promoted cell death under serum free conditions, produced a delayed increase in Thr308 phosphorylation on Akt, while IGF alone caused solely an early, transient increase in phosphorylation (Fig. S3C). We confirmed the kinetics of the Akt Thr308 and Ser473 phosphorylation changes using a quantitative ELISA assay, which also showed a robust delayed necroptosis-specific RIP1-dependent increase in Akt Thr308 phosphorylation (Fig. S3D, E). Taken together, these results indicate that the observed delayed increases in Akt and JNK phosphorylation, preceding the onset of cell death, represent specific consequences of necroptotic signaling downstream from RIP1 kinase. TNFα Induces Delayed Akt Thr308 Phosphorylation and Necroptosis Independent of Growth Factor Stimulation Consistent with TNFα inducing necroptosis independently of growth factors (Fig. 1A), FGFR inhibitors did not attenuate TNFα-induced changes in Akt or JNK phosphorylation, while efficiently preventing these changes in response to zVAD.fmk (Fig. S4A). Furthermore, addition of TNFα led to comparable late activation of Akt p308 signal under both normal and serum free conditions (Fig. S4B, C), indicating that TNFα signaling to Akt Thr308 is growth factor-independent. In contrast, activation of JNK by TNFα followed different kinetics from zVAD.fmk-induced changes. TNFα treatment caused an early and robust increase in the phosphorylation of JNK and c-Jun. Nec-1 did not affect this early increase, however, it reduced levels of pJNK/Jun at the late, 9 hr time point (Fig. S4B, C). This again separated early RIP1-independent changes, which likely reflect the ability of additional upstream kinases, such as Ask1 to activate JNK [27], from the late RIP1 kinase-dependent necroptotic signaling. Late Increase in Akt Thr308 Phosphorylation Contributes to the Induction of Necroptotic Cell Death We next investigated if the delayed RIP1 kinase-dependent increase in Akt Thr308 phosphorylation functionally contributes to the execution of necroptotic cell death. Firstly, PDGF/zVAD.fmk, which cannot induce necroptosis (Fig. 2A), triggered only the initial, rapid Akt and JNK phosphorylation changes and not the delayed activation (Fig. 4A), indicating that late, rather than early Akt phosphorylation correlates with necroptosis. Secondly, we saw that the ability of the Akt inhibitor to protect cells from necroptosis rapidly declined after 6 hrs of stimulation with zVAD.fmk, TNFα or bFGF/zVAD.fmk and no protection was observed when the inhibitor was added at 9 hrs (Fig. 4B,C). This time frame coincides with the timing of the secondary Akt Thr308 phosphorylation. Finally, we terminated the bFGF signal one hour after addition of bFGF by the addition of PD173074. This allowed us to retain early Akt activation, but to suppress the secondary increase (Fig. 4D). Both pre-addition and delayed addition of PD173074 fully prevented necroptosis (Fig. 4E). Overall, these data, while correlative, indicate that early Akt activation is insufficient to promote necroptosis and are strongly supportive of an important role for the delayed activation of Akt in the induction of necroptotic cell death. 10.1371/journal.pone.0056576.g004 Figure 4 Late Thr308 phosphorylation of Akt contributes to necroptosis. (A) L929 cells were treated with zVAD.fmk and bFGF or PDGF, with or without Nec-1, for the indicated periods of time. (B,C) L929 cells were stimulated by zVAD.fmk or TNFα (B) or bFGF/zVAD.fmk under serum free conditions (C). Akt inh. VIII was added 15 min before necroptotic stimulation (Pre) or at indicated times after stimulation. Viability was measured 24 hr after activation of necroptosis. (D) L929 cells were stimulated with bFGF/zVAD under serum free conditions. PD173074 was added 15 min before or 1 hr after FGF/zVAD. Samples for western blot were collected at 15 min and 9 hr time points. (E) Cells were pretreated with PD173074 or it was added 1 hr after bFGF/zVAD.fmk, followed by viability assessment at 24 hr. In all graphs, average±SD was plotted. The Akt Signaling Pathway Contributes to the Regulation of Necroptosis We next determined whether the necroptosis-associated increase in Thr308 phosphorylation results in an increase in Akt kinase activity. Under necroptotic conditions, we observed an increase in the phosphorylation of multiple known Akt substrates (Forkhead box class O (FoxO) proteins, GSK-3 kinases and mouse double minute 2 (MDM2)) as well as downstream molecules (p70 ribosomal protein S6 Kinase (p70S6K), S6) (Fig. 5A). In some cases (FoxO1, FoxO4, MDM2), a robust increase was observed. In other cases (FoxO3a, GSK-3α/β, p70S6K and its substrate S6), the changes were less pronounced (Fig. 5A). The timing of the phosphorylation changes paralleled the increase in Akt phosphorylation (Fig. 5B, S5A, B). In the case of pFoxO1 we occasionally observed a shift in migration rather than an increase in band intensity (e.g. comparing Fig. 5A and B), suggesting that phosphorylation events in addition to Thr24 take place during necroptosis. Notably, in all cases the necroptosis-associated increases in Akt substrates were abrogated by Nec-1 (Fig. 5A, Fig. S5A, B). Overall, these data suggested that a significant part of the “canonical” Akt signaling network is activated at the onset of necroptotic cell death in a RIP1 dependent fashion. 10.1371/journal.pone.0056576.g005 Figure 5 mTORC1 contributes to the regulation of necroptosis. (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr and harvested for western blot. (B) Cell under serum free condition were treated with bFGF or bFGF/zVAD.fmk for the indicated amounts of time, followed by western blotting using the indicated antibodies. (C) Necroptosis was induced by zVAD.fmk or TNFα in L929 cell in the presence of inhibitors of Akt(Akt inh. VIII) and mTOR (rapamycin, Torin-1 and PI-103). (D) L929 cells with mTOR siRNA knockdown were harvested for western blot or treated with zVAD.fmk or TNFα for 24 hrs. Cell viability was determined 24 hr after activation of necroptosis. In all graphs, average±SD was plotted. Akt kinase is considered to be a pro-survival protein that inhibits apoptosis through the control of multiple effectors including mTORC1, GSK-3 and others [28]. An important question is whether these same molecules reverse their pro-survival roles during necroptosis. We found that inhibition of mTORC1 by rapamycin, an inhibitor of the mTOR co-factor Raptor [29], protected cells from necroptosis (Fig. 5C). Similarly, the direct mTOR kinase inhibitor Torin1 [30] and the dual PI3K/mTOR inhibitor PI-103 [31] also efficiently inhibited necroptosis (Fig. 5C). Knockdown of mTOR using siRNA further validated the small-molecule inhibitor data indicating a role for mTOR in necroptosis by protecting cells from both zVAD.fmk and TNFα induced death (Fig. 5D). mTORC1 regulates translation through activation of p70S6 kinase and, subsequently, ribosomal protein S6 [32]. Notably, a genome-wide siRNA screen [10] suggested an important role for protein translation in necroptosis. Consistently, we found that the small molecule inhibitor of p70S6K PF-4708671 [33] attenuated necroptosis at the concentrations required to block S6 phosphorylation (Fig. S5C, D). Partial siRNA knockdown of S6 protein attenuated necroptosis as well (Fig. S5E), suggesting that translational control by p70S6K/S6 may play a role in necroptosis. Overall, while the full repertoire of Akt targets during necroptosis remains to be fully explored, our data provide evidence that the activity of an anti-apoptotic branch of Akt signaling can promote necroptosis. RIP1 kinase, Akt, mTORC1 and JNK control the upregulation of TNFα accompanying necroptosis. Hitomi et al. [10] have recently reported that the induction of necroptosis by zVAD.fmk in L929 cells is associated with increased synthesis of TNFα, which potentiates cell death. Therefore, we examined whether Akt and its effectors contribute to TNFα synthesis. Consistent with a RIP1-dependent increase in TNFα protein (Fig. S6A, B), we found that TNFα mRNA levels increased during necroptosis in L929 cells in a RIP1 (Fig. S6C. Under serum free conditions, bFGF alone triggered some induction of TNFα mRNA, while its combination with zVAD.fmk (but not zVAD.fmk alone) caused a pronounced further increase (Fig. 6A). Conversely, PDGF caused a modest upregulation of TNFα mRNA, which was not further increased in the presence of zVAD.fmk (Fig. 6A), demonstrating that activation of necroptosis is specifically accompanied by a marked increase in autocrine TNFα synthesis. 10.1371/journal.pone.0056576.g006 Figure 6 Akt and mTORC1 control autocrine TNFα synthesis and JNK activation during necroptosis. (A) Cells were treated under serum free conditions with bFGF or PDGF with or without zVAD.fmk for 9 hr, followed by qRT-PCR analysis of mTNFα. Data was normalized to mouse 18S RNA. (B) Necroptosis was induced by zVAD.fmk or TNFα in cells treated with Nec-1, rapamycin (rapa), or Akt inh. VIII inh. followed by qRT-PCR analysis of TNFα mRNA levels. (C-F) L929 cells with siRNA knockdown of Akt isoforms (C,E) or mTOR (D,F) were stimulated with zVAD.fmk or TNFα for 9 hr, followed by qRT-PCR analysis of mTNFα (C,D) or western blot (E,F). In all graphs, average±SD was plotted. Further analysis suggested that both Akt and mTORC1 contribute to the upregulation of TNFα mRNA during necroptosis as both small-molecule inhibition and siRNA knockdown of Akt and mTOR reduced TNFα mRNA levels in necroptotic cells (Fig. 6B,C,D). Notably, RIP1 and Akt inhibitors had no effect on the levels of TNFα mRNA in control cells or in the cells stimulated with bFGF alone (Fig. 6A,B, Fig. S6C), suggesting that these kinases specifically mediate necroptosis-dependent increase in TNFα synthesis. Akt and mTORC1 Control the Activation of JNK during Necroptosis JNK is a well-established regulator of TNFα synthesis in a variety of systems [13], [14], [15], [34]. Therefore, the ability of Akt and mTORC1 inhibitors to block the increase in TNFα mRNA lead us to examine their role in the activation of JNK during necroptosis. Knockdown of Akt isoforms Akt1 and Akt2 or inhibition of Akt prominently suppressed the necroptosis dependent increase in JNK and c-Jun phosphorylation (Fig. 6E, S6D,E) suggesting that Akt may provide a link between RIP1 and JNK activation. Importantly, inhibition of Akt only inhibited the delayed, but not the early, increase in bFGF/zVAD.fmk induced JNK and c-Jun phosphorylation (Fig. S6F). Knockdown of mTOR, rapamycin and the p70S6K inhibitor PF-4708671 also attenuated the necroptosis-associated increase in JNK and c-Jun phosphorylation (Fig. 6F, S6E,G, Fig. S5D). Overall, these data suggested that the Akt-mTORC1-S6K axis, acting downstream from RIP1 kinase, is required for the increase in JNK activity during necroptosis in L929 cells. PI3-kinase and PDK1 Mediate the Increase in Akt Thr308 Phosphorylation Under Necroptotic Conditions Typical regulation of Akt by growth factors involves its recruitment to the plasma membrane, which is mediated by the binding of the pleckstrin homology (PH) domain of Akt to the product of PI3K, phosphatidylinositol-3,4,5-triphosphate (PIP3). In the membrane, Akt is phosphorylated on Thr308 and Ser473 by 3-phosphoinositide dependent protein kinase-1 (PDK1) and mTORC2 (or DNA-PK), respectively [35]. Since our results showed that only Thr308 Akt phosphorylation is increased during necroptosis, we next examined whether it is still dependent on PI3K and PDK1. Inhibition of PI3K and PDK1 using the specific inhibitors LY249002 and BX912 [36] resulted in the efficient inhibition of cell death and Akt Thr308 phosphorylation (Fig. S7A–D). Likewise, siRNA knockdown of PDK1 protected cells from death and inhibited Akt Thr308 phosphorylation (Fig. S7E,F) Therefore, PI3K and PDK1 activity is still required for non-canonical Akt activation during necroptosis. Expression of Constitutively Active Akt, Rescues Necroptosis Under Serum Free Conditions We used L929 cells stably expressing constitutively active wild type Akt1 (Myr-Akt) or the catalytically inactive mutant K179M in order to further understand the contribution of growth factors and RIP1 kinase to Akt activation during necroptosis. Constitutively active Akt1 (Myr-Akt) was generated as previously described [37] by the addition of a myristoylation signal which provides constitutive localization to the plasma membrane and by the deletion of the auto-inhibitory PH domain (Fig. 7A) resulting in an Akt that is active under serum free. It is important to note that the cells expressing Myr-Akt were viable, grew in a manner indistinguishable from the empty vector control cells, and were not triggered to induce necroptosis by serum starvation (Fig. 7B). This indicates that active Akt alone is not sufficient to induce necroptotic cell death. Under serum free conditions Myr-Akt, but not the K179M mutant, fully restored zVAD.fmk-induced necroptosis (Fig. 7A,B). Nec-1 prevented both Myr-Akt dependent cell death and the necroptosis-specific delayed increase in Akt Thr308 phosphorylation (Fig. 7B,C). Myr-Akt also allowed other zVAD.fmk-dependent events, including activation of JNK and c-Jun phosphorylation (Fig. 7C) and upregulation of TNFα mRNA (Fig. 7D) to occur under serum free conditions, confirming an important role for Akt at the apex of necroptotic signaling. These data demonstrated that the presence of active and membrane localized Akt is sufficient to uncouple Akt activation during necroptosis from growth factor signaling. RIP1 kinase was still able to regulate Akt activation during necroptosis, suggesting that growth factors and RIP1 kinase provide two independent inputs required for Akt changes during necroptosis. 10.1371/journal.pone.0056576.g007 Figure 7 Over expression of constitutively active Akt restores necroptosis under serum free conditions. (A,B) L929 cells were stably infected with empty MSCV retrovirus or viruses encoding Myr-Akt or the catalytically inactive Myr-Akt K179M. Necroptosis was induced by the addition of zVAD.fmk under serum free conditions (A) or serum or serum free conditions with Nec-1 (B). Viability assays were performed after 24 hr. (C) Myr-Akt and Myr-Akt K179M cells were treated with zVAD.fmk and/or Nec-1 under serum free conditions for 9 hr, followed by western blot using the indicated antibodies. Endogenous Akt (∼) and Myr-Akt () bands are indicated. (D) L929 cells, stably infected with Myr-Akt and Myr-Akt K179KM, were stimulated with zVAD.fmk for 9 hr under serum free conditions. TNFα mRNA levels were determined by qRT-PCR and normalized using mouse 18S RNA. (E-G) L929 cells expressing Myr-Akt and Ala and Asp mutants of Thr308 and Ser473 were treated with zVAD.fmk under serum free conditions, followed by viability assay at 24 hr (E), western blot at 9 hr (F), or evaluation of TNFα mRNA levels by qRT-PCR at 9 hrs (G). In all graphs, average±SD was plotted. RIP1 kinase-dependent Thr308 phosphorylation of Myr-Akt during necroptosis","RIP1 kinase-dependent Thr308 phosphorylation during necroptosis in multiple cell types. Furthermore, we found that downstream Akt signaling through mTORC1 and S6 contributes to the activation of necroptosis and TNFα production. We found that the Akt pathway serves as a critical link between RIP1 kinase and JNK activation in L929 cells. Further data suggested that in multiple other cell types including FADD deficient Jurkat cells, RAW and J774.1 macrophage cell lines, and mouse lung fibroblasts Akt provides a key link to TNFα production, but is dispensible for cell death per se. Overall, our results reveal a specific and novel role for the Akt pathway in regulated necrosis and necrosis-associated inflammatory signaling. Results Basic Fibroblast Growth Factor Promotes Necroptosis in L929 Cells It has been established that mouse fibrosarcoma L929 cells undergo necroptotic cell death following stimulation with TNFα [10], [17]. In addition, inhibition of caspase-8 activity alone, either through siRNA knockdown or by using the pan-caspase inhibitor, zVAD.fmk, is sufficient to trigger necroptosis in these cells [10], [14]. Interestingly, while necroptosis was initially identified as a back-up form of cell death triggered by pro-apoptotic stimuli in the presence of apoptosis inhibitors [17], recent analysis of physiological cell death during mouse development has suggested that the loss of apoptotic regulators, such as caspase-8 and FADD [18], [19], [20], leads to robust induction of necroptosis and death of E10.5 embryos even though apoptosis is not normally induced in wild type embryos. These data are reminiscent of the observations in L929 cells where the loss of caspase activity in healthy cells is sufficient to trigger necroptosis and prompted us to explore the extrinsic or intrinsic cellular factors that promote necroptosis once caspase-8 activity, which cleaves and inactivates RIP1 kinase and the RIP1 deubiquitinase CYLD [21], [22], is removed in L929 cells. Consistent with a previous report [16], we found that serum starvation of L929 cells prevented necroptosis in response to zVAD.fmk (Fig. 1A). The addition of growth factors, such as bFGF, restored zVAD.fmk induced death under serum free conditions (Fig. 1B). Interestingly, this does not reflect a generic requirement for growth factor signaling, as only some growth factors (bFGF and IGF-1, but not EGF and PDGF) promoted death (Fig. 1B). Furthermore, growth factor-dependent necroptosis required the inhibition of caspase activity, as bFGF alone did not induce cell death (Fig. 1C). In contrast, TNFα triggered necroptosis equally efficiently in the absence of serum (Fig. 1A), suggesting that either growth factors and zVAD.fmk or TNFα are required for necroptotic death in L929 cells. 10.1371/journal.pone.0056576.g001 Figure 1 bFGF and IGF-1 promote necroptosis in concert with zVAD.fmk. (A) L929 cells were treated with TNFα or zVAD.fmk under normal serum (10% FBS) or serum free conditions. Cell viability was determined after 24 hr using the CellTiter-Glo Viability assay. The concentrations of all necroptosis-inducing agents are listed in the Materials and Methods section or indicated in the figures. (B) Cells were treated with zVAD.fmk, the indicated growth factors, and Nec-1 under serum free conditions for 24 hrs followed by measurement of cell viability. (C) Cells under serum free conditions were treated with FGF, zVAD.fmk, or both for 24 hrs followed by viability assay. (D) Cell death was induced by zVAD.fmk or TNFα under full serum condition in the presence of 2 µM PD173074 and 20 µM PD166866. In all graphs, average±SD was plotted. Previously we described the development of 7-Cl-O-Nec-1 (Nec-1) as a potent and selective inhibitor of RIP1 kinase and necroptosis (Fig. S1A) [23], [24]. Recently, its selectivity has been further validated against a panel of more than 400 human kinases [15]. This inhibitor efficiently blocked growth factor/zVAD.fmk-induced necroptosis under serum free conditions in L929 cells and both zVAD.fmk and TNFα-induced necroptosis under full serum conditions (Fig. 1B, S1B). To further validate the role of RIP1, we used an inactive analog, 7-Cl-O-Nec-1i (Nec-1i) (Fig. S1A), which contains an extra N-methyl group that leads to almost complete loss of RIP1 kinase inhibitory activity in vitro [23]. Nec-1i was unable to protect L929 cell death under serum condtions treated with zVAD.fmk or TNFα (Fig. S1B) or serum free conditions treated with bFGF/zVAD.fmk (Fig. S1C). This confirms that RIP1 kinase is responsible for necroptosis in L929 cells under both serum and serum free conditions. We next examined whether bFGF contributes to zVAD.fmk-induced necroptosis under normal serum conditions (10% FBS). We used two bFGF receptor tyrosine kinase inhibitors (PD173074 and PD166866), and determined that inhibition of bFGF signaling strongly inhibited zVAD.fmk-induced necroptosis under normal serum conditions (Fig. 1D). In contrast, neither bFGF receptor inhibitor was able to attenuate TNFα-induced necroptosis (Fig. 1D), consistent with growth factors being dispensable for this pathway (Fig. 1A). Overall, these data suggest that the induction of necroptosis by zVAD.fmk is promoted by bFGF under both serum and serum free conditions. The induction of necroptosis, however, is not a simple consequence of growth factor signaling since not all growth factors allowed death to occur. Instead, specific signaling events mediated by particular growth factors appear to contribute to necroptotic death. RIP1 Kinase-dependent Activation of Akt Contributes to Necroptosis Given our observation that growth factors are important for zVAD.fmk induced death, we examined the contribution of several pathways, including MAPK pathways and Akt, which are known to be activated following growth factor receptor activation (Fig. 2A). Inhibition of Akt (Akt inhibitor VIII) strongly protected the cells from growth factor-sensitive necroptosis induced by zVAD.fmk [16] as well as cell death triggered by bFGF or IGF-1/zVAD.fmk under serum free conditions (Fig. 2B). Inhibition of Akt also protected the cells from growth-factor insensitive death by caused by TNFα (Fig. 2A). Consistent with previous reports, the JNK inhibitor SP600125 protected the cells from both zVAD.fmk and TNFα induced death (Fig. 2A,B and Fig. S2A) [12], [14]. In contrast, inhibition of two other MAPKs, p38 and ERK, previously reported not to be activated during necroptosis [14], did not protect from either zVAD.fmk or TNFα induced death (Fig. 2A). 10.1371/journal.pone.0056576.g002 Figure 2 Akt contributes to necroptosis induced by zVAD.fmk and TNFα. (A,B) Necroptosis was induced by zVAD.fmk or TNFα (full serum, A) or growth factors/zVAD.fmk (serum free, B) in the presence of inhibitors of Akt (Akt inhibitor VIII), JNK (SP600125), p38 (PD169316), and Erk (UO126). Cell viability was determined after 24 hrs. (C) L929 cells transfected with Akt1, Akt2, and Akt3 siRNAs for 72 hrs were treated with zVAD.fmk or TNFα for 9 hrs. Cell viability and Akt expression levels were determined after 24 hrs. In all graphs, average±SD was plotted. Next, we used two approaches to further validate the role of Akt in necroptotic cell death. First, two additional Akt inhibitors, a highly specific, allosteric kinase inhibitor MK-2206 [25] and triciribine (TCN) [26], which blocks membrane translocation of Akt, both attenuated cell death (Fig. S2B). Secondly, simultaneous knockdown of Akt isoforms Akt1 and Akt2 using siRNAs protected cells from necroptosis induced by both zVAD.fmk and TNFα (Fig. 2C). No expression of Akt3 was seen in L929 cells (Fig. S2C) and, consistently, Akt3 siRNA had no additional effect on necroptosis. Our results confirmed that Akt plays a key role in necroptosis induced by multiple stimuli in L929 cells. To understand the activation of Akt and JNK under necroptotic conditions, we examined the changes in Akt and JNK phosphorylation at 9 hrs post zVAD.fmk and TNFα stimulation. This time point was chosen because it reflects the early stage of cell death in our system (Fig. S3A, B). Following stimulation with either zVAD.fmk or TNFα we observed a robust increase in Akt phosphorylation at a known major activation site, Thr308 (Fig. 3A). Interestingly, we did not observe concomitant phosphorylation changes in the second major activation site of Akt, Ser473. We also observed an increase in the phosphorylation of both the p46 and p54 isoforms of JNK and its major substrate c-Jun (Fig. 3A). These data indicate that both Akt and JNK are activated under necroptotic conditions. 10.1371/journal.pone.0056576.g003 Figure 3 RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis. (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr, followed by western blotting with indicated antibodies. (B,C) L929 cells were treated with zVAD.fmk (B) or bFGF/zVAD.fmk (serum free conditions, C) and samples were collected at the indicated time points for western blot. (D) Nec-1 was added to the cells stimulated with bFGF or bFGF/zVAD (serum free conditions) for 15 min or 9 hr followed by western blot with the indicated antibodies. The RIP1 kinase inhibitor, Nec-1, completely prevented the increase in Thr308 Akt phosphorylation, while Nec-1i did not (Fig. 3A, Fig. S1D). Similarly, Nec-1 prevented the induction of JNK phosphorylation in response to zVAD.fmk and substantially reduced this change after TNFα addition. We observed some changes in total protein levels of JNK and c-Jun following necroptotic stimulation. Some of these changes, e.g. zVAD.fmk-induced increase in c-Jun, were also attenuated by Nec-1. Importantly, Nec-1 did not alter the basal phosphorylation levels of either Akt or JNK (Fig. 3A). This established that Akt Thr308 and JNK phosphorylation during necroptosis is RIP1 dependent. Interestingly, we discovered that the phosphorylation of Akt Thr308, JNK and Jun are late events following zVAD.fmk stimulation (Fig. 3B) that coincide with the onset of necroptosis at 6 hr post-stimulation (Fig. S3A). To better understand the contributions of growth factors and RIP1 kinase to necroptotic regulation of Akt, we next analyzed the time course of these phosphorylation changes under serum free conditions. We found that the addition of bFGF alone or in combination with zVAD.fmk led to a substantial rapid and transient increase in both Thr308 and Ser473 phosphorylation of Akt as well as JNK and c-Jun at 15 minutes, reflecting the expected response to growth factor stimulation (Fig. 3C). Significantly, the combination of bFGF/zVAD.fmk, but not bFGF alone, also caused a robust, second, delayed increase in the phosphorylation of Thr308, but not Ser473, of Akt as well as a delayed increase in the phosphorylation of JNK and Jun. Furthermore, Nec-1 had no significant effect on the early increase in both Akt and JNK/c-Jun phosphorylation triggered by both bFGF and bFGF/zVAD, while Nec-1, but not its inactive analog Nec-1i (Fig. S1E), efficiently blocked the bFGF/zVAD increase at 6–9 hr (Fig. 3D), suggesting that only the delayed activation of Akt and JNK is specific for necroptosis and dependent on RIP1 kinase activity. Similarly, IGF/zVAD, which also promoted cell death under serum free conditions, produced a delayed increase in Thr308 phosphorylation on Akt, while IGF alone caused solely an early, transient increase in phosphorylation (Fig. S3C). We confirmed the kinetics of the Akt Thr308 and Ser473 phosphorylation changes using a quantitative ELISA assay, which also showed a robust delayed necroptosis-specific RIP1-dependent increase in Akt Thr308 phosphorylation (Fig. S3D, E). Taken together, these results indicate that the observed delayed increases in Akt and JNK phosphorylation, preceding the onset of cell death, represent specific consequences of necroptotic signaling downstream from RIP1 kinase. TNFα Induces Delayed Akt Thr308 Phosphorylation and Necroptosis Independent of Growth Factor Stimulation Consistent with TNFα inducing necroptosis independently of growth factors (Fig. 1A), FGFR inhibitors did not attenuate TNFα-induced changes in Akt or JNK phosphorylation, while efficiently preventing these changes in response to zVAD.fmk (Fig. S4A). Furthermore, addition of TNFα led to comparable late activation of Akt p308 signal under both normal and serum free conditions (Fig. S4B, C), indicating that TNFα signaling to Akt Thr308 is growth factor-independent. In contrast, activation of JNK by TNFα followed different kinetics from zVAD.fmk-induced changes. TNFα treatment caused an early and robust increase in the phosphorylation of JNK and c-Jun. Nec-1 did not affect this early increase, however, it reduced levels of pJNK/Jun at the late, 9 hr time point (Fig. S4B, C). This again separated early RIP1-independent changes, which likely reflect the ability of additional upstream kinases, such as Ask1 to activate JNK [27], from the late RIP1 kinase-dependent necroptotic signaling. Late Increase in Akt Thr308 Phosphorylation Contributes to the Induction of Necroptotic Cell Death We next investigated if the delayed RIP1 kinase-dependent increase in Akt Thr308 phosphorylation functionally contributes to the execution of necroptotic cell death. Firstly, PDGF/zVAD.fmk, which cannot induce necroptosis (Fig. 2A), triggered only the initial, rapid Akt and JNK phosphorylation changes and not the delayed activation (Fig. 4A), indicating that late, rather than early Akt phosphorylation correlates with necroptosis. Secondly, we saw that the ability of the Akt inhibitor to protect cells from necroptosis rapidly declined after 6 hrs of stimulation with zVAD.fmk, TNFα or bFGF/zVAD.fmk and no protection was observed when the inhibitor was added at 9 hrs (Fig. 4B,C). This time frame coincides with the timing of the secondary Akt Thr308 phosphorylation. Finally, we terminated the bFGF signal one hour after addition of bFGF by the addition of PD173074. This allowed us to retain early Akt activation, but to suppress the secondary increase (Fig. 4D). Both pre-addition and delayed addition of PD173074 fully prevented necroptosis (Fig. 4E). Overall, these data, while correlative, indicate that early Akt activation is insufficient to promote necroptosis and are strongly supportive of an important role for the delayed activation of Akt in the induction of necroptotic cell death. 10.1371/journal.pone.0056576.g004 Figure 4 Late Thr308 phosphorylation of Akt contributes to necroptosis. (A) L929 cells were treated with zVAD.fmk and bFGF or PDGF, with or without Nec-1, for the indicated periods of time. (B,C) L929 cells were stimulated by zVAD.fmk or TNFα (B) or bFGF/zVAD.fmk under serum free conditions (C). Akt inh. VIII was added 15 min before necroptotic stimulation (Pre) or at indicated times after stimulation. Viability was measured 24 hr after activation of necroptosis. (D) L929 cells were stimulated with bFGF/zVAD under serum free conditions. PD173074 was added 15 min before or 1 hr after FGF/zVAD. Samples for western blot were collected at 15 min and 9 hr time points. (E) Cells were pretreated with PD173074 or it was added 1 hr after bFGF/zVAD.fmk, followed by viability assessment at 24 hr. In all graphs, average±SD was plotted. The Akt Signaling Pathway Contributes to the Regulation of Necroptosis We next determined whether the necroptosis-associated increase in Thr308 phosphorylation results in an increase in Akt kinase activity. Under necroptotic conditions, we observed an increase in the phosphorylation of multiple known Akt substrates (Forkhead box class O (FoxO) proteins, GSK-3 kinases and mouse double minute 2 (MDM2)) as well as downstream molecules (p70 ribosomal protein S6 Kinase (p70S6K), S6) (Fig. 5A). In some cases (FoxO1, FoxO4, MDM2), a robust increase was observed. In other cases (FoxO3a, GSK-3α/β, p70S6K and its substrate S6), the changes were less pronounced (Fig. 5A). The timing of the phosphorylation changes paralleled the increase in Akt phosphorylation (Fig. 5B, S5A, B). In the case of pFoxO1 we occasionally observed a shift in migration rather than an increase in band intensity (e.g. comparing Fig. 5A and B), suggesting that phosphorylation events in addition to Thr24 take place during necroptosis. Notably, in all cases the necroptosis-associated increases in Akt substrates were abrogated by Nec-1 (Fig. 5A, Fig. S5A, B). Overall, these data suggested that a significant part of the “canonical” Akt signaling network is activated at the onset of necroptotic cell death in a RIP1 dependent fashion. 10.1371/journal.pone.0056576.g005 Figure 5 mTORC1 contributes to the regulation of necroptosis. (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr and harvested for western blot. (B) Cell under serum free condition were treated with bFGF or bFGF/zVAD.fmk for the indicated amounts of time, followed by western blotting using the indicated antibodies. (C) Necroptosis was induced by zVAD.fmk or TNFα in L929 cell in the presence of inhibitors of Akt(Akt inh. VIII) and mTOR (rapamycin, Torin-1 and PI-103). (D) L929 cells with mTOR siRNA knockdown were harvested for western blot or treated with zVAD.fmk or TNFα for 24 hrs. Cell viability was determined 24 hr after activation of necroptosis. In all graphs, average±SD was plotted. Akt kinase is considered to be a pro-survival protein that inhibits apoptosis through the control of multiple effectors including mTORC1, GSK-3 and others [28]. An important question is whether these same molecules reverse their pro-survival roles during necroptosis. We found that inhibition of mTORC1 by rapamycin, an inhibitor of the mTOR co-factor Raptor [29], protected cells from necroptosis (Fig. 5C). Similarly, the direct mTOR kinase inhibitor Torin1 [30] and the dual PI3K/mTOR inhibitor PI-103 [31] also efficiently inhibited necroptosis (Fig. 5C). Knockdown of mTOR using siRNA further validated the small-molecule inhibitor data indicating a role for mTOR in necroptosis by protecting cells from both zVAD.fmk and TNFα induced death (Fig. 5D). mTORC1 regulates translation through activation of p70S6 kinase and, subsequently, ribosomal protein S6 [32]. Notably, a genome-wide siRNA screen [10] suggested an important role for protein translation in necroptosis. Consistently, we found that the small molecule inhibitor of p70S6K PF-4708671 [33] attenuated necroptosis at the concentrations required to block S6 phosphorylation (Fig. S5C, D). Partial siRNA knockdown of S6 protein attenuated necroptosis as well (Fig. S5E), suggesting that translational control by p70S6K/S6 may play a role in necroptosis. Overall, while the full repertoire of Akt targets during necroptosis remains to be fully explored, our data provide evidence that the activity of an anti-apoptotic branch of Akt signaling can promote necroptosis. RIP1 kinase, Akt, mTORC1 and JNK control the upregulation of TNFα accompanying necroptosis. Hitomi et al. [10] have recently reported that the induction of necroptosis by zVAD.fmk in L929 cells is associated with increased synthesis of TNFα, which potentiates cell death. Therefore, we examined whether Akt and its effectors contribute to TNFα synthesis. Consistent with a RIP1-dependent increase in TNFα protein (Fig. S6A, B), we found that TNFα mRNA levels increased during necroptosis in L929 cells in a RIP1 (Fig. S6C. Under serum free conditions, bFGF alone triggered some induction of TNFα mRNA, while its combination with zVAD.fmk (but not zVAD.fmk alone) caused a pronounced further increase (Fig. 6A). Conversely, PDGF caused a modest upregulation of TNFα mRNA, which was not further increased in the presence of zVAD.fmk (Fig. 6A), demonstrating that activation of necroptosis is specifically accompanied by a marked increase in autocrine TNFα synthesis. 10.1371/journal.pone.0056576.g006 Figure 6 Akt and mTORC1 control autocrine TNFα synthesis and JNK activation during necroptosis. (A) Cells were treated under serum free conditions with bFGF or PDGF with or without zVAD.fmk for 9 hr, followed by qRT-PCR analysis of mTNFα. Data was normalized to mouse 18S RNA. (B) Necroptosis was induced by zVAD.fmk or TNFα in cells treated with Nec-1, rapamycin (rapa), or Akt inh. VIII inh. followed by qRT-PCR analysis of TNFα mRNA levels. (C-F) L929 cells with siRNA knockdown of Akt isoforms (C,E) or mTOR (D,F) were stimulated with zVAD.fmk or TNFα for 9 hr, followed by qRT-PCR analysis of mTNFα (C,D) or western blot (E,F). In all graphs, average±SD was plotted. Further analysis suggested that both Akt and mTORC1 contribute to the upregulation of TNFα mRNA during necroptosis as both small-molecule inhibition and siRNA knockdown of Akt and mTOR reduced TNFα mRNA levels in necroptotic cells (Fig. 6B,C,D). Notably, RIP1 and Akt inhibitors had no effect on the levels of TNFα mRNA in control cells or in the cells stimulated with bFGF alone (Fig. 6A,B, Fig. S6C), suggesting that these kinases specifically mediate necroptosis-dependent increase in TNFα synthesis. Akt and mTORC1 Control the Activation of JNK during Necroptosis JNK is a well-established regulator of TNFα synthesis in a variety of systems [13], [14], [15], [34]. Therefore, the ability of Akt and mTORC1 inhibitors to block the increase in TNFα mRNA lead us to examine their role in the activation of JNK during necroptosis. Knockdown of Akt isoforms Akt1 and Akt2 or inhibition of Akt prominently suppressed the necroptosis dependent increase in JNK and c-Jun phosphorylation (Fig. 6E, S6D,E) suggesting that Akt may provide a link between RIP1 and JNK activation. Importantly, inhibition of Akt only inhibited the delayed, but not the early, increase in bFGF/zVAD.fmk induced JNK and c-Jun phosphorylation (Fig. S6F). Knockdown of mTOR, rapamycin and the p70S6K inhibitor PF-4708671 also attenuated the necroptosis-associated increase in JNK and c-Jun phosphorylation (Fig. 6F, S6E,G, Fig. S5D). Overall, these data suggested that the Akt-mTORC1-S6K axis, acting downstream from RIP1 kinase, is required for the increase in JNK activity during necroptosis in L929 cells. PI3-kinase and PDK1 Mediate the Increase in Akt Thr308 Phosphorylation Under Necroptotic Conditions Typical regulation of Akt by growth factors involves its recruitment to the plasma membrane, which is mediated by the binding of the pleckstrin homology (PH) domain of Akt to the product of PI3K, phosphatidylinositol-3,4,5-triphosphate (PIP3). In the membrane, Akt is phosphorylated on Thr308 and Ser473 by 3-phosphoinositide dependent protein kinase-1 (PDK1) and mTORC2 (or DNA-PK), respectively [35]. Since our results showed that only Thr308 Akt phosphorylation is increased during necroptosis, we next examined whether it is still dependent on PI3K and PDK1. Inhibition of PI3K and PDK1 using the specific inhibitors LY249002 and BX912 [36] resulted in the efficient inhibition of cell death and Akt Thr308 phosphorylation (Fig. S7A–D). Likewise, siRNA knockdown of PDK1 protected cells from death and inhibited Akt Thr308 phosphorylation (Fig. S7E,F) Therefore, PI3K and PDK1 activity is still required for non-canonical Akt activation during necroptosis. Expression of Constitutively Active Akt, Rescues Necroptosis Under Serum Free Conditions We used L929 cells stably expressing constitutively active wild type Akt1 (Myr-Akt) or the catalytically inactive mutant K179M in order to further understand the contribution of growth factors and RIP1 kinase to Akt activation during necroptosis. Constitutively active Akt1 (Myr-Akt) was generated as previously described [37] by the addition of a myristoylation signal which provides constitutive localization to the plasma membrane and by the deletion of the auto-inhibitory PH domain (Fig. 7A) resulting in an Akt that is active under serum free. It is important to note that the cells expressing Myr-Akt were viable, grew in a manner indistinguishable from the empty vector control cells, and were not triggered to induce necroptosis by serum starvation (Fig. 7B). This indicates that active Akt alone is not sufficient to induce necroptotic cell death. Under serum free conditions Myr-Akt, but not the K179M mutant, fully restored zVAD.fmk-induced necroptosis (Fig. 7A,B). Nec-1 prevented both Myr-Akt dependent cell death and the necroptosis-specific delayed increase in Akt Thr308 phosphorylation (Fig. 7B,C). Myr-Akt also allowed other zVAD.fmk-dependent events, including activation of JNK and c-Jun phosphorylation (Fig. 7C) and upregulation of TNFα mRNA (Fig. 7D) to occur under serum free conditions, confirming an important role for Akt at the apex of necroptotic signaling. These data demonstrated that the presence of active and membrane localized Akt is sufficient to uncouple Akt activation during necroptosis from growth factor signaling. RIP1 kinase was still able to regulate Akt activation during necroptosis, suggesting that growth factors and RIP1 kinase provide two independent inputs required for Akt changes during necroptosis. 10.1371/journal.pone.0056576.g007 Figure 7 Over expression of constitutively active Akt restores necroptosis under serum free conditions. (A,B) L929 cells were stably infected with empty MSCV retrovirus or viruses encoding Myr-Akt or the catalytically inactive Myr-Akt K179M. Necroptosis was induced by the addition of zVAD.fmk under serum free conditions (A) or serum or serum free conditions with Nec-1 (B). Viability assays were performed after 24 hr. (C) Myr-Akt and Myr-Akt K179M cells were treated with zVAD.fmk and/or Nec-1 under serum free conditions for 9 hr, followed by western blot using the indicated antibodies. Endogenous Akt (∼) and Myr-Akt () bands are indicated. (D) L929 cells, stably infected with Myr-Akt and Myr-Akt K179KM, were stimulated with zVAD.fmk for 9 hr under serum free conditions. TNFα mRNA levels were determined by qRT-PCR and normalized using mouse 18S RNA. (E-G) L929 cells expressing Myr-Akt and Ala and Asp mutants of Thr308 and Ser473 were treated with zVAD.fmk under serum free conditions, followed by viability assay at 24 hr (E), western blot at 9 hr (F), or evaluation of TNFα mRNA levels by qRT-PCR at 9 hrs (G). In all graphs, average±SD was plotted. RIP1 kinase-dependent Thr308 phosphorylation of Myr-Akt during necroptosis"
R10242	T15756	T15763	causeOf	"RIP1 kinase-dependent Thr308 phosphorylation during necroptosis in multiple cell types. Furthermore, we found that downstream Akt signaling through mTORC1 and S6 contributes to the activation of necroptosis and TNFα production. We found that the Akt pathway serves as a critical link between RIP1 kinase and JNK activation in L929 cells. Further data suggested that in multiple other cell types including FADD deficient Jurkat cells, RAW and J774.1 macrophage cell lines, and mouse lung fibroblasts Akt provides a key link to TNFα production, but is dispensible for cell death per se. Overall, our results reveal a specific and novel role for the Akt pathway in regulated necrosis and necrosis-associated inflammatory signaling. Results Basic Fibroblast Growth Factor Promotes Necroptosis in L929 Cells It has been established that mouse fibrosarcoma L929 cells undergo necroptotic cell death following stimulation with TNFα [10], [17]. In addition, inhibition of caspase-8 activity alone, either through siRNA knockdown or by using the pan-caspase inhibitor, zVAD.fmk, is sufficient to trigger necroptosis in these cells [10], [14]. Interestingly, while necroptosis was initially identified as a back-up form of cell death triggered by pro-apoptotic stimuli in the presence of apoptosis inhibitors [17], recent analysis of physiological cell death during mouse development has suggested that the loss of apoptotic regulators, such as caspase-8 and FADD [18], [19], [20], leads to robust induction of necroptosis and death of E10.5 embryos even though apoptosis is not normally induced in wild type embryos. These data are reminiscent of the observations in L929 cells where the loss of caspase activity in healthy cells is sufficient to trigger necroptosis and prompted us to explore the extrinsic or intrinsic cellular factors that promote necroptosis once caspase-8 activity, which cleaves and inactivates RIP1 kinase and the RIP1 deubiquitinase CYLD [21], [22], is removed in L929 cells. Consistent with a previous report [16], we found that serum starvation of L929 cells prevented necroptosis in response to zVAD.fmk (Fig. 1A). The addition of growth factors, such as bFGF, restored zVAD.fmk induced death under serum free conditions (Fig. 1B). Interestingly, this does not reflect a generic requirement for growth factor signaling, as only some growth factors (bFGF and IGF-1, but not EGF and PDGF) promoted death (Fig. 1B). Furthermore, growth factor-dependent necroptosis required the inhibition of caspase activity, as bFGF alone did not induce cell death (Fig. 1C). In contrast, TNFα triggered necroptosis equally efficiently in the absence of serum (Fig. 1A), suggesting that either growth factors and zVAD.fmk or TNFα are required for necroptotic death in L929 cells. 10.1371/journal.pone.0056576.g001 Figure 1 bFGF and IGF-1 promote necroptosis in concert with zVAD.fmk. (A) L929 cells were treated with TNFα or zVAD.fmk under normal serum (10% FBS) or serum free conditions. Cell viability was determined after 24 hr using the CellTiter-Glo Viability assay. The concentrations of all necroptosis-inducing agents are listed in the Materials and Methods section or indicated in the figures. (B) Cells were treated with zVAD.fmk, the indicated growth factors, and Nec-1 under serum free conditions for 24 hrs followed by measurement of cell viability. (C) Cells under serum free conditions were treated with FGF, zVAD.fmk, or both for 24 hrs followed by viability assay. (D) Cell death was induced by zVAD.fmk or TNFα under full serum condition in the presence of 2 µM PD173074 and 20 µM PD166866. In all graphs, average±SD was plotted. Previously we described the development of 7-Cl-O-Nec-1 (Nec-1) as a potent and selective inhibitor of RIP1 kinase and necroptosis (Fig. S1A) [23], [24]. Recently, its selectivity has been further validated against a panel of more than 400 human kinases [15]. This inhibitor efficiently blocked growth factor/zVAD.fmk-induced necroptosis under serum free conditions in L929 cells and both zVAD.fmk and TNFα-induced necroptosis under full serum conditions (Fig. 1B, S1B). To further validate the role of RIP1, we used an inactive analog, 7-Cl-O-Nec-1i (Nec-1i) (Fig. S1A), which contains an extra N-methyl group that leads to almost complete loss of RIP1 kinase inhibitory activity in vitro [23]. Nec-1i was unable to protect L929 cell death under serum condtions treated with zVAD.fmk or TNFα (Fig. S1B) or serum free conditions treated with bFGF/zVAD.fmk (Fig. S1C). This confirms that RIP1 kinase is responsible for necroptosis in L929 cells under both serum and serum free conditions. We next examined whether bFGF contributes to zVAD.fmk-induced necroptosis under normal serum conditions (10% FBS). We used two bFGF receptor tyrosine kinase inhibitors (PD173074 and PD166866), and determined that inhibition of bFGF signaling strongly inhibited zVAD.fmk-induced necroptosis under normal serum conditions (Fig. 1D). In contrast, neither bFGF receptor inhibitor was able to attenuate TNFα-induced necroptosis (Fig. 1D), consistent with growth factors being dispensable for this pathway (Fig. 1A). Overall, these data suggest that the induction of necroptosis by zVAD.fmk is promoted by bFGF under both serum and serum free conditions. The induction of necroptosis, however, is not a simple consequence of growth factor signaling since not all growth factors allowed death to occur. Instead, specific signaling events mediated by particular growth factors appear to contribute to necroptotic death. RIP1 Kinase-dependent Activation of Akt Contributes to Necroptosis Given our observation that growth factors are important for zVAD.fmk induced death, we examined the contribution of several pathways, including MAPK pathways and Akt, which are known to be activated following growth factor receptor activation (Fig. 2A). Inhibition of Akt (Akt inhibitor VIII) strongly protected the cells from growth factor-sensitive necroptosis induced by zVAD.fmk [16] as well as cell death triggered by bFGF or IGF-1/zVAD.fmk under serum free conditions (Fig. 2B). Inhibition of Akt also protected the cells from growth-factor insensitive death by caused by TNFα (Fig. 2A). Consistent with previous reports, the JNK inhibitor SP600125 protected the cells from both zVAD.fmk and TNFα induced death (Fig. 2A,B and Fig. S2A) [12], [14]. In contrast, inhibition of two other MAPKs, p38 and ERK, previously reported not to be activated during necroptosis [14], did not protect from either zVAD.fmk or TNFα induced death (Fig. 2A). 10.1371/journal.pone.0056576.g002 Figure 2 Akt contributes to necroptosis induced by zVAD.fmk and TNFα. (A,B) Necroptosis was induced by zVAD.fmk or TNFα (full serum, A) or growth factors/zVAD.fmk (serum free, B) in the presence of inhibitors of Akt (Akt inhibitor VIII), JNK (SP600125), p38 (PD169316), and Erk (UO126). Cell viability was determined after 24 hrs. (C) L929 cells transfected with Akt1, Akt2, and Akt3 siRNAs for 72 hrs were treated with zVAD.fmk or TNFα for 9 hrs. Cell viability and Akt expression levels were determined after 24 hrs. In all graphs, average±SD was plotted. Next, we used two approaches to further validate the role of Akt in necroptotic cell death. First, two additional Akt inhibitors, a highly specific, allosteric kinase inhibitor MK-2206 [25] and triciribine (TCN) [26], which blocks membrane translocation of Akt, both attenuated cell death (Fig. S2B). Secondly, simultaneous knockdown of Akt isoforms Akt1 and Akt2 using siRNAs protected cells from necroptosis induced by both zVAD.fmk and TNFα (Fig. 2C). No expression of Akt3 was seen in L929 cells (Fig. S2C) and, consistently, Akt3 siRNA had no additional effect on necroptosis. Our results confirmed that Akt plays a key role in necroptosis induced by multiple stimuli in L929 cells. To understand the activation of Akt and JNK under necroptotic conditions, we examined the changes in Akt and JNK phosphorylation at 9 hrs post zVAD.fmk and TNFα stimulation. This time point was chosen because it reflects the early stage of cell death in our system (Fig. S3A, B). Following stimulation with either zVAD.fmk or TNFα we observed a robust increase in Akt phosphorylation at a known major activation site, Thr308 (Fig. 3A). Interestingly, we did not observe concomitant phosphorylation changes in the second major activation site of Akt, Ser473. We also observed an increase in the phosphorylation of both the p46 and p54 isoforms of JNK and its major substrate c-Jun (Fig. 3A). These data indicate that both Akt and JNK are activated under necroptotic conditions. 10.1371/journal.pone.0056576.g003 Figure 3 RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis. (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr, followed by western blotting with indicated antibodies. (B,C) L929 cells were treated with zVAD.fmk (B) or bFGF/zVAD.fmk (serum free conditions, C) and samples were collected at the indicated time points for western blot. (D) Nec-1 was added to the cells stimulated with bFGF or bFGF/zVAD (serum free conditions) for 15 min or 9 hr followed by western blot with the indicated antibodies. The RIP1 kinase inhibitor, Nec-1, completely prevented the increase in Thr308 Akt phosphorylation, while Nec-1i did not (Fig. 3A, Fig. S1D). Similarly, Nec-1 prevented the induction of JNK phosphorylation in response to zVAD.fmk and substantially reduced this change after TNFα addition. We observed some changes in total protein levels of JNK and c-Jun following necroptotic stimulation. Some of these changes, e.g. zVAD.fmk-induced increase in c-Jun, were also attenuated by Nec-1. Importantly, Nec-1 did not alter the basal phosphorylation levels of either Akt or JNK (Fig. 3A). This established that Akt Thr308 and JNK phosphorylation during necroptosis is RIP1 dependent. Interestingly, we discovered that the phosphorylation of Akt Thr308, JNK and Jun are late events following zVAD.fmk stimulation (Fig. 3B) that coincide with the onset of necroptosis at 6 hr post-stimulation (Fig. S3A). To better understand the contributions of growth factors and RIP1 kinase to necroptotic regulation of Akt, we next analyzed the time course of these phosphorylation changes under serum free conditions. We found that the addition of bFGF alone or in combination with zVAD.fmk led to a substantial rapid and transient increase in both Thr308 and Ser473 phosphorylation of Akt as well as JNK and c-Jun at 15 minutes, reflecting the expected response to growth factor stimulation (Fig. 3C). Significantly, the combination of bFGF/zVAD.fmk, but not bFGF alone, also caused a robust, second, delayed increase in the phosphorylation of Thr308, but not Ser473, of Akt as well as a delayed increase in the phosphorylation of JNK and Jun. Furthermore, Nec-1 had no significant effect on the early increase in both Akt and JNK/c-Jun phosphorylation triggered by both bFGF and bFGF/zVAD, while Nec-1, but not its inactive analog Nec-1i (Fig. S1E), efficiently blocked the bFGF/zVAD increase at 6–9 hr (Fig. 3D), suggesting that only the delayed activation of Akt and JNK is specific for necroptosis and dependent on RIP1 kinase activity. Similarly, IGF/zVAD, which also promoted cell death under serum free conditions, produced a delayed increase in Thr308 phosphorylation on Akt, while IGF alone caused solely an early, transient increase in phosphorylation (Fig. S3C). We confirmed the kinetics of the Akt Thr308 and Ser473 phosphorylation changes using a quantitative ELISA assay, which also showed a robust delayed necroptosis-specific RIP1-dependent increase in Akt Thr308 phosphorylation (Fig. S3D, E). Taken together, these results indicate that the observed delayed increases in Akt and JNK phosphorylation, preceding the onset of cell death, represent specific consequences of necroptotic signaling downstream from RIP1 kinase. TNFα Induces Delayed Akt Thr308 Phosphorylation and Necroptosis Independent of Growth Factor Stimulation Consistent with TNFα inducing necroptosis independently of growth factors (Fig. 1A), FGFR inhibitors did not attenuate TNFα-induced changes in Akt or JNK phosphorylation, while efficiently preventing these changes in response to zVAD.fmk (Fig. S4A). Furthermore, addition of TNFα led to comparable late activation of Akt p308 signal under both normal and serum free conditions (Fig. S4B, C), indicating that TNFα signaling to Akt Thr308 is growth factor-independent. In contrast, activation of JNK by TNFα followed different kinetics from zVAD.fmk-induced changes. TNFα treatment caused an early and robust increase in the phosphorylation of JNK and c-Jun. Nec-1 did not affect this early increase, however, it reduced levels of pJNK/Jun at the late, 9 hr time point (Fig. S4B, C). This again separated early RIP1-independent changes, which likely reflect the ability of additional upstream kinases, such as Ask1 to activate JNK [27], from the late RIP1 kinase-dependent necroptotic signaling. Late Increase in Akt Thr308 Phosphorylation Contributes to the Induction of Necroptotic Cell Death We next investigated if the delayed RIP1 kinase-dependent increase in Akt Thr308 phosphorylation functionally contributes to the execution of necroptotic cell death. Firstly, PDGF/zVAD.fmk, which cannot induce necroptosis (Fig. 2A), triggered only the initial, rapid Akt and JNK phosphorylation changes and not the delayed activation (Fig. 4A), indicating that late, rather than early Akt phosphorylation correlates with necroptosis. Secondly, we saw that the ability of the Akt inhibitor to protect cells from necroptosis rapidly declined after 6 hrs of stimulation with zVAD.fmk, TNFα or bFGF/zVAD.fmk and no protection was observed when the inhibitor was added at 9 hrs (Fig. 4B,C). This time frame coincides with the timing of the secondary Akt Thr308 phosphorylation. Finally, we terminated the bFGF signal one hour after addition of bFGF by the addition of PD173074. This allowed us to retain early Akt activation, but to suppress the secondary increase (Fig. 4D). Both pre-addition and delayed addition of PD173074 fully prevented necroptosis (Fig. 4E). Overall, these data, while correlative, indicate that early Akt activation is insufficient to promote necroptosis and are strongly supportive of an important role for the delayed activation of Akt in the induction of necroptotic cell death. 10.1371/journal.pone.0056576.g004 Figure 4 Late Thr308 phosphorylation of Akt contributes to necroptosis. (A) L929 cells were treated with zVAD.fmk and bFGF or PDGF, with or without Nec-1, for the indicated periods of time. (B,C) L929 cells were stimulated by zVAD.fmk or TNFα (B) or bFGF/zVAD.fmk under serum free conditions (C). Akt inh. VIII was added 15 min before necroptotic stimulation (Pre) or at indicated times after stimulation. Viability was measured 24 hr after activation of necroptosis. (D) L929 cells were stimulated with bFGF/zVAD under serum free conditions. PD173074 was added 15 min before or 1 hr after FGF/zVAD. Samples for western blot were collected at 15 min and 9 hr time points. (E) Cells were pretreated with PD173074 or it was added 1 hr after bFGF/zVAD.fmk, followed by viability assessment at 24 hr. In all graphs, average±SD was plotted. The Akt Signaling Pathway Contributes to the Regulation of Necroptosis We next determined whether the necroptosis-associated increase in Thr308 phosphorylation results in an increase in Akt kinase activity. Under necroptotic conditions, we observed an increase in the phosphorylation of multiple known Akt substrates (Forkhead box class O (FoxO) proteins, GSK-3 kinases and mouse double minute 2 (MDM2)) as well as downstream molecules (p70 ribosomal protein S6 Kinase (p70S6K), S6) (Fig. 5A). In some cases (FoxO1, FoxO4, MDM2), a robust increase was observed. In other cases (FoxO3a, GSK-3α/β, p70S6K and its substrate S6), the changes were less pronounced (Fig. 5A). The timing of the phosphorylation changes paralleled the increase in Akt phosphorylation (Fig. 5B, S5A, B). In the case of pFoxO1 we occasionally observed a shift in migration rather than an increase in band intensity (e.g. comparing Fig. 5A and B), suggesting that phosphorylation events in addition to Thr24 take place during necroptosis. Notably, in all cases the necroptosis-associated increases in Akt substrates were abrogated by Nec-1 (Fig. 5A, Fig. S5A, B). Overall, these data suggested that a significant part of the “canonical” Akt signaling network is activated at the onset of necroptotic cell death in a RIP1 dependent fashion. 10.1371/journal.pone.0056576.g005 Figure 5 mTORC1 contributes to the regulation of necroptosis. (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr and harvested for western blot. (B) Cell under serum free condition were treated with bFGF or bFGF/zVAD.fmk for the indicated amounts of time, followed by western blotting using the indicated antibodies. (C) Necroptosis was induced by zVAD.fmk or TNFα in L929 cell in the presence of inhibitors of Akt(Akt inh. VIII) and mTOR (rapamycin, Torin-1 and PI-103). (D) L929 cells with mTOR siRNA knockdown were harvested for western blot or treated with zVAD.fmk or TNFα for 24 hrs. Cell viability was determined 24 hr after activation of necroptosis. In all graphs, average±SD was plotted. Akt kinase is considered to be a pro-survival protein that inhibits apoptosis through the control of multiple effectors including mTORC1, GSK-3 and others [28]. An important question is whether these same molecules reverse their pro-survival roles during necroptosis. We found that inhibition of mTORC1 by rapamycin, an inhibitor of the mTOR co-factor Raptor [29], protected cells from necroptosis (Fig. 5C). Similarly, the direct mTOR kinase inhibitor Torin1 [30] and the dual PI3K/mTOR inhibitor PI-103 [31] also efficiently inhibited necroptosis (Fig. 5C). Knockdown of mTOR using siRNA further validated the small-molecule inhibitor data indicating a role for mTOR in necroptosis by protecting cells from both zVAD.fmk and TNFα induced death (Fig. 5D). mTORC1 regulates translation through activation of p70S6 kinase and, subsequently, ribosomal protein S6 [32]. Notably, a genome-wide siRNA screen [10] suggested an important role for protein translation in necroptosis. Consistently, we found that the small molecule inhibitor of p70S6K PF-4708671 [33] attenuated necroptosis at the concentrations required to block S6 phosphorylation (Fig. S5C, D). Partial siRNA knockdown of S6 protein attenuated necroptosis as well (Fig. S5E), suggesting that translational control by p70S6K/S6 may play a role in necroptosis. Overall, while the full repertoire of Akt targets during necroptosis remains to be fully explored, our data provide evidence that the activity of an anti-apoptotic branch of Akt signaling can promote necroptosis. RIP1 kinase, Akt, mTORC1 and JNK control the upregulation of TNFα accompanying necroptosis. Hitomi et al. [10] have recently reported that the induction of necroptosis by zVAD.fmk in L929 cells is associated with increased synthesis of TNFα, which potentiates cell death. Therefore, we examined whether Akt and its effectors contribute to TNFα synthesis. Consistent with a RIP1-dependent increase in TNFα protein (Fig. S6A, B), we found that TNFα mRNA levels increased during necroptosis in L929 cells in a RIP1 (Fig. S6C. Under serum free conditions, bFGF alone triggered some induction of TNFα mRNA, while its combination with zVAD.fmk (but not zVAD.fmk alone) caused a pronounced further increase (Fig. 6A). Conversely, PDGF caused a modest upregulation of TNFα mRNA, which was not further increased in the presence of zVAD.fmk (Fig. 6A), demonstrating that activation of necroptosis is specifically accompanied by a marked increase in autocrine TNFα synthesis. 10.1371/journal.pone.0056576.g006 Figure 6 Akt and mTORC1 control autocrine TNFα synthesis and JNK activation during necroptosis. (A) Cells were treated under serum free conditions with bFGF or PDGF with or without zVAD.fmk for 9 hr, followed by qRT-PCR analysis of mTNFα. Data was normalized to mouse 18S RNA. (B) Necroptosis was induced by zVAD.fmk or TNFα in cells treated with Nec-1, rapamycin (rapa), or Akt inh. VIII inh. followed by qRT-PCR analysis of TNFα mRNA levels. (C-F) L929 cells with siRNA knockdown of Akt isoforms (C,E) or mTOR (D,F) were stimulated with zVAD.fmk or TNFα for 9 hr, followed by qRT-PCR analysis of mTNFα (C,D) or western blot (E,F). In all graphs, average±SD was plotted. Further analysis suggested that both Akt and mTORC1 contribute to the upregulation of TNFα mRNA during necroptosis as both small-molecule inhibition and siRNA knockdown of Akt and mTOR reduced TNFα mRNA levels in necroptotic cells (Fig. 6B,C,D). Notably, RIP1 and Akt inhibitors had no effect on the levels of TNFα mRNA in control cells or in the cells stimulated with bFGF alone (Fig. 6A,B, Fig. S6C), suggesting that these kinases specifically mediate necroptosis-dependent increase in TNFα synthesis. Akt and mTORC1 Control the Activation of JNK during Necroptosis JNK is a well-established regulator of TNFα synthesis in a variety of systems [13], [14], [15], [34]. Therefore, the ability of Akt and mTORC1 inhibitors to block the increase in TNFα mRNA lead us to examine their role in the activation of JNK during necroptosis. Knockdown of Akt isoforms Akt1 and Akt2 or inhibition of Akt prominently suppressed the necroptosis dependent increase in JNK and c-Jun phosphorylation (Fig. 6E, S6D,E) suggesting that Akt may provide a link between RIP1 and JNK activation. Importantly, inhibition of Akt only inhibited the delayed, but not the early, increase in bFGF/zVAD.fmk induced JNK and c-Jun phosphorylation (Fig. S6F). Knockdown of mTOR, rapamycin and the p70S6K inhibitor PF-4708671 also attenuated the necroptosis-associated increase in JNK and c-Jun phosphorylation (Fig. 6F, S6E,G, Fig. S5D). Overall, these data suggested that the Akt-mTORC1-S6K axis, acting downstream from RIP1 kinase, is required for the increase in JNK activity during necroptosis in L929 cells. PI3-kinase and PDK1 Mediate the Increase in Akt Thr308 Phosphorylation Under Necroptotic Conditions Typical regulation of Akt by growth factors involves its recruitment to the plasma membrane, which is mediated by the binding of the pleckstrin homology (PH) domain of Akt to the product of PI3K, phosphatidylinositol-3,4,5-triphosphate (PIP3). In the membrane, Akt is phosphorylated on Thr308 and Ser473 by 3-phosphoinositide dependent protein kinase-1 (PDK1) and mTORC2 (or DNA-PK), respectively [35]. Since our results showed that only Thr308 Akt phosphorylation is increased during necroptosis, we next examined whether it is still dependent on PI3K and PDK1. Inhibition of PI3K and PDK1 using the specific inhibitors LY249002 and BX912 [36] resulted in the efficient inhibition of cell death and Akt Thr308 phosphorylation (Fig. S7A–D). Likewise, siRNA knockdown of PDK1 protected cells from death and inhibited Akt Thr308 phosphorylation (Fig. S7E,F) Therefore, PI3K and PDK1 activity is still required for non-canonical Akt activation during necroptosis. Expression of Constitutively Active Akt, Rescues Necroptosis Under Serum Free Conditions We used L929 cells stably expressing constitutively active wild type Akt1 (Myr-Akt) or the catalytically inactive mutant K179M in order to further understand the contribution of growth factors and RIP1 kinase to Akt activation during necroptosis. Constitutively active Akt1 (Myr-Akt) was generated as previously described [37] by the addition of a myristoylation signal which provides constitutive localization to the plasma membrane and by the deletion of the auto-inhibitory PH domain (Fig. 7A) resulting in an Akt that is active under serum free. It is important to note that the cells expressing Myr-Akt were viable, grew in a manner indistinguishable from the empty vector control cells, and were not triggered to induce necroptosis by serum starvation (Fig. 7B). This indicates that active Akt alone is not sufficient to induce necroptotic cell death. Under serum free conditions Myr-Akt, but not the K179M mutant, fully restored zVAD.fmk-induced necroptosis (Fig. 7A,B). Nec-1 prevented both Myr-Akt dependent cell death and the necroptosis-specific delayed increase in Akt Thr308 phosphorylation (Fig. 7B,C). Myr-Akt also allowed other zVAD.fmk-dependent events, including activation of JNK and c-Jun phosphorylation (Fig. 7C) and upregulation of TNFα mRNA (Fig. 7D) to occur under serum free conditions, confirming an important role for Akt at the apex of necroptotic signaling. These data demonstrated that the presence of active and membrane localized Akt is sufficient to uncouple Akt activation during necroptosis from growth factor signaling. RIP1 kinase was still able to regulate Akt activation during necroptosis, suggesting that growth factors and RIP1 kinase provide two independent inputs required for Akt changes during necroptosis. 10.1371/journal.pone.0056576.g007 Figure 7 Over expression of constitutively active Akt restores necroptosis under serum free conditions. (A,B) L929 cells were stably infected with empty MSCV retrovirus or viruses encoding Myr-Akt or the catalytically inactive Myr-Akt K179M. Necroptosis was induced by the addition of zVAD.fmk under serum free conditions (A) or serum or serum free conditions with Nec-1 (B). Viability assays were performed after 24 hr. (C) Myr-Akt and Myr-Akt K179M cells were treated with zVAD.fmk and/or Nec-1 under serum free conditions for 9 hr, followed by western blot using the indicated antibodies. Endogenous Akt (∼) and Myr-Akt () bands are indicated. (D) L929 cells, stably infected with Myr-Akt and Myr-Akt K179KM, were stimulated with zVAD.fmk for 9 hr under serum free conditions. TNFα mRNA levels were determined by qRT-PCR and normalized using mouse 18S RNA. (E-G) L929 cells expressing Myr-Akt and Ala and Asp mutants of Thr308 and Ser473 were treated with zVAD.fmk under serum free conditions, followed by viability assay at 24 hr (E), western blot at 9 hr (F), or evaluation of TNFα mRNA levels by qRT-PCR at 9 hrs (G). In all graphs, average±SD was plotted. RIP1 kinase-dependent Thr308 phosphorylation of Myr-Akt during necroptosis","RIP1 kinase-dependent Thr308 phosphorylation during necroptosis in multiple cell types. Furthermore, we found that downstream Akt signaling through mTORC1 and S6 contributes to the activation of necroptosis and TNFα production. We found that the Akt pathway serves as a critical link between RIP1 kinase and JNK activation in L929 cells. Further data suggested that in multiple other cell types including FADD deficient Jurkat cells, RAW and J774.1 macrophage cell lines, and mouse lung fibroblasts Akt provides a key link to TNFα production, but is dispensible for cell death per se. Overall, our results reveal a specific and novel role for the Akt pathway in regulated necrosis and necrosis-associated inflammatory signaling. Results Basic Fibroblast Growth Factor Promotes Necroptosis in L929 Cells It has been established that mouse fibrosarcoma L929 cells undergo necroptotic cell death following stimulation with TNFα [10], [17]. In addition, inhibition of caspase-8 activity alone, either through siRNA knockdown or by using the pan-caspase inhibitor, zVAD.fmk, is sufficient to trigger necroptosis in these cells [10], [14]. Interestingly, while necroptosis was initially identified as a back-up form of cell death triggered by pro-apoptotic stimuli in the presence of apoptosis inhibitors [17], recent analysis of physiological cell death during mouse development has suggested that the loss of apoptotic regulators, such as caspase-8 and FADD [18], [19], [20], leads to robust induction of necroptosis and death of E10.5 embryos even though apoptosis is not normally induced in wild type embryos. These data are reminiscent of the observations in L929 cells where the loss of caspase activity in healthy cells is sufficient to trigger necroptosis and prompted us to explore the extrinsic or intrinsic cellular factors that promote necroptosis once caspase-8 activity, which cleaves and inactivates RIP1 kinase and the RIP1 deubiquitinase CYLD [21], [22], is removed in L929 cells. Consistent with a previous report [16], we found that serum starvation of L929 cells prevented necroptosis in response to zVAD.fmk (Fig. 1A). The addition of growth factors, such as bFGF, restored zVAD.fmk induced death under serum free conditions (Fig. 1B). Interestingly, this does not reflect a generic requirement for growth factor signaling, as only some growth factors (bFGF and IGF-1, but not EGF and PDGF) promoted death (Fig. 1B). Furthermore, growth factor-dependent necroptosis required the inhibition of caspase activity, as bFGF alone did not induce cell death (Fig. 1C). In contrast, TNFα triggered necroptosis equally efficiently in the absence of serum (Fig. 1A), suggesting that either growth factors and zVAD.fmk or TNFα are required for necroptotic death in L929 cells. 10.1371/journal.pone.0056576.g001 Figure 1 bFGF and IGF-1 promote necroptosis in concert with zVAD.fmk. (A) L929 cells were treated with TNFα or zVAD.fmk under normal serum (10% FBS) or serum free conditions. Cell viability was determined after 24 hr using the CellTiter-Glo Viability assay. The concentrations of all necroptosis-inducing agents are listed in the Materials and Methods section or indicated in the figures. (B) Cells were treated with zVAD.fmk, the indicated growth factors, and Nec-1 under serum free conditions for 24 hrs followed by measurement of cell viability. (C) Cells under serum free conditions were treated with FGF, zVAD.fmk, or both for 24 hrs followed by viability assay. (D) Cell death was induced by zVAD.fmk or TNFα under full serum condition in the presence of 2 µM PD173074 and 20 µM PD166866. In all graphs, average±SD was plotted. Previously we described the development of 7-Cl-O-Nec-1 (Nec-1) as a potent and selective inhibitor of RIP1 kinase and necroptosis (Fig. S1A) [23], [24]. Recently, its selectivity has been further validated against a panel of more than 400 human kinases [15]. This inhibitor efficiently blocked growth factor/zVAD.fmk-induced necroptosis under serum free conditions in L929 cells and both zVAD.fmk and TNFα-induced necroptosis under full serum conditions (Fig. 1B, S1B). To further validate the role of RIP1, we used an inactive analog, 7-Cl-O-Nec-1i (Nec-1i) (Fig. S1A), which contains an extra N-methyl group that leads to almost complete loss of RIP1 kinase inhibitory activity in vitro [23]. Nec-1i was unable to protect L929 cell death under serum condtions treated with zVAD.fmk or TNFα (Fig. S1B) or serum free conditions treated with bFGF/zVAD.fmk (Fig. S1C). This confirms that RIP1 kinase is responsible for necroptosis in L929 cells under both serum and serum free conditions. We next examined whether bFGF contributes to zVAD.fmk-induced necroptosis under normal serum conditions (10% FBS). We used two bFGF receptor tyrosine kinase inhibitors (PD173074 and PD166866), and determined that inhibition of bFGF signaling strongly inhibited zVAD.fmk-induced necroptosis under normal serum conditions (Fig. 1D). In contrast, neither bFGF receptor inhibitor was able to attenuate TNFα-induced necroptosis (Fig. 1D), consistent with growth factors being dispensable for this pathway (Fig. 1A). Overall, these data suggest that the induction of necroptosis by zVAD.fmk is promoted by bFGF under both serum and serum free conditions. The induction of necroptosis, however, is not a simple consequence of growth factor signaling since not all growth factors allowed death to occur. Instead, specific signaling events mediated by particular growth factors appear to contribute to necroptotic death. RIP1 Kinase-dependent Activation of Akt Contributes to Necroptosis Given our observation that growth factors are important for zVAD.fmk induced death, we examined the contribution of several pathways, including MAPK pathways and Akt, which are known to be activated following growth factor receptor activation (Fig. 2A). Inhibition of Akt (Akt inhibitor VIII) strongly protected the cells from growth factor-sensitive necroptosis induced by zVAD.fmk [16] as well as cell death triggered by bFGF or IGF-1/zVAD.fmk under serum free conditions (Fig. 2B). Inhibition of Akt also protected the cells from growth-factor insensitive death by caused by TNFα (Fig. 2A). Consistent with previous reports, the JNK inhibitor SP600125 protected the cells from both zVAD.fmk and TNFα induced death (Fig. 2A,B and Fig. S2A) [12], [14]. In contrast, inhibition of two other MAPKs, p38 and ERK, previously reported not to be activated during necroptosis [14], did not protect from either zVAD.fmk or TNFα induced death (Fig. 2A). 10.1371/journal.pone.0056576.g002 Figure 2 Akt contributes to necroptosis induced by zVAD.fmk and TNFα. (A,B) Necroptosis was induced by zVAD.fmk or TNFα (full serum, A) or growth factors/zVAD.fmk (serum free, B) in the presence of inhibitors of Akt (Akt inhibitor VIII), JNK (SP600125), p38 (PD169316), and Erk (UO126). Cell viability was determined after 24 hrs. (C) L929 cells transfected with Akt1, Akt2, and Akt3 siRNAs for 72 hrs were treated with zVAD.fmk or TNFα for 9 hrs. Cell viability and Akt expression levels were determined after 24 hrs. In all graphs, average±SD was plotted. Next, we used two approaches to further validate the role of Akt in necroptotic cell death. First, two additional Akt inhibitors, a highly specific, allosteric kinase inhibitor MK-2206 [25] and triciribine (TCN) [26], which blocks membrane translocation of Akt, both attenuated cell death (Fig. S2B). Secondly, simultaneous knockdown of Akt isoforms Akt1 and Akt2 using siRNAs protected cells from necroptosis induced by both zVAD.fmk and TNFα (Fig. 2C). No expression of Akt3 was seen in L929 cells (Fig. S2C) and, consistently, Akt3 siRNA had no additional effect on necroptosis. Our results confirmed that Akt plays a key role in necroptosis induced by multiple stimuli in L929 cells. To understand the activation of Akt and JNK under necroptotic conditions, we examined the changes in Akt and JNK phosphorylation at 9 hrs post zVAD.fmk and TNFα stimulation. This time point was chosen because it reflects the early stage of cell death in our system (Fig. S3A, B). Following stimulation with either zVAD.fmk or TNFα we observed a robust increase in Akt phosphorylation at a known major activation site, Thr308 (Fig. 3A). Interestingly, we did not observe concomitant phosphorylation changes in the second major activation site of Akt, Ser473. We also observed an increase in the phosphorylation of both the p46 and p54 isoforms of JNK and its major substrate c-Jun (Fig. 3A). These data indicate that both Akt and JNK are activated under necroptotic conditions. 10.1371/journal.pone.0056576.g003 Figure 3 RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis. (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr, followed by western blotting with indicated antibodies. (B,C) L929 cells were treated with zVAD.fmk (B) or bFGF/zVAD.fmk (serum free conditions, C) and samples were collected at the indicated time points for western blot. (D) Nec-1 was added to the cells stimulated with bFGF or bFGF/zVAD (serum free conditions) for 15 min or 9 hr followed by western blot with the indicated antibodies. The RIP1 kinase inhibitor, Nec-1, completely prevented the increase in Thr308 Akt phosphorylation, while Nec-1i did not (Fig. 3A, Fig. S1D). Similarly, Nec-1 prevented the induction of JNK phosphorylation in response to zVAD.fmk and substantially reduced this change after TNFα addition. We observed some changes in total protein levels of JNK and c-Jun following necroptotic stimulation. Some of these changes, e.g. zVAD.fmk-induced increase in c-Jun, were also attenuated by Nec-1. Importantly, Nec-1 did not alter the basal phosphorylation levels of either Akt or JNK (Fig. 3A). This established that Akt Thr308 and JNK phosphorylation during necroptosis is RIP1 dependent. Interestingly, we discovered that the phosphorylation of Akt Thr308, JNK and Jun are late events following zVAD.fmk stimulation (Fig. 3B) that coincide with the onset of necroptosis at 6 hr post-stimulation (Fig. S3A). To better understand the contributions of growth factors and RIP1 kinase to necroptotic regulation of Akt, we next analyzed the time course of these phosphorylation changes under serum free conditions. We found that the addition of bFGF alone or in combination with zVAD.fmk led to a substantial rapid and transient increase in both Thr308 and Ser473 phosphorylation of Akt as well as JNK and c-Jun at 15 minutes, reflecting the expected response to growth factor stimulation (Fig. 3C). Significantly, the combination of bFGF/zVAD.fmk, but not bFGF alone, also caused a robust, second, delayed increase in the phosphorylation of Thr308, but not Ser473, of Akt as well as a delayed increase in the phosphorylation of JNK and Jun. Furthermore, Nec-1 had no significant effect on the early increase in both Akt and JNK/c-Jun phosphorylation triggered by both bFGF and bFGF/zVAD, while Nec-1, but not its inactive analog Nec-1i (Fig. S1E), efficiently blocked the bFGF/zVAD increase at 6–9 hr (Fig. 3D), suggesting that only the delayed activation of Akt and JNK is specific for necroptosis and dependent on RIP1 kinase activity. Similarly, IGF/zVAD, which also promoted cell death under serum free conditions, produced a delayed increase in Thr308 phosphorylation on Akt, while IGF alone caused solely an early, transient increase in phosphorylation (Fig. S3C). We confirmed the kinetics of the Akt Thr308 and Ser473 phosphorylation changes using a quantitative ELISA assay, which also showed a robust delayed necroptosis-specific RIP1-dependent increase in Akt Thr308 phosphorylation (Fig. S3D, E). Taken together, these results indicate that the observed delayed increases in Akt and JNK phosphorylation, preceding the onset of cell death, represent specific consequences of necroptotic signaling downstream from RIP1 kinase. TNFα Induces Delayed Akt Thr308 Phosphorylation and Necroptosis Independent of Growth Factor Stimulation Consistent with TNFα inducing necroptosis independently of growth factors (Fig. 1A), FGFR inhibitors did not attenuate TNFα-induced changes in Akt or JNK phosphorylation, while efficiently preventing these changes in response to zVAD.fmk (Fig. S4A). Furthermore, addition of TNFα led to comparable late activation of Akt p308 signal under both normal and serum free conditions (Fig. S4B, C), indicating that TNFα signaling to Akt Thr308 is growth factor-independent. In contrast, activation of JNK by TNFα followed different kinetics from zVAD.fmk-induced changes. TNFα treatment caused an early and robust increase in the phosphorylation of JNK and c-Jun. Nec-1 did not affect this early increase, however, it reduced levels of pJNK/Jun at the late, 9 hr time point (Fig. S4B, C). This again separated early RIP1-independent changes, which likely reflect the ability of additional upstream kinases, such as Ask1 to activate JNK [27], from the late RIP1 kinase-dependent necroptotic signaling. Late Increase in Akt Thr308 Phosphorylation Contributes to the Induction of Necroptotic Cell Death We next investigated if the delayed RIP1 kinase-dependent increase in Akt Thr308 phosphorylation functionally contributes to the execution of necroptotic cell death. Firstly, PDGF/zVAD.fmk, which cannot induce necroptosis (Fig. 2A), triggered only the initial, rapid Akt and JNK phosphorylation changes and not the delayed activation (Fig. 4A), indicating that late, rather than early Akt phosphorylation correlates with necroptosis. Secondly, we saw that the ability of the Akt inhibitor to protect cells from necroptosis rapidly declined after 6 hrs of stimulation with zVAD.fmk, TNFα or bFGF/zVAD.fmk and no protection was observed when the inhibitor was added at 9 hrs (Fig. 4B,C). This time frame coincides with the timing of the secondary Akt Thr308 phosphorylation. Finally, we terminated the bFGF signal one hour after addition of bFGF by the addition of PD173074. This allowed us to retain early Akt activation, but to suppress the secondary increase (Fig. 4D). Both pre-addition and delayed addition of PD173074 fully prevented necroptosis (Fig. 4E). Overall, these data, while correlative, indicate that early Akt activation is insufficient to promote necroptosis and are strongly supportive of an important role for the delayed activation of Akt in the induction of necroptotic cell death. 10.1371/journal.pone.0056576.g004 Figure 4 Late Thr308 phosphorylation of Akt contributes to necroptosis. (A) L929 cells were treated with zVAD.fmk and bFGF or PDGF, with or without Nec-1, for the indicated periods of time. (B,C) L929 cells were stimulated by zVAD.fmk or TNFα (B) or bFGF/zVAD.fmk under serum free conditions (C). Akt inh. VIII was added 15 min before necroptotic stimulation (Pre) or at indicated times after stimulation. Viability was measured 24 hr after activation of necroptosis. (D) L929 cells were stimulated with bFGF/zVAD under serum free conditions. PD173074 was added 15 min before or 1 hr after FGF/zVAD. Samples for western blot were collected at 15 min and 9 hr time points. (E) Cells were pretreated with PD173074 or it was added 1 hr after bFGF/zVAD.fmk, followed by viability assessment at 24 hr. In all graphs, average±SD was plotted. The Akt Signaling Pathway Contributes to the Regulation of Necroptosis We next determined whether the necroptosis-associated increase in Thr308 phosphorylation results in an increase in Akt kinase activity. Under necroptotic conditions, we observed an increase in the phosphorylation of multiple known Akt substrates (Forkhead box class O (FoxO) proteins, GSK-3 kinases and mouse double minute 2 (MDM2)) as well as downstream molecules (p70 ribosomal protein S6 Kinase (p70S6K), S6) (Fig. 5A). In some cases (FoxO1, FoxO4, MDM2), a robust increase was observed. In other cases (FoxO3a, GSK-3α/β, p70S6K and its substrate S6), the changes were less pronounced (Fig. 5A). The timing of the phosphorylation changes paralleled the increase in Akt phosphorylation (Fig. 5B, S5A, B). In the case of pFoxO1 we occasionally observed a shift in migration rather than an increase in band intensity (e.g. comparing Fig. 5A and B), suggesting that phosphorylation events in addition to Thr24 take place during necroptosis. Notably, in all cases the necroptosis-associated increases in Akt substrates were abrogated by Nec-1 (Fig. 5A, Fig. S5A, B). Overall, these data suggested that a significant part of the “canonical” Akt signaling network is activated at the onset of necroptotic cell death in a RIP1 dependent fashion. 10.1371/journal.pone.0056576.g005 Figure 5 mTORC1 contributes to the regulation of necroptosis. (A) L929 cells were treated with zVAD.fmk or TNFα for 9 hr and harvested for western blot. (B) Cell under serum free condition were treated with bFGF or bFGF/zVAD.fmk for the indicated amounts of time, followed by western blotting using the indicated antibodies. (C) Necroptosis was induced by zVAD.fmk or TNFα in L929 cell in the presence of inhibitors of Akt(Akt inh. VIII) and mTOR (rapamycin, Torin-1 and PI-103). (D) L929 cells with mTOR siRNA knockdown were harvested for western blot or treated with zVAD.fmk or TNFα for 24 hrs. Cell viability was determined 24 hr after activation of necroptosis. In all graphs, average±SD was plotted. Akt kinase is considered to be a pro-survival protein that inhibits apoptosis through the control of multiple effectors including mTORC1, GSK-3 and others [28]. An important question is whether these same molecules reverse their pro-survival roles during necroptosis. We found that inhibition of mTORC1 by rapamycin, an inhibitor of the mTOR co-factor Raptor [29], protected cells from necroptosis (Fig. 5C). Similarly, the direct mTOR kinase inhibitor Torin1 [30] and the dual PI3K/mTOR inhibitor PI-103 [31] also efficiently inhibited necroptosis (Fig. 5C). Knockdown of mTOR using siRNA further validated the small-molecule inhibitor data indicating a role for mTOR in necroptosis by protecting cells from both zVAD.fmk and TNFα induced death (Fig. 5D). mTORC1 regulates translation through activation of p70S6 kinase and, subsequently, ribosomal protein S6 [32]. Notably, a genome-wide siRNA screen [10] suggested an important role for protein translation in necroptosis. Consistently, we found that the small molecule inhibitor of p70S6K PF-4708671 [33] attenuated necroptosis at the concentrations required to block S6 phosphorylation (Fig. S5C, D). Partial siRNA knockdown of S6 protein attenuated necroptosis as well (Fig. S5E), suggesting that translational control by p70S6K/S6 may play a role in necroptosis. Overall, while the full repertoire of Akt targets during necroptosis remains to be fully explored, our data provide evidence that the activity of an anti-apoptotic branch of Akt signaling can promote necroptosis. RIP1 kinase, Akt, mTORC1 and JNK control the upregulation of TNFα accompanying necroptosis. Hitomi et al. [10] have recently reported that the induction of necroptosis by zVAD.fmk in L929 cells is associated with increased synthesis of TNFα, which potentiates cell death. Therefore, we examined whether Akt and its effectors contribute to TNFα synthesis. Consistent with a RIP1-dependent increase in TNFα protein (Fig. S6A, B), we found that TNFα mRNA levels increased during necroptosis in L929 cells in a RIP1 (Fig. S6C. Under serum free conditions, bFGF alone triggered some induction of TNFα mRNA, while its combination with zVAD.fmk (but not zVAD.fmk alone) caused a pronounced further increase (Fig. 6A). Conversely, PDGF caused a modest upregulation of TNFα mRNA, which was not further increased in the presence of zVAD.fmk (Fig. 6A), demonstrating that activation of necroptosis is specifically accompanied by a marked increase in autocrine TNFα synthesis. 10.1371/journal.pone.0056576.g006 Figure 6 Akt and mTORC1 control autocrine TNFα synthesis and JNK activation during necroptosis. (A) Cells were treated under serum free conditions with bFGF or PDGF with or without zVAD.fmk for 9 hr, followed by qRT-PCR analysis of mTNFα. Data was normalized to mouse 18S RNA. (B) Necroptosis was induced by zVAD.fmk or TNFα in cells treated with Nec-1, rapamycin (rapa), or Akt inh. VIII inh. followed by qRT-PCR analysis of TNFα mRNA levels. (C-F) L929 cells with siRNA knockdown of Akt isoforms (C,E) or mTOR (D,F) were stimulated with zVAD.fmk or TNFα for 9 hr, followed by qRT-PCR analysis of mTNFα (C,D) or western blot (E,F). In all graphs, average±SD was plotted. Further analysis suggested that both Akt and mTORC1 contribute to the upregulation of TNFα mRNA during necroptosis as both small-molecule inhibition and siRNA knockdown of Akt and mTOR reduced TNFα mRNA levels in necroptotic cells (Fig. 6B,C,D). Notably, RIP1 and Akt inhibitors had no effect on the levels of TNFα mRNA in control cells or in the cells stimulated with bFGF alone (Fig. 6A,B, Fig. S6C), suggesting that these kinases specifically mediate necroptosis-dependent increase in TNFα synthesis. Akt and mTORC1 Control the Activation of JNK during Necroptosis JNK is a well-established regulator of TNFα synthesis in a variety of systems [13], [14], [15], [34]. Therefore, the ability of Akt and mTORC1 inhibitors to block the increase in TNFα mRNA lead us to examine their role in the activation of JNK during necroptosis. Knockdown of Akt isoforms Akt1 and Akt2 or inhibition of Akt prominently suppressed the necroptosis dependent increase in JNK and c-Jun phosphorylation (Fig. 6E, S6D,E) suggesting that Akt may provide a link between RIP1 and JNK activation. Importantly, inhibition of Akt only inhibited the delayed, but not the early, increase in bFGF/zVAD.fmk induced JNK and c-Jun phosphorylation (Fig. S6F). Knockdown of mTOR, rapamycin and the p70S6K inhibitor PF-4708671 also attenuated the necroptosis-associated increase in JNK and c-Jun phosphorylation (Fig. 6F, S6E,G, Fig. S5D). Overall, these data suggested that the Akt-mTORC1-S6K axis, acting downstream from RIP1 kinase, is required for the increase in JNK activity during necroptosis in L929 cells. PI3-kinase and PDK1 Mediate the Increase in Akt Thr308 Phosphorylation Under Necroptotic Conditions Typical regulation of Akt by growth factors involves its recruitment to the plasma membrane, which is mediated by the binding of the pleckstrin homology (PH) domain of Akt to the product of PI3K, phosphatidylinositol-3,4,5-triphosphate (PIP3). In the membrane, Akt is phosphorylated on Thr308 and Ser473 by 3-phosphoinositide dependent protein kinase-1 (PDK1) and mTORC2 (or DNA-PK), respectively [35]. Since our results showed that only Thr308 Akt phosphorylation is increased during necroptosis, we next examined whether it is still dependent on PI3K and PDK1. Inhibition of PI3K and PDK1 using the specific inhibitors LY249002 and BX912 [36] resulted in the efficient inhibition of cell death and Akt Thr308 phosphorylation (Fig. S7A–D). Likewise, siRNA knockdown of PDK1 protected cells from death and inhibited Akt Thr308 phosphorylation (Fig. S7E,F) Therefore, PI3K and PDK1 activity is still required for non-canonical Akt activation during necroptosis. Expression of Constitutively Active Akt, Rescues Necroptosis Under Serum Free Conditions We used L929 cells stably expressing constitutively active wild type Akt1 (Myr-Akt) or the catalytically inactive mutant K179M in order to further understand the contribution of growth factors and RIP1 kinase to Akt activation during necroptosis. Constitutively active Akt1 (Myr-Akt) was generated as previously described [37] by the addition of a myristoylation signal which provides constitutive localization to the plasma membrane and by the deletion of the auto-inhibitory PH domain (Fig. 7A) resulting in an Akt that is active under serum free. It is important to note that the cells expressing Myr-Akt were viable, grew in a manner indistinguishable from the empty vector control cells, and were not triggered to induce necroptosis by serum starvation (Fig. 7B). This indicates that active Akt alone is not sufficient to induce necroptotic cell death. Under serum free conditions Myr-Akt, but not the K179M mutant, fully restored zVAD.fmk-induced necroptosis (Fig. 7A,B). Nec-1 prevented both Myr-Akt dependent cell death and the necroptosis-specific delayed increase in Akt Thr308 phosphorylation (Fig. 7B,C). Myr-Akt also allowed other zVAD.fmk-dependent events, including activation of JNK and c-Jun phosphorylation (Fig. 7C) and upregulation of TNFα mRNA (Fig. 7D) to occur under serum free conditions, confirming an important role for Akt at the apex of necroptotic signaling. These data demonstrated that the presence of active and membrane localized Akt is sufficient to uncouple Akt activation during necroptosis from growth factor signaling. RIP1 kinase was still able to regulate Akt activation during necroptosis, suggesting that growth factors and RIP1 kinase provide two independent inputs required for Akt changes during necroptosis. 10.1371/journal.pone.0056576.g007 Figure 7 Over expression of constitutively active Akt restores necroptosis under serum free conditions. (A,B) L929 cells were stably infected with empty MSCV retrovirus or viruses encoding Myr-Akt or the catalytically inactive Myr-Akt K179M. Necroptosis was induced by the addition of zVAD.fmk under serum free conditions (A) or serum or serum free conditions with Nec-1 (B). Viability assays were performed after 24 hr. (C) Myr-Akt and Myr-Akt K179M cells were treated with zVAD.fmk and/or Nec-1 under serum free conditions for 9 hr, followed by western blot using the indicated antibodies. Endogenous Akt (∼) and Myr-Akt () bands are indicated. (D) L929 cells, stably infected with Myr-Akt and Myr-Akt K179KM, were stimulated with zVAD.fmk for 9 hr under serum free conditions. TNFα mRNA levels were determined by qRT-PCR and normalized using mouse 18S RNA. (E-G) L929 cells expressing Myr-Akt and Ala and Asp mutants of Thr308 and Ser473 were treated with zVAD.fmk under serum free conditions, followed by viability assay at 24 hr (E), western blot at 9 hr (F), or evaluation of TNFα mRNA levels by qRT-PCR at 9 hrs (G). In all graphs, average±SD was plotted. RIP1 kinase-dependent Thr308 phosphorylation of Myr-Akt during necroptosis increased Myr-Akt activity as it did"
R10243	T15758	T15746	themeOf	Akt activation,to regulate Akt activation during necroptosis
R12061	T18035	T18095	causeOf	RIP1,of RIP1 kinase-dependent signaling
R12062	T18038	T18103	causeOf	kinase-dependent,of RIP1 kinase-dependent signaling
R12063	T18039	T18096	themeOf	protein,Fas-associated protein with death domain (FADD)
R12064	T18043	T18107	themeOf	endogenous Akt1,fibroblasts expressing endogenous Akt1 or Akt2
R12065	T18051	T18099	locationOf	Cell,Other Cell Types
R12066	T18055	T18039	partOf	with death domain (FADD),protein
R12067	T18055	T18096	siteOf	with death domain (FADD),Fas-associated protein with death domain (FADD)
R12068	T18056	T18099	themeOf	Other Cell Types,Other Cell Types
R12069	T18057	T18104	causeOf	RIP1,a RIP1 kinase dependent increase in the phosphorylation of Thr308 on Akt
R12070	T18060	T18108	themeOf	Akt2,fibroblasts expressing endogenous Akt1 or Akt2
R12071	T18064	T18098	themeOf	TNFα,TNFα Production in Other Cell Types
R12072	T18066	T18100	causeOf	Akt,Akt Controls TNFα Production in Other Cell Types
R12073	T18068	T18097	causeOf	Akt-mediated,Akt-mediated inflammatory signaling under necroptotic conditions
R12074	T18069	T18106	causeOf	kinase dependent,a RIP1 kinase dependent increase in the phosphorylation of Thr308 on Akt
R12075	T18081	T18102	themeOf	robust RIP1-dependent TNFα mRNA,robust RIP1-dependent TNFα mRNA upregulation
R12076	T18082	T18096	themeOf	Fas,Fas-associated protein with death domain (FADD)
R12077	T18090	T18105	themeOf	of Akt,inhibition of Akt
R12078	T18091	T18101	themeOf	TNFα mRNA,TNFα mRNA production
R12079	T18095	T18103	themeOf	of RIP1 kinase-dependent signaling,of RIP1 kinase-dependent signaling
R12080	T18098	T18100	themeOf	TNFα Production in Other Cell Types,Akt Controls TNFα Production in Other Cell Types
R12081	T18104	T18106	themeOf	a RIP1 kinase dependent increase in the phosphorylation of Thr308 on Akt,a RIP1 kinase dependent increase in the phosphorylation of Thr308 on Akt
R13122	T19774	T19898	themeOf	of Akt,necroptotic activation of Akt
R13123	T19776	T19890	themeOf	Akt,selective necroptotic phosphorylation of Thr308 of Akt
R13124	T19781	T19886	themeOf	caspase,caspase inhibition
R13125	T19784	T19897	themeOf	of Akt,Thr308 phosphorylation of Akt
R13126	T19786	T19888	themeOf	of Akt,necroptosis-associated phosphorylation of Akt
R13127	T19787	T19892	themeOf	TNFα,TNFα production
R13128	T19790	T19900	themeOf	the p110δ subunit of PI3K [41],inhibitor that may inhibit the p110δ subunit of PI3K [41] and PDK1 [42]
R13129	T19791	T19899	causeOf	on c-Jun,"autocrine TNFα production, dependent on c-Jun,"
R13130	T19806	T19895	themeOf	of Akt,the delayed activation of Akt
R13131	T19810	T19884	themeOf	JNK,JNK activation
R13132	T19821	T19896	themeOf	of Akt,phosphorylation of Akt
R13133	T19824	T19887	themeOf	JNK,JNK inhibition
R13134	T19831	T19776	partOf	of Thr308 of Akt,Akt
R13135	T19831	T19890	siteOf	of Thr308 of Akt,selective necroptotic phosphorylation of Thr308 of Akt
R13136	T19835	T19784	partOf	Thr308,of Akt
R13137	T19835	T19897	siteOf	Thr308,Thr308 phosphorylation of Akt
R13138	T19837	T19894	themeOf	of c-Jun,the phosphorylation of c-Jun at Ser63
R13139	T19844	T19883	themeOf	Akt,"basal Akt phosphorylation levels,"
R13140	T19847	T19837	partOf	Ser63,of c-Jun
R13141	T19847	T19894	siteOf	Ser63,the phosphorylation of c-Jun at Ser63
R13142	T19850	T19880	themeOf	TNFα,TNFα production
R13143	T19854	T19901	themeOf	PDK1 [42],inhibitor that may inhibit the p110δ subunit of PI3K [41] and PDK1 [42]
R13144	T19860	T19889	themeOf	Akt,we examined Akt phosphorylation after inhibition of a downstream
R13145	T19861	T19881	themeOf	of Myr-Akt,expression of Myr-Akt
R13146	T19864	T19891	themeOf	TNFα,"autocrine TNFα production, dependent on c-Jun,"
R13147	T19872	T19885	themeOf	of c-Jun,phosphorylation of c-Jun
R13148	T19878	T19900	causeOf	inhibitor that may inhibit the p110δ subunit of PI3K [41] and PDK1 [42],inhibitor that may inhibit the p110δ subunit of PI3K [41] and PDK1 [42]
R13149	T19878	T19901	causeOf	inhibitor that may inhibit the p110δ subunit of PI3K [41] and PDK1 [42],inhibitor that may inhibit the p110δ subunit of PI3K [41] and PDK1 [42]
R13150	T19891	T19899	themeOf	"autocrine TNFα production, dependent on c-Jun,","autocrine TNFα production, dependent on c-Jun,"
R13151	T19892	T19893	themeOf	TNFα production,which protected L929 cells from death and inhibited TNFα production
R13152	T19895	T19882	themeOf	the delayed activation of Akt,the delayed activation of Akt
R15643	T23476	T23639	themeOf	Akt,Necroptotic phosphorylation of Thr308 of Akt
R15644	T23477	T23654	themeOf	of TNFα,This increased production of TNFα during necroptosis
R15645	T23486	T23476	partOf	of Thr308 of Akt,Akt
R15646	T23486	T23639	siteOf	of Thr308 of Akt,Necroptotic phosphorylation of Thr308 of Akt
R15647	T23494	T23637	themeOf	JNK,JNK activation
R15648	T23498	T23640	themeOf	of Akt,necrosis-specific regulation of Akt
R15649	T23506	T23645	themeOf	Akt,in Akt Thr308 phosphorylation
R15650	T23511	T23630	themeOf	Akt,Akt activation
R15651	T23518	T23644	themeOf	of JNK,the activation of JNK
R15652	T23519	T23647	themeOf	to JNK,connecting mTORC1 to JNK
R15653	T23522	T23643	themeOf	of Myr-Akt,expression of Myr-Akt
R15654	T23523	T23653	locationOf	epithelial cells,caspase-8 in epithelial cells
R15655	T23527	T23649	locationOf	"cell fates alternative to apoptosis, ranging from survival to non-apoptotic cell death","cell fates alternative to apoptosis, ranging from survival to non-apoptotic cell death"
R15656	T23530	T23629	themeOf	of Akt,to assume that activation of Akt
R15657	T23533	T23647	themeOf	mTORC1,connecting mTORC1 to JNK
R15658	T23535	T23642	themeOf	of Akt,"Thr308 phosphorylation of Akt,"
R15659	T23541	T23625	themeOf	of Akt,phosphorylation of Akt
R15660	T23542	T23652	themeOf	of JNK,of mTORC1-dependent regulation of JNK
R15661	T23543	T23641	causeOf	by recombinant RIP1 kinase,"Interestingly, we observed phosphorylation of Akt by recombinant RIP1 kinase in vitro on Thr146, 195/197, and 435"
R15662	T23544	T23506	partOf	Akt Thr308,Akt
R15663	T23544	T23645	siteOf	Akt Thr308,in Akt Thr308 phosphorylation
R15664	T23550	T23651	themeOf	of mTOR [48],activation of mTOR [48]
R15665	T23551	T23535	partOf	Thr308,of Akt
R15666	T23551	T23642	siteOf	Thr308,"Thr308 phosphorylation of Akt,"
R15667	T23555	T23628	causeOf	kinase,that RIP1 kinase inhibits a phosphatase that targets Thr308
R15668	T23562	T23653	themeOf	caspase-8 in epithelial cells,caspase-8 in epithelial cells
R15669	T23573	T23633	causeOf	RIP1-dependent,the RIP1-dependent increase in Akt Thr308 phosphorylation
R15670	T23576	T23641	themeOf	of Akt,"Interestingly, we observed phosphorylation of Akt by recombinant RIP1 kinase in vitro on Thr146, 195/197, and 435"
R15671	T23577	T23628	themeOf	that RIP1 kinase inhibits a phosphatase that targets Thr308,that RIP1 kinase inhibits a phosphatase that targets Thr308
R15672	T23587	T23650	themeOf	the only enzyme established to specifically dephosphorylate this residue [45],the only enzyme established to specifically dephosphorylate this residue [45]
R15673	T23591	T23646	causeOf	RIP1 kinase,RIP1 kinase signaling
R15674	T23600	T23631	themeOf	of TNFα,the production of TNFα
R15675	T23603	T23636	causeOf	Akt,"Akt signaling contributed more prominently to an increase in TNFα synthesis, rather than cell death"
R15676	T23608	T23648	themeOf	"cell fates alternative to apoptosis, ranging from survival to non-apoptotic cell death","promote cell fates alternative to apoptosis, ranging from survival to non-apoptotic cell death"
R15677	T23608	T23649	themeOf	"cell fates alternative to apoptosis, ranging from survival to non-apoptotic cell death","cell fates alternative to apoptosis, ranging from survival to non-apoptotic cell death"
R15678	T23609	T23635	themeOf	of TNFα,the translation of TNFα
R15679	T23626	T23633	themeOf	the RIP1-dependent increase in Akt Thr308 phosphorylation,the RIP1-dependent increase in Akt Thr308 phosphorylation
R15680	T23631	T23638	themeOf	the production of TNFα,mediating the production of TNFα
R15681	T23632	T23634	themeOf	a selective increase in Akt phosphorylation on Thr308,promoting a selective increase in Akt phosphorylation on Thr308
R15682	T23645	T23626	themeOf	in Akt Thr308 phosphorylation,the RIP1-dependent increase in Akt Thr308 phosphorylation
R15683	T23654	T23627	themeOf	This increased production of TNFα during necroptosis,This increased production of TNFα during necroptosis
R17464	T25562	T25569	themeOf	Pan-caspase inhibitor zVAD.fmk (20–30 µM),Pan-caspase inhibitor zVAD.fmk (20–30 µM) was purchased from Bachem
R19285	T27871	T27877	themeOf	of Myr-Akt1,Stable Infection of Myr-Akt1
R1953	T2733	T2795	themeOf	"to autocrine TNFα synthesis, activation of oxidative stress and induction of autophagy,","Activation of JNK in L929 cells has been linked to autocrine TNFα synthesis, activation of oxidative stress and induction of autophagy,"
R1955	T2735	T2803	themeOf	Akt,that Akt is activated through RIP1 kinase-dependent Thr308 phosphorylation during necroptosis in multiple cell types
R1959	T2746	T2800	themeOf	TNFα,TNFα production
R1962	T2750	T2796	themeOf	of JNK,Activation of JNK in L929 cells
R1964	T2752	T2808	themeOf	JNK,JNK activation in L929 cells
R1969	T2763	T2806	causeOf	insulin-dependent,insulin-dependent Akt activity
R1971	T2766	T2797	themeOf	TNFα,TNFα production
R1973	T2769	T2802	themeOf	TNFα,TNFα production
R1976	T2773	T2804	causeOf	kinase-dependent,RIP1 kinase-dependent Thr308 phosphorylation during necroptosis in multiple cell types
R1978	T2777	T2801	themeOf	Akt,Akt activation
R1982	T2807	T2798	themeOf	insulin-dependent activation of Akt,insulin-dependent activation of Akt
R1983	T2785	T2799	themeOf	JNK kinase,JNK kinase activation
R1984	T2787	T2794	causeOf	Akt,we found that downstream Akt signaling
R1985	T2788	T2807	themeOf	of Akt,insulin-dependent activation of Akt
R1986	T2790	T2798	causeOf	insulin-dependent,insulin-dependent activation of Akt
R20359	T29355	T29370	themeOf	Akt,Akt expression levels
R20582	T29705	T29719	themeOf	JNK,RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis
R20583	T29706	T29720	themeOf	Akt,RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis
R20584	T29707	T29719	causeOf	RIP1,RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis
R20585	T29707	T29720	causeOf	RIP1,RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis
R20586	T29709	T29717	causeOf	kinase-dependent,RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis
R20587	T29709	T29718	causeOf	kinase-dependent,RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis
R20588	T29719	T29717	themeOf	RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis,RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis
R20589	T29720	T29718	themeOf	RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis,RIP1 kinase-dependent phosphorylation of Akt and JNK during necroptosis
R20932	T30199	T30203	themeOf	of Akt,phosphorylation of Akt
R21540	T31121	T31152	themeOf	JNK,JNK activation during necroptosis
R22250	T32255	T32266	themeOf	Akt2,fibroblasts expressing only endogenous Akt1 or Akt2
R22251	T32258	T32267	themeOf	only endogenous Akt1,fibroblasts expressing only endogenous Akt1 or Akt2
R22252	T32263	T32265	themeOf	TNFα,autocrine TNFα production in multiple cell types
R22423	T32552	T32568	causeOf	JNK,JNK dependent signaling
R22424	T32559	T32560	partOf	Thr308,Akt
R22425	T32559	T32571	siteOf	Thr308,Akt phosphorylation at Thr308 during necroptosis
R22426	T32560	T32571	themeOf	Akt,Akt phosphorylation at Thr308 during necroptosis
R22427	T32564	T32569	themeOf	of Akt,Activation of Akt during necroptosis
R22428	T32566	T32572	themeOf	"of several known Akt substrates, such as mTOR","the phosphorylation of several known Akt substrates, such as mTOR"
R22429	T32571	T32570	themeOf	Akt phosphorylation at Thr308 during necroptosis,Akt phosphorylation at Thr308 during necroptosis requires inputs from both growth factors and RIP1 kinase
R3458	T4918	T4984	themeOf	Basic Fibroblast Growth Factor,Basic Fibroblast Growth Factor
R3461	T4922	T4987	causeOf	bFGF,of bFGF signaling
R3463	T4926	T4988	causeOf	growth factor,of growth factor signaling
R3466	T4931	T4991	themeOf	RIP1 kinase,which cleaves and inactivates RIP1 kinase and the RIP1 deubiquitinase
R3476	T4952	T4983	causeOf	growth factor,growth factor signaling
R3486	T4967	T4990	themeOf	the RIP1 deubiquitinase,which cleaves and inactivates RIP1 kinase and the RIP1 deubiquitinase
R3488	T4968	T4986	themeOf	"CYLD [21], [22],","CYLD [21], [22], is removed in L929 cells"
R3492	T4976	T4984	locationOf	Fibroblast,Basic Fibroblast Growth Factor
R3495	T4987	T4989	themeOf	of bFGF signaling,"We used two bFGF receptor tyrosine kinase inhibitors (PD173074 and PD166866), and determined that inhibition of bFGF signaling"
R429	T729	T757	themeOf	Akt,"During necroptosis, Akt is activated in a RIP1 dependent fashion through its phosphorylation on Thr308"
R430	T729	T758	themeOf	Akt,"During necroptosis, Akt is activated in a RIP1 dependent fashion through its phosphorylation on Thr308"
R431	T734	T764	themeOf	TNFα,TNFα production
R432	T737	T729	partOf	on Thr308,Akt
R433	T737	T758	siteOf	on Thr308,"During necroptosis, Akt is activated in a RIP1 dependent fashion through its phosphorylation on Thr308"
R434	T740	T762	themeOf	JNK,JNK activation
R435	T741	T765	themeOf	RIP1 Kinase,RIP1 Kinase Activation during Necroptosis
R436	T747	T759	themeOf	TNFα,necroptosis-associated TNFα production
R437	T751	T763	themeOf	mTORC1,"mTORC1, links RIP1 to JNK activation and autocrine production of TNFα"
R438	T752	T763	themeOf	RIP1,"mTORC1, links RIP1 to JNK activation and autocrine production of TNFα"
R439	T756	T761	themeOf	of TNFα,autocrine production of TNFα
R4700	T7147	T7189	partOf	"of Akt Thr308,",Akt
R4701	T7147	T7308	siteOf	"of Akt Thr308,","the phosphorylation of Akt Thr308, JNK and Jun are late"
R4704	T7156	T7303	themeOf	Thr308 Akt,in Thr308 Akt phosphorylation
R4706	T7162	T7306	themeOf	JNK,the activation of Akt and JNK
R4707	T7164	T7295	causeOf	RIP1-dependent,a robust delayed necroptosis-specific RIP1-dependent increase in Akt Thr308 phosphorylation
R4709	T7165	T7287	themeOf	JNK,JNK phosphorylation
R4714	T7174	T7285	themeOf	JNK,the delayed activation of Akt and JNK
R4719	T7175	T7156	partOf	Thr308,Thr308 Akt
R4720	T7175	T7303	siteOf	Thr308,in Thr308 Akt phosphorylation
R4721	T7176	T7279	themeOf	of Akt3,No expression of Akt3 was seen in L929 cells (Fig. S2C)
R4727	T7189	T7308	themeOf	Akt,"the phosphorylation of Akt Thr308, JNK and Jun are late"
R4728	T7190	T7305	themeOf	Akt,the activation of Akt and JNK
R4732	T7204	T7294	themeOf	of Akt,Activation of Akt
R4733	T7205	T7288	themeOf	Akt,in Akt Thr308 phosphorylation
R4738	T7216	T7292	themeOf	JNK,of JNK phosphorylation
R4740	T7218	T7297	themeOf	JNK,These data indicate that both Akt and JNK are activated under necroptotic conditions
R4741	T7219	T7296	themeOf	JNK,JNK phosphorylation
R4743	T7224	T7282	themeOf	of two other MAPKs,inhibition of two other MAPKs
R4746	T7227	T7284	themeOf	Akt,the delayed activation of Akt and JNK
R4749	T7236	T7205	partOf	Akt Thr308,Akt
R4750	T7236	T7288	siteOf	Akt Thr308,in Akt Thr308 phosphorylation
R4753	T7240	T7286	themeOf	Akt,in Akt phosphorylation
R4754	T7241	T7298	themeOf	Akt,These data indicate that both Akt and JNK are activated under necroptotic conditions
R4755	T7243	T7309	themeOf	JNK,"JNK phosphorylation,"
R4759	T7253	T7307	causeOf	Nec-1,"Nec-1, completely prevented the increase in Thr308 Akt phosphorylation,"
R4760	T7254	T7304	themeOf	of Akt,necroptotic regulation of Akt
R4763	T7265	T7302	themeOf	receptor,activated following growth factor receptor activation
R4766	T7268	T7293	themeOf	of Akt,Inhibition of Akt (Akt inhibitor VIII)
R4768	T7271	T7291	themeOf	of Akt,Inhibition of Akt
R4770	T7280	T7290	themeOf	"a delayed increase in Thr308 phosphorylation on Akt,","a delayed increase in Thr308 phosphorylation on Akt,"
R4771	T7276	T7281	themeOf	TNFα,TNFα stimulation
R4772	T7284	T7277	themeOf	the delayed activation of Akt and JNK,the delayed activation of Akt and JNK
R4773	T7285	T7278	themeOf	the delayed activation of Akt and JNK,the delayed activation of Akt and JNK
R4774	T7286	T7299	themeOf	in Akt phosphorylation,Following stimulation with either zVAD.fmk or TNFα we observed a robust increase in Akt phosphorylation
R4775	T7288	T7300	themeOf	in Akt Thr308 phosphorylation,which also showed a robust delayed necroptosis-specific RIP1-dependent increase in Akt Thr308 phosphorylation
R4776	T7300	T7283	themeOf	which also showed a robust delayed necroptosis-specific RIP1-dependent increase in Akt Thr308 phosphorylation,a robust delayed necroptosis-specific RIP1-dependent increase in Akt Thr308 phosphorylation
R4777	T7300	T7295	themeOf	which also showed a robust delayed necroptosis-specific RIP1-dependent increase in Akt Thr308 phosphorylation,a robust delayed necroptosis-specific RIP1-dependent increase in Akt Thr308 phosphorylation
R4778	T7301	T7307	themeOf	"the increase in Thr308 Akt phosphorylation,","Nec-1, completely prevented the increase in Thr308 Akt phosphorylation,"
R4779	T7303	T7301	themeOf	in Thr308 Akt phosphorylation,"the increase in Thr308 Akt phosphorylation,"
R5232	T8032	T8042	partOf	Thr308,Delayed Akt Thr308 Phosphorylation
R5233	T8032	T8075	siteOf	Thr308,Delayed Akt Thr308 Phosphorylation
R5234	T8033	T8073	causeOf	FGFR inhibitors,FGFR inhibitors did not attenuate TNFα-induced changes in Akt or JNK phosphorylation
R5235	T8036	T8065	causeOf	TNFα,TNFα signaling
R5236	T8038	T8066	themeOf	of JNK,in the phosphorylation of JNK
R5237	T8042	T8075	themeOf	Delayed Akt Thr308 Phosphorylation,Delayed Akt Thr308 Phosphorylation
R5238	T8044	T8072	causeOf	kinase-dependent,RIP1 kinase-dependent necroptotic signaling
R5239	T8047	T8069	themeOf	of JNK,activation of JNK by TNFα
R5240	T8049	T8067	themeOf	of Akt,activation of Akt
R5241	T8051	T8074	causeOf	RIP1,RIP1 kinase-dependent necroptotic signaling
R5242	T8052	T8070	themeOf	JNK,to activate JNK
R5243	T8053	T8068	themeOf	JNK,JNK phosphorylation
R5244	T8057	T8077	themeOf	TNFα,TNFα treatment caused
R5245	T8059	T8069	causeOf	by TNFα,activation of JNK by TNFα
R5246	T8061	T8071	themeOf	Growth Factor,of Growth Factor Stimulation
R5247	T8062	T8076	causeOf	growth factor-independent,TNFα signaling to Akt Thr308 is growth factor-independent
R5248	T8065	T8076	themeOf	TNFα signaling,TNFα signaling to Akt Thr308 is growth factor-independent
R5249	T8066	T8063	themeOf	in the phosphorylation of JNK,robust increase in the phosphorylation of JNK
R5250	T8074	T8072	themeOf	RIP1 kinase-dependent necroptotic signaling,RIP1 kinase-dependent necroptotic signaling
R5251	T8075	T8064	themeOf	Delayed Akt Thr308 Phosphorylation,Delayed Akt Thr308 Phosphorylation
R5781	T8793	T8827	themeOf	Akt,in Akt Thr308 Phosphorylation
R5782	T8794	T8830	causeOf	RIP1 kinase-dependent,the delayed RIP1 kinase-dependent increase in Akt Thr308 phosphorylation
R5783	T8796	T8823	themeOf	JNK,JNK phosphorylation changes
R5784	T8797	T8802	partOf	Akt Thr308,Akt
R5785	T8797	T8831	siteOf	Akt Thr308,in Akt Thr308 phosphorylation
R5786	T8798	T8793	partOf	Akt Thr308,Akt
R5787	T8798	T8827	siteOf	Akt Thr308,in Akt Thr308 Phosphorylation
R5788	T8802	T8831	themeOf	Akt,in Akt Thr308 phosphorylation
R5789	T8805	T8832	themeOf	Akt,Akt activation
R5790	T8809	T8829	themeOf	of Akt,the delayed activation of Akt in the induction of necroptotic cell death
R5791	T8810	T8814	partOf	the secondary Akt Thr308,Akt
R5792	T8810	T8828	siteOf	the secondary Akt Thr308,the secondary Akt Thr308 phosphorylation
R5793	T8814	T8828	themeOf	Akt,the secondary Akt Thr308 phosphorylation
R5794	T8816	T8826	themeOf	Akt,Akt activation
R5795	T8825	T8822	themeOf	the delayed RIP1 kinase-dependent increase in Akt Thr308 phosphorylation,the delayed RIP1 kinase-dependent increase in Akt Thr308 phosphorylation
R5796	T8825	T8830	themeOf	the delayed RIP1 kinase-dependent increase in Akt Thr308 phosphorylation,the delayed RIP1 kinase-dependent increase in Akt Thr308 phosphorylation
R5797	T8829	T8833	themeOf	the delayed activation of Akt in the induction of necroptotic cell death,the delayed activation of Akt in the induction of necroptotic cell death
R5798	T8831	T8825	themeOf	in Akt Thr308 phosphorylation,the delayed RIP1 kinase-dependent increase in Akt Thr308 phosphorylation
R6962	T10804	T10927	causeOf	Akt,of Akt signaling
R6963	T10818	T10925	themeOf	"of TNFα mRNA,","a modest upregulation of TNFα mRNA,"
R6964	T10823	T10931	themeOf	S6,S6 phosphorylation
R6965	T10826	T10933	themeOf	of TNFα accompanying necroptosis,the upregulation of TNFα accompanying necroptosis
R6966	T10842	T10934	themeOf	of TNFα mRNA,the upregulation of TNFα mRNA during necroptosis
R6967	T10850	T10930	causeOf	RIP1-dependent,with a RIP1-dependent increase in TNFα protein
R6968	T10859	T10922	themeOf	of TNFα mRNA,some induction of TNFα mRNA
R6969	T10859	T10923	themeOf	of TNFα mRNA,some induction of TNFα mRNA
R6970	T10875	T10924	causeOf	TORC1,TORC1 regulates translation through activation of p70S6 kinase
R6971	T10885	T10938	causeOf	these kinases,that these kinases specifically mediate necroptosis-dependent increase in TNFα synthesis
R6972	T10899	T10926	themeOf	Akt,"Akt phosphorylation (Fig. 5B,"
R6973	T10903	T10937	themeOf	protein,protein translation in necroptosis
R6974	T10905	T10929	themeOf	of p70S6 kinase,activation of p70S6 kinase
R6975	T10915	T10939	themeOf	Akt kinase,in an increase in Akt kinase activity
R6976	T10931	T10935	themeOf	S6 phosphorylation,block S6 phosphorylation
R8381	T12625	T12667	themeOf	of Akt,inhibition of Akt
R8382	T12627	T12662	themeOf	c-Jun,c-Jun phosphorylation
R8383	T12628	T12663	themeOf	c-Jun,c-Jun phosphorylation
R8384	T12632	T12664	themeOf	c-Jun,c-Jun phosphorylation
R8385	T12634	T12665	themeOf	JNK,the increase in JNK activity during necroptosis in L929 cells
R8386	T12640	T12670	themeOf	of Akt,inhibition of Akt
R8387	T12641	T12661	themeOf	of JNK,the Activation of JNK during Necroptosis
R8388	T12642	T12669	themeOf	JNK,JNK activation
R8389	T12648	T12668	themeOf	of JNK,the activation of JNK during necroptosis
R8868	T13360	T13401	themeOf	Akt,non-canonical Akt activation during necroptosis
R8869	T13361	T13373	partOf	Thr308,Akt
R8870	T13361	T13398	siteOf	Thr308,Akt is phosphorylated on Thr308 and Ser473 by 3-phosphoinositide dependent protein kinase-1 (PDK1)
R8871	T13370	T13399	themeOf	Thr308 Akt,Thr308 Akt phosphorylation
R8872	T13372	T13396	causeOf	PI3-kinase,PI3-kinase and PDK1 Mediate the Increase in Akt Thr308 Phosphorylation Under
R8873	T13373	T13398	themeOf	Akt,Akt is phosphorylated on Thr308 and Ser473 by 3-phosphoinositide dependent protein kinase-1 (PDK1)
R8874	T13374	T13395	themeOf	Akt,inhibited Akt Thr308 phosphorylation
R8875	T13376	T13400	themeOf	Akt,Akt Thr308 phosphorylation
R8876	T13379	T13398	causeOf	by 3-phosphoinositide dependent protein kinase-1 (PDK1),Akt is phosphorylated on Thr308 and Ser473 by 3-phosphoinositide dependent protein kinase-1 (PDK1)
R8877	T13382	T13403	themeOf	PI3K,Inhibition of PI3K and PDK1
R8878	T13385	T13373	partOf	Ser473,Akt
R8879	T13385	T13398	siteOf	Ser473,Akt is phosphorylated on Thr308 and Ser473 by 3-phosphoinositide dependent protein kinase-1 (PDK1)
R8880	T13388	T13376	partOf	Akt Thr308,Akt
R8881	T13388	T13400	siteOf	Akt Thr308,Akt Thr308 phosphorylation
R8882	T13390	T13374	partOf	Akt Thr308,Akt
R8883	T13390	T13395	siteOf	Akt Thr308,inhibited Akt Thr308 phosphorylation
R8884	T13391	T13397	causeOf	PDK1,PI3-kinase and PDK1 Mediate the Increase in Akt Thr308 Phosphorylation Under
R8885	T13392	T13402	themeOf	PDK1,Inhibition of PI3K and PDK1
R8886	T13393	T13370	partOf	Thr308,Thr308 Akt
R8887	T13393	T13399	siteOf	Thr308,Thr308 Akt phosphorylation
R8888	T13395	T13394	themeOf	inhibited Akt Thr308 phosphorylation,inhibited Akt Thr308 phosphorylation

PMC:3585731 JSONTXT 30 Projects

Annnotations TAB TSV DIC JSON TextAE

PMC:3585731 JSON TXT 30 Projects