Id |
Subject |
Object |
Predicate |
Lexical cue |
T58 |
0-5 |
NNP |
denotes |
M-CSF |
T59 |
6-13 |
NNP |
denotes |
Induces |
T60 |
14-22 |
NNP |
denotes |
Monocyte |
T61 |
23-31 |
NNP |
denotes |
Survival |
T62 |
32-34 |
IN |
denotes |
by |
T63 |
35-45 |
NNP |
denotes |
Activating |
T64 |
46-51 |
NNP |
denotes |
NF-κB |
T14519 |
46-51 |
JJ |
denotes |
NF-κB |
T65 |
52-55 |
CD |
denotes |
p65 |
T66 |
56-71 |
NNP |
denotes |
Phosphorylation |
T67 |
72-74 |
IN |
denotes |
at |
T68 |
75-81 |
NNP |
denotes |
Ser276 |
T69 |
82-85 |
IN |
denotes |
via |
T70 |
86-93 |
NNP |
denotes |
Protein |
T71 |
94-100 |
NNP |
denotes |
Kinase |
T72 |
101-102 |
NNP |
denotes |
C |
T73 |
134-144 |
NNP |
denotes |
Macrophage |
T74 |
145-163 |
JJ |
denotes |
colony-stimulating |
T75 |
164-170 |
NN |
denotes |
factor |
T76 |
171-172 |
-LRB- |
denotes |
( |
T77 |
172-177 |
NNP |
denotes |
M-CSF |
T78 |
177-178 |
-RRB- |
denotes |
) |
T79 |
179-187 |
VBZ |
denotes |
promotes |
T80 |
188-199 |
JJ |
denotes |
mononuclear |
T81 |
200-209 |
JJ |
denotes |
phagocyte |
T82 |
210-218 |
NN |
denotes |
survival |
T83 |
219-222 |
CC |
denotes |
and |
T84 |
223-236 |
NN |
denotes |
proliferation |
T85 |
236-237 |
. |
denotes |
. |
T86 |
238-241 |
DT |
denotes |
The |
T87 |
242-255 |
NN |
denotes |
transcription |
T14520 |
242-454 |
JJ |
denotes |
transcription factor Nuclear Factor-kappaB (NF-κB) is a key regulator of genes involved in M-CSF-induced mononuclear phagocyte survival and this study focused at identifying the mechanism of NF-κB transcriptional |
T88 |
256-262 |
NN |
denotes |
factor |
T89 |
263-270 |
NNP |
denotes |
Nuclear |
T90 |
271-284 |
NNP |
denotes |
Factor-kappaB |
T91 |
285-286 |
-LRB- |
denotes |
( |
T92 |
286-291 |
NNP |
denotes |
NF-κB |
T93 |
291-292 |
-RRB- |
denotes |
) |
T94 |
293-295 |
VBZ |
denotes |
is |
T95 |
296-297 |
DT |
denotes |
a |
T96 |
298-301 |
JJ |
denotes |
key |
T97 |
302-311 |
NN |
denotes |
regulator |
T98 |
312-314 |
IN |
denotes |
of |
T99 |
315-320 |
NNS |
denotes |
genes |
T100 |
321-329 |
VBN |
denotes |
involved |
T101 |
330-332 |
IN |
denotes |
in |
T102 |
333-346 |
JJ |
denotes |
M-CSF-induced |
T103 |
347-358 |
NN |
denotes |
mononuclear |
T104 |
359-368 |
NN |
denotes |
phagocyte |
T105 |
369-377 |
NN |
denotes |
survival |
T106 |
378-381 |
CC |
denotes |
and |
T107 |
382-386 |
DT |
denotes |
this |
T108 |
387-392 |
NN |
denotes |
study |
T109 |
393-400 |
VBD |
denotes |
focused |
T110 |
401-403 |
IN |
denotes |
at |
T111 |
404-415 |
VBG |
denotes |
identifying |
T112 |
416-419 |
DT |
denotes |
the |
T113 |
420-429 |
NN |
denotes |
mechanism |
T114 |
430-432 |
IN |
denotes |
of |
T115 |
433-438 |
JJ |
denotes |
NF-κB |
T116 |
439-454 |
JJ |
denotes |
transcriptional |
T117 |
455-465 |
NN |
denotes |
activation |
T14521 |
455-540 |
NN |
denotes |
activation. Here, we demonstrate that M-CSF stimulated NF-κB transcriptional activity |
T118 |
465-466 |
. |
denotes |
. |
T119 |
467-471 |
RB |
denotes |
Here |
T120 |
471-472 |
, |
denotes |
, |
T121 |
473-475 |
PRP |
denotes |
we |
T122 |
476-487 |
VBP |
denotes |
demonstrate |
T123 |
488-492 |
IN |
denotes |
that |
T124 |
493-498 |
NNP |
denotes |
M-CSF |
T125 |
499-509 |
VBD |
denotes |
stimulated |
T126 |
510-515 |
NNP |
denotes |
NF-κB |
T127 |
516-531 |
JJ |
denotes |
transcriptional |
T128 |
532-540 |
NN |
denotes |
activity |
T129 |
541-543 |
IN |
denotes |
in |
T14522 |
541-1876 |
VBZ |
denotes |
in human monocyte-derived macrophages (MDMs) and the murine macrophage cell line RAW 264.7. The general protein kinase C (PKC) inhibitor Ro-31-8220, the conventional PKCα/β inhibitor Gö-6976, overexpression of dominant negative PKCα constructs and PKCα siRNA reduced NF-κB activity in response to M-CSF. Interestingly, Ro-31-8220 reduced Ser276 phosphorylation of NF-κBp65 leading to decreased M-CSF-induced monocyte survival. In this report, we identify conventional PKCs, including PKCα as important upstream kinases for M-CSF-induced NF-κB transcriptional activation, NF-κB-regulated gene expression, NF-κB p65 Ser276 phosphorylation, and macrophage survival. Lastly, we find that NF-κB p65 Ser276 plays an important role in basal and M-CSF-stimulated NF-κB activation in human mononuclear phagocytes.
Introduction
Monocytes are produced in the bone marrow and circulate in blood for 24–48 hours [1]. In the absence of serum, monocytes die via apoptosis [1], [2]. Macrophage colony-stimulating factor (M-CSF) stimulates mononuclear phagocyte survival and differentiation [3]. Importantly, M-CSF-mediated cell survival and activation is associated with a variety of human diseases, including atherosclerosis, transplant vascular sclerosis and breast cancer metastasis [4], [5], [6].
We previously identified that NF-κB activation is |
T130 |
544-549 |
JJ |
denotes |
human |
T131 |
550-566 |
JJ |
denotes |
monocyte-derived |
T132 |
567-578 |
NNS |
denotes |
macrophages |
T133 |
579-580 |
-LRB- |
denotes |
( |
T134 |
580-584 |
NNS |
denotes |
MDMs |
T135 |
584-585 |
-RRB- |
denotes |
) |
T136 |
586-589 |
CC |
denotes |
and |
T137 |
590-593 |
DT |
denotes |
the |
T138 |
594-600 |
NN |
denotes |
murine |
T139 |
601-611 |
NN |
denotes |
macrophage |
T140 |
612-616 |
NN |
denotes |
cell |
T141 |
617-621 |
NN |
denotes |
line |
T142 |
622-625 |
NNP |
denotes |
RAW |
T143 |
626-631 |
CD |
denotes |
264.7 |
T144 |
631-632 |
. |
denotes |
. |
T145 |
633-636 |
DT |
denotes |
The |
T146 |
637-644 |
JJ |
denotes |
general |
T147 |
645-652 |
NN |
denotes |
protein |
T148 |
653-659 |
NN |
denotes |
kinase |
T149 |
660-661 |
NNP |
denotes |
C |
T150 |
662-663 |
-LRB- |
denotes |
( |
T151 |
663-666 |
NNP |
denotes |
PKC |
T152 |
666-667 |
-RRB- |
denotes |
) |
T153 |
668-677 |
NN |
denotes |
inhibitor |
T154 |
678-688 |
NN |
denotes |
Ro-31-8220 |
T155 |
688-689 |
, |
denotes |
, |
T156 |
690-693 |
DT |
denotes |
the |
T157 |
694-706 |
JJ |
denotes |
conventional |
T158 |
707-711 |
NNP |
denotes |
PKCα |
T159 |
711-712 |
NN |
denotes |
/ |
T160 |
712-713 |
NN |
denotes |
β |
T161 |
714-723 |
NN |
denotes |
inhibitor |
T162 |
724-731 |
NNP |
denotes |
Gö-6976 |
T163 |
731-732 |
, |
denotes |
, |
T164 |
733-747 |
NN |
denotes |
overexpression |
T165 |
748-750 |
IN |
denotes |
of |
T166 |
751-759 |
JJ |
denotes |
dominant |
T167 |
760-768 |
JJ |
denotes |
negative |
T168 |
769-773 |
NNP |
denotes |
PKCα |
T169 |
774-784 |
NNS |
denotes |
constructs |
T170 |
785-788 |
CC |
denotes |
and |
T171 |
789-793 |
NNP |
denotes |
PKCα |
T172 |
794-799 |
NNP |
denotes |
siRNA |
T173 |
800-807 |
VBD |
denotes |
reduced |
T174 |
808-813 |
JJ |
denotes |
NF-κB |
T175 |
814-822 |
NN |
denotes |
activity |
T176 |
823-825 |
IN |
denotes |
in |
T177 |
826-834 |
NN |
denotes |
response |
T178 |
835-837 |
TO |
denotes |
to |
T179 |
838-843 |
NNP |
denotes |
M-CSF |
T180 |
843-844 |
. |
denotes |
. |
T181 |
845-858 |
RB |
denotes |
Interestingly |
T182 |
858-859 |
, |
denotes |
, |
T183 |
860-870 |
JJ |
denotes |
Ro-31-8220 |
T184 |
871-878 |
JJ |
denotes |
reduced |
T185 |
879-885 |
NNP |
denotes |
Ser276 |
T186 |
886-901 |
NN |
denotes |
phosphorylation |
T187 |
902-904 |
IN |
denotes |
of |
T188 |
905-913 |
NN |
denotes |
NF-κBp65 |
T189 |
914-921 |
VBG |
denotes |
leading |
T190 |
922-924 |
TO |
denotes |
to |
T191 |
925-934 |
VBN |
denotes |
decreased |
T192 |
935-948 |
JJ |
denotes |
M-CSF-induced |
T193 |
949-957 |
NN |
denotes |
monocyte |
T194 |
958-966 |
NN |
denotes |
survival |
T195 |
966-967 |
. |
denotes |
. |
T196 |
968-970 |
IN |
denotes |
In |
T197 |
971-975 |
DT |
denotes |
this |
T198 |
976-982 |
NN |
denotes |
report |
T199 |
982-983 |
, |
denotes |
, |
T200 |
984-986 |
PRP |
denotes |
we |
T201 |
987-995 |
VBP |
denotes |
identify |
T202 |
996-1008 |
JJ |
denotes |
conventional |
T203 |
1009-1013 |
NNS |
denotes |
PKCs |
T204 |
1013-1014 |
, |
denotes |
, |
T205 |
1015-1024 |
VBG |
denotes |
including |
T206 |
1025-1029 |
NNP |
denotes |
PKCα |
T207 |
1030-1032 |
IN |
denotes |
as |
T208 |
1033-1042 |
JJ |
denotes |
important |
T209 |
1043-1051 |
JJ |
denotes |
upstream |
T210 |
1052-1059 |
NNS |
denotes |
kinases |
T211 |
1060-1063 |
IN |
denotes |
for |
T212 |
1064-1077 |
JJ |
denotes |
M-CSF-induced |
T213 |
1078-1083 |
NN |
denotes |
NF-κB |
T214 |
1084-1099 |
JJ |
denotes |
transcriptional |
T215 |
1100-1110 |
NN |
denotes |
activation |
T216 |
1110-1111 |
, |
denotes |
, |
T217 |
1112-1127 |
JJ |
denotes |
NF-κB-regulated |
T218 |
1128-1132 |
NN |
denotes |
gene |
T219 |
1133-1143 |
NN |
denotes |
expression |
T220 |
1143-1144 |
, |
denotes |
, |
T221 |
1145-1150 |
NNP |
denotes |
NF-κB |
T222 |
1151-1154 |
CD |
denotes |
p65 |
T223 |
1155-1161 |
NNP |
denotes |
Ser276 |
T224 |
1162-1177 |
NN |
denotes |
phosphorylation |
T225 |
1177-1178 |
, |
denotes |
, |
T226 |
1179-1182 |
CC |
denotes |
and |
T227 |
1183-1193 |
NN |
denotes |
macrophage |
T228 |
1194-1202 |
NN |
denotes |
survival |
T229 |
1202-1203 |
. |
denotes |
. |
T230 |
1204-1210 |
RB |
denotes |
Lastly |
T231 |
1210-1211 |
, |
denotes |
, |
T232 |
1212-1214 |
PRP |
denotes |
we |
T233 |
1215-1219 |
VBP |
denotes |
find |
T234 |
1220-1224 |
IN |
denotes |
that |
T235 |
1225-1230 |
NNP |
denotes |
NF-κB |
T236 |
1231-1234 |
CD |
denotes |
p65 |
T237 |
1235-1241 |
NNP |
denotes |
Ser276 |
T238 |
1242-1247 |
VBZ |
denotes |
plays |
T239 |
1248-1250 |
DT |
denotes |
an |
T240 |
1251-1260 |
JJ |
denotes |
important |
T241 |
1261-1265 |
NN |
denotes |
role |
T242 |
1266-1268 |
IN |
denotes |
in |
T243 |
1269-1274 |
JJ |
denotes |
basal |
T244 |
1275-1278 |
CC |
denotes |
and |
T245 |
1279-1295 |
JJ |
denotes |
M-CSF-stimulated |
T246 |
1296-1301 |
NN |
denotes |
NF-κB |
T247 |
1302-1312 |
NN |
denotes |
activation |
T248 |
1313-1315 |
IN |
denotes |
in |
T249 |
1316-1321 |
JJ |
denotes |
human |
T250 |
1322-1333 |
NN |
denotes |
mononuclear |
T251 |
1334-1344 |
NNS |
denotes |
phagocytes |
T252 |
1344-1345 |
. |
denotes |
. |
T1018 |
1360-1369 |
NNS |
denotes |
Monocytes |
T1019 |
1370-1373 |
VBP |
denotes |
are |
T1020 |
1374-1382 |
VBN |
denotes |
produced |
T1021 |
1383-1385 |
IN |
denotes |
in |
T1022 |
1386-1389 |
DT |
denotes |
the |
T1023 |
1390-1394 |
NN |
denotes |
bone |
T1024 |
1395-1401 |
NN |
denotes |
marrow |
T1025 |
1402-1405 |
CC |
denotes |
and |
T1026 |
1406-1415 |
VBP |
denotes |
circulate |
T1027 |
1416-1418 |
IN |
denotes |
in |
T1028 |
1419-1424 |
NN |
denotes |
blood |
T1029 |
1425-1428 |
IN |
denotes |
for |
T1030 |
1429-1431 |
CD |
denotes |
24 |
T1031 |
1432-1434 |
CD |
denotes |
48 |
T1032 |
1435-1440 |
NNS |
denotes |
hours |
T1033 |
1441-1442 |
NNP |
denotes |
[ |
T1034 |
1442-1443 |
CD |
denotes |
1 |
T1035 |
1443-1444 |
NNP |
denotes |
] |
T1036 |
1444-1445 |
. |
denotes |
. |
T1037 |
1446-1448 |
IN |
denotes |
In |
T1038 |
1449-1452 |
DT |
denotes |
the |
T1039 |
1453-1460 |
NN |
denotes |
absence |
T1040 |
1461-1463 |
IN |
denotes |
of |
T1041 |
1464-1469 |
NN |
denotes |
serum |
T1042 |
1469-1470 |
, |
denotes |
, |
T1043 |
1471-1480 |
NNS |
denotes |
monocytes |
T1044 |
1481-1484 |
VBP |
denotes |
die |
T1045 |
1485-1488 |
IN |
denotes |
via |
T1046 |
1489-1498 |
NN |
denotes |
apoptosis |
T1047 |
1499-1500 |
NN |
denotes |
[ |
T1048 |
1500-1501 |
CD |
denotes |
1 |
T1049 |
1501-1502 |
NNP |
denotes |
] |
T1050 |
1502-1503 |
, |
denotes |
, |
T1051 |
1504-1505 |
NNP |
denotes |
[ |
T1052 |
1505-1506 |
CD |
denotes |
2 |
T1053 |
1506-1507 |
NNP |
denotes |
] |
T1054 |
1507-1508 |
. |
denotes |
. |
T1055 |
1509-1519 |
NNP |
denotes |
Macrophage |
T1056 |
1520-1538 |
JJ |
denotes |
colony-stimulating |
T1057 |
1539-1545 |
NN |
denotes |
factor |
T1058 |
1546-1547 |
-LRB- |
denotes |
( |
T1059 |
1547-1552 |
NNP |
denotes |
M-CSF |
T1060 |
1552-1553 |
-RRB- |
denotes |
) |
T1061 |
1554-1564 |
VBZ |
denotes |
stimulates |
T1062 |
1565-1576 |
JJ |
denotes |
mononuclear |
T1063 |
1577-1586 |
JJ |
denotes |
phagocyte |
T1064 |
1587-1595 |
NN |
denotes |
survival |
T1065 |
1596-1599 |
CC |
denotes |
and |
T1066 |
1600-1615 |
NN |
denotes |
differentiation |
T1067 |
1616-1617 |
NN |
denotes |
[ |
T1068 |
1617-1618 |
CD |
denotes |
3 |
T1069 |
1618-1619 |
NNP |
denotes |
] |
T1070 |
1619-1620 |
. |
denotes |
. |
T1071 |
1621-1632 |
RB |
denotes |
Importantly |
T1072 |
1632-1633 |
, |
denotes |
, |
T1073 |
1634-1648 |
JJ |
denotes |
M-CSF-mediated |
T1074 |
1649-1653 |
NN |
denotes |
cell |
T1075 |
1654-1662 |
NN |
denotes |
survival |
T1076 |
1663-1666 |
CC |
denotes |
and |
T1077 |
1667-1677 |
NN |
denotes |
activation |
T1078 |
1678-1680 |
VBZ |
denotes |
is |
T1079 |
1681-1691 |
VBN |
denotes |
associated |
T1080 |
1692-1696 |
IN |
denotes |
with |
T1081 |
1697-1698 |
DT |
denotes |
a |
T1082 |
1699-1706 |
NN |
denotes |
variety |
T1083 |
1707-1709 |
IN |
denotes |
of |
T1084 |
1710-1715 |
JJ |
denotes |
human |
T1085 |
1716-1724 |
NNS |
denotes |
diseases |
T1086 |
1724-1725 |
, |
denotes |
, |
T1087 |
1726-1735 |
VBG |
denotes |
including |
T1088 |
1736-1751 |
NN |
denotes |
atherosclerosis |
T1089 |
1751-1752 |
, |
denotes |
, |
T1090 |
1753-1763 |
NN |
denotes |
transplant |
T1091 |
1764-1772 |
JJ |
denotes |
vascular |
T1092 |
1773-1782 |
NN |
denotes |
sclerosis |
T1093 |
1783-1786 |
CC |
denotes |
and |
T1094 |
1787-1793 |
NN |
denotes |
breast |
T1095 |
1794-1800 |
NN |
denotes |
cancer |
T1096 |
1801-1811 |
NN |
denotes |
metastasis |
T1097 |
1812-1813 |
NNP |
denotes |
[ |
T1098 |
1813-1814 |
CD |
denotes |
4 |
T1099 |
1814-1815 |
NNP |
denotes |
] |
T1100 |
1815-1816 |
, |
denotes |
, |
T1101 |
1817-1818 |
NNP |
denotes |
[ |
T1102 |
1818-1819 |
CD |
denotes |
5 |
T1103 |
1819-1820 |
NNP |
denotes |
] |
T1104 |
1820-1821 |
, |
denotes |
, |
T1105 |
1822-1823 |
NNP |
denotes |
[ |
T1106 |
1823-1824 |
CD |
denotes |
6 |
T1107 |
1824-1825 |
NNP |
denotes |
] |
T1108 |
1825-1826 |
. |
denotes |
. |
T1109 |
1827-1829 |
PRP |
denotes |
We |
T1110 |
1830-1840 |
RB |
denotes |
previously |
T1111 |
1841-1851 |
VBD |
denotes |
identified |
T1112 |
1852-1856 |
IN |
denotes |
that |
T1113 |
1857-1862 |
JJ |
denotes |
NF-κB |
T1114 |
1863-1873 |
NN |
denotes |
activation |
T1115 |
1874-1876 |
VBZ |
denotes |
is |
T1116 |
1877-1886 |
JJ |
denotes |
important |
T14523 |
1877-1886 |
JJ |
denotes |
important |
T1117 |
1887-1889 |
IN |
denotes |
in |
T14524 |
1887-1889 |
IN |
denotes |
in |
T1118 |
1890-1903 |
JJ |
denotes |
M-CSF-induced |
T1119 |
1904-1912 |
NN |
denotes |
monocyte |
T1120 |
1913-1921 |
NN |
denotes |
survival |
T1121 |
1922-1923 |
NN |
denotes |
[ |
T1122 |
1923-1924 |
CD |
denotes |
7 |
T1123 |
1924-1925 |
NNP |
denotes |
] |
T1124 |
1925-1926 |
. |
denotes |
. |
T1125 |
1927-1929 |
IN |
denotes |
In |
T1126 |
1930-1938 |
NN |
denotes |
addition |
T1127 |
1939-1941 |
TO |
denotes |
to |
T1128 |
1942-1945 |
PRP$ |
denotes |
its |
T1129 |
1946-1950 |
NN |
denotes |
role |
T1130 |
1951-1953 |
IN |
denotes |
in |
T1131 |
1954-1965 |
NN |
denotes |
mononuclear |
T1132 |
1966-1975 |
JJ |
denotes |
phagocyte |
T1133 |
1976-1984 |
NN |
denotes |
survival |
T1134 |
1984-1985 |
, |
denotes |
, |
T1135 |
1986-1989 |
DT |
denotes |
the |
T1136 |
1990-2003 |
NN |
denotes |
transcription |
T1137 |
2004-2010 |
NN |
denotes |
factor |
T1138 |
2011-2016 |
NNP |
denotes |
NF-κB |
T1139 |
2017-2026 |
VBZ |
denotes |
regulates |
T1140 |
2027-2035 |
JJ |
denotes |
numerous |
T1141 |
2036-2041 |
NNS |
denotes |
genes |
T1142 |
2042-2046 |
WDT |
denotes |
that |
T1143 |
2047-2051 |
VBP |
denotes |
play |
T1144 |
2052-2061 |
JJ |
denotes |
important |
T1145 |
2062-2067 |
NNS |
denotes |
roles |
T1146 |
2068-2070 |
IN |
denotes |
in |
T1147 |
2071-2079 |
JJ |
denotes |
cellular |
T1148 |
2080-2089 |
VBG |
denotes |
signaling |
T1149 |
2089-2090 |
, |
denotes |
, |
T1150 |
2091-2097 |
NN |
denotes |
stress |
T1151 |
2098-2106 |
NN |
denotes |
response |
T1152 |
2106-2107 |
, |
denotes |
, |
T1153 |
2108-2112 |
NN |
denotes |
cell |
T1154 |
2113-2119 |
NN |
denotes |
growth |
T1155 |
2119-2120 |
, |
denotes |
, |
T1156 |
2121-2129 |
NN |
denotes |
survival |
T1157 |
2129-2130 |
, |
denotes |
, |
T1158 |
2131-2146 |
NN |
denotes |
differentiation |
T1159 |
2147-2150 |
CC |
denotes |
and |
T1160 |
2151-2163 |
NN |
denotes |
inflammation |
T1161 |
2164-2165 |
NN |
denotes |
[ |
T1162 |
2165-2166 |
CD |
denotes |
8 |
T1163 |
2166-2167 |
NNP |
denotes |
] |
T1164 |
2167-2168 |
. |
denotes |
. |
T1165 |
2169-2174 |
EX |
denotes |
There |
T1166 |
2175-2178 |
VBP |
denotes |
are |
T1167 |
2179-2183 |
CD |
denotes |
five |
T1168 |
2184-2191 |
NNS |
denotes |
members |
T1169 |
2192-2194 |
IN |
denotes |
in |
T1170 |
2195-2198 |
DT |
denotes |
the |
T1171 |
2199-2204 |
NNP |
denotes |
NF-κB |
T1172 |
2205-2211 |
NN |
denotes |
family |
T1173 |
2211-2212 |
: |
denotes |
: |
T1174 |
2213-2221 |
NNS |
denotes |
RelA/p65 |
T1175 |
2221-2222 |
, |
denotes |
, |
T1176 |
2223-2226 |
CD |
denotes |
p50 |
T1177 |
2226-2227 |
, |
denotes |
, |
T1178 |
2228-2231 |
CD |
denotes |
p52 |
T1179 |
2231-2232 |
, |
denotes |
, |
T1180 |
2233-2238 |
NNP |
denotes |
c-Rel |
T1181 |
2239-2242 |
CC |
denotes |
and |
T1182 |
2243-2247 |
NNP |
denotes |
RelB |
T1183 |
2247-2248 |
. |
denotes |
. |
T1184 |
2249-2252 |
DT |
denotes |
The |
T1185 |
2253-2257 |
RBS |
denotes |
most |
T1186 |
2258-2264 |
JJ |
denotes |
common |
T1187 |
2265-2275 |
NN |
denotes |
activating |
T1188 |
2276-2283 |
NN |
denotes |
complex |
T1189 |
2284-2286 |
VBZ |
denotes |
is |
T1190 |
2287-2290 |
DT |
denotes |
the |
T1191 |
2291-2298 |
CD |
denotes |
p50/p65 |
T1192 |
2299-2310 |
NN |
denotes |
heterodimer |
T1193 |
2310-2311 |
, |
denotes |
, |
T1194 |
2312-2318 |
VBN |
denotes |
driven |
T1195 |
2319-2321 |
IN |
denotes |
by |
T1196 |
2322-2325 |
DT |
denotes |
the |
T1197 |
2326-2336 |
NN |
denotes |
activation |
T1198 |
2337-2343 |
NN |
denotes |
domain |
T1199 |
2344-2346 |
IN |
denotes |
in |
T1200 |
2347-2350 |
DT |
denotes |
the |
T1201 |
2351-2356 |
NNP |
denotes |
NF-κB |
T1202 |
2357-2360 |
CD |
denotes |
p65 |
T1203 |
2361-2368 |
NN |
denotes |
subunit |
T1204 |
2368-2369 |
. |
denotes |
. |
T1205 |
2370-2375 |
NNP |
denotes |
NF-κB |
T1206 |
2376-2379 |
CD |
denotes |
p65 |
T1207 |
2380-2389 |
VBZ |
denotes |
regulates |
T1208 |
2390-2399 |
JJ |
denotes |
important |
T1209 |
2400-2413 |
JJ |
denotes |
developmental |
T1210 |
2414-2423 |
NNS |
denotes |
processes |
T1211 |
2424-2425 |
VBP |
denotes |
[ |
T1212 |
2425-2426 |
CD |
denotes |
9 |
T1213 |
2426-2427 |
NNP |
denotes |
] |
T1214 |
2427-2428 |
, |
denotes |
, |
T1215 |
2429-2430 |
NNP |
denotes |
[ |
T1216 |
2430-2432 |
CD |
denotes |
10 |
T1217 |
2432-2433 |
NNP |
denotes |
] |
T1218 |
2433-2434 |
. |
denotes |
. |
T1219 |
2435-2439 |
NNP |
denotes |
Mice |
T1220 |
2440-2447 |
VBG |
denotes |
lacking |
T1221 |
2448-2453 |
NNP |
denotes |
NF-κB |
T1222 |
2454-2457 |
CD |
denotes |
p65 |
T1223 |
2458-2461 |
NN |
denotes |
die |
T1224 |
2462-2464 |
IN |
denotes |
in |
T1225 |
2465-2470 |
NN |
denotes |
utero |
T1226 |
2471-2474 |
CC |
denotes |
and |
T1227 |
2475-2479 |
VBP |
denotes |
have |
T1228 |
2480-2489 |
JJ |
denotes |
extensive |
T1229 |
2490-2495 |
NN |
denotes |
liver |
T1230 |
2496-2502 |
NN |
denotes |
damage |
T1231 |
2503-2506 |
IN |
denotes |
via |
T1232 |
2507-2515 |
JJ |
denotes |
enhanced |
T1233 |
2516-2525 |
NN |
denotes |
apoptosis |
T1234 |
2526-2527 |
NN |
denotes |
[ |
T1235 |
2527-2528 |
CD |
denotes |
9 |
T1236 |
2528-2529 |
NNP |
denotes |
] |
T1237 |
2529-2530 |
. |
denotes |
. |
T1238 |
2531-2540 |
JJ |
denotes |
Embryonic |
T1239 |
2541-2552 |
NNS |
denotes |
macrophages |
T1240 |
2553-2557 |
IN |
denotes |
from |
T1241 |
2558-2563 |
NNP |
denotes |
NF-κB |
T1242 |
2564-2567 |
CD |
denotes |
p65 |
T1243 |
2568-2572 |
NN |
denotes |
null |
T1244 |
2573-2577 |
NNS |
denotes |
mice |
T1245 |
2578-2581 |
VBP |
denotes |
are |
T1246 |
2582-2593 |
JJ |
denotes |
susceptible |
T1247 |
2594-2596 |
TO |
denotes |
to |
T1248 |
2597-2609 |
JJ |
denotes |
TNFα-induced |
T1249 |
2610-2619 |
NN |
denotes |
apoptosis |
T1250 |
2620-2625 |
WDT |
denotes |
which |
T1251 |
2626-2628 |
VBZ |
denotes |
is |
T1252 |
2629-2636 |
VBN |
denotes |
rescued |
T1253 |
2637-2639 |
IN |
denotes |
by |
T1254 |
2640-2654 |
VBG |
denotes |
overexpressing |
T1255 |
2655-2658 |
DT |
denotes |
the |
T1256 |
2659-2664 |
NNP |
denotes |
NF-κB |
T1257 |
2665-2668 |
CD |
denotes |
p65 |
T1258 |
2669-2676 |
VBN |
denotes |
subunit |
T1259 |
2677-2678 |
NNP |
denotes |
[ |
T1260 |
2678-2680 |
CD |
denotes |
10 |
T1261 |
2680-2681 |
NNP |
denotes |
] |
T1262 |
2681-2682 |
. |
denotes |
. |
T1263 |
2683-2691 |
RB |
denotes |
Moreover |
T1264 |
2691-2692 |
, |
denotes |
, |
T1265 |
2693-2703 |
VBG |
denotes |
inhibiting |
T1266 |
2704-2709 |
JJ |
denotes |
NF-κB |
T1267 |
2710-2717 |
VBZ |
denotes |
induces |
T1268 |
2718-2722 |
NN |
denotes |
cell |
T1269 |
2723-2728 |
NN |
denotes |
death |
T1270 |
2729-2731 |
IN |
denotes |
in |
T1271 |
2732-2736 |
JJ |
denotes |
many |
T1272 |
2737-2741 |
NN |
denotes |
cell |
T1273 |
2742-2747 |
NNS |
denotes |
types |
T1274 |
2748-2751 |
CC |
denotes |
and |
T1275 |
2752-2772 |
JJ |
denotes |
cytokine-independent |
T1276 |
2773-2781 |
NN |
denotes |
survival |
T1277 |
2782-2784 |
VBZ |
denotes |
is |
T1278 |
2785-2793 |
VBN |
denotes |
mediated |
T1279 |
2794-2796 |
IN |
denotes |
by |
T1280 |
2797-2811 |
RB |
denotes |
constitutively |
T1281 |
2812-2818 |
JJ |
denotes |
active |
T1282 |
2819-2824 |
NN |
denotes |
NF-κB |
T1283 |
2825-2827 |
IN |
denotes |
in |
T1284 |
2828-2834 |
JJ |
denotes |
murine |
T1285 |
2835-2846 |
NNS |
denotes |
macrophages |
T1286 |
2847-2848 |
NNP |
denotes |
[ |
T1287 |
2848-2850 |
CD |
denotes |
11 |
T1288 |
2850-2851 |
NNP |
denotes |
] |
T1289 |
2851-2852 |
. |
denotes |
. |
T1290 |
2853-2855 |
IN |
denotes |
In |
T1291 |
2856-2865 |
NNS |
denotes |
monocytes |
T1292 |
2866-2869 |
CC |
denotes |
and |
T1293 |
2870-2881 |
NNS |
denotes |
macrophages |
T1294 |
2881-2882 |
, |
denotes |
, |
T1295 |
2883-2888 |
NN |
denotes |
NF-κB |
T1296 |
2889-2891 |
VBZ |
denotes |
is |
T1297 |
2892-2894 |
DT |
denotes |
an |
T1298 |
2895-2904 |
JJ |
denotes |
important |
T1299 |
2905-2920 |
JJ |
denotes |
transcriptional |
T1300 |
2921-2927 |
NN |
denotes |
factor |
T1301 |
2928-2931 |
IN |
denotes |
for |
T1302 |
2932-2942 |
NN |
denotes |
expression |
T1303 |
2943-2945 |
IN |
denotes |
of |
T1304 |
2946-2955 |
NNS |
denotes |
cytokines |
T1305 |
2956-2959 |
CC |
denotes |
and |
T1306 |
2960-2964 |
NN |
denotes |
cell |
T1307 |
2965-2972 |
NN |
denotes |
surface |
T1308 |
2973-2982 |
NNS |
denotes |
receptors |
T1309 |
2983-2984 |
NNP |
denotes |
[ |
T1310 |
2984-2986 |
CD |
denotes |
12 |
T1311 |
2986-2987 |
NNP |
denotes |
] |
T1312 |
2987-2988 |
. |
denotes |
. |
T1313 |
2989-2996 |
RB |
denotes |
However |
T1314 |
2996-2997 |
, |
denotes |
, |
T1315 |
2998-3004 |
IN |
denotes |
unlike |
T1316 |
3005-3012 |
VBG |
denotes |
resting |
T1317 |
3013-3020 |
NNS |
denotes |
T-cells |
T1318 |
3020-3021 |
, |
denotes |
, |
T1319 |
3022-3027 |
NN |
denotes |
NF-κB |
T1320 |
3028-3030 |
VBZ |
denotes |
is |
T1321 |
3031-3045 |
RB |
denotes |
constitutively |
T1322 |
3046-3053 |
JJ |
denotes |
present |
T1323 |
3054-3056 |
IN |
denotes |
in |
T1324 |
3057-3060 |
DT |
denotes |
the |
T1325 |
3061-3067 |
NN |
denotes |
nuclei |
T1326 |
3068-3070 |
IN |
denotes |
of |
T1327 |
3071-3078 |
JJ |
denotes |
primary |
T1328 |
3079-3088 |
NNS |
denotes |
monocytes |
T1329 |
3089-3092 |
CC |
denotes |
and |
T1330 |
3093-3102 |
JJ |
denotes |
monocytic |
T1331 |
3103-3107 |
NN |
denotes |
cell |
T1332 |
3108-3113 |
NNS |
denotes |
lines |
T1333 |
3114-3116 |
IN |
denotes |
in |
T1334 |
3117-3120 |
DT |
denotes |
the |
T1335 |
3121-3128 |
NN |
denotes |
absence |
T1336 |
3129-3131 |
IN |
denotes |
of |
T1337 |
3132-3141 |
JJ |
denotes |
exogenous |
T1338 |
3142-3149 |
NNS |
denotes |
stimuli |
T1339 |
3150-3152 |
IN |
denotes |
as |
T1340 |
3153-3165 |
VBN |
denotes |
demonstrated |
T1341 |
3166-3168 |
IN |
denotes |
by |
T1342 |
3169-3177 |
NN |
denotes |
mobility |
T1343 |
3178-3183 |
NN |
denotes |
shift |
T1344 |
3184-3192 |
NN |
denotes |
analysis |
T1345 |
3193-3194 |
NNP |
denotes |
[ |
T1346 |
3194-3196 |
CD |
denotes |
13 |
T1347 |
3196-3197 |
NNP |
denotes |
] |
T1348 |
3197-3198 |
. |
denotes |
. |
T1349 |
3199-3208 |
RB |
denotes |
Similarly |
T1350 |
3208-3209 |
, |
denotes |
, |
T1351 |
3210-3224 |
RB |
denotes |
constitutively |
T1352 |
3225-3231 |
JJ |
denotes |
active |
T1353 |
3232-3237 |
NN |
denotes |
NF-κB |
T1354 |
3238-3241 |
VBD |
denotes |
was |
T1355 |
3242-3250 |
VBN |
denotes |
observed |
T1356 |
3251-3253 |
IN |
denotes |
in |
T1357 |
3254-3259 |
JJ |
denotes |
human |
T1358 |
3260-3268 |
JJ |
denotes |
alveolar |
T1359 |
3269-3280 |
NNS |
denotes |
macrophages |
T1360 |
3281-3282 |
NNP |
denotes |
[ |
T1361 |
3282-3284 |
CD |
denotes |
14 |
T1362 |
3284-3285 |
NNP |
denotes |
] |
T1363 |
3285-3286 |
. |
denotes |
. |
T1364 |
3287-3289 |
IN |
denotes |
In |
T1365 |
3290-3293 |
DT |
denotes |
the |
T1366 |
3294-3311 |
JJ |
denotes |
classic/canonical |
T1367 |
3312-3319 |
NN |
denotes |
pathway |
T1368 |
3319-3320 |
, |
denotes |
, |
T1369 |
3321-3324 |
DT |
denotes |
the |
T1370 |
3325-3330 |
NNP |
denotes |
NF-κB |
T1371 |
3331-3338 |
CD |
denotes |
p50/p65 |
T1372 |
3339-3346 |
NN |
denotes |
complex |
T1373 |
3347-3349 |
VBZ |
denotes |
is |
T1374 |
3350-3361 |
VBN |
denotes |
sequestered |
T1375 |
3362-3364 |
IN |
denotes |
in |
T1376 |
3365-3368 |
DT |
denotes |
the |
T1377 |
3369-3376 |
NN |
denotes |
cytosol |
T1378 |
3377-3379 |
IN |
denotes |
by |
T1379 |
3380-3384 |
NNP |
denotes |
IκBα |
T1380 |
3385-3386 |
NNP |
denotes |
[ |
T1381 |
3386-3388 |
CD |
denotes |
15 |
T1382 |
3388-3389 |
NNP |
denotes |
] |
T1383 |
3389-3390 |
. |
denotes |
. |
T1384 |
3391-3395 |
IN |
denotes |
Upon |
T1385 |
3396-3407 |
NN |
denotes |
stimulation |
T1386 |
3408-3410 |
IN |
denotes |
by |
T1387 |
3411-3420 |
NNS |
denotes |
cytokines |
T1388 |
3421-3423 |
CC |
denotes |
or |
T1389 |
3424-3426 |
NN |
denotes |
UV |
T1390 |
3427-3436 |
NN |
denotes |
radiation |
T1391 |
3436-3437 |
, |
denotes |
, |
T1392 |
3438-3442 |
NNP |
denotes |
IκBα |
T1393 |
3443-3445 |
VBZ |
denotes |
is |
T1394 |
3446-3460 |
VBN |
denotes |
phosphorylated |
T1395 |
3460-3461 |
, |
denotes |
, |
T1396 |
3462-3475 |
VBN |
denotes |
ubiquitinated |
T1397 |
3475-3476 |
, |
denotes |
, |
T1398 |
3477-3480 |
CC |
denotes |
and |
T1399 |
3481-3489 |
JJ |
denotes |
degraded |
T1400 |
3489-3490 |
, |
denotes |
, |
T1401 |
3491-3500 |
VBG |
denotes |
releasing |
T1402 |
3501-3506 |
NNP |
denotes |
NF-κB |
T1403 |
3507-3514 |
CD |
denotes |
p50/p65 |
T1404 |
3515-3517 |
TO |
denotes |
to |
T1405 |
3518-3529 |
VB |
denotes |
translocate |
T1406 |
3530-3532 |
TO |
denotes |
to |
T1407 |
3533-3536 |
DT |
denotes |
the |
T1408 |
3537-3544 |
NN |
denotes |
nucleus |
T1409 |
3545-3548 |
CC |
denotes |
and |
T1410 |
3549-3562 |
NN |
denotes |
transactivate |
T1411 |
3563-3569 |
NN |
denotes |
target |
T1412 |
3570-3575 |
NNS |
denotes |
genes |
T1413 |
3575-3576 |
. |
denotes |
. |
T1414 |
3577-3582 |
IN |
denotes |
After |
T1415 |
3583-3586 |
PRP$ |
denotes |
its |
T1416 |
3587-3594 |
NN |
denotes |
release |
T1417 |
3595-3599 |
IN |
denotes |
from |
T1418 |
3600-3604 |
NNP |
denotes |
IκBα |
T1419 |
3604-3605 |
, |
denotes |
, |
T1420 |
3606-3611 |
NNP |
denotes |
NF-κB |
T1421 |
3612-3615 |
NNS |
denotes |
p65 |
T1422 |
3616-3619 |
MD |
denotes |
can |
T1423 |
3620-3627 |
VB |
denotes |
undergo |
T1424 |
3628-3646 |
JJ |
denotes |
post-translational |
T1425 |
3647-3659 |
NN |
denotes |
modification |
T1426 |
3660-3662 |
TO |
denotes |
to |
T1427 |
3663-3671 |
VB |
denotes |
activate |
T1428 |
3672-3676 |
NN |
denotes |
gene |
T1429 |
3677-3690 |
NN |
denotes |
transcription |
T1430 |
3690-3691 |
. |
denotes |
. |
T1431 |
3692-3695 |
DT |
denotes |
The |
T1432 |
3696-3700 |
NN |
denotes |
role |
T1433 |
3701-3703 |
IN |
denotes |
of |
T1434 |
3704-3709 |
NNP |
denotes |
NF-κB |
T1435 |
3710-3713 |
CD |
denotes |
p65 |
T1436 |
3714-3729 |
NN |
denotes |
phosphorylation |
T1437 |
3730-3732 |
IN |
denotes |
on |
T1438 |
3733-3738 |
JJ |
denotes |
NF-κB |
T1439 |
3739-3754 |
JJ |
denotes |
transcriptional |
T1440 |
3755-3763 |
NN |
denotes |
activity |
T1441 |
3764-3770 |
VBZ |
denotes |
varies |
T1442 |
3771-3773 |
IN |
denotes |
by |
T1443 |
3774-3782 |
NN |
denotes |
stimulus |
T1444 |
3782-3783 |
, |
denotes |
, |
T1445 |
3784-3788 |
NN |
denotes |
time |
T1446 |
3789-3791 |
IN |
denotes |
of |
T1447 |
3792-3803 |
NN |
denotes |
stimulation |
T1448 |
3804-3807 |
CC |
denotes |
and |
T1449 |
3808-3812 |
NN |
denotes |
cell |
T1450 |
3813-3817 |
NN |
denotes |
type |
T1451 |
3818-3819 |
NNP |
denotes |
[ |
T1452 |
3819-3821 |
CD |
denotes |
16 |
T1453 |
3821-3822 |
NNP |
denotes |
] |
T1454 |
3822-3823 |
. |
denotes |
. |
T1455 |
3824-3832 |
JJ |
denotes |
Previous |
T1456 |
3833-3841 |
NN |
denotes |
research |
T1457 |
3842-3847 |
VBZ |
denotes |
shows |
T1458 |
3848-3852 |
IN |
denotes |
that |
T1459 |
3853-3868 |
NN |
denotes |
phosphorylation |
T1460 |
3869-3871 |
IN |
denotes |
of |
T1461 |
3872-3877 |
NNP |
denotes |
NF-κB |
T1462 |
3878-3881 |
NNS |
denotes |
p65 |
T1463 |
3882-3884 |
IN |
denotes |
at |
T1464 |
3885-3891 |
NNP |
denotes |
Ser276 |
T1465 |
3891-3892 |
, |
denotes |
, |
T1466 |
3893-3899 |
NNP |
denotes |
Ser529 |
T1467 |
3900-3902 |
CC |
denotes |
or |
T1468 |
3903-3909 |
NNP |
denotes |
Ser536 |
T1469 |
3910-3915 |
VBZ |
denotes |
plays |
T1470 |
3916-3918 |
DT |
denotes |
an |
T1471 |
3919-3928 |
JJ |
denotes |
important |
T1472 |
3929-3933 |
NN |
denotes |
role |
T1473 |
3934-3936 |
IN |
denotes |
in |
T1474 |
3937-3947 |
VBG |
denotes |
regulating |
T1475 |
3948-3963 |
JJ |
denotes |
transcriptional |
T1476 |
3964-3972 |
NN |
denotes |
activity |
T1477 |
3973-3975 |
IN |
denotes |
of |
T1478 |
3976-3981 |
NNP |
denotes |
NF-κB |
T1479 |
3982-3983 |
NNP |
denotes |
[ |
T1480 |
3983-3985 |
CD |
denotes |
17 |
T1481 |
3985-3986 |
NNP |
denotes |
] |
T1482 |
3986-3987 |
. |
denotes |
. |
T1483 |
3988-3990 |
IN |
denotes |
In |
T1484 |
3991-4003 |
JJ |
denotes |
TNFα-treated |
T1485 |
4004-4010 |
NN |
denotes |
murine |
T1486 |
4011-4022 |
NNS |
denotes |
fibroblasts |
T1487 |
4022-4023 |
, |
denotes |
, |
T1488 |
4024-4030 |
NNP |
denotes |
Ser276 |
T1489 |
4031-4033 |
IN |
denotes |
of |
T1490 |
4034-4039 |
NNP |
denotes |
NF-κB |
T1491 |
4040-4043 |
CD |
denotes |
p65 |
T1492 |
4044-4046 |
VBZ |
denotes |
is |
T1493 |
4047-4061 |
VBN |
denotes |
phosphorylated |
T1494 |
4062-4064 |
IN |
denotes |
by |
T1495 |
4065-4069 |
CD |
denotes |
MSK1 |
T1496 |
4070-4072 |
TO |
denotes |
to |
T1497 |
4073-4080 |
VB |
denotes |
enhance |
T1498 |
4081-4086 |
JJ |
denotes |
NF-κB |
T1499 |
4087-4102 |
JJ |
denotes |
transcriptional |
T1500 |
4103-4111 |
NN |
denotes |
activity |
T1501 |
4112-4113 |
NNP |
denotes |
[ |
T1502 |
4113-4115 |
CD |
denotes |
18 |
T1503 |
4115-4116 |
NNP |
denotes |
] |
T1504 |
4116-4117 |
. |
denotes |
. |
T1505 |
4118-4120 |
IN |
denotes |
In |
T1506 |
4121-4132 |
NNS |
denotes |
macrophages |
T1507 |
4133-4140 |
VBN |
denotes |
treated |
T1508 |
4141-4145 |
IN |
denotes |
with |
T1509 |
4146-4155 |
NN |
denotes |
endotoxin |
T1510 |
4155-4156 |
, |
denotes |
, |
T1511 |
4157-4162 |
JJ |
denotes |
NF-κB |
T1512 |
4163-4176 |
NN |
denotes |
transcription |
T1513 |
4177-4185 |
NN |
denotes |
activity |
T1514 |
4186-4188 |
VBZ |
denotes |
is |
T1515 |
4189-4199 |
VBN |
denotes |
associated |
T1516 |
4200-4204 |
IN |
denotes |
with |
T1517 |
4205-4220 |
NN |
denotes |
phosphorylation |
T1518 |
4221-4223 |
IN |
denotes |
on |
T1519 |
4224-4230 |
NNP |
denotes |
Ser276 |
T1520 |
4231-4234 |
CC |
denotes |
and |
T1521 |
4235-4241 |
NNP |
denotes |
Ser536 |
T1522 |
4242-4246 |
WDT |
denotes |
that |
T1523 |
4247-4249 |
VBZ |
denotes |
is |
T1524 |
4250-4259 |
VBN |
denotes |
regulated |
T1525 |
4260-4267 |
IN |
denotes |
through |
T1526 |
4268-4275 |
NN |
denotes |
protein |
T1527 |
4276-4282 |
NN |
denotes |
kinase |
T1528 |
4283-4284 |
DT |
denotes |
A |
T1529 |
4285-4286 |
-LRB- |
denotes |
( |
T1530 |
4286-4289 |
NNP |
denotes |
PKA |
T1531 |
4289-4290 |
-RRB- |
denotes |
) |
T1532 |
4291-4294 |
CC |
denotes |
and |
T1533 |
4295-4299 |
NNP |
denotes |
IKKβ |
T1534 |
4300-4312 |
RB |
denotes |
respectively |
T1535 |
4312-4313 |
NNP |
denotes |
[ |
T1536 |
4313-4315 |
CD |
denotes |
16 |
T1537 |
4315-4316 |
NNP |
denotes |
] |
T1538 |
4316-4317 |
, |
denotes |
, |
T1539 |
4318-4319 |
NNP |
denotes |
[ |
T1540 |
4319-4321 |
CD |
denotes |
19 |
T1541 |
4321-4322 |
NNP |
denotes |
] |
T1542 |
4322-4323 |
. |
denotes |
. |
T1543 |
4324-4326 |
IN |
denotes |
In |
T1544 |
4327-4332 |
JJ |
denotes |
human |
T1545 |
4333-4334 |
NNP |
denotes |
T |
T1546 |
4335-4340 |
NNS |
denotes |
cells |
T1547 |
4340-4341 |
, |
denotes |
, |
T1548 |
4342-4347 |
NNP |
denotes |
NF-κB |
T1549 |
4348-4351 |
CD |
denotes |
p65 |
T1550 |
4352-4354 |
VBZ |
denotes |
is |
T1551 |
4355-4369 |
RB |
denotes |
constitutively |
T1552 |
4370-4384 |
VBN |
denotes |
phosphorylated |
T1553 |
4385-4387 |
IN |
denotes |
on |
T1554 |
4388-4394 |
CD |
denotes |
Ser536 |
T1555 |
4395-4397 |
TO |
denotes |
to |
T1556 |
4398-4408 |
VB |
denotes |
facilitate |
T1557 |
4409-4414 |
NNP |
denotes |
NF-κB |
T1558 |
4415-4418 |
CD |
denotes |
p65 |
T1559 |
4419-4426 |
JJ |
denotes |
nuclear |
T1560 |
4427-4440 |
NN |
denotes |
translocation |
T1561 |
4441-4450 |
VBG |
denotes |
following |
T1562 |
4451-4459 |
JJ |
denotes |
cellular |
T1563 |
4460-4471 |
NN |
denotes |
stimulation |
T1564 |
4472-4473 |
NNP |
denotes |
[ |
T1565 |
4473-4475 |
CD |
denotes |
20 |
T1566 |
4475-4476 |
NNP |
denotes |
] |
T1567 |
4476-4477 |
. |
denotes |
. |
T1568 |
4478-4490 |
VBG |
denotes |
Accumulating |
T1569 |
4491-4499 |
NN |
denotes |
evidence |
T1570 |
4500-4507 |
VBZ |
denotes |
reveals |
T1571 |
4508-4512 |
IN |
denotes |
that |
T1572 |
4513-4518 |
NNP |
denotes |
NF-κB |
T1573 |
4519-4522 |
CD |
denotes |
p65 |
T1574 |
4523-4538 |
NN |
denotes |
phosphorylation |
T1575 |
4539-4541 |
IN |
denotes |
at |
T1576 |
4542-4548 |
NNP |
denotes |
Ser276 |
T1577 |
4549-4551 |
VBZ |
denotes |
is |
T1578 |
4552-4559 |
JJ |
denotes |
crucial |
T1579 |
4560-4563 |
IN |
denotes |
for |
T1580 |
4564-4567 |
PRP$ |
denotes |
its |
T1581 |
4568-4583 |
JJ |
denotes |
transcriptional |
T1582 |
4584-4592 |
NN |
denotes |
activity |
T1583 |
4592-4593 |
. |
denotes |
. |
T1584 |
4594-4598 |
IN |
denotes |
Upon |
T1585 |
4599-4606 |
JJ |
denotes |
nuclear |
T1586 |
4607-4620 |
NN |
denotes |
translocation |
T1587 |
4620-4621 |
, |
denotes |
, |
T1588 |
4622-4637 |
NN |
denotes |
phosphorylation |
T1589 |
4638-4640 |
IN |
denotes |
of |
T1590 |
4641-4647 |
NNP |
denotes |
Ser276 |
T1591 |
4648-4650 |
IN |
denotes |
on |
T1592 |
4651-4656 |
NNP |
denotes |
NF-κB |
T1593 |
4657-4660 |
CD |
denotes |
p65 |
T1594 |
4661-4663 |
IN |
denotes |
by |
T1595 |
4664-4667 |
NNP |
denotes |
PKA |
T1596 |
4668-4676 |
VBZ |
denotes |
recruits |
T1597 |
4677-4680 |
DT |
denotes |
the |
T1598 |
4681-4694 |
NN |
denotes |
transcription |
T1599 |
4695-4707 |
NN |
denotes |
co-activator |
T1600 |
4707-4708 |
, |
denotes |
, |
T1601 |
4709-4713 |
CD |
denotes |
p300 |
T1602 |
4714-4716 |
TO |
denotes |
to |
T1603 |
4717-4727 |
VB |
denotes |
potentiate |
T1604 |
4728-4743 |
JJ |
denotes |
NF-κB-regulated |
T1605 |
4744-4748 |
NN |
denotes |
gene |
T1606 |
4749-4762 |
NN |
denotes |
transcription |
T1607 |
4763-4764 |
NNP |
denotes |
[ |
T1608 |
4764-4766 |
CD |
denotes |
21 |
T1609 |
4766-4767 |
NNP |
denotes |
] |
T1610 |
4767-4768 |
. |
denotes |
. |
T1611 |
4769-4776 |
RB |
denotes |
However |
T1612 |
4776-4777 |
, |
denotes |
, |
T1613 |
4778-4783 |
JJ |
denotes |
other |
T1614 |
4784-4791 |
NNS |
denotes |
studies |
T1615 |
4792-4796 |
VBP |
denotes |
show |
T1616 |
4797-4801 |
IN |
denotes |
that |
T1617 |
4802-4805 |
NNP |
denotes |
PKA |
T1618 |
4806-4814 |
VBZ |
denotes |
inhibits |
T1619 |
4815-4830 |
JJ |
denotes |
NF-κB-regulated |
T1620 |
4831-4835 |
NN |
denotes |
gene |
T1621 |
4836-4846 |
NN |
denotes |
expression |
T1622 |
4847-4849 |
IN |
denotes |
by |
T1623 |
4850-4861 |
VBG |
denotes |
stabilizing |
T1624 |
4862-4866 |
NNP |
denotes |
IκBα |
T1625 |
4867-4868 |
NNP |
denotes |
[ |
T1626 |
4868-4870 |
CD |
denotes |
22 |
T1627 |
4870-4871 |
NNP |
denotes |
] |
T1628 |
4871-4872 |
, |
denotes |
, |
T1629 |
4873-4874 |
NNP |
denotes |
[ |
T1630 |
4874-4876 |
CD |
denotes |
23 |
T1631 |
4876-4877 |
NNP |
denotes |
] |
T1632 |
4877-4878 |
. |
denotes |
. |
T1633 |
4879-4892 |
RB |
denotes |
Interestingly |
T1634 |
4892-4893 |
, |
denotes |
, |
T1635 |
4894-4897 |
DT |
denotes |
the |
T1636 |
4898-4914 |
JJ |
denotes |
serine/threonine |
T1637 |
4915-4921 |
NN |
denotes |
kinase |
T1638 |
4922-4927 |
NN |
denotes |
Pim-1 |
T1639 |
4928-4936 |
RB |
denotes |
directly |
T1640 |
4937-4951 |
VBZ |
denotes |
phosphorylates |
T1641 |
4952-4957 |
NNP |
denotes |
NF-κB |
T1642 |
4958-4961 |
CD |
denotes |
p65 |
T1643 |
4962-4964 |
IN |
denotes |
at |
T1644 |
4965-4971 |
CD |
denotes |
Ser276 |
T1645 |
4972-4974 |
IN |
denotes |
by |
T1646 |
4975-4986 |
VBG |
denotes |
stabilizing |
T1647 |
4987-4989 |
TO |
denotes |
to |
T1648 |
4990-4997 |
VB |
denotes |
prevent |
T1649 |
4998-5018 |
JJ |
denotes |
ubiquitin-proteasome |
T1650 |
5019-5030 |
NN |
denotes |
degradation |
T1651 |
5031-5032 |
NNP |
denotes |
[ |
T1652 |
5032-5034 |
CD |
denotes |
24 |
T1653 |
5034-5035 |
NNP |
denotes |
] |
T1654 |
5035-5036 |
. |
denotes |
. |
T1655 |
5037-5044 |
JJ |
denotes |
Several |
T1656 |
5045-5050 |
JJ |
denotes |
other |
T1657 |
5051-5066 |
NN |
denotes |
phosphorylation |
T1658 |
5067-5072 |
NNS |
denotes |
sites |
T1659 |
5073-5076 |
VBP |
denotes |
are |
T1660 |
5077-5081 |
RB |
denotes |
also |
T1661 |
5082-5091 |
VBN |
denotes |
described |
T1662 |
5092-5094 |
TO |
denotes |
to |
T1663 |
5095-5102 |
VB |
denotes |
enhance |
T1664 |
5103-5108 |
JJ |
denotes |
NF-κB |
T1665 |
5109-5113 |
NN |
denotes |
gene |
T1666 |
5114-5129 |
NN |
denotes |
transactivation |
T1667 |
5130-5131 |
NNP |
denotes |
[ |
T1668 |
5131-5133 |
CD |
denotes |
25 |
T1669 |
5133-5134 |
NNP |
denotes |
] |
T1670 |
5134-5135 |
. |
denotes |
. |
T1671 |
5136-5140 |
RB |
denotes |
Here |
T1672 |
5140-5141 |
, |
denotes |
, |
T1673 |
5142-5144 |
PRP |
denotes |
we |
T1674 |
5145-5156 |
VBP |
denotes |
investigate |
T1675 |
5157-5160 |
DT |
denotes |
the |
T1676 |
5161-5165 |
NN |
denotes |
role |
T1677 |
5166-5168 |
IN |
denotes |
of |
T1678 |
5169-5176 |
NN |
denotes |
protein |
T1679 |
5177-5183 |
NN |
denotes |
kinase |
T1680 |
5184-5185 |
NNP |
denotes |
C |
T1681 |
5186-5187 |
-LRB- |
denotes |
( |
T1682 |
5187-5190 |
NNP |
denotes |
PKC |
T1683 |
5190-5191 |
-RRB- |
denotes |
) |
T1684 |
5192-5194 |
IN |
denotes |
in |
T1685 |
5195-5211 |
NNP |
denotes |
M-CSF-stimulated |
T1686 |
5212-5217 |
NNP |
denotes |
NF-κB |
T1687 |
5218-5228 |
NN |
denotes |
activation |
T1688 |
5228-5229 |
. |
denotes |
. |
T1689 |
5230-5233 |
NNP |
denotes |
PKC |
T1690 |
5234-5242 |
NNS |
denotes |
proteins |
T1691 |
5243-5246 |
VBP |
denotes |
are |
T1692 |
5247-5262 |
JJ |
denotes |
multifunctional |
T1693 |
5263-5270 |
NNS |
denotes |
kinases |
T1694 |
5271-5275 |
WDT |
denotes |
that |
T1695 |
5276-5282 |
VBP |
denotes |
differ |
T1696 |
5283-5285 |
IN |
denotes |
in |
T1697 |
5286-5295 |
NN |
denotes |
structure |
T1698 |
5295-5296 |
, |
denotes |
, |
T1699 |
5297-5305 |
NN |
denotes |
function |
T1700 |
5306-5309 |
CC |
denotes |
and |
T1701 |
5310-5319 |
NN |
denotes |
co-factor |
T1702 |
5320-5331 |
NN |
denotes |
requirement |
T1703 |
5332-5333 |
NNP |
denotes |
[ |
T1704 |
5333-5335 |
CD |
denotes |
26 |
T1705 |
5335-5336 |
NNP |
denotes |
] |
T1706 |
5336-5337 |
. |
denotes |
. |
T1707 |
5338-5342 |
NNS |
denotes |
PKCs |
T1708 |
5343-5346 |
VBP |
denotes |
are |
T1709 |
5347-5355 |
VBN |
denotes |
involved |
T1710 |
5356-5358 |
IN |
denotes |
in |
T1711 |
5359-5366 |
JJ |
denotes |
diverse |
T1712 |
5367-5371 |
NN |
denotes |
cell |
T1713 |
5372-5381 |
NNS |
denotes |
responses |
T1714 |
5381-5382 |
, |
denotes |
, |
T1715 |
5383-5392 |
VBG |
denotes |
including |
T1716 |
5393-5397 |
NN |
denotes |
cell |
T1717 |
5398-5404 |
NN |
denotes |
growth |
T1718 |
5404-5405 |
, |
denotes |
, |
T1719 |
5406-5414 |
NN |
denotes |
survival |
T1720 |
5414-5415 |
, |
denotes |
, |
T1721 |
5416-5431 |
NN |
denotes |
differentiation |
T1722 |
5432-5435 |
CC |
denotes |
and |
T1723 |
5436-5447 |
NN |
denotes |
development |
T1724 |
5448-5449 |
NNP |
denotes |
[ |
T1725 |
5449-5451 |
CD |
denotes |
27 |
T1726 |
5451-5452 |
NNP |
denotes |
] |
T1727 |
5452-5453 |
. |
denotes |
. |
T1728 |
5454-5457 |
DT |
denotes |
The |
T1729 |
5458-5460 |
CD |
denotes |
12 |
T1730 |
5461-5468 |
RB |
denotes |
closely |
T1731 |
5469-5476 |
JJ |
denotes |
related |
T1732 |
5477-5484 |
NNS |
denotes |
enzymes |
T1733 |
5485-5487 |
IN |
denotes |
of |
T1734 |
5488-5491 |
DT |
denotes |
the |
T1735 |
5492-5495 |
NNP |
denotes |
PKC |
T1736 |
5496-5502 |
NN |
denotes |
family |
T1737 |
5503-5506 |
VBP |
denotes |
are |
T1738 |
5507-5514 |
VBN |
denotes |
divided |
T1739 |
5515-5519 |
IN |
denotes |
into |
T1740 |
5520-5525 |
CD |
denotes |
three |
T1741 |
5526-5533 |
NNS |
denotes |
classes |
T1742 |
5533-5534 |
: |
denotes |
: |
T1743 |
5535-5547 |
JJ |
denotes |
conventional |
T1744 |
5548-5549 |
-LRB- |
denotes |
( |
T1745 |
5549-5554 |
NNS |
denotes |
cPKCs |
T1746 |
5554-5555 |
: |
denotes |
: |
T1747 |
5556-5557 |
VB |
denotes |
α |
T1748 |
5558-5560 |
NNP |
denotes |
βI |
T1749 |
5561-5564 |
NNP |
denotes |
βII |
T1750 |
5565-5568 |
CC |
denotes |
and |
T1751 |
5569-5570 |
NNP |
denotes |
γ |
T1752 |
5571-5578 |
VBP |
denotes |
require |
T1753 |
5579-5582 |
JJ |
denotes |
Ca2 |
T1754 |
5582-5583 |
NN |
denotes |
+ |
T1755 |
5584-5587 |
CC |
denotes |
and |
T1756 |
5588-5602 |
NN |
denotes |
diacylglycerol |
T1757 |
5603-5604 |
-LRB- |
denotes |
( |
T1758 |
5604-5607 |
NNP |
denotes |
DAG |
T1759 |
5607-5608 |
-RRB- |
denotes |
) |
T1760 |
5608-5609 |
: |
denotes |
; |
T1761 |
5610-5615 |
NN |
denotes |
novel |
T1762 |
5616-5617 |
-LRB- |
denotes |
( |
T1763 |
5617-5622 |
NNS |
denotes |
nPKCs |
T1764 |
5622-5623 |
: |
denotes |
: |
T1765 |
5624-5625 |
VB |
denotes |
δ |
T1766 |
5625-5626 |
, |
denotes |
, |
T1767 |
5627-5628 |
VB |
denotes |
ε |
T1768 |
5628-5629 |
, |
denotes |
, |
T1769 |
5630-5631 |
VB |
denotes |
η |
T1770 |
5631-5632 |
, |
denotes |
, |
T1771 |
5633-5634 |
VB |
denotes |
θ |
T1772 |
5635-5638 |
CC |
denotes |
and |
T1773 |
5639-5640 |
VB |
denotes |
μ |
T1774 |
5640-5641 |
-RRB- |
denotes |
) |
T1775 |
5642-5649 |
VBP |
denotes |
require |
T1776 |
5650-5653 |
NNP |
denotes |
DAG |
T1777 |
5653-5654 |
: |
denotes |
; |
T1778 |
5655-5658 |
CC |
denotes |
and |
T1779 |
5659-5667 |
JJ |
denotes |
atypical |
T1780 |
5668-5669 |
-LRB- |
denotes |
( |
T1781 |
5669-5674 |
NNS |
denotes |
aPKCs |
T1782 |
5674-5675 |
: |
denotes |
: |
T1783 |
5676-5677 |
VB |
denotes |
ξ |
T1784 |
5677-5678 |
, |
denotes |
, |
T1785 |
5679-5680 |
VB |
denotes |
ι |
T1786 |
5681-5684 |
CC |
denotes |
and |
T1787 |
5685-5686 |
VB |
denotes |
λ |
T1788 |
5686-5687 |
-RRB- |
denotes |
) |
T1789 |
5688-5695 |
VBP |
denotes |
require |
T1790 |
5696-5703 |
CC |
denotes |
neither |
T1791 |
5704-5707 |
VBP |
denotes |
Ca2 |
T1792 |
5707-5708 |
CD |
denotes |
+ |
T1793 |
5709-5712 |
CC |
denotes |
nor |
T1794 |
5713-5716 |
NNP |
denotes |
DAG |
T1795 |
5716-5717 |
. |
denotes |
. |
T1796 |
5718-5727 |
NNS |
denotes |
Monocytes |
T1797 |
5728-5731 |
CC |
denotes |
and |
T1798 |
5732-5743 |
NNS |
denotes |
macrophages |
T1799 |
5744-5757 |
RB |
denotes |
predominantly |
T1800 |
5758-5765 |
VBP |
denotes |
express |
T1801 |
5766-5778 |
JJ |
denotes |
conventional |
T1802 |
5779-5782 |
NNP |
denotes |
PKC |
T1803 |
5783-5791 |
NNS |
denotes |
isoforms |
T1804 |
5792-5793 |
-LRB- |
denotes |
( |
T1805 |
5793-5797 |
NNP |
denotes |
PKCα |
T1806 |
5798-5803 |
NNP |
denotes |
PKCβI |
T1807 |
5804-5807 |
CC |
denotes |
and |
T1808 |
5808-5814 |
NNP |
denotes |
PKCβII |
T1809 |
5814-5815 |
-RRB- |
denotes |
) |
T1810 |
5816-5819 |
CC |
denotes |
and |
T1811 |
5820-5825 |
JJ |
denotes |
novel |
T1812 |
5826-5830 |
NNS |
denotes |
PKCs |
T1813 |
5831-5832 |
-LRB- |
denotes |
( |
T1814 |
5832-5836 |
NNP |
denotes |
PKCδ |
T1815 |
5837-5840 |
CC |
denotes |
and |
T1816 |
5841-5845 |
NNP |
denotes |
PKCε |
T1817 |
5845-5846 |
-RRB- |
denotes |
) |
T1818 |
5846-5847 |
. |
denotes |
. |
T1819 |
5848-5860 |
JJ |
denotes |
Conventional |
T1820 |
5861-5865 |
NNS |
denotes |
PKCs |
T1821 |
5866-5874 |
VB |
denotes |
regulate |
T1822 |
5875-5890 |
NN |
denotes |
differentiation |
T1823 |
5891-5893 |
IN |
denotes |
of |
T1824 |
5894-5897 |
DT |
denotes |
the |
T1825 |
5898-5903 |
JJ |
denotes |
human |
T1826 |
5904-5917 |
JJ |
denotes |
promyelocytic |
T1827 |
5918-5926 |
NN |
denotes |
leukemia |
T1828 |
5927-5931 |
NN |
denotes |
cell |
T1829 |
5932-5936 |
NN |
denotes |
line |
T1830 |
5937-5941 |
CD |
denotes |
HL60 |
T1831 |
5942-5944 |
TO |
denotes |
to |
T1832 |
5945-5956 |
NNS |
denotes |
macrophages |
T1833 |
5957-5958 |
NNP |
denotes |
[ |
T1834 |
5958-5960 |
CD |
denotes |
28 |
T1835 |
5960-5961 |
NNP |
denotes |
] |
T1836 |
5961-5962 |
. |
denotes |
. |
T1837 |
5963-5967 |
NNP |
denotes |
PKCα |
T1838 |
5968-5975 |
VBZ |
denotes |
induces |
T1839 |
5976-5981 |
NNP |
denotes |
IL-1α |
T1840 |
5981-5982 |
, |
denotes |
, |
T1841 |
5983-5987 |
NNP |
denotes |
iNOS |
T1842 |
5988-5991 |
CC |
denotes |
and |
T1843 |
5992-5996 |
NNP |
denotes |
TNFα |
T1844 |
5997-6001 |
NNP |
denotes |
mRNA |
T1845 |
6002-6012 |
NN |
denotes |
production |
T1846 |
6013-6018 |
IN |
denotes |
after |
T1847 |
6019-6037 |
NN |
denotes |
lipopolysaccharide |
T1848 |
6038-6039 |
-LRB- |
denotes |
( |
T1849 |
6039-6042 |
NNP |
denotes |
LPS |
T1850 |
6042-6043 |
-RRB- |
denotes |
) |
T1851 |
6044-6052 |
NN |
denotes |
exposure |
T1852 |
6053-6054 |
NNP |
denotes |
[ |
T1853 |
6054-6056 |
CD |
denotes |
29 |
T1854 |
6056-6057 |
NNP |
denotes |
] |
T1855 |
6057-6058 |
. |
denotes |
. |
T1856 |
6059-6061 |
IN |
denotes |
In |
T1857 |
6062-6070 |
NN |
denotes |
addition |
T1858 |
6070-6071 |
, |
denotes |
, |
T1859 |
6072-6084 |
VBG |
denotes |
accumulating |
T1860 |
6085-6093 |
NN |
denotes |
evidence |
T1861 |
6094-6102 |
VBZ |
denotes |
suggests |
T1862 |
6103-6107 |
IN |
denotes |
that |
T1863 |
6108-6120 |
JJ |
denotes |
conventional |
T1864 |
6121-6125 |
NNS |
denotes |
PKCs |
T1865 |
6126-6130 |
IN |
denotes |
like |
T1866 |
6131-6135 |
NNP |
denotes |
PKCα |
T1867 |
6136-6140 |
VBP |
denotes |
have |
T1868 |
6141-6155 |
JJ |
denotes |
anti-apoptotic |
T1869 |
6156-6165 |
NNS |
denotes |
functions |
T1870 |
6165-6166 |
. |
denotes |
. |
T1871 |
6167-6170 |
IN |
denotes |
For |
T1872 |
6171-6178 |
NN |
denotes |
example |
T1873 |
6178-6179 |
, |
denotes |
, |
T1874 |
6180-6184 |
NNP |
denotes |
PKCα |
T1875 |
6185-6187 |
VBZ |
denotes |
is |
T1876 |
6188-6201 |
VBN |
denotes |
overexpressed |
T1877 |
6202-6204 |
IN |
denotes |
in |
T1878 |
6205-6206 |
DT |
denotes |
a |
T1879 |
6207-6214 |
NN |
denotes |
variety |
T1880 |
6215-6217 |
IN |
denotes |
of |
T1881 |
6218-6223 |
NN |
denotes |
tumor |
T1882 |
6224-6229 |
NNS |
denotes |
cells |
T1883 |
6230-6239 |
VBG |
denotes |
including |
T1884 |
6240-6247 |
NNS |
denotes |
gliomas |
T1885 |
6247-6248 |
, |
denotes |
, |
T1886 |
6249-6254 |
NN |
denotes |
liver |
T1887 |
6254-6255 |
, |
denotes |
, |
T1888 |
6256-6259 |
CC |
denotes |
and |
T1889 |
6260-6264 |
NN |
denotes |
lung |
T1890 |
6265-6266 |
NNP |
denotes |
[ |
T1891 |
6266-6268 |
CD |
denotes |
30 |
T1892 |
6268-6269 |
NNP |
denotes |
] |
T1893 |
6269-6270 |
, |
denotes |
, |
T1894 |
6271-6272 |
NNP |
denotes |
[ |
T1895 |
6272-6274 |
CD |
denotes |
31 |
T1896 |
6274-6275 |
NNP |
denotes |
] |
T1897 |
6275-6276 |
. |
denotes |
. |
T1898 |
6277-6279 |
IN |
denotes |
In |
T1899 |
6280-6290 |
JJ |
denotes |
epithelial |
T1900 |
6291-6296 |
NNS |
denotes |
cells |
T1901 |
6296-6297 |
, |
denotes |
, |
T1902 |
6298-6308 |
NN |
denotes |
inhibition |
T1903 |
6309-6311 |
IN |
denotes |
of |
T1904 |
6312-6316 |
NNP |
denotes |
PKCα |
T1905 |
6317-6324 |
VBZ |
denotes |
induces |
T1906 |
6325-6339 |
JJ |
denotes |
PKCδ-dependent |
T1907 |
6340-6349 |
NN |
denotes |
apoptosis |
T1908 |
6350-6351 |
NNP |
denotes |
[ |
T1909 |
6351-6353 |
CD |
denotes |
31 |
T1910 |
6353-6354 |
NNP |
denotes |
] |
T1911 |
6354-6355 |
. |
denotes |
. |
T1912 |
6356-6369 |
RB |
denotes |
Interestingly |
T1913 |
6369-6370 |
, |
denotes |
, |
T1914 |
6371-6373 |
IN |
denotes |
in |
T1915 |
6374-6379 |
JJ |
denotes |
human |
T1916 |
6380-6389 |
NNS |
denotes |
monocytes |
T1917 |
6390-6393 |
CC |
denotes |
and |
T1918 |
6394-6406 |
JJ |
denotes |
premonocytic |
T1919 |
6407-6412 |
NN |
denotes |
THP-1 |
T1920 |
6413-6421 |
NN |
denotes |
leukemia |
T1921 |
6422-6427 |
NNS |
denotes |
cells |
T1922 |
6427-6428 |
, |
denotes |
, |
T1923 |
6429-6434 |
NN |
denotes |
novel |
T1924 |
6435-6439 |
NNS |
denotes |
PKCs |
T1925 |
6440-6444 |
IN |
denotes |
like |
T1926 |
6445-6449 |
NNP |
denotes |
PKCδ |
T1927 |
6450-6454 |
VBP |
denotes |
have |
T1928 |
6455-6458 |
DT |
denotes |
the |
T1929 |
6459-6467 |
JJ |
denotes |
opposite |
T1930 |
6468-6474 |
NN |
denotes |
effect |
T1931 |
6475-6477 |
IN |
denotes |
on |
T1932 |
6478-6482 |
NN |
denotes |
cell |
T1933 |
6483-6491 |
NN |
denotes |
survival |
T1934 |
6491-6492 |
, |
denotes |
, |
T1935 |
6493-6497 |
NNP |
denotes |
Voss |
T1936 |
6498-6500 |
FW |
denotes |
et |
T1937 |
6501-6503 |
FW |
denotes |
al |
T1938 |
6504-6510 |
VBD |
denotes |
showed |
T1939 |
6511-6515 |
IN |
denotes |
that |
T1940 |
6516-6520 |
NNP |
denotes |
PKCδ |
T1941 |
6521-6529 |
RB |
denotes |
directly |
T1942 |
6530-6544 |
VBZ |
denotes |
phosphorylates |
T1943 |
6545-6554 |
JJ |
denotes |
caspase-3 |
T1944 |
6555-6558 |
CC |
denotes |
and |
T1945 |
6559-6567 |
VBZ |
denotes |
promotes |
T1946 |
6568-6585 |
JJ |
denotes |
etoposide-induced |
T1947 |
6586-6595 |
NN |
denotes |
apoptosis |
T1948 |
6596-6597 |
NNP |
denotes |
[ |
T1949 |
6597-6599 |
CD |
denotes |
32 |
T1950 |
6599-6600 |
NNP |
denotes |
] |
T1951 |
6600-6601 |
. |
denotes |
. |
T1952 |
6602-6610 |
RB |
denotes |
Moreover |
T1953 |
6610-6611 |
, |
denotes |
, |
T1954 |
6612-6620 |
NN |
denotes |
knockout |
T1955 |
6621-6626 |
NN |
denotes |
mouse |
T1956 |
6627-6634 |
NNS |
denotes |
studies |
T1957 |
6635-6642 |
VBP |
denotes |
suggest |
T1958 |
6643-6647 |
IN |
denotes |
that |
T1959 |
6648-6655 |
DT |
denotes |
another |
T1960 |
6656-6661 |
NN |
denotes |
novel |
T1961 |
6662-6665 |
NNP |
denotes |
PKC |
T1962 |
6665-6666 |
, |
denotes |
, |
T1963 |
6667-6671 |
NNP |
denotes |
PKCε |
T1964 |
6672-6674 |
VBZ |
denotes |
is |
T1965 |
6675-6685 |
RB |
denotes |
critically |
T1966 |
6686-6694 |
VBN |
denotes |
involved |
T1967 |
6695-6697 |
IN |
denotes |
in |
T1968 |
6698-6703 |
JJ |
denotes |
early |
T1969 |
6704-6716 |
JJ |
denotes |
LPS-mediated |
T1970 |
6717-6726 |
VBG |
denotes |
signaling |
T1971 |
6727-6729 |
IN |
denotes |
in |
T1972 |
6730-6739 |
VBN |
denotes |
activated |
T1973 |
6740-6751 |
NNS |
denotes |
macrophages |
T1974 |
6752-6753 |
NNP |
denotes |
[ |
T1975 |
6753-6755 |
CD |
denotes |
33 |
T1976 |
6755-6756 |
NNP |
denotes |
] |
T1977 |
6756-6757 |
. |
denotes |
. |
T1978 |
6758-6768 |
RB |
denotes |
Previously |
T1979 |
6768-6769 |
, |
denotes |
, |
T1980 |
6770-6772 |
PRP |
denotes |
we |
T1981 |
6773-6781 |
VBD |
denotes |
reported |
T1982 |
6782-6786 |
IN |
denotes |
that |
T1983 |
6787-6792 |
NNP |
denotes |
M-CSF |
T1984 |
6793-6801 |
VBZ |
denotes |
promotes |
T1985 |
6802-6810 |
NN |
denotes |
monocyte |
T1986 |
6811-6819 |
NN |
denotes |
survival |
T1987 |
6820-6827 |
IN |
denotes |
through |
T1988 |
6828-6831 |
DT |
denotes |
the |
T1989 |
6832-6842 |
NN |
denotes |
activation |
T1990 |
6843-6845 |
IN |
denotes |
of |
T1991 |
6846-6849 |
DT |
denotes |
the |
T1992 |
6850-6859 |
NN |
denotes |
PI3-K/AKT |
T1993 |
6860-6867 |
NN |
denotes |
pathway |
T1994 |
6868-6869 |
NNP |
denotes |
[ |
T1995 |
6869-6870 |
CD |
denotes |
3 |
T1996 |
6870-6871 |
NNP |
denotes |
] |
T1997 |
6871-6872 |
. |
denotes |
. |
T1998 |
6873-6875 |
IN |
denotes |
In |
T1999 |
6876-6884 |
NN |
denotes |
addition |
T2000 |
6885-6887 |
TO |
denotes |
to |
T2001 |
6888-6891 |
NNP |
denotes |
AKT |
T2002 |
6892-6902 |
NN |
denotes |
activation |
T2003 |
6902-6903 |
, |
denotes |
, |
T2004 |
6904-6909 |
NNP |
denotes |
M-CSF |
T2005 |
6910-6920 |
VBZ |
denotes |
stimulates |
T2006 |
6921-6924 |
NNP |
denotes |
PKC |
T2007 |
6925-6927 |
IN |
denotes |
in |
T2008 |
6928-6933 |
JJ |
denotes |
human |
T2009 |
6934-6943 |
NNS |
denotes |
monocytes |
T2010 |
6944-6947 |
CC |
denotes |
and |
T2011 |
6948-6957 |
NNS |
denotes |
increases |
T2012 |
6958-6963 |
NNP |
denotes |
NF-κB |
T2013 |
6964-6967 |
NNP |
denotes |
DNA |
T2014 |
6968-6975 |
JJ |
denotes |
binding |
T2015 |
6976-6977 |
NNP |
denotes |
[ |
T2016 |
6977-6979 |
CD |
denotes |
34 |
T2017 |
6979-6980 |
NNP |
denotes |
] |
T2018 |
6980-6981 |
. |
denotes |
. |
T2019 |
6982-6989 |
RB |
denotes |
However |
T2020 |
6989-6990 |
, |
denotes |
, |
T2021 |
6991-6998 |
IN |
denotes |
whether |
T2022 |
6999-7002 |
NNP |
denotes |
PKC |
T2023 |
7003-7009 |
CC |
denotes |
and/or |
T2024 |
7010-7015 |
NNP |
denotes |
NF-κB |
T2025 |
7016-7026 |
NN |
denotes |
activation |
T2026 |
7027-7029 |
VBZ |
denotes |
is |
T2027 |
7030-7038 |
JJ |
denotes |
critical |
T2028 |
7039-7041 |
IN |
denotes |
in |
T2029 |
7042-7058 |
JJ |
denotes |
M-CSF-stimulated |
T2030 |
7059-7070 |
NN |
denotes |
mononuclear |
T2031 |
7071-7080 |
NN |
denotes |
phagocyte |
T2032 |
7081-7089 |
NN |
denotes |
survival |
T2033 |
7090-7096 |
CC |
denotes |
and/or |
T2034 |
7097-7112 |
NN |
denotes |
differentiation |
T2035 |
7113-7115 |
VBZ |
denotes |
is |
T2036 |
7116-7123 |
JJ |
denotes |
unclear |
T2037 |
7123-7124 |
. |
denotes |
. |
T2038 |
7125-7127 |
IN |
denotes |
In |
T2039 |
7128-7133 |
JJ |
denotes |
other |
T2040 |
7134-7139 |
NNS |
denotes |
cells |
T2041 |
7139-7140 |
, |
denotes |
, |
T2042 |
7141-7144 |
NNP |
denotes |
PKC |
T2043 |
7145-7150 |
VBZ |
denotes |
plays |
T2044 |
7151-7153 |
DT |
denotes |
an |
T2045 |
7154-7163 |
JJ |
denotes |
important |
T2046 |
7164-7168 |
NN |
denotes |
role |
T2047 |
7169-7171 |
IN |
denotes |
in |
T2048 |
7172-7177 |
JJ |
denotes |
NF-κB |
T2049 |
7178-7188 |
NN |
denotes |
activation |
T2050 |
7189-7192 |
CC |
denotes |
and |
T2051 |
7193-7197 |
NN |
denotes |
cell |
T2052 |
7198-7206 |
NN |
denotes |
survival |
T2053 |
7207-7208 |
NNP |
denotes |
[ |
T2054 |
7208-7210 |
CD |
denotes |
35 |
T2055 |
7210-7211 |
NNP |
denotes |
] |
T2056 |
7211-7212 |
, |
denotes |
, |
T2057 |
7213-7220 |
RB |
denotes |
however |
T2058 |
7221-7224 |
DT |
denotes |
the |
T2059 |
7225-7233 |
JJ |
denotes |
specific |
T2060 |
7234-7244 |
NNS |
denotes |
mechanisms |
T2061 |
7245-7247 |
IN |
denotes |
of |
T2062 |
7248-7252 |
DT |
denotes |
this |
T2063 |
7253-7263 |
NN |
denotes |
activation |
T2064 |
7264-7267 |
CC |
denotes |
and |
T2065 |
7268-7271 |
DT |
denotes |
the |
T2066 |
7272-7282 |
JJ |
denotes |
biological |
T2067 |
7283-7290 |
NNS |
denotes |
effects |
T2068 |
7291-7293 |
IN |
denotes |
on |
T2069 |
7294-7302 |
JJ |
denotes |
cellular |
T2070 |
7303-7312 |
NN |
denotes |
phenotype |
T2071 |
7313-7316 |
VBP |
denotes |
are |
T2072 |
7317-7320 |
RB |
denotes |
not |
T2073 |
7321-7326 |
VBN |
denotes |
known |
T2074 |
7326-7327 |
. |
denotes |
. |
T2075 |
7328-7337 |
RB |
denotes |
Therefore |
T2076 |
7337-7338 |
, |
denotes |
, |
T2077 |
7339-7341 |
PRP |
denotes |
we |
T2078 |
7342-7349 |
VBD |
denotes |
focused |
T2079 |
7350-7352 |
IN |
denotes |
at |
T2080 |
7353-7366 |
VBG |
denotes |
understanding |
T2081 |
7367-7370 |
DT |
denotes |
the |
T2082 |
7371-7375 |
NN |
denotes |
role |
T2083 |
7376-7378 |
IN |
denotes |
of |
T2084 |
7379-7382 |
NNP |
denotes |
PKC |
T2085 |
7383-7385 |
IN |
denotes |
in |
T2086 |
7386-7389 |
DT |
denotes |
the |
T2087 |
7390-7400 |
NN |
denotes |
regulation |
T2088 |
7401-7403 |
IN |
denotes |
of |
T2089 |
7404-7409 |
JJ |
denotes |
NF-κB |
T2090 |
7410-7420 |
NN |
denotes |
activation |
T2091 |
7421-7424 |
CC |
denotes |
and |
T2092 |
7425-7438 |
JJ |
denotes |
M-CSF-induced |
T2093 |
7439-7447 |
NN |
denotes |
monocyte |
T2094 |
7448-7456 |
NN |
denotes |
survival |
T2095 |
7456-7457 |
. |
denotes |
. |
T2096 |
7458-7462 |
RB |
denotes |
Here |
T2097 |
7463-7465 |
PRP |
denotes |
we |
T2098 |
7466-7478 |
VBZ |
denotes |
demonstrates |
T2099 |
7479-7483 |
IN |
denotes |
that |
T2100 |
7484-7489 |
NNP |
denotes |
M-CSF |
T2101 |
7490-7501 |
VBD |
denotes |
upregulated |
T2102 |
7502-7505 |
DT |
denotes |
the |
T2103 |
7506-7511 |
JJ |
denotes |
NF-κB |
T2104 |
7512-7525 |
NN |
denotes |
transcription |
T2105 |
7526-7529 |
CC |
denotes |
and |
T2106 |
7530-7534 |
NN |
denotes |
cell |
T2107 |
7535-7543 |
NN |
denotes |
survival |
T2108 |
7544-7546 |
IN |
denotes |
in |
T2109 |
7547-7552 |
JJ |
denotes |
human |
T2110 |
7553-7556 |
CC |
denotes |
and |
T2111 |
7557-7562 |
NN |
denotes |
mouse |
T2112 |
7563-7574 |
NNS |
denotes |
macrophages |
T2113 |
7574-7575 |
. |
denotes |
. |
T2114 |
7576-7580 |
DT |
denotes |
This |
T2115 |
7581-7589 |
NN |
denotes |
activity |
T2116 |
7590-7593 |
VBD |
denotes |
was |
T2117 |
7594-7601 |
VBN |
denotes |
reduced |
T2118 |
7602-7604 |
IN |
denotes |
by |
T2119 |
7605-7608 |
DT |
denotes |
the |
T2120 |
7609-7621 |
JJ |
denotes |
conventional |
T2121 |
7621-7622 |
, |
denotes |
, |
T2122 |
7623-7626 |
CC |
denotes |
but |
T2123 |
7627-7630 |
RB |
denotes |
not |
T2124 |
7631-7636 |
JJ |
denotes |
novel |
T2125 |
7636-7637 |
, |
denotes |
, |
T2126 |
7638-7641 |
NNP |
denotes |
PKC |
T2127 |
7642-7652 |
NNS |
denotes |
inhibitors |
T2128 |
7652-7653 |
, |
denotes |
, |
T2129 |
7654-7662 |
JJ |
denotes |
dominant |
T2130 |
7663-7671 |
JJ |
denotes |
negative |
T2131 |
7672-7676 |
NNP |
denotes |
PKCα |
T2132 |
7677-7687 |
NNS |
denotes |
constructs |
T2133 |
7688-7690 |
CC |
denotes |
or |
T2134 |
7691-7695 |
NNP |
denotes |
PKCα |
T2135 |
7696-7701 |
NNP |
denotes |
siRNA |
T2136 |
7701-7702 |
. |
denotes |
. |
T2137 |
7703-7715 |
JJ |
denotes |
Conventional |
T2138 |
7716-7719 |
NNP |
denotes |
PKC |
T2139 |
7720-7729 |
VBN |
denotes |
regulated |
T2140 |
7730-7745 |
JJ |
denotes |
NF-κB-regulated |
T2141 |
7746-7750 |
NN |
denotes |
gene |
T2142 |
7751-7761 |
NN |
denotes |
expression |
T2143 |
7762-7765 |
CC |
denotes |
and |
T2144 |
7766-7781 |
NN |
denotes |
phosphorylation |
T2145 |
7782-7784 |
IN |
denotes |
of |
T2146 |
7785-7791 |
NNP |
denotes |
Ser276 |
T2147 |
7792-7794 |
IN |
denotes |
of |
T2148 |
7795-7800 |
NNP |
denotes |
NF-κB |
T2149 |
7801-7804 |
CD |
denotes |
p65 |
T2150 |
7805-7813 |
VBD |
denotes |
occurred |
T2151 |
7814-7816 |
IN |
denotes |
in |
T2152 |
7817-7819 |
DT |
denotes |
an |
T2153 |
7820-7835 |
JJ |
denotes |
M-CSF-dependent |
T2154 |
7836-7843 |
NN |
denotes |
fashion |
T2155 |
7844-7855 |
VBG |
denotes |
correlating |
T2156 |
7856-7860 |
IN |
denotes |
with |
T2157 |
7861-7864 |
PRP$ |
denotes |
its |
T2158 |
7865-7872 |
JJ |
denotes |
maximal |
T2159 |
7873-7888 |
JJ |
denotes |
transcriptional |
T2160 |
7889-7897 |
NN |
denotes |
activity |
T2161 |
7897-7898 |
. |
denotes |
. |
T2162 |
7899-7910 |
RB |
denotes |
Furthermore |
T2163 |
7910-7911 |
, |
denotes |
, |
T2164 |
7912-7926 |
JJ |
denotes |
PKCα-regulated |
T2165 |
7927-7942 |
NN |
denotes |
phosphorylation |
T2166 |
7943-7945 |
IN |
denotes |
of |
T2167 |
7946-7952 |
NNP |
denotes |
Ser276 |
T2168 |
7953-7955 |
IN |
denotes |
of |
T2169 |
7956-7961 |
NNP |
denotes |
NF-κB |
T2170 |
7962-7965 |
CD |
denotes |
p65 |
T2171 |
7966-7971 |
VBZ |
denotes |
plays |
T2172 |
7972-7974 |
DT |
denotes |
an |
T2173 |
7975-7984 |
JJ |
denotes |
important |
T2174 |
7985-7989 |
NN |
denotes |
role |
T2175 |
7990-7992 |
IN |
denotes |
in |
T2176 |
7993-8003 |
VBG |
denotes |
regulating |
T2177 |
8004-8007 |
PRP$ |
denotes |
its |
T2178 |
8008-8016 |
NN |
denotes |
activity |
T2179 |
8017-8019 |
IN |
denotes |
in |
T2180 |
8020-8031 |
NN |
denotes |
mononuclear |
T2181 |
8032-8042 |
NNS |
denotes |
phagocytes |
T2182 |
8043-8046 |
CC |
denotes |
and |
T2183 |
8047-8053 |
JJ |
denotes |
murine |
T2184 |
8054-8063 |
JJ |
denotes |
embryonic |
T2185 |
8064-8075 |
NNS |
denotes |
fibroblasts |
T2186 |
8075-8076 |
. |
denotes |
. |
T4674 |
8087-8092 |
NNP |
denotes |
M-CSF |
T4675 |
8093-8100 |
VBZ |
denotes |
Induces |
T4676 |
8101-8106 |
NNP |
denotes |
NF-κB |
T4677 |
8107-8122 |
NNP |
denotes |
Transcriptional |
T4678 |
8123-8131 |
NNP |
denotes |
Activity |
T4679 |
8132-8134 |
IN |
denotes |
in |
T4680 |
8135-8140 |
NNP |
denotes |
Human |
T4681 |
8141-8149 |
NNP |
denotes |
Monocyte |
T4682 |
8150-8157 |
NNP |
denotes |
Derived |
T4683 |
8158-8169 |
NNP |
denotes |
Macrophages |
T4684 |
8170-8171 |
-LRB- |
denotes |
( |
T4685 |
8171-8175 |
NNP |
denotes |
MDMs |
T4686 |
8175-8176 |
-RRB- |
denotes |
) |
T4687 |
8177-8180 |
CC |
denotes |
and |
T4688 |
8181-8186 |
NNP |
denotes |
Mouse |
T4689 |
8187-8197 |
NNP |
denotes |
Macrophage |
T4690 |
8198-8202 |
NNP |
denotes |
Cell |
T4691 |
8203-8207 |
NNP |
denotes |
Line |
T4692 |
8207-8208 |
, |
denotes |
, |
T4693 |
8209-8212 |
NNP |
denotes |
RAW |
T4694 |
8213-8218 |
CD |
denotes |
264.7 |
T4695 |
8219-8221 |
TO |
denotes |
To |
T4696 |
8222-8231 |
VB |
denotes |
determine |
T4697 |
8232-8234 |
IN |
denotes |
if |
T4698 |
8235-8240 |
NNP |
denotes |
M-CSF |
T4699 |
8241-8248 |
VBD |
denotes |
induced |
T4700 |
8249-8254 |
NNP |
denotes |
NF-κB |
T4701 |
8255-8258 |
NNP |
denotes |
DNA |
T4702 |
8259-8266 |
JJ |
denotes |
binding |
T4703 |
8267-8269 |
IN |
denotes |
in |
T4704 |
8270-8275 |
JJ |
denotes |
human |
T4705 |
8276-8287 |
NNS |
denotes |
macrophages |
T4706 |
8287-8288 |
, |
denotes |
, |
T4707 |
8289-8291 |
PRP |
denotes |
we |
T4708 |
8292-8301 |
VBD |
denotes |
performed |
T4709 |
8302-8306 |
NNP |
denotes |
EMSA |
T4710 |
8307-8315 |
NN |
denotes |
analysis |
T4711 |
8316-8318 |
IN |
denotes |
on |
T4712 |
8319-8326 |
JJ |
denotes |
nuclear |
T4713 |
8327-8334 |
NNS |
denotes |
lysates |
T4714 |
8335-8339 |
IN |
denotes |
from |
T4715 |
8340-8353 |
JJ |
denotes |
M-CSF-treated |
T4716 |
8354-8358 |
NNS |
denotes |
MDMs |
T4717 |
8358-8359 |
. |
denotes |
. |
T4718 |
8360-8367 |
JJ |
denotes |
Similar |
T4719 |
8368-8370 |
TO |
denotes |
to |
T4720 |
8371-8379 |
JJ |
denotes |
previous |
T4721 |
8380-8387 |
NNS |
denotes |
reports |
T4722 |
8388-8389 |
NNP |
denotes |
[ |
T4723 |
8389-8391 |
CD |
denotes |
11 |
T4724 |
8391-8392 |
NNP |
denotes |
] |
T4725 |
8392-8393 |
, |
denotes |
, |
T4726 |
8394-8401 |
JJ |
denotes |
nuclear |
T4727 |
8402-8407 |
NN |
denotes |
NF-κB |
T4728 |
8408-8422 |
RB |
denotes |
constitutively |
T4729 |
8423-8428 |
VBN |
denotes |
bound |
T4730 |
8429-8432 |
NN |
denotes |
DNA |
T4731 |
8433-8435 |
IN |
denotes |
in |
T4732 |
8436-8450 |
JJ |
denotes |
non-stimulated |
T4733 |
8451-8460 |
NNS |
denotes |
monocytes |
T4734 |
8461-8462 |
-LRB- |
denotes |
( |
T4735 |
8462-8468 |
NN |
denotes |
Figure |
T4736 |
8469-8471 |
CD |
denotes |
1A |
T4737 |
8471-8472 |
-RRB- |
denotes |
) |
T4738 |
8472-8473 |
. |
denotes |
. |
T4739 |
8474-8487 |
RB |
denotes |
Interestingly |
T4740 |
8487-8488 |
, |
denotes |
, |
T4741 |
8489-8495 |
VBG |
denotes |
adding |
T4742 |
8496-8501 |
NNP |
denotes |
M-CSF |
T4743 |
8502-8505 |
VBD |
denotes |
did |
T4744 |
8506-8509 |
RB |
denotes |
not |
T4745 |
8510-8515 |
VB |
denotes |
alter |
T4746 |
8516-8521 |
NNP |
denotes |
NF-κB |
T4747 |
8522-8525 |
NNP |
denotes |
DNA |
T4748 |
8526-8533 |
JJ |
denotes |
binding |
T4749 |
8534-8536 |
IN |
denotes |
by |
T4750 |
8537-8541 |
NNP |
denotes |
EMSA |
T4751 |
8541-8542 |
. |
denotes |
. |
T4752 |
8543-8545 |
IN |
denotes |
In |
T4753 |
8546-8554 |
NN |
denotes |
contrast |
T4754 |
8554-8555 |
, |
denotes |
, |
T4755 |
8556-8561 |
IN |
denotes |
after |
T4756 |
8562-8573 |
RB |
denotes |
transiently |
T4757 |
8574-8586 |
VBG |
denotes |
transfecting |
T4758 |
8587-8592 |
JJ |
denotes |
human |
T4759 |
8593-8597 |
NNS |
denotes |
MDMs |
T4760 |
8598-8602 |
IN |
denotes |
with |
T4761 |
8603-8614 |
JJ |
denotes |
pNF-κB-SEAP |
T4762 |
8615-8625 |
NNS |
denotes |
constructs |
T4763 |
8626-8636 |
VBG |
denotes |
containing |
T4764 |
8637-8641 |
CD |
denotes |
four |
T4765 |
8642-8647 |
JJ |
denotes |
NF-κB |
T4766 |
8648-8657 |
NN |
denotes |
consensus |
T4767 |
8658-8665 |
JJ |
denotes |
binding |
T4768 |
8666-8675 |
NNS |
denotes |
sequences |
T4769 |
8675-8676 |
, |
denotes |
, |
T4770 |
8677-8682 |
NNP |
denotes |
M-CSF |
T4771 |
8683-8692 |
NN |
denotes |
treatment |
T4772 |
8693-8695 |
IN |
denotes |
of |
T4773 |
8696-8699 |
DT |
denotes |
the |
T4774 |
8700-8711 |
VBN |
denotes |
transfected |
T4775 |
8712-8717 |
NNS |
denotes |
cells |
T4776 |
8718-8726 |
VBD |
denotes |
resulted |
T4777 |
8727-8729 |
IN |
denotes |
in |
T4778 |
8730-8731 |
DT |
denotes |
a |
T4779 |
8732-8740 |
JJ |
denotes |
2.3-fold |
T4780 |
8741-8749 |
NN |
denotes |
increase |
T4781 |
8750-8752 |
IN |
denotes |
in |
T4782 |
8753-8757 |
NNP |
denotes |
SEAP |
T4783 |
8758-8765 |
NN |
denotes |
release |
T4784 |
8766-8768 |
IN |
denotes |
in |
T4785 |
8769-8772 |
DT |
denotes |
the |
T4786 |
8773-8780 |
NN |
denotes |
culture |
T4787 |
8781-8786 |
NNS |
denotes |
media |
T4788 |
8787-8795 |
VBN |
denotes |
compared |
T4789 |
8796-8798 |
TO |
denotes |
to |
T4790 |
8799-8802 |
NNP |
denotes |
PBS |
T4791 |
8803-8804 |
-LRB- |
denotes |
( |
T4792 |
8804-8811 |
NN |
denotes |
vehicle |
T4793 |
8811-8812 |
-RRB- |
denotes |
) |
T4794 |
8812-8813 |
: |
denotes |
- |
T4795 |
8813-8820 |
VBN |
denotes |
treated |
T4796 |
8821-8832 |
VBN |
denotes |
transfected |
T4797 |
8833-8837 |
NNS |
denotes |
MDMs |
T4798 |
8838-8839 |
-LRB- |
denotes |
( |
T4799 |
8839-8845 |
NN |
denotes |
Figure |
T4800 |
8846-8848 |
NN |
denotes |
1B |
T4801 |
8848-8849 |
-RRB- |
denotes |
) |
T4802 |
8849-8850 |
. |
denotes |
. |
T4803 |
8851-8853 |
IN |
denotes |
As |
T4804 |
8854-8855 |
DT |
denotes |
a |
T4805 |
8856-8863 |
NN |
denotes |
control |
T4806 |
8863-8864 |
, |
denotes |
, |
T4807 |
8865-8868 |
DT |
denotes |
the |
T4808 |
8869-8878 |
NNP |
denotes |
pTAL-SEAP |
T4809 |
8879-8888 |
VB |
denotes |
construct |
T4810 |
8889-8896 |
VBG |
denotes |
lacking |
T4811 |
8897-8902 |
JJ |
denotes |
NF-κB |
T4812 |
8903-8910 |
JJ |
denotes |
binding |
T4813 |
8911-8916 |
NNS |
denotes |
sites |
T4814 |
8917-8920 |
VBD |
denotes |
was |
T4815 |
8921-8925 |
VBN |
denotes |
used |
T4816 |
8925-8926 |
. |
denotes |
. |
T4817 |
8927-8932 |
NNS |
denotes |
Cells |
T4818 |
8933-8944 |
VBN |
denotes |
transfected |
T4819 |
8945-8949 |
IN |
denotes |
with |
T4820 |
8950-8953 |
DT |
denotes |
the |
T4821 |
8954-8963 |
NNP |
denotes |
pTAL-SEAP |
T4822 |
8964-8973 |
VBP |
denotes |
construct |
T4823 |
8974-8977 |
VBD |
denotes |
did |
T4824 |
8978-8981 |
RB |
denotes |
not |
T4825 |
8982-8989 |
VB |
denotes |
produce |
T4826 |
8990-8994 |
NNP |
denotes |
SEAP |
T4827 |
8995-8997 |
IN |
denotes |
in |
T4828 |
8998-9001 |
DT |
denotes |
the |
T4829 |
9002-9009 |
NN |
denotes |
absence |
T4830 |
9010-9012 |
CC |
denotes |
or |
T4831 |
9013-9021 |
NN |
denotes |
presence |
T4832 |
9022-9024 |
IN |
denotes |
of |
T4833 |
9025-9030 |
NNP |
denotes |
M-CSF |
T4834 |
9031-9032 |
-LRB- |
denotes |
( |
T4835 |
9032-9038 |
NNP |
denotes |
Figure |
T4836 |
9039-9041 |
NNP |
denotes |
1B |
T4837 |
9041-9042 |
-RRB- |
denotes |
) |
T4838 |
9042-9043 |
. |
denotes |
. |
T22818 |
9088-9093 |
NNP |
denotes |
M-CSF |
T22819 |
9094-9101 |
VBZ |
denotes |
induces |
T22820 |
9102-9107 |
JJ |
denotes |
NF-κB |
T22821 |
9108-9123 |
JJ |
denotes |
transcriptional |
T22822 |
9124-9132 |
NN |
denotes |
activity |
T22823 |
9133-9135 |
IN |
denotes |
in |
T22824 |
9136-9147 |
NNS |
denotes |
macrophages |
T22825 |
9147-9148 |
. |
denotes |
. |
T22826 |
9149-9150 |
-LRB- |
denotes |
( |
T22827 |
9150-9151 |
NNP |
denotes |
A |
T22828 |
9151-9152 |
-RRB- |
denotes |
) |
T22829 |
9153-9159 |
NNP |
denotes |
Nuclei |
T22830 |
9160-9164 |
VBD |
denotes |
were |
T22831 |
9165-9174 |
VBN |
denotes |
extracted |
T22832 |
9175-9179 |
IN |
denotes |
from |
T22833 |
9180-9185 |
JJ |
denotes |
human |
T22834 |
9186-9190 |
NNS |
denotes |
MDMs |
T22835 |
9191-9198 |
VBN |
denotes |
treated |
T22836 |
9199-9206 |
IN |
denotes |
without |
T22837 |
9207-9209 |
CC |
denotes |
or |
T22838 |
9210-9214 |
IN |
denotes |
with |
T22839 |
9215-9220 |
NNP |
denotes |
M-CSF |
T22840 |
9221-9224 |
IN |
denotes |
for |
T22841 |
9225-9227 |
CD |
denotes |
15 |
T22842 |
9228-9230 |
CC |
denotes |
or |
T22843 |
9231-9233 |
CD |
denotes |
30 |
T22844 |
9234-9241 |
NNS |
denotes |
minutes |
T22845 |
9241-9242 |
. |
denotes |
. |
T22846 |
9243-9248 |
NNP |
denotes |
NF-κB |
T22847 |
9249-9252 |
NNP |
denotes |
DNA |
T22848 |
9253-9260 |
JJ |
denotes |
binding |
T22849 |
9261-9269 |
NN |
denotes |
activity |
T22850 |
9270-9273 |
VBD |
denotes |
was |
T22851 |
9274-9282 |
VBN |
denotes |
analyzed |
T22852 |
9283-9285 |
IN |
denotes |
by |
T22853 |
9286-9290 |
NNP |
denotes |
EMSA |
T22854 |
9291-9296 |
NNP |
denotes |
Shown |
T22855 |
9297-9299 |
VBZ |
denotes |
is |
T22856 |
9300-9301 |
DT |
denotes |
a |
T22857 |
9302-9316 |
JJ |
denotes |
representative |
T22858 |
9317-9321 |
NN |
denotes |
blot |
T22859 |
9322-9326 |
IN |
denotes |
from |
T22860 |
9327-9332 |
CD |
denotes |
three |
T22861 |
9333-9344 |
JJ |
denotes |
independent |
T22862 |
9345-9356 |
NNS |
denotes |
experiments |
T22863 |
9356-9357 |
. |
denotes |
. |
T22864 |
9358-9360 |
NNP |
denotes |
NS |
T22865 |
9360-9361 |
: |
denotes |
: |
T22866 |
9362-9376 |
JJ |
denotes |
non-stimulated |
T22867 |
9376-9377 |
. |
denotes |
. |
T22868 |
9378-9379 |
-LRB- |
denotes |
( |
T22869 |
9379-9380 |
NNP |
denotes |
B |
T22870 |
9380-9381 |
-RRB- |
denotes |
) |
T22871 |
9382-9387 |
NNP |
denotes |
Human |
T22872 |
9388-9392 |
NNP |
denotes |
MDMs |
T22873 |
9393-9404 |
RB |
denotes |
transiently |
T22874 |
9405-9416 |
VBD |
denotes |
transfected |
T22875 |
9417-9421 |
IN |
denotes |
with |
T22876 |
9422-9431 |
JJ |
denotes |
pTAL-SEAP |
T22877 |
9432-9434 |
CC |
denotes |
or |
T22878 |
9435-9446 |
JJ |
denotes |
pNF-κB-SEAP |
T22879 |
9447-9457 |
NNS |
denotes |
constructs |
T22880 |
9458-9462 |
VBD |
denotes |
were |
T22881 |
9463-9470 |
VBN |
denotes |
treated |
T22882 |
9471-9475 |
IN |
denotes |
with |
T22883 |
9476-9481 |
NNP |
denotes |
M-CSF |
T22884 |
9482-9484 |
IN |
denotes |
in |
T22885 |
9485-9491 |
NNP |
denotes |
X-vivo |
T22886 |
9492-9498 |
NN |
denotes |
medium |
T22887 |
9499-9502 |
CC |
denotes |
and |
T22888 |
9503-9512 |
VBN |
denotes |
incubated |
T22889 |
9513-9516 |
IN |
denotes |
for |
T22890 |
9517-9518 |
CD |
denotes |
6 |
T22891 |
9519-9524 |
NNS |
denotes |
hours |
T22892 |
9525-9531 |
IN |
denotes |
before |
T22893 |
9532-9535 |
DT |
denotes |
the |
T22894 |
9536-9546 |
NN |
denotes |
collection |
T22895 |
9547-9549 |
IN |
denotes |
of |
T22896 |
9550-9556 |
NN |
denotes |
medium |
T22897 |
9556-9557 |
. |
denotes |
. |
T22898 |
9558-9563 |
JJ |
denotes |
NF-κB |
T22899 |
9564-9572 |
NN |
denotes |
activity |
T22900 |
9573-9576 |
VBD |
denotes |
was |
T22901 |
9577-9585 |
VBN |
denotes |
analyzed |
T22902 |
9586-9588 |
IN |
denotes |
by |
T22903 |
9589-9598 |
VBG |
denotes |
measuring |
T22904 |
9599-9602 |
DT |
denotes |
the |
T22905 |
9603-9609 |
NN |
denotes |
amount |
T22906 |
9610-9612 |
IN |
denotes |
of |
T22907 |
9613-9617 |
NNP |
denotes |
SEAP |
T22908 |
9618-9626 |
VBD |
denotes |
secreted |
T22909 |
9627-9631 |
IN |
denotes |
into |
T22910 |
9632-9635 |
DT |
denotes |
the |
T22911 |
9636-9642 |
NN |
denotes |
medium |
T22912 |
9643-9646 |
CC |
denotes |
and |
T22913 |
9647-9651 |
NNS |
denotes |
data |
T22914 |
9652-9655 |
VBP |
denotes |
are |
T22915 |
9656-9665 |
VBN |
denotes |
expressed |
T22916 |
9666-9668 |
IN |
denotes |
as |
T22917 |
9669-9673 |
VBP |
denotes |
fold |
T22918 |
9674-9682 |
NN |
denotes |
increase |
T22919 |
9683-9685 |
IN |
denotes |
of |
T22920 |
9686-9690 |
NNP |
denotes |
SEAP |
T22921 |
9691-9699 |
NN |
denotes |
activity |
T22922 |
9700-9704 |
IN |
denotes |
over |
T22923 |
9705-9709 |
DT |
denotes |
that |
T22924 |
9710-9712 |
IN |
denotes |
in |
T22925 |
9713-9722 |
JJ |
denotes |
pTAL-SEAP |
T22926 |
9723-9734 |
VBN |
denotes |
transfected |
T22927 |
9735-9742 |
VBG |
denotes |
resting |
T22928 |
9743-9748 |
NNS |
denotes |
cells |
T22929 |
9748-9749 |
. |
denotes |
. |
T22930 |
9750-9751 |
-LRB- |
denotes |
( |
T22931 |
9751-9752 |
NNP |
denotes |
C |
T22932 |
9752-9753 |
-RRB- |
denotes |
) |
T22933 |
9754-9757 |
NNP |
denotes |
RAW |
T22934 |
9758-9763 |
CD |
denotes |
264.7 |
T22935 |
9764-9769 |
NNS |
denotes |
cells |
T22936 |
9770-9774 |
VBD |
denotes |
were |
T22937 |
9775-9786 |
RB |
denotes |
transiently |
T22938 |
9787-9798 |
VBN |
denotes |
transfected |
T22939 |
9799-9803 |
IN |
denotes |
with |
T22940 |
9804-9813 |
NNP |
denotes |
pTAL-SEAP |
T22941 |
9814-9816 |
CC |
denotes |
or |
T22942 |
9817-9828 |
NNP |
denotes |
pNF-κB-SEAP |
T22943 |
9829-9838 |
VBP |
denotes |
construct |
T22944 |
9838-9839 |
. |
denotes |
. |
T22945 |
9840-9845 |
NNS |
denotes |
Cells |
T22946 |
9846-9850 |
VBD |
denotes |
were |
T22947 |
9851-9856 |
JJ |
denotes |
serum |
T22948 |
9857-9864 |
VBN |
denotes |
starved |
T22949 |
9865-9868 |
IN |
denotes |
for |
T22950 |
9869-9870 |
CD |
denotes |
4 |
T22951 |
9871-9876 |
NNS |
denotes |
hours |
T22952 |
9877-9882 |
RB |
denotes |
prior |
T22953 |
9883-9885 |
TO |
denotes |
to |
T22954 |
9886-9887 |
CD |
denotes |
2 |
T22955 |
9888-9893 |
NNS |
denotes |
hours |
T22956 |
9894-9905 |
NN |
denotes |
stimulation |
T22957 |
9906-9910 |
IN |
denotes |
with |
T22958 |
9911-9916 |
NN |
denotes |
mouse |
T22959 |
9917-9928 |
JJ |
denotes |
recombinant |
T22960 |
9929-9934 |
NNP |
denotes |
M-CSF |
T22961 |
9935-9936 |
-LRB- |
denotes |
( |
T22962 |
9936-9939 |
CD |
denotes |
100 |
T22963 |
9940-9945 |
NN |
denotes |
ng/ml |
T22964 |
9945-9946 |
-RRB- |
denotes |
) |
T22965 |
9946-9947 |
. |
denotes |
. |
T22966 |
9948-9955 |
NNP |
denotes |
Culture |
T22967 |
9956-9961 |
NNS |
denotes |
media |
T22968 |
9962-9965 |
VBD |
denotes |
was |
T22969 |
9966-9975 |
VBN |
denotes |
collected |
T22970 |
9976-9978 |
TO |
denotes |
to |
T22971 |
9979-9986 |
VB |
denotes |
measure |
T22972 |
9987-9991 |
NNP |
denotes |
SEAP |
T22973 |
9992-10002 |
NN |
denotes |
production |
T22974 |
10002-10003 |
. |
denotes |
. |
T22975 |
10004-10008 |
NNS |
denotes |
Data |
T22976 |
10009-10012 |
VBP |
denotes |
are |
T22977 |
10013-10022 |
VBN |
denotes |
expressed |
T22978 |
10023-10027 |
JJ |
denotes |
mean |
T22979 |
10028-10029 |
NN |
denotes |
± |
T22980 |
10030-10035 |
NNP |
denotes |
S.E.M |
T22981 |
10035-10036 |
, |
denotes |
, |
T22982 |
10037-10040 |
IN |
denotes |
for |
T22983 |
10041-10046 |
CD |
denotes |
three |
T22984 |
10047-10058 |
JJ |
denotes |
independent |
T22985 |
10059-10070 |
NNS |
denotes |
experiments |
T22986 |
10070-10071 |
. |
denotes |
. |
T4839 |
10074-10076 |
PRP |
denotes |
We |
T4840 |
10077-10081 |
JJ |
denotes |
next |
T4841 |
10082-10094 |
VBD |
denotes |
investigated |
T4842 |
10095-10102 |
IN |
denotes |
whether |
T4843 |
10103-10108 |
NNP |
denotes |
M-CSF |
T4844 |
10109-10116 |
VBD |
denotes |
induced |
T4845 |
10117-10122 |
JJ |
denotes |
NF-κB |
T4846 |
10123-10131 |
NN |
denotes |
activity |
T4847 |
10132-10134 |
IN |
denotes |
in |
T4848 |
10135-10138 |
DT |
denotes |
the |
T4849 |
10139-10144 |
NN |
denotes |
mouse |
T4850 |
10145-10155 |
NN |
denotes |
macrophage |
T4851 |
10156-10160 |
NN |
denotes |
cell |
T4852 |
10161-10165 |
NN |
denotes |
line |
T4853 |
10165-10166 |
, |
denotes |
, |
T4854 |
10167-10170 |
NNP |
denotes |
RAW |
T4855 |
10171-10176 |
CD |
denotes |
264.7 |
T4856 |
10176-10177 |
. |
denotes |
. |
T4857 |
10178-10181 |
NNP |
denotes |
RAW |
T4858 |
10182-10187 |
CD |
denotes |
264.7 |
T4859 |
10188-10193 |
NNS |
denotes |
cells |
T4860 |
10194-10198 |
VBD |
denotes |
were |
T4861 |
10199-10210 |
VBN |
denotes |
transfected |
T4862 |
10211-10215 |
IN |
denotes |
with |
T4863 |
10216-10222 |
CC |
denotes |
either |
T4864 |
10223-10226 |
DT |
denotes |
the |
T4865 |
10227-10237 |
NNP |
denotes |
NF-κB-SEAP |
T4866 |
10238-10246 |
NN |
denotes |
reporter |
T4867 |
10247-10249 |
CC |
denotes |
or |
T4868 |
10250-10257 |
NN |
denotes |
control |
T4869 |
10258-10267 |
JJ |
denotes |
pTAL-SEAP |
T4870 |
10268-10277 |
VBP |
denotes |
construct |
T4871 |
10277-10278 |
. |
denotes |
. |
T4872 |
10279-10281 |
IN |
denotes |
As |
T4873 |
10282-10287 |
VBN |
denotes |
shown |
T4874 |
10288-10290 |
IN |
denotes |
in |
T4875 |
10291-10297 |
NN |
denotes |
Figure |
T4876 |
10298-10300 |
CD |
denotes |
1C |
T4877 |
10300-10301 |
, |
denotes |
, |
T4878 |
10302-10307 |
NNP |
denotes |
M-CSF |
T4879 |
10308-10317 |
NN |
denotes |
treatment |
T4880 |
10318-10320 |
IN |
denotes |
of |
T4881 |
10321-10324 |
NNP |
denotes |
RAW |
T4882 |
10325-10330 |
CD |
denotes |
264.7 |
T4883 |
10331-10336 |
NNS |
denotes |
cells |
T4884 |
10337-10346 |
VBD |
denotes |
increased |
T4885 |
10347-10352 |
JJ |
denotes |
NF-κB |
T4886 |
10353-10361 |
NN |
denotes |
reporter |
T4887 |
10362-10370 |
NN |
denotes |
activity |
T4888 |
10371-10373 |
IN |
denotes |
by |
T4889 |
10374-10382 |
CD |
denotes |
2.5-fold |
T4890 |
10383-10387 |
IN |
denotes |
over |
T4891 |
10388-10392 |
DT |
denotes |
that |
T4892 |
10393-10395 |
IN |
denotes |
of |
T4893 |
10396-10407 |
JJ |
denotes |
non-treated |
T4894 |
10408-10413 |
NNS |
denotes |
cells |
T4895 |
10413-10414 |
. |
denotes |
. |
T4896 |
10415-10423 |
RB |
denotes |
Together |
T4897 |
10423-10424 |
, |
denotes |
, |
T4898 |
10425-10428 |
PRP$ |
denotes |
our |
T4899 |
10429-10433 |
NNS |
denotes |
data |
T4900 |
10434-10445 |
VBP |
denotes |
demonstrate |
T4901 |
10446-10450 |
IN |
denotes |
that |
T4902 |
10451-10456 |
NNP |
denotes |
M-CSF |
T4903 |
10457-10464 |
VBD |
denotes |
induced |
T4904 |
10465-10470 |
NNP |
denotes |
NF-κB |
T4905 |
10471-10486 |
JJ |
denotes |
transcriptional |
T4906 |
10487-10495 |
NN |
denotes |
activity |
T4907 |
10496-10498 |
IN |
denotes |
in |
T4908 |
10499-10510 |
NNS |
denotes |
macrophages |
T4909 |
10510-10511 |
. |
denotes |
. |
T5344 |
10513-10516 |
NNP |
denotes |
PKC |
T5345 |
10517-10527 |
NNP |
denotes |
Inhibition |
T5346 |
10528-10535 |
VBZ |
denotes |
Reduces |
T5347 |
10536-10541 |
NNP |
denotes |
NF-κB |
T5348 |
10542-10550 |
NNP |
denotes |
Activity |
T5349 |
10551-10553 |
IN |
denotes |
in |
T5350 |
10554-10559 |
NNP |
denotes |
Human |
T5351 |
10560-10564 |
NNPS |
denotes |
MDMs |
T5352 |
10565-10568 |
CC |
denotes |
and |
T5353 |
10569-10572 |
NNP |
denotes |
RAW |
T5354 |
10573-10578 |
CD |
denotes |
264.7 |
T5355 |
10579-10584 |
NNP |
denotes |
Cells |
T5356 |
10585-10590 |
IN |
denotes |
Since |
T5357 |
10591-10596 |
NNP |
denotes |
NF-κB |
T5358 |
10597-10599 |
VBZ |
denotes |
is |
T5359 |
10600-10609 |
VBN |
denotes |
activated |
T5360 |
10610-10612 |
IN |
denotes |
by |
T5361 |
10613-10616 |
NNP |
denotes |
PKC |
T5362 |
10617-10619 |
IN |
denotes |
in |
T5363 |
10620-10627 |
JJ |
denotes |
several |
T5364 |
10628-10632 |
NN |
denotes |
cell |
T5365 |
10633-10638 |
NNS |
denotes |
types |
T5366 |
10639-10640 |
NNP |
denotes |
[ |
T5367 |
10640-10642 |
CD |
denotes |
36 |
T5368 |
10642-10643 |
NNP |
denotes |
] |
T5369 |
10643-10644 |
, |
denotes |
, |
T5370 |
10645-10647 |
PRP |
denotes |
we |
T5371 |
10648-10652 |
JJ |
denotes |
next |
T5372 |
10653-10663 |
VBN |
denotes |
determined |
T5373 |
10664-10666 |
IN |
denotes |
if |
T5374 |
10667-10680 |
JJ |
denotes |
M-CSF-induced |
T5375 |
10681-10686 |
NN |
denotes |
NF-κB |
T5376 |
10687-10702 |
JJ |
denotes |
transcriptional |
T5377 |
10703-10711 |
NN |
denotes |
activity |
T5378 |
10712-10715 |
VBD |
denotes |
was |
T5379 |
10716-10725 |
JJ |
denotes |
dependent |
T5380 |
10726-10728 |
IN |
denotes |
on |
T5381 |
10729-10732 |
NNP |
denotes |
PKC |
T5382 |
10733-10743 |
NN |
denotes |
activation |
T5383 |
10744-10747 |
CC |
denotes |
and |
T5384 |
10748-10750 |
IN |
denotes |
if |
T5385 |
10751-10758 |
NN |
denotes |
calcium |
T5386 |
10758-10759 |
, |
denotes |
, |
T5387 |
10760-10761 |
DT |
denotes |
a |
T5388 |
10762-10771 |
NN |
denotes |
co-factor |
T5389 |
10772-10775 |
IN |
denotes |
for |
T5390 |
10776-10788 |
JJ |
denotes |
conventional |
T5391 |
10789-10792 |
NNP |
denotes |
PKC |
T5392 |
10793-10800 |
NN |
denotes |
isoform |
T5393 |
10801-10811 |
NN |
denotes |
activation |
T5394 |
10811-10812 |
, |
denotes |
, |
T5395 |
10813-10816 |
VBD |
denotes |
was |
T5396 |
10817-10826 |
JJ |
denotes |
important |
T5397 |
10826-10827 |
. |
denotes |
. |
T5398 |
10828-10830 |
IN |
denotes |
In |
T5399 |
10831-10839 |
NN |
denotes |
addition |
T5400 |
10839-10840 |
, |
denotes |
, |
T5401 |
10841-10848 |
IN |
denotes |
because |
T5402 |
10849-10851 |
IN |
denotes |
of |
T5403 |
10852-10855 |
DT |
denotes |
the |
T5404 |
10856-10862 |
NN |
denotes |
number |
T5405 |
10863-10865 |
IN |
denotes |
of |
T5406 |
10866-10878 |
JJ |
denotes |
conventional |
T5407 |
10879-10883 |
NNS |
denotes |
PKCs |
T5408 |
10884-10892 |
VBG |
denotes |
existing |
T5409 |
10893-10899 |
IN |
denotes |
within |
T5410 |
10900-10911 |
NN |
denotes |
mononuclear |
T5411 |
10912-10917 |
NNS |
denotes |
cells |
T5412 |
10917-10918 |
, |
denotes |
, |
T5413 |
10919-10934 |
JJ |
denotes |
pharmacological |
T5414 |
10935-10945 |
NNS |
denotes |
inhibitors |
T5415 |
10946-10948 |
IN |
denotes |
of |
T5416 |
10949-10952 |
NNP |
denotes |
PKC |
T5417 |
10953-10959 |
NN |
denotes |
family |
T5418 |
10960-10970 |
NN |
denotes |
activation |
T5419 |
10971-10974 |
VBD |
denotes |
was |
T5420 |
10975-10979 |
VBN |
denotes |
used |
T5421 |
10980-10982 |
TO |
denotes |
to |
T5422 |
10983-10992 |
VB |
denotes |
determine |
T5423 |
10993-10996 |
DT |
denotes |
the |
T5424 |
10997-11009 |
NN |
denotes |
relationship |
T5425 |
11010-11012 |
IN |
denotes |
of |
T5426 |
11013-11016 |
NNP |
denotes |
PKC |
T5427 |
11017-11027 |
NN |
denotes |
activation |
T5428 |
11028-11030 |
TO |
denotes |
to |
T5429 |
11031-11044 |
JJ |
denotes |
M-CSF-induced |
T5430 |
11045-11053 |
JJ |
denotes |
cellular |
T5431 |
11054-11062 |
NN |
denotes |
survival |
T5432 |
11062-11063 |
. |
denotes |
. |
T5433 |
11064-11068 |
NNS |
denotes |
MDMs |
T5434 |
11069-11073 |
VBD |
denotes |
were |
T5435 |
11074-11085 |
VBN |
denotes |
transfected |
T5436 |
11086-11090 |
IN |
denotes |
with |
T5437 |
11091-11094 |
DT |
denotes |
the |
T5438 |
11095-11106 |
JJ |
denotes |
pNF-κB-SEAP |
T5439 |
11107-11115 |
NN |
denotes |
reporter |
T5440 |
11116-11119 |
CC |
denotes |
and |
T5441 |
11120-11124 |
RB |
denotes |
then |
T5442 |
11125-11132 |
VBN |
denotes |
treated |
T5443 |
11133-11137 |
IN |
denotes |
with |
T5444 |
11138-11141 |
DT |
denotes |
the |
T5445 |
11142-11149 |
JJ |
denotes |
general |
T5446 |
11150-11153 |
NNP |
denotes |
PKC |
T5447 |
11154-11163 |
NN |
denotes |
inhibitor |
T5448 |
11163-11164 |
, |
denotes |
, |
T5449 |
11165-11175 |
NN |
denotes |
Ro-31-8220 |
T5450 |
11175-11176 |
: |
denotes |
; |
T5451 |
11177-11180 |
DT |
denotes |
the |
T5452 |
11181-11193 |
JJ |
denotes |
conventional |
T5453 |
11194-11198 |
NNP |
denotes |
PKCα |
T5454 |
11198-11199 |
NN |
denotes |
/ |
T5455 |
11199-11200 |
NN |
denotes |
β |
T5456 |
11201-11210 |
NN |
denotes |
inhibitor |
T5457 |
11211-11218 |
NNP |
denotes |
Gö-6976 |
T5458 |
11218-11219 |
: |
denotes |
; |
T5459 |
11220-11222 |
CC |
denotes |
or |
T5460 |
11223-11226 |
DT |
denotes |
the |
T5461 |
11227-11240 |
JJ |
denotes |
intracellular |
T5462 |
11241-11248 |
NN |
denotes |
calcium |
T5463 |
11249-11256 |
NN |
denotes |
blocker |
T5464 |
11257-11265 |
NNP |
denotes |
BAPTA/AM |
T5465 |
11265-11266 |
. |
denotes |
. |
T5466 |
11267-11277 |
JJ |
denotes |
Ro-31-8220 |
T5467 |
11278-11291 |
RB |
denotes |
significantly |
T5468 |
11292-11302 |
VBN |
denotes |
suppressed |
T5469 |
11303-11316 |
JJ |
denotes |
M-CSF-induced |
T5470 |
11317-11322 |
NN |
denotes |
NF-κB |
T5471 |
11323-11331 |
NN |
denotes |
activity |
T5472 |
11332-11340 |
VBN |
denotes |
compared |
T5473 |
11341-11343 |
TO |
denotes |
to |
T5474 |
11344-11349 |
NNS |
denotes |
cells |
T5475 |
11350-11357 |
VBN |
denotes |
treated |
T5476 |
11358-11362 |
IN |
denotes |
with |
T5477 |
11363-11368 |
NNP |
denotes |
M-CSF |
T5478 |
11369-11374 |
RB |
denotes |
alone |
T5479 |
11375-11376 |
-LRB- |
denotes |
( |
T5480 |
11376-11382 |
NN |
denotes |
Figure |
T5481 |
11383-11385 |
NN |
denotes |
2A |
T5482 |
11385-11386 |
-RRB- |
denotes |
) |
T5483 |
11386-11387 |
. |
denotes |
. |
T5484 |
11388-11390 |
IN |
denotes |
In |
T5485 |
11391-11399 |
NN |
denotes |
addition |
T5486 |
11399-11400 |
, |
denotes |
, |
T5487 |
11401-11408 |
NNP |
denotes |
Gö-6976 |
T5488 |
11409-11412 |
CC |
denotes |
and |
T5489 |
11413-11421 |
NNP |
denotes |
BAPTA/AM |
T5490 |
11422-11426 |
RB |
denotes |
also |
T5491 |
11427-11434 |
VBD |
denotes |
blocked |
T5492 |
11435-11440 |
JJ |
denotes |
NF-κB |
T5493 |
11441-11449 |
NN |
denotes |
activity |
T5494 |
11450-11452 |
IN |
denotes |
in |
T5495 |
11453-11466 |
JJ |
denotes |
M-CSF-treated |
T5496 |
11467-11471 |
NNS |
denotes |
MDMs |
T5497 |
11471-11472 |
. |
denotes |
. |
T5498 |
11473-11479 |
NNP |
denotes |
Trypan |
T5499 |
11480-11484 |
JJ |
denotes |
blue |
T5500 |
11485-11494 |
NN |
denotes |
exclusion |
T5501 |
11495-11503 |
NN |
denotes |
analysis |
T5502 |
11504-11507 |
VBD |
denotes |
did |
T5503 |
11508-11511 |
RB |
denotes |
not |
T5504 |
11512-11520 |
VB |
denotes |
indicate |
T5505 |
11521-11525 |
NN |
denotes |
cell |
T5506 |
11526-11531 |
NN |
denotes |
death |
T5507 |
11532-11542 |
VBG |
denotes |
suggesting |
T5508 |
11543-11547 |
IN |
denotes |
that |
T5509 |
11548-11552 |
DT |
denotes |
this |
T5510 |
11553-11564 |
NN |
denotes |
suppression |
T5511 |
11565-11568 |
VBD |
denotes |
was |
T5512 |
11569-11572 |
RB |
denotes |
not |
T5513 |
11573-11576 |
JJ |
denotes |
due |
T5514 |
11577-11579 |
TO |
denotes |
to |
T5515 |
11580-11592 |
JJ |
denotes |
non-specific |
T5516 |
11593-11601 |
NN |
denotes |
toxicity |
T5517 |
11601-11602 |
. |
denotes |
. |
T5518 |
11603-11608 |
DT |
denotes |
These |
T5519 |
11609-11613 |
NNS |
denotes |
data |
T5520 |
11614-11622 |
VBP |
denotes |
indicate |
T5521 |
11623-11627 |
IN |
denotes |
that |
T5522 |
11628-11633 |
NNP |
denotes |
M-CSF |
T5523 |
11634-11642 |
VBD |
denotes |
mediated |
T5524 |
11643-11648 |
NNP |
denotes |
NF-κB |
T5525 |
11649-11659 |
NN |
denotes |
activation |
T5526 |
11660-11667 |
IN |
denotes |
through |
T5527 |
11668-11685 |
JJ |
denotes |
calcium-dependent |
T5528 |
11686-11698 |
JJ |
denotes |
conventional |
T5529 |
11699-11702 |
NNP |
denotes |
PKC |
T5530 |
11703-11713 |
NN |
denotes |
activation |
T5531 |
11713-11714 |
. |
denotes |
. |
T23222 |
11759-11769 |
NNP |
denotes |
Inhibition |
T23223 |
11770-11772 |
IN |
denotes |
of |
T23224 |
11773-11776 |
NNP |
denotes |
PKC |
T23225 |
11777-11784 |
VBZ |
denotes |
reduces |
T23226 |
11785-11790 |
JJ |
denotes |
NF-κB |
T23227 |
11791-11799 |
NN |
denotes |
activity |
T23228 |
11800-11802 |
IN |
denotes |
in |
T23229 |
11803-11808 |
NNP |
denotes |
M-CSF |
T23230 |
11809-11819 |
VBD |
denotes |
stimulated |
T23231 |
11820-11831 |
NNS |
denotes |
macrophages |
T23232 |
11831-11832 |
. |
denotes |
. |
T23233 |
11833-11834 |
-LRB- |
denotes |
( |
T23234 |
11834-11835 |
NNP |
denotes |
A |
T23235 |
11835-11836 |
-RRB- |
denotes |
) |
T23236 |
11837-11842 |
NNP |
denotes |
Human |
T23237 |
11843-11847 |
NNS |
denotes |
MDMs |
T23238 |
11848-11859 |
VBN |
denotes |
transfected |
T23239 |
11860-11864 |
IN |
denotes |
with |
T23240 |
11865-11876 |
JJ |
denotes |
pNF-κB-SEAP |
T23241 |
11877-11881 |
VBD |
denotes |
were |
T23242 |
11882-11895 |
VBN |
denotes |
pre-incubated |
T23243 |
11896-11900 |
IN |
denotes |
with |
T23244 |
11901-11911 |
NNS |
denotes |
inhibitors |
T23245 |
11911-11912 |
: |
denotes |
; |
T23246 |
11913-11923 |
NNP |
denotes |
Ro-31-8220 |
T23247 |
11923-11924 |
, |
denotes |
, |
T23248 |
11925-11932 |
NNP |
denotes |
Gö-6976 |
T23249 |
11932-11933 |
, |
denotes |
, |
T23250 |
11934-11936 |
CC |
denotes |
or |
T23251 |
11937-11945 |
NNP |
denotes |
BAPTA/AM |
T23252 |
11946-11949 |
IN |
denotes |
for |
T23253 |
11950-11952 |
CD |
denotes |
30 |
T23254 |
11953-11960 |
NNS |
denotes |
minutes |
T23255 |
11961-11966 |
RB |
denotes |
prior |
T23256 |
11967-11969 |
TO |
denotes |
to |
T23257 |
11970-11971 |
CD |
denotes |
6 |
T23258 |
11972-11977 |
NNS |
denotes |
hours |
T23259 |
11978-11983 |
JJ |
denotes |
M-CSF |
T23260 |
11984-11995 |
NN |
denotes |
stimulation |
T23261 |
11995-11996 |
. |
denotes |
. |
T23262 |
11997-11998 |
-LRB- |
denotes |
( |
T23263 |
11998-11999 |
NNP |
denotes |
B |
T23264 |
11999-12000 |
-RRB- |
denotes |
) |
T23265 |
12001-12004 |
NNP |
denotes |
RAW |
T23266 |
12005-12010 |
CD |
denotes |
264.7 |
T23267 |
12011-12016 |
NNS |
denotes |
cells |
T23268 |
12017-12028 |
VBN |
denotes |
transfected |
T23269 |
12029-12033 |
IN |
denotes |
with |
T23270 |
12034-12037 |
DT |
denotes |
the |
T23271 |
12038-12049 |
NNP |
denotes |
pNF-κB-SEAP |
T23272 |
12050-12059 |
VBP |
denotes |
construct |
T23273 |
12060-12064 |
VBD |
denotes |
were |
T23274 |
12065-12078 |
VBN |
denotes |
pre-incubated |
T23275 |
12079-12083 |
IN |
denotes |
with |
T23276 |
12084-12094 |
NNS |
denotes |
inhibitors |
T23277 |
12095-12098 |
IN |
denotes |
for |
T23278 |
12099-12101 |
CD |
denotes |
30 |
T23279 |
12102-12109 |
NNS |
denotes |
minutes |
T23280 |
12110-12115 |
RB |
denotes |
prior |
T23281 |
12116-12118 |
TO |
denotes |
to |
T23282 |
12119-12120 |
CD |
denotes |
2 |
T23283 |
12121-12126 |
NNS |
denotes |
hours |
T23284 |
12127-12129 |
IN |
denotes |
of |
T23285 |
12130-12141 |
NN |
denotes |
stimulation |
T23286 |
12142-12146 |
IN |
denotes |
with |
T23287 |
12147-12152 |
NN |
denotes |
mouse |
T23288 |
12153-12164 |
JJ |
denotes |
recombinant |
T23289 |
12165-12170 |
NNP |
denotes |
M-CSF |
T23290 |
12170-12171 |
. |
denotes |
. |
T23291 |
12172-12175 |
DT |
denotes |
The |
T23292 |
12176-12181 |
JJ |
denotes |
NF-κB |
T23293 |
12182-12190 |
NN |
denotes |
activity |
T23294 |
12191-12194 |
VBD |
denotes |
was |
T23295 |
12195-12203 |
VBN |
denotes |
analyzed |
T23296 |
12204-12206 |
IN |
denotes |
by |
T23297 |
12207-12216 |
VBG |
denotes |
measuring |
T23298 |
12217-12221 |
NNP |
denotes |
SEAP |
T23299 |
12222-12232 |
NN |
denotes |
production |
T23300 |
12233-12235 |
IN |
denotes |
in |
T23301 |
12236-12239 |
DT |
denotes |
the |
T23302 |
12240-12246 |
NN |
denotes |
medium |
T23303 |
12247-12250 |
CC |
denotes |
and |
T23304 |
12251-12255 |
NNS |
denotes |
data |
T23305 |
12256-12259 |
VBP |
denotes |
are |
T23306 |
12260-12269 |
VBN |
denotes |
expressed |
T23307 |
12270-12272 |
IN |
denotes |
as |
T23308 |
12273-12277 |
VBP |
denotes |
fold |
T23309 |
12278-12286 |
NN |
denotes |
increase |
T23310 |
12287-12289 |
IN |
denotes |
of |
T23311 |
12290-12294 |
NNP |
denotes |
SEAP |
T23312 |
12295-12303 |
NN |
denotes |
activity |
T23313 |
12304-12308 |
IN |
denotes |
over |
T23314 |
12309-12313 |
DT |
denotes |
that |
T23315 |
12314-12316 |
IN |
denotes |
in |
T23316 |
12317-12326 |
JJ |
denotes |
pTAL-SEAP |
T23317 |
12327-12338 |
VBN |
denotes |
transfected |
T23318 |
12339-12346 |
VBG |
denotes |
resting |
T23319 |
12347-12352 |
NNS |
denotes |
cells |
T23320 |
12352-12353 |
. |
denotes |
. |
T23321 |
12354-12357 |
DT |
denotes |
The |
T23322 |
12358-12363 |
NN |
denotes |
graph |
T23323 |
12364-12374 |
VBZ |
denotes |
represents |
T23324 |
12375-12379 |
JJ |
denotes |
mean |
T23325 |
12380-12381 |
NN |
denotes |
± |
T23326 |
12382-12387 |
NNP |
denotes |
S.E.M |
T23327 |
12388-12391 |
IN |
denotes |
for |
T23328 |
12392-12397 |
CD |
denotes |
three |
T23329 |
12398-12409 |
JJ |
denotes |
independent |
T23330 |
12410-12421 |
NNS |
denotes |
experiments |
T23331 |
12421-12422 |
. |
denotes |
. |
T23332 |
12423-12424 |
SYM |
denotes |
* |
T23333 |
12424-12427 |
DT |
denotes |
The |
T23334 |
12428-12436 |
NNS |
denotes |
p-values |
T23335 |
12437-12439 |
IN |
denotes |
of |
T23336 |
12440-12445 |
NNS |
denotes |
cells |
T23337 |
12446-12453 |
VBN |
denotes |
treated |
T23338 |
12454-12458 |
IN |
denotes |
with |
T23339 |
12459-12475 |
JJ |
denotes |
inhibitors/M-CSF |
T23340 |
12476-12484 |
VBN |
denotes |
compared |
T23341 |
12485-12487 |
TO |
denotes |
to |
T23342 |
12488-12501 |
NNP |
denotes |
vehicle/M-CSF |
T23343 |
12502-12506 |
VBD |
denotes |
were |
T23344 |
12507-12508 |
CD |
denotes |
≤ |
T23345 |
12508-12512 |
CD |
denotes |
0.05 |
T23346 |
12512-12513 |
. |
denotes |
. |
T5532 |
12516-12518 |
PRP |
denotes |
We |
T5533 |
12519-12523 |
JJ |
denotes |
next |
T5534 |
12524-12536 |
VBD |
denotes |
investigated |
T5535 |
12537-12544 |
IN |
denotes |
whether |
T5536 |
12545-12548 |
NNP |
denotes |
PKC |
T5537 |
12549-12559 |
NN |
denotes |
inhibition |
T5538 |
12560-12568 |
VBD |
denotes |
affected |
T5539 |
12569-12574 |
JJ |
denotes |
NF-κB |
T5540 |
12575-12583 |
NN |
denotes |
activity |
T5541 |
12584-12586 |
IN |
denotes |
in |
T5542 |
12587-12590 |
DT |
denotes |
the |
T5543 |
12591-12596 |
NN |
denotes |
mouse |
T5544 |
12597-12607 |
NN |
denotes |
macrophage |
T5545 |
12608-12612 |
NN |
denotes |
cell |
T5546 |
12613-12617 |
NN |
denotes |
line |
T5547 |
12617-12618 |
, |
denotes |
, |
T5548 |
12619-12622 |
NNP |
denotes |
RAW |
T5549 |
12623-12628 |
CD |
denotes |
264.7 |
T5550 |
12628-12629 |
. |
denotes |
. |
T5551 |
12630-12637 |
JJ |
denotes |
Similar |
T5552 |
12638-12640 |
TO |
denotes |
to |
T5553 |
12641-12645 |
NNS |
denotes |
MDMs |
T5554 |
12645-12646 |
, |
denotes |
, |
T5555 |
12647-12650 |
NNP |
denotes |
PKC |
T5556 |
12651-12661 |
NNS |
denotes |
inhibitors |
T5557 |
12662-12672 |
NNP |
denotes |
Ro-31-8220 |
T5558 |
12672-12673 |
, |
denotes |
, |
T5559 |
12674-12681 |
NNP |
denotes |
Gö-6976 |
T5560 |
12682-12685 |
CC |
denotes |
and |
T5561 |
12686-12694 |
NNP |
denotes |
BAPTA/AM |
T5562 |
12695-12702 |
VBD |
denotes |
reduced |
T5563 |
12703-12716 |
JJ |
denotes |
M-CSF-induced |
T5564 |
12717-12722 |
NN |
denotes |
NF-κB |
T5565 |
12723-12731 |
NN |
denotes |
activity |
T5566 |
12732-12734 |
IN |
denotes |
in |
T5567 |
12735-12736 |
DT |
denotes |
a |
T5568 |
12737-12751 |
JJ |
denotes |
dose-dependent |
T5569 |
12752-12758 |
NN |
denotes |
manner |
T5570 |
12759-12761 |
IN |
denotes |
in |
T5571 |
12762-12765 |
NNP |
denotes |
RAW |
T5572 |
12766-12771 |
CD |
denotes |
264.7 |
T5573 |
12772-12783 |
NNS |
denotes |
macrophages |
T5574 |
12784-12785 |
-LRB- |
denotes |
( |
T5575 |
12785-12791 |
NN |
denotes |
Figure |
T5576 |
12792-12794 |
NN |
denotes |
2B |
T5577 |
12794-12795 |
-RRB- |
denotes |
) |
T5578 |
12795-12796 |
. |
denotes |
. |
T5579 |
12797-12799 |
TO |
denotes |
To |
T5580 |
12800-12806 |
VB |
denotes |
ensure |
T5581 |
12807-12811 |
IN |
denotes |
that |
T5582 |
12812-12815 |
NNP |
denotes |
PKC |
T5583 |
12816-12828 |
RB |
denotes |
specifically |
T5584 |
12829-12838 |
VBD |
denotes |
regulated |
T5585 |
12839-12844 |
NNP |
denotes |
NF-κB |
T5586 |
12845-12848 |
CD |
denotes |
p65 |
T5587 |
12849-12852 |
CC |
denotes |
and |
T5588 |
12853-12856 |
RB |
denotes |
not |
T5589 |
12857-12860 |
DT |
denotes |
the |
T5590 |
12861-12868 |
RB |
denotes |
closely |
T5591 |
12869-12876 |
JJ |
denotes |
related |
T5592 |
12877-12883 |
NN |
denotes |
family |
T5593 |
12884-12890 |
NN |
denotes |
member |
T5594 |
12890-12891 |
, |
denotes |
, |
T5595 |
12892-12897 |
NNP |
denotes |
c-Rel |
T5596 |
12897-12898 |
, |
denotes |
, |
T5597 |
12899-12901 |
PRP |
denotes |
we |
T5598 |
12902-12916 |
VBD |
denotes |
co-transfected |
T5599 |
12917-12922 |
NNP |
denotes |
c-Rel |
T5600 |
12923-12926 |
CC |
denotes |
and |
T5601 |
12927-12937 |
NNP |
denotes |
NF-κB-SEAP |
T5602 |
12938-12948 |
VBZ |
denotes |
constructs |
T5603 |
12949-12953 |
IN |
denotes |
into |
T5604 |
12954-12957 |
DT |
denotes |
the |
T5605 |
12958-12961 |
NNP |
denotes |
Raw |
T5606 |
12962-12967 |
CD |
denotes |
264.7 |
T5607 |
12968-12972 |
NN |
denotes |
cell |
T5608 |
12973-12977 |
NN |
denotes |
line |
T5609 |
12978-12981 |
CC |
denotes |
and |
T5610 |
12982-12990 |
VBN |
denotes |
measured |
T5611 |
12991-12996 |
JJ |
denotes |
NF-κB |
T5612 |
12997-13005 |
NN |
denotes |
activity |
T5613 |
13006-13008 |
IN |
denotes |
in |
T5614 |
13009-13017 |
NN |
denotes |
response |
T5615 |
13018-13020 |
TO |
denotes |
to |
T5616 |
13021-13026 |
NNP |
denotes |
M-CSF |
T5617 |
13026-13027 |
. |
denotes |
. |
T5618 |
13028-13033 |
EX |
denotes |
There |
T5619 |
13034-13037 |
VBD |
denotes |
was |
T5620 |
13038-13040 |
DT |
denotes |
no |
T5621 |
13041-13050 |
VBN |
denotes |
increased |
T5622 |
13051-13056 |
NN |
denotes |
NF-κB |
T5623 |
13057-13065 |
NN |
denotes |
activity |
T5624 |
13066-13068 |
IN |
denotes |
in |
T5625 |
13069-13074 |
NNS |
denotes |
cells |
T5626 |
13075-13085 |
VBG |
denotes |
expressing |
T5627 |
13086-13091 |
NNP |
denotes |
c-Rel |
T5628 |
13092-13093 |
-LRB- |
denotes |
( |
T5629 |
13093-13099 |
NNP |
denotes |
Figure |
T5630 |
13100-13102 |
NNP |
denotes |
S1 |
T5631 |
13102-13103 |
-RRB- |
denotes |
) |
T5632 |
13103-13104 |
. |
denotes |
. |
T5633 |
13105-13110 |
DT |
denotes |
These |
T5634 |
13111-13123 |
NNS |
denotes |
observations |
T5635 |
13124-13132 |
VBP |
denotes |
indicate |
T5636 |
13133-13137 |
IN |
denotes |
that |
T5637 |
13138-13141 |
NNP |
denotes |
PKC |
T5638 |
13142-13152 |
VBD |
denotes |
functioned |
T5639 |
13153-13161 |
RB |
denotes |
upstream |
T5640 |
13162-13164 |
IN |
denotes |
of |
T5641 |
13165-13170 |
NNP |
denotes |
NF-κB |
T5642 |
13171-13174 |
CD |
denotes |
p65 |
T5643 |
13175-13177 |
IN |
denotes |
in |
T5644 |
13178-13182 |
NNS |
denotes |
MDMs |
T5645 |
13183-13186 |
CC |
denotes |
and |
T5646 |
13187-13190 |
NNP |
denotes |
RAW |
T5647 |
13191-13196 |
CD |
denotes |
264.7 |
T5648 |
13197-13202 |
NNS |
denotes |
cells |
T5649 |
13202-13203 |
. |
denotes |
. |
T6258 |
13205-13210 |
NN |
denotes |
NF-κB |
T6259 |
13211-13214 |
CC |
denotes |
and |
T6260 |
13215-13218 |
NNP |
denotes |
PKC |
T6261 |
13218-13219 |
-LRB- |
denotes |
( |
T6262 |
13219-13220 |
PRP |
denotes |
s |
T6263 |
13220-13221 |
-RRB- |
denotes |
) |
T6264 |
13222-13229 |
NNP |
denotes |
Mediate |
T6265 |
13230-13235 |
NNP |
denotes |
Human |
T6266 |
13236-13239 |
NNP |
denotes |
MDM |
T6267 |
13240-13248 |
NNP |
denotes |
Survival |
T6268 |
13249-13251 |
IN |
denotes |
in |
T6269 |
13252-13260 |
NNP |
denotes |
Response |
T6270 |
13261-13263 |
TO |
denotes |
to |
T6271 |
13264-13269 |
NNP |
denotes |
M-CSF |
T6272 |
13270-13281 |
NNP |
denotes |
Stimulation |
T6273 |
13282-13287 |
IN |
denotes |
Since |
T6274 |
13288-13291 |
NNP |
denotes |
PKC |
T6275 |
13292-13295 |
CC |
denotes |
and |
T6276 |
13296-13301 |
NNP |
denotes |
NF-κB |
T6277 |
13302-13305 |
VBP |
denotes |
are |
T6278 |
13306-13314 |
JJ |
denotes |
critical |
T6279 |
13315-13317 |
IN |
denotes |
in |
T6280 |
13318-13322 |
NN |
denotes |
cell |
T6281 |
13323-13331 |
NN |
denotes |
survival |
T6282 |
13332-13333 |
NNP |
denotes |
[ |
T6283 |
13333-13335 |
CD |
denotes |
37 |
T6284 |
13335-13336 |
NNP |
denotes |
] |
T6285 |
13336-13337 |
, |
denotes |
, |
T6286 |
13338-13339 |
NNP |
denotes |
[ |
T6287 |
13339-13341 |
CD |
denotes |
38 |
T6288 |
13341-13342 |
NNP |
denotes |
] |
T6289 |
13342-13343 |
, |
denotes |
, |
T6290 |
13344-13346 |
PRP |
denotes |
we |
T6291 |
13347-13359 |
VBD |
denotes |
hypothesized |
T6292 |
13360-13364 |
IN |
denotes |
that |
T6293 |
13365-13370 |
NNP |
denotes |
M-CSF |
T6294 |
13371-13379 |
VBD |
denotes |
promoted |
T6295 |
13380-13384 |
NN |
denotes |
cell |
T6296 |
13385-13393 |
NN |
denotes |
survival |
T6297 |
13394-13401 |
IN |
denotes |
through |
T6298 |
13402-13405 |
NNP |
denotes |
PKC |
T6299 |
13406-13408 |
IN |
denotes |
in |
T6300 |
13409-13414 |
JJ |
denotes |
human |
T6301 |
13415-13419 |
NNS |
denotes |
MDMs |
T6302 |
13419-13420 |
. |
denotes |
. |
T6303 |
13421-13423 |
TO |
denotes |
To |
T6304 |
13424-13430 |
VB |
denotes |
detect |
T6305 |
13431-13440 |
NN |
denotes |
apoptosis |
T6306 |
13440-13441 |
, |
denotes |
, |
T6307 |
13442-13445 |
DT |
denotes |
the |
T6308 |
13446-13456 |
NN |
denotes |
expression |
T6309 |
13457-13459 |
IN |
denotes |
of |
T6310 |
13460-13467 |
JJ |
denotes |
cleaved |
T6311 |
13468-13477 |
JJ |
denotes |
caspase-3 |
T6312 |
13477-13478 |
, |
denotes |
, |
T6313 |
13479-13480 |
DT |
denotes |
a |
T6314 |
13481-13487 |
NN |
denotes |
marker |
T6315 |
13488-13490 |
IN |
denotes |
of |
T6316 |
13491-13500 |
NN |
denotes |
apoptosis |
T6317 |
13500-13501 |
, |
denotes |
, |
T6318 |
13502-13505 |
VBD |
denotes |
was |
T6319 |
13506-13514 |
VBN |
denotes |
analyzed |
T6320 |
13515-13517 |
IN |
denotes |
in |
T6321 |
13518-13521 |
DT |
denotes |
the |
T6322 |
13522-13530 |
NN |
denotes |
presence |
T6323 |
13531-13533 |
CC |
denotes |
or |
T6324 |
13534-13541 |
NN |
denotes |
absence |
T6325 |
13542-13544 |
IN |
denotes |
of |
T6326 |
13545-13550 |
NNP |
denotes |
M-CSF |
T6327 |
13551-13554 |
CC |
denotes |
and |
T6328 |
13555-13558 |
NNP |
denotes |
PKC |
T6329 |
13559-13569 |
NNS |
denotes |
inhibitors |
T6330 |
13569-13570 |
. |
denotes |
. |
T6331 |
13571-13573 |
IN |
denotes |
In |
T6332 |
13574-13578 |
NNS |
denotes |
MDMs |
T6333 |
13579-13589 |
VBN |
denotes |
pretreated |
T6334 |
13590-13594 |
IN |
denotes |
with |
T6335 |
13595-13598 |
NNP |
denotes |
PKC |
T6336 |
13599-13609 |
NNS |
denotes |
inhibitors |
T6337 |
13610-13611 |
-LRB- |
denotes |
( |
T6338 |
13611-13621 |
NN |
denotes |
Ro-31-8220 |
T6339 |
13621-13622 |
, |
denotes |
, |
T6340 |
13623-13630 |
NNP |
denotes |
Gö-6976 |
T6341 |
13630-13631 |
, |
denotes |
, |
T6342 |
13632-13634 |
CC |
denotes |
or |
T6343 |
13635-13643 |
NNP |
denotes |
BAPTA/AM |
T6344 |
13643-13644 |
-RRB- |
denotes |
) |
T6345 |
13645-13648 |
CC |
denotes |
and |
T6346 |
13649-13659 |
VBN |
denotes |
stimulated |
T6347 |
13660-13664 |
IN |
denotes |
with |
T6348 |
13665-13670 |
NNP |
denotes |
M-CSF |
T6349 |
13670-13671 |
, |
denotes |
, |
T6350 |
13672-13679 |
VBD |
denotes |
cleaved |
T6351 |
13680-13689 |
JJ |
denotes |
caspase-3 |
T6352 |
13690-13693 |
VBD |
denotes |
was |
T6353 |
13694-13702 |
VBN |
denotes |
elevated |
T6354 |
13703-13705 |
TO |
denotes |
to |
T6355 |
13706-13712 |
NNS |
denotes |
levels |
T6356 |
13713-13715 |
IN |
denotes |
of |
T6357 |
13716-13721 |
NNS |
denotes |
cells |
T6358 |
13722-13729 |
VBN |
denotes |
treated |
T6359 |
13730-13734 |
IN |
denotes |
with |
T6360 |
13735-13742 |
NN |
denotes |
vehicle |
T6361 |
13743-13748 |
RB |
denotes |
alone |
T6362 |
13749-13750 |
-LRB- |
denotes |
( |
T6363 |
13750-13756 |
NN |
denotes |
Figure |
T6364 |
13757-13759 |
NN |
denotes |
3A |
T6365 |
13759-13760 |
-RRB- |
denotes |
) |
T6366 |
13760-13761 |
. |
denotes |
. |
T6367 |
13762-13764 |
IN |
denotes |
In |
T6368 |
13765-13773 |
NN |
denotes |
contrast |
T6369 |
13773-13774 |
, |
denotes |
, |
T6370 |
13775-13780 |
NNS |
denotes |
cells |
T6371 |
13781-13790 |
VBN |
denotes |
incubated |
T6372 |
13791-13795 |
IN |
denotes |
with |
T6373 |
13796-13801 |
NNP |
denotes |
M-CSF |
T6374 |
13802-13805 |
CC |
denotes |
and |
T6375 |
13806-13813 |
NN |
denotes |
vehicle |
T6376 |
13814-13817 |
VBD |
denotes |
had |
T6377 |
13818-13822 |
RBR |
denotes |
less |
T6378 |
13823-13830 |
JJ |
denotes |
cleaved |
T6379 |
13831-13840 |
JJ |
denotes |
caspase-3 |
T6380 |
13841-13845 |
IN |
denotes |
than |
T6381 |
13846-13851 |
NNS |
denotes |
cells |
T6382 |
13852-13861 |
VBN |
denotes |
incubated |
T6383 |
13862-13866 |
IN |
denotes |
with |
T6384 |
13867-13874 |
NN |
denotes |
vehicle |
T6385 |
13875-13880 |
RB |
denotes |
alone |
T6386 |
13881-13883 |
CC |
denotes |
or |
T6387 |
13884-13889 |
RB |
denotes |
M-CSF |
T6388 |
13890-13894 |
IN |
denotes |
with |
T6389 |
13895-13898 |
NNP |
denotes |
PKC |
T6390 |
13899-13909 |
NNS |
denotes |
inhibitors |
T6391 |
13909-13910 |
. |
denotes |
. |
T6392 |
13911-13916 |
DT |
denotes |
These |
T6393 |
13917-13921 |
NNS |
denotes |
data |
T6394 |
13922-13931 |
VBD |
denotes |
supported |
T6395 |
13932-13935 |
DT |
denotes |
the |
T6396 |
13936-13946 |
NN |
denotes |
hypothesis |
T6397 |
13947-13951 |
WDT |
denotes |
that |
T6398 |
13952-13965 |
VBD |
denotes |
M-CSF-induced |
T6399 |
13966-13971 |
JJ |
denotes |
NF-κB |
T6400 |
13972-13980 |
NN |
denotes |
activity |
T6401 |
13981-13984 |
VBD |
denotes |
was |
T6402 |
13985-13994 |
VBN |
denotes |
regulated |
T6403 |
13995-13997 |
IN |
denotes |
by |
T6404 |
13998-14010 |
JJ |
denotes |
conventional |
T6405 |
14011-14015 |
NNS |
denotes |
PKCs |
T6406 |
14015-14016 |
, |
denotes |
, |
T6407 |
14017-14020 |
RB |
denotes |
not |
T6408 |
14021-14026 |
JJ |
denotes |
novel |
T6409 |
14027-14031 |
NNS |
denotes |
PKCs |
T6410 |
14031-14032 |
. |
denotes |
. |
T23560 |
14077-14087 |
NNP |
denotes |
Inhibition |
T23561 |
14088-14090 |
IN |
denotes |
of |
T23562 |
14091-14094 |
NNP |
denotes |
PKC |
T23563 |
14095-14097 |
CC |
denotes |
or |
T23564 |
14098-14103 |
NNP |
denotes |
NF-κB |
T23565 |
14104-14111 |
VBZ |
denotes |
induces |
T23566 |
14112-14121 |
NN |
denotes |
apoptosis |
T23567 |
14122-14124 |
IN |
denotes |
in |
T23568 |
14125-14129 |
NNS |
denotes |
MDMs |
T23569 |
14129-14130 |
. |
denotes |
. |
T23570 |
14131-14132 |
-LRB- |
denotes |
( |
T23571 |
14132-14133 |
NNP |
denotes |
A |
T23572 |
14133-14134 |
-RRB- |
denotes |
) |
T23573 |
14135-14139 |
NNS |
denotes |
MDMs |
T23574 |
14140-14144 |
VBD |
denotes |
were |
T23575 |
14145-14158 |
VBN |
denotes |
pre-incubated |
T23576 |
14159-14161 |
IN |
denotes |
in |
T23577 |
14162-14166 |
NNP |
denotes |
RPMI |
T23578 |
14167-14173 |
NN |
denotes |
medium |
T23579 |
14174-14184 |
VBG |
denotes |
containing |
T23580 |
14185-14195 |
NNS |
denotes |
inhibitors |
T23581 |
14196-14197 |
-LRB- |
denotes |
( |
T23582 |
14197-14207 |
NN |
denotes |
Ro-31-8220 |
T23583 |
14207-14208 |
: |
denotes |
: |
T23584 |
14209-14210 |
CD |
denotes |
5 |
T23585 |
14211-14213 |
NNP |
denotes |
µM |
T23586 |
14213-14214 |
, |
denotes |
, |
T23587 |
14215-14222 |
NNP |
denotes |
Gö-6976 |
T23588 |
14222-14223 |
: |
denotes |
: |
T23589 |
14224-14225 |
CD |
denotes |
5 |
T23590 |
14226-14228 |
NNP |
denotes |
µM |
T23591 |
14228-14229 |
, |
denotes |
, |
T23592 |
14230-14238 |
NNP |
denotes |
BAPTA/AM |
T23593 |
14238-14239 |
: |
denotes |
: |
T23594 |
14240-14243 |
CD |
denotes |
2.5 |
T23595 |
14244-14246 |
NNP |
denotes |
µM |
T23596 |
14246-14247 |
-RRB- |
denotes |
) |
T23597 |
14248-14251 |
IN |
denotes |
for |
T23598 |
14252-14254 |
CD |
denotes |
30 |
T23599 |
14255-14262 |
NNS |
denotes |
minutes |
T23600 |
14263-14268 |
RB |
denotes |
prior |
T23601 |
14269-14271 |
TO |
denotes |
to |
T23602 |
14272-14275 |
DT |
denotes |
the |
T23603 |
14276-14284 |
NN |
denotes |
addition |
T23604 |
14285-14287 |
IN |
denotes |
of |
T23605 |
14288-14293 |
NNP |
denotes |
M-CSF |
T23606 |
14293-14294 |
. |
denotes |
. |
T23607 |
14295-14297 |
IN |
denotes |
As |
T23608 |
14298-14299 |
DT |
denotes |
a |
T23609 |
14300-14307 |
NN |
denotes |
control |
T23610 |
14307-14308 |
, |
denotes |
, |
T23611 |
14309-14318 |
JJ |
denotes |
untreated |
T23612 |
14319-14324 |
NNS |
denotes |
cells |
T23613 |
14325-14329 |
VBD |
denotes |
were |
T23614 |
14330-14339 |
VBN |
denotes |
incubated |
T23615 |
14340-14344 |
IN |
denotes |
with |
T23616 |
14345-14353 |
NN |
denotes |
dimethyl |
T23617 |
14354-14363 |
NN |
denotes |
sulfoxide |
T23618 |
14364-14365 |
-LRB- |
denotes |
( |
T23619 |
14365-14369 |
NNP |
denotes |
DMSO |
T23620 |
14369-14370 |
-RRB- |
denotes |
) |
T23621 |
14370-14371 |
. |
denotes |
. |
T23622 |
14372-14376 |
NN |
denotes |
Cell |
T23623 |
14377-14384 |
NNS |
denotes |
lysates |
T23624 |
14385-14389 |
VBD |
denotes |
were |
T23625 |
14390-14398 |
VBN |
denotes |
resolved |
T23626 |
14399-14401 |
IN |
denotes |
by |
T23627 |
14402-14410 |
NNP |
denotes |
SDS-PAGE |
T23628 |
14411-14414 |
CC |
denotes |
and |
T23629 |
14415-14428 |
VBN |
denotes |
immunoblotted |
T23630 |
14429-14433 |
IN |
denotes |
with |
T23631 |
14434-14442 |
NN |
denotes |
antibody |
T23632 |
14443-14454 |
VBG |
denotes |
recognizing |
T23633 |
14455-14458 |
DT |
denotes |
the |
T23634 |
14459-14465 |
JJ |
denotes |
active |
T23635 |
14466-14473 |
JJ |
denotes |
cleaved |
T23636 |
14474-14478 |
NN |
denotes |
form |
T23637 |
14479-14481 |
IN |
denotes |
of |
T23638 |
14482-14491 |
JJ |
denotes |
caspase-3 |
T23639 |
14491-14492 |
. |
denotes |
. |
T23640 |
14493-14496 |
DT |
denotes |
The |
T23641 |
14497-14502 |
NNS |
denotes |
blots |
T23642 |
14503-14507 |
VBD |
denotes |
were |
T23643 |
14508-14517 |
VBN |
denotes |
reblotted |
T23644 |
14518-14522 |
IN |
denotes |
with |
T23645 |
14523-14530 |
NN |
denotes |
β-actin |
T23646 |
14531-14535 |
IN |
denotes |
that |
T23647 |
14536-14542 |
VBD |
denotes |
served |
T23648 |
14543-14545 |
IN |
denotes |
as |
T23649 |
14546-14547 |
DT |
denotes |
a |
T23650 |
14548-14555 |
VBG |
denotes |
loading |
T23651 |
14556-14563 |
NN |
denotes |
control |
T23652 |
14563-14564 |
. |
denotes |
. |
T23653 |
14565-14568 |
DT |
denotes |
The |
T23654 |
14569-14574 |
NN |
denotes |
ratio |
T23655 |
14575-14577 |
IN |
denotes |
of |
T23656 |
14578-14584 |
JJ |
denotes |
active |
T23657 |
14585-14594 |
JJ |
denotes |
caspase-3 |
T23658 |
14595-14600 |
NNS |
denotes |
bands |
T23659 |
14601-14602 |
-LRB- |
denotes |
( |
T23660 |
14602-14604 |
CD |
denotes |
17 |
T23661 |
14605-14607 |
NN |
denotes |
kD |
T23662 |
14608-14611 |
CC |
denotes |
and |
T23663 |
14612-14614 |
CD |
denotes |
19 |
T23664 |
14615-14617 |
NN |
denotes |
kD |
T23665 |
14617-14618 |
-RRB- |
denotes |
) |
T23666 |
14619-14621 |
TO |
denotes |
to |
T23667 |
14622-14629 |
VB |
denotes |
β-actin |
T23668 |
14630-14637 |
NN |
denotes |
control |
T23669 |
14638-14641 |
VBD |
denotes |
was |
T23670 |
14642-14652 |
VBN |
denotes |
determined |
T23671 |
14653-14655 |
IN |
denotes |
by |
T23672 |
14656-14668 |
NN |
denotes |
densitometry |
T23673 |
14669-14677 |
NN |
denotes |
analysis |
T23674 |
14678-14679 |
-LRB- |
denotes |
( |
T23675 |
14679-14685 |
JJ |
denotes |
bottom |
T23676 |
14686-14691 |
NN |
denotes |
panel |
T23677 |
14691-14692 |
-RRB- |
denotes |
) |
T23678 |
14692-14693 |
. |
denotes |
. |
T23679 |
14694-14698 |
NNP |
denotes |
Data |
T23680 |
14699-14709 |
VBZ |
denotes |
represents |
T23681 |
14710-14713 |
DT |
denotes |
the |
T23682 |
14714-14718 |
JJ |
denotes |
mean |
T23683 |
14719-14720 |
NN |
denotes |
± |
T23684 |
14721-14726 |
NNP |
denotes |
S.E.M |
T23685 |
14727-14731 |
IN |
denotes |
from |
T23686 |
14732-14735 |
CD |
denotes |
two |
T23687 |
14736-14747 |
JJ |
denotes |
independent |
T23688 |
14748-14754 |
NNS |
denotes |
donors |
T23689 |
14754-14755 |
. |
denotes |
. |
T23690 |
14756-14757 |
-LRB- |
denotes |
( |
T23691 |
14757-14758 |
NNP |
denotes |
B |
T23692 |
14758-14759 |
-RRB- |
denotes |
) |
T23693 |
14760-14769 |
NNP |
denotes |
Apoptosis |
T23694 |
14770-14772 |
IN |
denotes |
of |
T23695 |
14773-14776 |
DT |
denotes |
the |
T23696 |
14777-14784 |
VBN |
denotes |
treated |
T23697 |
14785-14789 |
NNS |
denotes |
MDMs |
T23698 |
14790-14793 |
VBD |
denotes |
was |
T23699 |
14794-14798 |
RB |
denotes |
also |
T23700 |
14799-14807 |
VBN |
denotes |
measured |
T23701 |
14808-14810 |
IN |
denotes |
by |
T23702 |
14811-14818 |
NNP |
denotes |
Annexin |
T23703 |
14819-14825 |
NNP |
denotes |
V-FITC |
T23704 |
14826-14829 |
CC |
denotes |
and |
T23705 |
14830-14839 |
NN |
denotes |
propidium |
T23706 |
14840-14846 |
NN |
denotes |
iodine |
T23707 |
14847-14848 |
-LRB- |
denotes |
( |
T23708 |
14848-14850 |
NNP |
denotes |
PI |
T23709 |
14850-14851 |
-RRB- |
denotes |
) |
T23710 |
14852-14860 |
VBG |
denotes |
staining |
T23711 |
14861-14864 |
CC |
denotes |
and |
T23712 |
14865-14873 |
VBN |
denotes |
analyzed |
T23713 |
14874-14876 |
IN |
denotes |
by |
T23714 |
14877-14881 |
NN |
denotes |
flow |
T23715 |
14882-14891 |
NN |
denotes |
cytometry |
T23716 |
14891-14892 |
. |
denotes |
. |
T23717 |
14893-14896 |
DT |
denotes |
The |
T23718 |
14897-14907 |
NN |
denotes |
percentage |
T23719 |
14908-14910 |
IN |
denotes |
of |
T23720 |
14911-14920 |
VBG |
denotes |
surviving |
T23721 |
14921-14926 |
NNS |
denotes |
cells |
T23722 |
14927-14928 |
-LRB- |
denotes |
( |
T23723 |
14928-14935 |
NNP |
denotes |
Annexin |
T23724 |
14936-14940 |
NNP |
denotes |
V/PI |
T23725 |
14941-14949 |
JJ |
denotes |
negative |
T23726 |
14949-14950 |
-RRB- |
denotes |
) |
T23727 |
14951-14954 |
IN |
denotes |
for |
T23728 |
14955-14958 |
DT |
denotes |
the |
T23729 |
14959-14964 |
NNS |
denotes |
cells |
T23730 |
14965-14972 |
VBN |
denotes |
treated |
T23731 |
14973-14977 |
IN |
denotes |
with |
T23732 |
14978-14991 |
NNP |
denotes |
vehicle/M-CSF |
T23733 |
14992-14995 |
VBD |
denotes |
was |
T23734 |
14996-15007 |
RB |
denotes |
arbitrarily |
T23735 |
15008-15011 |
VBN |
denotes |
set |
T23736 |
15012-15014 |
IN |
denotes |
as |
T23737 |
15015-15018 |
CD |
denotes |
100 |
T23738 |
15018-15019 |
. |
denotes |
. |
T23739 |
15020-15024 |
NNP |
denotes |
Data |
T23740 |
15025-15030 |
VBN |
denotes |
shown |
T23741 |
15031-15040 |
VBP |
denotes |
represent |
T23742 |
15041-15044 |
DT |
denotes |
the |
T23743 |
15045-15049 |
JJ |
denotes |
mean |
T23744 |
15050-15051 |
NN |
denotes |
± |
T23745 |
15052-15057 |
NNP |
denotes |
S.E.M |
T23746 |
15058-15062 |
IN |
denotes |
from |
T23747 |
15063-15068 |
CD |
denotes |
three |
T23748 |
15069-15080 |
JJ |
denotes |
independent |
T23749 |
15081-15092 |
NNS |
denotes |
experiments |
T23750 |
15092-15093 |
. |
denotes |
. |
T23751 |
15094-15095 |
SYM |
denotes |
* |
T23752 |
15095-15098 |
DT |
denotes |
The |
T23753 |
15099-15107 |
NNS |
denotes |
p-values |
T23754 |
15108-15110 |
IN |
denotes |
of |
T23755 |
15111-15127 |
JJ |
denotes |
inhibitors/M-CSF |
T23756 |
15128-15136 |
VBN |
denotes |
compared |
T23757 |
15137-15139 |
TO |
denotes |
to |
T23758 |
15140-15153 |
NNP |
denotes |
vehicle/M-CSF |
T23759 |
15154-15158 |
VBD |
denotes |
were |
T23760 |
15159-15160 |
CD |
denotes |
≤ |
T23761 |
15160-15164 |
CD |
denotes |
0.05 |
T23762 |
15164-15165 |
. |
denotes |
. |
T6411 |
15168-15170 |
TO |
denotes |
To |
T6412 |
15171-15178 |
VB |
denotes |
confirm |
T6413 |
15179-15183 |
DT |
denotes |
that |
T6414 |
15184-15187 |
NNP |
denotes |
PKC |
T6415 |
15188-15198 |
NN |
denotes |
inhibition |
T6416 |
15199-15208 |
VBD |
denotes |
decreased |
T6417 |
15209-15213 |
NN |
denotes |
cell |
T6418 |
15214-15222 |
NN |
denotes |
survival |
T6419 |
15222-15223 |
, |
denotes |
, |
T6420 |
15224-15229 |
NNS |
denotes |
cells |
T6421 |
15230-15234 |
VBD |
denotes |
were |
T6422 |
15235-15242 |
VBN |
denotes |
treated |
T6423 |
15243-15247 |
IN |
denotes |
with |
T6424 |
15248-15253 |
NNP |
denotes |
M-CSF |
T6425 |
15254-15256 |
IN |
denotes |
in |
T6426 |
15257-15260 |
DT |
denotes |
the |
T6427 |
15261-15268 |
NN |
denotes |
absence |
T6428 |
15269-15271 |
CC |
denotes |
or |
T6429 |
15272-15280 |
NN |
denotes |
presence |
T6430 |
15281-15283 |
IN |
denotes |
of |
T6431 |
15284-15287 |
NNP |
denotes |
PKC |
T6432 |
15288-15298 |
NNS |
denotes |
inhibitors |
T6433 |
15299-15302 |
CC |
denotes |
and |
T6434 |
15303-15307 |
RB |
denotes |
then |
T6435 |
15308-15312 |
RB |
denotes |
also |
T6436 |
15313-15321 |
VBD |
denotes |
examined |
T6437 |
15322-15325 |
IN |
denotes |
for |
T6438 |
15326-15335 |
NN |
denotes |
apoptosis |
T6439 |
15336-15338 |
IN |
denotes |
by |
T6440 |
15339-15346 |
NNP |
denotes |
Annexin |
T6441 |
15347-15351 |
NNP |
denotes |
V/PI |
T6442 |
15352-15360 |
VBG |
denotes |
staining |
T6443 |
15360-15361 |
. |
denotes |
. |
T6444 |
15362-15365 |
NNP |
denotes |
PKC |
T6445 |
15366-15376 |
NNS |
denotes |
inhibitors |
T6446 |
15377-15379 |
IN |
denotes |
in |
T6447 |
15380-15383 |
DT |
denotes |
the |
T6448 |
15384-15392 |
NN |
denotes |
presence |
T6449 |
15393-15395 |
IN |
denotes |
of |
T6450 |
15396-15401 |
NNP |
denotes |
M-CSF |
T6451 |
15402-15409 |
VBD |
denotes |
reduced |
T6452 |
15410-15413 |
DT |
denotes |
the |
T6453 |
15414-15420 |
NN |
denotes |
number |
T6454 |
15421-15423 |
IN |
denotes |
of |
T6455 |
15424-15431 |
NNP |
denotes |
Annexin |
T6456 |
15432-15436 |
NNP |
denotes |
V/PI |
T6457 |
15437-15445 |
JJ |
denotes |
negative |
T6458 |
15446-15450 |
NNS |
denotes |
MDMs |
T6459 |
15451-15459 |
VBN |
denotes |
compared |
T6460 |
15460-15462 |
TO |
denotes |
to |
T6461 |
15463-15468 |
NNS |
denotes |
cells |
T6462 |
15469-15476 |
VBN |
denotes |
treated |
T6463 |
15477-15481 |
IN |
denotes |
with |
T6464 |
15482-15487 |
NNP |
denotes |
M-CSF |
T6465 |
15488-15493 |
RB |
denotes |
alone |
T6466 |
15494-15495 |
-LRB- |
denotes |
( |
T6467 |
15495-15501 |
NN |
denotes |
Figure |
T6468 |
15502-15504 |
NN |
denotes |
3B |
T6469 |
15504-15505 |
-RRB- |
denotes |
) |
T6470 |
15505-15506 |
. |
denotes |
. |
T6471 |
15507-15512 |
DT |
denotes |
These |
T6472 |
15513-15525 |
NNS |
denotes |
observations |
T6473 |
15526-15533 |
RBR |
denotes |
further |
T6474 |
15534-15543 |
VBD |
denotes |
suggested |
T6475 |
15544-15548 |
IN |
denotes |
that |
T6476 |
15549-15552 |
NNP |
denotes |
MDM |
T6477 |
15553-15561 |
NN |
denotes |
survival |
T6478 |
15562-15564 |
VBZ |
denotes |
is |
T6479 |
15565-15573 |
VBN |
denotes |
promoted |
T6480 |
15574-15576 |
IN |
denotes |
by |
T6481 |
15577-15582 |
NNP |
denotes |
M-CSF |
T6482 |
15583-15586 |
CC |
denotes |
and |
T6483 |
15587-15597 |
RB |
denotes |
critically |
T6484 |
15598-15606 |
VBZ |
denotes |
involves |
T6485 |
15607-15619 |
JJ |
denotes |
conventional |
T6486 |
15620-15624 |
NNS |
denotes |
PKCs |
T6487 |
15625-15628 |
CC |
denotes |
and |
T6488 |
15629-15634 |
JJ |
denotes |
NF-κB |
T6489 |
15635-15643 |
NN |
denotes |
activity |
T6490 |
15643-15644 |
. |
denotes |
. |
T7014 |
15646-15659 |
NNS |
denotes |
M-CSF-Induces |
T7015 |
15660-15664 |
NNP |
denotes |
PKCα |
T7016 |
15665-15671 |
NNP |
denotes |
Kinase |
T7017 |
15672-15680 |
NNP |
denotes |
Activity |
T7018 |
15681-15686 |
IN |
denotes |
Since |
T7019 |
15687-15690 |
PRP$ |
denotes |
our |
T7020 |
15691-15695 |
NNS |
denotes |
data |
T7021 |
15696-15705 |
VBD |
denotes |
suggested |
T7022 |
15706-15710 |
IN |
denotes |
that |
T7023 |
15711-15723 |
JJ |
denotes |
conventional |
T7024 |
15724-15728 |
NNS |
denotes |
PKCs |
T7025 |
15729-15733 |
VBD |
denotes |
were |
T7026 |
15734-15742 |
VBN |
denotes |
involved |
T7027 |
15743-15745 |
IN |
denotes |
in |
T7028 |
15746-15756 |
VBG |
denotes |
activating |
T7029 |
15757-15762 |
NN |
denotes |
NF-κB |
T7030 |
15763-15765 |
IN |
denotes |
in |
T7031 |
15766-15774 |
NN |
denotes |
response |
T7032 |
15775-15777 |
TO |
denotes |
to |
T7033 |
15778-15783 |
NNP |
denotes |
M-CSF |
T7034 |
15784-15786 |
IN |
denotes |
in |
T7035 |
15787-15794 |
JJ |
denotes |
primary |
T7036 |
15795-15800 |
JJ |
denotes |
human |
T7037 |
15801-15812 |
NNS |
denotes |
macrophages |
T7038 |
15812-15813 |
, |
denotes |
, |
T7039 |
15814-15816 |
PRP |
denotes |
we |
T7040 |
15817-15821 |
JJ |
denotes |
next |
T7041 |
15822-15834 |
VBD |
denotes |
investigated |
T7042 |
15835-15842 |
IN |
denotes |
whether |
T7043 |
15843-15846 |
DT |
denotes |
the |
T7044 |
15847-15859 |
JJ |
denotes |
conventional |
T7045 |
15860-15863 |
NNP |
denotes |
PKC |
T7046 |
15863-15864 |
, |
denotes |
, |
T7047 |
15865-15869 |
NNP |
denotes |
PKCα |
T7048 |
15870-15873 |
VBD |
denotes |
was |
T7049 |
15874-15875 |
DT |
denotes |
a |
T7050 |
15876-15886 |
JJ |
denotes |
downstream |
T7051 |
15887-15893 |
NN |
denotes |
target |
T7052 |
15894-15896 |
IN |
denotes |
of |
T7053 |
15897-15902 |
NNP |
denotes |
M-CSF |
T7054 |
15903-15905 |
IN |
denotes |
in |
T7055 |
15906-15911 |
JJ |
denotes |
human |
T7056 |
15912-15916 |
NNS |
denotes |
MDMs |
T7057 |
15916-15917 |
. |
denotes |
. |
T7058 |
15918-15922 |
NNP |
denotes |
PKCα |
T7059 |
15923-15926 |
VBD |
denotes |
was |
T7060 |
15927-15945 |
VBN |
denotes |
immunoprecipitated |
T7061 |
15946-15950 |
IN |
denotes |
from |
T7062 |
15951-15956 |
JJ |
denotes |
human |
T7063 |
15957-15961 |
NNS |
denotes |
MDMs |
T7064 |
15962-15964 |
IN |
denotes |
at |
T7065 |
15965-15968 |
DT |
denotes |
the |
T7066 |
15969-15978 |
JJ |
denotes |
indicated |
T7067 |
15979-15983 |
NN |
denotes |
time |
T7068 |
15984-15990 |
NNS |
denotes |
points |
T7069 |
15991-15992 |
-LRB- |
denotes |
( |
T7070 |
15992-15998 |
NN |
denotes |
Figure |
T7071 |
15999-16000 |
CD |
denotes |
4 |
T7072 |
16000-16001 |
-RRB- |
denotes |
) |
T7073 |
16001-16002 |
, |
denotes |
, |
T7074 |
16003-16006 |
CC |
denotes |
and |
T7075 |
16007-16011 |
RB |
denotes |
then |
T7076 |
16012-16013 |
DT |
denotes |
a |
T7077 |
16014-16017 |
NNP |
denotes |
PKC |
T7078 |
16018-16024 |
NN |
denotes |
kinase |
T7079 |
16025-16030 |
NN |
denotes |
assay |
T7080 |
16031-16034 |
VBD |
denotes |
was |
T7081 |
16035-16044 |
VBN |
denotes |
performed |
T7082 |
16045-16050 |
VBG |
denotes |
using |
T7083 |
16051-16052 |
DT |
denotes |
a |
T7084 |
16053-16071 |
JJ |
denotes |
fluorescein-tagged |
T7085 |
16072-16079 |
NN |
denotes |
peptide |
T7086 |
16080-16082 |
IN |
denotes |
as |
T7087 |
16083-16084 |
DT |
denotes |
a |
T7088 |
16085-16094 |
NN |
denotes |
substrate |
T7089 |
16094-16095 |
. |
denotes |
. |
T7090 |
16096-16098 |
IN |
denotes |
As |
T7091 |
16099-16104 |
VBN |
denotes |
shown |
T7092 |
16105-16107 |
IN |
denotes |
in |
T7093 |
16108-16114 |
NN |
denotes |
Figure |
T7094 |
16115-16116 |
CD |
denotes |
4 |
T7095 |
16117-16118 |
-LRB- |
denotes |
( |
T7096 |
16118-16123 |
JJ |
denotes |
upper |
T7097 |
16124-16129 |
NN |
denotes |
panel |
T7098 |
16129-16130 |
-RRB- |
denotes |
) |
T7099 |
16130-16131 |
, |
denotes |
, |
T7100 |
16132-16135 |
DT |
denotes |
the |
T7101 |
16136-16143 |
NN |
denotes |
peptide |
T7102 |
16144-16153 |
NN |
denotes |
substrate |
T7103 |
16154-16157 |
VBD |
denotes |
was |
T7104 |
16158-16167 |
RB |
denotes |
maximally |
T7105 |
16168-16182 |
VBN |
denotes |
phosphorylated |
T7106 |
16183-16189 |
IN |
denotes |
within |
T7107 |
16190-16192 |
CD |
denotes |
10 |
T7108 |
16193-16200 |
NNS |
denotes |
minutes |
T7109 |
16201-16203 |
IN |
denotes |
of |
T7110 |
16204-16215 |
NN |
denotes |
stimulation |
T7111 |
16216-16217 |
-LRB- |
denotes |
( |
T7112 |
16217-16225 |
JJ |
denotes |
1.8-fold |
T7113 |
16226-16230 |
IN |
denotes |
over |
T7114 |
16231-16238 |
VBG |
denotes |
resting |
T7115 |
16239-16244 |
NNS |
denotes |
cells |
T7116 |
16244-16245 |
, |
denotes |
, |
T7117 |
16246-16251 |
JJR |
denotes |
lower |
T7118 |
16252-16257 |
NN |
denotes |
panel |
T7119 |
16257-16258 |
-RRB- |
denotes |
) |
T7120 |
16258-16259 |
, |
denotes |
, |
T7121 |
16260-16263 |
CC |
denotes |
and |
T7122 |
16264-16268 |
RB |
denotes |
then |
T7123 |
16269-16277 |
VBD |
denotes |
returned |
T7124 |
16278-16280 |
TO |
denotes |
to |
T7125 |
16281-16286 |
JJ |
denotes |
basal |
T7126 |
16287-16293 |
NNS |
denotes |
levels |
T7127 |
16294-16296 |
IN |
denotes |
by |
T7128 |
16297-16299 |
CD |
denotes |
15 |
T7129 |
16300-16307 |
NNS |
denotes |
minutes |
T7130 |
16307-16308 |
. |
denotes |
. |
T7131 |
16309-16313 |
DT |
denotes |
This |
T7132 |
16314-16320 |
NN |
denotes |
effect |
T7133 |
16321-16324 |
VBD |
denotes |
was |
T7134 |
16325-16328 |
RB |
denotes |
not |
T7135 |
16329-16333 |
VBN |
denotes |
seen |
T7136 |
16334-16336 |
IN |
denotes |
in |
T7137 |
16337-16353 |
JJ |
denotes |
M-CSF-stimulated |
T7138 |
16354-16363 |
NNS |
denotes |
monocytes |
T7139 |
16364-16368 |
WRB |
denotes |
when |
T7140 |
16369-16377 |
JJ |
denotes |
isogenic |
T7141 |
16378-16388 |
NNS |
denotes |
antibodies |
T7142 |
16389-16390 |
-LRB- |
denotes |
( |
T7143 |
16390-16393 |
NNP |
denotes |
IgG |
T7144 |
16393-16394 |
-RRB- |
denotes |
) |
T7145 |
16395-16399 |
VBD |
denotes |
were |
T7146 |
16400-16404 |
VBN |
denotes |
used |
T7147 |
16405-16408 |
IN |
denotes |
for |
T7148 |
16409-16428 |
NN |
denotes |
immunoprecipitation |
T7149 |
16428-16429 |
. |
denotes |
. |
T7150 |
16430-16437 |
JJ |
denotes |
Western |
T7151 |
16438-16443 |
NNS |
denotes |
blots |
T7152 |
16444-16446 |
IN |
denotes |
of |
T7153 |
16447-16456 |
JJ |
denotes |
identical |
T7154 |
16457-16464 |
NNS |
denotes |
samples |
T7155 |
16465-16470 |
VBG |
denotes |
using |
T7156 |
16471-16473 |
DT |
denotes |
an |
T7157 |
16474-16482 |
NN |
denotes |
antibody |
T7158 |
16483-16494 |
VBG |
denotes |
recognizing |
T7159 |
16495-16499 |
NNP |
denotes |
PKCα |
T7160 |
16500-16512 |
VBD |
denotes |
demonstrated |
T7161 |
16513-16517 |
IN |
denotes |
that |
T7162 |
16518-16523 |
JJ |
denotes |
equal |
T7163 |
16524-16531 |
NNS |
denotes |
amounts |
T7164 |
16532-16534 |
IN |
denotes |
of |
T7165 |
16535-16539 |
NNP |
denotes |
PKCα |
T7166 |
16540-16544 |
VBD |
denotes |
were |
T7167 |
16545-16552 |
VBN |
denotes |
assayed |
T7168 |
16553-16554 |
-LRB- |
denotes |
( |
T7169 |
16554-16560 |
NN |
denotes |
Figure |
T7170 |
16561-16562 |
CD |
denotes |
4 |
T7171 |
16562-16563 |
, |
denotes |
, |
T7172 |
16564-16570 |
JJ |
denotes |
middle |
T7173 |
16571-16576 |
NN |
denotes |
panel |
T7174 |
16576-16577 |
-RRB- |
denotes |
) |
T7175 |
16577-16578 |
. |
denotes |
. |
T24095 |
16623-16628 |
NNP |
denotes |
M-CSF |
T24096 |
16629-16638 |
VBZ |
denotes |
activates |
T24097 |
16639-16643 |
NNP |
denotes |
PKCα |
T24098 |
16644-16646 |
IN |
denotes |
in |
T24099 |
16647-16652 |
JJ |
denotes |
human |
T24100 |
16653-16657 |
NNS |
denotes |
MDMs |
T24101 |
16657-16658 |
. |
denotes |
. |
T24102 |
16659-16663 |
NNS |
denotes |
MDMs |
T24103 |
16664-16671 |
VBN |
denotes |
treated |
T24104 |
16672-16676 |
IN |
denotes |
with |
T24105 |
16677-16682 |
NNP |
denotes |
M-CSF |
T24106 |
16683-16684 |
-LRB- |
denotes |
( |
T24107 |
16684-16687 |
CD |
denotes |
100 |
T24108 |
16688-16693 |
NN |
denotes |
ng/ml |
T24109 |
16693-16694 |
-RRB- |
denotes |
) |
T24110 |
16695-16698 |
IN |
denotes |
for |
T24111 |
16699-16706 |
VBG |
denotes |
varying |
T24112 |
16707-16714 |
NNS |
denotes |
amounts |
T24113 |
16715-16717 |
IN |
denotes |
of |
T24114 |
16718-16722 |
NN |
denotes |
time |
T24115 |
16723-16727 |
VBD |
denotes |
were |
T24116 |
16728-16733 |
VBN |
denotes |
lysed |
T24117 |
16734-16737 |
CC |
denotes |
and |
T24118 |
16738-16756 |
VBN |
denotes |
immunoprecipitated |
T24119 |
16757-16762 |
VBG |
denotes |
using |
T24120 |
16763-16771 |
JJ |
denotes |
anti-PKC |
T24121 |
16772-16780 |
NN |
denotes |
antibody |
T24122 |
16781-16783 |
CC |
denotes |
or |
T24123 |
16784-16791 |
NN |
denotes |
control |
T24124 |
16792-16795 |
NNP |
denotes |
IgG |
T24125 |
16796-16804 |
NN |
denotes |
antibody |
T24126 |
16804-16805 |
. |
denotes |
. |
T24127 |
16806-16809 |
CD |
denotes |
One |
T24128 |
16810-16814 |
NN |
denotes |
half |
T24129 |
16815-16817 |
IN |
denotes |
of |
T24130 |
16818-16821 |
DT |
denotes |
the |
T24131 |
16822-16829 |
NNS |
denotes |
samples |
T24132 |
16830-16833 |
VBD |
denotes |
was |
T24133 |
16834-16838 |
VBN |
denotes |
used |
T24134 |
16839-16841 |
TO |
denotes |
to |
T24135 |
16842-16849 |
VB |
denotes |
analyze |
T24136 |
16850-16853 |
NNP |
denotes |
PKC |
T24137 |
16854-16860 |
NN |
denotes |
kinase |
T24138 |
16861-16869 |
NN |
denotes |
activity |
T24139 |
16870-16875 |
VBG |
denotes |
using |
T24140 |
16876-16877 |
DT |
denotes |
a |
T24141 |
16878-16889 |
NN |
denotes |
fluorescein |
T24142 |
16890-16896 |
VBD |
denotes |
tagged |
T24143 |
16897-16904 |
NN |
denotes |
peptide |
T24144 |
16905-16908 |
CC |
denotes |
and |
T24145 |
16909-16919 |
VBN |
denotes |
visualized |
T24146 |
16920-16922 |
IN |
denotes |
by |
T24147 |
16923-16930 |
JJ |
denotes |
agarose |
T24148 |
16931-16934 |
NN |
denotes |
gel |
T24149 |
16935-16950 |
NN |
denotes |
electrophoresis |
T24150 |
16951-16952 |
-LRB- |
denotes |
( |
T24151 |
16952-16955 |
JJ |
denotes |
top |
T24152 |
16956-16961 |
NN |
denotes |
panel |
T24153 |
16961-16962 |
-RRB- |
denotes |
) |
T24154 |
16962-16963 |
, |
denotes |
, |
T24155 |
16964-16969 |
IN |
denotes |
while |
T24156 |
16970-16973 |
DT |
denotes |
the |
T24157 |
16974-16979 |
JJ |
denotes |
other |
T24158 |
16980-16984 |
NN |
denotes |
half |
T24159 |
16985-16988 |
VBD |
denotes |
was |
T24160 |
16989-16998 |
VBN |
denotes |
subjected |
T24161 |
16999-17001 |
TO |
denotes |
to |
T24162 |
17002-17009 |
JJ |
denotes |
Western |
T24163 |
17010-17014 |
NN |
denotes |
blot |
T24164 |
17015-17023 |
NN |
denotes |
analysis |
T24165 |
17024-17026 |
TO |
denotes |
to |
T24166 |
17027-17034 |
VB |
denotes |
confirm |
T24167 |
17035-17040 |
JJ |
denotes |
equal |
T24168 |
17041-17048 |
NNS |
denotes |
amounts |
T24169 |
17049-17051 |
IN |
denotes |
of |
T24170 |
17052-17056 |
NNP |
denotes |
PKCα |
T24171 |
17057-17061 |
VBD |
denotes |
were |
T24172 |
17062-17080 |
VBN |
denotes |
immunoprecipitated |
T24173 |
17081-17085 |
IN |
denotes |
from |
T24174 |
17086-17090 |
DT |
denotes |
each |
T24175 |
17091-17097 |
NN |
denotes |
sample |
T24176 |
17098-17099 |
-LRB- |
denotes |
( |
T24177 |
17099-17105 |
JJ |
denotes |
middle |
T24178 |
17106-17111 |
NN |
denotes |
panel |
T24179 |
17111-17112 |
-RRB- |
denotes |
) |
T24180 |
17112-17113 |
. |
denotes |
. |
T24181 |
17114-17117 |
DT |
denotes |
The |
T24182 |
17118-17124 |
NN |
denotes |
kinase |
T24183 |
17125-17130 |
NN |
denotes |
assay |
T24184 |
17131-17134 |
VBD |
denotes |
was |
T24185 |
17135-17146 |
VBN |
denotes |
quantitated |
T24186 |
17147-17152 |
VBG |
denotes |
using |
T24187 |
17153-17161 |
NNP |
denotes |
Quantity |
T24188 |
17162-17165 |
CD |
denotes |
One |
T24189 |
17166-17174 |
NN |
denotes |
software |
T24190 |
17175-17176 |
-LRB- |
denotes |
( |
T24191 |
17176-17183 |
NNP |
denotes |
Bio-Rad |
T24192 |
17183-17184 |
-RRB- |
denotes |
) |
T24193 |
17185-17186 |
-LRB- |
denotes |
( |
T24194 |
17186-17192 |
JJ |
denotes |
bottom |
T24195 |
17193-17198 |
NN |
denotes |
panel |
T24196 |
17198-17199 |
-RRB- |
denotes |
) |
T24197 |
17199-17200 |
. |
denotes |
. |
T24198 |
17201-17205 |
NNP |
denotes |
Data |
T24199 |
17206-17216 |
VBZ |
denotes |
represents |
T24200 |
17217-17220 |
DT |
denotes |
the |
T24201 |
17221-17228 |
JJ |
denotes |
average |
T24202 |
17229-17233 |
VBP |
denotes |
fold |
T24203 |
17234-17242 |
NN |
denotes |
increase |
T24204 |
17243-17245 |
IN |
denotes |
of |
T24205 |
17246-17250 |
NN |
denotes |
PKCα |
T24206 |
17251-17259 |
NN |
denotes |
activity |
T24207 |
17260-17262 |
IN |
denotes |
in |
T24208 |
17263-17277 |
JJ |
denotes |
non-stimulated |
T24209 |
17278-17285 |
NNS |
denotes |
samples |
T24210 |
17286-17294 |
VBN |
denotes |
compared |
T24211 |
17295-17297 |
TO |
denotes |
to |
T24212 |
17298-17311 |
JJ |
denotes |
M-CSF-treated |
T24213 |
17312-17315 |
NNP |
denotes |
MDM |
T24214 |
17316-17317 |
NN |
denotes |
± |
T24215 |
17318-17323 |
NNP |
denotes |
S.E.M |
T24216 |
17324-17327 |
IN |
denotes |
for |
T24217 |
17328-17333 |
CD |
denotes |
three |
T24218 |
17334-17345 |
JJ |
denotes |
independent |
T24219 |
17346-17357 |
NNS |
denotes |
experiments |
T24220 |
17357-17358 |
. |
denotes |
. |
T24221 |
17359-17361 |
NNP |
denotes |
NS |
T24222 |
17361-17362 |
: |
denotes |
: |
T24223 |
17363-17377 |
JJ |
denotes |
non-stimulated |
T24224 |
17377-17378 |
. |
denotes |
. |
T24225 |
17379-17380 |
SYM |
denotes |
* |
T24226 |
17381-17384 |
DT |
denotes |
The |
T24227 |
17385-17393 |
NNS |
denotes |
p-values |
T24228 |
17394-17396 |
IN |
denotes |
of |
T24229 |
17397-17402 |
NNP |
denotes |
M-CSF |
T24230 |
17403-17413 |
VBD |
denotes |
stimulated |
T24231 |
17414-17422 |
VBN |
denotes |
compared |
T24232 |
17423-17425 |
TO |
denotes |
to |
T24233 |
17426-17440 |
JJ |
denotes |
non-stimulated |
T24234 |
17441-17445 |
VBD |
denotes |
were |
T24235 |
17446-17447 |
CD |
denotes |
≤ |
T24236 |
17447-17451 |
CD |
denotes |
0.05 |
T24237 |
17451-17452 |
. |
denotes |
. |
T7492 |
17454-17469 |
JJ |
denotes |
M-CSF-Dependent |
T7493 |
17470-17480 |
NNP |
denotes |
Activation |
T7494 |
17481-17483 |
IN |
denotes |
of |
T7495 |
17484-17487 |
NNP |
denotes |
PKC |
T7496 |
17488-17492 |
VBZ |
denotes |
Does |
T7497 |
17493-17496 |
RB |
denotes |
Not |
T7498 |
17497-17505 |
VB |
denotes |
Regulate |
T7499 |
17506-17509 |
DT |
denotes |
the |
T7500 |
17510-17519 |
JJ |
denotes |
Classical |
T7501 |
17520-17525 |
NN |
denotes |
NF-κB |
T7502 |
17526-17529 |
CD |
denotes |
p65 |
T7503 |
17530-17540 |
NNP |
denotes |
Activation |
T7504 |
17541-17548 |
NNP |
denotes |
Pathway |
T7505 |
17549-17558 |
NNP |
denotes |
Canonical |
T7506 |
17559-17569 |
NN |
denotes |
activation |
T7507 |
17570-17572 |
IN |
denotes |
of |
T7508 |
17573-17578 |
JJ |
denotes |
NF-κB |
T7509 |
17579-17585 |
VBZ |
denotes |
occurs |
T7510 |
17586-17589 |
IN |
denotes |
via |
T7511 |
17590-17605 |
NN |
denotes |
phosphorylation |
T7512 |
17606-17609 |
CC |
denotes |
and |
T7513 |
17610-17621 |
NN |
denotes |
degradation |
T7514 |
17622-17624 |
IN |
denotes |
of |
T7515 |
17625-17629 |
NNP |
denotes |
IκBα |
T7516 |
17630-17637 |
VBG |
denotes |
leading |
T7517 |
17638-17640 |
TO |
denotes |
to |
T7518 |
17641-17644 |
DT |
denotes |
the |
T7519 |
17645-17652 |
NN |
denotes |
release |
T7520 |
17653-17656 |
CC |
denotes |
and |
T7521 |
17657-17664 |
JJ |
denotes |
nuclear |
T7522 |
17665-17678 |
NN |
denotes |
translocation |
T7523 |
17679-17681 |
IN |
denotes |
of |
T7524 |
17682-17685 |
DT |
denotes |
the |
T7525 |
17686-17691 |
NNP |
denotes |
NF-κB |
T7526 |
17692-17699 |
CD |
denotes |
p50/p65 |
T7527 |
17700-17711 |
NN |
denotes |
heterodimer |
T7528 |
17712-17714 |
TO |
denotes |
to |
T7529 |
17715-17728 |
VB |
denotes |
transactivate |
T7530 |
17729-17735 |
NN |
denotes |
target |
T7531 |
17736-17741 |
NNS |
denotes |
genes |
T7532 |
17742-17743 |
NNP |
denotes |
[ |
T7533 |
17743-17745 |
CD |
denotes |
37 |
T7534 |
17745-17746 |
NNP |
denotes |
] |
T7535 |
17746-17747 |
, |
denotes |
, |
T7536 |
17748-17749 |
NNP |
denotes |
[ |
T7537 |
17749-17751 |
CD |
denotes |
39 |
T7538 |
17751-17752 |
NNP |
denotes |
] |
T7539 |
17752-17753 |
. |
denotes |
. |
T7540 |
17754-17759 |
IN |
denotes |
Since |
T7541 |
17760-17772 |
JJ |
denotes |
conventional |
T7542 |
17773-17776 |
NNP |
denotes |
PKC |
T7543 |
17777-17785 |
NN |
denotes |
activity |
T7544 |
17786-17789 |
VBD |
denotes |
was |
T7545 |
17790-17799 |
JJ |
denotes |
important |
T7546 |
17800-17802 |
IN |
denotes |
in |
T7547 |
17803-17813 |
VBG |
denotes |
regulating |
T7548 |
17814-17827 |
JJ |
denotes |
M-CSF-induced |
T7549 |
17828-17833 |
NN |
denotes |
NF-κB |
T7550 |
17834-17844 |
NN |
denotes |
activation |
T7551 |
17844-17845 |
, |
denotes |
, |
T7552 |
17846-17848 |
PRP |
denotes |
we |
T7553 |
17849-17853 |
JJ |
denotes |
next |
T7554 |
17854-17866 |
VBD |
denotes |
investigated |
T7555 |
17867-17874 |
IN |
denotes |
whether |
T7556 |
17875-17879 |
NNP |
denotes |
IκBα |
T7557 |
17880-17891 |
NN |
denotes |
degradation |
T7558 |
17892-17895 |
VBD |
denotes |
was |
T7559 |
17896-17905 |
VBN |
denotes |
regulated |
T7560 |
17906-17908 |
IN |
denotes |
by |
T7561 |
17909-17912 |
NNP |
denotes |
PKC |
T7562 |
17912-17913 |
. |
denotes |
. |
T7563 |
17914-17919 |
NNS |
denotes |
Cells |
T7564 |
17920-17924 |
VBD |
denotes |
were |
T7565 |
17925-17932 |
VBN |
denotes |
treated |
T7566 |
17933-17937 |
IN |
denotes |
with |
T7567 |
17938-17951 |
NN |
denotes |
cyclohexamide |
T7568 |
17952-17953 |
-LRB- |
denotes |
( |
T7569 |
17953-17956 |
NNP |
denotes |
CHX |
T7570 |
17956-17957 |
-RRB- |
denotes |
) |
T7571 |
17958-17960 |
TO |
denotes |
to |
T7572 |
17961-17968 |
VB |
denotes |
inhibit |
T7573 |
17969-17976 |
NN |
denotes |
protein |
T7574 |
17977-17986 |
NN |
denotes |
synthesis |
T7575 |
17987-17989 |
IN |
denotes |
of |
T7576 |
17990-17994 |
NNP |
denotes |
IκBα |
T7577 |
17994-17995 |
, |
denotes |
, |
T7578 |
17996-17999 |
CC |
denotes |
and |
T7579 |
18000-18003 |
PRP$ |
denotes |
its |
T7580 |
18004-18015 |
NN |
denotes |
degradation |
T7581 |
18016-18019 |
VBD |
denotes |
was |
T7582 |
18020-18028 |
VBN |
denotes |
followed |
T7583 |
18028-18029 |
. |
denotes |
. |
T7584 |
18030-18032 |
IN |
denotes |
As |
T7585 |
18033-18038 |
VBN |
denotes |
shown |
T7586 |
18039-18041 |
IN |
denotes |
in |
T7587 |
18042-18048 |
NN |
denotes |
Figure |
T7588 |
18049-18051 |
CD |
denotes |
5A |
T7589 |
18051-18052 |
, |
denotes |
, |
T7590 |
18053-18056 |
NNP |
denotes |
PKC |
T7591 |
18057-18067 |
NN |
denotes |
inhibition |
T7592 |
18068-18072 |
IN |
denotes |
with |
T7593 |
18073-18083 |
NN |
denotes |
Ro-31-8220 |
T7594 |
18084-18087 |
VBD |
denotes |
did |
T7595 |
18088-18091 |
RB |
denotes |
not |
T7596 |
18092-18097 |
VB |
denotes |
alter |
T7597 |
18098-18111 |
JJ |
denotes |
M-CSF-induced |
T7598 |
18112-18116 |
NNP |
denotes |
IκBα |
T7599 |
18117-18128 |
NN |
denotes |
degradation |
T7600 |
18128-18129 |
, |
denotes |
, |
T7601 |
18130-18140 |
VBG |
denotes |
suggesting |
T7602 |
18141-18145 |
IN |
denotes |
that |
T7603 |
18146-18159 |
JJ |
denotes |
M-CSF-induced |
T7604 |
18160-18163 |
NNP |
denotes |
PKC |
T7605 |
18164-18172 |
NN |
denotes |
activity |
T7606 |
18173-18182 |
VBD |
denotes |
augmented |
T7607 |
18183-18188 |
JJ |
denotes |
NF-κB |
T7608 |
18189-18204 |
JJ |
denotes |
transcriptional |
T7609 |
18205-18213 |
NN |
denotes |
activity |
T7610 |
18214-18216 |
IN |
denotes |
by |
T7611 |
18217-18219 |
DT |
denotes |
an |
T7612 |
18220-18231 |
JJ |
denotes |
alternative |
T7613 |
18232-18239 |
NN |
denotes |
pathway |
T7614 |
18239-18240 |
, |
denotes |
, |
T7615 |
18241-18245 |
IN |
denotes |
like |
T7616 |
18246-18264 |
JJ |
denotes |
post-translational |
T7617 |
18265-18277 |
NN |
denotes |
modification |
T7618 |
18278-18280 |
IN |
denotes |
of |
T7619 |
18281-18286 |
NNP |
denotes |
NF-κB |
T7620 |
18287-18290 |
NNS |
denotes |
p65 |
T7621 |
18290-18291 |
. |
denotes |
. |
T24510 |
18336-18349 |
JJ |
denotes |
M-CSF-induced |
T24511 |
18350-18353 |
NN |
denotes |
PKC |
T24512 |
18354-18362 |
NN |
denotes |
activity |
T24513 |
18363-18367 |
VBZ |
denotes |
does |
T24514 |
18368-18371 |
RB |
denotes |
not |
T24515 |
18372-18380 |
VB |
denotes |
regulate |
T24516 |
18381-18385 |
NNP |
denotes |
IκBα |
T24517 |
18386-18397 |
NN |
denotes |
degradation |
T24518 |
18398-18401 |
CC |
denotes |
but |
T24519 |
18402-18411 |
VBZ |
denotes |
regulates |
T24520 |
18412-18415 |
DT |
denotes |
the |
T24521 |
18416-18431 |
NN |
denotes |
phosphorylation |
T24522 |
18432-18434 |
IN |
denotes |
of |
T24523 |
18435-18440 |
NNP |
denotes |
NF-κB |
T24524 |
18441-18444 |
NNS |
denotes |
p65 |
T24525 |
18445-18447 |
IN |
denotes |
at |
T24526 |
18448-18454 |
NNP |
denotes |
Ser276 |
T24527 |
18454-18455 |
. |
denotes |
. |
T24528 |
18456-18457 |
-LRB- |
denotes |
( |
T24529 |
18457-18458 |
NNP |
denotes |
A |
T24530 |
18458-18459 |
-RRB- |
denotes |
) |
T24531 |
18460-18464 |
NNS |
denotes |
MDMs |
T24532 |
18465-18469 |
VBD |
denotes |
were |
T24533 |
18470-18480 |
VBN |
denotes |
pretreated |
T24534 |
18481-18485 |
IN |
denotes |
with |
T24535 |
18486-18499 |
NN |
denotes |
cycloheximide |
T24536 |
18500-18501 |
-LRB- |
denotes |
( |
T24537 |
18501-18504 |
NNP |
denotes |
CHX |
T24538 |
18504-18505 |
-RRB- |
denotes |
) |
T24539 |
18506-18508 |
IN |
denotes |
in |
T24540 |
18509-18512 |
DT |
denotes |
the |
T24541 |
18513-18520 |
NN |
denotes |
absence |
T24542 |
18521-18523 |
CC |
denotes |
or |
T24543 |
18524-18532 |
NN |
denotes |
presence |
T24544 |
18533-18535 |
IN |
denotes |
of |
T24545 |
18536-18546 |
NN |
denotes |
Ro-31-8220 |
T24546 |
18547-18550 |
IN |
denotes |
for |
T24547 |
18551-18553 |
CD |
denotes |
30 |
T24548 |
18554-18561 |
NNS |
denotes |
minutes |
T24549 |
18562-18567 |
RB |
denotes |
prior |
T24550 |
18568-18570 |
TO |
denotes |
to |
T24551 |
18571-18576 |
NNP |
denotes |
M-CSF |
T24552 |
18577-18588 |
NN |
denotes |
stimulation |
T24553 |
18589-18592 |
IN |
denotes |
for |
T24554 |
18593-18596 |
DT |
denotes |
the |
T24555 |
18597-18606 |
JJ |
denotes |
indicated |
T24556 |
18607-18612 |
NNS |
denotes |
times |
T24557 |
18612-18613 |
. |
denotes |
. |
T24558 |
18614-18619 |
JJ |
denotes |
Whole |
T24559 |
18620-18624 |
NN |
denotes |
cell |
T24560 |
18625-18632 |
NNS |
denotes |
lysates |
T24561 |
18633-18637 |
VBD |
denotes |
were |
T24562 |
18638-18647 |
VBN |
denotes |
subjected |
T24563 |
18648-18650 |
TO |
denotes |
to |
T24564 |
18651-18658 |
JJ |
denotes |
Western |
T24565 |
18659-18667 |
VBG |
denotes |
blotting |
T24566 |
18668-18672 |
IN |
denotes |
with |
T24567 |
18673-18682 |
JJ |
denotes |
anti-IκBα |
T24568 |
18683-18691 |
NN |
denotes |
antibody |
T24569 |
18691-18692 |
. |
denotes |
. |
T24570 |
18693-18697 |
NNS |
denotes |
Data |
T24571 |
18698-18701 |
VBP |
denotes |
are |
T24572 |
18702-18716 |
NN |
denotes |
representative |
T24573 |
18717-18719 |
IN |
denotes |
of |
T24574 |
18720-18725 |
CD |
denotes |
three |
T24575 |
18726-18737 |
JJ |
denotes |
independent |
T24576 |
18738-18749 |
NNS |
denotes |
experiments |
T24577 |
18749-18750 |
. |
denotes |
. |
T24578 |
18751-18752 |
-LRB- |
denotes |
( |
T24579 |
18752-18753 |
NNP |
denotes |
B |
T24580 |
18753-18754 |
-RRB- |
denotes |
) |
T24581 |
18755-18759 |
NNS |
denotes |
MDMs |
T24582 |
18760-18764 |
VBD |
denotes |
were |
T24583 |
18765-18775 |
VBN |
denotes |
pretreated |
T24584 |
18776-18780 |
IN |
denotes |
with |
T24585 |
18781-18787 |
DT |
denotes |
either |
T24586 |
18788-18795 |
NN |
denotes |
vehicle |
T24587 |
18796-18798 |
CC |
denotes |
or |
T24588 |
18799-18809 |
NN |
denotes |
Ro-31-8220 |
T24589 |
18810-18813 |
IN |
denotes |
for |
T24590 |
18814-18816 |
CD |
denotes |
30 |
T24591 |
18817-18824 |
NNS |
denotes |
minutes |
T24592 |
18825-18831 |
IN |
denotes |
before |
T24593 |
18832-18835 |
DT |
denotes |
the |
T24594 |
18836-18844 |
NN |
denotes |
addition |
T24595 |
18845-18847 |
IN |
denotes |
of |
T24596 |
18848-18853 |
NNP |
denotes |
M-CSF |
T24597 |
18854-18857 |
IN |
denotes |
for |
T24598 |
18858-18860 |
CD |
denotes |
10 |
T24599 |
18861-18868 |
NNS |
denotes |
minutes |
T24600 |
18868-18869 |
. |
denotes |
. |
T24601 |
18870-18875 |
JJ |
denotes |
Whole |
T24602 |
18876-18880 |
NN |
denotes |
cell |
T24603 |
18881-18888 |
NNS |
denotes |
lysates |
T24604 |
18889-18893 |
VBD |
denotes |
were |
T24605 |
18894-18902 |
VBN |
denotes |
resolved |
T24606 |
18903-18905 |
IN |
denotes |
by |
T24607 |
18906-18914 |
NNP |
denotes |
SDS-PAGE |
T24608 |
18915-18918 |
CC |
denotes |
and |
T24609 |
18919-18933 |
NNP |
denotes |
phospho-Ser276 |
T24610 |
18934-18936 |
CC |
denotes |
or |
T24611 |
18937-18951 |
NNP |
denotes |
phospho-Ser536 |
T24612 |
18952-18954 |
IN |
denotes |
of |
T24613 |
18955-18960 |
NNP |
denotes |
NF-κB |
T24614 |
18961-18964 |
CD |
denotes |
p65 |
T24615 |
18965-18968 |
VBD |
denotes |
was |
T24616 |
18969-18977 |
VBN |
denotes |
detected |
T24617 |
18978-18983 |
VBG |
denotes |
using |
T24618 |
18984-19000 |
JJ |
denotes |
phospho-specific |
T24619 |
19001-19011 |
NNS |
denotes |
antibodies |
T24620 |
19012-19014 |
TO |
denotes |
to |
T24621 |
19015-19021 |
DT |
denotes |
either |
T24622 |
19022-19029 |
NN |
denotes |
residue |
T24623 |
19030-19032 |
IN |
denotes |
of |
T24624 |
19033-19038 |
NNP |
denotes |
NF-κB |
T24625 |
19039-19042 |
NNS |
denotes |
p65 |
T24626 |
19042-19043 |
. |
denotes |
. |
T24627 |
19044-19045 |
-LRB- |
denotes |
( |
T24628 |
19045-19046 |
$ |
denotes |
C |
T24629 |
19046-19047 |
-RRB- |
denotes |
) |
T24630 |
19048-19053 |
JJ |
denotes |
Whole |
T24631 |
19054-19058 |
NN |
denotes |
cell |
T24632 |
19059-19066 |
NNS |
denotes |
lysates |
T24633 |
19067-19069 |
IN |
denotes |
of |
T24634 |
19070-19073 |
NNP |
denotes |
RAW |
T24635 |
19074-19079 |
CD |
denotes |
264.7 |
T24636 |
19080-19085 |
NNS |
denotes |
cells |
T24637 |
19086-19093 |
VBN |
denotes |
treated |
T24638 |
19094-19098 |
IN |
denotes |
with |
T24639 |
19099-19106 |
NN |
denotes |
vehicle |
T24640 |
19107-19114 |
NN |
denotes |
control |
T24641 |
19115-19117 |
CC |
denotes |
or |
T24642 |
19118-19128 |
NN |
denotes |
Ro-31-8220 |
T24643 |
19129-19131 |
IN |
denotes |
in |
T24644 |
19132-19135 |
DT |
denotes |
the |
T24645 |
19136-19143 |
NN |
denotes |
absence |
T24646 |
19144-19146 |
CC |
denotes |
or |
T24647 |
19147-19155 |
NN |
denotes |
presence |
T24648 |
19156-19158 |
IN |
denotes |
of |
T24649 |
19159-19164 |
NNP |
denotes |
M-CSF |
T24650 |
19165-19169 |
VBD |
denotes |
were |
T24651 |
19170-19179 |
VBN |
denotes |
subjected |
T24652 |
19180-19182 |
TO |
denotes |
to |
T24653 |
19183-19190 |
JJ |
denotes |
Western |
T24654 |
19191-19195 |
NN |
denotes |
blot |
T24655 |
19196-19204 |
NN |
denotes |
analysis |
T24656 |
19205-19209 |
IN |
denotes |
with |
T24657 |
19210-19224 |
NN |
denotes |
phospho-Ser276 |
T24658 |
19225-19227 |
CC |
denotes |
or |
T24659 |
19228-19242 |
NN |
denotes |
phospho-Ser536 |
T24660 |
19243-19248 |
NNP |
denotes |
NF-κB |
T24661 |
19249-19252 |
CD |
denotes |
p65 |
T24662 |
19253-19263 |
NNS |
denotes |
antibodies |
T24663 |
19263-19264 |
. |
denotes |
. |
T24664 |
19265-19266 |
-LRB- |
denotes |
( |
T24665 |
19266-19267 |
NNP |
denotes |
D |
T24666 |
19267-19268 |
-RRB- |
denotes |
) |
T24667 |
19269-19278 |
NNP |
denotes |
Cytosolic |
T24668 |
19279-19282 |
CC |
denotes |
and |
T24669 |
19283-19290 |
JJ |
denotes |
nuclear |
T24670 |
19291-19300 |
NNS |
denotes |
fractions |
T24671 |
19301-19303 |
IN |
denotes |
of |
T24672 |
19304-19307 |
NNP |
denotes |
RAW |
T24673 |
19308-19313 |
CD |
denotes |
264.7 |
T24674 |
19314-19318 |
VBD |
denotes |
were |
T24675 |
19319-19327 |
VBN |
denotes |
obtained |
T24676 |
19328-19332 |
IN |
denotes |
from |
T24677 |
19333-19336 |
DT |
denotes |
the |
T24678 |
19337-19344 |
VBN |
denotes |
treated |
T24679 |
19345-19350 |
NNS |
denotes |
cells |
T24680 |
19351-19354 |
CC |
denotes |
and |
T24681 |
19355-19368 |
VBN |
denotes |
immunoblotted |
T24682 |
19369-19372 |
IN |
denotes |
for |
T24683 |
19373-19386 |
NN |
denotes |
phospho-NF-κB |
T24684 |
19386-19387 |
. |
denotes |
. |
T24685 |
19388-19391 |
DT |
denotes |
The |
T24686 |
19392-19398 |
NN |
denotes |
purity |
T24687 |
19399-19401 |
IN |
denotes |
of |
T24688 |
19402-19405 |
DT |
denotes |
the |
T24689 |
19406-19415 |
JJ |
denotes |
cytosolic |
T24690 |
19416-19419 |
CC |
denotes |
and |
T24691 |
19420-19427 |
JJ |
denotes |
nuclear |
T24692 |
19428-19437 |
NNS |
denotes |
fractions |
T24693 |
19438-19441 |
VBD |
denotes |
was |
T24694 |
19442-19451 |
VBN |
denotes |
confirmed |
T24695 |
19452-19454 |
IN |
denotes |
by |
T24696 |
19455-19469 |
VBG |
denotes |
immunoblotting |
T24697 |
19470-19474 |
IN |
denotes |
with |
T24698 |
19475-19480 |
NNP |
denotes |
GAPDH |
T24699 |
19481-19484 |
CC |
denotes |
and |
T24700 |
19485-19490 |
NNP |
denotes |
Lamin |
T24701 |
19491-19492 |
NNP |
denotes |
B |
T24702 |
19492-19493 |
, |
denotes |
, |
T24703 |
19494-19506 |
RB |
denotes |
respectively |
T24704 |
19506-19507 |
. |
denotes |
. |
T24705 |
19508-19513 |
VBN |
denotes |
Shown |
T24706 |
19514-19517 |
VBP |
denotes |
are |
T24707 |
19518-19532 |
JJ |
denotes |
representative |
T24708 |
19533-19538 |
NNS |
denotes |
blots |
T24709 |
19539-19543 |
IN |
denotes |
from |
T24710 |
19544-19549 |
CD |
denotes |
three |
T24711 |
19550-19561 |
JJ |
denotes |
independent |
T24712 |
19562-19573 |
NNS |
denotes |
experiments |
T24713 |
19573-19574 |
. |
denotes |
. |
T8089 |
19576-19581 |
NNP |
denotes |
M-CSF |
T8090 |
19582-19589 |
NNP |
denotes |
Induces |
T8091 |
19590-19605 |
NNP |
denotes |
Phosphorylation |
T8092 |
19606-19608 |
IN |
denotes |
of |
T8093 |
19609-19614 |
NNP |
denotes |
NF-κB |
T8094 |
19615-19621 |
NNP |
denotes |
Ser276 |
T8095 |
19622-19624 |
IN |
denotes |
in |
T8096 |
19625-19626 |
DT |
denotes |
a |
T8097 |
19627-19640 |
JJ |
denotes |
PKC-dependent |
T8098 |
19641-19648 |
NN |
denotes |
Fashion |
T8099 |
19649-19654 |
IN |
denotes |
Since |
T8100 |
19655-19660 |
NNP |
denotes |
M-CSF |
T8101 |
19661-19664 |
VBD |
denotes |
did |
T8102 |
19665-19668 |
RB |
denotes |
not |
T8103 |
19669-19677 |
VB |
denotes |
regulate |
T8104 |
19678-19683 |
JJ |
denotes |
NF-κB |
T8105 |
19684-19694 |
NN |
denotes |
activation |
T8106 |
19695-19697 |
IN |
denotes |
by |
T8107 |
19698-19709 |
VBG |
denotes |
influencing |
T8108 |
19710-19714 |
NNP |
denotes |
IκBα |
T8109 |
19714-19715 |
, |
denotes |
, |
T8110 |
19716-19718 |
PRP |
denotes |
we |
T8111 |
19719-19723 |
JJ |
denotes |
next |
T8112 |
19724-19730 |
VBN |
denotes |
sought |
T8113 |
19731-19733 |
TO |
denotes |
to |
T8114 |
19734-19743 |
VB |
denotes |
determine |
T8115 |
19744-19746 |
IN |
denotes |
if |
T8116 |
19747-19752 |
NNP |
denotes |
M-CSF |
T8117 |
19753-19761 |
VBD |
denotes |
affected |
T8118 |
19762-19767 |
NNP |
denotes |
NF-κB |
T8119 |
19768-19771 |
CD |
denotes |
p65 |
T8120 |
19772-19774 |
IN |
denotes |
by |
T8121 |
19775-19793 |
JJ |
denotes |
post-translational |
T8122 |
19794-19804 |
NNS |
denotes |
mechanisms |
T8123 |
19804-19805 |
. |
denotes |
. |
T8124 |
19806-19810 |
RB |
denotes |
Thus |
T8125 |
19810-19811 |
, |
denotes |
, |
T8126 |
19812-19814 |
PRP |
denotes |
we |
T8127 |
19815-19823 |
VBD |
denotes |
examined |
T8128 |
19824-19827 |
DT |
denotes |
the |
T8129 |
19828-19843 |
NN |
denotes |
phosphorylation |
T8130 |
19844-19846 |
IN |
denotes |
of |
T8131 |
19847-19852 |
NNP |
denotes |
NF-κB |
T8132 |
19853-19856 |
CD |
denotes |
p65 |
T8133 |
19857-19861 |
IN |
denotes |
with |
T8134 |
19862-19870 |
JJ |
denotes |
specific |
T8135 |
19871-19883 |
NN |
denotes |
phospho-NFκB |
T8136 |
19884-19887 |
NNS |
denotes |
p65 |
T8137 |
19888-19889 |
-LRB- |
denotes |
( |
T8138 |
19889-19895 |
CD |
denotes |
Ser276 |
T8139 |
19896-19899 |
CC |
denotes |
and |
T8140 |
19900-19906 |
NNP |
denotes |
Ser536 |
T8141 |
19906-19907 |
-RRB- |
denotes |
) |
T8142 |
19908-19918 |
NNS |
denotes |
antibodies |
T8143 |
19918-19919 |
. |
denotes |
. |
T8144 |
19920-19925 |
NNP |
denotes |
M-CSF |
T8145 |
19926-19933 |
VBD |
denotes |
induced |
T8146 |
19934-19937 |
DT |
denotes |
the |
T8147 |
19938-19953 |
NN |
denotes |
phosphorylation |
T8148 |
19954-19956 |
IN |
denotes |
of |
T8149 |
19957-19963 |
NNP |
denotes |
Ser276 |
T8150 |
19964-19967 |
CC |
denotes |
but |
T8151 |
19968-19971 |
RB |
denotes |
not |
T8152 |
19972-19978 |
NNP |
denotes |
Ser536 |
T8153 |
19979-19981 |
IN |
denotes |
of |
T8154 |
19982-19987 |
NNP |
denotes |
NF-κB |
T8155 |
19988-19991 |
CD |
denotes |
p65 |
T8156 |
19992-19994 |
IN |
denotes |
in |
T8157 |
19995-19999 |
NNS |
denotes |
MDMs |
T8158 |
19999-20000 |
. |
denotes |
. |
T8159 |
20001-20009 |
VBN |
denotes |
Compared |
T8160 |
20010-20012 |
TO |
denotes |
to |
T8161 |
20013-20020 |
NN |
denotes |
vehicle |
T8162 |
20020-20021 |
, |
denotes |
, |
T8163 |
20022-20025 |
DT |
denotes |
the |
T8164 |
20026-20033 |
JJ |
denotes |
general |
T8165 |
20034-20037 |
NNP |
denotes |
PKC |
T8166 |
20038-20047 |
NN |
denotes |
inhibitor |
T8167 |
20048-20058 |
NN |
denotes |
Ro-31-8220 |
T8168 |
20059-20066 |
VBN |
denotes |
reduced |
T8169 |
20067-20073 |
NNP |
denotes |
Ser276 |
T8170 |
20074-20089 |
NN |
denotes |
phosphorylation |
T8171 |
20089-20090 |
, |
denotes |
, |
T8172 |
20091-20094 |
CC |
denotes |
but |
T8173 |
20095-20098 |
RB |
denotes |
not |
T8174 |
20099-20105 |
NNP |
denotes |
Ser536 |
T8175 |
20105-20106 |
, |
denotes |
, |
T8176 |
20107-20122 |
NN |
denotes |
phosphorylation |
T8177 |
20123-20125 |
IN |
denotes |
in |
T8178 |
20126-20142 |
JJ |
denotes |
M-CSF-stimulated |
T8179 |
20143-20148 |
NNS |
denotes |
cells |
T8180 |
20149-20150 |
-LRB- |
denotes |
( |
T8181 |
20150-20156 |
NN |
denotes |
Figure |
T8182 |
20157-20159 |
NN |
denotes |
5B |
T8183 |
20159-20160 |
-RRB- |
denotes |
) |
T8184 |
20160-20161 |
. |
denotes |
. |
T8185 |
20162-20173 |
RB |
denotes |
Furthermore |
T8186 |
20173-20174 |
, |
denotes |
, |
T8187 |
20175-20191 |
JJ |
denotes |
M-CSF-stimulated |
T8188 |
20192-20197 |
NNP |
denotes |
NF-κB |
T8189 |
20198-20201 |
CD |
denotes |
p65 |
T8190 |
20202-20217 |
NN |
denotes |
phosphorylation |
T8191 |
20218-20220 |
IN |
denotes |
at |
T8192 |
20221-20228 |
NN |
denotes |
residue |
T8193 |
20229-20235 |
NNP |
denotes |
Ser276 |
T8194 |
20236-20238 |
IN |
denotes |
in |
T8195 |
20239-20242 |
NNP |
denotes |
RAW |
T8196 |
20243-20248 |
CD |
denotes |
264.7 |
T8197 |
20249-20254 |
NNS |
denotes |
cells |
T8198 |
20255-20258 |
VBD |
denotes |
was |
T8199 |
20259-20263 |
RB |
denotes |
also |
T8200 |
20264-20267 |
NNP |
denotes |
PKC |
T8201 |
20268-20277 |
JJ |
denotes |
dependent |
T8202 |
20278-20279 |
-LRB- |
denotes |
( |
T8203 |
20279-20285 |
NN |
denotes |
Figure |
T8204 |
20286-20288 |
NN |
denotes |
5C |
T8205 |
20288-20289 |
-RRB- |
denotes |
) |
T8206 |
20289-20290 |
. |
denotes |
. |
T8207 |
20291-20296 |
DT |
denotes |
These |
T8208 |
20297-20304 |
NNS |
denotes |
studies |
T8209 |
20305-20314 |
VBD |
denotes |
suggested |
T8210 |
20315-20319 |
IN |
denotes |
that |
T8211 |
20320-20323 |
NNP |
denotes |
PKC |
T8212 |
20323-20324 |
-LRB- |
denotes |
( |
T8213 |
20324-20325 |
PRP |
denotes |
s |
T8214 |
20325-20326 |
-RRB- |
denotes |
) |
T8215 |
20327-20336 |
VBN |
denotes |
regulated |
T8216 |
20337-20343 |
NNP |
denotes |
Ser276 |
T8217 |
20344-20359 |
NN |
denotes |
phosphorylation |
T8218 |
20360-20363 |
CC |
denotes |
but |
T8219 |
20364-20367 |
RB |
denotes |
not |
T8220 |
20368-20374 |
NNP |
denotes |
Ser536 |
T8221 |
20375-20377 |
IN |
denotes |
in |
T8222 |
20378-20382 |
DT |
denotes |
both |
T8223 |
20383-20388 |
JJ |
denotes |
human |
T8224 |
20389-20393 |
NNS |
denotes |
MDMs |
T8225 |
20394-20397 |
CC |
denotes |
and |
T8226 |
20398-20403 |
NN |
denotes |
mouse |
T8227 |
20404-20415 |
NNS |
denotes |
macrophages |
T8228 |
20416-20421 |
IN |
denotes |
after |
T8229 |
20422-20427 |
NNP |
denotes |
M-CSF |
T8230 |
20428-20439 |
NN |
denotes |
stimulation |
T8231 |
20439-20440 |
. |
denotes |
. |
T8232 |
20441-20443 |
PRP |
denotes |
We |
T8233 |
20444-20448 |
JJ |
denotes |
next |
T8234 |
20449-20458 |
VBN |
denotes |
performed |
T8235 |
20459-20467 |
JJ |
denotes |
cellular |
T8236 |
20468-20481 |
NN |
denotes |
fractionation |
T8237 |
20482-20484 |
TO |
denotes |
to |
T8238 |
20485-20493 |
VB |
denotes |
identify |
T8239 |
20494-20497 |
DT |
denotes |
the |
T8240 |
20498-20506 |
JJ |
denotes |
cellular |
T8241 |
20507-20515 |
NN |
denotes |
location |
T8242 |
20516-20518 |
IN |
denotes |
of |
T8243 |
20519-20533 |
VBN |
denotes |
phosphorylated |
T8244 |
20534-20539 |
NNP |
denotes |
NF-κB |
T8245 |
20540-20543 |
NNS |
denotes |
p65 |
T8246 |
20544-20546 |
IN |
denotes |
in |
T8247 |
20547-20550 |
NNP |
denotes |
Raw |
T8248 |
20551-20556 |
CD |
denotes |
264.7 |
T8249 |
20557-20562 |
NNS |
denotes |
cells |
T8250 |
20562-20563 |
. |
denotes |
. |
T8251 |
20564-20582 |
JJ |
denotes |
Non-phosphorylated |
T8252 |
20583-20588 |
NNP |
denotes |
NF-κB |
T8253 |
20589-20592 |
NNS |
denotes |
p65 |
T8254 |
20593-20596 |
VBD |
denotes |
was |
T8255 |
20597-20604 |
VBN |
denotes |
located |
T8256 |
20605-20607 |
IN |
denotes |
in |
T8257 |
20608-20612 |
DT |
denotes |
both |
T8258 |
20613-20622 |
JJ |
denotes |
cytosolic |
T8259 |
20623-20626 |
CC |
denotes |
and |
T8260 |
20627-20634 |
JJ |
denotes |
nuclear |
T8261 |
20635-20644 |
NNS |
denotes |
fractions |
T8262 |
20644-20645 |
, |
denotes |
, |
T8263 |
20646-20649 |
CC |
denotes |
but |
T8264 |
20650-20664 |
VBD |
denotes |
phosphorylated |
T8265 |
20665-20671 |
NNP |
denotes |
Ser276 |
T8266 |
20672-20675 |
CC |
denotes |
and |
T8267 |
20676-20682 |
NNP |
denotes |
Ser536 |
T8268 |
20683-20688 |
NNP |
denotes |
NF-κB |
T8269 |
20689-20692 |
CD |
denotes |
p65 |
T8270 |
20693-20696 |
VBD |
denotes |
was |
T8271 |
20697-20706 |
RB |
denotes |
primarily |
T8272 |
20707-20714 |
VBN |
denotes |
located |
T8273 |
20715-20717 |
IN |
denotes |
in |
T8274 |
20718-20725 |
JJ |
denotes |
nuclear |
T8275 |
20726-20734 |
NN |
denotes |
fraction |
T8276 |
20735-20740 |
IN |
denotes |
after |
T8277 |
20741-20746 |
NNP |
denotes |
M-CSF |
T8278 |
20747-20758 |
NN |
denotes |
stimulation |
T8279 |
20759-20760 |
-LRB- |
denotes |
( |
T8280 |
20760-20766 |
NN |
denotes |
Figure |
T8281 |
20767-20769 |
CD |
denotes |
5D |
T8282 |
20769-20770 |
-RRB- |
denotes |
) |
T8283 |
20770-20771 |
. |
denotes |
. |
T8284 |
20772-20779 |
RB |
denotes |
Notably |
T8285 |
20779-20780 |
, |
denotes |
, |
T8286 |
20781-20793 |
JJ |
denotes |
constitutive |
T8287 |
20794-20809 |
NN |
denotes |
phosphorylation |
T8288 |
20810-20812 |
IN |
denotes |
of |
T8289 |
20813-20819 |
NNP |
denotes |
Ser536 |
T8290 |
20820-20825 |
NNP |
denotes |
NF-κB |
T8291 |
20826-20829 |
CD |
denotes |
p65 |
T8292 |
20830-20833 |
VBD |
denotes |
was |
T8293 |
20834-20839 |
VBN |
denotes |
found |
T8294 |
20840-20842 |
IN |
denotes |
in |
T8295 |
20843-20848 |
DT |
denotes |
these |
T8296 |
20849-20854 |
NNS |
denotes |
cells |
T8297 |
20854-20855 |
. |
denotes |
. |
T8298 |
20856-20867 |
RB |
denotes |
Importantly |
T8299 |
20867-20868 |
, |
denotes |
, |
T8300 |
20869-20879 |
JJ |
denotes |
Ro-31-8220 |
T8301 |
20880-20887 |
JJ |
denotes |
reduced |
T8302 |
20888-20901 |
JJ |
denotes |
M-CSF-induced |
T8303 |
20902-20908 |
NNP |
denotes |
Ser276 |
T8304 |
20909-20924 |
NN |
denotes |
phosphorylation |
T8305 |
20925-20927 |
IN |
denotes |
of |
T8306 |
20928-20933 |
NNP |
denotes |
NF-κB |
T8307 |
20934-20937 |
CD |
denotes |
p65 |
T8308 |
20938-20940 |
IN |
denotes |
in |
T8309 |
20941-20945 |
CC |
denotes |
both |
T8310 |
20946-20949 |
DT |
denotes |
the |
T8311 |
20950-20959 |
JJ |
denotes |
cytosolic |
T8312 |
20960-20963 |
CC |
denotes |
and |
T8313 |
20964-20971 |
JJ |
denotes |
nuclear |
T8314 |
20972-20981 |
NNS |
denotes |
fractions |
T8315 |
20981-20982 |
, |
denotes |
, |
T8316 |
20983-20988 |
IN |
denotes |
while |
T8317 |
20989-21002 |
NNP |
denotes |
M-CSF-induced |
T8318 |
21003-21008 |
NNP |
denotes |
NF-κB |
T8319 |
21009-21012 |
CD |
denotes |
p65 |
T8320 |
21013-21019 |
NNP |
denotes |
Ser536 |
T8321 |
21020-21035 |
NN |
denotes |
phosphorylation |
T8322 |
21036-21039 |
VBD |
denotes |
was |
T8323 |
21040-21047 |
JJ |
denotes |
present |
T8324 |
21048-21050 |
IN |
denotes |
in |
T8325 |
21051-21054 |
DT |
denotes |
the |
T8326 |
21055-21062 |
NN |
denotes |
nucleus |
T8327 |
21063-21073 |
RB |
denotes |
regardless |
T8328 |
21074-21076 |
IN |
denotes |
of |
T8329 |
21077-21080 |
NNP |
denotes |
PKC |
T8330 |
21081-21091 |
NN |
denotes |
inhibition |
T8331 |
21091-21092 |
. |
denotes |
. |
T8332 |
21093-21098 |
DT |
denotes |
These |
T8333 |
21099-21111 |
NNS |
denotes |
observations |
T8334 |
21112-21120 |
VBP |
denotes |
indicate |
T8335 |
21121-21125 |
IN |
denotes |
that |
T8336 |
21126-21139 |
JJ |
denotes |
M-CSF-induced |
T8337 |
21140-21146 |
NNP |
denotes |
Ser276 |
T8338 |
21147-21150 |
CC |
denotes |
and |
T8339 |
21151-21157 |
NNP |
denotes |
Ser536 |
T8340 |
21158-21161 |
VBP |
denotes |
are |
T8341 |
21162-21171 |
VBN |
denotes |
regulated |
T8342 |
21172-21183 |
RB |
denotes |
differently |
T8343 |
21184-21186 |
IN |
denotes |
by |
T8344 |
21187-21199 |
JJ |
denotes |
conventional |
T8345 |
21200-21203 |
NNP |
denotes |
PKC |
T8346 |
21204-21214 |
NN |
denotes |
activation |
T8347 |
21215-21217 |
IN |
denotes |
in |
T8348 |
21218-21229 |
NN |
denotes |
mononuclear |
T8349 |
21230-21240 |
NNS |
denotes |
phagocytes |
T8350 |
21240-21241 |
. |
denotes |
. |
T8351 |
21242-21245 |
DT |
denotes |
The |
T8352 |
21246-21252 |
NN |
denotes |
purity |
T8353 |
21253-21255 |
IN |
denotes |
of |
T8354 |
21256-21259 |
DT |
denotes |
the |
T8355 |
21260-21267 |
NN |
denotes |
cytosol |
T8356 |
21268-21271 |
CC |
denotes |
and |
T8357 |
21272-21279 |
JJ |
denotes |
nuclear |
T8358 |
21280-21284 |
NN |
denotes |
cell |
T8359 |
21285-21294 |
NNS |
denotes |
fractions |
T8360 |
21295-21298 |
VBD |
denotes |
was |
T8361 |
21299-21308 |
VBN |
denotes |
confirmed |
T8362 |
21309-21311 |
IN |
denotes |
by |
T8363 |
21312-21326 |
VBG |
denotes |
immunoblotting |
T8364 |
21327-21331 |
IN |
denotes |
with |
T8365 |
21332-21337 |
NNP |
denotes |
GAPDH |
T8366 |
21338-21341 |
CC |
denotes |
and |
T8367 |
21342-21347 |
NNP |
denotes |
Lamin |
T8368 |
21348-21349 |
NNP |
denotes |
B |
T8369 |
21349-21350 |
, |
denotes |
, |
T8370 |
21351-21363 |
RB |
denotes |
respectively |
T8371 |
21364-21365 |
-LRB- |
denotes |
( |
T8372 |
21365-21371 |
NN |
denotes |
Figure |
T8373 |
21372-21374 |
CD |
denotes |
5D |
T8374 |
21374-21375 |
-RRB- |
denotes |
) |
T8375 |
21375-21376 |
. |
denotes |
. |
T9427 |
21378-21393 |
JJ |
denotes |
M-CSF-dependent |
T9428 |
21394-21397 |
NNP |
denotes |
PKC |
T9429 |
21398-21407 |
VBZ |
denotes |
Regulates |
T9430 |
21408-21422 |
JJ |
denotes |
NF-κB-targeted |
T9431 |
21423-21428 |
NNS |
denotes |
Genes |
T9432 |
21429-21434 |
JJ |
denotes |
NF-κB |
T9433 |
21435-21442 |
VBZ |
denotes |
induces |
T9434 |
21443-21444 |
DT |
denotes |
a |
T9435 |
21445-21451 |
NN |
denotes |
number |
T9436 |
21452-21454 |
IN |
denotes |
of |
T9437 |
21455-21465 |
JJ |
denotes |
downstream |
T9438 |
21466-21471 |
NNS |
denotes |
genes |
T9439 |
21471-21472 |
, |
denotes |
, |
T9440 |
21473-21482 |
VBG |
denotes |
including |
T9441 |
21483-21486 |
DT |
denotes |
the |
T9442 |
21487-21490 |
NNP |
denotes |
IκB |
T9443 |
21491-21497 |
NN |
denotes |
family |
T9444 |
21497-21498 |
. |
denotes |
. |
T9445 |
21499-21504 |
IN |
denotes |
Among |
T9446 |
21505-21508 |
DT |
denotes |
the |
T9447 |
21509-21512 |
NNP |
denotes |
IκB |
T9448 |
21513-21522 |
NNS |
denotes |
molecules |
T9449 |
21522-21523 |
, |
denotes |
, |
T9450 |
21524-21528 |
NNP |
denotes |
IκBα |
T9451 |
21529-21531 |
VBZ |
denotes |
is |
T9452 |
21532-21538 |
RB |
denotes |
highly |
T9453 |
21539-21546 |
VBN |
denotes |
induced |
T9454 |
21547-21549 |
IN |
denotes |
by |
T9455 |
21550-21555 |
JJ |
denotes |
NF-κB |
T9456 |
21556-21566 |
NN |
denotes |
activation |
T9457 |
21567-21568 |
NNP |
denotes |
[ |
T9458 |
21568-21570 |
CD |
denotes |
40 |
T9459 |
21570-21571 |
NNP |
denotes |
] |
T9460 |
21571-21572 |
. |
denotes |
. |
T9461 |
21573-21579 |
VBG |
denotes |
Having |
T9462 |
21580-21585 |
VBN |
denotes |
shown |
T9463 |
21586-21590 |
IN |
denotes |
that |
T9464 |
21591-21594 |
NNP |
denotes |
PKC |
T9465 |
21595-21604 |
VBD |
denotes |
regulated |
T9466 |
21605-21610 |
JJ |
denotes |
NF-κB |
T9467 |
21611-21619 |
NN |
denotes |
activity |
T9468 |
21620-21622 |
IN |
denotes |
in |
T9469 |
21623-21639 |
JJ |
denotes |
M-CSF-stimulated |
T9470 |
21640-21644 |
NNS |
denotes |
MDMs |
T9471 |
21644-21645 |
, |
denotes |
, |
T9472 |
21646-21648 |
PRP |
denotes |
we |
T9473 |
21649-21653 |
JJ |
denotes |
next |
T9474 |
21654-21664 |
VBN |
denotes |
determined |
T9475 |
21665-21672 |
IN |
denotes |
whether |
T9476 |
21673-21683 |
NN |
denotes |
inhibition |
T9477 |
21684-21686 |
IN |
denotes |
of |
T9478 |
21687-21690 |
NNP |
denotes |
PKC |
T9479 |
21691-21699 |
NN |
denotes |
activity |
T9480 |
21700-21709 |
VBD |
denotes |
decreased |
T9481 |
21710-21720 |
NN |
denotes |
expression |
T9482 |
21721-21723 |
IN |
denotes |
of |
T9483 |
21724-21739 |
JJ |
denotes |
NF-κB-regulated |
T9484 |
21740-21745 |
NNS |
denotes |
genes |
T9485 |
21745-21746 |
. |
denotes |
. |
T9486 |
21747-21749 |
PRP |
denotes |
We |
T9487 |
21750-21757 |
VBD |
denotes |
treated |
T9488 |
21758-21762 |
DT |
denotes |
both |
T9489 |
21763-21767 |
NNS |
denotes |
MDMs |
T9490 |
21768-21771 |
CC |
denotes |
and |
T9491 |
21772-21775 |
NNP |
denotes |
RAW |
T9492 |
21776-21781 |
CD |
denotes |
264.7 |
T9493 |
21782-21787 |
NNS |
denotes |
cells |
T9494 |
21788-21792 |
IN |
denotes |
with |
T9495 |
21793-21796 |
DT |
denotes |
the |
T9496 |
21797-21800 |
NNP |
denotes |
PKC |
T9497 |
21801-21810 |
NN |
denotes |
inhibitor |
T9498 |
21811-21821 |
NN |
denotes |
Ro-31-8220 |
T9499 |
21822-21825 |
IN |
denotes |
for |
T9500 |
21826-21828 |
CD |
denotes |
30 |
T9501 |
21829-21836 |
NNS |
denotes |
minutes |
T9502 |
21837-21840 |
CC |
denotes |
and |
T9503 |
21841-21845 |
RB |
denotes |
then |
T9504 |
21846-21856 |
VBN |
denotes |
stimulated |
T9505 |
21857-21861 |
IN |
denotes |
with |
T9506 |
21862-21867 |
NNP |
denotes |
M-CSF |
T9507 |
21867-21868 |
. |
denotes |
. |
T9508 |
21869-21873 |
NNP |
denotes |
IκBα |
T9509 |
21874-21878 |
NN |
denotes |
gene |
T9510 |
21879-21882 |
VBD |
denotes |
was |
T9511 |
21883-21891 |
VBN |
denotes |
measured |
T9512 |
21892-21894 |
IN |
denotes |
by |
T9513 |
21895-21902 |
NNP |
denotes |
qRT-PCR |
T9514 |
21902-21903 |
. |
denotes |
. |
T9515 |
21904-21906 |
IN |
denotes |
As |
T9516 |
21907-21912 |
VBN |
denotes |
shown |
T9517 |
21913-21915 |
IN |
denotes |
in |
T9518 |
21916-21923 |
NNS |
denotes |
Figures |
T9519 |
21924-21926 |
NNP |
denotes |
6A |
T9520 |
21927-21930 |
CC |
denotes |
and |
T9521 |
21931-21933 |
NNP |
denotes |
6B |
T9522 |
21933-21934 |
, |
denotes |
, |
T9523 |
21935-21940 |
NNP |
denotes |
M-CSF |
T9524 |
21941-21949 |
VBD |
denotes |
enhanced |
T9525 |
21950-21954 |
NNP |
denotes |
IκBα |
T9526 |
21955-21959 |
NN |
denotes |
gene |
T9527 |
21960-21970 |
NN |
denotes |
expression |
T9528 |
21971-21974 |
CC |
denotes |
and |
T9529 |
21975-21978 |
NNP |
denotes |
PKC |
T9530 |
21979-21989 |
NN |
denotes |
inhibition |
T9531 |
21990-21992 |
IN |
denotes |
by |
T9532 |
21993-22003 |
JJ |
denotes |
Ro-31-8220 |
T9533 |
22004-22013 |
VBN |
denotes |
decreased |
T9534 |
22014-22018 |
NNP |
denotes |
IκBα |
T9535 |
22019-22023 |
NN |
denotes |
gene |
T9536 |
22024-22034 |
NN |
denotes |
expression |
T9537 |
22035-22037 |
IN |
denotes |
in |
T9538 |
22038-22042 |
DT |
denotes |
both |
T9539 |
22043-22047 |
NNS |
denotes |
MDMs |
T9540 |
22048-22051 |
CC |
denotes |
and |
T9541 |
22052-22055 |
NNP |
denotes |
RAW |
T9542 |
22056-22061 |
CD |
denotes |
264.7 |
T9543 |
22062-22067 |
NNS |
denotes |
cells |
T9544 |
22068-22069 |
-LRB- |
denotes |
( |
T9545 |
22069-22070 |
FW |
denotes |
p |
T9546 |
22070-22071 |
FW |
denotes |
< |
T9547 |
22071-22075 |
CD |
denotes |
0.01 |
T9548 |
22075-22076 |
-RRB- |
denotes |
) |
T9549 |
22076-22077 |
, |
denotes |
, |
T9550 |
22078-22091 |
VBG |
denotes |
demonstrating |
T9551 |
22092-22096 |
IN |
denotes |
that |
T9552 |
22097-22100 |
NNP |
denotes |
PKC |
T9553 |
22101-22109 |
VBD |
denotes |
affected |
T9554 |
22110-22125 |
JJ |
denotes |
NF-κB-regulated |
T9555 |
22126-22130 |
NN |
denotes |
gene |
T9556 |
22131-22141 |
NN |
denotes |
expression |
T9557 |
22142-22144 |
IN |
denotes |
in |
T9558 |
22145-22156 |
NNS |
denotes |
macrophages |
T9559 |
22156-22157 |
. |
denotes |
. |
T25121 |
22202-22212 |
NNP |
denotes |
Inhibition |
T25122 |
22213-22215 |
IN |
denotes |
of |
T25123 |
22216-22229 |
NNP |
denotes |
M-CSF-induced |
T25124 |
22230-22233 |
NNP |
denotes |
PKC |
T25125 |
22234-22241 |
VBZ |
denotes |
reduces |
T25126 |
22242-22257 |
JJ |
denotes |
NF-κB-regulated |
T25127 |
22258-22263 |
NNS |
denotes |
genes |
T25128 |
22264-22266 |
IN |
denotes |
in |
T25129 |
22267-22271 |
DT |
denotes |
both |
T25130 |
22272-22276 |
NNS |
denotes |
MDMs |
T25131 |
22277-22280 |
CC |
denotes |
and |
T25132 |
22281-22284 |
NNP |
denotes |
RAW |
T25133 |
22285-22290 |
CD |
denotes |
264.7 |
T25134 |
22291-22296 |
NNS |
denotes |
cells |
T25135 |
22296-22297 |
. |
denotes |
. |
T25136 |
22298-22302 |
NNS |
denotes |
MDMs |
T25137 |
22303-22304 |
-LRB- |
denotes |
( |
T25138 |
22304-22305 |
DT |
denotes |
A |
T25139 |
22306-22309 |
CC |
denotes |
and |
T25140 |
22310-22311 |
NNP |
denotes |
C |
T25141 |
22311-22312 |
-RRB- |
denotes |
) |
T25142 |
22313-22316 |
CC |
denotes |
and |
T25143 |
22317-22320 |
NNP |
denotes |
RAW |
T25144 |
22321-22326 |
CD |
denotes |
264.7 |
T25145 |
22327-22328 |
-LRB- |
denotes |
( |
T25146 |
22328-22329 |
NN |
denotes |
B |
T25147 |
22329-22330 |
-RRB- |
denotes |
) |
T25148 |
22331-22336 |
NNS |
denotes |
cells |
T25149 |
22337-22341 |
VBD |
denotes |
were |
T25150 |
22342-22352 |
VBN |
denotes |
pretreated |
T25151 |
22353-22357 |
IN |
denotes |
with |
T25152 |
22358-22368 |
NN |
denotes |
Ro-31-8220 |
T25153 |
22369-22371 |
CC |
denotes |
or |
T25154 |
22372-22379 |
JJ |
denotes |
solvent |
T25155 |
22380-22387 |
NN |
denotes |
control |
T25156 |
22388-22392 |
NNP |
denotes |
DMSO |
T25157 |
22393-22396 |
IN |
denotes |
for |
T25158 |
22397-22399 |
CD |
denotes |
30 |
T25159 |
22400-22407 |
NNS |
denotes |
minutes |
T25160 |
22408-22413 |
RB |
denotes |
prior |
T25161 |
22414-22416 |
TO |
denotes |
to |
T25162 |
22417-22422 |
NNP |
denotes |
M-CSF |
T25163 |
22423-22434 |
NN |
denotes |
stimulation |
T25164 |
22435-22438 |
IN |
denotes |
for |
T25165 |
22439-22442 |
DT |
denotes |
the |
T25166 |
22443-22452 |
JJ |
denotes |
indicated |
T25167 |
22453-22458 |
NNS |
denotes |
times |
T25168 |
22458-22459 |
. |
denotes |
. |
T25169 |
22460-22465 |
JJ |
denotes |
Total |
T25170 |
22466-22469 |
NNP |
denotes |
RNA |
T25171 |
22470-22473 |
VBD |
denotes |
was |
T25172 |
22474-22482 |
VBN |
denotes |
isolated |
T25173 |
22483-22486 |
CC |
denotes |
and |
T25174 |
22487-22496 |
VBN |
denotes |
converted |
T25175 |
22497-22499 |
TO |
denotes |
to |
T25176 |
22500-22504 |
NNP |
denotes |
cDNA |
T25177 |
22504-22505 |
. |
denotes |
. |
T25178 |
22506-22515 |
JJ |
denotes |
Real-time |
T25179 |
22516-22518 |
NNP |
denotes |
RT |
T25180 |
22519-22522 |
NNP |
denotes |
PCR |
T25181 |
22523-22526 |
VBD |
denotes |
was |
T25182 |
22527-22536 |
VBN |
denotes |
performed |
T25183 |
22537-22542 |
VBG |
denotes |
using |
T25184 |
22543-22550 |
NNS |
denotes |
primers |
T25185 |
22551-22554 |
IN |
denotes |
for |
T25186 |
22555-22559 |
NNP |
denotes |
IκBα |
T25187 |
22559-22560 |
, |
denotes |
, |
T25188 |
22561-22567 |
NNP |
denotes |
BCL-xl |
T25189 |
22568-22570 |
CC |
denotes |
or |
T25190 |
22571-22576 |
NNP |
denotes |
GAPDH |
T25191 |
22576-22577 |
. |
denotes |
. |
T25192 |
22578-22582 |
NNS |
denotes |
Data |
T25193 |
22583-22586 |
VBP |
denotes |
are |
T25194 |
22587-22596 |
VBN |
denotes |
expressed |
T25195 |
22597-22599 |
IN |
denotes |
as |
T25196 |
22600-22608 |
JJ |
denotes |
relative |
T25197 |
22609-22613 |
VBP |
denotes |
fold |
T25198 |
22614-22622 |
NN |
denotes |
increase |
T25199 |
22623-22625 |
IN |
denotes |
of |
T25200 |
22626-22630 |
NNP |
denotes |
IκBα |
T25201 |
22631-22633 |
CC |
denotes |
or |
T25202 |
22634-22640 |
NNP |
denotes |
BCL-xl |
T25203 |
22641-22645 |
NN |
denotes |
gene |
T25204 |
22646-22656 |
NN |
denotes |
expression |
T25205 |
22657-22661 |
IN |
denotes |
upon |
T25206 |
22662-22671 |
NN |
denotes |
treatment |
T25207 |
22672-22676 |
IN |
denotes |
over |
T25208 |
22677-22691 |
JJ |
denotes |
non-stimulated |
T25209 |
22692-22697 |
NNS |
denotes |
cells |
T25210 |
22697-22698 |
. |
denotes |
. |
T25211 |
22699-22703 |
NNP |
denotes |
Data |
T25212 |
22704-22713 |
VBP |
denotes |
represent |
T25213 |
22714-22717 |
DT |
denotes |
the |
T25214 |
22718-22722 |
JJ |
denotes |
mean |
T25215 |
22723-22724 |
NN |
denotes |
± |
T25216 |
22725-22730 |
NNP |
denotes |
S.E.M |
T25217 |
22731-22734 |
IN |
denotes |
for |
T25218 |
22735-22740 |
CD |
denotes |
three |
T25219 |
22741-22752 |
JJ |
denotes |
independent |
T25220 |
22753-22764 |
NNS |
denotes |
experiments |
T25221 |
22764-22765 |
. |
denotes |
. |
T9560 |
22768-22770 |
TO |
denotes |
To |
T9561 |
22771-22778 |
RBR |
denotes |
further |
T9562 |
22779-22785 |
VB |
denotes |
define |
T9563 |
22786-22789 |
DT |
denotes |
the |
T9564 |
22790-22794 |
NN |
denotes |
role |
T9565 |
22795-22797 |
IN |
denotes |
of |
T9566 |
22798-22801 |
NNP |
denotes |
PKC |
T9567 |
22802-22804 |
IN |
denotes |
in |
T9568 |
22805-22814 |
VBG |
denotes |
mediating |
T9569 |
22815-22820 |
JJ |
denotes |
human |
T9570 |
22821-22824 |
NNP |
denotes |
MDM |
T9571 |
22825-22833 |
NN |
denotes |
survival |
T9572 |
22834-22836 |
IN |
denotes |
in |
T9573 |
22837-22845 |
NN |
denotes |
response |
T9574 |
22846-22848 |
TO |
denotes |
to |
T9575 |
22849-22854 |
NNP |
denotes |
M-CSF |
T9576 |
22854-22855 |
, |
denotes |
, |
T9577 |
22856-22858 |
PRP |
denotes |
we |
T9578 |
22859-22867 |
VBD |
denotes |
examined |
T9579 |
22868-22871 |
DT |
denotes |
the |
T9580 |
22872-22882 |
NN |
denotes |
expression |
T9581 |
22883-22885 |
IN |
denotes |
of |
T9582 |
22886-22889 |
DT |
denotes |
the |
T9583 |
22890-22904 |
JJ |
denotes |
anti-apoptotic |
T9584 |
22905-22909 |
NN |
denotes |
gene |
T9585 |
22910-22916 |
NNP |
denotes |
BCL-xL |
T9586 |
22916-22917 |
, |
denotes |
, |
T9587 |
22918-22923 |
WDT |
denotes |
which |
T9588 |
22924-22926 |
VBZ |
denotes |
is |
T9589 |
22927-22931 |
RB |
denotes |
also |
T9590 |
22932-22941 |
VBN |
denotes |
regulated |
T9591 |
22942-22944 |
IN |
denotes |
by |
T9592 |
22945-22950 |
NNP |
denotes |
NF-κB |
T9593 |
22950-22951 |
. |
denotes |
. |
T9594 |
22952-22954 |
IN |
denotes |
As |
T9595 |
22955-22960 |
VBN |
denotes |
shown |
T9596 |
22961-22963 |
IN |
denotes |
in |
T9597 |
22964-22970 |
NNP |
denotes |
Figure |
T9598 |
22971-22973 |
NNP |
denotes |
6C |
T9599 |
22973-22974 |
, |
denotes |
, |
T9600 |
22975-22985 |
NNP |
denotes |
Ro-31-8220 |
T9601 |
22986-22993 |
VBD |
denotes |
reduced |
T9602 |
22994-23010 |
JJ |
denotes |
M-CSF-stimulated |
T9603 |
23011-23017 |
JJ |
denotes |
BCL-xL |
T9604 |
23018-23028 |
NN |
denotes |
expression |
T9605 |
23029-23037 |
VBN |
denotes |
compared |
T9606 |
23038-23040 |
TO |
denotes |
to |
T9607 |
23041-23046 |
NNS |
denotes |
cells |
T9608 |
23047-23054 |
VBN |
denotes |
treated |
T9609 |
23055-23059 |
IN |
denotes |
with |
T9610 |
23060-23065 |
NNP |
denotes |
M-CSF |
T9611 |
23066-23069 |
CC |
denotes |
and |
T9612 |
23070-23073 |
DT |
denotes |
the |
T9613 |
23074-23081 |
NN |
denotes |
vehicle |
T9614 |
23082-23089 |
NN |
denotes |
control |
T9615 |
23090-23094 |
NNP |
denotes |
DMSO |
T9616 |
23095-23096 |
-LRB- |
denotes |
( |
T9617 |
23096-23097 |
JJ |
denotes |
p |
T9618 |
23097-23098 |
NN |
denotes |
< |
T9619 |
23098-23102 |
CD |
denotes |
0.05 |
T9620 |
23102-23103 |
-RRB- |
denotes |
) |
T9621 |
23103-23104 |
. |
denotes |
. |
T10239 |
23106-23120 |
NN |
denotes |
Identification |
T10240 |
23121-23123 |
IN |
denotes |
of |
T10241 |
23124-23128 |
NNP |
denotes |
PKCα |
T10242 |
23129-23131 |
IN |
denotes |
as |
T10243 |
23132-23135 |
DT |
denotes |
the |
T10244 |
23136-23144 |
NNP |
denotes |
Upstream |
T10245 |
23145-23154 |
NNP |
denotes |
Activator |
T10246 |
23155-23157 |
IN |
denotes |
of |
T10247 |
23158-23163 |
NNP |
denotes |
NF-κB |
T10248 |
23164-23166 |
IN |
denotes |
in |
T10249 |
23167-23174 |
NNP |
denotes |
Myeloid |
T10250 |
23175-23180 |
NNP |
denotes |
Cells |
T10251 |
23181-23185 |
RB |
denotes |
Even |
T10252 |
23186-23192 |
IN |
denotes |
though |
T10253 |
23193-23196 |
DT |
denotes |
the |
T10254 |
23197-23200 |
NNP |
denotes |
PKC |
T10255 |
23201-23207 |
NN |
denotes |
family |
T10256 |
23208-23216 |
VBZ |
denotes |
consists |
T10257 |
23217-23219 |
IN |
denotes |
of |
T10258 |
23220-23222 |
CD |
denotes |
10 |
T10259 |
23223-23230 |
NNS |
denotes |
members |
T10260 |
23230-23231 |
, |
denotes |
, |
T10261 |
23232-23239 |
VBG |
denotes |
finding |
T10262 |
23240-23244 |
IN |
denotes |
that |
T10263 |
23245-23249 |
NNP |
denotes |
PKCα |
T10264 |
23249-23250 |
NNP |
denotes |
/ |
T10265 |
23250-23251 |
VBD |
denotes |
β |
T10266 |
23252-23262 |
NNS |
denotes |
inhibitors |
T10267 |
23263-23266 |
CC |
denotes |
and |
T10268 |
23267-23280 |
JJ |
denotes |
intracellular |
T10269 |
23281-23288 |
NN |
denotes |
calcium |
T10270 |
23289-23299 |
NNS |
denotes |
inhibitors |
T10271 |
23300-23307 |
VBD |
denotes |
reduced |
T10272 |
23308-23321 |
JJ |
denotes |
M-CSF-induced |
T10273 |
23322-23327 |
NN |
denotes |
NF-κB |
T10274 |
23328-23336 |
NN |
denotes |
activity |
T10275 |
23336-23337 |
, |
denotes |
, |
T10276 |
23338-23347 |
VBD |
denotes |
suggested |
T10277 |
23348-23352 |
NNP |
denotes |
PKCα |
T10278 |
23353-23356 |
VBD |
denotes |
was |
T10279 |
23357-23365 |
VBN |
denotes |
involved |
T10280 |
23366-23368 |
IN |
denotes |
in |
T10281 |
23369-23374 |
JJ |
denotes |
NF-κB |
T10282 |
23375-23385 |
NN |
denotes |
activation |
T10283 |
23386-23391 |
IN |
denotes |
after |
T10284 |
23392-23397 |
NNP |
denotes |
M-CSF |
T10285 |
23398-23407 |
NN |
denotes |
treatment |
T10286 |
23407-23408 |
. |
denotes |
. |
T10287 |
23409-23411 |
TO |
denotes |
To |
T10288 |
23412-23419 |
VB |
denotes |
confirm |
T10289 |
23420-23423 |
DT |
denotes |
the |
T10290 |
23424-23428 |
NN |
denotes |
role |
T10291 |
23429-23431 |
IN |
denotes |
of |
T10292 |
23432-23436 |
NNP |
denotes |
PKCα |
T10293 |
23437-23439 |
IN |
denotes |
in |
T10294 |
23440-23445 |
NNP |
denotes |
NF-κB |
T10295 |
23446-23456 |
NN |
denotes |
activation |
T10296 |
23457-23459 |
IN |
denotes |
in |
T10297 |
23460-23471 |
NNS |
denotes |
macrophages |
T10298 |
23471-23472 |
, |
denotes |
, |
T10299 |
23473-23483 |
NNS |
denotes |
constructs |
T10300 |
23484-23487 |
IN |
denotes |
for |
T10301 |
23488-23494 |
DT |
denotes |
either |
T10302 |
23495-23503 |
NN |
denotes |
wildtype |
T10303 |
23504-23505 |
-LRB- |
denotes |
( |
T10304 |
23505-23507 |
NNP |
denotes |
WT |
T10305 |
23507-23508 |
-RRB- |
denotes |
) |
T10306 |
23508-23509 |
: |
denotes |
- |
T10307 |
23509-23513 |
NN |
denotes |
PKCα |
T10308 |
23514-23516 |
CC |
denotes |
or |
T10309 |
23517-23533 |
NN |
denotes |
kinase-deficient |
T10310 |
23534-23535 |
-LRB- |
denotes |
( |
T10311 |
23535-23537 |
NNP |
denotes |
KD |
T10312 |
23537-23538 |
-RRB- |
denotes |
) |
T10313 |
23538-23539 |
: |
denotes |
- |
T10314 |
23539-23543 |
NN |
denotes |
PKCα |
T10315 |
23544-23547 |
VBD |
denotes |
was |
T10316 |
23548-23562 |
VBN |
denotes |
co-transfected |
T10317 |
23563-23567 |
IN |
denotes |
with |
T10318 |
23568-23571 |
DT |
denotes |
the |
T10319 |
23572-23583 |
JJ |
denotes |
pNF-κB-SEAP |
T10320 |
23584-23592 |
NN |
denotes |
reporter |
T10321 |
23593-23597 |
NN |
denotes |
gene |
T10322 |
23598-23601 |
CC |
denotes |
and |
T10323 |
23602-23606 |
NNP |
denotes |
SEAP |
T10324 |
23607-23616 |
NN |
denotes |
secretion |
T10325 |
23617-23620 |
VBD |
denotes |
was |
T10326 |
23621-23629 |
VBN |
denotes |
measured |
T10327 |
23629-23630 |
. |
denotes |
. |
T10328 |
23631-23633 |
IN |
denotes |
As |
T10329 |
23634-23639 |
VBN |
denotes |
shown |
T10330 |
23640-23642 |
IN |
denotes |
in |
T10331 |
23643-23649 |
NN |
denotes |
Figure |
T10332 |
23650-23652 |
NN |
denotes |
7A |
T10333 |
23652-23653 |
, |
denotes |
, |
T10334 |
23654-23658 |
NNP |
denotes |
MDMs |
T10335 |
23659-23673 |
VBD |
denotes |
co-transfected |
T10336 |
23674-23678 |
IN |
denotes |
with |
T10337 |
23679-23690 |
NNP |
denotes |
pNF-κB-SEAP |
T10338 |
23691-23694 |
CC |
denotes |
and |
T10339 |
23695-23702 |
NNP |
denotes |
WT-PKCα |
T10340 |
23703-23706 |
VBD |
denotes |
had |
T10341 |
23707-23708 |
DT |
denotes |
a |
T10342 |
23709-23717 |
JJ |
denotes |
1.8-fold |
T10343 |
23718-23726 |
NN |
denotes |
increase |
T10344 |
23727-23729 |
IN |
denotes |
in |
T10345 |
23730-23735 |
JJ |
denotes |
NF-κB |
T10346 |
23736-23751 |
JJ |
denotes |
transcriptional |
T10347 |
23752-23760 |
NN |
denotes |
activity |
T10348 |
23761-23766 |
IN |
denotes |
after |
T10349 |
23767-23772 |
NNP |
denotes |
M-CSF |
T10350 |
23773-23783 |
NN |
denotes |
activation |
T10351 |
23784-23792 |
VBN |
denotes |
compared |
T10352 |
23793-23797 |
IN |
denotes |
with |
T10353 |
23798-23800 |
NNP |
denotes |
NS |
T10354 |
23801-23806 |
NNS |
denotes |
cells |
T10355 |
23807-23808 |
-LRB- |
denotes |
( |
T10356 |
23808-23809 |
FW |
denotes |
p |
T10357 |
23810-23811 |
SYM |
denotes |
= |
T10358 |
23812-23816 |
CD |
denotes |
0.05 |
T10359 |
23816-23817 |
-RRB- |
denotes |
) |
T10360 |
23817-23818 |
, |
denotes |
, |
T10361 |
23819-23826 |
JJ |
denotes |
similar |
T10362 |
23827-23829 |
TO |
denotes |
to |
T10363 |
23830-23843 |
JJ |
denotes |
M-CSF-treated |
T10364 |
23844-23849 |
NNS |
denotes |
cells |
T10365 |
23850-23860 |
VBG |
denotes |
expressing |
T10366 |
23861-23865 |
RB |
denotes |
only |
T10367 |
23866-23877 |
JJ |
denotes |
pNF-κB-SEAP |
T10368 |
23877-23878 |
. |
denotes |
. |
T10369 |
23879-23891 |
VBG |
denotes |
Transfecting |
T10370 |
23892-23897 |
JJ |
denotes |
human |
T10371 |
23898-23909 |
NNS |
denotes |
macrophages |
T10372 |
23910-23914 |
IN |
denotes |
with |
T10373 |
23915-23918 |
DT |
denotes |
the |
T10374 |
23919-23926 |
NNP |
denotes |
KD-PKCα |
T10375 |
23927-23936 |
VBP |
denotes |
construct |
T10376 |
23937-23950 |
RB |
denotes |
significantly |
T10377 |
23951-23958 |
VBN |
denotes |
reduced |
T10378 |
23959-23972 |
JJ |
denotes |
M-CSF-induced |
T10379 |
23973-23978 |
NN |
denotes |
NF-κB |
T10380 |
23979-23987 |
NN |
denotes |
activity |
T10381 |
23988-23996 |
VBN |
denotes |
compared |
T10382 |
23997-23999 |
TO |
denotes |
to |
T10383 |
24000-24007 |
JJ |
denotes |
WT-PKCα |
T10384 |
24008-24019 |
VBN |
denotes |
transfected |
T10385 |
24020-24025 |
NNS |
denotes |
cells |
T10386 |
24026-24027 |
-LRB- |
denotes |
( |
T10387 |
24027-24028 |
FW |
denotes |
p |
T10388 |
24029-24030 |
SYM |
denotes |
= |
T10389 |
24031-24036 |
CD |
denotes |
0.016 |
T10390 |
24036-24037 |
-RRB- |
denotes |
) |
T10391 |
24037-24038 |
. |
denotes |
. |
T10392 |
24039-24048 |
RB |
denotes |
Similarly |
T10393 |
24048-24049 |
, |
denotes |
, |
T10394 |
24050-24053 |
NNP |
denotes |
RAW |
T10395 |
24054-24059 |
CD |
denotes |
264.7 |
T10396 |
24060-24065 |
NNS |
denotes |
cells |
T10397 |
24066-24077 |
VBN |
denotes |
transfected |
T10398 |
24078-24082 |
IN |
denotes |
with |
T10399 |
24083-24090 |
NNP |
denotes |
WT-PKCα |
T10400 |
24091-24094 |
VBD |
denotes |
had |
T10401 |
24095-24103 |
CD |
denotes |
2.5-fold |
T10402 |
24104-24108 |
JJR |
denotes |
more |
T10403 |
24109-24114 |
JJ |
denotes |
NF-κB |
T10404 |
24115-24130 |
NN |
denotes |
transcriptional |
T10405 |
24131-24139 |
NN |
denotes |
activity |
T10406 |
24140-24145 |
IN |
denotes |
after |
T10407 |
24146-24151 |
NNP |
denotes |
M-CSF |
T10408 |
24152-24162 |
NN |
denotes |
activation |
T10409 |
24163-24171 |
VBN |
denotes |
compared |
T10410 |
24172-24174 |
TO |
denotes |
to |
T10411 |
24175-24187 |
JJ |
denotes |
unstimulated |
T10412 |
24188-24191 |
NNP |
denotes |
RAW |
T10413 |
24192-24197 |
CD |
denotes |
264.7 |
T10414 |
24198-24203 |
NNS |
denotes |
cells |
T10415 |
24204-24205 |
-LRB- |
denotes |
( |
T10416 |
24205-24207 |
NNP |
denotes |
NS |
T10417 |
24207-24208 |
-RRB- |
denotes |
) |
T10418 |
24209-24220 |
VBN |
denotes |
transfected |
T10419 |
24221-24225 |
IN |
denotes |
with |
T10420 |
24226-24233 |
NNP |
denotes |
WT-PKCα |
T10421 |
24234-24235 |
-LRB- |
denotes |
( |
T10422 |
24235-24241 |
NNP |
denotes |
Figure |
T10423 |
24242-24244 |
NN |
denotes |
7B |
T10424 |
24244-24245 |
-RRB- |
denotes |
) |
T10425 |
24245-24246 |
. |
denotes |
. |
T10426 |
24247-24257 |
NN |
denotes |
Expression |
T10427 |
24258-24260 |
IN |
denotes |
of |
T10428 |
24261-24264 |
DT |
denotes |
the |
T10429 |
24265-24272 |
NNP |
denotes |
KD-PKCα |
T10430 |
24273-24282 |
VBP |
denotes |
construct |
T10431 |
24283-24287 |
IN |
denotes |
into |
T10432 |
24288-24291 |
NNP |
denotes |
RAW |
T10433 |
24292-24297 |
CD |
denotes |
264.7 |
T10434 |
24298-24303 |
NNS |
denotes |
cells |
T10435 |
24304-24311 |
VBN |
denotes |
reduced |
T10436 |
24312-24325 |
JJ |
denotes |
M-CSF-induced |
T10437 |
24326-24331 |
NN |
denotes |
NF-κB |
T10438 |
24332-24340 |
NN |
denotes |
activity |
T10439 |
24341-24343 |
TO |
denotes |
to |
T10440 |
24344-24352 |
CD |
denotes |
1.5-fold |
T10441 |
24353-24354 |
-LRB- |
denotes |
( |
T10442 |
24354-24355 |
NN |
denotes |
p |
T10443 |
24356-24357 |
SYM |
denotes |
= |
T10444 |
24358-24363 |
CD |
denotes |
0.045 |
T10445 |
24363-24364 |
-RRB- |
denotes |
) |
T10446 |
24365-24373 |
VBN |
denotes |
compared |
T10447 |
24374-24376 |
TO |
denotes |
to |
T10448 |
24377-24382 |
NNS |
denotes |
cells |
T10449 |
24383-24394 |
VBN |
denotes |
transfected |
T10450 |
24395-24399 |
IN |
denotes |
with |
T10451 |
24400-24402 |
NNP |
denotes |
WT |
T10452 |
24403-24407 |
NNP |
denotes |
PKCα |
T10453 |
24407-24408 |
. |
denotes |
. |
T25475 |
24453-24457 |
NNP |
denotes |
PKCα |
T25476 |
24458-24467 |
VBZ |
denotes |
regulates |
T25477 |
24468-24483 |
NN |
denotes |
phosphorylation |
T25478 |
24484-24486 |
IN |
denotes |
of |
T25479 |
24487-24492 |
NNP |
denotes |
NF-κB |
T25480 |
24493-24496 |
NNS |
denotes |
p65 |
T25481 |
24497-24499 |
IN |
denotes |
at |
T25482 |
24500-24506 |
NNP |
denotes |
Ser276 |
T25483 |
24506-24507 |
. |
denotes |
. |
T25484 |
24508-24509 |
-LRB- |
denotes |
( |
T25485 |
24509-24510 |
NNP |
denotes |
A |
T25486 |
24510-24511 |
-RRB- |
denotes |
) |
T25487 |
24512-24515 |
NNP |
denotes |
MDM |
T25488 |
24516-24518 |
CC |
denotes |
or |
T25489 |
24519-24520 |
-LRB- |
denotes |
( |
T25490 |
24520-24521 |
NNP |
denotes |
B |
T25491 |
24521-24522 |
-RRB- |
denotes |
) |
T25492 |
24523-24526 |
NNP |
denotes |
RAW |
T25493 |
24527-24532 |
CD |
denotes |
264.7 |
T25494 |
24533-24538 |
NNS |
denotes |
cells |
T25495 |
24539-24543 |
VBD |
denotes |
were |
T25496 |
24544-24555 |
RB |
denotes |
transiently |
T25497 |
24556-24567 |
VBN |
denotes |
transfected |
T25498 |
24568-24572 |
IN |
denotes |
with |
T25499 |
24573-24584 |
JJ |
denotes |
pNF-κB-SEAP |
T25500 |
24585-24590 |
IN |
denotes |
along |
T25501 |
24591-24595 |
IN |
denotes |
with |
T25502 |
24596-24602 |
DT |
denotes |
either |
T25503 |
24603-24610 |
NNP |
denotes |
WT-PKCα |
T25504 |
24611-24613 |
CC |
denotes |
or |
T25505 |
24614-24617 |
DT |
denotes |
the |
T25506 |
24618-24634 |
JJ |
denotes |
kinase-deficient |
T25507 |
24635-24636 |
-LRB- |
denotes |
( |
T25508 |
24636-24638 |
NNP |
denotes |
KD |
T25509 |
24638-24639 |
-RRB- |
denotes |
) |
T25510 |
24639-24640 |
: |
denotes |
- |
T25511 |
24640-24644 |
NNP |
denotes |
PKCα |
T25512 |
24645-24654 |
VB |
denotes |
construct |
T25513 |
24655-24657 |
IN |
denotes |
at |
T25514 |
24658-24659 |
DT |
denotes |
a |
T25515 |
24660-24661 |
CD |
denotes |
1 |
T25516 |
24661-24662 |
NN |
denotes |
∶ |
T25517 |
24662-24663 |
CD |
denotes |
5 |
T25518 |
24664-24669 |
NN |
denotes |
ratio |
T25519 |
24669-24670 |
. |
denotes |
. |
T25520 |
24671-24676 |
NNS |
denotes |
Cells |
T25521 |
24677-24681 |
VBD |
denotes |
were |
T25522 |
24682-24687 |
JJ |
denotes |
serum |
T25523 |
24688-24695 |
VBN |
denotes |
starved |
T25524 |
24696-24699 |
CC |
denotes |
and |
T25525 |
24700-24710 |
VBN |
denotes |
stimulated |
T25526 |
24711-24715 |
IN |
denotes |
with |
T25527 |
24716-24721 |
NNP |
denotes |
M-CSF |
T25528 |
24722-24725 |
CC |
denotes |
and |
T25529 |
24726-24730 |
RB |
denotes |
then |
T25530 |
24731-24735 |
NNP |
denotes |
SEAP |
T25531 |
24736-24745 |
NN |
denotes |
secretion |
T25532 |
24746-24748 |
IN |
denotes |
in |
T25533 |
24749-24752 |
DT |
denotes |
the |
T25534 |
24753-24759 |
NN |
denotes |
medium |
T25535 |
24760-24763 |
VBD |
denotes |
was |
T25536 |
24764-24772 |
VBN |
denotes |
measured |
T25537 |
24772-24773 |
. |
denotes |
. |
T25538 |
24774-24778 |
NNP |
denotes |
Data |
T25539 |
24779-24781 |
VBZ |
denotes |
is |
T25540 |
24782-24786 |
IN |
denotes |
from |
T25541 |
24787-24789 |
IN |
denotes |
of |
T25542 |
24790-24795 |
CD |
denotes |
three |
T25543 |
24796-24807 |
JJ |
denotes |
independent |
T25544 |
24808-24819 |
NNS |
denotes |
experiments |
T25545 |
24819-24820 |
. |
denotes |
. |
T25546 |
24821-24824 |
DT |
denotes |
The |
T25547 |
24825-24832 |
NN |
denotes |
p-value |
T25548 |
24833-24835 |
IN |
denotes |
of |
T25549 |
24836-24841 |
NNS |
denotes |
cells |
T25550 |
24842-24853 |
VBN |
denotes |
transfected |
T25551 |
24854-24858 |
IN |
denotes |
with |
T25552 |
24859-24861 |
NNP |
denotes |
KD |
T25553 |
24862-24870 |
VBN |
denotes |
compared |
T25554 |
24871-24873 |
TO |
denotes |
to |
T25555 |
24874-24879 |
DT |
denotes |
those |
T25556 |
24880-24891 |
VBN |
denotes |
transfected |
T25557 |
24892-24896 |
IN |
denotes |
with |
T25558 |
24897-24899 |
NNP |
denotes |
WT |
T25559 |
24900-24903 |
VBD |
denotes |
was |
T25560 |
24904-24908 |
CD |
denotes |
0.05 |
T25561 |
24908-24909 |
. |
denotes |
. |
T25562 |
24910-24911 |
-LRB- |
denotes |
( |
T25563 |
24911-24912 |
$ |
denotes |
C |
T25564 |
24912-24913 |
-RRB- |
denotes |
) |
T25565 |
24914-24918 |
NNS |
denotes |
MDMs |
T25566 |
24919-24923 |
VBD |
denotes |
were |
T25567 |
24924-24931 |
VBN |
denotes |
removed |
T25568 |
24932-24936 |
IN |
denotes |
from |
T25569 |
24937-24940 |
DT |
denotes |
the |
T25570 |
24941-24946 |
NN |
denotes |
plate |
T25571 |
24947-24952 |
VBG |
denotes |
using |
T25572 |
24953-24961 |
NN |
denotes |
accutase |
T25573 |
24962-24965 |
CC |
denotes |
and |
T25574 |
24966-24975 |
NN |
denotes |
apoptosis |
T25575 |
24976-24978 |
IN |
denotes |
of |
T25576 |
24979-24983 |
NNS |
denotes |
MDMs |
T25577 |
24984-24987 |
VBD |
denotes |
was |
T25578 |
24988-24996 |
VBN |
denotes |
measured |
T25579 |
24997-24999 |
IN |
denotes |
by |
T25580 |
25000-25004 |
NN |
denotes |
flow |
T25581 |
25005-25014 |
NN |
denotes |
cytometry |
T25582 |
25015-25020 |
VBG |
denotes |
using |
T25583 |
25021-25028 |
NNP |
denotes |
Annexin |
T25584 |
25029-25035 |
NNP |
denotes |
V-FITC |
T25585 |
25036-25039 |
CC |
denotes |
and |
T25586 |
25040-25049 |
NN |
denotes |
propidium |
T25587 |
25050-25056 |
NN |
denotes |
iodine |
T25588 |
25057-25058 |
-LRB- |
denotes |
( |
T25589 |
25058-25060 |
NNP |
denotes |
PI |
T25590 |
25060-25061 |
-RRB- |
denotes |
) |
T25591 |
25061-25062 |
. |
denotes |
. |
T25592 |
25063-25064 |
-LRB- |
denotes |
( |
T25593 |
25064-25065 |
NNP |
denotes |
D |
T25594 |
25065-25066 |
-RRB- |
denotes |
) |
T25595 |
25067-25072 |
NNP |
denotes |
Whole |
T25596 |
25073-25077 |
NN |
denotes |
cell |
T25597 |
25078-25085 |
VBZ |
denotes |
lysates |
T25598 |
25086-25090 |
IN |
denotes |
from |
T25599 |
25091-25094 |
DT |
denotes |
the |
T25600 |
25095-25106 |
VBN |
denotes |
transfected |
T25601 |
25107-25110 |
NNP |
denotes |
RAW |
T25602 |
25111-25116 |
CD |
denotes |
264.7 |
T25603 |
25117-25122 |
NNS |
denotes |
cells |
T25604 |
25123-25127 |
VBD |
denotes |
were |
T25605 |
25128-25137 |
VBN |
denotes |
subjected |
T25606 |
25138-25140 |
TO |
denotes |
to |
T25607 |
25141-25148 |
JJ |
denotes |
Western |
T25608 |
25149-25153 |
NN |
denotes |
blot |
T25609 |
25154-25162 |
NN |
denotes |
analysis |
T25610 |
25163-25167 |
IN |
denotes |
with |
T25611 |
25168-25182 |
NN |
denotes |
phospho-Ser276 |
T25612 |
25183-25185 |
CC |
denotes |
or |
T25613 |
25186-25200 |
NN |
denotes |
phospho-Ser536 |
T25614 |
25201-25206 |
NNP |
denotes |
NF-κB |
T25615 |
25207-25210 |
CD |
denotes |
p65 |
T25616 |
25211-25221 |
NNS |
denotes |
antibodies |
T25617 |
25221-25222 |
. |
denotes |
. |
T25618 |
25223-25228 |
NNS |
denotes |
Blots |
T25619 |
25229-25233 |
VBD |
denotes |
were |
T25620 |
25234-25247 |
VBN |
denotes |
immunoblotted |
T25621 |
25248-25252 |
IN |
denotes |
with |
T25622 |
25253-25257 |
NNP |
denotes |
PKCα |
T25623 |
25258-25260 |
TO |
denotes |
to |
T25624 |
25261-25270 |
VB |
denotes |
determine |
T25625 |
25271-25276 |
JJ |
denotes |
equal |
T25626 |
25277-25284 |
NN |
denotes |
protein |
T25627 |
25285-25295 |
NN |
denotes |
expression |
T25628 |
25296-25299 |
IN |
denotes |
for |
T25629 |
25300-25303 |
DT |
denotes |
the |
T25630 |
25304-25308 |
NNP |
denotes |
PKCα |
T25631 |
25309-25319 |
NNS |
denotes |
constructs |
T25632 |
25319-25320 |
. |
denotes |
. |
T25633 |
25321-25328 |
JJ |
denotes |
β-actin |
T25634 |
25329-25335 |
VBD |
denotes |
served |
T25635 |
25336-25338 |
IN |
denotes |
as |
T25636 |
25339-25340 |
DT |
denotes |
a |
T25637 |
25341-25348 |
VBG |
denotes |
loading |
T25638 |
25349-25356 |
NN |
denotes |
control |
T25639 |
25356-25357 |
. |
denotes |
. |
T25640 |
25358-25363 |
VBN |
denotes |
Shown |
T25641 |
25364-25366 |
VBZ |
denotes |
is |
T25642 |
25367-25368 |
DT |
denotes |
a |
T25643 |
25369-25383 |
JJ |
denotes |
representative |
T25644 |
25384-25388 |
NN |
denotes |
blot |
T25645 |
25389-25393 |
IN |
denotes |
from |
T25646 |
25394-25399 |
CD |
denotes |
three |
T25647 |
25400-25411 |
JJ |
denotes |
independent |
T25648 |
25412-25423 |
NNS |
denotes |
experiments |
T25649 |
25423-25424 |
. |
denotes |
. |
T25650 |
25425-25426 |
-LRB- |
denotes |
( |
T25651 |
25426-25427 |
NNP |
denotes |
E |
T25652 |
25427-25428 |
-RRB- |
denotes |
) |
T25653 |
25429-25432 |
NNP |
denotes |
MDM |
T25654 |
25433-25435 |
CC |
denotes |
or |
T25655 |
25436-25437 |
-LRB- |
denotes |
( |
T25656 |
25437-25438 |
NN |
denotes |
F |
T25657 |
25438-25439 |
-RRB- |
denotes |
) |
T25658 |
25440-25443 |
NNP |
denotes |
RAW |
T25659 |
25444-25449 |
CD |
denotes |
264.7 |
T25660 |
25450-25455 |
NNS |
denotes |
cells |
T25661 |
25456-25460 |
VBD |
denotes |
were |
T25662 |
25461-25472 |
RB |
denotes |
transiently |
T25663 |
25473-25484 |
VBN |
denotes |
transfected |
T25664 |
25485-25489 |
IN |
denotes |
with |
T25665 |
25490-25491 |
DT |
denotes |
a |
T25666 |
25492-25503 |
JJ |
denotes |
pNF-κB-SEAP |
T25667 |
25504-25509 |
IN |
denotes |
along |
T25668 |
25510-25514 |
IN |
denotes |
with |
T25669 |
25515-25521 |
DT |
denotes |
either |
T25670 |
25522-25525 |
CD |
denotes |
100 |
T25671 |
25526-25528 |
NNP |
denotes |
nM |
T25672 |
25529-25533 |
NNP |
denotes |
PKCα |
T25673 |
25534-25539 |
NNP |
denotes |
siRNA |
T25674 |
25540-25542 |
CC |
denotes |
or |
T25675 |
25543-25550 |
VB |
denotes |
control |
T25676 |
25551-25556 |
NNP |
denotes |
siRNA |
T25677 |
25557-25560 |
IN |
denotes |
for |
T25678 |
25561-25566 |
CD |
denotes |
20-24 |
T25679 |
25567-25572 |
NNS |
denotes |
hours |
T25680 |
25572-25573 |
. |
denotes |
. |
T25681 |
25574-25579 |
NNS |
denotes |
Cells |
T25682 |
25580-25584 |
VBD |
denotes |
were |
T25683 |
25585-25590 |
JJ |
denotes |
serum |
T25684 |
25591-25598 |
VBN |
denotes |
starved |
T25685 |
25599-25602 |
IN |
denotes |
for |
T25686 |
25603-25606 |
CD |
denotes |
2-4 |
T25687 |
25607-25612 |
NNS |
denotes |
hours |
T25688 |
25613-25616 |
CC |
denotes |
and |
T25689 |
25617-25627 |
VBN |
denotes |
stimulated |
T25690 |
25628-25632 |
IN |
denotes |
with |
T25691 |
25633-25636 |
CD |
denotes |
100 |
T25692 |
25637-25642 |
JJ |
denotes |
ng/ml |
T25693 |
25643-25648 |
NN |
denotes |
M-CSF |
T25694 |
25649-25652 |
IN |
denotes |
for |
T25695 |
25653-25654 |
CD |
denotes |
6 |
T25696 |
25655-25660 |
NNS |
denotes |
hours |
T25697 |
25661-25664 |
IN |
denotes |
for |
T25698 |
25665-25668 |
NNP |
denotes |
MDM |
T25699 |
25669-25671 |
CC |
denotes |
or |
T25700 |
25672-25675 |
NNP |
denotes |
RAW |
T25701 |
25676-25681 |
CD |
denotes |
264.7 |
T25702 |
25682-25685 |
IN |
denotes |
for |
T25703 |
25686-25687 |
CD |
denotes |
2 |
T25704 |
25688-25693 |
NNS |
denotes |
hours |
T25705 |
25694-25697 |
CC |
denotes |
and |
T25706 |
25698-25702 |
RB |
denotes |
then |
T25707 |
25703-25707 |
NNP |
denotes |
SEAP |
T25708 |
25708-25717 |
NN |
denotes |
secretion |
T25709 |
25718-25720 |
IN |
denotes |
in |
T25710 |
25721-25724 |
DT |
denotes |
the |
T25711 |
25725-25731 |
NN |
denotes |
medium |
T25712 |
25732-25735 |
VBD |
denotes |
was |
T25713 |
25736-25744 |
VBN |
denotes |
measured |
T25714 |
25744-25745 |
. |
denotes |
. |
T25715 |
25746-25751 |
VBN |
denotes |
Shown |
T25716 |
25752-25754 |
VBZ |
denotes |
is |
T25717 |
25755-25759 |
NNS |
denotes |
data |
T25718 |
25760-25762 |
IN |
denotes |
of |
T25719 |
25763-25768 |
CD |
denotes |
three |
T25720 |
25769-25780 |
JJ |
denotes |
independent |
T25721 |
25781-25792 |
NNS |
denotes |
experiments |
T25722 |
25792-25793 |
. |
denotes |
. |
T25723 |
25794-25795 |
-LRB- |
denotes |
( |
T25724 |
25795-25796 |
NNP |
denotes |
G |
T25725 |
25796-25797 |
-RRB- |
denotes |
) |
T25726 |
25798-25802 |
NNS |
denotes |
MDMs |
T25727 |
25803-25807 |
VBD |
denotes |
were |
T25728 |
25808-25815 |
VBN |
denotes |
removed |
T25729 |
25816-25820 |
IN |
denotes |
from |
T25730 |
25821-25824 |
DT |
denotes |
the |
T25731 |
25825-25830 |
NN |
denotes |
plate |
T25732 |
25831-25836 |
VBG |
denotes |
using |
T25733 |
25837-25845 |
NN |
denotes |
accutase |
T25734 |
25846-25849 |
CC |
denotes |
and |
T25735 |
25850-25859 |
NN |
denotes |
apoptosis |
T25736 |
25860-25862 |
IN |
denotes |
of |
T25737 |
25863-25867 |
NNS |
denotes |
MDMs |
T25738 |
25868-25871 |
VBD |
denotes |
was |
T25739 |
25872-25880 |
VBN |
denotes |
measured |
T25740 |
25881-25883 |
IN |
denotes |
by |
T25741 |
25884-25891 |
NNP |
denotes |
Annexin |
T25742 |
25892-25898 |
NNP |
denotes |
V-FITC |
T25743 |
25899-25902 |
CC |
denotes |
and |
T25744 |
25903-25912 |
NN |
denotes |
propidium |
T25745 |
25913-25919 |
NN |
denotes |
iodine |
T25746 |
25920-25921 |
-LRB- |
denotes |
( |
T25747 |
25921-25923 |
NNP |
denotes |
PI |
T25748 |
25923-25924 |
-RRB- |
denotes |
) |
T25749 |
25925-25933 |
VBG |
denotes |
staining |
T25750 |
25934-25937 |
CC |
denotes |
and |
T25751 |
25938-25946 |
VBN |
denotes |
analyzed |
T25752 |
25947-25949 |
IN |
denotes |
by |
T25753 |
25950-25954 |
NN |
denotes |
flow |
T25754 |
25955-25964 |
NN |
denotes |
cytometry |
T25755 |
25964-25965 |
. |
denotes |
. |
T25756 |
25966-25967 |
-LRB- |
denotes |
( |
T25757 |
25967-25968 |
NNP |
denotes |
H |
T25758 |
25968-25969 |
-RRB- |
denotes |
) |
T25759 |
25970-25975 |
NNP |
denotes |
Whole |
T25760 |
25976-25980 |
NN |
denotes |
cell |
T25761 |
25981-25988 |
VBZ |
denotes |
lysates |
T25762 |
25989-25993 |
IN |
denotes |
from |
T25763 |
25994-25997 |
DT |
denotes |
the |
T25764 |
25998-26009 |
VBN |
denotes |
transfected |
T25765 |
26010-26013 |
NNP |
denotes |
MDM |
T25766 |
26014-26017 |
CC |
denotes |
and |
T25767 |
26018-26021 |
NNP |
denotes |
RAW |
T25768 |
26022-26027 |
CD |
denotes |
264.7 |
T25769 |
26028-26033 |
NNS |
denotes |
cells |
T25770 |
26034-26038 |
VBD |
denotes |
were |
T25771 |
26039-26048 |
VBN |
denotes |
subjected |
T25772 |
26049-26051 |
TO |
denotes |
to |
T25773 |
26052-26059 |
JJ |
denotes |
Western |
T25774 |
26060-26064 |
NN |
denotes |
blot |
T25775 |
26065-26073 |
NN |
denotes |
analysis |
T25776 |
26074-26078 |
IN |
denotes |
with |
T25777 |
26079-26083 |
NNP |
denotes |
PKCα |
T25778 |
26084-26092 |
NN |
denotes |
antibody |
T25779 |
26092-26093 |
. |
denotes |
. |
T25780 |
26094-26101 |
JJ |
denotes |
β-actin |
T25781 |
26102-26108 |
VBD |
denotes |
served |
T25782 |
26109-26111 |
IN |
denotes |
as |
T25783 |
26112-26113 |
DT |
denotes |
a |
T25784 |
26114-26121 |
VBG |
denotes |
loading |
T25785 |
26122-26129 |
NN |
denotes |
control |
T25786 |
26129-26130 |
. |
denotes |
. |
T25787 |
26131-26136 |
VBN |
denotes |
Shown |
T25788 |
26137-26139 |
VBZ |
denotes |
is |
T25789 |
26140-26141 |
DT |
denotes |
a |
T25790 |
26142-26156 |
JJ |
denotes |
representative |
T25791 |
26157-26161 |
NN |
denotes |
blot |
T25792 |
26162-26166 |
IN |
denotes |
from |
T25793 |
26167-26169 |
IN |
denotes |
at |
T25794 |
26170-26175 |
JJS |
denotes |
least |
T25795 |
26176-26181 |
CD |
denotes |
three |
T25796 |
26182-26193 |
JJ |
denotes |
independent |
T25797 |
26194-26205 |
NNS |
denotes |
experiments |
T25798 |
26205-26206 |
. |
denotes |
. |
T10454 |
26209-26213 |
NNP |
denotes |
Cell |
T10455 |
26214-26222 |
NN |
denotes |
survival |
T10456 |
26223-26226 |
VBD |
denotes |
was |
T10457 |
26227-26231 |
RB |
denotes |
also |
T10458 |
26232-26240 |
VBN |
denotes |
examined |
T10459 |
26241-26243 |
IN |
denotes |
in |
T10460 |
26244-26248 |
NNS |
denotes |
MDMs |
T10461 |
26249-26259 |
VBG |
denotes |
expressing |
T10462 |
26260-26266 |
CC |
denotes |
either |
T10463 |
26267-26274 |
NNP |
denotes |
WT-PKCα |
T10464 |
26275-26277 |
CC |
denotes |
or |
T10465 |
26278-26285 |
NNP |
denotes |
KD-PKCα |
T10466 |
26286-26296 |
NNS |
denotes |
constructs |
T10467 |
26297-26299 |
IN |
denotes |
by |
T10468 |
26300-26307 |
NNP |
denotes |
Annexin |
T10469 |
26308-26314 |
NNP |
denotes |
V-FITC |
T10470 |
26315-26318 |
CC |
denotes |
and |
T10471 |
26319-26321 |
NNP |
denotes |
PI |
T10472 |
26322-26330 |
VBG |
denotes |
staining |
T10473 |
26330-26331 |
. |
denotes |
. |
T10474 |
26332-26334 |
IN |
denotes |
As |
T10475 |
26335-26343 |
VBN |
denotes |
expected |
T10476 |
26343-26344 |
, |
denotes |
, |
T10477 |
26345-26350 |
NNP |
denotes |
M-CSF |
T10478 |
26351-26360 |
VBD |
denotes |
increased |
T10479 |
26361-26364 |
NNP |
denotes |
MDM |
T10480 |
26365-26373 |
NN |
denotes |
survival |
T10481 |
26374-26376 |
IN |
denotes |
as |
T10482 |
26377-26385 |
VBN |
denotes |
measured |
T10483 |
26386-26388 |
IN |
denotes |
by |
T10484 |
26389-26392 |
DT |
denotes |
the |
T10485 |
26393-26400 |
NN |
denotes |
percent |
T10486 |
26401-26403 |
IN |
denotes |
of |
T10487 |
26404-26411 |
NNP |
denotes |
Annexin |
T10488 |
26412-26416 |
NNP |
denotes |
V/PI |
T10489 |
26417-26425 |
JJ |
denotes |
negative |
T10490 |
26426-26431 |
NNS |
denotes |
cells |
T10491 |
26431-26432 |
. |
denotes |
. |
T10492 |
26433-26442 |
RB |
denotes |
Similarly |
T10493 |
26442-26443 |
, |
denotes |
, |
T10494 |
26444-26454 |
NN |
denotes |
expression |
T10495 |
26455-26457 |
IN |
denotes |
of |
T10496 |
26458-26465 |
JJ |
denotes |
WT-PKCα |
T10497 |
26466-26475 |
JJ |
denotes |
protected |
T10498 |
26476-26481 |
NNS |
denotes |
cells |
T10499 |
26482-26486 |
IN |
denotes |
from |
T10500 |
26487-26496 |
NN |
denotes |
apoptosis |
T10501 |
26496-26497 |
. |
denotes |
. |
T10502 |
26498-26500 |
IN |
denotes |
In |
T10503 |
26501-26509 |
NN |
denotes |
contrast |
T10504 |
26509-26510 |
, |
denotes |
, |
T10505 |
26511-26521 |
NN |
denotes |
expression |
T10506 |
26522-26524 |
IN |
denotes |
of |
T10507 |
26525-26532 |
NNP |
denotes |
KD-PKCα |
T10508 |
26533-26542 |
VBD |
denotes |
decreased |
T10509 |
26543-26556 |
JJ |
denotes |
M-CSF-induced |
T10510 |
26557-26561 |
NN |
denotes |
cell |
T10511 |
26562-26570 |
NN |
denotes |
survival |
T10512 |
26571-26572 |
-LRB- |
denotes |
( |
T10513 |
26572-26573 |
FW |
denotes |
p |
T10514 |
26573-26574 |
FW |
denotes |
< |
T10515 |
26574-26578 |
CD |
denotes |
0.01 |
T10516 |
26578-26579 |
-RRB- |
denotes |
) |
T10517 |
26580-26581 |
-LRB- |
denotes |
( |
T10518 |
26581-26587 |
NN |
denotes |
Figure |
T10519 |
26588-26590 |
NN |
denotes |
7C |
T10520 |
26590-26591 |
-RRB- |
denotes |
) |
T10521 |
26591-26592 |
. |
denotes |
. |
T10522 |
26593-26597 |
JJ |
denotes |
Next |
T10523 |
26597-26598 |
, |
denotes |
, |
T10524 |
26599-26601 |
PRP |
denotes |
we |
T10525 |
26602-26610 |
VBD |
denotes |
examined |
T10526 |
26611-26614 |
DT |
denotes |
the |
T10527 |
26615-26621 |
NN |
denotes |
effect |
T10528 |
26622-26624 |
IN |
denotes |
of |
T10529 |
26625-26635 |
VBG |
denotes |
expressing |
T10530 |
26636-26639 |
DT |
denotes |
the |
T10531 |
26640-26644 |
NNP |
denotes |
PKCα |
T10532 |
26645-26655 |
NNS |
denotes |
constructs |
T10533 |
26656-26658 |
IN |
denotes |
on |
T10534 |
26659-26664 |
JJ |
denotes |
NF-κB |
T10535 |
26665-26680 |
NN |
denotes |
phosphorylation |
T10536 |
26680-26681 |
. |
denotes |
. |
T10537 |
26682-26684 |
IN |
denotes |
As |
T10538 |
26685-26690 |
VBN |
denotes |
shown |
T10539 |
26691-26693 |
IN |
denotes |
in |
T10540 |
26694-26700 |
NN |
denotes |
Figure |
T10541 |
26701-26703 |
CD |
denotes |
7D |
T10542 |
26703-26704 |
, |
denotes |
, |
T10543 |
26705-26715 |
NN |
denotes |
expression |
T10544 |
26716-26718 |
IN |
denotes |
of |
T10545 |
26719-26726 |
NNP |
denotes |
KD-PKCα |
T10546 |
26727-26729 |
IN |
denotes |
in |
T10547 |
26730-26733 |
NNP |
denotes |
RAW |
T10548 |
26734-26739 |
CD |
denotes |
264.7 |
T10549 |
26740-26745 |
NNS |
denotes |
cells |
T10550 |
26746-26749 |
VBD |
denotes |
did |
T10551 |
26750-26753 |
RB |
denotes |
not |
T10552 |
26754-26760 |
VB |
denotes |
affect |
T10553 |
26761-26764 |
DT |
denotes |
the |
T10554 |
26765-26777 |
JJ |
denotes |
constitutive |
T10555 |
26778-26793 |
NN |
denotes |
phosphorylation |
T10556 |
26794-26796 |
IN |
denotes |
at |
T10557 |
26797-26803 |
NNP |
denotes |
Ser536 |
T10558 |
26804-26806 |
IN |
denotes |
of |
T10559 |
26807-26812 |
NNP |
denotes |
NF-κB |
T10560 |
26813-26816 |
CD |
denotes |
p65 |
T10561 |
26816-26817 |
, |
denotes |
, |
T10562 |
26818-26821 |
CC |
denotes |
but |
T10563 |
26822-26832 |
VBD |
denotes |
attenuated |
T10564 |
26833-26836 |
DT |
denotes |
the |
T10565 |
26837-26852 |
NN |
denotes |
phosphorylation |
T10566 |
26853-26855 |
IN |
denotes |
at |
T10567 |
26856-26862 |
NNP |
denotes |
Ser276 |
T10568 |
26862-26863 |
. |
denotes |
. |
T10569 |
26864-26874 |
NN |
denotes |
Expression |
T10570 |
26875-26877 |
IN |
denotes |
of |
T10571 |
26878-26885 |
NNP |
denotes |
WT-PKCα |
T10572 |
26886-26889 |
VBD |
denotes |
did |
T10573 |
26890-26893 |
RB |
denotes |
not |
T10574 |
26894-26900 |
NN |
denotes |
effect |
T10575 |
26901-26904 |
DT |
denotes |
the |
T10576 |
26905-26920 |
NN |
denotes |
phosphorylation |
T10577 |
26921-26923 |
IN |
denotes |
of |
T10578 |
26924-26930 |
DT |
denotes |
either |
T10579 |
26931-26938 |
NN |
denotes |
residue |
T10580 |
26939-26943 |
IN |
denotes |
with |
T10581 |
26944-26946 |
CC |
denotes |
or |
T10582 |
26947-26954 |
IN |
denotes |
without |
T10583 |
26955-26960 |
NNP |
denotes |
M-CSF |
T10584 |
26961-26972 |
NN |
denotes |
stimulation |
T10585 |
26972-26973 |
. |
denotes |
. |
T10586 |
26974-26979 |
DT |
denotes |
These |
T10587 |
26980-26992 |
NNS |
denotes |
observations |
T10588 |
26993-27004 |
VBP |
denotes |
demonstrate |
T10589 |
27005-27009 |
IN |
denotes |
that |
T10590 |
27010-27014 |
NNP |
denotes |
PKCα |
T10591 |
27015-27017 |
VBZ |
denotes |
is |
T10592 |
27018-27027 |
JJ |
denotes |
important |
T10593 |
27028-27030 |
IN |
denotes |
in |
T10594 |
27031-27046 |
JJ |
denotes |
M-CSF-regulated |
T10595 |
27047-27051 |
NN |
denotes |
cell |
T10596 |
27052-27060 |
NN |
denotes |
survival |
T10597 |
27061-27064 |
CC |
denotes |
and |
T10598 |
27065-27070 |
JJ |
denotes |
NF-κB |
T10599 |
27071-27081 |
NN |
denotes |
activation |
T10600 |
27082-27085 |
CC |
denotes |
and |
T10601 |
27086-27092 |
JJ |
denotes |
likely |
T10602 |
27093-27102 |
VBN |
denotes |
regulated |
T10603 |
27103-27110 |
IN |
denotes |
through |
T10604 |
27111-27126 |
NN |
denotes |
phosphorylation |
T10605 |
27127-27129 |
IN |
denotes |
of |
T10606 |
27130-27136 |
NNP |
denotes |
Ser276 |
T10607 |
27137-27139 |
IN |
denotes |
of |
T10608 |
27140-27145 |
NNP |
denotes |
NF-κB |
T10609 |
27146-27149 |
NNS |
denotes |
p65 |
T10610 |
27149-27150 |
. |
denotes |
. |
T10611 |
27151-27153 |
TO |
denotes |
To |
T10612 |
27154-27161 |
RBR |
denotes |
further |
T10613 |
27162-27170 |
VB |
denotes |
validate |
T10614 |
27171-27174 |
DT |
denotes |
the |
T10615 |
27175-27181 |
NN |
denotes |
impact |
T10616 |
27182-27186 |
WDT |
denotes |
that |
T10617 |
27187-27191 |
NNP |
denotes |
PKCα |
T10618 |
27192-27198 |
VBD |
denotes |
played |
T10619 |
27199-27201 |
IN |
denotes |
in |
T10620 |
27202-27215 |
JJ |
denotes |
M-CSF-induced |
T10621 |
27216-27221 |
NN |
denotes |
NF-κB |
T10622 |
27222-27237 |
JJ |
denotes |
transcriptional |
T10623 |
27238-27246 |
NN |
denotes |
activity |
T10624 |
27246-27247 |
, |
denotes |
, |
T10625 |
27248-27250 |
PRP |
denotes |
we |
T10626 |
27251-27255 |
JJ |
denotes |
next |
T10627 |
27256-27264 |
VBN |
denotes |
employed |
T10628 |
27265-27269 |
NNP |
denotes |
PKCα |
T10629 |
27270-27275 |
NNP |
denotes |
siRNA |
T10630 |
27276-27285 |
NN |
denotes |
treatment |
T10631 |
27286-27288 |
IN |
denotes |
of |
T10632 |
27289-27292 |
NNP |
denotes |
MDM |
T10633 |
27293-27295 |
CC |
denotes |
or |
T10634 |
27296-27299 |
NNP |
denotes |
RAW |
T10635 |
27300-27305 |
NNS |
denotes |
cells |
T10636 |
27305-27306 |
. |
denotes |
. |
T10637 |
27307-27308 |
DT |
denotes |
A |
T10638 |
27309-27313 |
NN |
denotes |
pool |
T10639 |
27314-27316 |
IN |
denotes |
of |
T10640 |
27317-27325 |
JJ |
denotes |
specific |
T10641 |
27326-27330 |
NNP |
denotes |
PKCα |
T10642 |
27331-27336 |
NNP |
denotes |
siRNA |
T10643 |
27337-27341 |
VBD |
denotes |
were |
T10644 |
27342-27353 |
VBN |
denotes |
transfected |
T10645 |
27354-27358 |
IN |
denotes |
into |
T10646 |
27359-27362 |
NNP |
denotes |
MDM |
T10647 |
27363-27365 |
CC |
denotes |
or |
T10648 |
27366-27369 |
NNP |
denotes |
Raw |
T10649 |
27370-27375 |
CD |
denotes |
264.7 |
T10650 |
27376-27381 |
NNS |
denotes |
cells |
T10651 |
27382-27384 |
IN |
denotes |
in |
T10652 |
27385-27388 |
DT |
denotes |
the |
T10653 |
27389-27397 |
NN |
denotes |
presence |
T10654 |
27398-27400 |
CC |
denotes |
or |
T10655 |
27401-27408 |
NN |
denotes |
absence |
T10656 |
27409-27411 |
CC |
denotes |
or |
T10657 |
27412-27417 |
NN |
denotes |
M-CSF |
T10658 |
27417-27418 |
. |
denotes |
. |
T10659 |
27419-27427 |
VBG |
denotes |
Reducing |
T10660 |
27428-27434 |
JJ |
denotes |
native |
T10661 |
27435-27439 |
NNP |
denotes |
PKCα |
T10662 |
27440-27450 |
NN |
denotes |
expression |
T10663 |
27451-27460 |
VBD |
denotes |
decreased |
T10664 |
27461-27474 |
JJ |
denotes |
M-CSF-induced |
T10665 |
27475-27480 |
NN |
denotes |
NF-κB |
T10666 |
27481-27496 |
JJ |
denotes |
transcriptional |
T10667 |
27497-27505 |
NN |
denotes |
activity |
T10668 |
27506-27508 |
IN |
denotes |
in |
T10669 |
27509-27513 |
DT |
denotes |
both |
T10670 |
27514-27517 |
NNP |
denotes |
MDM |
T10671 |
27518-27519 |
-LRB- |
denotes |
( |
T10672 |
27519-27525 |
NNP |
denotes |
Figure |
T10673 |
27526-27528 |
NNP |
denotes |
7E |
T10674 |
27528-27529 |
-RRB- |
denotes |
) |
T10675 |
27530-27531 |
-LRB- |
denotes |
( |
T10676 |
27531-27532 |
FW |
denotes |
p |
T10677 |
27533-27534 |
SYM |
denotes |
= |
T10678 |
27535-27540 |
CD |
denotes |
0.012 |
T10679 |
27540-27541 |
-RRB- |
denotes |
) |
T10680 |
27542-27545 |
CC |
denotes |
and |
T10681 |
27546-27549 |
NNP |
denotes |
Raw |
T10682 |
27550-27555 |
CD |
denotes |
264.7 |
T10683 |
27556-27561 |
NNS |
denotes |
cells |
T10684 |
27562-27563 |
-LRB- |
denotes |
( |
T10685 |
27563-27569 |
NN |
denotes |
Figure |
T10686 |
27570-27572 |
CD |
denotes |
7F |
T10687 |
27572-27573 |
-RRB- |
denotes |
) |
T10688 |
27574-27575 |
-LRB- |
denotes |
( |
T10689 |
27575-27576 |
FW |
denotes |
p |
T10690 |
27577-27578 |
SYM |
denotes |
= |
T10691 |
27579-27583 |
CD |
denotes |
0.01 |
T10692 |
27583-27584 |
-RRB- |
denotes |
) |
T10693 |
27584-27585 |
. |
denotes |
. |
T10694 |
27586-27588 |
PRP |
denotes |
We |
T10695 |
27589-27593 |
RB |
denotes |
also |
T10696 |
27594-27602 |
VBD |
denotes |
examined |
T10697 |
27603-27607 |
NN |
denotes |
cell |
T10698 |
27608-27616 |
NN |
denotes |
survival |
T10699 |
27617-27619 |
IN |
denotes |
of |
T10700 |
27620-27623 |
DT |
denotes |
the |
T10701 |
27624-27628 |
NNS |
denotes |
MDMs |
T10702 |
27629-27631 |
IN |
denotes |
by |
T10703 |
27632-27639 |
NNP |
denotes |
Annexin |
T10704 |
27640-27646 |
NNP |
denotes |
V-FITC |
T10705 |
27647-27650 |
CC |
denotes |
and |
T10706 |
27651-27653 |
NNP |
denotes |
PI |
T10707 |
27654-27662 |
VBG |
denotes |
staining |
T10708 |
27663-27668 |
IN |
denotes |
after |
T10709 |
27669-27673 |
NNP |
denotes |
PKCα |
T10710 |
27674-27679 |
NNP |
denotes |
siRNA |
T10711 |
27680-27692 |
NN |
denotes |
transfection |
T10712 |
27692-27693 |
. |
denotes |
. |
T10713 |
27694-27696 |
IN |
denotes |
As |
T10714 |
27697-27702 |
VBN |
denotes |
shown |
T10715 |
27703-27705 |
IN |
denotes |
in |
T10716 |
27706-27712 |
NN |
denotes |
Figure |
T10717 |
27713-27715 |
CD |
denotes |
7G |
T10718 |
27715-27716 |
, |
denotes |
, |
T10719 |
27717-27730 |
JJ |
denotes |
M-CSF-induced |
T10720 |
27731-27734 |
NNP |
denotes |
MDM |
T10721 |
27735-27743 |
NN |
denotes |
survival |
T10722 |
27744-27747 |
VBD |
denotes |
was |
T10723 |
27748-27755 |
VBN |
denotes |
reduced |
T10724 |
27756-27758 |
IN |
denotes |
in |
T10725 |
27759-27762 |
DT |
denotes |
the |
T10726 |
27763-27768 |
NNS |
denotes |
cells |
T10727 |
27769-27780 |
VBN |
denotes |
transfected |
T10728 |
27781-27785 |
IN |
denotes |
with |
T10729 |
27786-27790 |
NNP |
denotes |
PKCα |
T10730 |
27791-27796 |
NNP |
denotes |
siRNA |
T10731 |
27797-27805 |
VBN |
denotes |
compared |
T10732 |
27806-27810 |
IN |
denotes |
with |
T10733 |
27811-27816 |
NNS |
denotes |
cells |
T10734 |
27817-27828 |
VBN |
denotes |
transfected |
T10735 |
27829-27833 |
IN |
denotes |
with |
T10736 |
27834-27841 |
NN |
denotes |
control |
T10737 |
27842-27847 |
NNP |
denotes |
siRNA |
T10738 |
27848-27849 |
-LRB- |
denotes |
( |
T10739 |
27849-27850 |
FW |
denotes |
p |
T10740 |
27851-27852 |
SYM |
denotes |
= |
T10741 |
27853-27858 |
CD |
denotes |
0.047 |
T10742 |
27858-27859 |
-RRB- |
denotes |
) |
T10743 |
27859-27860 |
. |
denotes |
. |
T10744 |
27861-27863 |
IN |
denotes |
In |
T10745 |
27864-27870 |
NN |
denotes |
Figure |
T10746 |
27871-27873 |
CD |
denotes |
7H |
T10747 |
27873-27874 |
, |
denotes |
, |
T10748 |
27875-27877 |
PRP |
denotes |
we |
T10749 |
27878-27887 |
VBD |
denotes |
confirmed |
T10750 |
27888-27892 |
IN |
denotes |
that |
T10751 |
27893-27897 |
NNP |
denotes |
PKCα |
T10752 |
27898-27903 |
NNP |
denotes |
siRNA |
T10753 |
27904-27916 |
NN |
denotes |
transfection |
T10754 |
27917-27926 |
VBD |
denotes |
decreased |
T10755 |
27927-27931 |
NNP |
denotes |
PKCα |
T10756 |
27932-27939 |
NN |
denotes |
protein |
T10757 |
27940-27950 |
NN |
denotes |
expression |
T10758 |
27951-27953 |
IN |
denotes |
in |
T10759 |
27954-27958 |
DT |
denotes |
both |
T10760 |
27959-27962 |
NNP |
denotes |
MDM |
T10761 |
27963-27966 |
CC |
denotes |
and |
T10762 |
27967-27970 |
NNP |
denotes |
Raw |
T10763 |
27971-27976 |
CD |
denotes |
264.7 |
T10764 |
27977-27982 |
NNS |
denotes |
cells |
T10765 |
27982-27983 |
. |
denotes |
. |
T10766 |
27984-27987 |
PRP$ |
denotes |
Our |
T10767 |
27988-27995 |
NNS |
denotes |
results |
T10768 |
27996-28005 |
VBD |
denotes |
indicated |
T10769 |
28006-28010 |
IN |
denotes |
that |
T10770 |
28011-28015 |
NNP |
denotes |
PKCα |
T10771 |
28016-28025 |
VBD |
denotes |
regulated |
T10772 |
28026-28031 |
NNP |
denotes |
NF-κB |
T10773 |
28032-28042 |
NN |
denotes |
activation |
T10774 |
28043-28046 |
CC |
denotes |
and |
T10775 |
28047-28062 |
JJ |
denotes |
M-CSF-regulated |
T10776 |
28063-28067 |
NN |
denotes |
cell |
T10777 |
28068-28076 |
NN |
denotes |
survival |
T10778 |
28076-28077 |
. |
denotes |
. |
T12350 |
28079-28082 |
NNP |
denotes |
PKC |
T12351 |
28083-28085 |
VBZ |
denotes |
is |
T12352 |
28086-28095 |
JJ |
denotes |
Essential |
T12353 |
28096-28098 |
IN |
denotes |
in |
T12354 |
28099-28109 |
VBG |
denotes |
Regulating |
T12355 |
28110-28115 |
NNP |
denotes |
NF-κB |
T12356 |
28116-28124 |
NNP |
denotes |
Activity |
T12357 |
28125-28140 |
NNP |
denotes |
M-CSF-dependent |
T12358 |
28141-28144 |
NNP |
denotes |
PKC |
T12359 |
28145-28153 |
NN |
denotes |
activity |
T12360 |
28154-28165 |
VBD |
denotes |
facilitated |
T12361 |
28166-28171 |
NNP |
denotes |
NF-κB |
T12362 |
28172-28175 |
CD |
denotes |
p65 |
T12363 |
28176-28191 |
NN |
denotes |
phosphorylation |
T12364 |
28192-28194 |
IN |
denotes |
at |
T12365 |
28195-28201 |
NNP |
denotes |
Ser276 |
T12366 |
28202-28205 |
CC |
denotes |
but |
T12367 |
28206-28209 |
RB |
denotes |
not |
T12368 |
28210-28216 |
NNP |
denotes |
Ser536 |
T12369 |
28216-28217 |
. |
denotes |
. |
T12370 |
28218-28220 |
TO |
denotes |
To |
T12371 |
28221-28228 |
VB |
denotes |
confirm |
T12372 |
28229-28232 |
DT |
denotes |
the |
T12373 |
28233-28237 |
NN |
denotes |
role |
T12374 |
28238-28240 |
IN |
denotes |
of |
T12375 |
28241-28244 |
NNP |
denotes |
PKC |
T12376 |
28245-28248 |
CC |
denotes |
and |
T12377 |
28249-28252 |
CD |
denotes |
p65 |
T12378 |
28253-28259 |
NNP |
denotes |
Ser276 |
T12379 |
28260-28275 |
NN |
denotes |
phosphorylation |
T12380 |
28276-28278 |
IN |
denotes |
on |
T12381 |
28279-28284 |
JJ |
denotes |
NF-κB |
T12382 |
28285-28293 |
NN |
denotes |
activity |
T12383 |
28293-28294 |
, |
denotes |
, |
T12384 |
28295-28297 |
PRP |
denotes |
we |
T12385 |
28298-28312 |
VBD |
denotes |
co-transfected |
T12386 |
28313-28316 |
DT |
denotes |
the |
T12387 |
28317-28327 |
NNP |
denotes |
NF-κB-SEAP |
T12388 |
28328-28337 |
VBP |
denotes |
construct |
T12389 |
28338-28342 |
IN |
denotes |
with |
T12390 |
28343-28349 |
DT |
denotes |
either |
T12391 |
28350-28352 |
NNP |
denotes |
WT |
T12392 |
28353-28358 |
NNP |
denotes |
NF-κB |
T12393 |
28359-28362 |
CD |
denotes |
p65 |
T12394 |
28363-28365 |
CC |
denotes |
or |
T12395 |
28366-28371 |
NNP |
denotes |
NF-κB |
T12396 |
28372-28375 |
CD |
denotes |
p65 |
T12397 |
28376-28382 |
NNP |
denotes |
276S/A |
T12398 |
28383-28393 |
NNS |
denotes |
constructs |
T12399 |
28394-28396 |
IN |
denotes |
in |
T12400 |
28397-28400 |
NNP |
denotes |
Raw |
T12401 |
28401-28406 |
CD |
denotes |
264.7 |
T12402 |
28407-28412 |
NNS |
denotes |
cells |
T12403 |
28412-28413 |
, |
denotes |
, |
T12404 |
28414-28418 |
RB |
denotes |
then |
T12405 |
28419-28426 |
VBD |
denotes |
treated |
T12406 |
28427-28432 |
NNS |
denotes |
cells |
T12407 |
28433-28437 |
IN |
denotes |
with |
T12408 |
28438-28441 |
DT |
denotes |
the |
T12409 |
28442-28445 |
NNP |
denotes |
PKC |
T12410 |
28446-28455 |
NN |
denotes |
inhibitor |
T12411 |
28456-28466 |
NN |
denotes |
Ro-31-8220 |
T12412 |
28467-28469 |
IN |
denotes |
in |
T12413 |
28470-28473 |
DT |
denotes |
the |
T12414 |
28474-28481 |
NN |
denotes |
absence |
T12415 |
28482-28484 |
CC |
denotes |
or |
T12416 |
28485-28494 |
NNS |
denotes |
presences |
T12417 |
28495-28497 |
IN |
denotes |
of |
T12418 |
28498-28503 |
NNP |
denotes |
M-CSF |
T12419 |
28503-28504 |
. |
denotes |
. |
T12420 |
28505-28507 |
IN |
denotes |
As |
T12421 |
28508-28516 |
VBN |
denotes |
expected |
T12422 |
28517-28519 |
IN |
denotes |
in |
T12423 |
28520-28525 |
NNS |
denotes |
cells |
T12424 |
28526-28537 |
VBN |
denotes |
transfected |
T12425 |
28538-28542 |
IN |
denotes |
with |
T12426 |
28543-28549 |
NN |
denotes |
vector |
T12427 |
28550-28557 |
NN |
denotes |
control |
T12428 |
28557-28558 |
, |
denotes |
, |
T12429 |
28559-28569 |
VBG |
denotes |
inhibiting |
T12430 |
28570-28573 |
NNP |
denotes |
PKC |
T12431 |
28574-28581 |
VBD |
denotes |
reduced |
T12432 |
28582-28598 |
JJ |
denotes |
M-CSF-stimulated |
T12433 |
28599-28604 |
NN |
denotes |
NF-κB |
T12434 |
28605-28613 |
NN |
denotes |
activity |
T12435 |
28614-28622 |
VBN |
denotes |
compared |
T12436 |
28623-28625 |
TO |
denotes |
to |
T12437 |
28626-28631 |
NNS |
denotes |
cells |
T12438 |
28632-28639 |
VBN |
denotes |
treated |
T12439 |
28640-28644 |
IN |
denotes |
with |
T12440 |
28645-28650 |
NNP |
denotes |
M-CSF |
T12441 |
28651-28654 |
CC |
denotes |
and |
T12442 |
28655-28658 |
DT |
denotes |
the |
T12443 |
28659-28666 |
NN |
denotes |
vehicle |
T12444 |
28667-28671 |
NNP |
denotes |
DMSO |
T12445 |
28672-28673 |
-LRB- |
denotes |
( |
T12446 |
28673-28674 |
FW |
denotes |
p |
T12447 |
28675-28676 |
SYM |
denotes |
= |
T12448 |
28677-28682 |
CD |
denotes |
0.001 |
T12449 |
28682-28683 |
-RRB- |
denotes |
) |
T12450 |
28684-28685 |
-LRB- |
denotes |
( |
T12451 |
28685-28691 |
NN |
denotes |
Figure |
T12452 |
28692-28694 |
NN |
denotes |
8A |
T12453 |
28694-28695 |
-RRB- |
denotes |
) |
T12454 |
28695-28696 |
. |
denotes |
. |
T12455 |
28697-28699 |
IN |
denotes |
In |
T12456 |
28700-28708 |
NN |
denotes |
contrast |
T12457 |
28708-28709 |
, |
denotes |
, |
T12458 |
28710-28720 |
VBG |
denotes |
expressing |
T12459 |
28721-28723 |
NNP |
denotes |
WT |
T12460 |
28724-28729 |
NNP |
denotes |
NF-κB |
T12461 |
28730-28733 |
NNS |
denotes |
p65 |
T12462 |
28734-28735 |
-LRB- |
denotes |
( |
T12463 |
28735-28738 |
CD |
denotes |
p65 |
T12464 |
28739-28741 |
NNP |
denotes |
WT |
T12465 |
28741-28742 |
-RRB- |
denotes |
) |
T12466 |
28743-28752 |
VBD |
denotes |
increased |
T12467 |
28753-28758 |
JJ |
denotes |
NF-κB |
T12468 |
28759-28767 |
NN |
denotes |
activity |
T12469 |
28767-28768 |
, |
denotes |
, |
T12470 |
28769-28774 |
IN |
denotes |
while |
T12471 |
28775-28778 |
DT |
denotes |
the |
T12472 |
28779-28786 |
JJ |
denotes |
general |
T12473 |
28787-28790 |
NNP |
denotes |
PKC |
T12474 |
28791-28800 |
NN |
denotes |
inhibitor |
T12475 |
28801-28811 |
NN |
denotes |
Ro-31-8220 |
T12476 |
28812-28821 |
VBD |
denotes |
decreased |
T12477 |
28822-28826 |
DT |
denotes |
this |
T12478 |
28827-28832 |
JJ |
denotes |
NF-κB |
T12479 |
28833-28841 |
NN |
denotes |
activity |
T12480 |
28842-28843 |
-LRB- |
denotes |
( |
T12481 |
28843-28844 |
FW |
denotes |
p |
T12482 |
28845-28846 |
SYM |
denotes |
= |
T12483 |
28847-28852 |
CD |
denotes |
0.001 |
T12484 |
28852-28853 |
-RRB- |
denotes |
) |
T12485 |
28853-28854 |
. |
denotes |
. |
T12486 |
28855-28862 |
RB |
denotes |
Notably |
T12487 |
28862-28863 |
, |
denotes |
, |
T12488 |
28864-28867 |
DT |
denotes |
the |
T12489 |
28868-28880 |
NN |
denotes |
introduction |
T12490 |
28881-28883 |
IN |
denotes |
of |
T12491 |
28884-28889 |
NNP |
denotes |
NF-κB |
T12492 |
28890-28893 |
CD |
denotes |
p65 |
T12493 |
28894-28897 |
CD |
denotes |
276 |
T12494 |
28898-28901 |
NNP |
denotes |
S/A |
T12495 |
28902-28911 |
VB |
denotes |
construct |
T12496 |
28912-28925 |
RB |
denotes |
significantly |
T12497 |
28926-28933 |
VBN |
denotes |
reduced |
T12498 |
28934-28939 |
JJ |
denotes |
NF-κB |
T12499 |
28940-28948 |
NN |
denotes |
activity |
T12500 |
28949-28957 |
VBN |
denotes |
compared |
T12501 |
28958-28962 |
IN |
denotes |
with |
T12502 |
28963-28966 |
DT |
denotes |
the |
T12503 |
28967-28969 |
NNP |
denotes |
WT |
T12504 |
28970-28975 |
NNP |
denotes |
NF-κB |
T12505 |
28976-28979 |
NNS |
denotes |
p65 |
T12506 |
28980-28989 |
VBP |
denotes |
construct |
T12507 |
28990-28991 |
-LRB- |
denotes |
( |
T12508 |
28991-28992 |
FW |
denotes |
p |
T12509 |
28993-28994 |
SYM |
denotes |
= |
T12510 |
28995-29000 |
CD |
denotes |
0.005 |
T12511 |
29000-29001 |
-RRB- |
denotes |
) |
T12512 |
29002-29005 |
CC |
denotes |
and |
T12513 |
29006-29011 |
NNP |
denotes |
M-CSF |
T12514 |
29012-29021 |
NN |
denotes |
treatment |
T12515 |
29022-29025 |
VBD |
denotes |
was |
T12516 |
29026-29032 |
JJ |
denotes |
unable |
T12517 |
29033-29035 |
TO |
denotes |
to |
T12518 |
29036-29044 |
VB |
denotes |
overcome |
T12519 |
29045-29049 |
DT |
denotes |
this |
T12520 |
29050-29060 |
NN |
denotes |
inhibition |
T12521 |
29060-29061 |
. |
denotes |
. |
T26362 |
29106-29111 |
NNP |
denotes |
NF-κB |
T26363 |
29112-29115 |
CD |
denotes |
p65 |
T26364 |
29116-29122 |
NNP |
denotes |
Ser276 |
T26365 |
29123-29125 |
VBZ |
denotes |
is |
T26366 |
29126-29135 |
JJ |
denotes |
essential |
T26367 |
29136-29138 |
IN |
denotes |
in |
T26368 |
29139-29149 |
VBG |
denotes |
regulating |
T26369 |
29150-29155 |
JJ |
denotes |
NF-κB |
T26370 |
29156-29164 |
NN |
denotes |
activity |
T26371 |
29164-29165 |
. |
denotes |
. |
T26372 |
29166-29167 |
-LRB- |
denotes |
( |
T26373 |
29167-29168 |
NNP |
denotes |
A |
T26374 |
29168-29169 |
-RRB- |
denotes |
) |
T26375 |
29170-29173 |
NNP |
denotes |
Raw |
T26376 |
29174-29179 |
CD |
denotes |
264.7 |
T26377 |
29180-29184 |
NN |
denotes |
cell |
T26378 |
29185-29189 |
NN |
denotes |
line |
T26379 |
29190-29193 |
VBD |
denotes |
was |
T26380 |
29194-29205 |
RB |
denotes |
transiently |
T26381 |
29206-29217 |
VBN |
denotes |
transfected |
T26382 |
29218-29222 |
IN |
denotes |
with |
T26383 |
29223-29234 |
JJ |
denotes |
pNF-κB-SEAP |
T26384 |
29235-29240 |
IN |
denotes |
along |
T26385 |
29241-29245 |
IN |
denotes |
with |
T26386 |
29246-29251 |
JJ |
denotes |
empty |
T26387 |
29252-29258 |
NN |
denotes |
vector |
T26388 |
29259-29261 |
CC |
denotes |
or |
T26389 |
29262-29269 |
NN |
denotes |
plasmid |
T26390 |
29270-29278 |
VBG |
denotes |
encoding |
T26391 |
29279-29285 |
CC |
denotes |
either |
T26392 |
29286-29291 |
NNP |
denotes |
NF-κB |
T26393 |
29292-29295 |
CD |
denotes |
p65 |
T26394 |
29296-29298 |
NNP |
denotes |
WT |
T26395 |
29299-29301 |
CC |
denotes |
or |
T26396 |
29302-29307 |
NNP |
denotes |
NF-κB |
T26397 |
29308-29311 |
CD |
denotes |
p65 |
T26398 |
29312-29318 |
NNP |
denotes |
276S/A |
T26399 |
29318-29319 |
. |
denotes |
. |
T26400 |
29320-29323 |
DT |
denotes |
The |
T26401 |
29324-29329 |
NNS |
denotes |
cells |
T26402 |
29330-29334 |
VBD |
denotes |
were |
T26403 |
29335-29346 |
VBN |
denotes |
transfected |
T26404 |
29347-29350 |
IN |
denotes |
for |
T26405 |
29351-29356 |
CD |
denotes |
18-24 |
T26406 |
29357-29362 |
NNS |
denotes |
hours |
T26407 |
29362-29363 |
, |
denotes |
, |
T26408 |
29364-29369 |
NN |
denotes |
serum |
T26409 |
29370-29377 |
VBD |
denotes |
starved |
T26410 |
29378-29381 |
IN |
denotes |
for |
T26411 |
29382-29383 |
CD |
denotes |
4 |
T26412 |
29384-29389 |
NNS |
denotes |
hours |
T26413 |
29389-29390 |
, |
denotes |
, |
T26414 |
29391-29394 |
CC |
denotes |
and |
T26415 |
29395-29399 |
RB |
denotes |
then |
T26416 |
29400-29409 |
VBN |
denotes |
incubated |
T26417 |
29410-29414 |
IN |
denotes |
with |
T26418 |
29415-29417 |
CD |
denotes |
10 |
T26419 |
29418-29420 |
NN |
denotes |
µM |
T26420 |
29421-29423 |
IN |
denotes |
of |
T26421 |
29424-29434 |
NN |
denotes |
Ro-31-8220 |
T26422 |
29435-29438 |
IN |
denotes |
for |
T26423 |
29439-29441 |
CD |
denotes |
30 |
T26424 |
29442-29449 |
NNS |
denotes |
minutes |
T26425 |
29450-29455 |
RB |
denotes |
prior |
T26426 |
29456-29458 |
TO |
denotes |
to |
T26427 |
29459-29468 |
NN |
denotes |
treatment |
T26428 |
29469-29473 |
IN |
denotes |
with |
T26429 |
29474-29477 |
CD |
denotes |
100 |
T26430 |
29478-29483 |
NN |
denotes |
ng/ml |
T26431 |
29484-29486 |
IN |
denotes |
of |
T26432 |
29487-29492 |
NNP |
denotes |
M-CSF |
T26433 |
29493-29496 |
IN |
denotes |
for |
T26434 |
29497-29498 |
CD |
denotes |
2 |
T26435 |
29499-29504 |
NNS |
denotes |
hours |
T26436 |
29505-29508 |
CC |
denotes |
and |
T26437 |
29509-29513 |
NNP |
denotes |
SEAP |
T26438 |
29514-29523 |
NN |
denotes |
secretion |
T26439 |
29524-29526 |
IN |
denotes |
in |
T26440 |
29527-29530 |
DT |
denotes |
the |
T26441 |
29531-29537 |
NN |
denotes |
medium |
T26442 |
29538-29541 |
VBD |
denotes |
was |
T26443 |
29542-29550 |
VBN |
denotes |
measured |
T26444 |
29550-29551 |
. |
denotes |
. |
T26445 |
29552-29553 |
-LRB- |
denotes |
( |
T26446 |
29553-29554 |
NNP |
denotes |
B |
T26447 |
29554-29555 |
-RRB- |
denotes |
) |
T26448 |
29556-29561 |
NNP |
denotes |
NF-κB |
T26449 |
29562-29565 |
NNS |
denotes |
p65 |
T26450 |
29565-29566 |
VBP |
denotes |
− |
T26451 |
29566-29567 |
CD |
denotes |
/ |
T26452 |
29567-29568 |
CD |
denotes |
− |
T26453 |
29569-29573 |
NN |
denotes |
cell |
T26454 |
29574-29578 |
NN |
denotes |
line |
T26455 |
29579-29582 |
VBD |
denotes |
was |
T26456 |
29583-29594 |
RB |
denotes |
transiently |
T26457 |
29595-29606 |
VBN |
denotes |
transfected |
T26458 |
29607-29611 |
IN |
denotes |
with |
T26459 |
29612-29623 |
JJ |
denotes |
pNF-κB-SEAP |
T26460 |
29624-29629 |
IN |
denotes |
along |
T26461 |
29630-29634 |
IN |
denotes |
with |
T26462 |
29635-29640 |
JJ |
denotes |
empty |
T26463 |
29641-29647 |
NN |
denotes |
vector |
T26464 |
29648-29650 |
CC |
denotes |
or |
T26465 |
29651-29658 |
NN |
denotes |
plasmid |
T26466 |
29659-29667 |
VBG |
denotes |
encoding |
T26467 |
29668-29674 |
CC |
denotes |
either |
T26468 |
29675-29680 |
NNP |
denotes |
NF-κB |
T26469 |
29681-29684 |
CD |
denotes |
p65 |
T26470 |
29685-29687 |
NNP |
denotes |
WT |
T26471 |
29687-29688 |
, |
denotes |
, |
T26472 |
29689-29694 |
NNP |
denotes |
NF-κB |
T26473 |
29695-29698 |
CD |
denotes |
p65 |
T26474 |
29699-29705 |
NNP |
denotes |
276S/A |
T26475 |
29705-29706 |
, |
denotes |
, |
T26476 |
29707-29709 |
CC |
denotes |
or |
T26477 |
29710-29715 |
NNP |
denotes |
NF-κB |
T26478 |
29716-29719 |
CD |
denotes |
p65 |
T26479 |
29720-29726 |
NNP |
denotes |
536S/A |
T26480 |
29726-29727 |
. |
denotes |
. |
T26481 |
29728-29731 |
DT |
denotes |
The |
T26482 |
29732-29737 |
NNS |
denotes |
cells |
T26483 |
29738-29742 |
VBD |
denotes |
were |
T26484 |
29743-29751 |
VBN |
denotes |
cultured |
T26485 |
29752-29755 |
IN |
denotes |
for |
T26486 |
29756-29758 |
CD |
denotes |
24 |
T26487 |
29759-29764 |
NNS |
denotes |
hours |
T26488 |
29765-29768 |
CC |
denotes |
and |
T26489 |
29769-29773 |
RB |
denotes |
then |
T26490 |
29774-29779 |
NN |
denotes |
serum |
T26491 |
29780-29787 |
VBD |
denotes |
starved |
T26492 |
29788-29791 |
IN |
denotes |
for |
T26493 |
29792-29793 |
CD |
denotes |
4 |
T26494 |
29794-29799 |
NNS |
denotes |
hours |
T26495 |
29799-29800 |
. |
denotes |
. |
T26496 |
29801-29806 |
NNS |
denotes |
Cells |
T26497 |
29807-29811 |
VBD |
denotes |
were |
T26498 |
29812-29816 |
RB |
denotes |
then |
T26499 |
29817-29826 |
VBN |
denotes |
incubated |
T26500 |
29827-29829 |
IN |
denotes |
in |
T26501 |
29830-29835 |
JJ |
denotes |
fresh |
T26502 |
29836-29840 |
NNP |
denotes |
DMEM |
T26503 |
29841-29847 |
NN |
denotes |
medium |
T26504 |
29848-29851 |
IN |
denotes |
for |
T26505 |
29852-29853 |
CD |
denotes |
2 |
T26506 |
29854-29859 |
NNS |
denotes |
hours |
T26507 |
29860-29863 |
CC |
denotes |
and |
T26508 |
29864-29868 |
NNP |
denotes |
SEAP |
T26509 |
29869-29878 |
NN |
denotes |
secretion |
T26510 |
29879-29881 |
IN |
denotes |
in |
T26511 |
29882-29885 |
DT |
denotes |
the |
T26512 |
29886-29892 |
NN |
denotes |
medium |
T26513 |
29893-29896 |
VBD |
denotes |
was |
T26514 |
29897-29905 |
VBN |
denotes |
measured |
T26515 |
29905-29906 |
. |
denotes |
. |
T26516 |
29907-29910 |
DT |
denotes |
The |
T26517 |
29911-29918 |
NNS |
denotes |
results |
T26518 |
29919-29924 |
VBN |
denotes |
shown |
T26519 |
29925-29928 |
VBP |
denotes |
are |
T26520 |
29929-29933 |
VB |
denotes |
fold |
T26521 |
29934-29940 |
NN |
denotes |
change |
T26522 |
29941-29945 |
IN |
denotes |
over |
T26523 |
29946-29951 |
JJ |
denotes |
empty |
T26524 |
29952-29958 |
NN |
denotes |
vector |
T26525 |
29959-29960 |
NN |
denotes |
+ |
T26526 |
29961-29970 |
NN |
denotes |
pTAL-SEAP |
T26527 |
29970-29971 |
. |
denotes |
. |
T26528 |
29972-29973 |
-LRB- |
denotes |
( |
T26529 |
29973-29974 |
NNP |
denotes |
C |
T26530 |
29974-29975 |
-RRB- |
denotes |
) |
T26531 |
29976-29981 |
NNP |
denotes |
NF-κB |
T26532 |
29982-29985 |
NNS |
denotes |
p65 |
T26533 |
29985-29986 |
VBP |
denotes |
− |
T26534 |
29986-29987 |
CD |
denotes |
/ |
T26535 |
29987-29988 |
CD |
denotes |
− |
T26536 |
29989-29993 |
NN |
denotes |
cell |
T26537 |
29994-29998 |
NN |
denotes |
line |
T26538 |
29999-30002 |
VBD |
denotes |
was |
T26539 |
30003-30014 |
RB |
denotes |
transiently |
T26540 |
30015-30026 |
VBN |
denotes |
transfected |
T26541 |
30027-30031 |
IN |
denotes |
with |
T26542 |
30032-30043 |
JJ |
denotes |
pNF-κB-SEAP |
T26543 |
30044-30048 |
IN |
denotes |
with |
T26544 |
30049-30055 |
DT |
denotes |
either |
T26545 |
30056-30061 |
JJ |
denotes |
empty |
T26546 |
30062-30068 |
NN |
denotes |
vector |
T26547 |
30069-30071 |
CC |
denotes |
or |
T26548 |
30072-30079 |
NN |
denotes |
plasmid |
T26549 |
30080-30088 |
VBG |
denotes |
encoding |
T26550 |
30089-30095 |
CC |
denotes |
either |
T26551 |
30096-30101 |
NNP |
denotes |
NF-κB |
T26552 |
30102-30105 |
CD |
denotes |
p65 |
T26553 |
30106-30108 |
NNP |
denotes |
WT |
T26554 |
30109-30111 |
CC |
denotes |
or |
T26555 |
30112-30117 |
NNP |
denotes |
NF-κB |
T26556 |
30118-30121 |
CD |
denotes |
p65 |
T26557 |
30122-30128 |
NNP |
denotes |
276S/A |
T26558 |
30128-30129 |
. |
denotes |
. |
T26559 |
30130-30133 |
DT |
denotes |
The |
T26560 |
30134-30139 |
NNS |
denotes |
cells |
T26561 |
30140-30144 |
VBD |
denotes |
were |
T26562 |
30145-30156 |
VBN |
denotes |
transfected |
T26563 |
30157-30160 |
IN |
denotes |
for |
T26564 |
30161-30163 |
CD |
denotes |
24 |
T26565 |
30164-30169 |
NNS |
denotes |
hours |
T26566 |
30170-30173 |
CC |
denotes |
and |
T26567 |
30174-30179 |
NN |
denotes |
serum |
T26568 |
30180-30187 |
VBD |
denotes |
starved |
T26569 |
30188-30191 |
IN |
denotes |
for |
T26570 |
30192-30193 |
CD |
denotes |
4 |
T26571 |
30194-30199 |
NNS |
denotes |
hours |
T26572 |
30199-30200 |
, |
denotes |
, |
T26573 |
30201-30204 |
CC |
denotes |
and |
T26574 |
30205-30209 |
RB |
denotes |
then |
T26575 |
30210-30219 |
VBN |
denotes |
incubated |
T26576 |
30220-30224 |
IN |
denotes |
with |
T26577 |
30225-30227 |
CD |
denotes |
10 |
T26578 |
30228-30230 |
NN |
denotes |
µM |
T26579 |
30231-30233 |
IN |
denotes |
of |
T26580 |
30234-30244 |
NN |
denotes |
Ro-31-8220 |
T26581 |
30245-30248 |
IN |
denotes |
for |
T26582 |
30249-30251 |
CD |
denotes |
30 |
T26583 |
30252-30259 |
NNS |
denotes |
minutes |
T26584 |
30260-30265 |
RB |
denotes |
prior |
T26585 |
30266-30268 |
TO |
denotes |
to |
T26586 |
30269-30278 |
NN |
denotes |
treatment |
T26587 |
30279-30283 |
IN |
denotes |
with |
T26588 |
30284-30286 |
CD |
denotes |
10 |
T26589 |
30287-30292 |
NN |
denotes |
ng/ml |
T26590 |
30293-30295 |
IN |
denotes |
of |
T26591 |
30296-30300 |
NNP |
denotes |
TNFα |
T26592 |
30300-30301 |
. |
denotes |
. |
T26593 |
30302-30305 |
DT |
denotes |
The |
T26594 |
30306-30317 |
JJ |
denotes |
supernatant |
T26595 |
30318-30322 |
VBD |
denotes |
were |
T26596 |
30323-30332 |
VBN |
denotes |
collected |
T26597 |
30333-30338 |
IN |
denotes |
after |
T26598 |
30339-30340 |
CD |
denotes |
2 |
T26599 |
30341-30346 |
NNS |
denotes |
hours |
T26600 |
30347-30349 |
IN |
denotes |
of |
T26601 |
30350-30359 |
NN |
denotes |
treatment |
T26602 |
30360-30363 |
CC |
denotes |
and |
T26603 |
30364-30368 |
NNP |
denotes |
SEAP |
T26604 |
30369-30378 |
NN |
denotes |
secretion |
T26605 |
30379-30381 |
IN |
denotes |
in |
T26606 |
30382-30385 |
DT |
denotes |
the |
T26607 |
30386-30392 |
NN |
denotes |
medium |
T26608 |
30393-30396 |
VBD |
denotes |
was |
T26609 |
30397-30405 |
VBN |
denotes |
measured |
T26610 |
30405-30406 |
. |
denotes |
. |
T26611 |
30407-30410 |
DT |
denotes |
The |
T26612 |
30411-30418 |
NNS |
denotes |
results |
T26613 |
30419-30424 |
VBN |
denotes |
shown |
T26614 |
30425-30428 |
VBP |
denotes |
are |
T26615 |
30429-30432 |
DT |
denotes |
the |
T26616 |
30433-30437 |
VBP |
denotes |
fold |
T26617 |
30438-30444 |
NN |
denotes |
change |
T26618 |
30445-30449 |
IN |
denotes |
over |
T26619 |
30450-30455 |
JJ |
denotes |
empty |
T26620 |
30456-30462 |
NN |
denotes |
vector |
T26621 |
30463-30464 |
NN |
denotes |
+ |
T26622 |
30465-30476 |
NN |
denotes |
pNF-κB-SEAP |
T26623 |
30476-30477 |
. |
denotes |
. |
T26624 |
30478-30482 |
NNP |
denotes |
Data |
T26625 |
30483-30488 |
VBN |
denotes |
shown |
T26626 |
30489-30492 |
VBP |
denotes |
are |
T26627 |
30493-30497 |
JJ |
denotes |
mean |
T26628 |
30498-30499 |
NN |
denotes |
± |
T26629 |
30500-30505 |
NNP |
denotes |
S.E.M |
T26630 |
30506-30509 |
IN |
denotes |
for |
T26631 |
30510-30512 |
IN |
denotes |
at |
T26632 |
30513-30518 |
JJS |
denotes |
least |
T26633 |
30519-30524 |
CD |
denotes |
three |
T26634 |
30525-30536 |
JJ |
denotes |
independent |
T26635 |
30537-30548 |
NNS |
denotes |
experiments |
T26636 |
30549-30558 |
VBN |
denotes |
performed |
T26637 |
30559-30561 |
IN |
denotes |
in |
T26638 |
30562-30571 |
VB |
denotes |
duplicate |
T26639 |
30571-30572 |
. |
denotes |
. |
T12522 |
30575-30586 |
RB |
denotes |
Furthermore |
T12523 |
30586-30587 |
, |
denotes |
, |
T12524 |
30588-30590 |
PRP |
denotes |
we |
T12525 |
30591-30605 |
VBD |
denotes |
co-transfected |
T12526 |
30606-30609 |
DT |
denotes |
the |
T12527 |
30610-30620 |
NNP |
denotes |
NF-κB-SEAP |
T12528 |
30621-30630 |
VBP |
denotes |
construct |
T12529 |
30631-30636 |
IN |
denotes |
along |
T12530 |
30637-30641 |
IN |
denotes |
with |
T12531 |
30642-30648 |
CC |
denotes |
either |
T12532 |
30649-30652 |
DT |
denotes |
the |
T12533 |
30653-30655 |
NNP |
denotes |
WT |
T12534 |
30656-30661 |
NNP |
denotes |
NF-κB |
T12535 |
30662-30665 |
NNS |
denotes |
p65 |
T12536 |
30665-30666 |
, |
denotes |
, |
T12537 |
30667-30672 |
NNP |
denotes |
NF-κB |
T12538 |
30673-30676 |
CD |
denotes |
p65 |
T12539 |
30677-30683 |
NNP |
denotes |
276S/A |
T12540 |
30684-30686 |
CC |
denotes |
or |
T12541 |
30687-30692 |
NNP |
denotes |
NF-κB |
T12542 |
30693-30696 |
CD |
denotes |
p65 |
T12543 |
30697-30703 |
NNP |
denotes |
536S/A |
T12544 |
30704-30714 |
NNS |
denotes |
constructs |
T12545 |
30715-30719 |
IN |
denotes |
into |
T12546 |
30720-30721 |
DT |
denotes |
a |
T12547 |
30722-30727 |
NNP |
denotes |
NF-κB |
T12548 |
30728-30731 |
CD |
denotes |
p65 |
T12549 |
30731-30732 |
FW |
denotes |
− |
T12550 |
30732-30733 |
FW |
denotes |
/ |
T12551 |
30733-30734 |
FW |
denotes |
− |
T12552 |
30735-30741 |
FW |
denotes |
murine |
T12553 |
30742-30752 |
FW |
denotes |
fibroblast |
T12554 |
30753-30757 |
NN |
denotes |
cell |
T12555 |
30758-30762 |
NN |
denotes |
line |
T12556 |
30763-30766 |
CC |
denotes |
and |
T12557 |
30767-30775 |
VBN |
denotes |
measured |
T12558 |
30776-30781 |
JJ |
denotes |
NF-κB |
T12559 |
30782-30790 |
NN |
denotes |
activity |
T12560 |
30790-30791 |
. |
denotes |
. |
T12561 |
30792-30794 |
IN |
denotes |
As |
T12562 |
30795-30804 |
VBN |
denotes |
predicted |
T12563 |
30804-30805 |
, |
denotes |
, |
T12564 |
30806-30816 |
NN |
denotes |
expression |
T12565 |
30817-30819 |
IN |
denotes |
of |
T12566 |
30820-30822 |
NNP |
denotes |
WT |
T12567 |
30823-30828 |
NNP |
denotes |
NF-κB |
T12568 |
30829-30832 |
NNS |
denotes |
p65 |
T12569 |
30833-30834 |
-LRB- |
denotes |
( |
T12570 |
30834-30837 |
CD |
denotes |
p65 |
T12571 |
30838-30840 |
NNP |
denotes |
WT |
T12572 |
30840-30841 |
-RRB- |
denotes |
) |
T12573 |
30842-30844 |
IN |
denotes |
in |
T12574 |
30845-30850 |
NNP |
denotes |
NF-κB |
T12575 |
30851-30854 |
CD |
denotes |
p65 |
T12576 |
30854-30855 |
CD |
denotes |
− |
T12577 |
30855-30856 |
NN |
denotes |
/ |
T12578 |
30856-30857 |
NN |
denotes |
− |
T12579 |
30858-30862 |
NN |
denotes |
cell |
T12580 |
30863-30867 |
NN |
denotes |
line |
T12581 |
30868-30882 |
RB |
denotes |
constitutively |
T12582 |
30883-30892 |
VBD |
denotes |
activated |
T12583 |
30893-30898 |
NNP |
denotes |
NF-κB |
T12584 |
30899-30907 |
VBN |
denotes |
compared |
T12585 |
30908-30910 |
TO |
denotes |
to |
T12586 |
30911-30916 |
NNS |
denotes |
cells |
T12587 |
30917-30928 |
VBN |
denotes |
transfected |
T12588 |
30929-30933 |
IN |
denotes |
with |
T12589 |
30934-30940 |
NN |
denotes |
vector |
T12590 |
30941-30948 |
NN |
denotes |
control |
T12591 |
30949-30956 |
IN |
denotes |
without |
T12592 |
30957-30960 |
DT |
denotes |
any |
T12593 |
30961-30972 |
NN |
denotes |
stimulation |
T12594 |
30973-30974 |
-LRB- |
denotes |
( |
T12595 |
30974-30980 |
NN |
denotes |
Figure |
T12596 |
30981-30983 |
NN |
denotes |
8B |
T12597 |
30983-30984 |
-RRB- |
denotes |
) |
T12598 |
30984-30985 |
. |
denotes |
. |
T12599 |
30986-30988 |
IN |
denotes |
In |
T12600 |
30989-30999 |
NN |
denotes |
comparison |
T12601 |
30999-31000 |
, |
denotes |
, |
T12602 |
31001-31013 |
VBG |
denotes |
transfecting |
T12603 |
31014-31017 |
DT |
denotes |
the |
T12604 |
31018-31023 |
NNP |
denotes |
NF-κB |
T12605 |
31024-31027 |
CD |
denotes |
p65 |
T12606 |
31028-31034 |
NNP |
denotes |
276S/A |
T12607 |
31035-31044 |
VB |
denotes |
construct |
T12608 |
31045-31052 |
VBN |
denotes |
reduced |
T12609 |
31053-31058 |
JJ |
denotes |
NF-κB |
T12610 |
31059-31067 |
NN |
denotes |
activity |
T12611 |
31068-31070 |
IN |
denotes |
by |
T12612 |
31071-31077 |
JJ |
denotes |
5-fold |
T12613 |
31078-31079 |
-LRB- |
denotes |
( |
T12614 |
31079-31080 |
FW |
denotes |
p |
T12615 |
31081-31082 |
SYM |
denotes |
= |
T12616 |
31083-31088 |
CD |
denotes |
0.006 |
T12617 |
31088-31089 |
, |
denotes |
, |
T12618 |
31090-31092 |
NNP |
denotes |
WT |
T12619 |
31093-31098 |
NNP |
denotes |
NF-κB |
T12620 |
31099-31102 |
CD |
denotes |
p65 |
T12621 |
31103-31106 |
FW |
denotes |
vs. |
T12622 |
31107-31112 |
NNP |
denotes |
NF-κB |
T12623 |
31113-31116 |
CD |
denotes |
p65 |
T12624 |
31117-31123 |
NNP |
denotes |
276S/A |
T12625 |
31123-31124 |
-RRB- |
denotes |
) |
T12626 |
31124-31125 |
, |
denotes |
, |
T12627 |
31126-31131 |
IN |
denotes |
while |
T12628 |
31132-31142 |
VBG |
denotes |
expressing |
T12629 |
31143-31146 |
DT |
denotes |
the |
T12630 |
31147-31152 |
NNP |
denotes |
NF-κB |
T12631 |
31153-31156 |
CD |
denotes |
p65 |
T12632 |
31157-31163 |
NNP |
denotes |
536S/A |
T12633 |
31164-31173 |
VB |
denotes |
construct |
T12634 |
31174-31183 |
VBN |
denotes |
increased |
T12635 |
31184-31189 |
JJ |
denotes |
NF-κB |
T12636 |
31190-31198 |
NN |
denotes |
activity |
T12637 |
31199-31201 |
IN |
denotes |
in |
T12638 |
31202-31205 |
DT |
denotes |
the |
T12639 |
31206-31209 |
NNS |
denotes |
p65 |
T12640 |
31209-31210 |
VBP |
denotes |
− |
T12641 |
31210-31211 |
CD |
denotes |
/ |
T12642 |
31211-31212 |
JJ |
denotes |
− |
T12643 |
31213-31218 |
NNS |
denotes |
cells |
T12644 |
31219-31221 |
TO |
denotes |
to |
T12645 |
31222-31228 |
NNS |
denotes |
levels |
T12646 |
31229-31236 |
JJ |
denotes |
similar |
T12647 |
31237-31239 |
TO |
denotes |
to |
T12648 |
31240-31242 |
NNP |
denotes |
WT |
T12649 |
31243-31248 |
NNP |
denotes |
NF-κB |
T12650 |
31249-31252 |
CD |
denotes |
p65 |
T12651 |
31253-31264 |
VBD |
denotes |
transfected |
T12652 |
31265-31270 |
NNS |
denotes |
cells |
T12653 |
31270-31271 |
. |
denotes |
. |
T12654 |
31272-31277 |
IN |
denotes |
Since |
T12655 |
31278-31291 |
JJ |
denotes |
M-CSF-induced |
T12656 |
31292-31295 |
NNP |
denotes |
PKC |
T12657 |
31296-31306 |
NN |
denotes |
activation |
T12658 |
31307-31316 |
VBN |
denotes |
regulated |
T12659 |
31317-31322 |
JJ |
denotes |
NF-κB |
T12660 |
31323-31331 |
NN |
denotes |
activity |
T12661 |
31332-31335 |
IN |
denotes |
via |
T12662 |
31336-31342 |
NNP |
denotes |
Ser276 |
T12663 |
31343-31350 |
NN |
denotes |
residue |
T12664 |
31351-31353 |
IN |
denotes |
of |
T12665 |
31354-31359 |
NNP |
denotes |
NF-κB |
T12666 |
31360-31363 |
CD |
denotes |
p65 |
T12667 |
31364-31366 |
IN |
denotes |
in |
T12668 |
31367-31374 |
JJ |
denotes |
primary |
T12669 |
31375-31380 |
JJ |
denotes |
human |
T12670 |
31381-31385 |
NNS |
denotes |
MDMs |
T12671 |
31386-31389 |
CC |
denotes |
and |
T12672 |
31390-31393 |
NNP |
denotes |
RAW |
T12673 |
31394-31399 |
CD |
denotes |
264.7 |
T12674 |
31400-31405 |
NNS |
denotes |
cells |
T12675 |
31405-31406 |
, |
denotes |
, |
T12676 |
31407-31409 |
PRP |
denotes |
we |
T12677 |
31410-31414 |
JJ |
denotes |
next |
T12678 |
31415-31423 |
VBN |
denotes |
examined |
T12679 |
31424-31426 |
IN |
denotes |
if |
T12680 |
31427-31431 |
DT |
denotes |
this |
T12681 |
31432-31440 |
VBD |
denotes |
occurred |
T12682 |
31441-31443 |
IN |
denotes |
in |
T12683 |
31444-31449 |
NNP |
denotes |
NF-κB |
T12684 |
31450-31453 |
CD |
denotes |
p65 |
T12685 |
31453-31454 |
CD |
denotes |
− |
T12686 |
31454-31455 |
NN |
denotes |
/ |
T12687 |
31455-31456 |
NN |
denotes |
− |
T12688 |
31457-31468 |
NNS |
denotes |
fibroblasts |
T12689 |
31469-31471 |
IN |
denotes |
in |
T12690 |
31472-31480 |
NN |
denotes |
response |
T12691 |
31481-31483 |
TO |
denotes |
to |
T12692 |
31484-31485 |
DT |
denotes |
a |
T12693 |
31486-31492 |
JJ |
denotes |
native |
T12694 |
31493-31501 |
NN |
denotes |
stimulus |
T12695 |
31502-31505 |
IN |
denotes |
for |
T12696 |
31506-31511 |
DT |
denotes |
these |
T12697 |
31512-31517 |
NNS |
denotes |
cells |
T12698 |
31517-31518 |
, |
denotes |
, |
T12699 |
31519-31523 |
NNP |
denotes |
TNFα |
T12700 |
31523-31524 |
. |
denotes |
. |
T12701 |
31525-31530 |
JJ |
denotes |
NF-κB |
T12702 |
31531-31539 |
NN |
denotes |
activity |
T12703 |
31540-31543 |
VBD |
denotes |
was |
T12704 |
31544-31552 |
VBN |
denotes |
measured |
T12705 |
31553-31555 |
IN |
denotes |
in |
T12706 |
31556-31559 |
DT |
denotes |
the |
T12707 |
31560-31562 |
NNP |
denotes |
WT |
T12708 |
31563-31568 |
NNP |
denotes |
NF-κB |
T12709 |
31569-31572 |
CD |
denotes |
p65 |
T12710 |
31573-31575 |
CC |
denotes |
or |
T12711 |
31576-31581 |
NNP |
denotes |
NF-κB |
T12712 |
31582-31585 |
CD |
denotes |
p65 |
T12713 |
31586-31592 |
NNP |
denotes |
276S/A |
T12714 |
31593-31604 |
VBD |
denotes |
transfected |
T12715 |
31605-31610 |
NNS |
denotes |
cells |
T12716 |
31611-31618 |
VBN |
denotes |
treated |
T12717 |
31619-31623 |
IN |
denotes |
with |
T12718 |
31624-31628 |
NNP |
denotes |
TNFα |
T12719 |
31629-31631 |
IN |
denotes |
in |
T12720 |
31632-31635 |
DT |
denotes |
the |
T12721 |
31636-31643 |
NN |
denotes |
absence |
T12722 |
31644-31646 |
CC |
denotes |
or |
T12723 |
31647-31655 |
NN |
denotes |
presence |
T12724 |
31656-31658 |
IN |
denotes |
of |
T12725 |
31659-31669 |
NNP |
denotes |
Ro-31-8220 |
T12726 |
31670-31671 |
-LRB- |
denotes |
( |
T12727 |
31671-31677 |
NNP |
denotes |
Figure |
T12728 |
31678-31680 |
NNP |
denotes |
8C |
T12729 |
31680-31681 |
-RRB- |
denotes |
) |
T12730 |
31681-31682 |
. |
denotes |
. |
T12731 |
31683-31685 |
IN |
denotes |
As |
T12732 |
31686-31694 |
VBN |
denotes |
expected |
T12733 |
31694-31695 |
, |
denotes |
, |
T12734 |
31696-31700 |
NNP |
denotes |
TNFα |
T12735 |
31701-31710 |
VBD |
denotes |
increased |
T12736 |
31711-31716 |
JJ |
denotes |
NF-κB |
T12737 |
31717-31725 |
NN |
denotes |
activity |
T12738 |
31726-31728 |
IN |
denotes |
in |
T12739 |
31729-31734 |
NNP |
denotes |
NF-κB |
T12740 |
31735-31738 |
CD |
denotes |
p65 |
T12741 |
31738-31739 |
CD |
denotes |
− |
T12742 |
31739-31740 |
NN |
denotes |
/ |
T12743 |
31740-31741 |
NN |
denotes |
− |
T12744 |
31742-31747 |
NNS |
denotes |
cells |
T12745 |
31748-31758 |
VBG |
denotes |
expressing |
T12746 |
31759-31761 |
NNP |
denotes |
WT |
T12747 |
31762-31765 |
CD |
denotes |
p65 |
T12748 |
31766-31769 |
CC |
denotes |
and |
T12749 |
31770-31771 |
-LRB- |
denotes |
( |
T12750 |
31771-31772 |
FW |
denotes |
p |
T12751 |
31773-31774 |
SYM |
denotes |
= |
T12752 |
31775-31780 |
CD |
denotes |
0.001 |
T12753 |
31780-31781 |
-RRB- |
denotes |
) |
T12754 |
31782-31785 |
NNP |
denotes |
PKC |
T12755 |
31786-31796 |
NNS |
denotes |
inhibitors |
T12756 |
31797-31806 |
VBD |
denotes |
decreased |
T12757 |
31807-31812 |
JJ |
denotes |
NF-κB |
T12758 |
31813-31821 |
NN |
denotes |
activity |
T12759 |
31822-31824 |
TO |
denotes |
to |
T12760 |
31825-31828 |
DT |
denotes |
the |
T12761 |
31829-31843 |
JJ |
denotes |
non-stimulated |
T12762 |
31844-31845 |
-LRB- |
denotes |
( |
T12763 |
31845-31847 |
NNP |
denotes |
NS |
T12764 |
31847-31848 |
-RRB- |
denotes |
) |
T12765 |
31849-31854 |
NN |
denotes |
level |
T12766 |
31855-31856 |
-LRB- |
denotes |
( |
T12767 |
31856-31857 |
FW |
denotes |
p |
T12768 |
31858-31859 |
SYM |
denotes |
= |
T12769 |
31860-31865 |
CD |
denotes |
0.007 |
T12770 |
31865-31866 |
-RRB- |
denotes |
) |
T12771 |
31866-31867 |
. |
denotes |
. |
T12772 |
31868-31879 |
VBG |
denotes |
Introducing |
T12773 |
31880-31885 |
JJ |
denotes |
NF-κB |
T12774 |
31886-31889 |
NNS |
denotes |
p65 |
T12775 |
31890-31893 |
CD |
denotes |
276 |
T12776 |
31894-31897 |
NNP |
denotes |
S/A |
T12777 |
31898-31908 |
NNS |
denotes |
constructs |
T12778 |
31909-31922 |
RB |
denotes |
significantly |
T12779 |
31923-31930 |
VBD |
denotes |
reduced |
T12780 |
31931-31936 |
JJ |
denotes |
NF-κB |
T12781 |
31937-31945 |
NN |
denotes |
activity |
T12782 |
31946-31954 |
VBN |
denotes |
compared |
T12783 |
31955-31959 |
IN |
denotes |
with |
T12784 |
31960-31963 |
DT |
denotes |
the |
T12785 |
31964-31966 |
NNP |
denotes |
WT |
T12786 |
31967-31972 |
NNP |
denotes |
NF-κB |
T12787 |
31973-31976 |
NNS |
denotes |
p65 |
T12788 |
31977-31986 |
VBP |
denotes |
construct |
T12789 |
31987-31988 |
-LRB- |
denotes |
( |
T12790 |
31988-31989 |
FW |
denotes |
p |
T12791 |
31990-31991 |
SYM |
denotes |
= |
T12792 |
31992-31997 |
CD |
denotes |
0.001 |
T12793 |
31997-31998 |
-RRB- |
denotes |
) |
T12794 |
31998-31999 |
. |
denotes |
. |
T12795 |
32000-32007 |
RB |
denotes |
Notably |
T12796 |
32007-32008 |
, |
denotes |
, |
T12797 |
32009-32013 |
NNP |
denotes |
TNFα |
T12798 |
32014-32020 |
VBD |
denotes |
failed |
T12799 |
32021-32023 |
TO |
denotes |
to |
T12800 |
32024-32032 |
VB |
denotes |
increase |
T12801 |
32033-32038 |
JJ |
denotes |
NF-κB |
T12802 |
32039-32047 |
NN |
denotes |
activity |
T12803 |
32048-32050 |
IN |
denotes |
in |
T12804 |
32051-32054 |
DT |
denotes |
the |
T12805 |
32055-32060 |
NNP |
denotes |
NF-κB |
T12806 |
32061-32064 |
CD |
denotes |
p65 |
T12807 |
32064-32065 |
CD |
denotes |
− |
T12808 |
32065-32066 |
NN |
denotes |
/ |
T12809 |
32066-32067 |
NN |
denotes |
− |
T12810 |
32068-32073 |
NNS |
denotes |
cells |
T12811 |
32074-32084 |
VBG |
denotes |
expressing |
T12812 |
32085-32090 |
NNP |
denotes |
NF-κB |
T12813 |
32091-32094 |
CD |
denotes |
p65 |
T12814 |
32095-32101 |
NNP |
denotes |
276S/A |
T12815 |
32102-32112 |
NNS |
denotes |
constructs |
T12816 |
32112-32113 |
. |
denotes |
. |
T12817 |
32114-32119 |
DT |
denotes |
These |
T12818 |
32120-32132 |
NNS |
denotes |
observations |
T12819 |
32133-32136 |
VBP |
denotes |
are |
T12820 |
32137-32144 |
JJ |
denotes |
similar |
T12821 |
32145-32147 |
TO |
denotes |
to |
T12822 |
32148-32159 |
NNS |
denotes |
macrophages |
T12823 |
32160-32174 |
VBG |
denotes |
overexpressing |
T12824 |
32175-32178 |
DT |
denotes |
the |
T12825 |
32179-32184 |
NNP |
denotes |
NF-κB |
T12826 |
32185-32188 |
CD |
denotes |
p65 |
T12827 |
32189-32195 |
NNP |
denotes |
276S/A |
T12828 |
32196-32197 |
-LRB- |
denotes |
( |
T12829 |
32197-32203 |
NNP |
denotes |
Figure |
T12830 |
32204-32206 |
NNP |
denotes |
8A |
T12831 |
32206-32207 |
-RRB- |
denotes |
) |
T12832 |
32207-32208 |
. |
denotes |
. |
T12833 |
32209-32212 |
PRP$ |
denotes |
Our |
T12834 |
32213-32217 |
NNS |
denotes |
data |
T12835 |
32218-32229 |
VBP |
denotes |
demonstrate |
T12836 |
32230-32234 |
IN |
denotes |
that |
T12837 |
32235-32241 |
NNP |
denotes |
Ser276 |
T12838 |
32242-32244 |
IN |
denotes |
of |
T12839 |
32245-32250 |
NNP |
denotes |
NF-κB |
T12840 |
32251-32254 |
CD |
denotes |
p65 |
T12841 |
32255-32257 |
VBZ |
denotes |
is |
T12842 |
32258-32267 |
JJ |
denotes |
essential |
T12843 |
32268-32270 |
IN |
denotes |
in |
T12844 |
32271-32281 |
VBG |
denotes |
regulating |
T12845 |
32282-32287 |
JJ |
denotes |
NF-κB |
T12846 |
32288-32296 |
NN |
denotes |
activity |
T12847 |
32297-32300 |
CC |
denotes |
and |
T12848 |
32301-32309 |
VBZ |
denotes |
suggests |
T12849 |
32310-32314 |
IN |
denotes |
that |
T12850 |
32315-32318 |
NNP |
denotes |
PKC |
T12851 |
32319-32328 |
VBZ |
denotes |
regulates |
T12852 |
32329-32334 |
JJ |
denotes |
NF-κB |
T12853 |
32335-32343 |
NN |
denotes |
activity |
T12854 |
32344-32346 |
IN |
denotes |
by |
T12855 |
32347-32357 |
VBG |
denotes |
modulating |
T12856 |
32358-32361 |
DT |
denotes |
the |
T12857 |
32362-32377 |
NN |
denotes |
phosphorylation |
T12858 |
32378-32380 |
IN |
denotes |
of |
T12859 |
32381-32386 |
NNP |
denotes |
NF-κB |
T12860 |
32387-32390 |
NNS |
denotes |
p65 |
T12861 |
32391-32393 |
IN |
denotes |
at |
T12862 |
32394-32400 |
NNP |
denotes |
Ser276 |
T12863 |
32401-32408 |
NN |
denotes |
residue |
T12864 |
32408-32409 |
. |
denotes |
. |
T14525 |
32469-32479 |
VBG |
denotes |
regulating |
T14526 |
32480-32493 |
JJ |
denotes |
intracellular |
T14527 |
32494-32503 |
VBG |
denotes |
signaling |
T14528 |
32503-32504 |
, |
denotes |
, |
T14529 |
32505-32511 |
NN |
denotes |
stress |
T14530 |
32512-32520 |
NN |
denotes |
response |
T14531 |
32520-32521 |
, |
denotes |
, |
T14532 |
32522-32535 |
NN |
denotes |
proliferation |
T14533 |
32535-32536 |
, |
denotes |
, |
T14534 |
32537-32545 |
NN |
denotes |
survival |
T14535 |
32545-32546 |
, |
denotes |
, |
T14536 |
32547-32562 |
NN |
denotes |
differentiation |
T14537 |
32563-32566 |
CC |
denotes |
and |
T14538 |
32567-32579 |
NN |
denotes |
inflammation |
T14539 |
32580-32581 |
NN |
denotes |
[ |
T14540 |
32581-32582 |
CD |
denotes |
8 |
T14541 |
32582-32583 |
NNP |
denotes |
] |
T14542 |
32583-32584 |
. |
denotes |
. |
T14543 |
32585-32587 |
TO |
denotes |
To |
T14544 |
32588-32596 |
VB |
denotes |
regulate |
T14545 |
32597-32601 |
NN |
denotes |
gene |
T14546 |
32602-32615 |
NN |
denotes |
transcription |
T14547 |
32615-32616 |
, |
denotes |
, |
T14548 |
32617-32622 |
NNP |
denotes |
NF-κB |
T14549 |
32623-32630 |
CD |
denotes |
p50/p65 |
T14550 |
32631-32643 |
NNS |
denotes |
heterodimers |
T14551 |
32644-32655 |
VBP |
denotes |
translocate |
T14552 |
32656-32658 |
TO |
denotes |
to |
T14553 |
32659-32662 |
DT |
denotes |
the |
T14554 |
32663-32670 |
NN |
denotes |
nucleus |
T14555 |
32671-32675 |
IN |
denotes |
from |
T14556 |
32676-32679 |
DT |
denotes |
the |
T14557 |
32680-32689 |
NN |
denotes |
cytoplasm |
T14558 |
32689-32690 |
, |
denotes |
, |
T14559 |
32691-32698 |
RB |
denotes |
however |
T14560 |
32698-32699 |
, |
denotes |
, |
T14561 |
32700-32705 |
PRP$ |
denotes |
their |
T14562 |
32706-32719 |
NN |
denotes |
translocation |
T14563 |
32720-32722 |
VBZ |
denotes |
is |
T14564 |
32723-32726 |
RB |
denotes |
not |
T14565 |
32727-32737 |
JJ |
denotes |
sufficient |
T14566 |
32738-32740 |
TO |
denotes |
to |
T14567 |
32741-32749 |
VB |
denotes |
activate |
T14568 |
32750-32754 |
NN |
denotes |
gene |
T14569 |
32755-32768 |
NN |
denotes |
transcription |
T14570 |
32768-32769 |
. |
denotes |
. |
T14571 |
32770-32788 |
JJ |
denotes |
Post-translational |
T14572 |
32789-32801 |
NN |
denotes |
modification |
T14573 |
32802-32804 |
IN |
denotes |
of |
T14574 |
32805-32810 |
JJ |
denotes |
NF-κB |
T14575 |
32811-32823 |
NNS |
denotes |
heterodimers |
T14576 |
32824-32828 |
JJ |
denotes |
such |
T14577 |
32829-32831 |
IN |
denotes |
as |
T14578 |
32832-32847 |
NN |
denotes |
phosphorylation |
T14579 |
32848-32850 |
CC |
denotes |
or |
T14580 |
32851-32862 |
NN |
denotes |
acetylation |
T14581 |
32863-32867 |
RB |
denotes |
also |
T14582 |
32868-32879 |
VBZ |
denotes |
contributes |
T14583 |
32880-32882 |
TO |
denotes |
to |
T14584 |
32883-32886 |
PRP$ |
denotes |
its |
T14585 |
32887-32902 |
JJ |
denotes |
transcriptional |
T14586 |
32903-32911 |
NN |
denotes |
activity |
T14587 |
32912-32913 |
NNP |
denotes |
[ |
T14588 |
32913-32915 |
CD |
denotes |
41 |
T14589 |
32915-32916 |
NNP |
denotes |
] |
T14590 |
32916-32917 |
, |
denotes |
, |
T14591 |
32918-32919 |
NNP |
denotes |
[ |
T14592 |
32919-32921 |
CD |
denotes |
42 |
T14593 |
32921-32922 |
NNP |
denotes |
] |
T14594 |
32922-32923 |
, |
denotes |
, |
T14595 |
32924-32925 |
NNP |
denotes |
[ |
T14596 |
32925-32927 |
CD |
denotes |
43 |
T14597 |
32927-32928 |
NNP |
denotes |
] |
T14598 |
32928-32929 |
. |
denotes |
. |
T14599 |
32930-32937 |
IN |
denotes |
Because |
T14600 |
32938-32943 |
JJ |
denotes |
NF-κB |
T14601 |
32944-32958 |
RB |
denotes |
constitutively |
T14602 |
32959-32971 |
VBZ |
denotes |
translocates |
T14603 |
32972-32974 |
TO |
denotes |
to |
T14604 |
32975-32978 |
DT |
denotes |
the |
T14605 |
32979-32986 |
NN |
denotes |
nucleus |
T14606 |
32987-32989 |
IN |
denotes |
in |
T14607 |
32990-32999 |
JJ |
denotes |
monocytic |
T14608 |
33000-33007 |
NN |
denotes |
lineage |
T14609 |
33008-33009 |
NNP |
denotes |
[ |
T14610 |
33009-33011 |
CD |
denotes |
13 |
T14611 |
33011-33012 |
NNP |
denotes |
] |
T14612 |
33013-33016 |
CC |
denotes |
and |
T14613 |
33017-33026 |
VBZ |
denotes |
activates |
T14614 |
33027-33031 |
NN |
denotes |
gene |
T14615 |
33032-33045 |
NN |
denotes |
transcription |
T14616 |
33046-33049 |
CC |
denotes |
and |
T14617 |
33050-33058 |
NN |
denotes |
survival |
T14618 |
33059-33061 |
IN |
denotes |
in |
T14619 |
33062-33068 |
JJ |
denotes |
murine |
T14620 |
33069-33080 |
NNS |
denotes |
macrophages |
T14621 |
33081-33082 |
NNP |
denotes |
[ |
T14622 |
33082-33084 |
CD |
denotes |
11 |
T14623 |
33084-33085 |
NNP |
denotes |
] |
T14624 |
33085-33086 |
, |
denotes |
, |
T14625 |
33087-33089 |
PRP |
denotes |
we |
T14626 |
33090-33096 |
VBD |
denotes |
sought |
T14627 |
33097-33099 |
TO |
denotes |
to |
T14628 |
33100-33109 |
VB |
denotes |
determine |
T14629 |
33110-33113 |
WRB |
denotes |
how |
T14630 |
33114-33119 |
JJ |
denotes |
M-CSF |
T14631 |
33120-33128 |
JJ |
denotes |
affected |
T14632 |
33129-33134 |
NN |
denotes |
NF-κB |
T14633 |
33135-33150 |
JJ |
denotes |
transcriptional |
T14634 |
33151-33159 |
NN |
denotes |
activity |
T14635 |
33160-33162 |
IN |
denotes |
in |
T14636 |
33163-33168 |
JJ |
denotes |
human |
T14637 |
33169-33173 |
NNS |
denotes |
MDMs |
T14638 |
33174-33177 |
CC |
denotes |
and |
T14639 |
33178-33185 |
IN |
denotes |
whether |
T14640 |
33186-33190 |
DT |
denotes |
this |
T14641 |
33191-33201 |
NN |
denotes |
activation |
T14642 |
33202-33211 |
VBN |
denotes |
regulated |
T14643 |
33212-33217 |
PRP$ |
denotes |
their |
T14644 |
33218-33226 |
NN |
denotes |
survival |
T14645 |
33226-33227 |
. |
denotes |
. |
T14646 |
33228-33231 |
DT |
denotes |
The |
T14647 |
33232-33239 |
JJ |
denotes |
present |
T14648 |
33240-33245 |
NN |
denotes |
study |
T14649 |
33246-33258 |
VBD |
denotes |
demonstrated |
T14650 |
33259-33263 |
IN |
denotes |
that |
T14651 |
33264-33269 |
NNP |
denotes |
M-CSF |
T14652 |
33270-33280 |
VBD |
denotes |
stimulated |
T14653 |
33281-33285 |
NNP |
denotes |
PKCα |
T14654 |
33286-33292 |
NN |
denotes |
kinase |
T14655 |
33293-33301 |
RB |
denotes |
upstream |
T14656 |
33302-33304 |
IN |
denotes |
of |
T14657 |
33305-33310 |
JJ |
denotes |
NF-κB |
T14658 |
33311-33326 |
JJ |
denotes |
transcriptional |
T14659 |
33327-33335 |
NN |
denotes |
activity |
T14660 |
33336-33338 |
IN |
denotes |
in |
T14661 |
33339-33346 |
JJ |
denotes |
primary |
T14662 |
33347-33352 |
JJ |
denotes |
human |
T14663 |
33353-33357 |
NNS |
denotes |
MDMs |
T14664 |
33358-33361 |
CC |
denotes |
and |
T14665 |
33362-33365 |
NNP |
denotes |
RAW |
T14666 |
33366-33371 |
CD |
denotes |
264.7 |
T14667 |
33372-33377 |
NNS |
denotes |
cells |
T14668 |
33377-33378 |
. |
denotes |
. |
T14669 |
33379-33381 |
PRP |
denotes |
We |
T14670 |
33382-33388 |
VBD |
denotes |
showed |
T14671 |
33389-33399 |
NN |
denotes |
inhibition |
T14672 |
33400-33402 |
IN |
denotes |
of |
T14673 |
33403-33415 |
JJ |
denotes |
conventional |
T14674 |
33416-33420 |
NNS |
denotes |
PKCs |
T14675 |
33421-33423 |
IN |
denotes |
by |
T14676 |
33424-33427 |
NNP |
denotes |
PKC |
T14677 |
33428-33438 |
NNS |
denotes |
inhibitors |
T14678 |
33438-33439 |
, |
denotes |
, |
T14679 |
33440-33446 |
NN |
denotes |
kinase |
T14680 |
33447-33456 |
NN |
denotes |
deficient |
T14681 |
33457-33461 |
NNP |
denotes |
PKCα |
T14682 |
33462-33464 |
CC |
denotes |
or |
T14683 |
33465-33469 |
NNP |
denotes |
PKCα |
T14684 |
33470-33475 |
NNP |
denotes |
siRNA |
T14685 |
33476-33483 |
VBD |
denotes |
blocked |
T14686 |
33484-33497 |
JJ |
denotes |
M-CSF-induced |
T14687 |
33498-33502 |
NN |
denotes |
cell |
T14688 |
33503-33511 |
NN |
denotes |
survival |
T14689 |
33512-33515 |
CC |
denotes |
and |
T14690 |
33516-33531 |
JJ |
denotes |
NF-κB-regulated |
T14691 |
33532-33536 |
NN |
denotes |
gene |
T14692 |
33537-33547 |
NN |
denotes |
expression |
T14693 |
33547-33548 |
. |
denotes |
. |
T14694 |
33549-33553 |
DT |
denotes |
This |
T14695 |
33554-33559 |
NN |
denotes |
block |
T14696 |
33560-33570 |
VBN |
denotes |
correlated |
T14697 |
33571-33575 |
IN |
denotes |
with |
T14698 |
33576-33577 |
DT |
denotes |
a |
T14699 |
33578-33587 |
NN |
denotes |
reduction |
T14700 |
33588-33590 |
IN |
denotes |
in |
T14701 |
33591-33604 |
JJ |
denotes |
M-CSF-induced |
T14702 |
33605-33620 |
NN |
denotes |
phosphorylation |
T14703 |
33621-33623 |
IN |
denotes |
of |
T14704 |
33624-33629 |
NNP |
denotes |
NF-κB |
T14705 |
33630-33633 |
NNS |
denotes |
p65 |
T14706 |
33634-33636 |
IN |
denotes |
at |
T14707 |
33637-33643 |
NNP |
denotes |
Ser276 |
T14708 |
33643-33644 |
. |
denotes |
. |
T14709 |
33645-33655 |
JJ |
denotes |
Consistent |
T14710 |
33656-33660 |
IN |
denotes |
with |
T14711 |
33661-33666 |
DT |
denotes |
these |
T14712 |
33667-33675 |
NNS |
denotes |
findings |
T14713 |
33676-33679 |
DT |
denotes |
the |
T14714 |
33680-33688 |
JJ |
denotes |
dominant |
T14715 |
33689-33697 |
JJ |
denotes |
negative |
T14716 |
33698-33702 |
NNP |
denotes |
PKCα |
T14717 |
33703-33713 |
NNS |
denotes |
constructs |
T14718 |
33714-33718 |
RB |
denotes |
also |
T14719 |
33719-33728 |
VBD |
denotes |
inhibited |
T14720 |
33729-33734 |
NNP |
denotes |
NF-κB |
T14721 |
33735-33738 |
CD |
denotes |
p65 |
T14722 |
33739-33754 |
NN |
denotes |
phosphorylation |
T14723 |
33755-33757 |
IN |
denotes |
at |
T14724 |
33758-33764 |
NNP |
denotes |
Ser276 |
T14725 |
33765-33768 |
CC |
denotes |
but |
T14726 |
33769-33772 |
RB |
denotes |
not |
T14727 |
33773-33775 |
IN |
denotes |
at |
T14728 |
33776-33782 |
CD |
denotes |
Ser536 |
T14729 |
33783-33792 |
VBG |
denotes |
resulting |
T14730 |
33793-33795 |
IN |
denotes |
in |
T14731 |
33796-33803 |
VBN |
denotes |
reduced |
T14732 |
33804-33809 |
NNP |
denotes |
NF-κB |
T14733 |
33810-33825 |
JJ |
denotes |
transcriptional |
T14734 |
33826-33836 |
NN |
denotes |
activation |
T14735 |
33837-33840 |
CC |
denotes |
and |
T14736 |
33841-33854 |
JJ |
denotes |
M-CSF-induced |
T14737 |
33855-33858 |
NNP |
denotes |
MDM |
T14738 |
33859-33867 |
NN |
denotes |
survival |
T14739 |
33867-33868 |
. |
denotes |
. |
T14740 |
33869-33870 |
DT |
denotes |
A |
T14741 |
33871-33881 |
VBN |
denotes |
simplified |
T14742 |
33882-33890 |
VBN |
denotes |
proposed |
T14743 |
33891-33898 |
NN |
denotes |
cartoon |
T14744 |
33899-33904 |
NN |
denotes |
model |
T14745 |
33905-33907 |
IN |
denotes |
in |
T14746 |
33908-33914 |
NN |
denotes |
Figure |
T14747 |
33915-33916 |
CD |
denotes |
9 |
T14748 |
33917-33929 |
VBZ |
denotes |
demonstrates |
T14749 |
33930-33934 |
IN |
denotes |
that |
T14750 |
33935-33940 |
NNP |
denotes |
M-CSF |
T14751 |
33941-33948 |
VBD |
denotes |
induced |
T14752 |
33949-33958 |
NNS |
denotes |
monocytes |
T14753 |
33959-33967 |
NN |
denotes |
survival |
T14754 |
33968-33970 |
VBZ |
denotes |
is |
T14755 |
33971-33980 |
VBN |
denotes |
regulated |
T14756 |
33981-33983 |
IN |
denotes |
by |
T14757 |
33984-33994 |
VBG |
denotes |
activating |
T14758 |
33995-34000 |
NNP |
denotes |
NF-κB |
T14759 |
34001-34004 |
CD |
denotes |
p65 |
T14760 |
34005-34020 |
NN |
denotes |
phosphorylation |
T14761 |
34021-34023 |
IN |
denotes |
at |
T14762 |
34024-34030 |
NNP |
denotes |
Ser276 |
T14763 |
34031-34034 |
IN |
denotes |
via |
T14764 |
34035-34038 |
NNP |
denotes |
PKC |
T14765 |
34038-34039 |
. |
denotes |
. |
T14766 |
34040-34047 |
RB |
denotes |
Finally |
T14767 |
34047-34048 |
, |
denotes |
, |
T14768 |
34049-34051 |
IN |
denotes |
in |
T14769 |
34052-34053 |
DT |
denotes |
a |
T14770 |
34054-34059 |
NNP |
denotes |
NF-κB |
T14771 |
34060-34063 |
CD |
denotes |
p65 |
T14772 |
34063-34064 |
CD |
denotes |
− |
T14773 |
34064-34065 |
NN |
denotes |
/ |
T14774 |
34065-34066 |
NN |
denotes |
− |
T14775 |
34067-34077 |
NN |
denotes |
fibroblast |
T14776 |
34078-34082 |
NN |
denotes |
cell |
T14777 |
34083-34087 |
NN |
denotes |
line |
T14778 |
34087-34088 |
, |
denotes |
, |
T14779 |
34089-34091 |
PRP |
denotes |
we |
T14780 |
34092-34101 |
VBD |
denotes |
confirmed |
T14781 |
34102-34106 |
IN |
denotes |
that |
T14782 |
34107-34110 |
DT |
denotes |
the |
T14783 |
34111-34117 |
NNP |
denotes |
Ser276 |
T14784 |
34118-34125 |
NN |
denotes |
residue |
T14785 |
34126-34128 |
IN |
denotes |
of |
T14786 |
34129-34134 |
NNP |
denotes |
NF-κB |
T14787 |
34135-34138 |
CD |
denotes |
p65 |
T14788 |
34139-34141 |
VBZ |
denotes |
is |
T14789 |
34142-34151 |
JJ |
denotes |
important |
T14790 |
34152-34155 |
CC |
denotes |
and |
T14791 |
34156-34165 |
JJ |
denotes |
essential |
T14792 |
34166-34169 |
IN |
denotes |
for |
T14793 |
34170-34173 |
NNP |
denotes |
PKC |
T14794 |
34174-34184 |
NN |
denotes |
modulation |
T14795 |
34185-34187 |
IN |
denotes |
of |
T14796 |
34188-34193 |
JJ |
denotes |
NF-κB |
T14797 |
34194-34202 |
NN |
denotes |
activity |
T14798 |
34202-34203 |
. |
denotes |
. |
T14799 |
34204-34208 |
RBR |
denotes |
More |
T14800 |
34209-34219 |
JJ |
denotes |
compelling |
T14801 |
34220-34222 |
VBZ |
denotes |
is |
T14802 |
34223-34227 |
IN |
denotes |
that |
T14803 |
34228-34230 |
PRP |
denotes |
we |
T14804 |
34231-34239 |
VBD |
denotes |
observed |
T14805 |
34240-34241 |
DT |
denotes |
a |
T14806 |
34242-34249 |
JJ |
denotes |
similar |
T14807 |
34250-34260 |
NN |
denotes |
regulation |
T14808 |
34261-34268 |
IN |
denotes |
between |
T14809 |
34269-34272 |
CD |
denotes |
two |
T14810 |
34273-34282 |
JJ |
denotes |
different |
T14811 |
34283-34287 |
NN |
denotes |
cell |
T14812 |
34288-34296 |
NNS |
denotes |
lineages |
T14813 |
34297-34299 |
IN |
denotes |
in |
T14814 |
34300-34303 |
PRP$ |
denotes |
our |
T14815 |
34304-34309 |
NN |
denotes |
study |
T14816 |
34309-34310 |
. |
denotes |
. |
T26848 |
34355-34363 |
VBN |
denotes |
Proposed |
T26849 |
34364-34369 |
NN |
denotes |
model |
T26850 |
34370-34373 |
IN |
denotes |
for |
T26851 |
34374-34387 |
JJ |
denotes |
M-CSF-induced |
T26852 |
34388-34396 |
NN |
denotes |
monocyte |
T26853 |
34397-34405 |
NN |
denotes |
survival |
T26854 |
34406-34409 |
IN |
denotes |
via |
T26855 |
34410-34413 |
NNP |
denotes |
PKC |
T26856 |
34414-34424 |
NN |
denotes |
regulation |
T26857 |
34425-34427 |
IN |
denotes |
by |
T26858 |
34428-34438 |
VBG |
denotes |
activating |
T26859 |
34439-34444 |
NNP |
denotes |
NF-κB |
T26860 |
34445-34448 |
CD |
denotes |
p65 |
T26861 |
34449-34464 |
NN |
denotes |
phosphorylation |
T26862 |
34465-34467 |
IN |
denotes |
at |
T26863 |
34468-34474 |
NNP |
denotes |
Ser276 |
T26864 |
34474-34475 |
. |
denotes |
. |
T14817 |
34478-34496 |
JJ |
denotes |
Post-translational |
T14818 |
34497-34509 |
NN |
denotes |
modification |
T14819 |
34510-34512 |
IN |
denotes |
of |
T14820 |
34513-34518 |
NNP |
denotes |
NF-κB |
T14821 |
34519-34522 |
CD |
denotes |
p65 |
T14822 |
34523-34532 |
VBZ |
denotes |
regulates |
T14823 |
34533-34536 |
PRP$ |
denotes |
its |
T14824 |
34537-34547 |
NN |
denotes |
activating |
T14825 |
34548-34550 |
CC |
denotes |
or |
T14826 |
34551-34561 |
VBG |
denotes |
repressing |
T14827 |
34562-34569 |
NNS |
denotes |
effects |
T14828 |
34570-34572 |
IN |
denotes |
on |
T14829 |
34573-34577 |
NN |
denotes |
gene |
T14830 |
34578-34588 |
NN |
denotes |
expression |
T14831 |
34588-34589 |
. |
denotes |
. |
T14832 |
34590-34595 |
IN |
denotes |
Among |
T14833 |
34596-34599 |
DT |
denotes |
the |
T14834 |
34600-34605 |
CD |
denotes |
seven |
T14835 |
34606-34614 |
VBD |
denotes |
reported |
T14836 |
34615-34623 |
JJ |
denotes |
putative |
T14837 |
34624-34629 |
NNP |
denotes |
NF-κB |
T14838 |
34630-34633 |
CD |
denotes |
p65 |
T14839 |
34634-34649 |
NN |
denotes |
phosphorylation |
T14840 |
34650-34655 |
NNS |
denotes |
sites |
T14841 |
34655-34656 |
, |
denotes |
, |
T14842 |
34657-34661 |
CD |
denotes |
five |
T14843 |
34662-34670 |
NN |
denotes |
increase |
T14844 |
34671-34678 |
JJ |
denotes |
nuclear |
T14845 |
34679-34692 |
NN |
denotes |
translocation |
T14846 |
34692-34693 |
, |
denotes |
, |
T14847 |
34694-34697 |
NNP |
denotes |
DNA |
T14848 |
34698-34705 |
JJ |
denotes |
binding |
T14849 |
34706-34709 |
CC |
denotes |
and |
T14850 |
34710-34715 |
JJ |
denotes |
NF-κB |
T14851 |
34716-34731 |
JJ |
denotes |
transcriptional |
T14852 |
34732-34740 |
NN |
denotes |
activity |
T14853 |
34741-34742 |
NNP |
denotes |
[ |
T14854 |
34742-34744 |
CD |
denotes |
17 |
T14855 |
34744-34745 |
NNP |
denotes |
] |
T14856 |
34745-34746 |
. |
denotes |
. |
T14857 |
34747-34754 |
JJ |
denotes |
Similar |
T14858 |
34755-34757 |
TO |
denotes |
to |
T14859 |
34758-34761 |
PRP$ |
denotes |
our |
T14860 |
34762-34769 |
NN |
denotes |
finding |
T14861 |
34769-34770 |
, |
denotes |
, |
T14862 |
34771-34776 |
NNP |
denotes |
Zhong |
T14863 |
34777-34779 |
FW |
denotes |
et |
T14864 |
34780-34783 |
FW |
denotes |
al. |
T14865 |
34784-34789 |
VBD |
denotes |
found |
T14866 |
34790-34794 |
IN |
denotes |
that |
T14867 |
34795-34797 |
IN |
denotes |
in |
T14868 |
34798-34806 |
NN |
denotes |
response |
T14869 |
34807-34809 |
TO |
denotes |
to |
T14870 |
34810-34813 |
NNP |
denotes |
LPS |
T14871 |
34813-34814 |
, |
denotes |
, |
T14872 |
34815-34820 |
NNP |
denotes |
NF-κB |
T14873 |
34821-34824 |
CD |
denotes |
p65 |
T14874 |
34825-34827 |
VBZ |
denotes |
is |
T14875 |
34828-34842 |
VBN |
denotes |
phosphorylated |
T14876 |
34843-34845 |
IN |
denotes |
at |
T14877 |
34846-34849 |
DT |
denotes |
the |
T14878 |
34850-34856 |
RB |
denotes |
highly |
T14879 |
34857-34866 |
VBN |
denotes |
conserved |
T14880 |
34867-34873 |
NNP |
denotes |
Ser276 |
T14881 |
34874-34881 |
NN |
denotes |
residue |
T14882 |
34882-34884 |
IN |
denotes |
by |
T14883 |
34885-34888 |
DT |
denotes |
the |
T14884 |
34889-34898 |
JJ |
denotes |
catalytic |
T14885 |
34899-34906 |
NN |
denotes |
subunit |
T14886 |
34907-34909 |
IN |
denotes |
of |
T14887 |
34910-34913 |
NNP |
denotes |
PKA |
T14888 |
34914-34915 |
NNP |
denotes |
[ |
T14889 |
34915-34917 |
CD |
denotes |
16 |
T14890 |
34917-34918 |
NNP |
denotes |
] |
T14891 |
34918-34919 |
. |
denotes |
. |
T14892 |
34920-34922 |
IN |
denotes |
In |
T14893 |
34923-34931 |
NN |
denotes |
addition |
T14894 |
34932-34934 |
TO |
denotes |
to |
T14895 |
34935-34938 |
NNP |
denotes |
PKA |
T14896 |
34938-34939 |
, |
denotes |
, |
T14897 |
34940-34946 |
NNP |
denotes |
Ser276 |
T14898 |
34947-34950 |
MD |
denotes |
can |
T14899 |
34951-34953 |
VB |
denotes |
be |
T14900 |
34954-34968 |
VBN |
denotes |
phosphorylated |
T14901 |
34969-34971 |
IN |
denotes |
by |
T14902 |
34972-34976 |
NNP |
denotes |
MSK1 |
T14903 |
34977-34979 |
IN |
denotes |
in |
T14904 |
34980-34983 |
DT |
denotes |
the |
T14905 |
34984-34991 |
NN |
denotes |
nucleus |
T14906 |
34992-34996 |
IN |
denotes |
upon |
T14907 |
34997-35001 |
NNP |
denotes |
TNFα |
T14908 |
35002-35011 |
NN |
denotes |
treatment |
T14909 |
35012-35013 |
NNP |
denotes |
[ |
T14910 |
35013-35015 |
CD |
denotes |
18 |
T14911 |
35015-35016 |
NNP |
denotes |
] |
T14912 |
35016-35017 |
. |
denotes |
. |
T14913 |
35018-35033 |
NNP |
denotes |
Phosphorylation |
T14914 |
35034-35036 |
IN |
denotes |
of |
T14915 |
35037-35042 |
NNP |
denotes |
NF-κB |
T14916 |
35043-35046 |
NNS |
denotes |
p65 |
T14917 |
35047-35049 |
IN |
denotes |
at |
T14918 |
35050-35056 |
NNP |
denotes |
Ser536 |
T14919 |
35057-35063 |
VBZ |
denotes |
occurs |
T14920 |
35064-35066 |
IN |
denotes |
in |
T14921 |
35067-35075 |
NN |
denotes |
response |
T14922 |
35076-35078 |
TO |
denotes |
to |
T14923 |
35079-35083 |
JJ |
denotes |
many |
T14924 |
35084-35096 |
JJ |
denotes |
inflammatory |
T14925 |
35097-35104 |
NNS |
denotes |
stimuli |
T14926 |
35105-35107 |
RB |
denotes |
as |
T14927 |
35108-35112 |
RB |
denotes |
well |
T14928 |
35113-35115 |
IN |
denotes |
as |
T14929 |
35116-35123 |
NNS |
denotes |
kinases |
T14930 |
35123-35124 |
, |
denotes |
, |
T14931 |
35125-35129 |
NNP |
denotes |
IKKα |
T14932 |
35129-35130 |
, |
denotes |
, |
T14933 |
35131-35135 |
NNP |
denotes |
IKKβ |
T14934 |
35136-35139 |
CC |
denotes |
and |
T14935 |
35140-35144 |
NNP |
denotes |
RSK1 |
T14936 |
35145-35146 |
NNP |
denotes |
[ |
T14937 |
35146-35148 |
CD |
denotes |
17 |
T14938 |
35148-35149 |
NNP |
denotes |
] |
T14939 |
35149-35150 |
, |
denotes |
, |
T14940 |
35151-35152 |
NNP |
denotes |
[ |
T14941 |
35152-35154 |
CD |
denotes |
18 |
T14942 |
35154-35155 |
NNP |
denotes |
] |
T14943 |
35155-35156 |
, |
denotes |
, |
T14944 |
35157-35158 |
NNP |
denotes |
[ |
T14945 |
35158-35160 |
CD |
denotes |
19 |
T14946 |
35160-35161 |
NNP |
denotes |
] |
T14947 |
35161-35162 |
, |
denotes |
, |
T14948 |
35163-35164 |
NNP |
denotes |
[ |
T14949 |
35164-35166 |
CD |
denotes |
20 |
T14950 |
35166-35167 |
NNP |
denotes |
] |
T14951 |
35167-35168 |
, |
denotes |
, |
T14952 |
35169-35170 |
NNP |
denotes |
[ |
T14953 |
35170-35172 |
CD |
denotes |
21 |
T14954 |
35172-35173 |
NNP |
denotes |
] |
T14955 |
35173-35174 |
. |
denotes |
. |
T14956 |
35175-35182 |
RB |
denotes |
Notably |
T14957 |
35182-35183 |
, |
denotes |
, |
T14958 |
35184-35186 |
IN |
denotes |
in |
T14959 |
35187-35195 |
NN |
denotes |
addition |
T14960 |
35196-35198 |
TO |
denotes |
to |
T14961 |
35199-35214 |
VBG |
denotes |
phosphorylating |
T14962 |
35215-35221 |
NNP |
denotes |
Ser276 |
T14963 |
35222-35224 |
IN |
denotes |
of |
T14964 |
35225-35230 |
NNP |
denotes |
NF-κB |
T14965 |
35230-35231 |
, |
denotes |
, |
T14966 |
35232-35235 |
PRP$ |
denotes |
our |
T14967 |
35236-35241 |
NN |
denotes |
study |
T14968 |
35242-35250 |
VBD |
denotes |
revealed |
T14969 |
35251-35255 |
IN |
denotes |
that |
T14970 |
35256-35261 |
NNP |
denotes |
M-CSF |
T14971 |
35262-35266 |
RB |
denotes |
also |
T14972 |
35267-35276 |
VBD |
denotes |
modulated |
T14973 |
35277-35280 |
DT |
denotes |
the |
T14974 |
35281-35296 |
NN |
denotes |
phosphorylation |
T14975 |
35297-35299 |
IN |
denotes |
of |
T14976 |
35300-35303 |
DT |
denotes |
the |
T14977 |
35304-35309 |
NNP |
denotes |
NF-κB |
T14978 |
35310-35313 |
CD |
denotes |
p65 |
T14979 |
35314-35321 |
NN |
denotes |
subunit |
T14980 |
35322-35324 |
IN |
denotes |
at |
T14981 |
35325-35331 |
NNP |
denotes |
Ser536 |
T14982 |
35331-35332 |
, |
denotes |
, |
T14983 |
35333-35340 |
RB |
denotes |
however |
T14984 |
35340-35341 |
, |
denotes |
, |
T14985 |
35342-35345 |
NNP |
denotes |
PKC |
T14986 |
35346-35356 |
NNS |
denotes |
inhibitors |
T14987 |
35357-35359 |
CC |
denotes |
or |
T14988 |
35360-35366 |
VB |
denotes |
kinase |
T14989 |
35367-35376 |
JJ |
denotes |
deficient |
T14990 |
35377-35381 |
NNP |
denotes |
PKCα |
T14991 |
35382-35392 |
NNS |
denotes |
constructs |
T14992 |
35393-35396 |
VBD |
denotes |
did |
T14993 |
35397-35400 |
RB |
denotes |
not |
T14994 |
35401-35407 |
VB |
denotes |
affect |
T14995 |
35408-35412 |
DT |
denotes |
this |
T14996 |
35413-35428 |
NN |
denotes |
phosphorylation |
T14997 |
35429-35434 |
NN |
denotes |
event |
T14998 |
35434-35435 |
. |
denotes |
. |
T14999 |
35436-35444 |
RB |
denotes |
Moreover |
T15000 |
35444-35445 |
, |
denotes |
, |
T15001 |
35446-35452 |
JJ |
denotes |
mutant |
T15002 |
35453-35463 |
NNS |
denotes |
constructs |
T15003 |
35464-35474 |
VBG |
denotes |
containing |
T15004 |
35475-35476 |
DT |
denotes |
a |
T15005 |
35477-35482 |
NN |
denotes |
point |
T15006 |
35483-35491 |
NN |
denotes |
mutation |
T15007 |
35492-35494 |
IN |
denotes |
at |
T15008 |
35495-35501 |
NNP |
denotes |
Ser536 |
T15009 |
35502-35504 |
IN |
denotes |
of |
T15010 |
35505-35510 |
NNP |
denotes |
NF-κB |
T15011 |
35511-35514 |
CD |
denotes |
p65 |
T15012 |
35515-35518 |
VBD |
denotes |
did |
T15013 |
35519-35522 |
RB |
denotes |
not |
T15014 |
35523-35529 |
VB |
denotes |
reduce |
T15015 |
35530-35535 |
JJ |
denotes |
NF-κB |
T15016 |
35536-35544 |
NN |
denotes |
activity |
T15017 |
35545-35547 |
IN |
denotes |
in |
T15018 |
35548-35553 |
NNS |
denotes |
cells |
T15019 |
35554-35561 |
VBG |
denotes |
lacking |
T15020 |
35562-35572 |
JJ |
denotes |
endogenous |
T15021 |
35573-35578 |
NNP |
denotes |
NF-κB |
T15022 |
35579-35582 |
NNS |
denotes |
p65 |
T15023 |
35582-35583 |
, |
denotes |
, |
T15024 |
35584-35589 |
IN |
denotes |
while |
T15025 |
35590-35593 |
DT |
denotes |
the |
T15026 |
35594-35599 |
NNP |
denotes |
NF-κB |
T15027 |
35600-35603 |
CD |
denotes |
p65 |
T15028 |
35604-35610 |
NNP |
denotes |
276S/A |
T15029 |
35611-35620 |
VB |
denotes |
construct |
T15030 |
35621-35624 |
VBD |
denotes |
did |
T15031 |
35625-35631 |
VB |
denotes |
reduce |
T15032 |
35632-35637 |
NN |
denotes |
NF-κB |
T15033 |
35638-35646 |
NN |
denotes |
activity |
T15034 |
35647-35649 |
IN |
denotes |
in |
T15035 |
35650-35655 |
DT |
denotes |
these |
T15036 |
35656-35661 |
NNS |
denotes |
cells |
T15037 |
35661-35662 |
. |
denotes |
. |
T15038 |
35663-35672 |
RB |
denotes |
Therefore |
T15039 |
35672-35673 |
, |
denotes |
, |
T15040 |
35674-35682 |
JJ |
denotes |
specific |
T15041 |
35683-35701 |
JJ |
denotes |
post-translational |
T15042 |
35702-35714 |
NN |
denotes |
modification |
T15043 |
35715-35717 |
IN |
denotes |
of |
T15044 |
35718-35723 |
NNP |
denotes |
NF-κB |
T15045 |
35724-35727 |
CD |
denotes |
p65 |
T15046 |
35728-35730 |
VBZ |
denotes |
is |
T15047 |
35731-35737 |
JJ |
denotes |
likely |
T15048 |
35738-35740 |
TO |
denotes |
to |
T15049 |
35741-35749 |
VB |
denotes |
regulate |
T15050 |
35750-35765 |
JJ |
denotes |
transcriptional |
T15051 |
35766-35776 |
NN |
denotes |
activation |
T15052 |
35777-35779 |
IN |
denotes |
in |
T15053 |
35780-35788 |
NN |
denotes |
response |
T15054 |
35789-35791 |
TO |
denotes |
to |
T15055 |
35792-35800 |
JJ |
denotes |
specific |
T15056 |
35801-35808 |
NNS |
denotes |
stimuli |
T15057 |
35809-35810 |
NNP |
denotes |
[ |
T15058 |
35810-35812 |
CD |
denotes |
15 |
T15059 |
35812-35813 |
NNP |
denotes |
] |
T15060 |
35813-35814 |
, |
denotes |
, |
T15061 |
35815-35816 |
NNP |
denotes |
[ |
T15062 |
35816-35818 |
CD |
denotes |
43 |
T15063 |
35818-35819 |
NNP |
denotes |
] |
T15064 |
35819-35820 |
. |
denotes |
. |
T15065 |
35821-35823 |
PRP |
denotes |
It |
T15066 |
35824-35826 |
VBZ |
denotes |
is |
T15067 |
35827-35834 |
JJ |
denotes |
notable |
T15068 |
35835-35839 |
IN |
denotes |
that |
T15069 |
35840-35845 |
NNP |
denotes |
M-CSF |
T15070 |
35846-35855 |
VBD |
denotes |
activated |
T15071 |
35856-35861 |
NNP |
denotes |
NF-κB |
T15072 |
35862-35865 |
CD |
denotes |
p65 |
T15073 |
35866-35872 |
NNP |
denotes |
Ser276 |
T15074 |
35873-35888 |
NN |
denotes |
phosphorylation |
T15075 |
35889-35892 |
CC |
denotes |
and |
T15076 |
35893-35908 |
JJ |
denotes |
transcriptional |
T15077 |
35909-35919 |
NN |
denotes |
activation |
T15078 |
35920-35922 |
IN |
denotes |
in |
T15079 |
35923-35924 |
DT |
denotes |
a |
T15080 |
35925-35939 |
JJ |
denotes |
PKCα-dependent |
T15081 |
35940-35946 |
NN |
denotes |
manner |
T15082 |
35946-35947 |
. |
denotes |
. |
T15083 |
35948-35952 |
NNP |
denotes |
PKCα |
T15084 |
35953-35955 |
VBZ |
denotes |
is |
T15085 |
35956-35957 |
DT |
denotes |
a |
T15086 |
35958-35964 |
NN |
denotes |
member |
T15087 |
35965-35967 |
IN |
denotes |
of |
T15088 |
35968-35971 |
DT |
denotes |
the |
T15089 |
35972-35984 |
JJ |
denotes |
conventional |
T15090 |
35985-35988 |
NNP |
denotes |
PKC |
T15091 |
35989-35995 |
NN |
denotes |
family |
T15092 |
35996-35998 |
IN |
denotes |
of |
T15093 |
35999-36006 |
NN |
denotes |
protein |
T15094 |
36007-36014 |
NNS |
denotes |
kinases |
T15095 |
36015-36019 |
WDT |
denotes |
that |
T15096 |
36020-36023 |
VBP |
denotes |
are |
T15097 |
36024-36032 |
JJ |
denotes |
critical |
T15098 |
36033-36036 |
IN |
denotes |
for |
T15099 |
36037-36041 |
NN |
denotes |
cell |
T15100 |
36042-36048 |
NN |
denotes |
growth |
T15101 |
36048-36049 |
, |
denotes |
, |
T15102 |
36050-36065 |
NN |
denotes |
differentiation |
T15103 |
36066-36069 |
CC |
denotes |
and |
T15104 |
36070-36074 |
NN |
denotes |
cell |
T15105 |
36075-36080 |
NN |
denotes |
death |
T15106 |
36080-36081 |
. |
denotes |
. |
T15107 |
36082-36086 |
NNP |
denotes |
PKCα |
T15108 |
36087-36096 |
RB |
denotes |
primarily |
T15109 |
36097-36106 |
VBZ |
denotes |
modulates |
T15110 |
36107-36121 |
JJ |
denotes |
anti-apoptotic |
T15111 |
36122-36125 |
CC |
denotes |
and |
T15112 |
36126-36139 |
NN |
denotes |
proliferation |
T15113 |
36140-36147 |
NNS |
denotes |
signals |
T15114 |
36148-36157 |
VBG |
denotes |
following |
T15115 |
36158-36166 |
JJ |
denotes |
cytokine |
T15116 |
36167-36176 |
NN |
denotes |
treatment |
T15117 |
36177-36179 |
IN |
denotes |
in |
T15118 |
36180-36187 |
JJ |
denotes |
various |
T15119 |
36188-36192 |
NN |
denotes |
cell |
T15120 |
36193-36198 |
NNS |
denotes |
types |
T15121 |
36199-36200 |
NNP |
denotes |
[ |
T15122 |
36200-36202 |
CD |
denotes |
42 |
T15123 |
36202-36203 |
NNP |
denotes |
] |
T15124 |
36203-36204 |
. |
denotes |
. |
T15125 |
36205-36215 |
NN |
denotes |
Expression |
T15126 |
36216-36218 |
IN |
denotes |
of |
T15127 |
36219-36223 |
NNP |
denotes |
PKCα |
T15128 |
36224-36234 |
VBZ |
denotes |
attenuates |
T15129 |
36235-36244 |
NN |
denotes |
apoptosis |
T15130 |
36245-36247 |
IN |
denotes |
in |
T15131 |
36248-36252 |
JJ |
denotes |
many |
T15132 |
36253-36262 |
JJ |
denotes |
different |
T15133 |
36263-36267 |
NN |
denotes |
cell |
T15134 |
36268-36273 |
NNS |
denotes |
types |
T15135 |
36273-36274 |
, |
denotes |
, |
T15136 |
36275-36280 |
IN |
denotes |
while |
T15137 |
36281-36285 |
NNP |
denotes |
PKCα |
T15138 |
36286-36296 |
NN |
denotes |
inhibition |
T15139 |
36297-36306 |
RB |
denotes |
generally |
T15140 |
36307-36318 |
VBZ |
denotes |
potentiates |
T15141 |
36319-36328 |
NN |
denotes |
apoptosis |
T15142 |
36329-36330 |
NNP |
denotes |
[ |
T15143 |
36330-36332 |
CD |
denotes |
42 |
T15144 |
36332-36333 |
NNP |
denotes |
] |
T15145 |
36333-36334 |
. |
denotes |
. |
T15146 |
36335-36337 |
IN |
denotes |
In |
T15147 |
36338-36341 |
PRP$ |
denotes |
our |
T15148 |
36342-36349 |
NNS |
denotes |
studies |
T15149 |
36350-36355 |
VBG |
denotes |
using |
T15150 |
36356-36368 |
JJ |
denotes |
conventional |
T15151 |
36369-36372 |
NNP |
denotes |
PKC |
T15152 |
36373-36383 |
NNS |
denotes |
inhibitors |
T15153 |
36384-36387 |
CC |
denotes |
and |
T15154 |
36388-36396 |
JJ |
denotes |
dominant |
T15155 |
36397-36405 |
JJ |
denotes |
negative |
T15156 |
36406-36410 |
NNP |
denotes |
PKCα |
T15157 |
36411-36421 |
NNS |
denotes |
constructs |
T15158 |
36421-36422 |
, |
denotes |
, |
T15159 |
36423-36427 |
NNP |
denotes |
PKCα |
T15160 |
36428-36431 |
VBD |
denotes |
was |
T15161 |
36432-36440 |
JJ |
denotes |
critical |
T15162 |
36441-36443 |
IN |
denotes |
in |
T15163 |
36444-36457 |
JJ |
denotes |
M-CSF-induced |
T15164 |
36458-36468 |
NN |
denotes |
macrophage |
T15165 |
36469-36477 |
NN |
denotes |
survival |
T15166 |
36478-36480 |
IN |
denotes |
by |
T15167 |
36481-36489 |
VBG |
denotes |
inducing |
T15168 |
36490-36496 |
NNP |
denotes |
Ser276 |
T15169 |
36497-36512 |
NN |
denotes |
phosphorylation |
T15170 |
36513-36515 |
IN |
denotes |
of |
T15171 |
36516-36521 |
NNP |
denotes |
NF-κB |
T15172 |
36522-36525 |
CD |
denotes |
p65 |
T15173 |
36526-36528 |
IN |
denotes |
in |
T15174 |
36529-36533 |
DT |
denotes |
both |
T15175 |
36534-36541 |
JJ |
denotes |
primary |
T15176 |
36542-36547 |
JJ |
denotes |
human |
T15177 |
36548-36552 |
NNS |
denotes |
MDMs |
T15178 |
36553-36556 |
CC |
denotes |
and |
T15179 |
36557-36560 |
NNP |
denotes |
Raw |
T15180 |
36561-36566 |
CD |
denotes |
264.7 |
T15181 |
36567-36572 |
NNS |
denotes |
cells |
T15182 |
36572-36573 |
. |
denotes |
. |
T15183 |
36574-36576 |
PRP |
denotes |
We |
T15184 |
36577-36581 |
RB |
denotes |
also |
T15185 |
36582-36594 |
VBD |
denotes |
demonstrated |
T15186 |
36595-36598 |
NNP |
denotes |
PKC |
T15187 |
36599-36609 |
NN |
denotes |
inhibition |
T15188 |
36610-36623 |
VBD |
denotes |
downregulated |
T15189 |
36624-36639 |
NNP |
denotes |
NF-κB-induction |
T15190 |
36640-36642 |
IN |
denotes |
of |
T15191 |
36643-36646 |
DT |
denotes |
the |
T15192 |
36647-36661 |
JJ |
denotes |
anti-apoptotic |
T15193 |
36662-36666 |
NN |
denotes |
gene |
T15194 |
36667-36673 |
NN |
denotes |
BCL-xL |
T15195 |
36673-36674 |
. |
denotes |
. |
T15196 |
36675-36685 |
JJ |
denotes |
Consistent |
T15197 |
36686-36690 |
IN |
denotes |
with |
T15198 |
36691-36694 |
PRP$ |
denotes |
our |
T15199 |
36695-36702 |
NN |
denotes |
finding |
T15200 |
36702-36703 |
, |
denotes |
, |
T15201 |
36704-36710 |
NNS |
denotes |
others |
T15202 |
36711-36719 |
VBD |
denotes |
reported |
T15203 |
36720-36725 |
JJ |
denotes |
NF-κB |
T15204 |
36726-36735 |
VBN |
denotes |
regulated |
T15205 |
36736-36739 |
DT |
denotes |
the |
T15206 |
36740-36744 |
NN |
denotes |
gene |
T15207 |
36745-36755 |
NN |
denotes |
expression |
T15208 |
36756-36758 |
IN |
denotes |
of |
T15209 |
36759-36763 |
JJ |
denotes |
many |
T15210 |
36764-36778 |
JJ |
denotes |
anti-apoptotic |
T15211 |
36779-36787 |
NNS |
denotes |
proteins |
T15212 |
36788-36797 |
VBG |
denotes |
including |
T15213 |
36798-36803 |
JJ |
denotes |
other |
T15214 |
36804-36809 |
NNP |
denotes |
BCL-2 |
T15215 |
36810-36816 |
NN |
denotes |
family |
T15216 |
36817-36824 |
NNS |
denotes |
members |
T15217 |
36825-36828 |
CC |
denotes |
and |
T15218 |
36829-36838 |
NN |
denotes |
inhibitor |
T15219 |
36839-36841 |
IN |
denotes |
of |
T15220 |
36842-36851 |
NN |
denotes |
apoptosis |
T15221 |
36852-36853 |
-LRB- |
denotes |
( |
T15222 |
36853-36856 |
NNP |
denotes |
IAP |
T15223 |
36856-36857 |
-RRB- |
denotes |
) |
T15224 |
36858-36866 |
NNS |
denotes |
proteins |
T15225 |
36867-36872 |
WDT |
denotes |
which |
T15226 |
36873-36876 |
VBP |
denotes |
are |
T15227 |
36877-36887 |
NNS |
denotes |
regulators |
T15228 |
36888-36890 |
IN |
denotes |
of |
T15229 |
36891-36900 |
NN |
denotes |
apoptosis |
T15230 |
36901-36904 |
CC |
denotes |
and |
T15231 |
36905-36913 |
NN |
denotes |
function |
T15232 |
36914-36922 |
RB |
denotes |
upstream |
T15233 |
36923-36925 |
IN |
denotes |
of |
T15234 |
36926-36934 |
NNS |
denotes |
caspases |
T15235 |
36935-36936 |
NNP |
denotes |
[ |
T15236 |
36936-36938 |
CD |
denotes |
44 |
T15237 |
36938-36939 |
NNP |
denotes |
] |
T15238 |
36939-36940 |
. |
denotes |
. |
T15239 |
36941-36943 |
PRP |
denotes |
It |
T15240 |
36944-36947 |
VBZ |
denotes |
has |
T15241 |
36948-36952 |
VBN |
denotes |
been |
T15242 |
36953-36958 |
VBN |
denotes |
shown |
T15243 |
36959-36963 |
IN |
denotes |
that |
T15244 |
36964-36979 |
NN |
denotes |
phosphorylation |
T15245 |
36980-36982 |
IN |
denotes |
of |
T15246 |
36983-36986 |
NNS |
denotes |
p65 |
T15247 |
36987-36989 |
IN |
denotes |
at |
T15248 |
36990-36996 |
NNP |
denotes |
Ser276 |
T15249 |
36997-37005 |
VBZ |
denotes |
prevents |
T15250 |
37006-37009 |
PRP$ |
denotes |
its |
T15251 |
37010-37021 |
NN |
denotes |
degradation |
T15252 |
37022-37024 |
IN |
denotes |
by |
T15253 |
37025-37043 |
JJ |
denotes |
ubiquitin-mediated |
T15254 |
37044-37055 |
NN |
denotes |
proteolysis |
T15255 |
37056-37059 |
CC |
denotes |
and |
T15256 |
37060-37068 |
VBZ |
denotes |
promotes |
T15257 |
37069-37073 |
NN |
denotes |
cell |
T15258 |
37074-37082 |
NN |
denotes |
survival |
T15259 |
37083-37085 |
IN |
denotes |
in |
T15260 |
37086-37090 |
NNP |
denotes |
HeLa |
T15261 |
37091-37096 |
NNS |
denotes |
cells |
T15262 |
37097-37098 |
NNP |
denotes |
[ |
T15263 |
37098-37100 |
CD |
denotes |
24 |
T15264 |
37100-37101 |
NNP |
denotes |
] |
T15265 |
37101-37102 |
. |
denotes |
. |
T15266 |
37103-37105 |
IN |
denotes |
In |
T15267 |
37106-37114 |
NN |
denotes |
addition |
T15268 |
37115-37117 |
TO |
denotes |
to |
T15269 |
37118-37124 |
JJ |
denotes |
BCL-xL |
T15270 |
37125-37135 |
NN |
denotes |
expression |
T15271 |
37136-37138 |
IN |
denotes |
as |
T15272 |
37139-37147 |
VBN |
denotes |
examined |
T15273 |
37148-37150 |
IN |
denotes |
in |
T15274 |
37151-37155 |
DT |
denotes |
this |
T15275 |
37156-37161 |
NN |
denotes |
study |
T15276 |
37161-37162 |
, |
denotes |
, |
T15277 |
37163-37165 |
PRP |
denotes |
we |
T15278 |
37166-37169 |
VBP |
denotes |
are |
T15279 |
37170-37180 |
VBG |
denotes |
evaluating |
T15280 |
37181-37184 |
DT |
denotes |
the |
T15281 |
37185-37196 |
NN |
denotes |
possibility |
T15282 |
37197-37201 |
IN |
denotes |
that |
T15283 |
37202-37216 |
JJ |
denotes |
PKCα-regulated |
T15284 |
37217-37222 |
NN |
denotes |
NF-κB |
T15285 |
37223-37231 |
NN |
denotes |
activity |
T15286 |
37232-37243 |
VBZ |
denotes |
upregulates |
T15287 |
37244-37254 |
JJ |
denotes |
additional |
T15288 |
37255-37269 |
JJ |
denotes |
anti-apoptotic |
T15289 |
37270-37275 |
NNS |
denotes |
genes |
T15290 |
37276-37278 |
IN |
denotes |
in |
T15291 |
37279-37281 |
DT |
denotes |
an |
T15292 |
37282-37297 |
JJ |
denotes |
M-CSF-dependent |
T15293 |
37298-37305 |
NN |
denotes |
fashion |
T15294 |
37306-37308 |
TO |
denotes |
to |
T15295 |
37309-37317 |
VB |
denotes |
modulate |
T15296 |
37318-37322 |
NN |
denotes |
cell |
T15297 |
37323-37331 |
NN |
denotes |
survival |
T15298 |
37331-37332 |
. |
denotes |
. |
T15299 |
37333-37336 |
DT |
denotes |
The |
T15300 |
37337-37340 |
NN |
denotes |
use |
T15301 |
37341-37343 |
IN |
denotes |
of |
T15302 |
37344-37354 |
NNS |
denotes |
inhibitors |
T15303 |
37355-37358 |
CC |
denotes |
and |
T15304 |
37359-37364 |
NN |
denotes |
siRNA |
T15305 |
37365-37367 |
IN |
denotes |
in |
T15306 |
37368-37371 |
PRP$ |
denotes |
our |
T15307 |
37372-37377 |
NN |
denotes |
study |
T15308 |
37378-37381 |
VBZ |
denotes |
has |
T15309 |
37382-37385 |
RB |
denotes |
not |
T15310 |
37386-37391 |
VBN |
denotes |
ruled |
T15311 |
37392-37395 |
RP |
denotes |
out |
T15312 |
37396-37400 |
IN |
denotes |
that |
T15313 |
37401-37406 |
JJ |
denotes |
other |
T15314 |
37407-37419 |
JJ |
denotes |
conventional |
T15315 |
37420-37424 |
NNS |
denotes |
PKCs |
T15316 |
37425-37430 |
MD |
denotes |
might |
T15317 |
37431-37435 |
RB |
denotes |
also |
T15318 |
37436-37438 |
VB |
denotes |
be |
T15319 |
37439-37448 |
JJ |
denotes |
important |
T15320 |
37449-37451 |
IN |
denotes |
in |
T15321 |
37452-37465 |
JJ |
denotes |
M-CSF-induced |
T15322 |
37466-37471 |
NN |
denotes |
NF-κB |
T15323 |
37472-37482 |
NN |
denotes |
activation |
T15324 |
37483-37486 |
CC |
denotes |
and |
T15325 |
37487-37497 |
NN |
denotes |
macrophage |
T15326 |
37498-37506 |
NN |
denotes |
survival |
T15327 |
37506-37507 |
. |
denotes |
. |
T15328 |
37508-37510 |
IN |
denotes |
In |
T15329 |
37511-37519 |
NN |
denotes |
contrast |
T15330 |
37520-37522 |
TO |
denotes |
to |
T15331 |
37523-37526 |
DT |
denotes |
the |
T15332 |
37527-37534 |
NNS |
denotes |
actions |
T15333 |
37535-37537 |
IN |
denotes |
of |
T15334 |
37538-37542 |
NNP |
denotes |
PKCα |
T15335 |
37543-37553 |
NN |
denotes |
activation |
T15336 |
37554-37556 |
IN |
denotes |
of |
T15337 |
37557-37562 |
JJ |
denotes |
other |
T15338 |
37563-37575 |
JJ |
denotes |
conventional |
T15339 |
37576-37579 |
NNP |
denotes |
PKC |
T15340 |
37580-37588 |
NNS |
denotes |
isoforms |
T15341 |
37588-37589 |
, |
denotes |
, |
T15342 |
37590-37594 |
IN |
denotes |
like |
T15343 |
37595-37600 |
NNP |
denotes |
PKCβI |
T15344 |
37600-37601 |
NNP |
denotes |
/ |
T15345 |
37601-37604 |
NNP |
denotes |
βII |
T15346 |
37604-37605 |
, |
denotes |
, |
T15347 |
37606-37612 |
VBP |
denotes |
appear |
T15348 |
37613-37622 |
JJ |
denotes |
necessary |
T15349 |
37623-37626 |
IN |
denotes |
for |
T15350 |
37627-37637 |
NN |
denotes |
macrophage |
T15351 |
37638-37647 |
NN |
denotes |
apoptosis |
T15352 |
37647-37648 |
. |
denotes |
. |
T15353 |
37649-37652 |
DT |
denotes |
The |
T15354 |
37653-37658 |
NNP |
denotes |
PKCβI |
T15355 |
37658-37659 |
NNP |
denotes |
/ |
T15356 |
37659-37662 |
NNP |
denotes |
βII |
T15357 |
37663-37671 |
NNS |
denotes |
isoforms |
T15358 |
37672-37675 |
VBP |
denotes |
are |
T15359 |
37676-37685 |
VBN |
denotes |
expressed |
T15360 |
37686-37688 |
IN |
denotes |
in |
T15361 |
37689-37698 |
JJ |
denotes |
apoptotic |
T15362 |
37699-37703 |
NNP |
denotes |
U937 |
T15363 |
37704-37718 |
JJ |
denotes |
myelomonocytic |
T15364 |
37719-37724 |
NNS |
denotes |
cells |
T15365 |
37725-37726 |
NNP |
denotes |
[ |
T15366 |
37726-37728 |
CD |
denotes |
45 |
T15367 |
37728-37729 |
NNP |
denotes |
] |
T15368 |
37729-37730 |
. |
denotes |
. |
T15369 |
37731-37734 |
DT |
denotes |
The |
T15370 |
37735-37740 |
JJ |
denotes |
human |
T15371 |
37741-37748 |
JJ |
denotes |
myeloid |
T15372 |
37749-37753 |
NN |
denotes |
cell |
T15373 |
37754-37758 |
NN |
denotes |
line |
T15374 |
37759-37765 |
NN |
denotes |
HL-525 |
T15375 |
37766-37771 |
WDT |
denotes |
which |
T15376 |
37772-37774 |
VBZ |
denotes |
is |
T15377 |
37775-37781 |
JJ |
denotes |
devoid |
T15378 |
37782-37784 |
IN |
denotes |
of |
T15379 |
37785-37795 |
JJ |
denotes |
endogenous |
T15380 |
37796-37802 |
NNP |
denotes |
PKCβII |
T15381 |
37803-37805 |
VBZ |
denotes |
is |
T15382 |
37806-37815 |
JJ |
denotes |
resistant |
T15383 |
37816-37818 |
TO |
denotes |
to |
T15384 |
37819-37831 |
JJ |
denotes |
TNFα-induced |
T15385 |
37832-37841 |
NN |
denotes |
apoptosis |
T15386 |
37842-37843 |
NNP |
denotes |
[ |
T15387 |
37843-37845 |
CD |
denotes |
46 |
T15388 |
37845-37846 |
NNP |
denotes |
] |
T15389 |
37846-37847 |
. |
denotes |
. |
T15390 |
37848-37861 |
NN |
denotes |
Re-expression |
T15391 |
37862-37864 |
IN |
denotes |
of |
T15392 |
37865-37871 |
NNP |
denotes |
PKCβII |
T15393 |
37872-37874 |
IN |
denotes |
in |
T15394 |
37875-37881 |
NNP |
denotes |
HL-525 |
T15395 |
37882-37887 |
NNS |
denotes |
cells |
T15396 |
37888-37896 |
VBZ |
denotes |
restores |
T15397 |
37897-37902 |
PRP$ |
denotes |
their |
T15398 |
37903-37917 |
NN |
denotes |
susceptibility |
T15399 |
37918-37920 |
TO |
denotes |
to |
T15400 |
37921-37933 |
JJ |
denotes |
TNFα-induced |
T15401 |
37934-37943 |
NN |
denotes |
apoptosis |
T15402 |
37944-37952 |
VBG |
denotes |
implying |
T15403 |
37953-37957 |
IN |
denotes |
that |
T15404 |
37958-37964 |
NNP |
denotes |
PKCβII |
T15405 |
37965-37967 |
VBZ |
denotes |
is |
T15406 |
37968-37981 |
JJ |
denotes |
pro-apoptotic |
T15407 |
37982-37985 |
CC |
denotes |
and |
T15408 |
37986-37989 |
MD |
denotes |
may |
T15409 |
37990-37992 |
VB |
denotes |
be |
T15410 |
37993-38001 |
VBN |
denotes |
required |
T15411 |
38002-38004 |
TO |
denotes |
to |
T15412 |
38005-38011 |
VB |
denotes |
induce |
T15413 |
38012-38022 |
NN |
denotes |
macrophage |
T15414 |
38023-38032 |
NN |
denotes |
apoptosis |
T15415 |
38032-38033 |
. |
denotes |
. |
T15416 |
38034-38040 |
JJ |
denotes |
Recent |
T15417 |
38041-38048 |
NNS |
denotes |
studies |
T15418 |
38049-38061 |
VBD |
denotes |
demonstrated |
T15419 |
38062-38066 |
IN |
denotes |
that |
T15420 |
38067-38072 |
JJ |
denotes |
NF-κB |
T15421 |
38073-38088 |
JJ |
denotes |
transcriptional |
T15422 |
38089-38097 |
NN |
denotes |
activity |
T15423 |
38098-38101 |
MD |
denotes |
can |
T15424 |
38102-38104 |
VB |
denotes |
be |
T15425 |
38105-38114 |
VBN |
denotes |
regulated |
T15426 |
38115-38117 |
IN |
denotes |
by |
T15427 |
38118-38133 |
NN |
denotes |
phosphorylation |
T15428 |
38134-38136 |
IN |
denotes |
of |
T15429 |
38137-38140 |
DT |
denotes |
the |
T15430 |
38141-38146 |
NNP |
denotes |
NF-κB |
T15431 |
38147-38150 |
CD |
denotes |
p65 |
T15432 |
38151-38158 |
NN |
denotes |
subunit |
T15433 |
38159-38161 |
IN |
denotes |
in |
T15434 |
38162-38165 |
DT |
denotes |
the |
T15435 |
38166-38173 |
NN |
denotes |
absence |
T15436 |
38174-38176 |
IN |
denotes |
of |
T15437 |
38177-38181 |
NNP |
denotes |
IκBα |
T15438 |
38182-38193 |
NN |
denotes |
degradation |
T15439 |
38194-38195 |
NNP |
denotes |
[ |
T15440 |
38195-38197 |
CD |
denotes |
47 |
T15441 |
38197-38198 |
NNP |
denotes |
] |
T15442 |
38198-38199 |
. |
denotes |
. |
T15443 |
38200-38202 |
IN |
denotes |
By |
T15444 |
38203-38207 |
DT |
denotes |
this |
T15445 |
38208-38215 |
NN |
denotes |
pathway |
T15446 |
38215-38216 |
, |
denotes |
, |
T15447 |
38217-38232 |
NN |
denotes |
phosphorylation |
T15448 |
38233-38235 |
IN |
denotes |
of |
T15449 |
38236-38241 |
JJ |
denotes |
NF-κB |
T15450 |
38242-38251 |
VBZ |
denotes |
regulates |
T15451 |
38252-38255 |
PRP$ |
denotes |
its |
T15452 |
38256-38267 |
NN |
denotes |
interaction |
T15453 |
38268-38272 |
IN |
denotes |
with |
T15454 |
38273-38278 |
JJ |
denotes |
other |
T15455 |
38279-38289 |
NNS |
denotes |
components |
T15456 |
38290-38292 |
IN |
denotes |
of |
T15457 |
38293-38296 |
DT |
denotes |
the |
T15458 |
38297-38302 |
JJ |
denotes |
basal |
T15459 |
38303-38318 |
JJ |
denotes |
transcriptional |
T15460 |
38319-38328 |
NN |
denotes |
machinery |
T15461 |
38329-38336 |
IN |
denotes |
without |
T15462 |
38337-38346 |
VBG |
denotes |
affecting |
T15463 |
38347-38350 |
PRP$ |
denotes |
its |
T15464 |
38351-38361 |
NN |
denotes |
capability |
T15465 |
38362-38364 |
TO |
denotes |
to |
T15466 |
38365-38369 |
NN |
denotes |
bind |
T15467 |
38370-38373 |
NNP |
denotes |
DNA |
T15468 |
38374-38375 |
NNP |
denotes |
[ |
T15469 |
38375-38377 |
CD |
denotes |
21 |
T15470 |
38377-38378 |
NNP |
denotes |
] |
T15471 |
38378-38379 |
. |
denotes |
. |
T15472 |
38380-38385 |
IN |
denotes |
Since |
T15473 |
38386-38391 |
NNP |
denotes |
NF-κB |
T15474 |
38392-38395 |
MD |
denotes |
can |
T15475 |
38396-38400 |
NN |
denotes |
bind |
T15476 |
38401-38404 |
DT |
denotes |
the |
T15477 |
38405-38414 |
NNS |
denotes |
promoters |
T15478 |
38415-38417 |
IN |
denotes |
of |
T15479 |
38418-38426 |
JJ |
denotes |
numerous |
T15480 |
38427-38431 |
NN |
denotes |
gene |
T15481 |
38432-38439 |
NNS |
denotes |
targets |
T15482 |
38439-38440 |
, |
denotes |
, |
T15483 |
38441-38459 |
JJ |
denotes |
post-translational |
T15484 |
38460-38472 |
NN |
denotes |
modification |
T15485 |
38473-38475 |
IN |
denotes |
of |
T15486 |
38476-38481 |
NNP |
denotes |
NF-κB |
T15487 |
38482-38485 |
NNS |
denotes |
p65 |
T15488 |
38486-38489 |
MD |
denotes |
may |
T15489 |
38490-38496 |
VB |
denotes |
affect |
T15490 |
38497-38500 |
PRP$ |
denotes |
its |
T15491 |
38501-38512 |
NN |
denotes |
interaction |
T15492 |
38513-38517 |
IN |
denotes |
with |
T15493 |
38518-38523 |
JJ |
denotes |
other |
T15494 |
38524-38532 |
NNS |
denotes |
proteins |
T15495 |
38532-38533 |
, |
denotes |
, |
T15496 |
38534-38542 |
VBG |
denotes |
refining |
T15497 |
38543-38546 |
DT |
denotes |
the |
T15498 |
38547-38557 |
NN |
denotes |
expression |
T15499 |
38558-38560 |
IN |
denotes |
of |
T15500 |
38561-38565 |
NN |
denotes |
gene |
T15501 |
38566-38573 |
NNS |
denotes |
targets |
T15502 |
38573-38574 |
. |
denotes |
. |
T15503 |
38575-38577 |
PRP |
denotes |
We |
T15504 |
38578-38581 |
VBD |
denotes |
did |
T15505 |
38582-38585 |
RB |
denotes |
not |
T15506 |
38586-38590 |
VB |
denotes |
find |
T15507 |
38591-38595 |
DT |
denotes |
that |
T15508 |
38596-38599 |
NNP |
denotes |
PKC |
T15509 |
38600-38603 |
VBD |
denotes |
was |
T15510 |
38604-38612 |
VBN |
denotes |
involved |
T15511 |
38613-38615 |
IN |
denotes |
in |
T15512 |
38616-38620 |
NNP |
denotes |
IκBα |
T15513 |
38621-38632 |
NN |
denotes |
degradation |
T15514 |
38633-38635 |
CC |
denotes |
or |
T15515 |
38636-38641 |
NN |
denotes |
NF-κB |
T15516 |
38642-38645 |
NNS |
denotes |
p65 |
T15517 |
38646-38653 |
JJ |
denotes |
nuclear |
T15518 |
38654-38667 |
NN |
denotes |
translocation |
T15519 |
38668-38675 |
VBN |
denotes |
induced |
T15520 |
38676-38678 |
IN |
denotes |
by |
T15521 |
38679-38684 |
NNP |
denotes |
M-CSF |
T15522 |
38684-38685 |
, |
denotes |
, |
T15523 |
38686-38689 |
CC |
denotes |
but |
T15524 |
38690-38694 |
DT |
denotes |
that |
T15525 |
38695-38708 |
JJ |
denotes |
M-CSF-induced |
T15526 |
38709-38724 |
NN |
denotes |
phosphorylation |
T15527 |
38725-38727 |
IN |
denotes |
of |
T15528 |
38728-38733 |
NNP |
denotes |
NF-κB |
T15529 |
38734-38737 |
NNS |
denotes |
p65 |
T15530 |
38738-38740 |
IN |
denotes |
at |
T15531 |
38741-38747 |
NNP |
denotes |
Ser276 |
T15532 |
38748-38751 |
VBD |
denotes |
was |
T15533 |
38752-38764 |
RB |
denotes |
dramatically |
T15534 |
38765-38772 |
VBN |
denotes |
reduced |
T15535 |
38773-38775 |
IN |
denotes |
by |
T15536 |
38776-38779 |
DT |
denotes |
the |
T15537 |
38780-38792 |
JJ |
denotes |
conventional |
T15538 |
38793-38796 |
NNP |
denotes |
PKC |
T15539 |
38797-38806 |
NN |
denotes |
inhibitor |
T15540 |
38807-38810 |
CC |
denotes |
and |
T15541 |
38811-38817 |
NN |
denotes |
kinase |
T15542 |
38818-38827 |
NN |
denotes |
deficient |
T15543 |
38828-38832 |
NNP |
denotes |
PKCα |
T15544 |
38833-38836 |
CC |
denotes |
and |
T15545 |
38837-38839 |
IN |
denotes |
by |
T15546 |
38840-38845 |
NNP |
denotes |
siRNA |
T15547 |
38846-38853 |
IN |
denotes |
towards |
T15548 |
38854-38858 |
NNP |
denotes |
PKCα |
T15549 |
38858-38859 |
. |
denotes |
. |
T15550 |
38860-38867 |
JJ |
denotes |
Current |
T15551 |
38868-38875 |
NNS |
denotes |
studies |
T15552 |
38876-38879 |
VBP |
denotes |
are |
T15553 |
38880-38888 |
JJ |
denotes |
underway |
T15554 |
38889-38891 |
TO |
denotes |
to |
T15555 |
38892-38901 |
VB |
denotes |
delineate |
T15556 |
38902-38905 |
DT |
denotes |
the |
T15557 |
38906-38913 |
NN |
denotes |
protein |
T15558 |
38914-38923 |
NNS |
denotes |
complexes |
T15559 |
38924-38930 |
VBN |
denotes |
formed |
T15560 |
38931-38933 |
IN |
denotes |
by |
T15561 |
38934-38943 |
VBN |
denotes |
activated |
T15562 |
38944-38949 |
NNP |
denotes |
NF-κB |
T15563 |
38950-38953 |
CC |
denotes |
and |
T15564 |
38954-38959 |
JJ |
denotes |
other |
T15565 |
38960-38975 |
JJ |
denotes |
transcriptional |
T15566 |
38976-38989 |
NNS |
denotes |
co-activators |
T15567 |
38990-38992 |
IN |
denotes |
in |
T15568 |
38993-39001 |
NN |
denotes |
response |
T15569 |
39002-39004 |
TO |
denotes |
to |
T15570 |
39005-39010 |
NNP |
denotes |
M-CSF |
T15571 |
39011-39014 |
CC |
denotes |
and |
T15572 |
39015-39018 |
NNP |
denotes |
PKC |
T15573 |
39019-39029 |
NN |
denotes |
activation |
T15574 |
39029-39030 |
. |
denotes |
. |
T15575 |
39031-39039 |
RB |
denotes |
Recently |
T15576 |
39040-39047 |
NNS |
denotes |
studies |
T15577 |
39048-39057 |
VBD |
denotes |
indicated |
T15578 |
39058-39062 |
IN |
denotes |
that |
T15579 |
39063-39066 |
DT |
denotes |
the |
T15580 |
39067-39080 |
JJ |
denotes |
non-canonical |
T15581 |
39081-39088 |
NN |
denotes |
pathway |
T15582 |
39089-39092 |
VBD |
denotes |
was |
T15583 |
39093-39102 |
VBN |
denotes |
activated |
T15584 |
39103-39109 |
IN |
denotes |
during |
T15585 |
39110-39115 |
JJ |
denotes |
human |
T15586 |
39116-39135 |
NN |
denotes |
monocyte-macrophage |
T15587 |
39136-39151 |
NN |
denotes |
differentiation |
T15588 |
39152-39153 |
NNP |
denotes |
[ |
T15589 |
39153-39155 |
CD |
denotes |
48 |
T15590 |
39155-39156 |
NNP |
denotes |
] |
T15591 |
39156-39157 |
. |
denotes |
. |
T15592 |
39158-39164 |
IN |
denotes |
During |
T15593 |
39165-39169 |
DT |
denotes |
this |
T15594 |
39170-39177 |
NN |
denotes |
process |
T15595 |
39177-39178 |
, |
denotes |
, |
T15596 |
39179-39189 |
NN |
denotes |
expression |
T15597 |
39190-39192 |
IN |
denotes |
of |
T15598 |
39193-39197 |
NNP |
denotes |
IKKα |
T15599 |
39198-39203 |
IN |
denotes |
among |
T15600 |
39204-39209 |
JJ |
denotes |
other |
T15601 |
39210-39218 |
NNS |
denotes |
proteins |
T15602 |
39218-39219 |
, |
denotes |
, |
T15603 |
39220-39222 |
VBZ |
denotes |
is |
T15604 |
39223-39231 |
JJ |
denotes |
elevated |
T15605 |
39232-39239 |
VBG |
denotes |
leading |
T15606 |
39240-39242 |
TO |
denotes |
to |
T15607 |
39243-39252 |
VBN |
denotes |
increased |
T15608 |
39253-39256 |
CD |
denotes |
p52 |
T15609 |
39257-39262 |
NNP |
denotes |
NF-κB |
T15610 |
39263-39264 |
-LRB- |
denotes |
( |
T15611 |
39264-39268 |
NNP |
denotes |
relB |
T15612 |
39268-39269 |
-RRB- |
denotes |
) |
T15613 |
39270-39280 |
NN |
denotes |
expression |
T15614 |
39281-39288 |
IN |
denotes |
through |
T15615 |
39289-39296 |
JJ |
denotes |
partial |
T15616 |
39297-39308 |
JJ |
denotes |
proteolytic |
T15617 |
39309-39320 |
NN |
denotes |
degradation |
T15618 |
39321-39323 |
IN |
denotes |
of |
T15619 |
39324-39327 |
DT |
denotes |
the |
T15620 |
39328-39332 |
CD |
denotes |
p100 |
T15621 |
39333-39338 |
NN |
denotes |
NF-κB |
T15622 |
39339-39346 |
NN |
denotes |
protein |
T15623 |
39346-39347 |
. |
denotes |
. |
T15624 |
39348-39352 |
RB |
denotes |
Thus |
T15625 |
39352-39353 |
, |
denotes |
, |
T15626 |
39354-39356 |
PRP |
denotes |
it |
T15627 |
39357-39359 |
VBZ |
denotes |
is |
T15628 |
39360-39368 |
JJ |
denotes |
possible |
T15629 |
39369-39373 |
IN |
denotes |
that |
T15630 |
39374-39379 |
NNP |
denotes |
M-CSF |
T15631 |
39380-39389 |
VBZ |
denotes |
regulates |
T15632 |
39390-39398 |
NN |
denotes |
monocyte |
T15633 |
39399-39407 |
NN |
denotes |
survival |
T15634 |
39408-39415 |
IN |
denotes |
through |
T15635 |
39416-39420 |
DT |
denotes |
both |
T15636 |
39421-39424 |
DT |
denotes |
the |
T15637 |
39425-39434 |
JJ |
denotes |
canonical |
T15638 |
39435-39438 |
CC |
denotes |
and |
T15639 |
39439-39452 |
JJ |
denotes |
non-canonical |
T15640 |
39453-39458 |
NN |
denotes |
NF-κB |
T15641 |
39459-39467 |
NNS |
denotes |
pathways |
T15642 |
39467-39468 |
, |
denotes |
, |
T15643 |
39469-39474 |
WDT |
denotes |
which |
T15644 |
39475-39479 |
MD |
denotes |
will |
T15645 |
39480-39482 |
VB |
denotes |
be |
T15646 |
39483-39484 |
DT |
denotes |
a |
T15647 |
39485-39490 |
NN |
denotes |
focus |
T15648 |
39491-39493 |
IN |
denotes |
in |
T15649 |
39494-39500 |
JJ |
denotes |
future |
T15650 |
39501-39509 |
NN |
denotes |
research |
T15651 |
39509-39510 |
. |
denotes |
. |
T15652 |
39511-39513 |
PRP |
denotes |
We |
T15653 |
39514-39524 |
RB |
denotes |
previously |
T15654 |
39525-39531 |
VBD |
denotes |
showed |
T15655 |
39532-39536 |
IN |
denotes |
that |
T15656 |
39537-39542 |
NNP |
denotes |
M-CSF |
T15657 |
39543-39550 |
VBD |
denotes |
reduced |
T15658 |
39551-39560 |
JJ |
denotes |
caspase-3 |
T15659 |
39561-39564 |
CC |
denotes |
and |
T15660 |
39565-39567 |
JJ |
denotes |
-9 |
T15661 |
39568-39576 |
NN |
denotes |
activity |
T15662 |
39577-39580 |
CC |
denotes |
and |
T15663 |
39581-39590 |
VBD |
denotes |
prevented |
T15664 |
39591-39599 |
NN |
denotes |
monocyte |
T15665 |
39600-39609 |
NN |
denotes |
apoptosis |
T15666 |
39610-39611 |
NNP |
denotes |
[ |
T15667 |
39611-39612 |
CD |
denotes |
3 |
T15668 |
39612-39613 |
NNP |
denotes |
] |
T15669 |
39613-39614 |
. |
denotes |
. |
T15670 |
39615-39619 |
DT |
denotes |
This |
T15671 |
39620-39625 |
NN |
denotes |
study |
T15672 |
39626-39633 |
VBZ |
denotes |
reveals |
T15673 |
39634-39638 |
IN |
denotes |
that |
T15674 |
39639-39648 |
NN |
denotes |
treatment |
T15675 |
39649-39651 |
IN |
denotes |
of |
T15676 |
39652-39661 |
NNS |
denotes |
monocytes |
T15677 |
39662-39666 |
IN |
denotes |
with |
T15678 |
39667-39679 |
JJ |
denotes |
conventional |
T15679 |
39680-39683 |
NNP |
denotes |
PKC |
T15680 |
39684-39694 |
NNS |
denotes |
inhibitors |
T15681 |
39694-39695 |
, |
denotes |
, |
T15682 |
39696-39698 |
CC |
denotes |
or |
T15683 |
39699-39713 |
NN |
denotes |
overexpression |
T15684 |
39714-39716 |
IN |
denotes |
of |
T15685 |
39717-39733 |
JJ |
denotes |
kinase-deficient |
T15686 |
39734-39738 |
NNP |
denotes |
PKCα |
T15687 |
39739-39746 |
VBD |
denotes |
blocked |
T15688 |
39747-39760 |
JJ |
denotes |
M-CSF-induced |
T15689 |
39761-39765 |
NN |
denotes |
cell |
T15690 |
39766-39774 |
NN |
denotes |
survival |
T15691 |
39774-39775 |
. |
denotes |
. |
T15692 |
39776-39779 |
PRP$ |
denotes |
Our |
T15693 |
39780-39784 |
NNS |
denotes |
data |
T15694 |
39785-39793 |
VBD |
denotes |
revealed |
T15695 |
39794-39798 |
IN |
denotes |
that |
T15696 |
39799-39811 |
JJ |
denotes |
conventional |
T15697 |
39812-39816 |
NNS |
denotes |
PKCs |
T15698 |
39817-39820 |
VBP |
denotes |
are |
T15699 |
39821-39829 |
RB |
denotes |
upstream |
T15700 |
39830-39832 |
IN |
denotes |
of |
T15701 |
39833-39838 |
JJ |
denotes |
NF-κB |
T15702 |
39839-39849 |
NN |
denotes |
activation |
T15703 |
39850-39852 |
IN |
denotes |
in |
T15704 |
39853-39861 |
NN |
denotes |
response |
T15705 |
39862-39864 |
TO |
denotes |
to |
T15706 |
39865-39870 |
NNP |
denotes |
M-CSF |
T15707 |
39871-39874 |
CC |
denotes |
and |
T15708 |
39875-39882 |
VB |
denotes |
mediate |
T15709 |
39883-39901 |
JJ |
denotes |
post-translational |
T15710 |
39902-39912 |
NN |
denotes |
activation |
T15711 |
39913-39915 |
IN |
denotes |
of |
T15712 |
39916-39921 |
NNP |
denotes |
NF-κB |
T15713 |
39922-39925 |
CD |
denotes |
p65 |
T15714 |
39926-39928 |
IN |
denotes |
by |
T15715 |
39929-39944 |
VBG |
denotes |
phosphorylating |
T15716 |
39945-39951 |
NNP |
denotes |
Ser276 |
T15717 |
39952-39954 |
TO |
denotes |
to |
T15718 |
39955-39963 |
VB |
denotes |
regulate |
T15719 |
39964-39968 |
NN |
denotes |
gene |
T15720 |
39969-39982 |
NN |
denotes |
transcription |
T15721 |
39983-39986 |
CC |
denotes |
and |
T15722 |
39987-39991 |
NN |
denotes |
cell |
T15723 |
39992-40000 |
NN |
denotes |
survival |
T15724 |
40000-40001 |
. |
denotes |
. |
T15725 |
40002-40006 |
RB |
denotes |
Thus |
T15726 |
40006-40007 |
, |
denotes |
, |
T15727 |
40008-40011 |
PRP$ |
denotes |
our |
T15728 |
40012-40023 |
NN |
denotes |
observation |
T15729 |
40024-40027 |
MD |
denotes |
may |
T15730 |
40028-40035 |
VB |
denotes |
provide |
T15731 |
40036-40043 |
NN |
denotes |
insight |
T15732 |
40044-40046 |
IN |
denotes |
in |
T15733 |
40047-40056 |
JJ |
denotes |
potential |
T15734 |
40057-40068 |
JJ |
denotes |
therapeutic |
T15735 |
40069-40076 |
NNS |
denotes |
targets |
T15736 |
40077-40080 |
IN |
denotes |
for |
T15737 |
40081-40093 |
JJ |
denotes |
inflammatory |
T15738 |
40094-40102 |
NNS |
denotes |
diseases |
T15739 |
40102-40103 |
. |
denotes |
. |
T18733 |
40128-40137 |
NNPS |
denotes |
Materials |
T18734 |
40138-40149 |
NNP |
denotes |
Recombinant |
T18735 |
40150-40155 |
JJ |
denotes |
human |
T18736 |
40156-40161 |
NNP |
denotes |
M-CSF |
T18737 |
40162-40165 |
VBD |
denotes |
was |
T18738 |
40166-40175 |
VBN |
denotes |
purchased |
T18739 |
40176-40180 |
IN |
denotes |
from |
T18740 |
40181-40184 |
NNP |
denotes |
R&D |
T18741 |
40185-40192 |
NNP |
denotes |
Systems |
T18742 |
40193-40194 |
-LRB- |
denotes |
( |
T18743 |
40194-40205 |
NNP |
denotes |
Minneapolis |
T18744 |
40205-40206 |
, |
denotes |
, |
T18745 |
40207-40209 |
NNP |
denotes |
MN |
T18746 |
40209-40210 |
-RRB- |
denotes |
) |
T18747 |
40210-40211 |
. |
denotes |
. |
T18748 |
40212-40222 |
NN |
denotes |
Ro-31-8220 |
T18749 |
40222-40223 |
, |
denotes |
, |
T18750 |
40224-40231 |
NNP |
denotes |
Gö-6976 |
T18751 |
40231-40232 |
, |
denotes |
, |
T18752 |
40233-40241 |
NNP |
denotes |
Rotterin |
T18753 |
40241-40242 |
, |
denotes |
, |
T18754 |
40243-40246 |
CC |
denotes |
and |
T18755 |
40247-40255 |
NNP |
denotes |
BAPTA/AM |
T18756 |
40256-40260 |
VBD |
denotes |
were |
T18757 |
40261-40269 |
VBN |
denotes |
obtained |
T18758 |
40270-40274 |
IN |
denotes |
from |
T18759 |
40275-40285 |
NNP |
denotes |
Calbiochem |
T18760 |
40286-40287 |
-LRB- |
denotes |
( |
T18761 |
40287-40290 |
NNP |
denotes |
San |
T18762 |
40291-40296 |
NNP |
denotes |
Diego |
T18763 |
40296-40297 |
, |
denotes |
, |
T18764 |
40298-40300 |
NNP |
denotes |
CA |
T18765 |
40300-40301 |
-RRB- |
denotes |
) |
T18766 |
40301-40302 |
. |
denotes |
. |
T18767 |
40303-40306 |
NNP |
denotes |
Low |
T18768 |
40307-40316 |
NN |
denotes |
endotoxin |
T18769 |
40317-40321 |
NNP |
denotes |
RPMI |
T18770 |
40322-40325 |
CC |
denotes |
and |
T18771 |
40326-40332 |
NNP |
denotes |
X-vivo |
T18772 |
40333-40338 |
VBP |
denotes |
serum |
T18773 |
40339-40343 |
JJ |
denotes |
free |
T18774 |
40344-40350 |
NN |
denotes |
medium |
T18775 |
40351-40355 |
VBD |
denotes |
were |
T18776 |
40356-40364 |
VBN |
denotes |
obtained |
T18777 |
40365-40369 |
IN |
denotes |
from |
T18778 |
40370-40375 |
NNP |
denotes |
Lonza |
T18779 |
40376-40388 |
NNP |
denotes |
Walkersville |
T18780 |
40389-40392 |
NNP |
denotes |
Inc |
T18781 |
40393-40394 |
-LRB- |
denotes |
( |
T18782 |
40394-40406 |
NNP |
denotes |
Walkersville |
T18783 |
40406-40407 |
, |
denotes |
, |
T18784 |
40408-40410 |
NNP |
denotes |
MD |
T18785 |
40410-40411 |
-RRB- |
denotes |
) |
T18786 |
40411-40412 |
. |
denotes |
. |
T18787 |
40413-40418 |
JJ |
denotes |
Fetal |
T18788 |
40419-40425 |
JJ |
denotes |
bovine |
T18789 |
40426-40431 |
NN |
denotes |
serum |
T18790 |
40432-40433 |
-LRB- |
denotes |
( |
T18791 |
40433-40436 |
NNP |
denotes |
FBS |
T18792 |
40436-40437 |
, |
denotes |
, |
T18793 |
40438-40447 |
VBD |
denotes |
certified |
T18794 |
40448-40449 |
CD |
denotes |
< |
T18795 |
40449-40453 |
CD |
denotes |
0.06 |
T18796 |
40454-40463 |
NN |
denotes |
endotoxin |
T18797 |
40464-40472 |
NN |
denotes |
units/ml |
T18798 |
40473-40482 |
NN |
denotes |
endotoxin |
T18799 |
40483-40489 |
NNS |
denotes |
levels |
T18800 |
40489-40490 |
-RRB- |
denotes |
) |
T18801 |
40491-40494 |
VBD |
denotes |
was |
T18802 |
40495-40504 |
VBN |
denotes |
purchased |
T18803 |
40505-40509 |
IN |
denotes |
from |
T18804 |
40510-40517 |
NNP |
denotes |
Atlanta |
T18805 |
40518-40528 |
NNP |
denotes |
Biological |
T18806 |
40529-40530 |
-LRB- |
denotes |
( |
T18807 |
40530-40543 |
NNP |
denotes |
Lawrenceville |
T18808 |
40543-40544 |
, |
denotes |
, |
T18809 |
40545-40547 |
NNP |
denotes |
GA |
T18810 |
40547-40548 |
-RRB- |
denotes |
) |
T18811 |
40548-40549 |
. |
denotes |
. |
T18812 |
40550-40553 |
DT |
denotes |
All |
T18813 |
40554-40559 |
JJ |
denotes |
other |
T18814 |
40560-40564 |
NN |
denotes |
cell |
T18815 |
40565-40572 |
NN |
denotes |
culture |
T18816 |
40573-40581 |
NNS |
denotes |
reagents |
T18817 |
40582-40586 |
VBD |
denotes |
were |
T18818 |
40587-40595 |
VBN |
denotes |
obtained |
T18819 |
40596-40603 |
IN |
denotes |
through |
T18820 |
40604-40614 |
NNP |
denotes |
Invitrogen |
T18821 |
40615-40616 |
-LRB- |
denotes |
( |
T18822 |
40616-40624 |
NNP |
denotes |
Carlsbad |
T18823 |
40624-40625 |
, |
denotes |
, |
T18824 |
40626-40628 |
NNP |
denotes |
CA |
T18825 |
40628-40629 |
-RRB- |
denotes |
) |
T18826 |
40629-40630 |
. |
denotes |
. |
T18827 |
40631-40635 |
NNP |
denotes |
PKCα |
T18828 |
40636-40641 |
NNP |
denotes |
NF-κB |
T18829 |
40642-40645 |
NNS |
denotes |
p65 |
T18830 |
40645-40646 |
, |
denotes |
, |
T18831 |
40647-40652 |
NNP |
denotes |
Lamin |
T18832 |
40653-40654 |
NNP |
denotes |
B |
T18833 |
40654-40655 |
, |
denotes |
, |
T18834 |
40656-40663 |
NN |
denotes |
β-actin |
T18835 |
40663-40664 |
, |
denotes |
, |
T18836 |
40665-40668 |
CC |
denotes |
and |
T18837 |
40669-40674 |
NNP |
denotes |
GAPDH |
T18838 |
40675-40685 |
NNS |
denotes |
antibodies |
T18839 |
40685-40686 |
, |
denotes |
, |
T18840 |
40687-40697 |
JJ |
denotes |
anti-mouse |
T18841 |
40698-40701 |
CC |
denotes |
and |
T18842 |
40702-40708 |
NN |
denotes |
rabbit |
T18843 |
40709-40716 |
JJ |
denotes |
IgG-HRP |
T18844 |
40717-40727 |
VBN |
denotes |
conjugated |
T18845 |
40728-40738 |
NNS |
denotes |
antibodies |
T18846 |
40738-40739 |
, |
denotes |
, |
T18847 |
40740-40743 |
CC |
denotes |
and |
T18848 |
40744-40748 |
NNP |
denotes |
PKCα |
T18849 |
40749-40754 |
NNP |
denotes |
siRNA |
T18850 |
40755-40759 |
VBD |
denotes |
were |
T18851 |
40760-40768 |
VBN |
denotes |
obtained |
T18852 |
40769-40773 |
IN |
denotes |
from |
T18853 |
40774-40779 |
NNP |
denotes |
Santa |
T18854 |
40780-40784 |
NNP |
denotes |
Cruz |
T18855 |
40785-40798 |
NNP |
denotes |
Biotechnology |
T18856 |
40799-40800 |
-LRB- |
denotes |
( |
T18857 |
40800-40805 |
NNP |
denotes |
Santa |
T18858 |
40806-40810 |
NNP |
denotes |
Cruz |
T18859 |
40810-40811 |
, |
denotes |
, |
T18860 |
40812-40814 |
NNP |
denotes |
CA |
T18861 |
40814-40815 |
-RRB- |
denotes |
) |
T18862 |
40815-40816 |
. |
denotes |
. |
T18863 |
40817-40829 |
NNP |
denotes |
Phospho-NFκB |
T18864 |
40830-40833 |
NNS |
denotes |
p65 |
T18865 |
40834-40835 |
-LRB- |
denotes |
( |
T18866 |
40835-40841 |
CD |
denotes |
Ser276 |
T18867 |
40842-40844 |
CC |
denotes |
or |
T18868 |
40845-40851 |
CD |
denotes |
Ser536 |
T18869 |
40851-40852 |
-RRB- |
denotes |
) |
T18870 |
40853-40863 |
NNS |
denotes |
antibodies |
T18871 |
40864-40868 |
VBD |
denotes |
were |
T18872 |
40869-40878 |
VBN |
denotes |
purchased |
T18873 |
40879-40883 |
IN |
denotes |
from |
T18874 |
40884-40888 |
NNP |
denotes |
Cell |
T18875 |
40889-40898 |
NNP |
denotes |
Signaling |
T18876 |
40899-40909 |
NNP |
denotes |
Technology |
T18877 |
40910-40911 |
-LRB- |
denotes |
( |
T18878 |
40911-40918 |
NNP |
denotes |
Danvers |
T18879 |
40918-40919 |
, |
denotes |
, |
T18880 |
40920-40922 |
NNP |
denotes |
MA |
T18881 |
40922-40923 |
-RRB- |
denotes |
) |
T18882 |
40923-40924 |
. |
denotes |
. |
T18883 |
40925-40928 |
NNP |
denotes |
DNA |
T18884 |
40929-40939 |
VBZ |
denotes |
constructs |
T18885 |
40940-40949 |
NNP |
denotes |
pTAL-SEAP |
T18886 |
40950-40953 |
CC |
denotes |
and |
T18887 |
40954-40965 |
NNP |
denotes |
pNF-κB-SEAP |
T18888 |
40966-40970 |
VBD |
denotes |
were |
T18889 |
40971-40979 |
VBN |
denotes |
obtained |
T18890 |
40980-40984 |
IN |
denotes |
from |
T18891 |
40985-40993 |
NNP |
denotes |
Clontech |
T18892 |
40994-40995 |
-LRB- |
denotes |
( |
T18893 |
40995-41003 |
NNP |
denotes |
Mountian |
T18894 |
41004-41008 |
NNP |
denotes |
View |
T18895 |
41008-41009 |
, |
denotes |
, |
T18896 |
41010-41012 |
NNP |
denotes |
CA |
T18897 |
41012-41013 |
-RRB- |
denotes |
) |
T18898 |
41013-41014 |
. |
denotes |
. |
T18899 |
41015-41025 |
NN |
denotes |
Expression |
T18900 |
41026-41033 |
NNS |
denotes |
vectors |
T18901 |
41034-41044 |
VBG |
denotes |
containing |
T18902 |
41045-41052 |
NNP |
denotes |
CMV-p65 |
T18903 |
41053-41055 |
NNP |
denotes |
WT |
T18904 |
41055-41056 |
, |
denotes |
, |
T18905 |
41057-41064 |
NNP |
denotes |
CMV-p65 |
T18906 |
41065-41071 |
NNP |
denotes |
276S/A |
T18907 |
41072-41075 |
CC |
denotes |
and |
T18908 |
41076-41083 |
NNP |
denotes |
CMV-p65 |
T18909 |
41084-41090 |
NNP |
denotes |
536S/A |
T18910 |
41091-41095 |
VBD |
denotes |
were |
T18911 |
41096-41102 |
VBN |
denotes |
cloned |
T18912 |
41103-41105 |
IN |
denotes |
in |
T18913 |
41106-41111 |
NNP |
denotes |
pBa5e |
T18914 |
41112-41116 |
NNP |
denotes |
Puro |
T18915 |
41117-41123 |
NN |
denotes |
vector |
T18916 |
41124-41126 |
CC |
denotes |
or |
T18917 |
41127-41138 |
NN |
denotes |
pFLAG-CMV-2 |
T18918 |
41139-41145 |
NN |
denotes |
vector |
T18919 |
41146-41148 |
IN |
denotes |
as |
T18920 |
41149-41158 |
VBN |
denotes |
described |
T18921 |
41159-41169 |
RB |
denotes |
previously |
T18922 |
41170-41171 |
NNP |
denotes |
[ |
T18923 |
41171-41173 |
CD |
denotes |
49 |
T18924 |
41173-41174 |
NNP |
denotes |
] |
T18925 |
41174-41175 |
. |
denotes |
. |
T18926 |
41176-41182 |
NNP |
denotes |
Kinase |
T18927 |
41183-41192 |
NN |
denotes |
deficient |
T18928 |
41193-41201 |
NNP |
denotes |
CMV-PKCα |
T18929 |
41202-41203 |
-LRB- |
denotes |
( |
T18930 |
41203-41210 |
NNP |
denotes |
KD-PKCα |
T18931 |
41210-41211 |
-RRB- |
denotes |
) |
T18932 |
41212-41214 |
CC |
denotes |
or |
T18933 |
41215-41219 |
JJ |
denotes |
wild |
T18934 |
41220-41224 |
NN |
denotes |
type |
T18935 |
41225-41234 |
NN |
denotes |
pCMV-PKCα |
T18936 |
41235-41236 |
-LRB- |
denotes |
( |
T18937 |
41236-41243 |
NNP |
denotes |
WT-PKCα |
T18938 |
41243-41244 |
-RRB- |
denotes |
) |
T18939 |
41245-41249 |
VBD |
denotes |
were |
T18940 |
41250-41258 |
JJ |
denotes |
generous |
T18941 |
41259-41264 |
NNS |
denotes |
gifts |
T18942 |
41265-41269 |
IN |
denotes |
from |
T18943 |
41270-41279 |
NNP |
denotes |
Alexandra |
T18944 |
41280-41282 |
NNP |
denotes |
C. |
T18945 |
41283-41289 |
NNP |
denotes |
Newton |
T18946 |
41290-41291 |
-LRB- |
denotes |
( |
T18947 |
41291-41301 |
NNP |
denotes |
University |
T18948 |
41302-41304 |
IN |
denotes |
of |
T18949 |
41305-41315 |
NNP |
denotes |
California |
T18950 |
41315-41316 |
, |
denotes |
, |
T18951 |
41317-41320 |
NNP |
denotes |
San |
T18952 |
41321-41326 |
NNP |
denotes |
Diego |
T18953 |
41326-41327 |
, |
denotes |
, |
T18954 |
41328-41330 |
NNP |
denotes |
CA |
T18955 |
41330-41331 |
-RRB- |
denotes |
) |
T18956 |
41331-41332 |
. |
denotes |
. |
T18957 |
41333-41337 |
NNP |
denotes |
IκBα |
T18958 |
41338-41339 |
-LRB- |
denotes |
( |
T18959 |
41339-41345 |
NNP |
denotes |
NFKBIA |
T18960 |
41345-41346 |
-RRB- |
denotes |
) |
T18961 |
41347-41350 |
CC |
denotes |
and |
T18962 |
41351-41356 |
NNP |
denotes |
GAPDH |
T18963 |
41357-41364 |
NNS |
denotes |
primers |
T18964 |
41365-41368 |
IN |
denotes |
for |
T18965 |
41369-41378 |
JJ |
denotes |
real-time |
T18966 |
41379-41385 |
NN |
denotes |
RT-PCR |
T18967 |
41386-41390 |
VBD |
denotes |
were |
T18968 |
41391-41399 |
VBN |
denotes |
obtained |
T18969 |
41400-41404 |
IN |
denotes |
from |
T18970 |
41405-41418 |
NNS |
denotes |
SABiosciences |
T18971 |
41419-41420 |
-LRB- |
denotes |
( |
T18972 |
41420-41429 |
NNP |
denotes |
Frederick |
T18973 |
41429-41430 |
, |
denotes |
, |
T18974 |
41431-41433 |
NNP |
denotes |
MD |
T18975 |
41433-41434 |
-RRB- |
denotes |
) |
T18976 |
41434-41435 |
. |
denotes |
. |
T18977 |
41436-41437 |
DT |
denotes |
A |
T18978 |
41438-41442 |
NN |
denotes |
pool |
T18979 |
41443-41445 |
IN |
denotes |
of |
T18980 |
41446-41451 |
NN |
denotes |
mouse |
T18981 |
41452-41454 |
CC |
denotes |
or |
T18982 |
41455-41460 |
JJ |
denotes |
human |
T18983 |
41461-41465 |
NNP |
denotes |
PKCα |
T18984 |
41466-41474 |
JJ |
denotes |
specific |
T18985 |
41475-41480 |
NNP |
denotes |
siRNA |
T18986 |
41481-41485 |
VBD |
denotes |
were |
T18987 |
41486-41495 |
VBN |
denotes |
purchased |
T18988 |
41496-41500 |
IN |
denotes |
from |
T18989 |
41501-41506 |
NNP |
denotes |
Santa |
T18990 |
41507-41511 |
NNP |
denotes |
Cruz |
T18991 |
41512-41525 |
NNP |
denotes |
Biotechnology |
T18992 |
41526-41527 |
-LRB- |
denotes |
( |
T18993 |
41527-41532 |
NNP |
denotes |
Santa |
T18994 |
41533-41537 |
NNP |
denotes |
cruz |
T18995 |
41537-41538 |
, |
denotes |
, |
T18996 |
41539-41541 |
NNP |
denotes |
CA |
T18997 |
41541-41542 |
-RRB- |
denotes |
) |
T18998 |
41542-41543 |
. |
denotes |
. |
T19447 |
41545-41549 |
NNP |
denotes |
Cell |
T19448 |
41550-41557 |
NNP |
denotes |
Culture |
T19449 |
41558-41561 |
NNP |
denotes |
The |
T19450 |
41562-41568 |
JJ |
denotes |
murine |
T19451 |
41569-41579 |
NN |
denotes |
macrophage |
T19452 |
41580-41584 |
NN |
denotes |
cell |
T19453 |
41585-41589 |
NN |
denotes |
line |
T19454 |
41590-41593 |
NNP |
denotes |
RAW |
T19455 |
41594-41599 |
CD |
denotes |
264.7 |
T19456 |
41600-41603 |
VBD |
denotes |
was |
T19457 |
41604-41613 |
VBN |
denotes |
purchased |
T19458 |
41614-41618 |
IN |
denotes |
from |
T19459 |
41619-41623 |
NNP |
denotes |
ATCC |
T19460 |
41624-41625 |
-LRB- |
denotes |
( |
T19461 |
41625-41633 |
NNP |
denotes |
Manassas |
T19462 |
41633-41634 |
, |
denotes |
, |
T19463 |
41635-41637 |
NNP |
denotes |
VA |
T19464 |
41637-41638 |
-RRB- |
denotes |
) |
T19465 |
41638-41639 |
. |
denotes |
. |
T19466 |
41640-41643 |
NNP |
denotes |
RAW |
T19467 |
41644-41649 |
CD |
denotes |
264.7 |
T19468 |
41650-41655 |
NNS |
denotes |
cells |
T19469 |
41656-41660 |
VBD |
denotes |
were |
T19470 |
41661-41671 |
VBN |
denotes |
maintained |
T19471 |
41672-41674 |
IN |
denotes |
in |
T19472 |
41675-41679 |
NNP |
denotes |
RPMI |
T19473 |
41680-41692 |
VBN |
denotes |
supplemented |
T19474 |
41693-41697 |
IN |
denotes |
with |
T19475 |
41698-41699 |
CD |
denotes |
5 |
T19476 |
41699-41700 |
NN |
denotes |
% |
T19477 |
41701-41704 |
NNP |
denotes |
FBS |
T19478 |
41705-41708 |
CC |
denotes |
and |
T19479 |
41709-41731 |
JJ |
denotes |
antibiotic-antimycotic |
T19480 |
41732-41733 |
-LRB- |
denotes |
( |
T19481 |
41733-41737 |
CD |
denotes |
1000 |
T19482 |
41738-41742 |
NNP |
denotes |
U/ml |
T19483 |
41743-41753 |
NN |
denotes |
penicillin |
T19484 |
41753-41754 |
, |
denotes |
, |
T19485 |
41755-41759 |
CD |
denotes |
1000 |
T19486 |
41760-41762 |
NN |
denotes |
µg |
T19487 |
41762-41763 |
NN |
denotes |
/ |
T19488 |
41763-41765 |
NN |
denotes |
ml |
T19489 |
41766-41778 |
NN |
denotes |
streptomycin |
T19490 |
41779-41786 |
NN |
denotes |
sulfate |
T19491 |
41786-41787 |
, |
denotes |
, |
T19492 |
41788-41791 |
CC |
denotes |
and |
T19493 |
41792-41795 |
CD |
denotes |
250 |
T19494 |
41796-41801 |
JJ |
denotes |
ng/ml |
T19495 |
41802-41814 |
NN |
denotes |
amphotericin |
T19496 |
41815-41816 |
NNP |
denotes |
B |
T19497 |
41816-41817 |
-RRB- |
denotes |
) |
T19498 |
41818-41820 |
IN |
denotes |
at |
T19499 |
41821-41823 |
CD |
denotes |
37 |
T19500 |
41823-41824 |
CD |
denotes |
° |
T19501 |
41824-41826 |
NNP |
denotes |
C. |
T19502 |
41827-41832 |
NNP |
denotes |
Mouse |
T19503 |
41833-41842 |
JJ |
denotes |
embryonic |
T19504 |
41843-41854 |
NNS |
denotes |
fibroblasts |
T19505 |
41855-41856 |
-LRB- |
denotes |
( |
T19506 |
41856-41860 |
NNS |
denotes |
MEFs |
T19507 |
41860-41861 |
-RRB- |
denotes |
) |
T19508 |
41862-41866 |
NN |
denotes |
cell |
T19509 |
41867-41871 |
NN |
denotes |
line |
T19510 |
41872-41879 |
VBG |
denotes |
lacking |
T19511 |
41880-41888 |
JJ |
denotes |
specific |
T19512 |
41889-41893 |
NNP |
denotes |
NFκB |
T19513 |
41894-41903 |
VBG |
denotes |
signaling |
T19514 |
41904-41912 |
NNS |
denotes |
subunits |
T19515 |
41913-41918 |
NNP |
denotes |
NF-κB |
T19516 |
41919-41922 |
NNS |
denotes |
p65 |
T19517 |
41923-41924 |
-LRB- |
denotes |
( |
T19518 |
41924-41927 |
CD |
denotes |
p65 |
T19519 |
41927-41928 |
CD |
denotes |
− |
T19520 |
41928-41929 |
NN |
denotes |
/ |
T19521 |
41929-41930 |
NN |
denotes |
− |
T19522 |
41931-41935 |
NN |
denotes |
cell |
T19523 |
41936-41940 |
NN |
denotes |
line |
T19524 |
41940-41941 |
-RRB- |
denotes |
) |
T19525 |
41942-41943 |
NNP |
denotes |
[ |
T19526 |
41943-41945 |
CD |
denotes |
50 |
T19527 |
41945-41946 |
NNP |
denotes |
] |
T19528 |
41947-41951 |
VBD |
denotes |
were |
T19529 |
41952-41960 |
VBN |
denotes |
cultured |
T19530 |
41961-41963 |
IN |
denotes |
in |
T19531 |
41964-41968 |
NNP |
denotes |
DMEM |
T19532 |
41969-41975 |
NN |
denotes |
medium |
T19533 |
41976-41988 |
VBN |
denotes |
supplemented |
T19534 |
41989-41993 |
IN |
denotes |
with |
T19535 |
41994-41996 |
CD |
denotes |
10 |
T19536 |
41996-41997 |
NN |
denotes |
% |
T19537 |
41998-42001 |
NNP |
denotes |
FBS |
T19538 |
42002-42005 |
CC |
denotes |
and |
T19539 |
42006-42028 |
JJ |
denotes |
antibiotic-antimycotic |
T19540 |
42029-42037 |
NN |
denotes |
solution |
T19541 |
42037-42038 |
. |
denotes |
. |
T19666 |
42040-42052 |
NN |
denotes |
Purification |
T19667 |
42053-42055 |
IN |
denotes |
of |
T19668 |
42056-42066 |
NNP |
denotes |
Peripheral |
T19669 |
42067-42072 |
NNP |
denotes |
Blood |
T19670 |
42073-42082 |
NNPS |
denotes |
Monocytes |
T19671 |
42083-42086 |
CC |
denotes |
and |
T19672 |
42087-42103 |
NNP |
denotes |
Monocyte-Derived |
T19673 |
42104-42115 |
NNP |
denotes |
Macrophages |
T19674 |
42116-42117 |
-LRB- |
denotes |
( |
T19675 |
42117-42121 |
NNP |
denotes |
MDMs |
T19676 |
42121-42122 |
-RRB- |
denotes |
) |
T19677 |
42123-42132 |
NNPS |
denotes |
Monocytes |
T19678 |
42133-42137 |
VBD |
denotes |
were |
T19679 |
42138-42146 |
VBN |
denotes |
isolated |
T19680 |
42147-42151 |
IN |
denotes |
from |
T19681 |
42152-42158 |
NN |
denotes |
source |
T19682 |
42159-42168 |
NN |
denotes |
leukocyte |
T19683 |
42169-42174 |
VBZ |
denotes |
packs |
T19684 |
42175-42183 |
VBN |
denotes |
obtained |
T19685 |
42184-42188 |
IN |
denotes |
from |
T19686 |
42189-42192 |
DT |
denotes |
the |
T19687 |
42193-42201 |
NNP |
denotes |
American |
T19688 |
42202-42205 |
NNP |
denotes |
Red |
T19689 |
42206-42211 |
NNP |
denotes |
Cross |
T19690 |
42212-42214 |
IN |
denotes |
as |
T19691 |
42215-42224 |
VBN |
denotes |
described |
T19692 |
42225-42235 |
RB |
denotes |
previously |
T19693 |
42236-42237 |
NNP |
denotes |
[ |
T19694 |
42237-42239 |
CD |
denotes |
51 |
T19695 |
42239-42240 |
NNP |
denotes |
] |
T19696 |
42240-42241 |
. |
denotes |
. |
T19697 |
42242-42251 |
NNS |
denotes |
Monocytes |
T19698 |
42252-42256 |
VBN |
denotes |
used |
T19699 |
42257-42259 |
IN |
denotes |
in |
T19700 |
42260-42264 |
JJ |
denotes |
real |
T19701 |
42265-42269 |
NN |
denotes |
time |
T19702 |
42270-42273 |
NNP |
denotes |
PCR |
T19703 |
42274-42285 |
NNS |
denotes |
experiments |
T19704 |
42286-42289 |
CC |
denotes |
and |
T19705 |
42290-42302 |
NN |
denotes |
transfection |
T19706 |
42303-42314 |
NNS |
denotes |
experiments |
T19707 |
42315-42319 |
VBD |
denotes |
were |
T19708 |
42320-42328 |
VBN |
denotes |
purified |
T19709 |
42329-42331 |
IN |
denotes |
by |
T19710 |
42332-42340 |
JJ |
denotes |
positive |
T19711 |
42341-42350 |
NN |
denotes |
selection |
T19712 |
42351-42356 |
VBG |
denotes |
using |
T19713 |
42357-42361 |
NNP |
denotes |
CD14 |
T19714 |
42362-42370 |
NNP |
denotes |
Monocyte |
T19715 |
42371-42380 |
NNP |
denotes |
Isolation |
T19716 |
42381-42384 |
NNP |
denotes |
Kit |
T19717 |
42385-42389 |
IN |
denotes |
from |
T19718 |
42390-42398 |
NNP |
denotes |
Miltenyi |
T19719 |
42399-42406 |
NNP |
denotes |
Biotech |
T19720 |
42407-42408 |
-LRB- |
denotes |
( |
T19721 |
42408-42414 |
NNP |
denotes |
Auburn |
T19722 |
42414-42415 |
, |
denotes |
, |
T19723 |
42416-42418 |
NNP |
denotes |
CA |
T19724 |
42418-42419 |
-RRB- |
denotes |
) |
T19725 |
42420-42421 |
-LRB- |
denotes |
( |
T19726 |
42421-42422 |
FW |
denotes |
> |
T19727 |
42422-42424 |
CD |
denotes |
90 |
T19728 |
42424-42425 |
NN |
denotes |
% |
T19729 |
42426-42430 |
JJ |
denotes |
pure |
T19730 |
42430-42431 |
-RRB- |
denotes |
) |
T19731 |
42431-42432 |
. |
denotes |
. |
T19732 |
42433-42435 |
IN |
denotes |
In |
T19733 |
42436-42440 |
DT |
denotes |
some |
T19734 |
42441-42452 |
NNS |
denotes |
experiments |
T19735 |
42452-42453 |
, |
denotes |
, |
T19736 |
42454-42463 |
NNS |
denotes |
monocytes |
T19737 |
42464-42468 |
VBD |
denotes |
were |
T19738 |
42469-42477 |
VBN |
denotes |
isolated |
T19739 |
42478-42480 |
IN |
denotes |
by |
T19740 |
42481-42489 |
VBG |
denotes |
clumping |
T19741 |
42490-42496 |
NN |
denotes |
method |
T19742 |
42497-42498 |
-LRB- |
denotes |
( |
T19743 |
42498-42500 |
CD |
denotes |
70 |
T19744 |
42500-42501 |
NN |
denotes |
% |
T19745 |
42502-42506 |
JJ |
denotes |
pure |
T19746 |
42506-42507 |
-RRB- |
denotes |
) |
T19747 |
42507-42508 |
. |
denotes |
. |
T19748 |
42509-42511 |
TO |
denotes |
To |
T19749 |
42512-42518 |
VB |
denotes |
obtain |
T19750 |
42519-42535 |
JJ |
denotes |
monocyte-derived |
T19751 |
42536-42547 |
NNS |
denotes |
macrophages |
T19752 |
42548-42549 |
-LRB- |
denotes |
( |
T19753 |
42549-42553 |
NNS |
denotes |
MDMs |
T19754 |
42553-42554 |
-RRB- |
denotes |
) |
T19755 |
42554-42555 |
, |
denotes |
, |
T19756 |
42556-42565 |
NNS |
denotes |
monocytes |
T19757 |
42566-42570 |
VBD |
denotes |
were |
T19758 |
42571-42579 |
VBN |
denotes |
cultured |
T19759 |
42580-42582 |
IN |
denotes |
in |
T19760 |
42583-42592 |
NN |
denotes |
RPMI-1640 |
T19761 |
42593-42599 |
NN |
denotes |
medium |
T19762 |
42600-42610 |
VBG |
denotes |
containing |
T19763 |
42611-42613 |
CD |
denotes |
10 |
T19764 |
42613-42614 |
NN |
denotes |
% |
T19765 |
42615-42618 |
NNP |
denotes |
FBS |
T19766 |
42618-42619 |
, |
denotes |
, |
T19767 |
42620-42623 |
CC |
denotes |
and |
T19768 |
42624-42626 |
CD |
denotes |
10 |
T19769 |
42627-42629 |
NN |
denotes |
µg |
T19770 |
42629-42630 |
NN |
denotes |
/ |
T19771 |
42630-42632 |
NN |
denotes |
ml |
T19772 |
42633-42642 |
NN |
denotes |
polymyxin |
T19773 |
42643-42644 |
NNP |
denotes |
B |
T19774 |
42645-42648 |
CC |
denotes |
and |
T19775 |
42649-42651 |
CD |
denotes |
20 |
T19776 |
42652-42657 |
JJ |
denotes |
ng/ml |
T19777 |
42658-42663 |
NN |
denotes |
M-CSF |
T19778 |
42663-42664 |
. |
denotes |
. |
T19917 |
42666-42681 |
NNP |
denotes |
Electrophoresis |
T19918 |
42682-42684 |
IN |
denotes |
of |
T19919 |
42685-42688 |
DT |
denotes |
the |
T19920 |
42689-42697 |
NNP |
denotes |
Mobility |
T19921 |
42698-42703 |
NNP |
denotes |
Shift |
T19922 |
42704-42712 |
NNP |
denotes |
Analysis |
T19923 |
42713-42714 |
-LRB- |
denotes |
( |
T19924 |
42714-42718 |
NNP |
denotes |
EMSA |
T19925 |
42718-42719 |
-RRB- |
denotes |
) |
T19926 |
42720-42727 |
NNP |
denotes |
Nuclear |
T19927 |
42728-42736 |
NNS |
denotes |
extracts |
T19928 |
42737-42741 |
VBD |
denotes |
were |
T19929 |
42742-42750 |
VBN |
denotes |
isolated |
T19930 |
42751-42755 |
IN |
denotes |
from |
T19931 |
42756-42760 |
NNS |
denotes |
MDMs |
T19932 |
42761-42763 |
IN |
denotes |
by |
T19933 |
42764-42769 |
VBG |
denotes |
using |
T19934 |
42770-42771 |
DT |
denotes |
a |
T19935 |
42772-42779 |
JJ |
denotes |
nuclear |
T19936 |
42780-42790 |
NN |
denotes |
extraction |
T19937 |
42791-42794 |
NN |
denotes |
kit |
T19938 |
42795-42804 |
VBG |
denotes |
according |
T19939 |
42805-42807 |
TO |
denotes |
to |
T19940 |
42808-42811 |
DT |
denotes |
the |
T19941 |
42812-42824 |
NN |
denotes |
manufacturer |
T19942 |
42824-42826 |
POS |
denotes |
's |
T19943 |
42827-42838 |
NN |
denotes |
instruction |
T19944 |
42839-42843 |
IN |
denotes |
from |
T19945 |
42844-42850 |
NNP |
denotes |
Active |
T19946 |
42851-42856 |
NNP |
denotes |
Motif |
T19947 |
42857-42858 |
-LRB- |
denotes |
( |
T19948 |
42858-42866 |
NNP |
denotes |
Carlsbad |
T19949 |
42866-42867 |
, |
denotes |
, |
T19950 |
42868-42870 |
NNP |
denotes |
CA |
T19951 |
42870-42871 |
-RRB- |
denotes |
) |
T19952 |
42871-42872 |
. |
denotes |
. |
T19953 |
42873-42880 |
RB |
denotes |
Briefly |
T19954 |
42880-42881 |
, |
denotes |
, |
T19955 |
42882-42886 |
NNS |
denotes |
MDMs |
T19956 |
42887-42891 |
VBD |
denotes |
were |
T19957 |
42892-42897 |
VBN |
denotes |
lysed |
T19958 |
42898-42900 |
IN |
denotes |
in |
T19959 |
42901-42910 |
JJ |
denotes |
hypotonic |
T19960 |
42911-42916 |
NN |
denotes |
lysis |
T19961 |
42917-42923 |
NN |
denotes |
buffer |
T19962 |
42924-42925 |
-LRB- |
denotes |
( |
T19963 |
42925-42927 |
CD |
denotes |
20 |
T19964 |
42928-42930 |
NNP |
denotes |
mM |
T19965 |
42931-42936 |
NNP |
denotes |
Hepes |
T19966 |
42936-42937 |
, |
denotes |
, |
T19967 |
42938-42940 |
NNP |
denotes |
pH |
T19968 |
42941-42944 |
CD |
denotes |
7.5 |
T19969 |
42944-42945 |
: |
denotes |
; |
T19970 |
42946-42947 |
CD |
denotes |
5 |
T19971 |
42948-42950 |
NNP |
denotes |
mM |
T19972 |
42951-42954 |
NNP |
denotes |
NaF |
T19973 |
42954-42955 |
, |
denotes |
, |
T19974 |
42956-42958 |
CD |
denotes |
10 |
T19975 |
42959-42961 |
NNP |
denotes |
µM |
T19976 |
42962-42969 |
NNP |
denotes |
Na2MoO4 |
T19977 |
42970-42973 |
CD |
denotes |
0.5 |
T19978 |
42973-42974 |
NN |
denotes |
% |
T19979 |
42975-42980 |
NN |
denotes |
NP-40 |
T19980 |
42981-42984 |
CC |
denotes |
and |
T19981 |
42985-42988 |
CD |
denotes |
0.1 |
T19982 |
42989-42991 |
NNP |
denotes |
mM |
T19983 |
42992-42996 |
NNP |
denotes |
EDTA |
T19984 |
42996-42997 |
-RRB- |
denotes |
) |
T19985 |
42997-42998 |
, |
denotes |
, |
T19986 |
42999-43002 |
CC |
denotes |
and |
T19987 |
43003-43007 |
RB |
denotes |
then |
T19988 |
43008-43014 |
NNS |
denotes |
nuclei |
T19989 |
43015-43019 |
VBD |
denotes |
were |
T19990 |
43020-43031 |
VBN |
denotes |
resuspended |
T19991 |
43032-43034 |
IN |
denotes |
in |
T19992 |
43035-43040 |
NN |
denotes |
lysis |
T19993 |
43041-43047 |
NN |
denotes |
buffer |
T19994 |
43048-43060 |
VBN |
denotes |
supplemented |
T19995 |
43061-43065 |
IN |
denotes |
with |
T19996 |
43066-43069 |
CD |
denotes |
0.5 |
T19997 |
43070-43072 |
NNP |
denotes |
mM |
T19998 |
43073-43076 |
NNP |
denotes |
DTT |
T19999 |
43077-43080 |
CC |
denotes |
and |
T20000 |
43081-43084 |
CD |
denotes |
0.2 |
T20001 |
43085-43087 |
NNP |
denotes |
mM |
T20002 |
43088-43092 |
NNP |
denotes |
PMSF |
T20003 |
43092-43093 |
. |
denotes |
. |
T20004 |
43094-43097 |
DT |
denotes |
The |
T20005 |
43098-43103 |
JJ |
denotes |
NF-κB |
T20006 |
43104-43113 |
NN |
denotes |
consensus |
T20007 |
43114-43130 |
NNS |
denotes |
oligonucleotides |
T20008 |
43131-43132 |
-LRB- |
denotes |
( |
T20009 |
43132-43137 |
NN |
denotes |
sense |
T20010 |
43137-43138 |
: |
denotes |
: |
T20011 |
43139-43161 |
NNP |
denotes |
AGTTGAGGGGACTTTCCCAGGC |
T20012 |
43161-43162 |
: |
denotes |
; |
T20013 |
43163-43172 |
NN |
denotes |
antisense |
T20014 |
43172-43173 |
: |
denotes |
: |
T20015 |
43174-43196 |
NNP |
denotes |
GCCTGGGAAAGTCCCCTCAACT |
T20016 |
43196-43197 |
-RRB- |
denotes |
) |
T20017 |
43198-43205 |
VBN |
denotes |
labeled |
T20018 |
43206-43210 |
IN |
denotes |
with |
T20019 |
43211-43214 |
CD |
denotes |
32P |
T20020 |
43215-43217 |
IN |
denotes |
by |
T20021 |
43218-43220 |
CD |
denotes |
T4 |
T20022 |
43221-43237 |
NN |
denotes |
polynucleokinase |
T20023 |
43238-43239 |
-LRB- |
denotes |
( |
T20024 |
43239-43246 |
NNP |
denotes |
Promega |
T20025 |
43246-43247 |
, |
denotes |
, |
T20026 |
43248-43255 |
NNP |
denotes |
Madison |
T20027 |
43255-43256 |
, |
denotes |
, |
T20028 |
43257-43259 |
NNP |
denotes |
WI |
T20029 |
43259-43260 |
-RRB- |
denotes |
) |
T20030 |
43261-43265 |
VBD |
denotes |
were |
T20031 |
43266-43275 |
VBN |
denotes |
incubated |
T20032 |
43276-43280 |
IN |
denotes |
with |
T20033 |
43281-43288 |
JJ |
denotes |
nuclear |
T20034 |
43289-43297 |
NNS |
denotes |
extracts |
T20035 |
43298-43300 |
IN |
denotes |
in |
T20036 |
43301-43308 |
JJ |
denotes |
binding |
T20037 |
43309-43315 |
NN |
denotes |
buffer |
T20038 |
43316-43317 |
-LRB- |
denotes |
( |
T20039 |
43317-43319 |
CD |
denotes |
10 |
T20040 |
43320-43322 |
NNP |
denotes |
mM |
T20041 |
43323-43327 |
NNP |
denotes |
Tris |
T20042 |
43328-43330 |
NNP |
denotes |
pH |
T20043 |
43331-43334 |
CD |
denotes |
7.6 |
T20044 |
43334-43335 |
, |
denotes |
, |
T20045 |
43336-43337 |
CD |
denotes |
1 |
T20046 |
43338-43340 |
NNP |
denotes |
mM |
T20047 |
43341-43344 |
NNP |
denotes |
DTT |
T20048 |
43344-43345 |
, |
denotes |
, |
T20049 |
43346-43349 |
CD |
denotes |
0.5 |
T20050 |
43350-43352 |
NNP |
denotes |
mM |
T20051 |
43353-43357 |
NNP |
denotes |
EDTA |
T20052 |
43357-43358 |
, |
denotes |
, |
T20053 |
43359-43360 |
CD |
denotes |
2 |
T20054 |
43361-43363 |
NN |
denotes |
µg |
T20055 |
43364-43373 |
NN |
denotes |
polydI-dC |
T20056 |
43374-43377 |
CC |
denotes |
and |
T20057 |
43378-43380 |
CD |
denotes |
10 |
T20058 |
43380-43381 |
NN |
denotes |
% |
T20059 |
43382-43390 |
NNP |
denotes |
Glycerol |
T20060 |
43390-43391 |
-RRB- |
denotes |
) |
T20061 |
43392-43394 |
IN |
denotes |
at |
T20062 |
43395-43397 |
CD |
denotes |
30 |
T20063 |
43397-43398 |
CD |
denotes |
° |
T20064 |
43398-43399 |
NNP |
denotes |
C |
T20065 |
43400-43403 |
IN |
denotes |
for |
T20066 |
43404-43406 |
CD |
denotes |
30 |
T20067 |
43407-43414 |
NNS |
denotes |
minutes |
T20068 |
43414-43415 |
. |
denotes |
. |
T20069 |
43416-43419 |
DT |
denotes |
The |
T20070 |
43420-43424 |
JJ |
denotes |
free |
T20071 |
43425-43428 |
NN |
denotes |
DNA |
T20072 |
43429-43432 |
CC |
denotes |
and |
T20073 |
43433-43444 |
JJ |
denotes |
DNA-protein |
T20074 |
43445-43453 |
NNS |
denotes |
mixtures |
T20075 |
43454-43458 |
VBD |
denotes |
were |
T20076 |
43459-43467 |
VBN |
denotes |
resolved |
T20077 |
43468-43470 |
IN |
denotes |
in |
T20078 |
43471-43472 |
CD |
denotes |
5 |
T20079 |
43472-43473 |
NN |
denotes |
% |
T20080 |
43474-43480 |
JJ |
denotes |
native |
T20081 |
43481-43495 |
NN |
denotes |
polyacrylamide |
T20082 |
43496-43500 |
NNS |
denotes |
gels |
T20083 |
43501-43503 |
IN |
denotes |
in |
T20084 |
43504-43507 |
CD |
denotes |
0.5 |
T20085 |
43507-43508 |
CD |
denotes |
× |
T20086 |
43509-43512 |
NNP |
denotes |
TBE |
T20087 |
43513-43519 |
NN |
denotes |
buffer |
T20088 |
43520-43521 |
-LRB- |
denotes |
( |
T20089 |
43521-43523 |
CD |
denotes |
45 |
T20090 |
43524-43526 |
NNP |
denotes |
mM |
T20091 |
43527-43531 |
NNP |
denotes |
Tris |
T20092 |
43531-43532 |
, |
denotes |
, |
T20093 |
43533-43535 |
CD |
denotes |
45 |
T20094 |
43536-43538 |
NN |
denotes |
mM |
T20095 |
43539-43544 |
JJ |
denotes |
boric |
T20096 |
43545-43549 |
NN |
denotes |
acid |
T20097 |
43550-43553 |
CC |
denotes |
and |
T20098 |
43554-43555 |
CD |
denotes |
1 |
T20099 |
43556-43558 |
NNP |
denotes |
mM |
T20100 |
43559-43563 |
NNP |
denotes |
EDTA |
T20101 |
43563-43564 |
, |
denotes |
, |
T20102 |
43565-43567 |
NNP |
denotes |
pH |
T20103 |
43568-43571 |
CD |
denotes |
8.3 |
T20104 |
43571-43572 |
-RRB- |
denotes |
) |
T20105 |
43573-43575 |
IN |
denotes |
by |
T20106 |
43576-43591 |
NN |
denotes |
electrophoresis |
T20107 |
43591-43592 |
. |
denotes |
. |
T20108 |
43593-43596 |
DT |
denotes |
The |
T20109 |
43597-43600 |
NN |
denotes |
gel |
T20110 |
43601-43604 |
VBD |
denotes |
was |
T20111 |
43605-43610 |
VBN |
denotes |
dried |
T20112 |
43611-43614 |
CC |
denotes |
and |
T20113 |
43615-43624 |
VBN |
denotes |
subjected |
T20114 |
43625-43627 |
TO |
denotes |
to |
T20115 |
43628-43643 |
NN |
denotes |
autoradiography |
T20116 |
43644-43652 |
NN |
denotes |
analysis |
T20117 |
43652-43653 |
. |
denotes |
. |
T20349 |
43655-43664 |
NNP |
denotes |
Transient |
T20350 |
43665-43677 |
NNP |
denotes |
Transfection |
T20351 |
43678-43680 |
IN |
denotes |
of |
T20352 |
43681-43684 |
NNP |
denotes |
RAW |
T20353 |
43685-43690 |
CD |
denotes |
264.7 |
T20354 |
43691-43696 |
NNP |
denotes |
Cells |
T20355 |
43697-43700 |
NNP |
denotes |
RAW |
T20356 |
43701-43706 |
CD |
denotes |
264.7 |
T20357 |
43707-43712 |
NNS |
denotes |
cells |
T20358 |
43713-43717 |
VBD |
denotes |
were |
T20359 |
43718-43724 |
VBN |
denotes |
seeded |
T20360 |
43725-43727 |
IN |
denotes |
in |
T20361 |
43728-43735 |
JJ |
denotes |
12-well |
T20362 |
43736-43742 |
NNS |
denotes |
plates |
T20363 |
43743-43745 |
IN |
denotes |
in |
T20364 |
43746-43750 |
NNP |
denotes |
RPMI |
T20365 |
43751-43757 |
NN |
denotes |
medium |
T20366 |
43758-43768 |
VBG |
denotes |
containing |
T20367 |
43769-43770 |
CD |
denotes |
5 |
T20368 |
43770-43771 |
NN |
denotes |
% |
T20369 |
43772-43775 |
NNP |
denotes |
FBS |
T20370 |
43776-43779 |
CD |
denotes |
one |
T20371 |
43780-43783 |
NN |
denotes |
day |
T20372 |
43784-43789 |
RB |
denotes |
prior |
T20373 |
43790-43792 |
TO |
denotes |
to |
T20374 |
43793-43805 |
NN |
denotes |
transfection |
T20375 |
43805-43806 |
, |
denotes |
, |
T20376 |
43807-43815 |
NNP |
denotes |
Secreted |
T20377 |
43816-43824 |
NN |
denotes |
alkaline |
T20378 |
43825-43836 |
NN |
denotes |
phosphatase |
T20379 |
43837-43838 |
-LRB- |
denotes |
( |
T20380 |
43838-43842 |
NNP |
denotes |
SEAP |
T20381 |
43842-43843 |
-RRB- |
denotes |
) |
T20382 |
43844-43852 |
NN |
denotes |
reporter |
T20383 |
43853-43861 |
NNS |
denotes |
plasmids |
T20384 |
43862-43871 |
JJ |
denotes |
pTAL-SEAP |
T20385 |
43872-43874 |
CC |
denotes |
or |
T20386 |
43875-43886 |
JJ |
denotes |
pNF-κB-SEAP |
T20387 |
43887-43891 |
VBD |
denotes |
were |
T20388 |
43892-43903 |
VBN |
denotes |
transfected |
T20389 |
43904-43908 |
IN |
denotes |
into |
T20390 |
43909-43914 |
NNS |
denotes |
cells |
T20391 |
43915-43920 |
VBG |
denotes |
using |
T20392 |
43921-43928 |
NNP |
denotes |
Qiagene |
T20393 |
43929-43938 |
NNP |
denotes |
Effectene |
T20394 |
43939-43941 |
CC |
denotes |
or |
T20395 |
43942-43952 |
NNP |
denotes |
Attractene |
T20396 |
43953-43965 |
NN |
denotes |
transfection |
T20397 |
43966-43969 |
NN |
denotes |
kit |
T20398 |
43970-43971 |
-LRB- |
denotes |
( |
T20399 |
43971-43977 |
NNP |
denotes |
Qiagen |
T20400 |
43977-43978 |
, |
denotes |
, |
T20401 |
43979-43987 |
NNP |
denotes |
Valencia |
T20402 |
43987-43988 |
, |
denotes |
, |
T20403 |
43989-43991 |
NNP |
denotes |
CA |
T20404 |
43991-43992 |
-RRB- |
denotes |
) |
T20405 |
43993-44002 |
VBG |
denotes |
according |
T20406 |
44003-44005 |
TO |
denotes |
to |
T20407 |
44006-44009 |
DT |
denotes |
the |
T20408 |
44010-44022 |
NN |
denotes |
manufacturer |
T20409 |
44022-44024 |
POS |
denotes |
's |
T20410 |
44025-44033 |
NN |
denotes |
protocol |
T20411 |
44033-44034 |
. |
denotes |
. |
T20412 |
44035-44038 |
IN |
denotes |
For |
T20413 |
44039-44054 |
JJ |
denotes |
co-transfection |
T20414 |
44055-44062 |
NNS |
denotes |
studies |
T20415 |
44062-44063 |
, |
denotes |
, |
T20416 |
44064-44068 |
NNP |
denotes |
PKCα |
T20417 |
44069-44071 |
CC |
denotes |
or |
T20418 |
44072-44077 |
NNP |
denotes |
NF-κB |
T20419 |
44078-44081 |
CD |
denotes |
p65 |
T20420 |
44082-44092 |
NNS |
denotes |
constructs |
T20421 |
44093-44097 |
VBD |
denotes |
were |
T20422 |
44098-44103 |
VBN |
denotes |
mixed |
T20423 |
44104-44106 |
IN |
denotes |
at |
T20424 |
44107-44108 |
DT |
denotes |
a |
T20425 |
44109-44114 |
NN |
denotes |
ratio |
T20426 |
44115-44117 |
IN |
denotes |
of |
T20427 |
44118-44119 |
CD |
denotes |
5 |
T20428 |
44119-44120 |
CD |
denotes |
∶ |
T20429 |
44120-44121 |
CD |
denotes |
1 |
T20430 |
44122-44126 |
IN |
denotes |
with |
T20431 |
44127-44130 |
DT |
denotes |
the |
T20432 |
44131-44139 |
NN |
denotes |
reporter |
T20433 |
44140-44147 |
NN |
denotes |
plasmid |
T20434 |
44147-44148 |
. |
denotes |
. |
T20435 |
44149-44152 |
IN |
denotes |
For |
T20436 |
44153-44158 |
JJ |
denotes |
siRNA |
T20437 |
44159-44171 |
NN |
denotes |
transfection |
T20438 |
44171-44172 |
, |
denotes |
, |
T20439 |
44173-44176 |
CD |
denotes |
100 |
T20440 |
44177-44179 |
NN |
denotes |
nM |
T20441 |
44180-44182 |
IN |
denotes |
of |
T20442 |
44183-44187 |
NNP |
denotes |
PKCα |
T20443 |
44188-44193 |
NNP |
denotes |
siRNA |
T20444 |
44194-44196 |
CC |
denotes |
or |
T20445 |
44197-44204 |
VB |
denotes |
control |
T20446 |
44205-44210 |
NNP |
denotes |
siRNA |
T20447 |
44211-44215 |
VBD |
denotes |
were |
T20448 |
44216-44220 |
VBN |
denotes |
used |
T20449 |
44220-44221 |
. |
denotes |
. |
T20450 |
44222-44227 |
NNS |
denotes |
Cells |
T20451 |
44228-44232 |
VBD |
denotes |
were |
T20452 |
44233-44242 |
VBN |
denotes |
incubated |
T20453 |
44243-44247 |
IN |
denotes |
with |
T20454 |
44248-44251 |
DT |
denotes |
the |
T20455 |
44252-44264 |
NN |
denotes |
transfection |
T20456 |
44265-44273 |
VBZ |
denotes |
reagents |
T20457 |
44274-44277 |
IN |
denotes |
for |
T20458 |
44278-44280 |
CD |
denotes |
16 |
T20459 |
44281-44283 |
CD |
denotes |
24 |
T20460 |
44284-44289 |
NNS |
denotes |
hours |
T20461 |
44289-44290 |
, |
denotes |
, |
T20462 |
44291-44297 |
VBD |
denotes |
washed |
T20463 |
44298-44301 |
CC |
denotes |
and |
T20464 |
44302-44309 |
VBD |
denotes |
starved |
T20465 |
44310-44312 |
IN |
denotes |
in |
T20466 |
44313-44317 |
NNP |
denotes |
RPMI |
T20467 |
44318-44325 |
IN |
denotes |
without |
T20468 |
44326-44329 |
NNP |
denotes |
FBS |
T20469 |
44330-44333 |
IN |
denotes |
for |
T20470 |
44334-44335 |
CD |
denotes |
4 |
T20471 |
44336-44341 |
NNS |
denotes |
hours |
T20472 |
44341-44342 |
. |
denotes |
. |
T20473 |
44343-44350 |
NNS |
denotes |
Samples |
T20474 |
44351-44355 |
VBD |
denotes |
were |
T20475 |
44356-44360 |
RB |
denotes |
then |
T20476 |
44361-44371 |
VBN |
denotes |
stimulated |
T20477 |
44372-44376 |
IN |
denotes |
with |
T20478 |
44377-44380 |
CD |
denotes |
100 |
T20479 |
44381-44386 |
JJ |
denotes |
ng/ml |
T20480 |
44387-44392 |
NN |
denotes |
M-CSF |
T20481 |
44393-44396 |
IN |
denotes |
for |
T20482 |
44397-44398 |
CD |
denotes |
4 |
T20483 |
44399-44404 |
NNS |
denotes |
hours |
T20484 |
44405-44407 |
IN |
denotes |
at |
T20485 |
44408-44413 |
WDT |
denotes |
which |
T20486 |
44414-44419 |
VBP |
denotes |
point |
T20487 |
44420-44423 |
DT |
denotes |
the |
T20488 |
44424-44430 |
NN |
denotes |
medium |
T20489 |
44431-44434 |
VBD |
denotes |
was |
T20490 |
44435-44444 |
VBN |
denotes |
collected |
T20491 |
44445-44448 |
IN |
denotes |
for |
T20492 |
44449-44452 |
DT |
denotes |
the |
T20493 |
44453-44457 |
NNP |
denotes |
SEAP |
T20494 |
44458-44466 |
NN |
denotes |
analysis |
T20495 |
44466-44467 |
. |
denotes |
. |
T20496 |
44468-44471 |
IN |
denotes |
For |
T20497 |
44472-44482 |
NN |
denotes |
inhibition |
T20498 |
44483-44490 |
NNS |
denotes |
studies |
T20499 |
44490-44491 |
, |
denotes |
, |
T20500 |
44492-44497 |
NNS |
denotes |
cells |
T20501 |
44498-44502 |
VBD |
denotes |
were |
T20502 |
44503-44516 |
VBN |
denotes |
pre-incubated |
T20503 |
44517-44521 |
IN |
denotes |
with |
T20504 |
44522-44532 |
NNS |
denotes |
inhibitors |
T20505 |
44533-44536 |
IN |
denotes |
for |
T20506 |
44537-44539 |
CD |
denotes |
30 |
T20507 |
44540-44547 |
NNS |
denotes |
minutes |
T20508 |
44548-44554 |
IN |
denotes |
before |
T20509 |
44555-44560 |
NNP |
denotes |
M-CSF |
T20510 |
44561-44570 |
NN |
denotes |
treatment |
T20511 |
44570-44571 |
. |
denotes |
. |
T20512 |
44572-44574 |
IN |
denotes |
On |
T20513 |
44575-44582 |
NN |
denotes |
average |
T20514 |
44582-44583 |
, |
denotes |
, |
T20515 |
44584-44586 |
PRP |
denotes |
we |
T20516 |
44587-44595 |
VBD |
denotes |
realized |
T20517 |
44596-44598 |
CD |
denotes |
30 |
T20518 |
44599-44601 |
CD |
denotes |
40 |
T20519 |
44601-44602 |
NN |
denotes |
% |
T20520 |
44603-44615 |
NN |
denotes |
transfection |
T20521 |
44616-44626 |
NN |
denotes |
efficiency |
T20522 |
44627-44629 |
IN |
denotes |
as |
T20523 |
44630-44639 |
VBN |
denotes |
confirmed |
T20524 |
44640-44642 |
IN |
denotes |
by |
T20525 |
44643-44646 |
NNP |
denotes |
GFP |
T20526 |
44647-44657 |
NN |
denotes |
expression |
T20527 |
44658-44660 |
IN |
denotes |
in |
T20528 |
44661-44664 |
NNP |
denotes |
Raw |
T20529 |
44665-44670 |
CD |
denotes |
264.7 |
T20530 |
44671-44676 |
NNS |
denotes |
cells |
T20531 |
44676-44677 |
. |
denotes |
. |
T20824 |
44679-44688 |
NNP |
denotes |
Transient |
T20825 |
44689-44701 |
NNP |
denotes |
Transfection |
T20826 |
44702-44704 |
IN |
denotes |
of |
T20827 |
44705-44712 |
JJ |
denotes |
Primary |
T20828 |
44713-44718 |
JJ |
denotes |
Human |
T20829 |
44719-44728 |
NNP |
denotes |
Monocytes |
T20830 |
44729-44738 |
NNPS |
denotes |
Monocytes |
T20831 |
44739-44743 |
VBD |
denotes |
were |
T20832 |
44744-44755 |
VBN |
denotes |
transfected |
T20833 |
44756-44761 |
VBG |
denotes |
using |
T20834 |
44762-44765 |
DT |
denotes |
the |
T20835 |
44766-44771 |
JJ |
denotes |
human |
T20836 |
44772-44780 |
NN |
denotes |
monocyte |
T20837 |
44781-44786 |
NNP |
denotes |
Amaxa |
T20838 |
44787-44799 |
NN |
denotes |
nucleofector |
T20839 |
44800-44803 |
NN |
denotes |
kit |
T20840 |
44804-44805 |
-LRB- |
denotes |
( |
T20841 |
44805-44810 |
NNP |
denotes |
Lonza |
T20842 |
44811-44823 |
NNP |
denotes |
Walkersville |
T20843 |
44824-44827 |
NNP |
denotes |
Inc |
T20844 |
44827-44828 |
, |
denotes |
, |
T20845 |
44829-44841 |
NNP |
denotes |
Walkersville |
T20846 |
44841-44842 |
, |
denotes |
, |
T20847 |
44843-44845 |
NNP |
denotes |
MD |
T20848 |
44845-44846 |
-RRB- |
denotes |
) |
T20849 |
44847-44849 |
IN |
denotes |
as |
T20850 |
44850-44860 |
RB |
denotes |
previously |
T20851 |
44861-44870 |
VBN |
denotes |
described |
T20852 |
44871-44872 |
NNP |
denotes |
[ |
T20853 |
44872-44874 |
CD |
denotes |
51 |
T20854 |
44874-44875 |
NNP |
denotes |
] |
T20855 |
44875-44876 |
. |
denotes |
. |
T20856 |
44877-44884 |
RB |
denotes |
Briefly |
T20857 |
44884-44885 |
, |
denotes |
, |
T20858 |
44886-44895 |
NNS |
denotes |
monocytes |
T20859 |
44896-44900 |
VBD |
denotes |
were |
T20860 |
44901-44912 |
VBN |
denotes |
resuspended |
T20861 |
44913-44915 |
IN |
denotes |
in |
T20862 |
44916-44921 |
NNP |
denotes |
Amaxa |
T20863 |
44922-44934 |
NNP |
denotes |
Nucleofactor |
T20864 |
44935-44943 |
NN |
denotes |
solution |
T20865 |
44944-44946 |
IN |
denotes |
at |
T20866 |
44947-44948 |
DT |
denotes |
a |
T20867 |
44949-44956 |
NN |
denotes |
density |
T20868 |
44957-44959 |
IN |
denotes |
of |
T20869 |
44960-44962 |
CD |
denotes |
20 |
T20870 |
44962-44963 |
CD |
denotes |
× |
T20871 |
44963-44966 |
CD |
denotes |
106 |
T20872 |
44967-44975 |
NN |
denotes |
cells/ml |
T20873 |
44975-44976 |
, |
denotes |
, |
T20874 |
44977-44980 |
CC |
denotes |
and |
T20875 |
44981-44982 |
CD |
denotes |
2 |
T20876 |
44983-44985 |
NN |
denotes |
µg |
T20877 |
44986-44988 |
IN |
denotes |
of |
T20878 |
44989-44994 |
JJ |
denotes |
total |
T20879 |
44995-45002 |
JJ |
denotes |
plasmid |
T20880 |
45003-45006 |
NN |
denotes |
DNA |
T20881 |
45007-45010 |
CD |
denotes |
100 |
T20882 |
45011-45013 |
NNP |
denotes |
nM |
T20883 |
45014-45016 |
IN |
denotes |
of |
T20884 |
45017-45021 |
NNP |
denotes |
PKCα |
T20885 |
45022-45027 |
NNP |
denotes |
siRNA |
T20886 |
45028-45030 |
CC |
denotes |
or |
T20887 |
45031-45038 |
VB |
denotes |
control |
T20888 |
45039-45044 |
NNP |
denotes |
siRNA |
T20889 |
45045-45048 |
VBD |
denotes |
was |
T20890 |
45049-45054 |
VBN |
denotes |
added |
T20891 |
45055-45058 |
CC |
denotes |
and |
T20892 |
45059-45070 |
VBN |
denotes |
transfected |
T20893 |
45071-45076 |
VBG |
denotes |
using |
T20894 |
45077-45084 |
NN |
denotes |
program |
T20895 |
45085-45090 |
NNP |
denotes |
Amaxa |
T20896 |
45091-45095 |
NNP |
denotes |
Y-01 |
T20897 |
45095-45096 |
. |
denotes |
. |
T20898 |
45097-45100 |
IN |
denotes |
For |
T20899 |
45101-45116 |
JJ |
denotes |
co-transfection |
T20900 |
45117-45124 |
NNS |
denotes |
studies |
T20901 |
45124-45125 |
, |
denotes |
, |
T20902 |
45126-45130 |
NNP |
denotes |
PKCα |
T20903 |
45131-45133 |
CC |
denotes |
or |
T20904 |
45134-45139 |
NNP |
denotes |
NF-κB |
T20905 |
45140-45143 |
CD |
denotes |
p65 |
T20906 |
45144-45154 |
NNS |
denotes |
constructs |
T20907 |
45155-45159 |
VBD |
denotes |
were |
T20908 |
45160-45165 |
VBN |
denotes |
mixed |
T20909 |
45166-45168 |
IN |
denotes |
at |
T20910 |
45169-45170 |
DT |
denotes |
a |
T20911 |
45171-45176 |
NN |
denotes |
ratio |
T20912 |
45177-45179 |
IN |
denotes |
of |
T20913 |
45180-45181 |
CD |
denotes |
5 |
T20914 |
45181-45182 |
CD |
denotes |
∶ |
T20915 |
45182-45183 |
CD |
denotes |
1 |
T20916 |
45184-45188 |
IN |
denotes |
with |
T20917 |
45189-45192 |
DT |
denotes |
the |
T20918 |
45193-45201 |
NN |
denotes |
reporter |
T20919 |
45202-45209 |
NN |
denotes |
plasmid |
T20920 |
45209-45210 |
. |
denotes |
. |
T20921 |
45211-45222 |
RB |
denotes |
Immediately |
T20922 |
45223-45228 |
IN |
denotes |
after |
T20923 |
45229-45241 |
NN |
denotes |
transfection |
T20924 |
45241-45242 |
, |
denotes |
, |
T20925 |
45243-45248 |
NNS |
denotes |
cells |
T20926 |
45249-45253 |
VBD |
denotes |
were |
T20927 |
45254-45260 |
VBN |
denotes |
washed |
T20928 |
45261-45265 |
IN |
denotes |
with |
T20929 |
45266-45267 |
CD |
denotes |
1 |
T20930 |
45268-45270 |
NN |
denotes |
ml |
T20931 |
45271-45273 |
IN |
denotes |
of |
T20932 |
45274-45278 |
NNP |
denotes |
RPMI |
T20933 |
45279-45285 |
NN |
denotes |
medium |
T20934 |
45286-45296 |
VBG |
denotes |
containing |
T20935 |
45297-45298 |
CD |
denotes |
2 |
T20936 |
45299-45301 |
NNP |
denotes |
mM |
T20937 |
45302-45311 |
NN |
denotes |
glutamine |
T20938 |
45312-45315 |
CC |
denotes |
and |
T20939 |
45316-45318 |
CD |
denotes |
10 |
T20940 |
45318-45319 |
NN |
denotes |
% |
T20941 |
45320-45323 |
NNP |
denotes |
FBS |
T20942 |
45324-45326 |
CC |
denotes |
or |
T20943 |
45327-45332 |
NN |
denotes |
serum |
T20944 |
45333-45337 |
JJ |
denotes |
free |
T20945 |
45338-45341 |
NNP |
denotes |
LGM |
T20946 |
45342-45348 |
NN |
denotes |
medium |
T20947 |
45349-45350 |
-LRB- |
denotes |
( |
T20948 |
45350-45355 |
NNP |
denotes |
Lonza |
T20949 |
45356-45368 |
NNP |
denotes |
Walkersville |
T20950 |
45369-45373 |
NNP |
denotes |
Inc. |
T20951 |
45373-45374 |
-RRB- |
denotes |
) |
T20952 |
45375-45379 |
RB |
denotes |
then |
T20953 |
45380-45386 |
VBD |
denotes |
plated |
T20954 |
45387-45389 |
IN |
denotes |
at |
T20955 |
45390-45391 |
CD |
denotes |
4 |
T20956 |
45391-45392 |
CD |
denotes |
× |
T20957 |
45392-45395 |
CD |
denotes |
105 |
T20958 |
45396-45406 |
NN |
denotes |
cells/well |
T20959 |
45407-45409 |
IN |
denotes |
in |
T20960 |
45410-45417 |
JJ |
denotes |
24-well |
T20961 |
45418-45424 |
NNS |
denotes |
plates |
T20962 |
45424-45425 |
. |
denotes |
. |
T20963 |
45426-45429 |
DT |
denotes |
The |
T20964 |
45430-45438 |
JJ |
denotes |
original |
T20965 |
45439-45445 |
NN |
denotes |
medium |
T20966 |
45446-45449 |
VBD |
denotes |
was |
T20967 |
45450-45458 |
VBN |
denotes |
replaced |
T20968 |
45459-45461 |
IN |
denotes |
by |
T20969 |
45462-45467 |
NN |
denotes |
serum |
T20970 |
45468-45472 |
JJ |
denotes |
free |
T20971 |
45473-45476 |
NNP |
denotes |
LGM |
T20972 |
45477-45483 |
NN |
denotes |
medium |
T20973 |
45484-45491 |
IN |
denotes |
without |
T20974 |
45492-45494 |
CC |
denotes |
or |
T20975 |
45495-45499 |
IN |
denotes |
with |
T20976 |
45500-45505 |
NNP |
denotes |
M-CSF |
T20977 |
45506-45507 |
-LRB- |
denotes |
( |
T20978 |
45507-45510 |
CD |
denotes |
100 |
T20979 |
45511-45516 |
NN |
denotes |
ng/ml |
T20980 |
45516-45517 |
-RRB- |
denotes |
) |
T20981 |
45518-45521 |
CD |
denotes |
one |
T20982 |
45522-45526 |
NN |
denotes |
hour |
T20983 |
45527-45532 |
RB |
denotes |
later |
T20984 |
45532-45533 |
. |
denotes |
. |
T20985 |
45534-45537 |
DT |
denotes |
The |
T20986 |
45538-45542 |
JJ |
denotes |
next |
T20987 |
45543-45546 |
NN |
denotes |
day |
T20988 |
45546-45547 |
, |
denotes |
, |
T20989 |
45548-45557 |
JJ |
denotes |
cell-free |
T20990 |
45558-45570 |
NNS |
denotes |
supernatants |
T20991 |
45571-45575 |
VBD |
denotes |
were |
T20992 |
45576-45585 |
VBN |
denotes |
collected |
T20993 |
45586-45589 |
IN |
denotes |
for |
T20994 |
45590-45593 |
DT |
denotes |
the |
T20995 |
45594-45598 |
NNP |
denotes |
SEAP |
T20996 |
45599-45607 |
NN |
denotes |
analysis |
T20997 |
45607-45608 |
. |
denotes |
. |
T20998 |
45609-45614 |
NNS |
denotes |
Cells |
T20999 |
45615-45619 |
VBD |
denotes |
were |
T21000 |
45620-45627 |
VBN |
denotes |
stained |
T21001 |
45628-45632 |
IN |
denotes |
with |
T21002 |
45633-45640 |
NNP |
denotes |
Annexin |
T21003 |
45641-45652 |
NNP |
denotes |
V/propidium |
T21004 |
45653-45659 |
NN |
denotes |
iodide |
T21005 |
45660-45661 |
-LRB- |
denotes |
( |
T21006 |
45661-45663 |
NNP |
denotes |
PI |
T21007 |
45663-45664 |
-RRB- |
denotes |
) |
T21008 |
45664-45665 |
. |
denotes |
. |
T21009 |
45666-45669 |
IN |
denotes |
For |
T21010 |
45670-45673 |
DT |
denotes |
the |
T21011 |
45674-45684 |
NN |
denotes |
inhibition |
T21012 |
45685-45692 |
NNS |
denotes |
studies |
T21013 |
45692-45693 |
, |
denotes |
, |
T21014 |
45694-45699 |
NNS |
denotes |
cells |
T21015 |
45700-45704 |
VBD |
denotes |
were |
T21016 |
45705-45718 |
VBN |
denotes |
pre-incubated |
T21017 |
45719-45723 |
IN |
denotes |
with |
T21018 |
45724-45733 |
NN |
denotes |
inhibitor |
T21019 |
45734-45737 |
IN |
denotes |
for |
T21020 |
45738-45740 |
CD |
denotes |
30 |
T21021 |
45741-45748 |
NNS |
denotes |
minutes |
T21022 |
45749-45751 |
IN |
denotes |
in |
T21023 |
45752-45758 |
NNP |
denotes |
X-vivo |
T21024 |
45759-45765 |
NN |
denotes |
medium |
T21025 |
45766-45771 |
RB |
denotes |
prior |
T21026 |
45772-45774 |
TO |
denotes |
to |
T21027 |
45775-45778 |
DT |
denotes |
the |
T21028 |
45779-45787 |
NN |
denotes |
addition |
T21029 |
45788-45790 |
IN |
denotes |
of |
T21030 |
45791-45796 |
NNP |
denotes |
M-CSF |
T21031 |
45796-45797 |
. |
denotes |
. |
T21302 |
45799-45807 |
NNP |
denotes |
Secreted |
T21303 |
45808-45816 |
NNP |
denotes |
Alkaline |
T21304 |
45817-45828 |
NNP |
denotes |
Phosphatase |
T21305 |
45829-45830 |
-LRB- |
denotes |
( |
T21306 |
45830-45834 |
NNP |
denotes |
SEAP |
T21307 |
45834-45835 |
-RRB- |
denotes |
) |
T21308 |
45836-45844 |
NNP |
denotes |
Analysis |
T21309 |
45845-45853 |
NNP |
denotes |
Secreted |
T21310 |
45854-45862 |
NN |
denotes |
alkaline |
T21311 |
45863-45874 |
NN |
denotes |
phosphatase |
T21312 |
45875-45883 |
NN |
denotes |
activity |
T21313 |
45884-45887 |
VBD |
denotes |
was |
T21314 |
45888-45896 |
VBN |
denotes |
analyzed |
T21315 |
45897-45899 |
IN |
denotes |
by |
T21316 |
45900-45911 |
NNP |
denotes |
GreatEscape |
T21317 |
45912-45916 |
NNP |
denotes |
SEAP |
T21318 |
45917-45920 |
NN |
denotes |
kit |
T21319 |
45921-45930 |
VBG |
denotes |
according |
T21320 |
45931-45933 |
TO |
denotes |
to |
T21321 |
45934-45937 |
DT |
denotes |
the |
T21322 |
45938-45950 |
NN |
denotes |
manufacturer |
T21323 |
45950-45952 |
POS |
denotes |
's |
T21324 |
45953-45964 |
NN |
denotes |
instruction |
T21325 |
45964-45965 |
. |
denotes |
. |
T21326 |
45966-45973 |
RB |
denotes |
Briefly |
T21327 |
45973-45974 |
, |
denotes |
, |
T21328 |
45975-45981 |
NN |
denotes |
medium |
T21329 |
45982-45985 |
VBD |
denotes |
was |
T21330 |
45986-45993 |
VBN |
denotes |
diluted |
T21331 |
45994-45996 |
IN |
denotes |
in |
T21332 |
45997-46000 |
DT |
denotes |
the |
T21333 |
46001-46009 |
NN |
denotes |
dilution |
T21334 |
46010-46016 |
NN |
denotes |
buffer |
T21335 |
46017-46020 |
CC |
denotes |
and |
T21336 |
46021-46027 |
VBN |
denotes |
heated |
T21337 |
46028-46030 |
TO |
denotes |
to |
T21338 |
46031-46033 |
CD |
denotes |
65 |
T21339 |
46033-46034 |
CD |
denotes |
° |
T21340 |
46034-46035 |
NNP |
denotes |
C |
T21341 |
46036-46038 |
TO |
denotes |
to |
T21342 |
46039-46049 |
VB |
denotes |
inactivate |
T21343 |
46050-46060 |
JJ |
denotes |
endogenous |
T21344 |
46061-46073 |
NNS |
denotes |
phosphatases |
T21345 |
46074-46078 |
RB |
denotes |
then |
T21346 |
46079-46088 |
VBD |
denotes |
incubated |
T21347 |
46089-46093 |
IN |
denotes |
with |
T21348 |
46094-46097 |
DT |
denotes |
the |
T21349 |
46098-46107 |
NN |
denotes |
substrate |
T21350 |
46108-46111 |
IN |
denotes |
for |
T21351 |
46112-46114 |
CD |
denotes |
30 |
T21352 |
46115-46122 |
NNS |
denotes |
minutes |
T21353 |
46122-46123 |
. |
denotes |
. |
T21354 |
46124-46127 |
DT |
denotes |
The |
T21355 |
46128-46142 |
NN |
denotes |
chemiluminence |
T21356 |
46143-46149 |
NN |
denotes |
signal |
T21357 |
46150-46153 |
VBD |
denotes |
was |
T21358 |
46154-46162 |
VBN |
denotes |
recorded |
T21359 |
46163-46168 |
VBG |
denotes |
using |
T21360 |
46169-46170 |
DT |
denotes |
a |
T21361 |
46171-46182 |
NN |
denotes |
luminometer |
T21362 |
46182-46183 |
. |
denotes |
. |
T21451 |
46185-46192 |
NNP |
denotes |
Annexin |
T21452 |
46193-46197 |
NNP |
denotes |
V/PI |
T21453 |
46198-46207 |
NNP |
denotes |
Apoptosis |
T21454 |
46208-46213 |
NNP |
denotes |
Assay |
T21455 |
46214-46218 |
NNP |
denotes |
Cell |
T21456 |
46219-46228 |
NN |
denotes |
apoptosis |
T21457 |
46229-46234 |
NN |
denotes |
assay |
T21458 |
46235-46238 |
VBD |
denotes |
was |
T21459 |
46239-46248 |
VBN |
denotes |
performed |
T21460 |
46249-46251 |
IN |
denotes |
as |
T21461 |
46252-46261 |
VBN |
denotes |
described |
T21462 |
46262-46272 |
RB |
denotes |
previously |
T21463 |
46273-46274 |
NNP |
denotes |
[ |
T21464 |
46274-46276 |
CD |
denotes |
51 |
T21465 |
46276-46277 |
NNP |
denotes |
] |
T21466 |
46278-46283 |
VBG |
denotes |
using |
T21467 |
46284-46287 |
DT |
denotes |
the |
T21468 |
46288-46295 |
NNP |
denotes |
Annexin |
T21469 |
46296-46297 |
NNP |
denotes |
V |
T21470 |
46298-46302 |
NNP |
denotes |
FITC |
T21471 |
46303-46312 |
VBZ |
denotes |
apoptosis |
T21472 |
46313-46322 |
NN |
denotes |
detection |
T21473 |
46323-46326 |
NN |
denotes |
kit |
T21474 |
46327-46328 |
-LRB- |
denotes |
( |
T21475 |
46328-46330 |
NNP |
denotes |
BD |
T21476 |
46331-46341 |
NNP |
denotes |
PharMingen |
T21477 |
46341-46342 |
, |
denotes |
, |
T21478 |
46343-46346 |
NNP |
denotes |
San |
T21479 |
46347-46352 |
NNP |
denotes |
Diego |
T21480 |
46352-46353 |
, |
denotes |
, |
T21481 |
46354-46356 |
NNP |
denotes |
CA |
T21482 |
46356-46357 |
-RRB- |
denotes |
) |
T21483 |
46357-46358 |
. |
denotes |
. |
T21484 |
46359-46366 |
RB |
denotes |
Briefly |
T21485 |
46366-46367 |
, |
denotes |
, |
T21486 |
46368-46373 |
JJ |
denotes |
human |
T21487 |
46374-46383 |
NNS |
denotes |
monocytes |
T21488 |
46384-46385 |
-LRB- |
denotes |
( |
T21489 |
46385-46386 |
CD |
denotes |
5 |
T21490 |
46386-46387 |
CD |
denotes |
× |
T21491 |
46387-46390 |
CD |
denotes |
106 |
T21492 |
46390-46391 |
-RRB- |
denotes |
) |
T21493 |
46392-46396 |
VBD |
denotes |
were |
T21494 |
46397-46406 |
VBN |
denotes |
incubated |
T21495 |
46407-46411 |
IN |
denotes |
with |
T21496 |
46412-46422 |
NNS |
denotes |
inhibitors |
T21497 |
46423-46426 |
IN |
denotes |
for |
T21498 |
46427-46429 |
CD |
denotes |
30 |
T21499 |
46430-46437 |
NNS |
denotes |
minutes |
T21500 |
46438-46440 |
IN |
denotes |
in |
T21501 |
46441-46447 |
NNP |
denotes |
X-vivo |
T21502 |
46448-46454 |
NN |
denotes |
medium |
T21503 |
46455-46458 |
CC |
denotes |
and |
T21504 |
46459-46471 |
VBN |
denotes |
restimulated |
T21505 |
46472-46476 |
IN |
denotes |
with |
T21506 |
46477-46480 |
CD |
denotes |
100 |
T21507 |
46481-46486 |
JJ |
denotes |
ng/ml |
T21508 |
46487-46492 |
NNP |
denotes |
M-CSF |
T21509 |
46493-46502 |
JJ |
denotes |
overnight |
T21510 |
46502-46503 |
. |
denotes |
. |
T21511 |
46504-46507 |
DT |
denotes |
The |
T21512 |
46508-46513 |
NNS |
denotes |
cells |
T21513 |
46514-46518 |
VBD |
denotes |
were |
T21514 |
46519-46526 |
VBN |
denotes |
removed |
T21515 |
46527-46531 |
IN |
denotes |
from |
T21516 |
46532-46535 |
DT |
denotes |
the |
T21517 |
46536-46543 |
NN |
denotes |
culture |
T21518 |
46544-46548 |
NN |
denotes |
dish |
T21519 |
46549-46554 |
VBG |
denotes |
using |
T21520 |
46555-46563 |
NNP |
denotes |
Accutase |
T21521 |
46564-46565 |
-LRB- |
denotes |
( |
T21522 |
46565-46576 |
NNP |
denotes |
eBioscience |
T21523 |
46576-46577 |
, |
denotes |
, |
T21524 |
46578-46581 |
NNP |
denotes |
San |
T21525 |
46582-46587 |
NNP |
denotes |
Diego |
T21526 |
46587-46588 |
, |
denotes |
, |
T21527 |
46589-46591 |
NNP |
denotes |
CA |
T21528 |
46591-46592 |
-RRB- |
denotes |
) |
T21529 |
46593-46596 |
CC |
denotes |
and |
T21530 |
46597-46604 |
VBN |
denotes |
stained |
T21531 |
46605-46609 |
IN |
denotes |
with |
T21532 |
46610-46617 |
NNP |
denotes |
Annexin |
T21533 |
46618-46619 |
NNP |
denotes |
V |
T21534 |
46620-46624 |
NNP |
denotes |
FITC |
T21535 |
46625-46628 |
CC |
denotes |
and |
T21536 |
46629-46631 |
NNP |
denotes |
PI |
T21537 |
46632-46635 |
CC |
denotes |
and |
T21538 |
46636-46644 |
VBN |
denotes |
analyzed |
T21539 |
46645-46647 |
IN |
denotes |
by |
T21540 |
46648-46652 |
NN |
denotes |
flow |
T21541 |
46653-46662 |
NN |
denotes |
cytometry |
T21542 |
46663-46664 |
-LRB- |
denotes |
( |
T21543 |
46664-46675 |
NNP |
denotes |
FACSCalibur |
T21544 |
46675-46676 |
: |
denotes |
; |
T21545 |
46677-46679 |
NNP |
denotes |
BD |
T21546 |
46680-46690 |
NNP |
denotes |
PharMingen |
T21547 |
46690-46691 |
-RRB- |
denotes |
) |
T21548 |
46691-46692 |
. |
denotes |
. |
T21549 |
46693-46700 |
NNP |
denotes |
Annexin |
T21550 |
46701-46707 |
NNP |
denotes |
V-FITC |
T21551 |
46708-46711 |
CC |
denotes |
and |
T21552 |
46712-46714 |
NNP |
denotes |
PI |
T21553 |
46715-46721 |
JJ |
denotes |
double |
T21554 |
46722-46730 |
JJ |
denotes |
negative |
T21555 |
46731-46736 |
NNS |
denotes |
cells |
T21556 |
46737-46741 |
VBD |
denotes |
were |
T21557 |
46742-46752 |
VBN |
denotes |
considered |
T21558 |
46753-46766 |
JJ |
denotes |
non-apoptotic |
T21559 |
46767-46772 |
NNS |
denotes |
cells |
T21560 |
46773-46776 |
IN |
denotes |
for |
T21561 |
46777-46788 |
JJ |
denotes |
statistical |
T21562 |
46789-46797 |
NN |
denotes |
analysis |
T21563 |
46797-46798 |
. |
denotes |
. |
T21735 |
46800-46807 |
JJ |
denotes |
Western |
T21736 |
46808-46812 |
NNP |
denotes |
Blot |
T21737 |
46813-46821 |
NNP |
denotes |
Analysis |
T21738 |
46822-46827 |
NNPS |
denotes |
Cells |
T21739 |
46828-46832 |
VBD |
denotes |
were |
T21740 |
46833-46839 |
VBN |
denotes |
washed |
T21741 |
46840-46844 |
IN |
denotes |
with |
T21742 |
46845-46848 |
NNP |
denotes |
PBS |
T21743 |
46849-46852 |
CC |
denotes |
and |
T21744 |
46853-46864 |
VBD |
denotes |
resuspended |
T21745 |
46865-46867 |
IN |
denotes |
in |
T21746 |
46868-46872 |
NN |
denotes |
cell |
T21747 |
46873-46878 |
NN |
denotes |
lysis |
T21748 |
46879-46885 |
NN |
denotes |
buffer |
T21749 |
46885-46886 |
. |
denotes |
. |
T21750 |
46887-46888 |
-LRB- |
denotes |
( |
T21751 |
46888-46892 |
NNP |
denotes |
Cell |
T21752 |
46893-46902 |
NNP |
denotes |
Signaling |
T21753 |
46903-46913 |
NNP |
denotes |
Technology |
T21754 |
46913-46914 |
-RRB- |
denotes |
) |
T21755 |
46915-46918 |
CC |
denotes |
and |
T21756 |
46919-46928 |
VBN |
denotes |
incubated |
T21757 |
46929-46932 |
IN |
denotes |
for |
T21758 |
46933-46935 |
CD |
denotes |
10 |
T21759 |
46936-46943 |
NNS |
denotes |
minutes |
T21760 |
46944-46946 |
IN |
denotes |
on |
T21761 |
46947-46950 |
NN |
denotes |
ice |
T21762 |
46951-46955 |
RB |
denotes |
then |
T21763 |
46956-46967 |
VBD |
denotes |
centrifuged |
T21764 |
46968-46970 |
TO |
denotes |
to |
T21765 |
46971-46977 |
VB |
denotes |
remove |
T21766 |
46978-46981 |
DT |
denotes |
the |
T21767 |
46982-46991 |
JJ |
denotes |
insoluble |
T21768 |
46992-47000 |
NN |
denotes |
fraction |
T21769 |
47000-47001 |
. |
denotes |
. |
T21770 |
47002-47005 |
DT |
denotes |
The |
T21771 |
47006-47013 |
NN |
denotes |
protein |
T21772 |
47014-47027 |
NN |
denotes |
concentration |
T21773 |
47028-47031 |
VBD |
denotes |
was |
T21774 |
47032-47042 |
VBN |
denotes |
determined |
T21775 |
47043-47045 |
IN |
denotes |
by |
T21776 |
47046-47049 |
DT |
denotes |
the |
T21777 |
47050-47053 |
NNP |
denotes |
BCA |
T21778 |
47054-47061 |
NN |
denotes |
protein |
T21779 |
47062-47067 |
NN |
denotes |
assay |
T21780 |
47068-47069 |
-LRB- |
denotes |
( |
T21781 |
47069-47076 |
NNP |
denotes |
Bio-Rad |
T21782 |
47076-47077 |
, |
denotes |
, |
T21783 |
47078-47086 |
NNP |
denotes |
Hercules |
T21784 |
47086-47087 |
, |
denotes |
, |
T21785 |
47088-47090 |
NNP |
denotes |
CA |
T21786 |
47090-47091 |
-RRB- |
denotes |
) |
T21787 |
47091-47092 |
. |
denotes |
. |
T21788 |
47093-47097 |
NN |
denotes |
Cell |
T21789 |
47098-47105 |
NNS |
denotes |
lysates |
T21790 |
47106-47110 |
VBD |
denotes |
were |
T21791 |
47111-47120 |
VBN |
denotes |
separated |
T21792 |
47121-47123 |
IN |
denotes |
by |
T21793 |
47124-47132 |
NNP |
denotes |
SDS-PAGE |
T21794 |
47133-47135 |
IN |
denotes |
on |
T21795 |
47136-47138 |
CD |
denotes |
10 |
T21796 |
47138-47139 |
NN |
denotes |
% |
T21797 |
47140-47154 |
NN |
denotes |
polyacrylamide |
T21798 |
47155-47159 |
NNS |
denotes |
gels |
T21799 |
47160-47163 |
CC |
denotes |
and |
T21800 |
47164-47168 |
RB |
denotes |
then |
T21801 |
47169-47180 |
VBD |
denotes |
transferred |
T21802 |
47181-47185 |
IN |
denotes |
onto |
T21803 |
47186-47200 |
JJ |
denotes |
nitrocellulose |
T21804 |
47201-47210 |
NNS |
denotes |
membranes |
T21805 |
47211-47214 |
CC |
denotes |
and |
T21806 |
47215-47224 |
VBN |
denotes |
subjected |
T21807 |
47225-47227 |
TO |
denotes |
to |
T21808 |
47228-47235 |
JJ |
denotes |
Western |
T21809 |
47236-47244 |
VBG |
denotes |
blotting |
T21810 |
47244-47245 |
. |
denotes |
. |
T21811 |
47246-47249 |
DT |
denotes |
The |
T21812 |
47250-47263 |
JJ |
denotes |
immunoblotted |
T21813 |
47264-47272 |
NNS |
denotes |
proteins |
T21814 |
47273-47277 |
VBD |
denotes |
were |
T21815 |
47278-47286 |
VBN |
denotes |
detected |
T21816 |
47287-47289 |
IN |
denotes |
by |
T21817 |
47290-47293 |
NNP |
denotes |
ECL |
T21818 |
47294-47301 |
NN |
denotes |
reagent |
T21819 |
47302-47303 |
-LRB- |
denotes |
( |
T21820 |
47303-47305 |
NNP |
denotes |
GE |
T21821 |
47306-47316 |
NNP |
denotes |
Healthcare |
T21822 |
47317-47329 |
NNP |
denotes |
Bio-Sciences |
T21823 |
47330-47335 |
NNP |
denotes |
Corp. |
T21824 |
47335-47336 |
, |
denotes |
, |
T21825 |
47337-47347 |
NNP |
denotes |
Piscataway |
T21826 |
47347-47348 |
, |
denotes |
, |
T21827 |
47349-47351 |
NNP |
denotes |
NJ |
T21828 |
47351-47352 |
-RRB- |
denotes |
) |
T21829 |
47352-47353 |
. |
denotes |
. |
T21944 |
47355-47363 |
NN |
denotes |
Analysis |
T21945 |
47364-47366 |
IN |
denotes |
of |
T21946 |
47367-47371 |
NNP |
denotes |
PKCα |
T21947 |
47372-47378 |
NNP |
denotes |
Kinase |
T21948 |
47379-47387 |
NNP |
denotes |
Activity |
T21949 |
47388-47393 |
NNP |
denotes |
Human |
T21950 |
47394-47398 |
NNPS |
denotes |
MDMs |
T21951 |
47399-47403 |
VBD |
denotes |
were |
T21952 |
47404-47411 |
VBN |
denotes |
starved |
T21953 |
47412-47415 |
IN |
denotes |
for |
T21954 |
47416-47417 |
CD |
denotes |
2 |
T21955 |
47418-47423 |
NNS |
denotes |
hours |
T21956 |
47424-47430 |
IN |
denotes |
before |
T21957 |
47431-47442 |
NN |
denotes |
stimulation |
T21958 |
47443-47447 |
IN |
denotes |
with |
T21959 |
47448-47453 |
NNP |
denotes |
M-CSF |
T21960 |
47454-47455 |
-LRB- |
denotes |
( |
T21961 |
47455-47456 |
CD |
denotes |
0 |
T21962 |
47457-47459 |
CD |
denotes |
60 |
T21963 |
47460-47467 |
NNS |
denotes |
minutes |
T21964 |
47467-47468 |
-RRB- |
denotes |
) |
T21965 |
47468-47469 |
, |
denotes |
, |
T21966 |
47470-47474 |
RB |
denotes |
then |
T21967 |
47475-47481 |
VBD |
denotes |
washed |
T21968 |
47482-47486 |
IN |
denotes |
with |
T21969 |
47487-47491 |
JJ |
denotes |
cold |
T21970 |
47492-47495 |
NNP |
denotes |
PBS |
T21971 |
47496-47499 |
CC |
denotes |
and |
T21972 |
47500-47507 |
VBN |
denotes |
removed |
T21973 |
47508-47512 |
IN |
denotes |
from |
T21974 |
47513-47516 |
DT |
denotes |
the |
T21975 |
47517-47523 |
NNS |
denotes |
plates |
T21976 |
47523-47524 |
. |
denotes |
. |
T21977 |
47525-47528 |
DT |
denotes |
The |
T21978 |
47529-47534 |
NNS |
denotes |
cells |
T21979 |
47535-47539 |
VBD |
denotes |
were |
T21980 |
47540-47551 |
VBN |
denotes |
resuspended |
T21981 |
47552-47554 |
IN |
denotes |
in |
T21982 |
47555-47560 |
NN |
denotes |
lysis |
T21983 |
47561-47567 |
NN |
denotes |
buffer |
T21984 |
47568-47569 |
-LRB- |
denotes |
( |
T21985 |
47569-47571 |
CD |
denotes |
20 |
T21986 |
47572-47574 |
NNP |
denotes |
mM |
T21987 |
47575-47579 |
NNP |
denotes |
Tris |
T21988 |
47579-47580 |
, |
denotes |
, |
T21989 |
47581-47582 |
CD |
denotes |
5 |
T21990 |
47583-47585 |
NNP |
denotes |
mM |
T21991 |
47586-47591 |
NNP |
denotes |
MgCl2 |
T21992 |
47591-47592 |
, |
denotes |
, |
T21993 |
47593-47594 |
CD |
denotes |
1 |
T21994 |
47595-47597 |
NNP |
denotes |
mM |
T21995 |
47598-47602 |
NNP |
denotes |
EGTA |
T21996 |
47602-47603 |
, |
denotes |
, |
T21997 |
47604-47606 |
CD |
denotes |
20 |
T21998 |
47607-47609 |
NNP |
denotes |
mM |
T21999 |
47610-47620 |
JJ |
denotes |
β-glycerol |
T22000 |
47621-47630 |
NN |
denotes |
phosphate |
T22001 |
47630-47631 |
, |
denotes |
, |
T22002 |
47632-47633 |
CD |
denotes |
1 |
T22003 |
47634-47636 |
NNP |
denotes |
mM |
T22004 |
47637-47641 |
NNP |
denotes |
PMSF |
T22005 |
47642-47643 |
CD |
denotes |
2 |
T22006 |
47644-47646 |
NN |
denotes |
µg |
T22007 |
47646-47647 |
NN |
denotes |
/ |
T22008 |
47647-47649 |
NN |
denotes |
ml |
T22009 |
47650-47659 |
NN |
denotes |
aprotinin |
T22010 |
47660-47663 |
CC |
denotes |
and |
T22011 |
47664-47665 |
CD |
denotes |
2 |
T22012 |
47666-47668 |
NN |
denotes |
µg |
T22013 |
47668-47669 |
NN |
denotes |
/ |
T22014 |
47669-47671 |
NN |
denotes |
ml |
T22015 |
47672-47681 |
NN |
denotes |
leupeptin |
T22016 |
47681-47682 |
, |
denotes |
, |
T22017 |
47683-47685 |
NNP |
denotes |
pH |
T22018 |
47686-47689 |
CD |
denotes |
7.5 |
T22019 |
47689-47690 |
-RRB- |
denotes |
) |
T22020 |
47690-47691 |
, |
denotes |
, |
T22021 |
47692-47701 |
VBN |
denotes |
sonicated |
T22022 |
47702-47705 |
CC |
denotes |
and |
T22023 |
47706-47717 |
VBN |
denotes |
centrifuged |
T22024 |
47718-47720 |
TO |
denotes |
to |
T22025 |
47721-47727 |
VB |
denotes |
obtain |
T22026 |
47728-47733 |
JJ |
denotes |
whole |
T22027 |
47734-47738 |
NN |
denotes |
cell |
T22028 |
47739-47746 |
NNS |
denotes |
lysates |
T22029 |
47746-47747 |
, |
denotes |
, |
T22030 |
47748-47753 |
WDT |
denotes |
which |
T22031 |
47754-47758 |
VBD |
denotes |
were |
T22032 |
47759-47763 |
RB |
denotes |
then |
T22033 |
47764-47782 |
VBN |
denotes |
immunoprecipitated |
T22034 |
47783-47787 |
IN |
denotes |
with |
T22035 |
47788-47797 |
JJ |
denotes |
anti-PKCα |
T22036 |
47798-47806 |
NN |
denotes |
antibody |
T22037 |
47807-47810 |
CC |
denotes |
and |
T22038 |
47811-47818 |
NN |
denotes |
protein |
T22039 |
47819-47828 |
NN |
denotes |
G-agarose |
T22040 |
47829-47830 |
-LRB- |
denotes |
( |
T22041 |
47830-47840 |
NNP |
denotes |
Invitrogen |
T22042 |
47840-47841 |
-RRB- |
denotes |
) |
T22043 |
47841-47842 |
. |
denotes |
. |
T22044 |
47843-47849 |
NNP |
denotes |
Immune |
T22045 |
47850-47859 |
NNS |
denotes |
complexes |
T22046 |
47860-47864 |
VBD |
denotes |
were |
T22047 |
47865-47871 |
VBN |
denotes |
washed |
T22048 |
47872-47877 |
RB |
denotes |
twice |
T22049 |
47877-47878 |
, |
denotes |
, |
T22050 |
47879-47882 |
CC |
denotes |
and |
T22051 |
47883-47887 |
NNP |
denotes |
PKCα |
T22052 |
47888-47896 |
NN |
denotes |
activity |
T22053 |
47897-47900 |
VBD |
denotes |
was |
T22054 |
47901-47909 |
VBN |
denotes |
analyzed |
T22055 |
47910-47912 |
IN |
denotes |
by |
T22056 |
47913-47928 |
JJ |
denotes |
non-radioactive |
T22057 |
47929-47935 |
NNP |
denotes |
Peptag |
T22058 |
47936-47941 |
NN |
denotes |
assay |
T22059 |
47942-47945 |
NN |
denotes |
kit |
T22060 |
47946-47947 |
-LRB- |
denotes |
( |
T22061 |
47947-47954 |
NNP |
denotes |
Promega |
T22062 |
47954-47955 |
-RRB- |
denotes |
) |
T22063 |
47955-47956 |
. |
denotes |
. |
T22064 |
47957-47964 |
RB |
denotes |
Briefly |
T22065 |
47964-47965 |
, |
denotes |
, |
T22066 |
47966-47972 |
NN |
denotes |
kinase |
T22067 |
47973-47979 |
NN |
denotes |
buffer |
T22068 |
47979-47980 |
, |
denotes |
, |
T22069 |
47981-47990 |
NN |
denotes |
activator |
T22070 |
47990-47991 |
, |
denotes |
, |
T22071 |
47992-47999 |
NN |
denotes |
peptide |
T22072 |
48000-48010 |
NN |
denotes |
protection |
T22073 |
48011-48019 |
NN |
denotes |
solution |
T22074 |
48020-48023 |
CC |
denotes |
and |
T22075 |
48024-48030 |
NNP |
denotes |
Peptag |
T22076 |
48031-48038 |
NN |
denotes |
peptide |
T22077 |
48039-48043 |
VBD |
denotes |
were |
T22078 |
48044-48053 |
VBN |
denotes |
incubated |
T22079 |
48054-48058 |
IN |
denotes |
with |
T22080 |
48059-48062 |
DT |
denotes |
the |
T22081 |
48063-48069 |
JJ |
denotes |
immune |
T22082 |
48070-48079 |
NNS |
denotes |
complexes |
T22083 |
48080-48082 |
IN |
denotes |
at |
T22084 |
48083-48085 |
CD |
denotes |
30 |
T22085 |
48085-48086 |
CD |
denotes |
° |
T22086 |
48086-48087 |
NNP |
denotes |
C |
T22087 |
48088-48091 |
IN |
denotes |
for |
T22088 |
48092-48094 |
CD |
denotes |
30 |
T22089 |
48095-48102 |
NNS |
denotes |
minutes |
T22090 |
48102-48103 |
. |
denotes |
. |
T22091 |
48104-48113 |
NNS |
denotes |
Reactions |
T22092 |
48114-48118 |
VBD |
denotes |
were |
T22093 |
48119-48126 |
VBN |
denotes |
stopped |
T22094 |
48127-48129 |
IN |
denotes |
by |
T22095 |
48130-48137 |
VBG |
denotes |
boiling |
T22096 |
48138-48141 |
IN |
denotes |
for |
T22097 |
48142-48144 |
CD |
denotes |
10 |
T22098 |
48145-48152 |
NNS |
denotes |
minutes |
T22099 |
48153-48156 |
CC |
denotes |
and |
T22100 |
48157-48164 |
NNS |
denotes |
samples |
T22101 |
48165-48169 |
VBD |
denotes |
were |
T22102 |
48170-48179 |
VBN |
denotes |
separated |
T22103 |
48180-48182 |
IN |
denotes |
on |
T22104 |
48183-48186 |
CD |
denotes |
0.8 |
T22105 |
48186-48187 |
NN |
denotes |
% |
T22106 |
48188-48195 |
JJ |
denotes |
agarose |
T22107 |
48196-48199 |
NN |
denotes |
gel |
T22108 |
48199-48200 |
. |
denotes |
. |
T22109 |
48201-48215 |
NNP |
denotes |
Phosphorylated |
T22110 |
48216-48223 |
NN |
denotes |
peptide |
T22111 |
48224-48232 |
VBD |
denotes |
migrated |
T22112 |
48233-48239 |
IN |
denotes |
toward |
T22113 |
48240-48243 |
DT |
denotes |
the |
T22114 |
48244-48249 |
NN |
denotes |
anode |
T22115 |
48250-48251 |
-LRB- |
denotes |
( |
T22116 |
48251-48252 |
FW |
denotes |
+ |
T22117 |
48252-48253 |
-RRB- |
denotes |
) |
T22118 |
48253-48254 |
, |
denotes |
, |
T22119 |
48255-48260 |
IN |
denotes |
while |
T22120 |
48261-48279 |
JJ |
denotes |
non-phosphorylated |
T22121 |
48280-48287 |
NN |
denotes |
peptide |
T22122 |
48288-48296 |
VBD |
denotes |
migrated |
T22123 |
48297-48303 |
IN |
denotes |
toward |
T22124 |
48304-48307 |
DT |
denotes |
the |
T22125 |
48308-48315 |
NN |
denotes |
cathode |
T22126 |
48316-48317 |
-LRB- |
denotes |
( |
T22127 |
48317-48318 |
FW |
denotes |
− |
T22128 |
48318-48319 |
-RRB- |
denotes |
) |
T22129 |
48319-48320 |
. |
denotes |
. |
T22130 |
48321-48339 |
JJ |
denotes |
Fluorescein-tagged |
T22131 |
48340-48348 |
NNS |
denotes |
peptides |
T22132 |
48349-48353 |
VBD |
denotes |
were |
T22133 |
48354-48364 |
VBN |
denotes |
visualized |
T22134 |
48365-48367 |
IN |
denotes |
by |
T22135 |
48368-48370 |
NNP |
denotes |
UV |
T22136 |
48371-48376 |
NN |
denotes |
light |
T22137 |
48376-48377 |
. |
denotes |
. |
T22378 |
48379-48382 |
NNP |
denotes |
RNA |
T22379 |
48383-48392 |
NNP |
denotes |
Isolation |
T22380 |
48393-48396 |
CC |
denotes |
and |
T22381 |
48397-48409 |
JJ |
denotes |
Quantitative |
T22382 |
48410-48419 |
JJ |
denotes |
Real-time |
T22383 |
48420-48423 |
NNP |
denotes |
PCR |
T22384 |
48424-48428 |
NNPS |
denotes |
MDMs |
T22385 |
48429-48431 |
CC |
denotes |
or |
T22386 |
48432-48435 |
NNP |
denotes |
RAW |
T22387 |
48436-48441 |
CD |
denotes |
264.7 |
T22388 |
48442-48447 |
NNS |
denotes |
cells |
T22389 |
48448-48452 |
VBD |
denotes |
were |
T22390 |
48453-48466 |
JJ |
denotes |
serum-starved |
T22391 |
48467-48476 |
JJ |
denotes |
overnight |
T22392 |
48477-48479 |
CC |
denotes |
or |
T22393 |
48480-48483 |
IN |
denotes |
for |
T22394 |
48484-48485 |
CD |
denotes |
2 |
T22395 |
48486-48491 |
NNS |
denotes |
hours |
T22396 |
48491-48492 |
, |
denotes |
, |
T22397 |
48493-48505 |
RB |
denotes |
respectively |
T22398 |
48505-48506 |
, |
denotes |
, |
T22399 |
48507-48512 |
RB |
denotes |
prior |
T22400 |
48513-48515 |
TO |
denotes |
to |
T22401 |
48516-48526 |
VBG |
denotes |
incubating |
T22402 |
48527-48531 |
IN |
denotes |
with |
T22403 |
48532-48542 |
NNS |
denotes |
inhibitors |
T22404 |
48543-48546 |
IN |
denotes |
for |
T22405 |
48547-48549 |
CD |
denotes |
30 |
T22406 |
48550-48557 |
NNS |
denotes |
minutes |
T22407 |
48557-48558 |
. |
denotes |
. |
T22408 |
48559-48562 |
DT |
denotes |
The |
T22409 |
48563-48568 |
NNS |
denotes |
cells |
T22410 |
48569-48573 |
VBD |
denotes |
were |
T22411 |
48574-48586 |
VBN |
denotes |
restimulated |
T22412 |
48587-48591 |
IN |
denotes |
with |
T22413 |
48592-48595 |
CD |
denotes |
100 |
T22414 |
48596-48601 |
JJ |
denotes |
ng/ml |
T22415 |
48602-48607 |
NNP |
denotes |
M-CSF |
T22416 |
48608-48611 |
CC |
denotes |
and |
T22417 |
48612-48617 |
JJ |
denotes |
total |
T22418 |
48618-48622 |
NNP |
denotes |
mRNA |
T22419 |
48623-48626 |
VBD |
denotes |
was |
T22420 |
48627-48636 |
VBN |
denotes |
extracted |
T22421 |
48637-48641 |
IN |
denotes |
from |
T22422 |
48642-48647 |
NNS |
denotes |
cells |
T22423 |
48648-48652 |
IN |
denotes |
with |
T22424 |
48653-48659 |
NNP |
denotes |
Trizol |
T22425 |
48660-48661 |
-LRB- |
denotes |
( |
T22426 |
48661-48671 |
NNP |
denotes |
Invitrogen |
T22427 |
48671-48672 |
-RRB- |
denotes |
) |
T22428 |
48673-48676 |
CC |
denotes |
and |
T22429 |
48677-48678 |
CD |
denotes |
1 |
T22430 |
48679-48680 |
CD |
denotes |
2 |
T22431 |
48681-48683 |
NN |
denotes |
µg |
T22432 |
48684-48686 |
IN |
denotes |
of |
T22433 |
48687-48692 |
JJ |
denotes |
total |
T22434 |
48693-48696 |
NNP |
denotes |
RNA |
T22435 |
48697-48700 |
VBD |
denotes |
was |
T22436 |
48701-48705 |
VBN |
denotes |
used |
T22437 |
48706-48708 |
TO |
denotes |
to |
T22438 |
48709-48720 |
VBN |
denotes |
synthesized |
T22439 |
48721-48725 |
NNP |
denotes |
cDNA |
T22440 |
48726-48731 |
VBG |
denotes |
using |
T22441 |
48732-48743 |
NNP |
denotes |
SuperScript |
T22442 |
48744-48747 |
NNP |
denotes |
III |
T22443 |
48748-48749 |
-LRB- |
denotes |
( |
T22444 |
48749-48759 |
NNP |
denotes |
Invitrogen |
T22445 |
48759-48760 |
-RRB- |
denotes |
) |
T22446 |
48760-48761 |
. |
denotes |
. |
T22447 |
48762-48774 |
JJ |
denotes |
Quantitative |
T22448 |
48775-48784 |
JJ |
denotes |
real-time |
T22449 |
48785-48786 |
-LRB- |
denotes |
( |
T22450 |
48786-48789 |
NNP |
denotes |
qRT |
T22451 |
48789-48790 |
-RRB- |
denotes |
) |
T22452 |
48790-48791 |
: |
denotes |
- |
T22453 |
48791-48794 |
NNP |
denotes |
PCR |
T22454 |
48795-48798 |
VBD |
denotes |
was |
T22455 |
48799-48808 |
VBN |
denotes |
performed |
T22456 |
48809-48814 |
VBG |
denotes |
using |
T22457 |
48815-48819 |
NNP |
denotes |
SYBR |
T22458 |
48820-48825 |
NNP |
denotes |
Green |
T22459 |
48826-48832 |
NNP |
denotes |
Master |
T22460 |
48833-48836 |
NNP |
denotes |
Mix |
T22461 |
48837-48838 |
-LRB- |
denotes |
( |
T22462 |
48838-48845 |
NNP |
denotes |
Applied |
T22463 |
48846-48856 |
NNPS |
denotes |
BioSystems |
T22464 |
48856-48857 |
, |
denotes |
, |
T22465 |
48858-48866 |
NNP |
denotes |
Carlsbad |
T22466 |
48866-48867 |
, |
denotes |
, |
T22467 |
48868-48870 |
NNP |
denotes |
CA |
T22468 |
48870-48871 |
-RRB- |
denotes |
) |
T22469 |
48871-48872 |
. |
denotes |
. |
T22470 |
48873-48876 |
DT |
denotes |
The |
T22471 |
48877-48886 |
NNS |
denotes |
reactions |
T22472 |
48887-48891 |
VBD |
denotes |
were |
T22473 |
48892-48901 |
VBN |
denotes |
performed |
T22474 |
48902-48907 |
VBG |
denotes |
using |
T22475 |
48908-48910 |
DT |
denotes |
an |
T22476 |
48911-48914 |
NNP |
denotes |
ABI |
T22477 |
48915-48920 |
NNP |
denotes |
PRIZM |
T22478 |
48921-48925 |
CD |
denotes |
7700 |
T22479 |
48926-48933 |
NN |
denotes |
machine |
T22480 |
48934-48938 |
IN |
denotes |
with |
T22481 |
48939-48947 |
NN |
denotes |
software |
T22482 |
48948-48956 |
NNP |
denotes |
Sequence |
T22483 |
48957-48965 |
NNP |
denotes |
Detector |
T22484 |
48966-48973 |
NN |
denotes |
version |
T22485 |
48974-48977 |
CD |
denotes |
1.7 |
T22486 |
48978-48979 |
-LRB- |
denotes |
( |
T22487 |
48979-48986 |
NNP |
denotes |
Applied |
T22488 |
48987-48997 |
NNPS |
denotes |
Biosystems |
T22489 |
48997-48998 |
-RRB- |
denotes |
) |
T22490 |
48998-48999 |
. |
denotes |
. |
T22491 |
49000-49003 |
DT |
denotes |
The |
T22492 |
49004-49010 |
NN |
denotes |
target |
T22493 |
49011-49015 |
NN |
denotes |
gene |
T22494 |
49016-49022 |
NNS |
denotes |
values |
T22495 |
49023-49027 |
VBD |
denotes |
were |
T22496 |
49028-49038 |
VBN |
denotes |
normalized |
T22497 |
49039-49041 |
TO |
denotes |
to |
T22498 |
49042-49045 |
DT |
denotes |
the |
T22499 |
49046-49052 |
NNS |
denotes |
values |
T22500 |
49053-49055 |
IN |
denotes |
of |
T22501 |
49056-49061 |
NNP |
denotes |
GAPDH |
T22502 |
49062-49064 |
IN |
denotes |
as |
T22503 |
49065-49066 |
DT |
denotes |
a |
T22504 |
49067-49079 |
NN |
denotes |
housekeeping |
T22505 |
49080-49084 |
NN |
denotes |
gene |
T22506 |
49085-49088 |
CC |
denotes |
and |
T22507 |
49089-49098 |
VBD |
denotes |
expressed |
T22508 |
49099-49101 |
IN |
denotes |
as |
T22509 |
49102-49110 |
JJ |
denotes |
relative |
T22510 |
49111-49115 |
VBP |
denotes |
fold |
T22511 |
49116-49124 |
NN |
denotes |
increase |
T22512 |
49125-49126 |
CD |
denotes |
2 |
T22513 |
49126-49127 |
-LRB- |
denotes |
( |
T22514 |
49127-49128 |
NN |
denotes |
− |
T22515 |
49128-49132 |
NNP |
denotes |
ΔΔCt |
T22516 |
49132-49133 |
-RRB- |
denotes |
) |
T22517 |
49134-49138 |
IN |
denotes |
over |
T22518 |
49139-49142 |
DT |
denotes |
the |
T22519 |
49143-49157 |
JJ |
denotes |
non-stimulated |
T22520 |
49158-49165 |
NNS |
denotes |
samples |
T22521 |
49166-49167 |
-LRB- |
denotes |
( |
T22522 |
49167-49169 |
NNP |
denotes |
NS |
T22523 |
49169-49170 |
-RRB- |
denotes |
) |
T22524 |
49170-49171 |
. |
denotes |
. |
T22732 |
49395-49401 |
NNS |
denotes |
Ethics |
T22733 |
49402-49411 |
NNP |
denotes |
Statement |
T22734 |
49412-49415 |
NNP |
denotes |
All |
T22735 |
49416-49424 |
NN |
denotes |
research |
T22736 |
49425-49434 |
VBG |
denotes |
involving |
T22737 |
49435-49440 |
JJ |
denotes |
human |
T22738 |
49441-49446 |
NN |
denotes |
blood |
T22739 |
49447-49448 |
-LRB- |
denotes |
( |
T22740 |
49448-49453 |
NNP |
denotes |
Buffy |
T22741 |
49454-49458 |
NN |
denotes |
coat |
T22742 |
49458-49459 |
-RRB- |
denotes |
) |
T22743 |
49460-49464 |
VBD |
denotes |
were |
T22744 |
49465-49472 |
VBN |
denotes |
ordered |
T22745 |
49473-49477 |
IN |
denotes |
from |
T22746 |
49478-49486 |
NNP |
denotes |
American |
T22747 |
49487-49490 |
NNP |
denotes |
Red |
T22748 |
49491-49496 |
NN |
denotes |
cross |
T22749 |
49497-49500 |
CC |
denotes |
and |
T22750 |
49501-49505 |
VBP |
denotes |
have |
T22751 |
49506-49510 |
VBN |
denotes |
been |
T22752 |
49511-49519 |
VBN |
denotes |
approved |
T22753 |
49520-49522 |
IN |
denotes |
by |
T22754 |
49523-49526 |
DT |
denotes |
the |
T22755 |
49527-49531 |
NNP |
denotes |
Ohio |
T22756 |
49532-49537 |
NNP |
denotes |
State |
T22757 |
49538-49548 |
NNP |
denotes |
University |
T22758 |
49549-49555 |
NN |
denotes |
review |
T22759 |
49556-49561 |
NN |
denotes |
board |
T22760 |
49562-49563 |
-LRB- |
denotes |
( |
T22761 |
49563-49566 |
NNP |
denotes |
ARC |
T22762 |
49567-49570 |
NNP |
denotes |
IRB |
T22763 |
49571-49579 |
NNP |
denotes |
Protocol |
T22764 |
49580-49581 |
# |
denotes |
# |
T22765 |
49581-49588 |
CD |
denotes |
2001-26 |
T22766 |
49588-49589 |
-RRB- |
denotes |
) |
T22767 |
49589-49590 |
. |
denotes |
. |
R100 |
T132 |
T129 |
pobj |
macrophages,in |
R1000 |
T1372 |
T1374 |
nsubjpass |
complex,sequestered |
R1001 |
T1373 |
T1374 |
auxpass |
is,sequestered |
R1002 |
T1374 |
T1374 |
ROOT |
sequestered,sequestered |
R1003 |
T1375 |
T1374 |
prep |
in,sequestered |
R1004 |
T1376 |
T1377 |
det |
the,cytosol |
R1005 |
T1377 |
T1375 |
pobj |
cytosol,in |
R1006 |
T1378 |
T1374 |
agent |
by,sequestered |
R1007 |
T1379 |
T1380 |
compound |
IκBα,[ |
R1008 |
T1380 |
T1378 |
pobj |
[,by |
R1009 |
T1381 |
T1382 |
nummod |
15,] |
R101 |
T133 |
T134 |
punct |
(,MDMs |
R1010 |
T1382 |
T1380 |
appos |
],[ |
R1011 |
T1383 |
T1374 |
punct |
.,sequestered |
R1012 |
T1384 |
T1394 |
mark |
Upon,phosphorylated |
R1013 |
T1385 |
T1384 |
pobj |
stimulation,Upon |
R1014 |
T1386 |
T1385 |
prep |
by,stimulation |
R1015 |
T1387 |
T1386 |
pobj |
cytokines,by |
R1016 |
T1388 |
T1387 |
cc |
or,cytokines |
R1017 |
T1389 |
T1390 |
compound |
UV,radiation |
R1018 |
T1390 |
T1387 |
conj |
radiation,cytokines |
R1019 |
T1391 |
T1390 |
punct |
",",radiation |
R102 |
T134 |
T132 |
appos |
MDMs,macrophages |
R1020 |
T1392 |
T1393 |
nsubj |
IκBα,is |
R1021 |
T1393 |
T1394 |
auxpass |
is,phosphorylated |
R1022 |
T1394 |
T1394 |
ROOT |
phosphorylated,phosphorylated |
R1023 |
T1395 |
T1394 |
punct |
",",phosphorylated |
R1024 |
T1396 |
T1394 |
conj |
ubiquitinated,phosphorylated |
R1025 |
T1397 |
T1396 |
punct |
",",ubiquitinated |
R1026 |
T1398 |
T1396 |
cc |
and,ubiquitinated |
R1027 |
T1399 |
T1396 |
conj |
degraded,ubiquitinated |
R1028 |
T1400 |
T1394 |
punct |
",",phosphorylated |
R1029 |
T1401 |
T1394 |
advcl |
releasing,phosphorylated |
R103 |
T135 |
T125 |
punct |
),stimulated |
R1030 |
T1402 |
T1403 |
compound |
NF-κB,p50/p65 |
R1031 |
T1403 |
T1401 |
dobj |
p50/p65,releasing |
R1032 |
T1404 |
T1405 |
aux |
to,translocate |
R1033 |
T1405 |
T1401 |
advcl |
translocate,releasing |
R1034 |
T1406 |
T1405 |
prep |
to,translocate |
R1035 |
T1407 |
T1408 |
det |
the,nucleus |
R1036 |
T1408 |
T1406 |
pobj |
nucleus,to |
R1037 |
T1409 |
T1408 |
cc |
and,nucleus |
R1038 |
T1410 |
T1412 |
compound |
transactivate,genes |
R1039 |
T1411 |
T1412 |
compound |
target,genes |
R104 |
T136 |
T125 |
cc |
and,stimulated |
R1040 |
T1412 |
T1408 |
conj |
genes,nucleus |
R1041 |
T1413 |
T1394 |
punct |
.,phosphorylated |
R1042 |
T1414 |
T1423 |
prep |
After,undergo |
R1043 |
T1415 |
T1416 |
poss |
its,release |
R1044 |
T1416 |
T1414 |
pobj |
release,After |
R1045 |
T1417 |
T1416 |
prep |
from,release |
R1046 |
T1418 |
T1417 |
pobj |
IκBα,from |
R1047 |
T1419 |
T1418 |
punct |
",",IκBα |
R1048 |
T1420 |
T1421 |
compound |
NF-κB,p65 |
R1049 |
T1421 |
T1423 |
nsubj |
p65,undergo |
R105 |
T137 |
T142 |
det |
the,RAW |
R1050 |
T1422 |
T1423 |
aux |
can,undergo |
R1051 |
T1423 |
T1423 |
ROOT |
undergo,undergo |
R1052 |
T1424 |
T1425 |
amod |
post-translational,modification |
R1053 |
T1425 |
T1423 |
dobj |
modification,undergo |
R1054 |
T1426 |
T1427 |
aux |
to,activate |
R1055 |
T1427 |
T1423 |
xcomp |
activate,undergo |
R1056 |
T1428 |
T1429 |
compound |
gene,transcription |
R1057 |
T1429 |
T1427 |
dobj |
transcription,activate |
R1058 |
T1430 |
T1423 |
punct |
.,undergo |
R1059 |
T1431 |
T1432 |
det |
The,role |
R106 |
T138 |
T141 |
nmod |
murine,line |
R1060 |
T1432 |
T1441 |
nsubj |
role,varies |
R10602 |
T14519 |
T14521 |
amod |
NF-κB,"activation. Here, we demonstrate that M-CSF stimulated NF-κB transcriptional activity" |
R10603 |
T14520 |
T14521 |
amod |
transcription factor Nuclear Factor-kappaB (NF-κB) is a key regulator of genes involved in M-CSF-induced mononuclear phagocyte survival and this study focused at identifying the mechanism of NF-κB transcriptional,"activation. Here, we demonstrate that M-CSF stimulated NF-κB transcriptional activity" |
R10604 |
T14521 |
T14522 |
nsubj |
"activation. Here, we demonstrate that M-CSF stimulated NF-κB transcriptional activity","in human monocyte-derived macrophages (MDMs) and the murine macrophage cell line RAW 264.7. The general protein kinase C (PKC) inhibitor Ro-31-8220, the conventional PKCα/β inhibitor Gö-6976, overexpression of dominant negative PKCα constructs and PKCα siRNA reduced NF-κB activity in response to M-CSF. Interestingly, Ro-31-8220 reduced Ser276 phosphorylation of NF-κBp65 leading to decreased M-CSF-induced monocyte survival. In this report, we identify conventional PKCs, including PKCα as important upstream kinases for M-CSF-induced NF-κB transcriptional activation, NF-κB-regulated gene expression, NF-κB p65 Ser276 phosphorylation, and macrophage survival. Lastly, we find that NF-κB p65 Ser276 plays an important role in basal and M-CSF-stimulated NF-κB activation in human mononuclear phagocytes.
Introduction
Monocytes are produced in the bone marrow and circulate in blood for 24–48 hours [1]. In the absence of serum, monocytes die via apoptosis [1], [2]. Macrophage colony-stimulating factor (M-CSF) stimulates mononuclear phagocyte survival and differentiation [3]. Importantly, M-CSF-mediated cell survival and activation is associated with a variety of human diseases, including atherosclerosis, transplant vascular sclerosis and breast cancer metastasis [4], [5], [6].
We previously identified that NF-κB activation is" |
R10605 |
T14522 |
T14522 |
ROOT |
"in human monocyte-derived macrophages (MDMs) and the murine macrophage cell line RAW 264.7. The general protein kinase C (PKC) inhibitor Ro-31-8220, the conventional PKCα/β inhibitor Gö-6976, overexpression of dominant negative PKCα constructs and PKCα siRNA reduced NF-κB activity in response to M-CSF. Interestingly, Ro-31-8220 reduced Ser276 phosphorylation of NF-κBp65 leading to decreased M-CSF-induced monocyte survival. In this report, we identify conventional PKCs, including PKCα as important upstream kinases for M-CSF-induced NF-κB transcriptional activation, NF-κB-regulated gene expression, NF-κB p65 Ser276 phosphorylation, and macrophage survival. Lastly, we find that NF-κB p65 Ser276 plays an important role in basal and M-CSF-stimulated NF-κB activation in human mononuclear phagocytes.
Introduction
Monocytes are produced in the bone marrow and circulate in blood for 24–48 hours [1]. In the absence of serum, monocytes die via apoptosis [1], [2]. Macrophage colony-stimulating factor (M-CSF) stimulates mononuclear phagocyte survival and differentiation [3]. Importantly, M-CSF-mediated cell survival and activation is associated with a variety of human diseases, including atherosclerosis, transplant vascular sclerosis and breast cancer metastasis [4], [5], [6].
We previously identified that NF-κB activation is","in human monocyte-derived macrophages (MDMs) and the murine macrophage cell line RAW 264.7. The general protein kinase C (PKC) inhibitor Ro-31-8220, the conventional PKCα/β inhibitor Gö-6976, overexpression of dominant negative PKCα constructs and PKCα siRNA reduced NF-κB activity in response to M-CSF. Interestingly, Ro-31-8220 reduced Ser276 phosphorylation of NF-κBp65 leading to decreased M-CSF-induced monocyte survival. In this report, we identify conventional PKCs, including PKCα as important upstream kinases for M-CSF-induced NF-κB transcriptional activation, NF-κB-regulated gene expression, NF-κB p65 Ser276 phosphorylation, and macrophage survival. Lastly, we find that NF-κB p65 Ser276 plays an important role in basal and M-CSF-stimulated NF-κB activation in human mononuclear phagocytes.
Introduction
Monocytes are produced in the bone marrow and circulate in blood for 24–48 hours [1]. In the absence of serum, monocytes die via apoptosis [1], [2]. Macrophage colony-stimulating factor (M-CSF) stimulates mononuclear phagocyte survival and differentiation [3]. Importantly, M-CSF-mediated cell survival and activation is associated with a variety of human diseases, including atherosclerosis, transplant vascular sclerosis and breast cancer metastasis [4], [5], [6].
We previously identified that NF-κB activation is" |
R10606 |
T14523 |
T14522 |
acomp |
important,"in human monocyte-derived macrophages (MDMs) and the murine macrophage cell line RAW 264.7. The general protein kinase C (PKC) inhibitor Ro-31-8220, the conventional PKCα/β inhibitor Gö-6976, overexpression of dominant negative PKCα constructs and PKCα siRNA reduced NF-κB activity in response to M-CSF. Interestingly, Ro-31-8220 reduced Ser276 phosphorylation of NF-κBp65 leading to decreased M-CSF-induced monocyte survival. In this report, we identify conventional PKCs, including PKCα as important upstream kinases for M-CSF-induced NF-κB transcriptional activation, NF-κB-regulated gene expression, NF-κB p65 Ser276 phosphorylation, and macrophage survival. Lastly, we find that NF-κB p65 Ser276 plays an important role in basal and M-CSF-stimulated NF-κB activation in human mononuclear phagocytes.
Introduction
Monocytes are produced in the bone marrow and circulate in blood for 24–48 hours [1]. In the absence of serum, monocytes die via apoptosis [1], [2]. Macrophage colony-stimulating factor (M-CSF) stimulates mononuclear phagocyte survival and differentiation [3]. Importantly, M-CSF-mediated cell survival and activation is associated with a variety of human diseases, including atherosclerosis, transplant vascular sclerosis and breast cancer metastasis [4], [5], [6].
We previously identified that NF-κB activation is" |
R10607 |
T14524 |
T14523 |
prep |
in,important |
R10608 |
T14525 |
T14524 |
pcomp |
regulating,in |
R10609 |
T14526 |
T14527 |
amod |
intracellular,signaling |
R1061 |
T1433 |
T1432 |
prep |
of,role |
R10610 |
T14527 |
T14525 |
dobj |
signaling,regulating |
R10611 |
T14528 |
T14527 |
punct |
",",signaling |
R10612 |
T14529 |
T14530 |
compound |
stress,response |
R10613 |
T14530 |
T14527 |
conj |
response,signaling |
R10614 |
T14531 |
T14530 |
punct |
",",response |
R10615 |
T14532 |
T14530 |
conj |
proliferation,response |
R10616 |
T14533 |
T14532 |
punct |
",",proliferation |
R10617 |
T14534 |
T14532 |
conj |
survival,proliferation |
R10618 |
T14535 |
T14534 |
punct |
",",survival |
R10619 |
T14536 |
T14534 |
conj |
differentiation,survival |
R1062 |
T1434 |
T1433 |
pobj |
NF-κB,of |
R10620 |
T14537 |
T14536 |
cc |
and,differentiation |
R10621 |
T14538 |
T14536 |
conj |
inflammation,differentiation |
R10622 |
T14539 |
T14536 |
conj |
[,differentiation |
R10623 |
T14540 |
T14541 |
nummod |
8,] |
R10624 |
T14541 |
T14530 |
npadvmod |
],response |
R10625 |
T14542 |
T14522 |
punct |
.,"in human monocyte-derived macrophages (MDMs) and the murine macrophage cell line RAW 264.7. The general protein kinase C (PKC) inhibitor Ro-31-8220, the conventional PKCα/β inhibitor Gö-6976, overexpression of dominant negative PKCα constructs and PKCα siRNA reduced NF-κB activity in response to M-CSF. Interestingly, Ro-31-8220 reduced Ser276 phosphorylation of NF-κBp65 leading to decreased M-CSF-induced monocyte survival. In this report, we identify conventional PKCs, including PKCα as important upstream kinases for M-CSF-induced NF-κB transcriptional activation, NF-κB-regulated gene expression, NF-κB p65 Ser276 phosphorylation, and macrophage survival. Lastly, we find that NF-κB p65 Ser276 plays an important role in basal and M-CSF-stimulated NF-κB activation in human mononuclear phagocytes.
Introduction
Monocytes are produced in the bone marrow and circulate in blood for 24–48 hours [1]. In the absence of serum, monocytes die via apoptosis [1], [2]. Macrophage colony-stimulating factor (M-CSF) stimulates mononuclear phagocyte survival and differentiation [3]. Importantly, M-CSF-mediated cell survival and activation is associated with a variety of human diseases, including atherosclerosis, transplant vascular sclerosis and breast cancer metastasis [4], [5], [6].
We previously identified that NF-κB activation is" |
R10626 |
T14543 |
T14544 |
aux |
To,regulate |
R10627 |
T14544 |
T14551 |
advcl |
regulate,translocate |
R10628 |
T14545 |
T14546 |
compound |
gene,transcription |
R10629 |
T14546 |
T14544 |
dobj |
transcription,regulate |
R1063 |
T1435 |
T1436 |
nummod |
p65,phosphorylation |
R10630 |
T14547 |
T14546 |
punct |
",",transcription |
R10631 |
T14548 |
T14551 |
npadvmod |
NF-κB,translocate |
R10632 |
T14549 |
T14550 |
nummod |
p50/p65,heterodimers |
R10633 |
T14550 |
T14551 |
nsubj |
heterodimers,translocate |
R10634 |
T14551 |
T14563 |
dep |
translocate,is |
R10635 |
T14552 |
T14551 |
prep |
to,translocate |
R10636 |
T14553 |
T14554 |
det |
the,nucleus |
R10637 |
T14554 |
T14552 |
pobj |
nucleus,to |
R10638 |
T14555 |
T14554 |
prep |
from,nucleus |
R10639 |
T14556 |
T14557 |
det |
the,cytoplasm |
R1064 |
T1436 |
T1441 |
nsubj |
phosphorylation,varies |
R10640 |
T14557 |
T14555 |
pobj |
cytoplasm,from |
R10641 |
T14558 |
T14551 |
punct |
",",translocate |
R10642 |
T14559 |
T14551 |
advmod |
however,translocate |
R10643 |
T14560 |
T14563 |
punct |
",",is |
R10644 |
T14561 |
T14562 |
poss |
their,translocation |
R10645 |
T14562 |
T14563 |
nsubj |
translocation,is |
R10646 |
T14563 |
T14563 |
ROOT |
is,is |
R10647 |
T14564 |
T14563 |
neg |
not,is |
R10648 |
T14565 |
T14563 |
acomp |
sufficient,is |
R10649 |
T14566 |
T14567 |
aux |
to,activate |
R1065 |
T1437 |
T1436 |
prep |
on,phosphorylation |
R10650 |
T14567 |
T14565 |
xcomp |
activate,sufficient |
R10651 |
T14568 |
T14569 |
compound |
gene,transcription |
R10652 |
T14569 |
T14567 |
dobj |
transcription,activate |
R10653 |
T14570 |
T14563 |
punct |
.,is |
R10654 |
T14571 |
T14572 |
amod |
Post-translational,modification |
R10655 |
T14572 |
T14582 |
nsubj |
modification,contributes |
R10656 |
T14573 |
T14572 |
prep |
of,modification |
R10657 |
T14574 |
T14575 |
amod |
NF-κB,heterodimers |
R10658 |
T14575 |
T14573 |
pobj |
heterodimers,of |
R10659 |
T14576 |
T14577 |
amod |
such,as |
R1066 |
T1438 |
T1440 |
amod |
NF-κB,activity |
R10660 |
T14577 |
T14575 |
prep |
as,heterodimers |
R10661 |
T14578 |
T14577 |
pobj |
phosphorylation,as |
R10662 |
T14579 |
T14578 |
cc |
or,phosphorylation |
R10663 |
T14580 |
T14578 |
conj |
acetylation,phosphorylation |
R10664 |
T14581 |
T14582 |
advmod |
also,contributes |
R10665 |
T14582 |
T14582 |
ROOT |
contributes,contributes |
R10666 |
T14583 |
T14582 |
prep |
to,contributes |
R10667 |
T14584 |
T14586 |
poss |
its,activity |
R10668 |
T14585 |
T14586 |
amod |
transcriptional,activity |
R10669 |
T14586 |
T14583 |
pobj |
activity,to |
R1067 |
T1439 |
T1440 |
amod |
transcriptional,activity |
R10670 |
T14587 |
T14589 |
nmod |
[,] |
R10671 |
T14588 |
T14589 |
nummod |
41,] |
R10672 |
T14589 |
T14586 |
appos |
],activity |
R10673 |
T14590 |
T14589 |
punct |
",",] |
R10674 |
T14591 |
T14593 |
nmod |
[,] |
R10675 |
T14592 |
T14593 |
nummod |
42,] |
R10676 |
T14593 |
T14589 |
conj |
],] |
R10677 |
T14594 |
T14593 |
punct |
",",] |
R10678 |
T14595 |
T14597 |
det |
[,] |
R10679 |
T14596 |
T14597 |
nummod |
43,] |
R1068 |
T1440 |
T1437 |
pobj |
activity,on |
R10680 |
T14597 |
T14593 |
appos |
],] |
R10681 |
T14598 |
T14582 |
punct |
.,contributes |
R10682 |
T14599 |
T14626 |
mark |
Because,sought |
R10683 |
T14600 |
T14602 |
amod |
NF-κB,translocates |
R10684 |
T14601 |
T14602 |
advmod |
constitutively,translocates |
R10685 |
T14602 |
T14626 |
advcl |
translocates,sought |
R10686 |
T14603 |
T14602 |
prep |
to,translocates |
R10687 |
T14604 |
T14605 |
det |
the,nucleus |
R10688 |
T14605 |
T14603 |
pobj |
nucleus,to |
R10689 |
T14606 |
T14605 |
prep |
in,nucleus |
R1069 |
T1441 |
T1441 |
ROOT |
varies,varies |
R10690 |
T14607 |
T14608 |
amod |
monocytic,lineage |
R10691 |
T14608 |
T14606 |
pobj |
lineage,in |
R10692 |
T14609 |
T14611 |
nmod |
[,] |
R10693 |
T14610 |
T14611 |
nummod |
13,] |
R10694 |
T14611 |
T14605 |
appos |
],nucleus |
R10695 |
T14612 |
T14602 |
cc |
and,translocates |
R10696 |
T14613 |
T14602 |
conj |
activates,translocates |
R10697 |
T14614 |
T14615 |
compound |
gene,transcription |
R10698 |
T14615 |
T14613 |
dobj |
transcription,activates |
R10699 |
T14616 |
T14615 |
cc |
and,transcription |
R107 |
T139 |
T141 |
compound |
macrophage,line |
R1070 |
T1442 |
T1441 |
prep |
by,varies |
R10700 |
T14617 |
T14615 |
conj |
survival,transcription |
R10701 |
T14618 |
T14615 |
prep |
in,transcription |
R10702 |
T14619 |
T14620 |
amod |
murine,macrophages |
R10703 |
T14620 |
T14618 |
pobj |
macrophages,in |
R10704 |
T14621 |
T14623 |
nmod |
[,] |
R10705 |
T14622 |
T14623 |
nummod |
11,] |
R10706 |
T14623 |
T14613 |
dobj |
],activates |
R10707 |
T14624 |
T14626 |
punct |
",",sought |
R10708 |
T14625 |
T14626 |
nsubj |
we,sought |
R10709 |
T14626 |
T14626 |
ROOT |
sought,sought |
R1071 |
T1443 |
T1442 |
pobj |
stimulus,by |
R10710 |
T14627 |
T14628 |
aux |
to,determine |
R10711 |
T14628 |
T14626 |
xcomp |
determine,sought |
R10712 |
T14629 |
T14634 |
advmod |
how,activity |
R10713 |
T14630 |
T14634 |
amod |
M-CSF,activity |
R10714 |
T14631 |
T14634 |
amod |
affected,activity |
R10715 |
T14632 |
T14634 |
nmod |
NF-κB,activity |
R10716 |
T14633 |
T14634 |
compound |
transcriptional,activity |
R10717 |
T14634 |
T14628 |
dobj |
activity,determine |
R10718 |
T14635 |
T14634 |
prep |
in,activity |
R10719 |
T14636 |
T14637 |
amod |
human,MDMs |
R1072 |
T1444 |
T1453 |
punct |
",",] |
R10720 |
T14637 |
T14635 |
pobj |
MDMs,in |
R10721 |
T14638 |
T14634 |
cc |
and,activity |
R10722 |
T14639 |
T14642 |
mark |
whether,regulated |
R10723 |
T14640 |
T14641 |
det |
this,activation |
R10724 |
T14641 |
T14642 |
nsubj |
activation,regulated |
R10725 |
T14642 |
T14634 |
conj |
regulated,activity |
R10726 |
T14643 |
T14644 |
poss |
their,survival |
R10727 |
T14644 |
T14642 |
dobj |
survival,regulated |
R10728 |
T14645 |
T14626 |
punct |
.,sought |
R10729 |
T14646 |
T14648 |
det |
The,study |
R1073 |
T1445 |
T1453 |
npadvmod |
time,] |
R10730 |
T14647 |
T14648 |
amod |
present,study |
R10731 |
T14648 |
T14649 |
nsubj |
study,demonstrated |
R10732 |
T14649 |
T14649 |
ROOT |
demonstrated,demonstrated |
R10733 |
T14650 |
T14652 |
mark |
that,stimulated |
R10734 |
T14651 |
T14652 |
nsubj |
M-CSF,stimulated |
R10735 |
T14652 |
T14649 |
ccomp |
stimulated,demonstrated |
R10736 |
T14653 |
T14654 |
compound |
PKCα,kinase |
R10737 |
T14654 |
T14655 |
compound |
kinase,upstream |
R10738 |
T14655 |
T14652 |
dobj |
upstream,stimulated |
R10739 |
T14656 |
T14655 |
prep |
of,upstream |
R1074 |
T1446 |
T1445 |
prep |
of,time |
R10740 |
T14657 |
T14659 |
amod |
NF-κB,activity |
R10741 |
T14658 |
T14659 |
amod |
transcriptional,activity |
R10742 |
T14659 |
T14656 |
pobj |
activity,of |
R10743 |
T14660 |
T14659 |
prep |
in,activity |
R10744 |
T14661 |
T14663 |
amod |
primary,MDMs |
R10745 |
T14662 |
T14663 |
amod |
human,MDMs |
R10746 |
T14663 |
T14660 |
pobj |
MDMs,in |
R10747 |
T14664 |
T14663 |
cc |
and,MDMs |
R10748 |
T14665 |
T14663 |
conj |
RAW,MDMs |
R10749 |
T14666 |
T14667 |
nummod |
264.7,cells |
R1075 |
T1447 |
T1446 |
pobj |
stimulation,of |
R10750 |
T14667 |
T14659 |
appos |
cells,activity |
R10751 |
T14668 |
T14649 |
punct |
.,demonstrated |
R10752 |
T14669 |
T14670 |
nsubj |
We,showed |
R10753 |
T14670 |
T14685 |
ccomp |
showed,blocked |
R10754 |
T14671 |
T14670 |
dobj |
inhibition,showed |
R10755 |
T14672 |
T14671 |
prep |
of,inhibition |
R10756 |
T14673 |
T14674 |
amod |
conventional,PKCs |
R10757 |
T14674 |
T14672 |
pobj |
PKCs,of |
R10758 |
T14675 |
T14670 |
prep |
by,showed |
R10759 |
T14676 |
T14677 |
compound |
PKC,inhibitors |
R1076 |
T1448 |
T1447 |
cc |
and,stimulation |
R10760 |
T14677 |
T14675 |
pobj |
inhibitors,by |
R10761 |
T14678 |
T14677 |
punct |
",",inhibitors |
R10762 |
T14679 |
T14685 |
intj |
kinase,blocked |
R10763 |
T14680 |
T14685 |
advmod |
deficient,blocked |
R10764 |
T14681 |
T14685 |
nsubj |
PKCα,blocked |
R10765 |
T14682 |
T14681 |
cc |
or,PKCα |
R10766 |
T14683 |
T14684 |
compound |
PKCα,siRNA |
R10767 |
T14684 |
T14681 |
conj |
siRNA,PKCα |
R10768 |
T14685 |
T14685 |
ROOT |
blocked,blocked |
R10769 |
T14686 |
T14688 |
amod |
M-CSF-induced,survival |
R1077 |
T1449 |
T1450 |
compound |
cell,type |
R10770 |
T14687 |
T14688 |
compound |
cell,survival |
R10771 |
T14688 |
T14685 |
dobj |
survival,blocked |
R10772 |
T14689 |
T14688 |
cc |
and,survival |
R10773 |
T14690 |
T14692 |
amod |
NF-κB-regulated,expression |
R10774 |
T14691 |
T14692 |
compound |
gene,expression |
R10775 |
T14692 |
T14688 |
conj |
expression,survival |
R10776 |
T14693 |
T14685 |
punct |
.,blocked |
R10777 |
T14694 |
T14695 |
det |
This,block |
R10778 |
T14695 |
T14695 |
ROOT |
block,block |
R10779 |
T14696 |
T14695 |
acl |
correlated,block |
R1078 |
T1450 |
T1447 |
conj |
type,stimulation |
R10780 |
T14697 |
T14696 |
prep |
with,correlated |
R10781 |
T14698 |
T14699 |
det |
a,reduction |
R10782 |
T14699 |
T14697 |
pobj |
reduction,with |
R10783 |
T14700 |
T14699 |
prep |
in,reduction |
R10784 |
T14701 |
T14702 |
amod |
M-CSF-induced,phosphorylation |
R10785 |
T14702 |
T14700 |
pobj |
phosphorylation,in |
R10786 |
T14703 |
T14702 |
prep |
of,phosphorylation |
R10787 |
T14704 |
T14705 |
compound |
NF-κB,p65 |
R10788 |
T14705 |
T14703 |
pobj |
p65,of |
R10789 |
T14706 |
T14699 |
prep |
at,reduction |
R1079 |
T1451 |
T1453 |
nmod |
[,] |
R10790 |
T14707 |
T14706 |
pobj |
Ser276,at |
R10791 |
T14708 |
T14695 |
punct |
.,block |
R10792 |
T14709 |
T14719 |
advmod |
Consistent,inhibited |
R10793 |
T14710 |
T14709 |
prep |
with,Consistent |
R10794 |
T14711 |
T14712 |
det |
these,findings |
R10795 |
T14712 |
T14710 |
pobj |
findings,with |
R10796 |
T14713 |
T14717 |
det |
the,constructs |
R10797 |
T14714 |
T14717 |
amod |
dominant,constructs |
R10798 |
T14715 |
T14717 |
amod |
negative,constructs |
R10799 |
T14716 |
T14717 |
compound |
PKCα,constructs |
R108 |
T140 |
T141 |
compound |
cell,line |
R1080 |
T1452 |
T1453 |
nummod |
16,] |
R10800 |
T14717 |
T14719 |
nsubj |
constructs,inhibited |
R10801 |
T14718 |
T14719 |
advmod |
also,inhibited |
R10802 |
T14719 |
T14719 |
ROOT |
inhibited,inhibited |
R10803 |
T14720 |
T14722 |
nsubj |
NF-κB,phosphorylation |
R10804 |
T14721 |
T14722 |
nummod |
p65,phosphorylation |
R10805 |
T14722 |
T14719 |
dobj |
phosphorylation,inhibited |
R10806 |
T14723 |
T14722 |
prep |
at,phosphorylation |
R10807 |
T14724 |
T14723 |
pobj |
Ser276,at |
R10808 |
T14725 |
T14723 |
cc |
but,at |
R10809 |
T14726 |
T14729 |
neg |
not,resulting |
R1081 |
T1453 |
T1441 |
npadvmod |
],varies |
R10810 |
T14727 |
T14726 |
prep |
at,not |
R10811 |
T14728 |
T14727 |
pobj |
Ser536,at |
R10812 |
T14729 |
T14719 |
advcl |
resulting,inhibited |
R10813 |
T14730 |
T14729 |
prep |
in,resulting |
R10814 |
T14731 |
T14734 |
amod |
reduced,activation |
R10815 |
T14732 |
T14734 |
nmod |
NF-κB,activation |
R10816 |
T14733 |
T14734 |
amod |
transcriptional,activation |
R10817 |
T14734 |
T14730 |
pobj |
activation,in |
R10818 |
T14735 |
T14734 |
cc |
and,activation |
R10819 |
T14736 |
T14737 |
compound |
M-CSF-induced,MDM |
R1082 |
T1454 |
T1441 |
punct |
.,varies |
R10820 |
T14737 |
T14738 |
compound |
MDM,survival |
R10821 |
T14738 |
T14734 |
conj |
survival,activation |
R10822 |
T14739 |
T14719 |
punct |
.,inhibited |
R10823 |
T14740 |
T14744 |
det |
A,model |
R10824 |
T14741 |
T14744 |
amod |
simplified,model |
R10825 |
T14742 |
T14744 |
amod |
proposed,model |
R10826 |
T14743 |
T14744 |
compound |
cartoon,model |
R10827 |
T14744 |
T14748 |
nsubj |
model,demonstrates |
R10828 |
T14745 |
T14744 |
prep |
in,model |
R10829 |
T14746 |
T14745 |
pobj |
Figure,in |
R1083 |
T1455 |
T1456 |
amod |
Previous,research |
R10830 |
T14747 |
T14746 |
nummod |
9,Figure |
R10831 |
T14748 |
T14748 |
ROOT |
demonstrates,demonstrates |
R10832 |
T14749 |
T14751 |
mark |
that,induced |
R10833 |
T14750 |
T14751 |
nsubj |
M-CSF,induced |
R10834 |
T14751 |
T14748 |
ccomp |
induced,demonstrates |
R10835 |
T14752 |
T14753 |
compound |
monocytes,survival |
R10836 |
T14753 |
T14751 |
dobj |
survival,induced |
R10837 |
T14754 |
T14755 |
auxpass |
is,regulated |
R10838 |
T14755 |
T14751 |
conj |
regulated,induced |
R10839 |
T14756 |
T14755 |
prep |
by,regulated |
R1084 |
T1456 |
T1457 |
nsubj |
research,shows |
R10840 |
T14757 |
T14756 |
pcomp |
activating,by |
R10841 |
T14758 |
T14760 |
nsubj |
NF-κB,phosphorylation |
R10842 |
T14759 |
T14760 |
nummod |
p65,phosphorylation |
R10843 |
T14760 |
T14757 |
dobj |
phosphorylation,activating |
R10844 |
T14761 |
T14760 |
prep |
at,phosphorylation |
R10845 |
T14762 |
T14761 |
pobj |
Ser276,at |
R10846 |
T14763 |
T14757 |
prep |
via,activating |
R10847 |
T14764 |
T14763 |
pobj |
PKC,via |
R10848 |
T14765 |
T14748 |
punct |
.,demonstrates |
R10849 |
T14766 |
T14780 |
advmod |
Finally,confirmed |
R1085 |
T1457 |
T1457 |
ROOT |
shows,shows |
R10850 |
T14767 |
T14780 |
punct |
",",confirmed |
R10851 |
T14768 |
T14780 |
prep |
in,confirmed |
R10852 |
T14769 |
T14777 |
det |
a,line |
R10853 |
T14770 |
T14777 |
nmod |
NF-κB,line |
R10854 |
T14771 |
T14772 |
nummod |
p65,− |
R10855 |
T14772 |
T14773 |
nummod |
−,/ |
R10856 |
T14773 |
T14777 |
nmod |
/,line |
R10857 |
T14774 |
T14777 |
nmod |
−,line |
R10858 |
T14775 |
T14777 |
compound |
fibroblast,line |
R10859 |
T14776 |
T14777 |
compound |
cell,line |
R1086 |
T1458 |
T1469 |
mark |
that,plays |
R10860 |
T14777 |
T14768 |
pobj |
line,in |
R10861 |
T14778 |
T14780 |
punct |
",",confirmed |
R10862 |
T14779 |
T14780 |
nsubj |
we,confirmed |
R10863 |
T14780 |
T14780 |
ROOT |
confirmed,confirmed |
R10864 |
T14781 |
T14788 |
mark |
that,is |
R10865 |
T14782 |
T14784 |
det |
the,residue |
R10866 |
T14783 |
T14784 |
compound |
Ser276,residue |
R10867 |
T14784 |
T14788 |
nsubj |
residue,is |
R10868 |
T14785 |
T14784 |
prep |
of,residue |
R10869 |
T14786 |
T14785 |
pobj |
NF-κB,of |
R1087 |
T1459 |
T1469 |
nsubj |
phosphorylation,plays |
R10870 |
T14787 |
T14786 |
nummod |
p65,NF-κB |
R10871 |
T14788 |
T14780 |
ccomp |
is,confirmed |
R10872 |
T14789 |
T14788 |
acomp |
important,is |
R10873 |
T14790 |
T14789 |
cc |
and,important |
R10874 |
T14791 |
T14789 |
conj |
essential,important |
R10875 |
T14792 |
T14788 |
prep |
for,is |
R10876 |
T14793 |
T14794 |
compound |
PKC,modulation |
R10877 |
T14794 |
T14792 |
pobj |
modulation,for |
R10878 |
T14795 |
T14794 |
prep |
of,modulation |
R10879 |
T14796 |
T14797 |
amod |
NF-κB,activity |
R1088 |
T1460 |
T1459 |
prep |
of,phosphorylation |
R10880 |
T14797 |
T14795 |
pobj |
activity,of |
R10881 |
T14798 |
T14780 |
punct |
.,confirmed |
R10882 |
T14799 |
T14800 |
advmod |
More,compelling |
R10883 |
T14800 |
T14801 |
acomp |
compelling,is |
R10884 |
T14801 |
T14801 |
ROOT |
is,is |
R10885 |
T14802 |
T14804 |
mark |
that,observed |
R10886 |
T14803 |
T14804 |
nsubj |
we,observed |
R10887 |
T14804 |
T14801 |
ccomp |
observed,is |
R10888 |
T14805 |
T14807 |
det |
a,regulation |
R10889 |
T14806 |
T14807 |
amod |
similar,regulation |
R1089 |
T1461 |
T1462 |
compound |
NF-κB,p65 |
R10890 |
T14807 |
T14804 |
dobj |
regulation,observed |
R10891 |
T14808 |
T14807 |
prep |
between,regulation |
R10892 |
T14809 |
T14812 |
nummod |
two,lineages |
R10893 |
T14810 |
T14812 |
amod |
different,lineages |
R10894 |
T14811 |
T14812 |
compound |
cell,lineages |
R10895 |
T14812 |
T14808 |
pobj |
lineages,between |
R10896 |
T14813 |
T14812 |
prep |
in,lineages |
R10897 |
T14814 |
T14815 |
poss |
our,study |
R10898 |
T14815 |
T14813 |
pobj |
study,in |
R10899 |
T14816 |
T14801 |
punct |
.,is |
R109 |
T141 |
T142 |
compound |
line,RAW |
R1090 |
T1462 |
T1460 |
pobj |
p65,of |
R10900 |
T14817 |
T14818 |
amod |
Post-translational,modification |
R10901 |
T14818 |
T14822 |
nsubj |
modification,regulates |
R10902 |
T14819 |
T14818 |
prep |
of,modification |
R10903 |
T14820 |
T14819 |
pobj |
NF-κB,of |
R10904 |
T14821 |
T14820 |
nummod |
p65,NF-κB |
R10905 |
T14822 |
T14822 |
ROOT |
regulates,regulates |
R10906 |
T14823 |
T14824 |
poss |
its,activating |
R10907 |
T14824 |
T14822 |
dobj |
activating,regulates |
R10908 |
T14825 |
T14824 |
cc |
or,activating |
R10909 |
T14826 |
T14824 |
conj |
repressing,activating |
R1091 |
T1463 |
T1459 |
prep |
at,phosphorylation |
R10910 |
T14827 |
T14826 |
dobj |
effects,repressing |
R10911 |
T14828 |
T14827 |
prep |
on,effects |
R10912 |
T14829 |
T14830 |
compound |
gene,expression |
R10913 |
T14830 |
T14828 |
pobj |
expression,on |
R10914 |
T14831 |
T14822 |
punct |
.,regulates |
R10915 |
T14832 |
T14835 |
prep |
Among,reported |
R10916 |
T14833 |
T14834 |
det |
the,seven |
R10917 |
T14834 |
T14835 |
nsubj |
seven,reported |
R10918 |
T14835 |
T14835 |
ROOT |
reported,reported |
R10919 |
T14836 |
T14840 |
amod |
putative,sites |
R1092 |
T1464 |
T1463 |
pobj |
Ser276,at |
R10920 |
T14837 |
T14840 |
nmod |
NF-κB,sites |
R10921 |
T14838 |
T14840 |
nummod |
p65,sites |
R10922 |
T14839 |
T14840 |
compound |
phosphorylation,sites |
R10923 |
T14840 |
T14835 |
dobj |
sites,reported |
R10924 |
T14841 |
T14840 |
punct |
",",sites |
R10925 |
T14842 |
T14843 |
nummod |
five,increase |
R10926 |
T14843 |
T14840 |
appos |
increase,sites |
R10927 |
T14844 |
T14845 |
amod |
nuclear,translocation |
R10928 |
T14845 |
T14843 |
appos |
translocation,increase |
R10929 |
T14846 |
T14843 |
punct |
",",increase |
R1093 |
T1465 |
T1464 |
punct |
",",Ser276 |
R10930 |
T14847 |
T14848 |
nsubj |
DNA,binding |
R10931 |
T14848 |
T14852 |
amod |
binding,activity |
R10932 |
T14849 |
T14848 |
cc |
and,binding |
R10933 |
T14850 |
T14848 |
conj |
NF-κB,binding |
R10934 |
T14851 |
T14852 |
amod |
transcriptional,activity |
R10935 |
T14852 |
T14855 |
nsubj |
activity,] |
R10936 |
T14853 |
T14855 |
nmod |
[,] |
R10937 |
T14854 |
T14855 |
nummod |
17,] |
R10938 |
T14855 |
T14843 |
appos |
],increase |
R10939 |
T14856 |
T14835 |
punct |
.,reported |
R1094 |
T1466 |
T1464 |
conj |
Ser529,Ser276 |
R10940 |
T14857 |
T14865 |
advmod |
Similar,found |
R10941 |
T14858 |
T14857 |
prep |
to,Similar |
R10942 |
T14859 |
T14860 |
poss |
our,finding |
R10943 |
T14860 |
T14858 |
pobj |
finding,to |
R10944 |
T14861 |
T14865 |
punct |
",",found |
R10945 |
T14862 |
T14864 |
compound |
Zhong,al. |
R10946 |
T14863 |
T14864 |
compound |
et,al. |
R10947 |
T14864 |
T14865 |
nsubj |
al.,found |
R10948 |
T14865 |
T14865 |
ROOT |
found,found |
R10949 |
T14866 |
T14874 |
mark |
that,is |
R1095 |
T1467 |
T1466 |
cc |
or,Ser529 |
R10950 |
T14867 |
T14874 |
prep |
in,is |
R10951 |
T14868 |
T14867 |
pobj |
response,in |
R10952 |
T14869 |
T14868 |
prep |
to,response |
R10953 |
T14870 |
T14869 |
pobj |
LPS,to |
R10954 |
T14871 |
T14870 |
punct |
",",LPS |
R10955 |
T14872 |
T14873 |
compound |
NF-κB,p65 |
R10956 |
T14873 |
T14874 |
nsubj |
p65,is |
R10957 |
T14874 |
T14865 |
ccomp |
is,found |
R10958 |
T14875 |
T14874 |
attr |
phosphorylated,is |
R10959 |
T14876 |
T14875 |
prep |
at,phosphorylated |
R1096 |
T1468 |
T1466 |
conj |
Ser536,Ser529 |
R10960 |
T14877 |
T14881 |
det |
the,residue |
R10961 |
T14878 |
T14879 |
advmod |
highly,conserved |
R10962 |
T14879 |
T14881 |
amod |
conserved,residue |
R10963 |
T14880 |
T14881 |
compound |
Ser276,residue |
R10964 |
T14881 |
T14876 |
pobj |
residue,at |
R10965 |
T14882 |
T14875 |
agent |
by,phosphorylated |
R10966 |
T14883 |
T14885 |
det |
the,subunit |
R10967 |
T14884 |
T14885 |
amod |
catalytic,subunit |
R10968 |
T14885 |
T14882 |
pobj |
subunit,by |
R10969 |
T14886 |
T14885 |
prep |
of,subunit |
R1097 |
T1469 |
T1457 |
ccomp |
plays,shows |
R10970 |
T14887 |
T14888 |
compound |
PKA,[ |
R10971 |
T14888 |
T14886 |
pobj |
[,of |
R10972 |
T14889 |
T14890 |
nummod |
16,] |
R10973 |
T14890 |
T14888 |
appos |
],[ |
R10974 |
T14891 |
T14865 |
punct |
.,found |
R10975 |
T14892 |
T14900 |
prep |
In,phosphorylated |
R10976 |
T14893 |
T14892 |
pobj |
addition,In |
R10977 |
T14894 |
T14893 |
prep |
to,addition |
R10978 |
T14895 |
T14894 |
pobj |
PKA,to |
R10979 |
T14896 |
T14900 |
punct |
",",phosphorylated |
R1098 |
T1470 |
T1472 |
det |
an,role |
R10980 |
T14897 |
T14900 |
nsubjpass |
Ser276,phosphorylated |
R10981 |
T14898 |
T14900 |
aux |
can,phosphorylated |
R10982 |
T14899 |
T14900 |
auxpass |
be,phosphorylated |
R10983 |
T14900 |
T14900 |
ROOT |
phosphorylated,phosphorylated |
R10984 |
T14901 |
T14900 |
agent |
by,phosphorylated |
R10985 |
T14902 |
T14901 |
pobj |
MSK1,by |
R10986 |
T14903 |
T14900 |
prep |
in,phosphorylated |
R10987 |
T14904 |
T14905 |
det |
the,nucleus |
R10988 |
T14905 |
T14903 |
pobj |
nucleus,in |
R10989 |
T14906 |
T14905 |
prep |
upon,nucleus |
R1099 |
T1471 |
T1472 |
amod |
important,role |
R10990 |
T14907 |
T14908 |
compound |
TNFα,treatment |
R10991 |
T14908 |
T14906 |
pobj |
treatment,upon |
R10992 |
T14909 |
T14911 |
nmod |
[,] |
R10993 |
T14910 |
T14911 |
nummod |
18,] |
R10994 |
T14911 |
T14908 |
appos |
],treatment |
R10995 |
T14912 |
T14900 |
punct |
.,phosphorylated |
R10996 |
T14913 |
T14919 |
nsubj |
Phosphorylation,occurs |
R10997 |
T14914 |
T14913 |
prep |
of,Phosphorylation |
R10998 |
T14915 |
T14916 |
compound |
NF-κB,p65 |
R10999 |
T14916 |
T14914 |
pobj |
p65,of |
R110 |
T142 |
T125 |
conj |
RAW,stimulated |
R1100 |
T1472 |
T1469 |
dobj |
role,plays |
R11000 |
T14917 |
T14913 |
prep |
at,Phosphorylation |
R11001 |
T14918 |
T14917 |
pobj |
Ser536,at |
R11002 |
T14919 |
T14919 |
ROOT |
occurs,occurs |
R11003 |
T14920 |
T14919 |
prep |
in,occurs |
R11004 |
T14921 |
T14920 |
pobj |
response,in |
R11005 |
T14922 |
T14921 |
prep |
to,response |
R11006 |
T14923 |
T14925 |
amod |
many,stimuli |
R11007 |
T14924 |
T14925 |
amod |
inflammatory,stimuli |
R11008 |
T14925 |
T14922 |
pobj |
stimuli,to |
R11009 |
T14926 |
T14928 |
advmod |
as,as |
R1101 |
T1473 |
T1472 |
prep |
in,role |
R11010 |
T14927 |
T14928 |
advmod |
well,as |
R11011 |
T14928 |
T14925 |
cc |
as,stimuli |
R11012 |
T14929 |
T14925 |
conj |
kinases,stimuli |
R11013 |
T14930 |
T14929 |
punct |
",",kinases |
R11014 |
T14931 |
T14929 |
conj |
IKKα,kinases |
R11015 |
T14932 |
T14931 |
punct |
",",IKKα |
R11016 |
T14933 |
T14931 |
conj |
IKKβ,IKKα |
R11017 |
T14934 |
T14933 |
cc |
and,IKKβ |
R11018 |
T14935 |
T14933 |
conj |
RSK1,IKKβ |
R11019 |
T14936 |
T14933 |
conj |
[,IKKβ |
R1102 |
T1474 |
T1473 |
pcomp |
regulating,in |
R11020 |
T14937 |
T14938 |
nummod |
17,] |
R11021 |
T14938 |
T14933 |
conj |
],IKKβ |
R11022 |
T14939 |
T14938 |
punct |
",",] |
R11023 |
T14940 |
T14942 |
nmod |
[,] |
R11024 |
T14941 |
T14942 |
nummod |
18,] |
R11025 |
T14942 |
T14938 |
conj |
],] |
R11026 |
T14943 |
T14942 |
punct |
",",] |
R11027 |
T14944 |
T14946 |
nmod |
[,] |
R11028 |
T14945 |
T14946 |
nummod |
19,] |
R11029 |
T14946 |
T14942 |
conj |
],] |
R1103 |
T1475 |
T1476 |
amod |
transcriptional,activity |
R11030 |
T14947 |
T14946 |
punct |
",",] |
R11031 |
T14948 |
T14946 |
conj |
[,] |
R11032 |
T14949 |
T14950 |
nummod |
20,] |
R11033 |
T14950 |
T14946 |
conj |
],] |
R11034 |
T14951 |
T14950 |
punct |
",",] |
R11035 |
T14952 |
T14950 |
conj |
[,] |
R11036 |
T14953 |
T14954 |
nummod |
21,] |
R11037 |
T14954 |
T14950 |
conj |
],] |
R11038 |
T14955 |
T14919 |
punct |
.,occurs |
R11039 |
T14956 |
T14968 |
advmod |
Notably,revealed |
R1104 |
T1476 |
T1474 |
dobj |
activity,regulating |
R11040 |
T14957 |
T14968 |
punct |
",",revealed |
R11041 |
T14958 |
T14968 |
prep |
in,revealed |
R11042 |
T14959 |
T14958 |
pobj |
addition,in |
R11043 |
T14960 |
T14959 |
prep |
to,addition |
R11044 |
T14961 |
T14960 |
pcomp |
phosphorylating,to |
R11045 |
T14962 |
T14961 |
dobj |
Ser276,phosphorylating |
R11046 |
T14963 |
T14962 |
prep |
of,Ser276 |
R11047 |
T14964 |
T14963 |
pobj |
NF-κB,of |
R11048 |
T14965 |
T14968 |
punct |
",",revealed |
R11049 |
T14966 |
T14967 |
poss |
our,study |
R1105 |
T1477 |
T1476 |
prep |
of,activity |
R11050 |
T14967 |
T14968 |
nsubj |
study,revealed |
R11051 |
T14968 |
T14968 |
ROOT |
revealed,revealed |
R11052 |
T14969 |
T14972 |
mark |
that,modulated |
R11053 |
T14970 |
T14972 |
nsubj |
M-CSF,modulated |
R11054 |
T14971 |
T14972 |
advmod |
also,modulated |
R11055 |
T14972 |
T14968 |
ccomp |
modulated,revealed |
R11056 |
T14973 |
T14974 |
det |
the,phosphorylation |
R11057 |
T14974 |
T14972 |
dobj |
phosphorylation,modulated |
R11058 |
T14975 |
T14974 |
prep |
of,phosphorylation |
R11059 |
T14976 |
T14979 |
det |
the,subunit |
R1106 |
T1478 |
T1479 |
compound |
NF-κB,[ |
R11060 |
T14977 |
T14979 |
nmod |
NF-κB,subunit |
R11061 |
T14978 |
T14979 |
nummod |
p65,subunit |
R11062 |
T14979 |
T14975 |
pobj |
subunit,of |
R11063 |
T14980 |
T14979 |
prep |
at,subunit |
R11064 |
T14981 |
T14980 |
pobj |
Ser536,at |
R11065 |
T14982 |
T14972 |
punct |
",",modulated |
R11066 |
T14983 |
T14972 |
advmod |
however,modulated |
R11067 |
T14984 |
T14972 |
punct |
",",modulated |
R11068 |
T14985 |
T14986 |
compound |
PKC,inhibitors |
R11069 |
T14986 |
T14972 |
dobj |
inhibitors,modulated |
R1107 |
T1479 |
T1477 |
pobj |
[,of |
R11070 |
T14987 |
T14972 |
cc |
or,modulated |
R11071 |
T14988 |
T14972 |
conj |
kinase,modulated |
R11072 |
T14989 |
T14991 |
amod |
deficient,constructs |
R11073 |
T14990 |
T14991 |
compound |
PKCα,constructs |
R11074 |
T14991 |
T14988 |
dobj |
constructs,kinase |
R11075 |
T14992 |
T14994 |
aux |
did,affect |
R11076 |
T14993 |
T14994 |
neg |
not,affect |
R11077 |
T14994 |
T14972 |
conj |
affect,modulated |
R11078 |
T14995 |
T14997 |
det |
this,event |
R11079 |
T14996 |
T14997 |
amod |
phosphorylation,event |
R1108 |
T1480 |
T1481 |
nummod |
17,] |
R11080 |
T14997 |
T14994 |
dobj |
event,affect |
R11081 |
T14998 |
T14968 |
punct |
.,revealed |
R11082 |
T14999 |
T15014 |
advmod |
Moreover,reduce |
R11083 |
T15000 |
T15014 |
punct |
",",reduce |
R11084 |
T15001 |
T15002 |
amod |
mutant,constructs |
R11085 |
T15002 |
T15014 |
nsubj |
constructs,reduce |
R11086 |
T15003 |
T15002 |
acl |
containing,constructs |
R11087 |
T15004 |
T15006 |
det |
a,mutation |
R11088 |
T15005 |
T15006 |
compound |
point,mutation |
R11089 |
T15006 |
T15003 |
dobj |
mutation,containing |
R1109 |
T1481 |
T1474 |
dobj |
],regulating |
R11090 |
T15007 |
T15006 |
prep |
at,mutation |
R11091 |
T15008 |
T15007 |
pobj |
Ser536,at |
R11092 |
T15009 |
T15008 |
prep |
of,Ser536 |
R11093 |
T15010 |
T15009 |
pobj |
NF-κB,of |
R11094 |
T15011 |
T15010 |
nummod |
p65,NF-κB |
R11095 |
T15012 |
T15014 |
aux |
did,reduce |
R11096 |
T15013 |
T15014 |
neg |
not,reduce |
R11097 |
T15014 |
T15014 |
ROOT |
reduce,reduce |
R11098 |
T15015 |
T15016 |
amod |
NF-κB,activity |
R11099 |
T15016 |
T15014 |
dobj |
activity,reduce |
R111 |
T143 |
T142 |
nummod |
264.7,RAW |
R1110 |
T1482 |
T1457 |
punct |
.,shows |
R11100 |
T15017 |
T15014 |
prep |
in,reduce |
R11101 |
T15018 |
T15017 |
pobj |
cells,in |
R11102 |
T15019 |
T15018 |
acl |
lacking,cells |
R11103 |
T15020 |
T15022 |
amod |
endogenous,p65 |
R11104 |
T15021 |
T15022 |
compound |
NF-κB,p65 |
R11105 |
T15022 |
T15019 |
dobj |
p65,lacking |
R11106 |
T15023 |
T15014 |
punct |
",",reduce |
R11107 |
T15024 |
T15029 |
mark |
while,construct |
R11108 |
T15025 |
T15028 |
det |
the,276S/A |
R11109 |
T15026 |
T15028 |
nmod |
NF-κB,276S/A |
R1111 |
T1483 |
T1493 |
prep |
In,phosphorylated |
R11110 |
T15027 |
T15028 |
nummod |
p65,276S/A |
R11111 |
T15028 |
T15029 |
nsubj |
276S/A,construct |
R11112 |
T15029 |
T15014 |
advcl |
construct,reduce |
R11113 |
T15030 |
T15031 |
aux |
did,reduce |
R11114 |
T15031 |
T15014 |
conj |
reduce,reduce |
R11115 |
T15032 |
T15033 |
compound |
NF-κB,activity |
R11116 |
T15033 |
T15031 |
dobj |
activity,reduce |
R11117 |
T15034 |
T15031 |
prep |
in,reduce |
R11118 |
T15035 |
T15036 |
det |
these,cells |
R11119 |
T15036 |
T15034 |
pobj |
cells,in |
R1112 |
T1484 |
T1486 |
amod |
TNFα-treated,fibroblasts |
R11120 |
T15037 |
T15014 |
punct |
.,reduce |
R11121 |
T15038 |
T15046 |
advmod |
Therefore,is |
R11122 |
T15039 |
T15046 |
punct |
",",is |
R11123 |
T15040 |
T15042 |
amod |
specific,modification |
R11124 |
T15041 |
T15042 |
amod |
post-translational,modification |
R11125 |
T15042 |
T15046 |
nsubj |
modification,is |
R11126 |
T15043 |
T15042 |
prep |
of,modification |
R11127 |
T15044 |
T15043 |
pobj |
NF-κB,of |
R11128 |
T15045 |
T15044 |
nummod |
p65,NF-κB |
R11129 |
T15046 |
T15046 |
ROOT |
is,is |
R1113 |
T1485 |
T1486 |
compound |
murine,fibroblasts |
R11130 |
T15047 |
T15046 |
acomp |
likely,is |
R11131 |
T15048 |
T15049 |
aux |
to,regulate |
R11132 |
T15049 |
T15047 |
xcomp |
regulate,likely |
R11133 |
T15050 |
T15051 |
amod |
transcriptional,activation |
R11134 |
T15051 |
T15049 |
dobj |
activation,regulate |
R11135 |
T15052 |
T15049 |
prep |
in,regulate |
R11136 |
T15053 |
T15052 |
pobj |
response,in |
R11137 |
T15054 |
T15053 |
prep |
to,response |
R11138 |
T15055 |
T15056 |
amod |
specific,stimuli |
R11139 |
T15056 |
T15054 |
pobj |
stimuli,to |
R1114 |
T1486 |
T1483 |
pobj |
fibroblasts,In |
R11140 |
T15057 |
T15059 |
nmod |
[,] |
R11141 |
T15058 |
T15059 |
nummod |
15,] |
R11142 |
T15059 |
T15056 |
appos |
],stimuli |
R11143 |
T15060 |
T15059 |
punct |
",",] |
R11144 |
T15061 |
T15063 |
nmod |
[,] |
R11145 |
T15062 |
T15063 |
nummod |
43,] |
R11146 |
T15063 |
T15059 |
appos |
],] |
R11147 |
T15064 |
T15046 |
punct |
.,is |
R11148 |
T15065 |
T15066 |
nsubj |
It,is |
R11149 |
T15066 |
T15066 |
ROOT |
is,is |
R1115 |
T1487 |
T1493 |
punct |
",",phosphorylated |
R11150 |
T15067 |
T15066 |
acomp |
notable,is |
R11151 |
T15068 |
T15070 |
mark |
that,activated |
R11152 |
T15069 |
T15070 |
nsubj |
M-CSF,activated |
R11153 |
T15070 |
T15066 |
ccomp |
activated,is |
R11154 |
T15071 |
T15070 |
dobj |
NF-κB,activated |
R11155 |
T15072 |
T15074 |
nummod |
p65,phosphorylation |
R11156 |
T15073 |
T15074 |
compound |
Ser276,phosphorylation |
R11157 |
T15074 |
T15071 |
appos |
phosphorylation,NF-κB |
R11158 |
T15075 |
T15074 |
cc |
and,phosphorylation |
R11159 |
T15076 |
T15077 |
amod |
transcriptional,activation |
R1116 |
T1488 |
T1493 |
nsubjpass |
Ser276,phosphorylated |
R11160 |
T15077 |
T15074 |
conj |
activation,phosphorylation |
R11161 |
T15078 |
T15077 |
prep |
in,activation |
R11162 |
T15079 |
T15081 |
det |
a,manner |
R11163 |
T15080 |
T15081 |
amod |
PKCα-dependent,manner |
R11164 |
T15081 |
T15078 |
pobj |
manner,in |
R11165 |
T15082 |
T15066 |
punct |
.,is |
R11166 |
T15083 |
T15084 |
nsubj |
PKCα,is |
R11167 |
T15084 |
T15084 |
ROOT |
is,is |
R11168 |
T15085 |
T15086 |
det |
a,member |
R11169 |
T15086 |
T15084 |
attr |
member,is |
R1117 |
T1489 |
T1488 |
prep |
of,Ser276 |
R11170 |
T15087 |
T15086 |
prep |
of,member |
R11171 |
T15088 |
T15091 |
det |
the,family |
R11172 |
T15089 |
T15091 |
amod |
conventional,family |
R11173 |
T15090 |
T15091 |
compound |
PKC,family |
R11174 |
T15091 |
T15087 |
pobj |
family,of |
R11175 |
T15092 |
T15091 |
prep |
of,family |
R11176 |
T15093 |
T15094 |
compound |
protein,kinases |
R11177 |
T15094 |
T15092 |
pobj |
kinases,of |
R11178 |
T15095 |
T15096 |
nsubj |
that,are |
R11179 |
T15096 |
T15094 |
relcl |
are,kinases |
R1118 |
T1490 |
T1489 |
pobj |
NF-κB,of |
R11180 |
T15097 |
T15096 |
acomp |
critical,are |
R11181 |
T15098 |
T15097 |
prep |
for,critical |
R11182 |
T15099 |
T15100 |
compound |
cell,growth |
R11183 |
T15100 |
T15098 |
pobj |
growth,for |
R11184 |
T15101 |
T15100 |
punct |
",",growth |
R11185 |
T15102 |
T15100 |
conj |
differentiation,growth |
R11186 |
T15103 |
T15102 |
cc |
and,differentiation |
R11187 |
T15104 |
T15105 |
compound |
cell,death |
R11188 |
T15105 |
T15102 |
conj |
death,differentiation |
R11189 |
T15106 |
T15084 |
punct |
.,is |
R1119 |
T1491 |
T1490 |
nummod |
p65,NF-κB |
R11190 |
T15107 |
T15109 |
nsubj |
PKCα,modulates |
R11191 |
T15108 |
T15109 |
advmod |
primarily,modulates |
R11192 |
T15109 |
T15109 |
ROOT |
modulates,modulates |
R11193 |
T15110 |
T15109 |
dobj |
anti-apoptotic,modulates |
R11194 |
T15111 |
T15110 |
cc |
and,anti-apoptotic |
R11195 |
T15112 |
T15110 |
conj |
proliferation,anti-apoptotic |
R11196 |
T15113 |
T15109 |
conj |
signals,modulates |
R11197 |
T15114 |
T15113 |
acl |
following,signals |
R11198 |
T15115 |
T15116 |
amod |
cytokine,treatment |
R11199 |
T15116 |
T15114 |
dobj |
treatment,following |
R112 |
T144 |
T122 |
punct |
.,demonstrate |
R1120 |
T1492 |
T1493 |
auxpass |
is,phosphorylated |
R11200 |
T15117 |
T15116 |
prep |
in,treatment |
R11201 |
T15118 |
T15120 |
amod |
various,types |
R11202 |
T15119 |
T15120 |
compound |
cell,types |
R11203 |
T15120 |
T15117 |
pobj |
types,in |
R11204 |
T15121 |
T15123 |
nmod |
[,] |
R11205 |
T15122 |
T15123 |
nummod |
42,] |
R11206 |
T15123 |
T15116 |
nmod |
],treatment |
R11207 |
T15124 |
T15109 |
punct |
.,modulates |
R11208 |
T15125 |
T15128 |
nsubj |
Expression,attenuates |
R11209 |
T15126 |
T15125 |
prep |
of,Expression |
R1121 |
T1493 |
T1493 |
ROOT |
phosphorylated,phosphorylated |
R11210 |
T15127 |
T15126 |
pobj |
PKCα,of |
R11211 |
T15128 |
T15128 |
ROOT |
attenuates,attenuates |
R11212 |
T15129 |
T15128 |
dobj |
apoptosis,attenuates |
R11213 |
T15130 |
T15128 |
prep |
in,attenuates |
R11214 |
T15131 |
T15134 |
amod |
many,types |
R11215 |
T15132 |
T15134 |
amod |
different,types |
R11216 |
T15133 |
T15134 |
compound |
cell,types |
R11217 |
T15134 |
T15130 |
pobj |
types,in |
R11218 |
T15135 |
T15128 |
punct |
",",attenuates |
R11219 |
T15136 |
T15140 |
mark |
while,potentiates |
R1122 |
T1494 |
T1493 |
agent |
by,phosphorylated |
R11220 |
T15137 |
T15138 |
compound |
PKCα,inhibition |
R11221 |
T15138 |
T15140 |
nsubj |
inhibition,potentiates |
R11222 |
T15139 |
T15140 |
advmod |
generally,potentiates |
R11223 |
T15140 |
T15128 |
advcl |
potentiates,attenuates |
R11224 |
T15141 |
T15142 |
compound |
apoptosis,[ |
R11225 |
T15142 |
T15140 |
dobj |
[,potentiates |
R11226 |
T15143 |
T15144 |
nummod |
42,] |
R11227 |
T15144 |
T15142 |
appos |
],[ |
R11228 |
T15145 |
T15128 |
punct |
.,attenuates |
R11229 |
T15146 |
T15160 |
prep |
In,was |
R1123 |
T1495 |
T1494 |
pobj |
MSK1,by |
R11230 |
T15147 |
T15148 |
poss |
our,studies |
R11231 |
T15148 |
T15146 |
pobj |
studies,In |
R11232 |
T15149 |
T15148 |
acl |
using,studies |
R11233 |
T15150 |
T15152 |
amod |
conventional,inhibitors |
R11234 |
T15151 |
T15152 |
compound |
PKC,inhibitors |
R11235 |
T15152 |
T15149 |
dobj |
inhibitors,using |
R11236 |
T15153 |
T15152 |
cc |
and,inhibitors |
R11237 |
T15154 |
T15157 |
amod |
dominant,constructs |
R11238 |
T15155 |
T15157 |
amod |
negative,constructs |
R11239 |
T15156 |
T15157 |
compound |
PKCα,constructs |
R1124 |
T1496 |
T1497 |
aux |
to,enhance |
R11240 |
T15157 |
T15152 |
conj |
constructs,inhibitors |
R11241 |
T15158 |
T15160 |
punct |
",",was |
R11242 |
T15159 |
T15160 |
nsubj |
PKCα,was |
R11243 |
T15160 |
T15160 |
ROOT |
was,was |
R11244 |
T15161 |
T15160 |
acomp |
critical,was |
R11245 |
T15162 |
T15161 |
prep |
in,critical |
R11246 |
T15163 |
T15165 |
amod |
M-CSF-induced,survival |
R11247 |
T15164 |
T15165 |
compound |
macrophage,survival |
R11248 |
T15165 |
T15162 |
pobj |
survival,in |
R11249 |
T15166 |
T15160 |
prep |
by,was |
R1125 |
T1497 |
T1493 |
advcl |
enhance,phosphorylated |
R11250 |
T15167 |
T15166 |
pcomp |
inducing,by |
R11251 |
T15168 |
T15169 |
compound |
Ser276,phosphorylation |
R11252 |
T15169 |
T15167 |
dobj |
phosphorylation,inducing |
R11253 |
T15170 |
T15169 |
prep |
of,phosphorylation |
R11254 |
T15171 |
T15170 |
pobj |
NF-κB,of |
R11255 |
T15172 |
T15171 |
nummod |
p65,NF-κB |
R11256 |
T15173 |
T15169 |
prep |
in,phosphorylation |
R11257 |
T15174 |
T15177 |
preconj |
both,MDMs |
R11258 |
T15175 |
T15177 |
amod |
primary,MDMs |
R11259 |
T15176 |
T15177 |
amod |
human,MDMs |
R1126 |
T1498 |
T1500 |
amod |
NF-κB,activity |
R11260 |
T15177 |
T15173 |
pobj |
MDMs,in |
R11261 |
T15178 |
T15177 |
cc |
and,MDMs |
R11262 |
T15179 |
T15177 |
conj |
Raw,MDMs |
R11263 |
T15180 |
T15181 |
nummod |
264.7,cells |
R11264 |
T15181 |
T15177 |
conj |
cells,MDMs |
R11265 |
T15182 |
T15160 |
punct |
.,was |
R11266 |
T15183 |
T15185 |
nsubj |
We,demonstrated |
R11267 |
T15184 |
T15185 |
advmod |
also,demonstrated |
R11268 |
T15185 |
T15185 |
ROOT |
demonstrated,demonstrated |
R11269 |
T15186 |
T15187 |
compound |
PKC,inhibition |
R1127 |
T1499 |
T1500 |
amod |
transcriptional,activity |
R11270 |
T15187 |
T15188 |
nsubj |
inhibition,downregulated |
R11271 |
T15188 |
T15185 |
ccomp |
downregulated,demonstrated |
R11272 |
T15189 |
T15188 |
dobj |
NF-κB-induction,downregulated |
R11273 |
T15190 |
T15189 |
prep |
of,NF-κB-induction |
R11274 |
T15191 |
T15193 |
det |
the,gene |
R11275 |
T15192 |
T15193 |
compound |
anti-apoptotic,gene |
R11276 |
T15193 |
T15194 |
compound |
gene,BCL-xL |
R11277 |
T15194 |
T15190 |
pobj |
BCL-xL,of |
R11278 |
T15195 |
T15185 |
punct |
.,demonstrated |
R11279 |
T15196 |
T15202 |
advcl |
Consistent,reported |
R1128 |
T1500 |
T1497 |
dobj |
activity,enhance |
R11280 |
T15197 |
T15196 |
prep |
with,Consistent |
R11281 |
T15198 |
T15199 |
poss |
our,finding |
R11282 |
T15199 |
T15197 |
pobj |
finding,with |
R11283 |
T15200 |
T15202 |
punct |
",",reported |
R11284 |
T15201 |
T15202 |
nsubj |
others,reported |
R11285 |
T15202 |
T15202 |
ROOT |
reported,reported |
R11286 |
T15203 |
T15204 |
nsubj |
NF-κB,regulated |
R11287 |
T15204 |
T15202 |
ccomp |
regulated,reported |
R11288 |
T15205 |
T15207 |
det |
the,expression |
R11289 |
T15206 |
T15207 |
compound |
gene,expression |
R1129 |
T1501 |
T1503 |
nmod |
[,] |
R11290 |
T15207 |
T15204 |
dobj |
expression,regulated |
R11291 |
T15208 |
T15207 |
prep |
of,expression |
R11292 |
T15209 |
T15211 |
amod |
many,proteins |
R11293 |
T15210 |
T15211 |
amod |
anti-apoptotic,proteins |
R11294 |
T15211 |
T15208 |
pobj |
proteins,of |
R11295 |
T15212 |
T15211 |
prep |
including,proteins |
R11296 |
T15213 |
T15216 |
amod |
other,members |
R11297 |
T15214 |
T15216 |
compound |
BCL-2,members |
R11298 |
T15215 |
T15216 |
compound |
family,members |
R11299 |
T15216 |
T15212 |
pobj |
members,including |
R113 |
T145 |
T147 |
det |
The,protein |
R1130 |
T1502 |
T1503 |
nummod |
18,] |
R11300 |
T15217 |
T15216 |
cc |
and,members |
R11301 |
T15218 |
T15216 |
conj |
inhibitor,members |
R11302 |
T15219 |
T15218 |
prep |
of,inhibitor |
R11303 |
T15220 |
T15224 |
amod |
apoptosis,proteins |
R11304 |
T15221 |
T15222 |
punct |
(,IAP |
R11305 |
T15222 |
T15220 |
appos |
IAP,apoptosis |
R11306 |
T15223 |
T15222 |
punct |
),IAP |
R11307 |
T15224 |
T15219 |
pobj |
proteins,of |
R11308 |
T15225 |
T15226 |
nsubj |
which,are |
R11309 |
T15226 |
T15224 |
relcl |
are,proteins |
R1131 |
T1503 |
T1500 |
appos |
],activity |
R11310 |
T15227 |
T15226 |
attr |
regulators,are |
R11311 |
T15228 |
T15227 |
prep |
of,regulators |
R11312 |
T15229 |
T15228 |
pobj |
apoptosis,of |
R11313 |
T15230 |
T15229 |
cc |
and,apoptosis |
R11314 |
T15231 |
T15232 |
compound |
function,upstream |
R11315 |
T15232 |
T15229 |
conj |
upstream,apoptosis |
R11316 |
T15233 |
T15232 |
prep |
of,upstream |
R11317 |
T15234 |
T15235 |
compound |
caspases,[ |
R11318 |
T15235 |
T15237 |
nmod |
[,] |
R11319 |
T15236 |
T15237 |
nummod |
44,] |
R1132 |
T1504 |
T1493 |
punct |
.,phosphorylated |
R11320 |
T15237 |
T15233 |
pobj |
],of |
R11321 |
T15238 |
T15202 |
punct |
.,reported |
R11322 |
T15239 |
T15242 |
nsubjpass |
It,shown |
R11323 |
T15240 |
T15242 |
aux |
has,shown |
R11324 |
T15241 |
T15242 |
auxpass |
been,shown |
R11325 |
T15242 |
T15242 |
ROOT |
shown,shown |
R11326 |
T15243 |
T15249 |
mark |
that,prevents |
R11327 |
T15244 |
T15249 |
nsubj |
phosphorylation,prevents |
R11328 |
T15245 |
T15244 |
prep |
of,phosphorylation |
R11329 |
T15246 |
T15245 |
pobj |
p65,of |
R1133 |
T1505 |
T1515 |
prep |
In,associated |
R11330 |
T15247 |
T15244 |
prep |
at,phosphorylation |
R11331 |
T15248 |
T15247 |
pobj |
Ser276,at |
R11332 |
T15249 |
T15242 |
ccomp |
prevents,shown |
R11333 |
T15250 |
T15251 |
poss |
its,degradation |
R11334 |
T15251 |
T15249 |
dobj |
degradation,prevents |
R11335 |
T15252 |
T15251 |
prep |
by,degradation |
R11336 |
T15253 |
T15254 |
amod |
ubiquitin-mediated,proteolysis |
R11337 |
T15254 |
T15252 |
pobj |
proteolysis,by |
R11338 |
T15255 |
T15249 |
cc |
and,prevents |
R11339 |
T15256 |
T15249 |
conj |
promotes,prevents |
R1134 |
T1506 |
T1505 |
pobj |
macrophages,In |
R11340 |
T15257 |
T15258 |
compound |
cell,survival |
R11341 |
T15258 |
T15256 |
dobj |
survival,promotes |
R11342 |
T15259 |
T15256 |
prep |
in,promotes |
R11343 |
T15260 |
T15261 |
compound |
HeLa,cells |
R11344 |
T15261 |
T15259 |
pobj |
cells,in |
R11345 |
T15262 |
T15264 |
nmod |
[,] |
R11346 |
T15263 |
T15264 |
nummod |
24,] |
R11347 |
T15264 |
T15261 |
appos |
],cells |
R11348 |
T15265 |
T15242 |
punct |
.,shown |
R11349 |
T15266 |
T15279 |
prep |
In,evaluating |
R1135 |
T1507 |
T1506 |
acl |
treated,macrophages |
R11350 |
T15267 |
T15266 |
pobj |
addition,In |
R11351 |
T15268 |
T15267 |
prep |
to,addition |
R11352 |
T15269 |
T15270 |
amod |
BCL-xL,expression |
R11353 |
T15270 |
T15268 |
pobj |
expression,to |
R11354 |
T15271 |
T15272 |
mark |
as,examined |
R11355 |
T15272 |
T15279 |
advcl |
examined,evaluating |
R11356 |
T15273 |
T15272 |
prep |
in,examined |
R11357 |
T15274 |
T15275 |
det |
this,study |
R11358 |
T15275 |
T15273 |
pobj |
study,in |
R11359 |
T15276 |
T15279 |
punct |
",",evaluating |
R1136 |
T1508 |
T1507 |
prep |
with,treated |
R11360 |
T15277 |
T15279 |
nsubj |
we,evaluating |
R11361 |
T15278 |
T15279 |
aux |
are,evaluating |
R11362 |
T15279 |
T15279 |
ROOT |
evaluating,evaluating |
R11363 |
T15280 |
T15281 |
det |
the,possibility |
R11364 |
T15281 |
T15279 |
dobj |
possibility,evaluating |
R11365 |
T15282 |
T15286 |
mark |
that,upregulates |
R11366 |
T15283 |
T15285 |
amod |
PKCα-regulated,activity |
R11367 |
T15284 |
T15285 |
compound |
NF-κB,activity |
R11368 |
T15285 |
T15286 |
nsubj |
activity,upregulates |
R11369 |
T15286 |
T15281 |
acl |
upregulates,possibility |
R1137 |
T1509 |
T1508 |
pobj |
endotoxin,with |
R11370 |
T15287 |
T15289 |
amod |
additional,genes |
R11371 |
T15288 |
T15289 |
amod |
anti-apoptotic,genes |
R11372 |
T15289 |
T15286 |
dobj |
genes,upregulates |
R11373 |
T15290 |
T15289 |
prep |
in,genes |
R11374 |
T15291 |
T15293 |
det |
an,fashion |
R11375 |
T15292 |
T15293 |
amod |
M-CSF-dependent,fashion |
R11376 |
T15293 |
T15290 |
pobj |
fashion,in |
R11377 |
T15294 |
T15295 |
aux |
to,modulate |
R11378 |
T15295 |
T15289 |
relcl |
modulate,genes |
R11379 |
T15296 |
T15297 |
compound |
cell,survival |
R1138 |
T1510 |
T1515 |
punct |
",",associated |
R11380 |
T15297 |
T15295 |
dobj |
survival,modulate |
R11381 |
T15298 |
T15279 |
punct |
.,evaluating |
R11382 |
T15299 |
T15300 |
det |
The,use |
R11383 |
T15300 |
T15310 |
nsubj |
use,ruled |
R11384 |
T15301 |
T15300 |
prep |
of,use |
R11385 |
T15302 |
T15301 |
pobj |
inhibitors,of |
R11386 |
T15303 |
T15302 |
cc |
and,inhibitors |
R11387 |
T15304 |
T15302 |
conj |
siRNA,inhibitors |
R11388 |
T15305 |
T15302 |
prep |
in,inhibitors |
R11389 |
T15306 |
T15307 |
poss |
our,study |
R1139 |
T1511 |
T1513 |
amod |
NF-κB,activity |
R11390 |
T15307 |
T15305 |
pobj |
study,in |
R11391 |
T15308 |
T15310 |
aux |
has,ruled |
R11392 |
T15309 |
T15310 |
neg |
not,ruled |
R11393 |
T15310 |
T15310 |
ROOT |
ruled,ruled |
R11394 |
T15311 |
T15310 |
prt |
out,ruled |
R11395 |
T15312 |
T15318 |
mark |
that,be |
R11396 |
T15313 |
T15315 |
amod |
other,PKCs |
R11397 |
T15314 |
T15315 |
amod |
conventional,PKCs |
R11398 |
T15315 |
T15318 |
nsubj |
PKCs,be |
R11399 |
T15316 |
T15318 |
aux |
might,be |
R114 |
T146 |
T147 |
amod |
general,protein |
R1140 |
T1512 |
T1513 |
compound |
transcription,activity |
R11400 |
T15317 |
T15318 |
advmod |
also,be |
R11401 |
T15318 |
T15310 |
ccomp |
be,ruled |
R11402 |
T15319 |
T15318 |
acomp |
important,be |
R11403 |
T15320 |
T15318 |
prep |
in,be |
R11404 |
T15321 |
T15323 |
amod |
M-CSF-induced,activation |
R11405 |
T15322 |
T15323 |
compound |
NF-κB,activation |
R11406 |
T15323 |
T15320 |
pobj |
activation,in |
R11407 |
T15324 |
T15323 |
cc |
and,activation |
R11408 |
T15325 |
T15326 |
compound |
macrophage,survival |
R11409 |
T15326 |
T15323 |
conj |
survival,activation |
R1141 |
T1513 |
T1515 |
nsubjpass |
activity,associated |
R11410 |
T15327 |
T15310 |
punct |
.,ruled |
R11411 |
T15328 |
T15347 |
prep |
In,appear |
R11412 |
T15329 |
T15328 |
pobj |
contrast,In |
R11413 |
T15330 |
T15329 |
prep |
to,contrast |
R11414 |
T15331 |
T15332 |
det |
the,actions |
R11415 |
T15332 |
T15330 |
pobj |
actions,to |
R11416 |
T15333 |
T15332 |
prep |
of,actions |
R11417 |
T15334 |
T15335 |
compound |
PKCα,activation |
R11418 |
T15335 |
T15333 |
pobj |
activation,of |
R11419 |
T15336 |
T15335 |
prep |
of,activation |
R1142 |
T1514 |
T1515 |
auxpass |
is,associated |
R11420 |
T15337 |
T15340 |
amod |
other,isoforms |
R11421 |
T15338 |
T15340 |
amod |
conventional,isoforms |
R11422 |
T15339 |
T15340 |
compound |
PKC,isoforms |
R11423 |
T15340 |
T15336 |
pobj |
isoforms,of |
R11424 |
T15341 |
T15340 |
punct |
",",isoforms |
R11425 |
T15342 |
T15335 |
prep |
like,activation |
R11426 |
T15343 |
T15345 |
compound |
PKCβI,βII |
R11427 |
T15344 |
T15345 |
compound |
/,βII |
R11428 |
T15345 |
T15342 |
pobj |
βII,like |
R11429 |
T15346 |
T15347 |
punct |
",",appear |
R1143 |
T1515 |
T1515 |
ROOT |
associated,associated |
R11430 |
T15347 |
T15347 |
ROOT |
appear,appear |
R11431 |
T15348 |
T15347 |
oprd |
necessary,appear |
R11432 |
T15349 |
T15348 |
prep |
for,necessary |
R11433 |
T15350 |
T15351 |
amod |
macrophage,apoptosis |
R11434 |
T15351 |
T15349 |
pobj |
apoptosis,for |
R11435 |
T15352 |
T15347 |
punct |
.,appear |
R11436 |
T15353 |
T15357 |
det |
The,isoforms |
R11437 |
T15354 |
T15356 |
compound |
PKCβI,βII |
R11438 |
T15355 |
T15356 |
compound |
/,βII |
R11439 |
T15356 |
T15357 |
compound |
βII,isoforms |
R1144 |
T1516 |
T1515 |
prep |
with,associated |
R11440 |
T15357 |
T15359 |
nsubjpass |
isoforms,expressed |
R11441 |
T15358 |
T15359 |
auxpass |
are,expressed |
R11442 |
T15359 |
T15359 |
ROOT |
expressed,expressed |
R11443 |
T15360 |
T15359 |
prep |
in,expressed |
R11444 |
T15361 |
T15364 |
amod |
apoptotic,cells |
R11445 |
T15362 |
T15364 |
nmod |
U937,cells |
R11446 |
T15363 |
T15364 |
amod |
myelomonocytic,cells |
R11447 |
T15364 |
T15360 |
pobj |
cells,in |
R11448 |
T15365 |
T15367 |
nmod |
[,] |
R11449 |
T15366 |
T15367 |
nummod |
45,] |
R1145 |
T1517 |
T1516 |
pobj |
phosphorylation,with |
R11450 |
T15367 |
T15359 |
npadvmod |
],expressed |
R11451 |
T15368 |
T15359 |
punct |
.,expressed |
R11452 |
T15369 |
T15374 |
det |
The,HL-525 |
R11453 |
T15370 |
T15372 |
amod |
human,cell |
R11454 |
T15371 |
T15372 |
compound |
myeloid,cell |
R11455 |
T15372 |
T15373 |
compound |
cell,line |
R11456 |
T15373 |
T15374 |
compound |
line,HL-525 |
R11457 |
T15374 |
T15381 |
nsubj |
HL-525,is |
R11458 |
T15375 |
T15376 |
nsubj |
which,is |
R11459 |
T15376 |
T15374 |
relcl |
is,HL-525 |
R1146 |
T1518 |
T1517 |
prep |
on,phosphorylation |
R11460 |
T15377 |
T15376 |
acomp |
devoid,is |
R11461 |
T15378 |
T15377 |
prep |
of,devoid |
R11462 |
T15379 |
T15380 |
compound |
endogenous,PKCβII |
R11463 |
T15380 |
T15378 |
pobj |
PKCβII,of |
R11464 |
T15381 |
T15381 |
ROOT |
is,is |
R11465 |
T15382 |
T15381 |
acomp |
resistant,is |
R11466 |
T15383 |
T15382 |
prep |
to,resistant |
R11467 |
T15384 |
T15385 |
amod |
TNFα-induced,apoptosis |
R11468 |
T15385 |
T15383 |
pobj |
apoptosis,to |
R11469 |
T15386 |
T15383 |
pobj |
[,to |
R1147 |
T1519 |
T1518 |
pobj |
Ser276,on |
R11470 |
T15387 |
T15388 |
nummod |
46,] |
R11471 |
T15388 |
T15386 |
dobj |
],[ |
R11472 |
T15389 |
T15381 |
punct |
.,is |
R11473 |
T15390 |
T15396 |
nsubj |
Re-expression,restores |
R11474 |
T15391 |
T15390 |
prep |
of,Re-expression |
R11475 |
T15392 |
T15391 |
pobj |
PKCβII,of |
R11476 |
T15393 |
T15392 |
prep |
in,PKCβII |
R11477 |
T15394 |
T15395 |
compound |
HL-525,cells |
R11478 |
T15395 |
T15393 |
pobj |
cells,in |
R11479 |
T15396 |
T15396 |
ROOT |
restores,restores |
R1148 |
T1520 |
T1519 |
cc |
and,Ser276 |
R11480 |
T15397 |
T15398 |
poss |
their,susceptibility |
R11481 |
T15398 |
T15396 |
dobj |
susceptibility,restores |
R11482 |
T15399 |
T15400 |
aux |
to,TNFα-induced |
R11483 |
T15400 |
T15396 |
xcomp |
TNFα-induced,restores |
R11484 |
T15401 |
T15400 |
dobj |
apoptosis,TNFα-induced |
R11485 |
T15402 |
T15400 |
advcl |
implying,TNFα-induced |
R11486 |
T15403 |
T15405 |
mark |
that,is |
R11487 |
T15404 |
T15405 |
nsubj |
PKCβII,is |
R11488 |
T15405 |
T15402 |
ccomp |
is,implying |
R11489 |
T15406 |
T15405 |
acomp |
pro-apoptotic,is |
R1149 |
T1521 |
T1519 |
conj |
Ser536,Ser276 |
R11490 |
T15407 |
T15405 |
cc |
and,is |
R11491 |
T15408 |
T15410 |
aux |
may,required |
R11492 |
T15409 |
T15410 |
auxpass |
be,required |
R11493 |
T15410 |
T15405 |
conj |
required,is |
R11494 |
T15411 |
T15412 |
aux |
to,induce |
R11495 |
T15412 |
T15410 |
advcl |
induce,required |
R11496 |
T15413 |
T15414 |
compound |
macrophage,apoptosis |
R11497 |
T15414 |
T15412 |
dobj |
apoptosis,induce |
R11498 |
T15415 |
T15396 |
punct |
.,restores |
R11499 |
T15416 |
T15417 |
amod |
Recent,studies |
R115 |
T147 |
T173 |
nsubj |
protein,reduced |
R1150 |
T1522 |
T1524 |
nsubjpass |
that,regulated |
R11500 |
T15417 |
T15418 |
nsubj |
studies,demonstrated |
R11501 |
T15418 |
T15418 |
ROOT |
demonstrated,demonstrated |
R11502 |
T15419 |
T15425 |
mark |
that,regulated |
R11503 |
T15420 |
T15422 |
amod |
NF-κB,activity |
R11504 |
T15421 |
T15422 |
amod |
transcriptional,activity |
R11505 |
T15422 |
T15425 |
nsubjpass |
activity,regulated |
R11506 |
T15423 |
T15425 |
aux |
can,regulated |
R11507 |
T15424 |
T15425 |
auxpass |
be,regulated |
R11508 |
T15425 |
T15418 |
ccomp |
regulated,demonstrated |
R11509 |
T15426 |
T15425 |
agent |
by,regulated |
R1151 |
T1523 |
T1524 |
auxpass |
is,regulated |
R11510 |
T15427 |
T15426 |
pobj |
phosphorylation,by |
R11511 |
T15428 |
T15427 |
prep |
of,phosphorylation |
R11512 |
T15429 |
T15432 |
det |
the,subunit |
R11513 |
T15430 |
T15432 |
nmod |
NF-κB,subunit |
R11514 |
T15431 |
T15432 |
nummod |
p65,subunit |
R11515 |
T15432 |
T15428 |
pobj |
subunit,of |
R11516 |
T15433 |
T15425 |
prep |
in,regulated |
R11517 |
T15434 |
T15435 |
det |
the,absence |
R11518 |
T15435 |
T15433 |
pobj |
absence,in |
R11519 |
T15436 |
T15435 |
prep |
of,absence |
R1152 |
T1524 |
T1515 |
conj |
regulated,associated |
R11520 |
T15437 |
T15438 |
compound |
IκBα,degradation |
R11521 |
T15438 |
T15436 |
pobj |
degradation,of |
R11522 |
T15439 |
T15441 |
nmod |
[,] |
R11523 |
T15440 |
T15441 |
nummod |
47,] |
R11524 |
T15441 |
T15438 |
appos |
],degradation |
R11525 |
T15442 |
T15418 |
punct |
.,demonstrated |
R11526 |
T15443 |
T15450 |
prep |
By,regulates |
R11527 |
T15444 |
T15445 |
det |
this,pathway |
R11528 |
T15445 |
T15443 |
pobj |
pathway,By |
R11529 |
T15446 |
T15450 |
punct |
",",regulates |
R1153 |
T1525 |
T1524 |
prep |
through,regulated |
R11530 |
T15447 |
T15450 |
nsubj |
phosphorylation,regulates |
R11531 |
T15448 |
T15447 |
prep |
of,phosphorylation |
R11532 |
T15449 |
T15448 |
pobj |
NF-κB,of |
R11533 |
T15450 |
T15450 |
ROOT |
regulates,regulates |
R11534 |
T15451 |
T15452 |
poss |
its,interaction |
R11535 |
T15452 |
T15450 |
dobj |
interaction,regulates |
R11536 |
T15453 |
T15452 |
prep |
with,interaction |
R11537 |
T15454 |
T15455 |
amod |
other,components |
R11538 |
T15455 |
T15453 |
pobj |
components,with |
R11539 |
T15456 |
T15455 |
prep |
of,components |
R1154 |
T1526 |
T1525 |
pobj |
protein,through |
R11540 |
T15457 |
T15460 |
det |
the,machinery |
R11541 |
T15458 |
T15460 |
amod |
basal,machinery |
R11542 |
T15459 |
T15460 |
amod |
transcriptional,machinery |
R11543 |
T15460 |
T15456 |
pobj |
machinery,of |
R11544 |
T15461 |
T15450 |
prep |
without,regulates |
R11545 |
T15462 |
T15461 |
pcomp |
affecting,without |
R11546 |
T15463 |
T15464 |
poss |
its,capability |
R11547 |
T15464 |
T15462 |
dobj |
capability,affecting |
R11548 |
T15465 |
T15466 |
aux |
to,bind |
R11549 |
T15466 |
T15462 |
xcomp |
bind,affecting |
R1155 |
T1527 |
T1528 |
compound |
kinase,A |
R11550 |
T15467 |
T15468 |
compound |
DNA,[ |
R11551 |
T15468 |
T15466 |
dobj |
[,bind |
R11552 |
T15469 |
T15470 |
nummod |
21,] |
R11553 |
T15470 |
T15466 |
dobj |
],bind |
R11554 |
T15471 |
T15450 |
punct |
.,regulates |
R11555 |
T15472 |
T15475 |
mark |
Since,bind |
R11556 |
T15473 |
T15475 |
nsubj |
NF-κB,bind |
R11557 |
T15474 |
T15475 |
aux |
can,bind |
R11558 |
T15475 |
T15489 |
advcl |
bind,affect |
R11559 |
T15476 |
T15477 |
det |
the,promoters |
R1156 |
T1528 |
T1530 |
det |
A,PKA |
R11560 |
T15477 |
T15475 |
dobj |
promoters,bind |
R11561 |
T15478 |
T15477 |
prep |
of,promoters |
R11562 |
T15479 |
T15481 |
amod |
numerous,targets |
R11563 |
T15480 |
T15481 |
compound |
gene,targets |
R11564 |
T15481 |
T15478 |
pobj |
targets,of |
R11565 |
T15482 |
T15481 |
punct |
",",targets |
R11566 |
T15483 |
T15484 |
amod |
post-translational,modification |
R11567 |
T15484 |
T15477 |
conj |
modification,promoters |
R11568 |
T15485 |
T15484 |
prep |
of,modification |
R11569 |
T15486 |
T15487 |
compound |
NF-κB,p65 |
R1157 |
T1529 |
T1530 |
punct |
(,PKA |
R11570 |
T15487 |
T15485 |
pobj |
p65,of |
R11571 |
T15488 |
T15489 |
aux |
may,affect |
R11572 |
T15489 |
T15489 |
ROOT |
affect,affect |
R11573 |
T15490 |
T15491 |
poss |
its,interaction |
R11574 |
T15491 |
T15489 |
dobj |
interaction,affect |
R11575 |
T15492 |
T15491 |
prep |
with,interaction |
R11576 |
T15493 |
T15494 |
amod |
other,proteins |
R11577 |
T15494 |
T15492 |
pobj |
proteins,with |
R11578 |
T15495 |
T15489 |
punct |
",",affect |
R11579 |
T15496 |
T15489 |
advcl |
refining,affect |
R1158 |
T1530 |
T1524 |
oprd |
PKA,regulated |
R11580 |
T15497 |
T15498 |
det |
the,expression |
R11581 |
T15498 |
T15496 |
dobj |
expression,refining |
R11582 |
T15499 |
T15498 |
prep |
of,expression |
R11583 |
T15500 |
T15501 |
compound |
gene,targets |
R11584 |
T15501 |
T15499 |
pobj |
targets,of |
R11585 |
T15502 |
T15489 |
punct |
.,affect |
R11586 |
T15503 |
T15506 |
nsubj |
We,find |
R11587 |
T15504 |
T15506 |
aux |
did,find |
R11588 |
T15505 |
T15506 |
neg |
not,find |
R11589 |
T15506 |
T15506 |
ROOT |
find,find |
R1159 |
T1531 |
T1530 |
punct |
),PKA |
R11590 |
T15507 |
T15510 |
mark |
that,involved |
R11591 |
T15508 |
T15510 |
nsubjpass |
PKC,involved |
R11592 |
T15509 |
T15510 |
auxpass |
was,involved |
R11593 |
T15510 |
T15506 |
ccomp |
involved,find |
R11594 |
T15511 |
T15510 |
prep |
in,involved |
R11595 |
T15512 |
T15513 |
compound |
IκBα,degradation |
R11596 |
T15513 |
T15511 |
pobj |
degradation,in |
R11597 |
T15514 |
T15513 |
cc |
or,degradation |
R11598 |
T15515 |
T15516 |
compound |
NF-κB,p65 |
R11599 |
T15516 |
T15518 |
nummod |
p65,translocation |
R116 |
T148 |
T149 |
compound |
kinase,C |
R1160 |
T1532 |
T1530 |
cc |
and,PKA |
R11600 |
T15517 |
T15518 |
amod |
nuclear,translocation |
R11601 |
T15518 |
T15513 |
conj |
translocation,degradation |
R11602 |
T15519 |
T15513 |
acl |
induced,degradation |
R11603 |
T15520 |
T15519 |
agent |
by,induced |
R11604 |
T15521 |
T15520 |
pobj |
M-CSF,by |
R11605 |
T15522 |
T15506 |
punct |
",",find |
R11606 |
T15523 |
T15506 |
cc |
but,find |
R11607 |
T15524 |
T15526 |
det |
that,phosphorylation |
R11608 |
T15525 |
T15526 |
amod |
M-CSF-induced,phosphorylation |
R11609 |
T15526 |
T15534 |
nsubjpass |
phosphorylation,reduced |
R1161 |
T1533 |
T1530 |
conj |
IKKβ,PKA |
R11610 |
T15527 |
T15526 |
prep |
of,phosphorylation |
R11611 |
T15528 |
T15529 |
compound |
NF-κB,p65 |
R11612 |
T15529 |
T15527 |
pobj |
p65,of |
R11613 |
T15530 |
T15526 |
prep |
at,phosphorylation |
R11614 |
T15531 |
T15530 |
pobj |
Ser276,at |
R11615 |
T15532 |
T15534 |
auxpass |
was,reduced |
R11616 |
T15533 |
T15534 |
advmod |
dramatically,reduced |
R11617 |
T15534 |
T15506 |
conj |
reduced,find |
R11618 |
T15535 |
T15534 |
agent |
by,reduced |
R11619 |
T15536 |
T15539 |
det |
the,inhibitor |
R1162 |
T1534 |
T1535 |
compound |
respectively,[ |
R11620 |
T15537 |
T15539 |
amod |
conventional,inhibitor |
R11621 |
T15538 |
T15539 |
compound |
PKC,inhibitor |
R11622 |
T15539 |
T15535 |
pobj |
inhibitor,by |
R11623 |
T15540 |
T15539 |
cc |
and,inhibitor |
R11624 |
T15541 |
T15539 |
conj |
kinase,inhibitor |
R11625 |
T15542 |
T15534 |
advcl |
deficient,reduced |
R11626 |
T15543 |
T15542 |
dobj |
PKCα,deficient |
R11627 |
T15544 |
T15542 |
cc |
and,deficient |
R11628 |
T15545 |
T15534 |
agent |
by,reduced |
R11629 |
T15546 |
T15545 |
pobj |
siRNA,by |
R1163 |
T1535 |
T1530 |
conj |
[,PKA |
R11630 |
T15547 |
T15534 |
prep |
towards,reduced |
R11631 |
T15548 |
T15547 |
pobj |
PKCα,towards |
R11632 |
T15549 |
T15534 |
punct |
.,reduced |
R11633 |
T15550 |
T15551 |
amod |
Current,studies |
R11634 |
T15551 |
T15552 |
nsubj |
studies,are |
R11635 |
T15552 |
T15552 |
ROOT |
are,are |
R11636 |
T15553 |
T15552 |
acomp |
underway,are |
R11637 |
T15554 |
T15555 |
aux |
to,delineate |
R11638 |
T15555 |
T15553 |
xcomp |
delineate,underway |
R11639 |
T15556 |
T15558 |
det |
the,complexes |
R1164 |
T1536 |
T1535 |
nummod |
16,[ |
R11640 |
T15557 |
T15558 |
compound |
protein,complexes |
R11641 |
T15558 |
T15555 |
dobj |
complexes,delineate |
R11642 |
T15559 |
T15558 |
acl |
formed,complexes |
R11643 |
T15560 |
T15559 |
agent |
by,formed |
R11644 |
T15561 |
T15562 |
amod |
activated,NF-κB |
R11645 |
T15562 |
T15560 |
pobj |
NF-κB,by |
R11646 |
T15563 |
T15562 |
cc |
and,NF-κB |
R11647 |
T15564 |
T15566 |
amod |
other,co-activators |
R11648 |
T15565 |
T15566 |
amod |
transcriptional,co-activators |
R11649 |
T15566 |
T15562 |
conj |
co-activators,NF-κB |
R1165 |
T1537 |
T1535 |
conj |
],[ |
R11650 |
T15567 |
T15559 |
prep |
in,formed |
R11651 |
T15568 |
T15567 |
pobj |
response,in |
R11652 |
T15569 |
T15568 |
prep |
to,response |
R11653 |
T15570 |
T15569 |
pobj |
M-CSF,to |
R11654 |
T15571 |
T15570 |
cc |
and,M-CSF |
R11655 |
T15572 |
T15573 |
compound |
PKC,activation |
R11656 |
T15573 |
T15570 |
conj |
activation,M-CSF |
R11657 |
T15574 |
T15552 |
punct |
.,are |
R11658 |
T15575 |
T15577 |
advmod |
Recently,indicated |
R11659 |
T15576 |
T15577 |
nsubj |
studies,indicated |
R1166 |
T1538 |
T1537 |
punct |
",",] |
R11660 |
T15577 |
T15577 |
ROOT |
indicated,indicated |
R11661 |
T15578 |
T15583 |
mark |
that,activated |
R11662 |
T15579 |
T15581 |
det |
the,pathway |
R11663 |
T15580 |
T15581 |
amod |
non-canonical,pathway |
R11664 |
T15581 |
T15583 |
nsubjpass |
pathway,activated |
R11665 |
T15582 |
T15583 |
auxpass |
was,activated |
R11666 |
T15583 |
T15577 |
ccomp |
activated,indicated |
R11667 |
T15584 |
T15583 |
prep |
during,activated |
R11668 |
T15585 |
T15586 |
amod |
human,monocyte-macrophage |
R11669 |
T15586 |
T15587 |
compound |
monocyte-macrophage,differentiation |
R1167 |
T1539 |
T1535 |
conj |
[,[ |
R11670 |
T15587 |
T15588 |
compound |
differentiation,[ |
R11671 |
T15588 |
T15590 |
compound |
[,] |
R11672 |
T15589 |
T15590 |
nummod |
48,] |
R11673 |
T15590 |
T15584 |
pobj |
],during |
R11674 |
T15591 |
T15577 |
punct |
.,indicated |
R11675 |
T15592 |
T15603 |
prep |
During,is |
R11676 |
T15593 |
T15594 |
det |
this,process |
R11677 |
T15594 |
T15592 |
pobj |
process,During |
R11678 |
T15595 |
T15596 |
punct |
",",expression |
R11679 |
T15596 |
T15603 |
nsubj |
expression,is |
R1168 |
T1540 |
T1539 |
nummod |
19,[ |
R11680 |
T15597 |
T15596 |
prep |
of,expression |
R11681 |
T15598 |
T15597 |
pobj |
IKKα,of |
R11682 |
T15599 |
T15596 |
prep |
among,expression |
R11683 |
T15600 |
T15601 |
amod |
other,proteins |
R11684 |
T15601 |
T15599 |
pobj |
proteins,among |
R11685 |
T15602 |
T15603 |
punct |
",",is |
R11686 |
T15603 |
T15603 |
ROOT |
is,is |
R11687 |
T15604 |
T15603 |
acomp |
elevated,is |
R11688 |
T15605 |
T15603 |
advcl |
leading,is |
R11689 |
T15606 |
T15605 |
prep |
to,leading |
R1169 |
T1541 |
T1535 |
conj |
],[ |
R11690 |
T15607 |
T15609 |
amod |
increased,NF-κB |
R11691 |
T15608 |
T15609 |
nummod |
p52,NF-κB |
R11692 |
T15609 |
T15606 |
pobj |
NF-κB,to |
R11693 |
T15610 |
T15609 |
punct |
(,NF-κB |
R11694 |
T15611 |
T15609 |
appos |
relB,NF-κB |
R11695 |
T15612 |
T15609 |
punct |
),NF-κB |
R11696 |
T15613 |
T15605 |
dobj |
expression,leading |
R11697 |
T15614 |
T15605 |
prep |
through,leading |
R11698 |
T15615 |
T15617 |
amod |
partial,degradation |
R11699 |
T15616 |
T15617 |
amod |
proteolytic,degradation |
R117 |
T149 |
T147 |
appos |
C,protein |
R1170 |
T1542 |
T1515 |
punct |
.,associated |
R11700 |
T15617 |
T15614 |
pobj |
degradation,through |
R11701 |
T15618 |
T15617 |
prep |
of,degradation |
R11702 |
T15619 |
T15622 |
det |
the,protein |
R11703 |
T15620 |
T15622 |
nummod |
p100,protein |
R11704 |
T15621 |
T15622 |
compound |
NF-κB,protein |
R11705 |
T15622 |
T15618 |
pobj |
protein,of |
R11706 |
T15623 |
T15603 |
punct |
.,is |
R11707 |
T15624 |
T15627 |
advmod |
Thus,is |
R11708 |
T15625 |
T15627 |
punct |
",",is |
R11709 |
T15626 |
T15627 |
nsubj |
it,is |
R1171 |
T1543 |
T1550 |
prep |
In,is |
R11710 |
T15627 |
T15627 |
ROOT |
is,is |
R11711 |
T15628 |
T15627 |
acomp |
possible,is |
R11712 |
T15629 |
T15631 |
mark |
that,regulates |
R11713 |
T15630 |
T15631 |
nsubj |
M-CSF,regulates |
R11714 |
T15631 |
T15627 |
ccomp |
regulates,is |
R11715 |
T15632 |
T15633 |
compound |
monocyte,survival |
R11716 |
T15633 |
T15631 |
dobj |
survival,regulates |
R11717 |
T15634 |
T15631 |
prep |
through,regulates |
R11718 |
T15635 |
T15641 |
predet |
both,pathways |
R11719 |
T15636 |
T15641 |
det |
the,pathways |
R1172 |
T1544 |
T1546 |
amod |
human,cells |
R11720 |
T15637 |
T15641 |
amod |
canonical,pathways |
R11721 |
T15638 |
T15637 |
cc |
and,canonical |
R11722 |
T15639 |
T15637 |
conj |
non-canonical,canonical |
R11723 |
T15640 |
T15641 |
compound |
NF-κB,pathways |
R11724 |
T15641 |
T15634 |
pobj |
pathways,through |
R11725 |
T15642 |
T15641 |
punct |
",",pathways |
R11726 |
T15643 |
T15645 |
nsubj |
which,be |
R11727 |
T15644 |
T15645 |
aux |
will,be |
R11728 |
T15645 |
T15641 |
relcl |
be,pathways |
R11729 |
T15646 |
T15647 |
det |
a,focus |
R1173 |
T1545 |
T1546 |
compound |
T,cells |
R11730 |
T15647 |
T15645 |
attr |
focus,be |
R11731 |
T15648 |
T15647 |
prep |
in,focus |
R11732 |
T15649 |
T15650 |
amod |
future,research |
R11733 |
T15650 |
T15648 |
pobj |
research,in |
R11734 |
T15651 |
T15627 |
punct |
.,is |
R11735 |
T15652 |
T15654 |
nsubj |
We,showed |
R11736 |
T15653 |
T15654 |
advmod |
previously,showed |
R11737 |
T15654 |
T15654 |
ROOT |
showed,showed |
R11738 |
T15655 |
T15657 |
mark |
that,reduced |
R11739 |
T15656 |
T15657 |
nsubj |
M-CSF,reduced |
R1174 |
T1546 |
T1543 |
pobj |
cells,In |
R11740 |
T15657 |
T15654 |
ccomp |
reduced,showed |
R11741 |
T15658 |
T15661 |
amod |
caspase-3,activity |
R11742 |
T15659 |
T15658 |
cc |
and,caspase-3 |
R11743 |
T15660 |
T15658 |
conj |
-9,caspase-3 |
R11744 |
T15661 |
T15657 |
dobj |
activity,reduced |
R11745 |
T15662 |
T15657 |
cc |
and,reduced |
R11746 |
T15663 |
T15657 |
conj |
prevented,reduced |
R11747 |
T15664 |
T15665 |
compound |
monocyte,apoptosis |
R11748 |
T15665 |
T15666 |
compound |
apoptosis,[ |
R11749 |
T15666 |
T15666 |
ROOT |
[,[ |
R1175 |
T1547 |
T1550 |
punct |
",",is |
R11750 |
T15667 |
T15668 |
nummod |
3,] |
R11751 |
T15668 |
T15663 |
dobj |
],prevented |
R11752 |
T15669 |
T15654 |
punct |
.,showed |
R11753 |
T15670 |
T15671 |
det |
This,study |
R11754 |
T15671 |
T15672 |
nsubj |
study,reveals |
R11755 |
T15672 |
T15672 |
ROOT |
reveals,reveals |
R11756 |
T15673 |
T15687 |
mark |
that,blocked |
R11757 |
T15674 |
T15687 |
nsubj |
treatment,blocked |
R11758 |
T15675 |
T15674 |
prep |
of,treatment |
R11759 |
T15676 |
T15675 |
pobj |
monocytes,of |
R1176 |
T1548 |
T1549 |
compound |
NF-κB,p65 |
R11760 |
T15677 |
T15676 |
prep |
with,monocytes |
R11761 |
T15678 |
T15680 |
amod |
conventional,inhibitors |
R11762 |
T15679 |
T15680 |
compound |
PKC,inhibitors |
R11763 |
T15680 |
T15677 |
pobj |
inhibitors,with |
R11764 |
T15681 |
T15680 |
punct |
",",inhibitors |
R11765 |
T15682 |
T15676 |
cc |
or,monocytes |
R11766 |
T15683 |
T15676 |
conj |
overexpression,monocytes |
R11767 |
T15684 |
T15683 |
prep |
of,overexpression |
R11768 |
T15685 |
T15686 |
compound |
kinase-deficient,PKCα |
R11769 |
T15686 |
T15684 |
pobj |
PKCα,of |
R1177 |
T1549 |
T1550 |
nsubj |
p65,is |
R11770 |
T15687 |
T15672 |
ccomp |
blocked,reveals |
R11771 |
T15688 |
T15690 |
amod |
M-CSF-induced,survival |
R11772 |
T15689 |
T15690 |
compound |
cell,survival |
R11773 |
T15690 |
T15687 |
dobj |
survival,blocked |
R11774 |
T15691 |
T15672 |
punct |
.,reveals |
R11775 |
T15692 |
T15693 |
poss |
Our,data |
R11776 |
T15693 |
T15694 |
nsubj |
data,revealed |
R11777 |
T15694 |
T15694 |
ROOT |
revealed,revealed |
R11778 |
T15695 |
T15698 |
mark |
that,are |
R11779 |
T15696 |
T15697 |
amod |
conventional,PKCs |
R1178 |
T1550 |
T1550 |
ROOT |
is,is |
R11780 |
T15697 |
T15698 |
nsubj |
PKCs,are |
R11781 |
T15698 |
T15694 |
ccomp |
are,revealed |
R11782 |
T15699 |
T15698 |
attr |
upstream,are |
R11783 |
T15700 |
T15699 |
prep |
of,upstream |
R11784 |
T15701 |
T15702 |
amod |
NF-κB,activation |
R11785 |
T15702 |
T15700 |
pobj |
activation,of |
R11786 |
T15703 |
T15698 |
prep |
in,are |
R11787 |
T15704 |
T15703 |
pobj |
response,in |
R11788 |
T15705 |
T15704 |
prep |
to,response |
R11789 |
T15706 |
T15705 |
pobj |
M-CSF,to |
R1179 |
T1551 |
T1552 |
advmod |
constitutively,phosphorylated |
R11790 |
T15707 |
T15698 |
cc |
and,are |
R11791 |
T15708 |
T15698 |
conj |
mediate,are |
R11792 |
T15709 |
T15710 |
amod |
post-translational,activation |
R11793 |
T15710 |
T15708 |
dobj |
activation,mediate |
R11794 |
T15711 |
T15710 |
prep |
of,activation |
R11795 |
T15712 |
T15711 |
pobj |
NF-κB,of |
R11796 |
T15713 |
T15712 |
nummod |
p65,NF-κB |
R11797 |
T15714 |
T15708 |
prep |
by,mediate |
R11798 |
T15715 |
T15714 |
pcomp |
phosphorylating,by |
R11799 |
T15716 |
T15715 |
dobj |
Ser276,phosphorylating |
R118 |
T150 |
T149 |
punct |
(,C |
R1180 |
T1552 |
T1550 |
acomp |
phosphorylated,is |
R11800 |
T15717 |
T15718 |
aux |
to,regulate |
R11801 |
T15718 |
T15715 |
advcl |
regulate,phosphorylating |
R11802 |
T15719 |
T15720 |
compound |
gene,transcription |
R11803 |
T15720 |
T15718 |
dobj |
transcription,regulate |
R11804 |
T15721 |
T15720 |
cc |
and,transcription |
R11805 |
T15722 |
T15723 |
compound |
cell,survival |
R11806 |
T15723 |
T15720 |
conj |
survival,transcription |
R11807 |
T15724 |
T15694 |
punct |
.,revealed |
R11808 |
T15725 |
T15730 |
advmod |
Thus,provide |
R11809 |
T15726 |
T15730 |
punct |
",",provide |
R1181 |
T1553 |
T1552 |
prep |
on,phosphorylated |
R11810 |
T15727 |
T15728 |
poss |
our,observation |
R11811 |
T15728 |
T15730 |
nsubj |
observation,provide |
R11812 |
T15729 |
T15730 |
aux |
may,provide |
R11813 |
T15730 |
T15730 |
ROOT |
provide,provide |
R11814 |
T15731 |
T15730 |
dobj |
insight,provide |
R11815 |
T15732 |
T15730 |
prep |
in,provide |
R11816 |
T15733 |
T15735 |
amod |
potential,targets |
R11817 |
T15734 |
T15735 |
amod |
therapeutic,targets |
R11818 |
T15735 |
T15732 |
pobj |
targets,in |
R11819 |
T15736 |
T15735 |
prep |
for,targets |
R1182 |
T1554 |
T1553 |
pobj |
Ser536,on |
R11820 |
T15737 |
T15738 |
amod |
inflammatory,diseases |
R11821 |
T15738 |
T15736 |
pobj |
diseases,for |
R11822 |
T15739 |
T15730 |
punct |
.,provide |
R1183 |
T1555 |
T1556 |
aux |
to,facilitate |
R1184 |
T1556 |
T1552 |
xcomp |
facilitate,phosphorylated |
R1185 |
T1557 |
T1560 |
nmod |
NF-κB,translocation |
R1186 |
T1558 |
T1557 |
nummod |
p65,NF-κB |
R1187 |
T1559 |
T1560 |
amod |
nuclear,translocation |
R1188 |
T1560 |
T1556 |
dobj |
translocation,facilitate |
R1189 |
T1561 |
T1560 |
prep |
following,translocation |
R119 |
T151 |
T149 |
appos |
PKC,C |
R1190 |
T1562 |
T1563 |
amod |
cellular,stimulation |
R1191 |
T1563 |
T1561 |
pobj |
stimulation,following |
R1192 |
T1564 |
T1566 |
nmod |
[,] |
R1193 |
T1565 |
T1566 |
nummod |
20,] |
R1194 |
T1566 |
T1563 |
appos |
],stimulation |
R1195 |
T1567 |
T1550 |
punct |
.,is |
R1196 |
T1568 |
T1569 |
amod |
Accumulating,evidence |
R1197 |
T1569 |
T1570 |
nsubj |
evidence,reveals |
R1198 |
T1570 |
T1570 |
ROOT |
reveals,reveals |
R1199 |
T1571 |
T1577 |
mark |
that,is |
R120 |
T152 |
T149 |
punct |
),C |
R1200 |
T1572 |
T1577 |
nsubj |
NF-κB,is |
R1201 |
T1573 |
T1574 |
nummod |
p65,phosphorylation |
R1202 |
T1574 |
T1577 |
nsubj |
phosphorylation,is |
R1203 |
T1575 |
T1574 |
prep |
at,phosphorylation |
R1204 |
T1576 |
T1575 |
pobj |
Ser276,at |
R1205 |
T1577 |
T1570 |
ccomp |
is,reveals |
R1206 |
T1578 |
T1577 |
acomp |
crucial,is |
R1207 |
T1579 |
T1578 |
prep |
for,crucial |
R1208 |
T1580 |
T1582 |
poss |
its,activity |
R1209 |
T1581 |
T1582 |
amod |
transcriptional,activity |
R121 |
T153 |
T154 |
compound |
inhibitor,Ro-31-8220 |
R1210 |
T1582 |
T1579 |
pobj |
activity,for |
R1211 |
T1583 |
T1570 |
punct |
.,reveals |
R1212 |
T1584 |
T1596 |
prep |
Upon,recruits |
R1213 |
T1585 |
T1586 |
amod |
nuclear,translocation |
R1214 |
T1586 |
T1584 |
pobj |
translocation,Upon |
R1215 |
T1587 |
T1596 |
punct |
",",recruits |
R1216 |
T1588 |
T1596 |
nsubj |
phosphorylation,recruits |
R1217 |
T1589 |
T1588 |
prep |
of,phosphorylation |
R1218 |
T1590 |
T1589 |
pobj |
Ser276,of |
R1219 |
T1591 |
T1588 |
prep |
on,phosphorylation |
R122 |
T154 |
T149 |
appos |
Ro-31-8220,C |
R1220 |
T1592 |
T1591 |
pobj |
NF-κB,on |
R1221 |
T1593 |
T1588 |
dep |
p65,phosphorylation |
R1222 |
T1594 |
T1588 |
prep |
by,phosphorylation |
R1223 |
T1595 |
T1594 |
pobj |
PKA,by |
R1224 |
T1596 |
T1596 |
ROOT |
recruits,recruits |
R1225 |
T1597 |
T1599 |
det |
the,co-activator |
R1226 |
T1598 |
T1599 |
compound |
transcription,co-activator |
R1227 |
T1599 |
T1596 |
dobj |
co-activator,recruits |
R1228 |
T1600 |
T1599 |
punct |
",",co-activator |
R1229 |
T1601 |
T1599 |
appos |
p300,co-activator |
R123 |
T155 |
T149 |
punct |
",",C |
R1230 |
T1602 |
T1603 |
aux |
to,potentiate |
R1231 |
T1603 |
T1596 |
advcl |
potentiate,recruits |
R1232 |
T1604 |
T1606 |
amod |
NF-κB-regulated,transcription |
R1233 |
T1605 |
T1606 |
compound |
gene,transcription |
R1234 |
T1606 |
T1603 |
dobj |
transcription,potentiate |
R1235 |
T1607 |
T1609 |
nmod |
[,] |
R1236 |
T1608 |
T1609 |
nummod |
21,] |
R1237 |
T1609 |
T1609 |
ROOT |
],] |
R1238 |
T1610 |
T1596 |
punct |
.,recruits |
R1239 |
T1611 |
T1615 |
advmod |
However,show |
R124 |
T156 |
T162 |
det |
the,Gö-6976 |
R1240 |
T1612 |
T1615 |
punct |
",",show |
R1241 |
T1613 |
T1614 |
amod |
other,studies |
R1242 |
T1614 |
T1615 |
nsubj |
studies,show |
R1243 |
T1615 |
T1615 |
ROOT |
show,show |
R1244 |
T1616 |
T1618 |
mark |
that,inhibits |
R1245 |
T1617 |
T1618 |
nsubj |
PKA,inhibits |
R1246 |
T1618 |
T1615 |
ccomp |
inhibits,show |
R1247 |
T1619 |
T1621 |
amod |
NF-κB-regulated,expression |
R1248 |
T1620 |
T1621 |
compound |
gene,expression |
R1249 |
T1621 |
T1618 |
dobj |
expression,inhibits |
R125 |
T157 |
T162 |
amod |
conventional,Gö-6976 |
R1250 |
T1622 |
T1618 |
prep |
by,inhibits |
R1251 |
T1623 |
T1622 |
pcomp |
stabilizing,by |
R1252 |
T1624 |
T1625 |
compound |
IκBα,[ |
R1253 |
T1625 |
T1623 |
dobj |
[,stabilizing |
R1254 |
T1626 |
T1627 |
nummod |
22,] |
R1255 |
T1627 |
T1623 |
dobj |
],stabilizing |
R1256 |
T1628 |
T1629 |
punct |
",",[ |
R1257 |
T1629 |
T1627 |
npadvmod |
[,] |
R1258 |
T1630 |
T1631 |
nummod |
23,] |
R1259 |
T1631 |
T1627 |
conj |
],] |
R126 |
T158 |
T162 |
compound |
PKCα,Gö-6976 |
R1260 |
T1632 |
T1615 |
punct |
.,show |
R1261 |
T1633 |
T1640 |
advmod |
Interestingly,phosphorylates |
R1262 |
T1634 |
T1640 |
punct |
",",phosphorylates |
R1263 |
T1635 |
T1638 |
det |
the,Pim-1 |
R1264 |
T1636 |
T1638 |
amod |
serine/threonine,Pim-1 |
R1265 |
T1637 |
T1638 |
compound |
kinase,Pim-1 |
R1266 |
T1638 |
T1640 |
nsubj |
Pim-1,phosphorylates |
R1267 |
T1639 |
T1640 |
advmod |
directly,phosphorylates |
R1268 |
T1640 |
T1640 |
ROOT |
phosphorylates,phosphorylates |
R1269 |
T1641 |
T1642 |
compound |
NF-κB,p65 |
R127 |
T159 |
T162 |
compound |
/,Gö-6976 |
R1270 |
T1642 |
T1640 |
dobj |
p65,phosphorylates |
R1271 |
T1643 |
T1640 |
prep |
at,phosphorylates |
R1272 |
T1644 |
T1643 |
pobj |
Ser276,at |
R1273 |
T1645 |
T1640 |
prep |
by,phosphorylates |
R1274 |
T1646 |
T1645 |
pcomp |
stabilizing,by |
R1275 |
T1647 |
T1648 |
aux |
to,prevent |
R1276 |
T1648 |
T1646 |
xcomp |
prevent,stabilizing |
R1277 |
T1649 |
T1650 |
amod |
ubiquitin-proteasome,degradation |
R1278 |
T1650 |
T1648 |
dobj |
degradation,prevent |
R1279 |
T1651 |
T1653 |
nmod |
[,] |
R128 |
T160 |
T162 |
compound |
β,Gö-6976 |
R1280 |
T1652 |
T1653 |
nummod |
24,] |
R1281 |
T1653 |
T1650 |
appos |
],degradation |
R1282 |
T1654 |
T1640 |
punct |
.,phosphorylates |
R1283 |
T1655 |
T1658 |
amod |
Several,sites |
R1284 |
T1656 |
T1658 |
amod |
other,sites |
R1285 |
T1657 |
T1658 |
amod |
phosphorylation,sites |
R1286 |
T1658 |
T1661 |
nsubjpass |
sites,described |
R1287 |
T1659 |
T1661 |
auxpass |
are,described |
R1288 |
T1660 |
T1661 |
advmod |
also,described |
R1289 |
T1661 |
T1661 |
ROOT |
described,described |
R129 |
T161 |
T162 |
compound |
inhibitor,Gö-6976 |
R1290 |
T1662 |
T1663 |
aux |
to,enhance |
R1291 |
T1663 |
T1661 |
xcomp |
enhance,described |
R1292 |
T1664 |
T1666 |
amod |
NF-κB,transactivation |
R1293 |
T1665 |
T1666 |
compound |
gene,transactivation |
R1294 |
T1666 |
T1663 |
dobj |
transactivation,enhance |
R1295 |
T1667 |
T1669 |
nmod |
[,] |
R1296 |
T1668 |
T1669 |
nummod |
25,] |
R1297 |
T1669 |
T1666 |
appos |
],transactivation |
R1298 |
T1670 |
T1661 |
punct |
.,described |
R1299 |
T1671 |
T1674 |
advmod |
Here,investigate |
R130 |
T162 |
T149 |
appos |
Gö-6976,C |
R1300 |
T1672 |
T1674 |
punct |
",",investigate |
R1301 |
T1673 |
T1674 |
nsubj |
we,investigate |
R1302 |
T1674 |
T1674 |
ROOT |
investigate,investigate |
R1303 |
T1675 |
T1676 |
det |
the,role |
R1304 |
T1676 |
T1674 |
dobj |
role,investigate |
R1305 |
T1677 |
T1676 |
prep |
of,role |
R1306 |
T1678 |
T1677 |
pobj |
protein,of |
R1307 |
T1679 |
T1680 |
compound |
kinase,C |
R1308 |
T1680 |
T1680 |
ROOT |
C,C |
R1309 |
T1681 |
T1680 |
punct |
(,C |
R131 |
T163 |
T162 |
punct |
",",Gö-6976 |
R1310 |
T1682 |
T1680 |
appos |
PKC,C |
R1311 |
T1683 |
T1680 |
punct |
),C |
R1312 |
T1684 |
T1676 |
prep |
in,role |
R1313 |
T1685 |
T1686 |
compound |
M-CSF-stimulated,NF-κB |
R1314 |
T1686 |
T1687 |
compound |
NF-κB,activation |
R1315 |
T1687 |
T1684 |
pobj |
activation,in |
R1316 |
T1688 |
T1674 |
punct |
.,investigate |
R1317 |
T1689 |
T1690 |
compound |
PKC,proteins |
R1318 |
T1690 |
T1691 |
nsubj |
proteins,are |
R1319 |
T1691 |
T1691 |
ROOT |
are,are |
R132 |
T164 |
T162 |
appos |
overexpression,Gö-6976 |
R1320 |
T1692 |
T1693 |
amod |
multifunctional,kinases |
R1321 |
T1693 |
T1691 |
attr |
kinases,are |
R1322 |
T1694 |
T1695 |
nsubj |
that,differ |
R1323 |
T1695 |
T1693 |
relcl |
differ,kinases |
R1324 |
T1696 |
T1695 |
prep |
in,differ |
R1325 |
T1697 |
T1696 |
pobj |
structure,in |
R1326 |
T1698 |
T1697 |
punct |
",",structure |
R1327 |
T1699 |
T1695 |
npadvmod |
function,differ |
R1328 |
T1700 |
T1699 |
cc |
and,function |
R1329 |
T1701 |
T1699 |
conj |
co-factor,function |
R133 |
T165 |
T164 |
prep |
of,overexpression |
R1330 |
T1702 |
T1705 |
compound |
requirement,] |
R1331 |
T1703 |
T1705 |
nmod |
[,] |
R1332 |
T1704 |
T1705 |
nummod |
26,] |
R1333 |
T1705 |
T1693 |
appos |
],kinases |
R1334 |
T1706 |
T1691 |
punct |
.,are |
R1335 |
T1707 |
T1709 |
nsubjpass |
PKCs,involved |
R1336 |
T1708 |
T1709 |
auxpass |
are,involved |
R1337 |
T1709 |
T1709 |
ROOT |
involved,involved |
R1338 |
T1710 |
T1709 |
prep |
in,involved |
R1339 |
T1711 |
T1713 |
amod |
diverse,responses |
R134 |
T166 |
T169 |
amod |
dominant,constructs |
R1340 |
T1712 |
T1713 |
compound |
cell,responses |
R1341 |
T1713 |
T1710 |
pobj |
responses,in |
R1342 |
T1714 |
T1713 |
punct |
",",responses |
R1343 |
T1715 |
T1713 |
prep |
including,responses |
R1344 |
T1716 |
T1717 |
compound |
cell,growth |
R1345 |
T1717 |
T1715 |
pobj |
growth,including |
R1346 |
T1718 |
T1717 |
punct |
",",growth |
R1347 |
T1719 |
T1717 |
conj |
survival,growth |
R1348 |
T1720 |
T1719 |
punct |
",",survival |
R1349 |
T1721 |
T1719 |
conj |
differentiation,survival |
R135 |
T167 |
T169 |
amod |
negative,constructs |
R1350 |
T1722 |
T1721 |
cc |
and,differentiation |
R1351 |
T1723 |
T1721 |
conj |
development,differentiation |
R1352 |
T1724 |
T1726 |
nmod |
[,] |
R1353 |
T1725 |
T1726 |
nummod |
27,] |
R1354 |
T1726 |
T1717 |
appos |
],growth |
R1355 |
T1727 |
T1709 |
punct |
.,involved |
R1356 |
T1728 |
T1732 |
det |
The,enzymes |
R1357 |
T1729 |
T1732 |
nummod |
12,enzymes |
R1358 |
T1730 |
T1731 |
advmod |
closely,related |
R1359 |
T1731 |
T1732 |
amod |
related,enzymes |
R136 |
T168 |
T169 |
compound |
PKCα,constructs |
R1360 |
T1732 |
T1738 |
nsubjpass |
enzymes,divided |
R1361 |
T1733 |
T1732 |
prep |
of,enzymes |
R1362 |
T1734 |
T1736 |
det |
the,family |
R1363 |
T1735 |
T1736 |
compound |
PKC,family |
R1364 |
T1736 |
T1733 |
pobj |
family,of |
R1365 |
T1737 |
T1738 |
auxpass |
are,divided |
R1366 |
T1738 |
T1738 |
ROOT |
divided,divided |
R1367 |
T1739 |
T1738 |
prep |
into,divided |
R1368 |
T1740 |
T1741 |
nummod |
three,classes |
R1369 |
T1741 |
T1739 |
pobj |
classes,into |
R137 |
T169 |
T165 |
pobj |
constructs,of |
R1370 |
T1742 |
T1741 |
punct |
:,classes |
R1371 |
T1743 |
T1741 |
appos |
conventional,classes |
R1372 |
T1744 |
T1747 |
punct |
(,α |
R1373 |
T1745 |
T1747 |
dep |
cPKCs,α |
R1374 |
T1746 |
T1747 |
punct |
:,α |
R1375 |
T1747 |
T1752 |
nsubj |
α,require |
R1376 |
T1748 |
T1749 |
compound |
βI,βII |
R1377 |
T1749 |
T1752 |
nsubj |
βII,require |
R1378 |
T1750 |
T1749 |
cc |
and,βII |
R1379 |
T1751 |
T1749 |
conj |
γ,βII |
R138 |
T170 |
T169 |
cc |
and,constructs |
R1380 |
T1752 |
T1738 |
advcl |
require,divided |
R1381 |
T1753 |
T1754 |
amod |
Ca2,+ |
R1382 |
T1754 |
T1752 |
dobj |
+,require |
R1383 |
T1755 |
T1754 |
cc |
and,+ |
R1384 |
T1756 |
T1754 |
conj |
diacylglycerol,+ |
R1385 |
T1757 |
T1758 |
punct |
(,DAG |
R1386 |
T1758 |
T1756 |
appos |
DAG,diacylglycerol |
R1387 |
T1759 |
T1756 |
punct |
),diacylglycerol |
R1388 |
T1760 |
T1752 |
punct |
;,require |
R1389 |
T1761 |
T1752 |
conj |
novel,require |
R139 |
T171 |
T172 |
compound |
PKCα,siRNA |
R1390 |
T1762 |
T1765 |
punct |
(,δ |
R1391 |
T1763 |
T1765 |
dep |
nPKCs,δ |
R1392 |
T1764 |
T1765 |
punct |
:,δ |
R1393 |
T1765 |
T1761 |
appos |
δ,novel |
R13934 |
T18733 |
T18736 |
compound |
Materials,M-CSF |
R13935 |
T18734 |
T18736 |
compound |
Recombinant,M-CSF |
R13936 |
T18735 |
T18736 |
compound |
human,M-CSF |
R13937 |
T18736 |
T18738 |
nsubjpass |
M-CSF,purchased |
R13938 |
T18737 |
T18738 |
auxpass |
was,purchased |
R13939 |
T18738 |
T18738 |
ROOT |
purchased,purchased |
R1394 |
T1766 |
T1765 |
punct |
",",δ |
R13940 |
T18739 |
T18738 |
prep |
from,purchased |
R13941 |
T18740 |
T18741 |
compound |
R&D,Systems |
R13942 |
T18741 |
T18739 |
pobj |
Systems,from |
R13943 |
T18742 |
T18741 |
punct |
(,Systems |
R13944 |
T18743 |
T18741 |
appos |
Minneapolis,Systems |
R13945 |
T18744 |
T18743 |
punct |
",",Minneapolis |
R13946 |
T18745 |
T18743 |
appos |
MN,Minneapolis |
R13947 |
T18746 |
T18743 |
punct |
),Minneapolis |
R13948 |
T18747 |
T18738 |
punct |
.,purchased |
R13949 |
T18748 |
T18757 |
nsubjpass |
Ro-31-8220,obtained |
R1395 |
T1767 |
T1765 |
dep |
ε,δ |
R13950 |
T18749 |
T18748 |
punct |
",",Ro-31-8220 |
R13951 |
T18750 |
T18748 |
conj |
Gö-6976,Ro-31-8220 |
R13952 |
T18751 |
T18750 |
punct |
",",Gö-6976 |
R13953 |
T18752 |
T18750 |
conj |
Rotterin,Gö-6976 |
R13954 |
T18753 |
T18752 |
punct |
",",Rotterin |
R13955 |
T18754 |
T18752 |
cc |
and,Rotterin |
R13956 |
T18755 |
T18752 |
conj |
BAPTA/AM,Rotterin |
R13957 |
T18756 |
T18757 |
auxpass |
were,obtained |
R13958 |
T18757 |
T18757 |
ROOT |
obtained,obtained |
R13959 |
T18758 |
T18757 |
prep |
from,obtained |
R1396 |
T1768 |
T1767 |
punct |
",",ε |
R13960 |
T18759 |
T18758 |
pobj |
Calbiochem,from |
R13961 |
T18760 |
T18759 |
punct |
(,Calbiochem |
R13962 |
T18761 |
T18762 |
compound |
San,Diego |
R13963 |
T18762 |
T18759 |
appos |
Diego,Calbiochem |
R13964 |
T18763 |
T18762 |
punct |
",",Diego |
R13965 |
T18764 |
T18759 |
conj |
CA,Calbiochem |
R13966 |
T18765 |
T18757 |
punct |
),obtained |
R13967 |
T18766 |
T18757 |
punct |
.,obtained |
R13968 |
T18767 |
T18769 |
amod |
Low,RPMI |
R13969 |
T18768 |
T18769 |
compound |
endotoxin,RPMI |
R1397 |
T1769 |
T1765 |
dep |
η,δ |
R13970 |
T18769 |
T18772 |
nsubj |
RPMI,serum |
R13971 |
T18770 |
T18769 |
cc |
and,RPMI |
R13972 |
T18771 |
T18769 |
conj |
X-vivo,RPMI |
R13973 |
T18772 |
T18772 |
ROOT |
serum,serum |
R13974 |
T18773 |
T18774 |
amod |
free,medium |
R13975 |
T18774 |
T18776 |
nsubjpass |
medium,obtained |
R13976 |
T18775 |
T18776 |
auxpass |
were,obtained |
R13977 |
T18776 |
T18772 |
ccomp |
obtained,serum |
R13978 |
T18777 |
T18776 |
prep |
from,obtained |
R13979 |
T18778 |
T18780 |
compound |
Lonza,Inc |
R1398 |
T1770 |
T1769 |
punct |
",",η |
R13980 |
T18779 |
T18780 |
compound |
Walkersville,Inc |
R13981 |
T18780 |
T18777 |
pobj |
Inc,from |
R13982 |
T18781 |
T18780 |
punct |
(,Inc |
R13983 |
T18782 |
T18780 |
appos |
Walkersville,Inc |
R13984 |
T18783 |
T18782 |
punct |
",",Walkersville |
R13985 |
T18784 |
T18782 |
appos |
MD,Walkersville |
R13986 |
T18785 |
T18782 |
punct |
),Walkersville |
R13987 |
T18786 |
T18772 |
punct |
.,serum |
R13988 |
T18787 |
T18789 |
amod |
Fetal,serum |
R13989 |
T18788 |
T18789 |
amod |
bovine,serum |
R1399 |
T1771 |
T1769 |
dep |
θ,η |
R13990 |
T18789 |
T18793 |
nsubj |
serum,certified |
R13991 |
T18790 |
T18791 |
punct |
(,FBS |
R13992 |
T18791 |
T18789 |
appos |
FBS,serum |
R13993 |
T18792 |
T18789 |
punct |
",",serum |
R13994 |
T18793 |
T18793 |
ROOT |
certified,certified |
R13995 |
T18794 |
T18795 |
compound |
<,0.06 |
R13996 |
T18795 |
T18799 |
nummod |
0.06,levels |
R13997 |
T18796 |
T18799 |
nmod |
endotoxin,levels |
R13998 |
T18797 |
T18799 |
nmod |
units/ml,levels |
R13999 |
T18798 |
T18799 |
compound |
endotoxin,levels |
R140 |
T172 |
T173 |
nsubj |
siRNA,reduced |
R1400 |
T1772 |
T1771 |
cc |
and,θ |
R14000 |
T18799 |
T18793 |
dobj |
levels,certified |
R14001 |
T18800 |
T18799 |
punct |
),levels |
R14002 |
T18801 |
T18802 |
auxpass |
was,purchased |
R14003 |
T18802 |
T18793 |
conj |
purchased,certified |
R14004 |
T18803 |
T18802 |
prep |
from,purchased |
R14005 |
T18804 |
T18805 |
compound |
Atlanta,Biological |
R14006 |
T18805 |
T18803 |
pobj |
Biological,from |
R14007 |
T18806 |
T18805 |
punct |
(,Biological |
R14008 |
T18807 |
T18805 |
appos |
Lawrenceville,Biological |
R14009 |
T18808 |
T18807 |
punct |
",",Lawrenceville |
R1401 |
T1773 |
T1771 |
conj |
μ,θ |
R14010 |
T18809 |
T18807 |
conj |
GA,Lawrenceville |
R14011 |
T18810 |
T18805 |
punct |
),Biological |
R14012 |
T18811 |
T18793 |
punct |
.,certified |
R14013 |
T18812 |
T18816 |
det |
All,reagents |
R14014 |
T18813 |
T18816 |
amod |
other,reagents |
R14015 |
T18814 |
T18815 |
compound |
cell,culture |
R14016 |
T18815 |
T18816 |
compound |
culture,reagents |
R14017 |
T18816 |
T18818 |
nsubjpass |
reagents,obtained |
R14018 |
T18817 |
T18818 |
auxpass |
were,obtained |
R14019 |
T18818 |
T18818 |
ROOT |
obtained,obtained |
R1402 |
T1774 |
T1773 |
punct |
),μ |
R14020 |
T18819 |
T18818 |
prep |
through,obtained |
R14021 |
T18820 |
T18819 |
pobj |
Invitrogen,through |
R14022 |
T18821 |
T18820 |
punct |
(,Invitrogen |
R14023 |
T18822 |
T18820 |
appos |
Carlsbad,Invitrogen |
R14024 |
T18823 |
T18822 |
punct |
",",Carlsbad |
R14025 |
T18824 |
T18820 |
conj |
CA,Invitrogen |
R14026 |
T18825 |
T18820 |
punct |
),Invitrogen |
R14027 |
T18826 |
T18818 |
punct |
.,obtained |
R14028 |
T18827 |
T18829 |
compound |
PKCα,p65 |
R14029 |
T18828 |
T18829 |
compound |
NF-κB,p65 |
R1403 |
T1775 |
T1765 |
dep |
require,δ |
R14030 |
T18829 |
T18851 |
nsubjpass |
p65,obtained |
R14031 |
T18830 |
T18829 |
punct |
",",p65 |
R14032 |
T18831 |
T18832 |
compound |
Lamin,B |
R14033 |
T18832 |
T18829 |
appos |
B,p65 |
R14034 |
T18833 |
T18832 |
punct |
",",B |
R14035 |
T18834 |
T18832 |
appos |
β-actin,B |
R14036 |
T18835 |
T18832 |
punct |
",",B |
R14037 |
T18836 |
T18832 |
cc |
and,B |
R14038 |
T18837 |
T18832 |
conj |
GAPDH,B |
R14039 |
T18838 |
T18832 |
appos |
antibodies,B |
R1404 |
T1776 |
T1775 |
dobj |
DAG,require |
R14040 |
T18839 |
T18838 |
punct |
",",antibodies |
R14041 |
T18840 |
T18838 |
conj |
anti-mouse,antibodies |
R14042 |
T18841 |
T18840 |
cc |
and,anti-mouse |
R14043 |
T18842 |
T18840 |
conj |
rabbit,anti-mouse |
R14044 |
T18843 |
T18845 |
amod |
IgG-HRP,antibodies |
R14045 |
T18844 |
T18845 |
amod |
conjugated,antibodies |
R14046 |
T18845 |
T18840 |
conj |
antibodies,anti-mouse |
R14047 |
T18846 |
T18845 |
punct |
",",antibodies |
R14048 |
T18847 |
T18840 |
cc |
and,anti-mouse |
R14049 |
T18848 |
T18849 |
compound |
PKCα,siRNA |
R1405 |
T1777 |
T1765 |
punct |
;,δ |
R14050 |
T18849 |
T18832 |
appos |
siRNA,B |
R14051 |
T18850 |
T18851 |
auxpass |
were,obtained |
R14052 |
T18851 |
T18851 |
ROOT |
obtained,obtained |
R14053 |
T18852 |
T18851 |
prep |
from,obtained |
R14054 |
T18853 |
T18855 |
compound |
Santa,Biotechnology |
R14055 |
T18854 |
T18855 |
compound |
Cruz,Biotechnology |
R14056 |
T18855 |
T18852 |
pobj |
Biotechnology,from |
R14057 |
T18856 |
T18855 |
punct |
(,Biotechnology |
R14058 |
T18857 |
T18858 |
compound |
Santa,Cruz |
R14059 |
T18858 |
T18855 |
appos |
Cruz,Biotechnology |
R1406 |
T1778 |
T1765 |
cc |
and,δ |
R14060 |
T18859 |
T18855 |
punct |
",",Biotechnology |
R14061 |
T18860 |
T18855 |
appos |
CA,Biotechnology |
R14062 |
T18861 |
T18855 |
punct |
),Biotechnology |
R14063 |
T18862 |
T18851 |
punct |
.,obtained |
R14064 |
T18863 |
T18864 |
compound |
Phospho-NFκB,p65 |
R14065 |
T18864 |
T18872 |
nsubjpass |
p65,purchased |
R14066 |
T18865 |
T18864 |
punct |
(,p65 |
R14067 |
T18866 |
T18864 |
appos |
Ser276,p65 |
R14068 |
T18867 |
T18866 |
cc |
or,Ser276 |
R14069 |
T18868 |
T18866 |
conj |
Ser536,Ser276 |
R1407 |
T1843 |
T1844 |
compound |
TNFα,mRNA |
R14070 |
T18869 |
T18864 |
punct |
),p65 |
R14071 |
T18870 |
T18864 |
conj |
antibodies,p65 |
R14072 |
T18871 |
T18872 |
auxpass |
were,purchased |
R14073 |
T18872 |
T18872 |
ROOT |
purchased,purchased |
R14074 |
T18873 |
T18872 |
prep |
from,purchased |
R14075 |
T18874 |
T18876 |
compound |
Cell,Technology |
R14076 |
T18875 |
T18876 |
compound |
Signaling,Technology |
R14077 |
T18876 |
T18873 |
pobj |
Technology,from |
R14078 |
T18877 |
T18880 |
punct |
(,MA |
R14079 |
T18878 |
T18880 |
npadvmod |
Danvers,MA |
R1408 |
T1779 |
T1765 |
conj |
atypical,δ |
R14080 |
T18879 |
T18880 |
punct |
",",MA |
R14081 |
T18880 |
T18876 |
appos |
MA,Technology |
R14082 |
T18881 |
T18880 |
punct |
),MA |
R14083 |
T18882 |
T18872 |
punct |
.,purchased |
R14084 |
T18883 |
T18884 |
nsubj |
DNA,constructs |
R14085 |
T18884 |
T18884 |
ROOT |
constructs,constructs |
R14086 |
T18885 |
T18884 |
dobj |
pTAL-SEAP,constructs |
R14087 |
T18886 |
T18885 |
cc |
and,pTAL-SEAP |
R14088 |
T18887 |
T18885 |
conj |
pNF-κB-SEAP,pTAL-SEAP |
R14089 |
T18888 |
T18889 |
auxpass |
were,obtained |
R1409 |
T1780 |
T1789 |
punct |
(,require |
R14090 |
T18889 |
T18884 |
conj |
obtained,constructs |
R14091 |
T18890 |
T18889 |
prep |
from,obtained |
R14092 |
T18891 |
T18890 |
pobj |
Clontech,from |
R14093 |
T18892 |
T18891 |
punct |
(,Clontech |
R14094 |
T18893 |
T18894 |
compound |
Mountian,View |
R14095 |
T18894 |
T18891 |
appos |
View,Clontech |
R14096 |
T18895 |
T18894 |
punct |
",",View |
R14097 |
T18896 |
T18894 |
npadvmod |
CA,View |
R14098 |
T18897 |
T18891 |
punct |
),Clontech |
R14099 |
T18898 |
T18884 |
punct |
.,constructs |
R141 |
T173 |
T173 |
ROOT |
reduced,reduced |
R1410 |
T1844 |
T1841 |
conj |
mRNA,iNOS |
R14100 |
T18899 |
T18900 |
compound |
Expression,vectors |
R14101 |
T18900 |
T18911 |
nsubjpass |
vectors,cloned |
R14102 |
T18901 |
T18900 |
acl |
containing,vectors |
R14103 |
T18902 |
T18903 |
compound |
CMV-p65,WT |
R14104 |
T18903 |
T18901 |
dobj |
WT,containing |
R14105 |
T18904 |
T18903 |
punct |
",",WT |
R14106 |
T18905 |
T18906 |
compound |
CMV-p65,276S/A |
R14107 |
T18906 |
T18903 |
conj |
276S/A,WT |
R14108 |
T18907 |
T18906 |
cc |
and,276S/A |
R14109 |
T18908 |
T18909 |
compound |
CMV-p65,536S/A |
R1411 |
T1781 |
T1789 |
nsubj |
aPKCs,require |
R14110 |
T18909 |
T18906 |
conj |
536S/A,276S/A |
R14111 |
T18910 |
T18911 |
auxpass |
were,cloned |
R14112 |
T18911 |
T18911 |
ROOT |
cloned,cloned |
R14113 |
T18912 |
T18911 |
prep |
in,cloned |
R14114 |
T18913 |
T18915 |
compound |
pBa5e,vector |
R14115 |
T18914 |
T18915 |
compound |
Puro,vector |
R14116 |
T18915 |
T18912 |
pobj |
vector,in |
R14117 |
T18916 |
T18915 |
cc |
or,vector |
R14118 |
T18917 |
T18918 |
compound |
pFLAG-CMV-2,vector |
R14119 |
T18918 |
T18915 |
conj |
vector,vector |
R1412 |
T1845 |
T1838 |
dobj |
production,induces |
R14120 |
T18919 |
T18920 |
mark |
as,described |
R14121 |
T18920 |
T18911 |
advcl |
described,cloned |
R14122 |
T18921 |
T18924 |
advmod |
previously,] |
R14123 |
T18922 |
T18924 |
nmod |
[,] |
R14124 |
T18923 |
T18924 |
nummod |
49,] |
R14125 |
T18924 |
T18920 |
dobj |
],described |
R14126 |
T18925 |
T18911 |
punct |
.,cloned |
R14127 |
T18926 |
T18939 |
nsubj |
Kinase,were |
R14128 |
T18927 |
T18939 |
advmod |
deficient,were |
R14129 |
T18928 |
T18935 |
nmod |
CMV-PKCα,pCMV-PKCα |
R1413 |
T1846 |
T1838 |
prep |
after,induces |
R14130 |
T18929 |
T18930 |
punct |
(,KD-PKCα |
R14131 |
T18930 |
T18928 |
appos |
KD-PKCα,CMV-PKCα |
R14132 |
T18931 |
T18930 |
punct |
),KD-PKCα |
R14133 |
T18932 |
T18928 |
cc |
or,CMV-PKCα |
R14134 |
T18933 |
T18934 |
amod |
wild,type |
R14135 |
T18934 |
T18935 |
compound |
type,pCMV-PKCα |
R14136 |
T18935 |
T18939 |
nsubj |
pCMV-PKCα,were |
R14137 |
T18936 |
T18935 |
punct |
(,pCMV-PKCα |
R14138 |
T18937 |
T18935 |
appos |
WT-PKCα,pCMV-PKCα |
R14139 |
T18938 |
T18935 |
punct |
),pCMV-PKCα |
R1414 |
T1847 |
T1854 |
nmod |
lipopolysaccharide,] |
R14140 |
T18939 |
T18939 |
ROOT |
were,were |
R14141 |
T18940 |
T18941 |
amod |
generous,gifts |
R14142 |
T18941 |
T18939 |
attr |
gifts,were |
R14143 |
T18942 |
T18941 |
prep |
from,gifts |
R14144 |
T18943 |
T18945 |
compound |
Alexandra,Newton |
R14145 |
T18944 |
T18945 |
compound |
C.,Newton |
R14146 |
T18945 |
T18942 |
pobj |
Newton,from |
R14147 |
T18946 |
T18945 |
punct |
(,Newton |
R14148 |
T18947 |
T18945 |
appos |
University,Newton |
R14149 |
T18948 |
T18947 |
prep |
of,University |
R1415 |
T1782 |
T1783 |
punct |
:,ξ |
R14150 |
T18949 |
T18948 |
pobj |
California,of |
R14151 |
T18950 |
T18945 |
punct |
",",Newton |
R14152 |
T18951 |
T18952 |
compound |
San,Diego |
R14153 |
T18952 |
T18945 |
npadvmod |
Diego,Newton |
R14154 |
T18953 |
T18952 |
punct |
",",Diego |
R14155 |
T18954 |
T18952 |
appos |
CA,Diego |
R14156 |
T18955 |
T18945 |
punct |
),Newton |
R14157 |
T18956 |
T18939 |
punct |
.,were |
R14158 |
T18957 |
T18968 |
nsubjpass |
IκBα,obtained |
R14159 |
T18958 |
T18959 |
punct |
(,NFKBIA |
R1416 |
T1848 |
T1849 |
punct |
(,LPS |
R14160 |
T18959 |
T18957 |
appos |
NFKBIA,IκBα |
R14161 |
T18960 |
T18959 |
punct |
),NFKBIA |
R14162 |
T18961 |
T18957 |
cc |
and,IκBα |
R14163 |
T18962 |
T18957 |
conj |
GAPDH,IκBα |
R14164 |
T18963 |
T18968 |
nsubjpass |
primers,obtained |
R14165 |
T18964 |
T18963 |
prep |
for,primers |
R14166 |
T18965 |
T18966 |
amod |
real-time,RT-PCR |
R14167 |
T18966 |
T18964 |
pobj |
RT-PCR,for |
R14168 |
T18967 |
T18968 |
auxpass |
were,obtained |
R14169 |
T18968 |
T18968 |
ROOT |
obtained,obtained |
R1417 |
T1849 |
T1847 |
appos |
LPS,lipopolysaccharide |
R14170 |
T18969 |
T18968 |
prep |
from,obtained |
R14171 |
T18970 |
T18969 |
pobj |
SABiosciences,from |
R14172 |
T18971 |
T18970 |
punct |
(,SABiosciences |
R14173 |
T18972 |
T18970 |
appos |
Frederick,SABiosciences |
R14174 |
T18973 |
T18972 |
punct |
",",Frederick |
R14175 |
T18974 |
T18972 |
conj |
MD,Frederick |
R14176 |
T18975 |
T18972 |
punct |
),Frederick |
R14177 |
T18976 |
T18968 |
punct |
.,obtained |
R14178 |
T18977 |
T18978 |
det |
A,pool |
R14179 |
T18978 |
T18987 |
nsubjpass |
pool,purchased |
R1418 |
T1850 |
T1849 |
punct |
),LPS |
R14180 |
T18979 |
T18978 |
prep |
of,pool |
R14181 |
T18980 |
T18979 |
pobj |
mouse,of |
R14182 |
T18981 |
T18980 |
cc |
or,mouse |
R14183 |
T18982 |
T18985 |
amod |
human,siRNA |
R14184 |
T18983 |
T18985 |
compound |
PKCα,siRNA |
R14185 |
T18984 |
T18985 |
amod |
specific,siRNA |
R14186 |
T18985 |
T18978 |
appos |
siRNA,pool |
R14187 |
T18986 |
T18987 |
auxpass |
were,purchased |
R14188 |
T18987 |
T18987 |
ROOT |
purchased,purchased |
R14189 |
T18988 |
T18987 |
prep |
from,purchased |
R1419 |
T1851 |
T1847 |
conj |
exposure,lipopolysaccharide |
R14190 |
T18989 |
T18991 |
compound |
Santa,Biotechnology |
R14191 |
T18990 |
T18991 |
compound |
Cruz,Biotechnology |
R14192 |
T18991 |
T18988 |
pobj |
Biotechnology,from |
R14193 |
T18992 |
T18991 |
punct |
(,Biotechnology |
R14194 |
T18993 |
T18994 |
compound |
Santa,cruz |
R14195 |
T18994 |
T18991 |
appos |
cruz,Biotechnology |
R14196 |
T18995 |
T18991 |
punct |
",",Biotechnology |
R14197 |
T18996 |
T18991 |
appos |
CA,Biotechnology |
R14198 |
T18997 |
T18987 |
punct |
),purchased |
R14199 |
T18998 |
T18987 |
punct |
.,purchased |
R142 |
T174 |
T175 |
amod |
NF-κB,activity |
R1420 |
T1852 |
T1854 |
nmod |
[,] |
R1421 |
T1783 |
T1789 |
nsubj |
ξ,require |
R1422 |
T1784 |
T1783 |
punct |
",",ξ |
R1423 |
T1853 |
T1854 |
nummod |
29,] |
R1424 |
T1785 |
T1783 |
dep |
ι,ξ |
R1425 |
T1854 |
T1846 |
pobj |
],after |
R1426 |
T1855 |
T1838 |
punct |
.,induces |
R1427 |
T1856 |
T1861 |
prep |
In,suggests |
R1428 |
T1786 |
T1785 |
cc |
and,ι |
R1429 |
T1857 |
T1856 |
pobj |
addition,In |
R143 |
T175 |
T173 |
dobj |
activity,reduced |
R1430 |
T1858 |
T1861 |
punct |
",",suggests |
R1431 |
T1787 |
T1785 |
conj |
λ,ι |
R1432 |
T1859 |
T1860 |
amod |
accumulating,evidence |
R1433 |
T1860 |
T1861 |
nsubj |
evidence,suggests |
R1434 |
T1861 |
T1861 |
ROOT |
suggests,suggests |
R1435 |
T1788 |
T1787 |
punct |
),λ |
R1436 |
T1862 |
T1867 |
mark |
that,have |
R1437 |
T1863 |
T1864 |
amod |
conventional,PKCs |
R1438 |
T1864 |
T1867 |
nsubj |
PKCs,have |
R1439 |
T1789 |
T1779 |
parataxis |
require,atypical |
R144 |
T176 |
T173 |
prep |
in,reduced |
R1440 |
T1865 |
T1864 |
prep |
like,PKCs |
R1441 |
T1866 |
T1865 |
pobj |
PKCα,like |
R1442 |
T1867 |
T1861 |
ccomp |
have,suggests |
R1443 |
T1790 |
T1791 |
preconj |
neither,Ca2 |
R1444 |
T1868 |
T1869 |
amod |
anti-apoptotic,functions |
R1445 |
T1869 |
T1867 |
dobj |
functions,have |
R1446 |
T1870 |
T1861 |
punct |
.,suggests |
R1447 |
T1791 |
T1792 |
intj |
Ca2,+ |
R14477 |
T19447 |
T19448 |
amod |
Cell,Culture |
R14478 |
T19448 |
T19457 |
nsubjpass |
Culture,purchased |
R14479 |
T19449 |
T19454 |
det |
The,RAW |
R1448 |
T1871 |
T1876 |
prep |
For,overexpressed |
R14480 |
T19450 |
T19453 |
amod |
murine,line |
R14481 |
T19451 |
T19453 |
compound |
macrophage,line |
R14482 |
T19452 |
T19453 |
compound |
cell,line |
R14483 |
T19453 |
T19454 |
compound |
line,RAW |
R14484 |
T19454 |
T19448 |
appos |
RAW,Culture |
R14485 |
T19455 |
T19454 |
nummod |
264.7,RAW |
R14486 |
T19456 |
T19457 |
auxpass |
was,purchased |
R14487 |
T19457 |
T19457 |
ROOT |
purchased,purchased |
R14488 |
T19458 |
T19457 |
prep |
from,purchased |
R14489 |
T19459 |
T19458 |
pobj |
ATCC,from |
R1449 |
T1792 |
T1789 |
dobj |
+,require |
R14490 |
T19460 |
T19459 |
punct |
(,ATCC |
R14491 |
T19461 |
T19459 |
appos |
Manassas,ATCC |
R14492 |
T19462 |
T19459 |
punct |
",",ATCC |
R14493 |
T19463 |
T19459 |
appos |
VA,ATCC |
R14494 |
T19464 |
T19459 |
punct |
),ATCC |
R14495 |
T19465 |
T19457 |
punct |
.,purchased |
R14496 |
T19466 |
T19470 |
nsubjpass |
RAW,maintained |
R14497 |
T19467 |
T19468 |
nummod |
264.7,cells |
R14498 |
T19468 |
T19470 |
nsubjpass |
cells,maintained |
R14499 |
T19469 |
T19470 |
auxpass |
were,maintained |
R145 |
T177 |
T176 |
pobj |
response,in |
R1450 |
T1872 |
T1871 |
pobj |
example,For |
R14500 |
T19470 |
T19470 |
ROOT |
maintained,maintained |
R14501 |
T19471 |
T19470 |
prep |
in,maintained |
R14502 |
T19472 |
T19471 |
pobj |
RPMI,in |
R14503 |
T19473 |
T19470 |
conj |
supplemented,maintained |
R14504 |
T19474 |
T19473 |
prep |
with,supplemented |
R14505 |
T19475 |
T19476 |
nummod |
5,% |
R14506 |
T19476 |
T19490 |
nmod |
%,sulfate |
R14507 |
T19477 |
T19490 |
nmod |
FBS,sulfate |
R14508 |
T19478 |
T19477 |
cc |
and,FBS |
R14509 |
T19479 |
T19477 |
conj |
antibiotic-antimycotic,FBS |
R1451 |
T1873 |
T1876 |
punct |
",",overexpressed |
R14510 |
T19480 |
T19483 |
punct |
(,penicillin |
R14511 |
T19481 |
T19483 |
nummod |
1000,penicillin |
R14512 |
T19482 |
T19483 |
compound |
U/ml,penicillin |
R14513 |
T19483 |
T19490 |
nmod |
penicillin,sulfate |
R14514 |
T19484 |
T19483 |
punct |
",",penicillin |
R14515 |
T19485 |
T19486 |
nummod |
1000,µg |
R14516 |
T19486 |
T19490 |
compound |
µg,sulfate |
R14517 |
T19487 |
T19490 |
nmod |
/,sulfate |
R14518 |
T19488 |
T19490 |
compound |
ml,sulfate |
R14519 |
T19489 |
T19490 |
compound |
streptomycin,sulfate |
R1452 |
T1874 |
T1875 |
nsubj |
PKCα,is |
R14520 |
T19490 |
T19474 |
pobj |
sulfate,with |
R14521 |
T19491 |
T19473 |
punct |
",",supplemented |
R14522 |
T19492 |
T19473 |
cc |
and,supplemented |
R14523 |
T19493 |
T19496 |
nummod |
250,B |
R14524 |
T19494 |
T19496 |
compound |
ng/ml,B |
R14525 |
T19495 |
T19496 |
compound |
amphotericin,B |
R14526 |
T19496 |
T19470 |
npadvmod |
B,maintained |
R14527 |
T19497 |
T19496 |
punct |
),B |
R14528 |
T19498 |
T19470 |
prep |
at,maintained |
R14529 |
T19499 |
T19500 |
nummod |
37,° |
R1453 |
T1875 |
T1876 |
auxpass |
is,overexpressed |
R14530 |
T19500 |
T19504 |
nummod |
°,fibroblasts |
R14531 |
T19501 |
T19502 |
compound |
C.,Mouse |
R14532 |
T19502 |
T19504 |
nmod |
Mouse,fibroblasts |
R14533 |
T19503 |
T19504 |
amod |
embryonic,fibroblasts |
R14534 |
T19504 |
T19498 |
pobj |
fibroblasts,at |
R14535 |
T19505 |
T19504 |
punct |
(,fibroblasts |
R14536 |
T19506 |
T19504 |
appos |
MEFs,fibroblasts |
R14537 |
T19507 |
T19504 |
punct |
),fibroblasts |
R14538 |
T19508 |
T19509 |
compound |
cell,line |
R14539 |
T19509 |
T19470 |
conj |
line,maintained |
R1454 |
T1876 |
T1876 |
ROOT |
overexpressed,overexpressed |
R14540 |
T19510 |
T19509 |
acl |
lacking,line |
R14541 |
T19511 |
T19514 |
amod |
specific,subunits |
R14542 |
T19512 |
T19514 |
nmod |
NFκB,subunits |
R14543 |
T19513 |
T19514 |
nsubj |
signaling,subunits |
R14544 |
T19514 |
T19510 |
dobj |
subunits,lacking |
R14545 |
T19515 |
T19516 |
compound |
NF-κB,p65 |
R14546 |
T19516 |
T19514 |
appos |
p65,subunits |
R14547 |
T19517 |
T19516 |
punct |
(,p65 |
R14548 |
T19518 |
T19519 |
nummod |
p65,− |
R14549 |
T19519 |
T19520 |
nummod |
−,/ |
R1455 |
T1877 |
T1876 |
prep |
in,overexpressed |
R14550 |
T19520 |
T19523 |
nmod |
/,line |
R14551 |
T19521 |
T19523 |
compound |
−,line |
R14552 |
T19522 |
T19523 |
compound |
cell,line |
R14553 |
T19523 |
T19516 |
appos |
line,p65 |
R14554 |
T19524 |
T19514 |
punct |
),subunits |
R14555 |
T19525 |
T19527 |
nmod |
[,] |
R14556 |
T19526 |
T19527 |
nummod |
50,] |
R14557 |
T19527 |
T19529 |
nsubjpass |
],cultured |
R14558 |
T19528 |
T19529 |
auxpass |
were,cultured |
R14559 |
T19529 |
T19529 |
ROOT |
cultured,cultured |
R1456 |
T1793 |
T1792 |
cc |
nor,+ |
R14560 |
T19530 |
T19529 |
prep |
in,cultured |
R14561 |
T19531 |
T19532 |
compound |
DMEM,medium |
R14562 |
T19532 |
T19530 |
pobj |
medium,in |
R14563 |
T19533 |
T19529 |
conj |
supplemented,cultured |
R14564 |
T19534 |
T19533 |
prep |
with,supplemented |
R14565 |
T19535 |
T19536 |
nummod |
10,% |
R14566 |
T19536 |
T19540 |
nmod |
%,solution |
R14567 |
T19537 |
T19540 |
nmod |
FBS,solution |
R14568 |
T19538 |
T19537 |
cc |
and,FBS |
R14569 |
T19539 |
T19540 |
amod |
antibiotic-antimycotic,solution |
R1457 |
T1878 |
T1879 |
det |
a,variety |
R14570 |
T19540 |
T19534 |
pobj |
solution,with |
R14571 |
T19541 |
T19529 |
punct |
.,cultured |
R1458 |
T1879 |
T1877 |
pobj |
variety,in |
R1459 |
T1880 |
T1879 |
prep |
of,variety |
R146 |
T178 |
T177 |
prep |
to,response |
R1460 |
T1881 |
T1882 |
compound |
tumor,cells |
R1461 |
T1794 |
T1792 |
conj |
DAG,+ |
R1462 |
T1882 |
T1880 |
pobj |
cells,of |
R1463 |
T1883 |
T1882 |
prep |
including,cells |
R1464 |
T1795 |
T1789 |
punct |
.,require |
R1465 |
T1884 |
T1883 |
pobj |
gliomas,including |
R14658 |
T19666 |
T19679 |
nsubjpass |
Purification,isolated |
R14659 |
T19667 |
T19666 |
prep |
of,Purification |
R1466 |
T1885 |
T1884 |
punct |
",",gliomas |
R14660 |
T19668 |
T19669 |
compound |
Peripheral,Blood |
R14661 |
T19669 |
T19670 |
compound |
Blood,Monocytes |
R14662 |
T19670 |
T19667 |
pobj |
Monocytes,of |
R14663 |
T19671 |
T19670 |
cc |
and,Monocytes |
R14664 |
T19672 |
T19673 |
compound |
Monocyte-Derived,Macrophages |
R14665 |
T19673 |
T19670 |
conj |
Macrophages,Monocytes |
R14666 |
T19674 |
T19673 |
punct |
(,Macrophages |
R14667 |
T19675 |
T19673 |
appos |
MDMs,Macrophages |
R14668 |
T19676 |
T19673 |
punct |
),Macrophages |
R14669 |
T19677 |
T19670 |
conj |
Monocytes,Monocytes |
R1467 |
T1886 |
T1884 |
conj |
liver,gliomas |
R14670 |
T19678 |
T19679 |
auxpass |
were,isolated |
R14671 |
T19679 |
T19679 |
ROOT |
isolated,isolated |
R14672 |
T19680 |
T19679 |
prep |
from,isolated |
R14673 |
T19681 |
T19683 |
compound |
source,packs |
R14674 |
T19682 |
T19683 |
compound |
leukocyte,packs |
R14675 |
T19683 |
T19680 |
pobj |
packs,from |
R14676 |
T19684 |
T19683 |
acl |
obtained,packs |
R14677 |
T19685 |
T19684 |
prep |
from,obtained |
R14678 |
T19686 |
T19689 |
det |
the,Cross |
R14679 |
T19687 |
T19689 |
compound |
American,Cross |
R1468 |
T1887 |
T1886 |
punct |
",",liver |
R14680 |
T19688 |
T19689 |
compound |
Red,Cross |
R14681 |
T19689 |
T19685 |
pobj |
Cross,from |
R14682 |
T19690 |
T19691 |
mark |
as,described |
R14683 |
T19691 |
T19683 |
advcl |
described,packs |
R14684 |
T19692 |
T19693 |
advmod |
previously,[ |
R14685 |
T19693 |
T19695 |
quantmod |
[,] |
R14686 |
T19694 |
T19695 |
nummod |
51,] |
R14687 |
T19695 |
T19683 |
appos |
],packs |
R14688 |
T19696 |
T19679 |
punct |
.,isolated |
R14689 |
T19697 |
T19708 |
nsubjpass |
Monocytes,purified |
R1469 |
T1888 |
T1886 |
cc |
and,liver |
R14690 |
T19698 |
T19697 |
acl |
used,Monocytes |
R14691 |
T19699 |
T19698 |
prep |
in,used |
R14692 |
T19700 |
T19701 |
amod |
real,time |
R14693 |
T19701 |
T19703 |
compound |
time,experiments |
R14694 |
T19702 |
T19703 |
compound |
PCR,experiments |
R14695 |
T19703 |
T19699 |
pobj |
experiments,in |
R14696 |
T19704 |
T19703 |
cc |
and,experiments |
R14697 |
T19705 |
T19706 |
compound |
transfection,experiments |
R14698 |
T19706 |
T19703 |
conj |
experiments,experiments |
R14699 |
T19707 |
T19708 |
auxpass |
were,purified |
R147 |
T179 |
T178 |
pobj |
M-CSF,to |
R1470 |
T1889 |
T1886 |
conj |
lung,liver |
R14700 |
T19708 |
T19708 |
ROOT |
purified,purified |
R14701 |
T19709 |
T19708 |
agent |
by,purified |
R14702 |
T19710 |
T19711 |
amod |
positive,selection |
R14703 |
T19711 |
T19709 |
pobj |
selection,by |
R14704 |
T19712 |
T19708 |
advcl |
using,purified |
R14705 |
T19713 |
T19716 |
compound |
CD14,Kit |
R14706 |
T19714 |
T19716 |
compound |
Monocyte,Kit |
R14707 |
T19715 |
T19716 |
compound |
Isolation,Kit |
R14708 |
T19716 |
T19712 |
dobj |
Kit,using |
R14709 |
T19717 |
T19712 |
prep |
from,using |
R1471 |
T1890 |
T1892 |
nmod |
[,] |
R14710 |
T19718 |
T19719 |
compound |
Miltenyi,Biotech |
R14711 |
T19719 |
T19717 |
pobj |
Biotech,from |
R14712 |
T19720 |
T19719 |
punct |
(,Biotech |
R14713 |
T19721 |
T19719 |
appos |
Auburn,Biotech |
R14714 |
T19722 |
T19721 |
punct |
",",Auburn |
R14715 |
T19723 |
T19721 |
appos |
CA,Auburn |
R14716 |
T19724 |
T19719 |
punct |
),Biotech |
R14717 |
T19725 |
T19719 |
punct |
(,Biotech |
R14718 |
T19726 |
T19729 |
advmod |
>,pure |
R14719 |
T19727 |
T19728 |
nummod |
90,% |
R1472 |
T1796 |
T1800 |
nsubj |
Monocytes,express |
R14720 |
T19728 |
T19729 |
nsubj |
%,pure |
R14721 |
T19729 |
T19712 |
advcl |
pure,using |
R14722 |
T19730 |
T19729 |
punct |
),pure |
R14723 |
T19731 |
T19708 |
punct |
.,purified |
R14724 |
T19732 |
T19738 |
prep |
In,isolated |
R14725 |
T19733 |
T19734 |
det |
some,experiments |
R14726 |
T19734 |
T19732 |
pobj |
experiments,In |
R14727 |
T19735 |
T19738 |
punct |
",",isolated |
R14728 |
T19736 |
T19738 |
nsubjpass |
monocytes,isolated |
R14729 |
T19737 |
T19738 |
auxpass |
were,isolated |
R1473 |
T1891 |
T1892 |
nummod |
30,] |
R14730 |
T19738 |
T19738 |
ROOT |
isolated,isolated |
R14731 |
T19739 |
T19738 |
prep |
by,isolated |
R14732 |
T19740 |
T19741 |
amod |
clumping,method |
R14733 |
T19741 |
T19739 |
pobj |
method,by |
R14734 |
T19742 |
T19745 |
punct |
(,pure |
R14735 |
T19743 |
T19744 |
nummod |
70,% |
R14736 |
T19744 |
T19745 |
npadvmod |
%,pure |
R14737 |
T19745 |
T19741 |
appos |
pure,method |
R14738 |
T19746 |
T19745 |
punct |
),pure |
R14739 |
T19747 |
T19738 |
punct |
.,isolated |
R1474 |
T1892 |
T1883 |
pobj |
],including |
R14740 |
T19748 |
T19749 |
aux |
To,obtain |
R14741 |
T19749 |
T19758 |
advcl |
obtain,cultured |
R14742 |
T19750 |
T19751 |
amod |
monocyte-derived,macrophages |
R14743 |
T19751 |
T19749 |
dobj |
macrophages,obtain |
R14744 |
T19752 |
T19751 |
punct |
(,macrophages |
R14745 |
T19753 |
T19751 |
appos |
MDMs,macrophages |
R14746 |
T19754 |
T19751 |
punct |
),macrophages |
R14747 |
T19755 |
T19758 |
punct |
",",cultured |
R14748 |
T19756 |
T19758 |
nsubjpass |
monocytes,cultured |
R14749 |
T19757 |
T19758 |
auxpass |
were,cultured |
R1475 |
T1893 |
T1892 |
punct |
",",] |
R14750 |
T19758 |
T19758 |
ROOT |
cultured,cultured |
R14751 |
T19759 |
T19758 |
prep |
in,cultured |
R14752 |
T19760 |
T19761 |
compound |
RPMI-1640,medium |
R14753 |
T19761 |
T19759 |
pobj |
medium,in |
R14754 |
T19762 |
T19761 |
acl |
containing,medium |
R14755 |
T19763 |
T19764 |
nummod |
10,% |
R14756 |
T19764 |
T19765 |
compound |
%,FBS |
R14757 |
T19765 |
T19762 |
dobj |
FBS,containing |
R14758 |
T19766 |
T19765 |
punct |
",",FBS |
R14759 |
T19767 |
T19765 |
cc |
and,FBS |
R1476 |
T1797 |
T1796 |
cc |
and,Monocytes |
R14760 |
T19768 |
T19773 |
nummod |
10,B |
R14761 |
T19769 |
T19773 |
compound |
µg,B |
R14762 |
T19770 |
T19773 |
compound |
/,B |
R14763 |
T19771 |
T19773 |
compound |
ml,B |
R14764 |
T19772 |
T19773 |
compound |
polymyxin,B |
R14765 |
T19773 |
T19765 |
conj |
B,FBS |
R14766 |
T19774 |
T19773 |
cc |
and,B |
R14767 |
T19775 |
T19777 |
nummod |
20,M-CSF |
R14768 |
T19776 |
T19777 |
amod |
ng/ml,M-CSF |
R14769 |
T19777 |
T19773 |
conj |
M-CSF,B |
R1477 |
T1894 |
T1896 |
nmod |
[,] |
R14770 |
T19778 |
T19758 |
punct |
.,cultured |
R1478 |
T1895 |
T1896 |
nummod |
31,] |
R1479 |
T1896 |
T1892 |
conj |
],] |
R148 |
T180 |
T173 |
punct |
.,reduced |
R1480 |
T1798 |
T1796 |
conj |
macrophages,Monocytes |
R1481 |
T1897 |
T1876 |
punct |
.,overexpressed |
R1482 |
T1898 |
T1905 |
prep |
In,induces |
R1483 |
T1799 |
T1800 |
advmod |
predominantly,express |
R1484 |
T1899 |
T1900 |
amod |
epithelial,cells |
R1485 |
T1900 |
T1898 |
pobj |
cells,In |
R1486 |
T1901 |
T1905 |
punct |
",",induces |
R1487 |
T1800 |
T1800 |
ROOT |
express,express |
R14878 |
T19917 |
T19927 |
nmod |
Electrophoresis,extracts |
R14879 |
T19918 |
T19917 |
prep |
of,Electrophoresis |
R1488 |
T1902 |
T1905 |
nsubj |
inhibition,induces |
R14880 |
T19919 |
T19922 |
det |
the,Analysis |
R14881 |
T19920 |
T19922 |
compound |
Mobility,Analysis |
R14882 |
T19921 |
T19922 |
compound |
Shift,Analysis |
R14883 |
T19922 |
T19918 |
pobj |
Analysis,of |
R14884 |
T19923 |
T19922 |
punct |
(,Analysis |
R14885 |
T19924 |
T19922 |
appos |
EMSA,Analysis |
R14886 |
T19925 |
T19922 |
punct |
),Analysis |
R14887 |
T19926 |
T19927 |
compound |
Nuclear,extracts |
R14888 |
T19927 |
T19929 |
nsubjpass |
extracts,isolated |
R14889 |
T19928 |
T19929 |
auxpass |
were,isolated |
R1489 |
T1903 |
T1902 |
prep |
of,inhibition |
R14890 |
T19929 |
T19929 |
ROOT |
isolated,isolated |
R14891 |
T19930 |
T19929 |
prep |
from,isolated |
R14892 |
T19931 |
T19930 |
pobj |
MDMs,from |
R14893 |
T19932 |
T19929 |
prep |
by,isolated |
R14894 |
T19933 |
T19932 |
pcomp |
using,by |
R14895 |
T19934 |
T19937 |
det |
a,kit |
R14896 |
T19935 |
T19936 |
amod |
nuclear,extraction |
R14897 |
T19936 |
T19937 |
compound |
extraction,kit |
R14898 |
T19937 |
T19933 |
dobj |
kit,using |
R14899 |
T19938 |
T19929 |
prep |
according,isolated |
R149 |
T181 |
T184 |
advmod |
Interestingly,reduced |
R1490 |
T1801 |
T1803 |
amod |
conventional,isoforms |
R14900 |
T19939 |
T19938 |
prep |
to,according |
R14901 |
T19940 |
T19941 |
det |
the,manufacturer |
R14902 |
T19941 |
T19943 |
poss |
manufacturer,instruction |
R14903 |
T19942 |
T19941 |
case |
's,manufacturer |
R14904 |
T19943 |
T19939 |
pobj |
instruction,to |
R14905 |
T19944 |
T19943 |
prep |
from,instruction |
R14906 |
T19945 |
T19946 |
compound |
Active,Motif |
R14907 |
T19946 |
T19944 |
pobj |
Motif,from |
R14908 |
T19947 |
T19951 |
punct |
(,) |
R14909 |
T19948 |
T19951 |
nmod |
Carlsbad,) |
R1491 |
T1904 |
T1903 |
pobj |
PKCα,of |
R14910 |
T19949 |
T19948 |
punct |
",",Carlsbad |
R14911 |
T19950 |
T19948 |
conj |
CA,Carlsbad |
R14912 |
T19951 |
T19929 |
punct |
),isolated |
R14913 |
T19952 |
T19929 |
punct |
.,isolated |
R14914 |
T19953 |
T19957 |
advmod |
Briefly,lysed |
R14915 |
T19954 |
T19957 |
punct |
",",lysed |
R14916 |
T19955 |
T19957 |
nsubjpass |
MDMs,lysed |
R14917 |
T19956 |
T19957 |
auxpass |
were,lysed |
R14918 |
T19957 |
T19957 |
ROOT |
lysed,lysed |
R14919 |
T19958 |
T19957 |
prep |
in,lysed |
R1492 |
T1905 |
T1905 |
ROOT |
induces,induces |
R14920 |
T19959 |
T19961 |
amod |
hypotonic,buffer |
R14921 |
T19960 |
T19961 |
compound |
lysis,buffer |
R14922 |
T19961 |
T19958 |
pobj |
buffer,in |
R14923 |
T19962 |
T19961 |
punct |
(,buffer |
R14924 |
T19963 |
T19965 |
nummod |
20,Hepes |
R14925 |
T19964 |
T19965 |
compound |
mM,Hepes |
R14926 |
T19965 |
T19961 |
appos |
Hepes,buffer |
R14927 |
T19966 |
T19965 |
punct |
",",Hepes |
R14928 |
T19967 |
T19965 |
appos |
pH,Hepes |
R14929 |
T19968 |
T19967 |
nummod |
7.5,pH |
R1493 |
T1906 |
T1907 |
amod |
PKCδ-dependent,apoptosis |
R14930 |
T19969 |
T19965 |
punct |
;,Hepes |
R14931 |
T19970 |
T19972 |
nummod |
5,NaF |
R14932 |
T19971 |
T19972 |
compound |
mM,NaF |
R14933 |
T19972 |
T19965 |
appos |
NaF,Hepes |
R14934 |
T19973 |
T19972 |
punct |
",",NaF |
R14935 |
T19974 |
T19979 |
nummod |
10,NP-40 |
R14936 |
T19975 |
T19976 |
compound |
µM,Na2MoO4 |
R14937 |
T19976 |
T19979 |
compound |
Na2MoO4,NP-40 |
R14938 |
T19977 |
T19978 |
nummod |
0.5,% |
R14939 |
T19978 |
T19979 |
compound |
%,NP-40 |
R1494 |
T1802 |
T1803 |
compound |
PKC,isoforms |
R14940 |
T19979 |
T19972 |
appos |
NP-40,NaF |
R14941 |
T19980 |
T19979 |
cc |
and,NP-40 |
R14942 |
T19981 |
T19983 |
nummod |
0.1,EDTA |
R14943 |
T19982 |
T19983 |
compound |
mM,EDTA |
R14944 |
T19983 |
T19979 |
conj |
EDTA,NP-40 |
R14945 |
T19984 |
T19983 |
punct |
),EDTA |
R14946 |
T19985 |
T19972 |
punct |
",",NaF |
R14947 |
T19986 |
T19972 |
cc |
and,NaF |
R14948 |
T19987 |
T19990 |
advmod |
then,resuspended |
R14949 |
T19988 |
T19990 |
nsubjpass |
nuclei,resuspended |
R1495 |
T1803 |
T1800 |
dobj |
isoforms,express |
R14950 |
T19989 |
T19990 |
auxpass |
were,resuspended |
R14951 |
T19990 |
T19957 |
conj |
resuspended,lysed |
R14952 |
T19991 |
T19990 |
prep |
in,resuspended |
R14953 |
T19992 |
T19993 |
compound |
lysis,buffer |
R14954 |
T19993 |
T19991 |
pobj |
buffer,in |
R14955 |
T19994 |
T19990 |
conj |
supplemented,resuspended |
R14956 |
T19995 |
T19994 |
prep |
with,supplemented |
R14957 |
T19996 |
T19998 |
nummod |
0.5,DTT |
R14958 |
T19997 |
T19998 |
compound |
mM,DTT |
R14959 |
T19998 |
T19995 |
pobj |
DTT,with |
R1496 |
T1907 |
T1908 |
compound |
apoptosis,[ |
R14960 |
T19999 |
T19998 |
cc |
and,DTT |
R14961 |
T20000 |
T20002 |
nummod |
0.2,PMSF |
R14962 |
T20001 |
T20002 |
compound |
mM,PMSF |
R14963 |
T20002 |
T19998 |
conj |
PMSF,DTT |
R14964 |
T20003 |
T19990 |
punct |
.,resuspended |
R14965 |
T20004 |
T20031 |
det |
The,incubated |
R14966 |
T20005 |
T20006 |
amod |
NF-κB,consensus |
R14967 |
T20006 |
T20031 |
nsubjpass |
consensus,incubated |
R14968 |
T20007 |
T20006 |
appos |
oligonucleotides,consensus |
R14969 |
T20008 |
T20007 |
punct |
(,oligonucleotides |
R1497 |
T1804 |
T1803 |
punct |
(,isoforms |
R14970 |
T20009 |
T20006 |
conj |
sense,consensus |
R14971 |
T20010 |
T20006 |
punct |
:,consensus |
R14972 |
T20011 |
T20006 |
appos |
AGTTGAGGGGACTTTCCCAGGC,consensus |
R14973 |
T20012 |
T20006 |
punct |
;,consensus |
R14974 |
T20013 |
T20017 |
nsubj |
antisense,labeled |
R14975 |
T20014 |
T20013 |
punct |
:,antisense |
R14976 |
T20015 |
T20013 |
appos |
GCCTGGGAAAGTCCCCTCAACT,antisense |
R14977 |
T20016 |
T20013 |
punct |
),antisense |
R14978 |
T20017 |
T20006 |
acl |
labeled,consensus |
R14979 |
T20018 |
T20017 |
prep |
with,labeled |
R1498 |
T1908 |
T1905 |
dobj |
[,induces |
R14980 |
T20019 |
T20018 |
pobj |
32P,with |
R14981 |
T20020 |
T20017 |
agent |
by,labeled |
R14982 |
T20021 |
T20022 |
nummod |
T4,polynucleokinase |
R14983 |
T20022 |
T20020 |
pobj |
polynucleokinase,by |
R14984 |
T20023 |
T20024 |
punct |
(,Promega |
R14985 |
T20024 |
T20022 |
appos |
Promega,polynucleokinase |
R14986 |
T20025 |
T20024 |
punct |
",",Promega |
R14987 |
T20026 |
T20024 |
conj |
Madison,Promega |
R14988 |
T20027 |
T20026 |
punct |
",",Madison |
R14989 |
T20028 |
T20026 |
conj |
WI,Madison |
R1499 |
T1909 |
T1910 |
nummod |
31,] |
R14990 |
T20029 |
T20024 |
punct |
),Promega |
R14991 |
T20030 |
T20031 |
auxpass |
were,incubated |
R14992 |
T20031 |
T20031 |
ROOT |
incubated,incubated |
R14993 |
T20032 |
T20031 |
prep |
with,incubated |
R14994 |
T20033 |
T20034 |
amod |
nuclear,extracts |
R14995 |
T20034 |
T20032 |
pobj |
extracts,with |
R14996 |
T20035 |
T20034 |
prep |
in,extracts |
R14997 |
T20036 |
T20037 |
amod |
binding,buffer |
R14998 |
T20037 |
T20035 |
pobj |
buffer,in |
R14999 |
T20038 |
T20034 |
punct |
(,extracts |
R150 |
T182 |
T184 |
punct |
",",reduced |
R1500 |
T1805 |
T1806 |
compound |
PKCα,PKCβI |
R15000 |
T20039 |
T20042 |
nummod |
10,pH |
R15001 |
T20040 |
T20042 |
compound |
mM,pH |
R15002 |
T20041 |
T20042 |
compound |
Tris,pH |
R15003 |
T20042 |
T20034 |
appos |
pH,extracts |
R15004 |
T20043 |
T20047 |
nummod |
7.6,DTT |
R15005 |
T20044 |
T20047 |
punct |
",",DTT |
R15006 |
T20045 |
T20047 |
nummod |
1,DTT |
R15007 |
T20046 |
T20047 |
compound |
mM,DTT |
R15008 |
T20047 |
T20034 |
appos |
DTT,extracts |
R15009 |
T20048 |
T20047 |
punct |
",",DTT |
R1501 |
T1910 |
T1908 |
appos |
],[ |
R15010 |
T20049 |
T20051 |
nummod |
0.5,EDTA |
R15011 |
T20050 |
T20051 |
compound |
mM,EDTA |
R15012 |
T20051 |
T20047 |
conj |
EDTA,DTT |
R15013 |
T20052 |
T20051 |
punct |
",",EDTA |
R15014 |
T20053 |
T20054 |
nummod |
2,µg |
R15015 |
T20054 |
T20055 |
compound |
µg,polydI-dC |
R15016 |
T20055 |
T20051 |
appos |
polydI-dC,EDTA |
R15017 |
T20056 |
T20055 |
cc |
and,polydI-dC |
R15018 |
T20057 |
T20058 |
nummod |
10,% |
R15019 |
T20058 |
T20059 |
compound |
%,Glycerol |
R1502 |
T1911 |
T1905 |
punct |
.,induces |
R15020 |
T20059 |
T20055 |
conj |
Glycerol,polydI-dC |
R15021 |
T20060 |
T20059 |
punct |
),Glycerol |
R15022 |
T20061 |
T20051 |
prep |
at,EDTA |
R15023 |
T20062 |
T20063 |
nummod |
30,° |
R15024 |
T20063 |
T20061 |
pobj |
°,at |
R15025 |
T20064 |
T20051 |
conj |
C,EDTA |
R15026 |
T20065 |
T20047 |
prep |
for,DTT |
R15027 |
T20066 |
T20067 |
nummod |
30,minutes |
R15028 |
T20067 |
T20065 |
pobj |
minutes,for |
R15029 |
T20068 |
T20031 |
punct |
.,incubated |
R1503 |
T1912 |
T1927 |
advmod |
Interestingly,have |
R15030 |
T20069 |
T20071 |
det |
The,DNA |
R15031 |
T20070 |
T20071 |
amod |
free,DNA |
R15032 |
T20071 |
T20076 |
nsubjpass |
DNA,resolved |
R15033 |
T20072 |
T20071 |
cc |
and,DNA |
R15034 |
T20073 |
T20074 |
amod |
DNA-protein,mixtures |
R15035 |
T20074 |
T20071 |
conj |
mixtures,DNA |
R15036 |
T20075 |
T20076 |
auxpass |
were,resolved |
R15037 |
T20076 |
T20076 |
ROOT |
resolved,resolved |
R15038 |
T20077 |
T20076 |
prep |
in,resolved |
R15039 |
T20078 |
T20079 |
nummod |
5,% |
R1504 |
T1913 |
T1927 |
punct |
",",have |
R15040 |
T20079 |
T20082 |
nmod |
%,gels |
R15041 |
T20080 |
T20082 |
amod |
native,gels |
R15042 |
T20081 |
T20082 |
compound |
polyacrylamide,gels |
R15043 |
T20082 |
T20077 |
pobj |
gels,in |
R15044 |
T20083 |
T20076 |
prep |
in,resolved |
R15045 |
T20084 |
T20087 |
nummod |
0.5,buffer |
R15046 |
T20085 |
T20087 |
nummod |
×,buffer |
R15047 |
T20086 |
T20087 |
compound |
TBE,buffer |
R15048 |
T20087 |
T20083 |
pobj |
buffer,in |
R15049 |
T20088 |
T20091 |
punct |
(,Tris |
R1505 |
T1806 |
T1803 |
appos |
PKCβI,isoforms |
R15050 |
T20089 |
T20091 |
nummod |
45,Tris |
R15051 |
T20090 |
T20091 |
compound |
mM,Tris |
R15052 |
T20091 |
T20087 |
appos |
Tris,buffer |
R15053 |
T20092 |
T20091 |
punct |
",",Tris |
R15054 |
T20093 |
T20094 |
nummod |
45,mM |
R15055 |
T20094 |
T20096 |
nmod |
mM,acid |
R15056 |
T20095 |
T20096 |
compound |
boric,acid |
R15057 |
T20096 |
T20091 |
appos |
acid,Tris |
R15058 |
T20097 |
T20096 |
cc |
and,acid |
R15059 |
T20098 |
T20100 |
nummod |
1,EDTA |
R1506 |
T1914 |
T1927 |
prep |
in,have |
R15060 |
T20099 |
T20100 |
compound |
mM,EDTA |
R15061 |
T20100 |
T20096 |
conj |
EDTA,acid |
R15062 |
T20101 |
T20100 |
punct |
",",EDTA |
R15063 |
T20102 |
T20100 |
appos |
pH,EDTA |
R15064 |
T20103 |
T20102 |
nummod |
8.3,pH |
R15065 |
T20104 |
T20100 |
punct |
),EDTA |
R15066 |
T20105 |
T20076 |
agent |
by,resolved |
R15067 |
T20106 |
T20105 |
pobj |
electrophoresis,by |
R15068 |
T20107 |
T20076 |
punct |
.,resolved |
R15069 |
T20108 |
T20109 |
det |
The,gel |
R1507 |
T1915 |
T1916 |
amod |
human,monocytes |
R15070 |
T20109 |
T20111 |
nsubjpass |
gel,dried |
R15071 |
T20110 |
T20111 |
auxpass |
was,dried |
R15072 |
T20111 |
T20111 |
ROOT |
dried,dried |
R15073 |
T20112 |
T20111 |
cc |
and,dried |
R15074 |
T20113 |
T20111 |
conj |
subjected,dried |
R15075 |
T20114 |
T20115 |
aux |
to,autoradiography |
R15076 |
T20115 |
T20113 |
xcomp |
autoradiography,subjected |
R15077 |
T20116 |
T20115 |
dobj |
analysis,autoradiography |
R15078 |
T20117 |
T20111 |
punct |
.,dried |
R1508 |
T1807 |
T1806 |
cc |
and,PKCβI |
R1509 |
T1916 |
T1914 |
pobj |
monocytes,in |
R151 |
T183 |
T184 |
nsubj |
Ro-31-8220,reduced |
R1510 |
T1917 |
T1916 |
cc |
and,monocytes |
R1511 |
T1808 |
T1806 |
conj |
PKCβII,PKCβI |
R1512 |
T1918 |
T1921 |
amod |
premonocytic,cells |
R1513 |
T1919 |
T1921 |
compound |
THP-1,cells |
R1514 |
T1920 |
T1921 |
compound |
leukemia,cells |
R1515 |
T1809 |
T1806 |
punct |
),PKCβI |
R1516 |
T1921 |
T1916 |
conj |
cells,monocytes |
R1517 |
T1922 |
T1921 |
punct |
",",cells |
R1518 |
T1923 |
T1924 |
compound |
novel,PKCs |
R1519 |
T1924 |
T1921 |
conj |
PKCs,cells |
R152 |
T184 |
T184 |
ROOT |
reduced,reduced |
R1520 |
T1925 |
T1924 |
prep |
like,PKCs |
R1521 |
T1926 |
T1925 |
pobj |
PKCδ,like |
R1522 |
T1810 |
T1806 |
cc |
and,PKCβI |
R1523 |
T1927 |
T1938 |
ccomp |
have,showed |
R1524 |
T1928 |
T1930 |
det |
the,effect |
R1525 |
T1929 |
T1930 |
amod |
opposite,effect |
R1526 |
T1930 |
T1927 |
dobj |
effect,have |
R1527 |
T1811 |
T1812 |
amod |
novel,PKCs |
R15278 |
T20349 |
T20350 |
compound |
Transient,Transfection |
R15279 |
T20350 |
T20359 |
nsubjpass |
Transfection,seeded |
R1528 |
T1931 |
T1930 |
prep |
on,effect |
R15280 |
T20351 |
T20350 |
prep |
of,Transfection |
R15281 |
T20352 |
T20351 |
pobj |
RAW,of |
R15282 |
T20353 |
T20355 |
nummod |
264.7,RAW |
R15283 |
T20354 |
T20355 |
compound |
Cells,RAW |
R15284 |
T20355 |
T20350 |
appos |
RAW,Transfection |
R15285 |
T20356 |
T20357 |
nummod |
264.7,cells |
R15286 |
T20357 |
T20359 |
nsubjpass |
cells,seeded |
R15287 |
T20358 |
T20359 |
auxpass |
were,seeded |
R15288 |
T20359 |
T20359 |
ROOT |
seeded,seeded |
R15289 |
T20360 |
T20359 |
prep |
in,seeded |
R1529 |
T1932 |
T1933 |
compound |
cell,survival |
R15290 |
T20361 |
T20362 |
amod |
12-well,plates |
R15291 |
T20362 |
T20360 |
pobj |
plates,in |
R15292 |
T20363 |
T20359 |
prep |
in,seeded |
R15293 |
T20364 |
T20365 |
compound |
RPMI,medium |
R15294 |
T20365 |
T20363 |
pobj |
medium,in |
R15295 |
T20366 |
T20365 |
acl |
containing,medium |
R15296 |
T20367 |
T20368 |
nummod |
5,% |
R15297 |
T20368 |
T20366 |
dobj |
%,containing |
R15298 |
T20369 |
T20372 |
nsubj |
FBS,prior |
R15299 |
T20370 |
T20371 |
nummod |
one,day |
R153 |
T185 |
T186 |
compound |
Ser276,phosphorylation |
R1530 |
T1933 |
T1931 |
pobj |
survival,on |
R15300 |
T20371 |
T20372 |
npadvmod |
day,prior |
R15301 |
T20372 |
T20368 |
amod |
prior,% |
R15302 |
T20373 |
T20372 |
prep |
to,prior |
R15303 |
T20374 |
T20373 |
pobj |
transfection,to |
R15304 |
T20375 |
T20359 |
punct |
",",seeded |
R15305 |
T20376 |
T20378 |
compound |
Secreted,phosphatase |
R15306 |
T20377 |
T20378 |
compound |
alkaline,phosphatase |
R15307 |
T20378 |
T20388 |
nsubjpass |
phosphatase,transfected |
R15308 |
T20379 |
T20380 |
punct |
(,SEAP |
R15309 |
T20380 |
T20378 |
appos |
SEAP,phosphatase |
R1531 |
T1812 |
T1806 |
conj |
PKCs,PKCβI |
R15310 |
T20381 |
T20380 |
punct |
),SEAP |
R15311 |
T20382 |
T20383 |
compound |
reporter,plasmids |
R15312 |
T20383 |
T20384 |
compound |
plasmids,pTAL-SEAP |
R15313 |
T20384 |
T20378 |
conj |
pTAL-SEAP,phosphatase |
R15314 |
T20385 |
T20384 |
cc |
or,pTAL-SEAP |
R15315 |
T20386 |
T20384 |
conj |
pNF-κB-SEAP,pTAL-SEAP |
R15316 |
T20387 |
T20388 |
auxpass |
were,transfected |
R15317 |
T20388 |
T20359 |
dep |
transfected,seeded |
R15318 |
T20389 |
T20388 |
prep |
into,transfected |
R15319 |
T20390 |
T20389 |
pobj |
cells,into |
R1532 |
T1934 |
T1938 |
punct |
",",showed |
R15320 |
T20391 |
T20390 |
acl |
using,cells |
R15321 |
T20392 |
T20393 |
compound |
Qiagene,Effectene |
R15322 |
T20393 |
T20391 |
dobj |
Effectene,using |
R15323 |
T20394 |
T20393 |
cc |
or,Effectene |
R15324 |
T20395 |
T20397 |
compound |
Attractene,kit |
R15325 |
T20396 |
T20397 |
compound |
transfection,kit |
R15326 |
T20397 |
T20393 |
conj |
kit,Effectene |
R15327 |
T20398 |
T20399 |
punct |
(,Qiagen |
R15328 |
T20399 |
T20397 |
appos |
Qiagen,kit |
R15329 |
T20400 |
T20399 |
punct |
",",Qiagen |
R1533 |
T1935 |
T1937 |
compound |
Voss,al |
R15330 |
T20401 |
T20399 |
npadvmod |
Valencia,Qiagen |
R15331 |
T20402 |
T20401 |
punct |
",",Valencia |
R15332 |
T20403 |
T20401 |
appos |
CA,Valencia |
R15333 |
T20404 |
T20399 |
punct |
),Qiagen |
R15334 |
T20405 |
T20388 |
prep |
according,transfected |
R15335 |
T20406 |
T20405 |
prep |
to,according |
R15336 |
T20407 |
T20408 |
det |
the,manufacturer |
R15337 |
T20408 |
T20410 |
poss |
manufacturer,protocol |
R15338 |
T20409 |
T20408 |
case |
's,manufacturer |
R15339 |
T20410 |
T20406 |
pobj |
protocol,to |
R1534 |
T1813 |
T1812 |
punct |
(,PKCs |
R15340 |
T20411 |
T20388 |
punct |
.,transfected |
R15341 |
T20412 |
T20421 |
prep |
For,were |
R15342 |
T20413 |
T20414 |
amod |
co-transfection,studies |
R15343 |
T20414 |
T20412 |
pobj |
studies,For |
R15344 |
T20415 |
T20421 |
punct |
",",were |
R15345 |
T20416 |
T20420 |
nmod |
PKCα,constructs |
R15346 |
T20417 |
T20416 |
cc |
or,PKCα |
R15347 |
T20418 |
T20416 |
conj |
NF-κB,PKCα |
R15348 |
T20419 |
T20418 |
nummod |
p65,NF-κB |
R15349 |
T20420 |
T20421 |
nsubj |
constructs,were |
R1535 |
T1936 |
T1937 |
compound |
et,al |
R15350 |
T20421 |
T20421 |
ROOT |
were,were |
R15351 |
T20422 |
T20421 |
acomp |
mixed,were |
R15352 |
T20423 |
T20422 |
prep |
at,mixed |
R15353 |
T20424 |
T20425 |
det |
a,ratio |
R15354 |
T20425 |
T20423 |
pobj |
ratio,at |
R15355 |
T20426 |
T20425 |
prep |
of,ratio |
R15356 |
T20427 |
T20429 |
nummod |
5,1 |
R15357 |
T20428 |
T20429 |
nummod |
∶,1 |
R15358 |
T20429 |
T20426 |
pobj |
1,of |
R15359 |
T20430 |
T20425 |
prep |
with,ratio |
R1536 |
T1937 |
T1938 |
nsubj |
al,showed |
R15360 |
T20431 |
T20433 |
det |
the,plasmid |
R15361 |
T20432 |
T20433 |
compound |
reporter,plasmid |
R15362 |
T20433 |
T20430 |
pobj |
plasmid,with |
R15363 |
T20434 |
T20421 |
punct |
.,were |
R15364 |
T20435 |
T20448 |
prep |
For,used |
R15365 |
T20436 |
T20437 |
amod |
siRNA,transfection |
R15366 |
T20437 |
T20435 |
pobj |
transfection,For |
R15367 |
T20438 |
T20448 |
punct |
",",used |
R15368 |
T20439 |
T20440 |
nummod |
100,nM |
R15369 |
T20440 |
T20448 |
nsubjpass |
nM,used |
R1537 |
T1938 |
T1938 |
ROOT |
showed,showed |
R15370 |
T20441 |
T20440 |
prep |
of,nM |
R15371 |
T20442 |
T20443 |
compound |
PKCα,siRNA |
R15372 |
T20443 |
T20441 |
pobj |
siRNA,of |
R15373 |
T20444 |
T20440 |
cc |
or,nM |
R15374 |
T20445 |
T20446 |
compound |
control,siRNA |
R15375 |
T20446 |
T20440 |
conj |
siRNA,nM |
R15376 |
T20447 |
T20448 |
auxpass |
were,used |
R15377 |
T20448 |
T20448 |
ROOT |
used,used |
R15378 |
T20449 |
T20448 |
punct |
.,used |
R15379 |
T20450 |
T20452 |
nsubjpass |
Cells,incubated |
R1538 |
T1939 |
T1942 |
mark |
that,phosphorylates |
R15380 |
T20451 |
T20452 |
auxpass |
were,incubated |
R15381 |
T20452 |
T20452 |
ROOT |
incubated,incubated |
R15382 |
T20453 |
T20452 |
prep |
with,incubated |
R15383 |
T20454 |
T20456 |
det |
the,reagents |
R15384 |
T20455 |
T20456 |
compound |
transfection,reagents |
R15385 |
T20456 |
T20453 |
pobj |
reagents,with |
R15386 |
T20457 |
T20452 |
prep |
for,incubated |
R15387 |
T20458 |
T20457 |
pobj |
16,for |
R15388 |
T20459 |
T20460 |
nummod |
24,hours |
R15389 |
T20460 |
T20458 |
appos |
hours,16 |
R1539 |
T1814 |
T1812 |
conj |
PKCδ,PKCs |
R15390 |
T20461 |
T20452 |
punct |
",",incubated |
R15391 |
T20462 |
T20452 |
conj |
washed,incubated |
R15392 |
T20463 |
T20462 |
cc |
and,washed |
R15393 |
T20464 |
T20462 |
conj |
starved,washed |
R15394 |
T20465 |
T20464 |
prep |
in,starved |
R15395 |
T20466 |
T20465 |
pobj |
RPMI,in |
R15396 |
T20467 |
T20464 |
prep |
without,starved |
R15397 |
T20468 |
T20467 |
pobj |
FBS,without |
R15398 |
T20469 |
T20464 |
prep |
for,starved |
R15399 |
T20470 |
T20471 |
nummod |
4,hours |
R154 |
T186 |
T184 |
dobj |
phosphorylation,reduced |
R1540 |
T1940 |
T1942 |
nsubj |
PKCδ,phosphorylates |
R15400 |
T20471 |
T20469 |
pobj |
hours,for |
R15401 |
T20472 |
T20452 |
punct |
.,incubated |
R15402 |
T20473 |
T20476 |
nsubjpass |
Samples,stimulated |
R15403 |
T20474 |
T20476 |
auxpass |
were,stimulated |
R15404 |
T20475 |
T20476 |
advmod |
then,stimulated |
R15405 |
T20476 |
T20476 |
ROOT |
stimulated,stimulated |
R15406 |
T20477 |
T20476 |
prep |
with,stimulated |
R15407 |
T20478 |
T20480 |
nummod |
100,M-CSF |
R15408 |
T20479 |
T20480 |
amod |
ng/ml,M-CSF |
R15409 |
T20480 |
T20477 |
pobj |
M-CSF,with |
R1541 |
T1815 |
T1814 |
cc |
and,PKCδ |
R15410 |
T20481 |
T20480 |
prep |
for,M-CSF |
R15411 |
T20482 |
T20483 |
nummod |
4,hours |
R15412 |
T20483 |
T20481 |
pobj |
hours,for |
R15413 |
T20484 |
T20486 |
preconj |
at,point |
R15414 |
T20485 |
T20486 |
det |
which,point |
R15415 |
T20486 |
T20483 |
relcl |
point,hours |
R15416 |
T20487 |
T20488 |
det |
the,medium |
R15417 |
T20488 |
T20490 |
nsubjpass |
medium,collected |
R15418 |
T20489 |
T20490 |
auxpass |
was,collected |
R15419 |
T20490 |
T20476 |
conj |
collected,stimulated |
R1542 |
T1816 |
T1814 |
conj |
PKCε,PKCδ |
R15420 |
T20491 |
T20490 |
prep |
for,collected |
R15421 |
T20492 |
T20494 |
det |
the,analysis |
R15422 |
T20493 |
T20494 |
compound |
SEAP,analysis |
R15423 |
T20494 |
T20491 |
pobj |
analysis,for |
R15424 |
T20495 |
T20490 |
punct |
.,collected |
R15425 |
T20496 |
T20502 |
prep |
For,pre-incubated |
R15426 |
T20497 |
T20498 |
compound |
inhibition,studies |
R15427 |
T20498 |
T20496 |
pobj |
studies,For |
R15428 |
T20499 |
T20502 |
punct |
",",pre-incubated |
R15429 |
T20500 |
T20502 |
nsubjpass |
cells,pre-incubated |
R1543 |
T1817 |
T1812 |
punct |
),PKCs |
R15430 |
T20501 |
T20502 |
auxpass |
were,pre-incubated |
R15431 |
T20502 |
T20502 |
ROOT |
pre-incubated,pre-incubated |
R15432 |
T20503 |
T20502 |
prep |
with,pre-incubated |
R15433 |
T20504 |
T20503 |
pobj |
inhibitors,with |
R15434 |
T20505 |
T20504 |
prep |
for,inhibitors |
R15435 |
T20506 |
T20507 |
nummod |
30,minutes |
R15436 |
T20507 |
T20505 |
pobj |
minutes,for |
R15437 |
T20508 |
T20507 |
prep |
before,minutes |
R15438 |
T20509 |
T20510 |
compound |
M-CSF,treatment |
R15439 |
T20510 |
T20508 |
pobj |
treatment,before |
R1544 |
T1818 |
T1800 |
punct |
.,express |
R15440 |
T20511 |
T20502 |
punct |
.,pre-incubated |
R15441 |
T20512 |
T20516 |
prep |
On,realized |
R15442 |
T20513 |
T20512 |
amod |
average,On |
R15443 |
T20514 |
T20516 |
punct |
",",realized |
R15444 |
T20515 |
T20516 |
nsubj |
we,realized |
R15445 |
T20516 |
T20516 |
ROOT |
realized,realized |
R15446 |
T20517 |
T20516 |
dobj |
30,realized |
R15447 |
T20518 |
T20519 |
nummod |
40,% |
R15448 |
T20519 |
T20521 |
nmod |
%,efficiency |
R15449 |
T20520 |
T20521 |
compound |
transfection,efficiency |
R1545 |
T1941 |
T1942 |
advmod |
directly,phosphorylates |
R15450 |
T20521 |
T20516 |
conj |
efficiency,realized |
R15451 |
T20522 |
T20523 |
mark |
as,confirmed |
R15452 |
T20523 |
T20521 |
advcl |
confirmed,efficiency |
R15453 |
T20524 |
T20523 |
agent |
by,confirmed |
R15454 |
T20525 |
T20526 |
compound |
GFP,expression |
R15455 |
T20526 |
T20524 |
pobj |
expression,by |
R15456 |
T20527 |
T20523 |
prep |
in,confirmed |
R15457 |
T20528 |
T20530 |
amod |
Raw,cells |
R15458 |
T20529 |
T20530 |
nummod |
264.7,cells |
R15459 |
T20530 |
T20527 |
pobj |
cells,in |
R1546 |
T1942 |
T1938 |
ccomp |
phosphorylates,showed |
R15460 |
T20531 |
T20516 |
punct |
.,realized |
R1547 |
T1943 |
T1942 |
dobj |
caspase-3,phosphorylates |
R1548 |
T1819 |
T1820 |
amod |
Conventional,PKCs |
R1549 |
T1944 |
T1942 |
cc |
and,phosphorylates |
R155 |
T187 |
T186 |
prep |
of,phosphorylation |
R1550 |
T1945 |
T1942 |
conj |
promotes,phosphorylates |
R1551 |
T1820 |
T1821 |
nsubj |
PKCs,regulate |
R1552 |
T1946 |
T1947 |
amod |
etoposide-induced,apoptosis |
R1553 |
T1947 |
T1948 |
compound |
apoptosis,[ |
R1554 |
T1948 |
T1945 |
dobj |
[,promotes |
R1555 |
T1821 |
T1821 |
ROOT |
regulate,regulate |
R1556 |
T1949 |
T1950 |
nummod |
32,] |
R1557 |
T1950 |
T1948 |
appos |
],[ |
R1558 |
T1822 |
T1821 |
dobj |
differentiation,regulate |
R1559 |
T1951 |
T1938 |
punct |
.,showed |
R156 |
T188 |
T189 |
compound |
NF-κBp65,leading |
R1560 |
T1952 |
T1957 |
advmod |
Moreover,suggest |
R1561 |
T1823 |
T1822 |
prep |
of,differentiation |
R1562 |
T1953 |
T1957 |
punct |
",",suggest |
R1563 |
T1954 |
T1956 |
compound |
knockout,studies |
R1564 |
T1955 |
T1956 |
compound |
mouse,studies |
R1565 |
T1824 |
T1829 |
det |
the,line |
R15655 |
T20824 |
T20825 |
compound |
Transient,Transfection |
R15656 |
T20825 |
T20832 |
nsubjpass |
Transfection,transfected |
R15657 |
T20826 |
T20825 |
prep |
of,Transfection |
R15658 |
T20827 |
T20828 |
compound |
Primary,Human |
R15659 |
T20828 |
T20829 |
compound |
Human,Monocytes |
R1566 |
T1956 |
T1957 |
nsubj |
studies,suggest |
R15660 |
T20829 |
T20830 |
compound |
Monocytes,Monocytes |
R15661 |
T20830 |
T20826 |
pobj |
Monocytes,of |
R15662 |
T20831 |
T20832 |
auxpass |
were,transfected |
R15663 |
T20832 |
T20832 |
ROOT |
transfected,transfected |
R15664 |
T20833 |
T20832 |
advcl |
using,transfected |
R15665 |
T20834 |
T20839 |
det |
the,kit |
R15666 |
T20835 |
T20836 |
amod |
human,monocyte |
R15667 |
T20836 |
T20839 |
compound |
monocyte,kit |
R15668 |
T20837 |
T20839 |
compound |
Amaxa,kit |
R15669 |
T20838 |
T20839 |
compound |
nucleofector,kit |
R1567 |
T1957 |
T1966 |
advcl |
suggest,involved |
R15670 |
T20839 |
T20833 |
dobj |
kit,using |
R15671 |
T20840 |
T20839 |
punct |
(,kit |
R15672 |
T20841 |
T20843 |
compound |
Lonza,Inc |
R15673 |
T20842 |
T20843 |
compound |
Walkersville,Inc |
R15674 |
T20843 |
T20839 |
appos |
Inc,kit |
R15675 |
T20844 |
T20843 |
punct |
",",Inc |
R15676 |
T20845 |
T20843 |
conj |
Walkersville,Inc |
R15677 |
T20846 |
T20845 |
punct |
",",Walkersville |
R15678 |
T20847 |
T20845 |
appos |
MD,Walkersville |
R15679 |
T20848 |
T20845 |
punct |
),Walkersville |
R1568 |
T1825 |
T1828 |
amod |
human,cell |
R15680 |
T20849 |
T20851 |
mark |
as,described |
R15681 |
T20850 |
T20851 |
advmod |
previously,described |
R15682 |
T20851 |
T20833 |
advcl |
described,using |
R15683 |
T20852 |
T20854 |
nmod |
[,] |
R15684 |
T20853 |
T20854 |
nummod |
51,] |
R15685 |
T20854 |
T20851 |
dobj |
],described |
R15686 |
T20855 |
T20832 |
punct |
.,transfected |
R15687 |
T20856 |
T20860 |
advmod |
Briefly,resuspended |
R15688 |
T20857 |
T20860 |
punct |
",",resuspended |
R15689 |
T20858 |
T20860 |
nsubjpass |
monocytes,resuspended |
R1569 |
T1958 |
T1960 |
mark |
that,novel |
R15690 |
T20859 |
T20860 |
auxpass |
were,resuspended |
R15691 |
T20860 |
T20860 |
ROOT |
resuspended,resuspended |
R15692 |
T20861 |
T20860 |
prep |
in,resuspended |
R15693 |
T20862 |
T20863 |
compound |
Amaxa,Nucleofactor |
R15694 |
T20863 |
T20864 |
compound |
Nucleofactor,solution |
R15695 |
T20864 |
T20861 |
pobj |
solution,in |
R15696 |
T20865 |
T20864 |
prep |
at,solution |
R15697 |
T20866 |
T20867 |
det |
a,density |
R15698 |
T20867 |
T20865 |
pobj |
density,at |
R15699 |
T20868 |
T20867 |
prep |
of,density |
R157 |
T189 |
T187 |
pobj |
leading,of |
R1570 |
T1959 |
T1960 |
det |
another,novel |
R15700 |
T20869 |
T20872 |
nummod |
20,cells/ml |
R15701 |
T20870 |
T20872 |
nummod |
×,cells/ml |
R15702 |
T20871 |
T20872 |
nummod |
106,cells/ml |
R15703 |
T20872 |
T20868 |
pobj |
cells/ml,of |
R15704 |
T20873 |
T20860 |
punct |
",",resuspended |
R15705 |
T20874 |
T20860 |
cc |
and,resuspended |
R15706 |
T20875 |
T20876 |
nummod |
2,µg |
R15707 |
T20876 |
T20890 |
nsubjpass |
µg,added |
R15708 |
T20877 |
T20876 |
prep |
of,µg |
R15709 |
T20878 |
T20880 |
amod |
total,DNA |
R1571 |
T1960 |
T1957 |
ccomp |
novel,suggest |
R15710 |
T20879 |
T20880 |
compound |
plasmid,DNA |
R15711 |
T20880 |
T20877 |
pobj |
DNA,of |
R15712 |
T20881 |
T20882 |
nummod |
100,nM |
R15713 |
T20882 |
T20876 |
conj |
nM,µg |
R15714 |
T20883 |
T20882 |
prep |
of,nM |
R15715 |
T20884 |
T20885 |
compound |
PKCα,siRNA |
R15716 |
T20885 |
T20883 |
pobj |
siRNA,of |
R15717 |
T20886 |
T20882 |
cc |
or,nM |
R15718 |
T20887 |
T20888 |
compound |
control,siRNA |
R15719 |
T20888 |
T20882 |
conj |
siRNA,nM |
R1572 |
T1961 |
T1960 |
appos |
PKC,novel |
R15720 |
T20889 |
T20890 |
auxpass |
was,added |
R15721 |
T20890 |
T20860 |
conj |
added,resuspended |
R15722 |
T20891 |
T20890 |
cc |
and,added |
R15723 |
T20892 |
T20890 |
conj |
transfected,added |
R15724 |
T20893 |
T20892 |
advcl |
using,transfected |
R15725 |
T20894 |
T20896 |
compound |
program,Y-01 |
R15726 |
T20895 |
T20896 |
compound |
Amaxa,Y-01 |
R15727 |
T20896 |
T20893 |
dobj |
Y-01,using |
R15728 |
T20897 |
T20890 |
punct |
.,added |
R15729 |
T20898 |
T20907 |
prep |
For,were |
R1573 |
T1962 |
T1966 |
punct |
",",involved |
R15730 |
T20899 |
T20900 |
amod |
co-transfection,studies |
R15731 |
T20900 |
T20898 |
pobj |
studies,For |
R15732 |
T20901 |
T20907 |
punct |
",",were |
R15733 |
T20902 |
T20906 |
nmod |
PKCα,constructs |
R15734 |
T20903 |
T20902 |
cc |
or,PKCα |
R15735 |
T20904 |
T20902 |
conj |
NF-κB,PKCα |
R15736 |
T20905 |
T20904 |
nummod |
p65,NF-κB |
R15737 |
T20906 |
T20907 |
nsubj |
constructs,were |
R15738 |
T20907 |
T20907 |
ROOT |
were,were |
R15739 |
T20908 |
T20907 |
acomp |
mixed,were |
R1574 |
T1963 |
T1966 |
nsubjpass |
PKCε,involved |
R15740 |
T20909 |
T20908 |
prep |
at,mixed |
R15741 |
T20910 |
T20911 |
det |
a,ratio |
R15742 |
T20911 |
T20909 |
pobj |
ratio,at |
R15743 |
T20912 |
T20911 |
prep |
of,ratio |
R15744 |
T20913 |
T20915 |
nummod |
5,1 |
R15745 |
T20914 |
T20915 |
nummod |
∶,1 |
R15746 |
T20915 |
T20912 |
pobj |
1,of |
R15747 |
T20916 |
T20908 |
prep |
with,mixed |
R15748 |
T20917 |
T20919 |
det |
the,plasmid |
R15749 |
T20918 |
T20919 |
compound |
reporter,plasmid |
R1575 |
T1964 |
T1966 |
auxpass |
is,involved |
R15750 |
T20919 |
T20916 |
pobj |
plasmid,with |
R15751 |
T20920 |
T20907 |
punct |
.,were |
R15752 |
T20921 |
T20922 |
advmod |
Immediately,after |
R15753 |
T20922 |
T20927 |
prep |
after,washed |
R15754 |
T20923 |
T20922 |
pobj |
transfection,after |
R15755 |
T20924 |
T20927 |
punct |
",",washed |
R15756 |
T20925 |
T20927 |
nsubjpass |
cells,washed |
R15757 |
T20926 |
T20927 |
auxpass |
were,washed |
R15758 |
T20927 |
T20927 |
ROOT |
washed,washed |
R15759 |
T20928 |
T20927 |
prep |
with,washed |
R1576 |
T1826 |
T1828 |
amod |
promyelocytic,cell |
R15760 |
T20929 |
T20930 |
nummod |
1,ml |
R15761 |
T20930 |
T20928 |
pobj |
ml,with |
R15762 |
T20931 |
T20930 |
prep |
of,ml |
R15763 |
T20932 |
T20933 |
compound |
RPMI,medium |
R15764 |
T20933 |
T20931 |
pobj |
medium,of |
R15765 |
T20934 |
T20930 |
acl |
containing,ml |
R15766 |
T20935 |
T20937 |
nummod |
2,glutamine |
R15767 |
T20936 |
T20937 |
compound |
mM,glutamine |
R15768 |
T20937 |
T20934 |
dobj |
glutamine,containing |
R15769 |
T20938 |
T20937 |
cc |
and,glutamine |
R1577 |
T1965 |
T1966 |
advmod |
critically,involved |
R15770 |
T20939 |
T20940 |
nummod |
10,% |
R15771 |
T20940 |
T20941 |
compound |
%,FBS |
R15772 |
T20941 |
T20937 |
conj |
FBS,glutamine |
R15773 |
T20942 |
T20941 |
cc |
or,FBS |
R15774 |
T20943 |
T20944 |
npadvmod |
serum,free |
R15775 |
T20944 |
T20946 |
amod |
free,medium |
R15776 |
T20945 |
T20946 |
compound |
LGM,medium |
R15777 |
T20946 |
T20941 |
conj |
medium,FBS |
R15778 |
T20947 |
T20950 |
punct |
(,Inc. |
R15779 |
T20948 |
T20950 |
compound |
Lonza,Inc. |
R1578 |
T1966 |
T1966 |
ROOT |
involved,involved |
R15780 |
T20949 |
T20950 |
compound |
Walkersville,Inc. |
R15781 |
T20950 |
T20946 |
appos |
Inc.,medium |
R15782 |
T20951 |
T20950 |
punct |
),Inc. |
R15783 |
T20952 |
T20953 |
advmod |
then,plated |
R15784 |
T20953 |
T20927 |
dep |
plated,washed |
R15785 |
T20954 |
T20953 |
prep |
at,plated |
R15786 |
T20955 |
T20958 |
nummod |
4,cells/well |
R15787 |
T20956 |
T20958 |
nummod |
×,cells/well |
R15788 |
T20957 |
T20958 |
nummod |
105,cells/well |
R15789 |
T20958 |
T20954 |
pobj |
cells/well,at |
R1579 |
T1967 |
T1966 |
prep |
in,involved |
R15790 |
T20959 |
T20958 |
prep |
in,cells/well |
R15791 |
T20960 |
T20961 |
amod |
24-well,plates |
R15792 |
T20961 |
T20959 |
pobj |
plates,in |
R15793 |
T20962 |
T20927 |
punct |
.,washed |
R15794 |
T20963 |
T20965 |
det |
The,medium |
R15795 |
T20964 |
T20965 |
amod |
original,medium |
R15796 |
T20965 |
T20967 |
nsubjpass |
medium,replaced |
R15797 |
T20966 |
T20967 |
auxpass |
was,replaced |
R15798 |
T20967 |
T20967 |
ROOT |
replaced,replaced |
R15799 |
T20968 |
T20967 |
agent |
by,replaced |
R158 |
T190 |
T189 |
prep |
to,leading |
R1580 |
T1827 |
T1828 |
compound |
leukemia,cell |
R15800 |
T20969 |
T20970 |
npadvmod |
serum,free |
R15801 |
T20970 |
T20972 |
amod |
free,medium |
R15802 |
T20971 |
T20972 |
compound |
LGM,medium |
R15803 |
T20972 |
T20968 |
pobj |
medium,by |
R15804 |
T20973 |
T20967 |
prep |
without,replaced |
R15805 |
T20974 |
T20973 |
cc |
or,without |
R15806 |
T20975 |
T20973 |
conj |
with,without |
R15807 |
T20976 |
T20975 |
pobj |
M-CSF,with |
R15808 |
T20977 |
T20976 |
punct |
(,M-CSF |
R15809 |
T20978 |
T20979 |
nummod |
100,ng/ml |
R1581 |
T1968 |
T1970 |
amod |
early,signaling |
R15810 |
T20979 |
T20976 |
appos |
ng/ml,M-CSF |
R15811 |
T20980 |
T20979 |
punct |
),ng/ml |
R15812 |
T20981 |
T20982 |
nummod |
one,hour |
R15813 |
T20982 |
T20983 |
npadvmod |
hour,later |
R15814 |
T20983 |
T20967 |
advmod |
later,replaced |
R15815 |
T20984 |
T20967 |
punct |
.,replaced |
R15816 |
T20985 |
T20987 |
det |
The,day |
R15817 |
T20986 |
T20987 |
amod |
next,day |
R15818 |
T20987 |
T20992 |
npadvmod |
day,collected |
R15819 |
T20988 |
T20992 |
punct |
",",collected |
R1582 |
T1969 |
T1970 |
amod |
LPS-mediated,signaling |
R15820 |
T20989 |
T20990 |
amod |
cell-free,supernatants |
R15821 |
T20990 |
T20992 |
nsubjpass |
supernatants,collected |
R15822 |
T20991 |
T20992 |
auxpass |
were,collected |
R15823 |
T20992 |
T20992 |
ROOT |
collected,collected |
R15824 |
T20993 |
T20992 |
prep |
for,collected |
R15825 |
T20994 |
T20996 |
det |
the,analysis |
R15826 |
T20995 |
T20996 |
compound |
SEAP,analysis |
R15827 |
T20996 |
T20993 |
pobj |
analysis,for |
R15828 |
T20997 |
T20992 |
punct |
.,collected |
R15829 |
T20998 |
T21000 |
nsubjpass |
Cells,stained |
R1583 |
T1970 |
T1967 |
pobj |
signaling,in |
R15830 |
T20999 |
T21000 |
auxpass |
were,stained |
R15831 |
T21000 |
T21000 |
ROOT |
stained,stained |
R15832 |
T21001 |
T21000 |
prep |
with,stained |
R15833 |
T21002 |
T21004 |
compound |
Annexin,iodide |
R15834 |
T21003 |
T21004 |
compound |
V/propidium,iodide |
R15835 |
T21004 |
T21001 |
pobj |
iodide,with |
R15836 |
T21005 |
T21006 |
punct |
(,PI |
R15837 |
T21006 |
T21004 |
appos |
PI,iodide |
R15838 |
T21007 |
T21004 |
punct |
),iodide |
R15839 |
T21008 |
T21000 |
punct |
.,stained |
R1584 |
T1828 |
T1829 |
compound |
cell,line |
R15840 |
T21009 |
T21016 |
prep |
For,pre-incubated |
R15841 |
T21010 |
T21012 |
det |
the,studies |
R15842 |
T21011 |
T21012 |
compound |
inhibition,studies |
R15843 |
T21012 |
T21009 |
pobj |
studies,For |
R15844 |
T21013 |
T21016 |
punct |
",",pre-incubated |
R15845 |
T21014 |
T21016 |
nsubjpass |
cells,pre-incubated |
R15846 |
T21015 |
T21016 |
auxpass |
were,pre-incubated |
R15847 |
T21016 |
T21016 |
ROOT |
pre-incubated,pre-incubated |
R15848 |
T21017 |
T21016 |
prep |
with,pre-incubated |
R15849 |
T21018 |
T21017 |
pobj |
inhibitor,with |
R1585 |
T1971 |
T1970 |
prep |
in,signaling |
R15850 |
T21019 |
T21016 |
prep |
for,pre-incubated |
R15851 |
T21020 |
T21021 |
nummod |
30,minutes |
R15852 |
T21021 |
T21019 |
pobj |
minutes,for |
R15853 |
T21022 |
T21021 |
prep |
in,minutes |
R15854 |
T21023 |
T21024 |
compound |
X-vivo,medium |
R15855 |
T21024 |
T21022 |
pobj |
medium,in |
R15856 |
T21025 |
T21016 |
advmod |
prior,pre-incubated |
R15857 |
T21026 |
T21025 |
prep |
to,prior |
R15858 |
T21027 |
T21028 |
det |
the,addition |
R15859 |
T21028 |
T21026 |
pobj |
addition,to |
R1586 |
T1972 |
T1973 |
amod |
activated,macrophages |
R15860 |
T21029 |
T21028 |
prep |
of,addition |
R15861 |
T21030 |
T21029 |
pobj |
M-CSF,of |
R15862 |
T21031 |
T21016 |
punct |
.,pre-incubated |
R1587 |
T1973 |
T1971 |
pobj |
macrophages,in |
R1588 |
T1829 |
T1823 |
pobj |
line,of |
R1589 |
T1974 |
T1976 |
nmod |
[,] |
R159 |
T191 |
T194 |
amod |
decreased,survival |
R1590 |
T1975 |
T1976 |
nummod |
33,] |
R1591 |
T1976 |
T1970 |
appos |
],signaling |
R1592 |
T1830 |
T1835 |
nummod |
HL60,] |
R1593 |
T1977 |
T1966 |
punct |
.,involved |
R1594 |
T1978 |
T1981 |
advmod |
Previously,reported |
R1595 |
T1979 |
T1981 |
punct |
",",reported |
R1596 |
T1980 |
T1981 |
nsubj |
we,reported |
R1597 |
T1831 |
T1835 |
prep |
to,] |
R1598 |
T1981 |
T1981 |
ROOT |
reported,reported |
R1599 |
T1982 |
T1984 |
mark |
that,promotes |
R160 |
T192 |
T194 |
amod |
M-CSF-induced,survival |
R1600 |
T1832 |
T1831 |
pobj |
macrophages,to |
R1601 |
T1983 |
T1984 |
nsubj |
M-CSF,promotes |
R1602 |
T1984 |
T1981 |
ccomp |
promotes,reported |
R1603 |
T1833 |
T1835 |
nmod |
[,] |
R1604 |
T1985 |
T1986 |
compound |
monocyte,survival |
R1605 |
T1834 |
T1835 |
nummod |
28,] |
R1606 |
T1986 |
T1984 |
dobj |
survival,promotes |
R16061 |
T21302 |
T21304 |
compound |
Secreted,Phosphatase |
R16062 |
T21303 |
T21304 |
compound |
Alkaline,Phosphatase |
R16063 |
T21304 |
T21314 |
nsubjpass |
Phosphatase,analyzed |
R16064 |
T21305 |
T21306 |
punct |
(,SEAP |
R16065 |
T21306 |
T21304 |
appos |
SEAP,Phosphatase |
R16066 |
T21307 |
T21306 |
punct |
),SEAP |
R16067 |
T21308 |
T21309 |
nsubj |
Analysis,Secreted |
R16068 |
T21309 |
T21312 |
compound |
Secreted,activity |
R16069 |
T21310 |
T21312 |
amod |
alkaline,activity |
R1607 |
T1835 |
T1829 |
appos |
],line |
R16070 |
T21311 |
T21312 |
compound |
phosphatase,activity |
R16071 |
T21312 |
T21314 |
nsubjpass |
activity,analyzed |
R16072 |
T21313 |
T21314 |
auxpass |
was,analyzed |
R16073 |
T21314 |
T21314 |
ROOT |
analyzed,analyzed |
R16074 |
T21315 |
T21314 |
agent |
by,analyzed |
R16075 |
T21316 |
T21317 |
compound |
GreatEscape,SEAP |
R16076 |
T21317 |
T21318 |
compound |
SEAP,kit |
R16077 |
T21318 |
T21315 |
pobj |
kit,by |
R16078 |
T21319 |
T21314 |
prep |
according,analyzed |
R16079 |
T21320 |
T21319 |
prep |
to,according |
R1608 |
T1987 |
T1984 |
prep |
through,promotes |
R16080 |
T21321 |
T21322 |
det |
the,manufacturer |
R16081 |
T21322 |
T21324 |
poss |
manufacturer,instruction |
R16082 |
T21323 |
T21322 |
case |
's,manufacturer |
R16083 |
T21324 |
T21320 |
pobj |
instruction,to |
R16084 |
T21325 |
T21314 |
punct |
.,analyzed |
R16085 |
T21326 |
T21330 |
advmod |
Briefly,diluted |
R16086 |
T21327 |
T21330 |
punct |
",",diluted |
R16087 |
T21328 |
T21330 |
nsubjpass |
medium,diluted |
R16088 |
T21329 |
T21330 |
auxpass |
was,diluted |
R16089 |
T21330 |
T21330 |
ROOT |
diluted,diluted |
R1609 |
T1988 |
T1989 |
det |
the,activation |
R16090 |
T21331 |
T21330 |
prep |
in,diluted |
R16091 |
T21332 |
T21334 |
det |
the,buffer |
R16092 |
T21333 |
T21334 |
compound |
dilution,buffer |
R16093 |
T21334 |
T21331 |
pobj |
buffer,in |
R16094 |
T21335 |
T21330 |
cc |
and,diluted |
R16095 |
T21336 |
T21330 |
conj |
heated,diluted |
R16096 |
T21337 |
T21336 |
prep |
to,heated |
R16097 |
T21338 |
T21339 |
compound |
65,° |
R16098 |
T21339 |
T21340 |
nummod |
°,C |
R16099 |
T21340 |
T21337 |
pobj |
C,to |
R161 |
T193 |
T194 |
compound |
monocyte,survival |
R1610 |
T1989 |
T1987 |
pobj |
activation,through |
R16100 |
T21341 |
T21342 |
aux |
to,inactivate |
R16101 |
T21342 |
T21336 |
advcl |
inactivate,heated |
R16102 |
T21343 |
T21344 |
amod |
endogenous,phosphatases |
R16103 |
T21344 |
T21342 |
dobj |
phosphatases,inactivate |
R16104 |
T21345 |
T21346 |
advmod |
then,incubated |
R16105 |
T21346 |
T21330 |
conj |
incubated,diluted |
R16106 |
T21347 |
T21346 |
prep |
with,incubated |
R16107 |
T21348 |
T21349 |
det |
the,substrate |
R16108 |
T21349 |
T21347 |
pobj |
substrate,with |
R16109 |
T21350 |
T21349 |
prep |
for,substrate |
R1611 |
T1836 |
T1821 |
punct |
.,regulate |
R16110 |
T21351 |
T21352 |
nummod |
30,minutes |
R16111 |
T21352 |
T21350 |
pobj |
minutes,for |
R16112 |
T21353 |
T21330 |
punct |
.,diluted |
R16113 |
T21354 |
T21356 |
det |
The,signal |
R16114 |
T21355 |
T21356 |
compound |
chemiluminence,signal |
R16115 |
T21356 |
T21358 |
nsubjpass |
signal,recorded |
R16116 |
T21357 |
T21358 |
auxpass |
was,recorded |
R16117 |
T21358 |
T21358 |
ROOT |
recorded,recorded |
R16118 |
T21359 |
T21358 |
advcl |
using,recorded |
R16119 |
T21360 |
T21361 |
det |
a,luminometer |
R1612 |
T1990 |
T1989 |
prep |
of,activation |
R16120 |
T21361 |
T21359 |
dobj |
luminometer,using |
R16121 |
T21362 |
T21358 |
punct |
.,recorded |
R1613 |
T1991 |
T1993 |
det |
the,pathway |
R1614 |
T1992 |
T1993 |
compound |
PI3-K/AKT,pathway |
R1615 |
T1837 |
T1838 |
nsubj |
PKCα,induces |
R1616 |
T1993 |
T1990 |
pobj |
pathway,of |
R1617 |
T1994 |
T1989 |
appos |
[,activation |
R16178 |
T21451 |
T21457 |
compound |
Annexin,assay |
R16179 |
T21452 |
T21457 |
compound |
V/PI,assay |
R1618 |
T1838 |
T1838 |
ROOT |
induces,induces |
R16180 |
T21453 |
T21457 |
compound |
Apoptosis,assay |
R16181 |
T21454 |
T21457 |
compound |
Assay,assay |
R16182 |
T21455 |
T21456 |
compound |
Cell,apoptosis |
R16183 |
T21456 |
T21457 |
compound |
apoptosis,assay |
R16184 |
T21457 |
T21459 |
nsubjpass |
assay,performed |
R16185 |
T21458 |
T21459 |
auxpass |
was,performed |
R16186 |
T21459 |
T21459 |
ROOT |
performed,performed |
R16187 |
T21460 |
T21461 |
mark |
as,described |
R16188 |
T21461 |
T21459 |
advcl |
described,performed |
R16189 |
T21462 |
T21465 |
advmod |
previously,] |
R1619 |
T1995 |
T1996 |
nummod |
3,] |
R16190 |
T21463 |
T21465 |
nmod |
[,] |
R16191 |
T21464 |
T21465 |
nummod |
51,] |
R16192 |
T21465 |
T21461 |
npadvmod |
],described |
R16193 |
T21466 |
T21471 |
csubj |
using,apoptosis |
R16194 |
T21467 |
T21469 |
det |
the,V |
R16195 |
T21468 |
T21469 |
compound |
Annexin,V |
R16196 |
T21469 |
T21466 |
dobj |
V,using |
R16197 |
T21470 |
T21471 |
nsubj |
FITC,apoptosis |
R16198 |
T21471 |
T21459 |
conj |
apoptosis,performed |
R16199 |
T21472 |
T21473 |
compound |
detection,kit |
R162 |
T194 |
T190 |
pobj |
survival,to |
R1620 |
T1996 |
T1994 |
appos |
],[ |
R16200 |
T21473 |
T21471 |
dobj |
kit,apoptosis |
R16201 |
T21474 |
T21473 |
punct |
(,kit |
R16202 |
T21475 |
T21476 |
compound |
BD,PharMingen |
R16203 |
T21476 |
T21473 |
appos |
PharMingen,kit |
R16204 |
T21477 |
T21476 |
punct |
",",PharMingen |
R16205 |
T21478 |
T21479 |
compound |
San,Diego |
R16206 |
T21479 |
T21476 |
npadvmod |
Diego,PharMingen |
R16207 |
T21480 |
T21479 |
punct |
",",Diego |
R16208 |
T21481 |
T21479 |
conj |
CA,Diego |
R16209 |
T21482 |
T21476 |
punct |
),PharMingen |
R1621 |
T1997 |
T1981 |
punct |
.,reported |
R16210 |
T21483 |
T21471 |
punct |
.,apoptosis |
R16211 |
T21484 |
T21494 |
advmod |
Briefly,incubated |
R16212 |
T21485 |
T21494 |
punct |
",",incubated |
R16213 |
T21486 |
T21487 |
amod |
human,monocytes |
R16214 |
T21487 |
T21494 |
nsubjpass |
monocytes,incubated |
R16215 |
T21488 |
T21487 |
punct |
(,monocytes |
R16216 |
T21489 |
T21491 |
nummod |
5,106 |
R16217 |
T21490 |
T21491 |
nummod |
×,106 |
R16218 |
T21491 |
T21487 |
appos |
106,monocytes |
R16219 |
T21492 |
T21487 |
punct |
),monocytes |
R1622 |
T1998 |
T2005 |
prep |
In,stimulates |
R16220 |
T21493 |
T21494 |
auxpass |
were,incubated |
R16221 |
T21494 |
T21494 |
ROOT |
incubated,incubated |
R16222 |
T21495 |
T21494 |
prep |
with,incubated |
R16223 |
T21496 |
T21495 |
pobj |
inhibitors,with |
R16224 |
T21497 |
T21496 |
prep |
for,inhibitors |
R16225 |
T21498 |
T21499 |
nummod |
30,minutes |
R16226 |
T21499 |
T21497 |
pobj |
minutes,for |
R16227 |
T21500 |
T21499 |
prep |
in,minutes |
R16228 |
T21501 |
T21502 |
compound |
X-vivo,medium |
R16229 |
T21502 |
T21500 |
pobj |
medium,in |
R1623 |
T1999 |
T1998 |
pobj |
addition,In |
R16230 |
T21503 |
T21499 |
cc |
and,minutes |
R16231 |
T21504 |
T21494 |
conj |
restimulated,incubated |
R16232 |
T21505 |
T21504 |
prep |
with,restimulated |
R16233 |
T21506 |
T21508 |
nummod |
100,M-CSF |
R16234 |
T21507 |
T21508 |
compound |
ng/ml,M-CSF |
R16235 |
T21508 |
T21509 |
compound |
M-CSF,overnight |
R16236 |
T21509 |
T21505 |
pobj |
overnight,with |
R16237 |
T21510 |
T21494 |
punct |
.,incubated |
R16238 |
T21511 |
T21512 |
det |
The,cells |
R16239 |
T21512 |
T21514 |
nsubjpass |
cells,removed |
R1624 |
T2000 |
T1999 |
prep |
to,addition |
R16240 |
T21513 |
T21514 |
auxpass |
were,removed |
R16241 |
T21514 |
T21546 |
ccomp |
removed,PharMingen |
R16242 |
T21515 |
T21514 |
prep |
from,removed |
R16243 |
T21516 |
T21518 |
det |
the,dish |
R16244 |
T21517 |
T21518 |
compound |
culture,dish |
R16245 |
T21518 |
T21515 |
pobj |
dish,from |
R16246 |
T21519 |
T21514 |
advcl |
using,removed |
R16247 |
T21520 |
T21519 |
dobj |
Accutase,using |
R16248 |
T21521 |
T21522 |
punct |
(,eBioscience |
R16249 |
T21522 |
T21520 |
appos |
eBioscience,Accutase |
R1625 |
T1839 |
T1838 |
dobj |
IL-1α,induces |
R16250 |
T21523 |
T21522 |
punct |
",",eBioscience |
R16251 |
T21524 |
T21525 |
compound |
San,Diego |
R16252 |
T21525 |
T21522 |
npadvmod |
Diego,eBioscience |
R16253 |
T21526 |
T21525 |
punct |
",",Diego |
R16254 |
T21527 |
T21525 |
conj |
CA,Diego |
R16255 |
T21528 |
T21527 |
punct |
),CA |
R16256 |
T21529 |
T21514 |
cc |
and,removed |
R16257 |
T21530 |
T21514 |
conj |
stained,removed |
R16258 |
T21531 |
T21530 |
prep |
with,stained |
R16259 |
T21532 |
T21533 |
compound |
Annexin,V |
R1626 |
T2001 |
T2002 |
compound |
AKT,activation |
R16260 |
T21533 |
T21531 |
pobj |
V,with |
R16261 |
T21534 |
T21533 |
conj |
FITC,V |
R16262 |
T21535 |
T21534 |
cc |
and,FITC |
R16263 |
T21536 |
T21534 |
conj |
PI,FITC |
R16264 |
T21537 |
T21530 |
cc |
and,stained |
R16265 |
T21538 |
T21530 |
conj |
analyzed,stained |
R16266 |
T21539 |
T21538 |
agent |
by,analyzed |
R16267 |
T21540 |
T21541 |
compound |
flow,cytometry |
R16268 |
T21541 |
T21539 |
pobj |
cytometry,by |
R16269 |
T21542 |
T21543 |
punct |
(,FACSCalibur |
R1627 |
T2002 |
T2000 |
pobj |
activation,to |
R16270 |
T21543 |
T21541 |
appos |
FACSCalibur,cytometry |
R16271 |
T21544 |
T21546 |
punct |
;,PharMingen |
R16272 |
T21545 |
T21546 |
compound |
BD,PharMingen |
R16273 |
T21546 |
T21546 |
ROOT |
PharMingen,PharMingen |
R16274 |
T21547 |
T21546 |
punct |
),PharMingen |
R16275 |
T21548 |
T21546 |
punct |
.,PharMingen |
R16276 |
T21549 |
T21550 |
compound |
Annexin,V-FITC |
R16277 |
T21550 |
T21555 |
nmod |
V-FITC,cells |
R16278 |
T21551 |
T21550 |
cc |
and,V-FITC |
R16279 |
T21552 |
T21550 |
conj |
PI,V-FITC |
R1628 |
T2003 |
T2005 |
punct |
",",stimulates |
R16280 |
T21553 |
T21555 |
amod |
double,cells |
R16281 |
T21554 |
T21555 |
amod |
negative,cells |
R16282 |
T21555 |
T21557 |
nsubjpass |
cells,considered |
R16283 |
T21556 |
T21557 |
auxpass |
were,considered |
R16284 |
T21557 |
T21557 |
ROOT |
considered,considered |
R16285 |
T21558 |
T21559 |
amod |
non-apoptotic,cells |
R16286 |
T21559 |
T21557 |
oprd |
cells,considered |
R16287 |
T21560 |
T21559 |
prep |
for,cells |
R16288 |
T21561 |
T21562 |
amod |
statistical,analysis |
R16289 |
T21562 |
T21560 |
pobj |
analysis,for |
R1629 |
T1840 |
T1839 |
punct |
",",IL-1α |
R16290 |
T21563 |
T21557 |
punct |
.,considered |
R163 |
T195 |
T184 |
punct |
.,reduced |
R1630 |
T2004 |
T2005 |
nsubj |
M-CSF,stimulates |
R1631 |
T2005 |
T2005 |
ROOT |
stimulates,stimulates |
R1632 |
T2006 |
T2005 |
dobj |
PKC,stimulates |
R1633 |
T2007 |
T2005 |
prep |
in,stimulates |
R1634 |
T1841 |
T1839 |
conj |
iNOS,IL-1α |
R1635 |
T2008 |
T2009 |
amod |
human,monocytes |
R1636 |
T2009 |
T2007 |
pobj |
monocytes,in |
R1637 |
T2010 |
T2009 |
cc |
and,monocytes |
R1638 |
T1842 |
T1841 |
cc |
and,iNOS |
R1639 |
T2011 |
T2009 |
conj |
increases,monocytes |
R164 |
T196 |
T201 |
prep |
In,identify |
R1640 |
T2012 |
T2013 |
compound |
NF-κB,DNA |
R16400 |
T21735 |
T21738 |
amod |
Western,Cells |
R16401 |
T21736 |
T21738 |
compound |
Blot,Cells |
R16402 |
T21737 |
T21738 |
compound |
Analysis,Cells |
R16403 |
T21738 |
T21740 |
nsubjpass |
Cells,washed |
R16404 |
T21739 |
T21740 |
auxpass |
were,washed |
R16405 |
T21740 |
T21740 |
ROOT |
washed,washed |
R16406 |
T21741 |
T21740 |
prep |
with,washed |
R16407 |
T21742 |
T21741 |
pobj |
PBS,with |
R16408 |
T21743 |
T21740 |
cc |
and,washed |
R16409 |
T21744 |
T21740 |
conj |
resuspended,washed |
R1641 |
T2013 |
T2017 |
det |
DNA,] |
R16410 |
T21745 |
T21744 |
prep |
in,resuspended |
R16411 |
T21746 |
T21747 |
compound |
cell,lysis |
R16412 |
T21747 |
T21748 |
compound |
lysis,buffer |
R16413 |
T21748 |
T21745 |
pobj |
buffer,in |
R16414 |
T21749 |
T21740 |
punct |
.,washed |
R16415 |
T21750 |
T21753 |
punct |
(,Technology |
R16416 |
T21751 |
T21753 |
compound |
Cell,Technology |
R16417 |
T21752 |
T21753 |
compound |
Signaling,Technology |
R16418 |
T21753 |
T21756 |
nsubj |
Technology,incubated |
R16419 |
T21754 |
T21753 |
punct |
),Technology |
R1642 |
T2038 |
T2043 |
prep |
In,plays |
R16420 |
T21755 |
T21753 |
cc |
and,Technology |
R16421 |
T21756 |
T21756 |
ROOT |
incubated,incubated |
R16422 |
T21757 |
T21756 |
prep |
for,incubated |
R16423 |
T21758 |
T21759 |
nummod |
10,minutes |
R16424 |
T21759 |
T21757 |
pobj |
minutes,for |
R16425 |
T21760 |
T21759 |
prep |
on,minutes |
R16426 |
T21761 |
T21760 |
pobj |
ice,on |
R16427 |
T21762 |
T21763 |
advmod |
then,centrifuged |
R16428 |
T21763 |
T21756 |
conj |
centrifuged,incubated |
R16429 |
T21764 |
T21765 |
aux |
to,remove |
R1643 |
T2014 |
T2017 |
amod |
binding,] |
R16430 |
T21765 |
T21763 |
xcomp |
remove,centrifuged |
R16431 |
T21766 |
T21768 |
det |
the,fraction |
R16432 |
T21767 |
T21768 |
amod |
insoluble,fraction |
R16433 |
T21768 |
T21765 |
dobj |
fraction,remove |
R16434 |
T21769 |
T21756 |
punct |
.,incubated |
R16435 |
T21770 |
T21772 |
det |
The,concentration |
R16436 |
T21771 |
T21772 |
compound |
protein,concentration |
R16437 |
T21772 |
T21774 |
nsubjpass |
concentration,determined |
R16438 |
T21773 |
T21774 |
auxpass |
was,determined |
R16439 |
T21774 |
T21774 |
ROOT |
determined,determined |
R1644 |
T2015 |
T2017 |
nmod |
[,] |
R16440 |
T21775 |
T21774 |
agent |
by,determined |
R16441 |
T21776 |
T21779 |
det |
the,assay |
R16442 |
T21777 |
T21779 |
compound |
BCA,assay |
R16443 |
T21778 |
T21779 |
compound |
protein,assay |
R16444 |
T21779 |
T21775 |
pobj |
assay,by |
R16445 |
T21780 |
T21781 |
punct |
(,Bio-Rad |
R16446 |
T21781 |
T21779 |
appos |
Bio-Rad,assay |
R16447 |
T21782 |
T21781 |
punct |
",",Bio-Rad |
R16448 |
T21783 |
T21781 |
conj |
Hercules,Bio-Rad |
R16449 |
T21784 |
T21783 |
punct |
",",Hercules |
R1645 |
T2016 |
T2017 |
nummod |
34,] |
R16450 |
T21785 |
T21783 |
conj |
CA,Hercules |
R16451 |
T21786 |
T21781 |
punct |
),Bio-Rad |
R16452 |
T21787 |
T21774 |
punct |
.,determined |
R16453 |
T21788 |
T21789 |
compound |
Cell,lysates |
R16454 |
T21789 |
T21791 |
nsubjpass |
lysates,separated |
R16455 |
T21790 |
T21791 |
auxpass |
were,separated |
R16456 |
T21791 |
T21791 |
ROOT |
separated,separated |
R16457 |
T21792 |
T21791 |
agent |
by,separated |
R16458 |
T21793 |
T21792 |
pobj |
SDS-PAGE,by |
R16459 |
T21794 |
T21791 |
prep |
on,separated |
R1646 |
T2017 |
T2005 |
dobj |
],stimulates |
R16460 |
T21795 |
T21796 |
nummod |
10,% |
R16461 |
T21796 |
T21798 |
nmod |
%,gels |
R16462 |
T21797 |
T21798 |
compound |
polyacrylamide,gels |
R16463 |
T21798 |
T21794 |
pobj |
gels,on |
R16464 |
T21799 |
T21791 |
cc |
and,separated |
R16465 |
T21800 |
T21801 |
advmod |
then,transferred |
R16466 |
T21801 |
T21791 |
conj |
transferred,separated |
R16467 |
T21802 |
T21801 |
prep |
onto,transferred |
R16468 |
T21803 |
T21804 |
amod |
nitrocellulose,membranes |
R16469 |
T21804 |
T21802 |
pobj |
membranes,onto |
R1647 |
T2039 |
T2040 |
amod |
other,cells |
R16470 |
T21805 |
T21801 |
cc |
and,transferred |
R16471 |
T21806 |
T21801 |
conj |
subjected,transferred |
R16472 |
T21807 |
T21806 |
prep |
to,subjected |
R16473 |
T21808 |
T21809 |
amod |
Western,blotting |
R16474 |
T21809 |
T21807 |
pobj |
blotting,to |
R16475 |
T21810 |
T21791 |
punct |
.,separated |
R16476 |
T21811 |
T21813 |
det |
The,proteins |
R16477 |
T21812 |
T21813 |
amod |
immunoblotted,proteins |
R16478 |
T21813 |
T21815 |
nsubjpass |
proteins,detected |
R16479 |
T21814 |
T21815 |
auxpass |
were,detected |
R1648 |
T2018 |
T2005 |
punct |
.,stimulates |
R16480 |
T21815 |
T21815 |
ROOT |
detected,detected |
R16481 |
T21816 |
T21815 |
agent |
by,detected |
R16482 |
T21817 |
T21818 |
compound |
ECL,reagent |
R16483 |
T21818 |
T21816 |
pobj |
reagent,by |
R16484 |
T21819 |
T21823 |
punct |
(,Corp. |
R16485 |
T21820 |
T21823 |
compound |
GE,Corp. |
R16486 |
T21821 |
T21823 |
compound |
Healthcare,Corp. |
R16487 |
T21822 |
T21823 |
compound |
Bio-Sciences,Corp. |
R16488 |
T21823 |
T21818 |
appos |
Corp.,reagent |
R16489 |
T21824 |
T21823 |
punct |
",",Corp. |
R1649 |
T2019 |
T2035 |
advmod |
However,is |
R16490 |
T21825 |
T21823 |
npadvmod |
Piscataway,Corp. |
R16491 |
T21826 |
T21825 |
punct |
",",Piscataway |
R16492 |
T21827 |
T21825 |
conj |
NJ,Piscataway |
R16493 |
T21828 |
T21823 |
punct |
),Corp. |
R16494 |
T21829 |
T21815 |
punct |
.,detected |
R165 |
T197 |
T198 |
det |
this,report |
R1650 |
T2020 |
T2035 |
punct |
",",is |
R1651 |
T2021 |
T2026 |
mark |
whether,is |
R1652 |
T2040 |
T2038 |
pobj |
cells,In |
R1653 |
T2022 |
T2025 |
poss |
PKC,activation |
R1654 |
T2023 |
T2022 |
cc |
and/or,PKC |
R1655 |
T2024 |
T2022 |
conj |
NF-κB,PKC |
R1656 |
T2041 |
T2043 |
punct |
",",plays |
R1657 |
T2025 |
T2026 |
nsubj |
activation,is |
R1658 |
T2026 |
T2035 |
csubj |
is,is |
R16589 |
T21944 |
T21952 |
nsubjpass |
Analysis,starved |
R1659 |
T2027 |
T2026 |
acomp |
critical,is |
R16590 |
T21945 |
T21944 |
prep |
of,Analysis |
R16591 |
T21946 |
T21950 |
compound |
PKCα,MDMs |
R16592 |
T21947 |
T21950 |
compound |
Kinase,MDMs |
R16593 |
T21948 |
T21950 |
compound |
Activity,MDMs |
R16594 |
T21949 |
T21950 |
compound |
Human,MDMs |
R16595 |
T21950 |
T21945 |
pobj |
MDMs,of |
R16596 |
T21951 |
T21952 |
auxpass |
were,starved |
R16597 |
T21952 |
T21952 |
ROOT |
starved,starved |
R16598 |
T21953 |
T21952 |
prep |
for,starved |
R16599 |
T21954 |
T21955 |
nummod |
2,hours |
R166 |
T198 |
T196 |
pobj |
report,In |
R1660 |
T2028 |
T2027 |
prep |
in,critical |
R16600 |
T21955 |
T21953 |
pobj |
hours,for |
R16601 |
T21956 |
T21952 |
prep |
before,starved |
R16602 |
T21957 |
T21956 |
pobj |
stimulation,before |
R16603 |
T21958 |
T21957 |
prep |
with,stimulation |
R16604 |
T21959 |
T21958 |
pobj |
M-CSF,with |
R16605 |
T21960 |
T21959 |
punct |
(,M-CSF |
R16606 |
T21961 |
T21959 |
nummod |
0,M-CSF |
R16607 |
T21962 |
T21963 |
nummod |
60,minutes |
R16608 |
T21963 |
T21959 |
appos |
minutes,M-CSF |
R16609 |
T21964 |
T21959 |
punct |
),M-CSF |
R1661 |
T2042 |
T2043 |
nsubj |
PKC,plays |
R16610 |
T21965 |
T21967 |
punct |
",",washed |
R16611 |
T21966 |
T21967 |
advmod |
then,washed |
R16612 |
T21967 |
T21952 |
dep |
washed,starved |
R16613 |
T21968 |
T21967 |
prep |
with,washed |
R16614 |
T21969 |
T21970 |
amod |
cold,PBS |
R16615 |
T21970 |
T21968 |
pobj |
PBS,with |
R16616 |
T21971 |
T21967 |
cc |
and,washed |
R16617 |
T21972 |
T21967 |
conj |
removed,washed |
R16618 |
T21973 |
T21972 |
prep |
from,removed |
R16619 |
T21974 |
T21975 |
det |
the,plates |
R1662 |
T2029 |
T2032 |
amod |
M-CSF-stimulated,survival |
R16620 |
T21975 |
T21973 |
pobj |
plates,from |
R16621 |
T21976 |
T21967 |
punct |
.,washed |
R16622 |
T21977 |
T21978 |
det |
The,cells |
R16623 |
T21978 |
T21980 |
nsubjpass |
cells,resuspended |
R16624 |
T21979 |
T21980 |
auxpass |
were,resuspended |
R16625 |
T21980 |
T21980 |
ROOT |
resuspended,resuspended |
R16626 |
T21981 |
T21980 |
prep |
in,resuspended |
R16627 |
T21982 |
T21983 |
compound |
lysis,buffer |
R16628 |
T21983 |
T21981 |
pobj |
buffer,in |
R16629 |
T21984 |
T21987 |
punct |
(,Tris |
R1663 |
T2030 |
T2032 |
nmod |
mononuclear,survival |
R16630 |
T21985 |
T21987 |
nummod |
20,Tris |
R16631 |
T21986 |
T21987 |
compound |
mM,Tris |
R16632 |
T21987 |
T21987 |
ROOT |
Tris,Tris |
R16633 |
T21988 |
T21987 |
punct |
",",Tris |
R16634 |
T21989 |
T21991 |
nummod |
5,MgCl2 |
R16635 |
T21990 |
T21991 |
compound |
mM,MgCl2 |
R16636 |
T21991 |
T21987 |
appos |
MgCl2,Tris |
R16637 |
T21992 |
T21991 |
punct |
",",MgCl2 |
R16638 |
T21993 |
T21995 |
nummod |
1,EGTA |
R16639 |
T21994 |
T21995 |
compound |
mM,EGTA |
R1664 |
T2031 |
T2032 |
compound |
phagocyte,survival |
R16640 |
T21995 |
T21991 |
appos |
EGTA,MgCl2 |
R16641 |
T21996 |
T21995 |
punct |
",",EGTA |
R16642 |
T21997 |
T22000 |
nummod |
20,phosphate |
R16643 |
T21998 |
T22000 |
nmod |
mM,phosphate |
R16644 |
T21999 |
T22000 |
amod |
β-glycerol,phosphate |
R16645 |
T22000 |
T21995 |
appos |
phosphate,EGTA |
R16646 |
T22001 |
T22000 |
punct |
",",phosphate |
R16647 |
T22002 |
T22021 |
nsubj |
1,sonicated |
R16648 |
T22003 |
T22009 |
nmod |
mM,aprotinin |
R16649 |
T22004 |
T22009 |
nmod |
PMSF,aprotinin |
R1665 |
T2043 |
T2043 |
ROOT |
plays,plays |
R16650 |
T22005 |
T22006 |
nummod |
2,µg |
R16651 |
T22006 |
T22009 |
nmod |
µg,aprotinin |
R16652 |
T22007 |
T22009 |
nmod |
/,aprotinin |
R16653 |
T22008 |
T22009 |
compound |
ml,aprotinin |
R16654 |
T22009 |
T22021 |
nsubj |
aprotinin,sonicated |
R16655 |
T22010 |
T22009 |
cc |
and,aprotinin |
R16656 |
T22011 |
T22012 |
nummod |
2,µg |
R16657 |
T22012 |
T22015 |
nmod |
µg,leupeptin |
R16658 |
T22013 |
T22015 |
nmod |
/,leupeptin |
R16659 |
T22014 |
T22015 |
compound |
ml,leupeptin |
R1666 |
T2032 |
T2028 |
pobj |
survival,in |
R16660 |
T22015 |
T22009 |
conj |
leupeptin,aprotinin |
R16661 |
T22016 |
T22015 |
punct |
",",leupeptin |
R16662 |
T22017 |
T22015 |
appos |
pH,leupeptin |
R16663 |
T22018 |
T22017 |
nummod |
7.5,pH |
R16664 |
T22019 |
T22015 |
punct |
),leupeptin |
R16665 |
T22020 |
T22015 |
punct |
",",leupeptin |
R16666 |
T22021 |
T22000 |
conj |
sonicated,phosphate |
R16667 |
T22022 |
T22021 |
cc |
and,sonicated |
R16668 |
T22023 |
T22021 |
conj |
centrifuged,sonicated |
R16669 |
T22024 |
T22025 |
aux |
to,obtain |
R1667 |
T2033 |
T2032 |
cc |
and/or,survival |
R16670 |
T22025 |
T22023 |
advcl |
obtain,centrifuged |
R16671 |
T22026 |
T22028 |
amod |
whole,lysates |
R16672 |
T22027 |
T22028 |
compound |
cell,lysates |
R16673 |
T22028 |
T22025 |
dobj |
lysates,obtain |
R16674 |
T22029 |
T22028 |
punct |
",",lysates |
R16675 |
T22030 |
T22033 |
nsubjpass |
which,immunoprecipitated |
R16676 |
T22031 |
T22033 |
auxpass |
were,immunoprecipitated |
R16677 |
T22032 |
T22033 |
advmod |
then,immunoprecipitated |
R16678 |
T22033 |
T22028 |
relcl |
immunoprecipitated,lysates |
R16679 |
T22034 |
T22033 |
prep |
with,immunoprecipitated |
R1668 |
T2034 |
T2032 |
conj |
differentiation,survival |
R16680 |
T22035 |
T22036 |
amod |
anti-PKCα,antibody |
R16681 |
T22036 |
T22034 |
pobj |
antibody,with |
R16682 |
T22037 |
T22036 |
cc |
and,antibody |
R16683 |
T22038 |
T22039 |
compound |
protein,G-agarose |
R16684 |
T22039 |
T22036 |
conj |
G-agarose,antibody |
R16685 |
T22040 |
T22041 |
punct |
(,Invitrogen |
R16686 |
T22041 |
T22039 |
appos |
Invitrogen,G-agarose |
R16687 |
T22042 |
T22039 |
punct |
),G-agarose |
R16688 |
T22043 |
T22021 |
punct |
.,sonicated |
R16689 |
T22044 |
T22045 |
compound |
Immune,complexes |
R1669 |
T2044 |
T2046 |
det |
an,role |
R16690 |
T22045 |
T22047 |
nsubjpass |
complexes,washed |
R16691 |
T22046 |
T22047 |
auxpass |
were,washed |
R16692 |
T22047 |
T22047 |
ROOT |
washed,washed |
R16693 |
T22048 |
T22047 |
advmod |
twice,washed |
R16694 |
T22049 |
T22047 |
punct |
",",washed |
R16695 |
T22050 |
T22047 |
cc |
and,washed |
R16696 |
T22051 |
T22052 |
compound |
PKCα,activity |
R16697 |
T22052 |
T22054 |
nsubjpass |
activity,analyzed |
R16698 |
T22053 |
T22054 |
auxpass |
was,analyzed |
R16699 |
T22054 |
T22047 |
conj |
analyzed,washed |
R167 |
T199 |
T201 |
punct |
",",identify |
R1670 |
T2035 |
T2035 |
ROOT |
is,is |
R16700 |
T22055 |
T22054 |
agent |
by,analyzed |
R16701 |
T22056 |
T22059 |
amod |
non-radioactive,kit |
R16702 |
T22057 |
T22059 |
compound |
Peptag,kit |
R16703 |
T22058 |
T22059 |
compound |
assay,kit |
R16704 |
T22059 |
T22055 |
pobj |
kit,by |
R16705 |
T22060 |
T22059 |
punct |
(,kit |
R16706 |
T22061 |
T22059 |
appos |
Promega,kit |
R16707 |
T22062 |
T22059 |
punct |
),kit |
R16708 |
T22063 |
T22054 |
punct |
.,analyzed |
R16709 |
T22064 |
T22078 |
advmod |
Briefly,incubated |
R1671 |
T2036 |
T2035 |
acomp |
unclear,is |
R16710 |
T22065 |
T22078 |
punct |
",",incubated |
R16711 |
T22066 |
T22067 |
compound |
kinase,buffer |
R16712 |
T22067 |
T22078 |
nsubjpass |
buffer,incubated |
R16713 |
T22068 |
T22067 |
punct |
",",buffer |
R16714 |
T22069 |
T22067 |
conj |
activator,buffer |
R16715 |
T22070 |
T22069 |
punct |
",",activator |
R16716 |
T22071 |
T22072 |
compound |
peptide,protection |
R16717 |
T22072 |
T22073 |
compound |
protection,solution |
R16718 |
T22073 |
T22069 |
conj |
solution,activator |
R16719 |
T22074 |
T22073 |
cc |
and,solution |
R1672 |
T2037 |
T2035 |
punct |
.,is |
R16720 |
T22075 |
T22076 |
compound |
Peptag,peptide |
R16721 |
T22076 |
T22073 |
conj |
peptide,solution |
R16722 |
T22077 |
T22078 |
auxpass |
were,incubated |
R16723 |
T22078 |
T22078 |
ROOT |
incubated,incubated |
R16724 |
T22079 |
T22078 |
prep |
with,incubated |
R16725 |
T22080 |
T22082 |
det |
the,complexes |
R16726 |
T22081 |
T22082 |
amod |
immune,complexes |
R16727 |
T22082 |
T22079 |
pobj |
complexes,with |
R16728 |
T22083 |
T22082 |
prep |
at,complexes |
R16729 |
T22084 |
T22085 |
compound |
30,° |
R1673 |
T2045 |
T2046 |
amod |
important,role |
R16730 |
T22085 |
T22086 |
nummod |
°,C |
R16731 |
T22086 |
T22083 |
pobj |
C,at |
R16732 |
T22087 |
T22078 |
prep |
for,incubated |
R16733 |
T22088 |
T22089 |
nummod |
30,minutes |
R16734 |
T22089 |
T22087 |
pobj |
minutes,for |
R16735 |
T22090 |
T22078 |
punct |
.,incubated |
R16736 |
T22091 |
T22093 |
nsubjpass |
Reactions,stopped |
R16737 |
T22092 |
T22093 |
auxpass |
were,stopped |
R16738 |
T22093 |
T22093 |
ROOT |
stopped,stopped |
R16739 |
T22094 |
T22093 |
prep |
by,stopped |
R1674 |
T2046 |
T2043 |
dobj |
role,plays |
R16740 |
T22095 |
T22094 |
pcomp |
boiling,by |
R16741 |
T22096 |
T22095 |
prep |
for,boiling |
R16742 |
T22097 |
T22098 |
nummod |
10,minutes |
R16743 |
T22098 |
T22096 |
pobj |
minutes,for |
R16744 |
T22099 |
T22098 |
cc |
and,minutes |
R16745 |
T22100 |
T22098 |
conj |
samples,minutes |
R16746 |
T22101 |
T22102 |
auxpass |
were,separated |
R16747 |
T22102 |
T22093 |
advcl |
separated,stopped |
R16748 |
T22103 |
T22102 |
prep |
on,separated |
R16749 |
T22104 |
T22105 |
nummod |
0.8,% |
R1675 |
T2047 |
T2046 |
prep |
in,role |
R16750 |
T22105 |
T22107 |
nmod |
%,gel |
R16751 |
T22106 |
T22107 |
amod |
agarose,gel |
R16752 |
T22107 |
T22103 |
pobj |
gel,on |
R16753 |
T22108 |
T22093 |
punct |
.,stopped |
R16754 |
T22109 |
T22110 |
compound |
Phosphorylated,peptide |
R16755 |
T22110 |
T22111 |
nsubj |
peptide,migrated |
R16756 |
T22111 |
T22111 |
ROOT |
migrated,migrated |
R16757 |
T22112 |
T22111 |
prep |
toward,migrated |
R16758 |
T22113 |
T22114 |
det |
the,anode |
R16759 |
T22114 |
T22112 |
pobj |
anode,toward |
R1676 |
T2135 |
T2132 |
conj |
siRNA,constructs |
R16760 |
T22115 |
T22114 |
punct |
(,anode |
R16761 |
T22116 |
T22114 |
parataxis |
+,anode |
R16762 |
T22117 |
T22114 |
punct |
),anode |
R16763 |
T22118 |
T22111 |
punct |
",",migrated |
R16764 |
T22119 |
T22122 |
mark |
while,migrated |
R16765 |
T22120 |
T22121 |
compound |
non-phosphorylated,peptide |
R16766 |
T22121 |
T22122 |
nsubj |
peptide,migrated |
R16767 |
T22122 |
T22111 |
advcl |
migrated,migrated |
R16768 |
T22123 |
T22122 |
prep |
toward,migrated |
R16769 |
T22124 |
T22125 |
det |
the,cathode |
R1677 |
T2048 |
T2049 |
amod |
NF-κB,activation |
R16770 |
T22125 |
T22123 |
pobj |
cathode,toward |
R16771 |
T22126 |
T22125 |
punct |
(,cathode |
R16772 |
T22127 |
T22125 |
appos |
−,cathode |
R16773 |
T22128 |
T22125 |
punct |
),cathode |
R16774 |
T22129 |
T22111 |
punct |
.,migrated |
R16775 |
T22130 |
T22131 |
amod |
Fluorescein-tagged,peptides |
R16776 |
T22131 |
T22133 |
nsubjpass |
peptides,visualized |
R16777 |
T22132 |
T22133 |
auxpass |
were,visualized |
R16778 |
T22133 |
T22133 |
ROOT |
visualized,visualized |
R16779 |
T22134 |
T22133 |
agent |
by,visualized |
R1678 |
T2136 |
T2117 |
punct |
.,reduced |
R16780 |
T22135 |
T22136 |
compound |
UV,light |
R16781 |
T22136 |
T22134 |
pobj |
light,by |
R16782 |
T22137 |
T22133 |
punct |
.,visualized |
R1679 |
T2137 |
T2137 |
ROOT |
Conventional,Conventional |
R168 |
T200 |
T201 |
nsubj |
we,identify |
R1680 |
T2138 |
T2139 |
nsubj |
PKC,regulated |
R1681 |
T2139 |
T2139 |
ROOT |
regulated,regulated |
R1682 |
T2049 |
T2047 |
pobj |
activation,in |
R1683 |
T2140 |
T2142 |
amod |
NF-κB-regulated,expression |
R1684 |
T2141 |
T2142 |
compound |
gene,expression |
R1685 |
T2050 |
T2049 |
cc |
and,activation |
R1686 |
T2142 |
T2139 |
dobj |
expression,regulated |
R1687 |
T2143 |
T2142 |
cc |
and,expression |
R1688 |
T2051 |
T2052 |
compound |
cell,survival |
R1689 |
T2052 |
T2049 |
conj |
survival,activation |
R169 |
T201 |
T201 |
ROOT |
identify,identify |
R1690 |
T2144 |
T2142 |
conj |
phosphorylation,expression |
R1691 |
T2145 |
T2142 |
prep |
of,expression |
R1692 |
T2053 |
T2055 |
nmod |
[,] |
R1693 |
T2146 |
T2145 |
pobj |
Ser276,of |
R1694 |
T2147 |
T2146 |
prep |
of,Ser276 |
R1695 |
T2148 |
T2147 |
pobj |
NF-κB,of |
R1696 |
T2054 |
T2055 |
nummod |
35,] |
R16968 |
T22378 |
T22379 |
compound |
RNA,Isolation |
R16969 |
T22379 |
T22379 |
ROOT |
Isolation,Isolation |
R1697 |
T2149 |
T2148 |
nummod |
p65,NF-κB |
R16970 |
T22380 |
T22379 |
cc |
and,Isolation |
R16971 |
T22381 |
T22384 |
nmod |
Quantitative,MDMs |
R16972 |
T22382 |
T22384 |
amod |
Real-time,MDMs |
R16973 |
T22383 |
T22384 |
compound |
PCR,MDMs |
R16974 |
T22384 |
T22379 |
conj |
MDMs,Isolation |
R16975 |
T22385 |
T22384 |
cc |
or,MDMs |
R16976 |
T22386 |
T22384 |
conj |
RAW,MDMs |
R16977 |
T22387 |
T22388 |
nummod |
264.7,cells |
R16978 |
T22388 |
T22389 |
nsubj |
cells,were |
R16979 |
T22389 |
T22389 |
ROOT |
were,were |
R1698 |
T2150 |
T2139 |
conj |
occurred,regulated |
R16980 |
T22390 |
T22391 |
amod |
serum-starved,overnight |
R16981 |
T22391 |
T22389 |
acomp |
overnight,were |
R16982 |
T22392 |
T22389 |
cc |
or,were |
R16983 |
T22393 |
T22399 |
prep |
for,prior |
R16984 |
T22394 |
T22395 |
nummod |
2,hours |
R16985 |
T22395 |
T22393 |
pobj |
hours,for |
R16986 |
T22396 |
T22399 |
punct |
",",prior |
R16987 |
T22397 |
T22399 |
advmod |
respectively,prior |
R16988 |
T22398 |
T22399 |
punct |
",",prior |
R16989 |
T22399 |
T22389 |
conj |
prior,were |
R1699 |
T2055 |
T2073 |
nsubjpass |
],known |
R16990 |
T22400 |
T22399 |
prep |
to,prior |
R16991 |
T22401 |
T22400 |
pobj |
incubating,to |
R16992 |
T22402 |
T22401 |
prep |
with,incubating |
R16993 |
T22403 |
T22402 |
pobj |
inhibitors,with |
R16994 |
T22404 |
T22403 |
prep |
for,inhibitors |
R16995 |
T22405 |
T22406 |
nummod |
30,minutes |
R16996 |
T22406 |
T22404 |
pobj |
minutes,for |
R16997 |
T22407 |
T22399 |
punct |
.,prior |
R16998 |
T22408 |
T22409 |
det |
The,cells |
R16999 |
T22409 |
T22411 |
nsubjpass |
cells,restimulated |
R170 |
T202 |
T203 |
amod |
conventional,PKCs |
R1700 |
T2151 |
T2150 |
prep |
in,occurred |
R17000 |
T22410 |
T22411 |
auxpass |
were,restimulated |
R17001 |
T22411 |
T22411 |
ROOT |
restimulated,restimulated |
R17002 |
T22412 |
T22411 |
prep |
with,restimulated |
R17003 |
T22413 |
T22415 |
nummod |
100,M-CSF |
R17004 |
T22414 |
T22415 |
compound |
ng/ml,M-CSF |
R17005 |
T22415 |
T22412 |
pobj |
M-CSF,with |
R17006 |
T22416 |
T22415 |
cc |
and,M-CSF |
R17007 |
T22417 |
T22418 |
amod |
total,mRNA |
R17008 |
T22418 |
T22415 |
conj |
mRNA,M-CSF |
R17009 |
T22419 |
T22420 |
auxpass |
was,extracted |
R1701 |
T2152 |
T2154 |
det |
an,fashion |
R17010 |
T22420 |
T22411 |
conj |
extracted,restimulated |
R17011 |
T22421 |
T22420 |
prep |
from,extracted |
R17012 |
T22422 |
T22421 |
pobj |
cells,from |
R17013 |
T22423 |
T22422 |
prep |
with,cells |
R17014 |
T22424 |
T22423 |
pobj |
Trizol,with |
R17015 |
T22425 |
T22424 |
punct |
(,Trizol |
R17016 |
T22426 |
T22424 |
appos |
Invitrogen,Trizol |
R17017 |
T22427 |
T22424 |
punct |
),Trizol |
R17018 |
T22428 |
T22422 |
cc |
and,cells |
R17019 |
T22429 |
T22422 |
conj |
1,cells |
R1702 |
T2153 |
T2154 |
amod |
M-CSF-dependent,fashion |
R17020 |
T22430 |
T22431 |
nummod |
2,µg |
R17021 |
T22431 |
T22436 |
nsubjpass |
µg,used |
R17022 |
T22432 |
T22431 |
prep |
of,µg |
R17023 |
T22433 |
T22434 |
amod |
total,RNA |
R17024 |
T22434 |
T22432 |
pobj |
RNA,of |
R17025 |
T22435 |
T22436 |
auxpass |
was,used |
R17026 |
T22436 |
T22436 |
ROOT |
used,used |
R17027 |
T22437 |
T22436 |
prep |
to,used |
R17028 |
T22438 |
T22439 |
amod |
synthesized,cDNA |
R17029 |
T22439 |
T22437 |
pobj |
cDNA,to |
R1703 |
T2056 |
T2060 |
punct |
",",mechanisms |
R17030 |
T22440 |
T22436 |
advcl |
using,used |
R17031 |
T22441 |
T22442 |
compound |
SuperScript,III |
R17032 |
T22442 |
T22440 |
dobj |
III,using |
R17033 |
T22443 |
T22442 |
punct |
(,III |
R17034 |
T22444 |
T22442 |
appos |
Invitrogen,III |
R17035 |
T22445 |
T22442 |
punct |
),III |
R17036 |
T22446 |
T22436 |
punct |
.,used |
R17037 |
T22447 |
T22455 |
amod |
Quantitative,performed |
R17038 |
T22448 |
T22455 |
npadvmod |
real-time,performed |
R17039 |
T22449 |
T22450 |
punct |
(,qRT |
R1704 |
T2154 |
T2151 |
pobj |
fashion,in |
R17040 |
T22450 |
T22448 |
appos |
qRT,real-time |
R17041 |
T22451 |
T22450 |
punct |
),qRT |
R17042 |
T22452 |
T22453 |
punct |
-,PCR |
R17043 |
T22453 |
T22455 |
nsubjpass |
PCR,performed |
R17044 |
T22454 |
T22455 |
auxpass |
was,performed |
R17045 |
T22455 |
T22455 |
ROOT |
performed,performed |
R17046 |
T22456 |
T22455 |
advcl |
using,performed |
R17047 |
T22457 |
T22460 |
compound |
SYBR,Mix |
R17048 |
T22458 |
T22460 |
compound |
Green,Mix |
R17049 |
T22459 |
T22460 |
compound |
Master,Mix |
R1705 |
T2155 |
T2154 |
acl |
correlating,fashion |
R17050 |
T22460 |
T22456 |
dobj |
Mix,using |
R17051 |
T22461 |
T22460 |
punct |
(,Mix |
R17052 |
T22462 |
T22463 |
compound |
Applied,BioSystems |
R17053 |
T22463 |
T22460 |
appos |
BioSystems,Mix |
R17054 |
T22464 |
T22463 |
punct |
",",BioSystems |
R17055 |
T22465 |
T22463 |
conj |
Carlsbad,BioSystems |
R17056 |
T22466 |
T22465 |
punct |
",",Carlsbad |
R17057 |
T22467 |
T22465 |
conj |
CA,Carlsbad |
R17058 |
T22468 |
T22460 |
punct |
),Mix |
R17059 |
T22469 |
T22455 |
punct |
.,performed |
R1706 |
T2156 |
T2155 |
prep |
with,correlating |
R17060 |
T22470 |
T22471 |
det |
The,reactions |
R17061 |
T22471 |
T22473 |
nsubjpass |
reactions,performed |
R17062 |
T22472 |
T22473 |
auxpass |
were,performed |
R17063 |
T22473 |
T22473 |
ROOT |
performed,performed |
R17064 |
T22474 |
T22473 |
advcl |
using,performed |
R17065 |
T22475 |
T22479 |
det |
an,machine |
R17066 |
T22476 |
T22477 |
compound |
ABI,PRIZM |
R17067 |
T22477 |
T22479 |
nmod |
PRIZM,machine |
R17068 |
T22478 |
T22479 |
nummod |
7700,machine |
R17069 |
T22479 |
T22474 |
dobj |
machine,using |
R1707 |
T2057 |
T2060 |
advmod |
however,mechanisms |
R17070 |
T22480 |
T22474 |
prep |
with,using |
R17071 |
T22481 |
T22483 |
compound |
software,Detector |
R17072 |
T22482 |
T22483 |
compound |
Sequence,Detector |
R17073 |
T22483 |
T22484 |
compound |
Detector,version |
R17074 |
T22484 |
T22480 |
pobj |
version,with |
R17075 |
T22485 |
T22484 |
nummod |
1.7,version |
R17076 |
T22486 |
T22488 |
punct |
(,Biosystems |
R17077 |
T22487 |
T22488 |
compound |
Applied,Biosystems |
R17078 |
T22488 |
T22484 |
appos |
Biosystems,version |
R17079 |
T22489 |
T22473 |
punct |
),performed |
R1708 |
T2157 |
T2160 |
poss |
its,activity |
R17080 |
T22490 |
T22473 |
punct |
.,performed |
R17081 |
T22491 |
T22494 |
det |
The,values |
R17082 |
T22492 |
T22493 |
compound |
target,gene |
R17083 |
T22493 |
T22494 |
compound |
gene,values |
R17084 |
T22494 |
T22495 |
nsubj |
values,were |
R17085 |
T22495 |
T22495 |
ROOT |
were,were |
R17086 |
T22496 |
T22495 |
acomp |
normalized,were |
R17087 |
T22497 |
T22496 |
prep |
to,normalized |
R17088 |
T22498 |
T22499 |
det |
the,values |
R17089 |
T22499 |
T22497 |
pobj |
values,to |
R1709 |
T2158 |
T2160 |
amod |
maximal,activity |
R17090 |
T22500 |
T22499 |
prep |
of,values |
R17091 |
T22501 |
T22500 |
pobj |
GAPDH,of |
R17092 |
T22502 |
T22496 |
prep |
as,normalized |
R17093 |
T22503 |
T22505 |
det |
a,gene |
R17094 |
T22504 |
T22505 |
compound |
housekeeping,gene |
R17095 |
T22505 |
T22502 |
pobj |
gene,as |
R17096 |
T22506 |
T22496 |
cc |
and,normalized |
R17097 |
T22507 |
T22496 |
conj |
expressed,normalized |
R17098 |
T22508 |
T22507 |
prep |
as,expressed |
R17099 |
T22509 |
T22511 |
amod |
relative,increase |
R171 |
T203 |
T201 |
dobj |
PKCs,identify |
R1710 |
T2058 |
T2060 |
det |
the,mechanisms |
R17100 |
T22510 |
T22511 |
compound |
fold,increase |
R17101 |
T22511 |
T22508 |
pobj |
increase,as |
R17102 |
T22512 |
T22511 |
nummod |
2,increase |
R17103 |
T22513 |
T22515 |
punct |
(,ΔΔCt |
R17104 |
T22514 |
T22515 |
compound |
−,ΔΔCt |
R17105 |
T22515 |
T22511 |
appos |
ΔΔCt,increase |
R17106 |
T22516 |
T22515 |
punct |
),ΔΔCt |
R17107 |
T22517 |
T22511 |
prep |
over,increase |
R17108 |
T22518 |
T22520 |
det |
the,samples |
R17109 |
T22519 |
T22520 |
amod |
non-stimulated,samples |
R1711 |
T2159 |
T2160 |
amod |
transcriptional,activity |
R17110 |
T22520 |
T22517 |
pobj |
samples,over |
R17111 |
T22521 |
T22522 |
punct |
(,NS |
R17112 |
T22522 |
T22520 |
appos |
NS,samples |
R17113 |
T22523 |
T22495 |
punct |
),were |
R17114 |
T22524 |
T22495 |
punct |
.,were |
R1712 |
T2160 |
T2156 |
pobj |
activity,with |
R1713 |
T2161 |
T2139 |
punct |
.,regulated |
R1714 |
T2059 |
T2060 |
amod |
specific,mechanisms |
R1715 |
T2162 |
T2171 |
advmod |
Furthermore,plays |
R1716 |
T2163 |
T2171 |
punct |
",",plays |
R1717 |
T2164 |
T2165 |
amod |
PKCα-regulated,phosphorylation |
R1718 |
T2060 |
T2073 |
nsubjpass |
mechanisms,known |
R1719 |
T2165 |
T2171 |
nsubj |
phosphorylation,plays |
R172 |
T204 |
T203 |
punct |
",",PKCs |
R1720 |
T2166 |
T2165 |
prep |
of,phosphorylation |
R1721 |
T2167 |
T2166 |
pobj |
Ser276,of |
R1722 |
T2168 |
T2167 |
prep |
of,Ser276 |
R1723 |
T2169 |
T2168 |
pobj |
NF-κB,of |
R1724 |
T2170 |
T2169 |
nummod |
p65,NF-κB |
R1725 |
T2171 |
T2171 |
ROOT |
plays,plays |
R1726 |
T2061 |
T2060 |
prep |
of,mechanisms |
R1727 |
T2172 |
T2174 |
det |
an,role |
R1728 |
T2173 |
T2174 |
amod |
important,role |
R17289 |
T22732 |
T22733 |
compound |
Ethics,Statement |
R1729 |
T2174 |
T2171 |
dobj |
role,plays |
R17290 |
T22733 |
T22735 |
compound |
Statement,research |
R17291 |
T22734 |
T22735 |
compound |
All,research |
R17292 |
T22735 |
T22744 |
nsubjpass |
research,ordered |
R17293 |
T22736 |
T22735 |
acl |
involving,research |
R17294 |
T22737 |
T22738 |
amod |
human,blood |
R17295 |
T22738 |
T22736 |
dobj |
blood,involving |
R17296 |
T22739 |
T22741 |
punct |
(,coat |
R17297 |
T22740 |
T22741 |
compound |
Buffy,coat |
R17298 |
T22741 |
T22738 |
appos |
coat,blood |
R17299 |
T22742 |
T22735 |
punct |
),research |
R173 |
T205 |
T203 |
prep |
including,PKCs |
R1730 |
T2175 |
T2174 |
prep |
in,role |
R17300 |
T22743 |
T22744 |
auxpass |
were,ordered |
R17301 |
T22744 |
T22744 |
ROOT |
ordered,ordered |
R17302 |
T22745 |
T22744 |
prep |
from,ordered |
R17303 |
T22746 |
T22748 |
amod |
American,cross |
R17304 |
T22747 |
T22748 |
compound |
Red,cross |
R17305 |
T22748 |
T22745 |
pobj |
cross,from |
R17306 |
T22749 |
T22744 |
cc |
and,ordered |
R17307 |
T22750 |
T22752 |
aux |
have,approved |
R17308 |
T22751 |
T22752 |
auxpass |
been,approved |
R17309 |
T22752 |
T22744 |
conj |
approved,ordered |
R1731 |
T2062 |
T2063 |
det |
this,activation |
R17310 |
T22753 |
T22752 |
agent |
by,approved |
R17311 |
T22754 |
T22759 |
det |
the,board |
R17312 |
T22755 |
T22757 |
compound |
Ohio,University |
R17313 |
T22756 |
T22757 |
compound |
State,University |
R17314 |
T22757 |
T22759 |
compound |
University,board |
R17315 |
T22758 |
T22759 |
compound |
review,board |
R17316 |
T22759 |
T22753 |
pobj |
board,by |
R17317 |
T22760 |
T22763 |
punct |
(,Protocol |
R17318 |
T22761 |
T22763 |
compound |
ARC,Protocol |
R17319 |
T22762 |
T22763 |
compound |
IRB,Protocol |
R1732 |
T2176 |
T2175 |
pcomp |
regulating,in |
R17320 |
T22763 |
T22759 |
appos |
Protocol,board |
R17321 |
T22764 |
T22763 |
nummod |
#,Protocol |
R17322 |
T22765 |
T22764 |
npadvmod |
2001-26,# |
R17323 |
T22766 |
T22763 |
punct |
),Protocol |
R17324 |
T22767 |
T22744 |
punct |
.,ordered |
R1733 |
T2177 |
T2178 |
poss |
its,activity |
R1734 |
T2178 |
T2176 |
dobj |
activity,regulating |
R1735 |
T2063 |
T2061 |
pobj |
activation,of |
R1736 |
T2179 |
T2176 |
prep |
in,regulating |
R17362 |
T22818 |
T22819 |
nsubj |
M-CSF,induces |
R17363 |
T22819 |
T22819 |
ROOT |
induces,induces |
R17364 |
T22820 |
T22822 |
amod |
NF-κB,activity |
R17365 |
T22821 |
T22822 |
amod |
transcriptional,activity |
R17366 |
T22822 |
T22819 |
dobj |
activity,induces |
R17367 |
T22823 |
T22822 |
prep |
in,activity |
R17368 |
T22824 |
T22823 |
pobj |
macrophages,in |
R17369 |
T22825 |
T22819 |
punct |
.,induces |
R1737 |
T2180 |
T2181 |
compound |
mononuclear,phagocytes |
R17370 |
T22826 |
T22831 |
punct |
(,extracted |
R17371 |
T22827 |
T22829 |
nmod |
A,Nuclei |
R17372 |
T22828 |
T22827 |
punct |
),A |
R17373 |
T22829 |
T22831 |
nsubjpass |
Nuclei,extracted |
R17374 |
T22830 |
T22831 |
auxpass |
were,extracted |
R17375 |
T22831 |
T22831 |
ROOT |
extracted,extracted |
R17376 |
T22832 |
T22831 |
prep |
from,extracted |
R17377 |
T22833 |
T22834 |
amod |
human,MDMs |
R17378 |
T22834 |
T22832 |
pobj |
MDMs,from |
R17379 |
T22835 |
T22831 |
conj |
treated,extracted |
R1738 |
T2181 |
T2179 |
pobj |
phagocytes,in |
R17380 |
T22836 |
T22835 |
prep |
without,treated |
R17381 |
T22837 |
T22836 |
cc |
or,without |
R17382 |
T22838 |
T22836 |
conj |
with,without |
R17383 |
T22839 |
T22838 |
pobj |
M-CSF,with |
R17384 |
T22840 |
T22835 |
prep |
for,treated |
R17385 |
T22841 |
T22844 |
nummod |
15,minutes |
R17386 |
T22842 |
T22841 |
cc |
or,15 |
R17387 |
T22843 |
T22841 |
conj |
30,15 |
R17388 |
T22844 |
T22840 |
pobj |
minutes,for |
R17389 |
T22845 |
T22831 |
punct |
.,extracted |
R1739 |
T2064 |
T2063 |
cc |
and,activation |
R17390 |
T22846 |
T22847 |
compound |
NF-κB,DNA |
R17391 |
T22847 |
T22849 |
compound |
DNA,activity |
R17392 |
T22848 |
T22849 |
amod |
binding,activity |
R17393 |
T22849 |
T22851 |
nsubjpass |
activity,analyzed |
R17394 |
T22850 |
T22851 |
auxpass |
was,analyzed |
R17395 |
T22851 |
T22851 |
ROOT |
analyzed,analyzed |
R17396 |
T22852 |
T22851 |
agent |
by,analyzed |
R17397 |
T22853 |
T22854 |
compound |
EMSA,Shown |
R17398 |
T22854 |
T22852 |
pobj |
Shown,by |
R17399 |
T22855 |
T22851 |
conj |
is,analyzed |
R174 |
T206 |
T205 |
pobj |
PKCα,including |
R1740 |
T2182 |
T2181 |
cc |
and,phagocytes |
R17400 |
T22856 |
T22858 |
det |
a,blot |
R17401 |
T22857 |
T22858 |
amod |
representative,blot |
R17402 |
T22858 |
T22855 |
attr |
blot,is |
R17403 |
T22859 |
T22858 |
prep |
from,blot |
R17404 |
T22860 |
T22862 |
nummod |
three,experiments |
R17405 |
T22861 |
T22862 |
amod |
independent,experiments |
R17406 |
T22862 |
T22859 |
pobj |
experiments,from |
R17407 |
T22863 |
T22851 |
punct |
.,analyzed |
R17408 |
T22864 |
T22864 |
ROOT |
NS,NS |
R17409 |
T22865 |
T22864 |
punct |
:,NS |
R1741 |
T2183 |
T2185 |
amod |
murine,fibroblasts |
R17410 |
T22866 |
T22864 |
acl |
non-stimulated,NS |
R17411 |
T22867 |
T22864 |
punct |
.,NS |
R17412 |
T22868 |
T22874 |
punct |
(,transfected |
R17413 |
T22869 |
T22874 |
dep |
B,transfected |
R17414 |
T22870 |
T22869 |
punct |
),B |
R17415 |
T22871 |
T22872 |
compound |
Human,MDMs |
R17416 |
T22872 |
T22874 |
nsubj |
MDMs,transfected |
R17417 |
T22873 |
T22874 |
advmod |
transiently,transfected |
R17418 |
T22874 |
T22874 |
ROOT |
transfected,transfected |
R17419 |
T22875 |
T22874 |
prep |
with,transfected |
R1742 |
T2184 |
T2185 |
amod |
embryonic,fibroblasts |
R17420 |
T22876 |
T22879 |
amod |
pTAL-SEAP,constructs |
R17421 |
T22877 |
T22876 |
cc |
or,pTAL-SEAP |
R17422 |
T22878 |
T22876 |
conj |
pNF-κB-SEAP,pTAL-SEAP |
R17423 |
T22879 |
T22875 |
pobj |
constructs,with |
R17424 |
T22880 |
T22881 |
auxpass |
were,treated |
R17425 |
T22881 |
T22874 |
dep |
treated,transfected |
R17426 |
T22882 |
T22881 |
prep |
with,treated |
R17427 |
T22883 |
T22882 |
pobj |
M-CSF,with |
R17428 |
T22884 |
T22883 |
prep |
in,M-CSF |
R17429 |
T22885 |
T22886 |
compound |
X-vivo,medium |
R1743 |
T2065 |
T2067 |
det |
the,effects |
R17430 |
T22886 |
T22884 |
pobj |
medium,in |
R17431 |
T22887 |
T22881 |
cc |
and,treated |
R17432 |
T22888 |
T22881 |
conj |
incubated,treated |
R17433 |
T22889 |
T22888 |
prep |
for,incubated |
R17434 |
T22890 |
T22891 |
nummod |
6,hours |
R17435 |
T22891 |
T22889 |
pobj |
hours,for |
R17436 |
T22892 |
T22888 |
advmod |
before,incubated |
R17437 |
T22893 |
T22894 |
det |
the,collection |
R17438 |
T22894 |
T22892 |
pobj |
collection,before |
R17439 |
T22895 |
T22894 |
prep |
of,collection |
R1744 |
T2185 |
T2181 |
conj |
fibroblasts,phagocytes |
R17440 |
T22896 |
T22895 |
pobj |
medium,of |
R17441 |
T22897 |
T22874 |
punct |
.,transfected |
R17442 |
T22898 |
T22899 |
amod |
NF-κB,activity |
R17443 |
T22899 |
T22901 |
nsubjpass |
activity,analyzed |
R17444 |
T22900 |
T22901 |
auxpass |
was,analyzed |
R17445 |
T22901 |
T22901 |
ROOT |
analyzed,analyzed |
R17446 |
T22902 |
T22901 |
prep |
by,analyzed |
R17447 |
T22903 |
T22902 |
pcomp |
measuring,by |
R17448 |
T22904 |
T22905 |
det |
the,amount |
R17449 |
T22905 |
T22903 |
dobj |
amount,measuring |
R1745 |
T2186 |
T2171 |
punct |
.,plays |
R17450 |
T22906 |
T22905 |
prep |
of,amount |
R17451 |
T22907 |
T22906 |
pobj |
SEAP,of |
R17452 |
T22908 |
T22901 |
conj |
secreted,analyzed |
R17453 |
T22909 |
T22908 |
prep |
into,secreted |
R17454 |
T22910 |
T22911 |
det |
the,medium |
R17455 |
T22911 |
T22909 |
pobj |
medium,into |
R17456 |
T22912 |
T22911 |
cc |
and,medium |
R17457 |
T22913 |
T22911 |
conj |
data,medium |
R17458 |
T22914 |
T22915 |
auxpass |
are,expressed |
R17459 |
T22915 |
T22915 |
ROOT |
expressed,expressed |
R1746 |
T2066 |
T2067 |
amod |
biological,effects |
R17460 |
T22916 |
T22915 |
prep |
as,expressed |
R17461 |
T22917 |
T22918 |
compound |
fold,increase |
R17462 |
T22918 |
T22916 |
pobj |
increase,as |
R17463 |
T22919 |
T22918 |
prep |
of,increase |
R17464 |
T22920 |
T22921 |
compound |
SEAP,activity |
R17465 |
T22921 |
T22919 |
pobj |
activity,of |
R17466 |
T22922 |
T22921 |
prep |
over,activity |
R17467 |
T22923 |
T22922 |
pobj |
that,over |
R17468 |
T22924 |
T22921 |
prep |
in,activity |
R17469 |
T22925 |
T22928 |
amod |
pTAL-SEAP,cells |
R1747 |
T2067 |
T2063 |
conj |
effects,activation |
R17470 |
T22926 |
T22928 |
amod |
transfected,cells |
R17471 |
T22927 |
T22928 |
amod |
resting,cells |
R17472 |
T22928 |
T22924 |
pobj |
cells,in |
R17473 |
T22929 |
T22901 |
punct |
.,analyzed |
R17474 |
T22930 |
T22933 |
punct |
(,RAW |
R17475 |
T22931 |
T22933 |
nmod |
C,RAW |
R17476 |
T22932 |
T22933 |
punct |
),RAW |
R17477 |
T22933 |
T22938 |
nsubjpass |
RAW,transfected |
R17478 |
T22934 |
T22935 |
nummod |
264.7,cells |
R17479 |
T22935 |
T22938 |
nsubjpass |
cells,transfected |
R1748 |
T2068 |
T2067 |
prep |
on,effects |
R17480 |
T22936 |
T22938 |
auxpass |
were,transfected |
R17481 |
T22937 |
T22938 |
advmod |
transiently,transfected |
R17482 |
T22938 |
T22938 |
ROOT |
transfected,transfected |
R17483 |
T22939 |
T22938 |
prep |
with,transfected |
R17484 |
T22940 |
T22939 |
pobj |
pTAL-SEAP,with |
R17485 |
T22941 |
T22940 |
cc |
or,pTAL-SEAP |
R17486 |
T22942 |
T22940 |
conj |
pNF-κB-SEAP,pTAL-SEAP |
R17487 |
T22943 |
T22938 |
conj |
construct,transfected |
R17488 |
T22944 |
T22938 |
punct |
.,transfected |
R17489 |
T22945 |
T22948 |
nsubjpass |
Cells,starved |
R1749 |
T2069 |
T2070 |
amod |
cellular,phenotype |
R17490 |
T22946 |
T22948 |
auxpass |
were,starved |
R17491 |
T22947 |
T22948 |
advmod |
serum,starved |
R17492 |
T22948 |
T22948 |
ROOT |
starved,starved |
R17493 |
T22949 |
T22948 |
prep |
for,starved |
R17494 |
T22950 |
T22951 |
nummod |
4,hours |
R17495 |
T22951 |
T22949 |
pobj |
hours,for |
R17496 |
T22952 |
T22948 |
advmod |
prior,starved |
R17497 |
T22953 |
T22952 |
prep |
to,prior |
R17498 |
T22954 |
T22955 |
nummod |
2,hours |
R17499 |
T22955 |
T22953 |
pobj |
hours,to |
R175 |
T207 |
T201 |
prep |
as,identify |
R1750 |
T2070 |
T2068 |
pobj |
phenotype,on |
R17500 |
T22956 |
T22948 |
advcl |
stimulation,starved |
R17501 |
T22957 |
T22956 |
prep |
with,stimulation |
R17502 |
T22958 |
T22960 |
amod |
mouse,M-CSF |
R17503 |
T22959 |
T22960 |
amod |
recombinant,M-CSF |
R17504 |
T22960 |
T22957 |
pobj |
M-CSF,with |
R17505 |
T22961 |
T22963 |
punct |
(,ng/ml |
R17506 |
T22962 |
T22963 |
nummod |
100,ng/ml |
R17507 |
T22963 |
T22960 |
appos |
ng/ml,M-CSF |
R17508 |
T22964 |
T22963 |
punct |
),ng/ml |
R17509 |
T22965 |
T22948 |
punct |
.,starved |
R1751 |
T2071 |
T2073 |
auxpass |
are,known |
R17510 |
T22966 |
T22967 |
compound |
Culture,media |
R17511 |
T22967 |
T22969 |
nsubjpass |
media,collected |
R17512 |
T22968 |
T22969 |
auxpass |
was,collected |
R17513 |
T22969 |
T22969 |
ROOT |
collected,collected |
R17514 |
T22970 |
T22971 |
aux |
to,measure |
R17515 |
T22971 |
T22969 |
xcomp |
measure,collected |
R17516 |
T22972 |
T22973 |
compound |
SEAP,production |
R17517 |
T22973 |
T22971 |
dobj |
production,measure |
R17518 |
T22974 |
T22969 |
punct |
.,collected |
R17519 |
T22975 |
T22977 |
nsubjpass |
Data,expressed |
R1752 |
T2072 |
T2073 |
neg |
not,known |
R17520 |
T22976 |
T22977 |
auxpass |
are,expressed |
R17521 |
T22977 |
T22977 |
ROOT |
expressed,expressed |
R17522 |
T22978 |
T22980 |
amod |
mean,S.E.M |
R17523 |
T22979 |
T22980 |
compound |
±,S.E.M |
R17524 |
T22980 |
T22977 |
dobj |
S.E.M,expressed |
R17525 |
T22981 |
T22977 |
punct |
",",expressed |
R17526 |
T22982 |
T22977 |
prep |
for,expressed |
R17527 |
T22983 |
T22985 |
nummod |
three,experiments |
R17528 |
T22984 |
T22985 |
amod |
independent,experiments |
R17529 |
T22985 |
T22982 |
pobj |
experiments,for |
R1753 |
T2073 |
T2073 |
ROOT |
known,known |
R17530 |
T22986 |
T22977 |
punct |
.,expressed |
R176 |
T208 |
T210 |
amod |
important,kinases |
R1760 |
T2074 |
T2073 |
punct |
.,known |
R1761 |
T2075 |
T2078 |
advmod |
Therefore,focused |
R1767 |
T2076 |
T2078 |
punct |
",",focused |
R177 |
T209 |
T210 |
compound |
upstream,kinases |
R1770 |
T2077 |
T2078 |
nsubj |
we,focused |
R17701 |
T23222 |
T23225 |
nsubj |
Inhibition,reduces |
R17702 |
T23223 |
T23222 |
prep |
of,Inhibition |
R17703 |
T23224 |
T23223 |
pobj |
PKC,of |
R17704 |
T23225 |
T23225 |
ROOT |
reduces,reduces |
R17705 |
T23226 |
T23227 |
amod |
NF-κB,activity |
R17706 |
T23227 |
T23225 |
dobj |
activity,reduces |
R17707 |
T23228 |
T23225 |
prep |
in,reduces |
R17708 |
T23229 |
T23228 |
pobj |
M-CSF,in |
R17709 |
T23230 |
T23225 |
advcl |
stimulated,reduces |
R17710 |
T23231 |
T23230 |
dobj |
macrophages,stimulated |
R17711 |
T23232 |
T23225 |
punct |
.,reduces |
R17712 |
T23233 |
T23233 |
ROOT |
(,( |
R17713 |
T23234 |
T23233 |
dep |
A,( |
R17714 |
T23235 |
T23234 |
punct |
),A |
R17715 |
T23236 |
T23237 |
compound |
Human,MDMs |
R17716 |
T23237 |
T23238 |
nsubj |
MDMs,transfected |
R17717 |
T23238 |
T23238 |
ROOT |
transfected,transfected |
R17718 |
T23239 |
T23238 |
prep |
with,transfected |
R17719 |
T23240 |
T23239 |
pobj |
pNF-κB-SEAP,with |
R17720 |
T23241 |
T23242 |
auxpass |
were,pre-incubated |
R17721 |
T23242 |
T23238 |
conj |
pre-incubated,transfected |
R17722 |
T23243 |
T23242 |
prep |
with,pre-incubated |
R17723 |
T23244 |
T23243 |
pobj |
inhibitors,with |
R17724 |
T23245 |
T23255 |
punct |
;,prior |
R17725 |
T23246 |
T23255 |
nsubj |
Ro-31-8220,prior |
R17726 |
T23247 |
T23246 |
punct |
",",Ro-31-8220 |
R17727 |
T23248 |
T23246 |
conj |
Gö-6976,Ro-31-8220 |
R17728 |
T23249 |
T23248 |
punct |
",",Gö-6976 |
R17729 |
T23250 |
T23248 |
cc |
or,Gö-6976 |
R17730 |
T23251 |
T23248 |
conj |
BAPTA/AM,Gö-6976 |
R17731 |
T23252 |
T23246 |
prep |
for,Ro-31-8220 |
R17732 |
T23253 |
T23254 |
nummod |
30,minutes |
R17733 |
T23254 |
T23252 |
pobj |
minutes,for |
R17734 |
T23255 |
T23260 |
amod |
prior,stimulation |
R17735 |
T23256 |
T23258 |
quantmod |
to,hours |
R17736 |
T23257 |
T23258 |
nummod |
6,hours |
R17737 |
T23258 |
T23259 |
npadvmod |
hours,M-CSF |
R17738 |
T23259 |
T23260 |
compound |
M-CSF,stimulation |
R17739 |
T23260 |
T23242 |
npadvmod |
stimulation,pre-incubated |
R17740 |
T23261 |
T23238 |
punct |
.,transfected |
R17741 |
T23262 |
T23265 |
punct |
(,RAW |
R17742 |
T23263 |
T23265 |
nmod |
B,RAW |
R17743 |
T23264 |
T23265 |
punct |
),RAW |
R17744 |
T23265 |
T23272 |
npadvmod |
RAW,construct |
R17745 |
T23266 |
T23265 |
nummod |
264.7,RAW |
R17746 |
T23267 |
T23272 |
nsubj |
cells,construct |
R17747 |
T23268 |
T23267 |
acl |
transfected,cells |
R17748 |
T23269 |
T23268 |
prep |
with,transfected |
R17749 |
T23270 |
T23271 |
det |
the,pNF-κB-SEAP |
R17750 |
T23271 |
T23269 |
pobj |
pNF-κB-SEAP,with |
R17751 |
T23272 |
T23272 |
ROOT |
construct,construct |
R17752 |
T23273 |
T23274 |
auxpass |
were,pre-incubated |
R17753 |
T23274 |
T23272 |
ccomp |
pre-incubated,construct |
R17754 |
T23275 |
T23274 |
prep |
with,pre-incubated |
R17755 |
T23276 |
T23275 |
pobj |
inhibitors,with |
R17756 |
T23277 |
T23276 |
prep |
for,inhibitors |
R17757 |
T23278 |
T23279 |
nummod |
30,minutes |
R17758 |
T23279 |
T23277 |
pobj |
minutes,for |
R17759 |
T23280 |
T23274 |
advmod |
prior,pre-incubated |
R1776 |
T2078 |
T2078 |
ROOT |
focused,focused |
R17760 |
T23281 |
T23280 |
prep |
to,prior |
R17761 |
T23282 |
T23283 |
nummod |
2,hours |
R17762 |
T23283 |
T23281 |
pobj |
hours,to |
R17763 |
T23284 |
T23283 |
prep |
of,hours |
R17764 |
T23285 |
T23284 |
pobj |
stimulation,of |
R17765 |
T23286 |
T23274 |
prep |
with,pre-incubated |
R17766 |
T23287 |
T23289 |
compound |
mouse,M-CSF |
R17767 |
T23288 |
T23289 |
amod |
recombinant,M-CSF |
R17768 |
T23289 |
T23286 |
pobj |
M-CSF,with |
R17769 |
T23290 |
T23272 |
punct |
.,construct |
R17770 |
T23291 |
T23293 |
det |
The,activity |
R17771 |
T23292 |
T23293 |
amod |
NF-κB,activity |
R17772 |
T23293 |
T23295 |
nsubjpass |
activity,analyzed |
R17773 |
T23294 |
T23295 |
auxpass |
was,analyzed |
R17774 |
T23295 |
T23295 |
ROOT |
analyzed,analyzed |
R17775 |
T23296 |
T23295 |
agent |
by,analyzed |
R17776 |
T23297 |
T23296 |
pcomp |
measuring,by |
R17777 |
T23298 |
T23299 |
compound |
SEAP,production |
R17778 |
T23299 |
T23297 |
dobj |
production,measuring |
R17779 |
T23300 |
T23299 |
prep |
in,production |
R17780 |
T23301 |
T23302 |
det |
the,medium |
R17781 |
T23302 |
T23300 |
pobj |
medium,in |
R17782 |
T23303 |
T23302 |
cc |
and,medium |
R17783 |
T23304 |
T23302 |
conj |
data,medium |
R17784 |
T23305 |
T23306 |
auxpass |
are,expressed |
R17785 |
T23306 |
T23295 |
advcl |
expressed,analyzed |
R17786 |
T23307 |
T23306 |
prep |
as,expressed |
R17787 |
T23308 |
T23309 |
compound |
fold,increase |
R17788 |
T23309 |
T23307 |
pobj |
increase,as |
R17789 |
T23310 |
T23309 |
prep |
of,increase |
R17790 |
T23311 |
T23312 |
compound |
SEAP,activity |
R17791 |
T23312 |
T23310 |
pobj |
activity,of |
R17792 |
T23313 |
T23312 |
prep |
over,activity |
R17793 |
T23314 |
T23313 |
pobj |
that,over |
R17794 |
T23315 |
T23312 |
prep |
in,activity |
R17795 |
T23316 |
T23319 |
amod |
pTAL-SEAP,cells |
R17796 |
T23317 |
T23319 |
amod |
transfected,cells |
R17797 |
T23318 |
T23319 |
amod |
resting,cells |
R17798 |
T23319 |
T23315 |
pobj |
cells,in |
R17799 |
T23320 |
T23295 |
punct |
.,analyzed |
R178 |
T210 |
T207 |
pobj |
kinases,as |
R1780 |
T2079 |
T2078 |
prep |
at,focused |
R17800 |
T23321 |
T23322 |
det |
The,graph |
R17801 |
T23322 |
T23323 |
nsubj |
graph,represents |
R17802 |
T23323 |
T23323 |
ROOT |
represents,represents |
R17803 |
T23324 |
T23326 |
amod |
mean,S.E.M |
R17804 |
T23325 |
T23326 |
compound |
±,S.E.M |
R17805 |
T23326 |
T23323 |
dobj |
S.E.M,represents |
R17806 |
T23327 |
T23323 |
prep |
for,represents |
R17807 |
T23328 |
T23330 |
nummod |
three,experiments |
R17808 |
T23329 |
T23330 |
amod |
independent,experiments |
R17809 |
T23330 |
T23327 |
pobj |
experiments,for |
R17810 |
T23331 |
T23323 |
punct |
.,represents |
R17811 |
T23332 |
T23332 |
ROOT |
*,* |
R17812 |
T23333 |
T23334 |
det |
The,p-values |
R17813 |
T23334 |
T23340 |
nsubj |
p-values,compared |
R17814 |
T23335 |
T23334 |
prep |
of,p-values |
R17815 |
T23336 |
T23335 |
pobj |
cells,of |
R17816 |
T23337 |
T23336 |
acl |
treated,cells |
R17817 |
T23338 |
T23337 |
prep |
with,treated |
R17818 |
T23339 |
T23340 |
amod |
inhibitors/M-CSF,compared |
R17819 |
T23340 |
T23340 |
ROOT |
compared,compared |
R1782 |
T2080 |
T2079 |
pcomp |
understanding,at |
R17820 |
T23341 |
T23340 |
prep |
to,compared |
R17821 |
T23342 |
T23341 |
pobj |
vehicle/M-CSF,to |
R17822 |
T23343 |
T23340 |
auxpass |
were,compared |
R17823 |
T23344 |
T23345 |
compound |
≤,0.05 |
R17824 |
T23345 |
T23343 |
attr |
0.05,were |
R17825 |
T23346 |
T23340 |
punct |
.,compared |
R179 |
T211 |
T210 |
prep |
for,kinases |
R1791 |
T2081 |
T2082 |
det |
the,role |
R1794 |
T2082 |
T2080 |
dobj |
role,understanding |
R1795 |
T2083 |
T2082 |
prep |
of,role |
R17951 |
T23560 |
T23565 |
nsubj |
Inhibition,induces |
R17952 |
T23561 |
T23560 |
prep |
of,Inhibition |
R17953 |
T23562 |
T23561 |
pobj |
PKC,of |
R17954 |
T23563 |
T23562 |
cc |
or,PKC |
R17955 |
T23564 |
T23562 |
conj |
NF-κB,PKC |
R17956 |
T23565 |
T23565 |
ROOT |
induces,induces |
R17957 |
T23566 |
T23565 |
dobj |
apoptosis,induces |
R17958 |
T23567 |
T23565 |
prep |
in,induces |
R17959 |
T23568 |
T23567 |
pobj |
MDMs,in |
R17960 |
T23569 |
T23565 |
punct |
.,induces |
R17961 |
T23570 |
T23575 |
punct |
(,pre-incubated |
R17962 |
T23571 |
T23573 |
nmod |
A,MDMs |
R17963 |
T23572 |
T23573 |
punct |
),MDMs |
R17964 |
T23573 |
T23575 |
nsubjpass |
MDMs,pre-incubated |
R17965 |
T23574 |
T23575 |
auxpass |
were,pre-incubated |
R17966 |
T23575 |
T23575 |
ROOT |
pre-incubated,pre-incubated |
R17967 |
T23576 |
T23575 |
prep |
in,pre-incubated |
R17968 |
T23577 |
T23578 |
compound |
RPMI,medium |
R17969 |
T23578 |
T23576 |
pobj |
medium,in |
R17970 |
T23579 |
T23578 |
acl |
containing,medium |
R17971 |
T23580 |
T23579 |
dobj |
inhibitors,containing |
R17972 |
T23581 |
T23580 |
punct |
(,inhibitors |
R17973 |
T23582 |
T23580 |
appos |
Ro-31-8220,inhibitors |
R17974 |
T23583 |
T23582 |
punct |
:,Ro-31-8220 |
R17975 |
T23584 |
T23585 |
nummod |
5,µM |
R17976 |
T23585 |
T23582 |
appos |
µM,Ro-31-8220 |
R17977 |
T23586 |
T23585 |
punct |
",",µM |
R17978 |
T23587 |
T23585 |
appos |
Gö-6976,µM |
R17979 |
T23588 |
T23587 |
punct |
:,Gö-6976 |
R1798 |
T2084 |
T2083 |
pobj |
PKC,of |
R17980 |
T23589 |
T23590 |
nummod |
5,µM |
R17981 |
T23590 |
T23587 |
conj |
µM,Gö-6976 |
R17982 |
T23591 |
T23590 |
punct |
",",µM |
R17983 |
T23592 |
T23590 |
conj |
BAPTA/AM,µM |
R17984 |
T23593 |
T23592 |
punct |
:,BAPTA/AM |
R17985 |
T23594 |
T23595 |
nummod |
2.5,µM |
R17986 |
T23595 |
T23592 |
appos |
µM,BAPTA/AM |
R17987 |
T23596 |
T23592 |
punct |
),BAPTA/AM |
R17988 |
T23597 |
T23592 |
prep |
for,BAPTA/AM |
R17989 |
T23598 |
T23599 |
nummod |
30,minutes |
R17990 |
T23599 |
T23597 |
pobj |
minutes,for |
R17991 |
T23600 |
T23587 |
npadvmod |
prior,Gö-6976 |
R17992 |
T23601 |
T23600 |
prep |
to,prior |
R17993 |
T23602 |
T23603 |
det |
the,addition |
R17994 |
T23603 |
T23601 |
pobj |
addition,to |
R17995 |
T23604 |
T23603 |
prep |
of,addition |
R17996 |
T23605 |
T23604 |
pobj |
M-CSF,of |
R17997 |
T23606 |
T23575 |
punct |
.,pre-incubated |
R17998 |
T23607 |
T23614 |
prep |
As,incubated |
R17999 |
T23608 |
T23609 |
det |
a,control |
R180 |
T212 |
T215 |
amod |
M-CSF-induced,activation |
R18000 |
T23609 |
T23607 |
pobj |
control,As |
R18001 |
T23610 |
T23614 |
punct |
",",incubated |
R18002 |
T23611 |
T23612 |
amod |
untreated,cells |
R18003 |
T23612 |
T23614 |
nsubjpass |
cells,incubated |
R18004 |
T23613 |
T23614 |
auxpass |
were,incubated |
R18005 |
T23614 |
T23614 |
ROOT |
incubated,incubated |
R18006 |
T23615 |
T23614 |
prep |
with,incubated |
R18007 |
T23616 |
T23617 |
compound |
dimethyl,sulfoxide |
R18008 |
T23617 |
T23615 |
pobj |
sulfoxide,with |
R18009 |
T23618 |
T23617 |
punct |
(,sulfoxide |
R18010 |
T23619 |
T23617 |
appos |
DMSO,sulfoxide |
R18011 |
T23620 |
T23617 |
punct |
),sulfoxide |
R18012 |
T23621 |
T23614 |
punct |
.,incubated |
R18013 |
T23622 |
T23623 |
compound |
Cell,lysates |
R18014 |
T23623 |
T23625 |
nsubjpass |
lysates,resolved |
R18015 |
T23624 |
T23625 |
auxpass |
were,resolved |
R18016 |
T23625 |
T23625 |
ROOT |
resolved,resolved |
R18017 |
T23626 |
T23625 |
agent |
by,resolved |
R18018 |
T23627 |
T23626 |
pobj |
SDS-PAGE,by |
R18019 |
T23628 |
T23625 |
cc |
and,resolved |
R18020 |
T23629 |
T23625 |
conj |
immunoblotted,resolved |
R18021 |
T23630 |
T23629 |
prep |
with,immunoblotted |
R18022 |
T23631 |
T23630 |
pobj |
antibody,with |
R18023 |
T23632 |
T23630 |
pcomp |
recognizing,with |
R18024 |
T23633 |
T23636 |
det |
the,form |
R18025 |
T23634 |
T23636 |
amod |
active,form |
R18026 |
T23635 |
T23636 |
amod |
cleaved,form |
R18027 |
T23636 |
T23632 |
dobj |
form,recognizing |
R18028 |
T23637 |
T23636 |
prep |
of,form |
R18029 |
T23638 |
T23637 |
pobj |
caspase-3,of |
R18030 |
T23639 |
T23625 |
punct |
.,resolved |
R18031 |
T23640 |
T23641 |
det |
The,blots |
R18032 |
T23641 |
T23643 |
nsubjpass |
blots,reblotted |
R18033 |
T23642 |
T23643 |
auxpass |
were,reblotted |
R18034 |
T23643 |
T23643 |
ROOT |
reblotted,reblotted |
R18035 |
T23644 |
T23643 |
prep |
with,reblotted |
R18036 |
T23645 |
T23644 |
pobj |
β-actin,with |
R18037 |
T23646 |
T23647 |
nsubj |
that,served |
R18038 |
T23647 |
T23643 |
conj |
served,reblotted |
R18039 |
T23648 |
T23647 |
prep |
as,served |
R1804 |
T2085 |
T2082 |
prep |
in,role |
R18040 |
T23649 |
T23651 |
det |
a,control |
R18041 |
T23650 |
T23651 |
compound |
loading,control |
R18042 |
T23651 |
T23648 |
pobj |
control,as |
R18043 |
T23652 |
T23643 |
punct |
.,reblotted |
R18044 |
T23653 |
T23654 |
det |
The,ratio |
R18045 |
T23654 |
T23670 |
nsubjpass |
ratio,determined |
R18046 |
T23655 |
T23654 |
prep |
of,ratio |
R18047 |
T23656 |
T23658 |
amod |
active,bands |
R18048 |
T23657 |
T23658 |
compound |
caspase-3,bands |
R18049 |
T23658 |
T23655 |
pobj |
bands,of |
R18050 |
T23659 |
T23658 |
punct |
(,bands |
R18051 |
T23660 |
T23661 |
nummod |
17,kD |
R18052 |
T23661 |
T23658 |
appos |
kD,bands |
R18053 |
T23662 |
T23661 |
cc |
and,kD |
R18054 |
T23663 |
T23664 |
nummod |
19,kD |
R18055 |
T23664 |
T23661 |
conj |
kD,kD |
R18056 |
T23665 |
T23664 |
punct |
),kD |
R18057 |
T23666 |
T23670 |
prep |
to,determined |
R18058 |
T23667 |
T23668 |
compound |
β-actin,control |
R18059 |
T23668 |
T23666 |
pobj |
control,to |
R1806 |
T2086 |
T2087 |
det |
the,regulation |
R18060 |
T23669 |
T23670 |
auxpass |
was,determined |
R18061 |
T23670 |
T23670 |
ROOT |
determined,determined |
R18062 |
T23671 |
T23670 |
agent |
by,determined |
R18063 |
T23672 |
T23673 |
amod |
densitometry,analysis |
R18064 |
T23673 |
T23671 |
pobj |
analysis,by |
R18065 |
T23674 |
T23676 |
punct |
(,panel |
R18066 |
T23675 |
T23676 |
amod |
bottom,panel |
R18067 |
T23676 |
T23673 |
appos |
panel,analysis |
R18068 |
T23677 |
T23670 |
punct |
),determined |
R18069 |
T23678 |
T23670 |
punct |
.,determined |
R18070 |
T23679 |
T23680 |
nsubj |
Data,represents |
R18071 |
T23680 |
T23680 |
ROOT |
represents,represents |
R18072 |
T23681 |
T23684 |
det |
the,S.E.M |
R18073 |
T23682 |
T23684 |
amod |
mean,S.E.M |
R18074 |
T23683 |
T23684 |
compound |
±,S.E.M |
R18075 |
T23684 |
T23680 |
dobj |
S.E.M,represents |
R18076 |
T23685 |
T23684 |
prep |
from,S.E.M |
R18077 |
T23686 |
T23688 |
nummod |
two,donors |
R18078 |
T23687 |
T23688 |
amod |
independent,donors |
R18079 |
T23688 |
T23685 |
pobj |
donors,from |
R18080 |
T23689 |
T23680 |
punct |
.,represents |
R18081 |
T23690 |
T23693 |
punct |
(,Apoptosis |
R18082 |
T23691 |
T23693 |
nmod |
B,Apoptosis |
R18083 |
T23692 |
T23693 |
punct |
),Apoptosis |
R18084 |
T23693 |
T23700 |
nsubjpass |
Apoptosis,measured |
R18085 |
T23694 |
T23693 |
prep |
of,Apoptosis |
R18086 |
T23695 |
T23697 |
det |
the,MDMs |
R18087 |
T23696 |
T23697 |
amod |
treated,MDMs |
R18088 |
T23697 |
T23694 |
pobj |
MDMs,of |
R18089 |
T23698 |
T23700 |
auxpass |
was,measured |
R18090 |
T23699 |
T23700 |
advmod |
also,measured |
R18091 |
T23700 |
T23700 |
ROOT |
measured,measured |
R18092 |
T23701 |
T23700 |
agent |
by,measured |
R18093 |
T23702 |
T23703 |
compound |
Annexin,V-FITC |
R18094 |
T23703 |
T23701 |
pobj |
V-FITC,by |
R18095 |
T23704 |
T23703 |
cc |
and,V-FITC |
R18096 |
T23705 |
T23706 |
compound |
propidium,iodine |
R18097 |
T23706 |
T23703 |
conj |
iodine,V-FITC |
R18098 |
T23707 |
T23708 |
punct |
(,PI |
R18099 |
T23708 |
T23706 |
appos |
PI,iodine |
R181 |
T213 |
T215 |
nmod |
NF-κB,activation |
R1810 |
T2087 |
T2085 |
pobj |
regulation,in |
R18100 |
T23709 |
T23706 |
punct |
),iodine |
R18101 |
T23710 |
T23700 |
advcl |
staining,measured |
R18102 |
T23711 |
T23700 |
cc |
and,measured |
R18103 |
T23712 |
T23700 |
conj |
analyzed,measured |
R18104 |
T23713 |
T23712 |
agent |
by,analyzed |
R18105 |
T23714 |
T23715 |
compound |
flow,cytometry |
R18106 |
T23715 |
T23713 |
pobj |
cytometry,by |
R18107 |
T23716 |
T23700 |
punct |
.,measured |
R18108 |
T23717 |
T23718 |
det |
The,percentage |
R18109 |
T23718 |
T23735 |
nsubjpass |
percentage,set |
R18110 |
T23719 |
T23718 |
prep |
of,percentage |
R18111 |
T23720 |
T23721 |
amod |
surviving,cells |
R18112 |
T23721 |
T23719 |
pobj |
cells,of |
R18113 |
T23722 |
T23718 |
punct |
(,percentage |
R18114 |
T23723 |
T23724 |
compound |
Annexin,V/PI |
R18115 |
T23724 |
T23718 |
appos |
V/PI,percentage |
R18116 |
T23725 |
T23724 |
amod |
negative,V/PI |
R18117 |
T23726 |
T23718 |
punct |
),percentage |
R18118 |
T23727 |
T23718 |
prep |
for,percentage |
R18119 |
T23728 |
T23729 |
det |
the,cells |
R18120 |
T23729 |
T23727 |
pobj |
cells,for |
R18121 |
T23730 |
T23729 |
acl |
treated,cells |
R18122 |
T23731 |
T23730 |
prep |
with,treated |
R18123 |
T23732 |
T23731 |
pobj |
vehicle/M-CSF,with |
R18124 |
T23733 |
T23735 |
auxpass |
was,set |
R18125 |
T23734 |
T23735 |
advmod |
arbitrarily,set |
R18126 |
T23735 |
T23735 |
ROOT |
set,set |
R18127 |
T23736 |
T23735 |
prep |
as,set |
R18128 |
T23737 |
T23736 |
pobj |
100,as |
R18129 |
T23738 |
T23735 |
punct |
.,set |
R18130 |
T23739 |
T23741 |
nsubj |
Data,represent |
R18131 |
T23740 |
T23739 |
acl |
shown,Data |
R18132 |
T23741 |
T23741 |
ROOT |
represent,represent |
R18133 |
T23742 |
T23745 |
det |
the,S.E.M |
R18134 |
T23743 |
T23745 |
amod |
mean,S.E.M |
R18135 |
T23744 |
T23745 |
compound |
±,S.E.M |
R18136 |
T23745 |
T23741 |
dobj |
S.E.M,represent |
R18137 |
T23746 |
T23741 |
prep |
from,represent |
R18138 |
T23747 |
T23749 |
nummod |
three,experiments |
R18139 |
T23748 |
T23749 |
amod |
independent,experiments |
R18140 |
T23749 |
T23746 |
pobj |
experiments,from |
R18141 |
T23750 |
T23741 |
punct |
.,represent |
R18142 |
T23751 |
T23751 |
ROOT |
*,* |
R18143 |
T23752 |
T23753 |
det |
The,p-values |
R18144 |
T23753 |
T23756 |
nsubj |
p-values,compared |
R18145 |
T23754 |
T23753 |
prep |
of,p-values |
R18146 |
T23755 |
T23754 |
pobj |
inhibitors/M-CSF,of |
R18147 |
T23756 |
T23756 |
ROOT |
compared,compared |
R18148 |
T23757 |
T23756 |
prep |
to,compared |
R18149 |
T23758 |
T23757 |
pobj |
vehicle/M-CSF,to |
R1815 |
T2088 |
T2087 |
prep |
of,regulation |
R18150 |
T23759 |
T23756 |
auxpass |
were,compared |
R18151 |
T23760 |
T23761 |
compound |
≤,0.05 |
R18152 |
T23761 |
T23759 |
attr |
0.05,were |
R18153 |
T23762 |
T23756 |
punct |
.,compared |
R1817 |
T2089 |
T2090 |
amod |
NF-κB,activation |
R1818 |
T2090 |
T2088 |
pobj |
activation,of |
R182 |
T214 |
T215 |
amod |
transcriptional,activation |
R1824 |
T2091 |
T2090 |
cc |
and,activation |
R1826 |
T2092 |
T2094 |
amod |
M-CSF-induced,survival |
R1827 |
T2093 |
T2094 |
compound |
monocyte,survival |
R183 |
T215 |
T211 |
pobj |
activation,for |
R1836 |
T2094 |
T2090 |
conj |
survival,activation |
R18363 |
T24095 |
T24096 |
nsubj |
M-CSF,activates |
R18364 |
T24096 |
T24096 |
ROOT |
activates,activates |
R18365 |
T24097 |
T24096 |
dobj |
PKCα,activates |
R18366 |
T24098 |
T24096 |
prep |
in,activates |
R18367 |
T24099 |
T24100 |
amod |
human,MDMs |
R18368 |
T24100 |
T24098 |
pobj |
MDMs,in |
R18369 |
T24101 |
T24096 |
punct |
.,activates |
R18370 |
T24102 |
T24116 |
nsubjpass |
MDMs,lysed |
R18371 |
T24103 |
T24102 |
acl |
treated,MDMs |
R18372 |
T24104 |
T24103 |
prep |
with,treated |
R18373 |
T24105 |
T24104 |
pobj |
M-CSF,with |
R18374 |
T24106 |
T24108 |
punct |
(,ng/ml |
R18375 |
T24107 |
T24108 |
nummod |
100,ng/ml |
R18376 |
T24108 |
T24105 |
appos |
ng/ml,M-CSF |
R18377 |
T24109 |
T24103 |
punct |
),treated |
R18378 |
T24110 |
T24103 |
prep |
for,treated |
R18379 |
T24111 |
T24112 |
amod |
varying,amounts |
R18380 |
T24112 |
T24110 |
pobj |
amounts,for |
R18381 |
T24113 |
T24112 |
prep |
of,amounts |
R18382 |
T24114 |
T24113 |
pobj |
time,of |
R18383 |
T24115 |
T24116 |
auxpass |
were,lysed |
R18384 |
T24116 |
T24116 |
ROOT |
lysed,lysed |
R18385 |
T24117 |
T24116 |
cc |
and,lysed |
R18386 |
T24118 |
T24116 |
conj |
immunoprecipitated,lysed |
R18387 |
T24119 |
T24118 |
advcl |
using,immunoprecipitated |
R18388 |
T24120 |
T24121 |
amod |
anti-PKC,antibody |
R18389 |
T24121 |
T24119 |
dobj |
antibody,using |
R18390 |
T24122 |
T24121 |
cc |
or,antibody |
R18391 |
T24123 |
T24121 |
conj |
control,antibody |
R18392 |
T24124 |
T24125 |
compound |
IgG,antibody |
R18393 |
T24125 |
T24121 |
conj |
antibody,antibody |
R18394 |
T24126 |
T24116 |
punct |
.,lysed |
R18395 |
T24127 |
T24128 |
nummod |
One,half |
R18396 |
T24128 |
T24133 |
nsubjpass |
half,used |
R18397 |
T24129 |
T24128 |
prep |
of,half |
R18398 |
T24130 |
T24131 |
det |
the,samples |
R18399 |
T24131 |
T24129 |
pobj |
samples,of |
R184 |
T216 |
T215 |
punct |
",",activation |
R1840 |
T2095 |
T2078 |
punct |
.,focused |
R18400 |
T24132 |
T24133 |
auxpass |
was,used |
R18401 |
T24133 |
T24133 |
ROOT |
used,used |
R18402 |
T24134 |
T24135 |
aux |
to,analyze |
R18403 |
T24135 |
T24133 |
xcomp |
analyze,used |
R18404 |
T24136 |
T24138 |
compound |
PKC,activity |
R18405 |
T24137 |
T24138 |
compound |
kinase,activity |
R18406 |
T24138 |
T24135 |
dobj |
activity,analyze |
R18407 |
T24139 |
T24135 |
advcl |
using,analyze |
R18408 |
T24140 |
T24141 |
det |
a,fluorescein |
R18409 |
T24141 |
T24139 |
dobj |
fluorescein,using |
R18410 |
T24142 |
T24133 |
conj |
tagged,used |
R18411 |
T24143 |
T24142 |
dobj |
peptide,tagged |
R18412 |
T24144 |
T24142 |
cc |
and,tagged |
R18413 |
T24145 |
T24142 |
conj |
visualized,tagged |
R18414 |
T24146 |
T24145 |
agent |
by,visualized |
R18415 |
T24147 |
T24149 |
amod |
agarose,electrophoresis |
R18416 |
T24148 |
T24149 |
compound |
gel,electrophoresis |
R18417 |
T24149 |
T24146 |
pobj |
electrophoresis,by |
R18418 |
T24150 |
T24149 |
punct |
(,electrophoresis |
R18419 |
T24151 |
T24152 |
amod |
top,panel |
R18420 |
T24152 |
T24149 |
appos |
panel,electrophoresis |
R18421 |
T24153 |
T24149 |
punct |
),electrophoresis |
R18422 |
T24154 |
T24142 |
punct |
",",tagged |
R18423 |
T24155 |
T24160 |
mark |
while,subjected |
R18424 |
T24156 |
T24158 |
det |
the,half |
R18425 |
T24157 |
T24158 |
amod |
other,half |
R18426 |
T24158 |
T24160 |
nsubjpass |
half,subjected |
R18427 |
T24159 |
T24160 |
auxpass |
was,subjected |
R18428 |
T24160 |
T24142 |
advcl |
subjected,tagged |
R18429 |
T24161 |
T24160 |
prep |
to,subjected |
R18430 |
T24162 |
T24164 |
amod |
Western,analysis |
R18431 |
T24163 |
T24164 |
compound |
blot,analysis |
R18432 |
T24164 |
T24161 |
pobj |
analysis,to |
R18433 |
T24165 |
T24166 |
aux |
to,confirm |
R18434 |
T24166 |
T24160 |
xcomp |
confirm,subjected |
R18435 |
T24167 |
T24168 |
amod |
equal,amounts |
R18436 |
T24168 |
T24166 |
dobj |
amounts,confirm |
R18437 |
T24169 |
T24168 |
prep |
of,amounts |
R18438 |
T24170 |
T24169 |
pobj |
PKCα,of |
R18439 |
T24171 |
T24172 |
auxpass |
were,immunoprecipitated |
R18440 |
T24172 |
T24142 |
conj |
immunoprecipitated,tagged |
R18441 |
T24173 |
T24172 |
prep |
from,immunoprecipitated |
R18442 |
T24174 |
T24175 |
det |
each,sample |
R18443 |
T24175 |
T24173 |
pobj |
sample,from |
R18444 |
T24176 |
T24178 |
punct |
(,panel |
R18445 |
T24177 |
T24178 |
amod |
middle,panel |
R18446 |
T24178 |
T24175 |
appos |
panel,sample |
R18447 |
T24179 |
T24172 |
punct |
),immunoprecipitated |
R18448 |
T24180 |
T24133 |
punct |
.,used |
R18449 |
T24181 |
T24183 |
det |
The,assay |
R1845 |
T2096 |
T2098 |
advmod |
Here,demonstrates |
R18450 |
T24182 |
T24183 |
compound |
kinase,assay |
R18451 |
T24183 |
T24185 |
nsubjpass |
assay,quantitated |
R18452 |
T24184 |
T24185 |
auxpass |
was,quantitated |
R18453 |
T24185 |
T24185 |
ROOT |
quantitated,quantitated |
R18454 |
T24186 |
T24185 |
advcl |
using,quantitated |
R18455 |
T24187 |
T24186 |
dobj |
Quantity,using |
R18456 |
T24188 |
T24189 |
nummod |
One,software |
R18457 |
T24189 |
T24195 |
nmod |
software,panel |
R18458 |
T24190 |
T24191 |
punct |
(,Bio-Rad |
R18459 |
T24191 |
T24189 |
appos |
Bio-Rad,software |
R18460 |
T24192 |
T24189 |
punct |
),software |
R18461 |
T24193 |
T24195 |
punct |
(,panel |
R18462 |
T24194 |
T24195 |
amod |
bottom,panel |
R18463 |
T24195 |
T24187 |
appos |
panel,Quantity |
R18464 |
T24196 |
T24187 |
punct |
),Quantity |
R18465 |
T24197 |
T24185 |
punct |
.,quantitated |
R18466 |
T24198 |
T24199 |
nsubj |
Data,represents |
R18467 |
T24199 |
T24199 |
ROOT |
represents,represents |
R18468 |
T24200 |
T24203 |
det |
the,increase |
R18469 |
T24201 |
T24202 |
amod |
average,fold |
R18470 |
T24202 |
T24203 |
compound |
fold,increase |
R18471 |
T24203 |
T24199 |
dobj |
increase,represents |
R18472 |
T24204 |
T24203 |
prep |
of,increase |
R18473 |
T24205 |
T24206 |
compound |
PKCα,activity |
R18474 |
T24206 |
T24204 |
pobj |
activity,of |
R18475 |
T24207 |
T24206 |
prep |
in,activity |
R18476 |
T24208 |
T24209 |
amod |
non-stimulated,samples |
R18477 |
T24209 |
T24207 |
pobj |
samples,in |
R18478 |
T24210 |
T24199 |
prep |
compared,represents |
R18479 |
T24211 |
T24210 |
prep |
to,compared |
R1848 |
T2097 |
T2098 |
nsubj |
we,demonstrates |
R18480 |
T24212 |
T24215 |
compound |
M-CSF-treated,S.E.M |
R18481 |
T24213 |
T24214 |
compound |
MDM,± |
R18482 |
T24214 |
T24215 |
compound |
±,S.E.M |
R18483 |
T24215 |
T24211 |
pobj |
S.E.M,to |
R18484 |
T24216 |
T24210 |
prep |
for,compared |
R18485 |
T24217 |
T24219 |
nummod |
three,experiments |
R18486 |
T24218 |
T24219 |
amod |
independent,experiments |
R18487 |
T24219 |
T24216 |
pobj |
experiments,for |
R18488 |
T24220 |
T24199 |
punct |
.,represents |
R18489 |
T24221 |
T24221 |
ROOT |
NS,NS |
R18490 |
T24222 |
T24221 |
punct |
:,NS |
R18491 |
T24223 |
T24221 |
acl |
non-stimulated,NS |
R18492 |
T24224 |
T24221 |
punct |
.,NS |
R18493 |
T24225 |
T24225 |
ROOT |
*,* |
R18494 |
T24226 |
T24227 |
det |
The,p-values |
R18495 |
T24227 |
T24230 |
nsubj |
p-values,stimulated |
R18496 |
T24228 |
T24227 |
prep |
of,p-values |
R18497 |
T24229 |
T24228 |
pobj |
M-CSF,of |
R18498 |
T24230 |
T24230 |
ROOT |
stimulated,stimulated |
R18499 |
T24231 |
T24230 |
prep |
compared,stimulated |
R185 |
T217 |
T219 |
amod |
NF-κB-regulated,expression |
R18500 |
T24232 |
T24231 |
prep |
to,compared |
R18501 |
T24233 |
T24232 |
pobj |
non-stimulated,to |
R18502 |
T24234 |
T24230 |
conj |
were,stimulated |
R18503 |
T24235 |
T24236 |
compound |
≤,0.05 |
R18504 |
T24236 |
T24234 |
attr |
0.05,were |
R18505 |
T24237 |
T24230 |
punct |
.,stimulated |
R1853 |
T2098 |
T2098 |
ROOT |
demonstrates,demonstrates |
R1859 |
T2099 |
T2101 |
mark |
that,upregulated |
R186 |
T218 |
T219 |
compound |
gene,expression |
R1861 |
T2100 |
T2101 |
nsubj |
M-CSF,upregulated |
R1864 |
T2101 |
T2098 |
ccomp |
upregulated,demonstrates |
R1865 |
T2102 |
T2104 |
det |
the,transcription |
R18676 |
T24510 |
T24512 |
amod |
M-CSF-induced,activity |
R18677 |
T24511 |
T24512 |
compound |
PKC,activity |
R18678 |
T24512 |
T24515 |
nsubj |
activity,regulate |
R18679 |
T24513 |
T24515 |
aux |
does,regulate |
R1868 |
T2103 |
T2104 |
compound |
NF-κB,transcription |
R18680 |
T24514 |
T24515 |
neg |
not,regulate |
R18681 |
T24515 |
T24515 |
ROOT |
regulate,regulate |
R18682 |
T24516 |
T24517 |
compound |
IκBα,degradation |
R18683 |
T24517 |
T24515 |
dobj |
degradation,regulate |
R18684 |
T24518 |
T24515 |
cc |
but,regulate |
R18685 |
T24519 |
T24515 |
conj |
regulates,regulate |
R18686 |
T24520 |
T24521 |
det |
the,phosphorylation |
R18687 |
T24521 |
T24519 |
dobj |
phosphorylation,regulates |
R18688 |
T24522 |
T24521 |
prep |
of,phosphorylation |
R18689 |
T24523 |
T24524 |
compound |
NF-κB,p65 |
R18690 |
T24524 |
T24522 |
pobj |
p65,of |
R18691 |
T24525 |
T24519 |
prep |
at,regulates |
R18692 |
T24526 |
T24525 |
pobj |
Ser276,at |
R18693 |
T24527 |
T24515 |
punct |
.,regulate |
R18694 |
T24528 |
T24529 |
punct |
(,A |
R18695 |
T24529 |
T24529 |
ROOT |
A,A |
R18696 |
T24530 |
T24529 |
punct |
),A |
R18697 |
T24531 |
T24533 |
nsubjpass |
MDMs,pretreated |
R18698 |
T24532 |
T24533 |
auxpass |
were,pretreated |
R18699 |
T24533 |
T24533 |
ROOT |
pretreated,pretreated |
R187 |
T219 |
T215 |
conj |
expression,activation |
R18700 |
T24534 |
T24533 |
prep |
with,pretreated |
R18701 |
T24535 |
T24534 |
pobj |
cycloheximide,with |
R18702 |
T24536 |
T24535 |
punct |
(,cycloheximide |
R18703 |
T24537 |
T24535 |
appos |
CHX,cycloheximide |
R18704 |
T24538 |
T24535 |
punct |
),cycloheximide |
R18705 |
T24539 |
T24533 |
prep |
in,pretreated |
R18706 |
T24540 |
T24541 |
det |
the,absence |
R18707 |
T24541 |
T24539 |
pobj |
absence,in |
R18708 |
T24542 |
T24541 |
cc |
or,absence |
R18709 |
T24543 |
T24541 |
conj |
presence,absence |
R1871 |
T2104 |
T2101 |
dobj |
transcription,upregulated |
R18710 |
T24544 |
T24541 |
prep |
of,absence |
R18711 |
T24545 |
T24544 |
pobj |
Ro-31-8220,of |
R18712 |
T24546 |
T24533 |
prep |
for,pretreated |
R18713 |
T24547 |
T24548 |
nummod |
30,minutes |
R18714 |
T24548 |
T24546 |
pobj |
minutes,for |
R18715 |
T24549 |
T24533 |
advmod |
prior,pretreated |
R18716 |
T24550 |
T24549 |
prep |
to,prior |
R18717 |
T24551 |
T24552 |
compound |
M-CSF,stimulation |
R18718 |
T24552 |
T24550 |
pobj |
stimulation,to |
R18719 |
T24553 |
T24549 |
prep |
for,prior |
R18720 |
T24554 |
T24556 |
det |
the,times |
R18721 |
T24555 |
T24556 |
amod |
indicated,times |
R18722 |
T24556 |
T24553 |
pobj |
times,for |
R18723 |
T24557 |
T24533 |
punct |
.,pretreated |
R18724 |
T24558 |
T24560 |
amod |
Whole,lysates |
R18725 |
T24559 |
T24560 |
compound |
cell,lysates |
R18726 |
T24560 |
T24562 |
nsubjpass |
lysates,subjected |
R18727 |
T24561 |
T24562 |
auxpass |
were,subjected |
R18728 |
T24562 |
T24562 |
ROOT |
subjected,subjected |
R18729 |
T24563 |
T24562 |
prep |
to,subjected |
R18730 |
T24564 |
T24565 |
amod |
Western,blotting |
R18731 |
T24565 |
T24563 |
pobj |
blotting,to |
R18732 |
T24566 |
T24562 |
prep |
with,subjected |
R18733 |
T24567 |
T24568 |
amod |
anti-IκBα,antibody |
R18734 |
T24568 |
T24566 |
pobj |
antibody,with |
R18735 |
T24569 |
T24562 |
punct |
.,subjected |
R18736 |
T24570 |
T24571 |
nsubj |
Data,are |
R18737 |
T24571 |
T24571 |
ROOT |
are,are |
R18738 |
T24572 |
T24571 |
attr |
representative,are |
R18739 |
T24573 |
T24572 |
prep |
of,representative |
R18740 |
T24574 |
T24576 |
nummod |
three,experiments |
R18741 |
T24575 |
T24576 |
amod |
independent,experiments |
R18742 |
T24576 |
T24573 |
pobj |
experiments,of |
R18743 |
T24577 |
T24571 |
punct |
.,are |
R18744 |
T24578 |
T24579 |
punct |
(,B |
R18745 |
T24579 |
T24579 |
ROOT |
B,B |
R18746 |
T24580 |
T24579 |
punct |
),B |
R18747 |
T24581 |
T24583 |
nsubjpass |
MDMs,pretreated |
R18748 |
T24582 |
T24583 |
auxpass |
were,pretreated |
R18749 |
T24583 |
T24583 |
ROOT |
pretreated,pretreated |
R18750 |
T24584 |
T24583 |
prep |
with,pretreated |
R18751 |
T24585 |
T24586 |
det |
either,vehicle |
R18752 |
T24586 |
T24584 |
pobj |
vehicle,with |
R18753 |
T24587 |
T24586 |
cc |
or,vehicle |
R18754 |
T24588 |
T24586 |
conj |
Ro-31-8220,vehicle |
R18755 |
T24589 |
T24583 |
prep |
for,pretreated |
R18756 |
T24590 |
T24591 |
nummod |
30,minutes |
R18757 |
T24591 |
T24589 |
pobj |
minutes,for |
R18758 |
T24592 |
T24591 |
prep |
before,minutes |
R18759 |
T24593 |
T24594 |
det |
the,addition |
R18760 |
T24594 |
T24592 |
pobj |
addition,before |
R18761 |
T24595 |
T24594 |
prep |
of,addition |
R18762 |
T24596 |
T24595 |
pobj |
M-CSF,of |
R18763 |
T24597 |
T24583 |
prep |
for,pretreated |
R18764 |
T24598 |
T24599 |
nummod |
10,minutes |
R18765 |
T24599 |
T24597 |
pobj |
minutes,for |
R18766 |
T24600 |
T24583 |
punct |
.,pretreated |
R18767 |
T24601 |
T24602 |
amod |
Whole,cell |
R18768 |
T24602 |
T24603 |
compound |
cell,lysates |
R18769 |
T24603 |
T24605 |
nsubjpass |
lysates,resolved |
R18770 |
T24604 |
T24605 |
auxpass |
were,resolved |
R18771 |
T24605 |
T24605 |
ROOT |
resolved,resolved |
R18772 |
T24606 |
T24605 |
agent |
by,resolved |
R18773 |
T24607 |
T24606 |
pobj |
SDS-PAGE,by |
R18774 |
T24608 |
T24607 |
cc |
and,SDS-PAGE |
R18775 |
T24609 |
T24607 |
conj |
phospho-Ser276,SDS-PAGE |
R18776 |
T24610 |
T24609 |
cc |
or,phospho-Ser276 |
R18777 |
T24611 |
T24609 |
conj |
phospho-Ser536,phospho-Ser276 |
R18778 |
T24612 |
T24611 |
prep |
of,phospho-Ser536 |
R18779 |
T24613 |
T24612 |
pobj |
NF-κB,of |
R18780 |
T24614 |
T24613 |
nummod |
p65,NF-κB |
R18781 |
T24615 |
T24616 |
auxpass |
was,detected |
R18782 |
T24616 |
T24605 |
conj |
detected,resolved |
R18783 |
T24617 |
T24616 |
advcl |
using,detected |
R18784 |
T24618 |
T24619 |
amod |
phospho-specific,antibodies |
R18785 |
T24619 |
T24617 |
dobj |
antibodies,using |
R18786 |
T24620 |
T24617 |
prep |
to,using |
R18787 |
T24621 |
T24622 |
det |
either,residue |
R18788 |
T24622 |
T24620 |
pobj |
residue,to |
R18789 |
T24623 |
T24622 |
prep |
of,residue |
R1879 |
T2105 |
T2104 |
cc |
and,transcription |
R18790 |
T24624 |
T24625 |
compound |
NF-κB,p65 |
R18791 |
T24625 |
T24623 |
pobj |
p65,of |
R18792 |
T24626 |
T24605 |
punct |
.,resolved |
R18793 |
T24627 |
T24628 |
punct |
(,C |
R18794 |
T24628 |
T24632 |
nmod |
C,lysates |
R18795 |
T24629 |
T24628 |
punct |
),C |
R18796 |
T24630 |
T24631 |
amod |
Whole,cell |
R18797 |
T24631 |
T24632 |
compound |
cell,lysates |
R18798 |
T24632 |
T24651 |
nsubjpass |
lysates,subjected |
R18799 |
T24633 |
T24632 |
prep |
of,lysates |
R188 |
T220 |
T215 |
punct |
",",activation |
R18800 |
T24634 |
T24633 |
pobj |
RAW,of |
R18801 |
T24635 |
T24634 |
nummod |
264.7,RAW |
R18802 |
T24636 |
T24632 |
conj |
cells,lysates |
R18803 |
T24637 |
T24632 |
acl |
treated,lysates |
R18804 |
T24638 |
T24637 |
prep |
with,treated |
R18805 |
T24639 |
T24640 |
compound |
vehicle,control |
R18806 |
T24640 |
T24638 |
pobj |
control,with |
R18807 |
T24641 |
T24640 |
cc |
or,control |
R18808 |
T24642 |
T24640 |
conj |
Ro-31-8220,control |
R18809 |
T24643 |
T24637 |
prep |
in,treated |
R18810 |
T24644 |
T24645 |
det |
the,absence |
R18811 |
T24645 |
T24643 |
pobj |
absence,in |
R18812 |
T24646 |
T24645 |
cc |
or,absence |
R18813 |
T24647 |
T24645 |
conj |
presence,absence |
R18814 |
T24648 |
T24645 |
prep |
of,absence |
R18815 |
T24649 |
T24648 |
pobj |
M-CSF,of |
R18816 |
T24650 |
T24651 |
auxpass |
were,subjected |
R18817 |
T24651 |
T24651 |
ROOT |
subjected,subjected |
R18818 |
T24652 |
T24651 |
prep |
to,subjected |
R18819 |
T24653 |
T24655 |
amod |
Western,analysis |
R18820 |
T24654 |
T24655 |
compound |
blot,analysis |
R18821 |
T24655 |
T24652 |
pobj |
analysis,to |
R18822 |
T24656 |
T24655 |
prep |
with,analysis |
R18823 |
T24657 |
T24656 |
pobj |
phospho-Ser276,with |
R18824 |
T24658 |
T24657 |
cc |
or,phospho-Ser276 |
R18825 |
T24659 |
T24660 |
compound |
phospho-Ser536,NF-κB |
R18826 |
T24660 |
T24657 |
conj |
NF-κB,phospho-Ser276 |
R18827 |
T24661 |
T24662 |
nummod |
p65,antibodies |
R18828 |
T24662 |
T24656 |
pobj |
antibodies,with |
R18829 |
T24663 |
T24651 |
punct |
.,subjected |
R18830 |
T24664 |
T24667 |
punct |
(,Cytosolic |
R18831 |
T24665 |
T24667 |
nmod |
D,Cytosolic |
R18832 |
T24666 |
T24667 |
punct |
),Cytosolic |
R18833 |
T24667 |
T24675 |
nsubjpass |
Cytosolic,obtained |
R18834 |
T24668 |
T24667 |
cc |
and,Cytosolic |
R18835 |
T24669 |
T24670 |
amod |
nuclear,fractions |
R18836 |
T24670 |
T24667 |
conj |
fractions,Cytosolic |
R18837 |
T24671 |
T24670 |
prep |
of,fractions |
R18838 |
T24672 |
T24675 |
nsubjpass |
RAW,obtained |
R18839 |
T24673 |
T24672 |
nummod |
264.7,RAW |
R18840 |
T24674 |
T24675 |
auxpass |
were,obtained |
R18841 |
T24675 |
T24675 |
ROOT |
obtained,obtained |
R18842 |
T24676 |
T24675 |
prep |
from,obtained |
R18843 |
T24677 |
T24679 |
det |
the,cells |
R18844 |
T24678 |
T24679 |
amod |
treated,cells |
R18845 |
T24679 |
T24676 |
pobj |
cells,from |
R18846 |
T24680 |
T24675 |
cc |
and,obtained |
R18847 |
T24681 |
T24675 |
conj |
immunoblotted,obtained |
R18848 |
T24682 |
T24681 |
prep |
for,immunoblotted |
R18849 |
T24683 |
T24682 |
pobj |
phospho-NF-κB,for |
R1885 |
T2106 |
T2107 |
compound |
cell,survival |
R18850 |
T24684 |
T24675 |
punct |
.,obtained |
R18851 |
T24685 |
T24686 |
det |
The,purity |
R18852 |
T24686 |
T24694 |
nsubjpass |
purity,confirmed |
R18853 |
T24687 |
T24686 |
prep |
of,purity |
R18854 |
T24688 |
T24692 |
det |
the,fractions |
R18855 |
T24689 |
T24692 |
amod |
cytosolic,fractions |
R18856 |
T24690 |
T24689 |
cc |
and,cytosolic |
R18857 |
T24691 |
T24689 |
conj |
nuclear,cytosolic |
R18858 |
T24692 |
T24687 |
pobj |
fractions,of |
R18859 |
T24693 |
T24694 |
auxpass |
was,confirmed |
R18860 |
T24694 |
T24694 |
ROOT |
confirmed,confirmed |
R18861 |
T24695 |
T24694 |
agent |
by,confirmed |
R18862 |
T24696 |
T24695 |
pcomp |
immunoblotting,by |
R18863 |
T24697 |
T24696 |
prep |
with,immunoblotting |
R18864 |
T24698 |
T24697 |
pobj |
GAPDH,with |
R18865 |
T24699 |
T24698 |
cc |
and,GAPDH |
R18866 |
T24700 |
T24701 |
compound |
Lamin,B |
R18867 |
T24701 |
T24698 |
conj |
B,GAPDH |
R18868 |
T24702 |
T24696 |
punct |
",",immunoblotting |
R18869 |
T24703 |
T24696 |
advmod |
respectively,immunoblotting |
R18870 |
T24704 |
T24694 |
punct |
.,confirmed |
R18871 |
T24705 |
T24705 |
ROOT |
Shown,Shown |
R18872 |
T24706 |
T24705 |
auxpass |
are,Shown |
R18873 |
T24707 |
T24708 |
compound |
representative,blots |
R18874 |
T24708 |
T24705 |
nsubjpass |
blots,Shown |
R18875 |
T24709 |
T24708 |
prep |
from,blots |
R18876 |
T24710 |
T24712 |
nummod |
three,experiments |
R18877 |
T24711 |
T24712 |
amod |
independent,experiments |
R18878 |
T24712 |
T24709 |
pobj |
experiments,from |
R18879 |
T24713 |
T24705 |
punct |
.,Shown |
R1889 |
T2107 |
T2104 |
conj |
survival,transcription |
R189 |
T221 |
T224 |
nmod |
NF-κB,phosphorylation |
R1893 |
T2108 |
T2104 |
prep |
in,transcription |
R1894 |
T2109 |
T2112 |
amod |
human,macrophages |
R1898 |
T2110 |
T2109 |
cc |
and,human |
R190 |
T222 |
T224 |
nummod |
p65,phosphorylation |
R1905 |
T2111 |
T2109 |
conj |
mouse,human |
R191 |
T223 |
T224 |
compound |
Ser276,phosphorylation |
R1911 |
T2112 |
T2108 |
pobj |
macrophages,in |
R1913 |
T2113 |
T2098 |
punct |
.,demonstrates |
R1916 |
T2114 |
T2115 |
det |
This,activity |
R19177 |
T25121 |
T25125 |
nsubj |
Inhibition,reduces |
R19178 |
T25122 |
T25121 |
prep |
of,Inhibition |
R19179 |
T25123 |
T25124 |
compound |
M-CSF-induced,PKC |
R19180 |
T25124 |
T25122 |
pobj |
PKC,of |
R19181 |
T25125 |
T25125 |
ROOT |
reduces,reduces |
R19182 |
T25126 |
T25127 |
amod |
NF-κB-regulated,genes |
R19183 |
T25127 |
T25125 |
dobj |
genes,reduces |
R19184 |
T25128 |
T25127 |
prep |
in,genes |
R19185 |
T25129 |
T25130 |
preconj |
both,MDMs |
R19186 |
T25130 |
T25128 |
pobj |
MDMs,in |
R19187 |
T25131 |
T25130 |
cc |
and,MDMs |
R19188 |
T25132 |
T25130 |
conj |
RAW,MDMs |
R19189 |
T25133 |
T25134 |
nummod |
264.7,cells |
R1919 |
T2115 |
T2117 |
nsubjpass |
activity,reduced |
R19190 |
T25134 |
T25130 |
conj |
cells,MDMs |
R19191 |
T25135 |
T25125 |
punct |
.,reduces |
R19192 |
T25136 |
T25136 |
ROOT |
MDMs,MDMs |
R19193 |
T25137 |
T25138 |
punct |
(,A |
R19194 |
T25138 |
T25136 |
appos |
A,MDMs |
R19195 |
T25139 |
T25138 |
cc |
and,A |
R19196 |
T25140 |
T25148 |
nmod |
C,cells |
R19197 |
T25141 |
T25140 |
punct |
),C |
R19198 |
T25142 |
T25140 |
cc |
and,C |
R19199 |
T25143 |
T25140 |
conj |
RAW,C |
R192 |
T224 |
T215 |
conj |
phosphorylation,activation |
R19200 |
T25144 |
T25143 |
nummod |
264.7,RAW |
R19201 |
T25145 |
T25146 |
punct |
(,B |
R19202 |
T25146 |
T25143 |
appos |
B,RAW |
R19203 |
T25147 |
T25143 |
punct |
),RAW |
R19204 |
T25148 |
T25150 |
nsubjpass |
cells,pretreated |
R19205 |
T25149 |
T25150 |
auxpass |
were,pretreated |
R19206 |
T25150 |
T25138 |
conj |
pretreated,A |
R19207 |
T25151 |
T25150 |
prep |
with,pretreated |
R19208 |
T25152 |
T25151 |
pobj |
Ro-31-8220,with |
R19209 |
T25153 |
T25152 |
cc |
or,Ro-31-8220 |
R19210 |
T25154 |
T25155 |
amod |
solvent,control |
R19211 |
T25155 |
T25156 |
compound |
control,DMSO |
R19212 |
T25156 |
T25152 |
conj |
DMSO,Ro-31-8220 |
R19213 |
T25157 |
T25150 |
prep |
for,pretreated |
R19214 |
T25158 |
T25159 |
nummod |
30,minutes |
R19215 |
T25159 |
T25157 |
pobj |
minutes,for |
R19216 |
T25160 |
T25150 |
advmod |
prior,pretreated |
R19217 |
T25161 |
T25160 |
prep |
to,prior |
R19218 |
T25162 |
T25163 |
compound |
M-CSF,stimulation |
R19219 |
T25163 |
T25161 |
pobj |
stimulation,to |
R19220 |
T25164 |
T25160 |
prep |
for,prior |
R19221 |
T25165 |
T25167 |
det |
the,times |
R19222 |
T25166 |
T25167 |
amod |
indicated,times |
R19223 |
T25167 |
T25164 |
pobj |
times,for |
R19224 |
T25168 |
T25150 |
punct |
.,pretreated |
R19225 |
T25169 |
T25170 |
amod |
Total,RNA |
R19226 |
T25170 |
T25171 |
nsubj |
RNA,was |
R19227 |
T25171 |
T25171 |
ROOT |
was,was |
R19228 |
T25172 |
T25171 |
acomp |
isolated,was |
R19229 |
T25173 |
T25172 |
cc |
and,isolated |
R19230 |
T25174 |
T25172 |
conj |
converted,isolated |
R19231 |
T25175 |
T25174 |
prep |
to,converted |
R19232 |
T25176 |
T25175 |
pobj |
cDNA,to |
R19233 |
T25177 |
T25171 |
punct |
.,was |
R19234 |
T25178 |
T25180 |
amod |
Real-time,PCR |
R19235 |
T25179 |
T25180 |
compound |
RT,PCR |
R19236 |
T25180 |
T25182 |
nsubjpass |
PCR,performed |
R19237 |
T25181 |
T25182 |
auxpass |
was,performed |
R19238 |
T25182 |
T25182 |
ROOT |
performed,performed |
R19239 |
T25183 |
T25182 |
advcl |
using,performed |
R19240 |
T25184 |
T25183 |
dobj |
primers,using |
R19241 |
T25185 |
T25183 |
prep |
for,using |
R19242 |
T25186 |
T25185 |
pobj |
IκBα,for |
R19243 |
T25187 |
T25186 |
punct |
",",IκBα |
R19244 |
T25188 |
T25186 |
conj |
BCL-xl,IκBα |
R19245 |
T25189 |
T25188 |
cc |
or,BCL-xl |
R19246 |
T25190 |
T25188 |
conj |
GAPDH,BCL-xl |
R19247 |
T25191 |
T25182 |
punct |
.,performed |
R19248 |
T25192 |
T25194 |
nsubjpass |
Data,expressed |
R19249 |
T25193 |
T25194 |
auxpass |
are,expressed |
R19250 |
T25194 |
T25194 |
ROOT |
expressed,expressed |
R19251 |
T25195 |
T25194 |
prep |
as,expressed |
R19252 |
T25196 |
T25197 |
amod |
relative,fold |
R19253 |
T25197 |
T25198 |
compound |
fold,increase |
R19254 |
T25198 |
T25195 |
pobj |
increase,as |
R19255 |
T25199 |
T25198 |
prep |
of,increase |
R19256 |
T25200 |
T25199 |
pobj |
IκBα,of |
R19257 |
T25201 |
T25200 |
cc |
or,IκBα |
R19258 |
T25202 |
T25200 |
conj |
BCL-xl,IκBα |
R19259 |
T25203 |
T25204 |
compound |
gene,expression |
R1926 |
T2116 |
T2117 |
auxpass |
was,reduced |
R19260 |
T25204 |
T25198 |
conj |
expression,increase |
R19261 |
T25205 |
T25204 |
prep |
upon,expression |
R19262 |
T25206 |
T25205 |
pobj |
treatment,upon |
R19263 |
T25207 |
T25204 |
prep |
over,expression |
R19264 |
T25208 |
T25209 |
amod |
non-stimulated,cells |
R19265 |
T25209 |
T25207 |
pobj |
cells,over |
R19266 |
T25210 |
T25194 |
punct |
.,expressed |
R19267 |
T25211 |
T25212 |
nsubj |
Data,represent |
R19268 |
T25212 |
T25212 |
ROOT |
represent,represent |
R19269 |
T25213 |
T25216 |
det |
the,S.E.M |
R19270 |
T25214 |
T25216 |
amod |
mean,S.E.M |
R19271 |
T25215 |
T25216 |
compound |
±,S.E.M |
R19272 |
T25216 |
T25212 |
dobj |
S.E.M,represent |
R19273 |
T25217 |
T25212 |
prep |
for,represent |
R19274 |
T25218 |
T25220 |
nummod |
three,experiments |
R19275 |
T25219 |
T25220 |
amod |
independent,experiments |
R19276 |
T25220 |
T25217 |
pobj |
experiments,for |
R19277 |
T25221 |
T25212 |
punct |
.,represent |
R193 |
T225 |
T224 |
punct |
",",phosphorylation |
R1930 |
T2117 |
T2117 |
ROOT |
reduced,reduced |
R1933 |
T2118 |
T2117 |
agent |
by,reduced |
R1936 |
T2119 |
T2120 |
det |
the,conventional |
R194 |
T226 |
T224 |
cc |
and,phosphorylation |
R1940 |
T2120 |
T2118 |
pobj |
conventional,by |
R19429 |
T25475 |
T25476 |
nsubj |
PKCα,regulates |
R19430 |
T25476 |
T25476 |
ROOT |
regulates,regulates |
R19431 |
T25477 |
T25476 |
dobj |
phosphorylation,regulates |
R19432 |
T25478 |
T25477 |
prep |
of,phosphorylation |
R19433 |
T25479 |
T25480 |
compound |
NF-κB,p65 |
R19434 |
T25480 |
T25478 |
pobj |
p65,of |
R19435 |
T25481 |
T25476 |
prep |
at,regulates |
R19436 |
T25482 |
T25481 |
pobj |
Ser276,at |
R19437 |
T25483 |
T25476 |
punct |
.,regulates |
R19438 |
T25484 |
T25497 |
punct |
(,transfected |
R19439 |
T25485 |
T25494 |
nmod |
A,cells |
R1944 |
T2121 |
T2117 |
punct |
",",reduced |
R19440 |
T25486 |
T25485 |
punct |
),A |
R19441 |
T25487 |
T25485 |
conj |
MDM,A |
R19442 |
T25488 |
T25487 |
cc |
or,MDM |
R19443 |
T25489 |
T25490 |
punct |
(,B |
R19444 |
T25490 |
T25492 |
nmod |
B,RAW |
R19445 |
T25491 |
T25492 |
punct |
),RAW |
R19446 |
T25492 |
T25487 |
conj |
RAW,MDM |
R19447 |
T25493 |
T25494 |
nummod |
264.7,cells |
R19448 |
T25494 |
T25497 |
nsubjpass |
cells,transfected |
R19449 |
T25495 |
T25497 |
auxpass |
were,transfected |
R19450 |
T25496 |
T25497 |
advmod |
transiently,transfected |
R19451 |
T25497 |
T25497 |
ROOT |
transfected,transfected |
R19452 |
T25498 |
T25497 |
prep |
with,transfected |
R19453 |
T25499 |
T25512 |
advcl |
pNF-κB-SEAP,construct |
R19454 |
T25500 |
T25499 |
prep |
along,pNF-κB-SEAP |
R19455 |
T25501 |
T25500 |
prep |
with,along |
R19456 |
T25502 |
T25503 |
det |
either,WT-PKCα |
R19457 |
T25503 |
T25501 |
pobj |
WT-PKCα,with |
R19458 |
T25504 |
T25503 |
cc |
or,WT-PKCα |
R19459 |
T25505 |
T25506 |
det |
the,kinase-deficient |
R19460 |
T25506 |
T25512 |
nsubj |
kinase-deficient,construct |
R19461 |
T25507 |
T25508 |
punct |
(,KD |
R19462 |
T25508 |
T25506 |
appos |
KD,kinase-deficient |
R19463 |
T25509 |
T25508 |
punct |
),KD |
R19464 |
T25510 |
T25511 |
punct |
-,PKCα |
R19465 |
T25511 |
T25506 |
appos |
PKCα,kinase-deficient |
R19466 |
T25512 |
T25497 |
advcl |
construct,transfected |
R19467 |
T25513 |
T25512 |
prep |
at,construct |
R19468 |
T25514 |
T25518 |
det |
a,ratio |
R19469 |
T25515 |
T25518 |
nummod |
1,ratio |
R19470 |
T25516 |
T25518 |
nmod |
∶,ratio |
R19471 |
T25517 |
T25516 |
nummod |
5,∶ |
R19472 |
T25518 |
T25513 |
pobj |
ratio,at |
R19473 |
T25519 |
T25497 |
punct |
.,transfected |
R19474 |
T25520 |
T25523 |
nsubjpass |
Cells,starved |
R19475 |
T25521 |
T25523 |
auxpass |
were,starved |
R19476 |
T25522 |
T25523 |
advmod |
serum,starved |
R19477 |
T25523 |
T25523 |
ROOT |
starved,starved |
R19478 |
T25524 |
T25523 |
cc |
and,starved |
R19479 |
T25525 |
T25523 |
conj |
stimulated,starved |
R1948 |
T2122 |
T2117 |
cc |
but,reduced |
R19480 |
T25526 |
T25525 |
prep |
with,stimulated |
R19481 |
T25527 |
T25526 |
pobj |
M-CSF,with |
R19482 |
T25528 |
T25525 |
cc |
and,stimulated |
R19483 |
T25529 |
T25531 |
advmod |
then,secretion |
R19484 |
T25530 |
T25531 |
compound |
SEAP,secretion |
R19485 |
T25531 |
T25536 |
nsubjpass |
secretion,measured |
R19486 |
T25532 |
T25531 |
prep |
in,secretion |
R19487 |
T25533 |
T25534 |
det |
the,medium |
R19488 |
T25534 |
T25532 |
pobj |
medium,in |
R19489 |
T25535 |
T25536 |
auxpass |
was,measured |
R19490 |
T25536 |
T25525 |
conj |
measured,stimulated |
R19491 |
T25537 |
T25536 |
punct |
.,measured |
R19492 |
T25538 |
T25539 |
nsubj |
Data,is |
R19493 |
T25539 |
T25539 |
ROOT |
is,is |
R19494 |
T25540 |
T25539 |
prep |
from,is |
R19495 |
T25541 |
T25540 |
prep |
of,from |
R19496 |
T25542 |
T25544 |
nummod |
three,experiments |
R19497 |
T25543 |
T25544 |
amod |
independent,experiments |
R19498 |
T25544 |
T25541 |
pobj |
experiments,of |
R19499 |
T25545 |
T25539 |
punct |
.,is |
R195 |
T227 |
T228 |
compound |
macrophage,survival |
R19500 |
T25546 |
T25547 |
det |
The,p-value |
R19501 |
T25547 |
T25550 |
nsubj |
p-value,transfected |
R19502 |
T25548 |
T25547 |
prep |
of,p-value |
R19503 |
T25549 |
T25548 |
pobj |
cells,of |
R19504 |
T25550 |
T25550 |
ROOT |
transfected,transfected |
R19505 |
T25551 |
T25550 |
prep |
with,transfected |
R19506 |
T25552 |
T25551 |
pobj |
KD,with |
R19507 |
T25553 |
T25550 |
prep |
compared,transfected |
R19508 |
T25554 |
T25553 |
prep |
to,compared |
R19509 |
T25555 |
T25559 |
nsubj |
those,was |
R1951 |
T2123 |
T2124 |
neg |
not,novel |
R19510 |
T25556 |
T25555 |
amod |
transfected,those |
R19511 |
T25557 |
T25556 |
prep |
with,transfected |
R19512 |
T25558 |
T25557 |
pobj |
WT,with |
R19513 |
T25559 |
T25559 |
ROOT |
was,was |
R19514 |
T25560 |
T25559 |
attr |
0.05,was |
R19515 |
T25561 |
T25559 |
punct |
.,was |
R19516 |
T25562 |
T25563 |
punct |
(,C |
R19517 |
T25563 |
T25563 |
ROOT |
C,C |
R19518 |
T25564 |
T25563 |
punct |
),C |
R19519 |
T25565 |
T25567 |
nsubjpass |
MDMs,removed |
R19520 |
T25566 |
T25567 |
auxpass |
were,removed |
R19521 |
T25567 |
T25567 |
ROOT |
removed,removed |
R19522 |
T25568 |
T25567 |
prep |
from,removed |
R19523 |
T25569 |
T25570 |
det |
the,plate |
R19524 |
T25570 |
T25568 |
pobj |
plate,from |
R19525 |
T25571 |
T25567 |
advcl |
using,removed |
R19526 |
T25572 |
T25571 |
dobj |
accutase,using |
R19527 |
T25573 |
T25572 |
cc |
and,accutase |
R19528 |
T25574 |
T25572 |
conj |
apoptosis,accutase |
R19529 |
T25575 |
T25572 |
prep |
of,accutase |
R19530 |
T25576 |
T25575 |
pobj |
MDMs,of |
R19531 |
T25577 |
T25578 |
auxpass |
was,measured |
R19532 |
T25578 |
T25567 |
conj |
measured,removed |
R19533 |
T25579 |
T25578 |
agent |
by,measured |
R19534 |
T25580 |
T25581 |
compound |
flow,cytometry |
R19535 |
T25581 |
T25579 |
pobj |
cytometry,by |
R19536 |
T25582 |
T25578 |
advcl |
using,measured |
R19537 |
T25583 |
T25584 |
compound |
Annexin,V-FITC |
R19538 |
T25584 |
T25582 |
dobj |
V-FITC,using |
R19539 |
T25585 |
T25584 |
cc |
and,V-FITC |
R1954 |
T2124 |
T2117 |
conj |
novel,reduced |
R19540 |
T25586 |
T25587 |
compound |
propidium,iodine |
R19541 |
T25587 |
T25584 |
conj |
iodine,V-FITC |
R19542 |
T25588 |
T25587 |
punct |
(,iodine |
R19543 |
T25589 |
T25587 |
appos |
PI,iodine |
R19544 |
T25590 |
T25587 |
punct |
),iodine |
R19545 |
T25591 |
T25567 |
punct |
.,removed |
R19546 |
T25592 |
T25597 |
punct |
(,lysates |
R19547 |
T25593 |
T25597 |
dep |
D,lysates |
R19548 |
T25594 |
T25595 |
punct |
),Whole |
R19549 |
T25595 |
T25596 |
amod |
Whole,cell |
R1955 |
T2125 |
T2124 |
punct |
",",novel |
R19550 |
T25596 |
T25597 |
nsubj |
cell,lysates |
R19551 |
T25597 |
T25597 |
ROOT |
lysates,lysates |
R19552 |
T25598 |
T25597 |
prep |
from,lysates |
R19553 |
T25599 |
T25601 |
det |
the,RAW |
R19554 |
T25600 |
T25601 |
amod |
transfected,RAW |
R19555 |
T25601 |
T25598 |
pobj |
RAW,from |
R19556 |
T25602 |
T25603 |
nummod |
264.7,cells |
R19557 |
T25603 |
T25605 |
nsubjpass |
cells,subjected |
R19558 |
T25604 |
T25605 |
auxpass |
were,subjected |
R19559 |
T25605 |
T25597 |
ccomp |
subjected,lysates |
R1956 |
T2126 |
T2127 |
compound |
PKC,inhibitors |
R19560 |
T25606 |
T25605 |
prep |
to,subjected |
R19561 |
T25607 |
T25609 |
amod |
Western,analysis |
R19562 |
T25608 |
T25609 |
compound |
blot,analysis |
R19563 |
T25609 |
T25606 |
pobj |
analysis,to |
R19564 |
T25610 |
T25609 |
prep |
with,analysis |
R19565 |
T25611 |
T25610 |
pobj |
phospho-Ser276,with |
R19566 |
T25612 |
T25611 |
cc |
or,phospho-Ser276 |
R19567 |
T25613 |
T25614 |
compound |
phospho-Ser536,NF-κB |
R19568 |
T25614 |
T25611 |
conj |
NF-κB,phospho-Ser276 |
R19569 |
T25615 |
T25616 |
nummod |
p65,antibodies |
R1957 |
T2127 |
T2124 |
appos |
inhibitors,novel |
R19570 |
T25616 |
T25609 |
appos |
antibodies,analysis |
R19571 |
T25617 |
T25597 |
punct |
.,lysates |
R19572 |
T25618 |
T25620 |
nsubjpass |
Blots,immunoblotted |
R19573 |
T25619 |
T25620 |
auxpass |
were,immunoblotted |
R19574 |
T25620 |
T25620 |
ROOT |
immunoblotted,immunoblotted |
R19575 |
T25621 |
T25620 |
prep |
with,immunoblotted |
R19576 |
T25622 |
T25621 |
pobj |
PKCα,with |
R19577 |
T25623 |
T25624 |
aux |
to,determine |
R19578 |
T25624 |
T25620 |
advcl |
determine,immunoblotted |
R19579 |
T25625 |
T25627 |
amod |
equal,expression |
R19580 |
T25626 |
T25627 |
compound |
protein,expression |
R19581 |
T25627 |
T25624 |
dobj |
expression,determine |
R19582 |
T25628 |
T25627 |
prep |
for,expression |
R19583 |
T25629 |
T25631 |
det |
the,constructs |
R19584 |
T25630 |
T25631 |
compound |
PKCα,constructs |
R19585 |
T25631 |
T25628 |
pobj |
constructs,for |
R19586 |
T25632 |
T25620 |
punct |
.,immunoblotted |
R19587 |
T25633 |
T25634 |
nsubj |
β-actin,served |
R19588 |
T25634 |
T25634 |
ROOT |
served,served |
R19589 |
T25635 |
T25634 |
prep |
as,served |
R19590 |
T25636 |
T25638 |
det |
a,control |
R19591 |
T25637 |
T25638 |
compound |
loading,control |
R19592 |
T25638 |
T25635 |
pobj |
control,as |
R19593 |
T25639 |
T25634 |
punct |
.,served |
R19594 |
T25640 |
T25640 |
ROOT |
Shown,Shown |
R19595 |
T25641 |
T25640 |
auxpass |
is,Shown |
R19596 |
T25642 |
T25644 |
det |
a,blot |
R19597 |
T25643 |
T25644 |
amod |
representative,blot |
R19598 |
T25644 |
T25640 |
nsubjpass |
blot,Shown |
R19599 |
T25645 |
T25644 |
prep |
from,blot |
R196 |
T228 |
T224 |
conj |
survival,phosphorylation |
R1960 |
T2128 |
T2127 |
punct |
",",inhibitors |
R19600 |
T25646 |
T25648 |
nummod |
three,experiments |
R19601 |
T25647 |
T25648 |
amod |
independent,experiments |
R19602 |
T25648 |
T25645 |
pobj |
experiments,from |
R19603 |
T25649 |
T25640 |
punct |
.,Shown |
R19604 |
T25650 |
T25653 |
punct |
(,MDM |
R19605 |
T25651 |
T25653 |
nmod |
E,MDM |
R19606 |
T25652 |
T25653 |
punct |
),MDM |
R19607 |
T25653 |
T25660 |
nmod |
MDM,cells |
R19608 |
T25654 |
T25653 |
cc |
or,MDM |
R19609 |
T25655 |
T25656 |
punct |
(,F |
R19610 |
T25656 |
T25653 |
conj |
F,MDM |
R19611 |
T25657 |
T25656 |
punct |
),F |
R19612 |
T25658 |
T25653 |
conj |
RAW,MDM |
R19613 |
T25659 |
T25660 |
nummod |
264.7,cells |
R19614 |
T25660 |
T25663 |
nsubjpass |
cells,transfected |
R19615 |
T25661 |
T25663 |
auxpass |
were,transfected |
R19616 |
T25662 |
T25663 |
advmod |
transiently,transfected |
R19617 |
T25663 |
T25663 |
ROOT |
transfected,transfected |
R19618 |
T25664 |
T25663 |
prep |
with,transfected |
R19619 |
T25665 |
T25666 |
det |
a,pNF-κB-SEAP |
R19620 |
T25666 |
T25664 |
pobj |
pNF-κB-SEAP,with |
R19621 |
T25667 |
T25666 |
prep |
along,pNF-κB-SEAP |
R19622 |
T25668 |
T25667 |
prep |
with,along |
R19623 |
T25669 |
T25673 |
det |
either,siRNA |
R19624 |
T25670 |
T25673 |
nummod |
100,siRNA |
R19625 |
T25671 |
T25673 |
compound |
nM,siRNA |
R19626 |
T25672 |
T25673 |
compound |
PKCα,siRNA |
R19627 |
T25673 |
T25668 |
pobj |
siRNA,with |
R19628 |
T25674 |
T25673 |
cc |
or,siRNA |
R19629 |
T25675 |
T25676 |
compound |
control,siRNA |
R1963 |
T2129 |
T2132 |
amod |
dominant,constructs |
R19630 |
T25676 |
T25673 |
conj |
siRNA,siRNA |
R19631 |
T25677 |
T25663 |
prep |
for,transfected |
R19632 |
T25678 |
T25679 |
nummod |
20-24,hours |
R19633 |
T25679 |
T25677 |
pobj |
hours,for |
R19634 |
T25680 |
T25663 |
punct |
.,transfected |
R19635 |
T25681 |
T25684 |
nsubjpass |
Cells,starved |
R19636 |
T25682 |
T25684 |
auxpass |
were,starved |
R19637 |
T25683 |
T25684 |
advmod |
serum,starved |
R19638 |
T25684 |
T25684 |
ROOT |
starved,starved |
R19639 |
T25685 |
T25684 |
prep |
for,starved |
R1964 |
T2130 |
T2132 |
amod |
negative,constructs |
R19640 |
T25686 |
T25687 |
nummod |
2-4,hours |
R19641 |
T25687 |
T25685 |
pobj |
hours,for |
R19642 |
T25688 |
T25684 |
cc |
and,starved |
R19643 |
T25689 |
T25684 |
conj |
stimulated,starved |
R19644 |
T25690 |
T25689 |
prep |
with,stimulated |
R19645 |
T25691 |
T25693 |
nummod |
100,M-CSF |
R19646 |
T25692 |
T25693 |
amod |
ng/ml,M-CSF |
R19647 |
T25693 |
T25690 |
pobj |
M-CSF,with |
R19648 |
T25694 |
T25693 |
prep |
for,M-CSF |
R19649 |
T25695 |
T25696 |
nummod |
6,hours |
R19650 |
T25696 |
T25694 |
pobj |
hours,for |
R19651 |
T25697 |
T25693 |
prep |
for,M-CSF |
R19652 |
T25698 |
T25697 |
pobj |
MDM,for |
R19653 |
T25699 |
T25698 |
cc |
or,MDM |
R19654 |
T25700 |
T25698 |
conj |
RAW,MDM |
R19655 |
T25701 |
T25700 |
nummod |
264.7,RAW |
R19656 |
T25702 |
T25693 |
prep |
for,M-CSF |
R19657 |
T25703 |
T25704 |
nummod |
2,hours |
R19658 |
T25704 |
T25702 |
pobj |
hours,for |
R19659 |
T25705 |
T25693 |
cc |
and,M-CSF |
R1966 |
T2131 |
T2132 |
compound |
PKCα,constructs |
R19660 |
T25706 |
T25708 |
advmod |
then,secretion |
R19661 |
T25707 |
T25708 |
compound |
SEAP,secretion |
R19662 |
T25708 |
T25693 |
conj |
secretion,M-CSF |
R19663 |
T25709 |
T25708 |
prep |
in,secretion |
R19664 |
T25710 |
T25711 |
det |
the,medium |
R19665 |
T25711 |
T25709 |
pobj |
medium,in |
R19666 |
T25712 |
T25713 |
auxpass |
was,measured |
R19667 |
T25713 |
T25684 |
conj |
measured,starved |
R19668 |
T25714 |
T25684 |
punct |
.,starved |
R19669 |
T25715 |
T25715 |
ROOT |
Shown,Shown |
R19670 |
T25716 |
T25715 |
auxpass |
is,Shown |
R19671 |
T25717 |
T25715 |
nsubjpass |
data,Shown |
R19672 |
T25718 |
T25717 |
prep |
of,data |
R19673 |
T25719 |
T25721 |
nummod |
three,experiments |
R19674 |
T25720 |
T25721 |
amod |
independent,experiments |
R19675 |
T25721 |
T25718 |
pobj |
experiments,of |
R19676 |
T25722 |
T25715 |
punct |
.,Shown |
R19677 |
T25723 |
T25724 |
punct |
(,G |
R19678 |
T25724 |
T25724 |
ROOT |
G,G |
R19679 |
T25725 |
T25724 |
punct |
),G |
R19680 |
T25726 |
T25728 |
nsubjpass |
MDMs,removed |
R19681 |
T25727 |
T25728 |
auxpass |
were,removed |
R19682 |
T25728 |
T25728 |
ROOT |
removed,removed |
R19683 |
T25729 |
T25728 |
prep |
from,removed |
R19684 |
T25730 |
T25731 |
det |
the,plate |
R19685 |
T25731 |
T25729 |
pobj |
plate,from |
R19686 |
T25732 |
T25728 |
advcl |
using,removed |
R19687 |
T25733 |
T25732 |
dobj |
accutase,using |
R19688 |
T25734 |
T25733 |
cc |
and,accutase |
R19689 |
T25735 |
T25733 |
conj |
apoptosis,accutase |
R19690 |
T25736 |
T25733 |
prep |
of,accutase |
R19691 |
T25737 |
T25736 |
pobj |
MDMs,of |
R19692 |
T25738 |
T25739 |
auxpass |
was,measured |
R19693 |
T25739 |
T25728 |
conj |
measured,removed |
R19694 |
T25740 |
T25739 |
agent |
by,measured |
R19695 |
T25741 |
T25742 |
compound |
Annexin,V-FITC |
R19696 |
T25742 |
T25740 |
pobj |
V-FITC,by |
R19697 |
T25743 |
T25742 |
cc |
and,V-FITC |
R19698 |
T25744 |
T25745 |
compound |
propidium,iodine |
R19699 |
T25745 |
T25742 |
conj |
iodine,V-FITC |
R197 |
T229 |
T201 |
punct |
.,identify |
R19700 |
T25746 |
T25747 |
punct |
(,PI |
R19701 |
T25747 |
T25745 |
appos |
PI,iodine |
R19702 |
T25748 |
T25745 |
punct |
),iodine |
R19703 |
T25749 |
T25739 |
xcomp |
staining,measured |
R19704 |
T25750 |
T25739 |
cc |
and,measured |
R19705 |
T25751 |
T25739 |
conj |
analyzed,measured |
R19706 |
T25752 |
T25751 |
agent |
by,analyzed |
R19707 |
T25753 |
T25754 |
compound |
flow,cytometry |
R19708 |
T25754 |
T25752 |
pobj |
cytometry,by |
R19709 |
T25755 |
T25728 |
punct |
.,removed |
R19710 |
T25756 |
T25761 |
punct |
(,lysates |
R19711 |
T25757 |
T25760 |
compound |
H,cell |
R19712 |
T25758 |
T25759 |
punct |
),Whole |
R19713 |
T25759 |
T25760 |
compound |
Whole,cell |
R19714 |
T25760 |
T25761 |
nsubj |
cell,lysates |
R19715 |
T25761 |
T25761 |
ROOT |
lysates,lysates |
R19716 |
T25762 |
T25761 |
prep |
from,lysates |
R19717 |
T25763 |
T25765 |
det |
the,MDM |
R19718 |
T25764 |
T25765 |
amod |
transfected,MDM |
R19719 |
T25765 |
T25769 |
nmod |
MDM,cells |
R19720 |
T25766 |
T25765 |
cc |
and,MDM |
R19721 |
T25767 |
T25765 |
conj |
RAW,MDM |
R19722 |
T25768 |
T25769 |
nummod |
264.7,cells |
R19723 |
T25769 |
T25762 |
pobj |
cells,from |
R19724 |
T25770 |
T25771 |
auxpass |
were,subjected |
R19725 |
T25771 |
T25761 |
conj |
subjected,lysates |
R19726 |
T25772 |
T25771 |
prep |
to,subjected |
R19727 |
T25773 |
T25775 |
amod |
Western,analysis |
R19728 |
T25774 |
T25775 |
compound |
blot,analysis |
R19729 |
T25775 |
T25772 |
pobj |
analysis,to |
R19730 |
T25776 |
T25771 |
prep |
with,subjected |
R19731 |
T25777 |
T25778 |
compound |
PKCα,antibody |
R19732 |
T25778 |
T25776 |
pobj |
antibody,with |
R19733 |
T25779 |
T25761 |
punct |
.,lysates |
R19734 |
T25780 |
T25781 |
nsubj |
β-actin,served |
R19735 |
T25781 |
T25781 |
ROOT |
served,served |
R19736 |
T25782 |
T25781 |
prep |
as,served |
R19737 |
T25783 |
T25785 |
det |
a,control |
R19738 |
T25784 |
T25785 |
compound |
loading,control |
R19739 |
T25785 |
T25782 |
pobj |
control,as |
R19740 |
T25786 |
T25781 |
punct |
.,served |
R19741 |
T25787 |
T25787 |
ROOT |
Shown,Shown |
R19742 |
T25788 |
T25787 |
auxpass |
is,Shown |
R19743 |
T25789 |
T25791 |
det |
a,blot |
R19744 |
T25790 |
T25791 |
amod |
representative,blot |
R19745 |
T25791 |
T25787 |
nsubjpass |
blot,Shown |
R19746 |
T25792 |
T25791 |
prep |
from,blot |
R19747 |
T25793 |
T25794 |
advmod |
at,least |
R19748 |
T25794 |
T25795 |
advmod |
least,three |
R19749 |
T25795 |
T25797 |
nummod |
three,experiments |
R19750 |
T25796 |
T25797 |
amod |
independent,experiments |
R19751 |
T25797 |
T25792 |
pobj |
experiments,from |
R19752 |
T25798 |
T25787 |
punct |
.,Shown |
R1977 |
T2132 |
T2127 |
conj |
constructs,inhibitors |
R1978 |
T2133 |
T2132 |
cc |
or,constructs |
R198 |
T230 |
T233 |
advmod |
Lastly,find |
R1984 |
T2134 |
T2135 |
compound |
PKCα,siRNA |
R199 |
T231 |
T233 |
punct |
",",find |
R200 |
T232 |
T233 |
nsubj |
we,find |
R201 |
T233 |
T233 |
ROOT |
find,find |
R20141 |
T26362 |
T26364 |
compound |
NF-κB,Ser276 |
R20142 |
T26363 |
T26364 |
compound |
p65,Ser276 |
R20143 |
T26364 |
T26365 |
nsubj |
Ser276,is |
R20144 |
T26365 |
T26365 |
ROOT |
is,is |
R20145 |
T26366 |
T26365 |
acomp |
essential,is |
R20146 |
T26367 |
T26366 |
prep |
in,essential |
R20147 |
T26368 |
T26367 |
pcomp |
regulating,in |
R20148 |
T26369 |
T26370 |
amod |
NF-κB,activity |
R20149 |
T26370 |
T26368 |
dobj |
activity,regulating |
R20150 |
T26371 |
T26365 |
punct |
.,is |
R20151 |
T26372 |
T26373 |
punct |
(,A |
R20152 |
T26373 |
T26373 |
ROOT |
A,A |
R20153 |
T26374 |
T26373 |
punct |
),A |
R20154 |
T26375 |
T26378 |
amod |
Raw,line |
R20155 |
T26376 |
T26378 |
nummod |
264.7,line |
R20156 |
T26377 |
T26378 |
compound |
cell,line |
R20157 |
T26378 |
T26381 |
nsubjpass |
line,transfected |
R20158 |
T26379 |
T26381 |
auxpass |
was,transfected |
R20159 |
T26380 |
T26381 |
advmod |
transiently,transfected |
R20160 |
T26381 |
T26381 |
ROOT |
transfected,transfected |
R20161 |
T26382 |
T26381 |
prep |
with,transfected |
R20162 |
T26383 |
T26390 |
amod |
pNF-κB-SEAP,encoding |
R20163 |
T26384 |
T26383 |
prep |
along,pNF-κB-SEAP |
R20164 |
T26385 |
T26384 |
prep |
with,along |
R20165 |
T26386 |
T26387 |
amod |
empty,vector |
R20166 |
T26387 |
T26385 |
pobj |
vector,with |
R20167 |
T26388 |
T26387 |
cc |
or,vector |
R20168 |
T26389 |
T26387 |
conj |
plasmid,vector |
R20169 |
T26390 |
T26382 |
pobj |
encoding,with |
R20170 |
T26391 |
T26392 |
det |
either,NF-κB |
R20171 |
T26392 |
T26390 |
appos |
NF-κB,encoding |
R20172 |
T26393 |
T26394 |
nummod |
p65,WT |
R20173 |
T26394 |
T26392 |
conj |
WT,NF-κB |
R20174 |
T26395 |
T26394 |
cc |
or,WT |
R20175 |
T26396 |
T26394 |
conj |
NF-κB,WT |
R20176 |
T26397 |
T26398 |
compound |
p65,276S/A |
R20177 |
T26398 |
T26394 |
conj |
276S/A,WT |
R20178 |
T26399 |
T26381 |
punct |
.,transfected |
R20179 |
T26400 |
T26401 |
det |
The,cells |
R20180 |
T26401 |
T26403 |
nsubjpass |
cells,transfected |
R20181 |
T26402 |
T26403 |
auxpass |
were,transfected |
R20182 |
T26403 |
T26409 |
ccomp |
transfected,starved |
R20183 |
T26404 |
T26403 |
prep |
for,transfected |
R20184 |
T26405 |
T26406 |
nummod |
18-24,hours |
R20185 |
T26406 |
T26404 |
pobj |
hours,for |
R20186 |
T26407 |
T26409 |
punct |
",",starved |
R20187 |
T26408 |
T26409 |
nsubj |
serum,starved |
R20188 |
T26409 |
T26409 |
ROOT |
starved,starved |
R20189 |
T26410 |
T26409 |
prep |
for,starved |
R20190 |
T26411 |
T26412 |
nummod |
4,hours |
R20191 |
T26412 |
T26410 |
pobj |
hours,for |
R20192 |
T26413 |
T26409 |
punct |
",",starved |
R20193 |
T26414 |
T26409 |
cc |
and,starved |
R20194 |
T26415 |
T26416 |
advmod |
then,incubated |
R20195 |
T26416 |
T26409 |
conj |
incubated,starved |
R20196 |
T26417 |
T26416 |
prep |
with,incubated |
R20197 |
T26418 |
T26419 |
nummod |
10,µM |
R20198 |
T26419 |
T26417 |
pobj |
µM,with |
R20199 |
T26420 |
T26419 |
prep |
of,µM |
R202 |
T234 |
T238 |
mark |
that,plays |
R20200 |
T26421 |
T26420 |
pobj |
Ro-31-8220,of |
R20201 |
T26422 |
T26416 |
prep |
for,incubated |
R20202 |
T26423 |
T26424 |
nummod |
30,minutes |
R20203 |
T26424 |
T26422 |
pobj |
minutes,for |
R20204 |
T26425 |
T26416 |
advmod |
prior,incubated |
R20205 |
T26426 |
T26425 |
prep |
to,prior |
R20206 |
T26427 |
T26426 |
pobj |
treatment,to |
R20207 |
T26428 |
T26425 |
prep |
with,prior |
R20208 |
T26429 |
T26430 |
nummod |
100,ng/ml |
R20209 |
T26430 |
T26428 |
pobj |
ng/ml,with |
R20210 |
T26431 |
T26430 |
prep |
of,ng/ml |
R20211 |
T26432 |
T26431 |
pobj |
M-CSF,of |
R20212 |
T26433 |
T26430 |
prep |
for,ng/ml |
R20213 |
T26434 |
T26435 |
nummod |
2,hours |
R20214 |
T26435 |
T26433 |
pobj |
hours,for |
R20215 |
T26436 |
T26435 |
cc |
and,hours |
R20216 |
T26437 |
T26438 |
compound |
SEAP,secretion |
R20217 |
T26438 |
T26430 |
conj |
secretion,ng/ml |
R20218 |
T26439 |
T26438 |
prep |
in,secretion |
R20219 |
T26440 |
T26441 |
det |
the,medium |
R20220 |
T26441 |
T26439 |
pobj |
medium,in |
R20221 |
T26442 |
T26443 |
auxpass |
was,measured |
R20222 |
T26443 |
T26416 |
conj |
measured,incubated |
R20223 |
T26444 |
T26409 |
punct |
.,starved |
R20224 |
T26445 |
T26450 |
punct |
(,− |
R20225 |
T26446 |
T26449 |
compound |
B,p65 |
R20226 |
T26447 |
T26448 |
punct |
),NF-κB |
R20227 |
T26448 |
T26449 |
compound |
NF-κB,p65 |
R20228 |
T26449 |
T26450 |
nsubj |
p65,− |
R20229 |
T26450 |
T26450 |
ROOT |
−,− |
R20230 |
T26451 |
T26454 |
amod |
/,line |
R20231 |
T26452 |
T26454 |
nummod |
−,line |
R20232 |
T26453 |
T26454 |
compound |
cell,line |
R20233 |
T26454 |
T26457 |
nsubjpass |
line,transfected |
R20234 |
T26455 |
T26457 |
auxpass |
was,transfected |
R20235 |
T26456 |
T26457 |
advmod |
transiently,transfected |
R20236 |
T26457 |
T26450 |
ccomp |
transfected,− |
R20237 |
T26458 |
T26457 |
prep |
with,transfected |
R20238 |
T26459 |
T26466 |
amod |
pNF-κB-SEAP,encoding |
R20239 |
T26460 |
T26459 |
prep |
along,pNF-κB-SEAP |
R20240 |
T26461 |
T26460 |
prep |
with,along |
R20241 |
T26462 |
T26463 |
amod |
empty,vector |
R20242 |
T26463 |
T26461 |
pobj |
vector,with |
R20243 |
T26464 |
T26463 |
cc |
or,vector |
R20244 |
T26465 |
T26463 |
conj |
plasmid,vector |
R20245 |
T26466 |
T26470 |
amod |
encoding,WT |
R20246 |
T26467 |
T26470 |
preconj |
either,WT |
R20247 |
T26468 |
T26470 |
compound |
NF-κB,WT |
R20248 |
T26469 |
T26470 |
compound |
p65,WT |
R20249 |
T26470 |
T26458 |
pobj |
WT,with |
R20250 |
T26471 |
T26470 |
punct |
",",WT |
R20251 |
T26472 |
T26474 |
compound |
NF-κB,276S/A |
R20252 |
T26473 |
T26474 |
compound |
p65,276S/A |
R20253 |
T26474 |
T26470 |
conj |
276S/A,WT |
R20254 |
T26475 |
T26474 |
punct |
",",276S/A |
R20255 |
T26476 |
T26474 |
cc |
or,276S/A |
R20256 |
T26477 |
T26474 |
conj |
NF-κB,276S/A |
R20257 |
T26478 |
T26479 |
compound |
p65,536S/A |
R20258 |
T26479 |
T26474 |
conj |
536S/A,276S/A |
R20259 |
T26480 |
T26450 |
punct |
.,− |
R20260 |
T26481 |
T26482 |
det |
The,cells |
R20261 |
T26482 |
T26483 |
nsubj |
cells,were |
R20262 |
T26483 |
T26483 |
ROOT |
were,were |
R20263 |
T26484 |
T26483 |
acomp |
cultured,were |
R20264 |
T26485 |
T26484 |
prep |
for,cultured |
R20265 |
T26486 |
T26487 |
nummod |
24,hours |
R20266 |
T26487 |
T26485 |
pobj |
hours,for |
R20267 |
T26488 |
T26484 |
cc |
and,cultured |
R20268 |
T26489 |
T26491 |
advmod |
then,starved |
R20269 |
T26490 |
T26491 |
nsubj |
serum,starved |
R20270 |
T26491 |
T26484 |
conj |
starved,cultured |
R20271 |
T26492 |
T26491 |
prep |
for,starved |
R20272 |
T26493 |
T26494 |
nummod |
4,hours |
R20273 |
T26494 |
T26492 |
pobj |
hours,for |
R20274 |
T26495 |
T26483 |
punct |
.,were |
R20275 |
T26496 |
T26499 |
nsubjpass |
Cells,incubated |
R20276 |
T26497 |
T26499 |
auxpass |
were,incubated |
R20277 |
T26498 |
T26499 |
advmod |
then,incubated |
R20278 |
T26499 |
T26499 |
ROOT |
incubated,incubated |
R20279 |
T26500 |
T26499 |
prep |
in,incubated |
R20280 |
T26501 |
T26503 |
amod |
fresh,medium |
R20281 |
T26502 |
T26503 |
compound |
DMEM,medium |
R20282 |
T26503 |
T26500 |
pobj |
medium,in |
R20283 |
T26504 |
T26499 |
prep |
for,incubated |
R20284 |
T26505 |
T26506 |
nummod |
2,hours |
R20285 |
T26506 |
T26504 |
pobj |
hours,for |
R20286 |
T26507 |
T26506 |
cc |
and,hours |
R20287 |
T26508 |
T26509 |
compound |
SEAP,secretion |
R20288 |
T26509 |
T26514 |
nsubjpass |
secretion,measured |
R20289 |
T26510 |
T26509 |
prep |
in,secretion |
R20290 |
T26511 |
T26512 |
det |
the,medium |
R20291 |
T26512 |
T26510 |
pobj |
medium,in |
R20292 |
T26513 |
T26514 |
auxpass |
was,measured |
R20293 |
T26514 |
T26499 |
conj |
measured,incubated |
R20294 |
T26515 |
T26514 |
punct |
.,measured |
R20295 |
T26516 |
T26517 |
det |
The,results |
R20296 |
T26517 |
T26519 |
nsubj |
results,are |
R20297 |
T26518 |
T26517 |
acl |
shown,results |
R20298 |
T26519 |
T26519 |
ROOT |
are,are |
R20299 |
T26520 |
T26519 |
xcomp |
fold,are |
R203 |
T235 |
T237 |
compound |
NF-κB,Ser276 |
R20300 |
T26521 |
T26520 |
dobj |
change,fold |
R20301 |
T26522 |
T26520 |
prep |
over,fold |
R20302 |
T26523 |
T26526 |
amod |
empty,pTAL-SEAP |
R20303 |
T26524 |
T26526 |
compound |
vector,pTAL-SEAP |
R20304 |
T26525 |
T26526 |
compound |
+,pTAL-SEAP |
R20305 |
T26526 |
T26522 |
pobj |
pTAL-SEAP,over |
R20306 |
T26527 |
T26519 |
punct |
.,are |
R20307 |
T26528 |
T26533 |
punct |
(,− |
R20308 |
T26529 |
T26532 |
compound |
C,p65 |
R20309 |
T26530 |
T26531 |
punct |
),NF-κB |
R20310 |
T26531 |
T26532 |
compound |
NF-κB,p65 |
R20311 |
T26532 |
T26533 |
nsubj |
p65,− |
R20312 |
T26533 |
T26533 |
ROOT |
−,− |
R20313 |
T26534 |
T26537 |
amod |
/,line |
R20314 |
T26535 |
T26537 |
nummod |
−,line |
R20315 |
T26536 |
T26537 |
compound |
cell,line |
R20316 |
T26537 |
T26540 |
nsubjpass |
line,transfected |
R20317 |
T26538 |
T26540 |
auxpass |
was,transfected |
R20318 |
T26539 |
T26540 |
advmod |
transiently,transfected |
R20319 |
T26540 |
T26533 |
ccomp |
transfected,− |
R20320 |
T26541 |
T26540 |
prep |
with,transfected |
R20321 |
T26542 |
T26541 |
pobj |
pNF-κB-SEAP,with |
R20322 |
T26543 |
T26542 |
prep |
with,pNF-κB-SEAP |
R20323 |
T26544 |
T26546 |
preconj |
either,vector |
R20324 |
T26545 |
T26546 |
amod |
empty,vector |
R20325 |
T26546 |
T26543 |
pobj |
vector,with |
R20326 |
T26547 |
T26546 |
cc |
or,vector |
R20327 |
T26548 |
T26546 |
conj |
plasmid,vector |
R20328 |
T26549 |
T26546 |
conj |
encoding,vector |
R20329 |
T26550 |
T26551 |
det |
either,NF-κB |
R20330 |
T26551 |
T26549 |
dobj |
NF-κB,encoding |
R20331 |
T26552 |
T26553 |
nummod |
p65,WT |
R20332 |
T26553 |
T26551 |
conj |
WT,NF-κB |
R20333 |
T26554 |
T26553 |
cc |
or,WT |
R20334 |
T26555 |
T26553 |
conj |
NF-κB,WT |
R20335 |
T26556 |
T26557 |
compound |
p65,276S/A |
R20336 |
T26557 |
T26553 |
conj |
276S/A,WT |
R20337 |
T26558 |
T26533 |
punct |
.,− |
R20338 |
T26559 |
T26560 |
det |
The,cells |
R20339 |
T26560 |
T26562 |
nsubjpass |
cells,transfected |
R20340 |
T26561 |
T26562 |
auxpass |
were,transfected |
R20341 |
T26562 |
T26562 |
ROOT |
transfected,transfected |
R20342 |
T26563 |
T26562 |
prep |
for,transfected |
R20343 |
T26564 |
T26565 |
nummod |
24,hours |
R20344 |
T26565 |
T26563 |
pobj |
hours,for |
R20345 |
T26566 |
T26565 |
cc |
and,hours |
R20346 |
T26567 |
T26565 |
conj |
serum,hours |
R20347 |
T26568 |
T26562 |
conj |
starved,transfected |
R20348 |
T26569 |
T26568 |
prep |
for,starved |
R20349 |
T26570 |
T26571 |
nummod |
4,hours |
R20350 |
T26571 |
T26569 |
pobj |
hours,for |
R20351 |
T26572 |
T26568 |
punct |
",",starved |
R20352 |
T26573 |
T26568 |
cc |
and,starved |
R20353 |
T26574 |
T26575 |
advmod |
then,incubated |
R20354 |
T26575 |
T26568 |
conj |
incubated,starved |
R20355 |
T26576 |
T26575 |
prep |
with,incubated |
R20356 |
T26577 |
T26578 |
nummod |
10,µM |
R20357 |
T26578 |
T26576 |
pobj |
µM,with |
R20358 |
T26579 |
T26578 |
prep |
of,µM |
R20359 |
T26580 |
T26579 |
pobj |
Ro-31-8220,of |
R20360 |
T26581 |
T26575 |
prep |
for,incubated |
R20361 |
T26582 |
T26583 |
nummod |
30,minutes |
R20362 |
T26583 |
T26581 |
pobj |
minutes,for |
R20363 |
T26584 |
T26575 |
advmod |
prior,incubated |
R20364 |
T26585 |
T26584 |
prep |
to,prior |
R20365 |
T26586 |
T26585 |
pobj |
treatment,to |
R20366 |
T26587 |
T26584 |
prep |
with,prior |
R20367 |
T26588 |
T26589 |
nummod |
10,ng/ml |
R20368 |
T26589 |
T26587 |
pobj |
ng/ml,with |
R20369 |
T26590 |
T26589 |
prep |
of,ng/ml |
R20370 |
T26591 |
T26590 |
pobj |
TNFα,of |
R20371 |
T26592 |
T26562 |
punct |
.,transfected |
R20372 |
T26593 |
T26594 |
det |
The,supernatant |
R20373 |
T26594 |
T26596 |
nsubjpass |
supernatant,collected |
R20374 |
T26595 |
T26596 |
auxpass |
were,collected |
R20375 |
T26596 |
T26596 |
ROOT |
collected,collected |
R20376 |
T26597 |
T26609 |
mark |
after,measured |
R20377 |
T26598 |
T26599 |
nummod |
2,hours |
R20378 |
T26599 |
T26597 |
pobj |
hours,after |
R20379 |
T26600 |
T26599 |
prep |
of,hours |
R20380 |
T26601 |
T26600 |
pobj |
treatment,of |
R20381 |
T26602 |
T26601 |
cc |
and,treatment |
R20382 |
T26603 |
T26604 |
compound |
SEAP,secretion |
R20383 |
T26604 |
T26601 |
conj |
secretion,treatment |
R20384 |
T26605 |
T26599 |
prep |
in,hours |
R20385 |
T26606 |
T26607 |
det |
the,medium |
R20386 |
T26607 |
T26605 |
pobj |
medium,in |
R20387 |
T26608 |
T26609 |
auxpass |
was,measured |
R20388 |
T26609 |
T26596 |
advcl |
measured,collected |
R20389 |
T26610 |
T26596 |
punct |
.,collected |
R20390 |
T26611 |
T26612 |
det |
The,results |
R20391 |
T26612 |
T26614 |
nsubj |
results,are |
R20392 |
T26613 |
T26612 |
acl |
shown,results |
R20393 |
T26614 |
T26614 |
ROOT |
are,are |
R20394 |
T26615 |
T26616 |
det |
the,fold |
R20395 |
T26616 |
T26614 |
attr |
fold,are |
R20396 |
T26617 |
T26616 |
dobj |
change,fold |
R20397 |
T26618 |
T26616 |
prep |
over,fold |
R20398 |
T26619 |
T26622 |
amod |
empty,pNF-κB-SEAP |
R20399 |
T26620 |
T26622 |
compound |
vector,pNF-κB-SEAP |
R204 |
T236 |
T237 |
compound |
p65,Ser276 |
R20400 |
T26621 |
T26622 |
compound |
+,pNF-κB-SEAP |
R20401 |
T26622 |
T26618 |
pobj |
pNF-κB-SEAP,over |
R20402 |
T26623 |
T26614 |
punct |
.,are |
R20403 |
T26624 |
T26626 |
nsubj |
Data,are |
R20404 |
T26625 |
T26624 |
acl |
shown,Data |
R20405 |
T26626 |
T26626 |
ROOT |
are,are |
R20406 |
T26627 |
T26629 |
amod |
mean,S.E.M |
R20407 |
T26628 |
T26629 |
compound |
±,S.E.M |
R20408 |
T26629 |
T26626 |
attr |
S.E.M,are |
R20409 |
T26630 |
T26629 |
prep |
for,S.E.M |
R20410 |
T26631 |
T26632 |
advmod |
at,least |
R20411 |
T26632 |
T26633 |
advmod |
least,three |
R20412 |
T26633 |
T26635 |
nummod |
three,experiments |
R20413 |
T26634 |
T26635 |
amod |
independent,experiments |
R20414 |
T26635 |
T26630 |
pobj |
experiments,for |
R20415 |
T26636 |
T26635 |
acl |
performed,experiments |
R20416 |
T26637 |
T26636 |
prep |
in,performed |
R20417 |
T26638 |
T26637 |
pobj |
duplicate,in |
R20418 |
T26639 |
T26626 |
punct |
.,are |
R20476 |
T26848 |
T26849 |
amod |
Proposed,model |
R20477 |
T26849 |
T26849 |
ROOT |
model,model |
R20478 |
T26850 |
T26849 |
prep |
for,model |
R20479 |
T26851 |
T26853 |
amod |
M-CSF-induced,survival |
R20480 |
T26852 |
T26853 |
compound |
monocyte,survival |
R20481 |
T26853 |
T26850 |
pobj |
survival,for |
R20482 |
T26854 |
T26849 |
prep |
via,model |
R20483 |
T26855 |
T26856 |
compound |
PKC,regulation |
R20484 |
T26856 |
T26854 |
pobj |
regulation,via |
R20485 |
T26857 |
T26849 |
prep |
by,model |
R20486 |
T26858 |
T26857 |
pcomp |
activating,by |
R20487 |
T26859 |
T26861 |
nsubj |
NF-κB,phosphorylation |
R20488 |
T26860 |
T26861 |
nummod |
p65,phosphorylation |
R20489 |
T26861 |
T26858 |
dobj |
phosphorylation,activating |
R20490 |
T26862 |
T26861 |
prep |
at,phosphorylation |
R20491 |
T26863 |
T26862 |
pobj |
Ser276,at |
R20492 |
T26864 |
T26849 |
punct |
.,model |
R205 |
T237 |
T238 |
nsubj |
Ser276,plays |
R206 |
T238 |
T233 |
ccomp |
plays,find |
R207 |
T239 |
T241 |
det |
an,role |
R208 |
T240 |
T241 |
amod |
important,role |
R209 |
T241 |
T238 |
dobj |
role,plays |
R210 |
T242 |
T241 |
prep |
in,role |
R211 |
T243 |
T247 |
amod |
basal,activation |
R212 |
T244 |
T243 |
cc |
and,basal |
R213 |
T245 |
T243 |
conj |
M-CSF-stimulated,basal |
R214 |
T246 |
T247 |
compound |
NF-κB,activation |
R215 |
T247 |
T242 |
pobj |
activation,in |
R216 |
T248 |
T247 |
prep |
in,activation |
R217 |
T249 |
T250 |
amod |
human,mononuclear |
R218 |
T250 |
T251 |
compound |
mononuclear,phagocytes |
R219 |
T251 |
T248 |
pobj |
phagocytes,in |
R220 |
T252 |
T233 |
punct |
.,find |
R26 |
T58 |
T59 |
nsubj |
M-CSF,Induces |
R27 |
T59 |
T79 |
nsubj |
Induces,promotes |
R28 |
T60 |
T61 |
compound |
Monocyte,Survival |
R29 |
T61 |
T59 |
dobj |
Survival,Induces |
R30 |
T62 |
T59 |
prep |
by,Induces |
R31 |
T63 |
T64 |
compound |
Activating,NF-κB |
R32 |
T64 |
T62 |
pobj |
NF-κB,by |
R33 |
T65 |
T66 |
nummod |
p65,Phosphorylation |
R34 |
T66 |
T59 |
conj |
Phosphorylation,Induces |
R3429 |
T4674 |
T4675 |
nsubj |
M-CSF,Induces |
R3430 |
T4675 |
T4675 |
ROOT |
Induces,Induces |
R3431 |
T4676 |
T4678 |
compound |
NF-κB,Activity |
R3432 |
T4677 |
T4678 |
compound |
Transcriptional,Activity |
R3433 |
T4678 |
T4675 |
dobj |
Activity,Induces |
R3434 |
T4679 |
T4678 |
prep |
in,Activity |
R3435 |
T4680 |
T4681 |
compound |
Human,Monocyte |
R3436 |
T4681 |
T4679 |
pobj |
Monocyte,in |
R3437 |
T4682 |
T4683 |
compound |
Derived,Macrophages |
R3438 |
T4683 |
T4678 |
conj |
Macrophages,Activity |
R3439 |
T4684 |
T4685 |
punct |
(,MDMs |
R3440 |
T4685 |
T4683 |
appos |
MDMs,Macrophages |
R3441 |
T4686 |
T4685 |
punct |
),MDMs |
R3442 |
T4687 |
T4683 |
cc |
and,Macrophages |
R3443 |
T4688 |
T4691 |
compound |
Mouse,Line |
R3444 |
T4689 |
T4691 |
compound |
Macrophage,Line |
R3445 |
T4690 |
T4691 |
compound |
Cell,Line |
R3446 |
T4691 |
T4683 |
conj |
Line,Macrophages |
R3447 |
T4692 |
T4691 |
punct |
",",Line |
R3448 |
T4693 |
T4691 |
conj |
RAW,Line |
R3449 |
T4694 |
T4693 |
nummod |
264.7,RAW |
R3450 |
T4695 |
T4696 |
aux |
To,determine |
R3451 |
T4696 |
T4675 |
advcl |
determine,Induces |
R3452 |
T4697 |
T4699 |
mark |
if,induced |
R3453 |
T4698 |
T4699 |
nsubj |
M-CSF,induced |
R3454 |
T4699 |
T4708 |
advcl |
induced,performed |
R3455 |
T4700 |
T4701 |
compound |
NF-κB,DNA |
R3456 |
T4701 |
T4699 |
dobj |
DNA,induced |
R3457 |
T4702 |
T4699 |
advcl |
binding,induced |
R3458 |
T4703 |
T4702 |
prep |
in,binding |
R3459 |
T4704 |
T4705 |
amod |
human,macrophages |
R3460 |
T4705 |
T4703 |
pobj |
macrophages,in |
R3461 |
T4706 |
T4708 |
punct |
",",performed |
R3462 |
T4707 |
T4708 |
nsubj |
we,performed |
R3463 |
T4708 |
T4675 |
conj |
performed,Induces |
R3464 |
T4709 |
T4710 |
compound |
EMSA,analysis |
R3465 |
T4710 |
T4708 |
dobj |
analysis,performed |
R3466 |
T4711 |
T4708 |
prep |
on,performed |
R3467 |
T4712 |
T4713 |
amod |
nuclear,lysates |
R3468 |
T4713 |
T4711 |
pobj |
lysates,on |
R3469 |
T4714 |
T4713 |
prep |
from,lysates |
R3470 |
T4715 |
T4716 |
amod |
M-CSF-treated,MDMs |
R3471 |
T4716 |
T4714 |
pobj |
MDMs,from |
R3472 |
T4717 |
T4708 |
punct |
.,performed |
R3473 |
T4718 |
T4718 |
ROOT |
Similar,Similar |
R3474 |
T4719 |
T4718 |
prep |
to,Similar |
R3475 |
T4720 |
T4721 |
amod |
previous,reports |
R3476 |
T4721 |
T4719 |
pobj |
reports,to |
R3477 |
T4722 |
T4724 |
compound |
[,] |
R3478 |
T4723 |
T4724 |
compound |
11,] |
R3479 |
T4724 |
T4718 |
appos |
],Similar |
R3480 |
T4725 |
T4724 |
punct |
",",] |
R3481 |
T4726 |
T4727 |
amod |
nuclear,NF-κB |
R3482 |
T4727 |
T4724 |
appos |
NF-κB,] |
R3483 |
T4728 |
T4729 |
advmod |
constitutively,bound |
R3484 |
T4729 |
T4730 |
amod |
bound,DNA |
R3485 |
T4730 |
T4724 |
conj |
DNA,] |
R3486 |
T4731 |
T4730 |
prep |
in,DNA |
R3487 |
T4732 |
T4733 |
amod |
non-stimulated,monocytes |
R3488 |
T4733 |
T4731 |
pobj |
monocytes,in |
R3489 |
T4734 |
T4735 |
punct |
(,Figure |
R3490 |
T4735 |
T4733 |
parataxis |
Figure,monocytes |
R3491 |
T4736 |
T4735 |
nummod |
1A,Figure |
R3492 |
T4737 |
T4735 |
punct |
),Figure |
R3493 |
T4738 |
T4718 |
punct |
.,Similar |
R3494 |
T4739 |
T4745 |
advmod |
Interestingly,alter |
R3495 |
T4740 |
T4745 |
punct |
",",alter |
R3496 |
T4741 |
T4745 |
advcl |
adding,alter |
R3497 |
T4742 |
T4741 |
dobj |
M-CSF,adding |
R3498 |
T4743 |
T4745 |
aux |
did,alter |
R3499 |
T4744 |
T4745 |
neg |
not,alter |
R35 |
T67 |
T66 |
prep |
at,Phosphorylation |
R3500 |
T4745 |
T4745 |
ROOT |
alter,alter |
R3501 |
T4746 |
T4747 |
compound |
NF-κB,DNA |
R3502 |
T4747 |
T4745 |
dobj |
DNA,alter |
R3503 |
T4748 |
T4747 |
acl |
binding,DNA |
R3504 |
T4749 |
T4748 |
agent |
by,binding |
R3505 |
T4750 |
T4749 |
pobj |
EMSA,by |
R3506 |
T4751 |
T4745 |
punct |
.,alter |
R3507 |
T4752 |
T4776 |
prep |
In,resulted |
R3508 |
T4753 |
T4752 |
pobj |
contrast,In |
R3509 |
T4754 |
T4776 |
punct |
",",resulted |
R3510 |
T4755 |
T4776 |
prep |
after,resulted |
R3511 |
T4756 |
T4757 |
advmod |
transiently,transfecting |
R3512 |
T4757 |
T4755 |
pcomp |
transfecting,after |
R3513 |
T4758 |
T4759 |
amod |
human,MDMs |
R3514 |
T4759 |
T4757 |
dobj |
MDMs,transfecting |
R3515 |
T4760 |
T4757 |
prep |
with,transfecting |
R3516 |
T4761 |
T4762 |
compound |
pNF-κB-SEAP,constructs |
R3517 |
T4762 |
T4760 |
pobj |
constructs,with |
R3518 |
T4763 |
T4762 |
acl |
containing,constructs |
R3519 |
T4764 |
T4768 |
nummod |
four,sequences |
R3520 |
T4765 |
T4768 |
amod |
NF-κB,sequences |
R3521 |
T4766 |
T4768 |
amod |
consensus,sequences |
R3522 |
T4767 |
T4768 |
amod |
binding,sequences |
R3523 |
T4768 |
T4763 |
dobj |
sequences,containing |
R3524 |
T4769 |
T4768 |
punct |
",",sequences |
R3525 |
T4770 |
T4771 |
compound |
M-CSF,treatment |
R3526 |
T4771 |
T4776 |
nsubj |
treatment,resulted |
R3527 |
T4772 |
T4771 |
prep |
of,treatment |
R3528 |
T4773 |
T4775 |
det |
the,cells |
R3529 |
T4774 |
T4775 |
amod |
transfected,cells |
R3530 |
T4775 |
T4772 |
pobj |
cells,of |
R3531 |
T4776 |
T4776 |
ROOT |
resulted,resulted |
R3532 |
T4777 |
T4776 |
prep |
in,resulted |
R3533 |
T4778 |
T4780 |
det |
a,increase |
R3534 |
T4779 |
T4780 |
amod |
2.3-fold,increase |
R3535 |
T4780 |
T4777 |
pobj |
increase,in |
R3536 |
T4781 |
T4780 |
prep |
in,increase |
R3537 |
T4782 |
T4783 |
compound |
SEAP,release |
R3538 |
T4783 |
T4781 |
pobj |
release,in |
R3539 |
T4784 |
T4783 |
prep |
in,release |
R3540 |
T4785 |
T4787 |
det |
the,media |
R3541 |
T4786 |
T4787 |
compound |
culture,media |
R3542 |
T4787 |
T4784 |
pobj |
media,in |
R3543 |
T4788 |
T4776 |
prep |
compared,resulted |
R3544 |
T4789 |
T4788 |
prep |
to,compared |
R3545 |
T4790 |
T4789 |
pobj |
PBS,to |
R3546 |
T4791 |
T4792 |
punct |
(,vehicle |
R3547 |
T4792 |
T4790 |
appos |
vehicle,PBS |
R3548 |
T4793 |
T4790 |
punct |
),PBS |
R3549 |
T4794 |
T4795 |
punct |
-,treated |
R3550 |
T4795 |
T4797 |
amod |
treated,MDMs |
R3551 |
T4796 |
T4797 |
amod |
transfected,MDMs |
R3552 |
T4797 |
T4789 |
pobj |
MDMs,to |
R3553 |
T4798 |
T4800 |
punct |
(,1B |
R3554 |
T4799 |
T4800 |
compound |
Figure,1B |
R3555 |
T4800 |
T4797 |
appos |
1B,MDMs |
R3556 |
T4801 |
T4800 |
punct |
),1B |
R3557 |
T4802 |
T4776 |
punct |
.,resulted |
R3558 |
T4803 |
T4809 |
prep |
As,construct |
R3559 |
T4804 |
T4805 |
det |
a,control |
R3560 |
T4805 |
T4803 |
pobj |
control,As |
R3561 |
T4806 |
T4809 |
punct |
",",construct |
R3562 |
T4807 |
T4808 |
det |
the,pTAL-SEAP |
R3563 |
T4808 |
T4809 |
nsubj |
pTAL-SEAP,construct |
R3564 |
T4809 |
T4809 |
ROOT |
construct,construct |
R3565 |
T4810 |
T4809 |
xcomp |
lacking,construct |
R3566 |
T4811 |
T4813 |
amod |
NF-κB,sites |
R3567 |
T4812 |
T4813 |
amod |
binding,sites |
R3568 |
T4813 |
T4815 |
nsubjpass |
sites,used |
R3569 |
T4814 |
T4815 |
auxpass |
was,used |
R3570 |
T4815 |
T4810 |
ccomp |
used,lacking |
R3571 |
T4816 |
T4809 |
punct |
.,construct |
R3572 |
T4817 |
T4822 |
nsubj |
Cells,construct |
R3573 |
T4818 |
T4817 |
acl |
transfected,Cells |
R3574 |
T4819 |
T4818 |
prep |
with,transfected |
R3575 |
T4820 |
T4821 |
det |
the,pTAL-SEAP |
R3576 |
T4821 |
T4819 |
pobj |
pTAL-SEAP,with |
R3577 |
T4822 |
T4822 |
ROOT |
construct,construct |
R3578 |
T4823 |
T4825 |
aux |
did,produce |
R3579 |
T4824 |
T4825 |
neg |
not,produce |
R3580 |
T4825 |
T4822 |
conj |
produce,construct |
R3581 |
T4826 |
T4825 |
dobj |
SEAP,produce |
R3582 |
T4827 |
T4825 |
prep |
in,produce |
R3583 |
T4828 |
T4829 |
det |
the,absence |
R3584 |
T4829 |
T4827 |
pobj |
absence,in |
R3585 |
T4830 |
T4829 |
cc |
or,absence |
R3586 |
T4831 |
T4829 |
conj |
presence,absence |
R3587 |
T4832 |
T4829 |
prep |
of,absence |
R3588 |
T4833 |
T4832 |
pobj |
M-CSF,of |
R3589 |
T4834 |
T4836 |
punct |
(,1B |
R3590 |
T4835 |
T4836 |
compound |
Figure,1B |
R3591 |
T4836 |
T4833 |
appos |
1B,M-CSF |
R3592 |
T4837 |
T4833 |
punct |
),M-CSF |
R3593 |
T4838 |
T4822 |
punct |
.,construct |
R3594 |
T4839 |
T4841 |
nsubj |
We,investigated |
R3595 |
T4840 |
T4841 |
advmod |
next,investigated |
R3596 |
T4841 |
T4841 |
ROOT |
investigated,investigated |
R3597 |
T4842 |
T4844 |
mark |
whether,induced |
R3598 |
T4843 |
T4844 |
nsubj |
M-CSF,induced |
R3599 |
T4844 |
T4841 |
ccomp |
induced,investigated |
R36 |
T68 |
T67 |
pobj |
Ser276,at |
R3600 |
T4845 |
T4846 |
compound |
NF-κB,activity |
R3601 |
T4846 |
T4844 |
dobj |
activity,induced |
R3602 |
T4847 |
T4844 |
prep |
in,induced |
R3603 |
T4848 |
T4852 |
det |
the,line |
R3604 |
T4849 |
T4852 |
compound |
mouse,line |
R3605 |
T4850 |
T4852 |
compound |
macrophage,line |
R3606 |
T4851 |
T4852 |
compound |
cell,line |
R3607 |
T4852 |
T4847 |
pobj |
line,in |
R3608 |
T4853 |
T4852 |
punct |
",",line |
R3609 |
T4854 |
T4852 |
appos |
RAW,line |
R3610 |
T4855 |
T4854 |
nummod |
264.7,RAW |
R3611 |
T4856 |
T4841 |
punct |
.,investigated |
R3612 |
T4857 |
T4861 |
nsubjpass |
RAW,transfected |
R3613 |
T4858 |
T4859 |
nummod |
264.7,cells |
R3614 |
T4859 |
T4861 |
nsubjpass |
cells,transfected |
R3615 |
T4860 |
T4861 |
auxpass |
were,transfected |
R3616 |
T4861 |
T4861 |
ROOT |
transfected,transfected |
R3617 |
T4862 |
T4861 |
prep |
with,transfected |
R3618 |
T4863 |
T4866 |
preconj |
either,reporter |
R3619 |
T4864 |
T4866 |
det |
the,reporter |
R3620 |
T4865 |
T4866 |
compound |
NF-κB-SEAP,reporter |
R3621 |
T4866 |
T4870 |
nsubj |
reporter,construct |
R3622 |
T4867 |
T4866 |
cc |
or,reporter |
R3623 |
T4868 |
T4866 |
conj |
control,reporter |
R3624 |
T4869 |
T4870 |
amod |
pTAL-SEAP,construct |
R3625 |
T4870 |
T4870 |
ROOT |
construct,construct |
R3626 |
T4871 |
T4870 |
punct |
.,construct |
R3627 |
T4872 |
T4873 |
mark |
As,shown |
R3628 |
T4873 |
T4884 |
advcl |
shown,increased |
R3629 |
T4874 |
T4873 |
prep |
in,shown |
R3630 |
T4875 |
T4874 |
pobj |
Figure,in |
R3631 |
T4876 |
T4875 |
nummod |
1C,Figure |
R3632 |
T4877 |
T4875 |
punct |
",",Figure |
R3633 |
T4878 |
T4879 |
compound |
M-CSF,treatment |
R3634 |
T4879 |
T4875 |
appos |
treatment,Figure |
R3635 |
T4880 |
T4879 |
prep |
of,treatment |
R3636 |
T4881 |
T4880 |
pobj |
RAW,of |
R3637 |
T4882 |
T4883 |
nummod |
264.7,cells |
R3638 |
T4883 |
T4884 |
nsubj |
cells,increased |
R3639 |
T4884 |
T4884 |
ROOT |
increased,increased |
R3640 |
T4885 |
T4887 |
amod |
NF-κB,activity |
R3641 |
T4886 |
T4887 |
compound |
reporter,activity |
R3642 |
T4887 |
T4884 |
dobj |
activity,increased |
R3643 |
T4888 |
T4884 |
prep |
by,increased |
R3644 |
T4889 |
T4888 |
pobj |
2.5-fold,by |
R3645 |
T4890 |
T4884 |
prep |
over,increased |
R3646 |
T4891 |
T4890 |
pobj |
that,over |
R3647 |
T4892 |
T4891 |
prep |
of,that |
R3648 |
T4893 |
T4894 |
amod |
non-treated,cells |
R3649 |
T4894 |
T4892 |
pobj |
cells,of |
R3650 |
T4895 |
T4884 |
punct |
.,increased |
R3651 |
T4896 |
T4900 |
advmod |
Together,demonstrate |
R3652 |
T4897 |
T4900 |
punct |
",",demonstrate |
R3653 |
T4898 |
T4899 |
poss |
our,data |
R3654 |
T4899 |
T4900 |
nsubj |
data,demonstrate |
R3655 |
T4900 |
T4900 |
ROOT |
demonstrate,demonstrate |
R3656 |
T4901 |
T4903 |
mark |
that,induced |
R3657 |
T4902 |
T4903 |
nsubj |
M-CSF,induced |
R3658 |
T4903 |
T4900 |
ccomp |
induced,demonstrate |
R3659 |
T4904 |
T4906 |
compound |
NF-κB,activity |
R3660 |
T4905 |
T4906 |
compound |
transcriptional,activity |
R3661 |
T4906 |
T4903 |
dobj |
activity,induced |
R3662 |
T4907 |
T4906 |
prep |
in,activity |
R3663 |
T4908 |
T4907 |
pobj |
macrophages,in |
R3664 |
T4909 |
T4900 |
punct |
.,demonstrate |
R37 |
T69 |
T59 |
prep |
via,Induces |
R38 |
T70 |
T71 |
compound |
Protein,Kinase |
R39 |
T71 |
T73 |
compound |
Kinase,Macrophage |
R3934 |
T5344 |
T5345 |
compound |
PKC,Inhibition |
R3935 |
T5345 |
T5346 |
nsubj |
Inhibition,Reduces |
R3936 |
T5346 |
T5346 |
ROOT |
Reduces,Reduces |
R3937 |
T5347 |
T5348 |
compound |
NF-κB,Activity |
R3938 |
T5348 |
T5346 |
dobj |
Activity,Reduces |
R3939 |
T5349 |
T5348 |
prep |
in,Activity |
R3940 |
T5350 |
T5351 |
compound |
Human,MDMs |
R3941 |
T5351 |
T5349 |
pobj |
MDMs,in |
R3942 |
T5352 |
T5351 |
cc |
and,MDMs |
R3943 |
T5353 |
T5351 |
conj |
RAW,MDMs |
R3944 |
T5354 |
T5355 |
nummod |
264.7,Cells |
R3945 |
T5355 |
T5348 |
conj |
Cells,Activity |
R3946 |
T5356 |
T5359 |
mark |
Since,activated |
R3947 |
T5357 |
T5359 |
nsubjpass |
NF-κB,activated |
R3948 |
T5358 |
T5359 |
auxpass |
is,activated |
R3949 |
T5359 |
T5372 |
advcl |
activated,determined |
R3950 |
T5360 |
T5359 |
agent |
by,activated |
R3951 |
T5361 |
T5360 |
pobj |
PKC,by |
R3952 |
T5362 |
T5359 |
prep |
in,activated |
R3953 |
T5363 |
T5365 |
amod |
several,types |
R3954 |
T5364 |
T5365 |
compound |
cell,types |
R3955 |
T5365 |
T5362 |
pobj |
types,in |
R3956 |
T5366 |
T5368 |
nmod |
[,] |
R3957 |
T5367 |
T5368 |
nummod |
36,] |
R3958 |
T5368 |
T5365 |
appos |
],types |
R3959 |
T5369 |
T5372 |
punct |
",",determined |
R3960 |
T5370 |
T5372 |
nsubj |
we,determined |
R3961 |
T5371 |
T5372 |
advmod |
next,determined |
R3962 |
T5372 |
T5346 |
ccomp |
determined,Reduces |
R3963 |
T5373 |
T5378 |
mark |
if,was |
R3964 |
T5374 |
T5377 |
amod |
M-CSF-induced,activity |
R3965 |
T5375 |
T5377 |
amod |
NF-κB,activity |
R3966 |
T5376 |
T5377 |
compound |
transcriptional,activity |
R3967 |
T5377 |
T5378 |
nsubj |
activity,was |
R3968 |
T5378 |
T5372 |
advcl |
was,determined |
R3969 |
T5379 |
T5378 |
acomp |
dependent,was |
R3970 |
T5380 |
T5379 |
prep |
on,dependent |
R3971 |
T5381 |
T5382 |
compound |
PKC,activation |
R3972 |
T5382 |
T5380 |
pobj |
activation,on |
R3973 |
T5383 |
T5378 |
cc |
and,was |
R3974 |
T5384 |
T5395 |
mark |
if,was |
R3975 |
T5385 |
T5395 |
nsubj |
calcium,was |
R3976 |
T5386 |
T5385 |
punct |
",",calcium |
R3977 |
T5387 |
T5388 |
det |
a,co-factor |
R3978 |
T5388 |
T5385 |
conj |
co-factor,calcium |
R3979 |
T5389 |
T5388 |
prep |
for,co-factor |
R3980 |
T5390 |
T5393 |
amod |
conventional,activation |
R3981 |
T5391 |
T5393 |
compound |
PKC,activation |
R3982 |
T5392 |
T5393 |
compound |
isoform,activation |
R3983 |
T5393 |
T5389 |
pobj |
activation,for |
R3984 |
T5394 |
T5395 |
punct |
",",was |
R3985 |
T5395 |
T5378 |
conj |
was,was |
R3986 |
T5396 |
T5395 |
acomp |
important,was |
R3987 |
T5397 |
T5346 |
punct |
.,Reduces |
R3988 |
T5398 |
T5420 |
prep |
In,used |
R3989 |
T5399 |
T5398 |
pobj |
addition,In |
R3990 |
T5400 |
T5420 |
punct |
",",used |
R3991 |
T5401 |
T5420 |
prep |
because,used |
R3992 |
T5402 |
T5401 |
pcomp |
of,because |
R3993 |
T5403 |
T5404 |
det |
the,number |
R3994 |
T5404 |
T5401 |
pobj |
number,because |
R3995 |
T5405 |
T5404 |
prep |
of,number |
R3996 |
T5406 |
T5407 |
amod |
conventional,PKCs |
R3997 |
T5407 |
T5405 |
pobj |
PKCs,of |
R3998 |
T5408 |
T5404 |
acl |
existing,number |
R3999 |
T5409 |
T5408 |
prep |
within,existing |
R40 |
T72 |
T73 |
compound |
C,Macrophage |
R4000 |
T5410 |
T5411 |
amod |
mononuclear,cells |
R4001 |
T5411 |
T5409 |
pobj |
cells,within |
R4002 |
T5412 |
T5420 |
punct |
",",used |
R4003 |
T5413 |
T5414 |
amod |
pharmacological,inhibitors |
R4004 |
T5414 |
T5420 |
nsubjpass |
inhibitors,used |
R4005 |
T5415 |
T5414 |
prep |
of,inhibitors |
R4006 |
T5416 |
T5418 |
compound |
PKC,activation |
R4007 |
T5417 |
T5418 |
compound |
family,activation |
R4008 |
T5418 |
T5415 |
pobj |
activation,of |
R4009 |
T5419 |
T5420 |
auxpass |
was,used |
R4010 |
T5420 |
T5420 |
ROOT |
used,used |
R4011 |
T5421 |
T5422 |
aux |
to,determine |
R4012 |
T5422 |
T5420 |
xcomp |
determine,used |
R4013 |
T5423 |
T5424 |
det |
the,relationship |
R4014 |
T5424 |
T5422 |
dobj |
relationship,determine |
R4015 |
T5425 |
T5424 |
prep |
of,relationship |
R4016 |
T5426 |
T5427 |
compound |
PKC,activation |
R4017 |
T5427 |
T5425 |
pobj |
activation,of |
R4018 |
T5428 |
T5429 |
aux |
to,M-CSF-induced |
R4019 |
T5429 |
T5424 |
relcl |
M-CSF-induced,relationship |
R4020 |
T5430 |
T5431 |
amod |
cellular,survival |
R4021 |
T5431 |
T5429 |
dobj |
survival,M-CSF-induced |
R4022 |
T5432 |
T5420 |
punct |
.,used |
R4023 |
T5433 |
T5435 |
nsubjpass |
MDMs,transfected |
R4024 |
T5434 |
T5435 |
auxpass |
were,transfected |
R4025 |
T5435 |
T5435 |
ROOT |
transfected,transfected |
R4026 |
T5436 |
T5435 |
prep |
with,transfected |
R4027 |
T5437 |
T5439 |
det |
the,reporter |
R4028 |
T5438 |
T5439 |
compound |
pNF-κB-SEAP,reporter |
R4029 |
T5439 |
T5436 |
pobj |
reporter,with |
R4030 |
T5440 |
T5435 |
cc |
and,transfected |
R4031 |
T5441 |
T5442 |
advmod |
then,treated |
R4032 |
T5442 |
T5435 |
conj |
treated,transfected |
R4033 |
T5443 |
T5442 |
prep |
with,treated |
R4034 |
T5444 |
T5447 |
det |
the,inhibitor |
R4035 |
T5445 |
T5447 |
amod |
general,inhibitor |
R4036 |
T5446 |
T5447 |
compound |
PKC,inhibitor |
R4037 |
T5447 |
T5443 |
pobj |
inhibitor,with |
R4038 |
T5448 |
T5449 |
punct |
",",Ro-31-8220 |
R4039 |
T5449 |
T5442 |
dep |
Ro-31-8220,treated |
R4040 |
T5450 |
T5449 |
punct |
;,Ro-31-8220 |
R4041 |
T5451 |
T5457 |
det |
the,Gö-6976 |
R4042 |
T5452 |
T5457 |
amod |
conventional,Gö-6976 |
R4043 |
T5453 |
T5457 |
compound |
PKCα,Gö-6976 |
R4044 |
T5454 |
T5457 |
compound |
/,Gö-6976 |
R4045 |
T5455 |
T5457 |
compound |
β,Gö-6976 |
R4046 |
T5456 |
T5457 |
compound |
inhibitor,Gö-6976 |
R4047 |
T5457 |
T5449 |
conj |
Gö-6976,Ro-31-8220 |
R4048 |
T5458 |
T5457 |
punct |
;,Gö-6976 |
R4049 |
T5459 |
T5457 |
cc |
or,Gö-6976 |
R4050 |
T5460 |
T5463 |
det |
the,blocker |
R4051 |
T5461 |
T5463 |
amod |
intracellular,blocker |
R4052 |
T5462 |
T5463 |
compound |
calcium,blocker |
R4053 |
T5463 |
T5457 |
conj |
blocker,Gö-6976 |
R4054 |
T5464 |
T5463 |
appos |
BAPTA/AM,blocker |
R4055 |
T5465 |
T5435 |
punct |
.,transfected |
R4056 |
T5466 |
T5471 |
amod |
Ro-31-8220,activity |
R4057 |
T5467 |
T5468 |
advmod |
significantly,suppressed |
R4058 |
T5468 |
T5471 |
amod |
suppressed,activity |
R4059 |
T5469 |
T5471 |
amod |
M-CSF-induced,activity |
R4060 |
T5470 |
T5471 |
compound |
NF-κB,activity |
R4061 |
T5471 |
T5472 |
nsubj |
activity,compared |
R4062 |
T5472 |
T5472 |
ROOT |
compared,compared |
R4063 |
T5473 |
T5472 |
prep |
to,compared |
R4064 |
T5474 |
T5473 |
pobj |
cells,to |
R4065 |
T5475 |
T5474 |
acl |
treated,cells |
R4066 |
T5476 |
T5475 |
prep |
with,treated |
R4067 |
T5477 |
T5476 |
pobj |
M-CSF,with |
R4068 |
T5478 |
T5477 |
advmod |
alone,M-CSF |
R4069 |
T5479 |
T5481 |
punct |
(,2A |
R4070 |
T5480 |
T5481 |
compound |
Figure,2A |
R4071 |
T5481 |
T5477 |
appos |
2A,M-CSF |
R4072 |
T5482 |
T5481 |
punct |
),2A |
R4073 |
T5483 |
T5472 |
punct |
.,compared |
R4074 |
T5484 |
T5491 |
prep |
In,blocked |
R4075 |
T5485 |
T5484 |
pobj |
addition,In |
R4076 |
T5486 |
T5491 |
punct |
",",blocked |
R4077 |
T5487 |
T5491 |
nsubj |
Gö-6976,blocked |
R4078 |
T5488 |
T5487 |
cc |
and,Gö-6976 |
R4079 |
T5489 |
T5487 |
conj |
BAPTA/AM,Gö-6976 |
R4080 |
T5490 |
T5491 |
advmod |
also,blocked |
R4081 |
T5491 |
T5491 |
ROOT |
blocked,blocked |
R4082 |
T5492 |
T5493 |
amod |
NF-κB,activity |
R4083 |
T5493 |
T5491 |
dobj |
activity,blocked |
R4084 |
T5494 |
T5491 |
prep |
in,blocked |
R4085 |
T5495 |
T5496 |
amod |
M-CSF-treated,MDMs |
R4086 |
T5496 |
T5494 |
pobj |
MDMs,in |
R4087 |
T5497 |
T5491 |
punct |
.,blocked |
R4088 |
T5498 |
T5501 |
compound |
Trypan,analysis |
R4089 |
T5499 |
T5500 |
amod |
blue,exclusion |
R4090 |
T5500 |
T5501 |
compound |
exclusion,analysis |
R4091 |
T5501 |
T5504 |
nsubj |
analysis,indicate |
R4092 |
T5502 |
T5504 |
aux |
did,indicate |
R4093 |
T5503 |
T5504 |
neg |
not,indicate |
R4094 |
T5504 |
T5504 |
ROOT |
indicate,indicate |
R4095 |
T5505 |
T5506 |
compound |
cell,death |
R4096 |
T5506 |
T5504 |
dobj |
death,indicate |
R4097 |
T5507 |
T5504 |
advcl |
suggesting,indicate |
R4098 |
T5508 |
T5511 |
mark |
that,was |
R4099 |
T5509 |
T5510 |
det |
this,suppression |
R41 |
T73 |
T75 |
nmod |
Macrophage,factor |
R4100 |
T5510 |
T5511 |
nsubj |
suppression,was |
R4101 |
T5511 |
T5507 |
ccomp |
was,suggesting |
R4102 |
T5512 |
T5511 |
neg |
not,was |
R4103 |
T5513 |
T5511 |
acomp |
due,was |
R4104 |
T5514 |
T5513 |
xcomp |
to,due |
R4105 |
T5515 |
T5516 |
amod |
non-specific,toxicity |
R4106 |
T5516 |
T5514 |
pobj |
toxicity,to |
R4107 |
T5517 |
T5504 |
punct |
.,indicate |
R4108 |
T5518 |
T5519 |
det |
These,data |
R4109 |
T5519 |
T5520 |
nsubj |
data,indicate |
R4110 |
T5520 |
T5520 |
ROOT |
indicate,indicate |
R4111 |
T5521 |
T5523 |
mark |
that,mediated |
R4112 |
T5522 |
T5523 |
nsubj |
M-CSF,mediated |
R4113 |
T5523 |
T5520 |
ccomp |
mediated,indicate |
R4114 |
T5524 |
T5525 |
compound |
NF-κB,activation |
R4115 |
T5525 |
T5523 |
dobj |
activation,mediated |
R4116 |
T5526 |
T5523 |
prep |
through,mediated |
R4117 |
T5527 |
T5530 |
amod |
calcium-dependent,activation |
R4118 |
T5528 |
T5530 |
amod |
conventional,activation |
R4119 |
T5529 |
T5530 |
compound |
PKC,activation |
R4120 |
T5530 |
T5526 |
pobj |
activation,through |
R4121 |
T5531 |
T5520 |
punct |
.,indicate |
R4122 |
T5532 |
T5534 |
nsubj |
We,investigated |
R4123 |
T5533 |
T5534 |
advmod |
next,investigated |
R4124 |
T5534 |
T5534 |
ROOT |
investigated,investigated |
R4125 |
T5535 |
T5538 |
mark |
whether,affected |
R4126 |
T5536 |
T5537 |
compound |
PKC,inhibition |
R4127 |
T5537 |
T5538 |
nsubj |
inhibition,affected |
R4128 |
T5538 |
T5534 |
ccomp |
affected,investigated |
R4129 |
T5539 |
T5540 |
amod |
NF-κB,activity |
R4130 |
T5540 |
T5538 |
dobj |
activity,affected |
R4131 |
T5541 |
T5538 |
prep |
in,affected |
R4132 |
T5542 |
T5546 |
det |
the,line |
R4133 |
T5543 |
T5546 |
compound |
mouse,line |
R4134 |
T5544 |
T5546 |
compound |
macrophage,line |
R4135 |
T5545 |
T5546 |
compound |
cell,line |
R4136 |
T5546 |
T5541 |
pobj |
line,in |
R4137 |
T5547 |
T5546 |
punct |
",",line |
R4138 |
T5548 |
T5546 |
appos |
RAW,line |
R4139 |
T5549 |
T5548 |
nummod |
264.7,RAW |
R4140 |
T5550 |
T5534 |
punct |
.,investigated |
R4141 |
T5551 |
T5556 |
amod |
Similar,inhibitors |
R4142 |
T5552 |
T5551 |
prep |
to,Similar |
R4143 |
T5553 |
T5552 |
pobj |
MDMs,to |
R4144 |
T5554 |
T5553 |
punct |
",",MDMs |
R4145 |
T5555 |
T5556 |
nsubj |
PKC,inhibitors |
R4146 |
T5556 |
T5556 |
ROOT |
inhibitors,inhibitors |
R4147 |
T5557 |
T5556 |
dobj |
Ro-31-8220,inhibitors |
R4148 |
T5558 |
T5557 |
punct |
",",Ro-31-8220 |
R4149 |
T5559 |
T5557 |
conj |
Gö-6976,Ro-31-8220 |
R4150 |
T5560 |
T5559 |
cc |
and,Gö-6976 |
R4151 |
T5561 |
T5559 |
conj |
BAPTA/AM,Gö-6976 |
R4152 |
T5562 |
T5556 |
conj |
reduced,inhibitors |
R4153 |
T5563 |
T5565 |
amod |
M-CSF-induced,activity |
R4154 |
T5564 |
T5565 |
compound |
NF-κB,activity |
R4155 |
T5565 |
T5562 |
dobj |
activity,reduced |
R4156 |
T5566 |
T5562 |
prep |
in,reduced |
R4157 |
T5567 |
T5569 |
det |
a,manner |
R4158 |
T5568 |
T5569 |
amod |
dose-dependent,manner |
R4159 |
T5569 |
T5566 |
pobj |
manner,in |
R4160 |
T5570 |
T5569 |
prep |
in,manner |
R4161 |
T5571 |
T5570 |
pobj |
RAW,in |
R4162 |
T5572 |
T5573 |
nummod |
264.7,macrophages |
R4163 |
T5573 |
T5569 |
appos |
macrophages,manner |
R4164 |
T5574 |
T5576 |
punct |
(,2B |
R4165 |
T5575 |
T5576 |
compound |
Figure,2B |
R4166 |
T5576 |
T5573 |
appos |
2B,macrophages |
R4167 |
T5577 |
T5573 |
punct |
),macrophages |
R4168 |
T5578 |
T5556 |
punct |
.,inhibitors |
R4169 |
T5579 |
T5580 |
aux |
To,ensure |
R4170 |
T5580 |
T5580 |
ROOT |
ensure,ensure |
R4171 |
T5581 |
T5584 |
mark |
that,regulated |
R4172 |
T5582 |
T5584 |
nsubj |
PKC,regulated |
R4173 |
T5583 |
T5584 |
advmod |
specifically,regulated |
R4174 |
T5584 |
T5580 |
ccomp |
regulated,ensure |
R4175 |
T5585 |
T5586 |
compound |
NF-κB,p65 |
R4176 |
T5586 |
T5584 |
dobj |
p65,regulated |
R4177 |
T5587 |
T5586 |
cc |
and,p65 |
R4178 |
T5588 |
T5593 |
neg |
not,member |
R4179 |
T5589 |
T5593 |
det |
the,member |
R4180 |
T5590 |
T5591 |
advmod |
closely,related |
R4181 |
T5591 |
T5593 |
amod |
related,member |
R4182 |
T5592 |
T5593 |
compound |
family,member |
R4183 |
T5593 |
T5602 |
nsubj |
member,constructs |
R4184 |
T5594 |
T5593 |
punct |
",",member |
R4185 |
T5595 |
T5593 |
appos |
c-Rel,member |
R4186 |
T5596 |
T5598 |
punct |
",",co-transfected |
R4187 |
T5597 |
T5598 |
nsubj |
we,co-transfected |
R4188 |
T5598 |
T5593 |
parataxis |
co-transfected,member |
R4189 |
T5599 |
T5598 |
dobj |
c-Rel,co-transfected |
R4190 |
T5600 |
T5599 |
cc |
and,c-Rel |
R4191 |
T5601 |
T5599 |
conj |
NF-κB-SEAP,c-Rel |
R4192 |
T5602 |
T5586 |
conj |
constructs,p65 |
R4193 |
T5603 |
T5602 |
prep |
into,constructs |
R4194 |
T5604 |
T5608 |
det |
the,line |
R4195 |
T5605 |
T5608 |
nmod |
Raw,line |
R4196 |
T5606 |
T5605 |
nummod |
264.7,Raw |
R4197 |
T5607 |
T5608 |
compound |
cell,line |
R4198 |
T5608 |
T5603 |
pobj |
line,into |
R4199 |
T5609 |
T5602 |
cc |
and,constructs |
R42 |
T74 |
T75 |
amod |
colony-stimulating,factor |
R4200 |
T5610 |
T5612 |
amod |
measured,activity |
R4201 |
T5611 |
T5612 |
amod |
NF-κB,activity |
R4202 |
T5612 |
T5602 |
conj |
activity,constructs |
R4203 |
T5613 |
T5612 |
prep |
in,activity |
R4204 |
T5614 |
T5613 |
pobj |
response,in |
R4205 |
T5615 |
T5614 |
prep |
to,response |
R4206 |
T5616 |
T5615 |
pobj |
M-CSF,to |
R4207 |
T5617 |
T5580 |
punct |
.,ensure |
R4208 |
T5618 |
T5619 |
expl |
There,was |
R4209 |
T5619 |
T5619 |
ROOT |
was,was |
R4210 |
T5620 |
T5623 |
det |
no,activity |
R4211 |
T5621 |
T5623 |
amod |
increased,activity |
R4212 |
T5622 |
T5623 |
compound |
NF-κB,activity |
R4213 |
T5623 |
T5619 |
attr |
activity,was |
R4214 |
T5624 |
T5619 |
prep |
in,was |
R4215 |
T5625 |
T5624 |
pobj |
cells,in |
R4216 |
T5626 |
T5625 |
acl |
expressing,cells |
R4217 |
T5627 |
T5626 |
dobj |
c-Rel,expressing |
R4218 |
T5628 |
T5630 |
punct |
(,S1 |
R4219 |
T5629 |
T5630 |
compound |
Figure,S1 |
R4220 |
T5630 |
T5627 |
appos |
S1,c-Rel |
R4221 |
T5631 |
T5630 |
punct |
),S1 |
R4222 |
T5632 |
T5619 |
punct |
.,was |
R4223 |
T5633 |
T5634 |
det |
These,observations |
R4224 |
T5634 |
T5635 |
nsubj |
observations,indicate |
R4225 |
T5635 |
T5635 |
ROOT |
indicate,indicate |
R4226 |
T5636 |
T5638 |
mark |
that,functioned |
R4227 |
T5637 |
T5638 |
nsubj |
PKC,functioned |
R4228 |
T5638 |
T5635 |
ccomp |
functioned,indicate |
R4229 |
T5639 |
T5638 |
advmod |
upstream,functioned |
R4230 |
T5640 |
T5639 |
prep |
of,upstream |
R4231 |
T5641 |
T5640 |
pobj |
NF-κB,of |
R4232 |
T5642 |
T5641 |
nummod |
p65,NF-κB |
R4233 |
T5643 |
T5638 |
prep |
in,functioned |
R4234 |
T5644 |
T5643 |
pobj |
MDMs,in |
R4235 |
T5645 |
T5644 |
cc |
and,MDMs |
R4236 |
T5646 |
T5644 |
conj |
RAW,MDMs |
R4237 |
T5647 |
T5648 |
nummod |
264.7,cells |
R4238 |
T5648 |
T5644 |
conj |
cells,MDMs |
R4239 |
T5649 |
T5635 |
punct |
.,indicate |
R43 |
T75 |
T69 |
pobj |
factor,via |
R44 |
T76 |
T75 |
punct |
(,factor |
R45 |
T77 |
T75 |
appos |
M-CSF,factor |
R46 |
T78 |
T75 |
punct |
),factor |
R4607 |
T6258 |
T6291 |
nsubj |
NF-κB,hypothesized |
R4608 |
T6259 |
T6258 |
cc |
and,NF-κB |
R4609 |
T6260 |
T6258 |
conj |
PKC,NF-κB |
R4610 |
T6261 |
T6262 |
punct |
(,s |
R4611 |
T6262 |
T6260 |
appos |
s,PKC |
R4612 |
T6263 |
T6262 |
punct |
),s |
R4613 |
T6264 |
T6291 |
advcl |
Mediate,hypothesized |
R4614 |
T6265 |
T6266 |
compound |
Human,MDM |
R4615 |
T6266 |
T6267 |
compound |
MDM,Survival |
R4616 |
T6267 |
T6264 |
dobj |
Survival,Mediate |
R4617 |
T6268 |
T6267 |
prep |
in,Survival |
R4618 |
T6269 |
T6268 |
pobj |
Response,in |
R4619 |
T6270 |
T6273 |
acl |
to,Since |
R4620 |
T6271 |
T6272 |
compound |
M-CSF,Stimulation |
R4621 |
T6272 |
T6270 |
pobj |
Stimulation,to |
R4622 |
T6273 |
T6277 |
mark |
Since,are |
R4623 |
T6274 |
T6277 |
nsubj |
PKC,are |
R4624 |
T6275 |
T6274 |
cc |
and,PKC |
R4625 |
T6276 |
T6274 |
conj |
NF-κB,PKC |
R4626 |
T6277 |
T6291 |
advcl |
are,hypothesized |
R4627 |
T6278 |
T6277 |
acomp |
critical,are |
R4628 |
T6279 |
T6278 |
prep |
in,critical |
R4629 |
T6280 |
T6281 |
compound |
cell,survival |
R4630 |
T6281 |
T6279 |
pobj |
survival,in |
R4631 |
T6282 |
T6284 |
nmod |
[,] |
R4632 |
T6283 |
T6284 |
nummod |
37,] |
R4633 |
T6284 |
T6277 |
npadvmod |
],are |
R4634 |
T6285 |
T6284 |
punct |
",",] |
R4635 |
T6286 |
T6288 |
nmod |
[,] |
R4636 |
T6287 |
T6288 |
nummod |
38,] |
R4637 |
T6288 |
T6284 |
conj |
],] |
R4638 |
T6289 |
T6291 |
punct |
",",hypothesized |
R4639 |
T6290 |
T6291 |
nsubj |
we,hypothesized |
R4640 |
T6291 |
T6291 |
ROOT |
hypothesized,hypothesized |
R4641 |
T6292 |
T6294 |
mark |
that,promoted |
R4642 |
T6293 |
T6294 |
nsubj |
M-CSF,promoted |
R4643 |
T6294 |
T6291 |
ccomp |
promoted,hypothesized |
R4644 |
T6295 |
T6296 |
compound |
cell,survival |
R4645 |
T6296 |
T6294 |
dobj |
survival,promoted |
R4646 |
T6297 |
T6294 |
prep |
through,promoted |
R4647 |
T6298 |
T6297 |
pobj |
PKC,through |
R4648 |
T6299 |
T6294 |
prep |
in,promoted |
R4649 |
T6300 |
T6301 |
amod |
human,MDMs |
R4650 |
T6301 |
T6299 |
pobj |
MDMs,in |
R4651 |
T6302 |
T6291 |
punct |
.,hypothesized |
R4652 |
T6303 |
T6304 |
aux |
To,detect |
R4653 |
T6304 |
T6319 |
advcl |
detect,analyzed |
R4654 |
T6305 |
T6304 |
dobj |
apoptosis,detect |
R4655 |
T6306 |
T6305 |
punct |
",",apoptosis |
R4656 |
T6307 |
T6308 |
det |
the,expression |
R4657 |
T6308 |
T6305 |
appos |
expression,apoptosis |
R4658 |
T6309 |
T6308 |
prep |
of,expression |
R4659 |
T6310 |
T6311 |
amod |
cleaved,caspase-3 |
R4660 |
T6311 |
T6309 |
pobj |
caspase-3,of |
R4661 |
T6312 |
T6311 |
punct |
",",caspase-3 |
R4662 |
T6313 |
T6314 |
det |
a,marker |
R4663 |
T6314 |
T6311 |
appos |
marker,caspase-3 |
R4664 |
T6315 |
T6314 |
prep |
of,marker |
R4665 |
T6316 |
T6315 |
pobj |
apoptosis,of |
R4666 |
T6317 |
T6319 |
punct |
",",analyzed |
R4667 |
T6318 |
T6319 |
auxpass |
was,analyzed |
R4668 |
T6319 |
T6319 |
ROOT |
analyzed,analyzed |
R4669 |
T6320 |
T6319 |
prep |
in,analyzed |
R4670 |
T6321 |
T6322 |
det |
the,presence |
R4671 |
T6322 |
T6320 |
pobj |
presence,in |
R4672 |
T6323 |
T6322 |
cc |
or,presence |
R4673 |
T6324 |
T6322 |
conj |
absence,presence |
R4674 |
T6325 |
T6324 |
prep |
of,absence |
R4675 |
T6326 |
T6329 |
nmod |
M-CSF,inhibitors |
R4676 |
T6327 |
T6326 |
cc |
and,M-CSF |
R4677 |
T6328 |
T6326 |
conj |
PKC,M-CSF |
R4678 |
T6329 |
T6325 |
pobj |
inhibitors,of |
R4679 |
T6330 |
T6319 |
punct |
.,analyzed |
R4680 |
T6331 |
T6353 |
prep |
In,elevated |
R4681 |
T6332 |
T6331 |
pobj |
MDMs,In |
R4682 |
T6333 |
T6332 |
acl |
pretreated,MDMs |
R4683 |
T6334 |
T6333 |
prep |
with,pretreated |
R4684 |
T6335 |
T6336 |
compound |
PKC,inhibitors |
R4685 |
T6336 |
T6334 |
pobj |
inhibitors,with |
R4686 |
T6337 |
T6336 |
punct |
(,inhibitors |
R4687 |
T6338 |
T6336 |
appos |
Ro-31-8220,inhibitors |
R4688 |
T6339 |
T6338 |
punct |
",",Ro-31-8220 |
R4689 |
T6340 |
T6338 |
conj |
Gö-6976,Ro-31-8220 |
R4690 |
T6341 |
T6340 |
punct |
",",Gö-6976 |
R4691 |
T6342 |
T6340 |
cc |
or,Gö-6976 |
R4692 |
T6343 |
T6340 |
conj |
BAPTA/AM,Gö-6976 |
R4693 |
T6344 |
T6343 |
punct |
),BAPTA/AM |
R4694 |
T6345 |
T6333 |
cc |
and,pretreated |
R4695 |
T6346 |
T6333 |
conj |
stimulated,pretreated |
R4696 |
T6347 |
T6346 |
prep |
with,stimulated |
R4697 |
T6348 |
T6347 |
pobj |
M-CSF,with |
R4698 |
T6349 |
T6350 |
punct |
",",cleaved |
R4699 |
T6350 |
T6351 |
compound |
cleaved,caspase-3 |
R47 |
T79 |
T79 |
ROOT |
promotes,promotes |
R4700 |
T6351 |
T6353 |
nsubjpass |
caspase-3,elevated |
R4701 |
T6352 |
T6353 |
auxpass |
was,elevated |
R4702 |
T6353 |
T6353 |
ROOT |
elevated,elevated |
R4703 |
T6354 |
T6353 |
prep |
to,elevated |
R4704 |
T6355 |
T6354 |
pobj |
levels,to |
R4705 |
T6356 |
T6355 |
prep |
of,levels |
R4706 |
T6357 |
T6356 |
pobj |
cells,of |
R4707 |
T6358 |
T6357 |
acl |
treated,cells |
R4708 |
T6359 |
T6358 |
prep |
with,treated |
R4709 |
T6360 |
T6359 |
pobj |
vehicle,with |
R4710 |
T6361 |
T6360 |
advmod |
alone,vehicle |
R4711 |
T6362 |
T6364 |
punct |
(,3A |
R4712 |
T6363 |
T6364 |
compound |
Figure,3A |
R4713 |
T6364 |
T6360 |
appos |
3A,vehicle |
R4714 |
T6365 |
T6353 |
punct |
),elevated |
R4715 |
T6366 |
T6353 |
punct |
.,elevated |
R4716 |
T6367 |
T6376 |
prep |
In,had |
R4717 |
T6368 |
T6367 |
pobj |
contrast,In |
R4718 |
T6369 |
T6376 |
punct |
",",had |
R4719 |
T6370 |
T6376 |
nsubj |
cells,had |
R4720 |
T6371 |
T6370 |
acl |
incubated,cells |
R4721 |
T6372 |
T6371 |
prep |
with,incubated |
R4722 |
T6373 |
T6372 |
pobj |
M-CSF,with |
R4723 |
T6374 |
T6373 |
cc |
and,M-CSF |
R4724 |
T6375 |
T6373 |
conj |
vehicle,M-CSF |
R4725 |
T6376 |
T6376 |
ROOT |
had,had |
R4726 |
T6377 |
T6378 |
advmod |
less,cleaved |
R4727 |
T6378 |
T6379 |
amod |
cleaved,caspase-3 |
R4728 |
T6379 |
T6376 |
dobj |
caspase-3,had |
R4729 |
T6380 |
T6379 |
prep |
than,caspase-3 |
R4730 |
T6381 |
T6380 |
pobj |
cells,than |
R4731 |
T6382 |
T6381 |
acl |
incubated,cells |
R4732 |
T6383 |
T6382 |
prep |
with,incubated |
R4733 |
T6384 |
T6383 |
pobj |
vehicle,with |
R4734 |
T6385 |
T6382 |
advmod |
alone,incubated |
R4735 |
T6386 |
T6385 |
cc |
or,alone |
R4736 |
T6387 |
T6385 |
conj |
M-CSF,alone |
R4737 |
T6388 |
T6382 |
prep |
with,incubated |
R4738 |
T6389 |
T6390 |
compound |
PKC,inhibitors |
R4739 |
T6390 |
T6388 |
pobj |
inhibitors,with |
R4740 |
T6391 |
T6376 |
punct |
.,had |
R4741 |
T6392 |
T6393 |
det |
These,data |
R4742 |
T6393 |
T6394 |
nsubj |
data,supported |
R4743 |
T6394 |
T6394 |
ROOT |
supported,supported |
R4744 |
T6395 |
T6396 |
det |
the,hypothesis |
R4745 |
T6396 |
T6394 |
dobj |
hypothesis,supported |
R4746 |
T6397 |
T6398 |
nsubj |
that,M-CSF-induced |
R4747 |
T6398 |
T6400 |
amod |
M-CSF-induced,activity |
R4748 |
T6399 |
T6400 |
amod |
NF-κB,activity |
R4749 |
T6400 |
T6402 |
nsubjpass |
activity,regulated |
R4750 |
T6401 |
T6402 |
auxpass |
was,regulated |
R4751 |
T6402 |
T6394 |
conj |
regulated,supported |
R4752 |
T6403 |
T6402 |
agent |
by,regulated |
R4753 |
T6404 |
T6405 |
amod |
conventional,PKCs |
R4754 |
T6405 |
T6403 |
pobj |
PKCs,by |
R4755 |
T6406 |
T6405 |
punct |
",",PKCs |
R4756 |
T6407 |
T6408 |
neg |
not,novel |
R4757 |
T6408 |
T6409 |
amod |
novel,PKCs |
R4758 |
T6409 |
T6405 |
appos |
PKCs,PKCs |
R4759 |
T6410 |
T6402 |
punct |
.,regulated |
R4760 |
T6411 |
T6412 |
aux |
To,confirm |
R4761 |
T6412 |
T6422 |
advcl |
confirm,treated |
R4762 |
T6413 |
T6416 |
mark |
that,decreased |
R4763 |
T6414 |
T6415 |
compound |
PKC,inhibition |
R4764 |
T6415 |
T6416 |
nsubj |
inhibition,decreased |
R4765 |
T6416 |
T6418 |
amod |
decreased,survival |
R4766 |
T6417 |
T6418 |
compound |
cell,survival |
R4767 |
T6418 |
T6412 |
dobj |
survival,confirm |
R4768 |
T6419 |
T6422 |
punct |
",",treated |
R4769 |
T6420 |
T6422 |
nsubjpass |
cells,treated |
R4770 |
T6421 |
T6422 |
auxpass |
were,treated |
R4771 |
T6422 |
T6422 |
ROOT |
treated,treated |
R4772 |
T6423 |
T6422 |
prep |
with,treated |
R4773 |
T6424 |
T6423 |
pobj |
M-CSF,with |
R4774 |
T6425 |
T6422 |
prep |
in,treated |
R4775 |
T6426 |
T6427 |
det |
the,absence |
R4776 |
T6427 |
T6425 |
pobj |
absence,in |
R4777 |
T6428 |
T6427 |
cc |
or,absence |
R4778 |
T6429 |
T6427 |
conj |
presence,absence |
R4779 |
T6430 |
T6427 |
prep |
of,absence |
R4780 |
T6431 |
T6432 |
compound |
PKC,inhibitors |
R4781 |
T6432 |
T6430 |
pobj |
inhibitors,of |
R4782 |
T6433 |
T6422 |
cc |
and,treated |
R4783 |
T6434 |
T6436 |
advmod |
then,examined |
R4784 |
T6435 |
T6436 |
advmod |
also,examined |
R4785 |
T6436 |
T6422 |
conj |
examined,treated |
R4786 |
T6437 |
T6436 |
prep |
for,examined |
R4787 |
T6438 |
T6437 |
pobj |
apoptosis,for |
R4788 |
T6439 |
T6436 |
agent |
by,examined |
R4789 |
T6440 |
T6441 |
compound |
Annexin,V/PI |
R4790 |
T6441 |
T6439 |
pobj |
V/PI,by |
R4791 |
T6442 |
T6436 |
prep |
staining,examined |
R4792 |
T6443 |
T6422 |
punct |
.,treated |
R4793 |
T6444 |
T6445 |
compound |
PKC,inhibitors |
R4794 |
T6445 |
T6451 |
nsubj |
inhibitors,reduced |
R4795 |
T6446 |
T6445 |
prep |
in,inhibitors |
R4796 |
T6447 |
T6448 |
det |
the,presence |
R4797 |
T6448 |
T6446 |
pobj |
presence,in |
R4798 |
T6449 |
T6448 |
prep |
of,presence |
R4799 |
T6450 |
T6449 |
pobj |
M-CSF,of |
R48 |
T80 |
T82 |
amod |
mononuclear,survival |
R4800 |
T6451 |
T6451 |
ROOT |
reduced,reduced |
R4801 |
T6452 |
T6453 |
det |
the,number |
R4802 |
T6453 |
T6451 |
dobj |
number,reduced |
R4803 |
T6454 |
T6453 |
prep |
of,number |
R4804 |
T6455 |
T6456 |
compound |
Annexin,V/PI |
R4805 |
T6456 |
T6458 |
nmod |
V/PI,MDMs |
R4806 |
T6457 |
T6458 |
amod |
negative,MDMs |
R4807 |
T6458 |
T6454 |
pobj |
MDMs,of |
R4808 |
T6459 |
T6451 |
prep |
compared,reduced |
R4809 |
T6460 |
T6459 |
prep |
to,compared |
R4810 |
T6461 |
T6460 |
pobj |
cells,to |
R4811 |
T6462 |
T6461 |
acl |
treated,cells |
R4812 |
T6463 |
T6462 |
prep |
with,treated |
R4813 |
T6464 |
T6463 |
pobj |
M-CSF,with |
R4814 |
T6465 |
T6464 |
advmod |
alone,M-CSF |
R4815 |
T6466 |
T6468 |
punct |
(,3B |
R4816 |
T6467 |
T6468 |
compound |
Figure,3B |
R4817 |
T6468 |
T6464 |
appos |
3B,M-CSF |
R4818 |
T6469 |
T6451 |
punct |
),reduced |
R4819 |
T6470 |
T6451 |
punct |
.,reduced |
R4820 |
T6471 |
T6472 |
det |
These,observations |
R4821 |
T6472 |
T6474 |
nsubj |
observations,suggested |
R4822 |
T6473 |
T6474 |
advmod |
further,suggested |
R4823 |
T6474 |
T6474 |
ROOT |
suggested,suggested |
R4824 |
T6475 |
T6479 |
mark |
that,promoted |
R4825 |
T6476 |
T6477 |
compound |
MDM,survival |
R4826 |
T6477 |
T6479 |
nsubjpass |
survival,promoted |
R4827 |
T6478 |
T6479 |
auxpass |
is,promoted |
R4828 |
T6479 |
T6474 |
ccomp |
promoted,suggested |
R4829 |
T6480 |
T6479 |
agent |
by,promoted |
R4830 |
T6481 |
T6480 |
pobj |
M-CSF,by |
R4831 |
T6482 |
T6479 |
cc |
and,promoted |
R4832 |
T6483 |
T6484 |
advmod |
critically,involves |
R4833 |
T6484 |
T6479 |
conj |
involves,promoted |
R4834 |
T6485 |
T6486 |
amod |
conventional,PKCs |
R4835 |
T6486 |
T6484 |
dobj |
PKCs,involves |
R4836 |
T6487 |
T6486 |
cc |
and,PKCs |
R4837 |
T6488 |
T6489 |
amod |
NF-κB,activity |
R4838 |
T6489 |
T6486 |
conj |
activity,PKCs |
R4839 |
T6490 |
T6474 |
punct |
.,suggested |
R49 |
T81 |
T82 |
amod |
phagocyte,survival |
R50 |
T82 |
T79 |
dobj |
survival,promotes |
R51 |
T83 |
T82 |
cc |
and,survival |
R5169 |
T7014 |
T7017 |
compound |
M-CSF-Induces,Activity |
R5170 |
T7015 |
T7017 |
compound |
PKCα,Activity |
R5171 |
T7016 |
T7017 |
compound |
Kinase,Activity |
R5172 |
T7017 |
T7021 |
nsubj |
Activity,suggested |
R5173 |
T7018 |
T7021 |
mark |
Since,suggested |
R5174 |
T7019 |
T7020 |
poss |
our,data |
R5175 |
T7020 |
T7021 |
nsubj |
data,suggested |
R5176 |
T7021 |
T7041 |
advcl |
suggested,investigated |
R5177 |
T7022 |
T7026 |
mark |
that,involved |
R5178 |
T7023 |
T7024 |
amod |
conventional,PKCs |
R5179 |
T7024 |
T7026 |
nsubjpass |
PKCs,involved |
R5180 |
T7025 |
T7026 |
auxpass |
were,involved |
R5181 |
T7026 |
T7021 |
ccomp |
involved,suggested |
R5182 |
T7027 |
T7026 |
prep |
in,involved |
R5183 |
T7028 |
T7027 |
pcomp |
activating,in |
R5184 |
T7029 |
T7028 |
dobj |
NF-κB,activating |
R5185 |
T7030 |
T7028 |
prep |
in,activating |
R5186 |
T7031 |
T7030 |
pobj |
response,in |
R5187 |
T7032 |
T7031 |
prep |
to,response |
R5188 |
T7033 |
T7032 |
pobj |
M-CSF,to |
R5189 |
T7034 |
T7033 |
prep |
in,M-CSF |
R5190 |
T7035 |
T7037 |
amod |
primary,macrophages |
R5191 |
T7036 |
T7037 |
amod |
human,macrophages |
R5192 |
T7037 |
T7034 |
pobj |
macrophages,in |
R5193 |
T7038 |
T7041 |
punct |
",",investigated |
R5194 |
T7039 |
T7041 |
nsubj |
we,investigated |
R5195 |
T7040 |
T7041 |
advmod |
next,investigated |
R5196 |
T7041 |
T7041 |
ROOT |
investigated,investigated |
R5197 |
T7042 |
T7048 |
mark |
whether,was |
R5198 |
T7043 |
T7045 |
det |
the,PKC |
R5199 |
T7044 |
T7045 |
amod |
conventional,PKC |
R52 |
T84 |
T82 |
conj |
proliferation,survival |
R5200 |
T7045 |
T7048 |
nsubj |
PKC,was |
R5201 |
T7046 |
T7048 |
punct |
",",was |
R5202 |
T7047 |
T7048 |
nsubj |
PKCα,was |
R5203 |
T7048 |
T7041 |
ccomp |
was,investigated |
R5204 |
T7049 |
T7051 |
det |
a,target |
R5205 |
T7050 |
T7051 |
amod |
downstream,target |
R5206 |
T7051 |
T7048 |
attr |
target,was |
R5207 |
T7052 |
T7051 |
prep |
of,target |
R5208 |
T7053 |
T7052 |
pobj |
M-CSF,of |
R5209 |
T7054 |
T7051 |
prep |
in,target |
R5210 |
T7055 |
T7056 |
amod |
human,MDMs |
R5211 |
T7056 |
T7054 |
pobj |
MDMs,in |
R5212 |
T7057 |
T7041 |
punct |
.,investigated |
R5213 |
T7058 |
T7060 |
nsubjpass |
PKCα,immunoprecipitated |
R5214 |
T7059 |
T7060 |
auxpass |
was,immunoprecipitated |
R5215 |
T7060 |
T7060 |
ROOT |
immunoprecipitated,immunoprecipitated |
R5216 |
T7061 |
T7060 |
prep |
from,immunoprecipitated |
R5217 |
T7062 |
T7063 |
amod |
human,MDMs |
R5218 |
T7063 |
T7061 |
pobj |
MDMs,from |
R5219 |
T7064 |
T7060 |
prep |
at,immunoprecipitated |
R5220 |
T7065 |
T7067 |
det |
the,time |
R5221 |
T7066 |
T7067 |
amod |
indicated,time |
R5222 |
T7067 |
T7064 |
pobj |
time,at |
R5223 |
T7068 |
T7081 |
advmod |
points,performed |
R5224 |
T7069 |
T7070 |
punct |
(,Figure |
R5225 |
T7070 |
T7068 |
appos |
Figure,points |
R5226 |
T7071 |
T7070 |
nummod |
4,Figure |
R5227 |
T7072 |
T7070 |
punct |
),Figure |
R5228 |
T7073 |
T7070 |
punct |
",",Figure |
R5229 |
T7074 |
T7070 |
cc |
and,Figure |
R5230 |
T7075 |
T7081 |
advmod |
then,performed |
R5231 |
T7076 |
T7079 |
det |
a,assay |
R5232 |
T7077 |
T7079 |
compound |
PKC,assay |
R5233 |
T7078 |
T7079 |
compound |
kinase,assay |
R5234 |
T7079 |
T7081 |
nsubjpass |
assay,performed |
R5235 |
T7080 |
T7081 |
auxpass |
was,performed |
R5236 |
T7081 |
T7081 |
ROOT |
performed,performed |
R5237 |
T7082 |
T7081 |
advcl |
using,performed |
R5238 |
T7083 |
T7085 |
det |
a,peptide |
R5239 |
T7084 |
T7085 |
amod |
fluorescein-tagged,peptide |
R5240 |
T7085 |
T7082 |
dobj |
peptide,using |
R5241 |
T7086 |
T7082 |
prep |
as,using |
R5242 |
T7087 |
T7088 |
det |
a,substrate |
R5243 |
T7088 |
T7086 |
pobj |
substrate,as |
R5244 |
T7089 |
T7081 |
punct |
.,performed |
R5245 |
T7090 |
T7091 |
mark |
As,shown |
R5246 |
T7091 |
T7103 |
advcl |
shown,was |
R5247 |
T7092 |
T7091 |
prep |
in,shown |
R5248 |
T7093 |
T7092 |
pobj |
Figure,in |
R5249 |
T7094 |
T7093 |
nummod |
4,Figure |
R5250 |
T7095 |
T7097 |
punct |
(,panel |
R5251 |
T7096 |
T7097 |
amod |
upper,panel |
R5252 |
T7097 |
T7093 |
appos |
panel,Figure |
R5253 |
T7098 |
T7093 |
punct |
),Figure |
R5254 |
T7099 |
T7103 |
punct |
",",was |
R5255 |
T7100 |
T7102 |
det |
the,substrate |
R5256 |
T7101 |
T7102 |
compound |
peptide,substrate |
R5257 |
T7102 |
T7103 |
nsubj |
substrate,was |
R5258 |
T7103 |
T7103 |
ROOT |
was,was |
R5259 |
T7104 |
T7105 |
advmod |
maximally,phosphorylated |
R5260 |
T7105 |
T7103 |
acomp |
phosphorylated,was |
R5261 |
T7106 |
T7105 |
prep |
within,phosphorylated |
R5262 |
T7107 |
T7108 |
nummod |
10,minutes |
R5263 |
T7108 |
T7106 |
pobj |
minutes,within |
R5264 |
T7109 |
T7108 |
prep |
of,minutes |
R5265 |
T7110 |
T7109 |
pobj |
stimulation,of |
R5266 |
T7111 |
T7112 |
punct |
(,1.8-fold |
R5267 |
T7112 |
T7105 |
appos |
1.8-fold,phosphorylated |
R5268 |
T7113 |
T7112 |
prep |
over,1.8-fold |
R5269 |
T7114 |
T7115 |
amod |
resting,cells |
R5270 |
T7115 |
T7113 |
pobj |
cells,over |
R5271 |
T7116 |
T7112 |
punct |
",",1.8-fold |
R5272 |
T7117 |
T7118 |
amod |
lower,panel |
R5273 |
T7118 |
T7112 |
appos |
panel,1.8-fold |
R5274 |
T7119 |
T7112 |
punct |
),1.8-fold |
R5275 |
T7120 |
T7112 |
punct |
",",1.8-fold |
R5276 |
T7121 |
T7105 |
cc |
and,phosphorylated |
R5277 |
T7122 |
T7123 |
advmod |
then,returned |
R5278 |
T7123 |
T7103 |
conj |
returned,was |
R5279 |
T7124 |
T7123 |
prep |
to,returned |
R5280 |
T7125 |
T7126 |
amod |
basal,levels |
R5281 |
T7126 |
T7124 |
pobj |
levels,to |
R5282 |
T7127 |
T7123 |
prep |
by,returned |
R5283 |
T7128 |
T7129 |
nummod |
15,minutes |
R5284 |
T7129 |
T7127 |
pobj |
minutes,by |
R5285 |
T7130 |
T7123 |
punct |
.,returned |
R5286 |
T7131 |
T7132 |
det |
This,effect |
R5287 |
T7132 |
T7135 |
nsubjpass |
effect,seen |
R5288 |
T7133 |
T7135 |
auxpass |
was,seen |
R5289 |
T7134 |
T7135 |
neg |
not,seen |
R5290 |
T7135 |
T7135 |
ROOT |
seen,seen |
R5291 |
T7136 |
T7135 |
prep |
in,seen |
R5292 |
T7137 |
T7138 |
amod |
M-CSF-stimulated,monocytes |
R5293 |
T7138 |
T7136 |
pobj |
monocytes,in |
R5294 |
T7139 |
T7146 |
advmod |
when,used |
R5295 |
T7140 |
T7141 |
amod |
isogenic,antibodies |
R5296 |
T7141 |
T7146 |
nsubjpass |
antibodies,used |
R5297 |
T7142 |
T7143 |
punct |
(,IgG |
R5298 |
T7143 |
T7141 |
appos |
IgG,antibodies |
R5299 |
T7144 |
T7141 |
punct |
),antibodies |
R53 |
T85 |
T79 |
punct |
.,promotes |
R5300 |
T7145 |
T7146 |
auxpass |
were,used |
R5301 |
T7146 |
T7135 |
advcl |
used,seen |
R5302 |
T7147 |
T7146 |
prep |
for,used |
R5303 |
T7148 |
T7147 |
pobj |
immunoprecipitation,for |
R5304 |
T7149 |
T7135 |
punct |
.,seen |
R5305 |
T7150 |
T7151 |
amod |
Western,blots |
R5306 |
T7151 |
T7160 |
nsubj |
blots,demonstrated |
R5307 |
T7152 |
T7151 |
prep |
of,blots |
R5308 |
T7153 |
T7154 |
amod |
identical,samples |
R5309 |
T7154 |
T7152 |
pobj |
samples,of |
R5310 |
T7155 |
T7151 |
acl |
using,blots |
R5311 |
T7156 |
T7157 |
det |
an,antibody |
R5312 |
T7157 |
T7155 |
dobj |
antibody,using |
R5313 |
T7158 |
T7155 |
advcl |
recognizing,using |
R5314 |
T7159 |
T7160 |
nsubj |
PKCα,demonstrated |
R5315 |
T7160 |
T7160 |
ROOT |
demonstrated,demonstrated |
R5316 |
T7161 |
T7167 |
mark |
that,assayed |
R5317 |
T7162 |
T7163 |
amod |
equal,amounts |
R5318 |
T7163 |
T7167 |
nsubjpass |
amounts,assayed |
R5319 |
T7164 |
T7163 |
prep |
of,amounts |
R5320 |
T7165 |
T7164 |
pobj |
PKCα,of |
R5321 |
T7166 |
T7167 |
auxpass |
were,assayed |
R5322 |
T7167 |
T7160 |
ccomp |
assayed,demonstrated |
R5323 |
T7168 |
T7169 |
punct |
(,Figure |
R5324 |
T7169 |
T7167 |
oprd |
Figure,assayed |
R5325 |
T7170 |
T7169 |
nummod |
4,Figure |
R5326 |
T7171 |
T7169 |
punct |
",",Figure |
R5327 |
T7172 |
T7173 |
amod |
middle,panel |
R5328 |
T7173 |
T7169 |
appos |
panel,Figure |
R5329 |
T7174 |
T7169 |
punct |
),Figure |
R5330 |
T7175 |
T7160 |
punct |
.,demonstrated |
R54 |
T86 |
T88 |
det |
The,factor |
R55 |
T87 |
T88 |
compound |
transcription,factor |
R5538 |
T7492 |
T7493 |
amod |
M-CSF-Dependent,Activation |
R5539 |
T7493 |
T7498 |
nsubj |
Activation,Regulate |
R5540 |
T7494 |
T7493 |
prep |
of,Activation |
R5541 |
T7495 |
T7494 |
pobj |
PKC,of |
R5542 |
T7496 |
T7498 |
aux |
Does,Regulate |
R5543 |
T7497 |
T7498 |
neg |
Not,Regulate |
R5544 |
T7498 |
T7498 |
ROOT |
Regulate,Regulate |
R5545 |
T7499 |
T7506 |
det |
the,activation |
R5546 |
T7500 |
T7501 |
amod |
Classical,NF-κB |
R5547 |
T7501 |
T7506 |
nmod |
NF-κB,activation |
R5548 |
T7502 |
T7506 |
nummod |
p65,activation |
R5549 |
T7503 |
T7504 |
compound |
Activation,Pathway |
R5550 |
T7504 |
T7506 |
nmod |
Pathway,activation |
R5551 |
T7505 |
T7506 |
amod |
Canonical,activation |
R5552 |
T7506 |
T7509 |
nsubj |
activation,occurs |
R5553 |
T7507 |
T7506 |
prep |
of,activation |
R5554 |
T7508 |
T7507 |
pobj |
NF-κB,of |
R5555 |
T7509 |
T7498 |
ccomp |
occurs,Regulate |
R5556 |
T7510 |
T7509 |
prep |
via,occurs |
R5557 |
T7511 |
T7510 |
pobj |
phosphorylation,via |
R5558 |
T7512 |
T7511 |
cc |
and,phosphorylation |
R5559 |
T7513 |
T7511 |
conj |
degradation,phosphorylation |
R5560 |
T7514 |
T7513 |
prep |
of,degradation |
R5561 |
T7515 |
T7516 |
nsubj |
IκBα,leading |
R5562 |
T7516 |
T7498 |
advcl |
leading,Regulate |
R5563 |
T7517 |
T7516 |
prep |
to,leading |
R5564 |
T7518 |
T7519 |
det |
the,release |
R5565 |
T7519 |
T7517 |
pobj |
release,to |
R5566 |
T7520 |
T7519 |
cc |
and,release |
R5567 |
T7521 |
T7522 |
amod |
nuclear,translocation |
R5568 |
T7522 |
T7519 |
conj |
translocation,release |
R5569 |
T7523 |
T7522 |
prep |
of,translocation |
R5570 |
T7524 |
T7527 |
det |
the,heterodimer |
R5571 |
T7525 |
T7527 |
nmod |
NF-κB,heterodimer |
R5572 |
T7526 |
T7527 |
nummod |
p50/p65,heterodimer |
R5573 |
T7527 |
T7523 |
pobj |
heterodimer,of |
R5574 |
T7528 |
T7529 |
aux |
to,transactivate |
R5575 |
T7529 |
T7516 |
xcomp |
transactivate,leading |
R5576 |
T7530 |
T7531 |
compound |
target,genes |
R5577 |
T7531 |
T7529 |
dobj |
genes,transactivate |
R5578 |
T7532 |
T7534 |
nmod |
[,] |
R5579 |
T7533 |
T7534 |
nummod |
37,] |
R5580 |
T7534 |
T7529 |
conj |
],transactivate |
R5581 |
T7535 |
T7534 |
punct |
",",] |
R5582 |
T7536 |
T7538 |
nmod |
[,] |
R5583 |
T7537 |
T7538 |
nummod |
39,] |
R5584 |
T7538 |
T7534 |
appos |
],] |
R5585 |
T7539 |
T7498 |
punct |
.,Regulate |
R5586 |
T7540 |
T7544 |
mark |
Since,was |
R5587 |
T7541 |
T7543 |
amod |
conventional,activity |
R5588 |
T7542 |
T7543 |
compound |
PKC,activity |
R5589 |
T7543 |
T7544 |
nsubj |
activity,was |
R5590 |
T7544 |
T7554 |
advcl |
was,investigated |
R5591 |
T7545 |
T7544 |
acomp |
important,was |
R5592 |
T7546 |
T7545 |
prep |
in,important |
R5593 |
T7547 |
T7546 |
pcomp |
regulating,in |
R5594 |
T7548 |
T7550 |
amod |
M-CSF-induced,activation |
R5595 |
T7549 |
T7550 |
compound |
NF-κB,activation |
R5596 |
T7550 |
T7547 |
dobj |
activation,regulating |
R5597 |
T7551 |
T7554 |
punct |
",",investigated |
R5598 |
T7552 |
T7554 |
nsubj |
we,investigated |
R5599 |
T7553 |
T7554 |
advmod |
next,investigated |
R56 |
T88 |
T94 |
nsubj |
factor,is |
R5600 |
T7554 |
T7554 |
ROOT |
investigated,investigated |
R5601 |
T7555 |
T7559 |
mark |
whether,regulated |
R5602 |
T7556 |
T7557 |
compound |
IκBα,degradation |
R5603 |
T7557 |
T7559 |
nsubjpass |
degradation,regulated |
R5604 |
T7558 |
T7559 |
auxpass |
was,regulated |
R5605 |
T7559 |
T7554 |
ccomp |
regulated,investigated |
R5606 |
T7560 |
T7559 |
agent |
by,regulated |
R5607 |
T7561 |
T7560 |
pobj |
PKC,by |
R5608 |
T7562 |
T7554 |
punct |
.,investigated |
R5609 |
T7563 |
T7565 |
nsubjpass |
Cells,treated |
R5610 |
T7564 |
T7565 |
auxpass |
were,treated |
R5611 |
T7565 |
T7565 |
ROOT |
treated,treated |
R5612 |
T7566 |
T7565 |
prep |
with,treated |
R5613 |
T7567 |
T7566 |
pobj |
cyclohexamide,with |
R5614 |
T7568 |
T7567 |
punct |
(,cyclohexamide |
R5615 |
T7569 |
T7567 |
appos |
CHX,cyclohexamide |
R5616 |
T7570 |
T7567 |
punct |
),cyclohexamide |
R5617 |
T7571 |
T7572 |
aux |
to,inhibit |
R5618 |
T7572 |
T7565 |
advcl |
inhibit,treated |
R5619 |
T7573 |
T7574 |
compound |
protein,synthesis |
R5620 |
T7574 |
T7572 |
dobj |
synthesis,inhibit |
R5621 |
T7575 |
T7574 |
prep |
of,synthesis |
R5622 |
T7576 |
T7575 |
pobj |
IκBα,of |
R5623 |
T7577 |
T7572 |
punct |
",",inhibit |
R5624 |
T7578 |
T7572 |
cc |
and,inhibit |
R5625 |
T7579 |
T7580 |
poss |
its,degradation |
R5626 |
T7580 |
T7582 |
nsubjpass |
degradation,followed |
R5627 |
T7581 |
T7582 |
auxpass |
was,followed |
R5628 |
T7582 |
T7565 |
conj |
followed,treated |
R5629 |
T7583 |
T7582 |
punct |
.,followed |
R5630 |
T7584 |
T7585 |
mark |
As,shown |
R5631 |
T7585 |
T7596 |
advcl |
shown,alter |
R5632 |
T7586 |
T7585 |
prep |
in,shown |
R5633 |
T7587 |
T7586 |
pobj |
Figure,in |
R5634 |
T7588 |
T7587 |
nummod |
5A,Figure |
R5635 |
T7589 |
T7585 |
punct |
",",shown |
R5636 |
T7590 |
T7591 |
compound |
PKC,inhibition |
R5637 |
T7591 |
T7596 |
nsubj |
inhibition,alter |
R5638 |
T7592 |
T7591 |
prep |
with,inhibition |
R5639 |
T7593 |
T7592 |
pobj |
Ro-31-8220,with |
R5640 |
T7594 |
T7596 |
aux |
did,alter |
R5641 |
T7595 |
T7596 |
neg |
not,alter |
R5642 |
T7596 |
T7596 |
ROOT |
alter,alter |
R5643 |
T7597 |
T7599 |
amod |
M-CSF-induced,degradation |
R5644 |
T7598 |
T7599 |
compound |
IκBα,degradation |
R5645 |
T7599 |
T7596 |
dobj |
degradation,alter |
R5646 |
T7600 |
T7596 |
punct |
",",alter |
R5647 |
T7601 |
T7596 |
advcl |
suggesting,alter |
R5648 |
T7602 |
T7606 |
mark |
that,augmented |
R5649 |
T7603 |
T7605 |
amod |
M-CSF-induced,activity |
R5650 |
T7604 |
T7605 |
compound |
PKC,activity |
R5651 |
T7605 |
T7606 |
nsubj |
activity,augmented |
R5652 |
T7606 |
T7601 |
ccomp |
augmented,suggesting |
R5653 |
T7607 |
T7609 |
amod |
NF-κB,activity |
R5654 |
T7608 |
T7609 |
amod |
transcriptional,activity |
R5655 |
T7609 |
T7606 |
dobj |
activity,augmented |
R5656 |
T7610 |
T7609 |
prep |
by,activity |
R5657 |
T7611 |
T7613 |
det |
an,pathway |
R5658 |
T7612 |
T7613 |
amod |
alternative,pathway |
R5659 |
T7613 |
T7610 |
pobj |
pathway,by |
R5660 |
T7614 |
T7613 |
punct |
",",pathway |
R5661 |
T7615 |
T7606 |
prep |
like,augmented |
R5662 |
T7616 |
T7617 |
amod |
post-translational,modification |
R5663 |
T7617 |
T7615 |
pobj |
modification,like |
R5664 |
T7618 |
T7617 |
prep |
of,modification |
R5665 |
T7619 |
T7620 |
compound |
NF-κB,p65 |
R5666 |
T7620 |
T7618 |
pobj |
p65,of |
R5667 |
T7621 |
T7596 |
punct |
.,alter |
R57 |
T89 |
T90 |
compound |
Nuclear,Factor-kappaB |
R58 |
T90 |
T88 |
appos |
Factor-kappaB,factor |
R59 |
T91 |
T92 |
punct |
(,NF-κB |
R5979 |
T8089 |
T8090 |
nsubj |
M-CSF,Induces |
R5980 |
T8090 |
T8091 |
compound |
Induces,Phosphorylation |
R5981 |
T8091 |
T8112 |
nsubj |
Phosphorylation,sought |
R5982 |
T8092 |
T8091 |
prep |
of,Phosphorylation |
R5983 |
T8093 |
T8094 |
compound |
NF-κB,Ser276 |
R5984 |
T8094 |
T8092 |
pobj |
Ser276,of |
R5985 |
T8095 |
T8091 |
prep |
in,Phosphorylation |
R5986 |
T8096 |
T8098 |
det |
a,Fashion |
R5987 |
T8097 |
T8098 |
amod |
PKC-dependent,Fashion |
R5988 |
T8098 |
T8095 |
pobj |
Fashion,in |
R5989 |
T8099 |
T8103 |
mark |
Since,regulate |
R5990 |
T8100 |
T8103 |
nsubj |
M-CSF,regulate |
R5991 |
T8101 |
T8103 |
aux |
did,regulate |
R5992 |
T8102 |
T8103 |
neg |
not,regulate |
R5993 |
T8103 |
T8112 |
advcl |
regulate,sought |
R5994 |
T8104 |
T8105 |
amod |
NF-κB,activation |
R5995 |
T8105 |
T8103 |
dobj |
activation,regulate |
R5996 |
T8106 |
T8103 |
prep |
by,regulate |
R5997 |
T8107 |
T8106 |
pcomp |
influencing,by |
R5998 |
T8108 |
T8107 |
dobj |
IκBα,influencing |
R5999 |
T8109 |
T8112 |
punct |
",",sought |
R60 |
T92 |
T90 |
appos |
NF-κB,Factor-kappaB |
R6000 |
T8110 |
T8112 |
nsubj |
we,sought |
R6001 |
T8111 |
T8112 |
advmod |
next,sought |
R6002 |
T8112 |
T8112 |
ROOT |
sought,sought |
R6003 |
T8113 |
T8114 |
aux |
to,determine |
R6004 |
T8114 |
T8112 |
xcomp |
determine,sought |
R6005 |
T8115 |
T8117 |
mark |
if,affected |
R6006 |
T8116 |
T8117 |
nsubj |
M-CSF,affected |
R6007 |
T8117 |
T8114 |
ccomp |
affected,determine |
R6008 |
T8118 |
T8119 |
compound |
NF-κB,p65 |
R6009 |
T8119 |
T8117 |
dobj |
p65,affected |
R6010 |
T8120 |
T8117 |
prep |
by,affected |
R6011 |
T8121 |
T8122 |
amod |
post-translational,mechanisms |
R6012 |
T8122 |
T8120 |
pobj |
mechanisms,by |
R6013 |
T8123 |
T8112 |
punct |
.,sought |
R6014 |
T8124 |
T8127 |
advmod |
Thus,examined |
R6015 |
T8125 |
T8127 |
punct |
",",examined |
R6016 |
T8126 |
T8127 |
nsubj |
we,examined |
R6017 |
T8127 |
T8127 |
ROOT |
examined,examined |
R6018 |
T8128 |
T8129 |
det |
the,phosphorylation |
R6019 |
T8129 |
T8127 |
dobj |
phosphorylation,examined |
R6020 |
T8130 |
T8129 |
prep |
of,phosphorylation |
R6021 |
T8131 |
T8130 |
pobj |
NF-κB,of |
R6022 |
T8132 |
T8131 |
nummod |
p65,NF-κB |
R6023 |
T8133 |
T8129 |
prep |
with,phosphorylation |
R6024 |
T8134 |
T8136 |
amod |
specific,p65 |
R6025 |
T8135 |
T8136 |
compound |
phospho-NFκB,p65 |
R6026 |
T8136 |
T8133 |
pobj |
p65,with |
R6027 |
T8137 |
T8136 |
punct |
(,p65 |
R6028 |
T8138 |
T8136 |
appos |
Ser276,p65 |
R6029 |
T8139 |
T8138 |
cc |
and,Ser276 |
R6030 |
T8140 |
T8138 |
conj |
Ser536,Ser276 |
R6031 |
T8141 |
T8136 |
punct |
),p65 |
R6032 |
T8142 |
T8136 |
appos |
antibodies,p65 |
R6033 |
T8143 |
T8127 |
punct |
.,examined |
R6034 |
T8144 |
T8145 |
nsubj |
M-CSF,induced |
R6035 |
T8145 |
T8145 |
ROOT |
induced,induced |
R6036 |
T8146 |
T8147 |
det |
the,phosphorylation |
R6037 |
T8147 |
T8145 |
dobj |
phosphorylation,induced |
R6038 |
T8148 |
T8147 |
prep |
of,phosphorylation |
R6039 |
T8149 |
T8148 |
pobj |
Ser276,of |
R6040 |
T8150 |
T8147 |
cc |
but,phosphorylation |
R6041 |
T8151 |
T8152 |
neg |
not,Ser536 |
R6042 |
T8152 |
T8147 |
conj |
Ser536,phosphorylation |
R6043 |
T8153 |
T8152 |
prep |
of,Ser536 |
R6044 |
T8154 |
T8153 |
pobj |
NF-κB,of |
R6045 |
T8155 |
T8154 |
nummod |
p65,NF-κB |
R6046 |
T8156 |
T8152 |
prep |
in,Ser536 |
R6047 |
T8157 |
T8156 |
pobj |
MDMs,in |
R6048 |
T8158 |
T8145 |
punct |
.,induced |
R6049 |
T8159 |
T8168 |
prep |
Compared,reduced |
R6050 |
T8160 |
T8159 |
prep |
to,Compared |
R6051 |
T8161 |
T8160 |
pobj |
vehicle,to |
R6052 |
T8162 |
T8168 |
punct |
",",reduced |
R6053 |
T8163 |
T8166 |
det |
the,inhibitor |
R6054 |
T8164 |
T8166 |
amod |
general,inhibitor |
R6055 |
T8165 |
T8166 |
compound |
PKC,inhibitor |
R6056 |
T8166 |
T8168 |
nsubj |
inhibitor,reduced |
R6057 |
T8167 |
T8168 |
nsubj |
Ro-31-8220,reduced |
R6058 |
T8168 |
T8168 |
ROOT |
reduced,reduced |
R6059 |
T8169 |
T8170 |
compound |
Ser276,phosphorylation |
R6060 |
T8170 |
T8168 |
dobj |
phosphorylation,reduced |
R6061 |
T8171 |
T8168 |
punct |
",",reduced |
R6062 |
T8172 |
T8168 |
cc |
but,reduced |
R6063 |
T8173 |
T8174 |
neg |
not,Ser536 |
R6064 |
T8174 |
T8168 |
conj |
Ser536,reduced |
R6065 |
T8175 |
T8174 |
punct |
",",Ser536 |
R6066 |
T8176 |
T8174 |
appos |
phosphorylation,Ser536 |
R6067 |
T8177 |
T8176 |
prep |
in,phosphorylation |
R6068 |
T8178 |
T8179 |
amod |
M-CSF-stimulated,cells |
R6069 |
T8179 |
T8177 |
pobj |
cells,in |
R6070 |
T8180 |
T8182 |
punct |
(,5B |
R6071 |
T8181 |
T8182 |
compound |
Figure,5B |
R6072 |
T8182 |
T8176 |
appos |
5B,phosphorylation |
R6073 |
T8183 |
T8182 |
punct |
),5B |
R6074 |
T8184 |
T8168 |
punct |
.,reduced |
R6075 |
T8185 |
T8198 |
advmod |
Furthermore,was |
R6076 |
T8186 |
T8198 |
punct |
",",was |
R6077 |
T8187 |
T8190 |
amod |
M-CSF-stimulated,phosphorylation |
R6078 |
T8188 |
T8190 |
nmod |
NF-κB,phosphorylation |
R6079 |
T8189 |
T8190 |
nummod |
p65,phosphorylation |
R6080 |
T8190 |
T8198 |
nsubj |
phosphorylation,was |
R6081 |
T8191 |
T8190 |
prep |
at,phosphorylation |
R6082 |
T8192 |
T8191 |
pobj |
residue,at |
R6083 |
T8193 |
T8190 |
conj |
Ser276,phosphorylation |
R6084 |
T8194 |
T8193 |
prep |
in,Ser276 |
R6085 |
T8195 |
T8194 |
pobj |
RAW,in |
R6086 |
T8196 |
T8197 |
nummod |
264.7,cells |
R6087 |
T8197 |
T8190 |
conj |
cells,phosphorylation |
R6088 |
T8198 |
T8198 |
ROOT |
was,was |
R6089 |
T8199 |
T8198 |
advmod |
also,was |
R6090 |
T8200 |
T8201 |
compound |
PKC,dependent |
R6091 |
T8201 |
T8198 |
attr |
dependent,was |
R6092 |
T8202 |
T8204 |
punct |
(,5C |
R6093 |
T8203 |
T8204 |
compound |
Figure,5C |
R6094 |
T8204 |
T8201 |
appos |
5C,dependent |
R6095 |
T8205 |
T8204 |
punct |
),5C |
R6096 |
T8206 |
T8198 |
punct |
.,was |
R6097 |
T8207 |
T8208 |
det |
These,studies |
R6098 |
T8208 |
T8209 |
nsubj |
studies,suggested |
R6099 |
T8209 |
T8209 |
ROOT |
suggested,suggested |
R61 |
T93 |
T90 |
punct |
),Factor-kappaB |
R6100 |
T8210 |
T8215 |
mark |
that,regulated |
R6101 |
T8211 |
T8215 |
nsubj |
PKC,regulated |
R6102 |
T8212 |
T8211 |
punct |
(,PKC |
R6103 |
T8213 |
T8211 |
appos |
s,PKC |
R6104 |
T8214 |
T8211 |
punct |
),PKC |
R6105 |
T8215 |
T8209 |
ccomp |
regulated,suggested |
R6106 |
T8216 |
T8217 |
compound |
Ser276,phosphorylation |
R6107 |
T8217 |
T8215 |
dobj |
phosphorylation,regulated |
R6108 |
T8218 |
T8217 |
cc |
but,phosphorylation |
R6109 |
T8219 |
T8220 |
neg |
not,Ser536 |
R6110 |
T8220 |
T8217 |
conj |
Ser536,phosphorylation |
R6111 |
T8221 |
T8220 |
prep |
in,Ser536 |
R6112 |
T8222 |
T8224 |
preconj |
both,MDMs |
R6113 |
T8223 |
T8224 |
amod |
human,MDMs |
R6114 |
T8224 |
T8221 |
pobj |
MDMs,in |
R6115 |
T8225 |
T8224 |
cc |
and,MDMs |
R6116 |
T8226 |
T8227 |
compound |
mouse,macrophages |
R6117 |
T8227 |
T8224 |
conj |
macrophages,MDMs |
R6118 |
T8228 |
T8220 |
prep |
after,Ser536 |
R6119 |
T8229 |
T8230 |
compound |
M-CSF,stimulation |
R6120 |
T8230 |
T8228 |
pobj |
stimulation,after |
R6121 |
T8231 |
T8209 |
punct |
.,suggested |
R6122 |
T8232 |
T8234 |
nsubj |
We,performed |
R6123 |
T8233 |
T8234 |
advmod |
next,performed |
R6124 |
T8234 |
T8234 |
ROOT |
performed,performed |
R6125 |
T8235 |
T8236 |
amod |
cellular,fractionation |
R6126 |
T8236 |
T8234 |
dobj |
fractionation,performed |
R6127 |
T8237 |
T8238 |
aux |
to,identify |
R6128 |
T8238 |
T8234 |
advcl |
identify,performed |
R6129 |
T8239 |
T8241 |
det |
the,location |
R6130 |
T8240 |
T8241 |
amod |
cellular,location |
R6131 |
T8241 |
T8238 |
dobj |
location,identify |
R6132 |
T8242 |
T8241 |
prep |
of,location |
R6133 |
T8243 |
T8245 |
amod |
phosphorylated,p65 |
R6134 |
T8244 |
T8245 |
compound |
NF-κB,p65 |
R6135 |
T8245 |
T8242 |
pobj |
p65,of |
R6136 |
T8246 |
T8245 |
prep |
in,p65 |
R6137 |
T8247 |
T8249 |
amod |
Raw,cells |
R6138 |
T8248 |
T8249 |
nummod |
264.7,cells |
R6139 |
T8249 |
T8246 |
pobj |
cells,in |
R6140 |
T8250 |
T8234 |
punct |
.,performed |
R6141 |
T8251 |
T8253 |
amod |
Non-phosphorylated,p65 |
R6142 |
T8252 |
T8253 |
compound |
NF-κB,p65 |
R6143 |
T8253 |
T8255 |
nsubjpass |
p65,located |
R6144 |
T8254 |
T8255 |
auxpass |
was,located |
R6145 |
T8255 |
T8255 |
ROOT |
located,located |
R6146 |
T8256 |
T8255 |
prep |
in,located |
R6147 |
T8257 |
T8258 |
preconj |
both,cytosolic |
R6148 |
T8258 |
T8261 |
amod |
cytosolic,fractions |
R6149 |
T8259 |
T8258 |
cc |
and,cytosolic |
R6150 |
T8260 |
T8258 |
conj |
nuclear,cytosolic |
R6151 |
T8261 |
T8256 |
pobj |
fractions,in |
R6152 |
T8262 |
T8255 |
punct |
",",located |
R6153 |
T8263 |
T8255 |
cc |
but,located |
R6154 |
T8264 |
T8272 |
dep |
phosphorylated,located |
R6155 |
T8265 |
T8272 |
nsubjpass |
Ser276,located |
R6156 |
T8266 |
T8265 |
cc |
and,Ser276 |
R6157 |
T8267 |
T8268 |
compound |
Ser536,NF-κB |
R6158 |
T8268 |
T8265 |
conj |
NF-κB,Ser276 |
R6159 |
T8269 |
T8268 |
nummod |
p65,NF-κB |
R6160 |
T8270 |
T8272 |
auxpass |
was,located |
R6161 |
T8271 |
T8272 |
advmod |
primarily,located |
R6162 |
T8272 |
T8255 |
conj |
located,located |
R6163 |
T8273 |
T8272 |
prep |
in,located |
R6164 |
T8274 |
T8275 |
amod |
nuclear,fraction |
R6165 |
T8275 |
T8273 |
pobj |
fraction,in |
R6166 |
T8276 |
T8272 |
prep |
after,located |
R6167 |
T8277 |
T8278 |
compound |
M-CSF,stimulation |
R6168 |
T8278 |
T8276 |
pobj |
stimulation,after |
R6169 |
T8279 |
T8280 |
punct |
(,Figure |
R6170 |
T8280 |
T8278 |
appos |
Figure,stimulation |
R6171 |
T8281 |
T8280 |
nummod |
5D,Figure |
R6172 |
T8282 |
T8272 |
punct |
),located |
R6173 |
T8283 |
T8255 |
punct |
.,located |
R6174 |
T8284 |
T8293 |
advmod |
Notably,found |
R6175 |
T8285 |
T8293 |
punct |
",",found |
R6176 |
T8286 |
T8287 |
amod |
constitutive,phosphorylation |
R6177 |
T8287 |
T8293 |
nsubjpass |
phosphorylation,found |
R6178 |
T8288 |
T8287 |
prep |
of,phosphorylation |
R6179 |
T8289 |
T8290 |
compound |
Ser536,NF-κB |
R6180 |
T8290 |
T8288 |
pobj |
NF-κB,of |
R6181 |
T8291 |
T8290 |
nummod |
p65,NF-κB |
R6182 |
T8292 |
T8293 |
auxpass |
was,found |
R6183 |
T8293 |
T8293 |
ROOT |
found,found |
R6184 |
T8294 |
T8293 |
prep |
in,found |
R6185 |
T8295 |
T8296 |
det |
these,cells |
R6186 |
T8296 |
T8294 |
pobj |
cells,in |
R6187 |
T8297 |
T8293 |
punct |
.,found |
R6188 |
T8298 |
T8301 |
advmod |
Importantly,reduced |
R6189 |
T8299 |
T8301 |
punct |
",",reduced |
R6190 |
T8300 |
T8301 |
nsubj |
Ro-31-8220,reduced |
R6191 |
T8301 |
T8301 |
ROOT |
reduced,reduced |
R6192 |
T8302 |
T8304 |
amod |
M-CSF-induced,phosphorylation |
R6193 |
T8303 |
T8304 |
compound |
Ser276,phosphorylation |
R6194 |
T8304 |
T8301 |
dobj |
phosphorylation,reduced |
R6195 |
T8305 |
T8304 |
prep |
of,phosphorylation |
R6196 |
T8306 |
T8305 |
pobj |
NF-κB,of |
R6197 |
T8307 |
T8306 |
nummod |
p65,NF-κB |
R6198 |
T8308 |
T8301 |
prep |
in,reduced |
R6199 |
T8309 |
T8314 |
preconj |
both,fractions |
R62 |
T94 |
T94 |
ROOT |
is,is |
R6200 |
T8310 |
T8314 |
det |
the,fractions |
R6201 |
T8311 |
T8314 |
amod |
cytosolic,fractions |
R6202 |
T8312 |
T8311 |
cc |
and,cytosolic |
R6203 |
T8313 |
T8311 |
conj |
nuclear,cytosolic |
R6204 |
T8314 |
T8308 |
pobj |
fractions,in |
R6205 |
T8315 |
T8301 |
punct |
",",reduced |
R6206 |
T8316 |
T8322 |
mark |
while,was |
R6207 |
T8317 |
T8318 |
compound |
M-CSF-induced,NF-κB |
R6208 |
T8318 |
T8322 |
nsubj |
NF-κB,was |
R6209 |
T8319 |
T8321 |
nummod |
p65,phosphorylation |
R6210 |
T8320 |
T8321 |
compound |
Ser536,phosphorylation |
R6211 |
T8321 |
T8322 |
nsubj |
phosphorylation,was |
R6212 |
T8322 |
T8301 |
advcl |
was,reduced |
R6213 |
T8323 |
T8322 |
acomp |
present,was |
R6214 |
T8324 |
T8323 |
prep |
in,present |
R6215 |
T8325 |
T8326 |
det |
the,nucleus |
R6216 |
T8326 |
T8324 |
pobj |
nucleus,in |
R6217 |
T8327 |
T8322 |
advmod |
regardless,was |
R6218 |
T8328 |
T8327 |
prep |
of,regardless |
R6219 |
T8329 |
T8330 |
compound |
PKC,inhibition |
R6220 |
T8330 |
T8328 |
pobj |
inhibition,of |
R6221 |
T8331 |
T8301 |
punct |
.,reduced |
R6222 |
T8332 |
T8333 |
det |
These,observations |
R6223 |
T8333 |
T8334 |
nsubj |
observations,indicate |
R6224 |
T8334 |
T8334 |
ROOT |
indicate,indicate |
R6225 |
T8335 |
T8341 |
mark |
that,regulated |
R6226 |
T8336 |
T8337 |
compound |
M-CSF-induced,Ser276 |
R6227 |
T8337 |
T8341 |
nsubjpass |
Ser276,regulated |
R6228 |
T8338 |
T8337 |
cc |
and,Ser276 |
R6229 |
T8339 |
T8337 |
conj |
Ser536,Ser276 |
R6230 |
T8340 |
T8341 |
auxpass |
are,regulated |
R6231 |
T8341 |
T8334 |
ccomp |
regulated,indicate |
R6232 |
T8342 |
T8341 |
advmod |
differently,regulated |
R6233 |
T8343 |
T8341 |
agent |
by,regulated |
R6234 |
T8344 |
T8346 |
amod |
conventional,activation |
R6235 |
T8345 |
T8346 |
compound |
PKC,activation |
R6236 |
T8346 |
T8343 |
pobj |
activation,by |
R6237 |
T8347 |
T8346 |
prep |
in,activation |
R6238 |
T8348 |
T8349 |
compound |
mononuclear,phagocytes |
R6239 |
T8349 |
T8347 |
pobj |
phagocytes,in |
R6240 |
T8350 |
T8334 |
punct |
.,indicate |
R6241 |
T8351 |
T8352 |
det |
The,purity |
R6242 |
T8352 |
T8361 |
nsubjpass |
purity,confirmed |
R6243 |
T8353 |
T8352 |
prep |
of,purity |
R6244 |
T8354 |
T8355 |
det |
the,cytosol |
R6245 |
T8355 |
T8353 |
pobj |
cytosol,of |
R6246 |
T8356 |
T8355 |
cc |
and,cytosol |
R6247 |
T8357 |
T8358 |
amod |
nuclear,cell |
R6248 |
T8358 |
T8359 |
compound |
cell,fractions |
R6249 |
T8359 |
T8352 |
conj |
fractions,purity |
R6250 |
T8360 |
T8361 |
auxpass |
was,confirmed |
R6251 |
T8361 |
T8361 |
ROOT |
confirmed,confirmed |
R6252 |
T8362 |
T8361 |
agent |
by,confirmed |
R6253 |
T8363 |
T8362 |
pcomp |
immunoblotting,by |
R6254 |
T8364 |
T8363 |
prep |
with,immunoblotting |
R6255 |
T8365 |
T8364 |
pobj |
GAPDH,with |
R6256 |
T8366 |
T8365 |
cc |
and,GAPDH |
R6257 |
T8367 |
T8368 |
compound |
Lamin,B |
R6258 |
T8368 |
T8365 |
conj |
B,GAPDH |
R6259 |
T8369 |
T8363 |
punct |
",",immunoblotting |
R6260 |
T8370 |
T8372 |
intj |
respectively,Figure |
R6261 |
T8371 |
T8372 |
punct |
(,Figure |
R6262 |
T8372 |
T8361 |
npadvmod |
Figure,confirmed |
R6263 |
T8373 |
T8372 |
nummod |
5D,Figure |
R6264 |
T8374 |
T8372 |
punct |
),Figure |
R6265 |
T8375 |
T8361 |
punct |
.,confirmed |
R63 |
T95 |
T97 |
det |
a,regulator |
R64 |
T96 |
T97 |
amod |
key,regulator |
R646 |
T1018 |
T1020 |
nsubjpass |
Monocytes,produced |
R647 |
T1019 |
T1020 |
auxpass |
are,produced |
R648 |
T1020 |
T1020 |
ROOT |
produced,produced |
R649 |
T1021 |
T1020 |
prep |
in,produced |
R65 |
T97 |
T94 |
attr |
regulator,is |
R650 |
T1022 |
T1024 |
det |
the,marrow |
R651 |
T1023 |
T1024 |
compound |
bone,marrow |
R652 |
T1024 |
T1021 |
pobj |
marrow,in |
R653 |
T1025 |
T1020 |
cc |
and,produced |
R654 |
T1026 |
T1020 |
conj |
circulate,produced |
R655 |
T1027 |
T1026 |
prep |
in,circulate |
R656 |
T1028 |
T1027 |
pobj |
blood,in |
R657 |
T1029 |
T1026 |
prep |
for,circulate |
R658 |
T1030 |
T1029 |
pobj |
24,for |
R659 |
T1031 |
T1032 |
nummod |
48,hours |
R66 |
T98 |
T97 |
prep |
of,regulator |
R660 |
T1032 |
T1030 |
appos |
hours,24 |
R661 |
T1033 |
T1035 |
nmod |
[,] |
R662 |
T1034 |
T1035 |
nummod |
1,] |
R663 |
T1035 |
T1032 |
appos |
],hours |
R664 |
T1036 |
T1020 |
punct |
.,produced |
R665 |
T1037 |
T1044 |
prep |
In,die |
R666 |
T1038 |
T1039 |
det |
the,absence |
R667 |
T1039 |
T1037 |
pobj |
absence,In |
R668 |
T1040 |
T1039 |
prep |
of,absence |
R669 |
T1041 |
T1040 |
pobj |
serum,of |
R67 |
T99 |
T98 |
pobj |
genes,of |
R670 |
T1042 |
T1044 |
punct |
",",die |
R671 |
T1043 |
T1044 |
nsubj |
monocytes,die |
R672 |
T1044 |
T1044 |
ROOT |
die,die |
R673 |
T1045 |
T1044 |
prep |
via,die |
R674 |
T1046 |
T1047 |
compound |
apoptosis,[ |
R675 |
T1047 |
T1045 |
pobj |
[,via |
R676 |
T1048 |
T1049 |
nummod |
1,] |
R677 |
T1049 |
T1044 |
advcl |
],die |
R678 |
T1050 |
T1049 |
punct |
",",] |
R679 |
T1051 |
T1053 |
nmod |
[,] |
R68 |
T100 |
T99 |
acl |
involved,genes |
R680 |
T1052 |
T1053 |
nummod |
2,] |
R681 |
T1053 |
T1049 |
appos |
],] |
R682 |
T1054 |
T1044 |
punct |
.,die |
R683 |
T1055 |
T1057 |
nmod |
Macrophage,factor |
R684 |
T1056 |
T1057 |
amod |
colony-stimulating,factor |
R685 |
T1057 |
T1061 |
nsubj |
factor,stimulates |
R686 |
T1058 |
T1059 |
punct |
(,M-CSF |
R687 |
T1059 |
T1057 |
appos |
M-CSF,factor |
R688 |
T1060 |
T1057 |
punct |
),factor |
R689 |
T1061 |
T1061 |
ROOT |
stimulates,stimulates |
R69 |
T101 |
T100 |
prep |
in,involved |
R690 |
T1062 |
T1064 |
amod |
mononuclear,survival |
R691 |
T1063 |
T1064 |
amod |
phagocyte,survival |
R692 |
T1064 |
T1069 |
nmod |
survival,] |
R693 |
T1065 |
T1064 |
cc |
and,survival |
R694 |
T1066 |
T1067 |
compound |
differentiation,[ |
R695 |
T1067 |
T1064 |
conj |
[,survival |
R696 |
T1068 |
T1069 |
nummod |
3,] |
R697 |
T1069 |
T1061 |
dobj |
],stimulates |
R698 |
T1070 |
T1061 |
punct |
.,stimulates |
R699 |
T1071 |
T1079 |
advmod |
Importantly,associated |
R70 |
T102 |
T105 |
amod |
M-CSF-induced,survival |
R700 |
T1072 |
T1079 |
punct |
",",associated |
R701 |
T1073 |
T1075 |
amod |
M-CSF-mediated,survival |
R702 |
T1074 |
T1075 |
compound |
cell,survival |
R703 |
T1075 |
T1079 |
nsubjpass |
survival,associated |
R704 |
T1076 |
T1075 |
cc |
and,survival |
R705 |
T1077 |
T1075 |
conj |
activation,survival |
R706 |
T1078 |
T1079 |
auxpass |
is,associated |
R707 |
T1079 |
T1079 |
ROOT |
associated,associated |
R7074 |
T9427 |
T9428 |
compound |
M-CSF-dependent,PKC |
R7075 |
T9428 |
T9429 |
nsubj |
PKC,Regulates |
R7076 |
T9429 |
T9429 |
ROOT |
Regulates,Regulates |
R7077 |
T9430 |
T9431 |
compound |
NF-κB-targeted,Genes |
R7078 |
T9431 |
T9432 |
compound |
Genes,NF-κB |
R7079 |
T9432 |
T9433 |
nsubj |
NF-κB,induces |
R708 |
T1080 |
T1079 |
prep |
with,associated |
R7080 |
T9433 |
T9429 |
ccomp |
induces,Regulates |
R7081 |
T9434 |
T9435 |
det |
a,number |
R7082 |
T9435 |
T9433 |
dobj |
number,induces |
R7083 |
T9436 |
T9435 |
prep |
of,number |
R7084 |
T9437 |
T9438 |
amod |
downstream,genes |
R7085 |
T9438 |
T9436 |
pobj |
genes,of |
R7086 |
T9439 |
T9438 |
punct |
",",genes |
R7087 |
T9440 |
T9438 |
prep |
including,genes |
R7088 |
T9441 |
T9443 |
det |
the,family |
R7089 |
T9442 |
T9443 |
compound |
IκB,family |
R709 |
T1081 |
T1082 |
det |
a,variety |
R7090 |
T9443 |
T9440 |
pobj |
family,including |
R7091 |
T9444 |
T9429 |
punct |
.,Regulates |
R7092 |
T9445 |
T9453 |
prep |
Among,induced |
R7093 |
T9446 |
T9448 |
det |
the,molecules |
R7094 |
T9447 |
T9448 |
compound |
IκB,molecules |
R7095 |
T9448 |
T9445 |
pobj |
molecules,Among |
R7096 |
T9449 |
T9453 |
punct |
",",induced |
R7097 |
T9450 |
T9453 |
nsubjpass |
IκBα,induced |
R7098 |
T9451 |
T9453 |
auxpass |
is,induced |
R7099 |
T9452 |
T9453 |
advmod |
highly,induced |
R71 |
T103 |
T105 |
compound |
mononuclear,survival |
R710 |
T1082 |
T1080 |
pobj |
variety,with |
R7100 |
T9453 |
T9453 |
ROOT |
induced,induced |
R7101 |
T9454 |
T9453 |
agent |
by,induced |
R7102 |
T9455 |
T9456 |
amod |
NF-κB,activation |
R7103 |
T9456 |
T9459 |
nmod |
activation,] |
R7104 |
T9457 |
T9459 |
nmod |
[,] |
R7105 |
T9458 |
T9459 |
nummod |
40,] |
R7106 |
T9459 |
T9454 |
pobj |
],by |
R7107 |
T9460 |
T9453 |
punct |
.,induced |
R7108 |
T9461 |
T9462 |
aux |
Having,shown |
R7109 |
T9462 |
T9474 |
advcl |
shown,determined |
R711 |
T1083 |
T1082 |
prep |
of,variety |
R7110 |
T9463 |
T9465 |
mark |
that,regulated |
R7111 |
T9464 |
T9465 |
nsubj |
PKC,regulated |
R7112 |
T9465 |
T9462 |
ccomp |
regulated,shown |
R7113 |
T9466 |
T9467 |
amod |
NF-κB,activity |
R7114 |
T9467 |
T9465 |
dobj |
activity,regulated |
R7115 |
T9468 |
T9465 |
prep |
in,regulated |
R7116 |
T9469 |
T9470 |
amod |
M-CSF-stimulated,MDMs |
R7117 |
T9470 |
T9468 |
pobj |
MDMs,in |
R7118 |
T9471 |
T9474 |
punct |
",",determined |
R7119 |
T9472 |
T9474 |
nsubj |
we,determined |
R712 |
T1084 |
T1085 |
amod |
human,diseases |
R7120 |
T9473 |
T9474 |
advmod |
next,determined |
R7121 |
T9474 |
T9474 |
ROOT |
determined,determined |
R7122 |
T9475 |
T9480 |
mark |
whether,decreased |
R7123 |
T9476 |
T9480 |
nsubj |
inhibition,decreased |
R7124 |
T9477 |
T9476 |
prep |
of,inhibition |
R7125 |
T9478 |
T9479 |
compound |
PKC,activity |
R7126 |
T9479 |
T9477 |
pobj |
activity,of |
R7127 |
T9480 |
T9474 |
ccomp |
decreased,determined |
R7128 |
T9481 |
T9480 |
dobj |
expression,decreased |
R7129 |
T9482 |
T9481 |
prep |
of,expression |
R713 |
T1085 |
T1083 |
pobj |
diseases,of |
R7130 |
T9483 |
T9484 |
amod |
NF-κB-regulated,genes |
R7131 |
T9484 |
T9482 |
pobj |
genes,of |
R7132 |
T9485 |
T9474 |
punct |
.,determined |
R7133 |
T9486 |
T9487 |
nsubj |
We,treated |
R7134 |
T9487 |
T9487 |
ROOT |
treated,treated |
R7135 |
T9488 |
T9489 |
det |
both,MDMs |
R7136 |
T9489 |
T9487 |
dobj |
MDMs,treated |
R7137 |
T9490 |
T9489 |
cc |
and,MDMs |
R7138 |
T9491 |
T9489 |
conj |
RAW,MDMs |
R7139 |
T9492 |
T9493 |
nummod |
264.7,cells |
R714 |
T1086 |
T1085 |
punct |
",",diseases |
R7140 |
T9493 |
T9489 |
conj |
cells,MDMs |
R7141 |
T9494 |
T9493 |
prep |
with,cells |
R7142 |
T9495 |
T9498 |
det |
the,Ro-31-8220 |
R7143 |
T9496 |
T9498 |
compound |
PKC,Ro-31-8220 |
R7144 |
T9497 |
T9498 |
compound |
inhibitor,Ro-31-8220 |
R7145 |
T9498 |
T9494 |
pobj |
Ro-31-8220,with |
R7146 |
T9499 |
T9487 |
prep |
for,treated |
R7147 |
T9500 |
T9501 |
nummod |
30,minutes |
R7148 |
T9501 |
T9499 |
pobj |
minutes,for |
R7149 |
T9502 |
T9487 |
cc |
and,treated |
R715 |
T1087 |
T1085 |
prep |
including,diseases |
R7150 |
T9503 |
T9504 |
advmod |
then,stimulated |
R7151 |
T9504 |
T9487 |
conj |
stimulated,treated |
R7152 |
T9505 |
T9504 |
prep |
with,stimulated |
R7153 |
T9506 |
T9505 |
pobj |
M-CSF,with |
R7154 |
T9507 |
T9487 |
punct |
.,treated |
R7155 |
T9508 |
T9509 |
compound |
IκBα,gene |
R7156 |
T9509 |
T9511 |
nsubjpass |
gene,measured |
R7157 |
T9510 |
T9511 |
auxpass |
was,measured |
R7158 |
T9511 |
T9511 |
ROOT |
measured,measured |
R7159 |
T9512 |
T9511 |
agent |
by,measured |
R716 |
T1088 |
T1087 |
pobj |
atherosclerosis,including |
R7160 |
T9513 |
T9512 |
pobj |
qRT-PCR,by |
R7161 |
T9514 |
T9511 |
punct |
.,measured |
R7162 |
T9515 |
T9516 |
mark |
As,shown |
R7163 |
T9516 |
T9524 |
advcl |
shown,enhanced |
R7164 |
T9517 |
T9516 |
prep |
in,shown |
R7165 |
T9518 |
T9519 |
compound |
Figures,6A |
R7166 |
T9519 |
T9517 |
pobj |
6A,in |
R7167 |
T9520 |
T9519 |
cc |
and,6A |
R7168 |
T9521 |
T9519 |
conj |
6B,6A |
R7169 |
T9522 |
T9521 |
punct |
",",6B |
R717 |
T1089 |
T1088 |
punct |
",",atherosclerosis |
R7170 |
T9523 |
T9524 |
nsubj |
M-CSF,enhanced |
R7171 |
T9524 |
T9524 |
ROOT |
enhanced,enhanced |
R7172 |
T9525 |
T9527 |
compound |
IκBα,expression |
R7173 |
T9526 |
T9527 |
compound |
gene,expression |
R7174 |
T9527 |
T9524 |
dobj |
expression,enhanced |
R7175 |
T9528 |
T9527 |
cc |
and,expression |
R7176 |
T9529 |
T9530 |
compound |
PKC,inhibition |
R7177 |
T9530 |
T9527 |
conj |
inhibition,expression |
R7178 |
T9531 |
T9527 |
prep |
by,expression |
R7179 |
T9532 |
T9531 |
pobj |
Ro-31-8220,by |
R718 |
T1090 |
T1092 |
nmod |
transplant,sclerosis |
R7180 |
T9533 |
T9536 |
amod |
decreased,expression |
R7181 |
T9534 |
T9536 |
compound |
IκBα,expression |
R7182 |
T9535 |
T9536 |
compound |
gene,expression |
R7183 |
T9536 |
T9527 |
conj |
expression,expression |
R7184 |
T9537 |
T9524 |
prep |
in,enhanced |
R7185 |
T9538 |
T9539 |
preconj |
both,MDMs |
R7186 |
T9539 |
T9537 |
pobj |
MDMs,in |
R7187 |
T9540 |
T9539 |
cc |
and,MDMs |
R7188 |
T9541 |
T9539 |
conj |
RAW,MDMs |
R7189 |
T9542 |
T9543 |
nummod |
264.7,cells |
R719 |
T1091 |
T1092 |
amod |
vascular,sclerosis |
R7190 |
T9543 |
T9539 |
conj |
cells,MDMs |
R7191 |
T9544 |
T9543 |
punct |
(,cells |
R7192 |
T9545 |
T9543 |
conj |
p,cells |
R7193 |
T9546 |
T9547 |
nmod |
<,0.01 |
R7194 |
T9547 |
T9545 |
npadvmod |
0.01,p |
R7195 |
T9548 |
T9545 |
punct |
),p |
R7196 |
T9549 |
T9524 |
punct |
",",enhanced |
R7197 |
T9550 |
T9524 |
advcl |
demonstrating,enhanced |
R7198 |
T9551 |
T9553 |
mark |
that,affected |
R7199 |
T9552 |
T9553 |
nsubj |
PKC,affected |
R72 |
T104 |
T105 |
compound |
phagocyte,survival |
R720 |
T1092 |
T1088 |
conj |
sclerosis,atherosclerosis |
R7200 |
T9553 |
T9550 |
ccomp |
affected,demonstrating |
R7201 |
T9554 |
T9556 |
amod |
NF-κB-regulated,expression |
R7202 |
T9555 |
T9556 |
compound |
gene,expression |
R7203 |
T9556 |
T9553 |
dobj |
expression,affected |
R7204 |
T9557 |
T9553 |
prep |
in,affected |
R7205 |
T9558 |
T9557 |
pobj |
macrophages,in |
R7206 |
T9559 |
T9524 |
punct |
.,enhanced |
R7207 |
T9560 |
T9562 |
aux |
To,define |
R7208 |
T9561 |
T9562 |
advmod |
further,define |
R7209 |
T9562 |
T9578 |
advcl |
define,examined |
R721 |
T1093 |
T1092 |
cc |
and,sclerosis |
R7210 |
T9563 |
T9564 |
det |
the,role |
R7211 |
T9564 |
T9562 |
dobj |
role,define |
R7212 |
T9565 |
T9564 |
prep |
of,role |
R7213 |
T9566 |
T9565 |
pobj |
PKC,of |
R7214 |
T9567 |
T9564 |
prep |
in,role |
R7215 |
T9568 |
T9567 |
pcomp |
mediating,in |
R7216 |
T9569 |
T9571 |
amod |
human,survival |
R7217 |
T9570 |
T9571 |
compound |
MDM,survival |
R7218 |
T9571 |
T9568 |
dobj |
survival,mediating |
R7219 |
T9572 |
T9568 |
prep |
in,mediating |
R722 |
T1094 |
T1095 |
compound |
breast,cancer |
R7220 |
T9573 |
T9572 |
pobj |
response,in |
R7221 |
T9574 |
T9573 |
prep |
to,response |
R7222 |
T9575 |
T9574 |
pobj |
M-CSF,to |
R7223 |
T9576 |
T9578 |
punct |
",",examined |
R7224 |
T9577 |
T9578 |
nsubj |
we,examined |
R7225 |
T9578 |
T9578 |
ROOT |
examined,examined |
R7226 |
T9579 |
T9580 |
det |
the,expression |
R7227 |
T9580 |
T9578 |
dobj |
expression,examined |
R7228 |
T9581 |
T9580 |
prep |
of,expression |
R7229 |
T9582 |
T9584 |
det |
the,gene |
R723 |
T1095 |
T1096 |
compound |
cancer,metastasis |
R7230 |
T9583 |
T9584 |
compound |
anti-apoptotic,gene |
R7231 |
T9584 |
T9581 |
pobj |
gene,of |
R7232 |
T9585 |
T9584 |
appos |
BCL-xL,gene |
R7233 |
T9586 |
T9584 |
punct |
",",gene |
R7234 |
T9587 |
T9590 |
nsubjpass |
which,regulated |
R7235 |
T9588 |
T9590 |
auxpass |
is,regulated |
R7236 |
T9589 |
T9590 |
advmod |
also,regulated |
R7237 |
T9590 |
T9584 |
relcl |
regulated,gene |
R7238 |
T9591 |
T9590 |
agent |
by,regulated |
R7239 |
T9592 |
T9591 |
pobj |
NF-κB,by |
R724 |
T1096 |
T1092 |
conj |
metastasis,sclerosis |
R7240 |
T9593 |
T9578 |
punct |
.,examined |
R7241 |
T9594 |
T9595 |
mark |
As,shown |
R7242 |
T9595 |
T9601 |
advcl |
shown,reduced |
R7243 |
T9596 |
T9595 |
prep |
in,shown |
R7244 |
T9597 |
T9598 |
compound |
Figure,6C |
R7245 |
T9598 |
T9596 |
pobj |
6C,in |
R7246 |
T9599 |
T9601 |
punct |
",",reduced |
R7247 |
T9600 |
T9601 |
nsubj |
Ro-31-8220,reduced |
R7248 |
T9601 |
T9601 |
ROOT |
reduced,reduced |
R7249 |
T9602 |
T9604 |
nmod |
M-CSF-stimulated,expression |
R725 |
T1097 |
T1099 |
nmod |
[,] |
R7250 |
T9603 |
T9604 |
amod |
BCL-xL,expression |
R7251 |
T9604 |
T9601 |
dobj |
expression,reduced |
R7252 |
T9605 |
T9601 |
prep |
compared,reduced |
R7253 |
T9606 |
T9605 |
prep |
to,compared |
R7254 |
T9607 |
T9606 |
pobj |
cells,to |
R7255 |
T9608 |
T9607 |
acl |
treated,cells |
R7256 |
T9609 |
T9608 |
prep |
with,treated |
R7257 |
T9610 |
T9609 |
pobj |
M-CSF,with |
R7258 |
T9611 |
T9610 |
cc |
and,M-CSF |
R7259 |
T9612 |
T9614 |
det |
the,control |
R726 |
T1098 |
T1099 |
nummod |
4,] |
R7260 |
T9613 |
T9614 |
compound |
vehicle,control |
R7261 |
T9614 |
T9610 |
conj |
control,M-CSF |
R7262 |
T9615 |
T9614 |
appos |
DMSO,control |
R7263 |
T9616 |
T9618 |
punct |
(,< |
R7264 |
T9617 |
T9618 |
compound |
p,< |
R7265 |
T9618 |
T9619 |
compound |
<,0.05 |
R7266 |
T9619 |
T9614 |
appos |
0.05,control |
R7267 |
T9620 |
T9614 |
punct |
),control |
R7268 |
T9621 |
T9601 |
punct |
.,reduced |
R727 |
T1099 |
T1088 |
conj |
],atherosclerosis |
R728 |
T1100 |
T1099 |
punct |
",",] |
R729 |
T1101 |
T1103 |
nmod |
[,] |
R73 |
T105 |
T101 |
pobj |
survival,in |
R730 |
T1102 |
T1103 |
nummod |
5,] |
R731 |
T1103 |
T1099 |
conj |
],] |
R732 |
T1104 |
T1103 |
punct |
",",] |
R733 |
T1105 |
T1107 |
nmod |
[,] |
R734 |
T1106 |
T1107 |
nummod |
6,] |
R735 |
T1107 |
T1103 |
conj |
],] |
R736 |
T1108 |
T1079 |
punct |
.,associated |
R737 |
T1109 |
T1111 |
nsubj |
We,identified |
R738 |
T1110 |
T1111 |
advmod |
previously,identified |
R739 |
T1111 |
T1111 |
ROOT |
identified,identified |
R74 |
T106 |
T94 |
cc |
and,is |
R740 |
T1112 |
T1115 |
mark |
that,is |
R741 |
T1113 |
T1114 |
amod |
NF-κB,activation |
R742 |
T1114 |
T1115 |
nsubj |
activation,is |
R743 |
T1115 |
T1111 |
ccomp |
is,identified |
R744 |
T1116 |
T1115 |
acomp |
important,is |
R745 |
T1117 |
T1116 |
prep |
in,important |
R746 |
T1118 |
T1120 |
amod |
M-CSF-induced,survival |
R747 |
T1119 |
T1120 |
compound |
monocyte,survival |
R748 |
T1120 |
T1117 |
pobj |
survival,in |
R749 |
T1121 |
T1123 |
nmod |
[,] |
R75 |
T107 |
T108 |
det |
this,study |
R750 |
T1122 |
T1123 |
nummod |
7,] |
R751 |
T1123 |
T1115 |
npadvmod |
],is |
R752 |
T1124 |
T1111 |
punct |
.,identified |
R753 |
T1125 |
T1139 |
prep |
In,regulates |
R754 |
T1126 |
T1125 |
pobj |
addition,In |
R755 |
T1127 |
T1126 |
prep |
to,addition |
R756 |
T1128 |
T1129 |
poss |
its,role |
R757 |
T1129 |
T1127 |
pobj |
role,to |
R758 |
T1130 |
T1129 |
prep |
in,role |
R759 |
T1131 |
T1133 |
nmod |
mononuclear,survival |
R76 |
T108 |
T109 |
nsubj |
study,focused |
R760 |
T1132 |
T1133 |
amod |
phagocyte,survival |
R761 |
T1133 |
T1130 |
pobj |
survival,in |
R762 |
T1134 |
T1129 |
punct |
",",role |
R7626 |
T10239 |
T10276 |
nsubj |
Identification,suggested |
R7627 |
T10240 |
T10239 |
prep |
of,Identification |
R7628 |
T10241 |
T10240 |
pobj |
PKCα,of |
R7629 |
T10242 |
T10239 |
prep |
as,Identification |
R763 |
T1135 |
T1137 |
det |
the,factor |
R7630 |
T10243 |
T10245 |
det |
the,Activator |
R7631 |
T10244 |
T10245 |
compound |
Upstream,Activator |
R7632 |
T10245 |
T10242 |
pobj |
Activator,as |
R7633 |
T10246 |
T10245 |
prep |
of,Activator |
R7634 |
T10247 |
T10246 |
pobj |
NF-κB,of |
R7635 |
T10248 |
T10245 |
prep |
in,Activator |
R7636 |
T10249 |
T10250 |
compound |
Myeloid,Cells |
R7637 |
T10250 |
T10248 |
pobj |
Cells,in |
R7638 |
T10251 |
T10256 |
advmod |
Even,consists |
R7639 |
T10252 |
T10256 |
mark |
though,consists |
R764 |
T1136 |
T1137 |
compound |
transcription,factor |
R7640 |
T10253 |
T10255 |
det |
the,family |
R7641 |
T10254 |
T10255 |
compound |
PKC,family |
R7642 |
T10255 |
T10256 |
nsubj |
family,consists |
R7643 |
T10256 |
T10276 |
advcl |
consists,suggested |
R7644 |
T10257 |
T10256 |
prep |
of,consists |
R7645 |
T10258 |
T10259 |
nummod |
10,members |
R7646 |
T10259 |
T10257 |
pobj |
members,of |
R7647 |
T10260 |
T10256 |
punct |
",",consists |
R7648 |
T10261 |
T10256 |
advcl |
finding,consists |
R7649 |
T10262 |
T10265 |
mark |
that,β |
R765 |
T1137 |
T1139 |
nsubj |
factor,regulates |
R7650 |
T10263 |
T10265 |
nsubj |
PKCα,β |
R7651 |
T10264 |
T10265 |
compound |
/,β |
R7652 |
T10265 |
T10261 |
ccomp |
β,finding |
R7653 |
T10266 |
T10265 |
dobj |
inhibitors,β |
R7654 |
T10267 |
T10266 |
cc |
and,inhibitors |
R7655 |
T10268 |
T10270 |
amod |
intracellular,inhibitors |
R7656 |
T10269 |
T10270 |
compound |
calcium,inhibitors |
R7657 |
T10270 |
T10266 |
conj |
inhibitors,inhibitors |
R7658 |
T10271 |
T10265 |
conj |
reduced,β |
R7659 |
T10272 |
T10274 |
amod |
M-CSF-induced,activity |
R766 |
T1138 |
T1139 |
nsubj |
NF-κB,regulates |
R7660 |
T10273 |
T10274 |
compound |
NF-κB,activity |
R7661 |
T10274 |
T10271 |
dobj |
activity,reduced |
R7662 |
T10275 |
T10276 |
punct |
",",suggested |
R7663 |
T10276 |
T10276 |
ROOT |
suggested,suggested |
R7664 |
T10277 |
T10279 |
nsubjpass |
PKCα,involved |
R7665 |
T10278 |
T10279 |
auxpass |
was,involved |
R7666 |
T10279 |
T10276 |
ccomp |
involved,suggested |
R7667 |
T10280 |
T10279 |
prep |
in,involved |
R7668 |
T10281 |
T10282 |
amod |
NF-κB,activation |
R7669 |
T10282 |
T10280 |
pobj |
activation,in |
R767 |
T1139 |
T1139 |
ROOT |
regulates,regulates |
R7670 |
T10283 |
T10282 |
prep |
after,activation |
R7671 |
T10284 |
T10285 |
compound |
M-CSF,treatment |
R7672 |
T10285 |
T10283 |
pobj |
treatment,after |
R7673 |
T10286 |
T10276 |
punct |
.,suggested |
R7674 |
T10287 |
T10288 |
aux |
To,confirm |
R7675 |
T10288 |
T10316 |
advcl |
confirm,co-transfected |
R7676 |
T10289 |
T10290 |
det |
the,role |
R7677 |
T10290 |
T10288 |
dobj |
role,confirm |
R7678 |
T10291 |
T10290 |
prep |
of,role |
R7679 |
T10292 |
T10291 |
pobj |
PKCα,of |
R768 |
T1140 |
T1141 |
amod |
numerous,genes |
R7680 |
T10293 |
T10292 |
prep |
in,PKCα |
R7681 |
T10294 |
T10295 |
compound |
NF-κB,activation |
R7682 |
T10295 |
T10293 |
pobj |
activation,in |
R7683 |
T10296 |
T10295 |
prep |
in,activation |
R7684 |
T10297 |
T10296 |
pobj |
macrophages,in |
R7685 |
T10298 |
T10290 |
punct |
",",role |
R7686 |
T10299 |
T10290 |
conj |
constructs,role |
R7687 |
T10300 |
T10290 |
prep |
for,role |
R7688 |
T10301 |
T10302 |
det |
either,wildtype |
R7689 |
T10302 |
T10300 |
pobj |
wildtype,for |
R769 |
T1141 |
T1139 |
dobj |
genes,regulates |
R7690 |
T10303 |
T10302 |
punct |
(,wildtype |
R7691 |
T10304 |
T10302 |
appos |
WT,wildtype |
R7692 |
T10305 |
T10304 |
punct |
),WT |
R7693 |
T10306 |
T10302 |
punct |
-,wildtype |
R7694 |
T10307 |
T10302 |
conj |
PKCα,wildtype |
R7695 |
T10308 |
T10307 |
cc |
or,PKCα |
R7696 |
T10309 |
T10307 |
conj |
kinase-deficient,PKCα |
R7697 |
T10310 |
T10311 |
punct |
(,KD |
R7698 |
T10311 |
T10302 |
appos |
KD,wildtype |
R7699 |
T10312 |
T10311 |
punct |
),KD |
R77 |
T109 |
T94 |
conj |
focused,is |
R770 |
T1142 |
T1143 |
nsubj |
that,play |
R7700 |
T10313 |
T10314 |
punct |
-,PKCα |
R7701 |
T10314 |
T10315 |
nsubj |
PKCα,was |
R7702 |
T10315 |
T10316 |
auxpass |
was,co-transfected |
R7703 |
T10316 |
T10316 |
ROOT |
co-transfected,co-transfected |
R7704 |
T10317 |
T10316 |
prep |
with,co-transfected |
R7705 |
T10318 |
T10321 |
det |
the,gene |
R7706 |
T10319 |
T10321 |
amod |
pNF-κB-SEAP,gene |
R7707 |
T10320 |
T10321 |
compound |
reporter,gene |
R7708 |
T10321 |
T10317 |
pobj |
gene,with |
R7709 |
T10322 |
T10321 |
cc |
and,gene |
R771 |
T1143 |
T1141 |
relcl |
play,genes |
R7710 |
T10323 |
T10324 |
compound |
SEAP,secretion |
R7711 |
T10324 |
T10321 |
conj |
secretion,gene |
R7712 |
T10325 |
T10326 |
auxpass |
was,measured |
R7713 |
T10326 |
T10316 |
conj |
measured,co-transfected |
R7714 |
T10327 |
T10316 |
punct |
.,co-transfected |
R7715 |
T10328 |
T10329 |
mark |
As,shown |
R7716 |
T10329 |
T10335 |
advcl |
shown,co-transfected |
R7717 |
T10330 |
T10329 |
prep |
in,shown |
R7718 |
T10331 |
T10332 |
compound |
Figure,7A |
R7719 |
T10332 |
T10330 |
pobj |
7A,in |
R772 |
T1144 |
T1145 |
amod |
important,roles |
R7720 |
T10333 |
T10335 |
punct |
",",co-transfected |
R7721 |
T10334 |
T10335 |
nsubj |
MDMs,co-transfected |
R7722 |
T10335 |
T10335 |
ROOT |
co-transfected,co-transfected |
R7723 |
T10336 |
T10335 |
prep |
with,co-transfected |
R7724 |
T10337 |
T10336 |
pobj |
pNF-κB-SEAP,with |
R7725 |
T10338 |
T10337 |
cc |
and,pNF-κB-SEAP |
R7726 |
T10339 |
T10337 |
conj |
WT-PKCα,pNF-κB-SEAP |
R7727 |
T10340 |
T10335 |
conj |
had,co-transfected |
R7728 |
T10341 |
T10343 |
det |
a,increase |
R7729 |
T10342 |
T10343 |
amod |
1.8-fold,increase |
R773 |
T1145 |
T1143 |
dobj |
roles,play |
R7730 |
T10343 |
T10340 |
dobj |
increase,had |
R7731 |
T10344 |
T10343 |
prep |
in,increase |
R7732 |
T10345 |
T10347 |
amod |
NF-κB,activity |
R7733 |
T10346 |
T10347 |
amod |
transcriptional,activity |
R7734 |
T10347 |
T10344 |
pobj |
activity,in |
R7735 |
T10348 |
T10343 |
prep |
after,increase |
R7736 |
T10349 |
T10350 |
compound |
M-CSF,activation |
R7737 |
T10350 |
T10348 |
pobj |
activation,after |
R7738 |
T10351 |
T10343 |
prep |
compared,increase |
R7739 |
T10352 |
T10351 |
prep |
with,compared |
R774 |
T1146 |
T1143 |
prep |
in,play |
R7740 |
T10353 |
T10354 |
compound |
NS,cells |
R7741 |
T10354 |
T10352 |
pobj |
cells,with |
R7742 |
T10355 |
T10354 |
punct |
(,cells |
R7743 |
T10356 |
T10354 |
appos |
p,cells |
R7744 |
T10357 |
T10358 |
punct |
=,0.05 |
R7745 |
T10358 |
T10356 |
prep |
0.05,p |
R7746 |
T10359 |
T10354 |
punct |
),cells |
R7747 |
T10360 |
T10354 |
punct |
",",cells |
R7748 |
T10361 |
T10354 |
amod |
similar,cells |
R7749 |
T10362 |
T10361 |
prep |
to,similar |
R775 |
T1147 |
T1148 |
amod |
cellular,signaling |
R7750 |
T10363 |
T10364 |
amod |
M-CSF-treated,cells |
R7751 |
T10364 |
T10362 |
pobj |
cells,to |
R7752 |
T10365 |
T10364 |
acl |
expressing,cells |
R7753 |
T10366 |
T10367 |
advmod |
only,pNF-κB-SEAP |
R7754 |
T10367 |
T10365 |
dobj |
pNF-κB-SEAP,expressing |
R7755 |
T10368 |
T10335 |
punct |
.,co-transfected |
R7756 |
T10369 |
T10369 |
ROOT |
Transfecting,Transfecting |
R7757 |
T10370 |
T10371 |
amod |
human,macrophages |
R7758 |
T10371 |
T10369 |
dobj |
macrophages,Transfecting |
R7759 |
T10372 |
T10369 |
prep |
with,Transfecting |
R776 |
T1148 |
T1146 |
pobj |
signaling,in |
R7760 |
T10373 |
T10374 |
det |
the,KD-PKCα |
R7761 |
T10374 |
T10372 |
pobj |
KD-PKCα,with |
R7762 |
T10375 |
T10369 |
nsubj |
construct,Transfecting |
R7763 |
T10376 |
T10377 |
advmod |
significantly,reduced |
R7764 |
T10377 |
T10380 |
amod |
reduced,activity |
R7765 |
T10378 |
T10380 |
amod |
M-CSF-induced,activity |
R7766 |
T10379 |
T10380 |
compound |
NF-κB,activity |
R7767 |
T10380 |
T10375 |
dobj |
activity,construct |
R7768 |
T10381 |
T10375 |
prep |
compared,construct |
R7769 |
T10382 |
T10381 |
prep |
to,compared |
R777 |
T1149 |
T1148 |
punct |
",",signaling |
R7770 |
T10383 |
T10385 |
amod |
WT-PKCα,cells |
R7771 |
T10384 |
T10385 |
amod |
transfected,cells |
R7772 |
T10385 |
T10382 |
pobj |
cells,to |
R7773 |
T10386 |
T10385 |
punct |
(,cells |
R7774 |
T10387 |
T10385 |
appos |
p,cells |
R7775 |
T10388 |
T10389 |
punct |
=,0.016 |
R7776 |
T10389 |
T10387 |
pobj |
0.016,p |
R7777 |
T10390 |
T10385 |
punct |
),cells |
R7778 |
T10391 |
T10369 |
punct |
.,Transfecting |
R7779 |
T10392 |
T10397 |
advmod |
Similarly,transfected |
R778 |
T1150 |
T1151 |
compound |
stress,response |
R7780 |
T10393 |
T10397 |
punct |
",",transfected |
R7781 |
T10394 |
T10397 |
nsubj |
RAW,transfected |
R7782 |
T10395 |
T10396 |
nummod |
264.7,cells |
R7783 |
T10396 |
T10397 |
compound |
cells,transfected |
R7784 |
T10397 |
T10397 |
ROOT |
transfected,transfected |
R7785 |
T10398 |
T10397 |
prep |
with,transfected |
R7786 |
T10399 |
T10398 |
pobj |
WT-PKCα,with |
R7787 |
T10400 |
T10397 |
conj |
had,transfected |
R7788 |
T10401 |
T10405 |
nummod |
2.5-fold,activity |
R7789 |
T10402 |
T10401 |
amod |
more,2.5-fold |
R779 |
T1151 |
T1148 |
conj |
response,signaling |
R7790 |
T10403 |
T10405 |
amod |
NF-κB,activity |
R7791 |
T10404 |
T10405 |
compound |
transcriptional,activity |
R7792 |
T10405 |
T10400 |
dobj |
activity,had |
R7793 |
T10406 |
T10400 |
prep |
after,had |
R7794 |
T10407 |
T10408 |
compound |
M-CSF,activation |
R7795 |
T10408 |
T10406 |
pobj |
activation,after |
R7796 |
T10409 |
T10400 |
prep |
compared,had |
R7797 |
T10410 |
T10409 |
prep |
to,compared |
R7798 |
T10411 |
T10412 |
compound |
unstimulated,RAW |
R7799 |
T10412 |
T10410 |
pobj |
RAW,to |
R78 |
T110 |
T109 |
prep |
at,focused |
R780 |
T1152 |
T1151 |
punct |
",",response |
R7800 |
T10413 |
T10414 |
nummod |
264.7,cells |
R7801 |
T10414 |
T10412 |
dobj |
cells,RAW |
R7802 |
T10415 |
T10416 |
punct |
(,NS |
R7803 |
T10416 |
T10414 |
appos |
NS,cells |
R7804 |
T10417 |
T10400 |
punct |
),had |
R7805 |
T10418 |
T10418 |
ROOT |
transfected,transfected |
R7806 |
T10419 |
T10418 |
prep |
with,transfected |
R7807 |
T10420 |
T10419 |
pobj |
WT-PKCα,with |
R7808 |
T10421 |
T10423 |
punct |
(,7B |
R7809 |
T10422 |
T10423 |
compound |
Figure,7B |
R781 |
T1153 |
T1154 |
compound |
cell,growth |
R7810 |
T10423 |
T10420 |
appos |
7B,WT-PKCα |
R7811 |
T10424 |
T10423 |
punct |
),7B |
R7812 |
T10425 |
T10418 |
punct |
.,transfected |
R7813 |
T10426 |
T10430 |
nsubj |
Expression,construct |
R7814 |
T10427 |
T10426 |
prep |
of,Expression |
R7815 |
T10428 |
T10429 |
det |
the,KD-PKCα |
R7816 |
T10429 |
T10427 |
pobj |
KD-PKCα,of |
R7817 |
T10430 |
T10430 |
ROOT |
construct,construct |
R7818 |
T10431 |
T10430 |
prep |
into,construct |
R7819 |
T10432 |
T10431 |
pobj |
RAW,into |
R782 |
T1154 |
T1151 |
conj |
growth,response |
R7820 |
T10433 |
T10434 |
nummod |
264.7,cells |
R7821 |
T10434 |
T10446 |
nsubj |
cells,compared |
R7822 |
T10435 |
T10434 |
acl |
reduced,cells |
R7823 |
T10436 |
T10438 |
amod |
M-CSF-induced,activity |
R7824 |
T10437 |
T10438 |
compound |
NF-κB,activity |
R7825 |
T10438 |
T10435 |
dobj |
activity,reduced |
R7826 |
T10439 |
T10435 |
prep |
to,reduced |
R7827 |
T10440 |
T10439 |
pobj |
1.5-fold,to |
R7828 |
T10441 |
T10440 |
punct |
(,1.5-fold |
R7829 |
T10442 |
T10440 |
appos |
p,1.5-fold |
R783 |
T1155 |
T1154 |
punct |
",",growth |
R7830 |
T10443 |
T10444 |
punct |
=,0.045 |
R7831 |
T10444 |
T10442 |
nummod |
0.045,p |
R7832 |
T10445 |
T10440 |
punct |
),1.5-fold |
R7833 |
T10446 |
T10430 |
prep |
compared,construct |
R7834 |
T10447 |
T10446 |
prep |
to,compared |
R7835 |
T10448 |
T10447 |
pobj |
cells,to |
R7836 |
T10449 |
T10448 |
acl |
transfected,cells |
R7837 |
T10450 |
T10449 |
prep |
with,transfected |
R7838 |
T10451 |
T10452 |
compound |
WT,PKCα |
R7839 |
T10452 |
T10450 |
pobj |
PKCα,with |
R784 |
T1156 |
T1154 |
conj |
survival,growth |
R7840 |
T10453 |
T10430 |
punct |
.,construct |
R7841 |
T10454 |
T10455 |
compound |
Cell,survival |
R7842 |
T10455 |
T10458 |
nsubjpass |
survival,examined |
R7843 |
T10456 |
T10458 |
auxpass |
was,examined |
R7844 |
T10457 |
T10458 |
advmod |
also,examined |
R7845 |
T10458 |
T10458 |
ROOT |
examined,examined |
R7846 |
T10459 |
T10458 |
prep |
in,examined |
R7847 |
T10460 |
T10459 |
pobj |
MDMs,in |
R7848 |
T10461 |
T10460 |
acl |
expressing,MDMs |
R7849 |
T10462 |
T10463 |
preconj |
either,WT-PKCα |
R785 |
T1157 |
T1156 |
punct |
",",survival |
R7850 |
T10463 |
T10461 |
dobj |
WT-PKCα,expressing |
R7851 |
T10464 |
T10463 |
cc |
or,WT-PKCα |
R7852 |
T10465 |
T10463 |
conj |
KD-PKCα,WT-PKCα |
R7853 |
T10466 |
T10463 |
conj |
constructs,WT-PKCα |
R7854 |
T10467 |
T10461 |
prep |
by,expressing |
R7855 |
T10468 |
T10469 |
compound |
Annexin,V-FITC |
R7856 |
T10469 |
T10467 |
pobj |
V-FITC,by |
R7857 |
T10470 |
T10469 |
cc |
and,V-FITC |
R7858 |
T10471 |
T10469 |
conj |
PI,V-FITC |
R7859 |
T10472 |
T10458 |
advcl |
staining,examined |
R786 |
T1158 |
T1156 |
conj |
differentiation,survival |
R7860 |
T10473 |
T10458 |
punct |
.,examined |
R7861 |
T10474 |
T10475 |
mark |
As,expected |
R7862 |
T10475 |
T10478 |
advcl |
expected,increased |
R7863 |
T10476 |
T10478 |
punct |
",",increased |
R7864 |
T10477 |
T10478 |
nsubj |
M-CSF,increased |
R7865 |
T10478 |
T10478 |
ROOT |
increased,increased |
R7866 |
T10479 |
T10480 |
compound |
MDM,survival |
R7867 |
T10480 |
T10478 |
dobj |
survival,increased |
R7868 |
T10481 |
T10482 |
mark |
as,measured |
R7869 |
T10482 |
T10478 |
advcl |
measured,increased |
R787 |
T1159 |
T1158 |
cc |
and,differentiation |
R7870 |
T10483 |
T10482 |
agent |
by,measured |
R7871 |
T10484 |
T10485 |
det |
the,percent |
R7872 |
T10485 |
T10483 |
pobj |
percent,by |
R7873 |
T10486 |
T10485 |
prep |
of,percent |
R7874 |
T10487 |
T10488 |
compound |
Annexin,V/PI |
R7875 |
T10488 |
T10490 |
nmod |
V/PI,cells |
R7876 |
T10489 |
T10490 |
amod |
negative,cells |
R7877 |
T10490 |
T10486 |
pobj |
cells,of |
R7878 |
T10491 |
T10478 |
punct |
.,increased |
R7879 |
T10492 |
T10494 |
advmod |
Similarly,expression |
R788 |
T1160 |
T1158 |
conj |
inflammation,differentiation |
R7880 |
T10493 |
T10494 |
punct |
",",expression |
R7881 |
T10494 |
T10494 |
ROOT |
expression,expression |
R7882 |
T10495 |
T10494 |
prep |
of,expression |
R7883 |
T10496 |
T10498 |
amod |
WT-PKCα,cells |
R7884 |
T10497 |
T10498 |
amod |
protected,cells |
R7885 |
T10498 |
T10495 |
pobj |
cells,of |
R7886 |
T10499 |
T10498 |
prep |
from,cells |
R7887 |
T10500 |
T10499 |
pobj |
apoptosis,from |
R7888 |
T10501 |
T10494 |
punct |
.,expression |
R7889 |
T10502 |
T10508 |
prep |
In,decreased |
R789 |
T1161 |
T1158 |
conj |
[,differentiation |
R7890 |
T10503 |
T10502 |
pobj |
contrast,In |
R7891 |
T10504 |
T10508 |
punct |
",",decreased |
R7892 |
T10505 |
T10508 |
nsubj |
expression,decreased |
R7893 |
T10506 |
T10505 |
prep |
of,expression |
R7894 |
T10507 |
T10506 |
pobj |
KD-PKCα,of |
R7895 |
T10508 |
T10508 |
ROOT |
decreased,decreased |
R7896 |
T10509 |
T10511 |
amod |
M-CSF-induced,survival |
R7897 |
T10510 |
T10511 |
compound |
cell,survival |
R7898 |
T10511 |
T10508 |
dobj |
survival,decreased |
R7899 |
T10512 |
T10511 |
punct |
(,survival |
R79 |
T111 |
T110 |
pcomp |
identifying,at |
R790 |
T1162 |
T1163 |
nummod |
8,] |
R7900 |
T10513 |
T10514 |
advmod |
p,< |
R7901 |
T10514 |
T10515 |
nmod |
<,0.01 |
R7902 |
T10515 |
T10511 |
appos |
0.01,survival |
R7903 |
T10516 |
T10511 |
punct |
),survival |
R7904 |
T10517 |
T10519 |
punct |
(,7C |
R7905 |
T10518 |
T10519 |
compound |
Figure,7C |
R7906 |
T10519 |
T10511 |
appos |
7C,survival |
R7907 |
T10520 |
T10508 |
punct |
),decreased |
R7908 |
T10521 |
T10508 |
punct |
.,decreased |
R7909 |
T10522 |
T10525 |
advmod |
Next,examined |
R791 |
T1163 |
T1139 |
npadvmod |
],regulates |
R7910 |
T10523 |
T10525 |
punct |
",",examined |
R7911 |
T10524 |
T10525 |
nsubj |
we,examined |
R7912 |
T10525 |
T10525 |
ROOT |
examined,examined |
R7913 |
T10526 |
T10527 |
det |
the,effect |
R7914 |
T10527 |
T10525 |
dobj |
effect,examined |
R7915 |
T10528 |
T10527 |
prep |
of,effect |
R7916 |
T10529 |
T10528 |
pcomp |
expressing,of |
R7917 |
T10530 |
T10532 |
det |
the,constructs |
R7918 |
T10531 |
T10532 |
nsubj |
PKCα,constructs |
R7919 |
T10532 |
T10529 |
dobj |
constructs,expressing |
R792 |
T1164 |
T1139 |
punct |
.,regulates |
R7920 |
T10533 |
T10532 |
prep |
on,constructs |
R7921 |
T10534 |
T10535 |
amod |
NF-κB,phosphorylation |
R7922 |
T10535 |
T10533 |
pobj |
phosphorylation,on |
R7923 |
T10536 |
T10525 |
punct |
.,examined |
R7924 |
T10537 |
T10538 |
mark |
As,shown |
R7925 |
T10538 |
T10552 |
advcl |
shown,affect |
R7926 |
T10539 |
T10538 |
prep |
in,shown |
R7927 |
T10540 |
T10539 |
pobj |
Figure,in |
R7928 |
T10541 |
T10540 |
nummod |
7D,Figure |
R7929 |
T10542 |
T10540 |
punct |
",",Figure |
R793 |
T1165 |
T1166 |
expl |
There,are |
R7930 |
T10543 |
T10538 |
dobj |
expression,shown |
R7931 |
T10544 |
T10543 |
prep |
of,expression |
R7932 |
T10545 |
T10544 |
pobj |
KD-PKCα,of |
R7933 |
T10546 |
T10545 |
prep |
in,KD-PKCα |
R7934 |
T10547 |
T10546 |
pobj |
RAW,in |
R7935 |
T10548 |
T10549 |
nummod |
264.7,cells |
R7936 |
T10549 |
T10544 |
pobj |
cells,of |
R7937 |
T10550 |
T10552 |
aux |
did,affect |
R7938 |
T10551 |
T10552 |
neg |
not,affect |
R7939 |
T10552 |
T10552 |
ROOT |
affect,affect |
R794 |
T1166 |
T1166 |
ROOT |
are,are |
R7940 |
T10553 |
T10555 |
det |
the,phosphorylation |
R7941 |
T10554 |
T10555 |
amod |
constitutive,phosphorylation |
R7942 |
T10555 |
T10552 |
dobj |
phosphorylation,affect |
R7943 |
T10556 |
T10555 |
prep |
at,phosphorylation |
R7944 |
T10557 |
T10556 |
pobj |
Ser536,at |
R7945 |
T10558 |
T10557 |
prep |
of,Ser536 |
R7946 |
T10559 |
T10558 |
pobj |
NF-κB,of |
R7947 |
T10560 |
T10559 |
nummod |
p65,NF-κB |
R7948 |
T10561 |
T10552 |
punct |
",",affect |
R7949 |
T10562 |
T10552 |
cc |
but,affect |
R795 |
T1167 |
T1168 |
nummod |
five,members |
R7950 |
T10563 |
T10552 |
conj |
attenuated,affect |
R7951 |
T10564 |
T10565 |
det |
the,phosphorylation |
R7952 |
T10565 |
T10563 |
dobj |
phosphorylation,attenuated |
R7953 |
T10566 |
T10563 |
prep |
at,attenuated |
R7954 |
T10567 |
T10566 |
pobj |
Ser276,at |
R7955 |
T10568 |
T10552 |
punct |
.,affect |
R7956 |
T10569 |
T10574 |
nsubj |
Expression,effect |
R7957 |
T10570 |
T10569 |
prep |
of,Expression |
R7958 |
T10571 |
T10570 |
pobj |
WT-PKCα,of |
R7959 |
T10572 |
T10574 |
aux |
did,effect |
R796 |
T1168 |
T1166 |
attr |
members,are |
R7960 |
T10573 |
T10574 |
neg |
not,effect |
R7961 |
T10574 |
T10574 |
ROOT |
effect,effect |
R7962 |
T10575 |
T10576 |
det |
the,phosphorylation |
R7963 |
T10576 |
T10574 |
dobj |
phosphorylation,effect |
R7964 |
T10577 |
T10576 |
prep |
of,phosphorylation |
R7965 |
T10578 |
T10579 |
det |
either,residue |
R7966 |
T10579 |
T10577 |
pobj |
residue,of |
R7967 |
T10580 |
T10576 |
prep |
with,phosphorylation |
R7968 |
T10581 |
T10580 |
cc |
or,with |
R7969 |
T10582 |
T10580 |
conj |
without,with |
R797 |
T1169 |
T1168 |
prep |
in,members |
R7970 |
T10583 |
T10584 |
compound |
M-CSF,stimulation |
R7971 |
T10584 |
T10582 |
pobj |
stimulation,without |
R7972 |
T10585 |
T10574 |
punct |
.,effect |
R7973 |
T10586 |
T10587 |
det |
These,observations |
R7974 |
T10587 |
T10588 |
nsubj |
observations,demonstrate |
R7975 |
T10588 |
T10588 |
ROOT |
demonstrate,demonstrate |
R7976 |
T10589 |
T10591 |
mark |
that,is |
R7977 |
T10590 |
T10591 |
nsubj |
PKCα,is |
R7978 |
T10591 |
T10588 |
ccomp |
is,demonstrate |
R7979 |
T10592 |
T10591 |
acomp |
important,is |
R798 |
T1170 |
T1172 |
det |
the,family |
R7980 |
T10593 |
T10592 |
prep |
in,important |
R7981 |
T10594 |
T10596 |
amod |
M-CSF-regulated,survival |
R7982 |
T10595 |
T10596 |
compound |
cell,survival |
R7983 |
T10596 |
T10593 |
pobj |
survival,in |
R7984 |
T10597 |
T10596 |
cc |
and,survival |
R7985 |
T10598 |
T10599 |
amod |
NF-κB,activation |
R7986 |
T10599 |
T10596 |
conj |
activation,survival |
R7987 |
T10600 |
T10599 |
cc |
and,activation |
R7988 |
T10601 |
T10602 |
advmod |
likely,regulated |
R7989 |
T10602 |
T10591 |
conj |
regulated,is |
R799 |
T1171 |
T1172 |
compound |
NF-κB,family |
R7990 |
T10603 |
T10602 |
prep |
through,regulated |
R7991 |
T10604 |
T10603 |
pobj |
phosphorylation,through |
R7992 |
T10605 |
T10604 |
prep |
of,phosphorylation |
R7993 |
T10606 |
T10605 |
pobj |
Ser276,of |
R7994 |
T10607 |
T10606 |
prep |
of,Ser276 |
R7995 |
T10608 |
T10609 |
compound |
NF-κB,p65 |
R7996 |
T10609 |
T10607 |
pobj |
p65,of |
R7997 |
T10610 |
T10588 |
punct |
.,demonstrate |
R7998 |
T10611 |
T10613 |
aux |
To,validate |
R7999 |
T10612 |
T10613 |
advmod |
further,validate |
R80 |
T112 |
T113 |
det |
the,mechanism |
R800 |
T1172 |
T1169 |
pobj |
family,in |
R8000 |
T10613 |
T10627 |
advcl |
validate,employed |
R8001 |
T10614 |
T10615 |
det |
the,impact |
R8002 |
T10615 |
T10613 |
dobj |
impact,validate |
R8003 |
T10616 |
T10618 |
dobj |
that,played |
R8004 |
T10617 |
T10618 |
nsubj |
PKCα,played |
R8005 |
T10618 |
T10615 |
relcl |
played,impact |
R8006 |
T10619 |
T10618 |
prep |
in,played |
R8007 |
T10620 |
T10623 |
amod |
M-CSF-induced,activity |
R8008 |
T10621 |
T10623 |
nmod |
NF-κB,activity |
R8009 |
T10622 |
T10623 |
compound |
transcriptional,activity |
R801 |
T1173 |
T1168 |
punct |
:,members |
R8010 |
T10623 |
T10619 |
pobj |
activity,in |
R8011 |
T10624 |
T10627 |
punct |
",",employed |
R8012 |
T10625 |
T10627 |
nsubj |
we,employed |
R8013 |
T10626 |
T10627 |
advmod |
next,employed |
R8014 |
T10627 |
T10627 |
ROOT |
employed,employed |
R8015 |
T10628 |
T10629 |
compound |
PKCα,siRNA |
R8016 |
T10629 |
T10630 |
compound |
siRNA,treatment |
R8017 |
T10630 |
T10627 |
dobj |
treatment,employed |
R8018 |
T10631 |
T10630 |
prep |
of,treatment |
R8019 |
T10632 |
T10635 |
nmod |
MDM,cells |
R802 |
T1174 |
T1168 |
appos |
RelA/p65,members |
R8020 |
T10633 |
T10632 |
cc |
or,MDM |
R8021 |
T10634 |
T10632 |
conj |
RAW,MDM |
R8022 |
T10635 |
T10631 |
pobj |
cells,of |
R8023 |
T10636 |
T10627 |
punct |
.,employed |
R8024 |
T10637 |
T10638 |
det |
A,pool |
R8025 |
T10638 |
T10644 |
nsubjpass |
pool,transfected |
R8026 |
T10639 |
T10638 |
prep |
of,pool |
R8027 |
T10640 |
T10642 |
amod |
specific,siRNA |
R8028 |
T10641 |
T10642 |
compound |
PKCα,siRNA |
R8029 |
T10642 |
T10639 |
pobj |
siRNA,of |
R803 |
T1175 |
T1174 |
punct |
",",RelA/p65 |
R8030 |
T10643 |
T10644 |
auxpass |
were,transfected |
R8031 |
T10644 |
T10644 |
ROOT |
transfected,transfected |
R8032 |
T10645 |
T10644 |
prep |
into,transfected |
R8033 |
T10646 |
T10645 |
pobj |
MDM,into |
R8034 |
T10647 |
T10646 |
cc |
or,MDM |
R8035 |
T10648 |
T10646 |
conj |
Raw,MDM |
R8036 |
T10649 |
T10650 |
nummod |
264.7,cells |
R8037 |
T10650 |
T10644 |
conj |
cells,transfected |
R8038 |
T10651 |
T10650 |
prep |
in,cells |
R8039 |
T10652 |
T10653 |
det |
the,presence |
R804 |
T1176 |
T1174 |
appos |
p50,RelA/p65 |
R8040 |
T10653 |
T10651 |
pobj |
presence,in |
R8041 |
T10654 |
T10653 |
cc |
or,presence |
R8042 |
T10655 |
T10653 |
conj |
absence,presence |
R8043 |
T10656 |
T10655 |
cc |
or,absence |
R8044 |
T10657 |
T10655 |
conj |
M-CSF,absence |
R8045 |
T10658 |
T10644 |
punct |
.,transfected |
R8046 |
T10659 |
T10663 |
advcl |
Reducing,decreased |
R8047 |
T10660 |
T10662 |
amod |
native,expression |
R8048 |
T10661 |
T10662 |
compound |
PKCα,expression |
R8049 |
T10662 |
T10659 |
dobj |
expression,Reducing |
R805 |
T1177 |
T1176 |
punct |
",",p50 |
R8050 |
T10663 |
T10663 |
ROOT |
decreased,decreased |
R8051 |
T10664 |
T10667 |
amod |
M-CSF-induced,activity |
R8052 |
T10665 |
T10667 |
nmod |
NF-κB,activity |
R8053 |
T10666 |
T10667 |
compound |
transcriptional,activity |
R8054 |
T10667 |
T10663 |
dobj |
activity,decreased |
R8055 |
T10668 |
T10663 |
prep |
in,decreased |
R8056 |
T10669 |
T10673 |
det |
both,7E |
R8057 |
T10670 |
T10673 |
compound |
MDM,7E |
R8058 |
T10671 |
T10672 |
punct |
(,Figure |
R8059 |
T10672 |
T10673 |
compound |
Figure,7E |
R806 |
T1178 |
T1176 |
appos |
p52,p50 |
R8060 |
T10673 |
T10668 |
pobj |
7E,in |
R8061 |
T10674 |
T10663 |
punct |
),decreased |
R8062 |
T10675 |
T10676 |
punct |
(,p |
R8063 |
T10676 |
T10676 |
ROOT |
p,p |
R8064 |
T10677 |
T10678 |
punct |
=,0.012 |
R8065 |
T10678 |
T10676 |
prep |
0.012,p |
R8066 |
T10679 |
T10676 |
punct |
),p |
R8067 |
T10680 |
T10676 |
cc |
and,p |
R8068 |
T10681 |
T10683 |
nmod |
Raw,cells |
R8069 |
T10682 |
T10683 |
nummod |
264.7,cells |
R807 |
T1179 |
T1176 |
punct |
",",p50 |
R8070 |
T10683 |
T10689 |
nmod |
cells,p |
R8071 |
T10684 |
T10685 |
punct |
(,Figure |
R8072 |
T10685 |
T10683 |
appos |
Figure,cells |
R8073 |
T10686 |
T10685 |
nummod |
7F,Figure |
R8074 |
T10687 |
T10683 |
punct |
),cells |
R8075 |
T10688 |
T10683 |
punct |
(,cells |
R8076 |
T10689 |
T10676 |
conj |
p,p |
R8077 |
T10690 |
T10691 |
punct |
=,0.01 |
R8078 |
T10691 |
T10689 |
prep |
0.01,p |
R8079 |
T10692 |
T10689 |
punct |
),p |
R808 |
T1180 |
T1176 |
conj |
c-Rel,p50 |
R8080 |
T10693 |
T10663 |
punct |
.,decreased |
R8081 |
T10694 |
T10696 |
nsubj |
We,examined |
R8082 |
T10695 |
T10696 |
advmod |
also,examined |
R8083 |
T10696 |
T10696 |
ROOT |
examined,examined |
R8084 |
T10697 |
T10698 |
compound |
cell,survival |
R8085 |
T10698 |
T10696 |
dobj |
survival,examined |
R8086 |
T10699 |
T10698 |
prep |
of,survival |
R8087 |
T10700 |
T10701 |
det |
the,MDMs |
R8088 |
T10701 |
T10699 |
pobj |
MDMs,of |
R8089 |
T10702 |
T10696 |
prep |
by,examined |
R809 |
T1181 |
T1180 |
cc |
and,c-Rel |
R8090 |
T10703 |
T10704 |
compound |
Annexin,V-FITC |
R8091 |
T10704 |
T10702 |
pobj |
V-FITC,by |
R8092 |
T10705 |
T10704 |
cc |
and,V-FITC |
R8093 |
T10706 |
T10704 |
conj |
PI,V-FITC |
R8094 |
T10707 |
T10696 |
advcl |
staining,examined |
R8095 |
T10708 |
T10707 |
advmod |
after,staining |
R8096 |
T10709 |
T10711 |
compound |
PKCα,transfection |
R8097 |
T10710 |
T10711 |
compound |
siRNA,transfection |
R8098 |
T10711 |
T10708 |
pobj |
transfection,after |
R8099 |
T10712 |
T10696 |
punct |
.,examined |
R81 |
T113 |
T111 |
dobj |
mechanism,identifying |
R810 |
T1182 |
T1180 |
conj |
RelB,c-Rel |
R8100 |
T10713 |
T10714 |
mark |
As,shown |
R8101 |
T10714 |
T10714 |
ROOT |
shown,shown |
R8102 |
T10715 |
T10714 |
prep |
in,shown |
R8103 |
T10716 |
T10721 |
nmod |
Figure,survival |
R8104 |
T10717 |
T10716 |
nummod |
7G,Figure |
R8105 |
T10718 |
T10716 |
punct |
",",Figure |
R8106 |
T10719 |
T10721 |
amod |
M-CSF-induced,survival |
R8107 |
T10720 |
T10721 |
compound |
MDM,survival |
R8108 |
T10721 |
T10715 |
pobj |
survival,in |
R8109 |
T10722 |
T10723 |
auxpass |
was,reduced |
R811 |
T1183 |
T1166 |
punct |
.,are |
R8110 |
T10723 |
T10714 |
conj |
reduced,shown |
R8111 |
T10724 |
T10723 |
prep |
in,reduced |
R8112 |
T10725 |
T10726 |
det |
the,cells |
R8113 |
T10726 |
T10724 |
pobj |
cells,in |
R8114 |
T10727 |
T10723 |
conj |
transfected,reduced |
R8115 |
T10728 |
T10727 |
prep |
with,transfected |
R8116 |
T10729 |
T10730 |
compound |
PKCα,siRNA |
R8117 |
T10730 |
T10728 |
pobj |
siRNA,with |
R8118 |
T10731 |
T10727 |
prep |
compared,transfected |
R8119 |
T10732 |
T10731 |
prep |
with,compared |
R812 |
T1184 |
T1188 |
det |
The,complex |
R8120 |
T10733 |
T10732 |
pobj |
cells,with |
R8121 |
T10734 |
T10733 |
acl |
transfected,cells |
R8122 |
T10735 |
T10734 |
prep |
with,transfected |
R8123 |
T10736 |
T10737 |
compound |
control,siRNA |
R8124 |
T10737 |
T10735 |
pobj |
siRNA,with |
R8125 |
T10738 |
T10737 |
punct |
(,siRNA |
R8126 |
T10739 |
T10737 |
parataxis |
p,siRNA |
R8127 |
T10740 |
T10741 |
punct |
=,0.047 |
R8128 |
T10741 |
T10739 |
prep |
0.047,p |
R8129 |
T10742 |
T10737 |
punct |
),siRNA |
R813 |
T1185 |
T1186 |
advmod |
most,common |
R8130 |
T10743 |
T10714 |
punct |
.,shown |
R8131 |
T10744 |
T10749 |
prep |
In,confirmed |
R8132 |
T10745 |
T10744 |
pobj |
Figure,In |
R8133 |
T10746 |
T10745 |
nummod |
7H,Figure |
R8134 |
T10747 |
T10749 |
punct |
",",confirmed |
R8135 |
T10748 |
T10749 |
nsubj |
we,confirmed |
R8136 |
T10749 |
T10749 |
ROOT |
confirmed,confirmed |
R8137 |
T10750 |
T10754 |
mark |
that,decreased |
R8138 |
T10751 |
T10753 |
compound |
PKCα,transfection |
R8139 |
T10752 |
T10753 |
compound |
siRNA,transfection |
R814 |
T1186 |
T1188 |
amod |
common,complex |
R8140 |
T10753 |
T10754 |
nsubj |
transfection,decreased |
R8141 |
T10754 |
T10749 |
ccomp |
decreased,confirmed |
R8142 |
T10755 |
T10757 |
compound |
PKCα,expression |
R8143 |
T10756 |
T10757 |
compound |
protein,expression |
R8144 |
T10757 |
T10754 |
dobj |
expression,decreased |
R8145 |
T10758 |
T10754 |
prep |
in,decreased |
R8146 |
T10759 |
T10760 |
det |
both,MDM |
R8147 |
T10760 |
T10764 |
nmod |
MDM,cells |
R8148 |
T10761 |
T10760 |
cc |
and,MDM |
R8149 |
T10762 |
T10760 |
conj |
Raw,MDM |
R815 |
T1187 |
T1188 |
compound |
activating,complex |
R8150 |
T10763 |
T10764 |
nummod |
264.7,cells |
R8151 |
T10764 |
T10758 |
pobj |
cells,in |
R8152 |
T10765 |
T10749 |
punct |
.,confirmed |
R8153 |
T10766 |
T10767 |
poss |
Our,results |
R8154 |
T10767 |
T10768 |
nsubj |
results,indicated |
R8155 |
T10768 |
T10768 |
ROOT |
indicated,indicated |
R8156 |
T10769 |
T10771 |
mark |
that,regulated |
R8157 |
T10770 |
T10771 |
nsubj |
PKCα,regulated |
R8158 |
T10771 |
T10768 |
ccomp |
regulated,indicated |
R8159 |
T10772 |
T10773 |
compound |
NF-κB,activation |
R816 |
T1188 |
T1189 |
nsubj |
complex,is |
R8160 |
T10773 |
T10771 |
dobj |
activation,regulated |
R8161 |
T10774 |
T10773 |
cc |
and,activation |
R8162 |
T10775 |
T10777 |
amod |
M-CSF-regulated,survival |
R8163 |
T10776 |
T10777 |
compound |
cell,survival |
R8164 |
T10777 |
T10773 |
conj |
survival,activation |
R8165 |
T10778 |
T10768 |
punct |
.,indicated |
R817 |
T1189 |
T1189 |
ROOT |
is,is |
R818 |
T1190 |
T1192 |
det |
the,heterodimer |
R819 |
T1191 |
T1192 |
nummod |
p50/p65,heterodimer |
R82 |
T114 |
T113 |
prep |
of,mechanism |
R820 |
T1192 |
T1189 |
attr |
heterodimer,is |
R821 |
T1193 |
T1192 |
punct |
",",heterodimer |
R822 |
T1194 |
T1192 |
acl |
driven,heterodimer |
R823 |
T1195 |
T1194 |
agent |
by,driven |
R824 |
T1196 |
T1198 |
det |
the,domain |
R825 |
T1197 |
T1198 |
compound |
activation,domain |
R826 |
T1198 |
T1195 |
pobj |
domain,by |
R827 |
T1199 |
T1198 |
prep |
in,domain |
R828 |
T1200 |
T1203 |
det |
the,subunit |
R829 |
T1201 |
T1203 |
nmod |
NF-κB,subunit |
R83 |
T115 |
T117 |
amod |
NF-κB,activation |
R830 |
T1202 |
T1203 |
nummod |
p65,subunit |
R831 |
T1203 |
T1199 |
pobj |
subunit,in |
R832 |
T1204 |
T1189 |
punct |
.,is |
R833 |
T1205 |
T1207 |
nsubj |
NF-κB,regulates |
R834 |
T1206 |
T1205 |
nummod |
p65,NF-κB |
R835 |
T1207 |
T1207 |
ROOT |
regulates,regulates |
R836 |
T1208 |
T1210 |
amod |
important,processes |
R837 |
T1209 |
T1210 |
amod |
developmental,processes |
R838 |
T1210 |
T1207 |
dobj |
processes,regulates |
R839 |
T1211 |
T1213 |
nmod |
[,] |
R84 |
T116 |
T117 |
amod |
transcriptional,activation |
R840 |
T1212 |
T1213 |
nummod |
9,] |
R841 |
T1213 |
T1217 |
nmod |
],] |
R842 |
T1214 |
T1213 |
punct |
",",] |
R843 |
T1215 |
T1217 |
nmod |
[,] |
R844 |
T1216 |
T1217 |
nummod |
10,] |
R845 |
T1217 |
T1207 |
npadvmod |
],regulates |
R846 |
T1218 |
T1207 |
punct |
.,regulates |
R847 |
T1219 |
T1219 |
ROOT |
Mice,Mice |
R848 |
T1220 |
T1219 |
acl |
lacking,Mice |
R849 |
T1221 |
T1223 |
nsubj |
NF-κB,die |
R85 |
T117 |
T114 |
pobj |
activation,of |
R850 |
T1222 |
T1223 |
nummod |
p65,die |
R851 |
T1223 |
T1220 |
dep |
die,lacking |
R852 |
T1224 |
T1223 |
prep |
in,die |
R853 |
T1225 |
T1224 |
pobj |
utero,in |
R854 |
T1226 |
T1223 |
cc |
and,die |
R855 |
T1227 |
T1223 |
conj |
have,die |
R856 |
T1228 |
T1230 |
amod |
extensive,damage |
R857 |
T1229 |
T1230 |
compound |
liver,damage |
R858 |
T1230 |
T1227 |
dobj |
damage,have |
R859 |
T1231 |
T1230 |
prep |
via,damage |
R86 |
T118 |
T109 |
punct |
.,focused |
R860 |
T1232 |
T1234 |
amod |
enhanced,[ |
R861 |
T1233 |
T1234 |
compound |
apoptosis,[ |
R862 |
T1234 |
T1231 |
pobj |
[,via |
R863 |
T1235 |
T1236 |
nummod |
9,] |
R864 |
T1236 |
T1230 |
appos |
],damage |
R865 |
T1237 |
T1220 |
punct |
.,lacking |
R866 |
T1238 |
T1239 |
amod |
Embryonic,macrophages |
R867 |
T1239 |
T1245 |
nsubj |
macrophages,are |
R868 |
T1240 |
T1239 |
prep |
from,macrophages |
R869 |
T1241 |
T1244 |
nmod |
NF-κB,mice |
R87 |
T119 |
T122 |
advmod |
Here,demonstrate |
R870 |
T1242 |
T1241 |
nummod |
p65,NF-κB |
R871 |
T1243 |
T1244 |
amod |
null,mice |
R872 |
T1244 |
T1240 |
pobj |
mice,from |
R873 |
T1245 |
T1245 |
ROOT |
are,are |
R874 |
T1246 |
T1245 |
acomp |
susceptible,are |
R875 |
T1247 |
T1246 |
prep |
to,susceptible |
R876 |
T1248 |
T1249 |
amod |
TNFα-induced,apoptosis |
R877 |
T1249 |
T1247 |
pobj |
apoptosis,to |
R878 |
T1250 |
T1252 |
nsubjpass |
which,rescued |
R879 |
T1251 |
T1252 |
auxpass |
is,rescued |
R88 |
T120 |
T122 |
punct |
",",demonstrate |
R880 |
T1252 |
T1249 |
relcl |
rescued,apoptosis |
R881 |
T1253 |
T1252 |
agent |
by,rescued |
R882 |
T1254 |
T1253 |
pcomp |
overexpressing,by |
R883 |
T1255 |
T1259 |
det |
the,[ |
R884 |
T1256 |
T1259 |
nmod |
NF-κB,[ |
R885 |
T1257 |
T1256 |
nummod |
p65,NF-κB |
R886 |
T1258 |
T1259 |
amod |
subunit,[ |
R887 |
T1259 |
T1254 |
dobj |
[,overexpressing |
R888 |
T1260 |
T1261 |
nummod |
10,] |
R889 |
T1261 |
T1254 |
dobj |
],overexpressing |
R89 |
T121 |
T122 |
nsubj |
we,demonstrate |
R890 |
T1262 |
T1245 |
punct |
.,are |
R891 |
T1263 |
T1267 |
advmod |
Moreover,induces |
R892 |
T1264 |
T1267 |
punct |
",",induces |
R893 |
T1265 |
T1267 |
csubj |
inhibiting,induces |
R894 |
T1266 |
T1267 |
nsubj |
NF-κB,induces |
R895 |
T1267 |
T1267 |
ROOT |
induces,induces |
R896 |
T1268 |
T1269 |
compound |
cell,death |
R897 |
T1269 |
T1267 |
dobj |
death,induces |
R898 |
T1270 |
T1267 |
prep |
in,induces |
R899 |
T1271 |
T1273 |
amod |
many,types |
R90 |
T122 |
T122 |
ROOT |
demonstrate,demonstrate |
R900 |
T1272 |
T1273 |
compound |
cell,types |
R901 |
T1273 |
T1270 |
pobj |
types,in |
R902 |
T1274 |
T1273 |
cc |
and,types |
R903 |
T1275 |
T1276 |
amod |
cytokine-independent,survival |
R904 |
T1276 |
T1273 |
conj |
survival,types |
R905 |
T1277 |
T1278 |
auxpass |
is,mediated |
R906 |
T1278 |
T1267 |
conj |
mediated,induces |
R907 |
T1279 |
T1278 |
agent |
by,mediated |
R908 |
T1280 |
T1281 |
advmod |
constitutively,active |
R909 |
T1281 |
T1282 |
amod |
active,NF-κB |
R9098 |
T12350 |
T12351 |
nsubj |
PKC,is |
R9099 |
T12351 |
T12351 |
ROOT |
is,is |
R91 |
T123 |
T125 |
mark |
that,stimulated |
R910 |
T1282 |
T1279 |
pobj |
NF-κB,by |
R9100 |
T12352 |
T12351 |
acomp |
Essential,is |
R9101 |
T12353 |
T12352 |
prep |
in,Essential |
R9102 |
T12354 |
T12353 |
pcomp |
Regulating,in |
R9103 |
T12355 |
T12356 |
compound |
NF-κB,Activity |
R9104 |
T12356 |
T12359 |
compound |
Activity,activity |
R9105 |
T12357 |
T12359 |
compound |
M-CSF-dependent,activity |
R9106 |
T12358 |
T12359 |
compound |
PKC,activity |
R9107 |
T12359 |
T12354 |
dobj |
activity,Regulating |
R9108 |
T12360 |
T12351 |
ccomp |
facilitated,is |
R9109 |
T12361 |
T12363 |
nsubj |
NF-κB,phosphorylation |
R911 |
T1283 |
T1282 |
prep |
in,NF-κB |
R9110 |
T12362 |
T12363 |
nummod |
p65,phosphorylation |
R9111 |
T12363 |
T12360 |
dobj |
phosphorylation,facilitated |
R9112 |
T12364 |
T12363 |
prep |
at,phosphorylation |
R9113 |
T12365 |
T12364 |
pobj |
Ser276,at |
R9114 |
T12366 |
T12364 |
cc |
but,at |
R9115 |
T12367 |
T12366 |
neg |
not,but |
R9116 |
T12368 |
T12363 |
appos |
Ser536,phosphorylation |
R9117 |
T12369 |
T12351 |
punct |
.,is |
R9118 |
T12370 |
T12371 |
aux |
To,confirm |
R9119 |
T12371 |
T12385 |
advcl |
confirm,co-transfected |
R912 |
T1284 |
T1285 |
compound |
murine,macrophages |
R9120 |
T12372 |
T12373 |
det |
the,role |
R9121 |
T12373 |
T12371 |
dobj |
role,confirm |
R9122 |
T12374 |
T12373 |
prep |
of,role |
R9123 |
T12375 |
T12374 |
pobj |
PKC,of |
R9124 |
T12376 |
T12373 |
cc |
and,role |
R9125 |
T12377 |
T12379 |
nummod |
p65,phosphorylation |
R9126 |
T12378 |
T12379 |
compound |
Ser276,phosphorylation |
R9127 |
T12379 |
T12373 |
conj |
phosphorylation,role |
R9128 |
T12380 |
T12379 |
prep |
on,phosphorylation |
R9129 |
T12381 |
T12382 |
amod |
NF-κB,activity |
R913 |
T1285 |
T1283 |
pobj |
macrophages,in |
R9130 |
T12382 |
T12380 |
pobj |
activity,on |
R9131 |
T12383 |
T12385 |
punct |
",",co-transfected |
R9132 |
T12384 |
T12385 |
nsubj |
we,co-transfected |
R9133 |
T12385 |
T12385 |
ROOT |
co-transfected,co-transfected |
R9134 |
T12386 |
T12387 |
det |
the,NF-κB-SEAP |
R9135 |
T12387 |
T12388 |
nsubj |
NF-κB-SEAP,construct |
R9136 |
T12388 |
T12385 |
ccomp |
construct,co-transfected |
R9137 |
T12389 |
T12388 |
prep |
with,construct |
R9138 |
T12390 |
T12393 |
det |
either,p65 |
R9139 |
T12391 |
T12392 |
compound |
WT,NF-κB |
R914 |
T1286 |
T1288 |
quantmod |
[,] |
R9140 |
T12392 |
T12393 |
compound |
NF-κB,p65 |
R9141 |
T12393 |
T12389 |
pobj |
p65,with |
R9142 |
T12394 |
T12393 |
cc |
or,p65 |
R9143 |
T12395 |
T12397 |
compound |
NF-κB,276S/A |
R9144 |
T12396 |
T12397 |
compound |
p65,276S/A |
R9145 |
T12397 |
T12398 |
nsubj |
276S/A,constructs |
R9146 |
T12398 |
T12393 |
conj |
constructs,p65 |
R9147 |
T12399 |
T12398 |
prep |
in,constructs |
R9148 |
T12400 |
T12399 |
pobj |
Raw,in |
R9149 |
T12401 |
T12402 |
nummod |
264.7,cells |
R915 |
T1287 |
T1288 |
nummod |
11,] |
R9150 |
T12402 |
T12398 |
conj |
cells,constructs |
R9151 |
T12403 |
T12405 |
punct |
",",treated |
R9152 |
T12404 |
T12405 |
advmod |
then,treated |
R9153 |
T12405 |
T12385 |
dep |
treated,co-transfected |
R9154 |
T12406 |
T12405 |
dobj |
cells,treated |
R9155 |
T12407 |
T12405 |
prep |
with,treated |
R9156 |
T12408 |
T12411 |
det |
the,Ro-31-8220 |
R9157 |
T12409 |
T12411 |
compound |
PKC,Ro-31-8220 |
R9158 |
T12410 |
T12411 |
compound |
inhibitor,Ro-31-8220 |
R9159 |
T12411 |
T12407 |
pobj |
Ro-31-8220,with |
R916 |
T1288 |
T1282 |
appos |
],NF-κB |
R9160 |
T12412 |
T12411 |
prep |
in,Ro-31-8220 |
R9161 |
T12413 |
T12414 |
det |
the,absence |
R9162 |
T12414 |
T12412 |
pobj |
absence,in |
R9163 |
T12415 |
T12411 |
cc |
or,Ro-31-8220 |
R9164 |
T12416 |
T12411 |
conj |
presences,Ro-31-8220 |
R9165 |
T12417 |
T12416 |
prep |
of,presences |
R9166 |
T12418 |
T12417 |
pobj |
M-CSF,of |
R9167 |
T12419 |
T12385 |
punct |
.,co-transfected |
R9168 |
T12420 |
T12421 |
mark |
As,expected |
R9169 |
T12421 |
T12424 |
advcl |
expected,transfected |
R917 |
T1289 |
T1267 |
punct |
.,induces |
R9170 |
T12422 |
T12421 |
prep |
in,expected |
R9171 |
T12423 |
T12422 |
pobj |
cells,in |
R9172 |
T12424 |
T12424 |
ROOT |
transfected,transfected |
R9173 |
T12425 |
T12424 |
prep |
with,transfected |
R9174 |
T12426 |
T12427 |
compound |
vector,control |
R9175 |
T12427 |
T12425 |
pobj |
control,with |
R9176 |
T12428 |
T12424 |
punct |
",",transfected |
R9177 |
T12429 |
T12424 |
advcl |
inhibiting,transfected |
R9178 |
T12430 |
T12431 |
nsubj |
PKC,reduced |
R9179 |
T12431 |
T12431 |
ROOT |
reduced,reduced |
R918 |
T1290 |
T1296 |
prep |
In,is |
R9180 |
T12432 |
T12434 |
amod |
M-CSF-stimulated,activity |
R9181 |
T12433 |
T12434 |
compound |
NF-κB,activity |
R9182 |
T12434 |
T12431 |
dobj |
activity,reduced |
R9183 |
T12435 |
T12431 |
prep |
compared,reduced |
R9184 |
T12436 |
T12435 |
prep |
to,compared |
R9185 |
T12437 |
T12436 |
pobj |
cells,to |
R9186 |
T12438 |
T12437 |
acl |
treated,cells |
R9187 |
T12439 |
T12438 |
prep |
with,treated |
R9188 |
T12440 |
T12439 |
pobj |
M-CSF,with |
R9189 |
T12441 |
T12440 |
cc |
and,M-CSF |
R919 |
T1291 |
T1290 |
pobj |
monocytes,In |
R9190 |
T12442 |
T12443 |
det |
the,vehicle |
R9191 |
T12443 |
T12440 |
conj |
vehicle,M-CSF |
R9192 |
T12444 |
T12443 |
appos |
DMSO,vehicle |
R9193 |
T12445 |
T12444 |
punct |
(,DMSO |
R9194 |
T12446 |
T12444 |
appos |
p,DMSO |
R9195 |
T12447 |
T12448 |
punct |
=,0.001 |
R9196 |
T12448 |
T12446 |
prep |
0.001,p |
R9197 |
T12449 |
T12444 |
punct |
),DMSO |
R9198 |
T12450 |
T12452 |
punct |
(,8A |
R9199 |
T12451 |
T12452 |
compound |
Figure,8A |
R92 |
T124 |
T125 |
nsubj |
M-CSF,stimulated |
R920 |
T1292 |
T1291 |
cc |
and,monocytes |
R9200 |
T12452 |
T12444 |
appos |
8A,DMSO |
R9201 |
T12453 |
T12452 |
punct |
),8A |
R9202 |
T12454 |
T12431 |
punct |
.,reduced |
R9203 |
T12455 |
T12466 |
prep |
In,increased |
R9204 |
T12456 |
T12455 |
pobj |
contrast,In |
R9205 |
T12457 |
T12466 |
punct |
",",increased |
R9206 |
T12458 |
T12466 |
csubj |
expressing,increased |
R9207 |
T12459 |
T12461 |
compound |
WT,p65 |
R9208 |
T12460 |
T12461 |
compound |
NF-κB,p65 |
R9209 |
T12461 |
T12458 |
dobj |
p65,expressing |
R921 |
T1293 |
T1291 |
conj |
macrophages,monocytes |
R9210 |
T12462 |
T12461 |
punct |
(,p65 |
R9211 |
T12463 |
T12464 |
nummod |
p65,WT |
R9212 |
T12464 |
T12461 |
appos |
WT,p65 |
R9213 |
T12465 |
T12461 |
punct |
),p65 |
R9214 |
T12466 |
T12466 |
ROOT |
increased,increased |
R9215 |
T12467 |
T12468 |
amod |
NF-κB,activity |
R9216 |
T12468 |
T12466 |
dobj |
activity,increased |
R9217 |
T12469 |
T12466 |
punct |
",",increased |
R9218 |
T12470 |
T12476 |
mark |
while,decreased |
R9219 |
T12471 |
T12474 |
det |
the,inhibitor |
R922 |
T1294 |
T1296 |
punct |
",",is |
R9220 |
T12472 |
T12474 |
amod |
general,inhibitor |
R9221 |
T12473 |
T12474 |
compound |
PKC,inhibitor |
R9222 |
T12474 |
T12476 |
nsubj |
inhibitor,decreased |
R9223 |
T12475 |
T12476 |
nsubj |
Ro-31-8220,decreased |
R9224 |
T12476 |
T12466 |
advcl |
decreased,increased |
R9225 |
T12477 |
T12479 |
det |
this,activity |
R9226 |
T12478 |
T12479 |
amod |
NF-κB,activity |
R9227 |
T12479 |
T12476 |
dobj |
activity,decreased |
R9228 |
T12480 |
T12479 |
punct |
(,activity |
R9229 |
T12481 |
T12479 |
appos |
p,activity |
R923 |
T1295 |
T1296 |
nsubj |
NF-κB,is |
R9230 |
T12482 |
T12483 |
punct |
=,0.001 |
R9231 |
T12483 |
T12481 |
pobj |
0.001,p |
R9232 |
T12484 |
T12479 |
punct |
),activity |
R9233 |
T12485 |
T12466 |
punct |
.,increased |
R9234 |
T12486 |
T12497 |
advmod |
Notably,reduced |
R9235 |
T12487 |
T12497 |
punct |
",",reduced |
R9236 |
T12488 |
T12489 |
det |
the,introduction |
R9237 |
T12489 |
T12497 |
nsubj |
introduction,reduced |
R9238 |
T12490 |
T12489 |
prep |
of,introduction |
R9239 |
T12491 |
T12490 |
pobj |
NF-κB,of |
R924 |
T1296 |
T1296 |
ROOT |
is,is |
R9240 |
T12492 |
T12491 |
nummod |
p65,NF-κB |
R9241 |
T12493 |
T12494 |
nummod |
276,S/A |
R9242 |
T12494 |
T12489 |
appos |
S/A,introduction |
R9243 |
T12495 |
T12497 |
aux |
construct,reduced |
R9244 |
T12496 |
T12497 |
advmod |
significantly,reduced |
R9245 |
T12497 |
T12497 |
ROOT |
reduced,reduced |
R9246 |
T12498 |
T12499 |
amod |
NF-κB,activity |
R9247 |
T12499 |
T12497 |
dobj |
activity,reduced |
R9248 |
T12500 |
T12497 |
prep |
compared,reduced |
R9249 |
T12501 |
T12500 |
prep |
with,compared |
R925 |
T1297 |
T1300 |
det |
an,factor |
R9250 |
T12502 |
T12505 |
det |
the,p65 |
R9251 |
T12503 |
T12504 |
compound |
WT,NF-κB |
R9252 |
T12504 |
T12505 |
compound |
NF-κB,p65 |
R9253 |
T12505 |
T12501 |
pobj |
p65,with |
R9254 |
T12506 |
T12497 |
conj |
construct,reduced |
R9255 |
T12507 |
T12506 |
punct |
(,construct |
R9256 |
T12508 |
T12506 |
nmod |
p,construct |
R9257 |
T12509 |
T12510 |
punct |
=,0.005 |
R9258 |
T12510 |
T12508 |
prep |
0.005,p |
R9259 |
T12511 |
T12508 |
punct |
),p |
R926 |
T1298 |
T1300 |
amod |
important,factor |
R9260 |
T12512 |
T12508 |
cc |
and,p |
R9261 |
T12513 |
T12514 |
compound |
M-CSF,treatment |
R9262 |
T12514 |
T12515 |
nsubj |
treatment,was |
R9263 |
T12515 |
T12508 |
conj |
was,p |
R9264 |
T12516 |
T12515 |
acomp |
unable,was |
R9265 |
T12517 |
T12518 |
aux |
to,overcome |
R9266 |
T12518 |
T12516 |
xcomp |
overcome,unable |
R9267 |
T12519 |
T12520 |
det |
this,inhibition |
R9268 |
T12520 |
T12518 |
dobj |
inhibition,overcome |
R9269 |
T12521 |
T12515 |
punct |
.,was |
R927 |
T1299 |
T1300 |
amod |
transcriptional,factor |
R9270 |
T12522 |
T12525 |
advmod |
Furthermore,co-transfected |
R9271 |
T12523 |
T12525 |
punct |
",",co-transfected |
R9272 |
T12524 |
T12525 |
nsubj |
we,co-transfected |
R9273 |
T12525 |
T12525 |
ROOT |
co-transfected,co-transfected |
R9274 |
T12526 |
T12527 |
det |
the,NF-κB-SEAP |
R9275 |
T12527 |
T12528 |
nsubj |
NF-κB-SEAP,construct |
R9276 |
T12528 |
T12525 |
ccomp |
construct,co-transfected |
R9277 |
T12529 |
T12528 |
prep |
along,construct |
R9278 |
T12530 |
T12529 |
prep |
with,along |
R9279 |
T12531 |
T12535 |
preconj |
either,p65 |
R928 |
T1300 |
T1296 |
attr |
factor,is |
R9280 |
T12532 |
T12535 |
det |
the,p65 |
R9281 |
T12533 |
T12534 |
compound |
WT,NF-κB |
R9282 |
T12534 |
T12535 |
compound |
NF-κB,p65 |
R9283 |
T12535 |
T12530 |
pobj |
p65,with |
R9284 |
T12536 |
T12535 |
punct |
",",p65 |
R9285 |
T12537 |
T12539 |
nmod |
NF-κB,276S/A |
R9286 |
T12538 |
T12539 |
nummod |
p65,276S/A |
R9287 |
T12539 |
T12535 |
conj |
276S/A,p65 |
R9288 |
T12540 |
T12539 |
cc |
or,276S/A |
R9289 |
T12541 |
T12539 |
conj |
NF-κB,276S/A |
R929 |
T1301 |
T1300 |
prep |
for,factor |
R9290 |
T12542 |
T12543 |
compound |
p65,536S/A |
R9291 |
T12543 |
T12539 |
conj |
536S/A,276S/A |
R9292 |
T12544 |
T12535 |
conj |
constructs,p65 |
R9293 |
T12545 |
T12528 |
prep |
into,construct |
R9294 |
T12546 |
T12555 |
det |
a,line |
R9295 |
T12547 |
T12555 |
nmod |
NF-κB,line |
R9296 |
T12548 |
T12549 |
nummod |
p65,− |
R9297 |
T12549 |
T12555 |
nmod |
−,line |
R9298 |
T12550 |
T12555 |
nmod |
/,line |
R9299 |
T12551 |
T12555 |
nmod |
−,line |
R93 |
T125 |
T122 |
ccomp |
stimulated,demonstrate |
R930 |
T1302 |
T1301 |
pobj |
expression,for |
R9300 |
T12552 |
T12555 |
nmod |
murine,line |
R9301 |
T12553 |
T12555 |
nmod |
fibroblast,line |
R9302 |
T12554 |
T12555 |
compound |
cell,line |
R9303 |
T12555 |
T12545 |
pobj |
line,into |
R9304 |
T12556 |
T12528 |
cc |
and,construct |
R9305 |
T12557 |
T12559 |
amod |
measured,activity |
R9306 |
T12558 |
T12559 |
amod |
NF-κB,activity |
R9307 |
T12559 |
T12528 |
conj |
activity,construct |
R9308 |
T12560 |
T12525 |
punct |
.,co-transfected |
R9309 |
T12561 |
T12562 |
mark |
As,predicted |
R931 |
T1303 |
T1302 |
prep |
of,expression |
R9310 |
T12562 |
T12582 |
advcl |
predicted,activated |
R9311 |
T12563 |
T12562 |
punct |
",",predicted |
R9312 |
T12564 |
T12582 |
advcl |
expression,activated |
R9313 |
T12565 |
T12564 |
prep |
of,expression |
R9314 |
T12566 |
T12567 |
compound |
WT,NF-κB |
R9315 |
T12567 |
T12568 |
compound |
NF-κB,p65 |
R9316 |
T12568 |
T12565 |
pobj |
p65,of |
R9317 |
T12569 |
T12568 |
punct |
(,p65 |
R9318 |
T12570 |
T12571 |
nummod |
p65,WT |
R9319 |
T12571 |
T12568 |
appos |
WT,p65 |
R932 |
T1304 |
T1303 |
pobj |
cytokines,of |
R9320 |
T12572 |
T12568 |
punct |
),p65 |
R9321 |
T12573 |
T12564 |
prep |
in,expression |
R9322 |
T12574 |
T12573 |
pobj |
NF-κB,in |
R9323 |
T12575 |
T12576 |
nummod |
p65,− |
R9324 |
T12576 |
T12577 |
nummod |
−,/ |
R9325 |
T12577 |
T12580 |
compound |
/,line |
R9326 |
T12578 |
T12580 |
compound |
−,line |
R9327 |
T12579 |
T12580 |
compound |
cell,line |
R9328 |
T12580 |
T12582 |
nsubj |
line,activated |
R9329 |
T12581 |
T12582 |
advmod |
constitutively,activated |
R933 |
T1305 |
T1304 |
cc |
and,cytokines |
R9330 |
T12582 |
T12582 |
ROOT |
activated,activated |
R9331 |
T12583 |
T12582 |
dobj |
NF-κB,activated |
R9332 |
T12584 |
T12582 |
prep |
compared,activated |
R9333 |
T12585 |
T12584 |
prep |
to,compared |
R9334 |
T12586 |
T12585 |
pobj |
cells,to |
R9335 |
T12587 |
T12586 |
acl |
transfected,cells |
R9336 |
T12588 |
T12587 |
prep |
with,transfected |
R9337 |
T12589 |
T12590 |
compound |
vector,control |
R9338 |
T12590 |
T12588 |
pobj |
control,with |
R9339 |
T12591 |
T12587 |
prep |
without,transfected |
R934 |
T1306 |
T1307 |
compound |
cell,surface |
R9340 |
T12592 |
T12593 |
det |
any,stimulation |
R9341 |
T12593 |
T12591 |
pobj |
stimulation,without |
R9342 |
T12594 |
T12596 |
punct |
(,8B |
R9343 |
T12595 |
T12596 |
compound |
Figure,8B |
R9344 |
T12596 |
T12593 |
appos |
8B,stimulation |
R9345 |
T12597 |
T12596 |
punct |
),8B |
R9346 |
T12598 |
T12582 |
punct |
.,activated |
R9347 |
T12599 |
T12607 |
prep |
In,construct |
R9348 |
T12600 |
T12599 |
pobj |
comparison,In |
R9349 |
T12601 |
T12607 |
punct |
",",construct |
R935 |
T1307 |
T1308 |
compound |
surface,receptors |
R9350 |
T12602 |
T12607 |
nsubj |
transfecting,construct |
R9351 |
T12603 |
T12604 |
det |
the,NF-κB |
R9352 |
T12604 |
T12606 |
compound |
NF-κB,276S/A |
R9353 |
T12605 |
T12606 |
compound |
p65,276S/A |
R9354 |
T12606 |
T12607 |
nsubj |
276S/A,construct |
R9355 |
T12607 |
T12607 |
ROOT |
construct,construct |
R9356 |
T12608 |
T12610 |
amod |
reduced,activity |
R9357 |
T12609 |
T12610 |
amod |
NF-κB,activity |
R9358 |
T12610 |
T12607 |
dobj |
activity,construct |
R9359 |
T12611 |
T12607 |
prep |
by,construct |
R936 |
T1308 |
T1304 |
conj |
receptors,cytokines |
R9360 |
T12612 |
T12611 |
pobj |
5-fold,by |
R9361 |
T12613 |
T12624 |
punct |
(,276S/A |
R9362 |
T12614 |
T12616 |
advmod |
p,0.006 |
R9363 |
T12615 |
T12616 |
punct |
=,0.006 |
R9364 |
T12616 |
T12624 |
nummod |
0.006,276S/A |
R9365 |
T12617 |
T12619 |
punct |
",",NF-κB |
R9366 |
T12618 |
T12619 |
compound |
WT,NF-κB |
R9367 |
T12619 |
T12624 |
npadvmod |
NF-κB,276S/A |
R9368 |
T12620 |
T12619 |
nummod |
p65,NF-κB |
R9369 |
T12621 |
T12622 |
nmod |
vs.,NF-κB |
R937 |
T1309 |
T1311 |
nmod |
[,] |
R9370 |
T12622 |
T12624 |
nmod |
NF-κB,276S/A |
R9371 |
T12623 |
T12624 |
nummod |
p65,276S/A |
R9372 |
T12624 |
T12612 |
appos |
276S/A,5-fold |
R9373 |
T12625 |
T12624 |
punct |
),276S/A |
R9374 |
T12626 |
T12607 |
punct |
",",construct |
R9375 |
T12627 |
T12628 |
mark |
while,expressing |
R9376 |
T12628 |
T12607 |
advcl |
expressing,construct |
R9377 |
T12629 |
T12632 |
det |
the,536S/A |
R9378 |
T12630 |
T12632 |
compound |
NF-κB,536S/A |
R9379 |
T12631 |
T12632 |
compound |
p65,536S/A |
R938 |
T1310 |
T1311 |
nummod |
12,] |
R9380 |
T12632 |
T12633 |
nsubj |
536S/A,construct |
R9381 |
T12633 |
T12628 |
ccomp |
construct,expressing |
R9382 |
T12634 |
T12636 |
amod |
increased,activity |
R9383 |
T12635 |
T12636 |
amod |
NF-κB,activity |
R9384 |
T12636 |
T12633 |
dobj |
activity,construct |
R9385 |
T12637 |
T12633 |
prep |
in,construct |
R9386 |
T12638 |
T12639 |
det |
the,p65 |
R9387 |
T12639 |
T12637 |
pobj |
p65,in |
R9388 |
T12640 |
T12633 |
conj |
−,construct |
R9389 |
T12641 |
T12643 |
nummod |
/,cells |
R939 |
T1311 |
T1300 |
appos |
],factor |
R9390 |
T12642 |
T12643 |
amod |
−,cells |
R9391 |
T12643 |
T12640 |
dobj |
cells,− |
R9392 |
T12644 |
T12640 |
prep |
to,− |
R9393 |
T12645 |
T12644 |
pobj |
levels,to |
R9394 |
T12646 |
T12645 |
amod |
similar,levels |
R9395 |
T12647 |
T12646 |
prep |
to,similar |
R9396 |
T12648 |
T12649 |
compound |
WT,NF-κB |
R9397 |
T12649 |
T12647 |
pobj |
NF-κB,to |
R9398 |
T12650 |
T12652 |
nummod |
p65,cells |
R9399 |
T12651 |
T12652 |
amod |
transfected,cells |
R94 |
T126 |
T128 |
compound |
NF-κB,activity |
R940 |
T1312 |
T1296 |
punct |
.,is |
R9400 |
T12652 |
T12645 |
conj |
cells,levels |
R9401 |
T12653 |
T12607 |
punct |
.,construct |
R9402 |
T12654 |
T12678 |
prep |
Since,examined |
R9403 |
T12655 |
T12657 |
amod |
M-CSF-induced,activation |
R9404 |
T12656 |
T12657 |
compound |
PKC,activation |
R9405 |
T12657 |
T12658 |
nsubj |
activation,regulated |
R9406 |
T12658 |
T12660 |
amod |
regulated,activity |
R9407 |
T12659 |
T12660 |
amod |
NF-κB,activity |
R9408 |
T12660 |
T12654 |
pobj |
activity,Since |
R9409 |
T12661 |
T12660 |
prep |
via,activity |
R941 |
T1313 |
T1320 |
advmod |
However,is |
R9410 |
T12662 |
T12663 |
compound |
Ser276,residue |
R9411 |
T12663 |
T12661 |
pobj |
residue,via |
R9412 |
T12664 |
T12663 |
prep |
of,residue |
R9413 |
T12665 |
T12664 |
pobj |
NF-κB,of |
R9414 |
T12666 |
T12665 |
nummod |
p65,NF-κB |
R9415 |
T12667 |
T12660 |
prep |
in,activity |
R9416 |
T12668 |
T12670 |
amod |
primary,MDMs |
R9417 |
T12669 |
T12670 |
amod |
human,MDMs |
R9418 |
T12670 |
T12667 |
pobj |
MDMs,in |
R9419 |
T12671 |
T12670 |
cc |
and,MDMs |
R942 |
T1314 |
T1320 |
punct |
",",is |
R9420 |
T12672 |
T12670 |
conj |
RAW,MDMs |
R9421 |
T12673 |
T12674 |
nummod |
264.7,cells |
R9422 |
T12674 |
T12660 |
appos |
cells,activity |
R9423 |
T12675 |
T12678 |
punct |
",",examined |
R9424 |
T12676 |
T12678 |
nsubj |
we,examined |
R9425 |
T12677 |
T12678 |
advmod |
next,examined |
R9426 |
T12678 |
T12678 |
ROOT |
examined,examined |
R9427 |
T12679 |
T12681 |
mark |
if,occurred |
R9428 |
T12680 |
T12681 |
nsubj |
this,occurred |
R9429 |
T12681 |
T12678 |
advcl |
occurred,examined |
R943 |
T1315 |
T1320 |
prep |
unlike,is |
R9430 |
T12682 |
T12681 |
prep |
in,occurred |
R9431 |
T12683 |
T12682 |
pobj |
NF-κB,in |
R9432 |
T12684 |
T12683 |
nummod |
p65,NF-κB |
R9433 |
T12685 |
T12688 |
nummod |
−,fibroblasts |
R9434 |
T12686 |
T12687 |
compound |
/,− |
R9435 |
T12687 |
T12688 |
compound |
−,fibroblasts |
R9436 |
T12688 |
T12681 |
npadvmod |
fibroblasts,occurred |
R9437 |
T12689 |
T12681 |
prep |
in,occurred |
R9438 |
T12690 |
T12689 |
pobj |
response,in |
R9439 |
T12691 |
T12690 |
prep |
to,response |
R944 |
T1316 |
T1317 |
amod |
resting,T-cells |
R9440 |
T12692 |
T12694 |
det |
a,stimulus |
R9441 |
T12693 |
T12694 |
amod |
native,stimulus |
R9442 |
T12694 |
T12691 |
pobj |
stimulus,to |
R9443 |
T12695 |
T12694 |
prep |
for,stimulus |
R9444 |
T12696 |
T12697 |
det |
these,cells |
R9445 |
T12697 |
T12695 |
pobj |
cells,for |
R9446 |
T12698 |
T12694 |
punct |
",",stimulus |
R9447 |
T12699 |
T12694 |
appos |
TNFα,stimulus |
R9448 |
T12700 |
T12678 |
punct |
.,examined |
R9449 |
T12701 |
T12702 |
amod |
NF-κB,activity |
R945 |
T1317 |
T1315 |
pobj |
T-cells,unlike |
R9450 |
T12702 |
T12704 |
nsubjpass |
activity,measured |
R9451 |
T12703 |
T12704 |
auxpass |
was,measured |
R9452 |
T12704 |
T12704 |
ROOT |
measured,measured |
R9453 |
T12705 |
T12704 |
prep |
in,measured |
R9454 |
T12706 |
T12708 |
det |
the,NF-κB |
R9455 |
T12707 |
T12708 |
compound |
WT,NF-κB |
R9456 |
T12708 |
T12705 |
pobj |
NF-κB,in |
R9457 |
T12709 |
T12708 |
nummod |
p65,NF-κB |
R9458 |
T12710 |
T12708 |
cc |
or,NF-κB |
R9459 |
T12711 |
T12708 |
conj |
NF-κB,NF-κB |
R946 |
T1318 |
T1320 |
punct |
",",is |
R9460 |
T12712 |
T12713 |
compound |
p65,276S/A |
R9461 |
T12713 |
T12708 |
conj |
276S/A,NF-κB |
R9462 |
T12714 |
T12715 |
amod |
transfected,cells |
R9463 |
T12715 |
T12704 |
advcl |
cells,measured |
R9464 |
T12716 |
T12715 |
acl |
treated,cells |
R9465 |
T12717 |
T12716 |
prep |
with,treated |
R9466 |
T12718 |
T12717 |
pobj |
TNFα,with |
R9467 |
T12719 |
T12716 |
prep |
in,treated |
R9468 |
T12720 |
T12721 |
det |
the,absence |
R9469 |
T12721 |
T12719 |
pobj |
absence,in |
R947 |
T1319 |
T1320 |
nsubj |
NF-κB,is |
R9470 |
T12722 |
T12721 |
cc |
or,absence |
R9471 |
T12723 |
T12721 |
conj |
presence,absence |
R9472 |
T12724 |
T12721 |
prep |
of,absence |
R9473 |
T12725 |
T12724 |
pobj |
Ro-31-8220,of |
R9474 |
T12726 |
T12728 |
punct |
(,8C |
R9475 |
T12727 |
T12728 |
compound |
Figure,8C |
R9476 |
T12728 |
T12725 |
appos |
8C,Ro-31-8220 |
R9477 |
T12729 |
T12725 |
punct |
),Ro-31-8220 |
R9478 |
T12730 |
T12704 |
punct |
.,measured |
R9479 |
T12731 |
T12732 |
mark |
As,expected |
R948 |
T1320 |
T1320 |
ROOT |
is,is |
R9480 |
T12732 |
T12735 |
advcl |
expected,increased |
R9481 |
T12733 |
T12735 |
punct |
",",increased |
R9482 |
T12734 |
T12735 |
nsubj |
TNFα,increased |
R9483 |
T12735 |
T12735 |
ROOT |
increased,increased |
R9484 |
T12736 |
T12737 |
amod |
NF-κB,activity |
R9485 |
T12737 |
T12735 |
dobj |
activity,increased |
R9486 |
T12738 |
T12735 |
prep |
in,increased |
R9487 |
T12739 |
T12738 |
pobj |
NF-κB,in |
R9488 |
T12740 |
T12741 |
nummod |
p65,− |
R9489 |
T12741 |
T12744 |
nummod |
−,cells |
R949 |
T1321 |
T1322 |
advmod |
constitutively,present |
R9490 |
T12742 |
T12743 |
compound |
/,− |
R9491 |
T12743 |
T12744 |
compound |
−,cells |
R9492 |
T12744 |
T12735 |
conj |
cells,increased |
R9493 |
T12745 |
T12744 |
acl |
expressing,cells |
R9494 |
T12746 |
T12745 |
dobj |
WT,expressing |
R9495 |
T12747 |
T12746 |
amod |
p65,WT |
R9496 |
T12748 |
T12744 |
cc |
and,cells |
R9497 |
T12749 |
T12744 |
punct |
(,cells |
R9498 |
T12750 |
T12744 |
conj |
p,cells |
R9499 |
T12751 |
T12752 |
punct |
=,0.001 |
R95 |
T127 |
T128 |
compound |
transcriptional,activity |
R950 |
T1322 |
T1320 |
acomp |
present,is |
R9500 |
T12752 |
T12750 |
pobj |
0.001,p |
R9501 |
T12753 |
T12744 |
punct |
),cells |
R9502 |
T12754 |
T12755 |
compound |
PKC,inhibitors |
R9503 |
T12755 |
T12756 |
nsubj |
inhibitors,decreased |
R9504 |
T12756 |
T12756 |
ROOT |
decreased,decreased |
R9505 |
T12757 |
T12758 |
amod |
NF-κB,activity |
R9506 |
T12758 |
T12756 |
dobj |
activity,decreased |
R9507 |
T12759 |
T12756 |
prep |
to,decreased |
R9508 |
T12760 |
T12761 |
det |
the,non-stimulated |
R9509 |
T12761 |
T12759 |
pobj |
non-stimulated,to |
R951 |
T1323 |
T1322 |
prep |
in,present |
R9510 |
T12762 |
T12765 |
punct |
(,level |
R9511 |
T12763 |
T12765 |
nmod |
NS,level |
R9512 |
T12764 |
T12765 |
punct |
),level |
R9513 |
T12765 |
T12761 |
appos |
level,non-stimulated |
R9514 |
T12766 |
T12765 |
punct |
(,level |
R9515 |
T12767 |
T12765 |
npadvmod |
p,level |
R9516 |
T12768 |
T12769 |
punct |
=,0.007 |
R9517 |
T12769 |
T12767 |
prep |
0.007,p |
R9518 |
T12770 |
T12765 |
punct |
),level |
R9519 |
T12771 |
T12756 |
punct |
.,decreased |
R952 |
T1324 |
T1325 |
det |
the,nuclei |
R9520 |
T12772 |
T12779 |
advcl |
Introducing,reduced |
R9521 |
T12773 |
T12774 |
amod |
NF-κB,p65 |
R9522 |
T12774 |
T12772 |
dobj |
p65,Introducing |
R9523 |
T12775 |
T12777 |
nummod |
276,constructs |
R9524 |
T12776 |
T12777 |
compound |
S/A,constructs |
R9525 |
T12777 |
T12779 |
nsubj |
constructs,reduced |
R9526 |
T12778 |
T12779 |
advmod |
significantly,reduced |
R9527 |
T12779 |
T12779 |
ROOT |
reduced,reduced |
R9528 |
T12780 |
T12781 |
amod |
NF-κB,activity |
R9529 |
T12781 |
T12779 |
dobj |
activity,reduced |
R953 |
T1325 |
T1323 |
pobj |
nuclei,in |
R9530 |
T12782 |
T12779 |
prep |
compared,reduced |
R9531 |
T12783 |
T12782 |
prep |
with,compared |
R9532 |
T12784 |
T12787 |
det |
the,p65 |
R9533 |
T12785 |
T12786 |
compound |
WT,NF-κB |
R9534 |
T12786 |
T12787 |
compound |
NF-κB,p65 |
R9535 |
T12787 |
T12783 |
pobj |
p65,with |
R9536 |
T12788 |
T12779 |
conj |
construct,reduced |
R9537 |
T12789 |
T12788 |
punct |
(,construct |
R9538 |
T12790 |
T12788 |
dobj |
p,construct |
R9539 |
T12791 |
T12792 |
punct |
=,0.001 |
R954 |
T1326 |
T1325 |
prep |
of,nuclei |
R9540 |
T12792 |
T12790 |
prep |
0.001,p |
R9541 |
T12793 |
T12790 |
punct |
),p |
R9542 |
T12794 |
T12779 |
punct |
.,reduced |
R9543 |
T12795 |
T12798 |
advmod |
Notably,failed |
R9544 |
T12796 |
T12798 |
punct |
",",failed |
R9545 |
T12797 |
T12798 |
nsubj |
TNFα,failed |
R9546 |
T12798 |
T12798 |
ROOT |
failed,failed |
R9547 |
T12799 |
T12800 |
aux |
to,increase |
R9548 |
T12800 |
T12798 |
xcomp |
increase,failed |
R9549 |
T12801 |
T12802 |
amod |
NF-κB,activity |
R955 |
T1327 |
T1328 |
amod |
primary,monocytes |
R9550 |
T12802 |
T12800 |
dobj |
activity,increase |
R9551 |
T12803 |
T12800 |
prep |
in,increase |
R9552 |
T12804 |
T12810 |
det |
the,cells |
R9553 |
T12805 |
T12810 |
nmod |
NF-κB,cells |
R9554 |
T12806 |
T12807 |
nummod |
p65,− |
R9555 |
T12807 |
T12810 |
nummod |
−,cells |
R9556 |
T12808 |
T12809 |
compound |
/,− |
R9557 |
T12809 |
T12810 |
compound |
−,cells |
R9558 |
T12810 |
T12803 |
pobj |
cells,in |
R9559 |
T12811 |
T12810 |
acl |
expressing,cells |
R956 |
T1328 |
T1326 |
pobj |
monocytes,of |
R9560 |
T12812 |
T12814 |
compound |
NF-κB,276S/A |
R9561 |
T12813 |
T12814 |
compound |
p65,276S/A |
R9562 |
T12814 |
T12815 |
compound |
276S/A,constructs |
R9563 |
T12815 |
T12811 |
dobj |
constructs,expressing |
R9564 |
T12816 |
T12798 |
punct |
.,failed |
R9565 |
T12817 |
T12818 |
det |
These,observations |
R9566 |
T12818 |
T12819 |
nsubj |
observations,are |
R9567 |
T12819 |
T12819 |
ROOT |
are,are |
R9568 |
T12820 |
T12819 |
acomp |
similar,are |
R9569 |
T12821 |
T12820 |
prep |
to,similar |
R957 |
T1329 |
T1328 |
cc |
and,monocytes |
R9570 |
T12822 |
T12821 |
pobj |
macrophages,to |
R9571 |
T12823 |
T12822 |
acl |
overexpressing,macrophages |
R9572 |
T12824 |
T12827 |
det |
the,276S/A |
R9573 |
T12825 |
T12827 |
nmod |
NF-κB,276S/A |
R9574 |
T12826 |
T12827 |
nummod |
p65,276S/A |
R9575 |
T12827 |
T12823 |
dobj |
276S/A,overexpressing |
R9576 |
T12828 |
T12827 |
punct |
(,276S/A |
R9577 |
T12829 |
T12830 |
compound |
Figure,8A |
R9578 |
T12830 |
T12827 |
appos |
8A,276S/A |
R9579 |
T12831 |
T12827 |
punct |
),276S/A |
R958 |
T1330 |
T1332 |
amod |
monocytic,lines |
R9580 |
T12832 |
T12819 |
punct |
.,are |
R9581 |
T12833 |
T12834 |
poss |
Our,data |
R9582 |
T12834 |
T12835 |
nsubj |
data,demonstrate |
R9583 |
T12835 |
T12835 |
ROOT |
demonstrate,demonstrate |
R9584 |
T12836 |
T12841 |
mark |
that,is |
R9585 |
T12837 |
T12841 |
nsubj |
Ser276,is |
R9586 |
T12838 |
T12837 |
prep |
of,Ser276 |
R9587 |
T12839 |
T12838 |
pobj |
NF-κB,of |
R9588 |
T12840 |
T12839 |
nummod |
p65,NF-κB |
R9589 |
T12841 |
T12835 |
ccomp |
is,demonstrate |
R959 |
T1331 |
T1332 |
compound |
cell,lines |
R9590 |
T12842 |
T12841 |
acomp |
essential,is |
R9591 |
T12843 |
T12841 |
prep |
in,is |
R9592 |
T12844 |
T12843 |
pcomp |
regulating,in |
R9593 |
T12845 |
T12846 |
amod |
NF-κB,activity |
R9594 |
T12846 |
T12844 |
dobj |
activity,regulating |
R9595 |
T12847 |
T12841 |
cc |
and,is |
R9596 |
T12848 |
T12841 |
conj |
suggests,is |
R9597 |
T12849 |
T12851 |
mark |
that,regulates |
R9598 |
T12850 |
T12851 |
nsubj |
PKC,regulates |
R9599 |
T12851 |
T12848 |
ccomp |
regulates,suggests |
R96 |
T128 |
T125 |
dobj |
activity,stimulated |
R960 |
T1332 |
T1328 |
conj |
lines,monocytes |
R9600 |
T12852 |
T12853 |
amod |
NF-κB,activity |
R9601 |
T12853 |
T12851 |
dobj |
activity,regulates |
R9602 |
T12854 |
T12851 |
prep |
by,regulates |
R9603 |
T12855 |
T12854 |
pcomp |
modulating,by |
R9604 |
T12856 |
T12857 |
det |
the,phosphorylation |
R9605 |
T12857 |
T12855 |
dobj |
phosphorylation,modulating |
R9606 |
T12858 |
T12857 |
prep |
of,phosphorylation |
R9607 |
T12859 |
T12860 |
compound |
NF-κB,p65 |
R9608 |
T12860 |
T12858 |
pobj |
p65,of |
R9609 |
T12861 |
T12855 |
prep |
at,modulating |
R961 |
T1333 |
T1322 |
prep |
in,present |
R9610 |
T12862 |
T12863 |
compound |
Ser276,residue |
R9611 |
T12863 |
T12861 |
pobj |
residue,at |
R9612 |
T12864 |
T12835 |
punct |
.,demonstrate |
R962 |
T1334 |
T1335 |
det |
the,absence |
R963 |
T1335 |
T1333 |
pobj |
absence,in |
R964 |
T1336 |
T1335 |
prep |
of,absence |
R965 |
T1337 |
T1338 |
amod |
exogenous,stimuli |
R966 |
T1338 |
T1336 |
pobj |
stimuli,of |
R967 |
T1339 |
T1340 |
mark |
as,demonstrated |
R968 |
T1340 |
T1322 |
advcl |
demonstrated,present |
R969 |
T1341 |
T1340 |
agent |
by,demonstrated |
R97 |
T129 |
T128 |
prep |
in,activity |
R970 |
T1342 |
T1343 |
compound |
mobility,shift |
R971 |
T1343 |
T1344 |
compound |
shift,analysis |
R972 |
T1344 |
T1345 |
compound |
analysis,[ |
R973 |
T1345 |
T1347 |
nmod |
[,] |
R974 |
T1346 |
T1347 |
nummod |
13,] |
R975 |
T1347 |
T1341 |
pobj |
],by |
R976 |
T1348 |
T1320 |
punct |
.,is |
R977 |
T1349 |
T1355 |
advmod |
Similarly,observed |
R978 |
T1350 |
T1355 |
punct |
",",observed |
R979 |
T1351 |
T1352 |
advmod |
constitutively,active |
R98 |
T130 |
T132 |
amod |
human,macrophages |
R980 |
T1352 |
T1353 |
amod |
active,NF-κB |
R981 |
T1353 |
T1355 |
nsubjpass |
NF-κB,observed |
R982 |
T1354 |
T1355 |
auxpass |
was,observed |
R983 |
T1355 |
T1355 |
ROOT |
observed,observed |
R984 |
T1356 |
T1355 |
prep |
in,observed |
R985 |
T1357 |
T1359 |
amod |
human,macrophages |
R986 |
T1358 |
T1359 |
amod |
alveolar,macrophages |
R987 |
T1359 |
T1356 |
pobj |
macrophages,in |
R988 |
T1360 |
T1362 |
nmod |
[,] |
R989 |
T1361 |
T1362 |
nummod |
14,] |
R99 |
T131 |
T132 |
amod |
monocyte-derived,macrophages |
R990 |
T1362 |
T1355 |
dobj |
],observed |
R991 |
T1363 |
T1355 |
punct |
.,observed |
R992 |
T1364 |
T1374 |
prep |
In,sequestered |
R993 |
T1365 |
T1367 |
det |
the,pathway |
R994 |
T1366 |
T1367 |
amod |
classic/canonical,pathway |
R995 |
T1367 |
T1364 |
pobj |
pathway,In |
R996 |
T1368 |
T1374 |
punct |
",",sequestered |
R997 |
T1369 |
T1374 |
det |
the,sequestered |
R998 |
T1370 |
T1374 |
nsubjpass |
NF-κB,sequestered |
R999 |
T1371 |
T1372 |
nummod |
p50/p65,complex |