Id |
Subject |
Object |
Predicate |
Lexical cue |
T573 |
0-4 |
NNP |
denotes |
Sox6 |
T574 |
5-13 |
RB |
denotes |
Directly |
T575 |
14-22 |
NNPS |
denotes |
Silences |
T576 |
23-30 |
NNP |
denotes |
Epsilon |
T577 |
31-37 |
NNP |
denotes |
Globin |
T578 |
38-48 |
NNP |
denotes |
Expression |
T579 |
49-51 |
IN |
denotes |
in |
T580 |
52-62 |
NNP |
denotes |
Definitive |
T581 |
63-77 |
NNP |
denotes |
Erythropoiesis |
T582 |
127-131 |
NNP |
denotes |
Sox6 |
T583 |
132-134 |
VBZ |
denotes |
is |
T584 |
135-136 |
DT |
denotes |
a |
T585 |
137-143 |
NN |
denotes |
member |
T586 |
144-146 |
IN |
denotes |
of |
T587 |
147-150 |
DT |
denotes |
the |
T588 |
151-154 |
NNPS |
denotes |
Sox |
T589 |
155-168 |
NN |
denotes |
transcription |
T590 |
169-175 |
NN |
denotes |
factor |
T591 |
176-182 |
NN |
denotes |
family |
T592 |
183-187 |
WDT |
denotes |
that |
T593 |
188-190 |
VBZ |
denotes |
is |
T594 |
191-198 |
VBN |
denotes |
defined |
T595 |
199-201 |
IN |
denotes |
by |
T596 |
202-205 |
DT |
denotes |
the |
T597 |
206-215 |
JJ |
denotes |
conserved |
T598 |
216-220 |
JJ |
denotes |
high |
T599 |
221-229 |
NN |
denotes |
mobility |
T600 |
230-235 |
NN |
denotes |
group |
T601 |
236-237 |
-LRB- |
denotes |
( |
T602 |
237-240 |
NNP |
denotes |
HMG |
T603 |
240-241 |
-RRB- |
denotes |
) |
T604 |
242-245 |
NNP |
denotes |
DNA |
T605 |
246-253 |
JJ |
denotes |
binding |
T606 |
254-260 |
NN |
denotes |
domain |
T607 |
260-261 |
, |
denotes |
, |
T608 |
262-267 |
JJ |
denotes |
first |
T609 |
268-277 |
VBN |
denotes |
described |
T610 |
278-280 |
IN |
denotes |
in |
T611 |
281-284 |
DT |
denotes |
the |
T612 |
285-291 |
NN |
denotes |
testis |
T613 |
292-303 |
VBG |
denotes |
determining |
T614 |
304-308 |
NN |
denotes |
gene |
T615 |
308-309 |
, |
denotes |
, |
T616 |
310-313 |
NNP |
denotes |
Sry |
T617 |
313-314 |
. |
denotes |
. |
T618 |
315-323 |
JJ |
denotes |
Previous |
T619 |
324-331 |
NNS |
denotes |
studies |
T620 |
332-336 |
VBP |
denotes |
have |
T621 |
337-346 |
VBN |
denotes |
suggested |
T622 |
347-351 |
IN |
denotes |
that |
T623 |
352-356 |
JJ |
denotes |
Sox6 |
T624 |
357-362 |
NNS |
denotes |
plays |
T625 |
363-364 |
DT |
denotes |
a |
T626 |
365-369 |
NN |
denotes |
role |
T627 |
370-372 |
IN |
denotes |
in |
T628 |
373-376 |
DT |
denotes |
the |
T629 |
377-388 |
NN |
denotes |
development |
T630 |
389-391 |
IN |
denotes |
of |
T631 |
392-395 |
DT |
denotes |
the |
T632 |
396-403 |
JJ |
denotes |
central |
T633 |
404-411 |
JJ |
denotes |
nervous |
T634 |
412-418 |
NN |
denotes |
system |
T635 |
418-419 |
, |
denotes |
, |
T636 |
420-429 |
NN |
denotes |
cartilage |
T637 |
429-430 |
, |
denotes |
, |
T638 |
431-434 |
CC |
denotes |
and |
T639 |
435-441 |
NN |
denotes |
muscle |
T640 |
441-442 |
. |
denotes |
. |
T641 |
443-445 |
IN |
denotes |
In |
T642 |
446-449 |
DT |
denotes |
the |
T643 |
450-464 |
JJ |
denotes |
Sox6-deficient |
T644 |
465-470 |
NN |
denotes |
mouse |
T645 |
470-471 |
, |
denotes |
, |
T646 |
472-477 |
NNP |
denotes |
p100H |
T647 |
477-478 |
, |
denotes |
, |
T648 |
479-481 |
JJ |
denotes |
ɛy |
T649 |
482-488 |
NN |
denotes |
globin |
T650 |
489-491 |
VBZ |
denotes |
is |
T651 |
492-504 |
RB |
denotes |
persistently |
T652 |
505-514 |
VBN |
denotes |
expressed |
T653 |
514-515 |
, |
denotes |
, |
T654 |
516-519 |
CC |
denotes |
and |
T655 |
520-529 |
VBD |
denotes |
increased |
T656 |
530-537 |
NNS |
denotes |
numbers |
T657 |
538-540 |
IN |
denotes |
of |
T658 |
541-550 |
JJ |
denotes |
nucleated |
T659 |
551-554 |
JJ |
denotes |
red |
T660 |
555-560 |
NNS |
denotes |
cells |
T661 |
561-564 |
VBP |
denotes |
are |
T662 |
565-572 |
JJ |
denotes |
present |
T663 |
573-575 |
IN |
denotes |
in |
T664 |
576-579 |
DT |
denotes |
the |
T665 |
580-585 |
JJ |
denotes |
fetal |
T666 |
586-597 |
NN |
denotes |
circulation |
T667 |
597-598 |
. |
denotes |
. |
T668 |
599-611 |
NNP |
denotes |
Transfection |
T669 |
612-618 |
NNS |
denotes |
assays |
T670 |
619-621 |
IN |
denotes |
in |
T671 |
622-627 |
NNP |
denotes |
GM979 |
T672 |
628-629 |
-LRB- |
denotes |
( |
T673 |
629-644 |
JJ |
denotes |
erythroleukemic |
T674 |
644-645 |
-RRB- |
denotes |
) |
T675 |
646-651 |
NNS |
denotes |
cells |
T676 |
652-658 |
VBP |
denotes |
define |
T677 |
659-660 |
DT |
denotes |
a |
T678 |
661-663 |
CD |
denotes |
36 |
T679 |
664-668 |
JJ |
denotes |
base |
T680 |
669-673 |
NN |
denotes |
pair |
T681 |
674-680 |
NN |
denotes |
region |
T682 |
681-683 |
IN |
denotes |
of |
T683 |
684-687 |
DT |
denotes |
the |
T684 |
688-690 |
JJ |
denotes |
ɛy |
T685 |
691-699 |
JJ |
denotes |
proximal |
T686 |
700-708 |
NN |
denotes |
promoter |
T687 |
709-713 |
WDT |
denotes |
that |
T688 |
714-716 |
VBZ |
denotes |
is |
T689 |
717-725 |
JJ |
denotes |
critical |
T690 |
726-729 |
IN |
denotes |
for |
T691 |
730-734 |
JJ |
denotes |
Sox6 |
T692 |
735-743 |
VBN |
denotes |
mediated |
T693 |
744-754 |
NN |
denotes |
repression |
T694 |
754-755 |
. |
denotes |
. |
T695 |
756-771 |
JJ |
denotes |
Electrophoretic |
T696 |
772-780 |
NN |
denotes |
mobility |
T697 |
781-786 |
NN |
denotes |
shift |
T698 |
787-792 |
NN |
denotes |
assay |
T699 |
793-794 |
-LRB- |
denotes |
( |
T700 |
794-798 |
NNP |
denotes |
EMSA |
T701 |
798-799 |
-RRB- |
denotes |
) |
T702 |
800-803 |
CC |
denotes |
and |
T703 |
804-813 |
NN |
denotes |
chromatin |
T704 |
814-833 |
NN |
denotes |
immunoprecipitation |
T705 |
834-835 |
-LRB- |
denotes |
( |
T706 |
835-839 |
NNP |
denotes |
ChIP |
T707 |
839-840 |
-RRB- |
denotes |
) |
T708 |
841-847 |
NNS |
denotes |
assays |
T709 |
848-859 |
VBP |
denotes |
demonstrate |
T710 |
860-864 |
IN |
denotes |
that |
T711 |
865-869 |
JJ |
denotes |
Sox6 |
T712 |
870-874 |
NNS |
denotes |
acts |
T713 |
875-877 |
IN |
denotes |
as |
T714 |
878-879 |
DT |
denotes |
a |
T715 |
880-889 |
NN |
denotes |
repressor |
T716 |
890-892 |
IN |
denotes |
by |
T717 |
893-901 |
RB |
denotes |
directly |
T718 |
902-909 |
JJ |
denotes |
binding |
T719 |
910-912 |
TO |
denotes |
to |
T720 |
913-916 |
DT |
denotes |
the |
T721 |
917-919 |
JJ |
denotes |
ɛy |
T722 |
920-928 |
NN |
denotes |
promoter |
T723 |
928-929 |
. |
denotes |
. |
T724 |
930-933 |
DT |
denotes |
The |
T725 |
934-940 |
JJ |
denotes |
normal |
T726 |
941-951 |
NN |
denotes |
expression |
T727 |
952-954 |
IN |
denotes |
of |
T728 |
955-959 |
NNP |
denotes |
Sox6 |
T729 |
960-962 |
IN |
denotes |
in |
T730 |
963-972 |
JJ |
denotes |
wild-type |
T731 |
973-978 |
JJ |
denotes |
fetal |
T732 |
979-984 |
NN |
denotes |
liver |
T733 |
985-988 |
CC |
denotes |
and |
T734 |
989-992 |
DT |
denotes |
the |
T735 |
993-1000 |
JJ |
denotes |
ectopic |
T736 |
1001-1011 |
NN |
denotes |
expression |
T737 |
1012-1014 |
IN |
denotes |
of |
T738 |
1015-1017 |
NN |
denotes |
ɛy |
T739 |
1018-1020 |
IN |
denotes |
in |
T740 |
1021-1026 |
JJ |
denotes |
p100H |
T741 |
1027-1037 |
JJ |
denotes |
homozygous |
T742 |
1038-1043 |
JJ |
denotes |
fetal |
T743 |
1044-1049 |
NN |
denotes |
liver |
T744 |
1050-1061 |
VBP |
denotes |
demonstrate |
T745 |
1062-1066 |
IN |
denotes |
that |
T746 |
1067-1071 |
JJ |
denotes |
Sox6 |
T747 |
1072-1081 |
NNS |
denotes |
functions |
T748 |
1082-1084 |
IN |
denotes |
in |
T749 |
1085-1095 |
JJ |
denotes |
definitive |
T750 |
1096-1110 |
NNS |
denotes |
erythropoiesis |
T751 |
1110-1111 |
. |
denotes |
. |
T752 |
1112-1115 |
DT |
denotes |
The |
T753 |
1116-1123 |
JJ |
denotes |
present |
T754 |
1124-1129 |
NN |
denotes |
study |
T755 |
1130-1135 |
VBZ |
denotes |
shows |
T756 |
1136-1140 |
IN |
denotes |
that |
T757 |
1141-1145 |
NNP |
denotes |
Sox6 |
T758 |
1146-1148 |
VBZ |
denotes |
is |
T759 |
1149-1157 |
VBN |
denotes |
required |
T760 |
1158-1161 |
IN |
denotes |
for |
T761 |
1162-1171 |
VBG |
denotes |
silencing |
T762 |
1172-1174 |
IN |
denotes |
of |
T763 |
1175-1177 |
JJ |
denotes |
ɛy |
T764 |
1178-1184 |
NN |
denotes |
globin |
T765 |
1185-1187 |
IN |
denotes |
in |
T766 |
1188-1198 |
JJ |
denotes |
definitive |
T767 |
1199-1213 |
NNS |
denotes |
erythropoiesis |
T768 |
1214-1217 |
CC |
denotes |
and |
T769 |
1218-1226 |
VBZ |
denotes |
suggests |
T770 |
1227-1228 |
DT |
denotes |
a |
T771 |
1229-1233 |
NN |
denotes |
role |
T772 |
1234-1237 |
IN |
denotes |
for |
T773 |
1238-1242 |
NNP |
denotes |
Sox6 |
T774 |
1243-1245 |
IN |
denotes |
in |
T775 |
1246-1255 |
JJ |
denotes |
erythroid |
T776 |
1256-1260 |
NN |
denotes |
cell |
T777 |
1261-1271 |
NN |
denotes |
maturation |
T778 |
1271-1272 |
. |
denotes |
. |
T779 |
1273-1277 |
RB |
denotes |
Thus |
T780 |
1277-1278 |
, |
denotes |
, |
T781 |
1279-1283 |
JJ |
denotes |
Sox6 |
T782 |
1284-1294 |
NN |
denotes |
regulation |
T783 |
1295-1297 |
IN |
denotes |
of |
T784 |
1298-1300 |
JJ |
denotes |
ɛy |
T785 |
1301-1307 |
NN |
denotes |
globin |
T786 |
1308-1313 |
MD |
denotes |
might |
T787 |
1314-1321 |
VB |
denotes |
provide |
T788 |
1322-1323 |
DT |
denotes |
a |
T789 |
1324-1329 |
NN |
denotes |
novel |
T790 |
1330-1343 |
JJ |
denotes |
therapeutical |
T791 |
1344-1350 |
NN |
denotes |
target |
T792 |
1351-1353 |
IN |
denotes |
in |
T793 |
1354-1357 |
DT |
denotes |
the |
T794 |
1358-1367 |
NN |
denotes |
treatment |
T795 |
1368-1370 |
IN |
denotes |
of |
T796 |
1371-1389 |
NNS |
denotes |
hemoglobinopathies |
T797 |
1390-1394 |
JJ |
denotes |
such |
T798 |
1395-1397 |
IN |
denotes |
as |
T799 |
1398-1404 |
JJ |
denotes |
sickle |
T800 |
1405-1409 |
NN |
denotes |
cell |
T801 |
1410-1416 |
NN |
denotes |
anemia |
T802 |
1417-1420 |
CC |
denotes |
and |
T803 |
1421-1432 |
NN |
denotes |
thalassemia |
T804 |
1432-1433 |
. |
denotes |
. |
T2913 |
2855-2858 |
NNP |
denotes |
Sry |
T2914 |
2859-2863 |
NN |
denotes |
type |
T2915 |
2864-2867 |
NNP |
denotes |
HMG |
T2916 |
2868-2871 |
NN |
denotes |
box |
T2917 |
2872-2873 |
-LRB- |
denotes |
( |
T2918 |
2873-2877 |
NNP |
denotes |
Sox6 |
T2919 |
2877-2878 |
-RRB- |
denotes |
) |
T2920 |
2879-2881 |
VBZ |
denotes |
is |
T2921 |
2882-2883 |
DT |
denotes |
a |
T2922 |
2884-2890 |
NN |
denotes |
member |
T2923 |
2891-2893 |
IN |
denotes |
of |
T2924 |
2894-2897 |
DT |
denotes |
the |
T2925 |
2898-2901 |
NNPS |
denotes |
Sox |
T2926 |
2902-2915 |
NN |
denotes |
transcription |
T2927 |
2916-2922 |
NN |
denotes |
factor |
T2928 |
2923-2929 |
NN |
denotes |
family |
T2929 |
2930-2943 |
VBN |
denotes |
characterized |
T2930 |
2944-2946 |
IN |
denotes |
by |
T2931 |
2947-2950 |
DT |
denotes |
the |
T2932 |
2951-2960 |
JJ |
denotes |
conserved |
T2933 |
2961-2965 |
JJ |
denotes |
high |
T2934 |
2966-2974 |
NN |
denotes |
mobility |
T2935 |
2975-2980 |
NN |
denotes |
group |
T2936 |
2981-2982 |
-LRB- |
denotes |
( |
T2937 |
2982-2985 |
NNP |
denotes |
HMG |
T2938 |
2985-2986 |
-RRB- |
denotes |
) |
T2939 |
2987-2993 |
NN |
denotes |
domain |
T2940 |
2993-2994 |
, |
denotes |
, |
T2941 |
2995-3005 |
VBG |
denotes |
consisting |
T2942 |
3006-3008 |
IN |
denotes |
of |
T2943 |
3009-3011 |
CD |
denotes |
79 |
T2944 |
3012-3017 |
JJ |
denotes |
amino |
T2945 |
3018-3023 |
NNS |
denotes |
acids |
T2946 |
3024-3032 |
VBN |
denotes |
involved |
T2947 |
3033-3035 |
IN |
denotes |
in |
T2948 |
3036-3039 |
NNP |
denotes |
DNA |
T2949 |
3040-3051 |
NN |
denotes |
recognition |
T2950 |
3052-3055 |
CC |
denotes |
and |
T2951 |
3056-3063 |
JJ |
denotes |
binding |
T2952 |
3064-3065 |
NN |
denotes |
[ |
T2953 |
3065-3066 |
CD |
denotes |
1 |
T2954 |
3066-3067 |
NNP |
denotes |
] |
T2955 |
3067-3068 |
. |
denotes |
. |
T2956 |
3069-3072 |
NNP |
denotes |
Sox |
T2957 |
3073-3086 |
NN |
denotes |
transcription |
T2958 |
3087-3094 |
NNS |
denotes |
factors |
T2959 |
3095-3099 |
NN |
denotes |
bind |
T2960 |
3100-3102 |
TO |
denotes |
to |
T2961 |
3103-3106 |
DT |
denotes |
the |
T2962 |
3107-3112 |
JJ |
denotes |
minor |
T2963 |
3113-3119 |
NN |
denotes |
groove |
T2964 |
3120-3122 |
IN |
denotes |
of |
T2965 |
3123-3126 |
NNP |
denotes |
DNA |
T2966 |
3127-3130 |
CC |
denotes |
and |
T2967 |
3131-3136 |
VB |
denotes |
cause |
T2968 |
3137-3138 |
DT |
denotes |
a |
T2969 |
3139-3141 |
CD |
denotes |
70 |
T2970 |
3141-3142 |
NN |
denotes |
° |
T2971 |
3143-3145 |
CD |
denotes |
85 |
T2972 |
3145-3146 |
NN |
denotes |
° |
T2973 |
3147-3151 |
VB |
denotes |
bend |
T2974 |
3152-3154 |
IN |
denotes |
of |
T2975 |
3155-3158 |
DT |
denotes |
the |
T2976 |
3159-3162 |
NN |
denotes |
DNA |
T2977 |
3163-3167 |
WDT |
denotes |
that |
T2978 |
3168-3173 |
VBZ |
denotes |
leads |
T2979 |
3174-3176 |
TO |
denotes |
to |
T2980 |
3177-3182 |
JJ |
denotes |
local |
T2981 |
3183-3197 |
JJ |
denotes |
conformational |
T2982 |
3198-3205 |
NNS |
denotes |
changes |
T2983 |
3206-3207 |
NNP |
denotes |
[ |
T2984 |
3207-3210 |
CD |
denotes |
2,3 |
T2985 |
3210-3211 |
NNP |
denotes |
] |
T2986 |
3211-3212 |
, |
denotes |
, |
T2987 |
3213-3218 |
IN |
denotes |
while |
T2988 |
3219-3223 |
RBS |
denotes |
most |
T2989 |
3224-3229 |
JJ |
denotes |
other |
T2990 |
3230-3243 |
NN |
denotes |
transcription |
T2991 |
3244-3251 |
NNS |
denotes |
factors |
T2992 |
3252-3258 |
VBP |
denotes |
target |
T2993 |
3259-3262 |
DT |
denotes |
the |
T2994 |
3263-3268 |
JJ |
denotes |
major |
T2995 |
3269-3275 |
NN |
denotes |
groove |
T2996 |
3276-3278 |
IN |
denotes |
of |
T2997 |
3279-3282 |
NNP |
denotes |
DNA |
T2998 |
3283-3284 |
NNP |
denotes |
[ |
T2999 |
3284-3285 |
CD |
denotes |
4 |
T3000 |
3285-3286 |
NNP |
denotes |
] |
T3001 |
3286-3287 |
. |
denotes |
. |
T3002 |
3288-3297 |
RB |
denotes |
Therefore |
T3003 |
3297-3298 |
, |
denotes |
, |
T3004 |
3299-3302 |
NNP |
denotes |
Sox |
T3005 |
3303-3311 |
NNS |
denotes |
proteins |
T3006 |
3312-3315 |
MD |
denotes |
may |
T3007 |
3316-3323 |
VB |
denotes |
perform |
T3008 |
3324-3328 |
NN |
denotes |
part |
T3009 |
3329-3331 |
IN |
denotes |
of |
T3010 |
3332-3337 |
PRP$ |
denotes |
their |
T3011 |
3338-3346 |
NN |
denotes |
function |
T3012 |
3347-3349 |
IN |
denotes |
as |
T3013 |
3350-3363 |
JJ |
denotes |
architectural |
T3014 |
3364-3372 |
NNS |
denotes |
proteins |
T3015 |
3373-3375 |
IN |
denotes |
by |
T3016 |
3376-3386 |
VBG |
denotes |
organizing |
T3017 |
3387-3392 |
JJ |
denotes |
local |
T3018 |
3393-3402 |
NN |
denotes |
chromatin |
T3019 |
3403-3412 |
NN |
denotes |
structure |
T3020 |
3413-3416 |
CC |
denotes |
and |
T3021 |
3417-3427 |
VBG |
denotes |
assembling |
T3022 |
3428-3433 |
JJ |
denotes |
other |
T3023 |
3434-3443 |
JJ |
denotes |
DNA-bound |
T3024 |
3444-3457 |
NN |
denotes |
transcription |
T3025 |
3458-3465 |
NNS |
denotes |
factors |
T3026 |
3466-3470 |
IN |
denotes |
into |
T3027 |
3471-3483 |
RB |
denotes |
biologically |
T3028 |
3484-3490 |
JJ |
denotes |
active |
T3029 |
3490-3491 |
, |
denotes |
, |
T3030 |
3492-3502 |
RB |
denotes |
sterically |
T3031 |
3503-3510 |
VBN |
denotes |
defined |
T3032 |
3511-3523 |
NN |
denotes |
multiprotein |
T3033 |
3524-3533 |
NNS |
denotes |
complexes |
T3034 |
3533-3534 |
. |
denotes |
. |
T3035 |
3535-3539 |
NNP |
denotes |
Sox6 |
T3036 |
3540-3543 |
VBZ |
denotes |
has |
T3037 |
3544-3548 |
VBN |
denotes |
been |
T3038 |
3549-3557 |
VBN |
denotes |
reported |
T3039 |
3558-3560 |
TO |
denotes |
to |
T3040 |
3561-3563 |
VB |
denotes |
be |
T3041 |
3564-3568 |
JJ |
denotes |
able |
T3042 |
3569-3571 |
TO |
denotes |
to |
T3043 |
3572-3575 |
VB |
denotes |
act |
T3044 |
3576-3578 |
IN |
denotes |
as |
T3045 |
3579-3585 |
DT |
denotes |
either |
T3046 |
3586-3588 |
DT |
denotes |
an |
T3047 |
3589-3598 |
NN |
denotes |
activator |
T3048 |
3599-3601 |
CC |
denotes |
or |
T3049 |
3602-3603 |
DT |
denotes |
a |
T3050 |
3604-3613 |
NN |
denotes |
repressor |
T3051 |
3613-3614 |
, |
denotes |
, |
T3052 |
3615-3624 |
VBG |
denotes |
depending |
T3053 |
3625-3627 |
IN |
denotes |
on |
T3054 |
3628-3631 |
PRP$ |
denotes |
its |
T3055 |
3632-3643 |
NNS |
denotes |
interactors |
T3056 |
3644-3647 |
CC |
denotes |
and |
T3057 |
3648-3651 |
PRP$ |
denotes |
its |
T3058 |
3652-3658 |
NN |
denotes |
target |
T3059 |
3659-3667 |
NN |
denotes |
promoter |
T3060 |
3668-3675 |
NN |
denotes |
context |
T3061 |
3676-3677 |
NNP |
denotes |
[ |
T3062 |
3677-3680 |
CD |
denotes |
5,6 |
T3063 |
3680-3681 |
NNP |
denotes |
] |
T3064 |
3681-3682 |
. |
denotes |
. |
T3065 |
3683-3695 |
RB |
denotes |
Intriguingly |
T3066 |
3695-3696 |
, |
denotes |
, |
T3067 |
3697-3701 |
NNP |
denotes |
Sox6 |
T3068 |
3702-3705 |
VBZ |
denotes |
has |
T3069 |
3706-3710 |
RB |
denotes |
also |
T3070 |
3711-3715 |
VBN |
denotes |
been |
T3071 |
3716-3721 |
VBN |
denotes |
shown |
T3072 |
3722-3724 |
TO |
denotes |
to |
T3073 |
3725-3728 |
VB |
denotes |
act |
T3074 |
3729-3731 |
IN |
denotes |
as |
T3075 |
3732-3733 |
DT |
denotes |
a |
T3076 |
3734-3741 |
JJ |
denotes |
general |
T3077 |
3742-3750 |
NN |
denotes |
splicing |
T3078 |
3751-3757 |
NN |
denotes |
factor |
T3079 |
3758-3762 |
WDT |
denotes |
that |
T3080 |
3763-3775 |
VBZ |
denotes |
participates |
T3081 |
3776-3778 |
IN |
denotes |
in |
T3082 |
3779-3787 |
JJ |
denotes |
pre-mRNA |
T3083 |
3788-3796 |
NN |
denotes |
splicing |
T3084 |
3797-3798 |
NN |
denotes |
[ |
T3085 |
3798-3799 |
CD |
denotes |
7 |
T3086 |
3799-3800 |
NNP |
denotes |
] |
T3087 |
3800-3801 |
. |
denotes |
. |
T3088 |
3802-3811 |
NN |
denotes |
Depletion |
T3089 |
3812-3814 |
IN |
denotes |
of |
T3090 |
3815-3819 |
NNP |
denotes |
Sox6 |
T3091 |
3820-3822 |
IN |
denotes |
in |
T3092 |
3823-3827 |
NNP |
denotes |
HeLa |
T3093 |
3828-3832 |
NN |
denotes |
cell |
T3094 |
3833-3841 |
VBZ |
denotes |
extracts |
T3095 |
3842-3849 |
VBN |
denotes |
blocked |
T3096 |
3850-3858 |
NN |
denotes |
splicing |
T3097 |
3859-3861 |
IN |
denotes |
of |
T3098 |
3862-3870 |
JJ |
denotes |
multiple |
T3099 |
3871-3881 |
NNS |
denotes |
substrates |
T3100 |
3881-3882 |
, |
denotes |
, |
T3101 |
3883-3886 |
CC |
denotes |
and |
T3102 |
3887-3897 |
NN |
denotes |
expression |
T3103 |
3898-3900 |
IN |
denotes |
of |
T3104 |
3901-3904 |
DT |
denotes |
the |
T3105 |
3905-3908 |
NNP |
denotes |
HMG |
T3106 |
3909-3915 |
NN |
denotes |
domain |
T3107 |
3916-3918 |
IN |
denotes |
of |
T3108 |
3919-3925 |
DT |
denotes |
either |
T3109 |
3926-3930 |
NNP |
denotes |
Sox6 |
T3110 |
3930-3931 |
, |
denotes |
, |
T3111 |
3932-3936 |
NNP |
denotes |
Sox9 |
T3112 |
3936-3937 |
, |
denotes |
, |
T3113 |
3938-3940 |
CC |
denotes |
or |
T3114 |
3941-3944 |
NNP |
denotes |
Sry |
T3115 |
3945-3947 |
IN |
denotes |
in |
T3116 |
3948-3951 |
DT |
denotes |
the |
T3117 |
3952-3960 |
NNS |
denotes |
extracts |
T3118 |
3961-3969 |
VBD |
denotes |
restored |
T3119 |
3970-3978 |
NN |
denotes |
splicing |
T3120 |
3978-3979 |
, |
denotes |
, |
T3121 |
3980-3990 |
VBG |
denotes |
indicating |
T3122 |
3991-4001 |
JJ |
denotes |
functional |
T3123 |
4002-4009 |
VBP |
denotes |
overlap |
T3124 |
4010-4012 |
IN |
denotes |
of |
T3125 |
4013-4018 |
DT |
denotes |
these |
T3126 |
4019-4027 |
NNS |
denotes |
proteins |
T3127 |
4028-4029 |
VBP |
denotes |
[ |
T3128 |
4029-4030 |
CD |
denotes |
7 |
T3129 |
4030-4031 |
NNP |
denotes |
] |
T3130 |
4031-4032 |
. |
denotes |
. |
T3131 |
4033-4043 |
RB |
denotes |
Regardless |
T3132 |
4044-4046 |
IN |
denotes |
of |
T3133 |
4047-4050 |
WRB |
denotes |
how |
T3134 |
4051-4055 |
JJ |
denotes |
Sox6 |
T3135 |
4056-4065 |
NNS |
denotes |
functions |
T3136 |
4066-4068 |
IN |
denotes |
in |
T3137 |
4069-4079 |
VBG |
denotes |
regulating |
T3138 |
4080-4084 |
NN |
denotes |
gene |
T3139 |
4085-4095 |
NN |
denotes |
expression |
T3140 |
4095-4096 |
, |
denotes |
, |
T3141 |
4097-4105 |
JJ |
denotes |
previous |
T3142 |
4106-4113 |
NNS |
denotes |
studies |
T3143 |
4114-4118 |
VBP |
denotes |
have |
T3144 |
4119-4131 |
VBN |
denotes |
demonstrated |
T3145 |
4132-4136 |
IN |
denotes |
that |
T3146 |
4137-4141 |
NNP |
denotes |
Sox6 |
T3147 |
4142-4144 |
VBZ |
denotes |
is |
T3148 |
4145-4147 |
DT |
denotes |
an |
T3149 |
4148-4157 |
JJ |
denotes |
important |
T3150 |
4158-4168 |
JJ |
denotes |
regulatory |
T3151 |
4169-4177 |
NN |
denotes |
molecule |
T3152 |
4178-4182 |
WDT |
denotes |
that |
T3153 |
4183-4188 |
VBZ |
denotes |
plays |
T3154 |
4189-4190 |
DT |
denotes |
a |
T3155 |
4191-4195 |
NN |
denotes |
role |
T3156 |
4196-4198 |
IN |
denotes |
in |
T3157 |
4199-4202 |
DT |
denotes |
the |
T3158 |
4203-4214 |
NN |
denotes |
development |
T3159 |
4215-4217 |
IN |
denotes |
of |
T3160 |
4218-4221 |
DT |
denotes |
the |
T3161 |
4222-4229 |
JJ |
denotes |
central |
T3162 |
4230-4237 |
JJ |
denotes |
nervous |
T3163 |
4238-4244 |
NN |
denotes |
system |
T3164 |
4245-4246 |
NN |
denotes |
[ |
T3165 |
4246-4247 |
CD |
denotes |
8 |
T3166 |
4248-4250 |
CD |
denotes |
11 |
T3167 |
4250-4251 |
NNP |
denotes |
] |
T3168 |
4251-4252 |
, |
denotes |
, |
T3169 |
4253-4262 |
NN |
denotes |
cartilage |
T3170 |
4263-4264 |
NNP |
denotes |
[ |
T3171 |
4264-4271 |
CD |
denotes |
6,12,13 |
T3172 |
4271-4272 |
NNP |
denotes |
] |
T3173 |
4272-4273 |
, |
denotes |
, |
T3174 |
4274-4277 |
CC |
denotes |
and |
T3175 |
4278-4284 |
NN |
denotes |
muscle |
T3176 |
4285-4286 |
NNP |
denotes |
[ |
T3177 |
4286-4291 |
CD |
denotes |
14,15 |
T3178 |
4291-4292 |
NNP |
denotes |
] |
T3179 |
4292-4293 |
. |
denotes |
. |
T3180 |
4294-4295 |
DT |
denotes |
A |
T3181 |
4296-4305 |
JJ |
denotes |
Sox6-null |
T3182 |
4306-4312 |
JJ |
denotes |
mutant |
T3183 |
4313-4318 |
NN |
denotes |
mouse |
T3184 |
4319-4320 |
-LRB- |
denotes |
( |
T3185 |
4320-4325 |
JJ |
denotes |
p100H |
T3186 |
4325-4326 |
-RRB- |
denotes |
) |
T3187 |
4327-4330 |
VBZ |
denotes |
has |
T3188 |
4331-4341 |
RB |
denotes |
previously |
T3189 |
4342-4346 |
VBN |
denotes |
been |
T3190 |
4347-4357 |
VBN |
denotes |
identified |
T3191 |
4358-4360 |
IN |
denotes |
in |
T3192 |
4361-4364 |
PRP$ |
denotes |
our |
T3193 |
4365-4375 |
NN |
denotes |
laboratory |
T3194 |
4376-4377 |
NNP |
denotes |
[ |
T3195 |
4377-4379 |
CD |
denotes |
14 |
T3196 |
4379-4380 |
NNP |
denotes |
] |
T3197 |
4380-4381 |
. |
denotes |
. |
T3198 |
4382-4386 |
NN |
denotes |
Mice |
T3199 |
4387-4397 |
NNS |
denotes |
homozygous |
T3200 |
4398-4401 |
IN |
denotes |
for |
T3201 |
4402-4407 |
JJ |
denotes |
p100H |
T3202 |
4408-4412 |
NN |
denotes |
show |
T3203 |
4413-4420 |
VBN |
denotes |
delayed |
T3204 |
4421-4427 |
NN |
denotes |
growth |
T3205 |
4427-4428 |
, |
denotes |
, |
T3206 |
4429-4436 |
VB |
denotes |
develop |
T3207 |
4437-4445 |
NN |
denotes |
myopathy |
T3208 |
4446-4449 |
CC |
denotes |
and |
T3209 |
4450-4468 |
JJ |
denotes |
arterioventricular |
T3210 |
4469-4474 |
NN |
denotes |
heart |
T3211 |
4475-4480 |
NN |
denotes |
block |
T3212 |
4480-4481 |
, |
denotes |
, |
T3213 |
4482-4485 |
CC |
denotes |
and |
T3214 |
4486-4489 |
VB |
denotes |
die |
T3215 |
4490-4496 |
IN |
denotes |
within |
T3216 |
4497-4498 |
CD |
denotes |
2 |
T3217 |
4499-4501 |
NN |
denotes |
wk |
T3218 |
4502-4507 |
IN |
denotes |
after |
T3219 |
4508-4513 |
NN |
denotes |
birth |
T3220 |
4514-4515 |
NNP |
denotes |
[ |
T3221 |
4515-4517 |
CD |
denotes |
14 |
T3222 |
4517-4518 |
NNP |
denotes |
] |
T3223 |
4518-4519 |
. |
denotes |
. |
T3224 |
4520-4523 |
DT |
denotes |
The |
T3225 |
4524-4529 |
JJ |
denotes |
p100H |
T3226 |
4530-4536 |
JJ |
denotes |
mutant |
T3227 |
4537-4543 |
NN |
denotes |
allele |
T3228 |
4544-4546 |
VBZ |
denotes |
is |
T3229 |
4547-4557 |
VBN |
denotes |
associated |
T3230 |
4558-4562 |
IN |
denotes |
with |
T3231 |
4563-4564 |
DT |
denotes |
a |
T3232 |
4565-4575 |
NN |
denotes |
Chromosome |
T3233 |
4576-4577 |
CD |
denotes |
7 |
T3234 |
4578-4587 |
NN |
denotes |
inversion |
T3235 |
4588-4592 |
WDT |
denotes |
that |
T3236 |
4593-4601 |
VBZ |
denotes |
disrupts |
T3237 |
4602-4606 |
CC |
denotes |
both |
T3238 |
4607-4610 |
DT |
denotes |
the |
T3239 |
4611-4612 |
NN |
denotes |
p |
T3240 |
4613-4617 |
NN |
denotes |
gene |
T3241 |
4618-4621 |
CC |
denotes |
and |
T3242 |
4622-4625 |
DT |
denotes |
the |
T3243 |
4626-4630 |
NNP |
denotes |
Sox6 |
T3244 |
4631-4635 |
NN |
denotes |
gene |
T3245 |
4636-4637 |
-LRB- |
denotes |
( |
T3246 |
4637-4640 |
CC |
denotes |
and |
T3247 |
4641-4643 |
DT |
denotes |
no |
T3248 |
4644-4649 |
JJ |
denotes |
other |
T3249 |
4650-4654 |
NN |
denotes |
gene |
T3250 |
4655-4661 |
IN |
denotes |
within |
T3251 |
4662-4668 |
CD |
denotes |
50,000 |
T3252 |
4669-4680 |
NNS |
denotes |
nucleotides |
T3253 |
4681-4683 |
IN |
denotes |
of |
T3254 |
4684-4687 |
DT |
denotes |
the |
T3255 |
4688-4699 |
JJ |
denotes |
chromosomal |
T3256 |
4700-4711 |
NNS |
denotes |
breakpoints |
T3257 |
4711-4712 |
-RRB- |
denotes |
) |
T3258 |
4713-4714 |
NNP |
denotes |
[ |
T3259 |
4714-4716 |
CD |
denotes |
14 |
T3260 |
4716-4717 |
NNP |
denotes |
] |
T3261 |
4717-4718 |
. |
denotes |
. |
T3262 |
4719-4726 |
IN |
denotes |
Because |
T3263 |
4727-4730 |
DT |
denotes |
the |
T3264 |
4731-4732 |
NN |
denotes |
p |
T3265 |
4733-4737 |
NN |
denotes |
gene |
T3266 |
4738-4747 |
NNS |
denotes |
functions |
T3267 |
4748-4754 |
RB |
denotes |
solely |
T3268 |
4755-4757 |
IN |
denotes |
in |
T3269 |
4758-4770 |
NN |
denotes |
pigmentation |
T3270 |
4771-4772 |
NNP |
denotes |
[ |
T3271 |
4772-4774 |
CD |
denotes |
16 |
T3272 |
4774-4775 |
NNP |
denotes |
] |
T3273 |
4775-4776 |
, |
denotes |
, |
T3274 |
4777-4780 |
DT |
denotes |
the |
T3275 |
4781-4785 |
NNP |
denotes |
Sox6 |
T3276 |
4786-4799 |
NN |
denotes |
transcription |
T3277 |
4800-4806 |
NN |
denotes |
factor |
T3278 |
4807-4809 |
VBZ |
denotes |
is |
T3279 |
4810-4820 |
VBN |
denotes |
implicated |
T3280 |
4821-4823 |
IN |
denotes |
in |
T3281 |
4824-4827 |
DT |
denotes |
all |
T3282 |
4828-4833 |
JJ |
denotes |
other |
T3283 |
4834-4844 |
NNS |
denotes |
phenotypes |
T3284 |
4844-4845 |
. |
denotes |
. |
T3285 |
4846-4851 |
IN |
denotes |
Among |
T3286 |
4852-4855 |
DT |
denotes |
the |
T3287 |
4856-4859 |
NNP |
denotes |
HMG |
T3288 |
4860-4863 |
NN |
denotes |
box |
T3289 |
4864-4872 |
NNS |
denotes |
proteins |
T3290 |
4873-4882 |
RB |
denotes |
distantly |
T3291 |
4883-4890 |
VBN |
denotes |
related |
T3292 |
4891-4893 |
TO |
denotes |
to |
T3293 |
4894-4897 |
NNP |
denotes |
Sry |
T3294 |
4898-4899 |
-LRB- |
denotes |
( |
T3295 |
4899-4902 |
DT |
denotes |
the |
T3296 |
4903-4908 |
JJ |
denotes |
first |
T3297 |
4909-4915 |
NN |
denotes |
member |
T3298 |
4916-4926 |
VBN |
denotes |
identified |
T3299 |
4927-4929 |
IN |
denotes |
of |
T3300 |
4930-4933 |
DT |
denotes |
the |
T3301 |
4934-4937 |
NNPS |
denotes |
Sox |
T3302 |
4938-4951 |
NN |
denotes |
transcription |
T3303 |
4952-4958 |
NN |
denotes |
factor |
T3304 |
4959-4965 |
NN |
denotes |
family |
T3305 |
4965-4966 |
-RRB- |
denotes |
) |
T3306 |
4967-4971 |
WDT |
denotes |
that |
T3307 |
4972-4981 |
RB |
denotes |
similarly |
T3308 |
4982-4986 |
NN |
denotes |
bind |
T3309 |
4987-4989 |
TO |
denotes |
to |
T3310 |
4990-4993 |
DT |
denotes |
the |
T3311 |
4994-4999 |
JJ |
denotes |
minor |
T3312 |
5000-5006 |
NN |
denotes |
groove |
T3313 |
5007-5010 |
CC |
denotes |
and |
T3314 |
5011-5015 |
VB |
denotes |
bend |
T3315 |
5016-5019 |
NNP |
denotes |
DNA |
T3316 |
5019-5020 |
, |
denotes |
, |
T3317 |
5021-5024 |
CC |
denotes |
but |
T3318 |
5025-5032 |
IN |
denotes |
without |
T3319 |
5033-5041 |
NN |
denotes |
sequence |
T3320 |
5042-5053 |
NN |
denotes |
specificity |
T3321 |
5053-5054 |
, |
denotes |
, |
T3322 |
5055-5058 |
VBP |
denotes |
are |
T3323 |
5059-5062 |
DT |
denotes |
the |
T3324 |
5063-5075 |
RB |
denotes |
ubiquitously |
T3325 |
5076-5085 |
VBN |
denotes |
expressed |
T3326 |
5086-5090 |
NNP |
denotes |
HMG1 |
T3327 |
5091-5094 |
CC |
denotes |
and |
T3328 |
5095-5099 |
NNP |
denotes |
HMG2 |
T3329 |
5100-5108 |
NNS |
denotes |
proteins |
T3330 |
5109-5110 |
NNP |
denotes |
[ |
T3331 |
5110-5112 |
CD |
denotes |
17 |
T3332 |
5112-5113 |
NNP |
denotes |
] |
T3333 |
5113-5114 |
. |
denotes |
. |
T3334 |
5115-5125 |
NNP |
denotes |
Modulation |
T3335 |
5126-5128 |
IN |
denotes |
of |
T3336 |
5129-5132 |
NNP |
denotes |
DNA |
T3337 |
5133-5142 |
NN |
denotes |
structure |
T3338 |
5143-5145 |
IN |
denotes |
by |
T3339 |
5146-5151 |
DT |
denotes |
these |
T3340 |
5152-5155 |
CC |
denotes |
and |
T3341 |
5156-5161 |
JJ |
denotes |
other |
T3342 |
5162-5165 |
NNP |
denotes |
HMG |
T3343 |
5166-5174 |
NNS |
denotes |
proteins |
T3344 |
5175-5178 |
MD |
denotes |
can |
T3345 |
5179-5186 |
VB |
denotes |
mediate |
T3346 |
5187-5197 |
JJ |
denotes |
long-range |
T3347 |
5198-5206 |
NN |
denotes |
enhancer |
T3348 |
5207-5215 |
NN |
denotes |
function |
T3349 |
5216-5218 |
IN |
denotes |
on |
T3350 |
5219-5223 |
DT |
denotes |
both |
T3351 |
5224-5227 |
NNP |
denotes |
DNA |
T3352 |
5228-5231 |
CC |
denotes |
and |
T3353 |
5232-5251 |
JJ |
denotes |
chromatin-assembled |
T3354 |
5252-5257 |
NNS |
denotes |
genes |
T3355 |
5258-5260 |
IN |
denotes |
by |
T3356 |
5261-5269 |
VBG |
denotes |
bringing |
T3357 |
5270-5278 |
RB |
denotes |
together |
T3358 |
5279-5286 |
JJ |
denotes |
distant |
T3359 |
5287-5294 |
NNS |
denotes |
regions |
T3360 |
5295-5297 |
IN |
denotes |
of |
T3361 |
5298-5301 |
NNP |
denotes |
DNA |
T3362 |
5302-5305 |
CC |
denotes |
and |
T3363 |
5306-5316 |
VBN |
denotes |
associated |
T3364 |
5317-5324 |
NNS |
denotes |
factors |
T3365 |
5324-5325 |
. |
denotes |
. |
T3366 |
5326-5338 |
RB |
denotes |
Specifically |
T3367 |
5338-5339 |
, |
denotes |
, |
T3368 |
5340-5343 |
NNP |
denotes |
HMG |
T3369 |
5344-5352 |
NNS |
denotes |
proteins |
T3370 |
5353-5357 |
VBP |
denotes |
have |
T3371 |
5358-5362 |
VBN |
denotes |
been |
T3372 |
5363-5368 |
VBN |
denotes |
shown |
T3373 |
5369-5371 |
TO |
denotes |
to |
T3374 |
5372-5380 |
VB |
denotes |
modulate |
T3375 |
5381-5389 |
JJ |
denotes |
β-globin |
T3376 |
5390-5395 |
NNS |
denotes |
genes |
T3377 |
5396-5397 |
NNP |
denotes |
[ |
T3378 |
5397-5399 |
CD |
denotes |
18 |
T3379 |
5400-5402 |
CD |
denotes |
21 |
T3380 |
5402-5403 |
NN |
denotes |
] |
T3381 |
5403-5404 |
. |
denotes |
. |
T3382 |
5405-5408 |
DT |
denotes |
The |
T3383 |
5409-5414 |
NN |
denotes |
mouse |
T3384 |
5415-5423 |
NN |
denotes |
β-globin |
T3385 |
5424-5429 |
NNS |
denotes |
genes |
T3386 |
5431-5433 |
NN |
denotes |
ɛy |
T3387 |
5433-5434 |
, |
denotes |
, |
T3388 |
5435-5438 |
CD |
denotes |
βh1 |
T3389 |
5438-5439 |
, |
denotes |
, |
T3390 |
5440-5447 |
NN |
denotes |
β-major |
T3391 |
5447-5448 |
, |
denotes |
, |
T3392 |
5449-5452 |
CC |
denotes |
and |
T3393 |
5453-5460 |
JJ |
denotes |
β-minor |
T3394 |
5462-5465 |
VBP |
denotes |
are |
T3395 |
5466-5475 |
VBN |
denotes |
clustered |
T3396 |
5476-5478 |
IN |
denotes |
on |
T3397 |
5479-5489 |
NN |
denotes |
Chromosome |
T3398 |
5490-5491 |
CD |
denotes |
7 |
T3399 |
5492-5495 |
CC |
denotes |
and |
T3400 |
5496-5500 |
PRP |
denotes |
they |
T3401 |
5501-5504 |
VBP |
denotes |
are |
T3402 |
5505-5511 |
RB |
denotes |
highly |
T3403 |
5512-5522 |
RB |
denotes |
homologous |
T3404 |
5523-5525 |
TO |
denotes |
to |
T3405 |
5526-5531 |
PRP$ |
denotes |
their |
T3406 |
5532-5537 |
JJ |
denotes |
human |
T3407 |
5538-5550 |
NNS |
denotes |
counterparts |
T3408 |
5551-5553 |
IN |
denotes |
in |
T3409 |
5554-5568 |
JJ |
denotes |
organizational |
T3410 |
5569-5578 |
NN |
denotes |
structure |
T3411 |
5579-5582 |
CC |
denotes |
and |
T3412 |
5583-5591 |
NN |
denotes |
function |
T3413 |
5592-5593 |
NNP |
denotes |
[ |
T3414 |
5593-5595 |
CD |
denotes |
22 |
T3415 |
5595-5596 |
NNP |
denotes |
] |
T3416 |
5596-5597 |
. |
denotes |
. |
T3417 |
5598-5608 |
JJ |
denotes |
High-level |
T3418 |
5609-5619 |
NN |
denotes |
expression |
T3419 |
5620-5622 |
IN |
denotes |
of |
T3420 |
5623-5628 |
DT |
denotes |
these |
T3421 |
5629-5634 |
NNS |
denotes |
genes |
T3422 |
5635-5643 |
VBZ |
denotes |
requires |
T3423 |
5644-5645 |
DT |
denotes |
a |
T3424 |
5646-5656 |
JJ |
denotes |
regulatory |
T3425 |
5657-5664 |
NN |
denotes |
element |
T3426 |
5664-5665 |
, |
denotes |
, |
T3427 |
5666-5669 |
DT |
denotes |
the |
T3428 |
5670-5675 |
NN |
denotes |
locus |
T3429 |
5676-5683 |
NN |
denotes |
control |
T3430 |
5684-5690 |
NN |
denotes |
region |
T3431 |
5691-5695 |
WDT |
denotes |
that |
T3432 |
5696-5698 |
VBZ |
denotes |
is |
T3433 |
5699-5712 |
VBN |
denotes |
characterized |
T3434 |
5713-5715 |
IN |
denotes |
by |
T3435 |
5716-5717 |
DT |
denotes |
a |
T3436 |
5718-5721 |
NN |
denotes |
set |
T3437 |
5722-5724 |
IN |
denotes |
of |
T3438 |
5725-5733 |
NN |
denotes |
nuclease |
T3439 |
5734-5748 |
JJ |
denotes |
hypersensitive |
T3440 |
5749-5754 |
NNS |
denotes |
sites |
T3441 |
5755-5761 |
VBN |
denotes |
spread |
T3442 |
5762-5766 |
IN |
denotes |
over |
T3443 |
5767-5769 |
CD |
denotes |
25 |
T3444 |
5770-5772 |
NN |
denotes |
kb |
T3445 |
5773-5780 |
VBN |
denotes |
located |
T3446 |
5781-5782 |
CD |
denotes |
5 |
T3447 |
5782-5783 |
NN |
denotes |
′ |
T3448 |
5784-5786 |
IN |
denotes |
of |
T3449 |
5787-5790 |
DT |
denotes |
the |
T3450 |
5791-5793 |
JJ |
denotes |
ɛy |
T3451 |
5794-5798 |
NN |
denotes |
gene |
T3452 |
5799-5800 |
NNP |
denotes |
[ |
T3453 |
5800-5802 |
CD |
denotes |
23 |
T3454 |
5802-5803 |
NNP |
denotes |
] |
T3455 |
5803-5804 |
. |
denotes |
. |
T3456 |
5805-5808 |
DT |
denotes |
The |
T3457 |
5809-5817 |
JJ |
denotes |
β-globin |
T3458 |
5818-5823 |
NNS |
denotes |
genes |
T3459 |
5824-5827 |
VBP |
denotes |
are |
T3460 |
5828-5837 |
VBN |
denotes |
expressed |
T3461 |
5838-5840 |
IN |
denotes |
in |
T3462 |
5841-5842 |
DT |
denotes |
a |
T3463 |
5843-5849 |
NN |
denotes |
tissue |
T3464 |
5849-5850 |
: |
denotes |
- |
T3465 |
5851-5854 |
CC |
denotes |
and |
T3466 |
5855-5875 |
JJ |
denotes |
development-specific |
T3467 |
5876-5883 |
NN |
denotes |
fashion |
T3468 |
5883-5884 |
. |
denotes |
. |
T3469 |
5885-5887 |
IN |
denotes |
In |
T3470 |
5888-5892 |
NNS |
denotes |
mice |
T3471 |
5892-5893 |
, |
denotes |
, |
T3472 |
5894-5908 |
VBZ |
denotes |
erythropoiesis |
T3473 |
5909-5919 |
VBZ |
denotes |
originates |
T3474 |
5920-5922 |
IN |
denotes |
in |
T3475 |
5923-5926 |
DT |
denotes |
the |
T3476 |
5927-5936 |
JJ |
denotes |
embryonic |
T3477 |
5937-5941 |
NN |
denotes |
yolk |
T3478 |
5942-5945 |
NN |
denotes |
sac |
T3479 |
5946-5951 |
WRB |
denotes |
where |
T3480 |
5952-5961 |
JJ |
denotes |
primitive |
T3481 |
5962-5971 |
JJ |
denotes |
erythroid |
T3482 |
5972-5977 |
NNS |
denotes |
cells |
T3483 |
5978-5985 |
VBP |
denotes |
express |
T3484 |
5986-5988 |
NN |
denotes |
ɛy |
T3485 |
5989-5992 |
CC |
denotes |
and |
T3486 |
5993-5997 |
JJ |
denotes |
βh-1 |
T3487 |
5998-6005 |
NNS |
denotes |
globins |
T3488 |
6006-6007 |
NNP |
denotes |
[ |
T3489 |
6007-6009 |
CD |
denotes |
22 |
T3490 |
6009-6010 |
NNP |
denotes |
] |
T3491 |
6010-6011 |
. |
denotes |
. |
T3492 |
6012-6014 |
IN |
denotes |
At |
T3493 |
6015-6019 |
CD |
denotes |
11.5 |
T3494 |
6020-6021 |
LS |
denotes |
d |
T3495 |
6022-6026 |
NN |
denotes |
post |
T3496 |
6027-6033 |
NN |
denotes |
coitus |
T3497 |
6034-6035 |
-LRB- |
denotes |
( |
T3498 |
6035-6038 |
FW |
denotes |
dpc |
T3499 |
6038-6039 |
-RRB- |
denotes |
) |
T3500 |
6039-6040 |
, |
denotes |
, |
T3501 |
6041-6055 |
VBZ |
denotes |
erythropoiesis |
T3502 |
6056-6062 |
NNS |
denotes |
shifts |
T3503 |
6063-6065 |
TO |
denotes |
to |
T3504 |
6066-6069 |
DT |
denotes |
the |
T3505 |
6070-6075 |
JJ |
denotes |
fetal |
T3506 |
6076-6081 |
NN |
denotes |
liver |
T3507 |
6082-6087 |
WRB |
denotes |
where |
T3508 |
6088-6098 |
JJ |
denotes |
definitive |
T3509 |
6099-6108 |
JJ |
denotes |
erythroid |
T3510 |
6109-6114 |
NNS |
denotes |
cells |
T3511 |
6115-6122 |
VBP |
denotes |
express |
T3512 |
6123-6128 |
NN |
denotes |
adult |
T3513 |
6129-6130 |
NN |
denotes |
β |
T3514 |
6131-6138 |
NNS |
denotes |
globins |
T3515 |
6139-6140 |
-LRB- |
denotes |
( |
T3516 |
6140-6141 |
FW |
denotes |
β |
T3517 |
6142-6147 |
JJ |
denotes |
major |
T3518 |
6148-6151 |
CC |
denotes |
and |
T3519 |
6152-6157 |
JJ |
denotes |
minor |
T3520 |
6157-6158 |
-RRB- |
denotes |
) |
T3521 |
6159-6160 |
NNP |
denotes |
[ |
T3522 |
6160-6162 |
CD |
denotes |
22 |
T3523 |
6162-6163 |
NNP |
denotes |
] |
T3524 |
6163-6164 |
. |
denotes |
. |
T3525 |
6165-6168 |
DT |
denotes |
The |
T3526 |
6169-6171 |
JJ |
denotes |
ɛy |
T3527 |
6172-6176 |
NN |
denotes |
gene |
T3528 |
6177-6179 |
VBZ |
denotes |
is |
T3529 |
6180-6188 |
VBN |
denotes |
silenced |
T3530 |
6189-6191 |
IN |
denotes |
in |
T3531 |
6192-6202 |
JJ |
denotes |
definitive |
T3532 |
6203-6212 |
JJ |
denotes |
erythroid |
T3533 |
6213-6218 |
NNS |
denotes |
cells |
T3534 |
6218-6219 |
. |
denotes |
. |
T3535 |
6220-6223 |
DT |
denotes |
The |
T3536 |
6224-6233 |
NN |
denotes |
mechanism |
T3537 |
6234-6236 |
IN |
denotes |
of |
T3538 |
6237-6246 |
VBG |
denotes |
silencing |
T3539 |
6247-6249 |
IN |
denotes |
of |
T3540 |
6250-6253 |
PRP$ |
denotes |
its |
T3541 |
6254-6259 |
JJ |
denotes |
human |
T3542 |
6260-6271 |
NN |
denotes |
counterpart |
T3543 |
6271-6272 |
, |
denotes |
, |
T3544 |
6273-6274 |
NN |
denotes |
ɛ |
T3545 |
6275-6281 |
NN |
denotes |
globin |
T3546 |
6281-6282 |
, |
denotes |
, |
T3547 |
6283-6286 |
VBZ |
denotes |
has |
T3548 |
6287-6291 |
VBN |
denotes |
been |
T3549 |
6292-6299 |
VBN |
denotes |
studied |
T3550 |
6300-6311 |
RB |
denotes |
extensively |
T3551 |
6311-6312 |
. |
denotes |
. |
T3552 |
6313-6315 |
IN |
denotes |
In |
T3553 |
6316-6326 |
JJ |
denotes |
definitive |
T3554 |
6327-6341 |
NNS |
denotes |
erythropoiesis |
T3555 |
6341-6342 |
, |
denotes |
, |
T3556 |
6343-6344 |
NN |
denotes |
ɛ |
T3557 |
6345-6347 |
VBZ |
denotes |
is |
T3558 |
6348-6357 |
VBN |
denotes |
activated |
T3559 |
6358-6361 |
CC |
denotes |
and |
T3560 |
6362-6370 |
VBN |
denotes |
silenced |
T3561 |
6371-6383 |
RB |
denotes |
autonomously |
T3562 |
6384-6385 |
NNP |
denotes |
[ |
T3563 |
6385-6390 |
CD |
denotes |
24,25 |
T3564 |
6390-6391 |
NNP |
denotes |
] |
T3565 |
6391-6392 |
, |
denotes |
, |
T3566 |
6393-6401 |
IN |
denotes |
although |
T3567 |
6402-6404 |
IN |
denotes |
in |
T3568 |
6405-6414 |
JJ |
denotes |
primitive |
T3569 |
6415-6429 |
NN |
denotes |
erythropoiesis |
T3570 |
6430-6431 |
NN |
denotes |
ɛ |
T3571 |
6432-6436 |
RB |
denotes |
also |
T3572 |
6437-6444 |
VBZ |
denotes |
appears |
T3573 |
6445-6447 |
TO |
denotes |
to |
T3574 |
6448-6450 |
VB |
denotes |
be |
T3575 |
6451-6460 |
VBN |
denotes |
regulated |
T3576 |
6461-6474 |
RB |
denotes |
competitively |
T3577 |
6475-6476 |
NNP |
denotes |
[ |
T3578 |
6476-6478 |
CD |
denotes |
26 |
T3579 |
6478-6479 |
NNP |
denotes |
] |
T3580 |
6479-6480 |
. |
denotes |
. |
T3581 |
6481-6484 |
DT |
denotes |
The |
T3582 |
6485-6493 |
NN |
denotes |
γ-globin |
T3583 |
6494-6496 |
TO |
denotes |
to |
T3584 |
6497-6502 |
NN |
denotes |
adult |
T3585 |
6503-6511 |
NN |
denotes |
β-globin |
T3586 |
6512-6518 |
NN |
denotes |
switch |
T3587 |
6519-6521 |
VBZ |
denotes |
is |
T3588 |
6522-6532 |
VBN |
denotes |
controlled |
T3589 |
6533-6535 |
IN |
denotes |
by |
T3590 |
6536-6544 |
NN |
denotes |
promoter |
T3591 |
6545-6556 |
NN |
denotes |
competition |
T3592 |
6557-6560 |
IN |
denotes |
for |
T3593 |
6561-6564 |
DT |
denotes |
the |
T3594 |
6565-6568 |
NNP |
denotes |
LCR |
T3595 |
6569-6570 |
NNP |
denotes |
[ |
T3596 |
6570-6575 |
CD |
denotes |
24,25 |
T3597 |
6575-6576 |
NNP |
denotes |
] |
T3598 |
6576-6577 |
. |
denotes |
. |
T3599 |
6578-6581 |
PDT |
denotes |
All |
T3600 |
6582-6585 |
DT |
denotes |
the |
T3601 |
6586-6594 |
NNS |
denotes |
elements |
T3602 |
6595-6606 |
JJ |
denotes |
responsible |
T3603 |
6607-6610 |
IN |
denotes |
for |
T3604 |
6611-6620 |
VBG |
denotes |
silencing |
T3605 |
6621-6624 |
DT |
denotes |
the |
T3606 |
6625-6626 |
NN |
denotes |
ɛ |
T3607 |
6627-6633 |
NN |
denotes |
globin |
T3608 |
6634-6638 |
NN |
denotes |
gene |
T3609 |
6639-6642 |
VBP |
denotes |
are |
T3610 |
6643-6649 |
IN |
denotes |
within |
T3611 |
6650-6653 |
DT |
denotes |
the |
T3612 |
6654-6655 |
NN |
denotes |
ɛ |
T3613 |
6656-6660 |
NN |
denotes |
gene |
T3614 |
6661-6663 |
CC |
denotes |
or |
T3615 |
6664-6666 |
IN |
denotes |
in |
T3616 |
6667-6675 |
JJ |
denotes |
adjacent |
T3617 |
6676-6685 |
NNS |
denotes |
sequences |
T3618 |
6686-6687 |
NNP |
denotes |
[ |
T3619 |
6687-6689 |
CD |
denotes |
27 |
T3620 |
6689-6690 |
NNP |
denotes |
] |
T3621 |
6690-6691 |
, |
denotes |
, |
T3622 |
6692-6702 |
VBG |
denotes |
suggesting |
T3623 |
6703-6707 |
IN |
denotes |
that |
T3624 |
6708-6717 |
VBG |
denotes |
silencing |
T3625 |
6718-6720 |
VBZ |
denotes |
is |
T3626 |
6721-6730 |
RB |
denotes |
primarily |
T3627 |
6731-6735 |
NN |
denotes |
gene |
T3628 |
6736-6746 |
JJ |
denotes |
autonomous |
T3629 |
6746-6747 |
. |
denotes |
. |
T3630 |
6748-6753 |
VBG |
denotes |
Using |
T3631 |
6754-6762 |
NN |
denotes |
promoter |
T3632 |
6763-6771 |
NN |
denotes |
deletion |
T3633 |
6772-6780 |
NNS |
denotes |
analyses |
T3634 |
6781-6783 |
IN |
denotes |
in |
T3635 |
6784-6794 |
JJ |
denotes |
transgenic |
T3636 |
6795-6800 |
NN |
denotes |
mouse |
T3637 |
6801-6807 |
NNS |
denotes |
models |
T3638 |
6808-6811 |
CC |
denotes |
and |
T3639 |
6812-6816 |
NN |
denotes |
cell |
T3640 |
6817-6829 |
NN |
denotes |
transfection |
T3641 |
6830-6836 |
NNS |
denotes |
assays |
T3642 |
6836-6837 |
, |
denotes |
, |
T3643 |
6838-6846 |
JJ |
denotes |
multiple |
T3644 |
6847-6850 |
NNP |
denotes |
DNA |
T3645 |
6851-6859 |
NNS |
denotes |
elements |
T3646 |
6860-6869 |
JJ |
denotes |
important |
T3647 |
6870-6872 |
TO |
denotes |
to |
T3648 |
6873-6876 |
DT |
denotes |
the |
T3649 |
6877-6886 |
VBG |
denotes |
silencing |
T3650 |
6887-6894 |
NN |
denotes |
process |
T3651 |
6895-6899 |
VBP |
denotes |
have |
T3652 |
6900-6904 |
VBN |
denotes |
been |
T3653 |
6905-6915 |
RB |
denotes |
previously |
T3654 |
6916-6926 |
VBN |
denotes |
identified |
T3655 |
6927-6929 |
IN |
denotes |
in |
T3656 |
6930-6934 |
DT |
denotes |
both |
T3657 |
6935-6938 |
DT |
denotes |
the |
T3658 |
6939-6947 |
NN |
denotes |
proximal |
T3659 |
6948-6951 |
CC |
denotes |
and |
T3660 |
6952-6955 |
DT |
denotes |
the |
T3661 |
6956-6962 |
JJ |
denotes |
distal |
T3662 |
6963-6964 |
NN |
denotes |
ɛ |
T3663 |
6965-6969 |
NN |
denotes |
gene |
T3664 |
6970-6978 |
NN |
denotes |
promoter |
T3665 |
6979-6980 |
NNP |
denotes |
[ |
T3666 |
6980-6982 |
CD |
denotes |
27 |
T3667 |
6982-6983 |
NNP |
denotes |
] |
T3668 |
6983-6984 |
. |
denotes |
. |
T3669 |
6985-6990 |
PRP$ |
denotes |
Their |
T3670 |
6991-7004 |
JJ |
denotes |
corresponding |
T3671 |
7005-7018 |
NN |
denotes |
transcription |
T3672 |
7019-7026 |
NNS |
denotes |
factors |
T3673 |
7026-7027 |
, |
denotes |
, |
T3674 |
7028-7032 |
JJ |
denotes |
such |
T3675 |
7033-7035 |
IN |
denotes |
as |
T3676 |
7036-7042 |
NNP |
denotes |
GATA-1 |
T3677 |
7042-7043 |
, |
denotes |
, |
T3678 |
7044-7048 |
NNP |
denotes |
YY-1 |
T3679 |
7048-7049 |
, |
denotes |
, |
T3680 |
7050-7057 |
NNP |
denotes |
COUP-TF |
T3681 |
7057-7058 |
, |
denotes |
, |
T3682 |
7059-7062 |
CC |
denotes |
and |
T3683 |
7063-7067 |
NNP |
denotes |
DRED |
T3684 |
7068-7072 |
VBP |
denotes |
have |
T3685 |
7073-7077 |
VBN |
denotes |
been |
T3686 |
7078-7088 |
VBN |
denotes |
identified |
T3687 |
7089-7092 |
CC |
denotes |
and |
T3688 |
7093-7098 |
VBN |
denotes |
shown |
T3689 |
7099-7101 |
TO |
denotes |
to |
T3690 |
7102-7110 |
RB |
denotes |
directly |
T3691 |
7111-7115 |
NN |
denotes |
bind |
T3692 |
7116-7118 |
TO |
denotes |
to |
T3693 |
7119-7124 |
DT |
denotes |
these |
T3694 |
7125-7128 |
NNP |
denotes |
DNA |
T3695 |
7129-7137 |
NNS |
denotes |
elements |
T3696 |
7138-7139 |
-LRB- |
denotes |
( |
T3697 |
7139-7141 |
IN |
denotes |
as |
T3698 |
7142-7146 |
NN |
denotes |
part |
T3699 |
7147-7149 |
IN |
denotes |
of |
T3700 |
7150-7157 |
NN |
denotes |
protein |
T3701 |
7158-7167 |
NNS |
denotes |
complexes |
T3702 |
7167-7168 |
-RRB- |
denotes |
) |
T3703 |
7169-7171 |
TO |
denotes |
to |
T3704 |
7172-7180 |
VB |
denotes |
regulate |
T3705 |
7181-7182 |
NN |
denotes |
ɛ |
T3706 |
7183-7192 |
VBG |
denotes |
silencing |
T3707 |
7193-7194 |
NNP |
denotes |
[ |
T3708 |
7194-7196 |
CD |
denotes |
27 |
T3709 |
7196-7197 |
NNP |
denotes |
] |
T3710 |
7197-7198 |
. |
denotes |
. |
T3711 |
7199-7203 |
RB |
denotes |
Thus |
T3712 |
7203-7204 |
, |
denotes |
, |
T3713 |
7205-7207 |
PRP |
denotes |
it |
T3714 |
7208-7215 |
VBZ |
denotes |
appears |
T3715 |
7216-7220 |
IN |
denotes |
that |
T3716 |
7221-7224 |
DT |
denotes |
the |
T3717 |
7225-7234 |
NN |
denotes |
silencing |
T3718 |
7235-7237 |
IN |
denotes |
of |
T3719 |
7238-7241 |
DT |
denotes |
the |
T3720 |
7242-7243 |
NN |
denotes |
ɛ |
T3721 |
7244-7248 |
NN |
denotes |
gene |
T3722 |
7249-7257 |
VBZ |
denotes |
involves |
T3723 |
7258-7259 |
DT |
denotes |
a |
T3724 |
7260-7271 |
JJ |
denotes |
complicated |
T3725 |
7272-7279 |
NN |
denotes |
network |
T3726 |
7280-7282 |
IN |
denotes |
of |
T3727 |
7283-7291 |
JJ |
denotes |
multiple |
T3728 |
7292-7295 |
NN |
denotes |
cis |
T3729 |
7296-7304 |
NNS |
denotes |
elements |
T3730 |
7305-7308 |
CC |
denotes |
and |
T3731 |
7309-7320 |
VBG |
denotes |
transacting |
T3732 |
7321-7329 |
NNS |
denotes |
proteins |
T3733 |
7329-7330 |
. |
denotes |
. |
T3734 |
7331-7333 |
IN |
denotes |
In |
T3735 |
7334-7342 |
NN |
denotes |
addition |
T3736 |
7343-7345 |
TO |
denotes |
to |
T3737 |
7346-7353 |
VBG |
denotes |
playing |
T3738 |
7354-7356 |
DT |
denotes |
an |
T3739 |
7357-7366 |
JJ |
denotes |
important |
T3740 |
7367-7371 |
NN |
denotes |
role |
T3741 |
7372-7374 |
IN |
denotes |
in |
T3742 |
7375-7378 |
DT |
denotes |
the |
T3743 |
7379-7390 |
NN |
denotes |
development |
T3744 |
7391-7393 |
IN |
denotes |
of |
T3745 |
7394-7397 |
DT |
denotes |
the |
T3746 |
7398-7405 |
JJ |
denotes |
central |
T3747 |
7406-7413 |
JJ |
denotes |
nervous |
T3748 |
7414-7420 |
NN |
denotes |
system |
T3749 |
7421-7422 |
NN |
denotes |
[ |
T3750 |
7422-7423 |
CD |
denotes |
8 |
T3751 |
7424-7426 |
CD |
denotes |
11 |
T3752 |
7426-7427 |
NNP |
denotes |
] |
T3753 |
7427-7428 |
, |
denotes |
, |
T3754 |
7429-7438 |
NN |
denotes |
cartilage |
T3755 |
7439-7440 |
NNP |
denotes |
[ |
T3756 |
7440-7447 |
CD |
denotes |
6,12,13 |
T3757 |
7447-7448 |
NNP |
denotes |
] |
T3758 |
7448-7449 |
, |
denotes |
, |
T3759 |
7450-7453 |
CC |
denotes |
and |
T3760 |
7454-7460 |
NN |
denotes |
muscle |
T3761 |
7461-7462 |
NNP |
denotes |
[ |
T3762 |
7462-7467 |
CD |
denotes |
14,15 |
T3763 |
7467-7468 |
NNP |
denotes |
] |
T3764 |
7468-7469 |
, |
denotes |
, |
T3765 |
7470-7472 |
PRP |
denotes |
it |
T3766 |
7473-7476 |
VBD |
denotes |
was |
T3767 |
7477-7482 |
VBN |
denotes |
shown |
T3768 |
7483-7487 |
IN |
denotes |
that |
T3769 |
7488-7492 |
NNP |
denotes |
Sox6 |
T3770 |
7493-7495 |
VBZ |
denotes |
is |
T3771 |
7496-7507 |
VBN |
denotes |
upregulated |
T3772 |
7508-7510 |
IN |
denotes |
in |
T3773 |
7511-7520 |
JJ |
denotes |
long-term |
T3774 |
7521-7534 |
NN |
denotes |
hematopoiesis |
T3775 |
7535-7539 |
NN |
denotes |
stem |
T3776 |
7540-7545 |
NNS |
denotes |
cells |
T3777 |
7546-7547 |
-LRB- |
denotes |
( |
T3778 |
7547-7553 |
NNP |
denotes |
LT-HSC |
T3779 |
7553-7554 |
-RRB- |
denotes |
) |
T3780 |
7555-7563 |
VBN |
denotes |
compared |
T3781 |
7564-7568 |
IN |
denotes |
with |
T3782 |
7569-7580 |
JJ |
denotes |
multipotent |
T3783 |
7581-7592 |
NNS |
denotes |
progenitors |
T3784 |
7593-7595 |
IN |
denotes |
of |
T3785 |
7596-7601 |
NN |
denotes |
adult |
T3786 |
7602-7607 |
NN |
denotes |
mouse |
T3787 |
7608-7612 |
NN |
denotes |
bone |
T3788 |
7613-7619 |
NN |
denotes |
marrow |
T3789 |
7620-7627 |
NN |
denotes |
lineage |
T3790 |
7628-7629 |
NNP |
denotes |
[ |
T3791 |
7629-7631 |
CD |
denotes |
28 |
T3792 |
7631-7632 |
NNP |
denotes |
] |
T3793 |
7632-7633 |
. |
denotes |
. |
T3794 |
7634-7636 |
IN |
denotes |
In |
T3795 |
7637-7641 |
DT |
denotes |
this |
T3796 |
7642-7647 |
NN |
denotes |
study |
T3797 |
7647-7648 |
, |
denotes |
, |
T3798 |
7649-7651 |
PRP |
denotes |
we |
T3799 |
7652-7660 |
VBP |
denotes |
describe |
T3800 |
7661-7665 |
IN |
denotes |
that |
T3801 |
7666-7670 |
NNP |
denotes |
Sox6 |
T3802 |
7671-7675 |
RB |
denotes |
also |
T3803 |
7676-7682 |
VBZ |
denotes |
exerts |
T3804 |
7683-7694 |
JJ |
denotes |
pleiotropic |
T3805 |
7695-7702 |
NNS |
denotes |
effects |
T3806 |
7703-7705 |
IN |
denotes |
on |
T3807 |
7706-7720 |
NN |
denotes |
erythropoiesis |
T3808 |
7720-7721 |
. |
denotes |
. |
T3809 |
7722-7727 |
DT |
denotes |
These |
T3810 |
7728-7735 |
NNS |
denotes |
effects |
T3811 |
7736-7743 |
VBP |
denotes |
include |
T3812 |
7744-7751 |
VBN |
denotes |
delayed |
T3813 |
7752-7762 |
NN |
denotes |
maturation |
T3814 |
7763-7765 |
IN |
denotes |
of |
T3815 |
7766-7778 |
NNS |
denotes |
erythrocytes |
T3816 |
7779-7780 |
-LRB- |
denotes |
( |
T3817 |
7780-7784 |
IN |
denotes |
that |
T3818 |
7785-7793 |
RB |
denotes |
normally |
T3819 |
7794-7803 |
JJ |
denotes |
enucleate |
T3820 |
7804-7809 |
RB |
denotes |
prior |
T3821 |
7810-7812 |
TO |
denotes |
to |
T3822 |
7813-7821 |
VBG |
denotes |
entering |
T3823 |
7822-7825 |
DT |
denotes |
the |
T3824 |
7826-7837 |
NN |
denotes |
bloodstream |
T3825 |
7838-7839 |
NNP |
denotes |
[ |
T3826 |
7839-7841 |
CD |
denotes |
27 |
T3827 |
7841-7842 |
NNP |
denotes |
] |
T3828 |
7842-7843 |
-RRB- |
denotes |
) |
T3829 |
7844-7847 |
CC |
denotes |
and |
T3830 |
7848-7854 |
JJR |
denotes |
higher |
T3831 |
7855-7865 |
NN |
denotes |
expression |
T3832 |
7866-7868 |
IN |
denotes |
of |
T3833 |
7869-7878 |
JJ |
denotes |
embryonic |
T3834 |
7879-7885 |
NN |
denotes |
globin |
T3835 |
7886-7891 |
NNS |
denotes |
genes |
T3836 |
7891-7892 |
. |
denotes |
. |
T3837 |
7893-7896 |
DT |
denotes |
The |
T3838 |
7897-7901 |
RBS |
denotes |
most |
T3839 |
7902-7909 |
JJ |
denotes |
extreme |
T3840 |
7910-7916 |
NN |
denotes |
effect |
T3841 |
7917-7919 |
VBZ |
denotes |
is |
T3842 |
7920-7923 |
DT |
denotes |
the |
T3843 |
7924-7935 |
NN |
denotes |
persistence |
T3844 |
7936-7938 |
IN |
denotes |
of |
T3845 |
7939-7943 |
JJ |
denotes |
high |
T3846 |
7944-7954 |
NN |
denotes |
expression |
T3847 |
7955-7957 |
IN |
denotes |
of |
T3848 |
7958-7961 |
DT |
denotes |
the |
T3849 |
7962-7971 |
JJ |
denotes |
embryonic |
T3850 |
7972-7974 |
NN |
denotes |
ɛy |
T3851 |
7975-7981 |
NN |
denotes |
globin |
T3852 |
7982-7986 |
NN |
denotes |
gene |
T3853 |
7986-7987 |
. |
denotes |
. |
T3854 |
7988-7992 |
RB |
denotes |
Here |
T3855 |
7993-7995 |
PRP |
denotes |
we |
T3856 |
7996-8004 |
VBP |
denotes |
describe |
T3857 |
8005-8008 |
CC |
denotes |
and |
T3858 |
8009-8021 |
VBP |
denotes |
characterize |
T3859 |
8022-8025 |
DT |
denotes |
the |
T3860 |
8026-8033 |
NNS |
denotes |
effects |
T3861 |
8034-8036 |
IN |
denotes |
of |
T3862 |
8037-8041 |
NNP |
denotes |
Sox6 |
T3863 |
8042-8044 |
IN |
denotes |
on |
T3864 |
8045-8048 |
DT |
denotes |
the |
T3865 |
8049-8051 |
JJ |
denotes |
ɛy |
T3866 |
8052-8058 |
NN |
denotes |
globin |
T3867 |
8059-8063 |
NN |
denotes |
gene |
T3868 |
8063-8064 |
. |
denotes |
. |
T3869 |
8065-8067 |
PRP |
denotes |
We |
T3870 |
8068-8072 |
VBP |
denotes |
show |
T3871 |
8073-8077 |
IN |
denotes |
that |
T3872 |
8078-8082 |
JJ |
denotes |
Sox6 |
T3873 |
8083-8088 |
NNS |
denotes |
binds |
T3874 |
8089-8091 |
TO |
denotes |
to |
T3875 |
8092-8095 |
DT |
denotes |
the |
T3876 |
8096-8104 |
JJ |
denotes |
proximal |
T3877 |
8105-8113 |
NN |
denotes |
promoter |
T3878 |
8114-8116 |
IN |
denotes |
of |
T3879 |
8117-8119 |
JJ |
denotes |
ɛy |
T3880 |
8120-8126 |
NN |
denotes |
globin |
T3881 |
8127-8130 |
CC |
denotes |
and |
T3882 |
8131-8140 |
VBZ |
denotes |
represses |
T3883 |
8141-8144 |
PRP$ |
denotes |
its |
T3884 |
8145-8158 |
NN |
denotes |
transcription |
T3885 |
8158-8159 |
. |
denotes |
. |
T3886 |
8160-8162 |
IN |
denotes |
In |
T3887 |
8163-8172 |
JJ |
denotes |
wild-type |
T3888 |
8173-8174 |
-LRB- |
denotes |
( |
T3889 |
8174-8176 |
NNP |
denotes |
WT |
T3890 |
8176-8177 |
-RRB- |
denotes |
) |
T3891 |
8178-8182 |
NNS |
denotes |
mice |
T3892 |
8182-8183 |
, |
denotes |
, |
T3893 |
8184-8188 |
NNP |
denotes |
Sox6 |
T3894 |
8189-8191 |
VBZ |
denotes |
is |
T3895 |
8192-8195 |
RB |
denotes |
not |
T3896 |
8196-8205 |
VBN |
denotes |
expressed |
T3897 |
8206-8208 |
IN |
denotes |
in |
T3898 |
8209-8213 |
NN |
denotes |
yolk |
T3899 |
8214-8217 |
NN |
denotes |
sac |
T3900 |
8218-8223 |
NN |
denotes |
blood |
T3901 |
8224-8231 |
NNS |
denotes |
islands |
T3902 |
8231-8232 |
, |
denotes |
, |
T3903 |
8233-8236 |
CC |
denotes |
but |
T3904 |
8237-8239 |
VBZ |
denotes |
is |
T3905 |
8240-8249 |
VBN |
denotes |
expressed |
T3906 |
8250-8252 |
IN |
denotes |
in |
T3907 |
8253-8258 |
JJ |
denotes |
fetal |
T3908 |
8259-8264 |
NN |
denotes |
liver |
T3909 |
8264-8265 |
, |
denotes |
, |
T3910 |
8266-8269 |
DT |
denotes |
the |
T3911 |
8270-8278 |
JJ |
denotes |
opposite |
T3912 |
8279-8289 |
NN |
denotes |
expression |
T3913 |
8290-8297 |
NN |
denotes |
pattern |
T3914 |
8298-8300 |
IN |
denotes |
of |
T3915 |
8301-8303 |
JJ |
denotes |
ɛy |
T3916 |
8304-8310 |
NN |
denotes |
globin |
T3917 |
8310-8311 |
. |
denotes |
. |
T3918 |
8312-8314 |
IN |
denotes |
In |
T3919 |
8315-8318 |
DT |
denotes |
the |
T3920 |
8319-8326 |
NN |
denotes |
absence |
T3921 |
8327-8329 |
IN |
denotes |
of |
T3922 |
8330-8334 |
NNP |
denotes |
Sox6 |
T3923 |
8334-8335 |
, |
denotes |
, |
T3924 |
8336-8338 |
JJ |
denotes |
ɛy |
T3925 |
8339-8345 |
NN |
denotes |
globin |
T3926 |
8346-8348 |
VBZ |
denotes |
is |
T3927 |
8349-8360 |
RB |
denotes |
ectopically |
T3928 |
8361-8370 |
VBN |
denotes |
expressed |
T3929 |
8371-8373 |
IN |
denotes |
in |
T3930 |
8374-8377 |
DT |
denotes |
the |
T3931 |
8378-8383 |
JJ |
denotes |
fetal |
T3932 |
8384-8389 |
NN |
denotes |
liver |
T3933 |
8389-8390 |
, |
denotes |
, |
T3934 |
8391-8404 |
VBG |
denotes |
demonstrating |
T3935 |
8405-8409 |
IN |
denotes |
that |
T3936 |
8410-8414 |
JJ |
denotes |
Sox6 |
T3937 |
8415-8424 |
NNS |
denotes |
functions |
T3938 |
8425-8427 |
IN |
denotes |
in |
T3939 |
8428-8438 |
JJ |
denotes |
definitive |
T3940 |
8439-8453 |
NNS |
denotes |
erythropoiesis |
T3941 |
8453-8454 |
. |
denotes |
. |
T4964 |
8465-8475 |
JJ |
denotes |
Persistent |
T4965 |
8476-8486 |
NN |
denotes |
Expression |
T4966 |
8487-8489 |
IN |
denotes |
of |
T4967 |
8490-8493 |
DT |
denotes |
the |
T4968 |
8494-8503 |
NNP |
denotes |
Embryonic |
T4969 |
8504-8510 |
NNP |
denotes |
Globin |
T4970 |
8510-8511 |
, |
denotes |
, |
T4971 |
8512-8514 |
NN |
denotes |
ɛy |
T4972 |
8514-8515 |
, |
denotes |
, |
T4973 |
8516-8518 |
IN |
denotes |
in |
T4974 |
8519-8533 |
JJ |
denotes |
Sox6-Deficient |
T4975 |
8534-8538 |
NNP |
denotes |
Mice |
T4976 |
8539-8542 |
DT |
denotes |
The |
T4977 |
8543-8545 |
JJ |
denotes |
ɛy |
T4978 |
8546-8552 |
NN |
denotes |
globin |
T4979 |
8553-8557 |
NN |
denotes |
gene |
T4980 |
8558-8561 |
VBD |
denotes |
was |
T4981 |
8562-8571 |
RB |
denotes |
initially |
T4982 |
8572-8582 |
VBN |
denotes |
identified |
T4983 |
8583-8585 |
IN |
denotes |
as |
T4984 |
8586-8588 |
DT |
denotes |
an |
T4985 |
8589-8600 |
JJ |
denotes |
upregulated |
T4986 |
8601-8611 |
NN |
denotes |
transcript |
T4987 |
8612-8614 |
IN |
denotes |
in |
T4988 |
8615-8618 |
DT |
denotes |
the |
T4989 |
8619-8625 |
JJ |
denotes |
p 100H |
T4990 |
8626-8631 |
NN |
denotes |
mouse |
T4991 |
8632-8637 |
VBG |
denotes |
using |
T4992 |
8638-8649 |
JJ |
denotes |
subtractive |
T4993 |
8650-8663 |
NN |
denotes |
hybridization |
T4994 |
8664-8666 |
TO |
denotes |
to |
T4995 |
8667-8675 |
VB |
denotes |
identify |
T4996 |
8676-8680 |
JJ |
denotes |
Sox6 |
T4997 |
8681-8691 |
JJ |
denotes |
downstream |
T4998 |
8692-8699 |
NNS |
denotes |
targets |
T4999 |
8699-8700 |
. |
denotes |
. |
T5000 |
8701-8705 |
DT |
denotes |
This |
T5001 |
8706-8713 |
JJ |
denotes |
initial |
T5002 |
8714-8725 |
NN |
denotes |
observation |
T5003 |
8726-8729 |
VBD |
denotes |
was |
T5004 |
8730-8739 |
VBN |
denotes |
confirmed |
T5005 |
8740-8742 |
IN |
denotes |
in |
T5006 |
8743-8745 |
DT |
denotes |
an |
T5007 |
8746-8757 |
JJ |
denotes |
independent |
T5008 |
8758-8767 |
JJ |
denotes |
knock-out |
T5009 |
8768-8774 |
NN |
denotes |
allele |
T5010 |
8775-8777 |
IN |
denotes |
of |
T5011 |
8778-8782 |
NNP |
denotes |
Sox6 |
T5012 |
8783-8784 |
NNP |
denotes |
[ |
T5013 |
8784-8786 |
CD |
denotes |
13 |
T5014 |
8786-8787 |
NNP |
denotes |
] |
T5015 |
8788-8793 |
VBG |
denotes |
using |
T5016 |
8794-8803 |
JJ |
denotes |
real-time |
T5017 |
8804-8814 |
NN |
denotes |
polymerase |
T5018 |
8815-8820 |
NN |
denotes |
chain |
T5019 |
8821-8829 |
NN |
denotes |
reaction |
T5020 |
8830-8831 |
-LRB- |
denotes |
( |
T5021 |
8831-8834 |
NNP |
denotes |
PCR |
T5022 |
8834-8835 |
-RRB- |
denotes |
) |
T5023 |
8836-8837 |
-LRB- |
denotes |
( |
T5024 |
8837-8848 |
JJ |
denotes |
unpublished |
T5025 |
8849-8853 |
NNS |
denotes |
data |
T5026 |
8853-8854 |
-RRB- |
denotes |
) |
T5027 |
8854-8855 |
. |
denotes |
. |
T5028 |
8856-8865 |
JJ |
denotes |
Real-time |
T5029 |
8866-8869 |
NNP |
denotes |
PCR |
T5030 |
8870-8873 |
VBD |
denotes |
was |
T5031 |
8874-8878 |
VBN |
denotes |
used |
T5032 |
8879-8881 |
TO |
denotes |
to |
T5033 |
8882-8892 |
VB |
denotes |
quantitate |
T5034 |
8893-8896 |
DT |
denotes |
the |
T5035 |
8897-8907 |
NN |
denotes |
expression |
T5036 |
8908-8914 |
NNS |
denotes |
levels |
T5037 |
8915-8917 |
IN |
denotes |
of |
T5038 |
8918-8923 |
JJ |
denotes |
other |
T5039 |
8924-8930 |
NN |
denotes |
globin |
T5040 |
8931-8936 |
NNS |
denotes |
genes |
T5041 |
8937-8939 |
IN |
denotes |
in |
T5042 |
8940-8945 |
JJ |
denotes |
p100H |
T5043 |
8946-8952 |
JJ |
denotes |
mutant |
T5044 |
8953-8956 |
CC |
denotes |
and |
T5045 |
8957-8959 |
NNP |
denotes |
WT |
T5046 |
8960-8965 |
NN |
denotes |
mouse |
T5047 |
8966-8972 |
NNS |
denotes |
livers |
T5048 |
8973-8975 |
IN |
denotes |
at |
T5049 |
8976-8979 |
CD |
denotes |
two |
T5050 |
8980-8993 |
JJ |
denotes |
developmental |
T5051 |
8994-9000 |
NNS |
denotes |
stages |
T5052 |
9000-9001 |
, |
denotes |
, |
T5053 |
9002-9006 |
CD |
denotes |
15.5 |
T5054 |
9007-9010 |
NN |
denotes |
dpc |
T5055 |
9011-9014 |
CC |
denotes |
and |
T5056 |
9015-9019 |
CD |
denotes |
18.5 |
T5057 |
9020-9023 |
NN |
denotes |
dpc |
T5058 |
9023-9024 |
. |
denotes |
. |
T5059 |
9025-9027 |
IN |
denotes |
As |
T5060 |
9028-9033 |
VBN |
denotes |
shown |
T5061 |
9034-9036 |
IN |
denotes |
in |
T5062 |
9037-9043 |
NN |
denotes |
Figure |
T5063 |
9044-9045 |
CD |
denotes |
1 |
T5064 |
9045-9046 |
, |
denotes |
, |
T5065 |
9047-9050 |
DT |
denotes |
the |
T5066 |
9051-9053 |
JJ |
denotes |
ɛy |
T5067 |
9054-9058 |
NN |
denotes |
gene |
T5068 |
9059-9061 |
VBZ |
denotes |
is |
T5069 |
9062-9071 |
VBN |
denotes |
expressed |
T5070 |
9072-9074 |
IN |
denotes |
at |
T5071 |
9075-9079 |
JJ |
denotes |
high |
T5072 |
9080-9086 |
NNS |
denotes |
levels |
T5073 |
9087-9089 |
IN |
denotes |
at |
T5074 |
9090-9094 |
DT |
denotes |
both |
T5075 |
9095-9099 |
NN |
denotes |
time |
T5076 |
9100-9106 |
NNS |
denotes |
points |
T5077 |
9107-9109 |
IN |
denotes |
in |
T5078 |
9110-9116 |
JJ |
denotes |
mutant |
T5079 |
9117-9121 |
NNS |
denotes |
mice |
T5080 |
9121-9122 |
, |
denotes |
, |
T5081 |
9123-9125 |
IN |
denotes |
in |
T5082 |
9126-9134 |
NN |
denotes |
contrast |
T5083 |
9135-9137 |
TO |
denotes |
to |
T5084 |
9138-9141 |
DT |
denotes |
the |
T5085 |
9142-9149 |
NN |
denotes |
decline |
T5086 |
9150-9152 |
IN |
denotes |
in |
T5087 |
9153-9163 |
NN |
denotes |
expression |
T5088 |
9164-9172 |
VBN |
denotes |
observed |
T5089 |
9173-9175 |
IN |
denotes |
in |
T5090 |
9176-9178 |
NNP |
denotes |
WT |
T5091 |
9179-9183 |
NNS |
denotes |
mice |
T5092 |
9183-9184 |
. |
denotes |
. |
T5093 |
9185-9187 |
DT |
denotes |
No |
T5094 |
9188-9198 |
NN |
denotes |
difference |
T5095 |
9199-9202 |
VBD |
denotes |
was |
T5096 |
9203-9207 |
VBN |
denotes |
seen |
T5097 |
9208-9215 |
IN |
denotes |
between |
T5098 |
9216-9218 |
NNP |
denotes |
WT |
T5099 |
9219-9222 |
CC |
denotes |
and |
T5100 |
9223-9235 |
JJ |
denotes |
heterozygous |
T5101 |
9236-9240 |
NNS |
denotes |
mice |
T5102 |
9241-9242 |
-LRB- |
denotes |
( |
T5103 |
9242-9253 |
JJ |
denotes |
unpublished |
T5104 |
9254-9258 |
NNS |
denotes |
data |
T5105 |
9258-9259 |
-RRB- |
denotes |
) |
T5106 |
9259-9260 |
. |
denotes |
. |
T5107 |
9261-9274 |
RB |
denotes |
Interestingly |
T5108 |
9274-9275 |
, |
denotes |
, |
T5109 |
9276-9279 |
DT |
denotes |
the |
T5110 |
9280-9290 |
NN |
denotes |
expression |
T5111 |
9291-9297 |
NNS |
denotes |
levels |
T5112 |
9298-9300 |
IN |
denotes |
of |
T5113 |
9301-9304 |
DT |
denotes |
the |
T5114 |
9305-9310 |
JJ |
denotes |
other |
T5115 |
9311-9314 |
CD |
denotes |
two |
T5116 |
9315-9324 |
JJ |
denotes |
embryonic |
T5117 |
9325-9331 |
NN |
denotes |
globin |
T5118 |
9332-9337 |
NNS |
denotes |
genes |
T5119 |
9338-9339 |
-LRB- |
denotes |
( |
T5120 |
9339-9340 |
NN |
denotes |
ζ |
T5121 |
9341-9344 |
CC |
denotes |
and |
T5122 |
9345-9348 |
CD |
denotes |
βh1 |
T5123 |
9348-9349 |
-RRB- |
denotes |
) |
T5124 |
9350-9353 |
VBP |
denotes |
are |
T5125 |
9354-9358 |
RB |
denotes |
also |
T5126 |
9359-9365 |
JJR |
denotes |
higher |
T5127 |
9366-9368 |
IN |
denotes |
in |
T5128 |
9369-9374 |
JJ |
denotes |
p100H |
T5129 |
9375-9385 |
JJ |
denotes |
homozygous |
T5130 |
9386-9390 |
NNS |
denotes |
mice |
T5131 |
9390-9391 |
, |
denotes |
, |
T5132 |
9392-9400 |
VBN |
denotes |
compared |
T5133 |
9401-9405 |
IN |
denotes |
with |
T5134 |
9406-9408 |
NNP |
denotes |
WT |
T5135 |
9409-9413 |
NNS |
denotes |
mice |
T5136 |
9413-9414 |
, |
denotes |
, |
T5137 |
9415-9418 |
CC |
denotes |
but |
T5138 |
9419-9421 |
TO |
denotes |
to |
T5139 |
9422-9423 |
DT |
denotes |
a |
T5140 |
9424-9428 |
JJ |
denotes |
much |
T5141 |
9429-9435 |
JJR |
denotes |
lesser |
T5142 |
9436-9442 |
NN |
denotes |
extent |
T5143 |
9443-9447 |
IN |
denotes |
than |
T5144 |
9448-9452 |
VBN |
denotes |
seen |
T5145 |
9453-9456 |
IN |
denotes |
for |
T5146 |
9457-9459 |
JJ |
denotes |
ɛy |
T5147 |
9460-9466 |
NN |
denotes |
globin |
T5148 |
9467-9469 |
IN |
denotes |
at |
T5149 |
9470-9474 |
CD |
denotes |
18.5 |
T5150 |
9475-9478 |
NN |
denotes |
dpc |
T5151 |
9479-9480 |
-LRB- |
denotes |
( |
T5152 |
9480-9486 |
NN |
denotes |
Figure |
T5153 |
9487-9488 |
CD |
denotes |
1 |
T5154 |
9488-9489 |
-RRB- |
denotes |
) |
T5155 |
9489-9490 |
. |
denotes |
. |
T5156 |
9491-9499 |
RB |
denotes |
Moreover |
T5157 |
9499-9500 |
, |
denotes |
, |
T5158 |
9501-9504 |
DT |
denotes |
the |
T5159 |
9505-9515 |
NN |
denotes |
expression |
T5160 |
9516-9521 |
NN |
denotes |
level |
T5161 |
9522-9524 |
IN |
denotes |
of |
T5162 |
9525-9530 |
NN |
denotes |
adult |
T5163 |
9531-9532 |
NN |
denotes |
β |
T5164 |
9533-9539 |
NN |
denotes |
globin |
T5165 |
9540-9542 |
VBZ |
denotes |
is |
T5166 |
9543-9547 |
RB |
denotes |
also |
T5167 |
9548-9556 |
RB |
denotes |
somewhat |
T5168 |
9557-9563 |
JJR |
denotes |
higher |
T5169 |
9564-9566 |
IN |
denotes |
in |
T5170 |
9567-9572 |
JJ |
denotes |
p100H |
T5171 |
9573-9583 |
JJ |
denotes |
homozygous |
T5172 |
9584-9588 |
NNS |
denotes |
mice |
T5173 |
9589-9593 |
IN |
denotes |
than |
T5174 |
9594-9596 |
IN |
denotes |
in |
T5175 |
9597-9599 |
NNP |
denotes |
WT |
T5176 |
9600-9604 |
NNS |
denotes |
mice |
T5177 |
9605-9607 |
IN |
denotes |
at |
T5178 |
9608-9612 |
CD |
denotes |
18.5 |
T5179 |
9613-9616 |
NN |
denotes |
dpc |
T5180 |
9617-9618 |
-LRB- |
denotes |
( |
T5181 |
9618-9624 |
NN |
denotes |
Figure |
T5182 |
9625-9626 |
CD |
denotes |
1 |
T5183 |
9626-9627 |
-RRB- |
denotes |
) |
T5184 |
9627-9628 |
. |
denotes |
. |
T5185 |
9629-9638 |
JJ |
denotes |
Perinatal |
T5186 |
9639-9648 |
NN |
denotes |
lethality |
T5187 |
9649-9651 |
IN |
denotes |
of |
T5188 |
9652-9658 |
JJ |
denotes |
mutant |
T5189 |
9659-9663 |
NNS |
denotes |
mice |
T5190 |
9664-9665 |
-LRB- |
denotes |
( |
T5191 |
9665-9675 |
RB |
denotes |
presumably |
T5192 |
9676-9680 |
IN |
denotes |
from |
T5193 |
9681-9684 |
DT |
denotes |
the |
T5194 |
9685-9690 |
NN |
denotes |
heart |
T5195 |
9691-9697 |
NN |
denotes |
defect |
T5196 |
9698-9699 |
NNP |
denotes |
[ |
T5197 |
9699-9701 |
CD |
denotes |
14 |
T5198 |
9701-9702 |
NNP |
denotes |
] |
T5199 |
9702-9703 |
-RRB- |
denotes |
) |
T5200 |
9704-9713 |
VBZ |
denotes |
precludes |
T5201 |
9714-9716 |
PRP |
denotes |
us |
T5202 |
9717-9721 |
IN |
denotes |
from |
T5203 |
9722-9732 |
VBG |
denotes |
evaluating |
T5204 |
9733-9742 |
JJ |
denotes |
postnatal |
T5205 |
9743-9749 |
NN |
denotes |
globin |
T5206 |
9750-9760 |
NN |
denotes |
expression |
T5207 |
9760-9761 |
. |
denotes |
. |
T5208 |
9762-9765 |
DT |
denotes |
The |
T5209 |
9766-9772 |
NNS |
denotes |
graphs |
T5210 |
9773-9775 |
IN |
denotes |
in |
T5211 |
9776-9782 |
NN |
denotes |
Figure |
T5212 |
9783-9784 |
CD |
denotes |
1 |
T5213 |
9785-9795 |
VBP |
denotes |
illustrate |
T5214 |
9796-9800 |
JJ |
denotes |
real |
T5215 |
9801-9805 |
NN |
denotes |
time |
T5216 |
9806-9809 |
NNP |
denotes |
PCR |
T5217 |
9810-9817 |
NNS |
denotes |
results |
T5218 |
9818-9822 |
WDT |
denotes |
that |
T5219 |
9823-9827 |
VBD |
denotes |
were |
T5220 |
9828-9837 |
VBN |
denotes |
performed |
T5221 |
9838-9840 |
IN |
denotes |
in |
T5222 |
9841-9851 |
NN |
denotes |
triplicate |
T5223 |
9852-9853 |
-LRB- |
denotes |
( |
T5224 |
9853-9861 |
JJ |
denotes |
standard |
T5225 |
9862-9871 |
NN |
denotes |
deviation |
T5226 |
9872-9874 |
IN |
denotes |
of |
T5227 |
9875-9878 |
DT |
denotes |
the |
T5228 |
9879-9883 |
NN |
denotes |
data |
T5229 |
9884-9886 |
VBZ |
denotes |
is |
T5230 |
9887-9892 |
VBN |
denotes |
shown |
T5231 |
9893-9895 |
IN |
denotes |
by |
T5232 |
9896-9901 |
NN |
denotes |
error |
T5233 |
9902-9906 |
NNS |
denotes |
bars |
T5234 |
9906-9907 |
-RRB- |
denotes |
) |
T5235 |
9907-9908 |
. |
denotes |
. |
T5236 |
9909-9916 |
IN |
denotes |
Because |
T5237 |
9917-9920 |
DT |
denotes |
all |
T5238 |
9921-9923 |
IN |
denotes |
of |
T5239 |
9924-9927 |
DT |
denotes |
the |
T5240 |
9928-9934 |
NNS |
denotes |
assays |
T5241 |
9935-9939 |
VBD |
denotes |
were |
T5242 |
9940-9949 |
VBN |
denotes |
performed |
T5243 |
9950-9952 |
IN |
denotes |
at |
T5244 |
9953-9956 |
DT |
denotes |
the |
T5245 |
9957-9961 |
JJ |
denotes |
same |
T5246 |
9962-9966 |
NN |
denotes |
time |
T5247 |
9967-9971 |
IN |
denotes |
with |
T5248 |
9972-9975 |
DT |
denotes |
the |
T5249 |
9976-9980 |
JJ |
denotes |
same |
T5250 |
9981-9989 |
JJ |
denotes |
internal |
T5251 |
9990-9997 |
NN |
denotes |
control |
T5252 |
9997-9998 |
, |
denotes |
, |
T5253 |
9999-10002 |
DT |
denotes |
the |
T5254 |
10003-10009 |
NNS |
denotes |
levels |
T5255 |
10010-10015 |
VBN |
denotes |
shown |
T5256 |
10016-10019 |
VBP |
denotes |
are |
T5257 |
10020-10028 |
JJ |
denotes |
relative |
T5258 |
10029-10035 |
NNS |
denotes |
levels |
T5259 |
10036-10039 |
CC |
denotes |
and |
T5260 |
10040-10043 |
VBP |
denotes |
are |
T5261 |
10044-10048 |
RB |
denotes |
thus |
T5262 |
10049-10059 |
JJ |
denotes |
comparable |
T5263 |
10060-10066 |
IN |
denotes |
across |
T5264 |
10067-10070 |
DT |
denotes |
all |
T5265 |
10071-10078 |
NNS |
denotes |
samples |
T5266 |
10079-10082 |
CC |
denotes |
and |
T5267 |
10083-10086 |
VBP |
denotes |
are |
T5268 |
10087-10089 |
IN |
denotes |
in |
T5269 |
10090-10099 |
NN |
denotes |
agreement |
T5270 |
10100-10104 |
IN |
denotes |
with |
T5271 |
10105-10115 |
RB |
denotes |
previously |
T5272 |
10116-10125 |
VBN |
denotes |
published |
T5273 |
10126-10133 |
NNS |
denotes |
results |
T5274 |
10134-10137 |
IN |
denotes |
for |
T5275 |
10138-10140 |
NNP |
denotes |
WT |
T5276 |
10141-10146 |
JJ |
denotes |
fetal |
T5277 |
10147-10151 |
NNS |
denotes |
mice |
T5278 |
10152-10153 |
NNP |
denotes |
[ |
T5279 |
10153-10155 |
CD |
denotes |
29 |
T5280 |
10155-10156 |
NNP |
denotes |
] |
T5281 |
10156-10157 |
. |
denotes |
. |
T5282 |
10158-10160 |
PRP |
denotes |
We |
T5283 |
10161-10165 |
VBP |
denotes |
note |
T5284 |
10166-10170 |
IN |
denotes |
that |
T5285 |
10171-10174 |
DT |
denotes |
the |
T5286 |
10175-10180 |
NN |
denotes |
level |
T5287 |
10181-10183 |
IN |
denotes |
of |
T5288 |
10184-10186 |
JJ |
denotes |
ɛy |
T5289 |
10187-10197 |
NN |
denotes |
expression |
T5290 |
10198-10200 |
IN |
denotes |
in |
T5291 |
10201-10204 |
DT |
denotes |
the |
T5292 |
10205-10211 |
NNS |
denotes |
livers |
T5293 |
10212-10214 |
IN |
denotes |
of |
T5294 |
10215-10219 |
CD |
denotes |
15.5 |
T5295 |
10220-10223 |
NN |
denotes |
dpc |
T5296 |
10224-10227 |
CC |
denotes |
and |
T5297 |
10228-10232 |
CD |
denotes |
18.5 |
T5298 |
10233-10236 |
NN |
denotes |
dpc |
T5299 |
10237-10247 |
JJ |
denotes |
homozygous |
T5300 |
10248-10254 |
JJ |
denotes |
mutant |
T5301 |
10255-10259 |
NNS |
denotes |
mice |
T5302 |
10260-10262 |
VBZ |
denotes |
is |
T5303 |
10263-10276 |
RB |
denotes |
statistically |
T5304 |
10277-10287 |
JJ |
denotes |
equivalent |
T5305 |
10288-10290 |
TO |
denotes |
to |
T5306 |
10291-10294 |
DT |
denotes |
the |
T5307 |
10295-10300 |
NN |
denotes |
level |
T5308 |
10301-10303 |
IN |
denotes |
of |
T5309 |
10304-10308 |
NN |
denotes |
βmaj |
T5310 |
10308-10309 |
NN |
denotes |
/ |
T5311 |
10309-10312 |
NN |
denotes |
min |
T5312 |
10313-10323 |
NN |
denotes |
expression |
T5313 |
10324-10326 |
IN |
denotes |
in |
T5314 |
10327-10330 |
DT |
denotes |
the |
T5315 |
10331-10337 |
NNS |
denotes |
livers |
T5316 |
10338-10340 |
IN |
denotes |
of |
T5317 |
10341-10345 |
CD |
denotes |
15.5 |
T5318 |
10346-10349 |
NN |
denotes |
dpc |
T5319 |
10350-10353 |
CC |
denotes |
and |
T5320 |
10354-10358 |
CD |
denotes |
18.5 |
T5321 |
10359-10362 |
NN |
denotes |
dpc |
T5322 |
10363-10373 |
JJ |
denotes |
homozygous |
T5323 |
10374-10376 |
NNP |
denotes |
WT |
T5324 |
10377-10381 |
NNS |
denotes |
mice |
T5325 |
10381-10382 |
. |
denotes |
. |
T6363 |
10796-10808 |
NNP |
denotes |
Transfection |
T6364 |
10809-10816 |
NNP |
denotes |
Studies |
T6365 |
10817-10822 |
VBG |
denotes |
Using |
T6366 |
10823-10828 |
NNP |
denotes |
GM979 |
T6367 |
10829-10834 |
NNP |
denotes |
Cells |
T6368 |
10835-10843 |
NNP |
denotes |
Indicate |
T6369 |
10844-10848 |
WDT |
denotes |
That |
T6370 |
10849-10853 |
NNP |
denotes |
Sox6 |
T6371 |
10854-10862 |
RB |
denotes |
Directly |
T6372 |
10863-10872 |
NNPS |
denotes |
Represses |
T6373 |
10873-10876 |
DT |
denotes |
the |
T6374 |
10877-10879 |
NN |
denotes |
ɛy |
T6375 |
10880-10884 |
NNP |
denotes |
Gene |
T6376 |
10885-10893 |
NNP |
denotes |
Promoter |
T6377 |
10894-10896 |
IN |
denotes |
at |
T6378 |
10897-10900 |
DT |
denotes |
the |
T6379 |
10901-10916 |
NNP |
denotes |
Transcriptional |
T6380 |
10917-10922 |
NNP |
denotes |
Level |
T6381 |
10923-10932 |
JJ |
denotes |
Real-time |
T6382 |
10933-10936 |
NNP |
denotes |
PCR |
T6383 |
10937-10943 |
NNS |
denotes |
assays |
T6384 |
10944-10945 |
-LRB- |
denotes |
( |
T6385 |
10945-10951 |
NN |
denotes |
Figure |
T6386 |
10952-10953 |
CD |
denotes |
1 |
T6387 |
10953-10954 |
-RRB- |
denotes |
) |
T6388 |
10955-10962 |
NN |
denotes |
measure |
T6389 |
10963-10975 |
JJ |
denotes |
steady-state |
T6390 |
10976-10982 |
NNS |
denotes |
levels |
T6391 |
10983-10985 |
IN |
denotes |
of |
T6392 |
10986-10988 |
JJ |
denotes |
ɛy |
T6393 |
10989-10993 |
NNP |
denotes |
mRNA |
T6394 |
10993-10994 |
, |
denotes |
, |
T6395 |
10995-10998 |
RB |
denotes |
not |
T6396 |
10999-11014 |
JJ |
denotes |
transcriptional |
T6397 |
11015-11023 |
NN |
denotes |
activity |
T6398 |
11024-11026 |
IN |
denotes |
of |
T6399 |
11027-11030 |
DT |
denotes |
the |
T6400 |
11031-11033 |
JJ |
denotes |
ɛy |
T6401 |
11034-11042 |
NN |
denotes |
promoter |
T6402 |
11042-11043 |
. |
denotes |
. |
T6403 |
11044-11046 |
TO |
denotes |
To |
T6404 |
11047-11058 |
VB |
denotes |
investigate |
T6405 |
11059-11066 |
IN |
denotes |
whether |
T6406 |
11067-11071 |
JJ |
denotes |
Sox6 |
T6407 |
11072-11080 |
RB |
denotes |
directly |
T6408 |
11081-11085 |
VBZ |
denotes |
acts |
T6409 |
11086-11088 |
IN |
denotes |
on |
T6410 |
11089-11092 |
DT |
denotes |
the |
T6411 |
11093-11095 |
JJ |
denotes |
ɛy |
T6412 |
11096-11100 |
NN |
denotes |
gene |
T6413 |
11101-11109 |
NN |
denotes |
promoter |
T6414 |
11110-11112 |
IN |
denotes |
at |
T6415 |
11113-11116 |
DT |
denotes |
the |
T6416 |
11117-11132 |
JJ |
denotes |
transcriptional |
T6417 |
11133-11138 |
NN |
denotes |
level |
T6418 |
11138-11139 |
, |
denotes |
, |
T6419 |
11140-11142 |
PRP |
denotes |
we |
T6420 |
11143-11147 |
VBD |
denotes |
used |
T6421 |
11148-11150 |
DT |
denotes |
an |
T6422 |
11151-11153 |
IN |
denotes |
in |
T6423 |
11154-11159 |
NN |
denotes |
vitro |
T6424 |
11160-11169 |
NN |
denotes |
transient |
T6425 |
11170-11182 |
NN |
denotes |
transfection |
T6426 |
11183-11188 |
NN |
denotes |
assay |
T6427 |
11189-11192 |
CC |
denotes |
and |
T6428 |
11193-11198 |
NNP |
denotes |
GM979 |
T6429 |
11199-11204 |
NNS |
denotes |
cells |
T6430 |
11204-11205 |
, |
denotes |
, |
T6431 |
11206-11207 |
DT |
denotes |
a |
T6432 |
11208-11214 |
JJ |
denotes |
murine |
T6433 |
11215-11230 |
JJ |
denotes |
erythroleukemic |
T6434 |
11231-11235 |
NN |
denotes |
cell |
T6435 |
11236-11240 |
NN |
denotes |
line |
T6436 |
11241-11245 |
WDT |
denotes |
that |
T6437 |
11246-11255 |
VBZ |
denotes |
expresses |
T6438 |
11256-11260 |
DT |
denotes |
both |
T6439 |
11261-11263 |
NN |
denotes |
ɛy |
T6440 |
11264-11267 |
CC |
denotes |
and |
T6441 |
11268-11273 |
NN |
denotes |
adult |
T6442 |
11274-11278 |
JJ |
denotes |
beta |
T6443 |
11279-11286 |
NNS |
denotes |
globins |
T6444 |
11287-11288 |
NNP |
denotes |
[ |
T6445 |
11288-11290 |
CD |
denotes |
30 |
T6446 |
11290-11291 |
NNP |
denotes |
] |
T6447 |
11291-11292 |
. |
denotes |
. |
T6448 |
11293-11295 |
PRP |
denotes |
We |
T6449 |
11296-11305 |
VBD |
denotes |
generated |
T6450 |
11306-11308 |
DT |
denotes |
an |
T6451 |
11309-11311 |
JJ |
denotes |
ɛy |
T6452 |
11312-11320 |
NN |
denotes |
promoter |
T6453 |
11321-11329 |
NN |
denotes |
reporter |
T6454 |
11330-11339 |
VBP |
denotes |
construct |
T6455 |
11340-11341 |
-LRB- |
denotes |
( |
T6456 |
11341-11346 |
JJ |
denotes |
E-Luc |
T6457 |
11346-11347 |
-RRB- |
denotes |
) |
T6458 |
11348-11350 |
IN |
denotes |
by |
T6459 |
11351-11357 |
NN |
denotes |
fusing |
T6460 |
11358-11359 |
DT |
denotes |
a |
T6461 |
11360-11369 |
NN |
denotes |
micro-LCR |
T6462 |
11370-11371 |
-LRB- |
denotes |
( |
T6463 |
11371-11375 |
NNP |
denotes |
μLCR |
T6464 |
11375-11376 |
-RRB- |
denotes |
) |
T6465 |
11377-11384 |
NN |
denotes |
element |
T6466 |
11385-11386 |
-LRB- |
denotes |
( |
T6467 |
11386-11389 |
CD |
denotes |
2.5 |
T6468 |
11390-11392 |
NN |
denotes |
kb |
T6469 |
11392-11393 |
-RRB- |
denotes |
) |
T6470 |
11394-11395 |
NNP |
denotes |
[ |
T6471 |
11395-11397 |
CD |
denotes |
31 |
T6472 |
11397-11398 |
NNP |
denotes |
] |
T6473 |
11399-11401 |
TO |
denotes |
to |
T6474 |
11402-11405 |
DT |
denotes |
the |
T6475 |
11406-11408 |
JJ |
denotes |
ɛy |
T6476 |
11409-11417 |
JJ |
denotes |
proximal |
T6477 |
11418-11426 |
NN |
denotes |
promoter |
T6478 |
11427-11428 |
-LRB- |
denotes |
( |
T6479 |
11428-11431 |
CD |
denotes |
2.2 |
T6480 |
11432-11434 |
NN |
denotes |
kb |
T6481 |
11434-11435 |
-RRB- |
denotes |
) |
T6482 |
11435-11436 |
, |
denotes |
, |
T6483 |
11437-11445 |
VBN |
denotes |
followed |
T6484 |
11446-11448 |
IN |
denotes |
by |
T6485 |
11449-11452 |
DT |
denotes |
the |
T6486 |
11453-11463 |
NN |
denotes |
luciferase |
T6487 |
11464-11472 |
NN |
denotes |
reporter |
T6488 |
11473-11477 |
NN |
denotes |
gene |
T6489 |
11477-11478 |
, |
denotes |
, |
T6490 |
11479-11481 |
IN |
denotes |
as |
T6491 |
11482-11487 |
VBN |
denotes |
shown |
T6492 |
11488-11490 |
IN |
denotes |
in |
T6493 |
11491-11497 |
NN |
denotes |
Figure |
T6494 |
11498-11500 |
CD |
denotes |
2A |
T6495 |
11501-11502 |
-LRB- |
denotes |
( |
T6496 |
11502-11510 |
VBN |
denotes |
detailed |
T6497 |
11511-11513 |
IN |
denotes |
in |
T6498 |
11514-11523 |
NNPS |
denotes |
Materials |
T6499 |
11524-11527 |
CC |
denotes |
and |
T6500 |
11528-11535 |
NNPS |
denotes |
Methods |
T6501 |
11535-11536 |
-RRB- |
denotes |
) |
T6502 |
11536-11537 |
. |
denotes |
. |
T6503 |
11538-11552 |
NNP |
denotes |
Overexpression |
T6504 |
11553-11555 |
IN |
denotes |
of |
T6505 |
11556-11560 |
NNP |
denotes |
Sox6 |
T6506 |
11561-11563 |
IN |
denotes |
in |
T6507 |
11564-11569 |
NNP |
denotes |
GM979 |
T6508 |
11570-11575 |
NNS |
denotes |
cells |
T6509 |
11576-11578 |
IN |
denotes |
by |
T6510 |
11579-11588 |
JJ |
denotes |
transient |
T6511 |
11589-11601 |
NN |
denotes |
transfection |
T6512 |
11602-11607 |
VBZ |
denotes |
leads |
T6513 |
11608-11610 |
TO |
denotes |
to |
T6514 |
11611-11612 |
DT |
denotes |
a |
T6515 |
11613-11629 |
JJ |
denotes |
dosage-dependent |
T6516 |
11630-11640 |
NN |
denotes |
repression |
T6517 |
11641-11643 |
IN |
denotes |
of |
T6518 |
11644-11649 |
JJ |
denotes |
E-Luc |
T6519 |
11650-11658 |
NN |
denotes |
reporter |
T6520 |
11659-11667 |
NN |
denotes |
activity |
T6521 |
11668-11669 |
-LRB- |
denotes |
( |
T6522 |
11669-11675 |
NN |
denotes |
Figure |
T6523 |
11676-11678 |
NN |
denotes |
2B |
T6524 |
11678-11679 |
-RRB- |
denotes |
) |
T6525 |
11679-11680 |
. |
denotes |
. |
T6526 |
11681-11683 |
IN |
denotes |
In |
T6527 |
11684-11692 |
NN |
denotes |
contrast |
T6528 |
11692-11693 |
, |
denotes |
, |
T6529 |
11694-11708 |
NN |
denotes |
overexpression |
T6530 |
11709-11711 |
IN |
denotes |
of |
T6531 |
11712-11713 |
DT |
denotes |
a |
T6532 |
11714-11723 |
VBN |
denotes |
truncated |
T6533 |
11724-11728 |
NNP |
denotes |
Sox6 |
T6534 |
11729-11736 |
NN |
denotes |
protein |
T6535 |
11737-11741 |
WDT |
denotes |
that |
T6536 |
11742-11747 |
VBZ |
denotes |
lacks |
T6537 |
11748-11751 |
PRP$ |
denotes |
its |
T6538 |
11752-11755 |
NNP |
denotes |
HMG |
T6539 |
11756-11762 |
NN |
denotes |
domain |
T6540 |
11763-11764 |
NNP |
denotes |
[ |
T6541 |
11764-11766 |
CD |
denotes |
32 |
T6542 |
11766-11767 |
NNP |
denotes |
] |
T6543 |
11768-11769 |
-LRB- |
denotes |
( |
T6544 |
11769-11776 |
JJ |
denotes |
similar |
T6545 |
11777-11779 |
TO |
denotes |
to |
T6546 |
11780-11783 |
DT |
denotes |
the |
T6547 |
11784-11790 |
JJ |
denotes |
p 100H |
T6548 |
11791-11796 |
NN |
denotes |
mouse |
T6549 |
11797-11803 |
NN |
denotes |
allele |
T6550 |
11803-11804 |
-RRB- |
denotes |
) |
T6551 |
11805-11810 |
VBZ |
denotes |
fails |
T6552 |
11811-11813 |
TO |
denotes |
to |
T6553 |
11814-11821 |
VB |
denotes |
repress |
T6554 |
11822-11827 |
JJ |
denotes |
E-Luc |
T6555 |
11828-11836 |
NN |
denotes |
activity |
T6556 |
11837-11838 |
-LRB- |
denotes |
( |
T6557 |
11838-11844 |
NN |
denotes |
Figure |
T6558 |
11845-11847 |
NN |
denotes |
2B |
T6559 |
11847-11848 |
-RRB- |
denotes |
) |
T6560 |
11848-11849 |
. |
denotes |
. |
T6561 |
11850-11855 |
DT |
denotes |
These |
T6562 |
11856-11860 |
NNS |
denotes |
data |
T6563 |
11861-11869 |
VBP |
denotes |
indicate |
T6564 |
11870-11874 |
IN |
denotes |
that |
T6565 |
11875-11879 |
JJ |
denotes |
Sox6 |
T6566 |
11880-11884 |
NNS |
denotes |
acts |
T6567 |
11885-11887 |
TO |
denotes |
to |
T6568 |
11888-11895 |
VB |
denotes |
repress |
T6569 |
11896-11899 |
DT |
denotes |
the |
T6570 |
11900-11902 |
JJ |
denotes |
ɛy |
T6571 |
11903-11911 |
NN |
denotes |
promoter |
T6572 |
11912-11914 |
IN |
denotes |
at |
T6573 |
11915-11918 |
DT |
denotes |
the |
T6574 |
11919-11934 |
JJ |
denotes |
transcriptional |
T6575 |
11935-11940 |
NN |
denotes |
level |
T6576 |
11940-11941 |
. |
denotes |
. |
T6577 |
13323-13327 |
NNP |
denotes |
Sox6 |
T6578 |
13328-13331 |
VBZ |
denotes |
has |
T6579 |
13332-13336 |
VBN |
denotes |
been |
T6580 |
13337-13342 |
VBN |
denotes |
shown |
T6581 |
13343-13345 |
TO |
denotes |
to |
T6582 |
13346-13349 |
VB |
denotes |
act |
T6583 |
13350-13352 |
IN |
denotes |
as |
T6584 |
13353-13354 |
DT |
denotes |
a |
T6585 |
13355-13364 |
NN |
denotes |
repressor |
T6586 |
13365-13368 |
CC |
denotes |
and |
T6587 |
13369-13371 |
TO |
denotes |
to |
T6588 |
13372-13380 |
VB |
denotes |
interact |
T6589 |
13381-13385 |
IN |
denotes |
with |
T6590 |
13386-13387 |
DT |
denotes |
a |
T6591 |
13388-13394 |
RB |
denotes |
widely |
T6592 |
13395-13404 |
VBN |
denotes |
expressed |
T6593 |
13405-13417 |
NN |
denotes |
co-repressor |
T6594 |
13417-13418 |
, |
denotes |
, |
T6595 |
13419-13424 |
NNP |
denotes |
CtBP2 |
T6596 |
13424-13425 |
, |
denotes |
, |
T6597 |
13426-13428 |
IN |
denotes |
on |
T6598 |
13429-13432 |
DT |
denotes |
the |
T6599 |
13433-13438 |
JJ |
denotes |
fgf-3 |
T6600 |
13439-13447 |
NN |
denotes |
promoter |
T6601 |
13448-13449 |
NN |
denotes |
[ |
T6602 |
13449-13450 |
CD |
denotes |
5 |
T6603 |
13450-13451 |
NNP |
denotes |
] |
T6604 |
13451-13452 |
. |
denotes |
. |
T6605 |
13453-13458 |
NNP |
denotes |
CtBP2 |
T6606 |
13459-13461 |
VBZ |
denotes |
is |
T6607 |
13462-13471 |
VBN |
denotes |
expressed |
T6608 |
13472-13474 |
IN |
denotes |
in |
T6609 |
13475-13480 |
NNP |
denotes |
GM979 |
T6610 |
13481-13486 |
NNS |
denotes |
cells |
T6611 |
13487-13488 |
-LRB- |
denotes |
( |
T6612 |
13488-13499 |
JJ |
denotes |
unpublished |
T6613 |
13500-13504 |
NNS |
denotes |
data |
T6614 |
13504-13505 |
-RRB- |
denotes |
) |
T6615 |
13505-13506 |
. |
denotes |
. |
T6616 |
13507-13509 |
TO |
denotes |
To |
T6617 |
13510-13521 |
VB |
denotes |
investigate |
T6618 |
13522-13529 |
IN |
denotes |
whether |
T6619 |
13530-13533 |
DT |
denotes |
the |
T6620 |
13534-13545 |
NN |
denotes |
interaction |
T6621 |
13546-13550 |
IN |
denotes |
with |
T6622 |
13551-13556 |
NNP |
denotes |
CtBP2 |
T6623 |
13557-13559 |
VBZ |
denotes |
is |
T6624 |
13560-13568 |
VBN |
denotes |
required |
T6625 |
13569-13572 |
IN |
denotes |
for |
T6626 |
13573-13577 |
JJ |
denotes |
Sox6 |
T6627 |
13578-13588 |
NN |
denotes |
repression |
T6628 |
13589-13591 |
IN |
denotes |
of |
T6629 |
13592-13595 |
DT |
denotes |
the |
T6630 |
13596-13598 |
JJ |
denotes |
ɛy |
T6631 |
13599-13607 |
NN |
denotes |
promoter |
T6632 |
13607-13608 |
, |
denotes |
, |
T6633 |
13609-13611 |
PRP |
denotes |
we |
T6634 |
13612-13622 |
VBD |
denotes |
introduced |
T6635 |
13623-13624 |
DT |
denotes |
a |
T6636 |
13625-13630 |
NN |
denotes |
point |
T6637 |
13631-13639 |
NN |
denotes |
mutation |
T6638 |
13640-13641 |
-LRB- |
denotes |
( |
T6639 |
13641-13646 |
NNP |
denotes |
L386H |
T6640 |
13646-13647 |
-RRB- |
denotes |
) |
T6641 |
13648-13650 |
IN |
denotes |
in |
T6642 |
13651-13654 |
DT |
denotes |
the |
T6643 |
13655-13659 |
JJ |
denotes |
Sox6 |
T6644 |
13660-13667 |
NN |
denotes |
protein |
T6645 |
13668-13672 |
WDT |
denotes |
that |
T6646 |
13673-13676 |
VBZ |
denotes |
has |
T6647 |
13677-13681 |
VBN |
denotes |
been |
T6648 |
13682-13692 |
RB |
denotes |
previously |
T6649 |
13693-13701 |
VBN |
denotes |
reported |
T6650 |
13702-13704 |
TO |
denotes |
to |
T6651 |
13705-13707 |
VB |
denotes |
be |
T6652 |
13708-13718 |
JJ |
denotes |
sufficient |
T6653 |
13719-13721 |
TO |
denotes |
to |
T6654 |
13722-13729 |
VB |
denotes |
abolish |
T6655 |
13730-13740 |
JJ |
denotes |
Sox6-CtBP2 |
T6656 |
13741-13752 |
NN |
denotes |
interaction |
T6657 |
13753-13754 |
NN |
denotes |
[ |
T6658 |
13754-13755 |
CD |
denotes |
5 |
T6659 |
13755-13756 |
NNP |
denotes |
] |
T6660 |
13756-13757 |
. |
denotes |
. |
T6661 |
13758-13762 |
DT |
denotes |
This |
T6662 |
13763-13768 |
JJ |
denotes |
amino |
T6663 |
13769-13773 |
NN |
denotes |
acid |
T6664 |
13774-13780 |
NN |
denotes |
change |
T6665 |
13781-13783 |
VBZ |
denotes |
is |
T6666 |
13784-13787 |
RB |
denotes |
not |
T6667 |
13788-13790 |
IN |
denotes |
in |
T6668 |
13791-13794 |
DT |
denotes |
the |
T6669 |
13795-13798 |
NNP |
denotes |
HMG |
T6670 |
13799-13802 |
NNP |
denotes |
DNA |
T6671 |
13803-13810 |
JJ |
denotes |
binding |
T6672 |
13811-13817 |
NN |
denotes |
domain |
T6673 |
13817-13818 |
. |
denotes |
. |
T6674 |
13819-13826 |
RB |
denotes |
However |
T6675 |
13826-13827 |
, |
denotes |
, |
T6676 |
13828-13832 |
DT |
denotes |
this |
T6677 |
13833-13839 |
JJ |
denotes |
mutant |
T6678 |
13840-13847 |
NN |
denotes |
version |
T6679 |
13848-13850 |
IN |
denotes |
of |
T6680 |
13851-13855 |
JJ |
denotes |
Sox6 |
T6681 |
13856-13863 |
VBZ |
denotes |
retains |
T6682 |
13864-13867 |
DT |
denotes |
the |
T6683 |
13868-13875 |
NN |
denotes |
ability |
T6684 |
13876-13878 |
TO |
denotes |
to |
T6685 |
13879-13886 |
VB |
denotes |
repress |
T6686 |
13887-13890 |
DT |
denotes |
the |
T6687 |
13891-13893 |
JJ |
denotes |
ɛy |
T6688 |
13894-13902 |
NN |
denotes |
promoter |
T6689 |
13903-13905 |
IN |
denotes |
in |
T6690 |
13906-13909 |
DT |
denotes |
the |
T6691 |
13910-13922 |
NN |
denotes |
transfection |
T6692 |
13923-13928 |
NN |
denotes |
assay |
T6693 |
13929-13930 |
-LRB- |
denotes |
( |
T6694 |
13930-13936 |
NN |
denotes |
Figure |
T6695 |
13937-13939 |
NN |
denotes |
2B |
T6696 |
13939-13940 |
-RRB- |
denotes |
) |
T6697 |
13940-13941 |
, |
denotes |
, |
T6698 |
13942-13952 |
VBG |
denotes |
indicating |
T6699 |
13953-13957 |
IN |
denotes |
that |
T6700 |
13958-13962 |
JJ |
denotes |
Sox6 |
T6701 |
13963-13972 |
NNS |
denotes |
represses |
T6702 |
13973-13976 |
DT |
denotes |
the |
T6703 |
13977-13979 |
JJ |
denotes |
ɛy |
T6704 |
13980-13988 |
NN |
denotes |
promoter |
T6705 |
13989-13991 |
IN |
denotes |
in |
T6706 |
13992-13993 |
DT |
denotes |
a |
T6707 |
13994-14011 |
JJ |
denotes |
CtBP2-independent |
T6708 |
14012-14018 |
NN |
denotes |
manner |
T6709 |
14018-14019 |
. |
denotes |
. |
T6710 |
14020-14028 |
NN |
denotes |
Deletion |
T6711 |
14029-14037 |
NN |
denotes |
analysis |
T6712 |
14038-14040 |
IN |
denotes |
of |
T6713 |
14041-14044 |
DT |
denotes |
the |
T6714 |
14045-14047 |
JJ |
denotes |
ɛy |
T6715 |
14048-14056 |
NN |
denotes |
promoter |
T6716 |
14056-14057 |
, |
denotes |
, |
T6717 |
14058-14060 |
IN |
denotes |
as |
T6718 |
14061-14066 |
VBN |
denotes |
shown |
T6719 |
14067-14069 |
IN |
denotes |
in |
T6720 |
14070-14076 |
NN |
denotes |
Figure |
T6721 |
14077-14079 |
CD |
denotes |
2C |
T6722 |
14079-14080 |
, |
denotes |
, |
T6723 |
14081-14088 |
VBD |
denotes |
defined |
T6724 |
14089-14090 |
DT |
denotes |
a |
T6725 |
14091-14097 |
NN |
denotes |
region |
T6726 |
14098-14099 |
-LRB- |
denotes |
( |
T6727 |
14099-14100 |
FW |
denotes |
− |
T6728 |
14100-14102 |
CD |
denotes |
63 |
T6729 |
14103-14105 |
TO |
denotes |
to |
T6730 |
14106-14107 |
CD |
denotes |
− |
T6731 |
14107-14109 |
CD |
denotes |
37 |
T6732 |
14109-14110 |
-RRB- |
denotes |
) |
T6733 |
14111-14117 |
IN |
denotes |
within |
T6734 |
14118-14121 |
DT |
denotes |
the |
T6735 |
14122-14124 |
JJ |
denotes |
ɛy |
T6736 |
14125-14133 |
JJ |
denotes |
proximal |
T6737 |
14134-14142 |
NN |
denotes |
promoter |
T6738 |
14143-14147 |
WDT |
denotes |
that |
T6739 |
14148-14150 |
VBZ |
denotes |
is |
T6740 |
14151-14159 |
JJ |
denotes |
critical |
T6741 |
14160-14163 |
IN |
denotes |
for |
T6742 |
14164-14168 |
JJ |
denotes |
Sox6 |
T6743 |
14169-14179 |
NN |
denotes |
repression |
T6744 |
14179-14180 |
. |
denotes |
. |
T6745 |
14181-14189 |
NN |
denotes |
Analysis |
T6746 |
14190-14192 |
IN |
denotes |
of |
T6747 |
14193-14197 |
DT |
denotes |
this |
T6748 |
14198-14203 |
JJ |
denotes |
short |
T6749 |
14204-14210 |
NN |
denotes |
region |
T6750 |
14211-14218 |
VBZ |
denotes |
reveals |
T6751 |
14219-14222 |
CD |
denotes |
two |
T6752 |
14223-14231 |
JJ |
denotes |
Sox/Sox6 |
T6753 |
14232-14241 |
NN |
denotes |
consensus |
T6754 |
14242-14249 |
JJ |
denotes |
binding |
T6755 |
14250-14255 |
NNS |
denotes |
sites |
T6756 |
14256-14257 |
VBP |
denotes |
[ |
T6757 |
14257-14258 |
CD |
denotes |
5 |
T6758 |
14258-14259 |
NNP |
denotes |
] |
T6759 |
14260-14261 |
-LRB- |
denotes |
( |
T6760 |
14261-14267 |
NNP |
denotes |
Figure |
T6761 |
14268-14270 |
NNP |
denotes |
3A |
T6762 |
14270-14271 |
-RRB- |
denotes |
) |
T6763 |
14271-14272 |
. |
denotes |
. |
T8140 |
16841-16845 |
NNP |
denotes |
EMSA |
T8141 |
16846-16849 |
CC |
denotes |
and |
T8142 |
16850-16854 |
NNP |
denotes |
ChIP |
T8143 |
16855-16861 |
NNP |
denotes |
Assays |
T8144 |
16862-16866 |
NNP |
denotes |
Show |
T8145 |
16867-16871 |
IN |
denotes |
that |
T8146 |
16872-16876 |
NNP |
denotes |
Sox6 |
T8147 |
16877-16885 |
RB |
denotes |
Directly |
T8148 |
16886-16891 |
VBZ |
denotes |
Binds |
T8149 |
16892-16894 |
TO |
denotes |
to |
T8150 |
16895-16898 |
DT |
denotes |
the |
T8151 |
16899-16901 |
NN |
denotes |
ɛy |
T8152 |
16902-16910 |
NNP |
denotes |
Promoter |
T8153 |
16911-16915 |
NNP |
denotes |
Sox6 |
T8154 |
16916-16921 |
MD |
denotes |
might |
T8155 |
16922-16929 |
VB |
denotes |
repress |
T8156 |
16930-16933 |
DT |
denotes |
the |
T8157 |
16934-16936 |
JJ |
denotes |
ɛy |
T8158 |
16937-16945 |
NN |
denotes |
promoter |
T8159 |
16945-16946 |
, |
denotes |
, |
T8160 |
16947-16953 |
CC |
denotes |
either |
T8161 |
16954-16961 |
IN |
denotes |
through |
T8162 |
16962-16968 |
JJ |
denotes |
direct |
T8163 |
16969-16977 |
JJ |
denotes |
physical |
T8164 |
16978-16985 |
NN |
denotes |
contact |
T8165 |
16986-16990 |
IN |
denotes |
with |
T8166 |
16991-16994 |
DT |
denotes |
the |
T8167 |
16995-17003 |
NN |
denotes |
promoter |
T8168 |
17004-17006 |
CC |
denotes |
or |
T8169 |
17007-17009 |
IN |
denotes |
by |
T8170 |
17010-17020 |
VBG |
denotes |
regulating |
T8171 |
17021-17034 |
NNS |
denotes |
intermediates |
T8172 |
17035-17044 |
VBG |
denotes |
affecting |
T8173 |
17045-17048 |
DT |
denotes |
the |
T8174 |
17049-17051 |
JJ |
denotes |
ɛy |
T8175 |
17052-17060 |
NN |
denotes |
promoter |
T8176 |
17060-17061 |
. |
denotes |
. |
T8177 |
17062-17064 |
TO |
denotes |
To |
T8178 |
17065-17076 |
VB |
denotes |
investigate |
T8179 |
17077-17084 |
IN |
denotes |
whether |
T8180 |
17085-17089 |
NNP |
denotes |
Sox6 |
T8181 |
17090-17092 |
VBZ |
denotes |
is |
T8182 |
17093-17101 |
RB |
denotes |
directly |
T8183 |
17102-17112 |
VBN |
denotes |
associated |
T8184 |
17113-17117 |
IN |
denotes |
with |
T8185 |
17118-17121 |
DT |
denotes |
the |
T8186 |
17122-17124 |
JJ |
denotes |
ɛy |
T8187 |
17125-17133 |
NN |
denotes |
promoter |
T8188 |
17133-17134 |
, |
denotes |
, |
T8189 |
17135-17137 |
PRP |
denotes |
we |
T8190 |
17138-17143 |
RB |
denotes |
first |
T8191 |
17144-17153 |
VBD |
denotes |
performed |
T8192 |
17154-17169 |
JJ |
denotes |
electrophoretic |
T8193 |
17170-17178 |
NN |
denotes |
mobility |
T8194 |
17179-17184 |
NN |
denotes |
shift |
T8195 |
17185-17191 |
NNS |
denotes |
assays |
T8196 |
17192-17193 |
-LRB- |
denotes |
( |
T8197 |
17193-17197 |
NNP |
denotes |
EMSA |
T8198 |
17197-17198 |
-RRB- |
denotes |
) |
T8199 |
17199-17204 |
VBG |
denotes |
using |
T8200 |
17205-17206 |
DT |
denotes |
a |
T8201 |
17207-17219 |
JJ |
denotes |
c-Myc-tagged |
T8202 |
17220-17224 |
NN |
denotes |
Sox6 |
T8203 |
17225-17227 |
IN |
denotes |
in |
T8204 |
17228-17229 |
DT |
denotes |
a |
T8205 |
17230-17242 |
NN |
denotes |
reticulocyte |
T8206 |
17243-17255 |
JJ |
denotes |
lysate-based |
T8207 |
17256-17281 |
NN |
denotes |
transcription/translation |
T8208 |
17282-17284 |
IN |
denotes |
in |
T8209 |
17285-17290 |
NN |
denotes |
vitro |
T8210 |
17291-17297 |
NN |
denotes |
system |
T8211 |
17297-17298 |
. |
denotes |
. |
T8212 |
17299-17302 |
DT |
denotes |
The |
T8213 |
17303-17309 |
NNS |
denotes |
probes |
T8214 |
17310-17314 |
VBN |
denotes |
used |
T8215 |
17315-17318 |
VBP |
denotes |
are |
T8216 |
17319-17325 |
VBN |
denotes |
listed |
T8217 |
17326-17328 |
IN |
denotes |
in |
T8218 |
17329-17335 |
NN |
denotes |
Figure |
T8219 |
17336-17338 |
NN |
denotes |
3A |
T8220 |
17338-17339 |
. |
denotes |
. |
T8221 |
17340-17343 |
DT |
denotes |
The |
T8222 |
17344-17346 |
CD |
denotes |
36 |
T8223 |
17347-17351 |
NN |
denotes |
base |
T8224 |
17352-17356 |
NN |
denotes |
pair |
T8225 |
17357-17358 |
-LRB- |
denotes |
( |
T8226 |
17358-17360 |
NN |
denotes |
bp |
T8227 |
17360-17361 |
-RRB- |
denotes |
) |
T8228 |
17362-17364 |
NN |
denotes |
WT |
T8229 |
17365-17370 |
NN |
denotes |
probe |
T8230 |
17371-17382 |
NNS |
denotes |
corresponds |
T8231 |
17383-17385 |
TO |
denotes |
to |
T8232 |
17386-17389 |
DT |
denotes |
the |
T8233 |
17390-17398 |
JJ |
denotes |
critical |
T8234 |
17399-17405 |
NN |
denotes |
region |
T8235 |
17406-17408 |
IN |
denotes |
of |
T8236 |
17409-17412 |
DT |
denotes |
the |
T8237 |
17413-17415 |
JJ |
denotes |
ɛy |
T8238 |
17416-17424 |
NN |
denotes |
promoter |
T8239 |
17425-17432 |
VBN |
denotes |
defined |
T8240 |
17433-17435 |
IN |
denotes |
in |
T8241 |
17436-17439 |
PRP$ |
denotes |
our |
T8242 |
17440-17448 |
NN |
denotes |
promoter |
T8243 |
17449-17457 |
NN |
denotes |
deletion |
T8244 |
17458-17466 |
NNS |
denotes |
analyses |
T8245 |
17466-17467 |
. |
denotes |
. |
T8246 |
17468-17472 |
DT |
denotes |
This |
T8247 |
17473-17478 |
NN |
denotes |
probe |
T8248 |
17479-17487 |
VBZ |
denotes |
contains |
T8249 |
17488-17491 |
CD |
denotes |
two |
T8250 |
17492-17501 |
NN |
denotes |
consensus |
T8251 |
17502-17510 |
NNP |
denotes |
Sox/Sox6 |
T8252 |
17511-17518 |
JJ |
denotes |
binding |
T8253 |
17519-17524 |
NNS |
denotes |
sites |
T8254 |
17524-17525 |
. |
denotes |
. |
T8255 |
17526-17530 |
RB |
denotes |
Also |
T8256 |
17531-17539 |
VBN |
denotes |
included |
T8257 |
17540-17542 |
IN |
denotes |
in |
T8258 |
17543-17546 |
PRP$ |
denotes |
our |
T8259 |
17547-17551 |
NNP |
denotes |
EMSA |
T8260 |
17552-17555 |
VBP |
denotes |
are |
T8261 |
17556-17561 |
CD |
denotes |
three |
T8262 |
17562-17569 |
VBN |
denotes |
mutated |
T8263 |
17570-17576 |
NNS |
denotes |
probes |
T8264 |
17577-17581 |
WDT |
denotes |
that |
T8265 |
17582-17585 |
VBP |
denotes |
are |
T8266 |
17585-17586 |
, |
denotes |
, |
T8267 |
17587-17593 |
CC |
denotes |
either |
T8268 |
17594-17603 |
VBN |
denotes |
truncated |
T8269 |
17604-17605 |
-LRB- |
denotes |
( |
T8270 |
17605-17607 |
CD |
denotes |
M1 |
T8271 |
17607-17608 |
-RRB- |
denotes |
) |
T8272 |
17608-17609 |
, |
denotes |
, |
T8273 |
17610-17612 |
CC |
denotes |
or |
T8274 |
17613-17620 |
VBN |
denotes |
mutated |
T8275 |
17621-17622 |
-LRB- |
denotes |
( |
T8276 |
17622-17624 |
CD |
denotes |
M2 |
T8277 |
17625-17628 |
CC |
denotes |
and |
T8278 |
17629-17631 |
CD |
denotes |
M3 |
T8279 |
17631-17632 |
-RRB- |
denotes |
) |
T8280 |
17633-17635 |
IN |
denotes |
in |
T8281 |
17636-17644 |
NNP |
denotes |
Sox/Sox6 |
T8282 |
17645-17652 |
JJ |
denotes |
binding |
T8283 |
17653-17658 |
NNS |
denotes |
sites |
T8284 |
17659-17660 |
-LRB- |
denotes |
( |
T8285 |
17660-17666 |
NN |
denotes |
Figure |
T8286 |
17667-17669 |
NN |
denotes |
3A |
T8287 |
17669-17670 |
-RRB- |
denotes |
) |
T8288 |
17670-17671 |
. |
denotes |
. |
T8289 |
17672-17676 |
NNP |
denotes |
Sox6 |
T8290 |
17677-17679 |
VBZ |
denotes |
is |
T8291 |
17680-17684 |
JJ |
denotes |
able |
T8292 |
17685-17687 |
TO |
denotes |
to |
T8293 |
17688-17698 |
RB |
denotes |
physically |
T8294 |
17699-17708 |
JJ |
denotes |
associate |
T8295 |
17709-17713 |
IN |
denotes |
with |
T8296 |
17714-17717 |
DT |
denotes |
the |
T8297 |
17718-17723 |
JJ |
denotes |
36-bp |
T8298 |
17724-17730 |
NN |
denotes |
region |
T8299 |
17731-17732 |
-LRB- |
denotes |
( |
T8300 |
17732-17738 |
NN |
denotes |
Figure |
T8301 |
17739-17741 |
NN |
denotes |
3B |
T8302 |
17741-17742 |
-RRB- |
denotes |
) |
T8303 |
17743-17749 |
IN |
denotes |
within |
T8304 |
17750-17753 |
DT |
denotes |
the |
T8305 |
17754-17756 |
JJ |
denotes |
ɛy |
T8306 |
17757-17765 |
NN |
denotes |
promoter |
T8307 |
17766-17773 |
VBN |
denotes |
defined |
T8308 |
17774-17776 |
IN |
denotes |
by |
T8309 |
17777-17780 |
DT |
denotes |
the |
T8310 |
17781-17789 |
NN |
denotes |
deletion |
T8311 |
17790-17798 |
NN |
denotes |
analysis |
T8312 |
17799-17810 |
NNS |
denotes |
experiments |
T8313 |
17811-17812 |
-LRB- |
denotes |
( |
T8314 |
17812-17818 |
NN |
denotes |
Figure |
T8315 |
17819-17821 |
CD |
denotes |
2C |
T8316 |
17821-17822 |
-RRB- |
denotes |
) |
T8317 |
17822-17823 |
. |
denotes |
. |
T8318 |
17824-17827 |
DT |
denotes |
The |
T8319 |
17828-17833 |
JJ |
denotes |
36-bp |
T8320 |
17834-17839 |
NN |
denotes |
probe |
T8321 |
17840-17843 |
VBD |
denotes |
was |
T8322 |
17844-17851 |
VBN |
denotes |
shifted |
T8323 |
17852-17854 |
IN |
denotes |
by |
T8324 |
17855-17858 |
DT |
denotes |
the |
T8325 |
17859-17865 |
VBN |
denotes |
tagged |
T8326 |
17866-17870 |
NNP |
denotes |
Sox6 |
T8327 |
17871-17878 |
NN |
denotes |
protein |
T8328 |
17878-17879 |
. |
denotes |
. |
T8329 |
17880-17888 |
RB |
denotes |
Moreover |
T8330 |
17888-17889 |
, |
denotes |
, |
T8331 |
17890-17894 |
DT |
denotes |
both |
T8332 |
17895-17900 |
JJ |
denotes |
c-Myc |
T8333 |
17901-17904 |
CC |
denotes |
and |
T8334 |
17905-17909 |
JJ |
denotes |
Sox6 |
T8335 |
17910-17920 |
NNS |
denotes |
antibodies |
T8336 |
17921-17931 |
VBP |
denotes |
supershift |
T8337 |
17932-17935 |
DT |
denotes |
the |
T8338 |
17936-17940 |
NN |
denotes |
band |
T8339 |
17940-17941 |
, |
denotes |
, |
T8340 |
17942-17952 |
VBG |
denotes |
indicating |
T8341 |
17953-17957 |
IN |
denotes |
that |
T8342 |
17958-17961 |
DT |
denotes |
the |
T8343 |
17962-17969 |
JJ |
denotes |
binding |
T8344 |
17970-17972 |
VBZ |
denotes |
is |
T8345 |
17973-17986 |
JJ |
denotes |
Sox6-specific |
T8346 |
17986-17987 |
. |
denotes |
. |
T8347 |
17988-17990 |
TO |
denotes |
To |
T8348 |
17991-17995 |
VB |
denotes |
rule |
T8349 |
17996-17999 |
RP |
denotes |
out |
T8350 |
18000-18003 |
DT |
denotes |
the |
T8351 |
18004-18015 |
NN |
denotes |
possibility |
T8352 |
18016-18020 |
IN |
denotes |
that |
T8353 |
18021-18024 |
DT |
denotes |
the |
T8354 |
18025-18030 |
JJ |
denotes |
c-Myc |
T8355 |
18031-18034 |
NN |
denotes |
tag |
T8356 |
18035-18041 |
PRP |
denotes |
itself |
T8357 |
18042-18047 |
VBZ |
denotes |
binds |
T8358 |
18048-18050 |
TO |
denotes |
to |
T8359 |
18051-18054 |
DT |
denotes |
the |
T8360 |
18055-18060 |
NN |
denotes |
probe |
T8361 |
18060-18061 |
, |
denotes |
, |
T8362 |
18062-18064 |
DT |
denotes |
an |
T8363 |
18065-18074 |
JJ |
denotes |
HA-tagged |
T8364 |
18075-18079 |
NN |
denotes |
Sox6 |
T8365 |
18080-18083 |
VBD |
denotes |
was |
T8366 |
18084-18088 |
VBN |
denotes |
used |
T8367 |
18089-18091 |
IN |
denotes |
in |
T8368 |
18092-18099 |
DT |
denotes |
another |
T8369 |
18100-18104 |
NNP |
denotes |
EMSA |
T8370 |
18105-18109 |
WDT |
denotes |
that |
T8371 |
18110-18119 |
VBD |
denotes |
confirmed |
T8372 |
18120-18125 |
DT |
denotes |
these |
T8373 |
18126-18133 |
NNS |
denotes |
results |
T8374 |
18134-18135 |
-LRB- |
denotes |
( |
T8375 |
18135-18141 |
NN |
denotes |
Figure |
T8376 |
18142-18144 |
NN |
denotes |
3C |
T8377 |
18144-18145 |
-RRB- |
denotes |
) |
T8378 |
18145-18146 |
. |
denotes |
. |
T8379 |
18147-18151 |
JJ |
denotes |
Next |
T8380 |
18151-18152 |
, |
denotes |
, |
T8381 |
18153-18160 |
JJ |
denotes |
nuclear |
T8382 |
18161-18169 |
NNS |
denotes |
extracts |
T8383 |
18170-18174 |
IN |
denotes |
from |
T8384 |
18175-18178 |
NNP |
denotes |
MEL |
T8385 |
18179-18184 |
NNS |
denotes |
cells |
T8386 |
18185-18189 |
VBD |
denotes |
were |
T8387 |
18190-18194 |
VBN |
denotes |
used |
T8388 |
18195-18197 |
IN |
denotes |
in |
T8389 |
18198-18202 |
NNP |
denotes |
EMSA |
T8390 |
18203-18212 |
VBG |
denotes |
employing |
T8391 |
18213-18216 |
DT |
denotes |
the |
T8392 |
18217-18221 |
JJ |
denotes |
same |
T8393 |
18222-18227 |
JJ |
denotes |
36-bp |
T8394 |
18228-18233 |
NN |
denotes |
probe |
T8395 |
18233-18234 |
. |
denotes |
. |
T8396 |
18235-18238 |
NNP |
denotes |
MEL |
T8397 |
18239-18244 |
NNS |
denotes |
cells |
T8398 |
18244-18245 |
, |
denotes |
, |
T8399 |
18246-18247 |
DT |
denotes |
a |
T8400 |
18248-18254 |
JJ |
denotes |
murine |
T8401 |
18255-18270 |
JJ |
denotes |
erythroleukemic |
T8402 |
18271-18275 |
NN |
denotes |
cell |
T8403 |
18276-18280 |
NN |
denotes |
line |
T8404 |
18280-18281 |
, |
denotes |
, |
T8405 |
18282-18289 |
JJ |
denotes |
express |
T8406 |
18290-18295 |
NN |
denotes |
adult |
T8407 |
18296-18297 |
NN |
denotes |
β |
T8408 |
18298-18305 |
NNS |
denotes |
globins |
T8409 |
18305-18306 |
, |
denotes |
, |
T8410 |
18307-18310 |
CC |
denotes |
but |
T8411 |
18311-18314 |
RB |
denotes |
not |
T8412 |
18315-18317 |
VB |
denotes |
ɛy |
T8413 |
18318-18319 |
NNP |
denotes |
[ |
T8414 |
18319-18321 |
CD |
denotes |
33 |
T8415 |
18321-18322 |
NNP |
denotes |
] |
T8416 |
18322-18323 |
. |
denotes |
. |
T8417 |
18324-18328 |
JJ |
denotes |
Sox6 |
T8418 |
18329-18337 |
RB |
denotes |
directly |
T8419 |
18338-18343 |
VBZ |
denotes |
binds |
T8420 |
18344-18346 |
TO |
denotes |
to |
T8421 |
18347-18351 |
DT |
denotes |
this |
T8422 |
18352-18355 |
NN |
denotes |
DNA |
T8423 |
18356-18364 |
NN |
denotes |
sequence |
T8424 |
18365-18367 |
IN |
denotes |
in |
T8425 |
18368-18371 |
NNP |
denotes |
MEL |
T8426 |
18372-18377 |
NNS |
denotes |
cells |
T8427 |
18378-18379 |
-LRB- |
denotes |
( |
T8428 |
18379-18385 |
NN |
denotes |
Figure |
T8429 |
18386-18388 |
CD |
denotes |
3D |
T8430 |
18388-18389 |
-RRB- |
denotes |
) |
T8431 |
18389-18390 |
. |
denotes |
. |
T8432 |
18391-18394 |
DT |
denotes |
The |
T8433 |
18395-18401 |
JJ |
denotes |
intact |
T8434 |
18402-18411 |
NN |
denotes |
consensus |
T8435 |
18412-18420 |
NNP |
denotes |
Sox/Sox6 |
T8436 |
18421-18428 |
JJ |
denotes |
binding |
T8437 |
18429-18434 |
NNS |
denotes |
sites |
T8438 |
18435-18437 |
IN |
denotes |
of |
T8439 |
18438-18441 |
DT |
denotes |
the |
T8440 |
18442-18445 |
NNP |
denotes |
DNA |
T8441 |
18446-18451 |
NN |
denotes |
probe |
T8442 |
18452-18455 |
VBP |
denotes |
are |
T8443 |
18456-18464 |
VBN |
denotes |
required |
T8444 |
18465-18468 |
IN |
denotes |
for |
T8445 |
18469-18472 |
DT |
denotes |
the |
T8446 |
18473-18480 |
JJ |
denotes |
binding |
T8447 |
18480-18481 |
, |
denotes |
, |
T8448 |
18482-18484 |
IN |
denotes |
as |
T8449 |
18485-18490 |
VBN |
denotes |
shown |
T8450 |
18491-18493 |
IN |
denotes |
in |
T8451 |
18494-18497 |
DT |
denotes |
the |
T8452 |
18498-18509 |
NN |
denotes |
competition |
T8453 |
18510-18515 |
NN |
denotes |
assay |
T8454 |
18516-18517 |
-LRB- |
denotes |
( |
T8455 |
18517-18523 |
NN |
denotes |
Figure |
T8456 |
18524-18526 |
CD |
denotes |
3E |
T8457 |
18526-18527 |
-RRB- |
denotes |
) |
T8458 |
18527-18528 |
. |
denotes |
. |
T8459 |
18529-18537 |
NNP |
denotes |
Ablation |
T8460 |
18538-18540 |
IN |
denotes |
of |
T8461 |
18541-18549 |
JJ |
denotes |
putative |
T8462 |
18550-18558 |
NNP |
denotes |
Sox/Sox6 |
T8463 |
18559-18566 |
JJ |
denotes |
binding |
T8464 |
18567-18572 |
NNS |
denotes |
sites |
T8465 |
18573-18574 |
-LRB- |
denotes |
( |
T8466 |
18574-18576 |
CD |
denotes |
M1 |
T8467 |
18577-18580 |
CC |
denotes |
and |
T8468 |
18581-18583 |
CD |
denotes |
M3 |
T8469 |
18583-18584 |
-RRB- |
denotes |
) |
T8470 |
18585-18592 |
VBP |
denotes |
abolish |
T8471 |
18593-18598 |
PRP$ |
denotes |
their |
T8472 |
18599-18606 |
NN |
denotes |
ability |
T8473 |
18607-18609 |
TO |
denotes |
to |
T8474 |
18610-18617 |
VB |
denotes |
compete |
T8475 |
18618-18620 |
IN |
denotes |
in |
T8476 |
18621-18625 |
NNP |
denotes |
EMSA |
T8477 |
18626-18627 |
-LRB- |
denotes |
( |
T8478 |
18627-18633 |
NNP |
denotes |
Figure |
T8479 |
18634-18636 |
NNP |
denotes |
3E |
T8480 |
18636-18637 |
-RRB- |
denotes |
) |
T8481 |
18637-18638 |
. |
denotes |
. |
T8482 |
18639-18642 |
DT |
denotes |
The |
T8483 |
18643-18645 |
NNP |
denotes |
M2 |
T8484 |
18646-18652 |
JJ |
denotes |
mutant |
T8485 |
18653-18658 |
NN |
denotes |
probe |
T8486 |
18659-18662 |
MD |
denotes |
may |
T8487 |
18663-18670 |
VB |
denotes |
compete |
T8488 |
18671-18680 |
RB |
denotes |
partially |
T8489 |
18681-18685 |
IN |
denotes |
with |
T8490 |
18686-18688 |
NNP |
denotes |
WT |
T8491 |
18689-18696 |
JJ |
denotes |
binding |
T8492 |
18696-18697 |
. |
denotes |
. |
T8493 |
18698-18700 |
TO |
denotes |
To |
T8494 |
18701-18712 |
VB |
denotes |
investigate |
T8495 |
18713-18716 |
DT |
denotes |
the |
T8496 |
18717-18727 |
JJ |
denotes |
functional |
T8497 |
18728-18740 |
NN |
denotes |
significance |
T8498 |
18741-18743 |
IN |
denotes |
of |
T8499 |
18744-18747 |
DT |
denotes |
the |
T8500 |
18748-18754 |
JJ |
denotes |
intact |
T8501 |
18755-18763 |
NNP |
denotes |
Sox/Sox6 |
T8502 |
18764-18771 |
JJ |
denotes |
binding |
T8503 |
18772-18777 |
NNS |
denotes |
sites |
T8504 |
18777-18778 |
, |
denotes |
, |
T8505 |
18779-18782 |
DT |
denotes |
the |
T8506 |
18783-18785 |
JJ |
denotes |
ɛy |
T8507 |
18786-18794 |
NN |
denotes |
promoter |
T8508 |
18795-18803 |
NN |
denotes |
reporter |
T8509 |
18804-18814 |
NNS |
denotes |
constructs |
T8510 |
18815-18819 |
IN |
denotes |
with |
T8511 |
18820-18831 |
VBN |
denotes |
mutagenized |
T8512 |
18832-18840 |
NNP |
denotes |
Sox/Sox6 |
T8513 |
18841-18848 |
JJ |
denotes |
binding |
T8514 |
18849-18854 |
NNS |
denotes |
sites |
T8515 |
18855-18859 |
VBD |
denotes |
were |
T8516 |
18860-18874 |
VBN |
denotes |
co-transfected |
T8517 |
18875-18879 |
IN |
denotes |
with |
T8518 |
18880-18883 |
DT |
denotes |
the |
T8519 |
18884-18888 |
JJ |
denotes |
Sox6 |
T8520 |
18889-18903 |
NN |
denotes |
overexpression |
T8521 |
18904-18910 |
NN |
denotes |
vector |
T8522 |
18911-18915 |
IN |
denotes |
into |
T8523 |
18916-18921 |
NNP |
denotes |
GM979 |
T8524 |
18922-18927 |
NNS |
denotes |
cells |
T8525 |
18927-18928 |
. |
denotes |
. |
T8526 |
18929-18939 |
JJ |
denotes |
Consistent |
T8527 |
18940-18944 |
IN |
denotes |
with |
T8528 |
18945-18948 |
DT |
denotes |
the |
T8529 |
18949-18953 |
NNP |
denotes |
EMSA |
T8530 |
18954-18961 |
NNS |
denotes |
results |
T8531 |
18961-18962 |
, |
denotes |
, |
T8532 |
18963-18966 |
DT |
denotes |
the |
T8533 |
18967-18973 |
JJ |
denotes |
mutant |
T8534 |
18974-18976 |
NN |
denotes |
ɛy |
T8535 |
18977-18985 |
NN |
denotes |
promoter |
T8536 |
18986-18994 |
NN |
denotes |
reporter |
T8537 |
18995-19005 |
NNS |
denotes |
constructs |
T8538 |
19006-19007 |
-LRB- |
denotes |
( |
T8539 |
19007-19011 |
IN |
denotes |
with |
T8540 |
19012-19018 |
DT |
denotes |
either |
T8541 |
19019-19022 |
CD |
denotes |
one |
T8542 |
19023-19025 |
CC |
denotes |
or |
T8543 |
19026-19030 |
DT |
denotes |
both |
T8544 |
19031-19039 |
JJ |
denotes |
Sox/Sox6 |
T8545 |
19040-19047 |
JJ |
denotes |
binding |
T8546 |
19048-19053 |
NNS |
denotes |
sites |
T8547 |
19054-19065 |
VBN |
denotes |
mutagenized |
T8548 |
19065-19066 |
-RRB- |
denotes |
) |
T8549 |
19067-19069 |
VBP |
denotes |
do |
T8550 |
19070-19073 |
RB |
denotes |
not |
T8551 |
19074-19080 |
VB |
denotes |
result |
T8552 |
19081-19083 |
IN |
denotes |
in |
T8553 |
19084-19095 |
JJ |
denotes |
significant |
T8554 |
19096-19104 |
NN |
denotes |
promoter |
T8555 |
19105-19115 |
NN |
denotes |
repression |
T8556 |
19116-19118 |
IN |
denotes |
in |
T8557 |
19119-19131 |
NN |
denotes |
transfection |
T8558 |
19132-19139 |
NNS |
denotes |
studies |
T8559 |
19140-19141 |
-LRB- |
denotes |
( |
T8560 |
19141-19147 |
NN |
denotes |
Figure |
T8561 |
19148-19150 |
CD |
denotes |
3F |
T8562 |
19150-19151 |
-RRB- |
denotes |
) |
T8563 |
19151-19152 |
. |
denotes |
. |
T8564 |
19153-19157 |
RB |
denotes |
Thus |
T8565 |
19157-19158 |
, |
denotes |
, |
T8566 |
19159-19163 |
DT |
denotes |
both |
T8567 |
19164-19169 |
NNS |
denotes |
sites |
T8568 |
19170-19173 |
VBP |
denotes |
are |
T8569 |
19174-19182 |
VBN |
denotes |
required |
T8570 |
19183-19186 |
IN |
denotes |
for |
T8571 |
19187-19194 |
JJ |
denotes |
maximal |
T8572 |
19195-19205 |
NN |
denotes |
repression |
T8573 |
19206-19208 |
IN |
denotes |
of |
T8574 |
19209-19211 |
NN |
denotes |
ɛy |
T8575 |
19212-19214 |
IN |
denotes |
by |
T8576 |
19215-19219 |
NNP |
denotes |
Sox6 |
T8577 |
19219-19220 |
, |
denotes |
, |
T8578 |
19221-19224 |
CC |
denotes |
but |
T8579 |
19225-19228 |
RB |
denotes |
not |
T8580 |
19229-19231 |
TO |
denotes |
to |
T8581 |
19232-19235 |
DT |
denotes |
the |
T8582 |
19236-19240 |
JJ |
denotes |
same |
T8583 |
19241-19247 |
NN |
denotes |
degree |
T8584 |
19247-19248 |
. |
denotes |
. |
T8585 |
19249-19251 |
PRP |
denotes |
We |
T8586 |
19252-19256 |
RB |
denotes |
also |
T8587 |
19257-19263 |
VBD |
denotes |
tested |
T8588 |
19264-19271 |
IN |
denotes |
whether |
T8589 |
19272-19276 |
JJ |
denotes |
Sox6 |
T8590 |
19277-19282 |
NNS |
denotes |
binds |
T8591 |
19283-19285 |
TO |
denotes |
to |
T8592 |
19286-19289 |
DT |
denotes |
the |
T8593 |
19290-19292 |
JJ |
denotes |
ɛy |
T8594 |
19293-19301 |
NN |
denotes |
promoter |
T8595 |
19302-19304 |
IN |
denotes |
in |
T8596 |
19305-19309 |
NN |
denotes |
vivo |
T8597 |
19310-19315 |
VBG |
denotes |
using |
T8598 |
19316-19325 |
NN |
denotes |
chromatin |
T8599 |
19326-19345 |
NN |
denotes |
immunoprecipitation |
T8600 |
19346-19347 |
-LRB- |
denotes |
( |
T8601 |
19347-19351 |
NNP |
denotes |
ChIP |
T8602 |
19351-19352 |
-RRB- |
denotes |
) |
T8603 |
19353-19354 |
-LRB- |
denotes |
( |
T8604 |
19354-19360 |
NN |
denotes |
Figure |
T8605 |
19361-19362 |
CD |
denotes |
4 |
T8606 |
19362-19363 |
-RRB- |
denotes |
) |
T8607 |
19363-19364 |
. |
denotes |
. |
T8608 |
19365-19368 |
DT |
denotes |
The |
T8609 |
19369-19384 |
JJ |
denotes |
Sox6-containing |
T8610 |
19385-19392 |
NN |
denotes |
complex |
T8611 |
19393-19396 |
VBD |
denotes |
was |
T8612 |
19397-19415 |
VBN |
denotes |
immunoprecipitated |
T8613 |
19416-19420 |
IN |
denotes |
from |
T8614 |
19421-19424 |
NNP |
denotes |
MEL |
T8615 |
19425-19430 |
NNS |
denotes |
cells |
T8616 |
19431-19433 |
CC |
denotes |
or |
T8617 |
19434-19438 |
IN |
denotes |
from |
T8618 |
19439-19444 |
NN |
denotes |
liver |
T8619 |
19445-19450 |
NNS |
denotes |
cells |
T8620 |
19451-19453 |
IN |
denotes |
of |
T8621 |
19454-19458 |
CD |
denotes |
15.5 |
T8622 |
19459-19462 |
NN |
denotes |
dpc |
T8623 |
19463-19465 |
NNP |
denotes |
WT |
T8624 |
19466-19470 |
NNS |
denotes |
mice |
T8625 |
19471-19476 |
VBG |
denotes |
using |
T8626 |
19477-19481 |
JJ |
denotes |
Sox6 |
T8627 |
19482-19490 |
NN |
denotes |
antibody |
T8628 |
19490-19491 |
. |
denotes |
. |
T8629 |
19492-19498 |
NN |
denotes |
Figure |
T8630 |
19499-19500 |
CD |
denotes |
4 |
T8631 |
19501-19506 |
NNS |
denotes |
shows |
T8632 |
19507-19511 |
IN |
denotes |
that |
T8633 |
19512-19515 |
DT |
denotes |
the |
T8634 |
19516-19518 |
JJ |
denotes |
ɛy |
T8635 |
19519-19527 |
JJ |
denotes |
proximal |
T8636 |
19528-19536 |
NN |
denotes |
promoter |
T8637 |
19537-19539 |
VBZ |
denotes |
is |
T8638 |
19540-19547 |
RB |
denotes |
readily |
T8639 |
19548-19566 |
VBN |
denotes |
immunoprecipitated |
T8640 |
19567-19571 |
IN |
denotes |
with |
T8641 |
19572-19576 |
JJ |
denotes |
Sox6 |
T8642 |
19577-19585 |
NN |
denotes |
antibody |
T8643 |
19586-19588 |
IN |
denotes |
in |
T8644 |
19589-19593 |
DT |
denotes |
both |
T8645 |
19594-19597 |
NNP |
denotes |
MEL |
T8646 |
19598-19603 |
NNS |
denotes |
cells |
T8647 |
19604-19607 |
CC |
denotes |
and |
T8648 |
19608-19613 |
NN |
denotes |
liver |
T8649 |
19614-19619 |
NNS |
denotes |
cells |
T8650 |
19619-19620 |
. |
denotes |
. |
T8651 |
19621-19627 |
JJ |
denotes |
Normal |
T8652 |
19628-19631 |
NNP |
denotes |
IgG |
T8653 |
19632-19635 |
VBD |
denotes |
was |
T8654 |
19636-19640 |
VBN |
denotes |
used |
T8655 |
19641-19643 |
IN |
denotes |
as |
T8656 |
19644-19645 |
DT |
denotes |
a |
T8657 |
19646-19654 |
JJ |
denotes |
negative |
T8658 |
19655-19662 |
NN |
denotes |
control |
T8659 |
19663-19664 |
-LRB- |
denotes |
( |
T8660 |
19664-19670 |
NN |
denotes |
Figure |
T8661 |
19671-19673 |
NN |
denotes |
4A |
T8662 |
19673-19674 |
-RRB- |
denotes |
) |
T8663 |
19674-19675 |
. |
denotes |
. |
T8664 |
19676-19679 |
DT |
denotes |
The |
T8665 |
19680-19685 |
IN |
denotes |
above |
T8666 |
19686-19690 |
NNS |
denotes |
data |
T8667 |
19691-19692 |
-LRB- |
denotes |
( |
T8668 |
19692-19699 |
NNS |
denotes |
Figures |
T8669 |
19700-19701 |
CD |
denotes |
3 |
T8670 |
19702-19705 |
CC |
denotes |
and |
T8671 |
19706-19707 |
CD |
denotes |
4 |
T8672 |
19707-19708 |
-RRB- |
denotes |
) |
T8673 |
19709-19716 |
RB |
denotes |
clearly |
T8674 |
19717-19725 |
VBP |
denotes |
indicate |
T8675 |
19726-19730 |
IN |
denotes |
that |
T8676 |
19731-19735 |
JJ |
denotes |
Sox6 |
T8677 |
19736-19740 |
NNS |
denotes |
acts |
T8678 |
19741-19743 |
IN |
denotes |
as |
T8679 |
19744-19745 |
DT |
denotes |
a |
T8680 |
19746-19755 |
NN |
denotes |
repressor |
T8681 |
19756-19758 |
IN |
denotes |
of |
T8682 |
19759-19762 |
DT |
denotes |
the |
T8683 |
19763-19765 |
JJ |
denotes |
ɛy |
T8684 |
19766-19770 |
NN |
denotes |
gene |
T8685 |
19771-19773 |
IN |
denotes |
by |
T8686 |
19774-19782 |
RB |
denotes |
directly |
T8687 |
19783-19790 |
JJ |
denotes |
binding |
T8688 |
19791-19793 |
TO |
denotes |
to |
T8689 |
19794-19797 |
DT |
denotes |
the |
T8690 |
19798-19800 |
JJ |
denotes |
ɛy |
T8691 |
19801-19809 |
NN |
denotes |
promoter |
T8692 |
19809-19810 |
, |
denotes |
, |
T8693 |
19811-19819 |
RB |
denotes |
probably |
T8694 |
19820-19822 |
IN |
denotes |
as |
T8695 |
19823-19824 |
DT |
denotes |
a |
T8696 |
19825-19830 |
NN |
denotes |
dimer |
T8697 |
19830-19831 |
. |
denotes |
. |
T9421 |
20660-20663 |
DT |
denotes |
The |
T9422 |
20664-20674 |
NNP |
denotes |
Persistent |
T9423 |
20675-20685 |
NNP |
denotes |
Expression |
T9424 |
20686-20688 |
IN |
denotes |
of |
T9425 |
20689-20691 |
NNP |
denotes |
ɛy |
T9426 |
20692-20698 |
NNP |
denotes |
Globin |
T9427 |
20699-20701 |
IN |
denotes |
in |
T9428 |
20702-20716 |
NNP |
denotes |
Sox6-Deficient |
T9429 |
20717-20721 |
NNP |
denotes |
Mice |
T9430 |
20722-20724 |
VBZ |
denotes |
Is |
T9431 |
20725-20728 |
JJ |
denotes |
Due |
T9432 |
20729-20731 |
TO |
denotes |
to |
T9433 |
20732-20733 |
DT |
denotes |
a |
T9434 |
20734-20740 |
NN |
denotes |
Defect |
T9435 |
20741-20743 |
IN |
denotes |
in |
T9436 |
20744-20747 |
DT |
denotes |
the |
T9437 |
20748-20755 |
JJ |
denotes |
ɛy-Gene |
T9438 |
20756-20765 |
VBG |
denotes |
Silencing |
T9439 |
20766-20775 |
NNP |
denotes |
Mechanism |
T9440 |
20776-20778 |
IN |
denotes |
in |
T9441 |
20779-20789 |
NNP |
denotes |
Definitive |
T9442 |
20790-20799 |
NNP |
denotes |
Erythroid |
T9443 |
20800-20805 |
NNP |
denotes |
Cells |
T9444 |
20806-20814 |
NNP |
denotes |
Normally |
T9445 |
20814-20815 |
, |
denotes |
, |
T9446 |
20816-20819 |
DT |
denotes |
the |
T9447 |
20820-20822 |
JJ |
denotes |
ɛy |
T9448 |
20823-20829 |
NN |
denotes |
globin |
T9449 |
20830-20834 |
NN |
denotes |
gene |
T9450 |
20835-20837 |
VBZ |
denotes |
is |
T9451 |
20838-20849 |
RB |
denotes |
exclusively |
T9452 |
20850-20859 |
VBN |
denotes |
expressed |
T9453 |
20860-20862 |
IN |
denotes |
in |
T9454 |
20863-20872 |
JJ |
denotes |
primitive |
T9455 |
20873-20885 |
NNS |
denotes |
erythrocytes |
T9456 |
20886-20889 |
CC |
denotes |
and |
T9457 |
20890-20898 |
VBN |
denotes |
silenced |
T9458 |
20899-20901 |
IN |
denotes |
in |
T9459 |
20902-20912 |
JJ |
denotes |
definitive |
T9460 |
20913-20925 |
NNS |
denotes |
erythrocytes |
T9461 |
20925-20926 |
. |
denotes |
. |
T9462 |
20927-20929 |
TO |
denotes |
To |
T9463 |
20930-20939 |
VB |
denotes |
determine |
T9464 |
20940-20947 |
IN |
denotes |
whether |
T9465 |
20948-20951 |
DT |
denotes |
the |
T9466 |
20952-20962 |
JJ |
denotes |
persistent |
T9467 |
20963-20973 |
NN |
denotes |
expression |
T9468 |
20974-20976 |
IN |
denotes |
of |
T9469 |
20977-20979 |
JJ |
denotes |
ɛy |
T9470 |
20980-20986 |
NN |
denotes |
globin |
T9471 |
20987-20989 |
VBZ |
denotes |
is |
T9472 |
20990-20993 |
JJ |
denotes |
due |
T9473 |
20994-20996 |
TO |
denotes |
to |
T9474 |
20997-21005 |
JJ |
denotes |
residual |
T9475 |
21006-21015 |
JJ |
denotes |
primitive |
T9476 |
21016-21028 |
NNS |
denotes |
erythrocytes |
T9477 |
21029-21031 |
CC |
denotes |
or |
T9478 |
21032-21034 |
VBZ |
denotes |
is |
T9479 |
21035-21038 |
JJ |
denotes |
due |
T9480 |
21039-21041 |
TO |
denotes |
to |
T9481 |
21042-21049 |
JJ |
denotes |
ectopic |
T9482 |
21050-21060 |
NN |
denotes |
expression |
T9483 |
21061-21063 |
IN |
denotes |
of |
T9484 |
21064-21066 |
JJ |
denotes |
ɛy |
T9485 |
21067-21073 |
NN |
denotes |
globin |
T9486 |
21074-21076 |
IN |
denotes |
in |
T9487 |
21077-21087 |
JJ |
denotes |
definitive |
T9488 |
21088-21100 |
NNS |
denotes |
erythrocytes |
T9489 |
21100-21101 |
, |
denotes |
, |
T9490 |
21102-21104 |
PRP |
denotes |
we |
T9491 |
21105-21113 |
VBD |
denotes |
examined |
T9492 |
21114-21117 |
DT |
denotes |
the |
T9493 |
21118-21125 |
JJ |
denotes |
spatial |
T9494 |
21126-21133 |
NN |
denotes |
pattern |
T9495 |
21134-21136 |
IN |
denotes |
of |
T9496 |
21137-21139 |
JJ |
denotes |
ɛy |
T9497 |
21140-21146 |
NN |
denotes |
globin |
T9498 |
21147-21158 |
NNS |
denotes |
transcripts |
T9499 |
21159-21161 |
IN |
denotes |
in |
T9500 |
21162-21167 |
NN |
denotes |
mouse |
T9501 |
21168-21175 |
NNS |
denotes |
embryos |
T9502 |
21176-21178 |
IN |
denotes |
by |
T9503 |
21179-21181 |
IN |
denotes |
in |
T9504 |
21182-21186 |
NN |
denotes |
situ |
T9505 |
21187-21200 |
NN |
denotes |
hybridization |
T9506 |
21201-21202 |
-LRB- |
denotes |
( |
T9507 |
21202-21208 |
NN |
denotes |
Figure |
T9508 |
21209-21210 |
CD |
denotes |
5 |
T9509 |
21210-21211 |
-RRB- |
denotes |
) |
T9510 |
21211-21212 |
. |
denotes |
. |
T9511 |
21213-21215 |
IN |
denotes |
As |
T9512 |
21216-21224 |
VBN |
denotes |
expected |
T9513 |
21224-21225 |
, |
denotes |
, |
T9514 |
21226-21228 |
JJ |
denotes |
ɛy |
T9515 |
21229-21235 |
NN |
denotes |
globin |
T9516 |
21236-21238 |
VBZ |
denotes |
is |
T9517 |
21239-21242 |
RB |
denotes |
not |
T9518 |
21243-21252 |
VBN |
denotes |
expressed |
T9519 |
21253-21255 |
IN |
denotes |
in |
T9520 |
21256-21259 |
DT |
denotes |
the |
T9521 |
21260-21262 |
NNP |
denotes |
WT |
T9522 |
21263-21271 |
JJ |
denotes |
14.5-dpc |
T9523 |
21272-21277 |
NN |
denotes |
liver |
T9524 |
21277-21278 |
, |
denotes |
, |
T9525 |
21279-21282 |
DT |
denotes |
the |
T9526 |
21283-21287 |
NN |
denotes |
site |
T9527 |
21288-21290 |
IN |
denotes |
of |
T9528 |
21291-21301 |
JJ |
denotes |
definitive |
T9529 |
21302-21316 |
NNS |
denotes |
erythropoiesis |
T9530 |
21317-21319 |
IN |
denotes |
in |
T9531 |
21320-21323 |
DT |
denotes |
the |
T9532 |
21324-21329 |
NN |
denotes |
fetus |
T9533 |
21329-21330 |
. |
denotes |
. |
T9534 |
21331-21333 |
IN |
denotes |
In |
T9535 |
21334-21342 |
NN |
denotes |
contrast |
T9536 |
21342-21343 |
, |
denotes |
, |
T9537 |
21344-21352 |
JJ |
denotes |
abundant |
T9538 |
21353-21360 |
JJ |
denotes |
ectopic |
T9539 |
21361-21363 |
NN |
denotes |
ɛy |
T9540 |
21364-21368 |
NNP |
denotes |
mRNA |
T9541 |
21369-21379 |
NN |
denotes |
expression |
T9542 |
21380-21382 |
VBZ |
denotes |
is |
T9543 |
21383-21387 |
VBN |
denotes |
seen |
T9544 |
21388-21390 |
IN |
denotes |
in |
T9545 |
21391-21394 |
DT |
denotes |
the |
T9546 |
21395-21400 |
NN |
denotes |
liver |
T9547 |
21401-21403 |
IN |
denotes |
of |
T9548 |
21404-21412 |
JJ |
denotes |
14.5-dpc |
T9549 |
21413-21420 |
NNS |
denotes |
mutants |
T9550 |
21421-21422 |
-LRB- |
denotes |
( |
T9551 |
21422-21428 |
NN |
denotes |
Figure |
T9552 |
21429-21430 |
CD |
denotes |
5 |
T9553 |
21431-21432 |
DT |
denotes |
A |
T9554 |
21433-21434 |
NNP |
denotes |
D |
T9555 |
21434-21435 |
-RRB- |
denotes |
) |
T9556 |
21435-21436 |
. |
denotes |
. |
T9557 |
21437-21444 |
RB |
denotes |
However |
T9558 |
21444-21445 |
, |
denotes |
, |
T9559 |
21446-21449 |
DT |
denotes |
the |
T9560 |
21450-21460 |
NN |
denotes |
expression |
T9561 |
21461-21463 |
IN |
denotes |
of |
T9562 |
21464-21468 |
NN |
denotes |
βmaj |
T9563 |
21468-21469 |
NN |
denotes |
/ |
T9564 |
21469-21472 |
NN |
denotes |
min |
T9565 |
21473-21479 |
NN |
denotes |
globin |
T9566 |
21480-21482 |
VBZ |
denotes |
is |
T9567 |
21483-21490 |
RB |
denotes |
equally |
T9568 |
21491-21499 |
JJ |
denotes |
abundant |
T9569 |
21500-21502 |
IN |
denotes |
in |
T9570 |
21503-21507 |
DT |
denotes |
both |
T9571 |
21508-21510 |
NNP |
denotes |
WT |
T9572 |
21511-21514 |
CC |
denotes |
and |
T9573 |
21515-21520 |
NNP |
denotes |
p100H |
T9574 |
21521-21527 |
JJ |
denotes |
mutant |
T9575 |
21528-21532 |
NNS |
denotes |
mice |
T9576 |
21533-21534 |
-LRB- |
denotes |
( |
T9577 |
21534-21540 |
NN |
denotes |
Figure |
T9578 |
21541-21542 |
CD |
denotes |
5 |
T9579 |
21543-21544 |
NNP |
denotes |
E |
T9580 |
21545-21548 |
CC |
denotes |
and |
T9581 |
21549-21550 |
NN |
denotes |
F |
T9582 |
21550-21551 |
-RRB- |
denotes |
) |
T9583 |
21551-21552 |
. |
denotes |
. |
T9584 |
21553-21558 |
DT |
denotes |
These |
T9585 |
21559-21563 |
NNS |
denotes |
data |
T9586 |
21564-21575 |
VBP |
denotes |
demonstrate |
T9587 |
21576-21580 |
IN |
denotes |
that |
T9588 |
21581-21584 |
DT |
denotes |
the |
T9589 |
21585-21595 |
JJ |
denotes |
persistent |
T9590 |
21596-21600 |
JJ |
denotes |
high |
T9591 |
21601-21607 |
NNS |
denotes |
levels |
T9592 |
21608-21610 |
IN |
denotes |
of |
T9593 |
21611-21613 |
NN |
denotes |
ɛy |
T9594 |
21614-21617 |
VBP |
denotes |
are |
T9595 |
21618-21621 |
JJ |
denotes |
due |
T9596 |
21622-21624 |
TO |
denotes |
to |
T9597 |
21625-21632 |
JJ |
denotes |
ectopic |
T9598 |
21633-21643 |
NN |
denotes |
expression |
T9599 |
21644-21646 |
IN |
denotes |
in |
T9600 |
21647-21650 |
DT |
denotes |
the |
T9601 |
21651-21661 |
JJ |
denotes |
definitive |
T9602 |
21662-21671 |
JJ |
denotes |
erythroid |
T9603 |
21672-21677 |
NNS |
denotes |
cells |
T9604 |
21678-21682 |
WDT |
denotes |
that |
T9605 |
21683-21689 |
VBP |
denotes |
mature |
T9606 |
21690-21692 |
IN |
denotes |
in |
T9607 |
21693-21696 |
DT |
denotes |
the |
T9608 |
21697-21702 |
JJ |
denotes |
fetal |
T9609 |
21703-21708 |
NN |
denotes |
liver |
T9610 |
21708-21709 |
, |
denotes |
, |
T9611 |
21710-21720 |
VBG |
denotes |
suggesting |
T9612 |
21721-21725 |
IN |
denotes |
that |
T9613 |
21726-21731 |
EX |
denotes |
there |
T9614 |
21732-21734 |
VBZ |
denotes |
is |
T9615 |
21735-21737 |
DT |
denotes |
an |
T9616 |
21738-21747 |
JJ |
denotes |
intrinsic |
T9617 |
21748-21754 |
NN |
denotes |
defect |
T9618 |
21755-21757 |
IN |
denotes |
of |
T9619 |
21758-21761 |
DT |
denotes |
the |
T9620 |
21762-21764 |
NN |
denotes |
ɛy |
T9621 |
21765-21774 |
VBG |
denotes |
silencing |
T9622 |
21775-21784 |
NN |
denotes |
mechanism |
T9623 |
21785-21787 |
IN |
denotes |
in |
T9624 |
21788-21797 |
JJ |
denotes |
Sox6-null |
T9625 |
21798-21802 |
NNS |
denotes |
mice |
T9626 |
21802-21803 |
. |
denotes |
. |
T10094 |
22433-22436 |
DT |
denotes |
The |
T10095 |
22437-22447 |
NNP |
denotes |
Expression |
T10096 |
22448-22455 |
NNP |
denotes |
Pattern |
T10097 |
22456-22458 |
IN |
denotes |
of |
T10098 |
22459-22463 |
NNP |
denotes |
Sox6 |
T10099 |
22464-22472 |
VBZ |
denotes |
Suggests |
T10100 |
22473-22474 |
DT |
denotes |
a |
T10101 |
22475-22479 |
NN |
denotes |
Role |
T10102 |
22480-22482 |
IN |
denotes |
in |
T10103 |
22483-22493 |
JJ |
denotes |
Definitive |
T10104 |
22494-22508 |
NNPS |
denotes |
Erythropoiesis |
T10105 |
22509-22512 |
DT |
denotes |
The |
T10106 |
22513-22524 |
NN |
denotes |
observation |
T10107 |
22525-22529 |
WDT |
denotes |
that |
T10108 |
22530-22544 |
JJ |
denotes |
Sox6-deficient |
T10109 |
22545-22549 |
NNS |
denotes |
mice |
T10110 |
22550-22561 |
RB |
denotes |
ectopically |
T10111 |
22562-22569 |
VBP |
denotes |
express |
T10112 |
22570-22572 |
JJ |
denotes |
ɛy |
T10113 |
22573-22579 |
NN |
denotes |
globin |
T10114 |
22580-22582 |
IN |
denotes |
in |
T10115 |
22583-22588 |
NN |
denotes |
liver |
T10116 |
22588-22589 |
, |
denotes |
, |
T10117 |
22590-22595 |
WRB |
denotes |
where |
T10118 |
22596-22606 |
JJ |
denotes |
definitive |
T10119 |
22607-22616 |
JJ |
denotes |
erythroid |
T10120 |
22617-22622 |
NNS |
denotes |
cells |
T10121 |
22623-22629 |
VBP |
denotes |
mature |
T10122 |
22629-22630 |
, |
denotes |
, |
T10123 |
22631-22639 |
VBZ |
denotes |
suggests |
T10124 |
22640-22644 |
IN |
denotes |
that |
T10125 |
22645-22649 |
NNP |
denotes |
Sox6 |
T10126 |
22650-22652 |
VBZ |
denotes |
is |
T10127 |
22653-22655 |
DT |
denotes |
an |
T10128 |
22656-22665 |
JJ |
denotes |
important |
T10129 |
22666-22675 |
NN |
denotes |
regulator |
T10130 |
22676-22678 |
IN |
denotes |
in |
T10131 |
22679-22689 |
JJ |
denotes |
definitive |
T10132 |
22690-22704 |
NNS |
denotes |
erythropoiesis |
T10133 |
22704-22705 |
. |
denotes |
. |
T10134 |
22706-22708 |
TO |
denotes |
To |
T10135 |
22709-22718 |
VB |
denotes |
determine |
T10136 |
22719-22722 |
DT |
denotes |
the |
T10137 |
22723-22731 |
JJ |
denotes |
temporal |
T10138 |
22732-22735 |
CC |
denotes |
and |
T10139 |
22736-22743 |
JJ |
denotes |
spatial |
T10140 |
22744-22754 |
NN |
denotes |
expression |
T10141 |
22755-22762 |
NN |
denotes |
pattern |
T10142 |
22763-22765 |
IN |
denotes |
of |
T10143 |
22766-22770 |
NNP |
denotes |
Sox6 |
T10144 |
22770-22771 |
, |
denotes |
, |
T10145 |
22772-22780 |
NNP |
denotes |
Northern |
T10146 |
22781-22785 |
NN |
denotes |
blot |
T10147 |
22786-22789 |
CC |
denotes |
and |
T10148 |
22790-22792 |
IN |
denotes |
in |
T10149 |
22793-22797 |
NN |
denotes |
situ |
T10150 |
22798-22811 |
NN |
denotes |
hybridization |
T10151 |
22812-22818 |
NNS |
denotes |
assays |
T10152 |
22819-22823 |
VBD |
denotes |
were |
T10153 |
22824-22832 |
VBN |
denotes |
employed |
T10154 |
22832-22833 |
. |
denotes |
. |
T10155 |
22834-22836 |
IN |
denotes |
As |
T10156 |
22837-22842 |
VBN |
denotes |
shown |
T10157 |
22843-22845 |
IN |
denotes |
in |
T10158 |
22846-22852 |
NN |
denotes |
Figure |
T10159 |
22853-22855 |
CD |
denotes |
6A |
T10160 |
22855-22856 |
, |
denotes |
, |
T10161 |
22857-22861 |
NNP |
denotes |
Sox6 |
T10162 |
22862-22864 |
VBZ |
denotes |
is |
T10163 |
22865-22875 |
JJ |
denotes |
detectable |
T10164 |
22876-22878 |
IN |
denotes |
by |
T10165 |
22879-22887 |
NNP |
denotes |
Northern |
T10166 |
22888-22892 |
NN |
denotes |
blot |
T10167 |
22893-22902 |
NN |
denotes |
beginning |
T10168 |
22903-22905 |
IN |
denotes |
at |
T10169 |
22906-22910 |
CD |
denotes |
10.5 |
T10170 |
22911-22914 |
NN |
denotes |
dpc |
T10171 |
22914-22915 |
, |
denotes |
, |
T10172 |
22916-22926 |
JJ |
denotes |
coincident |
T10173 |
22927-22931 |
IN |
denotes |
with |
T10174 |
22932-22935 |
DT |
denotes |
the |
T10175 |
22936-22944 |
JJ |
denotes |
temporal |
T10176 |
22945-22950 |
NN |
denotes |
onset |
T10177 |
22951-22953 |
IN |
denotes |
of |
T10178 |
22954-22964 |
JJ |
denotes |
definitive |
T10179 |
22965-22979 |
NNS |
denotes |
erythropoiesis |
T10180 |
22980-22982 |
IN |
denotes |
in |
T10181 |
22983-22986 |
DT |
denotes |
the |
T10182 |
22987-22992 |
NN |
denotes |
liver |
T10183 |
22992-22993 |
. |
denotes |
. |
T10184 |
22994-23005 |
RB |
denotes |
Furthermore |
T10185 |
23005-23006 |
, |
denotes |
, |
T10186 |
23007-23009 |
IN |
denotes |
in |
T10187 |
23010-23014 |
NN |
denotes |
situ |
T10188 |
23015-23028 |
NN |
denotes |
hybridization |
T10189 |
23029-23034 |
VBZ |
denotes |
shows |
T10190 |
23035-23039 |
IN |
denotes |
that |
T10191 |
23040-23044 |
NNP |
denotes |
Sox6 |
T10192 |
23045-23047 |
VBZ |
denotes |
is |
T10193 |
23048-23054 |
RB |
denotes |
highly |
T10194 |
23055-23066 |
VBN |
denotes |
transcribed |
T10195 |
23067-23069 |
IN |
denotes |
in |
T10196 |
23070-23078 |
JJ |
denotes |
12.5-dpc |
T10197 |
23079-23084 |
NN |
denotes |
liver |
T10198 |
23084-23085 |
, |
denotes |
, |
T10199 |
23086-23089 |
CC |
denotes |
but |
T10200 |
23090-23093 |
RB |
denotes |
not |
T10201 |
23094-23096 |
IN |
denotes |
in |
T10202 |
23097-23101 |
NN |
denotes |
yolk |
T10203 |
23102-23105 |
NN |
denotes |
sac |
T10204 |
23106-23111 |
NN |
denotes |
blood |
T10205 |
23112-23119 |
NNS |
denotes |
islands |
T10206 |
23120-23122 |
IN |
denotes |
at |
T10207 |
23123-23126 |
CD |
denotes |
7.5 |
T10208 |
23127-23130 |
NN |
denotes |
dpc |
T10209 |
23131-23132 |
-LRB- |
denotes |
( |
T10210 |
23132-23138 |
NN |
denotes |
Figure |
T10211 |
23139-23141 |
NN |
denotes |
6B |
T10212 |
23141-23142 |
-RRB- |
denotes |
) |
T10213 |
23142-23143 |
. |
denotes |
. |
T10214 |
23144-23153 |
RB |
denotes |
Therefore |
T10215 |
23153-23154 |
, |
denotes |
, |
T10216 |
23155-23159 |
JJ |
denotes |
Sox6 |
T10217 |
23160-23170 |
NN |
denotes |
expression |
T10218 |
23171-23173 |
VBZ |
denotes |
is |
T10219 |
23174-23184 |
RB |
denotes |
temporally |
T10220 |
23185-23188 |
CC |
denotes |
and |
T10221 |
23189-23198 |
RB |
denotes |
spatially |
T10222 |
23199-23209 |
JJ |
denotes |
coincident |
T10223 |
23210-23214 |
IN |
denotes |
with |
T10224 |
23215-23225 |
JJ |
denotes |
definitive |
T10225 |
23225-23226 |
, |
denotes |
, |
T10226 |
23227-23230 |
CC |
denotes |
but |
T10227 |
23231-23234 |
RB |
denotes |
not |
T10228 |
23235-23244 |
JJ |
denotes |
primitive |
T10229 |
23244-23245 |
, |
denotes |
, |
T10230 |
23246-23260 |
NNS |
denotes |
erythropoiesis |
T10231 |
23260-23261 |
. |
denotes |
. |
T10232 |
23262-23267 |
DT |
denotes |
These |
T10233 |
23268-23272 |
NNS |
denotes |
data |
T10234 |
23272-23273 |
, |
denotes |
, |
T10235 |
23274-23279 |
VBN |
denotes |
taken |
T10236 |
23280-23288 |
RB |
denotes |
together |
T10237 |
23289-23293 |
IN |
denotes |
with |
T10238 |
23294-23297 |
DT |
denotes |
the |
T10239 |
23298-23309 |
NN |
denotes |
observation |
T10240 |
23310-23314 |
IN |
denotes |
that |
T10241 |
23315-23317 |
JJ |
denotes |
ɛy |
T10242 |
23318-23324 |
NN |
denotes |
globin |
T10243 |
23325-23327 |
VBZ |
denotes |
is |
T10244 |
23328-23334 |
RB |
denotes |
highly |
T10245 |
23335-23344 |
VBN |
denotes |
expressed |
T10246 |
23345-23347 |
IN |
denotes |
in |
T10247 |
23348-23351 |
DT |
denotes |
the |
T10248 |
23352-23357 |
NN |
denotes |
liver |
T10249 |
23358-23363 |
NNS |
denotes |
cells |
T10250 |
23364-23366 |
IN |
denotes |
of |
T10251 |
23367-23375 |
JJ |
denotes |
14.5-dpc |
T10252 |
23376-23381 |
JJ |
denotes |
p100H |
T10253 |
23382-23388 |
JJ |
denotes |
mutant |
T10254 |
23389-23393 |
NNS |
denotes |
mice |
T10255 |
23394-23395 |
-LRB- |
denotes |
( |
T10256 |
23395-23401 |
NN |
denotes |
Figure |
T10257 |
23402-23403 |
CD |
denotes |
5 |
T10258 |
23403-23404 |
-RRB- |
denotes |
) |
T10259 |
23404-23405 |
, |
denotes |
, |
T10260 |
23406-23417 |
VBP |
denotes |
demonstrate |
T10261 |
23418-23422 |
IN |
denotes |
that |
T10262 |
23423-23427 |
JJ |
denotes |
Sox6 |
T10263 |
23428-23437 |
NNS |
denotes |
functions |
T10264 |
23438-23440 |
IN |
denotes |
in |
T10265 |
23441-23451 |
JJ |
denotes |
definitive |
T10266 |
23452-23466 |
NNS |
denotes |
erythropoiesis |
T10267 |
23466-23467 |
. |
denotes |
. |
T10522 |
24516-24522 |
JJ |
denotes |
Mutant |
T10523 |
24523-24528 |
NNP |
denotes |
p100H |
T10524 |
24529-24533 |
NNP |
denotes |
Mice |
T10525 |
24534-24538 |
NNP |
denotes |
Have |
T10526 |
24539-24545 |
JJR |
denotes |
Higher |
T10527 |
24546-24553 |
NNS |
denotes |
Numbers |
T10528 |
24554-24556 |
IN |
denotes |
of |
T10529 |
24557-24566 |
NNP |
denotes |
Nucleated |
T10530 |
24567-24570 |
NNP |
denotes |
Red |
T10531 |
24571-24576 |
NNP |
denotes |
Cells |
T10532 |
24577-24582 |
IN |
denotes |
Among |
T10533 |
24583-24586 |
DT |
denotes |
the |
T10534 |
24587-24592 |
JJ |
denotes |
other |
T10535 |
24593-24597 |
JJ |
denotes |
Sox6 |
T10536 |
24598-24605 |
NNS |
denotes |
effects |
T10537 |
24606-24608 |
IN |
denotes |
in |
T10538 |
24609-24623 |
NN |
denotes |
erythropoiesis |
T10539 |
24623-24624 |
, |
denotes |
, |
T10540 |
24625-24627 |
PRP |
denotes |
we |
T10541 |
24628-24632 |
VBP |
denotes |
have |
T10542 |
24633-24640 |
VBN |
denotes |
noticed |
T10543 |
24641-24645 |
IN |
denotes |
that |
T10544 |
24646-24651 |
EX |
denotes |
there |
T10545 |
24652-24655 |
VBP |
denotes |
are |
T10546 |
24656-24660 |
RBR |
denotes |
more |
T10547 |
24661-24670 |
JJ |
denotes |
nucleated |
T10548 |
24671-24674 |
JJ |
denotes |
red |
T10549 |
24675-24680 |
NN |
denotes |
blood |
T10550 |
24681-24686 |
NNS |
denotes |
cells |
T10551 |
24687-24698 |
VBG |
denotes |
circulating |
T10552 |
24699-24701 |
IN |
denotes |
in |
T10553 |
24702-24707 |
JJ |
denotes |
p100H |
T10554 |
24708-24714 |
JJ |
denotes |
mutant |
T10555 |
24715-24719 |
NNS |
denotes |
mice |
T10556 |
24720-24724 |
IN |
denotes |
than |
T10557 |
24725-24727 |
IN |
denotes |
in |
T10558 |
24728-24730 |
NNP |
denotes |
WT |
T10559 |
24731-24735 |
NNS |
denotes |
mice |
T10560 |
24736-24738 |
IN |
denotes |
at |
T10561 |
24739-24743 |
CD |
denotes |
14.5 |
T10562 |
24744-24747 |
NN |
denotes |
dpc |
T10563 |
24748-24751 |
CC |
denotes |
and |
T10564 |
24752-24756 |
CD |
denotes |
18.5 |
T10565 |
24757-24760 |
NN |
denotes |
dpc |
T10566 |
24761-24762 |
-LRB- |
denotes |
( |
T10567 |
24762-24768 |
NN |
denotes |
Figure |
T10568 |
24769-24771 |
NN |
denotes |
7A |
T10569 |
24771-24772 |
-RRB- |
denotes |
) |
T10570 |
24772-24773 |
. |
denotes |
. |
T10571 |
24774-24781 |
RB |
denotes |
However |
T10572 |
24781-24782 |
, |
denotes |
, |
T10573 |
24783-24785 |
IN |
denotes |
at |
T10574 |
24786-24795 |
JJ |
denotes |
postnatal |
T10575 |
24796-24799 |
NN |
denotes |
day |
T10576 |
24800-24804 |
CD |
denotes |
10.5 |
T10577 |
24804-24805 |
, |
denotes |
, |
T10578 |
24806-24808 |
PRP |
denotes |
we |
T10579 |
24809-24811 |
VBP |
denotes |
do |
T10580 |
24812-24815 |
RB |
denotes |
not |
T10581 |
24816-24819 |
VB |
denotes |
see |
T10582 |
24820-24831 |
VBG |
denotes |
circulating |
T10583 |
24832-24841 |
JJ |
denotes |
nucleated |
T10584 |
24842-24845 |
JJ |
denotes |
red |
T10585 |
24846-24851 |
NNS |
denotes |
cells |
T10586 |
24852-24854 |
IN |
denotes |
in |
T10587 |
24855-24861 |
DT |
denotes |
either |
T10588 |
24862-24864 |
NNP |
denotes |
WT |
T10589 |
24865-24867 |
CC |
denotes |
or |
T10590 |
24868-24874 |
JJ |
denotes |
mutant |
T10591 |
24875-24879 |
NNS |
denotes |
mice |
T10592 |
24879-24880 |
, |
denotes |
, |
T10593 |
24881-24891 |
VBG |
denotes |
suggesting |
T10594 |
24892-24896 |
IN |
denotes |
that |
T10595 |
24897-24901 |
DT |
denotes |
this |
T10596 |
24902-24905 |
MD |
denotes |
may |
T10597 |
24906-24908 |
VB |
denotes |
be |
T10598 |
24909-24910 |
DT |
denotes |
a |
T10599 |
24911-24920 |
JJ |
denotes |
transient |
T10600 |
24921-24927 |
NN |
denotes |
effect |
T10601 |
24927-24928 |
. |
denotes |
. |
T10602 |
24929-24931 |
IN |
denotes |
In |
T10603 |
24932-24940 |
NN |
denotes |
addition |
T10604 |
24940-24941 |
, |
denotes |
, |
T10605 |
24942-24945 |
DT |
denotes |
the |
T10606 |
24946-24952 |
JJ |
denotes |
mutant |
T10607 |
24953-24958 |
NN |
denotes |
liver |
T10608 |
24959-24964 |
VBZ |
denotes |
shows |
T10609 |
24965-24966 |
DT |
denotes |
a |
T10610 |
24967-24978 |
JJ |
denotes |
significant |
T10611 |
24979-24987 |
NN |
denotes |
increase |
T10612 |
24988-24990 |
IN |
denotes |
in |
T10613 |
24991-25004 |
JJ |
denotes |
hematopoietic |
T10614 |
25005-25014 |
NN |
denotes |
precursor |
T10615 |
25015-25020 |
NNS |
denotes |
cells |
T10616 |
25021-25030 |
VBG |
denotes |
including |
T10617 |
25031-25040 |
JJ |
denotes |
nucleated |
T10618 |
25041-25053 |
NNS |
denotes |
erythrocytes |
T10619 |
25054-25056 |
IN |
denotes |
at |
T10620 |
25057-25061 |
CD |
denotes |
18.5 |
T10621 |
25062-25065 |
NN |
denotes |
dpc |
T10622 |
25066-25067 |
-LRB- |
denotes |
( |
T10623 |
25067-25073 |
NN |
denotes |
Figure |
T10624 |
25074-25076 |
NN |
denotes |
7B |
T10625 |
25076-25077 |
-RRB- |
denotes |
) |
T10626 |
25077-25078 |
. |
denotes |
. |
T10627 |
25079-25083 |
DT |
denotes |
This |
T10628 |
25084-25094 |
NN |
denotes |
alteration |
T10629 |
25095-25097 |
VBZ |
denotes |
is |
T10630 |
25098-25103 |
VBN |
denotes |
noted |
T10631 |
25104-25106 |
IN |
denotes |
as |
T10632 |
25107-25112 |
JJ |
denotes |
early |
T10633 |
25113-25115 |
IN |
denotes |
as |
T10634 |
25116-25120 |
CD |
denotes |
14.5 |
T10635 |
25121-25124 |
NN |
denotes |
dpc |
T10636 |
25124-25125 |
. |
denotes |
. |
T10637 |
25126-25131 |
DT |
denotes |
These |
T10638 |
25132-25144 |
NNS |
denotes |
observations |
T10639 |
25145-25152 |
VBP |
denotes |
suggest |
T10640 |
25153-25157 |
IN |
denotes |
that |
T10641 |
25158-25165 |
IN |
denotes |
besides |
T10642 |
25166-25175 |
VBG |
denotes |
silencing |
T10643 |
25176-25179 |
DT |
denotes |
the |
T10644 |
25180-25182 |
JJ |
denotes |
ɛy |
T10645 |
25183-25189 |
NN |
denotes |
globin |
T10646 |
25190-25194 |
NN |
denotes |
gene |
T10647 |
25194-25195 |
, |
denotes |
, |
T10648 |
25196-25200 |
NNP |
denotes |
Sox6 |
T10649 |
25201-25204 |
MD |
denotes |
may |
T10650 |
25205-25211 |
VB |
denotes |
affect |
T10651 |
25212-25215 |
JJ |
denotes |
red |
T10652 |
25216-25220 |
NN |
denotes |
cell |
T10653 |
25221-25231 |
NN |
denotes |
maturation |
T10654 |
25231-25232 |
. |
denotes |
. |
T13803 |
25551-25553 |
IN |
denotes |
In |
T13804 |
25554-25558 |
DT |
denotes |
this |
T13805 |
25559-25565 |
NN |
denotes |
report |
T13806 |
25565-25566 |
, |
denotes |
, |
T13807 |
25567-25569 |
PRP |
denotes |
we |
T13808 |
25570-25574 |
VBP |
denotes |
show |
T13809 |
25575-25579 |
IN |
denotes |
that |
T13810 |
25580-25584 |
NNP |
denotes |
Sox6 |
T13811 |
25585-25587 |
VBZ |
denotes |
is |
T13812 |
25588-25589 |
DT |
denotes |
a |
T13813 |
25590-25595 |
JJ |
denotes |
novel |
T13814 |
25596-25602 |
NN |
denotes |
factor |
T13815 |
25603-25605 |
IN |
denotes |
in |
T13816 |
25606-25609 |
DT |
denotes |
the |
T13817 |
25610-25621 |
JJ |
denotes |
complicated |
T13818 |
25622-25632 |
NN |
denotes |
regulation |
T13819 |
25633-25642 |
NN |
denotes |
mechanism |
T13820 |
25643-25645 |
IN |
denotes |
of |
T13821 |
25646-25652 |
NN |
denotes |
globin |
T13822 |
25653-25658 |
NNS |
denotes |
genes |
T13823 |
25658-25659 |
. |
denotes |
. |
T13824 |
25660-25662 |
IN |
denotes |
In |
T13825 |
25663-25666 |
DT |
denotes |
the |
T13826 |
25667-25671 |
NNP |
denotes |
Sox6 |
T13827 |
25672-25676 |
NN |
denotes |
null |
T13828 |
25677-25682 |
NN |
denotes |
mouse |
T13829 |
25682-25683 |
, |
denotes |
, |
T13830 |
25684-25689 |
EX |
denotes |
there |
T13831 |
25690-25692 |
VBZ |
denotes |
is |
T13832 |
25693-25694 |
DT |
denotes |
a |
T13833 |
25695-25704 |
JJ |
denotes |
transient |
T13834 |
25705-25711 |
NN |
denotes |
effect |
T13835 |
25712-25714 |
IN |
denotes |
on |
T13836 |
25715-25718 |
DT |
denotes |
the |
T13837 |
25719-25728 |
JJ |
denotes |
embryonic |
T13838 |
25729-25735 |
NN |
denotes |
globin |
T13839 |
25736-25741 |
NNS |
denotes |
genes |
T13840 |
25741-25742 |
, |
denotes |
, |
T13841 |
25743-25744 |
NN |
denotes |
ζ |
T13842 |
25745-25748 |
CC |
denotes |
and |
T13843 |
25749-25752 |
NNP |
denotes |
βH1 |
T13844 |
25752-25753 |
, |
denotes |
, |
T13845 |
25754-25757 |
CC |
denotes |
and |
T13846 |
25758-25759 |
DT |
denotes |
a |
T13847 |
25760-25770 |
JJ |
denotes |
persistent |
T13848 |
25771-25783 |
NN |
denotes |
upregulation |
T13849 |
25784-25786 |
IN |
denotes |
of |
T13850 |
25787-25790 |
DT |
denotes |
the |
T13851 |
25791-25793 |
JJ |
denotes |
ɛy |
T13852 |
25794-25800 |
NN |
denotes |
globin |
T13853 |
25801-25805 |
NN |
denotes |
gene |
T13854 |
25805-25806 |
. |
denotes |
. |
T13855 |
25807-25811 |
JJ |
denotes |
Sox6 |
T13856 |
25812-25820 |
RB |
denotes |
directly |
T13857 |
25821-25830 |
VBZ |
denotes |
regulates |
T13858 |
25831-25834 |
CC |
denotes |
and |
T13859 |
25835-25840 |
VBZ |
denotes |
binds |
T13860 |
25841-25843 |
TO |
denotes |
to |
T13861 |
25844-25847 |
DT |
denotes |
the |
T13862 |
25848-25856 |
JJ |
denotes |
proximal |
T13863 |
25857-25865 |
NN |
denotes |
promoter |
T13864 |
25866-25868 |
IN |
denotes |
of |
T13865 |
25869-25871 |
JJ |
denotes |
ɛy |
T13866 |
25872-25876 |
NN |
denotes |
gene |
T13867 |
25877-25880 |
CC |
denotes |
and |
T13868 |
25881-25890 |
VBZ |
denotes |
represses |
T13869 |
25891-25894 |
DT |
denotes |
the |
T13870 |
25895-25904 |
JJ |
denotes |
ɛy-globin |
T13871 |
25905-25909 |
NN |
denotes |
gene |
T13872 |
25910-25912 |
IN |
denotes |
in |
T13873 |
25913-25923 |
JJ |
denotes |
definitive |
T13874 |
25924-25938 |
NNS |
denotes |
erythropoiesis |
T13875 |
25938-25939 |
. |
denotes |
. |
T13876 |
25940-25944 |
JJ |
denotes |
Sox6 |
T13877 |
25945-25952 |
VBZ |
denotes |
belongs |
T13878 |
25953-25955 |
TO |
denotes |
to |
T13879 |
25956-25961 |
NN |
denotes |
group |
T13880 |
25962-25963 |
NNP |
denotes |
D |
T13881 |
25964-25966 |
IN |
denotes |
of |
T13882 |
25967-25970 |
DT |
denotes |
the |
T13883 |
25971-25974 |
NNP |
denotes |
Sox |
T13884 |
25975-25981 |
NN |
denotes |
family |
T13885 |
25982-25984 |
IN |
denotes |
of |
T13886 |
25985-25993 |
NNS |
denotes |
proteins |
T13887 |
25994-25998 |
WDT |
denotes |
that |
T13888 |
25999-26007 |
VBZ |
denotes |
includes |
T13889 |
26008-26012 |
NNS |
denotes |
Sox5 |
T13890 |
26012-26013 |
, |
denotes |
, |
T13891 |
26014-26016 |
CD |
denotes |
12 |
T13892 |
26016-26017 |
, |
denotes |
, |
T13893 |
26018-26020 |
CD |
denotes |
13 |
T13894 |
26020-26021 |
, |
denotes |
, |
T13895 |
26022-26025 |
CC |
denotes |
and |
T13896 |
26026-26028 |
CD |
denotes |
23 |
T13897 |
26029-26030 |
NNP |
denotes |
[ |
T13898 |
26030-26032 |
CD |
denotes |
34 |
T13899 |
26032-26033 |
NNP |
denotes |
] |
T13900 |
26033-26034 |
. |
denotes |
. |
T13901 |
26035-26040 |
NNP |
denotes |
Group |
T13902 |
26041-26042 |
NNP |
denotes |
D |
T13903 |
26043-26046 |
NNP |
denotes |
Sox |
T13904 |
26047-26055 |
NNS |
denotes |
proteins |
T13905 |
26056-26063 |
VBP |
denotes |
contain |
T13906 |
26064-26065 |
DT |
denotes |
a |
T13907 |
26066-26072 |
VBN |
denotes |
coiled |
T13908 |
26073-26079 |
VBN |
denotes |
coiled |
T13909 |
26080-26086 |
NN |
denotes |
domain |
T13910 |
26087-26091 |
WDT |
denotes |
that |
T13911 |
26092-26100 |
VBZ |
denotes |
mediates |
T13912 |
26101-26105 |
NN |
denotes |
homo |
T13913 |
26105-26106 |
: |
denotes |
- |
T13914 |
26107-26110 |
CC |
denotes |
and |
T13915 |
26111-26129 |
NN |
denotes |
heterodimerization |
T13916 |
26130-26131 |
NNP |
denotes |
[ |
T13917 |
26131-26135 |
CD |
denotes |
6,35 |
T13918 |
26135-26136 |
NNP |
denotes |
] |
T13919 |
26136-26137 |
. |
denotes |
. |
T13920 |
26138-26150 |
RB |
denotes |
Functionally |
T13921 |
26150-26151 |
, |
denotes |
, |
T13922 |
26152-26164 |
NN |
denotes |
dimerization |
T13923 |
26165-26167 |
IN |
denotes |
of |
T13924 |
26168-26172 |
NNS |
denotes |
Sox5 |
T13925 |
26173-26176 |
CC |
denotes |
and |
T13926 |
26177-26181 |
NNP |
denotes |
Sox6 |
T13927 |
26182-26185 |
VBZ |
denotes |
has |
T13928 |
26186-26190 |
VBN |
denotes |
been |
T13929 |
26191-26196 |
VBN |
denotes |
shown |
T13930 |
26197-26199 |
TO |
denotes |
to |
T13931 |
26200-26207 |
RB |
denotes |
greatly |
T13932 |
26208-26216 |
VB |
denotes |
increase |
T13933 |
26217-26220 |
DT |
denotes |
the |
T13934 |
26221-26228 |
JJ |
denotes |
binding |
T13935 |
26229-26239 |
NN |
denotes |
efficiency |
T13936 |
26240-26242 |
IN |
denotes |
of |
T13937 |
26243-26246 |
DT |
denotes |
the |
T13938 |
26247-26250 |
CD |
denotes |
two |
T13939 |
26251-26254 |
NNP |
denotes |
Sox |
T13940 |
26255-26263 |
NNS |
denotes |
proteins |
T13941 |
26264-26266 |
TO |
denotes |
to |
T13942 |
26267-26270 |
NNP |
denotes |
DNA |
T13943 |
26271-26275 |
IN |
denotes |
that |
T13944 |
26276-26284 |
VBZ |
denotes |
contains |
T13945 |
26285-26293 |
JJ |
denotes |
adjacent |
T13946 |
26294-26297 |
NNP |
denotes |
Sox |
T13947 |
26298-26303 |
NNS |
denotes |
sites |
T13948 |
26304-26305 |
NNP |
denotes |
[ |
T13949 |
26305-26306 |
CD |
denotes |
6 |
T13950 |
26306-26307 |
NNP |
denotes |
] |
T13951 |
26307-26308 |
. |
denotes |
. |
T13952 |
26309-26311 |
IN |
denotes |
In |
T13953 |
26312-26320 |
NN |
denotes |
addition |
T13954 |
26320-26321 |
, |
denotes |
, |
T13955 |
26322-26326 |
JJ |
denotes |
Sox6 |
T13956 |
26327-26332 |
NNS |
denotes |
binds |
T13957 |
26333-26337 |
RBR |
denotes |
more |
T13958 |
26338-26346 |
RB |
denotes |
strongly |
T13959 |
26347-26349 |
TO |
denotes |
to |
T13960 |
26350-26352 |
DT |
denotes |
an |
T13961 |
26353-26360 |
JJ |
denotes |
HMG-box |
T13962 |
26361-26366 |
NN |
denotes |
dimer |
T13963 |
26367-26372 |
NN |
denotes |
motif |
T13964 |
26373-26377 |
IN |
denotes |
than |
T13965 |
26378-26380 |
TO |
denotes |
to |
T13966 |
26381-26382 |
DT |
denotes |
a |
T13967 |
26383-26389 |
JJ |
denotes |
single |
T13968 |
26390-26397 |
JJ |
denotes |
HMG-box |
T13969 |
26398-26403 |
NN |
denotes |
motif |
T13970 |
26404-26405 |
NN |
denotes |
[ |
T13971 |
26405-26406 |
CD |
denotes |
5 |
T13972 |
26406-26407 |
NNP |
denotes |
] |
T13973 |
26407-26408 |
. |
denotes |
. |
T13974 |
26409-26418 |
RB |
denotes |
Therefore |
T13975 |
26418-26419 |
, |
denotes |
, |
T13976 |
26420-26422 |
PRP |
denotes |
it |
T13977 |
26423-26430 |
VBZ |
denotes |
appears |
T13978 |
26431-26435 |
IN |
denotes |
that |
T13979 |
26436-26442 |
NN |
denotes |
target |
T13980 |
26443-26448 |
NNS |
denotes |
genes |
T13981 |
26449-26452 |
IN |
denotes |
for |
T13982 |
26453-26458 |
NN |
denotes |
group |
T13983 |
26459-26460 |
NNP |
denotes |
D |
T13984 |
26461-26464 |
NNP |
denotes |
Sox |
T13985 |
26465-26473 |
NNS |
denotes |
proteins |
T13986 |
26473-26474 |
, |
denotes |
, |
T13987 |
26475-26479 |
JJ |
denotes |
such |
T13988 |
26480-26482 |
IN |
denotes |
as |
T13989 |
26483-26487 |
NNP |
denotes |
Sox6 |
T13990 |
26487-26488 |
, |
denotes |
, |
T13991 |
26489-26497 |
RB |
denotes |
probably |
T13992 |
26498-26504 |
NN |
denotes |
harbor |
T13993 |
26505-26510 |
NNS |
denotes |
pairs |
T13994 |
26511-26513 |
IN |
denotes |
of |
T13995 |
26514-26517 |
NNP |
denotes |
HMG |
T13996 |
26518-26525 |
JJ |
denotes |
binding |
T13997 |
26526-26531 |
NNS |
denotes |
sites |
T13998 |
26532-26536 |
IN |
denotes |
with |
T13999 |
26537-26538 |
DT |
denotes |
a |
T14000 |
26539-26552 |
NN |
denotes |
configuration |
T14001 |
26553-26563 |
JJ |
denotes |
compatible |
T14002 |
26564-26568 |
IN |
denotes |
with |
T14003 |
26569-26576 |
JJ |
denotes |
binding |
T14004 |
26577-26579 |
IN |
denotes |
of |
T14005 |
26580-26585 |
JJ |
denotes |
D-Sox |
T14006 |
26586-26593 |
NN |
denotes |
protein |
T14007 |
26594-26600 |
NNS |
denotes |
dimers |
T14008 |
26600-26601 |
. |
denotes |
. |
T14009 |
26602-26608 |
RB |
denotes |
Indeed |
T14010 |
26608-26609 |
, |
denotes |
, |
T14011 |
26610-26612 |
IN |
denotes |
in |
T14012 |
26613-26616 |
DT |
denotes |
the |
T14013 |
26617-26624 |
JJ |
denotes |
present |
T14014 |
26625-26630 |
NN |
denotes |
study |
T14015 |
26630-26631 |
, |
denotes |
, |
T14016 |
26632-26635 |
DT |
denotes |
the |
T14017 |
26636-26643 |
VBN |
denotes |
defined |
T14018 |
26644-26648 |
NNP |
denotes |
Sox6 |
T14019 |
26649-26655 |
NN |
denotes |
target |
T14020 |
26656-26664 |
NN |
denotes |
sequence |
T14021 |
26665-26667 |
IN |
denotes |
of |
T14022 |
26668-26671 |
DT |
denotes |
the |
T14023 |
26672-26674 |
JJ |
denotes |
ɛy |
T14024 |
26675-26683 |
NN |
denotes |
promoter |
T14025 |
26684-26692 |
VBZ |
denotes |
contains |
T14026 |
26693-26696 |
CD |
denotes |
two |
T14027 |
26697-26705 |
JJ |
denotes |
Sox/Sox6 |
T14028 |
26706-26715 |
NN |
denotes |
consensus |
T14029 |
26716-26721 |
NNS |
denotes |
sites |
T14030 |
26722-26723 |
-LRB- |
denotes |
( |
T14031 |
26723-26729 |
NN |
denotes |
Figure |
T14032 |
26730-26732 |
NN |
denotes |
3A |
T14033 |
26732-26733 |
-RRB- |
denotes |
) |
T14034 |
26733-26734 |
. |
denotes |
. |
T14035 |
26735-26747 |
RB |
denotes |
Functionally |
T14036 |
26747-26748 |
, |
denotes |
, |
T14037 |
26749-26753 |
DT |
denotes |
both |
T14038 |
26754-26759 |
NNS |
denotes |
sites |
T14039 |
26760-26763 |
VBP |
denotes |
are |
T14040 |
26764-26773 |
JJ |
denotes |
essential |
T14041 |
26774-26777 |
IN |
denotes |
for |
T14042 |
26778-26782 |
JJ |
denotes |
Sox6 |
T14043 |
26783-26790 |
JJ |
denotes |
binding |
T14044 |
26791-26793 |
TO |
denotes |
to |
T14045 |
26794-26797 |
DT |
denotes |
the |
T14046 |
26798-26800 |
JJ |
denotes |
ɛy |
T14047 |
26801-26809 |
NN |
denotes |
promoter |
T14048 |
26810-26813 |
CC |
denotes |
and |
T14049 |
26814-26824 |
NN |
denotes |
repression |
T14050 |
26825-26827 |
IN |
denotes |
of |
T14051 |
26828-26831 |
PRP$ |
denotes |
its |
T14052 |
26832-26840 |
NN |
denotes |
activity |
T14053 |
26841-26842 |
-LRB- |
denotes |
( |
T14054 |
26842-26848 |
NN |
denotes |
Figure |
T14055 |
26849-26851 |
CD |
denotes |
3E |
T14056 |
26852-26855 |
CC |
denotes |
and |
T14057 |
26856-26858 |
CD |
denotes |
3F |
T14058 |
26858-26859 |
-RRB- |
denotes |
) |
T14059 |
26859-26860 |
. |
denotes |
. |
T14060 |
26861-26866 |
DT |
denotes |
These |
T14061 |
26867-26879 |
NNS |
denotes |
observations |
T14062 |
26880-26887 |
VBP |
denotes |
suggest |
T14063 |
26888-26892 |
IN |
denotes |
that |
T14064 |
26893-26897 |
JJ |
denotes |
Sox6 |
T14065 |
26898-26903 |
NNS |
denotes |
binds |
T14066 |
26904-26906 |
TO |
denotes |
to |
T14067 |
26907-26911 |
DT |
denotes |
this |
T14068 |
26912-26920 |
NN |
denotes |
sequence |
T14069 |
26921-26923 |
IN |
denotes |
of |
T14070 |
26924-26927 |
DT |
denotes |
the |
T14071 |
26928-26930 |
JJ |
denotes |
ɛy |
T14072 |
26931-26939 |
NN |
denotes |
promoter |
T14073 |
26940-26946 |
CC |
denotes |
either |
T14074 |
26947-26949 |
IN |
denotes |
as |
T14075 |
26950-26951 |
DT |
denotes |
a |
T14076 |
26952-26961 |
NN |
denotes |
homodimer |
T14077 |
26962-26964 |
CC |
denotes |
or |
T14078 |
26965-26967 |
IN |
denotes |
as |
T14079 |
26968-26969 |
DT |
denotes |
a |
T14080 |
26970-26981 |
NN |
denotes |
heterodimer |
T14081 |
26982-26986 |
IN |
denotes |
with |
T14082 |
26987-26992 |
JJ |
denotes |
other |
T14083 |
26993-26996 |
NNP |
denotes |
Sox |
T14084 |
26997-27005 |
NNS |
denotes |
proteins |
T14085 |
27005-27006 |
. |
denotes |
. |
T14086 |
27007-27014 |
IN |
denotes |
Because |
T14087 |
27015-27018 |
NNP |
denotes |
Sox |
T14088 |
27019-27027 |
NNS |
denotes |
proteins |
T14089 |
27028-27037 |
VBP |
denotes |
recognize |
T14090 |
27038-27039 |
DT |
denotes |
a |
T14091 |
27040-27045 |
JJ |
denotes |
short |
T14092 |
27046-27050 |
JJ |
denotes |
6-bp |
T14093 |
27051-27063 |
JJ |
denotes |
core-binding |
T14094 |
27064-27072 |
NN |
denotes |
sequence |
T14095 |
27073-27077 |
WDT |
denotes |
that |
T14096 |
27078-27084 |
VBZ |
denotes |
allows |
T14097 |
27085-27088 |
IN |
denotes |
for |
T14098 |
27089-27101 |
JJ |
denotes |
considerable |
T14099 |
27102-27112 |
NN |
denotes |
degeneracy |
T14100 |
27112-27113 |
, |
denotes |
, |
T14101 |
27114-27117 |
DT |
denotes |
the |
T14102 |
27118-27129 |
NN |
denotes |
specificity |
T14103 |
27130-27132 |
IN |
denotes |
of |
T14104 |
27133-27138 |
PRP$ |
denotes |
their |
T14105 |
27139-27146 |
NNS |
denotes |
actions |
T14106 |
27147-27149 |
VBZ |
denotes |
is |
T14107 |
27150-27157 |
VBN |
denotes |
thought |
T14108 |
27158-27160 |
TO |
denotes |
to |
T14109 |
27161-27165 |
VB |
denotes |
rely |
T14110 |
27166-27170 |
IN |
denotes |
upon |
T14111 |
27171-27183 |
NNS |
denotes |
interactions |
T14112 |
27184-27188 |
IN |
denotes |
with |
T14113 |
27189-27194 |
JJ |
denotes |
other |
T14114 |
27195-27208 |
NN |
denotes |
transcription |
T14115 |
27209-27216 |
NNS |
denotes |
factors |
T14116 |
27217-27218 |
NNP |
denotes |
[ |
T14117 |
27218-27220 |
CD |
denotes |
36 |
T14118 |
27220-27221 |
NNP |
denotes |
] |
T14119 |
27221-27222 |
. |
denotes |
. |
T14120 |
27223-27225 |
IN |
denotes |
In |
T14121 |
27226-27229 |
PRP$ |
denotes |
our |
T14122 |
27230-27235 |
NNS |
denotes |
EMSAs |
T14123 |
27235-27236 |
, |
denotes |
, |
T14124 |
27237-27239 |
PRP |
denotes |
we |
T14125 |
27240-27243 |
VBD |
denotes |
had |
T14126 |
27244-27246 |
TO |
denotes |
to |
T14127 |
27247-27250 |
VB |
denotes |
run |
T14128 |
27251-27254 |
DT |
denotes |
the |
T14129 |
27255-27270 |
NN |
denotes |
electrophoresis |
T14130 |
27271-27273 |
IN |
denotes |
on |
T14131 |
27274-27275 |
DT |
denotes |
a |
T14132 |
27276-27277 |
CD |
denotes |
4 |
T14133 |
27277-27278 |
NN |
denotes |
% |
T14134 |
27279-27280 |
CD |
denotes |
6 |
T14135 |
27280-27281 |
NN |
denotes |
% |
T14136 |
27282-27285 |
NN |
denotes |
gel |
T14137 |
27286-27289 |
IN |
denotes |
for |
T14138 |
27290-27292 |
IN |
denotes |
at |
T14139 |
27293-27298 |
JJS |
denotes |
least |
T14140 |
27299-27300 |
CD |
denotes |
4 |
T14141 |
27301-27302 |
CD |
denotes |
8 |
T14142 |
27303-27304 |
NN |
denotes |
h |
T14143 |
27305-27307 |
TO |
denotes |
to |
T14144 |
27308-27314 |
VB |
denotes |
detect |
T14145 |
27315-27318 |
DT |
denotes |
the |
T14146 |
27319-27334 |
JJ |
denotes |
Sox6-associated |
T14147 |
27335-27339 |
NN |
denotes |
band |
T14148 |
27339-27340 |
, |
denotes |
, |
T14149 |
27341-27351 |
VBG |
denotes |
suggesting |
T14150 |
27352-27356 |
IN |
denotes |
that |
T14151 |
27357-27361 |
NNP |
denotes |
Sox6 |
T14152 |
27362-27364 |
VBZ |
denotes |
is |
T14153 |
27365-27369 |
NN |
denotes |
part |
T14154 |
27370-27372 |
IN |
denotes |
of |
T14155 |
27373-27374 |
DT |
denotes |
a |
T14156 |
27375-27379 |
JJ |
denotes |
high |
T14157 |
27380-27389 |
JJ |
denotes |
molecular |
T14158 |
27390-27396 |
NN |
denotes |
weight |
T14159 |
27397-27404 |
NN |
denotes |
complex |
T14160 |
27404-27405 |
. |
denotes |
. |
T14161 |
27406-27407 |
DT |
denotes |
A |
T14162 |
27408-27411 |
JJ |
denotes |
few |
T14163 |
27412-27417 |
JJ |
denotes |
other |
T14164 |
27418-27420 |
JJ |
denotes |
ɛy |
T14165 |
27421-27427 |
NN |
denotes |
globin |
T14166 |
27428-27438 |
NNS |
denotes |
repressors |
T14167 |
27439-27443 |
VBP |
denotes |
have |
T14168 |
27444-27448 |
VBN |
denotes |
been |
T14169 |
27449-27457 |
VBN |
denotes |
reported |
T14170 |
27458-27460 |
TO |
denotes |
to |
T14171 |
27461-27465 |
NN |
denotes |
bind |
T14172 |
27466-27468 |
TO |
denotes |
to |
T14173 |
27469-27472 |
NNP |
denotes |
DNA |
T14174 |
27473-27482 |
NNS |
denotes |
sequences |
T14175 |
27483-27487 |
IN |
denotes |
near |
T14176 |
27488-27491 |
DT |
denotes |
the |
T14177 |
27492-27500 |
NNP |
denotes |
Sox/Sox6 |
T14178 |
27501-27510 |
NN |
denotes |
consensus |
T14179 |
27511-27516 |
NNS |
denotes |
sites |
T14180 |
27516-27517 |
, |
denotes |
, |
T14181 |
27518-27527 |
VBG |
denotes |
including |
T14182 |
27528-27531 |
DT |
denotes |
the |
T14183 |
27532-27536 |
NNP |
denotes |
DRED |
T14184 |
27537-27544 |
JJ |
denotes |
complex |
T14185 |
27545-27546 |
NNP |
denotes |
[ |
T14186 |
27546-27548 |
CD |
denotes |
37 |
T14187 |
27548-27549 |
NNP |
denotes |
] |
T14188 |
27550-27553 |
CC |
denotes |
and |
T14189 |
27554-27561 |
NNP |
denotes |
COUP-TF |
T14190 |
27562-27563 |
NNP |
denotes |
[ |
T14191 |
27563-27565 |
CD |
denotes |
38 |
T14192 |
27565-27566 |
NNP |
denotes |
] |
T14193 |
27566-27567 |
. |
denotes |
. |
T14194 |
27568-27572 |
NNS |
denotes |
Sox6 |
T14195 |
27573-27578 |
MD |
denotes |
might |
T14196 |
27579-27587 |
VB |
denotes |
interact |
T14197 |
27588-27592 |
IN |
denotes |
with |
T14198 |
27593-27598 |
DT |
denotes |
these |
T14199 |
27599-27606 |
NNS |
denotes |
factors |
T14200 |
27607-27610 |
CC |
denotes |
and |
T14201 |
27611-27615 |
VB |
denotes |
form |
T14202 |
27616-27617 |
DT |
denotes |
a |
T14203 |
27618-27623 |
JJ |
denotes |
large |
T14204 |
27624-27634 |
NN |
denotes |
repression |
T14205 |
27635-27642 |
NN |
denotes |
complex |
T14206 |
27642-27643 |
. |
denotes |
. |
T14207 |
27644-27658 |
NN |
denotes |
Identification |
T14208 |
27659-27661 |
IN |
denotes |
of |
T14209 |
27662-27667 |
JJ |
denotes |
other |
T14210 |
27668-27678 |
NNS |
denotes |
components |
T14211 |
27679-27681 |
IN |
denotes |
of |
T14212 |
27682-27685 |
DT |
denotes |
the |
T14213 |
27686-27701 |
JJ |
denotes |
Sox6-containing |
T14214 |
27702-27709 |
JJ |
denotes |
complex |
T14215 |
27710-27720 |
VBN |
denotes |
associated |
T14216 |
27721-27725 |
IN |
denotes |
with |
T14217 |
27726-27729 |
DT |
denotes |
the |
T14218 |
27730-27732 |
JJ |
denotes |
ɛy |
T14219 |
27733-27741 |
NN |
denotes |
promoter |
T14220 |
27742-27746 |
MD |
denotes |
will |
T14221 |
27747-27751 |
VB |
denotes |
shed |
T14222 |
27752-27757 |
NN |
denotes |
light |
T14223 |
27758-27760 |
IN |
denotes |
on |
T14224 |
27761-27764 |
PRP$ |
denotes |
its |
T14225 |
27765-27774 |
NN |
denotes |
mechanism |
T14226 |
27775-27777 |
IN |
denotes |
of |
T14227 |
27778-27788 |
NN |
denotes |
repression |
T14228 |
27788-27789 |
. |
denotes |
. |
T14229 |
27790-27793 |
NNP |
denotes |
Sox |
T14230 |
27794-27802 |
NNS |
denotes |
proteins |
T14231 |
27803-27807 |
NN |
denotes |
bind |
T14232 |
27808-27811 |
CC |
denotes |
and |
T14233 |
27812-27816 |
VB |
denotes |
bend |
T14234 |
27817-27823 |
JJ |
denotes |
linear |
T14235 |
27824-27827 |
NN |
denotes |
DNA |
T14236 |
27828-27830 |
IN |
denotes |
by |
T14237 |
27831-27838 |
JJ |
denotes |
partial |
T14238 |
27839-27852 |
NN |
denotes |
intercalation |
T14239 |
27853-27855 |
IN |
denotes |
in |
T14240 |
27856-27859 |
DT |
denotes |
the |
T14241 |
27860-27865 |
JJ |
denotes |
minor |
T14242 |
27866-27872 |
NN |
denotes |
groove |
T14243 |
27872-27873 |
, |
denotes |
, |
T14244 |
27874-27877 |
CC |
denotes |
and |
T14245 |
27878-27881 |
MD |
denotes |
can |
T14246 |
27882-27886 |
RB |
denotes |
also |
T14247 |
27887-27891 |
NN |
denotes |
bind |
T14248 |
27892-27894 |
TO |
denotes |
to |
T14249 |
27895-27903 |
JJ |
denotes |
four-way |
T14250 |
27904-27913 |
NNS |
denotes |
junctions |
T14251 |
27914-27915 |
VBP |
denotes |
[ |
T14252 |
27915-27916 |
CD |
denotes |
2 |
T14253 |
27917-27918 |
CD |
denotes |
4 |
T14254 |
27918-27919 |
NNP |
denotes |
] |
T14255 |
27919-27920 |
. |
denotes |
. |
T14256 |
27921-27930 |
RB |
denotes |
Therefore |
T14257 |
27930-27931 |
, |
denotes |
, |
T14258 |
27932-27935 |
CD |
denotes |
one |
T14259 |
27936-27946 |
JJ |
denotes |
attractive |
T14260 |
27947-27952 |
NN |
denotes |
model |
T14261 |
27953-27955 |
TO |
denotes |
to |
T14262 |
27956-27963 |
VB |
denotes |
explain |
T14263 |
27964-27967 |
WRB |
denotes |
how |
T14264 |
27968-27972 |
JJ |
denotes |
Sox6 |
T14265 |
27973-27981 |
NNS |
denotes |
proteins |
T14266 |
27982-27989 |
VBP |
denotes |
control |
T14267 |
27990-27994 |
NN |
denotes |
gene |
T14268 |
27995-28005 |
NN |
denotes |
expression |
T14269 |
28006-28008 |
VBZ |
denotes |
is |
T14270 |
28009-28013 |
IN |
denotes |
that |
T14271 |
28014-28018 |
PRP |
denotes |
they |
T14272 |
28019-28027 |
VBP |
denotes |
function |
T14273 |
28028-28030 |
IN |
denotes |
as |
T14274 |
28031-28044 |
JJ |
denotes |
architectural |
T14275 |
28045-28052 |
NNS |
denotes |
factors |
T14276 |
28053-28058 |
VBN |
denotes |
bound |
T14277 |
28059-28061 |
TO |
denotes |
to |
T14278 |
28062-28065 |
NNP |
denotes |
DNA |
T14279 |
28065-28066 |
, |
denotes |
, |
T14280 |
28067-28078 |
VBG |
denotes |
influencing |
T14281 |
28079-28084 |
JJ |
denotes |
local |
T14282 |
28085-28094 |
NN |
denotes |
chromatin |
T14283 |
28095-28104 |
NN |
denotes |
structure |
T14284 |
28105-28107 |
IN |
denotes |
by |
T14285 |
28108-28115 |
VBG |
denotes |
bending |
T14286 |
28116-28119 |
NNP |
denotes |
DNA |
T14287 |
28120-28123 |
CC |
denotes |
and |
T14288 |
28124-28126 |
IN |
denotes |
by |
T14289 |
28127-28137 |
VBG |
denotes |
assembling |
T14290 |
28138-28150 |
JJ |
denotes |
multiprotein |
T14291 |
28151-28166 |
JJ |
denotes |
transcriptional |
T14292 |
28167-28176 |
NNS |
denotes |
complexes |
T14293 |
28176-28177 |
. |
denotes |
. |
T14294 |
28178-28180 |
IN |
denotes |
By |
T14295 |
28181-28189 |
VBG |
denotes |
changing |
T14296 |
28190-28193 |
DT |
denotes |
the |
T14297 |
28194-28199 |
JJ |
denotes |
local |
T14298 |
28200-28209 |
NN |
denotes |
chromatin |
T14299 |
28210-28219 |
NN |
denotes |
structure |
T14300 |
28219-28220 |
, |
denotes |
, |
T14301 |
28221-28225 |
NNP |
denotes |
Sox6 |
T14302 |
28226-28231 |
MD |
denotes |
could |
T14303 |
28232-28238 |
RB |
denotes |
either |
T14304 |
28239-28248 |
VB |
denotes |
interfere |
T14305 |
28249-28253 |
IN |
denotes |
with |
T14306 |
28254-28261 |
JJ |
denotes |
binding |
T14307 |
28262-28264 |
IN |
denotes |
of |
T14308 |
28265-28270 |
JJ |
denotes |
other |
T14309 |
28271-28281 |
NNS |
denotes |
activators |
T14310 |
28282-28284 |
TO |
denotes |
to |
T14311 |
28285-28288 |
DT |
denotes |
the |
T14312 |
28289-28297 |
NN |
denotes |
promoter |
T14313 |
28298-28300 |
CC |
denotes |
or |
T14314 |
28301-28311 |
VB |
denotes |
facilitate |
T14315 |
28312-28319 |
JJ |
denotes |
binding |
T14316 |
28320-28322 |
IN |
denotes |
of |
T14317 |
28323-28328 |
JJ |
denotes |
other |
T14318 |
28329-28339 |
NNS |
denotes |
repressors |
T14319 |
28339-28340 |
. |
denotes |
. |
T14320 |
28341-28348 |
DT |
denotes |
Another |
T14321 |
28349-28356 |
NN |
denotes |
example |
T14322 |
28357-28359 |
IN |
denotes |
of |
T14323 |
28360-28361 |
DT |
denotes |
a |
T14324 |
28362-28371 |
NN |
denotes |
repressor |
T14325 |
28372-28376 |
WDT |
denotes |
that |
T14326 |
28377-28387 |
VBZ |
denotes |
interferes |
T14327 |
28388-28392 |
IN |
denotes |
with |
T14328 |
28393-28395 |
DT |
denotes |
an |
T14329 |
28396-28405 |
NN |
denotes |
activator |
T14330 |
28406-28408 |
IN |
denotes |
on |
T14331 |
28409-28412 |
DT |
denotes |
the |
T14332 |
28413-28415 |
JJ |
denotes |
ɛy |
T14333 |
28416-28424 |
NN |
denotes |
promoter |
T14334 |
28425-28427 |
VBZ |
denotes |
is |
T14335 |
28428-28432 |
NNP |
denotes |
DRED |
T14336 |
28432-28433 |
. |
denotes |
. |
T14337 |
28434-28438 |
NNP |
denotes |
DRED |
T14338 |
28439-28449 |
VBZ |
denotes |
interferes |
T14339 |
28450-28454 |
IN |
denotes |
with |
T14340 |
28455-28459 |
NNP |
denotes |
EKLF |
T14341 |
28459-28460 |
, |
denotes |
, |
T14342 |
28461-28463 |
DT |
denotes |
an |
T14343 |
28464-28473 |
NN |
denotes |
activator |
T14344 |
28473-28474 |
, |
denotes |
, |
T14345 |
28475-28477 |
IN |
denotes |
in |
T14346 |
28478-28485 |
JJ |
denotes |
binding |
T14347 |
28486-28488 |
TO |
denotes |
to |
T14348 |
28489-28492 |
DT |
denotes |
the |
T14349 |
28493-28495 |
JJ |
denotes |
ɛy |
T14350 |
28496-28504 |
NN |
denotes |
promoter |
T14351 |
28505-28506 |
NNP |
denotes |
[ |
T14352 |
28506-28508 |
CD |
denotes |
39 |
T14353 |
28508-28509 |
NNP |
denotes |
] |
T14354 |
28509-28510 |
. |
denotes |
. |
T14355 |
28511-28514 |
CD |
denotes |
Two |
T14356 |
28515-28518 |
NNP |
denotes |
HMG |
T14357 |
28519-28532 |
JJ |
denotes |
architectural |
T14358 |
28533-28541 |
NNS |
denotes |
proteins |
T14359 |
28542-28543 |
-LRB- |
denotes |
( |
T14360 |
28543-28552 |
RB |
denotes |
distantly |
T14361 |
28553-28560 |
VBN |
denotes |
related |
T14362 |
28561-28563 |
TO |
denotes |
to |
T14363 |
28564-28567 |
DT |
denotes |
the |
T14364 |
28568-28571 |
NNP |
denotes |
Sox |
T14365 |
28572-28578 |
NN |
denotes |
family |
T14366 |
28579-28581 |
IN |
denotes |
of |
T14367 |
28582-28595 |
NN |
denotes |
transcription |
T14368 |
28596-28603 |
NNS |
denotes |
factors |
T14369 |
28603-28604 |
-RRB- |
denotes |
) |
T14370 |
28604-28605 |
, |
denotes |
, |
T14371 |
28606-28611 |
NNP |
denotes |
HMG-I |
T14372 |
28612-28615 |
CC |
denotes |
and |
T14373 |
28616-28621 |
NNP |
denotes |
HMG-Y |
T14374 |
28621-28622 |
, |
denotes |
, |
T14375 |
28623-28627 |
VBD |
denotes |
were |
T14376 |
28628-28640 |
VBN |
denotes |
demonstrated |
T14377 |
28641-28643 |
TO |
denotes |
to |
T14378 |
28644-28648 |
NN |
denotes |
bind |
T14379 |
28649-28651 |
TO |
denotes |
to |
T14380 |
28652-28655 |
DT |
denotes |
the |
T14381 |
28656-28661 |
JJ |
denotes |
human |
T14382 |
28662-28667 |
NN |
denotes |
adult |
T14383 |
28668-28669 |
NN |
denotes |
β |
T14384 |
28670-28676 |
NN |
denotes |
globin |
T14385 |
28677-28686 |
NNS |
denotes |
silencers |
T14386 |
28687-28688 |
-LRB- |
denotes |
( |
T14387 |
28688-28697 |
NNS |
denotes |
silencers |
T14388 |
28698-28699 |
PRP |
denotes |
I |
T14389 |
28700-28703 |
CC |
denotes |
and |
T14390 |
28704-28706 |
NNP |
denotes |
II |
T14391 |
28706-28707 |
-RRB- |
denotes |
) |
T14392 |
28708-28711 |
CC |
denotes |
and |
T14393 |
28712-28717 |
VB |
denotes |
cause |
T14394 |
28718-28725 |
VBG |
denotes |
bending |
T14395 |
28726-28728 |
IN |
denotes |
of |
T14396 |
28729-28732 |
DT |
denotes |
the |
T14397 |
28733-28736 |
NNP |
denotes |
DNA |
T14398 |
28736-28737 |
, |
denotes |
, |
T14399 |
28738-28750 |
VBG |
denotes |
facilitating |
T14400 |
28751-28754 |
DT |
denotes |
the |
T14401 |
28755-28762 |
JJ |
denotes |
binding |
T14402 |
28763-28765 |
IN |
denotes |
of |
T14403 |
28766-28771 |
JJ |
denotes |
other |
T14404 |
28772-28782 |
NNS |
denotes |
repressors |
T14405 |
28783-28784 |
NNP |
denotes |
[ |
T14406 |
28784-28786 |
CD |
denotes |
40 |
T14407 |
28786-28787 |
NNP |
denotes |
] |
T14408 |
28787-28788 |
. |
denotes |
. |
T14409 |
28789-28793 |
JJ |
denotes |
Sox6 |
T14410 |
28794-28804 |
NN |
denotes |
expression |
T14411 |
28805-28807 |
VBZ |
denotes |
is |
T14412 |
28808-28818 |
RB |
denotes |
temporally |
T14413 |
28819-28822 |
CC |
denotes |
and |
T14414 |
28823-28832 |
RB |
denotes |
spatially |
T14415 |
28833-28843 |
JJ |
denotes |
coincident |
T14416 |
28844-28848 |
IN |
denotes |
with |
T14417 |
28849-28859 |
JJ |
denotes |
definitive |
T14418 |
28860-28861 |
-LRB- |
denotes |
( |
T14419 |
28861-28864 |
CC |
denotes |
but |
T14420 |
28865-28868 |
RB |
denotes |
not |
T14421 |
28869-28878 |
JJ |
denotes |
primitive |
T14422 |
28878-28879 |
-RRB- |
denotes |
) |
T14423 |
28880-28894 |
VBZ |
denotes |
erythropoiesis |
T14424 |
28895-28896 |
-LRB- |
denotes |
( |
T14425 |
28896-28902 |
NN |
denotes |
Figure |
T14426 |
28903-28904 |
CD |
denotes |
6 |
T14427 |
28904-28905 |
-RRB- |
denotes |
) |
T14428 |
28905-28906 |
, |
denotes |
, |
T14429 |
28907-28910 |
CC |
denotes |
and |
T14430 |
28911-28915 |
NNP |
denotes |
Sox6 |
T14431 |
28916-28925 |
VBZ |
denotes |
represses |
T14432 |
28926-28928 |
JJ |
denotes |
ɛy |
T14433 |
28929-28935 |
NN |
denotes |
globin |
T14434 |
28936-28946 |
NN |
denotes |
expression |
T14435 |
28947-28951 |
DT |
denotes |
both |
T14436 |
28952-28954 |
IN |
denotes |
in |
T14437 |
28955-28959 |
NN |
denotes |
vivo |
T14438 |
28960-28961 |
-LRB- |
denotes |
( |
T14439 |
28961-28967 |
NN |
denotes |
Figure |
T14440 |
28968-28969 |
CD |
denotes |
1 |
T14441 |
28969-28970 |
-RRB- |
denotes |
) |
T14442 |
28971-28974 |
CC |
denotes |
and |
T14443 |
28975-28977 |
IN |
denotes |
in |
T14444 |
28978-28983 |
NN |
denotes |
vitro |
T14445 |
28984-28985 |
-LRB- |
denotes |
( |
T14446 |
28985-28991 |
NN |
denotes |
Figure |
T14447 |
28992-28993 |
CD |
denotes |
2 |
T14448 |
28993-28994 |
-RRB- |
denotes |
) |
T14449 |
28994-28995 |
. |
denotes |
. |
T14450 |
28996-29004 |
RB |
denotes |
Moreover |
T14451 |
29004-29005 |
, |
denotes |
, |
T14452 |
29006-29008 |
IN |
denotes |
in |
T14453 |
29009-29013 |
NN |
denotes |
situ |
T14454 |
29014-29027 |
NN |
denotes |
hybridization |
T14455 |
29028-29035 |
RB |
denotes |
clearly |
T14456 |
29036-29041 |
VBZ |
denotes |
shows |
T14457 |
29042-29046 |
IN |
denotes |
that |
T14458 |
29047-29050 |
DT |
denotes |
the |
T14459 |
29051-29061 |
JJ |
denotes |
persistent |
T14460 |
29062-29072 |
NN |
denotes |
expression |
T14461 |
29073-29075 |
IN |
denotes |
of |
T14462 |
29076-29078 |
JJ |
denotes |
ɛy |
T14463 |
29079-29085 |
NN |
denotes |
globin |
T14464 |
29086-29088 |
IN |
denotes |
in |
T14465 |
29089-29094 |
JJ |
denotes |
p100H |
T14466 |
29095-29101 |
JJ |
denotes |
mutant |
T14467 |
29102-29106 |
NNS |
denotes |
mice |
T14468 |
29107-29109 |
VBZ |
denotes |
is |
T14469 |
29110-29113 |
JJ |
denotes |
due |
T14470 |
29114-29116 |
TO |
denotes |
to |
T14471 |
29117-29124 |
NNS |
denotes |
defects |
T14472 |
29125-29127 |
IN |
denotes |
in |
T14473 |
29128-29131 |
DT |
denotes |
the |
T14474 |
29132-29141 |
VBG |
denotes |
silencing |
T14475 |
29142-29151 |
NN |
denotes |
mechanism |
T14476 |
29152-29154 |
IN |
denotes |
of |
T14477 |
29155-29165 |
JJ |
denotes |
definitive |
T14478 |
29166-29180 |
NNS |
denotes |
erythropoiesis |
T14479 |
29181-29185 |
WDT |
denotes |
that |
T14480 |
29186-29191 |
VBZ |
denotes |
takes |
T14481 |
29192-29197 |
NN |
denotes |
place |
T14482 |
29198-29200 |
IN |
denotes |
in |
T14483 |
29201-29204 |
DT |
denotes |
the |
T14484 |
29205-29210 |
NN |
denotes |
liver |
T14485 |
29211-29212 |
-LRB- |
denotes |
( |
T14486 |
29212-29218 |
NN |
denotes |
Figure |
T14487 |
29219-29220 |
CD |
denotes |
5 |
T14488 |
29220-29221 |
-RRB- |
denotes |
) |
T14489 |
29221-29222 |
. |
denotes |
. |
T14490 |
29223-29228 |
VBN |
denotes |
Taken |
T14491 |
29229-29237 |
RB |
denotes |
together |
T14492 |
29237-29238 |
, |
denotes |
, |
T14493 |
29239-29244 |
DT |
denotes |
these |
T14494 |
29245-29249 |
NNS |
denotes |
data |
T14495 |
29250-29261 |
VBP |
denotes |
demonstrate |
T14496 |
29262-29266 |
IN |
denotes |
that |
T14497 |
29267-29271 |
JJ |
denotes |
Sox6 |
T14498 |
29272-29281 |
NNS |
denotes |
functions |
T14499 |
29282-29284 |
IN |
denotes |
in |
T14500 |
29285-29295 |
JJ |
denotes |
definitive |
T14501 |
29296-29310 |
NNS |
denotes |
erythropoiesis |
T14502 |
29311-29313 |
TO |
denotes |
to |
T14503 |
29314-29321 |
NN |
denotes |
silence |
T14504 |
29322-29324 |
NN |
denotes |
ɛy |
T14505 |
29325-29331 |
NN |
denotes |
globin |
T14506 |
29332-29342 |
NN |
denotes |
expression |
T14507 |
29342-29343 |
. |
denotes |
. |
T14508 |
29344-29347 |
DT |
denotes |
The |
T14509 |
29348-29358 |
NN |
denotes |
expression |
T14510 |
29359-29364 |
NN |
denotes |
level |
T14511 |
29365-29367 |
IN |
denotes |
of |
T14512 |
29368-29370 |
JJ |
denotes |
ɛy |
T14513 |
29371-29377 |
NN |
denotes |
globin |
T14514 |
29378-29380 |
IN |
denotes |
in |
T14515 |
29381-29391 |
JJ |
denotes |
homozygous |
T14516 |
29392-29396 |
JJ |
denotes |
Sox6 |
T14517 |
29397-29401 |
NN |
denotes |
null |
T14518 |
29402-29406 |
NNS |
denotes |
mice |
T14519 |
29407-29409 |
IN |
denotes |
at |
T14520 |
29410-29414 |
CD |
denotes |
15.5 |
T14521 |
29415-29418 |
NN |
denotes |
dpc |
T14522 |
29419-29422 |
CC |
denotes |
and |
T14523 |
29423-29427 |
CD |
denotes |
18.5 |
T14524 |
29428-29431 |
NN |
denotes |
dpc |
T14525 |
29432-29434 |
VBZ |
denotes |
is |
T14526 |
29435-29448 |
RB |
denotes |
statistically |
T14527 |
29449-29459 |
JJ |
denotes |
equivalent |
T14528 |
29460-29462 |
TO |
denotes |
to |
T14529 |
29463-29466 |
DT |
denotes |
the |
T14530 |
29467-29472 |
NN |
denotes |
level |
T14531 |
29473-29475 |
IN |
denotes |
of |
T14532 |
29476-29480 |
NN |
denotes |
βmaj |
T14533 |
29480-29481 |
NN |
denotes |
/ |
T14534 |
29481-29484 |
NN |
denotes |
min |
T14535 |
29485-29495 |
NN |
denotes |
expression |
T14536 |
29496-29498 |
IN |
denotes |
in |
T14537 |
29499-29502 |
DT |
denotes |
the |
T14538 |
29503-29509 |
NNS |
denotes |
livers |
T14539 |
29510-29512 |
IN |
denotes |
of |
T14540 |
29513-29521 |
JJ |
denotes |
15.5-dpc |
T14541 |
29522-29525 |
CC |
denotes |
and |
T14542 |
29526-29534 |
JJ |
denotes |
18.5-dpc |
T14543 |
29535-29545 |
JJ |
denotes |
homozygous |
T14544 |
29546-29548 |
NNP |
denotes |
WT |
T14545 |
29549-29553 |
NNS |
denotes |
mice |
T14546 |
29554-29555 |
-LRB- |
denotes |
( |
T14547 |
29555-29561 |
NN |
denotes |
Figure |
T14548 |
29562-29563 |
CD |
denotes |
1 |
T14549 |
29563-29564 |
-RRB- |
denotes |
) |
T14550 |
29564-29565 |
. |
denotes |
. |
T14551 |
29566-29570 |
DT |
denotes |
This |
T14552 |
29571-29583 |
VBZ |
denotes |
demonstrates |
T14553 |
29584-29588 |
IN |
denotes |
that |
T14554 |
29589-29596 |
JJ |
denotes |
ectopic |
T14555 |
29597-29607 |
NN |
denotes |
expression |
T14556 |
29608-29610 |
IN |
denotes |
of |
T14557 |
29611-29614 |
DT |
denotes |
the |
T14558 |
29615-29617 |
JJ |
denotes |
ɛy |
T14559 |
29618-29624 |
NN |
denotes |
globin |
T14560 |
29625-29629 |
NN |
denotes |
gene |
T14561 |
29630-29632 |
VBZ |
denotes |
is |
T14562 |
29633-29638 |
RB |
denotes |
quite |
T14563 |
29639-29645 |
JJ |
denotes |
robust |
T14564 |
29646-29648 |
IN |
denotes |
in |
T14565 |
29649-29659 |
JJ |
denotes |
homozygous |
T14566 |
29660-29666 |
JJ |
denotes |
mutant |
T14567 |
29667-29671 |
NNS |
denotes |
mice |
T14568 |
29671-29672 |
. |
denotes |
. |
T14569 |
29673-29676 |
DT |
denotes |
The |
T14570 |
29677-29687 |
NN |
denotes |
expression |
T14571 |
29688-29694 |
NNS |
denotes |
levels |
T14572 |
29695-29697 |
IN |
denotes |
of |
T14573 |
29698-29701 |
CD |
denotes |
two |
T14574 |
29702-29707 |
JJ |
denotes |
other |
T14575 |
29708-29717 |
JJ |
denotes |
embryonic |
T14576 |
29718-29724 |
NN |
denotes |
globin |
T14577 |
29725-29730 |
NNS |
denotes |
genes |
T14578 |
29731-29732 |
-LRB- |
denotes |
( |
T14579 |
29732-29733 |
NN |
denotes |
ζ |
T14580 |
29734-29737 |
CC |
denotes |
and |
T14581 |
29738-29741 |
CD |
denotes |
βh1 |
T14582 |
29741-29742 |
-RRB- |
denotes |
) |
T14583 |
29743-29746 |
VBP |
denotes |
are |
T14584 |
29747-29751 |
RB |
denotes |
also |
T14585 |
29752-29758 |
JJR |
denotes |
higher |
T14586 |
29759-29761 |
IN |
denotes |
in |
T14587 |
29762-29767 |
JJ |
denotes |
p100H |
T14588 |
29768-29779 |
NNS |
denotes |
homozygotes |
T14589 |
29779-29780 |
, |
denotes |
, |
T14590 |
29781-29789 |
VBN |
denotes |
compared |
T14591 |
29790-29794 |
IN |
denotes |
with |
T14592 |
29795-29797 |
NNP |
denotes |
WT |
T14593 |
29797-29798 |
. |
denotes |
. |
T14594 |
29799-29803 |
IN |
denotes |
Like |
T14595 |
29804-29806 |
VB |
denotes |
ɛy |
T14596 |
29806-29807 |
, |
denotes |
, |
T14597 |
29808-29814 |
NNS |
denotes |
levels |
T14598 |
29815-29817 |
IN |
denotes |
of |
T14599 |
29818-29819 |
NN |
denotes |
ζ |
T14600 |
29820-29823 |
CC |
denotes |
and |
T14601 |
29824-29827 |
CD |
denotes |
βh1 |
T14602 |
29828-29831 |
VBP |
denotes |
are |
T14603 |
29832-29844 |
RB |
denotes |
dramatically |
T14604 |
29845-29851 |
JJR |
denotes |
higher |
T14605 |
29852-29854 |
IN |
denotes |
in |
T14606 |
29855-29861 |
JJ |
denotes |
mutant |
T14607 |
29862-29866 |
NNS |
denotes |
mice |
T14608 |
29867-29869 |
IN |
denotes |
at |
T14609 |
29870-29874 |
CD |
denotes |
15.5 |
T14610 |
29875-29878 |
NN |
denotes |
dpc |
T14611 |
29878-29879 |
. |
denotes |
. |
T14612 |
29880-29887 |
RB |
denotes |
However |
T14613 |
29887-29888 |
, |
denotes |
, |
T14614 |
29889-29895 |
IN |
denotes |
unlike |
T14615 |
29896-29898 |
JJ |
denotes |
ɛy |
T14616 |
29899-29905 |
NN |
denotes |
globin |
T14617 |
29905-29906 |
, |
denotes |
, |
T14618 |
29907-29908 |
NN |
denotes |
ζ |
T14619 |
29909-29912 |
CC |
denotes |
and |
T14620 |
29913-29916 |
JJ |
denotes |
βh1 |
T14621 |
29917-29924 |
NN |
denotes |
decline |
T14622 |
29925-29927 |
IN |
denotes |
in |
T14623 |
29928-29938 |
NN |
denotes |
expression |
T14624 |
29939-29941 |
IN |
denotes |
by |
T14625 |
29942-29945 |
NN |
denotes |
day |
T14626 |
29946-29950 |
CD |
denotes |
18.5 |
T14627 |
29951-29954 |
NN |
denotes |
dpc |
T14628 |
29955-29956 |
-LRB- |
denotes |
( |
T14629 |
29956-29962 |
NN |
denotes |
Figure |
T14630 |
29963-29964 |
CD |
denotes |
1 |
T14631 |
29964-29965 |
-RRB- |
denotes |
) |
T14632 |
29965-29966 |
, |
denotes |
, |
T14633 |
29967-29977 |
VBG |
denotes |
suggesting |
T14634 |
29978-29982 |
IN |
denotes |
that |
T14635 |
29983-29985 |
NN |
denotes |
ɛy |
T14636 |
29986-29988 |
VBZ |
denotes |
is |
T14637 |
29989-29998 |
VBN |
denotes |
regulated |
T14638 |
29999-30010 |
RB |
denotes |
differently |
T14639 |
30011-30015 |
IN |
denotes |
than |
T14640 |
30016-30017 |
VB |
denotes |
ζ |
T14641 |
30018-30021 |
CC |
denotes |
and |
T14642 |
30022-30025 |
VB |
denotes |
βh1 |
T14643 |
30025-30026 |
. |
denotes |
. |
T14644 |
30027-30029 |
PRP |
denotes |
It |
T14645 |
30030-30032 |
VBZ |
denotes |
is |
T14646 |
30033-30041 |
JJ |
denotes |
possible |
T14647 |
30042-30046 |
IN |
denotes |
that |
T14648 |
30047-30051 |
NNP |
denotes |
Sox6 |
T14649 |
30052-30055 |
VBZ |
denotes |
has |
T14650 |
30056-30057 |
DT |
denotes |
a |
T14651 |
30058-30065 |
JJ |
denotes |
general |
T14652 |
30066-30072 |
NN |
denotes |
effect |
T14653 |
30073-30075 |
IN |
denotes |
on |
T14654 |
30076-30085 |
JJ |
denotes |
embryonic |
T14655 |
30086-30092 |
NN |
denotes |
globin |
T14656 |
30093-30098 |
NNS |
denotes |
genes |
T14657 |
30099-30100 |
-LRB- |
denotes |
( |
T14658 |
30100-30103 |
CC |
denotes |
and |
T14659 |
30104-30115 |
JJ |
denotes |
erythrocyte |
T14660 |
30116-30126 |
NN |
denotes |
maturation |
T14661 |
30126-30127 |
-RRB- |
denotes |
) |
T14662 |
30128-30130 |
IN |
denotes |
in |
T14663 |
30131-30139 |
NN |
denotes |
addition |
T14664 |
30140-30142 |
TO |
denotes |
to |
T14665 |
30143-30144 |
DT |
denotes |
a |
T14666 |
30145-30153 |
JJ |
denotes |
specific |
T14667 |
30154-30158 |
NN |
denotes |
role |
T14668 |
30159-30161 |
IN |
denotes |
in |
T14669 |
30162-30171 |
VBG |
denotes |
silencing |
T14670 |
30172-30174 |
NN |
denotes |
ɛy |
T14671 |
30174-30175 |
. |
denotes |
. |
T14672 |
30176-30184 |
IN |
denotes |
Although |
T14673 |
30185-30189 |
JJS |
denotes |
most |
T14674 |
30190-30195 |
JJ |
denotes |
p100H |
T14675 |
30196-30202 |
JJ |
denotes |
mutant |
T14676 |
30203-30207 |
NNS |
denotes |
mice |
T14677 |
30208-30211 |
VBP |
denotes |
die |
T14678 |
30212-30216 |
RB |
denotes |
just |
T14679 |
30217-30222 |
IN |
denotes |
after |
T14680 |
30223-30228 |
VBG |
denotes |
being |
T14681 |
30229-30233 |
VBN |
denotes |
born |
T14682 |
30233-30234 |
, |
denotes |
, |
T14683 |
30235-30236 |
DT |
denotes |
a |
T14684 |
30237-30241 |
JJ |
denotes |
rare |
T14685 |
30242-30245 |
JJ |
denotes |
few |
T14686 |
30246-30253 |
VBP |
denotes |
survive |
T14687 |
30254-30260 |
RBR |
denotes |
longer |
T14688 |
30260-30261 |
. |
denotes |
. |
T14689 |
30262-30266 |
NN |
denotes |
None |
T14690 |
30267-30271 |
VBP |
denotes |
have |
T14691 |
30272-30276 |
VBN |
denotes |
been |
T14692 |
30277-30285 |
VBN |
denotes |
observed |
T14693 |
30286-30288 |
TO |
denotes |
to |
T14694 |
30289-30293 |
VB |
denotes |
live |
T14695 |
30294-30300 |
JJR |
denotes |
longer |
T14696 |
30301-30305 |
IN |
denotes |
than |
T14697 |
30306-30307 |
CD |
denotes |
2 |
T14698 |
30308-30310 |
NN |
denotes |
wk |
T14699 |
30311-30316 |
IN |
denotes |
after |
T14700 |
30317-30322 |
NN |
denotes |
birth |
T14701 |
30323-30324 |
NNP |
denotes |
[ |
T14702 |
30324-30326 |
CD |
denotes |
14 |
T14703 |
30326-30327 |
NNP |
denotes |
] |
T14704 |
30327-30328 |
. |
denotes |
. |
T14705 |
30329-30331 |
PRP |
denotes |
We |
T14706 |
30332-30340 |
VBD |
denotes |
examined |
T14707 |
30341-30342 |
DT |
denotes |
a |
T14708 |
30343-30349 |
JJ |
denotes |
single |
T14709 |
30350-30358 |
JJ |
denotes |
archived |
T14710 |
30359-30365 |
NN |
denotes |
sample |
T14711 |
30366-30368 |
IN |
denotes |
of |
T14712 |
30369-30374 |
NN |
denotes |
liver |
T14713 |
30375-30378 |
NNP |
denotes |
RNA |
T14714 |
30379-30383 |
IN |
denotes |
from |
T14715 |
30384-30385 |
DT |
denotes |
a |
T14716 |
30386-30392 |
JJ |
denotes |
mutant |
T14717 |
30393-30398 |
NN |
denotes |
mouse |
T14718 |
30399-30401 |
IN |
denotes |
on |
T14719 |
30402-30411 |
JJ |
denotes |
postnatal |
T14720 |
30412-30415 |
NN |
denotes |
day |
T14721 |
30416-30420 |
CD |
denotes |
13.5 |
T14722 |
30421-30424 |
IN |
denotes |
for |
T14723 |
30425-30431 |
NN |
denotes |
globin |
T14724 |
30432-30436 |
NN |
denotes |
gene |
T14725 |
30437-30447 |
NN |
denotes |
expression |
T14726 |
30448-30451 |
CC |
denotes |
and |
T14727 |
30452-30460 |
VBD |
denotes |
detected |
T14728 |
30461-30465 |
JJ |
denotes |
high |
T14729 |
30466-30472 |
NNS |
denotes |
levels |
T14730 |
30473-30475 |
IN |
denotes |
of |
T14731 |
30476-30478 |
JJ |
denotes |
ɛy |
T14732 |
30479-30485 |
NN |
denotes |
globin |
T14733 |
30486-30488 |
IN |
denotes |
in |
T14734 |
30489-30493 |
DT |
denotes |
this |
T14735 |
30494-30497 |
NNP |
denotes |
RNA |
T14736 |
30498-30504 |
NN |
denotes |
sample |
T14737 |
30504-30505 |
, |
denotes |
, |
T14738 |
30506-30514 |
VBN |
denotes |
compared |
T14739 |
30515-30519 |
IN |
denotes |
with |
T14740 |
30520-30532 |
JJ |
denotes |
undetectable |
T14741 |
30533-30535 |
NN |
denotes |
ɛy |
T14742 |
30536-30539 |
NNP |
denotes |
RNA |
T14743 |
30540-30542 |
IN |
denotes |
in |
T14744 |
30543-30545 |
NNP |
denotes |
WT |
T14745 |
30546-30553 |
NN |
denotes |
control |
T14746 |
30554-30558 |
NNS |
denotes |
mice |
T14747 |
30558-30559 |
. |
denotes |
. |
T14748 |
30560-30562 |
IN |
denotes |
At |
T14749 |
30563-30567 |
DT |
denotes |
this |
T14750 |
30568-30573 |
NN |
denotes |
point |
T14751 |
30574-30576 |
IN |
denotes |
in |
T14752 |
30577-30588 |
NN |
denotes |
development |
T14753 |
30588-30589 |
, |
denotes |
, |
T14754 |
30590-30593 |
DT |
denotes |
the |
T14755 |
30594-30600 |
NNS |
denotes |
levels |
T14756 |
30601-30603 |
IN |
denotes |
of |
T14757 |
30604-30605 |
NN |
denotes |
ζ |
T14758 |
30606-30609 |
CC |
denotes |
and |
T14759 |
30610-30613 |
CD |
denotes |
βh1 |
T14760 |
30614-30617 |
NNP |
denotes |
RNA |
T14761 |
30618-30622 |
VBD |
denotes |
were |
T14762 |
30623-30635 |
JJ |
denotes |
undetectable |
T14763 |
30636-30640 |
DT |
denotes |
both |
T14764 |
30641-30643 |
IN |
denotes |
in |
T14765 |
30644-30650 |
JJ |
denotes |
mutant |
T14766 |
30651-30654 |
CC |
denotes |
and |
T14767 |
30655-30657 |
NNP |
denotes |
WT |
T14768 |
30657-30658 |
: |
denotes |
; |
T14769 |
30659-30666 |
RB |
denotes |
however |
T14770 |
30666-30667 |
, |
denotes |
, |
T14771 |
30668-30673 |
NN |
denotes |
adult |
T14772 |
30674-30680 |
JJ |
denotes |
β-like |
T14773 |
30681-30687 |
NN |
denotes |
globin |
T14774 |
30688-30691 |
NNP |
denotes |
RNA |
T14775 |
30692-30698 |
NNS |
denotes |
levels |
T14776 |
30699-30703 |
VBD |
denotes |
were |
T14777 |
30704-30714 |
RB |
denotes |
moderately |
T14778 |
30715-30723 |
VBN |
denotes |
elevated |
T14779 |
30724-30726 |
IN |
denotes |
in |
T14780 |
30727-30730 |
DT |
denotes |
the |
T14781 |
30731-30737 |
JJ |
denotes |
mutant |
T14782 |
30738-30741 |
NNP |
denotes |
RNA |
T14783 |
30742-30750 |
VBN |
denotes |
compared |
T14784 |
30751-30755 |
IN |
denotes |
with |
T14785 |
30756-30758 |
NNP |
denotes |
WT |
T14786 |
30759-30760 |
-LRB- |
denotes |
( |
T14787 |
30760-30771 |
JJ |
denotes |
unpublished |
T14788 |
30772-30776 |
NNS |
denotes |
data |
T14789 |
30776-30777 |
-RRB- |
denotes |
) |
T14790 |
30777-30778 |
, |
denotes |
, |
T14791 |
30779-30786 |
JJ |
denotes |
similar |
T14792 |
30787-30789 |
TO |
denotes |
to |
T14793 |
30790-30794 |
WP |
denotes |
what |
T14794 |
30795-30797 |
PRP |
denotes |
we |
T14795 |
30798-30805 |
VBP |
denotes |
observe |
T14796 |
30806-30808 |
IN |
denotes |
at |
T14797 |
30809-30813 |
CD |
denotes |
18.5 |
T14798 |
30814-30817 |
NN |
denotes |
dpc |
T14799 |
30818-30819 |
-LRB- |
denotes |
( |
T14800 |
30819-30825 |
NN |
denotes |
Figure |
T14801 |
30826-30827 |
CD |
denotes |
1 |
T14802 |
30827-30828 |
-RRB- |
denotes |
) |
T14803 |
30828-30829 |
. |
denotes |
. |
T14804 |
30830-30835 |
DT |
denotes |
These |
T14805 |
30836-30844 |
NNS |
denotes |
findings |
T14806 |
30845-30852 |
VBP |
denotes |
suggest |
T14807 |
30853-30857 |
IN |
denotes |
that |
T14808 |
30858-30862 |
JJ |
denotes |
Sox6 |
T14809 |
30863-30872 |
VBZ |
denotes |
continues |
T14810 |
30873-30875 |
TO |
denotes |
to |
T14811 |
30876-30884 |
VB |
denotes |
function |
T14812 |
30885-30896 |
RB |
denotes |
postnatally |
T14813 |
30897-30899 |
TO |
denotes |
to |
T14814 |
30900-30907 |
NN |
denotes |
silence |
T14815 |
30908-30910 |
NN |
denotes |
ɛy |
T14816 |
30911-30917 |
NN |
denotes |
globin |
T14817 |
30918-30928 |
NN |
denotes |
expression |
T14818 |
30929-30932 |
CC |
denotes |
and |
T14819 |
30933-30936 |
VBZ |
denotes |
has |
T14820 |
30937-30938 |
DT |
denotes |
a |
T14821 |
30939-30945 |
JJ |
denotes |
unique |
T14822 |
30946-30954 |
NN |
denotes |
function |
T14823 |
30955-30957 |
IN |
denotes |
in |
T14824 |
30958-30961 |
DT |
denotes |
the |
T14825 |
30962-30972 |
NN |
denotes |
regulation |
T14826 |
30973-30975 |
IN |
denotes |
of |
T14827 |
30976-30985 |
NN |
denotes |
ɛy-globin |
T14828 |
30985-30986 |
. |
denotes |
. |
T14829 |
30987-30990 |
DT |
denotes |
The |
T14830 |
30991-31000 |
NN |
denotes |
mechanism |
T14831 |
31001-31003 |
IN |
denotes |
by |
T14832 |
31004-31009 |
WDT |
denotes |
which |
T14833 |
31010-31014 |
NNP |
denotes |
Sox6 |
T14834 |
31015-31024 |
VBZ |
denotes |
regulates |
T14835 |
31025-31028 |
DT |
denotes |
the |
T14836 |
31029-31034 |
JJ |
denotes |
other |
T14837 |
31035-31044 |
JJ |
denotes |
embryonic |
T14838 |
31045-31051 |
NN |
denotes |
globin |
T14839 |
31052-31057 |
NNS |
denotes |
genes |
T14840 |
31058-31065 |
VBZ |
denotes |
remains |
T14841 |
31066-31068 |
TO |
denotes |
to |
T14842 |
31069-31071 |
VB |
denotes |
be |
T14843 |
31072-31082 |
VBN |
denotes |
elucidated |
T14844 |
31082-31083 |
. |
denotes |
. |
T14845 |
31084-31088 |
NNP |
denotes |
Sox6 |
T14846 |
31089-31092 |
VBZ |
denotes |
has |
T14847 |
31093-31098 |
JJ |
denotes |
other |
T14848 |
31099-31106 |
NNS |
denotes |
effects |
T14849 |
31107-31109 |
IN |
denotes |
in |
T14850 |
31110-31124 |
NN |
denotes |
erythropoiesis |
T14851 |
31124-31125 |
, |
denotes |
, |
T14852 |
31126-31135 |
VBG |
denotes |
including |
T14853 |
31136-31137 |
DT |
denotes |
a |
T14854 |
31138-31143 |
NN |
denotes |
delay |
T14855 |
31144-31146 |
IN |
denotes |
in |
T14856 |
31147-31169 |
NN |
denotes |
enucleation/maturation |
T14857 |
31170-31172 |
IN |
denotes |
in |
T14858 |
31173-31178 |
JJ |
denotes |
p100H |
T14859 |
31179-31185 |
JJ |
denotes |
mutant |
T14860 |
31186-31190 |
NNS |
denotes |
mice |
T14861 |
31190-31191 |
. |
denotes |
. |
T14862 |
31192-31196 |
DT |
denotes |
This |
T14863 |
31197-31200 |
MD |
denotes |
may |
T14864 |
31201-31203 |
VB |
denotes |
be |
T14865 |
31204-31207 |
DT |
denotes |
the |
T14866 |
31208-31214 |
NN |
denotes |
result |
T14867 |
31215-31217 |
IN |
denotes |
of |
T14868 |
31218-31226 |
JJ |
denotes |
indirect |
T14869 |
31227-31234 |
NNS |
denotes |
effects |
T14870 |
31234-31235 |
, |
denotes |
, |
T14871 |
31236-31240 |
JJ |
denotes |
such |
T14872 |
31241-31243 |
IN |
denotes |
as |
T14873 |
31244-31258 |
JJ |
denotes |
stress-induced |
T14874 |
31259-31272 |
NN |
denotes |
proliferation |
T14875 |
31273-31274 |
-LRB- |
denotes |
( |
T14876 |
31274-31283 |
VBG |
denotes |
resulting |
T14877 |
31284-31288 |
IN |
denotes |
from |
T14878 |
31289-31296 |
JJ |
denotes |
cardiac |
T14879 |
31297-31304 |
NNS |
denotes |
defects |
T14880 |
31304-31305 |
-RRB- |
denotes |
) |
T14881 |
31306-31312 |
CC |
denotes |
and/or |
T14882 |
31313-31319 |
NN |
denotes |
anemia |
T14883 |
31319-31320 |
. |
denotes |
. |
T14884 |
31321-31327 |
JJ |
denotes |
Severe |
T14885 |
31328-31334 |
NN |
denotes |
anemia |
T14886 |
31335-31338 |
MD |
denotes |
can |
T14887 |
31339-31343 |
VB |
denotes |
lead |
T14888 |
31344-31346 |
TO |
denotes |
to |
T14889 |
31347-31352 |
JJ |
denotes |
rapid |
T14890 |
31353-31362 |
JJ |
denotes |
premature |
T14891 |
31363-31370 |
NN |
denotes |
release |
T14892 |
31371-31373 |
IN |
denotes |
of |
T14893 |
31374-31377 |
JJ |
denotes |
red |
T14894 |
31378-31383 |
NNS |
denotes |
cells |
T14895 |
31383-31384 |
, |
denotes |
, |
T14896 |
31385-31390 |
RB |
denotes |
prior |
T14897 |
31391-31393 |
TO |
denotes |
to |
T14898 |
31394-31399 |
PRP$ |
denotes |
their |
T14899 |
31400-31408 |
JJ |
denotes |
complete |
T14900 |
31409-31419 |
NN |
denotes |
maturation |
T14901 |
31419-31420 |
. |
denotes |
. |
T14902 |
31421-31428 |
RB |
denotes |
However |
T14903 |
31428-31429 |
, |
denotes |
, |
T14904 |
31430-31433 |
DT |
denotes |
the |
T14905 |
31434-31444 |
NN |
denotes |
hematocrit |
T14906 |
31445-31447 |
IN |
denotes |
of |
T14907 |
31448-31456 |
JJ |
denotes |
18.5-dpc |
T14908 |
31457-31463 |
JJ |
denotes |
mutant |
T14909 |
31464-31468 |
NNS |
denotes |
mice |
T14910 |
31469-31471 |
VBZ |
denotes |
is |
T14911 |
31472-31476 |
RB |
denotes |
only |
T14912 |
31477-31479 |
CD |
denotes |
20 |
T14913 |
31479-31480 |
NN |
denotes |
% |
T14914 |
31481-31486 |
JJR |
denotes |
lower |
T14915 |
31487-31491 |
IN |
denotes |
than |
T14916 |
31492-31496 |
DT |
denotes |
that |
T14917 |
31497-31499 |
IN |
denotes |
of |
T14918 |
31500-31502 |
NNP |
denotes |
WT |
T14919 |
31503-31504 |
-LRB- |
denotes |
( |
T14920 |
31504-31515 |
JJ |
denotes |
unpublished |
T14921 |
31516-31520 |
NNS |
denotes |
data |
T14922 |
31520-31521 |
-RRB- |
denotes |
) |
T14923 |
31521-31522 |
, |
denotes |
, |
T14924 |
31523-31526 |
CC |
denotes |
and |
T14925 |
31527-31531 |
DT |
denotes |
this |
T14926 |
31532-31536 |
JJ |
denotes |
mild |
T14927 |
31537-31543 |
NN |
denotes |
anemia |
T14928 |
31544-31546 |
VBZ |
denotes |
is |
T14929 |
31547-31555 |
RB |
denotes |
probably |
T14930 |
31556-31559 |
RB |
denotes |
not |
T14931 |
31560-31570 |
JJ |
denotes |
sufficient |
T14932 |
31571-31573 |
TO |
denotes |
to |
T14933 |
31574-31581 |
VB |
denotes |
explain |
T14934 |
31582-31585 |
DT |
denotes |
the |
T14935 |
31586-31592 |
NN |
denotes |
extent |
T14936 |
31593-31595 |
IN |
denotes |
of |
T14937 |
31596-31605 |
JJ |
denotes |
nucleated |
T14938 |
31606-31609 |
JJ |
denotes |
red |
T14939 |
31610-31615 |
NNS |
denotes |
cells |
T14940 |
31615-31616 |
. |
denotes |
. |
T14941 |
31617-31630 |
RB |
denotes |
Alternatively |
T14942 |
31630-31631 |
, |
denotes |
, |
T14943 |
31632-31636 |
JJ |
denotes |
Sox6 |
T14944 |
31637-31643 |
PRP |
denotes |
itself |
T14945 |
31644-31647 |
MD |
denotes |
may |
T14946 |
31648-31652 |
VB |
denotes |
play |
T14947 |
31653-31654 |
DT |
denotes |
a |
T14948 |
31655-31659 |
NN |
denotes |
role |
T14949 |
31660-31662 |
IN |
denotes |
in |
T14950 |
31663-31666 |
JJ |
denotes |
red |
T14951 |
31667-31671 |
NN |
denotes |
cell |
T14952 |
31672-31680 |
NN |
denotes |
terminal |
T14953 |
31681-31696 |
NN |
denotes |
differentiation |
T14954 |
31696-31697 |
, |
denotes |
, |
T14955 |
31698-31700 |
IN |
denotes |
as |
T14956 |
31701-31703 |
PRP |
denotes |
it |
T14957 |
31704-31707 |
VBZ |
denotes |
has |
T14958 |
31708-31712 |
VBN |
denotes |
been |
T14959 |
31713-31718 |
VBN |
denotes |
shown |
T14960 |
31719-31721 |
TO |
denotes |
to |
T14961 |
31722-31724 |
VB |
denotes |
be |
T14962 |
31725-31727 |
DT |
denotes |
an |
T14963 |
31728-31737 |
JJ |
denotes |
important |
T14964 |
31738-31744 |
NN |
denotes |
factor |
T14965 |
31745-31747 |
IN |
denotes |
in |
T14966 |
31748-31755 |
JJ |
denotes |
cardiac |
T14967 |
31756-31757 |
NNP |
denotes |
[ |
T14968 |
31757-31759 |
CD |
denotes |
15 |
T14969 |
31759-31760 |
NNP |
denotes |
] |
T14970 |
31760-31761 |
, |
denotes |
, |
T14971 |
31762-31770 |
JJ |
denotes |
neuronal |
T14972 |
31771-31772 |
NNP |
denotes |
[ |
T14973 |
31772-31774 |
CD |
denotes |
10 |
T14974 |
31774-31775 |
NNP |
denotes |
] |
T14975 |
31775-31776 |
, |
denotes |
, |
T14976 |
31777-31787 |
JJ |
denotes |
astrocytic |
T14977 |
31788-31789 |
NNP |
denotes |
[ |
T14978 |
31789-31791 |
CD |
denotes |
11 |
T14979 |
31791-31792 |
NNP |
denotes |
] |
T14980 |
31792-31793 |
, |
denotes |
, |
T14981 |
31794-31797 |
CC |
denotes |
and |
T14982 |
31798-31807 |
NN |
denotes |
cartilage |
T14983 |
31808-31823 |
NN |
denotes |
differentiation |
T14984 |
31824-31832 |
NNS |
denotes |
programs |
T14985 |
31833-31834 |
NNP |
denotes |
[ |
T14986 |
31834-31839 |
CD |
denotes |
32,41 |
T14987 |
31840-31842 |
CD |
denotes |
44 |
T14988 |
31842-31843 |
NN |
denotes |
] |
T14989 |
31843-31844 |
. |
denotes |
. |
T14990 |
31845-31848 |
DT |
denotes |
The |
T14991 |
31849-31860 |
NN |
denotes |
restoration |
T14992 |
31861-31863 |
IN |
denotes |
of |
T14993 |
31864-31870 |
JJ |
denotes |
normal |
T14994 |
31871-31882 |
NN |
denotes |
enucleation |
T14995 |
31883-31885 |
IN |
denotes |
of |
T14996 |
31886-31889 |
JJ |
denotes |
red |
T14997 |
31890-31895 |
NNS |
denotes |
cells |
T14998 |
31896-31898 |
IN |
denotes |
in |
T14999 |
31899-31913 |
JJ |
denotes |
Sox6-deficient |
T15000 |
31914-31919 |
NN |
denotes |
mouse |
T15001 |
31920-31922 |
IN |
denotes |
by |
T15002 |
31923-31932 |
JJ |
denotes |
postnatal |
T15003 |
31933-31936 |
NN |
denotes |
day |
T15004 |
31937-31941 |
CD |
denotes |
10.5 |
T15005 |
31942-31945 |
MD |
denotes |
may |
T15006 |
31946-31952 |
VB |
denotes |
result |
T15007 |
31953-31957 |
IN |
denotes |
from |
T15008 |
31958-31968 |
JJ |
denotes |
functional |
T15009 |
31969-31981 |
NN |
denotes |
compensation |
T15010 |
31982-31984 |
IN |
denotes |
of |
T15011 |
31985-31990 |
JJ |
denotes |
other |
T15012 |
31991-31994 |
NNP |
denotes |
Sox |
T15013 |
31995-32003 |
NNS |
denotes |
proteins |
T15014 |
32004-32005 |
-LRB- |
denotes |
( |
T15015 |
32005-32014 |
VBN |
denotes |
expressed |
T15016 |
32015-32017 |
IN |
denotes |
at |
T15017 |
32018-32023 |
JJ |
denotes |
later |
T15018 |
32024-32037 |
JJ |
denotes |
developmental |
T15019 |
32038-32044 |
NNS |
denotes |
stages |
T15020 |
32044-32045 |
-RRB- |
denotes |
) |
T15021 |
32045-32046 |
, |
denotes |
, |
T15022 |
32047-32052 |
IN |
denotes |
since |
T15023 |
32053-32063 |
JJ |
denotes |
functional |
T15024 |
32064-32074 |
NN |
denotes |
redundancy |
T15025 |
32075-32077 |
VBZ |
denotes |
is |
T15026 |
32078-32079 |
DT |
denotes |
a |
T15027 |
32080-32089 |
VBG |
denotes |
recurring |
T15028 |
32090-32095 |
NN |
denotes |
theme |
T15029 |
32096-32100 |
IN |
denotes |
with |
T15030 |
32101-32104 |
NNP |
denotes |
Sox |
T15031 |
32105-32113 |
NNS |
denotes |
proteins |
T15032 |
32114-32115 |
NNP |
denotes |
[ |
T15033 |
32115-32123 |
CD |
denotes |
13,45,46 |
T15034 |
32123-32124 |
NNP |
denotes |
] |
T15035 |
32124-32125 |
. |
denotes |
. |
T15036 |
32126-32134 |
RB |
denotes |
Moreover |
T15037 |
32134-32135 |
, |
denotes |
, |
T15038 |
32136-32150 |
NN |
denotes |
erythropoiesis |
T15039 |
32151-32154 |
VBZ |
denotes |
has |
T15040 |
32155-32162 |
RB |
denotes |
already |
T15041 |
32163-32170 |
VBN |
denotes |
shifted |
T15042 |
32171-32175 |
IN |
denotes |
from |
T15043 |
32176-32181 |
JJ |
denotes |
fetal |
T15044 |
32182-32187 |
NN |
denotes |
liver |
T15045 |
32188-32190 |
TO |
denotes |
to |
T15046 |
32191-32195 |
NN |
denotes |
bone |
T15047 |
32196-32202 |
NN |
denotes |
marrow |
T15048 |
32203-32205 |
IN |
denotes |
by |
T15049 |
32206-32215 |
JJ |
denotes |
postnatal |
T15050 |
32216-32219 |
NN |
denotes |
day |
T15051 |
32220-32224 |
CD |
denotes |
10.5 |
T15052 |
32224-32225 |
. |
denotes |
. |
T15053 |
32226-32229 |
DT |
denotes |
The |
T15054 |
32230-32242 |
JJ |
denotes |
accompanying |
T15055 |
32243-32249 |
NN |
denotes |
change |
T15056 |
32250-32252 |
IN |
denotes |
in |
T15057 |
32253-32256 |
DT |
denotes |
the |
T15058 |
32257-32273 |
NN |
denotes |
microenvironment |
T15059 |
32274-32276 |
IN |
denotes |
of |
T15060 |
32277-32280 |
JJ |
denotes |
red |
T15061 |
32281-32285 |
NN |
denotes |
cell |
T15062 |
32286-32296 |
NN |
denotes |
production |
T15063 |
32297-32300 |
MD |
denotes |
may |
T15064 |
32301-32307 |
VB |
denotes |
permit |
T15065 |
32308-32314 |
JJ |
denotes |
normal |
T15066 |
32315-32326 |
NN |
denotes |
enucleation |
T15067 |
32326-32327 |
. |
denotes |
. |
T15068 |
32328-32342 |
NN |
denotes |
Identification |
T15069 |
32343-32345 |
IN |
denotes |
of |
T15070 |
32346-32350 |
JJ |
denotes |
Sox6 |
T15071 |
32351-32361 |
JJ |
denotes |
downstream |
T15072 |
32362-32368 |
NN |
denotes |
target |
T15073 |
32369-32374 |
NNS |
denotes |
genes |
T15074 |
32375-32378 |
CC |
denotes |
and |
T15075 |
32379-32382 |
PRP$ |
denotes |
its |
T15076 |
32383-32394 |
VBG |
denotes |
interacting |
T15077 |
32395-32403 |
NNS |
denotes |
proteins |
T15078 |
32404-32408 |
MD |
denotes |
will |
T15079 |
32409-32413 |
VB |
denotes |
shed |
T15080 |
32414-32419 |
NN |
denotes |
light |
T15081 |
32420-32422 |
IN |
denotes |
on |
T15082 |
32423-32426 |
DT |
denotes |
the |
T15083 |
32427-32431 |
NN |
denotes |
role |
T15084 |
32432-32434 |
IN |
denotes |
of |
T15085 |
32435-32439 |
NNP |
denotes |
Sox6 |
T15086 |
32440-32442 |
IN |
denotes |
in |
T15087 |
32443-32446 |
JJ |
denotes |
red |
T15088 |
32447-32451 |
NN |
denotes |
cell |
T15089 |
32452-32460 |
NN |
denotes |
terminal |
T15090 |
32461-32476 |
NN |
denotes |
differentiation |
T15091 |
32477-32480 |
CC |
denotes |
and |
T15092 |
32481-32484 |
DT |
denotes |
the |
T15093 |
32485-32496 |
NN |
denotes |
enucleation |
T15094 |
32497-32504 |
NN |
denotes |
process |
T15095 |
32504-32505 |
. |
denotes |
. |
T15096 |
32506-32514 |
RB |
denotes |
Recently |
T15097 |
32514-32515 |
, |
denotes |
, |
T15098 |
32516-32518 |
IN |
denotes |
in |
T15099 |
32519-32523 |
NN |
denotes |
vivo |
T15100 |
32524-32527 |
CC |
denotes |
and |
T15101 |
32528-32530 |
IN |
denotes |
in |
T15102 |
32531-32536 |
NN |
denotes |
vitro |
T15103 |
32537-32545 |
NNS |
denotes |
analyses |
T15104 |
32546-32553 |
VBP |
denotes |
suggest |
T15105 |
32554-32558 |
IN |
denotes |
that |
T15106 |
32559-32571 |
NN |
denotes |
reactivation |
T15107 |
32572-32574 |
IN |
denotes |
of |
T15108 |
32575-32580 |
JJ |
denotes |
human |
T15109 |
32581-32589 |
NN |
denotes |
ɛ-globin |
T15110 |
32590-32595 |
MD |
denotes |
would |
T15111 |
32596-32598 |
VB |
denotes |
be |
T15112 |
32599-32614 |
RB |
denotes |
therapeutically |
T15113 |
32615-32625 |
JJ |
denotes |
beneficial |
T15114 |
32626-32628 |
TO |
denotes |
to |
T15115 |
32629-32635 |
NNS |
denotes |
adults |
T15116 |
32636-32640 |
IN |
denotes |
with |
T15117 |
32641-32647 |
JJ |
denotes |
sickle |
T15118 |
32648-32652 |
NN |
denotes |
cell |
T15119 |
32653-32660 |
NN |
denotes |
disease |
T15120 |
32661-32662 |
NNP |
denotes |
[ |
T15121 |
32662-32664 |
CD |
denotes |
47 |
T15122 |
32664-32665 |
NNP |
denotes |
] |
T15123 |
32665-32666 |
, |
denotes |
, |
T15124 |
32667-32676 |
VBG |
denotes |
providing |
T15125 |
32677-32678 |
DT |
denotes |
a |
T15126 |
32679-32688 |
NN |
denotes |
rationale |
T15127 |
32689-32692 |
IN |
denotes |
for |
T15128 |
32693-32701 |
JJ |
denotes |
detailed |
T15129 |
32702-32716 |
NNS |
denotes |
investigations |
T15130 |
32717-32721 |
IN |
denotes |
into |
T15131 |
32722-32725 |
DT |
denotes |
the |
T15132 |
32726-32735 |
JJ |
denotes |
molecular |
T15133 |
32736-32741 |
NN |
denotes |
basis |
T15134 |
32742-32744 |
IN |
denotes |
of |
T15135 |
32745-32753 |
JJ |
denotes |
ɛ-globin |
T15136 |
32754-32758 |
NN |
denotes |
gene |
T15137 |
32759-32768 |
VBG |
denotes |
silencing |
T15138 |
32768-32769 |
. |
denotes |
. |
T15139 |
32770-32773 |
DT |
denotes |
The |
T15140 |
32774-32781 |
JJ |
denotes |
present |
T15141 |
32782-32787 |
NN |
denotes |
study |
T15142 |
32788-32798 |
VBZ |
denotes |
identifies |
T15143 |
32799-32800 |
DT |
denotes |
a |
T15144 |
32801-32806 |
NN |
denotes |
novel |
T15145 |
32807-32816 |
NN |
denotes |
repressor |
T15146 |
32816-32817 |
, |
denotes |
, |
T15147 |
32818-32822 |
NNP |
denotes |
Sox6 |
T15148 |
32822-32823 |
, |
denotes |
, |
T15149 |
32824-32829 |
WDT |
denotes |
which |
T15150 |
32830-32835 |
VBZ |
denotes |
binds |
T15151 |
32836-32838 |
TO |
denotes |
to |
T15152 |
32839-32842 |
DT |
denotes |
the |
T15153 |
32843-32845 |
JJ |
denotes |
ɛy |
T15154 |
32846-32854 |
JJ |
denotes |
proximal |
T15155 |
32855-32863 |
NN |
denotes |
promoter |
T15156 |
32863-32864 |
, |
denotes |
, |
T15157 |
32865-32876 |
RB |
denotes |
potentially |
T15158 |
32877-32879 |
IN |
denotes |
as |
T15159 |
32880-32884 |
NN |
denotes |
part |
T15160 |
32885-32887 |
IN |
denotes |
of |
T15161 |
32888-32889 |
DT |
denotes |
a |
T15162 |
32890-32896 |
JJR |
denotes |
larger |
T15163 |
32897-32907 |
NN |
denotes |
repression |
T15164 |
32908-32915 |
NN |
denotes |
complex |
T15165 |
32915-32916 |
. |
denotes |
. |
T15166 |
32917-32924 |
IN |
denotes |
Because |
T15167 |
32925-32931 |
JJ |
denotes |
murine |
T15168 |
32932-32936 |
NNP |
denotes |
Sox6 |
T15169 |
32937-32940 |
CC |
denotes |
and |
T15170 |
32941-32944 |
PRP$ |
denotes |
its |
T15171 |
32945-32950 |
JJ |
denotes |
human |
T15172 |
32951-32962 |
NN |
denotes |
counterpart |
T15173 |
32963-32966 |
VBP |
denotes |
are |
T15174 |
32967-32969 |
CD |
denotes |
94 |
T15175 |
32969-32970 |
NN |
denotes |
% |
T15176 |
32971-32980 |
JJ |
denotes |
identical |
T15177 |
32981-32983 |
IN |
denotes |
at |
T15178 |
32984-32987 |
DT |
denotes |
the |
T15179 |
32988-32993 |
JJ |
denotes |
amino |
T15180 |
32994-32998 |
NN |
denotes |
acid |
T15181 |
32999-33004 |
NN |
denotes |
level |
T15182 |
33005-33006 |
NNP |
denotes |
[ |
T15183 |
33006-33008 |
CD |
denotes |
48 |
T15184 |
33008-33009 |
NNP |
denotes |
] |
T15185 |
33009-33010 |
, |
denotes |
, |
T15186 |
33011-33013 |
PRP |
denotes |
it |
T15187 |
33014-33016 |
VBZ |
denotes |
is |
T15188 |
33017-33025 |
JJ |
denotes |
possible |
T15189 |
33026-33030 |
IN |
denotes |
that |
T15190 |
33031-33036 |
JJ |
denotes |
human |
T15191 |
33037-33041 |
NNP |
denotes |
Sox6 |
T15192 |
33042-33045 |
MD |
denotes |
may |
T15193 |
33046-33050 |
RB |
denotes |
also |
T15194 |
33051-33053 |
VB |
denotes |
be |
T15195 |
33054-33063 |
JJ |
denotes |
important |
T15196 |
33064-33066 |
IN |
denotes |
in |
T15197 |
33067-33072 |
JJ |
denotes |
human |
T15198 |
33073-33074 |
NN |
denotes |
ɛ |
T15199 |
33075-33081 |
NN |
denotes |
globin |
T15200 |
33082-33091 |
VBG |
denotes |
silencing |
T15201 |
33091-33092 |
. |
denotes |
. |
T15202 |
33093-33098 |
EX |
denotes |
There |
T15203 |
33099-33101 |
VBZ |
denotes |
is |
T15204 |
33102-33113 |
JJ |
denotes |
significant |
T15205 |
33114-33122 |
NN |
denotes |
sequence |
T15206 |
33123-33131 |
NN |
denotes |
homology |
T15207 |
33132-33139 |
IN |
denotes |
between |
T15208 |
33140-33143 |
DT |
denotes |
the |
T15209 |
33144-33149 |
JJ |
denotes |
human |
T15210 |
33150-33153 |
CC |
denotes |
and |
T15211 |
33154-33159 |
NN |
denotes |
mouse |
T15212 |
33160-33161 |
NN |
denotes |
ɛ |
T15213 |
33162-33170 |
NN |
denotes |
promoter |
T15214 |
33171-33178 |
NNS |
denotes |
regions |
T15215 |
33178-33179 |
, |
denotes |
, |
T15216 |
33180-33183 |
CC |
denotes |
and |
T15217 |
33184-33187 |
DT |
denotes |
the |
T15218 |
33188-33193 |
JJ |
denotes |
human |
T15219 |
33194-33202 |
NN |
denotes |
promoter |
T15220 |
33203-33211 |
VBZ |
denotes |
contains |
T15221 |
33212-33214 |
IN |
denotes |
at |
T15222 |
33215-33220 |
JJS |
denotes |
least |
T15223 |
33221-33224 |
CD |
denotes |
two |
T15224 |
33225-33234 |
JJ |
denotes |
potential |
T15225 |
33235-33239 |
JJ |
denotes |
Sox6 |
T15226 |
33240-33247 |
JJ |
denotes |
binding |
T15227 |
33248-33253 |
NNS |
denotes |
sites |
T15228 |
33253-33254 |
. |
denotes |
. |
T15229 |
33255-33261 |
RB |
denotes |
Indeed |
T15230 |
33261-33262 |
, |
denotes |
, |
T15231 |
33263-33266 |
DT |
denotes |
the |
T15232 |
33267-33276 |
NN |
denotes |
existence |
T15233 |
33277-33279 |
IN |
denotes |
of |
T15234 |
33280-33281 |
DT |
denotes |
a |
T15235 |
33282-33290 |
NN |
denotes |
silencer |
T15236 |
33291-33293 |
IN |
denotes |
of |
T15237 |
33294-33297 |
DT |
denotes |
the |
T15238 |
33298-33303 |
JJ |
denotes |
human |
T15239 |
33304-33305 |
NN |
denotes |
ɛ |
T15240 |
33306-33312 |
NN |
denotes |
globin |
T15241 |
33313-33317 |
NN |
denotes |
gene |
T15242 |
33318-33321 |
VBZ |
denotes |
has |
T15243 |
33322-33326 |
VBN |
denotes |
been |
T15244 |
33327-33335 |
VBN |
denotes |
proposed |
T15245 |
33336-33337 |
NNP |
denotes |
[ |
T15246 |
33337-33342 |
CD |
denotes |
49,50 |
T15247 |
33342-33343 |
NNP |
denotes |
] |
T15248 |
33343-33344 |
. |
denotes |
. |
T15249 |
33345-33349 |
RB |
denotes |
Thus |
T15250 |
33349-33350 |
, |
denotes |
, |
T15251 |
33351-33362 |
NN |
denotes |
elucidation |
T15252 |
33363-33365 |
IN |
denotes |
of |
T15253 |
33366-33369 |
DT |
denotes |
the |
T15254 |
33370-33374 |
JJ |
denotes |
Sox6 |
T15255 |
33375-33385 |
NN |
denotes |
repression |
T15256 |
33386-33395 |
NN |
denotes |
mechanism |
T15257 |
33396-33399 |
CC |
denotes |
and |
T15258 |
33400-33414 |
NN |
denotes |
identification |
T15259 |
33415-33417 |
IN |
denotes |
of |
T15260 |
33418-33423 |
JJ |
denotes |
other |
T15261 |
33424-33434 |
NNS |
denotes |
components |
T15262 |
33435-33437 |
IN |
denotes |
of |
T15263 |
33438-33441 |
DT |
denotes |
the |
T15264 |
33442-33457 |
JJ |
denotes |
Sox6-containing |
T15265 |
33458-33465 |
NN |
denotes |
complex |
T15266 |
33466-33469 |
MD |
denotes |
may |
T15267 |
33470-33477 |
RB |
denotes |
further |
T15268 |
33478-33481 |
PRP$ |
denotes |
our |
T15269 |
33482-33495 |
NN |
denotes |
understanding |
T15270 |
33496-33498 |
IN |
denotes |
of |
T15271 |
33499-33500 |
NN |
denotes |
ɛ |
T15272 |
33501-33507 |
NN |
denotes |
globin |
T15273 |
33508-33518 |
NN |
denotes |
regulation |
T15274 |
33519-33522 |
CC |
denotes |
and |
T15275 |
33523-33534 |
RB |
denotes |
potentially |
T15276 |
33535-33541 |
VB |
denotes |
reveal |
T15277 |
33542-33552 |
JJ |
denotes |
additional |
T15278 |
33553-33562 |
JJ |
denotes |
molecular |
T15279 |
33563-33570 |
NNS |
denotes |
targets |
T15280 |
33571-33574 |
IN |
denotes |
for |
T15281 |
33575-33578 |
DT |
denotes |
the |
T15282 |
33579-33588 |
NN |
denotes |
treatment |
T15283 |
33589-33591 |
IN |
denotes |
of |
T15284 |
33592-33598 |
NN |
denotes |
sickle |
T15285 |
33599-33603 |
NN |
denotes |
cell |
T15286 |
33604-33610 |
NN |
denotes |
anemia |
T15287 |
33611-33614 |
CC |
denotes |
and |
T15288 |
33615-33616 |
NN |
denotes |
β |
T15289 |
33617-33629 |
NNS |
denotes |
thalassemias |
T15290 |
33629-33630 |
. |
denotes |
. |
T16562 |
33655-33662 |
JJ |
denotes |
Plasmid |
T16563 |
33663-33675 |
NN |
denotes |
construction |
T16564 |
33675-33676 |
. |
denotes |
. |
T16565 |
33677-33680 |
DT |
denotes |
The |
T16566 |
33681-33683 |
JJ |
denotes |
ɛy |
T16567 |
33684-33692 |
NN |
denotes |
promoter |
T16568 |
33693-33701 |
NN |
denotes |
deletion |
T16569 |
33702-33710 |
NN |
denotes |
reporter |
T16570 |
33711-33718 |
NN |
denotes |
plasmid |
T16571 |
33719-33720 |
-LRB- |
denotes |
( |
T16572 |
33720-33725 |
JJ |
denotes |
E-luc |
T16573 |
33725-33726 |
-RRB- |
denotes |
) |
T16574 |
33727-33730 |
VBD |
denotes |
was |
T16575 |
33731-33740 |
VBN |
denotes |
generated |
T16576 |
33741-33743 |
IN |
denotes |
by |
T16577 |
33744-33747 |
NNP |
denotes |
PCR |
T16578 |
33748-33761 |
NN |
denotes |
amplification |
T16579 |
33762-33764 |
IN |
denotes |
of |
T16580 |
33765-33768 |
DT |
denotes |
the |
T16581 |
33769-33771 |
JJ |
denotes |
ɛy |
T16582 |
33772-33780 |
JJ |
denotes |
proximal |
T16583 |
33781-33789 |
NN |
denotes |
promoter |
T16584 |
33789-33790 |
. |
denotes |
. |
T16585 |
33791-33792 |
DT |
denotes |
A |
T16586 |
33793-33799 |
JJ |
denotes |
2.2-kb |
T16587 |
33800-33808 |
NN |
denotes |
fragment |
T16588 |
33809-33817 |
RB |
denotes |
upstream |
T16589 |
33818-33820 |
IN |
denotes |
of |
T16590 |
33821-33824 |
DT |
denotes |
the |
T16591 |
33825-33827 |
JJ |
denotes |
ɛy |
T16592 |
33828-33834 |
NN |
denotes |
globin |
T16593 |
33835-33845 |
NN |
denotes |
initiation |
T16594 |
33846-33851 |
NN |
denotes |
codon |
T16595 |
33852-33853 |
-LRB- |
denotes |
( |
T16596 |
33853-33856 |
NNP |
denotes |
ATG |
T16597 |
33856-33857 |
-RRB- |
denotes |
) |
T16598 |
33858-33861 |
VBD |
denotes |
was |
T16599 |
33862-33866 |
VBN |
denotes |
used |
T16600 |
33866-33867 |
, |
denotes |
, |
T16601 |
33868-33875 |
IN |
denotes |
because |
T16602 |
33876-33878 |
PRP |
denotes |
it |
T16603 |
33879-33882 |
VBZ |
denotes |
has |
T16604 |
33883-33887 |
VBN |
denotes |
been |
T16605 |
33888-33893 |
VBN |
denotes |
shown |
T16606 |
33894-33898 |
IN |
denotes |
that |
T16607 |
33899-33902 |
DT |
denotes |
all |
T16608 |
33903-33912 |
NNS |
denotes |
sequences |
T16609 |
33913-33921 |
VBN |
denotes |
required |
T16610 |
33922-33925 |
IN |
denotes |
for |
T16611 |
33926-33927 |
NN |
denotes |
ɛ |
T16612 |
33928-33932 |
NN |
denotes |
gene |
T16613 |
33933-33942 |
VBG |
denotes |
silencing |
T16614 |
33943-33946 |
VBP |
denotes |
are |
T16615 |
33947-33954 |
VBN |
denotes |
located |
T16616 |
33955-33961 |
IN |
denotes |
within |
T16617 |
33962-33963 |
DT |
denotes |
a |
T16618 |
33964-33970 |
JJ |
denotes |
3.7-kb |
T16619 |
33971-33976 |
NNP |
denotes |
EcoRI |
T16620 |
33977-33985 |
NN |
denotes |
fragment |
T16621 |
33986-33996 |
VBG |
denotes |
containing |
T16622 |
33997-34002 |
IN |
denotes |
about |
T16623 |
34003-34004 |
CD |
denotes |
2 |
T16624 |
34005-34007 |
NN |
denotes |
kb |
T16625 |
34008-34010 |
IN |
denotes |
of |
T16626 |
34011-34019 |
NN |
denotes |
sequence |
T16627 |
34020-34028 |
RB |
denotes |
upstream |
T16628 |
34029-34031 |
IN |
denotes |
of |
T16629 |
34032-34035 |
DT |
denotes |
the |
T16630 |
34036-34037 |
NN |
denotes |
ɛ |
T16631 |
34038-34044 |
NN |
denotes |
globin |
T16632 |
34045-34049 |
NN |
denotes |
gene |
T16633 |
34050-34053 |
NN |
denotes |
cap |
T16634 |
34054-34058 |
NN |
denotes |
site |
T16635 |
34059-34060 |
NNP |
denotes |
[ |
T16636 |
34060-34062 |
CD |
denotes |
50 |
T16637 |
34062-34063 |
NNP |
denotes |
] |
T16638 |
34063-34064 |
. |
denotes |
. |
T16639 |
34065-34075 |
NNP |
denotes |
Nucleotide |
T16640 |
34076-34085 |
NN |
denotes |
numbering |
T16641 |
34086-34088 |
VBZ |
denotes |
is |
T16642 |
34089-34097 |
JJ |
denotes |
relative |
T16643 |
34098-34100 |
TO |
denotes |
to |
T16644 |
34101-34104 |
DT |
denotes |
the |
T16645 |
34105-34118 |
NN |
denotes |
transcription |
T16646 |
34119-34124 |
VB |
denotes |
start |
T16647 |
34125-34129 |
NN |
denotes |
site |
T16648 |
34129-34130 |
. |
denotes |
. |
T16649 |
34131-34134 |
DT |
denotes |
The |
T16650 |
34135-34150 |
JJ |
denotes |
transcriptional |
T16651 |
34151-34156 |
NN |
denotes |
start |
T16652 |
34157-34161 |
NN |
denotes |
site |
T16653 |
34162-34164 |
VBZ |
denotes |
is |
T16654 |
34165-34170 |
VBN |
denotes |
based |
T16655 |
34171-34173 |
IN |
denotes |
on |
T16656 |
34174-34177 |
DT |
denotes |
the |
T16657 |
34178-34185 |
JJS |
denotes |
longest |
T16658 |
34186-34190 |
NN |
denotes |
cDNA |
T16659 |
34191-34193 |
IN |
denotes |
in |
T16660 |
34194-34197 |
DT |
denotes |
the |
T16661 |
34198-34204 |
NNP |
denotes |
Fantom |
T16662 |
34205-34206 |
-LRB- |
denotes |
( |
T16663 |
34206-34216 |
NNP |
denotes |
Functional |
T16664 |
34217-34227 |
NNP |
denotes |
Annotation |
T16665 |
34228-34230 |
IN |
denotes |
of |
T16666 |
34231-34236 |
NNP |
denotes |
Mouse |
T16667 |
34236-34237 |
-RRB- |
denotes |
) |
T16668 |
34238-34246 |
NN |
denotes |
database |
T16669 |
34246-34247 |
. |
denotes |
. |
T16670 |
34248-34251 |
DT |
denotes |
The |
T16671 |
34252-34255 |
NNP |
denotes |
PCR |
T16672 |
34256-34263 |
NNS |
denotes |
primers |
T16673 |
34264-34273 |
VBD |
denotes |
contained |
T16674 |
34274-34278 |
NNP |
denotes |
XhoI |
T16675 |
34279-34282 |
CC |
denotes |
and |
T16676 |
34283-34290 |
NNP |
denotes |
HindIII |
T16677 |
34291-34296 |
NNS |
denotes |
sites |
T16678 |
34297-34301 |
WDT |
denotes |
that |
T16679 |
34302-34306 |
VBD |
denotes |
were |
T16680 |
34307-34311 |
VBN |
denotes |
used |
T16681 |
34312-34314 |
TO |
denotes |
to |
T16682 |
34315-34320 |
VB |
denotes |
clone |
T16683 |
34321-34324 |
DT |
denotes |
the |
T16684 |
34325-34327 |
JJ |
denotes |
ɛy |
T16685 |
34328-34336 |
NN |
denotes |
promoter |
T16686 |
34337-34345 |
NN |
denotes |
fragment |
T16687 |
34346-34354 |
RB |
denotes |
upstream |
T16688 |
34355-34357 |
IN |
denotes |
of |
T16689 |
34358-34361 |
DT |
denotes |
the |
T16690 |
34362-34369 |
JJ |
denotes |
firefly |
T16691 |
34370-34380 |
NN |
denotes |
luciferase |
T16692 |
34381-34385 |
NN |
denotes |
gene |
T16693 |
34386-34388 |
IN |
denotes |
in |
T16694 |
34389-34393 |
NNP |
denotes |
pGL3 |
T16695 |
34394-34399 |
NNP |
denotes |
Basic |
T16696 |
34400-34401 |
-LRB- |
denotes |
( |
T16697 |
34401-34408 |
NNP |
denotes |
Promega |
T16698 |
34408-34409 |
, |
denotes |
, |
T16699 |
34410-34417 |
NNP |
denotes |
Madison |
T16700 |
34417-34418 |
, |
denotes |
, |
T16701 |
34419-34428 |
NNP |
denotes |
Wisconsin |
T16702 |
34428-34429 |
, |
denotes |
, |
T16703 |
34430-34436 |
NNP |
denotes |
United |
T16704 |
34437-34443 |
NNPS |
denotes |
States |
T16705 |
34443-34444 |
-RRB- |
denotes |
) |
T16706 |
34444-34445 |
. |
denotes |
. |
T16707 |
34446-34447 |
DT |
denotes |
A |
T16708 |
34448-34454 |
JJ |
denotes |
2.5-kb |
T16709 |
34455-34464 |
NNP |
denotes |
SstI/XhoI |
T16710 |
34465-34473 |
NN |
denotes |
fragment |
T16711 |
34474-34476 |
IN |
denotes |
of |
T16712 |
34477-34482 |
NNP |
denotes |
μLCRβ |
T16713 |
34483-34486 |
CD |
denotes |
9.3 |
T16714 |
34487-34488 |
-LRB- |
denotes |
( |
T16715 |
34488-34493 |
NN |
denotes |
micro |
T16716 |
34494-34497 |
NNP |
denotes |
LCR |
T16717 |
34497-34498 |
: |
denotes |
; |
T16718 |
34499-34500 |
NNP |
denotes |
[ |
T16719 |
34500-34502 |
CD |
denotes |
31 |
T16720 |
34502-34503 |
NNP |
denotes |
] |
T16721 |
34503-34504 |
-RRB- |
denotes |
) |
T16722 |
34505-34508 |
VBD |
denotes |
was |
T16723 |
34509-34513 |
RB |
denotes |
then |
T16724 |
34514-34522 |
VBN |
denotes |
inserted |
T16725 |
34523-34531 |
RB |
denotes |
upstream |
T16726 |
34532-34534 |
IN |
denotes |
of |
T16727 |
34535-34538 |
DT |
denotes |
the |
T16728 |
34539-34541 |
JJ |
denotes |
ɛy |
T16729 |
34542-34550 |
NN |
denotes |
promoter |
T16730 |
34551-34553 |
IN |
denotes |
in |
T16731 |
34554-34557 |
DT |
denotes |
the |
T16732 |
34558-34563 |
JJ |
denotes |
above |
T16733 |
34564-34568 |
JJ |
denotes |
pGL3 |
T16734 |
34569-34574 |
JJ |
denotes |
Basic |
T16735 |
34575-34582 |
NN |
denotes |
plasmid |
T16736 |
34582-34583 |
, |
denotes |
, |
T16737 |
34584-34593 |
VBG |
denotes |
resulting |
T16738 |
34594-34596 |
IN |
denotes |
in |
T16739 |
34597-34598 |
DT |
denotes |
a |
T16740 |
34599-34607 |
NN |
denotes |
reporter |
T16741 |
34608-34617 |
VB |
denotes |
construct |
T16742 |
34618-34620 |
IN |
denotes |
in |
T16743 |
34621-34626 |
WDT |
denotes |
which |
T16744 |
34627-34637 |
NN |
denotes |
luciferase |
T16745 |
34638-34648 |
NN |
denotes |
expression |
T16746 |
34649-34651 |
VBZ |
denotes |
is |
T16747 |
34652-34658 |
VBN |
denotes |
driven |
T16748 |
34659-34661 |
IN |
denotes |
by |
T16749 |
34662-34665 |
DT |
denotes |
the |
T16750 |
34666-34668 |
JJ |
denotes |
ɛy |
T16751 |
34669-34677 |
NN |
denotes |
promoter |
T16752 |
34677-34678 |
. |
denotes |
. |
T16753 |
34679-34680 |
DT |
denotes |
A |
T16754 |
34681-34687 |
NN |
denotes |
series |
T16755 |
34688-34690 |
IN |
denotes |
of |
T16756 |
34691-34699 |
NN |
denotes |
deletion |
T16757 |
34700-34710 |
NNS |
denotes |
constructs |
T16758 |
34711-34713 |
IN |
denotes |
of |
T16759 |
34714-34717 |
DT |
denotes |
the |
T16760 |
34718-34720 |
JJ |
denotes |
ɛy |
T16761 |
34721-34729 |
NN |
denotes |
promoter |
T16762 |
34730-34734 |
VBD |
denotes |
were |
T16763 |
34735-34744 |
VBN |
denotes |
generated |
T16764 |
34745-34754 |
RB |
denotes |
similarly |
T16765 |
34754-34755 |
. |
denotes |
. |
T16766 |
34756-34763 |
RB |
denotes |
Forward |
T16767 |
34764-34771 |
NNS |
denotes |
primers |
T16768 |
34772-34776 |
IN |
denotes |
with |
T16769 |
34777-34779 |
DT |
denotes |
an |
T16770 |
34780-34784 |
NNP |
denotes |
XhoI |
T16771 |
34785-34789 |
NN |
denotes |
site |
T16772 |
34790-34797 |
VBP |
denotes |
include |
T16773 |
34797-34798 |
: |
denotes |
: |
T16774 |
34799-34806 |
NNP |
denotes |
MHB1457 |
T16775 |
34806-34807 |
, |
denotes |
, |
T16776 |
34808-34809 |
CD |
denotes |
5 |
T16777 |
34809-34810 |
NN |
denotes |
′ |
T16778 |
34810-34837 |
CD |
denotes |
CCGCTCGAGTGCTAGGCAAACACTCA3 |
T16779 |
34837-34838 |
NN |
denotes |
′ |
T16780 |
34839-34840 |
-LRB- |
denotes |
( |
T16781 |
34840-34841 |
FW |
denotes |
− |
T16782 |
34841-34845 |
CD |
denotes |
2077 |
T16783 |
34846-34848 |
TO |
denotes |
to |
T16784 |
34849-34850 |
CD |
denotes |
− |
T16785 |
34850-34854 |
CD |
denotes |
2052 |
T16786 |
34854-34855 |
-RRB- |
denotes |
) |
T16787 |
34855-34856 |
: |
denotes |
; |
T16788 |
34857-34864 |
NNP |
denotes |
MHB1503 |
T16789 |
34864-34865 |
, |
denotes |
, |
T16790 |
34866-34867 |
CD |
denotes |
5 |
T16791 |
34867-34868 |
NN |
denotes |
′ |
T16792 |
34868-34899 |
CD |
denotes |
CCGCTCGAGTCTCTACACTGTCACTCCCTG3 |
T16793 |
34899-34900 |
NN |
denotes |
′ |
T16794 |
34901-34902 |
-LRB- |
denotes |
( |
T16795 |
34902-34903 |
FW |
denotes |
− |
T16796 |
34903-34906 |
CD |
denotes |
634 |
T16797 |
34907-34909 |
TO |
denotes |
to |
T16798 |
34910-34911 |
CD |
denotes |
− |
T16799 |
34911-34914 |
CD |
denotes |
605 |
T16800 |
34914-34915 |
-RRB- |
denotes |
) |
T16801 |
34915-34916 |
: |
denotes |
; |
T16802 |
34917-34924 |
NNP |
denotes |
MHB1505 |
T16803 |
34924-34925 |
, |
denotes |
, |
T16804 |
34926-34927 |
CD |
denotes |
5 |
T16805 |
34927-34928 |
NN |
denotes |
′ |
T16806 |
34928-34957 |
CD |
denotes |
CCGCTCGAGGGAGCCAAAAAAAGAATGC3 |
T16807 |
34957-34958 |
NN |
denotes |
′ |
T16808 |
34959-34960 |
-LRB- |
denotes |
( |
T16809 |
34960-34961 |
FW |
denotes |
− |
T16810 |
34961-34964 |
CD |
denotes |
197 |
T16811 |
34965-34967 |
TO |
denotes |
to |
T16812 |
34968-34969 |
CD |
denotes |
− |
T16813 |
34969-34972 |
CD |
denotes |
169 |
T16814 |
34972-34973 |
-RRB- |
denotes |
) |
T16815 |
34973-34974 |
: |
denotes |
; |
T16816 |
34975-34982 |
NNP |
denotes |
MHB1506 |
T16817 |
34982-34983 |
, |
denotes |
, |
T16818 |
34984-34985 |
CD |
denotes |
5 |
T16819 |
34985-34986 |
NN |
denotes |
′ |
T16820 |
34986-35015 |
CD |
denotes |
CCGCTCGAGCTGACCAATGGCTTCAAAG3 |
T16821 |
35015-35016 |
NN |
denotes |
′ |
T16822 |
35017-35018 |
-LRB- |
denotes |
( |
T16823 |
35018-35019 |
FW |
denotes |
− |
T16824 |
35019-35021 |
CD |
denotes |
85 |
T16825 |
35022-35024 |
TO |
denotes |
to |
T16826 |
35025-35026 |
CD |
denotes |
− |
T16827 |
35026-35028 |
CD |
denotes |
58 |
T16828 |
35028-35029 |
-RRB- |
denotes |
) |
T16829 |
35029-35030 |
: |
denotes |
; |
T16830 |
35031-35038 |
NNP |
denotes |
MHB1532 |
T16831 |
35038-35039 |
, |
denotes |
, |
T16832 |
35040-35041 |
CD |
denotes |
5 |
T16833 |
35041-35042 |
NN |
denotes |
′ |
T16834 |
35042-35073 |
CD |
denotes |
CCGCTCGAGAATGCAGAACAAAGGGTCAGA3 |
T16835 |
35073-35074 |
NN |
denotes |
′ |
T16836 |
35075-35076 |
-LRB- |
denotes |
( |
T16837 |
35076-35077 |
FW |
denotes |
− |
T16838 |
35077-35079 |
CD |
denotes |
63 |
T16839 |
35080-35082 |
TO |
denotes |
to |
T16840 |
35083-35084 |
CD |
denotes |
− |
T16841 |
35084-35086 |
CD |
denotes |
34 |
T16842 |
35086-35087 |
-RRB- |
denotes |
) |
T16843 |
35087-35088 |
: |
denotes |
; |
T16844 |
35089-35092 |
CC |
denotes |
and |
T16845 |
35093-35100 |
NNP |
denotes |
MHB1507 |
T16846 |
35100-35101 |
, |
denotes |
, |
T16847 |
35102-35103 |
CD |
denotes |
5 |
T16848 |
35103-35104 |
NN |
denotes |
′ |
T16849 |
35104-35133 |
NNP |
denotes |
CCGCTCGAGGTCTGCGAAGAATAAAAGGC |
T16850 |
35134-35135 |
CD |
denotes |
3 |
T16851 |
35135-35136 |
NN |
denotes |
′ |
T16852 |
35137-35138 |
-LRB- |
denotes |
( |
T16853 |
35138-35139 |
FW |
denotes |
− |
T16854 |
35139-35141 |
CD |
denotes |
37 |
T16855 |
35142-35144 |
TO |
denotes |
to |
T16856 |
35145-35146 |
CD |
denotes |
− |
T16857 |
35146-35147 |
CD |
denotes |
9 |
T16858 |
35147-35148 |
-RRB- |
denotes |
) |
T16859 |
35148-35149 |
. |
denotes |
. |
T16860 |
35150-35153 |
DT |
denotes |
All |
T16861 |
35154-35161 |
RB |
denotes |
forward |
T16862 |
35162-35169 |
NNS |
denotes |
primers |
T16863 |
35170-35174 |
VBD |
denotes |
were |
T16864 |
35175-35179 |
VBN |
denotes |
used |
T16865 |
35180-35182 |
IN |
denotes |
in |
T16866 |
35183-35194 |
NN |
denotes |
combination |
T16867 |
35195-35199 |
IN |
denotes |
with |
T16868 |
35200-35203 |
DT |
denotes |
the |
T16869 |
35204-35211 |
NN |
denotes |
reverse |
T16870 |
35212-35218 |
NN |
denotes |
primer |
T16871 |
35219-35226 |
NNP |
denotes |
HindIII |
T16872 |
35227-35231 |
NN |
denotes |
site |
T16873 |
35231-35232 |
: |
denotes |
: |
T16874 |
35233-35240 |
NNP |
denotes |
MHB1477 |
T16875 |
35240-35241 |
, |
denotes |
, |
T16876 |
35242-35243 |
CD |
denotes |
5 |
T16877 |
35243-35244 |
NN |
denotes |
′ |
T16878 |
35244-35270 |
CD |
denotes |
CGGAAGCTTGGGAGGTTGCTGGTGA3 |
T16879 |
35270-35271 |
NN |
denotes |
′ |
T16880 |
35272-35273 |
-LRB- |
denotes |
( |
T16881 |
35273-35276 |
CD |
denotes |
+45 |
T16882 |
35277-35279 |
TO |
denotes |
to |
T16883 |
35280-35283 |
CD |
denotes |
+20 |
T16884 |
35283-35284 |
-RRB- |
denotes |
) |
T16885 |
35284-35285 |
. |
denotes |
. |
T16886 |
35286-35297 |
JJ |
denotes |
Sox6-pcDNA3 |
T16887 |
35297-35299 |
CD |
denotes |
.1 |
T16888 |
35300-35301 |
NNP |
denotes |
[ |
T16889 |
35301-35303 |
CD |
denotes |
15 |
T16890 |
35303-35304 |
NNP |
denotes |
] |
T16891 |
35305-35308 |
VBD |
denotes |
was |
T16892 |
35309-35313 |
VBN |
denotes |
used |
T16893 |
35314-35316 |
TO |
denotes |
to |
T16894 |
35317-35328 |
VB |
denotes |
overexpress |
T16895 |
35329-35333 |
NNP |
denotes |
Sox6 |
T16896 |
35333-35334 |
. |
denotes |
. |
T16897 |
35335-35336 |
DT |
denotes |
A |
T16898 |
35337-35346 |
VBN |
denotes |
truncated |
T16899 |
35347-35354 |
NN |
denotes |
version |
T16900 |
35355-35357 |
IN |
denotes |
of |
T16901 |
35358-35361 |
DT |
denotes |
the |
T16902 |
35362-35366 |
JJ |
denotes |
Sox6 |
T16903 |
35367-35381 |
NN |
denotes |
overexpression |
T16904 |
35382-35391 |
VBP |
denotes |
construct |
T16905 |
35392-35393 |
-LRB- |
denotes |
( |
T16906 |
35393-35409 |
JJ |
denotes |
Sox6-ΔHMG-pcDNA3 |
T16907 |
35409-35411 |
CD |
denotes |
.1 |
T16908 |
35411-35412 |
-RRB- |
denotes |
) |
T16909 |
35413-35417 |
WDT |
denotes |
that |
T16910 |
35418-35423 |
VBZ |
denotes |
lacks |
T16911 |
35424-35427 |
DT |
denotes |
the |
T16912 |
35428-35431 |
NNP |
denotes |
HMG |
T16913 |
35432-35438 |
NN |
denotes |
domain |
T16914 |
35439-35442 |
VBD |
denotes |
was |
T16915 |
35443-35452 |
VBN |
denotes |
generated |
T16916 |
35452-35453 |
, |
denotes |
, |
T16917 |
35454-35456 |
IN |
denotes |
as |
T16918 |
35457-35466 |
VBN |
denotes |
described |
T16919 |
35467-35469 |
IN |
denotes |
by |
T16920 |
35470-35476 |
NNS |
denotes |
others |
T16921 |
35477-35478 |
NNP |
denotes |
[ |
T16922 |
35478-35480 |
CD |
denotes |
32 |
T16923 |
35480-35481 |
NNP |
denotes |
] |
T16924 |
35481-35482 |
. |
denotes |
. |
T16925 |
35483-35494 |
NNP |
denotes |
Mutagenesis |
T16926 |
35495-35497 |
IN |
denotes |
of |
T16927 |
35498-35506 |
NNP |
denotes |
Sox/Sox6 |
T16928 |
35507-35516 |
NN |
denotes |
consensus |
T16929 |
35517-35524 |
JJ |
denotes |
binding |
T16930 |
35525-35530 |
NNS |
denotes |
sites |
T16931 |
35531-35533 |
IN |
denotes |
of |
T16932 |
35534-35537 |
DT |
denotes |
the |
T16933 |
35538-35540 |
JJ |
denotes |
ɛy |
T16934 |
35541-35549 |
NN |
denotes |
promoter |
T16935 |
35550-35554 |
VBD |
denotes |
were |
T16936 |
35555-35559 |
VBN |
denotes |
done |
T16937 |
35560-35562 |
IN |
denotes |
by |
T16938 |
35563-35566 |
NNP |
denotes |
PCR |
T16939 |
35566-35567 |
. |
denotes |
. |
T16940 |
35568-35575 |
RB |
denotes |
Forward |
T16941 |
35576-35583 |
NNS |
denotes |
primers |
T16942 |
35584-35588 |
VBN |
denotes |
used |
T16943 |
35589-35591 |
TO |
denotes |
to |
T16944 |
35592-35600 |
VB |
denotes |
generate |
T16945 |
35601-35606 |
DT |
denotes |
these |
T16946 |
35607-35618 |
VBN |
denotes |
mutagenized |
T16947 |
35619-35621 |
NN |
denotes |
ɛy |
T16948 |
35622-35630 |
NN |
denotes |
promoter |
T16949 |
35631-35639 |
NN |
denotes |
reporter |
T16950 |
35640-35650 |
NNS |
denotes |
constructs |
T16951 |
35651-35658 |
VBP |
denotes |
include |
T16952 |
35658-35659 |
: |
denotes |
: |
T16953 |
35660-35667 |
CD |
denotes |
MHB1661 |
T16954 |
35667-35668 |
, |
denotes |
, |
T16955 |
35669-35670 |
CD |
denotes |
5 |
T16956 |
35670-35671 |
NN |
denotes |
′ |
T16957 |
35671-35717 |
CD |
denotes |
CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3 |
T16958 |
35717-35718 |
NN |
denotes |
′ |
T16959 |
35719-35720 |
-LRB- |
denotes |
( |
T16960 |
35720-35721 |
FW |
denotes |
− |
T16961 |
35721-35723 |
CD |
denotes |
63 |
T16962 |
35724-35726 |
TO |
denotes |
to |
T16963 |
35727-35728 |
CD |
denotes |
− |
T16964 |
35728-35730 |
CD |
denotes |
19 |
T16965 |
35730-35731 |
-RRB- |
denotes |
) |
T16966 |
35731-35732 |
: |
denotes |
; |
T16967 |
35733-35740 |
NNP |
denotes |
MHB1662 |
T16968 |
35740-35741 |
, |
denotes |
, |
T16969 |
35742-35743 |
CD |
denotes |
5 |
T16970 |
35743-35744 |
NN |
denotes |
′ |
T16971 |
35744-35792 |
CD |
denotes |
CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3 |
T16972 |
35792-35793 |
NN |
denotes |
′ |
T16973 |
35794-35795 |
-LRB- |
denotes |
( |
T16974 |
35795-35796 |
FW |
denotes |
− |
T16975 |
35796-35798 |
CD |
denotes |
63 |
T16976 |
35799-35801 |
TO |
denotes |
to |
T16977 |
35802-35803 |
CD |
denotes |
− |
T16978 |
35803-35805 |
CD |
denotes |
16 |
T16979 |
35805-35806 |
-RRB- |
denotes |
) |
T16980 |
35806-35807 |
: |
denotes |
; |
T16981 |
35808-35811 |
CC |
denotes |
and |
T16982 |
35812-35819 |
NNP |
denotes |
MHB1663 |
T16983 |
35819-35820 |
, |
denotes |
, |
T16984 |
35821-35822 |
CD |
denotes |
5 |
T16985 |
35822-35823 |
NN |
denotes |
′ |
T16986 |
35823-35869 |
NNP |
denotes |
CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA |
T16987 |
35870-35871 |
CD |
denotes |
3 |
T16988 |
35871-35872 |
NN |
denotes |
′ |
T16989 |
35873-35874 |
-LRB- |
denotes |
( |
T16990 |
35874-35875 |
FW |
denotes |
− |
T16991 |
35875-35877 |
CD |
denotes |
63 |
T16992 |
35878-35880 |
TO |
denotes |
to |
T16993 |
35881-35882 |
CD |
denotes |
− |
T16994 |
35882-35884 |
CD |
denotes |
18 |
T16995 |
35884-35885 |
-RRB- |
denotes |
) |
T16996 |
35885-35886 |
. |
denotes |
. |
T17438 |
35888-35900 |
NN |
denotes |
Quantitation |
T17439 |
35901-35903 |
IN |
denotes |
of |
T17440 |
35904-35910 |
NN |
denotes |
globin |
T17441 |
35911-35915 |
NNP |
denotes |
mRNA |
T17442 |
35915-35916 |
. |
denotes |
. |
T17443 |
35917-35920 |
NNP |
denotes |
RNA |
T17444 |
35921-35924 |
VBD |
denotes |
was |
T17445 |
35925-35930 |
JJ |
denotes |
first |
T17446 |
35931-35938 |
JJ |
denotes |
reverse |
T17447 |
35939-35950 |
VBN |
denotes |
transcribed |
T17448 |
35951-35953 |
TO |
denotes |
to |
T17449 |
35954-35958 |
NNP |
denotes |
cDNA |
T17450 |
35958-35959 |
. |
denotes |
. |
T17451 |
35960-35967 |
NNS |
denotes |
Primers |
T17452 |
35968-35971 |
IN |
denotes |
for |
T17453 |
35972-35976 |
NNP |
denotes |
cDNA |
T17454 |
35977-35980 |
NNP |
denotes |
PCR |
T17455 |
35981-35994 |
NN |
denotes |
amplification |
T17456 |
35995-35997 |
IN |
denotes |
of |
T17457 |
35998-36004 |
NN |
denotes |
globin |
T17458 |
36005-36010 |
NNS |
denotes |
genes |
T17459 |
36011-36015 |
VBD |
denotes |
were |
T17460 |
36016-36024 |
VBN |
denotes |
obtained |
T17461 |
36025-36029 |
IN |
denotes |
from |
T17462 |
36030-36040 |
NNP |
denotes |
Primerbank |
T17463 |
36041-36042 |
NNP |
denotes |
[ |
T17464 |
36042-36044 |
CD |
denotes |
51 |
T17465 |
36044-36045 |
NNP |
denotes |
] |
T17466 |
36045-36046 |
. |
denotes |
. |
T17467 |
36047-36050 |
DT |
denotes |
All |
T17468 |
36051-36058 |
NNS |
denotes |
primers |
T17469 |
36059-36063 |
VBD |
denotes |
were |
T17470 |
36064-36072 |
VBN |
denotes |
searched |
T17471 |
36073-36080 |
IN |
denotes |
against |
T17472 |
36081-36084 |
DT |
denotes |
the |
T17473 |
36085-36089 |
NNP |
denotes |
NCBI |
T17474 |
36090-36098 |
NN |
denotes |
database |
T17475 |
36099-36101 |
TO |
denotes |
to |
T17476 |
36102-36109 |
VB |
denotes |
confirm |
T17477 |
36110-36121 |
NN |
denotes |
specificity |
T17478 |
36121-36122 |
. |
denotes |
. |
T17479 |
36123-36126 |
IN |
denotes |
For |
T17480 |
36127-36129 |
JJ |
denotes |
ɛy |
T17481 |
36130-36136 |
NN |
denotes |
globin |
T17482 |
36136-36137 |
: |
denotes |
: |
T17483 |
36138-36145 |
NNP |
denotes |
MHB1666 |
T17484 |
36145-36146 |
, |
denotes |
, |
T17485 |
36147-36148 |
CD |
denotes |
5 |
T17486 |
36148-36149 |
CD |
denotes |
′ |
T17487 |
36149-36171 |
CD |
denotes |
TGGCCTGTGGAGTAAGGTCAA3 |
T17488 |
36171-36172 |
NN |
denotes |
′ |
T17489 |
36172-36173 |
: |
denotes |
; |
T17490 |
36174-36177 |
CC |
denotes |
and |
T17491 |
36178-36185 |
NNP |
denotes |
MHB1667 |
T17492 |
36185-36186 |
, |
denotes |
, |
T17493 |
36187-36188 |
CD |
denotes |
5 |
T17494 |
36188-36189 |
CD |
denotes |
′ |
T17495 |
36189-36211 |
NNP |
denotes |
GAAGCAGAGGACAAGTTCCCA3 |
T17496 |
36211-36212 |
NN |
denotes |
′ |
T17497 |
36212-36213 |
. |
denotes |
. |
T17498 |
36214-36217 |
IN |
denotes |
For |
T17499 |
36218-36219 |
JJ |
denotes |
ζ |
T17500 |
36220-36226 |
NN |
denotes |
globin |
T17501 |
36226-36227 |
: |
denotes |
: |
T17502 |
36228-36235 |
CD |
denotes |
MHB1668 |
T17503 |
36235-36236 |
, |
denotes |
, |
T17504 |
36237-36238 |
CD |
denotes |
5 |
T17505 |
36238-36239 |
NN |
denotes |
′ |
T17506 |
36239-36261 |
CD |
denotes |
CTACCCCCAGACGAAGACCTA3 |
T17507 |
36261-36262 |
NN |
denotes |
′ |
T17508 |
36262-36263 |
: |
denotes |
; |
T17509 |
36264-36267 |
CC |
denotes |
and |
T17510 |
36268-36275 |
NNP |
denotes |
MHB1669 |
T17511 |
36275-36276 |
, |
denotes |
, |
T17512 |
36277-36278 |
CD |
denotes |
5 |
T17513 |
36278-36279 |
NN |
denotes |
′ |
T17514 |
36279-36300 |
CD |
denotes |
CTTAACCGCATCCCCTACGG3 |
T17515 |
36300-36301 |
NN |
denotes |
′ |
T17516 |
36301-36302 |
. |
denotes |
. |
T17517 |
36303-36306 |
IN |
denotes |
For |
T17518 |
36307-36310 |
JJ |
denotes |
βH1 |
T17519 |
36311-36317 |
NN |
denotes |
globin |
T17520 |
36317-36318 |
: |
denotes |
: |
T17521 |
36319-36326 |
NNP |
denotes |
MHB1672 |
T17522 |
36326-36327 |
, |
denotes |
, |
T17523 |
36328-36329 |
CD |
denotes |
5 |
T17524 |
36329-36330 |
CD |
denotes |
′ |
T17525 |
36330-36351 |
CD |
denotes |
TGGACAACCTCAAGGAGACC3 |
T17526 |
36351-36352 |
NN |
denotes |
′ |
T17527 |
36352-36353 |
: |
denotes |
; |
T17528 |
36354-36357 |
CC |
denotes |
and |
T17529 |
36358-36365 |
NNP |
denotes |
MHB1673 |
T17530 |
36365-36366 |
, |
denotes |
, |
T17531 |
36367-36368 |
CD |
denotes |
5 |
T17532 |
36368-36369 |
CD |
denotes |
′ |
T17533 |
36369-36390 |
NNP |
denotes |
ACCTCTGGGGTGAATTCCTT3 |
T17534 |
36390-36391 |
NN |
denotes |
′ |
T17535 |
36391-36392 |
. |
denotes |
. |
T17536 |
36393-36396 |
IN |
denotes |
For |
T17537 |
36397-36401 |
JJ |
denotes |
βmaj |
T17538 |
36401-36402 |
NN |
denotes |
/ |
T17539 |
36402-36405 |
NN |
denotes |
min |
T17540 |
36406-36412 |
NN |
denotes |
globin |
T17541 |
36412-36413 |
: |
denotes |
: |
T17542 |
36414-36421 |
NNP |
denotes |
MHB1674 |
T17543 |
36421-36422 |
: |
denotes |
: |
T17544 |
36423-36424 |
CD |
denotes |
5 |
T17545 |
36424-36425 |
CD |
denotes |
′ |
T17546 |
36425-36446 |
NNP |
denotes |
ATGGCCTGAATCACTTGGAC3 |
T17547 |
36446-36447 |
NN |
denotes |
′ |
T17548 |
36447-36448 |
: |
denotes |
; |
T17549 |
36449-36452 |
CC |
denotes |
and |
T17550 |
36453-36460 |
NNP |
denotes |
MHB1675 |
T17551 |
36460-36461 |
, |
denotes |
, |
T17552 |
36462-36463 |
CD |
denotes |
5 |
T17553 |
36463-36464 |
CD |
denotes |
′ |
T17554 |
36464-36485 |
NNP |
denotes |
ACGATCATATTGCCCAGGAG3 |
T17555 |
36485-36486 |
NN |
denotes |
′ |
T17556 |
36486-36487 |
. |
denotes |
. |
T17557 |
36488-36493 |
VBG |
denotes |
Using |
T17558 |
36494-36497 |
DT |
denotes |
the |
T17559 |
36498-36502 |
NNP |
denotes |
SYBR |
T17560 |
36503-36508 |
JJ |
denotes |
green |
T17561 |
36509-36517 |
NN |
denotes |
supermix |
T17562 |
36518-36521 |
NN |
denotes |
kit |
T17563 |
36522-36526 |
IN |
denotes |
with |
T17564 |
36527-36530 |
NNP |
denotes |
ROX |
T17565 |
36531-36532 |
-LRB- |
denotes |
( |
T17566 |
36532-36539 |
NNP |
denotes |
Bio-Rad |
T17567 |
36539-36540 |
, |
denotes |
, |
T17568 |
36541-36549 |
NNP |
denotes |
Hercules |
T17569 |
36549-36550 |
, |
denotes |
, |
T17570 |
36551-36561 |
NNP |
denotes |
California |
T17571 |
36561-36562 |
, |
denotes |
, |
T17572 |
36563-36569 |
NNP |
denotes |
United |
T17573 |
36570-36576 |
NNPS |
denotes |
States |
T17574 |
36576-36577 |
-RRB- |
denotes |
) |
T17575 |
36577-36578 |
, |
denotes |
, |
T17576 |
36579-36582 |
NNP |
denotes |
PCR |
T17577 |
36583-36596 |
NN |
denotes |
amplification |
T17578 |
36597-36600 |
VBD |
denotes |
was |
T17579 |
36601-36604 |
VBN |
denotes |
run |
T17580 |
36605-36607 |
IN |
denotes |
on |
T17581 |
36608-36610 |
DT |
denotes |
an |
T17582 |
36611-36618 |
NNP |
denotes |
ABI7000 |
T17583 |
36619-36620 |
-LRB- |
denotes |
( |
T17584 |
36620-36627 |
NNP |
denotes |
Applied |
T17585 |
36628-36638 |
NNPS |
denotes |
Biosystems |
T17586 |
36638-36639 |
, |
denotes |
, |
T17587 |
36640-36646 |
NNP |
denotes |
Foster |
T17588 |
36647-36651 |
NNP |
denotes |
City |
T17589 |
36651-36652 |
, |
denotes |
, |
T17590 |
36653-36663 |
NNP |
denotes |
California |
T17591 |
36663-36664 |
, |
denotes |
, |
T17592 |
36665-36671 |
NNP |
denotes |
United |
T17593 |
36672-36678 |
NNPS |
denotes |
States |
T17594 |
36678-36679 |
-RRB- |
denotes |
) |
T17595 |
36680-36682 |
IN |
denotes |
at |
T17596 |
36683-36686 |
DT |
denotes |
the |
T17597 |
36687-36697 |
NNP |
denotes |
University |
T17598 |
36698-36700 |
IN |
denotes |
of |
T17599 |
36701-36708 |
NNP |
denotes |
Arizona |
T17600 |
36709-36713 |
NN |
denotes |
core |
T17601 |
36714-36722 |
NN |
denotes |
facility |
T17602 |
36722-36723 |
. |
denotes |
. |
T17603 |
36724-36727 |
DT |
denotes |
All |
T17604 |
36728-36731 |
NNP |
denotes |
PCR |
T17605 |
36732-36735 |
VBD |
denotes |
was |
T17606 |
36736-36745 |
VBN |
denotes |
performed |
T17607 |
36746-36748 |
IN |
denotes |
in |
T17608 |
36749-36750 |
DT |
denotes |
a |
T17609 |
36751-36756 |
JJ |
denotes |
25-μl |
T17610 |
36757-36765 |
NN |
denotes |
reaction |
T17611 |
36766-36770 |
IN |
denotes |
with |
T17612 |
36771-36775 |
CD |
denotes |
12.5 |
T17613 |
36776-36778 |
NN |
denotes |
μl |
T17614 |
36779-36783 |
NNP |
denotes |
SYBR |
T17615 |
36784-36789 |
JJ |
denotes |
green |
T17616 |
36790-36798 |
NN |
denotes |
supermix |
T17617 |
36798-36799 |
. |
denotes |
. |
T17618 |
36800-36805 |
NNP |
denotes |
GAPDH |
T17619 |
36806-36810 |
NNP |
denotes |
mRNA |
T17620 |
36811-36817 |
NNS |
denotes |
levels |
T17621 |
36818-36822 |
VBD |
denotes |
were |
T17622 |
36823-36827 |
VBN |
denotes |
used |
T17623 |
36828-36830 |
IN |
denotes |
as |
T17624 |
36831-36838 |
NN |
denotes |
control |
T17625 |
36839-36842 |
IN |
denotes |
for |
T17626 |
36843-36848 |
NN |
denotes |
input |
T17627 |
36849-36852 |
NNP |
denotes |
RNA |
T17628 |
36852-36853 |
. |
denotes |
. |
T17629 |
36854-36862 |
NNP |
denotes |
Standard |
T17630 |
36863-36868 |
NN |
denotes |
curve |
T17631 |
36869-36877 |
NNS |
denotes |
analyses |
T17632 |
36878-36882 |
VBD |
denotes |
were |
T17633 |
36883-36892 |
VBN |
denotes |
performed |
T17634 |
36893-36895 |
TO |
denotes |
to |
T17635 |
36896-36900 |
VB |
denotes |
test |
T17636 |
36901-36904 |
DT |
denotes |
the |
T17637 |
36905-36915 |
NN |
denotes |
efficiency |
T17638 |
36916-36918 |
IN |
denotes |
of |
T17639 |
36919-36922 |
DT |
denotes |
the |
T17640 |
36923-36937 |
NNS |
denotes |
amplifications |
T17641 |
36937-36938 |
. |
denotes |
. |
T17642 |
36939-36950 |
NNS |
denotes |
Triplicates |
T17643 |
36951-36955 |
VBD |
denotes |
were |
T17644 |
36956-36960 |
VBN |
denotes |
done |
T17645 |
36961-36964 |
IN |
denotes |
for |
T17646 |
36965-36969 |
DT |
denotes |
each |
T17647 |
36970-36973 |
NNP |
denotes |
PCR |
T17648 |
36974-36982 |
NN |
denotes |
reaction |
T17649 |
36982-36983 |
. |
denotes |
. |
T17650 |
36984-36992 |
JJ |
denotes |
Relative |
T17651 |
36993-37005 |
JJ |
denotes |
quantitative |
T17652 |
37006-37012 |
NNS |
denotes |
values |
T17653 |
37013-37017 |
VBD |
denotes |
were |
T17654 |
37018-37028 |
VBN |
denotes |
calculated |
T17655 |
37029-37031 |
IN |
denotes |
in |
T17656 |
37032-37035 |
DT |
denotes |
the |
T17657 |
37036-37039 |
NNP |
denotes |
ABI |
T17658 |
37040-37045 |
NNP |
denotes |
Prism |
T17659 |
37046-37050 |
CD |
denotes |
7000 |
T17660 |
37051-37054 |
NNP |
denotes |
SDS |
T17661 |
37055-37063 |
NNP |
denotes |
Software |
T17662 |
37064-37065 |
-LRB- |
denotes |
( |
T17663 |
37065-37072 |
NNP |
denotes |
Applied |
T17664 |
37073-37083 |
NNPS |
denotes |
Biosystems |
T17665 |
37083-37084 |
-RRB- |
denotes |
) |
T17666 |
37085-37088 |
CC |
denotes |
and |
T17667 |
37089-37099 |
VBN |
denotes |
normalized |
T17668 |
37100-37102 |
TO |
denotes |
to |
T17669 |
37103-37108 |
NNP |
denotes |
GAPDH |
T17670 |
37109-37111 |
IN |
denotes |
in |
T17671 |
37112-37121 |
NNP |
denotes |
Microsoft |
T17672 |
37122-37127 |
NNP |
denotes |
Excel |
T17673 |
37128-37129 |
-LRB- |
denotes |
( |
T17674 |
37129-37136 |
NNP |
denotes |
Redmond |
T17675 |
37136-37137 |
, |
denotes |
, |
T17676 |
37138-37148 |
NNP |
denotes |
Washington |
T17677 |
37148-37149 |
, |
denotes |
, |
T17678 |
37150-37156 |
NNP |
denotes |
United |
T17679 |
37157-37163 |
NNPS |
denotes |
States |
T17680 |
37163-37164 |
-RRB- |
denotes |
) |
T17681 |
37164-37165 |
. |
denotes |
. |
T17961 |
37167-37169 |
IN |
denotes |
In |
T17962 |
37170-37174 |
NN |
denotes |
situ |
T17963 |
37175-37188 |
NN |
denotes |
hybridization |
T17964 |
37188-37189 |
. |
denotes |
. |
T17965 |
37190-37199 |
JJ |
denotes |
Antisense |
T17966 |
37200-37206 |
NNS |
denotes |
probes |
T17967 |
37207-37211 |
VBD |
denotes |
were |
T17968 |
37212-37220 |
VBN |
denotes |
designed |
T17969 |
37221-37223 |
TO |
denotes |
to |
T17970 |
37224-37230 |
VB |
denotes |
murine |
T17971 |
37231-37233 |
JJ |
denotes |
ɛy |
T17972 |
37234-37240 |
NN |
denotes |
globin |
T17973 |
37241-37252 |
NNS |
denotes |
nucleotides |
T17974 |
37253-37256 |
CD |
denotes |
509 |
T17975 |
37257-37260 |
CD |
denotes |
584 |
T17976 |
37260-37261 |
: |
denotes |
; |
T17977 |
37262-37266 |
NN |
denotes |
βmaj |
T17978 |
37267-37273 |
NN |
denotes |
globin |
T17979 |
37274-37285 |
NNS |
denotes |
nucleotides |
T17980 |
37286-37289 |
CD |
denotes |
458 |
T17981 |
37290-37293 |
CD |
denotes |
549 |
T17982 |
37293-37294 |
: |
denotes |
; |
T17983 |
37295-37298 |
CC |
denotes |
and |
T17984 |
37299-37304 |
NN |
denotes |
mouse |
T17985 |
37305-37309 |
JJ |
denotes |
Sox6 |
T17986 |
37310-37321 |
NNS |
denotes |
nucleotides |
T17987 |
37322-37326 |
CD |
denotes |
1353 |
T17988 |
37327-37331 |
CD |
denotes |
1927 |
T17989 |
37331-37332 |
. |
denotes |
. |
T17990 |
37333-37340 |
NNS |
denotes |
Embryos |
T17991 |
37341-37345 |
VBD |
denotes |
were |
T17992 |
37346-37351 |
VBN |
denotes |
fixed |
T17993 |
37352-37361 |
RB |
denotes |
overnight |
T17994 |
37362-37364 |
IN |
denotes |
by |
T17995 |
37365-37374 |
NN |
denotes |
immersion |
T17996 |
37375-37377 |
IN |
denotes |
in |
T17997 |
37378-37379 |
CD |
denotes |
4 |
T17998 |
37379-37380 |
NN |
denotes |
% |
T17999 |
37381-37397 |
NN |
denotes |
paraformaldehyde |
T18000 |
37397-37398 |
, |
denotes |
, |
T18001 |
37399-37407 |
VBN |
denotes |
embedded |
T18002 |
37408-37410 |
IN |
denotes |
in |
T18003 |
37411-37419 |
NN |
denotes |
paraffin |
T18004 |
37419-37420 |
, |
denotes |
, |
T18005 |
37421-37430 |
VBN |
denotes |
sectioned |
T18006 |
37431-37433 |
IN |
denotes |
at |
T18007 |
37434-37435 |
CD |
denotes |
5 |
T18008 |
37436-37438 |
NN |
denotes |
μm |
T18009 |
37438-37439 |
, |
denotes |
, |
T18010 |
37440-37443 |
CC |
denotes |
and |
T18011 |
37444-37451 |
VBD |
denotes |
adhered |
T18012 |
37452-37454 |
TO |
denotes |
to |
T18013 |
37455-37461 |
VB |
denotes |
charge |
T18014 |
37462-37470 |
VBN |
denotes |
modified |
T18015 |
37471-37477 |
NNS |
denotes |
slides |
T18016 |
37478-37479 |
-LRB- |
denotes |
( |
T18017 |
37479-37482 |
NNP |
denotes |
VWR |
T18018 |
37482-37483 |
, |
denotes |
, |
T18019 |
37484-37488 |
NNP |
denotes |
West |
T18020 |
37489-37496 |
NNP |
denotes |
Chester |
T18021 |
37496-37497 |
, |
denotes |
, |
T18022 |
37498-37510 |
NNP |
denotes |
Pennsylvania |
T18023 |
37510-37511 |
, |
denotes |
, |
T18024 |
37512-37518 |
NNP |
denotes |
United |
T18025 |
37519-37525 |
NNPS |
denotes |
States |
T18026 |
37525-37526 |
-RRB- |
denotes |
) |
T18027 |
37526-37527 |
. |
denotes |
. |
T18028 |
37528-37534 |
NNS |
denotes |
Slides |
T18029 |
37535-37539 |
VBD |
denotes |
were |
T18030 |
37540-37549 |
VBN |
denotes |
processed |
T18031 |
37550-37553 |
IN |
denotes |
for |
T18032 |
37554-37556 |
IN |
denotes |
in |
T18033 |
37557-37561 |
NN |
denotes |
situ |
T18034 |
37562-37575 |
NN |
denotes |
hybridization |
T18035 |
37576-37578 |
IN |
denotes |
as |
T18036 |
37579-37588 |
VBN |
denotes |
described |
T18037 |
37589-37590 |
NNP |
denotes |
[ |
T18038 |
37590-37592 |
CD |
denotes |
52 |
T18039 |
37592-37593 |
NNP |
denotes |
] |
T18040 |
37594-37599 |
VBG |
denotes |
using |
T18041 |
37600-37602 |
IN |
denotes |
in |
T18042 |
37603-37608 |
NN |
denotes |
vitro |
T18043 |
37609-37620 |
VBN |
denotes |
transcribed |
T18044 |
37621-37624 |
NNP |
denotes |
RNA |
T18045 |
37625-37631 |
NNS |
denotes |
probes |
T18046 |
37632-37639 |
VBN |
denotes |
labeled |
T18047 |
37640-37644 |
IN |
denotes |
with |
T18048 |
37645-37648 |
NNP |
denotes |
33P |
T18049 |
37648-37649 |
. |
denotes |
. |
T18050 |
37650-37659 |
NNP |
denotes |
Darkfield |
T18051 |
37660-37663 |
CC |
denotes |
and |
T18052 |
37664-37675 |
JJ |
denotes |
brightfield |
T18053 |
37676-37682 |
NNS |
denotes |
images |
T18054 |
37683-37687 |
VBD |
denotes |
were |
T18055 |
37688-37696 |
VBN |
denotes |
obtained |
T18056 |
37697-37701 |
IN |
denotes |
with |
T18057 |
37702-37703 |
DT |
denotes |
a |
T18058 |
37704-37709 |
NNP |
denotes |
Nikon |
T18059 |
37710-37718 |
NNP |
denotes |
Optiphot |
T18060 |
37719-37729 |
NN |
denotes |
microscope |
T18061 |
37730-37731 |
-LRB- |
denotes |
( |
T18062 |
37731-37736 |
NNP |
denotes |
Nikon |
T18063 |
37736-37737 |
, |
denotes |
, |
T18064 |
37738-37746 |
NNP |
denotes |
Melville |
T18065 |
37746-37747 |
, |
denotes |
, |
T18066 |
37748-37751 |
NNP |
denotes |
New |
T18067 |
37752-37756 |
NNP |
denotes |
York |
T18068 |
37756-37757 |
, |
denotes |
, |
T18069 |
37758-37764 |
NNP |
denotes |
United |
T18070 |
37765-37771 |
NNPS |
denotes |
States |
T18071 |
37771-37772 |
-RRB- |
denotes |
) |
T18072 |
37773-37776 |
CC |
denotes |
and |
T18073 |
37777-37781 |
NNP |
denotes |
SPOT |
T18074 |
37782-37791 |
JJ |
denotes |
RT-Slider |
T18075 |
37792-37799 |
JJ |
denotes |
digital |
T18076 |
37800-37806 |
NN |
denotes |
camera |
T18077 |
37807-37808 |
-LRB- |
denotes |
( |
T18078 |
37808-37818 |
NNP |
denotes |
Diagnostic |
T18079 |
37819-37830 |
NNP |
denotes |
Instruments |
T18080 |
37830-37831 |
, |
denotes |
, |
T18081 |
37832-37840 |
NNP |
denotes |
Sterling |
T18082 |
37841-37848 |
NNP |
denotes |
Heights |
T18083 |
37848-37849 |
, |
denotes |
, |
T18084 |
37850-37858 |
NNP |
denotes |
Michigan |
T18085 |
37858-37859 |
, |
denotes |
, |
T18086 |
37860-37866 |
NNP |
denotes |
United |
T18087 |
37867-37873 |
NNPS |
denotes |
States |
T18088 |
37873-37874 |
-RRB- |
denotes |
) |
T18089 |
37874-37875 |
. |
denotes |
. |
T18090 |
37876-37886 |
NNS |
denotes |
Objectives |
T18091 |
37887-37891 |
VBN |
denotes |
used |
T18092 |
37892-37896 |
VBD |
denotes |
were |
T18093 |
37897-37898 |
CD |
denotes |
1 |
T18094 |
37898-37899 |
NN |
denotes |
× |
T18095 |
37900-37901 |
-LRB- |
denotes |
( |
T18096 |
37901-37903 |
NNP |
denotes |
NA |
T18097 |
37904-37905 |
SYM |
denotes |
= |
T18098 |
37906-37910 |
CD |
denotes |
0.04 |
T18099 |
37910-37911 |
-RRB- |
denotes |
) |
T18100 |
37912-37915 |
CC |
denotes |
and |
T18101 |
37916-37918 |
CD |
denotes |
10 |
T18102 |
37918-37919 |
NN |
denotes |
× |
T18103 |
37920-37921 |
-LRB- |
denotes |
( |
T18104 |
37921-37923 |
NNP |
denotes |
NA |
T18105 |
37924-37925 |
SYM |
denotes |
= |
T18106 |
37926-37929 |
CD |
denotes |
0.5 |
T18107 |
37929-37930 |
-RRB- |
denotes |
) |
T18108 |
37930-37931 |
. |
denotes |
. |
T18109 |
37932-37938 |
NNS |
denotes |
Images |
T18110 |
37939-37943 |
VBD |
denotes |
were |
T18111 |
37944-37953 |
VBN |
denotes |
processed |
T18112 |
37953-37954 |
, |
denotes |
, |
T18113 |
37955-37968 |
VBN |
denotes |
pseudocolored |
T18114 |
37968-37969 |
, |
denotes |
, |
T18115 |
37970-37973 |
CC |
denotes |
and |
T18116 |
37974-37982 |
VBN |
denotes |
combined |
T18117 |
37983-37988 |
VBG |
denotes |
using |
T18118 |
37989-37998 |
NNP |
denotes |
Photoshop |
T18119 |
37999-38000 |
-LRB- |
denotes |
( |
T18120 |
38000-38005 |
NNP |
denotes |
Adobe |
T18121 |
38005-38006 |
, |
denotes |
, |
T18122 |
38007-38010 |
NNP |
denotes |
San |
T18123 |
38011-38015 |
NNP |
denotes |
Jose |
T18124 |
38015-38016 |
, |
denotes |
, |
T18125 |
38017-38027 |
NNP |
denotes |
California |
T18126 |
38027-38028 |
, |
denotes |
, |
T18127 |
38029-38035 |
NNP |
denotes |
United |
T18128 |
38036-38042 |
NNPS |
denotes |
States |
T18129 |
38042-38043 |
-RRB- |
denotes |
) |
T18130 |
38044-38052 |
NN |
denotes |
software |
T18131 |
38053-38057 |
IN |
denotes |
with |
T18132 |
38058-38063 |
NNP |
denotes |
Fovea |
T18133 |
38064-38067 |
FW |
denotes |
Pro |
T18134 |
38068-38069 |
-LRB- |
denotes |
( |
T18135 |
38069-38077 |
NNP |
denotes |
Reindeer |
T18136 |
38078-38086 |
NNP |
denotes |
Graphics |
T18137 |
38086-38087 |
, |
denotes |
, |
T18138 |
38088-38097 |
NNP |
denotes |
Asheville |
T18139 |
38097-38098 |
, |
denotes |
, |
T18140 |
38099-38104 |
NNP |
denotes |
North |
T18141 |
38105-38113 |
NNP |
denotes |
Carolina |
T18142 |
38113-38114 |
, |
denotes |
, |
T18143 |
38115-38121 |
NNP |
denotes |
United |
T18144 |
38122-38128 |
NNPS |
denotes |
States |
T18145 |
38128-38129 |
-RRB- |
denotes |
) |
T18146 |
38130-38137 |
NNS |
denotes |
plugins |
T18147 |
38137-38138 |
. |
denotes |
. |
T18148 |
38139-38147 |
NNP |
denotes |
Original |
T18149 |
38148-38154 |
NNS |
denotes |
images |
T18150 |
38155-38158 |
VBP |
denotes |
are |
T18151 |
38159-38168 |
JJ |
denotes |
available |
T18152 |
38168-38169 |
. |
denotes |
. |
T18304 |
38171-38180 |
NNP |
denotes |
Histology |
T18305 |
38180-38181 |
. |
denotes |
. |
T18306 |
38182-38190 |
JJ |
denotes |
18.5-dpc |
T18307 |
38191-38198 |
NNS |
denotes |
embryos |
T18308 |
38199-38203 |
VBD |
denotes |
were |
T18309 |
38204-38217 |
VBN |
denotes |
exsanguinated |
T18310 |
38218-38221 |
CC |
denotes |
and |
T18311 |
38222-38232 |
JJ |
denotes |
peripheral |
T18312 |
38233-38238 |
NN |
denotes |
blood |
T18313 |
38239-38245 |
NNS |
denotes |
smears |
T18314 |
38246-38250 |
VBD |
denotes |
were |
T18315 |
38251-38259 |
VBN |
denotes |
prepared |
T18316 |
38260-38264 |
IN |
denotes |
from |
T18317 |
38265-38269 |
DT |
denotes |
both |
T18318 |
38270-38276 |
JJ |
denotes |
mutant |
T18319 |
38277-38280 |
CC |
denotes |
and |
T18320 |
38281-38283 |
NNP |
denotes |
WT |
T18321 |
38284-38288 |
NNS |
denotes |
mice |
T18322 |
38288-38289 |
. |
denotes |
. |
T18323 |
38290-38293 |
DT |
denotes |
The |
T18324 |
38294-38300 |
NNS |
denotes |
slides |
T18325 |
38301-38305 |
VBD |
denotes |
were |
T18326 |
38306-38320 |
JJ |
denotes |
Wright-stained |
T18327 |
38321-38324 |
CC |
denotes |
and |
T18328 |
38325-38329 |
VBN |
denotes |
read |
T18329 |
38330-38332 |
IN |
denotes |
by |
T18330 |
38333-38336 |
NNP |
denotes |
DAF |
T18331 |
38336-38337 |
. |
denotes |
. |
T18332 |
38338-38341 |
IN |
denotes |
For |
T18333 |
38342-38347 |
JJ |
denotes |
whole |
T18334 |
38348-38353 |
VBP |
denotes |
mount |
T18335 |
38354-38362 |
NN |
denotes |
analysis |
T18336 |
38362-38363 |
, |
denotes |
, |
T18337 |
38364-38372 |
JJ |
denotes |
14.5-dpc |
T18338 |
38373-38375 |
NNP |
denotes |
WT |
T18339 |
38376-38379 |
CC |
denotes |
and |
T18340 |
38380-38386 |
JJ |
denotes |
mutant |
T18341 |
38387-38394 |
NNS |
denotes |
embryos |
T18342 |
38394-38395 |
, |
denotes |
, |
T18343 |
38396-38399 |
CC |
denotes |
and |
T18344 |
38400-38409 |
JJ |
denotes |
postnatal |
T18345 |
38410-38413 |
NN |
denotes |
day |
T18346 |
38414-38418 |
CD |
denotes |
10.5 |
T18347 |
38419-38423 |
NNS |
denotes |
mice |
T18348 |
38424-38428 |
VBD |
denotes |
were |
T18349 |
38429-38434 |
VBN |
denotes |
fixed |
T18350 |
38435-38437 |
IN |
denotes |
in |
T18351 |
38438-38440 |
CD |
denotes |
10 |
T18352 |
38440-38441 |
NN |
denotes |
% |
T18353 |
38442-38450 |
NN |
denotes |
formalin |
T18354 |
38450-38451 |
, |
denotes |
, |
T18355 |
38452-38469 |
JJ |
denotes |
paraffin-embedded |
T18356 |
38469-38470 |
, |
denotes |
, |
T18357 |
38471-38480 |
VBN |
denotes |
sectioned |
T18358 |
38481-38483 |
IN |
denotes |
at |
T18359 |
38484-38485 |
CD |
denotes |
5 |
T18360 |
38486-38488 |
NN |
denotes |
μm |
T18361 |
38488-38489 |
, |
denotes |
, |
T18362 |
38490-38493 |
CC |
denotes |
and |
T18363 |
38494-38501 |
VBN |
denotes |
stained |
T18364 |
38502-38506 |
IN |
denotes |
with |
T18365 |
38507-38518 |
NN |
denotes |
hematoxylin |
T18366 |
38519-38522 |
CC |
denotes |
and |
T18367 |
38523-38528 |
NN |
denotes |
eosin |
T18368 |
38528-38529 |
. |
denotes |
. |
T18369 |
38530-38535 |
NNP |
denotes |
Liver |
T18370 |
38536-38543 |
NNS |
denotes |
samples |
T18371 |
38544-38545 |
-LRB- |
denotes |
( |
T18372 |
38545-38547 |
IN |
denotes |
at |
T18373 |
38548-38552 |
CD |
denotes |
14.5 |
T18374 |
38553-38556 |
NN |
denotes |
dpc |
T18375 |
38557-38560 |
CC |
denotes |
and |
T18376 |
38561-38565 |
CD |
denotes |
18.5 |
T18377 |
38566-38569 |
NN |
denotes |
dpc |
T18378 |
38569-38570 |
-RRB- |
denotes |
) |
T18379 |
38571-38575 |
VBD |
denotes |
were |
T18380 |
38576-38584 |
VBN |
denotes |
prepared |
T18381 |
38585-38587 |
IN |
denotes |
in |
T18382 |
38588-38589 |
DT |
denotes |
a |
T18383 |
38590-38597 |
JJ |
denotes |
similar |
T18384 |
38598-38604 |
NN |
denotes |
manner |
T18385 |
38604-38605 |
. |
denotes |
. |
T18386 |
38606-38612 |
NNS |
denotes |
Images |
T18387 |
38613-38617 |
VBD |
denotes |
were |
T18388 |
38618-38626 |
VBN |
denotes |
obtained |
T18389 |
38627-38631 |
IN |
denotes |
with |
T18390 |
38632-38637 |
NNP |
denotes |
Nikon |
T18391 |
38638-38648 |
NNP |
denotes |
Labophot-2 |
T18392 |
38649-38659 |
NN |
denotes |
microscope |
T18393 |
38659-38660 |
. |
denotes |
. |
T18394 |
38661-38671 |
NNS |
denotes |
Objectives |
T18395 |
38672-38676 |
VBN |
denotes |
used |
T18396 |
38677-38681 |
VBD |
denotes |
were |
T18397 |
38682-38683 |
NNP |
denotes |
E |
T18398 |
38684-38688 |
NNP |
denotes |
Plan |
T18399 |
38689-38693 |
CD |
denotes |
40/0 |
T18400 |
38693-38696 |
CD |
denotes |
.65 |
T18401 |
38697-38702 |
CD |
denotes |
160/0 |
T18402 |
38702-38705 |
CD |
denotes |
.17 |
T18403 |
38706-38711 |
NNP |
denotes |
Nikon |
T18404 |
38712-38713 |
-LRB- |
denotes |
( |
T18405 |
38713-38715 |
CD |
denotes |
40 |
T18406 |
38715-38716 |
NN |
denotes |
× |
T18407 |
38717-38726 |
NN |
denotes |
objective |
T18408 |
38726-38727 |
-RRB- |
denotes |
) |
T18409 |
38727-38728 |
, |
denotes |
, |
T18410 |
38729-38730 |
NNP |
denotes |
E |
T18411 |
38731-38735 |
NNP |
denotes |
Plan |
T18412 |
38736-38741 |
CD |
denotes |
100/1 |
T18413 |
38741-38744 |
CD |
denotes |
.25 |
T18414 |
38745-38748 |
NN |
denotes |
oil |
T18415 |
38749-38754 |
CD |
denotes |
160/0 |
T18416 |
38754-38757 |
CD |
denotes |
.17 |
T18417 |
38758-38763 |
NNP |
denotes |
Nikon |
T18418 |
38764-38765 |
-LRB- |
denotes |
( |
T18419 |
38765-38768 |
CD |
denotes |
100 |
T18420 |
38768-38769 |
CD |
denotes |
× |
T18421 |
38770-38779 |
NN |
denotes |
objective |
T18422 |
38779-38780 |
-RRB- |
denotes |
) |
T18423 |
38780-38781 |
. |
denotes |
. |
T18424 |
38782-38785 |
DT |
denotes |
The |
T18425 |
38786-38792 |
NN |
denotes |
camera |
T18426 |
38793-38796 |
VBD |
denotes |
was |
T18427 |
38797-38798 |
DT |
denotes |
a |
T18428 |
38799-38804 |
NNP |
denotes |
Nikon |
T18429 |
38805-38812 |
NNP |
denotes |
Coolpix |
T18430 |
38813-38817 |
CD |
denotes |
4300 |
T18431 |
38817-38818 |
. |
denotes |
. |
T18432 |
38819-38827 |
NNP |
denotes |
Original |
T18433 |
38828-38834 |
NNS |
denotes |
images |
T18434 |
38835-38838 |
VBP |
denotes |
are |
T18435 |
38839-38848 |
JJ |
denotes |
available |
T18436 |
38848-38849 |
. |
denotes |
. |
T18572 |
38851-38859 |
NNP |
denotes |
Northern |
T18573 |
38860-38864 |
NN |
denotes |
blot |
T18574 |
38864-38865 |
. |
denotes |
. |
T18575 |
38866-38867 |
DT |
denotes |
A |
T18576 |
38868-38873 |
NN |
denotes |
mouse |
T18577 |
38874-38883 |
JJ |
denotes |
embryonic |
T18578 |
38884-38890 |
NN |
denotes |
tissue |
T18579 |
38891-38899 |
NNP |
denotes |
Northern |
T18580 |
38900-38904 |
NN |
denotes |
blot |
T18581 |
38905-38911 |
NN |
denotes |
filter |
T18582 |
38912-38913 |
-LRB- |
denotes |
( |
T18583 |
38913-38920 |
NNP |
denotes |
Seegene |
T18584 |
38920-38921 |
, |
denotes |
, |
T18585 |
38922-38931 |
NNP |
denotes |
Rockville |
T18586 |
38931-38932 |
, |
denotes |
, |
T18587 |
38933-38941 |
NNP |
denotes |
Maryland |
T18588 |
38941-38942 |
, |
denotes |
, |
T18589 |
38943-38949 |
NNP |
denotes |
United |
T18590 |
38950-38956 |
NNPS |
denotes |
States |
T18591 |
38956-38957 |
-RRB- |
denotes |
) |
T18592 |
38958-38961 |
VBD |
denotes |
was |
T18593 |
38962-38972 |
VBN |
denotes |
hybridized |
T18594 |
38973-38977 |
IN |
denotes |
with |
T18595 |
38978-38979 |
DT |
denotes |
a |
T18596 |
38980-38984 |
JJ |
denotes |
Sox6 |
T18597 |
38985-38990 |
NN |
denotes |
probe |
T18598 |
38991-39000 |
VBN |
denotes |
generated |
T18599 |
39001-39003 |
IN |
denotes |
by |
T18600 |
39004-39010 |
NNP |
denotes |
RT-PCR |
T18601 |
39011-39012 |
-LRB- |
denotes |
( |
T18602 |
39012-39023 |
NNS |
denotes |
nucleotides |
T18603 |
39024-39028 |
CD |
denotes |
1353 |
T18604 |
39029-39033 |
CD |
denotes |
1927 |
T18605 |
39033-39034 |
-RRB- |
denotes |
) |
T18606 |
39035-39038 |
CC |
denotes |
and |
T18607 |
39039-39046 |
VBN |
denotes |
labeled |
T18608 |
39047-39051 |
IN |
denotes |
with |
T18609 |
39052-39053 |
NNP |
denotes |
[ |
T18610 |
39053-39058 |
NNP |
denotes |
α-32P |
T18611 |
39058-39059 |
NNP |
denotes |
] |
T18612 |
39059-39063 |
NNP |
denotes |
dCTP |
T18613 |
39063-39064 |
, |
denotes |
, |
T18614 |
39065-39067 |
IN |
denotes |
by |
T18615 |
39068-39074 |
JJ |
denotes |
random |
T18616 |
39075-39081 |
NN |
denotes |
primer |
T18617 |
39082-39090 |
VBG |
denotes |
labeling |
T18618 |
39091-39092 |
-LRB- |
denotes |
( |
T18619 |
39092-39103 |
NNP |
denotes |
RediprimeII |
T18620 |
39103-39104 |
: |
denotes |
; |
T18621 |
39105-39113 |
NNP |
denotes |
Amersham |
T18622 |
39114-39125 |
NNP |
denotes |
Biosciences |
T18623 |
39125-39126 |
, |
denotes |
, |
T18624 |
39127-39142 |
NNP |
denotes |
Buckinghamshire |
T18625 |
39142-39143 |
, |
denotes |
, |
T18626 |
39144-39151 |
NNP |
denotes |
England |
T18627 |
39151-39152 |
, |
denotes |
, |
T18628 |
39153-39159 |
NNP |
denotes |
United |
T18629 |
39160-39167 |
NNP |
denotes |
Kingdom |
T18630 |
39167-39168 |
-RRB- |
denotes |
) |
T18631 |
39168-39169 |
. |
denotes |
. |
T18632 |
39170-39173 |
DT |
denotes |
The |
T18633 |
39174-39187 |
NN |
denotes |
hybridization |
T18634 |
39188-39191 |
VBD |
denotes |
was |
T18635 |
39192-39201 |
VBN |
denotes |
performed |
T18636 |
39202-39204 |
IN |
denotes |
in |
T18637 |
39205-39214 |
NN |
denotes |
phosphate |
T18638 |
39215-39223 |
VBD |
denotes |
buffered |
T18639 |
39224-39225 |
CD |
denotes |
7 |
T18640 |
39225-39226 |
NN |
denotes |
% |
T18641 |
39227-39230 |
NNP |
denotes |
SDS |
T18642 |
39231-39244 |
NN |
denotes |
hybridization |
T18643 |
39245-39253 |
NN |
denotes |
solution |
T18644 |
39253-39254 |
. |
denotes |
. |
T18645 |
39255-39260 |
NNS |
denotes |
Blots |
T18646 |
39261-39265 |
VBD |
denotes |
were |
T18647 |
39266-39272 |
VBN |
denotes |
washed |
T18648 |
39273-39277 |
IN |
denotes |
with |
T18649 |
39278-39281 |
CD |
denotes |
0.2 |
T18650 |
39281-39282 |
CD |
denotes |
× |
T18651 |
39283-39286 |
NNP |
denotes |
SSC |
T18652 |
39286-39287 |
, |
denotes |
, |
T18653 |
39288-39289 |
CD |
denotes |
1 |
T18654 |
39289-39290 |
NN |
denotes |
% |
T18655 |
39291-39294 |
NNP |
denotes |
SDS |
T18656 |
39295-39297 |
IN |
denotes |
at |
T18657 |
39298-39300 |
CD |
denotes |
60 |
T18658 |
39301-39302 |
CD |
denotes |
° |
T18659 |
39302-39303 |
NNP |
denotes |
C |
T18660 |
39304-39309 |
RB |
denotes |
prior |
T18661 |
39310-39312 |
TO |
denotes |
to |
T18662 |
39313-39321 |
NN |
denotes |
exposure |
T18663 |
39322-39324 |
TO |
denotes |
to |
T18664 |
39325-39330 |
NN |
denotes |
X-ray |
T18665 |
39331-39335 |
NN |
denotes |
film |
T18666 |
39336-39337 |
-LRB- |
denotes |
( |
T18667 |
39337-39342 |
NNP |
denotes |
Kodak |
T18668 |
39342-39343 |
, |
denotes |
, |
T18669 |
39344-39353 |
NNP |
denotes |
Rochester |
T18670 |
39353-39354 |
, |
denotes |
, |
T18671 |
39355-39358 |
NNP |
denotes |
New |
T18672 |
39359-39363 |
NNP |
denotes |
York |
T18673 |
39363-39364 |
, |
denotes |
, |
T18674 |
39365-39371 |
NNP |
denotes |
United |
T18675 |
39372-39378 |
NNPS |
denotes |
States |
T18676 |
39378-39379 |
-RRB- |
denotes |
) |
T18677 |
39380-39382 |
IN |
denotes |
at |
T18678 |
39383-39384 |
CD |
denotes |
− |
T18679 |
39384-39386 |
CD |
denotes |
80 |
T18680 |
39387-39388 |
CD |
denotes |
° |
T18681 |
39388-39389 |
NNP |
denotes |
C |
T18682 |
39390-39393 |
IN |
denotes |
for |
T18683 |
39394-39395 |
CD |
denotes |
6 |
T18684 |
39396-39398 |
NN |
denotes |
d. |
T18901 |
39400-39404 |
NNP |
denotes |
Cell |
T18902 |
39405-39412 |
NN |
denotes |
culture |
T18903 |
39413-39416 |
CC |
denotes |
and |
T18904 |
39417-39429 |
NN |
denotes |
transfection |
T18905 |
39429-39430 |
. |
denotes |
. |
T18906 |
39431-39436 |
CD |
denotes |
GM979 |
T18907 |
39437-39442 |
NNS |
denotes |
cells |
T18908 |
39443-39444 |
-LRB- |
denotes |
( |
T18909 |
39444-39451 |
NNP |
denotes |
Coriell |
T18910 |
39452-39456 |
NNP |
denotes |
Cell |
T18911 |
39457-39469 |
NNPS |
denotes |
Repositories |
T18912 |
39469-39470 |
, |
denotes |
, |
T18913 |
39471-39477 |
NNP |
denotes |
Camden |
T18914 |
39477-39478 |
, |
denotes |
, |
T18915 |
39479-39482 |
NNP |
denotes |
New |
T18916 |
39483-39489 |
NNP |
denotes |
Jersey |
T18917 |
39489-39490 |
, |
denotes |
, |
T18918 |
39491-39497 |
NNP |
denotes |
United |
T18919 |
39498-39504 |
NNPS |
denotes |
States |
T18920 |
39504-39505 |
-RRB- |
denotes |
) |
T18921 |
39506-39510 |
VBD |
denotes |
were |
T18922 |
39511-39519 |
VBN |
denotes |
cultured |
T18923 |
39520-39522 |
IN |
denotes |
in |
T18924 |
39523-39526 |
NNP |
denotes |
Ham |
T18925 |
39526-39528 |
POS |
denotes |
's |
T18926 |
39529-39532 |
CD |
denotes |
F12 |
T18927 |
39533-39537 |
IN |
denotes |
with |
T18928 |
39538-39539 |
CD |
denotes |
2 |
T18929 |
39540-39542 |
NNP |
denotes |
mM |
T18930 |
39543-39554 |
NNP |
denotes |
L-glutamine |
T18931 |
39555-39567 |
VBD |
denotes |
supplemented |
T18932 |
39568-39572 |
IN |
denotes |
with |
T18933 |
39573-39589 |
JJ |
denotes |
heat-inactivated |
T18934 |
39590-39592 |
CD |
denotes |
10 |
T18935 |
39592-39593 |
NN |
denotes |
% |
T18936 |
39594-39599 |
JJ |
denotes |
fetal |
T18937 |
39600-39604 |
NN |
denotes |
calf |
T18938 |
39605-39610 |
NN |
denotes |
serum |
T18939 |
39611-39612 |
-LRB- |
denotes |
( |
T18940 |
39612-39621 |
NNP |
denotes |
Ivitrogen |
T18941 |
39621-39622 |
, |
denotes |
, |
T18942 |
39623-39631 |
NNP |
denotes |
Carlsbad |
T18943 |
39631-39632 |
, |
denotes |
, |
T18944 |
39633-39643 |
NNP |
denotes |
California |
T18945 |
39643-39644 |
, |
denotes |
, |
T18946 |
39645-39651 |
NNP |
denotes |
United |
T18947 |
39652-39658 |
NNPS |
denotes |
States |
T18948 |
39658-39659 |
-RRB- |
denotes |
) |
T18949 |
39659-39660 |
, |
denotes |
, |
T18950 |
39661-39671 |
NN |
denotes |
penicillin |
T18951 |
39672-39673 |
-LRB- |
denotes |
( |
T18952 |
39673-39676 |
CD |
denotes |
100 |
T18953 |
39677-39685 |
NN |
denotes |
units/ml |
T18954 |
39685-39686 |
-RRB- |
denotes |
) |
T18955 |
39686-39687 |
, |
denotes |
, |
T18956 |
39688-39700 |
NNP |
denotes |
streptomycin |
T18957 |
39701-39704 |
CD |
denotes |
100 |
T18958 |
39705-39707 |
NN |
denotes |
μg |
T18959 |
39707-39708 |
NN |
denotes |
/ |
T18960 |
39708-39710 |
NN |
denotes |
ml |
T18961 |
39710-39711 |
-RRB- |
denotes |
) |
T18962 |
39711-39712 |
, |
denotes |
, |
T18963 |
39713-39716 |
CC |
denotes |
and |
T18964 |
39717-39728 |
NNP |
denotes |
L-glutamine |
T18965 |
39729-39730 |
-LRB- |
denotes |
( |
T18966 |
39730-39731 |
CD |
denotes |
2 |
T18967 |
39732-39734 |
NNP |
denotes |
mM |
T18968 |
39734-39735 |
-RRB- |
denotes |
) |
T18969 |
39735-39736 |
. |
denotes |
. |
T18970 |
39737-39740 |
NNP |
denotes |
MEL |
T18971 |
39741-39746 |
NNS |
denotes |
cells |
T18972 |
39747-39751 |
VBD |
denotes |
were |
T18973 |
39752-39760 |
VBN |
denotes |
cultured |
T18974 |
39761-39763 |
IN |
denotes |
in |
T18975 |
39764-39768 |
NNP |
denotes |
DMEM |
T18976 |
39769-39781 |
VBD |
denotes |
supplemented |
T18977 |
39782-39784 |
IN |
denotes |
as |
T18978 |
39785-39790 |
IN |
denotes |
above |
T18979 |
39791-39792 |
-LRB- |
denotes |
( |
T18980 |
39792-39799 |
IN |
denotes |
without |
T18981 |
39800-39804 |
NN |
denotes |
heat |
T18982 |
39805-39817 |
VBG |
denotes |
inactivating |
T18983 |
39818-39821 |
DT |
denotes |
the |
T18984 |
39822-39827 |
NN |
denotes |
serum |
T18985 |
39827-39828 |
-RRB- |
denotes |
) |
T18986 |
39828-39829 |
. |
denotes |
. |
T18987 |
39830-39835 |
CD |
denotes |
GM979 |
T18988 |
39836-39841 |
NNS |
denotes |
cells |
T18989 |
39842-39843 |
-LRB- |
denotes |
( |
T18990 |
39843-39844 |
CD |
denotes |
4 |
T18991 |
39845-39846 |
CD |
denotes |
× |
T18992 |
39847-39850 |
CD |
denotes |
105 |
T18993 |
39850-39851 |
-RRB- |
denotes |
) |
T18994 |
39852-39854 |
IN |
denotes |
in |
T18995 |
39855-39858 |
VB |
denotes |
log |
T18996 |
39859-39864 |
NN |
denotes |
phase |
T18997 |
39865-39867 |
IN |
denotes |
of |
T18998 |
39868-39874 |
NN |
denotes |
growth |
T18999 |
39875-39879 |
VBD |
denotes |
were |
T19000 |
39880-39891 |
VBN |
denotes |
transfected |
T19001 |
39892-39896 |
IN |
denotes |
with |
T19002 |
39897-39905 |
NNS |
denotes |
plasmids |
T19003 |
39906-39908 |
IN |
denotes |
by |
T19004 |
39909-39916 |
NNP |
denotes |
FuGENE6 |
T19005 |
39917-39918 |
-LRB- |
denotes |
( |
T19006 |
39918-39923 |
NNP |
denotes |
Roche |
T19007 |
39923-39924 |
, |
denotes |
, |
T19008 |
39925-39937 |
NNP |
denotes |
Indianapolis |
T19009 |
39937-39938 |
, |
denotes |
, |
T19010 |
39939-39946 |
NNP |
denotes |
Indiana |
T19011 |
39946-39947 |
, |
denotes |
, |
T19012 |
39948-39954 |
NNP |
denotes |
United |
T19013 |
39955-39961 |
NNPS |
denotes |
States |
T19014 |
39961-39962 |
-RRB- |
denotes |
) |
T19015 |
39962-39963 |
. |
denotes |
. |
T19016 |
39964-39969 |
NNS |
denotes |
Cells |
T19017 |
39970-39974 |
VBD |
denotes |
were |
T19018 |
39975-39986 |
VBN |
denotes |
transfected |
T19019 |
39987-39991 |
IN |
denotes |
with |
T19020 |
39992-39994 |
JJ |
denotes |
ɛy |
T19021 |
39995-40003 |
NN |
denotes |
promoter |
T19022 |
40004-40012 |
NN |
denotes |
reporter |
T19023 |
40013-40023 |
NNS |
denotes |
constructs |
T19024 |
40024-40025 |
-LRB- |
denotes |
( |
T19025 |
40025-40028 |
CD |
denotes |
500 |
T19026 |
40029-40031 |
NN |
denotes |
ng |
T19027 |
40031-40032 |
-RRB- |
denotes |
) |
T19028 |
40033-40038 |
IN |
denotes |
along |
T19029 |
40039-40043 |
IN |
denotes |
with |
T19030 |
40044-40050 |
DT |
denotes |
either |
T19031 |
40051-40056 |
JJ |
denotes |
empty |
T19032 |
40057-40063 |
NN |
denotes |
vector |
T19033 |
40064-40066 |
CC |
denotes |
or |
T19034 |
40067-40071 |
JJ |
denotes |
Sox6 |
T19035 |
40072-40086 |
NN |
denotes |
overexpression |
T19036 |
40087-40093 |
NN |
denotes |
vector |
T19037 |
40094-40095 |
-LRB- |
denotes |
( |
T19038 |
40095-40099 |
CD |
denotes |
1000 |
T19039 |
40100-40102 |
NN |
denotes |
ng |
T19040 |
40102-40103 |
-RRB- |
denotes |
) |
T19041 |
40103-40104 |
. |
denotes |
. |
T19042 |
40105-40107 |
IN |
denotes |
In |
T19043 |
40108-40114 |
NNS |
denotes |
assays |
T19044 |
40115-40117 |
IN |
denotes |
of |
T19045 |
40118-40124 |
NN |
denotes |
dosage |
T19046 |
40125-40131 |
NN |
denotes |
effect |
T19047 |
40131-40132 |
, |
denotes |
, |
T19048 |
40133-40135 |
PRP |
denotes |
we |
T19049 |
40136-40140 |
VBD |
denotes |
used |
T19050 |
40141-40144 |
CD |
denotes |
200 |
T19051 |
40145-40147 |
NN |
denotes |
ng |
T19052 |
40147-40148 |
, |
denotes |
, |
T19053 |
40149-40152 |
CD |
denotes |
500 |
T19054 |
40153-40155 |
NN |
denotes |
ng |
T19055 |
40155-40156 |
, |
denotes |
, |
T19056 |
40157-40160 |
CC |
denotes |
and |
T19057 |
40161-40165 |
CD |
denotes |
1000 |
T19058 |
40166-40168 |
NN |
denotes |
ng |
T19059 |
40168-40169 |
-RRB- |
denotes |
) |
T19060 |
40169-40170 |
. |
denotes |
. |
T19061 |
40171-40178 |
JJ |
denotes |
pRL-CMV |
T19062 |
40179-40183 |
JJ |
denotes |
15ng |
T19063 |
40184-40185 |
-LRB- |
denotes |
( |
T19064 |
40185-40192 |
NNP |
denotes |
Promega |
T19065 |
40192-40193 |
-RRB- |
denotes |
) |
T19066 |
40194-40197 |
VBD |
denotes |
was |
T19067 |
40198-40202 |
VBN |
denotes |
used |
T19068 |
40203-40205 |
IN |
denotes |
as |
T19069 |
40206-40207 |
DT |
denotes |
a |
T19070 |
40208-40215 |
NN |
denotes |
control |
T19071 |
40216-40219 |
IN |
denotes |
for |
T19072 |
40220-40232 |
NN |
denotes |
transfection |
T19073 |
40233-40243 |
NN |
denotes |
efficiency |
T19074 |
40243-40244 |
. |
denotes |
. |
T19267 |
40246-40253 |
NNP |
denotes |
Nuclear |
T19268 |
40254-40261 |
NN |
denotes |
protein |
T19269 |
40262-40269 |
VB |
denotes |
extract |
T19270 |
40270-40273 |
CC |
denotes |
and |
T19271 |
40274-40276 |
IN |
denotes |
in |
T19272 |
40277-40282 |
NN |
denotes |
vitro |
T19273 |
40283-40294 |
NN |
denotes |
translation |
T19274 |
40295-40297 |
IN |
denotes |
of |
T19275 |
40298-40302 |
NNP |
denotes |
Sox6 |
T19276 |
40302-40303 |
. |
denotes |
. |
T19277 |
40304-40311 |
NNP |
denotes |
Nuclear |
T19278 |
40312-40320 |
NNS |
denotes |
extracts |
T19279 |
40321-40325 |
VBD |
denotes |
were |
T19280 |
40326-40334 |
VBN |
denotes |
prepared |
T19281 |
40335-40339 |
IN |
denotes |
from |
T19282 |
40340-40343 |
NNP |
denotes |
MEL |
T19283 |
40344-40349 |
NNS |
denotes |
cells |
T19284 |
40350-40351 |
-LRB- |
denotes |
( |
T19285 |
40351-40352 |
CD |
denotes |
2 |
T19286 |
40353-40354 |
CD |
denotes |
× |
T19287 |
40355-40358 |
CD |
denotes |
107 |
T19288 |
40358-40359 |
-RRB- |
denotes |
) |
T19289 |
40360-40365 |
VBG |
denotes |
using |
T19290 |
40366-40367 |
DT |
denotes |
a |
T19291 |
40368-40371 |
NN |
denotes |
kit |
T19292 |
40372-40373 |
-LRB- |
denotes |
( |
T19293 |
40373-40379 |
JJ |
denotes |
Active |
T19294 |
40380-40385 |
NN |
denotes |
Motif |
T19295 |
40385-40386 |
, |
denotes |
, |
T19296 |
40387-40395 |
NNP |
denotes |
Carlsbad |
T19297 |
40395-40396 |
, |
denotes |
, |
T19298 |
40397-40407 |
NNP |
denotes |
California |
T19299 |
40407-40408 |
, |
denotes |
, |
T19300 |
40409-40415 |
NNP |
denotes |
United |
T19301 |
40416-40422 |
NNPS |
denotes |
States |
T19302 |
40422-40423 |
-RRB- |
denotes |
) |
T19303 |
40423-40424 |
. |
denotes |
. |
T19304 |
40425-40428 |
DT |
denotes |
The |
T19305 |
40429-40433 |
NNP |
denotes |
Sox6 |
T19306 |
40434-40436 |
IN |
denotes |
in |
T19307 |
40437-40442 |
NN |
denotes |
vitro |
T19308 |
40443-40454 |
NN |
denotes |
translation |
T19309 |
40455-40465 |
NN |
denotes |
expression |
T19310 |
40466-40472 |
NN |
denotes |
vector |
T19311 |
40472-40473 |
, |
denotes |
, |
T19312 |
40474-40480 |
VBN |
denotes |
tagged |
T19313 |
40481-40485 |
IN |
denotes |
with |
T19314 |
40486-40491 |
JJ |
denotes |
c-Myc |
T19315 |
40492-40495 |
CC |
denotes |
and |
T19316 |
40496-40498 |
NNP |
denotes |
HA |
T19317 |
40498-40499 |
, |
denotes |
, |
T19318 |
40500-40503 |
VBD |
denotes |
was |
T19319 |
40504-40513 |
VBN |
denotes |
described |
T19320 |
40514-40520 |
IN |
denotes |
before |
T19321 |
40521-40522 |
NNP |
denotes |
[ |
T19322 |
40522-40524 |
CD |
denotes |
15 |
T19323 |
40524-40525 |
NNP |
denotes |
] |
T19324 |
40525-40526 |
. |
denotes |
. |
T19325 |
40527-40530 |
DT |
denotes |
The |
T19326 |
40531-40542 |
NN |
denotes |
translation |
T19327 |
40543-40546 |
VBD |
denotes |
was |
T19328 |
40547-40556 |
VBN |
denotes |
performed |
T19329 |
40557-40559 |
IN |
denotes |
in |
T19330 |
40560-40561 |
DT |
denotes |
a |
T19331 |
40562-40574 |
NN |
denotes |
reticulocyte |
T19332 |
40575-40581 |
NN |
denotes |
lysate |
T19333 |
40582-40587 |
VBN |
denotes |
based |
T19334 |
40588-40590 |
IN |
denotes |
in |
T19335 |
40591-40596 |
NN |
denotes |
vitro |
T19336 |
40597-40610 |
JJ |
denotes |
translational |
T19337 |
40611-40617 |
NN |
denotes |
system |
T19338 |
40618-40619 |
-LRB- |
denotes |
( |
T19339 |
40619-40622 |
NNP |
denotes |
TNT |
T19340 |
40622-40623 |
CD |
denotes |
® |
T19341 |
40624-40629 |
NNP |
denotes |
Quick |
T19342 |
40630-40637 |
NNP |
denotes |
Coupled |
T19343 |
40638-40663 |
NNP |
denotes |
Transcription/Translation |
T19344 |
40664-40671 |
NNPS |
denotes |
Systems |
T19345 |
40671-40672 |
, |
denotes |
, |
T19346 |
40673-40680 |
NNP |
denotes |
Promega |
T19347 |
40680-40681 |
-RRB- |
denotes |
) |
T19348 |
40681-40682 |
. |
denotes |
. |
T19349 |
40683-40684 |
DT |
denotes |
A |
T19350 |
40685-40691 |
NN |
denotes |
vector |
T19351 |
40692-40699 |
IN |
denotes |
without |
T19352 |
40700-40703 |
DT |
denotes |
the |
T19353 |
40704-40708 |
JJ |
denotes |
Sox6 |
T19354 |
40709-40715 |
NN |
denotes |
coding |
T19355 |
40716-40724 |
NN |
denotes |
sequence |
T19356 |
40725-40728 |
VBD |
denotes |
was |
T19357 |
40729-40733 |
RB |
denotes |
also |
T19358 |
40734-40744 |
VBN |
denotes |
translated |
T19359 |
40745-40747 |
IN |
denotes |
as |
T19360 |
40748-40749 |
DT |
denotes |
a |
T19361 |
40750-40758 |
JJ |
denotes |
negative |
T19362 |
40759-40766 |
NN |
denotes |
control |
T19363 |
40766-40767 |
. |
denotes |
. |
T19522 |
40769-40779 |
NNS |
denotes |
Antibodies |
T19523 |
40779-40780 |
. |
denotes |
. |
T19524 |
40781-40785 |
JJ |
denotes |
Sox6 |
T19525 |
40786-40796 |
NNS |
denotes |
antibodies |
T19526 |
40797-40801 |
VBN |
denotes |
used |
T19527 |
40802-40804 |
IN |
denotes |
in |
T19528 |
40805-40809 |
DT |
denotes |
this |
T19529 |
40810-40815 |
NN |
denotes |
study |
T19530 |
40816-40820 |
VBD |
denotes |
were |
T19531 |
40821-40827 |
RB |
denotes |
either |
T19532 |
40828-40834 |
RB |
denotes |
kindly |
T19533 |
40835-40843 |
VBN |
denotes |
provided |
T19534 |
40844-40846 |
IN |
denotes |
by |
T19535 |
40847-40850 |
NNP |
denotes |
Dr. |
T19536 |
40851-40855 |
NNP |
denotes |
Enzo |
T19537 |
40856-40861 |
NNP |
denotes |
Lalli |
T19538 |
40862-40863 |
-LRB- |
denotes |
( |
T19539 |
40863-40873 |
NNP |
denotes |
Université |
T19540 |
40874-40879 |
NNP |
denotes |
Louis |
T19541 |
40880-40887 |
NNP |
denotes |
Pasteur |
T19542 |
40887-40888 |
, |
denotes |
, |
T19543 |
40889-40895 |
NNP |
denotes |
France |
T19544 |
40896-40897 |
NNP |
denotes |
[ |
T19545 |
40897-40898 |
CD |
denotes |
7 |
T19546 |
40898-40899 |
NNP |
denotes |
] |
T19547 |
40899-40900 |
-RRB- |
denotes |
) |
T19548 |
40901-40903 |
CC |
denotes |
or |
T19549 |
40904-40916 |
RB |
denotes |
commercially |
T19550 |
40917-40925 |
VBN |
denotes |
obtained |
T19551 |
40926-40927 |
-LRB- |
denotes |
( |
T19552 |
40927-40934 |
NN |
denotes |
Catalog |
T19553 |
40935-40937 |
UH |
denotes |
No |
T19554 |
40937-40938 |
. |
denotes |
. |
T19555 |
40939-40947 |
JJ |
denotes |
sc-17332 |
T19556 |
40948-40949 |
NNP |
denotes |
X |
T19557 |
40949-40950 |
, |
denotes |
, |
T19558 |
40951-40956 |
NNP |
denotes |
Santa |
T19559 |
40957-40961 |
NNP |
denotes |
Cruz |
T19560 |
40962-40975 |
NNP |
denotes |
Biotechnology |
T19561 |
40975-40976 |
, |
denotes |
, |
T19562 |
40977-40982 |
NNP |
denotes |
Santa |
T19563 |
40983-40987 |
NNP |
denotes |
Cruz |
T19564 |
40987-40988 |
, |
denotes |
, |
T19565 |
40989-40999 |
NNP |
denotes |
California |
T19566 |
40999-41000 |
, |
denotes |
, |
T19567 |
41001-41007 |
NNP |
denotes |
United |
T19568 |
41008-41014 |
NNPS |
denotes |
States |
T19569 |
41014-41015 |
-RRB- |
denotes |
) |
T19570 |
41015-41016 |
. |
denotes |
. |
T19571 |
41017-41020 |
DT |
denotes |
All |
T19572 |
41021-41025 |
JJ |
denotes |
Sox6 |
T19573 |
41026-41036 |
NNS |
denotes |
antibodies |
T19574 |
41037-41046 |
VBD |
denotes |
generated |
T19575 |
41047-41054 |
JJ |
denotes |
similar |
T19576 |
41055-41062 |
NNS |
denotes |
results |
T19577 |
41062-41063 |
. |
denotes |
. |
T19578 |
41064-41069 |
JJ |
denotes |
c-Myc |
T19579 |
41070-41078 |
NN |
denotes |
antibody |
T19580 |
41079-41082 |
VBD |
denotes |
was |
T19581 |
41083-41092 |
VBN |
denotes |
purchased |
T19582 |
41093-41097 |
IN |
denotes |
from |
T19583 |
41098-41108 |
NNP |
denotes |
Invitrogen |
T19584 |
41108-41109 |
. |
denotes |
. |
T19585 |
41110-41116 |
JJ |
denotes |
Normal |
T19586 |
41117-41123 |
NN |
denotes |
rabbit |
T19587 |
41124-41127 |
NNP |
denotes |
IgG |
T19588 |
41128-41136 |
NN |
denotes |
antibody |
T19589 |
41137-41140 |
VBD |
denotes |
was |
T19590 |
41141-41149 |
VBN |
denotes |
obtained |
T19591 |
41150-41154 |
IN |
denotes |
from |
T19592 |
41155-41162 |
NNP |
denotes |
Upstate |
T19593 |
41163-41176 |
NNP |
denotes |
Biotechnology |
T19594 |
41177-41178 |
-LRB- |
denotes |
( |
T19595 |
41178-41182 |
NNP |
denotes |
Lake |
T19596 |
41183-41189 |
NNP |
denotes |
Placid |
T19597 |
41189-41190 |
, |
denotes |
, |
T19598 |
41191-41194 |
NNP |
denotes |
New |
T19599 |
41195-41199 |
NNP |
denotes |
York |
T19600 |
41199-41200 |
, |
denotes |
, |
T19601 |
41201-41207 |
NNP |
denotes |
United |
T19602 |
41208-41214 |
NNPS |
denotes |
States |
T19603 |
41214-41215 |
-RRB- |
denotes |
) |
T19604 |
41215-41216 |
. |
denotes |
. |
T19985 |
41218-41222 |
NNP |
denotes |
EMSA |
T19986 |
41222-41223 |
. |
denotes |
. |
T19987 |
41224-41239 |
JJ |
denotes |
Single-stranded |
T19988 |
41240-41253 |
JJ |
denotes |
complementary |
T19989 |
41254-41270 |
NNS |
denotes |
oligonucleotides |
T19990 |
41271-41275 |
VBD |
denotes |
were |
T19991 |
41276-41284 |
JJ |
denotes |
annealed |
T19992 |
41285-41288 |
CC |
denotes |
and |
T19993 |
41289-41300 |
JJ |
denotes |
end-labeled |
T19994 |
41301-41305 |
IN |
denotes |
with |
T19995 |
41306-41307 |
NNP |
denotes |
[ |
T19996 |
41307-41312 |
NNP |
denotes |
γ-32P |
T19997 |
41312-41313 |
NNP |
denotes |
] |
T19998 |
41314-41317 |
NNP |
denotes |
ATP |
T19999 |
41318-41322 |
IN |
denotes |
with |
T20000 |
41323-41325 |
CD |
denotes |
T4 |
T20001 |
41326-41340 |
NN |
denotes |
polynucleotide |
T20002 |
41341-41347 |
NN |
denotes |
kinase |
T20003 |
41347-41348 |
. |
denotes |
. |
T20004 |
41349-41353 |
NNP |
denotes |
EMSA |
T20005 |
41354-41357 |
VBD |
denotes |
was |
T20006 |
41358-41367 |
VBN |
denotes |
performed |
T20007 |
41368-41372 |
IN |
denotes |
with |
T20008 |
41373-41374 |
CD |
denotes |
5 |
T20009 |
41375-41377 |
NN |
denotes |
μg |
T20010 |
41378-41380 |
IN |
denotes |
of |
T20011 |
41381-41388 |
JJ |
denotes |
nuclear |
T20012 |
41389-41397 |
NNS |
denotes |
proteins |
T20013 |
41398-41402 |
IN |
denotes |
from |
T20014 |
41403-41406 |
NNP |
denotes |
MEL |
T20015 |
41407-41412 |
NNS |
denotes |
cells |
T20016 |
41413-41415 |
CC |
denotes |
or |
T20017 |
41416-41417 |
CD |
denotes |
3 |
T20018 |
41418-41420 |
NN |
denotes |
μl |
T20019 |
41421-41423 |
IN |
denotes |
of |
T20020 |
41424-41426 |
IN |
denotes |
in |
T20021 |
41427-41443 |
JJ |
denotes |
vitro-translated |
T20022 |
41444-41448 |
NNS |
denotes |
Sox6 |
T20023 |
41449-41454 |
IN |
denotes |
along |
T20024 |
41455-41459 |
IN |
denotes |
with |
T20025 |
41460-41463 |
DT |
denotes |
the |
T20026 |
41464-41476 |
NN |
denotes |
reticulocyte |
T20027 |
41477-41483 |
NN |
denotes |
lysate |
T20028 |
41484-41486 |
IN |
denotes |
in |
T20029 |
41487-41494 |
JJ |
denotes |
binding |
T20030 |
41495-41501 |
NN |
denotes |
buffer |
T20031 |
41501-41502 |
: |
denotes |
: |
T20032 |
41503-41506 |
CD |
denotes |
100 |
T20033 |
41507-41509 |
NNP |
denotes |
mM |
T20034 |
41510-41514 |
NNP |
denotes |
NaCl |
T20035 |
41514-41515 |
, |
denotes |
, |
T20036 |
41516-41518 |
CD |
denotes |
10 |
T20037 |
41518-41519 |
NN |
denotes |
% |
T20038 |
41520-41528 |
NN |
denotes |
glycerol |
T20039 |
41528-41529 |
, |
denotes |
, |
T20040 |
41530-41533 |
CD |
denotes |
200 |
T20041 |
41534-41536 |
NN |
denotes |
ng |
T20042 |
41536-41537 |
NN |
denotes |
/ |
T20043 |
41537-41539 |
NN |
denotes |
μl |
T20044 |
41540-41543 |
NNP |
denotes |
BSA |
T20045 |
41543-41544 |
, |
denotes |
, |
T20046 |
41545-41547 |
CD |
denotes |
50 |
T20047 |
41548-41550 |
NN |
denotes |
ng |
T20048 |
41550-41551 |
NN |
denotes |
/ |
T20049 |
41551-41553 |
NN |
denotes |
μl |
T20050 |
41554-41558 |
NN |
denotes |
poly |
T20051 |
41559-41560 |
-LRB- |
denotes |
( |
T20052 |
41560-41565 |
JJ |
denotes |
dI-dC |
T20053 |
41565-41566 |
-RRB- |
denotes |
) |
T20054 |
41567-41569 |
CC |
denotes |
or |
T20055 |
41570-41574 |
NN |
denotes |
poly |
T20056 |
41575-41576 |
-LRB- |
denotes |
( |
T20057 |
41576-41581 |
JJ |
denotes |
dG-dC |
T20058 |
41581-41582 |
-RRB- |
denotes |
) |
T20059 |
41582-41583 |
, |
denotes |
, |
T20060 |
41584-41586 |
CD |
denotes |
10 |
T20061 |
41587-41589 |
NN |
denotes |
mM |
T20062 |
41590-41595 |
NNS |
denotes |
HEPES |
T20063 |
41596-41597 |
-LRB- |
denotes |
( |
T20064 |
41597-41599 |
NN |
denotes |
pH |
T20065 |
41600-41601 |
CD |
denotes |
7 |
T20066 |
41601-41602 |
-RRB- |
denotes |
) |
T20067 |
41602-41603 |
, |
denotes |
, |
T20068 |
41604-41607 |
CD |
denotes |
0.1 |
T20069 |
41608-41610 |
NNP |
denotes |
mM |
T20070 |
41611-41615 |
NNP |
denotes |
EDTA |
T20071 |
41615-41616 |
, |
denotes |
, |
T20072 |
41617-41621 |
CD |
denotes |
0.25 |
T20073 |
41622-41624 |
NNP |
denotes |
mM |
T20074 |
41625-41628 |
NNP |
denotes |
DTT |
T20075 |
41628-41629 |
, |
denotes |
, |
T20076 |
41630-41633 |
CD |
denotes |
0.6 |
T20077 |
41634-41636 |
NNP |
denotes |
mM |
T20078 |
41637-41642 |
NNP |
denotes |
MgCl2 |
T20079 |
41642-41643 |
. |
denotes |
. |
T20080 |
41644-41647 |
IN |
denotes |
For |
T20081 |
41648-41659 |
NN |
denotes |
competition |
T20082 |
41660-41662 |
CC |
denotes |
or |
T20083 |
41663-41673 |
NN |
denotes |
supershift |
T20084 |
41674-41680 |
NNS |
denotes |
assays |
T20085 |
41680-41681 |
, |
denotes |
, |
T20086 |
41682-41685 |
DT |
denotes |
the |
T20087 |
41686-41695 |
VBN |
denotes |
indicated |
T20088 |
41696-41706 |
JJ |
denotes |
unlabelled |
T20089 |
41707-41722 |
NN |
denotes |
oligonucleotide |
T20090 |
41723-41733 |
NN |
denotes |
competitor |
T20091 |
41734-41735 |
-LRB- |
denotes |
( |
T20092 |
41735-41743 |
JJ |
denotes |
200-fold |
T20093 |
41744-41749 |
NN |
denotes |
molar |
T20094 |
41750-41756 |
NN |
denotes |
excess |
T20095 |
41756-41757 |
-RRB- |
denotes |
) |
T20096 |
41758-41760 |
CC |
denotes |
or |
T20097 |
41761-41769 |
NN |
denotes |
antibody |
T20098 |
41770-41771 |
-LRB- |
denotes |
( |
T20099 |
41771-41772 |
CD |
denotes |
3 |
T20100 |
41773-41775 |
NN |
denotes |
μl |
T20101 |
41775-41776 |
-RRB- |
denotes |
) |
T20102 |
41777-41780 |
VBD |
denotes |
was |
T20103 |
41781-41786 |
VBN |
denotes |
added |
T20104 |
41787-41789 |
CD |
denotes |
30 |
T20105 |
41790-41793 |
NN |
denotes |
min |
T20106 |
41794-41796 |
TO |
denotes |
to |
T20107 |
41797-41799 |
CD |
denotes |
60 |
T20108 |
41800-41803 |
NN |
denotes |
min |
T20109 |
41804-41809 |
RB |
denotes |
prior |
T20110 |
41810-41812 |
TO |
denotes |
to |
T20111 |
41813-41821 |
NN |
denotes |
addition |
T20112 |
41822-41824 |
IN |
denotes |
of |
T20113 |
41825-41837 |
JJ |
denotes |
radiolabeled |
T20114 |
41838-41843 |
NN |
denotes |
probe |
T20115 |
41843-41844 |
. |
denotes |
. |
T20116 |
41845-41854 |
VBG |
denotes |
Following |
T20117 |
41855-41863 |
NN |
denotes |
addition |
T20118 |
41864-41866 |
IN |
denotes |
of |
T20119 |
41867-41870 |
DT |
denotes |
the |
T20120 |
41871-41883 |
JJ |
denotes |
radiolabeled |
T20121 |
41884-41889 |
NN |
denotes |
probe |
T20122 |
41889-41890 |
, |
denotes |
, |
T20123 |
41891-41894 |
DT |
denotes |
the |
T20124 |
41895-41902 |
NNS |
denotes |
samples |
T20125 |
41903-41907 |
VBD |
denotes |
were |
T20126 |
41908-41917 |
VBN |
denotes |
incubated |
T20127 |
41918-41921 |
IN |
denotes |
for |
T20128 |
41922-41924 |
CD |
denotes |
30 |
T20129 |
41925-41928 |
NN |
denotes |
min |
T20130 |
41929-41931 |
CC |
denotes |
or |
T20131 |
41932-41934 |
CD |
denotes |
60 |
T20132 |
41935-41938 |
NN |
denotes |
min |
T20133 |
41939-41941 |
IN |
denotes |
at |
T20134 |
41942-41946 |
NN |
denotes |
room |
T20135 |
41947-41958 |
NN |
denotes |
temperature |
T20136 |
41959-41962 |
CC |
denotes |
and |
T20137 |
41963-41969 |
VBN |
denotes |
loaded |
T20138 |
41970-41972 |
IN |
denotes |
on |
T20139 |
41973-41974 |
DT |
denotes |
a |
T20140 |
41975-41976 |
CD |
denotes |
4 |
T20141 |
41976-41977 |
NN |
denotes |
% |
T20142 |
41978-41980 |
CC |
denotes |
or |
T20143 |
41981-41982 |
CD |
denotes |
6 |
T20144 |
41982-41983 |
NN |
denotes |
% |
T20145 |
41984-41985 |
-LRB- |
denotes |
( |
T20146 |
41985-41988 |
FW |
denotes |
w/v |
T20147 |
41988-41989 |
-RRB- |
denotes |
) |
T20148 |
41990-42004 |
NN |
denotes |
polyacrylamide |
T20149 |
42005-42008 |
NN |
denotes |
gel |
T20150 |
42008-42009 |
. |
denotes |
. |
T20151 |
42010-42025 |
NNP |
denotes |
Electrophoresis |
T20152 |
42026-42029 |
VBD |
denotes |
was |
T20153 |
42030-42039 |
VBN |
denotes |
performed |
T20154 |
42040-42042 |
IN |
denotes |
at |
T20155 |
42043-42044 |
DT |
denotes |
a |
T20156 |
42045-42053 |
JJ |
denotes |
constant |
T20157 |
42054-42056 |
CD |
denotes |
19 |
T20158 |
42057-42061 |
NN |
denotes |
mAmp |
T20159 |
42062-42065 |
IN |
denotes |
for |
T20160 |
42066-42067 |
CD |
denotes |
4 |
T20161 |
42068-42069 |
CD |
denotes |
8 |
T20162 |
42070-42071 |
NN |
denotes |
h |
T20163 |
42072-42074 |
IN |
denotes |
at |
T20164 |
42075-42079 |
NN |
denotes |
room |
T20165 |
42080-42091 |
NN |
denotes |
temperature |
T20166 |
42091-42092 |
, |
denotes |
, |
T20167 |
42093-42096 |
CC |
denotes |
and |
T20168 |
42097-42100 |
DT |
denotes |
the |
T20169 |
42101-42105 |
NNS |
denotes |
gels |
T20170 |
42106-42110 |
VBD |
denotes |
were |
T20171 |
42111-42116 |
VBN |
denotes |
dried |
T20172 |
42117-42122 |
RB |
denotes |
prior |
T20173 |
42123-42125 |
TO |
denotes |
to |
T20174 |
42126-42141 |
NN |
denotes |
autoradiography |
T20175 |
42141-42142 |
. |
denotes |
. |
T20176 |
42143-42153 |
NNS |
denotes |
Antibodies |
T20177 |
42154-42158 |
VBD |
denotes |
used |
T20178 |
42159-42162 |
IN |
denotes |
for |
T20179 |
42163-42173 |
NN |
denotes |
supershift |
T20180 |
42174-42182 |
NNS |
denotes |
analyses |
T20181 |
42183-42191 |
VBD |
denotes |
included |
T20182 |
42192-42197 |
NNP |
denotes |
c-Myc |
T20183 |
42197-42198 |
, |
denotes |
, |
T20184 |
42199-42201 |
NNP |
denotes |
HA |
T20185 |
42201-42202 |
, |
denotes |
, |
T20186 |
42203-42206 |
CC |
denotes |
and |
T20187 |
42207-42211 |
NNP |
denotes |
Sox6 |
T20188 |
42212-42222 |
NNS |
denotes |
antibodies |
T20189 |
42223-42224 |
-LRB- |
denotes |
( |
T20190 |
42224-42233 |
VBN |
denotes |
described |
T20191 |
42234-42236 |
RB |
denotes |
as |
T20192 |
42237-42242 |
IN |
denotes |
above |
T20193 |
42242-42243 |
-RRB- |
denotes |
) |
T20194 |
42243-42244 |
. |
denotes |
. |
T20195 |
42245-42248 |
DT |
denotes |
The |
T20196 |
42249-42252 |
NNP |
denotes |
DNA |
T20197 |
42253-42262 |
NNS |
denotes |
sequences |
T20198 |
42263-42265 |
IN |
denotes |
of |
T20199 |
42266-42269 |
DT |
denotes |
the |
T20200 |
42270-42286 |
NNS |
denotes |
oligonucleotides |
T20201 |
42287-42290 |
VBP |
denotes |
are |
T20202 |
42291-42293 |
IN |
denotes |
as |
T20203 |
42294-42301 |
VBZ |
denotes |
follows |
T20204 |
42302-42303 |
-LRB- |
denotes |
( |
T20205 |
42303-42307 |
RB |
denotes |
only |
T20206 |
42308-42315 |
RB |
denotes |
forward |
T20207 |
42316-42322 |
NNS |
denotes |
oligos |
T20208 |
42323-42326 |
VBP |
denotes |
are |
T20209 |
42327-42333 |
VBN |
denotes |
listed |
T20210 |
42333-42334 |
-RRB- |
denotes |
) |
T20211 |
42334-42335 |
: |
denotes |
: |
T20212 |
42336-42339 |
IN |
denotes |
For |
T20213 |
42340-42343 |
DT |
denotes |
the |
T20214 |
42344-42349 |
JJ |
denotes |
36-bp |
T20215 |
42350-42352 |
NNP |
denotes |
WT |
T20216 |
42353-42358 |
NN |
denotes |
probe |
T20217 |
42358-42359 |
: |
denotes |
: |
T20218 |
42360-42361 |
CD |
denotes |
5 |
T20219 |
42361-42362 |
CD |
denotes |
′ |
T20220 |
42362-42399 |
NNP |
denotes |
AATGCAGAACAAAGGGTCAGAACATTGTCTGCGAAG3 |
T20221 |
42399-42400 |
NNP |
denotes |
′ |
T20222 |
42401-42402 |
-LRB- |
denotes |
( |
T20223 |
42402-42409 |
NNP |
denotes |
MHB1556 |
T20224 |
42409-42410 |
-RRB- |
denotes |
) |
T20225 |
42410-42411 |
: |
denotes |
; |
T20226 |
42412-42415 |
IN |
denotes |
for |
T20227 |
42416-42422 |
JJ |
denotes |
mutant |
T20228 |
42423-42428 |
NN |
denotes |
probe |
T20229 |
42429-42430 |
CD |
denotes |
1 |
T20230 |
42431-42432 |
-LRB- |
denotes |
( |
T20231 |
42432-42434 |
NN |
denotes |
M1 |
T20232 |
42434-42435 |
-RRB- |
denotes |
) |
T20233 |
42435-42436 |
: |
denotes |
: |
T20234 |
42437-42438 |
CD |
denotes |
5 |
T20235 |
42438-42439 |
CD |
denotes |
′ |
T20236 |
42439-42469 |
NNP |
denotes |
AACAAAGGGTCAGAACATTGTCTGCGAAG3 |
T20237 |
42469-42470 |
NNP |
denotes |
′ |
T20238 |
42471-42472 |
-LRB- |
denotes |
( |
T20239 |
42472-42479 |
NNP |
denotes |
MHB1644 |
T20240 |
42479-42480 |
-RRB- |
denotes |
) |
T20241 |
42480-42481 |
: |
denotes |
; |
T20242 |
42482-42485 |
IN |
denotes |
for |
T20243 |
42486-42492 |
JJ |
denotes |
mutant |
T20244 |
42493-42498 |
NN |
denotes |
probe |
T20245 |
42499-42500 |
CD |
denotes |
2 |
T20246 |
42501-42502 |
-LRB- |
denotes |
( |
T20247 |
42502-42504 |
NN |
denotes |
M2 |
T20248 |
42504-42505 |
-RRB- |
denotes |
) |
T20249 |
42505-42506 |
: |
denotes |
: |
T20250 |
42507-42508 |
CD |
denotes |
5 |
T20251 |
42508-42509 |
NN |
denotes |
′ |
T20252 |
42509-42546 |
NNP |
denotes |
AATGCAGAACAAAGGGTCAGAtgagTGTCTGCGAAG3 |
T20253 |
42546-42547 |
NNP |
denotes |
′ |
T20254 |
42548-42549 |
-LRB- |
denotes |
( |
T20255 |
42549-42556 |
NNP |
denotes |
MHB1648 |
T20256 |
42556-42557 |
-RRB- |
denotes |
) |
T20257 |
42557-42558 |
: |
denotes |
; |
T20258 |
42559-42562 |
IN |
denotes |
for |
T20259 |
42563-42569 |
JJ |
denotes |
mutant |
T20260 |
42570-42575 |
NN |
denotes |
probe |
T20261 |
42576-42577 |
CD |
denotes |
3 |
T20262 |
42578-42579 |
-LRB- |
denotes |
( |
T20263 |
42579-42581 |
NN |
denotes |
M3 |
T20264 |
42581-42582 |
-RRB- |
denotes |
) |
T20265 |
42582-42583 |
: |
denotes |
: |
T20266 |
42584-42585 |
CD |
denotes |
5 |
T20267 |
42585-42586 |
NN |
denotes |
′ |
T20268 |
42586-42623 |
NNP |
denotes |
AATGCAGtgccAAGGGTCAGAACATTGTCTGCGAAG3 |
T20269 |
42623-42624 |
NNP |
denotes |
′ |
T20270 |
42625-42626 |
-LRB- |
denotes |
( |
T20271 |
42626-42633 |
NNP |
denotes |
MHB1650 |
T20272 |
42633-42634 |
-RRB- |
denotes |
) |
T20273 |
42634-42635 |
. |
denotes |
. |
T20678 |
42637-42641 |
NN |
denotes |
ChIP |
T20679 |
42642-42647 |
NN |
denotes |
assay |
T20680 |
42647-42648 |
. |
denotes |
. |
T20681 |
42649-42651 |
IN |
denotes |
As |
T20682 |
42652-42661 |
VBN |
denotes |
described |
T20683 |
42662-42664 |
IN |
denotes |
by |
T20684 |
42665-42672 |
NNP |
denotes |
Nouzova |
T20685 |
42673-42674 |
NNP |
denotes |
[ |
T20686 |
42674-42676 |
CD |
denotes |
53 |
T20687 |
42676-42677 |
NNP |
denotes |
] |
T20688 |
42677-42678 |
, |
denotes |
, |
T20689 |
42679-42681 |
IN |
denotes |
in |
T20690 |
42682-42687 |
NN |
denotes |
brief |
T20691 |
42687-42688 |
: |
denotes |
: |
T20692 |
42689-42694 |
NNS |
denotes |
Cells |
T20693 |
42695-42699 |
IN |
denotes |
from |
T20694 |
42700-42703 |
NNP |
denotes |
MEL |
T20695 |
42704-42709 |
NNS |
denotes |
cells |
T20696 |
42710-42711 |
-LRB- |
denotes |
( |
T20697 |
42711-42712 |
CD |
denotes |
4 |
T20698 |
42713-42714 |
CD |
denotes |
× |
T20699 |
42715-42718 |
CD |
denotes |
107 |
T20700 |
42718-42719 |
-RRB- |
denotes |
) |
T20701 |
42720-42722 |
CC |
denotes |
or |
T20702 |
42723-42728 |
JJ |
denotes |
fetal |
T20703 |
42729-42734 |
NN |
denotes |
liver |
T20704 |
42735-42740 |
NNS |
denotes |
cells |
T20705 |
42741-42745 |
IN |
denotes |
from |
T20706 |
42746-42751 |
CD |
denotes |
three |
T20707 |
42752-42760 |
JJ |
denotes |
15.5-dpc |
T20708 |
42761-42763 |
NNP |
denotes |
WT |
T20709 |
42764-42768 |
NNS |
denotes |
mice |
T20710 |
42769-42773 |
VBD |
denotes |
were |
T20711 |
42774-42781 |
VBN |
denotes |
treated |
T20712 |
42782-42786 |
IN |
denotes |
with |
T20713 |
42787-42788 |
CD |
denotes |
1 |
T20714 |
42788-42789 |
NN |
denotes |
% |
T20715 |
42790-42802 |
NN |
denotes |
formaldehyde |
T20716 |
42803-42806 |
IN |
denotes |
for |
T20717 |
42807-42809 |
CD |
denotes |
10 |
T20718 |
42810-42813 |
NN |
denotes |
min |
T20719 |
42814-42816 |
IN |
denotes |
at |
T20720 |
42817-42819 |
CD |
denotes |
37 |
T20721 |
42820-42821 |
CD |
denotes |
° |
T20722 |
42821-42822 |
NNP |
denotes |
C |
T20723 |
42822-42823 |
, |
denotes |
, |
T20724 |
42824-42830 |
VBD |
denotes |
rinsed |
T20725 |
42831-42833 |
IN |
denotes |
in |
T20726 |
42834-42842 |
JJ |
denotes |
ice-cold |
T20727 |
42843-42844 |
CD |
denotes |
1 |
T20728 |
42844-42845 |
CD |
denotes |
× |
T20729 |
42846-42851 |
NNP |
denotes |
Hanks |
T20730 |
42851-42852 |
POS |
denotes |
' |
T20731 |
42853-42861 |
JJ |
denotes |
balanced |
T20732 |
42862-42866 |
NN |
denotes |
salt |
T20733 |
42867-42875 |
NN |
denotes |
solution |
T20734 |
42876-42880 |
IN |
denotes |
with |
T20735 |
42881-42884 |
CD |
denotes |
0.1 |
T20736 |
42884-42885 |
NN |
denotes |
% |
T20737 |
42886-42890 |
NNP |
denotes |
EDTA |
T20738 |
42891-42901 |
VBG |
denotes |
containing |
T20739 |
42902-42910 |
NN |
denotes |
protease |
T20740 |
42911-42921 |
NNS |
denotes |
inhibitors |
T20741 |
42921-42922 |
, |
denotes |
, |
T20742 |
42923-42932 |
VBN |
denotes |
collected |
T20743 |
42933-42935 |
IN |
denotes |
by |
T20744 |
42936-42950 |
NN |
denotes |
centrifugation |
T20745 |
42951-42953 |
IN |
denotes |
at |
T20746 |
42954-42955 |
CD |
denotes |
4 |
T20747 |
42956-42957 |
CD |
denotes |
° |
T20748 |
42957-42958 |
NNP |
denotes |
C |
T20749 |
42958-42959 |
, |
denotes |
, |
T20750 |
42960-42971 |
VBD |
denotes |
resuspended |
T20751 |
42972-42974 |
IN |
denotes |
in |
T20752 |
42975-42976 |
DT |
denotes |
a |
T20753 |
42977-42980 |
NNP |
denotes |
SDS |
T20754 |
42981-42986 |
NN |
denotes |
lysis |
T20755 |
42987-42993 |
NN |
denotes |
buffer |
T20756 |
42994-43004 |
VBG |
denotes |
containing |
T20757 |
43005-43013 |
NN |
denotes |
protease |
T20758 |
43014-43024 |
NNS |
denotes |
inhibitors |
T20759 |
43024-43025 |
, |
denotes |
, |
T20760 |
43026-43029 |
CC |
denotes |
and |
T20761 |
43030-43039 |
VBD |
denotes |
incubated |
T20762 |
43040-43042 |
IN |
denotes |
on |
T20763 |
43043-43046 |
NN |
denotes |
ice |
T20764 |
43047-43050 |
IN |
denotes |
for |
T20765 |
43051-43053 |
CD |
denotes |
10 |
T20766 |
43054-43057 |
NN |
denotes |
min |
T20767 |
43057-43058 |
. |
denotes |
. |
T20768 |
43059-43070 |
JJ |
denotes |
DNA-protein |
T20769 |
43071-43080 |
NNS |
denotes |
complexes |
T20770 |
43081-43085 |
VBD |
denotes |
were |
T20771 |
43086-43095 |
VBN |
denotes |
sonicated |
T20772 |
43096-43098 |
TO |
denotes |
to |
T20773 |
43099-43102 |
CD |
denotes |
200 |
T20774 |
43103-43106 |
CC |
denotes |
and |
T20775 |
43107-43110 |
CD |
denotes |
600 |
T20776 |
43111-43113 |
NN |
denotes |
bp |
T20777 |
43113-43114 |
. |
denotes |
. |
T20778 |
43115-43124 |
NN |
denotes |
One-tenth |
T20779 |
43125-43127 |
IN |
denotes |
of |
T20780 |
43128-43131 |
DT |
denotes |
the |
T20781 |
43132-43138 |
NN |
denotes |
sample |
T20782 |
43139-43142 |
VBD |
denotes |
was |
T20783 |
43143-43146 |
VBN |
denotes |
set |
T20784 |
43147-43152 |
RB |
denotes |
aside |
T20785 |
43153-43156 |
IN |
denotes |
for |
T20786 |
43157-43162 |
NN |
denotes |
input |
T20787 |
43163-43170 |
NN |
denotes |
control |
T20788 |
43170-43171 |
, |
denotes |
, |
T20789 |
43172-43175 |
CC |
denotes |
and |
T20790 |
43176-43179 |
DT |
denotes |
the |
T20791 |
43180-43189 |
VBG |
denotes |
remaining |
T20792 |
43190-43196 |
NN |
denotes |
sample |
T20793 |
43197-43200 |
VBD |
denotes |
was |
T20794 |
43201-43211 |
VBN |
denotes |
precleared |
T20795 |
43212-43216 |
IN |
denotes |
with |
T20796 |
43217-43224 |
NN |
denotes |
protein |
T20797 |
43225-43236 |
JJ |
denotes |
A-Sepharose |
T20798 |
43237-43238 |
-LRB- |
denotes |
( |
T20799 |
43238-43246 |
NNP |
denotes |
Amersham |
T20800 |
43247-43258 |
NNP |
denotes |
Biosciences |
T20801 |
43258-43259 |
, |
denotes |
, |
T20802 |
43260-43270 |
NNP |
denotes |
Piscataway |
T20803 |
43270-43271 |
, |
denotes |
, |
T20804 |
43272-43275 |
NNP |
denotes |
New |
T20805 |
43276-43282 |
NNP |
denotes |
Jersey |
T20806 |
43282-43283 |
, |
denotes |
, |
T20807 |
43284-43290 |
NNP |
denotes |
United |
T20808 |
43291-43297 |
NNPS |
denotes |
States |
T20809 |
43297-43298 |
-RRB- |
denotes |
) |
T20810 |
43298-43299 |
. |
denotes |
. |
T20811 |
43300-43309 |
VBG |
denotes |
Following |
T20812 |
43310-43321 |
NN |
denotes |
preclearing |
T20813 |
43321-43322 |
, |
denotes |
, |
T20814 |
43323-43326 |
DT |
denotes |
the |
T20815 |
43327-43334 |
NNS |
denotes |
samples |
T20816 |
43335-43339 |
VBD |
denotes |
were |
T20817 |
43340-43345 |
VBN |
denotes |
split |
T20818 |
43346-43350 |
IN |
denotes |
into |
T20819 |
43351-43357 |
NNS |
denotes |
thirds |
T20820 |
43357-43358 |
: |
denotes |
: |
T20821 |
43359-43362 |
CD |
denotes |
one |
T20822 |
43363-43369 |
NN |
denotes |
sample |
T20823 |
43370-43377 |
VBN |
denotes |
treated |
T20824 |
43378-43382 |
IN |
denotes |
with |
T20825 |
43383-43392 |
JJ |
denotes |
anti-Sox6 |
T20826 |
43392-43393 |
, |
denotes |
, |
T20827 |
43394-43395 |
DT |
denotes |
a |
T20828 |
43396-43402 |
JJ |
denotes |
second |
T20829 |
43403-43410 |
VBN |
denotes |
treated |
T20830 |
43411-43415 |
IN |
denotes |
with |
T20831 |
43416-43422 |
JJ |
denotes |
normal |
T20832 |
43423-43429 |
NN |
denotes |
rabbit |
T20833 |
43430-43433 |
NNP |
denotes |
IgG |
T20834 |
43433-43434 |
, |
denotes |
, |
T20835 |
43435-43438 |
CC |
denotes |
and |
T20836 |
43439-43442 |
DT |
denotes |
the |
T20837 |
43443-43448 |
JJ |
denotes |
third |
T20838 |
43449-43455 |
NN |
denotes |
sample |
T20839 |
43456-43463 |
IN |
denotes |
without |
T20840 |
43464-43466 |
NNP |
denotes |
Ab |
T20841 |
43466-43467 |
. |
denotes |
. |
T20842 |
43468-43471 |
DT |
denotes |
The |
T20843 |
43472-43476 |
JJ |
denotes |
last |
T20844 |
43477-43480 |
CD |
denotes |
two |
T20845 |
43481-43485 |
VBD |
denotes |
were |
T20846 |
43486-43490 |
VBN |
denotes |
used |
T20847 |
43491-43493 |
IN |
denotes |
as |
T20848 |
43494-43502 |
JJ |
denotes |
negative |
T20849 |
43503-43511 |
NNS |
denotes |
controls |
T20850 |
43511-43512 |
. |
denotes |
. |
T20851 |
43513-43516 |
DT |
denotes |
The |
T20852 |
43517-43535 |
JJ |
denotes |
chromatin-antibody |
T20853 |
43536-43545 |
NNS |
denotes |
complexes |
T20854 |
43546-43550 |
VBD |
denotes |
were |
T20855 |
43551-43557 |
VBN |
denotes |
eluted |
T20856 |
43557-43558 |
, |
denotes |
, |
T20857 |
43559-43562 |
CC |
denotes |
and |
T20858 |
43563-43566 |
DT |
denotes |
the |
T20859 |
43567-43570 |
NNP |
denotes |
DNA |
T20860 |
43571-43578 |
NN |
denotes |
protein |
T20861 |
43579-43590 |
NNS |
denotes |
cross-links |
T20862 |
43591-43595 |
VBD |
denotes |
were |
T20863 |
43596-43604 |
VBN |
denotes |
reversed |
T20864 |
43605-43609 |
IN |
denotes |
with |
T20865 |
43610-43611 |
CD |
denotes |
5 |
T20866 |
43612-43613 |
NNP |
denotes |
M |
T20867 |
43614-43618 |
NNP |
denotes |
NaCl |
T20868 |
43619-43621 |
IN |
denotes |
at |
T20869 |
43622-43624 |
CD |
denotes |
65 |
T20870 |
43625-43626 |
CD |
denotes |
° |
T20871 |
43626-43627 |
NNP |
denotes |
C |
T20872 |
43628-43631 |
IN |
denotes |
for |
T20873 |
43632-43633 |
CD |
denotes |
4 |
T20874 |
43634-43636 |
NN |
denotes |
h. |
T20875 |
43637-43642 |
NNP |
denotes |
Input |
T20876 |
43643-43646 |
NNP |
denotes |
DNA |
T20877 |
43647-43649 |
CC |
denotes |
or |
T20878 |
43650-43668 |
JJ |
denotes |
immunoprecipitated |
T20879 |
43669-43672 |
NN |
denotes |
DNA |
T20880 |
43673-43676 |
VBD |
denotes |
was |
T20881 |
43677-43681 |
VBN |
denotes |
used |
T20882 |
43682-43684 |
IN |
denotes |
as |
T20883 |
43685-43686 |
DT |
denotes |
a |
T20884 |
43687-43695 |
NN |
denotes |
template |
T20885 |
43696-43698 |
IN |
denotes |
in |
T20886 |
43699-43702 |
DT |
denotes |
the |
T20887 |
43703-43706 |
NNP |
denotes |
PCR |
T20888 |
43707-43715 |
NN |
denotes |
reaction |
T20889 |
43715-43716 |
. |
denotes |
. |
T20890 |
43717-43720 |
NNP |
denotes |
PCR |
T20891 |
43721-43734 |
NN |
denotes |
amplification |
T20892 |
43735-43737 |
IN |
denotes |
of |
T20893 |
43738-43741 |
DT |
denotes |
the |
T20894 |
43742-43744 |
JJ |
denotes |
ɛy |
T20895 |
43745-43753 |
NN |
denotes |
promoter |
T20896 |
43754-43757 |
VBD |
denotes |
was |
T20897 |
43758-43767 |
VBN |
denotes |
performed |
T20898 |
43768-43771 |
CC |
denotes |
and |
T20899 |
43772-43779 |
VBD |
denotes |
yielded |
T20900 |
43780-43781 |
DT |
denotes |
a |
T20901 |
43782-43788 |
JJ |
denotes |
172-bp |
T20902 |
43789-43797 |
NN |
denotes |
amplicon |
T20903 |
43797-43798 |
, |
denotes |
, |
T20904 |
43799-43812 |
JJ |
denotes |
corresponding |
T20905 |
43813-43815 |
TO |
denotes |
to |
T20906 |
43816-43827 |
NNS |
denotes |
nucleotides |
T20907 |
43828-43829 |
VBP |
denotes |
− |
T20908 |
43829-43831 |
CD |
denotes |
31 |
T20909 |
43832-43834 |
TO |
denotes |
to |
T20910 |
43835-43839 |
CD |
denotes |
+140 |
T20911 |
43840-43842 |
IN |
denotes |
of |
T20912 |
43843-43846 |
DT |
denotes |
the |
T20913 |
43847-43849 |
JJ |
denotes |
ɛy |
T20914 |
43850-43858 |
NN |
denotes |
promoter |
T20915 |
43859-43860 |
-LRB- |
denotes |
( |
T20916 |
43860-43867 |
NNS |
denotes |
primers |
T20917 |
43868-43875 |
NNP |
denotes |
MHB1688 |
T20918 |
43875-43876 |
, |
denotes |
, |
T20919 |
43877-43878 |
CD |
denotes |
5 |
T20920 |
43878-43879 |
NN |
denotes |
′ |
T20921 |
43879-43900 |
CD |
denotes |
CGAAGAATAAAAGGCCACCA3 |
T20922 |
43900-43901 |
NN |
denotes |
′ |
T20923 |
43901-43902 |
: |
denotes |
; |
T20924 |
43903-43906 |
CC |
denotes |
and |
T20925 |
43907-43914 |
NNP |
denotes |
MHB1689 |
T20926 |
43914-43915 |
, |
denotes |
, |
T20927 |
43916-43917 |
CD |
denotes |
5 |
T20928 |
43917-43918 |
NN |
denotes |
′ |
T20929 |
43918-43939 |
NNP |
denotes |
GCTTCACCACCAACCTCTTC3 |
T20930 |
43939-43940 |
NNP |
denotes |
′ |
T20931 |
43940-43941 |
-RRB- |
denotes |
) |
T20932 |
43941-43942 |
. |
denotes |
. |
T20933 |
43943-43946 |
NNP |
denotes |
PCR |
T20934 |
43947-43950 |
VBD |
denotes |
was |
T20935 |
43951-43960 |
VBN |
denotes |
performed |
T20936 |
43961-43966 |
IN |
denotes |
under |
T20937 |
43967-43970 |
DT |
denotes |
the |
T20938 |
43971-43980 |
JJ |
denotes |
following |
T20939 |
43981-43991 |
NNS |
denotes |
conditions |
T20940 |
43991-43992 |
: |
denotes |
: |
T20941 |
43993-43995 |
CD |
denotes |
95 |
T20942 |
43996-43997 |
NN |
denotes |
° |
T20943 |
43997-43998 |
NNP |
denotes |
C |
T20944 |
43999-44002 |
IN |
denotes |
for |
T20945 |
44003-44005 |
CD |
denotes |
15 |
T20946 |
44006-44009 |
NN |
denotes |
min |
T20947 |
44010-44018 |
VBN |
denotes |
followed |
T20948 |
44019-44021 |
IN |
denotes |
by |
T20949 |
44022-44024 |
CD |
denotes |
30 |
T20950 |
44025-44031 |
NNS |
denotes |
cycles |
T20951 |
44032-44034 |
IN |
denotes |
at |
T20952 |
44035-44037 |
CD |
denotes |
95 |
T20953 |
44038-44039 |
CD |
denotes |
° |
T20954 |
44039-44040 |
NNP |
denotes |
C |
T20955 |
44041-44044 |
IN |
denotes |
for |
T20956 |
44045-44047 |
CD |
denotes |
30 |
T20957 |
44048-44049 |
PRP |
denotes |
s |
T20958 |
44049-44050 |
, |
denotes |
, |
T20959 |
44051-44053 |
CD |
denotes |
60 |
T20960 |
44054-44055 |
NN |
denotes |
° |
T20961 |
44055-44056 |
NNP |
denotes |
C |
T20962 |
44057-44060 |
IN |
denotes |
for |
T20963 |
44061-44063 |
CD |
denotes |
30 |
T20964 |
44064-44065 |
PRP |
denotes |
s |
T20965 |
44065-44066 |
, |
denotes |
, |
T20966 |
44067-44070 |
CC |
denotes |
and |
T20967 |
44071-44073 |
CD |
denotes |
72 |
T20968 |
44074-44075 |
NN |
denotes |
° |
T20969 |
44075-44076 |
NNP |
denotes |
C |
T20970 |
44077-44080 |
IN |
denotes |
for |
T20971 |
44081-44083 |
CD |
denotes |
45 |
T20972 |
44084-44085 |
PRP |
denotes |
s |
T20973 |
44085-44086 |
, |
denotes |
, |
T20974 |
44087-44093 |
VBG |
denotes |
ending |
T20975 |
44094-44098 |
IN |
denotes |
with |
T20976 |
44099-44100 |
DT |
denotes |
a |
T20977 |
44101-44106 |
JJ |
denotes |
final |
T20978 |
44107-44116 |
NN |
denotes |
extension |
T20979 |
44117-44119 |
IN |
denotes |
at |
T20980 |
44120-44122 |
CD |
denotes |
72 |
T20981 |
44123-44124 |
CD |
denotes |
° |
T20982 |
44124-44125 |
NNP |
denotes |
C |
T20983 |
44126-44129 |
IN |
denotes |
for |
T20984 |
44130-44131 |
CD |
denotes |
5 |
T20985 |
44132-44135 |
NN |
denotes |
min |
T20986 |
44135-44136 |
. |
denotes |
. |
R10000 |
T14394 |
T14393 |
xcomp |
bending,cause |
R10001 |
T14395 |
T14394 |
prep |
of,bending |
R10002 |
T14396 |
T14397 |
det |
the,DNA |
R10003 |
T14463 |
T14461 |
pobj |
globin,of |
R10004 |
T14397 |
T14395 |
pobj |
DNA,of |
R10005 |
T14464 |
T14463 |
prep |
in,globin |
R10006 |
T14465 |
T14467 |
amod |
p100H,mice |
R10007 |
T14398 |
T14394 |
punct |
",",bending |
R10008 |
T14466 |
T14467 |
amod |
mutant,mice |
R10009 |
T14467 |
T14464 |
pobj |
mice,in |
R10010 |
T14468 |
T14456 |
ccomp |
is,shows |
R10011 |
T14469 |
T14468 |
acomp |
due,is |
R10012 |
T14470 |
T14469 |
prep |
to,due |
R10013 |
T14399 |
T14394 |
conj |
facilitating,bending |
R10014 |
T14471 |
T14470 |
pobj |
defects,to |
R10015 |
T14472 |
T14471 |
prep |
in,defects |
R10016 |
T14473 |
T14475 |
det |
the,mechanism |
R10017 |
T14400 |
T14401 |
det |
the,binding |
R10018 |
T14474 |
T14475 |
amod |
silencing,mechanism |
R10019 |
T14475 |
T14472 |
pobj |
mechanism,in |
R10020 |
T14401 |
T14399 |
dobj |
binding,facilitating |
R10021 |
T14476 |
T14475 |
prep |
of,mechanism |
R10022 |
T14477 |
T14478 |
amod |
definitive,erythropoiesis |
R10023 |
T14478 |
T14476 |
pobj |
erythropoiesis,of |
R10024 |
T14402 |
T14401 |
prep |
of,binding |
R10025 |
T14479 |
T14480 |
nsubj |
that,takes |
R10026 |
T14480 |
T14475 |
relcl |
takes,mechanism |
R10027 |
T14481 |
T14480 |
dobj |
place,takes |
R10028 |
T14482 |
T14480 |
prep |
in,takes |
R10029 |
T14403 |
T14404 |
amod |
other,repressors |
R10030 |
T14483 |
T14484 |
det |
the,liver |
R10031 |
T14484 |
T14482 |
pobj |
liver,in |
R10032 |
T14404 |
T14405 |
compound |
repressors,[ |
R10033 |
T14485 |
T14486 |
punct |
(,Figure |
R10034 |
T14486 |
T14480 |
npadvmod |
Figure,takes |
R10035 |
T14487 |
T14486 |
nummod |
5,Figure |
R10036 |
T14488 |
T14486 |
punct |
),Figure |
R10037 |
T14405 |
T14402 |
pobj |
[,of |
R10038 |
T14489 |
T14456 |
punct |
.,shows |
R10039 |
T14490 |
T14495 |
advcl |
Taken,demonstrate |
R10040 |
T14406 |
T14407 |
nummod |
40,] |
R10041 |
T14491 |
T14490 |
advmod |
together,Taken |
R10042 |
T14492 |
T14495 |
punct |
",",demonstrate |
R10043 |
T14493 |
T14494 |
det |
these,data |
R10044 |
T14407 |
T14405 |
appos |
],[ |
R10045 |
T14494 |
T14495 |
nsubj |
data,demonstrate |
R10046 |
T14495 |
T14495 |
ROOT |
demonstrate,demonstrate |
R10047 |
T14408 |
T14376 |
punct |
.,demonstrated |
R10048 |
T14496 |
T14506 |
det |
that,expression |
R10049 |
T14497 |
T14498 |
amod |
Sox6,functions |
R10050 |
T14498 |
T14503 |
nsubj |
functions,silence |
R10051 |
T14409 |
T14410 |
amod |
Sox6,expression |
R10052 |
T14499 |
T14498 |
prep |
in,functions |
R10053 |
T14500 |
T14501 |
amod |
definitive,erythropoiesis |
R10054 |
T14501 |
T14499 |
pobj |
erythropoiesis,in |
R10055 |
T14502 |
T14503 |
aux |
to,silence |
R10056 |
T14410 |
T14411 |
nsubj |
expression,is |
R10057 |
T14503 |
T14506 |
nmod |
silence,expression |
R10058 |
T14504 |
T14506 |
nmod |
ɛy,expression |
R10059 |
T14505 |
T14506 |
compound |
globin,expression |
R10060 |
T14411 |
T14411 |
ROOT |
is,is |
R10061 |
T14506 |
T14495 |
dobj |
expression,demonstrate |
R10062 |
T14507 |
T14495 |
punct |
.,demonstrate |
R10063 |
T14508 |
T14510 |
det |
The,level |
R10064 |
T14509 |
T14510 |
compound |
expression,level |
R10065 |
T14510 |
T14525 |
nsubj |
level,is |
R10066 |
T14412 |
T14411 |
acomp |
temporally,is |
R10067 |
T14511 |
T14510 |
prep |
of,level |
R10068 |
T14512 |
T14513 |
amod |
ɛy,globin |
R10069 |
T14513 |
T14511 |
pobj |
globin,of |
R10070 |
T14413 |
T14412 |
cc |
and,temporally |
R10071 |
T14514 |
T14513 |
prep |
in,globin |
R10072 |
T14515 |
T14518 |
amod |
homozygous,mice |
R10073 |
T14414 |
T14412 |
conj |
spatially,temporally |
R10074 |
T14516 |
T14518 |
amod |
Sox6,mice |
R10075 |
T14517 |
T14518 |
amod |
null,mice |
R10076 |
T14518 |
T14514 |
pobj |
mice,in |
R10077 |
T14415 |
T14412 |
conj |
coincident,temporally |
R10078 |
T14519 |
T14510 |
prep |
at,level |
R10079 |
T14520 |
T14524 |
nummod |
15.5,dpc |
R10080 |
T14521 |
T14520 |
npadvmod |
dpc,15.5 |
R10081 |
T14416 |
T14411 |
prep |
with,is |
R10082 |
T14522 |
T14520 |
cc |
and,15.5 |
R10083 |
T14523 |
T14520 |
conj |
18.5,15.5 |
R10084 |
T14417 |
T14416 |
pobj |
definitive,with |
R10085 |
T14524 |
T14519 |
pobj |
dpc,at |
R10086 |
T14525 |
T14525 |
ROOT |
is,is |
R10087 |
T14526 |
T14527 |
advmod |
statistically,equivalent |
R10088 |
T14418 |
T14417 |
punct |
(,definitive |
R10089 |
T14527 |
T14525 |
acomp |
equivalent,is |
R10090 |
T14528 |
T14527 |
prep |
to,equivalent |
R10091 |
T14529 |
T14530 |
det |
the,level |
R10092 |
T14419 |
T14417 |
cc |
but,definitive |
R10093 |
T14530 |
T14528 |
pobj |
level,to |
R10094 |
T14531 |
T14530 |
prep |
of,level |
R10095 |
T14420 |
T14421 |
neg |
not,primitive |
R10096 |
T14532 |
T14535 |
amod |
βmaj,expression |
R10097 |
T14533 |
T14534 |
compound |
/,min |
R10098 |
T14534 |
T14535 |
compound |
min,expression |
R10099 |
T14535 |
T14531 |
pobj |
expression,of |
R10100 |
T14421 |
T14417 |
conj |
primitive,definitive |
R10101 |
T14536 |
T14530 |
prep |
in,level |
R10102 |
T14537 |
T14538 |
det |
the,livers |
R10103 |
T14422 |
T14411 |
punct |
),is |
R10104 |
T14538 |
T14536 |
pobj |
livers,in |
R10105 |
T14423 |
T14423 |
ROOT |
erythropoiesis,erythropoiesis |
R10106 |
T14539 |
T14538 |
prep |
of,livers |
R10107 |
T14424 |
T14425 |
punct |
(,Figure |
R10108 |
T14540 |
T14545 |
amod |
15.5-dpc,mice |
R10109 |
T14541 |
T14540 |
cc |
and,15.5-dpc |
R10110 |
T14542 |
T14540 |
conj |
18.5-dpc,15.5-dpc |
R10111 |
T14425 |
T14423 |
parataxis |
Figure,erythropoiesis |
R10112 |
T14543 |
T14545 |
amod |
homozygous,mice |
R10113 |
T14544 |
T14545 |
compound |
WT,mice |
R10114 |
T14545 |
T14539 |
pobj |
mice,of |
R10115 |
T14546 |
T14547 |
punct |
(,Figure |
R10116 |
T14547 |
T14538 |
appos |
Figure,livers |
R10117 |
T14426 |
T14425 |
nummod |
6,Figure |
R10118 |
T14548 |
T14547 |
nummod |
1,Figure |
R10119 |
T14549 |
T14547 |
punct |
),Figure |
R10120 |
T14550 |
T14525 |
punct |
.,is |
R10121 |
T14427 |
T14425 |
punct |
),Figure |
R10122 |
T14551 |
T14552 |
nsubj |
This,demonstrates |
R10123 |
T14552 |
T14552 |
ROOT |
demonstrates,demonstrates |
R10124 |
T14553 |
T14561 |
mark |
that,is |
R10125 |
T14554 |
T14555 |
amod |
ectopic,expression |
R10126 |
T14428 |
T14423 |
punct |
",",erythropoiesis |
R10127 |
T14555 |
T14561 |
nsubj |
expression,is |
R10128 |
T14556 |
T14555 |
prep |
of,expression |
R10129 |
T14557 |
T14560 |
det |
the,gene |
R10130 |
T14429 |
T14423 |
cc |
and,erythropoiesis |
R10131 |
T14558 |
T14560 |
amod |
ɛy,gene |
R10132 |
T14559 |
T14560 |
compound |
globin,gene |
R10133 |
T14430 |
T14431 |
nsubj |
Sox6,represses |
R10134 |
T14431 |
T14423 |
conj |
represses,erythropoiesis |
R10135 |
T14432 |
T14434 |
amod |
ɛy,expression |
R10136 |
T14433 |
T14434 |
compound |
globin,expression |
R10137 |
T14560 |
T14556 |
pobj |
gene,of |
R10138 |
T14561 |
T14552 |
ccomp |
is,demonstrates |
R10139 |
T14562 |
T14563 |
advmod |
quite,robust |
R10140 |
T14434 |
T14431 |
dobj |
expression,represses |
R10141 |
T14563 |
T14561 |
acomp |
robust,is |
R10142 |
T14564 |
T14563 |
prep |
in,robust |
R10143 |
T14435 |
T14436 |
preconj |
both,in |
R10144 |
T14565 |
T14567 |
amod |
homozygous,mice |
R10145 |
T14566 |
T14567 |
amod |
mutant,mice |
R10146 |
T14567 |
T14564 |
pobj |
mice,in |
R10147 |
T14568 |
T14552 |
punct |
.,demonstrates |
R10148 |
T14436 |
T14434 |
prep |
in,expression |
R10149 |
T14569 |
T14571 |
det |
The,levels |
R10150 |
T14570 |
T14571 |
compound |
expression,levels |
R10151 |
T14437 |
T14436 |
pobj |
vivo,in |
R10152 |
T14571 |
T14583 |
nsubj |
levels,are |
R10153 |
T14572 |
T14571 |
prep |
of,levels |
R10154 |
T14573 |
T14577 |
nummod |
two,genes |
R10155 |
T14438 |
T14439 |
punct |
(,Figure |
R10156 |
T14574 |
T14577 |
amod |
other,genes |
R10157 |
T14575 |
T14577 |
amod |
embryonic,genes |
R10158 |
T14576 |
T14577 |
compound |
globin,genes |
R10159 |
T14439 |
T14434 |
appos |
Figure,expression |
R10160 |
T14577 |
T14572 |
pobj |
genes,of |
R10161 |
T14578 |
T14577 |
punct |
(,genes |
R10162 |
T14440 |
T14439 |
nummod |
1,Figure |
R10163 |
T14579 |
T14577 |
appos |
ζ,genes |
R10164 |
T14580 |
T14579 |
cc |
and,ζ |
R10165 |
T14441 |
T14439 |
punct |
),Figure |
R10166 |
T14581 |
T14579 |
conj |
βh1,ζ |
R10167 |
T14582 |
T14577 |
punct |
),genes |
R10168 |
T14442 |
T14431 |
cc |
and,represses |
R10169 |
T14583 |
T14583 |
ROOT |
are,are |
R10170 |
T14584 |
T14583 |
advmod |
also,are |
R10171 |
T14443 |
T14431 |
conj |
in,represses |
R10172 |
T14585 |
T14583 |
acomp |
higher,are |
R10173 |
T14586 |
T14585 |
prep |
in,higher |
R10174 |
T14587 |
T14588 |
amod |
p100H,homozygotes |
R10175 |
T14444 |
T14446 |
amod |
vitro,Figure |
R10176 |
T14588 |
T14586 |
pobj |
homozygotes,in |
R10177 |
T14589 |
T14583 |
punct |
",",are |
R10178 |
T14590 |
T14583 |
prep |
compared,are |
R10179 |
T14445 |
T14446 |
punct |
(,Figure |
R10180 |
T14591 |
T14590 |
prep |
with,compared |
R10181 |
T14592 |
T14591 |
pobj |
WT,with |
R10182 |
T14593 |
T14583 |
punct |
.,are |
R10183 |
T14446 |
T14443 |
pobj |
Figure,in |
R10184 |
T14594 |
T14602 |
prep |
Like,are |
R10185 |
T14595 |
T14594 |
pobj |
ɛy,Like |
R10186 |
T14596 |
T14602 |
punct |
",",are |
R10187 |
T14447 |
T14446 |
nummod |
2,Figure |
R10188 |
T14597 |
T14602 |
nsubj |
levels,are |
R10189 |
T14598 |
T14597 |
prep |
of,levels |
R10190 |
T14448 |
T14446 |
punct |
),Figure |
R10191 |
T14599 |
T14598 |
pobj |
ζ,of |
R10192 |
T14600 |
T14597 |
cc |
and,levels |
R10193 |
T14601 |
T14597 |
conj |
βh1,levels |
R10194 |
T14449 |
T14431 |
punct |
.,represses |
R10195 |
T14602 |
T14602 |
ROOT |
are,are |
R10196 |
T14603 |
T14604 |
advmod |
dramatically,higher |
R10197 |
T14604 |
T14602 |
acomp |
higher,are |
R10198 |
T14450 |
T14456 |
advmod |
Moreover,shows |
R10199 |
T14605 |
T14604 |
prep |
in,higher |
R10200 |
T14606 |
T14607 |
amod |
mutant,mice |
R10201 |
T14451 |
T14456 |
punct |
",",shows |
R10202 |
T14607 |
T14605 |
pobj |
mice,in |
R10203 |
T14608 |
T14602 |
prep |
at,are |
R10204 |
T14609 |
T14610 |
nummod |
15.5,dpc |
R10205 |
T14452 |
T14456 |
prep |
in,shows |
R10206 |
T14610 |
T14608 |
pobj |
dpc,at |
R10207 |
T14611 |
T14602 |
punct |
.,are |
R10208 |
T14612 |
T14612 |
ROOT |
However,However |
R10209 |
T14453 |
T14454 |
compound |
situ,hybridization |
R10210 |
T14613 |
T14612 |
pobj |
",",However |
R10211 |
T14614 |
T14613 |
xcomp |
unlike,"," |
R10212 |
T14454 |
T14456 |
nsubj |
hybridization,shows |
R10213 |
T14615 |
T14616 |
amod |
ɛy,globin |
R10214 |
T14616 |
T14614 |
pobj |
globin,unlike |
R10215 |
T14617 |
T14616 |
punct |
",",globin |
R10216 |
T14455 |
T14456 |
advmod |
clearly,shows |
R10217 |
T14618 |
T14616 |
conj |
ζ,globin |
R10218 |
T14619 |
T14618 |
cc |
and,ζ |
R10219 |
T14456 |
T14456 |
ROOT |
shows,shows |
R10220 |
T14620 |
T14621 |
amod |
βh1,decline |
R10221 |
T14621 |
T14618 |
conj |
decline,ζ |
R10222 |
T14622 |
T14621 |
prep |
in,decline |
R10223 |
T14457 |
T14468 |
mark |
that,is |
R10224 |
T14623 |
T14622 |
pobj |
expression,in |
R10225 |
T14624 |
T14621 |
prep |
by,decline |
R10226 |
T14625 |
T14624 |
pobj |
day,by |
R10227 |
T14458 |
T14460 |
det |
the,expression |
R10228 |
T14626 |
T14625 |
nummod |
18.5,day |
R10229 |
T14459 |
T14460 |
amod |
persistent,expression |
R10230 |
T14627 |
T14627 |
ROOT |
dpc,dpc |
R10231 |
T14628 |
T14629 |
punct |
(,Figure |
R10232 |
T14629 |
T14627 |
appos |
Figure,dpc |
R10233 |
T14460 |
T14468 |
nsubj |
expression,is |
R10234 |
T14630 |
T14629 |
nummod |
1,Figure |
R10235 |
T14631 |
T14629 |
punct |
),Figure |
R10236 |
T14632 |
T14627 |
punct |
",",dpc |
R10237 |
T14461 |
T14460 |
prep |
of,expression |
R10238 |
T14633 |
T14627 |
acl |
suggesting,dpc |
R10239 |
T14634 |
T14637 |
mark |
that,regulated |
R10240 |
T14635 |
T14637 |
nsubjpass |
ɛy,regulated |
R10241 |
T14462 |
T14463 |
amod |
ɛy,globin |
R10242 |
T14636 |
T14637 |
auxpass |
is,regulated |
R10243 |
T14637 |
T14633 |
ccomp |
regulated,suggesting |
R10244 |
T14657 |
T14656 |
punct |
(,genes |
R10245 |
T14638 |
T14637 |
advmod |
differently,regulated |
R10246 |
T14658 |
T14656 |
cc |
and,genes |
R10247 |
T14639 |
T14638 |
prep |
than,differently |
R10248 |
T14640 |
T14639 |
pobj |
ζ,than |
R10249 |
T14659 |
T14660 |
amod |
erythrocyte,maturation |
R10250 |
T14641 |
T14640 |
cc |
and,ζ |
R10251 |
T14642 |
T14640 |
conj |
βh1,ζ |
R10252 |
T14643 |
T14627 |
punct |
.,dpc |
R10253 |
T14660 |
T14656 |
conj |
maturation,genes |
R10254 |
T14644 |
T14645 |
nsubj |
It,is |
R10255 |
T14645 |
T14645 |
ROOT |
is,is |
R10256 |
T14646 |
T14645 |
acomp |
possible,is |
R10257 |
T14661 |
T14652 |
punct |
),effect |
R10258 |
T14647 |
T14649 |
mark |
that,has |
R10259 |
T14648 |
T14649 |
nsubj |
Sox6,has |
R10260 |
T14649 |
T14645 |
ccomp |
has,is |
R10261 |
T14662 |
T14649 |
prep |
in,has |
R10262 |
T14650 |
T14652 |
det |
a,effect |
R10263 |
T14651 |
T14652 |
amod |
general,effect |
R10264 |
T14652 |
T14649 |
dobj |
effect,has |
R10265 |
T14653 |
T14652 |
prep |
on,effect |
R10266 |
T14654 |
T14656 |
amod |
embryonic,genes |
R10267 |
T14655 |
T14656 |
compound |
globin,genes |
R10268 |
T14663 |
T14662 |
pobj |
addition,in |
R10269 |
T14656 |
T14653 |
pobj |
genes,on |
R10270 |
T14664 |
T14663 |
prep |
to,addition |
R10271 |
T14665 |
T14667 |
det |
a,role |
R10272 |
T14666 |
T14667 |
amod |
specific,role |
R10273 |
T14667 |
T14664 |
pobj |
role,to |
R10274 |
T14754 |
T14755 |
det |
the,levels |
R10275 |
T14668 |
T14667 |
prep |
in,role |
R10276 |
T14755 |
T14761 |
nsubj |
levels,were |
R10277 |
T14756 |
T14755 |
prep |
of,levels |
R10278 |
T14757 |
T14756 |
pobj |
ζ,of |
R10279 |
T14669 |
T14668 |
pcomp |
silencing,in |
R10280 |
T14758 |
T14757 |
cc |
and,ζ |
R10281 |
T14759 |
T14760 |
nummod |
βh1,RNA |
R10282 |
T14760 |
T14757 |
conj |
RNA,ζ |
R10283 |
T14670 |
T14669 |
dobj |
ɛy,silencing |
R10284 |
T14761 |
T14778 |
ccomp |
were,elevated |
R10285 |
T14762 |
T14761 |
acomp |
undetectable,were |
R10286 |
T14671 |
T14645 |
punct |
.,is |
R10287 |
T14763 |
T14764 |
advmod |
both,in |
R10288 |
T14764 |
T14762 |
prep |
in,undetectable |
R10289 |
T14672 |
T14677 |
mark |
Although,die |
R10290 |
T14765 |
T14764 |
pobj |
mutant,in |
R10291 |
T14766 |
T14765 |
cc |
and,mutant |
R10292 |
T14767 |
T14765 |
conj |
WT,mutant |
R10293 |
T14673 |
T14676 |
amod |
most,mice |
R10294 |
T14768 |
T14778 |
punct |
;,elevated |
R10295 |
T14769 |
T14778 |
advmod |
however,elevated |
R10296 |
T14770 |
T14778 |
punct |
",",elevated |
R10297 |
T14674 |
T14676 |
amod |
p100H,mice |
R10298 |
T14771 |
T14775 |
nmod |
adult,levels |
R10299 |
T14772 |
T14775 |
amod |
β-like,levels |
R10300 |
T14773 |
T14775 |
compound |
globin,levels |
R10301 |
T14675 |
T14676 |
amod |
mutant,mice |
R10302 |
T14774 |
T14775 |
compound |
RNA,levels |
R10303 |
T14775 |
T14776 |
nsubj |
levels,were |
R10304 |
T14676 |
T14677 |
nsubj |
mice,die |
R10305 |
T14677 |
T14686 |
advcl |
die,survive |
R10306 |
T14776 |
T14778 |
auxpass |
were,elevated |
R10307 |
T14678 |
T14679 |
advmod |
just,after |
R10308 |
T14777 |
T14778 |
advmod |
moderately,elevated |
R10309 |
T14778 |
T14778 |
ROOT |
elevated,elevated |
R10310 |
T14779 |
T14778 |
prep |
in,elevated |
R10311 |
T14679 |
T14677 |
prep |
after,die |
R10312 |
T14780 |
T14782 |
det |
the,RNA |
R10313 |
T14781 |
T14782 |
amod |
mutant,RNA |
R10314 |
T14782 |
T14779 |
pobj |
RNA,in |
R10315 |
T14783 |
T14778 |
prep |
compared,elevated |
R10316 |
T14784 |
T14783 |
prep |
with,compared |
R10317 |
T14680 |
T14681 |
auxpass |
being,born |
R10318 |
T14785 |
T14784 |
pobj |
WT,with |
R10319 |
T14786 |
T14785 |
punct |
(,WT |
R10320 |
T14681 |
T14679 |
pcomp |
born,after |
R10321 |
T14787 |
T14788 |
amod |
unpublished,data |
R10322 |
T14788 |
T14785 |
appos |
data,WT |
R10323 |
T14789 |
T14785 |
punct |
),WT |
R10324 |
T14682 |
T14686 |
punct |
",",survive |
R10325 |
T14790 |
T14785 |
punct |
",",WT |
R10326 |
T14791 |
T14778 |
conj |
similar,elevated |
R10327 |
T14683 |
T14686 |
det |
a,survive |
R10328 |
T14792 |
T14791 |
prep |
to,similar |
R10329 |
T14793 |
T14795 |
dobj |
what,observe |
R10330 |
T14794 |
T14795 |
nsubj |
we,observe |
R10331 |
T14684 |
T14686 |
amod |
rare,survive |
R10332 |
T14795 |
T14792 |
pcomp |
observe,to |
R10333 |
T14796 |
T14795 |
prep |
at,observe |
R10334 |
T14797 |
T14798 |
nummod |
18.5,dpc |
R10335 |
T14685 |
T14686 |
nsubj |
few,survive |
R10336 |
T14798 |
T14796 |
pobj |
dpc,at |
R10337 |
T14799 |
T14800 |
punct |
(,Figure |
R10338 |
T14800 |
T14792 |
pobj |
Figure,to |
R10339 |
T14686 |
T14686 |
ROOT |
survive,survive |
R10340 |
T14801 |
T14800 |
nummod |
1,Figure |
R10341 |
T14802 |
T14800 |
punct |
),Figure |
R10342 |
T14803 |
T14778 |
punct |
.,elevated |
R10343 |
T14687 |
T14686 |
advmod |
longer,survive |
R10344 |
T14804 |
T14805 |
det |
These,findings |
R10345 |
T14805 |
T14806 |
nsubj |
findings,suggest |
R10346 |
T14806 |
T14806 |
ROOT |
suggest,suggest |
R10347 |
T14807 |
T14809 |
mark |
that,continues |
R10348 |
T14688 |
T14686 |
punct |
.,survive |
R10349 |
T14808 |
T14809 |
nsubj |
Sox6,continues |
R10350 |
T14809 |
T14806 |
ccomp |
continues,suggest |
R10351 |
T14810 |
T14811 |
aux |
to,function |
R10352 |
T14689 |
T14692 |
nsubjpass |
None,observed |
R10353 |
T14811 |
T14809 |
xcomp |
function,continues |
R10354 |
T14812 |
T14811 |
advmod |
postnatally,function |
R10355 |
T14690 |
T14692 |
aux |
have,observed |
R10356 |
T14813 |
T14811 |
prep |
to,function |
R10357 |
T14814 |
T14817 |
nmod |
silence,expression |
R10358 |
T14815 |
T14817 |
nmod |
ɛy,expression |
R10359 |
T14691 |
T14692 |
auxpass |
been,observed |
R10360 |
T14816 |
T14817 |
compound |
globin,expression |
R10361 |
T14817 |
T14813 |
pobj |
expression,to |
R10362 |
T14818 |
T14809 |
cc |
and,continues |
R10363 |
T14692 |
T14692 |
ROOT |
observed,observed |
R10364 |
T14819 |
T14809 |
conj |
has,continues |
R10365 |
T14820 |
T14822 |
det |
a,function |
R10366 |
T14821 |
T14822 |
amod |
unique,function |
R10367 |
T14822 |
T14819 |
dobj |
function,has |
R10368 |
T14823 |
T14822 |
prep |
in,function |
R10369 |
T14824 |
T14825 |
det |
the,regulation |
R10370 |
T14693 |
T14694 |
aux |
to,live |
R10371 |
T14825 |
T14823 |
pobj |
regulation,in |
R10372 |
T14826 |
T14825 |
prep |
of,regulation |
R10373 |
T14827 |
T14826 |
pobj |
ɛy-globin,of |
R10374 |
T14694 |
T14692 |
xcomp |
live,observed |
R10375 |
T14828 |
T14806 |
punct |
.,suggest |
R10376 |
T14829 |
T14830 |
det |
The,mechanism |
R10377 |
T14830 |
T14840 |
nsubj |
mechanism,remains |
R10378 |
T14695 |
T14698 |
amod |
longer,wk |
R10379 |
T14831 |
T14834 |
prep |
by,regulates |
R10380 |
T14832 |
T14831 |
pobj |
which,by |
R10381 |
T14696 |
T14698 |
quantmod |
than,wk |
R10382 |
T14833 |
T14834 |
nsubj |
Sox6,regulates |
R10383 |
T14834 |
T14830 |
relcl |
regulates,mechanism |
R10384 |
T14697 |
T14698 |
nummod |
2,wk |
R10385 |
T14835 |
T14839 |
det |
the,genes |
R10386 |
T14836 |
T14839 |
amod |
other,genes |
R10387 |
T14837 |
T14839 |
amod |
embryonic,genes |
R10388 |
T14698 |
T14694 |
dobj |
wk,live |
R10389 |
T14838 |
T14839 |
compound |
globin,genes |
R10390 |
T14839 |
T14834 |
dobj |
genes,regulates |
R10391 |
T14840 |
T14840 |
ROOT |
remains,remains |
R10392 |
T14699 |
T14694 |
prep |
after,live |
R10393 |
T14841 |
T14843 |
aux |
to,elucidated |
R10394 |
T14842 |
T14843 |
auxpass |
be,elucidated |
R10395 |
T14843 |
T14840 |
xcomp |
elucidated,remains |
R10396 |
T14700 |
T14703 |
nsubjpass |
birth,] |
R10397 |
T14844 |
T14840 |
punct |
.,remains |
R10398 |
T14845 |
T14846 |
nsubj |
Sox6,has |
R10399 |
T14846 |
T14846 |
ROOT |
has,has |
R10400 |
T14701 |
T14703 |
nmod |
[,] |
R10401 |
T14847 |
T14848 |
amod |
other,effects |
R10402 |
T14848 |
T14846 |
dobj |
effects,has |
R10403 |
T14849 |
T14848 |
prep |
in,effects |
R10404 |
T14702 |
T14703 |
nummod |
14,] |
R10405 |
T14850 |
T14849 |
pobj |
erythropoiesis,in |
R10406 |
T14703 |
T14699 |
pobj |
],after |
R10407 |
T14704 |
T14692 |
punct |
.,observed |
R10408 |
T14705 |
T14706 |
nsubj |
We,examined |
R10409 |
T14851 |
T14848 |
punct |
",",effects |
R10410 |
T14706 |
T14706 |
ROOT |
examined,examined |
R10411 |
T14852 |
T14848 |
prep |
including,effects |
R10412 |
T14853 |
T14854 |
det |
a,delay |
R10413 |
T14854 |
T14852 |
pobj |
delay,including |
R10414 |
T14707 |
T14710 |
det |
a,sample |
R10415 |
T14708 |
T14710 |
amod |
single,sample |
R10416 |
T14855 |
T14854 |
prep |
in,delay |
R10417 |
T14709 |
T14710 |
amod |
archived,sample |
R10418 |
T14856 |
T14855 |
pobj |
enucleation/maturation,in |
R10419 |
T14857 |
T14854 |
prep |
in,delay |
R10420 |
T14710 |
T14706 |
dobj |
sample,examined |
R10421 |
T14858 |
T14860 |
amod |
p100H,mice |
R10422 |
T14859 |
T14860 |
amod |
mutant,mice |
R10423 |
T14711 |
T14710 |
prep |
of,sample |
R10424 |
T14860 |
T14857 |
pobj |
mice,in |
R10425 |
T14861 |
T14846 |
punct |
.,has |
R10426 |
T14862 |
T14864 |
nsubj |
This,be |
R10427 |
T14712 |
T14713 |
compound |
liver,RNA |
R10428 |
T14863 |
T14864 |
aux |
may,be |
R10429 |
T14713 |
T14711 |
pobj |
RNA,of |
R10430 |
T14864 |
T14864 |
ROOT |
be,be |
R10431 |
T14865 |
T14866 |
det |
the,result |
R10432 |
T14866 |
T14864 |
attr |
result,be |
R10433 |
T14714 |
T14710 |
prep |
from,sample |
R10434 |
T14867 |
T14866 |
prep |
of,result |
R10435 |
T14868 |
T14869 |
amod |
indirect,effects |
R10436 |
T14715 |
T14717 |
det |
a,mouse |
R10437 |
T14869 |
T14867 |
pobj |
effects,of |
R10438 |
T14870 |
T14869 |
punct |
",",effects |
R10439 |
T14716 |
T14717 |
amod |
mutant,mouse |
R10440 |
T14871 |
T14872 |
amod |
such,as |
R10441 |
T14872 |
T14869 |
prep |
as,effects |
R10442 |
T14873 |
T14874 |
compound |
stress-induced,proliferation |
R10443 |
T14717 |
T14714 |
pobj |
mouse,from |
R10444 |
T14874 |
T14872 |
pobj |
proliferation,as |
R10445 |
T14875 |
T14874 |
punct |
(,proliferation |
R10446 |
T14876 |
T14874 |
acl |
resulting,proliferation |
R10447 |
T14718 |
T14717 |
prep |
on,mouse |
R10448 |
T14877 |
T14876 |
prep |
from,resulting |
R10449 |
T14878 |
T14879 |
amod |
cardiac,defects |
R10450 |
T14879 |
T14877 |
pobj |
defects,from |
R10451 |
T14719 |
T14720 |
amod |
postnatal,day |
R10452 |
T14880 |
T14874 |
punct |
),proliferation |
R10453 |
T14881 |
T14874 |
cc |
and/or,proliferation |
R10454 |
T14882 |
T14874 |
conj |
anemia,proliferation |
R10455 |
T14720 |
T14718 |
pobj |
day,on |
R10456 |
T14883 |
T14864 |
punct |
.,be |
R10457 |
T14884 |
T14885 |
amod |
Severe,anemia |
R10458 |
T14721 |
T14720 |
nummod |
13.5,day |
R10459 |
T14885 |
T14887 |
nsubj |
anemia,lead |
R10460 |
T14886 |
T14887 |
aux |
can,lead |
R10461 |
T14887 |
T14887 |
ROOT |
lead,lead |
R10462 |
T14722 |
T14710 |
prep |
for,sample |
R10463 |
T14888 |
T14887 |
prep |
to,lead |
R10464 |
T14889 |
T14891 |
amod |
rapid,release |
R10465 |
T14890 |
T14891 |
amod |
premature,release |
R10466 |
T14891 |
T14888 |
pobj |
release,to |
R10467 |
T14892 |
T14891 |
prep |
of,release |
R10468 |
T14893 |
T14894 |
amod |
red,cells |
R10469 |
T14723 |
T14725 |
amod |
globin,expression |
R10470 |
T14894 |
T14892 |
pobj |
cells,of |
R10471 |
T14895 |
T14887 |
punct |
",",lead |
R10472 |
T14724 |
T14725 |
compound |
gene,expression |
R10473 |
T14896 |
T14887 |
advmod |
prior,lead |
R10474 |
T14897 |
T14896 |
prep |
to,prior |
R10475 |
T14898 |
T14900 |
poss |
their,maturation |
R10476 |
T14725 |
T14722 |
pobj |
expression,for |
R10477 |
T14899 |
T14900 |
amod |
complete,maturation |
R10478 |
T14900 |
T14897 |
pobj |
maturation,to |
R10479 |
T14901 |
T14887 |
punct |
.,lead |
R10480 |
T14726 |
T14706 |
cc |
and,examined |
R10481 |
T14902 |
T14910 |
advmod |
However,is |
R10482 |
T14903 |
T14910 |
punct |
",",is |
R10483 |
T14727 |
T14706 |
conj |
detected,examined |
R10484 |
T14904 |
T14905 |
det |
the,hematocrit |
R10485 |
T14905 |
T14910 |
nsubj |
hematocrit,is |
R10486 |
T14906 |
T14905 |
prep |
of,hematocrit |
R10487 |
T14728 |
T14729 |
amod |
high,levels |
R10488 |
T14729 |
T14727 |
dobj |
levels,detected |
R10489 |
T14730 |
T14729 |
prep |
of,levels |
R10490 |
T14907 |
T14909 |
amod |
18.5-dpc,mice |
R10491 |
T14731 |
T14732 |
amod |
ɛy,globin |
R10492 |
T14908 |
T14909 |
amod |
mutant,mice |
R10493 |
T14909 |
T14906 |
pobj |
mice,of |
R10494 |
T14910 |
T14910 |
ROOT |
is,is |
R10495 |
T14732 |
T14730 |
pobj |
globin,of |
R10496 |
T14911 |
T14912 |
advmod |
only,20 |
R10497 |
T14912 |
T14913 |
nummod |
20,% |
R10498 |
T14733 |
T14727 |
prep |
in,detected |
R10499 |
T14913 |
T14914 |
npadvmod |
%,lower |
R10500 |
T14914 |
T14910 |
acomp |
lower,is |
R10501 |
T14915 |
T14914 |
prep |
than,lower |
R10502 |
T14734 |
T14736 |
det |
this,sample |
R10503 |
T14916 |
T14915 |
pobj |
that,than |
R10504 |
T14917 |
T14916 |
prep |
of,that |
R10505 |
T14918 |
T14917 |
pobj |
WT,of |
R10506 |
T14735 |
T14736 |
compound |
RNA,sample |
R10507 |
T14919 |
T14918 |
punct |
(,WT |
R10508 |
T14920 |
T14921 |
amod |
unpublished,data |
R10509 |
T14921 |
T14918 |
appos |
data,WT |
R10510 |
T14736 |
T14733 |
pobj |
sample,in |
R10511 |
T14922 |
T14918 |
punct |
),WT |
R10512 |
T14923 |
T14910 |
punct |
",",is |
R10513 |
T14737 |
T14727 |
punct |
",",detected |
R10514 |
T14924 |
T14910 |
cc |
and,is |
R10515 |
T14925 |
T14927 |
det |
this,anemia |
R10516 |
T14926 |
T14927 |
amod |
mild,anemia |
R10517 |
T14927 |
T14928 |
nsubj |
anemia,is |
R10518 |
T14928 |
T14910 |
conj |
is,is |
R10519 |
T14738 |
T14727 |
prep |
compared,detected |
R10520 |
T14929 |
T14928 |
advmod |
probably,is |
R10521 |
T14930 |
T14928 |
neg |
not,is |
R10522 |
T14931 |
T14928 |
acomp |
sufficient,is |
R10523 |
T14739 |
T14738 |
prep |
with,compared |
R10524 |
T14932 |
T14933 |
aux |
to,explain |
R10525 |
T14933 |
T14931 |
xcomp |
explain,sufficient |
R10526 |
T14740 |
T14742 |
amod |
undetectable,RNA |
R10527 |
T14741 |
T14742 |
compound |
ɛy,RNA |
R10528 |
T14934 |
T14935 |
det |
the,extent |
R10529 |
T14742 |
T14739 |
pobj |
RNA,with |
R10530 |
T14935 |
T14933 |
dobj |
extent,explain |
R10531 |
T14936 |
T14935 |
prep |
of,extent |
R10532 |
T14743 |
T14742 |
prep |
in,RNA |
R10533 |
T14937 |
T14939 |
amod |
nucleated,cells |
R10534 |
T14938 |
T14939 |
amod |
red,cells |
R10535 |
T14939 |
T14936 |
pobj |
cells,of |
R10536 |
T14744 |
T14745 |
compound |
WT,control |
R10537 |
T14940 |
T14928 |
punct |
.,is |
R10538 |
T14941 |
T14946 |
advmod |
Alternatively,play |
R10539 |
T14745 |
T14746 |
compound |
control,mice |
R10540 |
T14942 |
T14946 |
punct |
",",play |
R10541 |
T14943 |
T14946 |
nsubj |
Sox6,play |
R10542 |
T14944 |
T14943 |
nmod |
itself,Sox6 |
R10543 |
T14746 |
T14743 |
pobj |
mice,in |
R10544 |
T14945 |
T14946 |
aux |
may,play |
R10545 |
T14747 |
T14706 |
punct |
.,examined |
R10546 |
T14748 |
T14761 |
prep |
At,were |
R10547 |
T14749 |
T14750 |
det |
this,point |
R10548 |
T14946 |
T14946 |
ROOT |
play,play |
R10549 |
T14750 |
T14748 |
pobj |
point,At |
R10550 |
T14947 |
T14948 |
det |
a,role |
R10551 |
T14948 |
T14946 |
dobj |
role,play |
R10552 |
T14751 |
T14750 |
prep |
in,point |
R10553 |
T14949 |
T14948 |
prep |
in,role |
R10554 |
T14752 |
T14751 |
pobj |
development,in |
R10555 |
T14753 |
T14761 |
punct |
",",were |
R10556 |
T15047 |
T15045 |
pobj |
marrow,to |
R10557 |
T14950 |
T14952 |
amod |
red,terminal |
R10558 |
T14951 |
T14952 |
compound |
cell,terminal |
R10559 |
T14952 |
T14953 |
compound |
terminal,differentiation |
R10560 |
T15048 |
T15047 |
prep |
by,marrow |
R10561 |
T14953 |
T14949 |
pobj |
differentiation,in |
R10562 |
T14954 |
T14946 |
punct |
",",play |
R10563 |
T14955 |
T14959 |
mark |
as,shown |
R10564 |
T15049 |
T15050 |
amod |
postnatal,day |
R10565 |
T14956 |
T14959 |
nsubjpass |
it,shown |
R10566 |
T14957 |
T14959 |
aux |
has,shown |
R10567 |
T14958 |
T14959 |
auxpass |
been,shown |
R10568 |
T14959 |
T14946 |
advcl |
shown,play |
R10569 |
T14960 |
T14961 |
aux |
to,be |
R10570 |
T14961 |
T14959 |
xcomp |
be,shown |
R10571 |
T15050 |
T15048 |
pobj |
day,by |
R10572 |
T14962 |
T14964 |
det |
an,factor |
R10573 |
T14963 |
T14964 |
amod |
important,factor |
R10574 |
T14964 |
T14961 |
attr |
factor,be |
R10575 |
T15051 |
T15050 |
nummod |
10.5,day |
R10576 |
T14965 |
T14964 |
prep |
in,factor |
R10577 |
T14966 |
T14967 |
amod |
cardiac,[ |
R10578 |
T14967 |
T14969 |
nmod |
[,] |
R10579 |
T15052 |
T15041 |
punct |
.,shifted |
R10580 |
T14968 |
T14969 |
nummod |
15,] |
R10581 |
T14969 |
T14965 |
pobj |
],in |
R10582 |
T15053 |
T15055 |
det |
The,change |
R10583 |
T14970 |
T14969 |
punct |
",",] |
R10584 |
T14971 |
T14972 |
compound |
neuronal,[ |
R10585 |
T14972 |
T14974 |
nmod |
[,] |
R10586 |
T15054 |
T15055 |
amod |
accompanying,change |
R10587 |
T14973 |
T14974 |
nummod |
10,] |
R10588 |
T14974 |
T14969 |
appos |
],] |
R10589 |
T14975 |
T14974 |
punct |
",",] |
R10590 |
T15055 |
T15064 |
nsubj |
change,permit |
R10591 |
T14976 |
T14977 |
compound |
astrocytic,[ |
R10592 |
T14977 |
T14964 |
appos |
[,factor |
R10593 |
T15056 |
T15055 |
prep |
in,change |
R10594 |
T14978 |
T14979 |
nummod |
11,] |
R10595 |
T14979 |
T14964 |
conj |
],factor |
R10596 |
T14980 |
T14979 |
punct |
",",] |
R10597 |
T15057 |
T15058 |
det |
the,microenvironment |
R10598 |
T14981 |
T14979 |
cc |
and,] |
R10599 |
T14982 |
T14984 |
compound |
cartilage,programs |
R10600 |
T15058 |
T15056 |
pobj |
microenvironment,in |
R10601 |
T14983 |
T14984 |
compound |
differentiation,programs |
R10602 |
T14984 |
T14979 |
conj |
programs,] |
R10603 |
T15059 |
T15058 |
prep |
of,microenvironment |
R10604 |
T14985 |
T14986 |
compound |
[,"32,41" |
R10605 |
T14986 |
T14984 |
appos |
"32,41",programs |
R10606 |
T14987 |
T14988 |
nummod |
44,] |
R10607 |
T14988 |
T14979 |
npadvmod |
],] |
R10608 |
T15060 |
T15062 |
amod |
red,production |
R10609 |
T14989 |
T14946 |
punct |
.,play |
R10610 |
T14990 |
T14991 |
det |
The,restoration |
R10611 |
T14991 |
T15006 |
nsubj |
restoration,result |
R10612 |
T15061 |
T15062 |
compound |
cell,production |
R10613 |
T14992 |
T14991 |
prep |
of,restoration |
R10614 |
T14993 |
T14994 |
amod |
normal,enucleation |
R10615 |
T14994 |
T14992 |
pobj |
enucleation,of |
R10616 |
T14995 |
T14994 |
prep |
of,enucleation |
R10617 |
T14996 |
T14997 |
amod |
red,cells |
R10618 |
T15062 |
T15059 |
pobj |
production,of |
R10619 |
T14997 |
T14995 |
pobj |
cells,of |
R10620 |
T14998 |
T14994 |
prep |
in,enucleation |
R10621 |
T15063 |
T15064 |
aux |
may,permit |
R10622 |
T14999 |
T15000 |
amod |
Sox6-deficient,mouse |
R10623 |
T15000 |
T14998 |
pobj |
mouse,in |
R10624 |
T15001 |
T14991 |
prep |
by,restoration |
R10625 |
T15002 |
T15003 |
amod |
postnatal,day |
R10626 |
T15064 |
T15064 |
ROOT |
permit,permit |
R10627 |
T15003 |
T15001 |
pobj |
day,by |
R10628 |
T15004 |
T15003 |
nummod |
10.5,day |
R10629 |
T15065 |
T15066 |
amod |
normal,enucleation |
R10630 |
T15005 |
T15006 |
aux |
may,result |
R10631 |
T15006 |
T15006 |
ROOT |
result,result |
R10632 |
T15007 |
T15006 |
prep |
from,result |
R10633 |
T15066 |
T15064 |
dobj |
enucleation,permit |
R10634 |
T15008 |
T15009 |
amod |
functional,compensation |
R10635 |
T15009 |
T15007 |
pobj |
compensation,from |
R10636 |
T15010 |
T15009 |
prep |
of,compensation |
R10637 |
T15011 |
T15013 |
amod |
other,proteins |
R10638 |
T15067 |
T15064 |
punct |
.,permit |
R10639 |
T15012 |
T15013 |
compound |
Sox,proteins |
R10640 |
T15068 |
T15079 |
nsubj |
Identification,shed |
R10641 |
T15013 |
T15010 |
pobj |
proteins,of |
R10642 |
T15069 |
T15068 |
prep |
of,Identification |
R10643 |
T15014 |
T15015 |
punct |
(,expressed |
R10644 |
T15015 |
T15006 |
advcl |
expressed,result |
R10645 |
T15070 |
T15073 |
amod |
Sox6,genes |
R10646 |
T15016 |
T15015 |
prep |
at,expressed |
R10647 |
T15017 |
T15019 |
amod |
later,stages |
R10648 |
T15018 |
T15019 |
amod |
developmental,stages |
R10649 |
T15071 |
T15073 |
amod |
downstream,genes |
R10650 |
T15019 |
T15016 |
pobj |
stages,at |
R10651 |
T15020 |
T15006 |
punct |
),result |
R10652 |
T15072 |
T15073 |
compound |
target,genes |
R10653 |
T15021 |
T15006 |
punct |
",",result |
R10654 |
T15022 |
T15025 |
mark |
since,is |
R10655 |
T15073 |
T15069 |
pobj |
genes,of |
R10656 |
T15023 |
T15024 |
amod |
functional,redundancy |
R10657 |
T15024 |
T15025 |
nsubj |
redundancy,is |
R10658 |
T15025 |
T15006 |
advcl |
is,result |
R10659 |
T15026 |
T15028 |
det |
a,theme |
R10660 |
T15074 |
T15073 |
cc |
and,genes |
R10661 |
T15027 |
T15028 |
amod |
recurring,theme |
R10662 |
T15028 |
T15025 |
attr |
theme,is |
R10663 |
T15075 |
T15077 |
poss |
its,proteins |
R10664 |
T15029 |
T15028 |
prep |
with,theme |
R10665 |
T15030 |
T15031 |
compound |
Sox,proteins |
R10666 |
T15031 |
T15029 |
pobj |
proteins,with |
R10667 |
T15032 |
T15034 |
compound |
[,] |
R10668 |
T15033 |
T15034 |
compound |
"13,45,46",] |
R10669 |
T15034 |
T15031 |
appos |
],proteins |
R10670 |
T15076 |
T15077 |
amod |
interacting,proteins |
R10671 |
T15035 |
T15006 |
punct |
.,result |
R10672 |
T15036 |
T15041 |
advmod |
Moreover,shifted |
R10673 |
T15077 |
T15073 |
conj |
proteins,genes |
R10674 |
T15037 |
T15041 |
punct |
",",shifted |
R10675 |
T15038 |
T15041 |
nsubj |
erythropoiesis,shifted |
R10676 |
T15039 |
T15041 |
aux |
has,shifted |
R10677 |
T15078 |
T15079 |
aux |
will,shed |
R10678 |
T15040 |
T15041 |
advmod |
already,shifted |
R10679 |
T15041 |
T15041 |
ROOT |
shifted,shifted |
R10680 |
T15042 |
T15041 |
prep |
from,shifted |
R10681 |
T15079 |
T15079 |
ROOT |
shed,shed |
R10682 |
T15043 |
T15044 |
amod |
fetal,liver |
R10683 |
T15044 |
T15042 |
pobj |
liver,from |
R10684 |
T15045 |
T15041 |
prep |
to,shifted |
R10685 |
T15080 |
T15079 |
dobj |
light,shed |
R10686 |
T15046 |
T15047 |
compound |
bone,marrow |
R10687 |
T15081 |
T15079 |
prep |
on,shed |
R10688 |
T15082 |
T15083 |
det |
the,role |
R10689 |
T15083 |
T15081 |
pobj |
role,on |
R10690 |
T15084 |
T15083 |
prep |
of,role |
R10691 |
T15101 |
T15098 |
conj |
in,in |
R10692 |
T15102 |
T15103 |
amod |
vitro,analyses |
R10693 |
T15085 |
T15084 |
pobj |
Sox6,of |
R10694 |
T15103 |
T15101 |
pobj |
analyses,in |
R10695 |
T15104 |
T15104 |
ROOT |
suggest,suggest |
R10696 |
T15105 |
T15111 |
mark |
that,be |
R10697 |
T15086 |
T15083 |
prep |
in,role |
R10698 |
T15106 |
T15111 |
nsubj |
reactivation,be |
R10699 |
T15107 |
T15106 |
prep |
of,reactivation |
R10700 |
T15087 |
T15089 |
amod |
red,terminal |
R10701 |
T15108 |
T15109 |
amod |
human,ɛ-globin |
R10702 |
T15109 |
T15107 |
pobj |
ɛ-globin,of |
R10703 |
T15088 |
T15089 |
compound |
cell,terminal |
R10704 |
T15110 |
T15111 |
aux |
would,be |
R10705 |
T15111 |
T15104 |
ccomp |
be,suggest |
R10706 |
T15112 |
T15113 |
advmod |
therapeutically,beneficial |
R10707 |
T15089 |
T15090 |
compound |
terminal,differentiation |
R10708 |
T15113 |
T15111 |
acomp |
beneficial,be |
R10709 |
T15114 |
T15113 |
prep |
to,beneficial |
R10710 |
T15115 |
T15114 |
pobj |
adults,to |
R10711 |
T15090 |
T15086 |
pobj |
differentiation,in |
R10712 |
T15116 |
T15115 |
prep |
with,adults |
R10713 |
T15117 |
T15119 |
amod |
sickle,disease |
R10714 |
T15118 |
T15119 |
compound |
cell,disease |
R10715 |
T15091 |
T15090 |
cc |
and,differentiation |
R10716 |
T15119 |
T15116 |
pobj |
disease,with |
R10717 |
T15120 |
T15122 |
nmod |
[,] |
R10718 |
T15121 |
T15122 |
nummod |
47,] |
R10719 |
T15122 |
T15115 |
appos |
],adults |
R10720 |
T15123 |
T15111 |
punct |
",",be |
R10721 |
T15124 |
T15111 |
advcl |
providing,be |
R10722 |
T15092 |
T15094 |
det |
the,process |
R10723 |
T15125 |
T15126 |
det |
a,rationale |
R10724 |
T15126 |
T15124 |
dobj |
rationale,providing |
R10725 |
T15127 |
T15126 |
prep |
for,rationale |
R10726 |
T15128 |
T15129 |
amod |
detailed,investigations |
R10727 |
T15093 |
T15094 |
compound |
enucleation,process |
R10728 |
T15129 |
T15127 |
pobj |
investigations,for |
R10729 |
T15130 |
T15129 |
prep |
into,investigations |
R10730 |
T15131 |
T15133 |
det |
the,basis |
R10731 |
T15094 |
T15090 |
conj |
process,differentiation |
R10732 |
T15132 |
T15133 |
amod |
molecular,basis |
R10733 |
T15133 |
T15130 |
pobj |
basis,into |
R10734 |
T15134 |
T15133 |
prep |
of,basis |
R10735 |
T15095 |
T15079 |
punct |
.,shed |
R10736 |
T15135 |
T15136 |
compound |
ɛ-globin,gene |
R10737 |
T15136 |
T15137 |
compound |
gene,silencing |
R10738 |
T15137 |
T15134 |
pobj |
silencing,of |
R10739 |
T15096 |
T15104 |
advmod |
Recently,suggest |
R10740 |
T15138 |
T15104 |
punct |
.,suggest |
R10741 |
T15139 |
T15141 |
det |
The,study |
R10742 |
T15140 |
T15141 |
amod |
present,study |
R10743 |
T15097 |
T15104 |
punct |
",",suggest |
R10744 |
T15141 |
T15142 |
nsubj |
study,identifies |
R10745 |
T15142 |
T15142 |
ROOT |
identifies,identifies |
R10746 |
T15098 |
T15104 |
prep |
in,suggest |
R10747 |
T15143 |
T15145 |
det |
a,repressor |
R10748 |
T15144 |
T15145 |
compound |
novel,repressor |
R10749 |
T15099 |
T15098 |
pobj |
vivo,in |
R10750 |
T15145 |
T15142 |
dobj |
repressor,identifies |
R10751 |
T15146 |
T15145 |
punct |
",",repressor |
R10752 |
T15100 |
T15098 |
cc |
and,in |
R10753 |
T15244 |
T15244 |
ROOT |
proposed,proposed |
R10754 |
T15245 |
T15247 |
compound |
[,] |
R10755 |
T15147 |
T15145 |
appos |
Sox6,repressor |
R10756 |
T15246 |
T15247 |
compound |
"49,50",] |
R10757 |
T15148 |
T15145 |
punct |
",",repressor |
R10758 |
T15149 |
T15150 |
nsubj |
which,binds |
R10759 |
T15247 |
T15244 |
dobj |
],proposed |
R10760 |
T15150 |
T15145 |
relcl |
binds,repressor |
R10761 |
T15151 |
T15150 |
prep |
to,binds |
R10762 |
T15248 |
T15244 |
punct |
.,proposed |
R10763 |
T15152 |
T15155 |
det |
the,promoter |
R10764 |
T15153 |
T15155 |
amod |
ɛy,promoter |
R10765 |
T15154 |
T15155 |
amod |
proximal,promoter |
R10766 |
T15155 |
T15151 |
pobj |
promoter,to |
R10767 |
T15156 |
T15145 |
punct |
",",repressor |
R10768 |
T15157 |
T15142 |
advmod |
potentially,identifies |
R10769 |
T15249 |
T15276 |
advmod |
Thus,reveal |
R10770 |
T15158 |
T15142 |
prep |
as,identifies |
R10771 |
T15159 |
T15158 |
pobj |
part,as |
R10772 |
T15160 |
T15159 |
prep |
of,part |
R10773 |
T15161 |
T15164 |
det |
a,complex |
R10774 |
T15250 |
T15276 |
punct |
",",reveal |
R10775 |
T15162 |
T15164 |
amod |
larger,complex |
R10776 |
T15163 |
T15164 |
compound |
repression,complex |
R10777 |
T15164 |
T15160 |
pobj |
complex,of |
R10778 |
T15251 |
T15276 |
nsubj |
elucidation,reveal |
R10779 |
T15165 |
T15142 |
punct |
.,identifies |
R10780 |
T15166 |
T15173 |
mark |
Because,are |
R10781 |
T15252 |
T15251 |
prep |
of,elucidation |
R10782 |
T15167 |
T15168 |
compound |
murine,Sox6 |
R10783 |
T15168 |
T15173 |
nsubj |
Sox6,are |
R10784 |
T15169 |
T15168 |
cc |
and,Sox6 |
R10785 |
T15253 |
T15256 |
det |
the,mechanism |
R10786 |
T15170 |
T15172 |
poss |
its,counterpart |
R10787 |
T15254 |
T15256 |
amod |
Sox6,mechanism |
R10788 |
T15255 |
T15256 |
compound |
repression,mechanism |
R10789 |
T15171 |
T15172 |
amod |
human,counterpart |
R10790 |
T15172 |
T15168 |
conj |
counterpart,Sox6 |
R10791 |
T15256 |
T15252 |
pobj |
mechanism,of |
R10792 |
T15173 |
T15187 |
advcl |
are,is |
R10793 |
T15174 |
T15175 |
nummod |
94,% |
R10794 |
T15175 |
T15176 |
npadvmod |
%,identical |
R10795 |
T15257 |
T15256 |
cc |
and,mechanism |
R10796 |
T15176 |
T15173 |
acomp |
identical,are |
R10797 |
T15177 |
T15176 |
prep |
at,identical |
R10798 |
T15178 |
T15181 |
det |
the,level |
R10799 |
T15258 |
T15256 |
conj |
identification,mechanism |
R10800 |
T15179 |
T15181 |
amod |
amino,level |
R10801 |
T15180 |
T15181 |
compound |
acid,level |
R10802 |
T15259 |
T15258 |
prep |
of,identification |
R10803 |
T15181 |
T15177 |
pobj |
level,at |
R10804 |
T15182 |
T15184 |
nmod |
[,] |
R10805 |
T15260 |
T15261 |
amod |
other,components |
R10806 |
T15183 |
T15184 |
nummod |
48,] |
R10807 |
T15184 |
T15181 |
appos |
],level |
R10808 |
T15185 |
T15187 |
punct |
",",is |
R10809 |
T15186 |
T15187 |
nsubj |
it,is |
R10810 |
T15261 |
T15259 |
pobj |
components,of |
R10811 |
T15187 |
T15187 |
ROOT |
is,is |
R10812 |
T15188 |
T15187 |
acomp |
possible,is |
R10813 |
T15189 |
T15194 |
mark |
that,be |
R10814 |
T15262 |
T15261 |
prep |
of,components |
R10815 |
T15190 |
T15191 |
compound |
human,Sox6 |
R10816 |
T15191 |
T15194 |
nsubj |
Sox6,be |
R10817 |
T15192 |
T15194 |
aux |
may,be |
R10818 |
T15193 |
T15194 |
advmod |
also,be |
R10819 |
T15194 |
T15187 |
ccomp |
be,is |
R10820 |
T15263 |
T15265 |
det |
the,complex |
R10821 |
T15195 |
T15194 |
acomp |
important,be |
R10822 |
T15196 |
T15194 |
prep |
in,be |
R10823 |
T15197 |
T15198 |
amod |
human,ɛ |
R10824 |
T15264 |
T15265 |
compound |
Sox6-containing,complex |
R10825 |
T15198 |
T15199 |
compound |
ɛ,globin |
R10826 |
T15199 |
T15200 |
compound |
globin,silencing |
R10827 |
T15200 |
T15196 |
pobj |
silencing,in |
R10828 |
T15265 |
T15262 |
pobj |
complex,of |
R10829 |
T15201 |
T15187 |
punct |
.,is |
R10830 |
T15202 |
T15203 |
expl |
There,is |
R10831 |
T15203 |
T15203 |
ROOT |
is,is |
R10832 |
T15266 |
T15267 |
aux |
may,further |
R10833 |
T15204 |
T15206 |
amod |
significant,homology |
R10834 |
T15267 |
T15269 |
advmod |
further,understanding |
R10835 |
T15205 |
T15206 |
compound |
sequence,homology |
R10836 |
T15206 |
T15203 |
attr |
homology,is |
R10837 |
T15207 |
T15206 |
prep |
between,homology |
R10838 |
T15208 |
T15214 |
det |
the,regions |
R10839 |
T15268 |
T15269 |
poss |
our,understanding |
R10840 |
T15209 |
T15214 |
amod |
human,regions |
R10841 |
T15210 |
T15209 |
cc |
and,human |
R10842 |
T15269 |
T15256 |
appos |
understanding,mechanism |
R10843 |
T15211 |
T15209 |
conj |
mouse,human |
R10844 |
T15212 |
T15214 |
compound |
ɛ,regions |
R10845 |
T15213 |
T15214 |
compound |
promoter,regions |
R10846 |
T15214 |
T15207 |
pobj |
regions,between |
R10847 |
T15270 |
T15269 |
prep |
of,understanding |
R10848 |
T15215 |
T15203 |
punct |
",",is |
R10849 |
T15216 |
T15203 |
cc |
and,is |
R10850 |
T15271 |
T15273 |
compound |
ɛ,regulation |
R10851 |
T15217 |
T15219 |
det |
the,promoter |
R10852 |
T15218 |
T15219 |
amod |
human,promoter |
R10853 |
T15219 |
T15220 |
nsubj |
promoter,contains |
R10854 |
T15272 |
T15273 |
compound |
globin,regulation |
R10855 |
T15220 |
T15203 |
conj |
contains,is |
R10856 |
T15221 |
T15222 |
advmod |
at,least |
R10857 |
T15222 |
T15223 |
advmod |
least,two |
R10858 |
T15273 |
T15270 |
pobj |
regulation,of |
R10859 |
T15223 |
T15227 |
nummod |
two,sites |
R10860 |
T15224 |
T15227 |
amod |
potential,sites |
R10861 |
T15274 |
T15269 |
cc |
and,understanding |
R10862 |
T15225 |
T15227 |
amod |
Sox6,sites |
R10863 |
T15226 |
T15227 |
amod |
binding,sites |
R10864 |
T15227 |
T15220 |
dobj |
sites,contains |
R10865 |
T15275 |
T15276 |
advmod |
potentially,reveal |
R10866 |
T15228 |
T15220 |
punct |
.,contains |
R10867 |
T15229 |
T15244 |
advmod |
Indeed,proposed |
R10868 |
T15230 |
T15244 |
punct |
",",proposed |
R10869 |
T15231 |
T15232 |
det |
the,existence |
R10870 |
T15232 |
T15244 |
nsubjpass |
existence,proposed |
R10871 |
T15233 |
T15232 |
prep |
of,existence |
R10872 |
T15276 |
T15276 |
ROOT |
reveal,reveal |
R10873 |
T15234 |
T15235 |
det |
a,silencer |
R10874 |
T15235 |
T15233 |
pobj |
silencer,of |
R10875 |
T15236 |
T15235 |
prep |
of,silencer |
R10876 |
T15237 |
T15241 |
det |
the,gene |
R10877 |
T15277 |
T15279 |
amod |
additional,targets |
R10878 |
T15238 |
T15239 |
amod |
human,ɛ |
R10879 |
T15239 |
T15241 |
compound |
ɛ,gene |
R10880 |
T15278 |
T15279 |
amod |
molecular,targets |
R10881 |
T15240 |
T15241 |
compound |
globin,gene |
R10882 |
T15241 |
T15236 |
pobj |
gene,of |
R10883 |
T15242 |
T15244 |
aux |
has,proposed |
R10884 |
T15279 |
T15276 |
dobj |
targets,reveal |
R10885 |
T15243 |
T15244 |
auxpass |
been,proposed |
R10886 |
T15280 |
T15279 |
prep |
for,targets |
R10887 |
T15281 |
T15282 |
det |
the,treatment |
R10888 |
T15282 |
T15280 |
pobj |
treatment,for |
R10889 |
T15283 |
T15282 |
prep |
of,treatment |
R10890 |
T15284 |
T15285 |
compound |
sickle,cell |
R10891 |
T15285 |
T15286 |
compound |
cell,anemia |
R10892 |
T15286 |
T15283 |
pobj |
anemia,of |
R10893 |
T15287 |
T15286 |
cc |
and,anemia |
R10894 |
T15288 |
T15289 |
compound |
β,thalassemias |
R10895 |
T15289 |
T15286 |
conj |
thalassemias,anemia |
R10897 |
T15290 |
T15276 |
punct |
.,reveal |
R11478 |
T16562 |
T16563 |
amod |
Plasmid,construction |
R11479 |
T16563 |
T16563 |
ROOT |
construction,construction |
R11480 |
T16564 |
T16563 |
punct |
.,construction |
R11481 |
T16565 |
T16570 |
det |
The,plasmid |
R11482 |
T16566 |
T16567 |
amod |
ɛy,promoter |
R11483 |
T16567 |
T16570 |
compound |
promoter,plasmid |
R11484 |
T16568 |
T16570 |
compound |
deletion,plasmid |
R11485 |
T16569 |
T16570 |
compound |
reporter,plasmid |
R11486 |
T16570 |
T16575 |
nsubjpass |
plasmid,generated |
R11487 |
T16571 |
T16570 |
punct |
(,plasmid |
R11488 |
T16572 |
T16570 |
appos |
E-luc,plasmid |
R11489 |
T16573 |
T16570 |
punct |
),plasmid |
R11490 |
T16574 |
T16575 |
auxpass |
was,generated |
R11491 |
T16575 |
T16575 |
ROOT |
generated,generated |
R11492 |
T16576 |
T16575 |
agent |
by,generated |
R11493 |
T16577 |
T16578 |
compound |
PCR,amplification |
R11494 |
T16578 |
T16576 |
pobj |
amplification,by |
R11495 |
T16579 |
T16578 |
prep |
of,amplification |
R11496 |
T16580 |
T16583 |
det |
the,promoter |
R11497 |
T16581 |
T16583 |
amod |
ɛy,promoter |
R11498 |
T16582 |
T16583 |
amod |
proximal,promoter |
R11499 |
T16583 |
T16579 |
pobj |
promoter,of |
R11500 |
T16584 |
T16575 |
punct |
.,generated |
R11501 |
T16585 |
T16587 |
det |
A,fragment |
R11502 |
T16586 |
T16587 |
compound |
2.2-kb,fragment |
R11503 |
T16587 |
T16588 |
compound |
fragment,upstream |
R11504 |
T16588 |
T16599 |
nsubjpass |
upstream,used |
R11505 |
T16589 |
T16588 |
prep |
of,upstream |
R11506 |
T16590 |
T16593 |
det |
the,initiation |
R11507 |
T16591 |
T16593 |
amod |
ɛy,initiation |
R11508 |
T16592 |
T16593 |
compound |
globin,initiation |
R11509 |
T16593 |
T16594 |
compound |
initiation,codon |
R11510 |
T16594 |
T16589 |
pobj |
codon,of |
R11511 |
T16595 |
T16596 |
punct |
(,ATG |
R11512 |
T16596 |
T16594 |
appos |
ATG,codon |
R11513 |
T16597 |
T16594 |
punct |
),codon |
R11514 |
T16598 |
T16599 |
auxpass |
was,used |
R11515 |
T16599 |
T16599 |
ROOT |
used,used |
R11516 |
T16600 |
T16599 |
punct |
",",used |
R11517 |
T16601 |
T16605 |
mark |
because,shown |
R11518 |
T16602 |
T16605 |
nsubjpass |
it,shown |
R11519 |
T16603 |
T16605 |
aux |
has,shown |
R11520 |
T16604 |
T16605 |
auxpass |
been,shown |
R11521 |
T16605 |
T16599 |
advcl |
shown,used |
R11522 |
T16606 |
T16615 |
mark |
that,located |
R11523 |
T16607 |
T16608 |
det |
all,sequences |
R11524 |
T16608 |
T16615 |
nsubjpass |
sequences,located |
R11525 |
T16609 |
T16608 |
acl |
required,sequences |
R11526 |
T16610 |
T16609 |
prep |
for,required |
R11527 |
T16611 |
T16612 |
compound |
ɛ,gene |
R11528 |
T16612 |
T16610 |
pobj |
gene,for |
R11529 |
T16613 |
T16612 |
acl |
silencing,gene |
R11530 |
T16614 |
T16615 |
auxpass |
are,located |
R11531 |
T16615 |
T16605 |
ccomp |
located,shown |
R11532 |
T16616 |
T16615 |
prep |
within,located |
R11533 |
T16617 |
T16620 |
det |
a,fragment |
R11534 |
T16618 |
T16620 |
compound |
3.7-kb,fragment |
R11535 |
T16619 |
T16620 |
compound |
EcoRI,fragment |
R11536 |
T16620 |
T16616 |
pobj |
fragment,within |
R11537 |
T16621 |
T16620 |
acl |
containing,fragment |
R11538 |
T16622 |
T16624 |
quantmod |
about,kb |
R11539 |
T16623 |
T16624 |
nummod |
2,kb |
R11540 |
T16624 |
T16621 |
dobj |
kb,containing |
R11541 |
T16625 |
T16624 |
prep |
of,kb |
R11542 |
T16626 |
T16625 |
pobj |
sequence,of |
R11543 |
T16627 |
T16621 |
advmod |
upstream,containing |
R11544 |
T16628 |
T16627 |
prep |
of,upstream |
R11545 |
T16629 |
T16634 |
det |
the,site |
R11546 |
T16630 |
T16634 |
nmod |
ɛ,site |
R11547 |
T16631 |
T16634 |
compound |
globin,site |
R11548 |
T16632 |
T16633 |
compound |
gene,cap |
R11549 |
T16633 |
T16634 |
compound |
cap,site |
R11550 |
T16634 |
T16628 |
pobj |
site,of |
R11551 |
T16635 |
T16634 |
appos |
[,site |
R11552 |
T16636 |
T16637 |
nummod |
50,] |
R11553 |
T16637 |
T16634 |
appos |
],site |
R11554 |
T16638 |
T16599 |
punct |
.,used |
R11555 |
T16639 |
T16640 |
compound |
Nucleotide,numbering |
R11556 |
T16640 |
T16641 |
nsubj |
numbering,is |
R11557 |
T16641 |
T16641 |
ROOT |
is,is |
R11558 |
T16642 |
T16641 |
acomp |
relative,is |
R11559 |
T16643 |
T16642 |
prep |
to,relative |
R11560 |
T16644 |
T16645 |
det |
the,transcription |
R11561 |
T16645 |
T16646 |
nsubj |
transcription,start |
R11562 |
T16646 |
T16641 |
conj |
start,is |
R11563 |
T16647 |
T16646 |
dobj |
site,start |
R11564 |
T16648 |
T16641 |
punct |
.,is |
R11565 |
T16649 |
T16652 |
det |
The,site |
R11566 |
T16650 |
T16652 |
amod |
transcriptional,site |
R11567 |
T16651 |
T16652 |
compound |
start,site |
R11568 |
T16652 |
T16654 |
nsubjpass |
site,based |
R11569 |
T16653 |
T16654 |
auxpass |
is,based |
R11570 |
T16654 |
T16654 |
ROOT |
based,based |
R11571 |
T16655 |
T16654 |
prep |
on,based |
R11572 |
T16656 |
T16658 |
det |
the,cDNA |
R11573 |
T16657 |
T16658 |
amod |
longest,cDNA |
R11574 |
T16658 |
T16655 |
pobj |
cDNA,on |
R11575 |
T16659 |
T16658 |
prep |
in,cDNA |
R11576 |
T16660 |
T16661 |
det |
the,Fantom |
R11577 |
T16661 |
T16659 |
pobj |
Fantom,in |
R11578 |
T16662 |
T16661 |
punct |
(,Fantom |
R11579 |
T16663 |
T16664 |
compound |
Functional,Annotation |
R11580 |
T16664 |
T16661 |
appos |
Annotation,Fantom |
R11581 |
T16665 |
T16664 |
prep |
of,Annotation |
R11582 |
T16666 |
T16665 |
pobj |
Mouse,of |
R11583 |
T16667 |
T16661 |
punct |
),Fantom |
R11584 |
T16668 |
T16658 |
conj |
database,cDNA |
R11585 |
T16669 |
T16654 |
punct |
.,based |
R11586 |
T16670 |
T16672 |
det |
The,primers |
R11587 |
T16671 |
T16672 |
compound |
PCR,primers |
R11588 |
T16672 |
T16673 |
nsubj |
primers,contained |
R11589 |
T16673 |
T16673 |
ROOT |
contained,contained |
R11590 |
T16674 |
T16677 |
nmod |
XhoI,sites |
R11591 |
T16675 |
T16674 |
cc |
and,XhoI |
R11592 |
T16676 |
T16674 |
conj |
HindIII,XhoI |
R11593 |
T16677 |
T16673 |
dobj |
sites,contained |
R11594 |
T16678 |
T16680 |
nsubjpass |
that,used |
R11595 |
T16679 |
T16680 |
auxpass |
were,used |
R11596 |
T16680 |
T16677 |
relcl |
used,sites |
R11597 |
T16681 |
T16682 |
aux |
to,clone |
R11598 |
T16682 |
T16680 |
xcomp |
clone,used |
R11599 |
T16683 |
T16686 |
det |
the,fragment |
R11600 |
T16684 |
T16686 |
amod |
ɛy,fragment |
R11601 |
T16685 |
T16686 |
compound |
promoter,fragment |
R11602 |
T16686 |
T16682 |
dobj |
fragment,clone |
R11603 |
T16687 |
T16682 |
advmod |
upstream,clone |
R11604 |
T16688 |
T16687 |
prep |
of,upstream |
R11605 |
T16689 |
T16692 |
det |
the,gene |
R11606 |
T16690 |
T16692 |
amod |
firefly,gene |
R11607 |
T16691 |
T16692 |
compound |
luciferase,gene |
R11608 |
T16692 |
T16688 |
pobj |
gene,of |
R11609 |
T16693 |
T16692 |
prep |
in,gene |
R11610 |
T16694 |
T16695 |
compound |
pGL3,Basic |
R11611 |
T16695 |
T16693 |
pobj |
Basic,in |
R11612 |
T16696 |
T16699 |
punct |
(,Madison |
R11613 |
T16697 |
T16699 |
nmod |
Promega,Madison |
R11614 |
T16698 |
T16697 |
punct |
",",Promega |
R11615 |
T16699 |
T16692 |
appos |
Madison,gene |
R11616 |
T16700 |
T16699 |
punct |
",",Madison |
R11617 |
T16701 |
T16699 |
npadvmod |
Wisconsin,Madison |
R11618 |
T16702 |
T16701 |
punct |
",",Wisconsin |
R11619 |
T16703 |
T16704 |
compound |
United,States |
R11620 |
T16704 |
T16701 |
appos |
States,Wisconsin |
R11621 |
T16705 |
T16699 |
punct |
),Madison |
R11622 |
T16706 |
T16673 |
punct |
.,contained |
R11623 |
T16707 |
T16710 |
det |
A,fragment |
R11624 |
T16708 |
T16710 |
amod |
2.5-kb,fragment |
R11625 |
T16709 |
T16710 |
compound |
SstI/XhoI,fragment |
R11626 |
T16710 |
T16724 |
nsubjpass |
fragment,inserted |
R11627 |
T16711 |
T16710 |
prep |
of,fragment |
R11628 |
T16712 |
T16713 |
quantmod |
μLCRβ,9.3 |
R11629 |
T16713 |
T16711 |
pobj |
9.3,of |
R11630 |
T16714 |
T16724 |
punct |
(,inserted |
R11631 |
T16715 |
T16716 |
compound |
micro,LCR |
R11632 |
T16716 |
T16724 |
nsubjpass |
LCR,inserted |
R11633 |
T16717 |
T16720 |
punct |
;,] |
R11634 |
T16718 |
T16720 |
compound |
[,] |
R11635 |
T16719 |
T16720 |
nummod |
31,] |
R11636 |
T16720 |
T16716 |
appos |
],LCR |
R11637 |
T16721 |
T16720 |
punct |
),] |
R11638 |
T16722 |
T16724 |
auxpass |
was,inserted |
R11639 |
T16723 |
T16724 |
advmod |
then,inserted |
R11640 |
T16724 |
T16724 |
ROOT |
inserted,inserted |
R11641 |
T16725 |
T16724 |
advmod |
upstream,inserted |
R11642 |
T16726 |
T16725 |
prep |
of,upstream |
R11643 |
T16727 |
T16729 |
det |
the,promoter |
R11644 |
T16728 |
T16729 |
amod |
ɛy,promoter |
R11645 |
T16729 |
T16726 |
pobj |
promoter,of |
R11646 |
T16730 |
T16729 |
prep |
in,promoter |
R11647 |
T16731 |
T16735 |
det |
the,plasmid |
R11648 |
T16732 |
T16735 |
amod |
above,plasmid |
R11649 |
T16733 |
T16735 |
amod |
pGL3,plasmid |
R11650 |
T16734 |
T16735 |
amod |
Basic,plasmid |
R11651 |
T16735 |
T16730 |
pobj |
plasmid,in |
R11652 |
T16736 |
T16724 |
punct |
",",inserted |
R11653 |
T16737 |
T16724 |
advcl |
resulting,inserted |
R11654 |
T16738 |
T16737 |
prep |
in,resulting |
R11655 |
T16739 |
T16740 |
det |
a,reporter |
R11656 |
T16740 |
T16738 |
pobj |
reporter,in |
R11657 |
T16741 |
T16724 |
punct |
construct,inserted |
R11658 |
T16742 |
T16747 |
prep |
in,driven |
R11659 |
T16743 |
T16742 |
pobj |
which,in |
R11660 |
T16744 |
T16745 |
amod |
luciferase,expression |
R11661 |
T16745 |
T16747 |
nsubjpass |
expression,driven |
R11662 |
T16746 |
T16747 |
auxpass |
is,driven |
R11663 |
T16747 |
T16724 |
advcl |
driven,inserted |
R11664 |
T16748 |
T16747 |
agent |
by,driven |
R11665 |
T16749 |
T16751 |
det |
the,promoter |
R11666 |
T16750 |
T16751 |
amod |
ɛy,promoter |
R11667 |
T16751 |
T16748 |
pobj |
promoter,by |
R11668 |
T16752 |
T16724 |
punct |
.,inserted |
R11669 |
T16753 |
T16754 |
det |
A,series |
R11670 |
T16754 |
T16763 |
nsubjpass |
series,generated |
R11671 |
T16755 |
T16754 |
prep |
of,series |
R11672 |
T16756 |
T16757 |
compound |
deletion,constructs |
R11673 |
T16757 |
T16755 |
pobj |
constructs,of |
R11674 |
T16758 |
T16757 |
prep |
of,constructs |
R11675 |
T16759 |
T16761 |
det |
the,promoter |
R11676 |
T16760 |
T16761 |
amod |
ɛy,promoter |
R11677 |
T16761 |
T16758 |
pobj |
promoter,of |
R11678 |
T16762 |
T16763 |
auxpass |
were,generated |
R11679 |
T16763 |
T16763 |
ROOT |
generated,generated |
R11680 |
T16764 |
T16763 |
advmod |
similarly,generated |
R11681 |
T16765 |
T16763 |
punct |
.,generated |
R11682 |
T16766 |
T16767 |
amod |
Forward,primers |
R11683 |
T16767 |
T16772 |
nsubj |
primers,include |
R11684 |
T16768 |
T16767 |
prep |
with,primers |
R11685 |
T16769 |
T16771 |
det |
an,site |
R11686 |
T16770 |
T16771 |
compound |
XhoI,site |
R11687 |
T16771 |
T16768 |
pobj |
site,with |
R11688 |
T16772 |
T16772 |
ROOT |
include,include |
R11689 |
T16773 |
T16772 |
punct |
:,include |
R11690 |
T16774 |
T16772 |
dobj |
MHB1457,include |
R11691 |
T16775 |
T16774 |
punct |
",",MHB1457 |
R11692 |
T16776 |
T16779 |
nummod |
5,′ |
R11693 |
T16777 |
T16778 |
quantmod |
′,CCGCTCGAGTGCTAGGCAAACACTCA3 |
R11694 |
T16778 |
T16779 |
nummod |
CCGCTCGAGTGCTAGGCAAACACTCA3,′ |
R11695 |
T16779 |
T16774 |
appos |
′,MHB1457 |
R11696 |
T16780 |
T16779 |
punct |
(,′ |
R11697 |
T16781 |
T16779 |
nmod |
−,′ |
R11698 |
T16782 |
T16781 |
pobj |
2077,− |
R11699 |
T16783 |
T16779 |
prep |
to,′ |
R11700 |
T16784 |
T16783 |
pobj |
−,to |
R11701 |
T16785 |
T16784 |
appos |
2052,− |
R11702 |
T16786 |
T16784 |
punct |
),− |
R11703 |
T16787 |
T16783 |
punct |
;,to |
R11704 |
T16788 |
T16783 |
pobj |
MHB1503,to |
R11705 |
T16789 |
T16788 |
punct |
",",MHB1503 |
R11706 |
T16790 |
T16791 |
nummod |
5,′ |
R11707 |
T16791 |
T16788 |
appos |
′,MHB1503 |
R11708 |
T16792 |
T16793 |
nummod |
CCGCTCGAGTCTCTACACTGTCACTCCCTG3,′ |
R11709 |
T16793 |
T16791 |
appos |
′,′ |
R11710 |
T16794 |
T16795 |
punct |
(,− |
R11711 |
T16795 |
T16793 |
appos |
−,′ |
R11712 |
T16796 |
T16795 |
nummod |
634,− |
R11713 |
T16797 |
T16796 |
prep |
to,634 |
R11714 |
T16798 |
T16797 |
pobj |
−,to |
R11715 |
T16799 |
T16798 |
appos |
605,− |
R11716 |
T16800 |
T16798 |
punct |
),− |
R11717 |
T16801 |
T16802 |
punct |
;,MHB1505 |
R11718 |
T16802 |
T16793 |
appos |
MHB1505,′ |
R11719 |
T16803 |
T16802 |
punct |
",",MHB1505 |
R11720 |
T16804 |
T16805 |
nummod |
5,′ |
R11721 |
T16805 |
T16807 |
dep |
′,′ |
R11722 |
T16806 |
T16807 |
nummod |
CCGCTCGAGGGAGCCAAAAAAAGAATGC3,′ |
R11723 |
T16807 |
T16802 |
appos |
′,MHB1505 |
R11724 |
T16808 |
T16809 |
punct |
(,− |
R11725 |
T16809 |
T16816 |
nmod |
−,MHB1506 |
R11726 |
T16810 |
T16809 |
nummod |
197,− |
R11727 |
T16811 |
T16815 |
quantmod |
to,; |
R11728 |
T16812 |
T16811 |
pobj |
−,to |
R11729 |
T16813 |
T16812 |
appos |
169,− |
R11730 |
T16814 |
T16812 |
punct |
),− |
R11731 |
T16815 |
T16816 |
punct |
;,MHB1506 |
R11732 |
T16816 |
T16830 |
nmod |
MHB1506,MHB1532 |
R11733 |
T16817 |
T16816 |
punct |
",",MHB1506 |
R11734 |
T16818 |
T16819 |
nummod |
5,′ |
R11735 |
T16819 |
T16830 |
nmod |
′,MHB1532 |
R11736 |
T16820 |
T16821 |
nummod |
CCGCTCGAGCTGACCAATGGCTTCAAAG3,′ |
R11737 |
T16821 |
T16819 |
appos |
′,′ |
R11738 |
T16822 |
T16823 |
punct |
(,− |
R11739 |
T16823 |
T16821 |
appos |
−,′ |
R11740 |
T16824 |
T16823 |
nummod |
85,− |
R11741 |
T16825 |
T16824 |
prep |
to,85 |
R11742 |
T16826 |
T16825 |
pobj |
−,to |
R11743 |
T16827 |
T16826 |
appos |
58,− |
R11744 |
T16828 |
T16826 |
punct |
),− |
R11745 |
T16829 |
T16830 |
punct |
;,MHB1532 |
R11746 |
T16830 |
T16807 |
appos |
MHB1532,′ |
R11747 |
T16831 |
T16830 |
punct |
",",MHB1532 |
R11748 |
T16832 |
T16833 |
nummod |
5,′ |
R11749 |
T16833 |
T16835 |
dep |
′,′ |
R11750 |
T16834 |
T16835 |
nummod |
CCGCTCGAGAATGCAGAACAAAGGGTCAGA3,′ |
R11751 |
T16835 |
T16830 |
appos |
′,MHB1532 |
R11752 |
T16836 |
T16837 |
punct |
(,− |
R11753 |
T16837 |
T16835 |
appos |
−,′ |
R11754 |
T16838 |
T16837 |
nummod |
63,− |
R11755 |
T16839 |
T16838 |
prep |
to,63 |
R11756 |
T16840 |
T16839 |
pobj |
−,to |
R11757 |
T16841 |
T16840 |
appos |
34,− |
R11758 |
T16842 |
T16840 |
punct |
),− |
R11759 |
T16843 |
T16837 |
punct |
;,− |
R11760 |
T16844 |
T16837 |
cc |
and,− |
R11761 |
T16845 |
T16835 |
appos |
MHB1507,′ |
R11762 |
T16846 |
T16845 |
punct |
",",MHB1507 |
R11763 |
T16847 |
T16848 |
nummod |
5,′ |
R11764 |
T16848 |
T16849 |
compound |
′,CCGCTCGAGGTCTGCGAAGAATAAAAGGC |
R11765 |
T16849 |
T16851 |
quantmod |
CCGCTCGAGGTCTGCGAAGAATAAAAGGC,′ |
R11766 |
T16850 |
T16851 |
nummod |
3,′ |
R11767 |
T16851 |
T16835 |
appos |
′,′ |
R11768 |
T16852 |
T16853 |
punct |
(,− |
R11769 |
T16853 |
T16851 |
appos |
−,′ |
R11770 |
T16854 |
T16853 |
dobj |
37,− |
R11771 |
T16855 |
T16853 |
prep |
to,− |
R11772 |
T16856 |
T16855 |
pobj |
−,to |
R11773 |
T16857 |
T16856 |
appos |
9,− |
R11774 |
T16858 |
T16856 |
punct |
),− |
R11775 |
T16859 |
T16772 |
punct |
.,include |
R11776 |
T16860 |
T16862 |
det |
All,primers |
R11777 |
T16861 |
T16862 |
amod |
forward,primers |
R11778 |
T16862 |
T16864 |
nsubjpass |
primers,used |
R11779 |
T16863 |
T16864 |
auxpass |
were,used |
R11780 |
T16864 |
T16864 |
ROOT |
used,used |
R11781 |
T16865 |
T16864 |
prep |
in,used |
R11782 |
T16866 |
T16865 |
pobj |
combination,in |
R11783 |
T16867 |
T16864 |
prep |
with,used |
R11784 |
T16868 |
T16872 |
det |
the,site |
R11785 |
T16869 |
T16870 |
compound |
reverse,primer |
R11786 |
T16870 |
T16872 |
compound |
primer,site |
R11787 |
T16871 |
T16872 |
compound |
HindIII,site |
R11788 |
T16872 |
T16867 |
pobj |
site,with |
R11789 |
T16873 |
T16872 |
punct |
:,site |
R11790 |
T16874 |
T16872 |
appos |
MHB1477,site |
R11791 |
T16875 |
T16874 |
punct |
",",MHB1477 |
R11792 |
T16876 |
T16877 |
nummod |
5,′ |
R11793 |
T16877 |
T16874 |
appos |
′,MHB1477 |
R11794 |
T16878 |
T16879 |
nummod |
CGGAAGCTTGGGAGGTTGCTGGTGA3,′ |
R11795 |
T16879 |
T16877 |
appos |
′,′ |
R11796 |
T16880 |
T16881 |
punct |
(,+45 |
R11797 |
T16881 |
T16879 |
appos |
+45,′ |
R11798 |
T16882 |
T16881 |
prep |
to,+45 |
R11799 |
T16883 |
T16882 |
pobj |
+20,to |
R11800 |
T16884 |
T16881 |
punct |
),+45 |
R11801 |
T16885 |
T16864 |
punct |
.,used |
R11802 |
T16886 |
T16890 |
amod |
Sox6-pcDNA3,] |
R11803 |
T16887 |
T16890 |
nummod |
.1,] |
R11804 |
T16888 |
T16890 |
nmod |
[,] |
R11805 |
T16889 |
T16890 |
nummod |
15,] |
R11806 |
T16890 |
T16892 |
nsubjpass |
],used |
R11807 |
T16891 |
T16892 |
auxpass |
was,used |
R11808 |
T16892 |
T16892 |
ROOT |
used,used |
R11809 |
T16893 |
T16894 |
aux |
to,overexpress |
R11810 |
T16894 |
T16892 |
xcomp |
overexpress,used |
R11811 |
T16895 |
T16894 |
dobj |
Sox6,overexpress |
R11812 |
T16896 |
T16892 |
punct |
.,used |
R11813 |
T16897 |
T16899 |
det |
A,version |
R11814 |
T16898 |
T16899 |
amod |
truncated,version |
R11815 |
T16899 |
T16904 |
nsubj |
version,construct |
R11816 |
T16900 |
T16899 |
prep |
of,version |
R11817 |
T16901 |
T16903 |
det |
the,overexpression |
R11818 |
T16902 |
T16903 |
amod |
Sox6,overexpression |
R11819 |
T16903 |
T16900 |
pobj |
overexpression,of |
R11820 |
T16904 |
T16904 |
ROOT |
construct,construct |
R11821 |
T16905 |
T16908 |
punct |
(,) |
R11822 |
T16906 |
T16908 |
nmod |
Sox6-ΔHMG-pcDNA3,) |
R11823 |
T16907 |
T16906 |
nummod |
.1,Sox6-ΔHMG-pcDNA3 |
R11824 |
T16908 |
T16904 |
punct |
),construct |
R11825 |
T16909 |
T16910 |
nsubj |
that,lacks |
R11826 |
T16910 |
T16904 |
ccomp |
lacks,construct |
R11827 |
T16911 |
T16913 |
det |
the,domain |
R11828 |
T16912 |
T16913 |
compound |
HMG,domain |
R11829 |
T16913 |
T16915 |
nsubjpass |
domain,generated |
R11830 |
T16914 |
T16915 |
auxpass |
was,generated |
R11831 |
T16915 |
T16910 |
ccomp |
generated,lacks |
R11832 |
T16916 |
T16915 |
punct |
",",generated |
R11833 |
T16917 |
T16918 |
mark |
as,described |
R11834 |
T16918 |
T16915 |
advcl |
described,generated |
R11835 |
T16919 |
T16918 |
agent |
by,described |
R11836 |
T16920 |
T16919 |
pobj |
others,by |
R11837 |
T16921 |
T16923 |
nmod |
[,] |
R11838 |
T16922 |
T16923 |
nummod |
32,] |
R11839 |
T16923 |
T16920 |
appos |
],others |
R11840 |
T16924 |
T16904 |
punct |
.,construct |
R11841 |
T16925 |
T16936 |
nsubjpass |
Mutagenesis,done |
R11842 |
T16926 |
T16925 |
prep |
of,Mutagenesis |
R11843 |
T16927 |
T16928 |
compound |
Sox/Sox6,consensus |
R11844 |
T16928 |
T16930 |
nmod |
consensus,sites |
R11845 |
T16929 |
T16930 |
amod |
binding,sites |
R11846 |
T16930 |
T16926 |
pobj |
sites,of |
R11847 |
T16931 |
T16930 |
prep |
of,sites |
R11848 |
T16932 |
T16934 |
det |
the,promoter |
R11849 |
T16933 |
T16934 |
amod |
ɛy,promoter |
R11850 |
T16934 |
T16931 |
pobj |
promoter,of |
R11851 |
T16935 |
T16936 |
auxpass |
were,done |
R11852 |
T16936 |
T16936 |
ROOT |
done,done |
R11853 |
T16937 |
T16936 |
agent |
by,done |
R11854 |
T16938 |
T16937 |
pobj |
PCR,by |
R11855 |
T16939 |
T16936 |
punct |
.,done |
R11856 |
T16940 |
T16941 |
amod |
Forward,primers |
R11857 |
T16941 |
T16951 |
nsubj |
primers,include |
R11858 |
T16942 |
T16941 |
acl |
used,primers |
R11859 |
T16943 |
T16944 |
aux |
to,generate |
R11860 |
T16944 |
T16942 |
xcomp |
generate,used |
R11861 |
T16945 |
T16950 |
det |
these,constructs |
R11862 |
T16946 |
T16950 |
amod |
mutagenized,constructs |
R11863 |
T16947 |
T16950 |
compound |
ɛy,constructs |
R11864 |
T16948 |
T16949 |
compound |
promoter,reporter |
R11865 |
T16949 |
T16950 |
compound |
reporter,constructs |
R11866 |
T16950 |
T16951 |
nsubj |
constructs,include |
R11867 |
T16951 |
T16951 |
ROOT |
include,include |
R11868 |
T16952 |
T16951 |
punct |
:,include |
R11869 |
T16953 |
T16967 |
nummod |
MHB1661,MHB1662 |
R11870 |
T16954 |
T16956 |
punct |
",",′ |
R11871 |
T16955 |
T16956 |
nummod |
5,′ |
R11872 |
T16956 |
T16967 |
nmod |
′,MHB1662 |
R11873 |
T16957 |
T16958 |
nummod |
CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3,′ |
R11874 |
T16958 |
T16956 |
appos |
′,′ |
R11875 |
T16959 |
T16960 |
punct |
(,− |
R11876 |
T16960 |
T16958 |
appos |
−,′ |
R11877 |
T16961 |
T16960 |
nummod |
63,− |
R11878 |
T16962 |
T16961 |
prep |
to,63 |
R11879 |
T16963 |
T16962 |
pobj |
−,to |
R11880 |
T16964 |
T16963 |
appos |
19,− |
R11881 |
T16965 |
T16963 |
punct |
),− |
R11882 |
T16966 |
T16967 |
punct |
;,MHB1662 |
R11883 |
T16967 |
T16951 |
dobj |
MHB1662,include |
R11884 |
T16968 |
T16967 |
punct |
",",MHB1662 |
R11885 |
T16969 |
T16970 |
nummod |
5,′ |
R11886 |
T16970 |
T16986 |
nmod |
′,CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA |
R11887 |
T16971 |
T16972 |
nummod |
CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3,′ |
R11888 |
T16972 |
T16970 |
appos |
′,′ |
R11889 |
T16973 |
T16974 |
punct |
(,− |
R11890 |
T16974 |
T16972 |
appos |
−,′ |
R11891 |
T16975 |
T16974 |
nummod |
63,− |
R11892 |
T16976 |
T16975 |
prep |
to,63 |
R11893 |
T16977 |
T16976 |
pobj |
−,to |
R11894 |
T16978 |
T16977 |
appos |
16,− |
R11895 |
T16979 |
T16977 |
punct |
),− |
R11896 |
T16980 |
T16970 |
punct |
;,′ |
R11897 |
T16981 |
T16970 |
cc |
and,′ |
R11898 |
T16982 |
T16970 |
conj |
MHB1663,′ |
R11899 |
T16983 |
T16982 |
punct |
",",MHB1663 |
R11900 |
T16984 |
T16985 |
nummod |
5,′ |
R11901 |
T16985 |
T16986 |
compound |
′,CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA |
R11902 |
T16986 |
T16967 |
conj |
CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA,MHB1662 |
R11903 |
T16987 |
T16988 |
nummod |
3,′ |
R11904 |
T16988 |
T16986 |
appos |
′,CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA |
R11905 |
T16989 |
T16990 |
punct |
(,− |
R11906 |
T16990 |
T16988 |
appos |
−,′ |
R11907 |
T16991 |
T16990 |
nummod |
63,− |
R11908 |
T16992 |
T16990 |
prep |
to,− |
R11909 |
T16993 |
T16992 |
pobj |
−,to |
R11910 |
T16994 |
T16993 |
appos |
18,− |
R11911 |
T16995 |
T16993 |
punct |
),− |
R11912 |
T16996 |
T16951 |
punct |
.,include |
R12137 |
T17438 |
T17438 |
ROOT |
Quantitation,Quantitation |
R12138 |
T17439 |
T17438 |
prep |
of,Quantitation |
R12139 |
T17440 |
T17441 |
compound |
globin,mRNA |
R12140 |
T17441 |
T17439 |
pobj |
mRNA,of |
R12141 |
T17442 |
T17438 |
punct |
.,Quantitation |
R12142 |
T17443 |
T17444 |
nsubj |
RNA,was |
R12143 |
T17444 |
T17444 |
ROOT |
was,was |
R12144 |
T17445 |
T17446 |
amod |
first,reverse |
R12145 |
T17446 |
T17447 |
advmod |
reverse,transcribed |
R12146 |
T17447 |
T17444 |
acomp |
transcribed,was |
R12147 |
T17448 |
T17447 |
prep |
to,transcribed |
R12148 |
T17449 |
T17448 |
pobj |
cDNA,to |
R12149 |
T17450 |
T17444 |
punct |
.,was |
R12150 |
T17451 |
T17460 |
nsubjpass |
Primers,obtained |
R12151 |
T17452 |
T17451 |
prep |
for,Primers |
R12152 |
T17453 |
T17455 |
compound |
cDNA,amplification |
R12153 |
T17454 |
T17455 |
compound |
PCR,amplification |
R12154 |
T17455 |
T17452 |
pobj |
amplification,for |
R12155 |
T17456 |
T17455 |
prep |
of,amplification |
R12156 |
T17457 |
T17458 |
compound |
globin,genes |
R12157 |
T17458 |
T17456 |
pobj |
genes,of |
R12158 |
T17459 |
T17460 |
auxpass |
were,obtained |
R12159 |
T17460 |
T17460 |
ROOT |
obtained,obtained |
R12160 |
T17461 |
T17460 |
prep |
from,obtained |
R12161 |
T17462 |
T17463 |
compound |
Primerbank,[ |
R12162 |
T17463 |
T17461 |
pobj |
[,from |
R12163 |
T17464 |
T17465 |
nummod |
51,] |
R12164 |
T17465 |
T17463 |
appos |
],[ |
R12165 |
T17466 |
T17460 |
punct |
.,obtained |
R12166 |
T17467 |
T17468 |
det |
All,primers |
R12167 |
T17468 |
T17470 |
nsubjpass |
primers,searched |
R12168 |
T17469 |
T17470 |
auxpass |
were,searched |
R12169 |
T17470 |
T17470 |
ROOT |
searched,searched |
R12170 |
T17471 |
T17470 |
prep |
against,searched |
R12171 |
T17472 |
T17474 |
det |
the,database |
R12172 |
T17473 |
T17474 |
compound |
NCBI,database |
R12173 |
T17474 |
T17471 |
pobj |
database,against |
R12174 |
T17475 |
T17476 |
aux |
to,confirm |
R12175 |
T17476 |
T17470 |
advcl |
confirm,searched |
R12176 |
T17477 |
T17476 |
dobj |
specificity,confirm |
R12177 |
T17478 |
T17470 |
punct |
.,searched |
R12178 |
T17479 |
T17479 |
ROOT |
For,For |
R12179 |
T17480 |
T17481 |
amod |
ɛy,globin |
R12180 |
T17481 |
T17479 |
pobj |
globin,For |
R12181 |
T17482 |
T17481 |
punct |
:,globin |
R12182 |
T17483 |
T17496 |
nmod |
MHB1666,′ |
R12183 |
T17484 |
T17483 |
punct |
",",MHB1666 |
R12184 |
T17485 |
T17483 |
nummod |
5,MHB1666 |
R12185 |
T17486 |
T17483 |
nummod |
′,MHB1666 |
R12186 |
T17487 |
T17488 |
nummod |
TGGCCTGTGGAGTAAGGTCAA3,′ |
R12187 |
T17488 |
T17488 |
ROOT |
′,′ |
R12188 |
T17489 |
T17483 |
punct |
;,MHB1666 |
R12189 |
T17490 |
T17483 |
cc |
and,MHB1666 |
R12190 |
T17491 |
T17483 |
conj |
MHB1667,MHB1666 |
R12191 |
T17492 |
T17491 |
punct |
",",MHB1667 |
R12192 |
T17493 |
T17496 |
nummod |
5,′ |
R12193 |
T17494 |
T17496 |
nummod |
′,′ |
R12194 |
T17495 |
T17496 |
compound |
GAAGCAGAGGACAAGTTCCCA3,′ |
R12195 |
T17496 |
T17481 |
appos |
′,globin |
R12196 |
T17497 |
T17479 |
punct |
.,For |
R12197 |
T17498 |
T17498 |
ROOT |
For,For |
R12198 |
T17499 |
T17500 |
amod |
ζ,globin |
R12199 |
T17500 |
T17498 |
pobj |
globin,For |
R12200 |
T17501 |
T17500 |
punct |
:,globin |
R12201 |
T17502 |
T17515 |
nummod |
MHB1668,′ |
R12202 |
T17503 |
T17507 |
punct |
",",′ |
R12203 |
T17504 |
T17507 |
nummod |
5,′ |
R12204 |
T17505 |
T17507 |
nmod |
′,′ |
R12205 |
T17506 |
T17507 |
nummod |
CTACCCCCAGACGAAGACCTA3,′ |
R12206 |
T17507 |
T17502 |
meta |
′,MHB1668 |
R12207 |
T17508 |
T17502 |
punct |
;,MHB1668 |
R12208 |
T17509 |
T17502 |
cc |
and,MHB1668 |
R12209 |
T17510 |
T17515 |
nmod |
MHB1669,′ |
R12210 |
T17511 |
T17510 |
punct |
",",MHB1669 |
R12211 |
T17512 |
T17513 |
nummod |
5,′ |
R12212 |
T17513 |
T17515 |
nmod |
′,′ |
R12213 |
T17514 |
T17515 |
nummod |
CTTAACCGCATCCCCTACGG3,′ |
R12214 |
T17515 |
T17500 |
appos |
′,globin |
R12215 |
T17516 |
T17498 |
punct |
.,For |
R12216 |
T17517 |
T17517 |
ROOT |
For,For |
R12217 |
T17518 |
T17519 |
amod |
βH1,globin |
R12218 |
T17519 |
T17517 |
pobj |
globin,For |
R12219 |
T17520 |
T17519 |
punct |
:,globin |
R12220 |
T17521 |
T17534 |
nmod |
MHB1672,′ |
R12221 |
T17522 |
T17521 |
punct |
",",MHB1672 |
R12222 |
T17523 |
T17521 |
nummod |
5,MHB1672 |
R12223 |
T17524 |
T17521 |
nummod |
′,MHB1672 |
R12224 |
T17525 |
T17526 |
nummod |
TGGACAACCTCAAGGAGACC3,′ |
R12225 |
T17526 |
T17526 |
ROOT |
′,′ |
R12226 |
T17527 |
T17521 |
punct |
;,MHB1672 |
R12227 |
T17528 |
T17521 |
cc |
and,MHB1672 |
R12228 |
T17529 |
T17521 |
conj |
MHB1673,MHB1672 |
R12229 |
T17530 |
T17529 |
punct |
",",MHB1673 |
R12230 |
T17531 |
T17534 |
nummod |
5,′ |
R12231 |
T17532 |
T17534 |
nummod |
′,′ |
R12232 |
T17533 |
T17534 |
compound |
ACCTCTGGGGTGAATTCCTT3,′ |
R12233 |
T17534 |
T17519 |
appos |
′,globin |
R12234 |
T17535 |
T17517 |
punct |
.,For |
R12235 |
T17536 |
T17536 |
ROOT |
For,For |
R12236 |
T17537 |
T17540 |
amod |
βmaj,globin |
R12237 |
T17538 |
T17540 |
compound |
/,globin |
R12238 |
T17539 |
T17540 |
compound |
min,globin |
R12239 |
T17540 |
T17536 |
pobj |
globin,For |
R12240 |
T17541 |
T17540 |
punct |
:,globin |
R12241 |
T17542 |
T17555 |
nmod |
MHB1674,′ |
R12242 |
T17543 |
T17542 |
punct |
:,MHB1674 |
R12243 |
T17544 |
T17547 |
nummod |
5,′ |
R12244 |
T17545 |
T17547 |
nummod |
′,′ |
R12245 |
T17546 |
T17547 |
compound |
ATGGCCTGAATCACTTGGAC3,′ |
R12246 |
T17547 |
T17542 |
appos |
′,MHB1674 |
R12247 |
T17548 |
T17542 |
punct |
;,MHB1674 |
R12248 |
T17549 |
T17542 |
cc |
and,MHB1674 |
R12249 |
T17550 |
T17542 |
conj |
MHB1675,MHB1674 |
R12250 |
T17551 |
T17550 |
punct |
",",MHB1675 |
R12251 |
T17552 |
T17555 |
nummod |
5,′ |
R12252 |
T17553 |
T17555 |
nummod |
′,′ |
R12253 |
T17554 |
T17555 |
compound |
ACGATCATATTGCCCAGGAG3,′ |
R12254 |
T17555 |
T17540 |
appos |
′,globin |
R12255 |
T17556 |
T17536 |
punct |
.,For |
R12256 |
T17557 |
T17579 |
advcl |
Using,run |
R12257 |
T17558 |
T17562 |
det |
the,kit |
R12258 |
T17559 |
T17562 |
nmod |
SYBR,kit |
R12259 |
T17560 |
T17562 |
amod |
green,kit |
R12260 |
T17561 |
T17562 |
compound |
supermix,kit |
R12261 |
T17562 |
T17557 |
dobj |
kit,Using |
R12262 |
T17563 |
T17557 |
prep |
with,Using |
R12263 |
T17564 |
T17563 |
pobj |
ROX,with |
R12264 |
T17565 |
T17566 |
punct |
(,Bio-Rad |
R12265 |
T17566 |
T17564 |
appos |
Bio-Rad,ROX |
R12266 |
T17567 |
T17566 |
punct |
",",Bio-Rad |
R12267 |
T17568 |
T17566 |
conj |
Hercules,Bio-Rad |
R12268 |
T17569 |
T17568 |
punct |
",",Hercules |
R12269 |
T17570 |
T17568 |
conj |
California,Hercules |
R12270 |
T17571 |
T17570 |
punct |
",",California |
R12271 |
T17572 |
T17573 |
compound |
United,States |
R12272 |
T17573 |
T17570 |
conj |
States,California |
R12273 |
T17574 |
T17570 |
punct |
),California |
R12274 |
T17575 |
T17579 |
punct |
",",run |
R12275 |
T17576 |
T17577 |
compound |
PCR,amplification |
R12276 |
T17577 |
T17579 |
nsubjpass |
amplification,run |
R12277 |
T17578 |
T17579 |
auxpass |
was,run |
R12278 |
T17579 |
T17579 |
ROOT |
run,run |
R12279 |
T17580 |
T17579 |
prep |
on,run |
R12280 |
T17581 |
T17585 |
det |
an,Biosystems |
R12281 |
T17582 |
T17585 |
nmod |
ABI7000,Biosystems |
R12282 |
T17583 |
T17585 |
punct |
(,Biosystems |
R12283 |
T17584 |
T17585 |
compound |
Applied,Biosystems |
R12284 |
T17585 |
T17580 |
pobj |
Biosystems,on |
R12285 |
T17586 |
T17585 |
punct |
",",Biosystems |
R12286 |
T17587 |
T17588 |
compound |
Foster,City |
R12287 |
T17588 |
T17585 |
conj |
City,Biosystems |
R12288 |
T17589 |
T17588 |
punct |
",",City |
R12289 |
T17590 |
T17588 |
appos |
California,City |
R12290 |
T17591 |
T17590 |
punct |
",",California |
R12291 |
T17592 |
T17593 |
compound |
United,States |
R12292 |
T17593 |
T17590 |
appos |
States,California |
R12293 |
T17594 |
T17588 |
punct |
),City |
R12294 |
T17595 |
T17585 |
prep |
at,Biosystems |
R12295 |
T17596 |
T17597 |
det |
the,University |
R12296 |
T17597 |
T17601 |
nmod |
University,facility |
R12297 |
T17598 |
T17597 |
prep |
of,University |
R12298 |
T17599 |
T17598 |
pobj |
Arizona,of |
R12299 |
T17600 |
T17601 |
amod |
core,facility |
R12300 |
T17601 |
T17595 |
pobj |
facility,at |
R12301 |
T17602 |
T17579 |
punct |
.,run |
R12302 |
T17603 |
T17604 |
det |
All,PCR |
R12303 |
T17604 |
T17606 |
nsubjpass |
PCR,performed |
R12304 |
T17605 |
T17606 |
auxpass |
was,performed |
R12305 |
T17606 |
T17606 |
ROOT |
performed,performed |
R12306 |
T17607 |
T17606 |
prep |
in,performed |
R12307 |
T17608 |
T17610 |
det |
a,reaction |
R12308 |
T17609 |
T17610 |
amod |
25-μl,reaction |
R12309 |
T17610 |
T17607 |
pobj |
reaction,in |
R12310 |
T17611 |
T17610 |
prep |
with,reaction |
R12311 |
T17612 |
T17613 |
nummod |
12.5,μl |
R12312 |
T17613 |
T17611 |
pobj |
μl,with |
R12313 |
T17614 |
T17616 |
nmod |
SYBR,supermix |
R12314 |
T17615 |
T17616 |
amod |
green,supermix |
R12315 |
T17616 |
T17613 |
appos |
supermix,μl |
R12316 |
T17617 |
T17606 |
punct |
.,performed |
R12317 |
T17618 |
T17619 |
compound |
GAPDH,mRNA |
R12318 |
T17619 |
T17620 |
compound |
mRNA,levels |
R12319 |
T17620 |
T17622 |
nsubjpass |
levels,used |
R12320 |
T17621 |
T17622 |
auxpass |
were,used |
R12321 |
T17622 |
T17622 |
ROOT |
used,used |
R12322 |
T17623 |
T17622 |
prep |
as,used |
R12323 |
T17624 |
T17623 |
pobj |
control,as |
R12324 |
T17625 |
T17624 |
prep |
for,control |
R12325 |
T17626 |
T17627 |
compound |
input,RNA |
R12326 |
T17627 |
T17625 |
pobj |
RNA,for |
R12327 |
T17628 |
T17622 |
punct |
.,used |
R12328 |
T17629 |
T17631 |
compound |
Standard,analyses |
R12329 |
T17630 |
T17631 |
compound |
curve,analyses |
R12330 |
T17631 |
T17633 |
nsubjpass |
analyses,performed |
R12331 |
T17632 |
T17633 |
auxpass |
were,performed |
R12332 |
T17633 |
T17633 |
ROOT |
performed,performed |
R12333 |
T17634 |
T17635 |
aux |
to,test |
R12334 |
T17635 |
T17633 |
xcomp |
test,performed |
R12335 |
T17636 |
T17637 |
det |
the,efficiency |
R12336 |
T17637 |
T17635 |
dobj |
efficiency,test |
R12337 |
T17638 |
T17637 |
prep |
of,efficiency |
R12338 |
T17639 |
T17640 |
det |
the,amplifications |
R12339 |
T17640 |
T17638 |
pobj |
amplifications,of |
R12340 |
T17641 |
T17633 |
punct |
.,performed |
R12341 |
T17642 |
T17644 |
nsubjpass |
Triplicates,done |
R12342 |
T17643 |
T17644 |
auxpass |
were,done |
R12343 |
T17644 |
T17644 |
ROOT |
done,done |
R12344 |
T17645 |
T17644 |
prep |
for,done |
R12345 |
T17646 |
T17648 |
det |
each,reaction |
R12346 |
T17647 |
T17648 |
compound |
PCR,reaction |
R12347 |
T17648 |
T17645 |
pobj |
reaction,for |
R12348 |
T17649 |
T17644 |
punct |
.,done |
R12349 |
T17650 |
T17652 |
amod |
Relative,values |
R12350 |
T17651 |
T17652 |
amod |
quantitative,values |
R12351 |
T17652 |
T17654 |
nsubjpass |
values,calculated |
R12352 |
T17653 |
T17654 |
auxpass |
were,calculated |
R12353 |
T17654 |
T17654 |
ROOT |
calculated,calculated |
R12354 |
T17655 |
T17654 |
prep |
in,calculated |
R12355 |
T17656 |
T17661 |
det |
the,Software |
R12356 |
T17657 |
T17658 |
compound |
ABI,Prism |
R12357 |
T17658 |
T17661 |
nmod |
Prism,Software |
R12358 |
T17659 |
T17661 |
nummod |
7000,Software |
R12359 |
T17660 |
T17661 |
compound |
SDS,Software |
R12360 |
T17661 |
T17655 |
pobj |
Software,in |
R12361 |
T17662 |
T17664 |
punct |
(,Biosystems |
R12362 |
T17663 |
T17664 |
compound |
Applied,Biosystems |
R12363 |
T17664 |
T17661 |
appos |
Biosystems,Software |
R12364 |
T17665 |
T17664 |
punct |
),Biosystems |
R12365 |
T17666 |
T17654 |
cc |
and,calculated |
R12366 |
T17667 |
T17654 |
conj |
normalized,calculated |
R12367 |
T17668 |
T17667 |
prep |
to,normalized |
R12368 |
T17669 |
T17668 |
pobj |
GAPDH,to |
R12369 |
T17670 |
T17667 |
prep |
in,normalized |
R12370 |
T17671 |
T17672 |
compound |
Microsoft,Excel |
R12371 |
T17672 |
T17670 |
pobj |
Excel,in |
R12372 |
T17673 |
T17674 |
punct |
(,Redmond |
R12373 |
T17674 |
T17672 |
appos |
Redmond,Excel |
R12374 |
T17675 |
T17674 |
punct |
",",Redmond |
R12375 |
T17676 |
T17674 |
conj |
Washington,Redmond |
R12376 |
T17677 |
T17676 |
punct |
",",Washington |
R12377 |
T17678 |
T17679 |
compound |
United,States |
R12378 |
T17679 |
T17674 |
appos |
States,Redmond |
R12379 |
T17680 |
T17674 |
punct |
),Redmond |
R12380 |
T17681 |
T17654 |
punct |
.,calculated |
R12562 |
T17961 |
T17961 |
ROOT |
In,In |
R12563 |
T17962 |
T17963 |
compound |
situ,hybridization |
R12564 |
T17963 |
T17961 |
pobj |
hybridization,In |
R12565 |
T17964 |
T17963 |
punct |
.,hybridization |
R12566 |
T17965 |
T17966 |
compound |
Antisense,probes |
R12567 |
T17966 |
T17968 |
nsubjpass |
probes,designed |
R12568 |
T17967 |
T17968 |
auxpass |
were,designed |
R12569 |
T17968 |
T17968 |
ROOT |
designed,designed |
R12570 |
T17969 |
T17970 |
aux |
to,murine |
R12571 |
T17970 |
T17968 |
xcomp |
murine,designed |
R12572 |
T17971 |
T17973 |
amod |
ɛy,nucleotides |
R12573 |
T17972 |
T17973 |
compound |
globin,nucleotides |
R12574 |
T17973 |
T17970 |
dobj |
nucleotides,murine |
R12575 |
T17974 |
T17970 |
npadvmod |
509,murine |
R12576 |
T17975 |
T17970 |
meta |
584,murine |
R12577 |
T17976 |
T17968 |
punct |
;,designed |
R12578 |
T17977 |
T17968 |
conj |
βmaj,designed |
R12579 |
T17978 |
T17979 |
compound |
globin,nucleotides |
R12580 |
T17979 |
T17977 |
dobj |
nucleotides,βmaj |
R12581 |
T17980 |
T17979 |
nummod |
458,nucleotides |
R12582 |
T17981 |
T17979 |
dep |
549,nucleotides |
R12583 |
T17982 |
T17979 |
punct |
;,nucleotides |
R12584 |
T17983 |
T17979 |
cc |
and,nucleotides |
R12585 |
T17984 |
T17986 |
nmod |
mouse,nucleotides |
R12586 |
T17985 |
T17986 |
compound |
Sox6,nucleotides |
R12587 |
T17986 |
T17979 |
conj |
nucleotides,nucleotides |
R12588 |
T17987 |
T17979 |
dep |
1353,nucleotides |
R12589 |
T17988 |
T17979 |
appos |
1927,nucleotides |
R12590 |
T17989 |
T17977 |
punct |
.,βmaj |
R12591 |
T17990 |
T17992 |
nsubjpass |
Embryos,fixed |
R12592 |
T17991 |
T17992 |
auxpass |
were,fixed |
R12593 |
T17992 |
T17992 |
ROOT |
fixed,fixed |
R12594 |
T17993 |
T17992 |
advmod |
overnight,fixed |
R12595 |
T17994 |
T17992 |
agent |
by,fixed |
R12596 |
T17995 |
T17994 |
pobj |
immersion,by |
R12597 |
T17996 |
T17992 |
prep |
in,fixed |
R12598 |
T17997 |
T17998 |
nummod |
4,% |
R12599 |
T17998 |
T17999 |
compound |
%,paraformaldehyde |
R12600 |
T17999 |
T17996 |
pobj |
paraformaldehyde,in |
R12601 |
T18000 |
T17992 |
punct |
",",fixed |
R12602 |
T18001 |
T17992 |
conj |
embedded,fixed |
R12603 |
T18002 |
T18001 |
prep |
in,embedded |
R12604 |
T18003 |
T18002 |
pobj |
paraffin,in |
R12605 |
T18004 |
T17992 |
punct |
",",fixed |
R12606 |
T18005 |
T17992 |
conj |
sectioned,fixed |
R12607 |
T18006 |
T18005 |
prep |
at,sectioned |
R12608 |
T18007 |
T18008 |
nummod |
5,μm |
R12609 |
T18008 |
T18006 |
pobj |
μm,at |
R12610 |
T18009 |
T17992 |
punct |
",",fixed |
R12611 |
T18010 |
T17992 |
cc |
and,fixed |
R12612 |
T18011 |
T17992 |
conj |
adhered,fixed |
R12613 |
T18012 |
T18013 |
aux |
to,charge |
R12614 |
T18013 |
T18011 |
xcomp |
charge,adhered |
R12615 |
T18014 |
T18015 |
amod |
modified,slides |
R12616 |
T18015 |
T18013 |
dobj |
slides,charge |
R12617 |
T18016 |
T18017 |
punct |
(,VWR |
R12618 |
T18017 |
T18015 |
appos |
VWR,slides |
R12619 |
T18018 |
T18017 |
punct |
",",VWR |
R12620 |
T18019 |
T18020 |
compound |
West,Chester |
R12621 |
T18020 |
T18017 |
conj |
Chester,VWR |
R12622 |
T18021 |
T18020 |
punct |
",",Chester |
R12623 |
T18022 |
T18020 |
conj |
Pennsylvania,Chester |
R12624 |
T18023 |
T18022 |
punct |
",",Pennsylvania |
R12625 |
T18024 |
T18025 |
compound |
United,States |
R12626 |
T18025 |
T18022 |
conj |
States,Pennsylvania |
R12627 |
T18026 |
T18015 |
punct |
),slides |
R12628 |
T18027 |
T17992 |
punct |
.,fixed |
R12629 |
T18028 |
T18030 |
nsubjpass |
Slides,processed |
R12630 |
T18029 |
T18030 |
auxpass |
were,processed |
R12631 |
T18030 |
T18030 |
ROOT |
processed,processed |
R12632 |
T18031 |
T18030 |
prep |
for,processed |
R12633 |
T18032 |
T18030 |
prep |
in,processed |
R12634 |
T18033 |
T18034 |
compound |
situ,hybridization |
R12635 |
T18034 |
T18032 |
pobj |
hybridization,in |
R12636 |
T18035 |
T18036 |
mark |
as,described |
R12637 |
T18036 |
T18030 |
advcl |
described,processed |
R12638 |
T18037 |
T18039 |
nmod |
[,] |
R12639 |
T18038 |
T18039 |
nummod |
52,] |
R12640 |
T18039 |
T18036 |
dobj |
],described |
R12641 |
T18040 |
T18036 |
advcl |
using,described |
R12642 |
T18041 |
T18040 |
prep |
in,using |
R12643 |
T18042 |
T18041 |
pobj |
vitro,in |
R12644 |
T18043 |
T18045 |
amod |
transcribed,probes |
R12645 |
T18044 |
T18045 |
compound |
RNA,probes |
R12646 |
T18045 |
T18040 |
dobj |
probes,using |
R12647 |
T18046 |
T18045 |
acl |
labeled,probes |
R12648 |
T18047 |
T18046 |
prep |
with,labeled |
R12649 |
T18048 |
T18047 |
pobj |
33P,with |
R12650 |
T18049 |
T18030 |
punct |
.,processed |
R12651 |
T18050 |
T18053 |
nmod |
Darkfield,images |
R12652 |
T18051 |
T18050 |
cc |
and,Darkfield |
R12653 |
T18052 |
T18050 |
conj |
brightfield,Darkfield |
R12654 |
T18053 |
T18055 |
nsubjpass |
images,obtained |
R12655 |
T18054 |
T18055 |
auxpass |
were,obtained |
R12656 |
T18055 |
T18055 |
ROOT |
obtained,obtained |
R12657 |
T18056 |
T18055 |
prep |
with,obtained |
R12658 |
T18057 |
T18060 |
det |
a,microscope |
R12659 |
T18058 |
T18060 |
compound |
Nikon,microscope |
R12660 |
T18059 |
T18060 |
compound |
Optiphot,microscope |
R12661 |
T18060 |
T18056 |
pobj |
microscope,with |
R12662 |
T18061 |
T18062 |
punct |
(,Nikon |
R12663 |
T18062 |
T18076 |
nmod |
Nikon,camera |
R12664 |
T18063 |
T18062 |
punct |
",",Nikon |
R12665 |
T18064 |
T18062 |
conj |
Melville,Nikon |
R12666 |
T18065 |
T18064 |
punct |
",",Melville |
R12667 |
T18066 |
T18067 |
compound |
New,York |
R12668 |
T18067 |
T18064 |
conj |
York,Melville |
R12669 |
T18068 |
T18067 |
punct |
",",York |
R12670 |
T18069 |
T18070 |
compound |
United,States |
R12671 |
T18070 |
T18067 |
conj |
States,York |
R12672 |
T18071 |
T18070 |
punct |
),States |
R12673 |
T18072 |
T18070 |
cc |
and,States |
R12674 |
T18073 |
T18076 |
nmod |
SPOT,camera |
R12675 |
T18074 |
T18076 |
amod |
RT-Slider,camera |
R12676 |
T18075 |
T18076 |
amod |
digital,camera |
R12677 |
T18076 |
T18060 |
appos |
camera,microscope |
R12678 |
T18077 |
T18079 |
punct |
(,Instruments |
R12679 |
T18078 |
T18079 |
compound |
Diagnostic,Instruments |
R12680 |
T18079 |
T18076 |
appos |
Instruments,camera |
R12681 |
T18080 |
T18079 |
punct |
",",Instruments |
R12682 |
T18081 |
T18082 |
compound |
Sterling,Heights |
R12683 |
T18082 |
T18079 |
conj |
Heights,Instruments |
R12684 |
T18083 |
T18082 |
punct |
",",Heights |
R12685 |
T18084 |
T18082 |
conj |
Michigan,Heights |
R12686 |
T18085 |
T18084 |
punct |
",",Michigan |
R12687 |
T18086 |
T18087 |
compound |
United,States |
R12688 |
T18087 |
T18084 |
conj |
States,Michigan |
R12689 |
T18088 |
T18079 |
punct |
),Instruments |
R12690 |
T18089 |
T18055 |
punct |
.,obtained |
R12691 |
T18090 |
T18092 |
nsubj |
Objectives,were |
R12692 |
T18091 |
T18090 |
acl |
used,Objectives |
R12693 |
T18092 |
T18092 |
ROOT |
were,were |
R12694 |
T18093 |
T18094 |
nummod |
1,× |
R12695 |
T18094 |
T18092 |
attr |
×,were |
R12696 |
T18095 |
T18098 |
punct |
(,0.04 |
R12697 |
T18096 |
T18098 |
dep |
NA,0.04 |
R12698 |
T18097 |
T18098 |
punct |
=,0.04 |
R12699 |
T18098 |
T18094 |
parataxis |
0.04,× |
R12700 |
T18099 |
T18098 |
punct |
),0.04 |
R12701 |
T18100 |
T18098 |
cc |
and,0.04 |
R12702 |
T18101 |
T18102 |
nummod |
10,× |
R12703 |
T18102 |
T18098 |
conj |
×,0.04 |
R12704 |
T18103 |
T18102 |
punct |
(,× |
R12705 |
T18104 |
T18107 |
nmod |
NA,) |
R12706 |
T18105 |
T18106 |
punct |
=,0.5 |
R12707 |
T18106 |
T18104 |
nummod |
0.5,NA |
R12708 |
T18107 |
T18102 |
punct |
),× |
R12709 |
T18108 |
T18092 |
punct |
.,were |
R12710 |
T18109 |
T18111 |
nsubjpass |
Images,processed |
R12711 |
T18110 |
T18111 |
auxpass |
were,processed |
R12712 |
T18111 |
T18111 |
ROOT |
processed,processed |
R12713 |
T18112 |
T18111 |
punct |
",",processed |
R12714 |
T18113 |
T18111 |
conj |
pseudocolored,processed |
R12715 |
T18114 |
T18113 |
punct |
",",pseudocolored |
R12716 |
T18115 |
T18113 |
cc |
and,pseudocolored |
R12717 |
T18116 |
T18113 |
conj |
combined,pseudocolored |
R12718 |
T18117 |
T18116 |
advcl |
using,combined |
R12719 |
T18118 |
T18117 |
dobj |
Photoshop,using |
R12720 |
T18119 |
T18120 |
punct |
(,Adobe |
R12721 |
T18120 |
T18118 |
appos |
Adobe,Photoshop |
R12722 |
T18121 |
T18120 |
punct |
",",Adobe |
R12723 |
T18122 |
T18123 |
compound |
San,Jose |
R12724 |
T18123 |
T18120 |
npadvmod |
Jose,Adobe |
R12725 |
T18124 |
T18123 |
punct |
",",Jose |
R12726 |
T18125 |
T18123 |
conj |
California,Jose |
R12727 |
T18126 |
T18125 |
punct |
",",California |
R12728 |
T18127 |
T18128 |
compound |
United,States |
R12729 |
T18128 |
T18125 |
appos |
States,California |
R12730 |
T18129 |
T18125 |
punct |
),California |
R12731 |
T18130 |
T18118 |
conj |
software,Photoshop |
R12732 |
T18131 |
T18117 |
prep |
with,using |
R12733 |
T18132 |
T18136 |
nmod |
Fovea,Graphics |
R12734 |
T18133 |
T18136 |
nmod |
Pro,Graphics |
R12735 |
T18134 |
T18136 |
punct |
(,Graphics |
R12736 |
T18135 |
T18136 |
compound |
Reindeer,Graphics |
R12737 |
T18136 |
T18146 |
nmod |
Graphics,plugins |
R12738 |
T18137 |
T18136 |
punct |
",",Graphics |
R12739 |
T18138 |
T18146 |
nmod |
Asheville,plugins |
R12740 |
T18139 |
T18138 |
punct |
",",Asheville |
R12741 |
T18140 |
T18141 |
compound |
North,Carolina |
R12742 |
T18141 |
T18138 |
conj |
Carolina,Asheville |
R12743 |
T18142 |
T18141 |
punct |
",",Carolina |
R12744 |
T18143 |
T18144 |
compound |
United,States |
R12745 |
T18144 |
T18141 |
appos |
States,Carolina |
R12746 |
T18145 |
T18146 |
punct |
),plugins |
R12747 |
T18146 |
T18131 |
pobj |
plugins,with |
R12748 |
T18147 |
T18111 |
punct |
.,processed |
R12749 |
T18148 |
T18149 |
amod |
Original,images |
R12750 |
T18149 |
T18150 |
nsubj |
images,are |
R12751 |
T18150 |
T18150 |
ROOT |
are,are |
R12752 |
T18151 |
T18150 |
acomp |
available,are |
R12753 |
T18152 |
T18150 |
punct |
.,are |
R12873 |
T18304 |
T18304 |
ROOT |
Histology,Histology |
R12874 |
T18305 |
T18304 |
punct |
.,Histology |
R12875 |
T18306 |
T18307 |
amod |
18.5-dpc,embryos |
R12876 |
T18307 |
T18309 |
nsubjpass |
embryos,exsanguinated |
R12877 |
T18308 |
T18309 |
auxpass |
were,exsanguinated |
R12878 |
T18309 |
T18309 |
ROOT |
exsanguinated,exsanguinated |
R12879 |
T18310 |
T18309 |
cc |
and,exsanguinated |
R12880 |
T18311 |
T18309 |
conj |
peripheral,exsanguinated |
R12881 |
T18312 |
T18313 |
compound |
blood,smears |
R12882 |
T18313 |
T18314 |
nsubj |
smears,were |
R12883 |
T18314 |
T18315 |
auxpass |
were,prepared |
R12884 |
T18315 |
T18309 |
conj |
prepared,exsanguinated |
R12885 |
T18316 |
T18315 |
prep |
from,prepared |
R12886 |
T18317 |
T18318 |
preconj |
both,mutant |
R12887 |
T18318 |
T18321 |
amod |
mutant,mice |
R12888 |
T18319 |
T18318 |
cc |
and,mutant |
R12889 |
T18320 |
T18318 |
conj |
WT,mutant |
R12890 |
T18321 |
T18316 |
pobj |
mice,from |
R12891 |
T18322 |
T18309 |
punct |
.,exsanguinated |
R12892 |
T18323 |
T18324 |
det |
The,slides |
R12893 |
T18324 |
T18325 |
nsubj |
slides,were |
R12894 |
T18325 |
T18325 |
ROOT |
were,were |
R12895 |
T18326 |
T18325 |
acomp |
Wright-stained,were |
R12896 |
T18327 |
T18325 |
cc |
and,were |
R12897 |
T18328 |
T18325 |
conj |
read,were |
R12898 |
T18329 |
T18328 |
agent |
by,read |
R12899 |
T18330 |
T18329 |
pobj |
DAF,by |
R12900 |
T18331 |
T18325 |
punct |
.,were |
R12901 |
T18332 |
T18349 |
prep |
For,fixed |
R12902 |
T18333 |
T18335 |
amod |
whole,analysis |
R12903 |
T18334 |
T18335 |
compound |
mount,analysis |
R12904 |
T18335 |
T18332 |
pobj |
analysis,For |
R12905 |
T18336 |
T18349 |
punct |
",",fixed |
R12906 |
T18337 |
T18338 |
compound |
14.5-dpc,WT |
R12907 |
T18338 |
T18349 |
nsubjpass |
WT,fixed |
R12908 |
T18339 |
T18338 |
cc |
and,WT |
R12909 |
T18340 |
T18341 |
amod |
mutant,embryos |
R12910 |
T18341 |
T18338 |
conj |
embryos,WT |
R12911 |
T18342 |
T18341 |
punct |
",",embryos |
R12912 |
T18343 |
T18341 |
cc |
and,embryos |
R12913 |
T18344 |
T18345 |
amod |
postnatal,day |
R12914 |
T18345 |
T18349 |
npadvmod |
day,fixed |
R12915 |
T18346 |
T18347 |
nummod |
10.5,mice |
R12916 |
T18347 |
T18349 |
nsubjpass |
mice,fixed |
R12917 |
T18348 |
T18349 |
auxpass |
were,fixed |
R12918 |
T18349 |
T18349 |
ROOT |
fixed,fixed |
R12919 |
T18350 |
T18349 |
prep |
in,fixed |
R12920 |
T18351 |
T18352 |
nummod |
10,% |
R12921 |
T18352 |
T18353 |
compound |
%,formalin |
R12922 |
T18353 |
T18350 |
pobj |
formalin,in |
R12923 |
T18354 |
T18353 |
punct |
",",formalin |
R12924 |
T18355 |
T18357 |
amod |
paraffin-embedded,sectioned |
R12925 |
T18356 |
T18355 |
punct |
",",paraffin-embedded |
R12926 |
T18357 |
T18349 |
conj |
sectioned,fixed |
R12927 |
T18358 |
T18357 |
prep |
at,sectioned |
R12928 |
T18359 |
T18360 |
nummod |
5,μm |
R12929 |
T18360 |
T18358 |
pobj |
μm,at |
R12930 |
T18361 |
T18357 |
punct |
",",sectioned |
R12931 |
T18362 |
T18357 |
cc |
and,sectioned |
R12932 |
T18363 |
T18357 |
conj |
stained,sectioned |
R12933 |
T18364 |
T18363 |
prep |
with,stained |
R12934 |
T18365 |
T18364 |
pobj |
hematoxylin,with |
R12935 |
T18366 |
T18365 |
cc |
and,hematoxylin |
R12936 |
T18367 |
T18365 |
conj |
eosin,hematoxylin |
R12937 |
T18368 |
T18349 |
punct |
.,fixed |
R12938 |
T18369 |
T18370 |
compound |
Liver,samples |
R12939 |
T18370 |
T18380 |
nsubjpass |
samples,prepared |
R12940 |
T18371 |
T18372 |
punct |
(,at |
R12941 |
T18372 |
T18370 |
prep |
at,samples |
R12942 |
T18373 |
T18372 |
pobj |
14.5,at |
R12943 |
T18374 |
T18380 |
nsubjpass |
dpc,prepared |
R12944 |
T18375 |
T18374 |
cc |
and,dpc |
R12945 |
T18376 |
T18377 |
nummod |
18.5,dpc |
R12946 |
T18377 |
T18374 |
conj |
dpc,dpc |
R12947 |
T18378 |
T18374 |
punct |
),dpc |
R12948 |
T18379 |
T18380 |
auxpass |
were,prepared |
R12949 |
T18380 |
T18380 |
ROOT |
prepared,prepared |
R12950 |
T18381 |
T18380 |
prep |
in,prepared |
R12951 |
T18382 |
T18384 |
det |
a,manner |
R12952 |
T18383 |
T18384 |
amod |
similar,manner |
R12953 |
T18384 |
T18381 |
pobj |
manner,in |
R12954 |
T18385 |
T18380 |
punct |
.,prepared |
R12955 |
T18386 |
T18388 |
nsubjpass |
Images,obtained |
R12956 |
T18387 |
T18388 |
auxpass |
were,obtained |
R12957 |
T18388 |
T18388 |
ROOT |
obtained,obtained |
R12958 |
T18389 |
T18388 |
prep |
with,obtained |
R12959 |
T18390 |
T18392 |
compound |
Nikon,microscope |
R12960 |
T18391 |
T18392 |
compound |
Labophot-2,microscope |
R12961 |
T18392 |
T18389 |
pobj |
microscope,with |
R12962 |
T18393 |
T18388 |
punct |
.,obtained |
R12963 |
T18394 |
T18396 |
nsubj |
Objectives,were |
R12964 |
T18395 |
T18394 |
acl |
used,Objectives |
R12965 |
T18396 |
T18396 |
ROOT |
were,were |
R12966 |
T18397 |
T18398 |
compound |
E,Plan |
R12967 |
T18398 |
T18396 |
attr |
Plan,were |
R12968 |
T18399 |
T18398 |
nummod |
40/0,Plan |
R12969 |
T18400 |
T18398 |
nummod |
.65,Plan |
R12970 |
T18401 |
T18398 |
appos |
160/0,Plan |
R12971 |
T18402 |
T18403 |
nummod |
.17,Nikon |
R12972 |
T18403 |
T18398 |
conj |
Nikon,Plan |
R12973 |
T18404 |
T18403 |
punct |
(,Nikon |
R12974 |
T18405 |
T18406 |
nummod |
40,× |
R12975 |
T18406 |
T18407 |
compound |
×,objective |
R12976 |
T18407 |
T18403 |
appos |
objective,Nikon |
R12977 |
T18408 |
T18403 |
punct |
),Nikon |
R12978 |
T18409 |
T18403 |
punct |
",",Nikon |
R12979 |
T18410 |
T18411 |
compound |
E,Plan |
R12980 |
T18411 |
T18398 |
conj |
Plan,Plan |
R12981 |
T18412 |
T18411 |
nummod |
100/1,Plan |
R12982 |
T18413 |
T18398 |
appos |
.25,Plan |
R12983 |
T18414 |
T18415 |
compound |
oil,160/0 |
R12984 |
T18415 |
T18417 |
nmod |
160/0,Nikon |
R12985 |
T18416 |
T18417 |
nummod |
.17,Nikon |
R12986 |
T18417 |
T18398 |
conj |
Nikon,Plan |
R12987 |
T18418 |
T18417 |
punct |
(,Nikon |
R12988 |
T18419 |
T18421 |
nummod |
100,objective |
R12989 |
T18420 |
T18421 |
nummod |
×,objective |
R12990 |
T18421 |
T18417 |
appos |
objective,Nikon |
R12991 |
T18422 |
T18417 |
punct |
),Nikon |
R12992 |
T18423 |
T18396 |
punct |
.,were |
R12993 |
T18424 |
T18425 |
det |
The,camera |
R12994 |
T18425 |
T18426 |
nsubj |
camera,was |
R12995 |
T18426 |
T18426 |
ROOT |
was,was |
R12996 |
T18427 |
T18429 |
det |
a,Coolpix |
R12997 |
T18428 |
T18429 |
compound |
Nikon,Coolpix |
R12998 |
T18429 |
T18430 |
compound |
Coolpix,4300 |
R12999 |
T18430 |
T18426 |
attr |
4300,was |
R13000 |
T18431 |
T18426 |
punct |
.,was |
R13001 |
T18432 |
T18433 |
amod |
Original,images |
R13002 |
T18433 |
T18434 |
nsubj |
images,are |
R13003 |
T18434 |
T18434 |
ROOT |
are,are |
R13004 |
T18435 |
T18434 |
acomp |
available,are |
R13005 |
T18436 |
T18434 |
punct |
.,are |
R13112 |
T18572 |
T18573 |
compound |
Northern,blot |
R13113 |
T18573 |
T18573 |
ROOT |
blot,blot |
R13114 |
T18574 |
T18573 |
punct |
.,blot |
R13115 |
T18575 |
T18581 |
det |
A,filter |
R13116 |
T18576 |
T18581 |
compound |
mouse,filter |
R13117 |
T18577 |
T18578 |
amod |
embryonic,tissue |
R13118 |
T18578 |
T18581 |
compound |
tissue,filter |
R13119 |
T18579 |
T18580 |
compound |
Northern,blot |
R13120 |
T18580 |
T18581 |
compound |
blot,filter |
R13121 |
T18581 |
T18593 |
nsubjpass |
filter,hybridized |
R13122 |
T18582 |
T18581 |
punct |
(,filter |
R13123 |
T18583 |
T18581 |
appos |
Seegene,filter |
R13124 |
T18584 |
T18583 |
punct |
",",Seegene |
R13125 |
T18585 |
T18583 |
conj |
Rockville,Seegene |
R13126 |
T18586 |
T18585 |
punct |
",",Rockville |
R13127 |
T18587 |
T18585 |
conj |
Maryland,Rockville |
R13128 |
T18588 |
T18587 |
punct |
",",Maryland |
R13129 |
T18589 |
T18590 |
compound |
United,States |
R13130 |
T18590 |
T18587 |
appos |
States,Maryland |
R13131 |
T18591 |
T18587 |
punct |
),Maryland |
R13132 |
T18592 |
T18593 |
auxpass |
was,hybridized |
R13133 |
T18593 |
T18593 |
ROOT |
hybridized,hybridized |
R13134 |
T18594 |
T18593 |
prep |
with,hybridized |
R13135 |
T18595 |
T18597 |
det |
a,probe |
R13136 |
T18596 |
T18597 |
amod |
Sox6,probe |
R13137 |
T18597 |
T18594 |
pobj |
probe,with |
R13138 |
T18598 |
T18597 |
acl |
generated,probe |
R13139 |
T18599 |
T18598 |
agent |
by,generated |
R13140 |
T18600 |
T18599 |
pobj |
RT-PCR,by |
R13141 |
T18601 |
T18602 |
punct |
(,nucleotides |
R13142 |
T18602 |
T18597 |
appos |
nucleotides,probe |
R13143 |
T18603 |
T18602 |
nummod |
1353,nucleotides |
R13144 |
T18604 |
T18602 |
npadvmod |
1927,nucleotides |
R13145 |
T18605 |
T18602 |
punct |
),nucleotides |
R13146 |
T18606 |
T18593 |
cc |
and,hybridized |
R13147 |
T18607 |
T18593 |
conj |
labeled,hybridized |
R13148 |
T18608 |
T18607 |
prep |
with,labeled |
R13149 |
T18609 |
T18612 |
compound |
[,dCTP |
R13150 |
T18610 |
T18612 |
compound |
α-32P,dCTP |
R13151 |
T18611 |
T18612 |
compound |
],dCTP |
R13152 |
T18612 |
T18608 |
pobj |
dCTP,with |
R13153 |
T18613 |
T18612 |
punct |
",",dCTP |
R13154 |
T18614 |
T18607 |
agent |
by,labeled |
R13155 |
T18615 |
T18616 |
amod |
random,primer |
R13156 |
T18616 |
T18614 |
pobj |
primer,by |
R13157 |
T18617 |
T18616 |
acl |
labeling,primer |
R13158 |
T18618 |
T18619 |
punct |
(,RediprimeII |
R13159 |
T18619 |
T18617 |
ccomp |
RediprimeII,labeling |
R13160 |
T18620 |
T18619 |
punct |
;,RediprimeII |
R13161 |
T18621 |
T18622 |
compound |
Amersham,Biosciences |
R13162 |
T18622 |
T18619 |
conj |
Biosciences,RediprimeII |
R13163 |
T18623 |
T18622 |
punct |
",",Biosciences |
R13164 |
T18624 |
T18622 |
conj |
Buckinghamshire,Biosciences |
R13165 |
T18625 |
T18624 |
punct |
",",Buckinghamshire |
R13166 |
T18626 |
T18624 |
conj |
England,Buckinghamshire |
R13167 |
T18627 |
T18626 |
punct |
",",England |
R13168 |
T18628 |
T18629 |
compound |
United,Kingdom |
R13169 |
T18629 |
T18619 |
npadvmod |
Kingdom,RediprimeII |
R13170 |
T18630 |
T18619 |
punct |
),RediprimeII |
R13171 |
T18631 |
T18593 |
punct |
.,hybridized |
R13172 |
T18632 |
T18633 |
det |
The,hybridization |
R13173 |
T18633 |
T18635 |
nsubjpass |
hybridization,performed |
R13174 |
T18634 |
T18635 |
auxpass |
was,performed |
R13175 |
T18635 |
T18635 |
ROOT |
performed,performed |
R13176 |
T18636 |
T18635 |
prep |
in,performed |
R13177 |
T18637 |
T18636 |
pobj |
phosphate,in |
R13178 |
T18638 |
T18635 |
advcl |
buffered,performed |
R13179 |
T18639 |
T18640 |
nummod |
7,% |
R13180 |
T18640 |
T18643 |
compound |
%,solution |
R13181 |
T18641 |
T18643 |
compound |
SDS,solution |
R13182 |
T18642 |
T18643 |
compound |
hybridization,solution |
R13183 |
T18643 |
T18638 |
dobj |
solution,buffered |
R13184 |
T18644 |
T18635 |
punct |
.,performed |
R13185 |
T18645 |
T18647 |
nsubjpass |
Blots,washed |
R13186 |
T18646 |
T18647 |
auxpass |
were,washed |
R13187 |
T18647 |
T18647 |
ROOT |
washed,washed |
R13188 |
T18648 |
T18647 |
prep |
with,washed |
R13189 |
T18649 |
T18651 |
nummod |
0.2,SSC |
R13190 |
T18650 |
T18651 |
nummod |
×,SSC |
R13191 |
T18651 |
T18648 |
pobj |
SSC,with |
R13192 |
T18652 |
T18651 |
punct |
",",SSC |
R13193 |
T18653 |
T18654 |
nummod |
1,% |
R13194 |
T18654 |
T18655 |
compound |
%,SDS |
R13195 |
T18655 |
T18651 |
appos |
SDS,SSC |
R13196 |
T18656 |
T18647 |
prep |
at,washed |
R13197 |
T18657 |
T18658 |
nummod |
60,° |
R13198 |
T18658 |
T18656 |
pobj |
°,at |
R13199 |
T18659 |
T18660 |
compound |
C,prior |
R13200 |
T18660 |
T18647 |
advmod |
prior,washed |
R13201 |
T18661 |
T18660 |
prep |
to,prior |
R13202 |
T18662 |
T18661 |
pobj |
exposure,to |
R13203 |
T18663 |
T18662 |
prep |
to,exposure |
R13204 |
T18664 |
T18665 |
compound |
X-ray,film |
R13205 |
T18665 |
T18663 |
pobj |
film,to |
R13206 |
T18666 |
T18667 |
punct |
(,Kodak |
R13207 |
T18667 |
T18665 |
appos |
Kodak,film |
R13208 |
T18668 |
T18667 |
punct |
",",Kodak |
R13209 |
T18669 |
T18667 |
conj |
Rochester,Kodak |
R13210 |
T18670 |
T18669 |
punct |
",",Rochester |
R13211 |
T18671 |
T18672 |
compound |
New,York |
R13212 |
T18672 |
T18669 |
conj |
York,Rochester |
R13213 |
T18673 |
T18672 |
punct |
",",York |
R13214 |
T18674 |
T18675 |
compound |
United,States |
R13215 |
T18675 |
T18672 |
appos |
States,York |
R13216 |
T18676 |
T18672 |
punct |
),York |
R13217 |
T18677 |
T18660 |
prep |
at,prior |
R13218 |
T18678 |
T18680 |
nummod |
−,° |
R13219 |
T18679 |
T18680 |
nummod |
80,° |
R13220 |
T18680 |
T18677 |
pobj |
°,at |
R13221 |
T18681 |
T18660 |
npadvmod |
C,prior |
R13222 |
T18682 |
T18660 |
prep |
for,prior |
R13223 |
T18683 |
T18684 |
nummod |
6,d. |
R13224 |
T18684 |
T18682 |
pobj |
d.,for |
R13398 |
T18901 |
T18902 |
compound |
Cell,culture |
R13399 |
T18902 |
T18902 |
ROOT |
culture,culture |
R13400 |
T18903 |
T18902 |
cc |
and,culture |
R13401 |
T18904 |
T18902 |
conj |
transfection,culture |
R13402 |
T18905 |
T18902 |
punct |
.,culture |
R13403 |
T18906 |
T18907 |
nummod |
GM979,cells |
R13404 |
T18907 |
T18922 |
nsubjpass |
cells,cultured |
R13405 |
T18908 |
T18907 |
punct |
(,cells |
R13406 |
T18909 |
T18911 |
compound |
Coriell,Repositories |
R13407 |
T18910 |
T18911 |
compound |
Cell,Repositories |
R13408 |
T18911 |
T18907 |
appos |
Repositories,cells |
R13409 |
T18912 |
T18911 |
punct |
",",Repositories |
R13410 |
T18913 |
T18911 |
conj |
Camden,Repositories |
R13411 |
T18914 |
T18913 |
punct |
",",Camden |
R13412 |
T18915 |
T18916 |
compound |
New,Jersey |
R13413 |
T18916 |
T18913 |
conj |
Jersey,Camden |
R13414 |
T18917 |
T18916 |
punct |
",",Jersey |
R13415 |
T18918 |
T18919 |
compound |
United,States |
R13416 |
T18919 |
T18916 |
appos |
States,Jersey |
R13417 |
T18920 |
T18916 |
punct |
),Jersey |
R13418 |
T18921 |
T18922 |
auxpass |
were,cultured |
R13419 |
T18922 |
T18922 |
ROOT |
cultured,cultured |
R13420 |
T18923 |
T18922 |
prep |
in,cultured |
R13421 |
T18924 |
T18926 |
poss |
Ham,F12 |
R13422 |
T18925 |
T18924 |
case |
's,Ham |
R13423 |
T18926 |
T18923 |
pobj |
F12,in |
R13424 |
T18927 |
T18931 |
mark |
with,supplemented |
R13425 |
T18928 |
T18930 |
nummod |
2,L-glutamine |
R13426 |
T18929 |
T18930 |
compound |
mM,L-glutamine |
R13427 |
T18930 |
T18931 |
nsubj |
L-glutamine,supplemented |
R13428 |
T18931 |
T18922 |
advcl |
supplemented,cultured |
R13429 |
T18932 |
T18931 |
prep |
with,supplemented |
R13430 |
T18933 |
T18938 |
amod |
heat-inactivated,serum |
R13431 |
T18934 |
T18935 |
nummod |
10,% |
R13432 |
T18935 |
T18938 |
compound |
%,serum |
R13433 |
T18936 |
T18937 |
amod |
fetal,calf |
R13434 |
T18937 |
T18938 |
compound |
calf,serum |
R13435 |
T18938 |
T18932 |
pobj |
serum,with |
R13436 |
T18939 |
T18938 |
punct |
(,serum |
R13437 |
T18940 |
T18968 |
nmod |
Ivitrogen,) |
R13438 |
T18941 |
T18940 |
punct |
",",Ivitrogen |
R13439 |
T18942 |
T18940 |
conj |
Carlsbad,Ivitrogen |
R13440 |
T18943 |
T18942 |
punct |
",",Carlsbad |
R13441 |
T18944 |
T18942 |
conj |
California,Carlsbad |
R13442 |
T18945 |
T18944 |
punct |
",",California |
R13443 |
T18946 |
T18947 |
compound |
United,States |
R13444 |
T18947 |
T18944 |
conj |
States,California |
R13445 |
T18948 |
T18944 |
punct |
),California |
R13446 |
T18949 |
T18940 |
punct |
",",Ivitrogen |
R13447 |
T18950 |
T18967 |
nmod |
penicillin,mM |
R13448 |
T18951 |
T18953 |
punct |
(,units/ml |
R13449 |
T18952 |
T18953 |
nummod |
100,units/ml |
R13450 |
T18953 |
T18950 |
appos |
units/ml,penicillin |
R13451 |
T18954 |
T18953 |
punct |
),units/ml |
R13452 |
T18955 |
T18950 |
punct |
",",penicillin |
R13453 |
T18956 |
T18960 |
nmod |
streptomycin,ml |
R13454 |
T18957 |
T18956 |
nummod |
100,streptomycin |
R13455 |
T18958 |
T18960 |
compound |
μg,ml |
R13456 |
T18959 |
T18960 |
compound |
/,ml |
R13457 |
T18960 |
T18950 |
appos |
ml,penicillin |
R13458 |
T18961 |
T18960 |
punct |
),ml |
R13459 |
T18962 |
T18950 |
punct |
",",penicillin |
R13460 |
T18963 |
T18950 |
cc |
and,penicillin |
R13461 |
T18964 |
T18950 |
conj |
L-glutamine,penicillin |
R13462 |
T18965 |
T18966 |
punct |
(,2 |
R13463 |
T18966 |
T18967 |
nummod |
2,mM |
R13464 |
T18967 |
T18940 |
appos |
mM,Ivitrogen |
R13465 |
T18968 |
T18938 |
punct |
),serum |
R13466 |
T18969 |
T18922 |
punct |
.,cultured |
R13467 |
T18970 |
T18971 |
compound |
MEL,cells |
R13468 |
T18971 |
T18976 |
nsubjpass |
cells,supplemented |
R13469 |
T18972 |
T18976 |
auxpass |
were,supplemented |
R13470 |
T18973 |
T18972 |
acomp |
cultured,were |
R13471 |
T18974 |
T18973 |
prep |
in,cultured |
R13472 |
T18975 |
T18974 |
pobj |
DMEM,in |
R13473 |
T18976 |
T18976 |
ROOT |
supplemented,supplemented |
R13474 |
T18977 |
T18976 |
prep |
as,supplemented |
R13475 |
T18978 |
T18977 |
prep |
above,as |
R13476 |
T18979 |
T18978 |
punct |
(,above |
R13477 |
T18980 |
T18978 |
prep |
without,above |
R13478 |
T18981 |
T18980 |
pobj |
heat,without |
R13479 |
T18982 |
T18978 |
pcomp |
inactivating,above |
R13480 |
T18983 |
T18984 |
det |
the,serum |
R13481 |
T18984 |
T18982 |
dobj |
serum,inactivating |
R13482 |
T18985 |
T18977 |
punct |
),as |
R13483 |
T18986 |
T18976 |
punct |
.,supplemented |
R13484 |
T18987 |
T18988 |
nummod |
GM979,cells |
R13485 |
T18988 |
T19000 |
nsubjpass |
cells,transfected |
R13486 |
T18989 |
T18988 |
punct |
(,cells |
R13487 |
T18990 |
T18992 |
nummod |
4,105 |
R13488 |
T18991 |
T18992 |
nummod |
×,105 |
R13489 |
T18992 |
T18988 |
appos |
105,cells |
R13490 |
T18993 |
T18988 |
punct |
),cells |
R13491 |
T18994 |
T18988 |
prep |
in,cells |
R13492 |
T18995 |
T18996 |
compound |
log,phase |
R13493 |
T18996 |
T18994 |
pobj |
phase,in |
R13494 |
T18997 |
T18996 |
prep |
of,phase |
R13495 |
T18998 |
T18997 |
pobj |
growth,of |
R13496 |
T18999 |
T19000 |
auxpass |
were,transfected |
R13497 |
T19000 |
T19000 |
ROOT |
transfected,transfected |
R13498 |
T19001 |
T19000 |
prep |
with,transfected |
R13499 |
T19002 |
T19001 |
pobj |
plasmids,with |
R13500 |
T19003 |
T19000 |
agent |
by,transfected |
R13501 |
T19004 |
T19003 |
pobj |
FuGENE6,by |
R13502 |
T19005 |
T19006 |
punct |
(,Roche |
R13503 |
T19006 |
T19004 |
appos |
Roche,FuGENE6 |
R13504 |
T19007 |
T19006 |
punct |
",",Roche |
R13505 |
T19008 |
T19013 |
nmod |
Indianapolis,States |
R13506 |
T19009 |
T19008 |
punct |
",",Indianapolis |
R13507 |
T19010 |
T19008 |
conj |
Indiana,Indianapolis |
R13508 |
T19011 |
T19010 |
punct |
",",Indiana |
R13509 |
T19012 |
T19013 |
compound |
United,States |
R13510 |
T19013 |
T19006 |
conj |
States,Roche |
R13511 |
T19014 |
T19006 |
punct |
),Roche |
R13512 |
T19015 |
T19000 |
punct |
.,transfected |
R13513 |
T19016 |
T19018 |
nsubjpass |
Cells,transfected |
R13514 |
T19017 |
T19018 |
auxpass |
were,transfected |
R13515 |
T19018 |
T19018 |
ROOT |
transfected,transfected |
R13516 |
T19019 |
T19018 |
prep |
with,transfected |
R13517 |
T19020 |
T19022 |
amod |
ɛy,reporter |
R13518 |
T19021 |
T19022 |
compound |
promoter,reporter |
R13519 |
T19022 |
T19023 |
compound |
reporter,constructs |
R13520 |
T19023 |
T19019 |
pobj |
constructs,with |
R13521 |
T19024 |
T19023 |
punct |
(,constructs |
R13522 |
T19025 |
T19026 |
nummod |
500,ng |
R13523 |
T19026 |
T19023 |
appos |
ng,constructs |
R13524 |
T19027 |
T19023 |
punct |
),constructs |
R13525 |
T19028 |
T19018 |
prep |
along,transfected |
R13526 |
T19029 |
T19028 |
prep |
with,along |
R13527 |
T19030 |
T19032 |
preconj |
either,vector |
R13528 |
T19031 |
T19032 |
amod |
empty,vector |
R13529 |
T19032 |
T19029 |
pobj |
vector,with |
R13530 |
T19033 |
T19032 |
cc |
or,vector |
R13531 |
T19034 |
T19036 |
amod |
Sox6,vector |
R13532 |
T19035 |
T19036 |
compound |
overexpression,vector |
R13533 |
T19036 |
T19032 |
conj |
vector,vector |
R13534 |
T19037 |
T19036 |
punct |
(,vector |
R13535 |
T19038 |
T19039 |
nummod |
1000,ng |
R13536 |
T19039 |
T19036 |
appos |
ng,vector |
R13537 |
T19040 |
T19036 |
punct |
),vector |
R13538 |
T19041 |
T19018 |
punct |
.,transfected |
R13539 |
T19042 |
T19049 |
prep |
In,used |
R13540 |
T19043 |
T19042 |
pobj |
assays,In |
R13541 |
T19044 |
T19043 |
prep |
of,assays |
R13542 |
T19045 |
T19046 |
compound |
dosage,effect |
R13543 |
T19046 |
T19044 |
pobj |
effect,of |
R13544 |
T19047 |
T19049 |
punct |
",",used |
R13545 |
T19048 |
T19049 |
nsubj |
we,used |
R13546 |
T19049 |
T19049 |
ROOT |
used,used |
R13547 |
T19050 |
T19051 |
nummod |
200,ng |
R13548 |
T19051 |
T19049 |
dobj |
ng,used |
R13549 |
T19052 |
T19051 |
punct |
",",ng |
R13550 |
T19053 |
T19054 |
nummod |
500,ng |
R13551 |
T19054 |
T19051 |
appos |
ng,ng |
R13552 |
T19055 |
T19054 |
punct |
",",ng |
R13553 |
T19056 |
T19054 |
cc |
and,ng |
R13554 |
T19057 |
T19058 |
nummod |
1000,ng |
R13555 |
T19058 |
T19054 |
conj |
ng,ng |
R13556 |
T19059 |
T19051 |
punct |
),ng |
R13557 |
T19060 |
T19049 |
punct |
.,used |
R13558 |
T19061 |
T19062 |
amod |
pRL-CMV,15ng |
R13559 |
T19062 |
T19067 |
nsubjpass |
15ng,used |
R13560 |
T19063 |
T19064 |
punct |
(,Promega |
R13561 |
T19064 |
T19062 |
appos |
Promega,15ng |
R13562 |
T19065 |
T19064 |
punct |
),Promega |
R13563 |
T19066 |
T19067 |
auxpass |
was,used |
R13564 |
T19067 |
T19067 |
ROOT |
used,used |
R13565 |
T19068 |
T19067 |
prep |
as,used |
R13566 |
T19069 |
T19070 |
det |
a,control |
R13567 |
T19070 |
T19068 |
pobj |
control,as |
R13568 |
T19071 |
T19070 |
prep |
for,control |
R13569 |
T19072 |
T19073 |
compound |
transfection,efficiency |
R13570 |
T19073 |
T19071 |
pobj |
efficiency,for |
R13571 |
T19074 |
T19067 |
punct |
.,used |
R13673 |
T19267 |
T19268 |
compound |
Nuclear,protein |
R13674 |
T19268 |
T19269 |
nsubj |
protein,extract |
R13675 |
T19269 |
T19269 |
ROOT |
extract,extract |
R13676 |
T19270 |
T19269 |
cc |
and,extract |
R13677 |
T19271 |
T19269 |
prep |
in,extract |
R13678 |
T19272 |
T19273 |
amod |
vitro,translation |
R13679 |
T19273 |
T19271 |
pobj |
translation,in |
R13680 |
T19274 |
T19273 |
prep |
of,translation |
R13681 |
T19275 |
T19274 |
pobj |
Sox6,of |
R13682 |
T19276 |
T19269 |
punct |
.,extract |
R13683 |
T19277 |
T19278 |
compound |
Nuclear,extracts |
R13684 |
T19278 |
T19280 |
nsubjpass |
extracts,prepared |
R13685 |
T19279 |
T19280 |
auxpass |
were,prepared |
R13686 |
T19280 |
T19280 |
ROOT |
prepared,prepared |
R13687 |
T19281 |
T19280 |
prep |
from,prepared |
R13688 |
T19282 |
T19283 |
compound |
MEL,cells |
R13689 |
T19283 |
T19281 |
pobj |
cells,from |
R13690 |
T19284 |
T19283 |
punct |
(,cells |
R13691 |
T19285 |
T19286 |
nummod |
2,× |
R13692 |
T19286 |
T19287 |
nummod |
×,107 |
R13693 |
T19287 |
T19283 |
appos |
107,cells |
R13694 |
T19288 |
T19283 |
punct |
),cells |
R13695 |
T19289 |
T19280 |
advcl |
using,prepared |
R13696 |
T19290 |
T19291 |
det |
a,kit |
R13697 |
T19291 |
T19289 |
dobj |
kit,using |
R13698 |
T19292 |
T19291 |
punct |
(,kit |
R13699 |
T19293 |
T19294 |
amod |
Active,Motif |
R13700 |
T19294 |
T19291 |
appos |
Motif,kit |
R13701 |
T19295 |
T19294 |
punct |
",",Motif |
R13702 |
T19296 |
T19294 |
conj |
Carlsbad,Motif |
R13703 |
T19297 |
T19296 |
punct |
",",Carlsbad |
R13704 |
T19298 |
T19296 |
conj |
California,Carlsbad |
R13705 |
T19299 |
T19298 |
punct |
",",California |
R13706 |
T19300 |
T19301 |
compound |
United,States |
R13707 |
T19301 |
T19298 |
conj |
States,California |
R13708 |
T19302 |
T19296 |
punct |
),Carlsbad |
R13709 |
T19303 |
T19280 |
punct |
.,prepared |
R13710 |
T19304 |
T19305 |
det |
The,Sox6 |
R13711 |
T19305 |
T19312 |
nsubjpass |
Sox6,tagged |
R13712 |
T19306 |
T19312 |
prep |
in,tagged |
R13713 |
T19307 |
T19309 |
amod |
vitro,expression |
R13714 |
T19308 |
T19309 |
compound |
translation,expression |
R13715 |
T19309 |
T19310 |
compound |
expression,vector |
R13716 |
T19310 |
T19306 |
pobj |
vector,in |
R13717 |
T19311 |
T19312 |
punct |
",",tagged |
R13718 |
T19312 |
T19312 |
ROOT |
tagged,tagged |
R13719 |
T19313 |
T19312 |
prep |
with,tagged |
R13720 |
T19314 |
T19313 |
pobj |
c-Myc,with |
R13721 |
T19315 |
T19314 |
cc |
and,c-Myc |
R13722 |
T19316 |
T19314 |
conj |
HA,c-Myc |
R13723 |
T19317 |
T19319 |
punct |
",",described |
R13724 |
T19318 |
T19319 |
auxpass |
was,described |
R13725 |
T19319 |
T19312 |
conj |
described,tagged |
R13726 |
T19320 |
T19319 |
prep |
before,described |
R13727 |
T19321 |
T19323 |
nmod |
[,] |
R13728 |
T19322 |
T19321 |
nummod |
15,[ |
R13729 |
T19323 |
T19320 |
pobj |
],before |
R13730 |
T19324 |
T19319 |
punct |
.,described |
R13731 |
T19325 |
T19326 |
det |
The,translation |
R13732 |
T19326 |
T19328 |
nsubjpass |
translation,performed |
R13733 |
T19327 |
T19328 |
auxpass |
was,performed |
R13734 |
T19328 |
T19328 |
ROOT |
performed,performed |
R13735 |
T19329 |
T19328 |
prep |
in,performed |
R13736 |
T19330 |
T19332 |
det |
a,lysate |
R13737 |
T19331 |
T19332 |
amod |
reticulocyte,lysate |
R13738 |
T19332 |
T19329 |
pobj |
lysate,in |
R13739 |
T19333 |
T19332 |
acl |
based,lysate |
R13740 |
T19334 |
T19333 |
prep |
in,based |
R13741 |
T19335 |
T19337 |
amod |
vitro,system |
R13742 |
T19336 |
T19337 |
amod |
translational,system |
R13743 |
T19337 |
T19334 |
pobj |
system,in |
R13744 |
T19338 |
T19337 |
punct |
(,system |
R13745 |
T19339 |
T19344 |
nmod |
TNT,Systems |
R13746 |
T19340 |
T19339 |
nummod |
®,TNT |
R13747 |
T19341 |
T19344 |
compound |
Quick,Systems |
R13748 |
T19342 |
T19344 |
compound |
Coupled,Systems |
R13749 |
T19343 |
T19344 |
compound |
Transcription/Translation,Systems |
R13750 |
T19344 |
T19337 |
appos |
Systems,system |
R13751 |
T19345 |
T19344 |
punct |
",",Systems |
R13752 |
T19346 |
T19344 |
appos |
Promega,Systems |
R13753 |
T19347 |
T19337 |
punct |
),system |
R13754 |
T19348 |
T19328 |
punct |
.,performed |
R13755 |
T19349 |
T19350 |
det |
A,vector |
R13756 |
T19350 |
T19358 |
nsubjpass |
vector,translated |
R13757 |
T19351 |
T19350 |
prep |
without,vector |
R13758 |
T19352 |
T19355 |
det |
the,sequence |
R13759 |
T19353 |
T19355 |
amod |
Sox6,sequence |
R13760 |
T19354 |
T19355 |
compound |
coding,sequence |
R13761 |
T19355 |
T19351 |
pobj |
sequence,without |
R13762 |
T19356 |
T19358 |
auxpass |
was,translated |
R13763 |
T19357 |
T19358 |
advmod |
also,translated |
R13764 |
T19358 |
T19358 |
ROOT |
translated,translated |
R13765 |
T19359 |
T19358 |
prep |
as,translated |
R13766 |
T19360 |
T19362 |
det |
a,control |
R13767 |
T19361 |
T19362 |
amod |
negative,control |
R13768 |
T19362 |
T19359 |
pobj |
control,as |
R13769 |
T19363 |
T19358 |
punct |
.,translated |
R13850 |
T19522 |
T19522 |
ROOT |
Antibodies,Antibodies |
R13851 |
T19523 |
T19522 |
punct |
.,Antibodies |
R13852 |
T19524 |
T19525 |
amod |
Sox6,antibodies |
R13853 |
T19525 |
T19530 |
nsubj |
antibodies,were |
R13854 |
T19526 |
T19525 |
acl |
used,antibodies |
R13855 |
T19527 |
T19526 |
prep |
in,used |
R13856 |
T19528 |
T19529 |
det |
this,study |
R13857 |
T19529 |
T19527 |
pobj |
study,in |
R13858 |
T19530 |
T19533 |
auxpass |
were,provided |
R13859 |
T19531 |
T19533 |
preconj |
either,provided |
R13860 |
T19532 |
T19533 |
advmod |
kindly,provided |
R13861 |
T19533 |
T19533 |
ROOT |
provided,provided |
R13862 |
T19534 |
T19533 |
agent |
by,provided |
R13863 |
T19535 |
T19537 |
compound |
Dr.,Lalli |
R13864 |
T19536 |
T19537 |
compound |
Enzo,Lalli |
R13865 |
T19537 |
T19534 |
pobj |
Lalli,by |
R13866 |
T19538 |
T19541 |
punct |
(,Pasteur |
R13867 |
T19539 |
T19541 |
compound |
Université,Pasteur |
R13868 |
T19540 |
T19541 |
compound |
Louis,Pasteur |
R13869 |
T19541 |
T19537 |
appos |
Pasteur,Lalli |
R13870 |
T19542 |
T19541 |
punct |
",",Pasteur |
R13871 |
T19543 |
T19550 |
nsubj |
France,obtained |
R13872 |
T19544 |
T19546 |
nmod |
[,] |
R13873 |
T19545 |
T19546 |
nummod |
7,] |
R13874 |
T19546 |
T19543 |
nmod |
],France |
R13875 |
T19547 |
T19546 |
punct |
),] |
R13876 |
T19548 |
T19543 |
cc |
or,France |
R13877 |
T19549 |
T19550 |
advmod |
commercially,obtained |
R13878 |
T19550 |
T19533 |
conj |
obtained,provided |
R13879 |
T19551 |
T19556 |
punct |
(,X |
R13880 |
T19552 |
T19553 |
compound |
Catalog,No |
R13881 |
T19553 |
T19556 |
nmod |
No,X |
R13882 |
T19554 |
T19556 |
punct |
.,X |
R13883 |
T19555 |
T19556 |
compound |
sc-17332,X |
R13884 |
T19556 |
T19550 |
dobj |
X,obtained |
R13885 |
T19557 |
T19556 |
punct |
",",X |
R13886 |
T19558 |
T19559 |
compound |
Santa,Cruz |
R13887 |
T19559 |
T19560 |
compound |
Cruz,Biotechnology |
R13888 |
T19560 |
T19556 |
conj |
Biotechnology,X |
R13889 |
T19561 |
T19560 |
punct |
",",Biotechnology |
R13890 |
T19562 |
T19563 |
compound |
Santa,Cruz |
R13891 |
T19563 |
T19560 |
conj |
Cruz,Biotechnology |
R13892 |
T19564 |
T19563 |
punct |
",",Cruz |
R13893 |
T19565 |
T19563 |
conj |
California,Cruz |
R13894 |
T19566 |
T19565 |
punct |
",",California |
R13895 |
T19567 |
T19568 |
compound |
United,States |
R13896 |
T19568 |
T19565 |
conj |
States,California |
R13897 |
T19569 |
T19550 |
punct |
),obtained |
R13898 |
T19570 |
T19533 |
punct |
.,provided |
R13899 |
T19571 |
T19573 |
det |
All,antibodies |
R13900 |
T19572 |
T19573 |
amod |
Sox6,antibodies |
R13901 |
T19573 |
T19574 |
nsubj |
antibodies,generated |
R13902 |
T19574 |
T19574 |
ROOT |
generated,generated |
R13903 |
T19575 |
T19576 |
amod |
similar,results |
R13904 |
T19576 |
T19574 |
dobj |
results,generated |
R13905 |
T19577 |
T19574 |
punct |
.,generated |
R13906 |
T19578 |
T19579 |
amod |
c-Myc,antibody |
R13907 |
T19579 |
T19581 |
nsubjpass |
antibody,purchased |
R13908 |
T19580 |
T19581 |
auxpass |
was,purchased |
R13909 |
T19581 |
T19581 |
ROOT |
purchased,purchased |
R13910 |
T19582 |
T19581 |
prep |
from,purchased |
R13911 |
T19583 |
T19582 |
pobj |
Invitrogen,from |
R13912 |
T19584 |
T19581 |
punct |
.,purchased |
R13913 |
T19585 |
T19588 |
amod |
Normal,antibody |
R13914 |
T19586 |
T19588 |
compound |
rabbit,antibody |
R13915 |
T19587 |
T19588 |
compound |
IgG,antibody |
R13916 |
T19588 |
T19590 |
nsubjpass |
antibody,obtained |
R13917 |
T19589 |
T19590 |
auxpass |
was,obtained |
R13918 |
T19590 |
T19590 |
ROOT |
obtained,obtained |
R13919 |
T19591 |
T19590 |
prep |
from,obtained |
R13920 |
T19592 |
T19593 |
compound |
Upstate,Biotechnology |
R13921 |
T19593 |
T19591 |
pobj |
Biotechnology,from |
R13922 |
T19594 |
T19596 |
punct |
(,Placid |
R13923 |
T19595 |
T19596 |
compound |
Lake,Placid |
R13924 |
T19596 |
T19593 |
appos |
Placid,Biotechnology |
R13925 |
T19597 |
T19596 |
punct |
",",Placid |
R13926 |
T19598 |
T19599 |
compound |
New,York |
R13927 |
T19599 |
T19596 |
npadvmod |
York,Placid |
R13928 |
T19600 |
T19599 |
punct |
",",York |
R13929 |
T19601 |
T19602 |
compound |
United,States |
R13930 |
T19602 |
T19599 |
appos |
States,York |
R13931 |
T19603 |
T19596 |
punct |
),Placid |
R13932 |
T19604 |
T19590 |
punct |
.,obtained |
R14199 |
T19985 |
T19985 |
ROOT |
EMSA,EMSA |
R14200 |
T19986 |
T19985 |
punct |
.,EMSA |
R14201 |
T19987 |
T19989 |
amod |
Single-stranded,oligonucleotides |
R14202 |
T19988 |
T19989 |
amod |
complementary,oligonucleotides |
R14203 |
T19989 |
T19990 |
nsubj |
oligonucleotides,were |
R14204 |
T19990 |
T19990 |
ROOT |
were,were |
R14205 |
T19991 |
T19990 |
acomp |
annealed,were |
R14206 |
T19992 |
T19991 |
cc |
and,annealed |
R14207 |
T19993 |
T19991 |
conj |
end-labeled,annealed |
R14208 |
T19994 |
T19991 |
prep |
with,annealed |
R14209 |
T19995 |
T19998 |
compound |
[,ATP |
R14210 |
T19996 |
T19998 |
compound |
γ-32P,ATP |
R14211 |
T19997 |
T19998 |
compound |
],ATP |
R14212 |
T19998 |
T19994 |
pobj |
ATP,with |
R14213 |
T19999 |
T19994 |
prep |
with,with |
R14214 |
T20000 |
T20002 |
nummod |
T4,kinase |
R14215 |
T20001 |
T20002 |
compound |
polynucleotide,kinase |
R14216 |
T20002 |
T19999 |
pobj |
kinase,with |
R14217 |
T20003 |
T19990 |
punct |
.,were |
R14218 |
T20004 |
T20006 |
nsubjpass |
EMSA,performed |
R14219 |
T20005 |
T20006 |
auxpass |
was,performed |
R14220 |
T20006 |
T20006 |
ROOT |
performed,performed |
R14221 |
T20007 |
T20006 |
prep |
with,performed |
R14222 |
T20008 |
T20009 |
nummod |
5,μg |
R14223 |
T20009 |
T20007 |
pobj |
μg,with |
R14224 |
T20010 |
T20009 |
prep |
of,μg |
R14225 |
T20011 |
T20012 |
amod |
nuclear,proteins |
R14226 |
T20012 |
T20010 |
pobj |
proteins,of |
R14227 |
T20013 |
T20009 |
prep |
from,μg |
R14228 |
T20014 |
T20015 |
compound |
MEL,cells |
R14229 |
T20015 |
T20013 |
pobj |
cells,from |
R14230 |
T20016 |
T20015 |
cc |
or,cells |
R14231 |
T20017 |
T20018 |
nummod |
3,μl |
R14232 |
T20018 |
T20015 |
conj |
μl,cells |
R14233 |
T20019 |
T20018 |
prep |
of,μl |
R14234 |
T20020 |
T20018 |
prep |
in,μl |
R14235 |
T20021 |
T20022 |
amod |
vitro-translated,Sox6 |
R14236 |
T20022 |
T20020 |
pobj |
Sox6,in |
R14237 |
T20023 |
T20009 |
prep |
along,μg |
R14238 |
T20024 |
T20023 |
prep |
with,along |
R14239 |
T20025 |
T20027 |
det |
the,lysate |
R14240 |
T20026 |
T20027 |
compound |
reticulocyte,lysate |
R14241 |
T20027 |
T20024 |
pobj |
lysate,with |
R14242 |
T20028 |
T20027 |
prep |
in,lysate |
R14243 |
T20029 |
T20030 |
amod |
binding,buffer |
R14244 |
T20030 |
T20028 |
pobj |
buffer,in |
R14245 |
T20031 |
T20009 |
punct |
:,μg |
R14246 |
T20032 |
T20034 |
nummod |
100,NaCl |
R14247 |
T20033 |
T20034 |
compound |
mM,NaCl |
R14248 |
T20034 |
T20009 |
appos |
NaCl,μg |
R14249 |
T20035 |
T20034 |
punct |
",",NaCl |
R14250 |
T20036 |
T20037 |
nummod |
10,% |
R14251 |
T20037 |
T20038 |
compound |
%,glycerol |
R14252 |
T20038 |
T20034 |
appos |
glycerol,NaCl |
R14253 |
T20039 |
T20038 |
punct |
",",glycerol |
R14254 |
T20040 |
T20041 |
nummod |
200,ng |
R14255 |
T20041 |
T20050 |
npadvmod |
ng,poly |
R14256 |
T20042 |
T20044 |
nmod |
/,BSA |
R14257 |
T20043 |
T20044 |
compound |
μl,BSA |
R14258 |
T20044 |
T20050 |
nmod |
BSA,poly |
R14259 |
T20045 |
T20050 |
punct |
",",poly |
R14260 |
T20046 |
T20047 |
nummod |
50,ng |
R14261 |
T20047 |
T20050 |
compound |
ng,poly |
R14262 |
T20048 |
T20050 |
compound |
/,poly |
R14263 |
T20049 |
T20050 |
compound |
μl,poly |
R14264 |
T20050 |
T20009 |
appos |
poly,μg |
R14265 |
T20051 |
T20050 |
punct |
(,poly |
R14266 |
T20052 |
T20050 |
appos |
dI-dC,poly |
R14267 |
T20053 |
T20052 |
punct |
),dI-dC |
R14268 |
T20054 |
T20052 |
cc |
or,dI-dC |
R14269 |
T20055 |
T20055 |
ROOT |
poly,poly |
R14270 |
T20056 |
T20057 |
punct |
(,dG-dC |
R14271 |
T20057 |
T20055 |
appos |
dG-dC,poly |
R14272 |
T20058 |
T20057 |
punct |
),dG-dC |
R14273 |
T20059 |
T20055 |
punct |
",",poly |
R14274 |
T20060 |
T20062 |
nummod |
10,HEPES |
R14275 |
T20061 |
T20062 |
compound |
mM,HEPES |
R14276 |
T20062 |
T20055 |
appos |
HEPES,poly |
R14277 |
T20063 |
T20064 |
punct |
(,pH |
R14278 |
T20064 |
T20062 |
parataxis |
pH,HEPES |
R14279 |
T20065 |
T20064 |
nummod |
7,pH |
R14280 |
T20066 |
T20064 |
punct |
),pH |
R14281 |
T20067 |
T20064 |
punct |
",",pH |
R14282 |
T20068 |
T20070 |
nummod |
0.1,EDTA |
R14283 |
T20069 |
T20070 |
compound |
mM,EDTA |
R14284 |
T20070 |
T20064 |
appos |
EDTA,pH |
R14285 |
T20071 |
T20070 |
punct |
",",EDTA |
R14286 |
T20072 |
T20074 |
nummod |
0.25,DTT |
R14287 |
T20073 |
T20074 |
compound |
mM,DTT |
R14288 |
T20074 |
T20070 |
appos |
DTT,EDTA |
R14289 |
T20075 |
T20074 |
punct |
",",DTT |
R14290 |
T20076 |
T20078 |
nummod |
0.6,MgCl2 |
R14291 |
T20077 |
T20078 |
compound |
mM,MgCl2 |
R14292 |
T20078 |
T20074 |
appos |
MgCl2,DTT |
R14293 |
T20079 |
T20006 |
punct |
.,performed |
R14294 |
T20080 |
T20103 |
prep |
For,added |
R14295 |
T20081 |
T20080 |
pobj |
competition,For |
R14296 |
T20082 |
T20081 |
cc |
or,competition |
R14297 |
T20083 |
T20084 |
compound |
supershift,assays |
R14298 |
T20084 |
T20081 |
conj |
assays,competition |
R14299 |
T20085 |
T20084 |
punct |
",",assays |
R14300 |
T20086 |
T20090 |
det |
the,competitor |
R14301 |
T20087 |
T20090 |
amod |
indicated,competitor |
R14302 |
T20088 |
T20090 |
amod |
unlabelled,competitor |
R14303 |
T20089 |
T20090 |
compound |
oligonucleotide,competitor |
R14304 |
T20090 |
T20084 |
conj |
competitor,assays |
R14305 |
T20091 |
T20090 |
punct |
(,competitor |
R14306 |
T20092 |
T20094 |
amod |
200-fold,excess |
R14307 |
T20093 |
T20094 |
compound |
molar,excess |
R14308 |
T20094 |
T20090 |
appos |
excess,competitor |
R14309 |
T20095 |
T20090 |
punct |
),competitor |
R14310 |
T20096 |
T20090 |
cc |
or,competitor |
R14311 |
T20097 |
T20090 |
conj |
antibody,competitor |
R14312 |
T20098 |
T20097 |
punct |
(,antibody |
R14313 |
T20099 |
T20100 |
nummod |
3,μl |
R14314 |
T20100 |
T20097 |
appos |
μl,antibody |
R14315 |
T20101 |
T20097 |
punct |
),antibody |
R14316 |
T20102 |
T20103 |
auxpass |
was,added |
R14317 |
T20103 |
T20103 |
ROOT |
added,added |
R14318 |
T20104 |
T20107 |
quantmod |
30,60 |
R14319 |
T20105 |
T20107 |
quantmod |
min,60 |
R14320 |
T20106 |
T20107 |
quantmod |
to,60 |
R14321 |
T20107 |
T20103 |
dobj |
60,added |
R14322 |
T20108 |
T20107 |
quantmod |
min,60 |
R14323 |
T20109 |
T20103 |
advmod |
prior,added |
R14324 |
T20110 |
T20103 |
prep |
to,added |
R14325 |
T20111 |
T20110 |
pobj |
addition,to |
R14326 |
T20112 |
T20111 |
prep |
of,addition |
R14327 |
T20113 |
T20114 |
amod |
radiolabeled,probe |
R14328 |
T20114 |
T20112 |
pobj |
probe,of |
R14329 |
T20115 |
T20103 |
punct |
.,added |
R14330 |
T20116 |
T20126 |
prep |
Following,incubated |
R14331 |
T20117 |
T20116 |
pobj |
addition,Following |
R14332 |
T20118 |
T20117 |
prep |
of,addition |
R14333 |
T20119 |
T20121 |
det |
the,probe |
R14334 |
T20120 |
T20121 |
compound |
radiolabeled,probe |
R14335 |
T20121 |
T20118 |
pobj |
probe,of |
R14336 |
T20122 |
T20126 |
punct |
",",incubated |
R14337 |
T20123 |
T20124 |
det |
the,samples |
R14338 |
T20124 |
T20126 |
nsubjpass |
samples,incubated |
R14339 |
T20125 |
T20126 |
auxpass |
were,incubated |
R14340 |
T20126 |
T20126 |
ROOT |
incubated,incubated |
R14341 |
T20127 |
T20126 |
prep |
for,incubated |
R14342 |
T20128 |
T20129 |
nummod |
30,min |
R14343 |
T20129 |
T20127 |
pobj |
min,for |
R14344 |
T20130 |
T20129 |
cc |
or,min |
R14345 |
T20131 |
T20132 |
nummod |
60,min |
R14346 |
T20132 |
T20129 |
conj |
min,min |
R14347 |
T20133 |
T20132 |
prep |
at,min |
R14348 |
T20134 |
T20135 |
compound |
room,temperature |
R14349 |
T20135 |
T20133 |
pobj |
temperature,at |
R14350 |
T20136 |
T20132 |
cc |
and,min |
R14351 |
T20137 |
T20129 |
acl |
loaded,min |
R14352 |
T20138 |
T20137 |
prep |
on,loaded |
R14353 |
T20139 |
T20141 |
det |
a,% |
R14354 |
T20140 |
T20141 |
nummod |
4,% |
R14355 |
T20141 |
T20138 |
pobj |
%,on |
R14356 |
T20142 |
T20141 |
cc |
or,% |
R14357 |
T20143 |
T20144 |
nummod |
6,% |
R14358 |
T20144 |
T20141 |
conj |
%,% |
R14359 |
T20145 |
T20146 |
punct |
(,w/v |
R14360 |
T20146 |
T20144 |
appos |
w/v,% |
R14361 |
T20147 |
T20126 |
punct |
),incubated |
R14362 |
T20148 |
T20149 |
compound |
polyacrylamide,gel |
R14363 |
T20149 |
T20149 |
ROOT |
gel,gel |
R14364 |
T20150 |
T20149 |
punct |
.,gel |
R14365 |
T20151 |
T20153 |
nsubjpass |
Electrophoresis,performed |
R14366 |
T20152 |
T20153 |
auxpass |
was,performed |
R14367 |
T20153 |
T20153 |
ROOT |
performed,performed |
R14368 |
T20154 |
T20153 |
prep |
at,performed |
R14369 |
T20155 |
T20158 |
det |
a,mAmp |
R14370 |
T20156 |
T20158 |
amod |
constant,mAmp |
R14371 |
T20157 |
T20158 |
nummod |
19,mAmp |
R14372 |
T20158 |
T20154 |
pobj |
mAmp,at |
R14373 |
T20159 |
T20153 |
prep |
for,performed |
R14374 |
T20160 |
T20159 |
pobj |
4,for |
R14375 |
T20161 |
T20162 |
nummod |
8,h |
R14376 |
T20162 |
T20171 |
nsubjpass |
h,dried |
R14377 |
T20163 |
T20162 |
prep |
at,h |
R14378 |
T20164 |
T20165 |
compound |
room,temperature |
R14379 |
T20165 |
T20163 |
pobj |
temperature,at |
R14380 |
T20166 |
T20162 |
punct |
",",h |
R14381 |
T20167 |
T20162 |
cc |
and,h |
R14382 |
T20168 |
T20169 |
det |
the,gels |
R14383 |
T20169 |
T20162 |
conj |
gels,h |
R14384 |
T20170 |
T20171 |
auxpass |
were,dried |
R14385 |
T20171 |
T20153 |
conj |
dried,performed |
R14386 |
T20172 |
T20171 |
advmod |
prior,dried |
R14387 |
T20173 |
T20172 |
prep |
to,prior |
R14388 |
T20174 |
T20173 |
pobj |
autoradiography,to |
R14389 |
T20175 |
T20171 |
punct |
.,dried |
R14390 |
T20176 |
T20177 |
nsubj |
Antibodies,used |
R14391 |
T20177 |
T20177 |
ROOT |
used,used |
R14392 |
T20178 |
T20177 |
prep |
for,used |
R14393 |
T20179 |
T20180 |
compound |
supershift,analyses |
R14394 |
T20180 |
T20178 |
pobj |
analyses,for |
R14395 |
T20181 |
T20177 |
conj |
included,used |
R14396 |
T20182 |
T20188 |
nmod |
c-Myc,antibodies |
R14397 |
T20183 |
T20182 |
punct |
",",c-Myc |
R14398 |
T20184 |
T20182 |
conj |
HA,c-Myc |
R14399 |
T20185 |
T20184 |
punct |
",",HA |
R14400 |
T20186 |
T20184 |
cc |
and,HA |
R14401 |
T20187 |
T20184 |
conj |
Sox6,HA |
R14402 |
T20188 |
T20181 |
dobj |
antibodies,included |
R14403 |
T20189 |
T20188 |
punct |
(,antibodies |
R14404 |
T20190 |
T20188 |
acl |
described,antibodies |
R14405 |
T20191 |
T20190 |
prep |
as,described |
R14406 |
T20192 |
T20191 |
pcomp |
above,as |
R14407 |
T20193 |
T20188 |
punct |
),antibodies |
R14408 |
T20194 |
T20177 |
punct |
.,used |
R14409 |
T20195 |
T20197 |
det |
The,sequences |
R14410 |
T20196 |
T20197 |
compound |
DNA,sequences |
R14411 |
T20197 |
T20201 |
nsubj |
sequences,are |
R14412 |
T20198 |
T20197 |
prep |
of,sequences |
R14413 |
T20199 |
T20200 |
det |
the,oligonucleotides |
R14414 |
T20200 |
T20198 |
pobj |
oligonucleotides,of |
R14415 |
T20201 |
T20201 |
ROOT |
are,are |
R14416 |
T20202 |
T20203 |
mark |
as,follows |
R14417 |
T20203 |
T20201 |
advcl |
follows,are |
R14418 |
T20204 |
T20209 |
punct |
(,listed |
R14419 |
T20205 |
T20206 |
advmod |
only,forward |
R14420 |
T20206 |
T20209 |
advmod |
forward,listed |
R14421 |
T20207 |
T20209 |
nsubjpass |
oligos,listed |
R14422 |
T20208 |
T20209 |
auxpass |
are,listed |
R14423 |
T20209 |
T20201 |
advcl |
listed,are |
R14424 |
T20210 |
T20209 |
punct |
),listed |
R14425 |
T20211 |
T20237 |
punct |
:,′ |
R14426 |
T20212 |
T20237 |
prep |
For,′ |
R14427 |
T20213 |
T20216 |
det |
the,probe |
R14428 |
T20214 |
T20216 |
amod |
36-bp,probe |
R14429 |
T20215 |
T20216 |
compound |
WT,probe |
R14430 |
T20216 |
T20212 |
pobj |
probe,For |
R14431 |
T20217 |
T20237 |
punct |
:,′ |
R14432 |
T20218 |
T20221 |
nummod |
5,′ |
R14433 |
T20219 |
T20221 |
nummod |
′,′ |
R14434 |
T20220 |
T20221 |
compound |
AATGCAGAACAAAGGGTCAGAACATTGTCTGCGAAG3,′ |
R14435 |
T20221 |
T20237 |
npadvmod |
′,′ |
R14436 |
T20222 |
T20223 |
punct |
(,MHB1556 |
R14437 |
T20223 |
T20221 |
appos |
MHB1556,′ |
R14438 |
T20224 |
T20223 |
punct |
),MHB1556 |
R14439 |
T20225 |
T20237 |
punct |
;,′ |
R14440 |
T20226 |
T20237 |
prep |
for,′ |
R14441 |
T20227 |
T20228 |
amod |
mutant,probe |
R14442 |
T20228 |
T20226 |
pobj |
probe,for |
R14443 |
T20229 |
T20228 |
nummod |
1,probe |
R14444 |
T20230 |
T20228 |
punct |
(,probe |
R14445 |
T20231 |
T20228 |
appos |
M1,probe |
R14446 |
T20232 |
T20228 |
punct |
),probe |
R14447 |
T20233 |
T20237 |
punct |
:,′ |
R14448 |
T20234 |
T20237 |
nummod |
5,′ |
R14449 |
T20235 |
T20237 |
nummod |
′,′ |
R14450 |
T20236 |
T20237 |
compound |
AACAAAGGGTCAGAACATTGTCTGCGAAG3,′ |
R14451 |
T20237 |
T20237 |
ROOT |
′,′ |
R14452 |
T20238 |
T20239 |
punct |
(,MHB1644 |
R14453 |
T20239 |
T20237 |
appos |
MHB1644,′ |
R14454 |
T20240 |
T20239 |
punct |
),MHB1644 |
R14455 |
T20241 |
T20253 |
punct |
;,′ |
R14456 |
T20242 |
T20253 |
prep |
for,′ |
R14457 |
T20243 |
T20244 |
amod |
mutant,probe |
R14458 |
T20244 |
T20242 |
pobj |
probe,for |
R14459 |
T20245 |
T20244 |
nummod |
2,probe |
R14460 |
T20246 |
T20244 |
punct |
(,probe |
R14461 |
T20247 |
T20244 |
appos |
M2,probe |
R14462 |
T20248 |
T20244 |
punct |
),probe |
R14463 |
T20249 |
T20253 |
punct |
:,′ |
R14464 |
T20250 |
T20251 |
nummod |
5,′ |
R14465 |
T20251 |
T20253 |
compound |
′,′ |
R14466 |
T20252 |
T20253 |
compound |
AATGCAGAACAAAGGGTCAGAtgagTGTCTGCGAAG3,′ |
R14467 |
T20253 |
T20237 |
conj |
′,′ |
R14468 |
T20254 |
T20253 |
punct |
(,′ |
R14469 |
T20255 |
T20253 |
appos |
MHB1648,′ |
R14470 |
T20256 |
T20253 |
punct |
),′ |
R14471 |
T20257 |
T20253 |
punct |
;,′ |
R14472 |
T20258 |
T20258 |
ROOT |
for,for |
R14473 |
T20259 |
T20260 |
amod |
mutant,probe |
R14474 |
T20260 |
T20258 |
pobj |
probe,for |
R14475 |
T20261 |
T20260 |
nummod |
3,probe |
R14476 |
T20262 |
T20260 |
punct |
(,probe |
R14477 |
T20263 |
T20260 |
appos |
M3,probe |
R14478 |
T20264 |
T20260 |
punct |
),probe |
R14479 |
T20265 |
T20258 |
punct |
:,for |
R14480 |
T20266 |
T20267 |
nummod |
5,′ |
R14481 |
T20267 |
T20269 |
compound |
′,′ |
R14482 |
T20268 |
T20269 |
compound |
AATGCAGtgccAAGGGTCAGAACATTGTCTGCGAAG3,′ |
R14483 |
T20269 |
T20269 |
ROOT |
′,′ |
R14484 |
T20270 |
T20269 |
punct |
(,′ |
R14485 |
T20271 |
T20269 |
appos |
MHB1650,′ |
R14486 |
T20272 |
T20269 |
punct |
),′ |
R14487 |
T20273 |
T20237 |
punct |
.,′ |
R14776 |
T20678 |
T20679 |
compound |
ChIP,assay |
R14777 |
T20679 |
T20679 |
ROOT |
assay,assay |
R14778 |
T20680 |
T20679 |
punct |
.,assay |
R14779 |
T20681 |
T20682 |
mark |
As,described |
R14780 |
T20682 |
T20711 |
advcl |
described,treated |
R14781 |
T20683 |
T20682 |
agent |
by,described |
R14782 |
T20684 |
T20685 |
compound |
Nouzova,[ |
R14783 |
T20685 |
T20687 |
nmod |
[,] |
R14784 |
T20686 |
T20687 |
nummod |
53,] |
R14785 |
T20687 |
T20683 |
pobj |
],by |
R14786 |
T20688 |
T20682 |
punct |
",",described |
R14787 |
T20689 |
T20682 |
prep |
in,described |
R14788 |
T20690 |
T20689 |
pobj |
brief,in |
R14789 |
T20691 |
T20711 |
punct |
:,treated |
R14790 |
T20692 |
T20711 |
nsubjpass |
Cells,treated |
R14791 |
T20693 |
T20692 |
prep |
from,Cells |
R14792 |
T20694 |
T20695 |
compound |
MEL,cells |
R14793 |
T20695 |
T20693 |
pobj |
cells,from |
R14794 |
T20696 |
T20695 |
punct |
(,cells |
R14795 |
T20697 |
T20699 |
nummod |
4,107 |
R14796 |
T20698 |
T20699 |
nummod |
×,107 |
R14797 |
T20699 |
T20695 |
appos |
107,cells |
R14798 |
T20700 |
T20699 |
punct |
),107 |
R14799 |
T20701 |
T20699 |
cc |
or,107 |
R14800 |
T20702 |
T20704 |
amod |
fetal,cells |
R14801 |
T20703 |
T20704 |
compound |
liver,cells |
R14802 |
T20704 |
T20711 |
nsubjpass |
cells,treated |
R14803 |
T20705 |
T20704 |
prep |
from,cells |
R14804 |
T20706 |
T20709 |
nummod |
three,mice |
R14805 |
T20707 |
T20709 |
amod |
15.5-dpc,mice |
R14806 |
T20708 |
T20709 |
compound |
WT,mice |
R14807 |
T20709 |
T20705 |
pobj |
mice,from |
R14808 |
T20710 |
T20711 |
auxpass |
were,treated |
R14809 |
T20711 |
T20711 |
ROOT |
treated,treated |
R14810 |
T20712 |
T20711 |
prep |
with,treated |
R14811 |
T20713 |
T20714 |
nummod |
1,% |
R14812 |
T20714 |
T20715 |
compound |
%,formaldehyde |
R14813 |
T20715 |
T20712 |
pobj |
formaldehyde,with |
R14814 |
T20716 |
T20711 |
prep |
for,treated |
R14815 |
T20717 |
T20718 |
nummod |
10,min |
R14816 |
T20718 |
T20716 |
pobj |
min,for |
R14817 |
T20719 |
T20711 |
prep |
at,treated |
R14818 |
T20720 |
T20721 |
nummod |
37,° |
R14819 |
T20721 |
T20722 |
nummod |
°,C |
R14820 |
T20722 |
T20719 |
pobj |
C,at |
R14821 |
T20723 |
T20711 |
punct |
",",treated |
R14822 |
T20724 |
T20711 |
conj |
rinsed,treated |
R14823 |
T20725 |
T20724 |
prep |
in,rinsed |
R14824 |
T20726 |
T20729 |
amod |
ice-cold,Hanks |
R14825 |
T20727 |
T20728 |
nummod |
1,× |
R14826 |
T20728 |
T20729 |
compound |
×,Hanks |
R14827 |
T20729 |
T20733 |
poss |
Hanks,solution |
R14828 |
T20730 |
T20729 |
case |
',Hanks |
R14829 |
T20731 |
T20733 |
amod |
balanced,solution |
R14830 |
T20732 |
T20733 |
compound |
salt,solution |
R14831 |
T20733 |
T20725 |
pobj |
solution,in |
R14832 |
T20734 |
T20733 |
prep |
with,solution |
R14833 |
T20735 |
T20736 |
nummod |
0.1,% |
R14834 |
T20736 |
T20737 |
compound |
%,EDTA |
R14835 |
T20737 |
T20738 |
nsubj |
EDTA,containing |
R14836 |
T20738 |
T20734 |
pcomp |
containing,with |
R14837 |
T20739 |
T20740 |
compound |
protease,inhibitors |
R14838 |
T20740 |
T20738 |
dobj |
inhibitors,containing |
R14839 |
T20741 |
T20740 |
punct |
",",inhibitors |
R14840 |
T20742 |
T20740 |
acl |
collected,inhibitors |
R14841 |
T20743 |
T20742 |
agent |
by,collected |
R14842 |
T20744 |
T20743 |
pobj |
centrifugation,by |
R14843 |
T20745 |
T20742 |
prep |
at,collected |
R14844 |
T20746 |
T20747 |
nummod |
4,° |
R14845 |
T20747 |
T20748 |
nummod |
°,C |
R14846 |
T20748 |
T20745 |
pobj |
C,at |
R14847 |
T20749 |
T20748 |
punct |
",",C |
R14848 |
T20750 |
T20724 |
conj |
resuspended,rinsed |
R14849 |
T20751 |
T20750 |
prep |
in,resuspended |
R14850 |
T20752 |
T20755 |
det |
a,buffer |
R14851 |
T20753 |
T20755 |
compound |
SDS,buffer |
R14852 |
T20754 |
T20755 |
compound |
lysis,buffer |
R14853 |
T20755 |
T20751 |
pobj |
buffer,in |
R14854 |
T20756 |
T20755 |
acl |
containing,buffer |
R14855 |
T20757 |
T20758 |
compound |
protease,inhibitors |
R14856 |
T20758 |
T20756 |
dobj |
inhibitors,containing |
R14857 |
T20759 |
T20750 |
punct |
",",resuspended |
R14858 |
T20760 |
T20750 |
cc |
and,resuspended |
R14859 |
T20761 |
T20750 |
conj |
incubated,resuspended |
R14860 |
T20762 |
T20761 |
prep |
on,incubated |
R14861 |
T20763 |
T20762 |
pobj |
ice,on |
R14862 |
T20764 |
T20761 |
prep |
for,incubated |
R14863 |
T20765 |
T20766 |
nummod |
10,min |
R14864 |
T20766 |
T20764 |
pobj |
min,for |
R14865 |
T20767 |
T20711 |
punct |
.,treated |
R14866 |
T20768 |
T20769 |
amod |
DNA-protein,complexes |
R14867 |
T20769 |
T20771 |
nsubjpass |
complexes,sonicated |
R14868 |
T20770 |
T20771 |
auxpass |
were,sonicated |
R14869 |
T20771 |
T20771 |
ROOT |
sonicated,sonicated |
R14870 |
T20772 |
T20771 |
prep |
to,sonicated |
R14871 |
T20773 |
T20776 |
nummod |
200,bp |
R14872 |
T20774 |
T20773 |
cc |
and,200 |
R14873 |
T20775 |
T20773 |
conj |
600,200 |
R14874 |
T20776 |
T20772 |
pobj |
bp,to |
R14875 |
T20777 |
T20771 |
punct |
.,sonicated |
R14876 |
T20778 |
T20783 |
nsubjpass |
One-tenth,set |
R14877 |
T20779 |
T20778 |
prep |
of,One-tenth |
R14878 |
T20780 |
T20781 |
det |
the,sample |
R14879 |
T20781 |
T20779 |
pobj |
sample,of |
R14880 |
T20782 |
T20783 |
auxpass |
was,set |
R14881 |
T20783 |
T20783 |
ROOT |
set,set |
R14882 |
T20784 |
T20783 |
advmod |
aside,set |
R14883 |
T20785 |
T20783 |
prep |
for,set |
R14884 |
T20786 |
T20787 |
compound |
input,control |
R14885 |
T20787 |
T20785 |
pobj |
control,for |
R14886 |
T20788 |
T20783 |
punct |
",",set |
R14887 |
T20789 |
T20783 |
cc |
and,set |
R14888 |
T20790 |
T20792 |
det |
the,sample |
R14889 |
T20791 |
T20792 |
amod |
remaining,sample |
R14890 |
T20792 |
T20794 |
nsubjpass |
sample,precleared |
R14891 |
T20793 |
T20794 |
auxpass |
was,precleared |
R14892 |
T20794 |
T20783 |
conj |
precleared,set |
R14893 |
T20795 |
T20794 |
prep |
with,precleared |
R14894 |
T20796 |
T20797 |
compound |
protein,A-Sepharose |
R14895 |
T20797 |
T20795 |
pobj |
A-Sepharose,with |
R14896 |
T20798 |
T20800 |
punct |
(,Biosciences |
R14897 |
T20799 |
T20800 |
compound |
Amersham,Biosciences |
R14898 |
T20800 |
T20797 |
appos |
Biosciences,A-Sepharose |
R14899 |
T20801 |
T20800 |
punct |
",",Biosciences |
R14900 |
T20802 |
T20800 |
npadvmod |
Piscataway,Biosciences |
R14901 |
T20803 |
T20802 |
punct |
",",Piscataway |
R14902 |
T20804 |
T20805 |
compound |
New,Jersey |
R14903 |
T20805 |
T20802 |
conj |
Jersey,Piscataway |
R14904 |
T20806 |
T20805 |
punct |
",",Jersey |
R14905 |
T20807 |
T20808 |
compound |
United,States |
R14906 |
T20808 |
T20802 |
appos |
States,Piscataway |
R14907 |
T20809 |
T20802 |
punct |
),Piscataway |
R14908 |
T20810 |
T20794 |
punct |
.,precleared |
R14909 |
T20811 |
T20817 |
prep |
Following,split |
R14910 |
T20812 |
T20811 |
pobj |
preclearing,Following |
R14911 |
T20813 |
T20817 |
punct |
",",split |
R14912 |
T20814 |
T20815 |
det |
the,samples |
R14913 |
T20815 |
T20817 |
nsubjpass |
samples,split |
R14914 |
T20816 |
T20817 |
auxpass |
were,split |
R14915 |
T20817 |
T20817 |
ROOT |
split,split |
R14916 |
T20818 |
T20817 |
prep |
into,split |
R14917 |
T20819 |
T20818 |
pobj |
thirds,into |
R14918 |
T20820 |
T20817 |
punct |
:,split |
R14919 |
T20821 |
T20822 |
nummod |
one,sample |
R14920 |
T20822 |
T20829 |
nsubjpass |
sample,treated |
R14921 |
T20823 |
T20822 |
acl |
treated,sample |
R14922 |
T20824 |
T20823 |
prep |
with,treated |
R14923 |
T20825 |
T20824 |
pobj |
anti-Sox6,with |
R14924 |
T20826 |
T20825 |
punct |
",",anti-Sox6 |
R14925 |
T20827 |
T20828 |
det |
a,second |
R14926 |
T20828 |
T20829 |
amod |
second,treated |
R14927 |
T20829 |
T20817 |
conj |
treated,split |
R14928 |
T20830 |
T20829 |
prep |
with,treated |
R14929 |
T20831 |
T20832 |
amod |
normal,rabbit |
R14930 |
T20832 |
T20833 |
compound |
rabbit,IgG |
R14931 |
T20833 |
T20830 |
pobj |
IgG,with |
R14932 |
T20834 |
T20829 |
punct |
",",treated |
R14933 |
T20835 |
T20829 |
cc |
and,treated |
R14934 |
T20836 |
T20838 |
det |
the,sample |
R14935 |
T20837 |
T20838 |
amod |
third,sample |
R14936 |
T20838 |
T20829 |
conj |
sample,treated |
R14937 |
T20839 |
T20838 |
prep |
without,sample |
R14938 |
T20840 |
T20839 |
pobj |
Ab,without |
R14939 |
T20841 |
T20829 |
punct |
.,treated |
R14940 |
T20842 |
T20844 |
det |
The,two |
R14941 |
T20843 |
T20844 |
amod |
last,two |
R14942 |
T20844 |
T20846 |
nsubjpass |
two,used |
R14943 |
T20845 |
T20846 |
auxpass |
were,used |
R14944 |
T20846 |
T20846 |
ROOT |
used,used |
R14945 |
T20847 |
T20846 |
prep |
as,used |
R14946 |
T20848 |
T20849 |
amod |
negative,controls |
R14947 |
T20849 |
T20847 |
pobj |
controls,as |
R14948 |
T20850 |
T20846 |
punct |
.,used |
R14949 |
T20851 |
T20853 |
det |
The,complexes |
R14950 |
T20852 |
T20853 |
amod |
chromatin-antibody,complexes |
R14951 |
T20853 |
T20855 |
nsubjpass |
complexes,eluted |
R14952 |
T20854 |
T20855 |
auxpass |
were,eluted |
R14953 |
T20855 |
T20855 |
ROOT |
eluted,eluted |
R14954 |
T20856 |
T20855 |
punct |
",",eluted |
R14955 |
T20857 |
T20855 |
cc |
and,eluted |
R14956 |
T20858 |
T20860 |
det |
the,protein |
R14957 |
T20859 |
T20860 |
compound |
DNA,protein |
R14958 |
T20860 |
T20861 |
compound |
protein,cross-links |
R14959 |
T20861 |
T20863 |
nsubjpass |
cross-links,reversed |
R14960 |
T20862 |
T20863 |
auxpass |
were,reversed |
R14961 |
T20863 |
T20855 |
conj |
reversed,eluted |
R14962 |
T20864 |
T20863 |
prep |
with,reversed |
R14963 |
T20865 |
T20867 |
nummod |
5,NaCl |
R14964 |
T20866 |
T20867 |
compound |
M,NaCl |
R14965 |
T20867 |
T20864 |
pobj |
NaCl,with |
R14966 |
T20868 |
T20863 |
prep |
at,reversed |
R14967 |
T20869 |
T20871 |
nummod |
65,C |
R14968 |
T20870 |
T20871 |
nummod |
°,C |
R14969 |
T20871 |
T20868 |
pobj |
C,at |
R14970 |
T20872 |
T20863 |
prep |
for,reversed |
R14971 |
T20873 |
T20874 |
nummod |
4,h. |
R14972 |
T20874 |
T20876 |
compound |
h.,DNA |
R14973 |
T20875 |
T20876 |
compound |
Input,DNA |
R14974 |
T20876 |
T20872 |
pobj |
DNA,for |
R14975 |
T20877 |
T20876 |
cc |
or,DNA |
R14976 |
T20878 |
T20879 |
amod |
immunoprecipitated,DNA |
R14977 |
T20879 |
T20876 |
conj |
DNA,DNA |
R14978 |
T20880 |
T20881 |
auxpass |
was,used |
R14979 |
T20881 |
T20863 |
conj |
used,reversed |
R14980 |
T20882 |
T20881 |
prep |
as,used |
R14981 |
T20883 |
T20884 |
det |
a,template |
R14982 |
T20884 |
T20882 |
pobj |
template,as |
R14983 |
T20885 |
T20884 |
prep |
in,template |
R14984 |
T20886 |
T20888 |
det |
the,reaction |
R14985 |
T20887 |
T20888 |
compound |
PCR,reaction |
R14986 |
T20888 |
T20885 |
pobj |
reaction,in |
R14987 |
T20889 |
T20863 |
punct |
.,reversed |
R14988 |
T20890 |
T20891 |
compound |
PCR,amplification |
R14989 |
T20891 |
T20897 |
nsubjpass |
amplification,performed |
R14990 |
T20892 |
T20891 |
prep |
of,amplification |
R14991 |
T20893 |
T20895 |
det |
the,promoter |
R14992 |
T20894 |
T20895 |
amod |
ɛy,promoter |
R14993 |
T20895 |
T20892 |
pobj |
promoter,of |
R14994 |
T20896 |
T20897 |
auxpass |
was,performed |
R14995 |
T20897 |
T20897 |
ROOT |
performed,performed |
R14996 |
T20898 |
T20897 |
cc |
and,performed |
R14997 |
T20899 |
T20897 |
conj |
yielded,performed |
R14998 |
T20900 |
T20902 |
det |
a,amplicon |
R14999 |
T20901 |
T20902 |
amod |
172-bp,amplicon |
R15000 |
T20902 |
T20899 |
dobj |
amplicon,yielded |
R15001 |
T20903 |
T20902 |
punct |
",",amplicon |
R15002 |
T20904 |
T20902 |
amod |
corresponding,amplicon |
R15003 |
T20905 |
T20907 |
aux |
to,− |
R15004 |
T20906 |
T20905 |
pobj |
nucleotides,to |
R15005 |
T20907 |
T20904 |
xcomp |
−,corresponding |
R15006 |
T20908 |
T20910 |
quantmod |
31,+140 |
R15007 |
T20909 |
T20910 |
quantmod |
to,+140 |
R15008 |
T20910 |
T20907 |
dobj |
+140,− |
R15009 |
T20911 |
T20910 |
prep |
of,+140 |
R15010 |
T20912 |
T20914 |
det |
the,promoter |
R15011 |
T20913 |
T20914 |
amod |
ɛy,promoter |
R15012 |
T20914 |
T20911 |
pobj |
promoter,of |
R15013 |
T20915 |
T20916 |
punct |
(,primers |
R15014 |
T20916 |
T20914 |
appos |
primers,promoter |
R15015 |
T20917 |
T20922 |
nmod |
MHB1688,′ |
R15016 |
T20918 |
T20917 |
punct |
",",MHB1688 |
R15017 |
T20919 |
T20920 |
nummod |
5,′ |
R15018 |
T20920 |
T20922 |
nmod |
′,′ |
R15019 |
T20921 |
T20922 |
nummod |
CGAAGAATAAAAGGCCACCA3,′ |
R15020 |
T20922 |
T20916 |
dobj |
′,primers |
R15021 |
T20923 |
T20916 |
punct |
;,primers |
R15022 |
T20924 |
T20916 |
cc |
and,primers |
R15023 |
T20925 |
T20916 |
conj |
MHB1689,primers |
R15024 |
T20926 |
T20925 |
punct |
",",MHB1689 |
R15025 |
T20927 |
T20928 |
nummod |
5,′ |
R15026 |
T20928 |
T20930 |
compound |
′,′ |
R15027 |
T20929 |
T20930 |
compound |
GCTTCACCACCAACCTCTTC3,′ |
R15028 |
T20930 |
T20925 |
conj |
′,MHB1689 |
R15029 |
T20931 |
T20930 |
punct |
),′ |
R15030 |
T20932 |
T20897 |
punct |
.,performed |
R15031 |
T20933 |
T20935 |
nsubjpass |
PCR,performed |
R15032 |
T20934 |
T20935 |
auxpass |
was,performed |
R15033 |
T20935 |
T20935 |
ROOT |
performed,performed |
R15034 |
T20936 |
T20935 |
prep |
under,performed |
R15035 |
T20937 |
T20939 |
det |
the,conditions |
R15036 |
T20938 |
T20939 |
amod |
following,conditions |
R15037 |
T20939 |
T20936 |
pobj |
conditions,under |
R15038 |
T20940 |
T20939 |
punct |
:,conditions |
R15039 |
T20941 |
T20942 |
nummod |
95,° |
R15040 |
T20942 |
T20943 |
compound |
°,C |
R15041 |
T20943 |
T20939 |
appos |
C,conditions |
R15042 |
T20944 |
T20943 |
prep |
for,C |
R15043 |
T20945 |
T20946 |
nummod |
15,min |
R15044 |
T20946 |
T20944 |
pobj |
min,for |
R15045 |
T20947 |
T20939 |
acl |
followed,conditions |
R15046 |
T20948 |
T20947 |
agent |
by,followed |
R15047 |
T20949 |
T20950 |
nummod |
30,cycles |
R15048 |
T20950 |
T20948 |
pobj |
cycles,by |
R15049 |
T20951 |
T20950 |
prep |
at,cycles |
R15050 |
T20952 |
T20951 |
pobj |
95,at |
R15051 |
T20953 |
T20954 |
nummod |
°,C |
R15052 |
T20954 |
T20950 |
conj |
C,cycles |
R15053 |
T20955 |
T20947 |
prep |
for,followed |
R15054 |
T20956 |
T20955 |
pobj |
30,for |
R15055 |
T20957 |
T20939 |
appos |
s,conditions |
R15056 |
T20958 |
T20935 |
punct |
",",performed |
R15057 |
T20959 |
T20960 |
nummod |
60,° |
R15058 |
T20960 |
T20961 |
compound |
°,C |
R15059 |
T20961 |
T20935 |
npadvmod |
C,performed |
R15060 |
T20962 |
T20935 |
prep |
for,performed |
R15061 |
T20963 |
T20962 |
pobj |
30,for |
R15062 |
T20964 |
T20935 |
dep |
s,performed |
R15063 |
T20965 |
T20935 |
punct |
",",performed |
R15064 |
T20966 |
T20935 |
cc |
and,performed |
R15065 |
T20967 |
T20969 |
nummod |
72,C |
R15066 |
T20968 |
T20969 |
compound |
°,C |
R15067 |
T20969 |
T20935 |
conj |
C,performed |
R15068 |
T20970 |
T20969 |
prep |
for,C |
R15069 |
T20971 |
T20970 |
pobj |
45,for |
R15070 |
T20972 |
T20969 |
appos |
s,C |
R15071 |
T20973 |
T20969 |
punct |
",",C |
R15072 |
T20974 |
T20935 |
advcl |
ending,performed |
R15073 |
T20975 |
T20974 |
prep |
with,ending |
R15074 |
T20976 |
T20978 |
det |
a,extension |
R15075 |
T20977 |
T20978 |
amod |
final,extension |
R15076 |
T20978 |
T20975 |
pobj |
extension,with |
R15077 |
T20979 |
T20978 |
prep |
at,extension |
R15078 |
T20980 |
T20981 |
nummod |
72,° |
R15079 |
T20981 |
T20979 |
pobj |
°,at |
R15080 |
T20982 |
T20978 |
npadvmod |
C,extension |
R15081 |
T20983 |
T20978 |
prep |
for,extension |
R15082 |
T20984 |
T20985 |
nummod |
5,min |
R15083 |
T20985 |
T20983 |
pobj |
min,for |
R15084 |
T20986 |
T20935 |
punct |
.,performed |
R1907 |
T2913 |
T2916 |
compound |
Sry,box |
R1909 |
T2914 |
T2916 |
compound |
type,box |
R1914 |
T2915 |
T2916 |
compound |
HMG,box |
R1918 |
T2916 |
T2920 |
nsubj |
box,is |
R1921 |
T2917 |
T2918 |
punct |
(,Sox6 |
R1922 |
T2918 |
T2916 |
appos |
Sox6,box |
R1923 |
T2919 |
T2916 |
punct |
),box |
R1924 |
T2920 |
T2920 |
ROOT |
is,is |
R1925 |
T2921 |
T2922 |
det |
a,member |
R1926 |
T2922 |
T2920 |
attr |
member,is |
R1927 |
T2926 |
T2927 |
compound |
transcription,factor |
R1928 |
T2923 |
T2922 |
prep |
of,member |
R1929 |
T2927 |
T2928 |
compound |
factor,family |
R1930 |
T2928 |
T2923 |
pobj |
family,of |
R1931 |
T2929 |
T2922 |
acl |
characterized,member |
R1932 |
T2924 |
T2928 |
det |
the,family |
R1933 |
T2930 |
T2929 |
agent |
by,characterized |
R1934 |
T2931 |
T2935 |
det |
the,group |
R1935 |
T2925 |
T2928 |
compound |
Sox,family |
R1936 |
T2932 |
T2935 |
amod |
conserved,group |
R1937 |
T2933 |
T2935 |
amod |
high,group |
R1938 |
T2934 |
T2935 |
compound |
mobility,group |
R1939 |
T3023 |
T3025 |
amod |
DNA-bound,factors |
R1940 |
T2935 |
T2930 |
pobj |
group,by |
R1941 |
T2936 |
T2937 |
punct |
(,HMG |
R1942 |
T2937 |
T2935 |
appos |
HMG,group |
R1943 |
T2938 |
T2937 |
punct |
),HMG |
R1944 |
T3024 |
T3025 |
compound |
transcription,factors |
R1945 |
T2939 |
T2935 |
conj |
domain,group |
R1946 |
T2940 |
T2935 |
punct |
",",group |
R1947 |
T2941 |
T2935 |
acl |
consisting,group |
R1948 |
T3025 |
T3021 |
dobj |
factors,assembling |
R1949 |
T2942 |
T2941 |
prep |
of,consisting |
R1950 |
T2943 |
T2945 |
nummod |
79,acids |
R1951 |
T3026 |
T3021 |
prep |
into,assembling |
R1952 |
T2944 |
T2945 |
compound |
amino,acids |
R1953 |
T2945 |
T2942 |
pobj |
acids,of |
R1954 |
T2946 |
T2945 |
acl |
involved,acids |
R1955 |
T3027 |
T3028 |
advmod |
biologically,active |
R1956 |
T2947 |
T2946 |
prep |
in,involved |
R1957 |
T2948 |
T2949 |
compound |
DNA,recognition |
R1958 |
T2949 |
T2947 |
pobj |
recognition,in |
R1959 |
T3028 |
T3033 |
amod |
active,complexes |
R1960 |
T2950 |
T2949 |
cc |
and,recognition |
R1961 |
T2951 |
T2952 |
amod |
binding,[ |
R1962 |
T2952 |
T2949 |
conj |
[,recognition |
R1963 |
T2953 |
T2954 |
nummod |
1,] |
R1964 |
T3029 |
T3033 |
punct |
",",complexes |
R1965 |
T2954 |
T2952 |
appos |
],[ |
R1966 |
T2955 |
T2920 |
punct |
.,is |
R1967 |
T3030 |
T3031 |
advmod |
sterically,defined |
R1968 |
T2956 |
T2959 |
nsubj |
Sox,bind |
R1969 |
T2957 |
T2958 |
compound |
transcription,factors |
R1970 |
T2958 |
T2959 |
nsubj |
factors,bind |
R1971 |
T3031 |
T3033 |
amod |
defined,complexes |
R1972 |
T2959 |
T2959 |
ROOT |
bind,bind |
R1973 |
T2960 |
T2959 |
prep |
to,bind |
R1974 |
T3032 |
T3033 |
compound |
multiprotein,complexes |
R1975 |
T2961 |
T2963 |
det |
the,groove |
R1976 |
T2962 |
T2963 |
amod |
minor,groove |
R1977 |
T3033 |
T3026 |
pobj |
complexes,into |
R1978 |
T2963 |
T2960 |
pobj |
groove,to |
R1979 |
T2964 |
T2963 |
prep |
of,groove |
R1980 |
T2965 |
T2964 |
pobj |
DNA,of |
R1981 |
T2966 |
T2959 |
cc |
and,bind |
R1982 |
T2967 |
T2959 |
conj |
cause,bind |
R1983 |
T2968 |
T2970 |
det |
a,° |
R1984 |
T3034 |
T3007 |
punct |
.,perform |
R1985 |
T2969 |
T2970 |
nummod |
70,° |
R1986 |
T2970 |
T2967 |
dobj |
°,cause |
R1987 |
T2971 |
T2973 |
nummod |
85,bend |
R1988 |
T3035 |
T3038 |
nsubjpass |
Sox6,reported |
R1989 |
T2972 |
T2973 |
compound |
°,bend |
R1990 |
T2973 |
T2970 |
appos |
bend,° |
R1991 |
T2974 |
T2973 |
prep |
of,bend |
R1992 |
T3036 |
T3038 |
aux |
has,reported |
R1993 |
T2975 |
T2976 |
det |
the,DNA |
R1994 |
T2976 |
T2974 |
pobj |
DNA,of |
R1995 |
T2977 |
T2978 |
nsubj |
that,leads |
R1996 |
T3037 |
T3038 |
auxpass |
been,reported |
R1997 |
T2978 |
T2976 |
relcl |
leads,DNA |
R1998 |
T2979 |
T2978 |
prep |
to,leads |
R1999 |
T2980 |
T2982 |
amod |
local,changes |
R2000 |
T2981 |
T2982 |
amod |
conformational,changes |
R2001 |
T3038 |
T3038 |
ROOT |
reported,reported |
R2002 |
T2982 |
T2979 |
pobj |
changes,to |
R2003 |
T2983 |
T2985 |
compound |
[,] |
R2004 |
T3039 |
T3040 |
aux |
to,be |
R2005 |
T2984 |
T2985 |
compound |
"2,3",] |
R2006 |
T2985 |
T2982 |
appos |
],changes |
R2007 |
T2986 |
T2973 |
punct |
",",bend |
R2008 |
T3040 |
T3038 |
xcomp |
be,reported |
R2009 |
T2987 |
T2992 |
mark |
while,target |
R2010 |
T2988 |
T2991 |
amod |
most,factors |
R2011 |
T2989 |
T2991 |
amod |
other,factors |
R2012 |
T3041 |
T3040 |
acomp |
able,be |
R2013 |
T2990 |
T2991 |
compound |
transcription,factors |
R2014 |
T2991 |
T2992 |
nsubj |
factors,target |
R2015 |
T2992 |
T2973 |
advcl |
target,bend |
R2016 |
T2993 |
T2995 |
det |
the,groove |
R2017 |
T2994 |
T2995 |
amod |
major,groove |
R2018 |
T2995 |
T2992 |
dobj |
groove,target |
R2019 |
T2996 |
T2995 |
prep |
of,groove |
R2020 |
T2997 |
T3000 |
compound |
DNA,] |
R2021 |
T3042 |
T3043 |
aux |
to,act |
R2022 |
T2998 |
T3000 |
nmod |
[,] |
R2023 |
T2999 |
T3000 |
nummod |
4,] |
R2024 |
T3000 |
T2996 |
pobj |
],of |
R2025 |
T3043 |
T3041 |
xcomp |
act,able |
R2026 |
T3001 |
T2959 |
punct |
.,bind |
R2027 |
T3002 |
T3007 |
advmod |
Therefore,perform |
R2028 |
T3044 |
T3043 |
prep |
as,act |
R2029 |
T3003 |
T3007 |
punct |
",",perform |
R2030 |
T3004 |
T3005 |
compound |
Sox,proteins |
R2031 |
T3005 |
T3007 |
nsubj |
proteins,perform |
R2032 |
T3045 |
T3047 |
preconj |
either,activator |
R2033 |
T3006 |
T3007 |
aux |
may,perform |
R2034 |
T3007 |
T3007 |
ROOT |
perform,perform |
R2035 |
T3008 |
T3007 |
dobj |
part,perform |
R2036 |
T3046 |
T3047 |
det |
an,activator |
R2037 |
T3009 |
T3008 |
prep |
of,part |
R2038 |
T3010 |
T3011 |
poss |
their,function |
R2039 |
T3047 |
T3044 |
pobj |
activator,as |
R2040 |
T3011 |
T3009 |
pobj |
function,of |
R2041 |
T3012 |
T3007 |
prep |
as,perform |
R2042 |
T3013 |
T3014 |
amod |
architectural,proteins |
R2043 |
T3048 |
T3047 |
cc |
or,activator |
R2044 |
T3014 |
T3012 |
pobj |
proteins,as |
R2045 |
T3015 |
T3007 |
prep |
by,perform |
R2046 |
T3016 |
T3015 |
pcomp |
organizing,by |
R2047 |
T3049 |
T3050 |
det |
a,repressor |
R2048 |
T3017 |
T3019 |
amod |
local,structure |
R2049 |
T3018 |
T3019 |
compound |
chromatin,structure |
R2050 |
T3050 |
T3047 |
conj |
repressor,activator |
R2051 |
T3019 |
T3016 |
dobj |
structure,organizing |
R2052 |
T3020 |
T3016 |
cc |
and,organizing |
R2053 |
T3021 |
T3016 |
conj |
assembling,organizing |
R2054 |
T3051 |
T3050 |
punct |
",",repressor |
R2055 |
T3022 |
T3025 |
amod |
other,factors |
R2056 |
T3052 |
T3043 |
prep |
depending,act |
R2057 |
T3053 |
T3052 |
prep |
on,depending |
R2058 |
T3054 |
T3055 |
poss |
its,interactors |
R2059 |
T3055 |
T3053 |
pobj |
interactors,on |
R2060 |
T3056 |
T3055 |
cc |
and,interactors |
R2061 |
T3120 |
T3118 |
punct |
",",restored |
R2062 |
T3057 |
T3060 |
poss |
its,context |
R2063 |
T3121 |
T3118 |
advcl |
indicating,restored |
R2064 |
T3122 |
T3123 |
amod |
functional,overlap |
R2065 |
T3123 |
T3121 |
dobj |
overlap,indicating |
R2066 |
T3124 |
T3123 |
prep |
of,overlap |
R2067 |
T3125 |
T3126 |
det |
these,proteins |
R2068 |
T3058 |
T3059 |
compound |
target,promoter |
R2069 |
T3126 |
T3124 |
pobj |
proteins,of |
R2070 |
T3127 |
T3123 |
conj |
[,overlap |
R2071 |
T3128 |
T3129 |
nummod |
7,] |
R2072 |
T3059 |
T3060 |
compound |
promoter,context |
R2073 |
T3129 |
T3127 |
dobj |
],[ |
R2074 |
T3130 |
T3118 |
punct |
.,restored |
R2075 |
T3131 |
T3131 |
ROOT |
Regardless,Regardless |
R2076 |
T3060 |
T3052 |
conj |
context,depending |
R2077 |
T3132 |
T3131 |
prep |
of,Regardless |
R2078 |
T3133 |
T3144 |
advmod |
how,demonstrated |
R2079 |
T3134 |
T3135 |
amod |
Sox6,functions |
R2080 |
T3061 |
T3063 |
compound |
[,] |
R2081 |
T3135 |
T3144 |
nsubj |
functions,demonstrated |
R2082 |
T3136 |
T3135 |
prep |
in,functions |
R2083 |
T3062 |
T3063 |
compound |
"5,6",] |
R2084 |
T3137 |
T3136 |
pcomp |
regulating,in |
R2085 |
T3138 |
T3139 |
compound |
gene,expression |
R2086 |
T3063 |
T3060 |
appos |
],context |
R2087 |
T3139 |
T3137 |
dobj |
expression,regulating |
R2088 |
T3140 |
T3144 |
punct |
",",demonstrated |
R2089 |
T3141 |
T3142 |
amod |
previous,studies |
R2090 |
T3064 |
T3038 |
punct |
.,reported |
R2091 |
T3142 |
T3144 |
nsubj |
studies,demonstrated |
R2092 |
T3143 |
T3144 |
aux |
have,demonstrated |
R2093 |
T3144 |
T3132 |
pcomp |
demonstrated,of |
R2094 |
T3065 |
T3071 |
advmod |
Intriguingly,shown |
R2095 |
T3145 |
T3147 |
mark |
that,is |
R2096 |
T3146 |
T3147 |
nsubj |
Sox6,is |
R2097 |
T3147 |
T3144 |
ccomp |
is,demonstrated |
R2098 |
T3066 |
T3071 |
punct |
",",shown |
R2099 |
T3148 |
T3151 |
det |
an,molecule |
R2100 |
T3149 |
T3151 |
amod |
important,molecule |
R2101 |
T3150 |
T3151 |
amod |
regulatory,molecule |
R2102 |
T3067 |
T3071 |
nsubj |
Sox6,shown |
R2103 |
T3151 |
T3147 |
attr |
molecule,is |
R2104 |
T3152 |
T3153 |
nsubj |
that,plays |
R2105 |
T3068 |
T3071 |
aux |
has,shown |
R2106 |
T3153 |
T3151 |
relcl |
plays,molecule |
R2107 |
T3154 |
T3155 |
det |
a,role |
R2108 |
T3155 |
T3153 |
dobj |
role,plays |
R2109 |
T3156 |
T3155 |
prep |
in,role |
R2110 |
T3069 |
T3071 |
advmod |
also,shown |
R2111 |
T3157 |
T3158 |
det |
the,development |
R2112 |
T3158 |
T3156 |
pobj |
development,in |
R2113 |
T3159 |
T3158 |
prep |
of,development |
R2114 |
T3160 |
T3163 |
det |
the,system |
R2115 |
T3161 |
T3163 |
amod |
central,system |
R2116 |
T3162 |
T3163 |
amod |
nervous,system |
R2117 |
T3070 |
T3071 |
auxpass |
been,shown |
R2118 |
T3163 |
T3159 |
pobj |
system,of |
R2119 |
T3164 |
T3172 |
nmod |
[,] |
R2120 |
T3165 |
T3164 |
nummod |
8,[ |
R2121 |
T3071 |
T3071 |
ROOT |
shown,shown |
R2122 |
T3166 |
T3167 |
nummod |
11,] |
R2123 |
T3167 |
T3164 |
appos |
],[ |
R2124 |
T3168 |
T3169 |
punct |
",",cartilage |
R2125 |
T3169 |
T3164 |
conj |
cartilage,[ |
R2126 |
T3072 |
T3073 |
aux |
to,act |
R2127 |
T3170 |
T3172 |
compound |
[,] |
R2128 |
T3171 |
T3172 |
compound |
"6,12,13",] |
R2129 |
T3172 |
T3153 |
npadvmod |
],plays |
R2130 |
T3073 |
T3071 |
xcomp |
act,shown |
R2131 |
T3173 |
T3172 |
punct |
",",] |
R2132 |
T3174 |
T3172 |
cc |
and,] |
R2133 |
T3074 |
T3073 |
prep |
as,act |
R2134 |
T3175 |
T3178 |
compound |
muscle,] |
R2135 |
T3176 |
T3178 |
compound |
[,] |
R2136 |
T3075 |
T3078 |
det |
a,factor |
R2137 |
T3177 |
T3178 |
compound |
"14,15",] |
R2138 |
T3178 |
T3172 |
conj |
],] |
R2139 |
T3179 |
T3131 |
punct |
.,Regardless |
R2140 |
T3076 |
T3078 |
amod |
general,factor |
R2141 |
T3180 |
T3183 |
det |
A,mouse |
R2142 |
T3181 |
T3183 |
amod |
Sox6-null,mouse |
R2143 |
T3182 |
T3183 |
amod |
mutant,mouse |
R2144 |
T3077 |
T3078 |
compound |
splicing,factor |
R2145 |
T3183 |
T3190 |
nsubjpass |
mouse,identified |
R2146 |
T3184 |
T3185 |
punct |
(,p100H |
R2147 |
T3185 |
T3183 |
appos |
p100H,mouse |
R2148 |
T3078 |
T3074 |
pobj |
factor,as |
R2149 |
T3186 |
T3185 |
punct |
),p100H |
R2150 |
T3187 |
T3190 |
aux |
has,identified |
R2151 |
T3188 |
T3190 |
advmod |
previously,identified |
R2152 |
T3079 |
T3080 |
nsubj |
that,participates |
R2153 |
T3080 |
T3078 |
relcl |
participates,factor |
R2154 |
T3189 |
T3190 |
auxpass |
been,identified |
R2155 |
T3190 |
T3190 |
ROOT |
identified,identified |
R2156 |
T3191 |
T3190 |
prep |
in,identified |
R2157 |
T3081 |
T3080 |
prep |
in,participates |
R2158 |
T3192 |
T3193 |
poss |
our,laboratory |
R2159 |
T3193 |
T3191 |
pobj |
laboratory,in |
R2160 |
T3082 |
T3084 |
amod |
pre-mRNA,[ |
R2161 |
T3194 |
T3196 |
nmod |
[,] |
R2162 |
T3195 |
T3196 |
nummod |
14,] |
R2163 |
T3196 |
T3190 |
dobj |
],identified |
R2164 |
T3197 |
T3190 |
punct |
.,identified |
R2165 |
T3198 |
T3199 |
compound |
Mice,homozygous |
R2166 |
T3199 |
T3206 |
nsubj |
homozygous,develop |
R2167 |
T3083 |
T3084 |
compound |
splicing,[ |
R2168 |
T3200 |
T3199 |
prep |
for,homozygous |
R2169 |
T3201 |
T3202 |
amod |
p100H,show |
R2170 |
T3202 |
T3200 |
pobj |
show,for |
R2171 |
T3084 |
T3086 |
nmod |
[,] |
R2172 |
T3203 |
T3204 |
amod |
delayed,growth |
R2173 |
T3204 |
T3202 |
dobj |
growth,show |
R2174 |
T3085 |
T3086 |
nummod |
7,] |
R2175 |
T3205 |
T3202 |
punct |
",",show |
R2176 |
T3206 |
T3206 |
ROOT |
develop,develop |
R2177 |
T3207 |
T3211 |
nmod |
myopathy,block |
R2178 |
T3086 |
T3081 |
pobj |
],in |
R2179 |
T3208 |
T3207 |
cc |
and,myopathy |
R2180 |
T3209 |
T3207 |
conj |
arterioventricular,myopathy |
R2181 |
T3210 |
T3211 |
compound |
heart,block |
R2182 |
T3211 |
T3206 |
dobj |
block,develop |
R2183 |
T3087 |
T3071 |
punct |
.,shown |
R2184 |
T3212 |
T3206 |
punct |
",",develop |
R2185 |
T3213 |
T3206 |
cc |
and,develop |
R2186 |
T3214 |
T3206 |
conj |
die,develop |
R2187 |
T3088 |
T3095 |
nsubj |
Depletion,blocked |
R2188 |
T3215 |
T3214 |
prep |
within,die |
R2189 |
T3216 |
T3217 |
nummod |
2,wk |
R2190 |
T3089 |
T3088 |
prep |
of,Depletion |
R2191 |
T3090 |
T3089 |
pobj |
Sox6,of |
R2192 |
T3091 |
T3090 |
prep |
in,Sox6 |
R2193 |
T3217 |
T3215 |
pobj |
wk,within |
R2194 |
T3218 |
T3214 |
prep |
after,die |
R2195 |
T3219 |
T3218 |
pobj |
birth,after |
R2196 |
T3092 |
T3093 |
compound |
HeLa,cell |
R2197 |
T3220 |
T3222 |
nmod |
[,] |
R2198 |
T3221 |
T3222 |
nummod |
14,] |
R2199 |
T3093 |
T3094 |
compound |
cell,extracts |
R2200 |
T3222 |
T3214 |
conj |
],die |
R2201 |
T3223 |
T3206 |
punct |
.,develop |
R2202 |
T3224 |
T3227 |
det |
The,allele |
R2203 |
T3094 |
T3095 |
nsubj |
extracts,blocked |
R2204 |
T3225 |
T3227 |
amod |
p100H,allele |
R2205 |
T3226 |
T3227 |
amod |
mutant,allele |
R2206 |
T3227 |
T3229 |
nsubjpass |
allele,associated |
R2207 |
T3095 |
T3095 |
ROOT |
blocked,blocked |
R2208 |
T3228 |
T3229 |
auxpass |
is,associated |
R2209 |
T3229 |
T3229 |
ROOT |
associated,associated |
R2210 |
T3096 |
T3095 |
dobj |
splicing,blocked |
R2211 |
T3230 |
T3229 |
prep |
with,associated |
R2212 |
T3231 |
T3234 |
det |
a,inversion |
R2213 |
T3232 |
T3234 |
nmod |
Chromosome,inversion |
R2214 |
T3233 |
T3232 |
nummod |
7,Chromosome |
R2215 |
T3234 |
T3230 |
pobj |
inversion,with |
R2216 |
T3235 |
T3236 |
nsubj |
that,disrupts |
R2217 |
T3097 |
T3096 |
prep |
of,splicing |
R2218 |
T3236 |
T3234 |
relcl |
disrupts,inversion |
R2219 |
T3237 |
T3240 |
preconj |
both,gene |
R2220 |
T3238 |
T3240 |
det |
the,gene |
R2221 |
T3098 |
T3099 |
amod |
multiple,substrates |
R2222 |
T3239 |
T3240 |
compound |
p,gene |
R2223 |
T3240 |
T3236 |
dobj |
gene,disrupts |
R2224 |
T3241 |
T3240 |
cc |
and,gene |
R2225 |
T3099 |
T3097 |
pobj |
substrates,of |
R2226 |
T3242 |
T3244 |
det |
the,gene |
R2227 |
T3243 |
T3244 |
compound |
Sox6,gene |
R2228 |
T3244 |
T3240 |
conj |
gene,gene |
R2229 |
T3100 |
T3095 |
punct |
",",blocked |
R2230 |
T3245 |
T3244 |
punct |
(,gene |
R2231 |
T3246 |
T3244 |
cc |
and,gene |
R2232 |
T3247 |
T3249 |
det |
no,gene |
R2233 |
T3101 |
T3095 |
cc |
and,blocked |
R2234 |
T3248 |
T3249 |
amod |
other,gene |
R2235 |
T3249 |
T3244 |
conj |
gene,gene |
R2236 |
T3250 |
T3249 |
prep |
within,gene |
R2237 |
T3102 |
T3095 |
conj |
expression,blocked |
R2238 |
T3251 |
T3252 |
nummod |
"50,000",nucleotides |
R2239 |
T3252 |
T3250 |
pobj |
nucleotides,within |
R2240 |
T3103 |
T3102 |
prep |
of,expression |
R2241 |
T3253 |
T3252 |
prep |
of,nucleotides |
R2242 |
T3254 |
T3256 |
det |
the,breakpoints |
R2243 |
T3255 |
T3256 |
amod |
chromosomal,breakpoints |
R2244 |
T3104 |
T3106 |
det |
the,domain |
R2245 |
T3256 |
T3253 |
pobj |
breakpoints,of |
R2246 |
T3257 |
T3229 |
punct |
),associated |
R2247 |
T3105 |
T3106 |
compound |
HMG,domain |
R2248 |
T3258 |
T3260 |
nmod |
[,] |
R2249 |
T3259 |
T3260 |
nummod |
14,] |
R2250 |
T3260 |
T3260 |
ROOT |
],] |
R2251 |
T3261 |
T3260 |
punct |
.,] |
R2252 |
T3106 |
T3103 |
pobj |
domain,of |
R2253 |
T3262 |
T3279 |
mark |
Because,implicated |
R2254 |
T3263 |
T3266 |
det |
the,functions |
R2255 |
T3107 |
T3106 |
prep |
of,domain |
R2256 |
T3264 |
T3265 |
compound |
p,gene |
R2257 |
T3265 |
T3266 |
compound |
gene,functions |
R2258 |
T3266 |
T3279 |
advcl |
functions,implicated |
R2259 |
T3108 |
T3118 |
preconj |
either,restored |
R2260 |
T3267 |
T3268 |
advmod |
solely,in |
R2261 |
T3268 |
T3266 |
prep |
in,functions |
R2262 |
T3109 |
T3118 |
nsubj |
Sox6,restored |
R2263 |
T3269 |
T3268 |
pobj |
pigmentation,in |
R2264 |
T3110 |
T3109 |
punct |
",",Sox6 |
R2265 |
T3270 |
T3272 |
nmod |
[,] |
R2266 |
T3271 |
T3272 |
nummod |
16,] |
R2267 |
T3272 |
T3266 |
appos |
],functions |
R2268 |
T3273 |
T3279 |
punct |
",",implicated |
R2269 |
T3274 |
T3277 |
det |
the,factor |
R2270 |
T3111 |
T3109 |
conj |
Sox9,Sox6 |
R2271 |
T3275 |
T3277 |
compound |
Sox6,factor |
R2272 |
T3276 |
T3277 |
compound |
transcription,factor |
R2273 |
T3112 |
T3111 |
punct |
",",Sox9 |
R2274 |
T3277 |
T3279 |
nsubjpass |
factor,implicated |
R2275 |
T3278 |
T3279 |
auxpass |
is,implicated |
R2276 |
T3279 |
T3279 |
ROOT |
implicated,implicated |
R2277 |
T3280 |
T3279 |
prep |
in,implicated |
R2278 |
T3113 |
T3111 |
cc |
or,Sox9 |
R2279 |
T3281 |
T3283 |
det |
all,phenotypes |
R2280 |
T3282 |
T3283 |
amod |
other,phenotypes |
R2281 |
T3283 |
T3280 |
pobj |
phenotypes,in |
R2282 |
T3114 |
T3111 |
conj |
Sry,Sox9 |
R2283 |
T3284 |
T3279 |
punct |
.,implicated |
R2284 |
T3285 |
T3322 |
prep |
Among,are |
R2285 |
T3286 |
T3289 |
det |
the,proteins |
R2286 |
T3115 |
T3109 |
prep |
in,Sox6 |
R2287 |
T3287 |
T3289 |
compound |
HMG,proteins |
R2288 |
T3288 |
T3289 |
compound |
box,proteins |
R2289 |
T3289 |
T3285 |
pobj |
proteins,Among |
R2290 |
T3116 |
T3117 |
det |
the,extracts |
R2291 |
T3290 |
T3291 |
advmod |
distantly,related |
R2292 |
T3291 |
T3289 |
acl |
related,proteins |
R2293 |
T3292 |
T3291 |
prep |
to,related |
R2294 |
T3117 |
T3115 |
pobj |
extracts,in |
R2295 |
T3293 |
T3292 |
pobj |
Sry,to |
R2296 |
T3294 |
T3293 |
punct |
(,Sry |
R2297 |
T3295 |
T3297 |
det |
the,member |
R2298 |
T3118 |
T3095 |
conj |
restored,blocked |
R2299 |
T3296 |
T3297 |
amod |
first,member |
R2300 |
T3297 |
T3293 |
appos |
member,Sry |
R2301 |
T3298 |
T3297 |
acl |
identified,member |
R2302 |
T3119 |
T3118 |
dobj |
splicing,restored |
R2303 |
T3299 |
T3298 |
prep |
of,identified |
R2304 |
T3300 |
T3304 |
det |
the,family |
R2305 |
T3314 |
T3308 |
conj |
bend,bind |
R2306 |
T3301 |
T3303 |
compound |
Sox,factor |
R2307 |
T3302 |
T3303 |
compound |
transcription,factor |
R2308 |
T3303 |
T3304 |
compound |
factor,family |
R2309 |
T3304 |
T3299 |
pobj |
family,of |
R2310 |
T3315 |
T3314 |
dobj |
DNA,bend |
R2311 |
T3305 |
T3293 |
punct |
),Sry |
R2312 |
T3306 |
T3308 |
nsubj |
that,bind |
R2313 |
T3307 |
T3308 |
advmod |
similarly,bind |
R2314 |
T3316 |
T3314 |
punct |
",",bend |
R2315 |
T3308 |
T3289 |
relcl |
bind,proteins |
R2316 |
T3309 |
T3308 |
prep |
to,bind |
R2317 |
T3310 |
T3312 |
det |
the,groove |
R2318 |
T3311 |
T3312 |
amod |
minor,groove |
R2319 |
T3312 |
T3309 |
pobj |
groove,to |
R2320 |
T3313 |
T3308 |
cc |
and,bind |
R2321 |
T3317 |
T3314 |
cc |
but,bend |
R2322 |
T3318 |
T3308 |
prep |
without,bind |
R2323 |
T3319 |
T3320 |
compound |
sequence,specificity |
R2324 |
T3411 |
T3401 |
cc |
and,are |
R2325 |
T3320 |
T3318 |
pobj |
specificity,without |
R2326 |
T3412 |
T3401 |
conj |
function,are |
R2327 |
T3413 |
T3415 |
nmod |
[,] |
R2328 |
T3321 |
T3322 |
punct |
",",are |
R2329 |
T3414 |
T3415 |
nummod |
22,] |
R2330 |
T3415 |
T3412 |
dobj |
],function |
R2331 |
T3416 |
T3401 |
punct |
.,are |
R2332 |
T3322 |
T3322 |
ROOT |
are,are |
R2333 |
T3417 |
T3418 |
amod |
High-level,expression |
R2334 |
T3418 |
T3422 |
nsubj |
expression,requires |
R2335 |
T3419 |
T3418 |
prep |
of,expression |
R2336 |
T3323 |
T3329 |
det |
the,proteins |
R2337 |
T3420 |
T3421 |
det |
these,genes |
R2338 |
T3421 |
T3419 |
pobj |
genes,of |
R2339 |
T3422 |
T3422 |
ROOT |
requires,requires |
R2340 |
T3324 |
T3325 |
nsubj |
ubiquitously,expressed |
R2341 |
T3423 |
T3425 |
det |
a,element |
R2342 |
T3424 |
T3425 |
amod |
regulatory,element |
R2343 |
T3325 |
T3329 |
amod |
expressed,proteins |
R2344 |
T3425 |
T3422 |
dobj |
element,requires |
R2345 |
T3426 |
T3425 |
punct |
",",element |
R2346 |
T3326 |
T3329 |
nmod |
HMG1,proteins |
R2347 |
T3427 |
T3430 |
det |
the,region |
R2348 |
T3428 |
T3429 |
compound |
locus,control |
R2349 |
T3327 |
T3326 |
cc |
and,HMG1 |
R2350 |
T3429 |
T3430 |
compound |
control,region |
R2351 |
T3430 |
T3425 |
appos |
region,element |
R2352 |
T3328 |
T3326 |
conj |
HMG2,HMG1 |
R2353 |
T3431 |
T3433 |
nsubjpass |
that,characterized |
R2354 |
T3432 |
T3433 |
auxpass |
is,characterized |
R2355 |
T3433 |
T3430 |
relcl |
characterized,region |
R2356 |
T3329 |
T3322 |
attr |
proteins,are |
R2357 |
T3330 |
T3332 |
nmod |
[,] |
R2358 |
T3434 |
T3433 |
agent |
by,characterized |
R2359 |
T3331 |
T3332 |
nummod |
17,] |
R2360 |
T3435 |
T3436 |
det |
a,set |
R2361 |
T3436 |
T3434 |
pobj |
set,by |
R2362 |
T3332 |
T3329 |
appos |
],proteins |
R2363 |
T3437 |
T3436 |
prep |
of,set |
R2364 |
T3438 |
T3440 |
amod |
nuclease,sites |
R2365 |
T3439 |
T3440 |
amod |
hypersensitive,sites |
R2366 |
T3440 |
T3437 |
pobj |
sites,of |
R2367 |
T3441 |
T3436 |
acl |
spread,set |
R2368 |
T3442 |
T3441 |
prep |
over,spread |
R2369 |
T3333 |
T3322 |
punct |
.,are |
R2370 |
T3443 |
T3444 |
nummod |
25,kb |
R2371 |
T3444 |
T3445 |
npadvmod |
kb,located |
R2372 |
T3445 |
T3436 |
acl |
located,set |
R2373 |
T3334 |
T3345 |
nsubj |
Modulation,mediate |
R2374 |
T3446 |
T3447 |
nummod |
5,′ |
R2375 |
T3447 |
T3445 |
dobj |
′,located |
R2376 |
T3448 |
T3447 |
prep |
of,′ |
R2377 |
T3335 |
T3334 |
prep |
of,Modulation |
R2378 |
T3449 |
T3451 |
det |
the,gene |
R2379 |
T3450 |
T3451 |
amod |
ɛy,gene |
R2380 |
T3451 |
T3448 |
pobj |
gene,of |
R2381 |
T3336 |
T3337 |
compound |
DNA,structure |
R2382 |
T3452 |
T3447 |
conj |
[,′ |
R2383 |
T3453 |
T3454 |
nummod |
23,] |
R2384 |
T3454 |
T3447 |
conj |
],′ |
R2385 |
T3337 |
T3335 |
pobj |
structure,of |
R2386 |
T3455 |
T3422 |
punct |
.,requires |
R2387 |
T3456 |
T3458 |
det |
The,genes |
R2388 |
T3457 |
T3458 |
amod |
β-globin,genes |
R2389 |
T3338 |
T3334 |
agent |
by,Modulation |
R2390 |
T3458 |
T3460 |
nsubjpass |
genes,expressed |
R2391 |
T3459 |
T3460 |
auxpass |
are,expressed |
R2392 |
T3460 |
T3460 |
ROOT |
expressed,expressed |
R2393 |
T3339 |
T3343 |
det |
these,proteins |
R2394 |
T3461 |
T3460 |
prep |
in,expressed |
R2395 |
T3462 |
T3463 |
det |
a,tissue |
R2396 |
T3463 |
T3461 |
pobj |
tissue,in |
R2397 |
T3340 |
T3339 |
cc |
and,these |
R2398 |
T3464 |
T3460 |
punct |
-,expressed |
R2399 |
T3465 |
T3460 |
cc |
and,expressed |
R2400 |
T3466 |
T3467 |
amod |
development-specific,fashion |
R2401 |
T3341 |
T3343 |
amod |
other,proteins |
R2402 |
T3467 |
T3460 |
conj |
fashion,expressed |
R2403 |
T3468 |
T3460 |
punct |
.,expressed |
R2404 |
T3469 |
T3473 |
prep |
In,originates |
R2405 |
T3342 |
T3343 |
compound |
HMG,proteins |
R2406 |
T3470 |
T3469 |
pobj |
mice,In |
R2407 |
T3471 |
T3472 |
punct |
",",erythropoiesis |
R2408 |
T3472 |
T3473 |
nsubj |
erythropoiesis,originates |
R2409 |
T3343 |
T3338 |
pobj |
proteins,by |
R2410 |
T3473 |
T3473 |
ROOT |
originates,originates |
R2411 |
T3474 |
T3473 |
prep |
in,originates |
R2412 |
T3344 |
T3345 |
aux |
can,mediate |
R2413 |
T3475 |
T3478 |
det |
the,sac |
R2414 |
T3476 |
T3477 |
amod |
embryonic,yolk |
R2415 |
T3477 |
T3478 |
compound |
yolk,sac |
R2416 |
T3478 |
T3474 |
pobj |
sac,in |
R2417 |
T3479 |
T3483 |
advmod |
where,express |
R2418 |
T3480 |
T3482 |
amod |
primitive,cells |
R2419 |
T3345 |
T3345 |
ROOT |
mediate,mediate |
R2420 |
T3481 |
T3482 |
amod |
erythroid,cells |
R2421 |
T3482 |
T3483 |
nsubj |
cells,express |
R2422 |
T3483 |
T3478 |
relcl |
express,sac |
R2423 |
T3346 |
T3348 |
amod |
long-range,function |
R2424 |
T3484 |
T3483 |
dobj |
ɛy,express |
R2425 |
T3485 |
T3484 |
cc |
and,ɛy |
R2426 |
T3486 |
T3487 |
amod |
βh-1,globins |
R2427 |
T3487 |
T3484 |
conj |
globins,ɛy |
R2428 |
T3347 |
T3348 |
compound |
enhancer,function |
R2429 |
T3488 |
T3490 |
nmod |
[,] |
R2430 |
T3489 |
T3490 |
nummod |
22,] |
R2431 |
T3490 |
T3490 |
ROOT |
],] |
R2432 |
T3348 |
T3345 |
dobj |
function,mediate |
R2433 |
T3491 |
T3490 |
punct |
.,] |
R2434 |
T3492 |
T3523 |
prep |
At,] |
R2435 |
T3493 |
T3502 |
nummod |
11.5,shifts |
R2436 |
T3349 |
T3348 |
prep |
on,function |
R2437 |
T3494 |
T3502 |
nmod |
d,shifts |
R2438 |
T3495 |
T3496 |
compound |
post,coitus |
R2439 |
T3350 |
T3351 |
det |
both,DNA |
R2440 |
T3496 |
T3502 |
dep |
coitus,shifts |
R2441 |
T3497 |
T3498 |
punct |
(,dpc |
R2442 |
T3498 |
T3496 |
parataxis |
dpc,coitus |
R2443 |
T3351 |
T3349 |
pobj |
DNA,on |
R2444 |
T3499 |
T3498 |
punct |
),dpc |
R2445 |
T3500 |
T3501 |
punct |
",",erythropoiesis |
R2446 |
T3501 |
T3502 |
compound |
erythropoiesis,shifts |
R2447 |
T3352 |
T3351 |
cc |
and,DNA |
R2448 |
T3502 |
T3492 |
pobj |
shifts,At |
R2449 |
T3503 |
T3502 |
prep |
to,shifts |
R2450 |
T3353 |
T3354 |
amod |
chromatin-assembled,genes |
R2451 |
T3504 |
T3506 |
det |
the,liver |
R2452 |
T3505 |
T3506 |
amod |
fetal,liver |
R2453 |
T3354 |
T3351 |
conj |
genes,DNA |
R2454 |
T3506 |
T3503 |
pobj |
liver,to |
R2455 |
T3355 |
T3345 |
prep |
by,mediate |
R2456 |
T3507 |
T3511 |
advmod |
where,express |
R2457 |
T3356 |
T3355 |
pcomp |
bringing,by |
R2458 |
T3357 |
T3356 |
advmod |
together,bringing |
R2459 |
T3508 |
T3510 |
amod |
definitive,cells |
R2460 |
T3358 |
T3359 |
amod |
distant,regions |
R2461 |
T3509 |
T3510 |
amod |
erythroid,cells |
R2462 |
T3510 |
T3511 |
nsubj |
cells,express |
R2463 |
T3359 |
T3356 |
dobj |
regions,bringing |
R2464 |
T3511 |
T3506 |
relcl |
express,liver |
R2465 |
T3512 |
T3514 |
compound |
adult,globins |
R2466 |
T3513 |
T3514 |
compound |
β,globins |
R2467 |
T3514 |
T3511 |
dobj |
globins,express |
R2468 |
T3515 |
T3514 |
punct |
(,globins |
R2469 |
T3360 |
T3359 |
prep |
of,regions |
R2470 |
T3516 |
T3517 |
advmod |
β,major |
R2471 |
T3517 |
T3514 |
amod |
major,globins |
R2472 |
T3518 |
T3517 |
cc |
and,major |
R2473 |
T3361 |
T3360 |
pobj |
DNA,of |
R2474 |
T3519 |
T3517 |
conj |
minor,major |
R2475 |
T3520 |
T3492 |
punct |
),At |
R2476 |
T3521 |
T3523 |
nmod |
[,] |
R2477 |
T3362 |
T3356 |
cc |
and,bringing |
R2478 |
T3522 |
T3523 |
nummod |
22,] |
R2479 |
T3523 |
T3523 |
ROOT |
],] |
R2480 |
T3363 |
T3364 |
amod |
associated,factors |
R2481 |
T3524 |
T3523 |
punct |
.,] |
R2482 |
T3525 |
T3527 |
det |
The,gene |
R2483 |
T3526 |
T3527 |
amod |
ɛy,gene |
R2484 |
T3364 |
T3356 |
dobj |
factors,bringing |
R2485 |
T3527 |
T3529 |
nsubjpass |
gene,silenced |
R2486 |
T3528 |
T3529 |
auxpass |
is,silenced |
R2487 |
T3365 |
T3345 |
punct |
.,mediate |
R2488 |
T3529 |
T3529 |
ROOT |
silenced,silenced |
R2489 |
T3530 |
T3529 |
prep |
in,silenced |
R2490 |
T3531 |
T3533 |
amod |
definitive,cells |
R2491 |
T3366 |
T3372 |
advmod |
Specifically,shown |
R2492 |
T3532 |
T3533 |
amod |
erythroid,cells |
R2493 |
T3533 |
T3530 |
pobj |
cells,in |
R2494 |
T3367 |
T3372 |
punct |
",",shown |
R2495 |
T3534 |
T3529 |
punct |
.,silenced |
R2496 |
T3535 |
T3536 |
det |
The,mechanism |
R2497 |
T3536 |
T3549 |
nsubj |
mechanism,studied |
R2498 |
T3368 |
T3369 |
compound |
HMG,proteins |
R2499 |
T3537 |
T3536 |
prep |
of,mechanism |
R2500 |
T3538 |
T3537 |
pcomp |
silencing,of |
R2501 |
T3539 |
T3538 |
prep |
of,silencing |
R2502 |
T3369 |
T3372 |
nsubjpass |
proteins,shown |
R2503 |
T3540 |
T3542 |
poss |
its,counterpart |
R2504 |
T3541 |
T3542 |
amod |
human,counterpart |
R2505 |
T3542 |
T3539 |
pobj |
counterpart,of |
R2506 |
T3370 |
T3372 |
aux |
have,shown |
R2507 |
T3543 |
T3542 |
punct |
",",counterpart |
R2508 |
T3544 |
T3545 |
compound |
ɛ,globin |
R2509 |
T3545 |
T3542 |
appos |
globin,counterpart |
R2510 |
T3371 |
T3372 |
auxpass |
been,shown |
R2511 |
T3546 |
T3549 |
punct |
",",studied |
R2512 |
T3547 |
T3549 |
aux |
has,studied |
R2513 |
T3372 |
T3372 |
ROOT |
shown,shown |
R2514 |
T3548 |
T3549 |
auxpass |
been,studied |
R2515 |
T3549 |
T3549 |
ROOT |
studied,studied |
R2516 |
T3550 |
T3549 |
advmod |
extensively,studied |
R2517 |
T3551 |
T3549 |
punct |
.,studied |
R2518 |
T3552 |
T3558 |
prep |
In,activated |
R2519 |
T3553 |
T3554 |
amod |
definitive,erythropoiesis |
R2520 |
T3554 |
T3552 |
pobj |
erythropoiesis,In |
R2521 |
T3373 |
T3374 |
aux |
to,modulate |
R2522 |
T3555 |
T3558 |
punct |
",",activated |
R2523 |
T3556 |
T3558 |
nsubjpass |
ɛ,activated |
R2524 |
T3374 |
T3372 |
xcomp |
modulate,shown |
R2525 |
T3557 |
T3558 |
auxpass |
is,activated |
R2526 |
T3558 |
T3558 |
ROOT |
activated,activated |
R2527 |
T3559 |
T3558 |
cc |
and,activated |
R2528 |
T3375 |
T3376 |
amod |
β-globin,genes |
R2529 |
T3560 |
T3558 |
conj |
silenced,activated |
R2530 |
T3561 |
T3564 |
advmod |
autonomously,] |
R2531 |
T3562 |
T3564 |
compound |
[,] |
R2532 |
T3376 |
T3374 |
dobj |
genes,modulate |
R2533 |
T3563 |
T3564 |
compound |
"24,25",] |
R2534 |
T3564 |
T3560 |
dobj |
],silenced |
R2535 |
T3377 |
T3374 |
npadvmod |
[,modulate |
R2536 |
T3565 |
T3560 |
punct |
",",silenced |
R2537 |
T3566 |
T3572 |
mark |
although,appears |
R2538 |
T3567 |
T3572 |
prep |
in,appears |
R2539 |
T3378 |
T3377 |
nummod |
18,[ |
R2540 |
T3568 |
T3570 |
amod |
primitive,ɛ |
R2541 |
T3569 |
T3570 |
compound |
erythropoiesis,ɛ |
R2542 |
T3570 |
T3567 |
pobj |
ɛ,in |
R2543 |
T3379 |
T3380 |
nummod |
21,] |
R2544 |
T3571 |
T3572 |
advmod |
also,appears |
R2545 |
T3572 |
T3558 |
conj |
appears,activated |
R2546 |
T3380 |
T3377 |
appos |
],[ |
R2547 |
T3573 |
T3575 |
aux |
to,regulated |
R2548 |
T3574 |
T3575 |
auxpass |
be,regulated |
R2549 |
T3575 |
T3572 |
xcomp |
regulated,appears |
R2550 |
T3381 |
T3372 |
punct |
.,shown |
R2551 |
T3576 |
T3575 |
advmod |
competitively,regulated |
R2552 |
T3577 |
T3579 |
nmod |
[,] |
R2553 |
T3382 |
T3385 |
det |
The,genes |
R2554 |
T3578 |
T3579 |
nummod |
26,] |
R2555 |
T3579 |
T3572 |
dep |
],appears |
R2556 |
T3580 |
T3572 |
punct |
.,appears |
R2557 |
T3383 |
T3385 |
compound |
mouse,genes |
R2558 |
T3581 |
T3582 |
det |
The,γ-globin |
R2559 |
T3582 |
T3588 |
nsubjpass |
γ-globin,controlled |
R2560 |
T3583 |
T3584 |
aux |
to,adult |
R2561 |
T3384 |
T3385 |
compound |
β-globin,genes |
R2562 |
T3385 |
T3395 |
nsubjpass |
genes,clustered |
R2563 |
T3584 |
T3582 |
acl |
adult,γ-globin |
R2564 |
T3585 |
T3586 |
compound |
β-globin,switch |
R2565 |
T3386 |
T3385 |
appos |
ɛy,genes |
R2566 |
T3586 |
T3588 |
nsubjpass |
switch,controlled |
R2567 |
T3587 |
T3588 |
auxpass |
is,controlled |
R2568 |
T3588 |
T3588 |
ROOT |
controlled,controlled |
R2569 |
T3589 |
T3588 |
agent |
by,controlled |
R2570 |
T3590 |
T3591 |
compound |
promoter,competition |
R2571 |
T3591 |
T3589 |
pobj |
competition,by |
R2572 |
T3387 |
T3386 |
punct |
",",ɛy |
R2573 |
T3592 |
T3591 |
prep |
for,competition |
R2574 |
T3593 |
T3597 |
det |
the,] |
R2575 |
T3388 |
T3386 |
appos |
βh1,ɛy |
R2576 |
T3594 |
T3595 |
compound |
LCR,[ |
R2577 |
T3595 |
T3597 |
nmod |
[,] |
R2578 |
T3389 |
T3386 |
punct |
",",ɛy |
R2579 |
T3596 |
T3597 |
nummod |
"24,25",] |
R2580 |
T3597 |
T3592 |
pobj |
],for |
R2581 |
T3598 |
T3588 |
punct |
.,controlled |
R2582 |
T3599 |
T3601 |
predet |
All,elements |
R2583 |
T3390 |
T3386 |
conj |
β-major,ɛy |
R2584 |
T3600 |
T3601 |
det |
the,elements |
R2585 |
T3601 |
T3609 |
nsubj |
elements,are |
R2586 |
T3391 |
T3390 |
punct |
",",β-major |
R2587 |
T3602 |
T3601 |
amod |
responsible,elements |
R2588 |
T3603 |
T3602 |
prep |
for,responsible |
R2589 |
T3604 |
T3603 |
pcomp |
silencing,for |
R2590 |
T3392 |
T3390 |
cc |
and,β-major |
R2591 |
T3393 |
T3390 |
conj |
β-minor,β-major |
R2592 |
T3394 |
T3395 |
auxpass |
are,clustered |
R2593 |
T3605 |
T3608 |
det |
the,gene |
R2594 |
T3606 |
T3608 |
nmod |
ɛ,gene |
R2595 |
T3395 |
T3395 |
ROOT |
clustered,clustered |
R2596 |
T3607 |
T3608 |
compound |
globin,gene |
R2597 |
T3608 |
T3604 |
dobj |
gene,silencing |
R2598 |
T3396 |
T3395 |
prep |
on,clustered |
R2599 |
T3609 |
T3609 |
ROOT |
are,are |
R2600 |
T3610 |
T3609 |
prep |
within,are |
R2601 |
T3611 |
T3613 |
det |
the,gene |
R2602 |
T3397 |
T3396 |
pobj |
Chromosome,on |
R2603 |
T3612 |
T3613 |
compound |
ɛ,gene |
R2604 |
T3613 |
T3610 |
pobj |
gene,within |
R2605 |
T3614 |
T3610 |
cc |
or,within |
R2606 |
T3398 |
T3397 |
nummod |
7,Chromosome |
R2607 |
T3615 |
T3610 |
conj |
in,within |
R2608 |
T3616 |
T3617 |
amod |
adjacent,sequences |
R2609 |
T3399 |
T3395 |
cc |
and,clustered |
R2610 |
T3617 |
T3615 |
pobj |
sequences,in |
R2611 |
T3618 |
T3620 |
nmod |
[,] |
R2612 |
T3400 |
T3401 |
nsubj |
they,are |
R2613 |
T3619 |
T3620 |
nummod |
27,] |
R2614 |
T3620 |
T3609 |
attr |
],are |
R2615 |
T3621 |
T3609 |
punct |
",",are |
R2616 |
T3401 |
T3395 |
conj |
are,clustered |
R2617 |
T3622 |
T3609 |
advcl |
suggesting,are |
R2618 |
T3623 |
T3625 |
mark |
that,is |
R2619 |
T3624 |
T3625 |
csubj |
silencing,is |
R2620 |
T3625 |
T3622 |
ccomp |
is,suggesting |
R2621 |
T3626 |
T3627 |
advmod |
primarily,gene |
R2622 |
T3627 |
T3625 |
attr |
gene,is |
R2623 |
T3402 |
T3403 |
advmod |
highly,homologous |
R2624 |
T3628 |
T3627 |
amod |
autonomous,gene |
R2625 |
T3629 |
T3609 |
punct |
.,are |
R2626 |
T3630 |
T3654 |
csubj |
Using,identified |
R2627 |
T3403 |
T3401 |
acomp |
homologous,are |
R2628 |
T3631 |
T3632 |
compound |
promoter,deletion |
R2629 |
T3632 |
T3633 |
compound |
deletion,analyses |
R2630 |
T3633 |
T3630 |
dobj |
analyses,Using |
R2631 |
T3404 |
T3403 |
prep |
to,homologous |
R2632 |
T3634 |
T3633 |
prep |
in,analyses |
R2633 |
T3635 |
T3637 |
amod |
transgenic,models |
R2634 |
T3405 |
T3407 |
poss |
their,counterparts |
R2635 |
T3636 |
T3637 |
compound |
mouse,models |
R2636 |
T3637 |
T3634 |
pobj |
models,in |
R2637 |
T3638 |
T3637 |
cc |
and,models |
R2638 |
T3406 |
T3407 |
amod |
human,counterparts |
R2639 |
T3639 |
T3640 |
compound |
cell,transfection |
R2640 |
T3640 |
T3641 |
compound |
transfection,assays |
R2641 |
T3641 |
T3637 |
conj |
assays,models |
R2642 |
T3407 |
T3404 |
pobj |
counterparts,to |
R2643 |
T3642 |
T3641 |
punct |
",",assays |
R2644 |
T3643 |
T3645 |
amod |
multiple,elements |
R2645 |
T3408 |
T3407 |
prep |
in,counterparts |
R2646 |
T3644 |
T3645 |
compound |
DNA,elements |
R2647 |
T3645 |
T3641 |
conj |
elements,assays |
R2648 |
T3646 |
T3645 |
amod |
important,elements |
R2649 |
T3409 |
T3410 |
amod |
organizational,structure |
R2650 |
T3647 |
T3646 |
prep |
to,important |
R2651 |
T3648 |
T3650 |
det |
the,process |
R2652 |
T3649 |
T3650 |
amod |
silencing,process |
R2653 |
T3410 |
T3408 |
pobj |
structure,in |
R2654 |
T3650 |
T3647 |
pobj |
process,to |
R2655 |
T3651 |
T3654 |
aux |
have,identified |
R2656 |
T3652 |
T3654 |
auxpass |
been,identified |
R2657 |
T3702 |
T3688 |
punct |
),shown |
R2658 |
T3653 |
T3654 |
advmod |
previously,identified |
R2659 |
T3654 |
T3654 |
ROOT |
identified,identified |
R2660 |
T3655 |
T3654 |
prep |
in,identified |
R2661 |
T3656 |
T3658 |
preconj |
both,proximal |
R2662 |
T3703 |
T3704 |
aux |
to,regulate |
R2663 |
T3657 |
T3658 |
det |
the,proximal |
R2664 |
T3658 |
T3655 |
pobj |
proximal,in |
R2665 |
T3659 |
T3658 |
cc |
and,proximal |
R2666 |
T3704 |
T3688 |
advcl |
regulate,shown |
R2667 |
T3660 |
T3664 |
det |
the,promoter |
R2668 |
T3661 |
T3664 |
amod |
distal,promoter |
R2669 |
T3662 |
T3664 |
compound |
ɛ,promoter |
R2670 |
T3705 |
T3704 |
dobj |
ɛ,regulate |
R2671 |
T3663 |
T3664 |
compound |
gene,promoter |
R2672 |
T3664 |
T3658 |
conj |
promoter,proximal |
R2673 |
T3665 |
T3667 |
nmod |
[,] |
R2674 |
T3706 |
T3705 |
acl |
silencing,ɛ |
R2675 |
T3666 |
T3667 |
nummod |
27,] |
R2676 |
T3667 |
T3664 |
appos |
],promoter |
R2677 |
T3707 |
T3709 |
nmod |
[,] |
R2678 |
T3668 |
T3654 |
punct |
.,identified |
R2679 |
T3669 |
T3672 |
poss |
Their,factors |
R2680 |
T3670 |
T3672 |
amod |
corresponding,factors |
R2681 |
T3708 |
T3709 |
nummod |
27,] |
R2682 |
T3671 |
T3672 |
compound |
transcription,factors |
R2683 |
T3709 |
T3706 |
dobj |
],silencing |
R2684 |
T3672 |
T3686 |
nsubjpass |
factors,identified |
R2685 |
T3673 |
T3672 |
punct |
",",factors |
R2686 |
T3674 |
T3675 |
amod |
such,as |
R2687 |
T3710 |
T3686 |
punct |
.,identified |
R2688 |
T3675 |
T3672 |
prep |
as,factors |
R2689 |
T3676 |
T3675 |
pobj |
GATA-1,as |
R269 |
T573 |
T575 |
nsubj |
Sox6,Silences |
R2690 |
T3677 |
T3676 |
punct |
",",GATA-1 |
R2691 |
T3711 |
T3714 |
advmod |
Thus,appears |
R2692 |
T3678 |
T3676 |
conj |
YY-1,GATA-1 |
R2693 |
T3679 |
T3678 |
punct |
",",YY-1 |
R2694 |
T3712 |
T3714 |
punct |
",",appears |
R2695 |
T3680 |
T3678 |
conj |
COUP-TF,YY-1 |
R2696 |
T3681 |
T3680 |
punct |
",",COUP-TF |
R2697 |
T3682 |
T3680 |
cc |
and,COUP-TF |
R2698 |
T3713 |
T3714 |
nsubj |
it,appears |
R2699 |
T3683 |
T3680 |
conj |
DRED,COUP-TF |
R270 |
T574 |
T575 |
advmod |
Directly,Silences |
R2700 |
T3684 |
T3686 |
aux |
have,identified |
R2701 |
T3685 |
T3686 |
auxpass |
been,identified |
R2702 |
T3714 |
T3714 |
ROOT |
appears,appears |
R2703 |
T3686 |
T3686 |
ROOT |
identified,identified |
R2704 |
T3687 |
T3686 |
cc |
and,identified |
R2705 |
T3688 |
T3686 |
conj |
shown,identified |
R2706 |
T3715 |
T3722 |
mark |
that,involves |
R2707 |
T3689 |
T3691 |
aux |
to,bind |
R2708 |
T3690 |
T3691 |
advmod |
directly,bind |
R2709 |
T3691 |
T3688 |
xcomp |
bind,shown |
R271 |
T575 |
T583 |
nsubj |
Silences,is |
R2710 |
T3716 |
T3717 |
det |
the,silencing |
R2711 |
T3692 |
T3691 |
prep |
to,bind |
R2712 |
T3693 |
T3695 |
det |
these,elements |
R2713 |
T3694 |
T3695 |
compound |
DNA,elements |
R2714 |
T3717 |
T3722 |
nsubj |
silencing,involves |
R2715 |
T3695 |
T3692 |
pobj |
elements,to |
R2716 |
T3696 |
T3695 |
punct |
(,elements |
R2717 |
T3697 |
T3688 |
prep |
as,shown |
R2718 |
T3698 |
T3697 |
pobj |
part,as |
R2719 |
T3699 |
T3698 |
prep |
of,part |
R272 |
T576 |
T578 |
compound |
Epsilon,Expression |
R2720 |
T3700 |
T3701 |
compound |
protein,complexes |
R2721 |
T3718 |
T3717 |
prep |
of,silencing |
R2722 |
T3701 |
T3699 |
pobj |
complexes,of |
R2723 |
T3719 |
T3721 |
det |
the,gene |
R2724 |
T3720 |
T3721 |
compound |
ɛ,gene |
R2725 |
T3721 |
T3718 |
pobj |
gene,of |
R2726 |
T3799 |
T3799 |
ROOT |
describe,describe |
R2727 |
T3722 |
T3714 |
ccomp |
involves,appears |
R2728 |
T3723 |
T3725 |
det |
a,network |
R2729 |
T3800 |
T3803 |
mark |
that,exerts |
R273 |
T577 |
T578 |
compound |
Globin,Expression |
R2730 |
T3801 |
T3803 |
nsubj |
Sox6,exerts |
R2731 |
T3724 |
T3725 |
amod |
complicated,network |
R2732 |
T3802 |
T3803 |
advmod |
also,exerts |
R2733 |
T3803 |
T3799 |
ccomp |
exerts,describe |
R2734 |
T3725 |
T3722 |
dobj |
network,involves |
R2735 |
T3804 |
T3805 |
amod |
pleiotropic,effects |
R2736 |
T3805 |
T3803 |
dobj |
effects,exerts |
R2737 |
T3726 |
T3725 |
prep |
of,network |
R2738 |
T3806 |
T3805 |
prep |
on,effects |
R2739 |
T3807 |
T3806 |
pobj |
erythropoiesis,on |
R274 |
T578 |
T583 |
nsubj |
Expression,is |
R2740 |
T3808 |
T3799 |
punct |
.,describe |
R2741 |
T3727 |
T3729 |
amod |
multiple,elements |
R2742 |
T3809 |
T3810 |
det |
These,effects |
R2743 |
T3810 |
T3811 |
nsubj |
effects,include |
R2744 |
T3728 |
T3729 |
compound |
cis,elements |
R2745 |
T3811 |
T3811 |
ROOT |
include,include |
R2746 |
T3812 |
T3813 |
amod |
delayed,maturation |
R2747 |
T3813 |
T3811 |
dobj |
maturation,include |
R2748 |
T3729 |
T3726 |
pobj |
elements,of |
R2749 |
T3814 |
T3813 |
prep |
of,maturation |
R275 |
T579 |
T578 |
prep |
in,Expression |
R2750 |
T3815 |
T3814 |
pobj |
erythrocytes,of |
R2751 |
T3816 |
T3819 |
punct |
(,enucleate |
R2752 |
T3730 |
T3729 |
cc |
and,elements |
R2753 |
T3817 |
T3819 |
nsubj |
that,enucleate |
R2754 |
T3818 |
T3819 |
advmod |
normally,enucleate |
R2755 |
T3731 |
T3732 |
amod |
transacting,proteins |
R2756 |
T3819 |
T3813 |
appos |
enucleate,maturation |
R2757 |
T3732 |
T3729 |
conj |
proteins,elements |
R2758 |
T3820 |
T3819 |
advmod |
prior,enucleate |
R2759 |
T3733 |
T3714 |
punct |
.,appears |
R276 |
T580 |
T582 |
compound |
Definitive,Sox6 |
R2760 |
T3821 |
T3820 |
prep |
to,prior |
R2761 |
T3822 |
T3821 |
pcomp |
entering,to |
R2762 |
T3823 |
T3824 |
det |
the,bloodstream |
R2763 |
T3734 |
T3767 |
prep |
In,shown |
R2764 |
T3824 |
T3822 |
dobj |
bloodstream,entering |
R2765 |
T3825 |
T3827 |
nmod |
[,] |
R2766 |
T3826 |
T3827 |
nummod |
27,] |
R2767 |
T3735 |
T3734 |
pobj |
addition,In |
R2768 |
T3827 |
T3824 |
appos |
],bloodstream |
R2769 |
T3828 |
T3827 |
punct |
),] |
R277 |
T581 |
T582 |
compound |
Erythropoiesis,Sox6 |
R2770 |
T3829 |
T3824 |
cc |
and,bloodstream |
R2771 |
T3830 |
T3831 |
amod |
higher,expression |
R2772 |
T3831 |
T3821 |
pobj |
expression,to |
R2773 |
T3832 |
T3831 |
prep |
of,expression |
R2774 |
T3736 |
T3735 |
prep |
to,addition |
R2775 |
T3833 |
T3835 |
amod |
embryonic,genes |
R2776 |
T3834 |
T3835 |
compound |
globin,genes |
R2777 |
T3835 |
T3832 |
pobj |
genes,of |
R2778 |
T3836 |
T3811 |
punct |
.,include |
R2779 |
T3737 |
T3736 |
pcomp |
playing,to |
R278 |
T582 |
T579 |
pobj |
Sox6,in |
R2780 |
T3837 |
T3840 |
det |
The,effect |
R2781 |
T3838 |
T3839 |
advmod |
most,extreme |
R2782 |
T3738 |
T3740 |
det |
an,role |
R2783 |
T3839 |
T3840 |
amod |
extreme,effect |
R2784 |
T3840 |
T3841 |
nsubj |
effect,is |
R2785 |
T3841 |
T3841 |
ROOT |
is,is |
R2786 |
T3739 |
T3740 |
amod |
important,role |
R2787 |
T3842 |
T3843 |
det |
the,persistence |
R2788 |
T3843 |
T3841 |
attr |
persistence,is |
R2789 |
T3844 |
T3843 |
prep |
of,persistence |
R279 |
T583 |
T583 |
ROOT |
is,is |
R2790 |
T3740 |
T3737 |
dobj |
role,playing |
R2791 |
T3845 |
T3846 |
amod |
high,expression |
R2792 |
T3846 |
T3844 |
pobj |
expression,of |
R2793 |
T3847 |
T3846 |
prep |
of,expression |
R2794 |
T3741 |
T3740 |
prep |
in,role |
R2795 |
T3848 |
T3852 |
det |
the,gene |
R2796 |
T3849 |
T3852 |
amod |
embryonic,gene |
R2797 |
T3742 |
T3743 |
det |
the,development |
R2798 |
T3850 |
T3852 |
compound |
ɛy,gene |
R2799 |
T3851 |
T3852 |
compound |
globin,gene |
R280 |
T584 |
T585 |
det |
a,member |
R2800 |
T3852 |
T3847 |
pobj |
gene,of |
R2801 |
T3743 |
T3741 |
pobj |
development,in |
R2802 |
T3853 |
T3841 |
punct |
.,is |
R2803 |
T3854 |
T3856 |
advmod |
Here,describe |
R2804 |
T3855 |
T3856 |
nsubj |
we,describe |
R2805 |
T3744 |
T3743 |
prep |
of,development |
R2806 |
T3856 |
T3856 |
ROOT |
describe,describe |
R2807 |
T3857 |
T3856 |
cc |
and,describe |
R2808 |
T3745 |
T3748 |
det |
the,system |
R2809 |
T3858 |
T3856 |
conj |
characterize,describe |
R281 |
T585 |
T583 |
attr |
member,is |
R2810 |
T3859 |
T3860 |
det |
the,effects |
R2811 |
T3860 |
T3858 |
dobj |
effects,characterize |
R2812 |
T3746 |
T3748 |
amod |
central,system |
R2813 |
T3861 |
T3860 |
prep |
of,effects |
R2814 |
T3862 |
T3861 |
pobj |
Sox6,of |
R2815 |
T3863 |
T3860 |
prep |
on,effects |
R2816 |
T3747 |
T3748 |
amod |
nervous,system |
R2817 |
T3864 |
T3867 |
det |
the,gene |
R2818 |
T3865 |
T3867 |
amod |
ɛy,gene |
R2819 |
T3866 |
T3867 |
compound |
globin,gene |
R282 |
T586 |
T585 |
prep |
of,member |
R2820 |
T3867 |
T3863 |
pobj |
gene,on |
R2821 |
T3868 |
T3856 |
punct |
.,describe |
R2822 |
T3869 |
T3870 |
nsubj |
We,show |
R2823 |
T3748 |
T3744 |
pobj |
system,of |
R2824 |
T3870 |
T3870 |
ROOT |
show,show |
R2825 |
T3871 |
T3882 |
mark |
that,represses |
R2826 |
T3872 |
T3873 |
amod |
Sox6,binds |
R2827 |
T3749 |
T3767 |
advcl |
[,shown |
R2828 |
T3873 |
T3882 |
nsubj |
binds,represses |
R2829 |
T3874 |
T3873 |
prep |
to,binds |
R283 |
T587 |
T591 |
det |
the,family |
R2830 |
T3875 |
T3877 |
det |
the,promoter |
R2831 |
T3750 |
T3749 |
nummod |
8,[ |
R2832 |
T3876 |
T3877 |
amod |
proximal,promoter |
R2833 |
T3877 |
T3874 |
pobj |
promoter,to |
R2834 |
T3878 |
T3877 |
prep |
of,promoter |
R2835 |
T3751 |
T3752 |
nummod |
11,] |
R2836 |
T3879 |
T3880 |
amod |
ɛy,globin |
R2837 |
T3880 |
T3878 |
pobj |
globin,of |
R2838 |
T3881 |
T3877 |
cc |
and,promoter |
R2839 |
T3752 |
T3749 |
appos |
],[ |
R284 |
T588 |
T591 |
compound |
Sox,family |
R2840 |
T3882 |
T3870 |
ccomp |
represses,show |
R2841 |
T3883 |
T3884 |
poss |
its,transcription |
R2842 |
T3884 |
T3882 |
dobj |
transcription,represses |
R2843 |
T3753 |
T3752 |
punct |
",",] |
R2844 |
T3885 |
T3870 |
punct |
.,show |
R2845 |
T3886 |
T3896 |
prep |
In,expressed |
R2846 |
T3754 |
T3757 |
compound |
cartilage,] |
R2847 |
T3887 |
T3891 |
nmod |
wild-type,mice |
R2848 |
T3888 |
T3889 |
punct |
(,WT |
R2849 |
T3889 |
T3887 |
appos |
WT,wild-type |
R285 |
T589 |
T590 |
compound |
transcription,factor |
R2850 |
T3755 |
T3757 |
compound |
[,] |
R2851 |
T3890 |
T3889 |
punct |
),WT |
R2852 |
T3891 |
T3886 |
pobj |
mice,In |
R2853 |
T3892 |
T3896 |
punct |
",",expressed |
R2854 |
T3756 |
T3757 |
compound |
"6,12,13",] |
R2855 |
T3893 |
T3896 |
nsubjpass |
Sox6,expressed |
R2856 |
T3894 |
T3896 |
auxpass |
is,expressed |
R2857 |
T3895 |
T3896 |
neg |
not,expressed |
R2858 |
T3757 |
T3749 |
conj |
],[ |
R2859 |
T3758 |
T3757 |
punct |
",",] |
R286 |
T590 |
T591 |
compound |
factor,family |
R2860 |
T3896 |
T3896 |
ROOT |
expressed,expressed |
R2861 |
T3759 |
T3757 |
cc |
and,] |
R2862 |
T3897 |
T3896 |
prep |
in,expressed |
R2863 |
T3898 |
T3901 |
compound |
yolk,islands |
R2864 |
T3760 |
T3763 |
compound |
muscle,] |
R2865 |
T3761 |
T3763 |
compound |
[,] |
R2866 |
T3899 |
T3901 |
compound |
sac,islands |
R2867 |
T3900 |
T3901 |
compound |
blood,islands |
R2868 |
T3762 |
T3763 |
compound |
"14,15",] |
R2869 |
T3901 |
T3897 |
pobj |
islands,in |
R287 |
T591 |
T586 |
pobj |
family,of |
R2870 |
T3902 |
T3896 |
punct |
",",expressed |
R2871 |
T3903 |
T3896 |
cc |
but,expressed |
R2872 |
T3904 |
T3905 |
auxpass |
is,expressed |
R2873 |
T3905 |
T3896 |
conj |
expressed,expressed |
R2874 |
T3906 |
T3905 |
prep |
in,expressed |
R2875 |
T3763 |
T3757 |
conj |
],] |
R2876 |
T3907 |
T3908 |
amod |
fetal,liver |
R2877 |
T3908 |
T3906 |
pobj |
liver,in |
R2878 |
T3764 |
T3767 |
punct |
",",shown |
R2879 |
T3909 |
T3905 |
punct |
",",expressed |
R288 |
T592 |
T594 |
nsubjpass |
that,defined |
R2880 |
T3910 |
T3913 |
det |
the,pattern |
R2881 |
T3765 |
T3767 |
nsubjpass |
it,shown |
R2882 |
T3911 |
T3913 |
amod |
opposite,pattern |
R2883 |
T3912 |
T3913 |
compound |
expression,pattern |
R2884 |
T3913 |
T3905 |
conj |
pattern,expressed |
R2885 |
T3766 |
T3767 |
auxpass |
was,shown |
R2886 |
T3914 |
T3913 |
prep |
of,pattern |
R2887 |
T3915 |
T3916 |
amod |
ɛy,globin |
R2888 |
T3767 |
T3767 |
ROOT |
shown,shown |
R2889 |
T3916 |
T3914 |
pobj |
globin,of |
R289 |
T593 |
T594 |
auxpass |
is,defined |
R2890 |
T3917 |
T3896 |
punct |
.,expressed |
R2891 |
T3918 |
T3928 |
prep |
In,expressed |
R2892 |
T3768 |
T3770 |
mark |
that,is |
R2893 |
T3919 |
T3920 |
det |
the,absence |
R2894 |
T3920 |
T3918 |
pobj |
absence,In |
R2895 |
T3921 |
T3920 |
prep |
of,absence |
R2896 |
T3769 |
T3770 |
nsubj |
Sox6,is |
R2897 |
T3922 |
T3921 |
pobj |
Sox6,of |
R2898 |
T3923 |
T3928 |
punct |
",",expressed |
R2899 |
T3924 |
T3925 |
amod |
ɛy,globin |
R290 |
T594 |
T585 |
relcl |
defined,member |
R2900 |
T3770 |
T3767 |
ccomp |
is,shown |
R2901 |
T3925 |
T3928 |
nsubjpass |
globin,expressed |
R2902 |
T3926 |
T3928 |
auxpass |
is,expressed |
R2903 |
T3771 |
T3770 |
acomp |
upregulated,is |
R2904 |
T3927 |
T3928 |
advmod |
ectopically,expressed |
R2905 |
T3928 |
T3928 |
ROOT |
expressed,expressed |
R2906 |
T3929 |
T3928 |
prep |
in,expressed |
R2907 |
T3772 |
T3771 |
prep |
in,upregulated |
R2908 |
T3930 |
T3932 |
det |
the,liver |
R2909 |
T3931 |
T3932 |
amod |
fetal,liver |
R291 |
T595 |
T594 |
agent |
by,defined |
R2910 |
T3932 |
T3929 |
pobj |
liver,in |
R2911 |
T3773 |
T3776 |
amod |
long-term,cells |
R2912 |
T3933 |
T3928 |
punct |
",",expressed |
R2913 |
T3934 |
T3928 |
advcl |
demonstrating,expressed |
R2914 |
T3935 |
T3934 |
dobj |
that,demonstrating |
R2915 |
T3774 |
T3776 |
compound |
hematopoiesis,cells |
R2916 |
T3936 |
T3937 |
amod |
Sox6,functions |
R2917 |
T3937 |
T3935 |
nsubj |
functions,that |
R2918 |
T3775 |
T3776 |
compound |
stem,cells |
R2919 |
T3938 |
T3937 |
prep |
in,functions |
R292 |
T596 |
T600 |
det |
the,group |
R2920 |
T3939 |
T3940 |
amod |
definitive,erythropoiesis |
R2921 |
T3940 |
T3938 |
pobj |
erythropoiesis,in |
R2922 |
T3941 |
T3928 |
punct |
.,expressed |
R2923 |
T3776 |
T3772 |
pobj |
cells,in |
R2924 |
T3777 |
T3778 |
punct |
(,LT-HSC |
R2925 |
T3778 |
T3771 |
appos |
LT-HSC,upregulated |
R2926 |
T3779 |
T3771 |
punct |
),upregulated |
R2927 |
T3780 |
T3771 |
prep |
compared,upregulated |
R2928 |
T3781 |
T3780 |
prep |
with,compared |
R2929 |
T3782 |
T3783 |
amod |
multipotent,progenitors |
R293 |
T597 |
T600 |
amod |
conserved,group |
R2933 |
T3783 |
T3781 |
pobj |
progenitors,with |
R2934 |
T3784 |
T3783 |
prep |
of,progenitors |
R2938 |
T3785 |
T3788 |
compound |
adult,marrow |
R2939 |
T3786 |
T3788 |
compound |
mouse,marrow |
R294 |
T598 |
T600 |
amod |
high,group |
R2940 |
T3787 |
T3788 |
compound |
bone,marrow |
R2941 |
T3788 |
T3789 |
compound |
marrow,lineage |
R2943 |
T3789 |
T3784 |
pobj |
lineage,of |
R2944 |
T3790 |
T3792 |
nmod |
[,] |
R2945 |
T3791 |
T3792 |
nummod |
28,] |
R2946 |
T3792 |
T3783 |
appos |
],progenitors |
R2948 |
T3793 |
T3767 |
punct |
.,shown |
R295 |
T599 |
T600 |
compound |
mobility,group |
R2952 |
T3794 |
T3799 |
prep |
In,describe |
R2953 |
T3795 |
T3796 |
det |
this,study |
R2954 |
T3796 |
T3794 |
pobj |
study,In |
R2956 |
T3797 |
T3799 |
punct |
",",describe |
R2957 |
T3798 |
T3799 |
nsubj |
we,describe |
R296 |
T600 |
T595 |
pobj |
group,by |
R297 |
T601 |
T602 |
punct |
(,HMG |
R298 |
T602 |
T600 |
appos |
HMG,group |
R299 |
T603 |
T602 |
punct |
),HMG |
R300 |
T604 |
T606 |
compound |
DNA,domain |
R301 |
T605 |
T606 |
amod |
binding,domain |
R302 |
T606 |
T600 |
conj |
domain,group |
R303 |
T607 |
T606 |
punct |
",",domain |
R304 |
T608 |
T609 |
advmod |
first,described |
R305 |
T609 |
T600 |
acl |
described,group |
R306 |
T610 |
T609 |
prep |
in,described |
R307 |
T611 |
T614 |
det |
the,gene |
R308 |
T612 |
T614 |
amod |
testis,gene |
R309 |
T613 |
T614 |
amod |
determining,gene |
R310 |
T614 |
T610 |
pobj |
gene,in |
R311 |
T615 |
T614 |
punct |
",",gene |
R312 |
T616 |
T614 |
appos |
Sry,gene |
R313 |
T617 |
T583 |
punct |
.,is |
R314 |
T618 |
T619 |
amod |
Previous,studies |
R315 |
T619 |
T621 |
nsubj |
studies,suggested |
R316 |
T620 |
T621 |
aux |
have,suggested |
R317 |
T621 |
T621 |
ROOT |
suggested,suggested |
R318 |
T622 |
T624 |
mark |
that,plays |
R319 |
T623 |
T624 |
nsubj |
Sox6,plays |
R320 |
T624 |
T621 |
ccomp |
plays,suggested |
R321 |
T625 |
T626 |
det |
a,role |
R322 |
T626 |
T624 |
dobj |
role,plays |
R323 |
T627 |
T626 |
prep |
in,role |
R324 |
T628 |
T629 |
det |
the,development |
R325 |
T629 |
T627 |
pobj |
development,in |
R326 |
T630 |
T629 |
prep |
of,development |
R327 |
T631 |
T634 |
det |
the,system |
R328 |
T632 |
T634 |
amod |
central,system |
R329 |
T633 |
T634 |
amod |
nervous,system |
R330 |
T634 |
T630 |
pobj |
system,of |
R331 |
T635 |
T634 |
punct |
",",system |
R332 |
T636 |
T634 |
conj |
cartilage,system |
R333 |
T637 |
T636 |
punct |
",",cartilage |
R334 |
T638 |
T636 |
cc |
and,cartilage |
R335 |
T639 |
T636 |
conj |
muscle,cartilage |
R336 |
T640 |
T621 |
punct |
.,suggested |
R337 |
T641 |
T652 |
prep |
In,expressed |
R338 |
T642 |
T644 |
det |
the,mouse |
R339 |
T643 |
T644 |
amod |
Sox6-deficient,mouse |
R340 |
T644 |
T641 |
pobj |
mouse,In |
R341 |
T645 |
T652 |
punct |
",",expressed |
R342 |
T646 |
T652 |
nsubjpass |
p100H,expressed |
R343 |
T647 |
T652 |
punct |
",",expressed |
R344 |
T648 |
T649 |
amod |
ɛy,globin |
R345 |
T649 |
T652 |
nsubjpass |
globin,expressed |
R346 |
T650 |
T652 |
auxpass |
is,expressed |
R347 |
T651 |
T652 |
advmod |
persistently,expressed |
R348 |
T652 |
T652 |
ROOT |
expressed,expressed |
R349 |
T653 |
T652 |
punct |
",",expressed |
R3495 |
T4964 |
T4965 |
amod |
Persistent,Expression |
R3496 |
T4965 |
T4965 |
ROOT |
Expression,Expression |
R3497 |
T4966 |
T4965 |
prep |
of,Expression |
R3498 |
T4967 |
T4969 |
det |
the,Globin |
R3499 |
T4968 |
T4969 |
compound |
Embryonic,Globin |
R350 |
T654 |
T652 |
cc |
and,expressed |
R3500 |
T4969 |
T4966 |
pobj |
Globin,of |
R3501 |
T4970 |
T4969 |
punct |
",",Globin |
R3502 |
T4971 |
T4965 |
intj |
ɛy,Expression |
R3503 |
T4972 |
T4965 |
punct |
",",Expression |
R3504 |
T4973 |
T4965 |
prep |
in,Expression |
R3505 |
T4974 |
T4975 |
amod |
Sox6-Deficient,Mice |
R3506 |
T4975 |
T4973 |
pobj |
Mice,in |
R3507 |
T4976 |
T4979 |
det |
The,gene |
R3508 |
T4977 |
T4979 |
amod |
ɛy,gene |
R3509 |
T4978 |
T4979 |
compound |
globin,gene |
R351 |
T655 |
T656 |
amod |
increased,numbers |
R3510 |
T4979 |
T4982 |
nsubjpass |
gene,identified |
R3511 |
T4980 |
T4982 |
auxpass |
was,identified |
R3512 |
T4981 |
T4982 |
advmod |
initially,identified |
R3513 |
T4982 |
T4982 |
ROOT |
identified,identified |
R3514 |
T4983 |
T4982 |
prep |
as,identified |
R3515 |
T4984 |
T4986 |
det |
an,transcript |
R3516 |
T4985 |
T4986 |
amod |
upregulated,transcript |
R3517 |
T4986 |
T4983 |
pobj |
transcript,as |
R3518 |
T4987 |
T4986 |
prep |
in,transcript |
R3519 |
T4988 |
T4990 |
det |
the,mouse |
R352 |
T656 |
T661 |
nsubj |
numbers,are |
R3520 |
T4989 |
T4990 |
amod |
p 100H,mouse |
R3521 |
T4990 |
T4987 |
pobj |
mouse,in |
R3522 |
T4991 |
T4986 |
acl |
using,transcript |
R3523 |
T4992 |
T4993 |
amod |
subtractive,hybridization |
R3524 |
T4993 |
T4991 |
dobj |
hybridization,using |
R3525 |
T4994 |
T4995 |
aux |
to,identify |
R3526 |
T4995 |
T4991 |
xcomp |
identify,using |
R3527 |
T4996 |
T4998 |
amod |
Sox6,targets |
R3528 |
T4997 |
T4998 |
amod |
downstream,targets |
R3529 |
T4998 |
T4995 |
dobj |
targets,identify |
R353 |
T657 |
T656 |
prep |
of,numbers |
R3530 |
T4999 |
T4982 |
punct |
.,identified |
R3531 |
T5000 |
T5002 |
det |
This,observation |
R3532 |
T5001 |
T5002 |
amod |
initial,observation |
R3533 |
T5002 |
T5004 |
nsubjpass |
observation,confirmed |
R3534 |
T5003 |
T5004 |
auxpass |
was,confirmed |
R3535 |
T5004 |
T5004 |
ROOT |
confirmed,confirmed |
R3536 |
T5005 |
T5004 |
prep |
in,confirmed |
R3537 |
T5006 |
T5009 |
det |
an,allele |
R3538 |
T5007 |
T5009 |
amod |
independent,allele |
R3539 |
T5008 |
T5009 |
amod |
knock-out,allele |
R354 |
T658 |
T660 |
amod |
nucleated,cells |
R3540 |
T5009 |
T5005 |
pobj |
allele,in |
R3541 |
T5010 |
T5009 |
prep |
of,allele |
R3542 |
T5011 |
T5012 |
compound |
Sox6,[ |
R3543 |
T5012 |
T5010 |
pobj |
[,of |
R3544 |
T5013 |
T5014 |
nummod |
13,] |
R3545 |
T5014 |
T5009 |
appos |
],allele |
R3546 |
T5015 |
T5004 |
advcl |
using,confirmed |
R3547 |
T5016 |
T5019 |
amod |
real-time,reaction |
R3548 |
T5017 |
T5019 |
compound |
polymerase,reaction |
R3549 |
T5018 |
T5019 |
compound |
chain,reaction |
R355 |
T659 |
T660 |
amod |
red,cells |
R3550 |
T5019 |
T5015 |
dobj |
reaction,using |
R3551 |
T5020 |
T5019 |
punct |
(,reaction |
R3552 |
T5021 |
T5019 |
appos |
PCR,reaction |
R3553 |
T5022 |
T5019 |
punct |
),reaction |
R3554 |
T5023 |
T5019 |
punct |
(,reaction |
R3555 |
T5024 |
T5025 |
amod |
unpublished,data |
R3556 |
T5025 |
T5019 |
appos |
data,reaction |
R3557 |
T5026 |
T5019 |
punct |
),reaction |
R3558 |
T5027 |
T5004 |
punct |
.,confirmed |
R3559 |
T5028 |
T5029 |
compound |
Real-time,PCR |
R356 |
T660 |
T657 |
pobj |
cells,of |
R3560 |
T5029 |
T5031 |
nsubjpass |
PCR,used |
R3561 |
T5030 |
T5031 |
auxpass |
was,used |
R3562 |
T5031 |
T5031 |
ROOT |
used,used |
R3563 |
T5032 |
T5033 |
aux |
to,quantitate |
R3564 |
T5033 |
T5031 |
xcomp |
quantitate,used |
R3565 |
T5034 |
T5036 |
det |
the,levels |
R3566 |
T5035 |
T5036 |
compound |
expression,levels |
R3567 |
T5036 |
T5033 |
dobj |
levels,quantitate |
R3568 |
T5037 |
T5036 |
prep |
of,levels |
R3569 |
T5038 |
T5040 |
amod |
other,genes |
R357 |
T661 |
T652 |
conj |
are,expressed |
R3570 |
T5039 |
T5040 |
compound |
globin,genes |
R3571 |
T5040 |
T5037 |
pobj |
genes,of |
R3572 |
T5041 |
T5040 |
prep |
in,genes |
R3573 |
T5042 |
T5043 |
amod |
p100H,mutant |
R3574 |
T5043 |
T5047 |
amod |
mutant,livers |
R3575 |
T5044 |
T5043 |
cc |
and,mutant |
R3576 |
T5045 |
T5047 |
compound |
WT,livers |
R3577 |
T5046 |
T5047 |
compound |
mouse,livers |
R3578 |
T5047 |
T5041 |
pobj |
livers,in |
R3579 |
T5048 |
T5033 |
prep |
at,quantitate |
R358 |
T662 |
T661 |
acomp |
present,are |
R3580 |
T5049 |
T5051 |
nummod |
two,stages |
R3581 |
T5050 |
T5051 |
amod |
developmental,stages |
R3582 |
T5051 |
T5048 |
pobj |
stages,at |
R3583 |
T5052 |
T5051 |
punct |
",",stages |
R3584 |
T5053 |
T5057 |
nummod |
15.5,dpc |
R3585 |
T5054 |
T5057 |
nmod |
dpc,dpc |
R3586 |
T5055 |
T5054 |
cc |
and,dpc |
R3587 |
T5056 |
T5057 |
nummod |
18.5,dpc |
R3588 |
T5057 |
T5051 |
appos |
dpc,stages |
R3589 |
T5058 |
T5031 |
punct |
.,used |
R359 |
T663 |
T662 |
prep |
in,present |
R3590 |
T5059 |
T5060 |
mark |
As,shown |
R3591 |
T5060 |
T5069 |
advcl |
shown,expressed |
R3592 |
T5061 |
T5060 |
prep |
in,shown |
R3593 |
T5062 |
T5061 |
pobj |
Figure,in |
R3594 |
T5063 |
T5062 |
nummod |
1,Figure |
R3595 |
T5064 |
T5069 |
punct |
",",expressed |
R3596 |
T5065 |
T5067 |
det |
the,gene |
R3597 |
T5066 |
T5067 |
amod |
ɛy,gene |
R3598 |
T5067 |
T5069 |
nsubjpass |
gene,expressed |
R3599 |
T5068 |
T5069 |
auxpass |
is,expressed |
R360 |
T664 |
T666 |
det |
the,circulation |
R3600 |
T5069 |
T5069 |
ROOT |
expressed,expressed |
R3601 |
T5070 |
T5069 |
prep |
at,expressed |
R3602 |
T5071 |
T5072 |
amod |
high,levels |
R3603 |
T5072 |
T5070 |
pobj |
levels,at |
R3604 |
T5073 |
T5072 |
prep |
at,levels |
R3605 |
T5074 |
T5075 |
det |
both,time |
R3606 |
T5075 |
T5076 |
compound |
time,points |
R3607 |
T5076 |
T5073 |
pobj |
points,at |
R3608 |
T5077 |
T5072 |
prep |
in,levels |
R3609 |
T5078 |
T5079 |
amod |
mutant,mice |
R361 |
T665 |
T666 |
amod |
fetal,circulation |
R3610 |
T5079 |
T5077 |
pobj |
mice,in |
R3611 |
T5080 |
T5069 |
punct |
",",expressed |
R3612 |
T5081 |
T5069 |
prep |
in,expressed |
R3613 |
T5082 |
T5081 |
pobj |
contrast,in |
R3614 |
T5083 |
T5082 |
prep |
to,contrast |
R3615 |
T5084 |
T5085 |
det |
the,decline |
R3616 |
T5085 |
T5083 |
pobj |
decline,to |
R3617 |
T5086 |
T5085 |
prep |
in,decline |
R3618 |
T5087 |
T5086 |
pobj |
expression,in |
R3619 |
T5088 |
T5085 |
acl |
observed,decline |
R362 |
T666 |
T663 |
pobj |
circulation,in |
R3620 |
T5089 |
T5088 |
prep |
in,observed |
R3621 |
T5090 |
T5091 |
compound |
WT,mice |
R3622 |
T5091 |
T5089 |
pobj |
mice,in |
R3623 |
T5092 |
T5069 |
punct |
.,expressed |
R3624 |
T5093 |
T5094 |
det |
No,difference |
R3625 |
T5094 |
T5096 |
nsubjpass |
difference,seen |
R3626 |
T5095 |
T5096 |
auxpass |
was,seen |
R3627 |
T5096 |
T5096 |
ROOT |
seen,seen |
R3628 |
T5097 |
T5096 |
prep |
between,seen |
R3629 |
T5098 |
T5101 |
nmod |
WT,mice |
R363 |
T667 |
T661 |
punct |
.,are |
R3630 |
T5099 |
T5098 |
cc |
and,WT |
R3631 |
T5100 |
T5098 |
conj |
heterozygous,WT |
R3632 |
T5101 |
T5097 |
pobj |
mice,between |
R3633 |
T5102 |
T5104 |
punct |
(,data |
R3634 |
T5103 |
T5104 |
amod |
unpublished,data |
R3635 |
T5104 |
T5101 |
appos |
data,mice |
R3636 |
T5105 |
T5101 |
punct |
),mice |
R3637 |
T5106 |
T5096 |
punct |
.,seen |
R3638 |
T5107 |
T5124 |
advmod |
Interestingly,are |
R3639 |
T5108 |
T5124 |
punct |
",",are |
R364 |
T668 |
T669 |
compound |
Transfection,assays |
R3640 |
T5109 |
T5111 |
det |
the,levels |
R3641 |
T5110 |
T5111 |
compound |
expression,levels |
R3642 |
T5111 |
T5124 |
nsubj |
levels,are |
R3643 |
T5112 |
T5111 |
prep |
of,levels |
R3644 |
T5113 |
T5118 |
det |
the,genes |
R3645 |
T5114 |
T5118 |
amod |
other,genes |
R3646 |
T5115 |
T5118 |
nummod |
two,genes |
R3647 |
T5116 |
T5118 |
amod |
embryonic,genes |
R3648 |
T5117 |
T5118 |
compound |
globin,genes |
R3649 |
T5118 |
T5112 |
pobj |
genes,of |
R365 |
T669 |
T676 |
nsubj |
assays,define |
R3650 |
T5119 |
T5118 |
punct |
(,genes |
R3651 |
T5120 |
T5118 |
appos |
ζ,genes |
R3652 |
T5121 |
T5120 |
cc |
and,ζ |
R3653 |
T5122 |
T5120 |
conj |
βh1,ζ |
R3654 |
T5123 |
T5118 |
punct |
),genes |
R3655 |
T5124 |
T5124 |
ROOT |
are,are |
R3656 |
T5125 |
T5124 |
advmod |
also,are |
R3657 |
T5126 |
T5124 |
acomp |
higher,are |
R3658 |
T5127 |
T5126 |
prep |
in,higher |
R3659 |
T5128 |
T5130 |
amod |
p100H,mice |
R366 |
T670 |
T669 |
prep |
in,assays |
R3660 |
T5129 |
T5130 |
amod |
homozygous,mice |
R3661 |
T5130 |
T5127 |
pobj |
mice,in |
R3662 |
T5131 |
T5124 |
punct |
",",are |
R3663 |
T5132 |
T5124 |
prep |
compared,are |
R3664 |
T5133 |
T5132 |
prep |
with,compared |
R3665 |
T5134 |
T5135 |
compound |
WT,mice |
R3666 |
T5135 |
T5133 |
pobj |
mice,with |
R3667 |
T5136 |
T5124 |
punct |
",",are |
R3668 |
T5137 |
T5124 |
cc |
but,are |
R3669 |
T5138 |
T5144 |
prep |
to,seen |
R367 |
T671 |
T670 |
pobj |
GM979,in |
R3670 |
T5139 |
T5142 |
det |
a,extent |
R3671 |
T5140 |
T5141 |
advmod |
much,lesser |
R3672 |
T5141 |
T5142 |
amod |
lesser,extent |
R3673 |
T5142 |
T5138 |
pobj |
extent,to |
R3674 |
T5143 |
T5144 |
mark |
than,seen |
R3675 |
T5144 |
T5124 |
conj |
seen,are |
R3676 |
T5145 |
T5144 |
prep |
for,seen |
R3677 |
T5146 |
T5147 |
amod |
ɛy,globin |
R3678 |
T5147 |
T5145 |
pobj |
globin,for |
R3679 |
T5148 |
T5144 |
prep |
at,seen |
R368 |
T672 |
T673 |
punct |
(,erythroleukemic |
R3680 |
T5149 |
T5150 |
nummod |
18.5,dpc |
R3681 |
T5150 |
T5148 |
pobj |
dpc,at |
R3682 |
T5151 |
T5152 |
punct |
(,Figure |
R3683 |
T5152 |
T5144 |
conj |
Figure,seen |
R3684 |
T5153 |
T5152 |
nummod |
1,Figure |
R3685 |
T5154 |
T5152 |
punct |
),Figure |
R3686 |
T5155 |
T5124 |
punct |
.,are |
R3687 |
T5156 |
T5165 |
advmod |
Moreover,is |
R3688 |
T5157 |
T5165 |
punct |
",",is |
R3689 |
T5158 |
T5160 |
det |
the,level |
R369 |
T673 |
T671 |
appos |
erythroleukemic,GM979 |
R3690 |
T5159 |
T5160 |
compound |
expression,level |
R3691 |
T5160 |
T5165 |
nsubj |
level,is |
R3692 |
T5161 |
T5160 |
prep |
of,level |
R3693 |
T5162 |
T5164 |
amod |
adult,globin |
R3694 |
T5163 |
T5164 |
compound |
β,globin |
R3695 |
T5164 |
T5161 |
pobj |
globin,of |
R3696 |
T5165 |
T5165 |
ROOT |
is,is |
R3697 |
T5166 |
T5165 |
advmod |
also,is |
R3698 |
T5167 |
T5168 |
advmod |
somewhat,higher |
R3699 |
T5168 |
T5165 |
acomp |
higher,is |
R370 |
T674 |
T673 |
punct |
),erythroleukemic |
R3700 |
T5169 |
T5168 |
prep |
in,higher |
R3701 |
T5170 |
T5172 |
amod |
p100H,mice |
R3702 |
T5171 |
T5172 |
amod |
homozygous,mice |
R3703 |
T5172 |
T5169 |
pobj |
mice,in |
R3704 |
T5173 |
T5168 |
prep |
than,higher |
R3705 |
T5174 |
T5173 |
prep |
in,than |
R3706 |
T5175 |
T5176 |
compound |
WT,mice |
R3707 |
T5176 |
T5174 |
pobj |
mice,in |
R3708 |
T5177 |
T5165 |
prep |
at,is |
R3709 |
T5178 |
T5179 |
nummod |
18.5,dpc |
R371 |
T675 |
T676 |
nsubj |
cells,define |
R3710 |
T5179 |
T5177 |
pobj |
dpc,at |
R3711 |
T5180 |
T5181 |
punct |
(,Figure |
R3712 |
T5181 |
T5165 |
npadvmod |
Figure,is |
R3713 |
T5182 |
T5181 |
nummod |
1,Figure |
R3714 |
T5183 |
T5181 |
punct |
),Figure |
R3715 |
T5184 |
T5165 |
punct |
.,is |
R3716 |
T5185 |
T5186 |
amod |
Perinatal,lethality |
R3717 |
T5186 |
T5200 |
nsubj |
lethality,precludes |
R3718 |
T5187 |
T5186 |
prep |
of,lethality |
R3719 |
T5188 |
T5189 |
amod |
mutant,mice |
R372 |
T676 |
T676 |
ROOT |
define,define |
R3720 |
T5189 |
T5187 |
pobj |
mice,of |
R3721 |
T5190 |
T5192 |
punct |
(,from |
R3722 |
T5191 |
T5192 |
advmod |
presumably,from |
R3723 |
T5192 |
T5186 |
prep |
from,lethality |
R3724 |
T5193 |
T5195 |
det |
the,defect |
R3725 |
T5194 |
T5195 |
compound |
heart,defect |
R3726 |
T5195 |
T5192 |
pobj |
defect,from |
R3727 |
T5196 |
T5200 |
nsubj |
[,precludes |
R3728 |
T5197 |
T5198 |
nummod |
14,] |
R3729 |
T5198 |
T5196 |
appos |
],[ |
R373 |
T677 |
T681 |
det |
a,region |
R3730 |
T5199 |
T5196 |
punct |
),[ |
R3731 |
T5200 |
T5200 |
ROOT |
precludes,precludes |
R3732 |
T5201 |
T5200 |
dobj |
us,precludes |
R3733 |
T5202 |
T5200 |
prep |
from,precludes |
R3734 |
T5203 |
T5202 |
pcomp |
evaluating,from |
R3735 |
T5204 |
T5206 |
amod |
postnatal,expression |
R3736 |
T5205 |
T5206 |
compound |
globin,expression |
R3737 |
T5206 |
T5203 |
dobj |
expression,evaluating |
R3738 |
T5207 |
T5200 |
punct |
.,precludes |
R3739 |
T5208 |
T5209 |
det |
The,graphs |
R374 |
T678 |
T681 |
nummod |
36,region |
R3740 |
T5209 |
T5213 |
nsubj |
graphs,illustrate |
R3741 |
T5210 |
T5209 |
prep |
in,graphs |
R3742 |
T5211 |
T5210 |
pobj |
Figure,in |
R3743 |
T5212 |
T5211 |
nummod |
1,Figure |
R3744 |
T5213 |
T5213 |
ROOT |
illustrate,illustrate |
R3745 |
T5214 |
T5215 |
amod |
real,time |
R3746 |
T5215 |
T5217 |
compound |
time,results |
R3747 |
T5216 |
T5217 |
compound |
PCR,results |
R3748 |
T5217 |
T5213 |
dobj |
results,illustrate |
R3749 |
T5218 |
T5220 |
nsubjpass |
that,performed |
R375 |
T679 |
T681 |
compound |
base,region |
R3750 |
T5219 |
T5220 |
auxpass |
were,performed |
R3751 |
T5220 |
T5217 |
relcl |
performed,results |
R3752 |
T5221 |
T5220 |
prep |
in,performed |
R3753 |
T5222 |
T5221 |
pobj |
triplicate,in |
R3754 |
T5223 |
T5222 |
punct |
(,triplicate |
R3755 |
T5224 |
T5225 |
amod |
standard,deviation |
R3756 |
T5225 |
T5230 |
nsubjpass |
deviation,shown |
R3757 |
T5226 |
T5225 |
prep |
of,deviation |
R3758 |
T5227 |
T5228 |
det |
the,data |
R3759 |
T5228 |
T5226 |
pobj |
data,of |
R376 |
T680 |
T681 |
compound |
pair,region |
R3760 |
T5229 |
T5230 |
auxpass |
is,shown |
R3761 |
T5230 |
T5213 |
ccomp |
shown,illustrate |
R3762 |
T5231 |
T5230 |
agent |
by,shown |
R3763 |
T5232 |
T5233 |
compound |
error,bars |
R3764 |
T5233 |
T5231 |
pobj |
bars,by |
R3765 |
T5234 |
T5230 |
punct |
),shown |
R3766 |
T5235 |
T5213 |
punct |
.,illustrate |
R3767 |
T5236 |
T5242 |
mark |
Because,performed |
R3768 |
T5237 |
T5242 |
nsubjpass |
all,performed |
R3769 |
T5238 |
T5237 |
prep |
of,all |
R377 |
T681 |
T676 |
dobj |
region,define |
R3770 |
T5239 |
T5240 |
det |
the,assays |
R3771 |
T5240 |
T5238 |
pobj |
assays,of |
R3772 |
T5241 |
T5242 |
auxpass |
were,performed |
R3773 |
T5242 |
T5256 |
advcl |
performed,are |
R3774 |
T5243 |
T5242 |
prep |
at,performed |
R3775 |
T5244 |
T5246 |
det |
the,time |
R3776 |
T5245 |
T5246 |
amod |
same,time |
R3777 |
T5246 |
T5243 |
pobj |
time,at |
R3778 |
T5247 |
T5242 |
prep |
with,performed |
R3779 |
T5248 |
T5251 |
det |
the,control |
R378 |
T682 |
T681 |
prep |
of,region |
R3780 |
T5249 |
T5251 |
amod |
same,control |
R3781 |
T5250 |
T5251 |
amod |
internal,control |
R3782 |
T5251 |
T5247 |
pobj |
control,with |
R3783 |
T5252 |
T5256 |
punct |
",",are |
R3784 |
T5253 |
T5254 |
det |
the,levels |
R3785 |
T5254 |
T5256 |
nsubj |
levels,are |
R3786 |
T5255 |
T5254 |
acl |
shown,levels |
R3787 |
T5256 |
T5256 |
ROOT |
are,are |
R3788 |
T5257 |
T5258 |
amod |
relative,levels |
R3789 |
T5258 |
T5256 |
attr |
levels,are |
R379 |
T683 |
T686 |
det |
the,promoter |
R3790 |
T5259 |
T5256 |
cc |
and,are |
R3791 |
T5260 |
T5256 |
conj |
are,are |
R3792 |
T5261 |
T5262 |
advmod |
thus,comparable |
R3793 |
T5262 |
T5260 |
acomp |
comparable,are |
R3794 |
T5263 |
T5260 |
prep |
across,are |
R3795 |
T5264 |
T5265 |
det |
all,samples |
R3796 |
T5265 |
T5263 |
pobj |
samples,across |
R3797 |
T5266 |
T5260 |
cc |
and,are |
R3798 |
T5267 |
T5260 |
conj |
are,are |
R3799 |
T5268 |
T5267 |
prep |
in,are |
R380 |
T684 |
T686 |
amod |
ɛy,promoter |
R3800 |
T5269 |
T5268 |
pobj |
agreement,in |
R3801 |
T5270 |
T5269 |
prep |
with,agreement |
R3802 |
T5271 |
T5272 |
advmod |
previously,published |
R3803 |
T5272 |
T5273 |
amod |
published,results |
R3804 |
T5273 |
T5270 |
pobj |
results,with |
R3805 |
T5274 |
T5273 |
prep |
for,results |
R3806 |
T5275 |
T5277 |
nmod |
WT,mice |
R3807 |
T5276 |
T5277 |
amod |
fetal,mice |
R3808 |
T5277 |
T5274 |
pobj |
mice,for |
R3809 |
T5278 |
T5280 |
nmod |
[,] |
R381 |
T685 |
T686 |
amod |
proximal,promoter |
R3810 |
T5279 |
T5280 |
nummod |
29,] |
R3811 |
T5280 |
T5277 |
appos |
],mice |
R3812 |
T5281 |
T5256 |
punct |
.,are |
R3813 |
T5282 |
T5283 |
nsubj |
We,note |
R3814 |
T5283 |
T5283 |
ROOT |
note,note |
R3815 |
T5284 |
T5302 |
mark |
that,is |
R3816 |
T5285 |
T5286 |
det |
the,level |
R3817 |
T5286 |
T5302 |
nsubj |
level,is |
R3818 |
T5287 |
T5286 |
prep |
of,level |
R3819 |
T5288 |
T5289 |
amod |
ɛy,expression |
R382 |
T686 |
T682 |
pobj |
promoter,of |
R3820 |
T5289 |
T5287 |
pobj |
expression,of |
R3821 |
T5290 |
T5286 |
prep |
in,level |
R3822 |
T5291 |
T5292 |
det |
the,livers |
R3823 |
T5292 |
T5290 |
pobj |
livers,in |
R3824 |
T5293 |
T5292 |
prep |
of,livers |
R3825 |
T5294 |
T5301 |
nummod |
15.5,mice |
R3826 |
T5295 |
T5301 |
nmod |
dpc,mice |
R3827 |
T5296 |
T5295 |
cc |
and,dpc |
R3828 |
T5297 |
T5298 |
nummod |
18.5,dpc |
R3829 |
T5298 |
T5301 |
nmod |
dpc,mice |
R383 |
T687 |
T688 |
nsubj |
that,is |
R3830 |
T5299 |
T5301 |
amod |
homozygous,mice |
R3831 |
T5300 |
T5301 |
amod |
mutant,mice |
R3832 |
T5301 |
T5293 |
pobj |
mice,of |
R3833 |
T5302 |
T5283 |
ccomp |
is,note |
R3834 |
T5303 |
T5304 |
advmod |
statistically,equivalent |
R3835 |
T5304 |
T5302 |
acomp |
equivalent,is |
R3836 |
T5305 |
T5304 |
prep |
to,equivalent |
R3837 |
T5306 |
T5307 |
det |
the,level |
R3838 |
T5307 |
T5305 |
pobj |
level,to |
R3839 |
T5308 |
T5307 |
prep |
of,level |
R384 |
T688 |
T686 |
relcl |
is,promoter |
R3840 |
T5309 |
T5312 |
compound |
βmaj,expression |
R3841 |
T5310 |
T5312 |
compound |
/,expression |
R3842 |
T5311 |
T5312 |
compound |
min,expression |
R3843 |
T5312 |
T5308 |
pobj |
expression,of |
R3844 |
T5313 |
T5307 |
prep |
in,level |
R3845 |
T5314 |
T5315 |
det |
the,livers |
R3846 |
T5315 |
T5313 |
pobj |
livers,in |
R3847 |
T5316 |
T5315 |
prep |
of,livers |
R3848 |
T5317 |
T5324 |
nummod |
15.5,mice |
R3849 |
T5318 |
T5324 |
nmod |
dpc,mice |
R385 |
T689 |
T688 |
acomp |
critical,is |
R3850 |
T5319 |
T5318 |
cc |
and,dpc |
R3851 |
T5320 |
T5321 |
nummod |
18.5,dpc |
R3852 |
T5321 |
T5324 |
nmod |
dpc,mice |
R3853 |
T5322 |
T5324 |
amod |
homozygous,mice |
R3854 |
T5323 |
T5324 |
compound |
WT,mice |
R3855 |
T5324 |
T5316 |
pobj |
mice,of |
R3856 |
T5325 |
T5283 |
punct |
.,note |
R386 |
T690 |
T689 |
prep |
for,critical |
R387 |
T691 |
T693 |
amod |
Sox6,repression |
R388 |
T692 |
T693 |
amod |
mediated,repression |
R389 |
T693 |
T690 |
pobj |
repression,for |
R390 |
T694 |
T676 |
punct |
.,define |
R391 |
T695 |
T698 |
amod |
Electrophoretic,assay |
R392 |
T696 |
T698 |
compound |
mobility,assay |
R393 |
T697 |
T698 |
compound |
shift,assay |
R394 |
T698 |
T708 |
nmod |
assay,assays |
R395 |
T699 |
T700 |
punct |
(,EMSA |
R396 |
T700 |
T698 |
appos |
EMSA,assay |
R397 |
T701 |
T700 |
punct |
),EMSA |
R398 |
T702 |
T698 |
cc |
and,assay |
R399 |
T703 |
T704 |
compound |
chromatin,immunoprecipitation |
R400 |
T704 |
T698 |
conj |
immunoprecipitation,assay |
R401 |
T705 |
T704 |
punct |
(,immunoprecipitation |
R402 |
T706 |
T704 |
appos |
ChIP,immunoprecipitation |
R403 |
T707 |
T704 |
punct |
),immunoprecipitation |
R404 |
T708 |
T709 |
nsubj |
assays,demonstrate |
R405 |
T709 |
T709 |
ROOT |
demonstrate,demonstrate |
R406 |
T710 |
T718 |
mark |
that,binding |
R407 |
T711 |
T712 |
amod |
Sox6,acts |
R408 |
T712 |
T718 |
nsubj |
acts,binding |
R409 |
T713 |
T712 |
prep |
as,acts |
R410 |
T714 |
T715 |
det |
a,repressor |
R411 |
T715 |
T713 |
pobj |
repressor,as |
R412 |
T716 |
T712 |
prep |
by,acts |
R413 |
T717 |
T718 |
advmod |
directly,binding |
R414 |
T718 |
T709 |
ccomp |
binding,demonstrate |
R415 |
T719 |
T718 |
prep |
to,binding |
R4426 |
T6363 |
T6364 |
compound |
Transfection,Studies |
R4427 |
T6364 |
T6365 |
compound |
Studies,Using |
R4428 |
T6365 |
T6365 |
ROOT |
Using,Using |
R4429 |
T6366 |
T6368 |
compound |
GM979,Indicate |
R4430 |
T6367 |
T6368 |
compound |
Cells,Indicate |
R4431 |
T6368 |
T6365 |
dobj |
Indicate,Using |
R4432 |
T6369 |
T6365 |
nsubj |
That,Using |
R4433 |
T6370 |
T6372 |
nsubj |
Sox6,Represses |
R4434 |
T6371 |
T6372 |
advmod |
Directly,Represses |
R4435 |
T6372 |
T6369 |
nsubj |
Represses,That |
R4436 |
T6373 |
T6374 |
det |
the,ɛy |
R4437 |
T6374 |
T6376 |
compound |
ɛy,Promoter |
R4438 |
T6375 |
T6376 |
compound |
Gene,Promoter |
R4439 |
T6376 |
T6372 |
dobj |
Promoter,Represses |
R4440 |
T6377 |
T6376 |
prep |
at,Promoter |
R4441 |
T6378 |
T6383 |
det |
the,assays |
R4442 |
T6379 |
T6380 |
compound |
Transcriptional,Level |
R4443 |
T6380 |
T6383 |
nmod |
Level,assays |
R4444 |
T6381 |
T6383 |
amod |
Real-time,assays |
R4445 |
T6382 |
T6383 |
compound |
PCR,assays |
R4446 |
T6383 |
T6377 |
pobj |
assays,at |
R4447 |
T6384 |
T6383 |
punct |
(,assays |
R4448 |
T6385 |
T6383 |
appos |
Figure,assays |
R4449 |
T6386 |
T6385 |
nummod |
1,Figure |
R4450 |
T6387 |
T6385 |
punct |
),Figure |
R4451 |
T6388 |
T6397 |
nmod |
measure,activity |
R4452 |
T6389 |
T6390 |
amod |
steady-state,levels |
R4453 |
T6390 |
T6388 |
dobj |
levels,measure |
R4454 |
T6391 |
T6390 |
prep |
of,levels |
R4455 |
T6392 |
T6393 |
compound |
ɛy,mRNA |
R4456 |
T6393 |
T6391 |
pobj |
mRNA,of |
R4457 |
T6394 |
T6393 |
punct |
",",mRNA |
R4458 |
T6395 |
T6397 |
neg |
not,activity |
R4459 |
T6396 |
T6397 |
amod |
transcriptional,activity |
R4460 |
T6397 |
T6383 |
appos |
activity,assays |
R4461 |
T6398 |
T6397 |
prep |
of,activity |
R4462 |
T6399 |
T6401 |
det |
the,promoter |
R4463 |
T6400 |
T6401 |
amod |
ɛy,promoter |
R4464 |
T6401 |
T6398 |
pobj |
promoter,of |
R4465 |
T6402 |
T6365 |
punct |
.,Using |
R4466 |
T6403 |
T6404 |
aux |
To,investigate |
R4467 |
T6404 |
T6420 |
advcl |
investigate,used |
R4468 |
T6405 |
T6408 |
mark |
whether,acts |
R4469 |
T6406 |
T6408 |
nsubj |
Sox6,acts |
R4470 |
T6407 |
T6408 |
advmod |
directly,acts |
R4471 |
T6408 |
T6404 |
ccomp |
acts,investigate |
R4472 |
T6409 |
T6408 |
prep |
on,acts |
R4473 |
T6410 |
T6413 |
det |
the,promoter |
R4474 |
T6411 |
T6413 |
amod |
ɛy,promoter |
R4475 |
T6412 |
T6413 |
compound |
gene,promoter |
R4476 |
T6413 |
T6409 |
pobj |
promoter,on |
R4477 |
T6414 |
T6413 |
prep |
at,promoter |
R4478 |
T6415 |
T6417 |
det |
the,level |
R4479 |
T6416 |
T6417 |
amod |
transcriptional,level |
R4480 |
T6417 |
T6414 |
pobj |
level,at |
R4481 |
T6418 |
T6420 |
punct |
",",used |
R4482 |
T6419 |
T6420 |
nsubj |
we,used |
R4483 |
T6420 |
T6420 |
ROOT |
used,used |
R4484 |
T6421 |
T6426 |
det |
an,assay |
R4485 |
T6422 |
T6426 |
nmod |
in,assay |
R4486 |
T6423 |
T6426 |
amod |
vitro,assay |
R4487 |
T6424 |
T6426 |
nmod |
transient,assay |
R4488 |
T6425 |
T6426 |
compound |
transfection,assay |
R4489 |
T6426 |
T6420 |
dobj |
assay,used |
R4490 |
T6427 |
T6426 |
cc |
and,assay |
R4491 |
T6428 |
T6429 |
compound |
GM979,cells |
R4492 |
T6429 |
T6426 |
conj |
cells,assay |
R4493 |
T6430 |
T6420 |
punct |
",",used |
R4494 |
T6431 |
T6435 |
det |
a,line |
R4495 |
T6432 |
T6435 |
amod |
murine,line |
R4496 |
T6433 |
T6435 |
amod |
erythroleukemic,line |
R4497 |
T6434 |
T6435 |
compound |
cell,line |
R4498 |
T6435 |
T6420 |
dobj |
line,used |
R4499 |
T6436 |
T6437 |
nsubj |
that,expresses |
R4500 |
T6437 |
T6435 |
relcl |
expresses,line |
R4501 |
T6438 |
T6439 |
det |
both,ɛy |
R4502 |
T6439 |
T6437 |
dobj |
ɛy,expresses |
R4503 |
T6440 |
T6439 |
cc |
and,ɛy |
R4504 |
T6441 |
T6443 |
amod |
adult,globins |
R4505 |
T6442 |
T6443 |
compound |
beta,globins |
R4506 |
T6443 |
T6446 |
dep |
globins,] |
R4507 |
T6444 |
T6446 |
nmod |
[,] |
R4508 |
T6445 |
T6446 |
nummod |
30,] |
R4509 |
T6446 |
T6439 |
conj |
],ɛy |
R4510 |
T6447 |
T6420 |
punct |
.,used |
R4511 |
T6448 |
T6449 |
nsubj |
We,generated |
R4512 |
T6449 |
T6449 |
ROOT |
generated,generated |
R4513 |
T6450 |
T6453 |
det |
an,reporter |
R4514 |
T6451 |
T6453 |
amod |
ɛy,reporter |
R4515 |
T6452 |
T6453 |
compound |
promoter,reporter |
R4516 |
T6453 |
T6454 |
nsubj |
reporter,construct |
R4517 |
T6454 |
T6449 |
ccomp |
construct,generated |
R4518 |
T6455 |
T6456 |
punct |
(,E-Luc |
R4519 |
T6456 |
T6454 |
dep |
E-Luc,construct |
R4520 |
T6457 |
T6456 |
punct |
),E-Luc |
R4521 |
T6458 |
T6454 |
prep |
by,construct |
R4522 |
T6459 |
T6458 |
pcomp |
fusing,by |
R4523 |
T6460 |
T6461 |
det |
a,micro-LCR |
R4524 |
T6461 |
T6459 |
dobj |
micro-LCR,fusing |
R4525 |
T6462 |
T6463 |
punct |
(,μLCR |
R4526 |
T6463 |
T6461 |
appos |
μLCR,micro-LCR |
R4527 |
T6464 |
T6463 |
punct |
),μLCR |
R4528 |
T6465 |
T6461 |
conj |
element,micro-LCR |
R4529 |
T6466 |
T6465 |
punct |
(,element |
R4530 |
T6467 |
T6468 |
nummod |
2.5,kb |
R4531 |
T6468 |
T6465 |
appos |
kb,element |
R4532 |
T6469 |
T6465 |
punct |
),element |
R4533 |
T6470 |
T6472 |
nmod |
[,] |
R4534 |
T6471 |
T6472 |
nummod |
31,] |
R4535 |
T6472 |
T6461 |
appos |
],micro-LCR |
R4536 |
T6473 |
T6459 |
prep |
to,fusing |
R4537 |
T6474 |
T6477 |
det |
the,promoter |
R4538 |
T6475 |
T6477 |
amod |
ɛy,promoter |
R4539 |
T6476 |
T6477 |
amod |
proximal,promoter |
R4540 |
T6477 |
T6473 |
pobj |
promoter,to |
R4541 |
T6478 |
T6477 |
punct |
(,promoter |
R4542 |
T6479 |
T6480 |
nummod |
2.2,kb |
R4543 |
T6480 |
T6477 |
appos |
kb,promoter |
R4544 |
T6481 |
T6477 |
punct |
),promoter |
R4545 |
T6482 |
T6459 |
punct |
",",fusing |
R4546 |
T6483 |
T6454 |
advcl |
followed,construct |
R4547 |
T6484 |
T6483 |
agent |
by,followed |
R4548 |
T6485 |
T6488 |
det |
the,gene |
R4549 |
T6486 |
T6488 |
compound |
luciferase,gene |
R4550 |
T6487 |
T6488 |
compound |
reporter,gene |
R4551 |
T6488 |
T6484 |
pobj |
gene,by |
R4552 |
T6489 |
T6483 |
punct |
",",followed |
R4553 |
T6490 |
T6491 |
mark |
as,shown |
R4554 |
T6491 |
T6454 |
advcl |
shown,construct |
R4555 |
T6492 |
T6491 |
prep |
in,shown |
R4556 |
T6493 |
T6492 |
pobj |
Figure,in |
R4557 |
T6494 |
T6493 |
nummod |
2A,Figure |
R4558 |
T6495 |
T6496 |
punct |
(,detailed |
R4559 |
T6496 |
T6454 |
advcl |
detailed,construct |
R4560 |
T6497 |
T6496 |
prep |
in,detailed |
R4561 |
T6498 |
T6497 |
pobj |
Materials,in |
R4562 |
T6499 |
T6498 |
cc |
and,Materials |
R4563 |
T6500 |
T6498 |
conj |
Methods,Materials |
R4564 |
T6501 |
T6496 |
punct |
),detailed |
R4565 |
T6502 |
T6449 |
punct |
.,generated |
R4566 |
T6503 |
T6512 |
nsubj |
Overexpression,leads |
R4567 |
T6504 |
T6503 |
prep |
of,Overexpression |
R4568 |
T6505 |
T6504 |
pobj |
Sox6,of |
R4569 |
T6506 |
T6503 |
prep |
in,Overexpression |
R4570 |
T6507 |
T6508 |
compound |
GM979,cells |
R4571 |
T6508 |
T6506 |
pobj |
cells,in |
R4572 |
T6509 |
T6503 |
agent |
by,Overexpression |
R4573 |
T6510 |
T6511 |
amod |
transient,transfection |
R4574 |
T6511 |
T6509 |
pobj |
transfection,by |
R4575 |
T6512 |
T6512 |
ROOT |
leads,leads |
R4576 |
T6513 |
T6512 |
prep |
to,leads |
R4577 |
T6514 |
T6516 |
det |
a,repression |
R4578 |
T6515 |
T6516 |
amod |
dosage-dependent,repression |
R4579 |
T6516 |
T6513 |
pobj |
repression,to |
R4580 |
T6517 |
T6516 |
prep |
of,repression |
R4581 |
T6518 |
T6520 |
amod |
E-Luc,activity |
R4582 |
T6519 |
T6520 |
compound |
reporter,activity |
R4583 |
T6520 |
T6517 |
pobj |
activity,of |
R4584 |
T6521 |
T6523 |
punct |
(,2B |
R4585 |
T6522 |
T6523 |
compound |
Figure,2B |
R4586 |
T6523 |
T6520 |
appos |
2B,activity |
R4587 |
T6524 |
T6520 |
punct |
),activity |
R4588 |
T6525 |
T6512 |
punct |
.,leads |
R4589 |
T6526 |
T6551 |
prep |
In,fails |
R4590 |
T6527 |
T6526 |
pobj |
contrast,In |
R4591 |
T6528 |
T6551 |
punct |
",",fails |
R4592 |
T6529 |
T6551 |
nsubj |
overexpression,fails |
R4593 |
T6530 |
T6529 |
prep |
of,overexpression |
R4594 |
T6531 |
T6534 |
det |
a,protein |
R4595 |
T6532 |
T6534 |
amod |
truncated,protein |
R4596 |
T6533 |
T6534 |
compound |
Sox6,protein |
R4597 |
T6534 |
T6530 |
pobj |
protein,of |
R4598 |
T6535 |
T6536 |
nsubj |
that,lacks |
R4599 |
T6536 |
T6534 |
relcl |
lacks,protein |
R4600 |
T6537 |
T6539 |
poss |
its,domain |
R4601 |
T6538 |
T6539 |
compound |
HMG,domain |
R4602 |
T6539 |
T6536 |
dobj |
domain,lacks |
R4603 |
T6540 |
T6542 |
nmod |
[,] |
R4604 |
T6541 |
T6542 |
nummod |
32,] |
R4605 |
T6542 |
T6539 |
appos |
],domain |
R4606 |
T6543 |
T6542 |
punct |
(,] |
R4607 |
T6544 |
T6542 |
amod |
similar,] |
R4608 |
T6545 |
T6544 |
prep |
to,similar |
R4609 |
T6546 |
T6549 |
det |
the,allele |
R4610 |
T6547 |
T6549 |
amod |
p 100H,allele |
R4611 |
T6548 |
T6549 |
compound |
mouse,allele |
R4612 |
T6549 |
T6545 |
pobj |
allele,to |
R4613 |
T6550 |
T6542 |
punct |
),] |
R4614 |
T6551 |
T6551 |
ROOT |
fails,fails |
R4615 |
T6552 |
T6553 |
aux |
to,repress |
R4616 |
T6553 |
T6551 |
xcomp |
repress,fails |
R4617 |
T6554 |
T6555 |
amod |
E-Luc,activity |
R4618 |
T6555 |
T6553 |
dobj |
activity,repress |
R4619 |
T6556 |
T6558 |
punct |
(,2B |
R4620 |
T6557 |
T6558 |
compound |
Figure,2B |
R4621 |
T6558 |
T6555 |
appos |
2B,activity |
R4622 |
T6559 |
T6558 |
punct |
),2B |
R4623 |
T6560 |
T6551 |
punct |
.,fails |
R4624 |
T6561 |
T6562 |
det |
These,data |
R4625 |
T6562 |
T6563 |
nsubj |
data,indicate |
R4626 |
T6563 |
T6563 |
ROOT |
indicate,indicate |
R4627 |
T6564 |
T6568 |
mark |
that,repress |
R4628 |
T6565 |
T6566 |
amod |
Sox6,acts |
R4629 |
T6566 |
T6568 |
nsubj |
acts,repress |
R4630 |
T6567 |
T6568 |
aux |
to,repress |
R4631 |
T6568 |
T6563 |
ccomp |
repress,indicate |
R4632 |
T6569 |
T6571 |
det |
the,promoter |
R4633 |
T6570 |
T6571 |
amod |
ɛy,promoter |
R4634 |
T6571 |
T6568 |
dobj |
promoter,repress |
R4635 |
T6572 |
T6571 |
prep |
at,promoter |
R4636 |
T6573 |
T6575 |
det |
the,level |
R4637 |
T6574 |
T6575 |
amod |
transcriptional,level |
R4638 |
T6575 |
T6572 |
pobj |
level,at |
R4639 |
T6576 |
T6563 |
punct |
.,indicate |
R4640 |
T6577 |
T6580 |
nsubjpass |
Sox6,shown |
R4641 |
T6578 |
T6580 |
aux |
has,shown |
R4642 |
T6579 |
T6580 |
auxpass |
been,shown |
R4643 |
T6580 |
T6580 |
ROOT |
shown,shown |
R4644 |
T6581 |
T6582 |
aux |
to,act |
R4645 |
T6582 |
T6580 |
xcomp |
act,shown |
R4646 |
T6583 |
T6582 |
prep |
as,act |
R4647 |
T6584 |
T6585 |
det |
a,repressor |
R4648 |
T6585 |
T6583 |
pobj |
repressor,as |
R4649 |
T6586 |
T6582 |
cc |
and,act |
R4650 |
T6587 |
T6588 |
aux |
to,interact |
R4651 |
T6588 |
T6582 |
conj |
interact,act |
R4652 |
T6589 |
T6588 |
prep |
with,interact |
R4653 |
T6590 |
T6593 |
det |
a,co-repressor |
R4654 |
T6591 |
T6592 |
advmod |
widely,expressed |
R4655 |
T6592 |
T6593 |
amod |
expressed,co-repressor |
R4656 |
T6593 |
T6589 |
pobj |
co-repressor,with |
R4657 |
T6594 |
T6593 |
punct |
",",co-repressor |
R4658 |
T6595 |
T6593 |
appos |
CtBP2,co-repressor |
R4659 |
T6596 |
T6588 |
punct |
",",interact |
R4660 |
T6597 |
T6588 |
prep |
on,interact |
R4661 |
T6598 |
T6600 |
det |
the,promoter |
R4662 |
T6599 |
T6600 |
amod |
fgf-3,promoter |
R4663 |
T6600 |
T6597 |
pobj |
promoter,on |
R4664 |
T6601 |
T6603 |
nmod |
[,] |
R4665 |
T6602 |
T6601 |
nummod |
5,[ |
R4666 |
T6603 |
T6600 |
appos |
],promoter |
R4667 |
T6604 |
T6580 |
punct |
.,shown |
R4668 |
T6605 |
T6607 |
nsubjpass |
CtBP2,expressed |
R4669 |
T6606 |
T6607 |
auxpass |
is,expressed |
R4670 |
T6607 |
T6607 |
ROOT |
expressed,expressed |
R4671 |
T6608 |
T6607 |
prep |
in,expressed |
R4672 |
T6609 |
T6610 |
compound |
GM979,cells |
R4673 |
T6610 |
T6608 |
pobj |
cells,in |
R4674 |
T6611 |
T6613 |
punct |
(,data |
R4675 |
T6612 |
T6613 |
amod |
unpublished,data |
R4676 |
T6613 |
T6610 |
appos |
data,cells |
R4677 |
T6614 |
T6607 |
punct |
),expressed |
R4678 |
T6615 |
T6607 |
punct |
.,expressed |
R4679 |
T6616 |
T6617 |
aux |
To,investigate |
R4680 |
T6617 |
T6634 |
advcl |
investigate,introduced |
R4681 |
T6618 |
T6624 |
mark |
whether,required |
R4682 |
T6619 |
T6620 |
det |
the,interaction |
R4683 |
T6620 |
T6624 |
nsubjpass |
interaction,required |
R4684 |
T6621 |
T6620 |
prep |
with,interaction |
R4685 |
T6622 |
T6621 |
pobj |
CtBP2,with |
R4686 |
T6623 |
T6624 |
auxpass |
is,required |
R4687 |
T6624 |
T6617 |
ccomp |
required,investigate |
R4688 |
T6625 |
T6624 |
prep |
for,required |
R4689 |
T6626 |
T6627 |
amod |
Sox6,repression |
R4690 |
T6627 |
T6625 |
pobj |
repression,for |
R4691 |
T6628 |
T6627 |
prep |
of,repression |
R4692 |
T6629 |
T6631 |
det |
the,promoter |
R4693 |
T6630 |
T6631 |
amod |
ɛy,promoter |
R4694 |
T6631 |
T6628 |
pobj |
promoter,of |
R4695 |
T6632 |
T6634 |
punct |
",",introduced |
R4696 |
T6633 |
T6634 |
nsubj |
we,introduced |
R4697 |
T6634 |
T6634 |
ROOT |
introduced,introduced |
R4698 |
T6635 |
T6637 |
det |
a,mutation |
R4699 |
T6636 |
T6637 |
compound |
point,mutation |
R4700 |
T6637 |
T6634 |
dobj |
mutation,introduced |
R4701 |
T6638 |
T6637 |
punct |
(,mutation |
R4702 |
T6639 |
T6637 |
appos |
L386H,mutation |
R4703 |
T6640 |
T6637 |
punct |
),mutation |
R4704 |
T6641 |
T6634 |
prep |
in,introduced |
R4705 |
T6642 |
T6644 |
det |
the,protein |
R4706 |
T6643 |
T6644 |
amod |
Sox6,protein |
R4707 |
T6644 |
T6641 |
pobj |
protein,in |
R4708 |
T6645 |
T6649 |
nsubjpass |
that,reported |
R4709 |
T6646 |
T6649 |
aux |
has,reported |
R4710 |
T6647 |
T6649 |
auxpass |
been,reported |
R4711 |
T6648 |
T6649 |
advmod |
previously,reported |
R4712 |
T6649 |
T6644 |
relcl |
reported,protein |
R4713 |
T6650 |
T6651 |
aux |
to,be |
R4714 |
T6651 |
T6649 |
xcomp |
be,reported |
R4715 |
T6652 |
T6651 |
acomp |
sufficient,be |
R4716 |
T6653 |
T6654 |
aux |
to,abolish |
R4717 |
T6654 |
T6652 |
xcomp |
abolish,sufficient |
R4718 |
T6655 |
T6656 |
amod |
Sox6-CtBP2,interaction |
R4719 |
T6656 |
T6654 |
dobj |
interaction,abolish |
R4720 |
T6657 |
T6659 |
nmod |
[,] |
R4721 |
T6658 |
T6657 |
nummod |
5,[ |
R4722 |
T6659 |
T6644 |
appos |
],protein |
R4723 |
T6660 |
T6634 |
punct |
.,introduced |
R4724 |
T6661 |
T6664 |
det |
This,change |
R4725 |
T6662 |
T6664 |
amod |
amino,change |
R4726 |
T6663 |
T6664 |
compound |
acid,change |
R4727 |
T6664 |
T6665 |
nsubj |
change,is |
R4728 |
T6665 |
T6665 |
ROOT |
is,is |
R4729 |
T6666 |
T6665 |
neg |
not,is |
R4730 |
T6667 |
T6665 |
prep |
in,is |
R4731 |
T6668 |
T6672 |
det |
the,domain |
R4732 |
T6669 |
T6670 |
compound |
HMG,DNA |
R4733 |
T6670 |
T6672 |
compound |
DNA,domain |
R4734 |
T6671 |
T6672 |
amod |
binding,domain |
R4735 |
T6672 |
T6667 |
pobj |
domain,in |
R4736 |
T6673 |
T6665 |
punct |
.,is |
R4737 |
T6674 |
T6681 |
advmod |
However,retains |
R4738 |
T6675 |
T6681 |
punct |
",",retains |
R4739 |
T6676 |
T6678 |
det |
this,version |
R4740 |
T6677 |
T6678 |
amod |
mutant,version |
R4741 |
T6678 |
T6681 |
nsubj |
version,retains |
R4742 |
T6679 |
T6678 |
prep |
of,version |
R4743 |
T6680 |
T6679 |
pobj |
Sox6,of |
R4744 |
T6681 |
T6681 |
ROOT |
retains,retains |
R4745 |
T6682 |
T6683 |
det |
the,ability |
R4746 |
T6683 |
T6681 |
dobj |
ability,retains |
R4747 |
T6684 |
T6685 |
aux |
to,repress |
R4748 |
T6685 |
T6683 |
acl |
repress,ability |
R4749 |
T6686 |
T6688 |
det |
the,promoter |
R4750 |
T6687 |
T6688 |
amod |
ɛy,promoter |
R4751 |
T6688 |
T6685 |
dobj |
promoter,repress |
R4752 |
T6689 |
T6688 |
prep |
in,promoter |
R4753 |
T6690 |
T6692 |
det |
the,assay |
R4754 |
T6691 |
T6692 |
compound |
transfection,assay |
R4755 |
T6692 |
T6689 |
pobj |
assay,in |
R4756 |
T6693 |
T6695 |
punct |
(,2B |
R4757 |
T6694 |
T6695 |
compound |
Figure,2B |
R4758 |
T6695 |
T6692 |
appos |
2B,assay |
R4759 |
T6696 |
T6692 |
punct |
),assay |
R4760 |
T6697 |
T6681 |
punct |
",",retains |
R4761 |
T6698 |
T6681 |
advcl |
indicating,retains |
R4762 |
T6699 |
T6701 |
mark |
that,represses |
R4763 |
T6700 |
T6701 |
nsubj |
Sox6,represses |
R4764 |
T6701 |
T6698 |
ccomp |
represses,indicating |
R4765 |
T6702 |
T6704 |
det |
the,promoter |
R4766 |
T6703 |
T6704 |
amod |
ɛy,promoter |
R4767 |
T6704 |
T6701 |
dobj |
promoter,represses |
R4768 |
T6705 |
T6704 |
prep |
in,promoter |
R4769 |
T6706 |
T6708 |
det |
a,manner |
R4770 |
T6707 |
T6708 |
amod |
CtBP2-independent,manner |
R4771 |
T6708 |
T6705 |
pobj |
manner,in |
R4772 |
T6709 |
T6681 |
punct |
.,retains |
R4773 |
T6710 |
T6711 |
compound |
Deletion,analysis |
R4774 |
T6711 |
T6723 |
nsubj |
analysis,defined |
R4775 |
T6712 |
T6711 |
prep |
of,analysis |
R4776 |
T6713 |
T6715 |
det |
the,promoter |
R4777 |
T6714 |
T6715 |
amod |
ɛy,promoter |
R4778 |
T6715 |
T6712 |
pobj |
promoter,of |
R4779 |
T6716 |
T6711 |
punct |
",",analysis |
R4780 |
T6717 |
T6718 |
mark |
as,shown |
R4781 |
T6718 |
T6711 |
advcl |
shown,analysis |
R4782 |
T6719 |
T6718 |
prep |
in,shown |
R4783 |
T6720 |
T6719 |
pobj |
Figure,in |
R4784 |
T6721 |
T6720 |
nummod |
2C,Figure |
R4785 |
T6722 |
T6723 |
punct |
",",defined |
R4786 |
T6723 |
T6723 |
ROOT |
defined,defined |
R4787 |
T6724 |
T6725 |
det |
a,region |
R4788 |
T6725 |
T6723 |
dobj |
region,defined |
R4789 |
T6726 |
T6727 |
punct |
(,− |
R4790 |
T6727 |
T6728 |
amod |
−,63 |
R4791 |
T6728 |
T6723 |
npadvmod |
63,defined |
R4792 |
T6729 |
T6728 |
prep |
to,63 |
R4793 |
T6730 |
T6729 |
pobj |
−,to |
R4794 |
T6731 |
T6730 |
appos |
37,− |
R4795 |
T6732 |
T6730 |
punct |
),− |
R4796 |
T6733 |
T6729 |
prep |
within,to |
R4797 |
T6734 |
T6737 |
det |
the,promoter |
R4798 |
T6735 |
T6737 |
amod |
ɛy,promoter |
R4799 |
T6736 |
T6737 |
amod |
proximal,promoter |
R4800 |
T6737 |
T6733 |
pobj |
promoter,within |
R4801 |
T6738 |
T6739 |
nsubj |
that,is |
R4802 |
T6739 |
T6737 |
relcl |
is,promoter |
R4803 |
T6740 |
T6739 |
acomp |
critical,is |
R4804 |
T6741 |
T6740 |
prep |
for,critical |
R4805 |
T6742 |
T6743 |
amod |
Sox6,repression |
R4806 |
T6743 |
T6741 |
pobj |
repression,for |
R4807 |
T6744 |
T6723 |
punct |
.,defined |
R4808 |
T6745 |
T6750 |
nsubj |
Analysis,reveals |
R4809 |
T6746 |
T6745 |
prep |
of,Analysis |
R4810 |
T6747 |
T6749 |
det |
this,region |
R4811 |
T6748 |
T6749 |
amod |
short,region |
R4812 |
T6749 |
T6746 |
pobj |
region,of |
R4813 |
T6750 |
T6750 |
ROOT |
reveals,reveals |
R4814 |
T6751 |
T6755 |
nummod |
two,sites |
R4815 |
T6752 |
T6755 |
amod |
Sox/Sox6,sites |
R4816 |
T6753 |
T6755 |
nmod |
consensus,sites |
R4817 |
T6754 |
T6755 |
amod |
binding,sites |
R4818 |
T6755 |
T6750 |
dobj |
sites,reveals |
R4819 |
T6756 |
T6758 |
nmod |
[,] |
R4820 |
T6757 |
T6758 |
nummod |
5,] |
R4821 |
T6758 |
T6761 |
compound |
],3A |
R4822 |
T6759 |
T6760 |
punct |
(,Figure |
R4823 |
T6760 |
T6761 |
compound |
Figure,3A |
R4824 |
T6761 |
T6750 |
oprd |
3A,reveals |
R4825 |
T6762 |
T6750 |
punct |
),reveals |
R4826 |
T6763 |
T6750 |
punct |
.,reveals |
R488 |
T720 |
T722 |
det |
the,promoter |
R489 |
T721 |
T722 |
amod |
ɛy,promoter |
R490 |
T722 |
T719 |
pobj |
promoter,to |
R491 |
T723 |
T709 |
punct |
.,demonstrate |
R492 |
T724 |
T726 |
det |
The,expression |
R493 |
T725 |
T726 |
amod |
normal,expression |
R494 |
T726 |
T744 |
nsubj |
expression,demonstrate |
R495 |
T727 |
T726 |
prep |
of,expression |
R496 |
T728 |
T727 |
pobj |
Sox6,of |
R497 |
T729 |
T726 |
prep |
in,expression |
R498 |
T730 |
T732 |
amod |
wild-type,liver |
R499 |
T731 |
T732 |
amod |
fetal,liver |
R500 |
T732 |
T729 |
pobj |
liver,in |
R501 |
T733 |
T732 |
cc |
and,liver |
R502 |
T734 |
T736 |
det |
the,expression |
R503 |
T735 |
T736 |
amod |
ectopic,expression |
R504 |
T736 |
T732 |
conj |
expression,liver |
R505 |
T737 |
T736 |
prep |
of,expression |
R506 |
T738 |
T737 |
pobj |
ɛy,of |
R507 |
T739 |
T738 |
prep |
in,ɛy |
R508 |
T740 |
T743 |
amod |
p100H,liver |
R509 |
T741 |
T743 |
amod |
homozygous,liver |
R510 |
T742 |
T743 |
amod |
fetal,liver |
R511 |
T743 |
T739 |
pobj |
liver,in |
R512 |
T744 |
T744 |
ROOT |
demonstrate,demonstrate |
R513 |
T745 |
T744 |
dobj |
that,demonstrate |
R514 |
T746 |
T747 |
amod |
Sox6,functions |
R515 |
T747 |
T745 |
conj |
functions,that |
R516 |
T748 |
T747 |
prep |
in,functions |
R517 |
T749 |
T750 |
amod |
definitive,erythropoiesis |
R518 |
T750 |
T748 |
pobj |
erythropoiesis,in |
R519 |
T751 |
T744 |
punct |
.,demonstrate |
R520 |
T752 |
T754 |
det |
The,study |
R521 |
T753 |
T754 |
amod |
present,study |
R522 |
T754 |
T755 |
nsubj |
study,shows |
R523 |
T755 |
T755 |
ROOT |
shows,shows |
R524 |
T756 |
T759 |
mark |
that,required |
R525 |
T757 |
T759 |
nsubjpass |
Sox6,required |
R526 |
T758 |
T759 |
auxpass |
is,required |
R527 |
T759 |
T755 |
ccomp |
required,shows |
R528 |
T760 |
T759 |
prep |
for,required |
R529 |
T761 |
T760 |
pcomp |
silencing,for |
R530 |
T762 |
T761 |
prep |
of,silencing |
R531 |
T763 |
T764 |
amod |
ɛy,globin |
R532 |
T764 |
T762 |
pobj |
globin,of |
R533 |
T765 |
T761 |
prep |
in,silencing |
R534 |
T766 |
T767 |
amod |
definitive,erythropoiesis |
R535 |
T767 |
T765 |
pobj |
erythropoiesis,in |
R536 |
T768 |
T759 |
cc |
and,required |
R537 |
T769 |
T755 |
conj |
suggests,shows |
R538 |
T770 |
T771 |
det |
a,role |
R539 |
T771 |
T769 |
dobj |
role,suggests |
R540 |
T772 |
T771 |
prep |
for,role |
R541 |
T773 |
T772 |
pobj |
Sox6,for |
R542 |
T774 |
T771 |
prep |
in,role |
R543 |
T775 |
T777 |
amod |
erythroid,maturation |
R544 |
T776 |
T777 |
compound |
cell,maturation |
R545 |
T777 |
T774 |
pobj |
maturation,in |
R546 |
T778 |
T755 |
punct |
.,shows |
R547 |
T779 |
T787 |
advmod |
Thus,provide |
R548 |
T780 |
T787 |
punct |
",",provide |
R549 |
T781 |
T782 |
amod |
Sox6,regulation |
R550 |
T782 |
T787 |
nsubj |
regulation,provide |
R551 |
T783 |
T782 |
prep |
of,regulation |
R552 |
T784 |
T785 |
amod |
ɛy,globin |
R553 |
T785 |
T783 |
pobj |
globin,of |
R554 |
T786 |
T787 |
aux |
might,provide |
R555 |
T787 |
T787 |
ROOT |
provide,provide |
R556 |
T788 |
T789 |
det |
a,novel |
R557 |
T789 |
T787 |
dobj |
novel,provide |
R558 |
T790 |
T791 |
amod |
therapeutical,target |
R559 |
T791 |
T789 |
appos |
target,novel |
R560 |
T792 |
T787 |
prep |
in,provide |
R5604 |
T8230 |
T8230 |
ROOT |
corresponds,corresponds |
R5605 |
T8231 |
T8230 |
prep |
to,corresponds |
R5606 |
T8232 |
T8234 |
det |
the,region |
R5607 |
T8233 |
T8234 |
amod |
critical,region |
R5608 |
T8234 |
T8231 |
pobj |
region,to |
R5609 |
T8140 |
T8155 |
nsubj |
EMSA,repress |
R561 |
T793 |
T794 |
det |
the,treatment |
R5610 |
T8141 |
T8140 |
cc |
and,EMSA |
R5611 |
T8142 |
T8144 |
compound |
ChIP,Show |
R5612 |
T8235 |
T8234 |
prep |
of,region |
R5613 |
T8143 |
T8144 |
compound |
Assays,Show |
R5614 |
T8144 |
T8140 |
conj |
Show,EMSA |
R5615 |
T8145 |
T8148 |
mark |
that,Binds |
R5616 |
T8236 |
T8238 |
det |
the,promoter |
R5617 |
T8146 |
T8148 |
nsubj |
Sox6,Binds |
R5618 |
T8147 |
T8148 |
advmod |
Directly,Binds |
R5619 |
T8148 |
T8155 |
advcl |
Binds,repress |
R562 |
T794 |
T792 |
pobj |
treatment,in |
R5620 |
T8149 |
T8148 |
prep |
to,Binds |
R5621 |
T8237 |
T8238 |
amod |
ɛy,promoter |
R5622 |
T8150 |
T8151 |
det |
the,ɛy |
R5623 |
T8151 |
T8155 |
nsubj |
ɛy,repress |
R5624 |
T8152 |
T8153 |
compound |
Promoter,Sox6 |
R5625 |
T8153 |
T8151 |
appos |
Sox6,ɛy |
R5626 |
T8238 |
T8235 |
pobj |
promoter,of |
R5627 |
T8154 |
T8155 |
aux |
might,repress |
R5628 |
T8155 |
T8155 |
ROOT |
repress,repress |
R5629 |
T8239 |
T8238 |
acl |
defined,promoter |
R563 |
T795 |
T794 |
prep |
of,treatment |
R5630 |
T8156 |
T8158 |
det |
the,promoter |
R5631 |
T8157 |
T8158 |
amod |
ɛy,promoter |
R5632 |
T8158 |
T8155 |
dobj |
promoter,repress |
R5633 |
T8240 |
T8239 |
prep |
in,defined |
R5634 |
T8159 |
T8155 |
punct |
",",repress |
R5635 |
T8160 |
T8161 |
preconj |
either,through |
R5636 |
T8161 |
T8155 |
prep |
through,repress |
R5637 |
T8162 |
T8164 |
amod |
direct,contact |
R5638 |
T8241 |
T8244 |
poss |
our,analyses |
R5639 |
T8163 |
T8164 |
amod |
physical,contact |
R564 |
T796 |
T795 |
pobj |
hemoglobinopathies,of |
R5640 |
T8164 |
T8161 |
pobj |
contact,through |
R5641 |
T8165 |
T8164 |
prep |
with,contact |
R5642 |
T8242 |
T8243 |
compound |
promoter,deletion |
R5643 |
T8166 |
T8167 |
det |
the,promoter |
R5644 |
T8167 |
T8165 |
pobj |
promoter,with |
R5645 |
T8168 |
T8165 |
cc |
or,with |
R5646 |
T8243 |
T8244 |
compound |
deletion,analyses |
R5647 |
T8169 |
T8155 |
prep |
by,repress |
R5648 |
T8170 |
T8169 |
pcomp |
regulating,by |
R5649 |
T8171 |
T8170 |
dobj |
intermediates,regulating |
R565 |
T797 |
T798 |
amod |
such,as |
R5650 |
T8244 |
T8240 |
pobj |
analyses,in |
R5651 |
T8172 |
T8171 |
acl |
affecting,intermediates |
R5652 |
T8173 |
T8175 |
det |
the,promoter |
R5653 |
T8245 |
T8230 |
punct |
.,corresponds |
R5654 |
T8174 |
T8175 |
amod |
ɛy,promoter |
R5655 |
T8175 |
T8172 |
dobj |
promoter,affecting |
R5656 |
T8176 |
T8155 |
punct |
.,repress |
R5657 |
T8177 |
T8178 |
aux |
To,investigate |
R5658 |
T8178 |
T8191 |
advcl |
investigate,performed |
R5659 |
T8179 |
T8183 |
mark |
whether,associated |
R566 |
T798 |
T796 |
prep |
as,hemoglobinopathies |
R5660 |
T8180 |
T8183 |
nsubjpass |
Sox6,associated |
R5661 |
T8181 |
T8183 |
auxpass |
is,associated |
R5662 |
T8246 |
T8247 |
det |
This,probe |
R5663 |
T8182 |
T8183 |
advmod |
directly,associated |
R5664 |
T8183 |
T8178 |
ccomp |
associated,investigate |
R5665 |
T8184 |
T8183 |
prep |
with,associated |
R5666 |
T8185 |
T8187 |
det |
the,promoter |
R5667 |
T8247 |
T8248 |
nsubj |
probe,contains |
R5668 |
T8186 |
T8187 |
amod |
ɛy,promoter |
R5669 |
T8187 |
T8184 |
pobj |
promoter,with |
R567 |
T799 |
T800 |
compound |
sickle,cell |
R5670 |
T8188 |
T8191 |
punct |
",",performed |
R5671 |
T8189 |
T8191 |
nsubj |
we,performed |
R5672 |
T8248 |
T8248 |
ROOT |
contains,contains |
R5673 |
T8190 |
T8191 |
advmod |
first,performed |
R5674 |
T8191 |
T8191 |
ROOT |
performed,performed |
R5675 |
T8192 |
T8194 |
amod |
electrophoretic,shift |
R5676 |
T8193 |
T8194 |
compound |
mobility,shift |
R5677 |
T8194 |
T8195 |
compound |
shift,assays |
R5678 |
T8195 |
T8191 |
dobj |
assays,performed |
R5679 |
T8249 |
T8253 |
nummod |
two,sites |
R568 |
T800 |
T801 |
compound |
cell,anemia |
R5680 |
T8196 |
T8195 |
punct |
(,assays |
R5681 |
T8197 |
T8195 |
appos |
EMSA,assays |
R5682 |
T8198 |
T8195 |
punct |
),assays |
R5683 |
T8199 |
T8191 |
advcl |
using,performed |
R5684 |
T8200 |
T8202 |
det |
a,Sox6 |
R5685 |
T8250 |
T8253 |
compound |
consensus,sites |
R5686 |
T8201 |
T8202 |
amod |
c-Myc-tagged,Sox6 |
R5687 |
T8251 |
T8253 |
nmod |
Sox/Sox6,sites |
R5688 |
T8202 |
T8199 |
dobj |
Sox6,using |
R5689 |
T8203 |
T8199 |
prep |
in,using |
R569 |
T801 |
T798 |
pobj |
anemia,as |
R5690 |
T8204 |
T8207 |
det |
a,transcription/translation |
R5691 |
T8252 |
T8253 |
amod |
binding,sites |
R5692 |
T8205 |
T8207 |
nmod |
reticulocyte,transcription/translation |
R5693 |
T8206 |
T8207 |
amod |
lysate-based,transcription/translation |
R5694 |
T8207 |
T8203 |
pobj |
transcription/translation,in |
R5695 |
T8253 |
T8248 |
dobj |
sites,contains |
R5696 |
T8208 |
T8207 |
prep |
in,transcription/translation |
R5697 |
T8209 |
T8210 |
amod |
vitro,system |
R5698 |
T8254 |
T8248 |
punct |
.,contains |
R5699 |
T8210 |
T8208 |
pobj |
system,in |
R570 |
T802 |
T801 |
cc |
and,anemia |
R5700 |
T8211 |
T8191 |
punct |
.,performed |
R5701 |
T8255 |
T8256 |
advmod |
Also,included |
R5702 |
T8212 |
T8213 |
det |
The,probes |
R5703 |
T8213 |
T8216 |
nsubjpass |
probes,listed |
R5704 |
T8214 |
T8213 |
acl |
used,probes |
R5705 |
T8215 |
T8216 |
auxpass |
are,listed |
R5706 |
T8216 |
T8216 |
ROOT |
listed,listed |
R5707 |
T8217 |
T8216 |
prep |
in,listed |
R5708 |
T8256 |
T8256 |
ROOT |
included,included |
R5709 |
T8218 |
T8219 |
compound |
Figure,3A |
R571 |
T803 |
T801 |
conj |
thalassemia,anemia |
R5710 |
T8219 |
T8217 |
pobj |
3A,in |
R5711 |
T8220 |
T8216 |
punct |
.,listed |
R5712 |
T8257 |
T8256 |
prep |
in,included |
R5713 |
T8221 |
T8224 |
det |
The,pair |
R5714 |
T8222 |
T8223 |
nummod |
36,base |
R5715 |
T8223 |
T8224 |
compound |
base,pair |
R5716 |
T8258 |
T8259 |
poss |
our,EMSA |
R5717 |
T8224 |
T8224 |
ROOT |
pair,pair |
R5718 |
T8225 |
T8224 |
punct |
(,pair |
R5719 |
T8226 |
T8224 |
appos |
bp,pair |
R572 |
T804 |
T787 |
punct |
.,provide |
R5720 |
T8259 |
T8257 |
pobj |
EMSA,in |
R5721 |
T8227 |
T8224 |
punct |
),pair |
R5722 |
T8228 |
T8229 |
compound |
WT,probe |
R5723 |
T8229 |
T8230 |
nsubj |
probe,corresponds |
R5724 |
T8260 |
T8256 |
auxpass |
are,included |
R5725 |
T8261 |
T8263 |
nummod |
three,probes |
R5726 |
T8262 |
T8263 |
amod |
mutated,probes |
R5727 |
T8263 |
T8256 |
nsubjpass |
probes,included |
R5728 |
T8327 |
T8323 |
pobj |
protein,by |
R5729 |
T8264 |
T8265 |
nsubj |
that,are |
R5730 |
T8328 |
T8322 |
punct |
.,shifted |
R5731 |
T8329 |
T8336 |
advmod |
Moreover,supershift |
R5732 |
T8330 |
T8336 |
punct |
",",supershift |
R5733 |
T8265 |
T8263 |
relcl |
are,probes |
R5734 |
T8331 |
T8332 |
preconj |
both,c-Myc |
R5735 |
T8332 |
T8336 |
nsubj |
c-Myc,supershift |
R5736 |
T8266 |
T8265 |
punct |
",",are |
R5737 |
T8333 |
T8332 |
cc |
and,c-Myc |
R5738 |
T8334 |
T8332 |
conj |
Sox6,c-Myc |
R5739 |
T8335 |
T8332 |
conj |
antibodies,c-Myc |
R5740 |
T8267 |
T8268 |
preconj |
either,truncated |
R5741 |
T8336 |
T8336 |
ROOT |
supershift,supershift |
R5742 |
T8337 |
T8338 |
det |
the,band |
R5743 |
T8268 |
T8265 |
acomp |
truncated,are |
R5744 |
T8338 |
T8336 |
dobj |
band,supershift |
R5745 |
T8339 |
T8336 |
punct |
",",supershift |
R5746 |
T8340 |
T8336 |
advcl |
indicating,supershift |
R5747 |
T8269 |
T8268 |
punct |
(,truncated |
R5748 |
T8341 |
T8344 |
mark |
that,is |
R5749 |
T8342 |
T8343 |
det |
the,binding |
R5750 |
T8343 |
T8344 |
nsubj |
binding,is |
R5751 |
T8270 |
T8268 |
npadvmod |
M1,truncated |
R5752 |
T8344 |
T8340 |
ccomp |
is,indicating |
R5753 |
T8345 |
T8344 |
acomp |
Sox6-specific,is |
R5754 |
T8346 |
T8336 |
punct |
.,supershift |
R5755 |
T8347 |
T8348 |
aux |
To,rule |
R5756 |
T8348 |
T8366 |
advcl |
rule,used |
R5757 |
T8349 |
T8348 |
prt |
out,rule |
R5758 |
T8271 |
T8268 |
punct |
),truncated |
R5759 |
T8350 |
T8351 |
det |
the,possibility |
R5760 |
T8351 |
T8348 |
dobj |
possibility,rule |
R5761 |
T8352 |
T8357 |
mark |
that,binds |
R5762 |
T8272 |
T8265 |
punct |
",",are |
R5763 |
T8353 |
T8355 |
det |
the,tag |
R5764 |
T8354 |
T8355 |
amod |
c-Myc,tag |
R5765 |
T8355 |
T8357 |
nsubj |
tag,binds |
R5766 |
T8273 |
T8265 |
cc |
or,are |
R5767 |
T8356 |
T8355 |
appos |
itself,tag |
R5768 |
T8357 |
T8351 |
acl |
binds,possibility |
R5769 |
T8274 |
T8265 |
conj |
mutated,are |
R5770 |
T8275 |
T8274 |
punct |
(,mutated |
R5771 |
T8358 |
T8357 |
prep |
to,binds |
R5772 |
T8276 |
T8274 |
dobj |
M2,mutated |
R5773 |
T8359 |
T8360 |
det |
the,probe |
R5774 |
T8360 |
T8358 |
pobj |
probe,to |
R5775 |
T8361 |
T8366 |
punct |
",",used |
R5776 |
T8277 |
T8276 |
cc |
and,M2 |
R5777 |
T8362 |
T8364 |
det |
an,Sox6 |
R5778 |
T8363 |
T8364 |
amod |
HA-tagged,Sox6 |
R5779 |
T8364 |
T8366 |
nsubjpass |
Sox6,used |
R5780 |
T8278 |
T8276 |
conj |
M3,M2 |
R5781 |
T8365 |
T8366 |
auxpass |
was,used |
R5782 |
T8366 |
T8366 |
ROOT |
used,used |
R5783 |
T8279 |
T8276 |
punct |
),M2 |
R5784 |
T8367 |
T8366 |
prep |
in,used |
R5785 |
T8368 |
T8369 |
det |
another,EMSA |
R5786 |
T8369 |
T8367 |
pobj |
EMSA,in |
R5787 |
T8280 |
T8274 |
prep |
in,mutated |
R5788 |
T8370 |
T8371 |
nsubj |
that,confirmed |
R5789 |
T8371 |
T8366 |
ccomp |
confirmed,used |
R5790 |
T8372 |
T8373 |
det |
these,results |
R5791 |
T8281 |
T8280 |
pobj |
Sox/Sox6,in |
R5792 |
T8373 |
T8371 |
dobj |
results,confirmed |
R5793 |
T8374 |
T8376 |
punct |
(,3C |
R5794 |
T8375 |
T8376 |
compound |
Figure,3C |
R5795 |
T8282 |
T8283 |
amod |
binding,sites |
R5796 |
T8376 |
T8373 |
appos |
3C,results |
R5797 |
T8377 |
T8376 |
punct |
),3C |
R5798 |
T8378 |
T8366 |
punct |
.,used |
R5799 |
T8283 |
T8280 |
pobj |
sites,in |
R5800 |
T8379 |
T8382 |
advmod |
Next,extracts |
R5801 |
T8380 |
T8382 |
punct |
",",extracts |
R5802 |
T8284 |
T8286 |
punct |
(,3A |
R5803 |
T8381 |
T8382 |
amod |
nuclear,extracts |
R5804 |
T8382 |
T8387 |
nsubjpass |
extracts,used |
R5805 |
T8383 |
T8382 |
prep |
from,extracts |
R5806 |
T8384 |
T8385 |
compound |
MEL,cells |
R5807 |
T8385 |
T8383 |
pobj |
cells,from |
R5808 |
T8386 |
T8387 |
auxpass |
were,used |
R5809 |
T8387 |
T8387 |
ROOT |
used,used |
R5810 |
T8285 |
T8286 |
compound |
Figure,3A |
R5811 |
T8388 |
T8387 |
prep |
in,used |
R5812 |
T8389 |
T8388 |
pobj |
EMSA,in |
R5813 |
T8390 |
T8387 |
advcl |
employing,used |
R5814 |
T8286 |
T8274 |
npadvmod |
3A,mutated |
R5815 |
T8391 |
T8394 |
det |
the,probe |
R5816 |
T8392 |
T8394 |
amod |
same,probe |
R5817 |
T8393 |
T8394 |
amod |
36-bp,probe |
R5818 |
T8287 |
T8263 |
punct |
),probes |
R5819 |
T8394 |
T8390 |
dobj |
probe,employing |
R5820 |
T8395 |
T8387 |
punct |
.,used |
R5821 |
T8396 |
T8397 |
compound |
MEL,cells |
R5822 |
T8288 |
T8256 |
punct |
.,included |
R5823 |
T8397 |
T8397 |
ROOT |
cells,cells |
R5824 |
T8398 |
T8397 |
punct |
",",cells |
R5825 |
T8399 |
T8403 |
det |
a,line |
R5826 |
T8289 |
T8290 |
nsubj |
Sox6,is |
R5827 |
T8400 |
T8403 |
amod |
murine,line |
R5828 |
T8401 |
T8402 |
compound |
erythroleukemic,cell |
R5829 |
T8402 |
T8403 |
compound |
cell,line |
R5830 |
T8290 |
T8290 |
ROOT |
is,is |
R5831 |
T8403 |
T8397 |
appos |
line,cells |
R5832 |
T8404 |
T8403 |
punct |
",",line |
R5833 |
T8405 |
T8408 |
amod |
express,globins |
R5834 |
T8291 |
T8290 |
acomp |
able,is |
R5835 |
T8406 |
T8408 |
compound |
adult,globins |
R5836 |
T8407 |
T8408 |
compound |
β,globins |
R5837 |
T8408 |
T8403 |
conj |
globins,line |
R5838 |
T8292 |
T8294 |
aux |
to,associate |
R5839 |
T8409 |
T8408 |
punct |
",",globins |
R5840 |
T8410 |
T8408 |
cc |
but,globins |
R5841 |
T8411 |
T8412 |
neg |
not,ɛy |
R5842 |
T8293 |
T8294 |
advmod |
physically,associate |
R5843 |
T8412 |
T8408 |
conj |
ɛy,globins |
R5844 |
T8413 |
T8415 |
nmod |
[,] |
R5845 |
T8414 |
T8415 |
nummod |
33,] |
R5846 |
T8294 |
T8291 |
xcomp |
associate,able |
R5847 |
T8415 |
T8415 |
ROOT |
],] |
R5848 |
T8416 |
T8415 |
punct |
.,] |
R5849 |
T8417 |
T8419 |
amod |
Sox6,binds |
R5850 |
T8295 |
T8294 |
prep |
with,associate |
R5851 |
T8418 |
T8419 |
advmod |
directly,binds |
R5852 |
T8419 |
T8419 |
ROOT |
binds,binds |
R5853 |
T8420 |
T8419 |
prep |
to,binds |
R5854 |
T8296 |
T8298 |
det |
the,region |
R5855 |
T8421 |
T8423 |
det |
this,sequence |
R5856 |
T8422 |
T8423 |
compound |
DNA,sequence |
R5857 |
T8423 |
T8420 |
pobj |
sequence,to |
R5858 |
T8297 |
T8298 |
amod |
36-bp,region |
R5859 |
T8298 |
T8295 |
pobj |
region,with |
R5860 |
T8424 |
T8423 |
prep |
in,sequence |
R5861 |
T8299 |
T8301 |
punct |
(,3B |
R5862 |
T8300 |
T8301 |
compound |
Figure,3B |
R5863 |
T8425 |
T8426 |
compound |
MEL,cells |
R5864 |
T8301 |
T8298 |
appos |
3B,region |
R5865 |
T8426 |
T8424 |
pobj |
cells,in |
R5866 |
T8302 |
T8298 |
punct |
),region |
R5867 |
T8427 |
T8428 |
punct |
(,Figure |
R5868 |
T8428 |
T8426 |
appos |
Figure,cells |
R5869 |
T8303 |
T8294 |
prep |
within,associate |
R5870 |
T8429 |
T8428 |
nummod |
3D,Figure |
R5871 |
T8430 |
T8428 |
punct |
),Figure |
R5872 |
T8431 |
T8419 |
punct |
.,binds |
R5873 |
T8304 |
T8306 |
det |
the,promoter |
R5874 |
T8432 |
T8434 |
det |
The,consensus |
R5875 |
T8433 |
T8434 |
amod |
intact,consensus |
R5876 |
T8434 |
T8434 |
ROOT |
consensus,consensus |
R5877 |
T8305 |
T8306 |
amod |
ɛy,promoter |
R5878 |
T8435 |
T8434 |
appos |
Sox/Sox6,consensus |
R5879 |
T8306 |
T8303 |
pobj |
promoter,within |
R5880 |
T8436 |
T8437 |
amod |
binding,sites |
R5881 |
T8307 |
T8306 |
acl |
defined,promoter |
R5882 |
T8437 |
T8443 |
nsubjpass |
sites,required |
R5883 |
T8438 |
T8437 |
prep |
of,sites |
R5884 |
T8308 |
T8307 |
agent |
by,defined |
R5885 |
T8439 |
T8441 |
det |
the,probe |
R5886 |
T8440 |
T8441 |
compound |
DNA,probe |
R5887 |
T8309 |
T8312 |
det |
the,experiments |
R5888 |
T8441 |
T8438 |
pobj |
probe,of |
R5889 |
T8442 |
T8443 |
auxpass |
are,required |
R5890 |
T8443 |
T8434 |
relcl |
required,consensus |
R5891 |
T8310 |
T8312 |
compound |
deletion,experiments |
R5892 |
T8444 |
T8443 |
prep |
for,required |
R5893 |
T8445 |
T8446 |
det |
the,binding |
R5894 |
T8311 |
T8312 |
compound |
analysis,experiments |
R5895 |
T8446 |
T8444 |
pobj |
binding,for |
R5896 |
T8447 |
T8443 |
punct |
",",required |
R5897 |
T8312 |
T8308 |
pobj |
experiments,by |
R5898 |
T8448 |
T8449 |
mark |
as,shown |
R5899 |
T8449 |
T8443 |
advcl |
shown,required |
R5900 |
T8450 |
T8449 |
prep |
in,shown |
R5901 |
T8313 |
T8314 |
punct |
(,Figure |
R5902 |
T8451 |
T8453 |
det |
the,assay |
R5903 |
T8452 |
T8453 |
compound |
competition,assay |
R5904 |
T8314 |
T8312 |
appos |
Figure,experiments |
R5905 |
T8453 |
T8450 |
pobj |
assay,in |
R5906 |
T8454 |
T8455 |
punct |
(,Figure |
R5907 |
T8455 |
T8453 |
appos |
Figure,assay |
R5908 |
T8456 |
T8455 |
nummod |
3E,Figure |
R5909 |
T8457 |
T8455 |
punct |
),Figure |
R5910 |
T8458 |
T8443 |
punct |
.,required |
R5911 |
T8459 |
T8470 |
nsubj |
Ablation,abolish |
R5912 |
T8315 |
T8314 |
nummod |
2C,Figure |
R5913 |
T8460 |
T8459 |
prep |
of,Ablation |
R5914 |
T8461 |
T8464 |
amod |
putative,sites |
R5915 |
T8462 |
T8464 |
nmod |
Sox/Sox6,sites |
R5916 |
T8316 |
T8314 |
punct |
),Figure |
R5917 |
T8463 |
T8464 |
amod |
binding,sites |
R5918 |
T8464 |
T8460 |
pobj |
sites,of |
R5919 |
T8317 |
T8290 |
punct |
.,is |
R5920 |
T8465 |
T8464 |
punct |
(,sites |
R5921 |
T8466 |
T8464 |
appos |
M1,sites |
R5922 |
T8467 |
T8466 |
cc |
and,M1 |
R5923 |
T8468 |
T8466 |
conj |
M3,M1 |
R5924 |
T8318 |
T8320 |
det |
The,probe |
R5925 |
T8469 |
T8464 |
punct |
),sites |
R5926 |
T8470 |
T8470 |
ROOT |
abolish,abolish |
R5927 |
T8319 |
T8320 |
compound |
36-bp,probe |
R5928 |
T8471 |
T8472 |
poss |
their,ability |
R5929 |
T8472 |
T8470 |
dobj |
ability,abolish |
R5930 |
T8473 |
T8474 |
aux |
to,compete |
R5931 |
T8320 |
T8322 |
nsubjpass |
probe,shifted |
R5932 |
T8474 |
T8472 |
acl |
compete,ability |
R5933 |
T8475 |
T8474 |
prep |
in,compete |
R5934 |
T8476 |
T8475 |
pobj |
EMSA,in |
R5935 |
T8321 |
T8322 |
auxpass |
was,shifted |
R5936 |
T8477 |
T8479 |
punct |
(,3E |
R5937 |
T8478 |
T8479 |
compound |
Figure,3E |
R5938 |
T8479 |
T8476 |
appos |
3E,EMSA |
R5939 |
T8322 |
T8322 |
ROOT |
shifted,shifted |
R5940 |
T8480 |
T8479 |
punct |
),3E |
R5941 |
T8481 |
T8470 |
punct |
.,abolish |
R5942 |
T8482 |
T8485 |
det |
The,probe |
R5943 |
T8323 |
T8322 |
agent |
by,shifted |
R5944 |
T8483 |
T8485 |
compound |
M2,probe |
R5945 |
T8484 |
T8485 |
amod |
mutant,probe |
R5946 |
T8485 |
T8487 |
nsubj |
probe,compete |
R5947 |
T8324 |
T8327 |
det |
the,protein |
R5948 |
T8486 |
T8487 |
aux |
may,compete |
R5949 |
T8487 |
T8487 |
ROOT |
compete,compete |
R5950 |
T8488 |
T8487 |
advmod |
partially,compete |
R5951 |
T8325 |
T8327 |
amod |
tagged,protein |
R5952 |
T8489 |
T8487 |
prep |
with,compete |
R5953 |
T8490 |
T8489 |
pobj |
WT,with |
R5954 |
T8491 |
T8487 |
advcl |
binding,compete |
R5955 |
T8326 |
T8327 |
compound |
Sox6,protein |
R5956 |
T8492 |
T8487 |
punct |
.,compete |
R5957 |
T8493 |
T8494 |
aux |
To,investigate |
R5958 |
T8494 |
T8516 |
advcl |
investigate,co-transfected |
R5959 |
T8495 |
T8497 |
det |
the,significance |
R5960 |
T8496 |
T8497 |
amod |
functional,significance |
R5961 |
T8497 |
T8494 |
dobj |
significance,investigate |
R5962 |
T8521 |
T8517 |
pobj |
vector,with |
R5963 |
T8498 |
T8497 |
prep |
of,significance |
R5964 |
T8499 |
T8503 |
det |
the,sites |
R5965 |
T8500 |
T8503 |
amod |
intact,sites |
R5966 |
T8522 |
T8521 |
prep |
into,vector |
R5967 |
T8501 |
T8503 |
nmod |
Sox/Sox6,sites |
R5968 |
T8502 |
T8503 |
amod |
binding,sites |
R5969 |
T8503 |
T8498 |
pobj |
sites,of |
R5970 |
T8523 |
T8524 |
compound |
GM979,cells |
R5971 |
T8504 |
T8503 |
punct |
",",sites |
R5972 |
T8505 |
T8508 |
det |
the,reporter |
R5973 |
T8506 |
T8508 |
amod |
ɛy,reporter |
R5974 |
T8524 |
T8522 |
pobj |
cells,into |
R5975 |
T8507 |
T8508 |
compound |
promoter,reporter |
R5976 |
T8508 |
T8509 |
nsubj |
reporter,constructs |
R5977 |
T8509 |
T8494 |
dobj |
constructs,investigate |
R5978 |
T8525 |
T8516 |
punct |
.,co-transfected |
R5979 |
T8510 |
T8509 |
prep |
with,constructs |
R5980 |
T8511 |
T8512 |
compound |
mutagenized,Sox/Sox6 |
R5981 |
T8512 |
T8514 |
nmod |
Sox/Sox6,sites |
R5982 |
T8526 |
T8537 |
advmod |
Consistent,constructs |
R5983 |
T8513 |
T8514 |
amod |
binding,sites |
R5984 |
T8514 |
T8510 |
pobj |
sites,with |
R5985 |
T8527 |
T8526 |
prep |
with,Consistent |
R5986 |
T8515 |
T8516 |
auxpass |
were,co-transfected |
R5987 |
T8528 |
T8530 |
det |
the,results |
R5988 |
T8516 |
T8516 |
ROOT |
co-transfected,co-transfected |
R5989 |
T8517 |
T8516 |
prep |
with,co-transfected |
R5990 |
T8529 |
T8530 |
compound |
EMSA,results |
R5991 |
T8518 |
T8521 |
det |
the,vector |
R5992 |
T8519 |
T8521 |
amod |
Sox6,vector |
R5993 |
T8520 |
T8521 |
compound |
overexpression,vector |
R5994 |
T8530 |
T8527 |
pobj |
results,with |
R5995 |
T8531 |
T8537 |
punct |
",",constructs |
R5996 |
T8532 |
T8536 |
det |
the,reporter |
R5997 |
T8533 |
T8536 |
amod |
mutant,reporter |
R5998 |
T8534 |
T8536 |
compound |
ɛy,reporter |
R5999 |
T8618 |
T8619 |
compound |
liver,cells |
R6000 |
T8535 |
T8536 |
compound |
promoter,reporter |
R6001 |
T8619 |
T8617 |
pobj |
cells,from |
R6002 |
T8620 |
T8619 |
prep |
of,cells |
R6003 |
T8536 |
T8537 |
nsubj |
reporter,constructs |
R6004 |
T8621 |
T8624 |
nummod |
15.5,mice |
R6005 |
T8622 |
T8623 |
compound |
dpc,WT |
R6006 |
T8537 |
T8551 |
nsubj |
constructs,result |
R6007 |
T8623 |
T8624 |
compound |
WT,mice |
R6008 |
T8624 |
T8620 |
pobj |
mice,of |
R6009 |
T8625 |
T8612 |
advcl |
using,immunoprecipitated |
R6010 |
T8626 |
T8627 |
amod |
Sox6,antibody |
R6011 |
T8627 |
T8625 |
dobj |
antibody,using |
R6012 |
T8628 |
T8612 |
punct |
.,immunoprecipitated |
R6013 |
T8629 |
T8631 |
nsubj |
Figure,shows |
R6014 |
T8538 |
T8539 |
punct |
(,with |
R6015 |
T8630 |
T8629 |
nummod |
4,Figure |
R6016 |
T8631 |
T8631 |
ROOT |
shows,shows |
R6017 |
T8539 |
T8537 |
prep |
with,constructs |
R6018 |
T8632 |
T8639 |
mark |
that,immunoprecipitated |
R6019 |
T8633 |
T8636 |
det |
the,promoter |
R6020 |
T8540 |
T8541 |
det |
either,one |
R6021 |
T8634 |
T8636 |
amod |
ɛy,promoter |
R6022 |
T8635 |
T8636 |
amod |
proximal,promoter |
R6023 |
T8541 |
T8539 |
pobj |
one,with |
R6024 |
T8636 |
T8639 |
nsubjpass |
promoter,immunoprecipitated |
R6025 |
T8637 |
T8639 |
auxpass |
is,immunoprecipitated |
R6026 |
T8638 |
T8639 |
advmod |
readily,immunoprecipitated |
R6027 |
T8542 |
T8541 |
cc |
or,one |
R6028 |
T8639 |
T8631 |
ccomp |
immunoprecipitated,shows |
R6029 |
T8640 |
T8639 |
prep |
with,immunoprecipitated |
R6030 |
T8641 |
T8642 |
amod |
Sox6,antibody |
R6031 |
T8543 |
T8546 |
det |
both,sites |
R6032 |
T8642 |
T8640 |
pobj |
antibody,with |
R6033 |
T8643 |
T8639 |
prep |
in,immunoprecipitated |
R6034 |
T8644 |
T8646 |
det |
both,cells |
R6035 |
T8544 |
T8546 |
amod |
Sox/Sox6,sites |
R6036 |
T8645 |
T8646 |
compound |
MEL,cells |
R6037 |
T8646 |
T8643 |
pobj |
cells,in |
R6038 |
T8545 |
T8546 |
amod |
binding,sites |
R6039 |
T8647 |
T8646 |
cc |
and,cells |
R6040 |
T8648 |
T8649 |
compound |
liver,cells |
R6041 |
T8649 |
T8646 |
conj |
cells,cells |
R6042 |
T8650 |
T8631 |
punct |
.,shows |
R6043 |
T8546 |
T8541 |
conj |
sites,one |
R6044 |
T8651 |
T8652 |
compound |
Normal,IgG |
R6045 |
T8652 |
T8654 |
nsubjpass |
IgG,used |
R6046 |
T8547 |
T8541 |
amod |
mutagenized,one |
R6047 |
T8653 |
T8654 |
auxpass |
was,used |
R6048 |
T8654 |
T8654 |
ROOT |
used,used |
R6049 |
T8655 |
T8654 |
prep |
as,used |
R6050 |
T8548 |
T8539 |
punct |
),with |
R6051 |
T8656 |
T8658 |
det |
a,control |
R6052 |
T8657 |
T8658 |
amod |
negative,control |
R6053 |
T8658 |
T8655 |
pobj |
control,as |
R6054 |
T8549 |
T8551 |
aux |
do,result |
R6055 |
T8659 |
T8661 |
punct |
(,4A |
R6056 |
T8660 |
T8661 |
compound |
Figure,4A |
R6057 |
T8661 |
T8658 |
appos |
4A,control |
R6058 |
T8662 |
T8661 |
punct |
),4A |
R6059 |
T8663 |
T8654 |
punct |
.,used |
R6060 |
T8664 |
T8666 |
det |
The,data |
R6061 |
T8665 |
T8666 |
amod |
above,data |
R6062 |
T8550 |
T8551 |
neg |
not,result |
R6063 |
T8666 |
T8674 |
nsubj |
data,indicate |
R6064 |
T8667 |
T8668 |
punct |
(,Figures |
R6065 |
T8551 |
T8551 |
ROOT |
result,result |
R6066 |
T8668 |
T8674 |
nsubj |
Figures,indicate |
R6067 |
T8669 |
T8668 |
nummod |
3,Figures |
R6068 |
T8670 |
T8669 |
cc |
and,3 |
R6069 |
T8671 |
T8668 |
appos |
4,Figures |
R6070 |
T8552 |
T8551 |
prep |
in,result |
R6071 |
T8553 |
T8555 |
amod |
significant,repression |
R6072 |
T8672 |
T8668 |
punct |
),Figures |
R6073 |
T8673 |
T8674 |
advmod |
clearly,indicate |
R6074 |
T8554 |
T8555 |
compound |
promoter,repression |
R6075 |
T8674 |
T8674 |
ROOT |
indicate,indicate |
R6076 |
T8675 |
T8687 |
mark |
that,binding |
R6077 |
T8676 |
T8677 |
amod |
Sox6,acts |
R6078 |
T8555 |
T8552 |
pobj |
repression,in |
R6079 |
T8677 |
T8687 |
nsubj |
acts,binding |
R6080 |
T8678 |
T8677 |
prep |
as,acts |
R6081 |
T8556 |
T8555 |
prep |
in,repression |
R6082 |
T8679 |
T8680 |
det |
a,repressor |
R6083 |
T8680 |
T8678 |
pobj |
repressor,as |
R6084 |
T8681 |
T8680 |
prep |
of,repressor |
R6085 |
T8557 |
T8558 |
compound |
transfection,studies |
R6086 |
T8682 |
T8684 |
det |
the,gene |
R6087 |
T8683 |
T8684 |
compound |
ɛy,gene |
R6088 |
T8684 |
T8681 |
pobj |
gene,of |
R6089 |
T8558 |
T8556 |
pobj |
studies,in |
R6090 |
T8685 |
T8677 |
prep |
by,acts |
R6091 |
T8686 |
T8687 |
advmod |
directly,binding |
R6092 |
T8687 |
T8674 |
ccomp |
binding,indicate |
R6093 |
T8559 |
T8560 |
punct |
(,Figure |
R6094 |
T8688 |
T8687 |
prep |
to,binding |
R6095 |
T8689 |
T8691 |
det |
the,promoter |
R6096 |
T8560 |
T8558 |
appos |
Figure,studies |
R6097 |
T8690 |
T8691 |
amod |
ɛy,promoter |
R6098 |
T8691 |
T8688 |
pobj |
promoter,to |
R6099 |
T8692 |
T8674 |
punct |
",",indicate |
R6100 |
T8561 |
T8560 |
nummod |
3F,Figure |
R6101 |
T8693 |
T8694 |
advmod |
probably,as |
R6102 |
T8694 |
T8674 |
prep |
as,indicate |
R6103 |
T8695 |
T8696 |
det |
a,dimer |
R6104 |
T8562 |
T8560 |
punct |
),Figure |
R6105 |
T8696 |
T8694 |
pobj |
dimer,as |
R6106 |
T8697 |
T8674 |
punct |
.,indicate |
R6107 |
T8563 |
T8551 |
punct |
.,result |
R6108 |
T8564 |
T8569 |
advmod |
Thus,required |
R6109 |
T8565 |
T8569 |
punct |
",",required |
R6110 |
T8566 |
T8567 |
det |
both,sites |
R6111 |
T8567 |
T8569 |
nsubjpass |
sites,required |
R6112 |
T8568 |
T8569 |
auxpass |
are,required |
R6113 |
T8569 |
T8569 |
ROOT |
required,required |
R6114 |
T8570 |
T8569 |
prep |
for,required |
R6115 |
T8571 |
T8572 |
amod |
maximal,repression |
R6116 |
T8572 |
T8570 |
pobj |
repression,for |
R6119 |
T8573 |
T8572 |
prep |
of,repression |
R6120 |
T8574 |
T8573 |
pobj |
ɛy,of |
R6122 |
T8575 |
T8569 |
agent |
by,required |
R6123 |
T8576 |
T8575 |
pobj |
Sox6,by |
R6124 |
T8577 |
T8569 |
punct |
",",required |
R6126 |
T8578 |
T8569 |
cc |
but,required |
R6127 |
T8579 |
T8580 |
neg |
not,to |
R6129 |
T8580 |
T8569 |
xcomp |
to,required |
R6131 |
T8581 |
T8583 |
det |
the,degree |
R6133 |
T8582 |
T8583 |
amod |
same,degree |
R6136 |
T8583 |
T8580 |
pobj |
degree,to |
R6139 |
T8584 |
T8569 |
punct |
.,required |
R6141 |
T8585 |
T8587 |
nsubj |
We,tested |
R6142 |
T8586 |
T8587 |
advmod |
also,tested |
R6143 |
T8587 |
T8587 |
ROOT |
tested,tested |
R6145 |
T8588 |
T8590 |
nmod |
whether,binds |
R6146 |
T8589 |
T8590 |
amod |
Sox6,binds |
R6149 |
T8590 |
T8587 |
dobj |
binds,tested |
R6151 |
T8591 |
T8590 |
prep |
to,binds |
R6152 |
T8592 |
T8594 |
det |
the,promoter |
R6153 |
T8593 |
T8594 |
amod |
ɛy,promoter |
R6154 |
T8594 |
T8591 |
pobj |
promoter,to |
R6157 |
T8595 |
T8594 |
prep |
in,promoter |
R6159 |
T8596 |
T8595 |
pobj |
vivo,in |
R6160 |
T8597 |
T8590 |
acl |
using,binds |
R6161 |
T8598 |
T8599 |
compound |
chromatin,immunoprecipitation |
R6162 |
T8599 |
T8597 |
dobj |
immunoprecipitation,using |
R6163 |
T8600 |
T8599 |
punct |
(,immunoprecipitation |
R6164 |
T8601 |
T8599 |
appos |
ChIP,immunoprecipitation |
R6165 |
T8602 |
T8599 |
punct |
),immunoprecipitation |
R6166 |
T8603 |
T8604 |
punct |
(,Figure |
R6167 |
T8604 |
T8590 |
appos |
Figure,binds |
R6169 |
T8605 |
T8604 |
nummod |
4,Figure |
R6171 |
T8606 |
T8604 |
punct |
),Figure |
R6172 |
T8607 |
T8587 |
punct |
.,tested |
R6174 |
T8608 |
T8610 |
det |
The,complex |
R6175 |
T8609 |
T8610 |
amod |
Sox6-containing,complex |
R6176 |
T8610 |
T8612 |
nsubjpass |
complex,immunoprecipitated |
R6179 |
T8611 |
T8612 |
auxpass |
was,immunoprecipitated |
R6180 |
T8612 |
T8612 |
ROOT |
immunoprecipitated,immunoprecipitated |
R6182 |
T8613 |
T8612 |
prep |
from,immunoprecipitated |
R6183 |
T8614 |
T8615 |
compound |
MEL,cells |
R6184 |
T8615 |
T8613 |
pobj |
cells,from |
R6185 |
T8616 |
T8613 |
cc |
or,from |
R6189 |
T8617 |
T8613 |
conj |
from,from |
R6518 |
T9421 |
T9423 |
det |
The,Expression |
R6519 |
T9422 |
T9423 |
compound |
Persistent,Expression |
R6520 |
T9423 |
T9423 |
ROOT |
Expression,Expression |
R6521 |
T9424 |
T9423 |
prep |
of,Expression |
R6522 |
T9425 |
T9426 |
compound |
ɛy,Globin |
R6523 |
T9426 |
T9424 |
pobj |
Globin,of |
R6524 |
T9427 |
T9423 |
prep |
in,Expression |
R6525 |
T9428 |
T9427 |
pobj |
Sox6-Deficient,in |
R6526 |
T9429 |
T9430 |
nsubj |
Mice,Is |
R6527 |
T9430 |
T9430 |
ROOT |
Is,Is |
R6528 |
T9431 |
T9430 |
acomp |
Due,Is |
R6529 |
T9432 |
T9431 |
prep |
to,Due |
R6530 |
T9433 |
T9434 |
det |
a,Defect |
R6531 |
T9434 |
T9432 |
pobj |
Defect,to |
R6532 |
T9435 |
T9434 |
prep |
in,Defect |
R6533 |
T9436 |
T9437 |
det |
the,ɛy-Gene |
R6534 |
T9437 |
T9435 |
pobj |
ɛy-Gene,in |
R6535 |
T9438 |
T9431 |
xcomp |
Silencing,Due |
R6536 |
T9439 |
T9438 |
dobj |
Mechanism,Silencing |
R6537 |
T9440 |
T9438 |
prep |
in,Silencing |
R6538 |
T9441 |
T9444 |
compound |
Definitive,Normally |
R6539 |
T9442 |
T9444 |
compound |
Erythroid,Normally |
R6540 |
T9443 |
T9444 |
compound |
Cells,Normally |
R6541 |
T9444 |
T9440 |
pobj |
Normally,in |
R6542 |
T9445 |
T9452 |
punct |
",",expressed |
R6543 |
T9446 |
T9449 |
det |
the,gene |
R6544 |
T9447 |
T9449 |
amod |
ɛy,gene |
R6545 |
T9448 |
T9449 |
compound |
globin,gene |
R6546 |
T9449 |
T9452 |
nsubjpass |
gene,expressed |
R6547 |
T9450 |
T9452 |
auxpass |
is,expressed |
R6548 |
T9451 |
T9452 |
advmod |
exclusively,expressed |
R6549 |
T9452 |
T9430 |
ccomp |
expressed,Is |
R6550 |
T9453 |
T9452 |
prep |
in,expressed |
R6551 |
T9454 |
T9455 |
amod |
primitive,erythrocytes |
R6552 |
T9455 |
T9453 |
pobj |
erythrocytes,in |
R6553 |
T9456 |
T9452 |
cc |
and,expressed |
R6554 |
T9457 |
T9452 |
conj |
silenced,expressed |
R6555 |
T9458 |
T9457 |
prep |
in,silenced |
R6556 |
T9459 |
T9460 |
amod |
definitive,erythrocytes |
R6557 |
T9460 |
T9458 |
pobj |
erythrocytes,in |
R6558 |
T9461 |
T9452 |
punct |
.,expressed |
R6559 |
T9462 |
T9463 |
aux |
To,determine |
R6560 |
T9463 |
T9463 |
ROOT |
determine,determine |
R6561 |
T9464 |
T9471 |
mark |
whether,is |
R6562 |
T9465 |
T9467 |
det |
the,expression |
R6563 |
T9466 |
T9467 |
amod |
persistent,expression |
R6564 |
T9467 |
T9471 |
nsubj |
expression,is |
R6565 |
T9468 |
T9467 |
prep |
of,expression |
R6566 |
T9469 |
T9470 |
amod |
ɛy,globin |
R6567 |
T9470 |
T9468 |
pobj |
globin,of |
R6568 |
T9471 |
T9463 |
ccomp |
is,determine |
R6569 |
T9472 |
T9471 |
acomp |
due,is |
R6570 |
T9473 |
T9472 |
prep |
to,due |
R6571 |
T9474 |
T9476 |
amod |
residual,erythrocytes |
R6572 |
T9475 |
T9476 |
amod |
primitive,erythrocytes |
R6573 |
T9476 |
T9473 |
pobj |
erythrocytes,to |
R6574 |
T9477 |
T9471 |
cc |
or,is |
R6575 |
T9478 |
T9471 |
conj |
is,is |
R6576 |
T9479 |
T9478 |
acomp |
due,is |
R6577 |
T9480 |
T9479 |
prep |
to,due |
R6578 |
T9481 |
T9482 |
amod |
ectopic,expression |
R6579 |
T9482 |
T9480 |
pobj |
expression,to |
R6580 |
T9483 |
T9482 |
prep |
of,expression |
R6581 |
T9484 |
T9485 |
amod |
ɛy,globin |
R6582 |
T9485 |
T9483 |
pobj |
globin,of |
R6583 |
T9486 |
T9479 |
prep |
in,due |
R6584 |
T9487 |
T9488 |
amod |
definitive,erythrocytes |
R6585 |
T9488 |
T9486 |
pobj |
erythrocytes,in |
R6586 |
T9489 |
T9491 |
punct |
",",examined |
R6587 |
T9490 |
T9491 |
nsubj |
we,examined |
R6588 |
T9491 |
T9478 |
ccomp |
examined,is |
R6589 |
T9492 |
T9494 |
det |
the,pattern |
R6590 |
T9493 |
T9494 |
amod |
spatial,pattern |
R6591 |
T9494 |
T9491 |
dobj |
pattern,examined |
R6592 |
T9495 |
T9494 |
prep |
of,pattern |
R6593 |
T9496 |
T9498 |
amod |
ɛy,transcripts |
R6594 |
T9497 |
T9498 |
compound |
globin,transcripts |
R6595 |
T9498 |
T9495 |
pobj |
transcripts,of |
R6596 |
T9499 |
T9491 |
prep |
in,examined |
R6597 |
T9500 |
T9501 |
compound |
mouse,embryos |
R6598 |
T9501 |
T9499 |
pobj |
embryos,in |
R6599 |
T9502 |
T9491 |
prep |
by,examined |
R6600 |
T9503 |
T9491 |
prep |
in,examined |
R6601 |
T9504 |
T9505 |
compound |
situ,hybridization |
R6602 |
T9505 |
T9503 |
pobj |
hybridization,in |
R6603 |
T9506 |
T9507 |
punct |
(,Figure |
R6604 |
T9507 |
T9491 |
parataxis |
Figure,examined |
R6605 |
T9508 |
T9507 |
nummod |
5,Figure |
R6606 |
T9509 |
T9507 |
punct |
),Figure |
R6607 |
T9510 |
T9463 |
punct |
.,determine |
R6608 |
T9511 |
T9512 |
mark |
As,expected |
R6609 |
T9512 |
T9518 |
advcl |
expected,expressed |
R6610 |
T9513 |
T9518 |
punct |
",",expressed |
R6611 |
T9514 |
T9515 |
amod |
ɛy,globin |
R6612 |
T9515 |
T9518 |
nsubjpass |
globin,expressed |
R6613 |
T9516 |
T9518 |
auxpass |
is,expressed |
R6614 |
T9517 |
T9518 |
neg |
not,expressed |
R6615 |
T9518 |
T9518 |
ROOT |
expressed,expressed |
R6616 |
T9519 |
T9518 |
prep |
in,expressed |
R6617 |
T9520 |
T9523 |
det |
the,liver |
R6618 |
T9521 |
T9523 |
nmod |
WT,liver |
R6619 |
T9522 |
T9523 |
amod |
14.5-dpc,liver |
R6620 |
T9523 |
T9519 |
pobj |
liver,in |
R6621 |
T9524 |
T9523 |
punct |
",",liver |
R6622 |
T9525 |
T9526 |
det |
the,site |
R6623 |
T9526 |
T9523 |
appos |
site,liver |
R6624 |
T9527 |
T9526 |
prep |
of,site |
R6625 |
T9528 |
T9529 |
amod |
definitive,erythropoiesis |
R6626 |
T9529 |
T9527 |
pobj |
erythropoiesis,of |
R6627 |
T9530 |
T9526 |
prep |
in,site |
R6628 |
T9531 |
T9532 |
det |
the,fetus |
R6629 |
T9532 |
T9530 |
pobj |
fetus,in |
R6630 |
T9533 |
T9518 |
punct |
.,expressed |
R6631 |
T9534 |
T9543 |
prep |
In,seen |
R6632 |
T9535 |
T9534 |
pobj |
contrast,In |
R6633 |
T9536 |
T9543 |
punct |
",",seen |
R6634 |
T9537 |
T9541 |
amod |
abundant,expression |
R6635 |
T9538 |
T9539 |
amod |
ectopic,ɛy |
R6636 |
T9539 |
T9541 |
compound |
ɛy,expression |
R6637 |
T9540 |
T9541 |
compound |
mRNA,expression |
R6638 |
T9541 |
T9543 |
nsubjpass |
expression,seen |
R6639 |
T9542 |
T9543 |
auxpass |
is,seen |
R6640 |
T9543 |
T9543 |
ROOT |
seen,seen |
R6641 |
T9544 |
T9543 |
prep |
in,seen |
R6642 |
T9545 |
T9546 |
det |
the,liver |
R6643 |
T9546 |
T9544 |
pobj |
liver,in |
R6644 |
T9547 |
T9546 |
prep |
of,liver |
R6645 |
T9548 |
T9549 |
amod |
14.5-dpc,mutants |
R6646 |
T9549 |
T9547 |
pobj |
mutants,of |
R6647 |
T9550 |
T9551 |
punct |
(,Figure |
R6648 |
T9551 |
T9543 |
dobj |
Figure,seen |
R6649 |
T9552 |
T9551 |
nummod |
5,Figure |
R6650 |
T9553 |
T9551 |
appos |
A,Figure |
R6651 |
T9554 |
T9553 |
appos |
D,A |
R6652 |
T9555 |
T9551 |
punct |
),Figure |
R6653 |
T9556 |
T9543 |
punct |
.,seen |
R6654 |
T9557 |
T9566 |
advmod |
However,is |
R6655 |
T9558 |
T9566 |
punct |
",",is |
R6656 |
T9559 |
T9560 |
det |
the,expression |
R6657 |
T9560 |
T9566 |
nsubj |
expression,is |
R6658 |
T9561 |
T9560 |
prep |
of,expression |
R6659 |
T9562 |
T9565 |
compound |
βmaj,globin |
R6660 |
T9563 |
T9565 |
compound |
/,globin |
R6661 |
T9564 |
T9565 |
compound |
min,globin |
R6662 |
T9565 |
T9561 |
pobj |
globin,of |
R6663 |
T9566 |
T9566 |
ROOT |
is,is |
R6664 |
T9567 |
T9568 |
advmod |
equally,abundant |
R6665 |
T9568 |
T9566 |
acomp |
abundant,is |
R6666 |
T9569 |
T9568 |
prep |
in,abundant |
R6667 |
T9570 |
T9571 |
preconj |
both,WT |
R6668 |
T9571 |
T9575 |
nmod |
WT,mice |
R6669 |
T9572 |
T9571 |
cc |
and,WT |
R6670 |
T9573 |
T9571 |
conj |
p100H,WT |
R6671 |
T9574 |
T9575 |
amod |
mutant,mice |
R6672 |
T9575 |
T9569 |
pobj |
mice,in |
R6673 |
T9576 |
T9577 |
punct |
(,Figure |
R6674 |
T9577 |
T9575 |
appos |
Figure,mice |
R6675 |
T9578 |
T9577 |
nummod |
5,Figure |
R6676 |
T9579 |
T9577 |
appos |
E,Figure |
R6677 |
T9580 |
T9579 |
cc |
and,E |
R6678 |
T9581 |
T9579 |
conj |
F,E |
R6679 |
T9582 |
T9581 |
punct |
),F |
R6680 |
T9583 |
T9566 |
punct |
.,is |
R6681 |
T9584 |
T9585 |
det |
These,data |
R6682 |
T9585 |
T9586 |
nsubj |
data,demonstrate |
R6683 |
T9586 |
T9586 |
ROOT |
demonstrate,demonstrate |
R6684 |
T9587 |
T9594 |
mark |
that,are |
R6685 |
T9588 |
T9591 |
det |
the,levels |
R6686 |
T9589 |
T9591 |
amod |
persistent,levels |
R6687 |
T9590 |
T9591 |
amod |
high,levels |
R6688 |
T9591 |
T9594 |
nsubj |
levels,are |
R6689 |
T9592 |
T9591 |
prep |
of,levels |
R6690 |
T9593 |
T9592 |
pobj |
ɛy,of |
R6691 |
T9594 |
T9586 |
ccomp |
are,demonstrate |
R6692 |
T9595 |
T9594 |
acomp |
due,are |
R6693 |
T9596 |
T9597 |
aux |
to,ectopic |
R6694 |
T9597 |
T9595 |
xcomp |
ectopic,due |
R6695 |
T9598 |
T9597 |
dobj |
expression,ectopic |
R6696 |
T9599 |
T9597 |
prep |
in,ectopic |
R6697 |
T9600 |
T9603 |
det |
the,cells |
R6698 |
T9601 |
T9603 |
amod |
definitive,cells |
R6699 |
T9602 |
T9603 |
amod |
erythroid,cells |
R6700 |
T9603 |
T9599 |
pobj |
cells,in |
R6701 |
T9604 |
T9605 |
nsubj |
that,mature |
R6702 |
T9605 |
T9603 |
relcl |
mature,cells |
R6703 |
T9606 |
T9605 |
prep |
in,mature |
R6704 |
T9607 |
T9609 |
det |
the,liver |
R6705 |
T9608 |
T9609 |
amod |
fetal,liver |
R6706 |
T9609 |
T9606 |
pobj |
liver,in |
R6707 |
T9610 |
T9586 |
punct |
",",demonstrate |
R6708 |
T9611 |
T9586 |
advcl |
suggesting,demonstrate |
R6709 |
T9612 |
T9614 |
mark |
that,is |
R6710 |
T9613 |
T9614 |
expl |
there,is |
R6711 |
T9614 |
T9611 |
ccomp |
is,suggesting |
R6712 |
T9615 |
T9617 |
det |
an,defect |
R6713 |
T9616 |
T9617 |
amod |
intrinsic,defect |
R6714 |
T9617 |
T9614 |
attr |
defect,is |
R6715 |
T9618 |
T9617 |
prep |
of,defect |
R6716 |
T9619 |
T9620 |
det |
the,ɛy |
R6717 |
T9620 |
T9618 |
pobj |
ɛy,of |
R6718 |
T9621 |
T9617 |
acl |
silencing,defect |
R6719 |
T9622 |
T9621 |
dobj |
mechanism,silencing |
R6720 |
T9623 |
T9621 |
prep |
in,silencing |
R6721 |
T9624 |
T9625 |
amod |
Sox6-null,mice |
R6722 |
T9625 |
T9623 |
pobj |
mice,in |
R6723 |
T9626 |
T9586 |
punct |
.,demonstrate |
R6969 |
T10094 |
T10096 |
det |
The,Pattern |
R6970 |
T10095 |
T10096 |
compound |
Expression,Pattern |
R6971 |
T10096 |
T10099 |
nsubj |
Pattern,Suggests |
R6972 |
T10097 |
T10096 |
prep |
of,Pattern |
R6973 |
T10098 |
T10097 |
pobj |
Sox6,of |
R6974 |
T10099 |
T10099 |
ROOT |
Suggests,Suggests |
R6975 |
T10100 |
T10101 |
det |
a,Role |
R6976 |
T10101 |
T10099 |
dobj |
Role,Suggests |
R6977 |
T10102 |
T10101 |
prep |
in,Role |
R6978 |
T10103 |
T10104 |
amod |
Definitive,Erythropoiesis |
R6979 |
T10104 |
T10102 |
pobj |
Erythropoiesis,in |
R6980 |
T10105 |
T10106 |
det |
The,observation |
R6981 |
T10106 |
T10123 |
nsubj |
observation,suggests |
R6982 |
T10107 |
T10111 |
mark |
that,express |
R6983 |
T10108 |
T10109 |
amod |
Sox6-deficient,mice |
R6984 |
T10109 |
T10111 |
nsubj |
mice,express |
R6985 |
T10110 |
T10111 |
advmod |
ectopically,express |
R6986 |
T10111 |
T10106 |
acl |
express,observation |
R6987 |
T10112 |
T10113 |
amod |
ɛy,globin |
R6988 |
T10113 |
T10111 |
dobj |
globin,express |
R6989 |
T10114 |
T10113 |
prep |
in,globin |
R6990 |
T10115 |
T10114 |
pobj |
liver,in |
R6991 |
T10116 |
T10115 |
punct |
",",liver |
R6992 |
T10117 |
T10121 |
advmod |
where,mature |
R6993 |
T10118 |
T10120 |
amod |
definitive,cells |
R6994 |
T10119 |
T10120 |
amod |
erythroid,cells |
R6995 |
T10120 |
T10121 |
nsubj |
cells,mature |
R6996 |
T10121 |
T10115 |
relcl |
mature,liver |
R6997 |
T10122 |
T10123 |
punct |
",",suggests |
R6998 |
T10123 |
T10123 |
ROOT |
suggests,suggests |
R6999 |
T10124 |
T10126 |
mark |
that,is |
R7000 |
T10125 |
T10126 |
nsubj |
Sox6,is |
R7001 |
T10126 |
T10123 |
ccomp |
is,suggests |
R7002 |
T10127 |
T10129 |
det |
an,regulator |
R7003 |
T10128 |
T10129 |
amod |
important,regulator |
R7004 |
T10129 |
T10126 |
attr |
regulator,is |
R7005 |
T10130 |
T10129 |
prep |
in,regulator |
R7006 |
T10131 |
T10132 |
amod |
definitive,erythropoiesis |
R7007 |
T10132 |
T10130 |
pobj |
erythropoiesis,in |
R7008 |
T10133 |
T10123 |
punct |
.,suggests |
R7009 |
T10134 |
T10135 |
aux |
To,determine |
R7010 |
T10135 |
T10153 |
advcl |
determine,employed |
R7011 |
T10136 |
T10141 |
det |
the,pattern |
R7012 |
T10137 |
T10141 |
amod |
temporal,pattern |
R7013 |
T10138 |
T10137 |
cc |
and,temporal |
R7014 |
T10139 |
T10137 |
conj |
spatial,temporal |
R7015 |
T10140 |
T10141 |
compound |
expression,pattern |
R7016 |
T10141 |
T10135 |
dobj |
pattern,determine |
R7017 |
T10142 |
T10141 |
prep |
of,pattern |
R7018 |
T10143 |
T10142 |
pobj |
Sox6,of |
R7019 |
T10144 |
T10143 |
punct |
",",Sox6 |
R7020 |
T10145 |
T10146 |
compound |
Northern,blot |
R7021 |
T10146 |
T10141 |
conj |
blot,pattern |
R7022 |
T10147 |
T10146 |
cc |
and,blot |
R7023 |
T10148 |
T10146 |
conj |
in,blot |
R7024 |
T10149 |
T10151 |
compound |
situ,assays |
R7025 |
T10150 |
T10151 |
compound |
hybridization,assays |
R7026 |
T10151 |
T10148 |
pobj |
assays,in |
R7027 |
T10152 |
T10153 |
auxpass |
were,employed |
R7028 |
T10153 |
T10153 |
ROOT |
employed,employed |
R7029 |
T10154 |
T10153 |
punct |
.,employed |
R7030 |
T10155 |
T10156 |
mark |
As,shown |
R7031 |
T10156 |
T10162 |
advcl |
shown,is |
R7032 |
T10157 |
T10156 |
prep |
in,shown |
R7033 |
T10158 |
T10157 |
pobj |
Figure,in |
R7034 |
T10159 |
T10158 |
nummod |
6A,Figure |
R7035 |
T10160 |
T10162 |
punct |
",",is |
R7036 |
T10161 |
T10162 |
nsubj |
Sox6,is |
R7037 |
T10162 |
T10162 |
ROOT |
is,is |
R7038 |
T10163 |
T10162 |
acomp |
detectable,is |
R7039 |
T10164 |
T10163 |
prep |
by,detectable |
R7040 |
T10165 |
T10166 |
compound |
Northern,blot |
R7041 |
T10166 |
T10164 |
pobj |
blot,by |
R7042 |
T10167 |
T10162 |
advcl |
beginning,is |
R7043 |
T10168 |
T10167 |
prep |
at,beginning |
R7044 |
T10169 |
T10170 |
nummod |
10.5,dpc |
R7045 |
T10170 |
T10168 |
pobj |
dpc,at |
R7046 |
T10171 |
T10170 |
punct |
",",dpc |
R7047 |
T10172 |
T10170 |
amod |
coincident,dpc |
R7048 |
T10173 |
T10172 |
prep |
with,coincident |
R7049 |
T10174 |
T10176 |
det |
the,onset |
R7050 |
T10175 |
T10176 |
amod |
temporal,onset |
R7051 |
T10176 |
T10173 |
pobj |
onset,with |
R7052 |
T10177 |
T10176 |
prep |
of,onset |
R7053 |
T10178 |
T10179 |
amod |
definitive,erythropoiesis |
R7054 |
T10179 |
T10177 |
pobj |
erythropoiesis,of |
R7055 |
T10180 |
T10179 |
prep |
in,erythropoiesis |
R7056 |
T10181 |
T10182 |
det |
the,liver |
R7057 |
T10182 |
T10180 |
pobj |
liver,in |
R7058 |
T10183 |
T10162 |
punct |
.,is |
R7059 |
T10184 |
T10189 |
advmod |
Furthermore,shows |
R7060 |
T10185 |
T10189 |
punct |
",",shows |
R7061 |
T10186 |
T10189 |
prep |
in,shows |
R7062 |
T10187 |
T10188 |
compound |
situ,hybridization |
R7063 |
T10188 |
T10189 |
compound |
hybridization,shows |
R7064 |
T10189 |
T10189 |
ROOT |
shows,shows |
R7065 |
T10190 |
T10194 |
mark |
that,transcribed |
R7066 |
T10191 |
T10194 |
nsubjpass |
Sox6,transcribed |
R7067 |
T10192 |
T10194 |
auxpass |
is,transcribed |
R7068 |
T10193 |
T10194 |
advmod |
highly,transcribed |
R7069 |
T10194 |
T10189 |
ccomp |
transcribed,shows |
R7070 |
T10195 |
T10194 |
prep |
in,transcribed |
R7071 |
T10196 |
T10197 |
amod |
12.5-dpc,liver |
R7072 |
T10197 |
T10195 |
pobj |
liver,in |
R7073 |
T10198 |
T10194 |
punct |
",",transcribed |
R7074 |
T10199 |
T10194 |
cc |
but,transcribed |
R7075 |
T10200 |
T10201 |
neg |
not,in |
R7076 |
T10201 |
T10206 |
prep |
in,at |
R7077 |
T10202 |
T10203 |
compound |
yolk,sac |
R7078 |
T10203 |
T10205 |
compound |
sac,islands |
R7079 |
T10204 |
T10205 |
compound |
blood,islands |
R7080 |
T10205 |
T10201 |
pobj |
islands,in |
R7081 |
T10206 |
T10194 |
conj |
at,transcribed |
R7082 |
T10207 |
T10208 |
nummod |
7.5,dpc |
R7083 |
T10208 |
T10206 |
pobj |
dpc,at |
R7084 |
T10209 |
T10211 |
punct |
(,6B |
R7085 |
T10210 |
T10211 |
compound |
Figure,6B |
R7086 |
T10211 |
T10208 |
appos |
6B,dpc |
R7087 |
T10212 |
T10211 |
punct |
),6B |
R7088 |
T10213 |
T10189 |
punct |
.,shows |
R7089 |
T10214 |
T10218 |
advmod |
Therefore,is |
R7090 |
T10215 |
T10218 |
punct |
",",is |
R7091 |
T10216 |
T10217 |
amod |
Sox6,expression |
R7092 |
T10217 |
T10218 |
nsubj |
expression,is |
R7093 |
T10218 |
T10218 |
ROOT |
is,is |
R7094 |
T10219 |
T10222 |
advmod |
temporally,coincident |
R7095 |
T10220 |
T10219 |
cc |
and,temporally |
R7096 |
T10221 |
T10219 |
conj |
spatially,temporally |
R7097 |
T10222 |
T10218 |
acomp |
coincident,is |
R7098 |
T10223 |
T10222 |
prep |
with,coincident |
R7099 |
T10224 |
T10223 |
pobj |
definitive,with |
R7100 |
T10225 |
T10222 |
punct |
",",coincident |
R7101 |
T10226 |
T10222 |
cc |
but,coincident |
R7102 |
T10227 |
T10228 |
neg |
not,primitive |
R7103 |
T10228 |
T10222 |
conj |
primitive,coincident |
R7104 |
T10229 |
T10228 |
punct |
",",primitive |
R7105 |
T10230 |
T10228 |
conj |
erythropoiesis,primitive |
R7106 |
T10231 |
T10218 |
punct |
.,is |
R7107 |
T10232 |
T10233 |
det |
These,data |
R7108 |
T10233 |
T10260 |
nsubj |
data,demonstrate |
R7109 |
T10234 |
T10233 |
punct |
",",data |
R7110 |
T10235 |
T10233 |
acl |
taken,data |
R7111 |
T10236 |
T10235 |
advmod |
together,taken |
R7112 |
T10237 |
T10235 |
prep |
with,taken |
R7113 |
T10238 |
T10239 |
det |
the,observation |
R7114 |
T10239 |
T10237 |
pobj |
observation,with |
R7115 |
T10240 |
T10245 |
mark |
that,expressed |
R7116 |
T10241 |
T10242 |
amod |
ɛy,globin |
R7117 |
T10242 |
T10245 |
nsubjpass |
globin,expressed |
R7118 |
T10243 |
T10245 |
auxpass |
is,expressed |
R7119 |
T10244 |
T10245 |
advmod |
highly,expressed |
R7120 |
T10245 |
T10239 |
acl |
expressed,observation |
R7121 |
T10246 |
T10245 |
prep |
in,expressed |
R7122 |
T10247 |
T10249 |
det |
the,cells |
R7123 |
T10248 |
T10249 |
compound |
liver,cells |
R7124 |
T10249 |
T10246 |
pobj |
cells,in |
R7125 |
T10250 |
T10249 |
prep |
of,cells |
R7126 |
T10251 |
T10254 |
amod |
14.5-dpc,mice |
R7127 |
T10252 |
T10254 |
amod |
p100H,mice |
R7128 |
T10253 |
T10254 |
amod |
mutant,mice |
R7129 |
T10254 |
T10250 |
pobj |
mice,of |
R7130 |
T10255 |
T10256 |
punct |
(,Figure |
R7131 |
T10256 |
T10249 |
appos |
Figure,cells |
R7132 |
T10257 |
T10256 |
nummod |
5,Figure |
R7133 |
T10258 |
T10256 |
punct |
),Figure |
R7134 |
T10259 |
T10260 |
punct |
",",demonstrate |
R7135 |
T10260 |
T10260 |
ROOT |
demonstrate,demonstrate |
R7136 |
T10261 |
T10263 |
mark |
that,functions |
R7137 |
T10262 |
T10263 |
amod |
Sox6,functions |
R7138 |
T10263 |
T10260 |
ccomp |
functions,demonstrate |
R7139 |
T10264 |
T10263 |
prep |
in,functions |
R7140 |
T10265 |
T10266 |
amod |
definitive,erythropoiesis |
R7141 |
T10266 |
T10264 |
pobj |
erythropoiesis,in |
R7142 |
T10267 |
T10260 |
punct |
.,demonstrate |
R7298 |
T10522 |
T10523 |
compound |
Mutant,p100H |
R7299 |
T10523 |
T10523 |
ROOT |
p100H,p100H |
R7300 |
T10524 |
T10542 |
nsubj |
Mice,noticed |
R7301 |
T10525 |
T10532 |
preconj |
Have,Among |
R7302 |
T10526 |
T10527 |
amod |
Higher,Numbers |
R7303 |
T10527 |
T10525 |
dobj |
Numbers,Have |
R7304 |
T10528 |
T10527 |
prep |
of,Numbers |
R7305 |
T10529 |
T10531 |
compound |
Nucleated,Cells |
R7306 |
T10530 |
T10531 |
compound |
Red,Cells |
R7307 |
T10531 |
T10528 |
pobj |
Cells,of |
R7308 |
T10532 |
T10542 |
prep |
Among,noticed |
R7309 |
T10533 |
T10536 |
det |
the,effects |
R7310 |
T10534 |
T10536 |
amod |
other,effects |
R7311 |
T10535 |
T10536 |
amod |
Sox6,effects |
R7312 |
T10536 |
T10532 |
pobj |
effects,Among |
R7313 |
T10537 |
T10536 |
prep |
in,effects |
R7314 |
T10538 |
T10537 |
pobj |
erythropoiesis,in |
R7315 |
T10539 |
T10542 |
punct |
",",noticed |
R7316 |
T10540 |
T10542 |
nsubj |
we,noticed |
R7317 |
T10541 |
T10542 |
aux |
have,noticed |
R7318 |
T10542 |
T10542 |
ROOT |
noticed,noticed |
R7319 |
T10543 |
T10545 |
mark |
that,are |
R7320 |
T10544 |
T10545 |
expl |
there,are |
R7321 |
T10545 |
T10542 |
ccomp |
are,noticed |
R7322 |
T10546 |
T10547 |
advmod |
more,nucleated |
R7323 |
T10547 |
T10550 |
amod |
nucleated,cells |
R7324 |
T10548 |
T10550 |
amod |
red,cells |
R7325 |
T10549 |
T10550 |
compound |
blood,cells |
R7326 |
T10550 |
T10545 |
attr |
cells,are |
R7327 |
T10551 |
T10550 |
acl |
circulating,cells |
R7328 |
T10552 |
T10551 |
prep |
in,circulating |
R7329 |
T10553 |
T10555 |
amod |
p100H,mice |
R7330 |
T10554 |
T10555 |
amod |
mutant,mice |
R7331 |
T10555 |
T10552 |
pobj |
mice,in |
R7332 |
T10556 |
T10550 |
prep |
than,cells |
R7333 |
T10557 |
T10556 |
prep |
in,than |
R7334 |
T10558 |
T10559 |
compound |
WT,mice |
R7335 |
T10559 |
T10557 |
pobj |
mice,in |
R7336 |
T10560 |
T10545 |
prep |
at,are |
R7337 |
T10561 |
T10560 |
pobj |
14.5,at |
R7338 |
T10562 |
T10569 |
nmod |
dpc,) |
R7339 |
T10563 |
T10562 |
cc |
and,dpc |
R7340 |
T10564 |
T10565 |
nummod |
18.5,dpc |
R7341 |
T10565 |
T10569 |
nmod |
dpc,) |
R7342 |
T10566 |
T10568 |
punct |
(,7A |
R7343 |
T10567 |
T10568 |
compound |
Figure,7A |
R7344 |
T10568 |
T10565 |
appos |
7A,dpc |
R7345 |
T10569 |
T10545 |
punct |
),are |
R7346 |
T10570 |
T10542 |
punct |
.,noticed |
R7347 |
T10571 |
T10581 |
advmod |
However,see |
R7348 |
T10572 |
T10581 |
punct |
",",see |
R7349 |
T10573 |
T10581 |
prep |
at,see |
R7350 |
T10574 |
T10575 |
amod |
postnatal,day |
R7351 |
T10575 |
T10573 |
pobj |
day,at |
R7352 |
T10576 |
T10575 |
nummod |
10.5,day |
R7353 |
T10577 |
T10581 |
punct |
",",see |
R7354 |
T10578 |
T10581 |
nsubj |
we,see |
R7355 |
T10579 |
T10581 |
aux |
do,see |
R7356 |
T10580 |
T10581 |
neg |
not,see |
R7357 |
T10581 |
T10581 |
ROOT |
see,see |
R7358 |
T10582 |
T10581 |
ccomp |
circulating,see |
R7359 |
T10583 |
T10585 |
amod |
nucleated,cells |
R7360 |
T10584 |
T10585 |
amod |
red,cells |
R7361 |
T10585 |
T10582 |
dobj |
cells,circulating |
R7362 |
T10586 |
T10582 |
prep |
in,circulating |
R7363 |
T10587 |
T10588 |
det |
either,WT |
R7364 |
T10588 |
T10586 |
pobj |
WT,in |
R7365 |
T10589 |
T10588 |
cc |
or,WT |
R7366 |
T10590 |
T10591 |
amod |
mutant,mice |
R7367 |
T10591 |
T10588 |
conj |
mice,WT |
R7368 |
T10592 |
T10582 |
punct |
",",circulating |
R7369 |
T10593 |
T10582 |
advcl |
suggesting,circulating |
R7370 |
T10594 |
T10597 |
mark |
that,be |
R7371 |
T10595 |
T10597 |
nsubj |
this,be |
R7372 |
T10596 |
T10597 |
aux |
may,be |
R7373 |
T10597 |
T10593 |
ccomp |
be,suggesting |
R7374 |
T10598 |
T10600 |
det |
a,effect |
R7375 |
T10599 |
T10600 |
amod |
transient,effect |
R7376 |
T10600 |
T10597 |
attr |
effect,be |
R7377 |
T10601 |
T10581 |
punct |
.,see |
R7378 |
T10602 |
T10608 |
prep |
In,shows |
R7379 |
T10603 |
T10602 |
pobj |
addition,In |
R7380 |
T10604 |
T10608 |
punct |
",",shows |
R7381 |
T10605 |
T10607 |
det |
the,liver |
R7382 |
T10606 |
T10607 |
amod |
mutant,liver |
R7383 |
T10607 |
T10608 |
nsubj |
liver,shows |
R7384 |
T10608 |
T10608 |
ROOT |
shows,shows |
R7385 |
T10609 |
T10611 |
det |
a,increase |
R7386 |
T10610 |
T10611 |
amod |
significant,increase |
R7387 |
T10611 |
T10608 |
dobj |
increase,shows |
R7388 |
T10612 |
T10611 |
prep |
in,increase |
R7389 |
T10613 |
T10615 |
amod |
hematopoietic,cells |
R7390 |
T10614 |
T10615 |
compound |
precursor,cells |
R7391 |
T10615 |
T10612 |
pobj |
cells,in |
R7392 |
T10616 |
T10615 |
prep |
including,cells |
R7393 |
T10617 |
T10618 |
amod |
nucleated,erythrocytes |
R7394 |
T10618 |
T10616 |
pobj |
erythrocytes,including |
R7395 |
T10619 |
T10618 |
prep |
at,erythrocytes |
R7396 |
T10620 |
T10621 |
nummod |
18.5,dpc |
R7397 |
T10621 |
T10619 |
pobj |
dpc,at |
R7398 |
T10622 |
T10624 |
punct |
(,7B |
R7399 |
T10623 |
T10624 |
compound |
Figure,7B |
R7400 |
T10624 |
T10621 |
appos |
7B,dpc |
R7401 |
T10625 |
T10624 |
punct |
),7B |
R7402 |
T10626 |
T10608 |
punct |
.,shows |
R7403 |
T10627 |
T10628 |
det |
This,alteration |
R7404 |
T10628 |
T10630 |
nsubjpass |
alteration,noted |
R7405 |
T10629 |
T10630 |
auxpass |
is,noted |
R7406 |
T10630 |
T10630 |
ROOT |
noted,noted |
R7407 |
T10631 |
T10632 |
advmod |
as,early |
R7408 |
T10632 |
T10630 |
advmod |
early,noted |
R7409 |
T10633 |
T10632 |
prep |
as,early |
R7410 |
T10634 |
T10635 |
nummod |
14.5,dpc |
R7411 |
T10635 |
T10633 |
pobj |
dpc,as |
R7412 |
T10636 |
T10630 |
punct |
.,noted |
R7413 |
T10637 |
T10638 |
det |
These,observations |
R7414 |
T10638 |
T10639 |
nsubj |
observations,suggest |
R7415 |
T10639 |
T10639 |
ROOT |
suggest,suggest |
R7416 |
T10640 |
T10650 |
mark |
that,affect |
R7417 |
T10641 |
T10650 |
prep |
besides,affect |
R7418 |
T10642 |
T10641 |
pcomp |
silencing,besides |
R7419 |
T10643 |
T10646 |
det |
the,gene |
R7420 |
T10644 |
T10646 |
amod |
ɛy,gene |
R7421 |
T10645 |
T10646 |
compound |
globin,gene |
R7422 |
T10646 |
T10642 |
dobj |
gene,silencing |
R7423 |
T10647 |
T10650 |
punct |
",",affect |
R7424 |
T10648 |
T10650 |
nsubj |
Sox6,affect |
R7425 |
T10649 |
T10650 |
aux |
may,affect |
R7426 |
T10650 |
T10639 |
ccomp |
affect,suggest |
R7427 |
T10651 |
T10652 |
amod |
red,cell |
R7428 |
T10652 |
T10653 |
compound |
cell,maturation |
R7429 |
T10653 |
T10650 |
dobj |
maturation,affect |
R7430 |
T10654 |
T10639 |
punct |
.,suggest |
R9403 |
T13803 |
T13808 |
prep |
In,show |
R9404 |
T13804 |
T13805 |
det |
this,report |
R9405 |
T13805 |
T13803 |
pobj |
report,In |
R9406 |
T13806 |
T13808 |
punct |
",",show |
R9407 |
T13807 |
T13808 |
nsubj |
we,show |
R9408 |
T13808 |
T13808 |
ROOT |
show,show |
R9409 |
T13809 |
T13811 |
mark |
that,is |
R9410 |
T13810 |
T13811 |
nsubj |
Sox6,is |
R9411 |
T13811 |
T13808 |
ccomp |
is,show |
R9412 |
T13812 |
T13814 |
det |
a,factor |
R9413 |
T13813 |
T13814 |
amod |
novel,factor |
R9414 |
T13814 |
T13811 |
attr |
factor,is |
R9415 |
T13815 |
T13814 |
prep |
in,factor |
R9416 |
T13816 |
T13819 |
det |
the,mechanism |
R9417 |
T13817 |
T13819 |
amod |
complicated,mechanism |
R9419 |
T13818 |
T13819 |
compound |
regulation,mechanism |
R9420 |
T13819 |
T13815 |
pobj |
mechanism,in |
R9421 |
T13820 |
T13819 |
prep |
of,mechanism |
R9422 |
T13821 |
T13822 |
compound |
globin,genes |
R9423 |
T13822 |
T13820 |
pobj |
genes,of |
R9424 |
T13823 |
T13808 |
punct |
.,show |
R9425 |
T13824 |
T13831 |
prep |
In,is |
R9426 |
T13825 |
T13828 |
det |
the,mouse |
R9428 |
T13826 |
T13828 |
compound |
Sox6,mouse |
R9429 |
T13827 |
T13828 |
amod |
null,mouse |
R9430 |
T13828 |
T13824 |
pobj |
mouse,In |
R9431 |
T13829 |
T13831 |
punct |
",",is |
R9433 |
T13830 |
T13831 |
expl |
there,is |
R9434 |
T13831 |
T13831 |
ROOT |
is,is |
R9436 |
T13832 |
T13834 |
det |
a,effect |
R9438 |
T13833 |
T13834 |
amod |
transient,effect |
R9439 |
T13834 |
T13831 |
attr |
effect,is |
R9441 |
T13846 |
T13848 |
det |
a,upregulation |
R9442 |
T13835 |
T13834 |
prep |
on,effect |
R9443 |
T13836 |
T13839 |
det |
the,genes |
R9444 |
T13837 |
T13839 |
amod |
embryonic,genes |
R9445 |
T13838 |
T13839 |
compound |
globin,genes |
R9446 |
T13839 |
T13835 |
pobj |
genes,on |
R9447 |
T13840 |
T13839 |
punct |
",",genes |
R9448 |
T13841 |
T13839 |
conj |
ζ,genes |
R9449 |
T13842 |
T13841 |
cc |
and,ζ |
R9450 |
T13843 |
T13841 |
conj |
βH1,ζ |
R9451 |
T13844 |
T13843 |
punct |
",",βH1 |
R9452 |
T13845 |
T13843 |
cc |
and,βH1 |
R9453 |
T13847 |
T13848 |
amod |
persistent,upregulation |
R9454 |
T13848 |
T13843 |
conj |
upregulation,βH1 |
R9455 |
T13849 |
T13848 |
prep |
of,upregulation |
R9456 |
T13850 |
T13853 |
det |
the,gene |
R9457 |
T13877 |
T13877 |
ROOT |
belongs,belongs |
R9458 |
T13851 |
T13853 |
amod |
ɛy,gene |
R9459 |
T13878 |
T13879 |
aux |
to,group |
R9460 |
T13879 |
T13877 |
xcomp |
group,belongs |
R9461 |
T13852 |
T13853 |
compound |
globin,gene |
R9462 |
T13880 |
T13879 |
dobj |
D,group |
R9463 |
T13881 |
T13880 |
prep |
of,D |
R9464 |
T13882 |
T13884 |
det |
the,family |
R9465 |
T13853 |
T13849 |
pobj |
gene,of |
R9466 |
T13883 |
T13884 |
compound |
Sox,family |
R9467 |
T13884 |
T13881 |
pobj |
family,of |
R9468 |
T13854 |
T13831 |
punct |
.,is |
R9469 |
T13885 |
T13884 |
prep |
of,family |
R9470 |
T13886 |
T13885 |
pobj |
proteins,of |
R9471 |
T13887 |
T13888 |
nsubj |
that,includes |
R9472 |
T13855 |
T13857 |
nsubj |
Sox6,regulates |
R9473 |
T13888 |
T13884 |
relcl |
includes,family |
R9474 |
T13889 |
T13888 |
dobj |
Sox5,includes |
R9475 |
T13856 |
T13857 |
advmod |
directly,regulates |
R9476 |
T13890 |
T13889 |
punct |
",",Sox5 |
R9477 |
T13891 |
T13888 |
npadvmod |
12,includes |
R9478 |
T13892 |
T13893 |
punct |
",",13 |
R9479 |
T13893 |
T13891 |
prep |
13,12 |
R9480 |
T13857 |
T13857 |
ROOT |
regulates,regulates |
R9481 |
T13894 |
T13891 |
punct |
",",12 |
R9482 |
T13895 |
T13891 |
cc |
and,12 |
R9483 |
T13858 |
T13857 |
cc |
and,regulates |
R9484 |
T13896 |
T13899 |
nummod |
23,] |
R9485 |
T13897 |
T13899 |
nmod |
[,] |
R9486 |
T13859 |
T13857 |
conj |
binds,regulates |
R9487 |
T13898 |
T13899 |
nummod |
34,] |
R9488 |
T13899 |
T13891 |
conj |
],12 |
R9489 |
T13900 |
T13877 |
punct |
.,belongs |
R9490 |
T13860 |
T13859 |
prep |
to,binds |
R9491 |
T13901 |
T13904 |
compound |
Group,proteins |
R9492 |
T13902 |
T13904 |
compound |
D,proteins |
R9493 |
T13903 |
T13904 |
compound |
Sox,proteins |
R9494 |
T13861 |
T13863 |
det |
the,promoter |
R9495 |
T13904 |
T13905 |
nsubj |
proteins,contain |
R9496 |
T13905 |
T13905 |
ROOT |
contain,contain |
R9497 |
T13906 |
T13907 |
det |
a,coiled |
R9498 |
T13862 |
T13863 |
amod |
proximal,promoter |
R9499 |
T13907 |
T13909 |
amod |
coiled,domain |
R9500 |
T13908 |
T13909 |
compound |
coiled,domain |
R9501 |
T13909 |
T13905 |
dobj |
domain,contain |
R9502 |
T13863 |
T13860 |
pobj |
promoter,to |
R9503 |
T13864 |
T13863 |
prep |
of,promoter |
R9504 |
T13910 |
T13911 |
nsubj |
that,mediates |
R9505 |
T13911 |
T13909 |
relcl |
mediates,domain |
R9506 |
T13912 |
T13916 |
nmod |
homo,[ |
R9507 |
T13913 |
T13912 |
punct |
-,homo |
R9508 |
T13914 |
T13912 |
cc |
and,homo |
R9509 |
T13915 |
T13912 |
conj |
heterodimerization,homo |
R9510 |
T13865 |
T13866 |
amod |
ɛy,gene |
R9511 |
T13916 |
T13918 |
compound |
[,] |
R9512 |
T13917 |
T13918 |
compound |
"6,35",] |
R9513 |
T13866 |
T13864 |
pobj |
gene,of |
R9514 |
T13918 |
T13911 |
dobj |
],mediates |
R9515 |
T13919 |
T13905 |
punct |
.,contain |
R9516 |
T13867 |
T13863 |
cc |
and,promoter |
R9517 |
T13920 |
T13929 |
advmod |
Functionally,shown |
R9518 |
T13921 |
T13929 |
punct |
",",shown |
R9519 |
T13868 |
T13857 |
conj |
represses,regulates |
R9520 |
T13922 |
T13929 |
nsubjpass |
dimerization,shown |
R9521 |
T13923 |
T13922 |
prep |
of,dimerization |
R9522 |
T13924 |
T13923 |
pobj |
Sox5,of |
R9523 |
T13869 |
T13871 |
det |
the,gene |
R9524 |
T13925 |
T13922 |
cc |
and,dimerization |
R9525 |
T13926 |
T13922 |
conj |
Sox6,dimerization |
R9526 |
T13927 |
T13929 |
aux |
has,shown |
R9527 |
T13928 |
T13929 |
auxpass |
been,shown |
R9528 |
T13870 |
T13871 |
amod |
ɛy-globin,gene |
R9529 |
T13929 |
T13929 |
ROOT |
shown,shown |
R9530 |
T13930 |
T13932 |
aux |
to,increase |
R9531 |
T13931 |
T13932 |
advmod |
greatly,increase |
R9532 |
T13871 |
T13868 |
dobj |
gene,represses |
R9533 |
T13932 |
T13929 |
xcomp |
increase,shown |
R9534 |
T13933 |
T13935 |
det |
the,efficiency |
R9535 |
T13934 |
T13935 |
amod |
binding,efficiency |
R9536 |
T13872 |
T13871 |
prep |
in,gene |
R9537 |
T13935 |
T13932 |
dobj |
efficiency,increase |
R9538 |
T13873 |
T13874 |
amod |
definitive,erythropoiesis |
R9539 |
T13936 |
T13935 |
prep |
of,efficiency |
R9540 |
T13937 |
T13940 |
det |
the,proteins |
R9541 |
T13938 |
T13940 |
nummod |
two,proteins |
R9542 |
T13939 |
T13940 |
compound |
Sox,proteins |
R9543 |
T13874 |
T13872 |
pobj |
erythropoiesis,in |
R9544 |
T13940 |
T13936 |
pobj |
proteins,of |
R9545 |
T13941 |
T13932 |
prep |
to,increase |
R9546 |
T13942 |
T13941 |
pobj |
DNA,to |
R9547 |
T13875 |
T13857 |
punct |
.,regulates |
R9548 |
T13943 |
T13944 |
nsubj |
that,contains |
R9549 |
T13944 |
T13929 |
conj |
contains,shown |
R9550 |
T13876 |
T13877 |
nsubj |
Sox6,belongs |
R9551 |
T13945 |
T13947 |
amod |
adjacent,sites |
R9552 |
T13946 |
T13947 |
compound |
Sox,sites |
R9553 |
T13947 |
T13944 |
dobj |
sites,contains |
R9554 |
T13948 |
T13950 |
nmod |
[,] |
R9555 |
T13974 |
T13977 |
advmod |
Therefore,appears |
R9556 |
T13949 |
T13950 |
nummod |
6,] |
R9557 |
T13950 |
T13947 |
appos |
],sites |
R9558 |
T13951 |
T13929 |
punct |
.,shown |
R9559 |
T13952 |
T13956 |
prep |
In,binds |
R9560 |
T13953 |
T13952 |
pobj |
addition,In |
R9561 |
T13954 |
T13956 |
punct |
",",binds |
R9562 |
T13955 |
T13956 |
amod |
Sox6,binds |
R9563 |
T13975 |
T13977 |
punct |
",",appears |
R9564 |
T13956 |
T13956 |
ROOT |
binds,binds |
R9565 |
T13957 |
T13958 |
advmod |
more,strongly |
R9566 |
T13958 |
T13959 |
advmod |
strongly,to |
R9567 |
T13959 |
T13956 |
prep |
to,binds |
R9568 |
T13976 |
T13977 |
nsubj |
it,appears |
R9569 |
T13960 |
T13963 |
det |
an,motif |
R9570 |
T13961 |
T13963 |
amod |
HMG-box,motif |
R9571 |
T13962 |
T13963 |
compound |
dimer,motif |
R9572 |
T13977 |
T13977 |
ROOT |
appears,appears |
R9573 |
T13963 |
T13959 |
pobj |
motif,to |
R9574 |
T13964 |
T13964 |
ROOT |
than,than |
R9575 |
T13978 |
T13992 |
mark |
that,harbor |
R9576 |
T13965 |
T13964 |
prep |
to,than |
R9577 |
T13966 |
T13969 |
det |
a,motif |
R9578 |
T13967 |
T13969 |
amod |
single,motif |
R9579 |
T13979 |
T13980 |
compound |
target,genes |
R9580 |
T13968 |
T13969 |
compound |
HMG-box,motif |
R9581 |
T13969 |
T13965 |
pobj |
motif,to |
R9582 |
T13970 |
T13956 |
advcl |
[,binds |
R9583 |
T13980 |
T13992 |
nsubj |
genes,harbor |
R9584 |
T13971 |
T13970 |
nummod |
5,[ |
R9585 |
T13972 |
T13970 |
dobj |
],[ |
R9586 |
T13973 |
T13956 |
punct |
.,binds |
R9587 |
T13981 |
T13980 |
prep |
for,genes |
R9588 |
T13982 |
T13985 |
nmod |
group,proteins |
R9589 |
T13983 |
T13985 |
amod |
D,proteins |
R9590 |
T13984 |
T13985 |
compound |
Sox,proteins |
R9591 |
T13985 |
T13992 |
nsubj |
proteins,harbor |
R9592 |
T14071 |
T14072 |
amod |
ɛy,promoter |
R9593 |
T13986 |
T13985 |
punct |
",",proteins |
R9594 |
T14072 |
T14069 |
pobj |
promoter,of |
R9595 |
T14073 |
T14074 |
preconj |
either,as |
R9596 |
T14074 |
T14065 |
prep |
as,binds |
R9597 |
T13987 |
T13988 |
amod |
such,as |
R9598 |
T14075 |
T14076 |
det |
a,homodimer |
R9599 |
T14076 |
T14074 |
pobj |
homodimer,as |
R9600 |
T13988 |
T13985 |
prep |
as,proteins |
R9601 |
T14077 |
T14074 |
cc |
or,as |
R9602 |
T14078 |
T14074 |
conj |
as,as |
R9603 |
T13989 |
T13988 |
pobj |
Sox6,as |
R9604 |
T14079 |
T14080 |
det |
a,heterodimer |
R9605 |
T14080 |
T14078 |
pobj |
heterodimer,as |
R9606 |
T14081 |
T14080 |
prep |
with,heterodimer |
R9607 |
T14082 |
T14084 |
amod |
other,proteins |
R9608 |
T14083 |
T14084 |
compound |
Sox,proteins |
R9609 |
T14084 |
T14081 |
pobj |
proteins,with |
R9610 |
T13990 |
T13989 |
punct |
",",Sox6 |
R9611 |
T14085 |
T14062 |
punct |
.,suggest |
R9612 |
T14086 |
T14089 |
mark |
Because,recognize |
R9613 |
T14087 |
T14088 |
compound |
Sox,proteins |
R9614 |
T14088 |
T14089 |
nsubj |
proteins,recognize |
R9615 |
T13991 |
T13992 |
advmod |
probably,harbor |
R9616 |
T14089 |
T14107 |
advcl |
recognize,thought |
R9617 |
T14090 |
T14094 |
det |
a,sequence |
R9618 |
T13992 |
T13977 |
oprd |
harbor,appears |
R9619 |
T14091 |
T14094 |
amod |
short,sequence |
R9620 |
T14092 |
T14094 |
amod |
6-bp,sequence |
R9621 |
T14093 |
T14094 |
compound |
core-binding,sequence |
R9622 |
T13993 |
T13992 |
dobj |
pairs,harbor |
R9623 |
T14094 |
T14089 |
dobj |
sequence,recognize |
R9624 |
T14095 |
T14096 |
nsubj |
that,allows |
R9625 |
T14096 |
T14094 |
relcl |
allows,sequence |
R9626 |
T13994 |
T13993 |
prep |
of,pairs |
R9627 |
T14097 |
T14096 |
prep |
for,allows |
R9628 |
T14098 |
T14099 |
amod |
considerable,degeneracy |
R9629 |
T14099 |
T14097 |
pobj |
degeneracy,for |
R9630 |
T13995 |
T13997 |
nmod |
HMG,sites |
R9631 |
T14100 |
T14099 |
punct |
",",degeneracy |
R9632 |
T13996 |
T13997 |
amod |
binding,sites |
R9633 |
T14101 |
T14102 |
det |
the,specificity |
R9634 |
T14102 |
T14099 |
appos |
specificity,degeneracy |
R9635 |
T14103 |
T14102 |
prep |
of,specificity |
R9636 |
T13997 |
T13994 |
pobj |
sites,of |
R9637 |
T14104 |
T14105 |
poss |
their,actions |
R9638 |
T14105 |
T14103 |
pobj |
actions,of |
R9639 |
T14106 |
T14107 |
auxpass |
is,thought |
R9640 |
T13998 |
T13997 |
prep |
with,sites |
R9641 |
T14107 |
T14107 |
ROOT |
thought,thought |
R9642 |
T14108 |
T14109 |
aux |
to,rely |
R9643 |
T13999 |
T14000 |
det |
a,configuration |
R9644 |
T14109 |
T14107 |
xcomp |
rely,thought |
R9645 |
T14110 |
T14109 |
prep |
upon,rely |
R9646 |
T14111 |
T14110 |
pobj |
interactions,upon |
R9647 |
T14000 |
T13998 |
pobj |
configuration,with |
R9648 |
T14112 |
T14111 |
prep |
with,interactions |
R9649 |
T14113 |
T14115 |
amod |
other,factors |
R9650 |
T14114 |
T14115 |
compound |
transcription,factors |
R9651 |
T14001 |
T14000 |
amod |
compatible,configuration |
R9652 |
T14115 |
T14112 |
pobj |
factors,with |
R9653 |
T14116 |
T14118 |
nmod |
[,] |
R9654 |
T14002 |
T14001 |
prep |
with,compatible |
R9655 |
T14117 |
T14118 |
nummod |
36,] |
R9656 |
T14118 |
T14115 |
appos |
],factors |
R9657 |
T14119 |
T14107 |
punct |
.,thought |
R9658 |
T14120 |
T14125 |
prep |
In,had |
R9659 |
T14121 |
T14122 |
poss |
our,EMSAs |
R9660 |
T14122 |
T14120 |
pobj |
EMSAs,In |
R9661 |
T14123 |
T14125 |
punct |
",",had |
R9662 |
T14003 |
T14002 |
pobj |
binding,with |
R9663 |
T14124 |
T14125 |
nsubj |
we,had |
R9664 |
T14125 |
T14125 |
ROOT |
had,had |
R9665 |
T14004 |
T14003 |
prep |
of,binding |
R9666 |
T14126 |
T14127 |
aux |
to,run |
R9667 |
T14127 |
T14125 |
xcomp |
run,had |
R9668 |
T14128 |
T14129 |
det |
the,electrophoresis |
R9669 |
T14129 |
T14127 |
dobj |
electrophoresis,run |
R9670 |
T14005 |
T14007 |
amod |
D-Sox,dimers |
R9671 |
T14130 |
T14127 |
prep |
on,run |
R9672 |
T14131 |
T14133 |
det |
a,% |
R9673 |
T14006 |
T14007 |
compound |
protein,dimers |
R9674 |
T14132 |
T14133 |
nummod |
4,% |
R9675 |
T14133 |
T14136 |
nmod |
%,gel |
R9676 |
T14134 |
T14135 |
nummod |
6,% |
R9677 |
T14007 |
T14004 |
pobj |
dimers,of |
R9678 |
T14135 |
T14136 |
compound |
%,gel |
R9679 |
T14008 |
T13977 |
punct |
.,appears |
R9680 |
T14009 |
T14025 |
advmod |
Indeed,contains |
R9681 |
T14136 |
T14130 |
pobj |
gel,on |
R9682 |
T14137 |
T14127 |
prep |
for,run |
R9683 |
T14010 |
T14025 |
punct |
",",contains |
R9684 |
T14138 |
T14139 |
advmod |
at,least |
R9685 |
T14139 |
T14140 |
advmod |
least,4 |
R9686 |
T14011 |
T14025 |
prep |
in,contains |
R9687 |
T14140 |
T14137 |
pobj |
4,for |
R9688 |
T14141 |
T14142 |
nummod |
8,h |
R9689 |
T14142 |
T14140 |
appos |
h,4 |
R9690 |
T14012 |
T14014 |
det |
the,study |
R9691 |
T14143 |
T14144 |
aux |
to,detect |
R9692 |
T14144 |
T14127 |
advcl |
detect,run |
R9693 |
T14013 |
T14014 |
amod |
present,study |
R9694 |
T14014 |
T14011 |
pobj |
study,in |
R9695 |
T14015 |
T14025 |
punct |
",",contains |
R9696 |
T14145 |
T14147 |
det |
the,band |
R9697 |
T14146 |
T14147 |
amod |
Sox6-associated,band |
R9698 |
T14016 |
T14020 |
det |
the,sequence |
R9699 |
T14147 |
T14144 |
dobj |
band,detect |
R9700 |
T14017 |
T14020 |
amod |
defined,sequence |
R9701 |
T14148 |
T14125 |
punct |
",",had |
R9702 |
T14149 |
T14125 |
advcl |
suggesting,had |
R9703 |
T14150 |
T14152 |
mark |
that,is |
R9704 |
T14151 |
T14152 |
nsubj |
Sox6,is |
R9705 |
T14018 |
T14020 |
compound |
Sox6,sequence |
R9706 |
T14152 |
T14149 |
ccomp |
is,suggesting |
R9707 |
T14153 |
T14152 |
attr |
part,is |
R9708 |
T14154 |
T14153 |
prep |
of,part |
R9709 |
T14155 |
T14159 |
det |
a,complex |
R9710 |
T14156 |
T14158 |
amod |
high,weight |
R9711 |
T14019 |
T14020 |
compound |
target,sequence |
R9712 |
T14157 |
T14158 |
amod |
molecular,weight |
R9713 |
T14158 |
T14159 |
compound |
weight,complex |
R9714 |
T14159 |
T14154 |
pobj |
complex,of |
R9715 |
T14020 |
T14025 |
nsubj |
sequence,contains |
R9716 |
T14160 |
T14125 |
punct |
.,had |
R9717 |
T14161 |
T14166 |
det |
A,repressors |
R9718 |
T14162 |
T14166 |
amod |
few,repressors |
R9719 |
T14021 |
T14020 |
prep |
of,sequence |
R9720 |
T14163 |
T14166 |
amod |
other,repressors |
R9721 |
T14164 |
T14166 |
amod |
ɛy,repressors |
R9722 |
T14022 |
T14024 |
det |
the,promoter |
R9723 |
T14165 |
T14166 |
compound |
globin,repressors |
R9724 |
T14166 |
T14169 |
nsubjpass |
repressors,reported |
R9725 |
T14167 |
T14169 |
aux |
have,reported |
R9726 |
T14168 |
T14169 |
auxpass |
been,reported |
R9727 |
T14023 |
T14024 |
amod |
ɛy,promoter |
R9728 |
T14169 |
T14169 |
ROOT |
reported,reported |
R9729 |
T14170 |
T14171 |
aux |
to,bind |
R9730 |
T14024 |
T14021 |
pobj |
promoter,of |
R9731 |
T14171 |
T14169 |
xcomp |
bind,reported |
R9732 |
T14025 |
T14025 |
ROOT |
contains,contains |
R9733 |
T14026 |
T14029 |
nummod |
two,sites |
R9734 |
T14027 |
T14029 |
amod |
Sox/Sox6,sites |
R9735 |
T14028 |
T14029 |
compound |
consensus,sites |
R9736 |
T14172 |
T14171 |
prep |
to,bind |
R9737 |
T14029 |
T14025 |
dobj |
sites,contains |
R9738 |
T14173 |
T14174 |
compound |
DNA,sequences |
R9739 |
T14174 |
T14172 |
pobj |
sequences,to |
R9740 |
T14175 |
T14174 |
prep |
near,sequences |
R9741 |
T14030 |
T14029 |
punct |
(,sites |
R9742 |
T14176 |
T14179 |
det |
the,sites |
R9743 |
T14177 |
T14179 |
compound |
Sox/Sox6,sites |
R9744 |
T14031 |
T14032 |
compound |
Figure,3A |
R9745 |
T14178 |
T14179 |
compound |
consensus,sites |
R9746 |
T14179 |
T14175 |
pobj |
sites,near |
R9747 |
T14180 |
T14179 |
punct |
",",sites |
R9748 |
T14032 |
T14029 |
appos |
3A,sites |
R9749 |
T14181 |
T14179 |
prep |
including,sites |
R9750 |
T14182 |
T14187 |
det |
the,] |
R9751 |
T14183 |
T14187 |
nmod |
DRED,] |
R9752 |
T14033 |
T14029 |
punct |
),sites |
R9753 |
T14184 |
T14187 |
amod |
complex,] |
R9754 |
T14185 |
T14187 |
nmod |
[,] |
R9755 |
T14034 |
T14025 |
punct |
.,contains |
R9756 |
T14186 |
T14187 |
nummod |
37,] |
R9757 |
T14187 |
T14181 |
pobj |
],including |
R9758 |
T14035 |
T14039 |
advmod |
Functionally,are |
R9759 |
T14188 |
T14187 |
cc |
and,] |
R9760 |
T14189 |
T14190 |
compound |
COUP-TF,[ |
R9761 |
T14190 |
T14187 |
conj |
[,] |
R9762 |
T14191 |
T14192 |
nummod |
38,] |
R9763 |
T14192 |
T14187 |
conj |
],] |
R9764 |
T14036 |
T14039 |
punct |
",",are |
R9765 |
T14193 |
T14169 |
punct |
.,reported |
R9766 |
T14194 |
T14196 |
nsubj |
Sox6,interact |
R9767 |
T14195 |
T14196 |
aux |
might,interact |
R9768 |
T14196 |
T14196 |
ROOT |
interact,interact |
R9769 |
T14037 |
T14038 |
det |
both,sites |
R9770 |
T14197 |
T14196 |
prep |
with,interact |
R9771 |
T14198 |
T14199 |
det |
these,factors |
R9772 |
T14038 |
T14039 |
nsubj |
sites,are |
R9773 |
T14199 |
T14197 |
pobj |
factors,with |
R9774 |
T14200 |
T14196 |
cc |
and,interact |
R9775 |
T14201 |
T14196 |
conj |
form,interact |
R9776 |
T14039 |
T14039 |
ROOT |
are,are |
R9777 |
T14202 |
T14205 |
det |
a,complex |
R9778 |
T14203 |
T14205 |
amod |
large,complex |
R9779 |
T14204 |
T14205 |
compound |
repression,complex |
R9780 |
T14040 |
T14039 |
acomp |
essential,are |
R9781 |
T14205 |
T14201 |
dobj |
complex,form |
R9782 |
T14206 |
T14196 |
punct |
.,interact |
R9783 |
T14207 |
T14215 |
nsubjpass |
Identification,associated |
R9784 |
T14041 |
T14040 |
prep |
for,essential |
R9785 |
T14208 |
T14207 |
prep |
of,Identification |
R9786 |
T14209 |
T14210 |
amod |
other,components |
R9787 |
T14210 |
T14208 |
pobj |
components,of |
R9788 |
T14042 |
T14043 |
amod |
Sox6,binding |
R9789 |
T14211 |
T14210 |
prep |
of,components |
R9790 |
T14212 |
T14215 |
det |
the,associated |
R9791 |
T14213 |
T14215 |
amod |
Sox6-containing,associated |
R9792 |
T14043 |
T14041 |
amod |
binding,for |
R9793 |
T14044 |
T14043 |
prep |
to,binding |
R9794 |
T14045 |
T14047 |
det |
the,promoter |
R9795 |
T14214 |
T14215 |
amod |
complex,associated |
R9796 |
T14046 |
T14047 |
amod |
ɛy,promoter |
R9797 |
T14215 |
T14215 |
ROOT |
associated,associated |
R9798 |
T14216 |
T14215 |
prep |
with,associated |
R9799 |
T14217 |
T14219 |
det |
the,promoter |
R9800 |
T14047 |
T14044 |
pobj |
promoter,to |
R9801 |
T14218 |
T14219 |
amod |
ɛy,promoter |
R9802 |
T14219 |
T14216 |
pobj |
promoter,with |
R9803 |
T14220 |
T14221 |
aux |
will,shed |
R9804 |
T14048 |
T14047 |
cc |
and,promoter |
R9805 |
T14221 |
T14215 |
conj |
shed,associated |
R9806 |
T14222 |
T14221 |
dobj |
light,shed |
R9807 |
T14223 |
T14221 |
prep |
on,shed |
R9808 |
T14049 |
T14047 |
conj |
repression,promoter |
R9809 |
T14224 |
T14225 |
poss |
its,mechanism |
R9810 |
T14050 |
T14047 |
prep |
of,promoter |
R9811 |
T14225 |
T14223 |
pobj |
mechanism,on |
R9812 |
T14226 |
T14225 |
prep |
of,mechanism |
R9813 |
T14227 |
T14226 |
pobj |
repression,of |
R9814 |
T14228 |
T14215 |
punct |
.,associated |
R9815 |
T14051 |
T14052 |
poss |
its,activity |
R9816 |
T14229 |
T14230 |
compound |
Sox,proteins |
R9817 |
T14230 |
T14231 |
nsubj |
proteins,bind |
R9818 |
T14052 |
T14050 |
pobj |
activity,of |
R9819 |
T14231 |
T14231 |
ROOT |
bind,bind |
R9820 |
T14232 |
T14231 |
cc |
and,bind |
R9821 |
T14233 |
T14231 |
conj |
bend,bind |
R9822 |
T14053 |
T14054 |
punct |
(,Figure |
R9823 |
T14234 |
T14235 |
compound |
linear,DNA |
R9824 |
T14235 |
T14233 |
dobj |
DNA,bend |
R9825 |
T14236 |
T14233 |
prep |
by,bend |
R9826 |
T14054 |
T14047 |
appos |
Figure,promoter |
R9827 |
T14237 |
T14238 |
amod |
partial,intercalation |
R9828 |
T14238 |
T14236 |
pobj |
intercalation,by |
R9829 |
T14239 |
T14233 |
prep |
in,bend |
R9830 |
T14055 |
T14054 |
nummod |
3E,Figure |
R9831 |
T14240 |
T14242 |
det |
the,groove |
R9832 |
T14241 |
T14242 |
amod |
minor,groove |
R9833 |
T14242 |
T14239 |
pobj |
groove,in |
R9834 |
T14056 |
T14054 |
cc |
and,Figure |
R9835 |
T14243 |
T14233 |
punct |
",",bend |
R9836 |
T14244 |
T14233 |
cc |
and,bend |
R9837 |
T14245 |
T14247 |
aux |
can,bind |
R9838 |
T14057 |
T14054 |
conj |
3F,Figure |
R9839 |
T14246 |
T14247 |
advmod |
also,bind |
R9840 |
T14247 |
T14231 |
conj |
bind,bind |
R9841 |
T14248 |
T14247 |
prep |
to,bind |
R9842 |
T14058 |
T14039 |
punct |
),are |
R9843 |
T14249 |
T14250 |
amod |
four-way,junctions |
R9844 |
T14250 |
T14248 |
pobj |
junctions,to |
R9845 |
T14251 |
T14231 |
conj |
[,bind |
R9846 |
T14059 |
T14039 |
punct |
.,are |
R9847 |
T14252 |
T14251 |
nummod |
2,[ |
R9848 |
T14253 |
T14254 |
nummod |
4,] |
R9849 |
T14254 |
T14251 |
appos |
],[ |
R9850 |
T14060 |
T14061 |
det |
These,observations |
R9851 |
T14255 |
T14251 |
punct |
.,[ |
R9852 |
T14256 |
T14269 |
advmod |
Therefore,is |
R9853 |
T14257 |
T14269 |
punct |
",",is |
R9854 |
T14061 |
T14062 |
nsubj |
observations,suggest |
R9855 |
T14258 |
T14260 |
nummod |
one,model |
R9856 |
T14259 |
T14260 |
amod |
attractive,model |
R9857 |
T14260 |
T14269 |
nsubj |
model,is |
R9858 |
T14062 |
T14062 |
ROOT |
suggest,suggest |
R9859 |
T14261 |
T14262 |
aux |
to,explain |
R9860 |
T14262 |
T14260 |
relcl |
explain,model |
R9861 |
T14263 |
T14266 |
advmod |
how,control |
R9862 |
T14264 |
T14266 |
acomp |
Sox6,control |
R9863 |
T14265 |
T14266 |
nsubj |
proteins,control |
R9864 |
T14063 |
T14065 |
mark |
that,binds |
R9865 |
T14266 |
T14268 |
compound |
control,expression |
R9866 |
T14267 |
T14268 |
compound |
gene,expression |
R9867 |
T14268 |
T14262 |
dobj |
expression,explain |
R9868 |
T14064 |
T14065 |
amod |
Sox6,binds |
R9869 |
T14065 |
T14062 |
ccomp |
binds,suggest |
R9870 |
T14066 |
T14065 |
prep |
to,binds |
R9871 |
T14067 |
T14068 |
det |
this,sequence |
R9872 |
T14269 |
T14269 |
ROOT |
is,is |
R9873 |
T14270 |
T14272 |
mark |
that,function |
R9874 |
T14271 |
T14272 |
nsubj |
they,function |
R9875 |
T14272 |
T14269 |
ccomp |
function,is |
R9876 |
T14068 |
T14066 |
pobj |
sequence,to |
R9877 |
T14273 |
T14272 |
prep |
as,function |
R9878 |
T14274 |
T14275 |
amod |
architectural,factors |
R9879 |
T14275 |
T14273 |
pobj |
factors,as |
R9880 |
T14069 |
T14068 |
prep |
of,sequence |
R9881 |
T14276 |
T14275 |
acl |
bound,factors |
R9882 |
T14277 |
T14276 |
prep |
to,bound |
R9883 |
T14070 |
T14072 |
det |
the,promoter |
R9884 |
T14278 |
T14277 |
pobj |
DNA,to |
R9885 |
T14279 |
T14272 |
punct |
",",function |
R9886 |
T14280 |
T14272 |
advcl |
influencing,function |
R9887 |
T14366 |
T14365 |
prep |
of,family |
R9888 |
T14281 |
T14283 |
amod |
local,structure |
R9889 |
T14367 |
T14368 |
compound |
transcription,factors |
R9890 |
T14282 |
T14283 |
compound |
chromatin,structure |
R9891 |
T14283 |
T14280 |
dobj |
structure,influencing |
R9892 |
T14284 |
T14280 |
prep |
by,influencing |
R9893 |
T14285 |
T14284 |
pcomp |
bending,by |
R9894 |
T14368 |
T14366 |
pobj |
factors,of |
R9895 |
T14286 |
T14285 |
dobj |
DNA,bending |
R9896 |
T14287 |
T14284 |
cc |
and,by |
R9897 |
T14288 |
T14284 |
conj |
by,by |
R9898 |
T14369 |
T14365 |
punct |
),family |
R9899 |
T14289 |
T14288 |
pcomp |
assembling,by |
R9900 |
T14290 |
T14292 |
amod |
multiprotein,complexes |
R9901 |
T14291 |
T14292 |
amod |
transcriptional,complexes |
R9902 |
T14370 |
T14365 |
punct |
",",family |
R9903 |
T14292 |
T14289 |
dobj |
complexes,assembling |
R9904 |
T14293 |
T14269 |
punct |
.,is |
R9905 |
T14294 |
T14304 |
prep |
By,interfere |
R9906 |
T14371 |
T14365 |
appos |
HMG-I,family |
R9907 |
T14295 |
T14294 |
pcomp |
changing,By |
R9908 |
T14296 |
T14299 |
det |
the,structure |
R9909 |
T14297 |
T14299 |
amod |
local,structure |
R9910 |
T14298 |
T14299 |
compound |
chromatin,structure |
R9911 |
T14299 |
T14295 |
dobj |
structure,changing |
R9912 |
T14300 |
T14304 |
punct |
",",interfere |
R9913 |
T14372 |
T14371 |
cc |
and,HMG-I |
R9914 |
T14301 |
T14304 |
nsubj |
Sox6,interfere |
R9915 |
T14302 |
T14304 |
aux |
could,interfere |
R9916 |
T14373 |
T14371 |
conj |
HMG-Y,HMG-I |
R9917 |
T14303 |
T14304 |
preconj |
either,interfere |
R9918 |
T14374 |
T14376 |
punct |
",",demonstrated |
R9919 |
T14304 |
T14304 |
ROOT |
interfere,interfere |
R9920 |
T14305 |
T14304 |
prep |
with,interfere |
R9921 |
T14375 |
T14376 |
auxpass |
were,demonstrated |
R9922 |
T14306 |
T14305 |
pobj |
binding,with |
R9923 |
T14307 |
T14306 |
prep |
of,binding |
R9924 |
T14308 |
T14309 |
amod |
other,activators |
R9925 |
T14376 |
T14376 |
ROOT |
demonstrated,demonstrated |
R9926 |
T14309 |
T14307 |
pobj |
activators,of |
R9927 |
T14310 |
T14309 |
prep |
to,activators |
R9928 |
T14311 |
T14312 |
det |
the,promoter |
R9929 |
T14377 |
T14378 |
aux |
to,bind |
R9930 |
T14312 |
T14310 |
pobj |
promoter,to |
R9931 |
T14313 |
T14304 |
cc |
or,interfere |
R9932 |
T14378 |
T14376 |
xcomp |
bind,demonstrated |
R9933 |
T14314 |
T14304 |
conj |
facilitate,interfere |
R9934 |
T14315 |
T14314 |
dobj |
binding,facilitate |
R9935 |
T14379 |
T14378 |
prep |
to,bind |
R9936 |
T14316 |
T14315 |
prep |
of,binding |
R9937 |
T14317 |
T14318 |
amod |
other,repressors |
R9938 |
T14318 |
T14316 |
pobj |
repressors,of |
R9939 |
T14380 |
T14385 |
det |
the,silencers |
R9940 |
T14319 |
T14304 |
punct |
.,interfere |
R9941 |
T14320 |
T14321 |
det |
Another,example |
R9942 |
T14321 |
T14334 |
nsubj |
example,is |
R9943 |
T14381 |
T14382 |
amod |
human,adult |
R9944 |
T14322 |
T14321 |
prep |
of,example |
R9945 |
T14323 |
T14324 |
det |
a,repressor |
R9946 |
T14324 |
T14322 |
pobj |
repressor,of |
R9947 |
T14382 |
T14385 |
nmod |
adult,silencers |
R9948 |
T14325 |
T14326 |
nsubj |
that,interferes |
R9949 |
T14326 |
T14324 |
relcl |
interferes,repressor |
R9950 |
T14327 |
T14326 |
prep |
with,interferes |
R9951 |
T14328 |
T14329 |
det |
an,activator |
R9952 |
T14329 |
T14327 |
pobj |
activator,with |
R9953 |
T14330 |
T14329 |
prep |
on,activator |
R9954 |
T14383 |
T14385 |
nmod |
β,silencers |
R9955 |
T14331 |
T14333 |
det |
the,promoter |
R9956 |
T14332 |
T14333 |
amod |
ɛy,promoter |
R9957 |
T14333 |
T14330 |
pobj |
promoter,on |
R9958 |
T14384 |
T14385 |
compound |
globin,silencers |
R9959 |
T14334 |
T14334 |
ROOT |
is,is |
R9960 |
T14335 |
T14334 |
attr |
DRED,is |
R9961 |
T14336 |
T14334 |
punct |
.,is |
R9962 |
T14337 |
T14338 |
nsubj |
DRED,interferes |
R9963 |
T14338 |
T14338 |
ROOT |
interferes,interferes |
R9964 |
T14339 |
T14338 |
prep |
with,interferes |
R9965 |
T14385 |
T14379 |
pobj |
silencers,to |
R9966 |
T14340 |
T14339 |
pobj |
EKLF,with |
R9967 |
T14341 |
T14340 |
punct |
",",EKLF |
R9968 |
T14342 |
T14343 |
det |
an,activator |
R9969 |
T14386 |
T14385 |
punct |
(,silencers |
R9970 |
T14343 |
T14340 |
appos |
activator,EKLF |
R9971 |
T14344 |
T14340 |
punct |
",",EKLF |
R9972 |
T14345 |
T14338 |
prep |
in,interferes |
R9973 |
T14346 |
T14345 |
amod |
binding,in |
R9974 |
T14387 |
T14385 |
appos |
silencers,silencers |
R9975 |
T14347 |
T14346 |
prep |
to,binding |
R9976 |
T14348 |
T14350 |
det |
the,promoter |
R9977 |
T14349 |
T14350 |
amod |
ɛy,promoter |
R9978 |
T14388 |
T14387 |
advmod |
I,silencers |
R9979 |
T14350 |
T14347 |
pobj |
promoter,to |
R9980 |
T14351 |
T14350 |
appos |
[,promoter |
R9981 |
T14352 |
T14353 |
nummod |
39,] |
R9982 |
T14389 |
T14388 |
cc |
and,I |
R9983 |
T14353 |
T14350 |
appos |
],promoter |
R9984 |
T14354 |
T14338 |
punct |
.,interferes |
R9985 |
T14355 |
T14358 |
nummod |
Two,proteins |
R9986 |
T14390 |
T14388 |
conj |
II,I |
R9987 |
T14356 |
T14358 |
nmod |
HMG,proteins |
R9988 |
T14357 |
T14358 |
amod |
architectural,proteins |
R9989 |
T14358 |
T14376 |
nsubjpass |
proteins,demonstrated |
R9990 |
T14391 |
T14388 |
punct |
),I |
R9991 |
T14359 |
T14358 |
punct |
(,proteins |
R9992 |
T14360 |
T14361 |
advmod |
distantly,related |
R9993 |
T14361 |
T14358 |
acl |
related,proteins |
R9994 |
T14362 |
T14361 |
prep |
to,related |
R9995 |
T14392 |
T14378 |
cc |
and,bind |
R9996 |
T14363 |
T14365 |
det |
the,family |
R9997 |
T14364 |
T14365 |
compound |
Sox,family |
R9998 |
T14365 |
T14362 |
pobj |
family,to |
R9999 |
T14393 |
T14378 |
conj |
cause,bind |